U.S. patent application number 11/586554 was filed with the patent office on 2007-06-14 for antisense iap nucleobase oligomers and uses thereof.
Invention is credited to Jon P. Durkin, Martin Holcik, Robert G. Korneluk, Eric LaCasse, Daniel McManus.
Application Number | 20070135371 11/586554 |
Document ID | / |
Family ID | 28454856 |
Filed Date | 2007-06-14 |
United States Patent
Application |
20070135371 |
Kind Code |
A1 |
LaCasse; Eric ; et
al. |
June 14, 2007 |
Antisense IAP nucleobase oligomers and uses thereof
Abstract
The present invention features nucleobase oligomers that
hybridize to IAP polynucleotides, and methods for using them to
enhance apoptosis.
Inventors: |
LaCasse; Eric; (Ottawa,
CA) ; McManus; Daniel; (Ottawa, CA) ; Durkin;
Jon P.; (Ottawa, CA) ; Korneluk; Robert G.;
(Ottawa, CA) ; Holcik; Martin; (Ottawa,
CA) |
Correspondence
Address: |
PHILIP SWAIN, PHD;C/O GOWLING LAFLEUR HENDERSON
1 PLACE VILLE MARIE,
37TH FLOOR
MONTREAL
QC
H3B 3P4
CA
|
Family ID: |
28454856 |
Appl. No.: |
11/586554 |
Filed: |
October 26, 2006 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
11442380 |
May 30, 2006 |
|
|
|
11586554 |
Oct 26, 2006 |
|
|
|
10400382 |
Mar 27, 2003 |
7091333 |
|
|
11442380 |
May 30, 2006 |
|
|
|
60367853 |
Mar 27, 2002 |
|
|
|
Current U.S.
Class: |
514/44A ;
536/23.1 |
Current CPC
Class: |
C12N 2310/346 20130101;
C12N 15/113 20130101; C12N 2310/53 20130101; C12N 2310/321
20130101; C12N 2310/111 20130101; A61P 35/02 20180101; A61P 35/00
20180101; A61P 43/00 20180101; C12N 2310/341 20130101; A61K 38/00
20130101; C12N 2310/315 20130101; C12N 2310/3341 20130101; C12N
2310/121 20130101; C12N 2310/321 20130101; C12N 2310/3525 20130101;
C12N 2310/321 20130101; C12N 2310/3521 20130101 |
Class at
Publication: |
514/044 ;
536/023.1 |
International
Class: |
A61K 48/00 20060101
A61K048/00; C07H 21/02 20060101 C07H021/02 |
Claims
1. A method of treating an animal having a lymphoproliferative
disorder, the method comprising: administering to the animal in
need thereof an IAP nucleobase oligomer of up to 30 nucleobases in
length, the nucleobase oligomer comprising at least eight
consecutive nucleobases of SEQ ID NOs: 1-96, 97-162 and 278-292,
thereby treating the animal.
2. The method, according to claim 1, in which the nucleobase
oligomer comprises at least eight consecutive nucleobases of a
sequence selected from the group consisting of SEQ ID NOs: 1-96,
97-162 and 278-292.
3. The method, according to claim 2, in which the nucleobase
oligomer comprises at least eight consecutive nucleobases of a
sequence selected from the group consisting of SEQ ID NOs: 1-96,
97-162 and 278-292.
4. The method, according to claim 3, in which the nucleobase
oligomer consists essentially of a sequence selected from the group
consisting of SEQ ID NOs: 1-96, 97-162 and 278-292.
5. The method, according to claim 4, in which the nucleobase
oligomer consists of a sequence selected from the group consisting
of SEQ ID NOs: 1-96, 97-162 and 278-292.
6. The method, according to claim 1, in which the nucleobase
oligomer is an oligonucleotide.
7. The method, according to claim 6, in which the oligonucleotide
comprises at least one modified linkage.
8. The method, according to claim 7, in which the modified linkage
is selected from the group consisting of phosphorothioate,
methylphosphonate, phosphotriester, phosphorodithioate, and
phosphoselenate linkages.
9. The method, according to claim 1, in which the nucleobase
oligomer comprises at least one modified sugar moiety.
10. The method, according to claim 9, in which the modified sugar
moiety is a 2'-O-methyl group or a 2'-O-methoxyethyl group.
11. The method, according to claim 1, in which the nucleobase
oligomer comprises at least one modified nucleobase.
12. The method, according to claim 11, in which the modified
nucleobase is 5-methyl cytosine.
13. The method, according to claim 1, in which the nucleobase
oligomer is a chimeric nucleobase oligomer.
14. The method, according to claim 13, in which the nucleobase
oligomer comprises DNA residues linked together by phosphorothioate
linkages, the DNA residues flanked on each side by at least one
2'-O-methyl or 2'-O-methoxyethyl RNA residue.
15. The method, according to claim 14, in which the DNA residues
are flanked on each side by at least three 2'-O-methyl or
2'-O-methoxyethyl RNA residues.
16. The method, according to claim 15, in which the DNA residues
are flanked on each side by four 2'-O-methyl or 2'-O-methoxyethyl
RNA residues.
17. The method, according to claim 14, in which the RNA residues
are linked together by phosphorothioate linkages, and the RNA
residues are linked to the DNA residues by phosphorothioate
linkages.
18. The method, according to claim 13, in which the nucleobase
oligomer comprises DNA residues linked together by phosphodiester
linkages, the DNA residues flanked on each side by at least two
2'-O-methyl or 2'-O-methoxyethyl RNA residues linked together by
phosphorothioate linkages.
19. The method, according to claim 18, in which the DNA residues
are flanked on each side by at least three 2'-O-methyl or
2'-O-methoxyethyl RNA residues.
20. The nucleobase oligomer of claim 1, the nucleobase oligomer
comprising eleven DNA residues flanked on each side by four
2'-O-methyl RNA residues, the nucleobase oligomer consisting of SEQ
ID NOs: 16, 27, 41, 47, 51,63,141, 151,155, 157 and 161, the
residues linked together by phosphorothioate linkages.
21. The method of claim 1, further comprising administering to the
animal a biological response-modifying agent.
22. The method, according to claim 21, in which the biological
response-modifying agent is an interferon.
23. The method, according to claim 22, in which the interferon is
interferon alpha, interferon beta, or interferon gamma.
24. The method, according to claim 1, in which the
lymphoproliferative disorder is multiple sclerosis, Crohn's
disease, lupus erythematosis, rheumatoid arthritis, or
osteoarthritis.
25. The method, according to claim 24, in which the
lymphoproliferative disorder is multiple sclerosis.
26. The method, according to claim 1, in which the nucleobase
oligomer is administered to the animal intravenously.
27. The method, according to claim 1, in which the animal is a
human.
28. A composition comprising: (i) an IAP nucleobase oligomer of up
to 30 nucleobases in length, the nucleobase oligomer comprising at
least eight consecutive nucleobases of SEQ ID NOs: 1-96, 97-162 and
278-292; and (ii) a biological response-modifying agent, in amounts
that together are sufficient to treat an animal having a
lymphoproliferative disorder.
29. The composition, according to claim 28, in which the nucleobase
oligomer comprises at least eight consecutive nucleobases of a
sequence selected from the group consisting of: SEQ ID NOs: 1-96,
97-162 and 278-292.
30. The composition, according to claim 29, in which the nucleobase
oligomer comprises at least eight consecutive nucleobases of a
sequence selected from the group consisting of SEQ ID NOs: 1-96,
97-162 and 278-292.
31. The composition, according to claim 30, in which the nucleobase
oligomer consists essentially of a sequence selected from the group
consisting of SEQ ID NOs: 1-96, 97-162 and 278-292.
32. The composition of claim 31, in which the nucleobase oligomer
consists of a sequence selected from the group consisting of SEQ ID
NOs: 1-96, 97-162 and 278-292.
33. A method of enhancing apoptosis of a cell in an animal, the
method comprising: administering to the animal the composition,
according to claim 28, in amounts that inhibits expression of an
IAP in the cell.
34. The method, according to claim 33, in which the cell is in
vivo.
35. The method, according to claim 33, in which the cell is ex
vivo.
36. The method, according to claim 33, in which the cell is of
lymphoid origin.
37. The method, according to claim 33, in which the cell is a T
cell.
38. The method, according to claim 33, in which the cell is a
B-cell.
39. A method of treating a human having multiple sclerosis, the
method comprising: administering to the patient in need thereof an
IAP nucleobase oligomer of up to 30 nucleobases in length, the
nucleobase oligomer comprising at least eight consecutive
nucleobases of SEQ ID NOs: 1-96, 97-162 and 278-292, thereby
treating the human.
40. A method of treating a human having multiple sclerosis, the
method comprising administering to the patient: (i) an IAP
nucleobase oligomer of up to 30 nucleobases in length, the
nucleobase oligomer comprising at least eight consecutive
nucleobases of SEQ ID NOs: 1-96, 97-162 and 278-292; and (ii) an
interferon in amounts that together are sufficient to treat the
human.
41. A method of treating an animal having a lymphoproliferative
disorder, the method comprising administering to the animal an
effective amount of a catalytic RNA molecule capable of cleaving
XIAP mRNA, thereby treating the animal.
42. The method, according to claim 41, in which the binding arms of
the catalytic RNA molecule contain at least eight consecutive
nucleobases corresponding to a sequence of any one of Tables 1 or
2.
43. The method, according to claim 42, in which the RNA molecule is
in a hammerhead motif.
44. The method, according to claim 41, in which the RNA molecule is
in a hairpin, hepatitis delta virus, group 1 intron, VS RNA or
RNAseP RNA motif.
45. A method of treating an animal having a lymphoproliferative
disorder, the method comprising administering to the animal an
effective amount of a double-stranded RNA molecule consisting of
between 21 and 29 nucleobases, the RNA molecule comprising at least
eight consecutive nucleobases corresponding to a sequence of any
one of Tables 1 and 2.
46. A method of treating an animal having a lymphoproliferative
disorder, the method comprising administering to the animal an
effective amount of a double-stranded hairpin RNA molecule
consisting of between 50 and 70 nucleobases, the RNA molecule
comprising a first domain of between 21 and nucleobases that
comprise least eight consecutive nucleobases corresponding to a
sequence of any one of Tables 1 and 2; a second domain
complementary to the first domain, and a loop domain situated
between the first and the second domains such that the first domain
and the second domain are capable of duplexing to form the
double-stranded hairpin RNA molecule.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application claims benefit of U.S. Provisional
Application No. 60/367,853, filed Mar. 27, 2002, which is hereby
incorporated by reference.
BACKGROUND OF THE INVENTION
[0002] The invention relates to antisense IAP nucleobase oligomers
and methods of using them to induce apoptosis.
[0003] One way by which cells die is referred to as apoptosis, or
programmed cell death. Apoptosis often occurs as a normal part of
the development and maintenance of healthy tissues. The process may
occur so rapidly that it is difficult to detect.
[0004] The apoptosis pathway is now known to play a critical role
in embryonic development, viral pathogenesis, cancer, autoimmune
disorders, and neurodegenerative diseases, as well as other events.
The failure of an apoptotic response has been implicated in the
development of cancer, autoimmune disorders, such as lupus
erythematosis and multiple sclerosis, and in viral infections,
including those associated with herpes virus, poxvirus, and
adenovirus.
[0005] The importance of apoptosis in cancer has become clear in
recent years. The identification of growth promoting oncogenes in
the late 1970's gave rise to an almost universal focus on cellular
proliferation that dominated research in cancer biology for many
years. Long-standing dogma held that anti-cancer therapies
preferentially targeted rapidly dividing cancer cells relative to
"normal" cells. This explanation was not entirely satisfactory,
since some slow growing tumors are easily treated, while many
rapidly dividing tumor types are extremely resistant to anti-cancer
therapies. Progress in the cancer field has now led to a new
paradigm in cancer biology wherein neoplasia is viewed as a failure
to execute normal pathways of programmed cell death. Normal cells
receive continuous feedback from their neighbors through various
growth factors, and commit "suicide" if removed from this context.
Cancer cells somehow bypass these commands and continue
inappropriate proliferation. It is now believed that many cancer
therapies, including radiation and many chemotherapies, previously
thought to act by causing cellular injury, actually work by
triggering apoptosis.
[0006] Both normal cell types and cancer cell types display a wide
range of susceptibility to apoptotic triggers, although the
determinants of this resistance are only now under investigation.
Many normal cell types undergo temporary growth arrest in response
to a sub-lethal dose of radiation or cytotoxic chemical, while
cancer cells in the vicinity undergo apoptosis. This differential
effect at a given dose provides the crucial treatment window that
allows successful anti-cancer therapy. It is therefore not
surprising that resistance of tumor cells to apoptosis is emerging
as a major category of cancer treatment failure.
[0007] Several potent endogenous proteins that inhibit apoptosis
have been identified, including Bcl-2, and IAP (inhibitor-of
apoptosis) families in mammalian cells. Certain members of the
latter family directly inhibit terminal effector caspases, i.e.
casp-3 and casp-7, engaged in the execution of cell death, as well
as the key mitochondrial initiator caspase, casp-9, important to
the mediation of cancer chemotherapy induced cell death. The IAPs
are the only known endogenous caspase inhibitors, and thus play a
central role in the regulation of apoptosis.
[0008] The IAPs have been postulated to contribute to the
development of some cancers, and a postulated causal chromosomal
translocation involving one particular IAP (cIAP2/HIAP1) has been
identified in MALT lymphoma. A recent correlation between elevated
XIAP, poor prognosis, and short survival has been demonstrated in
patients with acute myelogenous leukemia. XIAP was highly
over-expressed in many tumor cell lines of the NCI panel.
[0009] There exists a need for improved cancer therapeutics and, in
particular, therapeutics that can induce cancer cells to undergo
apoptosis and override anti-apoptotic signals provided in such
cells.
SUMMARY OF THE INVENTION
[0010] In general, the invention features methods and reagents
useful for inducing apoptosis in a cell. The methods and reagents
of the invention are useful in treating cancers, and other
proliferative diseases.
[0011] The present invention features nucleobase oligomers,
particularly oligonucleotides, for use in modulating the function
of a polynucleotide encoding an IAP. These oligomers reduce the
amount of an IAP produced, allowing a cell normally expressing the
IAP to undergo apoptosis. This is accomplished by providing
nucleobase oligomers that specifically hybridize with one or more
polynucleotides encoding an IAP. The specific hybridization of the
nucleobase oligomer with an IAP polynucleotide (e.g., RNA, DNA)
interferes with the normal function of that IAP polynucleotide,
reducing the amount of IAP protein produced. This modulation of
function of a target nucleic acid by compounds that specifically
hybridize to the target is generally referred to as
"antisense."
[0012] In one aspect, the invention features a nucleobase oligomer
of up to 30 nucleobases in length, the oligomer including at least
eight consecutive nucleobases of a sequence selected from SEQ ID
NOs: 1-99, 143, 147, 151, 163-260, 287, 289, and 300-460.
Desirably, when administered to a cell, the oligomer inhibits
expression of an IAP.
[0013] In certain embodiments, the nucleobase oligomer includes a
sequence selected from SEQ ID NOs: 1-99, 143, 147, 151, 163-260,
287, 289, and 300-460. It is desirable that the nucleobase oligomer
consists of (or essentially of) one or more of the foregoing SEQ ID
NOs. For example, the nucleobase oligomer may be a XIAP antisense
nucleic acid that includes a sequence chosen from SEQ ID NOs 97,
98, 99, 143, 147, 151, 287, and 289, a HIAP1 antisense nucleic acid
that includes a sequence chosen from SEQ ID NOs 300-389, or a HIAP2
antisense nucleic acid includes a sequence chosen from SEQ ID NOs
390-460. In a particularly desirable embodiment, the invention
features a nucleobase oligomer having eleven DNA residues flanked
on each side by four 2'-O-methyl RNA residues, and consists of one
of the following sequences: 5'-AUUGGTTC CAATGTGUUCU-3' (SEQ ID NO:
155); 5'-ACACGACCGCTAAGAAACA-3' (SEQ ID NO: 16);
5'-ACAGGACTACCACTTGGAA-3' (SEQ ID NO: 157); 5'-UGCCAGTG
TTGATGCUGAA-3' (SEQ ID NO: 27); 5'-GCUGAGTCTCCATATUGCC-3' (SEQ ID
NO: 141); 5'-UCGGGTATATGGTGTCUGA-3' (SEQ ID NO: 41); 5'-AAGCACTGCA
CTTGGUCAC-3' (SEQ ID NO: 47); 5'- CCGGCCCAAAACAA AGAAG-3' (SEQ ID
NO: 51); 5'- ACCCTGGATACCATTUAGC-3' (SEQ ID NO: 63); 5'-UGUCAGTACA
TGTTGGCUC-3' (SEQ ID NO: 161); and 5'-UGCACCCTGGATA CCAUUU-3' (SEQ
ID NO: 151).
[0014] A nucleobase oligomer of the present invention may include
at least one modified linkage (e.g., a phosphorothioate, a
methylphosphonate, a phosphotriester, a phosphorodithioate, or a
phosphoselenate linkage), modified nucleobase (e.g., a 5-methyl
cytosine), and/or a modified sugar moiety (e.g., a
2'-O-methoxyethyl group or a 2'-O-methyl group). In one embodiment,
the oligomer is a chimeric oligomer (e.g., an oligonucleotide that
includes DNA residues linked together by phosphorothioate or
phosphodiester linkages, flanked on each side by at least one, two,
three, or four 2'-O-methyl RNA residue linked together by a
phosphorothioate linkage).
[0015] In another aspect, the invention features a method of
enhancing apoptosis in a cell. This method includes the step of
administering to the cell a nucleobase oligomer of the present
invention so that expression of an IAP (e.g., XIAP, HIAP1, or
HIAP2) is inhibited. The nucleobase oligomer may be, e.g., a
component of an antisense compound, a double-stranded RNA, or a
ribozyme. This administering step may be performed alone, or in
combination with a second step (e.g., administration of a
chemotherapeutic agent, a biological response modifying agent,
and/or a chemosensitizer). The cell can be in vitro or in vivo. In
one embodiment, the cell is a cancer cell (e.g., a human cancer
cell) or a cell of lymphoid or myeloid origin.
[0016] In a related aspect, the invention features a method for
treating an animal (e.g., a human) having a proliferative disease
(e.g., a cancer, lymphoproliferative disorder, or myelodysplastic
syndrome) or preventing the development of such a disease, by
administering to the animal an effective amount of a nucleobase
oligomer of the present invention.
[0017] The cancer may be, for example, acute leukemia, acute
lymphocytic leukemia, acute myelocytic leukemia, acute myeloblastic
leukemia, acute promyelocytic leukemia, acute myelomonocytic
leukemia, acute monocytic leukemia, acute erythroleukemia, chronic
leukemia, chronic myelocytic leukemia, myelodysplastic syndrome,
chronic lymphocytic leukemia, polycythemia vera, lymphoma,
Hodgkin's disease, Waldenstrom's macroglobulinemia, fibrosarcoma,
myxosarcoma, liposarcoma, chondrosarcoma, osteogenic sarcoma,
chordoma, angiosarcoma, endotheliosarcoma, lymphangiosarcoma,
lymphangioendotheliosarcoma, synovioma, mesothelioma, Ewing's
tumor, leiomyosarcoma, rhabdomyosarcoma, colon carcinoma,
pancreatic cancer, breast cancer, ovarian cancer, prostate cancer,
squamous cell carcinoma, basal cell carcinoma, adenocarcinoma,
sweat gland carcinoma, sebaceous gland carcinoma, papillary
carcinoma, papillary adenocarcinoma, cystadenocarcinoma, medullary
carcinoma, bronchogenic carcinoma, renal cell carcinoma, hepatoma,
bile duct carcinoma, choriocarcinoma, seminoma, embryonal
carcinoma, Wilm's tumor, cervical cancer, uterine cancer,
testicular cancer, lung carcinoma, small cell lung carcinoma,
bladder carcinoma, epithelial carcinoma, glioma, astrocytoma,
medulloblastoma, craniopharyngioma, ependymoma, pinealoma,
hemangioblastoma, acoustic neuroma, oligodenroglioma, schwannoma,
meningioma, melanoma, neuroblastoma, or retinoblastoma. When
treating a cancer, it may be desirable to also administer one or
more chemotherapeutic agents, biological response modifying agents,
and/or chemosensitizers. Desirably, the administration of one or
more of these agents is within five days of the administration of
the nucleobase oligomer. Exemplary chemotherapeutic agents are
adriamycin (doxorubicin), vinorelbine, etoposide, taxol, and
cisplatin. While any route of administration that results in an
effective amount at the desired site may be used, particularly
desirable routes are by intravenous and intratumoral
administration.
[0018] In another aspect, the invention features a pharmaceutical
composition that includes a nucleobase oligomer of the present
invention and a pharmaceutically acceptable carrier. If desirable,
the pharmaceutical composition may further include additional
components (e.g., a. colloidal dispersion system or a
chemotherapeutic agent).
[0019] The invention also features a catalytic RNA molecule capable
of cleaving XIAP, HIAP1, or HIAP2 mRNA. In desirable embodiments,
the catalytic RNA molecule includes, in its binding arms, at least
eight consecutive nucleobases corresponding to a nucleobase
oligomer of the invention. (e.g., a nucleobase sequence of any one
of Tables 1, 2, 6, and 7). The RNA molecule is desirably in a
hammerhead motif, but may also be in a hairpin, hepatitis delta
virus, group 1 intron, VS RNA or RNAseP RNA motif.
[0020] The invention also features an expression vector including a
nucleic acid encoding one or more catalytic RNA molecules of the
invention positioned for expression in a mammalian cell.
[0021] The invention also features a method of treating an animal
having a cancer or lymphoproliferative disorder by administering to
the animal an effective amount of a catalytic RNA molecule
described above, or an expression vector encoding such a catalytic
RNA molecule.
[0022] In still another aspect, the invention features a
double-stranded RNA molecule having between 21 and 29 nucleobases,
wherein at least eight consecutive nucleobases corresponding to a
sequence of any one of Tables 1, 2, 6, and 7 are present.
[0023] In a related aspect, the invention also features a
double-stranded RNA molecule having between 50 and 70 nucleobases,
the RNA molecule having a first domain of between 21 and 29
nucleobases that include least eight consecutive nucleobases
corresponding to a sequence of any one of Tables 1, 2, 6, and 7; a
second domain complementary to the first domain, and a loop domain
situated between the first and second domains such that the first
and second domains are capable of duplexing to form a
double-stranded RNA molecule. The invention also features an
expression vector (e.g., an adenoviral vector or a retroviral
vector) encoding such a double stranded RNA.
[0024] The invention also features a method of treating an animal
having a cancer or lymphoproliferative disorder by administering to
the animal an effective amount of a double-stranded RNA molecule
described above
[0025] By a "nucleobase oligomer" is meant a compound that includes
a chain of at least eight nucleobases joined together by linkage
groups. Included in this definition are natural and non-natural
oligonucleotides, both modified and unmodified, as well as
oligonucleotide mimetics such as Protein Nucleic Acids, locked
nucleic acids, and arabinonucleic acids. Numerous nucleobases and
linkage groups may be employed in the nucleobase oligomers of the
invention, including those described in detail herein in the
section entitled "Oligonucleotides and other nucleobase oligomers,"
infra.
[0026] "Protein" or "polypeptide" or "polypeptide fragment" means
any chain of more than two amino acids, regardless of
post-translational modification (e.g., glycosylation or
phosphorylation), constituting all or part of a naturally occurring
polypeptide or peptide, or constituting a non-naturally occurring
polypeptide or peptide.
[0027] "Apoptosis" means the process of cell death wherein a dying
cell displays a set of well-characterized biochemical hallmarks
that include cell membrane blebbing, cell soma shrinkage, chromatin
condensation, and DNA laddering. Cells that die by apoptosis
include neurons (e.g., during the course of neurodegenerative
diseases such as stroke, Parkinson's disease, and Alzheimer's
disease), cardiomyocytes (e.g., after myocardial infarction or over
the course of congestive heart failure), and cancer cells (e.g.,
after exposure to radiation or chemotherapeutic agents).
Environmental stress (e.g., hypoxic stress) that is not alleviated
may cause a cell to enter the early phase of the apoptotic pathway,
which is reversible (i.e., cells at the early stage of the
apoptotic pathway can be rescued). At a later phase of apoptosis
(the commitment phase), cells cannot be rescued, and, as a result,
are committed to die.
[0028] Proteins and compounds known to stimulate and inhibit
apoptosis in a diverse variety of cells are well known in the art.
For example, intracellular expression and activation of the caspase
(ICE) family induces or stimulates apoptotic cell death, whereas
expression of the IAPs or some members of the Bcl-2 family inhibit
apoptotic cell death. In addition, there are survival factors that
inhibit cell death in specific cell types. For example,
neurotrophic factors, such as NGF inhibit neuronal apoptosis.
[0029] By "IAP gene" is meant a gene encoding a polypeptide having
at least one BIR domain and that is capable of modulating
(inhibiting or enhancing) apoptosis in a cell or tissue when
provided by other intracellular or extracellular delivery methods
(see, e.g., U.S. Pat. No. 5,919,912). In preferred embodiments, the
IAP gene is a gene having about 50% or greater nucleotide sequence
identity (e.g., at least 85%, 90%, or 95%) to at least one of human
or murine XIAP, HIAP1, or HIAP2 (each of which is described in U.S.
Pat. No. 6,156,535). Preferably the region of sequence over which
identity is measured is a region encoding at least one BIR domain
and a ring zinc finger domain. Mammalian IAP genes include
nucleotide sequences isolated from any mammalian source. Preferably
the mammal is a human.
[0030] By "IAP protein" or "IAP polypeptide" is meant a
polypeptide, or fragment thereof, encoded by an IAP gene.
[0031] By "IAP biological activity" is meant any activity known to
be caused in vivo or in vitro by an IAP polypeptide.
[0032] By "enhancing apoptosis" is meant increasing the number of
cells that apoptose in a given cell population (e.g., cancer cells,
lymphocytes, fibroblasts, or any other cells). It will be
appreciated that the degree of apoptosis enhancement provided by an
apoptosis-enhancing compound in a given assay will vary, but that
one skilled in the art can determine the statistically significant
change in the level of apoptosis that identifies a nucleobase
oligomer that enhances apoptosis otherwise limited by an IAP.
Preferably, "enhancing apoptosis" means that the increase in the
number of cells undergoing apoptosis is at least 10%, more
preferably the increase is 25% or even 50%, and most preferably the
increase is at least one-fold, relative to cells not administered a
nucleobase oligomer of the invention but otherwise treated in a
substantially similar manner. Preferably the sample monitored is a
sample of cells that normally undergo insufficient apoptosis (i.e.,
cancer cells). Methods for detecting changes in the level of
apoptosis (i.e., enhancement or reduction) are described
herein.
[0033] By a nucleobase oligomer that "inhibits the expression" of a
target gene (e.g., an IAP) is meant one that reduces the amount of
a target mRNA, or protein encoded by such mRNA, by at least about
5%, more desirable by at least about 10%, 25%, or even 50%,
relative to an untreated control. Methods for measuring both mRNA
and protein levels are well-known in the art; exemplary methods are
described herein.
[0034] "Hybridization" means hydrogen bonding, which may be
Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen bonding,
between complementary nucleobases. For example, adenine and thymine
are complementary nucleobases that pair through the formation of
hydrogen bonds.
[0035] By "proliferative disease" is meant a disease that is caused
by or results in inappropriately high levels of cell division,
inappropriately low levels of apoptosis, or both. For example,
cancer is an example of a proliferative disease. Examples of
cancers include, without limitation, leukemias (e.g., acute
leukemia, acute lymphocytic leukemia, acute myelocytic leukemia,
acute myeloblastic leukemia, acute promyelocytic leukemia, acute
myelomonocytic leukemia, acute monocytic leukemia, acute
erythroleukemia, chronic leukemia, chronic myelocytic leukemia,
chronic lymphocytic leukemia), polycythemia vera, lymphoma
(Hodgkin's disease, non-Hodgkin's disease), Waldenstrom's
macroglobulinemia, heavy chain disease, and solid tumors such as
sarcomas and carcinomas (e.g., fibrosarcoma, myxosarcoma,
liposarcoma, chondrosarcoma, osteogenic sarcoma, chordoma,
angiosarcoma, endotheliosarcoma, lymphangiosarcoma,
lymphangioendotheliosarcoma, synovioma, mesothelioma, Ewing's
tumor, leiomyosarcoma, rhabdomyosarcoma, colon carcinoma,
pancreatic cancer, breast cancer, ovarian cancer, prostate cancer,
squamous cell carcinoma, basal cell carcinoma, adenocarcinoma,
sweat gland carcinoma, sebaceous gland carcinoma, papillary
carcinoma, papillary adenocarcinomas, cystadenocarcinoma, medullary
carcinoma, bronchogenic carcinoma, renal cell carcinoma, hepatoma,
nile duct carcinoma, choriocarcinoma, seminoma, embryonal
carcinoma, Wilm's tumor, cervical cancer, uterine cancer,
testicular cancer, lung carcinoma, small cell lung carcinoma,
bladder carcinoma, epithelial carcinoma, glioma, astrocytoma,
medulloblastoma, craniopharyngioma, ependymoma, pinealoma,
hemangioblastoma, acoustic neuroma, oligodenroglioma, schwannoma,
meningioma, melanoma, neuroblastoma, and retinoblastoma).
Lymphoproliferative disorders are also considered to be
proliferative diseases.
[0036] Preferably, a nucleobase oligomer of the invention is
capable of enhancing apoptosis and/or decreasing IAP mRNA or
protein levels when present in a cell that normally does not
undergo sufficient apoptosis. Preferably the increase is by at
least 10%, relative to a control, more preferably 25%, and most
preferably 1-fold or more. Preferably a nucleobase oligomer of the
invention includes from about 8 to 30 nucleobases, wherein at least
eight consecutive nucleobases are from a sequence selected from SEQ
ID NOs: 1-99, 143, 147, 151, 163-260, 287, 289, and 300-460. A
nucleobase oligomer of the invention may also contain, e.g., an
additional 20, 40, 60, 85, 120, or more consecutive nucleobases
that are complementary to an IAP polynucleotide. The nucleobase
oligomer (or a portion thereof) may contain a modified backbone.
Phosphorothioate, phosphorodithioate, and other modified backbones
are known in the art. The nucleobase oligomer may also contain one
or more non-natural linkages.
[0037] By "chemotherapeutic agent" is meant an agent that is used
to kill cancer cells or to slow their growth. Accordingly, both
cytotoxic and cytostatic agents are considered to be
chemotherapeutic agents.
[0038] By "biological response modifying agent" is meant an agent
that stimulates or restores the ability of the immune system to
fight disease. Some, but not all, biological response modifying
agents may slow the growth of cancer cells and thus are also
considered to be chemotherapeutic agents." Examples of biological
response modifying agents are interferons (alpha, beta, gamma),
interleukin-2, rituximab, and trastuzumab.
[0039] By "chemosensitizer" is meant an agent that makes tumor
cells more sensitive to the effects of chemotherapy.
[0040] By "an effective amount" is meant the amount of a compound
(e.g., a nucleobase oligomer) required to ameliorate the symptoms
of a disease, inhibit the growth of the target cells, reduce the
size or number of tumors, inhibit the expression of an IAP, or
enhance apoptosis of target cells, relative to an untreated
patient. The effective amount of active compound(s) used to
practice the present invention for therapeutic treatment of
abnormal proliferation (i.e., cancer) varies depending upon the
manner of administration, the age, body weight, and general health
of the subject. Ultimately, the attending physician or veterinarian
will decide the appropriate amount and dosage regimen. Such amount
is referred to as an "effective" amount.
[0041] By "lymphoproliferative disorder" is meant a disorder in
which there is abnormal proliferation of cells of the lymphatic
system (e.g., T-cells and B-cells), and includes multiple
sclerosis, Crohn's disease, lupus erythematosus, rheumatoid
arthritis, and osteoarthritis.
[0042] By "ribozyme" is meant an RNA that has enzymatic activity,
possessing site specificity and cleavage capability for a target
RNA molecule. Ribozymes can be used to decrease expression of a
polypeptide. Methods for using ribozymes to decrease polypeptide
expression are described, for example, by Turner et al., (Adv. Exp.
Med. Biol. 465:303-318, 2000) and Norris et al., (Adv. Exp. Med.
Biol. 465:293-301, 2000).
[0043] By "reporter gene" is meant a gene encoding a polypeptide
whose expression may be assayed; such polypeptides include, without
limitation, glucuronidase (GUS), luciferase, chloramphenicol
transacetylase (CAT), and beta-galactosidase.
[0044] By "promoter" is meant a polynucleotide sufficient to direct
transcription.
[0045] By "operably linked" is meant that a first polynucleotide is
positioned adjacent to a second polynucleotide that directs
transcription of the first polynucleotide when appropriate
molecules (e.g., transcriptional activator proteins) are bound to
the second polynucleotide.
[0046] Other features and advantages of the invention will be
apparent from the following description of the preferred
embodiments thereof, and from the claims.
BRIEF DESCRIPTION OF THE DRAWINGS
[0047] FIGS. 1A-1L are graphs showing the effect of antisense XIAP
oligonucleotides on XIAP protein expression, relative to total
protein (FIGS. 1A, 1C, 1E, 1G, 11, and 1K). FIGS. 1B, 1D, 1F, 1H,
1J, and 1L are the total protein concentration values for each
oligonucleotide transfection compared to mock transfection results
that were used to normalize the above XIAP protein results.
[0048] FIGS. 2A-2C are graphs showing the effects of various
antisense XIAP oligonucleotides, alone or in combination, on XIAP
RNA (FIG. 2A) and protein (FIG. 2B). FIG. 2C is a graph of the
total protein concentration values for each oligonucleotide
transfection compared to mock transfection results, which were used
to normalize the XIAP protein results shown in FIG. 2B.
[0049] FIGS. 3 and 4 are graphs showing the effects of 4.times.4
mixed backbone (MBO) FG8 or E12 oligonucleotides in amounts of 31
nM (FIG. 3) or 63 nM (FIG. 4). H460 lung carcinoma cells were
transfected for 18 hours on one, two, or three consecutive days
using 125 nM MBOs and Lipofectamine 2000. Samples for western
analysis were harvested at the indicated time. Scanning
densitometry was performed, and XIAP protein levels were normalized
to GAPDH and compared to a mock control set to 100%. The indicated
percentages express % XIAP protein knockdown versus specific
scrambled controls.
[0050] FIGS. 5A-5D are graphs of the effects of antisense XIAP
oligonucleotides on cell viability (FIGS. 5A, 5C, and 5D), and
chemosensitization in the presence of adriamycin (FIG. 5B).
[0051] FIG. 6 is a graph showing oligonucleotide-mediated specific
down-regulation of XIAP mRNA in H460 cells in vitro. Depicted are
XIAP mRNA levels in H460 cells treated with Lipofectamine 2000
alone (LFA) or Lipofectamine 2000 with 1.2 .quadrature.M of
oligonucleotides F3, G4, CS, AB6, DE4 or D7, or a respective
reverse polarity (RP) or scrambled (SC) oligonucleotide control.
Real-time RT-PCR quantification of the relative amount of XIAP mRNA
was performed at 6 hours of transfection. All data are presented as
the mean.+-.standard deviation (SD) of triplicates from a
representative experiment. The level of XIAP mRNA in untreated
cells (control) maintained under identical experimental conditions
was assigned a value of 1.
[0052] FIG. 7 is a graph showing XIAP RNA levels in H460 cells
after transfection with various PS-XIAP oligonucleotides. H460
human lung cancer cells were transfected for 6 hours using 1 .mu.M
PS-oligonucleotides and Lipofectamine 2000. Cells were then
harvested for Taqman analysis.
[0053] FIG. 8 is a graph showing XIAP RNA levels in H460 cells 9
hours post-transfection with 4.times.4 MBOs. H460 cells were
transfected for 9 hours using 4.times.4 MBOs at 62.5 nM to 1 .mu.M
and Lipofectamine 2000. The cells were then harvested for Taqman
analysis.
[0054] FIG. 9 is a graph showing XIAP protein knockdown in H460
cells 24 hours after transfection with 4.times.4 MBOs. H460 cells
were transfected for 24 hours using 1 .mu.M 4.times.4 MBOs at 1
.mu.M and Lipofectamine 2000. The cells were then harvested for
western blot analysis. Scanning densitometry was performed, and
XIAP protein levels were normalized to actin and compared to their
specific scrambled (sm, rm) controls, which were set at 100%.
[0055] FIGS. 10A and 10B are schematic illustrations showing
antisense-mediated specific downregulation of XIAP protein in H460
cells in vitro. Depicted are XIAP protein levels in H460 cells
treated with Lipofectamine 2000 alone (LFA) or LFA plus 1.2 .mu.M
of XIAP oligonucleotides F3, G4, or C5, or their respective
oligonucleotide controls (RP, SC). XIAP protein levels were
analyzed by western blotting (FIG. I OA), and the amount of protein
was quantified by densitometry (FIG. 10B). XIAP levels were
normalized to cellular actin levels and compared to untreated
control (CNT) levels.
[0056] FIGS. 11A and 11B are schematic illustrations showing XIAP
oligonucleotide-mediated effects on caspase activation. The effect
of XIAP oligonucleotides F3, G4, or CS, or their respective RP and
SC ODN controls at 1.2 .mu.M on the expression of pro-caspase-3,
PARP (both full length (116 kDa) and processed (85 kDa)) (FIG. 10A)
and Bcl-2 and Bax protein levels (FIG. 10B) in transfected H460
cells compared to control is shown. Proteins expression was
analyzed by western blotting. Bcl-2 and Bax protein levels were
normalized to cellular actin levels and quantified by densitometry.
The ratio of Bcl-2/Bax is presented as the mean of two or three
independent experiments, and the ratio in control (CNT) cells set
at 1.
[0057] FIGS. 12A and 12B are schematic illustrations showing XIAP
oligonucleotide-specific induction of apoptosis. Induction of
apoptosis was measured in H460 cells treated with 1.2 .mu.M of XIAP
G4 AS oligonucleotide, G4 SC oligonucleotide or untreated control
(CNT). FIG. 12A shows the percentage of cells having sub-G0/G1
(apoptotic) DNA content, as measured by propidium iodide (PI)
staining and flow cytometry. FIG. 12B. shows nuclear morphology of
oligonucleotide-treated H460 cells stained with DAPI. Arrows
indicate cells that have characteristic apoptotic morphology of
nuclear DNA condensation or fragmentation.
[0058] FIG. 13A is a graph showing the effect of XIAP G4 AS
oligonucleotide treatment on the viability of H460 cells. Cells
were treated with an increasing concentration of LFA alone or
LFA-oligonucleotide complexes with G4 AS oligonucleotides or G4 SC
oligonucleotides, and cells viability was determined by MTT assay
after 24 hours of treatment. The data represent the mean.+-.SD of
three independent experiments.
[0059] FIG. 13B is a graph showing the percentage of dead H460
cells after treatment with LFA and complexes with G4 AS
oligonucleotides or G4 SC oligonucleotides at 0.4 .mu.M dose in the
presence or absence of doxorubicin (DOX), taxol, vinorelbine (VNB)
or etoposide (Etop), as determined by MTT assay. The data represent
the mean.+-.SD of three independent experiments.
[0060] FIG. 14 is a graph showing relative H460 tumor growth in
mice treated with XIAP AS 2.times.2 MBOs and vinorelbine.
Intratumoral injection of oligonucleotides at 50 .mu.g/g tumor mass
was performed in SCID-RAG2 mice carrying subcutaneous H460 cell
xenografts. This treatment was combined with administration of
vinorelbine.
[0061] FIG. 15 is a graph showing mean H460 cell tumor size in mice
treated systemically with XIAP AS PS-oligonucleotides. Systemic
delivery (i.p.) of XIAP AS PS-oligonucleotides into SCID-RAG2 mice
implanted with subcutaneous H460 cell xenografts reduced the size
of the tumors, relative to control.
[0062] FIG. 16 is a graph showing MDA-MB-435/LCC6 human breast
carcinoma cell (LCC cell) tumor size in mice treated systemically
with XIAP AS PS-oligonucleotides. Systemic delivery (i.p.) of XIAP
AS PS-oligonucleotides into female SCID-RAG2 mice implanted with
LCC6 cell xenografts in mammary fat pads reduced the size of the
tumors, relative to control.
[0063] FIG. 17 is a schematic illustration showing in vivo effects
of G4 oligonucleotides on tumor growth and tumor XIAP protein
levels. Antitumor efficacy of systemically delivered, naked XIAP G4
AS oligonucleotides or G4 SC oligonucleotides on the growth of
subcutaneous H460 cell xenografts in male SCID-RAG2 mice. All data
are expressed as mean.+-.SEM (n=6 mice/group).
[0064] FIGS. 18A and 18B are schematic illustrations depicting XIAP
protein expression levels in H460 tumor xenografts implanted in
SCID-RAG2 mice after 21 days treatment with G4 AS oligonucleotides,
G4 SC oligonucleotides, or vehicle alone (control), analyzed by
western blotting and quantified by densitometry. XIAP levels were
normalized to cellular actin levels. All data are expressed as
mean.+-.SD (n=3).
[0065] FIGS. 19A and 19B are photomicrographs showing in vivo
effects of G4 oligonucleotides on histopathology of H460 tumors
implanted in SCID-RAG2 mice after 15 mg/kg systemic dosing of XIAP
G4 AS oligonucleotides or G4 SC oligonucleotides over 21 days. FIG.
19A depicts tumor sections stained with hematoxylin and eosin. FIG.
19B shows immunohistochemistry of ubiquitin expression in tumor
sections. Representative tumor photomicrographs are shown. Internal
scale markers equal 100 .mu.m.
[0066] FIGS. 20A and 20B are graphs showing increased in vivo
efficacy of vinorelbine (VNB) in combination with XIAP
oligonucleotides. Antitumor efficacy of VNB with or without XIAP G4
AS oligonucleotides or G4 SC oligonucleotides against H460 tumors
xenografts was determined in SCID-RAG2 mice. FIG. 20A depicts
antitumor activity of single agents, while FIG. 20B depicts
antitumor activity of VNB and G4 oligonucleotides in combination.
All data are expressed as means.+-.SEM (n=6 mice/group).
[0067] FIG. 21 is a graph showing the effects of HIAP1
oligonucleotides on HIAP1 RNA levels.
[0068] FIGS., 22 A and 22B are schematic illustrations showing
densitometric scans of western blots showing the effects of HIAP1
oligonucleotides on a cell's ability to block cycloheximide-induced
upregulation of HIAP1 protein.
[0069] FIG. 23 is a graph showing the effects of HIAP1
oligonucleotides on cytotoxicity, as measured by total protein.
[0070] FIG. 24 is a graph showing the validation of the sequence
specificity for HIAP1 oligonucleotide APO 2.
[0071] FIG. 25 is a graph showing the effect of HIAP1
oligonucleotides on the chemosensitization of drug-resistant SF295
glioblastomas.
DETAILED DESCRIPTION OF THE INVENTION
[0072] The present invention provides nucleobase oligomers that
inhibit expression of an LAP, and methods for using them to induce
apoptosis in a cell. The nucleobase oligomers of the present
invention may also be used to form pharmaceutical compositions. The
invention also features methods for enhancing apoptosis in a cell
by administering an oligonucleotide of the invention in combination
with a chemotherapeutic agent such as a cytotoxic agent, cytostatic
agent, or biological response modifying agent (e.g., adriamycin,
vinorelbine, etoposide, taxol, cisplatin, interferon,
interleukin-2, monoclonal antibodies). The chemotherapeutic agent
may be, for example,. If desirable, a chemosensitizer (i.e., an
agent that makes the proliferating cells more sensitive to the
chemotherapy) may also be administered. Any combination of the
foregoing agents may also be used to form a pharmaceutical
composition. These pharmaceutical compositions may be used to treat
a proliferative disease, for example, cancer or a
lymphoproliferative disorder, or a symptom of a proliferative
disease. The nucleobase oligomer of the invention may also be used
in combination with radiotherapy for the treatment of cancer or
other proliferative disease.
[0073] Activation of apoptosis in cancer cells offers novel, and
potentially useful approaches to improve patient responses to
conventional chemotherapy or radiotherapy. XIAP is the most potent
member of the IAP gene family in terms of its ability to directly
inhibit caspases and to suppress apoptosis. We investigated the
effect of XIAP down-regulation by antisense (AS) oligonucleotides
on human non-small cell lung cancer (NIH-H460) growth in vitro and
in vivo. In cultured H460 human lung cancer cells, oligonucleotide
G4 AS was identified as the most potent compound, effectively
down-regulated XIAP mRNA by 55% and protein levels up to 60%, as
determined by real-time RT-PCR and western blotting, respectively,
and induced 60% cell death at 1.2 .mu.M concentrations. In
contrast, the scrambled control G4 oligonucleotide caused little
XIAP loss and less than 10% cell death. Treatment with G4 AS
induced apoptosis, as revealed by degradation of pro-caspase-3 and
PARP proteins, with significant nuclear DNA condensation and
fragmentation at 1.2 .mu.M concentrations. Moreover, XIAP AS
oligonucleotides sensitized H460 cells to the cytotoxic effects of
doxorubicin, taxol, vinorelbine, and etoposide. In animal models,
we demonstrate that G4 AS at 15 mg/kg had significant
sequence-specific growth inhibitory effects on human H460 tumors in
xenograft models of SCID/RAG2-immunodeficient mice by systemic
intraperitoneal administration. Systemic AS ODN administration was
associated with an 85% down-regulation of XIAP protein in tumor
xenografts. The combination of 15 mg/kg G4 AS with 5 mg/kg
vinorelbine significantly inhibited tumor growth, more than either
agent alone. These studies indicate that down-regulation of XIAP is
a potent death signal in lung carcinoma cells and is able to induce
apoptosis in vitro as well as inhibit tumor growth in vivo. These
studies support the contention that lAPs are suitable targets for
cancer therapy in human non-small cell lung cancer, as well as
other solid tumors.
Therapy
[0074] Therapy may be provided wherever cancer therapy is
performed: at home, the doctor's office, a clinic, a hospital's
outpatient department, or a hospital. Treatment generally begins at
a hospital so that the doctor can observe the therapy's effects
closely and make any adjustments that are needed. The duration of
the therapy depends on the kind of cancer being treated, the age
and condition of the patient, the stage and type of the patient's
disease, and how the patient's body responds to the treatment. Drug
administration may be performed at different intervals (e.g.,
daily, weekly, or monthly). Therapy may be given in on-and-off
cycles that include rest periods so that the patient's body has a
chance to build healthy new cells and regain its strength.
[0075] Depending on the type of cancer and its stage of
development, the therapy can be used to slow the spreading of the
cancer, to slow the cancer's growth, to kill or arrest cancer cells
that may have spread to other parts of the body from the original
tumor, to relieve symptoms caused by the cancer, or to prevent
cancer in the first place.
[0076] As used herein, the terms "cancer" or "neoplasm" or
"neoplastic cells" is meant a collection of cells multiplying in an
abnormal manner. Cancer growth is uncontrolled and progressive, and
occurs under conditions that would not elicit, or would cause
cessation of, multiplication of normal cells.
[0077] A nucleobase oligomer of the invention, or other negative
regulator of the IAP anti-apoptotic pathway, may be administered
within a pharmaceutically-acceptable diluent, carrier, or
excipient, in unit dosage form. Conventional pharmaceutical
practice may be employed to provide suitable formulations or
compositions to administer the compounds to patients suffering from
a disease that is caused by excessive cell proliferation.
Administration may begin before the patient is symptomatic. Any
appropriate route of administration may be employed, for example,
administration may be parenteral, intravenous, intraarterial,
subcutaneous, intratumoral, intramuscular, intracranial,
intraorbital, ophthalmic, intraventricular, intrahepatic,
intracapsular, intrathecal, intracisternal, intraperitoneal,
intranasal, aerosol, suppository, or oral administration. For
example, therapeutic formulations may be in the form of liquid
solutions or suspensions; for oral administration, formulations may
be in the form of tablets or capsules; and for intranasal
formulations, in the form of powders, nasal drops, or aerosols.
[0078] Methods well known in the art for making formulations are
found, for example, in "Remington: The Science and Practice of
Pharmacy" Ed. A. R. Gennaro, Lippincourt Williams & Wilkins,
Philadelphia, Pa., 2000. Formulations for parenteral administration
may, for example, contain excipients, sterile water, or saline,
polyalkylene glycols such as polyethylene glycol, oils of vegetable
origin, or hydrogenated napthalenes. Biocompatible, biodegradable
lactide polymer, lactide/glycolide copolymer, or
polyoxyethylene-polyoxypropylene copolymers may be used to control
the release of the compounds. Other potentially useful parenteral
delivery systems for IAP modulatory compounds include
ethylene-vinyl acetate copolymer particles, osmotic pumps,
implantable infusion systems, and liposomes. Formulations for
inhalation may contain excipients, for example, lactose, or may be
aqueous solutions containing, for example, polyoxyethylene-9-lauryl
ether, glycocholate and deoxycholate, or may be oily solutions for
administration in the form of nasal drops, or as a gel.
[0079] The formulations can be administered to human patients in
therapeutically effective amounts (e.g., amounts which prevent,
eliminate, or reduce a pathological condition) to provide therapy
for a disease or condition. The preferred dosage of a nucleobase
oligomer of the invention is likely to depend on such variables as
the type and extent of the disorder, the overall health status of
the particular patient, the formulation of the compound excipients,
and its route of administration.
[0080] As described above, if desired, treatment with a nucleobase
oligomer of the invention may be combined with therapies for the
treatment of proliferative disease (e.g., radiotherapy, surgery, or
chemotherapy).
[0081] For any of the methods of application described above, a
nucleobase oligomer of the invention is desirably administered
intravenously or is applied to the site of the needed apoptosis
event (e.g., by injection).
Oligonucleotides and Other Nucleobase Oligomers
[0082] At least two types of oligonucleotides induce the cleavage
of RNA by RNase H: polydeoxynucleotides with phosphodiester (PO) or
phosphorothioate (PS) linkages. Although 2'-OMe-RNA sequences
exhibit a high affinity for RNA targets, these sequences are not
substrates for RNase H. A desirable oligonucleotide is one based on
2'-modified oligonucleotides containing oligodeoxynucleotide gaps
with some or all internucleotide linkages modified to
phosphorothioates for nuclease resistance. The presence of
methylphosphonate modifications increases the affinity of the
oligonucleotide for its target RNA and thus reduces the IC.sub.50.
This modification also increases the nuclease resistance of the
modified oligonucleotide. It is understood that the methods and
reagents of the present invention may be used in conjunction with
any technologies that may be developed, including covalently-closed
multiple antisense (CMAS) oligonucleotides (Moon et al., Biochem J.
346:295-303, 2000; PCT Publication No. WO 00/61595), ribbon-type
antisense (RiAS) oligonucleotides (Moon et al., J. Biol. Chem.
275:4647-4653, 2000; PCT Publication No. WO 00/61595), and large
circular antisense oligonucleotides (U.S. Patent Application
Publication No. U.S. 2002/0168631 A1).
[0083] As is known in the art, a nucleoside is a nucleobase-sugar
combination. The base portion of the nucleoside is normally a
heterocyclic base. The two most common classes of such heterocyclic
bases are the purines and the pyrimidines. Nucleotides are
nucleosides that further include a phosphate group covalently
linked to the sugar portion of the nucleoside. For those
nucleosides that include a pentofuranosyl sugar, the phosphate
group can be linked to either the 2', 3' or 5' hydroxyl moiety of
the sugar. In forming oligonucleotides, the phosphate groups
covalently link adjacent nucleosides to one another to form a
linear polymeric compound. In turn, the respective ends of this
linear polymeric structure can be further joined to form a circular
structure; open linear structures are generally preferred. Within
the oligonucleotide structure, the phosphate groups are commonly
referred to as forming the backbone of the oligonucleotide. The
normal linkage or backbone of RNA and DNA is a 3' to 5'
phosphodiester linkage.
[0084] Specific examples of preferred nucleobase oligomers useful
in this invention include oligonucleotides containing modified
backbones or non-natural internucleoside linkages. As defined in
this specification, nucleobase oligomers having modified backbones
include those that retain a phosphorus atom in the backbone and
those that do not have a phosphorus atom in the backbone. For the
purposes of this specification, modified oligonucleotides that do
not have a phosphorus atom in their internucleoside backbone are
also considered to be nucleobase oligomers.
[0085] Nucleobase oligomers that have modified oligonucleotide
backbones include, for example, phosphorothioates, chiral
phosphorothioates, phosphorodithioates, phosphotriesters,
aminoalkyl-phosphotriesters, methyl and other alkyl phosphonates
including 3'-alkylene phosphonates and chiral phosphonates,
phosphinates, phosphoramidates including 3'-amino phosphoramidate
and aminoalkylphosphoramidates, thionophosphoramidates,
thionoalkylphosphonates, thionoalkylphosphotriesters, and
boranophosphates having normal 3'-5' linkages, 2'-5' linked analogs
of these, and those having inverted polarity, wherein the adjacent
pairs of nucleoside units are linked 3'-5' to 5'-3' or 2'-5' to
5'-2'. Various salts, mixed salts and free acid forms are also
included. Representative United States patents that teach the
preparation of the above phosphorus-containing linkages include,
but are not limited to, U.S. Pat. Nos. 3,687,808; 4,469,863;
4,476,301; 5,023,243; 5,177,196; 5,188,897; 5,264,423; 5,276,019;
.5,278,302; 5,286,717; 5,321,131; 5,399,676; 5,405,939; 5,453,496;
5,455,233; 5,466,677; 5,476,925; 5,519,126; 5,536,821; 5,541,306;
5,550,111; 5,563,253; 5,571,799; 5,587,361; and 5,625,050, each of
which is herein incorporated by reference.
[0086] Nucleobase oligomers having modified oligonucleotide
backbones that do not include a phosphorus atom therein have
backbones that are formed by short chain alkyl or cycloalkyl
internucleoside linkages, mixed heteroatom and alkyl or cycloalkyl
internucleoside linkages, or one or more short chain heteroatomic
or heterocyclic internucleoside linkages. These include those
having morpholino linkages (formed in part from the sugar portion
of a nucleoside); siloxane backbones; sulfide, sulfoxide and
sulfone backbones; formacetyl and thioformacetyl backbones;
methylene formacetyl and thioformacetyl backbones; alkene
containing backbones; sulfamate backbones; methyleneimino and
methylenehydrazino backbones; sulfonate and sulfonamide backbones;
amide backbones; and others having mixed N, O, S and CH.sub.2
component parts. Representative United States patents that teach
the preparation of the above oligonucleotides include, but are not
limited to, U.S. Pat. Nos.: 5,034,506; 5,166,315; 5,185,444;
5,214,134; 5,216,141; 5,235,033; 5,264,562; 5,264,564; 5,405,938;
5,434,257; 5,466,677; 5,470,967; 5,489,677; 5,541,307; 5,561,225;
5,596,086; 5,602,240; 5,610,289; 5,602,240; 5,608,046; 5,610,289;
5,618,704; 5,623,070; 5,663,312; 5,633,360; 5,677,437; and
5,677,439, each of which is herein incorporated by reference.
[0087] In other nucleobase oligomers, both the sugar and the
internucleoside linkage, i.e., the backbone, are replaced with
novel groups. The nucleobase units are maintained for hybridization
with an IAP. One such nucleobase oligomer, is referred to as a
Peptide Nucleic Acid (PNA). In PNA compounds, the sugar-backbone of
an oligonucleotide is replaced with an amide containing backbone,
in particular an aminoethylglycine backbone. The nucleobases are
retained and are bound directly or indirectly to aza nitrogen atoms
of the amide portion of the backbone. Methods for making and using
these nucleobase oligomers are described, for example, in "Peptide
Nucleic Acids: Protocols and Applications" Ed. P. E. Nielsen,
Horizon Press, Norfolk, United Kingdom, 1999. Representative United
States patents that teach the preparation of PNAs include, but are
not limited to, U.S. Pat. Nos.: 5,539,082; 5,714,33 1; and
5,719,262, each of which is herein incorporated by reference.
Further teaching of PNA compounds can be found in Nielsen et al.,
Science, 1991, 254, 1497-1500.
[0088] In particular embodiments of the invention, the nucleobase
oligomers have phosphorothioate backbones and nucleosides with
heteroatom backbones, and in particular
--CH.sub.2--NH--O--CH.sub.2--,
--CH.sub.2--N(CH.sub.3)--O--CH.sub.2-- (known as a methylene
(methylimino) or MMI backbone),
--CH.sub.2--O--N(CH.sub.3)--CH.sub.2--,
--CH.sub.2--N(CH.sub.3)--N(CH.sub.3)--CH.sub.2--, and
--O--N(CH.sub.3)--CH.sub.2--CH.sub.2--. In other embodiments, the
oligonucleotides have morpholino backbone structures described in
U.S. Pat. No. 5,034,506.
[0089] Nucleobase oligomers may also contain one or more
substituted sugar moieties. Nucleobase oligomers comprise one of
the following at the 2' position: OH; F; O-, S-, or N-alkyl; O-,
S-, or N-alkenyl; O-, S- or N-alkynyl; or O-alkyl-O-alkyl, wherein
the alkyl, alkenyl, and alkynyl may be substituted or unsubstituted
C.sub.1 to C.sub.10 alkyl or --C.sub.2 to C.sub.10 alkenyl and
alkynyl. Particularly preferred are
O[(CH.sub.2).sub.nO].sub.mCH.sub.3, O(CH.sub.2).sub.nOCH.sub.3,
O(CH.sub.2).sub.nNH.sub.2, O(CH.sub.2).sub.nCH.sub.3,
O(CH.sub.2).sub.nONH.sub.2, and
O(CH.sub.2).sub.nON[(CH.sub.2).sub.nCH.sub.3)].sub.2, where n and m
are from 1 to about 10. Other preferred nucleobase oligomers
include one of the following at the 2' position: C, to C.sub.1 to
C.sub.10 lower alkyl, substituted lower alkyl, alkaryl, aralkyl,
O-alkaryl, or 0-aralkyl, SH, SCH.sub.3, OCN, Cl, Br, CN, CF.sub.3,
OCF.sub.3, SOCH.sub.3, SO.sub.2CH.sub.3, ONO.sub.2, NO.sub.2,
NH.sub.2, heterocycloalkyl, heterocycloalkaryl, aminoalkylamino,
polyalkylamino, substituted silyl, an RNA cleaving group, a
reporter group, an intercalator, a group for improving the
pharmacokinetic properties of a nucleobase oligomer, or a group for
improving the pharmacodynamic properties of an nucleobase oligomer,
and other substituents having similar properties. Preferred
modifications are 2'-O-methyl and 2'-methoxyethoxy
(2'-O--CH.sub.2CH.sub.2OCH.sub.3, also known as
2'-O-(2-methoxyethyl) or 2'-MOE). Another desirable modification is
2'-dimethylaminooxyethoxy (i.e.,
O(CH.sub.2).sub.2ON(CH.sub.3).sub.2), also known as 2'-DMAOE. Other
modifications include, 2'-aminopropoxy
(2'--OCH.sub.2CH.sub.2CH.sub.2NH.sub.2) and 2'-fluoro (2'-F).
Similar modifications may also be made at other positions on an
oligonucleotide or other nucleobase oligomer, particularly the 3'
position of the sugar on the 3' terminal nucleotide or in 2'-5'
linked oligonucleotides and the 5' position of 5' terminal
nucleotide. Nucleobase oligomers may also have sugar mimetics such
as cyclobutyl moieties in place of the pentofuranosyl sugar.
Representative United States patents that teach the preparation of
such modified sugar structures include, but are not limited to,
U.S. Pat. Nos.: 4,981,957; 5,118,800; 5,319,080; 5,359,044;
5,393,878; 5,446,137; 5,466,786; 5,514,785; 5,519,134; 5,567,811;
5,576,427; 5,591,722; 5,597,909; 5,610,300; 5,627,053; 5,639,873;
5,646,265; 5,658,873; 5,670,633; and 5,700,920, each of which is
herein incorporated by reference in its entirety.
[0090] Nucleobase oligomers may also include nucleobase
modifications or substitutions. As used herein, "unmodified" or
"natural" nucleobases include the purine bases adenine (A) and
guanine (G), and the pyrimidine bases thymine (T), cytosine (C) and
uracil (U). Modified nucleobases include other synthetic and
natural nucleobases, such as 5-methylcytosine (5-me-C),
5-hydroxymethyl cytosine, xanthine, hypoxanthine, 2-aminoadenine,
6-methyl and other alkyl derivatives of adenine and guanine;
2-propyl and other alkyl derivatives of adenine and guanine;
2-thiouracil, 2-thiothymine and 2-thiocytosine; 5-halouracil and
cytosine; 5-propynyl uracil and cytosine; 6-azo uracil, cytosine
and thymine; 5-uracil (pseudouracil); 4-thiouracil; 8-halo,
8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl and other 8-substituted
adenines and guanines; 5-halo (e.g., 5-bromo), 5-trifluoromethyl
and other 5-substituted uracils and cytosines; 7-methylguanine and
7-methyladenine; 8-azaguanine and 8-azaadenine; 7-deazaguanine and
7-deazaadenine; and 3-deazaguanine and 3-deazaadenine. Further
nucleobases include those disclosed in U.S. Pat. No. 3,687,808,
those disclosed in The Concise Encyclopedia Of Polymer Science And
Engineering, pages 858-859, Kroschwitz, J. I., ed. John Wiley &
Sons, 1990, those disclosed by Englisch et al., Angewandte Chemie,
International Edition, 1991, 30, 613, and those disclosed by
Sanghvi, Y. S., Chapter 15, Antisense Research and Applications,
pages 289-302, Crooke, S. T. and Lebleu, B., ed., CRC Press, 1993.
Certain of these nucleobases are particularly usefil for increasing
the binding affinity of an antisense oligonucleotide of the
invention. These include 5-substituted pyrimidines,
6-azapyrimidines, and N-2, N-6 and O-6 substituted purines,
including 2-aminopropyladenine, 5-propynyluracil and
5-propynylcytosine. 5-methylcytosine substitutions have been shown
to increase nucleic acid duplex stability by 0.6-1.2.degree. C.
(Sanghvi, Y. S., Crooke, S. T. and Lebleu, B., eds., Antisense
Research and Applications, CRC Press, Boca Raton, 1993, pp.
276-278) and are desirable base substitutions, even more
particularly when combined with 2'-O-methoxyethyl or 2'-O-methyl
sugar modifications. Representative United States patents that
teach the preparation of certain of the above noted modified
nucleobases as well as other modified nucleobases include U.S. Pat.
Nos.: 4,845,205; 5,130,302; 5,134,066; 5,175,273; 5,367,066;
5,432,272; 5,457,187; 5,459,255; 5,484,908; 5,502,177; 5,525,711;
5,552,540; 5,587,469; 5,594,121, 5,596,091; 5,614,617; 5,681,941;
and 5,750,692, each of which is herein incorporated by
reference.
[0091] Another modification of a nucleobase oligomer of the
invention involves chemically linking to the nucleobase oligomer
one or more moieties or conjugates that enhance the activity,
cellular distribution, or cellular uptake of the oligonucleotide.
Such moieties include but are not limited to lipid moieties such as
a cholesterol moiety (Letsinger et al., Proc. Natl. Acad. Sci. USA,
86:6553-6556, 1989), cholic acid (Manoharan et al., Bioorg. Med.
Chem. Let, 4:1053-1060, 1994), a thioether, e.g.,
hexyl-S-tritylthiol (Manoharan et al., Ann. N.Y. Acad. Sci.,
660:306-309, 1992; Manoharan et al., Bioorg. Med. Chem. Let.,
3:2765-2770, 1993), a thiocholesterol (Oberhauser et al., Nucl.
Acids Res., 20:533-538: 1992), an aliphatic chain, e.g.,
dodecandiol or undecyl residues (Saison-Behmoaras et al., EMBO J.,
10:1111-1118, 1991; Kabanov et al., FEBS Lett., 259:327-330, 1990;
Svinarchuk et al., Biochimie, 75:49-54, 1993), a phospholipid,
e.g., di-hexadecyl-rac-glycerol or triethylammonium
1,2-di-O-hexadecyl-rac-glycero-3-H-phosphonate (Manoharan et al.,
Tetrahedron Lett., 36:3651-3654, 1995; Shea et al., Nucl. Acids
Res., 18:3777-3783, 1990), a polyamine or a polyethylene glycol
chain (Manoharan et al., Nucleosides & Nucleotides, 14:969-973,
1995), or adamantane acetic acid (Manoharan et al., Tetrahedron
Lett., 36:3651-3654, 1995), a palmityl moiety (Mishra et al.,
Biochim. Biophys. Acta, 1264:229-237, 1995), or an octadecylamine
or hexylamino-carbonyl-oxycholesterol moiety (Crooke et al., J.
Pharmacol. Exp. Ther., 277:923-937, 1996. Representative United
States patents that teach the preparation of such nucleobase
oligomer conjugates include U.S. Pat. Nos.: 4,587,044; 4,605,735;
4,667,025; 4,762,779; 4,789,737; 4,824,941; 4,828,979; 4,835,263;
4,876,335; 4,904,582; 4,948,882; 4,958,013; 5,082,830; 5,109,124;
5,112,963; 5,118,802; 5,138,045; 5,214,136; 5,218,105; 5,245,022;
5,254,469; 5,258,506; 5,262,536; 5,272,250; 5,292,873; 5,317,098;
5,371,241, 5,391,723; 5,414,077; 5,416,203, 5,451,463; 5,486,603;
5,510,475; 5,512,439; 5,512,667; 5,514,785; 5,525,465; 5,541,313;
5,545,730; 5,552,538; 5,565,552; 5,567,810; 5,574,142; 5,578,717;
5,578,718; 5,580,731; 5,585,481; 5,587,371; 5,591,584; 5,595,726;
5,597,696; 5,599,923; 5,599,928; 5,608,046; and 5,688,941, each of
which is herein incorporated by reference.
[0092] The present invention also includes nucleobase oligomers
that are chimeric compounds. "Chimeric" nucleobase oligomers are
nucleobase oligomers, particularly oligonucleotides, that contain
two or more chemically distinct regions, each made up of at least
one monomer unit, i.e., a nucleotide in the case of an
oligonucleotide. These nucleobase oligomers typically contain at
least one region where the nucleobase oligomer is modified to
confer, upon the nucleobase oligomer, increased resistance to
nuclease degradation, increased cellular uptake, and/or increased
binding affinity for the target nucleic acid. An additional region
of the nucleobase oligomer may serve as a substrate for enzymes
capable of cleaving RNA:DNA or RNA:RNA hybrids. By way of example,
RNase H is a cellular endonuclease which cleaves the RNA strand of
an RNA:DNA duplex. Activation of RNase H, therefore, results in
cleavage of the RNA target, thereby greatly enhancing the
efficiency of nucleobase oligomer inhibition of gene expression.
Consequently, comparable results can often be obtained with shorter
nucleobase oligomers when chimeric nucleobase oligomers are used,
compared to phosphorothioate deoxyoligonucleotides hybridizing to
the same target region.
[0093] Chimeric nucleobase oligomers of the invention may be formed
as composite structures of two or more nucleobase oligomers as
described above. Such nucleobase oligomers, when oligonucleotides,
have also been referred to in the art as hybrids or gapmers.
Representative United States patents that teach the preparation of
such hybrid structures include U.S. Pat. Nos.: 5,013,830;
5,149,797; 5,220,007; 5,256,775; 5,366,878; 5,403,711; 5,491,133;
5,565,350; 5,623,065; 5,652,355; 5,652,356; and 5,700,922, each of
which is herein incorporated by reference in its entirety.
[0094] The nucleobase oligomers used in accordance with this
invention may be conveniently and routinely made through the
well-known technique of solid phase synthesis. Equipment for such
synthesis is sold by several vendors including, for example,
Applied Biosystems (Foster City, Calif.). Any other means for such
synthesis known in the art may additionally or alternatively be
employed. It is well known to use similar techniques to prepare
oligonucleotides such as the phosphorothioates and alkylated
derivatives.
[0095] The nucleobase oligomers of the invention may also be
admixed, encapsulated, conjugated or otherwise associated with
other molecules, molecule structures or mixtures of compounds, as
for example, liposomes, receptor targeted molecules, oral, rectal,
topical or other formulations, for assisting in uptake,
distribution and/or absorption. Representative United States
patents that teach the preparation of such uptake, distribution
and/or absorption assisting formulations include U.S. Pat. Nos.:
5,108,921; 5,354,844; 5,416,016; 5,459,127; 5,521,291; 5,543,158;
5,547,932; 5,583,020; 5,591,721; 4,426,330; 4,534,899; 5,013,556;
5,108,921; 5,213,804; 5,227,170; 5,264,221; 5,356,633; 5,395,619;
5,416,016; 5,417,978; 5,462,854; 5,469,854; 5,512,295; 5,527,528;
5,534,259; 5,543,152; 5,556,948; 5,580,575; and 5,595,756, each of
which is herein incorporated by reference.
[0096] The nucleobase oligomers of the invention encompass any
pharmaceutically acceptable salts, esters, or salts of such esters,
or any other compound that, upon administration to an animal, is
capable of providing (directly or indirectly) the biologically
active metabolite or residue thereof. Accordingly, for example, the
disclosure is also drawn to prodrugs and pharmaceutically
acceptable salts of the compounds of the invention,
pharmaceutically acceptable salts of such prodrugs, and other
bioequivalents.
[0097] The term "prodrug" indicates a therapeutic agent that is
prepared in an inactive form that is converted to an active form
(i.e., drug) within the body or cells thereof by the action of
endogenous enzymes or other chemicals and/or conditions. In
particular, prodrug versions of the oligonucleotides of the
invention can be prepared as SATE [(S-acetyl-2-thioethyl)
phosphate] derivatives according to the methods disclosed in PCT
publication Nos. WO 93/24510 or WO 94/26764.
[0098] The term "pharmaceutically acceptable salts" refers to salts
that retain the desired biological activity of the parent compound
and do not impart undesired toxicological effects thereto.
Pharmaceutically acceptable base addition salts are formed with
metals or amines, such as alkali and alkaline earth metals or
organic amines. Examples of metals used as cations are sodium,
potassium, magnesium, calcium, and the like. Examples of suitable
amines are N,N'-dibenzylethylenediamine, chloroprocaine, choline,
diethanolamine, dicyclohexylamine, ethylenediamine,
N-methylglucamine, and procaine (see, for example, Berge et al., J.
Pharma Sci., 66:1-19, 1977). The base addition salts of acidic
compounds are prepared by contacting the free acid form with a
sufficient amount of the desired base to produce the salt in the
conventional manner. The free acid form may be regenerated by
contacting the salt form with an acid and isolating the free acid
in the conventional manner. The free acid forms differ from their
respective salt forms somewhat in certain physical properties such
as solubility in polar solvents, but otherwise the salts are
equivalent to their respective free acid for purposes of the
present invention. As used herein, a "pharmaceutical addition salt"
includes a pharmaceutically acceptable salt of an acid form of one
of the components of the compositions of the invention. These
include organic or inorganic acid salts of the amines. Preferred
acid salts are the hydrochlorides, acetates, salicylates, nitrates
and phosphates. Other suitable pharmaceutically acceptable salts
are well known to those skilled in the art and include basic salts
of a variety of inorganic and organic acids, such as, for example,
with inorganic acids, such as for example hydrochloric acid,
hydrobromic acid, sulfuric acid or phosphoric acid; with organic
carboxylic, sulfonic, sulfo or phospho acids or N-substituted
sulfamic acids, for example acetic acid, propionic acid, glycolic
acid, succinic acid, maleic acid, hydroxymaleic acid, methylmaleic
acid, fumaric acid, malic acid, tartaric acid, lactic acid, oxalic
acid, gluconic acid, glucaric acid, glucuronic acid, citric acid,
benzoic acid, cinnamic acid, mandelic acid, salicylic acid,
4-aminosalicylic acid, 2-phenoxybenzoic acid, 2-acetoxybenzoic
acid, embonic acid, nicotinic acid or isonicotinic acid; and with
amino acids, such as the 20 alpha-amino acids involved in the
synthesis of proteins in nature, for example glutamic acid or
aspartic acid, and also with phenylacetic acid, methanesulfonic
acid, ethanesulfonic acid, 2-hydroxyethanesulfonic acid,
ethane-1,2-disulfonic acid, benzenesulfonic acid,
4-methylbenzenesulfonic acid, naphthalene-2-sulfonic acid,
naphthalene-1,5-disulfonic acid, 2- or 3-phosphoglycerate,
glucose-6-phosphate, N-cyclohexylsulfamic acid (with the formation
of cyclamates), or with other acid organic compounds, such as
ascorbic acid. Pharmaceutically acceptable salts of compounds may
also be prepared with a pharmaceutically acceptable cation.
Suitable pharmaceutically acceptable cations are well known to
those skilled in the art and include alkaline, alkaline earth,
ammonium and quaternary ammonium cations. Carbonates or hydrogen
carbonates are also possible.
[0099] For oligonucleotides and other nucleobase oligomers,
suitable pharmaceutically acceptable salts include (i) salts formed
with cations such as sodium, potassium, ammonium, magnesium,
calcium, polyamines such as spermine and spermidine, etc.; (ii)
acid addition salts formed with inorganic acids, for example
hydrochloric acid, hydrobromic acid, sulfuric acid, phosphoric
acid, nitric acid and the like; (iii) salts formed with organic
acids such as, for example, acetic acid, oxalic acid, tartaric
acid, succinic acid, maleic acid, fumaric acid, gluconic acid,
citric acid, malic acid, ascorbic acid, benzoic acid, tannic acid,
palmitic acid, alginic acid, polyglutamic acid, naphthalenesulfonic
acid, methanesulfonic acid, p-toluenesulfonic acid,
naphthalenedisulfonic acid, polygalacturonic acid, and the like;
and (iv) salts formed from elemental anions such as chlorine,
bromine, and iodine.
[0100] The present invention also includes pharmaceutical
compositions and formulations that include the nucleobase oligomers
of the invention. The pharmaceutical compositions of the present
invention may be administered in a number of ways depending upon
whether local or systemic treatment is desired and upon the area to
be treated. Administration may be topical (including ophthalmic and
to mucous membranes including vaginal and rectal delivery),
pulmonary, e.g., by inhalation or insufflation of powders or
aerosols, including by nebulizer; intratracheal, intranasal,
epidermal and transdermal), oral, or parenteral. Parenteral
administration includes intravenous, intraarterial, subcutaneous,
intraperitoneal, or intramuscular injection or infusion; or
intracranial, e.g., intrathecal or intraventricular,
administration.
Locked Nucleic Acids
[0101] Locked nucleic acids (LNAs) are nucleobase oligomers that
can be employed in the present invention. LNAs contain a 2'O, 4'-C
methylene bridge that restrict the flexibility of the ribofuranose
ring of the nucleotide analog and locks it into the rigid bicyclic
N-type conformation. LNAs show improved resistance to certain exo-
and endonucleases and activate RNAse H, and can be incorporated
into almost any nucleobase oligomer. Moreover, LNA-containing
nucleobase oligomers can be prepared using standard phosphoramidite
synthesis protocols. Additional details regarding LNAs can be found
in PCT publication No. WO 99/14226 and U.S. Patent Application
Publication No. U.S. 2002/0094555 A1, each of which is hereby
incorporated by reference.
Arabinonucleic Acids
[0102] Arabinonucleic acids (ANAs) can also be employed in methods
and reagents of the present invention. ANAs are nucleobase
oligomers based on D-arabinose sugars instead of the natural
D-2'-deoxyribose sugars. Underivatized ANA analogs have similar
binding affinity for RNA as do phosphorothioates. When the
arabinose sugar is derivatized with fluorine (2.degree. F-ANA), an
enhancement in binding affinity results, and selective hydrolysis
of bound RNA occurs efficiently in the resulting ANA/RNA and
F-ANA/RNA duplexes. These analogs can be made stable in cellular
media by a derivatization at their termini with simple L sugars.
The use of ANAs in therapy is discussed, for example, in Damha et
al., Nucleosides Nucleotides & Nucleic Acids 20: 429-440,
2001.
Delivery of Nucleobase Oligomers
[0103] We demonstrate herein that naked oligonucleotides are
capable on entering tumor cells and inhibiting IAP expression.
Nonetheless, it may be desirable to utilize a formulation that aids
in the delivery of oligonucleotides or other nucleobase oligomers
to cells (see, e.g., U.S. Pat. Nos. 5,656,611, 5,753,613,
5,785,992, 6,120,798, 6,221,959, 6,346,613, and 6,353,055, each of
which is hereby incorporated by reference).
Ribozymes
[0104] Catalytic RNA molecules or ribozymes that include an
antisense IAP sequence of the present invention can be used to
inhibit expression of an IAP polynucleotide in vivo. The inclusion
of ribozyme sequences within antisense RNAs confers RNA-cleaving
activity upon them, thereby increasing the activity of the
constructs. The design and use of target RNA-specific ribozymes is
described in Haseloff et al., Nature 334:585-591. 1988, and U.S.
Patent Application Publication No. 2003/0003469 A1, each of which
is incorporated by reference.
[0105] Accordingly, the invention also features a catalytic RNA
molecule that includes, in the binding arm, an antisense RNA having
between eight and nineteen consecutive nucleobases corresponding to
a sequence of any one of Tables 1, 2, 6, and 7. In preferred
embodiments of this invention, the catalytic nucleic acid molecule
is formed in a hammerhead or hairpin motif, but may also be formed
in the motif of a hepatitis delta virus, group I intron or RNaseP
RNA (in association with an RNA guide sequence) or Neurospora VS
RNA. Examples of such hammerhead motifs are described by Rossi et
al., Aids Research and Human Retroviruses, 8:183, 1992. Example of
hairpin motifs are described by Hampel et al., "RNA Catalyst for
Cleaving Specific RNA Sequences," filed Sep. 20, 1989, which is a
continuation-in-part of U.S. Ser. No. 07/247,100 filed Sept. 20,
1988, Hampel and Tritz, Biochemistry, 28:4929, 1989, and Hampel et
al., Nucleic Acids Research, 18: 299, 1990. An example of the
hepatitis delta virus motif is described by Perrotta and Been,
Biochemistry, 31:16, 1992. The RNaseP motif is described by
Guernier-Takada et al., Cell, 35:849, 1983. The Neurospora VS RNA
ribozyme motif is described by Collins et al. (Saville and Collins,
Cell 61:685-696, 1990; Saville and Collins, Proc. Natl. Acad. Sci.
USA 88:8826-8830, 1991; Collins and Olive, Biochemistry
32:2795-2799, 1993). These specific motifs are not limiting in the
invention and those skilled in the art will recognize that all that
is important in an enzymatic nucleic acid molecule of this
invention is that it has a specific substrate binding site which is
complementary to one or more of the target gene RNA regions, and
that it have nucleotide sequences within or surrounding that
substrate binding site which impart an RNA cleaving activity to the
molecule.
RNA Interference
[0106] The nucleobase oligomers of the present invention may be
employed in double-stranded RNAs for RNA interference
(RNAi)-mediated knock-down of IAP expression. RNAi is a method for
decreasing the cellular expression of specific proteins of interest
(reviewed in Tuschl, Chembiochem 2:239-245, 2001; Sharp, Genes
& Devel. 15:485-490, 2000; Hutvagner and Zamore, Curr. Opin.
Genet. Devel. 12:225-232, 2002; and Hannon, Nature 418:244-251,
2002). In RNAi, gene silencing is typically triggered
post-transcriptionally by the presence of double-stranded RNA
(dsRNA) in a cell. This dsRNA is processed intracellularly into
shorter pieces called small interfering RNAs (siRNAs). The
introduction of siRNAs into cells either by transfection of dsRNAs
or through expression of siRNAs using a plasmid-based expression
system is increasingly being used to create loss-of-function
phenotypes in mammalian cells.
[0107] In one embodiment of the invention, double-stranded RNA
(dsRNA) molecule is made that includes between eight and nineteen
consecutive nucleobases of a nucleobase oligomer of the invention.
The dsRNA can be two distinct strands of RNA that have duplexed, or
a single RNA strand that has self-duplexed (small hairpin (sh)RNA).
Typically, dsRNAs are about 21 or 22 base pairs, but may be shorter
or longer (up to about 29 nucleobases) if desired. dsRNA can be
made using standard techniques (e.g., chemical synthesis or in
vitro transcription). Kits are available, for example, from Ambion
(Austin, Tex.) and Epicentre (Madison, Wis.). Methods for
expressing dsRNA in mammalian cells are described in Brummelkamp et
al. Science 296:550-553, 2002; Paddison et al. Genes & Devel.
16:948-958, 2002. Paul et al. Nature Biotechnol. 20:505-508, 2002;
Sui et al. Proc. Natl. Acad. Sci. USA 99:5515-5520, 2002; Yu et al.
Proc. Natl. Acad. Sci. USA 99:6047-6052, 2002; Miyagishi et al.
Nature Biotechnol. 20:497-500, 2002; and Lee et al. Nature
Biotechnol. 20:500-505 2002,, each of which is hereby incorporated
by reference.
[0108] Small hairpin RNAs consist of a stem-loop structure with
optional 3' UU-overhangs. While there may be variation, stems can
range from 21 to 31 bp (desirably 25 to 29 bp), and the loops can
range from 4 to 30 bp (desirably 4 to 23 bp). For expression of
shRNAs within cells, plasmid vectors containing either the
polymerase III HI -RNA or U6 promoter, a cloning site for the
stem-looped RNA insert, and a 4-5-thymidine transcription
termination signal can be employed. The Polymerase III promoters
generally have well-defined initiation and stop sites and their
transcripts lack poly(A) tails. The termination signal for these
promoters is defined by the polythymidine tract, and the transcript
is typically cleaved after the second uridine. Cleavage at this
position generates a 3' UU overhang in the expressed shRNA, which
is similar to the 3' overhangs of synthetic siRNAs. Additional
methods for expressing the shRNA in mammalian cells are described
in the references cited above.
[0109] The following examples are to illustrate the invention. They
are not meant to limit the invention in any way.
EXAMPLE 1
Nucleobase Oligomer Selection
[0110] We selected 96 and 98, mostly non-overlapping, 19-mer
nucleobase sequences for human XIAP and HIAP 1, respectively, based
on the selection criteria listed below. In the case of XIAP, we
selected 96 sequences (each being 19 nucleobases in length) (SEQ ID
NOs: I through 96; Table 1), from a region approximately 1 kb
upstream of the start codon to approximately 1 kb downstream of the
stop codon of the cDNA sequence. This blanketed approximately 50%
of the coding region, and immediate 5' and 3' UTR sequences (i.e.,
96 19-mers span 1.8 kb of sequence, while the targeted region is
approximately 3.5 kb in length, comprised of a coding region of 1.5
kb plus 1 kb at either side of UTR sequences). TABLE-US-00001 TABLE
1 SEQ XIAP down- XIAP down- XIAP down- ID regulation regulation
regulation NO: Code Nucleobase Sequence T24 RNA T24 protein H460
RNA 1 A1 AAAATTCTAAGTACCTGCA -- -- 48% 2 B1 TCTAGAGGGTGGCTCAGGA --
-- 66% 3 C1 CAGATATATATGTAACACT -- -- 66% 4 D1 TGAGAGCCCTTTTTTTGTT
-- -- 75% 5 E1 AGTATGAAATATTTCTGAT -- -- 69% 6 F1
ATTGGTTCCAATGTGTTCT -- -- 81% 7 G1 TTAGCAAAATATGTTTTAA -- -- 33% 8
H1 TGAATTAATTTTTAATATG -- -- 13% 9 A2 ATTCAAGGCATCAAAGTTG -- -- 58%
10 B2 GTCAAATCATTAATTAGGA -- -- 55% 11 C2 AATATGTAAACTGTGATGC 36%
45% 70% 12 D2 GCAGAATAAAACTAATAAT -- -- 39% 13 E2
GAAAGTAATATTTAAGCAG 54% 51% 60% 14 F2 TTACCACATCATTCAAGTC -- -- 34%
15 G2 CTAAATACTAGAGTTCGAC -- -- 55% 16 H2 ACACGACCGCTAAGAAACA -- --
46% 17 A3 TATCCACTTATGACATAAA -- -- 27% 18 B3 GTTATAGGAGCTAACAAAT
-- -- 34% 19 C3 AATGTGAAACACAAGCAAC -- -- 43% 20 D3
ACATTATATTAGGAAATCC -- -- 30% 21 E3 CTTGTCCACCTTTTCTAAA 53% 64% 55%
22 F3 ATCTTCTCTTGAAAATAGG 44% 53% -- 23 G3 CCTTCAAAACTGTTAAAAG --
-- -- 24 H3 ATGTCTGCAGGTACACAAG -- -- -- 25 A4 ATCTATTAAACTCTTCTAC
-- -- -- 26 B4 ACAGGACTACCACTTGGAA -- -- 76% 27 C4
TGCCAGTGTTGATGCTGAA 28% 56% 77% 28 D4 GTATAAAGAAACCCTGCTC 12% 43%
51% 29 E4 CGCACGGTATCTCCTTCAC 47% 34% 51% 30 F4 CTACAGCTGCATGACAACT
33% 43% -- 31 G4 GCTGAGTCTCCATATTGCC 34% 48% 51% 32 H4
ATACTTTCCTGTGTCTTCC -- -- -- 33 A5 GATAAATCTGCAATTTGGG -- -- -- 34
B5 TTGTAGACTGCGTGGCACT -- -- 61% 35 C5 ACCATTCTGGATACCAGAA 71% 54%
-- 36 D5 AGTTTTCAACTTTGTAGTG 39% 33% -- 37 E5 ATGATCTCTGCTTCCCAGA
-- -- 46% 38 F5 AGATGGCCTGTCTAAGGCA -- -- -- 39 G5
AGTTCTCAAAAGATAGTCT -- -- 30% 40 H5 GTGTCTGATATATCTACAA -- -- 39%
41 A6 TCGGGTATATGGTGTCTGA -- -- 72% 42 B6 CAGGGTTCCTCGGGTATAT 51%
47% -- 43 C6 GCTTCTTCACAATACATGG -- -- -- 44 D6 GGCGAGTTCTGAAAGGACT
-- -- 60% 45 E6 GCTAACTCTCTTGGGGTTA -- -- -- 46 F6
GTGTAGTAGAGTCCAGCAC 34% 39% -- 47 G6 AAGCACTGCACTTGGTCAC -- -- 69%
48 H6 TTCAGTTTTCCACCACAAC -- -- 68% 49 A7 ACGATCACAAGGTTCCCAA -- --
-- 50 B7 TCGCCTGTGTTCTGACCAG -- -- -- 51 C7 CCGGCCCAAAACAAAGAAG --
-- 72% 52 D7 GATTCACTTCGAATATTAA 56% 88% 46% 53 E7
TATCAGAACTCACAGCATC -- -- -- 54 F7 GGAAGATTTGTTGAATTTG -- -- 69% 55
G7 TCTGCCATGGATGGATTTC -- -- 41% 56 H7 AAGTAAAGATCCGTGCTTC -- --
63% 57 A8 CTGAGTATATCCATGTCCC -- -- -- 58 B8 GCAAGCTGCTCCTTGTTAA --
-- -- 59 C8 AAAGCATAAAATCCAGCTC -- -- 16% 60 D8 GAAAGCACTTTACTTTATC
38% 26% 49% 61 H8 ACTGGGCTTCCAATCAGTT -- -- -- 62 E8
GTTGTTCCCAAGGGTCTTC 72% 56% 44% 63 F8 ACCCTGGATACCATTTAGC -- -- 47%
64 G8 TGTTCTAACAGATATTTGC -- -- 49% 65 A9 TATATATTCTTGTCCCTTC -- --
62% 66 B9 AGTTAAATGAATATTGTTT -- -- 38% 67 C9 GACACTCCTCAAGTGAATG
-- -- -- 68 D9 TTTCTCAGTAGTTCTTACC -- -- 39% 69 E9
GTTAGTGATGGTGTTTTCT -- -- 43% 70 F9 AGATGGTATCATCAATTCT -- -- 19%
71 G9 TGTACCATAGGATTTTGGA -- -- -- 72 H9 CCCGATTCGTATAGCTTCT -- --
-- 73 A10 ATTATTTTCTTAATGTCCT -- -- 29% 74 B10 CAAGTGATTTATAGTTGCT
-- -- -- 75 C10 TAGATCTGCAACCAGAACC -- -- 53% 76 D10
GATCTTGCATACTGTCTTT -- -- 55% 77 E10 CCTTAGCTGCTCTTCAGTA -- -- --
78 F10 AAGCTTCTCCTCTTGCAGG -- -- 51% 79 G10 ATATTTCTATCCATACAGA --
-- 56% 80 H10 CTAGATGTCCACAAGGAAC -- -- -- 81 A11
AGCACATTGTTTACAAGTG -- -- 68% 82 B11 AGCACATGGGACACTTGTC -- -- 63%
83 C11 CTTGAAAGTAATGACTGTG -- -- 52% 84 D11 CCTACTATAGAGTTAGATT --
-- -- 85 E11 ATTCAATCAGGGTAATAAG -- -- 48% 86 F11
AAGTCAGTTCACATCACAC -- -- 64% 87 G11 CAGTAAAAAAAATGGATAA -- -- 33%
88 H11 TTCAGTTATAGTATGATGC -- -- -- 89 A12 TACACTTAGAAATTAAATC --
-- 46% 90 B12 TCTCTATCTTTCCACCAGC -- -- -- 91 C12
AGAATCCTAAAACACAACA -- -- -- 92 D12 ATTCGCACAAGTACGTGTT -- -- 77%
93 E12 TGTCAGTACATGTTGGCTC -- -- 74% 94 F12 ACATAGTGTTTTGCCACTT --
-- 74% 95 G12 CTTTGATCTGGCTCAGACT -- -- 76% 96 H12
GAAACCAGATTTAACAGTT -- -- 52%
[0111] Note that in any of the foregoing nucleobase oligomers, or
any other nucleobase oligomers described herein, each nucleobase
may independently be a DNA residue or RNA residue, such as a
2'-O-methyl or 2'-O-methoxyelthyl RNA residue. For example, the
nucleobase sequence of SEQ ID NO: 3 may be, for example,
5'-CAGATATATATG TAACACT-3', 5'-CAGATATATATGTAACACU-3', or
5'-mCmAGATATATATGTA ACAmCmU-3' (wherein mX represents a 2'-O-methyl
X residue). Additional modified nucleobases are known in the art.
The linkages may be phosphodiester (PO), phosphorothioate (PS), or
methylphosphonate (MP) linkages, or may have a mixed backbone (MB).
The backbone may be any suitable backbone that allows hybridization
of the nucleobase oligomer to the target IAP polynucleotide.
Exemplary backbones are described herein. In other embodiments, the
nucleobase oligomers include acridine-protected linkages,
cholesteryl or psoralen components, C5-propynyl pyrimidines, or
C5-methyl pyrimidines. Suitable modifications to the nucleobase
oligomers of the invention include those described above, as well
as those in U.S. Patent Application Publication No. U.S.
2002/0128216 A1, hereby incorporated by reference.
[0112] Examples of nucleobase oligomers are provided in Table 2,
below (wherein mX represents a 2'-O-methyl X RNA residue).
TABLE-US-00002 TABLE 2 SEQ ID NO: 2 .times. 2 MB PO DE4 as
mGmGTATCTCCTTCACCAGmUmA 97 DE4 rev mAmUGACCACTTCCTCTATmGmG 98
.delta.BC5 as mGmATACCAGAATTTmGmU 99 .delta.BC5 rev
mUmGTTTAAGACCATmAmG 100 mG4 as mGmCTGAGTCTCCATACTGmCmC 101 mG4 sm
mGmGCTCTCTGCCCACTGAmAmU 102 3 .times. 3 MB PO F3 as
mAmUmCTTCTCTTGAAAATmAmGmG 103 F3 scr mCmAmGAGATTTCATTTAAmCmGmU 104
F3 mm mAmUmCTTGACTTGATTATmAmGmG 105 F3 rev
mGmGmATAAAAGTTCTCTTmCmUmA 106 E4 as mCmGmCACGGTATCTCCTTmCmAmC 107
E4 scr mCmUmACGCTCGCCATCGTmUmCmA 108 E4 rev
mCmAmCTTCCTCTATGGCAmCmGmC 109 E4 mm mCmGmCACCCTATCTGGTTmCmAmC 110
G4 as mGmCmUGAGTCTCCATATTmGmCmC 111 G4 scr
mGmGmCTCTTTCGCCACTGmAmAmU 112 G4 rev mCmCmGTTATACCTCTGAGmUmCmG 113
G4 mm mGmCmUGACACTCCAATTTmGmcmC 114 C5 as mAmCmCATTCTGGTAACCAmGmAmA
115 C5 scr mUmGmCCCAAGAATACTAGmUmCmA 116 C5 mm
mAmCmCATAGTGGATTGCAmGmAmA 117 C5 rev mAmAmGACCATAGGTCTTAmCmCmA 118
D7 as mGmAmUTCACTTCTTCGAATATmUmAmA 119 D7 scr
mUmGmAAATGTAAATCATCmUmUmC 120 D7 mm mGmAmUTCTGTTCGATAATmUmAMA 121
D7 rev mAmAmUTATAAGCTTCACTmUmAmG 122 Phosphorothioate PS-G4 as
GCTGAGTCTCCATATTGCC 123 PS-G4 sm GGCTCTTTGCCCACTGAAT 124 PS-C5 as
ACCATTCTGGATACCAGAA 125 PS-C5 rev AAGACCATAGGTCTTACCA 126 PS-F3 as
ATCTTCTCTTGAAAATAGG 127 PS-F3 rev GGATAAAAGTTCTCTTCTA 128 PS-DE4 as
GGTATCTCCTTCACCAGTA 129 PS-DE4 rev ATGACCACTTCCTCTATGG 130 PS-BC5
as TCTGGATACCAGAATTTGT 131 PS-BC5 rev TGTTTAAGACCATAGGTCT 132
PS-AB6 as GGGTTCCTCGGGTATATGG 133 PS-AB6 rs GGTATATGGCGTCCTTGGG 134
PS-D7 as GATTCACTTCGAATATTAA 135 PS-D7 rs AATTATAACGTTCACTTAG 136
Penetratin F3 as ATCTTCTCTTGAAAATAGG 137 G4 as GCTGAGTCTCCATATTGCC
138 D7 as GATTCACTTCGAATATTAA 139 C5 cs TGCCCAAGAATACTAGTCA 140 4
.times. 4 MBO PS (phosphorothioate linkages throughout) G4 as
mGmCmUmGAGTCTCGATATmUmGmCmC 141 G4 sm mGmGmCmUCTTTGCCCACTmGmAmAmU
142 DE4 as mGmGmUmATCTCCTTCACCmAmGmUmA 143 DE4 rev
mAmUmGmACCACTTCCTCTmAmUmGmG 144 E2 as mGmAmAmAGTAATATTTAAmGmCmAmG
145 E2 rm mGmAmGmCAATTTATAATGmAmAmAmG 146 H2G as
mAmCmCmGCTAAGAAACATmUmCmUmA 147 H2G rm mAmUmCmUTACAAAGAATCmCmGmCmA
148 A3 as mUmAmUmCCACTTATGACAmUmAmAmA 149 A3 rev
mAmAmAmUACAGTATTCACmCmUmAmU 150 FG8 as mUmGmCmACCCTGGATACCmAmUmUmU
151 FG8 rm mUmUmUmACCATAGGTCCCmAmGmCmU 152 mG4 as
mGmCmUmGAGTCTCCATACmUmGmCmC 153 mG4 sm mGmGmCmUCTCTGCCCACTmGmAmAmU
154 F1 as mAmUmUmGGTTCCAATGTGmUmUmCmU 155 F1 rev
mUmCmUmUGTGTAACCTTGmGmUmUmA 156 B4 as mAmCmAmGGACTACCACTTmGmGmAmA
157 B4 rev mAmAmGmGTTCACCATGAGmGmAmCmA 158 G6 as
mAmAmGmCACTGCACTTGGmUmCmAmC 159 G6 sm mCmAmCmTGGTTGACCTCAmCmAmAmG
160 E12 as mUmGmUmCAGTACATGTTGmGmCmUmC 161 E12 sm
mCmUmAmGGTTGTCCATGAmCmUmGmU 162 Penetratin and its use in mediating
entry of nucleobase oligomers into cells are described in PCT
patent application No. FR 91/00444.
[0113] A similar identification approach was taken for designing
nucleobase oligomers against HIAP1. Initially, 98 19-mer nucleobase
oligomers were chosen (SEQ ID NOs: 163-260; Table 3). Of these 98
nucleobase oligomers targeted to the HIAP1 sequence, fifteen (SEQ
ID NOs: 163-170, 173, 179, 202, 222, 223, 247, and 259) were
selected for further evaluation. These fifteen candidate nucleobase
oligomers included four nucleobase oligomers targeting the coding
region (SEQ ID NOs: 202, 222, 223, and 247), one nucleobase
oligomer targeting the 3' UTR (SEQ ID NO: 259), seven nucleobase
oligomers targeting the 5' UTR (SEQ ID NOs: 166-170, 173, and 179;
one of the seven nucleobase oligomers overlapped the start codon),
and three other oligonucleotides (SEQ ID NOs: 163-165) that were
designed to target an intronic segment of the 5' UTR.
TABLE-US-00003 TABLE 3 SEQ ID NO: Code Nucleobase Oligomer Sequence
163 APO 1 TCATTTGAGCCTGGGAGGT 164 APO 2 CGGAGGCTGAGGCAGGAGA 165 APO
3 GGTGTGGTGGTACGCGCCT 166 APO 4 ACCCATGCACAAAACTACC 167 APO 5
AGAATGTGCCAGTAGGAGA 168 APO 6 TCTCACAGACGTTGGGCTT 169 APO 7
CCAGTGGTTTGCAAGCATG 170 APO 8 GAAATTTAGTGGCCAGGAA 171
AGAAATACACAATTGCACC 172 TACTGATACATTTTAAGGA 173 APO 9
TTCAACATGGAGATTCTAA 174 ATTTCTATGCATTTAGAGT 175 AATACTAGGCTGAAAAGCC
176 GGCTTTGCTTTTATCAGTT 177 TCTAGGGAGGTAGTTTTGT 178
GGGAAGAAAAGGGACTAGC 179 APO 10 GTTCATAATGAAATGAATG 180
ATAAGAATATGCTGTTTTC 181 TTCAAACGTGTTGGCGCTT 182 ATGACAAGTCGTATTTCAG
183 AAGTGGAATACGTAGACAT 184 AGACAGGAACCCCAGCAGG 185
CGAGCAAGACTCCTTTCTG 186 AGTGTAATAGAAACCAGCA 187 TGACCTTGTCATTCACACC
188 TTATCCAGCATCAGGCCAC 189 ACTGTCTCCTCTTTTCCAG 190
TTTTATGCTTTTCAGTAGG 191 ACGAATCTGCAGCTAGGAT 192 CAAGTTGTTAACGGAATTT
193 TAGGCTGAGAGGTAGCTTC 194 GTTACTGAAGAAGGAAAAG 195
GAATGAGTGTGTGGAATGT 196 TGTTTTCTGTACCCGGAAG 197 GAGCGACGGAAATATCCAC
198 TGATGGAGAGTTTGAATAA 199 GATTTGCTCTGGAGTTTAC 200
GGCAGAAAATTCTTGATTT 201 GGACAGGGGTAGGAACTTC 202 APO 11
GCATTTTCGTTATTCATTG 203 CTGAAAAGTAAGTAATCTG 204 GGCGACAGAAAAGTCAATG
205 CCACTCTGTCTCCAGGTCC 206 CCACCACAGGCAAAGCAAG 207
TTCGGTTCCCAATTGCTCA 208 TTCTGACATAGCATTATCC 209 TGGGAAAATGTCTCAGGTG
210 TATAAATGGGCATTTGGGA 211 TGTCTTGAAGCTGATTTTC 212
GAAACTGTGTATCTTGAAG 213 TGTCTGCATGCTCAGATTA 214 GAATGTTTTAAAGCGGGCT
215 CACTAGAGGGCCAGTTAAA 216 CCGCACTTGCAAGCTGCTC 217
CATCATCACTGTTACCCAC 218 CCACCATCACAGCAAAAGC 219 TCCAGATTCCCAACACCTG
220 CCCATGGATCATCTCCAGA 221 AACCACTTGGCATGTTGAA 222 APO 12
CAAGTACTCACACCTTGGA 223 APO 13 CCTGTCCTTTAATTCTTAT 224
TGAACTTGACGGATGAACT 225 TAGATGAGGGTAACTGGCT 226 TGGATAGCAGCTGTTCAAG
227 CATTTTCATCTCCTGGGCT 228 TGGATAATTGATGACTCTG 229
GTCTTCTCCAGGTTCAAAA 230 TATTCATCATGATTGCATC 231 CATTTCCACGGCAGCATTA
232 CCAGGCTTCTACTAAAGCC 233 GCTAGGATTTTTCTCTGAA 234
TCTATAATTCTCTCCAGTT 235 ACACAAGATCATTGACTAG 236 TCTGCATTGAGTAAGTCTA
237 CTCTTCCCTTATTTCATCT 238 TCCTCAGTTGCTCTTTCTC 239
GCCATTCTATTCTTCCGGA 240 AGTCAAATGTTGAAAAAGT 241 CCAGGATTGGAATTACACA
242 ATTCCGGCAGTTAGTAGAC 243 TAACATCATGTTCTTGTTC 244
GTCTGTGTCTTCTGTTTAA 245 TTCTCTTGCTTGTAAAGAC 246 CTAAAATCGTATCAATCAG
247 APO 14 GGCTGCAATATTTCCTTTT 248 GAGAGTTTCTGAATACAGT 249
ACAGCTTCAGCTTCTTGCA 250 AAATAAATGCTCATATAAC 251 GAAACATCTTCTGTGGGAA
252 GTTCTTCCACTGGTAGATC 253 CTTCTTGTAGTCTCCGCAA 254
TTGTCCATACACACTTTAC 255 AACCAAATTAGGATAAAAG 256 ATGTTCATATGGTTTAGAT
257 TAAGTTTTACTTCACTTAC 258 ATGTTCCCGGTATTAGTAC 259 APO 15
GGGCTCAAGTAATTCTCTT 260 GCCCAGGATGGATTCAAAC
Nucleobase Oligomer Selection Criteria
[0114] The computer program OLIGO (previously distributed by
National Biosciences Inc.) was used to select candidate nucleobase
oligomers based on the following criteria: [0115] 1) no more than
75% GC content, and no more than 75% AT content; [0116] 2)
preferably no nucleobase oligomers with four or more consecutive G
residues (due to reported toxic effects, although one was chosen as
a toxicity control); [0117] 3) no nucleobase oligomers with the
ability to form stable dimers or hairpin structures; and [0118] 4)
sequences around the translation start site are a preferred region.
In addition, accessible regions of the target mRNA were predicted
with the help of the RNA secondary structure folding program MFOLD
(M. Zuker, D. H. Mathews & D. H. Turner, Algorithms and
Thermodynamics for RNA Secondary Structure Prediction: A Practical
Guide. In: RNA Biochemistry and Biotechnology, J. Barciszewski
& B. F. C. Clark, eds., NATO ASI Series, Kluwer Academic
Publishers, (1999). Sub-optimal folds with a free energy value
within 5% of the predicted most stable fold of the mRNA were
predicted using a window of 200 bases within which a residue can
find a complimentary base to form a base pair bond. Open regions
that did not form a base pair were summed together with each
suboptimal fold and areas that consistently were predicted as open
were considered more accessible to the binding to nucleobase
oligomers. Additional nucleobase oligomer that only partially
fulfilled some of the above selection criteria were also chosen as
possible candidates if they recognized a predicted open region of
the target mRNA.
EXAMPLE 2
Oligonucleotide Synthesis
[0119] The ability of nucleobase oligomers to inhibit IAP
expression was tested using oligonucleotides as exemplary
nucleobase oligomers. The oligonucleotides were synthesized by IDT
(Integrated DNA Technologies, USA) as chimeric, second-generation
oligonucleotides, consisting of a core of phosphodiester DNA
residues flanked on either side by two 2'-O-methyl RNA residues
with a phosphorothioate linkage between the flanking RNA residues.
The oligonucleotides were provided in a 96-well plate, as well as
matching tubes, with a minimum of 12 ODs of nucleobase oligomer,
which provided ample material for transfections (greater than a
hundred assays in the 96-well format) when the detection method is
a sensitive method, such as TaqMan quantitative PCR, or an ELISA.
Once the positive hits were identified (see below),
oligonucleotides were re-synthesized with three, instead of two,
flanking RNA residues to further increase stability/nuclease
resistance. In addition, for validation purposes, appropriate
controls (such as scrambled, 4-base mismatch, and reverse polarity
oligonucleotides) were synthesized for some of the targets that
yielded the highest activity.
EXAMPLE 3
Screening Assays and Optimization of Nucleobase Oligomers
[0120] Our approach to identifying nucleobase oligomers capable of
inhibiting expression of an IAP was to screen the above-described
oligonucleotide libraries for specific decreases (knock-down) of
the RNA and/or protein for the specific IAP gene targeted. Any
number of standard assays may be used to detect RNA and protein
levels in cells. For example, RNA levels can be measured using
standard northern blot analysis or RT-PCR techniques. Protein
levels can be measured, for example, by standard western blot
analyses or immunoprecipitation techniques. Alternatively, cells
administered an antisense IAP nucleic acid may be examined for cell
viability, according to methods described, for example, in U.S.
Pat. Nos. 5,919,912, 6,156,535, and 6,133,437, incorporated herein
by reference.
[0121] We used TaqMan quantitative PCR (described below) to assay
for changes in mRNA levels after oligonucleotide treatment. We
employed ELISA for determining XIAP protein levels and western
blotting for determining HIAP1 protein levels. Transfection
conditions were optimized with Lipofectamine plus or Lipofectamine
2000 (Life Technologies, Canada) on T24 bladder carcinoma cells or
H460 non-small cell lung carcinoma cells, or lipofectin on SF-295
glioblastoma cells, using a fluorescein-tagged sense
oligonucleotide (5'-mGmAGAAGATGACTGGTAAmCmA-3'; SEQ ID NO: 261)
from XIAP spanning the start codon as a control. The results were
visualized and gauged by epi-fluorescence microscopy. In the case
of T24 cells, transfections were further optimized based on the
ability of a published oligonucleotide to downregulate survivin
expression (Li et al., Nat. Cell Biol. 1:461-466, 1999)
(5'-U/TGTGCTATTCTGTGAA U/TU/T-3' SEQ ID NO: 262). We optimized the
transfection conditions based on the TaqMan results of survivin RNA
knock-down detected with PCR primers and fluorescent probe,
described in detail below. Optimal conditions for oligonucleotide
uptake by the cells were found to be 940 nM oligonucleotide and 4
.mu.L PLUS reagent and 0.8 .mu.L Lipofectamine in a total of 70
.mu.L for three hours. We then applied these conditions to screen
for XIAP protein knock-down using the oligo library against T24
cells.
[0122] HIAP1 knock-down was studied in SF-295 cells because these
cells had easily detectable and discernable 70 kDa HIAP1 protein,
while many cell lines do not express high levels of the protein, or
are not distinguishable from the large amounts of the similarly
sized 68 kDa HIAP2 protein.
[0123] Real-Time PCR
[0124] RNA was extracted from cells lysed in RLT buffer (QIAGEN,
Valencia, Calif.), and purified using QIAGEN RNeasy columns/kits.
Real-time quantitative PCR was performed on a Perkin-Elmer ABI 7700
Prism PCR machine. RNA was reverse transcribed and amplified
according to the TaqMan Universal PCR Master Mix protocol of PE
Biosystems, using primers and probes designed to specifically
recognize XIAP, HIAP1, survivin, or GAPDH. For human survivin, the
forward primer was 5'-TCTGCT TCAAGGAGCTGGAA-3' (SEQ ID NO: 263),
the reverse primer was 5'-GAAAGGAA AGCGCAACCG-3' (SEQ ID NO: 264),
and the probe was 5'-(FAM)AGCCAGATGAC GACCCCATAGAGGAACATA(TAMRA)-3'
(SEQ ID NO: 265). For human HIAP1, the forward primer was
5'-TGGAGATGATCCATGGGTTCA-3' (SEQ ID NO: 266), the reverse primer
was 5'-GAACTCCTGTCCTTTAATTCTTATCAAGT-3' (SEQ ID NO: 267), and the
probe was 5'-(FAM)CTCACACCTTGGAAACCACTTGGCATG (TAMRA)-3' (SEQ ID
NO: 268). For human XIAP, the forward primer was 5'-GGTGA
TAAAGTAAAGTGCTTTCACTGT-3' (SEQ ID NO: 269), the reverse primer was
5'-TCAGTAGTTCTTACCAGACACTCCTCAA-3' (SEQ ID NO: 270), and the probe
was 5'-(FAM)CAACATGCTAAATGGTATCCAGGGTGCAAATATC(TAMRA)-3' (SEQ ID
NO: 271). For human GAPDH, the forward primer was 5'-GAAGGTGAAGG
TCGGAGTC-3' (SEQ ID NO: 272), the reverse primer was
5'-GAAGATGGTGATGG GATTC-3' (SEQ ID NO: 273), and the probe was
5'-(JOE)CAAGCTTCCCGTTCTCA GCC(TAMRA)-3' (SEQ ID NO: 274). FAM is
6-carboxyfluoroscein, JOE is
6-carboxy-4,5-dichloro-2,7-dimethoxyfluoroscein, and TAMRA is
6-carboxy-N,N,N',N'-tetramethylrhodamine. FAM and JOE are 5'
reporter dyes, while TAMRA is a 3' quencher dye.
[0125] Relative quantification of gene expression was performed as
described in the PE Biosystems manual using GAPDH as an internal
standard. The comparative Ct (cycle threshold) method was used for
relative quantitation of IAP mRNA levels compared to GAPDH mRNA
levels. Briefly, real-time fluorescence measurements were taken at
each PCR cycle and the threshold cycle (Ct) value for each sample
was calculated by determining the point at which fluorescence
exceeded a threshold limit of 30 times the baseline standard
deviation. The average baseline value and the baseline SD are
calculated starting from the third cycle baseline value and
stopping at the baseline value three cycles before the signal
starts to exponentially rise. The PCR primers and/or probes for the
specific IAPs were designed to span at least one exon-intron
boundary separated by 1 kb or more of genomic DNA, to reduce the
possibility of amplifying and detecting genomic DNA contamination.
The specificity of the signal, and possible contamination from DNA,
were verified by treating some RNA samples with either DNase or
RNase, prior to performing the reverse transcription and PCR
reaction steps.
[0126] XIAP ELISA and HIAP1 Western Immunoblots
[0127] A standard colorimetric XIAP ELISA assay was performed using
an affinity-purified rabbit polyclonal antibody to XIAP as a
capture antibody, and was detected with a XIAP monoclonal antibody
(MBL, Japan) and a biotinylated anti-mouse Ig antibody and
horseradish peroxidase-conjugated streptavidin and TMB substrate.
Alternatively, a polyclonal XIAP or HIAP1 antibody may be used to
measure XIAP or HIAP1 protein levels, respectively.
[0128] HIAP1 was detected on a western immunoblot using an
affinity-purified anti-rat HIAP1 rabbit polyclonal antibody as a
primary antibody and was detected by ECL (Amersham) on X-ray film
with a secondary horseradish-peroxidase-conjugated anti-rabbit Ig
antibody and a chemiluminescent substrate. The anti-HIAP1
polyclonal antibody is raised against a GST-fusion of the rat
HIAP1. This antibody cross-reacts with both human and murine HIAP1
and HIAP2.
EXAMPLE 4
Antisense XIAP Oligonucleotides Decrease XIAP RNA and Polypeptide
Expression
[0129] The XIAP synthetic library of 96 antisense oligonucleotides
was first screened for decreases in XIAP protein levels.
Specifically, T24 cells (1.5.times.10.sup.4 cells/well) were seeded
in wells of a 96-well plate on day 1, and were cultured in
antibiotic-free McCoy's medium for 24 hours. On day 2, the cells
were transfected with XIAP antisense oligonucleotides as described
above (oligonucleotides are labeled according to their plated
position, i.e., A1 to H12, and include two repeats, A13 and B13
that contain lyophilized DNA pellets that stuck to the sealing
membrane). Briefly, the nucleobase oligomers were diluted in 10
.mu.l/well of serum-free, antibiotic-free McCoy's medium and then
PLUS reagent was added. Lipofectamine was diluted in 10 .mu.l/well
of serum-free, antibiotic-free McCoy's medium, and both mixes were
incubated for 15 minutes at room temperature. The mixes were then
combined and incubated for 15 minutes at room temperature.
[0130] In the meantime, the complete medium was removed from the
cells and 50 .mu.l/well of serum-free, antibiotic-free medium was
added to the cells. The transfection mixes were added to the well,
and the cells were incubated for three hours. Then 30 .mu.l/well of
serum-free, antibiotic-free medium and 100 .mu.l/well of
antibiotic-free complete medium, containing 20% fetal bovine serum
were added to each well.
[0131] At day 3, XIAP RNA levels were measured using quantitative
real-time PCR techniques, as described above. At day 4, XIAP
protein levels were measured by ELISA (FIGS. 1A, 1C, 1E, 1G, 1I,
and 1K), and total cellular protein was measured biochemically
(FIGS. 1B, 1D, 1F, 1H, 1J, and 1L; used to normalize the XIAP
protein levels). The results were compared to a mock transfection
sample (treated with the transfection agent but no oligonucleotide
DNA was added, and then processed as for the other samples). Time
course experiments determined that the optimal time for protein
knock-down to be around 12 to 24 hours.
[0132] The oligonucleotide library was also screened for decreases
in RNA levels, using TaqMan-specific PCR primers and fluorescent
probes at the appropriate optimal time, using the primers and
probes described above. Time course experiments determined mRNA to
be optimally decreased at 6 to 9 hours. These results agree well
with the protein results.
[0133] The first screen (although performed at a sub-optimal time
point when XIAP levels are returning to normal, possibly due to an
outgrowth of non-transfected cells) identified 16 antisense
oligonucleotides (Table 1: C2, E2, E3, F3, C4, D4, E4, F4, G4, C5,
D5, B6, F6, D7, D8, F8) out of the 96 nucleobase oligomers tested
that showed some decrease in XIAP protein levels relative to total
protein, compared to mock (no nucleobase oligomer) transfection
levels (FIGS. 1A, 1C, 1E, 1G, 1I, and 1K). Total protein was
decreased for each of these 16 nucleobase oligomers, which
indicates a toxic or cytostatic effect of these nucleobase
oligomers (FIGS. 1B, 1D, 1F, 1H, 1J, 1L). Nucleobase oligomers B9
and C9 showed a clear drop in total protein but no relative drop in
XIAP protein levels.
[0134] The 16 antisense nucleobase oligomers that showed some
decrease in relative XIAP protein levels compared to mock
transfection, were re-tested alone or in combination, with one
control nucleobase oligomer (D2) included, for their ability to
knock-down XIAP protein at a more optimal time point (12 hours)
based on the above described time course studies (FIG. 2B). These
nucleobase oligomers were also examined for their ability to
decrease XIAP mRNA levels at 12 hours, normalized against GAPDH
levels, and compared to mock transfection. Total protein
concentrations at 12 hours were also determined (FIG. 2C).
[0135] There was a good correlation between the ability of a
nucleobase oligomer to decrease XIAP protein levels (FIG. 2B) with
its ability to decrease XIAP MRNA levels (FIG. 2A). In addition,
there is no major loss of total protein at this early time point,
and the decrease in XIAP mRNA and protein precede the decrease in
total protein that is seen at later time points. The nucleobase
oligomers that showed greater than 50% loss of XIAP protein or mRNA
levels alone, or in a combination of two nucleobase oligomers added
at a 1:1 ratio, were identified as the best nucleobase oligomers
and validated further. Of these 16 oligonucleotides, ten (E2, E3,
F3, E4, F4, G4, C5, B6, D7, F8) showed a consistent ability to
decrease XIAP protein or RNA levels by more than 50%, depending on
the transfection conditions used, or when used in combination (as
for C5 and G4). Moreover, these 16 oligonucleotides that
demonstrated antisense activity clustered in four different target
regions of the XIAP mRNA, with adjacent nucleobase oligomers
showing some knock-down activity. Little or no antisense activity
was observed with nucleobase oligomers that target sequences
between these regions or islands of sensitivity. Presumably, these
regions represent open areas on the mRNA that are accessible to
nucleobase oligomers inside the cell. Two nucleobase oligomers, E3
and F3, target XIAP just upstream of the start codon in the
intervening region between the IRES and the translation start site,
and partially overlap the end of the IRES element. C2, D2, and E2
target a XIAP region upstream of the minimal IRES element,
providing further evidence that the minimal IRES region is a highly
structured region of RNA that is not readily accessible to
nucleobase oligomers in vivo. All the other nucleobase oligomers
are complimentary to a portion of the coding region, including a
cluster of activity at positions 856-916 of the XIAP sequence (E4,
F4, and G4) and smaller separate areas, as demonstrated by
nucleobase oligomers C5 and D5, for example.
[0136] A portion of the 96 nucleobase oligomers depicted in Table 1
were rescreened for their ability to knock-down XIAP mRNA in
NCI-H460 cells at 9 hours post-transfection. The data are
summarized in Table 4, below. TABLE-US-00004 TABLE 4 2 .times. 2
MBO XIAP RNA Std. Dev. Untrf. Co. 1.04 0.055 Mock Co. 1.01 0.006 G4
sm 0.97 0.071 DE4 rev 1.06 0.121 A1 as 0.46 0.01 B1 as 0.34 0.03 C1
as 0.3 0.04 D1 as 0.25 0.03 E1 as 0.31 0.01 F1 as 0.19 0.01 G1 as
0.67 0.03 H1 as 0.87 0.03 A2 as 0.42 0.02 B2 as 0.45 0.03 C2 as
0.33 0.02 D2 as 0.66 0.01 E2 as 0.44 0.01 F2 as 0.64 0.02 G2 as
0.44 0.01 H2 as 0.56 0.04 A3 as 0.71 0.03 B3 as 0.64 0.08 C3 as
0.55 0.04 D3 as 0.68 0.02 E3 as 0.48 0.02 B4 as 0.23 0.01 C4 as
0.22 0.04 D4 as 0.48 0.04 E4 as 0.44 0.01 G4 as 0.48 0.02 B5 as
0.38 0.03 E5 as 0.52 0.05 G5 as 0.68 0.05 H5 as 0.59 0.09 A6 as
0.27 0 D6 as 0.39 0.03 G6 as 0.3 0.01 H6 as 0.31 0.01 C7 as 0.27
0.02 D7 as 0.52 0.04 F7 as 0.3 0.04 G7 as 0.66 0.04 H7 as 0.49 0.01
C8 as 1.01 0.08 D8 as 0.55 0.04 F8 as 0.62 0 G8 as 0.64 0.06 H8 as
0.61 0.06 A9 as 0.46 0.02 B9 as 0.74 0.07 D9 as 0.73 0.04 E9 as
0.69 0.06 F9 as 0.97 0.15 A10 as 0.85 0.04 C10 as 0.56 0.01 D10 as
0.54 0.01 F10 as 0.64 0 G10 as 0.49 0 A11 as 0.36 0.03 B11 as 0.39
0.02 C11 as 0.44 0.03 E11 as 0.52 0.04 F11 as 0.36 0.05 G11 as 0.67
0.02 A12 as 0.54 0.03 D12 as 0.23 0.05 E12 as 0.26 0.01 F12 as 0.26
0.03 G12 as 0.24 0.05 H12 as 0.48 0.06
We also determined whether 4.times.4 MBOs (all PS, DNA residues
flanked on both sides by four 2'-O-methyl RNA residues) were
capable of knocking-down XIAP protein in H460 cells. As shown in
FIGS. 3 and 4, 4.times.4 MBs of E12 and another oligonucleotide,
FG8, were effective in amounts as low as 31 nM.
EXAMPLE 5
XIAP Antisense Nucleobase Oligomers Increase Cytotoxicity and
Chemosensitization
[0137] We investigated if XIAP antisense nucleobase oligomers could
chemosensitize the highly drug resistant T24 cells to traditional
chemotherapeutic agents, such as adriamycin or cisplatin. Antisense
oligonucleotides were chosen to represent some of the different
XIAP target regions and tested for their cytotoxic effects, alone
or in combination with other oligonucleotides or drugs. Five XIAP
antisense oligonucleotides were tested for their ability to kill or
chemosensitize T24 bladder carcinoma cells, and were compared to
the effects of three corresponding scrambled control
oligonucleotides.
[0138] T24 cells were transfected with XIAP antisense
oligonucleotides, scrambled oligonucleotides, no oligonucleotides
(mock transfected), or were left untreated. The cells were tested
for viability 20 hours after transfection (with the exception of
the untreated control) using the WST-1 tetrazolium dye assay in
which WST-1 tetrazolium dye is reduced to a colored formazan
product in metabolically active cells (FIG. 5A).
[0139] The occurrence of cytoxicity induced by oligonucleotide E4
was examined by visually inspecting T24 cells that were left
untreated, mock transfected, or transfected with E4, E4 scrambled,
E4 reverse polarity, or E4 mismatched oligonucleotides. Twenty
hours after transfection, the cells were examined for morphology
(FIG. 5D). Only the cell transfected with antisense E4
oligonucleotides showed signs of toxicity.
[0140] To examine the effects of the nucleobase oligomers on the
chemosensitization of the T24 cells to cisplatin or adriamycin,
oligonucleotides were tested for their ability to further kill T24
cells in the presence of a fixed dose of adriamycin (0.5 .mu.g/ml).
Cells were first transfected with a oligonucleotide, then
adriamycin was added for another 20 hours. Viability was measured
by WST-1 at the end of the 20-hour drug treatment (FIG. 5B).
Results are shown in FIG. 5C as percentage viability compared to
nucleobase oligomer treatment alone.
[0141] All five nucleobase oligomers tested (F3, E4, G4, C5, D7) as
well as combinations of E4+C5 and G4+C5, killed the T24 cells,
leaving only 10-15% surviving cells after 24 hours, as compared to
the mock (no oligonucleotide) transfected cells, or to cells
transfected with three corresponding scrambled controls to F3
(5'-mCmAmGAGATTT CATTTAAmCmGmU-3'; SEQ ID NO: 275), E4
(5'-mCmUmACGCTCGCCATCGTm UmCmA-3'; SEQ ID NO: 276) and C5
(5'-mUmGmCCCAAGAATACTAGmUmC mA-3'; SEQ ID NO: 277)(FIGS. 5A and
5C). Therefore, the toxicity is sequence-specific to those
nucleobase oligomers that reduce XIAP levels, and not to a
non-sequence specific toxicity due to nucleobase oligomers this
chemistry in general. This cytotoxicity may result from the
combined effect of XIAP protein knock-down (and the expected loss
of anti-apoptotic protection afforded by XIAP) and the cytotoxicity
of the transfection itself.
[0142] The addition of a fixed dose of adriamycin or cisplatin at
the end of the three hour transfection period resulted in a further
decrease in survival for some of the tested oligonucleotides, a
further 40% drop in survival after 20 hours for nucleobase
oligomers F3, D7 and G4+C5 combination (FIG. 5B), compared to their
corresponding oligonucleotide-treated values (FIG. 5C). The values
in FIG. 5B (oligonucleotide plus drug) are compared to the values
of oligonucleotide alone in FIG. 5C, which is set a 100% for each
ODN. Only the results for adriamycin chemosensitization are shown;
similar results were obtained when the cells were chemosensitized
with cisplatin. At the fixed doses used, the mock and scrambled
control transfections did not show any increased loss of survival
when either treated with adriamycin (FIG. 5B). Chemosensitization
is only seen when XL1P levels are decreased by a specific antisense
oligonucleotide.
EXAMPLE 6
Down-Regulating Effects of Antisense Oligonucleotides on XIAP mRNA
in H460 Cells
[0143] By using real-time PCR, antisense oligonucleotides
(2.times.2 MBO, composed of two flanking 2'-O-methyl RNA residues
at either end with phosphorothioate linkages, and a central core of
15 phosphodiester DNA residues) were examined for their effects on
XIAP mRNA in H460 cells. In this configuration, nucleobase
oligomers F3, G4, C5, AB6 and DE4 reduced the mRNA level by 50-70%,
compared to untreated control, while D7 AS nucleobase oligomers
reduced the mRNA level by 30% (FIG. 6). In contrast, control
nucleobase oligomers and transfectant agent alone (LFA) each only
reduced the mRNA level to less than 20% of untreated control (FIG.
6). Nucleobase oligomers F3, G4 and C5 were selected for further
study in vitro and in vivo. Additional knockdown of XIAP mRNA
observed by TaqMan analysis is depicted in FIGS. 7 and 8.
EXAMPLE 7
Down-Regulating Effects of Antisense Oligonucleotides on XIAP
Protein
[0144] We characterized the potency of nucleobase oligomers F3, G4
and C5 in oligonucleotide configuration on the XIAP protein
expression by western blot analysis (FIGS. 9, 10A, and 10B). G4 AS
oligonucleotides exhibited the strongest down-regulating effect on
XIAP protein, reducing XIAP protein levels by 62% at 24 h after the
end of transfection at a concentration of 1.2 .mu.M (FIGS. 10A and
10B). F3 AS oligonucleotides at 1.2 .mu.M reduced XIAP protein
level by 50%, while C5 AS oligonucleotides did not show sequence
specific effects compared to its control (FIG. 10B). In additional
studies, E12 and FG8 AS oligonucleotides significantly reduced XIAP
protein levels (FIG. 9).
EXAMPLE 8
Induction of Apoptosis by XIAP AS Oligonucleotides
[0145] Having demonstrated that XIAP AS nucleobase oligomers were
capable of reducing viability of H460 cells and T24 bladder
carcinoma cells after, we determined whether the observed cell
death was due to the induction of apoptosis. As shown in FIG. 11A,
H460 cells treated with F3 or G4 AS oligonucleotides at 1.2 .mu.M
activated and degraded pro-caspase-3 protein with a reduction of
40% or 60% of protein levels, respectively, compared to untreated
control cells. PARP was also to its predicted caspase-3-generated
fragment (FIG. 11A). In contrast, F3 and G4 SC oligonucleotide
controls at 1.2 .mu.M did not have any effect on caspase-3 or PARP
protein expression (FIG. 11A). The ratio of Bcl-2:Bax was unchanged
in H460 cells treated with. F3 and G4 AS oligonucleotides and their
respective controls at 1.2 .mu.M. Flow cytometry was used to detect
the hypo-diploid DNA content in H460 cells treated with G4 AS
oligonucleotides and stained with PI (FIG. 12A). When H460 cells
were treated with G4 AS oligonucleotides or scrambled control
oligonucleotides at 1.2 .mu.M, the hypo-diploid DNA content of
cells was 40.8 and 22. 1%, respectively, compared to 16.6% for
untreated control cells. DAPI staining was used to detect the
nuclear morphological changes of the H460 cells treated with G4 AS
oligonucleotides or scrambled control oligonucleotides at 1.2
.mu.M. As shown in FIG. 12B, cells treated with G4 AS
oligonucleotides underwent morphological changes characteristic of
apoptosis, including chromatin condensation and nuclear DNA
fragmentation. Few cells showed these morphological changes in G4
SC-treated control cells.
EXAMPLE 9
Inhibition of Cell Growth and Sensitization of H460 Cells to
Anticancer Agents by AS Oligonucleotides
[0146] To analyze biological effects of nucleobase oligomers
associated with down-regulation of XIAP expression and apoptosis,
the growth of H460 cells treated with G4 AS oligonucleotides was
investigated by MTT assay. Forty-eight hours after the
transfection, G4 AS oligonucleotides had reduced H460 cell growth
in a dose-dependent manner, exhibiting a 55% reduction relative to
untreated control levels at 1.2 .mu.M (FIG. 13A). In contrast, the
growth-inhibitory effect of G4 SC oligonucleotides, or transfectant
agent alone, was comparatively low, only less than 10% of their
untreated control.
[0147] To investigate whether down-regulation of XIAP expression
has the potential to sensitize H460 cells to chemotherapy,
combination treatments using G4 AS oligonucleotides and one of the
following anticancer drugs: doxorubicin (DOX), taxol, vinorelbine
(VNB) and etoposide (Etop) were performed. FIG. 13B demonstrates
that each of the combinations resulted in at least an additive
cytotoxic effect on the cell death, compared to treatment with
either G4 AS oligonucleotides or the anticancer drugs alone.
EXAMPLE 10
Antitumor Efficacy of G4 AS Oligonucleotides on 11460 and LCC6
Tumor Xenografts
[0148] We first determined whether intra-tumoral injection of XIAP
antisense 2.times.2-MBOs into SCID-RAG2 mice carrying sub-cutaneous
H460 human lung carcinoma xenografts reduced the amount of tumor
growth. Treatment started 14 days after tumor ell inoculation (s.c.
shoulder injection of 106 cells) by injecting MBOs (50 .mu.g
2'-O-methyl RNA oligonucleotides per g tumor) into the palpable
tumor mass three times per week for two weeks. Vinorelbine (VNB;
also referred to as navelbine (NVB) (15 mg/kg i.p.) was injected on
days 17 and 24. Tumor size was measured with calipers three times
per week. At the end of the treatment period (day 24), the mean
relative tumor growth of mice treated with a combination of C5+G4
AS MBOs and VNB was .about.70% reduced compared to those treated
with scrambled control MBOs and VNB. Treatments with C5 AS MBO and
VNB resulted in a .about.60% reduction of tumor size, compared to
scrambled control (FIG. 14).
[0149] Initial systemic PS-oligonucleotide studies were designed
without any chemotherapeutic agents. SCID-RAG2 mice were inoculated
with H460 human lung carcinoma cells (s.c. shoulder injection of
10.sup.6 cells) and treatments with G4 and F3 AS
PS-oligonucleotides, as well as a scrambled control, were initiated
three days after tumor inoculation. Nucleobase oligomer injections
were administered i.p. at 12.5 mg/kg three times a week for three
weeks. At the end of the treatment period, mean tumor sizes in the
groups treated with either G4 or F3 AS oligonucleotides were 50%
smaller than in the group treated with a scrambled control
oligonucleotides (FIG. 15). The same treatment protocol was tested
on female SCID-RAG2 mice inoculated orthotopically with
MDA-MB-435/LCC6 human breast carcinoma cells. Two weeks after the
last treatment (day 35) tumor volumes of mice treated with F3, C5
or G4 AS oligonucleotides were 70%, 60%, and 45%, respectively,
smaller than vehicle controls (FIG. 16).
[0150] We conducted additional examination of the antitumor effects
of G4 AS oligonucleotides in SCID-RAG2 mice bearing xenografts of
H460 human non-small-cell lung tumors implanted subcutaneously.
Saline-treated control tumors grew reproducibly to a size of 0.75
cm.sup.3 within approximately 24 days (FIG. 17). Oligonucleotide
treatments were initiated three days after tumor cell inoculation.
G4 AS oligonucleotides (5 to 15 mg/kg) were administered using a
treatment schedule of i.p. injections given once a day on days 3-7,
10-14, and 17-21. The treatment with 5 or 15 mg/kg G4 AS
oligonucleotides greatly delayed tumor growth: on day 24 mean tumor
sizes were 0.75, 0.45 and 0.29 cm.sup.3 in control, 5 and 15 mg/kg
treated groups, respectively (FIG. 18A). There was a dose-dependent
inhibition of tumor growth. Tumor size in mice treated with 15
mg/kg G4 AS oligonucleotides was significantly smaller than in
control groups, and represented 39% of control mean tumor size. In
contrast, administration of G4 SC oligonucleotides at 15 mg/kg
provided no therapeutic activity (FIG. 17). None of the mice
treated with oligonucleotides displayed any signs of toxicities,
and both doses of oligonucleotides were well tolerated. A dose of
15 mg/kg was selected for the future combination treatment regimens
with anticancer drugs.
EXAMPLE 11
XIAP Expression is Reduced in H460 Tumors Treated With G4 AS
Oligonucleotides
[0151] To correlate the tumor growth inhibitory effects of G4 AS
oligonucleotides with XIAP protein expression, we examined the
changes in XIAP expression at the end of the in vivo treatment with
15 mg/kg of G4 AS and SC oligonucleotides. At day 21 or 24
post-tumor inoculation when tumors reached 1 cm in size (FIG. 17),
tumors were harvested and lysates from tumor homogenates were used
for western blot analysis. XIAP and .beta.-actin antibodies against
the human protein were used, allowing for determination of human
XIAP levels obtained from tumor cells specimens without
contamination from XIAP derived from mouse cells. XIAP protein
levels in tumors treated with G4 AS oligonucleotides were
significantly reduced to approximately 85% of control tumors
(P<0.005) (FIGS. 18A and 18B). Tumors treated with G4 SC
oligonucleotides were reduced in size by 24% of control tumors.
These results indicated that inhibition of H460 tumor growth by G4
AS oligonucleotides correlated with the down-regulation of XIAP
protein expression.
EXAMPLE 12
Histopathology of Tumor Specimens
[0152] To evaluate whether XIAP AS oligonucleotide administration
results in direct tumor cell kill, we examined the histology of
tumors after treatment both for morphology and ubiquitin
immunostaining (FIGS. 19A and 19B). At day 21 or 24 post-tumor
inoculation, tumors treated with 15 mg/kg of G4 AS
oligonucleotides, SC oligonucleotides, or saline control were
excised, sectioned, and stained with hematoxylin and eosin. The
results demonstrate that tumors in animals administered given XIAP
AS oligonucleotides treatment contained an increased number of dead
cells, identified morphologically by their amorphous shape and
condensed nuclear material (FIG. 19A).
[0153] The degradation of proteins is largely
ubiquitin-proteasome-dependent; increased ubiquitin expression has
been observed during apoptosis. Thus, we examined the ubiquitin
expression in the tumors sections used for hematoxylin and eosin
staining. As shown in FIG. 19B, tumors in mice administered XIAP AS
oligonucleotides displayed more intense immunohistochemical
staining, relative to tumors in control or SC ODN-treated mice.
These data indicate that there is more free ubiquitin and/or
ubiquitinated-protein in XIAP AS nucleobase oligonucleotide-treated
tumor cells than in control tumors.
EXAMPLE 13
Combined Treatment of G4 AS Oligonucleotides With Vinorelbine
[0154] To evaluate whether combined treatments of G4 AS nucleobase
oligomers and vinorelbine (VNB), a chemotherapeutic agent used for
lung cancer treatment, may result in any cooperative effects, we
compared the therapeutic efficacy of VNB in the presence and
absence of G4 AS oligonucleotides or 64 SC oligonucleotides.
Treatment regimens were initiated on day 3 after tumor inoculation.
FIG. 20A shows the in vivo efficacy results for 5 mg/kg and 10
mg/kg doses of VNB given to H460 tumor-bearing mice and compared
with saline controls. Each of the two regimens induced significant
tumor growth suppression in a dose-dependent manner without showing
significant signs of undesirable toxicity (i.e., body weight loss).
When administration of G4 AS oligonucleotides (15 mg/kg) was
combined with VNB (5 mg/kg) for the treatment of H460 tumors, even
more pronounced delay of H460 tumor growth was observed compared to
either treatment administrated alone (FIG. 20B). Again, the mice
did not show any significant signs of toxicity (i.e., body weight
loss). The mean tumor sizes in mice treated with 5 mg/kg VNB in the
presence or absence of G4 AS. or SC oligonucleotides were compared
on day 29 (FIGS. 20A and 20B). The average tumor size in the group
of VNB and G4 AS oligonucleotides was 0.22.+-.0.03 cm.sup.3, which
was significantly smaller than the average tumor size in animals
treated with 5 mg/kg VNB alone or with a combination of VNB G4 SC
oligonucleotides (0.59.+-.0.04 and 0.48.+-.0.05 cm.sup.3,
respectively).
Methods
[0155] The results obtained in Examples 5-13 were obtained using
the following methods.
[0156] Oligonucleotide Synthesis
[0157] A library of over 96 non-overlapping chimeric, or
mixed-backbone (MBO), 19-mer antisense oligonucleotides was
synthesized as 2.times.2 MBO oligonucleotides, composed of two
flanking 2'-O-methyl RNA residues at either end with
phosphorothioate linkages, and a central core of 15 phosphodiester
DNA residues. Each final product was desalted by Sephadex G-25
chromatography (IDT Inc., Coralville, Iowa). This chimeric wingmer
configuration, and mix of phosphorothioate and phosphodiester
linkages (referred to as 2.times.2 PS/PO), provided adequate
stability while also reducing non-specific toxicity associated with
phosphorothioate residues. Fully phosphorothioated non-chimeric
(DNA) antisense oligonucleotides for in vivo and in vitro studies
were synthesized by Trilink Biotech and purified by RP-HPLC.
[0158] Antisense Oligonucleotide Screening
[0159] T24 bladder carcinoma cells, transfected with 1-1.2 .mu.M
oligonucleotide-lipofectin complexes for 24-48 hours, were assessed
to determine the ability of each oligonucleotide to knock-down XIAP
protein. Positive hits were reconfirmed for their ability to
knock-down (i) XIAP protein levels at 12-18 hours of transfection
by western analysis, and (ii) XIAP mRNA levels at 6-9 hours of
transfection by quantitative RT-PCR (see below) in T24 bladder
carcinoma cells and H460 lung carcinoma cells. Candidate
oligonucleotides were identified and tested further. Identified
2.times.2 PS/PO chimeric oligonucleotides showed a dose-dependent
ability to decrease XIAP mRNA levels at 6-9 hours in the range of
400-1200 nM concentrations. Exemplary oligonucleotides are shown in
Table 5. TABLE-US-00005 TABLE 5 SEQ ID Oligonucleotide Sequence*
NO: F3 AS ATCTTCTCTTGAAAATAGG (PS) 278 F3 AS AUCTTCTCTTGAAAATAGG (2
.times. PS/ 279 PO) F3 RP GGATAAAAGTTCTCTTCTA (PS) 280 G4 AS
GCTGAGTCTCCATATTGCC (PS) 281 G4 AS GCTGAGTCTCCATATTGCC (2 .times.
PS/ 282 PO) G4 SC GGCTCTTTGCCCACTGAAT (PS) 283 C5 AS
ACCATTCTGGATACCAGAA (PS) 284 C5 AS ACCATTCTGGATACCAGAA (2 .times.
PS/ 285 PO) C5 RP AAGACCATAGGTCTTACCA (PS) 286 AB6 AS
GGGTTCCTCGGGTATATGG (PS) 287 AB6 RP GGTATATGGCGTCCTTGGG (PS) 288
DE4 AS GGTATCTCCTTCACCAGTA (PS) 289 DE4 RP ATGACCACTTCCTCTATGG (PS)
290 D7 AS GATTCACTTCGAATATTAA (PS) 291 D7 RP AATTATAACGTTCACTTAG
(PS) 292 *Bold residues = DNA residues with phosphorothioate
linkages, underlined residues = 2'-O-methyl RNA bases, plain type =
phosphodiester DNA residues.
[0160] Tumor Cell Line and Animal Xenografts Model
[0161] The human non-small cell lung cancer cell line (large cell
type) NCI-H460 (H460) was obtained from ATCC and maintained in RPMI
1640 supplemented with 10% FCS at 37.degree. C. in a humidified
atmosphere containing 5% CO.sub.2. Cells were used in exponential
growth phase, up to a maximum of 25 in vitro passages. Male
SCID-RAG2 mice (7-9 weeks old, 23-26g) were obtained from British
Columbia Cancer Agency Joint Animal Facility breeding colony and
kept in aseptic environments. A tumor model of NCI-H460 cells in
SCID-RAG2 mice was established by subcutaneous implantation of
1.times.10.sup.6 NCI-H460 cells on the back of mice.
[0162] Treatment of Cells With Antisense and Anticancer Drugs
[0163] One day prior to transfection, H460 cells were plated in 6-
or 96-well tissue culture plates. Phosphorothioate antisense
oligonucleotides were delivered into cells with Lipofectamine 2000
(Life Technologies) in the form of liposome-oligonucleotide
complexes. Following a 4.5 or 6 h transfection, the transfection
medium was replaced with RPMI medium containing 10% FBS, and the
cells incubated for another 24 or 48 h.
[0164] Real-Time Quantitative RT-PCR
[0165] Total RNA from H460 cells treated with
liposome-oligonucleotide complexes for 6 hours was immediately
isolated using RNeasy mini spin columns and DNase treatment
(QIAGEN, Valencia, Calif.). Specific XIAP mRNA was measured using a
real-time quantitative RT-PCR method. XIAP forward and reverse
primers (600 nM) and probe (200 nM)
(5'-GGTGATAAAGTAAAGTGCTTTCACTGT-3' (SEQ ID NO 293), 6FAM-
CAACATGCTAAATGGTTCCAGGGTGCAAATATC-TAMRA (SEQ ID NO: 294), and
5'-TCAGTAGTTCTTACCAGACACTCCTCAA-3' (SEQ ID NO: 295) were designed
to span exon 3-4 and 4-5 junctions. One of the primers, as well as
the probe, was designed to overlap an intron-exon boundary to block
detection of any possible genomic DNA contamination. The RNA was
reverse-transcribed and PCR amplified using the TaqMan EZ RT-PCR
kit (PE/ABI, Foster City, Calif.) in the ABI prism 7700 Sequence
Detection System (PE/ABI). The thermal cycling condition for the RT
step were 50.degree. C. for 2 min, 60.degree. C. for 30 min, and
95.degree. C. for 5 min, followed by 45 cycles of PCR (at
94.degree. C. for 20 s and 60.degree. C. for 1 min per cycle). The
XIAP mRNA level of each sample was calculated relative to untreated
control cells. XIAP mRNA levels were determined by the cycle
threshold method (Ct) using a threshold of 30.times. the baseline
SD, and XIAP levels were normalized for GAPDH content, using PE/ABI
supplied primers and probe.
[0166] Western Blot Analysis
[0167] The cells or tumor tissue samples were lysed with ice-cold
lysis buffer (50 mM Tris, 150 mM NaCl, 2.5 mM EDTA, 0.1% SDS, 0.5%
sodium deoxycholate, 1% NP-40, 0.02% sodium azide) containing
protease inhibitors (Complete-Mini protease inhibitor tablets;
Boehringer Mannheim GmBH, Mannheim, Germany). After incubation for
30 min on ice, samples were centrifuged at 10,000 rpm for 15 min,
and stored at -20.degree. C. Protein content in the lysed extracts
was determined using a detergent-compatible Bio-Rad assay (Bio-Rad
Labs, Hercules, Calif.). Equal amounts of protein (40 .mu.g/lane)
were separated on 12% SDS-polyacrylamide gels or 4-15% gradient
SDS-polyacrylamide pre-made gels (Bio-Rad) and transferred to
nitrocellulose membranes. Primary antibodies against XIAP, Bcl-2
(DAKO, Glostrup, Denmark), Bax (Sigma, St. Louis, Mo.),
.beta.-actin (Sigma), caspase-3 (BD PharMingen, San Diego, Calif.),
and PARP (BD PharMingen) were used. The secondary antibody was the
appropriate horseradish-conjugated anti-mouse or anti-rabbit IgG
(Promega, Madison, Wis.). Proteins were detected by enhanced
chemiluminescence (ECL; Amersham Pharmacia Biotech,
Buckinghamshire, England) and visualized after exposure to Kodak
autoradiography film. Scanning densitometry (Molecular Dynamics,
Sunnyvale, Calif.) was performed to quantify band intensities by
volume/area integration. The amount of XIAP, caspase-3, Bcl-2 and
Bax in cells was normalized to their respective lane .beta.-actin
levels, upon stripping and reprobing.
[0168] Measurement of Cell Growth and Viability or Death
[0169] Growth inhibition of H640 cells was determined by the
colorimetric MTT cell viability/proliferation assay. In brief,
cells were treated with liposome-oligonucleotide complexes for 4.5
h, then incubated for another 48 h at 37.degree. C. in medium
without transfection reagent or oligonucleotides in the presence or
absence of anticancer drugs. MTT (25 .mu.g/well) was added to each
well, and the plates incubated for 3 h at 37.degree. C. Following
the incubation step, the colored formazan product was dissolved by
the addition of 200 .mu.l DMSO. Plates were read using the
microtiter plate reader (Dynex Technologies Inc., Chantilly, Va.)
at a wavelength of 570 nm. The percentage of surviving cells in
wells treated with oligonucleotides was normalized to untreated
controls. All assays were performed in triplicate.
[0170] Apoptotic Flow Cytometric Assays
[0171] Cells were treated with liposome-oligonucleotide complexes
for 4.5 h, and incubated for another 48 h in the medium without
transfection reagent at 37.degree. C. Following incubation, cells
were harvested, washed twice with sample buffer (0.5% glucose in
PBS without Ca.sup.++ and Mg.sup.++), and fixed in cold 70% ethanol
at 4.degree. C. for at least 18 hrs. Samples were centrifuged at
3000 rpm for 10 min, then resuspended in sample buffer containing
50 .mu.g/ml propidium iodide (PI) and 400 U/ml RNase A. Samples
were incubated for 30 min at room temperature and 30 min on ice,
followed by flow cytometry analysis. EXPO Software (Applied
Cytometry Systems, Sacramento, Calif.) was used to generate
histograms, which were used to determine the cell cycle phase
distribution after debris exclusion. The Sub G1/G0 cell fraction
was considered as representative for apoptotic cells.
[0172] Nuclear Morphology
[0173] Cells were treated with liposome-oligonucleotde complexes
for 4.5 h, and incubated for another 48 h at 37.degree. C. in the
medium without transfection reagent or oligonucleotides. Cells were
harvested and stained with 0.10 .mu.g/ml DAPI
(4',6-diamidino-2-2-phenylindole) for 30 min at room temperature.
Cells were placed on a glass slide, cytospun, and viewed with a
Leica microscope and 40.times. objective lens under UV fluorescent
illumination. Digital images were captured using Imagedatabase V.
4.01 Software (Leica, Germany).
[0174] In Vivo Antitumor Activity
[0175] Efficacy experiments were conducted in male RAG2
immunodeficient mice bearing NCI-H460 tumours or female RAG2 mice
bearing LCC6 tumors. Treatments were commenced on day 3 after tumor
inoculation. Saline (controls), G4 AS oligonucleotides (5 or 15
mg/kg), or G4 SC oligonucleotides (5 or 15 mg/kg) were administered
i.p. daily for five doses a week over a three week regimen.
Vinorelbine (VNB, 5 or 10 mg/kg) was administered i.v. via the tail
vein, either alone or in combination with oligonucleotides, at day
3, 7, 11 and 17 after tumor inoculation. When oligonucleotides were
administered in combination with VNB, the drug.treat.ment was
performed four hours after ODN treatment.
[0176] Mice were observed daily. Body weight measurements and signs
of stress (e.g., lethargy, ruffled coat, ataxia) were used to
detect possible toxicities. Animals with ulcerated tumor, or tumor
volumes of 1 cm.sup.3 or greater were killed. Digital caliper
measurements of tumors were converted into mean tumor size
(cm.sup.3) using the formula: 1/2[length (cm)].times.[width
(cm)].sup.2. An average tumor size per mouse was used to calculate
the group mean tumor size.+-.SE (n=6 mice) from at least two
independent experiments per group.
[0177] Tumor and Tissue Processing
[0178] Mouse tumors were collected on day 21 or 24 post-tumor
inoculation and treatment. One portion of the tumor tissue was
fixed in formalin. Paraffin-embedded tissues were sectioned and
subjected to gross histopathology using hematoxylin and eosin
staining and immunohistochemistry for ubiquitin expression. The
other portion of the tumor was homogenized in lysis buffer for
western blot analysis (see above).
[0179] Statistical Analyses
[0180] Student's t test was used to measure statistical
significance between two treatment groups. Multiple comparisons
were done using one-way ANOVA and a post-hoc test that compared
different treatment groups by the Shelle test criteria (Statistica
release 4.5, StatSoft Inc., Tulsa, Okla.). Data were considered
significant for a P-value of <0.05.
EXAMPLE 14
Antisense HIAP1 Oligonucleotides Decrease HIAP1 RNA and Polypeptide
Expression
[0181] A library of 15 HIAP1 antisense nucleobase oligomers as
oligonucleotides was screened for protein knock-down by western
blot analysis and for RNA knock-down by TaqMan, using the primers
and probes described in Example 3, above, under two different
conditions. HIAP1 RNA levels may be detected using standard
Northern blot analyses or RT-PCR techniques. The antisense
oligonucleotides were administered to cells under basal conditions
or under cycloheximide-induction conditions (24 hour treatment with
sub-toxic doses). Cycloheximide (CHX) can lead to a 10- to 200-fold
induction of HIAP1 mRNA depending on the cell line treated. This in
turn leads to an increase in HIAP1 protein, as seen on a Western
blot (70 kDa band). This effect of CHX is via two distinct
mechanisms of action. First, CHX activates NFkB, a known
transcriptional inducer of HIAP1, by blocking the de novo synthesis
of a labile protein, IkB, which is an inhibitor of NFKB. This
effect is mimicked by puromycin, another protein synthesis
inhibitor, and by TNF-alpha, which induces a signaling cascade
leading to the phosphorylation, ubiquination, and degradation of
IkB. Only CHX leads to a further stabilization of the HIAP1 mRNA,
as seen by the decreased rate of disappearance of HIAP1 message in
the presence of actinomycin D, to block de novo transcription, and
CHX, as opposed to actinomycin D and puromycin or TNF-alpha
combined.
[0182] SF295 glioblastoma cells were transfected with lipofectin
and oligonucleotide (scrambled survivin, no oligonucleotide,
antisense APO 1 to APO 15) or left untreated. RNA was isolated from
the cells six hours after transfection and the level of HIAP1 mRNA
was measured by quantitative PCR (TaqMan analysis), normalized for
GAPDH mRNA, with the value for the scrambled survivin
oligonucleotide transfection set as 1.0. The results of this
experiment, a compilation of three separate experiments, are shown
in FIG. 21. The scrambled survivin oligonucleotide, the mock
transfection, and untreated (non-transfected) cells, all showed
similar HIAP1 1mRNA levels. Of the 15 antisense oligonucleotides,
seven (APO 1, 2, 7, 8, 9, 12, 15) showed an almost 50% decrease
when compared to mock transfection or survivin scrambled control
oligonucleotide transfection (5'-mUmAmAGCTGTTCTATGTGmUmUmC-3'; SEQ
ID NO: 296) (FIG. 21). Some of the oligonucleotides led to an
induction in HIAP1 mRNA, which may be a stress response to a
non-specific toxic oligonucleotide. An antisense oligonucleotide
may still be effective at knocking down HIAP1 protein levels even
if the message is increased if the oligonucleotide is able to
interfere with the translation process.
[0183] The effect of HIAP1 antisense nucleobase oligomers on HIAP1
protein and mRNA expression was also examined in cells induced to
express HIAP1. SF295 cells were transfected with oligonucleotides,
or were mock transfected. The transfected cells were then treated
with 10 .mu.g/ml cycloheximide for 24 hours to induce 70 kDa HIAP1
mRNA and protein. Protein levels were measured by western blot
analysis with an anti-HIAP1 polyclonal antibody, and normalized
against actin protein in a re-probing of the same blots. Scans of
the western blot results are shown in FIG. 22A. The densitometric
scan results were plotted against the mock results (set at 100%) in
FIG. 22B. A line is drawn at 50% to easily identify the most
effective antisense oligonucleotides. The transfection process
itself (e.g., mock or scrambled survivin) induces HIAP1 protein
compared to the untreated sample as shown on the western
immunoblot.
[0184] Of the 15 tested nucleobase oligomers, six of them (APO 1,
2, 7, 8, 12, and 15) showed high activity, or had significant
activity in both the protein and mRNA assays, and did not cause a
stress-induced increase in HIAP1 mRNA, such as that seen with APO
4, 6, 11, 13, 14 (FIG. 21), and by control oligonucleotides to APO
2 (mismatch or reverse polarity, see text below and FIGS. 23 and
24). Note that APO 6 also showed evidence of toxicity as seen by
the general decrease in total protein (FIG. 23).
[0185] To further investigate the efficacy of HIAP1 antisense
oligonucleotides under cycloheximide induction conditions, changes
in HIAP1 mRNA were measured by TaqMan real time PCR 6 hours after
transfection with APO 2, which targets an Alu repeat within an
intron of HIAP1 and results in the greatest block of CHX-induced
upregulation of HIAP1 mRNA and protein. Controls for this
experiment were three oligonucleotides for APO 2: one scrambled
sequence (same base composition but random order,
5'-AAGGGCGGCGGAGTGAGAC-3'; SEQ ID NO: 297), one reverse polarity
(same base composition, same sequential order but in the opposite
direction, 5'-AGAGG ACGGAGTCGGAGGC-3'; SEQ ID NO: 298), and one
mismatch sequence (containing four base mismatches out of 19 bases,
5'-CGGAGCGTGAGGATGGAGA-3'; SEQ ID NO: 299).
[0186] Transfection of the APO 2 antisense into cells resulted in a
50% decrease in mRNA compared to a scrambled survivin control and
matched perfectly with the protein results, while the scrambled
control for APO 2 (H1 sc apo 2 in FIG. 24) did not change HIAP1
mRNA levels at all (repeated twice here, and in two different
experiments). However, the mismatch control ODN (H1 mm apo 2) and
the reverse polarity control oligonucleotide (H1 RV apo 2) showed
an induction of 6 to 7 fold in HIAP1 mRNA at 6 hours. These
oligonucleotides no longer targeted HIAP1, as expected, but may
still target Alu repeats because of the degeneracy and repeat
nature of these sequences. Therefore, it is possible that these two
controls are toxic to the cell and cause a stress response that
leads to the induction of HIAP1. This effect may also occur with
the antisense APO 2 oligonucleotide, but in this case, APO 2 also
causes the degradation of the induced HIAP1 mRNA which results in a
relative decrease of HIAP1 mRNA, compared to a scrambled survivin
control, as well as decreasing the relative fold induction of HIAP1
protein after transfection and CHX treatment, compared to scrambled
survivin control oligonucleotide.
[0187] The six antisense HIAP1 nucleobase oligomers include two
very effective oligonucleotides against an intronic sequence (APO
1, and APO 2, with APO 2 demonstrating the better activity). These
oligonucleotides could be used therapeutically for treatment of
cancer or autoimmune disorders. The oligonucleotides against an
intronic sequence would likely only target pre-mRNA (very
short-lived target) and not the mature, processed form of HIAP1.
Typically, introns are not targeted for antisense except when one
wants to alter splicing by targeting the intron-exon boundaries or
the branching point. These usually result in the skipping of an
exon rather than RNase-mediated degradation of the message. Both
mechanisms would likely be favorable for the enhancement of
apoptosis, as the skipping would result in the loss of the exon
encoding the first two important BIR domains of HIAP1. The APO 2
antisense ODN also targets an intron of survivin for 18 consecutive
bases out of 19, but we did not see any loss of survivin protein;
only HIAP1 was decreased after the oligo treatment, demonstrating
the specificity of the HIAP1 antisense oligonucleotide. These
antisense oligonucleotides hit Alu sequences in the HIAP1 intron
and potentially in many other genes, and induce the cancer cells to
die (see below), which may be as a result of down regulating HIAP1
and some other critical genes, and thus of therapeutic value if it
is not too toxic to normal cells.
[0188] Cancer cells have reportedly more Alu-containing transcripts
and may therefore be more sensitive to apoptosis induction with an
Alu targeting nucleobase oligomer. Furthermore, this killing effect
of nucleobase oligomers APO 1 and APO 2 may be due to the combined
effect of both targeting Alu sequences and HIAP1 simultaneously.
This dual effect would result in an effective way to prevent the
normal stress response of HIAP1 induction through the NFKB pathway,
when the cell is exposed to certain toxic agents. This stress
response is most likely part of the cancer cell's anti-apoptotic
program. By blocking HIAP1 expression, we counter this
anti-apoptotic stress response and precipitate the cancer cell's
demise.
EXAMPLE 15
HIAP1 Antisense Oligonucleotides Increase Cytotoxicity and
Chemosensitization
[0189] The effect of HIAP1 antisense nucleobase oligomers on the
chemosentization of SF295 cells was also evaluated. Cells were
transfected with one of three different antisense oligonucleotides
(APO 7, APO 15, and SC APO 2 (control)). Twenty-four hours after
transfection with the oligonucleotides, the cells were incubated
with adriamycin for an additional 24 hours before assaying by for
cell survival by assaying WST-1.
[0190] The WST-1 survival curves for SF295 cells transfected with
the above-described HIAP1 oligonucleotides and then treated with
increasing concentrations of adriamycin are shown in FIG. 25. The
two oligonucleotides that resulted in a decrease in HIAP1 mRNA also
showed a decrease in survival when treated with adriamycin compared
to cells treated with an oligonucleotide that did not reduce HIAP1
mRNA levels. Therefore, reducing HIAP1 levels by antisense, or
other means, can chemosensitize a glioblastoma cell line that is
highly resistant to the cytotoxic action of many chemotherapeutic
drugs.
[0191] An additional 89 HIAP1 antisense sequences that can be
employed in the methods of the invention are shown in Table 6.
Sequences that are 100% identical between human HIAP1 and human
HIAP2, or have one or two mismatches, are in bold. TABLE-US-00006
TABLE 6 Nucleobase oligomer sequence SEQ ID NO: AGCAAGGACAAGCCCAGTC
300 TGTAAACCTGCTGCCCAGA 301 AGAAGTCGTTTTCCTCCTT 302
CCGAGATTAGACTAAGTCC 303 ACTTTTCCTTTATTTCCAC 304 TCCCAAACACAGGTACTAT
305 CATTCTCAGCGGTAACAGC 306 ACCATCATTCTCATCCTCA 307
AATGTAACCTTCAACCATC 308 TTTGTATTCATCACTGTC 309 TCACATCTCATTACCAAC
310 CCAGGTGGCAGGAGAAACA 311 TGCAGACTTCAATGCTTTG 312
TAAGCAAGTCACTGTGGCT 313 CTGAGTCGATAATACTAGC 314 ACTAGCCATTAGTAAAGAG
315 CAACAGCAGAGACCTTGTC 316 ATAGCATACCTTGAACCAG 317
CATCTGTAGGCTAAGATGG 318 AGTTACCAGATGCCATCTG 319 AATCTACTCTGATAGTGGA
320 GTTTCTGAAGCCAACATCA 321 TCAACTTATCACCTCCTGA 322
AAGAACTAACATTGTAGAG 323 GTAGACAACAGGTGCTGCA 324 ATGTCCTCTGTAATTATGG
325 TACTTGGCTAGAACATGGA 326 GAAGCAACTCAATGTTAAG 327
TTTGGTCTTTTGGACTCAG 328 CCATAGATCATCAGGAATA 329 CAGGACTGGCTAACACATC
330 TTTAATGGCAGGCATCTCC 331 TTAAGCCATCAGGATGCCA 332
GCTACAGAGTAAGCTGTGT 333 CTCTAGGGAGGTAGTTTTG 334 AAGAAAAGGGACTAGCCTT
335 CAGTTCACATGACAAGTCG 336 GACTCCTTTCTGAGACAGG 337
ATTCACACCAGTGTAATAG 338 CAGAAGCATTTGACCTTGT 339 CCAGCATCAGGCCACAACA
340 TTTCAGTAGGACTGTCTCC 341 TGCAGCTAGGATACAACTT 342
AGAGGTAGCTTCCAAGTTG 343 GAAGTAATGAGTGTGTGGA 344 GGATTTGATGGAGAGTTTG
345 GAACTTCTCATCAAGGCAG 346 AGGTCCTATGTAGTAAAAG 347
CAATTTTCCACCACAGGCA 348 CATTATCCTTCGGTTCCCA 349 CTCAGGTGTTCTGACATAG
350 GCTCAGATTAGAAACTGTG 351 CTGCATGTGTCTGCATGCT 352
TTAACTAGAACACTAGAGG 353 CATAATAAAAACCCGCACT 354 CACCATCACAGCAAAAGCA
355 CTCCAGATTCCCAACACCT 356 GGAAACCACTTGGCATGTT 357
GTTCAAGTAGATGAGGGTA 358 GATAATTGATGACTCTGCA 359 ATGGTCTTCTCCAGGTTCA
360 GCATTAATCACAGGGGTAT 361 TAAAGCCCATTTCCACGGC 362
TGTTTTACCAGGCTTCTAC 363 GATTTTTCTCTGAACTGTC 364 CTATAATTCTCTCCAGTTG
365 ACACAAGATCATTGACTAG 366 TCTGCATTGAGTAAGTCTA 367
TCTTTTTCCTCAGTTGCTC 368 GTGCCATTCTATTCTTCCG 369 GTAGACTATCCAGGATTGG
370 AGTTCTCTTGCTTGTAAAG 371 TCGTATCAATCAGTTCTCT 372
GCAGAGAGTTTCTGAATAC 373 ATGTCCTGTTGCACAAATA 374 CTGAAACATCTTCTGTGGG
375 TTTCTTCTTGTAGTCTCCG 376 CTTCTTTGTCCATACACAC 377
GGAATAAACACTATGGACA 378 CATACTACTAGATGACCAC 379 TGTACCCTTGATTGTACTC
380 GAAATGTACGAACTGTACC 381 GATGTTTTGGTTCTTCTTC 382
CTATCATTCTCTTAGTTTC 383 ACACCTGGCTTCATGTTCC 384 GACTACAGGCACATACCAC
385 TGCCTCAGCCTGGGACTAC 386 AGGATGGATTCAAACTCCT 387
GAGAAATGTGTCCCTGGTG 388 GCCACAACAGAAGCATTTG 389
[0192] We also analyzed human HIAP2 for sequences suitable for use
as antisense nucleobase oligomers. Identified sequences are shown
in Table 7. TABLE-US-00007 TABLE 7 Nucleobase oligomer sequence SEQ
ID NO: TTCTGAAAACTCTTCAATG 390 CTTAGCATAAAGTATCAGT 391
CAAAAAAGTACTGCTTAGC 392 CAAGATAAAACTTGTCCTT 393 TATCAGTCATGTTGTAAAC
394 CTAAATAACCTGTTCATCA 395 AGCACACTTTTTACACTGC 396
ACCACTATTATTCTTGATC 397 TGTATTTGTTTCCATTTCC 398 ACTGTAAACTCTATCTTTG
399 CTTAAGTGGGCTAAATTAC 400 CCTTCATATGGTCACACTA 401
GGTTACAAGCTATGAAGCC 402 CTAAGCAACTATAGAATAC 403 TCCTTGATTTTTCACAGAG
404 ATACTAACTTAAAGCCCTG 405 GGGTTGTAGTAACTCTTTC 406
TAGAACACAACTCTTTGGG 407 CTCTGAATTTCCAAGATAC 408 TTTACTGGATTTATCTCAG
409 TGAGTAGGTGACAGTGCTG 410 GGAGGCAGTTTTGTGCATG 411
CTATCTTCCATTATACTCT 412 TTGTTTGTTGCTGTTTGTC 413 TCCTTTCTGAGACAGGCAC
414 ACCACCACGAGCAAGACTC 415 ACCTTGTCATTCACACCAG 416
TCCAGTTATCCAGCATCAG 417 GCTTTTGAATAGGACTGTC 418 GAGATGTCTTCAACTGCTC
419 GGGGTTAGTCCTCGATGAA 420 TCATTGCATAACTGTAGGG 421
GCTCTTGCCAATTCTGATG 422 ACCCTATCTCCAGGTCCTA 423 ACAGGCAAAGCAGGCTACC
424 GTTCTGACATAGCATCATC 425 CTCAGAGTTTCTAGAGAAT 426
ATGTTCTCATTCGAGCTGC 427 TGAACTGGAACACTAGATG 428 GCTCAGGCTGAACTGGAAC
429 TTGACATCATCATTGCGAC 430 ACCATCACAACAAAAGCAT 431
CCACTTGGCATGTTCTACC 432 TCGTATCAAGAACTCACAC 433 GGTATCTGAAGTTGACAAC
434 TTTCTTCTCCAGTGGTATC 435 TTCTCCAGGTCCAAAATGA 436
ACAGCATCTTCTGAAGAAC 437 CACAGGTGTATTCATCATG 438 CCAGGTCTCTATTAAAGCC
439 TTCTCTCCAGTTGTCAGGA 440 GAAGTGCTGACACAATATC 441
TTTTCCTTCTCCTCCTCTC 442 CATCTGATGCCATTTCTTC 443 AGCCATTCTGTTCTTCCGA
444 CCAGGATAGGAAGCACACA 445 ATGGTATCAATCAGTTCTC 446
CCGCAGCATTTCCTTTAAC 447 CAGTTTTTGAAGATGTTGG 448 GTGACAGACCTGAAACATC
449 GGGCATTTTCTTAGAGAAG 450 AGTACCCTTGATTATACCC 451
GAAATGTACGAACAGTACC 452 TGAAAAACTCATAATTCCC 453 CCATCTTTTCAGAAACAAG
454 CTATAATTCTCTCCAGTTG 455 CTCCCTTAGGTACACATAC 456
ACAAGCAGTGACACTACTC 457 GTAACTCCTGAAATGATGC 458 CAACAAATCCAGTAACTCC
459 CACCATAACTCTGATGAAC 460
Other Embodiments
[0193] All publications and patent applications mentioned in this
specification, including U.S. Pat. Nos. 5,919,912, 6,156,535, and
6,133,437, are herein incorporated by reference to the same extent
as if each independent publication or patent application was
specifically and individually indicated to be incorporated by
reference.
[0194] While the invention has been described in connection with
specific embodiments thereof, it will be understood that it is
capable of further modifications and this application is intended
to cover any variations, uses, or adaptations of the invention
following, in general, the principles of the invention and
including such departures from the present disclosure come within
known or customary practice within the art to which the invention
pertains and may be applied to the essential features hereinbefore
set forth.
Sequence CWU 1
1
460 1 19 DNA Artificial Sequence based on Homo sapiens. Each
nucleobase may be part of a ribonucleotide, deoxyribonucleotide, or
nucleotide analog misc_feature 5, 6, 8, 12, 16 n = T or U 1
aaaanncnaa gnaccngca 19 2 19 DNA Artificial Sequence based on Homo
sapiens. Each nucleobase may be part of a ribonucleotide,
deoxyribonucleotide, or nucleotide analog misc_feature 1, 3, 10, 14
n = T or U 2 ncnagagggn ggcncagga 19 3 19 DNA Artificial Sequence
based on Homo sapiens. Each nucleobase may be part of a
ribonucleotide, deoxyribonucleotide, or nucleotide analog
misc_feature 5, 7, 9, 11, 13, 19 n = T or U 3 cagananana ngnaacacn
19 4 19 DNA Artificial Sequence based on Homo sapiens. Each
nucleobase may be part of a ribonucleotide, deoxyribonucleotide, or
nucleotide analog misc_feature 1, 10, 11, 12, 13, 14, 15, 16, 18,
19 n = T or U 4 ngagagcccn nnnnnngnn 19 5 19 DNA Artificial
Sequence based on Homo sapiens. Each nucleobase may be part of a
ribonucleotide, deoxyribonucleotide, or nucleotide analog
misc_feature 3, 5, 10, 12, 13, 14, 16, 19 n = T or U 5 agnangaaan
annncngan 19 6 19 DNA Artificial Sequence based on Homo sapiens.
Each nucleobase may be part of a ribonucleotide,
deoxyribonucleotide, or nucleotide analog misc_feature 2, 3, 6, 7,
12, 14, 16, 17, 19 n = T or U 6 annggnncca angngnncn 19 7 19 DNA
Artificial Sequence based on Homo sapiens. Each nucleobase may be
part of a ribonucleotide, deoxyribonucleotide, or nucleotide analog
misc_feature 1, 2, 10, 12, 14, 15, 16, 17 n = T or U 7 nnagcaaaan
angnnnnaa 19 8 19 DNA Artificial Sequence based on Homo sapiens.
Each nucleobase may be part of a ribonucleotide,
deoxyribonucleotide, or nucleotide analog misc_feature 1, 5, 6, 9,
10, 11, 12, 13, 16, 18 n = T or U 8 ngaannaann nnnaananc 19 9 19
DNA Artificial Sequence based on Homo sapiens. Each nucleobase may
be part of a ribonucleotide, deoxyribonucleotide, or nucleotide
analog misc_feature 2, 3, 11, 17, 18 n = T or U 9 anncaaggca
ncaaagnng 19 10 19 DNA Artificial Sequence based on Homo sapiens.
Each nucleobase may be part of a ribonucleotide,
deoxyribonucleotide, or nucleotide analog misc_feature 2, 7, 10,
11, 14, 15 n = T or U 10 gncaaancan naannagga 19 11 19 DNA
Artificial Sequence based on Homo sapiens. Each nucleobase may be
part of a ribonucleotide, deoxyribonucleotide, or nucleotide analog
misc_feature 3, 5, 7, 12, 14, 17 n = T or U 11 aanangnaaa cngngangc
19 12 19 DNA Artificial Sequence based on Homo sapiens. Each
nucleobase may be part of a ribonucleotide, deoxyribonucleotide, or
nucleotide analog misc_feature 7, 13, 16, 19 n = T or U 12
gcagaanaaa acnaanaan 19 13 19 DNA Artificial Sequence based on Homo
sapiens. Each nucleobase may be part of a ribonucleotide,
deoxyribonucleotide, or nucleotide analog misc_feature 6, 9, 11,
12, 13 n = T or U 13 gaaagnaana nnnaagcag 19 14 19 DNA Artificial
Sequence based on Homo sapiens. Each nucleobase may be part of a
ribonucleotide, deoxyribonucleotide, or nucleotide analog
misc_feature 1, 2, 9, 12, 13, 18 n = T or U 14 nnaccacanc anncaagnc
19 15 19 DNA Artificial Sequence based on Homo sapiens. Each
nucleobase may be part of a ribonucleotide, deoxyribonucleotide, or
nucleotide analog misc_feature 2, 6, 9, 14, 15 n = T or U 15
cnaaanacna gagnncgac 19 16 19 DNA Artificial Sequence based on Homo
sapiens. Each nucleobase may be part of a ribonucleotide,
deoxyribonucleotide, or nucleotide analog misc_feature 11 n = T or
U 16 acacgaccgc naagaaaca 19 17 19 DNA Artificial Sequence based on
Homo sapiens. Each nucleobase may be part of a ribonucleotide,
deoxyribonucleotide, or nucleotide analog misc_feature 1, 3, 8, 9,
11, 16 n = T or U 17 nanccacnna ngacanaaa 19 18 19 DNA Artificial
Sequence based on Homo sapiens. Each nucleobase may be part of a
ribonucleotide, deoxyribonucleotide, or nucleotide analog
misc_feature 2, 3, 5, 12, 19 n = T or U 18 gnnanaggag cnaacaaan 19
19 19 DNA Artificial Sequence based on Homo sapiens. Each
nucleobase may be part of a ribonucleotide, deoxyribonucleotide, or
nucleotide analog misc_feature 3, 5 n = T or U 19 aangngaaac
acaagcaac 19 20 19 DNA Artificial Sequence based on Homo sapiens.
Each nucleobase may be part of a ribonucleotide,
deoxyribonucleotide, or nucleotide analog misc_feature 4, 5, 7, 9,
10, 17 n = T or U 20 acannanann aggaaancc 19 21 19 DNA Artificial
Sequence based on Homo sapiens. Each nucleobase may be part of a
ribonucleotide, deoxyribonucleotide, or nucleotide analog
misc_feature 2, 3, 5, 11, 12, 13, 14, 16 n = T or U 21 cnngnccacc
nnnncnaaa 19 22 19 DNA Artificial Sequence based on Homo sapiens.
Each nucleobase may be part of a ribonucleotide,
deoxyribonucleotide, or nucleotide analog misc_feature 2, 4, 5, 7,
9, 10, 16 n = T or U 22 ancnncncnn gaaaanagg 19 23 19 DNA
Artificial Sequence based on Homo sapiens. Each nucleobase may be
part of a ribonucleotide, deoxyribonucleotide, or nucleotide analog
misc_feature 3, 4, 11, 13, 14 n = T or U 23 ccnncaaaac ngnnaaaag 19
24 19 DNA Artificial Sequence based on Homo sapiens. Each
nucleobase may be part of a ribonucleotide, deoxyribonucleotide, or
nucleotide analog misc_feature 2, 4, 6, 12 n = T or U 24 angncngcag
gnacacaag 19 25 19 DNA Artificial Sequence based on Homo sapiens.
Each nucleobase may be part of a ribonucleotide,
deoxyribonucleotide, or nucleotide analog misc_feature 2, 4, 6, 7,
12, 14, 15, 17 n = T or U 25 ancnannaaa cncnncnac 19 26 19 DNA
Artificial Sequence based on Homo sapiens. Each nucleobase may be
part of a ribonucleotide, deoxyribonucleotide, or nucleotide analog
misc_feature 8, 14, 15 n = T or U 26 acaggacnac cacnnggaa 19 27 19
DNA Artificial Sequence based on Homo sapiens. Each nucleobase may
be part of a ribonucleotide, deoxyribonucleotide, or nucleotide
analog misc_feature 1, 7, 9, 10, 13, 16 n = T or U 27 ngccagngnn
gangcngaa 19 28 19 DNA Artificial Sequence based on Homo sapiens.
Each nucleobase may be part of a ribonucleotide,
deoxyribonucleotide, or nucleotide analog misc_feature 2, 4, 15, 18
n = T or U 28 gnanaaagaa acccngcnc 19 29 19 DNA Artificial Sequence
based on Homo sapiens. Each nucleobase may be part of a
ribonucleotide, deoxyribonucleotide, or nucleotide analog
misc_feature 8, 10, 12, 15, 16 n = T or U 29 cgcacggnan cnccnncac
19 30 19 DNA Artificial Sequence based on Homo sapiens. Each
nucleobase may be part of a ribonucleotide, deoxyribonucleotide, or
nucleotide analog misc_feature 2, 8, 12, 19 n = T or U 30
cnacagcngc angacaacn 19 31 19 DNA Artificial Sequence based on Homo
sapiens. Each nucleobase may be part of a ribonucleotide,
deoxyribonucleotide, or nucleotide analog misc_feature 3, 7, 9, 13,
15, 16 n = T or U 31 gcngagncnc cananngcc 19 32 19 DNA Artificial
Sequence based on Homo sapiens. Each nucleobase may be part of a
ribonucleotide, deoxyribonucleotide, or nucleotide analog
misc_feature 2, 5, 6, 7, 10, 12, 14, 16, 17 n = T or U 32
anacnnnccn gngncnncc 19 33 19 DNA Artificial Sequence based on Homo
sapiens. Each nucleobase may be part of a ribonucleotide,
deoxyribonucleotide, or nucleotide analog misc_feature 3, 7, 9, 14,
15, 16 n = T or U 33 ganaaancng caannnggg 19 34 19 DNA Artificial
Sequence based on Homo sapiens. Each nucleobase may be part of a
ribonucleotide, deoxyribonucleotide, or nucleotide analog
misc_feature 1, 2, 4, 9, 13, 19 n = T or U 34 nngnagacng cgnggcacn
19 35 19 DNA Artificial Sequence based on Homo sapiens. Each
nucleobase may be part of a ribonucleotide, deoxyribonucleotide, or
nucleotide analog misc_feature 5, 6, 8, 12 n = T or U 35 accanncngg
anaccagaa 19 36 19 DNA Artificial Sequence based on Homo sapiens.
Each nucleobase may be part of a ribonucleotide,
deoxyribonucleotide, or nucleotide analog misc_feature 3, 4, 5, 6,
11, 12, 13, 15, 18 n = T or U 36 agnnnncaac nnngnacng 19 37 19 DNA
Artificial Sequence based on Homo sapiens. Each nucleobase may be
part of a ribonucleotide, deoxyribonucleotide, or nucleotide analog
misc_feature 2, 5, 7, 9, 12, 13 n = T or U 37 angancncng cnncccaga
19 38 19 DNA Artificial Sequence based on Homo sapiens. Each
nucleobase may be part of a ribonucleotide, deoxyribonucleotide, or
nucleotide analog misc_feature 4, 9, 11, 13 n = T or U 38
aganggccng ncnaaggca 19 39 19 DNA Artificial Sequence based on Homo
sapiens. Each nucleobase may be part of a ribonucleotide,
deoxyribonucleotide, or nucleotide analog misc_feature 3, 4, 6, 14,
17, 19 n = T or U 39 agnncncaaa aganagncn 19 40 19 DNA Artificial
Sequence based on Homo sapiens. Each nucleobase may be part of a
ribonucleotide, deoxyribonucleotide, or nucleotide analog
misc_feature 2, 4, 6, 9, 11, 13, 15 n = T or U 40 gngncngana
nancnacaa 19 41 19 DNA Artificial Sequence based on Homo sapiens.
Each nucleobase may be part of a ribonucleotide,
deoxyribonucleotide, or nucleotide analog misc_feature 1, 6, 8, 10,
13, 15, 17 n = T or U 41 ncgggnanan ggngncnga 19 42 19 DNA
Artificial Sequence based on Homo sapiens. Each nucleobase may be
part of a ribonucleotide, deoxyribonucleotide, or nucleotide analog
misc_feature 6, 7, 10, 15, 17, 19 n = T or U 42 cagggnnccn
cgggnanan 19 43 19 DNA Artificial Sequence based on Homo sapiens.
Each nucleobase may be part of a ribonucleotide,
deoxyribonucleotide, or nucleotide analog misc_feature 3, 4, 6, 7,
13, 17 n = T or U 43 gcnncnncac aanacangg 19 44 19 DNA Artificial
Sequence based on Homo sapiens. Each nucleobase may be part of a
ribonucleotide, deoxyribonucleotide, or nucleotide analog
misc_feature 7, 8, 10, 19 n = T or U 44 ggccagnncn gaaaggacn 19 45
19 DNA Artificial Sequence based on Homo sapiens. Each nucleobase
may be part of a ribonucleotide, deoxyribonucleotide, or nucleotide
analog misc_feature 3, 7, 9, 11, 12, 17, 18 n = T or U 45
gcnaacncnc nnggggnna 19 46 19 DNA Artificial Sequence based on Homo
sapiens. Each nucleobase may be part of a ribonucleotide,
deoxyribonucleotide, or nucleotide analog misc_feature 2, 4, 7, 12
n = T or U 46 gngnagnaga gnccagcac 19 47 19 DNA Artificial Sequence
based on Homo sapiens. Each nucleobase may be part of a
ribonucleotide, deoxyribonucleotide, or nucleotide analog
misc_feature 7, 12, 13, 16 n = T or U 47 aagcacngca cnnggncac 19 48
19 DNA Artificial Sequence based on Homo sapiens. Each nucleobase
may be part of a ribonucleotide, deoxyribonucleotide, or nucleotide
analog misc_feature 1, 2, 6, 7, 8, 9 n = T or U 48 nncagnnnnc
caccacaac 19 49 19 DNA Artificial Sequence based on Homo sapiens.
Each nucleobase may be part of a ribonucleotide,
deoxyribonucleotide, or nucleotide analog misc_feature 5, 13, 14 n
= T or U 49 acgancacaa ggnncccaa 19 50 19 DNA Artificial Sequence
based on Homo sapiens. Each nucleobase may be part of a
ribonucleotide, deoxyribonucleotide, or nucleotide analog
misc_feature 1, 6, 8, 10, 11, 13 n = T or U 50 ncgccngngn ncngaccag
19 51 19 DNA Artificial Sequence based on Homo sapiens. Each
nucleobase may be part of a ribonucleotide, deoxyribonucleotide, or
nucleotide analog 51 ccggcccaaa acaaagaag 19 52 19 DNA Artificial
Sequence based on Homo sapiens. Each nucleobase may be part of a
ribonucleotide, deoxyribonucleotide, or nucleotide analog
misc_feature 3, 4, 8, 9, 14, 16, 17 n = T or U 52 ganncacnnc
gaanannaa 19 53 19 DNA Artificial Sequence based on Homo sapiens.
Each nucleobase may be part of a ribonucleotide,
deoxyribonucleotide, or nucleotide analog misc_feature 1, 3, 10, 18
n = T or U 53 nancagaacn cacagcanc 19 54 19 DNA Artificial Sequence
based on Homo sapiens. Each nucleobase may be part of a
ribonucleotide, deoxyribonucleotide, or nucleotide analog
misc_feature 7, 8, 9, 11, 12, 16, 17, 18 n = T or U 54 ggaagannng
nngaannng 19 55 19 DNA Artificial Sequence based on Homo sapiens.
Each nucleobase may be part of a ribonucleotide,
deoxyribonucleotide, or nucleotide analog misc_feature 1, 3, 8, 12,
16, 17, 18 n = T or U 55 ncngccangg anggannnc 19 56 19 DNA
Artificial Sequence based on Homo sapiens. Each nucleobase may be
part of a ribonucleotide, deoxyribonucleotide, or nucleotide analog
misc_feature 4, 10, 14, 17, 18 n = T or U 56 aagnaaagan ccgngcnnc
19 57 19 DNA Artificial Sequence based on Homo sapiens. Each
nucleobase may be part of a ribonucleotide, deoxyribonucleotide, or
nucleotide analog misc_feature 2, 6, 8, 10, 14, 16 n = T or U 57
cngagnanan ccangnccc 19 58 19 DNA Artificial Sequence based on Homo
sapiens. Each nucleobase may be part of a ribonucleotide,
deoxyribonucleotide, or nucleotide analog misc_feature 7, 10, 13,
14, 16, 17 n = T or U 58 gcaagcngcn ccnngnnaa 19 59 19 DNA
Artificial Sequence based on Homo sapiens. Each nucleobase may be
part of a ribonucleotide, deoxyribonucleotide, or nucleotide analog
misc_feature 7, 12, 18 n = T or U 59 aaagcanaaa anccagcnc 19 60 19
DNA Artificial Sequence based on Homo sapiens. Each nucleobase may
be part of a ribonucleotide, deoxyribonucleotide, or nucleotide
analog misc_feature 9, 10, 11, 14, 15, 16, 18 n = T or U 60
gaaagcacnn nacnnnanc 19 61 19 DNA Artificial Sequence based on Homo
sapiens. Each nucleobase may be part of a ribonucleotide,
deoxyribonucleotide, or nucleotide analog misc_feature 3, 8, 9, 14,
18, 19 n = T or U 61 acngggcnnc caancagnn 19 62 19 DNA Artificial
Sequence based on Homo sapiens. Each nucleobase may be part of a
ribonucleotide, deoxyribonucleotide, or nucleotide analog
misc_feature 2, 3, 5, 6, 15, 17, 18 n = T or U 62 gnngnnccca
agggncnnc 19 63 19 DNA Artificial Sequence based on Homo sapiens.
Each nucleobase may be part of a ribonucleotide,
deoxyribonucleotide, or nucleotide analog misc_feature 5, 9, 14,
15, 16 n = T or U 63 acccnggana ccannnagc 19 64 19 DNA Artificial
Sequence based on Homo sapiens. Each nucleobase may be part of a
ribonucleotide, deoxyribonucleotide, or nucleotide analog
misc_feature 1, 3, 4, 6, 13, 15, 16, 17 n = T or U 64 ngnncnaaca
ganannngc
19 65 19 DNA Artificial Sequence based on Homo sapiens. Each
nucleobase may be part of a ribonucleotide, deoxyribonucleotide, or
nucleotide analog misc_feature 1, 3, 5, 7, 8, 10, 11, 13, 17, 18 n
= T or U 65 nanananncn ngncccnnc 19 66 19 DNA Artificial Sequence
based on Homo sapiens. Each nucleobase may be part of a
ribonucleotide, deoxyribonucleotide, or nucleotide analog
misc_feature 3, 4, 8, 12, 14, 15, 17, 18, 19 n = T or U 66
agnnaaanga ananngnnn 19 67 19 DNA Artificial Sequence based on Homo
sapiens. Each nucleobase may be part of a ribonucleotide,
deoxyribonucleotide, or nucleotide analog misc_feature 6, 9, 14, 18
n = T or U 67 gacacnccnc aagngaang 19 68 19 DNA Artificial Sequence
based on Homo sapiens. Each nucleobase may be part of a
ribonucleotide, deoxyribonucleotide, or nucleotide analog
misc_feature 1, 2, 3, 5, 9, 12, 13, 15, 16 n = T or U 68 nnncncagna
gnncnnacc 19 69 19 DNA Artificial Sequence based on Homo sapiens.
Each nucleobase may be part of a ribonucleotide,
deoxyribonucleotide, or nucleotide analog misc_feature 2, 3, 6, 9,
12, 14, 15, 16, 17, 19 n = T or U 69 gnnagngang gngnnnncn 19 70 19
DNA Artificial Sequence based on Homo sapiens. Each nucleobase may
be part of a ribonucleotide, deoxyribonucleotide, or nucleotide
analog misc_feature 4, 7, 9, 12, 16, 17, 19 n = T or U 70
aganggnanc ancaanncn 19 71 19 DNA Artificial Sequence based on Homo
sapiens. Each nucleobase may be part of a ribonucleotide,
deoxyribonucleotide, or nucleotide analog misc_feature 1, 3, 8, 13,
14, 15, 16 n = T or U 71 ngnaccanag gannnngga 19 72 19 DNA
Artificial Sequence based on Homo sapiens. Each nucleobase may be
part of a ribonucleotide, deoxyribonucleotide, or nucleotide analog
misc_feature 6, 7, 10, 12, 16, 17, 19 n = T or U 72 ccccanncgn
anagcnncn 19 73 19 DNA Artificial Sequence based on Homo sapiens.
Each nucleobase may be part of a ribonucleotide,
deoxyribonucleotide, or nucleotide analog misc_feature 2, 3, 5, 6,
7, 8, 10, 11, 14, 16, 19 n = T or U 73 annannnncn naangnccn 19 74
19 DNA Artificial Sequence based on Homo sapiens. Each nucleobase
may be part of a ribonucleotide, deoxyribonucleotide, or nucleotide
analog misc_feature 5, 8, 9, 10, 12, 15, 16, 19 n = T or U 74
caagngannn anagnngcn 19 75 19 DNA Artificial Sequence based on Homo
sapiens. Each nucleobase may be part of a ribonucleotide,
deoxyribonucleotide, or nucleotide analog misc_feature 1, 5, 7 n =
T or U 75 nagancngca accagaacc 19 76 19 DNA Artificial Sequence
based on Homo sapiens. Each nucleobase may be part of a
ribonucleotide, deoxyribonucleotide, or nucleotide analog
misc_feature 3, 5, 6, 10, 13, 15, 17, 18, 19 n = T or U 76
cancnngcan acngncnnn 19 77 19 DNA Artificial Sequence based on Homo
sapiens. Each nucleobase may be part of a ribonucleotide,
deoxyribonucleotide, or nucleotide analog misc_feature 3, 4, 8, 11,
13, 14, 18 n = T or U 77 ccnnagcngc ncnncagna 19 78 19 DNA
Artificial Sequence based on Homo sapiens. Each nucleobase may be
part of a ribonucleotide, deoxyribonucleotide, or nucleotide analog
misc_feature 5, 6, 8, 11, 13, 14 n = T or U 78 aagcnncncc ncnngcagg
19 79 19 DNA Artificial Sequence based on Homo sapiens. Each
nucleobase may be part of a ribonucleotide, deoxyribonucleotide, or
nucleotide analog misc_feature 2, 4, 5, 6, 8, 10, 14 n = T or U 79
anannncnan ccanacaga 19 80 19 DNA Artificial Sequence based on Homo
sapiens. Each nucleobase may be part of a ribonucleotide,
deoxyribonucleotide, or nucleotide analog misc_feature 2, 6, 8 n =
T or U 80 cnagangncc acaaggaac 19 81 19 DNA Artificial Sequence
based on Homo sapiens. Each nucleobase may be part of a
ribonucleotide, deoxyribonucleotide, or nucleotide analog
misc_feature 7, 8, 10, 11, 12, 18 n = T or U 81 agcacanngn
nnacaagng 19 82 19 DNA Artificial Sequence based on Homo sapiens.
Each nucleobase may be part of a ribonucleotide,
deoxyribonucleotide, or nucleotide analog misc_feature 7, 15, 16,
18 n = T or U 82 agcacanggg acacnngnc 19 83 19 DNA Artificial
Sequence based on Homo sapiens. Each nucleobase may be part of a
ribonucleotide, deoxyribonucleotide, or nucleotide analog
misc_feature 2, 3, 9, 12, 16, 18 n = T or U 83 cnngaaagna angacngng
19 84 19 DNA Artificial Sequence based on Homo sapiens. Each
nucleobase may be part of a ribonucleotide, deoxyribonucleotide, or
nucleotide analog misc_feature 3, 6, 8, 13, 14, 18, 19 n = T or U
84 ccnacnanag agnnagann 19 85 19 DNA Artificial Sequence based on
Homo sapiens. Each nucleobase may be part of a ribonucleotide,
deoxyribonucleotide, or nucleotide analog misc_feature 2, 3, 7, 13,
16 n = T or U 85 anncaancag ggnaanaag 19 86 19 DNA Artificial
Sequence based on Homo sapiens. Each nucleobase may be part of a
ribonucleotide, deoxyribonucleotide, or nucleotide analog
misc_feature 4, 8, 9, 14 n = T or U 86 aagncagnnc acancacac 19 87
19 DNA Artificial Sequence based on Homo sapiens. Each nucleobase
may be part of a ribonucleotide, deoxyribonucleotide, or nucleotide
analog misc_feature 4, 13, 17 n = T or U 87 cagnaaaaaa aangganaa 19
88 19 DNA Artificial Sequence based on Homo sapiens. Each
nucleobase may be part of a ribonucleotide, deoxyribonucleotide, or
nucleotide analog misc_feature 1, 2, 6, 7, 9, 12, 14, 17 n = T or U
88 nncagnnana gnangangc 19 89 19 DNA Artificial Sequence based on
Homo sapiens. Each nucleobase may be part of a ribonucleotide,
deoxyribonucleotide, or nucleotide analog misc_feature 1, 6, 7, 13,
14, 18 n = T or U 89 nacacnnaga aannaaanc 19 90 19 DNA Artificial
Sequence based on Homo sapiens. Each nucleobase may be part of a
ribonucleotide, deoxyribonucleotide, or nucleotide analog
misc_feature 1, 3, 5, 7, 9, 10, 11 n = T or U 90 ncncnancnn
nccaccagc 19 91 19 DNA Artificial Sequence based on Homo sapiens.
Each nucleobase may be part of a ribonucleotide,
deoxyribonucleotide, or nucleotide analog misc_feature 5, 8 n = T
or U 91 agaanccnaa aacacaaca 19 92 19 DNA Artificial Sequence based
on Homo sapiens. Each nucleobase may be part of a ribonucleotide,
deoxyribonucleotide, or nucleotide analog misc_feature 2, 3, 12,
16, 18, 19 n = T or U 92 anncgcacaa gnacgngnn 19 93 19 DNA
Artificial Sequence based on Homo sapiens. Each nucleobase may be
part of a ribonucleotide, deoxyribonucleotide, or nucleotide analog
misc_feature 1, 3, 7, 11, 13, 14, 18 n = T or U 93 ngncagnaca
ngnnggcnc 19 94 19 DNA Artificial Sequence based on Homo sapiens.
Each nucleobase may be part of a ribonucleotide,
deoxyribonucleotide, or nucleotide analog misc_feature 4, 7, 9, 10,
11, 12, 18, 19 n = T or U 94 acanagngnn nngccacnn 19 95 19 DNA
Artificial Sequence based on Homo sapiens. Each nucleobase may be
part of a ribonucleotide, deoxyribonucleotide, or nucleotide analog
misc_feature 2, 3, 4, 7, 9, 13, 19 n = T or U 95 cnnngancng
gcncagacn 19 96 19 DNA Artificial Sequence based on Homo sapiens.
Each nucleobase may be part of a ribonucleotide,
deoxyribonucleotide, or nucleotide analog misc_feature 10, 11, 12,
18, 19 n = T or U 96 gaaaccacan nnaacagnn 19 97 19 DNA Artificial
Sequence based on Homo sapiens. Each nucleobase may be part of a
ribonucleotide, deoxyribonucleotide, or nucleotide analog
misc_feature 3, 5, 7, 10, 11, 18 n = T or U 97 ggnancnccn ncaccagna
19 98 19 DNA Artificial Sequence based on Homo sapiens. Each
nucleobase may be part of a ribonucleotide, deoxyribonucleotide, or
nucleotide analog misc_feature 2, 9, 10, 13, 15, 17 n = T or U 98
angaccacnn ccncnangg 19 99 15 DNA Artificial Sequence based on Homo
sapiens. Each nucleobase may be part of a ribonucleotide,
deoxyribonucleotide, or nucleotide analog misc_feature 3, 11, 12,
13, 15 n = T or U 99 ganaccagaa nnngn 15 100 15 DNA Artificial
Sequence based on Homo sapiens. Each nucleobase may be part of a
ribonucleotide, deoxyribonucleotide, or nucleotide analog
misc_feature 1, 3, 4, 5, 13 n = T or U 100 ngnnnaagac canag 15 101
19 DNA Artificial Sequence based on Homo sapiens. Each nucleobase
may be part of a ribonucleotide, deoxyribonucleotide, or nucleotide
analog misc_feature 3, 7, 9, 13, 16 n = T or U 101 gcngagncnc
canacngcc 19 102 19 DNA Artificial Sequence based on Homo sapiens.
Each nucleobase may be part of a ribonucleotide,
deoxyribonucleotide, or nucleotide analog misc_feature 4, 6, 8, 15,
19 n = T or U 102 ggcncncngc ccacngaan 19 103 19 DNA Artificial
Sequence based on Homo sapiens. Each nucleobase may be part of a
ribonucleotide, deoxyribonucleotide, or nucleotide analog
misc_feature 2, 4, 5, 7, 9, 10, 16 n = T or U 103 ancnncncnn
gaaaanagg 19 104 19 DNA Artificial Sequence based on Homo sapiens.
Each nucleobase may be part of a ribonucleotide,
deoxyribonucleotide, or nucleotide analog misc_feature 7, 8, 9, 12,
13, 14, 19 n = T or U 104 cagagannnc annnaacgn 19 105 19 DNA
Artificial Sequence based on Homo sapiens. Each nucleobase may be
part of a ribonucleotide, deoxyribonucleotide, or nucleotide analog
misc_feature 2, 4, 5, 9, 10, 13, 14, 16 n = T or U 105 ancnngacnn
gannanagg 19 106 19 DNA Artificial Sequence based on Homo sapiens.
Each nucleobase may be part of a ribonucleotide,
deoxyribonucleotide, or nucleotide analog misc_feature 4, 10, 11,
13, 15, 16, 18 n = T or U 106 gganaaaagn ncncnncna 19 107 19 DNA
Artificial Sequence based on Homo sapiens. Each nucleobase may be
part of a ribonucleotide, deoxyribonucleotide, or nucleotide analog
misc_feature 8, 10, 12, 15, 16 n = T or U 107 cgcacggnan cnccnncac
19 108 19 DNA Artificial Sequence based on Homo sapiens. Each
nucleobase may be part of a ribonucleotide, deoxyribonucleotide, or
nucleotide analog misc_feature 2, 7, 13, 16, 17 n = T or U 108
cnacgcncgc cancgnnca 19 109 19 DNA Artificial Sequence based on
Homo sapiens. Each nucleobase may be part of a ribonucleotide,
deoxyribonucleotide, or nucleotide analog misc_feature 4, 5, 8, 10,
12 n = T or U 109 cacnnccncn anggcacgc 19 110 19 DNA Artificial
Sequence based on Homo sapiens. Each nucleobase may be part of a
ribonucleotide, deoxyribonucleotide, or nucleotide analog
misc_feature 8, 10, 12, 15, 16 n = T or U 110 cgcacccnan cnggnncac
19 111 19 DNA Artificial Sequence based on Homo sapiens. Each
nucleobase may be part of a ribonucleotide, deoxyribonucleotide, or
nucleotide analog misc_feature 3, 7, 9, 13, 15, 16 n = T or U 111
gcngagncnc cananngcc 19 112 19 DNA Artificial Sequence based on
Homo sapiens. Each nucleobase may be part of a ribonucleotide,
deoxyribonucleotide, or nucleotide analog misc_feature 4, 6, 7, 8,
15, 19 n = T or U 112 ggcncnnncg ccacngaan 19 113 19 DNA Artificial
Sequence based on Homo sapiens. Each nucleobase may be part of a
ribonucleotide, deoxyribonucleotide, or nucleotide analog
misc_feature 4, 5, 7, 11, 13, 17 n = T or U 113 ccgnnanacc
ncngagncg 19 114 19 DNA Artificial Sequence based on Homo sapiens.
Each nucleobase may be part of a ribonucleotide,
deoxyribonucleotide, or nucleotide analog misc_feature 3, 9, 14,
15, 16 n = T or U 114 gcngacacnc caannngcc 19 115 19 DNA Artificial
Sequence based on Homo sapiens. Each nucleobase may be part of a
ribonucleotide, deoxyribonucleotide, or nucleotide analog
misc_feature 5, 6, 8, 11 n = T or U 115 accanncngg naaccagaa 19 116
19 DNA Artificial Sequence based on Homo sapiens. Each nucleobase
may be part of a ribonucleotide, deoxyribonucleotide, or nucleotide
analog misc_feature 1, 11, 14, 17 n = T or U 116 ngcccaagaa
nacnagnca 19 117 19 DNA Artificial Sequence based on Homo sapiens.
Each nucleobase may be part of a ribonucleotide,
deoxyribonucleotide, or nucleotide analog misc_feature 5, 8, 12, 13
n = T or U 117 accanagngg anngcagaa 19 118 19 DNA Artificial
Sequence based on Homo sapiens. Each nucleobase may be part of a
ribonucleotide, deoxyribonucleotide, or nucleotide analog
misc_feature 8, 12, 14, 15 n = T or U 118 aagaccanag gncnnacca 19
119 22 DNA Artificial Sequence based on Homo sapiens. Each
nucleobase may be part of a ribonucleotide, deoxyribonucleotide, or
nucleotide analog misc_feature 3, 4, 8, 9, 11, 12, 17, 19, 20 n = T
or U 119 ganncacnnc nncgaanann aa 22 120 19 DNA Artificial Sequence
based on Homo sapiens. Each nucleobase may be part of a
ribonucleotide, deoxyribonucleotide, or nucleotide analog
misc_feature 1, 6, 8, 12, 15, 17, 18 n = T or U 120 ngaaangnaa
ancancnnc 19 121 19 DNA Artificial Sequence based on Homo sapiens.
Each nucleobase may be part of a ribonucleotide,
deoxyribonucleotide, or nucleotide analog misc_feature 3, 4, 6, 8,
9, 13, 16, 17 n = T or U 121 ganncngnnc ganaannaa 19 122 19 DNA
Artificial Sequence based on Homo sapiens. Each nucleobase may be
part of a ribonucleotide, deoxyribonucleotide, or nucleotide analog
misc_feature 3, 4, 6, 11, 12, 16, 17 n = T or U 122 aannanaagc
nncacnnag 19 123 19 DNA Artificial Sequence based on Homo sapiens.
Each nucleobase may be part of a ribonucleotide,
deoxyribonucleotide, or nucleotide analog misc_feature 3, 7, 9, 13,
15, 16 n = T or U 123 gcngagncnc cananngcc 19 124 19 DNA Artificial
Sequence based on Homo sapiens. Each nucleobase may be part of a
ribonucleotide, deoxyribonucleotide, or nucleotide analog
misc_feature 4, 6, 7, 8, 15, 19 n = T or U 124 ggcncnnngc ccacngaan
19 125 19 DNA Artificial Sequence based on Homo sapiens. Each
nucleobase may be part of a ribonucleotide, deoxyribonucleotide, or
nucleotide analog misc_feature 5, 6, 8, 12 n = T or U 125
accanncngg anaccagaa 19 126 19 DNA Artificial Sequence based on
Homo sapiens. Each nucleobase may be part of a ribonucleotide,
deoxyribonucleotide, or nucleotide analog misc_feature 8, 12, 14,
15 n = T or U 126 aagaccanag gncnnacca 19 127 19 DNA Artificial
Sequence based on Homo sapiens. Each nucleobase may be part of a
ribonucleotide, deoxyribonucleotide, or nucleotide analog
misc_feature 2, 4, 5, 7, 9, 10, 16 n = T or U 127 ancnncncnn
gaaaanagg 19 128 19 DNA Artificial Sequence based on Homo sapiens.
Each nucleobase may be part of a
ribonucleotide, deoxyribonucleotide, or nucleotide analog
misc_feature 4, 10, 11, 13, 15, 16, 18 n = T or U 128 gganaaaagn
ncncnncna 19 129 19 DNA Artificial Sequence based on Homo sapiens.
Each nucleobase may be part of a ribonucleotide,
deoxyribonucleotide, or nucleotide analog misc_feature 3, 5, 7, 10,
11, 18 n = T or U 129 ggnancnccn ncaccagna 19 130 19 DNA Artificial
Sequence based on Homo sapiens. Each nucleobase may be part of a
ribonucleotide, deoxyribonucleotide, or nucleotide analog
misc_feature 2, 9, 10, 13, 15, 17 n = T or U 130 angaccacnn
ccncnangg 19 131 19 DNA Artificial Sequence based on Homo sapiens.
Each nucleobase may be part of a ribonucleotide,
deoxyribonucleotide, or nucleotide analog misc_feature 1, 3, 7, 15,
16, 17, 19 n = T or U 131 ncngganacc agaannngn 19 132 19 DNA
Artificial Sequence based on Homo sapiens. Each nucleobase may be
part of a ribonucleotide, deoxyribonucleotide, or nucleotide analog
misc_feature 1, 3, 4, 5, 13, 17, 19 n = T or U 132 ngnnnaagac
canaggncn 19 133 19 DNA Artificial Sequence based on Homo sapiens.
Each nucleobase may be part of a ribonucleotide,
deoxyribonucleotide, or nucleotide analog misc_feature 4, 5, 8, 13,
15, 17 n = T or U 133 gggnnccncg ggnanangg 19 134 19 DNA Artificial
Sequence based on Homo sapiens. Each nucleobase may be part of a
ribonucleotide, deoxyribonucleotide, or nucleotide analog
misc_feature 3, 5, 7, 12, 15, 16 n = T or U 134 ggnananggc
gnccnnggg 19 135 19 DNA Artificial Sequence based on Homo sapiens.
Each nucleobase may be part of a ribonucleotide,
deoxyribonucleotide, or nucleotide analog misc_feature 3, 4, 8, 9,
14, 16, 17 n = T or U 135 ganncacnnc gaanannaa 19 136 19 DNA
Artificial Sequence based on Homo sapiens. Each nucleobase may be
part of a ribonucleotide, deoxyribonucleotide, or nucleotide analog
misc_feature 3, 4, 6, 11, 12, 16, 17 n = T or U 136 aannanaacg
nncacnnag 19 137 19 DNA Artificial Sequence based on Homo sapiens.
Each nucleobase may be part of a ribonucleotide,
deoxyribonucleotide, or nucleotide analog misc_feature 2, 4, 5, 7,
9, 10, 16 n = T or U 137 ancnncncnn gaaaanagg 19 138 19 DNA
Artificial Sequence based on Homo sapiens. Each nucleobase may be
part of a ribonucleotide, deoxyribonucleotide, or nucleotide analog
misc_feature 3, 7, 9, 13, 15, 16 n = T or U 138 gcngagncnc
cananngcc 19 139 19 DNA Artificial Sequence based on Homo sapiens.
Each nucleobase may be part of a ribonucleotide,
deoxyribonucleotide, or nucleotide analog misc_feature 3, 4, 8, 9,
14, 16, 17 n = T or U 139 ganncacnnc gaanannaa 19 140 19 DNA
Artificial Sequence based on Homo sapiens. Each nucleobase may be
part of a ribonucleotide, deoxyribonucleotide, or nucleotide analog
misc_feature 1, 11, 14, 17 n = T or U 140 ngcccaagaa nacnagnca 19
141 19 DNA Artificial Sequence based on Homo sapiens. Each
nucleobase may be part of a ribonucleotide, deoxyribonucleotide, or
nucleotide analog misc_feature 3, 7, 9, 13, 15, 16 n = T or U 141
gcngagncnc cananngcc 19 142 19 DNA Artificial Sequence based on
Homo sapiens. Each nucleobase may be part of a ribonucleotide,
deoxyribonucleotide, or nucleotide analog misc_feature 4, 6, 7, 8,
15, 19 n = T or U 142 ggcncnnngc ccacngaan 19 143 19 DNA Artificial
Sequence based on Homo sapiens. Each nucleobase may be part of a
ribonucleotide, deoxyribonucleotide, or nucleotide analog
misc_feature 3, 5, 7, 10, 11, 18 n = T or U 143 ggnancnccn
ncaccagna 19 144 19 DNA Artificial Sequence based on Homo sapiens.
Each nucleobase may be part of a ribonucleotide,
deoxyribonucleotide, or nucleotide analog misc_feature 2, 9, 10,
13, 15, 17 n = T or U 144 angaccacnn ccncnangg 19 145 19 DNA
Artificial Sequence based on Homo sapiens. Each nucleobase may be
part of a ribonucleotide, deoxyribonucleotide, or nucleotide analog
misc_feature 6, 9, 11, 12, 13 n = T or U 145 gaaagnaana nnnaagcag
19 146 19 DNA Artificial Sequence based on Homo sapiens. Each
nucleobase may be part of a ribonucleotide, deoxyribonucleotide, or
nucleotide analog misc_feature 7, 8, 9, 11, 14 n = T or U 146
gagcaannna naangaaag 19 147 19 DNA Artificial Sequence based on
Homo sapiens. Each nucleobase may be part of a ribonucleotide,
deoxyribonucleotide, or nucleotide analog misc_feature 6, 15, 16,
18 n = T or U 147 accgcnaaga aacanncna 19 148 19 DNA Artificial
Sequence based on Homo sapiens. Each nucleobase may be part of a
ribonucleotide, deoxyribonucleotide, or nucleotide analog
misc_feature 2, 4, 5, 14 n = T or U 148 ancnnacaaa gaanccgca 19 149
19 DNA Artificial Sequence based on Homo sapiens. Each nucleobase
may be part of a ribonucleotide, deoxyribonucleotide, or nucleotide
analog misc_feature 1, 3, 8, 9, 11, 16 n = T or U 149 nanccacnna
ngacanaaa 19 150 19 DNA Artificial Sequence based on Homo sapiens.
Each nucleobase may be part of a ribonucleotide,
deoxyribonucleotide, or nucleotide analog misc_feature 4, 9, 11,
12, 17, 19 n = T or U 150 aaanacagna nncaccnan 19 151 19 DNA
Artificial Sequence based on Homo sapiens. Each nucleobase may be
part of a ribonucleotide, deoxyribonucleotide, or nucleotide analog
misc_feature 1, 8, 12, 17, 18, 19 n = T or U 151 ngcacccngg
anaccannn 19 152 19 DNA Artificial Sequence based on Homo sapiens.
Each nucleobase may be part of a ribonucleotide,
deoxyribonucleotide, or nucleotide analog misc_feature 1, 2, 3, 8,
12, 19 n = T or U 152 nnnaccanag gncccagcn 19 153 19 DNA Artificial
Sequence based on Homo sapiens. Each nucleobase may be part of a
ribonucleotide, deoxyribonucleotide, or nucleotide analog
misc_feature 3, 7, 9, 13, 16 n = T or U 153 gcngagncnc canacngcc 19
154 19 DNA Artificial Sequence based on Homo sapiens. Each
nucleobase may be part of a ribonucleotide, deoxyribonucleotide, or
nucleotide analog misc_feature 4, 6, 8, 15, 19 n = T or U 154
ggcncncngc ccacngaan 19 155 19 DNA Artificial Sequence based on
Homo sapiens. Each nucleobase may be part of a ribonucleotide,
deoxyribonucleotide, or nucleotide analog misc_feature 2, 3, 6, 7,
12, 14, 16, 17, 19 n = T or U 155 annggnncca angngnncn 19 156 19
DNA Artificial Sequence based on Homo sapiens. Each nucleobase may
be part of a ribonucleotide, deoxyribonucleotide, or nucleotide
analog misc_feature 1, 3, 4, 6, 8, 13, 14, 17, 18 n = T or U 156
ncnngngnaa ccnnggnna 19 157 19 DNA Artificial Sequence based on
Homo sapiens. Each nucleobase may be part of a ribonucleotide,
deoxyribonucleotide, or nucleotide analog misc_feature 8, 14, 15 n
= T or U 157 acaggacnac cacnnggaa 19 158 19 DNA Artificial Sequence
based on Homo sapiens. Each nucleobase may be part of a
ribonucleotide, deoxyribonucleotide, or nucleotide analog
misc_feature 5, 6, 12 n = T or U 158 aaggnncacc ancaggaca 19 159 19
DNA Artificial Sequence based on Homo sapiens. Each nucleobase may
be part of a ribonucleotide, deoxyribonucleotide, or nucleotide
analog misc_feature 7, 12, 13, 16 n = T or U 159 aagcacngca
cnnggncac 19 160 19 DNA Artificial Sequence based on Homo sapiens.
Each nucleobase may be part of a ribonucleotide,
deoxyribonucleotide, or nucleotide analog misc_feature 4, 7, 8, 13
n = T or U 160 cacnggnnga ccncacaag 19 161 19 DNA Artificial
Sequence based on Homo sapiens. Each nucleobase may be part of a
ribonucleotide, deoxyribonucleotide, or nucleotide analog
misc_feature 1, 3, 7, 11, 13, 14, 18 n = T or U 161 ngncagnaca
ngnnggcnc 19 162 19 DNA Artificial Sequence based on Homo sapiens.
Each nucleobase may be part of a ribonucleotide,
deoxyribonucleotide, or nucleotide analog misc_feature 2, 6, 7, 9,
13, 17, 19 n = T or U 162 cnaggnngnc cangacngn 19 163 19 DNA
Artificial Sequence based on Homo sapiens. Each nucleobase may be
part of a ribonucleotide, deoxyribonucleotide, or nucleotide analog
misc_feature 1, 4, 5, 6, 12, 19 n = T or U 163 ncannngagc cngggaggn
19 164 19 DNA Artificial Sequence based on Homo sapiens. Each
nucleobase may be part of a ribonucleotide, deoxyribonucleotide, or
nucleotide analog misc_feature 8 n = T or U 164 cggaggcnga
ggcaggaga 19 165 19 DNA Artificial Sequence based on Homo sapiens.
Each nucleobase may be part of a ribonucleotide,
deoxyribonucleotide, or nucleotide analog misc_feature 3, 5, 8, 11,
19 n = T or U 165 ggngnggngg nacgcgccn 19 166 19 DNA Artificial
Sequence based on Homo sapiens. Each nucleobase may be part of a
ribonucleotide, deoxyribonucleotide, or nucleotide analog
misc_feature 6, 16 n = T or U 166 acccangcac aaaacnacc 19 167 19
DNA Artificial Sequence based on Homo sapiens. Each nucleobase may
be part of a ribonucleotide, deoxyribonucleotide, or nucleotide
analog misc_feature 5, 7, 13 n = T or U 167 agaangngcc agnaggaga 19
168 19 DNA Artificial Sequence based on Homo sapiens. Each
nucleobase may be part of a ribonucleotide, deoxyribonucleotide, or
nucleotide analog misc_feature 1, 3, 12, 13, 18, 19 n = T or U 168
ncncacagac gnngggcnn 19 169 19 DNA Artificial Sequence based on
Homo sapiens. Each nucleobase may be part of a ribonucleotide,
deoxyribonucleotide, or nucleotide analog misc_feature 5, 8, 9, 10,
18 n = T or U 169 ccagnggnnn gcaagcang 19 170 19 DNA Artificial
Sequence based on Homo sapiens. Each nucleobase may be part of a
ribonucleotide, deoxyribonucleotide, or nucleotide analog
misc_feature 5, 6, 7, 10 n = T or U 170 gaaannnagn ggccaggaa 19 171
19 DNA Artificial Sequence based on Homo sapiens. Each nucleobase
may be part of a ribonucleotide, deoxyribonucleotide, or nucleotide
analog misc_feature 6, 13, 14 n = T or U 171 agaaanacac aanngcacc
19 172 19 DNA Artificial Sequence based on Homo sapiens. Each
nucleobase may be part of a ribonucleotide, deoxyribonucleotide, or
nucleotide analog misc_feature 1, 4, 7, 11, 12, 13, 14 n = T or U
172 nacnganaca nnnnaagga 19 173 19 DNA Artificial Sequence based on
Homo sapiens. Each nucleobase may be part of a ribonucleotide,
deoxyribonucleotide, or nucleotide analog misc_feature 1, 2, 8, 14,
15, 17 n = T or U 173 nncaacangg aganncnaa 19 174 19 DNA Artificial
Sequence based on Homo sapiens. Each nucleobase may be part of a
ribonucleotide, deoxyribonucleotide, or nucleotide analog
misc_feature 2, 3, 4, 6, 8, 12, 13, 14, 19 n = T or U 174
annncnangc annnagagn 19 175 19 DNA Artificial Sequence based on
Homo sapiens. Each nucleobase may be part of a ribonucleotide,
deoxyribonucleotide, or nucleotide analog misc_feature 3, 6, 11 n =
T or U 175 aanacnaggc ngaaaagcc 19 176 19 DNA Artificial Sequence
based on Homo sapiens. Each nucleobase may be part of a
ribonucleotide, deoxyribonucleotide, or nucleotide analog
misc_feature 4, 5, 6, 9, 10, 11, 12, 14, 18, 19 n = T or U 176
ggcnnngcnn nnancagnn 19 177 19 DNA Artificial Sequence based on
Homo sapiens. Each nucleobase may be part of a ribonucleotide,
deoxyribonucleotide, or nucleotide analog misc_feature 1, 3, 11,
14, 15, 16, 17, 19 n = T or U 177 ncnagggagg nagnnnngn 19 178 19
DNA Artificial Sequence based on Homo sapiens. Each nucleobase may
be part of a ribonucleotide, deoxyribonucleotide, or nucleotide
analog misc_feature 16 n = T or U 178 gggaagaaaa gggacnagc 19 179
19 DNA Artificial Sequence based on Homo sapiens. Each nucleobase
may be part of a ribonucleotide, deoxyribonucleotide, or nucleotide
analog misc_feature 2, 3, 6, 9, 14, 18 n = T or U 179 gnncanaang
aaangaang 19 180 19 DNA Artificial Sequence based on Homo sapiens.
Each nucleobase may be part of a ribonucleotide,
deoxyribonucleotide, or nucleotide analog misc_feature 2, 8, 10,
13, 15, 16, 17, 18 n = T or U 180 anaagaanan gcngnnnnc 19 181 19
DNA Artificial Sequence based on Homo sapiens. Each nucleobase may
be part of a ribonucleotide, deoxyribonucleotide, or nucleotide
analog misc_feature 1, 2, 9, 11, 12, 18, 19 n = T or U 181
nncaaacgng nnggcgcnn 19 182 19 DNA Artificial Sequence based on
Homo sapiens. Each nucleobase may be part of a ribonucleotide,
deoxyribonucleotide, or nucleotide analog misc_feature 2, 9, 12,
14, 15, 16 n = T or U 182 angacaagnc gnannncag 19 183 19 DNA
Artificial Sequence based on Homo sapiens. Each nucleobase may be
part of a ribonucleotide, deoxyribonucleotide, or nucleotide analog
misc_feature 4, 9, 13, 19 n = T or U 183 aagnggaana cgnagacan 19
184 19 DNA Artificial Sequence based on Homo sapiens. Each
nucleobase may be part of a ribonucleotide, deoxyribonucleotide, or
nucleotide analog 184 agacaggaac cccagcagg 19 185 19 DNA Artificial
Sequence based on Homo sapiens. Each nucleobase may be part of a
ribonucleotide, deoxyribonucleotide, or nucleotide analog
misc_feature 11, 14, 15, 16, 18 n = T or U 185 cgagcaagac nccnnncng
19 186 19 DNA Artificial Sequence based on Homo sapiens. Each
nucleobase may be part of a ribonucleotide, deoxyribonucleotide, or
nucleotide analog misc_feature 3, 5, 8 n = T or U 186 agngnaanag
aaaccagca 19 187 19 DNA Artificial Sequence based on Homo sapiens.
Each nucleobase may be part of a ribonucleotide,
deoxyribonucleotide, or nucleotide analog misc_feature 1, 6, 7, 9,
12, 13 n = T or U 187 ngaccnngnc anncacacc 19 188 19 DNA Artificial
Sequence based on Homo sapiens. Each nucleobase may be part of a
ribonucleotide, deoxyribonucleotide, or nucleotide analog
misc_feature 1, 2, 4, 11 n = T or U 188 nnanccagca ncaggccac 19 189
19 DNA Artificial Sequence based on Homo sapiens. Each nucleobase
may be part of a ribonucleotide, deoxyribonucleotide, or nucleotide
analog misc_feature 3, 5, 7, 10, 12, 13, 14, 15 n = T or U 189
acngncnccn cnnnnccag 19 190 19 DNA Artificial Sequence based on
Homo sapiens. Each nucleobase may be part of a ribonucleotide,
deoxyribonucleotide, or nucleotide analog misc_feature 1, 2, 3, 4,
6, 9, 10, 11, 12, 16 n = T or U 190 nnnnangcnn nncagnagg 19 191 19
DNA Artificial Sequence based on Homo sapiens. Each nucleobase may
be part of a ribonucleotide, deoxyribonucleotide, or nucleotide
analog misc_feature 6, 8, 14, 19 n = T or U 191 acgaancngc
agcnaggan 19 192 19 DNA Artificial Sequence
based on Homo sapiens. Each nucleobase may be part of a
ribonucleotide, deoxyribonucleotide, or nucleotide analog
misc_feature 5, 6, 8, 9, 17, 18, 19 n = T or U 192 caagnngnna
acggaannn 19 193 19 DNA Artificial Sequence based on Homo sapiens.
Each nucleobase may be part of a ribonucleotide,
deoxyribonucleotide, or nucleotide analog misc_feature 1, 6, 13,
17, 18 n = T or U 193 naggcngaga ggnagcnnc 19 194 19 DNA Artificial
Sequence based on Homo sapiens. Each nucleobase may be part of a
ribonucleotide, deoxyribonucleotide, or nucleotide analog
misc_feature 2, 3, 6 n = T or U 194 gnnacngaag aaggaaaag 19 195 19
DNA Artificial Sequence based on Homo sapiens. Each nucleobase may
be part of a ribonucleotide, deoxyribonucleotide, or nucleotide
analog misc_feature 4, 8, 10, 12, 17, 19 n = T or U 195 gaangagngn
gnggaangn 19 196 19 DNA Artificial Sequence based on Homo sapiens.
Each nucleobase may be part of a ribonucleotide,
deoxyribonucleotide, or nucleotide analog misc_feature 1, 3, 4, 5,
6, 8, 10 n = T or U 196 ngnnnncngn acccggaag 19 197 19 DNA
Artificial Sequence based on Homo sapiens. Each nucleobase may be
part of a ribonucleotide, deoxyribonucleotide, or nucleotide analog
misc_feature 13, 15 n = T or U 197 gagccacgga aananccac 19 198 19
DNA Artificial Sequence based on Homo sapiens. Each nucleobase may
be part of a ribonucleotide, deoxyribonucleotide, or nucleotide
analog misc_feature 1, 4, 11, 12, 13, 17 n = T or U 198 nganggagag
nnngaanaa 19 199 19 DNA Artificial Sequence based on Homo sapiens.
Each nucleobase may be part of a ribonucleotide,
deoxyribonucleotide, or nucleotide analog misc_feature 3, 4, 5, 8,
10, 15, 16, 17 n = T or U 199 gannngcncn ggagnnnac 19 200 19 DNA
Artificial Sequence based on Homo sapiens. Each nucleobase may be
part of a ribonucleotide, deoxyribonucleotide, or nucleotide analog
misc_feature 10, 11, 13, 14, 17, 18, 19 n = T or U 200 ggcagaaaan
ncnngannn 19 201 19 DNA Artificial Sequence based on Homo sapiens.
Each nucleobase may be part of a ribonucleotide,
deoxyribonucleotide, or nucleotide analog misc_feature 10, 17, 18 n
= T or U 201 ggacaggggn aggaacnnc 19 202 19 DNA Artificial Sequence
based on Homo sapiens. Each nucleobase may be part of a
ribonucleotide, deoxyribonucleotide, or nucleotide analog
misc_feature 4, 5, 6, 7, 10, 11, 13, 14, 17, 18 n = T or U 202
gcannnncgn nanncanng 19 203 19 DNA Artificial Sequence based on
Homo sapiens. Each nucleobase may be part of a ribonucleotide,
deoxyribonucleotide, or nucleotide analog misc_feature 2, 9, 13,
16, 18 n = T or U 203 cngaaaagna agnaancng 19 204 19 DNA Artificial
Sequence based on Homo sapiens. Each nucleobase may be part of a
ribonucleotide, deoxyribonucleotide, or nucleotide analog
misc_feature 14, 18 n = T or U 204 ggcgacagaa aagncaang 19 205 19
DNA Artificial Sequence based on Homo sapiens. Each nucleobase may
be part of a ribonucleotide, deoxyribonucleotide, or nucleotide
analog misc_feature 5, 7, 9, 11, 17 n = T or U 205 ccacncngnc
nccaggncc 19 206 19 DNA Artificial Sequence based on Homo sapiens.
Each nucleobase may be part of a ribonucleotide,
deoxyribonucleotide, or nucleotide analog 206 ccaccacagg caaagcaag
19 207 19 DNA Artificial Sequence based on Homo sapiens. Each
nucleobase may be part of a ribonucleotide, deoxyribonucleotide, or
nucleotide analog misc_feature 1, 2, 6, 7, 13, 14, 17 n = T or U
207 nncggnnccc aanngcnca 19 208 19 DNA Artificial Sequence based on
Homo sapiens. Each nucleobase may be part of a ribonucleotide,
deoxyribonucleotide, or nucleotide analog misc_feature 1, 2, 4, 9,
14, 15, 17 n = T or U 208 nncngacana gcannancc 19 209 19 DNA
Artificial Sequence based on Homo sapiens. Each nucleobase may be
part of a ribonucleotide, deoxyribonucleotide, or nucleotide analog
misc_feature 1, 9, 11, 13, 18 n = T or U 209 ngggaaaang ncncaggng
19 210 19 DNA Artificial Sequence based on Homo sapiens. Each
nucleobase may be part of a ribonucleotide, deoxyribonucleotide, or
nucleotide analog misc_feature 1, 3, 7, 13, 14, 15 n = T or U 210
nanaaanggg cannnggga 19 211 19 DNA Artificial Sequence based on
Homo sapiens. Each nucleobase may be part of a ribonucleotide,
deoxyribonucleotide, or nucleotide analog misc_feature 1, 3, 5, 6,
12, 15, 16, 17, 18 n = T or U 211 ngncnngaag cngannnnc 19 212 19
DNA Artificial Sequence based on Homo sapiens. Each nucleobase may
be part of a ribonucleotide, deoxyribonucleotide, or nucleotide
analog misc_feature 6, 8, 10, 12, 14, 15 n = T or U 212 gaaacngngn
ancnngaag 19 213 19 DNA Artificial Sequence based on Homo sapiens.
Each nucleobase may be part of a ribonucleotide,
deoxyribonucleotide, or nucleotide analog misc_feature 1, 3, 5, 9,
12, 17, 18 n = T or U 213 ngncngcang cncaganna 19 214 19 DNA
Artificial Sequence based on Homo sapiens. Each nucleobase may be
part of a ribonucleotide, deoxyribonucleotide, or nucleotide analog
misc_feature 4, 6, 7, 8, 9, 19 n = T or U 214 gaangnnnna aagcgggcn
19 215 19 DNA Artificial Sequence based on Homo sapiens. Each
nucleobase may be part of a ribonucleotide, deoxyribonucleotide, or
nucleotide analog misc_feature 4, 15, 16 n = T or U 215 cacnagaggg
ccagnnaaa 19 216 19 DNA Artificial Sequence based on Homo sapiens.
Each nucleobase may be part of a ribonucleotide,
deoxyribonucleotide, or nucleotide analog misc_feature 7, 8, 15, 18
n = T or U 216 ccgcacnngc aagcngcnc 19 217 19 DNA Artificial
Sequence based on Homo sapiens. Each nucleobase may be part of a
ribonucleotide, deoxyribonucleotide, or nucleotide analog
misc_feature 3, 6, 10, 12, 13 n = T or U 217 cancancacn gnnacccac
19 218 19 DNA Artificial Sequence based on Homo sapiens. Each
nucleobase may be part of a ribonucleotide, deoxyribonucleotide, or
nucleotide analog misc_feature 7 n = T or U 218 ccaccancac
agcaaaagc 19 219 19 DNA Artificial Sequence based on Homo sapiens.
Each nucleobase may be part of a ribonucleotide,
deoxyribonucleotide, or nucleotide analog misc_feature 1, 7, 8, 18
n = T or U 219 nccaganncc caacaccng 19 220 19 DNA Artificial
Sequence based on Homo sapiens. Each nucleobase may be part of a
ribonucleotide, deoxyribonucleotide, or nucleotide analog
misc_feature 5, 9, 12, 14 n = T or U 220 cccangganc ancnccaga 19
221 19 DNA Artificial Sequence based on Homo sapiens. Each
nucleobase may be part of a ribonucleotide, deoxyribonucleotide, or
nucleotide analog misc_feature 7, 8, 13, 15, 16 n = T or U 221
aaccacnngg cangnngaa 19 222 19 DNA Artificial Sequence based on
Homo sapiens. Each nucleobase may be part of a ribonucleotide,
deoxyribonucleotide, or nucleotide analog misc_feature 5, 8, 15, 16
n = T or U 222 caagnacnca caccnngga 19 223 19 DNA Artificial
Sequence based on Homo sapiens. Each nucleobase may be part of a
ribonucleotide, deoxyribonucleotide, or nucleotide analog
misc_feature 3, 5, 8, 9, 10, 13, 14, 16, 17, 19 n = T or U 223
ccngnccnnn aanncnnan 19 224 19 DNA Artificial Sequence based on
Homo sapiens. Each nucleobase may be part of a ribonucleotide,
deoxyribonucleotide, or nucleotide analog misc_feature 1, 6, 7, 14,
19 n = T or U 224 ngaacnngac ggangaacn 19 225 19 DNA Artificial
Sequence based on Homo sapiens. Each nucleobase may be part of a
ribonucleotide, deoxyribonucleotide, or nucleotide analog
misc_feature 1, 5, 11, 15, 19 n = T or U 225 nagangaggg naacnggcn
19 226 19 DNA Artificial Sequence based on Homo sapiens. Each
nucleobase may be part of a ribonucleotide, deoxyribonucleotide, or
nucleotide analog misc_feature 1, 5, 12, 14, 15 n = T or U 226
ngganagcag cngnncaag 19 227 19 DNA Artificial Sequence based on
Homo sapiens. Each nucleobase may be part of a ribonucleotide,
deoxyribonucleotide, or nucleotide analog misc_feature 3, 4, 5, 6,
9, 11, 14, 19 n = T or U 227 cannnncanc nccngggcn 19 228 19 DNA
Artificial Sequence based on Homo sapiens. Each nucleobase may be
part of a ribonucleotide, deoxyribonucleotide, or nucleotide analog
misc_feature 1, 5, 8, 9, 12, 16, 18 n = T or U 228 ngganaanng
angacncng 19 229 19 DNA Artificial Sequence based on Homo sapiens.
Each nucleobase may be part of a ribonucleotide,
deoxyribonucleotide, or nucleotide analog misc_feature 2, 4, 5, 7,
13, 14 n = T or U 229 gncnncncca ggnncaaaa 19 230 19 DNA Artificial
Sequence based on Homo sapiens. Each nucleobase may be part of a
ribonucleotide, deoxyribonucleotide, or nucleotide analog
misc_feature 1, 3, 4, 7, 10, 13, 14, 18 n = T or U 230 nanncancan
ganngcanc 19 231 19 DNA Artificial Sequence based on Homo sapiens.
Each nucleobase may be part of a ribonucleotide,
deoxyribonucleotide, or nucleotide analog misc_feature 3, 4, 5, 17,
18 n = T or U 231 cannnccacg gcagcanna 19 232 19 DNA Artificial
Sequence based on Homo sapiens. Each nucleobase may be part of a
ribonucleotide, deoxyribonucleotide, or nucleotide analog
misc_feature 7, 8, 10, 13 n = T or U 232 ccaggcnncn acnaaagcc 19
233 19 DNA Artificial Sequence based on Homo sapiens. Each
nucleobase may be part of a ribonucleotide, deoxyribonucleotide, or
nucleotide analog misc_feature 3, 8, 9, 10, 11, 12, 14, 16 n = T or
U 233 gcnaggannn nncncngaa 19 234 19 DNA Artificial Sequence based
on Homo sapiens. Each nucleobase may be part of a ribonucleotide,
deoxyribonucleotide, or nucleotide analog misc_feature 1, 3, 5, 8,
9, 11, 13, 18, 19 n = T or U 234 ncnanaannc ncnccagnn 19 235 19 DNA
Artificial Sequence based on Homo sapiens. Each nucleobase may be
part of a ribonucleotide, deoxyribonucleotide, or nucleotide analog
misc_feature 9, 12, 13, 17 n = T or U 235 acacaaganc anngacnag 19
236 19 DNA Artificial Sequence based on Homo sapiens. Each
nucleobase may be part of a ribonucleotide, deoxyribonucleotide, or
nucleotide analog misc_feature 1, 3, 7, 8, 12, 16, 18 n = T or U
236 ncngcannga gnaagncna 19 237 19 DNA Artificial Sequence based on
Homo sapiens. Each nucleobase may be part of a ribonucleotide,
deoxyribonucleotide, or nucleotide analog misc_feature 2, 4, 5, 9,
10, 12, 13, 14, 17, 19 n = T or U 237 cncnncccnn annncancn 19 238
19 DNA Artificial Sequence based on Homo sapiens. Each nucleobase
may be part of a ribonucleotide, deoxyribonucleotide, or nucleotide
analog misc_feature 1, 4, 8, 9, 12, 14, 15, 16, 18 n = T or U 238
nccncagnng cncnnncnc 19 239 19 DNA Artificial Sequence based on
Homo sapiens. Each nucleobase may be part of a ribonucleotide,
deoxyribonucleotide, or nucleotide analog misc_feature 5, 6, 8, 10,
11, 13, 14 n = T or U 239 gccanncnan ncnnccgga 19 240 19 DNA
Artificial Sequence based on Homo sapiens. Each nucleobase may be
part of a ribonucleotide, deoxyribonucleotide, or nucleotide analog
misc_feature 3, 8, 10, 11, 19 n = T or U 240 agncaaangn ngaaaaagn
19 241 19 DNA Artificial Sequence based on Homo sapiens. Each
nucleobase may be part of a ribonucleotide, deoxyribonucleotide, or
nucleotide analog misc_feature 7, 8, 13, 14 n = T or U 241
ccagganngg aannacaca 19 242 19 DNA Artificial Sequence based on
Homo sapiens. Each nucleobase may be part of a ribonucleotide,
deoxyribonucleotide, or nucleotide analog misc_feature 2, 3, 11,
12, 15 n = T or U 242 annccggcag nnagnagac 19 243 19 DNA Artificial
Sequence based on Homo sapiens. Each nucleobase may be part of a
ribonucleotide, deoxyribonucleotide, or nucleotide analog
misc_feature 1, 6, 9, 11, 12, 14, 15, 17, 18 n = T or U 243
naacancang nncnngnnc 19 244 19 DNA Artificial Sequence based on
Homo sapiens. Each nucleobase may be part of a ribonucleotide,
deoxyribonucleotide, or nucleotide analog misc_feature 2, 4, 6, 8,
10, 11, 13, 15, 16, 17 n = T or U 244 gncngngncn ncngnnnaa 19 245
19 DNA Artificial Sequence based on Homo sapiens. Each nucleobase
may be part of a ribonucleotide, deoxyribonucleotide, or nucleotide
analog misc_feature 1, 2, 4, 6, 7, 10, 11, 13 n = T or U 245
nncncnngcn ngnaaagac 19 246 19 DNA Artificial Sequence based on
Homo sapiens. Each nucleobase may be part of a ribonucleotide,
deoxyribonucleotide, or nucleotide analog misc_feature 2, 7, 10,
12, 16 n = T or U 246 cnaaaancgn ancaancag 19 247 19 DNA Artificial
Sequence based on Homo sapiens. Each nucleobase may be part of a
ribonucleotide, deoxyribonucleotide, or nucleotide analog
misc_feature 4, 9, 11, 12, 13, 16, 17, 18, 19 n = T or U 247
ggcngcaana nnnccnnnn 19 248 19 DNA Artificial Sequence based on
Homo sapiens. Each nucleobase may be part of a ribonucleotide,
deoxyribonucleotide, or nucleotide analog misc_feature 6, 7, 8, 10,
14, 19 n = T or U 248 gagagnnncn gaanacagn 19 249 19 DNA Artificial
Sequence based on Homo sapiens. Each nucleobase may be part of a
ribonucleotide, deoxyribonucleotide, or nucleotide analog
misc_feature 6, 7, 12, 13, 15, 16 n = T or U 249 acagcnncag
cnncnngca 19 250 19 DNA Artificial Sequence based on Homo sapiens.
Each nucleobase may be part of a ribonucleotide,
deoxyribonucleotide, or nucleotide analog misc_feature 4, 8, 11,
14, 16 n = T or U 250 aaanaaangc ncananaac 19 251 19 DNA Artificial
Sequence based on Homo sapiens. Each nucleobase may be part of a
ribonucleotide, deoxyribonucleotide, or nucleotide analog
misc_feature 7, 9, 10, 12, 14 n = T or U 251 gaaacancnn cngngggaa
19 252 19 DNA Artificial Sequence based on Homo sapiens. Each
nucleobase may be part of a ribonucleotide, deoxyribonucleotide, or
nucleotide analog misc_feature 2, 3, 5, 6, 11, 14, 18 n = T or U
252 gnncnnccac nggnaganc 19 253 19 DNA Artificial Sequence based on
Homo sapiens. Each nucleobase may be part of a ribonucleotide,
deoxyribonucleotide, or nucleotide analog misc_feature 2, 3, 5, 6,
8, 11, 13 n = T or U 253 cnncnngnag ncnccgcaa 19 254 19 DNA
Artificial Sequence based on Homo sapiens. Each nucleobase may be
part of a ribonucleotide, deoxyribonucleotide, or nucleotide analog
misc_feature 1, 2, 4, 8, 15, 16, 17 n = T or U 254 nngnccanac
acacnnnac 19 255 19 DNA Artificial Sequence based on Homo sapiens.
Each nucleobase may be part of a ribonucleotide,
deoxyribonucleotide, or
nucleotide analog misc_feature 8, 9, 14 n = T or U 255 aaccaaanna
gganaaaag 19 256 19 DNA Artificial Sequence based on Homo sapiens.
Each nucleobase may be part of a ribonucleotide,
deoxyribonucleotide, or nucleotide analog misc_feature 2, 4, 5, 8,
10, 13, 14, 15, 19 n = T or U 256 angnncanan ggnnnagan 19 257 19
DNA Artificial Sequence based on Homo sapiens. Each nucleobase may
be part of a ribonucleotide, deoxyribonucleotide, or nucleotide
analog misc_feature 1, 5, 6, 7, 8, 11, 12, 16, 17 n = T or U 257
naagnnnnac nncacnnac 19 258 19 DNA Artificial Sequence based on
Homo sapiens. Each nucleobase may be part of a ribonucleotide,
deoxyribonucleotide, or nucleotide analog misc_feature 2, 4, 5, 11,
13, 14, 17 n = T or U 258 angnncccgg nannagnac 19 259 19 DNA
Artificial Sequence based on Homo sapiens. Each nucleobase may be
part of a ribonucleotide, deoxyribonucleotide, or nucleotide analog
misc_feature 5, 10, 13, 14, 16, 18, 19 n = T or U 259 gggcncaagn
aanncncnn 19 260 19 DNA Artificial Sequence based on Homo sapiens.
Each nucleobase may be part of a ribonucleotide,
deoxyribonucleotide, or nucleotide analog misc_feature 9, 13, 14 n
= T or U 260 gcccaggang ganncaaac 19 261 19 DNA Artificial Sequence
based on Homo sapiens. DNA/RNA hybrid. 261 gagaagatga ctggtaaca 19
262 18 DNA Artificial Sequence based on Homo sapiens. DNA/RNA
hybrid misc_feature 1, 17, 18 n = T or U 262 ngtgctattc tgtgaann 18
263 20 DNA Artificial Sequence based on Homo sapiens. 263
tctgcttcaa ggagctggaa 20 264 18 DNA Artificial Sequence based on
Homo sapiens. 264 gaaaggaaag cgcaaccg 18 265 30 DNA Artificial
Sequence based on Homo sapiens. 265 agccagatga cgaccccata
gaggaacata 30 266 21 DNA Artificial Sequence based on Homo sapiens.
266 tggagatgat ccatgggttc a 21 267 29 DNA Artificial Sequence based
on Homo sapiens. 267 gaactcctgt cctttaattc ttatcaagt 29 268 27 DNA
Artificial Sequence based on Homo sapiens. 268 ctcacacctt
ggaaaccact tggcatg 27 269 27 DNA Artificial Sequence based on Homo
sapiens. 269 ggtgataaag taaagtgctt tcactgt 27 270 28 DNA Artificial
Sequence based on Homo sapiens. 270 tcagtagttc ttaccagaca ctcctcaa
28 271 34 DNA Artificial Sequence based on Homo sapiens. 271
caacatgcta aatggtatcc agggtgcaaa tatc 34 272 19 DNA Artificial
Sequence based on Homo sapiens. 272 gaaggtgaag gtcggagtc 19 273 19
DNA Artificial Sequence based on Homo sapiens. 273 gaagatggtg
atgggattc 19 274 20 DNA Artificial Sequence based on Homo sapiens.
274 caagcttccc gttctcagcc 20 275 19 DNA Artificial Sequence based
on Homo sapiens. Each nucleobase is part of a deoxyribonucleotide
or ribonucleotide. 275 cagagatttc atttaacgu 19 276 19 DNA
Artificial Sequence based on Homo sapiens. Each nucleobase may be
part of a deoxyribonucleotide or ribonucleotide 276 cuacgctcgc
catcgtuca 19 277 19 DNA Artificial Sequence based on Homo sapiens.
Each nucleobase is part of a deoxyribonucleotide or ribonucleotide
277 ugcccaagaa tactaguca 19 278 19 DNA Artificial Sequence based on
Homo sapiens. Each nucleobase may be part of a ribonucleotide,
deoxyribonucleotide, or nucleotide analog misc_feature 2, 4, 5, 7,
9, 10, 16 n = T or U 278 ancnncncnn gaaaanagg 19 279 19 DNA
Artificial Sequence based on Homo sapiens. Each nucleobase may be
part of a ribonucleotide, deoxyribonucleotide, or nucleotide analog
misc_feature 2, 4, 5, 7, 9, 10, 16 n = T or U 279 ancnncncnn
gaaaanagg 19 280 19 DNA Artificial Sequence based on Homo sapiens.
Each nucleobase may be part of a ribonucleotide,
deoxyribonucleotide, or nucleotide analog misc_feature 4, 10, 11,
13, 15, 16, 18 n = T or U 280 gganaaaagn ncncnncna 19 281 19 DNA
Artificial Sequence based on Homo sapiens. Each nucleobase may be
part of a ribonucleotide, deoxyribonucleotide, or nucleotide analog
misc_feature 3, 7, 9, 13, 15, 16 n = T or U 281 gcngagncnc
cananngcc 19 282 19 DNA Artificial Sequence based on Homo sapiens.
Each nucleobase may be part of a ribonucleotide,
deoxyribonucleotide, or nucleotide analog misc_feature 3, 7, 9, 13,
15, 16 n = T or U 282 gcngagncnc cananngcc 19 283 19 DNA Artificial
Sequence based on Homo sapiens. Each nucleobase may be part of a
ribonucleotide, deoxyribonucleotide, or nucleotide analog
misc_feature 4, 6, 7, 8, 15, 19 n = T or U 283 ggcncnnngc ccacngaan
19 284 19 DNA Artificial Sequence based on Homo sapiens. Each
nucleobase may be part of a ribonucleotide, deoxyribonucleotide, or
nucleotide analog misc_feature 5, 6, 8, 12 n = T or U 284
accanncngg anaccagaa 19 285 19 DNA Artificial Sequence based on
Homo sapiens. Each nucleobase may be part of a ribonucleotide,
deoxyribonucleotide, or nucleotide analog misc_feature 5, 6, 8, 12
n = T or U 285 accanncngg anaccagaa 19 286 19 DNA Artificial
Sequence based on Homo sapiens. Each nucleobase may be part of a
ribonucleotide, deoxyribonucleotide, or nucleotide analog
misc_feature 8, 12, 14, 15 n = T or U 286 aagaccanag gncnnacca 19
287 19 DNA Artificial Sequence based on Homo sapiens. Each
nucleobase may be part of a ribonucleotide, deoxyribonucleotide, or
nucleotide analog misc_feature 4, 5, 8, 13, 15, 17 n = T or U 287
gggnnccncg ggnanangg 19 288 19 DNA Artificial Sequence based on
Homo sapiens. Each nucleobase may be part of a ribonucleotide,
deoxyribonucleotide, or nucleotide analog misc_feature 3, 5, 7, 12,
15, 16 n = T or U 288 ggnananggc gnccnnggg 19 289 19 DNA Artificial
Sequence based on Homo sapiens. Each nucleobase may be part of a
ribonucleotide, deoxyribonucleotide, or nucleotide analog
misc_feature 3, 5, 7, 10, 11, 18 n = T or U 289 ggnancnccn
ncaccagna 19 290 19 DNA Artificial Sequence based on Homo sapiens.
Each nucleobase may be part of a ribonucleotide,
deoxyribonucleotide, or nucleotide analog misc_feature 2, 9, 10,
13, 15, 17 n = T or U 290 angaccacnn ccncnangg 19 291 19 DNA
Artificial Sequence based on Homo sapiens. Each nucleobase may be
part of a ribonucleotide, deoxyribonucleotide, or nucleotide analog
misc_feature 3, 4, 8, 9, 14, 16, 17 n = T or U 291 ganncacnnc
gaanannaa 19 292 19 DNA Artificial Sequence based on Homo sapiens.
Each nucleobase may be part of a ribonucleotide,
deoxyribonucleotide, or nucleotide analog misc_feature 3, 4, 6, 11,
12, 16, 17 n = T or U 292 aannanaacg nncacnnag 19 293 27 DNA
Artificial Sequence based on Homo sapiens. 293 ggtgataaag
taaagtgctt tcactgt 27 294 33 DNA Artificial Sequence based on Homo
sapiens. 294 caacatgcta aatggttcca gggtgcaaat atc 33 295 28 DNA
Artificial Sequence based on Homo sapiens. 295 tcagtagttc
ttaccagaca ctcctcaa 28 296 19 DNA Artificial Sequence based on Homo
sapiens. DNA/RNA hybrid. 296 uaagctgttc tatgtguuc 19 297 19 DNA
Artificial Sequence based on Homo sapiens. 297 aagggcggcg gagtgagac
19 298 19 DNA Artificial Sequence based on Homo sapiens. 298
agaggacgga gtcggaggc 19 299 19 DNA Artificial Sequence based on
Homo sapiens. 299 cggagcgtga ggatggaga 19 300 19 DNA Artificial
Sequence based on Homo sapiens. Each nucleobase may be part of a
ribonucleotide, deoxyribonucleotide, or nucleotide analog
misc_feature 18 n = T or U 300 agcaaggaca agcccagnc 19 301 19 DNA
Artificial Sequence based on Homo sapiens. Each nucleobase may be
part of a ribonucleotide, deoxyribonucleotide, or nucleotide analog
misc_feature 1, 3, 9, 12 n = T or U 301 ngnaaaccng cngcccaga 19 302
19 DNA Artificial Sequence based on Homo sapiens. Each nucleobase
may be part of a ribonucleotide, deoxyribonucleotide, or nucleotide
analog misc_feature 6, 9, 10, 11, 12, 15, 18, 19 n = T or U 302
agaagncgnn nnccnccnn 19 303 19 DNA Artificial Sequence based on
Homo sapiens. Each nucleobase may be part of a ribonucleotide,
deoxyribonucleotide, or nucleotide analog misc_feature 7, 8, 13, 17
n = T or U 303 ccgagannag acnaagncc 19 304 19 DNA Artificial
Sequence based on Homo sapiens. Each nucleobase may be part of a
ribonucleotide, deoxyribonucleotide, or nucleotide analog
misc_feature 3, 4, 5, 6, 9, 10, 11, 13, 14, 15 n = T or U 304
acnnnnccnn nannnccac 19 305 19 DNA Artificial Sequence based on
Homo sapiens. Each nucleobase may be part of a ribonucleotide,
deoxyribonucleotide, or nucleotide analog misc_feature 1, 14, 17,
19 n = T or U 305 ncccaaacac aggnacnan 19 306 19 DNA Artificial
Sequence based on Homo sapiens. Each nucleobase may be part of a
ribonucleotide, deoxyribonucleotide, or nucleotide analog
misc_feature 3, 4, 6, 13 n = T or U 306 canncncagc ggnaacagc 19 307
19 DNA Artificial Sequence based on Homo sapiens. Each nucleobase
may be part of a ribonucleotide, deoxyribonucleotide, or nucleotide
analog misc_feature 5, 8, 9, 11, 14, 17 n = T or U 307 accancannc
ncanccnca 19 308 19 DNA Artificial Sequence based on Homo sapiens.
Each nucleobase may be part of a ribonucleotide,
deoxyribonucleotide, or nucleotide analog misc_feature 3, 5, 10,
11, 18 n = T or U 308 aangnaaccn ncaaccanc 19 309 18 DNA Artificial
Sequence based on Homo sapiens. Each nucleobase may be part of a
ribonucleotide, deoxyribonucleotide, or nucleotide analog
misc_feature 1, 2, 3, 5, 7, 8, 11, 15, 17 n = T or U 309 nnngnannca
ncacngnc 18 310 18 DNA Artificial Sequence based on Homo sapiens.
Each nucleobase may be part of a ribonucleotide,
deoxyribonucleotide, or nucleotide analog misc_feature 1, 6, 8, 11,
12 n = T or U 310 ncacancnca nnaccaac 18 311 19 DNA Artificial
Sequence based on Homo sapiens. Each nucleobase may be part of a
ribonucleotide, deoxyribonucleotide, or nucleotide analog
misc_feature 6 n = T or U 311 ccaggnggca ggagaaaca 19 312 19 DNA
Artificial Sequence based on Homo sapiens. Each nucleobase may be
part of a ribonucleotide, deoxyribonucleotide, or nucleotide analog
misc_feature 1, 8, 9, 13, 16, 17, 18 n = T or U 312 ngcagacnnc
aangcnnng 19 313 19 DNA Artificial Sequence based on Homo sapiens.
Each nucleobase may be part of a ribonucleotide,
deoxyribonucleotide, or nucleotide analog misc_feature 1, 9, 13,
15, 19 n = T or U 313 naagcaagnc acngnggcn 19 314 19 DNA Artificial
Sequence based on Homo sapiens. Each nucleobase may be part of a
ribonucleotide, deoxyribonucleotide, or nucleotide analog
misc_feature 2, 6, 10, 13, 16 n = T or U 314 cngagncgan aanacnagc
19 315 19 DNA Artificial Sequence based on Homo sapiens. Each
nucleobase may be part of a ribonucleotide, deoxyribonucleotide, or
nucleotide analog misc_feature 3, 9, 10, 13 n = T or U 315
acnagccann agnaaagag 19 316 19 DNA Artificial Sequence based on
Homo sapiens. Each nucleobase may be part of a ribonucleotide,
deoxyribonucleotide, or nucleotide analog misc_feature 15, 16, 18 n
= T or U 316 caacagcaga gaccnngnc 19 317 19 DNA Artificial Sequence
based on Homo sapiens. Each nucleobase may be part of a
ribonucleotide, deoxyribonucleotide, or nucleotide analog
misc_feature 2, 7, 11, 12 n = T or U 317 anagcanacc nngaaccag 19
318 19 DNA Artificial Sequence based on Homo sapiens. Each
nucleobase may be part of a ribonucleotide, deoxyribonucleotide, or
nucleotide analog misc_feature 3, 5, 7, 12, 17 n = T or U 318
cancngnagg cnaagangg 19 319 19 DNA Artificial Sequence based on
Homo sapiens. Each nucleobase may be part of a ribonucleotide,
deoxyribonucleotide, or nucleotide analog misc_feature 3, 4, 11,
16, 18 n = T or U 319 agnnaccaga ngccancng 19 320 19 DNA Artificial
Sequence based on Homo sapiens. Each nucleobase may be part of a
ribonucleotide, deoxyribonucleotide, or nucleotide analog
misc_feature 3, 5, 8, 10, 13, 16 n = T or U 320 aancnacncn
ganagngga 19 321 19 DNA Artificial Sequence based on Homo sapiens.
Each nucleobase may be part of a ribonucleotide,
deoxyribonucleotide, or nucleotide analog misc_feature 2, 3, 4, 6,
17 n = T or U 321 gnnncngaag ccaacanca 19 322 19 DNA Artificial
Sequence based on Homo sapiens. Each nucleobase may be part of a
ribonucleotide, deoxyribonucleotide, or nucleotide analog
misc_feature 1, 6, 7, 9, 14, 17 n = T or U 322 ncaacnnanc accnccnga
19 323 19 DNA Artificial Sequence based on Homo sapiens. Each
nucleobase may be part of a ribonucleotide, deoxyribonucleotide, or
nucleotide analog misc_feature 7, 12, 13, 15 n = T or U 323
aagaacnaac anngnagag 19 324 19 DNA Artificial Sequence based on
Homo sapiens. Each nucleobase may be part of a ribonucleotide,
deoxyribonucleotide, or nucleotide analog misc_feature 2, 13, 16 n
= T or U 324 gnagacaaca ggngcngca 19 325 19 DNA Artificial Sequence
based on Homo sapiens. Each nucleobase may be part of a
ribonucleotide, deoxyribonucleotide, or nucleotide analog
misc_feature 2, 4, 7, 9, 11, 14, 15, 17 n = T or U 325 angnccncng
naannangg 19 326 19 DNA Artificial Sequence based on Homo sapiens.
Each nucleobase may be part of a ribonucleotide,
deoxyribonucleotide, or nucleotide analog misc_feature 1, 4, 5, 9,
16 n = T or U 326 nacnnggcna gaacangga 19 327 19 DNA Artificial
Sequence based on Homo sapiens. Each nucleobase may be part of a
ribonucleotide, deoxyribonucleotide, or nucleotide analog
misc_feature 9, 13, 15, 16 n = T or U 327 gaagcaacnc aangnnaag 19
328 19 DNA Artificial Sequence based on Homo sapiens. Each
nucleobase may be part of a ribonucleotide, deoxyribonucleotide, or
nucleotide analog misc_feature 1, 2, 3, 6, 8, 9, 10, 11, 16 n = T
or U 328 nnnggncnnn nggacncag 19 329 19 DNA Artificial Sequence
based on Homo sapiens. Each nucleobase may be part of a
ribonucleotide, deoxyribonucleotide, or nucleotide analog
misc_feature 4, 8, 11, 18 n = T or U 329 ccanaganca ncaggaana 19
330 19 DNA Artificial Sequence based on Homo sapiens. Each
nucleobase may be part of a ribonucleotide, deoxyribonucleotide, or
nucleotide analog misc_feature 7, 11, 18 n = T or U 330 caggacnggc
naacacanc
19 331 19 DNA Artificial Sequence based on Homo sapiens. Each
nucleobase may be part of a ribonucleotide, deoxyribonucleotide, or
nucleotide analog misc_feature 1, 2, 3, 6, 15, 17 n = T or U 331
nnnaanggca ggcancncc 19 332 19 DNA Artificial Sequence based on
Homo sapiens. Each nucleobase may be part of a ribonucleotide,
deoxyribonucleotide, or nucleotide analog misc_feature 1, 2, 9, 15
n = T or U 332 nnaagccanc aggangcca 19 333 19 DNA Artificial
Sequence based on Homo sapiens. Each nucleobase may be part of a
ribonucleotide, deoxyribonucleotide, or nucleotide analog
misc_feature 3, 10, 15, 17, 19 n = T or U 333 gcnacagagn aagcngngn
19 334 19 DNA Artificial Sequence based on Homo sapiens. Each
nucleobase may be part of a ribonucleotide, deoxyribonucleotide, or
nucleotide analog misc_feature 2, 4, 12, 15, 16, 17, 18 n = T or U
334 cncnagggag gnagnnnng 19 335 19 DNA Artificial Sequence based on
Homo sapiens. Each nucleobase may be part of a ribonucleotide,
deoxyribonucleotide, or nucleotide analog misc_feature 13, 18, 19 n
= T or U 335 aagaaaaggg acnagccnn 19 336 19 DNA Artificial Sequence
based on Homo sapiens. Each nucleobase may be part of a
ribonucleotide, deoxyribonucleotide, or nucleotide analog
misc_feature 4, 5, 10, 17 n = T or U 336 cagnncacan gacaagncg 19
337 19 DNA Artificial Sequence based on Homo sapiens. Each
nucleobase may be part of a ribonucleotide, deoxyribonucleotide, or
nucleotide analog misc_feature 4, 7, 8, 9, 11 n = T or U 337
gacnccnnnc ngagacagg 19 338 19 DNA Artificial Sequence based on
Homo sapiens. Each nucleobase may be part of a ribonucleotide,
deoxyribonucleotide, or nucleotide analog misc_feature 2, 3, 12,
14, 17 n = T or U 338 anncacacca gngnaanag 19 339 19 DNA Artificial
Sequence based on Homo sapiens. Each nucleobase may be part of a
ribonucleotide, deoxyribonucleotide, or nucleotide analog
misc_feature 9, 10, 11, 16, 17, 19 n = T or U 339 cagaagcann
ngaccnngn 19 340 19 DNA Artificial Sequence based on Homo sapiens.
Each nucleobase may be part of a ribonucleotide,
deoxyribonucleotide, or nucleotide analog misc_feature 7 n = T or U
340 ccagcancag gccacaaca 19 341 19 DNA Artificial Sequence based on
Homo sapiens. Each nucleobase may be part of a ribonucleotide,
deoxyribonucleotide, or nucleotide analog misc_feature 1, 2, 3, 7,
13, 15, 17 n = T or U 341 nnncagnagg acngncncc 19 342 19 DNA
Artificial Sequence based on Homo sapiens. Each nucleobase may be
part of a ribonucleotide, deoxyribonucleotide, or nucleotide analog
misc_feature 1, 7, 12, 18, 19 n = T or U 342 ngcagcnagg anacaacnn
19 343 19 DNA Artificial Sequence based on Homo sapiens. Each
nucleobase may be part of a ribonucleotide, deoxyribonucleotide, or
nucleotide analog misc_feature 6, 10, 11, 17, 18 n = T or U 343
agaggnagcn nccaagnng 19 344 19 DNA Artificial Sequence based on
Homo sapiens. Each nucleobase may be part of a ribonucleotide,
deoxyribonucleotide, or nucleotide analog misc_feature 5, 8, 12,
14, 16 n = T or U 344 gaagnaanga gngngngga 19 345 19 DNA Artificial
Sequence based on Homo sapiens. Each nucleobase may be part of a
ribonucleotide, deoxyribonucleotide, or nucleotide analog
misc_feature 4, 5, 6, 9, 16, 17, 18 n = T or U 345 ggannngang
gagagnnng 19 346 19 DNA Artificial Sequence based on Homo sapiens.
Each nucleobase may be part of a ribonucleotide,
deoxyribonucleotide, or nucleotide analog misc_feature 5, 6, 8, 11
n = T or U 346 gaacnncnca ncaaggcag 19 347 19 DNA Artificial
Sequence based on Homo sapiens. Each nucleobase may be part of a
ribonucleotide, deoxyribonucleotide, or nucleotide analog
misc_feature 4, 7, 9, 11, 14 n = T or U 347 aggnccnang nagnaaaag 19
348 19 DNA Artificial Sequence based on Homo sapiens. Each
nucleobase may be part of a ribonucleotide, deoxyribonucleotide, or
nucleotide analog misc_feature 4, 5, 6, 7 n = T or U 348 caannnncca
ccacaggca 19 349 19 DNA Artificial Sequence based on Homo sapiens.
Each nucleobase may be part of a ribonucleotide,
deoxyribonucleotide, or nucleotide analog misc_feature 3, 4, 6, 9,
10, 14, 15 n = T or U 349 cannanccnn cggnnccca 19 350 19 DNA
Artificial Sequence based on Homo sapiens. Each nucleobase may be
part of a ribonucleotide, deoxyribonucleotide, or nucleotide analog
misc_feature 2, 7, 9, 10, 12, 17 n = T or U 350 cncaggngnn
cngacanag 19 351 19 DNA Artificial Sequence based on Homo sapiens.
Each nucleobase may be part of a ribonucleotide,
deoxyribonucleotide, or nucleotide analog misc_feature 3, 8, 9, 16,
18 n = T or U 351 gcncaganna gaaacngng 19 352 19 DNA Artificial
Sequence based on Homo sapiens. Each nucleobase may be part of a
ribonucleotide, deoxyribonucleotide, or nucleotide analog
misc_feature 2, 6, 8, 10, 12, 16, 19 n = T or U 352 cngcangngn
cngcangcn 19 353 19 DNA Artificial Sequence based on Homo sapiens.
Each nucleobase may be part of a ribonucleotide,
deoxyribonucleotide, or nucleotide analog misc_feature 1, 2, 6, 14
n = T or U 353 nnaacnagaa cacnagagg 19 354 19 DNA Artificial
Sequence based on Homo sapiens. Each nucleobase may be part of a
ribonucleotide, deoxyribonucleotide, or nucleotide analog
misc_feature 3, 6, 19 n = T or U 354 canaanaaaa acccgcacn 19 355 19
DNA Artificial Sequence based on Homo sapiens. Each nucleobase may
be part of a ribonucleotide, deoxyribonucleotide, or nucleotide
analog misc_feature 6 n = T or U 355 caccancaca gcaaaagca 19 356 19
DNA Artificial Sequence based on Homo sapiens. Each nucleobase may
be part of a ribonucleotide, deoxyribonucleotide, or nucleotide
analog misc_feature 2, 8, 9, 19 n = T or U 356 cnccagannc ccaacaccn
19 357 19 DNA Artificial Sequence based on Homo sapiens. Each
nucleobase may be part of a ribonucleotide, deoxyribonucleotide, or
nucleotide analog misc_feature 10, 11, 16, 18, 19 n = T or U 357
ggaaaccacn nggcangnn 19 358 19 DNA Artificial Sequence based on
Homo sapiens. Each nucleobase may be part of a ribonucleotide,
deoxyribonucleotide, or nucleotide analog misc_feature 2, 3, 8, 12,
18 n = T or U 358 gnncaagnag angagggna 19 359 19 DNA Artificial
Sequence based on Homo sapiens. Each nucleobase may be part of a
ribonucleotide, deoxyribonucleotide, or nucleotide analog
misc_feature 3, 6, 7, 10, 14, 16 n = T or U 359 ganaanngan
gacncngca 19 360 19 DNA Artificial Sequence based on Homo sapiens.
Each nucleobase may be part of a ribonucleotide,
deoxyribonucleotide, or nucleotide analog misc_feature 2, 5, 7, 8,
10, 16, 17 n = T or U 360 anggncnncn ccaggnnca 19 361 19 DNA
Artificial Sequence based on Homo sapiens. Each nucleobase may be
part of a ribonucleotide, deoxyribonucleotide, or nucleotide analog
misc_feature 4, 5, 8, 17, 19 n = T or U 361 gcannaanca caggggnan 19
362 19 DNA Artificial Sequence based on Homo sapiens. Each
nucleobase may be part of a ribonucleotide, deoxyribonucleotide, or
nucleotide analog misc_feature 1, 10, 11, 12 n = T or U 362
naaagcccan nnccacggc 19 363 19 DNA Artificial Sequence based on
Homo sapiens. Each nucleobase may be part of a ribonucleotide,
deoxyribonucleotide, or nucleotide analog misc_feature 1, 2, 9, 15
n = T or U 363 nnaagccanc aggangcca 19 364 19 DNA Artificial
Sequence based on Homo sapiens. Each nucleobase may be part of a
ribonucleotide, deoxyribonucleotide, or nucleotide analog
misc_feature 3, 4, 5, 6, 7, 9, 11, 16, 18 n = T or U 364 gannnnncnc
ngaacngnc 19 365 19 DNA Artificial Sequence based on Homo sapiens.
Each nucleobase may be part of a ribonucleotide,
deoxyribonucleotide, or nucleotide analog misc_feature 2, 4, 7, 8,
10, 12, 17, 18 n = T or U 365 cnanaanncn cnccagnng 19 366 19 DNA
Artificial Sequence based on Homo sapiens. Each nucleobase may be
part of a ribonucleotide, deoxyribonucleotide, or nucleotide analog
misc_feature 9, 12, 13, 17 n = T or U 366 acacaaganc anngacnag 19
367 19 DNA Artificial Sequence based on Homo sapiens. Each
nucleobase may be part of a ribonucleotide, deoxyribonucleotide, or
nucleotide analog misc_feature 1, 3, 7, 8, 12, 16, 18 n = T or U
367 ncngcannga gnaagncna 19 368 19 DNA Artificial Sequence based on
Homo sapiens. Each nucleobase may be part of a ribonucleotide,
deoxyribonucleotide, or nucleotide analog misc_feature 1, 3, 4, 5,
6, 7, 10, 14, 15, 18 n = T or U 368 ncnnnnnccn cagnngcnc 19 369 19
DNA Artificial Sequence based on Homo sapiens. Each nucleobase may
be part of a ribonucleotide, deoxyribonucleotide, or nucleotide
analog misc_feature 2, 7, 8, 10, 12, 13, 15, 16 n = T or U 369
gngccanncn anncnnccg 19 370 19 DNA Artificial Sequence based on
Homo sapiens. Each nucleobase may be part of a ribonucleotide,
deoxyribonucleotide, or nucleotide analog misc_feature 2, 7, 9, 16,
17 n = T or U 370 gnagacnanc cagganngg 19 371 19 DNA Artificial
Sequence based on Homo sapiens. Each nucleobase may be part of a
ribonucleotide, deoxyribonucleotide, or nucleotide analog
misc_feature 3, 4, 6, 8, 9, 12, 13, 15 n = T or U 371 agnncncnng
cnngnaaag 19 372 19 DNA Artificial Sequence based on Homo sapiens.
Each nucleobase may be part of a ribonucleotide,
deoxyribonucleotide, or nucleotide analog misc_feature 1, 4, 6, 10,
14, 15, 17, 19 n = T or U 372 ncgnancaan cagnncncn 19 373 19 DNA
Artificial Sequence based on Homo sapiens. Each nucleobase may be
part of a ribonucleotide, deoxyribonucleotide, or nucleotide analog
misc_feature 9, 10, 11, 13, 17 n = T or U 373 gcagagagnn ncngaanac
19 374 19 DNA Artificial Sequence based on Homo sapiens. Each
nucleobase may be part of a ribonucleotide, deoxyribonucleotide, or
nucleotide analog misc_feature 2, 4, 7, 9, 10, 18 n = T or U 374
angnccngnn gcacaaana 19 375 19 DNA Artificial Sequence based on
Homo sapiens. Each nucleobase may be part of a ribonucleotide,
deoxyribonucleotide, or nucleotide analog misc_feature 2, 9, 11,
12, 14, 16 n = T or U 375 cngaaacanc nncngnggg 19 376 19 DNA
Artificial Sequence based on Homo sapiens. Each nucleobase may be
part of a ribonucleotide, deoxyribonucleotide, or nucleotide analog
misc_feature 1, 2, 3, 5, 6, 8, 9, 11, 14, 16 n = T or U 376
nnncnncnng nagncnccg 19 377 19 DNA Artificial Sequence based on
Homo sapiens. Each nucleobase may be part of a ribonucleotide,
deoxyribonucleotide, or nucleotide analog misc_feature 2, 3, 5, 6,
7, 9, 13 n = T or U 377 cnncnnngnc canacacac 19 378 19 DNA
Artificial Sequence based on Homo sapiens. Each nucleobase may be
part of a ribonucleotide, deoxyribonucleotide, or nucleotide analog
misc_feature 5, 12, 14 n = T or U 378 ggaanaaaca cnanggaca 19 379
19 DNA Artificial Sequence based on Homo sapiens. Each nucleobase
may be part of a ribonucleotide, deoxyribonucleotide, or nucleotide
analog misc_feature 3, 6, 9, 13 n = T or U 379 canacnacna gangaccac
19 380 19 DNA Artificial Sequence based on Homo sapiens. Each
nucleobase may be part of a ribonucleotide, deoxyribonucleotide, or
nucleotide analog misc_feature 1, 3, 8, 9, 12, 13, 15, 18 n = T or
U 380 ngnacccnng anngnacnc 19 381 19 DNA Artificial Sequence based
on Homo sapiens. Each nucleobase may be part of a ribonucleotide,
deoxyribonucleotide, or nucleotide analog misc_feature 5, 7, 14, 16
n = T or U 381 gaaangnacg aacngnacc 19 382 19 DNA Artificial
Sequence based on Homo sapiens. Each nucleobase may be part of a
ribonucleotide, deoxyribonucleotide, or nucleotide analog
misc_feature 3, 5, 6, 7, 8, 11, 12, 14, 15, 17, 18 n = T or U 382
gangnnnngg nncnncnnc 19 383 19 DNA Artificial Sequence based on
Homo sapiens. Each nucleobase may be part of a ribonucleotide,
deoxyribonucleotide, or nucleotide analog misc_feature 2, 4, 7, 8,
10, 12, 13, 16, 17, 18 n = T or U 383 cnancanncn cnnagnnnc 19 384
19 DNA Artificial Sequence based on Homo sapiens. Each nucleobase
may be part of a ribonucleotide, deoxyribonucleotide, or nucleotide
analog misc_feature 6, 10, 11, 14, 16, 17 n = T or U 384 acaccnggcn
ncangnncc 19 385 19 DNA Artificial Sequence based on Homo sapiens.
Each nucleobase may be part of a ribonucleotide,
deoxyribonucleotide, or nucleotide analog misc_feature 4, 14 n = T
or U 385 gacnacaggc acanaccac 19 386 19 DNA Artificial Sequence
based on Homo sapiens. Each nucleobase may be part of a
ribonucleotide, deoxyribonucleotide, or nucleotide analog
misc_feature 1, 5, 11, 17 n = T or U 386 ngccncagcc ngggacnac 19
387 19 DNA Artificial Sequence based on Homo sapiens. Each
nucleobase may be part of a ribonucleotide, deoxyribonucleotide, or
nucleotide analog misc_feature 5, 9, 10, 16, 19 n = T or U 387
agganggann caaacnccn 19 388 19 DNA Artificial Sequence based on
Homo sapiens. Each nucleobase may be part of a ribonucleotide,
deoxyribonucleotide, or nucleotide analog misc_feature 7, 9, 11,
15, 18 n = T or U 388 gagaaangng ncccnggng 19 389 19 DNA Artificial
Sequence based on Homo sapiens. Each nucleobase may be part of a
ribonucleotide, deoxyribonucleotide, or nucleotide analog
misc_feature 16, 17, 18 n = T or U 389 gccacaacag aagcannng 19 390
19 DNA Artificial Sequence based on Homo sapiens. Each nucleobase
may be part of a ribonucleotide, deoxyribonucleotide, or nucleotide
analog misc_feature 1, 2, 4, 11, 13, 14, 18 n = T or U 390
nncngaaaac ncnncaang 19 391 19 DNA Artificial Sequence based on
Homo sapiens. Each nucleobase may be part of a ribonucleotide,
deoxyribonucleotide, or nucleotide analog misc_feature 2, 3, 8, 13,
15, 19 n = T or U 391 cnnagcanaa agnancagn 19 392 19 DNA Artificial
Sequence based on Homo sapiens. Each nucleobase may be part of a
ribonucleotide, deoxyribonucleotide, or nucleotide analog
misc_feature 9, 12, 15, 16 n = T or U 392 caaaaaagna cngcnnagc 19
393 19 DNA Artificial Sequence based on Homo sapiens. Each
nucleobase may be part of a ribonucleotide, deoxyribonucleotide, or
nucleotide analog misc_feature 6, 12, 13, 15, 18, 19 n = T or U 393
caaganaaaa cnngnccnn 19 394 19 DNA Artificial
Sequence based on Homo sapiens. Each nucleobase may be part of a
ribonucleotide, deoxyribonucleotide, or nucleotide analog
misc_feature 1, 3, 7, 10, 12, 13, 15 n = T or U 394 nancagncan
gnngnaaac 19 395 19 DNA Artificial Sequence based on Homo sapiens.
Each nucleobase may be part of a ribonucleotide,
deoxyribonucleotide, or nucleotide analog misc_feature 2, 6, 11,
13, 14, 17 n = T or U 395 cnaaanaacc ngnncanca 19 396 19 DNA
Artificial Sequence based on Homo sapiens. Each nucleobase may be
part of a ribonucleotide, deoxyribonucleotide, or nucleotide analog
misc_feature 8, 9, 10, 11, 12, 17 n = T or U 396 agcacacnnn
nnacacngc 19 397 19 DNA Artificial Sequence based on Homo sapiens.
Each nucleobase may be part of a ribonucleotide,
deoxyribonucleotide, or nucleotide analog misc_feature 6, 8, 9, 11,
12, 14, 15, 18 n = T or U 397 accacnanna nncnnganc 19 398 19 DNA
Artificial Sequence based on Homo sapiens. Each nucleobase may be
part of a ribonucleotide, deoxyribonucleotide, or nucleotide analog
misc_feature 1, 3, 5, 6, 7, 9, 10, 11, 15, 16, 17 n = T or U 398
ngnannngnn nccannncc 19 399 19 DNA Artificial Sequence based on
Homo sapiens. Each nucleobase may be part of a ribonucleotide,
deoxyribonucleotide, or nucleotide analog misc_feature 3, 5, 10,
12, 14, 16, 17, 18 n = T or U 399 acngnaaacn cnancnnng 19 400 19
DNA Artificial Sequence based on Homo sapiens. Each nucleobase may
be part of a ribonucleotide, deoxyribonucleotide, or nucleotide
analog misc_feature 2, 3, 7, 12, 16, 17 n = T or U 400 cnnaagnggg
cnaaannac 19 401 19 DNA Artificial Sequence based on Homo sapiens.
Each nucleobase may be part of a ribonucleotide,
deoxyribonucleotide, or nucleotide analog misc_feature 3, 4, 7, 9,
12, 18 n = T or U 401 ccnncanang gncacacna 19 402 19 DNA Artificial
Sequence based on Homo sapiens. Each nucleobase may be part of a
ribonucleotide, deoxyribonucleotide, or nucleotide analog
misc_feature 3, 4, 11, 13 n = T or U 402 ggnnacaagc nangaagcc 19
403 19 DNA Artificial Sequence based on Homo sapiens. Each
nucleobase may be part of a ribonucleotide, deoxyribonucleotide, or
nucleotide analog misc_feature 2, 10, 12, 17 n = T or U 403
cnaagcaacn anagaanac 19 404 19 DNA Artificial Sequence based on
Homo sapiens. Each nucleobase may be part of a ribonucleotide,
deoxyribonucleotide, or nucleotide analog misc_feature 1, 4, 5, 8,
9, 10, 11, 12 n = T or U 404 nccnngannn nncacagag 19 405 19 DNA
Artificial Sequence based on Homo sapiens. Each nucleobase may be
part of a ribonucleotide, deoxyribonucleotide, or nucleotide analog
misc_feature 2, 5, 9, 10, 18 n = T or U 405 anacnaacnn aaagcccng 19
406 19 DNA Artificial Sequence based on Homo sapiens. Each
nucleobase may be part of a ribonucleotide, deoxyribonucleotide, or
nucleotide analog misc_feature 4, 5, 7, 10, 14, 16, 17, 18 n = T or
U 406 gggnngnagn aacncnnnc 19 407 19 DNA Artificial Sequence based
on Homo sapiens. Each nucleobase may be part of a ribonucleotide,
deoxyribonucleotide, or nucleotide analog misc_feature 1, 12, 14,
15, 16 n = T or U 407 nagaacacaa cncnnnggg 19 408 19 DNA Artificial
Sequence based on Homo sapiens. Each nucleobase may be part of a
ribonucleotide, deoxyribonucleotide, or nucleotide analog
misc_feature 2, 4, 8, 9, 10, 17 n = T or U 408 cncngaannn ccaaganac
19 409 19 DNA Artificial Sequence based on Homo sapiens. Each
nucleobase may be part of a ribonucleotide, deoxyribonucleotide, or
nucleotide analog misc_feature 1, 2, 3, 6, 10, 11, 12, 14, 16 n = T
or U 409 nnnacnggan nnancncag 19 410 19 DNA Artificial Sequence
based on Homo sapiens. Each nucleobase may be part of a
ribonucleotide, deoxyribonucleotide, or nucleotide analog
misc_feature 1, 5, 9, 15, 18 n = T or U 410 ngagnaggng acagngcng 19
411 19 DNA Artificial Sequence based on Homo sapiens. Each
nucleobase may be part of a ribonucleotide, deoxyribonucleotide, or
nucleotide analog misc_feature 9, 10, 11, 12, 14, 18 n = T or U 411
ggaggcagnn nngngcang 19 412 19 DNA Artificial Sequence based on
Homo sapiens. Each nucleobase may be part of a ribonucleotide,
deoxyribonucleotide, or nucleotide analog misc_feature 2, 4, 6, 7,
11, 12, 14, 17, 19 n = T or U 412 cnancnncca nnanacncn 19 413 19
DNA Artificial Sequence based on Homo sapiens. Each nucleobase may
be part of a ribonucleotide, deoxyribonucleotide, or nucleotide
analog misc_feature 1, 2, 4, 5, 6, 8, 9, 12, 14, 15, 16, 18 n = T
or U 413 nngnnngnng cngnnngnc 19 414 19 DNA Artificial Sequence
based on Homo sapiens. Each nucleobase may be part of a
ribonucleotide, deoxyribonucleotide, or nucleotide analog
misc_feature 1, 4, 5, 6, 8 n = T or U 414 nccnnncnga gacaggcac 19
415 19 DNA Artificial Sequence based on Homo sapiens. Each
nucleobase may be part of a ribonucleotide, deoxyribonucleotide, or
nucleotide analog misc_feature 18 n = T or U 415 accagcacga
gcaagacnc 19 416 19 DNA Artificial Sequence based on Homo sapiens.
Each nucleobase may be part of a ribonucleotide,
deoxyribonucleotide, or nucleotide analog misc_feature 4, 5, 7, 10,
11 n = T or U 416 accnngncan ncacaccag 19 417 19 DNA Artificial
Sequence based on Homo sapiens. Each nucleobase may be part of a
ribonucleotide, deoxyribonucleotide, or nucleotide analog
misc_feature 1, 6, 7, 9, 16 n = T or U 417 nccagnnanc cagcancag 19
418 19 DNA Artificial Sequence based on Homo sapiens. Each
nucleobase may be part of a ribonucleotide, deoxyribonucleotide, or
nucleotide analog misc_feature 3, 4, 5, 6, 10, 16, 18 n = T or U
418 gcnnnngaan aggacngnc 19 419 19 DNA Artificial Sequence based on
Homo sapiens. Each nucleobase may be part of a ribonucleotide,
deoxyribonucleotide, or nucleotide analog misc_feature 5, 7, 9, 10,
15, 18 n = T or U 419 gagangncnn caacngcnc 19 420 19 DNA Artificial
Sequence based on Homo sapiens. Each nucleobase may be part of a
ribonucleotide, deoxyribonucleotide, or nucleotide analog
misc_feature 5, 6, 9, 12, 16 n = T or U 420 ggggnnagnc cncgangaa 19
421 19 DNA Artificial Sequence based on Homo sapiens. Each
nucleobase may be part of a ribonucleotide, deoxyribonucleotide, or
nucleotide analog misc_feature 1, 4, 5, 9, 13, 15 n = T or U 421
ncanngcana acngnaggg 19 422 19 DNA Artificial Sequence based on
Homo sapiens. Each nucleobase may be part of a ribonucleotide,
deoxyribonucleotide, or nucleotide analog misc_feature 3, 5, 6, 12,
13, 15, 18 n = T or U 422 gcncnngcca anncngang 19 423 19 DNA
Artificial Sequence based on Homo sapiens. Each nucleobase may be
part of a ribonucleotide, deoxyribonucleotide, or nucleotide analog
misc_feature 5, 7, 9, 15, 18 n = T or U 423 acccnancnc caggnccna 19
424 19 DNA Artificial Sequence based on Homo sapiens. Each
nucleobase may be part of a ribonucleotide, deoxyribonucleotide, or
nucleotide analog misc_feature 16 n = T or U 424 acaggcaaag
caggcnacc 19 425 19 DNA Artificial Sequence based on Homo sapiens.
Each nucleobase may be part of a ribonucleotide,
deoxyribonucleotide, or nucleotide analog misc_feature 2, 3, 5, 10,
15, 18 n = T or U 425 gnncngacan agcancanc 19 426 19 DNA Artificial
Sequence based on Homo sapiens. Each nucleobase may be part of a
ribonucleotide, deoxyribonucleotide, or nucleotide analog
misc_feature 2, 8, 9, 10, 12, 19 n = T or U 426 cncagagnnn
cnagagaan 19 427 19 DNA Artificial Sequence based on Homo sapiens.
Each nucleobase may be part of a ribonucleotide,
deoxyribonucleotide, or nucleotide analog misc_feature 2, 4, 5, 7,
10, 11, 17 n = T or U 427 angnncncan ncgagcngc 19 428 19 DNA
Artificial Sequence based on Homo sapiens. Each nucleobase may be
part of a ribonucleotide, deoxyribonucleotide, or nucleotide analog
misc_feature 1, 6, 14, 18 n = T or U 428 ngaacnggaa cacnagang 19
429 19 DNA Artificial Sequence based on Homo sapiens. Each
nucleobase may be part of a ribonucleotide, deoxyribonucleotide, or
nucleotide analog misc_feature 3, 9, 14 n = T or U 429 gcncaggcng
aacnggaac 19 430 19 DNA Artificial Sequence based on Homo sapiens.
Each nucleobase may be part of a ribonucleotide,
deoxyribonucleotide, or nucleotide analog misc_feature 1, 2, 7, 10,
13, 14 n = T or U 430 nngacancan canngcgac 19 431 19 DNA Artificial
Sequence based on Homo sapiens. Each nucleobase may be part of a
ribonucleotide, deoxyribonucleotide, or nucleotide analog
misc_feature 5, 19 n = T or U 431 accancacaa caaaagcan 19 432 19
DNA Artificial Sequence based on Homo sapiens. Each nucleobase may
be part of a ribonucleotide, deoxyribonucleotide, or nucleotide
analog misc_feature 5, 6, 11, 13, 14, 16 n = T or U 432 ccacnnggca
ngnncnacc 19 433 19 DNA Artificial Sequence based on Homo sapiens.
Each nucleobase may be part of a ribonucleotide,
deoxyribonucleotide, or nucleotide analog misc_feature 1, 4, 6, 14
n = T or U 433 ncgnancaag aacncacac 19 434 19 DNA Artificial
Sequence based on Homo sapiens. Each nucleobase may be part of a
ribonucleotide, deoxyribonucleotide, or nucleotide analog
misc_feature 3, 5, 7, 12, 13 n = T or U 434 ggnancngaa gnngacaac 19
435 19 DNA Artificial Sequence based on Homo sapiens. Each
nucleobase may be part of a ribonucleotide, deoxyribonucleotide, or
nucleotide analog misc_feature 1, 2, 3, 5, 6, 8, 13, 16, 18 n = T
or U 435 nnncnncncc agnggnanc 19 436 19 DNA Artificial Sequence
based on Homo sapiens. Each nucleobase may be part of a
ribonucleotide, deoxyribonucleotide, or nucleotide analog
misc_feature 1, 2, 4, 10, 17 n = T or U 436 nncnccaggn ccaaaanga 19
437 19 DNA Artificial Sequence based on Homo sapiens. Each
nucleobase may be part of a ribonucleotide, deoxyribonucleotide, or
nucleotide analog misc_feature 7, 9, 10, 12 n = T or U 437
acagcancnn cngaagaac 19 438 19 DNA Artificial Sequence based on
Homo sapiens. Each nucleobase may be part of a ribonucleotide,
deoxyribonucleotide, or nucleotide analog misc_feature 7, 9, 11,
12, 15, 18 n = T or U 438 cacaggngna nncancang 19 439 19 DNA
Artificial Sequence based on Homo sapiens. Each nucleobase may be
part of a ribonucleotide, deoxyribonucleotide, or nucleotide analog
misc_feature 6, 8, 10, 12, 13 n = T or U 439 ccaggncncn annaaagcc
19 440 19 DNA Artificial Sequence based on Homo sapiens. Each
nucleobase may be part of a ribonucleotide, deoxyribonucleotide, or
nucleotide analog misc_feature 1, 2, 4, 6, 11, 12, 14 n = T or U
440 nncncnccag nngncagga 19 441 19 DNA Artificial Sequence based on
Homo sapiens. Each nucleobase may be part of a ribonucleotide,
deoxyribonucleotide, or nucleotide analog misc_feature 5, 8, 16, 18
n = T or U 441 gaagngcnga cacaananc 19 442 19 DNA Artificial
Sequence based on Homo sapiens. Each nucleobase may be part of a
ribonucleotide, deoxyribonucleotide, or nucleotide analog
misc_feature 1, 2, 3, 4, 7, 8, 10, 13, 16, 18 n = T or U 442
nnnnccnncn ccnccncnc 19 443 19 DNA Artificial Sequence based on
Homo sapiens. Each nucleobase may be part of a ribonucleotide,
deoxyribonucleotide, or nucleotide analog misc_feature 3, 5, 8, 13,
14, 15, 17, 18 n = T or U 443 cancngangc cannncnnc 19 444 19 DNA
Artificial Sequence based on Homo sapiens. Each nucleobase may be
part of a ribonucleotide, deoxyribonucleotide, or nucleotide analog
misc_feature 6, 7, 9, 11, 12, 14, 15 n = T or U 444 agccanncng
nncnnccga 19 445 19 DNA Artificial Sequence based on Homo sapiens.
Each nucleobase may be part of a ribonucleotide,
deoxyribonucleotide, or nucleotide analog misc_feature 7 n = T or U
445 ccagganagg aagcacaca 19 446 19 DNA Artificial Sequence based on
Homo sapiens. Each nucleobase may be part of a ribonucleotide,
deoxyribonucleotide, or nucleotide analog misc_feature 2, 5, 7, 11,
15, 16, 18 n = T or U 446 anggnancaa ncagnncnc 19 447 19 DNA
Artificial Sequence based on Homo sapiens. Each nucleobase may be
part of a ribonucleotide, deoxyribonucleotide, or nucleotide analog
misc_feature 9, 10, 11, 14, 15, 16 n = T or U 447 ccgcagcann
nccnnnaac 19 448 19 DNA Artificial Sequence based on Homo sapiens.
Each nucleobase may be part of a ribonucleotide,
deoxyribonucleotide, or nucleotide analog misc_feature 4, 5, 6, 7,
8, 14, 16, 17 n = T or U 448 cagnnnnnga agangnngg 19 449 19 DNA
Artificial Sequence based on Homo sapiens. Each nucleobase may be
part of a ribonucleotide, deoxyribonucleotide, or nucleotide analog
misc_feature 2, 11, 18 n = T or U 449 gngacagacc ngaaacanc 19 450
19 DNA Artificial Sequence based on Homo sapiens. Each nucleobase
may be part of a ribonucleotide, deoxyribonucleotide, or nucleotide
analog misc_feature 6, 7, 8, 9, 11, 12 n = T or U 450 gggcannnnc
nnagagaag 19 451 19 DNA Artificial Sequence based on Homo sapiens.
Each nucleobase may be part of a ribonucleotide,
deoxyribonucleotide, or nucleotide analog misc_feature 3, 8, 9, 12,
13, 15 n = T or U 451 agnacccnng annanaccc 19 452 19 DNA Artificial
Sequence based on Homo sapiens. Each nucleobase may be part of a
ribonucleotide, deoxyribonucleotide, or nucleotide analog
misc_feature 5, 7, 16 n = T or U 452 gaaangnacg aacagnacc 19 453 19
DNA Artificial Sequence based on Homo sapiens. Each nucleobase may
be part of a ribonucleotide, deoxyribonucleotide, or nucleotide
analog misc_feature 1, 9, 12, 15, 16 n = T or U 453 ngaaaaacnc
anaannccc 19 454 19 DNA Artificial Sequence based on Homo sapiens.
Each nucleobase may be part of a ribonucleotide,
deoxyribonucleotide, or nucleotide analog misc_feature 4, 6, 7, 8,
9 n = T or U 454 ccancnnnnc agaaacaag 19 455 19 DNA Artificial
Sequence based on Homo sapiens. Each nucleobase may be part of a
ribonucleotide, deoxyribonucleotide, or nucleotide analog
misc_feature 2, 4, 7, 8, 10, 12, 17, 18 n = T or U 455 cnanaanncn
cnccagnng 19 456 19 DNA Artificial Sequence based on Homo sapiens.
Each nucleobase may be part of a ribonucleotide,
deoxyribonucleotide, or nucleotide analog misc_feature 2, 6, 7, 11,
17 n = T or U 456 cncccnnagg nacacanac 19 457 19 DNA Artificial
Sequence based on Homo sapiens. Each nucleobase may be part of a
ribonucleotide, deoxyribonucleotide, or nucleotide analog
misc_feature 9, 15, 18 n = T or U 457 acaagcagng acacnacnc 19 458
19 DNA Artificial Sequence based on Homo sapiens. Each nucleobase
may be part of a ribonucleotide, deoxyribonucleotide, or nucleotide
analog misc_feature 2, 6, 9, 14, 17 n = T or U 458 gnaacnccng
aaangangc 19 459 19 DNA Artificial Sequence based on Homo sapiens.
Each nucleobase may be part of a ribonucleotide,
deoxyribonucleotide, or nucleotide analog misc_feature 8, 13, 17 n
= T or U 459 caacaaancc agnaacncc 19 460 19 DNA Artificial Sequence
based on Homo sapiens. Each nucleobase may be part of a
ribonucleotide, deoxyribonucleotide, or nucleotide analog
misc_feature 6, 10, 12, 15 n = T or U 460 caccanaacn cngangaac
19
* * * * *