U.S. patent application number 11/668337 was filed with the patent office on 2007-06-14 for systematic evolution of ligands by exponential enrichment: blended selex.
This patent application is currently assigned to GILEAD SCIENCES, INC.. Invention is credited to Greg Biesecker, Larry Gold, Sumedha D. Jayasena, Gary P. Kirschenheuter, Drew Smith.
Application Number | 20070134715 11/668337 |
Document ID | / |
Family ID | 27568758 |
Filed Date | 2007-06-14 |
United States Patent
Application |
20070134715 |
Kind Code |
A1 |
Biesecker; Greg ; et
al. |
June 14, 2007 |
SYSTEMATIC EVOLUTION OF LIGANDS BY EXPONENTIAL ENRICHMENT: BLENDED
SELEX
Abstract
A method is described for generating blended nucleic acid
ligands containing non-nucleic acid functional units. Specifically,
a SELEX identified RNA ligand to the integrin gpIIbIIIa is
conjugated to the peptide Gly-Arg-Gly-Asp-Thr-Pro (SEQ ID NO:1).
This blended RNA ligand inhibits the biological activity of
gpIIbIIIa with high specificity. Also described is a
single-stranded DNA ligand to elastase coupled to
N-methoxysuccinyl-Ala-Ala-Pro-Val-chloromethyl ketone (SEQ ID
NO:2). This elastase blended nucleic acid ligand inhibits the
biological activity of elastase.
Inventors: |
Biesecker; Greg; (Boulder,
CO) ; Jayasena; Sumedha D.; (Thousand Oaks, CA)
; Gold; Larry; (Boulder, CO) ; Smith; Drew;
(Boulder, CO) ; Kirschenheuter; Gary P.; (Arvada,
CO) |
Correspondence
Address: |
SWANSON & BRATSCHUN L.L.C.
1745 SHEA CENTER DRIVE
SUITE 330
HIGHLANDS RANCH
CO
80129
US
|
Assignee: |
GILEAD SCIENCES, INC.
333 Lakeside Drive
Foster City
CA
94404
|
Family ID: |
27568758 |
Appl. No.: |
11/668337 |
Filed: |
January 29, 2007 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10263456 |
Oct 2, 2002 |
7176295 |
|
|
11668337 |
Jan 29, 2007 |
|
|
|
09606477 |
Jun 29, 2000 |
6465189 |
|
|
10263456 |
Oct 2, 2002 |
|
|
|
08956699 |
Oct 23, 1997 |
6083696 |
|
|
09606477 |
Jun 29, 2000 |
|
|
|
08234997 |
Apr 28, 1994 |
5683867 |
|
|
08956699 |
Oct 23, 1997 |
|
|
|
08199507 |
Feb 22, 1994 |
5472841 |
|
|
08234997 |
Apr 28, 1994 |
|
|
|
08123935 |
Sep 17, 1993 |
|
|
|
08199507 |
Feb 22, 1994 |
|
|
|
08117991 |
Sep 8, 1993 |
|
|
|
08123935 |
Sep 17, 1993 |
|
|
|
07714131 |
Jun 10, 1991 |
5475096 |
|
|
08117991 |
Sep 8, 1993 |
|
|
|
07536428 |
Jun 11, 1990 |
|
|
|
07714131 |
Jun 10, 1991 |
|
|
|
Current U.S.
Class: |
435/6.11 ;
435/91.2 |
Current CPC
Class: |
A61K 47/64 20170801;
C12N 15/1048 20130101; C07K 19/00 20130101; C07K 5/1008 20130101;
C12P 19/34 20130101 |
Class at
Publication: |
435/006 ;
435/091.2 |
International
Class: |
C12Q 1/68 20060101
C12Q001/68; C12P 19/34 20060101 C12P019/34 |
Claims
1. A blended nucleic acid ligand of a target compound prepared by a
method comprising the steps of: a) identifying a nucleic acid
ligand of a target compound from a candidate mixture comprised of
nucleic acids each having a region of randomized sequence by a
method comprising: i) contacting the candidate mixture with the
target, wherein nucleic acids having an increased affinity to the
target relative to the candidate mixture may be partitioned from
the remainder of the candidate mixture; ii) partitioning the
increased affinity nucleic acids from the remainder of the
candidate mixture, and iii) amplifying the increased affinity
nucleic acids to yield a ligand-enriched mixture of nucleic acids,
whereby nucleic acid ligands of the target may be identified; and
b) attaching at least one functional unit to said nucleic acid
ligand to yield a blended nucleic acid ligand of the target
compound.
2. The blended nucleic acid ligand of claim 1 wherein said at least
one functional unit is attached to an oligonucleotide capable of
hybridizing to said nucleic acid ligand, and wherein step b) is
accomplished by hybridizing said oligonucleotide to said nucleic
acid ligand.
3. A diagnostic reagent comprising a blended nucleic acid ligand of
a target compound and a reporter molecule, wherein said diagnostic
reagent is prepared by a method comprising the steps of: a)
identifying a nucleic acid ligand of a target compound from a
candidate mixture comprised of nucleic acids each having a region
of randomized sequence by a method comprising: i) contacting the
candidate mixture with the target, wherein nucleic acids having an
increased affinity to the target relative to the candidate mixture;
ii) partitioning the increased affinity nucleic acids from the
remainder of the candidate mixture, and iii) amplifying the
increased affinity nucleic acids to yield a ligand-enriched mixture
of nucleic acids, whereby a nucleic acid ligand of the target
compound may be identified; b) attaching at least one functional
unit to said nucleic acid ligand to yield a blended nucleic, acid
ligand of the target compound; and c) attaching at least one
reporter molecule to said blended nucleic acid ligand, whereby a
diagnostic reagent is prepared.
4. The diagnostic reagent of claim 3 wherein said at least one
functional unit is attached to an oligonucleotide capable of
hybridizing to said nucleic acid ligand, and wherein step b) is
accomplished by hybridizing said oligonucleotide to said nucleic
acid ligand.
Description
RELATED APPLICATIONS
[0001] This application is a continuation of U.S. patent
application Ser. No. 10/263,456, filed Oct. 2, 2002, entitled
"Systematic Evolution of Ligands by Exponential Enrichment: Blended
SELEX," which is a continuation of U.S. patent application Ser. No.
09/606,477, now U.S. Pat. No. 6,465,189, filed Jun. 30, 2000,
entitled "Systematic Evolution of Ligands by Exponential
Enrichment: Blended SELEX," which is a continuation of U.S. patent
application Ser. No. 08/956,699, filed Oct. 23, 1997, now U.S. Pat.
No. 6,083,696, entitled "Systematic Evolution of Ligands by
Exponential Enrichment: Blended SELEX," which is a continuation of
U.S. patent application Ser. No. 08/234,997, filed Apr. 28, 1994,
now U.S. Pat. No. 5,683,867, entitled "Systematic Evolution of
Ligands by Exponential Enrichment: Blended SELEX," which is a
continuation-in-part of U.S. patent application Ser. No.
08/199,507, filed Feb. 22, 1994, entitled "Methods for Identifying
Nucleic Acid Ligands of Human Neutrophil Elastase," now U.S. Pat.
No. 5,472,841, which is a continuation-in-part of U.S. patent
application Ser. No. 08/123,935, filed Sep. 17, 1993, entitled
"Photoselection of Nucleic Acid Ligands," now abandoned, which is a
continuation-in-part of U.S. patent application Ser. No.
08/117,991, filed Sep. 8, 1993, entitled "High Affinity Nucleic
Acid Ligands Containing Modified Nucleotides," now abandoned, which
is a continuation-in-part of U.S. patent application Ser. No.
07/714,131, filed Jun. 10, 1991, entitled "Nucleic Acid Ligands,"
now U.S. Pat. No. 5,475,096, which was filed as a
continuation-in-part of U.S. patent application Ser. No.
07/536,428, filed Jun. 11, 1990, entitled "Systematic Evolution of
Ligands by Exponential Enrichment," now abandoned.
FIELD OF THE INVENTION
[0002] Described herein is a method of combining nucleic acids with
other functional units for generation of high affinity ligands. The
method of this invention takes advantage of the method for
identifying nucleic acid ligands referred to as SELEX. SELEX is an
acronym for Systematic Evolution of Ligands by EXponential
enrichment. The method presented herein is termed blended SELEX.
Examples of functional units that may be coupled to nucleic acids
include proteins, peptides, photoreactive groups,
chemically-reactive groups, active site directed compounds, lipids,
biotin, and fluorescent compounds. The blended nucleic acid ligands
of the present invention consist of at least one nucleic acid
ligand unit and at least one functional unit. The nucleic acid
ligand unit(s) of the blended nucleic acid ligand serve in whole or
in part as ligands to a given target. The functional unit(s) can be
designed to serve in a large variety of functions. For example, the
functional unit may independently or in combination with the
nucleic acid ligand have specific affinity for the target, and in
some cases may be a ligand to a different site of interaction with
the target than the nucleic acid ligand. The functional unit(s) may
be added which covalently react and couple the ligand to the target
molecule, catalytic groups may be added to aid in the selection of
protease or nuclease activity, and reporter molecules such as
biotin- or fluorescence-tagged oligonucleotides may be added for
use as diagnostic reagents.
BACKGROUND OF THE INVENTION
[0003] The SELEX method (hereinafter termed SELEX), was first
described in U.S. application Ser. No. 07/536,428, filed Jun. 11,
1990, entitled "Systematic Evolution of Ligands By Exponential
Enrichment," now abandoned. U.S. Pat. No. 5,475,096, entitled
"Nucleic Acid Ligands," and U.S. Pat. No. 5,270,163, entitled
"Methods for Identifying Nucleic Acid Ligands," further disclose
the basic SELEX process. Each of these applications are herein
specifically incorporated by reference. The SELEX process provides
a class of products which are referred to as nucleic acid ligands,
such ligands having a unique sequence, and which have the property
of binding specifically to a desired target compound or molecule.
Each SELEX-identified nucleic acid ligand is a specific ligand of a
given target compound or molecule. SELEX is based on the unique
insight that nucleic acids have sufficient capacity for forming a
variety of two- and three-dimensional structures and sufficient
chemical versatility available within their monomers to act as
ligands (form specific binding pairs) with virtually any chemical
compound, whether monomeric or polymeric. Molecules of any size can
serve as targets.
[0004] The SELEX method involves selection from a mixture of
candidates and step-wise iterations of binding, partitioning, and
amplification, using the same general selection theme, to achieve
virtually any desired criterion of binding affinity and
selectivity. Starting from a mixture of nucleic acids, preferably
comprising a segment of randomized sequence, the method includes
steps of contacting the mixture with the target under conditions
favorable for binding, partitioning unbound nucleic acids from
those nucleic acids which have bound to target molecules,
dissociating the nucleic acid-target pairs, amplifying the nucleic
acids dissociated from the nucleic acid-target pairs to yield a
ligand-enriched mixture of nucleic acids, then reiterating the
steps of binding, partitioning, dissociating and amplifying through
as many cycles as desired. A variety of techniques can be used to
partition members in the pool of nucleic acids that have a higher
affinity to the target than the bulk of the nucleic acids in the
mixture.
[0005] While not bound by theory, SELEX is based on the inventors'
insight that within a nucleic acid mixture containing a large
number of possible sequences and structures there is a wide range
of binding affinities for a given target. A nucleic acid mixture
comprising, for example, a 20 nucleotide randomized segment, can
have 4.sup.20 candidate possibilities. Those which have the higher
affinity constants for the target are most likely to bind to the
target. After partitioning, dissociation and amplification, a
second nucleic acid mixture is generated, enriched for the higher
binding affinity candidates. Additional rounds of selection
progressively favor the best ligands until the resulting nucleic
acid mixture is predominantly composed of only one or a few
sequences. These can then be cloned, sequenced and individually
tested for binding affinity as pure ligands.
[0006] Cycles of selection, partition and amplification are
repeated until a desired goal is achieved. In the most general
case, selection/partition/amplification is continued until no
significant improvement in binding strength is achieved on
repetition of the cycle. The method may be used to sample as many
as about 10.sup.18 different nucleic acid species. The nucleic
acids of the test mixture preferably include a randomized sequence
portion as well as conserved sequences necessary for efficient
amplification. Nucleic acid sequence variants can be produced in a
number of ways including synthesis of randomized nucleic acid
sequences and size selection from randomly cleaved cellular nucleic
acids. The variable sequence portion may contain fully or partially
random sequence; it may also contain subportions of conserved
sequence incorporated with randomized sequence. Sequence variation
in test nucleic acids can be introduced or increased by mutagenesis
before or during the selection/partition/amplification
iterations.
[0007] For target molecules which are nucleic acid binding
proteins, evolved SELEX ligands may be homologous to the natural
ligand since the nucleic acid binding protein target has evolved
naturally to present side-chain and/or main-chain atoms with the
correct geometry to interact with nucleic acids. Non-nucleic acid
binding proteins which have evolved to bind poly-anions such as
sulfated glycans (e.g., heparin), or to bind phospholipids or
phosphosugars, also have sites into which nucleic acids can fit and
make contacts analogous with the natural ligands and/or
substrates.
[0008] For certain target molecules where the natural ligand is not
a poly-anion, it can be more difficult (but still likely with
relatively more rounds of SELEX) to identify oligonucleotides that
fit into the substrate or ligand site. For instance, the binding
pocket of trypsin contains a carboxyl group which interacts during
catalysis with a lysine or arginine residue on the substrate. An
oligonucleotide may not fit into this specific catalytic site
because it would not contain a positively charged counter ion.
Basic SELEX evolution of oligonucleotide ligands to such a target
molecule may result in ligands to a site(s) distant from the
substrate site, since the probability of recovering ligands to the
substrate site may be low.
[0009] The basic SELEX method may be modified to achieve specific
objectives. For example, U.S. Pat. No. 5,707,796, entitled "Method
for Selecting Nucleic Acids on the Basis of Structure," describes
the use of SELEX in conjunction with gel electrophoresis to select
nucleic acid molecules with specific structural characteristics,
such as bent DNA. U.S. Pat. No. 5,763,177, entitled "Photoselection
of Nucleic Acid Ligands," describes a SELEX based method for
selecting nucleic acid ligands containing photoreactive groups
capable of binding and/or photocrosslinking to and/or
photoinactivating a target molecule. U.S. Pat. No. 5,580,737,
entitled "High-Affinity Nucleic Acid Ligands That Discriminate
Between Theophylline and Caffeine," describes a method for
identifying highly specific nucleic acid ligands able to
discriminate between closely related molecules, termed
"counter-SELEX". U.S. patent application Ser. No. 08/143,564, filed
Oct. 25, 1993, entitled "Systematic Evolution of Ligands by
EXponential Enrichment: Solution SELEX," now abandoned (See U.S.
Pat. No. 5,567,588), describes a SELEX-based method which achieves
highly efficient partitioning between oligonucleotides having high
and low affinity for a target molecule.
[0010] The SELEX method encompasses the identification of
high-affinity nucleic acid ligands containing modified nucleotides
conferring improved characteristics on the ligand, such as improved
in vivo stability or delivery. Examples of such modifications
include chemical substitutions at the ribose and/or phosphate
and/or base positions. Specific SELEX-identified nucleic acid
ligands containing modified nucleotides are described in U.S.
patent application Ser. No. 08/117,991, filed Sep. 8, 1993,
entitled "High Affinity Nucleic Acid Ligands Containing Modified
Nucleotides," now abandoned (See U.S. Pat. No. 5,660,985), that
describes oligonucleotides containing nucleotide derivatives
chemically modified at the 5- and 2'-positions of pyrimidines, as
well as specific RNA ligands to thrombin containing 2'-amino
modifications. U.S. patent application Ser. No. 08/117,911, supra,
describes highly specific nucleic acid ligands containing one or
more nucleotides modified with 2'-amino (2'-NH.sub.2), 2'-fluoro
(2'-F), and/or 2'-O-methyl (2'-OMe).
[0011] Members of the integrin superfamily of cell adhesion
receptors are known to recognize the peptide
arginine-glycine-aspartic acid sequence (RGD). Integrin gpIIbIIIa
is a protein expressed on activated platelets which mediates
platelet adhesion to fibrinogen and fibrin clots (Phillips et al.
(1988) Blood 71:831; Frojmovic et al. (1991) Blood 78:369). When
gpIIbIIIa binds a RGD-containing ligand, a signal is generated
which triggers platelet granule release, shape change, aggregation
and adhesion (Loftus et al. (1990) Science 249:915; Ware et al.
(1993) N. Eng. J. Med. 328:628). Inhibitors of gpIIbIIIa-mediated
platelet clot formation may have therapeutic potential in a variety
of vascular diseases including reducing the occurrence of heart
attacks following angioplasty.
[0012] Currently known integrin inhibitors are limited by a lack of
specificity. The development of a high specificity integrin
inhibitor which does not crossreact with other integrin proteins
would have significant therapeutic potential.
[0013] Human neutrophil elastase (HNE or elastase) is a major
protein stored in the azurophilic granules of human
polymorphonuclear granulocytes (Dewald et al. (1975) J. Exp. Med.
141:709) and secreted upon inflammatory stimuli (Bonney et al.
(1989) J. Cell. Biochem. 39:47). Elastase is a serine protease with
a broad substrate specificity able to digest many of the
macromolecules found in connective tissue such as elastin, type III
and type IV collagen, and fibronectin. In addition to connective
tissue components, many plasma proteins such as immunoglobulins,
clotting factors, and complement proteins can also be hydrolyzed by
elastase.
[0014] An excess of elastase activity has been implicated in
various disease states, such as pulmonary emphysema (Kaplan et al.
(1973) J. Lab. Clin. Med. 82:349; Sanders and Moore (1983) Am. Rev.
Respir. Dis. 127:554), cystic fibrosis, rheumatoid arthritis
(Barrett (1978) Agents and Actions 8:11), chronic bronchitis,
bronchopulmonary dysplasia in premature infants, and adult
respiratory distress syndrome (ARDS) (Weiland et al. (1986) Am.
Rev. Respir. Dis. 133:218). In most cases, the pathogenesis of
these diseases has been correlated with the inactivation or the
insufficiency of natural inhibitors of elastase, which have the
primary role of keeping excess elastase activity under control.
[0015] The development of an elastase-specific inhibitor has been a
major therapeutic goal of the pharmaceutical industry for some
time. While different types of elastase inhibitors have been
developed, most of them appear to be nonspecific inhibitors of
other serine proteases as well (Hemmi et al. (1985) Biochem.
24:1841). A method for developing an elastase-specific inhibitor
and such an inhibitor would be highly desirable.
BRIEF SUMMARY OF THE INVENTION
[0016] Herein described is a method for generating blended nucleic
acid ligands comprised of functional unit(s) added to provide a
nucleic acid ligand with additional functions. In the preferred
embodiment, the functional unit provides additional affinity or a
desired effect such as inhibition or induction between the blended
nucleic acid ligand and the target molecule. This method for
combining nucleic acids with other functional groups to use in
molecular evolution is herein referred to as blended SELEX.
[0017] The method of this invention provides novel means for
generating nucleic acid ligands with specifically selected
functionalities. For example, high affinity ligands are generated
by the method of this invention which are highly specific
inhibitors of a target enzyme.
[0018] The present invention encompasses nucleic acid ligands
coupled to a non-nucleic acid functional unit. In one example of
the blended nucleic acid ligand generated by the method of this
invention, a peptide-conjugated nucleotide was produced by coupling
the peptide Gly-Arg-Gly-Asp-Thr-Pro (SEQ ID NO:1) to the
derivatized base 5-(3-aminoallyl)-uridine triphosphate (RGD-UTP).
RGD-UTP containing oligonucleotides (RGD-RNA) were generated by the
method of this invention and shown to bind the RGD-binding protein
integrin gpIIbIIIa. It is expected that RGD-RNA is a highly
specific inhibitor of gpIIbIIIa.
[0019] In another example of the blended nucleic acid ligands
produced by the method of this invention, a blended nucleic acid
ligand to elastase with the ability to specifically inhibit
elastase activity was generated. An inhibitory peptide was coupled
to a single-stranded DNA ligand to elastase and the blended nucleic
acid ligand shown to specifically inhibit elastase activity.
BRIEF DESCRIPTION OF THE FIGURES
[0020] FIG. 1 illustrates the structure of 5-(3-aminoallyl)-uridine
triphosphate (AA-UTP) and the synthetic scheme for production of
Arg-Gly-Asp-UTP (RGD-UTP). Details of the reaction conditions are
as described in Example 1.
[0021] FIG. 2A shows the isolation of succinyl-UTP by Mono Q anion
exchange column chromatography. FIG. 2B shows the fractions versus
the optical density at 290 nm. As described in Example 1,
succinyl-UTP eluted in fractions 43-49.
[0022] FIG. 3A shows the isolation of RGD-UTP by Mono Q anion
exchange column chromatography. FIG. 3B shows the fractions versus
the optical density at 290 nm. As described in Example 1, RGD-UTP
eluted in fractions 35-38.
[0023] FIG. 4 shows the results of thin layer chromatography of
aminoallyl-UTP, succinyl-UTP, and RGD-UTP.
[0024] FIG. 5 shows the results of RGD-UTP RNA transcript
purification by anion exchange chromatography. The elution of
RGD-UTP RNA (.quadrature.) and RNA (.circle-solid.) from a Mono Q
anion exchange column is shown.
[0025] FIG. 6 shows the separation of RGD-30n7 RNA and gpIIbIIIa by
size exclusion chromatography on Superdex 200 (Pharmacia). The
elution profiles of RGD-30n7 bound to gpIIbIIIa (.quadrature.) and
RGD-30n7 (.circle-solid.) are shown.
[0026] FIG. 7 shows the chemistry of the attachment of the
inhibitory substrate peptide N-methoxysuccinyl
Ala-Ala-Pro-Val-chloromethyl ketone (SEQ ID NO:2) to a high
affinity single-stranded DNA (DNA-17).
[0027] FIG. 8 shows the inactivation of 1.95 mM N-methoxysuccinyl
Ala-Ala-Pro-Val-chloromethyl ketone (SEQ ID NO:2) by 50 mM DTT.
[0028] FIG. 9 shows the inhibition of the blended nucleic acid
ligand in the presence of 20 mM DTT.
[0029] FIG. 10 shows the inhibition of elastase by DNA-17
conjugated at the 5' end with chloromethyl ketone (.largecircle.),
and DNA-17 conjugated at the 3' end with chloromethyl ketone
(.circle-solid.).
[0030] FIG. 11 is a Lineweaver-Burk plot of the inhibition of
elastase by N-methoxysuccinyl Ala-Ala-Pro-Val (SEQ ID NO:5)
(.circle-solid.), peptide-conjugated oligonucleotide (.quadrature.)
and substrate alone (.largecircle.).
[0031] FIGS. 12A-12C show the inhibition of elastase by DNA ligands
with and without the inhibitors conjugated at the 3' end compared
with the effect of conjugated and non-conjugated ligands on (A) HNE
Activity, (B) Urokinase Activity and (C) Thrombin Activity.
[0032] FIG. 13 depicts the valyl phosphonate moiety attached to a
nucleic acid segment as used in Example 4 below, and the reaction
of the species with human neutrophil elastase.
[0033] FIG. 14 depicts the first order rate constant of a pool of
splint blended SELEX nucleic acid ligands after five rounds of
SELEX measured by gel electrophoresis; TBE pH 8 (.box-solid.) and
MAE pH 6 (.circle-solid.).
DETAILED DESCRIPTION OF THE INVENTION
[0034] This application describes methods for generating blended
nucleic acid ligand molecules. Examples of blended nucleic acid
libraries and molecules generated by these methods are provided.
The methods herein described are based on the SELEX method. SELEX
is described in U.S. patent application Ser. No. 07/536,428,
entitled "Systematic Evolution of Ligands by EXponential
Enrichment," now abandoned, U.S. Pat. No. 5,475,096, entitled
"Nucleic Acid Ligands," U.S. Pat. No. 5,270,163, entitled "Methods
for Identifying Nucleic Acid Ligands," (see also WO 91/19813).
These applications, each specifically incorporated herein by
reference, are collectively called the SELEX Patent
Applications.
[0035] In its most basic form, the SELEX process may be defined by
the following series of steps:
[0036] 1) A candidate mixture of nucleic acids of differing
sequence is prepared. The candidate mixture generally includes
regions of fixed sequences (i.e., each of the members of the
candidate mixture contains the same sequences in the same location)
and regions of randomized sequences. The fixed sequence regions are
selected either: a) to assist in the amplification steps described
below; b) to mimic a sequence known to bind to the target; or c) to
enhance the concentration of a given structural arrangement of the
nucleic acids in the candidate mixture. The randomized sequences
can be totally randomized (i.e., the probability of finding a base
at any position being one in four) or only partially randomized
(e.g., the probability of finding a base at any location can be
selected at any level between 0 and 100 percent).
[0037] 2) The candidate mixture is contacted with the selected
target under conditions favorable for binding between the target
and members of the candidate mixture. Under these circumstances,
the interaction between the target and the nucleic acids of the
candidate mixture can be considered as forming nucleic acid-target
pairs between the target and those nucleic acids having the
strongest affinity for the target.
[0038] 3) The nucleic acids with the highest affinity for the
target are partitioned from those nucleic acids with lesser
affinity to the target. Because only an extremely small number of
sequences (and possibly only one molecule of nucleic acid)
corresponding to the highest affinity nucleic acids exist in the
candidate mixture, it is generally desirable to set the
partitioning criteria so that a significant amount of the nucleic
acids in the candidate mixture (approximately 5-50%) are retained
during partitioning.
[0039] 4) Those nucleic acids selected during partitioning as
having the relatively higher affinity to the target are then
amplified to create a new candidate mixture that is enriched in
nucleic acids having a relatively higher affinity for the
target.
[0040] 5) By repeating the partitioning and amplifying steps above,
the newly formed candidate mixture contains fewer and fewer unique
sequences, and the average degree of affinity of the nucleic acids
to the target will generally increase. Taken to its extreme, the
SELEX process will yield a candidate mixture containing one or a
small number of unique nucleic acids representing those nucleic
acids from the original candidate mixture having the highest
affinity to the target molecule.
[0041] The SELEX Patent Applications describe and elaborate on this
process in great detail. Included are targets that can be used in
the process; methods for the preparation of the initial candidate
mixture; methods for partitioning nucleic acids within a candidate
mixture; and methods for amplifying partitioned nucleic acids to
generate enriched candidate mixtures. The SELEX Patent Applications
also describe ligand solutions obtained to a number of target
species, including both protein targets wherein the protein is and
is not a nucleic acid binding protein.
[0042] The present invention includes a method for generating high
affinity blended nucleic acid ligands to specific target molecules.
The method generates blended nucleic acid molecules comprised of at
least one functional unit.
[0043] Functional units that can be coupled to nucleotides or
oligonucleotides include peptides, amino acids, aliphatic groups
and lipid chains, or larger compounds such as peptide motifs,
recognizable by the target molecule. These non-nucleic acid
components of oligonucleotides may fit into specific binding
pockets to form a tight binding via appropriate hydrogen bonds,
salt bridges, or van der Waals interactions.
[0044] In certain embodiments of this invention, the blended
nucleic acid ligands generated by the method of this invention may
guide SELEX-generated ligands to specific sites of the target
molecule. Further blended nucleic acid ligands may be prepared
after the SELEX process for post-SELEX modification to add
functionality to the ligand, for example, to increase RNA
hydrophobicity and enhance binding, membrane partitioning and/or
permeability, or to add reporter molecules, such as biotin- or
fluorescence-tagged reporter oligonucleotides, for use as
diagnostics. Blended nucleic acid ligands may be generated by the
addition of chemical groups which covalently react and couple the
SELEX ligand to the target molecule; in addition, catalytic groups
can be added to nucleic acids to aid in the selection of SELEX
ligands with protease or nuclease activity. The functional units
may also serve as toxins or radiochemicals that are delivered to
specific locations in the body determined by the specificity of the
SELEX devised nucleic acid ligand.
[0045] Blended nucleic acid ligands are defined herein as
comprising at least one nucleic acid ligand and at least one
functional unit. A nucleic acid ligand is defined as any nucleic
acid identified generally according to the SELEX process as
described in the SELEX Patent Applications. The functional unit may
be any chemical species not naturally associated with nucleic
acids, and may have any number of functions as enumerated
herein.
[0046] In one preferred embodiment of the invention, the blended
nucleic acid ligand is prepared by performing the SELEX method
utilizing an initial candidate mixture wherein each nucleic acid
sequence of the candidate mixture contains at least one function
unit, or a "blended candidate mixture". This may be accomplished
using a candidate mixture wherein each nucleic acid sequence of the
candidate mixture has 1) a single functional unit attached at
either the 5' or 3' end of nucleic acid sequence, 2) functional
units at both the 5' and 3' ends of the nucleic acid sequence, 3)
functional units added to individual nucleic acid residues, 4)
functional units attached to all or a portion of all pyrimidine or
purine residues, or functional units attached to all or a portion
of all nucleotides of a given type. The functional units may also
be attached only to the fixed or to the randomized regions of each
nucleic acid sequence of the candidate mixture.
[0047] In an alternate preferred embodiment of the invention, one
or more functional units may be attached to a nucleic acid ligand
identified according to the SELEX method wherein a blended
candidate mixture is not used. Again the points of attachment of
the functional unit(s) to the nucleic acid ligand may vary
depending on the ultimate requirements for the blended nucleic acid
ligands.
[0048] The examples below describe methods for generating the
blended nucleic acid ligands of the present invention. As these
examples establish, nucleotides and oligonucleotides containing a
new functional unit are useful in generating blended nucleic acid
ligands to specific sites of a target molecule.
[0049] Two examples are described for coupling peptide molecules to
SELEX nucleic acid ligands in order to target specific peptide
binding pockets. In the first example, a peptide containing the
sequence arginine-glycine-aspartic acid (RGD) is coupled to a
nucleotide and enzymatically incorporated into unselected
polyribonucleotide. The RGD-containing peptide is recognized and
bound by the gpIIbIIIa integrin protein, causing gpIIbIIIa-mediated
platelet aggregation. A SELEX RGD-nucleic acid ligand may be
generated with high specificity for gpIIbIIIa that would not
crossreact with other integrins such as receptors for fibronectin,
vitronectin, collagen, or laminin. SELEX blended nucleic acid
ligands containing the RGD peptide could bind at or near the
gpIIbIIIa ligand site and specifically inhibit gpIIbIIIa
activity.
[0050] Example 1 describes the generation of a peptide-conjugated
RNA. The peptide Gly-Arg-Gly-Asp-Thr-Pro (SEQ ID NO:1) was coupled
to the derivatized base, 5-(3-aminoallyl)-uridine triphosphate to
produce the peptide-conjugated UTP (RGD-UTP), as shown in FIG. 1.
RGD-UTP may be used in SELEX T7-catalyzed template-dependent
transcription to produce an RNA oligonucleotide containing the RGD
peptide at every uridine position. The Gly-Arg-Gly-Asp-Thr-Pro (SEQ
ID NO:1) peptide was chosen because the Arg-Gly-Asp (RGD) motif in
matrix proteins is recognized and bound specifically by proteins of
the integrin superfamily of cell adhesion receptors. Integrins bind
to such proteins as fibronectin, laminin and vitronectin, at sites
containing the RGD sequence. This binding is inhibited by short
RGD-containing peptides which bind integrin proteins with a Kd of
approximately 10.sup.-5 M.
[0051] Because of the specificity of RGD-containing peptides for
integrins, the inventors of this application concluded that an
RGD-containing peptide conjugated to an oligonucleotide may
facilitate selection of high-affinity ligands to a RGD-binding
target molecule. However, according to this embodiment of the
invention utilizing a blended candidate mixture, peptide-conjugated
oligonucleotides must also be compatible with the SELEX method: the
peptide-conjugated nucleotide must be incorporated with reasonable
efficiency into transcribed RNA; partitioned RNA in turn must be
reasonably efficiently transcribed into complementary DNA for
amplification and additional rounds of SELEX. The Examples below
demonstrate that all of the conditions required for successful
SELEX identification of nucleic acid ligands containing new
functional groups are met by the method of this invention. The
peptide-UTP derivative was enzymatically incorporated into a
blended RNA oligonucleotide as shown by increased size and altered
charge compared with the native or unmodified oligonucleotide and
by the UV shoulder at 310 nm.
[0052] Example 2 describes the binding of RGD-RNA to RGD-binding
integrin gpIIbIIIa. After separation, the bound RGD-RNA was
reversed transcribed into DNA using normal SELEX protocols. The
efficient transcription, partitioning, and reverse transcription
shows that the site-directed blended nucleic acid ligands of this
invention are compatible with the basic SELEX procedure.
[0053] A second example of the method of the present invention
describes a DNA SELEX ligand coupled to a peptide inhibitor known
to bind elastase.
[0054] Example 3 describes the generation of a highly specific
elastase inhibitor by the method of the present invention. A
SELEX-identified single stranded DNA ligand to elastase was
produced and coupled to inhibitory substrate peptide chloromethyl
ketone. A description of the isolation of DNA ligands to elastase
and specific ligands to elastase are provided in U.S. Pat. No.
5,472,841, entitled, "Methods for Identifying Nucleic Acid Ligands
of Human Neutrophil Elastase," incorporated specifically herein by
reference. The resulting blended nucleic acid ligand was shown to
specifically inhibit elastase.
[0055] The methods described herein do not include all of the
schemes for introducing non-nucleic acid functional units, such as
peptides, into an oligonucleotide. However, such methods would be
well within the skill of those ordinarily practicing in the art.
Putting a peptide on every uridine, as done in Example 1, has
several advantages as compared with other labelling methods for use
in the SELEX procedure. First, the peptide is introduced throughout
both the random and fixed regions, so that evolved RNA ligands
could bind close to the peptide binding site. Second, distributing
the peptide at multiple sites does not restrict the geometry of RNA
and does not interfere with SELEX identification of the optimal
peptide position. Third, one can use pre-derivatized nucleotides
with SELEX. Post-transcription modification may require additional
time and expertise and introduces the additional variable of
coupling efficiency.
[0056] Other methods for coupling non-nucleic acid functional units
to nucleic acids may be used to yield evolved ligands with a
non-overlapping spectrum of binding sites. For instance, a peptide
could be placed at the 5' or 3' end of SELEX identified RNA
ligands. Another embodiment of this invention for introducing a
non-nucleic acid functional unit at random positions and amounts is
by use of a template-directed reaction with non-traditional base
pairs. This method uses molecular evolution to select the best
placement of the non-nucleic acid group on the SELEX identified
ligand. For example, a X-dY base pair could be used, where X is a
derivatizable ribonucleotide and the deoxynucleotide dY would pair
only with X. The X-RNA would contain the non-nucleic acid
functional unit only at positions opposite dY in the dY-DNA
template; the derivatized X base could be positioned in either the
fixed or random regions or both, and the amount of X at each
position could vary between 0-100%. The sequence space of
non-evolved SELEX ligands would be increased from N.sup.4 to
N.sup.5 by substituting this fifth base without requiring changes
in the SELEX protocol.
[0057] This embodiment may be used with photo-SELEX (U.S. Pat. No.
5,736,177, specifically incorporated herein by reference), where
photo-active bases are placed at random sites, and these blended
ligands partitioned after photolysis, then high affinity ligands
are selected with the minimum number of substituted bases needed to
crosslink with the target. In the same way, functional units that
react covalently at enzyme active sites, such as
chloromethylketones, may be incorporated to produce irreversible
enzyme inhibitors. Use of directed incorporation could be used also
for post-SELEX incorporation of fluorescence tags, biotin,
radiolabel, lipid groups, or to cap the oligonucleotide with a
uniquely modified base for protection against nuclease
digestion.
[0058] Incorporation of non-nucleic acid functional units to
produce blended SELEX ligands increases the repertoire of
structures and interactions available to produce high affinity
binding ligands. Various types of functional units can be
incorporated to produce a spectrum of molecular structures. At one
end of this structural spectrum are normal polynucleic acids where
the ligand interactions involve only nucleic acid functional units.
At the other, are fully substituted nucleic acid ligands where
ligand interactions involve only non-nucleic acid functional units.
Since the nucleic acid topology is determined by the sequence, and
sequence partitioning and amplification are the basic SELEX steps,
the best ligand topology is selected by nucleic acid evolution.
[0059] Example 3 below describes the preparation of a blended
nucleic acid ligand to elastase to act as an elastase inhibitor.
N-methoxysuccinyl-Ala-Ala-Pro-Val-chloromethyl ketone (SEQ ID NO:2)
is an effective irreversible inhibitor for elastase. However, the
nonspecific high reactive nature of chloromethyl ketone
functionality in conjunction with mM range Kd of the tetrapeptide
makes the inhibitor molecule unsuitable as a therapeutic agent. The
enzyme inhibition of nucleic acid ligands to elastase may be
improved by coupling such ligands to the substrate tetrapeptide in
a nonhydrolyzable manner such that the blended nucleic acid will
inhibit the enzyme by occupying the substrate binding pocket. In
such a blended nucleic acid affinity and specificity is provided by
the SELEX-derived nucleic acid ligand, whereas inhibition is
provided by the peptide.
[0060] In one embodiment of the invention, referred to as splint
blended SELEX, the functional unit of the blended nucleic acid
ligand is attached to the SELEX derived nucleic acid ligand via the
attachment of the functional unit to a nucleic acid that hybridizes
to a region of the nucleic acid sequence of the ligand. In the
preferred embodiment, the functional unit oligonucleotide is DNA,
and hybridizes to the fixed region of the nucleic acid ligand or at
least a region of the nucleic acid ligand that is not involved in
the binding reaction to the target.
[0061] In one variation of this embodiment, the SELEX process is
accomplished by the preparation of a candidate mixture of nucleic
acid sequences comprised of fixed and randomized regions. The
candidate mixture also contains an oligonucleotide attached to a
selected functional group. The oligonucleotide is complementary to
the fixed region of the nucleic acid candidate mixture, and is able
to hybridize under the conditions employed in SELEX for the
partitioning of high affinity ligands from the bulk of the
candidate mixture. Following partitioning, the conditions can be
adjusted so that the oligo-functional unit dissociates from the
nucleic acid sequences.
[0062] Advantages to this embodiment include the following: 1) it
places a single functional unit, such as a peptide analog, at a
site where it is available for interaction with the random region
of nucleic acid sequences of the candidate mixture; 2) because the
functional unit is coupled to a separate molecule, the coupling
reaction must only be performed once, whereas when the functional
unit is coupled directly to the SELEX ligand, the coupling reaction
must be performed at every SELEX cycle. (aliquots from this
reaction can be withdrawn for use at every cycle of SELEX); 3) the
coupling chemistry between the functional unit and the
oligonucleotide need not be compatible with RNA integrity or
solubility--thus simplifying the task of coupling; 4) in cases
where the functional unit forms a covalent complex with the target,
the SELEX derived nucleic acid ligand portion of the selected
members of the candidate mixture can be released from the target
for amplification or identification; and 5) following the
successful identification of a blended nucleic ligand, the tethered
portion of nucleic acid can be made into a hairpin loop to
covalently attach the two portions of the blended nucleic acid
ligand. An example of splint blended nucleic acid ligand for human
neutrophil elastase is shown in Example 4 below.
EXAMPLES
[0063] The following examples are provided for illustrative
purposes only and are not intended to limit the scope of the
invention.
Example 1
[0064] Synthesis of Peptide Conjugated UTP.
[0065] Reagents. 5-(3-aminoallyl)-uridine 5'-triphosphate, sodium
salt, was obtained from Sigma Chem. Co. (St. Louis, Mo.).
Gly-Arg-Gly-Asp-Thr-Pro (SEQ ID NO:1) was obtained from GIBCO-BRL
(Gaithersburg, Md.). 1-ethyl-3-(dimethylaminopropyl) carbodiimide
hydrochloride (EDC) was obtained from Pierce Chemical Co.
(Rockford, Ill.). Other chemicals were of highest quality available
from Aldrich Chem. Co. (Milwaukee, Wis.).
[0066] Succinylation of AA-UTP. The peptide Gly-Arg-Gly-Asp-Thr-Pro
(SEQ ID NO:1) was coupled to UTP via a two-step reaction through
the N-terminal .alpha.-amino group of the peptide. This
.alpha.-amino group is the only reactive amine in the peptide and
is not required for integrin binding. Condensation with peptide
carboxyl groups could function to block the aspartic acid residue,
thus preventing integrin binding.
[0067] 5-(3-aminoallyl)UTP (5 mg) was dissolved in 250 .mu.l of 0.2
M sodium borate, pH 8.5. The solution was mixed with 750 .mu.l
succinic anhydride (97 mg/1.14 ml DMF) and reacted for 2 h at
4.degree. C. An equal volume of 0.1 M triethylammonium bicarbonate,
pH 7.6, was added, filtered and purified on Mono Q 5.times.5 anion
exchange FPLC (Pharmacia). The sample was applied in 0.1 M
triethylammonium bicarbonate, and eluted with a linear gradient to
1.0 M triethylammonium bicarbonate. The column was eluted at 1.0
ml/min over 20 min. The major peak was pooled, lyophilized, and
taken up in dry DMF for the next reaction. The sample was analyzed
by TLC by spotting on PEI-F chromatography plates (J.T. Baker) and
developing with 0.2 M sodium phosphate, pH 3.5.
[0068] Chromatographic isolation of succinyl-UTP. The succinylation
reaction mixture was diluted 1:1 with 0.1 M
triethylammonium-bicarbonate, pH 7.6 (Buffer A), filtered and
applied to a 0.5 cm.times.5 cm Mono Q anion exchange column which
was equilibrated with the same buffer. The column was eluted with a
gradient to 1.0 M triethylammonium-bicarbonate (Buffer B) at a flow
rate of 0.5 ml/ml (1 min/fraction) (FIG. 2). Succinyl-UTP was
easily separated by ion exchange from the starting material. This
separation is achieved because succinyl-UTP elutes from Mono Q
similar to UTP, whereas AA-UTP partially neutralizes the
5'-triphosphate and elutes earlier in the salt gradient.
Succinyl-UTP eluted late in the gradient from the Mono Q column
(92% of Buffer B), well separated from reactants and from the
AA-UTP (which eluted at approximated 68% of Buffer B). The majority
of UV adsorbing material eluted in the major peak, although several
other peaks were present. Succinyl-UTP pooled from fractions 43-49
was lyophilized to remove the volatile buffer in preparation for
the next step. The yield of this step was 80-95%. The dried sample
was dissolved in dry DMF and its UV spectrum determined. This peak
had the expected maximum at 290 nm.
[0069] Coupling of GRGDTP peptide to 5'(3-succinyl-aminoallyl)
uridine 5'-triphosphate. The RGD peptide was condensed with
succinyl-UTP using the water soluble carbodiimide. Succinyl-UTP in
58 .mu.l of DMF was cooled to 4.degree. C. 117 .mu.l of
N-hydroxy-succinimide (24 mg/1.4 ml DMF) was added and the mixture
was reacted for 30 min at 4.degree. C. 175 .mu.l of EDC (0.1 M, pH
4.8) was added and the mixture reacted for 2 h at 4.degree. C. The
activated nucleotide was added to 14 mg of lyophilized GRGDTP and
the mixture reacted for 2 h at 4.degree. C. The reaction mixture
was diluted 1:1 with 0.1 M triethylammonium bicarbonate, purified
on a Mono Q column as above, and analyzed by TLC and Fast Atom
Bombardment (FAB) Mass Spectrometry (University of Colorado
Structural Division).
[0070] Chromatographic isolation of RGD-UTP. RGD-UTP was purified
by ion exchange chromatography. The peptide coupling reaction
mixture was diluted with Buffer A, filtered and purified on the
Mono Q column described above. RGD-UTP eluted from the Mono Q
column similar to AA-UTP, but ahead of succinyl-UTP, suggesting the
arginine side chain also interacts with the phosphate charge. The
major peak eluted at approximately 70% of Buffer B, ahead of the
peak of residual succinyl-UPT (which eluted at approximately 90% of
Buffer B) (FIG. 3). Only trace amounts of other peaks were
detected, except for the EDC which eluted earlier. Fractions 35-38
were pooled and lyophilized. The sample was dissolved in dry DMF
for thin layer chromatography (TLC) and FAB mass spectroscopy. The
sample had a maximum adsorption at 290 nm.
[0071] Thin layer chromatography of AA-UTP, succinyl-UTP, and
RGD-UTP. As shown in FIG. 4, RGD-UTP is cleanly separated from both
AA-UTP and succinyl-UTP. AA-UTP, succinyl-UTP, and RGD-UTP were
spotted onto cellulose PEI-F TLC plates (J. T. Baker, Inc.) and
developed with 0.75 M NaH.sub.2PO.sub.4, pH 3.5. AA-UTP migrated
near the solvent front, succinyl-UTP migrated with an R.sub.f of
0.42, and RGD-UTP remained at the origin. This TLC system is an
ideal method for monitoring product formation.
[0072] Mass spectrometry analysis. RGD-UTP analyzed by FAB mass
spectroscopy yielded a mass of 1223, remarkably close to the
calculated formula weight (FW) of 1222. The precision of the mass
spectrometry result shows that RGD was coupled in the predicted
manner, and that no side reactions occurred introducing alternative
or additional derivatives. Further, there were no smaller peaks
present which would indicate degradation or dephosphorylation of
the triphosphate.
Example 2
[0073] Binding of RGD-RNA to gpIIbIIIa.
[0074] Molecular biology techniques. Agarose electrophoresis, T7
RNA transcription, and AMV reverse transcription were performed
generally as described in the SELEX Patent Applications. FPLC
purification of RNA oligonucleotides was achieved using a 5.times.5
Mono Q anion exchange column. The RNA transcription reaction
mixture was phenol:chloroform extracted, ethanol precipitated and
washed, and dissolved in 50 mM sodium phosphate, 0.2 M NaCl, 6 M
urea, 50% formamide (Fisher, Ultrapore, low-UV absorbance), pH 6.0.
Following sample application, the column was developed with a
linear gradient to 1 M NaCl. The RNA peak was precipitated by
addition of 2:1 v/v ethanol, the pellet was washed with 80% ethanol
and dried in a speed-vac, then dissolved in SELEX binding buffer
(150 mM NaCl, 10 nM HEPES, 2 mM CaCl.sub.2, 1 mM MgCl.sub.2, 0.1%
Tween, pH 7.4). RNA and RNA-gpIIbIIIa (Enzyme Research) complexes
were prepared by incubation at 37.degree. C. for 10 min, and
separated by size exclusion chromatography on a 16.times.100
Superdex 200 column (Pharmacia) which was equilibrated and run in
the binding buffer. Concentration and removal of detergent from the
samples collected from the Superdex column was achieved by
adsorption onto a Resource Q column (Pharmacia) and elution with 1
M NaCl.
[0075] RGD-UPT transcription and purification. RGD-UTP was used in
a T7 RNA polymerase reaction by direct substitution for normal UTP,
and gave yields that were at least 50% of those obtainable with
UTP. The concentration of RGD-UTP and other NTPs was 1 mM; the DNA
template contained 5' and 3' fixed regions flanking a 30 base pair
random sequence. The RNA transcript was purified by adsorption onto
an anion exchange column (Mono Q) in a phosphate buffer containing
6 M urea and 50% formamide, and eluted with a gradient to 1 M NaCl
(FIG. 5). RGD-RNA eluted as one major peak from the column at a
position in the gradient slightly ahead of the elution position of
an equivalent RNA transcript made with normal UTP, consistent with
the altered charge and perhaps altered conformation of the
derivatized RNA. The amount of truncated RNA material was only
slightly increased compared to normal RNA transcription.
[0076] Binding of RGD-30n7 RNA to gpIIbIIIa. Size-based
partitioning, used to separate RGD-RNA bound to gpIIbIIIa integrin
from unbound RGD-RNA, is a method for identifying high affinity RNA
ligands to gpIIbIIIa (Kd<10.sup.-8). RGD-RNA was incubated with
gpIIbIIIa (2 mg/ml) in 0.15 M NaCl, 2 mM CaCl.sub.2, 1 mM
MgCl.sub.2, 20 mM HEPES, 0.1% Tween 20, pH 7.4. The results showed
that RGD-RNA incubated with gpIIbIIIa yielded a higher molecular
weight RNA peak than obtained for samples not incubated with
gpIIbIIIa. Normal RNA made with UTP and partitioned in the same
manner did not have the high molecular weight peak, indicating that
binding to gpIIbIIIa of RNA not coupled to the RGD peptide was
weaker than that of the blended molecule. The estimated molecular
mass is consistent with the addition of the RGD peptide at each
uridine position (FIG. 6). Perhaps more conclusively,
chromatographically purified RGD-RNA had an absorbance shoulder,
compared to normal RNA, at 310 nm resulting from incorporation of
AA-UTP. A small peak of early eluting material was detected in the
column void volume which was not present in samples of RGD-RNA
chromatographed without protein. The high molecular weight
RGD-RNA-gpIIbIIIa peak was concentrated and detergent removed by
adsorption and elution from an anion exchange column. The RNA was
reversed transcribed and PCR amplified. The DNA obtained yielded a
single band of expected size on agarose electrophoresis, indicating
that RGD-RNA is reverse transcribed with acceptable efficiency even
with the low amounts of RNA extracted during SELEX
partitioning.
Example 3
[0077] Substrate-Coupled SELEX-Derived Blended Ligands as Elastase
Inhibitors.
[0078] To demonstrate that a high affinity, high specificity
nucleic acid ligand coupled to an inhibitor peptide is a viable
method of producing a high affinity inhibitor to elastase, a ssDNA
ligand to elastase was coupled to the inhibitory substrate peptide
chloromethyl ketone such that the chloromethyl functionality is
inactivated by creating a non-hydrolyzable linkage. ssDNA ligand 17
(DNA-17) (from U.S. Pat. No. 5,472,841, entitled, "Methods for
Identifying Nucleic Acid Ligands of Human Neutrophil Elastase,"
having the sequence
TAGCGATACTGCGTGGGTTGGGGCGGGTAGGGCCAGCAGTCTCGTGCGGTACTTGA GCA (SEQ
ID NO:3)) has a Kd for elastase of 15 nM. Because it was not known
which end of DNA-17 is in close proximity to the active site of
elastase, blended nucleic acid molecules were prepared in which the
substrate peptide was attached to both the 3' and 5' ends of the
DNA.
[0079] Peptide conjugation. The chemistry of the attachment is
shown in FIG. 7. An oligonucleotide with four 18-atom ethylene
glycol moieties (synthesized by using spacer phosphoramidite,
Clonetech) and a thiol group at the 3' end was synthesized by
automated DNA synthesis, deprotected by standard methods, and gel
purified. Immediately after the deprotection of the 3'-SH group,
the oligonucleotide was passed through a Sephadex-G50 spin column
equilibrated in 0.5 M triethylammonium acetate buffer (pH 7.5) to
remove excess DTT, and then mixed with N-methoxysuccinyl
Ala-Ala-Pro-Val-chloromethyl ketone (SEQ ID NO:2) (25 mg/200 V.mu.l
of DMF). The mixture was incubated at 37.degree. C. overnight.
[0080] 20 .mu.l of 1 M DTT was added to inactivate the unreacted
chloromethyl ketone inhibitor. The peptide conjugated DNA was
finally purified from the unconjugated peptide either by three
successive Sephadex-G50 spin columns or by reverse phase HPLC.
[0081] Elastase inhibition assay. The assay for elastase inhibition
is based on the use of a chromogenic tetrapeptide substrate. The
assay was conducted in a buffer containing 10 nM elastase, 0.5 mM
N-methoxysuccinyl-Ala-Ala-Pro-Val-p-nitroanilide (SEQ ID NO:4), 150
mM NaCl, 26 mM KCl, 2 mM MgCl.sub.2, 0.02% HSA, 0.05% DMSO, 0.01%
Triton X-100, and 100 mM Tris-HCl, at 25.degree. C. The assay
measured the generation of elastase-induced release of
p-nitroanilide as a function of time by spectroscopy (OD 405 nm).
The rate of p-nitroanilide generation in the absence of inhibitor
was used as the control. Positive control was established in the
presence of the irreversible inhibitor
N-methoxysuccinyl-Ala-Ala-Pro-Val-chloromethyl ketone (SEQ ID
NO:2).
[0082] The presence of trace amounts of unreacted N-methoxysuccinyl
Ala-Ala-Pro-Val-chloromethyl ketone (SEQ ID NO:2) in the final
blended nucleic acid ligand preparation will inhibit the enzyme.
However, this possibility will be eliminated by inactivating the
inhibitor with DTT. FIG. 8 shows the inactivation of
N-methoxysuccinyl Ala-Ala-Pro-Val-chloromethyl ketone (SEQ ID NO:2)
by DTT. Incubation of 1.95 M N-methoxysuccinyl
Ala-Ala-Pro-Val-chloromethyl ketone (SEQ ID NO:2) with 50 mM DTT
destroyed the inhibition. The partial inhibition seen with the
inactivated inhibitor may be due to competitive inhibition due to
the high peptide concentration.
[0083] FIG. 9 shows the inhibition of the blended nucleic acid
ligand in the presence of 20 mM DTT. The inhibition of elastase by
the 5' end blended nucleic acid ligand and the 3' end blended
nucleic acid ligand is shown in FIG. 10. A Lineweaver-Burk plot of
elastase inhibition by N-methoxysuccinyl Ala-Ala-Pro-Val (SEQ ID
NO:5) or the blended nucleic acid ligand is shown in FIG. 11. The
resulting Km of 0.16 mM for the substrate is in good agreement with
published values. The Ki of the blended nucleic acid ligands was 30
nM versus 920 .mu.M for the inhibitor peptide alone, or a 30,000
fold improvement.
[0084] The inhibition of two other human serine
proteases--urokinase and thrombin--by the 3' end blended nucleic
acid DNA-17 was also examined, and shown in FIG. 12. At 70 nm
concentration the 3' end blended nucleic acid has greater than 50%
inhibition of elastase, whereas even at 650 nm concentration
neither urokinase nor thrombin were inhibited to any detectable
extent. These results demonstrate the specificity of the blended
nucleic acid ligand for elastase.
Example 4
[0085] Splint Blended SELEX.
[0086] The splint blended SELEX process was performed by preparing
a standard SELEX candidate mixture and a single compound containing
a valyl phosphonate attached to a nucleic acid sequence that
hybridizes to a portion of the fixed region of the candidate
mixture of nucleic acid sequences as shown in FIG. 13. FIG. 13 also
shows the chemical reaction that occurs between the valyl
phosphonate and human neutrophil elastase (HNE).
[0087] The valyl phosphonate was activated via an NHS ester. This
compound was coupled to the 5' hexyl amine linker of a 19-mer DNA
oligo complementary to the 5'-fixed region of 40N7.1. A candidate
mixture composed of pyrimidine 2'NH.sub.2-substituted RNA was
hybridized to the splint, and reacted with HNE at subsaturating
protein concentrations. Covalent complexes were enriched by
diluting the reaction 100-fold, then filtering through
nitrocellulose.
[0088] After five rounds of selection for species that reacted with
the HNE, the reactivity of the pool was assayed by gel
electrophoresis (5% polyacrylamide/TBE pH 8 or MAE pH 6/0.25% SDS).
The results are shown in FIG. 14. The analysis of reaction rates
indicates biphasic kinetics, with k.sub.1obs.apprxeq.0.1
min.sup.-1, and k.sub.2obs.apprxeq.0.01 min.sup.-1. The reaction
plateaus at 30%, presumably because the valyl phosphonate is a
racemic mixture and the theoretical limit is 50%. A k.sub.1obs of
0.1 min.sup.-1 at a protein concentration of 50 nM indicates a
second order rate constant >2.times.10.sup.6 M.sup.-1min.sup.-1.
The reported rate constant for the valyl phosphonate alone is
10.sup.3-10.sup.4 M.sup.-1min.sup.-1 (Oleksyszyn et al. (1989)
Biophys. Biochem. Res. Comm. 161: 143-149). Thus, the splint
blended nucleic acid mixture increases the reaction rate of the
species by at least 10.sup.3 fold. The reaction of the selected
pool is also highly specific. No reaction of the pool with
thrombin, another serine protease, is detectable. The second-order
rate constant for the thrombin reaction is estimated to be <200
M.sup.-1min.sup.-1, 10.sup.4 fold lower than the reaction rate with
elastase.
Sequence CWU 1
1
* * * * *