U.S. patent application number 11/492194 was filed with the patent office on 2007-06-21 for thermostable reverse transcriptases and uses thereof.
Invention is credited to Gulshan Dhariwal, Gary F. Gerard, Jun E. Lee, Robert Jason Potter, Kim Rosenthal, Michael D. Smith.
Application Number | 20070141592 11/492194 |
Document ID | / |
Family ID | 31994103 |
Filed Date | 2007-06-21 |
United States Patent
Application |
20070141592 |
Kind Code |
A1 |
Smith; Michael D. ; et
al. |
June 21, 2007 |
Thermostable reverse transcriptases and uses thereof
Abstract
The present invention is in the fields of molecular and cellular
biology. The invention is generally related to reverse
transcriptase enzymes and methods for the reverse transcription of
nucleic acid molecules, especially messenger RNA molecules.
Specifically, the invention relates to reverse transcriptase
enzymes which have been mutated or modified to increase
thermostability, decrease terminal deoxynucleotidyl transferase
activity, and/or increase fidelity, and to methods of producing,
amplifying or sequencing nucleic acid molecules (particularly cDNA
molecules) using these reverse transcriptase enzymes or
compositions. The invention also relates to nucleic acid molecules
produced by these methods and to the use of such nucleic acid
molecules to produce desired polypeptides. The invention also
concerns kits comprising such enzymes or compositions.
Inventors: |
Smith; Michael D.;
(Rockville, MD) ; Potter; Robert Jason; (San
Marcos, CA) ; Dhariwal; Gulshan; (Potomac, MD)
; Gerard; Gary F.; (Frederick, MD) ; Rosenthal;
Kim; (Laytonsille, MD) ; Lee; Jun E.; (San
Diego, CA) |
Correspondence
Address: |
INVITROGEN CORPORATION;C/O INTELLEVATE
P.O. BOX 52050
MINNEAPOLIS
MN
55402
US
|
Family ID: |
31994103 |
Appl. No.: |
11/492194 |
Filed: |
July 25, 2006 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10661819 |
Sep 15, 2003 |
|
|
|
11492194 |
Jul 25, 2006 |
|
|
|
11437681 |
May 22, 2006 |
|
|
|
11492194 |
Jul 25, 2006 |
|
|
|
09845157 |
May 1, 2001 |
7078208 |
|
|
11437681 |
May 22, 2006 |
|
|
|
60410283 |
Sep 13, 2002 |
|
|
|
60207196 |
May 26, 2000 |
|
|
|
Current U.S.
Class: |
435/6.11 ;
435/199; 435/325; 435/456; 435/69.1; 536/23.2 |
Current CPC
Class: |
C12P 19/34 20130101;
C12N 9/1276 20130101; C12Y 207/07049 20130101 |
Class at
Publication: |
435/006 ;
435/069.1; 435/199; 435/456; 435/325; 536/023.2 |
International
Class: |
C12Q 1/68 20060101
C12Q001/68; C07H 21/04 20060101 C07H021/04; C12P 21/06 20060101
C12P021/06; C12N 9/22 20060101 C12N009/22; C12N 15/86 20060101
C12N015/86 |
Claims
1. A mutant reverse transcriptase having one or more modifications
or mutations at positions corresponding to amino acids selected
from the group consisting of: (a) leucine 52 of M-MLV reverse
transcriptase; (b) tyrosine 64 of M-MLV reverse transcriptase; (c)
lysine 152 of M-MLV reverse transcriptase; (d) histidine 204 of
M-MLV reverse transcriptase; (e) methionine 289 of M-MLV reverse
transcriptase; (f) threonine 306 of M-MLV reverse transcriptase;
and (g) phenylalanine 309 of M-MLV reverse transcriptase, wherein
said reverse transcriptase synthesizes at least 50% as much full
length cDNA at 50.degree. C. as at it does at 40.degree. C.
2. The reverse transcriptase of claim 1, which synthesizes at least
70% as much full length cDNA at 50.degree. C. as it does at
40.degree. C.
3. The reverse transcriptase of claim 1, which synthesizes at least
80% as much full length cDNA at 50.degree. C. as at it does at
40.degree. C.
4. The reverse transcriptase of claim 1, which synthesizes at least
90% as much full length cDNA at 50.degree. C. as at it does at
40.degree. C.
5. The reverse transcriptase of claim 1, wherein the reverse
transcriptase is M-MLV.
6. A mutant reverse transcriptase having one or more modifications
or mutations at positions corresponding to amino acids selected
from the group consisting of: (a) leucine 52 of M-MLV reverse
transcriptase; (b) tyrosine 64 of M-MLV reverse transcriptase; (c)
lysine 152 of M-MLV reverse transcriptase; (d) histidine 204 of
M-MLV reverse transcriptase; (e) methionine 289 of M-MLV reverse
transcriptase; (f) threonine 306 of M-MLV reverse transcriptase;
and (g) phenylalanine 309 of M-MLV reverse transcriptase, wherein
said reverse transcriptase synthesizes at least 20% as much full
length cDNA at 52.5.degree. C. as at it does at 40.degree. C.
7. The reverse transcriptase of claim 6, which synthesizes at least
40% as much full length cDNA at 52.5.degree. C. as at it does at
40.degree. C.
8. The reverse transcriptase of claim 6, which synthesizes at least
50% as much full length cDNA at 52.5.degree. C. as at it does at
40.degree. C.
9. The reverse transcriptase of claim 6, which synthesizes at least
60% as much full length cDNA at 52.5.degree. C. as at it does at
40.degree. C.
10. The reverse transcriptase of claim 6, wherein the reverse
transcriptase is M-MLV.
11. A mutant reverse transcriptase having one or more modifications
or mutations at positions corresponding to amino acids selected
from the group consisting of: (a) leucine 52 of M-MLV reverse
transcriptase; (b) tyrosine 64 of M-MLV reverse transcriptase; (c)
lysine 152 of M-MLV reverse transcriptase; (d) histidine 204 of
M-MLV reverse transcriptase; (e) methionine 289 of M-MLV reverse
transcriptase; (f) threonine 306 of M-MLV reverse transcriptase;
and (g) phenylalanine 309 of M-MLV reverse transcriptase, wherein
said reverse transcriptase synthesizes at least 1% as much full
length cDNA at 55.degree. C. as at it does at 40.degree. C.
12. The reverse transcriptase of claim 11, which synthesizes at
least 5% as much full length cDNA at 55.degree. C. as at it does at
40.degree. C.
13. The reverse transcriptase of claim 11, which synthesizes at
least 10% as much full length cDNA at 55.degree. C. as at it does
at 40.degree. C.
14. The reverse transcriptase of claim 11, which synthesizes at
least 20% as much full length cDNA at 55.degree. C. as at it does
at 40.degree. C.
15. The reverse transcriptase of claim 11, wherein the reverse
transcriptase is M-MLV.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] The present application is a continuation of U.S. patent
application Ser. No. 10/661,819, filed Sep. 15, 2003 which claims
priority from Provisional Application No. 60/410,283, filed Sep.
13, 2002. This application is also a continuation-in-part of U.S.
patent application Ser. No. 11/437,681, filed May 22, 2006, which
is a continuation of U.S. application Ser. No. 09/845,157, filed
May 1, 2001, now U.S. Pat. No. 7,078,208, which claims priority
from Provisional Application No. 60/207,196, filed May 26, 2000,
the entire disclosures of which are incorporated herein by
reference.
BACKGROUND OF THE INVENTION
[0002] 1. Field of the Invention
[0003] The present invention is in the fields of molecular and
cellular biology. The invention is generally related to reverse
transcriptase enzymes and methods for the reverse transcription of
nucleic acid molecules, especially messenger RNA molecules.
Specifically, the invention relates to reverse transcriptase
enzymes which have been mutated or modified to increase
thermostability, decrease terminal deoxynucleotidyl transferase
activity, and/or increase fidelity, and to methods of producing,
amplifying or sequencing nucleic acid molecules (particularly cDNA
molecules) using these reverse transcriptase enzymes or
compositions. The invention also relates to nucleic acid molecules
produced by these methods and to the use of such nucleic acid
molecules to produce desired polypeptides. The invention also
relates to nucleic acid molecules encoding the reverse
transcriptases of the invention, to vectors containing such nucleic
acid molecules, and to host cells containing such nucleic acid
molecules. The invention also concerns kits or compositions
comprising such enzymes.
[0004] 2. Related Art
cDNA and cDNA Libraries
[0005] In examining the structure and physiology of an organism,
tissue or cell, it is often desirable to determine its genetic
content. The genetic framework of an organism is encoded in the
double-stranded sequence of nucleotide bases in the
deoxyribonucleic acid (DNA) which is contained in the somatic and
germ cells of the organism. The genetic content of a particular
segment of DNA, or gene, is typically manifested upon production of
the protein which the gene encodes. In order to produce a protein,
a complementary copy of one strand of the DNA double helix is
produced by RNA polymerase enzymes, resulting in a specific
sequence of ribonucleic acid (RNA). This particular type of RNA,
since it contains the genetic message from the DNA for production
of a protein, is called messenger RNA (mRNA).
[0006] Within a given cell, tissue or organism, there exist myriad
mRNA species, each encoding a separate and specific protein. This
fact provides a powerful tool to investigators interested in
studying genetic expression in a tissue or cell. mRNA molecules may
be isolated and further manipulated by various molecular biological
techniques, thereby allowing the elucidation of the full functional
genetic content of a cell, tissue or organism.
[0007] One common approach to the study of gene expression is the
production of complementary DNA (cDNA) clones. In this technique,
the mRNA molecules from an organism are isolated from an extract of
the cells or tissues of the organism. This isolation often employs
solid chromatography matrices, such as cellulose or agarose, to
which oligomers of thymidine (T) have been complexed. Since the 3'
termini on most eukaryotic mRNA molecules contain a string of
adenosine (A) bases, and since A base pairs with T, the mRNA
molecules can be rapidly purified from other molecules and
substances in the tissue or cell extract. From these purified mRNA
molecules, cDNA copies may be made using the enzyme reverse
transcriptase (RT), which results in the production of
single-stranded cDNA molecules. This reaction is typically referred
to as the first strand reaction. The single-stranded cDNAs may then
be converted into a complete double-stranded DNA copy (i.e., a
double-stranded cDNA) of the original mRNA (and thus of the
original double-stranded DNA sequence, encoding this mRNA,
contained in the genome of the organism) by the action of a DNA
polymerase. The protein-specific double-stranded cDNAs can then be
inserted into a plasmid or viral vector, which is then introduced
into a host bacterial, yeast, animal or plant cell. The host cells
are then grown in culture media, resulting in a population of host
cells containing (or in many cases, expressing) the gene of
interest.
[0008] This entire process, from isolation of mRNA from a source
organism or tissue to insertion of the cDNA into a plasmid or
vector to growth of host cell populations containing the isolated
gene, is termed "cDNA cloning." The set of cDNAs prepared from a
given source of mRNAs is called a "cDNA library." The cDNA clones
in a cDNA library correspond to the genes transcribed in the source
tissue. Analysis of a cDNA library can yield much information on
the pattern of gene expression in the organism or tissue from which
it was derived.
Retroviral Reverse Transcriptase Enzymes
[0009] Three prototypical forms of retroviral reverse transcriptase
have been studied thoroughly. Moloney Murine Leukemia Virus (M-MLV)
reverse transcriptase contains a single subunit of 78 kDa with
RNA-dependent DNA polymerase and RNase H activity. This enzyme has
been cloned and expressed in a fully active form in E. coli
(reviewed in Prasad, V. R., Reverse Transcriptase, Cold Spring
Harbor, N.Y.: Cold Spring Harbor Laboratory Press, p. 135 (1993)).
Human Immunodeficiency Virus (HIV) reverse transcriptase is a
heterodimer of p66 and p51 subunits in which the smaller subunit is
derived from the larger by proteolytic cleavage. The p66 subunit
has both a RNA-dependent DNA polymerase and an RNase H domain,
while the p51 subunit has only a DNA polymerase domain. Active HIV
p66/p51 reverse transcriptase has been cloned and expressed
successfully in a number of expression hosts, including E. coli
(reviewed in Le Grice, S. F. J., Reverse Transcriptase, Cold Spring
Harbor, N.Y.: Cold Spring Harbor Laboratory press, p. 163 (1993)).
Within the HIV p66/p51 heterodimer, the 51-kD subunit is
catalytically inactive, and the 66-kD subunit has both DNA
polymerase and RNase H activity (Le Grice, S. F. J., et al., EMBO
Journal 10:3905 (1991); Hostomsky, Z., et al., J. Virol. 66:3179
(1992)). Avian Sarcoma-Leukosis Virus (ASLV) reverse transcriptase,
which includes but is not limited to Rous Sarcoma Virus (RSV)
reverse transcriptase, Avian Myeloblastosis Virus (AMV) reverse
transcriptase, Avian Erythroblastosis Virus (AEV) Helper Virus MCAV
reverse transcriptase, Avian Myelocytomatosis Virus MC29 Helper
Virus MCAV reverse transcriptase, Avian Reticuloendotheliosis Virus
(REV-T) Helper Virus REV-A reverse transcriptase, Avian Sarcoma
Virus UR2 Helper Virus UR2AV reverse transcriptase, Avian Sarcoma
Virus Y73 Helper Virus YAV reverse transcriptase, Rous Associated
Virus (RAV) reverse transcriptase, and Myeloblastosis Associated
Virus (MAV) reverse transcriptase, is also a heterodimer of two
subunits, .alpha. (approximately 62 kDa) and .beta. (approximately
94 kDa), in which .alpha. is derived from .beta. by proteolytic
cleavage (reviewed in Prasad, V. R., Reverse Transcriptase, Cold
Spring Harbor, N.Y.: Cold Spring Harbor Laboratory Press (1993), p.
135). ASLV reverse transcriptase can exist in two additional
catalytically active structural forms, .beta..beta. and .alpha.
(Hizi, A. and Joklik, W. K., J. Biol. Chem. 252: 2281 (1977)).
Sedimentation analysis suggests .alpha..beta. and .beta..beta. are
dimers and that the .alpha. form exists in an equilibrium between
monomeric and dimeric forms (Grandgenett, D. P., et al., Proc. Nat.
Acad. Sci. USA 70:230 (1973); Hizi, A. and Joklik, W. K., J. Biol.
Chem. 252:2281 (1977); and Soltis, D. A. and Skalka, A. M., Proc.
Nat. Acad. Sci. USA 85:3372 (1988)). The ASLV .alpha..beta. and
.beta..beta. reverse transcriptases are the only known examples of
retroviral reverse transcriptase that include three different
activities in the same protein complex: DNA polymerase, RNase H,
and DNA endonuclease (integrase) activities (reviewed in Skalka, A.
M., Reverse Transcriptase, Cold Spring Harbor, N.Y.: Cold Spring
Harbor Laboratory Press (1993), p. 193). The .alpha. form lacks the
integrase domain and activity.
[0010] Various forms of the individual subunits of ASLV reverse
transcriptase have been cloned and expressed. These include a
98-kDa precursor polypeptide that is normally processed
proteolytically to .beta. and a 4 kDa polypeptide removed from the
.beta. carboxy end (Alexander, F., et al., J. Virol. 61:534 (1987)
and Anderson, D. et al., Focus 17:53 (1995)), and the mature .beta.
subunit (Weis, J. H. and Salstrom, J. S., U.S. Pat. No. 4,663,290
(1987); and Soltis, D. A. and Skalka, A. M., Proc. Nat. Acad. Sci.
USA 85:3372 (1988)). (See also Werner S. and Wohrl B. M., Eur. J.
Biochem. 267:4740-4744 (2000); Werner S. and Wohrl B. M., J. Virol.
74:3245-3252 (2000); Werner S. and Wohrl B. M., J. Biol. Chem.
274:26329-26336 (1999).) Heterodimeric RSV .alpha..beta. reverse
transcriptase has also been purified from E. coli cells expressing
a cloned RSV .beta. gene (Chernov, A. P., et al., Biomed. Sci. 2:49
(1991)).
Reverse Transcription Efficiency
[0011] As noted above, the conversion of mRNA into cDNA by reverse
transcriptase-mediated reverse transcription is an essential step
in the study of proteins expressed from cloned genes. However, the
use of unmodified reverse transcriptase to catalyze reverse
transcription is inefficient for a number of reasons. First,
reverse transcriptase sometimes degrades an RNA template before the
first strand reaction is initiated or completed, primarily due to
the intrinsic RNase H activity present in reverse transcriptase. In
addition, mis-priming of the mRNA template molecule can lead to the
introduction of errors in the cDNA first strand while secondary
structure of the mRNA molecule itself may make some mRNAs
refractory to first strand synthesis.
[0012] Removal of the RNase H activity of reverse transcriptase can
eliminate the first problem and improve the efficiency of reverse
transcription (Gerard, G. F., et al., FOCUS 11(4):60 (1989);
Gerard, G. F., et al., FOCUS 14(3):91 (1992)). However such reverse
transcriptases ("RNase H-" forms) do not address the additional
problems of mis-priming and mRNA secondary structure.
[0013] Another factor which influences the efficiency of reverse
transcription is the ability of RNA to form secondary structures.
Such secondary structures can form, for example, when regions of
RNA molecules have sufficient complementarity to hybridize and form
double stranded RNA. Generally, the formation of RNA secondary
structures can be reduced by raising the temperature of solutions
which contain the RNA molecules. Thus, in many instances, it is
desirable to reverse transcribe RNA at temperatures above
37.degree. C. However, art known reverse transcriptases generally
lose activity when incubated at temperatures much above 37.degree.
C. (e.g., 50.degree. C.).
SUMMARY OF THE INVENTION
[0014] The present invention provides, in part, reverse
transcriptase enzymes, compositions comprising such enzymes and
methods useful in overcoming limitations of reverse transcription
discussed above. In general, the invention provides compositions
for use in reverse transcription of a nucleic acid molecule, these
compositions comprising one or more (e.g., one, two, three, four,
five, ten, fifteen, etc.) polypeptides having at least one reverse
transcriptase activity. Such compositions may further comprise one
or more (e.g., one, two, three, four, five, etc.) nucleotides (e.g.
one or more fluorescent1-labeled nucleotides, one or more
radiolabeled nucleotides, etc.), a suitable buffer, and/or one or
more (e.g., one, two, three, four, five, ten, fifteen, etc.) DNA
polymerases. Compositions of the invention may also comprise one or
more (e.g., one, two, three, four, five, ten, fifteen, etc.)
oligonucleotide primers, and/or one or more templates, and/or one
or more nucleic acid molecules (which may be complementary to all
or a portion of such templates).
[0015] Reverse transcriptases of the invention are preferably
modified or mutated such that the thermostability of the enzyme is
increased or enhanced and/or the fidelity of the enzyme is
increased or enhanced. In specific embodiments, reverse
transcriptases of the invention may be single chained (single
subunit) or multi-chained (multi-subunit) and may be reduced or
substantially reduced in RNase H activity or may have no detectable
RNase H activity or may be lacking in RNase H activity. Preferably
enzymes of the invention are enzymes selected from the group
consisting of Moloney Murine Leukemia Virus (M-MLV) RNase H-
reverse transcriptase, Rous Sarcoma Virus (RSV) RNase H- reverse
transcriptase, Avian Myeloblastosis Virus (AMV) RNase H- reverse
transcriptase, Rous Associated Virus (RAV) RNase H- reverse
transcriptase, Myeloblastosis Associated Virus (MAV) RNase H-
reverse transcriptase or other ASLV RNase H- reverse transcriptases
and Human Immunodeficiency Virus (HIV) RNase H- reverse
transcriptase and mutants thereof. In preferred compositions, the
reverse transcriptases are present at working concentrations.
[0016] In certain aspects, the invention includes reverse
transcriptases which have been modified or mutated to increase or
enhance thermostability. Examples of such reverse transcriptases
include enzymes comprising one or more modifications or mutations
at positions corresponding to amino acids selected from the group
consisting of:
[0017] (a) leucine 52 of M-MLV reverse transcriptase;
[0018] (b) tyrosine 64 of M-MLV reverse transcriptase;
[0019] (c) lysine 152 of M-MLV reverse transcriptase;
[0020] (d) histidine 204 of M-MLV reverse transcriptase;
[0021] (e) methionine 289 of M-MLV reverse transcriptase;
[0022] (f) threonine 306 of M-MLV reverse transcriptase; and
[0023] (g) phenylalanine 309 of M-MLV reverse transcriptase.
In some embodiments, a modification or mutation may be the addition
of an N- and/or C-terminal tag sequence.
[0024] In specific embodiments, the invention is directed to M-MLV
reverse transcriptases wherein leucine 52 is replaced with proline,
tyrosine 64 is replaced with arginine, lysine 152 is replaced with
methionine, histidine 204 is replaced with arginine, methionine 289
is replaced with leucine, threonine 306 is replaced with either
lysine or arginine, and/or phenylalanine 309 is replaced with
asparagine or serine. Further included within the scope of the
invention are reverse transcriptases, other than M-MLV reverse
transcriptase, which contain alterations corresponding to those set
out above.
[0025] In additional aspects, the invention also include
thermostable reverse transcriptases which retain at least about
50%, at least about 60%, at least about 70%, at least about 85%, at
least about 95%, at least about 97%, at least about 98%, at least
about 99%, at least about 100%, at least about 150%, at least about
200%, at least about 250%, or at least about 300% of reverse
transcriptase activity after heating to 50.degree. C. for 5
minutes.
[0026] As noted above, enzymes of the invention include reverse
transcriptases which exhibit reverse transcriptase activity either
upon the formation of multimers (e.g., dimers) or as individual
protein molecules (i.e., in monomeric form). Examples of reverse
transcriptases which exhibit reverse transcriptase activity upon
the formation of multimers include AMV, RSV and HIV reverse
transcriptases. One example of a reverse transcriptase which
exhibits reverse transcriptase activity as separate, individual
proteins (i.e., in monomeric form) is M-MLV reverse
transcriptase.
[0027] Multimeric reverse transcriptases of the invention may form
homo-multimers or hetero-multimers. In other words, the subunits of
the multimeric protein complex may be identical or different. One
example of a hetero-dimeric reverse transcriptase is AMV reverse
transcriptase, which is composed of two subunits that differ in
primary amino acid sequence. More specifically, as already
discussed, AMV reverse transcriptase may be composed of two
subunits wherein one of these subunits is generated by proteolytic
processing of the other. Thus, dimeric AMV reverse transcriptase
may be composed of subunits of differing size which share regions
of amino acid sequence identity.
[0028] The present invention relates in particular to mutant or
modified reverse transcriptases wherein one or more (e.g., one,
two, three, four, five, ten, twelve, fifteen, twenty, etc.) amino
acid changes have been made which renders the enzyme more
thermostable in nucleic acid synthesis, as compared to the
unmutated or unmodified reverse transcriptases. Sites for mutation
or modification to produce the thermostable reverse transcriptase
enzymes of the present invention and/or reverse transcriptases
which exhibit other characteristics (e.g., increased fidelity,
decreased TdT activity, etc.) are listed for some reverse
transcriptases in Table 1. As will be appreciated by those skilled
in the art, one or more of the amino acids identified may be
deleted and/or replaced with one or a number of amino acid
residues. In a preferred aspect, any one or more of the amino acids
identified in Table 1 may be substituted with any one or more amino
acid residues such as Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His,
Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, and/or Val. The
modifications described in Table 1 preferably produce thermostable
reverse transcriptases of the invention. Similar or equivalent
sites or corresponding sites in other reverse transcriptases can be
mutated or modified to produce additional thermostable reverse
transcriptases, as well as reverse transcriptases which exhibit
other characteristics (e.g., increased fidelity, decreased TdT
activity, etc.). Thus, a reverse transcriptase of the present
invention may have one or more of the following properties: (a)
increased thermostability or increased half-life at elevated
temperatures; (b) reduced, substantially reduced, or no detectable
RNase H activity, (c) reduced or substantially reduced terminal
deoxynucleotidyl transferase activity, and/or (d) increased
fidelity. In some embodiments, a reverse transcriptase of the
invention may have a plurality of the properties listed above
(e.g., a reverse transcriptase may have enhanced thermostability,
reduced RNase H activity, and enhanced fidelity). TABLE-US-00001
TABLE 1 RT Amino Acids M-MLV L52, Y64, L135, H143, K152, Q165,
G181, H204, I218, N249, M289, T306, F309, A517, D524, T544, V546,
W548, E562, H577, D583, L604, S606, G608, F625, L626, H629, H631,
H638, G641 AMV V2, L4, W12, P14, H16, T17, W20, I21, Q23, W24, L26,
P27, G29, V32, Q36, L42, Q43, L44, G45, H46, I47, P49, S50, L51,
S52, C53, W54, F59, I61, A64, S65, G66, S67, Y68, L70, L71, A76,
A79, P83, A86, V87, Q88, Q89, G90, A91, W101, P102, L108, Q120,
S131, V132, N133, N134, Q135, P137, A138, Q142, Q148, T151, Y180,
M181, S190, H191, G193, A196, I201, S202, P214, V217, Q218, P221,
G222, Q224, L226, G227, Y228, G231, T233, Y234, A236, P237, G239,
L240, P244, I246, T248, W250, Q252, G257, Q260, W261, P264, L266,
G267, L272, Y277, Q279, L280, G282, S283, P285, N286, A288, N292,
L293, M297, I302, V303, L305, S306, T308, L311, L320, I332, G333,
V334, G336, Q337, G338, P345, W348, L349, F350, S351, P354, A357,
F358, A360, W361, L362, V364, L365, T366, T370, A374, V377, G381,
C392, P400, G402, L405, G412, I414, F423, I425, A426, P428, L433,
H440, P441, V443, G444, P445, A451, S453, S454, T455, H456, G458,
V459, V460, W462, W468, I470, I473, A474, L476, G477, A478, S479,
V480, Q481, Q482, L483, A491, W495, P496, T497, T498, P499, T500,
A507, F508, M512, L513, G520, V521, P522, S523, T524, A525, A527,
F528, L534, S535, Q536, S538, V543, S548, H549, S550, V552, P553,
F556, T557, N560, A562 RSV V2, L4, W12, P14, H16, T17, W20, I21,
Q23, W24, L26, P27, G29, V32, Q36, L42, Q43, L44, G45, H46, I47,
P49, S50, L51, S52, C53, W54, F59, I61, A64, S65, G66, S67, Y68,
L70, L71, A76, A79, P83, A86, V87, Q88, Q89, G90, A91, W101, P102,
L108, Q120, S131, V132, N133, N134, Q135, P137, A138, Q142, Q148,
T151, Y180, M181, S190, H191, G193, A196, I201, S202, P214, V217,
Q218, P221, G222, Q224, L226, G227, Y228, G231, T233, Y234, A236,
P237, G239, L240, P244, I246, T248, W250, Q252, G257, Q260, W261,
P264, L266, G267, L272, Y277, Q279, L280, G282, S283, P285, N286,
A288, N292, L293, M297, I302, V303, L305, S306, T308, L311, L320,
I332, G333, V334, G336, Q337, G338, P345, W348, L349, F350, S351,
P354, A357, F358, A360, W361, L362, V364, L365, T366, T370, A374,
V377, G381, C392, P400, G402, L405, G412, I414, F423, I425, A426,
P428, L433, H440, P441, V443, G444, P445, A451, S453, S454, T455,
H456, G458, V459, V460, W462, W468, I470, I473, A474, L476, G477,
A478, S479, V480, Q481, Q482, L483, A491, W495, P496, T497, T498,
P499, T500, A507, F508, M512, L513, G520, V521, P522, S523, T524,
A525, A527, F528, L534, S535, Q536, S538, V543, S548, H549, S550,
V552, P553, F556, T557, N560, A562 HIV I1, P3, L11, P13, G14, M15,
Q22, W23, L25, T26, T38, G44, I46, S47, G50, P51, N53, P54, Y55,
F60, I62, S67, T68, W70, L73, V89, Q90L91, G92, I93, S104, V110,
G111, S133, I134, N135, N136, P139, G140, I141, Q144, N146, Q150,,
Y182, M183, I194, G195, Q196, T,199, Q206, L209, P216, Q221, P224,
P225, L227, M229, G230, Y231, H234, Q241, P242, V244, L245, S250,
T252, N254, Q257, G261, N264, W265, Q268, P271, G272, Q277, C279,
L281, L282, G284, T285, A287, L288, T289, V291, P293, L294, T295,
L300, A303, I308, L309, P312, H314, Y317, L324, I328, Q329, G332,
Q333, G334, Y341, P344, F345, Y353, M356, G358, A359, H360, T361,
Q372, T376, V380, Q392, W405, Q406, A407, F415, V416, N417, T418,
P419, P420, L424, W425, P432, V434, G435, A436, A444, A445, N446,
T449, L451, N459, G461, Q463, V465, V466, P467, L468, T469, N470,
T471, T472, N473, Q474, Y482, Q486, S488, G489, L490, Q499, Y500,
G503, I504, S512, S514, L516, N518, Q519, Q523, I525, W534, P536,
A537, H538, G540, I541, G542, Q546, L550, S552, A553, V554,
I555
[0029] Those skilled in the art will appreciate that a different
isolate of virus may encode a reverse transcriptase enzyme having a
different amino acid at the positions identified above. Such
isolates may be modified to produce the reverse transcriptases
(e.g., thermostable reverse transcriptases) of the present
invention.
[0030] Reverse transcriptases of the invention may have one or more
of the following properties: (a) increased thermostability or
increased half-life at elevated temperatures; (b) reduced,
substantially reduced, or no detectable RNase H activity, (c)
reduced or substantially reduced terminal deoxynucleotidyl
transferase activity, and/or (d) increased fidelity.
[0031] Enzymes of the invention which have reduced or substantially
reduced terminal deoxynucleotidyl transferase activity may comprise
one or more modifications or mutations at positions corresponding
to amino acids selected from the group consisting of:
[0032] (a) tyrosine 133 of M-MLV reverse transcriptase;
[0033] (b) threonine 197 of M-MLV reverse transcriptase; and
[0034] (c) phenylalanine 309 of M-MLV reverse transcriptase.
[0035] In specific embodiments, the invention is directed to M-MLV
reverse transcriptases wherein tyrosine 133 is replaced with
alanine, threonine 197 is replaced with glutamic acid, and/or
phenylalanine 309 is replaced with asparagine. As will be
appreciated, one or more of the amino acids identified may be
deleted and/or replaced with one or a number of amino acid
residues. Further included within the scope of the invention are
reverse transcriptases, other than M-MLV reverse transcriptase,
which contain alterations corresponding to those set out above.
[0036] Additionally, enzymes which exhibit increased fidelity may
comprise one or more modifications or mutations at positions
corresponding to amino acids selected from the group consisting
of:
[0037] (a) tyrosine 64 of M-MLV reverse transcriptase;
[0038] (b) arginine 116 of M-MLV reverse transcriptase;
[0039] (c) glutamine 190 of M-MLV reverse transcriptase; and
[0040] (d) valine 223 of M-MLV reverse transcriptase.
[0041] As will be appreciated, one or more of the amino acids
identified may be deleted and/or replaced with any one or a number
of amino acid residues. Further, included in the invention are
reverse transcriptases, other than M-MLV reverse transcriptase,
that contain alterations corresponding to those set out above.
[0042] In some embodiments, the present invention provides a
modified or mutated reverse transcriptase (e.g., preferably a
modified or mutated retroviral reverse transcriptase) having a
reverse transcriptase activity that has a half-life of greater than
that of the corresponding unmodified or un-mutated reverse
transcriptase at an elevated temperature, i.e., greater than
37.degree. C. In some embodiments, the half-life of a reverse
transcriptase of the present invention may be 5 minutes or greater
and preferably 10 minutes or greater at 50.degree. C. In some
embodiments, the reverse transcriptases of the invention may have a
half-life (e.g., at 50.degree. C.) equal to or greater than about
25 minutes, preferably equal to or greater than about 50 minutes,
more preferably equal to or greater than about 100 minutes, and
most preferably, equal to or greater than about 200 minutes.
[0043] In some embodiments, the reverse transcriptases of the
invention may have a half-life at 50.degree. C. that is from about
10 minutes to about 200 minutes, from about 10 minutes to about 150
minutes, from about 10 minutes to about 100 minutes, from about 10
minutes to about 75 minutes, from about 10 minutes to about 50
minutes, from about 10 minutes to about 40 minutes, from about 10
minutes to about 30 minutes, or from about 10 minutes to about 20
minutes.
[0044] A modified or mutated reverse transcriptase of the invention
(e.g., one having a half-life at 50.degree. C. as described above)
may be a modified or mutated retroviral reverse transcriptase. A
reverse transcriptase according to the invention may be selected
from a group consisting of M-MLV reverse transcriptase, ASV reverse
transcriptase, HIV reverse transcriptase, Avian Sarcoma-Leukosis
Virus (ASLV) reverse transcriptase, Rous Sarcoma Virus (RSV)
reverse transcriptase, Avian Myeloblastosis Virus (AMV) reverse
transcriptase, Avian Erythroblastosis Virus (AEV) Helper Virus MCAV
reverse transcriptase, Avian Myelocytomatosis Virus MC29 Helper
Virus MCAV reverse transcriptase, Avian Reticuloendotheliosis Virus
(REV-T) Helper Virus REV-A reverse transcriptase, Avian Sarcoma
Virus UR2 Helper Virus UR2AV reverse transcriptase, Avian Sarcoma
Virus Y73 Helper Virus YAV reverse transcriptase, Rous Associated
Virus (RAV) reverse transcriptase, and Myeloblastosis Associated
Virus (MAV) reverse transcriptase, and fragments of any of the
above having reverse transcriptase activity.
[0045] Mutated or modified reverse transcriptases of the present
invention may have a reverse transcriptase activity (e.g.,
RNA-dependent DNA polymerase activity) that has a longer half-life
at 55.degree. C. than the reverse transcriptase activity of a
corresponding un-mutated or unmodified reverse transcriptases. For
example, introduction of the H204R, M289K, T306K, and F309N
mutation into His.sub.6-H.sup.-RT increases the half-life at
55.degree. C. from 1.6 minutes to 8.1 minutes (see Table 9). At
55.degree. C., the half-life of reverse transcriptase activity of a
mutated or modified reverse transcriptase of the invention may be
greater than about 2 minutes, greater than about 3 minutes, greater
than about 4 minutes, greater than about 5 minutes, greater than
about 6 minutes, greater than about 7 minutes, greater than about 8
minutes, greater than about 10 minutes, greater than about 15
minutes, greater than about 20 minutes, or greater than about 30
minutes. At 55.degree. C., the half-life of reverse transcriptase
activity of a reverse transcriptase of the invention may be from
about 2 minutes to about 60 minutes, from about 2 minutes to about
45 minutes, from about 2 minutes to about 30 minutes, from about 2
minutes to about 20 minutes, from about 2 minutes to about 15
minutes, from about 2 minutes to about 10 minutes, from about 2
minutes to about 8 minutes, from about 2 minutes to about 7
minutes, from about 2 minutes to about 6 minutes, from about 2
minutes to about 5 minutes, from about 2 minutes to about 4
minutes, or from about 2 minutes to about 3 minutes. Such a reverse
transcriptase may be a modified or mutant retroviral reverse
transcriptase.
[0046] A modified or mutated reverse transcriptase of the invention
(e.g., one having a half-life at 55.degree. C. as described above)
may be a modified or mutated retroviral reverse transcriptase. A
mutated reverse transcriptase according to the present invention
may be selected from a group consisting of M-MLV reverse
transcriptase, ASV reverse transcriptase, HIV reverse
transcriptase, Avian Sarcoma-Leukosis Virus (ASLV) reverse
transcriptase, Rous Sarcoma Virus (RSV) reverse transcriptase,
Avian Myeloblastosis Virus (AMV) reverse transcriptase, Avian
Erythroblastosis Virus (AEV) Helper Virus MCAV reverse
transcriptase, Avian Myelocytomatosis Virus MC29 Helper Virus MCAV
reverse transcriptase, Avian Reticuloendotheliosis Virus (REV-T)
Helper Virus REV-A reverse transcriptase, Avian Sarcoma Virus UR2
Helper Virus UR2AV reverse transcriptase, Avian Sarcoma Virus Y73
Helper Virus YAV reverse transcriptase, Rous Associated Virus (RAV)
reverse transcriptase, and Myeloblastosis Associated Virus (MAV)
reverse transcriptase and fragments of any of the above having
reverse transcriptase activity.
[0047] Reverse transcriptases of the present invention may produce
more product (e.g., full length product) at elevated temperatures
than other reverse transcriptases. In one aspect, comparisons of
full length product synthesis is made at different temperatures
(e.g., one temperature being lower, such as between 37.degree. C.
and 50.degree. C., and one temperature being higher, such as
between 50.degree. C. and 78.degree. C.) while keeping all other
reaction conditions similar or the same. The amount of full length
product produced may be determined using techniques well known in
the art, for example, by conducting a reverse transcription
reaction at a first temperature (e.g., 37.degree. C., 38.degree.
C., 39.degree. C., 40.degree. C., etc.) and determining the amount
of full length transcript produced, conducting a second reverse
transcription reaction at a temperature higher than the first
temperature (e.g., 45.degree. C., 50.degree. C., 52.5.degree. C.,
55.degree. C., etc.) and determining the amount of full length
product produced, and comparing the amounts produced at the two
temperatures. A convenient form of comparison is to determine the
percentage of the amount of full length product at the first
temperature that is produced at the second (i.e., elevated)
temperature. The reaction conditions used for the two reactions
(e.g., salt concentration, buffer concentration, pH, divalent metal
ion concentration, nucleoside triphosphate concentration, template
concentration, reverse transcriptase concentration, primer
concentration, length of time the reaction is conducted, etc.) are
preferably the same for both reactions. Suitable reaction
conditions include, but are not limited to, a template
concentration of from about 1 nM to about 1 .mu.M, from about 100
nM to 1 .mu.M, from about 300 nM to about 750 nM, or from about 400
nM to about 600 nM, and a reverse transcriptase concentration of
from about 1 nM to about 1 .mu.M, from about 10 nM to 500 nM, from
about 50 nM to about 250 nM, or from about 75 nM to about 125 nM.
The ratio of the template concentration to the reverse
transcriptase concentration may be from about 100:1 to about 1:1,
from about 50:1 to about 1:1, from about 25:1 to about 1:1, from
about 10:1 to about 1:1, from about 5:1 to about 1:1, or from about
2.5:1 to 1:1. A reaction may be conducted from about 5 minutes to
about 5 hours, from about 10 minutes to about 2.5 hours, from about
30 minutes to about 2 hours, from about 45 minutes to about 1.5
hours, or from about 45 minutes to about 1 hour. A suitable
reaction time is about one hour. Other suitable reaction conditions
may be determined by those skilled in the art using routine
techniques and examples of such conditions are provided below.
[0048] When the amount of full length product produced by a reverse
transcriptase of the invention at an elevated temperature is
compared to the amount of full length product produced by the same
reverse transcriptase at a lower temperature, at an elevated
temperature, the reverse transcriptases of the invention may
produce not less than about 25%, 35%, 45%, 55%, 65%, 75%, 85%, 95%,
100% of the amount of full length product produced at the lower
temperature. In some cases, the reverse transcriptases of the
invention may produce an amount of full length product at a higher
temperature that is greater than the amount of full length product
produced by the reverse transcriptase at a lower temperature (e.g.,
1% to about 100% greater). In one aspect, reverse transcriptases of
the invention produce approximately the same amount (e.g., no more
than a 25% difference) of full length product at the lower
temperature compared to the amount of full length product made at
the higher temperature.
[0049] A reverse transcriptase of the present invention may be one
that synthesizes an amount of full length product, wherein the
amount of full length product synthesized at 50.degree. C. is no
less than 10% (e.g., from about 10% to about 95%, from about 10% to
about 80%, from about 10% to about 70%, from about 10% to about
60%, from about 10% to about 50%, from about 10% to about 40%, from
about 10% to about 30%, or from about 10% to about 20%) of the
amount of full length product it synthesizes at 40.degree. C. In
some embodiments, a reverse transcriptase of the invention is one
wherein the amount of full length product synthesized at 50.degree.
C. is no less than 50% (e.g., from about 50% to about 95%, from
about 50% to about 80%, from about 50% to about 70%, or from about
50% to about 60%) of the amount of full length product it
synthesizes at 40.degree. C. In some embodiments, a reverse
transcriptase of the invention is one wherein the amount of full
length product synthesized at 50.degree. C. is no less than 75%
(e.g., from about 75% to about 95%, from about 75%, to about 90%,
from about 75% to about 85%, or from about 75% to about 80%) of the
amount of full length product it synthesizes at 40.degree. C. In
other embodiments, a reverse transcriptase of the invention is one
wherein the amount of full length product synthesized at 50.degree.
C. is no less than 85% (e.g., from about 85% to about 95%, or from
about 85% to about 90%) of the amount of full length product it
synthesizes at 40.degree. C.
[0050] A reverse transcriptase of the invention may be one that
synthesizes an amount of full length product, wherein the amount of
full length product synthesized at 52.5.degree. C. is no less than
10% (e.g., from about 10% to about 30%, from about 10% to about to
about 25%, from about 10% to about 20%, from about 10% to about
15%, from about 20% to about 60%, from about 20% to about 40%, from
about 20% to about 30%, from about 30% to about 80%, from about 30%
to about 60%, from about 30% to about 45%, from about 40% to about
90%, from about 40% to about 80%, from about 40% to about 60%, from
about 40% to about 50% from about 50% to about 90%, or from about
50% to about 70%), of the amount of full length product it
synthesizes at 40.degree. C. In some embodiments, the amount of
full length product synthesized at 52.5.degree. C. is no less than
30% (e.g., from about 30% to about 70%, from about 30% to about
60%, from about 30% to about 50%, or from about 30% to about 40%)
of the amount of full length product it synthesizes at 40.degree.
C. In some embodiments, the amount of full length product
synthesized at 52.5.degree. C. is no less than 50% (e.g., from
about 50% to about 70%, from about 50% to about 65%, from about 50%
to about 60%, or from about 50% to about 55%), of the amount of
full length product it synthesizes at 40.degree. C.
[0051] A reverse transcriptase of the invention may be one that
synthesizes an amount of full length product, wherein the amount of
full length product synthesized at 55.degree. C. is no less than 1%
(e.g., from about 1% to about 30%, from about 1% to about 25%, from
about 1% to about 20%, from about 1% to about 15%, from about 1% to
about 10%, or from about 1% to about 5%) of the amount of fall
length product it synthesizes at 40.degree. C. In some embodiments,
the amount of full length product synthesized at 55.degree. C. is
no less than 5% (e.g., from about 5% to about 30%, from about 5% to
about to about 25%, from about 5% to about 20%, from about 5% to
about 15%, or from about 5% to about 10%) of the amount of full
length product it synthesizes at 40.degree. C. In some embodiments,
the amount of full length product synthesized at 55.degree. C. is
no less than 10% (e.g., from about 10% to about 30%, from about 10%
to about to about 25%, from about 10% to about 20%, from about 10%
to about 15%, from about 20% to about 60%, from about 20% to about
40%, from about 20% to about 30%, from about 30% to about 80%, from
about 30% to about 60%, from about 30% to about 45%, from about 40%
to about 90%, from about 40% to about 80%, from about 40% to about
60%, from about 40% to about 50% from about 50% to about 90%, or
from about 50% to about 70%) of the amount of full length product
it synthesizes at 40.degree. C.
[0052] In another aspect, the reverse transcriptases of the
invention are capable of producing more nucleic acid product (e.g.,
cDNA) and, preferably, more full length product, at one or a number
of elevated temperatures (typically between 40.degree. C. an
78.degree. C.) compared to the corresponding un-mutated or
unmodified reverse transcriptase (e.g., the control reverse
transcriptase). Such comparisons are typically made under similar
or the same reaction conditions and the amount of product
synthesized by the control reverse transcriptase is compared to the
amount of product synthesized by the reverse transcriptase of the
invention. Preferably, the reverse transcriptases of the invention
produce at least about 5%, at least 10%, at least 15%, at least
25%, at least 50%, at least 75%, at least 100%, or at least 200%
more product or full length product compared to the corresponding
control reverse transcriptase under the same reaction conditions
and temperature. The reverse transcriptases of the invention
preferably produce from about 10% to about 200%, from about 25% to
about 200%, from about 50% to about 200%, from about 75% to about
200%, or from about 100% to about 200% more product or full length
product compared to a control reverse transcriptase under the same
reaction conditions and incubation temperature. The reverse
transcriptases of the invention preferably produce at least 2
times, at least 3 times, at least 4 times, at least 5 times, at
least 6 times, at least 7 times, at least 8 times, at least 9
times, at least 10 times, at least 25 times, at least 50 times, at
least 75 times, at least 100 times, at least 150 times, at least
200 times, at least 300 times, at least 400 times, at least 500
times, at least 1000 times, at least 5,000 times, or at least
10,000 times more product or full length product compared to a
control reverse transcriptase (e.g., the corresponding un-mutated
or unmodified reverse transcriptase) under the same reaction
conditions and temperature. The reverse transcriptases of the
invention preferably produce from 2 to 10,000, 5 to 10,000, 10 to
5,000, 50 to 5,000, 50 to 500, 2 to 500, 5 to 500, 5 to 200, 5 to
100, or 5 to 75 times more product or full length product than a
control reverse transcriptase under the same reaction conditions
and temperature.
[0053] In one aspect, the reverse transcriptases of the invention
produce, at 50.degree. C., at least 25% more, preferably at least
50% more and more preferably at least 100% more nucleic acid
product or full length product than a control reverse transcriptase
(which is preferably the corresponding wild-type reverse
transcriptase). In another aspect, at 52.5.degree. C., the reverse
transcriptases of the invention produce at least 1.5 times, at
least 2 times, at least 2.5 times, at least 3 times, at least 4
times, at least 5 times, at least 6 times, at least 7 times, at
least 8 times, at least 9 times, at least 10 times the amount of
nucleic acid product or full length product compared to a control
reverse transcriptase. In another aspect, at 55.degree. C., the
reverse transcriptases of the invention produce at least 2 times,
at least 5 times, at least 10 times, at least 15 times, at least 20
times, at least 25 times, at least 50 times, at least 75 times, at
least 100 times the amount of nucleic acid product or full length
product compared to a control reverse transcriptase. Such
comparisons are preferably made under the same reaction conditions
and temperature.
[0054] Modified or mutated reverse transcriptases of the present
invention may have an increased thermostability at elevated
temperatures as compared to corresponding unmodified or un-mutated
reverse transcriptases. They may show increased thermostability in
the presence or absence an RNA template. In some instances, reverse
transcriptases of the invention may show an increased
thermostability in both the presence and absence of an RNA
template. Those skilled in the art will appreciate that reverse
transcriptase enzymes are typically more thermostable in the
presence of an RNA template. The increase in thermostability may be
measured by comparing suitable parameters of the modified or
mutated reverse transcriptase of the invention to those of a
corresponding unmodified or un-mutated reverse transcriptase.
Suitable parameters to compare include, but are not limited to, the
amount of product and/or full length product synthesized by the
modified or mutated reverse transcriptase at an elevated
temperature compared to the amount or product and/or full length
product synthesized by the corresponding un-modified or un-mutated
reverse transcriptase at the same temperature, and/or the half-life
of reverse transcriptase activity at an elevated temperature of a
modified or mutated reverse transcriptase at an elevated
temperature compared to that of a corresponding unmodified or
un-mutated reverse transcriptase.
[0055] A modified or mutated reverse transcriptase of the invention
may have an increase in thermostability at 50.degree. C. of at
least about 1.5 fold (e.g., from about 1.5 fold to about 100 fold,
from about 1.5 fold to about 50 fold, from about 1.5 fold to about
25 fold, from about 1.5 fold to about 10 fold) compared, for
example, to the corresponding un-mutated or unmodified reverse
transcriptase. A reverse transcriptase of the invention may have an
increase in thermostability at 50.degree. C. of at least about 10
fold (e.g., from about 10 fold to about 100 fold, from about 10
fold to about 50 fold, from about 10 fold to about 25 fold, or from
about 10 fold to about 15 fold) compared, for example, to the
corresponding un-mutated or un-modified reverse transcriptase. A
reverse transcriptase of the invention may have an increase in
thermostability at 50.degree. C. of at least about 25 fold (e.g.,
from about 25 fold to about 100 fold, from about 25 fold to about
75 fold, from about 25 fold to about 50 fold, or from about 25 fold
to about 35 fold) compared to a corresponding un-mutated or
unmodified reverse transcriptase.
[0056] The present invention also contemplates a modified or
mutated thermostable reverse transcriptase, wherein the reverse
transcriptase has an increase in thermostability of greater than
about 1.5 fold at 52.5.degree. C. (e.g., from about 1.5 fold to
about 100 fold, from about 1.5 fold to about 50 fold, from about
1.5 fold to about 25 fold, or from about 1.5 fold to about 10 fold)
compared, for example, to the corresponding un-mutated or
unmodified reverse transcriptase. A reverse transcriptase of the
invention may have an increase in thermostability at 52.5.degree.
C. of at least about 10 fold (e.g., from about 10 fold to about 100
fold, from about 10 fold to about 50 fold, from about 10 fold to
about 25 fold, or from about 10 fold to about 15 fold) compared,
for example, to the corresponding un-mutated or unmodified reverse
transcriptase. A reverse transcriptase of the invention may have an
increase in thermostability at 52.5.degree. C. of at least about 25
fold (e.g., from about 25 fold to about 100 fold, from about 25
fold to about 75 fold, from about 25 fold to about 50 fold, or from
about 25 fold to about 35 fold) compared, for example, to the
corresponding un-mutated or unmodified reverse transcriptase.
[0057] In other embodiments, the present invention provides a
reverse transcriptase, wherein the reverse transcriptase has an
increase in thermostability of greater than about 1.5 fold at
55.degree. C. (e.g., from about 1.5 fold to about 100 fold, from
about 1.5 fold to about 50 fold, from about 1.5 fold to about 25
fold, or from about 1.5 fold to about 10 fold) compared to a
corresponding un-mutated or unmodified reverse transcriptase. In
some embodiments, a reverse transcriptase of the invention may have
an increase in thermostability at 55.degree. C. of at least about
10 fold (e.g., from about 10 fold to about 100 fold, from about 10
fold to about 50 fold, from about 10 fold to about 25 fold, or from
about 10 fold to about 15 fold) compared to a corresponding
un-mutated or unmodified reverse transcriptase. In some
embodiments, a reverse transcriptase of the invention may have an
increase in thermostability at 55.degree. C. of at least about 25
fold (e.g., from about 25 fold to about 100 fold, from about 25
fold to about 75 fold, from about 25 fold to about 50 fold, or from
about 25 fold to about 35 fold) compared to a corresponding
un-mutated or unmodified reverse transcriptase.
[0058] The present invention provides reverse transcriptase
enzymes, compositions and kits comprising such enzymes, and methods
useful in preparing labeled nucleic acid molecules by reverse
transcription. In general, the invention relates to the use of
polypeptides of the invention (e.g., reverse transcriptase enzymes
having one or more of the mutations identified above) to
synthesized labeled nucleic acid molecules. In some embodiments,
polypeptides of the invention may be heterodimers and more
specifically two subunit enzymes (e.g., dimers) such as HIV RT and
ASLV RTs. In some embodiments, polypeptides of the invention may be
single sub-unit enzymes (e.g., M-MLV reverse transcriptase).
Preferably, such labeling involves the use of modified nucleotides
(e.g., labeled nucleotides, particularly fluorescently labeled
nucleotides, nucleotide analogs and the like) and one or more
nucleic acid templates (preferably RNA and most preferably mRNA).
In accordance with the invention, one or more labeled nucleic acid
molecules are synthesized which are complementary to all or a
portion of the one or more templates. The labeled nucleic acid
molecules preferably have one or more labeled nucleotides
incorporated into the synthesized molecule and in a preferred
aspect, the labels are one or more fluorescent labels (which may be
the same or different). In another aspect, nucleotides are used
during nucleic acid synthesis using the reverse transcriptases of
the invention to produce one or more nucleic acid molecules
complementary to all or a portion of one or more templates. In such
aspects, such nucleotides, which are incorporated in the
synthesized nucleic acid molecules, may be modified (before or
after incorporation) to contain one or more labels, which may then
be detected.
[0059] The invention also relates to compositions for use in the
invention and such compositions may comprise one or more
polypeptides of the invention (e.g., single sub-unit such as M-MLV
RT and/or multi-subunit RTs such as HIV and ASLV RTs). Such
compositions may further comprise one or more nucleotides, a
suitable buffer, and/or one or more DNA polymerases. The
compositions of the invention may also comprise one or more
primers. The reverse transcriptases in these compositions
preferably have RNase H activity or are reduced or substantially
reduced in RNase H activity, and most preferably are enzymes
selected from the group consisting of Moloney Murine Leukemia Virus
(M-MLV) reverse transcriptase, Rous Sarcoma Virus (RSV) reverse
transcriptase, Avian Myeloblastosis Virus (AMV) reverse
transcriptase, Rous Associated Virus (RAV) reverse transcriptase,
Myeloblastosis Associated Virus (MAV) reverse transcriptase and
Human Immunodeficiency Virus (HIV) reverse transcriptase or other
ASLV reverse transcriptases. The reverse transcriptases of the
invention may be composed of one or more subunits (which may be the
same or different). When two subunit RTs are use in the practice of
the invention, such enzymes may contain various forms and
combinations of such subunits such as .alpha..beta., .alpha..beta.,
.beta..beta., etc. and mutants, variants or derivatives thereof. In
preferred compositions, the reverse transcriptases are present at
working concentrations.
[0060] The invention is also directed to methods for making one or
more nucleic acid molecules and/or labeled nucleic acid molecules,
comprising mixing one or more nucleic acid templates (preferably
one or more RNA templates and most preferably one or more messenger
RNA templates) with one or more polypeptides of the invention
having reverse transcriptase activity and incubating the mixture
under conditions sufficient to synthesize one or more first nucleic
acid molecules complementary to all or a portion of the one or more
nucleic acid templates, wherein said at least one of said
synthesized molecules are optionally labeled and/or comprise one or
more labeled nucleotides and/or wherein said synthesized molecules
may optionally be modified to contain one or more labels. In a
preferred embodiment, the one or more first nucleic acid molecules
are single-stranded cDNA molecules. Nucleic acid templates suitable
for reverse transcription according to this aspect of the invention
include any nucleic acid molecule or population of nucleic acid
molecules (preferably RNA and most preferably mRNA), particularly
those derived from a cell or tissue. In a preferred aspect, a
population of mRNA molecules (a number of different mRNA molecules,
typically obtained from cells or tissue) are used to make a labeled
cDNA library, in accordance with the invention. Preferred sources
of nucleic acid templates include viruses, virally infected cells,
bacterial cells, fungal cells, plant cells and animal cells.
[0061] The invention also concerns methods for making one or more
double-stranded nucleic acid molecules (which may optionally be
labeled). Such methods comprise (a) mixing one or more nucleic acid
templates (preferably RNA or mRNA, and more preferably a population
of mRNA templates) with one or more polypeptides of the invention
having reverse transcriptase activity; (b) incubating the mixture
under conditions sufficient to make one or more first nucleic acid
molecules complementary to all or a portion of the one or more
templates; and (c) incubating the one or more first nucleic acid
molecules under conditions sufficient to make one or more second
nucleic acid molecules complementary to all or a portion of the one
or more first nucleic acid molecules, thereby forming one or more
double-stranded nucleic acid molecules comprising the first and
second nucleic acid molecules. In accordance with the invention,
the first and/or second nucleic acid molecules may be labeled
(e.g., may comprise one or more of the same or different labeled
nucleotides and/or may be modified to contain one or more of the
same or different labels). Thus, labeled nucleotides may be used at
one or both synthesis steps. Such methods may include the use of
one or more DNA polymerases as part of the process of making the
one or more double-stranded nucleic acid molecules. The invention
also concerns compositions useful for making such double-stranded
nucleic acid molecules. Such compositions comprise one or more
reverse transcriptases of the invention and optionally one or more
DNA polymerases, a suitable buffer and/or one or more nucleotides
(preferably including labeled nucleotides).
[0062] The invention is also directed to nucleic acid molecules
and/or labeled nucleic acid molecules (particularly single- or
double-stranded cDNA molecules) produced according to the
above-described methods and to kits comprising these nucleic acid
molecules. Such molecules or kits may be used to detect nucleic
acid molecules (for example by hybridization) or for diagnostic
purposes.
[0063] The invention is also directed to kits for use in the
methods of the invention. Such kits can be used for making nucleic
acid molecules and/or labeled nucleic acid molecules (single- or
double-stranded). Kits of the invention may comprise a carrier,
such as a box or carton, having in close confinement therein one or
more containers, such as vials, tubes, bottles and the like. In
kits of the invention, a first container may contain one or more of
the reverse transcriptase enzymes of the invention or one or more
of the compositions of the invention. Kits of the invention may
also comprise, in the same or different containers, at least one
component selected from one or more DNA polymerases (preferably
thermostable DNA polymerases), a suitable buffer for nucleic acid
synthesis and one or more nucleotides. Alternatively, the
components of the kit may be divided into separate containers. In
one aspect, kits of the invention comprise reverse transcriptases
which have RNase H activity or are reduced or substantially reduced
in RNase H activity (or lacking or having undetectable RNase H
activity). Such RTs preferably are selected from the group
consisting of M-MLV reverse transcriptase, RSV reverse
transcriptase, AMV reverse transcriptase, RAV reverse
transcriptase, MAV reverse transcriptase and HIV reverse
transcriptase. In additional preferred kits of the invention, the
enzymes (e.g. reverse transcriptases and/or DNA polymerases) in the
containers are present at working concentrations.
[0064] In specific embodiments, reverse transcriptases of the
invention may not include M-MLV reverse transcriptases, HIV reverse
transcriptases, AMV reverse transcriptases, and/or RSV reverse
transcriptases. Thus, for example, in certain embodiments, the
invention is directed to reverse transcriptases with increased
thermostability that are not a HIV reverse transcriptase. In other
embodiments, the invention is directed to reverse transcriptases
with increased thermostability that are not a M-MLV reverse
transcriptase. In yet other embodiments, the invention is directed
to reverse transcriptases with increased thermostability that are
not an AMV reverse transcriptase. In still other embodiments, the
invention is directed to reverse transcriptases with increased
thermostability that are not a RSV reverse transcriptase.
[0065] The present invention is also directed to nucleic acid
molecules (e.g., vectors) containing a gene or nucleic acid
molecules encoding the mutant or modified reverse transcriptases of
the present invention (or fragments thereof including fragments
having polymerase activity) and to host cells containing such DNA
or other nucleic acid molecules. Any number of hosts may be used to
express the gene or nucleic acid molecule of interest, including
prokaryotic and eukaryotic cells. In specific embodiments,
prokaryotic cells are used to express the reverse transcriptases of
the invention. One example of a prokaryotic host suitable for use
with the present invention is Escherichia coli. Examples of
eukaryotic hosts suitable for use with the present invention
include fungal cells (e.g., Saccharomyces cerevisiae cells, Pichia
pastoris cells, etc.), plant cells, and animal cells (e.g.,
Drosophila melanogaster cells, Spodoptera frugiperda Sf9 and Sf21
cells, Trichoplusa High-Five cells, C. elegans cells, Xenopus
laevis cells, CHO cells, COS cells, VERO cells, BHK cells, etc.).
Preferably, polypeptides of the invention may be purified and/or
isolated from a cell or organism expressing them, which may be a
wild type cell or organism or a recombinant cell or organism. In
some embodiments, such polypeptides may be substantially isolated
from the cell or organism in which they are expressed.
[0066] The invention also relates to a method of producing reverse
transcriptases of the invention, said method comprising:
[0067] (a) culturing a host cell comprising a gene or other nucleic
acid molecule encoding a reverse transcriptase of the invention
(preferably such reverse transcriptase gene or other nucleic acid
molecule is contained by a vector within the host cell);
[0068] (b) expressing the gene or nucleic acid molecule; and
[0069] (c) isolating or purifying said reverse transcriptase.
[0070] The invention is also directed to methods for making one or
more (e.g., one, two, three, four, five, ten, twelve, fifteen,
etc.) nucleic acid molecules, comprising mixing one or more (e.g.,
one, two, three, four, five, ten, twelve, fifteen, etc.) nucleic
acid templates (preferably one or more RNA templates and most
preferably one or more messenger RNA templates or a population of
messenger RNA templates) with one or more (e.g., one, two, three,
four, five, ten, fifteen, etc.) reverse transcriptases of the
invention and incubating the mixture under conditions sufficient to
make a first nucleic acid molecule or molecules complementary to
all or a portion of the one or more nucleic acid templates. In some
embodiments, the mixture is incubated at an elevated temperature,
i.e., greater than 37.degree. C. In specific embodiments, the
elevated temperature may be from about 40.degree. C. or greater,
from about 45.degree. C. or greater, from about 50.degree. C. or
greater, from about 51.degree. C. or greater, from about 52.degree.
C. or greater, from about 53.degree. C. or greater, from about
54.degree. C. or greater, from about 55.degree. C. or greater, from
about 56.degree. C. or greater, from about 57.degree. C. or
greater, from about 58.degree. C. or greater, from about 59.degree.
C. or greater, from about 60.degree. C. or greater, from about
61.degree. C. or greater, from about 62.degree. C. or greater, from
about 63.degree. C. or greater, from about 64.degree. C. or
greater, from about 65.degree. C. or greater, from about 66.degree.
C. or greater, from about 67.degree. C. or greater, from about
68.degree. C. or greater, from about 69.degree. C. or greater, from
about 70.degree. C. or greater, from about 71.degree. C. or
greater, from about 72.degree. C. or greater, from about 73.degree.
C. or greater, from about 74.degree. C. or greater, from about
75.degree. C. or greater, from about 76.degree. C. or greater, from
about 77.degree. C. or greater, or from about 78.degree. C. or
greater. An elevated temperature may be within a temperature range
of from about 40.degree. C. to about 45.degree. C., from about
40.degree. C. to about 48.degree. C., from about 40.degree. C. to
about 50.degree. C., from about 40.degree. C. to about 52.degree.
C., from about 40.degree. C. to about 55.degree. C., from about
40.degree. C. to about 58.degree. C., from about 40.degree. C. to
about 60.degree. C., from about 40.degree. C. to about 65.degree.
C., from about 42.degree. C. to about 45.degree. C., from about
42.degree. C. to about 48.degree. C., from about 42.degree. C. to
about 50.degree. C., from about 42.degree. C. to about 52.degree.
C., from about 42.degree. C. to about 55.degree. C., from about
42.degree. C. to about 58.degree. C., from about 42.degree. C. to
about 60.degree. C., from about 42.degree. C. to about 65.degree.
C., from about 45.degree. C. to about 48.degree. C., from about
45.degree. C. to about 50.degree. C., from about 45.degree. C. to
about 52.degree. C., from about 45.degree. C. to about 55.degree.
C., from about 45.degree. C. to about 58.degree. C., from about
45.degree. C. to about 60.degree. C., from about 45.degree. C. to
about 65.degree. C., from about 48.degree. C. to about 50.degree.
C., from about 48.degree. C. to about 52.degree. C., from about
48.degree. C. to about 55.degree. C., from about 48.degree. C. to
about 58.degree. C., from about 48.degree. C. to about 60.degree.
C., from about 48.degree. C. to about 65.degree. C., from about
50.degree. C. to about 52.degree. C., from about 50.degree. C. to
about 55.degree. C., from about 50.degree. C. to about 58.degree.
C., from about 50.degree. C. to about 60.degree. C., from about
50.degree. C. to about 65.degree. C., from about 52.degree. C. to
about 55.degree. C., from about 52.degree. C. to about 58.degree.
C., from about 52.degree. C. to about 60.degree. C., from about
52.degree. C. to about 65.degree. C., from about 55.degree. C. to
about 58.degree. C., from about 55.degree. C. to about 60.degree.
C., from about 55.degree. C. to about 65.degree. C., from about
55.degree. C. to about 70.degree. C., from about 58.degree. C. to
about 60.degree. C., from about 58.degree. C. to about 65.degree.
C., from about 58.degree. C. to about 70.degree. C. An elevated
temperature may be within a temperature range from about 37.degree.
C. to about 75.degree. C., from about 40.degree. C. to about
75.degree. C., from about 45.degree. C. to about 75.degree. C.,
from about 50.degree. C. to about 75.degree. C., from about
51.degree. C. to about 75.degree. C., from about 52.degree. C. to
about 75.degree. C., from about 53.degree. C. to about 75.degree.
C., from about 54.degree. C. to about 75.degree. C., from about
55.degree. C. to about 75.degree. C. In other embodiments, the
elevated temperature may be within the range of about 50.degree. C.
to about 70.degree. C., from about 51.degree. C. to about
70.degree. C., from about 52.degree. C. to about 70.degree. C.,
from about 53.degree. C. to about 70.degree. C., from about
54.degree. C. to about 70.degree. C., from about 55.degree. C. to
about 70.degree. C., from about 56.degree. C. to about 65.degree.
C., from about 56.degree. C. to about 64.degree. C. or about
56.degree. C. to about 62.degree. C. In other embodiments, the
elevated temperature may be within the range of about 46.degree. C.
to about 60.degree. C., from about 47.degree. C. to about
60.degree. C., from about 49.degree. C. to about 60.degree. C.,
from about 51.degree. C. to about 60.degree. C., from about
53.degree. C. to about 60.degree. C., or from about 54.degree. C.
to about 60.degree. C. In additional specific embodiments, the
first nucleic acid molecule is a single-stranded cDNA. The
invention further includes nucleic acid molecules prepared by the
above methods and reaction mixtures used in and formed by such
methods. Such conditions for incubation may include the use of one
or more buffers or buffering salts, one or more primers (such as
oligo dT primers) and/or one or more nucleotides (e.g.; one or more
nucleoside triphosphates). The invention also concerns compositions
for making one or more nucleic acid molecules comprising one or
more components selected from the group consisting of one or more
reverse transcriptases of the invention, one or more primers, one
or more nucleotides and one or more suitable buffers.
[0071] Nucleic acid templates suitable for reverse transcription
according to this aspect of the invention include any nucleic acid
molecule or population of nucleic acid molecules (preferably RNA
and most preferably mRNA), particularly those derived from a cell
or tissue. In a specific aspect, a population of mRNA molecules (a
number of different mRNA molecules, typically obtained from a
particular cell or tissue type) is used to make a cDNA library, in
accordance with the invention. Examples of cellular sources of
nucleic acid templates include bacterial cells, fungal cells, plant
cells and animal cells.
[0072] The invention also concerns methods for making one or more
(e.g., one, two, three, four, five, ten, twelve, fifteen, etc.)
double-stranded nucleic acid molecules. Such methods comprise (a)
mixing one or more nucleic acid templates (preferably RNA or mRNA,
and more preferably a population of mRNA templates) with one or
more (e.g., one, two, three, four, five, ten, fifteen, etc.)
reverse transcriptases of the invention; (b) incubating the mixture
under conditions sufficient to make a first nucleic acid molecule
or molecules complementary to all or a portion of the one or more
templates; and (c) incubating the first nucleic acid molecule or
molecules under conditions sufficient to make a second nucleic acid
molecule or molecules complementary to all or a portion of the
first nucleic acid molecule or molecules, thereby forming one or
more double-stranded nucleic acid molecules comprising the first
and second nucleic acid molecules. In some embodiments, the
incubation of step (b) is performed at an elevated temperature. In
some embodiments, conditions may comprise the use of one or more
labeled nucleotides and the double stranded nucleic acid molecules
may be labeled. In specific embodiments, the elevated temperature
may be from about 40.degree. C. or greater, from about 45.degree.
C. or greater, from about 50.degree. C. or greater, from about
51.degree. C. or greater, from about 52.degree. C. or greater, from
about 53.degree. C. or greater, from about 54.degree. C. or
greater, from about 55.degree. C. or greater, from about 56.degree.
C. or greater, from about 57.degree. C. or greater, from about
58.degree. C. or greater, from about 59.degree. C. or greater, from
about 60.degree. C. or greater, from about 61.degree. C. or
greater, from about 62.degree. C. or greater, from about 63.degree.
C. or greater, from about 64.degree. C. or greater, from about
65.degree. C. or greater, from about 66.degree. C. or greater, from
about 67.degree. C. or greater, from about 68.degree. C. or
greater, from about 69.degree. C. or greater, from about 70.degree.
C. or greater, from about 71.degree. C. or greater, from about
72.degree. C. or greater, from about 73.degree. C. or greater, from
about 74.degree. C. or greater, from about 75.degree. C. or
greater, from about 76.degree. C. or greater, from about 77.degree.
C. or greater, or from about 78.degree. C. or greater. An elevated
temperature may be within a temperature range of from about
40.degree. C. to about 45.degree. C., from about 40.degree. C. to
about 48.degree. C., from about 40.degree. C. to about 50.degree.
C., from about 40.degree. C. to about 52.degree. C., from about
40.degree. C. to about 55.degree. C., from about 40.degree. C. to
about 58.degree. C., from about 40.degree. C. to about 60.degree.
C., from about 40.degree. C. to about 65.degree. C., from about
42.degree. C. to about 45.degree. C., from about 42.degree. C. to
about 48.degree. C., from about 42.degree. C. to about 50.degree.
C., from about 42.degree. C. to about 52.degree. C., from about
42.degree. C. to about 55.degree. C., from about 42.degree. C. to
about 58.degree. C., from about 42.degree. C. to about 60.degree.
C., from about 42.degree. C. to about 65.degree. C., from about
45.degree. C. to about 48.degree. C., from about 45.degree. C. to
about 50.degree. C., from about 45.degree. C. to about 52.degree.
C., from about 45.degree. C. to about 55.degree. C., from about
45.degree. C. to about 58.degree. C., from about 45.degree. C. to
about 60.degree. C., from about 45.degree. C. to about 65.degree.
C., from about 48.degree. C. to about 50.degree. C., from about
48.degree. C. to about 52.degree. C., from about 48.degree. C. to
about 55.degree. C., from about 48.degree. C. to about 58.degree.
C., from about 48.degree. C. to about 60.degree. C., from about
48.degree. C. to about 65.degree. C., from about 50.degree. C. to
about 52.degree. C., from about 50.degree. C. to about 55.degree.
C., from about 50.degree. C. to about 58.degree. C., from about
50.degree. C. to about 60.degree. C., from about 50.degree. C. to
about 65.degree. C., from about 52.degree. C. to about 55.degree.
C., from about 52.degree. C. to about 58.degree. C., from about
52.degree. C. to about 60.degree. C., from about 52.degree. C. to
about 65.degree. C., from about 55.degree. C. to about 58.degree.
C., from about 55.degree. C. to about 60.degree. C., from about
55.degree. C. to about 65.degree. C., from about 55.degree. C. to
about 70.degree. C., from about 58.degree. C. to about 60.degree.
C., from about 58.degree. C. to about 65.degree. C., from about
58.degree. C. to about 70.degree. C. An elevated temperature may be
within a temperature range from about 37.degree. C. to about
75.degree. C., from about 40.degree. C. to about 75.degree. C.,
from about 45.degree. C. to about 75.degree. C., from about
50.degree. C. to about 75.degree. C., from about 51.degree. C. to
about 75.degree. C., from about 52.degree. C. to about 75.degree.
C., from about 53.degree. C. to about 75.degree. C., from about
54.degree. C. to about 75.degree. C., from about 55.degree. C. to
about 75.degree. C. In other embodiments, the elevated temperature
may be within the range of about 50.degree. C. to about 70.degree.
C., from about 51.degree. C. to about 70.degree. C., from about
52.degree. C. to about 70.degree. C., from about 53.degree. C. to
about 70.degree. C., from about 54.degree. C. to about 70.degree.
C., from about 55.degree. C. to about 70.degree. C., from about
56.degree. C. to about 65.degree. C., from about 56.degree. C. to
about 64.degree. C. or about 56.degree. C. to about 62.degree. C.
In other embodiments, the elevated temperature may be within the
range of about 46.degree. C. to about 60.degree. C., from about
47.degree. C. to about 60.degree. C., from about 49.degree. C. to
about 60.degree. C., from about 51.degree. C. to about 60.degree.
C., from about 53.degree. C. to about 60.degree. C., or from about
54.degree. C. to about 60.degree. C. Such conditions may involve
the use of one or more suitable buffers or buffer salts, on or more
primers (such as oligo dT primers), and one or more nucleotides.
Such methods may include the use of one or more (e.g., one, two,
three, four, five, ten, twelve, fifteen, etc.) DNA polymerases as
part of the process of making the one or more double-stranded
nucleic acid molecules. Such DNA polymerases are preferably
thermostable DNA polymerases and most preferably the nucleic acid
synthesis accomplished with such DNA polymerases is conducted at
elevated temperatures, i.e., greater than 37.degree. C. The
invention also concerns compositions useful for making such
double-stranded nucleic acid molecules. Such compositions comprise
one or more (e.g., one, two, three, four, five, ten, twelve,
fifteen, twenty, etc.) reverse transcriptases of the invention and
optionally one or more DNA polymerases, a suitable buffer, one or
more (e.g., one, two, three, four, five, ten, twelve, fifteen,
etc.) primers, and/or one or more (e.g., one, two, three, four,
five, etc.) nucleotides. The invention further includes nucleic
acid molecules prepared by the above methods and reaction mixtures
used in and formed by such methods.
[0073] The invention also relates to methods for amplifying a
nucleic acid molecule. Such amplification methods comprise mixing
the double-stranded nucleic acid molecule or molecules produced as
described above with one or more (e.g., one, two, three, four,
five, ten, twelve, fifteen, etc.) DNA polymerases (preferably
thermostable DNA polymerases) and incubating the mixture under
conditions sufficient to amplify the double-stranded nucleic acid
molecule. In a first embodiment, the invention concerns a method
for amplifying a nucleic acid molecule, the method comprising (a)
mixing one or more (e.g., one, two, three, four, five, ten, twelve,
fifteen, twenty, etc.) nucleic acid templates (preferably one or
more RNA or mRNA templates and more preferably a population of mRNA
templates) with one or more reverse transcriptases of the invention
and with one or more DNA polymerases and (b) incubating the mixture
under conditions sufficient to amplify nucleic acid molecules
complementary to all or a portion of the one or more templates. In
some embodiments, the incubation of step (b) is performed at an
elevated temperature. In specific embodiments, the elevated
temperature may be from about 40.degree. C. or greater, from about
45.degree. C. or greater, from about 50.degree. C. or greater, from
about 51.degree. C. or greater, from about 52.degree. C. or
greater, from about 53.degree. C. or greater, from about 54.degree.
C. or greater, from about 55.degree. C. or greater, from about
56.degree. C. or greater, from about 57.degree. C. or greater, from
about 58.degree. C. or greater, from about 59.degree. C. or
greater, from about 60.degree. C. or greater, from about 61.degree.
C. or greater, from about 62.degree. C. or greater, from about
63.degree. C. or greater, from about 64.degree. C. or greater, from
about 65.degree. C. or greater, from about 66.degree. C. or
greater, from about 67.degree. C. or greater, from about 68.degree.
C. or greater, from about 69.degree. C. or greater, from about
70.degree. C. or greater, from about 71.degree. C. or greater, from
about 72.degree. C. or greater, from about 73.degree. C. or
greater, from about 74.degree. C. or greater, from about 75.degree.
C. or greater, from about 76.degree. C. or greater, from about
77.degree. C. or greater, or from about 78.degree. C. or greater.
An elevated temperature may be within a temperature range of from
about 40.degree. C. to about 45.degree. C., from about 40.degree.
C. to about 48.degree. C., from about 40.degree. C. to about
50.degree. C., from about 40.degree. C. to about 52.degree. C.,
from about 40.degree. C. to about 55.degree. C., from about
40.degree. C. to about 58.degree. C., from about 40.degree. C. to
about 60.degree. C., from about 40.degree. C. to about 65.degree.
C., from about 42.degree. C. to about 45.degree. C., from about
42.degree. C. to about 48.degree. C., from about 42.degree. C. to
about 50.degree. C., from about 42.degree. C. to about 52.degree.
C., from about 42.degree. C. to about 55.degree. C., from about
42.degree. C. to about 58.degree. C., from about 42.degree. C. to
about 60.degree. C., from about 42.degree. C. to about 65.degree.
C., from about 45.degree. C. to about 48.degree. C., from about
45.degree. C. to about 50.degree. C., from about 45.degree. C. to
about 52.degree. C., from about 45.degree. C. to about 55.degree.
C., from about 45.degree. C. to about 58.degree. C., from about
45.degree. C. to about 60.degree. C., from about 45.degree. C. to
about 65.degree. C., from about 48.degree. C. to about 50.degree.
C., from about 48.degree. C. to about 52.degree. C., from about
48.degree. C. to about 55.degree. C., from about 48.degree. C. to
about 58.degree. C., from about 48.degree. C. to about 60.degree.
C., from about 48.degree. C. to about 65.degree. C., from about
50.degree. C. to about 52.degree. C., from about 50.degree. C. to
about 55.degree. C., from about 50.degree. C. to about 58.degree.
C., from about 50.degree. C. to about 60.degree. C., from about
50.degree. C. to about 65.degree. C., from about 52.degree. C. to
about 55.degree. C., from about 52.degree. C. to about 58.degree.
C., from about 52.degree. C. to about 60.degree. C., from about
52.degree. C. to about 65.degree. C., from about 55.degree. C. to
about 58.degree. C., from about 55.degree. C. to about 60.degree.
C., from about 55.degree. C. to about 65.degree. C., from about
55.degree. C. to about 70.degree. C., from about 58.degree. C. to
about 60.degree. C., from about 58.degree. C. to about 65.degree.
C., from about 58.degree. C. to about 70.degree. C. An elevated
temperature may be within a temperature range from about 37.degree.
C. to about 75.degree. C., from about 40.degree. C. to about
75.degree. C., from about 45.degree. C. to about 75.degree. C.,
from about 50.degree. C. to about 75.degree. C., from about
51.degree. C. to about 75.degree. C., from about 52.degree. C. to
about 75.degree. C., from about 53.degree. C. to about 75.degree.
C., from about 54.degree. C. to about 75.degree. C., from about
55.degree. C. to about 75.degree. C. In other embodiments, the
elevated temperature may be within the range of about 50.degree. C.
to about 70.degree. C., from about 51.degree. C. to about
70.degree. C., from about 52.degree. C. to about 70.degree. C.,
from about 53.degree. C. to about 70.degree. C., from about
54.degree. C. to about 70.degree. C., from about 55.degree. C. to
about 70.degree. C., from about 56.degree. C. to about 65.degree.
C., from about 56.degree. C. to about 64.degree. C. or about
56.degree. C. to about 62.degree. C. In other embodiments, the
elevated temperature may be within the range of about 46.degree. C.
to about 60.degree. C., from about 47.degree. C. to about
60.degree. C., from about 49.degree. C. to about 60.degree. C.,
from about 51.degree. C. to about 60.degree. C., from about
53.degree. C. to about 60.degree. C., or from about 54.degree. C.
to about 60.degree. C.
[0074] Preferably, reverse transcriptases of the invention, used in
methods of the invention, and/or present in compositions of the
invention (1) are reduced or substantially reduced in RNase H
activity, (2) are reduced or substantially reduced in TdT activity,
and/or (3) exhibit increased fidelity. Preferably, DNA polymerases
used with the invention may comprise a first DNA polymerase having
3' exonuclease activity and a second DNA polymerase having
substantially reduced 3' exonuclease activity. The invention
further includes nucleic acid molecules prepared by the above
methods and reaction mixtures used in and formed by such
methods.
[0075] The invention also concerns compositions comprising one or
more reverse transcriptases of the invention and one or more DNA
polymerases for use in amplification reactions. Such compositions
may further comprise one or more nucleotides and/or a buffer
suitable for amplification. Compositions of the invention may also
comprise one or more oligonucleotide primers. Compositions of the
invention may further include nucleic acid molecules prepared by
the above methods and reaction mixtures used in and formed by such
methods.
[0076] The invention is also directed to nucleic acid molecules
(particularly single- or double-stranded cDNA molecules) or
amplified nucleic acid molecules produced according to the
above-described methods and to vectors (particularly expression
vectors) comprising these nucleic acid molecules or amplified
nucleic acid molecules.
[0077] The invention is further directed to recombinant host cells
comprising the above-described nucleic acid molecules, amplified
nucleic acid molecules or vectors. Examples of such host cells
include bacterial cells, yeast cells, plant cells and animal cells
(including insect cells and mammalian cells).
[0078] The invention is additionally directed to methods of
producing polypeptides encoded by the nucleic acid molecules
produced by the methods of the invention. Such methods include
those comprising culturing the above-described recombinant host
cells and isolating the encoded polypeptides. The invention further
includes polypeptides produced by such methods.
[0079] The invention also concerns methods for sequencing one or
more (e.g., one, two, three, four, five, ten, twelve, fifteen,
etc.) nucleic acid molecules using compositions or enzymes of the
invention. Such methods comprise (a) mixing one or more nucleic
acid molecules (e.g., one or more RNA or DNA molecules) to be
sequenced with one or more reverse transcriptases of the invention,
and, optionally, one or more nucleotides, one or more terminating
agents, such as one or more dideoxynucleoside triphosphates, and
one or more primers; (b) incubating the mixture under conditions
sufficient to synthesize a population of nucleic acid molecules
complementary to all or a portion of the one or more (e.g., one,
two, three, four, five, ten, twelve, fifteen, twenty, thirty,
fifty, one hundred, two hundred, etc.) nucleic acid molecules to be
sequenced; and (c) separating the population of nucleic acid
molecules to determine the nucleotide sequence of all or a portion
of the one or more nucleic acid molecules to be sequenced. Such
methods may also comprise (a) mixing a nucleic acid molecule (e.g.,
one or more RNA or DNA molecules) to be sequenced with one or more
primers, one or more reverse transcriptases of the invention, one
or more nucleotides and one or more terminating agents, such as one
or more dideoxynucleoside triphosphates; (b) incubating the mixture
under conditions sufficient to synthesize a population of nucleic
acid molecules complementary to all or a portion of the nucleic
acid molecule to be sequenced; and (c) separating members of the
population of nucleic acid molecules to determine the nucleotide
sequence of all or a portion of the nucleic acid molecule to be
sequenced. In some embodiments, such incubation may be performed at
elevated temperatures as described herein. The invention further
includes sequence data generated by the above methods, as well as
methods for generating such sequence data, and reaction mixtures
used in and formed by such methods.
[0080] The invention is also directed to kits for use in methods of
the invention. Such kits can be used for making, sequencing or
amplifying nucleic acid molecules (single- or double-stranded),
preferably at the elevated temperatures described herein. Kits of
the invention may comprise a carrier, such as a box or carton,
having in close confinement therein one or more (e.g., one, two,
three, four, five, ten, twelve, fifteen, etc.) containers, such as
vials, tubes, bottles and the like. In kits of the invention, a
first container contains one or more of the reverse transcriptase
enzymes of the present invention. Kits of the invention may also
comprise, in the same or different containers, one or more DNA
polymerases (preferably thermostable DNA polymerases), one or more
(e.g., one, two, three, four, five, ten, twelve, fifteen, etc.)
suitable buffers for nucleic acid synthesis, one or more
nucleotides and one or more (e.g., one, two, three, four, five,
ten, twelve, fifteen, etc.) oligonucleotide primers. Alternatively,
the components of the kit may be divided into separate containers
(e.g., one container for each enzyme and/or component). Kits of the
invention also may comprise instructions or protocols for carrying
out the methods of the invention. In preferred kits of the
invention, the reverse transcriptases are reduced or substantially
reduced in RNase H activity (or lacking or having undetectable
RNase H activity), and are most preferably selected from the group
consisting of M-MLV RNase H- reverse transcriptase, RSV RNase H-
reverse transcriptase, AMV RNase H- reverse transcriptase, RAV
RNase H- reverse transcriptase, MAV RNase H- reverse transcriptase
and HIV RNase H- reverse transcriptase. In other preferred kits of
the invention, the reverse transcriptases are reduced or
substantially reduced in TdT activity, and/or exhibit increased
fidelity, as described elsewhere herein.
[0081] In additional preferred kits of the invention, the enzymes
(reverse transcriptases and/or DNA polymerases) in the containers
are present at working concentrations.
[0082] Thus, the invention is further directed to kits for use in
reverse transcription, amplification or sequencing of a nucleic
acid molecule, the kit comprising one or more reverse
transcriptases of the invention.
[0083] As indicated above, kits of the invention may contain any
number of various components for practicing methods of the
invention. One example of such a component is instructions for
performing methods of the invention. Example of such instructions
include those which direct individuals using the kits to perform
methods for amplifying nucleic acid molecules using one or more
reverse transcriptases of the invention.
[0084] As one skilled in the art would recognize, the full text of
these instructions need not be included with the kit. One example
of a situation in which kits of the invention would not contain
such full length instructions is where directions are provided
which inform individuals using the kits where to obtain
instructions for using the kit. Thus, instructions for performing
methods of the invention may be obtain from internet web pages,
separately sold or distributed manuals or other product literature,
etc. The invention thus includes kits which direct kit users to
locations where they can find instructions which are not directly
packaged and/or distributed with the kits. These instructions may
be in any form including, but not limited to, electronic or printed
forms.
[0085] The invention thus also provides, in part, kits for
performing methods using the reverse transcriptases of the
invention. In specific embodiments, kits of the invention contain
instructions for performing methods for amplifying and/or
sequencing nucleic acid molecules. These methods will often involve
reacting RNA molecules with one or more reverse transcriptases of
the invention.
[0086] In specific embodiments, reverse transcriptases of kits of
the invention may comprise one or more modifications or mutations
at positions corresponding to amino acids selected from the group
consisting of:
[0087] (a) leucine 52 of M-MLV reverse transcriptase;
[0088] (b) tyrosine 64 of M-MLV reverse transcriptase;
[0089] (c) lysine 152 of M-MLV reverse transcriptase;
[0090] (d) arginine 204 of M-MLV reverse transcriptase;
[0091] (e) methionine 289 of M-MLV reverse transcriptase;
[0092] (f) threonine 306 of M-MLV reverse transcriptase; and
[0093] (g) phenylalanine 309 of M-MLV reverse transcriptase.
[0094] Reverse transcriptases of the invention include any reverse
transcriptase having one or a combination of the properties
described herein. Such properties include, but are not limited to,
enhanced thermostability, reduced or eliminated RNase H activity,
reduced terminal deoxynucleotidyl transferase activity, and/or
increased fidelity. Such reverse transcriptases include retroviral
reverse transcriptases, bacterial reverse transcriptases,
retrotransposon reverse transcriptases (e.g., reverse
transcriptases of the Ty1 and/or Ty3 retrotransposons), and DNA
polymerases having reverse transcriptase activity. Preferred
reverse transcriptases of the invention include a single and
multi-subunit reverse transcriptase and preferably retroviral
reverse transcriptases. In particular, the invention relates to
M-MLV-reverse transcriptases and ASLV-reverse transcriptases (such
as AMV-RT and RSV-RT). Such reverse transcriptases of the invention
preferably have reduced, substantially reduced, or no detectable
RNase H activity.
[0095] Other embodiments of the present invention will be apparent
to one of ordinary skill in light of the following drawings and
description of the invention, and of the claims.
BRIEF DESCRIPTION OF THE DRAWINGS/FIGURES
[0096] FIG. 1 is a map of plasmid pBAD-6-His-M-MLV H- (F1).
[0097] FIG. 2A is a linear representation of the coding sequence of
the M-MLV reverse transcriptase showing the locations of the
restriction enzyme cleavage sites used to generate the segments of
the gene used to generate mutations. FIG. 2B is a schematic
representation showing the insertion of a mutagenized PCR fragment
into the coding sequence of the remaining portion of the reverse
transcriptase gene.
[0098] FIG. 3 represents a scanned phosphoimage of an extension
assay using (1) SUPERSCRIPT.TM. II reverse transcriptase, and (2)
F309N. The [.sup.32P]-labeled 18-mer primer annealed to a 47-mer
DNA template (5 nM) was extended by equal units of reverse
transcriptase at 37.degree. C. for 30 minutes as seen in the
extension reactions with all 4 nucleotides. The extension reactions
were analyzed by denaturing 6% gel electrophoresis. P, non-extended
primer.
[0099] FIG. 4 represents a scanned phosphoimage showing a TdT
extension assay of SUPERSCRIPT.TM. II reverse transcriptase and the
mutants F309N, T197E, and Y133A. The [.sup.32P]-labeled 18-mer
primer annealed to a 47-mer DNA template (5 nM) was extended with
decreasing units of reverse transcriptase (lane (1) 646 units, lane
(2) 200 units, lane (3) 50 units, and lane (4) 20 units) at
37.degree. C. for 30 minutes with all four nucleotides (see the
Methods section below in Example 3). The extension reactions were
analyzed by denaturing 6% gel electrophoresis. In this assay,
extension past the 47 nucleotide templates is considered
non-template directed addition or TdT activity. P, non-extended
primer.
[0100] FIG. 5 represents a scanned phosphoimage showing
misinsertion assays of SUPERSCRIPT.TM. II reverse transcriptase (1)
and mutant protein F309N reverse transcriptase (2) with DNA
template. The [.sup.32P]-labeled 18-mer primer annealed to a 47-mer
DNA template (5 nM) was extended by equal units of reverse
transcriptase protein at 37.degree. C. for 30 min. as seen in the
extension reactions with all four nucleotides. The extension
reactions were also performed in the presence of only 3
complementary dNTPs; minus dCTP, minus dATP, minus TTP, and minus
dGTP. The extension reactions were analyzed by denaturing 6% gel
electrophoresis. In this assay, the higher efficiency of elongation
of terminated primer with only three nucleotides will reflect the
lower fidelity of the SUPERSCRIPT.TM. II reverse transcriptase
assayed. P, non-extended primer.
[0101] FIG. 6 represents a scanned phosphoimage showing a
misinsertion assay of SUPERSCRIPT.TM. II reverse transcriptase (1)
and mutant protein T197A/F309N reverse transcriptase (2) and
V223H/F309N (3) with DNA template. The [.sup.32P]-labeled 18-mer
primer annealed to a 47-mer DNA template (5 nM) was extended by
equal units of reverse transcriptase protein at 37.degree. C. for
30 min. as seen in the extension reactions with all four
nucleotides. The extension reactions were also performed in the
presence of only 3 complementary dNTPs; minus dATP, and minus dCTP.
The extension reactions were analyzed by denaturing 6% gel
electrophoresis. In this assay, the higher efficiency of elongation
of terminated primer with only three nucleotides will reflect the
lower fidelity of the SUPERSCRIPT.TM. II reverse transcriptase
assayed. P, non-extended primer.
[0102] FIGS. 7A-7C show representative results obtained from the
screen for thermal stable RT mutants. Lysates of mutants were
assayed for RT activity in a 96-well plate format. .sup.32P-Labeled
DNA product was trapped on a membrane and the amount of
radioactivity present was quantified with a phosphorimager. FIG. 7A
shows the results of an initial screen of RT mutants in 4, 96-well
plates. Heat pretreatment of lysates was at 58.degree. C. for 10
min. RT mutants that retained the most activity after heat
treatment at 58.degree. C. were selected and lysates were screened
again and the results are shown in 7B. A duplicate screen was
performed with no heat pretreatment (FIG. 7B upper panel) and heat
pretreatment at 58.degree. C. (FIG. 7B lower panel). RT mutants
with the highest resistance to heat inactivation in crude extracts
were purified by nickel-affinity chromatography and screened again
for RT activity and the results are shown in FIG. 7C. The results
after heat treatment at 37.degree. C. are shown in FIG. 7C in the
upper row, after heat treatment at 53.degree. C. in FIG. 7C middle
row, and after heat treatment at 58.degree. C. in 7C bottom
row.
[0103] FIG. 8 shows a comparison of the thermal inactivation
profiles of His.sub.6H- RT and His.sub.6H- H204R T306K R in crude
extracts. Crude extracts were subjected to a heat treatment in a
96-well plate for 5 min. The temperature of the heat treatment
increased from left to right, except that the wells on the far
right were not heat treated.
[0104] FIG. 9 is a ribbon diagram of the crystal structure of amino
acids 193 to 232 of M-MLV RT showing the sites of some of the amino
acids identified by the methods of the present invention. Potential
interactions of arginine substituted for histidine at M-MLV RT
position 204 in .alpha.-helix H with E201 or T128. The catalytic
site amino acids D224 and D225 in the turn between .beta.10 and
.beta.11 are also shown. The three-dimensional structure is taken
from Georgiadis, et al., (1995) Structure 3, 879-892. Thus, the
invention also includes reverse transcriptases having one or more
mutations or modifications in various regions including the
.alpha.-helix H region.
[0105] FIGS. 10A and 10B are graphs of reverse transcriptase
activity as a function of Mg.sup.2+ concentration (FIG. 10A) and
KCl concentration (FIG. 10B). The DNA polymerase assay for
SUPERSCRIPT.TM. III (SuIII) RT was conducted at 37.degree. C. or
50.degree. C. for 10 minutes under various concentrations of A)
Mg.sup.2+ or B) KCl. SUPERSCRIPT.TM. II (SuII) at 37.degree. C.
included for comparison).
[0106] FIGS. 11A and 11B show autoradiograms of TdT activity
measure by extension for 60 minutes at various temperatures of a
labeled DNA primer on DNA (FIG. 11A) or RNA (FIG. 11B) template
forming a blunt end. T is template only, Lanes marked (-) is T-P
plus enzyme without dNTPs. Since SUPERSCRIPT.TM. III is more
thermostable, its TdT activity appears greater at 50 degrees than
SUPERSCRIPT.TM. II.
[0107] FIGS. 12A, 12B and 12C are graphs of RT activity as a
function of incubation time. FIG. 12A shows the data obtained at
50.degree. C., FIG. 12B shows the data obtained at 55.degree. C.,
and FIG. 12C shows the data obtained at 60.degree. C.
[0108] FIG. 13 is an autoradiogram comparing reverse transcriptase
activity of a variety of commercially available reverse
transcriptase enzymes at 45.degree. C., 50.degree. C., and
55.degree. C. SUPERSCRIPT.TM. III is designated SS III and
SUPERSCRIPT.TM. II is designated SS II.
[0109] FIG. 14 is a photograph of ethidium bromide stained gels
showing the results of the evaluation of the pH of the first strand
buffer. RT reactions with first-strand buffers at pHs from 8.0 to
8.8 were performed with 500 ng of total Hela RNA and 200 units of
SUPERSCRIPT.TM. II (SS II) or 400 units of SUPERSCRIPT.TM. III
(LEFN RT, which contains an N-terminal tag
sequence=MASGTGGQQMGRDLYDDDDKH (SEQ ID NO:3) and the following
point mutations H204R, T306K, M289L, and F309N). 2 .mu.l of the
resulting cDNA were then added to 50 .mu.l PCR reactions containing
the BF 2.4 kb or Pol .epsilon. 6.8 kb primer set. Resulting PCR
products were then run on a 0.8% agarose gel containing 0.4 mg/ml
ethidium bromide.
[0110] FIG. 15 is a photograph of ethidium bromide stained gels
showing the results of the evaluation of the effect of temperature
on the reverse transcription reaction with various reverse
transcriptases. SUPERSCRIPT.TM. II (SS II) was compared to the
His-tagged EFN reverse transcriptase (His tag
sequence=MGGSHHHHHHGMASMTGGQQMGRDLYDDDDKH, amino acids 1-32 of SEQ
ID NO:2 and Table 3, EFN mutations are H204R, T306K, and F309N),
His-tagged LEFN reverse transcriptase (same His tag sequence, LEFN
mutations are H204R, T306K, M289L, and F309N), and to
SUPERSCRIPT.TM. III, which is the tagged, no His LEFN reverse
transcriptase (tag sequence=MASGTGGQQMGRDLYDDDDKH (SEQ ID NO:3),
LEFN mutations are H204R, T306K, M289L, and F309N).
[0111] FIG. 16 is a photograph of ethidium bromide stained gels
showing the results of the evaluation of the effect of reverse
transcriptase concentration on the reverse transcription reaction
with SUPERSCRIPT.TM. III designated LEFN which contains the tag
sequence=MASGTGGQQMGRDLYDDDDKH (SEQ ID NO:1), and LEFN mutations,
which are H204R, T306K, M289L, and F309N.
[0112] FIG. 17 is a photograph of ethidium bromide stained gels
showing the results of the comparison of hot start RT-PCR
amplification by SUPERSCRIPT.TM. II (Panel A) or SUPERSCRIPT.TM.
III (Panel B). Lanes (in duplicate) 1, 4, 7, and 10 are products
reverse transcribed at 42.degree. C. Lanes 2, 5, 8, and 11 are
products reverse transcribed at 50.degree. C. Lanes 3, 6, 9, and 12
are products transcribed at 55.degree. C. Lanes 1-3 are the result
of RNAs reverse transcribed by gene-specific priming from FGF,
lanes 4-6 CBS 2.4, lanes 7-9 from TOP 3.2, lanes 10-12 VIN 4.6.
Arrows indicate expected product sizes of 240 bp, 2390 bp, 3162 bp,
and 4641 bp. SUPERSCRIPT.TM. III contains the tag
sequence=MASGTGGQQMGRDLYDDDDKH (SEQ ID NO:3), and the LEFN
mutations, which are H204R, T306K, M289L, and F309N.
[0113] FIG. 18 shows the results of RT-PCR performed with varying
amounts SUPERSCRIPT.TM. III from 25 units to 250 units per reaction
with a variety of primer sets.
[0114] FIG. 19 shows a comparison of SUPERSCRIPT.TM. II (SS II) and
His tagged LEFN RT in RT-PCR using 200 or 400 units in the first
strand reaction. His tagged LEFN has the His tag
sequence=MGGSHHHHHHGMASMTGGQQMGRDLYDDDDKH, amino acids 1-32 of SEQ
ID NO:2 and Table 3, and the LEFN mutations, which are H204R,
T306K, M289L, and F309N).
[0115] FIG. 20 shows the use of SUPERSCRIPT.TM. III (LEFN RT) in
RT-PCR with varying amounts of RT in the first strand reaction.
SUPERSCRIPT.TM. III contains the tag sequence=MASGTGGQQMGRDLYDDDDKH
(SEQ ID NO:3), and the LEFN mutations, which are H204R, T306K,
M289L, and F309N.
[0116] FIG. 21 shows the results of a comparison of various primers
in RT-PCR reactions using the polypeptides of the invention. EFN
contains the tag sequence=MASGTGGQQMGRDLYDDDDKH (SEQ ID NO:3), and
the EFN mutations, which are H204R, T306K, and F309N.
DETAILED DESCRIPTION OF THE INVENTION
[0117] In the description that follows, a number of terms used in
recombinant DNA, virology and immunology are utilized. In order to
provide a clearer and consistent understanding of the specification
and claims, including the scope to be given such terms, the
following definitions are provided.
[0118] Cloning vector. As used herein "cloning vector" means a
nucleic acid molecule such as plasmid, cosmid, phage, phagemid or
other nucleic acid molecule which is able to replicate autonomously
in a host cell, and which is characterized by one or a small number
of recognition sequences, (e.g., restriction endonuclease
recognition sites, recombination sites, topoisomerase recognition
sites, etc.) at which such nucleic acid sequences may be
manipulated in a determinable fashion, and into which a nucleic
acid segment of interest may be inserted in order to bring about
its replication and cloning. The cloning vector may further contain
a marker suitable for use in the identification of cells
transformed with the cloning vector. Markers, for example, are
genes that confer a recognizable phenotype on host cells in which
such markers are expressed. Commonly used markers include, but are
not limited to, antibiotic resistance genes such as tetracycline
resistance or ampicillin resistance.
[0119] Expression vector. As used herein "expression vector" means
a nucleic acid molecule similar to a cloning vector but which may
additionally comprise nucleic acid sequences capable of enhancing
and/or controlling the expression of a gene or other nucleic acid
molecule which has been cloned into it, after transformation into a
host. The additional nucleic acid sequences may comprise promoter
sequences, repressor binding sequences and the like. The cloned
gene or nucleic acid molecule is usually operably linked to one or
more (e.g., one, two, three, four, etc.) of such control sequences
such as promoter sequences.
[0120] Recombinant host. As used herein "recombinant" means any
prokaryotic or eukaryotic or microorganism which contains the
desired cloned genes or nucleic acid molecules, for example, in an
expression vector, cloning vector or any nucleic acid molecule. The
term "recombinant host" is also meant to include those host cells
which have been genetically engineered to contain the desired gene
or other nucleic acid molecule on the host chromosome or
genome.
[0121] Host. As used herein "host" means any prokaryotic or
eukaryotic cell or organism that is the recipient of a replicable
expression vector, cloning vector or any nucleic acid molecule. The
nucleic acid molecule may contain, but is not limited to, a
structural gene, a promoter and/or an origin of replication.
[0122] Promoter. As used herein "promoter" means a nucleic acid
sequence generally described as the 5' region of a gene, located
proximal to the start codon which is capable of directing the
transcription of a gene or other nucleic acid molecule. At the
promoter region, transcription of an adjacent gene(s) or nucleic
acid(s) is initiated.
[0123] Gene. As used herein "gene" means a nucleic acid sequence
that contains information necessary for expression of a polypeptide
or protein. It includes the promoter and the structural gene as
well as other sequences involved in expression of the protein.
[0124] Structural gene. As used herein "structural gene" means a
DNA or other nucleic acid sequence that is transcribed into
messenger RNA that is then translated into a sequence of amino
acids characteristic of a specific polypeptide.
[0125] Operably linked. As used herein "operably linked" means that
a nucleic acid element is positioned so as to influence the
initiation of expression of the polypeptide encoded by the
structural gene or other nucleic acid molecule.
[0126] Expression. As used herein "expression" refers to the
process by which a gene or other nucleic acid molecule produces a
polypeptide. It includes transcription of the gene or nucleic acid
molecule into messenger RNA (mRNA) and the translation of such mRNA
into polypeptide(s).
[0127] Substantially Pure. As used herein "substantially pure"
means that the desired material is essentially free from
contaminating cellular components which are associated with the
desired material in nature. In a preferred aspect, a reverse
transcriptase of the invention has 25% or less, preferably 15% or
less, more preferably 10% or less, more preferably 5% or less, and
still more preferably 1% or less contaminating cellular components.
In another aspect, the reverse transcriptases of the invention have
no detectable protein contaminants when 200 units of reverse
transcriptase are run on a protein gel (e.g., SDS-PAGE) and stained
with Comassie blue. Contaminating cellular components may include,
but are not limited to, enzymatic activities such as phosphatases,
exonucleases, endonucleases or undesirable DNA polymerase enzymes.
Preferably, reverse transcriptases of the invention are
substantially pure.
[0128] Substantially isolated. As used herein "substantially
isolated" means that the polypeptide of the invention is
essentially free from contaminating proteins, which may be
associated with the polypeptide of the invention in nature and/or
in a recombinant host. In one aspect, a substantially isolated
reverse transcriptase of the invention has 25% or less, preferably
15% or less, more preferably 10% or less, more preferably 5% or
less, and still more preferably 1% or less contaminating proteins.
In another aspect, in a sample of a substantially isolated
polypeptide of the invention, 75% or greater (preferably 80%, 85%,
90%, 95%, 98%, or 99% or greater) of the protein in the sample is
the desired reverse transcriptase of the invention. The percentage
of contaminating protein and/or protein of interest in a sample may
be determined using techniques known in the art, for example, by
using a protein gel (e.g., SDS-PAGE) and staining the gel with a
protein dye (e.g., Coomassie blue, silver stain, amido black,
etc.). In another aspect, the reverse transcriptases of the
invention have no detectable protein contaminants when 200 units of
reverse transcriptase are run on a protein gel (e.g., SDS-PAGE) and
stained with Comassie blue.
[0129] Primer. As used herein "primer" refers to a single-stranded
oligonucleotide that is extended by covalent bonding of nucleotide
monomers during amplification or polymerization of a DNA
molecule.
[0130] Template. The term "template" as used herein refers to a
double-stranded or single-stranded nucleic acid molecule which is
to be amplified, copied or sequenced. In the case of a
double-stranded DNA molecule, denaturation of its strands to form
single-stranded first and second strands may be performed before
these molecules are amplified, copied or sequenced. A primer
complementary to a portion of a nucleic acid template is hybridized
under appropriate conditions and a nucleic acid polymerase, such as
the reverse transcriptase enzymes of the invention, may then add
nucleotide monomers to the primer thereby synthesizing a nucleic
acid molecule complementary to said template or a portion thereof.
The newly synthesized nucleic acid molecule, according to the
invention, may be equal or shorter in length than the original
template. Mismatch incorporation during the synthesis or extension
of the newly synthesized nucleic acid molecule may result in one or
a number of mismatched base pairs. Thus, the synthesized nucleic
acid molecule need not be exactly complementary to the
template.
[0131] Incorporating. The term "incorporating" as used herein means
becoming a part of a nucleic acid molecule or primer.
[0132] Oligonucleotide. "Oligonucleotide" refers to a synthetic or
natural molecule comprising a covalently linked sequence of
nucleotides which are joined by a phosphodiester bond between the
3' position of the pentose of one nucleotide and the 5' position of
the pentose of the adjacent nucleotide.
[0133] Nucleotide. As used herein "nucleotide" refers to a
base-sugar-phosphate combination. Nucleotides are monomeric units
of a nucleic acid sequence (DNA and RNA). The term nucleotide
includes ribonucleoside triphosphates ATP, UTP, CTG, GTP and
deoxyribonucleoside triphosphates such as dATP, dCTP, dITP, dUTP,
dGTP, dTTP, or derivatives thereof. Such derivatives include, for
example, [.alpha.S]dATP, 7-deaza-dGTP and 7-deaza-dATP, and
nucleotide derivatives that confer nuclease resistance on the
nucleic acid molecule containing them. The term nucleotide as used
herein also refers to dideoxyribonucleoside triphosphates (ddNTPs)
and their derivatives. Illustrated examples of
dideoxyribonucleoside triphosphates include, but are not limited
to, ddATP, ddCTP, ddGTP, ddITP, and ddTTP. According to the present
invention, a "nucleotide" may be unlabeled or detectably labeled by
well known techniques. Detectable labels include, for example,
radioactive isotopes, fluorescent labels, chemiluminescent labels,
bioluminescent labels and enzyme labels. Fluorescent labels of
nucleotides may include but are not limited fluorescein,
5-carboxyfluorescein (FAM),
2'7'-dimethoxy-4'5-dichloro-6-carboxyfluorescein (JOE), rhodamine,
6-carboxyrhodamine (R6G), N,N,N',N'-tetramethyl-6-carboxyrhodamine
(TAMRA), 6-carboxy-X-rhodamine (ROX), 4-(4'dimethylaminophenylazo)
benzoic acid (DABCYL), Cascade Blue, Oregon Green, Texas Red,
Cyanine and 5-(2'-aminoethyl)aminonaphthalene-1-sulfonic acid
(EDANS). Specific examples of fluroescently labeled nucleotides
include [R6G]dUTP, [TAMRA]dUTP, [R110]dCTP, [R6G]dCTP, [TAMRA]dCTP,
[JOE]ddATP, [R6G]ddATP, [FAM]ddCTP, [R110]ddCTP, [TAMRA]ddGTP,
[ROX]ddTTP, [dR6G]ddATP, [dR110]ddCTP, [dTAMRA]ddGTP, and
[dROX]ddTTP available from Perkin Elmer, Foster City, Calif.
FluoroLink DeoxyNucleotides, FluoroLink Cy3-dCTP, FluoroLink
Cy5-dCTP, FluoroLink FluorX-dCTP, FluoroLink Cy3-dUTP, and
FluoroLink Cy5-dUTP available from Amersham Arlington Heights,
Ill.; Fluorescein-15-dATP, Fluorescein-12-dUTP,
Tetramethyl-rodamine-6-dUTP, IR.sub.770-9-dATP,
Fluorescein-12-ddUTP, Fluorescein-12-UTP, and
Fluorescein-15-2'-dATP available from Boehringer Mannheim
Indianapolis, Ind.; and ChromaTide Labeled Nucleotides,
BODIPY-FL-14-UTP, BODIPY-FL-4-UTP, BODIPY-TMR-14-UTP,
BODIPY-TMR-14-dUTP, BODIPY-TR-14-UTP, BODIPY-TR-14-dUTP, Cascade
Blue-7-UTP, Cascade Blue-7-dUTP, fluorescein-12-UTP,
fluorescein-12-dUTP, Oregon Green 488-5-dUTP, Rhodamine
Green-5-UTP, Rhodamine Green-5-dUTP, tetramethylrhodamine-6-UTP,
tetramethylrhodamine-6-dUTP, Texas Red-5-UTP, Texas Red-5-dUTP, and
Texas Red-12-dUTP available from Molecular Probes, Eugene,
Oreg.
[0134] Probes. The term probes refer to single or double stranded
nucleic acid molecules or oligonucleotides which are detectably
labeled by one or more detectable markers or labels. Such labels or
markers may be the same or different and may include radioactive
labels, fluorescent labels, chemiluminescent labels, bioluminescent
labels and enzyme labels, although one or more fluorescent labels
(which are the same or different) are preferred in accordance with
the invention. Probes have specific utility in the detection of
nucleic acid molecules by hybridization and thus may be used in
diagnostic assays.
[0135] Hybridization. As used herein, hybridization (hybridizing)
refers to the pairing of two complementary single-stranded nucleic
acid molecules (RNA and/or DNA) to give a double-stranded molecule.
As one skilled in the art will recognize, two nucleic acid
molecules may be hybridized, although the base pairing is not
completely complementary. Accordingly, mismatched bases do not
prevent hybridization of two nucleic acid molecules provided that
appropriate conditions, well known in the art, are used.
[0136] Thermostable Reverse Transcriptase. For the purposes of this
disclosure, a thermostable reverse transcriptase includes a reverse
transcriptase which retains a greater percentage or amount of its
activity after a heat treatment than is retained by a reverse
transcriptase that has wild-type thermostability after an identical
treatment. Thus, a reverse transcriptase having increased/enhanced
thermostability may be defined as a reverse transcriptase having
any increase in thermostability, preferably from about 1.2 to about
10,000 fold, from about 1.5 to about 10,000 fold, from about 2 to
about 5,000 fold, or from about 2 to about 2000 fold (preferably
greater than about 5 fold, more preferably greater than about 10
fold, still more preferably greater than about 50 fold, still more
preferably greater than about 100 fold, still more preferably
greater than about 500 fold, and most preferably greater than about
1000 fold) retention of activity after a heat treatment sufficient
to cause a reduction in the activity of a reverse transcriptase
that is wild-type for thermostability. Preferably, the mutant or
modified reverse transcriptase of the invention is compared to the
corresponding unmodified or wild-type reverse transcriptase to
determine the relative enhancement or increase in thermostability.
For example, after a heat treatment at 52.degree. C. for 5 minutes,
a thermostable reverse transcriptase may retain approximately 90%
of the activity present before the heat treatment, whereas a
reverse transcriptase that is wild-type for thermostability may
retain 10% of its original activity. Likewise, after a heat
treatment at 53.degree. C. for five minutes, a thermostable reverse
transcriptase may retain approximately 80% of its original
activity, whereas a reverse transcriptase that is wild-type for
thermostability may have no measurable activity. Similarly, after a
heat treatment at 50.degree. C. for five minutes, a thermostable
reverse transcriptase may retain approximately 50%, approximately
55%, approximately 60%, approximately 65%, approximately 70%,
approximately 75%, approximately 80%, approximately 85%,
approximately 90%, or approximately 95% of its original activity,
whereas a reverse transcriptase that is wild-type for
thermostability may have no measurable activity or may retain 10%,
15% or 20% of its original activity. In the first instance (i.e.,
after heat treatment at 52.degree. C. for 5 minutes), the
thermostable reverse transcriptase would be said to be 9-fold more
thermostable than the wild-type reverse transcriptase. Examples of
conditions which may be used to measure thermostability of reverse
transcriptases are set out below, for example, in the Examples.
[0137] The thermostability of a reverse transcriptase can be
determined by comparing the residual activity of a sample of the
reverse transcriptase that has been subjected to a heat treatment,
i.e., incubated at 52.degree. C. for a given period of time, for
example, five minutes, to a control sample of the same reverse
transcriptase that has been incubated at room temperature for the
same length of time as the heat treatment. Typically the residual
activity may be measured by following the incorporation of a
radiolabled deoxyribonucleotide into an oligodeoxyribonucleotide
primer using a complementary oligoribonucleotide template. For
example, the ability of the reverse transcriptase to incorporate
[.alpha.-.sup.32P]-dGTP into an oligo-dG primer using a poly(riboC)
template may be assayed to determine the residual activity of the
reverse transcriptase.
[0138] In another aspect, thermostable reverse transcriptases of
the invention may include any reverse transcriptase which is
inactivated at a higher temperature compared to the corresponding
wild-type, unmutated, or unmodified reverse transcriptase.
Preferably, the inactivation temperature for the thermostable
reverse transcriptases of the invention is from about 2.degree. C.
to about 50.degree. C. (e.g., about 2.degree. C., about 4.degree.
C., about 5.degree. C., about 8.degree. C., about 10.degree. C.,
about 12.degree. C., about 14.degree. C., about 16.degree. C.,
about 18.degree. C., about 20.degree. C., about 24.degree. C.,
about 26.degree. C., about 28.degree. C., about 30.degree. C.,
about 33.degree. C., about 35.degree. C., about 38.degree. C.,
about 40.degree. C., about 42.degree. C., about 44.degree. C.,
about 46.degree. C., about 48.degree. C., or about 50.degree. C.)
higher than the inactivation temperature for the corresponding
wild-type, unmutated, or unmodified reverse transcriptase. More
preferably, the inactivation temperature for the reverse
transcriptases of the invention is from about 5.degree. C. to about
50.degree. C., from about 5.degree. C. to about 40.degree. C., from
about 5.degree. C. to about 30.degree. C., or from about 5.degree.
C. to about 25.degree. C. greater than the inactivation temperature
for the corresponding wild-type, unmutated or unmodified reverse
transcriptase, when compared under the same conditions.
[0139] The difference in inactivation temperature for the reverse
transcriptase of the invention compared to its corresponding
wild-type, unmutated or unmodified reverse transcriptase can be
determined by treating samples of such reverse transcriptases at
different temperatures for a defined time period and then measuring
residual reverse transcriptase activity, if any, after the samples
have been heat treated. Determination of the difference or delta in
the inactivation temperature between the test reverse transcriptase
compared to the wild-type, unmutated or unmodified control is
determined by comparing the difference in temperature at which each
reverse transcriptase is inactivated (i.e., no residual reverse
transcriptase activity is measurable in the particular assay used).
As will be recognized, any number of reverse transcriptase assays
may be used to determine the different or delta of inactivation
temperatures for any reverse transcriptases tested.
[0140] In another aspect, thermostability of a reverse
transcriptase of the invention may be determined by measuring the
half-life of the reverse transcriptase activity of a reverse
transcriptase of interest. Such half-life may be compared to a
control or wild-type reverse transcriptase to determine the
difference (or delta) in half-life. Half-lifes of the reverse
transcriptases of the invention are preferably determined at
elevated temperatures (e.g., greater than 37.degree. C.) and
preferably at temperatures ranging from 40.degree. C. to 80.degree.
C., more preferably at temperatures ranging from 45.degree. C. to
75.degree. C., 50.degree. C. to 70.degree. C., 50.degree. C. to
65.degree. C., and 50.degree. C. to 60.degree. C. Preferred
half-lifes of the reverse transcriptases of the invention may range
from 4 minutes to 10 hours, 4 minutes to 7.5 hours, 4 minutes to 5
hours, 4 minutes to 2.5 hours, or 4 minutes to 2 hours, depending
upon the temperature used. For example, the reverse transcriptase
activity of the reverse transcriptases of the invention may have a
half-life of at least 4 minutes, at least 5 minutes, at least 6
minutes, at least 7 minutes, at least 8 minutes, at least 9
minutes, at least 10 minutes, at least 11 minutes, at least 12
minutes, at least 13 minutes, at least 14 minutes, at least 15
minutes, at least 20 minute, at least 25 minutes, at least 30
minutes, at least 40 minutes, at least 50 minutes, at least 60
minutes, at least 70 minutes, at least 80 minutes, at least 90
minutes, at least 100 minutes, at least 115 minutes, at least 125
minutes, at least 150 minutes, at least 175 minutes, at least 200
minutes, at least 225 minutes, at least 250 minutes, at least 275
minutes, at least 300 minutes, at least 400 minutes, at least 500
minutes at temperatures of 48.degree. C., 50.degree. C., 52.degree.
C., 52.5.degree. C., 55.degree. C., 57.degree. C., 60.degree. C.,
62.degree. C., 65.degree. C., 68.degree. C., and/or 70.degree.
C.
[0141] Terminal extension activity. As used herein, terminal
extension activity refers to the ability of a reverse transcriptase
(RT) to add additional bases on to the 3' end of a newly
synthesized cDNA strand beyond the 5' end of the DNA or mRNA
template. Terminal extension activity may add bases specifically
(with a nucleotide bias) or randomly.
[0142] Terminal extension activity is also known as terminal
deoxynucleotidyl transferase (TdT) activity. A reverse
transcriptase having reduced TdT activity is defined as any reverse
transcriptase having lower TdT specific activity than the TdT
specific activity of the corresponding wild-type, unmutated, or
unmodified enzyme, for example, less than about 90% of the TdT
specific activity of the corresponding wild-type, unmutated, or
unmodified enzyme, less than about 85% of the TdT specific activity
of the corresponding wild-type, unmutated, or unmodified enzyme,
less than about 80% of the TdT specific activity of the
corresponding wild-type, unmutated, or unmodified enzyme, less than
about 75% of the TdT specific activity of the corresponding
wild-type, unmutated, or unmodified enzyme, less than about 50% of
the TdT specific activity of the corresponding wild-type,
unmutated, or unmodified enzyme, less than about 25% of the TdT
specific activity of the corresponding wild-type, unmutated, or
unmodified enzyme, less than about 15% of the TdT specific activity
of the corresponding wild-type, unmutated, or unmodified enzyme,
less than 10% of the TdT specific activity of the corresponding
wild-type, unmutated, or unmodified enzyme, less than about 5% of
the TdT specific activity of the corresponding wild-type,
unmutated, or unmodified enzyme, or less than about 1% of the TdT
specific activity of the corresponding wild-type, unmutated, or
unmodified enzyme. A reverse transcriptase of the invention having
substantially reduced TdT activity refers to a reverse
transcriptase having a TdT specific activity level of 30% or less
than the TdT specific activity of the corresponding wild-type or
TdT.sup.+ reverse transcriptase. Eliminated TdT activity is defined
as a level of activity that is undetectable by the assay methods
set out herein in Example 3.
[0143] As noted below in Example 3, reverse transcriptases are
known in the art which extend nucleic acid molecules 2-3
nucleotides past the end of templates (e.g., RNA or DNA templates).
Further, in any one reaction mixture in which reverse transcription
occurs, mixtures of molecules may be present which contain
different numbers of nucleotides that extend beyond the end of the
template. TdT activity may be determined herein in reference to the
number or percentage of molecules which contain one or more
nucleotides which extend beyond the end of the template. For
example, if a wild-type reverse transcriptase adds 1 or more
nucleotides past the end of a template to 90% of the molecules
generated during reverse transcription and a modified reverse
transcriptase adds 1 or more nucleotides past the end of a template
to 45% of the molecules under the same or similar conditions, then
the modified reverse transcriptase would be said to exhibit a 50%
decrease in TdT activity as compared to the wild-type enzyme.
Further, an F309N, T306K, H204R mutant of M-MLV SUPERSCRIPT.TM. II
has been generated which exhibits about 0% of the TdT activity
exhibited by SUPERSCRIPT.TM. II when DNA is used as a template and
about 10-20% of the TdT activity exhibited by SUPERSCRIPT.TM. II
when RNA is used as a template.
[0144] Fidelity. Fidelity refers to the accuracy of polymerization,
or the ability of the reverse transcriptase to discriminate correct
from incorrect substrates, (e.g., nucleotides) when synthesizing
nucleic acid molecules which are complementary to a template. The
higher the fidelity of a reverse transcriptase, the less the
reverse transcriptase misincorporates nucleotides in the growing
strand during nucleic acid synthesis; that is, an increase or
enhancement in fidelity results in a more faithful reverse
transcriptase having decreased error rate or decreased
misincorporation rate.
[0145] A reverse transcriptase having increased/enhanced/higher
fidelity is defined as a polymerase having any increase in
fidelity, preferably about 1.2 to about 10,000 fold, about 1.5 to
about 10,000 fold, about 2 to about 5,000 fold, or about 2 to about
2000 fold (preferably greater than about 5 fold, more preferably
greater than about 10 fold, still more preferably greater than
about 50 fold, still more preferably greater than about 100 fold,
still more preferably greater than about 500 fold and most
preferably greater than about 100 fold) reduction in the number of
misincorporated nucleotides during synthesis of any given nucleic
acid molecule of a given length compared to the control reverse
transcriptase. Preferably, the mutant or modified reverse
transcriptase of the invention is compared to the corresponding
unmodified or wild-type reverse transcriptase to determine the
relative enhancement or increase in fidelity. For example, a
mutated reverse transcriptase may misincorporate one nucleotide in
the synthesis of a nucleic acid molecule segment of 1000 bases
compared to an unmutated reverse transcriptase misincorporating 10
nucleotides in the same size segment. Such a mutant reverse
transcriptase would be said to have an increase of fidelity of 10
fold.
[0146] Fidelity can also be measured by the decrease in the
incidence of frame shifting, as described below in Example 5. A
reverse transcriptase having increased fidelity may be defined as a
polymerase or reverse transcriptase having any increase in fidelity
with respect to frame shifting, as compared to a control reverse
transcriptase (e.g., a corresponding wild-type and/or a
corresponding un-mutated or unmodified reverse transcriptase), for
example, a reverse transcriptase having greater than about 1.2 fold
increased fidelity with respect to frame shifting, having greater
than about 1.5 fold increased fidelity with respect to frame
shifting, having greater than about 5 fold increased fidelity with
respect to frame shifting, having greater than about 10 fold
increased fidelity with respect to frame shifting, having greater
than about 20 fold increased fidelity with respect to frame
shifting, having greater than about 30 fold increased fidelity with
respect to frame shifting, or having greater than about 40 fold
increased fidelity with respect to frame shifting.
[0147] A reverse transcriptase having increased/enhanced/higher
fidelity, with respect to frame shifting, can also be defined as a
reverse transcriptase or polymerase having any increase in
fidelity, such as from about 1.5 to about 10,000 fold, from about 2
to about 5,000 fold, from about 2 to about 2000 fold, from about
1.5 to about 40 fold, from about 5 to about 40 fold, from about 10
to about 40 fold, from about 20 to about 40 fold, from about 30 to
about 40 fold, from about 5 to about 30 fold, from about 10 to
about 30 fold, from about 15 to about 30 fold, from about 20 to
about 30 fold, from about 5 to about 20 fold, from about 10 to
about 20 fold, from about 15 to about 20 fold, from about 10 to
about 100 fold, from about 15 to about 100 fold, from about 20 to
about 100 fold, from about 30 to about 100 fold, or from about 50
to about 100 fold increased fidelity with respect to frame
shifting.
[0148] A reverse transcriptase having reduced misincorporation is
defined herein as either a mutated or modified reverse
transcriptase that has about or less than 90%, has about or less
than 85%, has about or less than 75%, has about or less than 70%,
has about or less than 60%, or preferably has about or less than
50%, preferably has about or less than 25%, more preferably has
about or less than 10%, and most preferably has about or less than
1% of relative misincorporation compared to the corresponding
wild-type, unmutated, or unmodified enzyme.
[0149] The fidelity or misincorporation rate of a reverse
transcriptase can be determined by sequencing or by other methods
known in the art (Eckert & Kunkel, 1990, Nucl. Acids Res.
18:3739-3744). In one example, the sequence of a DNA molecule
synthesized by the unmutated and mutated reverse transcriptases can
be compared to the expected (known) sequence. In this way, the
number of errors (misincorporation or frame shifts) can be
determined for each enzyme and compared. In another example, the
unmutated and mutated reverse transcriptases may be used to
sequence a DNA molecule having a known sequence. The number of
sequencing errors (misincorporation or frame shifts) can be
compared to determine the fidelity or misincorporation rate of the
enzymes. Other means of determining the fidelity or
misincorporation rate include a forward complementation assay using
an RNA template as described below and previously in Boyer J. C. et
al. Methods Enzymol. 275:523 (1996), and are set out in the
examples. Other methods of determining the fidelity or
misincorporation rate will be recognized by one of skill in the
art.
[0150] Strand jumping. Strand jumping, as used herein, refers to a
type of random mutation caused by an reverse transcriptase
"skipping" more than one (e.g., two, five, ten, fifty, one-hundred,
etc.) nucleotides on the mRNA template, resulting in a deletion of
the corresponding nucleotides in the resulting cDNA. Sequencing the
synthesized nucleic acid molecule and comparing to the expected
sequence may allow determination of the level or amount of strand
jumping for the reverse transcriptases of the invention. This level
or amount may then be compared to the level or amount of strand
jumping caused by the corresponding wild type and/or unmodified or
un-mutated reverse transcriptase.
[0151] Hand domain. The hand domain, as used herein, refers to
those amino acids which are in the area or areas that control the
template, primer, or nucleotide interaction of the reverse
transcriptase. This domain is further characterized by a group of
three regions of secondary structure in a reverse transcriptase
enzyme, the thumb, fingers and palm regions. The thumb region is
defined as residing between amino acids 240-315 of HIV reverse
transcriptase, or between amino acids 280-355 of M-MLV reverse
transcriptase. The fingers region is defined as residing between
amino acids 1-85 and 120-154 of HIV reverse transcriptase, or
between 1-124 and 161-193 of M-MLV reverse transcriptase. The palm
region is defined as residing between amino acids 86-199 and
155-239 of HIV reverse transcriptase, or between amino acids
126-160 and 193-279 of M-MLV reverse transcriptase. These areas are
generally defined, and the amino acids defining the N-termini and
C-termini are approximate. Corresponding regions may also be
defined for other reverse transcriptases. Preferred reverse
transcriptases of the invention have one or more modifications or
mutations within the hand domain. More particularly, reverse
transcriptases of the invention comprise one or more mutations or
modifications within one or more regions, including the thumb,
finger, and palm regions.
[0152] Full length. As used herein, full length when used to
describe a product molecule, e.g., a cDNA molecule, indicates that
the product molecule is the same length or substantially the same
length as the template molecule, e.g., an mRNA molecule, from which
it is produced by the activity of polypeptides of the invention. A
cDNA molecule may be substantially the same length as the template
from which it is copied when it is about 90%, 91%, 92%, 93%, 94%,
95%, 96%, 97%, 98%, 99% or greater of the length of the portion of
the template located 3' to the 3' most nucleotide of the primer
used to reverse transcribe the template. Thus, if a primer anneals
in the center of a template, a full length product would be one
that contains a cDNA copy of half of the template. Template
molecules may be from about 100 bases to about 50 kb in length,
from about 200 bases to about 50 kb in length, from about 300 bases
to about 50 kb in length, from about 400 bases to about 50 kb in
length, from about 500 bases to about 50 kb in length, from about
600 bases to about 50 kb in length, from about 700 bases to about
50 kb in length, from about 800 bases to about 50 kb in length,
from about 900 bases to about 50 kb in length, and from about 1 kb
to about 50 kb in length. In some embodiments, template molecules
may be from about 500 bases to about 10 kb in length, from about
600 bases to about 10 kb in length, from about 700 bases to about
10 kb in length, from about 800 bases to about 10 kb in length,
from about 900 bases to about 10 kb in length, from about 1000
bases to about 10 kb in length, from about 1100 bases to about 10
kb in length, and/or from about 1200 bases to about 10 kb in
length. In some embodiments, template molecules may be from about
250 bases to about 5 kb in length, from about 300 bases to about 5
kb in length, and from about 350 bases to about 5 kb in length,
from about 400 bases to about 5 kb in length, from about 450 bases
to about 5 kb in length, from about 500 bases to about 5 kb in
length, from about 550 bases to about 5 kb in length, from about
600 bases to about 5 kb in length, from about 650 bases to about 5
kb in length, from about 700 bases to about 5 kb in length, from
about 750 bases to about 5 kb in length, from about 800 bases to
about 5 kb in length, and from about 850 bases to about 5 kb in
length.
[0153] In some embodiments, the ability of a reverse transcriptase
to synthesize a full length product may be determined using a
defined template and primer, for example, a polyadenylated template
corresponding to the chloramphenicol acetyl transferase gene and an
oligo(dT) primer, under defined reaction conditions, e.g., pH, salt
concentration, divalent metal concentration, template
concentration, temperature, etc. In some embodiments, a template
molecule is greater than about 500 base pairs in length, and the
amount of full length product synthesized may determined by
separating full length product from truncated product, for example,
by gel electrophoresis, and quantifying the full length product,
for example, by incorporating a radiolabel in to the product and
using a scintillation counter.
[0154] About. The term "about" as used herein, means the recited
number plus or minus 10%. Thus, "about 100" includes 90-110.
Overview
[0155] In general, the invention provides, in part, compositions
for use in reverse transcription of a nucleic acid molecule
comprising a reverse transcriptase with one or more (e.g., one,
two, three, four, five, ten, twelve, fifteen, twenty, thirty, etc.)
mutations or modification which render the reverse transcriptase
more thermostable. The invention also provides compositions for use
in reverse transcription of a nucleic acid molecule, the
compositions comprising a reverse transcriptase with one or more
mutations or modification which render the reverse transcriptase
more efficient, that is having higher fidelity, and/or has lower
TdT activity than a corresponding un-mutated or un-modified reverse
transcriptase. The invention further provides compositions
comprising a reverse transcriptase with one or more mutations or
modification which render the reverse transcriptase more
thermostable and/or more efficient than a corresponding un-mutated
or un-modified reverse transcriptase.
[0156] The enzymes in these compositions are preferably present in
working concentrations and are also preferably reduced,
substantially reduced, or eliminated in RNase H activity.
Alternatively, reverse transcriptases used in the compositions of
the invention may have RNase H activity. Preferred reverse
transcriptases include retroviral reverse transcriptases such as
M-MLV reverse transcriptase, HIV reverse transcriptase, RSV reverse
transcriptase, AMV reverse transcriptase, RAV reverse
transcriptase, and MAV reverse transcriptase or other ASLV reverse
transcriptases or their corresponding RNase H- derivatives.
Additional reverse transcriptases which may be used to prepare
compositions of the invention include bacterial reverse
transcriptases (e.g., Escherichia coli reverse transcriptase) (see,
e.g., Mao et al., Biochem. Biophys. Res. Commun. 227:489-93 (1996))
and reverse transcriptases of Saccharomyces cerevisiae (e.g.,
reverse transcriptases of the Ty1 or Ty3 retrotransposons) (see,
e.g., Cristofari et al., Jour. Biol. Chem. 274:36643-36648 (1999);
Mules et al., Jour. Virol. 72:6490-6503 (1998)).
[0157] In accordance with the invention, any number of mutations
can be made to the reverse transcriptases and, in a preferred
aspect, multiple mutations can be made to result in an increased
thermostability and/or to confer other desired properties on
reverse transcriptases of the invention. Such mutations include
point mutations, frame shift mutations, deletions and insertions,
with one or more (e.g., one, two, three, four, five, ten, twelve,
fifteen, twenty, thirty, etc.) point mutations preferred. Mutations
may be introduced into reverse transcriptases of the present
invention using any methodology known to those of skill in the art.
Mutations may be introduced randomly by, for example, conducting a
PCR reaction in the presence of manganese as a divalent metal ion
cofactor. Alternatively, oligonucleotide directed mutagenesis may
be used to create the mutant polymerases which allows for all
possible classes of base pair changes at any determined site along
the encoding DNA molecule. In general, this technique involves
annealing an oligonucleotide complementary (except for one or more
mismatches) to a single stranded nucleotide sequence coding for the
reverse transcriptase of interest. The mismatched oligonucleotide
is then extended by DNA polymerase, generating a double-stranded
DNA molecule which contains the desired change in sequence in one
strand. The changes in sequence can, for example, result in the
deletion, substitution, or insertion of an amino acid. The
double-stranded polynucleotide can then be inserted into an
appropriate expression vector, and a mutant or modified polypeptide
can thus be produced. The above-described oligonucleotide directed
mutagenesis can, for example, be carried out via PCR.
[0158] The invention is also directed to methods for reverse
transcription of one or more (e.g., one, two, three, four, five,
ten, twelve, fifteen, twenty, etc.) nucleic acid molecules
comprising mixing one or more (e.g., one, two, three, four, five,
ten, twelve, fifteen, twenty, etc.) nucleic acid templates, which
are preferably RNA or messenger RNA (mRNA) and more preferably a
population of mRNA molecules, with one or more reverse
transcriptase of the present invention and incubating the mixture
under conditions sufficient to make a nucleic acid molecule or
molecules complementary to all or a portion of the one or more
(e.g., one, two, three, four, five, ten, twelve, fifteen, twenty,
thirty, etc.) templates. To make the nucleic acid molecule or
molecules complementary to the one or more templates, a primer
(e.g., an oligo(dT) primer) and one or more nucleotides are
preferably used for nucleic acid synthesis in the 5' to 3'
direction. Nucleic acid molecules suitable for reverse
transcription according to this aspect of the invention include any
nucleic acid molecule, particularly those derived from a
prokaryotic or eukaryotic cell. Such cells may include normal
cells, diseased cells, transformed cells, established cells,
progenitor cells, precursor cells, fetal cells, embryonic cells,
bacterial cells, yeast cells, animal cells (including human cells),
avian cells, plant cells and the like, or tissue isolated from a
plant or an animal (e.g., human, cow, pig, mouse, sheep, horse,
monkey, canine, feline, rat, rabbit, bird, fish, insect, etc.).
Nucleic acid molecules suitable for reverse transcription may also
be isolated and/or obtained from viruses and/or virally infected
cells.
[0159] The invention further provides methods for amplifying or
sequencing a nucleic acid molecule comprising contacting the
nucleic acid molecule with a reverse transcriptase of the present
invention. Preferred such methods comprise one or more polymerase
chain reactions (PCRs).
Sources of Reverse Transcriptases
[0160] Enzymes for use in compositions, methods and kits of the
invention include any enzyme having reverse transcriptase activity.
Such enzymes include, but are not limited to, retroviral reverse
transcriptase, retrotransposon reverse transcriptase, hepatitis B
reverse transcriptase, cauliflower mosaic virus reverse
transcriptase, bacterial reverse transcriptase, Tth DNA polymerase,
Taq DNA polymerase (Saiki, R. K., et al., Science 239:487-491
(1988); U.S. Pat. Nos. 4,889,818 and 4,965,188), Tne DNA polymerase
(PCT Publication No. WO 96/10640), Tma DNA polymerase (U.S. Pat.
No. 5,374,553) and mutants, fragments, variants or derivatives
thereof (see, e.g., commonly owned U.S. Pat. Nos. 5,948,614 and
6,015,668, which are incorporated by reference herein in their
entireties). Preferably, reverse transcriptases for use in the
invention include retroviral reverse transcriptases such as M-MLV
reverse transcriptase, AMV reverse transcriptase, RSV reverse
transcriptase, RAV reverse transcriptase, MAV reverse
transcriptase, and generally ASLV reverse transcriptases. As will
be understood by one of ordinary skill in the art, modified reverse
transcriptases may be obtained by recombinant or genetic
engineering techniques that are routine and well-known in the art.
Mutant reverse transcriptases can, for example, be obtained by
mutating the gene or genes encoding the reverse transcriptase of
interest by site-directed or random mutagenesis. Such mutations may
include point mutations, deletion mutations and insertional
mutations. For example, one or more point mutations (e.g.,
substitution of one or more amino acids with one or more different
amino acids) may be used to construct mutant reverse transcriptases
of the invention.
[0161] The invention further includes reverse transcriptases which
are 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical
at the amino acid level to a wild-type reverse transcriptase (e.g.,
M-MLV reverse transcriptase, AMV reverse transcriptase, RSV reverse
transcriptase, HIV reverse transcriptase, etc.) and exhibit
increased thermostability and/or other desired properties of the
invention. Also included within the invention are reverse
transcriptases which are 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%,
98%, or 99% identical at the amino acid level to a reverse
transcriptase comprising the amino acid sequence set out below in
Table 3 (SEQ ID NO:2) and exhibit increased thermostability and/or
more efficient (e.g., having higher fidelity and/or having lower
TdT activity). The invention also includes nucleic acid molecules
which encode the above described reverse transcriptases.
[0162] The invention also includes fragments of reverse
transcriptases which comprise at least 200, 250, 300, 350, 400,
450, 500, 550, 600, 650, or 700 amino acid residues and retain one
or more activities associated with reverse transcriptases. Such
fragments may be obtained by deletion mutation, by recombinant
techniques that are routine and well-known in the art, or by
enzymatic digestion of the reverse transcriptase(s) of interest
using any of a number of well-known proteolytic enzymes. The
invention further includes nucleic acid molecules which encode the
above described mutant reverse transcriptases and reverse
transcriptase fragments.
[0163] Reverse transcriptase fragments of the invention also
comprise amino acids 1-10, 11-20, 21-30, 31-40, 41-50, 51-60,
61-70, 71-80, 81-90, 91-100, 101-110, 111-120, 121-130, 131-140,
141-150, 151-160, 161-170, 171-180, 181-190, 191-200, 201-210,
211-220, 221-230, 231-240, 241-250, 251-260, 261-270, 271-280,
281-290, 291-300, 301-310, 311-320, 321-330, 331-340, 341-350,
351-360, 361-370, 371-380, 381-390, 391-400, 401-410, 411-420,
421-430, 431-440, 441-450, 451-460, 461-470, 471-480, 481-490,
491-500, 501-510, 511-520, 521-530, 531-540, and/or 541-550 and/or
amino acids 1-355, 1-498, 1-500, and/or 1-550 of M-MLV reverse
transcriptase (and more preferably the sequence shown in Table 3,
which may further contain one or more of the modifications or
mutations discussed herein), as well as corresponding fragments of
other reverse transcriptases. Reverse transcriptase fragments of
the invention further comprise polypeptides which are 70%, 75%,
80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to one or more
of the fragments set out above. The invention also concerns various
combinations of any number of these fragments.
[0164] By a protein or protein fragment having an amino acid
sequence at least, for example, 70% "identical" to a reference
amino acid sequence it is intended that the amino acid sequence of
the protein is identical to the reference sequence except that the
protein sequence may include up to 30 amino acid alterations per
each 100 amino acids of the amino acid sequence of the reference
protein. In other words, to obtain a protein having an amino acid
sequence at least 70% identical to a reference amino acid sequence,
up to 30% of the amino acid residues in the reference sequence may
be deleted or substituted with another amino acid, or a number of
amino acids up to 30% of the total amino acid residues in the
reference sequence may be inserted into the reference sequence.
These alterations of the reference sequence may occur at the amino
(N-) and/or carboxy (C-) terminal positions of the reference amino
acid sequence and/or anywhere between those terminal positions,
interspersed either individually among residues in the reference
sequence and/or in one or more contiguous groups within the
reference sequence. As a practical matter, whether a given amino
acid sequence is, for example, at least 70% identical to the amino
acid sequence of a reference protein can be determined
conventionally using known computer programs such as those
described above for nucleic acid sequence identity determinations,
or using the CLUSTAL W program (Thompson, J. D., et al., Nucleic
Acids Res. 22:4673-4680 (1994)).
[0165] Sequence identity may be determined by comparing a reference
sequence or a subsequence of the reference sequence to a test
sequence. The reference sequence and the test sequence are
optimally aligned over an arbitrary number of residues termed a
comparison window. In order to obtain optimal alignment, additions
or deletions, such as gaps, may be introduced into the test
sequence. The percent sequence identity is determined by
determining the number of positions at which the same residue is
present in both sequences and dividing the number of matching
positions by the total length of the sequences in the comparison
window and multiplying by 100 to give the percentage. In addition
to the number of matching positions, the number and size of gaps is
also considered in calculating the percentage sequence
identity.
[0166] Sequence identity is typically determined using computer
programs. A representative program is the BLAST (Basic Local
Alignment Search Tool) program publicly accessible at the National
Center for Biotechnology Information (NCBI,
http://www.ncbi.nlm.nih.gov/). This program compares segments in a
test sequence to sequences in a database to determine the
statistical significance of the matches, then identifies and
reports only those matches that that are more significant than a
threshold level. A suitable version of the BLAST program is one
that allows gaps, for example, version 2.X (Altschul, et al.,
Nucleic Acids Res. 25(17):3389-402, 1997). Standard BLAST programs
for searching nucleotide sequences (blastn) or protein (blastp) may
be used. Translated query searches in which the query sequence is
translated, i.e., from nucleotide sequence to protein (blastx) or
from protein to nucleic acid sequence (tbblastn) may also be used
as well as queries in which a nucleotide query sequence is
translated into protein sequences in all 6 reading frames and then
compared to an NCBI nucleotide database which has been translated
in all six reading frames (tbblastx).
[0167] Additional suitable programs for identifying proteins with
sequence identity to the proteins of the invention include, but are
not limited to, PHI-BLAST (Pattern Hit Initiated BLAST, Zhang, et
al., Nucleic Acids Res. 26(17):3986-90, 1998) and PSI-BLAST
(Position-Specific Iterated BLAST, Altschul, et al., Nucleic Acids
Res. 25(17):3389-402, 1997).
[0168] Programs may be used with default searching parameters.
Alternatively, one or more search parameter may be adjusted.
Selecting suitable search parameter values is within the abilities
of one of ordinary skill in the art.
[0169] Preferred enzymes for use in the invention include those
that are reduced, substantially reduced, or lacking in RNase H
activity. Such enzymes that are reduced or substantially reduced in
RNase H activity may be obtained by mutating, for example, the
RNase H domain within the reverse transcriptase of interest, for
example, by introducing one or more (e.g., one, two, three, four,
five, ten, twelve, fifteen, twenty, thirty, etc.) point mutations,
one or more (e.g., one, two, three, four, five, ten, twelve,
fifteen, twenty, thirty, etc.) deletion mutations, and/or one or
more (e.g., one, two, three, four, five, ten, twelve, fifteen,
twenty, thirty, etc.) insertion mutations as described above. In
some embodiments, the reverse transcriptase of the invention does
not contain a modification or mutation in the RNase H domain and
preferably does not contain a modification which reduces RNase H
activity. In one aspect, the reverse transcriptase of the invention
has 90%, 95%, or 100% of the RNase H activity compared to the
corresponding wildtype reverse transcriptase.
[0170] By an enzyme "substantially reduced in RNase H activity" is
meant that the enzyme has less than about 30%, less than about 25%,
less than about 20%, more preferably less than about 15%, less than
about 10%, less than about 7.5%, or less than about 5%, and most
preferably less than about 5% or less than about 2%, of the RNase H
activity of the corresponding wild-type or RNase H.sup.+ enzyme,
such as wild-type Moloney Murine Leukemia Virus (M-MLV), Avian
Myeloblastosis Virus (AMV) or Rous Sarcoma Virus (RSV) reverse
transcriptases. A reduction in RNase H activity means any reduction
in the activity compared, for example, to the corresponding wild
type or un-mutatated or unmodified reverse transcriptase.
[0171] Reverse transcriptases having reduced, substantially
reduced, undetectable or lacking RNase H activity have been
previously described (see U.S. Pat. No. 5,668,005, U.S. Pat. No.
6,063,608, and PCT Publication No. WO 98/47912). The RNase H
activity of any enzyme may be determined by a variety of assays,
such as those described, for example, in U.S. Pat. No. 5,244,797,
in Kotewicz, M. L., et al., Nucl. Acids Res. 16:265 (1988), in
Gerard, G. F., et al., FOCUS 14(5):91 (1992), in PCT publication
number WO 98/47912, and in U.S. Pat. No. 5,668,005, the disclosures
of all of which are fully incorporated herein by reference. Reverse
transcriptases having no detectable RNase H activity or lacking
RNase H activity by one or more of the described assays are
particularly preferred.
[0172] Particularly preferred enzymes for use in the invention
include, but are not limited to, M-MLV RNase H- reverse
transcriptase, RSV RNase H- reverse transcriptase, AMV RNase H-
reverse transcriptase, RAV RNase H- reverse transcriptase, MAV
RNase H- reverse transcriptase and HIV RNase H- reverse
transcriptase. It will be understood by one of ordinary skill,
however, that any enzyme capable of producing a DNA molecule from a
ribonucleic acid molecule (i.e., an enzyme having reverse
transcriptase activity) that is reduced, substantially reduced, or
lacking in RNase H activity may be equivalently used in the
compositions, methods and kits of the invention.
[0173] Enzymes for use in the invention also include those in which
terminal deoxynucleotidyl transferase (TdT) activity has been
reduced, substantially reduced, or eliminated. Such enzymes that
are reduced or substantially reduced in terminal deoxynucleotidyl
transferase activity, or in which TdT activity has been eliminated,
may be obtained by mutating, for example, amino acid residues
within the reverse transcriptase of interest which are in close
proximity or in contact with the template-primer, for example, by
introducing one or more (e.g., one, two, three, four, five, ten,
twelve, fifteen, twenty, thirty, etc.) point mutations, one or more
deletion mutations, and/or one or more insertion mutations. Reverse
transcriptases which exhibit decreased TdT activity are described
in U.S. application Ser. No. 09/808,124, filed Mar. 15, 2001 (the
entire disclosure of which is incorporated herein by reference),
and include reverse transcriptases with one or more alterations at
amino acid positions equivalent or corresponding to Y64, M289,
F309, T197 and/or Y133 of M-MLV reverse transcriptase.
[0174] In one aspect, amino acid substitutions are made at one or
more of the above identified positions (i.e., amino acid positions
equivalent or corresponding to Y64, M289, F309, T197 or Y133 of
M-MLV reverse transcriptase). Thus, the amino acids at these
positions may be substituted with any other amino acid including
Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile, Leu, Lys, Met,
Phe, Pro, Ser, Thr, Trp, Tyr, and Val. Specific example of reverse
transcriptases which exhibit reduced, substantially reduced, or
eliminated TdT activity include M-MLV reverse transcriptases (e.g.,
SUPERSCRIPT.TM. II) in which (1) the phenylalanine residue at
position 309 has been replaced with asparagine, (2) the threonine
residue at position 197 has been replaced with either alanine or
glutamic acid, and/or (3) the tyrosine residue at position 133 has
been replaced with alanine.
[0175] Enzymes for use in the invention also include those that
exhibit increased fidelity. Reverse transcriptases which exhibit
increased fidelity are described in U.S. Appl. No. 60/189,454,
filed Mar. 15, 2000, and U.S. application Ser. No. 09/808,124,
filed Mar. 15, 2001 (the entire disclosures of each of which are
incorporated herein by reference), and include reverse
transcriptases with one or more alterations at positions equivalent
or corresponding to those set out below in Table 2. TABLE-US-00002
TABLE 2 RT Amino Acid M-MLV Y64 (e.g., Y64W, Y64R), R116 (e.g.,
R116M), K152 (e.g., K152R), Q190 (e.g., Q190F), T197 (e.g., T197A,
T197E), V223 (e.g., V223H, V223I, V223F), D124, H126, Y133 (e.g.,
Y133A, Y133H), F309 (e.g., F309N, F309R) AMV W25, R76, K110, Q149,
T156, M182 RSV W25, R76, K110, Q149, T156, M182 HIV W24, R78, G112,
Q151, A158, M184
[0176] In some embodiments of the invention, amino acid
substitutions are made at one or more of the above identified
positions. Thus, the amino acids at these positions may be
substituted with any other amino acid including Ala, Arg, Asn, Arg,
Asp, Cys, Gln, Glu, Gly, His, Ile, Leu, Lys, Met, Phe, Pro, Ser,
Thr, Trp, Tyr, and Val. Specific example of reverse transcriptases
which exhibit increased fidelity include M-MLV reverse
transcriptase in which (1) the valine residue at position 223 has
been replaced with histidine, phenylalanine or isoleucine, (2) the
arginine residue at position 116 has been replaced with methionine,
(3) the lysine residue at position 152 has been replaced with
arginine, (4) the glutamic acid residue at position 190 has been
replaced with phenylalanine, (5) the threonine residue at position
197 has been replaced with alanine or glutamic acid, (6) the
phenylalanine residue at position 309 has been replaced with
asparagine or arginine, (7) the tyrosine residue at position 133
has been replaced with histidine or alanine, and/or (8) the
tyrosine residue at position 64 has been replaced with tryptophan
or arginine.
[0177] Thus, in specific embodiments, the invention includes
reverse transcriptases which exhibit increased thermostability and,
optionally, also exhibit one or more of the following
characteristics: (1) reduced or substantially reduced RNase H
activity, (2) reduced or substantially reduced TdT activity, and/or
(3) increased fidelity.
[0178] The invention also relates to reverse transcriptase mutants,
where the mutations or substitutions have been made in a recognized
region of the reverse transcriptase enzyme. Such regions include,
but are not limited to, the fingers, palm, thumb, .alpha.-helix H,
.beta.-sheet 10, and/or .beta.-sheet 11 regions. Thus, the
invention includes reverse transcriptases which exhibit increased
thermostability (as well as other properties), as described
elsewhere herein, and have one or more (e.g., one, two, three,
four, five, ten, fifteen, etc.) mutations or modification in the
hand domain and, more specifically, in one or more regions
including the fingers, palm and/or thumb regions.
[0179] Polypeptides having reverse transcriptase activity for use
in the invention may be isolated from their natural viral or
bacterial sources according to standard procedures for isolating
and purifying natural proteins that are well-known to one of
ordinary skill in the art (see, e.g., Houts, G. E., et al., J.
Virol. 29:517 (1979); U.S. Pat. No. 5,668,005; and PCT publication
number WO 98/47912). In addition, polypeptides having reverse
transcriptase activity may be prepared by recombinant DNA
techniques that are familiar to one of ordinary skill in the art
(see, e.g., Kotewicz, M. L., et al., Nucl. Acids Res. 16:265
(1988); Soltis, D. A., and Skalka, A. M., Proc. Natl. Acad. Sci.
USA 85:3372-3376 (1988)); U.S. Pat. No. 5,668,005; and PCT
publication no. WO 98/47912.
[0180] In one aspect of the invention, mutant or modified reverse
transcriptases are made by recombinant techniques. A number of
cloned reverse transcriptase genes are available or may be obtained
using standard recombinant techniques (see U.S. Pat. No. 5,668,005
and PCT Publication No. WO 98/47912).
[0181] To clone a gene or other nucleic acid molecule encoding a
reverse transcriptase which will be modified in accordance with the
invention, isolated, DNA which contains the reverse transcriptase
gene or open reading frame may be used to construct a recombinant
DNA library. Any vector, well known in the art, can be used to
clone the reverse transcriptase of interest. However, the vector
used must be compatible with the host in which the recombinant
vector will be transformed.
[0182] Prokaryotic vectors for constructing the plasmid library
include plasmids such as those capable of replication in E. coli
such as, for example, pBR322, ColE1, pSC101, pUC-vectors (pUC18,
pUC19, etc.: In: Molecular Cloning, A Laboratory Manual, Cold
Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (1982);
and Sambrook et al., In: Molecular Cloning A Laboratory Manual (2d
ed.) Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
(1989)). Bacillus plasmids include pC194, pUB110, pE194, pC221,
pC217, etc. Such plasmids are disclosed by Glyczan, T. In: The
Molecular Biology Bacilli, Academic Press, York (1982), 307-329.
Suitable Streptomyces plasmids include pIJ101 (Kendall et al., J.
Bacteriol. 169:4177-4183 (1987)). Pseudomonas plasmids are reviewed
by John et al., (Rad. Insec. Dis. 8:693-704 (1986)), and Igaki,
(Jpn. J. Bacteriol. 33:729-742 (1978)). Broad-host range plasmids
or cosmids, such as pCP13 (Darzins and Chakrabarty, J. Bacteriol.
159:9-18 (1984)) can also be used for the present invention.
Preferred vectors for cloning the genes and nucleic acid molecules
of the present invention are prokaryotic vectors. Preferably, pBAD,
pCP13 and pUC vectors are used to clone the genes of the present
invention. Other suitable vectors are known to those skilled in the
art and are commercially available, for example, from Invitrogen
Corporation, Carlsbad, Calif.
[0183] Suitable host for cloning the reverse transcriptase genes
and nucleic acid molecules of interest are prokaryotic hosts. One
example of a prokaryotic host is E. coli. However, the desired
reverse transcriptase genes and nucleic acid molecules of the
present invention may be cloned in other prokaryotic hosts
including, but not limited to, hosts in the genera Escherichia,
Bacillus, Streptomyces, Pseudomonas, Salmonella, Serratia, and
Proteus. Bacterial hosts of particular interest include E. coli
DH10B, which may be obtained from Invitrogen Corporation (Carlsbad,
Calif.).
[0184] Eukaryotic hosts for cloning and expression of the reverse
transcriptase of interest include yeast, fungal, and mammalian
cells. Expression of the desired reverse transcriptase in such
eukaryotic cells may require the use of eukaryotic regulatory
regions which include eukaryotic promoters. Cloning and expressing
the reverse transcriptase gene or nucleic acid molecule in
eukaryotic cells may be accomplished by well known techniques using
well known eukaryotic vector systems.
[0185] Once a DNA library has been constructed in a particular
vector, an appropriate host is transformed by well known
techniques. Transformed cells are plated at a density to produce
approximately 200-300 transformed colonies per petri dish. For
selection of reverse transcriptase, colonies are then screened for
the expression of a reverse transcriptase or a thermostable reverse
transcriptase as described in the Examples below. Briefly,
overnight cultures of individual transformant colonies are assayed
directly for reverse transcriptase or thermostable reverse
transcriptase activity and/or other desirable activities using a
labeled deoxynucleotide and analyzed for the presence of labeled
product. If thermostable reverse transcriptase activity and/or
other desirable activity is detected, the mutant is sequenced to
determine which amino acids maintained reverse transcriptase
activity. The gene or nucleic acid molecule encoding a reverse
transcriptase of the present invention can be cloned using
techniques known to those in the art.
Modifications or Mutations of Polymerases
[0186] In accordance with the invention, one or more mutations may
be made in any reverse transcriptase in order to increase the
thermostability of the enzyme, or confer other properties described
herein upon the enzyme, in accordance with the invention. Such
mutations include point mutations, frame shift mutations, deletions
and insertions. Preferably, one or more point mutations, resulting
in one or more amino acid substitutions, are used to produce
reverse transcriptases having enhanced or increased
thermostability. In a preferred aspect of the invention, one or
more mutations at positions equivalent or corresponding to position
H204 (e.g., H204R) and/or T306 (e.g., T306K or T306R) of M-MLV
reverse transcriptase may be made to produced the desired result in
other reverse transcriptases of interest.
[0187] In specific embodiments, one or more mutations at positions
equivalent or corresponding to position L52, Y64, R116, Y133, K152
Q190, T197, H204, V223, M289, T306 and/or F309 of M-MLV reverse
transcriptase may be made to produced a desired result (e.g.,
increased thermostability, increased fidelity, decreased TdT
activity, etc.). Thus, in specific embodiments, using amino acid
positions of M-MLV reverse transcriptase as a frame of reference,
proteins of the invention include reverse transcriptases (e.g.,
M-MLV reverse transcriptase, AMV reverse transcriptase, HIV reverse
transcriptase, RSV reverse transcriptase, etc.) having one or more
of the following alterations: L52P, Y64S, Y64W, Y64R, R116M, Y133A,
Y133H, K152R, K152M, Q190F, T197R, T197E, T197A, T197K, H204R,
V223H, V223F, V2231, M289L, T306K, T306R, F309R, and/or F309N, as
well as compositions containing these proteins, nucleic acid
molecules which encode these proteins, and host cells which contain
these nucleic acid molecules.
[0188] Mutations in reverse transcriptases which alter
thermostability properties of these proteins may be present in
conjunction with alterations which either have little or no effect
on activities normally associated with reverse transcriptases
(e.g., RNase H activity, reverse transcriptase or polymerase
activity, terminal deoxynucleotidyl transferase (TdTase) activity,
etc.) or substantially alter one or more activities normally
associated with reverse transcriptases. One example of a reverse
transcriptase which has such a combination of mutations is a M-MLV
reverse transcriptase which has the following alterations: K152M,
V223H.
[0189] One mutation which has been shown to enhanced the fidelity
of SUPERSCRIPT.TM. II (Invitrogen Corporation (Carlsbad, Calif.)
Catalog No. 18064-022) is V223H (see U.S. Appl. No. 60/189,454,
filed Mar. 15, 2000, U.S. application Ser. No. 09/808,124, filed
Mar. 15, 2001, and PCT publication number WO 01/68895, the entire
disclosures of each of which are incorporated herein by reference).
However, the V223H alteration decreases the thermostability of this
enzyme. One mutant was identified, K152M, which suppress the
destabilizing effect of enzymes having the V223H mutation. Thus,
the invention includes M-MLV reverse transcriptase which contain
alterations at positions K152 and V223 and exhibit both increased
fidelity and increased thermostability. Specific examples of such
reverse transcriptases are those in which K152 is replaced with
methionine and V223 is replaced with histidine. Other reverse
transcriptases (e.g., AMV reverse transcriptase, HIV reverse
transcriptase, RSV reverse transcriptase, etc.) with corresponding
alterations are also included within the scope of the
invention.
[0190] SUPERSCRIPT.TM. II is an RNase H- reverse transcriptase from
M-MLV which has the following substitutions: D524G, E562Q, and
D583N (see U.S. Pat. Nos. 5,017,492, 5,244,797, 5,405,776,
5,668,005, and 6,063,608, the entire disclosures of which are
incorporated herein by reference). The invention includes reverse
transcriptases that contain alterations, such as those reference
positions (i.e., 524, 562, and/or 583) or equivalent positions.
[0191] One or more amino acid substitutions are made at one or more
selected positions for any reverse transcriptase of interest. Thus,
the amino acids at the selected positions may be substituted with
any other amino acid including Ala, Arg, Asn, Asp, Cys, Gln, Glu,
Gly, His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, and
Val. In some preferred embodiments, the selected amino acid will be
a non-charged surface residue and will be replaced by a charged
residue. In some preferred embodiments, the non-charged surface
residue may be replaced by a positively charged amino acid (e.g.,
lysine or arginine). In one aspect, a charged residue will be
replaced with an un-charged residue. In one aspect, a non-charged
residue will be replaced with a negatively charged residue. In
another aspect, a negatively charged residue will be replaced with
a positively charged residue and/or a positively charged residue
will be replaced with a negatively charged residue.
[0192] The corresponding positions of M-MLV reverse transcriptase
identified above may be readily identified for other reverse
transcriptases by one with skill in the art. Thus, given the
defined region and the assays described in the present application,
one with skill in the art can make one or a number of modifications
which would result in increased thermostability and/or other
desired features of any reverse transcriptase of interest. Residues
to be modified in accordance with the present invention may include
those listed in Table 1 above.
[0193] The nucleotide sequences for M-MLV reverse transcriptase
(Shinnick et al., 1981, Nature 293:543-548; Georgiadis et al.,
1995, Structure 3:879-892), AMV reverse transcriptase (Joliot et
al., 1993, Virology 195:812-819), RSV reverse transcriptase
(Schwartz et al., 1983, Cell 32:853-859), and HIV reverse
transcriptase (Wong-Staal et al., 1985, Nature 313:277-284) are
known and are incorporated herein by reference in their
entirety.
[0194] Preferably, oligonucleotide directed mutagenesis is used to
create the mutant reverse transcriptases which allows for all
possible classes of base pair changes at any determined site along
the encoding DNA molecule.
Enhancing Expression of Reverse Transcriptases
[0195] To optimize expression of reverse transcriptases of the
present invention, inducible or constitutive promoters are well
known and may be used to express high levels of a reverse
transcriptase structural gene in a recombinant host. Similarly,
high copy number vectors, well known in the art, may be used to
achieve high levels of expression. Vectors having an inducible high
copy number may also be useful to enhance expression of the reverse
transcriptases of the invention in a recombinant host.
[0196] To express the desired structural gene in a prokaryotic cell
(such as E. coli, B. subtilis, Pseudomonas, etc.), it is preferable
to operably link the desired structural gene to a functional
prokaryotic promoter. However, the natural promoter of the reverse
transcriptase gene may function in prokaryotic hosts allowing
expression of the reverse transcriptase gene. Thus, the natural
promoter or other promoters may be used to express the reverse
transcriptase gene. Such other promoters that may be used to
enhance expression include constitutive or regulatable (i.e.,
inducible or derepressible) promoters. Examples of constitutive
promoters include the int promoter of bacteriophage .lamda., and
the bla promoter of the .beta.-lactamase gene of pBR322. Examples
of inducible prokaryotic promoters include the major right and left
promoters of bacteriophage .lamda. (P.sub.R and P.sub.L), trp,
recA, lacZ, lac, tet, gal, trc, ara BAD (Guzman, et al., 1995, J.
Bacteriol. 177(14):4121-4130) and tac promoters of E. coli. The B.
subtilis promoters include .alpha.-amylase (Ulmanen et al., J.
Bacteriol 162:176-182 (1985)) and Bacillus bacteriophage promoters
(Gryczan, T., In: The Molecular Biology Of Bacilli, Academic Press,
New York (1982)). Streptomyces promoters are described by Ward et
al., Mol. Gen. Genet. 203:468478 (1986)). Prokaryotic promoters are
also reviewed by Glick, J. Ind. Microbiol. 1:277-282 (1987);
Cenatiempto, Y., Biochimie 68:505-516 (1986); and Gottesman, Ann.
Rev. Genet. 18:415-442 (1984). Expression in a prokaryotic cell
also requires the presence of a ribosomal binding site upstream of
the gene-encoding sequence. Such ribosomal binding sites are
disclosed, for example, by Gold et al., Ann. Rev. Microbiol.
35:365404 (1981).
[0197] To enhance the expression of polymerases of the invention in
a eukaryotic cell, well known eukaryotic promoters and hosts may be
used. Enhanced expression of the polymerases may be accomplished in
a prokaryotic host. One example of a prokaryotic host suitable for
use with the present invention is Escherichia coli.
Isolation and Purification of Reverse Transcriptases
[0198] The enzyme(s) of the present invention is preferably
produced by growth in culture of the recombinant host containing
and expressing the desired reverse transcriptase gene. However, the
reverse transcriptase of the present invention may be isolated from
any strain, organism, or tissue which produces the reverse
transcriptase of the present invention. Fragments of the reverse
transcriptase are also included in the present invention. Such
fragments include proteolytic fragments and fragments having
reverse transcriptase activity. Such fragments may also be produced
by cloning and expressing portions of the reverse transcriptase
gene of interest, creating frame shift mutations and/or by adding
one or more stop codons in the gene of interest for expression of a
truncated protein or polypeptide. Preferably, polypeptides of the
invention may be purified and/or isolated from a cell or organism
expressing them, which may be a wild type cell or organism or a
recombinant cell or organism. In some embodiments, such
polypeptides may be substantially isolated from the cell or
organism in which they are expressed.
[0199] Any nutrient that can be assimilated by a host containing
the cloned reverse transcriptase gene may be added to the culture
medium. Optimal culture conditions should be selected case by case
according to the strain used and the composition of the culture
medium. Antibiotics may also be added to the growth media to insure
maintenance of vector DNA containing the desired gene to be
expressed. Media formulations have been described in DSM or ATCC
Catalogs and Sambrook et al., In: Molecular Cloning, a Laboratory
Manual (2nd ed.), Cold Spring Harbor Laboratory Press, Cold Spring
Harbor, N.Y. (1989).
[0200] Recombinant host cells producing the reverse transcriptases
of this invention can be separated from liquid culture, for
example, by centrifugation. In general, the collected microbial
cells are dispersed in a suitable buffer, and then broken open by
ultrasonic treatment or by other well known procedures to allow
extraction of the enzymes by the buffer solution. After removal of
cell debris by ultracentrifugation or centrifugation, the reverse
transcriptases can be purified by standard protein purification
techniques such as extraction, precipitation, chromatography,
affinity chromatography, electrophoresis or the like. Assays to
detect the presence of the reverse transcriptase during
purification are well known in the art and can be used during
conventional biochemical purification methods to determine the
presence of these enzymes.
[0201] In some embodiments, reverse transcriptases of the present
invention may be modified to contain an affinity tag in order to
facilitate the purification of the reverse transcriptase. Suitable
affinity tags are well known to those skilled in the art and
include, but are not limited to, repeated sequences of amino acids
such as six histidines, epitopes such as the hemagglutinin epitope
and the myc epitope, and other amino acid sequences that permit the
simplified purification of the reverse transcriptase.
[0202] The invention further relates to fusion proteins comprising
(1) a protein, or fragment thereof, having one or more activity
associated with a reverse transcriptase and (2) a tag (e.g., an
affinity tag). In particular embodiments, the invention includes a
reverse transcriptase (e.g., a thermostable reverse transcriptase)
described herein having one or more (e.g., one, two, three, four,
five, six, seven, eight, etc.) tags. These tags may be located, for
example, (1) at the N-terminus, (2) at the C-terminus, or (3) at
both the N-terminus and C-terminus of the protein, or a fragment
thereof having one or more activities associated with a reverse
transcriptase. A tag may also be located internally (e.g., between
regions of amino acid sequence derived from a reverse transcriptase
and/or attached to an amino acid side chain). For example, Ferguson
et al., Protein Sci. 7:1636-1638 (1998), describe a siderophore
receptor, FhuA, from Escherichia coli into which an affinity tag
(i.e., a hexahistidine sequence) was inserted. This tag was shown
to function in purification protocols employing metal chelate
affinity chromatography. Additional fusion proteins with internal
tags are described in U.S. Pat. No. 6,143,524, the entire
disclosure of which is incorporated herein by reference.
[0203] Tags used to prepare compositions of the invention may vary
in length but will typically be from about 5 to about 500, from
about 5 to about 100, from about 10 to about 100, from about 15 to
about 100, from about 20 to about 100, from about 25 to about 100,
from about 30 to about 100 from about 35 to about 100, from about
40 to about 100, from about 45 to about 100, from about 50 to about
100, from about 55 to about 100, from about 60 to about 100, from
about 65 to about 100, from about 70 to about 100, from about 75 to
about 100, from about 80 to about 100, from about 85 to about 100,
from about 90 to about 100, from about 95 to about 100, from about
5 to about 80, from about 10 to about 80, from about 20 to about
80, from about 30 to about 80, from about 40 to about 80, from
about 50 to about 80, from about 60 to about 80, from about 70 to
about 80, from about 5 to about 60, from about 10 to about 60, from
about 20 to about 60, from about 30 to about 60, from about 40 to
about 60, from about 50 to about 60, from about 5 to about 40, from
about 10 to about 40, from about 20 to about 40, from about 30 to
about 40, from about 5 to about 30, from about 10 to about 30, from
about 20 to about 30, from about 5 to about 25, from about 10 to
about 25, or from about 15 to about 25 amino acid residues in
length.
[0204] Tags used to prepare compositions of the invention include
those which contribute to the thermostability of the fusion
protein. Thus, these tags may be at least partly responsible, for
example, for a particular protein (e.g., a protein having one or
more activities of a reverse transcriptase activity) having
increased thermostability. Examples of tags that enhance the
thermostability of a reverse transcriptase (i.e., M-MLV reverse
transcriptase) include, but are not limited to, tags having the
following amino acid sequences: MGGSHHHHHHGMASMTGGQQMGRDLYDDDDKH,
which corresponds to amino acids 1-32 of the sequence set forth in
SEQ ID NO:2 and Table 3, and MASGTGGQQMGRDLYDDDDKH, (SEQ ID NO:3).
Fragments of these tags may also be used in accordance with the
invention (preferably those having 3 or more, 5 or more, 10 or
more, or 15 or more amino acids) Thus, the invention includes, in
part, reverse transcriptases, or fragments thereof that comprise
tags and demonstrate enhanced thermostability. Using well known
methods, one of skill in the art can attach one or more of
above-mentioned tags to one or more RT enzymes, or fragments
thereof having reverse transcriptase activity, to produce a
thermostable RT enzyme or fragment thereof. Suitable RT enzymes
include, but are not limited to, retroviral reverse transcriptase,
retrotransposon reverse transcriptase, hepatitis B reverse
transcriptase, cauliflower mosaic virus reverse transcriptase,
bacterial reverse transcriptase, Tth DNA polymerase, Taq DNA
polymerase (Saiki, R. K., et al., Science 239:487-491 (1988); U.S.
Pat. Nos. 4,889,818 and 4,965,188), Tne DNA polymerase (PCT
Publication No. WO 96/10640), Tma DNA polymerase (U.S. Pat. No.
5,374,553) and mutants, fragments, variants or derivatives thereof
(see, e.g., commonly owned U.S. Pat. Nos. 5,948,614 and 6,015,668,
which are incorporated by reference herein in their entireties).
Reverse transcriptases for use in the invention also include
retroviral reverse transcriptases such as M-MLV reverse
transcriptase, AMV reverse transcriptase, RSV reverse
transcriptase, RAV reverse transcriptase, MAV reverse
transcriptase, and generally ASLV reverse transcriptases.
[0205] Tags used in the practice of the invention may serve any
number of purposes and a number of tags may be added to impart one
or more different functions to the reverse transcriptase of the
invention. For example, tags may (1) contribute to protein-protein
interactions both internally within a protein and with other
protein molecules, (2) make the protein amenable to particular
purification methods, (3) enable one to identify whether the
protein is present in a composition; or (4) give the protein other
functional characteristics.
[0206] Examples of tags which may be used in the practice of the
invention include metal binding domains (e.g., a poly-histidine
segments such as a three, four, five, six, or seven histidine
region), immunoglobulin binding domains (e.g., (1) Protein A; (2)
Protein G; (3) T cell, B cell, and/or Fc receptors; and/or (4)
complement protein antibody-binding domain); sugar binding domains
(e.g., a maltose binding domain, chitin-binding domain); and
detectable domains (e.g., at least a portion of
beta-galactosidase). Fusion proteins may contain one or more tags
such as those described above. Typically, fusion proteins that
contain more than one tag will contain these tags at one terminus
or both termini (i.e., the N-terminus and the C-terminus) of the
reverse transcriptase, although one or more tags may be located
internally instead of or in addition to those present at termini.
Further, more than one tag may be present at one terminus,
internally and/or at both termini of the reverse transcriptase. For
example, three consecutive tags could be linked end-to-end at the
N-terminus of the reverse transcriptase. The invention further
include compositions and reaction mixture which contain the above
fusion proteins, as well as methods for preparing these fusion
proteins, nucleic acid molecules (e.g., vectors) which encode these
fusion proteins and recombinant host cells which contain these
nucleic acid molecules. The invention also includes methods for
using these fusion proteins as described elsewhere herein (e.g.,
methods for reverse transcribing nucleic acid molecules).
[0207] Tags which enable one to identify whether the fusion protein
is present in a composition include, for example, tags which can be
used to identify the protein in an electrophoretic gel. A number of
such tags are known in the art and include epitopes and antibody
binding domains which can be used for Western blots.
[0208] The amino acid composition of the tags for use in the
present invention may vary. In some embodiments, a tag may contain
from about 1% to about 5% amino acids that have a positive charge
at physiological pH, e.g., lysine, arginine, and histidine, or from
about 5% to about 10% amino acids that have a positive charge at
physiological pH, or from about 10% to about 20% amino acids that
have a positive charge at physiological pH, or from about 10% to
about 30% amino acids that have a positive charge at physiological
pH, or from about 10% to about 50% amino acids that have a positive
charge at physiological pH, or from about 10% to about 75% amino
acids that have a positive charge at physiological pH. In some
embodiments, a tag may contain from about 1% to about 5% amino
acids that have a negative charge at physiological pH, e.g.,
aspartic acid and glutamic acid, or from about 5% to about 10%
amino acids that have a negative charge at physiological pH, or
from about 10% to about 20% amino acids that have a negative charge
at physiological pH, or from about 10% to about 30% amino acids
that have a negative charge at physiological pH, or from about 10%
to about 50% amino acids that have a negative charge at
physiological pH, or from about 10% to about 75% amino acids that
have a negative charge at physiological pH. In some embodiments, a
tag may comprise a sequence of amino acids that contains two or
more contiguous charged amino acids that may be the same or
different and may be of the same or different charge. For example,
a tag may contain a series (e.g., two, three, four, five, six, ten
etc.) of positively charged amino acids that may be the same or
different. A tag may contain a series (e.g., two, three, four,
five, six, ten etc.) of negatively charged amino acids that may be
the same or different. In some embodiments, a tag may contain a
series (e.g., two, three, four, five, six, ten etc.) of alternating
positively charged and negatively charged amino acids that may be
the same or different (e.g., positive, negative, positive,
negative, etc.). Any of the above-described series of amino acids
(e.g., positively charged, negatively charged or alternating
charge) may comprise one or more neutral polar or non-polar amino
acids (e.g., two, three, four, five, six, ten etc.) spaced between
the charged amino acids. Such neutral amino acids may be evenly
distributed through out the series of charged amino acids (e.g.,
charged, neutral, charged, neutral) or may be unevenly distributed
throughout the series (e.g., charged, a plurality of neutral,
charged, neutral, a plurality of charged, etc.). In some
embodiments, tags to be attached to the polypeptides of the
invention may have an overall charge at physiological pH (e.g.,
positive charge or negative charge). The size of the overall charge
may vary, for example, the tag may contain a net plus one, two,
three, four, five, etc. or may possess a net negative one, two,
three, four, five, etc. The present invention also relates to
reverse transcriptases (e.g., thermostable reverse transcriptases)
comprising one or more of the above-described tag sequences,
vectors encoding such reverse transcriptases, host cells reaction
mixture, compositions and reaction mixtures comprising such reverse
transcriptases, as well as kits comprising containers containing
such reverse transcriptases.
[0209] In some embodiments, it may be desirable to remove all or a
portion of a tag sequence from a fusion protein comprising a tag
sequence and a sequence having reverse transcriptase (RT) activity.
In embodiments of this type, one or more amino acids forming a
cleavage site, e.g., for a protease enzyme, may be incorporated
into the primary sequence of the fusion protein. The cleavage site
may be located such that cleavage at the site may remove all or a
portion of the tag sequence from the fusion protein. In some
embodiments, the cleavage site may be located between the tag
sequence and the sequence having RT activity such that all of the
tag sequence is removed by cleavage with a protease enzyme that
recognizes the cleavage site. Examples of suitable cleavage sites
include, but are not limited to, the Factor Xa cleavage site having
the sequence Ile-Glu-Gly-Arg (SEQ ID NO:4), which is recognized and
cleaved by blood coagulation factor Xa, and the thrombin cleavage
site having the sequence Leu-Val-Pro-Arg (SEQ ID NO:5), which is
recognized and cleaved by thrombin. Other suitable cleavage sites
are known to those skilled in the art and may be used in
conjunction with the present invention.
[0210] The reverse transcriptases of the invention preferably have
specific activities (e.g., RNA-directed DNA polymerase activity
and/or RNase H activity) greater than about 5 units/mg, more
preferably greater than about 50 units/mg, still more preferably
greater than about 100 units/mg, 250 units/mg, 500 units/mg, 1000
units/mg, 5000 units/mg or 10,000 units/mg, and most preferably
greater than about 15,000 units/mg, greater than about 16,000
units/mg, greater than about 17,000 units/mg, greater than about
18,000 units/mg, greater than about 19,000 units/mg and greater
than about 20,000 units/mg. In some embodiments, the reverse
transcriptases of the present invention may have specific
activities greater than about 50,000 units/mg, greater than about
100,000 units/mg, greater than about 150,000 units/mg, greater than
about 200,000 units/mg, greater than about 250,000 units/mg and
greater than about 300,000 units/mg. Preferred ranges of specific
activities for the reverse transcriptases of the invention include
a specific activity from about 5 units/mg to about 750,000
units/mg, a specific activity from about 5 units/mg to about
500,000 units/mg, from about 5 units/mg to about 300,000 units/mg,
a specific activity of from about 50 units/mg to about 750,000
units/mg, a specific activity from about 100 units/mg to about
750,000 units/mg, a specific activity from about 250 units/mg to
about 750,000 units/mg, a specific activity from about 500 units/mg
to about 750,000 units/mg, a specific activity from about 1000
units/mg to about 750,000 units/mg, a specific activity from about
5000 units/mg to about 750,000 units/mg, a specific activity from
about 10,000 units/mg to about 750,000 units/mg, a specific
activity from about 25,000 units/mg to about 750,000 units/mg, a
specific activity from about 100 units/mg to about 500 units/mg, a
specific activity from about 100 units/mg to about 400 units/mg,
and a specific activity from about 200 units/mg to about 500
units/mg. Other preferred ranges of specific activities include a
specific activity of from about 200,000 units/mg to about 350,000
units/mg, a specific activity from about 225,000 units/mg to about
300,000 units/mg, a specific activity from about 250,000 units/mg
to about 300,000 units/mg, a specific activity of from about
200,000 units/mg to about 750,000 units/mg, a specific activity of
from about 200,000 units/mg to about 500,000 units/mg, a specific
activity of from about 200,000 units/mg to about 400,000 units/mg,
a specific activity of from about 250,000 units/mg to about 750,000
units/mg, a specific activity of from about 250,000 units/mg to
about 500,000 units/mg, and a specific activity of from about
250,000 units/mg to about 400,000 units/mg. Preferably, the lower
end of the specific activity range may vary from 50, 100, 200, 300,
400, 500, 700, 900, 1,000, 5,000, 10,000, 20,000, 30,000, 35,000,
40,000, 45,000, 50,000, 55,000, 60,000, 65,000, 70,000, 75,000, and
80,000 units/mg, while the upper end of the range may vary from
750,000, 650,000, 600,000, 550,000, 500,000, 450,000, 400,000,
350,000, 300,000, 250,000, 200,000, 150,000, 140,000, 130,000,
120,000, 110,000, 100,000, and 90,000 units/mg. Specific activity
may be determined using enzyme assays and protein assays well known
in the art. DNA polymerase assays and RNase H assays are described,
for example, in U.S. Pat. No. 5,244,797 and WO 98/47912. In some
embodiments of the present invention, the specific activity of the
thermostable reverse transcriptase prepared in accordance with the
present invention may be higher than the specific activity of a
non-thermostable reverse transcriptase. In some embodiments, the
specific activity of the thermostable reverse transcriptase may be
5%, 10,%, 15%, 20%, 25%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% or
more higher than the specific activity of a corresponding
non-thermostable reverse transcriptase. In some preferred
embodiments, the specific activity of the thermostable reverse
transcriptase according to the present invention may be 30% or more
higher than the specific activity of a corresponding
non-thermostable reverse transcriptase. In accordance with the
invention, specific activity is a measurement of the enzymatic
activity (in units) of the protein or enzyme relative to the total
amount of protein or enzyme used in a reaction. The measurement of
a specific activity may be determined by standard techniques
well-known to one of ordinary skill in the art.
[0211] The reverse transcriptases of the invention may be used to
make nucleic acid molecules from one or more templates. Such
methods comprise mixing one or more nucleic acid templates (e.g.,
mRNA, and more preferably a population of mRNA molecules) with one
or more of the reverse transcriptases of the invention and
incubating the mixture under conditions sufficient to make one or
more nucleic acid molecules complementary to all or a portion of
the one or more nucleic acid templates.
[0212] The invention also relates to methods for the amplification
of one or more nucleic acid molecules comprising mixing one or more
nucleic acid templates with one of the reverse transcriptases of
the invention, and incubating the mixture under conditions
sufficient to amplify one or more nucleic acid molecules
complementary to all or a portion of the one or more nucleic acid
templates. Such amplification methods may further comprise the use
of one or more DNA polymerases and may be employed as in standard
RT-PCR reactions.
[0213] The invention also concerns methods for the sequencing of
one or more nucleic acid molecules comprising (a) mixing one or
more nucleic acid molecules to be sequenced with one or more primer
nucleic acid molecules, one or more reverse transcriptases of the
invention, one or more nucleotides and one or more terminating
agents; (b) incubating the mixture under conditions sufficient to
synthesize a population of nucleic acid molecules complementary to
all or a portion of the one or more nucleic acid molecules to be
sequenced; and (c) separating the population of nucleic acid
molecules to determine the nucleotide sequence of all or a portion
of the one or more nucleic acid molecules to be sequenced.
[0214] The invention also concerns nucleic acid molecules produced
by such methods (which may be full-length cDNA molecules), vectors
(particularly expression vectors) comprising these nucleic acid
molecules and host cells comprising these vectors and nucleic acid
molecules.
Sources of DNA Polymerase
[0215] A variety of DNA polymerases are useful in accordance with
the present invention. Such polymerases include, but are not
limited to, Thermus thermophilus (Tth) DNA polymerase, Thermus
aquaticus (Taq) DNA polymerase, Thermotoga neapolitana (Tne) DNA
polymerase, Thermotoga maritima (Tma) DNA polymerase, Thermococcus
litoralis (Tli or VENT.TM.) DNA polymerase, Thermococcus
kodakaraensis KOD1 DNA Polymerase, Pyrococcus furiosis (Pfu) DNA
polymerase, Pyrococcus species GB-D (DEEPVENT.TM.) DNA polymerase,
Pyrococcus woosii (Pwo) DNA polymerase, Bacillus sterothermophilus
(Bst) DNA polymerase, Bacillus caldophilus (Bca) DNA polymerase,
Sulfolobus acidocaldarius (Sac) DNA polymerase, Thermoplasma
acidophilum (Tac) DNA polymerase, Thermus flavus (Tfl/Tub) DNA
polymerase, Thermus ruber (Tru) DNA polymerase, Thermus brockianus
(DYNAZYME.TM.) DNA polymerase, Methanobacterium thermoautotrophicum
(Mth) DNA polymerase, Mycobacterium spp. DNA polymerase (Mtb,
Mlep), and mutants, variants and derivatives thereof.
[0216] DNA polymerases used in accordance with the invention may be
any enzyme that can synthesize a DNA molecule from a nucleic acid
template, typically in the 5' to 3' direction. Such polymerases may
be mesophilic or thermophilic, but are preferably thermophilic.
Mesophilic polymerases include T5 DNA polymerase, T7 DNA
polymerase, Klenow fragment DNA polymerase, DNA polymerase III, and
the like. Preferred DNA polymerases are thermostable DNA
polymerases such as Taq, Tne, Tma, Pfu, VENT.TM., DEEPVENT.TM., Tth
and mutants, variants and derivatives thereof (U.S. Pat. No.
5,436,149; U.S. Pat. No. 5,512,462; PCT Publication No. WO
92/06188; PCT Publication No. WO 92/06200; PCT Publication No. WO
96/10640; Barnes, W. M., Gene 112:29-35 (1992); Lawyer, F. C., et
al., PCR Meth. Appl. 2:275-287 (1993); Flaman, J.-M., et al., Nucl.
Acids Res. 22(15):3259-3260 (1994)). For amplification of long
nucleic acid molecules (e.g., nucleic acid molecules longer than
about 3-5 Kb in length), at least two DNA polymerases (one
substantially lacking 3' exonuclease activity and the other having
3' exonuclease activity) are typically used. See U.S. Pat. No.
5,436,149; U.S. Pat. No. 5,512,462; Barnes, W. M., Gene 112:29-35
(1992); PCT Publication No. WO 98/06736; and commonly owned,
co-pending U.S. patent application Ser. No. 08/801,720, filed Feb.
14, 1997, the disclosures of all of which are incorporated herein
in their entireties. Examples of DNA polymerases substantially
lacking in 3' exonuclease activity include, but are not limited to,
Taq, Tne(exo.sup.-), Tma, Pfu(exo.sup.-), Pwo and Tth DNA
polymerases, and mutants, variants and derivatives thereof.
Nonlimiting examples of DNA polymerases having 3' exonuclease
activity include Pfu, DEEPVENT.TM. and Tli/VENT.TM. and mutants,
variants and derivatives thereof.
Formulation of Compositions and Reaction Mixtures
[0217] To form the compositions of the present invention, one or
more reverse transcriptases are preferably admixed in a buffered
salt solution. One or more DNA polymerases and/or one or more
nucleotides, and/or one or more primers may optionally be added to
make the compositions of the invention. More preferably, the
enzymes are provided at working concentrations in stable buffered
salt solutions. The terms "stable" and "stability" as used herein
generally mean the retention by a composition, such as an enzyme
composition, of at least 70%, preferably at least 80%, and most
preferably at least 90%, of the original enzymatic activity (in
units) after the enzyme or composition containing the enzyme has
been stored for about one week at a temperature of about 4.degree.
C., about two to six months at a temperature of about -20.degree.
C., and about six months or longer at a temperature of about
-80.degree. C. As used herein, the term "working concentration"
means the concentration of an enzyme that is at or near the optimal
concentration used in a solution to perform a particular function
(such as reverse transcription of nucleic acids).
[0218] The water used in forming the compositions of the present
invention is preferably distilled, deionized and sterile filtered
(through a 0.1-0.2 micrometer filter), and is free of contamination
by DNase and RNase enzymes. Such water is available commercially,
for example from Sigma Chemical Company (Saint Louis, Mo.), or may
be made as needed according to methods well known to those skilled
in the art.
[0219] In addition to the enzyme components, the present
compositions preferably comprise one or more buffers and cofactors
necessary for synthesis of a nucleic acid molecule such as a cDNA
molecule. Particularly preferred buffers for use in forming the
present compositions are the acetate, sulfate, hydrochloride,
phosphate or free acid forms of Tris-(hydroxymethyl)aminomethane
(TRIS.RTM.), although alternative buffers of the same approximate
ionic strength and pKa as TRIS.RTM. may be used with equivalent
results. In addition to the buffer salts, cofactor salts such as
those of potassium (preferably potassium chloride or potassium
acetate) and magnesium (preferably magnesium chloride or magnesium
acetate) are included in the compositions. Addition of one or more
carbohydrates and/or sugars to the compositions and/or synthesis
reaction mixtures may also be advantageous, to support enhanced
stability of the compositions and/or reaction mixtures upon
storage. Preferred such carbohydrates or sugars for inclusion in
the compositions and/or synthesis reaction mixtures of the
invention include, but are not limited to, sucrose, trehalose,
glycerol, and the like. Furthermore, such carbohydrates and/or
sugars may be added to the storage buffers for the enzymes used in
the production of the enzyme compositions and kits of the
invention. Such carbohydrates and/or sugars are commercially
available from a number of sources, including Sigma (St. Louis,
Mo.).
[0220] It is often preferable to first dissolve the buffer salts,
cofactor salts and carbohydrates or sugars at working
concentrations in water and to adjust the pH of the solution prior
to addition of the enzymes. In this way, the pH-sensitive enzymes
will be less subject to acid- or alkaline-mediated inactivation
during formulation of the present compositions.
[0221] To formulate the buffered salts solution, a buffer salt
which is preferably a salt of Tris(hydroxymethyl)aminomethane
(TRIS.RTM.), and most preferably the hydrochloride salt thereof, is
combined with a sufficient quantity of water to yield a solution
having a TRIS.RTM. concentration of 5-150 millimolar, preferably
10-60 millimolar, and most preferably about 20-60 millimolar. To
this solution, a salt of magnesium (preferably either the chloride
or acetate salt thereof) or other divalent cation, may be added to
provide a working concentration thereof of 1-10 millimolar,
preferably 1.5-8.0 millimolar, and most preferably about 3-7.5
millimolar. A salt of potassium (preferably a chloride or acetate
salt of potassium), or other monovalent cation (e.g., Na), may also
be added to the solution, at a working concentration of 10-100
millimolar and most preferably about 75 millimolar. A reducing
agent, such as dithiothreitol, may be added to the solution,
preferably at a final concentration of about 1-100 mM, more
preferably a concentration of about 5-50 mM or about 7.5-20 mM, and
most preferably at a concentration of about 10 mM. Preferred
concentrations of carbohydrates and/or sugars for inclusion in the
compositions of the invention range from about 5% (w/v) to about
30% (w/v), from about 7.5% (w/v) to about 25% (w/v), from about 10%
(w/v) to about 25% (w/v), from about 10% (w/v) to about 20% (w/v),
and preferably from about 10% (w/v) to about 15% (w/v). A small
amount of a salt of ethylenediaminetetraacetate (EDTA), such as
disodium EDTA, may also be added (preferably about 0.1 millimolar),
although inclusion of EDTA does not appear to be essential to the
function or stability of the compositions of the present invention.
After addition of all buffers and salts, this buffered salt
solution is mixed well until all salts are dissolved, and the pH is
adjusted using methods known in the art to a pH value of from about
7.4 to about 9.2, preferably from about 8.0 to about 9.0, and most
preferably to about 8.4.
[0222] To these buffered salt solutions, the enzymes (reverse
transcriptases and/or DNA polymerases) are added to produce the
compositions of the present invention. M-MLV reverse transcriptases
are preferably added at a working concentration in the solution of
from about 1,000 to about 50,000 units per milliliter, from about
2,000 to about 30,000 units per milliliter, from about 2,500 to
about 25,000 units per milliliter, from about 3,000 to about 22,500
units per milliliter, from about 4,000 to about 20,000 units per
milliliter, and most preferably at a working concentration of from
about 5,000 to about 20,000 units per milliliter. In some
embodiments, a reverse transcriptases of the invention (e.g., an
M-MLV reverse transcriptase) may be added at a working
concentration described above in a first strand reaction mixture
(e.g., a reaction to reverse transcribe an mRNA molecule) and/or in
a couple RT/PCR. A suitable concentration of a reverse
transcriptase of the invention for these reactions may be from
about 5,000 units/ml to about 50,000 units/ml, from about 5,000
units/ml to about 40,000 units/ml, from about 5,000 units/ml to
about 30,000 units/ml, or from about 5,000 units/ml to about 20,000
units/ml of reverse transcriptase. A reaction may be conducted in a
volume of 20 .mu.l to 50 .mu.l and such a reaction may contain 50
units, 100, units, 200 units, 300 units, 400 units or more of a
reverse transcriptase of the invention. Those skilled in the art
will appreciate that adding additional reverse transcriptase may
allow increased synthesis of the first strand (e.g., the DNA strand
complementary to the mRNA strand) at the expense of increased
enzyme usage. The skilled artisan can determine without undue
experimentation the amount of a reverse transcriptase of the
invention to add to a reaction in order to produce a desired amount
of product at an acceptable expense.
[0223] AMV reverse transcriptases, RSV reverse transcriptases and
HIV reverse transcriptases, including those of the invention
described above, are preferably added at a working concentration in
the solution of from about 100 to about 5000 units per milliliter,
from about 125 to about 4000 units per milliliter, from about 150
to about 3000 units per milliliter, from about 200 to about 2500
units per milliliter, from about 225 to about 2000 units per
milliliter, and most preferably at a working concentration of from
about 250 to about 1000 units per milliliter. The enzymes in the
thermophilic DNA polymerase group (Taq, Tne, Tma, Pfu, VENT,
DEEPVENT, Tth and mutants, variants and derivatives thereof) are
preferably added at a working concentration in the solution of from
about 100 to about 1000 units per milliliter, from about 125 to
about 750 units per milliliter, from about 150 to about 700 units
per milliliter, from about 200 to about 650 units per milliliter,
from about 225 to about 550 units per milliliter, and most
preferably at a working concentration of from about 250 to about
500 units per milliliter. The enzymes may be added to the solution
in any order, or may be added simultaneously.
[0224] The compositions of the invention may further comprise one
or more nucleotides, which are preferably deoxynucleoside
triphosphates (dNTPs) or dideoxynucleoside triphosphates (ddNTPs).
The dNTP components of the present compositions serve as the
"building blocks" for newly synthesized nucleic acids, being
incorporated therein by the action of the polymerases, and the
ddNTPs may be used in sequencing methods according to the
invention. Examples of nucleotides suitable for use in the present
compositions include, but are not limited to, dUTP, dATP, dTTP,
dCTP, dGTP, dITP, 7-deaza-dGTP, .alpha.-thio-dATP,
.alpha.-thio-dTTP, .alpha.-thio-dGTP, .alpha.-thio-dCTP, ddUTP,
ddATP, ddTTP, ddCTP, ddGTP, ddITP, 7-deaza-ddGTP,
.alpha.-thio-ddATP, .alpha.-thio-ddTTP, .alpha.-thio-ddGTP,
.alpha.-thio-ddCTP or derivatives thereof, all of which are
available commercially from sources including Invitrogen
Corporation (Carlsbad, Calif.), New England BioLabs (Beverly,
Mass.) and Sigma Chemical Company (Saint Louis, Mo.). The
nucleotides may be unlabeled, or they may be detectably labeled by
coupling them by methods known in the art with radioisotopes (e.g.,
.sup.3H, .sup.14C, .sup.32P or .sup.35S), vitamins (e.g., biotin),
fluorescent moieties (e.g., fluorescein, rhodamine, Texas Red, or
phycoerythrin), chemiluminescent labels (e.g., using the
PHOTO-GENE.TM. or ACES.TM. chemiluminescence systems, available
commercially from Invitrogen Corporation (Carlsbad, Calif.)),
dioxigenin and the like. Labeled nucleotides may also be obtained
commercially, for example from Invitrogen Corporation (Carlsbad,
Calif.) or Sigma Chemical Company (Saint Louis, Mo.). In the
present compositions, the nucleotides are added to give a working
concentration of each nucleotide of about 10-4000 micromolar, about
50-2000 micromolar, about 100-1500 micromolar, or about 200-1200
micromolar, and most preferably a concentration of about 1000
micromolar.
[0225] To reduce component deterioration, storage of the reagent
compositions is preferably at about 4.degree. C. for up to one day,
or most preferably at -20.degree. C. for up to one year.
[0226] In another aspect, the compositions and reverse
transcriptases of the invention may be prepared and stored in dry
form in the presence of one or more carbohydrates, sugars, or
synthetic polymers. Preferred carbohydrates, sugars or polymers for
the preparation of dried compositions or reverse transcriptases
include, but are not limited to, sucrose, trehalose, and
polyvinylpyrrolidone (PVP) or combinations thereof. See, e.g., U.S.
Pat. Nos. 5,098,893, 4,891,319, and 5,556,771, the disclosures of
which are entirely incorporated herein by reference. Such dried
compositions and enzymes may be stored at various temperatures for
extended times without significant deterioration of enzymes or
components of the compositions of the invention. Preferably, the
dried reverse transcriptases or compositions are stored at
4.degree. C. or at -20.degree. C.
[0227] The invention further includes reaction solutions for
reverse transcribing nucleic acid molecules, as well as reverse
transcription methods employing such reaction solutions and product
nucleic acid molecules produced using such methods. In many
instances, reaction solutions of the invention will contain one or
more of the following components: (1) one or more buffering agent
(e.g., sodium phosphate, sodium acetate,
2-(N-moropholino)-ethanesulfonic acid (MES),
tris-(hydroxymethyl)aminomethane (Tris),
3-(cyclohexylamino)-2-hydroxy-1-propanesulfonic acid (CAPS),
citrate, N-2-hydroxyethylpiperazine-N'-2-ethanesulfonic acid
(HEPES), acetate, 3-(N-morpholino)prpoanesulfonic acid (MOPS),
N-tris(hydroxymethyl)methyl-3-aminopropanesulfonio acid (TAPS),
etc.), (2) one or more monovalent cationic salt (e.g., NaCl, KCl,
etc.), (3) one or more divalent cationic salt (e.g., MnCl.sub.2,
MgCl.sub.2, MgSO.sub.4, CaCl.sub.2, etc.), (4) one or more reducing
agent (e.g., dithiothreitol, .beta.-mercaptoethanol, etc.), (5) one
or more ioninc or non-ionic detergent (e.g., TRITON X-100.TM.,
NONIDET P40.TM., sodium dodecyl sulphate, etc.), (6) one or more
DNA polymerase inhibitor (e.g., Actinomycin D, etc.), (7)
nucleotides (e.g., dNTPs, such as dGTP, dATP, dCTP, dTTP, etc.),
(8) RNA to be reverse transcribed and/or amplified, (9) one or more
RNase inhibitor (e.g., RNASEOUT.TM., Invitrogen Corporation,
Carlsbad, Calif., catalog number 10777-019 etc.), (10) a reverse
transcriptase (e.g., a reverse transcriptase of the invention,
and/or (11) one or more diluent (e.g., water). Other components
and/or constituents (e.g., primers, DNA polymerases, etc.) may also
be present in reaction solutions.
[0228] The concentration of the buffering agent in the reaction
solutions of the invention will vary with the particular buffering
agent used. Typically, the working concentration (i.e., the
concentration in the reaction mixture) of the buffering agent will
be from about 5 mM to about 500 mM (e.g., about 10 mM, about 15 mM,
about 20 mM, about 25 mM, about 30 mM, about 35 mM, about 40 mM,
about 45 mM, about 50 mM, about 55 mM, about 60 mM, about 65 mM,
about 70 mM, about 75 mM, about 80 mM, about 85 mM, about 90 mM,
about 95 mM, about 100 mM, from about 5 mM to about 500 mM, from
about 10 mM to about 500 mM, from about 20 mM to about 500 mM, from
about 25 mM to about 500 mM, from about 30 mM to about 500 mM, from
about 40 mM to about 500 mM, from about 50 mM to about 500 mM, from
about 75 mM to about 500 mM, from about 100 mM to about 500 mM,
from about 25 mM to about 50 mM, from about 25 mM to about 75 mM,
from about 25 mM to about 100 mM, from about 25 mM to about 200 mM,
from about 25 mM to about 300 mM, etc.). When Tris (e.g., Tris-HCl)
is used, the Tris working concentration will typically be from
about 5 mM to about 100 mM, from about 5 mM to about 75 mM, from
about 10 mM to about 75 mM, from about 10 mM to about 60 mM, from
about 10 mM to about 50 mM, from about 25 mM to about 50 mM,
etc.
[0229] The final pH of solutions of the invention will generally be
set and maintained by buffering agents present in reaction
solutions of the invention. The pH of reaction solutions of the
invention, and hence reaction mixtures of the invention, will vary
with the particular use and the buffering agent present but will
often be from about pH 5.5 to about pH 9.0 (e.g., about pH 6.0,
about pH 6.5, about pH 7.0, about pH 7.1, about pH 7.2, about pH
7.3, about pH 7.4, about pH 7.5, about pH 7.6, about pH 7.7, about
pH 7.8, about pH 7.9, about pH 8.0, about pH 8.1, about pH 8.2,
about pH 8.3, about pH 8.4, about pH 8.5, about pH 8.6, about pH
8.7, about pH 8.8, about pH 8.9, about pH 9.0, from about pH 6.0 to
about pH 8.5, from about pH 6.5 to about pH 8.5, from about pH 7.0
to about pH 8.5, from about pH 7.5 to about pH 8.5, from about pH
6.0 to about pH 8.0, from about pH 6.0 to about pH 7.7, from about
pH 6.0 to about pH 7.5, from about pH 6.0 to about pH 7.0, from
about pH 7.2 to about pH 7.7, from about pH 7.3 to about pH 7.7,
from about pH 7.4 to about pH 7.6, from about pH 7.0 to about pH
7.4, from about pH 7.6 to about pH 8.0, from about pH 7.6 to about
pH 8.5, from about pH 7.7 to about pH 8.5, from about pH 7.9 to
about pH 8.5, from about pH 8.0 to about pH 8.5, from about pH 8.2
to about pH 8.5, from about pH 8.3 to about pH 8.5, from about pH
8.4 to about pH 8.5, from about pH 8.4 to about pH 9.0, from about
pH 8.5 to about pH 9.0, etc.)
[0230] As indicated, one or more monovalent cationic salts (e.g.,
NaCl, KCl, etc.) may be included in reaction solutions of the
invention. In many instances, salts used in reaction solutions of
the invention will dissociate in solution to generate at least one
species which is monovalent (e.g., Na+, K+, etc.) When included in
reaction solutions of the invention, salts will often be present
either individually or in a combined concentration of from about
0.5 mM to about 500 mM (e.g., about 1 mM, about 2 mM, about 3 mM,
about 5 mM, about 10 mM, about 12 mM, about 15 mM, about 17 mM,
about 20 mM, about 22 mM, about 23 mM, about 24 mM, about 25 mM,
about 27 mM, about 30 mM, about 35 mM, about 40 mM, about 45 mM,
about 50 mM, about 55 mM, about 60 mM, about 64 mM, about 65 mM,
about 70 mM, about 75 mM, about 80 mM, about 85 mM, about 90 mM,
about 95 mM, about 100 mM, about 120 mM, about 140 mM, about 150
mM, about 175 mM, about 200 mM, about 225 mM, about 250 mM, about
275 mM, about 300 mM, about 325 mM, about 350 mM, about 375 mM,
about 400 mM, from about 1 mM to about 500 mM, from about 5 mM to
about 500 mM, from about 10 mM to about 500 mM, from about 20 mM to
about 500 mM, from about 30 mM to about 500 mM, from about 40 mM to
about 500 mM, from about 50 mM to about 500 mM, from about 60 mM to
about 500 mM, from about 65 mM to about 500 mM, from about 75 mM to
about 500 mM, from about 85 mM to about 500 mM, from about 90 mM to
about 500 mM, from about 100 mM to about 500 mM, from about 125 mM
to about 500 mM, from about 150 mM to about 500 mM, from about 200
mM to about 500 mM, from about 10 mM to about 100 mM, from about 10
mM to about 75 mM, from about 10 mM to about 50 mM, from about 20
mM to about 200 mM, from about 20 mM to about 150 mM, from about 20
mM to about 125 mM, from about 20 mM to about 100 mM, from about 20
mM to about 80 mM, from about 20 mM to about 75 mM, from about 20
mM to about 60 mM, from about 20 mM to about 50 mM, from about 30
mM to about 500 mM, from about 30 mM to about 100 mM, from about 30
mM to about 70 mM, from about 30 mM to about 50 mM, etc.).
[0231] As indicated, one or more divalent cationic salts (e.g.,
MnCl.sub.2, MgCl.sub.2, MgSO.sub.4, CaCl.sub.2, etc.) may be
included in reaction solutions of the invention. In many instances,
salts used in reaction solutions of the invention will dissociate
in solution to generate at least one species which is monovalent
(e.g., Mg.sup.++, Mn.sup.++, Ca.sup.++, etc.) When included in
reaction solutions of the invention, salts will often be present
either individually or in a combined concentration of from about
0.5 mM to about 500 mM (e.g., about 1 mM, about 2 mM, about 3 mM,
about 4 mM, about 5 mM, about 6 mM, about 7 mM, about 8 mM, about 9
mM, about 10 mM, about 12 mM, about 15 mM, about 17 mM, about 20
mM, about 22 mM, about 23 mM, about 24 mM, about 25 mM, about 27
mM, about 30 mM, about 35 mM, about 40 mM, about 45 mM, about 50
mM, about 55 mM, about 60 mM, about 64 mM, about 65 mM, about 70
mM, about 75 mM, about 80 mM, about 85 mM, about 90 mM, about 95
mM, about 100 mM, about 120 mM, about 140 mM, about 150 mM, about
175 mM, about 200 mM, about 225 mM, about 250 mM, about 275 mM,
about 300 mM, about 325 mM, about 350 mM, about 375 mM, about 400
mM, from about 1 mM to about 500 mM, from about 5 mM to about 500
mM, from about 10 mM to about 500 mM, from about 20 mM to about 500
mM, from about 30 mM to about 500 mM, from about 40 mM to about 500
mM, from about 50 mM to about 500 mM, from about 60 mM to about 500
mM, from about 65 mM to about 500 mM, from about 75 mM to about 500
mM, from about 85 mM to about 500 mM, from about 90 mM to about 500
mM, from about 100 mM to about 500 mM, from about 125 mM to about
500 mM, from about 150 mM to about 500 mM, from about 200 mM to
about 500 mM, from about 10 mM to about 100 mM, from about 10 mM to
about 75 mM, from about 10 mM to about 50 mM, from about 20 mM to
about 200 mM, from about 20 mM to about 150 mM, from about 20 mM to
about 125 mM, from about 20 mM to about 100 mM, from about 20 mM to
about 80 mM, from about 20 mM to about 75 mM, from about 20 mM to
about 60 mM, from about 20 mM to about 50 mM, from about 30 mM to
about 500 mM, from about 30 mM to about 100 mM, from about 30 mM to
about 70 mM, from about 30 mM to about 50 mM, etc.).
[0232] When included in reaction solutions of the invention,
reducing agents (e.g., dithiothreitol, .beta.-mercaptoethanol,
etc.) will often be present either individually or in a combined
concentration of from about 0.1 mM to about 50 mM (e.g., about 0.2
mM, about 0.3 mM, about 0.5 mM, about 0.7 mM, about 0.9 mM, about 1
mM, about 2 mM, about 3 mM, about 4 mM, about 5 mM, about 6 mM,
about 10 mM, about 12 mM, about 15 mM, about 17 mM, about 20 mM,
about 22 mM, about 23 mM, about 24 mM, about 25 mM, about 27 mM,
about 30 mM, about 35 mM, about 40 mM, about 45 mM, about 50 mM,
from about 0.1 mM to about 50 mM, from about 0.5 mM to about 50 mM,
from about 1 mM to about 50 mM, from about 2 mM to about 50 mM,
from about 3 mM to about 50 mM, from about 0.5 mM to about 20 mM,
from about 0.5 mM to about 10 mM, from about 0.5 mM to about 5 mM,
from about 0.5 mM to about 2.5 mM, from about 1 mM to about 20 mM,
from about 1 mM to about 10 mM, from about 1 mM to about 5 mM, from
about 1 mM to about 3.4 mM, from about 0.5 mM to about 3.0 mM, from
about 1 mM to about 3.0 mM, from about 1.5 mM to about 3.0 mM, from
about 2 mM to about 3.0 mM, from about 0.5 mM to about 2.5 mM, from
about 1 mM to about 2.5 mM, from about 1.5 mM to about 2.5 mM, from
about 2 mM to about 3.0 mM, from about 2.5 mM to about 3.0 mM, from
about 0.5 mM to about 2 mM, from about 0.5 mM to about 1.5 mM, from
about 0.5 mM to about 1.1 mM, from about 5.0 mM to about 10 mM,
from about 5.0 mM to about 15 mM, from about 5.0 mM to about 20 mM,
from about 10 mM to about 15 mM, from about 10 mM to about 20 mM,
etc.).
[0233] Reaction solutions of the invention may also contain one or
more ioninc or non-ionic detergent (e.g., TRITON X-100.TM., NONIDET
P40.TM., sodium dodecyl sulphate, etc.). When included in reaction
solutions of the invention, detergents will often be present either
individually or in a combined concentration of from about 0.01% to
about 5.0% (e.g., about 0.01%, about 0.02%, about 0.03%, about
0.04%, about 0.05%, about 0.06%, about 0.07%, about 0.08%, about
0.09%, about 0.1%, about 0.15%, about 0.2%, about 0.3%, about 0.5%,
about 0.7%, about 0.9%, about 1%, about 2%, about 3%, about 4%,
about 5%, from about 0.01% to about 5.0%, from about 0.01% to about
4.0%, from about 0.01% to about 3.0%, from about 0.01% to about
2.0%, from about 0.01% to about 1.0%, from about 0.05% to about
5.0%, from about 0.05% to about 3.0%, from about 0.05% to about
2.0%, from about 0.05% to about 1.0%, from about 0.1% to about
5.0%, from about 0.1% to about 4.0%, from about 0.1% to about 3.0%,
from about 0.1% to about 2.0%, from about 0.1% to about 1.0%, from
about 0.1% to about 0.5%, etc.). For example, reaction solutions of
the invention may contain TRITON X-100.TM. at a concentration of
from about 0.01% to about 2.0%, from about 0.03% to about 1.0%,
from about 0.04% to about 1.0%, from about 0.05% to about 0.5%,
from about 0.04% to about 0.6%, from about 0.04% to about 0.3%,
etc.
[0234] Reaction solutions of the invention may also contain one or
more DNA polymerase inhibitor (e.g., Actinomycin D, etc.). When
included in reaction solutions of the invention, such inhibitors
will often be present either individually or in a combined
concentration of from about 0.1 .mu.g/ml to about 100 .mu.g/ml
(e.g., about 0.1 .mu.g/ml, about 0.2 .mu.g/ml, about 0.3 .mu.g/ml,
about 0.4 .mu.g/ml, about 0.5 .mu.g/ml, about 0.6 .mu.g/ml, about
0.7 .mu.g/ml, about 0.8 .mu.g/ml, about 0.9 .mu.g/ml, about 1.0
.mu.g/ml, about 1.1 .mu.g/ml, about 1.3 .mu.g/ml, about 1.5
.mu.g/ml, about 1.7 .mu.g/ml, about 2.0 .mu.g/ml, about 2.5
.mu.g/ml, about 3.5 .mu.g/ml, about 5.0 .mu.g/ml, about 7.5
.mu.g/ml, about 10 .mu.g/ml, about 15 .mu.g/ml, about 20 .mu.g/ml,
about 25 .mu.g/ml, about 30 .mu.g/ml, about 35 .mu.g/ml, about 40
.mu.g/ml, about 50 .mu.g/ml, about 60 .mu.g/ml, about 70 .mu.g/ml,
about 80 .mu.g/ml, about 90 .mu.g/ml, about 100 .mu.g/ml, from
about 0.5 .mu.g/ml to about 30 .mu.g/ml, from about 0.75 .mu.g/ml
to about 30 .mu.g/ml, from about 1.0 .mu.g/ml to about 30 .mu.g/ml,
from about 2.0 .mu.g/ml to about 30 .mu.g/ml, from about 3.0
.mu.g/ml to about 30 .mu.g/ml, from about 4.0 .mu.g/ml to about 30
.mu.g/ml, from about 5.0 .mu.g/ml to about 30 .mu.g/ml, from about
7.5 .mu.g/ml to about 30 .mu.g/ml, from about 10 .mu.g/ml to about
30 .mu.g/ml, from about 15 .mu.g/ml to about 30 .mu.g/ml, from
about 0.5 .mu.g/ml to about 20 .mu.g/ml, from about 0.5 .mu.g/ml to
about 10 .mu.g/ml, from about 0.5 .mu.g/ml to about 5 .mu.g/ml,
from about 0.5 .mu.g/ml to about 2 .mu.g/ml, from about 0.5
.mu.g/ml to about 1 .mu.g/ml, from about 1 .mu.g/ml to about 10
.mu.g/ml, from about 1 .mu.g/ml to about 5 .mu.g/ml, from about 1
.mu.g/ml to about 2 .mu.g/ml, from about 1 .mu.g/ml to about 100
.mu.g/ml, from about 10 .mu.g/ml to about 100 .mu.g/ml, from about
20 .mu.g/ml to about 100 .mu.g/ml, from about 40 .mu.g/ml to about
100 .mu.g/ml, from about 30 .mu.g/ml to about 80 .mu.g/ml, from
about 30 .mu.g/ml to about 70 .mu.g/ml, from about 40 .mu.g/ml to
about 60 .mu.g/ml, from about 40 .mu.g/ml to about 70 .mu.g/ml,
from about 40 .mu.g/ml to about 80 .mu.g/ml, etc.).
[0235] In many instances, nucleotides (e.g., dNTPs, such as dGTP,
dATP, dCTP, dTTP, etc.) will be present in reaction mixtures of the
invention. Typically, individually nucleotides will be present in
concentrations of from about 0.05 mM to about 50 mM (e.g., about
0.07 mM, about 0.1 mM, about 0.15 mM, about 0.18 mM, about 0.2 mM,
about 0.3 mM, about 0.5 mM, about 0.7 mM, about 0.9 mM, about 1 mM,
about 2 mM, about 3 mM, about 4 mM, about 5 mM, about 6 mM, about
10 mM, about 12 mM, about 15 mM, about 17 mM, about 20 mM, about 22
mM, about 23 mM, about 24 mM, about 25 mM, about 27 mM, about 30
mM, about 35 mM, about 40 mM, about 45 mM, about 50 mM, from about
0.1 mM to about 50 mM, from about 0.5 mM to about 50 mM, from about
1 mM to about 50 mM, from about 2 mM to about 0.50 mM, from about 3
mM to about 50 mM, from about 0.5 mM to about 20 mM, from about 0.5
mM to about 10 mM, from about 0.5 mM to about 5 mM, from about 0.5
mM to about 2.5 mM, from about 1 mM to about 20 mM, from about 1 mM
to about 10 mM, from about 1 mM to about 5 mM, from about 1 mM to
about 3.4 mM, from about 0.5 mM to about 3.0 mM, from about 1 mM to
about 3.0 mM, from about 1.5 mM to about 3.0 mM, from about 2 mM to
about 3.0 mM, from about 0.5 mM to about 2.5 mM, from about 1 mM to
about 2.5 mM, from about 1.5 mM to about 2.5 mM, from about 2 mM to
about 3.0 mM, from about 2.5 mM to about 3.0 mM, from about 0.5 mM
to about 2 mM, from about 0.5 mM to about 1.5 mM, from about 0.5 mM
to about 1.1 mM, from about 5.0 mM to about 10 mM, from about 5.0
mM to about 15 mM, from about 5.0 mM to about 20 mM, from about 10
mM to about 15 mM, from about 10 mM to about 20 mM, etc.). The
combined nucleotide concentration, when more than one nucleotides
is present, can be determined by adding the concentrations of the
individual nucleotides together. When more than one nucleotide is
present in reaction solutions of the invention, the individual
nucleotides may not be present in equimolar amounts. Thus, a
reaction solution may contain, for example, 1 mM dGTP, 1 mM dATP,
0.5 mM dCTP, and 1 mM dTTP.
[0236] RNA will typically be present in reaction solutions of the
invention. In most instances, RNA will be added to the reaction
solution shortly prior to reverse transcription. Thus, reaction
solutions may be provided without RNA. This will typically be the
case when reaction solutions are provided in kits. RNA, when
present in reaction solutions will often be present in a
concentration of 1 picogram to 100 .mu.g/20 .mu.l reaction mixture
(e.g., about 1 picogram/20 .mu.l, about 10 picograms/20 .mu.l,
about 50 picograms/20 .mu.l, about 100 picograms/20 .mu.l, about
200 picograms/20 .mu.l, about 10 picograms/20 .mu.l, about 500
picograms/20 .mu.l, about 800 picograms/20 .mu.l, about 1.0
nanogram/20 .mu.l, about 5.0 nanograms/20 .mu.l, about 10
nanograms/20 .mu.l, about 25 nanograms/20 .mu.l, about 50
nanograms/20 .mu.l, about 75 nanograms/20 .mu.l, about 100
nanograms/20 .mu.l, about 150 nanograms/20 .mu.l, about 250
nanograms/20 .mu.l, about 400 nanograms/20 .mu.l, about 500
nanograms/20 .mu.l, about 750 nanograms/20 .mu.l, about 1.0
.mu.g/20 .mu.l, about 5.0 .mu.g/20 .mu.l, about 10 .mu.g/20 .mu.l,
about 20 .mu.g/20 .mu.l, about 30 .mu.g/20 .mu.l, about 40 .mu.g/20
.mu.l, about 50 .mu.g/20 .mu.l, about 70 .mu.g/20 .mu.l, about 85
.mu.g/20 .mu.l, about 100 .mu.g/20 .mu.l, from about 10
picograms/20 .mu.l to about 100 .mu.g/20 .mu.l, from about 10
picograms/20 .mu.l to about 100 .mu.g/20 .mu.l, from about 100
picograms/20 .mu.l to about 100 .mu.g/20 .mu.l, from about 1.0
nanograms/20 .mu.l to about 100 .mu.g/20 .mu.l, from about 100
nanograms/20 .mu.l to about 100 .mu.g/20 .mu.l, from about 10
picograms/20 .mu.l to about 10 .mu.g/20 .mu.l, from about 10
picograms/20 .mu.l to about 5 .mu.g/20 .mu.l, from about 100
nanograms/20 .mu.l to about 5 .mu.g/20 .mu.l, from about 1 .mu.g/20
.mu.l to about 10 .mu.g/20 .mu.l, from about 1 .mu.g/20 .mu.l to
about 5 .mu.g/20 .mu.l, from about 100 nanograms/20 .mu.l to about
1 .mu.g/20 .mu.l, from about 500 nanograms/20 .mu.l to about 5
.mu.g/20 .mu.l, etc.). As one skilled in the art would recognize,
different reverse transcription reactions may be performed in
volumes other than 20 .mu.l. In such instances, the total amount of
RNA present will vary with the volume used. Thus, the above amounts
are provided as examples of the amount of RNA/20 .mu.l of reaction
solution.
[0237] Reverse transcriptases (e.g., reverse transcriptases of the
invention) may also be present in reaction solutions. When present,
reverse transcriptases, will often be present in a concentration
which results in about 0.01 to about 1,000 units of reverse
transcriptase activity/.mu.l (e.g., about 0.01 unit/.mu.l, about
0.05 unit/.mu.l, about 0.1 unit/.mu.l, about 0.2 unit/.mu.l, about
0.3 unit/.mu.l, about 0.4 unit/.mu.l, about 0.5 unit/.mu.l, about
0.7 unit/.mu.l, about 1.0 unit/.mu.l, about 1.5 unit/.mu.l, about
2.0 unit/.mu.l, about 2.5 unit/.mu.l, about 5.0 unit/.mu.l, about
7.5 unit/.mu.l, about 10 unit/.mu.l, about 20 unit/.mu.l, about 25
unit/.mu.l, about 50 unit/.mu.l, about 100 unit/.mu.l, about 150
unit/.mu.l, about 200 unit/.mu.l, about 250 unit/.mu.l, about 350
unit/.mu.l, about 500 unit/.mu.l, about 750 unit/.mu.l, about 1,000
unit/.mu.l, from about 0.1 unit/.mu.l to about 1,000 unit/.mu.l,
from about 0.2 unit/.mu.l to about 1,000 unit/.mu.l, from about 1.0
unit/.mu.l to about 1,000 unit/.mu.l, from about 5.0 unit/.mu.l to
about 1,000 unit/.mu.l, from about 10 unit/.mu.l to about 1,000
unit/.mu.l, from about 20 unit/.mu.l to about 1,000 unit/.mu.l,
from about 50 unit/.mu.l to about 1,000 unit/.mu.l, from about 100
unit/.mu.l to about 1,000 unit/.mu.l, from about 200 unit/.mu.l to
about 1,000 unit/.mu.l, from about 400 unit/.mu.l to about 1,000
unit/.mu.l, from about 500 unit/.mu.l to about 1,000 unit/.mu.l,
from about 0.1 unit/.mu.l to about 300 unit/.mu.l, from about 0.1
unit/.mu.l to about 200 unit/.mu.l, from about 0.1 unit/.mu.l to
about 100 unit/.mu.l, from about 0.1 unit/.mu.l to about 50
unit/.mu.l, from about 0.1 unit/.mu.l to about 10 unit/.mu.l, from
about 0.1 unit/.mu.l to about 5.0 unit/.mu.l, from about 0.1
unit/.mu.l to about 1.0 unit/.mu.l, from about 0.2 unit/.mu.l to
about 0.5 unit/.mu.l, etc.
[0238] Reaction solutions of the invention may be prepared as
concentrated solutions (e.g., 5.times. solutions) which are diluted
to a working concentration for final use. With respect to a
5.times. reaction solution, a 5:1 dilution is required to bring
such a 5.times. solution to a working concentration. Reaction
solutions of the invention may be prepared, for examples, as a
2.times., a 3.times., a 4.times., a 5.times., a 6.times., a
7.times., a 8.times., a 9.times., a 10.times., etc. solutions. One
major limitation on the fold concentration of such solutions is
that, when compounds reach particular concentrations in solution,
precipitation occurs. Thus, concentrated reaction solutions will
generally be prepared such that the concentrations of the various
components are low enough so that precipitation of buffer
components will not occur. As one skilled in the art would
recognize, the upper limit of concentration which is feasible for
each solution will vary with the particular solution and the
components present.
[0239] In many instances, reaction solutions of the invention will
be provided in sterile form. Sterilization may be performed on the
individual components of reaction solutions prior to mixing or on
reaction solutions after they are prepared. Sterilization of such
solutions may be performed by any suitable means including
autoclaving or ultrafiltration.
Labeling Nucleic Acids
[0240] In general, the invention provides, in part, compositions
for use in reverse transcription of a nucleic acid molecule to
produce labeled nucleic acid molecules. Such compositions may
comprise one or more reverse transcriptases (e.g., single subunit
and/or multi-subunit RTs). The enzymes in these compositions are
preferably present in working concentrations and have RNase H
activity or are reduced or substantially reduced or lacking in
RNase H activity, although mixtures of enzymes, some having RNase H
activity and some reduced or substantially reduced or lacking in
RNase H activity, may be used in the compositions of the invention.
Preferred reverse transcriptases include M-MLV reverse
transcriptase, RSV reverse transcriptase, AMV reverse
transcriptase, RAV reverse transcriptase, MAV reverse transcriptase
and HIV reverse transcriptase or other ASLV reverse
transcriptases.
[0241] The invention is also directed to methods for reverse
transcription of one or more nucleic acid molecules comprising
mixing one or more nucleic acid templates, which is preferably RNA
or messenger RNA (mRNA) and more preferably a population of mRNA
molecules, with one or more polypeptides having reverse
transcriptase activity and incubating the mixture under conditions
sufficient to make one or more labeled nucleic acid molecules
complementary to all or a portion of the one or more templates. To
make the nucleic acid molecule or molecules complementary to the
one or more templates, at least one primer (e.g., an oligo(dT)
primer) and one or more nucleotides (a portion of which are
preferably labeled, most preferably fluorescently labeled) are used
for nucleic acid synthesis. Nucleic acid templates suitable for
reverse transcription according to this aspect of the invention
include any nucleic acid molecule, particularly those derived from
a prokaryotic or eukaryotic cell. Such cells may include normal
cells, diseased cells, transformed cells, established cells,
progenitor cells, precursor cells, fetal cells, embryonic cells,
bacterial cells, yeast cells, animal cells (including human cells),
avian cells, plant cells and the like, or tissue isolated from a
plant or an animal (e.g., human, cow, pig, mouse, sheep, horse,
monkey, canine, feline, rat, rabbit, bird, fish, insect, etc.).
Such nucleic acid molecules may also be isolated from viruses. In
some embodiments, methods of the invention result in the direct
labeling of a nucleic acid molecule by incorporation of a labeled
nucleotide (e.g., a nucleotide containing a fluorescent label). In
other methods, nucleic acid molecules are indirectly labeled by
first, incorporating a nucleotide analog containing a reactive
functionality to produce a nucleic acid containing one or more
reactive functionalities. The nucleic acid containing reactive
functionalities may subsequently be reacted with a molecule
containing a label that reacts with the functionality to attach the
label to the nucleic acid molecule. The reaction may be result in
covalent attachment of all or a portion of the label-containing
molecule to the nucleic acid molecule (e.g., chemical coupling). In
some embodiments, amine-modified NTPs (e.g., amino allyl-dUTP/UTP)
are incorporated during reverse transcription. Amino allyl-NTPs are
incorporated with similar efficiency as unmodified NTPs during
enzymatic reactions such as reverse transcription. The amine
functionality is then coupled with a dye using standard techniques.
Kits for indirect labeling of cDNA are commercially available from,
for example, Ambion, Inc., Austin, Tex. In some embodiments, the
label-containing molecule may be non-covalently bound to the
reactive functionality. For example, the reactive functionality may
be a biotin moiety and the label-containing molecule may be a
labeled (e.g., fluorescently labeled) avidin or streptavidin
molecule.
[0242] The invention also provides labeled nucleic acid molecules
produced according to the above-described methods. Such labeled
nucleic acid molecules may be single or double stranded and are
useful as detection probes. Depending on the labeled nucleotide(s)
used during synthesis, the labeled molecules may contain one or a
number of labels. Where multiple labels are used, the molecules may
comprise a number of the same or different labels. Thus, one type
or multiple different labeled nucleotides may be used during
synthesis of nucleic acid molecules to provide for the labeled
nucleic acid molecules of the invention. Such labeled nucleic acid
molecules will thus comprise one or more (e.g., two, three, four,
five, six, seven, eight, nine, ten, etc.) labeled nucleotides
(which may be the same or different).
[0243] Labeled nucleic acid molecules produced by methods of the
invention may either (1) comprise a particular numbers of labeled
nucleotides or (2) a particular percentage of the nucleotides
present in the nucleic acid molecule may be labeled. In either
instance, the concentration of labeled nucleotides present in the
reaction mixture may be adjusted, with respect to un-labeled
nucleotides, such that product nucleic acid molecules are produced
which contain (1) a particular number of labeled nucleotides or (2)
a particular percentage of label nucleotides as compared to
un-labeled nucleotides. In particular instances, from about 0.1% to
about 20%, from about 0.1% to about 15%, from about 0.1% to about
10%, from about 0.1% to about 5.0%, from about 0.1% to about 2.5%,
from about 0.1% to about 1.5%, from about 0.1% to about 1.0%, from
about 0.1% to about 0.5%, from about 2.0% to about 20%, from about
4.0% to about 20%, from about 0.5% to about 10%, from about 0.5% to
about 5%, from about 0.5% to about 2.0%, or from about 0.5% to
about 1.0% of the total nucleotides present in product nucleic acid
molecules are labeled. As one skilled in the art would recognize,
the actual number of labeled nucleotides, and thus the percentage
of nucleotides which are labeled, present in individual molecules
of a population will typically differ. In other words, different
members of populations of nucleic acid molecules will typically
contain different numbers of labeled nucleotides with the overall
average of labeled nucleotides present in each product molecule
varying with a number of factors (e.g., the ratio of labeled to
un-labeled nucleotides present in the reaction mixture). In most
instances, at least 85%, at least 90%, at least 95%, or at least
99% of the individual product nucleic acid molecules in the
population will contain labeled nucleotides which fall within a
range set out above.
[0244] In accordance with the invention, the amount of labeled
product is preferably measured based on percent incorporation of
the label of interest into synthesized product as may be determined
by one skilled in the art, although other means of measuring the
amount or efficiency of labeling of product will be recognized by
one of ordinary skill in the art. The invention provides for
enhanced or increased percent incorporation of labeled nucleotide
during synthesis of a nucleic acid molecule from a template,
preferably during synthesis of one or more cDNA molecules from RNA.
According to the invention, such enhancement or increase in percent
incorporation is preferably about equal to or greater than a
2-fold, a 5-fold, a 10-fold, a 15-fold, a 20-fold, a 25-fold, a
30-fold, a 40-fold or a 50-fold increase or enhancement in percent
incorporation compared to a standard reverse transcriptase.
[0245] The invention also provides kits for use in accordance with
the invention. Such kits comprise a carrier means, such as a box or
carton, having in close confinement therein one or more container
means, such as vials, tubes, bottles and the like, wherein the kit
comprises, in the same or different containers, one or more reverse
transcriptases. The kits of the invention may also comprise, in the
same or different containers, one or more DNA polymerases, one or
more primers, one or more suitable buffers and/or one or more
nucleotides (such as deoxynucleoside triphosphates (dNTPs) and
preferably labeled dNTPs (e.g., fluorescently labeled dNTPs)).
[0246] In some embodiments, the RTs used in the invention comprise
two or more subunits (or derivatives, variants, fragments or
mutants thereof) and preferably comprise two subunits (e.g., a
dimer or heterodimer). Two subunit reverse transcriptases typically
have an .alpha. and a .beta. subunit forming a dimer, although any
form or combination of subunits (and derivatives, variants or
mutants of such subunits) may be used. Such combinations may
include .alpha..beta., .beta..beta., .alpha..alpha. and the like.
Preferred two subunit RTs for use in the invention include RSV RT,
AMV RT, AEV RT, RAV RT, HIV RT and MAV RT, or other ASLV RTs, or
mutants, variants or derivatives thereof. In a particular
embodiment, AMV RT and/or RSV RT is used in accordance with the
invention. Preferred single subunit RTs include M-MLV reverse
transcriptase.
Production/Sources of cDNA Molecules
[0247] In accordance with the invention, cDNA molecules
(single-stranded or double-stranded) may be prepared from a variety
of nucleic acid template molecules. Preferred nucleic acid
molecules for use in the present invention include single-stranded
or double-stranded DNA and RNA molecules, as well as
double-stranded DNA:RNA hybrids. More preferred nucleic acid
molecules include messenger RNA (mRNA), transfer RNA (tRNA) and
ribosomal RNA (rRNA) molecules, although mRNA molecules are the
preferred template according to the invention.
[0248] The nucleic acid molecules that are used to prepare cDNA
molecules according to the methods of the present invention may be
prepared synthetically according to standard organic chemical
synthesis methods that will be familiar to one of ordinary skill.
More preferably, the nucleic acid molecules may be obtained from
natural sources, such as a variety of cells, tissues, organs or
organisms. Cells that may be used as sources of nucleic acid
molecules may be prokaryotic (bacterial cells, including but not
limited to those of species of the genera Escherichia, Bacillus,
Serratia, Salmonella, Staphylococcus, Streptococcus, Clostridium,
Chlamydia, Neisseria, Treponema, Mycoplasma, Borrelia, Legionella,
Pseudomonas, Mycobacterium, Helicobacter, Erwinia, Agrobacterium,
Rhizobium, Xanthomonas and Streptomyces) or eukaryotic (including
fungi (especially yeasts), plants, protozoans and other parasites,
and animals including insects (particularly Drosophila spp. cells),
nematodes (particularly Caenorhabditis elegans cells), and mammals
(particularly human cells)).
[0249] Mammalian somatic cells that may be used as sources of
nucleic acids include blood cells (reticulocytes and leukocytes),
endothelial cells, epithelial cells, neuronal cells (from the
central or peripheral nervous systems), muscle cells (including
myocytes and myoblasts from skeletal, smooth or cardiac muscle),
connective tissue cells (including fibroblasts, adipocytes,
chondrocytes, chondroblasts, osteocytes and osteoblasts) and other
stromal cells (e.g., macrophages, dendritic cells, Schwann cells).
Mammalian germ cells (spermatocytes and oocytes) may also be used
as sources of nucleic acids for use in the invention, as may the
progenitors, precursors and stem cells that give rise to the above
somatic and germ cells. Also suitable for use as nucleic acid
sources are mammalian tissues or organs such as those derived from
brain, kidney, liver, pancreas, blood, bone marrow, muscle,
nervous, skin, genitourinary, circulatory, lymphoid,
gastrointestinal and connective tissue sources, as well as those
derived from a mammalian (including human) embryo or fetus.
[0250] Any of the above prokaryotic or eukaryotic cells, tissues
and organs may be normal, diseased, transformed, established,
progenitors, precursors, fetal or embryonic. Diseased cells may,
for example, include those involved in infectious diseases (caused
by bacteria, fungi or yeast, viruses (including AIDS, HIV, HTLV,
herpes, hepatitis and the like) or parasites), in genetic or
biochemical pathologies (e.g., cystic fibrosis, hemophilia,
Alzheimer's disease, muscular dystrophy or multiple sclerosis) or
in cancerous processes. Transformed or established animal cell
lines may include, for example, COS cells, CHO cells, VERO cells,
BHK cells, HeLa cells, HepG2 cells, K562 cells, 293 cells, L929
cells, F9 cells, and the like. Other cells, cell lines, tissues,
organs and organisms suitable as sources of nucleic acids for use
in the present invention will be apparent to one of ordinary skill
in the art.
[0251] Once the starting cells, tissues, organs or other samples
are obtained, nucleic acid molecules (such as mRNA) may be isolated
therefrom by methods that are well-known in the art (See, e.g.,
Maniatis, T., et al., Cell 15:687-701 (1978); Okayama, H., and
Berg, P., Mol. Cell. Biol. 2:161-170 (1982); Gubler, U., and
Hoffman, B. J., Gene 25:263-269 (1983)). The nucleic acid molecules
thus isolated may then be used to prepare cDNA molecules and cDNA
libraries in accordance with the present invention.
[0252] In the practice of the invention, cDNA molecules or cDNA
libraries are produced by mixing one or more nucleic acid molecules
obtained as described above, which is preferably one or more mRNA
molecules such as a population of mRNA molecules, with a
polypeptide having reverse transcriptase activity of the present
invention, or with one or more of the compositions of the
invention, under conditions favoring the reverse transcription of
the nucleic acid molecule by the action of the enzymes or the
compositions to form one or more cDNA molecules (single-stranded or
double-stranded). Thus, the method of the invention comprises (a)
mixing one or more nucleic acid templates (preferably one or more
RNA or mRNA templates, such as a population of mRNA molecules) with
one or more reverse transcriptases of the invention and (b)
incubating the mixture under conditions sufficient to make one or
more nucleic acid molecules complementary to all or a portion of
the one or more templates. Such methods may include the use of one
or more DNA polymerases, one or more nucleotides, one or more
primers, one or more buffers, and the like. The invention may be
used in conjunction with methods of cDNA synthesis such as those
described in the Examples below, or others that are well-known in
the art (see, e.g., Gubler, U., and Hoffman, B. J., Gene 25:263-269
(1983); Krug, M. S., and Berger, S. L., Meth. Enzymol. 152:316-325
(1987); Sambrook, J., et al., Molecular Cloning: A Laboratory
Manual, 2nd ed., Cold Spring Harbor, N.Y.: Cold Spring Harbor
Laboratory Press, pp. 8.60-8.63 (1989); PCT Publication No. WO
99/15702; PCT Publication No. WO 98/47912; and PCT Publication No.
WO 98/51699), to produce cDNA molecules or libraries.
[0253] Other methods of cDNA synthesis which may advantageously use
the present invention will be readily apparent to one of ordinary
skill in the art.
[0254] Having obtained cDNA molecules or libraries according to the
present methods, these cDNAs may be isolated for further analysis
or manipulation. Detailed methodologies for purification of cDNAs
are taught in the GENETRAPPER.TM. manual (Invitrogen Corporation
(Carlsbad, Calif.)), which is incorporated herein by reference in
its entirety, although alternative standard techniques of cDNA
isolation that are known in the art (see, e.g., Sambrook, J., et
al., Molecular Cloning: A Laboratory Manual, 2nd ed., Cold Spring
Harbor, N.Y.: Cold Spring Harbor Laboratory Press, pp. 8.60-8.63
(1989)) may also be used.
[0255] In other aspects of the invention, the invention may be used
in methods for amplifying and sequencing nucleic acid molecules.
Nucleic acid amplification methods according to this aspect of the
invention may be one-step (e.g., one-step RT-PCR) or two-step
(e.g., two-step RT-PCR) reactions. According to the invention,
one-step RT-PCR type reactions may be accomplished in one tube
thereby lowering the possibility of contamination. Such one-step
reactions comprise (a) mixing a nucleic acid template (e.g., mRNA)
with one or more reverse transcriptases of the present invention
and with one or more DNA polymerases and (b) incubating the mixture
under conditions sufficient to amplify a nucleic acid molecule
complementary to all or a portion of the template. Such
amplification may be accomplished by the reverse transcriptase
activity alone or in combination with the DNA polymerase activity.
Two-step RT-PCR reactions may be accomplished in two separate
steps. Such a method comprises (a) mixing a nucleic acid template
(e.g., mRNA) with a reverse transcriptase of the present invention,
(b) incubating the mixture under conditions sufficient to make a
nucleic acid molecule (e.g., a DNA molecule) complementary to all
or a portion of the template, (c) mixing the nucleic acid molecule
with one or more DNA polymerases, and (d) incubating the mixture of
step (c) under conditions sufficient to amplify the nucleic acid
molecule. For amplification of long nucleic acid molecules (i.e.,
greater than about 3-5 Kb in length), a combination of DNA
polymerases may be used, such as one DNA polymerase having 3'
exonuclease activity and another DNA polymerase being substantially
reduced in 3' exonuclease activity.
[0256] Nucleic acid sequencing methods according to this aspect of
the invention may comprise both cycle sequencing (sequencing in
combination with amplification) and standard sequencing reactions.
The sequencing method of the invention thus comprises (a) mixing a
nucleic acid molecule to be sequenced with one or more primers, one
or more reverse transcriptases of the invention, one or more
nucleotides and one or more terminating agents, (b) incubating the
mixture under conditions sufficient to synthesize a population of
nucleic acid molecules complementary to all or a portion of the
molecule to be sequenced, and (c) separating the population to
determine the nucleotide sequence of all or a portion of the
molecule to be sequenced. According to the invention, one or more
DNA polymerases (preferably thermostable DNA polymerases) may be
used in combination with or separate from the reverse
transcriptases of the invention.
[0257] Amplification methods which may be used in accordance with
the present invention include PCR (U.S. Pat. Nos. 4,683,195 and
4,683,202), Strand Displacement Amplification (SDA; U.S. Pat. No.
5,455,166; EP 0 684 315), and Nucleic Acid Sequence-Based
Amplification (NASBA; U.S. Pat. No. 5,409,818; EP 0 329 822), as
well as more complex PCR-based nucleic acid fingerprinting
techniques such as Random Amplified Polymorphic DNA (RAPD) analysis
(Williams, J. G. K., et al., Nucl. Acids Res. 18(22):6531-6535,
1990), Arbitrarily Primed PCR (AP-PCR; Welsh, J., and McClelland,
M., Nucl. Acids Res. 18(24):7213-7218, 1990), DNA Amplification
Fingerprinting (DAF; Caetano-Anolles et al., Bio/Technology
9:553-557, 1991), microsatellite PCR or Directed Amplification of
Minisatellite-region DNA (AMD; Heath, D. D., et al., Nucl. Acids
Res. 21(24): 5782-5785, 1993), and Amplification Fragment Length
Polymorphism (AFLP) analysis (EP 0 534 858; Vos, P., et al., Nucl.
Acids Res. 23(21):4407-4414, 1995; Lin, J. J., and Kuo, J., FOCUS
17(2):66-70, 1995). Nucleic acid sequencing techniques which may
employ the present compositions include dideoxy sequencing methods
such as those disclosed in U.S. Pat. Nos. 4,962,022 and 5,498,523.
In a particularly preferred aspects, the invention may be used in
methods of amplifying or sequencing a nucleic acid molecule
comprising one or more polymerase chain reactions (PCRs), such as
any of the PCR-based methods described above.
Kits
[0258] In another embodiment, the present invention may be
assembled into kits, which may be used in reverse transcription or
amplification of a nucleic acid molecule, or into kits for use in
sequencing of a nucleic acid molecule. Kits according to this
aspect of the invention comprise a carrier means, such as a box,
carton, tube or the like, having in close confinement therein one
or more container means, such as vials, tubes, ampoules, bottles
and the like, wherein a first container means contains one or more
polypeptides of the present invention having reverse transcriptase
activity. When more than one polypeptide having reverse
transcriptase activity is used, they may be in a single container
as mixtures of two or more polypeptides, or in separate containers.
The kits of the invention may also comprise (in the same or
separate containers) one or more DNA polymerases, a suitable
buffer, one or more nucleotides and/or one or more primers. The
kits of the invention may also comprise one or more hosts or cells
including those that are competent to take up nucleic acids (e.g.,
DNA molecules including vectors). Preferred hosts may include
chemically competent or electrocompetent bacteria such as E. coli
(including DH5, DH5.alpha., DH10B, HB101, Top 10, and other K-12
strains as well as E. coli B and E. coli W strains).
[0259] In a specific aspect of the invention, the kits of the
invention (e.g., reverse transcription and amplification kits) may
comprise one or more components (in mixtures or separately)
including one or more polypeptides having reverse transcriptase
activity of the invention, one or more nucleotides (one or more of
which may be labeled, e.g., fluorescently labeled) used for
synthesis of a nucleic acid molecule, and/or one or more primers
(e.g., oligo(dT) for reverse transcription). Such kits (including
the reverse transcription and amplification kits) may further
comprise one or more DNA polymerases. Sequencing kits of the
invention may comprise one or more polypeptides having reverse
transcriptase activity of the invention, and optionally one or more
DNA polymerases, one or more terminating agents (e.g.,
dideoxynucleoside triphosphate molecules) used for sequencing of a
nucleic acid molecule, one or more nucleotides and/or one or more
primers. Preferred polypeptides having reverse transcriptase
activity, DNA polymerases, nucleotides, primers and other
components suitable for use in the reverse transcription,
amplification and sequencing kits of the invention include those
described above. The kits encompassed by this aspect of the present
invention may further comprise additional reagents and compounds
necessary for carrying out standard nucleic acid reverse
transcription, amplification or sequencing protocols. Such
polypeptides having reverse transcriptase activity of the
invention, DNA polymerases, nucleotides, primers, and additional
reagents, components or compounds may be contained in one or more
containers, and may be contained in such containers in a mixture of
two or more of the above-noted components or may be contained in
the kits of the invention in separate containers. Such kits may
also comprise instructions (e.g., for performing the methods of the
invention such as for labeling nucleic acid molecules in accordance
with the invention).
Use of Nucleic Acid Molecules
[0260] The nucleic acid molecules or cDNA libraries prepared by the
methods of the present invention may be further characterized, for
example by cloning and sequencing (i.e., determining the nucleotide
sequence of the nucleic acid molecule), by the sequencing methods
of the invention or by others that are standard in the art (see,
e.g., U.S. Pat. Nos. 4,962,022 and 5,498,523, which are directed to
methods of DNA sequencing). Alternatively, these nucleic acid
molecules may be used for the manufacture of various materials in
industrial processes, such as hybridization probes by methods that
are well-known in the art. Production of hybridization probes from
cDNAs will, for example, provide the ability for those in the
medical field to examine a patient's cells or tissues for the
presence of a particular genetic marker such as a marker of cancer,
of an infectious or genetic disease, or a marker of embryonic
development. Furthermore, such hybridization probes can be used to
isolate DNA fragments from genomic DNA or cDNA libraries prepared
from a different cell, tissue or organism for further
characterization.
[0261] The nucleic acid molecules of the present invention may also
be used to prepare compositions for use in recombinant DNA
methodologies. Accordingly, the present invention relates to
recombinant vectors which comprise the cDNA or amplified nucleic
acid molecules of the present invention, to host cells which are
genetically engineered with the recombinant vectors, to methods for
the production of a recombinant polypeptide using these vectors and
host cells, and to recombinant polypeptides produced using these
methods.
[0262] Recombinant vectors may be produced according to this aspect
of the invention by inserting, using methods that are well-known in
the art, one or more of the cDNA molecules or amplified nucleic
acid molecules prepared according to the present methods into a
vector. The vector used in this aspect of the invention may be, for
example, a phage or a plasmid, and is preferably a plasmid.
Preferred are vectors comprising cis-acting control regions to the
nucleic acid encoding the polypeptide of interest. Appropriate
trans-acting factors may be supplied by the host, supplied by a
complementing vector or supplied by the vector itself upon
introduction into the host.
[0263] In certain preferred embodiments in this regard, the vectors
provide for specific expression (and are therefore termed
"expression vectors"), which may be inducible and/or cell
type-specific. Particularly preferred among such vectors are those
inducible by environmental factors that are easy to manipulate,
such as temperature and nutrient additives.
[0264] Expression vectors useful in the present invention include
chromosomal-, episomal- and virus-derived vectors, e.g., vectors
derived from bacterial plasmids or bacteriophages, and vectors
derived from combinations thereof, such as cosmids and phagemids,
and will preferably include at least one selectable marker such as
a tetracycline or ampicillin resistance gene for culturing in a
bacterial host cell. Prior to insertion into such an expression
vector, the cDNA or amplified nucleic acid molecules of the
invention should be operatively linked to an appropriate promoter,
such as the phage lambda P.sub.L promoter, the E. coli lac, trp and
tac promoters. Other suitable promoters will be known to the
skilled artisan.
[0265] Among vectors preferred for use in the present invention
include pQE70, pQE60 and pQE-9, available from Qiagen; pBS vectors,
Phagescript vectors, Bluescript vectors, pNH8A, pNH16a, pNH18A,
pNH46A, available from Stratagene; pcDNA3 available from
Invitrogen; pGEX, pTrxfus, pTrc99a, pET-5, pET-9, pKK223-3,
pKK233-3, pDR540, pRIT5 available from Pharmacia; and pSPORT1,
pSPORT2 and pSV.cndot.SPORT1, available from Invitrogen Corporation
(Carlsbad, Calif.). Other suitable vectors will be readily apparent
to the skilled artisan.
[0266] The invention also provides methods of producing a
recombinant host cell comprising the cDNA molecules, amplified
nucleic acid molecules or recombinant vectors of the invention, as
well as host cells produced by such methods. Representative host
cells (prokaryotic or eukaryotic) that may be produced according to
the invention include, but are not limited to, bacterial cells,
yeast cells, plant cells and animal cells. Preferred bacterial host
cells include Escherichia coli cells (most particularly E. coli
strains DH10B and Stb12, which are available commercially
(Invitrogen Corporation (Carlsbad, Calif.)), Bacillus subtilis
cells, Bacillus megaterium cells, Streptomyces spp. cells, Erwinia
spp. cells, Klebsiella spp. cells and Salmonella typhimurium cells.
Preferred animal host cells include insect cells (most particularly
Spodoptera frugiperda Sf9 and Sf21 cells and Trichoplusa HigH-Five
cells) and mammalian cells (most particularly CHO, COS, VERO, BHK
and human cells). Such host cells may be prepared by well-known
transformation, electroporation or transfection techniques that
will be familiar to one of ordinary skill in the art.
[0267] In addition, the invention provides methods for producing a
recombinant polypeptide, and polypeptides produced by these
methods. According to this aspect of the invention, a recombinant
polypeptide may be produced by culturing any of the above
recombinant host cells under conditions favoring production of a
polypeptide therefrom, and isolation of the polypeptide. Methods
for culturing recombinant host cells, and for production and
isolation of polypeptides therefrom, are well-known to one of
ordinary skill in the art.
[0268] It will be readily apparent to one of ordinary skill in the
relevant arts that other suitable modifications and adaptations to
the methods and applications described herein are obvious and may
be made without departing from the scope of the invention or any
embodiment thereof. Having now described the present invention in
detail, the same will be more clearly understood by reference to
the following examples, which are included herewith for purposes of
illustration only and are not intended to be limiting of the
invention.
EXAMPLES
Example 1
Preparation of Mutant Reverse Transcriptases
[0269] Plasmid pBAD was obtained from Invitrogen Corporation,
Carlsbad, Calif. and the coding sequence of M-MLV reverse
transcriptase was inserted to produce plasmid pBAD-6-His-M-MLV H-
(F1). Plasmid pBAD-6-His-M-MLV H-(F1) was used as both a cloning
vector and as a target for PCR mutagenesis (FIG. 1).
pBAD-6-His-M-MLV H- (F1) replicates in E. coli and confers
ampicillin resistance to transformed cells. The M-MLV reverse
transcriptase gene is expressed from the ara BAD promoter which is
induced by the presence of arabinose. The promoter is repressed by
the product of the araC gene, which is present on the plasmid. The
host used, E. coli strain DH10B, is an araD mutant and cannot
metabolize arabinose, making arabinose a gratuitous inducer in
DH10B cells transformed with pBAD-6-His-M-MLV H-(F1). The plasmid
contains a 6 histidine containing leader sequence in frame with the
coding sequence of the M-MLV reverse transcriptase gene. The gene
starting at nucleotide 2598 and ending at nucleotide 4628
(Shinnick, et al., (1981) Nature 293, 543-548.) was cloned under
control of an araD promoter into plasmid pBAD/HisA (Invitrogen).
The M-MLV gene was further modified by site-directed mutagenesis
without changing amino acid coding to include several unique
restriction endonuclease sites that divided the gene into five
segments (FIG. 2). The amino end of the protein contained a
His.sub.6 tag to simplify purification that included the following
amino acids: MGGSHHHHHHGMASMTGGQQMGRDLYDDDDKE corresponding to
amino acids 1-32 of SEQ ID NO:2. The carboxy end of the protein
contained the additional amino acids NSRLIN, corresponding to amino
acids 711-716 of SEQ ID NO:2, present as the result of subcloning
from pRT601. In addition, the M-MLV RT gene was mutated (D524G,
E562Q, D583N) to eliminate RNase H activity. The final construct
was designated pBAD-HSS2 (FIG. 1), and the gene and gene product
were designated His.sub.6H- RT. In addition to this construct,
other constructs having different N-terminal sequences are
contemplated in the present invention. For example, a construct
beginning at methionine 12 of SEQ ID NO:6 and Table 3 and
containing a mutation changing methionine 15 to glycine (M15G) to
produce a protein with an N-terminal sequence MASGTGGQQMGRDLYDDDDKH
(SEQ ID NO:1) followed by the remaining sequence of M-MLV RT from
Table 3 has been produced as well as a construct beginning with
methionine 33 of SEQ ID NO:6 and Table 3.
[0270] With reference to the sequence of this plasmid provided in
Table 3 (SEQ ID NOs:1 and 2), nucleotides 1-96 encode the leader
sequence and nucleotides 97-99 encode a methionine. Those skilled
in the art will appreciate that the wild-type M-MLV reverse
transcriptase is derived by proteolysis from a precursor
polyprotein and thus the wild-type M-MLV reverse transcriptase does
not start with a methionine. Therefore, amino acid number 1 of the
M-MLV reverse transcriptase is the threonine (amino acid 34 in SEQ
ID NO:2 and Table 3) following the methionine encoded by
nucleotides 97-99 (amino acid 33 in SEQ ID NO:2 and Table 3).
[0271] The sequence of the M-MLV reverse transcriptase gene in
pBAD-6-His-M-MLV H- (F1) which was used in these experiments was
derived from the sequence of plasmid pRT601. pRT601 is described in
Kotewicz, et al., (1988) Nuc. Acids Res. 16, 265-277, Gerard, et
al., (1986) DNA 5, 271-279, U.S. Pat. Nos. 5,668,005 and 5,017,492,
which are incorporated herein by reference in their entireties.
TABLE-US-00003 TABLE 3 (SEQ ID NOs: 1 and 2). 1 atggggggtt
ctcatcatca tcatcatcat ggtatggcta m g g s h h h h h h g m a
gcatgactgg tggacagcaa s m t g g q q 61 atgggtcggg atctgtacga
cgatgacgat aagcatatga m g r d l y d d d d k h m ccctaaatat
agaagatgag t l n i e d e 121 tatcggctac atgagacctc aaaagagcca
gatgtttctc y r l h e t s k e p d v s tagggtccac atggctgtct l g s t
w l s 181 gattttcctc aggcctgggc ggaaaccggg ggcatgggac d f p q a w a
e t g g m g tggcagttcg ccaagctcct l a v r q a p 241 ctgatcatac
ttctgaaagc aacctctacc cccgtgtcca l i i l l k a t s t p v s
taaaacaata ccccatgtca i k q y p m s 301 caagaagcca gactggggat
caagccccac atacagagac q e a r l g i k p h i q r tgttggacca
gggaatactg l l d q g i l 361 gtaccctgcc agtccccctg gaacacgccc
ctgctacccg v p c q s p w n t p l l p tcaagaaacc cgggactaat v k k p
g t n 421 gattacaggc ctgtccaaga tctgagagag gtcaacaaac d y r p v q d
l r e v n k gcgtagaaga catccacccc r v e d i h p 481 accgtaccca
acccctacaa cctcttgagt gggctcccac t v p n p y n l l s g l p
cgtcccacca gtggtacact p s h q w y t 541 gttctagact taaaagatgc
ctttttctgc ctgagactcc v l d l k d a f f c l r l acccgacgtc
tcagcctctc h p t s q p l 601 ttcgcctttg aatggagaga cccagagatg
ggaatctctg f a f e w r d p e m g i s gccaactaac ctggaccaga g q l t
w t r 661 ctcccacagg gattcaaaaa cagtcccacc ctgtttgatg l p q g f k n
s p t l f d aggcactgcg cagagaccta e a l r r d l 721 gcagacttcc
ggatccagca cccagacttg atcctgctac a d f r i q h p d l i l l
agtacgtaga tgacttactg q y v d d l l 781 ctggccgcca cttctgagct
cgactgccaa caaggtactc l a a t s e l d c q q g t gggccctgtt
acaaacccta r a l l q t l 841 ggagacctcg ggtatcgggc ctcggccaag
aaagcccaaa g d l g y r a s a k k a q tttgccagaa acaggtcaag i c q k
q v k 901 tatctggggt atcttctaaa agagggtcag agatggctga y l g y l l k
e g q r w l ctgaggccag aaaagagact t e a r k e t 961 gtgatggggc
agcctactcc gaagaccccg cggcaactaa v m g q p t p k t p r q l
gggagttcct agggacggca r e f l g t a 1021 ggcttctgtc gcctctggat
ccctgggttt gcagaaatgg g f c r l w i p g f a e m cagccccctt
gtaccctctc a a p l y p l 1081 accaaaacgg ggactctgtt taattggggc
ccagaccaac t k t g t l f n w g p d q aaaaggccta tcaagaaatc q k a y
q e i 1141 aagcaagctc ttctaactgc cccagccctg gggttgccag k q a l l t
a p a l g l p atttgactaa gccctttgaa d l t k p f e 1201 ctctttgtcg
acgagaagca gggctacgcc aaaggtgtcc l f v d e k q g y a k g v
taacgcaaaa actgggacct l t q k l g p 1261 tggcgtcggc cggtggccta
cctgtccaaa aagctagacc w r r p v a y l s k k l d cagtagcagc
tgggtggccc p v a a g w p 1321 ccttgcctac ggatggtagc agccattgcc
gtactgacaa p c l r m v a a i a v l t aggatgcagg caagctaacc k d a g
k l t 1381 atgggacagc cactagtcat tctggccccc catgcagtag m g q p l v
i l a p h a v aggcactagt caaacaaccc e a l v k q p 1441 cccgatcgat
ggctttccaa cgcccggatg actcactatc p d r w l s n a r m t h y
aggccttgct tttggacacg q a l l l d t 1501 gaccgggtcc agttcggacc
ggtggtagcc ctgaacccgg d r v q f g p v v a l n p ctacactgct
cccactgcct a t l l p l p 1561 gaggaagggc tgcagcacaa ctgccttgat
atcctggccg e e g l q h n c l d i l a aagcccacgg aacccgaccc e a h g
t r p 1621 gacctaacgg accagccgct cccagacgcc gaccacacct d l t d q p
l p d a d h t ggtacacggg tggatccagt w y t g g s s 1681 ctcttgcaag
agggacagcg taaggcggga gctgcggtga l l q e g q r k a g a a v
ccaccgagac cgaggtaatc t t e t e v i 1741 tgggctaaag ccctgccagc
cgggacatcc gctcagcggg w a k a l p a g t s a q r ctcagctgat
agcactcacc a q l i a l t 1801 caggccctaa ggatggcaga aggtaagaag
ctaaatgttt q a l r m a e g k k l n v atacgaattc ccgttatgct y t n s
r y a 1861 tttgctactg cccatatcca tggagaaata tacagaaggc f a t a h i
h g e i y r r gtgggttgct cacatcagaa r g l l t s e 1921 ggcaaagaga
tcaaaaataa ggacgagata ttggccctac g k e i k n k d e i l a l
taaaagccct ctttctgccc l k a l f l p 1981 aaaagactta gcataatcca
ttgtccagga catcaaaagg k r l s i i h c p g h q k gacacagcgc
cgaggctaga g h s a e a r 2041 ggcaaccgga tggctgacca agcggcccga
aaggcagcca g n r m a d q a a r k a a tcacagagaa tccagacacc i t e n
p d t 2101 tctaccctcc tcatagaaaa ttcatcaccc aattcccgct s t l l i e
n s s p n s r taattaatta a l i n -
[0272] Table 4 provides a list of the point mutations introduced in
the M-MLV reverse transcriptase coding sequence of pRT601 to
produce the plasmid used. The numbering of the point mutations
corresponds to the nucleotide sequence presented in Table 3.
TABLE-US-00004 TABLE 4 Nucleotide # in Table 3 change 411
a.sub..fwdarw.c 459 g.sub..fwdarw.a 462 g.sub..fwdarw.c 543
g.sub..fwdarw.t 546 t.sub..fwdarw.a 585 c.sub..fwdarw.g 588
c.sub..fwdarw.g 589 a.sub..fwdarw.t 590 g.sub..fwdarw.c 639
a.sub..fwdarw.t 642 a.sub..fwdarw.c 710 a.sub..fwdarw.g 801
a.sub..fwdarw.c 990 t.sub..fwdarw.g 993 a.sub..fwdarw.g 1446
c.sub..fwdarw.t 1449 c.sub..fwdarw.a 1670 a.sub..fwdarw.g 1675
a.sub..fwdarw.t 1676 g.sub..fwdarw.c 1783 g.sub..fwdarw.c 1785
a.sub..fwdarw.g 1845 t.sub..fwdarw.g 1846 g.sub..fwdarw.a 1849
a.sub..fwdarw.t 1850 g.sub..fwdarw.c 1950 c.sub..fwdarw.a
[0273] The mutations which were introduced to make RNase H- mutants
of M-MLV reverse transcriptase are D524G, D583N, and E562Q. The
remaining mutations were introduced to insert or remove restriction
enzyme sites to facilitate the production of appropriately sized
segments for the random PCR mutagenesis. This RNase H- mutant is
referred to herein as SUPERSCRIPT.TM. II or SUPERSCRIPT.TM. II
gene.
[0274] The sequence of the M-MLV reverse transcriptase was
engineered to introduce restriction enzyme cleavage sites as shown
schematically in FIG. 2 without changing the amino acids encoded by
the sequence. The sequence was divided into 5 segments and
oligonucleotides were designed so that each segment could be
amplified. The segments roughly corresponded to the coding
sequences of the five separate structural subdomains of RT
(Kohlstaedt, et al., (1992) Science 256, 1783-1789, Jacobo-Molina,
et al., (1993) Proc. Natl. Acad. Sci. USA 90, 6320-6324). Segments
one through four corresponded to the polymerase subdomain of
fingers, palm, thumb, and connection, respectively, and segment
five corresponded to the RNase H domain (FIG. 2). An upper limit
cut-off of 1 to 2 mutations per segment was set as the target for
mutation frequency to suppress accumulation of deleterious
mutations, and to minimize the amount of screening required to find
active mutants. Mutation frequencies of >5 mutations/segment in
segment one, two, or three produced only about 5% active mutants
with all the mutants having less than wild-type activity. At the
mutation frequency used of 1 to 2 mutations per segment,
approximately one-third of the mutants had little or no activity,
one-third had less than 50% of His.sub.6H- RT activity, and
one-third had up to 100% of His.sub.6H- RT activity.
[0275] Segments were prepared from pBAD-6-His-M-MLV H- (F1) by
restriction enzyme digests and the segments were gel purified away
from the vector backbone. Each segment was randomly mutagenized by
PCR in the presence of manganese. The PCR conditions were standard
except that 0.25 mM MnCl.sub.2 was present, and the nucleotide
triphosphate concentration was limited to 20 .mu.M of each dNTP (50
mM Tris.HCl pH 8.3, 50 mM KCl, 3 mM MgCl.sub.2, 20 .mu.M dGTP, 20
.mu.M dCTP, 20 .mu.M dATP, 20 .mu.M dTTP, 1 unit Taq DNA polymerase
per 100 .mu.l reaction). The PCR product was extracted with
phenol-chloroform, precipitated with ethanol and the mutated
segments were cloned into a vector from which the given segment had
been removed.
[0276] In some random mutagenesis experiments, mutagenic PCR was
performed in a reaction mixture (100 .mu.l) containing 20 mM
Tris-HCl (pH 8.4), 50 mM KCl, 1.8 mM MgCl.sub.2, 0.3 mM MnSO.sub.4,
200 .mu.M each of dCTP, dGTP, dTTP, and dATP, and 0.5 units of Taq
DNA polymerase (Invitrogen Corporation, Carlsbad, Calif.). After a
1 min denaturation step at 94.degree. C., the cycling protocol was
15 sec at 94.degree. C., 15 sec at 55.degree. C., and 30 sec at
72.degree. C. for 20 cycles. Amplification was 100 fold from 50 ng
of target to 5 .mu.g of amplified product. PCR primers included
appropriate restriction endonuclease cut sites. An amplified DNA
segment was cleaved with appropriate restriction endonucleases, gel
purified, and cloned into gel purified vector DNA cut with the
corresponding restriction enzymes. The vectors containing the
mutated segments were transformed into appropriate host cells to
produce a library.
[0277] Libraries were sampled by DNA sequencing of the mutagenized
H- RT gene segment of a small number of clones to determine the
mutation frequency. The goal was to achieve rates of PCR random
mutagenesis that produced 1 to 2 mutations per segment. It was
found that random mutagenesis that produced greater than 2
mutations per segment tended to produce a large proportion of
inactive RT mutants. If the library met this criterion, further
screening by heat treatment was carried out to identify mutants
that showed greater RT activity in lysates than H- RT after a heat
treatment step. Those mutants with the highest apparent thermal
stability were screened again in duplicate by pretreatment at
24.degree. C. (to normalize for activity) and at 52 to 58.degree.
C. to confirm the presence of enhanced thermal stability. In all,
about 15,000 clones were screened by heat treatment in the 96-well
format for each segment or a total of about 100,000 mutants.
Libraries of transformants for each mutated segment were screened
for thermostable variants.
Example 2
Screening for Thermostable Reverse Transcriptases
[0278] In this example the following solutions were used:
EG--per liter: 20 g bacto-tryptone, 10 g bacto yeast extract, 2 ml
glycerol, 0.54 g NaCl, 0.194 g KCl
EG-arabinose--150 ml EG plus 1.5 ml of 10 mg/ml ampicillin and 1.5
ml of 20% (w/v) arabinose (if plates are to have arabinose)
20.times.PEB-I Buffer--18% (w/v) glucose, 500 mM Tris-HCl (pH 8.0),
200 mM EDTA
Kinase Storage Buffer--50% (v/v) glycerol, 20 mM Tris-HCl (pH 8.0),
100 mM KCl, 5 mM .beta.ME
100 mg/ml lysozyme--made in Kinase Storage Buffer and stored at
-20.degree. C.
2.times.PLD--5 ml of 20.times.PEB-1,1 ml of 1 M DTT, 5 ml of 10%
(v/v) Triton X-100, 1 ml of 100 mg/ml lysozyme and 38 ml of
water
2.times.PZD--0.5 ml of 20.times.PEB-I, 100 .mu.l of 1 M DTT, 0.5 ml
of 10% (v/v) Triton X-100, 10 .mu.l of zymolase and 3.9 ml of
water
10.times. Poly(C) Reaction Buffer--500 mM Tris-HCl (pH 8.4), 500 mM
KCl, 100 mM MgCl.sub.2
1.25.times. Reaction Mix--1 ml of 10.times. Poly(C) Reaction
Buffer, 100 .mu.l of 1 M DTT, 1 ml of poly(C)/oligo(dG) (30 mM/12
mM in nucleotide), 10 .mu.l of 100 mM dGTP, 5.87 ml of water and 20
.mu.l of [.alpha.-.sup.32P] dGTP at 10 .mu.Ci/.mu.l
[0279] E. coli DH10B (Invitrogen Corporation, Carlsbad, Calif.) was
used in all experiments. Bacterial liquid cultures were grown at
37.degree. C. in EG: 2% tryptone, 1% yeast extract, 0.5% glycerol,
10 mM NaCl, and 1 mM KCl. Solid medium was LB (1% bacto-tryptone,
0.5% yeast extract, and 86 mM NaCl)+1.5% agar. Selective media
included 100 .mu.g/ml ampicillin. For induction of cultures, cells
were inoculated into selective EG+0.2% arabinose and grown for 18
hr.
[0280] Mutant populations were plated on selective agar. Individual
transformant colonies were inoculated into single wells of a 96
well culture plate. Each well contained 120 .mu.l of EG-Ap medium
(EG medium with 100 .mu.g/ml ampicillin). Although colonies from
the selective agar may be grown in media containing 0.2% arabinose,
it is preferable to first inoculate a 96 well plate with selective
medium without the inducer, to grow that master plate overnight,
and then to make a replica of the master plate into a 96-well plate
with the inducer and grow that plate overnight.
[0281] An aliquot of the un-induced culture from each well was
transferred into a new 96-well plate containing 120 .mu.l per well
of selective media +0.2% arabinose. The cultures containing the
inducer were grown overnight (e.g., 15-20 hours) at 37.degree. C.
without shaking to induce RT production. An aliquot (5 .mu.l) of
culture from each well was then transferred into another 96-well
plate containing 5 .mu.l per well of 2.times.PLD(50 mM Tris-HCl, pH
8.0, 20 mM EDTA, 1.8% (w/v) sucrose, 1% (v/v) Triton X-100, 10 mM
DTT, and 2 mg/ml lysozyme) at room temperature. These extracts were
sometimes assayed directly for reverse transcriptase before the
heating step. The amount of RT activity in a 5-.mu.l aliquot of
extract was within the linear range of the assay. Lysates were
stable at room temperature for at least 1 hr.
[0282] The extracts were heated, for example, using a water bath or
thermocycler, for 5 or 10 minutes at temperatures that ranged from
50.degree. C. to 60.degree. C. Preferably, the cultures were heated
for 5 minutes at 52.degree. C. After heating and cooling to room
temperature, RT activity in a 5-.mu.l aliquot from the lysate in
each well was assayed with (rC).sub.n.(dG).sub.15 in another
96-well plate. An aliquot (5 to 10 .mu.l) of the extract was mixed
with 1.25.times.RT reaction mix. This reaction was placed in a
37.degree. C. water bath for 10 minutes. A small aliquot of the
reaction mixture (5 .mu.l) was spotted onto a charged nylon
membrane (Genescreen+, NEN). The membrane was washed twice with 10%
TCA+1% sodium pyrophosphate, rinsed with ethanol, dried, and placed
next to a phosphor screen. As an alternative, the membrane may be
washed twice with 4% sodium pyrophosphate (pH 8.0), rinsed with
ethanol, dried, and then placed next to a phosphor screen.
Radioactive product that had been trapped on the filter was
detected by analyzing the screen in a Posphorimager, using
ImageQuant software (Molecular Devices).
[0283] Candidates were selected if they showed more reverse
transcriptase activity (radioactivity) after the heat inactivation
step. These candidates were screened a second time to confirm the
phenotype. Candidates which appeared to be thermostable after the
second screen were grown in small cultures and tested a third time
for thermostable reverse transcriptase activity. Candidates that
were reproducibly heat resistant were sequenced and the mutation in
each clone was determined.
[0284] Plasmid DNA was prepared from an over night E. coli culture
bearing an RT mutant using a Concert High Purity Miniprep Kit
(Invitrogen Corporation, Carlsbad, Calif.) following the
manufacturer's instructions. Each DNA was sequenced using a forward
and reverse primer bordering the segment that had been mutagenized
to generate the mutant. The sequencing reactions were carried out
as specified for plasmid DNA using the ABI Big Dye Terminator
Sequencing Ready Reaction Kit. The reactions were analyzed using an
ABI PRISM 377 DNA Sequencer.
[0285] An oligonucleotide corresponding to the mutagenized site was
designed in which the codon for the mutagenized amino acid was
randomized (NNK or NNN). Oligonucleotide site-directed mutagenesis
was carried out by established procedures. Saturation of an amino
acid coding site in the H- RT gene with all possible amino acids
was performed by introducing the sequence NNK (N=A, C, G or T and
K=G or T) at the codon site into the mutagenic oligonucleotide.
These oligonucleotides were used in site-directed mutagenesis to
generate a library in which all possible substitutions at the
mutagenized site were made. This library was screened for
thermostable reverse transcriptase activity, and the most promising
clones were sequenced.
[0286] Screening of mutants in Segment 2 (see FIG. 2) resulted in
the identification of one mutant, H204R. Screening of a library
mutagenized at site H204 resulted in several mutants, but the only
one that was more thermostable than M-MLV reverse transcriptase was
another H204R mutant. H204R mutants of M-MLV reverse transcriptase
have enhanced thermostability. Screening of mutants in segment 3
(see FIG. 2) resulted in one mutant, T306K. Randomization of the
T306 position produced thermostable mutants which, when sequenced,
were T306R. Both T306K and T306R mutants of M-MLV reverse
transcriptase have about 1.5 fold enhanced thermostability.
Example 3
TdT Reverse Transcriptase Mutants
[0287] In checking fidelity mutants of reverse transcriptase (RT)
for misextension in a 3 dNTP assay, it was observed that
SUPERSCRIPT.TM. II reverse transcriptase extended 2-3 bases past
the end of the template in the presence of 3 and 4 dNTPs. This
non-template directed extension or TdT activity is reduced in many
mutants, but in a few such as F309N and T197E it appears that this
activity is severely reduced or eliminated. These mutants are
probably in close proximity or in contact with the template-primer
as determined by homology to HIV reverse transcriptase and its
crystal structure with bound template-primer.
Methods
Mutagenesis
[0288] For F309N:
[0289] Primers were designed corresponding to the mutant position
F309 with the silent insertion of a NgoMIV restriction site at
amino acid positions 310-311. The primers encoded a random NNK
sequence for this position generating a random library of F309
mutants, where N is any of the four bases and K is T or G. The
primers along with internal SUPERSCRIPT.TM. II reverse
transcriptase primers at an upstream SstI restriction site and a
downstream SalI restriction site were used in a standard PCR
reaction (10 ng SUPERSCRIPT.TM. II reverse transcriptase template,
2 .mu.M of each primer, 48 .mu.l SuperMix (Invitrogen Corporation
(Carlsbad, Calif.)) for 20 cycles of 94.degree. C. 15 sec,
55.degree. C. 15 sec, 72.degree. C. 30 sec) to generate two PCR
fragments. These were a 240 base pair SstI-NgoMIV fragment and a
200 base pair NgoMIV-SalI fragment. The fragments were isolated and
digested and ligated together and then inserted into the original
SUPERSCRIPT.TM. II reverse transcriptase clone cut with SstI and
SalI. The resulting ligation product was transformed in Max
Efficiency DH10B (Invitrogen Corporation (Carlsbad, Calif.))
competent cells to create the library of mutants at site F309. This
library was then plated overnight for selection.
[0290] For Ti 97E and Y133A:
[0291] The mutants T197E and Y133A were made by oligo-directed
mutagenesis as described in Kunkel, T. A. et al. Methods Enzymol.
204:125 (1991). Briefly, the SUPERSCRIPT.TM. II reverse
transcriptase gene was inserted into pBADhisA (Invitrogen
Corporation) vector and named pBAD-SSII. This plasmid was
transformed into DH11S cells and the cells were infected with
M13K07 helper phage from which single strand DNA was isolated.
Oligos, were designed corresponding to each mutation: T197E and
Y133A. Each oligo (100 .mu.M) was kinased with T4 polynucleotide
kinase (Invitrogen Corporation (Carlsbad, Calif.)) using the
Forward Reaction Buffer (Invitrogen Corporation (Carlsbad,
Calif.)). The oligo was annealed to single stranded pBAD-SSII DNA.
Native T7 DNA polymerase (USB) and T4 DNA ligase (Invitrogen
Corporation (Carlsbad, Calif.)) were added with synthesis buffer
(0.4 mM dNTPs, 17.5 mM Tris-HCl, pH 7.5, 5 mM MgCl.sub.2, 2.5 mM
DTT, and 1 mM ATP) to the annealed reaction on ice. The reactions
were incubated at 37.degree. C. for 30 minutes and terminated by
adding 1 .mu.l of 0.5 M EDTA. The reactions were transformed and
plated with DH10B cells. Colonies were picked and mutants were
determined by restriction enzyme analysis and sequenced for
confirmation using an ABI 377 instrument and ABI Big Dye Terminator
Cycle Sequencing Ready Reaction kit.
Selecting Colonies Containing Active Reverse Transcriptase.
[0292] Individual transformant colonies were inoculated into single
wells of a 96 well culture plate. Each well contained 120 .mu.l of
media (EG-Ap) containing 0.2% arabinose. It is preferable to first
inoculate a 96 well plate with selective medium without the
inducer, to grow that master plate overnight, and then to make a
replica of the master plate into a 96-well plate with the inducer
and grow that plate overnight. The cultures were grown overnight at
37.degree. C. without shaking. Overnight cultures were mixed with
an equal volume of 2.times.PLD (1.8% glucose, 50 mM Tris-HCl, pH
8.0, 20 mM EDTA, 20 mM DTT, 1% Triton X-100, 2 mg/mL lysozyme) at
room temperature. These extracts were assayed directly for reverse
transcriptase activity by mixing 10 .mu.l of the extract with 40
.mu.l of 1.25.times.RT reaction mix (62.5 mM Tris-HCl, pH 8.4, 62.5
mM KCl, 12.5 mM MgCl.sub.2, 12.5 mM DTT, 1.25 mM dGTP, polyC/oligo
dG (3.75 mM/1.5 mM in nucleotide), [.sup.32P] dGTP). This reaction
was placed in a 37.degree. C. water bath for 10 minutes. A small
aliquot of the reaction mixture (5 .mu.l) was spotted onto a
charged nylon membrane (Genescreen+, NEN). The membrane was washed
twice with 10% TCA+1% sodium pyrophosphate, rinsed with ethanol,
dried, and placed next to a phosphor screen. Radioactive product
that had been trapped on the filter was detected by analyzing the
screen in a Phosphorimager, using ImageQuant software (Molecular
Devices). Candidates were selected if they showed reverse
transcriptase activity (radioactivity). These candidates were
screened a second time to confirm the phenotype. The confirmed
candidates were then sequenced to determine which amino acids
maintained detectable reverse transcriptase activity.
[0293] Purification of Reverse Transcriptase Mutants.
[0294] The cell pellet containing induced reverse transcriptase was
suspended in a ratio of 2 mL Lysis buffer (40 mM Tris-HCl, pH 8.0,
0.1 M KCl, 1 mM PMSF)/1 gram of cell pellet. The suspension was
sonicated on ice and then centrifuged at 27,000 g for 30 minutes.
The cell-free extract was filtered through a 0.45.mu. syringe
filter. The cell-free extract was applied to a 5 mL Ni.sup.2+
HI-TRAP column (Pharmacia) pre-equilibrated with 5 volumes 5 mM
imidazole in buffer A (40 mM Tris HCl, pH 8.0, 10% glycerol, 0.01%
Triton X-100, 0.1 M KCl) at 1 mL/min. The column was washed with 10
volumes 5 mM imidazole in buffer A. The reverse transcriptase was
eluted by washing with 20 volumes of a gradient of 5 mM to 1M
imidazole in buffer A. The eluate containing reverse transcriptase
protein was applied to a 1 mL Mono-S column (Pharmacia)
pre-equilibrated with 10 column volumes 50 mM KCl in buffer B (40
mM Tris-HCl, pH 8.0, 10% glycerol, 0.01% Triton X-100, 0.1 mM EDTA,
1 mM DTT) at a flow rate of 1.0 mL/min. The column was washed with
10 volumes of 50 mM KCl in buffer B. Reverse transcriptase was
eluted with 20 volumes of a gradient from 50 mM to 1 M KCl in
buffer B. The individual fractions were analyzed for RT activity.
The fraction containing peak RT activity was dialyzed against
storage buffer (40 mM Tris-HCl, pH 8.0, 50% glycerol, 0.01% Triton
X-100, 0.1 mM EDTA, 1 mM DTT, 0.1 M KCl). The purified reverse
transcriptases were more than 95% pure, as judged by SDS-PAGE. The
protein concentrations were determined by using the Biorad
colorimetric kit.
[0295] 3 dNTP Assay Method.
[0296] Procedures were modified from those of Preston, B. D., et
al. Science 242:1168 (1988). The DNA template-primer was prepared
by annealing a 47-mer template
(5'-GAGTTACAGTGTTTTTGTTCCAGTCTGTAGCAGTGTGTGAATGGAA G-3') (SEQ ID
NO:6) to an 18-mer primer (5'-CTTCCATTCACACACTGC-3') (SEQ ID NO:7)
[.sup.32P]-labeled at the 5'-end with T4 polynucleotide kinase
(template:primer, 3:1). Assay mixture (10 .mu.l) contained 5 nM
template-primer, 50-200 nM reverse transcriptase as specified in
figure legends, 3 or 4 dNTPs (250 .mu.M each), 50 mM Tris-HCl (pH
8.3), 75 mM KCl, 3 mM MgCl.sub.2, 10 mM DTT. Reactions were
incubated at 37.degree. C. for 30 minutes and terminated by the
addition of 5 .mu.l of 40 mM EDTA, 99% formamide. Reaction products
were denatured by incubating at 95.degree. C. for 5 minutes and
analyzed by electrophoresis on urea 6% polyacrylamide gels.
[0297] To determine if any TdT activity was occurring in the
control reaction of the 3 dNTP assay, which uses all 4 dNTPs, the
control reaction was repeated with varying amounts of enzyme,
>600 units to 20 units, at 37.degree. C. for 30 minutes. For
SUPERSCRIPT.TM. II, T197E, and Y133A, 200, 100, 50, and 20 units
were used. For F309N, 646, 200, 50, and 20 units were used.
Results
[0298] We carried out a misinsertion assay of F309N(H204R, T306K)
SUPERSCRIPT.TM. II reverse transcriptase, hereafter referred to as
F309N, with DNA template. This assay was employed to compare the
misincorporation capability of the mutant to SUPERSCRIPT.TM. II.
The assay is a primer extension assay using synthetic DNA
template-primer and biased dNTP pools containing only three of four
dNTPs. The reactions are displayed on a gel in FIG. 3. While
conducting this procedure to screen for mutants with lower
misinsertion/misextension rates it was observed that
SUPERSCRIPT.TM. II reverse transcriptase extended 2-3 nucleotides
past the template end and that some mutations reduced or appeared
to eliminate this non-template directed extension or TdT activity.
As shown in FIG. 4, in the presence of all 4 dNTPs, SUPERSCRIPT.TM.
II reverse transcriptase and the mutant F309N were able to extend
the primer approximately equally, with SUPERSCRIPT.TM. II reverse
transcriptase adding 2 nucleotides past the template, and F309N
adding none beyond the end of the template. To further evaluate
this non-templated directed extension the control reaction for the
3 dNTP misextension assay containing all 4 dNTPs was carried out
with SUPERSCRIPT.TM. II, F309N, T197E, and Y133A reverse
transcriptase for 30 minutes with varying amounts of enzyme. The
three mutants had shown very reduced levels of TdT activity in
prior screens. Since it had been observed that 5 minutes with 20
units of enzyme was more than enough time for the primer extension
to be completed, a 30 minute incubation and 200 to 646 units of
reverse transcriptase were both in large excess over what was
necessary for the reaction to be completed. As seen in FIG. 4, all
the reverse transcriptase reactions at the lowest amount tested had
similar extension products to the reactions at the highest unit
concentrations demonstrating that the reaction had gone to
completion. SUPERSCRIPT.TM. II reverse transcriptase added 2
nucleotides past the end of the template, F309N and T197E did not
extend past the end of the template, and Y133A appears to have a
small amount of product that is 1 nucleotide past the end of the
template.
Example 4
Dual Thermostable and TdT Mutants
[0299] The F309 amino acid position in M-MLV reverse transcriptase
(RT) aligns with the W266 position in HIV reverse transcriptase.
This position is at the base of the thumb domain and is considered
part of the minor groove binding tract which interacts with the
minor groove of the template-primer. The mutations H204R and T306K
have been shown to increase the thermostability of the enzyme. The
F309N mutation in an H204R/T306K clone displays 2.3.times. lower
mutation frequency in a lacZ forward assay (Table 5) on RNA
template and shorter extension products in a 3 dNTP extension assay
than SUPERSCRIPT.TM. II reverse transcriptase or H204R/T306K in
SUPERSCRIPT.TM. II reverse transcriptase. Both findings support the
claim of an enzyme with higher fidelity (Table 6). TABLE-US-00005
TABLE 5 Mutation Frequency of M-MLV Reverse Transcriptase High
Fidelity Mutants Construct total plaques mutant plaques
MF(.times.10.sup.-4) SUPERSCRIPT .TM. II 15689 87 39 SUPERSCRIPT
.TM. II 14410 83 41 (H204R, T306K) SUPERSCRIPT .TM. II 11623 39 17
(H204R, T306K, F309N) SUPERSCRIPT .TM. II 11415 39 14 (H204R,
T306K, F309N, V223H)
[0300] Table 5. The mutation frequency of SUPERSCRIPT.TM. II
reverse transcriptase and point mutants. Mutation frequency (MF)
was determined by dividing the number of mutant plaques (light blue
or white) by the total number of plaques. The background mutant
frequency of the starting DNA was 17.times.10.sup.-4 for the first
3 constructs and 20.times.10.sup.-4 for the last construct.
TABLE-US-00006 TABLE 6 Error Rates of M-MLV Reverse Transcriptase
High Fidelity Mutants SUPERSCRIPT .TM. V223H/ M-MLV II F309N F309N
Overall ER 1/17,000 1/15,000 1/34,000 1/41,000 (oER) Mismatch % of
total 46 35 68 72 ER (mER) 1/37,000 1/42,000 1/50,000 1/58,000
Frameshift % of total 46 60 21 22 ER (rER) 1/37,000 1/25,000
1/162,000 1/188,000 Strand Jump % of total 8 5 11 6 ER (jER)
1/213,000 1/297,000 1/324,000 1/690,000
Methods
[0301] Mutagenesis. Using a standard site directed mutagenesis
protocol, as described in Example 3, a primer containing the V223H
mutation was annealed to single strand DNA of SUPERSCRIPT.TM. II
with the following mutations: H204R, T306K, F309N. The colonies
were sequenced to confirm the new combination of V223H, H204R,
T306K, and F309N.
[0302] Selecting Colonies Containing Active Reverse Transcriptase.
Colony selection was performed as in Example 3.
[0303] Purification of RT mutants. Purification was performed as in
Example 3.
[0304] Sequencing of plaques. The plaques from the lacZ forward
assay were transferred from the soft agar plate to Whatmann 3MM
paper and allowed to dry for at least 1 hour. The plaque was then
punched out and the plaque/paper disk was added directly to a
sequencing reaction mix containing 4-8 .mu.l ABI PRISM Dye
Terminator Cycle Sequencing Ready Reaction (Perkin Elmer), 1 .mu.l
primer (GAAGATCGCACTCCAGCCAGC) (SEQ ID NO:8), and distilled water
to 20 .mu.l total volume. The ABI cycle sequencing protocol was
used for 96.degree. C. 10 seconds, 50.degree. C. 5 seconds,
60.degree. C. 4 minutes for 25 cycles. The paper disks were removed
and the reactions were precipitated, then resuspended in loading
dye and run on an ABI 377 sequencing machine.
[0305] The sequences were compared to wild type lacZ alpha sequence
and then classified as frameshift (either 1 nucleotide insertion or
deletion), mismatch, or strand jump (an insertion or deletion
between repeated sequences). The overall error rate for each class
was determined by dividing the mutation frequency by the number of
detectable sites (i.e., sites the alteration of which results in a
phenotypic change) (116) multiplied by 0.5 (to exclude the original
single strand contribution) and then multiplied by the percentage
of mutants observed to be in each class. ER=MF/(detectable
sites*0.5)*(% in each class).
[0306] 3dNTP assay method. 3dNTP assays were performed as in
Example 3.
Results
[0307] We carried out a misinsertion assay of F309N(H204R T306K)
SUPERSCRIPT.TM. II reverse transcriptase, hereafter referred to as
F309N, and V223H F309N(H204R T306K), hereafter referred to as
V223H/F309N with DNA template. This assay was employed to compare
the misincorporation capability of the mutant to SUPERSCRIPT.TM.
II. The assay is a primer extension assay using synthetic DNA
template-primer and biased dNTP pools containing only three of the
four dNTPs. The reactions are displayed on a gel in FIG. 5 and FIG.
6. In this assay, higher efficiency of primer extension denotes
lower fidelity. As shown in FIGS. 5 and 6, in the presence of all 4
dNTPs, SUPERSCRIPT.TM. II reverse transcriptase and the mutants
F309N and V223H/F309N were able to extend the primer approximately
equally, with some variance in the addition of non-template
directed nucleotides at the end of the primer. However when
incubated with biased pools of nucleotides, SUPERSCRIPT.TM. II
reverse transcriptase was able to catalyze substantial extension
past template nucleotides for which a complementary dNTP was
missing, indicating use of incorrect nucleotides and lower
fidelity. In FIG. 5, the F309N (2) mutant showed shorter extension
products than SUPERSCRIPT.TM. II reverse transcriptase in each of
the biased pools of three dNTPs, indicating less ability to
incorporate incorrect nucleotides and thus higher fidelity. In FIG.
6, the V223H/F309N mutant was extended with just the dATP and dCTP
pools. In each case V223H/F309N also had lower extension products
than SUPERSCRIPT.TM. II. This corresponds with the results of the
lacZ.alpha. assay where the F309N and V223H/F309N mutants had a
lower mutation frequency than SUPERSCRIPT.TM. II reverse
transcriptase (17.times.10.sup.4 and 14.times.10.sup.4 to
39.times.10.sup.4). The reverse transcriptase with just the H204R
T306K mutations without F309N has a mutation frequency similar to
SUPERSCRIPT.TM. II reverse transcriptase (41.times.10.sup.4 to
39.times.10.sup.4), suggesting that these mutations do not
influence fidelity. This data shows a correlation between the
misinsertion assay on DNA and the lacZ.alpha. assay on RNA wherein
higher fidelity mutants had both shorter extension products with
biased pools of dNTPs and lower mutation frequencies in the
lacZ.alpha. assay.
Example 5
Error Rate Determination
[0308] To determine Error Rates, mutant plaques from the lacZ
forward assay were sequenced using known methods. The mutations
were then classified into one of the following categories:
mismatches for misinsertion events, frameshifts for single
insertion or deletion events, or jumps for large insertions or
deletions caused by jumping between similar sequences. An overall
Error Rate was then determined for nucleic acid encoding the lacZ
alpha peptide using the following equation: ER(error
rate)=MF(mutation frequency)/(number of detectable
sites.times.0.5), where the number of detectable sites is 116.
[0309] Not all bases mutated in lacZ forward assays result in a
detectable phenotypic change. To determine specific error rates for
mismatch, frameshift and jumps, the mutation frequency was modified
by multiplying by the percent of the total of each mutant category,
and then used to determine the specific error rate. The following
is a sequence map of the lacZ.alpha. peptide in M13mp19 from
SUPERSCRIPT.TM. II reverse transcriptase and the high fidelity
SUPERSCRIPT.TM. II H203R T306K F309N reverse transcriptase assays.
Underlining indicates deletions; " " indicates insertions of the
base A, T, C, or G shown above; A, T, C, or G shown above the
complete sequence indicates mismatches. TABLE-US-00007 Map of
Mutations Introduced by SUPERSCRIPT .TM. II T C T T TC C AGCGCAACGC
AATTAATGTG AGTTAGCTCA CTCATTAGGC ACCCCAGGCT TTACACTTTA 1 1 4 CG C
CC TGCTTCCGGC TCGTATGTTG TGTGGAATTG TGAGCGGATA ACAATTTCAC
ACAGGAAACA 1 C CC CG C GCTATG ACC ATG ATT ACG{circumflex over (
)}CCA AGC TTG CAT GCC TGC AGG TCG ACT CTA GAG GAT CCC CGG 1 T AAAA
T A AAA T T A A T T T A T A C GTA CCG AGC TCG AAT TCA CTG GCC GTC
GTT{circumflex over ( )}TTA CAA CGT CGT GAC TGG GAA AAC CCT GGC 7 1
1 1 TTTTT TTTTT C TTTTT C TTT A T T GTT ACC CAA CTT AAT CGC CTT GCA
GCA CAT CCC{circumflex over ( )}CCT{circumflex over (
)}TTC{circumflex over ( )}GCC AGC TGG CGT 1 4
[0310] TABLE-US-00008 TABLE 7 Insertions 40 38% 60% frameshift
(insertion or deletion) Deletions 23 22% Mismatches 36 35% 35%
mismatch Jumps 5 5% 5% Jumps
[0311] TABLE-US-00009 TABLE 8 Overall Error Rate (oER) 1/15,000 (39
.times. 10.sup.-4)/(116 .times. 0.5) Mismatch Error Rate 1/42,500
(0.35 .times. 39 .times. 10.sup.-4)/(116 .times. 0.5) (mER)
Frameshift Error Rate (fER) 1/25,000 (0.60 .times. 39 .times.
10.sup.-4)/(116 .times. 0.5) Jumps Error Rate (jER) 1/297,000 (0.05
.times. 39 .times. 10.sup.-4)/(116 .times. 0.5)
Example 6
Analysis of Enzymatic Activity in Mutant RTs
[0312] Reverse transcriptase (RT) (e.g., retroviral RT) is one of
the most intensely studied DNA polymerases, both because of its use
as an essential tool for the synthesis and cloning of cDNA and
because of its importance as a target for inhibition of HIV
(Skalka, A. M. and Goff, S. P., Reverse Transcriptase, Cold Spring
Harbor Laboratory Press, Cold Spring, N.Y. (1993)). A dichotomy
exists however in that HIV RT, the focus of much of recent study
(Le Grice, S. F. J. in Reverse Transcriptase (Skalka, A. M. and
Goff, S. P., eds) Cold Spring Harbor Laboratory Press, Cold Spring,
N.Y., pp. 163-191, (1993)), has not been used widely as a tool for
cDNA synthesis. This is because HIV RT has a relatively high error
rate (Bebenek, K. and Kunkel, T. A. in Reverse Transcriptase
(Skalka, A. M. and Goff, S. P., eds) Cold Spring Harbor Laboratory
Press, Cold Spring, N.Y., pp. 85-102 (1993), and because it does
not synthesize efficiently full-length copies of long mRNAs in
vitro. Other forms of retroviral RT used widely to synthesize cDNA,
M-MLV RT and AMV RT, also suffer from these limitations, but to a
lesser extent (Bebenek, K. and Kunkel, T. A. in Reverse
Transcriptase (Skalka, A. M. and Goff, S. P., eds) Cold Spring
Harbor Laboratory Press, Cold Spring, N.Y., pp. 85-102 (1993);
Krug, M. S. and Berger, S. L. Methods in Enzymol. 152:316-325
(1987); Gerard, G. F. and D'Alessio, J. M. (1993) in Methods in
Molecular Biology, Vol 16: Enzymes of Molecular Biology (Burrell,
M. M., ed) pp. 73-93, Humana Press, Totowa, N.J. (1993); Gerard, G.
F., et al., Molecular Biotechnology 8:61-77 (1997)). In addition to
polymerase activity, retroviral RT possesses RNase H activity that
degrades the RNA in an RNA-DNA hybrid (Moelling, K., et al., Nature
New Biology 234:240-244 (1971)). The presence of this degradative
activity is responsible in part for the limitation on efficient
synthesis of long cDNA (Krug, M. S. and Berger, S. L. Methods in
Enzymol. 152:316-325 (1987), Berger, S. L., et al., Biochem.
22:2365-2372 (1983)). The RNase H domain of RT can be mutated to
reduce or eliminate RNase H activity while maintaining
mRNA-directed DNA polymerase activity (Kotewicz, M. L., et al.,
Nuc. Acids Res. 16:265-277 (1988), DeStefano, J. J., et al.,
Biochim. Biophys. Acta 1219:380-388 (1994)), improving the
efficiency of cDNA synthesis (Kotewicz, M. L., et al., Nuc. Acids
Res. 16:265-277 (1988)).
[0313] A second significant drawback to copying mRNA is the
tendency of RT to pause during cDNA synthesis resulting in the
generation of truncated products (Harrison, G. P., et al., Nuc.
Acids Res. 26:3433-3442 (1998), DeStefano, J. J., et al., J. Biol.
Chem. 266:7423-7431 (1991)). This pausing is due in part to the
secondary structure of RNA (Harrison, G. P., et al., Nuc. Acids
Res. 26:3433-3442 (1998), Wu, W., et al., J. Virol. 70:7132-7142
(1996)). Performing cDNA synthesis at reaction temperatures that
melt the secondary structure of mRNA helps to alleviate this
problem (Myers, T. W. and Gelfand, D. H., Biochem. 30:7661-7666
(1991)). In addition, the oligo(dT), primer often used to initiate
cDNA synthesis tends to prime at internal stretches of A residues
in mRNA at lower temperatures, resulting in the synthesis of 3'-end
truncated cDNA products. M-MLV RT does not efficiently synthesize
cDNA from mRNA above 43.degree. C. (Tosh, C., et al., Acta Virol.
41:153-155 (1997)). RNase H-minus (H-) M-MLV RT can be used up to
48.degree. C. because in the absence of RNase H activity the mRNA
template-DNA product complex is maintained during cDNA synthesis in
a structural form that protects RT from thermal inactivation.
[0314] In an effort to raise the temperature at which M-MLV RT can
be used to synthesize cDNA, we have randomly mutagenized the H-
M-MLV RT gene and screened for thermal stable mutants. Several
thermal stable mutants of H- M-MLV RT were identified and purified
enzymes were characterized. We show that when the mutations are
present together they increase RT thermal activity by increasing
its intrinsic thermal stability without altering catalytic
activity.
Experimental Procedures
[0315] Bacterial Strains and Plasmids--E. coli DH10B (Invitrogen)
was used in all experiments. Bacterial liquid cultures were grown
at 37.degree. C. in EG: 2% tryptone, 1% yeast extract, 0.5%
glycerol, 10 mM NaCl, and 1 mM KCl. Solid medium was LB (1%
bactotryptone, 0.5% yeast extract, and 86 mM NaCl)+1.5% agar.
Selective media included 100 .mu.g/ml ampicillin. For induction of
cultures, cells were inoculated into selective EG+0.2% arabinose
and grown for 18 hr.
[0316] RNA and DNA--Chloramphenicol acetyl transferase (CAT) cRNA
(.about.900 nt) with a 40-nucleotide poly(A) tail at the 3'-end was
synthesized by T7 RNA polymerase run-off transcription from
linearized plasmid DNA (D'Alessio, J. M. and Gerard, G. F., Nuc.
Acids Res. 16:1999-2014 (1988)). The cRNA was selected on
oligo(dT)-cellulose to ensure the presence of a poly(A) tail. For
labeling, the 5' end of CAT cRNA was dephosphorylated with alkaline
phosphatase. (rC).sub.n, p(dT).sub.12-18, and p(dT).sub.25-30 were
purchased from Amersham Pharmacia. (rA).sub.630 was purchased from
Miles. (dG).sub.15 and (dT).sub.20 were from Invitrogen. A DNA
24-mer complementary to CAT cRNA that annealed between nucleotides
679 and 692 with its 5' end 146 nucleotides distant from the first
base at the 5' end of the CAT cRNA poly(A) tail was from
Invitrogen. Oligonucleotides to prime PCR and perform site-directed
mutagenesis were from Invitrogen.
[0317] M-MLV RT Gene--The M-MLV RT gene used in these studies was
derived from pRT601 (Kotewicz, M. L., et al., Nuc. Acids Res.
16:265-277 (1988), Gerard, G. F., et al., DNA 5:271-279 (1986)).
The gene starting at nucleotide 2598 and ending at nucleotide 4628
(Shinnick, T. M., et al., Nature 293:543-548 (1981)) was cloned
under control of an araD promoter into plasmid pBAD/HisA
(Invitrogen). The M-MLV gene was further modified by site-directed
mutagenesis without changing amino acid coding to include several
unique restriction endonuclease sites that divided the gene into
five segments (FIG. 2A). The amino end of the protein contained a
His.sub.6 tag to simplify purification that included the following
amino acids: MGGSHHHHHHGMASMTGGQQMGRDLYDDDDKH (amino acids 1-32 of
SEQ ID NO:2). The carboxy end of the protein contained the
additional amino acids NSRLIN present as the result of subcloning
from pRT601 (17). In addition, the M-MLV RT gene was mutated
(D524G, E562Q, D583N) to eliminate RNase H activity. The final
construct was designated pBAD-HSS2 (FIG. 2B), and the gene and gene
product were designated His.sub.6H- RT.
[0318] DNA Sequencing--Plasmid DNA was prepared from an over night
E. coli culture bearing an RT mutant using a Concert High Purity
Miniprep Kit (Invitrogen) following the manufacturer's
instructions. Each DNA was sequenced using a forward and reverse
primer bordering the segment that had been mutagenized to generate
the mutant. The sequencing reactions were carried out as specified
for plasmid DNA using the ABI Big Dye Terminator Sequencing Ready
Reaction Kit. The reactions were analyzed using an ABI PRISM 377
DNA Sequencer.
[0319] Random Mutagenesis--Mutagenic PCR was performed in a
reaction mixture (100 .mu.l) containing 20 mM Tris-HCl (pH 8.4), 50
mM KCl, 1.8 mM MgCl.sub.2, 0.3 mM MnSO.sub.4, 200 .mu.M each of
dCTP, dGTP, dTTP, and dATP, and 0.5 units of Taq DNA polymerase
(Invitrogen Corporation, Carlsbad, Calif.). After a 1 min
denaturation step at 94.degree. C., the cycling protocol was 15 sec
at 94.degree. C., 15 sec at 55.degree. C., and 30 sec at 72.degree.
C. for 20 cycles. Amplification was 100 fold from 50 ng of target
to 5 .mu.g of amplified product. PCR primers included appropriate
restriction endonuclease cut sites. An amplified DNA segment was
cleaved with appropriate restriction endonucleases, gel purified,
and cloned into gel purified vector DNA cut with the corresponding
restriction enzymes.
[0320] Site-directed Mutagenesis--Oligonucleotide site-directed
mutagenesis was carried out by established procedures (Kunkel, T.
A., et al., Methods Enzymol. 154:812-819 (1987), Kunkel, T. A., et
al., Methods Enzymol. 204:125-139 (1991)). Saturation of an amino
acid coding site in the H- RT gene with all possible amino acids
was performed by introducing the sequence NNK (N=A, C, G or T and
K=G or T) at the codon site into the mutagenic oligonucleotide.
[0321] DNA Polymerase Assays--During screening of RT mutants, RT
RNA-directed DNA polymerase activity was assayed with
(rC).sub.n.(dG).sub.15, which is specific for RT under the reaction
conditions used (Gerard, G. F., et al., Biochem. 13:1632-1641
(1974)). Reaction mixtures (50 .mu.l) containing 50 mM Tris-HCl (pH
8.4), 50 mM KCl, 10 mM MgCl.sub.2, 300 .mu.M (rC).sub.n, 120 .mu.M
(dG).sub.15, 0.01% (v/v) Triton X-100, and 100 .mu.M
[.alpha.-.sup.32P]dGTP (1,000 cpm/pmole), were incubated at
37.degree. C. for 10 min in the wells of a 96-well plate. An
aliquot (5 .mu.l) from each well was spotted onto a
Genescreen+(NEN) filter and the filter was washed twice for 10 min
with 4% (w/v) sodium pyrophosphate (pH 8.0). Radioactivity bound to
the dried filter was quantified in a phosphorimager (Molecular
Dynamics).
[0322] RT DNA polymerase unit activity was assayed with
(rA).sub.630.p(dT).sub.12-18 (Houts, G. E., et al., J. Virol.
29:517-522 (1979)). One unit of DNA polymerase activity is the
amount of RT that incorporates one nmole of deoxynucleoside
triphosphate into acid insoluble product at 37.degree. C. in 10
min.
[0323] cDNA synthesis from CAT cRNA was carried out in reaction
mixtures (20 .mu.l) containing 50 mM Tris-HCl (pH 8.4), 75 mM KCl,
3 mM MgCl.sub.2, 10 mM dithiotreitol (DTT), 500 .mu.M each of dATP,
dTTP, dGTP, and [.alpha.-.sup.32P]dCTP (300 cpm/pmole), 1,750
units/ml RNase Inhibitor, 130 .mu.g/ml (465 mM) CAT cRNA, 20
.mu.g/ml (2,300 nM) p(dT).sub.25-30, and 3,250 units/ml (100 mM)
RT. Incubation was at various temperatures for 60, min in
individual tubes. An aliquot of the reaction mixture was
precipitated with TCA to determine yield of cDNA synthesized, and
the remaining cDNA product was size fractionated on an alkaline
1.2% agarose gel (McDonell, M. W., et al., J. Mol. Biol.
110:199-146 (1977)).
[0324] To establish mono- and divalent metal reaction optima,
initial reaction rates were determined under conditions of limiting
RT concentration during a 10-min incubation at 37 or 50.degree. C.
Reaction mixtures (20 .mu.l) contained 50 mM Tris-HCl (pH 8.4), 10
mM DTT, 500 .mu.M each of dTTP, dATP, dCTP, and [.sup.3H]dGTP (100
cpm/pmole), 10 pmoles (2.8 .mu.g) CAT cRNA, 50 pmoles DNA 24-mer,
0.5 pmoles RT, and KCl and MgCl.sub.2, varied in concentration one
at a time.
[0325] Steady-state Kinetic Measurements--The steady-state kinetic
parameters K.sub.m(dTTP) and k.sub.cat were determined as described
(Polesky, A. H., et al., J. Biol. Chem. 265:14579-14591 (1990)),
using (A).sub.n.(dT).sub.30. A range of five [.sup.32P]dTTP
concentrations, which bracketed the K.sub.m(dTTP) value, was used
for each determination of the kinetic parameters. The concentration
of the template-primer and enzyme in the reaction were 2 .mu.M (in
primer termini) and 4 .mu.M, respectively. Reaction mixtures (50
.mu.l) also contained 50 mM Tris-HCl, pH 8.4, 75 mM KCl, 3 mM
MgCl.sub.2, and 10 mM DTT and were incubated at 37.degree. C.
[0326] Mutant Screening--Mutant populations were plated on
selective agar. Individual colonies were inoculated into 120 .mu.l
of selective EG in 96 well plates and grown overnight at 37.degree.
C. The cell density of the cultures was .about.10.sup.9 cfu/ml. An
aliquot of the culture from each well was transferred into a new
96-well plate containing 120 .mu.l per well of selective media
+0.2% arabinose. This plate was incubated at 37.degree. C. for 20
hr to induce expression of RT. An aliquot (5 .mu.l) of culture from
each well was then transferred into another 96-well plate
containing 5 .mu.l per well of 2.times.PLD (50 mM Tris-HCl, pH 8.0,
20 mM EDTA, 1.8% (w/v) sucrose, 1% (v/v) Triton X-100, 10 mM DTT,
and 2 mg/ml lysozyme). After heating for 5 to 10 min at various
temperatures (52 to 58.degree. C.) in a thermocycler and cooling to
room temperature, RT activity in a 5-.mu.l aliquot from the lysate
in each well was assayed with (rC).sub.n.(dG).sub.15 in another
96-well plate as described above. The amount of RT activity in a
5-.mu.l aliquot of extract was within the linear range of the
assay. Lysates were stable at room temperature for at least 1
hr.
[0327] Purification of RTs--All operations were at 4.degree. C.
Induced E. coli cells (5 g) bearing pBAD-HSS2 or a derivative were
suspended in 10 mL of buffer (20 mM Tris-HCl, pH 8.0, 100 mM KCl,
and 1 mM PMSF) and were sonicated for disruption. After
clarification by centrifugation at 20,000.times.g for 30 min, RT
was purified by sequential chromatography on a 5-ml Chelating
Sepharose column charged with Ni.sup.2+ and a Mono S HR 5/5 column
(Amersham Pharmacia). In some cases the RT was fractionated on a
third column (AF-Heparin-650 from TosoHaas) to eliminate traces of
RNase contamination. The purified RT was dialyzed against storage
buffer (40 mM Tris-HCl, pH 8.0, 100 mM KCl, 0.01% (v/v) Triton
X-100, 0.1 mM EDTA, 1 mM DTT, and 50% v/v glycerol) and stored at
-20.degree. C. RT purified by this procedure was >90%
homogeneous as judged by SDS PAGE and was free of detectable
contaminating DNA endonuclease, DNA exonuclease, and RNA
endonuclease.
[0328] Thermal Inactivation Profile of RT in Extracts--Cell lysates
prepared in PLD as described already were heated in a 96-well plate
in a thermocycler in which a temperature gradient exists through
the rows, but the temperature in each column is the same. After
incubation for 5 min at temperatures ranging from 25.degree. C. to
56.degree. C., RT activity was assayed with (rC).sub.n.(dG).sub.15
as described already.
[0329] Half Life Determination--Mixtures (20 .mu.l) were incubated
for various times in 0.5-ml tubes in a thermocycler at 50 or
55.degree. C. and contained 50 mM Tris-HCl (pH 8.4), 75 mM KCl, 3
mM MgCl.sub.2, 10 mM DTT, 0.1% (v/v) Triton X-100, and 3-7 .mu.g/ml
purified RT. Incubation was stopped by placing the tube in ice. An
aliquot (5 .mu.l) was assayed for residual activity with
(rA).sub.630.p(dT).sub.12-18.
[0330] Measurement of K.sub.D by Filter Binding--A nitrocellulose
filter-binding assay (Bailey, J. M., Anal. Biochem. 93:204-206
(1979), Strauss, H. S., et al., Gene 13:75-87 (1981)) was used to
determine the nucleic acid binding constants (K.sub.D) of RTs for
CAT cRNA*(dT).sub.20. Dephosphorylated CAT cRNA was labeled at the
5' end with [.gamma.-.sup.32P]ATP and T4 polynucleotide kinase
(Boehringer). Oligo(dT).sub.20 was annealed to the poly(A)-tailed
CAT cRNA in a buffer containing 10 mM Tris-HCl, pH 7.5, and 80 mM
KCl at 65.degree. C. for 5 min followed by chilling on ice.
Reaction mixtures (100 .mu.l) containing binding buffer (50 mM
Tris-HCl, pH 8.4, 75 mM KCl, 3 mM MgCl.sub.2, and 10 mM DTT), 0.05
nM 12P-labeled CAT cRNA, 1 nM (dT).sub.20, and 1 to 50 nM RT were
incubated at 23.degree. C. for 5 min. After incubation, the mixture
was filtered through a nitrocelullose filter (Millipore, HA 0.45
mm) soaked in binding buffer, which was then washed with binding
buffer. The K.sub.D is equal to that enzyme concentration at which
50% of the labeled CAT cRNA is bound. For this method of analysis
to be valid, the CAT cRNA concentration in the reaction must be
substantially below K.sub.D, so that the total enzyme concentration
approximates the concentration of free unbound enzyme.
Results
[0331] Mutants Generated by Random Mutagenesis--PCR primers were
designed to amplify each of five segments of the M-MLV His.sub.6H-
RT gene (FIG. 2A) and to contain appropriate restriction
endonuclease cut sites. Each segment was randomly mutagenized by
PCR mutagenesis (Experimental Procedures), digested with the
appropriate restriction endonucleases, and cloned into a similarly
digested pBAD-HSS2 plasmid in such a way as to replace the
corresponding segment in the H- RT gene with the mutagenized
segment (FIG. 2B). Libraries were sampled by DNA sequencing of the
mutagenized H- RT gene segment of a small number of clones to
determine the mutation frequency. The goal was to achieve rates of
PCR random mutagenesis that produced 1 to 2 mutations per segment.
We found that random mutagenesis that produced greater than 2
mutations per segment tended to produce a large proportion of
inactive RT mutants. If the library met this criterion, further
screening by heat treatment was carried out to identify mutants
that showed greater RT activity in lysates than H- RT after a heat
treatment step (Experimental Procedures; FIG. 7A). Those mutants
with the highest apparent thermal stability were screened again in
duplicate by pretreatment at 24.degree. C. (to normalize for
activity) and at 52 to 58.degree. C. to confirm the presence of
enhanced thermal stability (FIG. 7B). In all, about 15,000 clones
were screened by heat treatment in the 96-well format for each
segment or a total of about 100,000 mutants.
[0332] Two mutants were found that produced RT with greater thermal
stability than H- RT. DNA sequencing of their genes revealed them
to be H204R in segment 2 and T306R in segment 3. Having identified
two amino acid locations that influence RT thermal stability, we
wished to establish if the particular mutant amino acid selected
gave the greatest possible increase in thermal stability. The two
sites in the H- RT gene were independently subjected to
site-directed mutagenesis in which the sequence NNK was substituted
for the existing codon in the mutagenic oligonucleotide
(Experimental Procedures). Eighty-four members from each of these
libraries were screened for thermal stable mutants. The results
showed that T306K and T306R were the most thermal stable variants
at T306, with T306K being somewhat more thermal stable, and H204R
was the most thermal stable variant at H204.
[0333] The mutations were combined in one clone by sequential
site-directed mutagenesis. Assay of heat-treated extracts showed
that the double mutant His.sub.6H- H204R T306K R was more thermal
stable than either mutant alone and much more thermal stable than
His.sub.6H- RT (FIG. 8).
[0334] Utilizing plasmid pBAD-HSS2 that contained the H204R and
T306K mutations as a starting point, RT gene segments 1 through 5
were again randomly mutagenized and libraries were screened for
additional mutations that rendered His.sub.6H- H204R T306K R more
thermal stable. One additional mutation, M289L, in segment 3 was
identified that increased the thermal stability of the RT double
mutant in crude extracts.
[0335] Mutants from Single-Site Mutagenesis--His.sub.6H- T306K R
was mutated at position F309 to F309N by site-directed mutagenesis
as part of a study of the fidelity of H- RT. The F309N mutation
increased the thermal stability of His.sub.6H- T306K R in crude
extracts.
[0336] Thermal Stability of Purified Mutant RTs--A number of RT
mutants were purified to near homogeneity (Experimental Procedures)
in order to establish their intrinsic thermal stability in the
absence of contaminants and to characterize their enzymatic
properties. The intrinsic thermal stability of purified forms of
single mutants of His.sub.6H- RT at each of the 4 positions were
established and compared with that of the starting enzyme.
Mutations T306K, M289L, or F309N increased the half-life of
His.sub.6H- RT a small amount at 50.degree. C. from 8 min to
between 10 and 13 min (Table 9). TABLE-US-00010 TABLE 9 Half-lives
of purified RT mutants at 50.degree. C. Enzyme Half-life at
50.degree. C. (min).sup.a H-RT (SUPERSCRIPT .TM. II) 3.2 .+-. 0.2
His.sub.6 H-RT 8 .+-. 1.2 (1.6 .+-. 0.3).sup.b His.sub.6 H-H204R RT
43 .+-. 9 His.sub.6 H-T306K RT 10 .+-. 0.4 His.sub.6 H-F309N RT 13
.+-. 3 His.sub.6 H-M289L RT 13 .+-. 1 His.sub.6 H-H204R T306K RT 78
.+-. 8 H-H204R T306K F309N RT 30 His.sub.6 H-H204R T306K F309N RT
105 .+-. 11 His.sub.6 H-H204R M289L T306K F309N RT 240 .+-. 10 (8.1
.+-. 0.3) .sup.aMean .+-. standard deviation of two or three
determinations .sup.bHalf-lives at 55.degree. C. are in
parentheses
[0337] The single mutation with the greatest impact was H204R,
which increased the half-life of RT at 50.degree. C. 5-fold (Table
9). However, combining the mutations had at a minimum a positive
additive effect upon thermal stability. Combining H204R and T306K
increased the half-life at 50.degree. C. 10-fold, and combining
M289L and F309N with these two mutations increased the half-life at
50.degree. C. another 3-fold to 240 min (a 30-fold increase
relative to the half-life of the starting enzyme; Table 9).
[0338] The half-lives of His.sub.6H- RT and all its mutants dropped
off at 55.degree. C. relative to 50.degree. C. (Table 9). The
magnitude of the relative increase in intrinsic half-life observed
at 50.degree. C. for the quadruple mutant was maintained partially
at 55.degree. C. (Table 9). The half-life of His.sub.6H- RT of 1.6
min at 55.degree. C. was increased 5-fold by H204R M289L T306K
F309N to 8.1 min (Table 9).
[0339] The presence of an N-terminal tag was seen to increase
thermal stability of the RTs examined. A comparison of an RT with
no N-terminal tag (SUPERSCRIPT.TM. II) with an RT having the same
point mutations and having an N-terminal tag with the sequence
MGGSHHHHHHGMASMTGGQQMGRDLYDDDDKH corresponding to amino acids 1-32
of SEQ ID NO:2 (His.sub.6H- RT) shows that the presence of the tag
increases the thermal stability of the RT. The presence of the tag
increased the half-life of the RT at 50.degree. C. by a factor of
2.5-fold (from 3.2 minutes to 8 minutes). A comparison of the
triple mutant H204R T306K F309N with and without tag showed an
increase in the half-life of the enzyme at 50.degree. C. by a
factor of 3.5-fold (30 minutes to 105 minutes). Thus, the present
invention contemplates RTs with an increased thermal stability that
comprise one or more amino acids added to the N-terminal of the RT.
In addition, the invention contemplates RTs with enhanced thermal
stability that comprise one or more amino acids added to the
C-terminal of the RT.
[0340] Enzymatic Characterization of Purified Mutant RTs--A number
of catalytic properties of the purified RT mutants were compared to
ascertain if introduction of all four point mutations in RT altered
its DNA synthetic activity. With one exception, all of the thermal
stable mutants characterized had RNA-directed DNA polymerase
specific activities greater than that of starting His.sub.6H- RT,
but within a factor of 1.5-fold (Table 10). TABLE-US-00011 TABLE 10
RNA-directed DNA polymerase specific activity of purified RT
mutants DNA Polymerase Specific Activity Enzyme (units/.mu.g)
His.sub.6 H-RT 281 (1.0).sup.a His.sub.6 H-H204R RT 325 (1.16)
His.sub.6 H-T306K RT 402 (1.43) His.sub.6 H-F309N RT 257 (0.91)
His.sub.6 H-M289L RT 339 (1.21) His.sub.6 H-H204R T306K RT 385
(1.37) His.sub.6 H-H204R T306K F309N RT 391 (1.39) His.sub.6
H-H204R M289L T306K F309N RT 410 (1.46) .sup.aRatio of specific
activity setting that of His.sub.6 H-RT at 1.0.
[0341] His.sub.6H- F309N RT had a slightly reduced DNA polymerase
specific activity (Table 10). The catalytic efficiency
(k.sub.cat/K.sub.m) of His.sub.6H- RT and His.sub.6H- H204R M289L
T306K F309N were within a factor of two of each other and their Kms
for nucleotide substrate were similar (Table 11). TABLE-US-00012
TABLE 11 Catalytic constants of purified RT mutants.sup.a Enzyme
K.sub.m (.mu.M) k.sub.cat (sec.sup.-1) k.sub.cat/K.sub.m His.sub.6
H-RT 390 .+-. 98 45 .+-. 18 0.115 His.sub.6 H-H204R 274 .+-. 92 46
.+-. 11 0.17 M289L T306K F309N RT .sup.aMean .+-. standard
deviation of three determinations
[0342] The monovalent and divalent metal ion optima of His.sub.6H-
RT and His.sub.6H-H204R M289L T306K F309N RT were determined. CAT
cRNA.DNA 24-mer in excess over enzyme was used as template-primer
(Experimental Procedures). The optima were the same: 75 mM KCl and
3 mM MgCl.sub.2 at 37.degree. C. for His.sub.6H- RT and His.sub.6H-
H204R M289L T306K F309N and at 50.degree. C. for the quadruple
point mutant. Taken together these results indicate that the four
mutations identified that substantially increased the thermal
stability of H- RT did not appreciably affect its DNA polymerase
catalytic capability.
[0343] In the presence of a template-primer, the half-life of M-MLV
H- RT at 50.degree. C. is increased by a factor of 3 to 4 relative
to the half-life in the absence of nucleic acids. This is the
result of the enzyme being more resistant to heat inactivation when
bound to template-primer than when unbound in solution. Mutations
that impact the affinity of RT for template-primer will affect the
apparent thermal stability of RT when it is engaged in cDNA
synthesis. Therefore the affinities (K.sub.D) of His.sub.6H- RT and
several of its mutants for CAT cRNA.(dT).sub.20 were determined
(Table 12). TABLE-US-00013 TABLE 12 Nucleic acid dissociation
constants of purified RT mutants Enzyme K.sub.D (nM).sup.a,b
His.sub.6 H-RT 8 .+-. 0.5 His.sub.6 H-H204R RT 35 .+-. 0.5
His.sub.6 H-T306K RT 6.6 .+-. 0.4 His.sub.6 H-F309N RT 28 .+-. 2.5
His.sub.6 H-M289L RT 4.7 .+-. 0.7 His.sub.6 H-H204R T306K RT 6.1
.+-. 1.5 His.sub.6 H-H204R T306K F309N RT 7.3 .+-. 2.4 His.sub.6
H-H204R M289L T306K F309N RT 11 .+-. 1.0 .sup.aMean .+-. standard
deviation of two or three determinations .sup.bThe nucleic acid was
CAT cRNA.cndot.(dT).sub.20
[0344] The K.sub.D of the His.sub.6H- RT quadruple mutant was
increased somewhat from 8 nM to 11 nM, indicating that nucleic acid
binding affinity was reduced slightly by the four point mutations
together. Interestingly two of the point mutations when present
alone, H204R and F309N, reduced the binding affinity of His.sub.6H-
RT substantially more, having a K.sub.D of 35 and 28, respectively.
The effects of these mutations on binding were apparently counter
balanced by mutation T306K (K.sub.D=6.6 nM), since the triple
mutant H204R T306K F309N had a K.sub.D of 7.3 nM. We conclude that
when the triple (H204R T306K F309N) or quadruple mutant of
His.sub.6H- RT is engaged in cDNA synthesis, any increase in
apparent thermal stability observed relative to His.sub.6H- RT is
not due to increased protection by virtue of binding more tightly
to template-primer.
[0345] Practical Implication of Higher RT Thermal Stability--To
assess the practical impact of the increases in thermal stability
imparted by the H- RT mutations selected in this study, we measured
the ability of some of the mutants to synthesize full-length CAT
cDNA between 40 and 55.degree. C. (Table 13). TABLE-US-00014 TABLE
13 Synthesis of full-length cDNA product from CAT cRNA by purified
RT mutants at elevated temperatures.sup.a Amount of Full Length
Product (ng) Synthesized at Enzyme 40.degree. C. 45.degree. C.
50.degree. C. 52.5.degree. C. 55.degree. C. His.sub.6 H-RT 517 523
229 40 2 His.sub.6 H-H204R RT 521 446 146 36 17 His.sub.6 H-T306K
RT 456 512 338 122 28 His.sub.6 H-H204R T306K 664 528 330 202 43 RT
His.sub.6 H-H204R T306K 488 556 396 209 53 F309N RT His.sub.6
H-H204R M289L 540 547 539 376 120 T306K F309N RT .sup.acDNA
synthesis reaction mixtures (as described above) contained 9.3
pmoles (2.6 .mu.g) of CAT cRNA. The amounts of full-length products
were established by cutting the region corresponding to the size of
each full-length band from a dried alkaline 1.2% agarose gel and
counting it in a scintillation counter.
Reaction mixtures contained 2 pmoles of RT and were incubated at
the temperatures indicated for 60 min. The results of a single
experiment are shown. Similar results were obtained in one other
experiment.
[0346] The amount of RT relative to template-primer was limiting in
these reactions. In the presence of limiting RT, failure to achieve
full-length cDNA synthesis as the temperature is increased is an
indicator of thermal inactivation of the enzyme under cDNA
synthesis conditions. With one exception at temperatures above
50.degree. C., the amount of full-length CAT cDNA synthesized by a
particular RT mutant (Table 13) correlated well with the thermal
stability (half-life) of the enzyme at 50.degree. C. (Table 9). The
one exception is mutant H204R. It produced less full-length cDNA
than His.sub.6H- RT at 50 and 52.5.degree. C., in spite of having a
5-fold greater half-life at 50.degree. C. This is probably due to
the weaker binding of H204R than H- RT to CAT cRNA.DNA, diminishing
thermal protection by template-primer. All the RTs tested
maintained activity at 45.degree. C. relative to 40.degree. C., but
with the exception of the quadruple mutant, all RTs synthesized
less full-length CAT cDNA at 50.degree. C. and above. The
His.sub.6H- RT quadruple mutant was fully active at 50.degree. C.
and at 55.degree. C. synthesized 60 times more full-length CAT cDNA
than His.sub.6H- RT. This was 22% of the amount synthesized by both
enzymes at 40.degree. C.
[0347] The methods of the present invention can be used to engineer
a polypeptide to have a % desired characteristic, for example, a
desired level of thermostability. The nucleic acid sequence of the
polypeptide may be sub-divided into segments and the segments
individually mutagenized, for example, using PCR random
mutagenesis. The individual segments may then be re-assembled and
used to express a mutated polypeptide that is screened for the
desired activity. The Examples above provide working embodiments of
the invention in which the rather large RT gene (2154 bases) was
randomly mutated in segments by PCR random mutagenesis (Leung, et
al., (1989) Technique 1, 11-15. Cadwell, et al., (1992) PCR Methods
and Applications 2, 28-33). It may be desirable to sub-divide the
sequence of the polypeptide of interest into fragments that
correspond to functional or structural domains of the polypeptide
of interest if such domains are known. In the working embodiments
above, the segments roughly corresponded to the coding sequences of
the five separate structural subdomains of RT (Kohlstaedt, et al.,
(1992) Science 256, 1783-1789. Jacobo-Molina, et al., (1993) Proc.
Natl. Acad. Sci. USA 90, 6320-6324). Segments one through four
corresponded to the polymerase subdomain of fingers, palm, thumb,
and connection, respectively, and segment five corresponded to the
RNase H domain (FIG. 2A).
[0348] Using the materials and methods of the present invention,
one skilled in the art can construct a modified RT enzyme having a
desired level of thermostability. In the examples presented above,
the operating temperature of H- M-MLV RT was increased to at least
10.degree. C. above 45.degree. C. This target temperature was
selected as a compromise: high enough to help reduce RNA secondary
structure and low enough to avoid RNA breakdown. Although, the rate
of chemical RNA breakdown catalyzed by Mg.sup.++ increases
dramatically as the temperature is increased above 55 to 60.degree.
C. under cDNA synthesis reaction conditions, it may be desirable in
certain instances (e.g., RNA with pronounced secondary structure)
to conduct a reverse transcription reaction at a temperature higher
than 55.degree. C., for example, at about 60.degree. C., or at
about 65.degree. C., or at about 70.degree. C. Using the methods
described above a suitable RT can be constructed using routine
experimentation.
[0349] Reaction conditions for the mutagenesis reaction may be
adjusted to introduce the desired number of mutations in each
segment. In the present study, an upper limit cut-off of 1 to 2
mutations per segment was set as the target for mutation frequency
to suppress accumulation of deleterious mutations (Lehmann, et al.,
(2001) Current Opinion in Biotechnology 12, 371-375), and to
minimize the amount of screening required to find active mutants.
Those skilled in the art will appreciate that conditions may be
adjusted in order to induce a greater mutation frequency, for
example, by adjusting the concentration of Mn.sup.2+, pH, salt
concentration etc. Mutation frequencies of >5 mutations/segment
in segment one, two, or three produced only about 5% active mutants
with all the mutants having less than wild-type activity. At the
mutation frequency used of 1 to 2 mutations per segment,
approximately one-third of the mutants had little or no activity,
one-third had less than 50% of His.sub.6H- RT activity, and
one-third had up to 100% of His.sub.6H- RT activity.
[0350] Polypeptides produced from the mutated sequences are
screened for a desired activity. The polypeptides may be screened
from crude extracts, partially purified extracts or from purified
polypeptide preparations. In the Examples above, crude extracts of
mutants were screened in a 96-well plate format with
template-primer specific for RT activity (Gerard, et al., (1974)
Biochem. 13, 1632-1641). The procedure used to produce E. coli cell
crude extracts permeabilized rather the lysed the cells, releasing
proteins and small RNAs to the outside of the cell matrix, while
keeping DNA inside. This made representative sampling and assay
with an exogenous template-primer of the cell suspension feasible.
The signal-to-noise ratio of the assay was such that to
differentiate starting from mutant cells at least a two-fold
difference in activity was required. Those skilled in the art will
appreciate that other methods of screening, for example, by first
purifying the mutated polypeptides of interest (e.g., RTs) will
permit detection of smaller changes in activity level.
[0351] Utilizing this approach, two mutations were found in segment
three (thumb) and one in segment two (fingers). A rational sequence
homology approach combined with site-directed mutagenesis was used
to identify a fourth mutation located in the fingers subdomain. The
small number of mutations found and the failure to identify
mutations in segments one and four were probably due to limitations
of both the random mutagenesis approach and the screen. The
mutation frequency cut off of 1 to 2 mutations per segment imposed
on the random mutagenesis limited the mutant space available in the
mutant population. The inability of the assay to detect less than a
two-fold difference in activity probably made many active and
slightly more thermal stable mutants undetectable. Since the RNase
H domain of wild-type M-MLV RT is already substantially more
thermal stable than the polymerase domain (Verma, I. (1975) J.
Virol. 15, 843-854), it was unlikely that stabilizing mutations
introduced in segment five would be picked up in a screen for more
thermal stable polymerase activity.
[0352] In spite of the limited number of mutations found with the
approach used, those that were identified had a significant
positive impact on RT thermal stability. The thermal stability of
His.sub.6H- M-MLV H204R M289L T306K F309N RT was increased 30 fold
at 50.degree. C. The RT operating temperature was increased
7.degree. C. to 55.degree. C. Three of the four mutations alone
increased the RT half-life 1.2 to 1.6-fold and the fourth mutation
gave a 5-fold increase. A well established operating principle in
protein stabilization is that the total stabilization obtained by
multiple mutations is the sum of the effects of individual
mutations, assuming each mutation exerts its effect independent of
the other mutations (Wells, J. A. (1990) Biochem. 29, 8509-8517).
The thermal stabilizing effects of the four mutations appear to be
additive, but an additional contribution to increased thermal
stability due to cooperative interaction between mutations cannot
be excluded.
[0353] Discussion of the mechanisms whereby each of these four
mutations affect the thermal stability and template-primer binding
affinity of M-MLV RT requires a 3-dimensional structural framework.
In the case of the mutation at H204 in the M-MLV RT palm subdomain,
this is easily accomplished because the structure of a fingers-palm
fragment of M-MLV RT is known (Georgiadis, et al., (1995) Structure
3, 879-892). For T306K and F309N located in the thumb, we must rely
on 3-dimensional structural data taken from HIV RT (Kohlstaedt, et
al., Jacobo-Molina, et al., Ding, et al., (1998) J. Mol. Biol. 284,
1095-1111, and Huang, et al., (1998) Science 282, 1669-1675).
Fortunately in this region of the thumb subdomain of HIV RT (T253
to P272) and the corresponding region of M-MLV RT (T296 to P315),
the amino acid sequence is reasonably well conserved. M-MLV RT can
be predicted to have an .alpha.-helix in this region that resembles
the structure of HIV RT .alpha.-helix H (Kohlstaedt, et al.,
Jacobo-Molina, et al., Kneller, et al., (1990) J. Mol. Biol. 214,
171-182, and Rost, B. (1996) Methods Enzymol. 266, 525-539.)
[0354] Together the four RT amino acid changes exerted their
stabilizing effect without significantly altering the DNA
synthesizing catalytic activity of the enzyme. However two
mutations, H204R and F309N, did significantly reduce RT binding to
template-primer (Table 12). M-MLV RT H204R is located in the middle
of the long .alpha.-helix H (.alpha.H) on the backside of the palm
subdomain, directly below .beta.-sheets 10-11 (.beta.10-.beta.11)
(FIG. 9, Georgiadis, et al., supra). Beta-sheets 10-11 contain the
M-MLV RT polymerase catalytic site (YVDD) at residues 222 to 225 on
the inside of the palm that contact the template-primer
(Georgiadis, et al., supra). Changes in H204R could directly affect
packing of amino acid residues near it in .alpha.H and
.beta.10-.beta.11, thus influencing how .beta.10-.beta.11 interact
with template-primer. Or its effect could be translated along the
polypeptide backbone since the .alpha.-helix containing H204 and
the .beta.-sheet containing Y222 are separated by a single short
turn (FIG. 9). As discussed above based upon an amino acid homology
comparison of M-MLV and HIV RT and from crystal structures of HIV
RT (Kohlstaedt, et al., supra, Jacobo-Molina, et al., supra, Ding,
et al., supra, Huang, et al., supra, Kneller, et al., supra, Rost,
Bebenek, et al., (1997) Nature Structural Biology 4, 194-197, and
Beard, et al., (1998) J. Biol. Chem. 273, 30435-30442), F309 in
M-MLV RT can be predicted to be part of a minor groove binding
track in an .alpha.-helix of the RT thumb subdomain. In HIV RT this
structure contributes significantly to RT binding to
template-primer (Bebenek, et al., supra). The aromatic
phenylalanine at position 309 in M-MLV RT corresponds to tryptophan
266 in HIV RT (Bebenek, et al., supra). Extensive amino acid
substitution studies of HIV RT W266 show that any substitution at
this position reduces the binding affinity of RT for
template-primer (Beard, et al., supra). We postulate that
alteration of M-MLV RT F309 to asparagine impacts the structure of
a putative M-MLV RT minor groove binding track resulting in a
reduction in binding affinity for template-primer. Interestingly
T306K was able to compensate for the reduced binding produced by
H204R or H204R and F309N together, restoring template-primer
binding affinity to the original level (Table 12). Again based upon
amino acid homology in this region, T306 in M-MLV RT corresponds to
a lysine in position 263 in the .alpha.-helix of HIV RT that
contains the minor groove binding track. The crystal structure of
HIV RT complexed with double-stranded DNA shows that K263 contacts
the n-2 phosphate of the DNA primer (Ding, et al., supra, Huang, et
al., supra). Introduction into M-MLV RT of a positively charged
lysine in place of phenylalanine at position 306 compensates for
the reduced binding of H204R and F309N, perhaps by enhancing RT
binding at the n-2 primer phosphate position.
[0355] H204R had the greatest individual thermal stabilizing effect
on H- M-MLV RT. At position 204 histidine has been replaced with a
more highly charged arginine in .alpha.-helix H at the underside of
the palm subdomain (Georgiadis, et al., supra). Examination of the
3-dimensional structural model of the fingers-palm fragment of
M-MLV RT (Georgiadis, et al., supra) reveals this substitution
places arginine at a proper distance to form a salt bridge with
E201 in .alpha.-helix H or a hydrogen bond with T128 in the loop
between .beta.-sheet 6 and .alpha.-helix E (FIG. 9). Either event
would help stabilize the RT molecule (Kumar, et al., (2001) Cell.
Mol. Life. Sci. 58, 1216-1233).
[0356] The mutation at position 306 from threonine to lysine
probably contributes to the thermal stability of M-MLV RT by making
an electrostatic contribution to stabilizing the polypeptide
backbone. Saturation of this site with all possible amino acids
showed that only substitution of arginine or lysine increased M-MLV
RT thermal stability. Both of these amino acids could allow for
hydrogen bonding to main chain carbonyl groups and amino acid side
chains in a loop adjacent to the putative .alpha.-helix containing
residue 306.
[0357] Predictions about the mechanism whereby F309N increases
M-MLV RT thermal stability are complicated by its proposed role in
template-primer binding (see discussion above). M-MLV RT position
309 was also examined by saturation with all possible amino acid
changes. Only serine and asparagine increased thermal stability.
Substitution of charged amino acids for the exposed hydrophobic
phenylalanine, which in other protein families correlates well with
amino acid changes observed in transitioning from mesophilic to
thermophilic family representatives (Kumar, et al., supra,
Cambillau, et al., (2000) J. Biol. Chem. 275, 32383-32386), reduced
or eliminated polymerase activity. Correlation of increased thermal
stability with substitution of polar for exposed hydrophobic amino
acids is observed much less frequently in protein families (Kumar,
et al., supra, Cambillau, et al., supra), so that the structural
basis for the stabilizing effect of F.fwdarw.N at position 309 is
not clear.
[0358] In the absence of both 3-dimensional structural information
and reasonable sequence homology between HIV RT and M-MLV RT in the
region of M-MLV RT M289, it is difficult to predict the structural
basis for the contribution of M289L to M-MLV RT thermal stability.
As a general tendency, thermally stable proteins have more and
larger hydrophobic amino acids than their mesophilic counterparts
that are better able to exclude water from the protein core
(Cambillau, et al., supra). It is possible that M-L at position 289
increases M-MLV RT thermal stability through allowing better
hydrophobic packing by replacing an unbranched methionine with a
.beta.-branched leucine (Cambillau, et al., supra).
[0359] Consistent with the results of other studies focused on
identifying mutations that increase protein thermal stability
(Arnold, et al., (2001) Trends in Biochemical Sciences 26,
100-106), the mutations identified in this study probably reside on
the RT surface and influence thermal stability without decreasing
catalytic activity. In the case of two of the stabilizing amino
acids, T306 and F309, they probably reside on a protein surface
that contacts template-primer and they bind in such a way that
their effects on binding are off setting.
[0360] The present invention provides materials and methods for
engineering a polypeptide to contain a desired characteristic. As
an example, the M-MLV RT gene was mutated to increase the
thermostability of the enzyme. The goal of this research was to
increase the temperature at which M-MLV RT efficiently catalyzes
cDNA synthesis from 48.degree. C. to about 55.degree. C. to about
60.degree. C. by increasing the intrinsic thermal stability of RT.
The ability to use retroviral RT at 55 to 60.degree. C. increases
both the efficiency and specificity of priming of cDNA synthesis.
With the mutagenesis and screening approaches used, mutations were
identified that increased the M-MLV RT operating temperature limit
to at least about 55.degree. C. These mutations created a dramatic
increase in intrinsic thermal stability measured as a half-life
increase at 50.degree. C. (30-fold), that was maintained partially
at 55.degree. C. (5-fold increase in half-life). There are
alternative approaches that could potentially build on the four
mutants already identified. For example, the target mutation
frequency could be set much higher (5-10 mutations/segment) during
random mutagenesis of several larger segments of the H- M-MLV RT
quadruple mutant polymerase domain, giving a much smaller
proportion of active mutants but a much broader mutant spectrum.
Several libraries generated in this fashion could then be shuffled
by recombination (Stemmer, W. P. C. (1994) Nature 370, 389-391),
which would tend to eliminate deleterious mutations (Lehmann, et
al., supra). When combined with a 96-well DNA polymerase activity
screen made more sensitive and a sampling procedure used to assay
multiple mutants per well to increase the number of mutations
screened, such an approach should yield additional mutations that
further increase the thermal stability of M-MLV RT.
Example 7
Engineering of SUPERSCRIPT.TM. III RT, Thermal Stability, cDNA
Synthesis
[0361] The gene for Moloney murine leukemia virus (M-MLV) RNase
H-minus (H-) reverse transcriptase (RT), also known as
SUPERSCRIPT.TM. II was randomly mutagenized and mutants were
screened for increased thermal stability. Four mutations were
identified that together increased the half-life of M-MLV H- RT at
50.degree. C. 35-fold and raised the RT cDNA synthesis operating
temperature from 42.degree. C. to 55.degree. C. This increase in
thermal stability was achieved by increasing the intrinsic thermal
stability of M-MLV H- RT and without diminishing the DNA polymerase
catalytic activity of the enzyme.
[0362] Reverse transcriptase (RT, e.g., retroviral RT) is an
essential tool for the synthesis and cloning of cDNA. Forms of
retroviral RT used widely to synthesize cDNA are M-MLV RT and AMV
RT. In addition to polymerase activity, retroviral RT possesses
RNase H activity that degrades the RNA in an RNA-DNA hybrid
(Moelling, et al., (1971) Nature New Biology 234, 240-244). The
presence of this degradative activity is responsible in part for
the limitation on efficient synthesis of long cDNA (Krug and Berger
(1987) Methods in Enzymol. 152, 316-325; Berger, et al., (1983)
Biochem. 22, 2365-2372). The RNase H domain of RT can be mutated to
reduce or eliminate RNase H activity while maintaining
mRNA-directed DNA polymerase activity (Kotewicz, et al., (1988)
Nuc. Acids Res. 16, 265-277; DeStefano, et al., (1994) Biochim.
Biophys. Acta 1219, 380-388), improving the efficiency of cDNA
synthesis (Kotewicz, et al., supra). This has been done in
SUPERSCRIPT.TM. II and ThermoScript.
[0363] A second significant drawback to copying mRNA is the
tendency of RT to pause during cDNA synthesis resulting in the
generation of truncated products (Harrison, et al., (1998) Nuc.
Acids Res. 26, 3433-3442; DeStefano, et al., (1991) J. Biol. Chem.
266, 7423-7431). This pausing is due in part to the secondary
structure of RNA (Harrison, et al., supra, Wu, et al., (1996) J.
Virol. 70, 7132-7142). Performing cDNA synthesis at reaction
temperatures that melt the secondary structure of mRNA helps to
alleviate this problem (Myers and Gelfand, (1991) Biochem. 30,
7661-7666). In addition, the oligo(dT).sub.n primer often used to
initiate cDNA synthesis tends to prime at internal stretches of A
residues in mRNA at lower temperatures, resulting in the synthesis
of 3'-end truncated cDNA products. M-MLV RT does not efficiently
synthesize cDNA from mRNA above 43.degree. C. (Tosh, et al., (1997)
Acta Virol. 41, 153-155).
[0364] In an effort to raise the temperature at which
SUPERSCRIPT.TM. II RT can be used to synthesize cDNA, we have
randomly mutagenized the SUPERSCRIPT.TM. II RT gene and screened
for thermal stable mutants. Several thermal stable mutants of
SUPERSCRIPT.TM. II RT were identified and purified enzymes were
characterized. We show that when the mutations are present together
they increase RT thermal activity by increasing its intrinsic
thermal stability without altering catalytic activity.
[0365] SUPERSCRIPT.TM. III RT Purification: The SUPERSCRIPT.TM. III
RT gene was derived from SUPERSCRIPT.TM. II RT. Four mutations, in
addition to the 3 RNase H mutations present in SUPERSCRIPT.TM. II,
were included along with modifications to the N-terminus to
increase the thermostability. The gene was cloned into plasmid pBAD
(Invitrogen Corporation, Carlsbad, Calif.) under control of an araD
promoter. The purified protein has an apparent molecular weight of
78 kDa. The plasmid was transformed into E. coli DH10B (Invitrogen
Corporation, Carlsbad, Calif.) cells and a seed stock was grown up
to an O.D. of 1.0 in EG (2% Tryptone, 1% yeast extract, 0.5%
glycerol, 10 mM NaCl, and 1 mM KCl) and frozen in 60% S.O.B./40%
glycerol at -80.degree. C.
[0366] For purification, a stab from the frozen seed was used to
inoculate a starter culture of 500 ml. The media used for the
R&D prep was either EG or CircleGrow (Bio101), supplemented
with 100 .mu.g/ml Ampicillin. The starter culture was incubated
overnight at 37.degree. C. and used to inoculate 10 liters EG+Amp
media. The culture was incubated at 37.degree. C. to an OD.sub.600
of 1.0 (3-4 hours), induced with 0.2% arabinose, and incubation
continued another 3 hours. Cells were pelleted by centrifugation at
5,000 g for 20 minutes at 4.degree. C. The supernatant was removed
and cells were either frozen at -80.degree. C. or processed.
[0367] Purification of SUPERSCRIPT.TM. III was done the same as
SUPERSCRIPT.TM. II and is outlined as follows, with the exception
of using an AF-Heparin 650M resin (TosoHaas) in place of Heparin
Agarose as the third column. All buffers must be autoclaved and
columns thoroughly cleaned to prevent RNase contamination. The
procedure is done at 4.degree. C. unless otherwise indicated.
[0368] Purification Method A. Thaw 50 grams of cells in 100 ml
Buffer A (2 ml per g of cell pellet: 20 mM Tris-HCL pH 7.5, 25 mM
NaCl, 1 mM EDTA, 1 mM DTT, 1.3 mM PMSF), stirring at 4.degree. C.
until homogenous. Add another 0.78 ml 0.1 M PMSF and mix well (5
minutes). Strain cells through 6 layers of cheesecloth. Filter the
sample through gaulin pre-equilibrated with 1 volume Buffer A
(avoid bubbles and particulates in gaulin) at 4-6.degree. C. with
pressure at 8000 psi. Repeat and check sample for >80% lysis.
Determine volume of cells and add 0.053 V of 5M NaCl to lysate.
Stir at 4.degree. C. till mixed. Add 0.111 V of 5% polymin P (pH
7.9) over 30 minutes while mixing and then mix for another 30
minutes. Centrifuge at 18,100 g for 60 min at 4.degree. C., keep
the supernatant. Add 226 g/L (NH.sub.4).sub.2SO.sub.4 to
supernatant over 30 minutes while stirring and mix for another 30
minutes. Centrifuge at 18,100 g for 60 min at 4.degree. C., keep
the supernatant. Resuspend the pellet in Buffer B (20 mM Tris-HCL
pH 7.5, 100 mM NaCl, 1 mM EDTA, 1 mM DTT, 0.01% NOG, 5% glycerol)
at 0.52 ml/g original pellet weight (26 ml) while stirring for 1
hour.
[0369] A G-25 F column (AP-Biotech, 270 ml resin volume) was
equilibrated with Buffer B and then the sample was loaded. The
column was washed and the sample eluted with 2 column volumes of
Buffer B at a flow rate of 3.3 ml/min and fraction volume of 6
ml/tube. Fractions were pooled based on UV absorbance and a clear
amber color. If precipitation formed, the pool was centrifuged at
18,100 g for 30 min at 4.degree. C.
[0370] The fraction pool was loaded onto a P-11 column (Whatman:
2.times. cycled, 25 ml resin volume) pre-equilibrated with Buffer B
at a flow rate of 1.0 ml/min. The column was washed with 10 column
volumes of Buffer C (20 mM Tris-HCL pH 7.5, 100 mM NaCl, 1 mM EDTA,
1 mM DTT, 0.01% NP-40, 5% glycerol) and eluted with 12 column
volumes of a 100 to 500 mM NaCl gradient (Buffer C and 0 to 100% of
Buffer D: 20 mM Tris-HCL pH 7.5, 500 mM NaCl, 1 mM EDTA, 1 mM DTT,
0.01% NP-40, 5% glycerol) at a flow rate of 1.6 ml/min and fraction
volume of 4 ml. Fractions were pooled by either OD.sub.280>50%
peak height or >50% peak RT activity. The fraction pool was then
diluted with one volume of Buffer E (20 mM Tris-HCL pH 7.5, 1 mM
EDTA, 1 mM DTT, 0.01% NP-40, 5% glycerol).
[0371] The diluted pool was then loaded onto an AF-Heparin 650M
column (TosoHaas, 12.5 ml resin volume) pre-equilibrated with
Buffer F (20 mM Tris-HCL pH 7.5, 160 mM NaCl, 1 mM EDTA, 1 mM DTT,
0.01% NP-40, 5% glycerol) at a flow rate of 0.7 ml/min.
[0372] The column was washed with 10 column volumes of Buffer F (20
mM Tris-HCL pH 7.5, 160 mM NaCl, 1 mM EDTA, 1 mM DTT, 0.01% NP-40,
5% glycerol) and eluted with 10 column volumes of a 160 to 700 mM
NaCl gradient (Buffer F and 0 to 100% of Buffer G: 20 mM Tris-HCL
pH 7.5, 700 mM NaCl, 1 mM EDTA, 1 mM DTT, 0.01% NP-40, 5% glycerol)
at a flow rate of 0.5 ml/min and fraction volume of 2 ml. Fractions
were pooled by either OD.sub.280>50% peak height or >50% peak
RT activity. The fraction pool was then diluted with three volumes
of Buffer H (20 mM Tris-HCL pH 7.5, 100 mM NaCl 1 mM EDTA, 1 mM
DTT, 0.03% NP-40, 5% glycerol).
[0373] The diluted pool was then loaded onto an SP Sepharose HP
column (Ap Biotech, 12.5 ml resin volume) pre-equilibrated with
Buffer I (20 mM Tris-HCl pH 7.5, 100 mM NaCl, 1 mM EDTA, 1 mM DTT,
0.01% NP-40, 5% glycerol) at a flow rate of 1.2 ml/min. The column
was washed with 10 column volumes of Buffer I (20 mM Tris-HCL pH
7.5, 100 mM NaCl, 1 mM EDTA, 1 mM DTT, 0.01% NP-40, 5% glycerol)
and eluted with 10 column volumes of a 100 to 280 mM NaCl gradient
(Buffer I and 0 to 40% of Buffer G) at a flow rate of 0.6 ml/min
and fraction volume of 2 ml. Fractions were pooled by either
OD.sub.280>50% peak height or >50% peak RT activity.
[0374] The RT containing fractions from the Sepharose column were
dialyzed against 20 volumes Buffer J (20 mM Tris-HCL pH 7.5, 100 mM
NaCl, 0.1 mM EDTA, 1 mM DTT, 0.01% NP-40, 50% glycerol) overnight
at 4.degree. C.
[0375] Purification Method B. One hundred grams of cells is
suspended in 80 ml of permeabilization buffer (500 mM Bis-Tris, pH
7.0 at 4.degree. C./50 mM EDTA/5 mM DTT). (Note: The DTT can be
added as a separate component and the volume of water added
adjusted accordingly.) 79.6 ml of H.sub.2O is added and the cell
suspension is stirred with an overhead stirrer at .about.700 rpm
with a Heidolph mixer or at 6+with a StirPak mixer using the three
blade mixer shaft. The suspension is checked to ensure that it is
homogeneous by stopping the mixer and pouring the suspension into a
glass beaker slowly while looking for clumps. Once thoroughly
mixed, 80 ml 25% Triton X-100/10% deoxycholic acid (at ambient
temperature) is added while mixing vigorously (as above). 400 ul of
100 mM PMSF is added and the suspension is allowed to stand with
mixing for 30 min at 4.degree. C. 60 ml of 2 M
(NH.sub.4).sub.2SO.sub.4 is added and mixing is continued for an
additional 15 min at 4.degree. C. Samples can now be taken or
proceed to the filtration stage. TABLE-US-00015 Volumes: Cells 100
ml Buffer 80 ml H.sub.2O 79.6 ml Detergent 80 ml PMSF 0.400 ml
(NH.sub.4).sub.2SO.sub.4 60 ml 400 ml
[0376] Filtration. The cell slurry is poured into a circulation
vessel and a flow rate of 1.5 L/min/ft2 through a 0.2 um Spectrum
mixed ester cellulose hollow fiber filter with a 1.0 mm lumen is
established. Extraction is performed with seven volumes of 100 mM
TRIS, pH 8.0/300 mM ammonium sulfate/10 mM EDTA/1 mM DTT/10%
glycerol (v/v) while maintaining 4-6.degree. C. and a TMP of 5-10
psi.
[0377] Once enough filtrate has been collected, the second stage
filtration using an AG/Tech 30,000 MWCO hollow fiber with a maximum
inlet pressure of 50 psi. (all operations chilled to 4-6.degree.
C.) is initiated. Once all seven volumes of extraction have been
collected, the solution is concentrate to 600 ml and diafiltered
against five volumes of 100 mM Tris, pH 8.0/100 mM NaCl/10 mM
EDTA/1 mM DTT.
[0378] The diafiltered retentate is collected and 50 ml previously
equilibrated DEAE cellulose is added. The suspension is mixed
gently for 15 min at 4.degree. C. The resulting solution is
clarified by filtration through a CUNO 30 SP depth filter.
[0379] Chromatography. The above solution is applied to a
previously equilibrated 120 ml column of Macroprep High S (20 mM
Tris, pH 8.0/150 mM NaCl/10% glycerol/1 mM EDTA/1 mM DTT/0.01%
Triton X-100). The column is washed with 10 column volumes of
equilibration buffer and eluted with a linear gradient of
equilibration buffer to the same buffer at 800 mM NaCl. 50
fractions are collected and the major uv peak is pooled.
[0380] The pool is applied to a previously equilibrated 120 ml
column of Ceramic hydroxy apatite (20 mM Kpi, pH 7.0/100 mM KCl/10%
glycerol/1 mM DTT/0.01% Triton X-100) at 20 cm/h. Elution is with
this same buffer and 10 ml fractions are collected. The uv peak is
pooled and an equal volume of solubilization buffer (100 mM Tris,
pH7.5/300 mM NaCV/0.2 mM EDTA/30% glycerol/1 mM DTT) is added.
[0381] The pool is applied to a previously equilibrated 16 ml
column of EM COO-- (20 mM Tris, pH 7.5/100 mM NaCl/0.1 mM EDTA/20%
glycerol/1 mM DTT/0.01% Triton X-100) at 20 cm/h. The column is
washed with two column volecules of equilibration buffer. Elution
is with a linear gradient of equilibration buffer to the same
buffer with 200 mM NaCl. The uv peak is pooled and dialyzed against
20 volumes of 20 mM Tris, pH 7.5/100 mM NaCl/0.1 mM/1 mM DTT/0.01%
Triton X-100/50% glycerol.
[0382] DNA Polymerase Assays: RT DNA polymerase unit activity was
assayed with (rA).sub.630.p(dT).sub.12-18. One unit of DNA
polymerase activity is the amount of RT that incorporates one nmole
of deoxynucleoside triphosphate into acid insoluble product at
37.degree. C. in 10 min. Specific Activity is determined by
dividing the Units/.mu.l by the protein concentration to get
units/mg.
[0383] cDNA synthesis from CAT cRNA was carried out in reaction
mixtures (20 .mu.l) containing 50 mM Tris-HCl (pH 8.4), 75 mM KCl,
3 mM MgCl.sub.2, 10 mM dithiotreitol (DTT), 500 .mu.M each of dATP,
dTTP, dGTP, and [.alpha.-.sup.32P]dCTP (300 cpm/pmole), 1,750
units/ml RNase Inhibitor, 130 .mu.g/ml (465 nM) CAT cRNA, 20
.mu.g/ml (2,300 nM) p(dT).sub.25-30, and 3,250 units/ml (100 nM)
RT. Incubation was at various temperatures for 60 min individual
tubes. An aliquot of the reaction mixture was precipitated with TCA
to determine yield of cDNA synthesized, and the remaining cDNA
product was size fractionated on an alkaline 1.2% agarose gel. To
establish mono- and divalent metal reaction optima, initial
reaction rates were determined under conditions of limiting RT
concentration during 10 min incubation at 37.degree. C. or
50.degree. C. Reaction mixtures (20 .mu.l) contained 50 mM Tris-HCl
(pH 8.4), 10 mM DTT, 500 .mu.M each of dTTP, dATP, dCTP, and
[.sup.3H]dGTP (100 cpm/pmole), 10 pmoles (2.8 .mu.g) CAT cRNA, 50
pmoles DNA 24-mer, 0.5 pmoles RT, and KCl and MgCl.sub.2, varied in
concentration one at a time.
[0384] Half Life Determination: Mixtures (20 .mu.l) were incubated
for various times in 0.5-ml tubes in a thermocycler at 50.degree.
C. or 55.degree. C. and contained 50 mM Tris-HCl (pH 8.4), 75 mM
KCl, 3 mM MgCl.sub.2, 10 mM DTT, 0.1% (v/v) Triton X-100, and 3-7
.mu.g/ml purified RT. Incubation was stopped by placing the tube in
ice. An aliquot (5 .mu.l) was assayed for residual activity with
(rA).sub.630.p(dT).sub.12-18.
[0385] Measurement of K.sub.D by Filter Binding: A nitrocellulose
filter-binding assay was used to determine the nucleic acid binding
constants (K.sub.D) of RTs for CAT cRNA.(dT).sub.20.
Dephosphorylated CAT cRNA was labeled at the 5' end with
[.gamma.-.sup.32P]ATP and T4 polynucleotide kinase (Boehringer).
Oligo(dT).sub.20 was annealed to the poly(A)-tailed CAT cRNA in a
buffer containing 10 mM Tris-HCl, pH 7.5, and 80 mM KCl at
65.degree. C. for 5 min followed by chilling on ice. Reaction
mixtures (100 .mu.l) containing binding buffer (50 mM Tris-HCl, pH
8.4, 75 mM KCl, 3 mM MgCl.sub.2, and 10 mM DTT), 0.05 nM
.sup.32P-labeled CAT cRNA, 1 nM (dT).sub.20, and 1 to 50 nM RT were
incubated at 23.degree. C. for 5 min. After incubation, the mixture
was filtered through a nitrocellulose filter (Millipore, HA 0.45
mm) soaked in binding buffer, which was then washed with binding
buffer. The K.sub.D is equal to that enzyme concentration at which
50% of the labeled CAT cRNA is bound. For this method of analysis
to be valid, the CAT cRNA concentration in the reaction must be
substantially below K.sub.D, so that the total enzyme concentration
approximates the concentration of free unbound enzyme.
[0386] LacZ.alpha. Fidelity measurements: Fidelity measurement were
conducted using a modified lacZ.alpha. gapped procedure from Boyer,
J. C. et al., (Methods in Enzymology, Vol 275, p 523-537). Briefly,
a modified pUC19 plasmid containing the promoter for T7 RNA
polymerase between nucleotides -112 and -113 (where position +1 is
the first transcribed nucleotide of the lacZ.alpha. gene) was used.
The plasmid was linearized with FspI, and transcription by T7 RNA
polymerase produces a 344 nucleotide transcript. Using this RNA as
template, cDNA synthesis under desired conditions (200 units
SUPERSCRIPT.TM. III RT or 15 units AMV H+ RT in their respective
buffers) was initiated from a 15-mer DNA primer. After heat
denaturation, the RNA was digested and an excess of cDNA was used
for hybridization to a circular DNA substrate containing a
complementary single-stranded gap. This substrate was made by
cutting M13mp19 RF with PvuI and PvuII in the appropriate buffer
and isolating the large linear fragment. This fragment is then
denatured and reannealed to a 2-fold excess of single-strand
M13mp19. The resulting DNA product is transfected into competent
DH12S cells, plated onto LB indicator plates containing X-gal and
IPTG and plaques are scored for color. Mutation frequency was
determined by dividing the number of mutant plaques (light blue or
white) by the total. The enzyme's mutation frequency is corrected
by subtracting the mutation frequency of the starting DNA. The
error rate is determined by dividing the mutation frequency by the
number of known detectable sites (116) and then dividing by the
probability of expressing the minus strand (50%).
[0387] rpsL Fidelity Assay: Fidelity assay was performed based on
the streptomycin resistance that rpsL mutatants exhibit (Fujii, et
al., (1999) J Mol. Biol. 289(4):835-50). Briefly, pMOL 21 plasmid
DNA (4 kb), containing the ampicillin (Ap.sup.r) and (rpsL) genes,
was modified with the insertion of a T7 RNA promoter sequence
downstream of the rpsL gene. The plasmid was linearized with ScaI
and this template was used for in vitro transcription of a 1.4 kb
RNA containing the rpsL gene. A first strand cDNA reaction using
the desired RT and reaction conditions was carried out, followed by
second strand synthesis using pol I, RNase H and ligase. This
double-strand DNA was then cut with HindIII and EcoRI and cloned
back into the original pMOL 21 plasmid and transformed into MF101
competent cells. Cells were plated on ampicillin plates to
determine the total number of transformed cells. Cells were plated
on ampicillin and streptomycin plates to determine the total number
of rpsL mutants. Mutation frequency was determined by dividing the
total number of mutations by the total number of transformed cells.
The error rate was determined by dividing the mutation frequency by
130 (the number of amino acids that cause phenotypic changes for
rpsL) and the template doubling. In addition rpsL was further
modified by altering the sequence prone to mutations to remove
template bias.
[0388] TDT activity: The template-primer was prepared by annealing
a 47-mer template (either RNA or DNA): TABLE-US-00016
5'-GAGTTACAGTGTTTTTGTTCCAGTCTGTAGCAGTGTGTGAATGG
[0389] AAG-3' (SEQ ID NO:6) to a 18-mer DNA primer
(5'-GAACAAAAACACTGTAACTC-3' (SEQ ID NO:10)) [.sup.32P]-labeled at
the 5'-end with T4 polynucleotide kinase (template:primer, 3:1).
Assay mixture (10 .mu.l) contained 5 nM template-primer, 200 units
each of either SUPERSCRIPT.TM. II or SUPERSCRIPT.TM. III, all 4
dNTPs, none or dCTP, dATP, dTTP, dGTP (250 uM each) as shown in the
figure legends, 50 mM Tris-HCl (pH 8.3), 75 mM KCl, 3 mM
MgCl.sub.2, 10 mM DTT. Reactions were incubated at various
temperatures for 10 or 60 min and terminated by the addition of 5
.mu.l of 40 mM EDTA, 99% formamide. Reaction products were
denatured by incubating at 95.degree. C. for 5 min and analyzed by
electrophoresis on urea 6% polyacrylamide gels.
[0390] Half Life Determination: Mixtures (20 .mu.l) were incubated
for various times in 0.5-ml tubes in a thermocycler at 50.degree.
C., 55.degree. C., or 60.degree. C. and contained 1.times. First
Strand Buffer (50 mM Tris-HCl (pH 8.3), 75 mM KCl, 3 mM
MgCl.sub.2), 10 mM DTT, 3 mM MgCl.sub.2 (total to 6 mM), 0.5 mM
dTTP, 0.05% (v/v) NP-40, [methyl-3H]dTTP (20 .mu.Ci/ml), and 5
.mu.l of RT. Incubation was stopped by placing the tube in ice. An
aliquot (5 .mu.l) was assayed for residual Unit activity with 5 mM
poly(A)/3 mM oligo(dT).sub.25. One unit of RT DNA polymerase
activity is the amount of RT that incorporates 1 nmol of
deoxynucleoside triphosphate into acid-insoluble product at
37.degree. C. in 10 min.
[0391] Full-length cDNA profiling: cDNA synthesis from cRNA by
SUPERSCRIPT.TM. III was carried out in reaction mixtures (20 .mu.l)
containing 1.times. First Strand Buffer (50 mM Tris-HCl (pH 8.3),
75 mM KCl, 3 mM MgCl.sub.2), 10 mM dithiotreitol (DTT), 500 .mu.M
each of dATP, dTTP, dGTP, and dCTP, [.alpha.-.sup.32P]-dCTP (300
cpm/pmole), 2 units/.mu.l RNaseOUT, different amounts of RNA, and
0.5 .mu.g oligo(dT).sub.25. The mix is prewarmed at various
temperatures for 2 minutes. After warming, 200 or 400 units of
SUPERSCRIPT.TM. III RT are added. The mixtures were incubated at
the same temperature for another 50 min in individual tubes. The
reactions were stopped by adding 10 .mu.l of 0.5 M EDTA. An aliquot
(5 .mu.l) of the reaction mixture was precipitated with TCA to
determine yield of cDNA synthesized, and the remaining cDNA product
was size fractionated on an alkaline 1.2% agarose gel (McDonell, et
al., J. Mol. Biol. 110, 199-146, 1977). For the RTs from other
vendors, each was assayed following the manufacturer's
suggestion.
Results and Discussion
[0392] Designation of polypeptides. Unless otherwise indicated, the
following designations will be used to describe various
polypeptides of the invention. SUPERSCRIPT.TM. II is M-MLV reverse
transcriptase with a methionine added as a start codon (as
discussed earlier, wild type M-MLV RT is a cleavage product that
does not contain a methionine) and having three point mutations
that reduce RNase H activity. EFN indicates a polypeptide having
the SUPERSCRIPT.TM. II sequence with an N-terminal six histidine
tag sequence MGGSHHHHHHGMASMTGGQQMGRDLYDDDDKH (amino acids 1-32 of
SEQ ID NO:2 and Table 3) and containing the EFN mutations, which
are H204R, T306K, and F309N of the SUPERSCRIPT.TM. II sequence.
Tagged, no His EFN has the tag sequence MASGTGGQQMGRDLYDDDDKH (SEQ
ID NO:3) and the EFN mutations, no tag EFN contains the EFN
mutations. SUPERSCRIPT.TM. III, which may be designated LEFN, has
the SUPERSCRIPT.TM. II sequence and an N-terminal tag sequence
MASGTGGQQMGRDLYDDDDK (SEQ ID NO:11) and the LEFN mutations, which
are H204R, M289L, T306K, and F309N of the SUPERSCRIPT.TM. II
sequence. His tagged LEFN indicates a polypeptide having an
N-terminal six histidine tag sequence
MGGSHHHHHHGMASMTGGQQMGRDLYDDDDKH (amino acids 1-32 of SEQ ID NO:2
and Table 3) and containing the LEFN mutations.
[0393] Purification: The protein expresses well and appears to not
be toxic. Varying levels of arabinose induction were used with 0.2%
being optimal but not very different from 2.0%. Induction times
longer than 3 hours can be done, however there is a 70 kDa product
that is generated over longer incubation periods. It appears to be
a proteolysis product removing the C-terminus as purified
N-terminal Histidine-tagged clones also had this protein
co-purify.
[0394] The purification protocol is essentially the same as was
used for SUPERSCRIPT.TM. II and the SUPERSCRIPT.TM. III enzyme
behaves almost the same throughout the purification.
SUPERSCRIPT.TM. III may be prepared at concentrations of
2,000-4,000 units/.mu.l after dialysis with no precipitation
problems.
[0395] Fidelity: Initial results have shown no difference between
SUPERSCRIPT.TM. II and SUPERSCRIPT.TM. III using either the rpsL or
lacZ.alpha. fidelity assay. RTs have sequence dependant mutation
hotspots in homopolymeric runs of nucleotides, primarily runs of A
or T. These most common mutations at these runs are one nucleotide
insertion or deletion which is caused by the template or primer
breathing and re-annealing with an overlap. The resulting
frameshift mutation usually results in premature termination of the
gene product. The modified EFN polypeptide, which contains the
H204R, T306K, and F309N mutations, had improved frameshift error
rates compared to SUPERSCRIPT.TM. II and MMLV H+. Experiments are
ongoing to determine if SUPERSCRIPT.TM. III, which contains the
M289L mutation in addition to the H204R, T306K, and F309N
mutations, also has this improvement.
[0396] Specific Activity: The specific activity for SUPERSCRIPT.TM.
III is about 25% higher than SUPERSCRIPT.TM. II. RT DNA polymerase
unit activity was assayed with (rA).sub.630.p(dT).sub.12-18 at
37.degree. C. and protein concentration was determined by Bradford
assay. Table 14 shows the RNA-directed DNA polymerase specific
activity of SUPERSCRIPT.TM. II and SUPERSCRIPT.TM. III using
(rA).sub.630.p(dT).sub.12-18 at 37.degree. C. for 10 min.
TABLE-US-00017 TABLE 14 DNA Polymerase Specific Activity Enzyme
(units/mg) SUPERSCRIPT .TM. II 330,000 SUPERSCRIPT .TM. III
410,000
[0397] Mono- and Divalent Metal Reaction Optima: Using primed CAT
RNA as substrate, the Mg.sup.2+ and KCl concentration optima were
determined and are shown in FIGS. 10A and 10B. The DNA polymerase
assay for SUPERSCRIPT.TM. III RT was conducted at 37.degree. C. or
50.degree. C. for 10 minutes under various concentrations of
Mg.sup.2+ (FIG. 10A) or KCl (FIG. 10B). SUPERSCRIPT.TM. II at
37.degree. C. is included for comparison. The Mg.sup.2+
concentration optima is at 3 mM at both 37.degree. C. and
50.degree. C. Though at 50.degree. C. there appears to be a broader
working range of 2-5 mM without much difference. For KCl, the
optima is at 75 mM at both temperatures, but the working range is
from 25-125 mM without much difference. Again at the higher
temperature a broader range is allowed (25-200 mM). Since there is
no change in optima between SUPERSCRIPT.TM. II and III, the
5.times. First Strand Buffer from SUPERSCRIPT.TM. II can be used as
SUPERSCRIPT.TM. III's reaction buffer.
[0398] TdT activity: TdT or non-template directed nucleotide
addition to the 3' primer end is a well known property of many
polymerases including RTs (Chen, D. et al., Biotechniques 2001;
30(3):574-582). Using a DNA template (FIG. 11A), SUPERSCRIPT.TM. II
adds 1-3 additional nucleotides to the end of the transcript.
SUPERSCRIPT.TM. III however has a greatly reduced TdT and on a DNA
template will not add any detectable nucleotides. On an RNA
template (FIG. 11B), SUPERSCRIPT.TM. II adds 1-2 bases with 69% of
the primer extended after 10 minutes and 90% extended after an
hour. SUPERSCRIPT.TM. III does have some TdT activity on RNA
template, but it is reduced with about 14% extended after 10
minutes and 50% extended after an hour at 45.degree. C. as shown in
FIG. 11B. This TdT activity is biased with the addition of dATP
being strongly favored followed by dGTP, dCTP and dTTP for both
SUPERSCRIPT.TM. II and III. TdT activity is temperature and time
dependant. The optimal temperature for SUPERSCRIPT.TM. III is
45.degree. C. to 50.degree. C. while SUPERSCRIPT.TM. II is at
45.degree. C. (FIG. 11). To further minimize TdT activity in any RT
one must shorten the extension time or lower the temperature.
[0399] Fidelity assays. The results of the fidelity assays are
shown in Tables 15 and 16. TABLE-US-00018 TABLE 15 rpsL Fidelity
Assay RT Temp Wt rpsL Mutated rpsL SUPERSCRIPT .TM. III 45.degree.
C. 3.9 .times. 10.sup.-4 3.4 .times. 10.sup.-5 SUPERSCRIPT .TM. II
45.degree. C. 3.5 .times. 10.sup.-4 3.1 .times. 10.sup.-5 MMLV H+
37.degree. C. 3.9 .times. 10.sup.-4 NA
[0400] TABLE-US-00019 TABLE 16 lacZ.alpha. Fidelity Assay RT Temp
Error Rate SUPERSCRIPT .TM. III 45.degree. C. 2.9 .times. 10.sup.-5
50.degree. C. 2.7 .times. 10.sup.-5 55.degree. C. 1.8 .times.
10.sup.-5 SUPERSCRIPT .TM. II 45.degree. C. 2.9 .times. 10.sup.-5
MMLV H+ 45.degree. C. 4.8 .times. 10.sup.-5
[0401] Fidelity assays for SUPERSCRIPT.TM. III, SUPERSCRIPT.TM. II
and MMLV Rnase H+ RTs. rpsL assay was conducted with either WT rpsL
gene or rpsL gene with mutation hotspots removed. A wt rpsL DNA
fragment was used as control to see the spontaneously mutation. The
error rate is about 10.sup.-6 to 10.sup.-7. The lacZ.alpha. assay
was conducted with gapped DNA starting substrate used as a control
with a background error rate of 2.2.times.10.sup.-5.
[0402] Thermal Stability of Purified Mutant RTs: The rate of
chemical RNA breakdown catalyzed by Mg.sup.2+ increases
dramatically as the temperature is increased above 55.degree. C. to
60.degree. C. under cDNA synthesis reaction conditions. In order to
characterize their intrinsic thermal stability, the half lives of
M-MLV, SUPERSCRIPT.TM. II and SUPERSCRIPT.TM. III were measured at
elevated temperatures. The RT enzymes were first diluted to 0.2-0.5
Unit/.mu.l in the IX first strand buffer in the presence of 0.05%
of NP-40. If diluted in absence of detergent, the RT activity is
reduced to more than 90% without incubation (data not shown). FIGS.
12A, 12B, and 12C and Table 17 show the half-lives of M-MLV,
SUPERSCRIPT.TM. II, and SUPERSCRIPT.TM. III at various
temperatures. The RT half-lives were detected in 1.times. First
strand reaction buffer in presence of 0.05% NP-40. Mixtures (20
.mu.l) were incubated for various times in 0.5-ml tubes in a
thermocycler at 50.degree. C., 55.degree. C., or 60.degree. C. and
contained 1.times. First Strand Buffer (50 mM Tris-HCl (pH 8.3), 75
mM KCl, 3 mM MgCl.sub.2), 10 mM DTT, 3 mM MgCl.sub.2 (total to 6
mM), 0.5 mM dTTP, 0.05% (v/v) NP-40, [methyl-3H]dTTP (20
.mu.Ci/ml), and 5 .mu.l of RT. Incubation was stopped by placing
the tube in ice. An aliquot (5 .mu.l) was assayed for remaining
units with 5 mM poly(A)/3 mM oligo(dT).sub.25. The half live of
SUPERSCRIPT.TM. III at 50.degree. C. was 220 minutes, about 35 fold
longer than that of SUPERSCRIPT.TM. II. The half live of
SUPERSCRIPT.TM. III at 55.degree. C. was 24 min, .about.10 fold
longer than that of SUPERSCRIPT.TM. II. TABLE-US-00020 TABLE 17
Summary of RT Half lives at 50.degree. C., 55.degree. C., and
60.degree. C. M-MLV SUPERSCRIPT .TM. II SUPERSCRIPT .TM. III (min)
(min) (min) 50.degree. C. ND 6.1 220 55.degree. C. 1.5 2.2 24
60.degree. C. 0.6 ND 2.5
[0403] Full-length cDNA profiling of RT: A practical method for
judging the useful higher temperature of the DNA polymerase
activity of RT is an assessment of the effect of increasing
reaction temperature on the amounts of full-length cDNA products
synthesized by RT from mixture of cRNA of various lengths. The
labeled full-length cDNA products can be separated and quantified
on an alkaline agarose gel. As the reaction temperate is increased,
full-length cDNA products disappear starting with those derived
from longer cRNA until a temperature is reached where no
discernible full-length product of any length is synthesized. For
comparison, we included Clontech's PowerScript RT, Stratagene's
StrataScript RT, Promega's ImProm II RT, and SUPERSCRIPT.TM. II
(Invitrogen Corporation, Carlsbad, Calif., catalog # 18064022).
Only SUPERSCRIPT.TM. III could produce a clear 9.5 kb full-length
product at 50.degree. C., and SUPERSCRIPT.TM. II can get a very
faint 9.5 kb band.
[0404] To compare RT from different companies, the same number of
units of RT were used for comparison. PowerScript RT is .about.350
unit/.mu.l, StrataScript RT is 50 unit/.mu.l, ImProm II is 50
unit/.mu.l. SUPERSCRIPT.TM. II, SUPERSCRIPT.TM. III and PowerScript
RT were diluted to 50 unit/.mu.l in RT dilution buffer. 100 units
(2 .mu.l) of RT enzyme were used. The amounts of full-length
products generated were determined and are shown in Tables 17 and
18 for various length templates. SUPERSCRIPT.TM. III RT shows
improved performance at 50.degree. C. and 55.degree. C. compared to
the other RTs. TABLE-US-00021 TABLE 17 Comparison of full length
cDNA produced by various RTs. Total Amount of cDNA Full-Length cDNA
Temp. RT Pmol 7.5 kb (ng) 2.4 kb (ng) 45.degree. C. PowerScript 293
75 64 StrataScript 199 47 35 ImProm II 256 41 44 SUPERSCRIPT .TM.
III 345 99 72 SUPERSCRIPT .TM. II 300 100 59 50.degree. C.
PowerScript 180 54 31 StrataScript 9 <2 <2 ImProm II 42 <2
<2 SUPERSCRIPT .TM. III 323 97 68 SUPERSCRIPT .TM. II 170 46 22
55.degree. C. PowerScript 5 <2 <2 StrataScript 5 <2 <2
ImProm II 3 <2 <2 SUPERSCRIPT .TM. III 37 3 22 SUPERSCRIPT
.TM. II 3 <2 <2
[0405] The amounts of full-length product were established by
cutting the region in a dried 1.2% alkaline agarose gel
corresponding to the size of each full-length band and counting it
in a scintillation counter. Only amounts of full-length products
>2 ng could be seen as discernible bands on the gel
autoradiograph. The cDNA synthesis reactions were performed in 20
.mu.l with 0.25 .mu.g of 2.4 kb, 0.5 mg of 7.5 kb cRNA, and 0.1
.mu.g of oligo (dT).sub.25. If provided, buffers and other
components were used from their own kits plus 0.1 .mu.l of
.alpha.-.sup.32P-dCTP (10 .mu.Ci/.mu.l). All the reactions were
"hot start." In "hot start" reactions, tubes were incubated at
reaction temperature for 2 minutes before adding enzyme. 2 .mu.l of
RT (50 u/.mu.l) was added and incubated at 45.degree. C. or
50.degree. C. or 55.degree. C. for 50 min. The reactions were
stopped by adding 10 .mu.l of 0.5 M EDTA. After ethanol
precipitation, the products were loaded on 1.2% agarose gel. The
dried gel was exposed on the film for 1 hour. TABLE-US-00022 TABLE
18 Comparison of full length cDNA produced by various RTs. Amount
of full length cDNA (ng) RT Temp (.degree. C.) 9.5 kb 7.5 kb
SUPERSCRIPT .TM. 45 19 54 III 50 26 78 55 13 53 StratScript 45 4 10
50 0 0 55 0 0 ImProm II 45 3 9 50 0 0 55 0 0 OmniScript 45 0 0 50 0
0 55 0 0 PowerScript 45 19 38 50 3 25 55 0 0 M-MLV 45 10 39 50 0 3
55 0 0 ThermoScript 45 16 38 50 29 56 55 3 13
[0406] cDNA synthesis reaction mixtures contained 9.5 kb (1.1
.mu.g) and 7.5 kb (0.8 .mu.g) cRNA. The cDNA synthesis reactions
were performed in 20 .mu.l with 20 .mu.g of Hela total RNA, and 0.5
.mu.g of oligo (dT).sub.25. If provided, buffers and other
components used were from their own kits plus 0.1 .mu.l of
.alpha.-.sup.32P-dCTP (10 .mu.Ci/.mu.l). All the reactions were
"hot start," 1 .mu.l of RT was added and incubated at 45.degree. C.
or 55.degree. C. for 50 min. 400 or 200 units of SUPERSCRIPT.TM.
III were used for comparison. The reactions were stopped by adding
10 .mu.l of 0.5 M EDTA. After ethanol precipitation, the products
were loaded on 1.2% agarose gel. The dried gel was exposed on the
film for 1 hour.
[0407] In an alternate procedure for comparing RTs from various
sources, a comparison of cDNA synthesis from Hela total RNA was
performed. The cDNA size synthesized by SUPERSCRIPT.TM. III RT at
55.degree. C. is from 0.5-10 kb. cDNA synthesis reactions were
performed in 20 .mu.l with 20 .mu.g of Hela total RNA, and 0.5
.mu.g of oligo(dT).sub.25. If provided, buffers and other
components used were from their own kits plus 0.1 .mu.l of
.alpha.-.sup.32P-dCTP (10 .mu.Ci/.mu.l). All the reactions were
"hot start," 1 .mu.l of RT was added and incubated at 45.degree. C.
or 55.degree. C. for 50 min. 400 or 200 units of SUPERSCRIPT.TM.
III were used for comparison. The reactions were stopped by adding
10 .mu.l of 0.5 M EDTA. Total cDNA synthesis was obtained by
TCA-precipitation of 5 .mu.l of mixtures. After ethanol
precipitation of the rest of the mixture, the products were loaded
on 1.2% agarose gel. The dried gel was exposed on the film for 1
hour.
[0408] Each reaction was performed according to each vendor's
recommendation. In these experiments, we used the buffers provided
with the RTs. DTT, RNase inhibitor, dNTP were used at the
recommended concentration and from the kit if provided. Otherwise,
Invitrogen's reagents were used. 1 .mu.l of RT was used in these
competitive audit. Table 18 shows the result when using 9.5 kb and
7.5 kb cRNA. FIG. 13 shows the results of a competitive audit for
cDNA profiling using poly (A)-tailed RNA ladder. The cDNA synthesis
reactions were performed in 20 .mu.l with 2 .mu.g of RNA Ladder and
0.5 .mu.g of oligo(dT).sub.25. If provided, buffers and other
components were used from their own kits plus 0.1 .mu.l of
.alpha.-.sup.32P-dCTP (10 .mu.Ci/.mu.l). All the reactions were
"hot start," 1 .mu.l of RT was added and incubated at 45.degree. C.
or 50.degree. C. or 55.degree. C. for 50 min. 400 or 200 units of
SUPERSCRIPT.TM. III were used for comparison. The reactions were
stopped by adding 10 .mu.l of 0.5 M EDTA. After ethanol
precipitation, the products were loaded in different order on two
1.2% agarose gels. The dried gels were exposed on the film for 1
hour.
Example 8
RT-PCR Applications
[0409] RT-PCR has become an effective tool in such applications as
detecting RNA, gene expression, profiling, gene quantitation, and
cloning full-length genes. An RNase H minus mutant of MMLV RT,
SUPERSCRIPT.TM. II RT, is widely accepted as the RT choice since it
has already proven that it produces higher cDNA yield and longer
target capacity than MMLV RT.
[0410] Recently we have engineered a new generation
RT--SUPERSCRIPT.TM. III.TM. RT. In addition to all the premier
features of SUPERSCRIPT.TM. II RT, it also provides a high
temperature RT capacity up to 55 degrees, which is approximately 5
degrees or more higher than SUPERSCRIPT.TM. II RT. The enzyme
half-life of SUPERSCRIPT.TM. II RT and SUPERSCRIPT.TM. III RT at
50.degree. C. is 6 minutes and 220 minutes respectively. Efficient
full-length cDNA synthesis activity occurs with SUPERSCRIPT.TM. III
even at 55 degrees RT temperature. High yield and more specific
RT-PCR products were also produced by this enzyme at elevated RT
temperatures. SUPERSCRIPT.TM. III provides a tool for efficient
cDNA synthesis for difficult RNA targets such as high GC and
secondary structured templates.
[0411] The enzyme has also been optimized for RT-PCR for both
sensitivity and long targets. We have demonstrated that
SUPERSCRIPT.TM. III RT is able to amplify as little as 1 pg of
starting HeLa RNA and amplify targets up to 12.3 kb in length. This
enzyme, when used with the accompanying buffers and conditions,
provides performance better than that of other MMLV derivative
reverse transcriptases.
Materials and Methods
[0412] Kit Components: SUPERSCRIPT.TM. III RT (200 U/.mu.l),
5.times. First-Strand Buffer, 0.1M DTT.
[0413] SUPERSCRIPT.TM. III RT=H204R, M289L, T306K, and F309N
mutations and may be referred to as the LEFN RT.
[0414] 5.times. First-Strand Buffer: 250 mM Tris-HCl (pH 8.3), 375
mM potassium chloride, and 15 mM magnesium chloride.
[0415] SUPERSCRIPT.TM. III RT Storage Buffer: 20 mM Tris-HCl, pH
7.5, 100 mM NaCl, 1 mM EDTA, 1 mM DTT, 0.01% NP-40, 50% (v/v)
glycerol.
[0416] RNA: Total HeLa RNA and total rat brain RNA were isolated
using TRIZOL.RTM. Reagent.
[0417] Gel Electrophoresis: RT-PCR products (10 .mu.l) were
analyzed by electrophoresis on 0.8% to 1.5% (w/v) agarose gels in
0.5.times.TBE with 0.4 .mu.g/ml ethidium bromide.
[0418] RT-PCR Procedure: First-Strand cDNA Synthesis for RT-PCR: A
20-.mu.l reaction volume can be used for 10 pg-5 .mu.g of total RNA
or 10 pg-500 ng of mRNA. Add the following components to a
nuclease-free microfuge tube: 1 .mu.l Oligo(dT).sub.20 (500
.mu.g/ml), 10 pg to 5 .mu.g total RNA, 1 .mu.l 10 mM dNTP mix (10
mM each dATP, dTTP, dGTP, and dCTP at neutral pH), and sterile,
distilled water to 12 .mu.l. Alternatively, 50-250 ng random
primers or 2 pmole of a gene specific primer may be used. Use of
random primers requires incubation at 25.degree. C. for 10 min
before the 50.degree. C. incubation.
[0419] Heat the mixture at 65.degree. C. for 5 min and then place
on ice. Collect the contents of the tube by brief centrifugation
and add: 4 .mu.l 5.times. First-Strand Buffer, 2 .mu.l 0.1 M DTT, 1
.mu.l RNaseOUT Recombinant Ribonuclease Inhibitor (40 units/.mu.l,
when using less than 50 ng of starting RNA, the addition of an
RNase inhibitor (e.g., RNaseOUT, Invitrogen Corporation, Carlsbad,
Calif., catalog # 10777019) is essential).
[0420] Mix the contents of the tube gently and incubate at
50.degree. C. for 2 minutes. Add 1 .mu.l (200-400 units) of
SUPERSCRIPT.TM. III RT, mix by pipetting gently up and down.
Incubate 50 min at 50.degree. C. (cDNA synthesis can be performed
at 42.degree. C.-60.degree. C. for oligo(dT).sub.20 or gene
specific primers). Inactivate the reaction by heating at 70.degree.
C. for 15 min. The cDNA can now be used as a template for
amplification in PCR or can be stored at -20.degree. C. until use.
However, amplification of some PCR targets (those >1 kb) may
require removal of RNA complementary to the cDNA. To remove RNA
complementary to the cDNA, add 1 .mu.l (2 units) of E. coli RNase H
and incubate at 37.degree. C. for 20 min.
RT-PCR Optimization
[0421] For the following experiments, either EFN (His-tag), EFN (no
tag), LEFN (His-tag), or LEFN (tag, no His) were used in finding
the optimal conditions for LEFN (tag, no His). These 4 reverse
transcriptases differ in their thermal-stability profiles. The
modified version of SUPERSCRIPT.TM. III, EFN, contains the H204R,
T306K, and F309N mutations. LEFN, otherwise known as
SUPERSCRIPT.TM. III RT, contains the M289L mutation in addition to
the H204R, T306K, and F309N mutations.
[0422] Unless otherwise noted, 20 .mu.l RT reactions were typically
done using 2.5 .mu.M Oligo(dT).sub.20 (500 ng Oligo(dT).sub.12-18
for SUPERSCRIPT.TM. II RT), 0.5 mM dNTPs, 1.times. First-Strand
Buffer, 10 mM DTT, and 40 units of RNaseOUT. In "hot start"
reactions, tubes were incubated at reaction temperature for 2
minutes before adding enzyme. Reactions were treated with 2 units
of RNase H at 37.degree. C. for 20 min after cDNA synthesis.
[0423] For the evaluation of these RTs in RT-PCR, standard 50 .mu.l
PCR reactions were performed. For primer sets deigned to amplify
<4 kb, PCR reactions consisted of 0.2 .mu.M primers, 200 .mu.M
each dNTP, 1.times.PCR Buffer, 1.5 mM MgCl.sub.2, 2 .mu.l of the
cDNA reaction, and 2 units of PLATINUM.RTM. Taq DNA Polymerase. For
primer sets designed to amplify >4 kb, PCR reactions consisted
of 0.2 .mu.M primers, 200 .mu.M each dNTP, 1.times. High Fidelity
PCR Buffer, 2 mM MgSO.sub.4, 2 .mu.l of the cDNA reaction, and 1
unit of PLATINUM.RTM. Taq DNA Polymerase High Fidelity. After an
incubation of 94.degree. C. for 2 min, amplification was 35 to 40
cycles of 94.degree. C. for 15 s, 55.degree. C.-60.degree. C. for
30 s, and 68.degree. C. for 1 min/kb. 10 .mu.l of the PCR reactions
were analyzed on agarose gels containing 0.4 .mu.g/ml EtBr. Primers
used in PCR are found in Table 19.
[0424] cDNA synthesis buffer: Reactions with 50 or 200 units of
SUPERSCRIPT.TM. II RT or EFN (His-tag) were assembled using the
reagent systems of SUPERSCRIPT.TM. II RT (stand-alone),
SUPERSCRIPT.TM. II First-Strand Synthesis System for RT-PCR, and
ThermoScript RT-PCR System. The conditions for each are as follows:
[0425] 1) SUPERSCRIPT.TM. II RT stand-alone: 50 mM Tris-HCl (pH
8.3), 75 mM KCl, 3 mM MgCl.sub.2, 0.5 mM dNTPs [0426] 2)
SUPERSCRIPT.TM. II First-Strand Synthesis System for RT-PCR: 20 mM
Tris-HCl (pH 8.4), 50 mM KCl, 5 mM MgCl.sub.2, 0.5 mM dNTPs [0427]
3) ThermoScript RT-PCR System: 50 mM Tris-acetate (pH 8.4), 75 mM
potassium acetate, 8 mM magnesium acetate, 1 mM dNTPs 20 .mu.l RT
reactions containing 1 pg to 100 ng of starting total HeLa RNA were
performed at 45.degree. C. for 50 min followed by 85.degree. C. for
5 min. 2 .mu.l of the resulting cDNA were added to 50 .mu.l PCR
reactions containing the .beta.-actin 353 bp, BF 2.4 kb, Pol
.epsilon. 6.8 kb, or APC 8.5 kb primer set (see Table 19).
[0428] Magnesium chloride was titrated into cDNA synthesis buffers
in final reaction concentrations of 1 to 10 mM, with dNTP
concentrations of 0.5 mM and 1 mM tested concurrently. These
buffers were used in 20 .mu.l RT reactions performed at 45.degree.
C. for 50 min followed by 85.degree. C. for 5 min with 1 pg, 100
ng, or 5 .mu.g of total HeLa RNA and 50 units or 200 units of EFN
(His-tag). 2 .mu.l of the resulting cDNA were added to 50 .mu.l PCR
reactions containing the .beta.-actin 353 bp or Pol .epsilon. 6.8
kb target (the 5 .mu.g cDNA samples were diluted 100 fold before
addition).
[0429] 5.times. First-Strand Buffer containing Tris-HCl at pH 8.0,
8.4, 8.8 and 8.3 were prepared to determine the ideal pH for the
enzyme to function at higher reaction temperatures. 20 .mu.l RT
reactions containing 100 ng to 500 ng of total HeLa RNA and 200
units of SUPERSCRIPT.TM. II or 400 units of LEFN (His-tag) were
performed at 50.degree. C.-60.degree. C. for 50 min (hot start)
followed by 70.degree. C. for 15 min using these different buffers.
2 .mu.l of the resulting cDNA were added to 50 .mu.l PCR reactions
containing the BF 2.4 kb or Pol .epsilon. 6.8 kb primer set.
[0430] RT reaction temperature: SUPERSCRIPT.TM. II RT (50 units),
EFN (His-tag) (50 and 200 units), and ThermoScript RT (15 units)
were compared in RT reactions from 42.degree. C. to 60.degree. C.
20 .mu.l RT reactions containing 1 pg to 100 ng of starting total
HeLa RNA were performed at the given temperatures for 50 min (hot
start) followed by 85.degree. C. for 5 min. 2 .mu.l of the
resulting cDNA were added to 50 .mu.l PCR reactions containing the
.beta.-actin 353 bp, TSC 5.3 kb, or Pol .epsilon. 6.8 kb primer
set.
[0431] SUPERSCRIPT.TM. II RT and EFN (no tag) were compared at 200
units in RT reactions at 45.degree. C. and 50.degree. C. 20 .mu.l
RT reactions containing 1 ng to 1 .mu.g of total HeLa RNA were
performed at the given temperatures for 50 min (hot start) followed
by 70.degree. C. for 15 min. 2 .mu.l of the resulting cDNA were
added to 50 .mu.l PCR reactions containing primer sets from 2.4 kb
to 9.3 kb.
[0432] SUPERSCRIPT.TM. II RT, EFN (His-tag), and EFN (no tag) were
compared at 200 units in RT reactions from 45.degree. C. to
55.degree. C. 20 .mu.l RT reactions containing 1 pg to 100 ng of
total HeLa RNA were performed at the given temperatures for 50 min
(hot start) followed by 70.degree. C. for 15 min. 2 .mu.l of the
resulting cDNA were added to 50 .mu.l PCR reactions containing
either the .beta.-actin 353 bp or Pol .epsilon. 6.8 kb primer
set.
[0433] SUPERSCRIPT.TM. II RT, EFN (His-tag), EFN (no tag), and LEFN
(His-tag) were compared at 200 units in RT reactions from
45.degree. C. to 55.degree. C. 20 .mu.l RT reactions containing 1
pg to 1 .mu.g of total HeLa RNA were performed at the given
temperatures for 50 min (hot start) followed by 70.degree. C. for
15 min. 2 .mu.l of the resulting cDNA were added to 50 .mu.l PCR
reactions containing either the .beta.-actin 353 bp or Pol
.epsilon. 6.8 kb primer set.
[0434] SUPERSCRIPT.TM. II RT, EFN (His-tag), EFN (no tag), and LEFN
(His-tag) were compared at 200 units in RT reactions from
45.degree. C. to 55.degree. C. with a gene-specific primer (CBP 1.6
kb) instead of Oligo(dT). 20 .mu.l RT reactions containing 1 ng or
10 ng of total HeLa RNA were performed at the given temperatures
for 50 min (hot start) followed by 70.degree. C. for 15 min. 2
.mu.l of the resulting cDNA were added to 50 .mu.l PCR reactions
containing the CBP 1.6 kb primer set.
[0435] SUPERSCRIPT.TM. II RT, EFN (no tag), EFN (His-tag), and LEFN
(His-tag) were compared at 200 and 400 units in RT reactions from
45.degree. C. to 60.degree. C. 20 .mu.l RT reactions containing 500
ng of total HeLa RNA were performed at the given temperatures for
50 min (hot start) followed by 70.degree. C. for 15 min. 2 .mu.l of
the resulting cDNA were added to 50 .mu.l PCR reactions containing
either the BF 2.4 kb or Pol .epsilon. 6.8 kb primer set.
[0436] SUPERSCRIPT.TM. II RT, EFN (His-tag), LEFN (His-tag), and
LEFN (tag, no His) were compared at 200 and 400 units in RT
reactions from 45.degree. C. to 60.degree. C. 20 .mu.l RT reactions
containing 500 ng of total HeLa RNA were performed at the given
temperatures for 50 min (hot start) followed by 70.degree. C. for
15 min. 2 .mu.l of the resulting cDNA were added to 50 .mu.l PCR
reactions containing either the BF 2.4 kb or Pol c 6.8 kb primer
set.
[0437] RT enzyme concentration: 20 .mu.l RT reactions containing
0.1 pg to 1 .mu.g of starting total HeLa RNA and 25 units to 250
units of EFN (His-tag) were performed at 45.degree. C. for 50 min
followed by 85.degree. C. for 5 min. 2 .mu.l of the resulting cDNA
were added to 50 .mu.l PCR reactions containing either the
.beta.-actin 353 bp, CBP 1.6 kb, TSC 5.3 kb, Pol .epsilon. 6.8 kb,
or APC 8.5 kb primer set.
[0438] SUPERSCRIPT.TM. II RT and LEFN (His-tag) were compared at
200 units and 400 units in RT reactions from 50.degree. C. to
60.degree. C. 20 .mu.l RT reactions containing 10 ng to 1 .mu.g of
total HeLa RNA were performed at the given temperatures for 50 min
(hot start) followed by 70.degree. C. for 15 min. 2 .mu.l of the
resulting cDNA were added to 50 .mu.l PCR reactions containing
either BF 2.4 kb or Pol .epsilon. 6.8 kb primer set.
[0439] SUPERSCRIPT.TM. II RT and LEFN (His-tag) were compared at
200 units and 400 units (LEFN was also used at 800 units) in RT
reactions (with or without 0.05% Triton X-100) from 50.degree. C.
to 60.degree. C. 20 .mu.l RT reactions containing 500 ng of total
HeLa RNA were performed at the given temperatures for 50 min (hot
start) followed by 70.degree. C. for 15 min. 2 .mu.l of the
resulting cDNA were added to 50 .mu.l PCR reactions containing
either BF 2.4 kb or Pol .epsilon. 6.8 kb primer set. Triton did not
improve the yield of the reaction and actually reduced the yield
slightly.
[0440] LEFN (tag, no His) was compared at 50, 200, and 400 units to
determine the effect on sensitivity. 20 .mu.l RT reactions
containing 0.1 pg to 100 pg of total HeLa RNA were performed at
50.degree. C. under both hot start and cold start conditions
followed by 70.degree. C. for 15 min. 2 .mu.l of the resulting cDNA
were added to 50 .mu.l PCR reactions containing either the
.beta.-actin 353 bp or GAPDH 532 bp primer set.
[0441] Comparison of 85.degree. C., 5 min and 70.degree. C., 15 min
Inactivation Steps. SUPERSCRIPT.TM. II RT and EFN (no tag) were
compared in RT reactions with either a 70.degree. C., 15 min or an
85.degree., 5 min inactivation step. 20 .mu.l RT reactions
containing 1 pg to 100 ng of starting total HeLa RNA and 200 units
of RT were performed at 45.degree. C. for 50 min followed by one of
the inactivation steps. 2 .mu.l of the resulting cDNA were added to
50 .mu.l PCR reactions containing either the M-actin 353 bp, CBP
1.6 kb, Pol .epsilon. 3.5 kb, TSC 5.3 kb, or Pol .epsilon. 6.8 kb
primer set.
[0442] Priming with Oligo(dT).sub.20, Random Hexamers, and
Gene-Specific Primers (GSP). EFN (no tag) and SUPERSCRIPT.TM. II RT
were used in RT reactions containing either 2.5 .mu.M
oligo(dT).sub.20, 50 ng random hexamers, or 0.1 .mu.M GSP. 20 .mu.l
RT reactions containing 1 ng to 1 .mu.g of starting total HeLa RNA
and 200 units of RT were performed at 45.degree. C. for 50 min
followed by 70.degree. C. for 15 min. 2 .mu.l of the resulting cDNA
were added to 50 .mu.l PCR reactions containing either the CBP 1.6
kb, TSC 5.3 kb, or APC 8.5 kb primer set (FIG. 21).
[0443] Comparison of reverse transcriptases from various sources.
LEFN (tag, no His) was compared to Clontech PowerScript.TM. RT,
Stratagene StrataScript.TM. RT, Qiagen SensiScript.TM. RT, Qiagen
OmniScript.TM. RT, and Promega ImProm-II.TM. RT System. RT
reactions containing 0.1 pg to 1 .mu.g of starting total HeLa RNA
or 1 .mu.g of rat brain RNA were performed in duplicate with each
of the reverse transcriptases using the procedure and conditions
recommended by each supplier. 10% of the cDNA reactions were added
to 50 .mu.l PCR reactions containing either the O-actin 353 bp,
GAPDH 532 bp, CBP 1.6 kb, BF 2.4 kb, VIN 4.6 kb, FIB 9.4 kb, or
Dynein 12.3 kb primer set. TABLE-US-00023 TABLE 19 Primer list
Human .beta.-actin - 353 bp sense GCTCGTCGTCGACAACGGCTC (SEQ ID NO:
12) antisense CAAACATGATCTGGGTCATCTTCTC (SEQ ID NO: 13) Human GAPDH
- 532 bp sense GTGAAGGTCGGAGTCAACGGATTT (SEQ ID NO: 14) antisense
CACAGTCTTCTGGGTGGCAGTGAT (SEQ ID NO: 15) Human Cap Binding Protein
(CBP) - 1.6 kb sense ATGGCGATCGTCGAACCGGA (SEQ ID NO: 16) antisense
CACTGTCTTAATATGAATGGGACCTACTGAG (SEQ ID NO: 17) Human B-factor
properdin (BF) - 2.4 kb sense GAGCCAAGCAGACAAGCAAAGCAAGC (SEQ ID
NO: 18) antisense TGTTTTAATTCAATCCCACGCCCCTGT (SEQ ID NO: 19) Human
DNA Polymerase .epsilon. (Pol .epsilon.) - 3.5 kb sense
AAGGCTGGCGGATTACTGCC (SEQ ID NO: 20) antisense
GATGCTGCTGGTGATGTACTC (SEQ ID NO: 21) Human Vinculin (VIN) - 4.6 kb
sense GAGGAGGGCGAGGTGGACGGC (SEQ ID NO: 22) antisense
GAACTAACACACAGCGATGGGTGGGAA (SEQ ID NO: 23) Human Tuberous
Sclerosis 2 (TSC-2) - 5.3 kb sense GGAGTTTATCATCACCGCGGAAATACTGAGAG
(SEQ ID NO: 24) antisense TATTTCACTGACAGGCAATACCGTCCAAGG (SEQ ID
NO: 25) Human DNA Polymerase .epsilon. (Pol .epsilon.) - 6.8 kb
sense CGCCAAATTTCTCCCCTGAA (SEQ ID NO: 26) antisense
CCGTAGTGCTGGGCAATGTTC (SEQ ID NO: 27) Human Adenomatous Polyposis
coli (APC) - 8.5 kb sense GCTGCAGCTTCATATGATCAGTTGTTA (SEQ ID NO:
28) antisense AATGGCGCTTAGGACTTTGG (SEQ ID NO: 29) Human Fibrillin
(FIB) - 9.4 kb sense TGGAGGCTGGGAACGTGAAGGAAA (SEQ ID NO: 30)
antisense ACAGGAATGACCGAGGGTAATCTTGGC (SEQ ID NO: 31) Rat Dynein -
12.3 kb sense GCGGCGCTGGAGGAGAA (SEQ ID NO: 32) antisense
AGGTGGCGGCTCAAACACAAAG (SEQ ID NO: 33) H-fibroblast growth factor
11 (FGF)-240 bp; 97.degree. C. denaturing, 60.degree. C. annealing
temp. sense (f1-60)- CGGGTGGTAACTGGCTGCTGTGGA (SEQ ID NO: 34)
antisense TGGAGGCTGGGAACGTGAAGGAAA (SEQ ID NO: 35) antisense
(r2-299)- GCGGACCTCCCGCTTCTGCCGGA (SEQ ID NO: 36)
H-cystathionine-beta-synthase (CBS 2.4)-2390 bp; 64.degree. C.
annealing temperature sense (f2-71)- CCAAGTAAAACAGCATCGGAACACCAGG
(SEQ ID NO: 37) antisense (r2-2460)- AAAGTCGATCAGCAGTTGCCAGGGG (SEQ
ID NO: 38) H-topoisomerase I (TOP3.2)-3162 bp; 60.degree. C.
annealing temperature sense (f2-80)- CCCACAGTCACCGCCGCTTACCT (SEQ
ID NO: 39) antisense (r1-3241)- CTTCATCCCTCCCCAACCCCAATCT (SEQ ID
NO: 40) H-vinculin (VIN4.6)-4641 bp; 66.degree. C. annealing
temperature sense (f1-132)- GAGGAGGGCGAGGTGGACGGC (SEQ ID NO: 41)
antisense (r2-4772)- GAACTAACACACAGCGATGGGTGGGAA (SEQ ID NO: 42)
H-PolE (PolE 6.8)-6800 bp; 60.degree. C. annealing temperature
sense- CGCCAAATTTCTCCCCTGAA (SEQ ID NO: 43) antisense-
CCGTAGTGCTGGGCAATGTTC (SEQ ID NO: 44) H-.beta.-actin (Bact353)-353
bp; 55.degree. C. annealing temperature sense- 5'
GCTCGTCGTCGACAACGGCTC (SEQ ID NO: 45) antisense-
ACCACATGATCTGGGTCATCTTCTC (SEQ ID NO: 46)
Comparison of SUPERSCRIPT.TM. III to SUPERSCRIPT.TM. II
[0444] A comparison of SUPERSCRIPT.TM. III to SUPERSCRIPT.TM. II
was made using the following assay. Total HeLa RNA (1 .mu.g) was
combined with 10 pmol gene specific primer (antisense primer, Table
19) and hybridized at 65 C for 5 min. Transcription with 200 U of
each enzyme was carried out at 42.degree. C., 50.degree. C., or
55.degree. C. for 50 min. Reverse transcription for comparison of
enzyme preparations were performed using 1 pg, 10 pg, 100 ng or 1
.mu.g of total RNA from HeLa cells with 50 pmol OligodT.sub.(20) at
55.degree. C. 50 min. Reaction components included 0.5 mM dNTPs,
0.01 M DTT, 40 U RNase OUT.TM., 50 mM Tris-KCl (pH 8.3), 75 mM KCl,
3 mM MgCl.sub.2. After reverse transcription, the enzyme was heat
inactivated by incubation at 70.degree. C. for 15 min. After a 20
min. incubation with 2 U RnaseH at 37.degree. C., 2 .mu.L of the 20
.mu.L reaction was amplified by PCR using Platinum Taq hi-fidelity.
The amplification reaction contained 60 mM Tris-SO.sub.4 (pH 8.9),
18 mM NH.sub.4SO.sub.4, 2 mM MgSO.sub.4, 0.2 mM each dNTP, 0.2
.mu.M each primer (Table 19), and 1 U Platinum Taq high fidelity.
The amplification was carried out by an initial 94.degree. C.
denaturation step for two min., followed by 35 cycles of the
following steps: 94.degree. C. 15 sec., X.degree. C. 30 sec.,
68.degree. C. 1 min/kb, where X indicates the annealing temperature
of the primer set listed in Table 19 (55.degree. C.-66.degree. C.).
High G/C content products were amplified with the following cycling
beginning with a 94.degree. C. denaturation step for two min.,
followed by 35 cycles of the following: 97.degree. C., 15 sec.;
60.degree. C. 30 sec.; 68.degree. C. one min. The reactions were
combined with 5 .mu.L 10.times. BlueJuice.RTM. and 20% (11 .mu.L)
of each reaction was electrophorsed through 0.8% or 1.5% agarose
gels stained with 0.5 .mu.g/ml ethidium bromide.
Results
[0445] RT-PCR Optimization: cDNA synthesis buffer. SUPERSCRIPT.TM.
III RT was used with the SUPERSCRIPT.TM. II RT stand-alone
conditions. These conditions were found to be optimal for
SUPERSCRIPT.TM. III RT in first-strand synthesis. No significant
difference in performance in RT-PCR was seen with SUPERSCRIPT.TM.
III RT using the reaction conditions of SUPERSCRIPT.TM. II RT
stand-alone, SUPERSCRIPT.TM. II First-Strand Synthesis System for
RT-PCR, or ThermoScript RT-PCR System with a .beta.-actin 353 bp
target or with larger targets.
[0446] A magnesium concentration of 3 mM was chosen for
SUPERSCRIPT.TM. III RT as this the minimum concentration needed in
the RT reaction and it was the same concentration found with the
SUPERSCRIPT.TM. II RT stand-alone. With 0.5 mM dNTPs, optimal
performance was seen with magnesium concentrations from 3 mM to 7
mM with both low RNA concentrations of 1 pg, 100 ng, and 5
.mu.g.
[0447] The pH of the 5.times. First-Strand Buffer will remain at
8.3 as this is the pH found in the SUPERSCRIPT.TM. II RT buffer and
little difference was seen with different pHs at higher
temperatures (FIG. 14).
[0448] RT reaction temperature. 200 units of LEFN (SUPERSCRIPT.TM.
III RT) showed little reduction in product up to 50.degree. C.,
which is 5.degree. C. higher than the capabilities of
SUPERSCRIPT.TM. II RT (50 U), and 5.degree. C. lower than that of
ThermoScript RT (15 U). Results were similar with both low levels
of RNA and the .beta.-actin 353 bp primer set, and higher levels of
RNA and the TSC 5.3 kb primer set.
[0449] When a His-tag is part of the RT, slightly higher
thermal-stability is noted. RT reactions containing 10 to 1000 ng
of total HeLa RNA and 200 units of SUPERSCRIPT.TM. II or LEFN RT
were run at 45.degree. C. to 55.degree. C. for 50 minutes in a hot
start reaction. 2 .mu.l of the resulting cDNA products were then
added to 50 .mu.l PCR reactions containing the Pol .epsilon. 6.8 kb
primer set. Resulting PCR products were then run on a 0.8% agarose
gel containing 0.4 mg/ml ethidium bromide. Not much difference was
seen between 200 units of EFN (His-tag), EFN (no tag), and LEFN
(His-tag) with the .beta.-actin 353 bp primer set with all three
showing product up to 55.degree. C. However, with the Pol .epsilon.
6.8 kb target, product was also seen up to 55.degree. C. with all
three mutants, except EFN (no tag) showed less product at this
temperature than either of the mutants with His-tags.
[0450] The same temperature profile as found with oligo(dT).sub.20
and the advantage of the His-tag was also seen with a gene-specific
primer. RT reactions containing 1 to 10 ng of total HeLa RNA and
200 units of SUPERSCRIPT.TM. II, EFN, or LEFN RT were run at
45.degree. C. to 65.degree. C. for 50 minutes in a hot start
reaction. 2 .mu.l of the resulting cDNA products were then added to
50 .mu.l PCR reactions containing the CBP 1.6 kb primer set.
Resulting PCR products were then run on a 0.8% agarose gel
containing 0.4 mg/ml ethidium bromide. Using a gene-specific primer
in the RT reaction, 200 units of EFN (His-tag), EFN (no tag), and
LEFN (His-tag) all still showed CBP 1.6 kb product up to 55.degree.
C., but EFN (no tag) showed slightly less than the others at
55.degree. C.
[0451] In order to exploit the stability provided by the His-tag,
LEFN with a tag minus the 6.times.His was designed. RT reactions
containing 500 ng of total HeLa RNA and 200 or 400 units of
SUPERSCRIPT.TM. II, EFN, or LEFN RT were run at 45.degree. C. to
65.degree. C. for 50 minutes in a hot start reaction. 2 .mu.l of
the resulting cDNA products were then added to 50 .mu.l PCR
reactions containing the BF 2.4 kb primer set. Resulting PCR
products were then run on a 0.8% agarose gel containing 0.4 mg/ml
ethidium bromide. Little difference was seen with the mutant when
compared to both EFN (His-tag) and LEFN (His-tag), product was seen
up to 60.degree. C. with all three with the BF 2.4 kb primer set
(FIG. 15).
[0452] RT enzyme concentration. An experiment comparing units of
EFN (His-tag) from 25 units to 250 units showed little difference
in performance over the entire range, when looking at both
sensitivity with the .beta.-actin 353 primer set or with longer
targets. RT reactions containing 0.1 to 1000 ng of total HeLa RNA
and 25 to 250 units of EFN were run at 45.degree. C. for 50 minutes
in a hot start reaction. 2 .mu.l of the resulting cDNA products
were then added to 50 .mu.l PCR reactions containing the
.beta.-actin 353 bp, CBP 1.6 kb, TSC 5.3 kb, Pol .epsilon. 6.8 kb,
or APC 8.5 kb primer set. Resulting PCR products were then run on a
0.8% agarose gel containing 0.4 mg/ml ethidium bromide.
[0453] 200 and 400 units of LEFN (tag, no His) showed slightly
better performance than 50 units with low concentrations of RNA. RT
reactions containing 0.1 to 100 pg of total HeLa RNA and 50 to 400
units of LEFN RT were run at 50.degree. C. for 50 minutes in a hot
start reaction. 2 .mu.l of the resulting cDNA products were then
added to 50 .mu.l PCR reactions containing the .beta.-actin 353 bp
primer (not shown) or the GAPDH 532 primer set. Resulting PCR
products were then run on a 1.5% agarose gel containing 0.4 mg/ml
ethidium bromide. The higher RT units yielded slightly more PCR
product under hot start conditions with both .beta.-actin 353 bp
(data not shown) and GAPDH 532 bp (FIG. 16).
[0454] Priming with Oligo(dT).sub.20, Random Hexamers, and
Gene-Specific Primers (GSP). SUPERSCRIPT.TM. III RT performed
similarly to SUPERSCRIPT.TM. II RT when RT reactions were run with
different priming methods. Oligo(dT) yielded the cleanest product
and highest specific yield with GSP having high levels on
non-specific products (at 55 degrees RT temperature) and random
hexamers having high specificity but low yield.
[0455] Comparison of reverse transcriptases from various sources.
Using .beta.-actin 353 bp primer set, SUPERSCRIPT.TM. III RT was
again able to detect down to 1 pg of starting HeLa RNA. RT
reactions containing 1 to 100 pg of total HeLa RNA were run with
each RT using the reagents and conditions specified in each
protocol. 2 .mu.l of the resulting cDNA products were then added to
50 .mu.l PCR reactions containing the .beta.-actin 353 bp primer
set. Resulting PCR products were then run on a 1.5% agarose gel
containing 0.4 mg/ml ethidium bromide. ImProm II RT and SensiScript
were also able to detect down to 1 pg, but StrataScript and
OmniScript could only detect down to 10 pg, and PowerScript was
unable to even detect 100 pg of starting HeLa RNA.
[0456] With larger targets and higher concentrations of total HeLa
RNA, SUPERSCRIPT.TM. III RT (LEFN tag, no His) performed
significantly better than most of the competitors in relation to
the RT-PCR product yield and length. RT reactions containing 10 to
1000 ng of total HeLa RNA were run with each RT using the reagents
and conditions specified in each protocol. 2 .mu.l of the resulting
cDNA products were then added to 50 .mu.l PCR reactions containing
the CBP 1.6 kb, BF 2.4 kb, VIN 4.6 kb or 9.4 kb primer set.
Resulting PCR products were then run on a 0.8% agarose gel
containing 0.4 mg/ml ethidium bromide. CLONTECH PowerScript only
showed product when the total HeLa RNA was 1000 ng, and the yield
of specific products was not as high as with SUPERSCRIPT.TM. III
RT. Qiagen SensiScript and OmniScript RT showed sufficient product
yield with the smaller targets (CBP 1.6 kb and BF 2.4 kb), but were
not able to detect the longer targets. Stratagene StrataScript was
able to detect all the targets but with lower yields than
SUPERSCRIPT.TM. III RT. Promega ImProm-II RT System showed
performance similar to SUPERSCRIPT.TM. III RT, but did not have as
high a yield with the longest target (FIB 9.4 kb).
[0457] Additional reactions with lower starting HeLa RNA
concentrations showed a similar pattern. RT reactions containing 10
to 100 ng of total HeLa RNA were run with each RT using the
reagents and conditions specified in each protocol. 2 .mu.l of the
resulting cDNA products were then added to 50 .mu.l PCR reactions
containing the CBP 1.6 kb, BF 2.4 kb, VIN 4.6 kb or 9.4 kb primer
set. Resulting PCR products were then run on a 0.8% agarose gel
containing 0.4 mg/ml ethidium bromide. CLONTECH PowerScript was
unable to detect any of the targets with 100 ng or less of starting
total HeLa RNA. Qiagen SensiScript was able to detect the VIN 4.6
kb target with this lower concentration of RNA when it had not been
able to detect this target previously with 1 .mu.g of starting
total HeLa RNA. Promega ImProm-II did not perform as well as
SUPERSCRIPT.TM. III RT with lower concentrations of RNA.
SUPERSCRIPT.TM. III RT was the only RT that was able to detect the
FIB 9.4 kb target with 100 ng starting total HeLa RNA.
[0458] RT-PCR analysis. SUPERSCRIPT.TM. II and SUPERSCRIPT.TM. III
performance in hot start RT-PCR amplification at 42.degree. C.,
50.degree. C., pr 55.degree. C. were compared and the results are
shown in FIG. 17 SUPERSCRIPT.TM. II (Panel A) or SUPERSCRIPT.TM.
III (Panel B). Lanes (in duplicate) 1, 4, 7, and 10 are products
reverse transcribed at 42.degree. C. Lanes 2, 5, 8, and 11 are
products reverse transcribed at 50.degree. C. Lanes 3, 6, 9, and 12
are products transcribed at 55.degree. C. Lanes 1-3 are the result
of RNAs reverse transcribed by gene-specific priming from FGF,
lanes 4-6 CBS 2.4, lanes 7-9 from TOP 3.2, lanes 10-12 VIN 4.6.
Arrows indicate expected product sizes of 240 bp, 2390 bp, 3162 bp,
and 4641 bp. SUPERSCRIPT.TM. II transcribed more robustly at
50.degree. C. whereas SUPERSCRIPT.TM. III best transcribes at
55.degree. C. Amplification at 55.degree. C. for some applications
that require higher annealing temperatures for gene specific
priming and/or to remove secondary structure from an RNA template
may be performed with the polypeptides of the invention. This will
allow the reduction of non-specific priming during reverse
transcription with gene specific primers and/or the increased
reverse transcription of refractory templates.
[0459] SUPERSCRIPT.TM. III RT: Two different purification
techniques. SUPERSCRIPT.TM. III has been purified by two different
methods (see above). In brief, Method A is similar to the
purification technique used for SUPERSCRIPT.TM. II, Method B
differs from method A by the use of a membrane permeabilization
protocol and filtration protocol to reduce cellular debris which
results in a high-purity preparation. RT-PCR was performed using
200 U of SUPERSCRIPT.TM. III purified by Method A or Method B.
RT-PCR was performed using the Pol .epsilon. 6.8 kb primers and
.beta.-act 353 bp primers. Product yield and quality were compared
for both purification methods. The methods yield similar results
and either are viable methods for purification of SUPERSCRIPT.TM.
III.
[0460] Optimum SUPERSCRIPT.TM. III RT enzyme concentration. RT
reactions containing 0.1 pg to 1000 ng of total HeLa RNA and 25 to
250 units of SUPERSCRIPT.TM. II, EFN, or LEFN RT were run at
45.degree. C. for 50 min (hot start). 2 .mu.l of the resulting cDNA
were then added to 50 .mu.l PCR reactions containing the
.beta.-actin 353 bp, CBP 1.6 kb, TSC 5.3 kb, Pol .epsilon. 6.8 kb,
or APC 8.5 kb primer set. Resulting PCR products were then run on a
0.8% or 1.5% agarose gel containing 0.4 .mu.g/ml ethidium bromide.
No significant differences was obtained from 25 units to 250 units
of SUPERSCRIPT.TM. III RT. (FIG. 18). However, higher amount of
SUPERSCRIPT.TM. III RT (400 units) shows higher RT-PCR product
yield at an elevated RT temperature (55 degrees, FIG. 19). In FIG.
19, RT reactions containing 10 to 1000 ng of total HeLa RNA and 200
or 400 units of SUPERSCRIPT.TM. II or LEFN RT were run at
50.degree. C. to 60.degree. C. for 50 min (hot start). 2 .mu.l of
the resulting cDNA were then added to 50 .mu.l PCR reactions
containing the Pol .epsilon. 6.8 kb primer set. Resulting PCR
products were then run on a 0.8% agarose gel containing 0.4
.mu.g/ml ethidium bromide. Unlike SUPERSCRIPT.TM. II RT, increased
amount of SUPERSCRIPT.TM. III RT (up to 400 units) did not inhibit
subsequent PCR amplification (FIG. 20). In FIG. 20, RT reactions
containing 0.1 to 100 pg of total HeLa RNA and 50 to 800 units of
LEFN RT were run at 50.degree. C. for 50 min in hot start
conditions (Oligo(dT).sub.20). 2 .mu.l of the resulting cDNA were
then added to 50 .mu.l PCR reactions containing the GADPH 532 bp
primer set. Resulting PCR products were then run on a 0.8% agarose
gel containing 0.4 .mu.g/ml ethidium bromide.
[0461] SUPERSCRIPT.TM. III RT has been engineered to increase the
temperature at which the enzyme can perform RT activity. The enzyme
has been optimized for RT-PCR for sensitivity, yield, and target
length. With this optimized system, it was demonstrated that
SUPERSCRIPT.TM. III RT was able to detect mRNA targets with as
little as 1 pg of starting total HeLa RNA and tot produce high
yield cDNAs from targets up to 12.3 kb in size. It has the ability
to function at elevated temperatures up to 55.degree. C. and to
detect a wide variety of targets. The performance of this enzyme is
superior to any other RTs commercially available, and the optimized
buffers and RT protocol provide a sensitive and robust RNA
detection system.
Example 9
Use of Polypeptides of the Invention to Prepare Labeled Nucleic
Acid Molecules
[0462] Polypeptides of the invention can be used to prepare labeled
nucleic acids from a variety of templates (e.g., total RNA, mRNA,
etc.). For direct labeling using a polyA tailed RNA template,
suitable reaction conditions may entail the use of from about 1
.mu.g to about 1000 .mu.g, from about 1 .mu.g to about 500 .mu.g,
from about 1 .mu.g to about 250 .mu.g, from about 1 .mu.g to about
100 .mu.g, from about 10 .mu.g to about 1000 .mu.g, from about 10
.mu.g to about 500 .mu.g, from about 10 .mu.g to about 250 .mu.g,
or from about 10 .mu.g to about 100 .mu.g of RNA.
[0463] RNA can be mixed with a suitable primer (e.g., an oligo dT
primer or a gene specific primer). After mixing, the template
primer mixture can be incubated at a suitable temperature (e.g.,
70.degree. C. for an oligo(dT).sub.25 primer) and incubated for a
suitable period of time (e.g., 5 minutes). Those skilled in the art
can readily determine incubation times and temperatures for any
template primer pair using routine experimentation. The mixture may
then be chilled on ice and the remaining reaction components
added.
[0464] Suitable reaction components, which may be provided in a
reaction mixture and/or solution either individually or in
combination, include a buffering agent, reducing agent, one or more
nucleotides, at least one of which may contain a label (e.g., a
fluorescent label), one or more polypeptide of the invention, and
suitable diluent (e.g., H.sub.2O). A suitable reaction mixture can
be prepared by combining 4 .mu.l 5.times. first strand buffer, 2
.mu.l 0.1M DTT, 1 .mu.l 10 mM dNTP, 2 .mu.l 1 mM Fluorescent dNTP,
2 .mu.l SUPERSCRIPT.TM. III (200 u/.mu.l), an aliquot containing
RNA, and dH.sub.2O to 20 .mu.l. Additional reaction mixtures and/or
solutions, as well as components thereof, which may be used with
this aspect of the invention are described elsewhere herein. The
mixture may be incubated at a suitable temperature, for example,
from about 42.degree. C. to about 60.degree. C., from about
45.degree. C. to about 60.degree. C., from about 48.degree. C. to
about 60.degree. C., from about 50.degree. C. to about 60.degree.
C., from about 52.degree. C. to about 60.degree. C., from about
55.degree. C. to about 60.degree. C., from about 42.degree. C. to
about 55.degree. C., from about 45.degree. C. to about 55.degree.
C., from about 45.degree. C. to about 50.degree. C., from about
45.degree. C. to about 48.degree. C., from about 48.degree. C. to
about 60.degree. C., from about 48.degree. C. to about 55.degree.
C., from about 48.degree. C. to about 52.degree. C., from about
50.degree. C. to about 60.degree. C., from about 50.degree. C. to
about 55.degree. C., or from about 50.degree. C. to about
52.degree. C. The mixture may be incubated until a sufficient
incorporation of label is seen, for example, from about 5 minutes
to about 24 hours, from about 10 minutes to about 24 hours, from
about 30 minutes to about 24 hours, from about 1 hour to about 24
hours, from about 2 hours to about 24 hours, from about 4 hours to
about 24 hours, from about 8 hours to about 24 hours, from about 30
minutes to about 16 hours, from about 30 minutes to about 8 hours,
from about 30 minutes to about 4 hours, from about 30 minutes to
about 2 hours, from about 30 minutes to about 1 hour, from about 1
hour to about 4 hours, or from about 1 hour to about 2 hours.
[0465] The reaction may be stopped, for example, by addition of a
suitable stopping reagent (e.g., 5 .mu.l of 0.5M EDTA in a 20 .mu.l
reaction). The resultant labeled nucleic acids may be purified
using any standard technique (e.g., column purification using a
SNAP column, Invitrogen Corporation, Carlsbad, Calif.).
[0466] Labeled nucleic acid produced by the methods of the
invention may be used for a variety of purposes, for example, to
detect a target sequence, which may be present on an array.
Typically, labeled nucleic acid of the invention may be hybridized
to one or more target sequences (e.g., a microarray).
[0467] In some embodiments, polypeptides of the invention may be
used to prepare labeled nucleic acids by indirect labeling. For
example, a modified nucleotide (e.g., an amino allyl nucleotide)
may be incorporated into a nucleic acid molecule using the
polypeptides of the invention. The nucleic acid molecules
containing the modified nucleotide may then be reacted with a
reactive molecule that comprises a detectable moiety (e.g., a
fluorescent moiety, radiolabel and the like). All or a portion of
the reactive molecule and the detectable moiety may then become
attached to the nucleic acid molecule.
[0468] Suitable reaction conditions for indirect labeling include
those listed above. For example, RNA (e.g., 5-50 .mu.g) can be
mixed with a suitable primer (e.g., an oligo(dT).sub.25 for polyA
tailed RNA), mixed and incubated, for example, at 70.degree. C. for
5 min, and then chilled on ice. To the primer: template mixture,
addition reaction components may be added. For example, for a 30
.mu.l reaction volume, suitable component may include: 6 .mu.l
5.times. first strand buffer, 1.5 .mu.l 0.1M DTT, 1 .mu.l RNaseOUT
(40 u/.mu.l), 1.5 .mu.l 10 mM dNTP mixture containing 10 mM dATP,
10 mM dCTP, 10 mM dGTP, 4 mM dTTP, and 6 mM Aminoallyl-dUTP), 2
.mu.l SUPERSCRIPT.TM. III (200 u/.mu.l), X .mu.l dH.sub.2O to a
total volume of 30 .mu.l. The mixture may be incubated at a
suitable temperature for a suitable time such as those described
above, for example, at 50.degree. C. for 2 hours. The mixture may
be treated to degrade the RNA template (e.g., by the addition of 15
.mu.l 1N NaOH, and heating to 70.degree. C. for 10 min). The pH of
the solution may then be adjusted (e.g., by the addition of 15
.mu.l 1N HCl) and the nucleic acid containing the modified
nucleotide may be purified by standard techniques (e.g., using a
SNAP column, Invitrogen Corporation, Carlsbad, Calif.). The
purified nucleic acid may be concentrated (e.g., by ethanol
precipitation).
[0469] After ethanol precipitation, the nucleic acid containing the
modified nucleotide may be resuspended in a buffer suitable for
coupling the reactive molecule containing the detectable moiety to
the nucleic acid. For example, the nucleic acid may be resuspended
in 5 .mu.l coupling buffer (e.g., 0.1 M sodium borate, pH 8.5). The
reactive molecule (e.g., a molecule comprising a dye and a reactive
functionality) may be added (e.g., 5 .mu.l monofunctional Cy3 or
Cy5 dye from APB Cat#PA23001 and # PA25001). When the reactive
molecule is a dye, the dye may be suspended in any suitable solvent
(e.g., DMSO). In one embodiment, 1 pack of CyDye was resuspended in
45 .mu.l DMSO and used as above. The reaction may be incubated for
a suitable length of time and at a suitable temperature, for
example, at room temperature for 1 hour. When the dye is light
sensitive, the incubation is preferably performed in the dark. The
coupling reaction is stopped by the addition of a reagent such as 5
.mu.l of 4M hydroxylamine. The labeled nucleic acid is then
purified (e.g., using a SNAP column, Invitrogen Corporation,
Carlsbad, Calif.).
[0470] Labeled nucleic acids (whether prepared by direct or
indirect labeling) may be hybridized to one or more target
sequences, which may be in any suitable form, for example, in a
microarray. The labeled nucleic acids are denatured (e.g., by
heating at 95.degree. C. for 2 min). The denatured, labeled nucleic
acids are brought into contact with the target sequences in a
suitable buffer. For example, a microarray slide can be placed in a
hybridization buffer (e.g., 25% Formamide, 5.times.SSC, 50 mM MES
pH 6.5, 0.1% SDS) that contains labeled nucleic acid (e.g.,
.about.1 .mu.g of Dye-label probe). The microarray can be incubated
for a suitable time at a suitable temperature, for example, at
42.degree. C. for 16 hours. The microarray may then be washed one
or more times, for example, the hybridization solution may be
removed and the microarray washed in Wash I (5.times.SSC, 0.2%
SDS), followed by a wash in Wash II (1.times.SSC, 0.2% SDS) at
42.degree. C. for 5 min, followed by a wash in Wash III
(0.1.times.SSC) for 2 min. The microarray may be dried, for
example, by spin drying the microarray at 600 rpm for 5 min.
[0471] The hybridized microarray may be analyzed using any
techniques known in the art.
[0472] All publications, patents and patent applications mentioned
in this specification are indicative of the level of skill of those
skilled in the art to which this invention pertains, and are herein
incorporated by reference to the same extent as if each individual
publication, patent or patent application was specifically and
individually indicated to be incorporate by reference.
Sequence CWU 1
1
46 1 2151 DNA Artificial Sequence Mutant Reverse Transcriptase
Derived from Moloney Murine Leukemia Virus CDS (1)..(2148) 1 atg
ggg ggt tct cat cat cat cat cat cat ggt atg gct agc atg act 48 Met
Gly Gly Ser His His His His His His Gly Met Ala Ser Met Thr 1 5 10
15 ggt gga cag caa atg ggt cgg gat ctg tac gac gat gac gat aag cat
96 Gly Gly Gln Gln Met Gly Arg Asp Leu Tyr Asp Asp Asp Asp Lys His
20 25 30 atg acc cta aat ata gaa gat gag tat cgg cta cat gag acc
tca aaa 144 Met Thr Leu Asn Ile Glu Asp Glu Tyr Arg Leu His Glu Thr
Ser Lys 35 40 45 gag cca gat gtt tct cta ggg tcc aca tgg ctg tct
gat ttt cct cag 192 Glu Pro Asp Val Ser Leu Gly Ser Thr Trp Leu Ser
Asp Phe Pro Gln 50 55 60 gcc tgg gcg gaa acc ggg ggc atg gga ctg
gca gtt cgc caa gct cct 240 Ala Trp Ala Glu Thr Gly Gly Met Gly Leu
Ala Val Arg Gln Ala Pro 65 70 75 80 ctg atc ata ctt ctg aaa gca acc
tct acc ccc gtg tcc ata aaa caa 288 Leu Ile Ile Leu Leu Lys Ala Thr
Ser Thr Pro Val Ser Ile Lys Gln 85 90 95 tac ccc atg tca caa gaa
gcc aga ctg ggg atc aag ccc cac ata cag 336 Tyr Pro Met Ser Gln Glu
Ala Arg Leu Gly Ile Lys Pro His Ile Gln 100 105 110 aga ctg ttg gac
cag gga ata ctg gta ccc tgc cag tcc ccc tgg aac 384 Arg Leu Leu Asp
Gln Gly Ile Leu Val Pro Cys Gln Ser Pro Trp Asn 115 120 125 acg ccc
ctg cta ccc gtc aag aaa ccc ggg act aat gat tac agg cct 432 Thr Pro
Leu Leu Pro Val Lys Lys Pro Gly Thr Asn Asp Tyr Arg Pro 130 135 140
gtc caa gat ctg aga gag gtc aac aaa cgc gta gaa gac atc cac ccc 480
Val Gln Asp Leu Arg Glu Val Asn Lys Arg Val Glu Asp Ile His Pro 145
150 155 160 acc gta ccc aac ccc tac aac ctc ttg agt ggg ctc cca ccg
tcc cac 528 Thr Val Pro Asn Pro Tyr Asn Leu Leu Ser Gly Leu Pro Pro
Ser His 165 170 175 cag tgg tac act gtt cta gac tta aaa gat gcc ttt
ttc tgc ctg aga 576 Gln Trp Tyr Thr Val Leu Asp Leu Lys Asp Ala Phe
Phe Cys Leu Arg 180 185 190 ctc cac ccg acg tct cag cct ctc ttc gcc
ttt gaa tgg aga gac cca 624 Leu His Pro Thr Ser Gln Pro Leu Phe Ala
Phe Glu Trp Arg Asp Pro 195 200 205 gag atg gga atc tct ggc caa cta
acc tgg acc aga ctc cca cag gga 672 Glu Met Gly Ile Ser Gly Gln Leu
Thr Trp Thr Arg Leu Pro Gln Gly 210 215 220 ttc aaa aac agt ccc acc
ctg ttt gat gag gca ctg cgc aga gac cta 720 Phe Lys Asn Ser Pro Thr
Leu Phe Asp Glu Ala Leu Arg Arg Asp Leu 225 230 235 240 gca gac ttc
cgg atc cag cac cca gac ttg atc ctg cta cag tac gta 768 Ala Asp Phe
Arg Ile Gln His Pro Asp Leu Ile Leu Leu Gln Tyr Val 245 250 255 gat
gac tta ctg ctg gcc gcc act tct gag ctc gac tgc caa caa ggt 816 Asp
Asp Leu Leu Leu Ala Ala Thr Ser Glu Leu Asp Cys Gln Gln Gly 260 265
270 act cgg gcc ctg tta caa acc cta gga gac ctc ggg tat cgg gcc tcg
864 Thr Arg Ala Leu Leu Gln Thr Leu Gly Asp Leu Gly Tyr Arg Ala Ser
275 280 285 gcc aag aaa gcc caa att tgc cag aaa cag gtc aag tat ctg
ggg tat 912 Ala Lys Lys Ala Gln Ile Cys Gln Lys Gln Val Lys Tyr Leu
Gly Tyr 290 295 300 ctt cta aaa gag ggt cag aga tgg ctg act gag gcc
aga aaa gag act 960 Leu Leu Lys Glu Gly Gln Arg Trp Leu Thr Glu Ala
Arg Lys Glu Thr 305 310 315 320 gtg atg ggg cag cct act ccg aag acc
ccg cgg caa cta agg gag ttc 1008 Val Met Gly Gln Pro Thr Pro Lys
Thr Pro Arg Gln Leu Arg Glu Phe 325 330 335 cta ggg acg gca ggc ttc
tgt cgc ctc tgg atc cct ggg ttt gca gaa 1056 Leu Gly Thr Ala Gly
Phe Cys Arg Leu Trp Ile Pro Gly Phe Ala Glu 340 345 350 atg gca gcc
ccc ttg tac cct ctc acc aaa acg ggg act ctg ttt aat 1104 Met Ala
Ala Pro Leu Tyr Pro Leu Thr Lys Thr Gly Thr Leu Phe Asn 355 360 365
tgg ggc cca gac caa caa aag gcc tat caa gaa atc aag caa gct ctt
1152 Trp Gly Pro Asp Gln Gln Lys Ala Tyr Gln Glu Ile Lys Gln Ala
Leu 370 375 380 cta act gcc cca gcc ctg ggg ttg cca gat ttg act aag
ccc ttt gaa 1200 Leu Thr Ala Pro Ala Leu Gly Leu Pro Asp Leu Thr
Lys Pro Phe Glu 385 390 395 400 ctc ttt gtc gac gag aag cag ggc tac
gcc aaa ggt gtc cta acg caa 1248 Leu Phe Val Asp Glu Lys Gln Gly
Tyr Ala Lys Gly Val Leu Thr Gln 405 410 415 aaa ctg gga cct tgg cgt
cgg ccg gtg gcc tac ctg tcc aaa aag cta 1296 Lys Leu Gly Pro Trp
Arg Arg Pro Val Ala Tyr Leu Ser Lys Lys Leu 420 425 430 gac cca gta
gca gct ggg tgg ccc cct tgc cta cgg atg gta gca gcc 1344 Asp Pro
Val Ala Ala Gly Trp Pro Pro Cys Leu Arg Met Val Ala Ala 435 440 445
att gcc gta ctg aca aag gat gca ggc aag cta acc atg gga cag cca
1392 Ile Ala Val Leu Thr Lys Asp Ala Gly Lys Leu Thr Met Gly Gln
Pro 450 455 460 cta gtc att ctg gcc ccc cat gca gta gag gca cta gtc
aaa caa ccc 1440 Leu Val Ile Leu Ala Pro His Ala Val Glu Ala Leu
Val Lys Gln Pro 465 470 475 480 ccc gat cga tgg ctt tcc aac gcc cgg
atg act cac tat cag gcc ttg 1488 Pro Asp Arg Trp Leu Ser Asn Ala
Arg Met Thr His Tyr Gln Ala Leu 485 490 495 ctt ttg gac acg gac cgg
gtc cag ttc gga ccg gtg gta gcc ctg aac 1536 Leu Leu Asp Thr Asp
Arg Val Gln Phe Gly Pro Val Val Ala Leu Asn 500 505 510 ccg gct aca
ctg ctc cca ctg cct gag gaa ggg ctg cag cac aac tgc 1584 Pro Ala
Thr Leu Leu Pro Leu Pro Glu Glu Gly Leu Gln His Asn Cys 515 520 525
ctt gat atc ctg gcc gaa gcc cac gga acc cga ccc gac cta acg gac
1632 Leu Asp Ile Leu Ala Glu Ala His Gly Thr Arg Pro Asp Leu Thr
Asp 530 535 540 cag ccg ctc cca gac gcc gac cac acc tgg tac acg ggt
gga tcc agt 1680 Gln Pro Leu Pro Asp Ala Asp His Thr Trp Tyr Thr
Gly Gly Ser Ser 545 550 555 560 ctc ttg caa gag gga cag cgt aag gcg
gga gct gcg gtg acc acc gag 1728 Leu Leu Gln Glu Gly Gln Arg Lys
Ala Gly Ala Ala Val Thr Thr Glu 565 570 575 acc gag gta atc tgg gct
aaa gcc ctg cca gcc ggg aca tcc gct cag 1776 Thr Glu Val Ile Trp
Ala Lys Ala Leu Pro Ala Gly Thr Ser Ala Gln 580 585 590 cgg gct cag
ctg ata gca ctc acc cag gcc cta agg atg gca gaa ggt 1824 Arg Ala
Gln Leu Ile Ala Leu Thr Gln Ala Leu Arg Met Ala Glu Gly 595 600 605
aag aag cta aat gtt tat acg aat tcc cgt tat gct ttt gct act gcc
1872 Lys Lys Leu Asn Val Tyr Thr Asn Ser Arg Tyr Ala Phe Ala Thr
Ala 610 615 620 cat atc cat gga gaa ata tac aga agg cgt ggg ttg ctc
aca tca gaa 1920 His Ile His Gly Glu Ile Tyr Arg Arg Arg Gly Leu
Leu Thr Ser Glu 625 630 635 640 ggc aaa gag atc aaa aat aag gac gag
ata ttg gcc cta cta aaa gcc 1968 Gly Lys Glu Ile Lys Asn Lys Asp
Glu Ile Leu Ala Leu Leu Lys Ala 645 650 655 ctc ttt ctg ccc aaa aga
ctt agc ata atc cat tgt cca gga cat caa 2016 Leu Phe Leu Pro Lys
Arg Leu Ser Ile Ile His Cys Pro Gly His Gln 660 665 670 aag gga cac
agc gcc gag gct aga ggc aac cgg atg gct gac caa gcg 2064 Lys Gly
His Ser Ala Glu Ala Arg Gly Asn Arg Met Ala Asp Gln Ala 675 680 685
gcc cga aag gca gcc atc aca gag aat cca gac acc tct acc ctc ctc
2112 Ala Arg Lys Ala Ala Ile Thr Glu Asn Pro Asp Thr Ser Thr Leu
Leu 690 695 700 ata gaa aat tca tca ccc aat tcc cgc tta att aat taa
2151 Ile Glu Asn Ser Ser Pro Asn Ser Arg Leu Ile Asn 705 710 715 2
716 PRT Artificial Sequence Mutant Reverse Transcriptase Derived
from Moloney Murine Leukemia Virus 2 Met Gly Gly Ser His His His
His His His Gly Met Ala Ser Met Thr 1 5 10 15 Gly Gly Gln Gln Met
Gly Arg Asp Leu Tyr Asp Asp Asp Asp Lys His 20 25 30 Met Thr Leu
Asn Ile Glu Asp Glu Tyr Arg Leu His Glu Thr Ser Lys 35 40 45 Glu
Pro Asp Val Ser Leu Gly Ser Thr Trp Leu Ser Asp Phe Pro Gln 50 55
60 Ala Trp Ala Glu Thr Gly Gly Met Gly Leu Ala Val Arg Gln Ala Pro
65 70 75 80 Leu Ile Ile Leu Leu Lys Ala Thr Ser Thr Pro Val Ser Ile
Lys Gln 85 90 95 Tyr Pro Met Ser Gln Glu Ala Arg Leu Gly Ile Lys
Pro His Ile Gln 100 105 110 Arg Leu Leu Asp Gln Gly Ile Leu Val Pro
Cys Gln Ser Pro Trp Asn 115 120 125 Thr Pro Leu Leu Pro Val Lys Lys
Pro Gly Thr Asn Asp Tyr Arg Pro 130 135 140 Val Gln Asp Leu Arg Glu
Val Asn Lys Arg Val Glu Asp Ile His Pro 145 150 155 160 Thr Val Pro
Asn Pro Tyr Asn Leu Leu Ser Gly Leu Pro Pro Ser His 165 170 175 Gln
Trp Tyr Thr Val Leu Asp Leu Lys Asp Ala Phe Phe Cys Leu Arg 180 185
190 Leu His Pro Thr Ser Gln Pro Leu Phe Ala Phe Glu Trp Arg Asp Pro
195 200 205 Glu Met Gly Ile Ser Gly Gln Leu Thr Trp Thr Arg Leu Pro
Gln Gly 210 215 220 Phe Lys Asn Ser Pro Thr Leu Phe Asp Glu Ala Leu
Arg Arg Asp Leu 225 230 235 240 Ala Asp Phe Arg Ile Gln His Pro Asp
Leu Ile Leu Leu Gln Tyr Val 245 250 255 Asp Asp Leu Leu Leu Ala Ala
Thr Ser Glu Leu Asp Cys Gln Gln Gly 260 265 270 Thr Arg Ala Leu Leu
Gln Thr Leu Gly Asp Leu Gly Tyr Arg Ala Ser 275 280 285 Ala Lys Lys
Ala Gln Ile Cys Gln Lys Gln Val Lys Tyr Leu Gly Tyr 290 295 300 Leu
Leu Lys Glu Gly Gln Arg Trp Leu Thr Glu Ala Arg Lys Glu Thr 305 310
315 320 Val Met Gly Gln Pro Thr Pro Lys Thr Pro Arg Gln Leu Arg Glu
Phe 325 330 335 Leu Gly Thr Ala Gly Phe Cys Arg Leu Trp Ile Pro Gly
Phe Ala Glu 340 345 350 Met Ala Ala Pro Leu Tyr Pro Leu Thr Lys Thr
Gly Thr Leu Phe Asn 355 360 365 Trp Gly Pro Asp Gln Gln Lys Ala Tyr
Gln Glu Ile Lys Gln Ala Leu 370 375 380 Leu Thr Ala Pro Ala Leu Gly
Leu Pro Asp Leu Thr Lys Pro Phe Glu 385 390 395 400 Leu Phe Val Asp
Glu Lys Gln Gly Tyr Ala Lys Gly Val Leu Thr Gln 405 410 415 Lys Leu
Gly Pro Trp Arg Arg Pro Val Ala Tyr Leu Ser Lys Lys Leu 420 425 430
Asp Pro Val Ala Ala Gly Trp Pro Pro Cys Leu Arg Met Val Ala Ala 435
440 445 Ile Ala Val Leu Thr Lys Asp Ala Gly Lys Leu Thr Met Gly Gln
Pro 450 455 460 Leu Val Ile Leu Ala Pro His Ala Val Glu Ala Leu Val
Lys Gln Pro 465 470 475 480 Pro Asp Arg Trp Leu Ser Asn Ala Arg Met
Thr His Tyr Gln Ala Leu 485 490 495 Leu Leu Asp Thr Asp Arg Val Gln
Phe Gly Pro Val Val Ala Leu Asn 500 505 510 Pro Ala Thr Leu Leu Pro
Leu Pro Glu Glu Gly Leu Gln His Asn Cys 515 520 525 Leu Asp Ile Leu
Ala Glu Ala His Gly Thr Arg Pro Asp Leu Thr Asp 530 535 540 Gln Pro
Leu Pro Asp Ala Asp His Thr Trp Tyr Thr Gly Gly Ser Ser 545 550 555
560 Leu Leu Gln Glu Gly Gln Arg Lys Ala Gly Ala Ala Val Thr Thr Glu
565 570 575 Thr Glu Val Ile Trp Ala Lys Ala Leu Pro Ala Gly Thr Ser
Ala Gln 580 585 590 Arg Ala Gln Leu Ile Ala Leu Thr Gln Ala Leu Arg
Met Ala Glu Gly 595 600 605 Lys Lys Leu Asn Val Tyr Thr Asn Ser Arg
Tyr Ala Phe Ala Thr Ala 610 615 620 His Ile His Gly Glu Ile Tyr Arg
Arg Arg Gly Leu Leu Thr Ser Glu 625 630 635 640 Gly Lys Glu Ile Lys
Asn Lys Asp Glu Ile Leu Ala Leu Leu Lys Ala 645 650 655 Leu Phe Leu
Pro Lys Arg Leu Ser Ile Ile His Cys Pro Gly His Gln 660 665 670 Lys
Gly His Ser Ala Glu Ala Arg Gly Asn Arg Met Ala Asp Gln Ala 675 680
685 Ala Arg Lys Ala Ala Ile Thr Glu Asn Pro Asp Thr Ser Thr Leu Leu
690 695 700 Ile Glu Asn Ser Ser Pro Asn Ser Arg Leu Ile Asn 705 710
715 3 21 PRT Unknown N-terminal tag sequence 3 Met Ala Ser Gly Thr
Gly Gly Gln Gln Met Gly Arg Asp Leu Tyr Asp 1 5 10 15 Asp Asp Asp
Lys His 20 4 4 PRT Unknown Factor Xa cleavage site 4 Ile Glu Gly
Arg 1 5 4 PRT Unknown Thrombin cleavage site 5 Leu Val Pro Arg 1 6
47 DNA Unknown 47mer DNA template 6 gagttacagt gtttttgttc
cagtctgtag cagtgtgtga atggaag 47 7 18 DNA Unknown 18mer DNA primer
7 cttccattca cacactgc 18 8 21 DNA Unknown Sequencing primer 8
gaagatcgca ctccagccag c 21 9 304 DNA Unknown Mutations introduced
by SuperScript II into LacZ Alpha DNA misc_feature (139)..(139) May
be an inserted cytosine, may not be present misc_feature
(212)..(212) May be an inserted thymine, may not be present
misc_feature (234)..(234) May be 1, 3 or 4 inserted adenines, may
not be present misc_feature (277)..(277) May be an inserted
cytosine or adenine, may not be present misc_feature (281)..(281)
May be 1, 3 or 5 inserted thymines, may not be present misc_feature
(285)..(285) May be an inserted cytosine, may not be present
misc_feature (304)..(304) May be deleted 9 agcgcaaygc aattaatgtg
agttagctya ctcattaggc accccaggyy ytacacttta 60 tgcttccggc
tcgyrtgttg tgtggaattg tgagcggata acaattycac acmsgaaaca 120
gctaysacca tgattacgns caagcytgca tgcctgcagg tcgactctag aggatccccg
180 ggtaccgagc tcgaattyac tggycgtcgt tntwacaacg tcgtgwctgg
gaanaaccct 240 ggcgttaccy macytaatcg ccytgcagya ymtcycncyt
nttcngccrg ctgkcgtaat 300 agcg 304 10 20 DNA Unknown 18 mer DNA
primer 10 gaacaaaaac actgtaactc 20 11 20 PRT Unknown N-terminal tag
sequence 11 Met Ala Ser Gly Thr Gly Gly Gln Gln Met Gly Arg Asp Leu
Tyr Asp 1 5 10 15 Asp Asp Asp Lys 20 12 21 DNA Homo sapiens 12
gctcgtcgtc gacaacggct c 21 13 25 DNA Homo sapiens 13 caaacatgat
ctgggtcatc ttctc 25 14 24 DNA Homo sapiens 14 gtgaaggtcg gagtcaacgg
attt 24 15 24 DNA Homo sapiens 15 cacagtcttc tgggtggcag tgat 24 16
20 DNA Homo sapiens 16 atggcgatcg tcgaaccgga 20 17 31 DNA Homo
sapiens 17 cactgtctta atatgaatgg gacctactga g 31 18 26 DNA Homo
sapiens 18 gagccaagca gacaagcaaa gcaagc 26 19 27 DNA Homo sapiens
19 tgttttaatt caatcccacg cccctgt 27 20 20 DNA Homo sapiens 20
aaggctggcg gattactgcc 20 21 21 DNA Homo sapiens 21 gatgctgctg
gtgatgtact c 21 22 21 DNA Homo sapiens 22 gaggagggcg aggtggacgg c
21 23 27 DNA Homo sapiens 23 gaactaacac acagcgatgg gtgggaa 27 24 32
DNA Homo sapiens 24 ggagtttatc atcaccgcgg aaatactgag ag 32 25 30
DNA Homo sapiens 25 tatttcactg acaggcaata ccgtccaagg 30 26 20 DNA
Homo sapiens 26 cgccaaattt ctcccctgaa 20 27 21 DNA Homo sapiens 27
ccgtagtgct gggcaatgtt c 21 28 27 DNA Homo sapiens 28 gctgcagctt
catatgatca gttgtta 27 29 20 DNA Homo sapiens 29 aatggcgctt
aggactttgg 20 30 24 DNA Homo sapiens 30 tggaggctgg gaacgtgaag gaaa
24 31 27 DNA Homo sapiens 31 acaggaatga ccgagggtaa tcttggc 27 32 17
DNA
Rattus sp. 32 gcggcgctgg aggagaa 17 33 22 DNA Rattus sp. 33
aggtggcggc tcaaacacaa ag 22 34 24 DNA Homo sapiens 34 cgggtggtaa
ctggctgctg tgga 24 35 24 DNA Homo sapiens 35 tggaggctgg gaacgtgaag
gaaa 24 36 23 DNA Homo sapiens 36 gcggacctcc cgcttctgcc gga 23 37
28 DNA Homo sapiens 37 ccaagtaaaa cagcatcgga acaccagg 28 38 25 DNA
Homo sapiens 38 aaagtcgatc agcagttgcc agggg 25 39 23 DNA Homo
sapiens 39 cccacagtca ccgccgctta cct 23 40 25 DNA Homo sapiens 40
cttcatccct ccccaacccc aatct 25 41 21 DNA Homo sapiens 41 gaggagggcg
aggtggacgg c 21 42 27 DNA Homo sapiens 42 gaactaacac acagcgatgg
gtgggaa 27 43 20 DNA Homo sapiens 43 cgccaaattt ctcccctgaa 20 44 21
DNA Homo sapiens 44 ccgtagtgct gggcaatgtt c 21 45 21 DNA Homo
sapiens 45 gctcgtcgtc gacaacggct c 21 46 25 DNA Homo sapiens 46
accacatgat ctgggtcatc ttctc 25
* * * * *
References