U.S. patent application number 11/556803 was filed with the patent office on 2007-06-21 for non-human transgenic animal models for hepatocellular carcinoma.
This patent application is currently assigned to Genentech, Inc.. Invention is credited to Avi J. Ashkenazi, Luc Desnoyers, Dorothy French, Jean-Philippe F. Stephan.
Application Number | 20070143871 11/556803 |
Document ID | / |
Family ID | 29736283 |
Filed Date | 2007-06-21 |
United States Patent
Application |
20070143871 |
Kind Code |
A1 |
French; Dorothy ; et
al. |
June 21, 2007 |
Non-human transgenic animal models for hepatocellular carcinoma
Abstract
The invention relates to the field of non-human, transgenic
animal models for hepatocellular carcinoma.
Inventors: |
French; Dorothy; (San
Carlos, CA) ; Ashkenazi; Avi J.; (San Mateo, CA)
; Stephan; Jean-Philippe F.; (San Carlos, CA) ;
Desnoyers; Luc; (San Francisco, CA) |
Correspondence
Address: |
GENENTECH, INC.
1 DNA WAY
SOUTH SAN FRANCISCO
CA
94080
US
|
Assignee: |
Genentech, Inc.
South San Francisco
CA
94080
|
Family ID: |
29736283 |
Appl. No.: |
11/556803 |
Filed: |
November 6, 2006 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10516868 |
Dec 3, 2004 |
|
|
|
PCT/US03/17697 |
Jun 4, 2003 |
|
|
|
11556803 |
Nov 6, 2006 |
|
|
|
60387264 |
Jun 7, 2002 |
|
|
|
Current U.S.
Class: |
800/18 ;
435/354 |
Current CPC
Class: |
G01N 33/57438 20130101;
A61P 13/10 20180101; A61P 17/00 20180101; A61P 25/00 20180101; A61P
11/00 20180101; A61P 35/02 20180101; A61P 1/16 20180101; A61P 35/00
20180101; G01N 2500/04 20130101; C07K 14/50 20130101; A61P 1/18
20180101; A61P 1/00 20180101; A61P 15/00 20180101 |
Class at
Publication: |
800/018 ;
435/354 |
International
Class: |
A01K 67/027 20060101
A01K067/027; C12N 5/06 20060101 C12N005/06 |
Claims
1. A transgenic mammal whose genome comprises a stably integrated
transgenic nucleotide sequence encoding an FGF19 operably linked to
a promoter.
2. The transgenic mammal of claim 1, wherein said mammal is a
mouse.
3. The transgenic mammal of claim 1, wherein said FGF19 is
expressed in skeletal muscle.
4. The transgenic mammal of claim 1, wherein said mammal acquires
hepatic disease.
5. The transgenic mammal of claim 4, wherein said disease is
hepatocellular carcinoma.
6. The transgenic mammal of claim 1, wherein said mammal serves as
an animal model for the study and development of treatments for
said hepatocellular carcinoma.
7. The transgenic mammal of claim 1, wherein said mammal has
elevated levels of alpha-fetoprotein.
8. The transgenic mammal of claim 1, wherein said mammal exhibits
increased proliferation of pericentral hepatocytes as compared with
a control, non-transgenic mammal.
9. An isolated cell from the mammal of claim 1, wherein said cell
expresses said FGF19.
10. A method for screening for biologically active agents that
modulate a phenomenon associated with hepatocellular carcinoma, the
method comprising: combining a candidate agent with a transgenic
mammal having a genome comprising a stably integrated transgene
encoding FGF19 operably linked to a promoter, wherein said
transgene results in said mammal acquiring hepatocellular
carcinoma; and determining the effect of said agent on the
hepatocellular carcinoma of said mammal.
11. A method for screening for biologically active agents that
modulate a phenomenon associated with hepatocellular carcinoma, the
method comprising: combining a candidate agent with a transgenic
mammal cell culture, each cell of said culture comprising a stably
integrated transgene encoding FGF19 operably linked to a promoter,
wherein said transgene results in said mammal acquiring
hepatocellular carcinoma; and determining the effect of said agent
on the transgenic mammal cell culture.
12-178. (canceled)
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application is a continuation of U.S. application Ser.
No. 10/516,868, filed Dec. 3, 2004, which is a National Stage of
PCT/US03/17697, filed Jun. 4, 2003, which claims priority under 35
USC .sctn.119(e) to provisional application No. 60/387,264, filed
Jun. 7, 2002, the contents of which applications are incorporated
herein by reference.
FIELD OF THE INVENTION
[0002] The invention relates to the field of non-human, transgenic
animal models for hepatocellular carcinoma.
BACKGROUND OF THE INVENTION
[0003] Malignant tumors (cancers) are the second leading cause of
death in the United States, after heart disease (Boring et al., CA
Cancel J. Clin. 43:7 (1993)). Cancer is characterized by the
increase in the number of abnormal, or neoplastic, cells derived
from a normal tissue which proliferate to form a tumor mass, the
invasion of adjacent tissues by these neoplastic tumor cells, and
the generation of malignant cells which eventually spread via the
blood or lymphatic system to regional lymph nodes and to distant
sites via a process called metastasis. In a cancerous state, a cell
proliferates under conditions in which normal cells would not grow.
Cancer manifests itself in a wide variety of forms, characterized
by different degrees of invasiveness and aggressiveness.
[0004] In attempts to discover effective cellular targets for
cancer therapy, researchers have sought to identify polypeptides
that are specifically overexpressed on the surface of a particular
type of cancer cell as compared to on one or more normal
non-cancerous cell(s). The identification of such tumor-associated
cell surface antigen polypeptides has given rise to the ability to
specifically target cancer cells for destruction via antibody-based
therapies. In this regard, it is noted that antibody-based therapy
has proved very effective in the treatment of certain cancers. For
example, HERCEPTIN.RTM. and RITUXAN.RTM. (both from Genentech Inc.,
South San Francisco, Calif.) are antibodies that have been used
successfully to treat breast cancer and non-Hodgkin's lymphoma,
respectively. More specifically, HERCEPTIN.RTM. is a recombinant
DNA-derived humanized monoclonal antibody that selectively binds to
the extracellular domain of the human epidermal growth factor
receptor 2 (HER2) proto-oncogene. HER2 protein overexpression is
observed in 25-30% of primary breast cancers. RITUXAN.RTM. is a
genetically engineered chimeric murine/human monoclonal antibody
directed against the CD20 antigen found on the surface of normal
and malignant B lymphocytes. Both these antibodies are
recombinantly produced in CHO cells.
[0005] Despite these advances in mammalian cancer therapy, however,
there is a great need for additional diagnostic and therapeutic
agents capable of detecting the presence of tumor in a mammal and
for effectively inhibiting neoplastic cell growth, respectively.
Accordingly, it is the objective of the present invention to
identify cell surface polypeptides that are overexpressed on cancer
cells as compared to on normal cells, and to use those
polypeptides, and their encoding nucleic acids, to produce
compositions of matter useful in the diagnostic detection and
therapeutic treatment of cancer in mammals.
[0006] In addition to finding additional diagnostic and therapeutic
agents capable of detecting the presence of tumor in a mammal,
there exists a need for animal models to effectively study such
diseases. One such disease for which an appropriate animal model
does not exist is hepatocellular carcinoma. Accordingly, it is a
further objective of the present invention to provide an animal
model which will provide an efficient, cost-effective method to
study hepatocellular carcinoma, and related diseases, in vivo.
SUMMARY OF THE INVENTION
A. Embodiments
[0007] In the present specification, Applicants describe for the
first time the identification of various cellular polypeptides (and
their encoding nucleic acids or fragments thereof) which are
expressed to a greater degree on the surface of one or more types
of cancer cell as compared to on the surface of one or more types
of normal non-cancer cells. Such polypeptides are herein referred
to as Tumor-associated Antigenic Target polypeptides ("TAT"
polypeptides) and are expected to serve as effective targets for
cancer therapy and diagnosis in mammals.
[0008] Accordingly, in one embodiment of the present invention, the
invention provides an isolated nucleic acid molecule comprising a
nucleotide sequence that encodes a tumor-associated antigenic
target polypeptide or fragment thereof (a "TAT" polypeptide).
[0009] In certain aspects, the isolated nucleic acid molecule
comprises a nucleotide sequence having at least about 80% nucleic
acid sequence identity, alternatively at least about 81%, 82%, 83%,
84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%,
97%, 98%, or 99% nucleic acid sequence identity, to (a) a DNA
molecule encoding a full-length TAT polypeptide having an amino
acid sequence as disclosed herein, a TAT polypeptide amino acid
sequence lacking the signal peptide as disclosed herein, an
extracellular domain of a transmembrane TAT polypeptide, with or
without the signal peptide, as disclosed herein or any other
specifically defined fragment of a full-length TAT polypeptide
amino acid sequence as disclosed herein, or (b) the complement of
the DNA molecule of (a).
[0010] In other aspects, the isolated nucleic acid molecule
comprises a nucleotide sequence having at least about 80% nucleic
acid sequence identity, alternatively at least about 81%, 82%, 83%,
84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%,
97%, 98%, or 99% nucleic acid sequence identity, to (a) a DNA
molecule comprising the coding sequence of a full-length TAT
polypeptide cDNA as disclosed herein, the coding sequence of a TAT
polypeptide lacking the signal peptide as disclosed herein, the
coding sequence of an extracellular domain of a transmembrane TAT
polypeptide, with or without the signal peptide, as disclosed
herein or the coding sequence of any other specifically defined
fragment of the full-length TAT polypeptide amino acid sequence as
disclosed herein, or (b) the complement of the DNA molecule of
(a).
[0011] In further aspects, the invention concerns an isolated
nucleic acid molecule comprising a nucleotide sequence having at
least about 80% nucleic acid sequence identity, alternatively at
least about 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%,
92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% nucleic acid sequence
identity, to (a) a DNA molecule that encodes the same mature
polypeptide encoded by the full-length coding sequence of any of
the human protein cDNAs deposited with the ATCC as disclosed
herein, or (b) the complement of the DNA molecule of (a). In this
regard, the term "full-length coding sequence" refers to the TAT
polypeptide-encoding nucleotide sequence of the cDNA that is
inserted into the vector deposited with the ATCC (which is often
shown between start and stop codons in the accompanying
figures).
[0012] Another aspect of the invention provides an isolated nucleic
acid molecule comprising a nucleotide sequence encoding a TAT
polypeptide which is either transmembrane domain-deleted or
transmembrane domain-inactivated, or is complementary to such
encoding nucleotide sequence, wherein the transmembrane domain(s)
of such polypeptide(s) are disclosed herein. Therefore, soluble
extracellular domains of the herein described TAT polypeptides are
contemplated.
[0013] In other aspects, the present invention is directed to
isolated nucleic acid molecules which hybridize to (a) a nucleotide
sequence encoding a TAT polypeptide having a full-length amino acid
sequence as disclosed herein, a TAT polypeptide amino acid sequence
lacking the signal peptide as disclosed herein, an extracellular
domain of a transmembrane TAT polypeptide, with or without the
signal peptide, as disclosed herein or any other specifically
defined fragment of a full-length TAT polypeptide amino acid
sequence as disclosed herein, or (b) the complement of the
nucleotide sequence of (a). In this regard, an embodiment of the
present invention is directed to fragments of a full-length TAT
polypeptide coding sequence, or the complement thereof, as
disclosed herein, that may find use as, for example, hybridization
probes useful as, for example, diagnostic probes, antisense
oligonucleotide probes, or for encoding fragments of a full-length
TAT polypeptide that may optionally encode a polypeptide comprising
a binding site for an anti-TAT polypeptide antibody. Such nucleic
acid fragments are usually at least about 5 nucleotides in length,
alternatively at least about 6, 7, 8, 9, 10, 11, 12, 13, 14, 15,
16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40,
45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 105, 110, 115,
120, 125, 130, 135, 140, 145, 150, 155, 160, 165, 170, 175, 180,
185, 190, 195, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290,
300, 310, 320, 330, 340, 350, 360, 370, 380, 390, 400, 410, 420,
430, 440, 450, 460, 470, 480, 490, 500, 510, 520, 530, 540, 550,
560, 570, 580, 590, 600, 610, 620, 630, 640, 650, 660, 670, 680,
690, 700, 710, 720, 730, 740, 750, 760, 770, 780, 790, 800, 810,
820, 830, 840, 850, 860, 870, 880, 890, 900, 910, 920, 930, 940,
950, 960, 970, 980, 990, or 1000 nucleotides in length, wherein in
this context the term "about" means the referenced nucleotide
sequence length plus or minus 10% of that referenced length. It is
noted that novel fragments of a TAT polypeptide-encoding nucleotide
sequence may be determined in a routine manner by aligning the TAT
polypeptide-encoding nucleotide sequence with other known
nucleotide sequences using any of a number of well known sequence
alignment programs and determining which TAT polypeptide-encoding
nucleotide sequence fragment(s) are novel. All of such novel
fragments of TAT polypeptide-encoding nucleotide sequences are
contemplated herein. Also contemplated are the TAT polypeptide
fragments encoded by these nucleotide molecule fragments,
preferably those TAT polypeptide fragments that comprise a binding
site for an anti-TAT antibody.
[0014] In another embodiment, the invention provides isolated TAT
polypeptide encoded by any of the isolated nucleic acid sequences
hereinabove identified.
[0015] In a certain aspect, the invention concerns an isolated TAT
polypeptide, comprising an amino acid sequence having at least
about 80% amino acid sequence identity, alternatively at least
about 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%,
93%, 94%, 95%, 96%, 97%, 98%, or 99% amino acid sequence identity,
to a TAT polypeptide having a full-length amino acid sequence as
disclosed herein, a TAT polypeptide amino acid sequence lacking the
signal peptide as disclosed herein, an extracellular domain of a
transmembrane TAT polypeptide protein, with or without the signal
peptide, as disclosed herein, an amino acid sequence encoded by any
of the nucleic acid sequences disclosed herein or any other
specifically defined fragment of a full-length TAT polypeptide
amino acid sequence as disclosed herein.
[0016] In a further aspect, the invention concerns an isolated TAT
polypeptide comprising an amino acid sequence having at least about
80% amino acid sequence identity, alternatively at least about 81%,
82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%,
95%, 96%, 97%, 98%, or 99% amino acid sequence identity, to an
amino acid sequence encoded by any of the human protein cDNAs
deposited with the ATCC as disclosed herein.
[0017] In a specific aspect, the invention provides an isolated TAT
polypeptide without the N-terminal signal sequence and/or the
initiating methionine and is encoded by a nucleotide sequence that
encodes such an amino acid sequence as hereinbefore described.
Processes for producing the same are also herein described, wherein
those processes comprise culturing a host cell comprising a vector
which comprises the appropriate encoding nucleic acid molecule
under conditions suitable for expression of the TAT polypeptide and
recovering the TAT polypeptide from the cell culture.
[0018] Another aspect of the invention provides an isolated TAT
polypeptide which is either transmembrane domain-deleted or
transmembrane domain-inactivated. Processes for producing the same
are also herein described, wherein those processes comprise
culturing a host cell comprising a vector which comprises the
appropriate encoding nucleic acid molecule under conditions
suitable for expression of the TAT polypeptide and recovering the
TAT polypeptide from the cell culture.
[0019] In other embodiments of the present invention, the invention
provides vectors comprising DNA encoding any of the herein
described polypeptides. Host cell comprising any such vector are
also provided. By way of example, the host cells may be CHO cells,
E. coli, or yeast. A process for producing any of the herein
described polypeptides is further provided and comprises culturing
host cells under conditions suitable for expression of the desired
polypeptide and recovering the desired polypeptide from the cell
culture.
[0020] In other embodiments, the invention provides isolated
chimeric polypeptides comprising any of the herein described TAT
polypeptides fused to a heterologous (non-TAT) polypeptide. Example
of such chimeric molecules comprise any of the herein described TAT
polypeptides fused to a heterologous polypeptide such as, for
example, an epitope tag sequence or a Fc region of an
immunoglobulin.
[0021] In another embodiment, the invention provides an antibody
which binds, preferably specifically, to any of the above or below
described polypeptides. Optionally, the antibody is a monoclonal
antibody, antibody fragment, chimeric antibody, humanized antibody,
or single-chain antibody. Antibodies of the present invention may
optionally be conjugated to a growth inhibitory agent or cytotoxic
agent such as a toxin, including, for example, a maytansinoid or
calicheamicin, an antibiotic, a radioactive isotope, a nucleolytic
enzyme, or the like. The antibodies of the present invention may
optionally be produced in CHO cells or bacterial cells and
preferably induce death of a cell to which it binds. For diagnostic
purposes, the antibodies of the present invention may be detectably
labeled.
[0022] In other embodiments of the present invention, the invention
provides vectors comprising DNA encoding any of the herein
described antibodies. Host cell comprising any such vector are also
provided. By way of example, the host cells may be CHO cells, E.
coli, or yeast. A process for producing any of the herein described
antibodies is further provided and comprises culturing host cells
under conditions suitable for expression of the desired antibody
and recovering the desired antibody from the cell culture.
[0023] In a still further embodiment, the invention concerns a
composition of matter comprising a TAT polypeptide as described
herein, a chimeric TAT polypeptide as described herein, or an
anti-TAT antibody as described herein, in combination with a
carrier. Optionally, the carrier is a pharmaceutically acceptable
carrier.
[0024] In yet another embodiment, the invention concerns an article
of manufacture comprising a container and a composition of matter
contained within the container, wherein the composition of matter
may comprise a TAT polypeptide as described herein, a chimeric TAT
polypeptide as described herein, or an anti-TAT antibody as
described herein. The article may further optionally comprise a
label affixed to the container, or a package insert included with
the container, that refers to the use of the composition of matter
for the therapeutic treatment or diagnostic detection of a
tumor.
[0025] Another embodiment of the present invention is directed to
the use of a TAT polypeptide as described herein, a chimeric TAT
polypeptide as described herein or an anti-TAT polypeptide antibody
as described herein, for the preparation of a medicament useful in
the treatment of a condition which is responsive to the TAT
polypeptide, chimeric TAT polypeptide or anti-TAT polypeptide
antibody.
B. Additional Embodiments
[0026] Another embodiment of the present invention is directed to a
method for killing a cancer cell that expresses a TAT polypeptide,
wherein the method comprises contacting the cancer cell with an
antibody that binds to the TAT polypeptide, thereby resulting in
the death of the cancer cell. Optionally, the antibody is a
monoclonal antibody, antibody fragment, chimeric antibody,
humanized antibody, or single-chain antibody. Antibodies employed
in the methods of the present invention may optionally be
conjugated to a growth inhibitory agent or cytotoxic agent such as
a toxin, including, for example, a maytansinoid or calicheamicin,
an antibiotic, a radioactive isotope, a nucleotlytic enzyme, or the
like. The antibodies employed in the methods of the present
invention may optionally be produced in CHO cells or bacterial
cells.
[0027] Yet another embodiment of the present invention is directed
to a method of therapeutically treating a TAT
polypeptide-expressing tumor in a mammal, wherein the method
comprises administering to the mammal a therapeutically effective
amount of an antibody that binds to the TAT polypeptide, thereby
resulting in the effective therapeutic treatment of the tumor.
Optionally, the antibody is a monoclonal antibody, antibody
fragment, chimeric antibody, humanized antibody, or single-chain
antibody. Antibodies employed in the methods of the present
invention may optionally be conjugated to a growth inhibitory agent
or cytotoxic agent such as a toxin, including, for example, a
maytansinoid or calicheamicin, an antibiotic, a radioactive
isotope, a nucleotlytic enzyme, or the like. The antibodies
employed in the methods of the present invention may optionally be
produced in CHO cells or bacterial cells.
[0028] Yet another embodiment of the present invention is directed
to a method of determining the presence of a TAT polypeptide in a
sample suspected of containing the TAT polypeptide, wherein the
method comprises exposing the sample to an antibody that binds to
the TAT polypeptide and determining binding of the antibody to the
TAT polypeptide in the sample, wherein the presence of such binding
is indicative of the presence of the TAT polypeptide in the sample.
Optionally, the sample may contain cells (which may be cancer
cells) suspected of expressing the TAT polypeptide. The antibody
employed in the method may optionally be detectably labeled.
[0029] A further embodiment of the present invention is directed to
a method of diagnosing the presence of a tumor in a mammal, wherein
the method comprises detecting the level of expression of a gene
encoding a TAT polypeptide (a) in a test sample of tissue cells
obtained from said mammal, and (b) in a control sample of known
normal cells of the same tissue origin, wherein a higher level of
expression of the TAT polypeptide in the test sample, as compared
to the control sample, is indicative of the presence of tumor in
the mammal from which the test sample was obtained.
[0030] Another embodiment of the present invention is directed to a
method of diagnosing the presence of a tumor in a mammal, wherein
the method comprises (a) contacting a test sample of tissue cells
obtained from the mammal with an antibody that binds to a TAT
polypeptide and (b) detecting the formation of a complex between
the antibody and the TAT polypeptide in the test sample, wherein
the formation of a complex is indicative of the presence of a tumor
in the mammal. Optionally, the antibody employed is detectably
labeled and/or the test sample of tissue cells is obtained from an
individual suspected of having a cancerous tumor.
[0031] Further embodiments of the present invention are directed to
transgenic animal models for the study of liver disease or
disorders, including, but not limited to, hepatocellular carcinoma.
Such animal models are characterized by expression of a human
fibroblast growth factor 19.
[0032] In a further embodiment, the present invention is directed
to methods of screening for biologically active agents that
modulate liver disease or disorders, including, but not limited to,
hepatocellular carcinoma.
[0033] Further embodiments of the present invention will be evident
to the skilled artisan upon a reading of the present
specification.
DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS
I. Definitions
[0034] The terms "TAT polypeptide" and "TAT" as used herein and
when immediately followed by a numerical designation, refer to
various polypeptides, wherein the complete designation (i.e.,
TAT/number) refers to specific polypeptide sequences as described
herein. The terms "TAT/number polypeptide" and "TAT/number" wherein
the term "number" is provided as an actual numerical designation as
used herein encompass native sequence polypeptides, polypeptide
variants and fragments of native sequence polypeptides and
polypeptide variants (which are further defined herein). The TAT
polypeptides described herein may be isolated from a variety of
sources, such as from human tissue types or from another source, or
prepared by recombinant or synthetic methods. The term "TAT
polypeptide" refers to each individual TAT/number polypeptide
disclosed herein. All disclosures in this specification which refer
to the "TAT polypeptide" refer to each of the polypeptides
individually as well as jointly. For example, descriptions of the
preparation of, purification of, derivation of, formation of
antibodies to or against, administration of, compositions
containing, treatment of a disease with, etc., pertain to each
polypeptide of the invention individually. The term "TAT
polypeptide" also includes variants of the TAT/number polypeptides
disclosed herein.
[0035] A "native sequence TAT polypeptide" comprises a polypeptide
having the same amino acid sequence as the corresponding TAT
polypeptide derived from nature. Such native sequence TAT
polypeptides can be isolated from nature or can be produced by
recombinant or synthetic means. The term "native sequence TAT
polypeptide" specifically encompasses naturally-occurring truncated
or secreted forms of the specific TAT polypeptide (e.g., an
extracellular domain sequence), naturally-occurring variant forms
(e.g., alternatively spliced forms) and naturally-occurring allelic
variants of the polypeptide. In certain embodiments of the
invention, the native sequence TAT polypeptides disclosed herein
are mature or full-length native sequence polypeptides comprising
the full-length amino acids sequences shown in the accompanying
figures. Start and stop codons (if indicated) are shown in bold
font and underlined in the figures. Nucleic acid residues indicated
as "N" in the accompanying figures are any nucleic acid residue.
However, while the TAT polypeptides disclosed in the accompanying
figures are shown to begin with methionine residues designated
herein as amino acid position 1 in the figures, it is conceivable
and possible that other methionine residues located either upstream
or downstream from the amino acid position 1 in the figures may be
employed as the starting amino acid residue for the TAT
polypeptides.
[0036] The TAT polypeptide "extracellular domain" or "ECD" refers
to a form of the TAT polypeptide which is essentially free of the
transmembrane and cytoplasmic domains. Ordinarily, a TAT
polypeptide ECD will have less than 1% of such transmembrane and/or
cytoplasmic domains and preferably, will have less than 0.5% of
such domains. It will be understood that any transmembrane domains
identified for the TAT polypeptides of the present invention are
identified pursuant to criteria routinely employed in the art for
identifying that type of hydrophobic domain. The exact boundaries
of a transmembrane domain may vary but most likely by no more than
about 5 amino acids at either end of the domain as initially
identified herein. Optionally, therefore, an extracellular domain
of a TAT polypeptide may contain from about 5 or fewer amino acids
on either side of the transmembrane domain/extracellular domain
boundary as identified in the Examples or specification and such
polypeptides, with or without the associated signal peptide, and
nucleic acid encoding them, are contemplated by the present
invention.
[0037] The approximate location of the "signal peptides" of the
various TAT polypeptides disclosed herein may be shown in the
present specification and/or the accompanying figures. It is noted,
however, that the C-terminal boundary of a signal peptide may vary,
but most likely by no more than about 5 amino acids on either side
of the signal peptide C-terminal boundary as initially identified
herein, wherein the C-terminal boundary of the signal peptide may
be identified pursuant to criteria routinely employed in the art
for identifying that type of amino acid sequence element (e.g.,
Nielsen et al., Prot. Eng. 10:1-6 (1997) and von Heinje et al.,
Nucl. Acids. Res. 14:4683-4690 (1986)). Moreover, it is also
recognized that, in some cases, cleavage of a signal sequence from
a secreted polypeptide is not entirely uniform, resulting in more
than one secreted species. These mature polypeptides, where the
signal peptide is cleaved within no more than about 5 amino acids
on either side of the C-terminal boundary of the signal peptide as
identified herein, and the polynucleotides encoding them, are
contemplated by the present invention.
[0038] "TAT polypeptide variant" means a TAT polypeptide,
preferably an active TAT polypeptide, as defined herein having at
least about 80% amino acid sequence identity with a full-length
native sequence TAT polypeptide sequence as disclosed herein, a TAT
polypeptide sequence lacking the signal peptide as disclosed
herein, an extracellular domain of a TAT polypeptide, with or
without the signal peptide, as disclosed herein or any other
fragment of a full-length TAT polypeptide sequence as disclosed
herein (such as those encoded by a nucleic acid that represents
only a portion of the complete coding sequence for a full-length
TAT polypeptide). Such TAT polypeptide variants include, for
instance, TAT polypeptides wherein one or more amino acid residues
are added, or deleted, at the - or C-terminus of the full-length
native amino acid sequence. Ordinarily, a TAT polypeptide variant
will have at least about 80% amino acid sequence identity,
alternatively at least about 81%, 82%, 83%, 84%, 85%, 86%, 87%,
88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% amino
acid sequence identity, to a full-length native sequence TAT
polypeptide sequence as disclosed herein, a TAT polypeptide
sequence lacking the signal peptide as disclosed herein, an
extracellular domain of a TAT polypeptide, with or without the
signal peptide, as disclosed herein or any other specifically
defined fragment of a full-length TAT polypeptide sequence as
disclosed herein. Ordinarily, TAT variant polypeptides are at least
about 10 amino acids in length, alternatively at least about 20,
30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170,
180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300,
310, 320, 330, 340, 350, 360, 370, 380, 390, 400, 410, 420, 430,
440, 450, 460, 470, 480, 490, 500, 510, 520, 530, 540, 550, 560,
570, 580, 590, 600 amino acids in length, or more.
[0039] "Percent (%) amino acid sequence identity" with respect to
the TAT polypeptide sequences identified herein is defined as the
percentage of amino acid residues in a candidate sequence that are
identical with the amino acid residues in the specific TAT
polypeptide sequence, after aligning the sequences and introducing
gaps, if necessary, to achieve the maximum percent sequence
identity, and not considering any conservative substitutions as
part of the sequence identity. Alignment for purposes of
determining percent amino acid sequence identity can be achieved in
various ways that are within the skill in the art, for instance,
using publicly available computer software such as BLAST, BLAST-2,
ALIGN or Megalign (DNASTAR) software. Those skilled in the art can
determine appropriate parameters for measuring alignment, including
any algorithms needed to achieve maximal alignment over the full
length of the sequences being compared. For purposes herein,
however, % amino acid sequence identity values are generated using
the sequence comparison computer program ALIGN-2, wherein the
complete source code for the ALIGN-2 program is provided in Table 1
below. The ALIGN-2 sequence comparison computer program was
authored by Genentech, Inc. and the source code shown in Table 1
below has been filed with user documentation in the U.S. Copyright
Office, Washington D.C., 20559, where it is registered under U.S.
Copyright Registration No. TXU510087. The ALIGN-2 program is
publicly available through Genentech, Inc., South San Francisco,
Calif. or may be compiled from the source code provided in Table 1
below. The ALIGN-2 program should be compiled for use on a UNIX
operating system, preferably digital UNIX V4.0D. All sequence
comparison parameters are set by the ALIGN-2 program and do not
vary.
[0040] In situations where ALIGN-2 is employed for amino acid
sequence comparisons, the % amino acid sequence identity of a given
amino acid sequence A to, with, or against a given amino acid
sequence B (which can alternatively be phrased as a given amino
acid sequence A that has or comprises a certain % amino acid
sequence identity to, with, or against a given amino acid sequence
B) is calculated as follows: 100 times the fraction X/Y where X is
the number of amino acid residues scored as identical matches by
the sequence alignment program ALIGN-2 in that program's alignment
of A and B, and where Y is the total number of amino acid residues
in B. It will be appreciated that where the length of amino acid
sequence A is not equal to the length of amino acid sequence B, the
% amino acid sequence identity of A to B will not equal the % amino
acid sequence identity of B to A. As examples of % amino acid
sequence identity calculations using this method, Tables 2 and 3
demonstrate how to calculate the % amino acid sequence identity of
the amino acid sequence designated "Comparison Protein" to the
amino acid sequence designated "TAT", wherein "TAT" represents the
amino acid sequence of a hypothetical TAT polypeptide of interest,
"Comparison Protein" represents the amino acid sequence of a
polypeptide against which the "TAT" polypeptide of interest is
being compared, and "X, "Y" and "Z" each represent different
hypothetical amino acid residues. Unless specifically stated
otherwise, all % amino acid sequence identity values used herein
are obtained as described in the immediately preceding paragraph
using the ALIGN-2 computer program.
[0041] "TAT variant polynucleotide" or "TAT variant nucleic acid
sequence" means a nucleic acid molecule which encodes a TAT
polypeptide, preferably an active TAT polypeptide, as defined
herein and which has at least about 80% nucleic acid sequence
identity with a nucleotide acid sequence encoding a full-length
native sequence TAT polypeptide sequence as disclosed herein, a
full-length native sequence TAT polypeptide sequence lacking the
signal peptide as disclosed herein, an extracellular domain of a
TAT polypeptide, with or without the signal peptide, as disclosed
herein or any other fragment of a full-length TAT polypeptide
sequence as disclosed herein (such as those encoded by a nucleic
acid that represents only a portion of the complete coding sequence
for a full-length TAT polypeptide). Ordinarily, a TAT variant
polynucleotide will have at least about 80% nucleic acid sequence
identity, alternatively at least about 81%, 82%, 83%, 84%, 85%,
86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or
99% nucleic acid sequence identity with a nucleic acid sequence
encoding a full-length native sequence TAT polypeptide sequence as
disclosed herein, a full-length native sequence TAT polypeptide
sequence lacking the signal peptide as disclosed herein, an
extracellular domain of a TAT polypeptide, with or without the
signal sequence, as disclosed herein or any other fragment of a
full-length TAT polypeptide sequence as disclosed herein. Variants
do not encompass the native nucleotide sequence.
[0042] Ordinarily, TAT variant polynucleotides are at least about 5
nucleotides in length, alternatively at least about 6, 7, 8, 9, 10,
11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27,
28, 29, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95,
100, 105, 110, 115, 120, 125, 130, 135, 140, 145, 150, 155, 160,
165, 170, 175, 180, 185, 190, 195, 200, 210, 220, 230, 240, 250,
260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380,
390, 400, 410, 420, 430, 440, 450, 460, 470, 480, 490, 500, 510,
520, 530, 540, 550, 560, 570, 580, 590, 600, 610, 620, 630, 640,
650, 660, 670, 680, 690, 700, 710, 720, 730, 740, 750, 760, 770,
780, 790, 800, 810, 820, 830, 840, 850, 860, 870, 880, 890, 900,
910, 920, 930, 940, 950, 960, 970, 980, 990, or 1000 nucleotides in
length, wherein in this context the term "about" means the
referenced nucleotide sequence length plus or minus 10% of that
referenced length.
[0043] "Percent (%) nucleic acid sequence identity" with respect to
TAT-encoding nucleic acid sequences identified herein is defined as
the percentage of nucleotides in a candidate sequence that are
identical with the nucleotides in the TAT nucleic acid sequence of
interest, after aligning the sequences and introducing gaps, if
necessary, to achieve the maximum percent sequence identity.
Alignment for purposes of determining percent nucleic acid sequence
identity can be achieved in various ways that are within the skill
in the art, for instance, using publicly available computer
software such as BLAST, BLAST-2, ALIGN or Megalign (DNASTAR)
software. For purposes herein, however, % nucleic acid sequence
identity values are generated using the sequence comparison
computer program ALIGN-2, wherein the complete source code for the
ALIGN-2 program is provided in Table 1 below. The ALIGN-2 sequence
comparison computer program was authored by Genentech, Inc. and the
source code shown in Table 1 below has been filed with user
documentation in the U.S. Copyright Office, Washington D.C., 20559,
where it is registered under U.S. Copyright Registration No.
TXU510087. The ALIGN-2 program is publicly available through
Genentech, Inc., South San Francisco, Calif. or may be compiled
from the source code provided in Table 1 below. The ALIGN-2 program
should be compiled for use on a UNIX operating system, preferably
digital UNIX V4.0D. All sequence comparison parameters are set by
the ALIGN-2 program and do not vary.
[0044] In situations where ALIGN-2 is employed for nucleic acid
sequence comparisons, the % nucleic acid sequence identity of a
given nucleic acid sequence C to, with, or against a given nucleic
acid sequence D (which can alternatively be phrased as a given
nucleic acid sequence C that has or comprises a certain % nucleic
acid sequence identity to, with, or against a given nucleic acid
sequence D) is calculated as follows: 100 times the fraction W/Z
where W is the number of nucleotides scored as identical matches by
the sequence alignment program ALIGN-2 in that program's alignment
of C and D, and where Z is the total number of nucleotides in D. It
will be appreciated that where the length of nucleic acid sequence
C is not equal to the length of nucleic acid sequence D, the %
nucleic acid sequence identity of C to D will not equal the %
nucleic acid sequence identity of D to C. As examples of % nucleic
acid sequence identity calculations, Tables 4 and 5, demonstrate
how to calculate the % nucleic acid sequence identity of the
nucleic acid sequence designated "Comparison DNA" to the nucleic
acid sequence designated "TAT-DNA", wherein "TAT-DNA" represents a
hypothetical TAT-encoding nucleic acid sequence of interest,
"Comparison DNA" represents the nucleotide sequence of a nucleic
acid molecule against which the "TAT-DNA" nucleic acid molecule of
interest is being compared, and "N", "L" and "V" each represent
different hypothetical nucleotides. Unless specifically stated
otherwise, all % nucleic acid sequence identity values used herein
are obtained as described in the immediately preceding paragraph
using the ALIGN-2 computer program.
[0045] In other embodiments, TAT variant polynucleotides are
nucleic acid molecules that encode a TAT polypeptide and which are
capable of hybridizing, preferably under stringent hybridization
and wash conditions, to nucleotide sequences encoding a full-length
TAT polypeptide as disclosed herein. TAT variant polypeptides may
be those that are encoded by a TAT variant polynucleotide.
[0046] "Isolated," when used to describe the various polypeptides
disclosed herein, means polypeptide that has been identified and
separated and/or recovered from a component of its natural
environment. Contaminant components of its natural environment are
materials that would typically interfere with diagnostic or
therapeutic uses for the polypeptide, and may include enzymes,
hormones, and other proteinaceous or non-proteinaceous solutes. In
preferred embodiments, the polypeptide will be purified (1) to a
degree sufficient to obtain at least 15 residues of N-terminal or
internal amino acid sequence by use of a spinning cup sequenator,
or (2) to homogeneity by SDS-PAGE under non-reducing or reducing
conditions using Coomassie blue or, preferably, silver stain.
Isolated polypeptide includes polypeptide in situ within
recombinant cells, since at least one component of the TAT
polypeptide natural environment will not be present. Ordinarily,
however, isolated polypeptide will be prepared by at least one
purification step.
[0047] An "isolated" TAT polypeptide-encoding nucleic acid or other
polypeptide-encoding nucleic acid is a nucleic acid molecule that
is identified and separated from at least one contaminant nucleic
acid molecule with which it is ordinarily associated in the natural
source of the polypeptide-encoding nucleic acid. An isolated
polypeptide-encoding nucleic acid molecule is other than in the
form or setting in which it is found in nature. Isolated
polypeptide-encoding nucleic acid molecules therefore are
distinguished from the specific polypeptide-encoding nucleic acid
molecule as it exists in natural cells. However, an isolated
polypeptide-encoding nucleic acid molecule includes
polypeptide-encoding nucleic acid molecules contained in cells that
ordinarily express the polypeptide where, for example, the nucleic
acid molecule is in a chromosomal location different from that of
natural cells.
[0048] The term "control sequences" refers to DNA sequences
necessary for the expression of an operably linked coding sequence
in a particular host organism. The control sequences that are
suitable for prokaryotes, for example, include a promoter,
optionally an operator sequence, and a ribosome binding site.
Eukaryotic cells are known to utilize promoters, polyadenylation
signals, and enhancers.
[0049] Nucleic acid is "operably linked" when it is placed into a
functional relationship with another nucleic acid sequence. For
example, DNA for a presequence or secretory leader is operably
linked to DNA for a polypeptide if it is expressed as a preprotein
that participates in the secretion of the polypeptide; a promoter
or enhancer is operably linked to a coding sequence if it affects
the transcription of the sequence; or a ribosome binding site is
operably linked to a coding sequence if it is positioned so as to
facilitate translation. Generally, "operably linked" means that the
DNA sequences being linked are contiguous, and, in the case of a
secretory leader, contiguous and in reading phase. However,
enhancers do not have to be contiguous. Linking is accomplished by
ligation at convenient restriction sites. If such sites do not
exist, the synthetic oligonucleotide adaptors or linkers are used
in accordance with conventional practice.
[0050] "Stringency" of hybridization reactions is readily
determinable by one of ordinary skill in the art, and generally is
an empirical calculation dependent upon probe length, washing
temperature, and salt concentration. In general, longer probes
require higher temperatures for proper annealing, while shorter
probes need lower temperatures. Hybridization generally depends on
the ability of denatured DNA to reanneal when complementary strands
are present in an environment below their melting temperature. The
higher the degree of desired homology between the probe and
hybridizable sequence, the higher the relative temperature which
can be used. As a result, it follows that higher relative
temperatures would tend to make the reaction conditions more
stringent, while lower temperatures less so. For additional details
and explanation of stringency of hybridization reactions, see
Ausubel et al., Current Protocols in Molecular Biology, Wiley
Interscience Publishers, (1995).
[0051] "Stringent conditions" or "high stringency conditions", as
defined herein, may be identified by those that: (1) employ low
ionic strength and high temperature for washing, for example 0.015
M sodium chloride/0.0015 M sodium citrate/0.1% sodium dodecyl
sulfate at 50.degree. C.; (2) employ during hybridization a
denaturing agent, such as formamide, for example, 50% (v/v)
formamide with 0.1% bovine serum albumin/0.1% Ficoll/0.1%
polyvinylpyrrolidone/50 mM sodium phosphate buffer at pH 6.5 with
750 mM sodium chloride, 75 mM sodium citrate at 42.degree. C.; or
(3) employ 50% formamide, 5.times.SSC (0.75 M NaCl, 0.075 M sodium
citrate), 50 mM sodium phosphate (pH 6.8), 0.1% sodium
pyrophosphate, 5.times. Denhardt's solution, sonicated salmon sperm
DNA (50 .mu.g/ml), 0.1% SDS, and 10% dextran sulfate at 42.degree.
C., with washes at 42.degree. C. in 0.2.times.SSC (sodium
chloride/sodium citrate) and 50% formamide at 55.degree. C.,
followed by a high-stringency wash consisting of 0.1.times.SSC
containing EDTA at 55.degree. C.
[0052] "Moderately stringent conditions" may be identified as
described by Sambrook et al., Molecular Cloning: A Laboratory
Manual, New York: Cold Spring Harbor Press, 1989, and include the
use of washing solution and hybridization conditions (e.g.,
temperature, ionic strength and % SDS) less stringent that those
described above. An example of moderately stringent conditions is
overnight incubation at 37.degree. C. in a solution comprising: 20%
formamide, 5.times.SSC (150 mM NaCl, 15 mM trisodium citrate), 50
mM sodium phosphate (pH 7.6), 5.times. Denhardt's solution, 10%
dextran sulfate, and 20 mg/ml denatured sheared salmon sperm DNA,
followed by washing the filters in 1.times.SSC at about
37-50.degree. C. The skilled artisan will recognize how to adjust
the temperature, ionic strength, etc. as necessary to accommodate
factors such as probe length and the like.
[0053] The term "epitope tagged" when used herein refers to a
chimeric polypeptide comprising a TAT polypeptide or anti-TAT
antibody fused to a "tag polypeptide". The tag polypeptide has
enough residues to provide an epitope against which an antibody can
be made, yet is short enough such that it does not interfere with
activity of the polypeptide to which it is fused. The tag
polypeptide preferably also is fairly unique so that the antibody
does not substantially cross-react with other epitopes. Suitable
tag polypeptides generally have at least six amino acid residues
and usually between about 8 and 50 amino acid residues (preferably,
between about 10 and 20 amino acid residues).
[0054] "Active" or "activity" for the purposes herein refers to
form(s) of a TAT polypeptide which retain a biological and/or an
immunological activity of native or naturally-occurring TAT,
wherein "biological" activity refers to a biological function
(either inhibitory or stimulatory) caused by a native or
naturally-occurring TAT other than the ability to induce the
production of an antibody against an antigenic epitope possessed by
a native or naturally-occurring TAT and an "immunological" activity
refers to the ability to induce the production of an antibody
against an antigenic epitope possessed by a native or
naturally-occurring TAT.
[0055] The term "antagonist" is used in the broadest sense, and
includes any molecule that partially or fully blocks, inhibits, or
neutralizes a biological activity of a native TAT polypeptide
disclosed herein. In a similar manner, the term "agonist" is used
in the broadest sense and includes any molecule that mimics a
biological activity of a native TAT polypeptide disclosed herein.
Suitable agonist or antagonist molecules specifically include
agonist or antagonist antibodies or antibody fragments, fragments
or amino acid sequence variants of native TAT polypeptides,
peptides, antisense oligonucleotides, small organic molecules, etc.
Methods for identifying agonists or antagonists of a TAT
polypeptide may comprise contacting a TAT polypeptide with a
candidate agonist or antagonist molecule and measuring a detectable
change in one or more biological activities normally associated
with the TAT polypeptide.
[0056] "Treating" or "treatment" or "alleviation" refers to both
therapeutic treatment and prophylactic or preventative measures,
wherein the object is to prevent or slow down (lessen) the targeted
pathologic condition or disorder. Those in need of treatment
include those already with the disorder as well as those prone to
have the disorder or those in whom the disorder is to be prevented.
A subject or mammal is successfully "treated" for a TAT
polypeptide-expressing cancer if, after receiving a therapeutic
amount of an anti-TAT antibody according to the methods of the
present invention, the patient shows observable and/or measurable
reduction in or absence of one or more of the following: reduction
in the number of cancer cells or absence of the cancer cells;
reduction in the tumor size; inhibition (i.e., slow to some extent
and preferably stop) of cancer cell infiltration into peripheral
organs including the spread of cancer into soft tissue and bone;
inhibition (i.e., slow to some extent and preferably stop) of tumor
metastasis; inhibition, to some extent, of tumor growth; and/or
relief to some extent, one or more of the symptoms associated with
the specific cancer; reduced morbidity and mortality, and
improvement in quality of life issues. To the extent the anti-TAT
antibody may prevent growth and/or kill existing cancer cells, it
may be cytostatic and/or cytotoxic. Reduction of these signs or
symptoms may also be felt by the patient.
[0057] The above parameters for assessing successful treatment and
improvement in the disease are readily measurable by routine
procedures familiar to a physician. For cancer therapy, efficacy
can be measured, for example, by assessing the time to disease
progression (TTP) and/or determining the response rate (RR).
Metastasis can be determined by staging tests and by bone scan and
tests for calcium level and other enzymes to determine spread to
the bone. CT scans can also be done to look for spread to the
pelvis and lymph nodes in the area. Chest X-rays and measurement of
liver enzyme levels by known methods are used to look for
metastasis to the lungs and liver, respectively. Other routine
methods for monitoring the disease include transrectal
ultrasonography (TRUS) and transrectal needle biopsy (TRNB).
[0058] For bladder cancer, which is a more localized cancer,
methods to determine progress of disease include urinary cytologic
evaluation by cystoscopy, monitoring for presence of blood in the
urine, visualization of the urothelial tract by sonography or an
intravenous pyelogram, computed tomography (CT) and magnetic
resonance imaging (MRI). The presence of distant metastases can be
assessed by CT of the abdomen, chest x-rays, or radionuclide
imaging of the skeleton.
[0059] "Chronic" administration refers to administration of the
agent(s) in a continuous mode as opposed to an acute mode, so as to
maintain the initial therapeutic effect (activity) for an extended
period of time. "Intermittent" administration is treatment that is
not consecutively done without interruption, but rather is cyclic
in nature.
[0060] "Mammal" for purposes of the treatment of, alleviating the
symptoms of or diagnosis of a cancer refers to any animal
classified as a mammal, including humans, domestic and farm
animals, and zoo, sports, or pet animals, such as dogs, cats,
cattle, horses, sheep, pigs, goats, rabbits, etc. Preferably, the
mammal is human.
[0061] Administration "in combination with" one or more further
therapeutic agents includes simultaneous (concurrent) and
consecutive administration in any order.
[0062] "Carriers" as used herein include pharmaceutically
acceptable carriers, excipients, or stabilizers which are nontoxic
to the cell or mammal being exposed thereto at the dosages and
concentrations employed. Often the physiologically acceptable
carrier is an aqueous pH buffered solution. Examples of
physiologically acceptable carriers include buffers such as
phosphate, citrate, and other organic acids; antioxidants including
ascorbic acid; low molecular weight (less than about 10 residues)
polypeptide; proteins, such as serum albumin, gelatin, or
immunoglobulins; hydrophilic polymers such as polyvinylpyrrolidone;
amino acids such as glycine, glutamine, asparagine, arginine or
lysine; monosaccharides, disaccharides, and other carbohydrates
including glucose, mannose, or dextrins; chelating agents such as
EDTA; sugar alcohols such as mannitol or sorbitol; salt-forming
counterions such as sodium; and/or nonionic surfactants such as
TWEEN.RTM., polyethylene glycol (PEG), and PLURONICS.RTM..
[0063] By "solid phase" is meant a non-aqueous matrix to which the
antibody of the present invention can adhere. Examples of solid
phases encompassed herein include those formed partially or
entirely of glass (e.g., controlled pore glass), polysaccharides
(e.g., agarose), polyacrylamides, polystyrene, polyvinyl alcohol
and silicones. In certain embodiments, depending on the context,
the solid phase can comprise the well of an assay plate; in others
it is a purification column (e.g., an affinity chromatography
column). This term also includes a discontinuous solid phase of
discrete particles, such as those described in U.S. Pat. No.
4,275,149.
[0064] A "liposome" is a small vesicle composed of various types of
lipids, phospholipids and/or surfactant which is useful for
delivery of a drug (such as a TAT polypeptide or antibody thereto)
to a mammal. The components of the liposome are commonly arranged
in a bilayer formation, similar to the lipid arrangement of
biological membranes.
[0065] A "small molecule" is defined herein to have a molecular
weight below about 500 Daltons.
[0066] An "effective amount" of a polypeptide or antibody disclosed
herein or an agonist or antagonist thereof is an amount sufficient
to carry out a specifically stated purpose. An "effective amount"
may be determined empirically and in a routine manner, in relation
to the stated purpose.
[0067] The term "therapeutically effective amount" refers to an
amount of an antibody, polypeptide or other drug effective to
"treat" a disease or disorder in a subject or mammal. In the case
of cancer, the therapeutically effective amount of the drug may
reduce the number of cancer cells; reduce the tumor size; inhibit
(i.e., slow to some extent and preferably stop) cancer cell
infiltration into peripheral organs; inhibit (i.e., slow to some
extent and preferably stop) tumor metastasis; inhibit, to some
extent, tumor growth; and/or relieve to some extent one or more of
the symptoms associated with the cancer. See the definition herein
of "treating". To the extent the drug may prevent growth and/or
kill existing cancer cells, it may be cytostatic and/or
cytotoxic.
[0068] A "growth inhibitory amount" of an anti-TAT antibody or TAT
polypeptide is an amount capable of inhibiting the growth of a
cell, especially tumor, e.g., cancer cell, either in vitro or in
vivo. A "growth inhibitory amount" of an anti-TAT antibody or TAT
polypeptide for purposes of inhibiting neoplastic cell growth may
be determined empirically and in a routine manner.
[0069] A "cytotoxic amount" of an anti-TAT antibody or TAT
polypeptide is an amount capable of causing the destruction of a
cell, especially tumor, e.g., cancer cell, either in vitro or in
vivo. A "cytotoxic amount" of an anti-TAT antibody or TAT
polypeptide for purposes of inhibiting neoplastic cell growth may
be determined empirically and in a routine manner.
[0070] The term "antibody" is used in the broadest sense and
specifically covers, for example, single anti-TAT monoclonal
antibodies (including agonist, antagonist, and neutralizing
antibodies), anti-TAT antibody compositions with polyepitopic
specificity, polyclonal antibodies, single chain anti-TAT
antibodies, and fragments of anti-TAT antibodies (see below) as
long as they exhibit the desired biological or immunological
activity. The term "immunoglobulin" (Ig) is used interchangeable
with antibody herein.
[0071] An "isolated antibody" is one which has been identified and
separated and/or recovered from a component of its natural
environment. Contaminant components of its natural environment are
materials which would interfere with diagnostic or therapeutic uses
for the antibody, and may include enzymes, hormones, and other
proteinaceous or nonproteinaceous solutes. In preferred
embodiments, the antibody will be purified (1) to greater than 95%
by weight of antibody as determined by the Lowry method, and most
preferably more than 99% by weight, (2) to a degree sufficient to
obtain at least 15 residues of N-terminal or internal amino acid
sequence by use of a spinning cup sequenator, or (3) to homogeneity
by SDS-PAGE under reducing or nonreducing conditions using
Coomassie blue or, preferably, silver stain. Isolated antibody
includes the antibody in situ within recombinant cells since at
least one component of the antibody's natural environment will not
be present. Ordinarily, however, isolated antibody will be prepared
by at least one purification step.
[0072] The basic 4-chain antibody unit is a heterotetrameric
glycoprotein composed of two identical light (L) chains and two
identical heavy (H) chains (an IgM antibody consists of 5 of the
basic heterotetramer unit along with an additional polypeptide
called J chain, and therefore contain 10 antigen binding sites,
while secreted IgA antibodies can polymerize to form polyvalent
assemblages comprising 2-5 of the basic 4-chain units along with J
chain). In the case of IgGs, the 4-chain unit is generally about
150,000 daltons. Each L chain is linked to a H chain by one
covalent disulfide bond, while the two H chains are linked to each
other by one or more disulfide bonds depending on the H chain
isotype. Each H and L chain also has regularly spaced intrachain
disulfide bridges. Each H chain has at the N-terminus, a variable
domain (V.sub.H) followed by three constant domains (C.sub.H) for
each of the .alpha. and .gamma. chains and four C.sub.H domains for
.mu. and .epsilon. isotypes. Each L chain has at the N-terminus, a
variable domain (V.sub.L) followed by a constant domain (C.sub.L)
at its other end. The V.sub.L is aligned with the V.sub.H and the
C.sub.L is aligned with the first constant domain of the heavy
chain (C.sub.H1). Particular amino acid residues are believed to
form an interface between the light chain and heavy chain variable
domains. The pairing of a V.sub.H and V.sub.L together forms a
single antigen-binding site. For the structure and properties of
the different classes of antibodies, see, e.g., Basic and Clinical
Immunology, 8th edition, Daniel P. Stites, Abba I. Terr and
Tristram G. Parslow (eds.), Appleton & Lange, Norwalk, Conn.,
1994, page 71 and Chapter 6.
[0073] The L chain from any vertebrate species can be assigned to
one of two clearly distinct types, called kappa and lambda, based
on the amino acid sequences of their constant domains. Depending on
the amino acid sequence of the constant domain of their heavy
chains (C.sub.H), immunoglobulins can be assigned to different
classes or isotypes. There are five classes of immunoglobulins:
IgA, IgD, IgE, IgG, and IgM, having heavy chains designated
.alpha., .delta., .epsilon., .gamma., and .mu., respectively. The
.gamma. and .alpha. classes are further divided into subclasses on
the basis of relatively minor differences in C.sub.H sequence and
function, e.g., humans express the following subclasses: IgG1,
IgG2, IgG3, IgG4, IgA1, and IgA2.
[0074] The term "variable" refers to the fact that certain segments
of the variable domains differ extensively in sequence among
antibodies. The V domain mediates antigen binding and define
specificity of a particular antibody for its particular antigen.
However, the variability is not evenly distributed across the
110-amino acid span of the variable domains. Instead, the V regions
consist of relatively invariant stretches called framework regions
(FRs) of 15-30 amino acids separated by shorter regions of extreme
variability called "hypervariable regions" that are each 9-12 amino
acids long. The variable domains of native heavy and light chains
each comprise four FRs, largely adopting a .beta.-sheet
configuration, connected by three hypervariable regions, which form
loops connecting, and in some cases forming part of, the
.beta.-sheet structure. The hypervariable regions in each chain are
held together in close proximity by the FRs and, with the
hypervariable regions from the other chain, contribute to the
formation of the antigen-binding site of antibodies (see Kabat et
al., Sequences of Proteins of Immunological Interest, 5th Ed.
Public Health Service, National Institutes of Health, Bethesda, Md.
(1991)). The constant domains are not involved directly in binding
an antibody to an antigen, but exhibit various effector functions,
such as participation of the antibody in antibody dependent
cellular cytotoxicity (ADCC).
[0075] The term "hypervariable region" when used herein refers to
the amino acid residues of an antibody which are responsible for
antigen-binding. The hypervariable region generally comprises amino
acid residues from a "complementarity determining region" or "CDR"
(e.g. around about residues 24-34 (L1), 50-56 (L2) and 89-97 (L3)
in the V.sub.L, and around about 1-35 (H1), 50-65 (H2) and 95-102
(H3) in the V.sub.H; Kabat et al., Sequences of Proteins of
Immunological Interest, 5.sup.th Ed. Public Health Service,
National Institutes of Health, Bethesda, Md. (1991)) and/or those
residues from a "hypervariable loop" (e.g. residues 26-32 (L1),
50-52 (L2) and 91-96 (L3) in the V.sub.L, and 26-32 (H1), 53-55
(H2) and 96-101 (H3) in the V.sub.H; Chothia and Lesk J. Mol. Biol.
196:901-917 (1987)).
[0076] The term "monoclonal antibody" as used herein refers to an
antibody obtained from a population of substantially homogeneous
antibodies, i.e., the individual antibodies comprising the
population are identical except for possible naturally occurring
mutations that may be present in minor amounts. Monoclonal
antibodies are highly specific, being directed against a single
antigenic site. Furthermore, in contrast to polyclonal antibody
preparations which include different antibodies directed against
different determinants (epitopes), each monoclonal antibody is
directed against a single determinant on the antigen. In addition
to their specificity, the monoclonal antibodies are advantageous in
that they may be synthesized uncontaminated by other antibodies.
The modifier "monoclonal" is not to be construed as requiring
production of the antibody by any particular method. For example,
the monoclonal antibodies useful in the present invention may be
prepared by the hybridoma methodology first described by Kohler et
al., Nature, 256:495 (1975), or may be made using recombinant DNA
methods in bacterial, eukaryotic animal or plant cells (see, e.g.,
U.S. Pat. No. 4,816,567). The "monoclonal antibodies" may also be
isolated from phage antibody libraries using the techniques
described in Clackson et al., Nature, 352:624-628 (1991) and Marks
et al., J. Mol. Biol., 222:581-597 (1991), for example.
[0077] The monoclonal antibodies herein include "chimeric"
antibodies in which a portion of the heavy and/or light chain is
identical with or homologous to corresponding sequences in
antibodies derived from a particular species or belonging to a
particular antibody class or subclass, while the remainder of the
chain(s) is identical with or homologous to corresponding sequences
in antibodies derived from another species or belonging to another
antibody class or subclass, as well as fragments of such
antibodies, so long as they exhibit the desired biological activity
(see U.S. Pat. No. 4,816,567; and Morrison et al., Proc. Natl.
Acad. Sci. USA, 81:6851-6855 (1984)). Chimeric antibodies of
interest herein include "primatized" antibodies comprising variable
domain antigen-binding sequences derived from a non-human primate
(e.g. Old World Monkey, Ape etc), and human constant region
sequences.
[0078] An "intact" antibody is one which comprises an
antigen-binding site as well as a C.sub.L and at least heavy chain
constant domains, C.sub.H1, C.sub.H2 and C.sub.H3. The constant
domains may be native sequence constant domains (e.g. human native
sequence constant domains) or amino acid sequence variant thereof.
Preferably, the intact antibody has one or more effector
functions.
[0079] "Antibody fragments" comprise a portion of an intact
antibody, preferably the antigen binding or variable region of the
intact antibody. Examples of antibody fragments include Fab, Fab',
F(ab').sub.2, and Fv fragments; diabodies; linear antibodies (see
U.S. Pat. No. 5,641,870, Example 2; Zapata et al., Protein Eng.
8(10): 1057-1062 [1995]); single-chain antibody molecules; and
multispecific antibodies formed from antibody fragments.
[0080] Papain digestion of antibodies produces two identical
antigen-binding fragments, called "Fab" fragments, and a residual
"Fc" fragment, a designation reflecting the ability to crystallize
readily. The Fab fragment consists of an entire L chain along with
the variable region domain of the H chain (V.sub.H), and the first
constant domain of one heavy chain (C.sub.H1). Each Fab fragment is
monovalent with respect to antigen binding, i.e., it has a single
antigen-binding site. Pepsin treatment of an antibody yields a
single large F(ab').sub.2 fragment which roughly corresponds to two
disulfide linked Fab fragments having divalent antigen-binding
activity and is still capable of cross-linking antigen. Fab'
fragments differ from Fab fragments by having additional few
residues at the carboxy terminus of the C.sub.H1 domain including
one or more cysteines from the antibody hinge region. Fab'-SH is
the designation herein for Fab' in which the cysteine residue(s) of
the constant domains bear a free thiol group. F(ab').sub.2 antibody
fragments originally were produced as pairs of Fab' fragments which
have hinge cysteines between them. Other chemical couplings of
antibody fragments are also known.
[0081] The Fc fragment comprises the carboxy-terminal portions of
both H chains held together by disulfides. The effector functions
of antibodies are determined by sequences in the Fc region, which
region is also the part recognized by Fc receptors (FcR) found on
certain types of cells.
[0082] "Fv" is the minimum antibody fragment which contains a
complete antigen-recognition and -binding site. This fragment
consists of a dimer of one heavy- and one light-chain variable
region domain in tight, non-covalent association. From the folding
of these two domains emanate six hypervariable loops (3 loops each
from the H and L chain) that contribute the amino acid residues for
antigen binding and confer antigen binding specificity to the
antibody. However, even a single variable domain (or half of an Fv
comprising only three CDRs specific for an antigen) has the ability
to recognize and bind antigen, although at a lower affinity than
the entire binding site.
[0083] "Single-chain Fv" also abbreviated as "sFv" or "scFv" are
antibody fragments that comprise the V.sub.H and V.sub.L antibody
domains connected into a single polypeptide chain. Preferably, the
sFv polypeptide further comprises a polypeptide linker between the
V.sub.H and V.sub.L domains which enables the sFv to form the
desired structure for antigen binding. For a review of sFv, see
Pluckthun in The Pharmacology of Monoclonal Antibodies, vol. 113,
Rosenburg and Moore eds., Springer-Verlag, New York, pp. 269-315
(1994); Borrebaeck 1995, infra.
[0084] The term "diabodies" refers to small antibody fragments
prepared by constructing sFv fragments (see preceding paragraph)
with short linkers (about 5-10 residues) between the V.sub.H and
V.sub.L domains such that inter-chain but not intra-chain pairing
of the V domains is achieved, resulting in a bivalent fragment,
i.e., fragment having two antigen-binding sites. Bispecific
diabodies are heterodimers of two "crossover" sFv fragments in
which the V.sub.H and V.sub.L domains of the two antibodies are
present on different polypeptide chains. Diabodies are described
more fully in, for example, EP 404,097; WO 93/11161; and Hollinger
et al., Proc. Natl. Acad. Sci. USA, 90:6444-6448 (1993).
[0085] "Humanized" forms of non-human (e.g., rodent) antibodies are
chimeric antibodies that contain minimal sequence derived from the
non-human antibody. For the most part, humanized antibodies are
human immunoglobulins (recipient antibody) in which residues from a
hypervariable region of the recipient are replaced by residues from
a hypervariable region of a non-human species (donor antibody) such
as mouse, rat, rabbit or non-human primate having the desired
antibody specificity, affinity, and capability. In some instances,
framework region (FR) residues of the human immunoglobulin are
replaced by corresponding non-human residues. Furthermore,
humanized antibodies may comprise residues that are not found in
the recipient antibody or in the donor antibody. These
modifications are made to further refine antibody performance. In
general, the humanized antibody will comprise substantially all of
at least one, and typically two, variable domains, in which all or
substantially all of the hypervariable loops correspond to those of
a non-human immunoglobulin and all or substantially all of the FRs
are those of a human immunoglobulin sequence. The humanized
antibody optionally also will comprise at least a portion of an
immunoglobulin constant region (Fc), typically that of a human
immunoglobulin. For further details, see Jones et al., Nature
321:522-525 (1986); Riechmann et al., Nature 332:323-329 (1988);
and Presta, Curr. Op. Struct. Biol. 2:593-596 (1992).
[0086] A "species-dependent antibody," e.g., a mammalian anti-human
IgE antibody, is an antibody which has a stronger binding affinity
for an antigen from a first mammalian species than it has for a
homologue of that antigen from a second mammalian species.
Normally, the species-dependent antibody "bind specifically" to a
human antigen (i.e., has a binding affinity (Kd) value of no more
than about 1.times.10.sup.-7 M, preferably no more than about
1.times.10.sup.-8 and most preferably no more than about
1.times.10.sup.-9 M) but has a binding affinity for a homologue of
the antigen from a second non-human mammalian species which is at
least about 50 fold, or at least about 500 fold, or at least about
1000 fold, weaker than its binding affinity for the human antigen.
The species-dependent antibody can be of any of the various types
of antibodies as defined above, but preferably is a humanized or
human antibody.
[0087] An antibody "which binds" an antigen of interest, e.g. a
tumor-associated polypeptide antigen target, is one that binds the
antigen with sufficient affinity such that the antibody is useful
as a diagnostic and/or therapeutic agent in targeting a cell
expressing the antigen, and does not significantly cross-react with
other proteins. In such embodiments, the extent of binding of the
antibody to a "non-target" protein will be less than about 10% of
the binding of the antibody to its particular target protein as
determined by fluorescence activated cell sorting (FACS) analysis
or radioimmunoprecipitation (RIA). An antibody that "specifically
binds to" or is "specific for" a particular polypeptide or an
epitope on a particular polypeptide is one that binds to that
particular polypeptide or epitope on a particular polypeptide
without substantially binding to any other polypeptide or
polypeptide epitope.
[0088] An "antibody that inhibits the growth of tumor cells
expressing a TAT polypeptide" or a "growth inhibitory" antibody is
one which binds to and results in measurable growth inhibition of
cancer cells expressing or overexpressing the appropriate TAT
polypeptide. Preferred growth inhibitory anti-TAT antibodies
inhibit growth of TAT-expressing tumor cells by greater than 20%,
preferably from about 20% to about 50%, and even more preferably,
by greater than 50% (e.g., from about 50% to about 100%) as
compared to the appropriate control, the control typically being
tumor cells not treated with the antibody being tested. Growth
inhibition can be measured at an antibody concentration of about
0.1 to 30 .mu.g/ml or about 0.5 nM to 200 nM in cell culture, where
the growth inhibition is determined 1-10 days after exposure of the
tumor cells to the antibody. Growth inhibition of tumor cells in
vivo can be determined in various ways such as is described in the
Experimental Examples section below. The antibody is growth
inhibitory in vivo if administration of the anti-TAT antibody at
about 1 .mu.g/kg to about 100 mg/kg body weight results in
reduction in tumor size or tumor cell proliferation within about 5
days to 3 months from the first administration of the antibody,
preferably within about 5 to 30 days.
[0089] An antibody which "induces apoptosis" is one which induces
programmed cell death as determined by binding of annexin V,
fragmentation of DNA, cell shrinkage, dilation of endoplasmic
reticulum, cell fragmentation, and/or formation of membrane
vesicles (called apoptotic bodies). The cell is usually one which
overexpresses a TAT polypeptide. Preferably the cell is a tumor
cell, e.g., a prostate, breast, ovarian, stomach, endometrial,
lung, kidney, colon, bladder cell. Various methods are available
for evaluating the cellular events associated with apoptosis. For
example, phosphatidyl serine (PS) translocation can be measured by
annexin binding; DNA fragmentation can be evaluated through DNA
laddering; and nuclear/chromatin condensation along with DNA
fragmentation can be evaluated by any increase in hypodiploid
cells. Preferably, the antibody which induces apoptosis is one
which results in about 2 to 50 fold, preferably about 5 to 50 fold,
and most preferably about 10 to 50 fold, induction of annexin
binding relative to untreated cell in an annexin binding assay.
[0090] Antibody "effector functions" refer to those biological
activities attributable to the Fc region (a native sequence Fc
region or amino acid sequence variant Fc region) of an antibody,
and vary with the antibody isotype. Examples of antibody effector
functions include: C1q binding and complement dependent
cytotoxicity; Fc receptor binding; antibody-dependent cell-mediated
cytotoxicity (ADCC); phagocytosis; down regulation of cell surface
receptors (e.g., B cell receptor); and B cell activation.
[0091] "Antibody-dependent cell-mediated cytotoxicity" or "ADCC"
refers to a form of cytotoxicity in which secreted Ig bound onto Fc
receptors (FcRs) present on certain cytotoxic cells (e.g., Natural
Killer (NK) cells, neutrophils, and macrophages) enable these
cytotoxic effector cells to bind specifically to an antigen-bearing
target cell and subsequently kill the target cell with cytotoxins.
The antibodies "arm" the cytotoxic cells and are absolutely
required for such killing. The primary cells for mediating ADCC, NK
cells, express Fc.gamma.RIII only, whereas monocytes express
Fc.gamma.RI, Fc.gamma.RII and Fc.gamma.RIII. FcR expression on
hematopoietic cells is summarized in Table 3 on page 464 of Ravetch
and Kinet, Annu. Rev. Immunol. 9:457-92 (1991). To assess ADCC
activity of a molecule of interest, an in vitro ADCC assay, such as
that described in U.S. Pat. No. 5,500,362 or 5,821,337 may be
performed. Useful effector cells for such assays include peripheral
blood mononuclear cells (PBMC) and Natural Killer (NK) cells.
Alternatively, or additionally, ADCC activity of the molecule of
interest may be assessed in vivo, e.g., in a animal model such as
that disclosed in Clynes et al. (USA) 95:652-656 (1998).
[0092] "Fc receptor" or "FcR" describes a receptor that binds to
the Fc region of an antibody. The preferred FcR is a native
sequence human FcR. Moreover, a preferred FcR is one which binds an
IgG antibody (a gamma receptor) and includes receptors of the
Fc.gamma.RI, Fc.gamma.RII and Fc.gamma.RIII subclasses, including
allelic variants and alternatively spliced forms of these
receptors. Fc.gamma.RII receptors include Fc.gamma.RIIA (an
"activating receptor") and Fc.gamma.RIIB (an "inhibiting
receptor"), which have similar amino acid sequences that differ
primarily in the cytoplasmic domains thereof. Activating receptor
Fc.gamma.RIIA contains an immunoreceptor tyrosine-based activation
motif (ITAM) in its cytoplasmic domain. Inhibiting receptor
Fc.gamma.RIIB contains an immunoreceptor tyrosine-based inhibition
motif (ITIM) in its cytoplasmic domain. (see review M. in Daeron,
Annu. Rev. Immunol. 15:203-234 (1997)). FcRs are reviewed in
Ravetch and Kinet, Annu. Rev. Immunol. 9:457-492 (1991); Capel et
al., Immunomethods 4:25-34 (1994); and de Haas et al., J. Lab.
Clin. Med. 126:330-41 (1995). Other FcRs, including those to be
identified in the future, are encompassed by the term "FcR" herein.
The term also includes the neonatal receptor, FcRn, which is
responsible for the transfer of maternal IgGs to the fetus (Guyer
et al., J. Immunol. 117:587 (1976) and Kim et al., J. Immunol.
24:249 (1994)).
[0093] "Human effector cells" are leukocytes which express one or
more FcRs and perform effector functions. Preferably, the cells
express at least Fc.gamma.RIII and perform ADCC effector function.
Examples of human leukocytes which mediate ADCC include peripheral
blood mononuclear cells (PBMC), natural killer (NK) cells,
monocytes, cytotoxic T cells and neutrophils; with PBMCs and NK
cells being preferred. The effector cells may be isolated from a
native source, e.g., from blood.
[0094] "Complement dependent cytotoxicity" or "CDC" refers to the
lysis of a target cell in the presence of complement. Activation of
the classical complement pathway is initiated by the binding of the
first component of the complement system (C1q) to antibodies (of
the appropriate subclass) which are bound to their cognate antigen.
To assess complement activation, a CDC assay, e.g., as described in
Gazzano-Santoro et al., J. Immunol. Methods 202:163 (1996), may be
performed.
[0095] The terms "cancer" and "cancerous" refer to or describe the
physiological condition in mammals that is typically characterized
by unregulated cell growth. Examples of cancer include, but are not
limited to, carcinoma, lymphoma, blastoma, sarcoma, and leukemia or
lymphoid malignancies. More particular examples of such cancers
include squamous cell cancer (e.g., epithelial squamous cell
cancer), lung cancer including small-cell lung cancer, non-small
cell lung cancer, adenocarcinoma of the lung and squamous carcinoma
of the lung, cancer of the peritoneum, hepatocellular cancer,
gastric or stomach cancer including gastrointestinal cancer,
pancreatic cancer, glioblastoma, cervical cancer, ovarian cancer,
liver cancer, bladder cancer, cancer of the urinary tract,
hepatoma, breast cancer, colon cancer, rectal cancer, colorectal
cancer, endometrial or uterine carcinoma, salivary gland carcinoma,
kidney or renal cancer, prostate cancer, vulval cancer, thyroid
cancer, hepatic carcinoma, anal carcinoma, penile carcinoma,
melanoma, multiple myeloma and B-cell lymphoma, brain, as well as
head and neck cancer, and associated metastases.
[0096] "Tumor", as used herein, refers to all neoplastic cell
growth and proliferation, whether malignant or benign, and all
pre-cancerous and cancerous cells and tissues.
[0097] An antibody which "induces cell death" is one which causes a
viable cell to become nonviable. The cell is one which expresses a
TAT polypeptide, preferably a cell that overexpresses a TAT
polypeptide as compared to a normal cell of the same tissue type.
Preferably, the cell is a cancer cell, e.g., a breast, ovarian,
stomach, endometrial, salivary gland, lung, kidney, colon, thyroid,
pancreatic or bladder cell. Cell death in vitro may be determined
in the absence of complement and immune effector cells to
distinguish cell death induced by antibody-dependent cell-mediated
cytotoxicity (ADCC) or complement dependent cytotoxicity (CDC).
Thus, the assay for cell death may be performed using heat
inactivated serum (i.e., in the absence of complement) and in the
absence of immune effector cells. To determine whether the antibody
is able to induce cell death, loss of membrane integrity as
evaluated by uptake of propidium iodide (PI), trypan blue (see
Moore et al. Cytotechnology 17:1-11 (1995)) or 7AAD can be assessed
relative to untreated cells. Preferred cell death-inducing
antibodies are those which induce PI uptake in the PI uptake assay
in BT474 cells.
[0098] A "TAT-expressing cell" is a cell which expresses an
endogenous or transfected TAT polypeptide on the cell surface. A
"TAT-expressing cancer" is a cancer comprising cells that have a
TAT polypeptide present on the cell surface. A "TAT-expressing
cancer" produces sufficient levels of TAT polypeptide on the
surface of cells thereof, such that an anti-TAT antibody can bind
thereto and have a therapeutic effect with respect to the cancer. A
cancer which "overexpresses" a TAT polypeptide is one which has
significantly higher levels of TAT polypeptide at the cell surface
thereof, compared to a noncancerous cell of the same tissue type.
Such overexpression may be caused by gene amplification or by
increased transcription or translation. TAT polypeptide
overexpression may be determined in a diagnostic or prognostic
assay by evaluating increased levels of the TAT protein present on
the surface of a cell (e.g., via an immunohistochemistry assay
using anti-TAT antibodies prepared against an isolated TAT
polypeptide which may be prepared using recombinant DNA technology
from an isolated nucleic acid encoding the TAT polypeptide; FACS
analysis, etc.). Alternatively, or additionally, one may measure
levels of TAT polypeptide-encoding nucleic acid or mRNA in the
cell, e.g., via fluorescent in situ hybridization using a nucleic
acid based probe corresponding to a TAT-encoding nucleic acid or
the complement thereof; (FISH; see WO98/45479 published October,
1998), Southern blotting, Northern blotting, or polymerase chain
reaction (PCR) techniques, such as real time quantitative PCR
(RT-PCR). One may also study TAT polypeptide overexpression by
measuring shed antigen in a biological fluid such as serum, e.g,
using antibody-based assays (see also, e.g., U.S. Pat. No.
4,933,294 issued Jun. 12, 1990; WO91/05264 published Apr. 18, 1991;
U.S. Pat. No. 5,401,638 issued Mar. 28, 1995; and Sias et al., J.
Immunol. Methods 132:73-80 (1990)). Aside from the above assays,
various in vivo assays are available to the skilled practitioner.
For example, one may expose cells within the body of the patient to
an antibody which is optionally labeled with a detectable label,
e.g., a radioactive isotope, and binding of the antibody to cells
in the patient can be evaluated, e.g., by external scanning for
radioactivity or by analyzing a biopsy taken from a patient
previously exposed to the antibody.
[0099] As used herein, the term "immunoadhesin" designates
antibody-like molecules which combine the binding specificity of a
heterologous protein (an "adhesin") with the effector functions of
immunoglobulin constant domains. Structurally, the immunoadhesins
comprise a fusion of an amino acid sequence with the desired
binding specificity which is other than the antigen recognition and
binding site of an antibody (i.e., is "heterologous"), and an
immunoglobulin constant domain sequence. The adhesin part of an
immunoadhesin molecule typically is a contiguous amino acid
sequence comprising at least the binding site of a receptor or a
ligand. The immunoglobulin constant domain sequence in the
immunoadhesin may be obtained from any immunoglobulin, such as
IgG-1, IgG-2, IgG-3, or IgG-4 subtypes, IgA (including IgA-1 and
IgA-2), IgE, IgD or IgM.
[0100] The word "label" when used herein refers to a detectable
compound or composition which is conjugated directly or indirectly
to the antibody so as to generate a "labeled" antibody. The label
may be detectable by itself (e.g. radioisotope labels or
fluorescent labels) or, in the case of an enzymatic label, may
catalyze chemical alteration of a substrate compound or composition
which is detectable.
[0101] The term "cytotoxic agent" as used herein refers to a
substance that inhibits or prevents the function of cells and/or
causes destruction of cells. The term is intended to include
radioactive isotopes (e.g., At.sup.211, I.sup.131, I.sup.125,
Y.sup.90, Re.sup.186, Re.sup.188, Sm.sup.153, Bi.sup.212, P.sup.32
and radioactive isotopes of Lu), chemotherapeutic agents e.g.
methotrexate, adriamicin, vinca alkaloids (vincristine,
vinblastine, etoposide), doxorubicin, melphalan, mitomycin C,
chlorambucil, daunorubicin or other intercalating agents, enzymes
and fragments thereof such as nucleolytic enzymes, antibiotics, and
toxins such as small molecule toxins or enzymatically active toxins
of bacterial, fungal, plant or animal origin, including fragments
and/or variants thereof, and the various antitumor or anticancer
agents disclosed below. Other cytotoxic agents are described below.
A tumoricidal agent causes destruction of tumor cells.
[0102] A "growth inhibitory agent" when used herein refers to a
compound or composition which inhibits growth of a cell, especially
a TAT-expressing cancer cell, either in vitro or in vivo. Thus, the
growth inhibitory agent may be one which significantly reduces the
percentage of TAT-expressing cells in S phase. Examples of growth
inhibitory agents include agents that block cell cycle progression
(at a place other than S phase), such as agents that induce G1
arrest and M-phase arrest. Classical M-phase blockers include the
vincas (vincristine and vinblastine), taxanes, and topoisomerase II
inhibitors such as doxorubicin, epirubicin, daunorubicin,
etoposide, and bleomycin. Those agents that arrest G1 also spill
over into S-phase arrest, for example, DNA alkylating agents such
as tamoxifen, prednisone, dacarbazine, mechlorethamine, cisplatin,
methotrexate, 5-fluorouracil, and ara-C. Further information can be
found in The Molecular Basis of Cancer, Mendelsohn and Israel,
eds., Chapter 1, entitled "Cell cycle regulation, oncogenes, and
antineoplastic drugs" by Murakami et al. (WB Saunders:
Philadelphia, 1995), especially p. 13. The taxanes (paclitaxel and
docetaxel) are anticancer drugs both derived from the yew tree.
Docetaxel (TAXOTERE.RTM., Rhone-Poulenc Rorer), derived from the
European yew, is a semisynthetic analogue of paclitaxel
(TAXOL.RTM., Bristol-Myers Squibb). Paclitaxel and docetaxel
promote the assembly of microtubules from tubulin dimers and
stabilize microtubules by preventing depolymerization, which
results in the inhibition of mitosis in cells.
[0103] "Doxorubicin" is an anthracycline antibiotic. The full
chemical name of doxorubicin is
(8S-cis)-10-[(3-amino-2,3,6-trideoxy-.alpha.-L-lyxo-hexapyranosyl)oxy]-7,-
8,9,10-tetrahydro-6,8,11-trihydroxy-8-(hydroxyacetyl)-1-methoxy-5,12-napht-
hacenedione.
[0104] The term "cytokine" is a generic term for proteins released
by one cell population which act on another cell as intercellular
mediators. Examples of such cytokines are lymphokines, monokines,
and traditional polypeptide hormones. Included among the cytokines
are growth hormone such as human growth hormone, N-methionyl human
growth hormone, and bovine growth hormone; parathyroid hormone;
thyroxine; insulin; proinsulin; relaxin; prorelaxin; glycoprotein
hormones such as follicle stimulating hormone (FSH), thyroid
stimulating hormone (TSH), and luteinizing hormone (LH); hepatic
growth factor; fibroblast growth factor; prolactin; placental
lactogen; tumor necrosis factor-.alpha. and -.beta.;
mullerian-inhibiting substance; mouse gonadotropin-associated
peptide; inhibin; activin; vascular endothelial growth factor;
integrin; thrombopoietin (TPO); nerve growth factors such as
NGF-.beta.; platelet-growth factor; transforming growth factors
(TGFs) such as TGF-.alpha. and TGF-.beta.; insulin-like growth
factor-I and -II; erythropoietin (EPO); osteoinductive factors;
interferons such as interferon-.alpha., -.beta., and -.gamma.;
colony stimulating factors (CSFs) such as macrophage-CSF (M-CSF);
granulocyte-macrophage-CSF (GM-CSF); and granulocyte-CSF (G-CSF);
interleukins (ILs) such as IL-1, IL-1a, IL-2, IL-3, IL-4, IL-5,
IL-6, IL-7, IL-8, IL-9, IL-11, IL-12; a tumor necrosis factor such
as TNF-.alpha. or TNF-.beta.; and other polypeptide factors
including LIF and kit ligand (KL). As used herein, the term
cytokine includes proteins from natural sources or from recombinant
cell culture and biologically active equivalents of the native
sequence cytokines.
[0105] The term "package insert" is used to refer to instructions
customarily included in commercial packages of therapeutic
products, that contain information about the indications, usage,
dosage, administration, contraindications and/or warnings
concerning the use of such therapeutic products. TABLE-US-00001
TABLE 2 TAT XXXXXXXXXXXXXXX (Length = 15 amino acids) Comparison
XXXXXYYYYYYY (Length = 12 amino acids) Protein % amino acid
sequence identity = (the number of identically matching amino acid
residues between the two polypeptide sequences as determined by
ALIGN-2) divided by (the total number of amino acid residues of the
TAT polypeptide) = 5 divided by 15 = 33.3%
[0106] TABLE-US-00002 TABLE 3 TAT XXXXXXXXXX (Length = 10 amino
acids) Comparison XXXXXYYYYYYZZYZ (Length = 15 amino acids) Protein
% amino acid sequence identity = (the number of identically
matching amino acid residues between the two polypeptide sequences
as determined by ALIGN-2) divided by (the total number of amino
acid residues of the TAT polypeptide) = 5 divided by 10 = 50%
[0107] TABLE-US-00003 TABLE 4 TAT-DNA NNNNNNNNNNNNNN (Length = 14
nucleotides) Comparison NNNNNNLLLLLLLLLL (Length = 16 nucleotides)
DNA % nucleic acid sequence identity = (the number of identically
matching nucleotides between the two nucleic acid sequences as
determined by ALIGN-2) divided by (the total number of nucleotides
of the TAT-DNA nucleic acid sequence) = 6 divided by 14 = 42.9%
[0108] TABLE-US-00004 TABLE 5 TAT-DNA NNNNNNNNNNNN (Length = 12
nucleotides) Comparison DNA NNNNLLLVV (Length = 9 nucleotides) %
nucleic acid sequence identity = (the number of identically
matching nucleotides between the two nucleic acid sequences as
determined by ALIGN-2) divided by (the total number of nucleotides
of the TAT-DNA nucleic acid sequence) = 4 divided by 12 = 33.3%
[0109] II. Compositions and Methods of the Invention
[0110] A. Anti-TAT Antibodies
[0111] In one embodiment, the present invention provides anti-TAT
antibodies which may find use herein as therapeutic and/or
diagnostic agents. Exemplary antibodies include polyclonal,
monoclonal, humanized, bispecific, and heteroconjugate
antibodies.
[0112] 1. Polyclonal Antibodies
[0113] Polyclonal antibodies are preferably raised in animals by
multiple subcutaneous (sc) or intraperitoneal (ip) injections of
the relevant antigen and an adjuvant. It may be useful to conjugate
the relevant antigen (especially when synthetic peptides are used)
to a protein that is immunogenic in the species to be immunized.
For example, the antigen can be conjugated to keyhole limpet
hemocyanin (KLH), serum albumin, bovine thyroglobulin, or soybean
trypsin inhibitor, using a bifunctional or derivatizing agent,
e.g., maleimidobenzoyl sulfosuccinimide ester (conjugation through
cysteine residues), N-hydroxysuccinimide (through lysine residues),
glutaraldehyde, succinic anhydride, SOCl.sub.2, or
R.sup.1N.dbd.C.dbd.NR, where R and R.sup.1 are different alkyl
groups.
[0114] Animals are immunized against the antigen, immunogenic
conjugates, or derivatives by combining, e.g., 100 .mu.g or 5 .mu.g
of the protein or conjugate (for rabbits or mice, respectively)
with 3 volumes of Freund's complete adjuvant and injecting the
solution intradermally at multiple sites. One month later, the
animals are boosted with 1/5 to 1/10 the original amount of peptide
or conjugate in Freund's complete adjuvant by subcutaneous
injection at multiple sites. Seven to 14 days later, the animals
are bled and the serum is assayed for antibody titer. Animals are
boosted until the titer plateaus. Conjugates also can be made in
recombinant cell culture as protein fusions. Also, aggregating
agents such as alum are suitably used to enhance the immune
response.
[0115] 2. Monoclonal Antibodies
[0116] Monoclonal antibodies may be made using the hybridoma method
first described by Kohler et al., Nature, 256:495 (1975), or may be
made by recombinant DNA methods (U.S. Pat. No. 4,816,567).
[0117] In the hybridoma method, a mouse or other appropriate host
animal, such as a hamster, is immunized as described above to
elicit lymphocytes that produce or are capable of producing
antibodies that will specifically bind to the protein used for
immunization. Alternatively, lymphocytes may be immunized in vitro.
After immunization, lymphocytes are isolated and then fused with a
myeloma cell line using a suitable fusing agent, such as
polyethylene glycol, to form a hybridoma cell (Goding, Monoclonal
Antibodies: Principles and Practice, pp. 59-103 (Academic Press,
1986)).
[0118] The hybridoma cells thus prepared are seeded and grown in a
suitable culture medium which medium preferably contains one or
more substances that inhibit the growth or survival of the unfused,
parental myeloma cells (also referred to as fusion partner). For
example, if the parental myeloma cells lack the enzyme hypoxanthine
guanine phosphoribosyl transferase (HGPRT or HPRT), the selective
culture medium for the hybridomas typically will include
hypoxanthine, aminopterin, and thymidine (HAT medium), which
substances prevent the growth of HGPRT-deficient cells.
[0119] Preferred fusion partner myeloma cells are those that fuse
efficiently, support stable high-level production of antibody by
the selected antibody-producing cells, and are sensitive to a
selective medium that selects against the unfused parental cells.
Preferred myeloma cell lines are murine myeloma lines, such as
those derived from MOPC-21 and MPC-11 mouse tumors available from
the Salk Institute Cell Distribution Center, San Diego, Calif. USA,
and SP-2 and derivatives e.g., X63-Ag8-653 cells available from the
American Type Culture Collection, Manassas, Va., USA. Human myeloma
and mouse-human heteromyeloma cell lines also have been described
for the production of human monoclonal antibodies (Kozbor, J.
Immunol., 133:3001 (1984); and Brodeur et al., Monoclonal Antibody
Production Techniques and Applications, pp. 51-63 (Marcel Dekker,
Inc., New York, 1987)).
[0120] Culture medium in which hybridoma cells are growing is
assayed for production of monoclonal antibodies directed against
the antigen. Preferably, the binding specificity of monoclonal
antibodies produced by hybridoma cells is determined by
immunoprecipitation or by an in vitro binding assay, such as
radioimmunoassay (RIA) or enzyme-linked immunosorbent assay
(ELISA).
[0121] The binding affinity of the monoclonal antibody can, for
example, be determined by the Scatchard analysis described in
Munson et al., Anal. Biochem., 107:220 (1980).
[0122] Once hybridoma cells that produce antibodies of the desired
specificity, affinity, and/or activity are identified, the clones
may be subcloned by limiting dilution procedures and grown by
standard methods (Goding, Monoclonal Antibodies: Principles and
Practice, pp. 59-103 (Academic Press, 1986)). Suitable culture
media for this purpose include, for example, D-MEM or RPMI-1640
medium. In addition, the hybridoma cells may be grown in vivo as
ascites tumors in an animal e.g, by i.p. injection of the cells
into mice.
[0123] The monoclonal antibodies secreted by the subclones are
suitably separated from the culture medium, ascites fluid, or serum
by conventional antibody purification procedures such as, for
example, affinity chromatography (e.g., using protein A or protein
G-Sepharose) or ion-exchange chromatography, hydroxylapatite
chromatography, gel electrophoresis, dialysis, etc.
[0124] DNA encoding the monoclonal antibodies is readily isolated
and sequenced using conventional procedures (e.g., by using
oligonucleotide probes that are capable of binding specifically to
genes encoding the heavy and light chains of murine antibodies).
The hybridoma cells serve as a preferred source of such DNA. Once
isolated, the DNA may be placed into expression vectors, which are
then transfected into host cells such as E. coli cells, simian COS
cells, Chinese Hamster Ovary (CHO) cells, or myeloma cells that do
not otherwise produce antibody protein, to obtain the synthesis of
monoclonal antibodies in the recombinant host cells. Review
articles on recombinant expression in bacteria of DNA encoding the
antibody include Skerra et al., Curr. Opinion in Immunol.,
5:256-262 (1993) and Pluckthun, Immunol. Revs. 130:151-188
(1992).
[0125] In a further embodiment, monoclonal antibodies or antibody
fragments can be isolated from antibody phage libraries generated
using the techniques described in McCafferty et al., Nature,
348:552-554 (1990). Clackson et al., Nature, 352:624-628 (1991) and
Marks et al., J. Mol. Biol., 222:581-597 (1991) describe the
isolation of murine and human antibodies, respectively, using phage
libraries. Subsequent publications describe the production of high
affinity (nM range) human antibodies by chain shuffling (Marks et
al., Bio/Technology, 10:779-783 (1992)), as well as combinatorial
infection and in vivo recombination as a strategy for constructing
very large phage libraries (Waterhouse et al., Nuc. Acids. Res.
21:2265-2266 (1993)). Thus, these techniques are viable
alternatives to traditional monoclonal antibody hybridoma
techniques for isolation of monoclonal antibodies.
[0126] The DNA that encodes the antibody may be modified to produce
chimeric or fusion antibody polypeptides, for example, by
substituting human heavy chain and light chain constant domain
(C.sub.H and C.sub.L) sequences for the homologous murine sequences
(U.S. Pat. No. 4,816,567; and Morrison, et al., Proc. Natl. Acad.
Sci. USA, 81:6851 (1984)), or by fusing the immunoglobulin coding
sequence with all or part of the coding sequence for a
non-immunoglobulin polypeptide (heterologous polypeptide). The
non-immunoglobulin polypeptide sequences can substitute for the
constant domains of an antibody, or they are substituted for the
variable domains of one antigen-combining site of an antibody to
create a chimeric bivalent antibody comprising one
antigen-combining site having specificity for an antigen and
another antigen-combining site having specificity for a different
antigen.
[0127] 3. Human and Humanized Antibodies
[0128] The anti-TAT antibodies of the invention may further
comprise humanized antibodies or human antibodies. Humanized forms
of non-human (e.g., murine) antibodies are chimeric
immunoglobulins, immunoglobulin chains or fragments thereof (such
as Fv, Fab, Fab', F(ab').sub.2 or other antigen-binding
subsequences of antibodies) which contain minimal sequence derived
from non-human immunoglobulin. Humanized antibodies include human
immunoglobulins (recipient antibody) in which residues from a
complementary determining region (CDR) of the recipient are
replaced by residues from a CDR of a non-human species (donor
antibody) such as mouse, rat or rabbit having the desired
specificity, affinity and capacity. In some instances, Fv framework
residues of the human immunoglobulin are replaced by corresponding
non-human residues. Humanized antibodies may also comprise residues
which are found neither in the recipient antibody nor in the
imported CDR or framework sequences. In general, the humanized
antibody will comprise substantially all of at least one, and
typically two, variable domains, in which all or substantially all
of the CDR regions correspond to those of a non-human
immunoglobulin and all or substantially all of the FR regions are
those of a human immunoglobulin consensus sequence. The humanized
antibody optimally also will comprise at least a portion of an
immunoglobulin constant region (Fc), typically that of a human
immunoglobulin [Jones et al., Nature, 321:522-525 (1986); Riechmann
et al., Nature, 332:323-329 (1988); and Presta, Curr. Op. Struct.
Biol., 2:593-596 (1992)].
[0129] Methods for humanizing non-human antibodies are well known
in the art. Generally, a humanized antibody has one or more amino
acid residues introduced into it from a source which is non-human.
These non-human amino acid residues are often referred to as
"import" residues, which are typically taken from an "import"
variable domain. Humanization can be essentially performed
following the method of Winter and co-workers [Jones et al.,
Nature, 321:522-525 (1986); Riechmann et al., Nature, 332:323-327
(1988); Verhoeyen et al., Science, 239:1534-1536 (1988)], by
substituting rodent CDRs or CDR sequences for the corresponding
sequences of a human antibody. Accordingly, such "humanized"
antibodies are chimeric antibodies (U.S. Pat. No. 4,816,567),
wherein substantially less than an intact human variable domain has
been substituted by the corresponding sequence from a non-human
species. In practice, humanized antibodies are typically human
antibodies in which some CDR residues and possibly some FR residues
are substituted by residues from analogous sites in rodent
antibodies.
[0130] The choice of human variable domains, both light and heavy,
to be used in making the humanized antibodies is very important to
reduce antigenicity and HAMA response (human anti-mouse antibody)
when the antibody is intended for human therapeutic use. According
to the so-called "best-fit" method, the sequence of the variable
domain of a rodent antibody is screened against the entire library
of known human variable domain sequences. The human V domain
sequence which is closest to that of the rodent is identified and
the human framework region (FR) within it accepted for the
humanized antibody (Sims et al., J. Immunol. 151:2296 (1993);
Chothia et al., J. Mol. Biol., 196:901 (1987)). Another method uses
a particular framework region derived from the consensus sequence
of all human antibodies of a particular subgroup of light or heavy
chains. The same framework may be used for several different
humanized antibodies (Carter et al., Proc. Natl. Acad. Sci. USA,
89:4285 (1992); Presta et al., J. Immunol. 151:2623 (1993)).
[0131] It is further important that antibodies be humanized with
retention of high binding affinity for the antigen and other
favorable biological properties. To achieve this goal, according to
a preferred method, humanized antibodies are prepared by a process
of analysis of the parental sequences and various conceptual
humanized products using three-dimensional models of the parental
and humanized sequences. Three-dimensional immunoglobulin models
are commonly available and are familiar to those skilled in the
art. Computer programs are available which illustrate and display
probable three-dimensional conformational structures of selected
candidate immunoglobulin sequences. Inspection of these displays
permits analysis of the likely role of the residues in the
functioning of the candidate immunoglobulin sequence, i.e., the
analysis of residues that influence the ability of the candidate
immunoglobulin to bind its antigen. In this way, FR residues can be
selected and combined from the recipient and import sequences so
that the desired antibody characteristic, such as increased
affinity for the target antigen(s), is achieved. In general, the
hypervariable region residues are directly and most substantially
involved in influencing antigen binding.
[0132] Various forms of a humanized anti-TAT antibody are
contemplated. For example, the humanized antibody may be an
antibody fragment, such as a Fab, which is optionally conjugated
with one or more cytotoxic agent(s) in order to generate an
immunoconjugate. Alternatively, the humanized antibody may be an
intact antibody, such as an intact IgG1 antibody.
[0133] As an alternative to humanization, human antibodies can be
generated. For example, it is now possible to produce transgenic
animals (e.g., mice) that are capable, upon immunization, of
producing a full repertoire of human antibodies in the absence of
endogenous immunoglobulin production. For example, it has been
described that the homozygous deletion of the antibody heavy-chain
joining region (J.sub.H) gene in chimeric and germ-line mutant mice
results in complete inhibition of endogenous antibody production.
Transfer of the human germ-line immunoglobulin gene array into such
germ-line mutant mice will result in the production of human
antibodies upon antigen challenge. See, e.g., Jakobovits et al.,
Proc. Natl. Acad. Sci. USA, 90:2551 (1993); Jakobovits et al.,
Nature, 362:255-258 (1993); Bruggemann et al., Year in Immuno. 7:33
(1993); U.S. Pat. Nos. 5,545,806, 5,569,825, 5,591,669 (all of
GenPharm); 5,545,807; and WO 97/17852.
[0134] Alternatively, phage display technology (McCafferty et al.,
Nature 348:552-553 [1990]) can be used to produce human antibodies
and antibody fragments in vitro, from immunoglobulin variable (V)
domain gene repertoires from unimmunized donors. According to this
technique, antibody V domain genes are cloned in-frame into either
a major or minor coat protein gene of a filamentous bacteriophage,
such as M13 or fd, and displayed as functional antibody fragments
on the surface of the phage particle. Because the filamentous
particle contains a single-stranded DNA copy of the phage genome,
selections based on the functional properties of the antibody also
result in selection of the gene encoding the antibody exhibiting
those properties. Thus, the phage mimics some of the properties of
the B-cell. Phage display can be performed in a variety of formats,
reviewed in, e.g., Johnson, Kevin S. and Chiswell, David J.,
Current Opinion in Structural Biology 3:564-571 (1993). Several
sources of V-gene segments can be used for phage display. Clackson
et al., Nature, 352:624-628 (1991) isolated a diverse array of
anti-oxazolone antibodies from a small random combinatorial library
of V genes derived from the spleens of immunized mice. A repertoire
of V genes from unimmunized human donors can be constructed and
antibodies to a diverse array of antigens (including self-antigens)
can be isolated essentially following the techniques described by
Marks et al., J. Mol. Biol. 222:581-597 (1991), or Griffith et al.,
EMBO J. 12:725-734 (1993). See, also, U.S. Pat. Nos. 5,565,332 and
5,573,905.
[0135] As discussed above, human antibodies may also be generated
by in vitro activated B cells (see U.S. Pat. Nos. 5,567,610 and
5,229,275).
[0136] 4. Antibody Fragments
[0137] In certain circumstances there are advantages of using
antibody fragments, rather than whole antibodies. The smaller size
of the fragments allows for rapid clearance, and may lead to
improved access to solid tumors.
[0138] Various techniques have been developed for the production of
antibody fragments. Traditionally, these fragments were derived via
proteolytic digestion of intact antibodies (see, e.g., Morimoto et
al., Journal of Biochemical and Biophysical Methods 24:107-117
(1992); and Brennan et al., Science, 229:81 (1985)). However, these
fragments can now be produced directly by recombinant host cells.
Fab, Fv and ScFv antibody fragments can all be expressed in and
secreted from E. coli, thus allowing the facile production of large
amounts of these fragments. Antibody fragments can be isolated from
the antibody phage libraries discussed above. Alternatively,
Fab'-SH fragments can be directly recovered from E. coli and
chemically coupled to form F(ab').sub.2 fragments (Carter et al.,
Bio/Technology 10:163-167 (1992)). According to another approach,
F(ab').sub.2 fragments can be isolated directly from recombinant
host cell culture. Fab and F(ab').sub.2 fragment with increased in
vivo half-life comprising a salvage receptor binding epitope
residues are described in U.S. Pat. No. 5,869,046. Other techniques
for the production of antibody fragments will be apparent to the
skilled practitioner. In other embodiments, the antibody of choice
is a single chain Fv fragment (scFv). See WO 93/16185; U.S. Pat.
No. 5,571,894; and U.S. Pat. No. 5,587,458. Fv and sFv are the only
species with intact combining sites that are devoid of constant
regions; thus, they are suitable for reduced nonspecific binding
during in vivo use. sFv fusion proteins may be constructed to yield
fusion of an effector protein at either the amino or the carboxy
terminus of an sFv. See Antibody Engineering, ed. Borrebaeck,
supra. The antibody fragment may also be a "linear antibody", e.g.,
as described in U.S. Pat. No. 5,641,870 for example. Such linear
antibody fragments may be monospecific or bispecific.
[0139] 5. Bispecific Antibodies
[0140] Bispecific antibodies are antibodies that have binding
specificities for at least two different epitopes. Exemplary
bispecific antibodies may bind to two different epitopes of a TAT
protein as described herein. Other such antibodies may combine a
TAT binding site with a binding site for another protein.
Alternatively, an anti-TAT arm may be combined with an arm which
binds to a triggering molecule on a leukocyte such as a T-cell
receptor molecule (e.g. CD3), or Fc receptors for IgG (Fc.gamma.R),
such as Fc.gamma.RI (CD64), Fc.gamma.RII (CD32) and Fc.gamma.RIII
(CD16), so as to focus and localize cellular defense mechanisms to
the TAT-expressing cell. Bispecific antibodies may also be used to
localize cytotoxic agents to cells which express TAT. These
antibodies possess a TAT-binding arm and an arm which binds the
cytotoxic agent (e.g., saporin, anti-interferon-.alpha., vinca
alkaloid, ricin A chain, methotrexate or radioactive isotope
hapten). Bispecific antibodies can be prepared as full length
antibodies or antibody fragments (e.g., F(ab').sub.2 bispecific
antibodies).
[0141] WO 96/16673 describes a bispecific
anti-ErbB2/anti-Fc.gamma.RIII antibody and U.S. Pat. No. 5,837,234
discloses a bispecific anti-ErbB2/anti-Fc.gamma.RI antibody. A
bispecific anti-ErbB2/Fc.alpha. antibody is shown in WO98/02463.
U.S. Pat. No. 5,821,337 teaches a bispecific anti-ErbB2/anti-CD3
antibody.
[0142] Methods for making bispecific antibodies are known in the
art. Traditional production of full length bispecific antibodies is
based on the co-expression of two immunoglobulin heavy chain-light
chain pairs, where the two chains have different specificities
(Millstein et al., Nature 305:537-539 (1983)). Because of the
random assortment of immunoglobulin heavy and light chains, these
hybridomas (quadromas) produce a potential mixture of 10 different
antibody molecules, of which only one has the correct bispecific
structure. Purification of the correct molecule, which is usually
done by affinity chromatography steps, is rather cumbersome, and
the product yields are low. Similar procedures are disclosed in WO
93/08829, and in Traunecker et al., EMBO J. 10:3655-3659
(1991).
[0143] According to a different approach, antibody variable domains
with the desired binding specificities (antibody-antigen combining
sites) are fused to immunoglobulin constant domain sequences.
Preferably, the fusion is with an Ig heavy chain constant domain,
comprising at least part of the hinge, C.sub.H2, and C.sub.H3
regions. It is preferred to have the first heavy-chain constant
region (C.sub.H1) containing the site necessary for light chain
bonding, present in at least one of the fusions. DNAs encoding the
immunoglobulin heavy chain fusions and, if desired, the
immunoglobulin light chain, are inserted into separate expression
vectors, and are co-transfected into a suitable host cell. This
provides for greater flexibility in adjusting the mutual
proportions of the three polypeptide fragments in embodiments when
unequal ratios of the three polypeptide chains used in the
construction provide the optimum yield of the desired bispecific
antibody. It is, however, possible to insert the coding sequences
for two or all three polypeptide chains into a single expression
vector when the expression of at least two polypeptide chains in
equal ratios results in high yields or when the ratios have no
significant affect on the yield of the desired chain
combination.
[0144] In a preferred embodiment of this approach, the bispecific
antibodies are composed of a hybrid immunoglobulin heavy chain with
a first binding specificity in one arm, and a hybrid immunoglobulin
heavy chain-light chain pair (providing a second binding
specificity) in the other arm. It was found that this asymmetric
structure facilitates the separation of the desired bispecific
compound from unwanted immunoglobulin chain combinations, as the
presence of an immunoglobulin light chain in only one half of the
bispecific molecule provides for a facile way of separation. This
approach is disclosed in WO 94/04690. For further details of
generating bispecific antibodies see, for example, Suresh et al.,
Methods in Enzymology 121:210 (1986).
[0145] According to another approach described in U.S. Pat. No.
5,731,168, the interface between a pair of antibody molecules can
be engineered to maximize the percentage of heterodimers which are
recovered from recombinant cell culture. The preferred interface
comprises at least a part of the C.sub.H3 domain. In this method,
one or more small amino acid side chains from the interface of the
first antibody molecule are replaced with larger side chains (e.g.,
tyrosine or tryptophan). Compensatory "cavities" of identical or
similar size to the large side chain(s) are created on the
interface of the second antibody molecule by replacing large amino
acid side chains with smaller ones (e.g., alanine or threonine).
This provides a mechanism for increasing the yield of the
heterodimer over other unwanted end-products such as
homodimers.
[0146] Bispecific antibodies include cross-linked or
"heteroconjugate" antibodies. For example, one of the antibodies in
the heteroconjugate can be coupled to avidin, the other to biotin.
Such antibodies have, for example, been proposed to target immune
system cells to unwanted cells (U.S. Pat. No. 4,676,980), and for
treatment of HIV infection (WO 91/00360, WO 92/200373, and EP
03089). Heteroconjugate antibodies may be made using any convenient
cross-linking methods. Suitable cross-linking agents are well known
in the art, and are disclosed in U.S. Pat. No. 4,676,980, along
with a number of cross-linking techniques.
[0147] Techniques for generating bispecific antibodies from
antibody fragments have also been described in the literature. For
example, bispecific antibodies can be prepared using chemical
linkage. Brennan et al., Science 229:81 (1985) describe a procedure
wherein intact antibodies are proteolytically cleaved to generate
F(ab').sub.2 fragments. These fragments are reduced in the presence
of the dithiol complexing agent, sodium arsenite, to stabilize
vicinal dithiols and prevent intermolecular disulfide formation.
The Fab' fragments generated are then converted to
thionitrobenzoate (TNB) derivatives. One of the Fab'-TNB
derivatives is then reconverted to the Fab'-thiol by reduction with
mercaptoethylamine and is mixed with an equimolar amount of the
other Fab'-TNB derivative to form the bispecific antibody. The
bispecific antibodies produced can be used as agents for the
selective immobilization of enzymes.
[0148] Recent progress has facilitated the direct recovery of
Fab'-SH fragments from E. coli, which can be chemically coupled to
form bispecific antibodies. Shalaby et al., J. Exp. Med. 175:
217-225 (1992) describe the production of a fully humanized
bispecific antibody F(ab').sub.2 molecule. Each Fab' fragment was
separately secreted from E. coli and subjected to directed chemical
coupling in vitro to form the bispecific antibody. The bispecific
antibody thus formed was able to bind to cells overexpressing the
ErbB2 receptor and normal human T cells, as well as trigger the
lytic activity of human cytotoxic lymphocytes against human breast
tumor targets. Various techniques for making and isolating
bispecific antibody fragments directly from recombinant cell
culture have also been described. For example, bispecific
antibodies have been produced using leucine zippers. Kostelny et
al., J. Immunol. 148(5):1547-1553 (1992). The leucine zipper
peptides from the Fos and Jun proteins were linked to the Fab'
portions of two different antibodies by gene fusion. The antibody
homodimers were reduced at the hinge region to form monomers and
then re-oxidized to form the antibody heterodimers. This method can
also be utilized for the production of antibody homodimers. The
"diabody" technology described by Hollinger et al., Proc. Natl.
Acad. Sci. USA 90:6444-6448 (1993) has provided an alternative
mechanism for making bispecific antibody fragments. The fragments
comprise a V.sub.H connected to a V.sub.L by a linker which is too
short to allow pairing between the two domains on the same chain.
Accordingly, the V.sub.H and V.sub.L domains of one fragment are
forced to pair with the complementary V.sub.L and V.sub.H domains
of another fragment, thereby forming two antigen-binding sites.
Another strategy for making bispecific antibody fragments by the
use of single-chain Fv (sFv) dimers has also been reported. See
Gruber et al., J. Immunol., 152:5368 (1994).
[0149] Antibodies with more than two valencies are contemplated.
For example, trispecific antibodies can be prepared. Tutt et al.,
J. Immunol. 147:60 (1991).
[0150] 6. Heteroconjugate Antibodies
[0151] Heteroconjugate antibodies are also within the scope of the
present invention. Heteroconjugate antibodies are composed of two
covalently joined antibodies. Such antibodies have, for example,
been proposed to target immune system cells to unwanted cells [U.S.
Pat. No. 4,676,980], and for treatment of HIV infection [WO
91/00360; WO 92/200373; EP 03089]. It is contemplated that the
antibodies may be prepared in vitro using known methods in
synthetic protein chemistry, including those involving crosslinking
agents. For example, immunotoxins may be constructed using a
disulfide exchange reaction or by forming a thioether bond.
Examples of suitable reagents for this purpose include
iminothiolate and methyl-4-mercaptobutyrimidate and those
disclosed, for example, in U.S. Pat. No. 4,676,980.
[0152] 7. Multivalent Antibodies
[0153] A multivalent antibody may be internalized (and/or
catabolized) faster than a bivalent antibody by a cell expressing
an antigen to which the antibodies bind. The antibodies of the
present invention can be multivalent antibodies (which are other
than of the IgM class) with three or more antigen binding sites
(e.g. tetravalent antibodies), which can be readily produced by
recombinant expression of nucleic acid encoding the polypeptide
chains of the antibody. The multivalent antibody can comprise a
dimerization domain and three or more antigen binding sites. The
preferred dimerization domain comprises (or consists of) an Fc
region or a hinge region. In this scenario, the antibody will
comprise an Fc region and three or more antigen binding sites
amino-terminal to the Fc region. The preferred multivalent antibody
herein comprises (or consists of) three to about eight, but
preferably four, antigen binding sites. The multivalent antibody
comprises at least one polypeptide chain (and preferably two
polypeptide chains), wherein the polypeptide chain(s) comprise two
or more variable domains. For instance, the polypeptide chain(s)
may comprise VD1-(X1).sub.n-VD2-(X2).sub.n-Fc, wherein VD1 is a
first variable domain, VD2 is a second variable domain, Fc is one
polypeptide chain of an Fc region, X1 and X2 represent an amino
acid or polypeptide, and n is 0 or 1. For instance, the polypeptide
chain(s) may comprise: VH-CH1-flexible linker-VH-CH1-Fc region
chain; or VH-CH1-VH-CH1-Fc region chain. The multivalent antibody
herein preferably further comprises at least two (and preferably
four) light chain variable domain polypeptides. The multivalent
antibody herein may, for instance, comprise from about two to about
eight light chain variable domain polypeptides. The light chain
variable domain polypeptides contemplated here comprise a light
chain variable domain and, optionally, further comprise a CL
domain.
[0154] 8. Effector Function Engineering
[0155] It may be desirable to modify the antibody of the invention
with respect to effector function, e.g., so as to enhance
antigen-dependent cell-mediated cyotoxicity (ADCC) and/or
complement dependent cytotoxicity (CDC) of the antibody. This may
be achieved by introducing one or more amino acid substitutions in
an Fc region of the antibody. Alternatively or additionally,
cysteine residue(s) may be introduced in the Fc region, thereby
allowing interchain disulfide bond formation in this region. The
homodimeric antibody thus generated may have improved
internalization capability and/or increased complement-mediated
cell killing and antibody-dependent cellular cytotoxicity (ADCC).
See Caron et al., J. Exp Med. 176:1191-1195 (1992) and Shopes, B.
J. Immunol. 148:2918-2922 (1992). Homodimeric antibodies with
enhanced anti-tumor activity may also be prepared using
heterobifunctional cross-linkers as described in Wolff et al.,
Cancer Research 53:2560-2565 (1993). Alternatively, an antibody can
be engineered which has dual Fc regions and may thereby have
enhanced complement lysis and ADCC capabilities. See Stevenson et
al., Anti-Cancer Drug Design 3:219-230 (1989). To increase the
serum half life of the antibody, one may incorporate a salvage
receptor binding epitope into the antibody (especially an antibody
fragment) as described in U.S. Pat. No. 5,739,277, for example. As
used herein, the term "salvage receptor binding epitope" refers to
an epitope of the Fc region of an IgG molecule (e.g., IgG.sub.1,
IgG.sub.2, IgG.sub.3, or IgG.sub.4) that is responsible for
increasing the in vivo serum half-life of the IgG molecule.
[0156] 9. Immunoconjugates
[0157] The invention also pertains to immunoconjugates comprising
an antibody conjugated to a cytotoxic agent such as a
chemotherapeutic agent, a growth inhibitory agent, a toxin (e.g.,
an enzymatically active toxin of bacterial, fungal, plant, or
animal origin, or fragments thereof), or a radioactive isotope
(i.e., a radioconjugate).
[0158] Chemotherapeutic agents useful in the generation of such
immunoconjugates have been described above. Enzymatically active
toxins and fragments thereof that can be used include diphtheria A
chain, nonbinding active fragments of diphtheria toxin, exotoxin A
chain (from Pseudomonas aeruginosa), ricin A chain, abrin A chain,
modeccin A chain, alpha-sarcin, Aleurites fordii proteins, dianthin
proteins, Phytolaca americana proteins (PAPI, PAPII, and PAP-S),
momordica charantia inhibitor, curcin, crotin, sapaonaria
officinalis inhibitor, gelonin, mitogellin, restrictocin,
phenomycin, enomycin, and the tricothecenes. A variety of
radionuclides are available for the production of radioconjugated
antibodies. Examples include .sup.212Bi, .sup.131I, .sup.131In,
.sup.90Y, and .sup.186Re.
[0159] Conjugates of the antibody and cytotoxic agent are made
using a variety of bifunctional protein-coupling agents such as
N-succinimidyl-3-(2-pyridyldithiol) propionate (SPDP),
iminothiolane (IT), bifunctional derivatives of imidoesters (such
as dimethyl adipimidate HCL), active esters (such as disuccinimidyl
suberate), aldehydes (such as glutareldehyde), bis-azido compounds
(such as bis(p-azidobenzoyl) hexanediamine), bis-diazonium
derivatives (such as bis-(p-diazoniumbenzoyl)-ethylenediamine),
diisocyanates (such as tolyene 2,6-diisocyanate), and bis-active
fluorine compounds (such as 1,5-difluoro-2,4-dinitrobenzene). For
example, a ricin immunotoxin can be prepared as described in
Vitetta et al., Science, 238: 1098 (1987). Carbon-14-labeled
1-isothiocyanatobenzyl-3-methyldiethylene triaminepentaacetic acid
(MX-DTPA) is an exemplary chelating agent for conjugation of
radionucleotide to the antibody. See WO94/11026.
[0160] Conjugates of an antibody and one or more small molecule
toxins, such as a calicheamicin, maytansinoids, a trichothene, and
CC1065, and the derivatives of these toxins that have toxin
activity, are also contemplated herein.
Maytansine and maytansinoids
[0161] In one preferred embodiment, an anti-TAT antibody (full
length or fragments) of the invention is conjugated to one or more
maytansinoid molecules.
[0162] Maytansinoids are mitototic inhibitors which act by
inhibiting tubulin polymerization. Maytansine was first isolated
from the east African shrub Maytenus serrata (U.S. Pat. No.
3,896,111). Subsequently, it was discovered that certain microbes
also produce maytansinoids, such as maytansinol and C-3 maytansinol
esters (U.S. Pat. No. 4,151,042). Synthetic maytansinol and
derivatives and analogues thereof are disclosed, for example, in
U.S. Pat. Nos. 4,137,230; 4,248,870; 4,256,746; 4,260,608;
4,265,814; 4,294,757; 4,307,016; 4,308,268; 4,308,269; 4,309,428;
4,313,946; 4,315,929; 4,317,821; 4,322,348; 4,331,598; 4,361,650;
4,364,866; 4,424,219; 4,450,254; 4,362,663; and 4,371,533, the
disclosures of which are hereby expressly incorporated by
reference.
Maytansinoid-Antibody Conjugates
[0163] In an attempt to improve their therapeutic index, maytansine
and maytansinoids have been conjugated to antibodies specifically
binding to tumor cell antigens. Immunoconjugates containing
maytansinoids and their therapeutic use are disclosed, for example,
in U.S. Pat. Nos. 5,208,020, 5,416,064 and European Patent EP 0 425
235 B1, the disclosures of which are hereby expressly incorporated
by reference. Liu et al., Proc. Natl. Acad. Sci. USA 93:8618-8623
(1996) described immunoconjugates comprising a maytansinoid
designated DM1 linked to the monoclonal antibody C242 directed
against human colorectal cancer. The conjugate was found to be
highly cytotoxic towards cultured colon cancer cells, and showed
antitumor activity in an in vivo tumor growth assay. Chari et al.,
Cancer Research 52:127-131 (1992) describe immunoconjugates in
which a maytansinoid was conjugated via a disulfide linker to the
murine antibody A7 binding to an antigen on human colon cancer cell
lines, or to another murine monoclonal antibody TA.1 that binds the
HER-2/neu oncogene. The cytotoxicity of the TA.1-maytansonoid
conjugate was tested in vitro on the human breast cancer cell line
SK-BR-3, which expresses 3.times.10.sup.5 HER-2 surface antigens
per cell. The drug conjugate achieved a degree of cytotoxicity
similar to the free maytansonid drug, which could be increased by
increasing the number of maytansinoid molecules per antibody
molecule. The A7-maytansinoid conjugate showed low systemic
cytotoxicity in mice.
Anti-TAT Polypeptide Antibody-Maytansinoid Conjugates
(Immunoconjugates)
[0164] Anti-TAT antibody-maytansinoid conjugates are prepared by
chemically linking an anti-TAT antibody to a maytansinoid molecule
without significantly diminishing the biological activity of either
the antibody or the maytansinoid molecule. An average of 3-4
maytansinoid molecules conjugated per antibody molecule has shown
efficacy in enhancing cytotoxicity of target cells without
negatively affecting the function or solubility of the antibody,
although even one molecule of toxin/antibody would be expected to
enhance cytotoxicity over the use of naked antibody. Maytansinoids
are well known in the art and can be synthesized by known
techniques or isolated from natural sources. Suitable maytansinoids
are disclosed, for example, in U.S. Pat. No. 5,208,020 and in the
other patents and nonpatent publications referred to hereinabove.
Preferred maytansinoids are maytansinol and maytansinol analogues
modified in the aromatic ring or at other positions of the
maytansinol molecule, such as various maytansinol esters.
[0165] There are many linking groups known in the art for making
antibody-maytansinoid conjugates, including, for example, those
disclosed in U.S. Pat. No. 5,208,020 or EP Patent 0 425 235 B1, and
Chari et al., Cancer Research 52:127-131 (1992). The linking groups
include disulfide groups, thioether groups, acid labile groups,
photolabile groups, peptidase labile groups, or esterase labile
groups, as disclosed in the above-identified patents, disulfide and
thioether groups being preferred.
[0166] Conjugates of the antibody and maytansinoid may be made
using a variety of bifunctional protein coupling agents such as
N-succinimidyl-3-(2-pyridyldithio)propionate (SPDP),
succinimidyl-4-(N-maleimidomethyl) cyclohexane-1-carboxylate,
iminothiolane (IT), bifunctional derivatives of imidoesters (such
as dimethyl adipimidate HCL), active esters (such as disuccinimidyl
suberate), aldehydes (such as glutareldehyde), bis-azido compounds
(such as bis(p-azidobenzoyl) hexanediamine), bis-diazonium
derivatives (such as bis-(p-diazoniumbenzoyl)-ethylenediamine),
diisocyanates (such as toluene 2,6-diisocyanate), and bis-active
fluorine compounds (such as 1,5-difluoro-2,4-dinitrobenzene).
Particularly preferred coupling agents include
N-succinimidyl-3-(2-pyridyldithio)propionate (SPDP) (Carlsson et
al., Biochem. J. 173:723-737 [1978]) and
N-succinimidyl-4-(2-pyridylthio)pentanoate (SPP) to provide for a
disulfide linkage.
[0167] The linker may be attached to the maytansinoid molecule at
various positions, depending on the type of the link. For example,
an ester linkage may be formed by reaction with a hydroxyl group
using conventional coupling techniques. The reaction may occur at
the C-3 position having a hydroxyl group, the C-14 position
modified with hyrdoxymethyl, the C-15 position modified with a
hydroxyl group, and the C-20 position having a hydroxyl group. In a
preferred embodiment, the linkage is formed at the C-3 position of
maytansinol or a maytansinol analogue.
Calicheamicin
[0168] Another immunoconjugate of interest comprises an anti-TAT
antibody conjugated to one or more calicheamicin molecules. The
calicheamicin family of antibiotics are capable of producing
double-stranded DNA breaks at sub-picomolar concentrations. For the
preparation of conjugates of the calicheamicin family, see U.S.
Pat. Nos. 5,712,374, 5,714,586, 5,739,116, 5,767,285, 5,770,701,
5,770,710, 5,773,001, 5,877,296 (all to American Cyanamid Company).
Structural analogues of calicheamicin which may be used include,
but are not limited to, .gamma..sub.1.sup.I, .alpha..sub.2.sup.I,
.alpha..sub.3.sup.I, N-acetyl-.gamma..sub.1.sup.I, PSAG and
.theta..sup.I.sub.1 (Hinman et al., Cancer Research 53:3336-3342
(1993), Lode et al., Cancer Research 58:2925-2928 (1998) and the
aforementioned U.S. patents to American Cyanamid). Another
anti-tumor drug that the antibody can be conjugated is QFA which is
an antifolate. Both calicheamicin and QFA have intracellular sites
of action and do not readily cross the plasma membrane. Therefore,
cellular uptake of these agents through antibody mediated
internalization greatly enhances their cytotoxic effects.
Other Cytotoxic Agents
[0169] Other antitumor agents that can be conjugated to the
anti-TAT antibodies of the invention include BCNU, streptozoicin,
vincristine and 5-fluorouracil, the family of agents known
collectively LL-E33288 complex described in U.S. Pat. Nos.
5,053,394, 5,770,710, as well as esperamicins (U.S. Pat. No.
5,877,296).
[0170] Enzymatically active toxins and fragments thereof which can
be used include diphtheria A chain, nonbinding active fragments of
diphtheria toxin, exotoxin A chain (from Pseudomonas aeruginosa),
ricin A chain, abrin A chain, modeccin A chain, alpha-sarcin,
Aleurites fordii proteins, dianthin proteins, Phytolaca americana
proteins (PAPI, PAPII, and PAP-S), momordica charantia inhibitor,
curcin, crotin, sapaonaria officinalis inhibitor, gelonin,
mitogellin, restrictocin, phenomycin, enomycin and the
tricothecenes. See, for example, WO 93/21232 published Oct. 28,
1993.
[0171] The present invention further contemplates an
immunoconjugate formed between an antibody and a compound with
nucleolytic activity (e.g., a ribonuclease or a DNA endonuclease
such as a deoxyribonuclease; DNase).
[0172] For selective destruction of the tumor, the antibody may
comprise a highly radioactive atom. A variety of radioactive
isotopes are available for the production of radioconjugated
anti-TAT antibodies. Examples include At.sup.211, I.sup.131,
I.sup.125, Y.sup.90, Re.sup.186, Re.sup.188, Sm.sup.153,
Bi.sup.212, P.sup.32, Pb.sup.212 and radioactive isotopes of Lu.
When the conjugate is used for diagnosis, it may comprise a
radioactive atom for scintigraphic studies, for example tc.sup.99m
or I.sup.123, or a spin label for nuclear magnetic resonance (NMR)
imaging (also known as magnetic resonance imaging, mri), such as
iodine-123 again, iodine-131, indium-111, fluorine-19, carbon-13,
nitrogen-15, oxygen-17, gadolinium, manganese or iron.
[0173] The radio- or other labels may be incorporated in the
conjugate in known ways. For example, the peptide may be
biosynthesized or may be synthesized by chemical amino acid
synthesis using suitable amino acid precursors involving, for
example, fluorine-19 in place of hydrogen. Labels such as
tc.sup.99m or I.sup.123, Re.sup.186, Re.sup.188 and In.sup.111 can
be attached via a cysteine residue in the peptide. Yttrium-90 can
be attached via a lysine residue. The IODOGEN method (Fraker et al
(1978) Biochem. Biophys. Res. Commun. 80: 49-57 can be used to
incorporate iodine-123. "Monoclonal Antibodies in
Immunoscintigraphy" (Chatal, CRC Press 1989) describes other
methods in detail.
[0174] Conjugates of the antibody and cytotoxic agent may be made
using a variety of bifunctional protein coupling agents such as
N-succinimidyl-3-(2-pyridyldithio)propionate (SPDP),
succinimidyl-4-(N-maleimidomethyl) cyclohexane-1-carboxylate,
iminothiolane (IT), bifunctional derivatives of imidoesters (such
as dimethyl adipimidate HCL), active esters (such as disuccinimidyl
suberate), aldehydes (such as glutareldehyde), bis-azido compounds
(such as bis(p-azidobenzoyl) hexanediamine), bis-diazonium
derivatives (such as bis-(p-diazoniumbenzoyl)-ethylenediamine),
diisocyanates (such as tolyene 2,6-diisocyanate), and bis-active
fluorine compounds (such as 1,5-difluoro-2,4-dinitrobenzene). For
example, a ricin immunotoxin can be prepared as described in
Vitetta et al., Science 238:1098 (1987). Carbon-14-labeled
1-isothiocyanatobenzyl-3-methyldiethylene triaminepentaacetic acid
(MX-DTPA) is an exemplary chelating agent for conjugation of
radionucleotide to the antibody. See WO94/11026. The linker may be
a "cleavable linker" facilitating release of the cytotoxic drug in
the cell. For example, an acid-labile linker, peptidase-sensitive
linker, photolabile linker, dimethyl linker or disulfide-containing
linker (Chari et al., Cancer Research 52:127-131 (1992); U.S. Pat.
No. 5,208,020) may be used.
[0175] Alternatively, a fusion protein comprising the anti-TAT
antibody and cytotoxic agent may be made, e.g., by recombinant
techniques or peptide synthesis. The length of DNA may comprise
respective regions encoding the two portions of the conjugate
either adjacent one another or separated by a region encoding a
linker peptide which does not destroy the desired properties of the
conjugate.
[0176] In yet another embodiment, the antibody may be conjugated to
a "receptor" (such streptavidin) for utilization in tumor
pre-targeting wherein the antibody-receptor conjugate is
administered to the patient, followed by removal of unbound
conjugate from the circulation using a clearing agent and then
administration of a "ligand" (e.g., avidin) which is conjugated to
a cytotoxic agent (e.g., a radionucleotide).
[0177] 10. Immunoliposomes
[0178] The anti-TAT antibodies disclosed herein may also be
formulated as immunoliposomes. A "liposome" is a small vesicle
composed of various types of lipids, phospholipids and/or
surfactant which is useful for delivery of a drug to a mammal. The
components of the liposome are commonly arranged in a bilayer
formation, similar to the lipid arrangement of biological
membranes. Liposomes containing the antibody are prepared by
methods known in the art, such as described in Epstein et al.,
Proc. Natl. Acad. Sci. USA 82:3688 (1985); Hwang et al., Proc.
Natl. Acad. Sci. USA 77:4030 (1980); U.S. Pat. Nos. 4,485,045 and
4,544,545; and WO97/38731 published Oct. 23, 1997. Liposomes with
enhanced circulation time are disclosed in U.S. Pat. No.
5,013,556.
[0179] Particularly useful liposomes can be generated by the
reverse phase evaporation method with a lipid composition
comprising phosphatidylcholine, cholesterol and PEG-derivatized
phosphatidylethanolamine (PEG-PE). Liposomes are extruded through
filters of defined pore size to yield liposomes with the desired
diameter. Fab' fragments of the antibody of the present invention
can be conjugated to the liposomes as described in Martin et al.,
J. Biol. Chem. 257:286-288 (1982) via a disulfide interchange
reaction. A chemotherapeutic agent is optionally contained within
the liposome. See Gabizon et al., J. National Cancer Inst.
81(19):1484 (1989).
[0180] B. Screening for Antibodies with the Desired Properties
[0181] Techniques for generating antibodies have been described
above. One may further select antibodies with certain biological
characteristics, as desired.
[0182] The growth inhibitory effects of an anti-TAT antibody of the
invention may be assessed by methods known in the art, e.g., using
cells which express a TAT polypeptide either endogenously or
following transfection with the TAT gene. For example, appropriate
tumor cell lines and TAT-transfected cells may treated with an
anti-TAT monoclonal antibody of the invention at various
concentrations for a few days (e.g., 2-7) days and stained with
crystal violet or MTT or analyzed by some other colorimetric assay.
Another method of measuring proliferation would be by comparing
.sup.3H-thymidine uptake by the cells treated in the presence or
absence an anti-TAT antibody of the invention. After antibody
treatment, the cells are harvested and the amount of radioactivity
incorporated into the DNA quantitated in a scintillation counter.
Appropriate positive controls include treatment of a selected cell
line with a growth inhibitory antibody known to inhibit growth of
that cell line. Growth inhibition of tumor cells in vivo can be
determined in various ways known in the art. Preferably, the tumor
cell is one that overexpresses a TAT polypeptide. Preferably, the
anti-TAT antibody will inhibit cell proliferation of a
TAT-expressing tumor cell in vitro or in vivo by about 25-100%
compared to the untreated tumor cell, more preferably, by about
30-100%, and even more preferably by about 50-100% or 70-100%, at
an antibody concentration of about 0.5 to 30 .mu.g/ml. Growth
inhibition can be measured at an antibody concentration of about
0.5 to 30 .mu.g/ml or about 0.5 nM to 200 nM in cell culture, where
the growth inhibition is determined 1-10 days after exposure of the
tumor cells to the antibody. The antibody is growth inhibitory in
vivo if administration of the anti-TAT antibody at about 1 .mu.g/kg
to about 100 mg/kg body weight results in reduction in tumor size
or reduction of tumor cell proliferation within about 5 days to 3
months from the first administration of the antibody, preferably
within about 5 to 30 days.
[0183] To select for antibodies which induce cell death, loss of
membrane integrity as indicated by, e.g., propidium iodide (PI),
trypan blue or 7AAD uptake may be assessed relative to control. A
PI uptake assay can be performed in the absence of complement and
immune effector cells. TAT polypeptide-expressing tumor cells are
incubated with medium alone or medium containing of the appropriate
monoclonal antibody at e.g, about 10 .mu.g/ml. The cells are
incubated for a 3 day time period. Following each treatment, cells
are washed and aliquoted into 35 mm strainer-capped 12.times.75
tubes (1 ml per tube, 3 tubes per treatment group) for removal of
cell clumps. Tubes then receive PI (10 .mu.g/ml). Samples may be
analyzed using a FACSCAN.RTM. flow cytometer and FACSCONVERT.RTM.
CellQuest software (Becton Dickinson). Those antibodies which
induce statistically significant levels of cell death as determined
by PI uptake may be selected as cell death-inducing antibodies.
[0184] To screen for antibodies which bind to an epitope on a TAT
polypeptide bound by an antibody of interest, a routine
cross-blocking assay such as that described in Antibodies A
Laboratory Manual, Cold Spring Harbor Laboratory, Ed Harlow and
David Lane (1988), can be performed. This assay can be used to
determine if a test antibody binds the same site or epitope as an
anti-TAT antibody of the invention. Alternatively, or additionally,
epitope mapping can be performed by methods known in the art. For
example, the antibody sequence can be mutagenized such as by
alanine scanning, to identify contact residues. The mutant antibody
is initially tested for binding with polyclonal antibody to ensure
proper folding. In a different method, peptides corresponding to
different regions of a TAT polypeptide can be used in competition
assays with the test antibodies or with a test antibody and an
antibody with a characterized or known epitope.
[0185] C. Antibody Dependent Enzyme Mediated Prodrug Therapy
(ADEPT)
[0186] The antibodies of the present invention may also be used in
ADEPT by conjugating the antibody to a prodrug-activating enzyme
which converts a prodrug (e.g., a peptidyl chemotherapeutic agent,
see WO81/01145) to an active anti-cancer drug. See, for example, WO
88/07378 and U.S. Pat. No. 4,975,278.
[0187] The enzyme component of the immunoconjugate useful for ADEPT
includes any enzyme capable of acting on a prodrug in such a way so
as to covert it into its more active, cytotoxic form.
[0188] Enzymes that are useful in the method of this invention
include, but are not limited to, alkaline phosphatase useful for
converting phosphate-containing prodrugs into free drugs;
arylsulfatase useful for converting sulfate-containing prodrugs
into free drugs; cytosine deaminase useful for converting non-toxic
5-fluorocytosine into the anti-cancer drug, 5-fluorouracil;
proteases, such as serratia protease, thermolysin, subtilisin,
carboxypeptidases and cathepsins (such as cathepsins B and L), that
are useful for converting peptide-containing prodrugs into free
drugs; D-alanylcarboxypeptidases, useful for converting prodrugs
that contain D-amino acid substituents; carbohydrate-cleaving
enzymes such as .beta.-galactosidase and neuraminidase useful for
converting glycosylated prodrugs into free drugs; .beta.-lactamase
useful for converting drugs derivatized with .beta.-lactams into
free drugs; and penicillin amidases, such as penicillin V amidase
or penicillin G amidase, useful for converting drugs derivatized at
their amine nitrogens with phenoxyacetyl or phenylacetyl groups,
respectively, into free drugs. Alternatively, antibodies with
enzymatic activity, also known in the art as "abzymes", can be used
to convert the prodrugs of the invention into free active drugs
(see, e.g., Massey, Nature 328:457-458 (1987)). Antibody-abzyme
conjugates can be prepared as described herein for delivery of the
abzyme to a tumor cell population.
[0189] The enzymes of this invention can be covalently bound to the
anti-TAT antibodies by techniques well known in the art such as the
use of the heterobifunctional crosslinking reagents discussed
above. Alternatively, fusion proteins comprising at least the
antigen binding region of an antibody of the invention linked to at
least a functionally active portion of an enzyme of the invention
can be constructed using recombinant DNA techniques well known in
the art (see, e.g., Neuberger et al., Nature 312:604-608
(1984).
[0190] D. Full-Length TAT Polypeptides
[0191] The present invention also provides newly identified and
isolated nucleotide sequences encoding polypeptides referred to in
the present application as TAT polypeptides. In particular, cDNAs
(partial and full-length) encoding various TAT polypeptides have
been identified and isolated, as disclosed in further detail in the
Examples below.
[0192] As disclosed in the Examples below, various cDNA clones have
been deposited with the ATCC. The actual nucleotide sequences of
those clones can readily be determined by the skilled artisan by
sequencing of the deposited clone using routine methods in the art.
The predicted amino acid sequence can be determined from the
nucleotide sequence using routine skill. For the TAT polypeptides
and encoding nucleic acids described herein, in some cases,
Applicants have identified what is believed to be the reading frame
best identifiable with the sequence information available at the
time.
[0193] E. Anti-TAT Antibody and TAT Polypeptide Variants
[0194] In addition to the anti-TAT antibodies and full-length
native sequence TAT polypeptides described herein, it is
contemplated that anti-TAT antibody and TAT polypeptide variants
can be prepared. Anti-TAT antibody and TAT polypeptide variants can
be prepared by introducing appropriate nucleotide changes into the
encoding DNA, and/or by synthesis of the desired antibody or
polypeptide. Those skilled in the art will appreciate that amino
acid changes may alter post-translational processes of the anti-TAT
antibody or TAT polypeptide, such as changing the number or
position of glycosylation sites or altering the membrane anchoring
characteristics.
[0195] Variations in the anti-TAT antibodies and TAT polypeptides
described herein, can be made, for example, using any of the
techniques and guidelines for conservative and non-conservative
mutations set forth, for instance, in U.S. Pat. No. 5,364,934.
Variations may be a substitution, deletion or insertion of one or
more codons encoding the antibody or polypeptide that results in a
change in the amino acid sequence as compared with the native
sequence antibody or polypeptide. Optionally the variation is by
substitution of at least one amino acid with any other amino acid
in one or more of the domains of the anti-TAT antibody or TAT
polypeptide. Guidance in determining which amino acid residue may
be inserted, substituted or deleted without adversely affecting the
desired activity may be found by comparing the sequence of the
anti-TAT antibody or TAT polypeptide with that of homologous known
protein molecules and minimizing the number of amino acid sequence
changes made in regions of high homology. Amino acid substitutions
can be the result of replacing one amino acid with another amino
acid having similar structural and/or chemical properties, such as
the replacement of a leucine with a serine, i.e., conservative
amino acid replacements. Insertions or deletions may optionally be
in the range of about 1 to 5 amino acids. The variation allowed may
be determined by systematically making insertions, deletions or
substitutions of amino acids in the sequence and testing the
resulting variants for activity exhibited by the full-length or
mature native sequence.
[0196] Anti-TAT antibody and TAT polypeptide fragments are provided
herein. Such fragments may be truncated at the N-terminus or
C-terminus, or may lack internal residues, for example, when
compared with a full length native antibody or protein. Certain
fragments lack amino acid residues that are not essential for a
desired biological activity of the anti-TAT antibody or TAT
polypeptide.
[0197] Anti-TAT antibody and TAT polypeptide fragments may be
prepared by any of a number of conventional techniques. Desired
peptide fragments may be chemically synthesized. An alternative
approach involves generating antibody or polypeptide fragments by
enzymatic digestion, e.g., by treating the protein with an enzyme
known to cleave proteins at sites defined by particular amino acid
residues, or by digesting the DNA with suitable restriction enzymes
and isolating the desired fragment. Yet another suitable technique
involves isolating and amplifying a DNA fragment encoding a desired
antibody or polypeptide fragment, by polymerase chain reaction
(PCR). Oligonucleotides that define the desired termini of the DNA
fragment are employed at the 5' and 3' primers in the PCR.
Preferably, anti-TAT antibody and TAT polypeptide fragments share
at least one biological and/or immunological activity with the
native anti-TAT antibody or TAT polypeptide disclosed herein.
[0198] In particular embodiments, conservative substitutions of
interest are shown in Table 6 under the heading of preferred
substitutions. If such substitutions result in a change in
biological activity, then more substantial changes, denominated
exemplary substitutions in Table 6, or as further described below
in reference to amino acid classes, are introduced and the products
screened. TABLE-US-00005 TABLE 6 Original Exemplary Preferred
Residue Substitutions Substitutions Ala (A) val; leu; ile val Arg
(R) lys; gln; asn lys Asn (N) gln; his; lys; arg gln Asp (D) glu
glu Cys (C) ser ser Gln (Q) asn asn Glu (E) asp asp Gly (G) pro;
ala ala His (H) asn; gln; lys; arg arg Ile (I) leu; val; met; ala;
phe; leu norleucine Leu (L) norleucine; ile; val; met; ile ala; phe
Lys (K) arg; gln; asn arg Met (M) leu; phe; ile leu Phe (F) leu;
val; ile; ala; tyr leu Pro (P) ala ala Ser (S) thr thr Thr (T) ser
ser Trp (W) tyr; phe tyr Tyr (Y) trp; phe; thr; ser phe Val (V)
ile; leu; met; phe; leu ala; norleucine
[0199] Substantial modifications in function or immunological
identity of the anti-TAT antibody or TAT polypeptide are
accomplished by selecting substitutions that differ significantly
in their effect on maintaining (a) the structure of the polypeptide
backbone in the area of the substitution, for example, as a sheet
or helical conformation, (b) the charge or hydrophobicity of the
molecule at the target site, or (c) the bulk of the side chain.
Naturally occurring residues are divided into groups based on
common side-chain properties:
(1) hydrophobic: norleucine, met, ala, val, leu, ile;
(2) neutral hydrophilic: cys, ser, thr;
(3) acidic: asp, glu;
(4) basic: asn, gln, his, lys, arg;
(5) residues that influence chain orientation: gly, pro; and
(6) aromatic: trp, tyr, phe.
[0200] Non-conservative substitutions will entail exchanging a
member of one of these classes for another class. Such substituted
residues also may be introduced into the conservative substitution
sites or, more preferably, into the remaining (non-conserved)
sites.
[0201] The variations can be made using methods known in the art
such as oligonucleotide-mediated (site-directed) mutagenesis,
alanine scanning, and PCR mutagenesis. Site-directed mutagenesis
[Carter et al., Nucl. Acids Res., 13:4331 (1986); Zoller et al.,
Nucl. Acids Res., 10:6487 (1987)], cassette mutagenesis [Wells et
al., Gene, 34:315 (1985)], restriction selection mutagenesis [Wells
et al., Philos. Trans. R. Soc. London SerA, 317:415 (1986)] or
other known techniques can be performed on the cloned DNA to
produce the anti-TAT antibody or TAT polypeptide variant DNA.
[0202] Scanning amino acid analysis can also be employed to
identify one or more amino acids along a contiguous sequence. Among
the preferred scanning amino acids are relatively small, neutral
amino acids. Such amino acids include alanine, glycine, serine, and
cysteine. Alanine is typically a preferred scanning amino acid
among this group because it eliminates the side-chain beyond the
beta-carbon and is less likely to alter the main-chain conformation
of the variant [Cunningham and Wells, Science, 244:1081-1085
(1989)]. Alanine is also typically preferred because it is the most
common amino acid. Further, it is frequently found in both buried
and exposed positions [Creighton, The Proteins, (W.H. Freeman &
Co., N.Y.); Chothia, J. Mol. Biol., 150:1 (1976)]. If alanine
substitution does not yield adequate amounts of variant, an
isoteric amino acid can be used.
[0203] Any cysteine residue not involved in maintaining the proper
conformation of the anti-TAT antibody or TAT polypeptide also may
be substituted, generally with serine, to improve the oxidative
stability of the molecule and prevent aberrant crosslinking.
Conversely, cysteine bond(s) may be added to the anti-TAT antibody
or TAT polypeptide to improve its stability (particularly where the
antibody is an antibody fragment such as an Fv fragment).
[0204] A particularly preferred type of substitutional variant
involves substituting one or more hypervariable region residues of
a parent antibody (e.g., a humanized or human antibody). Generally,
the resulting variant(s) selected for further development will have
improved biological properties relative to the parent antibody from
which they are generated. A convenient way for generating such
substitutional variants involves affinity maturation using phage
display. Briefly, several hypervariable region sites (e.g., 6-7
sites) are mutated to generate all possible amino substitutions at
each site. The antibody variants thus generated are displayed in a
monovalent fashion from filamentous phage particles as fusions to
the gene III product of M13 packaged within each particle. The
phage-displayed variants are then screened for their biological
activity (e.g., binding affinity) as herein disclosed. In order to
identify candidate hypervariable region sites for modification,
alanine scanning mutagenesis can be performed to identify
hypervariable region residues contributing significantly to antigen
binding. Alternatively, or additionally, it may be beneficial to
analyze a crystal structure of the antigen-antibody complex to
identify contact points between the antibody and human TAT
polypeptide. Such contact residues and neighboring residues are
candidates for substitution according to the techniques elaborated
herein. Once such variants are generated, the panel of variants is
subjected to screening as described herein and antibodies with
superior properties in one or more relevant assays may be selected
for further development.
[0205] Nucleic acid molecules encoding amino acid sequence variants
of the anti-TAT antibody are prepared by a variety of methods known
in the art. These methods include, but are not limited to,
isolation from a natural source (in the case of naturally occurring
amino acid sequence variants) or preparation by
oligonucleotide-mediated (or site-directed) mutagenesis, PCR
mutagenesis, and cassette mutagenesis of an earlier prepared
variant or a non-variant version of the anti-TAT antibody.
[0206] F. Modifications of Anti-TAT Antibodies and TAT
Polypeptides
[0207] Covalent modifications of anti-TAT antibodies and TAT
polypeptides are included within the scope of this invention. One
type of covalent modification includes reacting targeted amino acid
residues of an anti-TAT antibody or TAT polypeptide with an organic
derivatizing agent that is capable of reacting with selected side
chains or the N- or C-terminal residues of the anti-TAT antibody or
TAT polypeptide. Derivatization with bifunctional agents is useful,
for instance, for crosslinking anti-TAT antibody or TAT polypeptide
to a water-insoluble support matrix or surface for use in the
method for purifying anti-TAT antibodies, and vice-versa. Commonly
used crosslinking agents include, e.g.,
1,1-bis(diazoacetyl)-2-phenylethane, glutaraldehyde,
N-hydroxysuccinimide esters, for example, esters with
4-azidosalicylic acid, homobifunctional imidoesters, including
disuccinimidyl esters such as
3,3'-dithiobis(succinimidylpropionate), bifunctional maleimides
such as bis-N-maleimido-1,8-octane and agents such as
methyl-3-[(p-azidophenyl)dithio]propioimidate.
[0208] Other modifications include deamidation of glutaminyl and
asparaginyl residues to the corresponding glutamyl and aspartyl
residues, respectively, hydroxylation of proline and lysine,
phosphorylation of hydroxyl groups of seryl or threonyl residues,
methylation of the .alpha.-amino groups of lysine, arginine, and
histidine side chains [T. E. Creighton, Proteins: Structure and
Molecular Properties, W.H. Freeman & Co., San Francisco, pp.
79-86 (1983)], acetylation of the N-terminal amine, and amidation
of any C-terminal carboxyl group.
[0209] Another type of covalent modification of the anti-TAT
antibody or TAT polypeptide included within the scope of this
invention comprises altering the native glycosylation pattern of
the antibody or polypeptide. "Altering the native glycosylation
pattern" is intended for purposes herein to mean deleting one or
more carbohydrate moieties found in native sequence anti-TAT
antibody or TAT polypeptide (either by removing the underlying
glycosylation site or by deleting the glycosylation by chemical
and/or enzymatic means), and/or adding one or more glycosylation
sites that are not present in the native sequence anti-TAT antibody
or TAT polypeptide. In addition, the phrase includes qualitative
changes in the glycosylation of the native proteins, involving a
change in the nature and proportions of the various carbohydrate
moieties present.
[0210] Glycosylation of antibodies and other polypeptides is
typically either N-linked or O-linked. N-linked refers to the
attachment of the carbohydrate moiety to the side chain of an
asparagine residue. The tripeptide sequences asparagine-X-serine
and asparagine-X-threonine, where X is any amino acid except
proline, are the recognition sequences for enzymatic attachment of
the carbohydrate moiety to the asparagine side chain. Thus, the
presence of either of these tripeptide sequences in a polypeptide
creates a potential glycosylation site. O-linked glycosylation
refers to the attachment of one of the sugars N-aceylgalactosamine,
galactose, or xylose to a hydroxyamino acid, most commonly serine
or threonine, although 5-hydroxyproline or 5-hydroxylysine may also
be used.
[0211] Addition of glycosylation sites to the anti-TAT antibody or
TAT polypeptide is conveniently accomplished by altering the amino
acid sequence such that it contains one or more of the
above-described tripeptide sequences (for N-linked glycosylation
sites). The alteration may also be made by the addition of, or
substitution by, one or more serine or threonine residues to the
sequence of the original anti-TAT antibody or TAT polypeptide (for
O-linked glycosylation sites). The anti-TAT antibody or TAT
polypeptide amino acid sequence may optionally be altered through
changes at the DNA level, particularly by mutating the DNA encoding
the anti-TAT antibody or TAT polypeptide at preselected bases such
that codons are generated that will translate into the desired
amino acids.
[0212] Another means of increasing the number of carbohydrate
moieties on the anti-TAT antibody or TAT polypeptide is by chemical
or enzymatic coupling of glycosides to the polypeptide. Such
methods are described in the art, e.g., in WO 87/05330 published 11
Sep. 1987, and in Aplin and Wriston, CRC Crit. Rev. Biochem., pp.
259-306 (1981).
[0213] Removal of carbohydrate moieties present on the anti-TAT
antibody or TAT polypeptide may be accomplished chemically or
enzymatically or by mutational substitution of codons encoding for
amino acid residues that serve as targets for glycosylation.
Chemical deglycosylation techniques are known in the art and
described, for instance, by Hakimuddin, et al., Arch. Biochem.
Biophys., 259:52 (1987) and by Edge et al., Anal. Biochem., 118:131
(1981). Enzymatic cleavage of carbohydrate moieties on polypeptides
can be achieved by the use of a variety of endo- and
exo-glycosidases as described by Thotakura et al., Meth. Enzymol.,
138:350 (1987).
[0214] Another type of covalent modification of anti-TAT antibody
or TAT polypeptide comprises linking the antibody or polypeptide to
one of a variety of nonproteinaceous polymers, e.g., polyethylene
glycol (PEG), polypropylene glycol, or polyoxyalkylenes, in the
manner set forth in U.S. Pat. Nos. 4,640,835; 4,496,689; 4,301,144;
4,670,417; 4,791,192 or 4,179,337. The antibody or polypeptide also
may be entrapped in microcapsules prepared, for example, by
coacervation techniques or by interfacial polymerization (for
example, hydroxymethylcellulose or gelatin-microcapsules and
poly-(methylmethacylate) microcapsules, respectively), in colloidal
drug delivery systems (for example, liposomes, albumin
microspheres, microemulsions, nano-particles and nanocapsules), or
in macroemulsions. Such techniques are disclosed in Remington's
Pharmaceutical Sciences, 16th edition, Oslo, A., Ed., (1980).
[0215] The anti-TAT antibody or TAT polypeptide of the present
invention may also be modified in a way to form chimeric molecules
comprising an anti-TAT antibody or TAT polypeptide fused to
another, heterologous polypeptide or amino acid sequence.
[0216] In one embodiment, such a chimeric molecule comprises a
fusion of the anti-TAT antibody or TAT polypeptide with a tag
polypeptide which provides an epitope to which an anti-tag antibody
can selectively bind. The epitope tag is generally placed at the
amino- or carboxyl-terminus of the anti-TAT antibody or TAT
polypeptide. The presence of such epitope-tagged forms of the
anti-TAT antibody or TAT polypeptide can be detected using an
antibody against the tag polypeptide. Also, provision of the
epitope tag enables the anti-TAT antibody or TAT polypeptide to be
readily purified by affinity purification using an anti-tag
antibody or another type of affinity matrix that binds to the
epitope tag. Various tag polypeptides and their respective
antibodies are well known in the art. Examples include
poly-histidine (poly-his) or poly-histidine-glycine (poly-his-gly)
tags; the flu HA tag polypeptide and its antibody 12CA5 [Field et
al., Mol. Cell. Biol., 8:2159-2165 (1988)]; the c-myc tag and the
8F9, 3C7, 6E10, G4, B7 and 9E10 antibodies thereto [Evan et al.,
Molecular and Cellular Biology, 5:3610-3616 (1985)]; and the Herpes
Simplex virus glycoprotein D (gD) tag and its antibody [Paborsky et
al., Protein Engineering, 3(6):547-553 (1990)]. Other tag
polypeptides include the Flag-peptide [Hopp et al., BioTechnology,
6:1204-1210 (1988)]; the KT3 epitope peptide [Martin et al.,
Science, 255:192-194 (1992)]; an .alpha.-tubulin epitope peptide
[Skinner et al., J. Biol. Chem., 266:15163-15166 (1991)]; and the
T7 gene 10 protein peptide tag [Lutz-Freyermuth et al., Proc. Natl.
Acad. Sci. USA, 87:6393-6397 (1990)].
[0217] In an alternative embodiment, the chimeric molecule may
comprise a fusion of the anti-TAT antibody or TAT polypeptide with
an immunoglobulin or a particular region of an immunoglobulin. For
a bivalent form of the chimeric molecule (also referred to as an
"immunoadhesin"), such a fusion could be to the Fc region of an IgG
molecule. The Ig fusions preferably include the substitution of a
soluble (transmembrane domain deleted or inactivated) form of an
anti-TAT antibody or TAT polypeptide in place of at least one
variable region within an Ig molecule. In a particularly preferred
embodiment, the immunoglobulin fusion includes the hinge, CH.sub.2
and CH.sub.3, or the hinge, CH.sub.1, CH.sub.2 and CH.sub.3 regions
of an IgG1 molecule. For the production of immunoglobulin fusions
see also U.S. Pat. No. 5,428,130 issued Jun. 27, 1995.
[0218] G. Preparation of Anti-TAT Antibodies and TAT
Polypeptides
[0219] The description below relates primarily to production of
anti-TAT antibodies and TAT polypeptides by culturing cells
transformed or transfected with a vector containing anti-TAT
antibody- and TAT polypeptide-encoding nucleic acid. It is, of
course, contemplated that alternative methods, which are well known
in the art, may be employed to prepare anti-TAT antibodies and TAT
polypeptides. For instance, the appropriate amino acid sequence, or
portions thereof, may be produced by direct peptide synthesis using
solid-phase techniques [see, e.g., Stewart et al., Solid-Phase
Peptide Synthesis, W.H. Freeman Co., San Francisco, Calif. (1969);
Merrifield, J. Am. Chem. Soc., 85:2149-2154 (1963)]. In vitro
protein synthesis may be performed using manual techniques or by
automation. Automated synthesis may be accomplished, for instance,
using an Applied Biosystems Peptide Synthesizer (Foster City,
Calif.) using manufacturer's instructions. Various portions of the
anti-TAT antibody or TAT polypeptide may be chemically synthesized
separately and combined using chemical or enzymatic methods to
produce the desired anti-TAT antibody or TAT polypeptide.
[0220] 1. Isolation of DNA Encoding Anti-TAT Antibody or TAT
Polypeptide
[0221] DNA encoding anti-TAT antibody or TAT polypeptide may be
obtained from a cDNA library prepared from tissue believed to
possess the anti-TAT antibody or TAT polypeptide mRNA and to
express it at a detectable level. Accordingly, human anti-TAT
antibody or TAT polypeptide DNA can be conveniently obtained from a
cDNA library prepared from human tissue. The anti-TAT antibody- or
TAT polypeptide-encoding gene may also be obtained from a genomic
library or by known synthetic procedures (e.g., automated nucleic
acid synthesis).
[0222] Libraries can be screened with probes (such as
oligonucleotides of at least about 20-80 bases) designed to
identify the gene of interest or the protein encoded by it.
Screening the cDNA or genomic library with the selected probe may
be conducted using standard procedures, such as described in
Sambrook et al., Molecular Cloning: A Laboratory Manual (New York:
Cold Spring Harbor Laboratory Press, 1989). An alternative means to
isolate the gene encoding anti-TAT antibody or TAT polypeptide is
to use PCR methodology [Sambrook et al., supra; Dieffenbach et al.,
PCR Primer: A Laboratory Manual (Cold Spring Harbor Laboratory
Press, 1995)].
[0223] Techniques for screening a cDNA library are well known in
the art. The oligonucleotide sequences selected as probes should be
of sufficient length and sufficiently unambiguous that false
positives are minimized. The oligonucleotide is preferably labeled
such that it can be detected upon hybridization to DNA in the
library being screened. Methods of labeling are well known in the
art, and include the use of radiolabels like .sup.32P-labeled ATP,
biotinylation or enzyme labeling. Hybridization conditions,
including moderate stringency and high stringency, are provided in
Sambrook et al., supra.
[0224] Sequences identified in such library screening methods can
be compared and aligned to other known sequences deposited and
available in public databases such as GenBank or other private
sequence databases. Sequence identity (at either the amino acid or
nucleotide level) within defined regions of the molecule or across
the full-length sequence can be determined using methods known in
the art and as described herein.
[0225] Nucleic acid having protein coding sequence may be obtained
by screening selected cDNA or genomic libraries using the deduced
amino acid sequence disclosed herein for the first time, and, if
necessary, using conventional primer extension procedures as
described in Sambrook et al., supra, to detect precursors and
processing intermediates of mRNA that may not have been
reverse-transcribed into cDNA.
[0226] 2. Selection and Transformation of Host Cells
[0227] Host cells are transfected or transformed with expression or
cloning vectors described herein for anti-TAT antibody or TAT
polypeptide production and cultured in conventional nutrient media
modified as appropriate for inducing promoters, selecting
transformants, or amplifying the genes encoding the desired
sequences. The culture conditions, such as media, temperature, pH
and the like, can be selected by the skilled artisan without undue
experimentation. In general, principles, protocols, and practical
techniques for maximizing the productivity of cell cultures can be
found in Mammalian Cell Biotechnology: a Practical Approach, M.
Butler, ed. (IRL Press, 1991) and Sambrook et al., supra.
[0228] Methods of eukaryotic cell transfection and prokaryotic cell
transformation are known to the ordinarily skilled artisan, for
example, CaCl.sub.2, CaPO.sub.4, liposome-mediated and
electroporation. Depending on the host cell used, transformation is
performed using standard techniques appropriate to such cells. The
calcium treatment employing calcium chloride, as described in
Sambrook et al., supra, or electroporation is generally used for
prokaryotes. Infection with Agrobacterium tumefaciens is used for
transformation of certain plant cells, as described by Shaw et al.,
Gene, 23:315 (1983) and WO 89/05859 published 29 Jun. 1989. For
mammalian cells without such cell walls, the calcium phosphate
precipitation method of Graham and van der Eb, Virology, 52:456-457
(1978) can be employed. General aspects of mammalian cell host
system transfections have been described in U.S. Pat. No.
4,399,216. Transformations into yeast are typically carried out
according to the method of Van Solingen et al., J. Bact., 130:946
(1977) and Hsiao et al., Proc. Natl. Acad. Sci. (USA), 76:3829
(1979). However, other methods for introducing DNA into cells, such
as by nuclear microinjection, electroporation, bacterial protoplast
fusion with intact cells, or polycations, e.g., polybrene,
polyornithine, may also be used. For various techniques for
transforming mammalian cells, see Keown et al., Methods in
Enzymology, 185:527-537 (1990) and Mansour et al., Nature,
336:348-352 (1988).
[0229] Suitable host cells for cloning or expressing the DNA in the
vectors herein include prokaryote, yeast, or higher eukaryote
cells. Suitable prokaryotes include but are not limited to
eubacteria, such as Gram-negative or Gram-positive organisms, for
example, Enterobacteriaceae such as E. coli. Various E. coli
strains are publicly available, such as E. coli K12 strain MM294
(ATCC 31,446); E. coli X1776 (ATCC 31,537); E. coli strain W3110
(ATCC 27,325) and K5 772 (ATCC 53,635). Other suitable prokaryotic
host cells include Enterobacteriaceae such as Escherichia, e.g., E.
coli, Enterobacter, Erwinia, Klebsiella, Proteus, Salmonella, e.g.,
Salmonella typhimurium, Serratia, e.g., Serratia marcescans, and
Shigella, as well as Bacilli such as B. subtilis and B.
licheniformis (e.g., B. licheniformis 41P disclosed in DD 266,710
published 12 Apr. 1989), Pseudomonas such as P. aeruginosa, and
Streptomyces. These examples are illustrative rather than limiting.
Strain W3110 is one particularly preferred host or parent host
because it is a common host strain for recombinant DNA product
fermentations. Preferably, the host cell secretes minimal amounts
of proteolytic enzymes. For example, strain W3110 may be modified
to effect a genetic mutation in the genes encoding proteins
endogenous to the host, with examples of such hosts including E.
coli W3110 strain 1A2, which has the complete genotype tonA; E.
coli W3110 strain 9E4, which has the complete genotype tonA ptr3;
E. coli W3110 strain 27C7 (ATCC 55,244), which has the complete
genotype tonA ptr3 phoA E15 (argF-lac)169 degP ompT kan.sup.r; E.
coli W3110 strain 37D6, which has the complete genotype tonA
ptr3phoA E15 (argF-lac)169 degP ompT rbs7 ilvG kan.sup.r; E. coli
W3110 strain 40B4, which is strain 37D6 with a non-kanamycin
resistant degP deletion mutation; and an E. coli strain having
mutant periplasmic protease disclosed in U.S. Pat. No. 4,946,783
issued 7 Aug. 1990. Alternatively, in vitro methods of cloning,
e.g., PCR or other nucleic acid polymerase reactions, are
suitable.
[0230] Full length antibody, antibody fragments, and antibody
fusion proteins can be produced in bacteria, in particular when
glycosylation and Fc effector function are not needed, such as when
the therapeutic antibody is conjugated to a cytotoxic agent (e.g.,
a toxin) and the immunoconjugate by itself shows effectiveness in
tumor cell destruction. Full length antibodies have greater half
life in circulation. Production in E. coli is faster and more cost
efficient. For expression of antibody fragments and polypeptides in
bacteria, see, e.g., U.S. Pat. No. 5,648,237 (Carter et. al.), U.S.
Pat. No. 5,789,199 (Joly et al.), and U.S. Pat. No. 5,840,523
(Simmons et al.) which describes translation initiation regio (TIR)
and signal sequences for optimizing expression and secretion, these
patents incorporated herein by reference. After expression, the
antibody is isolated from the E. coli cell paste in a soluble
fraction and can be purified through, e.g., a protein A or G column
depending on the isotype. Final purification can be carried out
similar to the process for purifying antibody expressed e.g., in
CHO cells.
[0231] In addition to prokaryotes, eukaryotic microbes such as
filamentous fungi or yeast are suitable cloning or expression hosts
for anti-TAT antibody- or TAT polypeptide-encoding vectors.
Saccharomyces cerevisiae is a commonly used lower eukaryotic host
microorganism. Others include Schizosaccharomyces pombe (Beach and
Nurse, Nature, 290: 140 [1981]; EP 139,383 published 2 May 1985);
Kluyveromyces hosts (U.S. Pat. No. 4,943,529; Fleer et al.,
Bio/Technology, 9:968-975 (1991)) such as, e.g., K lactis (MW98-8C,
CBS683, CBS4574; Louvencourt et al., J. Bacteriol., 154(2):737-742
[1983]), K. fragilis (ATCC 12,424), K. bulgaricus (ATCC 16,045), K.
wickeramii (ATCC 24,178), K. waltii (ATCC 56,500), K. drosophilarum
(ATCC 36,906; Van den Berg et al., Bio/Technology, 8:135 (1990)),
K. thermotolerans, and K. marxianus; yarrowia (EP 402,226); Pichia
pastoris (EP 183,070; Sreekrishna et al., J. Basic Microbiol.,
28:265-278 [1988]); Candida; Trichoderma reesia (EP 244,234);
Neurospora crassa (Case et al., Proc. Natl. Acad. Sci. USA,
76:5259-5263 [1979]); Schwanniomyces such as Schwanniomyces
occidentalis (EP 394,538 published 31 Oct. 1990); and filamentous
fungi such as, e.g., Neurospora, Penicillium, Tolypocladium (WO
91/00357 published 10 Jan. 1991), and Aspergillus hosts such as A.
nidulans (Ballance et al., Biochem. Biophys. Res. Commun.,
112:284-289 [1983]; Tilbum et al., Gene, 26:205-221 [1983]; Yelton
et al., Proc. Natl. Acad. Sci. USA, 81: 1470-1474 [1984]) and A.
niger (Kelly and Hynes, EMBO J., 4:475-479 [1985]). Methylotropic
yeasts are suitable herein and include, but are not limited to,
yeast capable of growth on methanol selected from the genera
consisting of Hansenula, Candida, Kloeckera, Pichia, Saccharomyces,
Torulopsis, and Rhodotorula. A list of specific species that are
exemplary of this class of yeasts may be found in C. Anthony, The
Biochemistry of Methylotrophs, 269 (1982).
[0232] Suitable host cells for the expression of glycosylated
anti-TAT antibody or TAT polypeptide are derived from multicellular
organisms. Examples of invertebrate cells include insect cells such
as Drosophila S2 and Spodoptera Sf9, as well as plant cells, such
as cell cultures of cotton, corn, potato, soybean, petunia, tomato,
and tobacco. Numerous baculoviral strains and variants and
corresponding permissive insect host cells from hosts such as
Spodoptera frugiperda (caterpillar), Aedes aegypti (mosquito),
Aedes albopictus (mosquito), Drosophila melanogaster (fruitfly),
and Bombyx mori have been identified. A variety of viral strains
for transfection are publicly available, e.g., the L-1 variant of
Autographa californica NPV and the Bm-5 strain of Bombyx mori NPV,
and such viruses may be used as the virus herein according to the
present invention, particularly for transfection of Spodoptera
frugiperda cells.
[0233] However, interest has been greatest in vertebrate cells, and
propagation of vertebrate cells in culture (tissue culture) has
become a routine procedure. Examples of useful mammalian host cell
lines are monkey kidney CV1 line transformed by SV40 (COS-7, ATCC
CRL 1651); human embryonic kidney line (293 or 293 cells subcloned
for growth in suspension culture, Graham et al., J. Gen Virol.
36:59 (1977)); baby hamster kidney cells (BHK, ATCC CCL 10);
Chinese hamster ovary cells/-DHFR (CHO, Urlaub et al., Proc. Natl.
Acad. Sci. USA 77:4216 (1980)); mouse sertoli cells (TM4, Mather,
Biol. Reprod. 23:243-251 (1980)); monkey kidney cells (CV1 ATCC CCL
70); African green monkey kidney cells (VERO-76, ATCC CRL-1587);
human cervical carcinoma cells (HELA, ATCC CCL 2); canine kidney
cells (MDCK, ATCC CCL 34); buffalo rat liver cells (BRL 3A, ATCC
CRL 1442); human lung cells (W138, ATCC CCL 75); human liver cells
(Hep G2, HB 8065); mouse mammary tumor (MMT 060562, ATCC CCL51);
TRI cells (Mather et al., Annals N.Y. Acad. Sci. 383:44-68 (1982));
MRC 5 cells; FS4 cells; and a human hepatoma line (Hep G2).
[0234] Host cells are transformed with the above-described
expression or cloning vectors for anti-TAT antibody or TAT
polypeptide production and cultured in conventional nutrient media
modified as appropriate for inducing promoters, selecting
transformants, or amplifying the genes encoding the desired
sequences.
[0235] 3. Selection and Use of a Replicable Vector
[0236] The nucleic acid (e.g., cDNA or genomic DNA) encoding
anti-TAT antibody or TAT polypeptide may be inserted into a
replicable vector for cloning (amplification of the DNA) or for
expression. Various vectors are publicly available. The vector may,
for example, be in the form of a plasmid, cosmid, viral particle,
or phage. The appropriate nucleic acid sequence may be inserted
into the vector by a variety of procedures. In general, DNA is
inserted into an appropriate restriction endonuclease site(s) using
techniques known in the art. Vector components generally include,
but are not limited to, one or more of a signal sequence, an origin
of replication, one or more marker genes, an enhancer element, a
promoter, and a transcription termination sequence. Construction of
suitable vectors containing one or more of these components employs
standard ligation techniques which are known to the skilled
artisan.
[0237] The TAT may be produced recombinantly not only directly, but
also as a fusion polypeptide with a heterologous polypeptide, which
may be a signal sequence or other polypeptide having a specific
cleavage site at the N-terminus of the mature protein or
polypeptide. In general, the signal sequence may be a component of
the vector, or it may be a part of the anti-TAT antibody- or TAT
polypeptide-encoding DNA that is inserted into the vector. The
signal sequence may be a prokaryotic signal sequence selected, for
example, from the group of the alkaline phosphatase, penicillinase,
lpp, or heat-stable enterotoxin II leaders. For yeast secretion the
signal sequence may be, e.g., the yeast invertase leader, alpha
factor leader (including Saccharomyces and Kluyveromyces
.alpha.-factor leaders, the latter described in U.S. Pat. No.
5,010,182), or acid phosphatase leader, the C. albicans
glucoamylase leader (EP 362,179 published 4 Apr. 1990), or the
signal described in WO 90/13646 published 15 Nov. 1990. In
mammalian cell expression, mammalian signal sequences may be used
to direct secretion of the protein, such as signal sequences from
secreted polypeptides of the same or related species, as well as
viral secretory leaders.
[0238] Both expression and cloning vectors contain a nucleic acid
sequence that enables the vector to replicate in one or more
selected host cells. Such sequences are well known for a variety of
bacteria, yeast, and viruses. The origin of replication from the
plasmid pBR322 is suitable for most Gram-negative bacteria, the
2.mu. plasmid origin is suitable for yeast, and various viral
origins (SV40, polyoma, adenovirus, VSV or BPV) are useful for
cloning vectors in mammalian cells.
[0239] Expression and cloning vectors will typically contain a
selection gene, also termed a selectable marker. Typical selection
genes encode proteins that (a) confer resistance to antibiotics or
other toxins, e.g., ampicillin, neomycin, methotrexate, or
tetracycline, (b) complement auxotrophic deficiencies, or (c)
supply critical nutrients not available from complex media, e.g.,
the gene encoding D-alanine racemase for Bacilli.
[0240] An example of suitable selectable markers for mammalian
cells are those that enable the identification of cells competent
to take up the anti-TAT antibody- or TAT polypeptide-encoding
nucleic acid, such as DHFR or thymidine kinase. An appropriate host
cell when wild-type DHFR is employed is the CHO cell line deficient
in DHFR activity, prepared and propagated as described by Urlaub et
al., Proc. Natl. Acad. Sci. USA, 77:4216 (1980). A suitable
selection gene for use in yeast is the trp1 gene present in the
yeast plasmid YRp7 [Stinchcomb et al., Nature, 282:39 (1979);
Kingsman et al., Gene, 7:141 (1979); Tschemper et al., Gene, 10:157
(1980)]. The trp1 gene provides a selection marker for a mutant
strain of yeast lacking the ability to grow in tryptophan, for
example, ATCC No. 44076 or PEP4-1 [Jones, Genetics, 85:12
(1977)].
[0241] Expression and cloning vectors usually contain a promoter
operably linked to the anti-TAT antibody- or TAT
polypeptide-encoding nucleic acid sequence to direct mRNA
synthesis. Promoters recognized by a variety of potential host
cells are well known. Promoters suitable for use with prokaryotic
hosts include the .beta.-lactamase and lactose promoter systems
[Chang et al., Nature, 275:615 (1978); Goeddel et al., Nature,
281:544 (1979)], alkaline phosphatase, a tryptophan (trp) promoter
system [Goeddel, Nucleic Acids Res., 8:4057 (1980); EP 36,776], and
hybrid promoters such as the tac promoter [deBoer et al., Proc.
Natl. Acad. Sci. USA, 80:21-25 (1983)]. Promoters for use in
bacterial systems also will contain a Shine-Dalgarno (S.D.)
sequence operably linked to the DNA encoding anti-TAT antibody or
TAT polypeptide.
[0242] Examples of suitable promoting sequences for use with yeast
hosts include the promoters for 3-phosphoglycerate kinase [Hitzeman
et al., J. Biol. Chem., 255:2073 (1980)] or other glycolytic
enzymes [Hess et al., J. Adv. Enzyme Reg., 7:149 (1968); Holland,
Biochemistry, 17:4900 (1978)], such as enolase,
glyceraldehyde-3-phosphate dehydrogenase, hexokinase, pyruvate
decarboxylase, phosphofructokinase, glucose-6-phosphate isomerase,
3-phosphoglycerate mutase, pyruvate kinase, triosephosphate
isomerase, phosphoglucose isomerase, and glucokinase.
[0243] Other yeast promoters, which are inducible promoters having
the additional advantage of transcription controlled by growth
conditions, are the promoter regions for alcohol dehydrogenase 2,
isocytochrome C, acid phosphatase, degradative enzymes associated
with nitrogen metabolism, metallothionein,
glyceraldehyde-3-phosphate dehydrogenase, and enzymes responsible
for maltose and galactose utilization. Suitable vectors and
promoters for use in yeast expression are further described in EP
73,657.
[0244] Anti-TAT antibody or TAT polypeptide transcription from
vectors in mammalian host cells is controlled, for example, by
promoters obtained from the genomes of viruses such as polyoma
virus, fowlpox virus (UK 2,211,504 published 5 Jul. 1989),
adenovirus (such as Adenovirus 2), bovine papilloma virus, avian
sarcoma virus, cytomegalovirus, a retrovirus, hepatitis-B virus and
Simian Virus 40 (SV40), from heterologous mammalian promoters,
e.g., the actin promoter or an immunoglobulin promoter, and from
heat-shock promoters, provided such promoters are compatible with
the host cell systems.
[0245] Transcription of a DNA encoding the anti-TAT antibody or TAT
polypeptide by higher eukaryotes may be increased by inserting an
enhancer sequence into the vector. Enhancers are cis-acting
elements of DNA, usually about from 10 to 300 bp, that act on a
promoter to increase its transcription. Many enhancer sequences are
now known from mammalian genes (globin, elastase, albumin,
.alpha.-fetoprotein, and insulin). Typically, however, one will use
an enhancer from a eukaryotic cell virus. Examples include the SV40
enhancer on the late side of the replication origin (bp 100-270),
the cytomegalovirus early promoter enhancer, the polyoma enhancer
on the late side of the replication origin, and adenovirus
enhancers. The enhancer may be spliced into the vector at a
position 5' or 3' to the anti-TAT antibody or TAT polypeptide
coding sequence, but is preferably located at a site 5' from the
promoter.
[0246] Expression vectors used in eukaryotic host cells (yeast,
fungi, insect, plant, animal, human, or nucleated cells from other
multicellular organisms) will also contain sequences necessary for
the termination of transcription and for stabilizing the mRNA. Such
sequences are commonly available from the 5' and, occasionally 3',
untranslated regions of eukaryotic or viral DNAs or cDNAs. These
regions contain nucleotide segments transcribed as polyadenylated
fragments in the untranslated portion of the mRNA encoding anti-TAT
antibody or TAT polypeptide.
[0247] Still other methods, vectors, and host cells suitable for
adaptation to the synthesis of anti-TAT antibody or TAT polypeptide
in recombinant vertebrate cell culture are described in Gething et
al., Nature, 293:620-625 (1981); Mantei et al., Nature, 281:40-46
(1979); EP 117,060; and EP 117,058.
[0248] 4. Culturing the Host Cells
[0249] The host cells used to produce the anti-TAT antibody or TAT
polypeptide of this invention may be cultured in a variety of
media. Commercially available media such as Ham's F10 (Sigma),
Minimal Essential Medium ((MEM), (Sigma), RPMI-1640 (Sigma), and
Dulbecco's Modified Eagle's Medium ((DMEM), Sigma) are suitable for
culturing the host cells. In addition, any of the media described
in Ham et al., Meth. Enz. 58:44 (1979), Barnes et al., Anal.
Biochem. 102:255 (1980), U.S. Pat. Nos. 4,767,704; 4,657,866;
4,927,762; 4,560,655; or 5,122,469; WO 90/03430; WO 87/00195; or
U.S. Pat. Re. 30,985 may be used as culture media for the host
cells. Any of these media may be supplemented as necessary with
hormones and/or other growth factors (such as insulin, transferrin,
or epidermal growth factor), salts (such as sodium chloride,
calcium, magnesium, and phosphate), buffers (such as HEPES),
nucleotides (such as adenosine and thymidine), antibiotics (such as
GENTAMYCIN.TM. drug), trace elements (defined as inorganic
compounds usually present at final concentrations in the micromolar
range), and glucose or an equivalent energy source. Any other
necessary supplements may also be included at appropriate
concentrations that would be known to those skilled in the art. The
culture conditions, such as temperature, pH, and the like, are
those previously used with the host cell selected for expression,
and will be apparent to the ordinarily skilled artisan.
[0250] 5. Detecting Gene Amplification/Expression
[0251] Gene amplification and/or expression may be measured in a
sample directly, for example, by conventional Southern blotting,
Northern blotting to quantitate the transcription of mRNA [Thomas,
Proc. Natl. Acad. Sci. USA, 77:5201-5205 (1980)], dot blotting (DNA
analysis), or in situ hybridization, using an appropriately labeled
probe, based on the sequences provided herein. Alternatively,
antibodies may be employed that can recognize specific duplexes,
including DNA duplexes, RNA duplexes, and DNA-RNA hybrid duplexes
or DNA-protein duplexes. The antibodies in turn may be labeled and
the assay may be carried out where the duplex is bound to a
surface, so that upon the formation of duplex on the surface, the
presence of antibody bound to the duplex can be detected.
[0252] Gene expression, alternatively, may be measured by
immunological methods, such as immunohistochemical staining of
cells or tissue sections and assay of cell culture or body fluids,
to quantitate directly the expression of gene product. Antibodies
useful for immunohistochemical staining and/or assay of sample
fluids may be either monoclonal or polyclonal, and may be prepared
in any mammal. Conveniently, the antibodies may be prepared against
a native sequence TAT polypeptide or against a synthetic peptide
based on the DNA sequences provided herein or against exogenous
sequence fused to TAT DNA and encoding a specific antibody
epitope.
[0253] 6. Purification of Anti-TAT Antibody and TAT Polypeptide
[0254] Forms of anti-TAT antibody and TAT polypeptide may be
recovered from culture medium or from host cell lysates. If
membrane-bound, it can be released from the membrane using a
suitable detergent solution (e.g. Triton-X 100) or by enzymatic
cleavage. Cells employed in expression of anti-TAT antibody and TAT
polypeptide can be disrupted by various physical or chemical means,
such as freeze-thaw cycling, sonication, mechanical disruption, or
cell lysing agents.
[0255] It may be desired to purify anti-TAT antibody and TAT
polypeptide from recombinant cell proteins or polypeptides. The
following procedures are exemplary of suitable purification
procedures: by fractionation on an ion-exchange column; ethanol
precipitation; reverse phase HPLC; chromatography on silica or on a
cation-exchange resin such as DEAE; chromatofocusing; SDS-PAGE;
ammonium sulfate precipitation; gel filtration using, for example,
Sephadex G-75; protein A Sepharose columns to remove contaminants
such as IgG; and metal chelating columns to bind epitope-tagged
forms of the anti-TAT antibody and TAT polypeptide. Various methods
of protein purification may be employed and such methods are known
in the art and described for example in Deutscher, Methods in
Enzymology, 182 (1990); Scopes, Protein Purification: Principles
and Practice, Springer-Verlag, New York (1982). The purification
step(s) selected will depend, for example, on the nature of the
production process used and the particular anti-TAT antibody or TAT
polypeptide produced.
[0256] When using recombinant techniques, the antibody can be
produced intracellularly, in the periplasmic space, or directly
secreted into the medium. If the antibody is produced
intracellularly, as a first step, the particulate debris, either
host cells or lysed fragments, are removed, for example, by
centrifugation or ultrafiltration. Carter et al., Bio/Technology
10:163-167 (1992) describe a procedure for isolating antibodies
which are secreted to the periplasmic space of E. coli. Briefly,
cell paste is thawed in the presence of sodium acetate (pH 3.5),
EDTA, and phenylmethylsulfonylfluoride (PMSF) over about 30 min.
Cell debris can be removed by centrifugation. Where the antibody is
secreted into the medium, supernatants from such expression systems
are generally first concentrated using a commercially available
protein concentration filter, for example, an Amicon or Millipore
Pellicon ultrafiltration unit. A protease inhibitor such as PMSF
may be included in any of the foregoing steps to inhibit
proteolysis and antibiotics may be included to prevent the growth
of adventitious contaminants.
[0257] The antibody composition prepared from the cells can be
purified using, for example, hydroxylapatite chromatography, gel
electrophoresis, dialysis, and affinity chromatography, with
affinity chromatography being the preferred purification technique.
The suitability of protein A as an affinity ligand depends on the
species and isotype of any immunoglobulin Fc domain that is present
in the antibody. Protein A can be used to purify antibodies that
are based on human .gamma.1, .gamma.2 or .gamma.4 heavy chains
(Lindmark et al., J. Immunol. Meth. 62:1-13 (1983)). Protein G is
recommended for all mouse isotypes and for human .gamma.3 (Guss et
al., EMBO J. 5:15671575 (1986)). The matrix to which the affinity
ligand is attached is most often agarose, but other matrices are
available. Mechanically stable matrices such as controlled pore
glass or poly(styrenedivinyl)benzene allow for faster flow rates
and shorter processing times than can be achieved with agarose.
Where the antibody comprises a C.sub.H3 domain, the Bakerbond
ABX.TM.resin (J. T. Baker, Phillipsburg, N.J.) is useful for
purification. Other techniques for protein purification such as
fractionation on an ion-exchange column, ethanol precipitation,
Reverse Phase HPLC, chromatography on silica, chromatography on
heparin SEPHAROSE.TM. chromatography on an anion or cation exchange
resin (such as a polyaspartic acid column), chromatofocusing,
SDS-PAGE, and ammonium sulfate precipitation are also available
depending on the antibody to be recovered.
[0258] Following any preliminary purification step(s), the mixture
comprising the antibody of interest and contaminants may be
subjected to low pH hydrophobic interaction chromatography using an
elution buffer at a pH between about 2.5-4.5, preferably performed
at low salt concentrations (e.g., from about 0-0.25M salt).
[0259] H. Pharmaceutical Formulations
[0260] Therapeutic formulations of the anti-TAT antibodies and/or
TAT polypeptides used in accordance with the present invention are
prepared for storage by mixing an antibody having the desired
degree of purity with optional pharmaceutically acceptable
carriers, excipients or stabilizers (Remington's Pharmaceutical
Sciences 16th edition, Osol, A. Ed. (1980)), in the form of
lyophilized formulations or aqueous solutions. Acceptable carriers,
excipients, or stabilizers are nontoxic to recipients at the
dosages and concentrations employed, and include buffers such as
acetate, Tris, phosphate, citrate, and other organic acids;
antioxidants including ascorbic acid and methionine; preservatives
(such as octadecyldimethylbenzyl ammonium chloride; hexamethonium
chloride; benzalkonium chloride, benzethonium chloride; phenol,
butyl or benzyl alcohol; alkyl parabens such as methyl or propyl
paraben; catechol; resorcinol; cyclohexanol; 3-pentanol; and
m-cresol); low molecular weight (less than about 10 residues)
polypeptides; proteins, such as serum albumin, gelatin, or
immunoglobulins; hydrophilic polymers such as polyvinylpyrrolidone;
amino acids such as glycine, glutamine, asparagine, histidine,
arginine, or lysine; monosaccharides, disaccharides, and other
carbohydrates including glucose, mannose, or dextrins; chelating
agents such as EDTA; tonicifiers such as trehalose and sodium
chloride; sugars such as sucrose, mannitol, trehalose or sorbitol;
surfactant such as polysorbate; salt-forming counter-ions such as
sodium; metal complexes (e.g., Zn-protein complexes); and/or
non-ionic surfactants such as TWEEN.RTM., PLURONICS.RTM. or
polyethylene glycol (PEG). The antibody preferably comprises the
antibody at a concentration of between 5-200 mg/ml, preferably
between 10-100 mg/ml.
[0261] The formulations herein may also contain more than one
active compound as necessary for the particular indication being
treated, preferably those with complementary activities that do not
adversely affect each other. For example, in addition to an
anti-TAT antibody, it may be desirable to include in the one
formulation, an additional antibody, e.g., a second anti-TAT
antibody which binds a different epitope on the TAT polypeptide, or
an antibody to some other target such as a growth factor that
affects the growth of the particular cancer. Alternatively, or
additionally, the composition may further comprise a
chemotherapeutic agent, cytotoxic agent, cytokine, growth
inhibitory agent, anti-hormonal agent, and/or cardioprotectant.
Such molecules are suitably present in combination in amounts that
are effective for the purpose intended.
[0262] The active ingredients may also be entrapped in
microcapsules prepared, for example, by coacervation techniques or
by interfacial polymerization, for example, hydroxymethylcellulose
or gelatin-microcapsules and poly-(methylmethacylate)
microcapsules, respectively, in colloidal drug delivery systems
(for example, liposomes, albumin microspheres, microemulsions,
nano-particles and nanocapsules) or in macroemulsions. Such
techniques are disclosed in Remington's Pharmaceutical Sciences,
16th edition, Osol, A. Ed. (1980).
[0263] Sustained-release preparations may be prepared. Suitable
examples of sustained-release preparations include semi-permeable
matrices of solid hydrophobic polymers containing the antibody,
which matrices are in the form of shaped articles, e.g., films, or
microcapsules. Examples of sustained-release matrices include
polyesters, hydrogels (for example,
poly(2-hydroxyethyl-methacrylate), or poly(vinylalcohol)),
polylactides (U.S. Pat. No. 3,773,919), copolymers of L-glutamic
acid and .gamma. ethyl-L-glutamate, non-degradable ethylene-vinyl
acetate, degradable lactic acid-glycolic acid copolymers such as
the LUPRON DEPOT.RTM. (injectable microspheres composed of lactic
acid-glycolic acid copolymer and leuprolide acetate), and
poly-D-(-)-3-hydroxybutyric acid.
[0264] The formulations to be used for in vivo administration must
be sterile. This is readily accomplished by filtration through
sterile filtration membranes.
[0265] I. Diagnosis and Treatment with Anti-TAT Polypeptide
Antibodies
[0266] To determine TAT expression in the cancer, various
diagnostic assays are available. In one embodiment, TAT polypeptide
overexpression may be analyzed by immunohistochemistry (IHC).
Parrafin embedded tissue sections from a tumor biopsy may be
subjected to the IHC assay and accorded a TAT protein staining
intensity criteria as follows:
[0267] Score 0--no staining is observed or membrane staining is
observed in less than 10% of tumor cells.
[0268] Score 1+--a faint/barely perceptible membrane staining is
detected in more than 10% of the tumor cells. The cells are only
stained in part of their membrane.
[0269] Score 2+--a weak to moderate complete membrane staining is
observed in more than 10% of the tumor cells.
[0270] Score 3+--a moderate to strong complete membrane staining is
observed in more than 10% of the tumor cells.
[0271] Those tumors with 0 or 1+ scores for TAT polypeptide
expression may be characterized as not overexpressing TAT, whereas
those tumors with 2+ or 3+ scores may be characterized as
overexpressing TAT.
[0272] Alternatively, or additionally, FISH assays such as the
INFORM.RTM. (sold by Ventana, Ariz.) or PATHVISION.RTM. (Vysis,
Ill.) may be carried out on formalin-fixed, paraffin-embedded tumor
tissue to determine the extent (if any) of TAT overexpression in
the tumor.
[0273] TAT overexpression or amplification may be evaluated using
an in vivo diagnostic assay, e.g., by administering a molecule
(such as an antibody) which binds the molecule to be detected and
is tagged with a detectable label (e.g., a radioactive isotope or a
fluorescent label) and externally scanning the patient for
localization of the label.
[0274] As described above, the anti-TAT antibodies of the invention
have various non-therapeutic applications. The anti-TAT antibodies
of the present invention can be useful for diagnosis and staging of
TAT polypeptide-expressing cancers (e.g., in radioimaging). The
antibodies are also useful for purification or immunoprecipitation
of TAT polypeptide from cells, for detection and quantitation of
TAT polypeptide in vitro, e.g., in an ELISA or a Western blot, to
kill and eliminate TAT-expressing cells from a population of mixed
cells as a step in the purification of other cells.
[0275] Currently, depending on the stage of the cancer, cancer
treatment involves one or a combination of the following therapies:
surgery to remove the cancerous tissue, radiation therapy, and
chemotherapy. Anti-TAT antibody therapy may be especially desirable
in elderly patients who do not tolerate the toxicity and side
effects of chemotherapy well and in metastatic disease where
radiation therapy has limited usefulness. The tumor targeting
anti-TAT antibodies of the invention are useful to alleviate
TAT-expressing cancers upon initial diagnosis of the disease or
during relapse. For therapeutic applications, the anti-TAT antibody
can be used alone, or in combination therapy with, e.g., hormones,
antiangiogens, or radiolabelled compounds, or with surgery,
cryotherapy, and/or radiotherapy. Anti-TAT antibody treatment can
be administered in conjunction with other forms of conventional
therapy, either consecutively with, pre- or post-conventional
therapy. Chemotherapeutic drugs such as TAXOTERE.RTM. (docetaxel),
TAXOL.RTM. (palictaxel), estramustine and mitoxantrone are used in
treating cancer, in particular, in good risk patients. In the
present method of the invention for treating or alleviating cancer,
the cancer patient can be administered anti-TAT antibody in
conjunction with treatment with the one or more of the preceding
chemotherapeutic agents. In particular, combination therapy with
palictaxel and modified derivatives (see, e.g., EP0600517) is
contemplated. The anti-TAT antibody will be administered with a
therapeutically effective dose of the chemotherapeutic agent. In
another embodiment, the anti-TAT antibody is administered in
conjunction with chemotherapy to enhance the activity and efficacy
of the chemotherapeutic agent, e.g., paclitaxel. The Physicians'
Desk Reference (PDR) discloses dosages of these agents that have
been used in treatment of various cancers. The dosing regimen and
dosages of these aforementioned chemotherapeutic drugs that are
therapeutically effective will depend on the particular cancer
being treated, the extent of the disease and other factors familiar
to the physician of skill in the art and can be determined by the
physician.
[0276] In one particular embodiment, an immunoconjugate comprising
the anti-TAT antibody conjugated with a cytotoxic agent is
administered to the patient. Preferably, the immunoconjugate bound
to the TAT protein is internalized by the cell, resulting in
increased therapeutic efficacy of the immunoconjugate in killing
the cancer cell to which it binds. In a preferred embodiment, the
cytotoxic agent targets or interferes with the nucleic acid in the
cancer cell. Examples of such cytotoxic agents are described above
and include maytansinoids, calicheamicins, ribonucleases and DNA
endonucleases.
[0277] The anti-TAT antibodies or immunoconjugates are administered
to a human patient, in accord with known methods, such as
intravenous administration, e.g., as a bolus or by continuous
infusion over a period of time, by intramuscular, intraperitoneal,
intracerobrospinal, subcutaneous, intra-articular, intrasynovial,
intrathecal, oral, topical, or inhalation routes. Intravenous or
subcutaneous administration of the antibody is preferred.
[0278] Other therapeutic regimens may be combined with the
administration of the anti-TAT antibody. The combined
administration includes co-administration, using separate
formulations or a single pharmaceutical formulation, and
consecutive administration in either order, wherein preferably
there is a time period while both (or all) active agents
simultaneously exert their biological activities. Preferably such
combined therapy results in a synergistic therapeutic effect.
[0279] It may also be desirable to combine administration of the
anti-TAT antibody or antibodies, with administration of an antibody
directed against another tumor antigen associated with the
particular cancer.
[0280] In another embodiment, the antibody therapeutic treatment
method of the present invention involves the combined
administration of an anti-TAT antibody (or antibodies) and one or
more chemotherapeutic agents or growth inhibitory agents, including
co-administration of cocktails of different chemotherapeutic
agents. Chemotherapeutic agents include estramustine phosphate,
prednimustine, cisplatin, 5-fluorouracil, melphalan,
cyclophosphamide, hydroxyurea and hydroxyureataxanes (such as
paclitaxel and doxetaxel) and/or anthracycline antibiotics.
Preparation and dosing schedules for such chemotherapeutic agents
may be used according to manufacturers' instructions or as
determined empirically by the skilled practitioner. Preparation and
dosing schedules for such chemotherapy are also described in
Chemotherapy Service Ed., M. C. Perry, Williams & Wilkins,
Baltimore, Md. (1992).
[0281] The antibody may be combined with an anti-hormonal compound;
e.g., an anti-estrogen compound such as tamoxifen; an
anti-progesterone such as onapristone (see, EP 616 812); or an
anti-androgen such as flutamide, in dosages known for such
molecules. Where the cancer to be treated is androgen independent
cancer, the patient may previously have been subjected to
anti-androgen therapy and, after the cancer becomes androgen
independent, the anti-TAT antibody (and optionally other agents as
described herein) may be administered to the patient.
[0282] Sometimes, it may be beneficial to also co-administer a
cardioprotectant (to prevent or reduce myocardial dysfunction
associated with the therapy) or one or more cytokines to the
patient. In addition to the above therapeutic regimes, the patient
may be subjected to surgical removal of cancer cells and/or
radiation therapy, before, simultaneously with, or post antibody
therapy. Suitable dosages for any of the above co-administered
agents are those presently used and may be lowered due to the
combined action (synergy) of the agent and anti-TAT antibody.
[0283] For the prevention or treatment of disease, the dosage and
mode of administration will be chosen by the physician according to
known criteria. The appropriate dosage of antibody will depend on
the type of disease to be treated, as defined above, the severity
and course of the disease, whether the antibody is administered for
preventive or therapeutic purposes, previous therapy, the patient's
clinical history and response to the antibody, and the discretion
of the attending physician. The antibody is suitably administered
to the patient at one time or over a series of treatments.
Preferably, the antibody is administered by intravenous infusion or
by subcutaneous injections. Depending on the type and severity of
the disease, about 1 .mu.g/kg to about 50 mg/kg body weight (e.g.,
about 0.1-15 mg/kg/dose) of antibody can be an initial candidate
dosage for administration to the patient, whether, for example, by
one or more separate administrations, or by continuous infusion. A
dosing regimen can comprise administering an initial loading dose
of about 4 mg/kg, followed by a weekly maintenance dose of about 2
mg/kg of the anti-TAT antibody. However, other dosage regimens may
be useful. A typical daily dosage might range from about 1 .mu.g/kg
to 100 mg/kg or more, depending on the factors mentioned above. For
repeated administrations over several days or longer, depending on
the condition, the treatment is sustained until a desired
suppression of disease symptoms occurs. The progress of this
therapy can be readily monitored by conventional methods and assays
and based on criteria known to the physician or other persons of
skill in the art.
[0284] Aside from administration of the antibody protein to the
patient, the present application contemplates administration of the
antibody by gene therapy. Such administration of nucleic acid
encoding the antibody is encompassed by the expression
"administering a therapeutically effective amount of an antibody".
See, for example, WO96/07321 published Mar. 14, 1996 concerning the
use of gene therapy to generate intracellular antibodies.
[0285] There are two major approaches to getting the nucleic acid
(optionally contained in a vector) into the patient's cells; in
vivo and ex vivo. For in vivo delivery the nucleic acid is injected
directly into the patient, usually at the site where the antibody
is required. For ex vivo treatment, the patient's cells are
removed, the nucleic acid is introduced into these isolated cells
and the modified cells are administered to the patient either
directly or, for example, encapsulated within porous membranes
which are implanted into the patient (see, e.g., U.S. Pat. Nos.
4,892,538 and 5,283,187). There are a variety of techniques
available for introducing nucleic acids into viable cells. The
techniques vary depending upon whether the nucleic acid is
transferred into cultured cells in vitro, or in vivo in the cells
of the intended host. Techniques suitable for the transfer of
nucleic acid into mammalian cells in vitro include the use of
liposomes, electroporation, microinjection, cell fusion,
DEAE-dextran, the calcium phosphate precipitation method, etc. A
commonly used vector for ex vivo delivery of the gene is a
retroviral vector.
[0286] The currently preferred in vivo nucleic acid transfer
techniques include transfection with viral vectors (such as
adenovirus, Herpes simplex I virus, or adeno-associated virus) and
lipid-based systems (useful lipids for lipid-mediated transfer of
the gene are DOTMA, DOPE and DC-Chol, for example). For review of
the currently known gene marking and gene therapy protocols see
Anderson et al., Science 256:808-813 (1992). See also WO 93/25673
and the references cited therein.
[0287] The anti-TAT antibodies of the invention can be in the
different forms encompassed by the definition of "antibody" herein.
Thus, the antibodies include full length or intact antibody,
antibody fragments, native sequence antibody or amino acid
variants, humanized, chimeric or fusion antibodies,
immunoconjugates, and functional fragments thereof. In fusion
antibodies an antibody sequence is fused to a heterologous
polypeptide sequence. The antibodies can be modified in the Fc
region to provide desired effector functions. As discussed in more
detail in the sections herein, with the appropriate Fc regions, the
naked antibody bound on the cell surface can induce cytotoxicity,
e.g., via antibody-dependent cellular cytotoxicity (ADCC) or by
recruiting complement in complement dependent cytotoxicity, or some
other mechanism. Alternatively, where it is desirable to eliminate
or reduce effector function, so as to minimize side effects or
therapeutic complications, certain other Fc regions may be
used.
[0288] In one embodiment, the antibody competes for binding or bind
substantially to, the same epitope as the antibodies of the
invention. Antibodies having the biological characteristics of the
present anti-TAT antibodies of the invention are also contemplated,
specifically including the in vivo tumor targeting and any cell
proliferation inhibition or cytotoxic characteristics.
[0289] Methods of producing the above antibodies are described in
detail herein.
[0290] The present anti-TAT antibodies are useful for treating a
TAT-expressing cancer or alleviating one or more symptoms of the
cancer in a mammal. Such a cancer includes prostate cancer, cancer
of the urinary tract, lung cancer, breast cancer, colon cancer and
ovarian cancer, more specifically, prostate adenocarcinoma, renal
cell carcinomas, colorectal adenocarcinomas, lung adenocarcinomas,
lung squamous cell carcinomas, and pleural mesothelioma. The
cancers encompass metastatic cancers of any of the preceding. The
antibody is able to bind to at least a portion of the cancer cells
that express TAT polypeptide in the mammal. In a preferred
embodiment, the antibody is effective to destroy or kill
TAT-expressing tumor cells or inhibit the growth of such tumor
cells, in vitro or in vivo, upon binding to TAT polypeptide on the
cell. Such an antibody includes a naked anti-TAT antibody (not
conjugated to any agent). Naked antibodies that have cytotoxic or
cell growth inhibition properties can be further harnessed with a
cytotoxic agent to render them even more potent in tumor cell
destruction. Cytotoxic properties can be conferred to an anti-TAT
antibody by, e.g., conjugating the antibody with a cytotoxic agent,
to form an immunoconjugate as described herein. The cytotoxic agent
or a growth inhibitory agent is preferably a small molecule. Toxins
such as calicheamicin or a maytansinoid and analogs or derivatives
thereof, are preferable.
[0291] The invention provides a composition comprising an anti-TAT
antibody of the invention, and a carrier. For the purposes of
treating cancer, compositions can be administered to the patient in
need of such treatment, wherein the composition can comprise one or
more anti-TAT antibodies present as an immunoconjugate or as the
naked antibody. In a further embodiment, the compositions can
comprise these antibodies in combination with other therapeutic
agents such as cytotoxic or growth inhibitory agents, including
chemotherapeutic agents. The invention also provides formulations
comprising an anti-TAT antibody of the invention, and a carrier. In
one embodiment, the formulation is a therapeutic formulation
comprising a pharmaceutically acceptable carrier.
[0292] Another aspect of the invention is isolated nucleic acids
encoding the anti-TAT antibodies. Nucleic acids encoding both the H
and L chains and especially the hypervariable region residues,
chains which encode the native sequence antibody as well as
variants, modifications and humanized versions of the antibody, are
encompassed.
[0293] The invention also provides methods useful for treating a
TAT polypeptide-expressing cancer or alleviating one or more
symptoms of the cancer in a mammal, comprising administering a
therapeutically effective amount of an anti-TAT antibody to the
mammal. The antibody therapeutic compositions can be administered
short term (acute) or chronic, or intermittent as directed by
physician. Also provided are methods of inhibiting the growth of,
and killing a TAT polypeptide-expressing cell.
[0294] The invention also provides kits and articles of manufacture
comprising at least one anti-TAT antibody. Kits containing anti-TAT
antibodies find use e.g., for TAT cell killing assays, for
purification or immunoprecipitation of TAT polypeptide from cells.
For example, for isolation and purification of TAT, the kit can
contain an anti-TAT antibody coupled to beads (e.g., sepharose
beads). Kits can be provided which contain the antibodies for
detection and quantitation of TAT in vitro, e.g., in an ELISA or a
Western blot. Such antibody useful for detection may be provided
with a label such as a fluorescent or radiolabel.
[0295] J. Articles of Manufacture and Kits
[0296] Another embodiment of the invention is an article of
manufacture containing materials useful for the treatment of
anti-TAT expressing cancer. The article of manufacture comprises a
container and a label or package insert on or associated with the
container. Suitable containers include, for example, bottles,
vials, syringes, etc. The containers may be formed from a variety
of materials such as glass or plastic. The container holds a
composition which is effective for treating the cancer condition
and may have a sterile access port (for example the container may
be an intravenous solution bag or a vial having a stopper
pierceable by a hypodermic injection needle). At least one active
agent in the composition is an anti-TAT antibody of the invention.
The label or package insert indicates that the composition is used
for treating cancer. The label or package insert will further
comprise instructions for administering the antibody composition to
the cancer patient. Additionally, the article of manufacture may
further comprise a second container comprising a
pharmaceutically-acceptable buffer, such as bacteriostatic water
for injection (BWFI), phosphate-buffered saline, Ringer's solution
and dextrose solution. It may further include other materials
desirable from a commercial and user standpoint, including other
buffers, diluents, filters, needles, and syringes.
[0297] Kits are also provided that are useful for various purposes,
e.g., for TAT-expressing cell killing assays, for purification or
immunoprecipitation of TAT polypeptide from cells. For isolation
and purification of TAT polypeptide, the kit can contain an
anti-TAT antibody coupled to beads (e.g., sepharose beads). Kits
can be provided which contain the antibodies for detection and
quantitation of TAT polypeptide in vitro, e.g., in an ELISA or a
Western blot. As with the article of manufacture, the kit comprises
a container and a label or package insert on or associated with the
container. The container holds a composition comprising at least
one anti-TAT antibody of the invention. Additional containers may
be included that contain, e.g., diluents and buffers, control
antibodies. The label or package insert may provide a description
of the composition as well as instructions for the intended in
vitro or diagnostic use.
[0298] K. Uses for TAT Polypeptides and TAT-Polypeptide Encoding
Nucleic Acids
[0299] Nucleotide sequences (or their complement) encoding TAT
polypeptides have various applications in the art of molecular
biology, including uses as hybridization probes, in chromosome and
gene mapping and in the generation of anti-sense RNA and DNA
probes. TAT-encoding nucleic acid will also be useful for the
preparation of TAT polypeptides by the recombinant techniques
described herein, wherein those TAT polypeptides may find use, for
example, in the preparation of anti-TAT antibodies as described
herein.
[0300] The full-length native sequence TAT gene, or portions
thereof, may be used as hybridization probes for a cDNA library to
isolate the full-length TAT cDNA or to isolate still other cDNAs
(for instance, those encoding naturally-occurring variants of TAT
or TAT from other species) which have a desired sequence identity
to the native TAT sequence disclosed herein. Optionally, the length
of the probes will be about 20 to about 50 bases. The hybridization
probes may be derived from at least partially novel regions of the
full length native nucleotide sequence wherein those regions may be
determined without undue experimentation or from genomic sequences
including promoters, enhancer elements and introns of native
sequence TAT. By way of example, a screening method will comprise
isolating the coding region of the TAT gene using the known DNA
sequence to synthesize a selected probe of about 40 bases.
Hybridization probes may be labeled by a variety of labels,
including radionucleotides such as .sup.32P or .sup.35S, or
enzymatic labels such as alkaline phosphatase coupled to the probe
via avidin/biotin coupling systems. Labeled probes having a
sequence complementary to that of the TAT gene of the present
invention can be used to screen libraries of human cDNA, genomic
DNA or mRNA to determine which members of such libraries the probe
hybridizes to. Hybridization techniques are described in further
detail in the Examples below. Any EST sequences disclosed in the
present application may similarly be employed as probes, using the
methods disclosed herein.
[0301] Other useful fragments of the TAT-encoding nucleic acids
include antisense or sense oligonucleotides comprising a
singe-stranded nucleic acid sequence (either RNA or DNA) capable of
binding to target TAT mRNA (sense) or TAT DNA (antisense)
sequences. Antisense or sense oligonucleotides, according to the
present invention, comprise a fragment of the coding region of TAT
DNA. Such a fragment generally comprises at least about 14
nucleotides, preferably from about 14 to 30 nucleotides. The
ability to derive an antisense or a sense oligonucleotide, based
upon a cDNA sequence encoding a given protein is described in, for
example, Stein and Cohen (Cancer Res. 48:2659, 1988) and van der
Krol et al. (BioTechniques 6:958, 1988).
[0302] Binding of antisense or sense oligonucleotides to target
nucleic acid sequences results in the formation of duplexes that
block transcription or translation of the target sequence by one of
several means, including enhanced degradation of the duplexes,
premature termination of transcription or translation, or by other
means. Such methods are encompassed by the present invention. The
antisense oligonucleotides thus may be used to block expression of
TAT proteins, wherein those TAT proteins may play a role in the
induction of cancer in mammals. Antisense or sense oligonucleotides
further comprise oligonucleotides having modified
sugar-phosphodiester backbones (or other sugar linkages, such as
those described in WO 91/06629) and wherein such sugar linkages are
resistant to endogenous nucleases. Such oligonucleotides with
resistant sugar linkages are stable in vivo (i.e., capable of
resisting enzymatic degradation) but retain sequence specificity to
be able to bind to target nucleotide sequences.
[0303] Other examples of sense or antisense oligonucleotides
include those oligonucleotides which are covalently linked to
organic moieties, such as those described in WO 90/10048, and other
moieties that increases affinity of the oligonucleotide for a
target nucleic acid sequence, such as poly-(L-lysine). Further
still, intercalating agents, such as ellipticine, and alkylating
agents or metal complexes may be attached to sense or antisense
oligonucleotides to modify binding specificities of the antisense
or sense oligonucleotide for the target nucleotide sequence.
[0304] Antisense or sense oligonucleotides may be introduced into a
cell containing the target nucleic acid sequence by any gene
transfer method, including, for example, CaPO.sub.4-mediated DNA
transfection, electroporation, or by using gene transfer vectors
such as Epstein-Barr virus. In a preferred procedure, an antisense
or sense oligonucleotide is inserted into a suitable retroviral
vector. A cell containing the target nucleic acid sequence is
contacted with the recombinant retroviral vector, either in vivo or
ex vivo. Suitable retroviral vectors include, but are not limited
to, those derived from the murine retrovirus M-MuLV, N2 (a
retrovirus derived from M-MuLV), or the double copy vectors
designated DCT5A, DCT5B and DCT5C (see WO 90/13641).
[0305] Sense or antisense oligonucleotides also may be introduced
into a cell containing the target nucleotide sequence by formation
of a conjugate with a ligand binding molecule, as described in WO
91/04753. Suitable ligand binding molecules include, but are not
limited to, cell surface receptors, growth factors, other
cytokines, or other ligands that bind to cell surface receptors.
Preferably, conjugation of the ligand binding molecule does not
substantially interfere with the ability of the ligand binding
molecule to bind to its corresponding molecule or receptor, or
block entry of the sense or antisense oligonucleotide or its
conjugated version into the cell.
[0306] Alternatively, a sense or an antisense oligonucleotide may
be introduced into a cell containing the target nucleic acid
sequence by formation of an oligonucleotide-lipid complex, as
described in WO 90/10448. The sense or antisense
oligonucleotide-lipid complex is preferably dissociated within the
cell by an endogenous lipase.
[0307] Antisense or sense RNA or DNA molecules are generally at
least about 5 nucleotides in length, alternatively at least about
6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23,
24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80,
85, 90, 95, 100, 105, 110, 115, 120, 125, 130, 135, 140, 145, 150,
155, 160, 165, 170, 175, 180, 185, 190, 195, 200, 210, 220, 230,
240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360,
370, 380, 390, 400, 410, 420, 430, 440, 450, 460, 470, 480, 490,
500, 510, 520, 530, 540, 550, 560, 570, 580, 590, 600, 610, 620,
630, 640, 650, 660, 670, 680, 690, 700, 710, 720, 730, 740, 750,
760, 770, 780, 790, 800, 810, 820, 830, 840, 850, 860, 870, 880,
890, 900, 910, 920, 930, 940, 950, 960, 970, 980, 990, or 1000
nucleotides in length, wherein in this context the term "about"
means the referenced nucleotide sequence length plus or minus 10%
of that referenced length.
[0308] The probes may also be employed in PCR techniques to
generate a pool of sequences for identification of closely related
TAT coding sequences.
[0309] Nucleotide sequences encoding a TAT can also be used to
construct hybridization probes for mapping the gene which encodes
that TAT and for the genetic analysis of individuals with genetic
disorders. The nucleotide sequences provided herein may be mapped
to a chromosome and specific regions of a chromosome using known
techniques, such as in situ hybridization, linkage analysis against
known chromosomal markers, and hybridization screening with
libraries.
[0310] When the coding sequences for TAT encode a protein which
binds to another protein (example, where the TAT is a receptor),
the TAT can be used in assays to identify the other proteins or
molecules involved in the binding interaction. By such methods,
inhibitors of the receptor/ligand binding interaction can be
identified. Proteins involved in such binding interactions can also
be used to screen for peptide or small molecule inhibitors or
agonists of the binding interaction. Also, the receptor TAT can be
used to isolate correlative ligand(s). Screening assays can be
designed to find lead compounds that mimic the biological activity
of a native TAT or a receptor for TAT. Such screening assays will
include assays amenable to high-throughput screening of chemical
libraries, making them particularly suitable for identifying small
molecule drug candidates. Small molecules contemplated include
synthetic organic or inorganic compounds. The assays can be
performed in a variety of formats, including protein-protein
binding assays, biochemical screening assays, immunoassays and cell
based assays, which are well characterized in the art.
[0311] For cancer, a variety of well-known animal models can be
used to further understand the role of the genes identified herein
in the development and pathogenesis of tumors, and to test the
efficacy of candidate therapeutic agents, including antibodies and
other antagonists of native TAT polypeptides, such as
small-molecule antagonists. The in vivo nature of such models makes
them particularly predictive of responses in human patients. Animal
models of tumors and cancers (e.g., breast cancer, colon cancer,
prostate cancer, lung cancer, etc.) include both non-recombinant
and recombinant (transgenic) animals. Non-recombinant animal models
include, for example, rodent, e.g., murine models. Such models can
be generated by introducing tumor cells into syngeneic mice using
standard techniques, e.g., subcutaneous injection, tail vein
injection, spleen implantation, intraperitoneal implantation,
implantation under the renal capsule, or orthopin implantation,
e.g., colon cancer cells implanted in colonic tissue. See, e.g.,
PCT publication No. WO 97/33551, published Sep. 18, 1997. Probably
the most often used animal species in oncological studies are
immunodeficient mice and, in particular, nude mice. The observation
that the nude mouse with thymic hypo/aplasia could successfully act
as a host for human tumor xenografts has lead to its widespread use
for this purpose. The autosomal recessive nu gene has been
introduced into a very large number of distinct congenic strains of
nude mouse, including, for example, ASW, A/He, AKR, BALB/c, B10.LP,
C17, C3H, C57BL, C57, CBA, DBA, DDD, I/st, NC, NFR, NFS, NFS/N,
NZB, NZC, NZW, P, RIII, and SJL. In addition, a wide variety of
other animals with inherited immunological defects other than the
nude mouse have been bred and used as recipients of tumor
xenografts. For further details see, e.g., The Nude Mouse in
Oncology Research, E. Boven and B. Winograd, eds. (CRC Press, Inc.,
1991).
[0312] The cells introduced into such animals can be derived from
known tumor/cancer cell lines, such as any of the above-listed
tumor cell lines, and, for example, the B104-1-1 cell line (stable
NIH-3T3 cell line transfected with the neu protooncogene);
ras-transfected NIH-3T3 cells; Caco-2 (ATCC HTB-37); or a
moderately well-differentiated grade II human colon adenocarcinoma
cell line, HT-29 (ATCC HTB-38); or from tumors and cancers. Samples
of tumor or cancer cells can be obtained from patients undergoing
surgery, using standard conditions involving freezing and storing
in liquid nitrogen. Karmali et al., Br. J. Cancer, 48: 689-696
(1983).
[0313] Tumor cells can be introduced into animals such as nude mice
by a variety of procedures. The subcutaneous (s.c.) space in mice
is very suitable for tumor implantation. Tumors can be transplanted
s.c. as solid blocks, as needle biopsies by use of a trochar, or as
cell suspensions. For solid-block or trochar implantation, tumor
tissue fragments of suitable size are introduced into the s.c.
space. Cell suspensions are freshly prepared from primary tumors or
stable tumor cell lines, and injected subcutaneously. Tumor cells
can also be injected as subdermal implants. In this location, the
inoculum is deposited between the lower part of the dermal
connective tissue and the s.c. tissue.
[0314] Animal models of breast cancer can be generated, for
example, by implanting rat neuroblastoma cells (from which the neu
oncogene was initially isolated), or neu-transformed NIH-3T3 cells
into nude mice, essentially as described by Drebin et al. Proc.
Nat. Acad. Sci. USA, 83: 9129-9133 (1986).
[0315] Similarly, animal models of colon cancer can be generated by
passaging colon cancer cells in animals, e.g., nude mice, leading
to the appearance of tumors in these animals. An orthotopic
transplant model of human colon cancer in nude mice has been
described, for example, by Wang et al., Cancer Research, 54:
4726-4728 (1994) and Too et al., Cancer Research, 55: 681-684
(1995). This model is based on the so-called "METAMOUSE.TM." sold
by AntiCancer, Inc., (San Diego, Calif.).
[0316] Tumors that arise in animals can be removed and cultured in
vitro. Cells from the in vitro cultures can then be passaged to
animals. Such tumors can serve as targets for further testing or
drug screening. Alternatively, the tumors resulting from the
passage can be isolated and RNA from pre-passage cells and cells
isolated after one or more rounds of passage analyzed for
differential expression of genes of interest. Such passaging
techniques can be performed with any known tumor or cancer cell
lines.
[0317] For example, Meth A, CMS4, CMS5, CMS21, and WEHI-164 are
chemically induced fibrosarcomas of BALB/c female mice (DeLeo et
al., J. Exp. Med., 146: 720 (1977)), which provide a highly
controllable model system for studying the anti-tumor activities of
various agents. Palladino et al., J. Immunol., 138: 4023-4032
(1987). Briefly, tumor cells are propagated in vitro in cell
culture. Prior to injection into the animals, the cell lines are
washed and suspended in buffer, at a cell density of about
10.times.10.sup.6 to 10.times.10.sup.7 cells/ml. The animals are
then infected subcutaneously with 10 to 100 .mu.l of the cell
suspension, allowing one to three weeks for a tumor to appear.
[0318] In addition, the Lewis lung (3LL) carcinoma of mice, which
is one of the most thoroughly studied experimental tumors, can be
used as an investigational tumor model. Efficacy in this tumor
model has been correlated with beneficial effects in the treatment
of human patients diagnosed with small-cell carcinoma of the lung
(SCCL). This tumor can be introduced in normal mice upon injection
of tumor fragments from an affected mouse or of cells maintained in
culture. Zupi et al., Br. J. Cancer, 41: suppl. 4, 30 (1980).
Evidence indicates that tumors can be started from injection of
even a single cell and that a very high proportion of infected
tumor cells survive. For further information about this tumor model
see, Zacharski, Haemostasis, 16: 300-320 (1986).
[0319] One way of evaluating the efficacy of a test compound in an
animal model with an implanted tumor is to measure the size of the
tumor before and after treatment. Traditionally, the size of
implanted tumors has been measured with a slide caliper in two or
three dimensions. The measure limited to two dimensions does not
accurately reflect the size of the tumor; therefore, it is usually
converted into the corresponding volume by using a mathematical
formula. However, the measurement of tumor size is very inaccurate.
The therapeutic effects of a drug candidate can be better described
as treatment-induced growth delay and specific growth delay.
Another important variable in the description of tumor growth is
the tumor volume doubling time. Computer programs for the
calculation and description of tumor growth are also available,
such as the program reported by Rygaard and Spang-Thomsen, Proc.
6th Int. Workshop on Immune-Deficient Animals, Wu and Sheng eds.
(Basel, 1989), p. 301. It is noted, however, that necrosis and
inflammatory responses following treatment may actually result in
an increase in tumor size, at least initially. Therefore, these
changes need to be carefully monitored, by a combination of a
morphometric method and flow cytometric analysis.
[0320] Further, recombinant (transgenic) animal models can be
engineered by introducing the coding portion of the TAT gene
identified herein into the genome of animals of interest, using
standard techniques for producing transgenic animals. Animals that
can serve as a target for transgenic manipulation include, without
limitation, mice, rats, rabbits, guinea pigs, sheep, goats, pigs,
and non-human primates, e.g., baboons, chimpanzees and monkeys.
Techniques known in the art to introduce a transgene into such
animals include pronucleic microinjection (U.S. Pat. No.
4,873,191); retrovirus-mediated gene transfer into germ lines
(e.g., Van der Putten et al., Proc. Natl. Acad. Sci. USA, 82:
6148-615 (1985)); gene targeting in embryonic stem cells (Thompson
et al., Cell, 56: 313-321 (1989)); electroporation of embryos (Lo,
Mol. Cell. Biol., 3: 1803-1814 (1983)); and sperm-mediated gene
transfer. Lavitrano et al., Cell, 57: 717-73 (1989). For a review,
see for example, U.S. Pat. No. 4,736,866.
[0321] For the purpose of the present invention, transgenic animals
include those that carry the transgene only in part of their cells
("mosaic animals"). The transgene can be integrated either as a
single transgene, or in concatamers, e.g., head-to-head or
head-to-tail tandems. Selective introduction of a transgene into a
particular cell type is also possible by following, for example,
the technique of Lasko et al., Proc. Natl. Acad. Sci. USA, 89:
6232-636 (1992). The expression of the transgene in transgenic
animals can be monitored by standard techniques. For example,
Southern blot analysis or PCR amplification can be used to verify
the integration of the transgene. The level of mRNA expression can
then be analyzed using techniques such as in situ hybridization,
Northern blot analysis, PCR, or immunocytochemistry. The animals
are further examined for signs of tumor or cancer development.
[0322] Alternatively, "knock-out" animals can be constructed that
have a defective or altered gene encoding a PRO polypeptide
identified herein, as a result of homologous recombination between
the endogenous gene encoding the TAT polypeptide and altered
genomic DNA encoding the same polypeptide introduced into an
embryonic cell of the animal. For example, cDNA encoding a
particular TAT polypeptide can be used to clone genomic DNA
encoding that polypeptide in accordance with established
techniques. A portion of the genomic DNA encoding a particular TAT
polypeptide can be deleted or replaced with another gene, such as a
gene encoding a selectable marker that can be used to monitor
integration. Typically, several kilobases of unaltered flanking DNA
(both at the 5' and 3' ends) are included in the vector. See, e.g.,
Thomas and Capecchi, Cell, 51: 503 (1987) for a description of
homologous recombination vectors. The vector is introduced into an
embryonic stem cell line (e.g., by electroporation) and cells in
which the introduced DNA has homologously recombined with the
endogenous DNA are selected. See, e.g., Li et al., Cell, 69: 915
(1992). The selected cells are then injected into a blastocyst of
an animal (e.g., a mouse or rat) to form aggregation chimeras. See,
e.g., Bradley, in Teratocarcinomas and Embryonic Stem Cells: A
Practical Approach, E. J. Robertson, ed. (IRL: Oxford, 1987), pp.
113-152. A chimeric embryo can then be implanted into a suitable
pseudopregnant female foster animal and the embryo brought to term
to create a "knock-out" animal. Progeny harboring the homologously
recombined DNA in their germ cells can be identified by standard
techniques and used to breed animals in which all cells of the
animal contain the homologously recombined DNA. Knockout animals
can be characterized, for instance, by their ability to defend
against certain pathological conditions and by their development of
pathological conditions due to absence of the TAT polypeptide.
[0323] The efficacy of antibodies specifically binding the TAT
polypeptides identified herein, and other drug candidates, can be
tested also in the treatment of spontaneous animal tumors. A
suitable target for such studies is the feline oral squamous cell
carcinoma (SCC). Feline oral SCC is a highly invasive, malignant
tumor that is the most common oral malignancy of cats, accounting
for over 60% of the oral tumors reported in this species. It rarely
metastasizes to distant sites, although this low incidence of
metastasis may merely be a reflection of the short survival times
for cats with this tumor. These tumors are usually not amenable to
surgery, primarily because of the anatomy of the feline oral
cavity. At present, there is no effective treatment for this tumor.
Prior to entry into the study, each cat undergoes complete clinical
examination and biopsy, and is scanned by computed tomography (CT).
Cats diagnosed with sublingual oral squamous cell tumors are
excluded from the study. The tongue can become paralyzed as a
result of such tumor, and even if the treatment kills the tumor,
the animals may not be able to feed themselves. Each cat is treated
repeatedly, over a longer period of time. Photographs of the tumors
will be taken daily during the treatment period, and at each
subsequent recheck. After treatment, each cat undergoes another CT
scan. CT scans and thoracic radiograms are evaluated every 8 weeks
thereafter. The data are evaluated for differences in survival,
response, and toxicity as compared to control groups. Positive
response may require evidence of tumor regression, preferably with
improvement of quality of life and/or increased life span.
[0324] Nucleic acid encoding the TAT polypeptides may also be used
in gene therapy. In gene therapy applications, genes are introduced
into cells in order to achieve in vivo synthesis of a
therapeutically effective genetic product, for example for
replacement of a defective gene. "Gene therapy" includes both
conventional gene therapy where a lasting effect is achieved by a
single treatment, and the administration of gene therapeutic
agents, which involves the one time or repeated administration of a
therapeutically effective DNA or mRNA. Antisense RNAs and DNAs can
be used as therapeutic agents for blocking the expression of
certain genes in vivo. It has already been shown that short
antisense oligonucleotides can be imported into cells where they
act as inhibitors, despite their low intracellular concentrations
caused by their restricted uptake by the cell membrane. (Zamecnik
et al., Proc. Natl. Acad. Sci. USA 83:4143-4146 [1986]). The
oligonucleotides can be modified to enhance their uptake, e.g. by
substituting their negatively charged phosphodiester groups by
uncharged groups.
[0325] There are a variety of techniques available for introducing
nucleic acids into viable cells. The techniques vary depending upon
whether the nucleic acid is transferred into cultured cells in
vitro, or in vivo in the cells of the intended host. Techniques
suitable for the transfer of nucleic acid into mammalian cells in
vitro include the use of liposomes, electroporation,
microinjection, cell fusion, DEAE-dextran, the calcium phosphate
precipitation method, etc. The currently preferred in vivo gene
transfer techniques include transfection with viral (typically
retroviral) vectors and viral coat protein-liposome mediated
transfection (Dzau et al., Trends in Biotechnology 11, 205-210
[1993]). In some situations it is desirable to provide the nucleic
acid source with an agent that targets the target cells, such as an
antibody specific for a cell surface membrane protein or the target
cell, a ligand for a receptor on the target cell, etc. Where
liposomes are employed, proteins which bind to a cell surface
membrane protein associated with endocytosis may be used for
targeting and/or to facilitate uptake, e.g. capsid proteins or
fragments thereof tropic for a particular cell type, antibodies for
proteins which undergo internalization in cycling, proteins that
target intracellular localization and enhance intracellular
half-life. The technique of receptor-mediated endocytosis is
described, for example, by Wu et al., J. Biol. Chem. 262, 4429-4432
(1987); and Wagner et al., Proc. Natl. Acad. Sci. USA 87, 3410-3414
(1990). For review of gene marking and gene therapy protocols see
Anderson et al., Science 256, 808-813 (1992).
[0326] The nucleic acid molecules encoding the TAT polypeptides or
fragments thereof described herein are useful for chromosome
identification. In this regard, there exists an ongoing need to
identify new chromosome markers, since relatively few chromosome
marking reagents, based upon actual sequence data are presently
available. Each TAT nucleic acid molecule of the present invention
can be used as a chromosome marker.
[0327] The TAT polypeptides and nucleic acid molecules of the
present invention may also be used diagnostically for tissue
typing, wherein the TAT polypeptides of the present invention may
be differentially expressed in one tissue as compared to another,
preferably in a diseased tissue as compared to a normal tissue of
the same tissue type. TAT nucleic acid molecules will find use for
generating probes for PCR, Northern analysis, Southern analysis and
Western analysis.
[0328] This invention encompasses methods of screening compounds to
identify those that mimic the TAT polypeptide (agonists) or prevent
the effect of the TAT polypeptide (antagonists). Screening assays
for antagonist drug candidates are designed to identify compounds
that bind or complex with the TAT polypeptides encoded by the genes
identified herein, or otherwise interfere with the interaction of
the encoded polypeptides with other cellular proteins, including
e.g., inhibiting the expression of TAT polypeptide from cells. Such
screening assays will include assays amenable to high-throughput
screening of chemical libraries, making them particularly suitable
for identifying small molecule drug candidates.
[0329] The assays can be performed in a variety of formats,
including protein-protein binding assays, biochemical screening
assays, immunoassays, and cell-based assays, which are well
characterized in the art.
[0330] All assays for antagonists are common in that they call for
contacting the drug candidate with a TAT polypeptide encoded by a
nucleic acid identified herein under conditions and for a time
sufficient to allow these two components to interact.
[0331] In binding assays, the interaction is binding and the
complex formed can be isolated or detected in the reaction mixture.
In a particular embodiment, the TAT polypeptide encoded by the gene
identified herein or the drug candidate is immobilized on a solid
phase, e.g., on a microtiter plate, by covalent or non-covalent
attachments. Non-covalent attachment generally is accomplished by
coating the solid surface with a solution of the TAT polypeptide
and drying. Alternatively, an immobilized antibody, e.g., a
monoclonal antibody, specific for the TAT polypeptide to be
immobilized can be used to anchor it to a solid surface. The assay
is performed by adding the non-immobilized component, which may be
labeled by a detectable label, to the immobilized component, e.g.,
the coated surface containing the anchored component. When the
reaction is complete, the non-reacted components are removed, e.g.,
by washing, and complexes anchored on the solid surface are
detected. When the originally non-immobilized component carries a
detectable label, the detection of label immobilized on the surface
indicates that complexing occurred. Where the originally
non-immobilized component does not carry a label, complexing can be
detected, for example, by using a labeled antibody specifically
binding the immobilized complex.
[0332] If the candidate compound interacts with but does not bind
to a particular TAT polypeptide encoded by a gene identified
herein, its interaction with that polypeptide can be assayed by
methods well known for detecting protein-protein interactions. Such
assays include traditional approaches, such as, e.g.,
cross-linking, co-immunoprecipitation, and co-purification through
gradients or chromatographic columns. In addition, protein-protein
interactions can be monitored by using a yeast-based genetic system
described by Fields and co-workers (Fields and Song, Nature
(London), 340:245-246 (1989); Chien et al., Proc. Natl. Acad. Sci.
USA, 88:9578-9582 (1991)) as disclosed by Chevray and Nathans,
Proc. Natl. Acad. Sci. USA, 89: 5789-5793 (1991). Many
transcriptional activators, such as yeast GAL4, consist of two
physically discrete modular domains, one acting as the DNA-binding
domain, the other one functioning as the transcription-activation
domain. The yeast expression system described in the foregoing
publications (generally referred to as the "two-hybrid system")
takes advantage of this property, and employs two hybrid proteins,
one in which the target protein is fused to the DNA-binding domain
of GAL4, and another, in which candidate activating proteins are
fused to the activation domain. The expression of a GAL1-lacZ
reporter gene under control of a GAL4-activated promoter depends on
reconstitution of GAL4 activity via protein-protein interaction.
Colonies containing interacting polypeptides are detected with a
chromogenic substrate for .beta.-galactosidase. A complete kit
(MATCHMAKER.TM.) for identifying protein-protein interactions
between two specific proteins using the two-hybrid technique is
commercially available from Clontech. This system can also be
extended to map protein domains involved in specific protein
interactions as well as to pinpoint amino acid residues that are
crucial for these interactions.
[0333] Compounds that interfere with the interaction of a gene
encoding a TAT polypeptide identified herein and other intra- or
extracellular components can be tested as follows: usually a
reaction mixture is prepared containing the product of the gene and
the intra- or extracellular component under conditions and for a
time allowing for the interaction and binding of the two products.
To test the ability of a candidate compound to inhibit binding, the
reaction is run in the absence and in the presence of the test
compound. In addition, a placebo may be added to a third reaction
mixture, to serve as positive control. The binding (complex
formation) between the test compound and the intra- or
extracellular component present in the mixture is monitored as
described hereinabove. The formation of a complex in the control
reaction(s) but not in the reaction mixture containing the test
compound indicates that the test compound interferes with the
interaction of the test compound and its reaction partner.
[0334] To assay for antagonists, the TAT polypeptide may be added
to a cell along with the compound to be screened for a particular
activity and the ability of the compound to inhibit the activity of
interest in the presence of the TAT polypeptide indicates that the
compound is an antagonist to the TAT polypeptide. Alternatively,
antagonists may be detected by combining the TAT polypeptide and a
potential antagonist with membrane-bound TAT polypeptide receptors
or recombinant receptors under appropriate conditions for a
competitive inhibition assay. The TAT polypeptide can be labeled,
such as by radioactivity, such that the number of TAT polypeptide
molecules bound to the receptor can be used to determine the
effectiveness of the potential antagonist. The gene encoding the
receptor can be identified by numerous methods known to those of
skill in the art, for example, ligand panning and FACS sorting.
Coligan et al., Current Protocols in Immun., 1(2): Chapter 5
(1991). Preferably, expression cloning is employed wherein
polyadenylated RNA is prepared from a cell responsive to the TAT
polypeptide and a cDNA library created from this RNA is divided
into pools and used to transfect COS cells or other cells that are
not responsive to the TAT polypeptide. Transfected cells that are
grown on glass slides are exposed to labeled TAT polypeptide. The
TAT polypeptide can be labeled by a variety of means including
iodination or inclusion of a recognition site for a site-specific
protein kinase. Following fixation and incubation, the slides are
subjected to autoradiographic analysis. Positive pools are
identified and sub-pools are prepared and re-transfected using an
interactive sub-pooling and re-screening process, eventually
yielding a single clone that encodes the putative receptor.
[0335] As an alternative approach for receptor identification,
labeled TAT polypeptide can be photoaffinity-linked with cell
membrane or extract preparations that express the receptor
molecule. Cross-linked material is resolved by PAGE and exposed to
X-ray film. The labeled complex containing the receptor can be
excised, resolved into peptide fragments, and subjected to protein
micro-sequencing. The amino acid sequence obtained from
micro-sequencing would be used to design a set of degenerate
oligonucleotide probes to screen a cDNA library to identify the
gene encoding the putative receptor.
[0336] In another assay for antagonists, mammalian cells or a
membrane preparation expressing the receptor would be incubated
with labeled TAT polypeptide in the presence of the candidate
compound. The ability of the compound to enhance or block this
interaction could then be measured.
[0337] More specific examples of potential antagonists include an
oligonucleotide that binds to the fusions of immunoglobulin with
TAT polypeptide, and, in particular, antibodies including, without
limitation, poly- and monoclonal antibodies and antibody fragments,
single-chain antibodies, anti-idiotypic antibodies, and chimeric or
humanized versions of such antibodies or fragments, as well as
human antibodies and antibody fragments. Alternatively, a potential
antagonist may be a closely related protein, for example, a mutated
form of the TAT polypeptide that recognizes the receptor but
imparts no effect, thereby competitively inhibiting the action of
the TAT polypeptide.
[0338] Another potential TAT polypeptide antagonist is an antisense
RNA or DNA construct prepared using antisense technology, where,
e.g., an antisense RNA or DNA molecule acts to block directly the
translation of mRNA by hybridizing to targeted mRNA and preventing
protein translation. Antisense technology can be used to control
gene expression through triple-helix formation or antisense DNA or
RNA, both of which methods are based on binding of a polynucleotide
to DNA or RNA. For example, the 5' coding portion of the
polynucleotide sequence, which encodes the mature TAT polypeptides
herein, is used to design an antisense RNA oligonucleotide of from
about 10 to 40 base pairs in length. A DNA oligonucleotide is
designed to be complementary to a region of the gene involved in
transcription (triple helix--see Lee et al., Nucl. Acids Res.,
6:3073 (1979); Cooney et al., Science, 241: 456 (1988); Dervan et
al., Science, 251:1360 (1991)), thereby preventing transcription
and the production of the TAT polypeptide. The antisense RNA
oligonucleotide hybridizes to the mRNA in vivo and blocks
translation of the mRNA molecule into the TAT polypeptide
(antisense--Okano, Neurochem., 56:560 (1991); Oligodeoxynucleotides
as Antisense Inhibitors of Gene Expression (CRC Press: Boca Raton,
Fla., 1988). The oligonucleotides described above can also be
delivered to cells such that the antisense RNA or DNA may be
expressed in vivo to inhibit production of the TAT polypeptide.
When antisense DNA is used, oligodeoxyribonucleotides derived from
the translation-initiation site, e.g., between about -10 and +10
positions of the target gene nucleotide sequence, are
preferred.
[0339] Potential antagonists include small molecules that bind to
the active site, the receptor binding site, or growth factor or
other relevant binding site of the TAT polypeptide, thereby
blocking the normal biological activity of the TAT polypeptide.
Examples of small molecules include, but are not limited to, small
peptides or peptide-like molecules, preferably soluble peptides,
and synthetic non-peptidyl organic or inorganic compounds.
[0340] Ribozymes are enzymatic RNA molecules capable of catalyzing
the specific cleavage of RNA. Ribozymes act by sequence-specific
hybridization to the complementary target RNA, followed by
endonucleolytic cleavage. Specific ribozyme cleavage sites within a
potential RNA target can be identified by known techniques. For
further details see, e.g., Rossi, Current Biology, 4:469-471
(1994), and PCT publication No. WO 97/33551 (published Sep. 18,
1997).
[0341] Nucleic acid molecules in triple-helix formation used to
inhibit transcription should be single-stranded and composed of
deoxynucleotides. The base composition of these oligonucleotides is
designed such that it promotes triple-helix formation via Hoogsteen
base-pairing rules, which generally require sizeable stretches of
purines or pyrimidines on one strand of a duplex. For further
details see, e.g., PCT publication No. WO 97/33551, supra.
[0342] These small molecules can be identified by any one or more
of the screening assays discussed hereinabove and/or by any other
screening techniques well known for those skilled in the art.
[0343] Isolated TAT polypeptide-encoding nucleic acid can be used
herein for recombinantly producing TAT polypeptide using techniques
well known in the art and as described herein. In turn, the
produced TAT polypeptides can be employed for generating anti-TAT
antibodies using techniques well known in the art and as described
herein.
[0344] Antibodies specifically binding a TAT polypeptide identified
herein, as well as other molecules identified by the screening
assays disclosed herein before, can be administered for the
treatment of various disorders, including cancer, in the form of
pharmaceutical compositions.
[0345] If the TAT polypeptide is intracellular and whole antibodies
are used as inhibitors, internalizing antibodies are preferred.
However, lipofections or liposomes can also be used to deliver the
antibody, or an antibody fragment, into cells. Where antibody
fragments are used, the smallest inhibitory fragment that
specifically binds to the binding domain of the target protein is
preferred. For example, based upon the variable-region sequences of
an antibody, peptide molecules can be designed that retain the
ability to bind the target protein sequence. Such peptides can be
synthesized chemically and/or produced by recombinant DNA
technology. See, e.g., Marasco et al, Proc. Natl. Acad. Sci. USA,
90: 7889-7893 (1993).
[0346] The formulation herein may also contain more than one active
compound as necessary for the particular indication being treated,
preferably those with complementary activities that do not
adversely affect each other. Alternatively, or in addition, the
composition may comprise an agent that enhances its function, such
as, for example, a cytotoxic agent, cytokine, chemotherapeutic
agent, or growth-inhibitory agent. Such molecules are suitably
present in combination in amounts that are effective for the
purpose intended.
[0347] The following examples are offered for illustrative purposes
only, and are not intended to limit the scope of the present
invention in any way.
[0348] All patent and literature references cited in the present
specification are hereby incorporated by reference in their
entirety.
EXAMPLES
[0349] Commercially available reagents referred to in the examples
were used according to manufacturer's instructions unless otherwise
indicated. The source of those cells identified in the following
examples, and throughout the specification, by ATCC accession
numbers is the American Type Culture Collection, Manassas, Va.
Example 1
Use of TAT as a Hybridization Probe
[0350] The following method describes use of a nucleotide sequence
encoding TAT as a hybridization probe for, i.e., diagnosis of the
presence of a tumor in a mammal.
[0351] DNA comprising the coding sequence of full-length or mature
TAT as disclosed herein can also be employed as a probe to screen
for homologous DNAs (such as those encoding naturally-occurring
variants of TAT) in human tissue cDNA libraries or human tissue
genomic libraries.
[0352] Hybridization and washing of filters containing either
library DNAs is performed under the following high stringency
conditions. Hybridization of radiolabeled TAT-derived probe to the
filters is performed in a solution of 50% formamide, 5.times.SSC,
0.1% SDS, 0.1% sodium pyrophosphate, 50 mM sodium phosphate, pH
6.8, 2.times. Denhardt's solution, and 10% dextran sulfate at
42.degree. C. for 20 hours. Washing of the filters is performed in
an aqueous solution of 0.1.times.SSC and 0.1% SDS at 42.degree.
C.
[0353] DNAs having a desired sequence identity with the DNA
encoding full-length native sequence TAT can then be identified
using standard techniques known in the art.
Example 2
Expression of TAT in E. coli
[0354] This example illustrates preparation of an unglycosylated
form of TAT by recombinant expression in E. coli.
[0355] The DNA sequence encoding TAT is initially amplified using
selected PCR primers. The primers should contain restriction enzyme
sites which correspond to the restriction enzyme sites on the
selected expression vector. A variety of expression vectors may be
employed. An example of a suitable vector is pBR322 (derived from
E. coli; see Bolivar et al., Gene, 2:95 (1977)) which contains
genes for ampicillin and tetracycline resistance. The vector is
digested with restriction enzyme and dephosphorylated. The PCR
amplified sequences are then ligated into the vector. The vector
will preferably include sequences which encode for an antibiotic
resistance gene, a trp promoter, a polyhis leader (including the
first six STII codons, polyhis sequence, and enterokinase cleavage
site), the TAT coding region, lambda transcriptional terminator,
and an argU gene.
[0356] The ligation mixture is then used to transform a selected E.
coli strain using the methods described in Sambrook et al., supra.
Transformants are identified by their ability to grow on LB plates
and antibiotic resistant colonies are then selected. Plasmid DNA
can be isolated and confirmed by restriction analysis and DNA
sequencing.
[0357] Selected clones can be grown overnight in liquid culture
medium such as LB broth supplemented with antibiotics. The
overnight culture may subsequently be used to inoculate a larger
scale culture. The cells are then grown to a desired optical
density, during which the expression promoter is turned on.
[0358] After culturing the cells for several more hours, the cells
can be harvested by centrifugation. The cell pellet obtained by the
centrifugation can be solubilized using various agents known in the
art, and the solubilized TAT protein can then be purified using a
metal chelating column under conditions that allow tight binding of
the protein.
[0359] TAT may be expressed in E. coli in a poly-His tagged form,
using the following procedure. The DNA encoding TAT is initially
amplified using selected PCR primers. The primers will contain
restriction enzyme sites which correspond to the restriction enzyme
sites on the selected expression vector, and other useful sequences
providing for efficient and reliable translation initiation, rapid
purification on a metal chelation column, and proteolytic removal
with enterokinase. The PCR-amplified, poly-His tagged sequences are
then ligated into an expression vector, which is used to transform
an E. coli host based on strain 52 (W3110 fuhA(tonA) lon galE
rpoHts(htpRts) clpP(lacIq). Transformants are first grown in LB
containing 50 mg/ml carbenicillin at 30.degree. C. with shaking
until an O.D.600 of 3-5 is reached. Cultures are then diluted
50-100 fold into CRAP media (prepared by mixing 3.57 g
(NH.sub.4).sub.2SO.sub.4, 0.71 g sodium citrate.2H2O, 1.07 g KCl,
5.36 g Difco yeast extract, 5.36 g Sheffield hycase SF in 500 mL
water, as well as 110 mM MPOS, pH 7.3, 0.55% (w/v) glucose and 7 mM
MgSO.sub.4) and grown for approximately 20-30 hours at 30.degree.
C. with shaking. Samples are removed to verify expression by
SDS-PAGE analysis, and the bulk culture is centrifuged to pellet
the cells. Cell pellets are frozen until purification and
refolding.
[0360] E. coli paste from 0.5 to 1 L fermentations (6-10 g pellets)
is resuspended in 10 volumes (w/v) in 7 M guanidine, 20 mM Tris, pH
8 buffer. Solid sodium sulfite and sodium tetrathionate is added to
make final concentrations of 0.1M and 0.02 M, respectively, and the
solution is stirred overnight at 4.degree. C. This step results in
a denatured protein with all cysteine residues blocked by
sulfitolization. The solution is centrifuged at 40,000 rpm in a
Beckman Ultracentifuge for 30 min. The supernatant is diluted with
3-5 volumes of metal chelate column buffer (6 M guanidine, 20 mM
Tris, pH 7.4) and filtered through 0.22 micron filters to clarify.
The clarified extract is loaded onto a 5 ml Qiagen Ni-NTA metal
chelate column equilibrated in the metal chelate column buffer. The
column is washed with additional buffer containing 50 mM imidazole
(Calbiochem, Utrol grade), pH 7.4. The protein is eluted with
buffer containing 250 mM imidazole. Fractions containing the
desired protein are pooled and stored at 4.degree. C. Protein
concentration is estimated by its absorbance at 280 nm using the
calculated extinction coefficient based on its amino acid
sequence.
[0361] The proteins are refolded by diluting the sample slowly into
freshly prepared refolding buffer consisting of: 20 mM Tris, pH
8.6, 0.3 M NaCl, 2.5 M urea, 5 mM cysteine, 20 mM glycine and 1 mM
EDTA. Refolding volumes are chosen so that the final protein
concentration is between 50 to 100 micrograms/ml. The refolding
solution is stirred gently at 4.degree. C. for 12-36 hours. The
refolding reaction is quenched by the addition of TFA to a final
concentration of 0.4% (pH of approximately 3). Before further
purification of the protein, the solution is filtered through a
0.22 micron filter and acetonitrile is added to 2-10% final
concentration. The refolded protein is chromatographed on a Poros
R1/H reversed phase column using a mobile buffer of 0.1% TFA with
elution with a gradient of acetonitrile from 10 to 80%. Aliquots of
fractions with A280 absorbance are analyzed on SDS polyacrylamide
gels and fractions containing homogeneous refolded protein are
pooled. Generally, the properly refolded species of most proteins
are eluted at the lowest concentrations of acetonitrile since those
species are the most compact with their hydrophobic interiors
shielded from interaction with the reversed phase resin. Aggregated
species are usually eluted at higher acetonitrile concentrations.
In addition to resolving misfolded forms of proteins from the
desired form, the reversed phase step also removes endotoxin from
the samples.
[0362] Fractions containing the desired folded TAT polypeptide are
pooled and the acetonitrile removed using a gentle stream of
nitrogen directed at the solution. Proteins are formulated into 20
mM Hepes, pH 6.8 with 0.14 M sodium chloride and 4% mannitol by
dialysis or by gel filtration using G25 Superfine (Pharmacia)
resins equilibrated in the formulation buffer and sterile
filtered.
[0363] Certain of the TAT polypeptides disclosed herein have been
successfully expressed and purified using this technique(s).
Example 3
Expression of TAT in Mammalian Cells
[0364] This example illustrates preparation of a potentially
glycosylated form of TAT by recombinant expression in mammalian
cells.
[0365] The vector, pRK5 (see EP 307,247, published Mar. 15, 1989),
is employed as the expression vector. Optionally, the TAT DNA is
ligated into pRK5 with selected restriction enzymes to allow
insertion of the TAT DNA using ligation methods such as described
in Sambrook et al., supra. The resulting vector is called
pRK5-TAT.
[0366] In one embodiment, the selected host cells may be 293 cells.
Human 293 cells (ATCC CCL 1573) are grown to confluence in tissue
culture plates in medium such as DMEM supplemented with fetal calf
serum and optionally, nutrient components and/or antibiotics. About
10 .mu.g pRK5-TAT DNA is mixed with about 1 .mu.g DNA encoding the
VA RNA gene [Thimmappaya et al., Cell, 31:543 (1982)] and dissolved
in 500 .mu.l of 1 mM Tris-HCl, 0.1 mM EDTA, 0.227 M CaCl.sub.2. To
this mixture is added, dropwise, 500 .mu.l of 50 mM HEPES (pH
7.35), 280 mM NaCl, 1.5 mM NaPO.sub.4, and a precipitate is allowed
to form for 10 minutes at 25.degree. C. The precipitate is
suspended and added to the 293 cells and allowed to settle for
about four hours at 37.degree. C. The culture medium is aspirated
off and 2 ml of 20% glycerol in PBS is added for 30 seconds. The
293 cells are then washed with serum free medium, fresh medium is
added and the cells are incubated for about 5 days.
[0367] Approximately 24 hours after the transfections, the culture
medium is removed and replaced with culture medium (alone) or
culture medium containing 200 .mu.Ci/ml .sup.35S-cysteine and 200
.mu.Ci/ml .sup.35S-methionine. After a 12 hour incubation, the
conditioned medium is collected, concentrated on a spin filter, and
loaded onto a 15% SDS gel. The processed gel may be dried and
exposed to film for a selected period of time to reveal the
presence of TAT polypeptide. The cultures containing transfected
cells may undergo further incubation (in serum free medium) and the
medium is tested in selected bioassays.
[0368] In an alternative technique, TAT may be introduced into 293
cells transiently using the dextran sulfate method described by
Somparyrac et al., Proc. Natl. Acad. Sci., 12:7575 (1981). 293
cells are grown to maximal density in a spinner flask and 700 .mu.g
pRK5-TAT DNA is added. The cells are first concentrated from the
spinner flask by centrifugation and washed with PBS. The
DNA-dextran precipitate is incubated on the cell pellet for four
hours. The cells are treated with 20% glycerol for 90 seconds,
washed with tissue culture medium, and re-introduced into the
spinner flask containing tissue culture medium, 5 .mu.g/ml bovine
insulin and 0.1 .mu.g/ml bovine transferrin. After about four days,
the conditioned media is centrifuged and filtered to remove cells
and debris. The sample containing expressed TAT can then be
concentrated and purified by any selected method, such as dialysis
and/or column chromatography.
[0369] In another embodiment, TAT can be expressed in CHO cells.
The pRK5-TAT can be transfected into CHO cells using known reagents
such as CaPO.sub.4 or DEAE-dextran. As described above, the cell
cultures can be incubated, and the medium replaced with culture
medium (alone) or medium containing a radiolabel such as
.sup.35S-methionine. After determining the presence of TAT
polypeptide, the culture medium may be replaced with serum free
medium. Preferably, the cultures are incubated for about 6 days,
and then the conditioned medium is harvested. The medium containing
the expressed TAT can then be concentrated and purified by any
selected method.
[0370] Epitope-tagged TAT may also be expressed in host CHO cells.
The TAT may be subcloned out of the pRK5 vector. The subclone
insert can undergo PCR to fuse in frame with a selected epitope tag
such as a poly-his tag into a Baculovirus expression vector. The
poly-his tagged TAT insert can then be subcloned into a SV40 driven
vector containing a selection marker such as DHFR for selection of
stable clones. Finally, the CHO cells can be transfected (as
described above) with the SV40 driven vector. Labeling may be
performed, as described above, to verify expression. The culture
medium containing the expressed poly-His tagged TAT can then be
concentrated and purified by any selected method, such as by
Ni.sup.2+-chelate affinity chromatography.
[0371] TAT may also be expressed in CHO and/or COS cells by a
transient expression procedure or in CHO cells by another stable
expression procedure.
[0372] Stable expression in CHO cells is performed using the
following procedure. The proteins are expressed as an IgG construct
(immunoadhesin), in which the coding sequences for the soluble
forms (e.g. extracellular domains) of the respective proteins are
fused to an IgG1 constant region sequence containing the hinge, CH2
and CH2 domains and/or is a poly-His tagged form.
[0373] Following PCR amplification, the respective DNAs are
subcloned in a CHO expression vector using standard techniques as
described in Ausubel et al., Current Protocols of Molecular
Biology, Unit 3.16, John Wiley and Sons (1997). CHO expression
vectors are constructed to have compatible restriction sites 5' and
3' of the DNA of interest to allow the convenient shuttling of
cDNA's. The vector used expression in CHO cells is as described in
Lucas et al., Nucl. Acids Res. 24:9 (1774-1779 (1996), and uses the
SV40 early promoter/enhancer to drive expression of the cDNA of
interest and dihydrofolate reductase (DHFR). DHFR expression
permits selection for stable maintenance of the plasmid following
transfection.
[0374] Twelve micrograms of the desired plasmid DNA is introduced
into approximately 10 million CHO cells using commercially
available transfection reagents Superfect.RTM. (Quiagen),
Dosper.RTM. or Fugene.RTM. (Boehringer Mannheim). The cells are
grown as described in Lucas et al., supra. Approximately
3.times.10.sup.7 cells are frozen in an ampule for further growth
and production as described below.
[0375] The ampules containing the plasmid DNA are thawed by
placement into water bath and mixed by vortexing. The contents are
pipetted into a centrifuge tube containing 10 mLs of media and
centrifuged at 1000 rpm for 5 minutes. The supernatant is aspirated
and the cells are resuspended in 10 mL of selective media (0.2
.mu.m filtered PS20 with 5% 0.2 .mu.m diafiltered fetal bovine
serum). The cells are then aliquoted into a 100 mL spinner
containing 90 mL of selective media. After 1-2 days, the cells are
transferred into a 250 mL spinner filled with 150 mL selective
growth medium and incubated at 37.degree. C. After another 2-3
days, 250 mL, 500 mL and 2000 mL spinners are seeded with
3.times.10.sup.5 cells/mL. The cell media is exchanged with fresh
media by centrifugation and resuspension in production medium.
Although any suitable CHO media may be employed, a production
medium described in U.S. Pat. No. 5,122,469, issued Jun. 16, 1992
may actually be used. A 3 L production spinner is seeded at
1.2.times.10.sup.6 cells/mL. On day 0, the cell number pH ie
determined. On day 1, the spinner is sampled and sparging with
filtered air is commenced. On day 2, the spinner is sampled, the
temperature shifted to 33.degree. C., and 30 mL of 500 g/L glucose
and 0.6 mL of 10% antifoam (e.g., 35% polydimethylsiloxane
emulsion, Dow Corning 365 Medical Grade Emulsion) taken. Throughout
the production, the pH is adjusted as necessary to keep it at
around 7.2. After 10 days, or until the viability dropped below
70%, the cell culture is harvested by centrifugation and filtering
through a 0.22 .mu.m filter. The filtrate was either stored at
4.degree. C. or immediately loaded onto columns for
purification.
[0376] For the poly-His tagged constructs, the proteins are
purified using a Ni-NTA column (Qiagen). Before purification,
imidazole is added to the conditioned media to a concentration of 5
mM. The conditioned media is pumped onto a 6 ml Ni-NTA column
equilibrated in 20 mM Hepes, pH 7.4, buffer containing 0.3 M NaCl
and 5 mM imidazole at a flow rate of 4-5 ml/min. at 4.degree. C.
After loading, the column is washed with additional equilibration
buffer and the protein eluted with equilibration buffer containing
0.25 M imidazole. The highly purified protein is subsequently
desalted into a storage buffer containing 10 mM Hepes, 0.14 M NaCl
and 4% mannitol, pH 6.8, with a 25 ml G25 Superfine (Pharmacia)
column and stored at -80.degree. C.
[0377] Immunoadhesin (Fc-containing) constructs are purified from
the conditioned media as follows. The conditioned medium is pumped
onto a 5 ml Protein A column (Pharmacia) which had been
equilibrated in 20 mM Na phosphate buffer, pH 6.8. After loading,
the column is washed extensively with equilibration buffer before
elution with 100 mM citric acid, pH 3.5. The eluted protein is
immediately neutralized by collecting 1 ml fractions into tubes
containing 275 .mu.L of 1 M Tris buffer, pH 9. The highly purified
protein is subsequently desalted into storage buffer as described
above for the poly-His tagged proteins. The homogeneity is assessed
by SDS polyacrylamide gels and by N-terminal amino acid sequencing
by Edman degradation.
[0378] Certain of the TAT polypeptides disclosed herein have been
successfully expressed and purified using this technique(s).
Example 4
Expression of TAT in Yeast
[0379] The following method describes recombinant expression of TAT
in yeast.
[0380] First, yeast expression vectors are constructed for
intracellular production or secretion of TAT from the ADH2/GAPDH
promoter. DNA encoding TAT and the promoter is inserted into
suitable restriction enzyme sites in the selected plasmid to direct
intracellular expression of TAT. For secretion, DNA encoding TAT
can be cloned into the selected plasmid, together with DNA encoding
the ADH2/GAPDH promoter, a native TAT signal peptide or other
mammalian signal peptide, or, for example, a yeast alpha-factor or
invertase secretory signal/leader sequence, and linker sequences
(if needed) for expression of TAT.
[0381] Yeast cells, such as yeast strain AB110, can then be
transformed with the expression plasmids described above and
cultured in selected fermentation media. The transformed yeast
supernatants can be analyzed by precipitation with 10%
trichloroacetic acid and separation by SDS-PAGE, followed by
staining of the gels with Coomassie Blue stain.
[0382] Recombinant TAT can subsequently be isolated and purified by
removing the yeast cells from the fermentation medium by
centrifugation and then concentrating the medium using selected
cartridge filters. The concentrate containing TAT may further be
purified using selected column chromatography resins.
[0383] Certain of the TAT polypeptides disclosed herein have been
successfully expressed and purified using this technique(s).
Example 5
Expression of TAT in Baculovirus-Infected Insect Cells
[0384] The following method describes recombinant expression of TAT
in Baculovirus-infected insect cells.
[0385] The sequence coding for TAT is fused upstream of an epitope
tag contained within a baculovirus expression vector. Such epitope
tags include poly-his tags and immunoglobulin tags (like Fc regions
of IgG). A variety of plasmids may be employed, including plasmids
derived from commercially available plasmids such as pVL1393
(Novagen). Briefly, the sequence encoding TAT or the desired
portion of the coding sequence of TAT such as the sequence encoding
the extracellular domain of a transmembrane protein or the sequence
encoding the mature protein if the protein is extracellular is
amplified by PCR with primers complementary to the 5' and 3'
regions. The 5' primer may incorporate flanking (selected)
restriction enzyme sites. The product is then digested with those
selected restriction enzymes and subcloned into the expression
vector.
[0386] Recombinant baculovirus is generated by co-transfecting the
above plasmid and BaculoGold.TM. virus DNA (Pharmingen) into
Spodoptera frugiperda ("Sf9") cells (ATCC CRL 1711) using
lipofectin (commercially available from GIBCO-BRL). After 4-5 days
of incubation at 28.degree. C., the released viruses are harvested
and used for further amplifications. Viral infection and protein
expression are performed as described by O'Reilley et al.,
Baculovirus expression vectors: A Laboratory Manual, Oxford: Oxford
University Press (1994).
[0387] Expressed poly-his tagged TAT can then be purified, for
example, by Ni.sup.2+-chelate affinity chromatography as follows.
Extracts are prepared from recombinant virus-infected Sf9 cells as
described by Rupert et al., Nature, 362:175-179 (1993). Briefly,
Sf9 cells are washed, resuspended in sonication buffer (25 mL
Hepes, pH 7.9; 12.5 mM MgCl.sub.2; 0.1 mM EDTA; 10% glycerol; 0.1%
NP-40; 0.4 M KCl), and sonicated twice for 20 seconds on ice. The
sonicates are cleared by centrifugation, and the supernatant is
diluted 50-fold in loading buffer (50 mM phosphate, 300 mM NaCl,
10% glycerol, pH 7.8) and filtered through a 0.45 .mu.m filter. A
Ni.sup.2+-NTA agarose column (commercially available from Qiagen)
is prepared with a bed volume of 5 mL, washed with 25 mL of water
and equilibrated with 25 mL of loading buffer. The filtered cell
extract is loaded onto the column at 0.5 mL per minute. The column
is washed to baseline A.sub.280 with loading buffer, at which point
fraction collection is started. Next, the column is washed with a
secondary wash buffer (50 mM phosphate; 300 mM NaCl, 10% glycerol,
pH 6.0), which elutes nonspecifically bound protein. After reaching
A.sub.280 baseline again, the column is developed with a 0 to 500
mM Imidazole gradient in the secondary wash buffer. One mL
fractions are collected and analyzed by SDS-PAGE and silver
staining or Western blot with Ni.sup.2+-NTA-conjugated to alkaline
phosphatase (Qiagen). Fractions containing the eluted
His.sub.10-tagged TAT are pooled and dialyzed against loading
buffer.
[0388] Alternatively, purification of the IgG tagged (or Fc tagged)
TAT can be performed using known chromatography techniques,
including for instance, Protein A or protein G column
chromatography.
[0389] Certain of the TAT polypeptides disclosed herein have been
successfully expressed and purified using this technique(s).
Example 6
Preparation of Antibodies that Bind TAT
[0390] This example illustrates preparation of monoclonal
antibodies which can specifically bind TAT.
[0391] Techniques for producing the monoclonal antibodies are known
in the art and are described, for instance, in Goding, supra.
Immunogens that may be employed include purified TAT, fusion
proteins containing TAT, and cells expressing recombinant TAT on
the cell surface. Selection of the immunogen can be made by the
skilled artisan without undue experimentation.
[0392] Mice, such as Balb/c, are immunized with the TAT immunogen
emulsified in complete Freund's adjuvant and injected
subcutaneously or intraperitoneally in an amount from 1-100
micrograms. Alternatively, the immunogen is emulsified in MPL-TDM
adjuvant (Ribi Immunochemical Research, Hamilton, Mont.) and
injected into the animal's hind foot pads. The immunized mice are
then boosted 10 to 12 days later with additional immunogen
emulsified in the selected adjuvant. Thereafter, for several weeks,
the mice may also be boosted with additional immunization
injections. Serum samples may be periodically obtained from the
mice by retro-orbital bleeding for testing in ELISA assays to
detect anti-TAT antibodies.
[0393] After a suitable antibody titer has been detected, the
animals "positive" for antibodies can be injected with a final
intravenous injection of TAT. Three to four days later, the mice
are sacrificed and the spleen cells are harvested. The spleen cells
are then fused (using 35% polyethylene glycol) to a selected murine
myeloma cell line such as P3X63AgU.1, available from ATCC, No. CRL
1597. The fusions generate hybridoma cells which can then be plated
in 96 well tissue culture plates containing HAT (hypoxanthine,
aminopterin, and thymidine) medium to inhibit proliferation of
non-fused cells, myeloma hybrids, and spleen cell hybrids.
[0394] The hybridoma cells will be screened in an ELISA for
reactivity against TAT. Determination of "positive" hybridoma cells
secreting the desired monoclonal antibodies against TAT is within
the skill in the art.
[0395] The positive hybridoma cells can be injected
intraperitoneally into syngeneic Balb/c mice to produce ascites
containing the anti-TAT monoclonal antibodies. Alternatively, the
hybridoma cells can be grown in tissue culture flasks or roller
bottles. Purification of the monoclonal antibodies produced in the
ascites can be accomplished using ammonium sulfate precipitation,
followed by gel exclusion chromatography. Alternatively, affinity
chromatography based upon binding of antibody to protein A or
protein G can be employed.
[0396] Antibodies directed against certain of the TAT polypeptides
disclosed herein have been successfully produced using this
technique(s).
Example 7
Purification of TAT Polypeptides Using Specific Antibodies
[0397] Native or recombinant TAT polypeptides may be purified by a
variety of standard techniques in the art of protein purification.
For example, pro-TAT polypeptide, mature TAT polypeptide, or
pre-TAT polypeptide is purified by immunoaffinity chromatography
using antibodies specific for the TAT polypeptide of interest. In
general, an immunoaffinity column is constructed by covalently
coupling the anti-TAT polypeptide antibody to an activated
chromatographic resin.
[0398] Polyclonal immunoglobulins are prepared from immune sera
either by precipitation with ammonium sulfate or by purification on
immobilized Protein A (Pharmacia LKB Biotechnology, Piscataway,
N.J.). Likewise, monoclonal antibodies are prepared from mouse
ascites fluid by ammonium sulfate precipitation or chromatography
on immobilized Protein A. Partially purified immunoglobulin is
covalently attached to a chromatographic resin such as
CnBr-activated SEPHAROSE.TM. (Pharmacia LKB Biotechnology). The
antibody is coupled to the resin, the resin is blocked, and the
derivative resin is washed according to the manufacturer's
instructions.
[0399] Such an immunoaffinity column is utilized in the
purification of TAT polypeptide by preparing a fraction from cells
containing TAT polypeptide in a soluble form. This preparation is
derived by solubilization of the whole cell or of a subcellular
fraction obtained via differential centrifugation by the addition
of detergent or by other methods well known in the art.
Alternatively, soluble TAT polypeptide containing a signal sequence
may be secreted in useful quantity into the medium in which the
cells are grown.
[0400] A soluble TAT polypeptide-containing preparation is passed
over the immunoaffinity column, and the column is washed under
conditions that allow the preferential absorbance of TAT
polypeptide (e.g., high ionic strength buffers in the presence of
detergent). Then, the column is eluted under conditions that
disrupt antibody/TAT polypeptide binding (e.g., a low pH buffer
such as approximately pH 2-3, or a high concentration of a
chaotrope such as urea or thiocyanate ion), and TAT polypeptide is
collected.
Example 8
Ectopic Expression of FGF19 Induces Hepatocellular Carcinoma
[0401] The role of FGF19 in cancer is unknown. FGF19 is a novel
member of the fibroblast growth factor (FGF) family with unique
specificity for FGFR4. Unlike other FGF family members, FGF19 has
minimal mitogenic activity on fibroblasts in vitro. To understand
in vivo effects of FGF19, transgenic mice overexpressing FGF19 in
skeletal muscle were generated. By 10 months of age, hepatocellular
carcinoma (HCC) developed in the FGF19 transgenic mice.
[0402] Primary cancer of the liver, or HCC, is the third most
frequent cause of death by cancer in the world. Consistent with the
observation that oncogenes, growth factors, or viral genes are
frequently upregulated in human HCC, it is not surprising that
overexpression of these genes in the liver also causes HCC in
transgenic mice. Transgenic mouse models of HCC previously
described include overexpression of transforming growth
factor-.alpha. (TGF-.alpha.) alone or in combination with c-myc,
mutated H-ras, hepatitis B viral genes encoding HbsAg and HBx, and
SV40 large T antigen. Liver-specific promoters drive transgene
expression in all of these models. No mouse model, however, up
until the instant invention, has been described in which ectopic
expression of an oncogene or growth factor leads to hepatic
tumors.
[0403] In the normal liver, hepatocytes are mitotically quiescent
but can readily proliferate in response to injury. Several studies
investigating the pathogenesis of hepatocellular carcinomas reveal
that constitutive hepatocellular proliferation is a prerequisite
for transformation. Hepatocellular proliferation leading to
transformation may be initiated by inflammation. For example,
transgenic mice overexpressing the hepatitis B virus (HBV) large
envelope protein develop focal hepatocellular necrosis due to
excessive accumulation of protein within the endoplasmic reticulum,
followed by inflammation that precedes tumor formation.
Inflammation is also prominent in mice lacking the mdr2 gene that
results in failure to transport phosphotidyl choline into the bile
and inability to emulsify biliary components leading to
inflammation, hepatocellular proliferation, and HCC by 18 months of
age. Similarly, mice lacking peroxisomal fatty acyl-CoA oxidase
develop hepatitis followed by hepatocellular regeneration then
hepatocellular tumors by 15 months of age. Alternatively, in the
absence of inflammation, increased hepatocellular proliferation and
subsequent transformation can result from genomic alteration. For
example, insertional activation of an oncogene leading to
hepatocellular proliferation prior to HCC was demonstrated in
woodchuck hepatitis virus (WHV) infection. HCC in woodchucks
results from integration of WHV at the c-myc or n-myc2 locus. Tumor
induction without preceding inflammation or necrosis also occurs in
transgenic mice overexpressing TGF-.alpha., c-myc, c-Ha-ras, or
SV40 large T antigen.
[0404] The discovery of the instant invention indicates that tumors
arise from pericentral hepatocytes following increased
proliferation and dysplasia. In addition, increased proliferation
is accompanied by expression of alpha-fetoprotein (AFP), an
oncofetal protein used as a marker for neoplastic transformation of
hepatocytes, prior to occurrence of tumors. Similar to mice
overexpressing TGF-.alpha. and/or c-myc, early dysplastic foci are
predominantly small cell type in the FGF19 transgenic mice. In
contrast, neither c-myc nor tgf-.alpha. mRNA was elevated in liver
tumors from the FGF19 transgenic mice. Nuclear accumulation of
.beta.-catenin was evident in neoplastic cells from some of the
FGF19 liver tumors suggesting nuclear translocation of
.beta.-catenin and activation of the Wingless/Wnt signaling
pathway. The present invention is the first to implicate an FGF
family member in development of hepatocellular tumors and this
model may provide insight into the pathogenesis of human HCC.
[0405] Taken together, the present invention suggests a previously
unknown role for FGF19 in hepatocarcinogenesis. Hepatocellular
proliferation in young transgenic mice and rFGF19 protein injected
mice implies FGF19 may directly affect hepatocytes. Expression of
the receptor for FGF19, FGFR4, in murine liver supports this
hypothesis.
Materials and Methods
Generation of FGF19 Transgenic Mice
[0406] Human FGF19 cDNA (Xie et al., Cytokine 1999, 11:729-35) was
ligated 3' to the pRK splice donor/acceptor site that was preceded
by the myosin light chain. (Shani et al, Nature 1985; 314:283-6).
This promoter is sufficient for muscle specific transcription of
the transgene. The FGF19 cDNA was also followed by the splice
donor/acceptor sites present between the fourth and fifth exons of
the human growth hormone gene to increase the level of expression
and a splice donor and acceptor with a poly A addition signal was
included 3' to the FGF-19 cDNA to increase the level of
transcription and to provide a transcription termination site. The
DNA encompassing the MLC promoter, the 5' splice acceptor and
donor, the FGF-19 cDNA and the 3' splice acceptor and donor and the
transcription termination site (the transgene) was released from
the bacterial vector sequences using appropriate restriction
enzymes and purified following size fractionation on agarose gels.
The purified DNA was injected into one pronucleus of fertilized
mouse eggs derived from FVB.times.FVB matings and transgenic mice
generated and identified as described (Genetic Modification of
Animals; Tim Stewart; In Exploring Genetic Mechanisms pp565-598;
1997 Eds M Singer and P Berg; University Science Books; Sausalito,
Calif.). Transgenic mice were identified by PCR analysis of DNA
extracted from tail biopsies. Expression of FGF19 was determined by
real-time RT-PCR (TaqMan; Perkin Elmer) on total RNA from skeletal
muscle biopsies.
[0407] Gross and Histopathological Analyses
[0408] To determine the onset of liver changes in FGF19 transgenic
mice, transgenic and wild-type mice were evaluated at designated
intervals over the course of a year. Five to eight each of male and
female FGF19 transgenic mice and wild-type littermates were
euthanized every month and evaluated as indicated below. Body and
liver weights were recorded. Livers were examined for gross
lesions. Specimens from each lobe and from grossly visible tumors
were fixed in 10% buffered formalin, embedded in paraffin,
sectioned at 4 .mu.m, and used for immunohistochemistry, in situ
hybridization, or stained with hematoxylin and eosin (H&E). For
in vivo labeling of S-phase hepatocytes, 5-Bromo-2'-deoxyuridine
(BrdU; Sigma) was dissolved in phosphate buffered saline (PBS) by
heating at a concentration of 100 mg/ml. While still warm, BrdU
solution was injected into osmotic minipumps (ALZET model 1002) and
incubated in excess PBS for 4 hours in amber vials. Pumps were
subcutaneously implanted between the shoulder blades and left in
for 6 days. For molecular analysis, half of each tumor was quickly
frozen in liquid nitrogen and stored at -80.degree. C.
[0409] Measurement of Serum FGF19 Protein
[0410] Human FGF19 was measured in serum from transgenic mice using
an ELISA. The 96 well Nunc-Immunoplates (Nalge Nunc International
Corporation, Rochester, N.Y., USA) were coated at 4.degree. C.
overnight with a mouse monoclonal antibody anti-rhFGF19 (MAb 1A6,
Genentech, Inc.) at 2 ug/ml in carbonate buffer (pH 9.6). ELISA
plates were washed with PBS/0.05% tween-20 (pH 7.2) and blocked for
2 hours with PBS/0.05% tween-20/0.5% BSA (pH 7.2). Serum samples
and rhFGF19 standard were diluted in PBS/0.5% BSA/0.2% bovine
IgG/0.25% CHAPS/5 mM EDTA (pH 7.4)/0.05% tween-20/0.35M NaCl and
incubated on the ELISA plate for 2 hours. After washing with
PBS/0.05% tween-20 (pH7.2), the ELISA plates were incubated with a
secondary biotinylated monoclonal anti-rhFGF19 (MAb 2A3, Genentech,
Inc.) antibody for 1 hour before washing, followed by incubation
with AMDEX.TM. streptavidin-horseradish peroxidase (Amersham
Pharmacia biotech, Picataway, N.J., USA). Signal was revealed using
the chromogenic substrate TMB (Kirkegard & Perry laboratories,
Gaithersburg, Md., ISA) and read at 450/620 nm after addition of
phosphoric acid (1 M).
In Situ Hybridization
[0411] .sup.33P-labeled murine FGFR4 and AFP riboprobes were used
to evaluate gene expression in murine liver, lung, spleen, kidney,
and brain. To generate the probes, PCR primers were designed to
amplify either a 654 bp fragment of murine AFP spanning from nt
731-1385 of NM.sub.--007423 (upper-5' CCTCCAGGCA ACAACCATTA T (SEQ
ID NO:1) and lower-5' CCGGTGAGGT CGATCAG (SEQ ID NO:2)) or a 170 bp
fragment of murine FGFR4 spanning from nt 327-497 of
NM.sub.--008011 (upper-5' CGAGTACGGGGTTGGAGA (SEQ ID NO:3) and
lower-5' TGCTGAGTGTCTTGGGGTCTT (SEQ ID NO:4)). Primers included
extensions encoding 27-nucleotide T7 or T3 RNA polymerase
initiation sites to allow in vitro transcription of sense or
antisense probes, respectively, from the amplified products.
Sections were deparaffinized, deproteinated in 4?g/ml of proteinase
K for 30 minutes at 37.degree. C., and further processed for in
situ hybridization as previously described. ENRfu.sup.43 33P-UTP
labeled sense and antisense probes were hybridized to the sections
at 55.degree. C. overnight. Unhybridized probe was removed by
incubation in 20?g/ml RNAse A for 30 minutes at 37.degree. C.,
followed by a high stringency wash at 55.degree. C. in
0.1.times.SSC for 2 hours and dehydration through graded ethanols.
The slides were dipped in NBT2 nuclear track emulsion (Eastman
Kodak), exposed in sealed plastic slide boxes containing desiccant
for 4 weeks at 4.degree. C., developed and counterstained with
hematoxylin and eosin.
Immunohistochemical and Morphometric Analyses
[0412] Monoclonal antibodies to glutamine synthetase (Chemicon,
Temecula, Calif.) and .beta.-catenin (Transduction Laboratories,
Lexington, Ky.) were prelabeled using the mouse-on-mouse Iso IHC
Kit (InnoGenex, San Ramon, Calif.) following the manufacturer's
instructions. Pretreatment of all slides included antigen retrieval
in preheated DAKO Target Retrieval (DAKO, Carpinteria, Calif.) for
20 minutes at 99.degree. C. and endogenous peroxidase blocking by
KPL Blocking Solution (Kirkegaard & Perry, Gaithersburg, Md.)
for 4 minutes at room temperature. After PBS washing, the
endogenous biotin was blocked using an Avidin Blocking Kit (Vector
Laboratories, Burlingame, Calif.) and the endogenous proteins were
blocked using Power Block Reagent (InnoGenex, San Ramon, Calif.).
The sections were incubated with the prelabeled primary antibodies
for 60 minutes at room temperature and washed in PBS. Sections were
then labeled with Vectastain Elite ABC-Peroxidase (Vector
Laboratories) followed by tyramide amplification (NEN Life Science
Products, Boston. MA) and visualization using metal enhanced DAB
(Pierce, Rockford, Ill.). Murine IgG (Oncogene, Cambridge Mass.)
was used as an isotype control; normal liver and cell pellets were
used to determine tissue and antigen specificity.
[0413] Cellular proliferation was evaluated using a monoclonal
antibody to BrdU (clone IU-4; Caltag Laboratories, Burlingame,
Calif.). After deparaffinization, sections were treated with
preheated 2N HCL for 30 minutes at 37.degree. C., rinsed with
borate buffer (pH 7.6) for 1 minute and digested in preheated 0.01%
trypsin (Sigma) for 3 minutes at 37.degree. C. Endogenous
peroxidase and endogenous biotin were blocked as previously
described. Endogenous proteins were blocked with 10% normal horse
serum (Gibco, Rockville, Md.) in 3% BSA/PBS (Boehringer Mannheim)
for 30 minutes. The sections were then incubated with anti-BrdU
antibody for 60 minutes, followed by biotinylated horse anti-mouse
IgG, Vectastain Elite ABC-Peroxidase (Vector Laboratories), then
metal enhanced DAB (Pierce) for visualization. For morphometric
analysis of BrdU labeled sections, 1000-3000 hepatocytes were
counted for each animal using MetaMorph image analysis software
(Universal Imaging Corporation, Downington Pa.). The labeling index
denotes the number of BrdU-positive hepatocytes divided by the
total number of hepatocytes counted and indicated as a
percentage.
Gene Expression
[0414] Total RNA was extracted from frozen liver samples using RNA
STAT-60 (Tel-test "B" Inc., Friendswood, Tex.). Liver samples were
homogenized in the RNA STAT-60, incubated at room temperature for 5
minutes, and centrifuged at 12,000 g for 10 minutes at 4.degree. C.
Chloroform was added to the supernatant to extract the RNA followed
by isopropanol precipitation for 10 minutes. The pellet was washed
with 75% ETOH and resuspended in DEPC treated water. Total RNA was
DNAse treated followed by addition of DNAse inactivation reagent
(Ambion) and centrifugation. Supernatant was used as RNA template
for real-time PCR. RNA concentration was determined using a
spectrophotometer (Beckman, DU 530) and visualized on a 1.2%
agarose gel.
[0415] Primers and probes were designed using Primer Express 1.1
(PE Applied Biosystems) for murine RPL19, FGFR4, TGF-alpha, HGF,
c-myc, and AFP (Table 2). Amplification reactions (50 .mu.l)
contained 10 ng RNA template, 5 mM MgCl.sub.2, 1.times. Buffer A,
1.2 mM dNTP's, 2.5 units TaqGold polymerase, 20 units Rnase
inhibitor, 12.5 units MuLV reverse transcriptase, 2 .mu.M each
forward and reverse primer, and 5 .mu.M probe (Perkin Elmer).
Thermal cycle (Perkin Elmer ABI Prism 7700 sequence detector)
conditions were 48.degree. C. for 30 minutes, 95.degree. C. for 10
minutes and 95.degree. C. for 15 seconds/60.degree. C. for 1 minute
for 40 cycles. Analysis of data was performed using Sequence
Detector 1.6.3 (PE Applied Biosystems) and results for genes of
interest were normalized to RPL19.
Recombinant FGF19 Protein
[0416] Recombinant human FGF19 (rFGF19) was expressed
intracellularly in E. coli. The FGF19 protein was purified via
anion exchange chromatography, size exclusion chromatography, and
preparative reverse phase chromatography. Sequence analysis and
analysis by mass spectrometry indicated that purified rFGF19 had
the expected mass and N-terminal sequence. Non-transgenic female
FVB mice were injected intraperitoneally with 30 .mu.g of rFGF 19
protein or ArgPO.sub.4 vehicle in a volume of 100 .mu.l once daily
for 6 days. BrdU was administered by Alzet minipumps placed
subcutaneously on day 1 as described above and the mice were
necropsied on the sixth day.
Cloning and Sequencing .beta.-Catenin
[0417] DNA extracted from tumor tissue was PCR amplified using
forward and reverse primers 5' TAC AGG TAG CAT TTT CAG TTC AC 3'
(SEQ ID NO:5) and 5' TAG CTT CCA AAC ACA AAT GC 3' (SEQ ID NO:6),
respectively. PCR products were subcloned into pCR2.1 using the TA
cloning kit (Invitrogen). Sequencing of subcloned PCR products was
done as outlined in the ABIPRISM.TM.BigDye.TM. Terminator Cycle
Sequencing Ready Reaction Kit on an Applied Biosystems PRISM 3700
DNA Analyzer. M13 primers were used for the TA vector. The trace
files were edited and aligned using Sequencher.TM. (Gene Codes
Corp., Ann Arbor Mich., USA). Mutations were identified by
comparing the trace files to the murine .beta.-catenin sequence
published in Genbank (NM.sub.--007614).
Statistical Analysis
[0418] Data are presented as the means plus or minus standard
deviations. Comparisons between transgenic and wild-type mice or
protein injected and vehicle control mice were made using an
unpaired student's t test.
Results
Hepatocellular Dysplasia and Neoplasia in FGF19 Transgenic Mice
[0419] As early as 2-4 months of age hepatocytes adjacent to
central veins formed a single columnar row with nuclei polarized
away from the endothelial basement membrane of the central vein
which was not observed in wild-type mice. Dysplastic changes (areas
of altered hepatocellular foci) preceded tumor formation and were
evident by 7-9 months. Within this age group, 33% of female and 7%
of male transgenics had hepatocellular dysplasia without evidence
of neoplasia. Interestingly, dysplastic foci were predominantly of
the small cell type and oriented around central veins. Rarely, foci
of large dysplastic hepatocytes were noted. FGF19 transgenic mice
developed liver tumors by 10-12 months of age at an overall
frequency of 53%. Within the 10-12 month-old group, 80% (8/10) of
female and 22% (2/9) of male FGF19 transgenic mice had locally
invasive hepatocellular carcinomas. Tumors were solitary or
multifocal, involving different liver lobes. Mean liver weights in
the 10-12 month-old female FGF19 transgenics were increased 30%
relative to liver weights of wild-type mice (mean liver
weights=1.97 and 1.54 grams, respectively; p<0.01) attributable
to tumor mass. The mean liver weight for 10-12 month-old male FGF19
transgenic mice was not significantly different than wild-type
mice, likely due to the low incidence of tumors in the male
transgenic mice (mean liver weights=1.53 and 1.63 grams,
respectively; p=0.37) Histologically, neoplastic hepatocytes
invaded and replaced adjacent normal hepatic parenchyma.
Hepatocellular carcinomas in the FGF19 transgenic mice were
predominantly the solid type although a trabecular pattern was
occasionally noted. The typical morphology of neoplastic
hepatocytes: neoplastic cells with nuclear pleomorphism and
frequent mitoses. The tumors did not metastasize. Other tissues
evaluated histologically included: lungs, heart, spleen, kidneys,
bone (femur), intestines, brain, pituitary gland, thyroid glands,
and skeletal muscle. Despite the fact that FGF19 was expressed in
the skeletal muscle, no histologic changes were evident in that
tissue.
[0420] Serum FGF19 protein levels were determined in the FGF19
transgenic and wild-type mice to assess whether phenotypic
differences between male and female transgenic mice could be due to
differences in levels of protein expression. The 2-4 month-old
transgenic females (n=16) have mean serum FGF19 protein levels of
77.7 ng/ml and the transgenic males in the same age group (n=7)
have mean serum FGF19 protein levels of 63.2 ng/ml (p=0.07). FGF19
serum protein levels are considerably lower in the older animals.
The 7-9 month-old transgenic females (n=10) have mean serum FGF19
protein levels of 21.8 ng/ml and transgenic males in the same age
group (n=13) have mean serum FGF19 protein levels of 18.6 ng/ml
(p=0.20). The 10-12 month-old transgenic females (n=9) have mean
FGF19 serum protein levels of 24.3 ng/ml and the transgenic males
in the same age group have mean FGF19 serum protein levels of 20.7
ng/ml (p=0.41).
FGFR4, the Receptor for FGF19, is Expressed in Murine Liver
[0421] FGF19 was previously shown to selectively bind with high
affinity to FGFR4.ENRfu.sup.14 Although FGFR4 expression has been
demonstrated in mouse and rat hepatocytes, in situ hybridization
with a .sup.33P-labeled murine FGFR4 riboprobe was used to
determine expression patterns in wild-type and FGF19 transgenic
mice. In both wild-type and FGF19 transgenic mice, a strong signal
for murine fgfr4 mRNA was present in hepatocytes adjacent to
central veins and in random, small hepatocytes throughout the
lobule. There was not a significant difference in signal intensity
or distribution based on genotype. In addition, real-time RT-PCR
did not demonstrate any difference in levels of fgfr4 mRNA between
FGF19 transgenic and wild-type mice.
FGF19 Transgenic Mice and rFGF19 Protein-Injected Mice Showed
Increased Hepatocellular Proliferation
[0422] Constitutive hepatocellular proliferation is considered a
prerequisite for neoplastic transformation. Therefore, in vivo BrdU
labeling in the FGF19 transgenic mice was used to assess
hepatocellular proliferation. Labeled hepatocytes were
predominantly perivenular whereas BrdU-labeled hepatocytes were
rare in wild-type mice. By 2-4 months of age the BrdU labeling
index of hepatocytes was eight-fold higher in FGF19 transgenic
females than age matched wild-type females (p=0.00003) and two- to
three-fold higher in FGF19 transgenic males than age matched wild
type males (p=0.040). The labeling index is also increased two- to
three-fold in 7-9 month old female and male FGF19 transgenics
relative to their respective controls (p=0.0000002 and p=0.006,
respectively). Together these data indicate hepatocellular
proliferation precedes tumor development and that the proliferative
fraction is predominantly pericentral hepatocytes.
[0423] To determine whether hepatocellular proliferation was due to
acute effects of FGF19 in vivo, the purified protein was injected
into non-transgenic female mice while infusing BrdU over 6 days.
Mice receiving rFGF19 protein had a significantly higher BrdU
labeling index than mice receiving vehicle alone (p=0.014). Similar
to results described above in FGF19 transgenic mice,
rFGF19-injected mice have a three- to five-fold increase in
hepatocellular proliferation relative to vehicle-injected mice.
Pericentral Hepatocytes Give Rise to Neoplastic Foci
[0424] Glutamine synthetase is a marker for tracing hepatocellular
lineage during preneoplastic and early neoplastic stages. In the
10-12 month old mice, 10 out of 19 FGF19 transgenic mice had HCCs.
All of the FGF19 induced tumors were strongly positive for
glutamine synthetase by IHC. In contrast, liver from wild-type mice
showed the expected pattern of staining one to three cell layers of
pericentral hepatocytes. Foci of large dysplastic hepatocytes were
also glutamine synthetase positive. Glutamine synthetase
immunoreactivity of the neoplastic cells suggests they originated
from the one to three cell layers of hepatocytes around the central
veins that constitutively express glutamine synthetase.
[0425] AFP is an oncofetal protein expressed by neoplastic
hepatocytes but not normal adult hepatocytes and is used as an
indicator of neoplastic transformation in the liver. Real-time
RT-PCR showed hepatic AFP mRNA was elevated in FGF19 transgenic
mice relative to wild types. At 2-4 months of age female
transgenics had a thirteen-fold increase (p=0.01) and male
transgenics had an eighteen-fold increase (p=0.005) in AFP
expression relative to respective wild-type controls. The 7-9 month
old transgenic females had a four-fold increase (p=0.01) and males
had a three-fold increase (p=0.03) in AFP expression relative to
respective wild type controls. Subsequently, AFP expression was
evaluated by in situ hybridization to determine which cells were
expressing AFP prior to tumor formation. Consistent with previous
findings that indicated initial involvement of pericentral
hepatocytes, AFP expression was demonstrated in hepatocytes
adjacent to central veins (FIGS. 8and 8+LD). Neoplastic hepatocytes
also consistently expressed AFP.
Expression of Growth Factors and Oncogenes in FGF19 Transgenic
Mice
[0426] To investigate potential mechanisms of hepatocarcinogenesis,
expression of mRNA encoding TGF-.alpha., HGF, and c-myc was
evaluated. Overexpression of TGF-.alpha. alone or in combination
with c-myc in the liver of transgenic mice leads to tumor
development. In this study, real-time RT-PCR analysis at each time
point did not demonstrate upregulated expression of mRNA encoding
TGF-.alpha., HGF, or c-myc in liver from MLC.FGF19 transgenic
relative to age matched wild type mice.
.beta.-Catenin Activation and Somatic Mutations in MLC.FGF19
Hepatocellular Carcinomas
[0427] To further evaluate the molecular pathogenesis of HCCs in
FGF19 transgenic mice, immunohistochemical staining for
.beta.-catenin in addition to cloning and sequencing exon 2 of the
.beta.-catenin gene from tumor tissue was used. HCCs from nine
different FGF19 transgenic mice were evaluated for immunoreactivity
to .beta.-catenin antibody. Four of the nine tumors (44%) had
nuclear and cytoplasmic staining for .beta.-catenin in neoplastic
hepatocytes. All four tumors with .beta.-catenin immunoreactivity
were from female FGF19 transgenic mice in the 10-12 month age
group. Cloning and sequencing hepatic DNA encoding exon 2 of
.beta.-catenin from tumor tissue that was IHC positive revealed
point mutations that resulted in amino acid substitutions. Overall,
16% of the clones contained mutations. A.fwdarw.G or G.fwdarw.A
transitions were the most common mutations observed and involved
codons 23, 34, 72, 76, and 80. Other transition mutations included
C.fwdarw.T (codon 44), T.fwdarw.C (codon 70), and A.fwdarw.T (codon
56). Four of the clones from three different animals had mutations
within the glycogen synthase kinase-3B (GSK-3B) phosphorylation
domain at codon 34 and codon 44. Of the 4 mutations within the
phosphorylation domain, 3 resulted in substitution of an amino acid
with a nonpolar side chain by an amino acid with a polar uncharged
(Pro45Ser) or a polar charged (Gly34Glx) amino acid side chain. The
fourth amino acid substitution within the phosphorylation domain
retained the polar side chain but replaced a relatively small amino
acid with a larger, space-occupying molecule (Gly34Ile). Seven
other mutations resulted in amino acid substitutions in regions
adjacent to the GSK-3B phosphorylation domain. Of the mutations
outside the phosphorylation domain, amino acid substitutions
resulted in altered charge (Gln72Arg, Gln76Arg, Asx56Val), polarity
(Ala80Ser, Ser23Gly) or molecular size (Phe70Leu). Mutations that
affect GSK-3B phosphorylation of .beta.-catenin prevent
ubiquitination and degradation, resulting in cytoplasmic
accumulation and nuclear translocation of .beta.-catenin, which
accounts for the immunoreactivity observed in this study.
Example 9
Drug Screening
[0428] This invention is particularly useful for screening
compounds by using FGF-19 polypeptides or binding fragment thereof
in any of a variety of drug screening techniques. The FGF-19
polypeptide or fragment employed in such a test may either be free
in solution, affixed to a solid support, borne on a cell surface,
or located intracellularly. One method of drug screening utilizes
eukaryotic or prokaryotic host cells which are stably transformed
with recombinant nucleic acids expressing the FGF-19 polypeptide or
fragment. Drugs are screened against such transformed cells in
competitive binding assays. Such cells, either in viable or fixed
form, can be used for standard binding assays. One may measure, for
example, the formation of complexes between FGF-19 polypeptide or a
fragment and the agent being tested. Alternatively, one can examine
the diminution in complex formation between the FGF-19 polypeptide
and its target cell or target receptors caused by the agent being
tested.
[0429] Thus, the present invention provides methods of screening
for drugs or any other agents which can affect a FGF-19
polypeptide-associated disease or disorder. These methods comprise
contacting such an agent with an FGF-19 polypeptide or fragment
thereof and assaying (I) for the presence of a complex between the
agent and the FGF-19 polypeptide or fragment, or (ii) for the
presence of a complex between the FGF-19 polypeptide or fragment
and the cell, by methods well known in the art. In such competitive
binding assays, the FGF-19 polypeptide or fragment is typically
labeled. After suitable incubation, free FGF-19 polypeptide or
fragment is separated from that present in bound form, and the
amount of free or uncomplexed label is a measure of the ability of
the particular agent to bind to FGF-19 polypeptide or to interfere
with the FGF-19 polypeptide/cell complex.
[0430] Another technique for drug screening provides high
throughput screening for compounds having suitable binding affinity
to a polypeptide and is described in detail in WO 84/03564,
published on Sep. 13, 1984. Briefly stated, large numbers of
different small peptide test compounds are synthesized on a solid
substrate, such as plastic pins or some other surface. As applied
to a FGF-19 polypeptide, the peptide test compounds are reacted
with FGF-19 polypeptide and washed. Bound FGF-19 polypeptide is
detected by methods well known in the art. Purified FGF-19
polypeptide can also be coated directly onto plates for use in the
aforementioned drug screening techniques. In addition,
non-neutralizing antibodies can be used to capture the peptide and
immobilize it on the solid support.
[0431] This invention also contemplates the use of competitive drug
screening assays in which neutralizing antibodies capable of
binding FGF-19 polypeptide specifically compete with a test
compound for binding to FGF-19 polypeptide or fragments thereof. In
this manner, the antibodies can be used to detect the presence of
any peptide which shares one or more antigenic determinants with
FGF-19 polypeptide.
Example 10
Rational Drug Design
[0432] The goal of rational drug design is to produce structural
analogs of biologically active polypeptide of interest (i.e., a
FGF-19 polypeptide) or of small molecules with which they interact,
e.g., agonists, antagonists, or inhibitors. Any of these examples
can be used to fashion drugs which are more active or stable forms
of the FGF-19 polypeptide or which enhance or interfere with the
function of the FGF-19 polypeptide in vivo (c.f., Hodgson,
Bio/Technology, 9: 19-21 (1991)).
[0433] In one approach, the three-dimensional structure of the
FGF-19 polypeptide, or of an FGF-19 polypeptide-inhibitor complex,
is determined by x-ray crystallography, by computer modeling or,
most typically, by a combination of the two approaches. Both the
shape and charges of the FGF-19 polypeptide must be ascertained to
elucidate the structure and to determine active site(s) of the
molecule. Less often, useful information regarding the structure of
the FGF-19 polypeptide may be gained by modeling based on the
structure of homologous proteins. In both cases, relevant
structural information is used to design analogous FGF-19
polypeptide-like molecules or to identify efficient inhibitors.
Useful examples of rational drug design may include molecules which
have improved activity or stability as shown by Braxton and Wells,
Biochemistry, 31:7796-7801 (1992) or which act as inhibitors,
agonists, or antagonists of native peptides as shown by Athauda et
al., J. Biochem., 113:742-746 (1993).
[0434] It is also possible to isolate a target-specific antibody,
selected by functional assay, as described above, and then to solve
its crystal structure. This approach, in principle, yields a
pharmacore upon which subsequent drug design can be based. It is
possible to bypass protein crystallography altogether by generating
anti-idiotypic antibodies (anti-ids) to a functional,
pharmacologically active antibody. As a mirror image of a mirror
image, the binding site of the anti-ids would be expected to be an
analog of the original receptor. The anti-id could then be used to
identify and isolate peptides from banks of chemically or
biologically produced peptides. The isolated peptides would then
act as the pharmacore.
[0435] By virtue of the present invention, sufficient amounts of
the FGF-19 polypeptide may be made available to perform such
analytical studies as X-ray crystallography. In addition, knowledge
of the FGF-19 polypeptide amino acid sequence provided herein will
provide guidance to those employing computer modeling techniques in
place of or in addition to x-ray crystallography.
Example 11
Quantitative Analysis of TAT mRNA Expression
[0436] In this assay, a 5' nuclease assay (for example,
TaqMan.RTM.) and real-time quantitative PCR (for example, ABI Prizm
7700 Sequence Detection System.RTM. (Perkin Elmer, Applied
Biosystems Division, Foster City, Calif.)), were used to find genes
that are significantly overexpressed in a cancerous tumor or tumors
as compared to other cancerous tumors or normal non-cancerous
tissue. The 5' nuclease assay reaction is a fluorescent PCR-based
technique which makes use of the 5' exonuclease activity of Taq DNA
polymerase enzyme to monitor gene expression in real time. Two
oligonucleotide primers (whose sequences are based upon the gene or
EST sequence of interest) are used to generate an amplicon typical
of a PCR reaction. A third oligonucleotide, or probe, is designed
to detect nucleotide sequence located between the two PCR primers.
The probe is non-extendible by Taq DNA polymerase enzyme, and is
labeled with a reporter fluorescent dye and a quencher fluorescent
dye. Any laser-induced emission from the reporter dye is quenched
by the quenching dye when the two dyes are located close together
as they are on the probe. During the PCR amplification reaction,
the Taq DNA polymerase enzyme cleaves the probe in a
template-dependent manner. The resultant probe fragments
disassociate in solution, and signal from the released reporter dye
is free from the quenching effect of the second fluorophore. One
molecule of reporter dye is liberated for each new molecule
synthesized, and detection of the unquenched reporter dye provides
the basis for quantitative interpretation of the data.
[0437] The 5' nuclease procedure is run on a real-time quantitative
PCR device such as the ABI Prism 7700.TM. Sequence Detection. The
system consists of a thermocycler, laser, charge-coupled device
(CCD) camera and computer. The system amplifies samples in a
96-well format on a thermocycler. During amplification,
laser-induced fluorescent signal is collected in real-time through
fiber optics cables for all 96 wells, and detected at the CCD. The
system includes software for running the instrument and for
analyzing the data.
[0438] The starting material for the screen was mRNA isolated from
a variety of different cancerous tissues. The mRNA is quantitated
precisely, e.g., fluorometrically. As a negative control, RNA was
isolated from various normal tissues of the same tissue type as the
cancerous tissues being tested.
[0439] 5' nuclease assay data are initially expressed as Ct, or the
threshold cycle. This is defined as the cycle at which the reporter
signal accumulates above the background level of fluorescence. The
.DELTA.Ct values are used as quantitative measurement of the
relative number of starting copies of a particular target sequence
in a nucleic acid sample when comparing cancer mRNA results to
normal human mRNA results. As one Ct unit corresponds to 1 PCR
cycle or approximately a 2-fold relative increase relative to
normal, two units corresponds to a 4-fold relative increase, 3
units corresponds to an 8-fold relative increase and so on, one can
quantitatively measure the relative fold increase in mRNA
expression between two or more different tissues. Using this
technique, the molecules listed below have been identified as being
significantly overexpressed (i.e., at least 2 fold) in a particular
tumor(s) as compared to their normal non-cancerous counterpart
tissue(s) (from both the same and different tissue donors) and
thus, represent excellent polypeptide targets for the diagnosis and
therapy of cancer in mammals. TABLE-US-00006 Molecule upregulation
of expression in: as compared to: DNA49435 colon tumor normal colon
tissue
Example 12
Tissue Expression Profiling Using GeneExpress.RTM.
[0440] A proprietary database containing gene expression
information (GeneExpress.RTM., Gene Logic Inc., Gaithersburg, Md.)
was analyzed in an attempt to identify polypeptides (and their
encoding nucleic acids) whose expression is significantly
upregulated in a particular tumor tissue(s) of interest as compared
to other tumor(s) and/or normal tissues. Specifically, analysis of
the GeneExpress.RTM. database was conducted using either software
available through Gene Logic Inc., Gaithersburg, Md., for use with
the GeneExpress.RTM. database or with proprietary software written
and developed at Genentech, Inc. for use with the GeneExpress.RTM.
database. The rating of positive hits in the analysis is based upon
several criteria including, for example, tissue specificity, tumor
specificity and expression level in normal essential and/or normal
proliferating tissues. The following is a list of molecules whose
tissue expression profile as determined from an analysis of the
GeneExpress.RTM. database evidences high tissue expression and
significant upregulation of expression in a specific tumor or
tumors as compared to other tumor(s) and/or normal tissues and
optionally relatively low expression in normal essential and/or
normal proliferating tissues. As such, the molecules listed below
are excellent polypeptide targets for the diagnosis and therapy of
cancer in mammals. TABLE-US-00007 upregulation of Molecule
expression in: as compared to: DNA49435 colon tumor normal colon
tissue DNA49435 liver tumor normal liver tissue
Example 13
In Situ Hybridization
[0441] In situ hybridization is a powerful and versatile technique
for the detection and localization of nucleic acid sequences within
cell or tissue preparations. It may be useful, for example, to
identify sites of gene expression, analyze the tissue distribution
of transcription, identify and localize viral infection, follow
changes in specific mRNA synthesis and aid in chromosome
mapping.
[0442] In situ hybridization was performed following an optimized
version of the protocol by Lu and Gillett, Cell Vision 1:169-176
(1994), using PCR-generated .sup.33P-labeled riboprobes. Briefly,
formalin-fixed, paraffin-embedded human tissues were sectioned,
deparaffinized, deproteinated in proteinase K (20 g/ml) for 15
minutes at 37.degree. C., and further processed for in situ
hybridization as described by Lu and Gillett, supra. A [.sup.33-P]
UTP-labeled antisense riboprobe was generated from a PCR product
and hybridized at 55.degree. C. overnight. The slides were dipped
in Kodak NTB2 nuclear track emulsion and exposed for 4 weeks.
.sup.33P-Riboprobe Synthesis
[0443] 6.0 .mu.l (125 mCi) of .sup.33P-UTP (Amersham BF 1002,
SA<2000 Ci/mmol) were speed vac dried. To each tube containing
dried .sup.33P-UTP, the following ingredients were added:
[0444] 2.0 .mu.l 5.times. transcription buffer
[0445] 1.0 .mu.l DTT (100 mM)
[0446] 2.0 .mu.l NTP mix (2.5 mM: 10 .mu.l; each of 10 mM GTP, CTP
& ATP+10 .mu.l H.sub.2O)
[0447] 1.0 .mu.l UTP (50 .mu.M)
[0448] 1.0 .mu.l Rnasin
[0449] 1.0 .mu.l DNA template (1 .mu.g)
[0450] 1.0 .mu.l H.sub.2O
[0451] 1.0 .mu.l RNA polymerase (for PCR products T3=AS, T7=S,
usually)
[0452] The tubes were incubated at 37.degree. C. for one hour. 1.0
.mu.l RQ1 DNase were added, followed by incubation at 37.degree. C.
for 15 minutes. 90 .mu.l TE (10 mM Tris pH 7.6/1 mM EDTA pH 8.0)
were added, and the mixture was pipetted onto DE81 paper. The
remaining solution was loaded in a Microcon-50 ultrafiltration
unit, and spun using program 10 (6 minutes). The filtration unit
was inverted over a second tube and spun using program 2 (3
minutes). After the final recovery spin, 100 .mu.l TE were added. 1
.mu.l of the final product was pipetted on DE81 paper and counted
in 6 ml of Biofluor II.
[0453] The probe was run on a TBE/urea gel. 1-3 .mu.l of the probe
or 5 .mu.l of RNA Mrk III were added to 3 .mu.l of loading buffer.
After heating on a 95.degree. C. heat block for three minutes, the
probe was immediately placed on ice. The wells of gel were flushed,
the sample loaded, and run at 180-250 volts for 45 minutes. The gel
was wrapped in saran wrap and exposed to XAR film with an
intensifying screen in -70.degree. C. freezer one hour to
overnight.
.sup.33P-Hybridization
[0454] A. Pretreatment of Frozen Sections
[0455] The slides were removed from the freezer, placed on
aluminium trays and thawed at room temperature for 5 minutes. The
trays were placed in 55.degree. C. incubator for five minutes to
reduce condensation. The slides were fixed for 10 minutes in 4%
paraformaldehyde on ice in the fume hood, and washed in
0.5.times.SSC for 5 minutes, at room temperature (25 ml
20.times.SSC+975 ml SQ H.sub.2O). After deproteination in 0.5
.mu.g/ml proteinase K for 10 minutes at 37.degree. C. (12.5 .mu.l
of 10 mg/ml stock in 250 ml prewarmed RNase-free RNAse buffer), the
sections were washed in 0.5.times.SSC for 10 minutes at room
temperature. The sections were dehydrated in 70%, 95%, 100%
ethanol, 2 minutes each.
[0456] B. Pretreatment of Paraffin-Embedded Sections
[0457] The slides were deparaffinized, placed in SQ H.sub.2O, and
rinsed twice in 2.times.SSC at room temperature, for 5 minutes each
time. The sections were deproteinated in 20 .mu.g/ml proteinase K
(500 .mu.l of 10 mg/ml in 250 ml RNase-free RNase buffer;
37.degree. C., 15 minutes)--human embryo, or 8.times. proteinase K
(100 .mu.l in 250 ml Rnase buffer, 37.degree. C., 30
minutes)--formalin tissues. Subsequent rinsing in 0.5.times.SSC and
dehydration were performed as described above.
[0458] C. Prehybridization
[0459] The slides were laid out in a plastic box lined with Box
buffer (4.times.SSC, 50% formamide)--saturated filter paper.
[0460] D. Hybridization
[0461] 1.0.times.10.sup.6 cpm probe and 1.0 .mu.l tRNA (50 mg/ml
stock) per slide were heated at 95.degree. C. for 3 minutes. The
slides were cooled on ice, and 48 .mu.l hybridization buffer were
added per slide. After vortexing, 50 .mu.l .sup.33P mix were added
to 50 .mu.l prehybridization on slide. The slides were incubated
overnight at 55.degree. C.
[0462] E. Washes
[0463] Washing was done 2.times.10 minutes with 2.times.SSC, EDTA
at room temperature (400 ml 20.times.SSC+16 ml 0.25M EDTA,
V.sub.f=4 L), followed by RNaseA treatment at 37.degree. C. for 30
minutes (500 .mu.l of 10 mg/ml in 250 ml Rnase buffer=20 .mu.g/ml),
The slides were washed 2.times.10 minutes with 2.times.SSC, EDTA at
room temperature. The stringency wash conditions were as follows: 2
hours at 55.degree. C., 0.1.times.SSC, EDTA (20 ml 20.times.SSC+16
ml EDTA, V.sub.f=4 L).
[0464] F. Oligonucleotides
[0465] In situ analysis was performed on a variety of DNA sequences
disclosed herein. The oligonucleotides employed for these analyses
were obtained so as to be complementary to the nucleic acids (or
the complements thereof) as shown in the accompanying figures.
[0466] G. Results
[0467] In situ analysis was performed on a variety of DNA sequences
disclosed herein. The results from these analyses are as
follows.
(1) DNA49435--DNA 49435 was specifically expressed in cirrhosis and
in colon carcinoma. Moreover, expression in colon carcinoma was
co-localized with FGFR-4 expression.
Deposit of Material
[0468] The following materials have been deposited with the
American Type Culture Collection, 10801 University Blvd., Manassas,
Va. 20110-2209, USA (ATCC): TABLE-US-00008 Material ATCC Dep. No.
Deposit Date DNA49435-1219 209480 Nov. 21, 1997
[0469] These deposits were made under the provisions of the
Budapest Treaty on the International Recognition of the Deposit of
Microorganisms for the Purpose of Patent Procedure and the
Regulations thereunder (Budapest Treaty). This assures maintenance
of a viable culture of the deposit for 30 years from the date of
deposit. The deposits will be made available by ATCC under the
terms of the Budapest Treaty, and subject to an agreement between
Genentech, Inc. and ATCC, which assures permanent and unrestricted
availability of the progeny of the culture of the deposit to the
public upon issuance of the pertinent U.S. patent or upon laying
open to the public of any U.S. or foreign patent application,
whichever comes first, and assures availability of the progeny to
one determined by the U.S. Commissioner of Patents and Trademarks
to be entitled thereto according to 35 USC .sctn. 122 and the
Commissioner's rules pursuant thereto (including 37 CFR .sctn. 1.14
with particular reference to 886 OG 638).
[0470] The assignee of the present application has agreed that if a
culture of the materials on deposit should die or be lost or
destroyed when cultivated under suitable conditions, the materials
will be promptly replaced on notification with another of the same.
Availability of the deposited material is not to be construed as a
license to practice the invention in contravention of the rights
granted under the authority of any government in accordance with
its patent laws.
[0471] The foregoing written specification is considered to be
sufficient to enable one skilled in the art to practice the
invention. The present invention is not to be limited in scope by
the construct deposited, since the deposited embodiment is intended
as a single illustration of certain aspects of the invention and
any constructs that are functionally equivalent are within the
scope of this invention. The deposit of material herein does not
constitute an admission that the written description herein
contained is inadequate to enable the practice of any aspect of the
invention, including the best mode thereof, nor is it to be
construed as limiting the scope of the claims to the specific
illustrations that it represents. Indeed, various modifications of
the invention in addition to those shown and described herein will
become apparent to those skilled in the art from the foregoing
description and fall within the scope of the appended claims.
Sequence CWU 1
1
6 1 21 DNA Homo sapiens 1 cctccaggca acaaccatta t 21 2 17 DNA Homo
sapiens 2 ccggtgaggt cgatcag 17 3 18 DNA Homo sapiens 3 cgagtacggg
gttggaga 18 4 21 DNA Homo sapiens 4 tgctgagtgt cttggggtct t 21 5 23
DNA Artificial sequence Sequence is synthesized 5 tacaggtagc
attttcagtt cac 23 6 20 DNA Artificial sequence Sequence is
synthesized 6 tagcttccaa acacaaatgc 20
* * * * *