U.S. patent application number 11/458081 was filed with the patent office on 2007-06-07 for hot start reverse transcription by primer design.
This patent application is currently assigned to APPLERA CORPORATION. Invention is credited to Kai Qin Lao, Kenneth J. Livak, Neil A. Straus.
Application Number | 20070128620 11/458081 |
Document ID | / |
Family ID | 37669484 |
Filed Date | 2007-06-07 |
United States Patent
Application |
20070128620 |
Kind Code |
A1 |
Lao; Kai Qin ; et
al. |
June 7, 2007 |
HOT START REVERSE TRANSCRIPTION BY PRIMER DESIGN
Abstract
The present teachings provide methods, compositions, and kits
for performing primer extension reactions. In some embodiments, a
reverse transcription reaction is performed on a target
polynucleotide with a hot start primer comprising a blunt-ended
self-complementary stem, and a loop, and extension products form at
high temperatures but reduce extension product formation at low
temperatures.
Inventors: |
Lao; Kai Qin; (Pleasanton,
CA) ; Straus; Neil A.; (Emeryville, CA) ;
Livak; Kenneth J.; (San Jose, CA) |
Correspondence
Address: |
MILA KASAN, PATENT DEPT.;APPLIED BIOSYSTEMS
850 LINCOLN CENTRE DRIVE
FOSTER CITY
CA
94404
US
|
Assignee: |
APPLERA CORPORATION
850 Linclon Centre Drive M/S 432-2
Foster City
CA
|
Family ID: |
37669484 |
Appl. No.: |
11/458081 |
Filed: |
July 17, 2006 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
60699967 |
Jul 15, 2005 |
|
|
|
Current U.S.
Class: |
435/6.11 ;
435/6.12; 435/91.2 |
Current CPC
Class: |
C12Q 1/686 20130101;
C12N 9/00 20130101; C12Q 1/6848 20130101; C07H 21/04 20130101; C07H
21/02 20130101; C12Q 1/6876 20130101; C12Q 1/6844 20130101; C12Q
1/6848 20130101; C12Q 2549/101 20130101; C12Q 2533/101 20130101;
C12Q 2525/301 20130101; C12Q 1/6844 20130101; C12Q 2549/101
20130101; C12Q 1/6848 20130101; C12Q 2549/101 20130101; C12Q
2525/301 20130101; C12Q 2521/107 20130101 |
Class at
Publication: |
435/006 ;
435/091.2 |
International
Class: |
C12Q 1/68 20060101
C12Q001/68; C12P 19/34 20060101 C12P019/34 |
Claims
1. A method of reducing primer extension products at a low
temperature and allowing primer extension at a high temperature
comprising; forming a reaction mixture at the low temperature below
about 27C, wherein the reaction mixture comprises a target
polynucleotide, a primer extending enzyme, and a hot start primer,
wherein the hot start primer comprises a loop and a
self-complementary stem, wherein a target-specific region of the
self-complementary stem comprises at least six nucleotides that are
complementary with the target polynucleotide, wherein the
target-specific region of the self-complementary stem is hybridized
with a quencher region in the self-complementary stem when at the
low temperature, and wherein the self-complementary stem is unable
to hybridize with the target polynucleotide when at the low
temperature; elevating the temperature of the reaction mixture to a
high temperature between 35C-60C, wherein the target-specific
region of the self-complementary stem is unhybridized with the
quencher region in the self-complementary stem at the high
temperature, and wherein the target-specific region hybridizes to
the target polynucleotide; extending the target-specific region of
the self-complementary stem with the primer extending enzyme to
form a primer extension product; and, generating a primer extension
product at the high temperature but not at the low temperature.
2. The method according to claim 1 wherein the primer extending
enzyme is a reverse transcriptase.
3. The method according to claim 1 wherein the target
polynucleotide is a messenger RNA.
4. The method according to claim 1 wherein the target
polynucleotide is a small non-coding RNA.
5. The method according to claim 4 wherein the small non-coding RNA
is a micro RNA.
6. The method according to claim 1 wherein the loop of the hot
start primer comprises 8-24 nucleotides.
7. The method according to claim 1 wherein the self-complementary
stem of the hot start primer comprises 6-12 nucleotide
base-pairs.
8. The method according to claim 1 wherein the target-specific
region of the hot start primer further comprises nucleotide s
present in the loop of the hot start primer.
9. The method according to claim 1 wherein the target-specific
region of the hot start primer, when hybridized to the quencher
region of the hot start primer, forms a blunt-ended structure.
10. The method according to claim 1 wherein the high temperature
between 35C-60C occurs for between 20 minutes and 40 minutes.
11. The method according to claim 1 wherein the primer extension
reaction is a reverse transcription reaction, said method further
comprising performing a polymerase chain reaction (PCR) on the
primer extension product with a forward primer and a reverse
primer, wherein the PCR comprises; a denaturizing step performed
after the extension reaction; an annealing step performed after the
melting step; and, an extension step performed after the annealing
step.
12. The method according to claim 11 wherein the reverse
transcription reaction comprises the forward primer.
13. A composition comprising a target polynucleotide and a hot
start primer primer, wherein the hot start primer comprises a
self-complementary stem, wherein the self-complementary stem
comprises a target-specific region and a quencher region, wherein
the target-specific region comprises at least six nucleotides,
wherein the target-specific region is substantially unhybridized
with the quencher region in the self-complementary stem, and
wherein the target-specific region is hybridized with the target
polynucleotide.
14. The composition according to claim 13 wherein the target
polynucleotide is a messenger RNA.
15. The composition according to claim 13 wherein the target
polynucleotide is a small non-coding RNA.
16. The composition according to claim 15 wherein the small
non-coding RNA is a micro RNA.
17. The composition according to claim 13 wherein the loop of the
hot start primer comprises 8-24 nucleotides.
18. The composition according to claim 18 wherein the
self-complementary stem of the hot start primer comprises 6-12
nucleotide base-pairs.
19. The composition according to claim 13 wherein the
target-specific region of the hot start primer further comprises at
least one nucleotide present in the loop of the hot start
primer.
20. The composition according to claim 13 wherein the
target-specific region of the hot start primer, when hybridized to
the quencher region of the hot start primer, forms a blunt-ended
structure.
21. A kit for reducing primer extension products at a low
temperature and allowing primer extension at a high temperature
comprising; a hot start primer, a primer extending enzyme, a primer
extending enzyme buffer, and dNTPs, wherein the hot start primer
comprises a loop and a self-complementary stem, wherein the
self-complementary stem comprises a target-specific region that is
at least six nucleotides in length, wherein the target-specific
region is complementary to target polynucleotide, wherein the
target-specific region is substantially hybridized to a quencher
region when at a temperature of 27C or lower, and wherein the
target-specific region when hybridized to the quencher region forms
a blunt end structure, a structure with a one nucleotide overlap,
or a structure with a two nucleotide overlap.
22. The kit according to claim 21 wherein the primer extending
enzyme is a reverse transcriptase.
23. The kit according to claim 21 wherein the loop of the hot start
primer comprises 8-24 nucleotides.
24. The kit according to claim 21 wherein the self-complementary
stem of the hot start primer comprises 6-12 nucleotide
base-pairs.
25. The kit according to claim 21 further comprising a forward
primer and reagents for performing a PCR.
26. The kit according to claim 25 wherein the reagents for
performing the PCR are included in a vessel that is the same vessel
that contains at least one of the hot start primer, the primer
extending enzyme, the primer extending enzyme buffer, and the
dNTPs.
27. The kit according to claim 21 wherein the target polynucleotide
is selected from the group comprising messenger RNA, small
non-coding RNA, and micro RNA.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application claims a benefit of priority under 35
U.S.C. .sctn.119(e) from U.S. application Ser. No. 60/699,967, Jul.
15, 2005, the contents of which is incorporated herein by
reference.
FIELD
[0002] The present teachings relate to methods of synthesizing
nucleic acids by primer extension.
INTRODUCTION
[0003] The integrity of primer-mediated methods of synthesizing
nucleic acids can be compromised by non-specific hybridization of
primer to inappropriate target polynucleotides. The analysis of
nucleic acids is benefited by approaches by approaches that
minimize the generation of mis-extension products. For example,
`hot start` approaches have been employed in PCR, where inhibition
of polymerase activity has been achieved. For example, U.S. Pat.
No. 5,338,671 describes the use of antibodies specific for a
thermostable DNA polymerase to inhibit the DNA polymerase activity
at low temperatures. Chemical treatment with citraconic anhydride
is another way hot start PCR has been achieved (see U.S. Pat. Nos.
5,773,258 and 5,677,152). Hot start methods which use a heat labile
material, such as wax, to separate or sequester reaction components
are described in U.S. Pat. No. 5,411,876. The application of such
hot start approaches to reverse transcription have proven
challenging. For example, many reverse transcriptases are not
heat-stabile.
SUMMARY
[0004] The present teachings provide a method for reducing the
formation of primer extension products at a low temperature but
allowing the formation of primer extension products at a high
temperature comprising; forming a reaction mixture at the low
temperature below about 27C, wherein the reaction mixture comprises
a target polynucleotide, a primer extending enzyme, and a hot start
primer, wherein the hot start primer comprises a loop and a
self-complementary stem, wherein a target-specific region of the
self-complementary stem comprises a sequence of at least six
nucleotides that are complementary with the target polynucleotide,
wherein the target-specific region of the self-complementary stem
is substantially hybridized with a quencher region in the
self-complementary stem when at the low temperature and wherein the
self-complementary stem is substantially unable to hybridize with
the target polynucleotide when at the low temperature; elevating
the temperature of the reaction mixture to a high temperature
between 35C-60C, wherein the target-specific region of the
self-complementary stem is substantially unhybridized with the
quencher region in the self-complementary stem at the high
temperature, and wherein the target-specific region hybridizes to
the target polynucleotide; extending the target-specific region of
the self-complementary stem with the primer extending enzyme to
form a primer extension product; and, generating a primer extension
product at the high temperature but not at the low temperature.
[0005] In some embodiments, the present teachings provide a
composition comprising a target polynucleotide and a hot start
primer, wherein the hot start primer comprises a self-complementary
stem, wherein the self-complementary stem comprises a
target-specific region and a quencher region, wherein the
target-specific region comprises at least six nucleotide s, wherein
the target-specific region is substantially unhybridized with the
quencher region in the self-complementary stem, and wherein the
target-specific region is hybridized with the target
polynucleotide.
[0006] In some embodiments, the present teachings provide a kit for
reducing the formation of primer extension products at a low
temperature but allowing the formation of primer extension products
at a high temperature comprising; a hot start primer, a primer
extending enzyme, a primer extending enzyme buffer, and dNTPs,
wherein the hot start primer comprises a loop and a
self-complementary stem, wherein the self-complementary stem
comprises a target-specific region that is at least six nucleotides
in length, wherein the target-specific region is complementary to
target polynucleotide, and wherein the target-specific region is
substantially hybridized to a quencher region when at a temperature
of 27C or lower.
[0007] These and other features of the present teachings are set
forth herein.
DRAWINGS
[0008] FIG. 1 depicts one illustrative embodiment according to the
present teachings.
DESCRIPTION OF EXEMPLARY EMBODIMENTS
[0009] It is to be understood that both the foregoing general
description and the following detailed description are exemplary
and explanatory only and are not intended to limit the scope of the
current teachings. In this application, the use of the singular
includes the plural unless specifically stated otherwise. For
example, "a forward primer" means that more than one forward primer
can be present; for example, one or more copies of a particular
forward primer species, as well as one or more different forward
primer species. Also, the use of "comprise", "contain", and
"include", or modifications of those root words, for example but
not limited to, "comprises", "contained", and "including", are not
intended to be limiting. The term and/or means that the terms
before and after can be taken together or separately. For
illustration purposes, but not as a limitation, "X and/or Y" can
mean "X" or "Y" or "X and Y".
[0010] The section headings used herein are for organizational
purposes only and are not to be construed as limiting the described
subject matter in any way. All literature and similar materials
cited in this application, including, patents, patent applications,
articles, books, treatises, and internet web pages are expressly
incorporated by reference in their entirety for any purpose. In the
event that one or more of the incorporated literature and similar
defines or uses a term in such a way that it contradicts that
term's definition in this application, this application controls.
While the present teachings are described in conjunction with
various embodiments, it is not intended that the present teachings
be limited to such embodiments. On the contrary, the present
teachings encompass various alternatives, modifications, and
equivalents, as will be appreciated by those of skill in the
art.
Some Definitions
[0011] As used herein, the term "denaturing" refers to the melting
of two complementary nucleic acid strands, and is typically
achieved by elevating the temperature. In some embodiments,
denaturing can be achieved by the addition of base (e.g. --NaOH) or
other approaches for dissociating nucleic acids that are familiar
to one of ordinary skill in the art of molecular biology.
[0012] As used herein, the term "complementary" refers to nucleic
acid sequences that are capable of forming Watson-Crick base-pairs.
For example, a self-complementary primer comprises a
self-complementary stem which is capable of forming Watson-Crick
base-pairs with itself at a low temperature. When at the low
temperature, the strands of such a self-complementary stem are said
to be hybridized to one another. When at a high temperature, the
strands of such a self-complementary stem are not hybridized to
each other, and the target specific region of the
self-complementary stem can be hybridized with a target. In this
application, a statement that one sequence is complementary to
another sequence encompasses situations in which the two sequences
have slight mismatches. Here, the term "sequence" encompasses, but
is not limited to, nucleic acid sequences, polynucleotides,
oligonucleotides, probes, primers, primer-specific regions, and
target-specific regions. Despite the mismatches, the two sequences
should selectively hybridize to one another under appropriate
conditions.
[0013] As used herein, the term "hot start primer" refers to a
primer comprising a self-complementary stem and a loop, wherein the
self-complementary stem comprises a target specific region and a
quencher region. At low temperatures, the target-specific region is
hybridized to the quencher region. At high temperatures, the
target-specific region is not hybridized to the quencher region,
and can hybridize to the corresponding target polynucleotide,
thereby allowing for a hot start extension reaction. In some
embodiments, the self-complementary stem is blunt-ended, such that
there is not a nucleotide overlap at the 5' or 3' end of the
self-complementary stem. In some embodiments, the mRNA primer
comprises a nearly blunt-ended self-complementary stem, such as for
example a single 3' nucleotide overhang. Generally, such 3'
overhangs will be of minimal length to avoid undesired priming on
targets prior to the melting of the self-complementary stem region
by the high temperature. Overhangs on the 5' end are generally more
tolerable, since extension does not proceed from the 5' of a
sequence.
[0014] As used herein, the term "target polynucleotide" refers to a
polynucleotide sequence that is sought to be reverse transcribed.
The target polynucleotide can be obtained from any source, and can
comprise any number of different compositional components. For
example, the target can be nucleic acid (e.g. DNA or RNA), transfer
RNA, siRNA, and can comprise nucleic acid analogs or other nucleic
acid mimic, though typically the target will be messenger RNA
(mRNA) and/or micro RNA (miRNA). The target can be methylated,
non-methylated, or both. The target can be bisulfite-treated and
non-methylated cytosines converted to uracil. Further, it will be
appreciated that "target polynucleotide" can refer to the target
polynucleotide itself, as well as surrogates thereof, for example
amplification products, and native sequences. In some embodiments,
the target polynucleotide is a short DNA molecule derived from a
degraded source, such as can be found in for example but not
limited to forensics samples (see for example Butler, 2001,
Forensic DNA Typing: Biology and Technology Behind STR Markers. The
target polynucleotides of the present teachings can be derived from
any of a number of sources, including without limitation, viruses,
prokaryotes, eukaryotes, for example but not limited to plants,
fungi, and animals. These sources may include, but are not limited
to, whole blood, a tissue biopsy, lymph, bone marrow, amniotic
fluid, hair, skin, semen, biowarfare agents, anal secretions,
vaginal secretions, perspiration, saliva, buccal swabs, various
environmental samples (for example, agricultural, water, and soil),
research samples generally, purified samples generally, cultured
cells, and lysed cells. It will be appreciated that target
polynucleotides can be isolated from samples using any of a variety
of procedures known in the art, for example the Applied Biosystems
ABI Prism.TM. 6100 Nucleic Acid PrepStation, and the ABI Prism.TM.
6700 Automated Nucleic Acid Workstation, Boom et al., U.S. Pat. No.
5,234,809., mirVana RNA isolation kit (Ambion), etc. It will be
appreciated that target polynucleotides can be cut or sheared prior
to analysis, including the use of such procedures as mechanical
force, sonication, restriction endonuclease cleavage, or any method
known in the art. In general, the target polynucleotides of the
present teachings will be single stranded, though in some
embodiments the target polynucleotide can be double stranded, and a
single strand can result from denaturation.
[0015] The term "nucleotide", as used herein, refers to a compound
comprising a nucleotide base linked to the C-1' carbon of a sugar,
such as ribose, arabinose, xylose, and pyranose, and sugar analogs
thereof. The term nucleotide also encompasses nucleotide analogs.
The sugar may be substituted or unsubstituted. Substituted ribose
sugars include, but are not limited to, those riboses in which one
or more of the carbon atoms, for example the 2'-carbon atom, is
substituted with one or more of the same or different Cl, F, --R,
--OR, --NR.sub.2 or halogen groups, where each R is independently
H, C.sub.1-C.sub.6 alkyl or C.sub.5-C.sub.14 aryl. Exemplary
riboses include, but are not limited to, 2'-(C1-C6)alkoxyribose,
2'-(C5-C14)aryloxyribose, 2',3'-didehydroribose,
2'-deoxy-3'-haloribose, 2'-deoxy-3'-fluororibose,
2'-deoxy-3'-chlororibose, 2'-deoxy-3'-aminoribose,
2'-deoxy-3'-(C1-C6)alkylribose, 2'-deoxy-3'-(C1-C6)alkoxyribose and
2'-deoxy-3'-(C5-C14)aryloxyribose, ribose, 2'-deoxyribose,
2',3'-dideoxyribose, 2'-haloribose, 2'-fluororibose,
2'-chlororibose, and 2'-alkylribose, e.g., 2'-O-methyl,
4'-.alpha.-anomeric nucleotides, 1'-.alpha.-anomeric nucleotides,
2'-4'- and 3'-4'-linked and other "locked" or "LNA", bicyclic sugar
modifications (see, e.g., PCT published application nos. WO
98/22489, WO 98/39352;, and WO 99/14226). Exemplary LNA sugar
analogs within a polynucleotide include, but are not limited to,
the structures: ##STR1## [0016] where B is any nucleotide base.
[0017] Modifications at the 2'- or 3'-position of ribose include,
but are not limited to, hydrogen, hydroxy, methoxy, ethoxy,
allyloxy, isopropoxy, butoxy, isobutoxy, methoxyethyl, alkoxy,
phenoxy, azido, amino, alkylamino, fluoro, chloro and bromo.
Nucleotides include, but are not limited to, the natural D optical
isomer, as well as the L optical isomer forms (see, e.g., Garbesi
(1993) Nucl. Acids Res. 21:4159-65; Fujimori (1990) J. Amer. Chem.
Soc. 112:7435; Urata, (1993) Nucleic Acids Symposium Ser. No.
29:69-70). When the nucleotide base is purine, e.g. A or G, the
ribose sugar is attached to the N.sup.9-position of the nucleotide
base. When the nucleotide base is pyrimidine, e.g. C, T or U, the
pentose sugar is attached to the N.sup.1-position of the nucleotide
base, except for pseudouridines, in which the pentose sugar is
attached to the C5 position of the uracil nucleotide base (see,
e.g., Kornberg and Baker, (1992) DNA Replication, 2.sup.nd Ed.,
Freeman, San Francisco, Calif.).
[0018] One or more of the pentose carbons of a nucleotide may be
substituted with a phosphate ester having the formula: ##STR2##
where .alpha. is an integer from 0 to 4. In certain embodiments,
.alpha. is 2 and the phosphate ester is attached to the 3'- or
5'-carbon of the pentose. In certain embodiments, the nucleotides
are those in which the nucleotide base is a purine, a
7-deazapurine, a pyrimidine, or an analog thereof. "Nucleotide
5'-triphosphate" refers to a nucleotide with a triphosphate ester
group at the 5' position, and are sometimes denoted as "NTP", or
"dNTP" and "ddNTP" to particularly point out the structural
features of the ribose sugar. The triphosphate ester group may
include sulfur substitutions for the various oxygens, e.g.
.alpha.-thio-nucleotide 5'-triphosphates. For a review of
nucleotide chemistry, see: Shabarova, Z. and Bogdanov, A. Advanced
Organic Chemistry of Nucleic Acids, VCH, New York, 1994.
Some Specific Exemplary Embodiments
[0019] FIG. 1 depicts an illustrative relationship between a hot
start primer and a target polynucleotide according to some
embodiments of the present teachings. In (A), a target
polynucleotide (1) is shown with a hot start primer (2) in a
reaction mixture at a low temperature (for example 25C, roughly
room temperature). The hot start primer (2) comprises a
self-complementary stem (3) comprising a target-specific region (4)
and a quencher region (5). The hot start primer also comprises a
loop (6). In (B), elevation to a high temperature is performed (for
example 42C, an appropriate temperature for a reverse
transcriptase), and the stem of the hot start primer melts, thereby
liberating the target-specific region (5) of the self-complementary
primer. In (C), the target-specific region (5) of the hot start
primer can hybridize to the target polynucleotide (1), and
extension of the primer by the reverse transcriptase can occur
(bold arrow).
[0020] In some embodiments, the architecture of the hot start
primer can differ from that depicted in FIG. 1. For example, the
loop (6) of the hot start primer shown in FIG. 1 can itself form
part of the target-specific region of the hot start primer. It will
be appreciated that one of skill in the art would be able to make
these and other minor modifications in the design of the hot start
primer provided by the present teachings, and still be within their
scope.
[0021] In some embodiments, the reverse transcription is set up at
room temperature. In some embodiments, the reverse transcription is
set up at 20C-27C. In some embodiments, the reverse transcription
can be set up on ice. In some embodiments, the reverse
transcription reaction can be set up at 4C-27C.
[0022] Certain methods of optimizing reverse transcription and
amplification reactions are known to those skilled in the art. For
example, it is known that PCR may be optimized by altering times
and temperatures for annealing, polymerization, and denaturing, as
well as changing the buffers, salts, and other reagents in the
reaction composition. Optimization may also be affected by the
design of the amplification primers used. For example, the length
of the primers, as well as the G-C:A-T ratio may alter the
efficiency of primer annealing, thus altering the amplification
reaction. Descriptions of amplification optimization can be found
in, among other places, James G. Wetmur, "Nucleic Acid Hybrids,
Formation and Structure," in Molecular Biology and Biotechnology,
pp.605-8, (Robert A. Meyers ed., 1995); McPherson, particularly in
Chapter 4; Rapley; and Protocols & Applications Guide, rev.
9/04, Promega.
[0023] In some embodiments, the present teachings contemplate
single-tube RT-PCR approaches, and discussed for example in Mohamed
et al., (2004) Journal of Clinical Virology, 30:150-156. In some
embodiments, the reverse transcription products of the present
teachings can be amplified in a multiplexed pre-amplifying PCR
followed by a plurality of lower-plex decoding PCRs, as described
for example in WO2004/051218 to Andersen and Ruff, U.S. Pat. No.
6,605,451 to Xtrana, and U.S. Non-Provisional application Ser. No.
11/090,830 to Andersen et al., and U.S. Non-Provisional application
Ser. No. 11,090,468 to Lao et al.,
[0024] Generally, the length of the stem of the hot start primer
can vary according to the context of the application. For example,
when the target-specific region of the hot start primer is G:C
rich, the length of the stem region can be shorter. Conversely,
when the target-specific region of the hot start primer is A:T
rich, the length of the stem region can be longer. Such procedures
can be employed to adjust the length of the stem to correspond with
a desired Tm, given a particular reaction context at hand. In some
embodiments, the length of the stem is between 6-12 nucleotide
base-pairs.
[0025] Generally, the length of the loop of the hot start primer
will be between 8-24 nucleotides in length. Generally, short loops
can have the beneficial effect of minimizing the likelihood of loop
sequence displacing stem sequence at lower reaction temperatures.
It will be appreciated by one of ordinary skill in the art that a
variety of stem-loop configurations are available and within
routine experimentation.
[0026] Illustrative molecular biology techniques of ready
availability to one of skill in the art can be found in Sambrook et
al., Molecular Cloning, 3rd Edition.
Certain Exemplary Kits
[0027] The instant teachings also provide kits designed to expedite
performing certain of the disclosed methods. Kits may serve to
expedite the performance of certain disclosed methods by assembling
two or more components required for carrying out the methods. In
certain embodiments, kits contain components in pre-measured unit
amounts to minimize the need for measurements by end-users. In some
embodiments, kits include instructions for performing one or more
of the disclosed methods. Preferably, the kit components are
optimized to operate in conjunction with one another.
[0028] Thus, in some embodiments the present teachings provide a
kit for reducing primer extension products at a low temperature and
allowing primer extension at a high temperature comprising; a hot
start primer, a primer extending enzyme, a primer extending enzyme
buffer, and dNTPs, wherein the hot start primer comprises a loop
and a self-complementary stem, wherein the self-complementary stem
comprises a target-specific region that is at least six nucleotide
s in length, wherein the target-specific region is complementary to
target polynucleotide, wherein the target-specific region is
substantially hybridized to a quencher region when at a temperature
of 27C or lower, and wherein the target-specific region when
hybridized to the quencher region forms a blunt end structure, a
structure with a one nucleotide overlap, or a structure with a two
nucleotide overlap. In some embodiments, the primer extending
enzyme is a reverse transcriptase. In some embodiments, the loop of
the hot start primer comprises 8-24 nucleotides. In some
embodiments, the self-complementary stem of the hot start primer
comprises 6-12 nucleotide base-pairs. In some embodiments, the kit
further comprises a forward primer and reagents for performing a
PCR. In some embodiments, the reagents for performing the PCR are
included in a vessel that is the same vessel that contains at least
one of the hot start primer, the primer extending enzyme, the
primer extending enzyme buffer, and the dNTPs. In some embodiments,
the target polynucleotide is selected from the group comprising
messenger RNA, small non-coding RNA, and micro RNA.
[0029] The current teachings, having been described above, may be
better understood by reference to examples. The following examples
are intended for illustration purposes only, and should not be
construed as limiting the scope of the teachings herein in any
way.
EXAMPLE
[0030] An illustrative experiment was performed comprising the
primer and probe sequences found in Table 1 below directed to the
ACTB messenger RNA. The results of different RT reactions using
different RT primers, and reaction temperatures, were quantitated
using real-time PCR with a forward primer FP-ACTB (SEQ ID NO:1), a
reverse primer RP-ACTB (SEQ ID NO:2), and a TaqMan 5' nuclease
probe Taq-ACTB (SEQ ID NO:7) There were two reverse transcription
temperature conditions: a low temperature RT at 20C, and a high
temperature RT at 40C. There were six RT reactions compared for
each of the two temperature conditions, using the following six
conditions.
[0031] 1) RT linear primer (SEQ ID NO:2).
[0032] 2) RT hot start primer with 8 base-pair stem (SEQ ID NO:
5.
[0033] 3) RT hot start primer with 10 base-pair stem (SEQ ID
NO:4).
[0034] 4) RT hot start primer with 12 base-pair stem (SEQ ID
NO:3).
[0035] 5) buffer alone (no RT primer).
[0036] 6) No template control. TABLE-US-00001 SEQ ID Oligo Name
Sequence SEQ ID NO:1 FP-ACTB CCCCGCGAGCACAGA SEQ ID NO:2 RP-ACTB
CCACGATGGAGGGGAAGAC SEQ ID NO:3 RP-ACTB-12
GTCTTCCCCTCCTTCCACGATGGAGGG GAAGAC SEQ ID NO:4 RP-ACTB-10
GTCTTCCCCTTTCCACGATGGAGGGGAAGAC SEQ ID NO:5 RP-ACTB-8
GTCTTCCCTTCCACGATGGAGGGGAAGAC SEQ ID NO:6 RP-ACTB-6
GTCTTCTTCCACGATGGAGGGGAAGAC SEQ ID NO:7 Taq-ACTB (6-FAM)
CTTTGCCGATCCGC (MGB)
[0037] The experiment was set up at room temperature. The RT
reaction was done following manufacture's suggestion by using of
Applied Biosystems High Capacity cDNA Archive Kit (CN: 4322171). In
the low temperature condition, the reverse transcription reaction
was performed at 20C for 30 minutes. In the high temperature
condition, the reverse transcription was performed at 40C for 30
minutes.
[0038] Ct values derived from TaqMan.TM. quantitative PCR using ABI
TaqMan universal PCR master mix demonstrated a hot start effect for
hot start primers comprising a self-complementary stem.
Specifically, the fold reduction of RT product of linear primer to
hot start primer at 20C was significantly greater than the fold
reduction of RT product of linear primer to hot start primer at
40C, thus illustrating inhibition of reverse transcription by the
presence of the hot-start primer comprising the self-complementary
stem. Further, hot start primers with longer self-complementary
stems showed a stronger hot start effect than primers with shorter
self-complementary stems. Thus, for example, the RT primer with a
twelve nucleotide base-pair stem showed a stronger reduction in RT
product formed at 20C compared to a linear RT primer, than did an
eight nucleotide base-pair stem RT primer in the 20C RT reaction
compared to the linear RT primer.
[0039] Although the disclosed teachings have been described with
reference to various applications, methods, and kits, it will be
appreciated that various changes and modifications may be made
without departing from the teachings herein. The foregoing examples
are provided to better illustrate the present teachings and are not
intended to limit the scope of the teachings herein. Certain
aspects of the present teachings may be further understood in light
of the following claims.
Sequence CWU 1
1
7 1 15 DNA Homo sapiens 1 ccccgcgagc acaga 15 2 19 DNA Homo sapiens
2 ccacgatgga ggggaagac 19 3 33 DNA Homo sapiens 3 gtcttcccct
ccttccacga tggaggggaa gac 33 4 31 DNA Homo sapiens 4 gtcttcccct
ttccacgatg gaggggaaga c 31 5 29 DNA Homo sapiens 5 gtcttccctt
ccacgatgga ggggaagac 29 6 27 DNA Homo sapiens 6 gtcttcttcc
acgatggagg ggaagac 27 7 14 DNA Homo sapiens 7 ctttgccgat ccgc
14
* * * * *