U.S. patent application number 11/537567 was filed with the patent office on 2007-06-14 for composition comprising and method of using angiopoietin-like protein 3 angptl3.
This patent application is currently assigned to GENENTECH, INC.. Invention is credited to Napoleone Ferrara, Hans-Peter Gerber, Joe Kowalski, Maria Teresa Pisabarro, Daniel Eric Sherman.
Application Number | 20070134250 11/537567 |
Document ID | / |
Family ID | 23298191 |
Filed Date | 2007-06-14 |
United States Patent
Application |
20070134250 |
Kind Code |
A1 |
Ferrara; Napoleone ; et
al. |
June 14, 2007 |
Composition Comprising and Method of Using Angiopoietin-Like
Protein 3 ANGPTL3
Abstract
The present invention is directed to methods and means for
making and using Angpt13 polypeptides. The invention specifically
concerns the use of Angpt13 polypeptides in inducing liver
regeneration and angiogenesis. Further methods include the use of
Angpt13 polypeptides in the diagnosis and treatment of liver
disease. Also provided herein are antibodies which bind to the
polypeptides of the present invention.
Inventors: |
Ferrara; Napoleone; (San
Francisco, CA) ; Gerber; Hans-Peter; (San Francisco,
CA) ; Kowalski; Joe; (Redwood City, CA) ;
Pisabarro; Maria Teresa; (01309 Dresden, DE) ;
Sherman; Daniel Eric; (San Francisco, CA) |
Correspondence
Address: |
MERCHANT & GOULD PC
P.O. BOX 2903
MINNEAPOLIS
MN
55402-0903
US
|
Assignee: |
GENENTECH, INC.
1 DNA Way
South San Francisco
CA
|
Family ID: |
23298191 |
Appl. No.: |
11/537567 |
Filed: |
September 29, 2006 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10298461 |
Nov 15, 2002 |
|
|
|
11537567 |
Sep 29, 2006 |
|
|
|
60332429 |
Nov 16, 2001 |
|
|
|
Current U.S.
Class: |
424/155.1 ;
435/6.16; 514/12.2; 514/13.3; 514/16.4; 514/16.5; 514/19.8;
514/9.1; 514/9.6 |
Current CPC
Class: |
A61P 9/00 20180101; A61P
1/00 20180101; A61P 1/16 20180101; A61P 35/00 20180101; C12N
2799/022 20130101; A61P 31/00 20180101; C07K 14/515 20130101; A61P
29/00 20180101; A61P 9/10 20180101; A61P 31/04 20180101; A61P 3/04
20180101; A61P 31/12 20180101; A61P 31/14 20180101; A61P 43/00
20180101; A61P 37/06 20180101; A61K 48/00 20130101; A61P 3/06
20180101; A61P 31/20 20180101 |
Class at
Publication: |
424/155.1 ;
514/012; 435/006 |
International
Class: |
A61K 39/395 20060101
A61K039/395; C12Q 1/68 20060101 C12Q001/68; A61K 38/55 20060101
A61K038/55 |
Claims
1-44. (canceled)
45. A method for the treatment of acute liver disease, comprising
administering to a mammalian subject in need a therapeutically
effective amount of a polypeptide comprising an amino acid sequence
having at least 80% sequence identity to the human Angpt13 sequence
of SEQ ID NO: 2, or an agonist thereof.
46. The method of claim 45 wherein the mammalian subject is
human.
47. The method of claim 46 wherein said polypeptide comprises an
amino acid sequence having at least 98% identity to the human
Angpt13 sequence of SEQ ID NO: 2, or an agonist thereof.
48. The method of claim 46 wherein said polypeptide comprises amino
acid regions 281-293 (P1, SEQ ID NO: 14), 442-460 (P2, SEQ ID NOO:
15), and 415-430 (P3 SEQ ID NO: 17) of the human Angpt13 sequence
of SEQ ID NO: 2.
49. The method of claim 47 wherein said polypeptide comprises amino
acid regions 281-293 (P1, SEQ ID NO: 14), 442-460 (P2, SEQ ID NOO:
15), and 415-430 (P3 SEQ ID NO: 17) of the human Angpt13 sequence
of SEQ ID NO: 2.
50. The method of claim 46 wherein said polypeptide comprises the
fibrinogen domain of the human Angpt13 sequence of SEQ ID NO:
2.
51. The method of 46 further comprising the administration of an
additional therapeutic agent.
52. The method of claim 51 wherein said additional therapeutic
agent is an angiogenic factor.
53. The method of claim 52 wherein said angiogenic factor is
vascular endothelial growth factor (VEGF) or fibroblast growth
factor (FGF).
54. The method of claim 46 wherein said agonist is an agonist
antibody specifically binding Angpt13.
55. The method of claim 46 wherein said agonist is an agonist
antibody specifically binding .alpha.v3.
56. A method of inducing liver regeneration following acute liver
injury, comprising administering to a mammalian subject in need a
therapeutically effective amount of a polypeptide comprising an
amino acid sequence having at least 80% sequence identity to the
human Angpt13 sequence of SEQ ID NO: 2, or an agonist thereof.
57. A method of claim 56 wherein the mammalian subject is
human.
58. The method of claim 57 wherein the human subject has been
diagnosed with an inflammatory liver disease.
59. The method of claim 58 wherein the inflammatory liver disease
is chronic, alcoholic or viral hepatitis.
60. The method of claim 57 wherein the human subject has suffered
chemical mechanical injury to the liver.
61. The method of claim 57 wherein the human subject has been
subject to hepatectomy.
62. The method of claim 61 wherein the hepatectomy is due to
hepatitis, liver cirrhosis, primary or metastatic liver cancer, or
gallbladder cancer.
63. A method for inducing angiogenesis in a tissue comprising
treating the tissue with an effective amount of a polypeptide
comprising amino acid sequence having at least 80% sequence
identity to the human Angpt13 sequence of SEQ ID NO; 2, or an
agonist thereof.
64. The method of claim 63 wherein the tissue is liver tissue.
65. The method of claim 63 is liver tissue has been injured as a
result of an infectious or autoimmune process, mechanical or
chemical injury, or cancer or metastatic cancer.
66. The method of claim 63 wherein the tissue is cardiac
tissue.
67. A method of inhibiting an undesired increase in vascular
permeability in a tissue comprising treating the tissue with an
effective amount of an antagonist of Angpt13.
68. The method of claim 67 wherein the increase in vascular
permeability of a small vessels following tissue damage.
69. The method of claim 68 wherein the increased vascular
permeability follows necrosis of vascular endothelium due to
exposure to toxins.
70. The method of claim 68 wherein the increased vascular
permeability associated with inflammation.
71. The method of claim 70 wherein the increased vascular
permeability is associated with chronic inflammation.
72. The method of claim 67 wherein the tissue is liver tissue.
73. The method of claim 67 wherein the tissue is heart tissue.
74. A method for identifying a human subject at risk of
cardiovascular disease, comprising determining the level of Angpt13
mRNA or its expression product in the heart tissue of said subject,
relative to the level of Angpt13 or its expression product in
normal heart tissue, and identifying the subject as being at risk
if the level of Angpt13 mRNA or its expression product in the heart
tissue of the subject is elevated relative to the normal heart
tissue.
75. A method for identifying a human subject at risk of liver
damage, comprising determining the level of Angpt13 mRNA or its
expression product in the liver tissue of said subject, relative to
the level of Angpt13 or its expression product in normal liver
tissue, and identifying the subject as being at risk if the level
of Angpt13 mRNA or its expression product in the liver tissue of
the subject is elevated relative to the normal liver tissue.
Description
RELATED APPLICATIONS
[0001] This is a continuation in part application that claims
priority under 35 U.S.C. .sctn.119(e) to U.S. provisional
application No. 60/332,429, filed on Nov. 16, 2001.
BACKGROUND OF THE INVENTION
[0002] 1. Field of the Invention
[0003] The present invention concerns Angpt13 polypeptides as well
as methods and means for making and using such protein molecules,
and antibodies binding Angpt13 polypeptides.
[0004] 2. Description of the Related Art
[0005] The growth of new blood vessels is a prerequisite during
normal physiological processes of embryonic and postnatal
development. Such proliferation of new blood vessels from
pre-existing capillaries, a process termed angiogenesis,
additionally plays a key role in the pathological development of
solid tumors, diabetic retinopathies, psoriasis, inflammation and
rheumatoid arthritis (Ferrara, Recent Prog Horm. Res. 55:15-35
(2000), discussion 35-6).
[0006] Angiogenesis not only depends on growth factors, such as
vascular endothelial growth factor (VEGF) and fibroblast growth
factor (FGF), but is also influenced by cell adhesion molecules
(CAMs), including integrins. Inactivation of various genes encoding
specific adhesion receptors or administration of blocking
antibodies in animal models had profound effects on the angiogenic
response of endothelial cells (Elicieri and Cheresh, Mol. Med.,
4:741-50 (1998)).
[0007] The integrin family of cell adhesion proteins is composed of
15 .alpha. and 8 .beta. subunits that are expressed in at least 22
different .alpha..beta. heterodimeric combinations (Byzova et al.,
Mol. Cell., 6(4):851-60 (2000)). Among these, at least six
(.alpha.v.beta.3, .alpha.v.beta.5, .alpha.5.beta.1,
.alpha.2v.beta.1, .alpha.v.beta.1 and .alpha.1.beta.1) of the
combinations have been implicated in angiogenesis (Hynes and Bader,
Thromb. Haemost., 78(l):83-7 (1997); Hynes et al., Braz. J. Med.
Biol. Res., 32(5):501-10 (1999)). Integrins facilitate cellular
adhesion to and migration on the extracellular matrix proteins
found in intercellular spaces and basement membranes.
[0008] Integrin .alpha.v.beta.3 is a receptor for a wide variety of
extracellular matrix proteins including vitronectin, fibronectin,
fibrinogen, laminin, collagen, Van Willebrand factor, osteopontin
and a fragment of MMP2 (PEX) among others (for review see Eliceiri
and Cheresh, Cancer J. Sci. Am. 6 Suppl 3:S245-9 (2000)). Despite
its promiscuous ligand binding behavior, .alpha.v.beta.3 is not
widely expressed in adult tissues, is found on some vascular,
intestinal and uterine smooth muscle cells (Brem et al., Invest.
Ophthalmol. Vis. Sci., 35:3466-74 (1994). This receptor is also
expressed on certain activated leukocytes, on macrophages and
osteoclasts, where plays a crucial role during bone resorption
(McHugh, et al, J. Clin. Invest., 105:433-40 (2000)). Most
prominently, .alpha.v.beta.3 becomes upregulated on endothelial
cells exposed to hypoxia and cytokines such as vascular endothelial
growth factor A (VEGF-A) (Suzuma et al., Invest Ophthalmol. Vis.
Sci. 39:1029-35 (1998); Walton et al., J. Cell. Biochem. 78:674-80
(2000)). In vivo, increased expression of .alpha.v.beta.3 was
observed on vascular cells within tumor granulation tissues, during
wound healing, macular degeneration and other neovascular diseases.
In a variety of in vitro and in vivo models of tumor angiogenesis,
blockade of .alpha.v.beta.3 with monoclonal antibodies or ligand
antagonists led to blunted blood vessel formation (Brooks et al.,
Cell 79:1157-64 (1994); Eliceiri and Cheresh, Mol. Med. 4:741-50
(1998)).
[0009] While there is a vast number of reports focusing on the
mechanism involved in regulation of angiogenesis in pathological
conditions such as tumor growth or collateral vessel formation
after myocardial ischemia, surprisingly little is known about the
role of the angiogenic process during liver regeneration. After
partial hepatectomy (PH), both hepatocytes and nonparenchymal cells
expressed vascular endothelial growth factor (VEGF) mRNA (Mochida
et al. Biochem. Biophys. Res. Commun. 226:176-9 issn: 0006-291x
(1996)), implicating that VEGF, by means of inducing angiogenesis,
might play a role in liver regeneration. However, neutralizing
antisera against VEGF did not alter recovery rates after injury but
led to a reduction of proliferating endothelial cells and
hepatocytes in this model (Taniguchiet al., J. Histochem. Cytochem.
49:121-30 (2001)). In support of this, the addition of the
angiogenesis inhibitor TNP-470 did not impair wound healing after
partial hepatectomy, suggesting that TNP470-sensitive angiogenesis
is not required during liver regeneration (Tanaka et al., Br. J.
Surg., 83(10):1444-7 (1996)).
[0010] There is a need for the identification of novel factors
which are involved in liver regeneration, and in particular in the
process of angiogenesis during liver regeneration.
SUMMARY OF THE INVENTION
[0011] The present invention concerns the use of polypeptides
comprising an amino acid sequence having sequence identity to the
human Angpt13 sequence, or an agonist thereof, to treat tissue
damage characterized by overexpression of Angpt13. In particular,
the invention concerns the use of Angpt13 in the treatment
(including prevention) or the identification of a human subject at
risk of tissue damage, preferably liver or heart tissue damage.
Accordingly, Angpt13 is believed to be involved in regulation of
the angiogenic process during liver regeneration.
[0012] The present invention concerns a method of treating tissue
damage characterized by overexpression of Angpt13 which comprises
the treatment of tissue with an antagonist of Angpt13 of SEQ ID NO:
2 or a mammalian homologue thereof. In one embodiment, the
treatment includes prevention and more specifically, the prevention
of the progression of tissue damage.
[0013] In a preferred embodiment, the tissue is preferably human
liver tissue. The antagonist is preferably an antagonist of Angpt13
of SEQ ID NO: 2. The tissue damage is preferably associated with
inflammation or a liver tumor. The inflammation is preferably
associated with a chronic liver disease selected from the group
consisting of liver cirrhosis, liver fibrosis, chronic hepatitis,
viral hepatitis A, B, C, D, E and G, toxic metabolic liver damage,
fatty liver, ischemia reperfusion injury of the liver and sepsis.
The liver cirrhosis is alcoholic liver cirrhosis or primary biliary
cirrhosis (PBC). The hepatitis is selected from the group
consisting of chronic autoimmune hepatitis, chronic alcoholic
hepatitis and non-alcoholic steatohepatits (NASH). The liver tumor
is selected from the group consisting of hepatocellular carcinoma,
cholangiocarcinoma and metastatic cancer of the liver.
[0014] In another embodiment, the tissue is preferably heart
tissue. The tissue damage is preferably associated with
inflammation. The tissue damage is preferably associated with a
cardiac disease characterized by elevated expression of Angpt13. In
another aspect, the tissue damage is associated with a cardiac
disease the pathogenesis of which includes an inflammatory
response, or in the development of which inflammation is a risk
factor. The cardiac disease is preferably selected from the group
consisting of coronary artery disease, cardiomyopathy, myocarditis,
congestive heart failure (CHF), and myocardial infarction. The
cardiomyopathy is preferably selected from the group consisting of
non-specific hypertrophy and dilated cardiomyopathy.
[0015] In another embodiment, the antagonist is an anti-Angpt13
antibody, an anti-.alpha.v.beta.3 antibody, an immunoadhesin or a
small molecule. The antibody is preferably a monoclonal antibody,
an antibody fragment or a single-chain antibody that is selected
from the group consisting of Fab, Fab', F(ab').sub.2 and Fv
fragments. The monoclonal antibody is preferably chimeric,
humanized or human. The immunoadhesin comprises at least the
ligand-binding region of .alpha.v.beta.3 fused to an immunoglobulin
sequence or comprises at least the receptor-binding region of
Angpt13 used to an immunoglobulin sequence.
[0016] In another aspect, the present invention includes a method
for the treatment of a chronic liver disease in a mammalian
subject, comprising administering to a mammalian subject in need of
an effective amount of an antagonist of Angpt13 of SEQ ID NO: 2, or
a mammalian homologue thereof. In one embodiment, the mammalian
subject is human. The treatment includes prevention and more
specifically, the prevention of the progression of liver disease.
The antagonist administered is an antagonist of Angpt13 of SEQ ID
NO: 2 or an antibody, in particular, an anti-Angpt13 antibody or an
anti-.alpha.v.beta.3 antibody. The chronic liver is characterized
by the elevated expression of Angpt13. The liver disease is
selected from the group consisting of liver cirrhosis, liver
fibrosis, chronic hepatitis, viral hepatitis A, B, C, D, E and G,
toxic metabolic liver damage, fatty liver, ischemia reperfusion
injury of the liver and sepsis.
[0017] In another aspect, the present invention includes a method
for the treatment of a heart disease in a mammalian subject,
comprising administering to the subject an effective amount of an
antagonist of Angpt13 of SEQ ID NO: 2, or a mammalian homologue
thereof. In one embodiment, the mammalian subject is human. The
treatment includes prevention and more specifically, the prevention
of the progression of heart disease. The antagonist administered is
an antagonist of Angpt13 of SEQ ID NO: 2. The heart disease is
selected from the group consisting of coronary artery disease,
cardiomyopathy, myocarditis, congestive heart failure (CHF), and
myocardial infarction. The antagonist is an anti-Angpt13 antibody
or an anti-.alpha.v.beta.3 antibody.
[0018] In another aspect, the present invention includes a method
for the treatment of acute liver disease, comprising administering
to a mammalian subject in need of a therapeutically effective
amount of a polypeptide comprising an amino acid sequence having at
least 80% sequence identity to the human Angpt13 sequence of SEQ ID
NO: 2, or an agonist thereof. In one embodiment, the mammalian
subject is human. The treatment includes prevention and more
specifically, the prevention of the progression of acute liver
disease. The polypeptide comprises an amino acid sequence having at
least 98% identity to the human Angpt13 sequence of SEQ ID NO: 2,
or an agonist thereof. In a preferred embodiment, the polypeptide
comprises amino acid regions 281-293 (P1, SEQ ID NO: 14), 442-460
(P2, SEQ ID NO: 15), and 415-430 (P3, SEQ ID NO: 17) of the human
Angpt13 sequence of SEQ ID NO: 2. In a further preferred
embodiment, the polypeptide comprises the fibrinogen domain of the
human Angpt13 sequence of SEQ ID NO: 2. In an even further
preferred embodiment, the method comprises the administration of an
additional therapeutic agent. The additional therapeutic agent is a
vascular endothelial growth factor (VEGF) or fibroblast growth
factor (FGF). The agonist is an agonist antibody specifically
binding Angpt13 or .alpha.v.beta.3.
[0019] In another aspect, the present invention includes a method
of inducing liver regeneration following acute liver injury,
comprising administering to a mammalian subject in need a
therapeutically effective amount of a polypeptide comprising an
amino acid sequence having at least 80% sequence identity to the
human Angpt13 sequence of SEQ ID NO: 2, or an agonist thereof. The
mammalian subject is preferably human. The human subject may have
been diagnosed with an inflammatory liver disease, such as chronic,
alcoholic or viral hepatitis, sepsis, primary biliary cirrhosis
(PBC) or primary or metastatic liver cancer, has suffered chemical
or mechanical injury to the liver or has been subject to
hepatectomy, due to any cause, such as chronic hepatitis, liver
cirrhosis, primary or metastatic liver cancer, or gallbladder
cancer. Alternatively, the patient may have been exposed to
chemical agents or other environmental or other known factors to
cause liver injury, and treated before such injury develops.
Preventative treatment is specifically within the scope of the
invention.
[0020] In another aspect, the present invention includes a method
for inducing angiogenesis in a tissue comprising treating the
tissue with an effective amount of a polypeptide comprising an
amino acid sequence having at least 80% sequence identity to the
human Angpt13 sequence of SEQ ID NO: 2, or an agonist thereof. In
one embodiment, the tissue is cardiac tissue or liver tissue which
may be diseased liver tissue that has been injured as a result of
an infectious or autoimmune process, mechanical or chemical injury.
or cancer or metastatic cancer. Preventative treatment and more
specifically the prevention of the progression of the disease is
specifically within the scope of the invention.
[0021] In another aspect, the present invention includes a method
for inhibiting an undesired increase in vascular permeability in a
tissue comprising administering an effective amount of an
antagonist of a Angpt13 of SEQ ID NO: 2, or a mammalian homologue
thereof. The increase in vascular permeability may be an increase
in permeability of small vessels following tissue damage or may
follow necrosis of vascular endothelium due to exposure to toxins.
The increased vascular permeability is associated with
inflammation, preferably chronic inflammation. The tissue is liver
tissue or heart tissue. Preventative treatment and more
specifically the prevention of the progression of the disease is
specifically within the scope of the invention.
[0022] In another aspect, the present invention includes a method
for identifying a human subject at risk of cardiovascular disease,
preferably before serious damage occurs. The method comprises
determining the level of Angpt13 mRNA or its expression product in
the heart tissue of said subject, relative to the level of Angpt13
or its expression product in the heart tissue of said subject,
relative to the level of Angpt13 or its expression product in
normal heart tissue, and identifying the subject as being at risk
if the level of Angpt13 mRNA or its expression product in the heart
tissue of the subject is elevated relative to the normal heart
tissue. The heart tissue sample may be taken from a subject
suspected of being at risk of cardiovascular disease, preferably
from a human patient, and may be subjected to differential gene
expression analysis to detect upregulation of a human Angpt13 gene
of SEQ ID NO: 1, comparing the expression of Angpt13 in the at risk
heart tissue sample to expression in a second heart sample taken
from normal heart tissue. The differential gene expression analysis
may be performed by known techniques, including northern blotting,
in situ hybridization, reverse transcription polymerase chain
reaction (RT-PCR) or by using microarray technique.
[0023] In another aspect, the present invention includes a method
for identifying a human subject at risk of liver damage, preferably
before serious damage occurs. The method comprises determining the
level of Angpt13 mRNA or its expression product in the liver tissue
of said subject, relative to the level of Angpt13 or its expression
product in normal liver tissue, and identifying the subject as
being at risk if the level of Angpt13 mRNA or its expression
product in the liver tissue of the subject is elevated relative to
the normal liver tissue. The liver tissue sample may be taken from
a subject suspected of being at risk of liver damage, preferably
from a human patient, and may be subjected to differential gene
expression analysis to detect upregulation of a human Angpt13 gene
of SEQ ID NO: 1, comparing the expression of Angpt13 in the at risk
liver sample to expression in a second liver sample taken from
normal liver tissue. The differential gene expression analysis may
be performed by known techniques, including northern blotting, in
situ hybridization, reverse transcription polymerase chain reaction
(RT-PCR) or by using microarray technique.
[0024] In all therapeutic applications (including prevention), the
Angpt13 polypeptide, or an agonist or an antagonist thereof, may be
administered in combination with a further therapeutic agent, such
as a further angiogenic factor, e.g. vascular endothelial growth
factors (VEGF), or fibroblast growth factor (FGF).
BRIEF DESCRIPTION OF THE DRAWINGS
[0025] FIG. 1 is the nucleotide sequence of Angpt13 (SEQ. ID NO: 1)
(DNA 16451).
[0026] FIGS. 2A and 2B are the amino acid sequence of Angpt13 (SEQ.
ID NO: 2).
[0027] FIG. 3A is a comparison of the domain structure of Angpt13
(SEQ ID NO: 2) and angiopoietin-1 (ANG1) and angiopoietin-2
(ANG2).
[0028] FIG. 3B shows the result of FACS analysis of IIMVEC cell
incubated with conditioned medium containing gD-epitope tagged
version of human ANG2, ARP1, Angpt13 or control medium.
[0029] FIG. 4 shows the result of co-immunoprecipitation
experiments using 293 cells cotransfected with plasmids encoding
gD-tagged version of ANG1, ANG2, ARP1, Angpt13 and Tie1 receptor or
Tie2 receptor, respectively. Supernatants were immunoprecipitated
with antibodies against Tie1 or Tie2 and proteins resolved by
SDS-PAGE and blotted to PVDF membrane were incubated with
antibodies against the gD tag or the Tie receptors,
respectively.
[0030] FIGS. 5A-C show homology modeling of the fibrinogen domain
of Angpt13. (A) Ribbon diagram of the superimposition of the x-ray
structure of the C terminus of the .gamma.-chain of human
fibrinogen (3FIB) in white, and the modeled structure of the
fibrinogen-like domain of Angpt13 in green. Alpha helices are shown
as cylinders and beta strands as arrows. Regions that differ in
both structures are labeled. (B) Ribbon diagram of the modeled
structure of the fibrinogen-like domain of Angpt13 in green.
Regions P1, P1, and P3 involved .alpha.5.beta.3 are highlighted in
yellow. (C) Sequence alignment of the C terminus of the
.gamma.-chain of human fibrinogen (3FIB) (SEQ ID NO: 27) and the
fibrinogen-like domain of Angpt13 (SEQ ID NO: 28) and human
angiopoietin 1 (SEQ ID NO: 29), 2 (SEQ ID NO: 30) and 4 (SEQ ID NO:
31). Hydrophilic and charged residues are displayed in blue, and
aromatic/hydrophobic residues in orange. The consensus sequence is
shown below the alignment; with conserved hydrophilic/charged and
aromatic/hydrophobic mutations marked as blue and orange squares,
respectively. Residues corresponding to the peptides used in our
study are boxed yellow. Numbering corresponds to the 3FIB x-ray
structure.
[0031] FIGS. 6A-C present evidence that Angpt13 is a secreted
glycoprotein. (A) Coomassie-stained SDS-polyacrylamide gel of
immunoaffinity purified human Angpt13. (B) Silver stained
SDS-polyacrylamide gel of immunoaffinity purified murine Angpt13
from transiently transfected CHO cells. (C) Comparison of molecular
weights of recombinant Angpt13 protein with (+) or without (-)
PNGase-F treatment. The predicted molecular weight for gD tagged
hAngpt13 is 60 kDa. Western blot were conducted using an anti-gD
antibody.
[0032] FIGS. 7A-E present functional analysis of the domains
engaged in endothelial cell binding by Angpt13 and identification
of .alpha.v.beta.3-integrin as mediator of biological responses.
(A) HMVEC adhesion was tested after preincubation with combinations
of the peptides p1, p2 and p3 (100 .mu.M or 250 .mu.M total),
control (NL6-PP2-scr, 250 .mu.M) or RGD or RGE peptides (250 .mu.M)
prior to stimulation with 200 nM MA for 4 hours. Adhesion in the
presence of 200 nM PMA and in the absence of peptides was assigned
a value of 100%. (B) Adhesion of 293 cells overexpressing either
integrin .alpha.IIb.beta.3, .alpha.v.beta.3, .alpha.v.beta.1, or
.alpha.v.beta.5 was tested in microtiter plates coated with 20
.mu.g/ml hAngpt13 or BSA. Cells were allowed to adhere at
37.degree. C. and quantitated after 4 hours. (C) 96-well plates
were coated with increasing amounts of hAngpt13 at 4.degree. C.
overnights, unspecific binding was blocked by 3% BSA at 37.degree.
C. for one hour and wells were washed with PBS before HMVEC cells
were plated. The data shown are means and SD of three separate
experiments. (D) HMVEC were preincubated with or without 25 mg/ml
blocking antibodies anti-.alpha.5.beta.1 (JBS5),
anti-.alpha.v.beta.3 (LM609), or anti-.alpha.v.beta.5 (P1F6) prior
to stimulation with 200 nM PMA. As negative control, adhesion was
carried out in the presence of 10 mM EDTA. (E) Migration of
nonstimulated or hAngpt13 stimulated (50 .mu.g/ml) HMCECs in the
presence or absence of 25 .mu.g /ml blocking antibodies
anti-.alpha.v.beta.3 (LM609), or anti-.alpha.v.beta.5 (PIF6) for 16
hours.
[0033] FIGS. 8A-C show that Angpt13 is expressed in hepatocytes
during development and is strongly upregulated in diseased liver.
(A) Northern blot analysis of hAngpt13 was done using human
multi-tissue blots (Clontech) and revealed expression of hAngpt13
in the liver and kidney. Each lane contains 2 .mu.g of RNA from
adult grain (BR), heart (HT), skeletal muscle (SM), colon (CO),
thymus (TH), spleen (SP), kidney (KD), liver (LI), small intestine
(SI), placenta (PL), lung (LU), and peripheral-blood leukocyte
(PBL). (B) Expression of hAngpt13 is strongly upregulated in
hepatocytes in tissues from liver cirrhosis and after toxic injury
with acetominophen. No alterations were observed within a liver
tumor samples. (C) In situ hybridization of fetal mouse liver shown
expression of mAngpt13 at E15 and E18 in hepatocytes but not in
erythroid progenitors, endothelial cells and megakaryocytes.
[0034] FIGS. 9A-E show the effects of CCLF1 on the induction of in
vivo angiogenesis in the rat cornea. (A) Representative flat-mount
phtomicrographs of rat corneas 6 days after implantation of hydron
pellets treated with buffer (Control), (B) murine Angpt13 (500 ng),
(C) VEGF (100 ng), (D) murine Angpt13 (500 ng) and VEGF (100 ng).
(E) Summary data of the in vivo angiogenic response to control,
VEGF (100 ng), mAngpt13 (500 ng), mAngpt13 (500 ng) and
combinations as indicated. Data are expressed as mean .+-.SE, n=5
animals/group. p<0.005 compared to control (Mann-Whitney test
for nonparametric values).
[0035] FIGS. 10A-B show the protective effect of murine Angpt13 in
CC14 induced liver toxicity as assessed by serum levels of
aspartate transferase (AST) at day 7 after adenoviral infection at
day 0 and CC14 treatment at day 4. FIG. 10A shows equal levels of
expression at day 7 after adenoviral infection at day 0 and CC14
treatment at day 4 of all constructs tested. FIG. 10B shows AST
levels in serum of mice at day 7 treated with the indicated viral
vectors at day 0 and CC14 at day 4. (P<0.0001)
[0036] FIGS. 11A-B show an increase in serum AST levels after
prolonged expression of murine Angpt13 in livers of C57/B16
wild-type mice. FIG. 11A shows AST levels in serum of mice at
various time-points after treatment with the indicated viral
constructs at day 0 and CC14 treatment at day 4. FIG. 11B shows an
increase in ALT and AST levels in serum of RAG2 knock-out mice 2
weeks after adenoviral infection. Results are shown in means i SEM.
The number of animals per group was 6 (P<0.0001).
[0037] FIGS. 12A-D show an increase in vascular leakage in skin of
K5-Angpt13 transgenic mice or in wild-type FVB mice in response to
intra-dermal administration of Angpt13-expressing adenoviral
vectors. FIG. 12A shows results from real-time RT-PCR analysis of
RNA isolated from various organs of transgenic and liter matched
wild-type control mice. Transgene expression in the skin reached
about 10% of the endogenous Angpt13 expression levels that was
detected in the liver. FIG. 12B shows results from real-time RT-PCR
analysis of RNA isolated from skin biopsies of transgenic and liter
matched wild-type control mice at different time points postnatal.
FIG. 12C shows results from Evans Blue assay that was performed on
11 week-old transgenic and liter matched wild-type control mice to
determine the level of vascular permeability. Transgenic mice
displayed a significant increase in vascular permeability in basal
conditions (left panels) but not when challenged with mustard oil
(right panel). The amount of extravasated Evans Blue dye was
measured by light spectrophotometer at 610 nm absorption and
expressed as the content dye per 1 mg of wet weight of tissue
(lower panel). Results are shown as means .+-.SEM, and the number
of animals per group was 6, P<0.05. FIG. 12D shows results from
Evan Blue assay performed 6 days post administration of FVB mice
injected intra-dermally with 1.times.10.sup.9 Pfu of the indicated
adenoviral construct. Skin of mice treated with Angpt13 (p<0.05)
or VEGF (p<0.005) displayed a significant increase in vascular
permeability under basal conditions (left panels) when compared to
control treated mice (LacZ). The amounts of extravasated Evans Blue
dye was measured with a light spectrophotometer at 610 nm and
expressed as the content dye per 1 mg of wet weight of tissue.
Results are shown as means ISEM, and the number of animals per
group was 6, P<0.05.
[0038] FIG. 13 shows the level of binding of freshly isolated
murine hepatocytes to recombinant murine Angpt13 (mAngpt13).
Hepatocyte adhesion to culture dishes coated at the indicated
concentrations of recombinant mAngpt13, fibronectin or BSA control.
Unspecific binding was blocked by 3% BSA at 37.degree. C. for 1
hour, and wells were washed with PBS before cells were plated. The
data shown represent means .+-.SD of one representative experiment
run in triplicates of a total three independent experiments.
DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENT
[0039] A. Definitions
[0040] The term "liver disease" is used herein in the broadest
sense and refers to any disease of the liver associated with any
type of liver injury, regardless of the underlying cause. Thus,
liver disease may result, for example, from infectious or
autoimmune processes, from mechanical or chemical injury to the
liver, or from cancer, all of which are included within the
definition of "liver disease." Chemical injury to the liver can be
caused by a variety of toxins, such as alcohol, carbon
tetrachloride, trichloroethylene, iron overdose, drug overdose,
drug side-effects etc.
[0041] The term "tissue damage associated with inflammation," and
grammatical variants thereof, are used to refer to any tissue
damage that, at least partially, results from inflammation or is
accompanied by an inflammatory response. The tissue may, for
example, be liver tissue or hear tissue, and the tissue damage may,
for example, be associated with an inflammatory liver disease, or a
heart disease.
[0042] The term "inflammatory liver disease" is used herein to
refer to any liver disease, the pathogenesis of which involves the
activation and recruitment of inflammatory cells to the liver,
regardless of whether the underlying cause is an infectious or
autoimmune process, chemical injury to the liver, or other. Thus,
inflammatory liver diseases include, without limitation, alcoholic
hepatitis and cirrhosis, viral hepatitis, ischemia reperfusion
injury of the liver, sepsis and primary biliary cirrhosis (PBC).
For review, see Lawson et al., Toxicol Sci 54:509-16 (2000).
[0043] The term "chronic liver disease" is used herein to refer to
liver diseases characterized by the overexpression of Angpt13, and
includes, without limitation, inflammatory diseases of the liver
and liver tumors. Inflammatory diseases of the liver include, for
example, cirrhosis, such as, alcoholic liver cirrhosis and primary
biliary cirrhosis (PBC), liver fibrosis, chronic hepatitis, i.e.
chronic autoimmune hepatitis, chronic alcoholic hepatitis,
non-alcoholic steatohepatitis (NASH, also known as steatosis),
viral hepatitis A, B, C, D, E and G, toxic metabolic liver damage,
fatty liver, ischemia reperfusion injury of the liver, and sepsis.
liver tumors include, for example, hepatocellular carcinoma,
cholangiocarcinoina, and metastatic cancer of the liver.
[0044] The term "acute liver disease" is used herein to refer to a
liver disease of short duration, the history of which typically
does not exceed six months. Included within this definition are,
for example, acute hepatitis, i.e. acute autoimmune hepatitis and
acute alcoholic hepatitis, and acute liver failure. Specifically
included within the definition is any liver disease of short
duration that is not characterized by the overexpression of
Angpt13.
[0045] The term "cardiac disease" is used herein to refer to any
heart disease the pathogenesis of which includes an inflammatory
response, or in the development of which inflammation is a risk
factor. Specifically included within the definition is any cardiac
disease characterized by elevated expression of Angpt13. Cardiac
diseases encompassed by this definition include, without
limitation, coronary artery disease, cardiomyopathy, such as
hypertrophic cardiomyopathy, non-specific hypertrophy and dilated
cardiomyopathy, myocarditis, congestive heart failure (CHF), heart
attack, and the like.
[0046] "Alcoholic hepatitis," as used herein, includes acute and
chronic hepatitis resulting from excessive alcohol consumption, and
can range from a mild hepatitis, with abnormal laboratory tests
being the only indication of disease, to severe liver dysfunction
with complications such as jaundice (yellow skin caused by
bilirubin retention), hepatic encephalopathy (neurological
dysfunction caused by liver failure), ascites (fluid accumulation
in the abdomen), bleeding esophageal varices (varicose veins in the
esophagus), abnormal blood clotting and coma.
[0047] The term "viral hepatitis," as used herein, refers to
hepatitis resulting from hepatitis A, B, C, D, E, or G
infection.
[0048] The hepatitis A virus (HAV) is a virus from the enterovirus
group of the Picornaviridae family, usually causing a mild illness
characterized by sudden onset of fever, malaise, nausea, anorexia,
and abdominal discomfort, followed in several days by jaundice.
[0049] The hepatitis B virus (HBV) is a mostly double-stranded DNA
virus in the Hepadnaviridae family. HBV causes hepatitis in human
and related virus in this family cause hepatitis in ducks, ground
squirrels and woodchucks. The HBV genome has four genes: pol, env,
pre-core and X that respectively encode the viral DNA-polymerase,
envelope protein, pre-core protein (which is processed to viral
capsid) and protein X. The function of protein X is not clear but
it may be involved in the activation of host cell genes and the
development of cancer. HBV causes acute and chronic hepatitis. The
chances of becoming chronically infected depends upon age. About
90% of infected neonates and 50% of infected young children will
become chronically infected. In contrast, only about 5% to 10% of
immunocompetent adults infected with HBV develop chronic hepatitis
B.
[0050] The hepatitis C virus (HCV) is a positive, single-stranded
RNA virus in the Flaviviridae family. The genome is approximately
10,000 nucleotides and encodes a single polyprotein of about 3,000
amino acids. The polyprotein is processed by host cell and viral
proteases into three major structural proteins and several
non-structural protein necessary for viral replication. Several
different genotypes of HCV with slightly different genomic
sequences have been identified that correlate with differences in
prognosis and response to treatment. About 85% of individuals
acutely infected with HCV become chronically infected. Hence, HCV
is a major cause of chronic (lasting longer than six months)
hepatitis. Once chronically infected, the virus is almost never
cleared without treatment. In rare cases, HCV infection causes
clinically acute disease and even liver failure, however, most
instances of acute infection are clinically undetectable.
[0051] The hepatitis D virus (HDV, also called delta virus) is a
small circular RNA virus. HDV is replication defective and
therefore cannot propagate in the absence of another virus. In
humans, HDV infection only occurs in the presence of HBV
infection.
[0052] The hepatitis E virus (HEV) usually causes hepatitis which
is clinically indistinguishable from hepatitis A disease. Symptoms
include malaise, anorexia, abdominal pain, arthralgia, and fever.
Hepatitis E occurs in both epidemic and sporadic-endemic forms,
usually associated with contaminated drinking water.
[0053] The hepatitis G virus (HBV) is a relatively newly discovered
flavivirus, related to but distinct from HCV, that may cause acute
and chronic hepatitis.
[0054] Ischemia reperfusion injury occurs when the flow of blood to
a region of the body is temporarily halted (ischemia) and then
re-established (reperfusion). The terms "ischemia reperfusion
injury" and "ischemic reperfusion injury," which are used
interchangeably, refer to the initial damage associated with oxygen
deprivation of a cell and the subsequent damage associated with the
inflammatory response when the cell is resupplied with oxygen.
Ischemia reperfusion injury can occur during certain surgical
procedures, such as repair of certain aortic aneurysms and organ
transplantation. The injury may occur in the parts of the body to
which the blood supply was interrupted, or it can occur in parts
fully supplied with blood during the period of ischemia. Ischemia
reperfusion injury of the liver may result, for example, from
hepatic and biliary surgical resections, and clinically is
manifested by such complications as hepatic dysfunction including
acute hepatocellular damage and necrosis.
[0055] "Primary biliary cirrhosis (PBC)" is a disease characterized
by inflammatory destruction of the small bile ducts within the
liver. PBC eventually leads to cirrhosis of the liver. The etiology
of PBC is not entirely understood, but because of the presence of
autoantibodies, it is generally thought to be an autoimmune
disease, however, other etiologies, such as infectious agents, have
not been completely excluded. About 90% of patients diagnosed with
PBC are women, most commonly between the ages of 40 and 60
years.
[0056] "Sepsis" is a result of bacterial infection that can
originate in any part of the body, including the liver or biliary
tract. Sepsis can be a life threatening situation, especially in
people with a weakened immune system.
[0057] The term "angiogenesis," as used herein, refers to the
process whereby new blood vessels emerge from existing vasculature
and requires both proliferation and motility of the endothelial
cells to proceed.
[0058] The term "cirrhosis" is used herein to refer to a pathologic
liver condition characterized anatomically by widespread nodules in
the liver combined with fibrosis. Cirrhosis is the final common
pathway for must types of chronic liver diseases, including those
associated with chronic alcohol abuse, chronic viral hepatitis,
metabolic and biliary diseases.
[0059] The terms "Angpt13 polypeptide", "Angpt13 protein", and
"Angpt13" are used interchangeably, and encompass native sequence
Angpt13 and Angpt13 polypeptide variants (which are further defined
herein). The Angpt13 polypeptide may be isolated from a variety of
sources, such as from human tissue types or from another source, or
prepared by recombinant and/or synthetic methods. In is noted, that
Angpt13 was earlier also referred to as "FLS139," "NL6," or "CCFL1"
Accordingly, any mention of Angpt13 should also be read as
referring to FLS139, NL6 and CCFL1 polypeptides.
[0060] A "native sequence Angpt13" or "native Angpt13" comprises a
polypeptide having the same amino acid sequence as a Angpt13
molecule derived from nature. Such native sequence Angpt13 can be
isolated from nature or can be produced by recombinant and/or
synthetic means. The term "native sequence Angpt13" or "native
Angpt13" specifically encompasses naturally-occurring truncated or
secreted forms (e.g., an extracellular domain sequence),
naturally-occurring variant forms (e.g., alternatively spliced
forms) and naturally-occurring allelic variants of Angpt13. In one
embodiment of the invention, the native sequence Angpt13 is a
mature or full-length native sequence Angpt13 comprising amino
acids 1 to 460 of SEQ ID NO: 2. While the human Angpt13 polypeptide
of SEQ ID NO: 2 is shown to begin with the methionine residue
designated herein as amino acid position 1, it is conceivable and
possible that another methionine residue located either upstream or
downstream from amino acid position 1 in SEQ ID NO: 2 may be
employed as the starting amino acid residue for the Angpt13
polypeptide. In addition, the terms "native sequence Angpt13" and
"native Angpt13" specifically include polypeptide without the
initiating methionine.
[0061] The "Angpt13 variant" or "Angpt13 variant polypeptide,"
which terms are used interchangeably, means an active Angpt13
polypeptide as defined below having at least about 80% amino acid
sequence identity with the amino acid sequence of (a) residues 1 to
460 of the Angpt13 polypeptide of SEQ ID NO: 2, or a non-human
mammalian homologue thereof, or (b) another specifically derived
fragment of the amino acid sequence of SEQ ID NO:2 or a non-human
mammalian homologue thereof. Such Angpt13 variant polypeptides
include, for instance, Angpt13 polypeptides wherein one or more
amino acid residues are added, or deleted, at the N- and/or
C-terminus, as well as within one or more internal domains, of the
sequence of SEQ ID NO: 2. Ordinarily, a Angpt13 variant polypeptide
will have at least about 80% amino acid sequence identity, more
preferably at least about 81% amino acid sequence identity, more
preferably at least about 82% amino acid sequence identity, more
preferably at least about 83% amino acid sequence identity, more
preferably at least about 84% amino acid sequence identity, more
preferably at least about 85% amino acid sequence identity, more
preferably at least about 86% amino acid sequence identity, more
preferably at least about 87% amino acid sequence identity, more
preferably at least about 88% amino acid sequence identity, more
preferably at least about 89% amino acid sequence identity, more
preferably at least about 90% amino acid sequence identity, more
preferably at least about 91% amino acid sequence identity, more
preferably at least about 92% amino acid sequence identity, more
preferably at least about 93% amino acid sequence identity, more
preferably at least about 94% amino acid sequence identity, more
preferably at least about 95% amino acid sequence identity, more
preferably at least about 96% amino acid sequence identity, more
preferably at least about 97% amino acid sequence identity, more
preferably at least about 98% amino acid sequence identity and yet
more preferably at least about 99% amino acid sequence identity
with residues 1 to 460 of the Angpt13 polypeptide of SEQ ID NO: 2,
or a non-human mammalian homologue thereof. Angpt13 variant
polypeptides do not encompass a native Angpt13 polypeptide
sequence. Ordinarily, Angpt13 variant polypeptides are at least
about 10 amino acids in length, often at least about 20 amino acids
in length, more often at least about 30 amino acids in length, more
often at least about 40 amino acids in length, more often at least
about 50 amino acids in length, more often at least about 60 amino
acids in length, more often at least about 70 amino acids in
length, more often at least about 80 amino acids in length, more
often at least about 90 amino acids in length, more often at least
about 100 amino acids in length, more often at least about 150
amino acids in length, more often at least about 200 amino acids in
length, more often at least about 250 amino acids in length, more
often at least about 300 amino acids in length, or more.
Particularly preferred Angpt13 variants retain at least one of
amino acid regions 281 to 193, 415 to 430, and 442-460 of the
native human Angpt13 sequence of SEQ ID NO: 2, or corresponding
region(s) of a non-human mammalian Angpt13 homologue, or contain
only conservative amino acid substitutions within such regions.
[0062] The term "fibrinogen domain" or "fibrinogen-like domain" is
used to refer to amino acids from about position 238 to about
position 460 in the amino acid sequence of Angpt13 (SEQ ID NO:
2).
[0063] "Percent (%) amino acid sequence identity" with respect to
the Angpt13 polypeptide sequences identified herein is defined as
the percentage of amino acid residues in a candidate sequence that
are identical with the amino acid residues in a Angpt13 sequence,
after aligning the sequences and introducing gaps, if necessary, to
achieve the maximum percent sequence identity, and not considering
any conservative substitutions as part of the sequence identity.
Alignment for purposes of determining percent amino acid sequence
identity can be achieved in various ways that are within the skill
in the art, for instance, using publicly available computer
software such as BLAST, BLAST-2, ALIGN, ALIGN-2 or Megalign
(DNASTAR) software. Those skilled in the art can determine
appropriate parameters for measuring alignment, including any
algorithms needed to achieve maximal alignment over the full-length
of the sequences being compared. For purposes herein, however, %
amino acid sequence identity values are obtained as described below
by using the sequence comparison computer program ALIGN-2, wherein
the complete source code for the ALIGN-2 program is provided in
FIGS. 4A-Q. The ALIGN-2 sequence comparison computer program was
authored by Genentech, Inc. and the source code shown in FIGS. 4A-Q
has been filed with user documentation in the U.S. Copyright
Office, Washington D.C., 20559, where it is registered under U.S.
Copyright Registration No. TXU510087. The ALIGN-2 program is
publicly available through Genentech, Inc., South San Francisco,
Calif. or may be compiled from the source code provided in FIGS.
4A-Q. The ALIGN-2 program should be compiled for use on a UNIX
operating system, preferably digital UNIX V4.0D. All sequence
comparison parameters are set by the ALIGN-2 program and do not
vary.
[0064] For purposes herein, the % amino acid sequence identity of a
given amino acid sequence A to, with, or against a given amino acid
sequence B (which can alternatively be phrased as a given amino
acid sequence A that has or comprises a certain % amino acid
sequence identity to, with, or against a given amino acid sequence
B) is calculated as follows: 100 times the fraction X/Y
[0065] where X is the number of amino acid residues scored as
identical matches by the sequence alignment program ALIGN-2 in that
program's alignment of A and B, and where Y is the total number of
amino acid residues in B. It will be appreciated that where the
length of amino acid sequence A is not equal to the length of amino
acid sequence B, the % amino acid sequence identity of A to B will
not equal the % amino acid sequence identity of B to A.
[0066] Unless specifically stated otherwise, all % amino acid
sequence identity values used herein are obtained as described
above using the ALIGN-2 sequence comparison computer program.
However, % amino acid sequence identity may also be determined
using the sequence comparison program NCBI-BLAST2 (Altschul et al.,
Nucleic Acids Res. 25:3389-3402 (1997)). The NCBI-BLAST2 sequence
comparison program may be downloaded from
http://www.ncbi.nlm.nih.gov. NCBI-BLAST2 uses several search
parameters, wherein all of those search parameters are set to
default values including, for example, unmask=yes, strand=all,
expected occurrences=10, minimum low complexity length=15/5,
multi-pass e-value=0.01, constant for multi-pass=25, dropoff for
final gapped alignment=25 and scoring matrix=BLOSUM62.
[0067] In situations where NCBI-BLAST2 is employed for amino acid
sequence comparisons, the % amino acid sequence identity of a given
amino acid sequence A to, with, or against a given amino acid
sequence B (which can alternatively be phrased as a given amino
acid sequence A that has or comprises a certain % amino acid
sequence identity to, with, or against a given amino acid sequence
B) is calculated as follows: 100 times the fraction X/Y
[0068] where X is the number of amino acid residues scored as
identical matches by the sequence alignment program NCBI-BLAST2 in
that program's alignment of A and B, and where Y is the total
number of amino acid residues in B. It will be appreciated that
where the length of amino acid sequence A is not equal to the
length of amino acid sequence B, the % amino acid sequence identity
of A to B will not equal the % amino acid sequence identity of B to
A.
[0069] "Angpt13 variant nucleic acid sequence" means a nucleic acid
molecule which encodes an active Angpt13 polypeptide as defined
below and which has at least about 80% nucleic acid sequence
identity with either (a) a nucleic acid sequence which encodes
residues 1 to 460 of the Angpt13 amino acid sequence of SEQ ID NO:
2, or a non-human mammalian homologue thereof, or (b) a nucleic
acid sequence which encodes another specifically derived fragment
of the amino acid sequence of SFQ ID NO: 2 or a non-human mammalian
homologue. Ordinarily, a Angpt13 variant polynucleotide will have
at least about 80% nucleic acid sequence identity, more preferably
at least about 81% nucleic acid sequence identity, more preferably
at least about 82% nucleic acid sequence identity, more preferably
at least about 83% nucleic acid sequence identity, more preferably
at least about 84% nucleic acid sequence identity, more preferably
at least about 85% nucleic acid sequence identity, more preferably
at least about 86% nucleic acid sequence identity, more preferably
at least about 87% nucleic acid sequence identity, more preferably
at least about 88% nucleic acid sequence identity, more preferably
at least about 89% nucleic acid sequence identity, more preferably
at least about 90% nucleic acid sequence identity, more preferably
at least about 91% nucleic acid sequence identity, more preferably
at least about 92% nucleic acid sequence identity, more preferably
at least about 93% nucleic acid sequence identity, more preferably
at least about 94% nucleic acid sequence identity, more preferably
at least about 95% nucleic acid sequence identity, more preferably
at least about 96% nucleic acid sequence identity, more preferably
at least about 97% nucleic acid sequence identity, more preferably
at least about 98% nucleic acid sequence identity and yet more
preferably at least about 99% nucleic acid sequence identity with
either (a) a nucleic acid sequence which encodes residues 1 to 460
of SEQ ID NO:2, or a non-human mammalian homologue of such human
polypeptide.
[0070] Ordinarily, Angpt13 variant nucleic acid sequences are at
least about 30 nucleotides in length, often at least about 60
nucleotides in length, more often at least about 90 nucleotides in
length, more often at least about 120 nucleotides in length, more
often at least about 150 nucleotides in length, more often at least
about 180 nucleotides in length, more often at least about 210
nucleotides in length, more often at least about 240 nucleotides in
length, more often at least about 270 nucleotides in length, more
often at least about 300 nucleotides in length, more often at least
about 450 nucleotides in length, more often at least about 600
nucleotides in length, more often at least about 900 nucleotides in
length, or more.
[0071] "Percent (%) nucleic acid sequence identity" with respect to
the Angpt13 polypeptide-encoding nucleic acid sequences identified
herein is defined as the percentage of nucleotides in a candidate
sequence that are identical with the nucleotides in a Angpt13
polypeptide-encoding nucleic acid sequence, after aligning the
sequences and introducing gaps, if necessary, to achieve the
maximum percent sequence identity. Alignment for purposes of
determining percent nucleic acid sequence identity can be achieved
in various ways that are within the skill in the art, for instance,
using publicly available computer software such as BLAST, BLAST-2,
ALIGN, ALIGN-2 or Megalign (DNASTAR) software. Those skilled in the
art can determine appropriate parameters for measuring alignment,
including any algorithms needed to achieve maximal alignment over
the full-length of the sequences being compared. For purposes
herein, however, % nucleic acid sequence identity values are
obtained as described below by using the sequence comparison
computer program ALIGN-2. The ALIGN-2 sequence comparison computer
program was authored by Genentech, Inc. and the source code has
been filed with user documentation in the U.S. Copyright Office,
Washington D.C., 20559, where it is registered under U.S. Copyright
Registration No. TXU510087. The ALIGN-2 program is publicly
available through Genentech, Inc., South San Francisco. The ALIGN-2
program should be compiled for use on a UNIX operating system,
preferably digital UNIX V4.0D. All sequence comparison parameters
are set by the ALIGN-2 program and do not vary.
[0072] For purposes herein, the % nucleic acid sequence identity of
a given nucleic acid sequence C to, with, or against a given
nucleic acid sequence D (which can alternatively be phrased as a
given nucleic acid sequence C that has or comprises a certain %
nucleic acid sequence identity to, with, or against a given nucleic
acid sequence D) is calculated as follows: 100 times the fraction
W/Z
[0073] where W is the number of nucleotides scored as identical
matches by the sequence alignment program ALIGN-2 in that program's
alignment of C and D, and where Z is the total number of
nucleotides in D. It will be appreciated that where the length of
nucleic acid sequence C is not equal to the length of nucleic acid
sequence D, the % nucleic acid sequence identity of C to D will not
equal the % nucleic acid sequence identity of D to C.
[0074] Unless specifically stated otherwise, all % nucleic acid
sequence identity values used herein are obtained as described
above using the ALIGN-2 sequence comparison computer program.
However, % nucleic acid sequence identity may also be determined
using the sequence comparison program NCBI-BLAST2 (Altschul et al.,
Nucleic Acids Res. 25:3389-3402 (1997)). The NCBI-BLAST2 sequence
comparison program may be downloaded from
http://www.ncbi.nlm.nih.gov. NCBI-BLAST2 uses several search
parameters, wherein all of those search parameters are set to
default values including, for example, unmask=yes, strand=all,
expected occurrences=10, minimum low complexity length=15/5,
multi-pass e-value=0.01, constant for multi-pass=25, dropoff for
final gapped alignment=25 and scoring matrix=BLOSUM62.
[0075] In situations where NCBI-BLAST2 is employed for sequence
comparisons, the % nucleic acid sequence identity of a given
nucleic acid sequence C to, with, or against a given nucleic acid
sequence D (which can alternatively be phrased as a given nucleic
acid sequence C that has or comprises a certain % nucleic acid
sequence identity to, with, or against a given nucleic acid
sequence D) is calculated as follows: 100 times the fraction
W/Z
[0076] where W is the number of nucleotides scored as identical
matches by the sequence alignment program NCBI-BLAST2 in that
program's alignment of C and D, and where Z is the total number of
nucleotides in D. It will be appreciated that where the length of
nucleic acid sequence C is not equal to the length of nucleic acid
sequence D, the % nucleic acid sequence identity of C to D will not
equal the % nucleic acid sequence identity of D to C.
[0077] In other embodiments, Angpt13 variant polynucleotides are
nucleic acid molecules that encode an active Angpt13 polypeptide
and which are capable of hybridizing, preferably under stringent
hybridization and wash conditions, to nucleotide sequences encoding
the full-length Angpt13 polypeptide of SEQ ID NO: 2. Angpt13
variant polypeptides may be those that are encoded by a Angpt13
variant polynucleotide.
[0078] The term "positives", in the context of the amino acid
sequence identity comparisons performed as described above,
includes amino acid residues in the sequences compared that are not
only identical, but also those that have similar properties. Amino
acid residues that score a positive value to an amino acid residue
of interest are those that are either identical to the amino acid
residue of interest or are a preferred substitution of the amino
acid residue of interest.
[0079] For purposes herein, the % value of positives of a given
amino acid sequence A to, with, or against a given amino acid
sequence B (which can alternatively be phrased as a given amino
acid sequence A that has or comprises a certain % positives to,
with, or against a given amino acid sequence B) is calculated as
follows: 100 times the fraction X/Y
[0080] where X is the number of amino acid residues scoring a
positive value as defined above by the sequence alignment program
ALIGN-2 in that program's alignment of A and B, and where Y is the
total number of amino acid residues in B. It will be appreciated
that where the length of amino acid sequence A is not equal to the
length of amino acid sequence B, the % positives of A to B will not
equal the % positives of B to A.
[0081] The term "antibody" is used in the broadest sense and
specifically covers, for example, single anti-Angpt13 monoclonal
antibodies (including agonist, antagonist, and neutralizing
antibodies), anti-Angpt13 antibody compositions with polyepitopic
specificity, single chain anti-Angpt13 antibodies, and fragments of
anti-Angpt13 antibodies (see below). The term "monoclonal antibody"
as used herein refers to an antibody obtained from a population of
substantially homogeneous antibodies, i.e., the individual
antibodies comprising the population are identical except for
possible naturally-occurring mutations that may be present in minor
amounts.
[0082] The term "monoclonal antibody" as used herein refers to an
antibody obtained from a population of substantially homogeneous
antibodies, i.e., the individual antibodies comprising the
population are identical except for possible naturally-occurring
mutations that may be present in minor amounts.
[0083] "Antibody fragments" comprise a portion of an intact
antibody, preferably the antigen binding or variable region of the
intact antibody. Examples of antibody fragments include Fab, Fab',
F(ab').sub.2, and Fv fragments; diabodies; linear antibodies
(Zapata et al., Protein Eng., 8(10):1057-1062 [1995]); single-chain
antibody molecules; and multispecific antibodies formed from
antibody fragments.
[0084] Papain digestion of antibodies produces two identical
antigen-binding fragments, called "Fab" fragments, each with a
single antigen-binding site, and a residual "Fe" fragment, whose
name reflects its ability to crystallize readily. Pepsin treatment
yields an F(ab').sub.2 fragment that has two antigen-combining
sites and is still capable of cross-linking antigen.
[0085] "Fv" is the minimum antibody fragment, which contains a
complete antigen-recognition and -binding site. This region
consists of a dimer of one heavy- and one light-chain variable
domain in tight, non-covalent association. It is in this
configuration that the three CDRs of each variable domain interact
to define an antigen-binding site on the surface of the
V.sub.H-V.sub.L dimer. Collectively, the six CDRs confer
antigen-binding specificity to the antibody. However, even a single
variable domain (or half of an Fv comprising only three CDRs
specific for an antigen) has the ability to recognize and bind
antigen, although at a lower affinity than the entire binding
site.
[0086] The Fab fragment also contains the constant domain of the
light chain and the first constant domain (CH1) of the heavy chain.
Fab fragments differ from Fab' fragments by the addition of a few
residues at the carboxy terminus of the heavy chain CH1 domain
including one or more cysteines from the antibody hinge region.
Fab'-SH is the designation herein for Fab' in which the cysteine
residue(s) of the constant domains bear a free thiol group.
F(ab').sub.2 antibody fragments originally were produced as pairs
of Fab' fragments which have hinge cysteines between them. Other
chemical couplings of antibody fragments are also known.
[0087] The "light chains" of antibodies (immunoglobulins) from any
vertebrate species can be assigned to one of two clearly distinct
types, called kappa ( ) and lambda ( ), based on the amino acid
sequences of their constant domains.
[0088] Depending on the amino acid sequence of the constant domain
of their heavy chains, immunoglobulins can be assigned to different
classes. There are five major classes of immunoglobulins: IgA, IgD,
IgE, IgG, and IgM, and several of these may be further divided into
subclasses (isotypes), e.g., IgG1, IgG2, IgG3, IgG4, IgA, and IgA2.
The heavy-chain constant domains that correspond to the different
classes of immunoglobulins are called , , , , and , respectively.
The subunit structures and three-dimensional configurations of
different classes of immunoglobulins are well known.
[0089] The term "diabodies" refers to small antibody fragments with
two antigen-binding sites, which fragments comprise a heavy-chain
variable domain (V.sub.H) connected to a light-chain variable
domain (V.sub.L) in the same polypeptide chain (V.sub.H-V.sub.L).
By using a linker that is too short to allow pairing between the
two domains on the same chain, the domains are forced to pair with
the complementary domains of another chain and create two
antigen-binding sites. Diabodies are described more fully in, for
example, EP 404,097; WO 93/11161; and Hollinger et al., Proc. Natl.
Acad. Sci. USA, 90:6444-6448 (1993).
[0090] An "isolated" antibody is one which has been identified and
separated and/or recovered from a component of its natural
environment. Contaminant components of its natural environment are
materials which would interfere with diagnostic or therapeutic uses
for the antibody, and may include enzymes, hormones, and other
proteinaceous or nonproteinaceous solutes. In preferred
embodiments, the antibody will be purified (1) to greater than 95%
by weight of antibody as determined by the Lowry method, and most
preferably more than 99% by weight, (2) to a degree sufficient to
obtain at least 15 residues of N-terminal or internal amino acid
sequence by use of a spinning cup sequenator, or (3) to homogeneity
by SDS-PAGE under reducing or nonreducing conditions using
Coomassie blue or, preferably, silver stain. Isolated antibody
includes the antibody in situ within recombinant cells since at
least one component of the antibody's natural environment will not
be present. Ordinarily, however, isolated antibody will be prepared
by at least one purification step.
[0091] The term "variable" refers to the fact that certain portions
of the variable domains differ extensively in sequence among
antibodies and are used in the binding and specificity of each
particular antibody for its particular antigen. However, the
variability is not evenly distributed throughout the variable
domains of antibodies. It is concentrated in three segments called
complementarity-determining regions (CDRs) or hypervariable regions
both in the light-chain and the heavy-chain variable domains. The
more highly conserved portions of variable domains are called the
framework (FR) regions. The variable domains of native heavy and
light chains each comprise four FR regions, largely adopting a
-sheet configuration, connected by three CDRs, which form loops
connecting, and in some cases forming part of, the -sheet
structure. The CDRs in each chain are held together in close
proximity by the FR regions and, with the CDRs from the other
chain, contribute to the formation of the antigen-binding site of
antibodies (see Kabat et al., NIH Publ. No. 91-3242, Vol. 1, pages
647-669 (1991)). The constant domains are not involved directly in
binding an antibody to an antigen, but exhibit various effector
functions, such as participation of the antibody in
antibody-dependent cellular toxicity.
[0092] The term "hypervariable region" when used herein refers to
the amino acid residues of an antibody which are responsible for
antigen-binding. The hypervariable region comprises amino acid
residues from a "complementarity determining region" or "CDR"
(i.e., residues 24-34 (L1), 50-56 (L2) and 89-97 (L3) in the light
chain variable domain and 31-35 (H1), 50-65 (H2) and 95-102 (H3) in
the heavy chain variable domain; Kabat et al., Sequences of
Proteins of Immunological Interest, 5th Ed. Public Health Service,
National Institute of Health, Bethesda, Md. [1991]) and/or those
residues from a "hypervariable loop" (i.e., residues 26-32 (L1),
50-52 (L2) and 91-96 (L3) in the light chain variable domain and
26-32 (H1), 53-55 (H2) and 96-101 (H3) in the heavy chain variable
domain ; Clothia and Lesk, J. Mol. Biol., 196:901-917 [1987]).
"Framework" or "FR" residues are those variable domain residues
other than the hypervariable region residues as herein defined.
[0093] "Humanized" forms of non-human (e.g., murine) antibodies are
chimeric immunoglobulins, immunoglobulin chains or fragments
thereof (such as Fv, Fab, Fab', F(ab').sub.2 or other
antigen-binding subsequences of antibodies) which contain minimal
sequence derived from non-human immunoglobulin. For the most part,
humanized antibodies are human immunoglobulins (recipient antibody)
in which residues from a CDR of the recipient are replaced by
residues from a CDR of a non-human species (donor antibody) such as
mouse, rat or rabbit having the desired specificity, affinity, and
capacity. In some instances, Fv FR residues of the human
immunoglobulin are replaced by corresponding non-human residues.
Furthermore, humanized antibodies may comprise residues which are
found neither in the recipient antibody nor in the imported CDR or
framework sequences. These modifications are made to further refine
and maximize antibody performance. In general, the humanized
antibody will comprise substantially all of at least one, and
typically two, variable domains, in which all or substantially all
of the CDR regions correspond to those of a non-human
immunoglobulin and all or substantially all of the FR regions arc
those of a human immunoglobulin sequence. The humanized antibody
optimally also will comprise at least a portion of an
immunoglobulin constant region (Fe), typically that of a human
immunoglobulin. For further details, see, Jones et al., Nature,
321:522-525 (1986); Reichmann et al., Nature, 332:323-329 [1988];
and Presta, Curr. Op. Struct. Biol., 2:593-596 (1992). The
humanized antibody includes a PRIMATIZED.TM. antibody wherein the
antigen-binding region of the antibody is derived from an antibody
produced by immunizing macaque monkeys with the antigen of
interest.
[0094] As used herein, the term "immunoadhesin" designates
antibody-like molecules which combine the binding specificity of a
heterologous protein (an "adhesin") with the effector functions of
immunoglobulin constant domains. Structurally, the immunoadhesins
comprise a fusion of an amino acid sequence with the desired
binding specificity which is other than the antigen recognition and
binding site of an antibody (i.e., is "heterologous"), and an
immunoglobulin constant domain sequence. The adhesin part of an
immunoadhesin molecule typically is a contiguous amino acid
sequence comprising at least the binding site of a receptor or a
ligand. The immunoglobulin constant domain sequence in the
immunoadhesin may be obtained from any immunoglobulin, such as
IgG-1, IgG-2, IgG-3, or IgG-4 subtypes, IgA (including IgA-1 and
IgA-2), IgE, IgD or IgM.
[0095] "Stringency" of hybridization reactions is readily
determinable by one of ordinary skill in the art, and generally is
an empirical calculation dependent upon probe length, washing
temperature, and salt concentration. In general, longer probes
require higher temperatures for proper annealing, while shorter
probes need lower temperatures. Hybridization generally depends on
the ability of denatured DNA to reanneal when complementary strands
are present in an environment below their melting temperature. The
higher the degree of desired homology between the probe and
hybridizable sequence, the higher the relative temperature which
can be used. As a result, it follows that higher relative
temperatures would tend to make the reaction conditions more
stringent, while lower temperatures less so. For additional details
and explanation of stringency of hybridization reactions, see
Ausubel et al., Current Protocols in Molecular Biology, Wiley
Interscience Publishers, (1995).
[0096] "Stringent conditions" or "high stringency conditions", as
defined herein, may be identified by those that: (1) employ low
ionic strength and high temperature for washing, for example 0.015
M sodium chloride/0.0015 M sodium citrate/0.1% sodium dodecyl
sulfate at 50.degree. C.; (2) employ during hybridization a
denaturing agent, such as formamide, for example, 50% (v/v)
formamide with 0.1% bovine serum albumin/0.1% Ficoll/0.1%
polyvinylpyrrolidone/50mM sodium phosphate buffer at pH 6.5 with
750 mM sodium chloride, 75 mM sodium citrate at 42.degree. C.; or
(3) employ 50% formamide, 5.times.SSC (0.75 M NaCl, 0.075 M sodium
citrate), 50 mM sodium phosphate (pH 6.8), 0.1% sodium
pyrophosphate, 5.times.Denhardt's solution, sonicated salmon sperm
DNA (50 g/ml), 0.1% SDS, and 10% dextran sulfate at 42.degree. C.,
with washes at 42.degree. C. in 0.2.times.SSC (sodium
chloride/sodium citrate) and 50% formamide at 55.degree. C.,
followed by a high-stringency wash consisting of 0.1.times.SSC
containing EDTA at 55.degree. C.
[0097] "Moderately stringent conditions" may be identified as
described by Sambrook et al., Molecular Cloning: A Laboratory
Manual, New York: Cold Spring Harbor Press, 1989, and include the
use of washing solution and hybridization conditions (e.g.,
temperature, ionic strength and % SDS) less stringent that those
described above. An example of moderately stringent conditions is
overnight incubation at 37.degree. C. in a solution comprising: 20%
formamide, 5.times.SSC (150 mM NaCl, 15 mM trisodium citrate), 50
mM sodium phosphate (pH 7.6), 5.times.Denhardt's solution, 10%
dextran sulfate, and 20 mg/ml denatured sheared salmon sperm DNA,
followed by washing the filters in 1.times.SSC at about
37-50.degree. C. The skilled artisan will recognize how to adjust
the temperature, ionic strength, etc. as necessary to accommodate
factors such as probe length and the like.
[0098] The term "epitope tagged" when used herein refers to a
chimeric polypeptide comprising a Angpt13 polypeptide fused to a
"tag polypeptide". The tag polypeptide has enough residues to
provide an epitope against which an antibody can be made, yet is
short enough such that it does not interfere with activity of the
polypeptide to which it is fused. The tag polypeptide preferably
also is fairly unique so that the antibody does not substantially
cross-react with other epitopes. Suitable tag polypeptides
generally have at least six amino acid residues and usually between
about 8 and 50 amino acid residues (preferably, between about 10
and 20 amino acid residues).
[0099] The terms "biological activity" and "biologically active"
with regard to the Angpt13 molecules herein refer to the ability of
a molecule to specifically bind to and regulate cellular responses
mediated by a native .alpha.v.beta.3 integrin receptor, such as
adhesion and/or migration of vascular endothelial cells. In this
context, the term "regulate" includes both promotion and
inhibition, therefore, the (native and variant) Angpt13 molecules
of the present invention include agonists and antagonists of a
native .alpha.v.beta.3 integrin receptor. Preferred biological
activities of the Angpt13 ligands herein include the promotion or
inhibition of vascularization (angiogenesis), and in particular,
involvement in the angiogenic process during liver
regeneration.
[0100] The term "agonist" is used to refer to peptide and
non-peptide analogs of the native Angpt13 molecules of the present
invention, and to antibodies specifically binding such native
Angpt13 molecules, provided that they have the ability to signal
through a native Angpt13 receptor (.alpha.v.beta.3). In other
words, the term "agonist" is defined in the context of the
biological role of the Angpt13 receptor (.alpha.v.beta.3).
Preferred agonists possess the preferred biological activities of a
native Angpt13, as defined above, such as the promotion of
vascularization (angiogenesis), for example, during liver
regeneration.
[0101] The term "antagonist" is used to refer to peptide and
non-peptide analogs of a native Angpt13 molecule, and to
antibodies, provided that they have the ability to inhibit the
biological function of Angpt13 regardless of whether they have the
ability to bind Angpt13 or its receptor, .alpha.v.beta.3.
Accordingly, antagonists that have the ability to bind Angpt13 or
its receptor include anti-Angpt13 and anti-.alpha.v.beta.3
antibodies. Preferred antagonists are inhibitors of the adhesion
and/or migration of vascular endothelial cells, and in particular
inhibitors of angiogenesis, especially angiogenesis associated with
malignant tumor growth, inflammatory diseases of the liver or
cardiac diseases.
[0102] "Tumor" as used herein, refers to all neoplastic cell growth
and proliferation, whether malignant or benign, and all
pre-cancerous and cancerous cells and tissues.
[0103] The terms "cancer" and "cancerous" refer to or describe the
physiological condition in mammals that is typically characterized
by unregulated cell growth. Examples of cancer include, but are not
limited to, carcinoma, lymphoma, blastoma, sarcoma, and leukemia.
More particular examples of cancers include breast cancer, prostate
cancer, colon cancer, squamous cell cancer, small-cell lung cancer,
non-small cell lung cancer, gastrointestinal cancer, pancreatic
cancer, glioblastoma, cervical cancer, ovarian cancer, liver
cancer, bladder cancer, hepatoma, colorectal cancer, endometrial
carcinoma, salivary gland carcinoma, kidney cancer, vulval cancer,
thyroid cancer, hepatic carcinoma and various types of head and
neck cancer.
[0104] "Treatment" refers to both therapeutic treatment and
prophylactic or preventative measures, wherein the object is to
prevent or slow down (lessen) the targeted pathologic condition or
disorder. Those in need of treatment include those already with the
disorder as well as those prone to have the disorder or those in
whom the disorder is to be prevented. In tumor (e.g., cancer)
treatment, a therapeutic agent may directly decrease the pathology
of tumor cells, or render the tumor cells more susceptible to
treatment by other therapeutic agents, e.g., radiation and/or
chemotherapy.
[0105] The "pathology" of cancer includes all phenomena that
compromise the well-being of the patient. This includes, without
limitation, abnormal or uncontrollable cell growth, metastasis,
interference with the normal functioning of neighboring cells,
release of cytokines or other secretory products at abnormal
levels, suppression or aggravation of inflammatory or immunological
response, etc.
[0106] "Chronic" administration refers to administration of the
agent(s) in a continuous mode as opposed to an acute mode, so as to
maintain the initial therapeutic effect (activity) for an extended
period of time. "Intermittent" administration is treatment that is
not consecutively done without interruption, but rather is cyclic
in nature.
[0107] "Mammal" for purposes of treatment refers to any animal
classified as a mammal, including humans, domestic and farm
animals, and zoo, sports, or pet animals, such as dogs, cats,
cattle, horses, sheep, pigs, goats, rabbits, etc. Preferably, the
mammal is human.
[0108] Administration "in combination with" one or more further
therapeutic agents includes simultaneous (concurrent) and
consecutive administration in any order.
[0109] "Carriers" as used herein include pharmaceutically
acceptable carriers, excipients, or stabilizers which are nontoxic
to the cell or mammal being exposed thereto at the dosages and
concentrations employed. Often the physiologically acceptable
carrier is an aqueous pH buffered solution. Examples of
physiologically acceptable carriers include buffers such as
phosphate, citrate, and other organic acids; antioxidants including
ascorbic acid; low molecular weight (less than about 10 residues)
polypeptide; proteins, such as serum albumin, gelatin, or
immunoglobulins; hydrophilic polymers such as polyvinylpyrrolidone;
amino acids such as glycine, glutamine, asparagine, arginine or
lysine; monosaccharides, disaccharides, and other carbohydrates
including glucose, mannose, or dextrins; chelating agents such as
EDTA; sugar alcohols such as mannitol or sorbitol; salt-forming
counterions such as sodium; and/or nonionic surfactants such as
TWEEN.TM., polyethylene glycol (PEG), and PLURONICS.TM..
[0110] A "liposome" is a small vesicle composed of various types of
lipids, phospholipids and/or surfactant which is useful for
delivery of a drug (such as a PRO10282 polypeptide or antibody
thereto) to a mammal. The components of the liposome are commonly
arranged in a bilayer formation, similar to the lipid arrangement
of biological membranes.
[0111] A "small molecule" is defined herein to have a molecular
weight below about 500 Daltons.
[0112] An "effective amount" of a Angpt13 polypeptide disclosed
herein is an amount capable of triggering a desired biological
response. In particular, an "effective amount" of a Angpt13
polypeptide or an agonist thereof preferably is an amount capable
of regulating a cellular response mediated by an .alpha.v.beta.3
Angpt13 receptor, such as adhesion and/or migration of endothelial
cells, e.g. vascular endothelial cells. The term includes an amount
capable of invoking angiogenesis, especially angiogenesis
associated with liver regeneration.
[0113] A "therapeutically effective amount", in reference to the
treatment of tumor, e.g. when antagonists of a native Angpt13
polypeptide are used, refers to an amount capable of invoking one
or more of the following effects: (1) inhibition, to some extent,
of tumor growth, including, slowing down and complete growth
arrest; (2) reduction in the number of tumor cells; (3) reduction
in tumor size; (4) inhibition (i.e., reduction, slowing down or
complete stopping) of tumor cell infiltration into peripheral
organs; (5) inhibition (i.e., reduction, slowing down or complete
stopping) of metastasis; (6) enhancement of anti-tumor immune
response, which may, but does not have to, result in the regression
or rejection of the tumor; and/or (7) relief, to some extent, of
one or more symptoms associated with the disorder. A
"therapeutically effective amount" of a Angpt13 polypeptide
antagonist for purpose of treatment of tumor may be determined
empirically and in a routine manner.
[0114] "Vascular endothelial growth factor" or "VEGF" is an
endothelial cell-specific mitogen which as been shown to be
stimulated by hypoxia and required for tumor angiogenesis (Senger
et al., Cancer 46:5629-5632 (1986); Kim et al., Nature 362:841-844
(1993); Schweiki et al., Nature 359:843-845 (1992); Plate et al.,
Nature 359:845-848 (1992)). The term, as used herein, includes all
VEGF isoforms, including, without limitation, the human VEGF121 and
VEGF165 isoforms.
[0115] B. Non-Human Mammalian Homologues of Human Angpt13
[0116] The isolation of native human Angpt13 is described in
Example 1, and also in PCT Publication WO 99/15654, which is hereby
expressly incorporated by reference in its entirety. Angpt13 DNA
has also been deposited with the American type Culture Collection
(ATCC) on Sep. 18, 1997, under the designation
FLS139-DNA16451-1078, and assigned ATCC Deposit No. 209283.
[0117] In order to identify other, non-human mammalian homologues,
or splice or other naturally occurring variants, libraries can be
screened with probes (such as antibodies to the human Angpt13
sequence or oligonucleotides of at least about 20-80 bases)
designed to identify the gene of interest or the protein encoded by
it. Screening the cDNA or genomic library with the selected probe
may be conducted using standard procedures, such as described in
Sambrook et al., Molecular Cloning: A Laboratory Manual (New York:
Cold Spring Harbor Laboratory Press, 1989). An alternative means to
isolate the gene encoding other native Angpt13 polypeptides is to
use PCR methodology (Sambrook et al., supra; Dieffenbach et al.,
PCR Primer: A Laboratory Manual (Cold Spring Harbor Laboratory
Press, 1995)).
[0118] The oligonucleotide sequences selected as probes should be
of sufficient length and sufficiently unambiguous that false
positives are minimized. The oligonucleotide is preferably labeled
such that it can be detected upon hybridization to DNA in the
library being screened. Methods of labeling are well known in the
art, and include the use of radiolabels like .sup.32P-labeled ATP,
biotinylation or enzyme labeling. Hybridization conditions,
including moderate stringency and high stringency, are provided in
Sambrook et al., supra.
[0119] Sequences identified in such library screening methods can
be compared and aligned to other known sequences deposited and
available in public databases such as GenBank or other private
sequence databases. Sequence identity (at either the amino acid or
nucleotide level) within defined regions of the molecule or across
the full-length sequence can be determined using methods known in
the art and as described herein.
[0120] Nucleic acid having protein coding sequence may be obtained
by screening selected cDNA or genomic libraries using the deduced
amino acid sequence disclosed herein for the first time, and, if
necessary, using conventional primer extension procedures as
described in Sambrook et al., supra, to detect precursors and
processing intermediates of mRNA that may not have been
reverse-transcribed into cDNA.
[0121] C. Angpt13 Variants
[0122] Native human Angpt13 is known in the art, and disclosed, for
example, in PCT Publication No. WO 99/15654 published on Apr. 1,
1999. Variations in the native full-length sequence Angpt13 (SEQ ID
NO: 2) or in various domains of the Angpt13 amino acid sequence
described herein, can be made, for example, using any of the
techniques and guidelines for conservative and non-conservative
mutations set forth, for instance, in U.S. Pat. No. 5,364,934.
Variations may be a substitution, deletion or insertion of one or
more codons encoding the Angpt13 polypeptide that results in a
change in the amino acid sequence of Angpt13 as compared with the
native sequence of SEQ ID NO: 2. Optionally the variation is by
substitution of at least one amino acid with any other amino acid
in one or more of the domains of a native or variant Angpt13
sequence. Guidance in determining which amino acid residue may be
inserted, substituted or deleted without adversely affecting the
desired activity may be found by comparing the sequence of the
Angpt13 with that of homologous known protein molecules and
minimizing the number of amino acid sequence changes made in
regions of high homology. Amino acid substitutions can be the
result of replacing one amino acid with another amino acid having
similar structural and/or chemical properties, such as the
replacement of a leucine with a serine, i.e., conservative amino
acid replacements. Insertions or deletions may optionally be in the
range of about 1 to 5 amino acids. The variation allowed may be
determined by systematically making insertions, deletions or
substitutions of amino acids in the sequence and testing the
resulting variants for activity exhibited by the full-length or
mature native sequence.
[0123] Thus, Angpt13 polypeptide fragments are provided herein.
Such fragments may be truncated at the N-terminus or C-terminus, or
may lack internal residues, for example, when compared with a
full-length native protein. Certain fragments lack amino acid
residues that are not essential for a desired biological activity
of the Angpt13 polypeptide.
[0124] The homology modeling of the fibrinogen domain of native
human Angpt13 of SEQ ID NO: 2, and the functional analysis of the
domains engaged in endothelial cell binding by Angpt13, as
described in Example 5, are useful in designing the Angpt13
variants herein. Based on the modeled structure of the
fibrinogen-like domain of Angpt13, it was found that regions P1:
amino acids 281-293 (SEQ ID NO: 14); P2: amino acids 442-460 (SEQ
ID NO: 15); and P3 amino acids 415-430 (SEQ ID NO: 17) of native
human Angpt13 (SEQ ID NO: 2) are involved in .alpha.v.beta.3
binding. In order to retain receptor binding and the ability to
activate and signal through the receptor, the P1, P2 and P3 regions
should be substantially retained, or only conservative
substitutions should be performed in these regions. On the other
hand, in order to design Angpt13 antagonists, it might be necessary
to make more significant amino acid alterations within one or more
of these regions. Design of the Angpt13 variants is further
assisted by the ribbon diagram shown in FIG. 5B, and the sequence
alignment shown in FIG. 5C, where the hydrophilic and charged
residues are displayed in blue, and the aromatic and hydrophobic
residues are displayed in orange.
[0125] As discussed above, in particular embodiments, conservative
substitutions are of interest in making Angpt13 variants of the
present invention. Such conservative substitutions are shown in
Table 1 under the heading of preferred substitutions. If such
substitutions result in a change in biological activity, then more
substantial changes, denominated exemplary substitutions in Table
1, or as further described below in reference to amino acid
classes, are introduced and the products screened. TABLE-US-00001
TABLE 1 Original Exemplary Preferred Residue Substitutions
Substitutions Ala (A) val; leu; ile val Arg (R) lys; gln; asn lys
Asn (N) gln; his; lys; arg gln Asp (D) glu glu Cys (C) ser ser Gln
(Q) asn asn Glu (E) asp asp Gly (G) pro; ala ala His (H) asn; gln;
lys; arg arg Ile (I) leu; val; met; ala; phe; leu norleucine Leu
(L) norleucine; ile; val; ile met; ala; phe Lys (K) arg; gln; asn
arg Met (M) leu; phe; ile leu Phe (F) leu; val; ile; ala; tyr leu
Pro (P) ala ala Ser (S) thr thr Thr (T) ser ser Trp (W) tyr; phe
tyr Tyr (Y) trp; phe; thr; ser phe Val (V) ile; leu; met; phe; leu
ala; norleucine
[0126] Substantial modifications in function or immunological
identity of the Angpt13 variant polypeptide are accomplished by
selecting substitutions that differ significantly in their effect
on maintaining (a) the structure of the polypeptide backbone in the
area of the substitution, for example, as a sheet or helical
conformation, (b) the charge or hydrophobicity of the molecule at
the target site, or (c) the bulk of the side chain. Naturally
occurring residues are divided into groups based on common
side-chain properties:
[0127] (1) hydrophobic: norleucine, met, ala, val, leu, ile;
[0128] (2) neutral hydrophilic: cys, ser, thr;
[0129] (3) acidic: asp, glu;
[0130] (4) basic: asn, gln, his, lys, arg;
[0131] (5) residues that influence chain orientation: gly, pro;
and
[0132] (6) aromatic: trp, tyr, phe.
[0133] Non-conservative substitutions will entail exchanging a
member of one of these classes for another class. Such substituted
residues also may be introduced into the conservative substitution
sites or, more preferably, into the remaining (non-conserved)
sites.
[0134] The variations can be made using methods known in the art
such as oligonucleotide-mediated (site-directed) mutagenesis,
alanine scanning, and PCR mutagenesis. Site-directed mutagenesis
(Carter et al., Nucl. Acids Res., 13:4331 (1986); Zoller et al.,
Nucl. Acids Res., 10:6487 (1987)), cassette mutagenesis [Wells et
al., Gene, 34:315 (1985)], restriction selection mutagenesis (Wells
et al., Philos. Trans. R. Soc. London SerA, 317:415 (1986)) or
other known techniques can be performed on the cloned DNA to
produce the Angpt13 variant DNA.
[0135] Angpt13 fragments may be prepared by any of a number of
conventional techniques. Desired peptide fragments may be
chemically synthesized. An alternative approach involves generating
Angpt13 fragments by enzymatic digestion, e.g., by treating the
protein with an enzyme known to cleave proteins at sites defined by
particular amino acid residues, or by digesting the DNA with
suitable restriction enzymes and isolating the desired fragment.
Yet another suitable technique involves isolating and amplifying a
DNA fragment encoding a desired polypeptide fragment, by polymerase
chain reaction (PCR). Oligonucleotides that define the desired
termini of the DNA fragment are employed at the 5' and 3' primers
in the PCR. Preferably, Angpt13 polypeptide fragments share at
least one biological and/or immunological activity with the native
Angpt13 of SEQ ID NO: 2.
[0136] Scanning amino acid analysis can also be employed to
identify one or more amino acids along a contiguous sequence. Among
the preferred scanning amino acids are relatively small, neutral
amino acids. Such amino acids include alanine, glycine, serine, and
cysteine. Alanine is typically a preferred scanning amino acid
among this group because it eliminates the side-chain beyond the
beta-carbon and is less likely to alter the main-chain conformation
of the variant (Cunningham and Wells, Science, 244: 1081-1085
(1989)). Alanine is also typically preferred because it is the most
common amino acid. Further, it is frequently found in both buried
and exposed positions (Creighton, The Proteins, (W.H. Freeman &
Co., N.Y.); Chothia, J. Mol. Biol., 150:1 (1976)). If alanine
substitution does not yield adequate amounts of variant, an
isoteric amino acid can be used.
[0137] Further details of making Angpt13 variants, covalent
modifications of native and variant Angpt13 polypeptides,
antibodies specifically binding to Angpt13 (including variants),
and immunoadhesins are provided, for example, in WO 99/15654.
[0138] D. Use of Angpt13 Polypeptides
[0139] As described in the examples below, expression analysis of
Angpt13 in adult tissues demonstrated liver specific expression and
strong upregulation in hepatocytes of diseases, cirrhotic liver or
after toxic liver injury. Further, in vivo administration of
Angpt13 resulted in a an increase in vascular permeability and a
short-term protective effect from liver damage but prolonged
expression of Angpt13 was associated with liver damage. Even
further, Angpt13 induced angiogenesis when tested in the rat cornea
assay in vivo. The robust induction of vessel growth by Angpt13 in
the latter assay combined in the pronounced expression detected in
disease liver specimens strongly indicate that this factor plays an
important role in regulation of the angiogenic process during liver
regeneration.
[0140] Accordingly, Angpt13 and Angpt13 agonists are believed to be
useful in the treatment, prevention and/or identification of
subjects at risk of acute liver disease and the induction of liver
regeneration following acute liver injury and/or angiogenesis in a
tissue. The acute liver injury may be associated with inflammatory
liver disease, such as chronic, alcoholic or viral hepatitis,
chemical or mechanical injury to the liver, heptatectomy which may
be due to chronic hepatitis, liver cirrhosis, primary or metastatic
liver cancer or gallbladder cancer. The angiogenesis in a tissue
may be asociated with cardiac tissue or liver tissue that has been
injured as a result of an infectious or autoimmune process,
mechanical or chemical injury or cancer or metastatic cancer.
[0141] Accordingly, Angpt13 antagonists are believed to be useful
in the treatment and/or prevention of tissue damage characterized
by overexpression of Angpt13, a chronic liver disease, and/or a
heart disease characterized by the elevated expression of Angpt13.
Tissue damage characterized by overexpression of Angpt13 includes
liver tissue damage associated with inflammation, without
limitation inflammation associated with a chronic liver disease,
the pathogenesis of which involves the activation and recruitment
of inflammatory cells to the liver, regardless of whether the
underlying cause is an infectious or autoimmune disease, or
chemical injury to the liver, or other. Thus, liver tissue damage
characterized by overexpression of Angpt13 includes liver
cirrhosis, such as alcoholic liver cirrhosis and primary biliary
cirrhosis (PBC), liver fibrosis, chronic hepatitis, such as chronic
autoimmune hepatitis, chronic alcoholic hepatitis, and
non-alcoholic steatohepatitis (NASH), viral hpatitis A, B, C, D, E
and G, toxic metabolic liver damage, fatty liver, ischemia
reperfusion injury of the liver and sepsis, and liver damage
associated with liver tumor, without limitation hepatocellular
carcinoma, extrahepatic bile duct carcinoma, cholangiocarcinoma and
metastatic cancer of the liver. Heart tissue damage associated with
elevated expression of Angpt13 or cardiac disease, the pathogenesis
of which includes an inflammatory response, or in the development
of which inflammation is a risk factor and heart tissue damage
associated with elevated expression of Angpt13, without limitation
coronary artery disease, cardiomyopathy, such as non-specific
hypertrophy and dilated cardiomyopathy, myocarditis, congestive
heart failure (CHF), and myocardial infarction. For review, see
Lawson et al., Toxicol Sci 54:509-16 (2000), supra.
[0142] Further, Angpt13 antagonists are believed to be useful in
the inhibition of an undesired increase in vascular permeability in
a tissue. The tissue may be liver or cardiac tissue. The increase
in vascular permeability may be an increased permeability of small
vessels following tissue damage and may follow necrosis of vascular
endothelium due to exposure to toxins or may be associated with
inflammation, such as chronic inflammation/treatment and/or
prevention of tissue damage characterized by overexpression of
Angpt13, a chronic liver disease, and/or a heart disease
characterized by the elevated expression of Angpt13.
[0143] Even further, Angpt13 antagonists are believed to be useful
in the prevention and/or treatment of chronic alcoholic hepatitis,
resulting from excessive alcohol consumption. Alcoholic hepatitis
can range from a mild hepatitis, with abnormal laboratory tests
being the only indication of disease, to severe liver dysfunction
with complications such as jaundice (yellow skin caused by
bilirubin retention), hepatic encephalopathy (neurological
dysfunction caused by liver failure), ascites (fluid accumulation
in the abdomen), bleeding esophageal varices (varicose veins in the
esophagus), abnormal blood clotting and coma.
[0144] Also encompassed by this invention are T-cell mediated
diseases which affect the liver. Autoimmune damage from T cells is
mediated directly by cytotoxic T cells and indirectly T helper
cells. Autoimmune diseases the treatment of which is contemplated
herein include, without limitation, autoimmune hepatitis and
primary biliary cirrhosis. Autoimmune hepatitis (also known as
autoimmune chronic active hepatitis) is a chronic disorder
characterized by continuing hepatocellular necrosis and
inflammation, which, if untreated, usually progresses to cirrhosis
and ultimately liver failure. Primary biliary cirrhosis is an
autoimmune disease of the intrahepatic or biliary system, and is
associated with impaired bile secretion. It is believed that
autoimmune antibodies and T cells mediate tissue damage to the
liver associated with this disease.
[0145] The Angpt13 antagonists are also useful in the treatment of
ischemia reperfusion injury of the liver. As discussed before,
ischemia reperfusion injury occurs generally when the flow of blood
to a region of the body is temporarily halted (ischemia) and then
re-established (reperfusion). The injury may occur in the parts of
the body to which the blood supply was interrupted, or it can occur
in parts fully supplied with blood during the period of ischemia.
Ischemia reperfusion injury of the liver may result from various
underlying causes such as, for example, from hepatic and biliary
surgical resections, and clinically is manifested by such
complications as hepatic dysfunction including acute hepatoccllular
damage and necrosis.
[0146] Angpt13 antagonists include, without limitation, antibodies,
small organic and inorganic molecules, peptides, phosphopeptides,
antisense and ribozyme molecules, triple helix molecules, etc.,
that inhibit the expression and/or activity of the target gene
product.
[0147] For example, antisense RNA and RNA molecules act to directly
block the translation of mRNA by hybridizing to targeted mRNA and
preventing protein translation. When antisense DNA is used,
oligodeoxyribonucleotides derived from the translation initiation
site, e.g., between about -10 and +10 positions of the target gene
nucleotide sequence, are preferred.
[0148] Ribozymes are enzymatic RNA molecules capable of catalyzing
the specific cleavage of RNA. Ribozymes act by sequence-specific
hybridization to the complementary target RNA, followed by
endonucleolytic cleavage. Specific ribozyme cleavage sites within a
potential RNA target can be identified by known techniques. For
further details see, e.g., Rossi, Current Biology, 4:469-471
(1994), and PCT publication No. WO 97/33551 (published Sep. 18,
1997).
[0149] Nucleic acid molecules in triple helix formation used to
inhibit transcription should be single-stranded and composed of
deoxynucleotides. The base composition of these oligonucleotides is
designed such that it promotes triple helix formation via Hoogsteen
base pairing rules, which generally require sizeable stretches of
purines or pyrimidines on one strand of a duplex. For further
details see, e.g., PCT publication No. WO 97/33551, supra.
[0150] When the Angpt13 polypeptides herein (including their
agonists and antagonists) are employed as therapeutic agents, they
can be formulated according to known methods to prepare
pharmaceutically useful compositions, whereby the Angpt13
polypeptide is combined in admixture with a pharmaceutically
acceptable carrier vehicle. Therapeutic formulations are prepared
for storage by mixing the active ingredient having the desired
degree of purity with optional physiologically acceptable carriers,
excipients or stabilizers (Remington's Pharmaceutical Sciences 16th
edition, Osol, A. Ed. (1980)), in the form of lyophilized
formulations or aqueous solutions. Acceptable carriers, excipients
or stabilizers are nontoxic to recipients at the dosages and
concentrations employed, and include buffers such as phosphate,
citrate and other organic acids; antioxidants including ascorbic
acid; low molecular weight (less than about 10 residues)
polypeptides; proteins, such as serum albumin, gelatin or
immunoglobulins; hydrophilic polymers such as polyvinylpyrrolidone,
amino acids such as glycine, glutamine, asparagine, arginine or
lysine; monosaccharides, disaccharides and other carbohydrates
including glucose, mannose, or dextrins; chelating agents such as
EDTA; sugar alcohols such as mannitol or sorbitol; salt-forming
counterions such as sodium; and/or nonionic surfactants such as
TWEEN.TM., PLURONICS.TM. or PEG.
[0151] The formulations to be used for in vivo administration must
be sterile. This is readily accomplished by filtration through
sterile filtration membranes, prior to or following lyophilization
and reconstitution.
[0152] Therapeutic compositions herein generally are placed into a
container having a sterile access port, for example, an intravenous
solution bag or vial having a stopper pierceable by a hypodermic
injection needle.
[0153] The route of administration is in accord with known methods,
e.g. injection or infusion by intravenous, intraperitoneal,
intracerebral, intramuscular, intraocular, intraarterial or
intralesional routes, topical administration, or by sustained
release systems.
[0154] Dosages and desired drug concentrations of pharmaceutical
compositions of the present invention may vary depending on the
particular use envisioned. The determination of the appropriate
dosage or route of administration is well within the skill of an
ordinary physician. Animal experiments provide reliable guidance
for the determination of effective doses for human therapy.
Interspecies scaling of effective doses can be performed following
the principles laid down by Mordenti, J. and Chappell, W. "The use
of interspecies scaling in toxicokinetics" In Toxicokinetics and
New Drug Development, Yacobi et al., Eds., Pergamon Press, New York
1989, pp. 42-96.
[0155] When in vivo administration of a Angpt13 polypeptide or
agonist or antagonist thereof is employed, normal dosage amounts
may vary from about 10 ng/kg to up to 100 mg/kg of mammal body
weight or more per day, preferably about 1 g/kg/day to 10
mg/kg/day, depending upon the route of administration. Guidance as
to particular dosages and methods of delivery is provided in the
literature; see, for example, U.S. Pat. Nos. 4,657,760; 5,206,344;
or 5,225,212. It is anticipated that different formulations will be
effective for different treatment compounds and different
disorders, that administration targeting one organ or tissue, for
example, may necessitate delivery in a manner different from that
to another organ or tissue.
[0156] For example, before determining the effective dosage for the
treatment of any specific liver disease, the severity of the
disease is determined by conventional clinical and laboratory
evaluation of the patient. Benefit of the treatment is assessed by
follow-up of liver function with clinical and laboratory
assessment, performed in regular intervals, such as every week, two
weeks or month.
[0157] Where sustained-release administration of a Angpt13
polypeptide is desired in a formulation with release
characteristics suitable for the treatment of any disease or
disorder requiring administration of the Angpt13 polypeptide,
microencapsulation of the Angpt13 polypeptide is contemplated.
Microencapsulation of recombinant proteins for sustained release
has been successfully performed with human growth hormone (rhGH),
interferon-.gamma. (rhIFN-.gamma.), interleukin-2, and MN rgp120.
Johnson et al., Nat. Med., 2:795-799 (1996); Yasuda, Biomed. Ther.,
27:1221-1223 (1993); Hora et al., Bio/Technology, 8:755-758 (1990);
Cleland, "Design and Production of Single Immunization Vaccines
Using Polylactide Polyglycolide Microsphere Systems," in Vaccine
Design: The Subunit and Adjuvant Approach, Powell and Newman, eds,
(Plenum Press: New York, 1995), pp. 439-462; WO 97/03692, WO
96/40072, WO 96/07399; and U.S. Pat. No. 5,654,010.
[0158] The sustained-release formulations of these proteins were
developed using poly-lactic-coglycolic acid (PLGA) polymer due to
its biocompatibility and wide range of biodegradable properties.
The degradation products of PLGA, lactic and glycolic acids, can be
cleared quickly within the human body. Moreover, the degradability
of this polymer can be adjusted from months to years depending on
its molecular weight and composition. Lewis, "Controlled release of
bioactive agents from lactide/glycolide polymer," in: M. Chasin and
R. Langer (Eds.), Biodegradable Polymers as Drug Delivery Systems
(Marcel Dekker: New York, 1990), pp. 1-41.
[0159] It may be desirable to combine the Angpt13 therapeutic
agents with other therapeutic regimens. For example, treatment with
the Angpt13 polypeptides or their agonists can be combined with the
administration of other angiogenic factors, such as vascular
endothelial cell growth factor (VEGF) or fibroblast growth factor
(FGF).
[0160] E. Articles of Manufacture
[0161] In another embodiment of the invention, an article of
manufacture containing materials useful for the diagnosis or
treatment of the disorders described above is provided. The article
of manufacture comprises a container and a label. Suitable
containers include, for example, bottles, vials, syringes, and test
tubes. The containers may be formed from a variety of materials
such as glass or plastic. The container holds a composition which
is effective for diagnosing or treating the condition and may have
a sterile access port (for example the container may be an
intravenous solution bag or a vial having a stopper pierceable by a
hypodermic injection needle). The active agent in the composition
is usually an anti-tumor agent capable of interfering with the
activity of a gene product identified herein, e.g., an antibody.
The label on, or associated with, the container indicates that the
composition is used for diagnosing or treating the condition of
choice. The article of manufacture may further comprise a second
container comprising a pharmaceutically-acceptable buffer, such as
phosphate-buffered saline, Ringer's solution and dextrose solution.
It may further include other materials desirable from a commercial
and user standpoint, including other buffers, diluents, filters,
needles, syringes, and package inserts with instructions for
use.
[0162] F. Diagnostic Use
[0163] As Angpt13 is upregulated in inflammatory liver diseases,
its overexpression relative to normal tissues can serve as a
diagnostic marker of such diseases.
[0164] Gene amplification and/or expression may be measured in a
sample directly, for example, by conventional Southern blotting,
Northern blotting to quantitate the transcription of mRNA (Thomas,
Proc. Natl. Acad. Sci. USA, 77:5201-5205 (1980)), dot blotting (DNA
analysis), or in situ hybridization, using an appropriately labeled
probe, based on the sequences provided herein. Alternatively,
antibodies may be employed that can recognize specific duplexes,
including DNA duplexes, RNA duplexes, and DNA-RNA hybrid duplexes
or DNA-protein duplexes. The antibodies in turn may be labeled and
the assay may be carried out where the duplex is bound to a
surface, so that upon the formation of duplex on the surface, the
presence of antibody bound to the duplex can be detected.
[0165] For example, antibodies, including antibody fragments, can
be used to qualitatively or quantitatively detect the expression of
Angpt13 proteins. As noted above, the antibody preferably is
equipped with a detectable, e.g., fluorescent label, and binding
can be monitored by light microscopy, flow cytometry, fluorimetry,
or other techniques known in the art. These techniques are
particularly suitable, if the amplified gene encodes a cell surface
protein, e.g., a growth factor. Such binding assays are performed
essentially as described in section 5 above.
[0166] In situ detection of antibody binding to the Angpt13 protein
can be performed, for example, by immunofluorescence or
immunoelectron microscopy. For this purpose, a tissue specimen is
removed from the patient, and a labeled antibody is applied to it,
preferably by overlaying the antibody on a biological sample. This
procedure also allows for determining the distribution of the
marker gene product in the tissue examined. It will be apparent for
those skilled in the art that a wide variety of histological
methods are readily available for in situ detection.
[0167] One of the most sensitive and most flexible quantitative
methods for quantitating differential gene expression is RT-PCR,
which can be used to compare mRNA levels in different sample
populations, in normal and tumor tissues, with or without drug
treatment, to characterize patterns of gene expression, to
discriminate between closely related mRNAs, and to analyze RNA
structure.
[0168] The first step is the isolation of mRNA from a target
sample. The starting material is typically total RNA isolated from
a disease tissue and corresponding normal tissues, respectively.
Thus, mRNA can be extracted, for example, from frozen or archived
paraffin-embedded and fixed (e.g. formalin-fixed) samples of
diseased tissue for comparison with normal tissue of the same type.
Methods for mRNA extraction are well known in the art and are
disclosed in standard textbooks of molecular biology, including
Ausubel et al., Current Protocols of Molecular Biology, John Wiley
and Sons (1997). Methods for RNA extraction from paraffin embedded
tissues are disclosed, for example, in Rupp and Locker, Lab Invest.
56:A67 (1987), and De Andres et al., BioTechniques 18:42044 (1995).
In particular, RNA isolation can be performed using purification
kit, buffer set and protease from commercial manufacturers, such as
Qiagen, according to the manufacturer's instructions. For example,
total RNA from cells in culture can be isolated using Qiagen RNeasy
mini-columns. Total RNA from tissue samples can be isolated using
RNA Stat-60 (Tel-Test).
[0169] As RNA cannot serve as a template for PCR, the first step in
differential gene expression analysis by RT-PCR is the reverse
transcription of the RNA template into cDNA, followed by its
exponential amplification in a PCR reaction. The two most commonly
used reverse transcriptases are avilo myeloblastosis virus reverse
transcriptase (AMV-RT) and Moloney murine leukemia virus reverse
transcriptase (MMLV-RT). The reverse transcription step is
typically primed using specific primers, random hexamers, or
oligo-dT primers, depending on the circumstances and the goal of
expression profiling. For example, extracted RNA can be
reverse-transcribed using a GeneAmp RNA PCR kit (Perkin Elmer, CA,
USA), following the manufacturer's instructions. The derived cDNA
can then be used as a template in the subsequent PCR reaction.
[0170] Although the PCR step can use a variety of thermostable
DNA-dependent DNA polymerases, it typically employs the Taq DNA
polymerase, which has a 5'-3' nuclease activity but lacks a 3'-5'
endonuclease activity. Thus, TaqMan PCR typically utilizes the
5'-nuclease activity of Taq or Tth polymerase to hydrolyze a
hybridization probe bound to its target amplicon, but any enzyme
with equivalent 5' nuclease activity can be used. Two
oligonucleotide primers are used to generate an amplicontypical of
a PCR reaction. A third oligonucleotide, or probe, is designed to
detect nucleotide sequence located between the two PCR primers. The
probe is non-extendible by Taq DNA polymerase enzyme, and is
labeled with a reporter fluorescent dye and a quencher fluorescent
dye. Any laser-induced emission from the reporter dye is quenched
by the quenching dye when the two dyes are located close together
as they are on the probe. During the amplification reaction, the
Taq DNA polymerase enzyme cleaves the probe in a template-dependent
manner. The resultant probe fragments disassociate in solution, and
signal from the released reporter dye is free from the quenching
effect of the second fluorophore. One molecule of reporter dye is
liberated for each new molecule synthesized, and detection of the
unquenched reporter dye provides the basis for quantitative
interpretation of the data.
[0171] TaqMan RT-PCR can be performed using commercially available
equipments, such as, for example, ABI PRIZM 7700.TM. Sequence
Detection System.TM. (Perkin-Elmer-Applied Biosystems, Foster City,
Calif., USA), or Lightcycler (Roche Molecular Biochemicals,
Mannheim, Germany). In a preferred embodiment, the 5' nuclease
procedure is run on a real-time quantitative PCR device such as the
ABI PRIZM 7700.TM. Sequence Detection System.TM.. The system
consists of a thermocycler, laser, charge-coupled device (CCD),
camera and computer. The system amplifies samples in a 96-well
format on a thermocycler. During amplification, laser-induced
fluorescent signal is collected in real-time through fiber optics
cables for all 96 wells, and detected at the CCD. The system
includes software for running the instrument and for analyzing the
data.
[0172] 5'-Nuclease assay data are initially expressed as Ct, or the
threshold cycle. As discussed above, fluorescence values are
recorded during every cycle and represent the amount of product
amplified to that point in the amplification reaction. The point
when the fluorescent signal is first recorded as statistically
significant is the threshold cycle (C.sub.t). The .DELTA.Ct values
are used as quantitative measurement of the relative number of
starting copies of a particular target sequence in a nucleic acid
sample when comparing the expression of RNA in a cell from a
diseased tissue with that from a normal cell.
[0173] To minimize errors and the effect of sample-to-sample
variation, RT-PCR is usually performed using an internal standard.
The ideal internal standard is expressed at a constant level among
different tissues, and is unaffected by the experimental treatment.
RNAs most frequently used to normalize patterns of gene expression
are mRNAs for the housekeeping genes
glyceraldehyde-3-phosphate-dehydrogenase (GAPDH) and
.beta.-actin.
[0174] Differential gene expression can also be identified, or
confirmed using the microarray technique. In this method,
nucleotide sequences of interest are plated, or arrayed, on a
microchip substrate. The arrayed sequences are then hybridized with
specific DNA probes from cells or tissues of interest.
[0175] In a specific embodiment of the microarray technique, PCR
amplified inserts of cDNA clones are applied to a substrate in a
dense array. Preferably at least 10,000 nucleotide sequences are
applied to the substrate. The microarrayed genes, immobilized on
the microchip at 10,000 elements each, are suitable for
hybridization under stringent conditions. Fluorescently labeled
cDNA probes may be generated through incorporation of fluorescent
nucleotides by reverse transcription of RNA extracted from tissues
of interest. Labeled cDNA probes applied to the chip hybridize with
specificity to each spot of DNA on the array. After stringent
washing to remove non-specifically bound probes, the chip is
scanned by confocal laser microscopy. Quantitation of hybridization
of each arrayed element allows for assessment of corresponding mRNA
abundance. With dual color fluorescence, separately labeled cDNA
probes generated from two sources of RNA are hybridized pairwise to
the array. The relative abundance of the transcripts from the two
sources corresponding to each specified gene is thus determined
simultaneously. The miniaturized scale of the hybridization affords
a convenient and rapid evaluation of the expression pattern for
large numbers of genes. Such methods have been shown to have the
sensitivity required to detect rare transcripts, which are
expressed at a few copies per cell, and to reproducibly detect at
least approximately two-fold differences in the expression levels
(Schena et al., Proc. Natl. Acad. Sci. USA 93(20):106-49 (1996)).
The methodology of hybridization of nucleic acids and microarray
technology is well known in the art.
[0176] The following examples are offered for illustrative purposes
only, and are not intended to limit the scope of the present
invention in any way.
[0177] All patent and literature references cited in the present
specification are hereby incorporated by reference in their
entirety.
EXAMPLES
[0178] Commercially available reagents referred to in the examples
were used according to manufacturer's instructions unless otherwise
indicated. The source of those cells identified in the following
examples, and throughout the specification, by ATCC accession
numbers is the American Type Culture Collection, Manassas, Va.
Example 1
Identification of Angpt13
[0179] Angpt13 was identified in a cDNA library prepared from human
fetal liver mRNA obtained from Clontech Laboratories, Inc. Palo
Alto, Calif. USA, catalog no. 64018-1, following the protocol
described in "Instruction Manual: Superscript.RTM. Lambda System
for cDNA Synthesis and.lamda. cloning," cat. No. 19643-014, Life
Technologics, Gaithersburg, Md., USA which is herein incorporated
by reference. Unless otherwise noted, all reagents were also
obtained from Life Technologies. The overall procedure can be
summarized into the following steps: (1) First strand synthesis;
(2) Second strand synthesis; (3) Adaptor addition; (4) Enzymatic
digestion; (5) Gel isolation of cDNA; (6) Ligation into vector; and
(7) Transformation.
[0180] First Strand Synthesis:
[0181] Not1 primer-adapter (Life Tech., 2 .mu.l, 0.5 .mu.g/.mu.l)
was added to a sterile 1.5 ml microcentrifuge tube to which was
added poly A+ mRNA (7 .mu.l, 5 .mu.g). The reaction tube was heated
to 70.degree. C. for 5 minutes or time sufficient to denature the
secondary structure of the mRNA. The reaction was then chilled on
ice and 5.times.First strand buffer (Life Tech., 4 .mu.l), 0.1 M
DTT (2 .mu.l) and 10 mM dNTP Mix (Life Tech., 1 .mu.l) were added
and then heated to 37.degree. C. for 2 minutes to equilibrate the
temperature. Superscript II.RTM. reverse transcriptase (Life Tech.,
5 .mu.l) was then added, the reaction tube mixed well and incubated
at 37.degree. C. for 1 hour, and terminated by placement on ice.
The final concentration of the reactants was the following: 50 mM
Tris-HCl (pH 8.3); 75 mM KCl; 3 mM MgCl.sub.2; 10 mM DTT; 500 .mu.M
each dATP, dCTP, dGTP and dTTP; 50 .mu.g/ml Not 1 primer-adapter; 5
.mu.g (250 .mu.g /ml) mRNA; 50,000 U/mi Superscript II.RTM. reverse
transcriptase.
[0182] Second Strand Synthesis:
[0183] While on ice, the following reagents were added to the
reaction tube from the first strand synthesis, the reaction well
mixed and allowed to react at 16.degree. C. for 2 hours, taking
care not to allow the temperature to go above 16.degree. C.:
distilled water (93 .mu.l); 5.times.Second strand buffer (30
.mu.l); dNTP mix (3 .mu.l); 10 U/.mu.l E. Coli DNA ligase (1
.mu.l); 10 U/.mu.l E. Coli DNA polymerase 1 (4 .mu.l); 2 U/.mu.l E.
Coli RNase H (1 .mu.l). 10 U T4 DNA Polymerase (2 .mu.l) was added
and the reaction continued to incubate at 16.degree. C. for another
5 minutes. The final concentration of the reaction was the
following: 25 mM Tris-HCl (pH 7.5); 100 mM KCl; 5 mM MgCl.sub.2; 10
mM (NH.sub.4).sub.2SO.sub.4; 0.15 mM .beta.-NAD+; 250 .mu.M each
dATP, dCTP, dGTP, dTTP; 1.2 mM DTT; 65 U/ml DNA ligase; 250 U/ml
DNA polymerase I; 13 U/ml Rnase H. The reaction has halted by
placement on ice and by addition of 0.5 M EDTA (10 .mu.l), then
extracted through phenol:chloroform:isoamyl alcohol (25:24:1, 150
.mu.l). The aqueous phase was removed, collected and diluted into
5M NaCl (15 .mu.l) and absolute ethanol (-20.degree. C., 400 .mu.l)
and centrifuged for 2 minutes at 14,000.times.g. The supernatant
was carefully removed from the resulting DNA pellet, the pellet
resuspended in 70% ethanol (0.5 ml) and centrifuged again for 2
minutes at 14,000.times.g. The supernatant was again removed and
the pellet dried in a speedvac.
[0184] Adapter Addition
[0185] The following reagents were added to the cDNA pellet from
the second strand synthesis above, and the reaction was gently
mixed and incubated at 16.degree. C. for 16 hours: distilled water
(25 .mu.l); 5.times. T4 DNA ligase buffer (10 .mu.l); Sal I
adapters (10 .mu.l); T4 DNA ligase (5 .mu.l). The final composition
of the reaction was the following: 50 mM Tris-HCl (pH 7.6); 10 mM
MgCl.sub.2; 1 mM ATP; 5% (w/v) PEG 8000; 1 mM DTT; 200 .mu.g/ml Sal
1 adapters; 100 U/ml T4 DNA ligase. The reaction was extracted
through phenol:chloroform:isoamyl alcohol (25:24:1, 50 .mu.l), the
aqueous phase removed, collected and diluted into 5M NaCl (8 .mu.l)
and absolute ethanol (-20.degree. C., 250 .mu.l). This was then
centrifuged for 20 minutes at 14,000.times.g, the supernatant
removed and the pellet was resuspended in 0.5 ml 70% ethanol, and
centrifuged again for 2 minutes at 14,000.times.g. Subsequently,
the supernatant was removed and the resulting pellet dried in a
speedvac and carried on into the next procedure.
[0186] Enzymatic Digestion:
[0187] To the cDNA prepared with the Sal 1 adapter from the
previous paragraph was added the following reagents and the mixture
was incubated at 37.degree. C. for 2 hours: DEPC-treated water (41
.mu.l); Not 1 restriction buffer (REACT, Life Tech., 5 .mu.l), Not
1 (4 .mu.l). The final composition of this reaction was the
following: 50 mM Tris-HCl (pH 8.0); 10 mM MgCl.sub.2; 100 mM MaCl;
1,200 U/ml Not 1.
[0188] Gel Isolation of cDNA:
[0189] The cDNA is size fractionated by acrylamide gel
electrophoresis on a 5% acrylamide gel, and any fragments which
were larger than 1 Kb, as determined by comparison with a molecular
weight marker, were excised from the gel. The cDNA was then
electroeluted from the gel into 0.1.times.TBE buffer (200 .mu.l)
and extracted with phenol:chloroform:isoamyl alcohol (25:24:1, 200
.mu.l). The aqueous phase was removed, collected and centrifuged
for 20 minutes at 14,000.times.g. The supernatant was removed from
the DNA pellet which was resuspended in 70% ethanol (0.5 ml) and
centrifuged again for 2 minutes at 14,000.times.g. The supernatant
was again discarded, the pellet dried in a speedvac and resuspended
in distilled water (15 .mu.l).
[0190] Ligation of cDNA into pRK5 Vector:
[0191] The following reagents were added together and incubated at
16.degree. C. for 16 hours: 5.times. T4 ligase buffer (3 .mu.l);
pRK5, Xho1, Not1 digested vector, 0.5 .mu.g, 1 .mu.l); cDNA
prepared from previous paragraph (5 .mu.l) and distilled water (6
.mu.l). Subsequently, additional distilled water (70 .mu.l) and 10
mg/ml tRNA (0.1 .mu.l) were added and the entire reaction was
extracted through phenol:chloroform:isoamyl alcohol (25:24:1). The
aqueous phase was removed, collected and diluted into 5M NaCl (10
.mu.l) and absolute ethanol (-20.degree. C., 250 .mu.l). This was
then centrifuged for 20 minutes at 14,000.times.g, decanted, and
the pellet resuspended into 70% ethanol (0.5 ml) and centrifuged
again for 2 minutes at 14,000.times.g. The DNA pellet was then
dried in a Speedvac and eluted into distilled water (3 .mu.l) for
use in the subsequent procedure.
[0192] Transformation of Library Ligation into Bacteria:
[0193] The ligated cDNA/pRK5 vector DNA prepared previously was
chilled on ice to which was added electrocompetent DH10B bacteria
(Life Tech., 20 .mu.l). The bacteria vector mixture was then
electroporated as per the manufacturers recommendation.
Subsequently SOC media (1 ml) was added and the mixture was
incubated at 37.degree. C. for 30 minutes. The transformants were
then plated onto 20 standard 150 mm LB plates containing ampicillin
and incubated for 16 hours (37.degree. C.) to allow the colonies to
grow. Positive colonies were then scraped off and the DNA isolated
from the bacterial pellet using standard CsCl-gradient protocols.
For example, Ausubel et al., 2.3.1.
[0194] Identification of Angpt13
[0195] Angpt13 can be identified in the human fetal liver library
by any standard method known in the art, including the methods
reported by Klein R. D. et al. (1996), Proc. Natl. Acad. Sci. 93,
7108-7113 and Jacobs (U.S. Pat. No. 5,563,637 issued Jul. 16,
1996). According to Klein et al. and Jacobs, cDNAs encoding novel
secreted and membrane-bound mammalian proteins are identified by
detecting their secretory leader sequences using the yeast
invertase gene as a reporter system. The enzyme invertase catalyzes
the breakdown of sucrose to glucose and fructose as well as the
breakdown of raffinose to sucrose and melibiose. The secreted form
of invertase is required for the utilization of sucrose by yeast
(Saccharomyces cerevisiae) so that yeast cells that are unable to
produce secreted invertase grow poorly on media containing sucrose
as the sole carbon and energy source. Both Klein R. D., supra, and
Jacobs, supra, take advantage of the known ability of mammalian
signal sequences to functionally replace the native signal sequence
of yeast invertase. A mammalian cDNA library is ligated to a DNA
encoding a nonsecreted yeast invertase, the ligated DNA is isolated
and transformed into yeast cells that do not contain an invertase
gene. Recombinants containing the nonsecreted yeast invertase gene
ligated to a mammalian signal sequence are identified based upon
their ability to grow on a medium containing only sucrose or only
raffinose as the carbon source. The mammalian signal sequences
identified are then used to screen a second, full-length cDNA
library to isolate the full-length clones encoding the
corresponding secreted proteins. Cloning may, for example, be
performed by expression cloning or by any other technique known in
the art.
[0196] The primers used for the identification of Angpt13 are as
follows: TABLE-US-00002 OLI114 (SEQ ID NO:3) CCACGTTGGCTTGAAATTGA
OLI115 (SEQ ID NO:4)
CCTCCAGAATTGATCAAGACAATTCATGATTTGATTCTCTATCTCCAGAG OLI116 (SEQ ID
NO:5) TCGTCTAACATAGCAAATC
[0197] The nucleotide sequence of Angpt13 is shown in FIG. 1 (SEQ.
ID. NO: 1), while its amino acid sequence is shown in FIGS. 2A and
2B (SEQ. ID. NO: 2). Angpt13 contains a fibrinogen-like domain
(FIG. 3A, and FIGS. 5A-C) that exhibits a high degree of sequence
homology with the two known human ligands of the TIE-2 receptor
(h-TIE2L1 and h-TIE2L2) and human angiopoietins 1, 2 and 4 (ANG1,
ANG2, ANG4, FIG. 5C).
[0198] A clone of Angpt13 was deposited with the American Type
Culture Collection (ATCC), 12301 Parklawn Drive, Rockville, Md.
20852, on Sep. 18, 1997, under the terms of the Budapest Treaty,
and has been assigned the deposit number ATCC 209281.
Example 2
[0199] Expression of Angpt13
[0200] Human Angpt13 was cloned into the eukaryotic expression
vector pRK5tkNEO and the baculovirus vector pHIF, a derivative of
pVL1393 purchased from PharMingen, CA. Plasmid DNA was
cotransfected with BaculoGold.TM. DNA (PharMingen, CA) into
Spodoptera frugiperda ("Sf9") cells (ATCC CRL 1711) using
Lipofectin (GIBCO-BRL, MD). After 4 days, the cells were harvested,
500 .mu.l of the supernatant was used to infect 2.times.10.sup.6
Sf9 cells and baculovirus was amplified. After 72 hours of
amplification the cells were harvested and 10 ml of the supernatant
used to infect 7.5.times.10.sup.5 H5 cells/ml for 40 hours. After
harvesting and filtration through a 0.45 .mu.m cellulose acetate
filter, the supernatant was purified. Mouse Angpt13 was
overexpressed in Chinese Hamster Ovary (CHO) cells in large scale
transient transfection experiments. Human Angpt13 was purified from
the supernatants of baculovirus-infected insect cells grown in
suspension utilizing immunoaffinity chromatography. The column was
generated by coupling anti-gD Fab to glycophase-CPG (controlled
pore glass). The clarified (1000.times.g 5 min then 0.2 .mu.m
filtered) medium was loaded overnight at 4.degree. C. The column
was washed with PBS until the absorbance at 280 nm of the effluent
returned to baseline and eluted with 50 mM Na Citrate at pH 3.0.
The eluted protein was dialyzed (Spectra-pore; MWCO 10,000) against
1 mM HCl and frozen at -70.degree. C. Transiently expressed CHO
cultures containing mouse Angpt13 were clarified and concentrated
using a 10,000 MWCO membrane (Amicon). This volume was passed over
an anti-gD Fab coupled to glycophase-CPG column as previously
described for human Angpt13. The eluted pool was diluted with 10 mM
Na Acetate (pH 5.0) to a conductivity of <5 mS and loaded on to
S Sepharose Fast Flow (Amersham Pharmacia Biotech, NJ). The column
was washed with 10 mM Na Acetate pH 5.0 until the absorbance of the
effluent at 280 nm returned to baseline and eluted with a 20 column
volume gradient 0-0.5 M NaCl in 10 mM Na Acetate pH 5.0. The
fractions that eluted at 0.45 M-0.5 M NaCl, containing mouse
Angpt13, were further purified utilizing reverse phase C-4
chromatography (Vydac, CA). The fractions were acidified with 0.1%
Trifluoroacetic acid gradient. The mouse mAngpt13 eluted at 67%
acetonitrile, was lyophilized and stored at -70.degree. C. The
identified of the purified proteins were verified by N-terminal
sequence analysis. The LPS concentration was verified using
commercial kits and determine to be <5 Eu/ml for all human or
murine Angpt13 preparations.
Example 3
[0201] Preparation of Antibodies that Bind Angpt13
[0202] This example illustrates preparation of monoclonal
antibodies which can specifically bind Angpt13.
[0203] Techniques for producing the monoclonal antibodies are known
in the art and are described, for example, in Goding, supra.
Immunogens that may be employed include purified ligand homologues
of the present invention, fusion proteins containing such ligand
homologues, and cells expressing recombinant ligand homologues on
the cell surface. Selection of the immunogen can be made by the
skilled artisan without undue experimentation.
[0204] Mice, such as Balb/c, are immunized with the immunogen
emulsified in complete Freund's adjuvant and injected
subcutaneously or intraperitoneally in an amount from 1-100
micrograms. Alternatively, the immunogen is emulsified in MPL-TDM
adjuvant (Ribi Immunochemical Research, Hamilton, Mont.) and
injected into the animal's hind food pads. The immunized mice arc
then boosted 10 to 12 days later with additional immunogen
emulsified in the selected adjuvant. Thereafter, for several weeks,
the mice might also be boosted with additional immunization
injections. Serum samples may be periodically obtained from the
mice by retro-orbital bleeding for testing ELISA assays to detect
the antibodies.
[0205] After a suitable antibody titer has been detected, the
animals "positive" for antibodies can be injected with a final
intravenous injection of the given ligand. Three to four days
later, the mice are sacrificed and the spleen cells are harvested.
The spleen cells arc then fused (using 35% polyethylene glycol) to
a selected murine myeloma cell line such as P3X63AgU.1, available
from ATCC, No. CRL 1597. The fusions generate hybridoma cells which
can then be plated in 96 well tissue culture plates containing HAT
(hypoxanthine, aminopterin, and thymidine) medium to inhibit
proliferation of non-fused cells, myeloma hybrids, and spleen cell
hybrids.
[0206] The hybridoma cells will be screened in an ELISA for
reactivity against the antigen. Determination of "positive"
hybridoma cells secreting the desired monoclonal antibodies against
the TIE ligand homologues herein is well within the skill in the
art.
[0207] The positive hybridoma cells can be injected intraperitoneal
into syngeneic Balb/c mice to produce ascites containing the
anti-TIE-ligand monoclonal antibodies. Alternatively, the hybridoma
cells can be grown in tissue culture flasks or roller bottles.
Purification of the monoclonal antibodies produced in the ascites
can be accomplished using ammonium sulfate precipitation, followed
by gel exclusion chromatography. Alternatively, affinity
chromatography based upon binding of antibody to protein A or
protein G can be employed.
Example 4
Endothelial Cell Binding
[0208] Angiopoietins are secreted factors that regulate
angiogenesis by binding to the endothelial cell specific tyrosine
kinase receptor Tie2 via their N-terminal fibrinogen (FBN)-like
domain. The C-terminal coiled-coil domain present in this family of
secreted ligands was found to be necessary for ligand
oligomerization (Procopio et al., J. Biol. Chem. 274:30196-201
(1999)).
[0209] Similar to the angiopoietins, Angpt13 is a secreted
glycoprotein consisting of an N-terminal signal peptide, followed
by a coiled-coil domain and a C-terminal FBN-like domain (FIG.
3A).
[0210] Because of the structural similarities between Angpt13 and
angiopoietins, Angpt13 was tested for the ability to bind, in
culture, to primary endothelial cells expressing the Tie2 receptor.
Human microvascular endothelial cells (HMVECs), purchased from Cell
System (Kirkland, Wash.), maintained in CS-C complete medium
containing 10% fetal bovine serum and mitogens according to the
recommendations by the supplier, were incubated with conditioned
media from transiently transfected 293 cells expressing epitope
(gD)-tagged versions of Tie2 ligands angiopoietin 1 and 2 (Ang1 and
Ang2), Angpt13, and angiopoietin related protein 1 (ARP1),
respectively. ARPI is a structurally related molecule, consisting
of a coiled-coil and a fibrinogen-like domain but unable to bind
Tie2, and was used as a negative control. As shown in FIG. 3B, Ang2
and Angpt13 strongly bound to HMVEC under conditions where no
binding was observed for ARP1. These findings demonstrated that the
binding of Angpt13 to endothelial cells was specific and implied
the presence of receptors on endothelial cells that mediate binding
of Angpt13.
[0211] To test whether Tie2, the receptor for angiopoetins 1, 2 and
3 (Ang1, Ang2, and Ang3), or Tie1, an orphan receptor with high
sequence homology to Tie2, bind to Angpt13, immunoprecipitation
experiments were conducted using 293 cells transiently with
expression vectors for epitope (gD)-tagged versions of Ang1 and
Ang2, Angpt13 and ARP1 in conjunction with full length receptor
constructs for Tie1 and Tie2, respectively. Whole cell extracts
were prepared by lysis in RIPA buffer (1.times.PBS; 1% NP40; 0.5%
sodium deoxycholate; 0.1% SDS; PMSF, 100 .mu.g/ml; Aprotinin, 30
.mu.l/ml; sodium orthovanadate, 1 .mu.M) containing freshly added
protease inhibitors. Extract was incubated with antibodies specific
for Tie1 or Tie2 (Santa Cruz Biotechnology, San Diego, Calif.) and
the resulting immunoprecipitate was analyzed by SDS-PAGE and
immunoblotting. Specifically, proteins resolved by SDS-PAGE and
blotted to PVDF membrane were incubated with antibodies against the
gD tag or the Tie receptors, respectively. As shown in FIG. 4, Tie1
and Tie2 did not bind Angpt13 in experimental conditions that
allowed Tie2 binding to Ang1 and Ang2. These findings demonstrated
that Angpt13 is neither a ligand for Tie2 nor Tie1 and suggested
the presence of other receptors on endothelial cells mediating the
strong binding observed in the cell binding experiments.
[0212] Interestingly, exposure of cells to hypoxia or VEGF,
mimicking "tumor-like" conditions, significantly increased the
binding of Angpt13 (data not shown). These conditions were
previously found to induce integrin expression on endothelial cells
(Suzuma et at., Invest. Ophthalmol. Vis. Sci. 39:1028-35 (1999)),
whereas Tie1 and Tie2 receptor levels were not found to be altered
(Mandriota and Pepper, Circ. Res. 83:852-9 (1998) and Oh et al., J.
Biol. Chem. 274:15732-9 (1999)).
Example 5
Molecular Modeling of FBN-Angpt13
[0213] The FBN-like domain of Angpt13 shares a 39.6% sequence
identity with the C terminus of the .gamma. chain of human
fibrinogen. To investigate the biological function and molecular
mechanisms by which Angpt13 binds to endothelial cells, a model of
the FBN-like domain of Angpt13 was built by using structural
information provided by X-ray crystallographic studies on FBN
domains and homology modeling techniques. The FBN domain has a
unique fold consisting of three well defined domains: an N terminus
domain formed by a two stranded antiparallel .beta.-sheet flanked
by a short helix; a central domain formed by a five-stranded
antiparallel .beta.-sheet with two short helices and a hairpin loop
aligned against one of its faces; and a third domain which is
composed predominantly of loops (FIG. 5B).
[0214] To build the FBN-Angpt13 model, a sequence-structure
alignment between the FBN-Angpt13 sequence and several FBN domain
structures was performed by using clustalW (Thompson et al.,
Nucleic Acids Res., 22:4673-80 (1994)) and threading (ProCeryon
Biosciences Inc.) From this alignment 3FB (PDB code) was chosen as
template structure for model construction. The program PROCHECK
(Laskowski et al., J. Biomol. NMR 8:477-86 (1996)) was used to
assess the geometric quality of the model which was above average
stereochemical quality when compared with the reference database of
structures deposited in the PDB. The final FBN-Angpt13 model had an
r.m.s.d of 1.95 .ANG. for all C.sub..alpha. atoms when compared
with the template. The overall fold of the FBN domain is conserved
in FBN-Angpt13, with some differences in the loop regions at amino
acid positions 220-224, 289-306, and 357-363 (FIGS. 5A and B).
[0215] Studies on the human fibrinogen gamma chain led to the
identification of two regions involved in binding to the integrin
.alpha.M.beta.2, an integrin predominantly expressed on leukocytes
(Ugarova et al., J. Biol. Chem. 273:22519-27 (1998)). Both regions,
separated in terms of linear amino acid sequence, form two adjacent
antiparallel .beta.-strands in the three-dimensional structure of
the FBN domain (P1, residues 190-202; P2, residues 377-395). A
different region within the fibrinogen gamma chain (P3, 346-358)
and tenasin-C has also been found to be involved in binding to
integrin (.alpha.v.beta.3 (Yokoyama et al., J. Biol. Chem.
275:16891-8 (2000)). The present FBN-Angpt13 model and the FBN
domain of the human fibrinogen gamma chain shares a high degree of
structural similarity in those regions (P1: 38-50; P2: 199-214; P3:
346-361) (FIG. 5A), where the numbering follows the numbering of
3FIB (PDB code). Following the amino acid numbering of Angpt13 (SEQ
ID NO: 2), P1 corresponds to amino acids 281-293 (SEQ ID NO: 14);
P2 corresponds to amino acids 442-460 (SEQ ID NO: 15); and P3
corresponds to amino acids 415-430 (SEQ ID NO: 17) in the mature
protein amino acid sequence.
[0216] In order to test the hypothesis whether the regions within
the FBN-like domain of Angpt13 were responsible for binding,
several peptides were designed and synthesized (Table 2). The P3
sequences encode regions with most structural diversity between the
different domains and therefore might determine receptor
specificity. Several scrambled and inverted peptides derived from
the same regions were used as control peptides (Table 2).
Recombinant human Angpt13 protein tagged with an amino-terminal gD
epitope was generated by using a baculovirus expression system as
described in Example 2 (FIG. 6A).
[0217] The glycosylation status of the recombinant Angpt13 was
determined with PNGase-F treatment according to the manufacturer's
instructions (New England Biolabs, MA). Purified protein (50 ng)
was electrophoresed through SDS polyacrylamide gel (10%
Tris-Glycine, Invitrogen, CA) and electrotransferred to
nitrocellulose membranes (Invitrogen, CA) using standard
procedures. The membrane was blocked by incubation in 5% w/v
instant nonfat milk powder in PBS and incubated overnights at
4.degree. C. with 1 .mu.g/ml monoclonal anti-gD (clone 5B6.K6)
antibody in blocking buffer. The membranes were washed with
PBS/0.05% Tween 20 and subsequently incubated with horseradish
peroxidase-coupled donkey anti-mouse antibodies (Jackson
ImmunoResearch laboratories, PA) for one hour at room temperature.
Angpt13 protein was visualized by chemiluminescent detection
according to the manufacturer's protocol (Amersham Pharmacia
Biotech, NJ). Immunoprecipitation, transient transfections and FACS
analysis were conducted as previously described (Klein et al.,
Nature 387:717-21 (1997)).
[0218] The decrease in mobility of the Angpt13 band upon incubation
with PNGase indicated that the recombinant protein was glycosylated
(FIG. 6C). Similar observations were made previously for the
angiopoietins. As demonstrated in FIG. 7A, addition of all three
peptides to the adhesion assay completely blocked binding of
endothelial cells to Angpt13. Integrin .alpha.v.beta.3 is capable
of recognizing some of its ligands in the context of the RGD
adhesive sequence. In support of our observation that the
fibrinogen-like domain of Angpt13 does not encode such RGD
sequence, addition of RGD peptides only partially abolished HMVEC
adhesion, whereas RGE-peptides had no effect. This result suggested
that only a part of the Angpt13 interaction with .alpha.v.beta.3 is
mediated in an RGD-dependent manner. In conclusion, these data
suggest that all three regions within the FBN-like domain of
Angpt13 are part of the receptor binding site. TABLE-US-00003 TABLE
2 SEQ ID Sequence NO Name NL6_P1* PWTLIQHRIDGSQ 14 NL6_PP1
PWTLIQHRIDGSQ 14 NL6_P2* YSIKSTKMLIHPTDSESFE 15 NL6_PP2
YSIKSTKMLIHPTDSES 16 NL6_P3* GKYNKPRAKSKPERRR 17 NL6_PP3
GKYNKPRAKSKPER 18 NL6_P32 GKYNKPRAKSKPE 19 Control peptide name
NL6_PP1_inv QSGDIRHQILTWP 20 NL6_PP1_src PQWSTGLDIIQRH 21
NL_PP2_inv SESDTPHILMKTSKISY 22 NL_PP2_src YSSEISKDSTTPKHMIL 23
NL6_PP3_inv REPKSKARPKNYKG 24 NL6_PP3_src GRKEYPNKKSPKRA 25 FBG_P1
GWTVFQKRLDGSV 26 FBG_P2 YSMKKTTMKIIPFNRL 10 FBG_P3 GVYYQGGTYSKAS
12
Example 6
Cell Adhesion Assays
[0219] A. Identification of Integrin Mediating Angpt13 Cell
Adhesion
[0220] In order to identify potential integrins binding to Angpt13,
recombinant Angpt13 proteins were coated onto 96-well flat-bottomed
microtiter plates (MaxiSorp, Nunc, Denmark) overnight at 4.degree.
C. and blocked with 100 .mu.g/ml BSA in PBS for 1 hour at
37.degree. C. Various 293 cell lines stably transfected with
different integrin heterodimers, including IIbIIIa
(.alpha..sub.IIB.beta.3), .alpha.v.beta.3, .alpha.v.beta.1 and
.alpha.v.beta.5, were tested for their ability to bind Angpt13
coated plates. Cells were harvested and diluted to 10.sup.5
cells/ml in serum-free CS-C medium containing 1% BSA, 1 mM
CaCl.sub.2 and 1 mM MgCl.sub.2. Cells were preincubated with or
without blocking antibodies or peptides for 15 minutes at
37.degree. C. and then stimulated with 200 nM PMA. Cell suspensions
(10.sup.4 cells/well) were added to the coated wells and the plates
were incubated at 37.degree. C. for selected times. Non-adherent
cells were removed by PBS washes and cell attachment was measured
using the PNAG method of Lanndegren (Landegren, U., J. Immunol.
Methods, 67:379-388 (1984)). Results are expressed at mean OD405
values of triplicate wells.
[0221] Among the stable cell lines tested, cells expressing
.alpha.v.beta.3 displayed a marked increased in adherence to
Angpt13 compared to other cell lines (FIG. 7B). Hence, these
findings demonstrate that recombinant human Angpt13 binds
specifically to the .alpha.v.beta.3 integrin. This is in agreement
with the earlier observations that endothelial cells exposed to
hypoxia and VEGF bound more effectively to Angpt13.
[0222] B. Mediation of Angpt3 Cell Adhesion by .alpha.v.beta.63
[0223] Integrins are known to induce biological responses, such as
cell adhesion and migration, upon activation by their ligands.
Experiments were designed to test whether Angpt13 exerts such
effects on primary human endothelial cells, and whether
.alpha.v.beta.3 was sufficient to mediate these responses. When
tested in the endothelial cell adhesion assay, Angpt13 induced a
robust, dose-dependent adhesion within 4 hours after incubation
(FIG. 7C). The levels observed were comparable to the levels
obtained when cells were plated on vitronectin, the prototypic
ligand for .alpha.v.beta.3 (data not shown).
[0224] To determine whether the .alpha.v.beta.3 integrin was
sufficient to mediate Angpt13 cell adhesion, blocking antibodies or
inhibitory peptides were tested for their ability to inhibit the
adhesion in the cell adhesion assay. Function blocking antibodies
were added to the endothelial cells prior to incubation with the
Angpt13-coated wells. The presence of function blocking antibodies
to .alpha.5.beta.1 or .alpha.v.beta.5 did not impair adhesion of
HMVECs to culture dishes coated with Angpt13 (20 .mu.g/ml),
however, the .alpha.v.beta.3 specific antibody completely blocked
adhesion (FIG. 7D). As a general control, EDTA (10 mM) which
abrogates integrin binding to their ligands, was added to the
binding experiment. As shown in FIG. 7D, the interference with the
integrin dependence on divalent cations completely abolished
endothelial cell adhesion.
Example 7
Cell Migration Assay
[0225] Since another hallmark of integrin activity on endothelial
cells is their migratory responses to ligand stimulation, a
migration assay was developed to allow study of the effects of
Angpt13 on the induction of migration of endothelial cells.
[0226] Angpt13 was tested in the migration assay, described by T.
V. Byzova et al., Exp. Cell Res., 254:299-308 (2000). The migration
assay utilizes HTS Multiwell tissue culture inserts with 8 .mu.m
pore size (Becton Dickinson, NJ). Angpt13 protein was diluted in
PBS to 50 ng/.mu.l and used to undercoat the surface of the
membrane filter. After precoating with 3% BSA/PBS, the filters were
placed in 500 .mu.l serum-free CS-C medium, 1% BSA, 1 mM
CaCl.sub.2. HMVECs were washed 3 times with PBS, harvested and
suspended at 10.sup.5 cells/ml in serum-free medium supplemented as
described above. The cells were preincubated with or without
blocking antibodies (25 .mu.g/ml) for 15 minutes at 37.degree. C.
prior to stimulation with PMA (200 nM). The cell suspension (250
.mu.l) was added to the upper chamber and the cells were allowed to
migrate overnight at 37.degree. C. in a 5% CO.sub.2 humidified
incubator. After incubation, cells remaining in the top wells were
removed using a swab, and the cells that had migrated to the lower
surface of the membrane were fixed with methanol and stained with
YO-PRO-1 iodide (Molecular Probes). Migration results were
quantitated as the average number of cells/microscopic field using
the Openlab software (Improvision, MA).
[0227] After 16 to 20 hours exposure of Angpt13 to endothelial
cells, a 2.5 fold increase in cell migration compared to BSA
control treatment (FIG. 7E) was observed. Most importantly, such
migration was blocked by administration of an antagonistic antibody
to.alpha.v.beta.33, but not by control antibodies blocking other
integrins. In conclusion, Angpt13 potently induces migration of
primary human endothelial cells and both activities were blocked by
antagonistic antibodies toward .alpha.v.beta.3.
Example 8
Tissue Expression of Angpt13
[0228] A. In situ Hybridization.
[0229] In situ hybridization was performed as previously described
(Lu, Cell Vision 1:169-176 (1994)). PCR primers
[0230] upper: 5' T7 promoter: GGATTCTAATACGACTCACT ATAGGGC (SEQ ID
NO: 6)+GGCATTCCTGCTGAATGTACC (hAngpt13 specific sequence, SEQ ID
NO: 7) 3' and lower: 5' T3 promoter: CTATGAAATT AACCCTCACTAAAGGGA
(SEQ ID NO: 8)+ACCACACTCATCATGCCACCA (hAngpt13 specific sequence,
SEQ ID NO: 9) 3' were designed to amplify a 506-bp fragment of
human Angpt13 and
[0231] upper: 5' T7 promoter: GGATTCTAATACGACTCACTATAGGGC (SEQ ID
NO: 6)+5' GATGACCTTCCTGCCGACTG (mAngpt13 specific sequence, SEQ ID
NO: 11) 3' and lower; T3 promoter: CTATGAAATTAACCCTCACTAAAGGGA (SEQ
ID NO: 8)+5' GTCATTCCACCACCAGCCA (mAngpt13 specific sequence, SEQ
ID NO: 13) Primers included extensions encoding 27 nucleotide T7 or
T3 RNA polymerase initiation sited to allow in vitro transcription
of sense or antisense riboprobes, respectively, from the amplified
products. Human tissue 5 .mu.m thick sections were deparaffinized,
deproteinated in 20 .mu.g/ml proteinase K for 15 minutes at
37.degree. C., rinsed in 2.times.SSC, dehydrated through graded
concentrations of ethanol and incubated in prehybridization buffer
1-4 h. The mouse tissues were digested in 4 .mu.g/ml proteinase K
for 30 minutes at 37.degree. C. and treated as described above.
.sup.33P-UTP-labeled sense and antisense probes were hybridized to
the sections at 55.degree. C. overnight. Unbound probe was removed
by incubation in 20 mg/ml RNaseA for 30 minutes at 37.degree. C.,
followed by a high stringency wash at 55.degree. C. in
0.1.times.SSC for 2 hours, and dehydration through graded
concentrations of ethanol. The slides were dipped in NBT2 nuclear
track emulsion (Eastman Kodak, NY), exposed in sealed plastic slide
boxes containing desiccant for 4 weeks at 4.degree. C., developed,
and counterstained with hematoxylin and eosin.
[0232] As shown in FIG. 8C, hepatocyte specific expression as
observed in sections of embryonic livers from E15 and E18 mouse
embryos. There was no Angpt13 expression on erythroid progenitors,
endothelial cells or megakaryocytes within the embryonic sections
analyzed.
[0233] B. Northern Blots
[0234] In order to study the Angpt13 expression in adult human
tissues, multi-tissue Northern blots were probed with a
radiolabeled probe covering the 5' end of the coding sequence, as
described above. In contrast to previous observation with the
murine orthologue Angpt13 (Conklin et al., Genomics 62:477-82
(1999)), which was found to be expressed exclusively in the liver,
expression of human Angpt13 was found in adult liver and kidney,
however, the signals observed in kidney were significantly lower
(FIG. 8A). No expression was found in any of the other adult
tissues analyzed, including lung and brain with the exception of
some weak signals in skeletal muscle tissues. Cellular localization
of Angpt13 mRNA expression was investigated by in situ
hybridization experiments on various normal and diseased tissues
derived from human and mouse specimens. The tissues included all
major organs, bone marrow, as well as pathologic liver tissues such
as cirrhosis, metastatic liver adenocarcinomas and section from
cases of acetominophen induced hepatotoxicity. As shown in FIG. 8B,
some background expression was found in normal adult liver
confirming the northern blot data. While there were no alterations
in the expression within liver tumor samples analyzed, strong
induction was observed in sections derived from diseased liver
associated with inflammation, such as liver cirrhosis and after
toxic injury. As shown in the high magnification insets, hepatocyte
specific expression was found in both normal and diseased liver
tissues (FIG. 8C). Expression was not detected in stromal cells, in
lymphocytes and in endothelial cells within or surrounding the
diseased tissues.
[0235] In summary, these data demonstrate a hepatocyte specific
expression pattern for Angpt13 during embryonic development as well
as a strong, hepatocyte specific upregulation in various cases of
diseased liver associated with inflammation.
[0236] C. Gene Expression Profiling
[0237] Gene Expression analysis was performed for Angpt13 using
GeneLogic database of human tissues representing normal and disease
states, including cancer and non-cancer.
[0238] Using the GeneLogic gene expression database, increased
expression in conditions of liver diseases identified by in situ
hybridization of human liver sections (FIG. 8B) was confirmed.
Basal levels of Angpt13 was low in most tissues and organs, with
the exception of liver. A significant increase in expression levels
of Angpt13 between normal and pathologic conditions was present in
liver, heart and thyroid. A more detailed subtype analysis for
Angpt13 expression with samples derived from patients suffering
from various forms of liver diseases confirmed strongest expression
of Angpt13 during liver cirrhosis. Interestingly, GeneLogic
database analysis revealed strong induction of Angpt13 expression
not only in pathologic livers, but also in heart diseases such as
coronary heart diseases and hypertrophic cardiomyopathy. The
disease forms associated with increased expression levels of
Angpt13 share in common the formation of fibrotic tissues
consisting of a variety of extracellular matrix proteins including
collagen, fibronectin, vitronectin and laminin, all of these ECM
molecules are known to bind to specific integrin forms.
Example 9
Assay for In Vivo Angiogenic Activity of Angpt13
[0239] In order to test whether Angpt13 was capable to induce an in
vivo angiogenic response in the rat cornea, hyaluron pellets
containing murine and human Angpt13 (500 ng) as well as human VEGF
(100 ng) were implanted separately or in combination as described
previously (Xin et al., J. Biol. Chem., 274:99116-9121 (1999)).
Hydron pellets containing excipient (control, murine or human
Angpt13 (500 ng), VEGF (100 ng), or the combination of murine or
human Angpt13 (500 ng) and VEGF (100 ng) were implanted into the
corneas of 250 to 300 g male Sprague-Dawley rates. All hydron
pellets contained 100 ng of sucralfate. At day 6, animals were
euthanized and injected with fluorescein isothiocyanate-dextran to
allow for visualization of the vasculature. Corneal whole mounts
were made of the enucleated eyes and analyzed for neovascular areas
using a computer-assisted image analysis (Image Pro-Plus 2.0,
Silver Spring, Md.). In contrast to previous reports focusing on
the effects of angiopoietin 1 and 2 when tested in the corneal
angiogenesis assay (Asahara et al., Circ. Res. 83:233-40 (1998)),
recombinant Angpt13 alone potently induced a strong angiogenic
response 5 days after pellet implantation. As shown in FIGS. 9A and
B, murine Angpt13 was slightly more potent in inducing angiogenesis
when compared to the recombinant human protein, however, both
responses were comparable to the levels obtained for VEGF. In the
combination treatment with VEGF, additive but not synergistic
effects were observed (FIG. 9B). These findings might reflect the
interdependent signal transduction pathways engaged by both ligands
(Byzova et al., Mol. Cell. 6:852-60 (2000)).
Example 10
In Vivo Biological Activity of Angpt13
[0240] A. Transient Protective Effect and Long-Term Effect of
Intravenous and Intradermal Administration of Angpt13
[0241] Methods
[0242] Adenovirus generation: Adenoviral CMV-gD-mAngpt13, CMV-lacZ
and mVEGF164 were generated using the AdEasy adenoviral vector
system (Stratagene) essentially following the manufacturer's
instructions. Recombinant adenoviral vectors encoding murine
Angpt13 or VEGF was constructed by cloning the coding region of
Angpt13 or VEGF into the polylinker site of the Ad-easy vector
construction kit from Stratagene. The coding region of mAngpt13 or
VEGF was cloned between the NotI and HindIII sites of the
pShuttleCMV vector. These vectors, along with the supplied
pShuttleCMV-lacZ, were recombined, in BJ5183 electrocompetent
bacteria (Stratagene), with the AdEasy vector containing the Ad5
genome deleted for E1 and E3 regions. Primary viral stocks were
prepared by transiently transfecting the recombined AdEasy plasmids
into host HEK293 cells. Adenovirus stocks were further amplified in
HEK293 cells and purified using the Virakit Adeno purification kit
(Virapur). Adenovirus titres were obtained by agarose-overlaid
plaque assays.
[0243] 1. Protective Effect of Short-Term Intravenous
Administration of Angpt13
[0244] For short-term analysis of liver protection from toxic
injury, Adenoviral constructs was administered to 12 adult BalbC
mice via tail vein injections which allows for continuous and
robust expression of protein in the livers as early as 2 days for
up to 3 weeks after treatment at a dose of 1.times.10.sup.9 Pfu for
mAngpt13 and LacZ encoding control virus, and 1.times.10.sup.7 Pfus
of VEGF encoding virus. 5 days after treatment with adenoviral
vectors, the mice were subdivided into two subgroups (n=6) that
were further subjected to treatment with: vehicle (olive oil) or
CC14 (carbon tetra chloride), the potent hepatotoxic agent which
induces liver damage. Both, vehicle and CC14 were given at 4 ml/kg
by oral gavage. After 48 hours, animals were killed, blood was
collected and tissues were harvested and fixed for analysis. The
levels of construct expression in the mice were analyzed by western
blot analysis at day 7 after adenoviral infection (FIG. 10A).
[0245] Results
[0246] The protective effect of Angpt13 on CC14 induced hepatocyte
necrosis was demonstrated by the significant, 2.1 fold reduction in
the blood levels of aspartate transferase (AST), which is an
indicator of liver failure, in the serum from mice treated with
adenovirus encoding Angpt13, but not by any of the control
constructs (p<0.0001) (FIG. 10B). Accordingly, transient
administration of recombinant Angpt13 may be beneficial for the
treatment of liver injuries.
[0247] 2. Induced Liver Damage with Prolonged Intravenous
Expression of Angpt13
[0248] In order to assess the long term effects of increased
Angpt13 levels, mice that were treated with adenoviral vectors
encoding Angpt13 as described above were characterized during a
period of 2 weeks post viral transduction. [0249] a. Blood
Chemistry Analysis
[0250] Blood chemistry levels indicative for liver function was
measured in serum samples taken from wild-type, C57B16 mice, during
a period of 2 weeks post adenoviral transduction. Hematology
Cell-Cyn 13700, and blood chemistry levels were determined on a
Cobas Integra 400.
[0251] As shown in FIG. 11A, adenoviral vectors encoding Angpt13,
but not control viruses encoding LacZ or Angiopoietin 1 (Ang1),
induced a strong increase in serum ALT and AST levels. The increase
in serum ALT and AST levels was comparable to levels of ALT and AST
that are observed with carbon tetrachloride treatment. Accordingly,
interference with Angpt13 activity may be potential treatments
during inflammatory diseases of the liver or diseases of the
heart.
[0252] In order to further assess a potential contribution of the
immune system, blood chemistry levels indicative for liver function
was measured in immuno-compromised RAG2-knock out mice, which lack
B- and T-cells and SCID mice, which lack B, T and natural killer
(NK) cells. As shown in FIG. 11B, adenoviral vectors encoding
Angpt13 induced AST and ALT levels in RAG2 mice, suggesting that
the changes in liver function induced by Angpt13 occur irrespective
of the presence of an intact immune system. [0253] b. Hepatocyte
Proliferation
[0254] To further characterize the effect of treatment with
adenoviral vectors expressing Angpt13 on RAG2-knock out and SCID
mice, cell proliferation in various formalin-fixed, BrdU
incorporated organs, including kidney, heart, liver, lung and small
intestine, of treated mice was quantitated in RAG2-knock out and
SCID mice that were either treated with adenoviral vectors
expressing Angpt13 or control adenoviral vectors. Cell
proliferation was measured by performing BrDU staining which
detects cells during the S phase of the cell cycle on
paraffin-embedded sections that were taken from the control- or
Angpt13-treated mice 14 days post adenoviral administration (IV).
BrdU was administered intraperitoneally to animals at the dose of
100 mg/kg, 1 hour prior to sacrifice. After a 20 minute treatment
with 0.05% trypsin at 37.degree. C. and a 45 minute treatment with
95% formamide in 0.15M trisodium citrate at 70.degree. C. for
denaturing, tissues were stained with mouse antibodies to IdU/BrdU
(Caltag) at a dilution of 1:1000 overnight at 4.degree. C. A
biotinylated horse antibody to mouse IgG (Vector) was used as the
secondary reagent and detected by using the Vectastin ABC Standard
Elite kit (Vector Laboratories). Mouse Isotype (Zymed) was used as
a negative control. Sections were then counterstained with
hematoxylin. The total number of labeled nuclei in 10 independent,
randomly selected fields using a 40.times. objective, were counted.
Each filed covered an area of 0.063 mm.sup.2.
[0255] As shown in Table 2, a greater than 10 fold induction of
hepatoycte proliferation was observed in RAG2-knock out and SCID
mice that were treated with adenoviral vectors expressing Angpt13.
TABLE-US-00004 TABLE 2 Increased BrDU staining in liver sections of
Angptl3 treated RAG2 knock out or SCID beige mice relative to
control treatment 14 days post treatment RAG2 knock out mice Scid
beige nude mice PBS 13.0 .+-. 5.3 9.0 .+-. 6.2 Ad-LacZ (1 .times.
10.sup.9 PFU) 3.5 .+-. 1.3 3.3 .+-. 1.7 Ad-Angptl3 (1 .times.
10.sup.9 PFU) 81.2 .+-. 24.9 67.2 .+-. 20.1
[0256] c. Histological Analysis
[0257] Histological analysis was performed on liver sections that
were harvested from C57/B16 14 days after infection with adenoviral
vectors. An increase in mitotic figure which are indicative of cell
proliferation within hepatocytes and inflammatory infiltrates was
observed in the liver sections that were isolated from mice treated
with adenoviral vectors encoding Angpt13 when compared to livers
that were isolated from control mice that were treated with
adenoviral vectors encoding LacZ. The livers of Angpt13-treated
animals were also significantly larger than livers of
control-treated animals. [0258] d. FACS Analysis
[0259] Although LFA1 and Mac-1 expressed on immune cells did not
bind to recombinant Angpt13 (Camenisch et al., 2002) when tested by
ELISA assays in vitro, other members of the integrin family that
are expressed on immune cells may be involved with Angpt13.
[0260] In order to study the possibility that inflammatory cells
contribute to the tissue damage observed in livers of mice treated
with adenoviral vector expressing CCLF1, the amount of peripheral
blood cells was determined by FACS for the presence of the various
lineages by staining for cell type specific markers. No significant
differences in the amounts of progenitors (Sca1), T-cells (CD4 and
CD8), B-cells (B220), macrophage (Gr1/Mac1) and erythroid cells
(Ter119) was detected in the mice treated with adenoviral vector
expressing Angpt13 when compared to amounts detected in mice
treated with control adenoviral vectors expressing LacZ or Ang1.
Similarly, no difference in the amount of serum glycerides and
cholesterol was observed between the treatment groups. [0261] e.
Cell Adhesion Analysis
[0262] To further investigate the cellular mechanism involved in
mediating liver damage, cell adhesion experiments with hepatocytes
and endothelial cells on Angpt13-coated tissue culture dishes were
performed similar to cell adhesion assays described in Example
6.
[0263] 96-well flat-bottomed plates (MaxiSorp, Nunc, Denmark) were
coated overnight at 4.degree. C. with the indicated concentrations
of proteins and blocked with 3% BSA in PBS for 1 hour at 37.degree.
C. Primary human dermal endothelial cells (HMVECs) and freshly
isolated murine hepatocytes that were prepared from the livers of
adult C57/B16 mice using the method described in LeCouter et al
(LeCouter et al., 2001) were harvested and diluted to 10.sup.5
cells/ml in serum-free CS-C medium containing 1% BSA, 1 mM
CaCl.sub.2 and 1 mM MgCl.sub.2 in the presence of 200 nM PMA.
Qualitatively similar results with regard to cell binding were
observed in the absence of PMA. Cell suspensions (10.sup.4
cells/well) were added to the coated wells and the plates were
incubated at 37.degree. C. for selected times. Non-adherent cells
were removed by PBS washes and cell attachment was measured using
the PNAG method of Landegren (Landegren, 1984). Results were
expressed at mean OD.sub.405 values of triplicate wells.
[0264] As shown in FIG. 13, HMVEC adhesion to Angpt13-coated dishes
was between 20% and 50% relative to the level of adhesion observed
for fibronectin-coated plates. Coating-concentration dependent
hepatocyte adhesion was also observed. Accordingly, hepatocytes and
endothelial cells may be involved in mediating the biological
effects observed in the liver of Angpt13 treated mice.
[0265] 3. Increased Vascular Permeability with Intradermal
Administration of Angpt13
[0266] To study the vascular changes induced by transient Angpt13
expression in adult mice, adenoviral expression vectors
(1.times.10.sup.-9 PFUs) were administered in a total volume of 10
.mu.l into the epidermal skin layer of the ears of adult FVB mice
under anesthesia and further analyzed for changes in vascular
permeability by using the Evans Blue assay. Briefly, mice were
anesthetized from the beginning and throughout the entire Evans
Blue assay. After onset of anesthesia, 100 .mu.l of Evans Blue (1%
solution in PBS) was administered intravenously to the mice via
tail vein injection. After a period of 60 minutes post
administration of Evan Blue, mice were perfused from the left
ventricle with 1% paraformaldehyde in citrate buffer at a pH of 3.5
at a pressure of 120 mmHg. Ears were removed and weighed. Evans
blue dye was extracted from the cars with 1 mL of formamide. The
amount of extravasated Evan Blue was measured with a light
spectrophotometer at 610 nm and expressed as the content dye per 1
mg of wet weight of tissue.
[0267] Results:
[0268] An increase in vascular permeability that was measured by
Evans Blue assay as relative to the levels of vascular permeability
in mice administered control adenoviral vectors expressing LacZ,
was observed in the ears of mice that were intradermally
administered adenoviral vectors expressing Angpt13 or VEGF (FIG.
12D), 6 days post administration.
[0269] B. Increased Vascular Permeability in Transgenic Mice
Expressing-K5-mAngpt13
[0270] In an alternate method, the developmental effects of
increased levels of Angpt13 expression in the skin were studied by
generating transgenic mice that expressed murine Angpt13 under the
control of a keratinocyte specific promoter, which is
constitutively expressed during development and in adults. [0271]
1. Founder Transgenic Mice
[0272] Founder transgenic mice were made using K5-gD-mAng5, a
construct that allows expression of Angpt13 under the control of
the murine K5 promoter, as per standard procedures (Filvaroff et
al., 2002). For generation of the K5-gD-mAng5 construct, the
Angpt13 gene was cut out NotI-NotI and inserted into pNASSK5.beta.
NotI-NotI-SAP resulting in K5-gD-mAng5.
[0273] A total of 17 transgenic founder strains were generated. The
mice pups were genotyped at 9 days of age by PCR of mouse tail DNA
(QIAGEN, Santa Clarita, Calif.) using the following primer sets:
TABLE-US-00005 (SEQ ID NO:32) gD-mAng5.311.F: ATATGCCTTGGCGGATGC;
and (SEQ ID NO:33) gD-mAng5.578.R: ATGGACAAAATCTTTAAGTCCATGAC.
[0274] At 8 weeks of age, biopsies of several tissues, including
muscle, kidney, liver, spleen, skin, brain, thymus an intestine,
were taken and subjected to real time RT-PCR for the determination
of the levels of endogenous and transgene expression of Angpt13.
For RT-PCR analysis, the following probes and primers which were
designed such that endogenous and transgenic transcripts were
measurable were used: TABLE-US-00006 MMAng5.1165.FP: (SEQ ID NO:34)
FAM-CTCCCAGAGCACACAGACCTGATGTTTT-TAMRA MMAng5.114.F: (SEQ ID NO:35)
GCTGGCAATATCCCTGGG MMAng5.1223.R: (SEQ ID NO:36)
AGCTGTCCCTTTGCTCTGTGA
[0275] Statistical analysis of differences between transgenic mice
expressing Angpt13 under the murine K5 promoter was determined by a
Student's t test with a value of P<0.05 considered to be
statistically significant and as value of P<0.01 as highly
significant.
[0276] 2. Progeny Transgenic Mice
[0277] Based on gene expression analysis from skin biopsies of all
the transgenic founder mice, the five most highly
Angpt13-expressing founders were identified and selected for
further breeding to C57/B16 mice. Genotype frequency analysis
revealed normal Mendelian frequency distribution of the transgene
and no significant postnatal lethality was observed to be
associated with transgene expression. [0278] a. Transgene
Expression
[0279] RNA from various tissues indicated was isolated and the
relative levels of transgene expression relative to endogenous
expression, specifically in the liver, was assessed by real time
RT-PCR.
[0280] As expected, increased levels of murine Angpt13 expression
was observed in the skin of transgenic versus liter matched
wild-type controls. Transgene expression of Angpt13 in the skin
reached about 10% of the endogenous Angpt13 expression levels in
the liver (FIG. 12A).
[0281] Further, moderate expression in the lung and the brain of 12
weeks old transgenic mice when compared to wild-type mice was
observed. Accordingly, the expression in the lung and the brain may
result from increased transcriptional activity of the K5 promoter
in these tissues.
[0282] In support of the moderate Angpt13 expression found by
Northern blot analysis in adult human kidneys (FIG. 8A), Taqman
analysis. of mouse kidney RNA revealed moderate endogenous
expression levels of Angpt13.
[0283] In order to monitor postnatal transgene expression over
time, real time RT-PCR analysis was conducted with RNA isolated
from skin biopsies of 3, 6 and 11 week old transgenic mice. As
shown in FIG. 12B, consistent levels of transgene expression were
observed in the skin of transgenic mice at all developmental stages
tested. [0284] b. Vascular Permeability
[0285] Based on the transgene expression data, 12 week old
transgenic and wild-type liter matched wild-type controls were
selected and subjected to an assay for vascular permeability using
the Evans Blue assay similar as described above and previously for
Ang1 and Ang2, two structurally related members of the angiopoietin
family of angiogenic molecules(Maisonpierre et al., 1997; Thurston
et al., 2000; Thurston et al., 1999). Vascular permeability was
measured by the Evans Blue assay as described above. Both of the 11
week-old transgenic strains that were subjected to Evans Blue
analysis had a significant increase, between 2- and 3-fold
increase, in vascular permeability at basal levels (FIG. 12C) when
compared to liter matched wild-type strains. However, the vascular
permeability differences between the transgenic mice and the liter
matched wild-type mice was less significant when the mice were
challenged with mustard oil prior to subjection to Evans Blue assay
analysis. Accordingly, the increase in vascular permeability in
transgenic mice relative to their wild-type litter controls may
suggest a role for Angpt13 in the regulation of vascular
permeability.
Deposit of Material
[0286] As noted before, the following materials have been deposited
with the American Type Culture Collection, 12301 Parklawn Drive,
Rockville, Md., USA (ATCC): TABLE-US-00007 Material ATCC Dep. No.
Deposit Date Angptl3-DNA16451-1078 209281 Sep. 18, 1997
[0287] These deposits were made under the provisions of the
Budapest Treaty on the International Recognition of the Deposit of
Microorganisms for the Purpose of Patent Procedure and the
Regulations thereunder (Budapest Treaty). This assures maintenance
of a viable culture of the deposit for 30 years from the date of
the deposit. The deposit will be made available by ATCC under the
terms of the Budapest Treaty, and subject to an agreement between
Genentech, Inc. and ATCC, which assures permanent and unrestricted
availability of the progeny of the culture of the deposit to the
public upon issuance of the pertinent U.S. patent or upon laying
open to the public of any U.S. or foreign patent application,
whichever comes first, and assures availability of the progeny to
one determined by the U.S. Commissioner of Patents and Trademarks
to be entitled thereto according to 35 USC .sctn.122 and
Commissioner's rules pursuant thereto (including 37 C.F.R.
.sctn.1.14 with particular reference to 886 OG 683).
[0288] The assignee of the present application has agreed that if a
culture of the materials on deposit should die to be lost or
destroyed when cultivated under suitable conditions, the materials
will be promptly replaced on notification with another of the same.
Availability of the deposited material is not to be construed as a
license to practice the invention in contravention of the rights
granted under the authority of any government in accordance with
its patent laws.
[0289] The present specification is considered to be sufficient to
enable one skilled in the art to practice the invention. The
present invention is not to be limited in scope by the construct
deposited, since the deposited embodiment is intended as a single
illustration of certain aspects of the invention and any constructs
that are functionally equivalent are within the scope of the
invention. The deposit of material herein does not constitute an
admission that the written description is inadequate to enable the
practice of any aspect of the invention, including the best more
thereof, nor is it to be construed as limiting the scope of the
claims to the specific illustrations that it represents. Indeed,
various modifications of the invention in addition to those shown
and described herein will become apparent to those skilled in the
art from the foregoing description and fall within the scope of the
appended claims.
Sequence CWU 1
1
36 1 2042 DNA Homo sapiens 1 gcggacgcgt gggtgaaatt gaaaatcaag
ataaaaatgt tcacaattaa gctccttctt 60 tttattgttc ctctagttat
ttcctccaga attgatcaag acaattcatc atttgattct 120 ctatctccag
agccaaaatc aagatttgct atgttagacg atgtaaaaat tttagccaat 180
ggcctccttc agttgggaca tggtcttaaa gactttgtcc ataagacgaa gggccaaatt
240 aatgacatat ttcaaaaact caacatattt gatcagtctt tttatgatct
atcgctgcaa 300 accagtgaaa tcaaagaaga agaaaaggaa ctgagaagaa
ctacatataa actacaagtc 360 aaaaatgaag aggtaaagaa tatgtcactt
gaactcaact caaaacttga aagcctccta 420 gaagaaaaaa ttctacttca
acaaaaagtg aaatatttag aagagcaact aactaactta 480 attcaaaatc
aacctgaaac tccagaacac ccagaagtaa cttcacttaa aacttttgta 540
gaaaaacaag ataatagcat caaagacctt ctccagaccg tggaagacca atataaacaa
600 ttaaaccaac agcatagtca aataaaagaa atagaaaatc agctcagaag
gactagtatt 660 caagaaccca cagaaatttc tctatcttcc aagccaagag
caccaagaac tactcccttt 720 cttcagttga atgaaataag aaatgtaaaa
catgatggca ttcctgctga atgtaccacc 780 atttataaca gaggtgaaca
tacaagtggc atgtatgcca tcagacccag caactctcaa 840 gtttttcatg
tctactgtga tgttatatca ggtagtccat ggacattaat tcaacatcga 900
atagatggat cacaaaactt caatgaaacg tgggagaact acaaatatgg ttttgggagg
960 cttgatggag aattttggtt gggcctagag aagatatact ccatagtgaa
gcaatctaat 1020 tatgttttac gaattgagtt ggaagactgg aaagacaaca
aacattatat tgaatattct 1080 ttttacttgg gaaatcacga aaccaactat
acgctacatc tagttgcgat tactggcaat 1140 gtccccaatg caatcccgga
aaacaaagat ttggtgtttt ctacttggga tcacaaagca 1200 aaaggacact
tcaactgtcc agagggttat tcaggaggct ggtggtggca tgatgagtgt 1260
ggagaaaaca acctaaatgg taaatataac aaaccaagag caaaatctaa gccagagagg
1320 agaagaggat tatcttggaa gtctcaaaat ggaaggttat actctataaa
atcaaccaaa 1380 atgttgatcc atccaacaga ttcagaaagc tttgaatgaa
ctgaggcaat ttaaaggcat 1440 atttaaccat taactcattc caagttaatg
tggtctaata atctggtata aatccttaag 1500 agaaagcttg agaaatagat
tttttttatc ttaaagtcac tgtctattta agattaaaca 1560 tacaatcaca
taaccttaaa gaataccgtt tacatttctc aatcaaaatt cttataatac 1620
tatttgtttt aaattttgtg atgtgggaat caattttaga tggtcacaat ctagattata
1680 atcaataggt gaacttatta aataactttt ctaaataaaa aatttagaga
cttttatttt 1740 aaaaggcatc atatgagcta atatcacaac tttcccagtt
taaaaaacta gtactcttgt 1800 taaaactcta aacttgacta aatacagagg
actggtaatt gtacagttct taaatgttgt 1860 agtattaatt tcaaaactaa
aaatcgtcag cacagagtat gtgtaaaaat ctgtaataca 1920 aatttttaaa
ctgatgcttc attttgctac aaaataattt ggagtaaatg tttgatatga 1980
tttatttatg aaacctaatg aagcagaatt aaatactgta ttaaaataag ttcgctgtct
2040 tt 2042 2 460 PRT Homo sapiens 2 Met Phe Thr Ile Lys Leu Leu
Leu Phe Ile Val Pro Leu Val Ile Ser 1 5 10 15 Ser Arg Ile Asp Gln
Asp Asn Ser Ser Phe Asp Ser Leu Ser Pro Glu 20 25 30 Pro Lys Ser
Arg Phe Ala Met Leu Asp Asp Val Lys Ile Leu Ala Asn 35 40 45 Gly
Leu Leu Gln Leu Gly His Gly Leu Lys Asp Phe Val His Lys Thr 50 55
60 Lys Gly Gln Ile Asn Asp Ile Phe Gln Lys Leu Asn Ile Phe Asp Gln
65 70 75 80 Ser Phe Tyr Asp Leu Ser Leu Gln Thr Ser Glu Ile Lys Glu
Glu Glu 85 90 95 Lys Glu Leu Arg Arg Thr Thr Tyr Lys Leu Gln Val
Lys Asn Glu Glu 100 105 110 Val Lys Asn Met Ser Leu Glu Leu Asn Ser
Lys Leu Glu Ser Leu Leu 115 120 125 Glu Glu Lys Ile Leu Leu Gln Gln
Lys Val Lys Tyr Leu Glu Glu Gln 130 135 140 Leu Thr Asn Leu Ile Gln
Asn Gln Pro Glu Thr Pro Glu His Pro Glu 145 150 155 160 Val Thr Ser
Leu Lys Thr Phe Val Glu Lys Gln Asp Asn Ser Ile Lys 165 170 175 Asp
Leu Leu Gln Thr Val Glu Asp Gln Tyr Lys Gln Leu Asn Gln Gln 180 185
190 His Ser Gln Ile Lys Glu Ile Glu Asn Gln Leu Arg Arg Thr Ser Ile
195 200 205 Gln Glu Pro Thr Glu Ile Ser Leu Ser Ser Lys Pro Arg Ala
Pro Arg 210 215 220 Thr Thr Pro Phe Leu Gln Leu Asn Glu Ile Arg Asn
Val Lys His Asp 225 230 235 240 Gly Ile Pro Ala Glu Cys Thr Thr Ile
Tyr Asn Arg Gly Glu His Thr 245 250 255 Ser Gly Met Tyr Ala Ile Arg
Pro Ser Asn Ser Gln Val Phe His Val 260 265 270 Tyr Cys Asp Val Ile
Ser Gly Ser Pro Trp Thr Leu Ile Gln His Arg 275 280 285 Ile Asp Gly
Ser Gln Asn Phe Asn Glu Thr Trp Glu Asn Tyr Lys Tyr 290 295 300 Gly
Phe Gly Arg Leu Asp Gly Glu Phe Trp Leu Gly Leu Glu Lys Ile 305 310
315 320 Tyr Ser Ile Val Lys Gln Ser Asn Tyr Val Leu Arg Ile Glu Leu
Glu 325 330 335 Asp Trp Lys Asp Asn Lys His Tyr Ile Glu Tyr Ser Phe
Tyr Leu Gly 340 345 350 Asn His Glu Thr Asn Tyr Thr Leu His Leu Val
Ala Ile Thr Gly Asn 355 360 365 Val Pro Asn Ala Ile Pro Glu Asn Lys
Asp Leu Val Phe Ser Thr Trp 370 375 380 Asp His Lys Ala Lys Gly His
Phe Asn Cys Pro Glu Gly Tyr Ser Gly 385 390 395 400 Gly Trp Trp Trp
His Asp Glu Cys Gly Glu Asn Asn Leu Asn Gly Lys 405 410 415 Tyr Asn
Lys Pro Arg Ala Lys Ser Lys Pro Glu Arg Arg Arg Gly Leu 420 425 430
Ser Trp Lys Ser Gln Asn Gly Arg Leu Tyr Ser Ile Lys Ser Thr Lys 435
440 445 Met Leu Ile His Pro Thr Asp Ser Glu Ser Phe Glu 450 455 460
3 20 DNA Homo sapiens 3 ccacgttggc ttgaaattga 20 4 50 DNA Homo
sapiens 4 cctccagaat tgatcaagac aattcatgat ttgattctct atctccagag 50
5 19 DNA Homo sapiens 5 tcgtctaaca tagcaaatc 19 6 27 DNA
Bacteriophage 6 ggattctaat acgactcact atagggc 27 7 21 DNA Homo
sapiens 7 ggcattcctg ctgaatgtac c 21 8 27 DNA Bacteriophage 8
ctatgaaatt aaccctcact aaaggga 27 9 21 DNA Homo sapiens 9 accacactca
tcatgccacc a 21 10 16 PRT Homo sapiens 10 Tyr Ser Met Lys Lys Thr
Thr Met Lys Ile Ile Pro Phe Asn Arg Leu 1 5 10 15 11 20 DNA Murine
11 gatgaccttc ctgccgactg 20 12 13 PRT Homo sapiens 12 Gly Val Tyr
Tyr Gln Gly Gly Thr Tyr Ser Lys Ala Ser 1 5 10 13 19 DNA Murine 13
gtcattccac caccagcca 19 14 13 PRT Homo sapiens 14 Pro Trp Thr Leu
Ile Gln His Arg Ile Asp Gly Ser Gln 1 5 10 15 19 PRT Homo sapiens
15 Tyr Ser Ile Lys Ser Thr Lys Met Leu Ile His Pro Thr Asp Ser Glu
1 5 10 15 Ser Phe Glu 16 17 PRT Homo sapiens 16 Tyr Ser Ile Lys Ser
Thr Lys Met Leu Ile His Pro Thr Asp Ser Glu 1 5 10 15 Ser 17 16 PRT
Homo sapiens 17 Gly Lys Tyr Asn Lys Pro Arg Ala Lys Ser Lys Pro Glu
Arg Arg Arg 1 5 10 15 18 14 PRT Homo sapiens 18 Gly Lys Tyr Asn Lys
Pro Arg Ala Lys Ser Lys Pro Glu Arg 1 5 10 19 13 PRT Homo sapiens
19 Gly Lys Tyr Asn Lys Pro Arg Ala Lys Ser Lys Pro Glu 1 5 10 20 13
PRT Artificial Sequence Peptide comprising inverted human sequence.
20 Gln Ser Gly Asp Ile Arg His Gln Ile Leu Thr Trp Pro 1 5 10 21 13
PRT Artificial Sequence Peptide comprising scrambled human
sequence. 21 Pro Gln Trp Ser Thr Gly Leu Asp Ile Ile Gln Arg His 1
5 10 22 17 PRT Artificial Sequence Peptide comprising inverted
human sequence. 22 Ser Glu Ser Asp Thr Pro His Ile Leu Met Lys Thr
Ser Lys Ile Ser 1 5 10 15 Tyr 23 17 PRT Artificial Sequence Peptide
comprising scrambled human sequence. 23 Tyr Ser Ser Glu Ile Ser Lys
Asp Ser Thr Thr Pro Lys His Met Ile 1 5 10 15 Leu 24 14 PRT
Artificial Sequence Peptide comprising inverted human sequence. 24
Arg Glu Pro Lys Ser Lys Ala Arg Pro Lys Asn Tyr Lys Gly 1 5 10 25
14 PRT Artificial Sequence Peptide comprising scrambled human
sequence. 25 Gly Arg Lys Glu Tyr Pro Asn Lys Lys Ser Pro Lys Arg
Ala 1 5 10 26 13 PRT Homo sapiens 26 Gly Trp Thr Val Phe Gln Lys
Arg Leu Asp Gly Ser Val 1 5 10 27 242 PRT Homo sapiens 27 Lys Asp
Cys Gln Asp Ile Ala Asn Lys Gly Ala Lys Gln Ser Gly Leu 1 5 10 15
Tyr Phe Ile Lys Pro Leu Lys Ala Asn Gln Gln Phe Leu Val Tyr Cys 20
25 30 Glu Ile Asp Gly Ser Gly Asn Gly Trp Thr Val Phe Gln Lys Arg
Leu 35 40 45 Asp Gly Ser Val Asp Phe Lys Lys Asn Trp Ile Gln Tyr
Lys Glu Gly 50 55 60 Phe Gly His Leu Ser Pro Thr Gly Thr Thr Glu
Phe Trp Leu Gly Asn 65 70 75 80 Glu Lys Ile His Leu Ile Ser Thr Gln
Ser Ala Ile Pro Tyr Ala Leu 85 90 95 Arg Val Glu Leu Glu Asp Trp
Asn Gly Arg Thr Ser Thr Ala Asp Tyr 100 105 110 Ala Met Phe Lys Val
Gly Pro Glu Ala Asp Lys Tyr Arg Leu Thr Tyr 115 120 125 Ala Tyr Phe
Ala Gly Gly Asp Ala Gly Asp Ala Phe Asp Gly Phe Asp 130 135 140 Phe
Gly Asp Asp Pro Ser Asp Lys Phe Phe Thr Ser His Asn Gly Met 145 150
155 160 Gln Phe Ser Thr Trp Asp Asn Asp Asn Asp Lys Phe Glu Gly Asn
Cys 165 170 175 Ala Glu Gln Asp Gly Ser Gly Trp Trp Met Asn Lys Cys
His Ala Gly 180 185 190 His Leu Asn Gly Val Tyr Tyr Gln Gly Gly Thr
Tyr Ser Lys Ala Ser 195 200 205 Thr Pro Asn Gly Tyr Asp Asn Gly Ile
Ile Trp Ala Thr Trp Lys Thr 210 215 220 Arg Trp Tyr Ser Met Lys Lys
Thr Thr Met Lys Ile Ile Pro Phe Asn 225 230 235 240 Arg Leu 28 215
PRT Homo sapiens 28 Ala Glu Cys Thr Thr Ile Tyr Asn Arg Gly Glu His
Thr Ser Gly Met 1 5 10 15 Tyr Ala Ile Arg Pro Ser Asn Ser Gln Val
Phe His Val Tyr Cys Asp 20 25 30 Val Ile Ser Gly Ser Pro Trp Thr
Leu Ile Gln His Arg Ile Asp Gly 35 40 45 Ser Gln Asn Phe Asn Glu
Thr Trp Glu Asn Tyr Lys Tyr Gly Phe Gly 50 55 60 Arg Leu Asp Gly
Glu Phe Trp Leu Gly Leu Glu Lys Ile Tyr Ser Ile 65 70 75 80 Val Lys
Gln Ser Asn Tyr Val Leu Arg Ile Glu Leu Glu Asp Trp Lys 85 90 95
Asp Asn Lys His Tyr Ile Glu Tyr Ser Phe Tyr Leu Gly Asn His Glu 100
105 110 Thr Asn Tyr Thr Leu His Leu Val Ala Ile Thr Gly Asn Val Pro
Asn 115 120 125 Ala Ile Pro Glu Asn Lys Asp Leu Val Phe Ser Thr Trp
Asp His Lys 130 135 140 Ala Lys Gly His Phe Asn Cys Pro Glu Gly Tyr
Ser Gly Gly Trp Trp 145 150 155 160 Trp His Asp Glu Cys Gly Glu Asn
Asn Leu Asn Gly Lys Tyr Asn Lys 165 170 175 Pro Arg Ala Lys Ser Lys
Pro Glu Arg Arg Arg Gly Leu Ser Trp Lys 180 185 190 Ser Gln Asn Gly
Arg Leu Tyr Ser Ile Lys Ser Thr Lys Met Leu Ile 195 200 205 His Pro
Thr Asp Ser Glu Ser 210 215 29 215 PRT Homo sapiens 29 Arg Asp Cys
Ala Asp Val Tyr Gln Ala Gly Phe Asn Lys Ser Gly Ile 1 5 10 15 Tyr
Thr Ile Tyr Ile Asn Asn Met Pro Glu Pro Lys Lys Val Phe Cys 20 25
30 Asn Met Asp Val Asn Gly Gly Gly Trp Thr Val Ile Gln His Arg Glu
35 40 45 Asp Gly Ser Leu Asp Phe Gln Arg Gly Trp Lys Glu Tyr Lys
Met Gly 50 55 60 Phe Gly Asn Pro Ser Gly Glu Tyr Trp Leu Gly Asn
Glu Phe Ile Phe 65 70 75 80 Ala Ile Thr Ser Gln Arg Gln Tyr Met Leu
Arg Ile Glu Leu Met Asp 85 90 95 Trp Glu Gly Asn Arg Ala Tyr Ser
Gln Tyr Asp Arg Phe His Ile Gly 100 105 110 Asn Glu Lys Gln Asn Tyr
Arg Leu Tyr Leu Lys Gly His Thr Gly Thr 115 120 125 Ala Gly Lys Gln
Ser Ser Leu Ile Leu His Gly Ala Asp Phe Ser Thr 130 135 140 Lys Asp
Ala Asp Asn Asp Asn Cys Met Cys Lys Cys Ala Leu Met Leu 145 150 155
160 Thr Gly Gly Trp Trp Phe Asp Ala Cys Gly Pro Ser Asn Leu Asn Gly
165 170 175 Met Phe Tyr Thr Ala Gly Gln Asn His Gly Lys Leu Asn Gly
Ile Lys 180 185 190 Trp His Tyr Phe Lys Gly Pro Ser Tyr Ser Leu Arg
Ser Thr Thr Met 195 200 205 Met Ile Arg Pro Leu Asp Phe 210 215 30
215 PRT Homo sapiens 30 Arg Asp Cys Ala Glu Val Phe Lys Ser Gly His
Thr Thr Asn Gly Ile 1 5 10 15 Tyr Thr Leu Thr Phe Pro Asn Ser Thr
Glu Glu Ile Lys Ala Tyr Cys 20 25 30 Asp Met Glu Ala Gly Gly Gly
Gly Trp Thr Ile Ile Gln Arg Arg Glu 35 40 45 Asp Gly Ser Val Asp
Phe Gln Arg Thr Trp Lys Glu Tyr Lys Val Gly 50 55 60 Phe Gly Asn
Pro Ser Gly Glu Tyr Trp Leu Gly Asn Glu Phe Val Ser 65 70 75 80 Gln
Leu Thr Asn Gln Gln Arg Tyr Val Leu Lys Ile His Leu Lys Asp 85 90
95 Trp Glu Gly Asn Glu Ala Tyr Ser Leu Tyr Glu His Phe Tyr Leu Ser
100 105 110 Ser Glu Glu Leu Asn Tyr Arg Ile His Leu Lys Gly Leu Thr
Gly Thr 115 120 125 Ala Gly Lys Ile Ser Ser Ile Ser Gln Pro Gly Asn
Asp Phe Ser Thr 130 135 140 Lys Asp Gly Asp Asn Asp Lys Cys Ile Cys
Lys Cys Ser Gln Met Leu 145 150 155 160 Thr Gly Gly Trp Trp Phe Asp
Ala Cys Gly Pro Ser Asn Leu Asn Gly 165 170 175 Met Tyr Tyr Pro Gln
Arg Gln Asn Thr Asn Lys Phe Asn Gly Ile Lys 180 185 190 Trp Tyr Tyr
Trp Lys Gly Ser Gly Tyr Ser Leu Lys Ala Thr Thr Met 195 200 205 Met
Ile Arg Pro Ala Asp Phe 210 215 31 215 PRT Homo sapiens 31 Gln Asp
Cys Ala Glu Ile Gln Arg Ser Gly Ala Ser Ala Ser Gly Val 1 5 10 15
Tyr Thr Ile Gln Val Ser Asn Ala Thr Lys Pro Arg Lys Val Phe Cys 20
25 30 Asp Leu Gln Ser Ser Gly Gly Arg Trp Thr Leu Ile Gln Arg Arg
Glu 35 40 45 Asn Gly Thr Val Asn Phe Gln Arg Asn Trp Lys Asp Tyr
Lys Gln Gly 50 55 60 Phe Gly Asp Pro Ala Gly Glu His Trp Leu Gly
Asn Glu Val Val His 65 70 75 80 Gln Leu Thr Arg Arg Ala Ala Tyr Ser
Leu Arg Val Glu Leu Gln Asp 85 90 95 Trp Glu Gly His Glu Ala Tyr
Ala Gln Tyr Glu His Phe His Leu Gly 100 105 110 Ser Glu Asn Gln Leu
Tyr Arg Leu Ser Val Val Gly Tyr Ser Gly Ser 115 120 125 Ala Gly Arg
Gln Ser Ser Leu Val Leu Gln Asn Thr Ser Phe Ser Thr 130 135 140 Leu
Asp Ser Asp Asn Asp His Cys Leu Cys Lys Cys Ala Gln Val Met 145 150
155 160 Ser Gly Gly Trp Trp Phe Asp Ala Cys Gly Leu Ser Asn Leu Asn
Gly 165 170 175 Val Tyr Tyr His Ala Pro Asp Asn Lys Tyr Lys Met Asp
Gly Ile Arg 180 185 190 Trp His Tyr Phe Lys Gly Pro Ser Tyr Ser Leu
Arg Ala Ser Arg Met 195 200 205 Met Ile Arg Pro Leu Asp Ile 210 215
32 18 DNA Murine 32 atatgccttg gcggatgc 18 33 26 DNA Murine 33
atggacaaaa tctttaagtc catgac 26 34 28 DNA Murine 34 ctcccagagc
acacagacct gatgtttt 28 35 18 DNA Murine 35 gctggcaata tccctggg 18
36 21 DNA Murine 36 agctgtccct ttgctctgtg a 21
* * * * *
References