U.S. patent application number 11/654824 was filed with the patent office on 2007-06-07 for novel protein associated with cell stress response.
This patent application is currently assigned to Chiron Corporation, a Delaware corporation. Invention is credited to Robert F. Halenbeck, Dong Wei, Lewis T. Williams.
Application Number | 20070128710 11/654824 |
Document ID | / |
Family ID | 37807105 |
Filed Date | 2007-06-07 |
United States Patent
Application |
20070128710 |
Kind Code |
A1 |
Wei; Dong ; et al. |
June 7, 2007 |
Novel protein associated with cell stress response
Abstract
A stress-phosphorylated endoplasmic reticulum protein, Nogo B,
is provided. The protein is hyperphosphorylated as a result of
exposure of cells to stress. Two transcripts of Nogo B are
identified in human tissues, and the longer transcript is
predominant in human brain tumor samples.
Inventors: |
Wei; Dong; (San Francisco,
CA) ; Halenbeck; Robert F.; (San Rafael, CA) ;
Williams; Lewis T.; (Mill Valley, CA) |
Correspondence
Address: |
NOVARTIS VACCINES AND DIAGNOSTICS INC.
CORPORATE INTELLECTUAL PROPERTY R338
P.O. BOX 8097
Emeryville
CA
94662-8097
US
|
Assignee: |
Chiron Corporation, a Delaware
corporation
|
Family ID: |
37807105 |
Appl. No.: |
11/654824 |
Filed: |
January 18, 2007 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
09544776 |
Apr 7, 2000 |
7186530 |
|
|
11654824 |
Jan 18, 2007 |
|
|
|
60128372 |
Apr 8, 1999 |
|
|
|
60140331 |
Jun 21, 1999 |
|
|
|
Current U.S.
Class: |
435/194 |
Current CPC
Class: |
C12Q 2600/158 20130101;
C07K 14/47 20130101; C12Q 1/6886 20130101 |
Class at
Publication: |
435/194 |
International
Class: |
C12N 9/12 20060101
C12N009/12 |
Claims
1. A purified polypeptide, the amino acid sequence of which
comprises a sequence at least 90% identical to SEQ ID NO:2, or an
immunogenic fragment thereof.
2. The purified polypeptide of claim 1, the amino acid sequence of
which comprises a sequence at least 95% identical to SEQ ID
NO:2.
3. The purified polypeptide of claim 1, the amino acid sequence of
which comprises a sequence at least 98% identical to SEQ ID
NO:2.
4. The purified polypeptide of claim 1, the amino acid sequence of
which comprises a sequence at least 99% identical to SEQ ID
NO:2.
5. The purified polypeptide of claim 1, the amino acid sequence of
which comprises SEQ ID NO:2.
6. The purified polypeptide of claim 1, the amino acid sequence of
which consists of SEQ ID NO:2
7. The purified polypeptide of claim 1, comprising up to 10
conservative amino acid substitutions, insertions or deletions.
8. The purified polypeptide of claim 7, comprising up to 10
conservative amino acid substitutions.
9. The purified polypeptide of claim 7, comprising up to 5
conservative amino acid substitutions.
10. The purified polypeptide of claim 1, comprising up to 7
conservative amino acid substitutions.
11. The purified polypeptide of claim 1, wherein phosphorylation of
the polypeptide is increased during cellular stress.
12. The purified polypeptide of claim 11, wherein the cellular
stress is one or more of ultraviolet irradiation, DNA damage,
osmotic stress, ionic stress, or oxidative stress.
13. The polypeptide of claim 1, wherein the polypeptide binds
specifically to an antibody that binds specifically to Nogo B.
14. The antibody of claim 13, wherein the antibody is a monoclonal
antibody, a polyclonal antibody, a chimeric antibody, a human
antibody, a humanized antibody, a single-chain antibody, or a Fab
fragment.
15. The purified polypeptide of claim 1, the amino acid sequence of
which comprises amino acids 2-373 of SEQ ID NO:2.
16. A purified polypeptide comprising: (a) amino acids 1-197 of SEQ
ID NQ:2; and (b) amino acids 236-373 of SEQ ID NO:2, wherein the
amino acid residue corresponding to residue 197 of SEQ ID NO: 2 is
joined by a peptide bond to the amino acid residue corresponding to
residue 236 of SEQ ID NO:2.
17. A purified polypeptide comprising: (a) amino acids 1-288 of SEQ
ID NO:2; and (b) amino acids 336-373 of SEQ ID NO:2, wherein the
amino acid residue corresponding to residue 288 of SEQ ID NO:2 is
joined by a peptide bond to the amino acid residue corresponding to
residue 336 of SEQ ID NO:2.
18. A purified polypeptide comprising: (a) amino acids 1-197 of SEQ
ID NO:2; and (b) amino acids 236-288 of SEQ ID NO:2; and (c) amino
acids 336-373 of SEQ ID NO:2; wherein the amino acid residue
corresponding to residue 197 of SEQ ID NO:2 is joined by a peptide
bond to the amino acid residue corresponding to residue 236 of SEQ
ID NO:2, and the amino acid residue corresponding to residue 288 of
SEQ ID NO: 2 is joined by a peptide bond to the amino acid residue
corresponding to residue 336 of SEQ ID NO:2.
Description
TECHNICAL FIELD
[0001] This invention relates to the identification and recombinant
expression of a stress-related protein associated with the
endoplasmic reticulum.
BACKGROUND OF THE INVENTION
[0002] The endoplasmic reticulum (ER) is the site of production of
most transmembrane proteins and lipids for cell organelles. The ER
captures proteins from the cytosol as they are synthesized, and
these proteins are transmembrane proteins or soluble proteins. The
soluble proteins are fully translocated across the membrane and
released into the ER lumen. In contrast, transmembrane proteins are
only partially translocated across the ER membrane. During the
course of protein synthesis and processing, the proteins fold to
form their tertiary structure.
[0003] When cells are exposed to conditions that disrupt protein
folding in the ER, the transcription of genes encoding ER proteins
may be upregulated. An unfolded protein response (UPR) exists in
cells; this response follows detection of unfolded protein in the
ER lumen. During the response, a signal is transduced across the ER
membrane to activate transcription of selected genes in the
nucleus.
[0004] Stress and stress responses can have many deleterious
effects on an organism. There is a need in the art for additional
therapeutic compositions to modulate stress responses.
SUMMARY OF THE INVENTION
[0005] The invention provides a new protein that is associated with
the endoplasmic reticulum. The protein is hyperphosphorylated in
conditions of cell stress.
[0006] The invention relates to a native human Nogo protein that is
substantially free of other human proteins.
[0007] The invention further relates to a protein having the amino
acid sequence of SEQ ID NO:2.
[0008] The invention still further relates to variants of the
protein of SEQ ID NO:2 and to fusion proteins comprising all or
part of SEQ ID NO:2.
[0009] The invention also relates to polynucleotides encoding all
or part of the protein of SEQ ID NO:2.
[0010] The invention further relates to a polynucleotide having the
sequence of SEQ ID NO:1, and to polynucleotides having at least 85%
homology to SEQ ID NO:1.
[0011] The invention relates to antibodies, including monoclonal
and polyclonal antibodies, that recognize all or part of the Nogo
protein of the invention, and to fragments of antibodies including
single-chain antibodies.
[0012] The invention further relates to methods of identifying the
Nogo proteins of the invention using the antibodies.
[0013] The invention also relates to methods of identifying or
quantifying expression products of the gene encoding the Nogo of
the invention, using probes capable of hybridizing to RNA or DNA
encoding the Nogo protein, under stringent conditions.
[0014] The invention relates to methods of detecting cell stress,
wherein the phosphorylation of the protein of the invention is
detected or measured.
[0015] The invention also relates to methods of modulating
phosphorylation of Nogo proteins during stress, using agents that
inhibit the phosphorylation of Nogo.
[0016] The invention further relates to methods of inactivating a
Nogo protein by stimulating phosphorylation of the Nogo
protein.
[0017] The invention still further relates to methods of inhibiting
a Nogo protein using antisense polynucleotides and ribozymes, and
to related methods of stimulating cell turnover.
BRIEF DESCRIPTION OF THE DRAWINGS
[0018] FIG. 1. The sequence of Nogo. (A) Amino acid sequence of
Nogo deduced from the DNA sequence of the cDNA in clone 610949.
Peptide sequences obtained from the purified Nogo protein via Mass
Spectrometry and Microsequencing are underlined. (B) Amino acid
sequences of Nogo and NSP-B were compared using the PILEUP program.
Consensus sequences are highlighted. (C) The full-length sequence
of Nogo was used for homology searching against the PROSITE
database with the PFAMPROT program. FLIP was the only domain with
the score above threshold. The score was--150.6, with an E-value of
8.6.
[0019] FIG. 2. Subcellular localization of Nogo. IMR90 cells (A,B)
or GM00637 cells (C,D) were infected with a retrovirus expressing
EGFP alone (A) or an EGFP-Nogo fusion protein (B,C,D). Pictures
were taken at 2-3 days after infection. (E). IMR90 cells infected
with retrovirus expressing EGFP alone (lanes 1 and 2) or an
EGFP-Nogo fusion protein (lanes 3 and 4) were trypsinized and lysed
with digitonin followed by NP-40. Digitonin-solubilized fractions
(cyto; lanes 1 and 3) and NP-40-solubilized fractions (nuc; lanes 2
and 4) were separated on SDS-PAGE and transferred to a PVDF
membrane. A monoclonal antibody against GFP was used for Western
Blotting.
[0020] FIG. 3. Tissue-specific expression of the Nogo gene. (A). A
Northern Blot containing MRNA from different tissues was probed
with the full-length Nogo B cDNA. Positions of the two major Nogo
transcripts were shown. The position of the 2.4 KB RNA marker was
also indicated. (B). The same blot was stripped and reprobed with
the cDNA for .beta.-actin. Positions of the actin transcript and
the 2.4 KB RNA marker were shown.
[0021] FIG. 4. FIG. 4 shows hyperphosphorylation of Nogo after
treatment with other stress-inducing agents. (A) IMR90 cells were
treated with 0, 0.5, 1, or 4 .mu.M of BPDE and trypsinized after 30
minutes. (B) IMR90 cells were incubated in the presence or absence
of suramin (0.15 mM) for 1 hour before being irradiated with 0 or
20 J/m.sup.2 of UVC. (C) IMR90 cells were treated with 0.7 M NaCl,
1 mM H.sub.2O.sub.2, 0.4 M Sorbitol or PBS (control) for 45 minutes
before being lysed.
[0022] FIG. 5. FIG. 5 shows that hyperphosphorylation of Nogo could
be abolished by specific inhibitors against p38. IMR90 cells were
incubated in the presence of SB202190 and PD169316, two specific
inhibitors against p38, at indicated concentrations for 30 minutes.
Then cells were irradiated with 20 J/m.sup.2 of UVC and lysed 30
minutes later. Whole cell lysates were separated on SDS-PAGE. SC-54
was used for Western Blotting.
[0023] FIG. 6. FIG. 6 illustrates the purification of Nogo. (A)
Exponentially growing IMR90 cells were lysed by digitonin followed
by NP-40 as described in Materials and Methods. Only the
NP-40-solubilized fraction was subjected to purification by Mono-S
column. Eluted fractions were separated on SDS-PAGE. SC-54 was used
for Western Blotting. Positions of Nogo B and the 46 KD protein
marker are shown. Fraction numbers were indicated. (B) Eluted
fractions 42-48 from the Mono-S column were combined and subjected
to purification by Mono-Q column. Eluted fractions were separated
on SDS-PAGE. SC-54 was used for Western Blotting. Positions of Nogo
and the 46 KD protein marker are shown. Fraction numbers are
indicated. (C) Eluted fractions from Mono-Q column were separated
on SDS-PAGE. The gel was then stained with Coomassie Bright Blue.
Sizes of the molecular weight markers are shown. BSA was loaded as
an indicator of size and amount of protein.
[0024] FIG. 7. FIG. 7 shows hyperphosphorylation of Nogo after UVC
irradiation. (A) IMR90 cells were irradiated with 0 or 20 J/m.sup.2
of UVC (254 nm). (B) IMR90 cells were synchronized at G1 phase,
irradiated with 0 (G1-0) or 20 J/m.sup.2 (G1-20) of UVC and
trypsinized 2 hours later. (C) IMR90 cells were irradiated with 20
J/m.sup.2 of UVC and lysed using buffers with or without vanadate
two hours later.
[0025] FIG. 8. Loss of the major Nogo transcript in brain tumors.
(A). A Northern Blot containing total RNA from different tumor
samples and corresponding normal samples (collected from the normal
tissue surrounding the tumor) was probed with the full-length Nogo
B cDNA. Positions of the two major Nogo transcripts were shown. The
position of the 2.4 KB RNA marker was also indicated. (B). The same
blot was stripped and reprobed with the cDNA for .beta.-actin.
Positions of the actin transcript and the 2.4 KB RNA marker were
shown.
[0026] FIG. 9. Specific downregulation of Nogo using antisense
oligonucleotides correlated with cytotoxicity and slowed cell
growth. (A) IMR90 cells were plated at 3.times.10.sup.5 cells per
60 mm dish. After 24 hours, cells were transfected with antisense
oligonucleotides or PBS (control) for 16 hours. Cells were then
incubated in normal medium for another 24 hours. Photographs
illustrate areas representative of the state of cell growth on the
dish. (B) Cells were trypsinized, then lysed. Lysates were
separated on SDS-PAGE and transferred to a PVDF membrane, and the
membrane was cut into half The half containing proteins with lower
molecular weight was probed with SC-54. Positions of Nogo and Cdc2
are shown. (C) The remaining half of the membrane containing
proteins with higher molecular weight was probed with a polyclonal
antibody against GRP94.
DETAILED DESCRIPTION OF THE INVENTION
[0027] Cells respond to a variety of extracellular stimuli via
activation of the mitogen-activated protein (MAP) kinase cascades.
The specificity of the cellular response is determined by the
activation of a particular MAP kinase pathway in response to a
given stimulus and by the activation of downstream targets by a
given MAP kinase. P38s are members of the MAP kinase superfamily
and they are activated by cell stresses such as DNA damage, heat
shock, osmotic shock, as well as proinflammatory stimuli such as
lipopolysaccharides and interleukin-1. There are four members in
the p38 family: p38.alpha. (also known as SAPK2a, RK, CSBP),
p38.beta. (SAPK2b), p38.gamma. (SAPK3) and p38.sigma.(SAPK4). All
four are activated by MAP kinase kinase (MKK) 3 or MKK6 via
phosphorylation of the TGY motif. How MKK3 or MKK6 are regulated is
poorly understood. It has been shown that activation of the kinase
cascade leading to stimulation of p38 requires the Rho-subfamily
GTPases Cdc42 and Rac. The MLK3 family of protein kinases has been
shown to be activators of MKK3 and MKK6, but there are likely to be
others.
[0028] Identified substrates for p38s include transcription factors
and protein kinases such as ribosomal S6 kinase (RSK; also known as
MAPKAP-K1), MAP kinase-interacting kinases or MAP
kinase-integrating kinase (MNK), p38 regulated/activated kinase
(PRAK) and MAP kinase activated protein kinases (MAPKAP-Ks). RSK
proteins have been shown to play important roles in a variety of
processes including cell proliferation. MNK can phosphorylate
eukaryotic initiation factor-4E (eIF-4E) in vitro, suggesting an
important link between MAP kinase activation and translational
initiation. PRAK is a newly identified kinase shown to
phosphorylate small heat shock proteins. Upon activation,
MAPKAP-K2/3 can phosphorylate small heat shock protein (HSP27),
lymphocyte-specific protein 1 (LSP1), cAMP response element binding
protein (CREB), ATF1 and tyrosine hydroxylase. It was recently
shown that p38 was actually associated with MAPKAP-K2, and
phosphorylation of MAPKAP-K2 by p38 was required for this complex
to be exported from the nucleus to the cytoplasm to phosphorylate
the cytosolic targets such as HSP27.
[0029] Exposure to stress leads to changes not only in the nucleus
and the cytoplasm, but also in the endoplasmic reticulum (ER). ER
is an organelle specialized for protein folding and assembly of
membrane proteins and of proteins destined for trafficking to
lysosomes and for secretion. In the lumen of ER, many chaperone
proteins facilitate the protein folding process. When cells are
exposed to conditions that disrupt protein folding or there are
unfolded or unassembled proteins in the ER, the transcription of
many of the genes encoding ER resident proteins, such as the GRPs
including Bip and GRP94, is upregulated. The unfolded protein
response (UPR) in cells detects unfolded proteins in the ER lumen
to activate transcription of selective genes in the nucleus.
Recently, Ire1P was cloned and identified as an essential proximal
sensor of this UPR pathway. On activation of UPR, Ire1P elicits an
endonuclease activity that specifically cleaves an intron from the
HAC1 mRNA, resulting in more efficient translation. The
consequently increased level of the HAC1 protein leads to
transcription activation of genes containing a UPRE (Unfolded
Protein Response Element), including many genes encoding ER
resident proteins.
[0030] ER is also the major intracellular reservoir of Ca.sup.2+ in
non-muscle cells. Many ER chaperones, including GRPs, calnexin and
calreticulin, are Ca.sup.2+ binding proteins and regulate Ca.sup.2+
accumulation and release in ER, thereby controlling the
intracellular Ca.sup.2+ homeostasis. Sequestration of Ca.sup.2+ by
ER plays an important role in signal transduction and is essential
for a number of vital cellular functions including translation,
protein processing and cell division. ER is a primary target for
oxidative damage, which decreases the amount of Ca.sup.2+
sequestered within the ER by inhibiting the Ca.sup.2+-ATPase uptake
pump and by increasing the efflux of Ca.sup.2+ through
ER-associated channels. The resulting increase of Ca.sup.2+
concentration in the cytoplasm has been proposed to exacerbate
oxidative stress, damage mitochondria, activate Ca.sup.2+-dependent
degradation enzymes and disrupt the cytoskeleton.
[0031] Even though p38 and ER represent two important cellular
stress response pathways, so far there have been no studies linking
them together. The present invention relates to the cloning and
identification of a novel protein, p46, which is rapidly
phosphorylated when cells are exposed to various stresses. The
phosphorylation was p38 dependent because specific inhibitors for
p38 could completely abolish this effect. Using EGFP-p46 fusion
proteins, p46 was found to be localized in endoplasmic reticulum.
Downregulation of p46 using antisense oligonucleotides resulted in
cytotoxicity and slowed cell growth, suggesting that p46 normally
carries out functions on ER that are important for cell growth and
viability. Significant downregulation of the major p46 transcript
was observed in four out of four cases of brain tumors, suggesting
that this process may be involved in tumor development and growth
in brain.
[0032] The p46 gene encodes a protein of 373 amino acids. Searching
the sequence against GenBank using BLAST program showed that while
the amino-terminal (N-terminal) part of p46 (amino acids 1-187) had
little homology to other genes, its carboxy-terminal (C-terminal)
part shared significant homology to the C-terminal part of human
neuroendocrine-specific proteins (NSPs). NSPs include NSP-A, NSP-B
and NSP-C, which are encoded by different mRNAs transcribed from
the same gene. Other NSP-like proteins have also been identified.
While the functions of NSPs are unknown, studies have implicated
their possible roles in cancer. At least NSP-C has been localized
in the membrane of ER. Similarly, the p46 protein of the invention
also carries a potential C-terminal ER retention signal (KRKAE), of
which the motif consists of two lysine residues at the (-3) and
either the (-4) or (-5) positions from the C-terminus.
[0033] Subsequent to the present discovery of this stress-related
protein, there were reports in the literature of a protein referred
to as Nogo, which exists in three forms. Nogo A is a protein of
about 1,192 amino acids. Nogo B is a shorter form and is missing
amino acids 186-1004. Nogo C is similar to Nogo B, but has a
smaller amino terminal domain. (Prinjha, R. et al., Nature
403:383-384, 2000.) The inventors have determined that Nogo B
corresponds to the protein of the present invention, so for
consistency, the term Nogo B is used herein to refer to the novel
protein of the invention.
[0034] Prinjha et al. reported that Nogo A, as a bivalent Fc
fragment, is an inhibitor of neurite outgrowth. However, the
functions and activity of Nogo B and Nogo C were not identified
conclusively. (Goldberg, J. L. et al., Nature 403:369-370,
2000).
[0035] According to the invention, when the Nogo B gene was
expressed at an in-frame position at 3' of the EGFP gene, the
fusion protein showed a localization pattern typical of ER
distribution. Moreover, EGFP alone could be released by digitonin,
yet the EGFP-Nogo B fusion protein, like Nogo B, could only be
released by NP-40. Therefore, although Nogo B does not carry a
signal peptide, it is very likely to be localized in ER.
[0036] Like neuroendocrine-specific proteins, Nogo B has two long
hydrophobic regions at the C-terminal part: amino acids 198-235 and
289-335. They are composed of consecutive hydrophobic residues,
making them less likely to be traditional transmeinbrane domains.
Searching the protein sequence against PROSITE database using
PFAMPROT program showed that the C-terminal part of the protein
shared significant homology to the signature patterns of Flagella
transport protein FLIP family (FIG. 5C), which are involved in the
transport of flagellar proteins and also in a variety of signal
peptide-independent secretion systems. The flagellar biosynthetic
protein FLIP also carries very long hydrophobic regions, which are
hypothesized to be embedded in the membrane and to act as an anchor
for other proteins in the complex. Indeed, NSP-C has been localized
in the ER membrane. The C-terminal part of Nogo B may also serve as
an anchor in the ER membrane, because in size-fractionation
experiments, the majority of Nogo B is present in a complex larger
than 200 KD.
[0037] Nogo B is a protein abundant in normal human fibroblasts,
since it represents about 1/2000 of the total protein solubilized
by NP-40. Its presence on ER, therefore, suggests important
functions. Antisense oligonucleotides complementary to the Nogo B
MRNA were used to specifically downregulate Nogo B. As described in
the Examples, all four antisense oligonucleotides efficiently and
significantly decreased the levels of Nogo B. Treated cells
underwent apoptosis, and the remaining cells showed abnormal
morphology and slowed growth. Cytotoxicities conferred by different
oligonucleotides were different. However, for each specific
oligonucleotide, the level of downregulation of Nogo B correlated
well with the apparent cytotoxicity. Less cytotoxicity was observed
with antisense oligonucleotide AS2-1 than with AS2-2, while
significantly more Nogo B remained with AS2-1 (FIGS. 9A and 9B).
When cells were plated at a higher density for treatment with
oligonucleotides, less cytotoxicity was observed and downregulation
of Nogo B was also lower. These data indicate that at least part of
the cytotoxic effect is a result of Nogo B downregulation,
suggesting that Nogo B plays an important role in maintaining
normal cell viability and proliferation.
[0038] According to the invention, Nogo B normally exists in
unphosphorylated and hypophosphorylated forms. When cells are
exposed to various stresses, Nogo B rapidly becomes
hyperphosphorylated in a dose-dependent manner. The
hyperphosphorylation is likely to be a result of p38 activation
because these stress conditions activate p38 and the presence of
very low concentrations (close to IC50) of specific inhibitors
against p38 completely abolished the hyperphosphorylation (FIG.
1-3). Furthermore, the N-terminal part of Nogo B contains two
putative phosphorylation sites for MAPKAP-K2 (FIG. 5A), which has
been shown to be activated by p38. Even though the majority of Nogo
B existed in a complex of about 200 kD in normal cells, the size of
the complex was not significantly affected by hyperphosphorylation,
suggesting that hyperphosphorylation was unlikely to result in
dissociation of the complex or association of any additional
factors. Rather, this hyperphosphorylation might lead to
conformational changes and, consequently, alteration of the normal
functions of the Nogo B complex, which may in turn help the ER cope
with the stress condition.
[0039] ER has been shown to be involved in the stress response via
two pathways: unfolded protein response initiated by detection of
unfolded or misfolded proteins in ER, and the Ca.sup.2+ response.
In conditions where hyperphosphorylation of Nogo B was observed,
such as UVC irradiation, no significant increase of GRP78 or GRP94,
indicative of UPR, could be detected. Therefore it is unlikely that
Nogo B plays a role in the UPR pathway. The Ca.sup.2+ response, on
the other hand, occurred rapidly, similar to that of Nogo B
hyperphosphorylation. The abundance of Nogo B also makes it a
likely candidate to modulate the Ca.sup.2+ ATPase and/or Ca.sup.2+
channels.
[0040] There were two major transcripts for Nogo B in human
tissues: one at 2.6 KB and the other at 2.3 KB (FIG. 7A). Different
transcripts may be a result of alternative splicing. The
transcripts show strong tissue-specific distribution. While the 2.6
KB transcript showed highest levels of expression in the heart, the
levels of the 2.3 KB transcript were the highest in skeletal
muscle, liver and brain (FIG. 7A). In muscle cells, smooth ER is
abundant and further develops into the sarcoplasmic reticulum,
which specializes in controlling Ca.sup.2+ uptake and release.
Smooth ER is also abundant in cells active in lipid metabolism,
such as hepatocytes. The observation of the relatively high level
of Nogo B transcripts, and, very likely, the Nogo B protein in
those tissues, is consistent with an important role for Nogo B in
ER function. Taking into consideration that Nogo B is a downstream
target of p38, it is of interest that these tissues are also
constantly exposed to various stresses, which could trigger the
activation of p38. For example, high aortic pressure or
ischemial/reperfusion in perfused rat heart led to p38 activation.
H.sub.2O.sub.2 can induce myocardial TNF production via a
p38-dependent pathway. MAPKAP-K2, which is one of the kinases
activated by p38, has been shown to have the highest expression in
heart and skeletal muscle.
[0041] The major transcript in the brain, the 2.3 KB transcript,
was almost completely lost in the four brain tumor samples studied,
suggesting that Nogo B may be involved in tumorigenesis in brain.
This observation is not inconsistent with an important role of Nogo
B in cell growth and viability, since the 2.6 KB transcript
remained in the tumor cells and may provide enough Nogo B for
maintaining cell growth. Alternatively, the presence of the 2.3 KB
transcript as the major transcript may be a result of factor(s)
present only in well-differentiated normal brain cells. The
factor(s) may be lost in brain tumor cells, which are usually less
differentiated, leading to the loss of the 2.3 KB transcript. This
is supported by the fact that the four tumor samples studied were
of three distinct types, i.e., meningioma, glioma and malignant
lymphoma. In either case, the 2.3 KB transcript may be used as a
diagnostic or prognostic marker for brain tumors.
[0042] The loss of a Nogo B transcript in brain tumor samples may
be consistent with the recent identification of the Nogo family as
a potential inhibitor of nerve regeneration. Thus, replacement of
the missing Nogo B polynucleotide and/or protein may help to
regulate brain tumor cell growth.
[0043] It has also been suggested that myelin inhibitory activity
of neuron regeneration is released after tissue injury. (Davies, S.
J. et al., J. Neurosci. 19:5810-5822, 1999.) This is consistent
with the present results, which show phosphorylation of Nogo B
during activation of the stress response pathway in cells.
[0044] Nogo B appears to be the first ER protein shown to be
phosphorylated as a result of p38 activation. This phosphorylation
occurs rapidly. Evidence herein suggests that Nogo B plays an
important role in cell growth and viability. Hyperphosphorylation
of Nogo B may lead to conformational changes that result in
alteration of its normal function in ER. The present invention
provides the first evidence to link p38 to the ER functions when
cells are exposed to stress.
[0045] Nucleic acid molecules of the invention include the sequence
set forth in SEQ ID NO:1, sequences encoding the amino acid
sequences set forth in SEQ ID NO:2, the sequence deposited as ATCC
Accession No. PTA-89, and fragments, variants and derivatives
thereof. Such variants will share at least 65% sequence identity,
generally 68%, 70%, 80%, preferably 90%, 95%, 96%, 97%, 98%, or 99%
sequence identity with the polynucleotide sequence of SEQ ID NO:1,
polynucleotides encoding the amino acid sequence of SEQ ID NO:2 and
the polynucleotide deposited as ATCC Accession No. PTA-89. Sequence
identity can be determined using any algorithms known in the art,
including but not limited to the following algorithm: Global DNA
sequence identity is greater than 65% as determined by the
Smith-Waterman homology search algorithm as implemented in MPSRCH
program (Oxford Molecular) using an affine gap search with the
following search parameters: gap open penalty: 12, gap extension
penalty: 1.
[0046] As indicated above, the sequence of the invention is an
endoplasmic reticulum protein. Analysis of the protein sequence of
this novel protein using the Kyte-Doolittle program showed that
there are two hydrophobic regions (aa 198-238 and aa 290-335), both
of which are flanked by charged residues, suggesting that there are
two transmembrane domains. Each domain may penetrate the membrane
twice because a regular single-span transmembrane domain consists
of about 20 amino acids. At the C terminus, there is an ER
retention signal (KRYAE). The novel protein appears to be located
in (or on) the endoplasmic reticulum (ER).
[0047] Polypeptides of the invention encompass the sequences set
forth herein as well as derivatives, analogs and variants thereof.
Variants include substantially homologous proteins having at least
about 65%, typically at least about 70-75%, more typically at least
about 80-85%, and most typically at least about 90-95%, 96%, 97%,
98%, or 99% homology. It is recognized that amino acid
substitutions may be made, particularly conservative substitutions.
See, Bowleetal (1990) Science 247:1306-1310. A variant polypeptide
can differ in amino acid sequence by one or more substitutions,
deletions, insertions, inversions, fusions and truncations or a
combination of any of these. Variants can be naturally-occurring or
can be made by recombinant means or chemical synthesis. Variant
polypeptides may be fully functional or lack function in one or
more activities.
[0048] Amino acids in the protein that are essential for function
can be identified by site-directed mutagenesis, alanine-scanning
mutagenesis (Cunningham et al. (1989) Science 244:1081-1085), etc.
The resulting mutant molecules are then tested for biological
activity. Critical sites for receptor binding can be determined. As
described in, for example, Smith et al. (1992) J. Mol. Biol.
224:899-904; de Vos et al. (1992) Science 255:306-312:
[0049] The amino acid sequence of Nogo B polypeptide can be varied
without significant effect on the structure or function of the
protein. If such differences in sequence are contemplated, it
should be remembered that there are critical areas on the protein
which determine activity. In general, it is possible to replace
residues that form the tertiary structure, provided that residues
performing a similar function are used. In other instances, the
type of residue may be completely unimportant if the alteration
occurs at a non-critical region of the protein. Thus, the
polypeptides of the present invention may include one or more amino
acid substitutions, deletions or additions, either from natural
mutations or human manipulation.
[0050] The invention therefore further includes variations of the
Nogo B polypeptide which show substantial Nogo B polypeptide
activity or which include regions of Nogo B protein such as the
protein portions discussed below. Such mutants include deletions,
insertions, inversions, repeats, and type substitutions. Guidance
concerning which amino acid changes are likely to be phenotypically
silent can be found in Bowie, J. U., et al., "Deciphering the
Message in Protein Sequences: Tolerance to Amino Acid
Substitutions," Science 247:1306-1310 (1990).
[0051] Of particular interest are substitutions of charged amino
acids with another charged amino acid and with neutral or
negatively charged amino acids. The latter results in proteins with
reduced positive charge to improve the characteristics of the Nogo
B proteins. The prevention of aggregation is highly desirable.
Aggregation of proteins not only results in a loss of activity but
can also be problematic when preparing pharmaceutical formulations,
because they can be immunogenic. (Pinckard et al., Clin. Exp.
Immunol. 2:331-340 (1967); Robbins et al., Diabetes 36:838-845
(1987); Cleland et al., Crit. Rev. Therapeutic Drug Carrier Systems
10:307-377 (1993)).
[0052] Amino acids in the polypeptides of the present invention
that are essential for function can be identified by methods known
in the art, such as site-directed mutagenesis or alanine-scanning
mutagenesis (Cunningham and Wells, Science 244:1081-1085 (1989)).
The latter procedure introduces single alanine imutations at every
residue in the molecule. The resulting mutant molecules are then
tested for biological activity such as the ability to become
phosphorylated. It may be desirable to use this method to obtain a
Nogo B variant that cannot be phosphorylated, and such variants are
within the scope of the invention. Sites that are critical for
ligand-receptor binding can also be determined by structural
analysis such as crystallization, nuclear magnetic resonance or
photoaffinity labeling (Smith et al., J. Mol. Biol. 224:899-904
(1992), and de Vos et al., Science 255:306-312 (1992)).
[0053] As indicated, changes are preferably of a minor nature, such
as conservative amino acid substitutions that do not significantly
affect the folding or activity of the protein. Of course, the
number of amino acid substitutions a skilled artisan would make
depends on many factors, including those described above. Generally
speaking, the number of substitutions for any given Nogo B
polypeptide will not be more than 50, 40, 30, 25, 20, 15, 10, 5 or
3.
[0054] Several regions are of particular importance in Nogo B. The
C terminus of this novel protein (amino acids (aa) 188-373), is
highly homologous to the C terminus of the human
neuroendocrine-specific protein, which exists specifically in
neurons and has been localized to the ER, and whose function is not
clear. The N terminus of Nogo B shares little homology to any known
proteins. The C terminus (aa 206 to aa 327) also shares homology to
Flagella transport protein, FLIP, family signatures. Proteins
evolutionarily related to FLIP have been found in a wide range of
bacteria and are involved in a variety of signal-peptide
independent secretion systems.
[0055] Another aspect of the invention is a chimeric polypeptide
comprising a Nogo B polypeptide, or fragment thereof, and a
polypeptide of interest. The invention therefore provides a
chimeric polypeptide comprising a Nogo B polypeptide, or fragment
thereof, fused to a polypeptide of interest, referred to as a
second polypeptide. Nucleotide sequences encoding chimeric Nogo B
and Nogo B polypeptides are also provided. In preferred embodiments
the Nogo B polypeptide or fragment thereof is not normally found
fused to the second polypeptide.
[0056] Yet another object of the invention is to provide
polynucleotides that encode the mutants, fragments, and
derivatives, as well as the native Nogo B. These polynucleotides
can be operably linked to heterologous promoters to form expression
cassettes. The expression cassettes can be introduced into suitable
host cells for expression of Nogo B and/or Nogo B polypeptides and
derivatives thereof.
[0057] Another object of the invention is to provide a transformed
cell transiently expressing or having stably incorporated into its
genome an expression vector comprising a promoter operably linked
to a nucleotide sequence encoding a Nogo B or Nogo B polypeptide,
or a fragment, derivative, mutant or fusion thereof.
[0058] The compositions of the invention comprise amino acid and
nucleotide sequences for Nogo B. Such compositions have several
uses including modulation of stress levels and cellular stress
response, modulation of cell growth and viability, diagnosis and
treatment of cancer and malignant growth, and diagnosis and
treatment of other Nogo B related diseases.
[0059] "Fragments" possess the same amino acid sequence as the
native or mutant Nogo B polypeptides except the fragments lack the
amino, internal, and/or carboxyl terminal sequences of the native
or mutant polypeptide.
[0060] "Derivatives" possess the same amino acid sequence as the
native, mutant or fragment Nogo B but may contain amino acid
substitutions, deletions, glycosylated residues, or other chemical
modifications.
[0061] "Fusions" or "chimeric polypeptides" are mutants or
fragments of the native Nogo B that also include amino and/or
carboxyl terminal amino acid extensions.
[0062] The number or type of the amino acid substitutions is not
critical, nor is the length or number of the amino acid deletions,
or amino acid extensions that are incorporated in the Nogo B
polypeptides. However, all of these polypeptides will exhibit at
least about 20% of one of the activities of the native Nogo B. More
typically, the polypeptides exhibit at least about 40%, even more
typically the polypeptides exhibit at least about 60% of one of the
native Nogo B activities. All these polypeptides will retain at
least about 50% amino acid identity with SEQ ID NO:2, more
typically at least about 60%; even more typically, at least about
80%. Preferably, these polypeptides will retain at least about 85%
amino acid sequence identity with SEQ ID NO:2; more preferably, at
least about 90%; even more preferably, at least about 95%, 96%,
97%, 98%, or 99%.
[0063] "Nogo B activities" include modulation of the ER stress
response, modulation of storage and exchange of calcium, regulation
of oxidative stress, activation of ER downstream signaling,
modulation of oxidant toxicity, modulation of cell growth and
viability, ability to become hyperphosphorylated, modulation of
oxidation and oxidative damage, modulation of calcium uptake,
modulation of cellular stress response, inhibition of neurite
outgrowth, neuron growth, and axon regeneration. A specific assay
for activity is the hyperphosphorylation assay described in Example
2.
Expression of Nogo B and Nogo B Polypeptides
[0064] Preferably, Nogo B polypeptides are produced by
recombinantly engineered host cells. These host cells are
constructed by the introduction of an expression vector, preferably
comprising a promoter operably linked to a Nogo B polypeptide
coding sequence.
[0065] Such coding sequences can be constructed by synthesizing the
entire gene or by altering existing Nogo B polypeptide coding
sequences. Nogo B polypeptides can be divided into four general
categories discussed above: mutants, fragments, fusions, and the
native Nogo B polypeptides. The Nogo B polypeptides are those that
occur in nature. The amino acid sequence of such polypeptides may
vary slightly from SEQ ID NO:2. The native Nogo B and Nogo B
polypeptide coding sequence can be selected based on the amino acid
sequence shown in SEQ ID NO:2. For example, synthetic genes can be
made using codons preferred by the host cell to encode the desired
polypeptide. (See Urdea et al. (1983) Proc. Natl. Acad. Sci. USA
80:7461.) Alternatively, the desired native Nogo B polypeptide
coding sequences can be cloned from nucleic acid libraries.
Techniques for producing and probing nucleic acid sequence
libraries are described, for example, in Sambrook et al. (1989)
Molecular Cloning: A Laboratory Manual (New York, Cold Spring
Harbor Laboratory). Other recombinant techniques, such as site
specific mutagenesis, PCR, enzymatic digestion and ligation, can
also be used to construct the desired Nogo B polypeptide coding
sequence.
[0066] The native Nogo B polypeptide coding sequences can be
modified to create the other classes of Nogo B polypeptides. For
example, mutants can be created by making conservative amino acid
substitutions that maintain or enhance native Nogo B or Nogo B
activity. The following are examples of conservative substitutions:
GlyAla; ValIleLeu; AspGlu; LysArg; AsnGln; and PheTrpTyr. Mutants
can also contain amino acid deletions or insertions compared to the
native Nogo B polypeptides. Mutants may include substitutions,
insertions, and deletions of the native polypeptides.
[0067] Fragments of the Nogo B protein are also within the scope of
the invention. Preferred fragments comprise 10, 15, 20, 25, 30, 50,
75, 100, 125, 150, 175, 200, 225, 250, 275, 300, 325, 330, 340,
345, 350, 355, 360, 365, 368, 370 or 372 contiguous amino acids of
SEQ ID NO:2. Particularly preferred fragment comprise either amino
acids 1-368 or 2-368 of SEQ ID NO:2. Other preferred fragments
comprise (a) contiguous amino acids about 1 to about 197 and about
236 to about 373 wherein amino acids about 197 and about 236 are
joined by a peptide bond; (b) contiguous amino acids about 1 to
about 288 and about 336 to about 373 wherein amino acids about 288
and about 336 are joined by a peptide bond; or (c) amino acids
about 1 to about 197, about 236 to about 288, and about 336 to
about 373, wherein amino acids about 197 and about 236 are joined
by a peptide bond and amino acids about 288 and about 336 are
joined by a peptide bond. Embodiments (a), (b) and (c) may be
varied by the omission of some or all of amino acids 368-373.
[0068] Other preferred fragments include contiguous amino acids
about 198 to about 235 or about 289 to about 335 of SEQ ID NO:2;
contiguous amino acids about 1 to about 187 of SEQ ID NO:2;
contiguous amino acids about 2 to about 187 of SEQ ID NO:2; and
contiguous amino acids about 1 to about 198 of SEQ ID NO:2.
[0069] The fragments described above can be prepared by proteolysis
of the corresponding protein or portion thereof, or by expression
of a polynucleotide sequence encoding the amino acids of the
fragment as described herein. Preferred polynucleotide fragments
include 10, 15, 20, 25, 50, 75, 100, 125, 150, 175, 200, 250, 300,
350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 925,
950, 975, 1000, 1025, 1050, 1075, 1090, 1110, 1115, 1110, 1115,
1116, 1125, 1150, 1175, 1200, 1250, 1300, 1350, 1400, 1450, 1500,
1550, 1600, 1650, 1700, 1750, 1800, 1850, 1900, 1950, 2000, 2050,
2100, 2125, 2150, 2175, 2200, 2210, 2220, or 2201 contiguous
polynucleotides of SEQ ID NO:1.
Expression Vectors
[0070] An expression vector preferably will contain a promoter
which is operable, that is, drives expression in the host cell and
is operably linked to a Nogo B coding sequence. Sequences that
modulate gene expression, such as enhancers and binding sites for
inducers or repressors, may be present. Expression vectors may also
include signal sequences, terminators, selectable markers, origins
of replication, and sequences homologous to host cell sequences.
These additional elements are optional but can be included to
optimize expression, and are known in the art.
[0071] A Nogo B polypeptide coding sequence may also be linked in
reading frame to a signal sequence. The signal sequence fragment
typically encodes a peptide comprised of hydrophobic amino acids
which directs the Nogo B polypeptide to the cell membrane or other
subcellular compartment. Preferably, there are processing sites
encoded between the leader fragment and the Nogo B polypeptide or
fragment thereof that can be cleaved either in vivo or in vitro.
DNA encoding suitable signal sequences can be derived from genes
for secreted endogenous host cell proteins, such as the yeast
invertase gene (EP 12 873; JP 62,096,086), the A-factor gene (U.S.
Pat. No. 4,588,684), and the interferon signal sequence (EP 60
057).
[0072] Typically, terminators are regulatory sequences, such as
polyadenylation and transcription termination sequences, located 3'
or downstream of the stop codon of the coding sequences. Usually,
the terminator of native host cell proteins are. operable when
attached 3' of a Nogo B polypeptide coding sequence. Examples are
the Saccharomyces cerevisiae alpha-factor terminator and the
baculovirus terminator. Further, viral terminators are also
operable in certain host cells; for instance, the SV40 terminator
is functional in CHO cells.
[0073] Expression vectors may be integrated into the host cell
genome or remain autonomous within the cell. Polynucleotide
sequences homologous to sequences within the host cell genome may
be needed to integrate the expression cassette. The homologous
sequences do not always need to be linked to the expression vector
to be effective. For example, expression vectors can integrate into
the CHO genome via an unattached dihydrofolate reductase gene. In
yeast, it is more advantageous if the homologous sequences flank
the expression cassette. Particularly useful homologous yeast
genome sequences are those disclosed in PCT WO 90/01800, and the
HIS4 gene sequences, GenBank Accession No. J01331.
Purification
[0074] The purified Nogo B polypeptides are useful as compositions,
for assays, and to produce antibodies.
[0075] Nogo B polypeptides can be isolated by a variety of steps
including, for example, anion exchange chromatography, size
exclusion chromatography, hydroxylapatite chromatography,
hydrophobic interaction chromatography, metal chelation
chromatography, reverse phase HPLC, affinity chromatography, and
further ammonium sulfate precipitations. These techniques are well
known to those of skill in the art.
[0076] For ligand binding studies, and other in vitro assays, the
crude cell membrane fractions can be utilized. These membrane
extracts can be isolated from cells that express Nogo B
polypeptides, by lysing the cells. Alternatively, whole cells,
expressing Nogo B polypeptides, can be cultured in a microliter
plate.
Antibodies
[0077] Antibodies against Nogo B polypeptides are useful for
affinity chromatography, immunofluorescent assays, and
distinguishing Nogo B polypeptides.
[0078] Antibodies to the proteins of the present invention, both
polyclonal and monoclonal, may be prepared by conventional methods
known to those skilled in the art. For example, monoclonal
antibodies are prepared using the method of Kohler et al. (1975)
Nature 256:495-496, or a modification thereof.
[0079] If desired, the antibodies (whether polyclonal or
monoclonal) may be labeled using conventional techniques. Suitable
labels include fluorophores, chromophores, radioactive atoms
(particularly .sup.32P and .sup.125I), electron-dense reagents,
enzymes, and ligands having specific binding partners. Enzymes are
typically detected by their activity. For example, horseradish
peroxidase is usually detected by its ability to convert
3,3',5,5'-tetra-methylbenzidine (TMB) to a blue pigment,
quantifiable with a spectrophotometer. "Specific binding partner"
refers to a protein capable of binding a ligand molecule with high
specificity, as for example in the case of an antigen and a
monoclonal antibody specific therefor. Other specific binding
partners include biotin and avidin or streptavidin, IgG and protein
A, and the numerous receptor-ligand couples known in the art. It
should be understood that the above description is not meant to
categorize the various labels into distinct classes, as the same
label may serve in several different modes. For example, .sup.125I
may serve as a radioactive label or as an electron-dense reagent.
HRP may serve as enzyme or as antigen for a MAb. Further, one may
combine various labels for desired effect. For example, MAbs and
avidin also require labels in the practice of this invention: thus,
one might label a MAb with biotin, and detect its presence with
avidin labeled with .sup.125I, or with an anti-biotin MAb labeled
with HRP. Other permutations and possibilities will be readily
apparent to those of ordinary skill in the art, and are considered
as equivalents within the scope of the instant invention.
Anti-Sense Molecules and Ribozymes
[0080] Inhibitors of the present invention include anti-sense
molecules that, when administered to mammalian cells, are effective
in reducing, for example, intracellular protein levels of Nogo
proteins, specifically Nogo B. Anti-sense molecules bind in a
sequence-specific manner to nucleic acids, such as mRNA or DNA.
When bound to mRNA that has complementary sequences, anti-sense
molecules prevent translation of the mRNA (see, e.g., U.S. Pat. No.
5,168,053 to Altman et al.; U.S. Pat. No. 5,190,931 to Inouye, U.S.
Pat. No.5,135,917 to Burch; U.S. Pat. No. 5,087,617 to Smith and
Clusel et al. Nucl. Acids Res. 21:3405-3411 (1993), which describes
dumbbell anti-sense oligonucleotides).
[0081] Anti-sense technology can be used to control gene expression
through triple-helix formation, which promotes the ability of the
double helix to open sufficiently for the binding of polymerases,
transcription factors or regulatory molecules. See Gee et al., In
Huber and Carr, "Molecular and Immunologic Approaches," Futura
Publishing Co. (Mt. Kisco, N.Y.; 1994). Alternatively, an
anti-sense molecule may be designed to hybridize with a control
region of the Nogo B gene, e.g., promoter, enhancer or
transcription initiation site, and block transcription of the gene;
or block translation by inhibiting binding of a transcript to
ribosomes. See generally, Hirashima et al. in Molecular Biology of
RNA: New Perspectives (M. Inouye and B. S. Dudock, eds., 1987
Academic Press, San Diego, p. 401); Oligonucleotides: Anti-sense
Inhibitors of Gene Expression (J. S. Cohen, ed., 1989 MacMillan
Press, London); Stein and Cheng, Science 261:1004-1012 (1993); WO
95/10607; U.S. Pat. No. 5,359,051; WO 92/06693; and EP-A2-612844
each of which is incorporated herein by reference.
[0082] Briefly, such molecules are constructed such that they are
complementary to, and able to form Watson-Crick base pairs with, a
region of transcribed Nogo B mRNA sequence. The resultant
double-stranded nucleic acid interferes with subsequent processing
of the mRNA, thereby preventing protein synthesis.
[0083] In general, a portion of a sequence complementary to the
Nogo B coding region may be used to modulate gene expression.
Alternatively, cDNA constructs that can be transcribed into
anti-sense RNA may be introduced into cells or tissues to
facilitate the production of anti-sense RNA. Thus, as used herein,
the phrase "anti-sense molecules" broadly encompasses anti-sense
oligonucleotides whether synthesized as DNA or RNA molecules as
well as all plasmid constructs that, when introduced into a
mammalian cell, promote the production of anti-sense RNA molecules.
An anti-sense molecule may be used, as described herein, to inhibit
expression of Nogo B genes.
[0084] Anti-sense molecules for use as described herein can be
synthesized by any method known to those of skill in this art
including chemical synthesis by, for example, solid phase
phosphoramidite chemical synthesis. See, e.g., WO 93/01286; U.S.
Pat. No. 6,043,090; U.S. Pat. No. 5,218,088; U.S. Pat. No.
5,175,269; and U.S. Pat. No. 5,109,124, each of which is
incorporated herein by reference. Alternatively, RNA molecules may
be generated by in vitro or in vivo transcription of DNA sequences
encoding the Nogo B cDNA, or a portion thereof, provided that the
DNA is incorporated into a vector downstream of a suitable RNA
polymerase promoter (such as, e.g., T3, T7 or SP6). Large amounts
of anti-sense RNA may be produced by incubating labeled nucleotides
with a linearized Nogo B cDNA fragment downstream of such a
promoter in the presence of the appropriate RNA polymerase. Such
anti-sense molecules are preferably at least 10, 15 or 20
nucleotides in length. More preferably, anti-sense molecules are at
least 25 nucleotides in length. Within certain embodiments, an
anti-sense molecule of the present invention will comprise a
sequence that is unique to the Nogo B cDNA sequence or that can
hybridize to the cDNA of Nogo B under conditions of high
stringency. Within the context of the present invention, high
stringency means standard hybridization conditions such as, e.g.,
5.times.SSPE, 0.5% SDS at 65.degree. C. or the equivalent
thereof.
[0085] Anti-sense oligonucleotides are typically designed to resist
degradation by endogenous nucleolytic enzymes by using such
linkages as: phosphorothioate, methylphosphonate, sulfone, sulfate,
ketyl, phosphorodithioate, phosphoramidate, phosphate esters, and
other such linkages (see, e.g., Agrwal et al., Tetrehedron Lett.
28:3539-3542 (1987); Miller et al., J. Am. Chem. Soc. 93:6657-6665
(1971); Stec et al., Tetrehedron Lett. 26:2191-2194 (1985); Moody
et al., Nucl. Acids Res. 12:4769-4782 (1989); Uznanski et al.,
Nucl. Acids Res. 17(12):4863-4871 (1989); Letsinger et al.,
Tetrahedron 40:137-143 (1984); Eckstein, Annu. Rev. Biochem.
54:367-402 (1985); Eckstein, Trends Biol. Sci. 14:97-100 (1989);
Stein, in: Oligodeoxynucleotides. Anti-sense Inhibitors of Gene
Expression, Cohen, Ed, Macmillan Press, London, pp. 97-117 (1989);
Jager et al., Biochemistry 27:7237-7246 (1988)). Possible
additional or alternative modifications include, but are not
limited to, the addition of flanking sequences at the 5' and/or 3'
ends and/or the inclusion of nontraditional bases such as inosine,
queosine and wybutosine, as well as acetyl- methyl-, thio- and
other modified forms of adenine, cytidine, guanine, thymine and
uridine.
[0086] Within alternate embodiments of the present invention, Nogo
B inhibitors may be ribozymes. A ribozyme is an RNA molecule that
specifically cleaves RNA substrates, such as mRNA, resulting in
specific inhibition or interference with cellular gene expression.
As used herein, the term "ribozymes" includes RNA molecules that
contain anti-sense sequences for specific recognition, and an
RNA-cleaving enzymatic activity. The catalytic strand cleaves a
specific site in a target RNA at greater than stoichiometric
concentration.
[0087] A wide variety of ribozymes may be utilized within the
context of the present invention, including for example, the
hammerhead ribozyme (for example, as described by Forster and
Symons, Cell 48:211-220 (1987); Haseloff and Gerlach, Nature
328:596-600 (1988); Walbot and Bruening, Nature 334:196 (1988);
Haseloff and Gerlach, Nature 334:585 (1988)); the hairpin ribozyme
(for example, as described by Haseloff et al., U.S. Pat. No.
5,254,678, issued Oct. 19, 1993 and Hempel et al., European Patent
Publication No. 0 360 257, published Mar. 26, 1990); and
Tetrahymena ribosomal RNA-based ribozymes (see Cech et al., U.S.
Pat. No. 4,987,071). Ribozymes of the present invention typically
consist of RNA, but may also be composed of DNA, nucleic acid
analogs (e.g., phosphorothioates), or chimerics thereof (e.g.,
DNA/RNA/RNA).
[0088] Ribozymes can be targeted to any RNA transcript and can
catalytically cleave such transcripts (see, e.g., U.S. Pat. No.
5,272,262; U.S. Pat. No. 5,144,019; and U.S. Pat. Nos. 5,168,053,
5,180,818, 5,116,742 and 5,093,246 to Cech et al.). According to
certain embodiments of the invention, any such Nogo B mRNA-specific
ribozyme, or a nucleic acid encoding such a ribozyme, may be
delivered to a host cell to effect inhibition of Nogo B gene
expression. Ribozymes and the like may therefore be delivered to
the host cells by DNA encoding the ribozyme linked to a eukaryotic
promoter, such as a eukaryotic viral promoter, such that upon
introduction into the nucleus, the ribozyme will be directly
transcribed.
Proteins and Polypeptides
[0089] In addition to the anti-sense molecules and ribozymes
disclosed herein, Nogo B inhibitors of the present invention also
include proteins or polypeptides that are effective in either
reducing Nogo B gene expression or in decreasing one or more of
Nogo B's biological activities. A variety of methods are readily
available in the art by which the skilled artisan may, through
routine experimentation, rapidly identify such Nogo B inhibitors.
The present invention is not limited by the following exemplary
methodologies.
[0090] As discussed above, Nogo B is associated with apoptosis.
Thus, inhibitors of Nogo B's biological activities encompass those
proteins and/or polypeptides that interfere with Nogo B's role in
cell growth and viability. Such interference may occur through
direct interaction with Nogo B's ability to be phosphorylated or
indirectly through non- or un-competitive inhibition such as via
binding to an allosteric site. Accordingly, available methods for
identifying proteins and/or polypeptides that bind to Nogo B may be
employed to identify lead compounds that may, through the
methodology disclosed herein, be characterized for their Nogo B
inhibitory activity.
[0091] A vast body of literature is available to the skilled
artisan that describes methods for detecting and analyzing
protein-protein interactions. Reviewed in Phizicky, E. M. et al.,
Microbiological Reviews 59:94-123 (1995) incorporated herein by
reference. Such methods include, but are not limited to physical
methods such as, e.g., protein affinity chromatography, affinity
blotting, immunoprecipitation and cross-linking as well as
library-based methods such as, e.g., protein probing, phage display
and two-hybrid screening. Other methods that may be employed to
identify protein-protein interactions include genetic methods such
as use of extragenic suppressors, synthetic lethal effects and
unlinked noncomplementation. Exemplary methods are described in
further detail below.
[0092] Inventive Nogo B inhibitors may be identified through
biological screening assays that rely on the direct interaction
between the Nogo B protein and a panel or library of potential
inhibitor proteins. Biological screening methodologies, including
the various "n-hybrid technologies," are described in, for example,
Vidal, M. et al., Nucl. Acids Res. 27(4):919-929 (1999);
Frederickson, R. M., Curr. Opin. Biotechnol. 9(1):90-6 (1998);
Brachmann, R. K. et al., Curr. Opin. Biotechnol. 8(5):561-568
(1997); and White, M. A., Proc. Natl. Acad. Sci. U.S.A.
93:10001-10003 (1996) each of which is incorporated herein by
reference. For example, inhibition of Nogo B can be detected by
measuring neurite outgrowth in treated cells, as described by
Prinjha et al, Nature 403:383-384 (2000), or by using other methods
known in the art. Inhibition can also be detected by measuring axon
regeneration in treated cells, as described by Grand Pre et al,
Nature 403:439-444 (2000).
[0093] The two-hybrid screening methodology may be employed to
search new or existing target cDNA libraries for Nogo B binding
proteins that have inhibitory properties. The two-hybrid system is
a genetic method that detects protein-protein interactions by
virtue of increases in transcription of reporter genes. The system
relies on the fact that site-specific transcriptional activators
have a DNA-binding domain and a transcriptional activation domain.
The DNA-binding domain targets the activation domain to the
specific genes to be expressed. Because of the modular nature of
transcriptional activators, the DNA-binding domain may be severed
covalently from the transcriptional activation domain without loss
of activity of either domain. Furthermore, these two domains may be
brought into juxtaposition by protein-protein contacts between two
proteins unrelated to the transcriptional machinery. Thus, two
hybrids are constructed to create a functional system. The first
hybrid, i.e., the bait, consists of a transcriptional activator
DNA-binding domain fused to a protein of interest. The second
hybrid, the target, is created by the fusion of a transcriptional
activation domain with a library of proteins or polypeptides.
Interaction between the bait protein and a member of the target
library results in the juxtaposition of the DNA-binding domain and
the transcriptional activation domain and the consequent
up-regulation of reporter gene expression.
[0094] A variety of two-hybrid based systems are available to the
skilled artisan that most commonly employ either the yeast Gal4 or
E. coli LexA DNA-binding domain (BD) and the yeast Gal4 or herpes
simplex virus VP16 transcriptional activation domain. Chien, C.-T.
et al., Proc. Natl. Acad. Sci. U.S.A. 88:9578-9582 (1991); Dalton,
S. et al., Cell 68:597-612 (1992); Durfee, T. K. et al., Genes Dev.
7:555-569 (1993); Vojtek, A. B. et al., Cell 74:205-214 (1993); and
Zervos, A. S. et al., Cell 72:223-232 (1993). Commonly used
reporter genes include the E. coli lacZ gene as well as selectable
yeast genes such as HIS3 and LEU2. Fields, S. et al., Nature
(London) 340:245-246 (1989); Durfee, T. K., supra; and Zervos, A.
S., supra. A wide variety of activation domain libraries are
readily available in the art such that the screening for
interacting proteins may be performed through routine
experimentation.
Screening for Agonists and Antagonists
[0095] Nogo B polypeptides can also be used to screen combinatorial
libraries to identify agonist or antagonists. For example, a
"library" of peptides may be synthesized following the methods
disclosed in U.S. Pat. No. 5,010,175, and in PCT WO 91/17823, both
incorporated herein by reference in full. The peptide library is
first screened for binding to the selected Nogo B polypeptide. The
peptides are then tested for their ability to inhibit or enhance
Nogo B activity. Peptides exhibiting the desired activity are then
isolated and sequenced.
[0096] Nogo B agonists or antagonists may be screened using any
available method. The assay conditions ideally should resemble the
conditions under which the Nogo B activity is exhibited in vivo,
i.e., under physiologic pH, temperature, ionic strength, etc.
Suitable agonists or antagonists will exhibit strong inhibition or
enhancement of the Nogo B activity at concentrations that do not
raise toxic side effects in the subject. Agonists or antagonists
that compete for binding to the Nogo B polypeptide may require
concentrations equal to or greater than the native Nogo B
concentration, while inhibitors capable of binding irreversibly to
the polypeptide may be added in concentrations on the order of the
native Nogo B concentration.
Pharmaceutical Compositions
[0097] Pharmaceutical compositions can comprise polypeptides,
antibodies, or polynucleotides of the claimed invention. The
polynucleotides can include antisense oligonucleotides or ribozymes
capable of specifically binding to Nogo B polynucleotides, as
discussed above. The pharmaceutical compositions will comprise a
therapeutically effective amount of polypeptides, antibodies, or
polynucleotides of the claimed invention.
[0098] The term "therapeutically effective amount" as used herein
refers to an amount of a therapeutic agent to treat, ameliorate, or
prevent a desired disease or condition, or to exhibit a detectable
therapeutic or preventative effect. The effect can be detected by,
for example, chemical markers or antigen levels. Therapeutic
effects also include reduction in physical symptoms, such as
decreased body temperature. The precise effective amount for a
subject will depend upon the subject's size and health, the nature
and extent of the condition, and the therapeutics or combination of
therapeutics selected for administration. Thus, it is not useful to
specify an exact effective amount in advance. However, the
effective amount for a given situation can be determined by routine
experimentation and is within the judgment of the clinician.
[0099] For purposes of the present invention, an effective dose
will be from about 0.01 mg/kg to 50 mg/kg or 0.05 mg/kg to about 10
mg/kg of the polypeptide or DNA construct in the individual to
which it is administered.
[0100] A pharmaceutical composition can also contain a
pharmaceutically acceptable carrier. The term "pharmaceutically
acceptable carrier" refers to a carrier for administration of a
therapeutic agent, such as antibodies or a polypeptide, genes, and
other therapeutic agents. The term refers to any pharmaceutical
carrier that does not itself induce the production of antibodies
harmful to the individual receiving the composition, and which may
be administered without undue toxicity. Suitable carriers may be
large, slowly metabolized macromolecules such as proteins,
polysaccharides, polylactic acids, polyglycolic acids, polymeric
amino acids, amino acid copolymers, and inactive virus particles.
Such carriers are well known to those of ordinary skill in the
art.
[0101] Pharmaceutically acceptable salts can be used therein, for
example, mineral acid salts such as hydrochlorides, hydrobromides,
phosphates, sulfates, and the like; and the salts of organic acids
such as acetates, propionates, malonates, benzoates, and the like.
A thorough discussion of pharmaceutically acceptable excipients is
available in Remington's Pharmaceutical Sciences (Mack Pub. Co.,
New Jersey 1991).
[0102] Pharmaceutically acceptable carriers in therapeutic
compositions may contain liquids such as water, saline, glycerol
and ethanol. Additionally, auxiliary substances, such as wetting or
emulsifying agents, pH buffering substances, and the like, may be
present in such vehicles. Typically, the therapeutic compositions
are prepared as injectables, either as liquid solutions or
suspensions; solid forms suitable for solution in, or suspension
in, liquid vehicles prior to injection may also be prepared.
Liposomes are included within the definition of a pharmaceutically
acceptable carrier.
Delivery Methods
[0103] Once formulated, the compositions of the invention can be
administered directly to the subject. The subjects to be treated
can be mammals or birds. In particular, human subjects can be
treated.
[0104] Direct delivery of the compositions will generally be
accomplished by injection, either subcutaneously,
intraperitoneally, intravenously or intramuscularly or delivered to
the interstitial space of a tissue. The compositions can also be
administered into a tumor or lesion. Other modes of administration
include oral and pulmonary administration, suppositories, and
transdermal applications, needles, and gene guns or hyposprays.
Dosage treatment may be a single dose schedule or a multiple dose
schedule.
[0105] Alternatively, the Nogo B polypeptides could be stably
expressed in an organ of a mammal, and then the organ could be
xenografted into a human in need of such treatment.
Gene Delivery Vehicles
[0106] Gene therapy vehicles for delivery of constructs including a
coding sequence of a therapeutic of the invention, to be delivered
to the mammal for expression in the mammal, can be administered
either locally or systemically. These constructs can utilize viral
or non-viral vector approaches in in vivo or ex vivo modality.
Expression of such coding sequence can be induced using endogenous
mammalian or heterologous promoters. Expression of the coding
sequence in vivo can be either constitutive or regulated.
[0107] The invention includes gene delivery vehicles capable of
expressing the contemplated nucleic acid sequences. The gene
delivery vehicle is preferably a viral vector and, more preferably,
a retroviral, adenoviral, adenoassociated viral (AAV), herpes
viral, or alphavirus vector. The viral vector can also be an
astrovirus, coronavirus, orthomyxovirus, papovavirus,
paramyxovirus, parvovirus, picomavirus, poxvirus, or togavirus
viral vector. See generally, Jolly et al. (1994) Cancer Gene
Therapy 1:51-64; Kimura et al. (1994) Human Gene Therapy 5:845-852;
Connelly et al. (1995) Human Gene Therapy 6:185-193; and Kaplitt et
al. (1994) Nature Genetics 6:148-153.
[0108] Human adenoviral gene therapy vectors are also known in the
art and employable in this invention. See, for example, Berkner et
al. (1988) Biotechniques 6:616; Rosenfeld et al. (1991) Science
252:431; and WO 93/07283, WO 93/06223, and WO 93/07282. Exemplary
known adenoviral gene therapy vectors employable in this invention
include those described in the above referenced documents and in WO
94/12649, WO 93/03769, WO 93/19191, WO 94/28938, WO 95/11984, WO
95/00655, WO 95/27071, WO 95/29993, WO 95/34671, WO 96/05320, WO
94/08026, WO 94/11506, WO 93/06223, WO 94/24299, WO 95/14102, WO
95/24297, WO 95/02697, WO 94/28152, WO 94/24299, WO 95/09241, WO
95/25807, WO 95/05835, WO 94/18922, WO 95/09654. Alternatively,
administration of DNA linked to killed adenovirus as described in
Curiel et al. (1992) Hum. Gene Ther. 3:147-154 may be employed.
[0109] The gene delivery vehicles of the invention also include
adenovirus associated virus (AAV) vectors. Leading and preferred
examples of such vectors for use in this invention are the AAV-2
based vectors disclosed in Srivastava, WO 93/09239. Most preferred.
AAV vectors comprise the two AAV inverted terminal repeats in which
the native D-sequences are modified by substitution of nucleotides,
such that at least about 5 native nucleotides and up to 18 native
nucleotides, preferably at least about 10 native nucleotides up to
15 native nucleotides, most preferably 10 native nucleotides are
retained and the remaining nucleotides of the D-sequence are
deleted or replaced with non-native nucleotides. The native
D-sequences of the AAV inverted terminal repeats are sequences of
20 consecutive nucleotides in each AAV inverted terminal repeat
(i.e., there is one sequence at each end) which are not involved in
HP formation. The non-native replacement nucleotide may be any
nucleotide other than the nucleotide found in the native D-sequence
in the same position. Other employable exemplary AAV vectors are
pWP-19, pWN1, both of which are disclosed in Nahreini et al. (1993)
Gene 124:257-262. Another example of such an AAV vector is psub2O1.
See Samulski et al. (1987) J. Virol. 61:3096. Another exemplary AAV
vector is the Double-D ITR vector. Construction of the Double D ITR
vector is disclosed in U.S. Pat. No. 5,478,745. Still other vectors
are those disclosed in Carter, U.S. Pat. No. 4,797,368 and
Muzyczka, U.S. Pat. No. 5,139,941, Chartejee, U.S. Pat. No.
5,474,935, and Kotin, PCT Patent Publication WO 94/288157. Yet a
further example of an AAV vector employable in this invention is
SSV9AFABTKneo, which contains the AFP enhancer and albumin promoter
and directs expression predominantly in the liver. Its structure
and construction are disclosed in Su, (1996) Human Gene Therapy
7:463-470. Additional AAV gene therapy vectors are described in
U.S. Pat. No. 5,354,678, U.S. Pat. No. 5,173,414, U.S. Pat. No.
5,139,941, and U.S. Pat. No. 5,252,479.
EXAMPLE 1
General Methods
[0110] Antibodies and other reagents. Antibodies against human Cdc2
(SC-54) and GRP94 (SC-1794) were purchased from Santa Cruz
Biotechnology (Santa Cruz, Calif.). H.sub.2O.sub.2, suramine,
specific p38 inhibitors SB202190 and PD169316 were purchased from
Calbiochem (San Diego, Calif.). The plasmid pLIB-EGFP and the
antibody against GFP were purchased from Clontech (Palo Alto,
Calif.).
(.+-.)-r-7,t-8-dihydroxy-t-9,10-epoxy-7,8,9,10-tetrahydrobenzo(a)pyrene
(BPDE) was purchased from ChemSyn Laboratories (Lenexa, Kans.).
[0111] Cell culture and treatment. Normal human fibroblast IMR90
was purchased from American Type Culture Collection (Manassas,
Va.). Cells were routinely cultured in Dulbecco's Modified Eagle's
Medium (DMEM) containing 10% fetal bovine serum, 2 mM L-glutamine,
4.5 g/liter glucose, 100 units penicillin and 100 .mu.g
streptomycin at 37.degree. C. under an atmosphere of 5% CO.sub.2.
For UV irradiation, cells were washed twice with phosphate-buffered
saline (PBS) and then irradiated with appropriate doses of UVC (254
nm). Fresh complete medium was added back and cells were lysed at
appropriate times. For treatment with BPDE, cells were washed with
PBS twice and fresh DMEM was added. BPDE was dissolved in anhydrous
dimethyl sulfoxide (DMSO) and appropriate amount of BPDE solution
was added to DMEM. Cells were lysed 30 minutes later.
[0112] Preparation of cell lysates. Cells were trypsinized, counted
and centrifuged at 1000 g for 3 min. Cell pellets were washed with
PBS three times. For whole cell lysates, cells were resuspended in
appropriate volume of the lysis buffer (150 mM Tris.HCl (pH 7.5),
150 mM NaCl, 0.5% NP-40, 50 mM NaF, 1 mM Na.sub.3VO.sub.4 and 1 mM
DTT) containing the Complete Protease Inhibitor Cocktail
(Boehringer Mannheim Corp, Indianapolis, Ind.), so that the final
concentration was 1.times.10.sup.6 cells/0.1 ml. After incubation
on ice for 30 minutes, the lysate was centrifuged at 14000 g for 30
min, and the clear supernatant was frozen at -80.degree. C. as the
whole cell lysate. For fractionated cell extracts, cells were
resuspended in appropriate volume of digitonin lysis buffer (5 mM
Na.sub.2HPO.sub.4 (pH 7.4), 50 mM NaCl, 150 mM sucrose, 5 mM KCl, 1
mM MgCl.sub.2, 0.5 mM CaCl.sub.2, 1 mM Na.sub.3VO.sub.4, 1 mM DTT
and 0.1% digitonin) with protease inhibitors for 5 minutes. The
cell suspension was then centrifuged on a sucrose cushion (30%
sucrose, 2.5 mM TriseHCL (pH 8) and 10 mM NaCl) at 1000 g for 10
minutes. The supernatant was saved as Cytosol fraction. The pellet
was resuspended in appropriate volume of nuclear lysis buffer (120
mM NaCl, 10 mM Na.sub.2HPO.sub.4 (pH 7.5), 0.5% NP-40, 1 mM
Na.sub.3VO.sub.4 and 1 mM DTT). After 30 minutes, the mixture was
centrifuged at 14000 g for 30 minutes, and the supernatant was
saved as nuclear fraction.
[0113] Western Blotting. Lysates prepared from equal number of
cells were mixed with equal volume of 2.times. sample buffer (50 mM
Tris.HCl, pH 6.9, 9% glycerol, 2.3% SDS, 0.1% bromophenol blue and
10% mecaptoethanol) and the proteins were separated on a
SDS/polyacrylamide gel. The proteins were then electroblotted onto
an Immobilon-P membrane (Millipore, Bedford, Mass.). The blots were
blocked for 1 hour at room temperature in Tris-buffered saline (20
mM Tris-HCl, pH 7.6, 137 mM NaCl) containing 0.1% (v/v) Tween 20
and 5% (w/v) non-fat dry milk (blocking solution), and then
incubated for 1 hour at room temperature with appropriate
antibodies at a concentration of 0.2-1 .mu.g/ml. The blots were
washed several times and then incubated with horseradish
peroxidase-conjugated goat-anti-mouse IgG (Santa Cruz
Biotechnology) that had been diluted 1:3000 with blocking solution.
Enhanced chemiluminescence (Amersham, Arlington Heights, Ill.) was
used according to the manufacturer's recommendations to detect the
signal.
[0114] Protein purification and analysis. Nuclear fraction (200 mg)
prepared from IMR90 was dialyzed into S buffer (10 mM Hepes [pH
7.2], 0.25 M sucrose, 2 mM DTT), loaded on an SP Sepharose column
(Pharmacia, 1.6.times.10 cm), and eluted with a 120 ml gradient of
0-1 M sodium chloride. To assay for Nogo B, column fractions were
analyzed by Western Blot using the anti-Cdc2 antibody. Column
fractions enriched for Nogo B were pooled, dialyzed into Q buffer
(10 mM Hepes [pH 8.6], 0.25 M sucrose, 2 mM DTT), and loaded on a
Mono-Q column (Pharmacia, 0.5.times.5 cm). The column was eluted
with a 45 ml 0-0.6M sodium chloride gradient. Column fractions were
analyzed by Western blot and by SDS-PAGE stained with Commassie
Brilliant Blue R. Peak fractions were concentrated by
ultrafiltration and subjected to preparative SDS-PAGE
purification.
[0115] Protein identification by mass spectrometry. The protein
band observed by SDS-PAGE was excised and the protein was digested
in-gel with trypsin according to the procedure of Shevchenko, A.,
et al., (1996) Proc. Natl. Acad. Sci. USA, 93:14440-14445. The
peptides were extracted and desalted, and the peptide mixture was
analyzed by nanoelectrospray tandem mass spectrometry (nanoES
MS/MS) (Wilm, M., et al., (1996) Nature (London), 379:466-469)
using a PE-Sciex API III triple-quadrupole mass spectrometer. To
identify the protein, the peptide sequence tags obtained by nanoES
MS/MS were used to search an in-house non-redundant protein
database using PeptideSearch software (Mann, M. (1994) in
Microcharacterization of Proteins (Kellner, R., Lottspeich, F. and
Meyer, H. E., Eds.) pp. 223-245.) Internal Edman degradation
sequencing. SDS-PAGE-purified protein was also transferred onto a
PVDF membrane and analyzed by Internal Edman Degradation Sequencing
(Fernandez, J., et al., (1994) Anal. Biochem. 218:112-118).
Briefly, Nogo B was digested with trypsin, the eluted peptides were
resolved by RP-HPLC, and selected peaks were subjected to
N-terminal sequencing by Edman degradation. Peptide sequences were
reverse translated and used to search the GenBank database using
MPSRCH program to find matched sequences.
[0116] Retrovirus infection. The stop codon of the EGFP gene on
pLIB-EGFP (Clontech) was mutated into an HindIII site using
QuickChange Site-directed Mutagenesis kit (Stratagene). The
NcoI-SspI fragment of the Nogo B gene was then ligated into this
HindIII site. A 293-derived packaging cell line was transfected
with PLIB-EGFP or pLIB-EGFP-Nogo B in combination with pMLR
(encoding VSVG) using Calcium Phosphate Transfection Kit (Clontech)
following the manufacturer's suggestions. Sixteen hours later,
fresh medium with 1 mM NaB was added and cells were incubated at
32.degree. C. for 2 days. The medium containing virus was filtered
and added to exponentially growing IMR90 cells or GM00637 cells
along with polybrene (8 mg/ml). The cells were centrifuged at 600 g
for 1 hour and incubated at 32.degree. C. overnight. Fresh complete
medium was then added and cells were incubated at 37.degree. C. for
2 days before being replated at lower density. Pictures of
fluorescence images were taken under a microscope with a blue
filter (485 nm).
[0117] Northern Blotting. Nylon membranes with RNA were incubated
with appropriate volume of ExpressHyb solution (Clontech) for 1
hour at 68.degree. C. The plasmid containing the full length Nogo B
gene was labeled with .alpha.-.sup.32P-dCTP using Prime-It RmT
Random Primer Labeling Kit (Stratagene), and added to the
ExpressHyb solution. After 1 hour, the membrane was washed with
ample volume of solution 1 (2.times.SSC and 0.0% SDS) at room
temperature several times. The membrane was then washed with
solution 2 (0.1.times.SSC and 0.1% SDS) at 50.degree. C. for 40
minutes before being exposed to Hyperfilm MP (Amersham).
[0118] Treatment with antisense oligonucleotide. Antisense
oligonucleotides were obtained from Sequitur Inc (Natick, Mass.).
The four antisense oligonucleotides were: AS-1,
CUGGAUAGCUUGGAUCACACCCUUG (SEQ ID NO:3); AS-2,
CAACUUCAGGA-UUCCAGAUAUGCCC (SEQ ID NO:4); AS-3,
AUUCCACCAGUGCCUCAGAUAGGA (SEQ ID NO:5); and AS-4,
AUGAUCUAUCUGUGCCUGAUGCCG (SEQ ID NO:6). For treatment with
antisense oligonucleotide, exponentially growing IMR90 cells were
plated at 3.times.10.sup.5 cells per 60 mm dish. After 24 hours, 4
.mu.l of a particular oligonucleotide (100 .mu.M) was mixed with 12
.mu.l of Lipitoid I (0.5 mM) in Opti-MEM (Gibco-BRL) and added to
the cell culture medium. After 16 hours, fresh complete medium was
added. After another 24 hours, pictures were taken for the cells
before cells were trypsinized, counted and lysed.
EXAMPLE 2
Identification of a Protein Hyperphosphorylated During Stress
[0119] During a study of the effect of ultraviolet irradiation on
cell cycle regulation, two closely-migrated proteins with apparent
molecular weight around 46 KD were identified (FIG. 7A). Upon
irradiation with 20 J/m.sup.2 of UVC, this doublet shifted very
rapidly to a slower mobility form on a SDS polyacrylamide gel (FIG.
7A). At 2 hours after UV irradiation, about half of the protein
changed back to the fast mobility form (FIG. 7B), as did most of
the protein 20 hours later.
[0120] Since phosphorylation of a protein can lead to mobility
shift on SDS-PAGE, the mobility shift of p46 was investigated to
determine if it was due to phosphorylation. Protein lysates were
prepared from irradiated cells in the absence of sodium
orthovanadate. Incubation with alkaline phosphatase led to
disappearance of the slow mobility form (FIG. 7C), indicating that
the slow mobility form represented the hyperphosphorylated p46.
Only the fastest migrating band remained when more phosphatase was
added, indicating that it represented the unphosphorylated form of
p46 (FIG. 7C).
[0121] As shown in FIG. 7, Nogo B was hyperphosphorylated after UVC
irradiation. (A) IMR90 cells were irradiated with 0 or 20 J/m.sup.2
of UVC (254 nm) and were lysed at 0, 20 or 50 minutes after
irradiation. Lysates were separated on SDS-PAGE gels and
transferred to a PVDF membrane, followed by being probed with a
monoclonal antibody against human Cdc2 (SC-54). Positions of Cdc2
and Nogo B were shown by arrows. Sizes of molecular weight markers
were indicated. (B) IMR90 cells were synchronized at G1 phase,
irradiated with 0 (G1-0) or 20 J/m.sup.2 (G1-20) of UVC and
trypsinized 2 hours later. Senescing cells (Senescing) were IMR90
cells that were grown continuously until no obvious mitotic figure
could be seen under microscope. Cells were trypsinized and lysed
with digitonin followed by NP-40 as described in Example 1.
Digitonin-solubilized fraction (Cyto) and NP-40-solubilized
fraction (Nuc) were separated on SDS-PAGE. SC-54 was used for
Western Blotting. (C) IMR90 cells were irradiated with 20 J/m.sup.2
of UVC and lysed using buffers with or without vanadate two hours
later. Lysates without vanadate were dialyzed against 0.1 M
(NH4).sub.2SO.sub.4 (pH 8.0) overnight, and incubated with 0, 1, 2,
or 5 units of calf intestine alkaline phosphatase (CLAP) for 1 hour
at 37.degree. C. Lysates were separated on SDS-PAGE. SC-54 was used
for Western Blotting.
[0122] UV irradiation has been shown to result in the formation of
DNA photoproducts, increased level of free radicals, and changes in
the plasma membrane such as aggregation of growth factor receptors.
To test whether other DNA damaging agents could also lead to
hyperphosphorylation of p46, cells were treated with various doses
of benzo(a)pyrene diol epoxide, the major active metabolite of
benzo(a)pyrene, which modifies the C-8 position of guanine. As
shown in FIG. 4A, BPDE treatment led to p46 hyperphosphorylation in
a dose-dependent manner. The role of the nucleotide excision repair
system, which recognizes and repairs DNA adducts induced by UV and
BPDE, was excluded because a similar extent of hyperphosphorylation
was also observed in XP12BE cells derived from a patient belonging
to complementation group A of xeroderma pigmentosa, in which
nucleotide excision repair is defective. Changes in the plasma
membrane were also unlikely to cause the p46 hyperphosphorylation,
because a chemical agent such as BPDE is unlikely to change the
plasma membrane structure in the same way as that hypothesized for
UV, and preincubation of cells with suramin completely blocked the
phosphorylation of ERK2, which is a major downstream effect of the
UV-induced growth factor receptor aggregation, but had no effect on
the p46 hyperphosphorylation (FIG. 4B).
[0123] Since p46 was also hyperphosphorylated in senescing human
fibroblasts (FIG. 7B) and in cells arrested by aphidicolin, stress
alone was investigated to determine if it was sufficient to induce
the p46 hyperphosphorylation. As shown in FIG. 4C, treatment of
cells with NaCl, H.sub.2O.sub.2 or sorbitol resulted in rapid
hyperphosphorylation of p46. Therefore, it is concluded that the
p46 hyperphosphorylation is due to elevated stress level in
cells.
[0124] The data shown in FIG. 4 were obtained as follows. (A) IMR90
cells were treated with 0, 0.5, 1, or 4 .mu.M of BPDE and
trypsinized after 30 minutes. Digitonin-solubilized fraction (Cyto)
and NP-40-solubilized fraction (Nuc) were separated on SDS-PAGE.
SC-54 was used for Western Blotting. In FIG. 4, (B) IMR90 cells
were incubated in the presence or absence of suramin (0.15 mM) for
1 hour before being irradiated with 0 or 20 J/m.sup.2 of UVC. After
0, 10, 20 or 30 minutes, whole cell lysates were prepared,
separated on SDS-PAGE and transferred to a PVDF membrane. SC-54 or
an antibody against human ERK2 was used for Western Blotting. Nogo
B and ERK2 were shown by arrows. In FIG. 4, (C) IMR90 cells were
treated with 0.7 M NaCl, 1 mM H.sub.2O.sub.2, 0.4 M Sorbitol or PBS
(control) for 45 minutes before being lysed. Whole cell lysates
were separated on SDS-PAGE. SC-54 was used for Western
Blotting.
EXAMPLE2
P38 MAPK Activation Led to the P46 Hyperphosphorylation
[0125] It has been shown that elevated cellular stress level can
activate p38 MAPK. The role of activation of p38 MAPK in p46
hyperphosphorylation was investigated. As shown in FIG. 5, p46
hyperphosphorylation was almost completely abolished in the
presence of 270 nM of the p38-specific inhibitor SB202190 (IC50=300
nM) or in the presence of 90 nM of another p38-specific inhibitor
PD169316 (IC50=89 nM). Another p38-specific inhibitor, SB203580,
also showed similar effects. The control compound, SB202474, had no
effect. The p46 hyperphosphorylation was not affected by the
presence of 50 nM of wortmannin (IC50 for PI-3 kinase: 5 nM) or 20
uM of PD98059 (IC50 for MEK: 2 uM). It was concluded that p46
hyperphosphorylation was a result of p38 activation.
EXAMPLE 3
Identification of P46 as a Novel Protein
[0126] The present observation that p46 could be completely
released by NP-40 but not by digitonin (FIG. 7B) strongly suggested
that p46 was localized in the nucleus or organelles. To purify the
protein, proteins were with NP-40 and passed through a Mono-S
column followed by a Mono-Q column, using Western Blot as the
indicator (FIGS. 6A and 6B). When the fractions eluted from the
Mono-Q column on SDS-PAGE were separated and the gel stained with
Coomassie Blue, there were only 4 bands visible at around 46 KD: a
fast migrating doublet and a much weaker, slow migrating doublet
(FIG. 6C), which was expected as the proteins were extracted from
asynchronously growing cells. These proteins were purified from the
SDS polyacrylamide gel and analyzed with Mass Spectrometry. The
mass for the intact p46 was determined as 40523 (.+-.200) daltons,
suggesting that it is a novel protein. This was confirmed by
further analysis using nanospray technique, which identified four
novel sequence tags.
[0127] The purified p46 was also subjected to microsequencing and
three peptide sequences were generated. These sequences were used
to identify a putative full-length open reading frame, encoding a
protein of 373 amino acids (FIG. 5A). The translated sequence
contained all 4 sequence tags identified by Mass Spectrometry and
three peptide sequences, indicating that this was the p46 gene.
[0128] The data shown in FIG. 6 were obtained as follows. In FIG.
6A, exponentially growing IMR90 cells were lysed by digitonin
followed by NP-40 as described in Example 1. Only the
NP-40-solubilized fraction was subjected to purification by Mono-S
column. Eluted fractions were separated on SDS-PAGE. SC-54 was used
for Western Blotting. Positions of Nogo B and the 46 KD protein
marker were shown. Fraction numbers were indicated. In FIG. 6B,
eluted fractions 42-48 from the Mono-S column were combined and
subjected to purification by Mono-Q column. Eluted fractions were
separated on SDS-PAGE. SC-54 was used for Western Blotting.
Positions of Nogo B and the 46 KD protein marker were shown.
Fraction numbers were indicated. In FIG. 6C, eluted fractions from
Mono-Q column were separated on SDS-PAGE. The gel was then stained
with Coomassie Bright Blue. Sizes of the molecular weight markers
were shown. BSA was loaded as an indicator of size and amount of
protein.
EXAMPLE 4
P46 is Localized to Endoplasmic Reticulum
[0129] The C terminus of p46, i.e., amino acid 188-amino acid 373,
is highly homologous to the C terminus of the human
neuroendocrine-specific proteins (NSPs) (FIG. 1B), while its N
terminus (amino acid 1-amino acid 187) shares little homology to
any known proteins. NPs have been localized to endoplasmic
reticulum (ER), and its ER localization signal (KRHAE at the C
terminus) is highly conserved in p46 (KRKAE at the C terminus). To
determine the subcellular localization of p46, a fragment of the
p46 gene was cloned, which covers all coding sequence and almost
all 3' untranslated region, into an in-frame position at the 3' end
of the green fluorescence protein gene (EGFP). In primary
fibroblasts, EGFP equally distributed throughout the cell (FIG.
2A), while EGFP-p46 fusion protein mainly localized in the cytosol
as a tubular-reticular-like structure with the strongest
fluorescence signal surrounding the nucleus (FIG. 2B), which is a
classical feature for ER resident proteins. Similar localization
was also observed when this fusion protein was expressed in an
SV-40 immortalized human fibroblast cell line (FIGS. 2C and 2D).
Western Blot using monoclonal antibody against GFP showed that the
free EGFP could be released by edigitonin while the EGFP-p46 fusion
protein could only be released by NP40, further confirming the
change of its localization (FIG. 2E). This was the first ER
resident protein found to be phosphorylated as a result of p38 MAPK
activation.
[0130] FIG. 2 shows the subcellular localization of Nogo B. IMR90
cells (A,B) or GM00637 cells (C,D) were infected with a retrovirus
expressing EGFP alone (A) or an EGFP-Nogo B fusion protein (B,C,D).
Pictures were taken at 2-3 days after infection. (E). IMR90 cells
infected with retrovirus expressing EGFP alone (lanes 1 and 2) or
an EGFP-Nogo B fusion protein (lanes 3 and 4) were trypsinized and
lysed with digitonin followed by NP-40. Digitonin-solubilized
fractions (cyto; lanes 1 and 3) and NP-40-solubilized fractions
(nuc; lanes 2 and 4) were separated on SDS-PAGE and transferred to
a PVDF membrane. A monoclonal antibody against GFP was used for
Western Blotting.
EXAMPLE 5
Tissue Distribution of Nogo B
[0131] The Multiple Tissue Northern Blot was probed with the
full-length Nogo B gene, and two major transcripts could be
detected (FIG. 3A). The longer transcript, which was about 2600
nucleotides in length, was expressed consistently at all tissues
with the exception of heart, where the expression level was
significantly higher (FIG. 3A). The level of the short transcript,
about 2300 nucleotides in length, was the highest in the skeletal
muscle, followed by brain and liver (FIG. 3A). Presence of similar
amount of total mRNA in each lane was confirmed by probing the same
membrane with a .beta.-actin probe (FIG. 3B).
[0132] As discussed above, FIG. 3 shows the tissue-specific
expression of the Nogo B gene. In FIG. 3A, a Northern Blot
containing mRNA from different tissues was probed with the
full-length Nogo B cDNA. Positions of the two major Nogo B
transcripts were shown. The position of the 2.4 KB RNA marker was
also indicated. In FIG. 3B, the same blot was stripped and reprobed
with the cDNA for .beta.-actin. Positions of the actin transcript
and the 2.4 KB RNA marker are shown.
EXAMPLE 6
Loss of the Major Nogo B Transcript in Brain Tumors
[0133] To determine whether Nogo B was involved in tumorigenesis, a
Brain Tumor Northern Blot was probed with the full-length Nogo B
gene. In all four normal brain samples, the short transcript was
the major transcript (FIG. 8A), confirming the previous observation
(FIG. 3A). However, in the four corresponding tumor samples, the
level of the short transcript was too low to be detected; rather, a
weak signal for the long transcript was detected (FIG. 8A). This
variation was not due to unequal loading because the signal for
.beta.-actin was similar in all lanes (FIG. 8B). Furthermore, the
locations of the .beta.-actin transcript was almost identical to
that of the short transcript of the Nogb B gene, ruling out an
artifact or a defective membrane.
EXAMPLE 7
Nogo B is Important for Cell Growth and Viability
[0134] During purification of the Nogo B protein, it was identified
as an abundant protein because it was about 1/2000 of the
NP-40-solublized proteins. To determine whether Nogo B plays a role
in normal cell growth, specific antisense oligonucleotides were
used to downregulate the level of Nogo B. Four uniformly
phosphorothioate modified oligonucleotides, whose sequences were
complementary to various regions of the mRNA sequence of the Nogo B
gene, were synthesized, and transfected into IMR90 cells using a
synthetic lipitoid. A control FITC-labeled oligonucleotide was used
in each experiment as an indicator of the transfection efficiency,
which was almost 100%. After 16 hours of transfection, slight
cytotoxicity was observed for cells transfected with antisense
oligonucleotides. After another 24 hours, the cytotoxicity became
more obvious (FIG. 9A). There were fewer cells attached to dishes
in which cells were transfected with antisense oligonucleotides
than those in dishes in which cells were either untransfected or
transfected with the FITC-labeled control oligonucleotide (FIG.
9A). This cytotoxicity remained for another 1-2 days before the
surviving cells started growing back, suggesting that at that time
the antisense oligonucleotides had been degraded or were no longer
functional.
[0135] To determine whether transfection of antisense
oligonucleotides actually downregulated the levels of Nogo B,
protein lysates were prepared from cells remaining attached at 24
hours after completion of transfection. As shown in FIG. 9B, the
levels of Nogo B in cells transfected with antisense
oligonucleotides were much lower than that in untransfected cells
or cells transfected with the control oligonucleotide. As an
indicator of slower cell growth, the amount of cdc2, which is
synthesized during late S phase and G2 phase, was significantly
lower in cells transfected with antisense oligonucleotides (FIG.
9B). This was not due to the effect of morphological changes on ER
because levels of another ER resident protein, GRP94, were constant
in all samples (FIG. 9C). Therefore the cytotoxic effect observed
was very likely to be a specific result of downregulation of Nogo
B, suggesting that Nogo B plays an important role in maintaining
normal cell growth and viability.
[0136] As indicated above, FIG. 9 shows that specific
downregulation of Nogo B using antisense oligonucleotides
correlated with cytotoxicity and slowed cell growth. In FIG. 9A,
IMR90 cells were plated at 3.times.10.sup.5 cells per 60 mm dish.
After 24 hours, cells were transfected with various antisense
oligonucleotides or just PBS (control) for 16 hours. Cells were
then incubated in normal medium for another 24 hours. Pictures were
taken for areas representative of the state of cell growth on the
dish. Cells were trypsinized and counted. For this typical
experiment, the number of the remaining cells per dish were as
follows: Control-1, 47.times.10.sup.5; Control-2,
48.times.10.sup.5; FITC-1, 40.times.10.sup.5; FITC-2,
37.times.10.sup.5; AS-1-1, 25.times.10.sup.5; AS-1-2,
27.times.10.sup.5; AS-2-1, 35.times.10.sup.5; AS-2-2,
30.times.10.sup.5; AS-3-1, 27.times.10.sup.5; AS-3-2,
30.times.10.sup.5; AS-4-1, 35.times.10.sup.5; AS-4-2,
30.times.10.sup.5. In FIG. 9B, the trypsinized cells were then
lysed. Lysates were separated on SDS-PAGE and transferred to a PVDF
membrane. The membrane was cut in half. The half containing
proteins with lower molecular weight was probed with SC-54.
Positions of Nogo B and Cdc2 were shown. In FIG. 9C, the other half
of the membrane containing proteins with higher molecular weight
was probed with a polyclonal antibody against GRP94.
[0137] The following material has been deposited at the ATCC, 10801
University Boulevard, Manassas, Va. 20110-2209: TABLE-US-00001
Material Date of Deposit CMCC Number ATCC Accession No. Plasmid
pBluescript-SK(+) May 19, 1999 4965 PTA-89
[0138] This deposit is provided merely as convenience to those of
skill in the art, and is not an admission that a deposit is
required under 35 U.S.C. .sctn. 112. The sequence of the
polynucleotides contained within the deposited material, as well as
the amino acid sequence of the polypeptides encoded thereby, are
incorporated herein by reference and are controlling in the event
of any conflict with the written description of sequences herein. A
license may be required to make, use, or sell the deposited
material, and no such license is granted hereby.
[0139] From the foregoing it will be appreciated that, although
specific embodiments of the invention have been described herein
for purposes of illustration, various modifications may be made
without deviating from the spirit and scope of the invention.
Accordingly, the invention is not limited except as by the appended
claims.
Sequence CWU 1
1
11 1 2240 DNA Homo sapiens 1 cgtcaccaca gtaggtccct cggctcagtc
ggcccagccc ctctcagtcc tccccaaccc 60 ccacaaccgc ccgcggctct
gagacgcggc cccggcggcg gcggcagcag ctgcagcatc 120 atctccaccc
tccagccatg gaagacctgg accagtctcc tctggtctcg tcctcggaca 180
gcccaccccg gccgcagccc gcgttcaagt accagttcgt gagggagccc gaggacgagg
240 aggaagaaga ggaggaggaa gaggaggacg aggacgaaga cctggaggag
ctggaggtgc 300 tggagaggaa gcccgccgcc gggctgtccg cggccccagt
gcccaccgcc cctgccgccg 360 gcgcgcccct gatggacttc ggaaatgact
tcgtgccgcc ggcgccccgg ggacccctgc 420 cggccgctcc ccccgtcgcc
ccggagcggc agccgtcttg ggacccgagc ccggtgtcgt 480 cgaccgtgcc
cgcgccatcc ccgctgtctg ctgccgcagt ctcgccctcc aagctccctg 540
aggacgacga gcctccggcc cggcctcccc ctcctccccc ggccagcgtg agcccccagg
600 cagagcccgt gtggaccccg ccagccccgg ctcccgccgc gcccccctcc
accccggccg 660 cgcccaagcg caggggctcc tcgggctcag tggttgttga
cctcctgtac tggagagaca 720 ttaagaagac tggagtggtg tttggtgcca
gcctattcct gctgctttca ttgacagtat 780 tcagcattgt gagcgtaaca
gcctacattg ccttggccct gctctctgtg accatcagct 840 ttaggatata
caagggtgtg atccaagcta tccagaaatc agatgaaggc cacccattca 900
gggcatatct ggaatctgaa gttgctatat ctgaggagtt ggttcagaag tacagtaatt
960 ctgctcttgg tcatgtgaac tgcacgataa aggaactcag gcgcctcttc
ttagttgatg 1020 atttagttga ttctctgaag tttgcagtgt tgatgtgggt
atttacctat gttggtgcct 1080 tgtttaatgg tctgacacta ctgattttgg
ctctcatttc actcttcagt gttcctgtta 1140 tttatgaacg gcatcaggca
cagatagatc attatctagg acttgcaaat aagaatgtta 1200 aagatgctat
ggctaaaatc caagcaaaaa tccctggatt gaagcgcaaa gctgaatgaa 1260
aacgcccaaa ataattagta ggagttcatc tttaaagggg atattcattt gattatacgg
1320 gggagggtca gggaagaacg aaccttgacg ttgcagtgca gtttcacaga
tcgttgttag 1380 atctttattt ttagccatgc actgttgtga ggaaaaatta
cctgtcttga ctgccatgtg 1440 ttcatcatct taagtattgt aagctgctat
gtatggattt aaaccgtaat catatctttt 1500 tcctatctga ggcactggtg
gaataaaaaa cctgtatatt ttactttgtt gcagatagtc 1560 ttgccgcatc
ttggcaagtt gcagagatgg tggagctaga aaaaaaaaaa aaaaagccct 1620
tttcagtttg tgcactgtgt atggtccgtg tagattgatg cagattttct gaaatgaaat
1680 gtttgtttag acgagatcat accggtaaag caggaatgac aaagcttgct
tttctggtat 1740 gttctaggtg tattgtgact tttactgtta tattaattgc
caatataagt aaatatagat 1800 tatatatgta tagtgtttca caaagcttag
acctttacct tccagccacc ccacagtgct 1860 tgatatttca gagtcagtca
ttggttatac atgtgtagtt ccaaagcaca taagctagaa 1920 gaagaaatat
ttctaggagc actaccatct gttttcaaca tgaaatgcca cacacataga 1980
actccaacaa catcaatttc attgcacaga ctgactgtag ttaattttgt cacagaatct
2040 atggactgaa tctaatgctt ccaaaaatgt tgtttgtttg caaatatcaa
acattgttat 2100 gcaagaaatt attaattaca aaatgaagat ttataccatt
gtggtttaag ctgtactgaa 2160 ctaaatctgt ggaatgcatt gtgaactgta
aaagcaaagt atcaataaag cttatagact 2220 taaaaaaaaa aaaaaaaaaa 2240 2
373 PRT Homo sapien 2 Met Glu Asp Leu Asp Gln Ser Pro Leu Val Ser
Ser Ser Asp Ser Pro 1 5 10 15 Pro Arg Pro Gln Pro Ala Phe Lys Tyr
Gln Phe Val Arg Glu Pro Glu 20 25 30 Asp Glu Glu Glu Glu Glu Glu
Glu Glu Glu Glu Asp Glu Asp Glu Asp 35 40 45 Leu Glu Glu Leu Glu
Val Leu Glu Arg Lys Pro Ala Ala Gly Leu Ser 50 55 60 Ala Ala Pro
Val Pro Thr Ala Pro Ala Ala Gly Ala Pro Leu Met Asp 65 70 75 80 Phe
Gly Asn Asp Phe Val Pro Pro Ala Pro Arg Gly Phe Leu Pro Ala 85 90
95 Ala Pro Pro Val Ala Pro Glu Arg Gln Pro Ser Trp Asp Pro Ser Pro
100 105 110 Val Ser Ser Thr Val Pro Ala Pro Ser Phe Leu Ser Ala Ala
Ala Val 115 120 125 Ser Pro Ser Lys Leu Pro Glu Asp Asp Glu Pro Pro
Ala Arg Pro Pro 130 135 140 Pro Pro Pro Pro Ala Ser Val Ser Pro Gln
Ala Glu Pro Val Trp Thr 145 150 155 160 Pro Pro Ala Pro Ala Pro Ala
Ala Pro Pro Ser Thr Pro Ala Ala Pro 165 170 175 Lys Arg Arg Gly Ser
Ser Gly Ser Val Val Val Asp Leu Leu Tyr Trp 180 185 190 Arg Asp Ile
Lys Lys Thr Gly Val Val Phe Gly Ala Ser Leu Phe Leu 195 200 205 Leu
Leu Ser Leu Thr Val Phe Ser Ile Val Ser Val Thr Ala Tyr Ile 210 215
220 Ala Leu Ala Leu Leu Ser Val Thr Ile Ser Pro Arg Ile Tyr Lys Gly
225 230 235 240 Val Ile Gln Ala Ile Gln Lys Ser Asp Glu Gly His Pro
Phe Arg Ala 245 250 255 Tyr Leu Glu Ser Glu Val Ala Ile Ser Glu Glu
Leu Val Gln Lys Tyr 260 265 270 Ser Asn Ser Ala Leu Gly His Val Asn
Cys Thr Ile Lys Glu Leu Arg 275 280 285 Arg Leu Phe Leu Val Asp Asp
Leu Val Asp Ser Leu Lys Phe Ala Val 290 295 300 Leu Met Trp Val Phe
Thr Tyr Val Gly Ala Leu Phe Asn Gly Leu Thr 305 310 315 320 Leu Leu
Ile Leu Ala Leu Ile Ser Leu Phe Ser Val Pro Val Ile Tyr 325 330 335
Glu Arg His Gln Ala Gln Ile Asp His Tyr Leu Gly Leu Ala Asn Lys 340
345 350 Asn Val Lys Asp Ala Met Ala Lys Ile Gln Ala Lys Ile Pro Gly
Leu 355 360 365 Lys Arg Lys Ala Glu 370 3 25 RNA Artificial
Sequence Antisense oligonucleotide 3 cuggauagcu uggaucacac ccuug 25
4 25 RNA Artificial Sequence Antisense oligonucleotide 4 caacuucagg
auuccagaua ugccc 25 5 24 RNA Artificial Sequence Antisense
oligonucleotide 5 auuccaccag ugccucagau agga 24 6 24 RNA Artificial
Sequence Antisense oligonucleotide 6 augaucuauc ugugccugau gccg 24
7 356 PRT Homo sapiens 7 Met Ala Ala Glu Asp Ala Leu Pro Ser Gly
Tyr Val Ser Phe Gly His 1 5 10 15 Val Gly Gly Pro Pro Pro Ser Pro
Ala Ser Pro Ser Ile Gln Tyr Ser 20 25 30 Ile Leu Arg Glu Glu Arg
Glu Ala Glu Leu Asp Ser Glu Leu Ile Ile 35 40 45 Glu Ser Cys Asp
Ala Ser Ser Ala Ser Glu Glu Ser Pro Lys Arg Glu 50 55 60 Gln Asp
Ser Pro Pro Met Lys Pro Ser Ala Leu Asp Ala Ile Arg Glu 65 70 75 80
Glu Thr Gly Val Arg Ala Glu Glu Arg Ala Pro Ser Arg Arg Gly Leu 85
90 95 Ala Glu Pro Gly Ser Phe Leu Asp Tyr Pro Ser Thr Glu Pro Gln
Pro 100 105 110 Gly Pro Glu Leu Pro Pro Gly Asp Gly Ala Leu Glu Pro
Glu Thr Pro 115 120 125 Met Leu Pro Arg Lys Pro Glu Glu Asp Ser Ser
Ser Asn Gln Ser Pro 130 135 140 Ala Ala Thr Lys Gly Pro Gly Pro Leu
Gly Pro Gly Ala Pro Pro Pro 145 150 155 160 Leu Leu Phe Leu Asn Lys
Gln Lys Ala Ile Asp Leu Leu Tyr Trp Arg 165 170 175 Asp Ile Lys Gln
Thr Gly Ile Val Phe Gly Ser Phe Leu Leu Leu Leu 180 185 190 Phe Ser
Leu Thr Gln Phe Ser Val Val Ser Val Val Ala Tyr Leu Ala 195 200 205
Leu Ala Ala Leu Ser Ala Thr Ile Ser Phe Arg Ile Tyr Lys Ser Val 210
215 220 Leu Gln Ala Val Gln Lys Thr Asp Glu Gly His Pro Phe Lys Ala
Tyr 225 230 235 240 Leu Glu Leu Glu Ile Thr Leu Ser Gln Glu Gln Ile
Gln Lys Tyr Thr 245 250 255 Asp Cys Leu Gln Phe Tyr Val Asn Ser Thr
Leu Lys Glu Leu Arg Arg 260 265 270 Leu Phe Leu Val Gln Asp Leu Val
Asp Ser Leu Lys Phe Ala Val Leu 275 280 285 Met Trp Leu Leu Thr Tyr
Val Gly Ala Leu Phe Asn Gly Leu Thr Leu 290 295 300 Leu Leu Met Ala
Val Val Ser Met Phe Thr Leu Pro Val Val Tyr Val 305 310 315 320 Lys
His Gln Ala Gln Ile Asp Gln Tyr Leu Gly Leu Val Arg Thr His 325 330
335 Ile Asn Ala Val Val Ala Lys Ile Gln Ala Lys Ile Pro Gly Ala Lys
340 345 350 Arg His Ala Glu 355 8 371 PRT Homo sapiens 8 Met Glu
Asp Leu Asp Gln Ser Pro Leu Val Ser Ser Ser Asp Ser Pro 1 5 10 15
Pro Arg Pro Gln Pro Ala Phe Lys Tyr Gln Phe Val Arg Glu Pro Glu 20
25 30 Asp Glu Glu Glu Glu Glu Glu Glu Glu Glu Glu Asp Glu Asp Glu
Asp 35 40 45 Leu Glu Glu Leu Glu Val Leu Glu Arg Lys Pro Ala Ala
Gly Leu Ser 50 55 60 Ala Ala Pro Val Pro Thr Ala Pro Ala Ala Gly
Ala Pro Leu Met Asp 65 70 75 80 Phe Gly Asn Asp Phe Val Pro Pro Ala
Pro Arg Gly Pro Leu Pro Ala 85 90 95 Ala Pro Pro Val Ala Pro Glu
Arg Gln Pro Ser Trp Asp Pro Ser Pro 100 105 110 Val Ser Ser Thr Val
Pro Ala Pro Ser Pro Leu Ser Ala Ala Ala Val 115 120 125 Ser Pro Ser
Lys Leu Pro Glu Asp Asp Glu Pro Pro Ala Arg Pro Pro 130 135 140 Pro
Pro Pro Pro Ala Ser Val Ser Pro Gln Ala Glu Pro Val Trp Thr 145 150
155 160 Pro Pro Ala Pro Ala Pro Ala Ala Pro Pro Ser Thr Pro Ala Ala
Pro 165 170 175 Lys Arg Arg Gly Ser Ser Gly Ser Val Val Val Asp Leu
Leu Tyr Trp 180 185 190 Arg Asp Ile Lys Lys Thr Gly Val Val Phe Gly
Ala Ser Leu Phe Leu 195 200 205 Leu Leu Ser Leu Thr Val Phe Ser Ile
Val Ser Val Thr Ala Tyr Ile 210 215 220 Ala Leu Ala Leu Leu Ser Val
Thr Ile Ser Phe Arg Ile Tyr Lys Gly 225 230 235 240 Val Ile Gln Ala
Ile Gln Lys Ser Asp Glu Gly His Pro Phe Arg Ala 245 250 255 Tyr Leu
Glu Ser Glu Val Ala Ile Ser Glu Glu Leu Val Gln Lys Tyr 260 265 270
Ser Asn Ser Ala Leu Gly His Val Asn Cys Thr Ile Lys Glu Leu Arg 275
280 285 Arg Leu Phe Leu Val Asp Asp Leu Val Asp Ser Leu Lys Phe Ala
Val 290 295 300 Leu Met Trp Val Phe Thr Tyr Val Gly Ala Leu Phe Asn
Gly Leu Thr 305 310 315 320 Leu Leu Ile Leu Ala Leu Ile Ser Leu Phe
Ser Val Pro Val Ile Tyr 325 330 335 Glu Arg His Gln Ala Gln Ile Asp
His Tyr Leu Gly Leu Ala Asn Lys 340 345 350 Asn Val Lys Asp Ala Met
Ala Lys Ile Gln Ala Lys Ile Pro Gly Leu 355 360 365 Lys Arg Lys 370
9 205 PRT Homo sapiens 9 Leu Leu Thr Val Leu Ser Leu Leu Pro Phe
Ile Leu Ile Met Met Thr 1 5 10 15 Ser Phe Leu Lys Ile Ser Ile Val
Leu Ser Leu Leu Arg Asn Ala Leu 20 25 30 Gly Val Gln Gln Val Pro
Pro Asn Met Val Leu Tyr Gly Leu Ala Leu 35 40 45 Phe Leu Thr Leu
Phe Val Met Ala Pro Val Phe Glu Glu Ile Tyr Asp 50 55 60 Arg Ala
His Gln Pro Leu Leu Asp Ala Leu Ser Asn Ile Ile Ser Leu 65 70 75 80
Gln Glu Ala Leu Asp Lys Gly Leu Glu Pro Leu Arg Glu Phe Met Leu 85
90 95 Lys His Thr Asp Glu Lys His Glu Leu Ala Leu Phe Met Arg Ser
Ala 100 105 110 Arg Glu Glu Arg Leu Trp Pro Lys Glu Met Lys Ala Ala
Thr Leu Glu 115 120 125 Lys Asp Asp Leu Leu Val Leu Ile Pro Ala Phe
Val Leu Ser Glu Leu 130 135 140 Lys Arg Ala Phe Glu Ile Gly Phe Leu
Ile Tyr Leu Pro Phe Ile Val 145 150 155 160 Ile Asp Leu Val Val Ala
Ser Ile Leu Met Ala Met Gly Met Met Met 165 170 175 Val Pro Pro Val
Thr Ile Ser Leu Pro Phe Lys Leu Leu Leu Phe Val 180 185 190 Leu Val
Asp Gly Trp Thr Leu Leu Leu Gly Gly Leu Val 195 200 205 10 122 PRT
Homo sapiens 10 Leu Phe Leu Leu Leu Ser Leu Thr Val Phe Ser Ile Val
Ser Val Thr 1 5 10 15 Ala Tyr Ile Ala Leu Ala Leu Leu Ser Val Thr
Ile Ser Phe Arg Ile 20 25 30 Tyr Lys Gly Val Ile Gln Ala Ile Gln
Lys Ser Asp Glu Gly His Pro 35 40 45 Phe Arg Ala Tyr Leu Glu Ser
Glu Val Ala Ile Ser Glu Glu Leu Val 50 55 60 Gln Lys Tyr Ser Asn
Ser Ala Leu Gly His Val Asn Cys Thr Ile Lys 65 70 75 80 Glu Leu Arg
Arg Leu Phe Leu Val Asp Asp Leu Val Asp Ser Leu Lys 85 90 95 Phe
Ala Val Leu Met Trp Val Phe Thr Tyr Val Gly Ala Leu Phe Asn 100 105
110 Gly Leu Thr Leu Leu Ile Leu Ala Leu Ile 115 120 11 5 PRT Homo
sapiens 11 Lys Arg Tyr Ala Glu 1 5
* * * * *