U.S. patent application number 11/643277 was filed with the patent office on 2007-05-24 for monoclonal antibodies and methods for their use in the detection of cervical disease.
This patent application is currently assigned to TriPath Imaging, Inc.. Invention is credited to Timothy J. Fischer, Douglas P. Malinowski, Adriann J. Taylor.
Application Number | 20070117167 11/643277 |
Document ID | / |
Family ID | 37199037 |
Filed Date | 2007-05-24 |
United States Patent
Application |
20070117167 |
Kind Code |
A1 |
Malinowski; Douglas P. ; et
al. |
May 24, 2007 |
Monoclonal antibodies and methods for their use in the detection of
cervical disease
Abstract
Compositions and methods for diagnosing high-grade cervical
disease in a patient sample are provided. The compositions include
novel monoclonal antibodies, and variants and fragments thereof,
that specifically bind to MCM2. Monoclonal antibodies having the
binding characteristics of an MCM2 antibody of the invention are
further provided. Hybridoma cell lines that produce an MCM2
monoclonal antibody of the invention are also disclosed herein. The
compositions find use in practicing methods for diagnosing
high-grade cervical disease comprising detecting overexpression of
MCM2 in a cervical sample from a patient. Kits for practicing the
methods of the invention are further provided. Polypeptides
comprising the amino acid sequence for an MCM2 epitope and methods
of using these polypeptides in the production of antibodies are
also encompassed by the present invention.
Inventors: |
Malinowski; Douglas P.;
(Hillsborough, NC) ; Fischer; Timothy J.;
(Raleigh, NC) ; Taylor; Adriann J.; (Durham,
NC) |
Correspondence
Address: |
ALSTON & BIRD LLP
BANK OF AMERICA PLAZA
101 SOUTH TRYON STREET, SUITE 4000
CHARLOTTE
NC
28280-4000
US
|
Assignee: |
TriPath Imaging, Inc.
Burlington
NC
|
Family ID: |
37199037 |
Appl. No.: |
11/643277 |
Filed: |
December 21, 2006 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
11410272 |
Apr 24, 2006 |
|
|
|
11643277 |
Dec 21, 2006 |
|
|
|
60675305 |
Apr 27, 2005 |
|
|
|
60718082 |
Sep 16, 2005 |
|
|
|
Current U.S.
Class: |
435/7.23 ;
435/338; 530/388.8 |
Current CPC
Class: |
G01N 33/57411 20130101;
C07K 16/3069 20130101; C07K 2317/34 20130101; C07K 14/4738
20130101 |
Class at
Publication: |
435/007.23 ;
435/338; 530/388.8 |
International
Class: |
G01N 33/574 20060101
G01N033/574; C12N 5/06 20060101 C12N005/06; C07K 16/30 20060101
C07K016/30 |
Claims
1. A monoclonal antibody that is capable of specifically binding to
MCM2, or a variant or fragment thereof, wherein the antibody is
selected from the group consisting of: (a) the monoclonal antibody
produced by the hybridoma cell line 26H6.19, deposited with the
ATCC as Patent Deposit No. PTA-6667; (b) a monoclonal antibody
having the binding characteristics of the monoclonal antibody
produced by the hybridoma cell line 26H6.19; (c) a monoclonal
antibody that binds to an epitope capable of binding the monoclonal
antibody produced by the hybridoma cell line 26H6.19; (d) a
monoclonal antibody that binds to an epitope comprising the amino
acid sequence of SEQ ID NO:14 (e) a monoclonal antibody that
competes in a competitive binding assay with the monoclonal
antibody produced by the hybridoma cell line 26H6.19; and, (f) a
monoclonal antibody that is an antigen binding fragment of a
monoclonal antibody of (a)-(e), wherein the fragment retains the
capability of specifically binding to MCM2, or a variant or
fragment thereof.
2. The hybridoma cell line 26H6.19, deposited with the ATCC as
Patent Deposit No. PTA-6667.
3. A hybridoma cell line capable of producing a monoclonal antibody
of claim 1.
4. A kit for diagnosing high-grade cervical disease comprising at
least one monoclonal antibody according to claim 1.
5. The kit of claim 4, wherein the monoclonal antibody is the
monoclonal antibody produced by the hybridoma cell line 26H6.19,
deposited with the ATCC as Patent Deposit No. PTA-6667.
6. The kit of claim 4 comprising at least two antibodies, wherein a
first antibody is the monoclonal antibody produced by the hybridoma
cell line 26H6.19, deposited with the ATCC as Patent Deposit No.
PTA-6667.
7. The kit of claim 6 further comprising an antibody that
specifically binds to Topo2A.
8. The kit of claim 6, wherein each antibody is provided as a
separate antibody reagent.
9. The kit of claim 6, wherein all of the antibodies are provided
as an antibody cocktail.
10. The kit of claim 4, wherein said kit further comprises a
peroxidase blocking reagent, a protein blocking reagent, chemicals
for the detection of antibody binding to said biomarker proteins, a
counterstain, a bluing agent, and instructions for use.
11. The kit of claim 4 further comprising reagents for Pap
staining.
12. The kit of claim 11, wherein the reagents for Pap staining
comprise EA50 and Orange G.
13. A method for diagnosing high-grade cervical disease in a
patient, the method comprising: a) obtaining a cervical sample from
the patient; b) contacting the sample with at least one monoclonal
antibody according to claim 1 that specifically binds to MCM2; and,
c) detecting binding of the antibody to MCM2.
14. The method of claim 13, wherein the monoclonal antibody is the
monoclonal antibody produced by the hybridoma cell line 26H6.19,
deposited with the ATCC as Patent Deposit No. PTA-6667.
15. The method of claim 13 comprising contacting the sample with at
least two monoclonal antibodies that specifically bind to MCM2,
wherein a first antibody is the monoclonal antibody produced by the
hybridoma cell line 26H6.19, deposited with the ATCC as Patent
Deposit No. PTA-6667.
16. The method of claim 15 further comprising contacting the sample
with an antibody that specifically binds to Topo2A.
17. The method of claim 15, wherein the antibodies are contacted
with the sample sequentially as individual antibody reagents or
simultaneously as an antibody cocktail.
18. An isolated polypeptide comprising an epitope for binding an
MCM2 monoclonal antibody, wherein the polypeptide comprises an
amino acid sequence selected from the group consisting of: (a) a
polypeptide comprising the amino acid sequence set forth in SEQ ID
NO:14; and, (b) a polypeptide having at least 90% sequence identity
to SEQ ID NO:14, wherein the polypeptide has antigenic
activity.
19. A method for producing an MCM2 antibody comprising immunizing
an animal with a polypeptide according to claim 19.
20. A method for producing an MCM2 monoclonal antibody comprising:
(a) immunizing an animal with a polypeptide according to claim 19
under conditions to elicit an immune response; (b) isolating
antibody-producing cells from the animal; (c) fusing the
antibody-producing cells with immortalized cells in culture to form
monoclonal antibody-producing hybridoma cells; (d) culturing the
hybridoma cells; and, (e) isolating monoclonal antibodies from
culture.
Description
CROSS REFERENCE TO RELATED APPLICATIONS
[0001] This application is a divisional of U.S. application Ser.
No. 1/410,272, filed Apr. 24, 2006, which claims the benefit of
U.S. Provisional Application Serial No. 60/675,305, filed Apr. 27,
2005, and U.S. Provisional Application Ser. No. 60/718,082, filed
Sep. 16, 2005, all of which are incorporated herein by reference in
their entirety.
FIELD OF THE INVENTION
[0002] The invention relates to antibodies capable of binding to
MCM2 and methods of using these antibodies, particularly in the
diagnosis of cervical disease.
BACKGROUND OF THE INVENTION
[0003] Carcinoma of the cervix is the second most common neoplasm
in women, accounting for approximately 12% of all female cancers
and causing approximately 250,000 deaths per year. Baldwin et al.
(2003) Nature Reviews Cancer 3:1-10. In many developing countries
where mass screening programs are not available, the clinical
problem is more serious. Cervical cancer in these countries is the
number one cause of cancer deaths in women.
[0004] The majority of cases of cervical cancer represent squamous
cell carcinoma, although adenocarcinoma is also seen. Cervical
cancer can be prevented by population screening as it evolves
through well-defined noninvasive intraepithelial stages, which can
be distinguished morphologically. Williams et al. (1998) Proc.
Natl. Acad. Sci. USA 95:14932-14937. While it is not understood how
normal cells become transformed, the concept of a continuous
spectrum of histopathological change from normal, stratified
epithelium through cervical intraepithelial neoplasia (CIN) to
invasive cancer has been widely accepted for years. The precursor
to cervical cancer is dysplasia, also known in the art as CIN or
squamous intraepithelial lesions (SIL). Squamous intraepithelial
abnormalities may be classified by using the three-tiered (CIN) or
two-tiered (Bethesda) system. Under the Bethesda system, low-grade
squamous intraepithelial lesions (LSIL), corresponding to CINI and
HPV infection, generally represent productive HPV infections with a
relatively low risk of progression to invasive disease. High-grade
squamous intraepithelial lesions (HSIL), corresponding to CINII and
CINIII in the three-tiered system, show a higher risk of
progression to cervical cancer than do LSIL, although both LSIL and
HSIL are viewed as potential precursors of malignancy. Patient
samples may also be classified as ASCUS (atypical squamous cells of
unknown significance) or AGUS (atypical glandular cells of unknown
significance) under this system.
[0005] A strong association of cervical cancer and infection by
high-risk types of human papilloma virus (HPV), such as types 16,
18, and 31, has been established. In fact, a large body of
epidemiological and molecular biological evidence has established
HPV infection as a causative factor in cervical cancer. Moreover,
HPV is found in 85% or more of the cases of high-grade cervical
disease. However, HPV infection is very common, possibly occurring
in 5-15% of women over the age of 30, but few HPV-positive women
will ever develop high-grade cervical disease or cancer. The
presence of HPV alone is indicative only of infection, not of
high-grade cervical disease, and, therefore, testing for HPV
infection alone results in many false positives. See, for example,
Wright et al. (2004) Obstet. Gynecol. 103:304-309.
[0006] Current literature suggests that HPV infects the basal stem
cells within the underlying tissue of the uterine-cervix.
Differentiation of the stem cells into mature keratinocytes, with
resulting migration of the cells to the stratified cervical
epithelium, is associated with HPV viral replication and
re-infection of cells. During this viral replication process, a
number of cellular changes occur that include cell-cycle
de-regulation, active proliferation, DNA replication,
transcriptional activation and genomic instability (Crum (2000)
Modern Pathology 13:243-25; Middleton et al. (2003) J Virol.
77:10186-10201; Pett et al. (2004) Cancer Res. 64:1359-1368).
[0007] Most HPV infections are transient in nature, with the viral
infection resolving itself within a 12-month period. For those
individuals who develop persistent infections with one or more
oncogenic subtypes of HPV, there is a risk for the development of
neoplasia in comparison to patients without an HPV infection. Given
the importance of HPV in the development of cervical neoplasia, the
clinical detection of HPV has become an important diagnostic tool
in the identification of patients at risk for cervical neoplasia
development. The clinical utility of HPV-based screening for
cervical disease is in its negative predictive value. An HPV
negative result in combination with a history of normal Pap smears
is an excellent indicator of a disease-free condition and a low
risk of cervical neoplasia development during the subsequent 1-3
years. However, a positive HPV result is not diagnostic of cervical
disease; rather it is an indication of infection. Although the
majority of HPV infections is transient and will spontaneously
clear within a 12-month period, a persistent infection with a
high-risk HPV viral subtype indicates a higher risk for the
development of cervical neoplasia. To supplement HPV testing, the
identification of molecular markers associated with cervical
neoplasia is expected to improve the clinical specificity for
cervical disease diagnosis.
[0008] Cytological examination of Papanicolaou-stained cervical
smears (Pap smears) currently is the method of choice for detecting
cervical cancer. The Pap test is a subjective method that has
remained substantially unchanged for 60 years. There are several
concerns, however, regarding its performance. The reported
sensitivity of a single Pap test (the proportion of disease
positives that are test-positive) is low and shows wide variation
(30-87%). The specificity of a single Pap test (the proportion of
disease negatives that are test-negative) might be as low as 86% in
a screening population and considerably lower in the ASCUS PLUS
population for the determination of underlying high-grade disease.
See, Baldwin et al., supra. A significant percentage of Pap smears
characterized as LSIL or CINI are actually positive for high-grade
lesions. Furthermore, up to 10% of Pap smears are classified as
ASCUS (atypical squamous cells of undetermined significance), i.e.,
it is not possible to make a clear categorization as normal,
moderate or severe lesion, or tumor. However, experience shows that
up to 10% of this ASCUS population has high-grade lesions, which
are consequently overlooked. See, for example, Manos et al. (1999)
JAMA 281:1605-1610. Therefore, molecular biomarkers that are
selectively overexpressed in high-grade cervical disease and
compositions for the detection of these biomarkers are needed to
practice reliable methods for diagnosing high-grade cervical
disease.
[0009] Minichromosome maintenance (MCM) proteins play an essential
part in eukaryotic DNA replication. The minichromosome maintenance
(MCM) proteins function in the early stages of DNA replication
through loading of the prereplication complex onto DNA and
functioning as a helicase to help unwind the duplex DNA during de
novo synthesis of the duplicate DNA strand. Each of the MCM
proteins has DNA-dependent ATPase motifs in their highly conserved
central domain. Levels of MCM proteins generally increase in a
variable manner as normal cells progress from G0 into the G1/S
phase of the cell cycle. In the G0 phase, MCM2 and MCM5 proteins
are much less abundant than are the MCM7 and MCM3 proteins. MCM6
forms a complex with MCM2, MCM4, and MCM7, which binds histone H3.
In addition, the subcomplex of MCM4, MCM6, and MCM7 has helicase
activity, which is mediated by the ATP-binding activity of MCM6 and
the DNA-binding activity of MCM4. See, for example, Freeman et al.
(1999) Clin. Cancer Res. 5:2121-2132; Lei et al. (2001) J Cell Sci.
114:1447-1454; Ishimi et al. (2003) Eur. J Biochem. 270:1089-1101,
all of which are herein incorporated by reference in their
entirety.
[0010] Early publications have shown that the MCM proteins, and in
particular, MCM-5, are useful for the detection of cervical disease
(Williams et al. (1998) Proc Natl Acad Sci U.S.A. 95:14932-14937),
as well as other cancers (Freeman et al. (1999) Clin Cancer Res.
5:2121-2132). The published literature indicates that antibodies to
MCM-5 are capable of detecting cervical neoplastic cells. The
specificity for detection of high-grade cervical disease has not
been demonstrated for MCM-5 (Williams et al. (1998) Proc Natl Acad
Sci U.S.A. 95:14932-14937). The detection of MCM-5 expression is
not restricted to high-grade cervical disease but is also detected
in identified low-grade dysplasia and proliferative cells that have
re-entered the cell cycle following infection with high-risk HPV.
In addition to MCM-5, other members from the MCM family, including
MCM-2 and MCM-7 have been shown to be potentially useful markers
for the detection of cervical neoplasia in tissue samples (Freeman
et al. (1999) Clin Cancer Res. 5:2121-2132; Brake et al. (2003)
Cancer Res. 63:8173-8180). Recent results have shown that MCM-7
appears to be a specific marker for the detection of high-grade
cervical disease using immunochemistry formats (Brake et al. (2003)
Cancer Res. 63:8173-8180; Malinowski et al. (2004) Acta Cytol.
43:696).
[0011] Therefore, there is a need in the art for antibodies that
are capable of detecting expression of a biomarker that is
selectively overexpressed in high-grade cervical disease. Such
antibodies could be used in methods for differentiating high-grade
disease from conditions that are not considered clinical disease,
such as early-stage HPV infection and mild dysplasia.
SUMMARY OF THE INVENTION
[0012] Compositions and methods for diagnosing high-grade cervical
disease are provided. Compositions include monoclonal antibodies
capable of binding to nuclear biomarker proteins of the invention,
particularly MCM proteins, more particularly MCM2. Antigen-binding
fragments and variants of these monoclonal antibodies, hybridoma
cell lines capable of producing these antibodies, and kits
comprising the monoclonal antibodies of the invention are also
encompassed herein.
[0013] The compositions of the invention find use in methods for
diagnosing high-grade cervical disease. The methods comprise
detecting overexpression of at least one nuclear biomarker, wherein
overexpression of the nuclear biomarker is indicative of high-grade
cervical disease. Specifically, the methods comprise using the
antibodies of the invention to detect overexpression of MCM2 in a
cervical sample.
[0014] Compositions of the invention further include isolated
polypeptides that comprise an epitope capable of binding an MCM2
monoclonal antibody. These polypeptides find use in methods for
producing MCM2 antibodies. Isolated nucleic acid molecules encoding
the amino acid sequences of the MCM2 epitopes are also
provided.
DETAILED DESCRIPTION OF THE INVENTION
[0015] Compositions and methods for diagnosing high-grade cervical
disease are provided. Compositions include monoclonal antibodies
that are capable of binding to nuclear biomarker proteins that are
selectively overexpressed in high-grade cervical disease,
particularly MCM proteins, more particularly MCM2. Hybridoma cell
lines that produce the monoclonal antibodies of the present
invention are also disclosed. Kits comprising the monoclonal
antibodies described herein are further provided. The present
compositions find use in methods for diagnosing high-grade cervical
disease in a patient.
[0016] The compositions of the invention include monoclonal
antibodies that specifically bind to MCM2, or to a variant or
fragment thereof. In particular, the MCM2 antibodies designated as
27C5.6 and 26H6.19 are provided. Hybridoma cell lines that produce
MCM2 monoclonal antibodies 27C5.6 and 26H6.19 were deposited with
the Patent Depository of the American Type Culture Collection
(ATCC), Manassas, Va., 20110-2209 on Apr. 14, 2005 and assigned
Patent Deposit Nos. PTA-6668 and PTA-6667, respectively. These
deposits will be maintained under the terms of the Budapest Treaty
on the International Recognition of the Deposit of Microorganisms
for the Purposes of Patent Procedure. These deposits were made
merely as a convenience for those of skill in the art and are not
an admission that a deposit is required under 35 U.S.C. .sctn.
112.
[0017] Antibodies that have the binding characteristics of
monoclonal antibodies 27C5.6, and 26H6.19 are also disclosed
herein. Such antibodies include, but are not limited to, antibodies
that compete in competitive binding assays with these antibodies,
as well as antibodies that bind to an epitope capable of binding
monoclonal antibody 27C5.6 or 26H6.19. Variants and fragments of
monoclonal antibodies 27C5.6 and 26H6.19 that retain the ability to
specifically bind to MCM2 are also provided. Compositions further
include hybridoma cell lines that produce the monoclonal antibodies
of the present invention and kits comprising at least one
monoclonal antibody disclosed herein. "Antibodies" and
"immunoglobulins" (Igs) are glycoproteins having the same
structural characteristics. While antibodies exhibit binding
specificity to an antigen, immunoglobulins include both antibodies
and other antibody-like molecules that lack antigen specificity.
Polypeptides of the latter kind are, for example, produced at low
levels by the lymph system and at increased levels by myelomas.
[0018] The terms "antibody" and "antibodies" broadly encompass
naturally occurring forms of antibodies and recombinant antibodies
such as single-chain antibodies, chimeric and humanized antibodies
and multi-specific antibodies as well as fragments and derivatives
of all of the foregoing, which fragments and derivatives have at
least an antigenic binding site. Antibody derivatives may comprise
a protein or chemical moiety conjugated to the antibody. The term
"antibody" is used in the broadest sense and covers fully assembled
antibodies, antibody fragments that can bind antigen (e.g., Fab',
F'(ab).sub.2, Fv, single chain antibodies, diabodies), and
recombinant peptides comprising the foregoing. As used herein,
"MCM2 antibody" refers to any antibody that specifically binds to
MCM2 (SEQ ID NO:1), or to a variant or fragment thereof, and
includes monoclonal antibodies, polyclonal antibodies, single-chain
antibodies, and fragments thereof which retain the antigen binding
function of the parent antibody.
[0019] The MCM2 antibodies of the invention are optimally
monoclonal antibodies. The term "monoclonal antibody" as used
herein refers to an antibody obtained from a population of
substantially homogeneous antibodies, i.e., the individual
antibodies comprising the population are identical except for
possible naturally-occurring mutations that may be present in minor
amounts.
[0020] "Native antibodies" and "native immunoglobulins" are usually
heterotetrameric glycoproteins of about 150,000 daltons, composed
of two identical light (L) chains and two identical heavy (H)
chains. Each light chain is linked to a heavy chain by one covalent
disulfide bond, while the number of disulfide linkages varies among
the heavy chains of different immunoglobulin isotypes. Each heavy
and light chain also has regularly spaced intrachain disulfide
bridges. Each heavy chain has at one end a variable domain (VH)
followed by a number of constant domains. Each light chain has a
variable domain at one end (V,) and a constant domain at its other
end; the constant domain of the light chain is aligned with the
first constant domain of the heavy chain, and the light chain
variable domain is aligned with the variable domain of the heavy
chain. Particular amino acid residues are believed to form an
interface between the light and heavy-chain variable domains.
[0021] The term "variable" refers to the fact that certain portions
of the variable domains differ extensively in sequence among
antibodies and are used in the binding and specificity of each
particular antibody for its particular antigen. However, the
variability is not evenly distributed throughout the variable
domains of antibodies. It is concentrated in three segments called
complementarity determining regions (CDRs) or hypervariable regions
both in the light chain and the heavy-chain variable domains. The
more highly conserved portions of variable domains are called the
framework (FR) regions. The variable domains of native heavy and
light chains each comprise four FR regions, largely adopting a
p-sheet configuration, connected by three CDRs, which form loops
connecting, and 15 in some cases forming part of, the p-sheet
structure. The CDRs in each chain are held together in close
proximity: by the FR regions and, with the CDRs from the other
chain, contribute to the formation of the antigen-binding site: of
antibodies (see Kabat et al., NIH Publ. No.91-3242, Vol. I, pages
647-669 (1991)).
[0022] The constant domains are not involved directly in binding an
antibody to an antigen, but exhibit various effecter functions,
such as participation of the antibody in antibody-dependent
cellular toxicity.
[0023] The term "hypervariable region" when used herein refers to
the amino acid residues of an antibody which: are responsible for
antigen-binding. The hypervariable region comprises amino acid
residues from a "complementarily determining region" or "CDR"
(i.e., residues 24-34 (L1),50-56 (L2) and89-97 (L3) in the light
chain variable domain and 31-35 (H1), 50-65 (H2) and 95-102 (H3) in
the heavy chain variable domain; Kabat et al., Sequences of
Proteins of Immunological Interest, 5th Ed. Public Health Service,
National Institute of Health, i 25 Bethesda, MD. [1991]) and/or
those residues from a "hypervariable loop" (i.e., residues
26-32(L1), 50-52 (L2) and 91-96 (L3) in the light chain variable
domain and 2632(H1), 53-55 (H2) and 96-101 (H3) in the heavy chain
variable domain; Clothia and Lesk, J. Mol. Biol., 196:901-917
[1987]). "Framework" or "FR" residues are those variable domain
residues other than the hypervariable region residues as herein
deemed.
[0024] "Antibody fragments" comprise a portion of an intact
antibody, preferably the antigen-binding or variable region of the
intact antibody. Examples of antibody fragments include Fab, Fab',
F(ab')2, and Fv fragments; diabodies; linear antibodies (Zapata et
al. (1995) Protein Eng. 8(10):1057-1062); single-chain antibody
molecules; and multispecific antibodies formed from antibody
fragments. Papain digestion of antibodies produces two identical
antigen-binding fragments, called "Fab" fragments, each with a
single antigen-binding site, and a residual "Fc" fragment, whose
name reflects its ability to crystallize readily. Pepsin treatment
yields an F(ab')2 fragment that has two antigen-combining sites and
is still capable of cross-linking antigen.
[0025] "Fv" is the minimum antibody fragment that contains a
complete antigen recognition and binding site. In a two-chain Fv
species, this region consists of a dimer of one heavy- and one
light-chain variable domain in tight, non-covalent association. In
a single-chain Fv species, one heavy- and one light-chain variable
domain can be covalently linked by flexible peptide linker such
that the light and heavy chains can associate in a "dimeric"
structure analogous to that in a two-chain Fv species. It is in
this configuration that the three CDRs of each variable domain
interact to define an antigen-binding site on the surface of the
V.sub.H-V.sub.L dimer. Collectively, the six CDRs confer
antigen-binding specificity to the antibody. However, even a single
variable domain (or half of an Fv comprising only three CDRs
specific for an antigen) has the ability to recognize and bind
antigen, although at a lower affinity than the entire binding
site.
[0026] The Fab fragment also contains the constant domain of the
light chain and the first constant domain (C.sub.H1) of the heavy
chain. Fab fragments differ from Fab' fragments by the addition of
a few residues at the carboxy terminus of the heavy-chain C.sub.H1
domain including one or more cysteines from the antibody hinge
region. Fab'-SH is the designation herein for Fab' in which the
cysteine residue(s) of the constant domains bear a free thiol
group. F(ab')2 antibody fragments originally were produced as pairs
of Fab' fragments that have hinge cysteines between them.
[0027] Fragments of the MCM2 antibodies are encompassed by the
invention so long as they retain the desired affinity of the
full-length antibody. Thus, for example, a fragment of an MCM2
antibody will retain the ability to bind to the MCM2 antigen. Such
fragments are characterized by properties similar to the
corresponding full-length antibody, that is, the fragments will
specifically bind MCM2. Such fragments are referred to herein as
"antigen-binding" fragments.
[0028] Suitable antigen-binding fragments of an antibody comprise a
portion of a full-length antibody, generally the antigen-binding or
variable region thereof. Examples of antibody fragments include,
but are not limited to, Fab, F(ab').sub.2, and Fv fragments and
single-chain antibody molecules. By "Fab" is intended a monovalent
antigen-binding fragment of an immunoglobulin that is composed of
the light chain and part of the heavy chain. By F(ab').sub.2 is
intended a bivalent antigen-binding fragment of an immunoglobulin
that contains both light chains and part of both heavy chains. By
"single-chain Fv" or "sFv" antibody fragments is intended fragments
comprising the V.sub.H and V.sub.L domains of an antibody, wherein
these domains are present in a single polypeptide chain. See, for
example, U.S. Pat. Nos. 4,946,778, 5,260,203, 5,455,030, and
5,856,456, herein incorporated by reference. Generally, the Fv
polypeptide further comprises a polypeptide linker between the
V.sub.H and V.sub.L domains that enables the sFv to form the
desired structure for antigen binding. For a review of sFv see
Pluckthun (1994) in The Pharmacology of Monoclonal Antibodies, Vol.
113, ed. Rosenburg and Moore (Springer-Verlag, New York), pp.
269-315.
[0029] Antibodies or antibody fragments can be isolated from
antibody phage libraries generated using the techniques described
in, for example, McCafferty et al. (1990) Nature 348:552-554 (1990)
and U.S. Pat. No. 5,514,548. Clackson et al. (1991) Nature
352:624-628 and Marks et al. (1991) J Mol. Biol. 222:581-597
describe the isolation of murine and human antibodies,
respectively, using phage libraries. Subsequent publications
describe the production of high affinity (nM range) human
antibodies by chain shuffling (Marks et al. (1992) Bio/Technology
10:779-783), as well as combinatorial infection and in vivo
recombination as a strategy for constructing very large phage
libraries (Waterhouse et al. (1993) Nucleic. Acids Res.
21:2265-2266). Thus, these techniques are viable alternatives to
traditional monoclonal antibody hybridoma techniques for isolation
of monoclonal antibodies.
[0030] Various techniques have been developed for the production of
antibody fragments. Traditionally, these fragments were derived via
proteolytic digestion of intact antibodies (see, e.g., Morimoto et
al. (1992) Journal of Biochemical and Biophysical Methods
24:107-117 (1992) and Brennan et al. (1985) Science 229:81).
However, these fragments can now be produced directly by
recombinant host cells. For example, the antibody fragments can be
isolated from the antibody phage libraries discussed above.
Alternatively, Fab'-SH fragments can be directly recovered from E.
coli and chemically coupled to form F(ab').sub.2 fragments (Carter
et al. (1992) Bio/Technology 10:163-167). According to another
approach, F(ab').sub.2 fragments can be isolated directly from
recombinant host cell culture. Other techniques for the production
of antibody fragments will be apparent to the skilled
practitioner.
[0031] Preferably antibodies of the invention are monoclonal in
nature. As indicated above, "monoclonal antibody" is intended an
antibody obtained from a population of substantially homogeneous
antibodies, i.e., the individual antibodies comprising the
population are identical except for possible naturally occurring
mutations that may be present in minor amounts. The term is not
limited regarding the species or source of the antibody. The term
encompasses whole immunoglobulins as well as fragments such as Fab,
F(ab')2, Fv, and others which retain the antigen binding function
of the antibody. Monoclonal antibodies are highly specific, being
directed against a single antigenic site, i.e., a particular
epitope within the MCM2 protein, as defined herein below.
Furthermore, in contrast to conventional (polyclonal) antibody
preparations that typically include different antibodies directed
against different determinants (epitopes), each monoclonal antibody
is directed against a single determinant on the antigen. The
modifier "monoclonal" indicates the character of the antibody as
being obtained from a substantially homogeneous population of
antibodies, and is not to be construed as requiring production of
the antibody by any particular method. For example, the monoclonal
antibodies to be used in accordance with the present invention may
be made by the hybridoma method first described by Kohler et al.
(1975) Nature 256:495, or may be made by recombinant DNA methods
(see, e.g., U.S. Pat. No. 4,816,567). The "monoclonal antibodies"
may also be isolated from phage antibody libraries using the
techniques described in, for example, Clackson et al. (1991) Nature
352:624-628; Marks et al. (1991) J Mol. Biol. 222:581-597; and U.S.
Pat. No. 5,514,548.
[0032] Monoclonal antibodies can be prepared using the method of
Kohler et al. (1975) Nature 256:495-496, or a modification thereof.
Typically, a mouse is immunized with a solution containing an
antigen. Immunization can be performed by mixing or emulsifying the
antigen-containing solution in saline, preferably in an adjuvant
such as Freund's complete adjuvant, and injecting the mixture or
emulsion parenterally. Any method of immunization known in the art
may be used to obtain the monoclonal antibodies of the invention.
After immunization of the animal, the spleen (and optionally,
several large lymph nodes) are removed and dissociated into single
cells. The spleen cells may be screened by applying a cell
suspension to a plate or well coated with the antigen of interest.
The B cells expressing membrane bound immunoglobulin specific for
the antigen (i.e., antibody-producing cells) bind to the plate and
are not rinsed away. Resulting B cells, or all dissociated spleen
cells, are then induced to fuse with myeloma cells to form
monoclonal antibody-producing hybridomas, and are cultured in a
selective medium. The resulting cells are plated by serial dilution
and are assayed for the production of antibodies that specifically
bind the antigen of interest (and that do not bind to unrelated
antigens). The selected monoclonal antibody (mAb)-secreting
hybridomas are then cultured either in vitro (e.g., in tissue
culture bottles or hollow fiber reactors), or in vivo (as ascites
in mice). Monoclonal antibodies can also be produced using
Repetitive Immunizations Multiple Sites technology (RIMMS). See,
for example, Kilpatrick et al. (1997) Hybridoma 16(4):381-389;
Wring et al. (1999) J. Pharm. Biomed. Anal. 19(5):695-707; and
Bynum et al. (1999) Hybridoma 18(5):407-41 1, all of which are
herein incorporated by reference in their entirety.
[0033] As an alternative to the use of hybridomas, antibody can be
produced in a cell line such as a CHO cell line, as disclosed in
U.S. Pat. Nos. 5,545,403; 5,545,405; and 5,998,144; incorporated
herein by reference. Briefly the cell line is transfected with
vectors capable of expressing a light chain and a heavy chain,
respectively. By transfecting the two proteins on separate vectors,
chimeric antibodies can be produced. Another advantage is the
correct glycosylation of the antibody. A monoclonal antibody can
also be identified and isolated by screening a recombinant
combinatorial immunoglobulin library (e.g., an antibody phage
display library) with a biomarker protein to thereby isolate
immunoglobulin library members that bind the biomarker protein.
Kits for generating and screening phage display libraries are
commercially available (e.g., the Pharmacia Recombinant Phage
Antibody System, Catalog No. 27-9400-01; and the Stratagene SurfZAP
9 Phage Display Kit, Catalog No. 240612). Additionally, examples of
methods and reagents particularly amenable for use in generating
and screening antibody display library can be found in, for
example, U.S. Pat. No. 5,223,409; PCT Publication Nos. WO 92/18619;
WO 91/17271; WO 92/20791; WO 92/15679; 93/01288; WO 92/01047;
92/09690; and 90/02809; Fuchs et al. (1991) Bio/Technology
9:1370-1372; Hay et al. (1992) Hum. Antibod. Hybridomas 3:81-85;
Huse et al. (1989) Science 246:1275-1281; Griffiths et al. (1993)
EMBO J. 12:725-734.
[0034] In some aspects of the invention, antibodies may be selected
on the basis of desirable staining of cytological, rather than
histological, samples. That is, in particular embodiments the
antibodies are selected with the end sample type (e.g., cytology
preparations) in mind and for binding specificity. Antibodies
directed to specific biomarkers of interest, such as MCM2, are
selected and purified via a multi-step screening process. Such
methods for antibody selection are described in pending U.S.
application Ser. No. 11/087,227, entitled "Methods and Compositions
for the Detection of Cervical Disease," filed Mar. 23, 2005, which
is herein incorporated by reference in its entirety.
[0035] Antibodies having the binding characteristics of a
monoclonal antibody of the invention are also provided. "Binding
characteristics" or "binding specificity" when used in reference to
an antibody means that the antibody recognizes the same or similar
antigenic epitope as a comparison antibody. Examples of such
antibodies include, for example, an antibody that competes with a
monoclonal antibody of the invention in a competitive binding
assay. One of skill in the art could determine whether an antibody
competitively interferes with another antibody using standard
methods.
[0036] By "epitope" is intended the part of an antigenic molecule
to which an antibody is produced and to which the antibody will
bind. An "MCM2 epitope" comprises the part of the MCM2 protein to
which an MCM2 monoclonal antibody binds. Epitopes can comprise
linear amino acid residues (i.e., residues within the epitope are
arranged sequentially one after another in a linear fashion),
nonlinear amino acid residues (referred to herein as "nonlinear
epitopes"; these epitopes are not arranged sequentially), or both
linear and nonlinear amino acid residues. Typically epitopes are
short amino acid sequences, e.g. about five amino acids in length.
Systematic techniques for identifying epitopes are known in the art
and are described, for example, in U.S. Pat. No. 4,708,871 and in
the examples set forth below. Briefly, in one method, a set of
overlapping oligopeptides derived from the antigen may be
synthesized and bound to a solid phase array of pins, with a unique
oligopeptide on each pin. The array of pins may comprise a 96-well
microtiter plate, permitting one to assay all 96 oligopeptides
simultaneously, e.g., for binding to a biomarker-specific
monoclonal antibody. Alternatively, phage display peptide library
kits (New England BioLabs) are currently commercially available for
epitope mapping. Using these methods, the binding affinity for
every possible subset of consecutive amino acids may be determined
in order to identify the epitope that a given antibody binds.
Epitopes may also be identified by inference when epitope length
peptide sequences are used to immunize animals from which
antibodies are obtained.
[0037] The invention also encompasses isolated polypeptides
comprising an epitope for binding an MCM2 monoclonal antibody.
These polypeptides correspond to a portion of the antigen (i.e.,
MCM2) that binds to a monoclonal antibody. Such polypeptides find
use in methods for producing antibodies that bind selectively to
MCM2. The ability of a polypeptide to be used in the production of
antibodies is referred to herein as "antigenic activity." For
example, the amino acid sequences set forth in SEQ ID NOs: 3, 4,
and 14 (corresponding to residues 369 to 382, 688 to 710, and 683
to 692, respectively, in the MCM2 amino acid sequence set forth in
SEQ ID NO:1) comprise epitopes recognized by MCM2 monoclonal
antibodies, more particularly monoclonal antibodies 27C5.6 and
26H6.19. See Example 4 for details. Variants and fragments of the
MCM2 epitope sequences set forth in SEQ ID NOs: 3, 4, and 14 that
retain the antigenic activity of the original polypeptide are also
provided. The invention further includes isolated nucleic acid
molecules that encode polypeptides that comprise MCM2 epitopes, and
variants and fragments thereof.
[0038] The polypeptides of the invention comprising MCM2 epitopes
can be used in methods for producing monoclonal antibodies that
specifically bind to MCM2, as described herein above. Such
polypeptides can also be used in the production of polyclonal MCM2
antibodies. For example, polyclonal antibodies can be prepared by
immunizing a suitable subject (e.g., rabbit, goat, mouse, or other
mammal) with a polypeptide comprising an MCM2 epitope (i.e., an
immunogen). The antibody titer in the immunized subject can be
monitored over time by standard techniques, such as with an enzyme
linked immunosorbent assay (ELISA) using immobilized biomarker
protein. At an appropriate time after immunization, e.g., when the
antibody titers are highest, antibody-producing cells can be
obtained from the subject and used to prepare monoclonal antibodies
by standard techniques, such as the hybridoma technique originally
described by Kohler and Milstein (1975) Nature 256:495-497, the
human B cell hybridoma technique (Kozbor et al. (1983) Immunol.
Today 4:72), the EBV-hybridoma technique (Cole et al. (1985) in
Monoclonal Antibodies and Cancer Therapy, ed. Reisfeld and Sell
(Alan R. Liss, Inc., New York, N.Y.), pp. 77-96) or trioma
techniques. The technology for producing hybridomas is well known
(see generally Coligan et al., eds. (1994) Current Protocols in
Immunology (John Wiley & Sons, Inc., New York, N.Y.); Galfre et
al. (1977) Nature 266:55052; Kenneth (1980) in Monoclonal
Antibodies: A New Dimension In Biological Analyses (Plenum
Publishing Corp., NY; and Lerner (1981) Yale J. Biol. Med.,
54:387-402).
[0039] Amino acid sequence variants of a monoclonal antibody or a
polypeptide comprising an MCM2 epitope described herein are also
encompassed by the present invention. Variants can be prepared by
mutations in the cloned DNA sequence encoding the antibody of
interest. Methods for mutagenesis and nucleotide sequence
alterations are well known in the art. See, for example, Walker and
Gaastra, eds. (1983) Techniques in Molecular Biology (MacMillan
Publishing Company, New York); Kunkel (1985) Proc. Natl. Acad. Sci.
USA 82:488-492; Kunkel et al. (1987) Methods Enzymol. 154:367-382;
Sambrook et al. (1989) Molecular Cloning: A Laboratory Manual (Cold
Spring Harbor, New York); U.S. Pat. No. 4,873,192; and the
references cited therein; herein incorporated by reference.
Guidance as to appropriate amino acid substitutions that do not
affect biological activity of the polypeptide of interest may be
found in the model of Dayhoff et al. (1978) in Atlas of Protein
Sequence and Structure (Natl. Biomed. Res. Found., Washington,
D.C.), herein incorporated by reference. Conservative
substitutions, such as exchanging one amino acid with another
having similar properties, may be preferred. Examples of
conservative substitutions include, but are not limited to,
Gly.revreaction.Ala, Val.revreaction.Ile.revreaction.Leu,
Asp.revreaction.Glu, Lys.revreaction.Arg, Asn.revreaction.Gln, and
Phe.revreaction.Trp.revreaction.Tyr.
[0040] In constructing variants of the polypeptide of interest,
modifications are made such that variants continue to possess the
desired activity, i.e., similar binding affinity to the biomarker.
Obviously, any mutations made in the DNA encoding the variant
polypeptide must not place the sequence out of reading frame and
preferably will not create complementary regions that could produce
secondary mRNA structure. See EP Patent Application Publication No.
75,444.
[0041] Preferably, variants of a reference polypeptide have amino
acid sequences that have at least 70% or 75% sequence identity,
preferably at least 80% or 85% sequence identity, more preferably
at least 90%, 91%, 92%, 93%, 94% or 95% sequence identity to the
amino acid sequence for the reference antibody molecule, or to a
shorter portion of the reference antibody molecule. More
preferably, the molecules share at least 96%, 97%, 98% or 99%
sequence identity. For purposes of the present invention, percent
sequence identity is determined using the Smith-Waterman homology
search algorithm using an affine gap search with a gap open penalty
of 12 and a gap extension penalty of 2, BLOSUM matrix of 62. The
Smith-Waterman homology search algorithm is taught in Smith and
Waterman (1981) Adv. Appl. Math. 2:482-489. A variant may, for
example, differ from the reference antibody by as few as 1 to 15
amino acid residues, as few as 1 to 10 amino acid residues, such as
6-10, as few as 5, as few as 4, 3, 2, or even 1 amino acid
residue.
[0042] With respect to optimal alignment of two amino acid
sequences, the contiguous segment of the variant amino acid
sequence may have additional amino acid residues or deleted amino
acid residues with respect to the reference amino acid sequence.
The contiguous segment used for comparison to the reference amino
acid sequence will include at least 20 contiguous amino acid
residues, and may be 30, 40, 50, or more amino acid residues.
Corrections for sequence identity associated with conservative
residue substitutions or gaps can be made (see Smith-Waterman
homology search algorithm).
[0043] The MCM2 monoclonal antibodies of the invention may be
labeled with a detectable substance as described below to
facilitate biomarker protein detection in the sample. Such
antibodies find use in practicing the methods of the invention. The
antibodies and antibody fragments of the invention can be coupled
to a detectable substance to facilitate detection of antibody
binding. The word "label" when used herein refers to a detectable
compound or composition that is conjugated directly or indirectly
to the antibody so as to generate a "labeled" antibody. The label
may be detectable by itself (e.g., radioisotope labels or
fluorescent labels) or, in the case of an enzymatic label, may
catalyze chemical alteration of a substrate compound or composition
that is detectable. Examples of detectable substances for purposes
of labeling antibodies include various enzymes, prosthetic groups,
fluorescent materials, luminescent materials, bioluminescent
materials, and radioactive materials. Examples of suitable enzymes
include horseradish peroxidase, alkaline phosphatase,
.beta.-galactosidase, or acetylcholinesterase; examples of suitable
prosthetic group complexes include streptavidin/biotin and
avidin/biotin; examples of suitable fluorescent materials include
umbelliferone, fluorescein, fluorescein isothiocyanate, rhodamine,
dichlorotriazinylamine fluorescein, dansyl chloride or
phycoerythrin; an example of a luminescent material includes
luminol; examples of bioluminescent materials include luciferase,
luciferin, and aequorin; and examples of suitable radioactive
material include .sup.125I, .sup.131I, .sup.35S, or .sup.3H.
[0044] Kits comprising at least one MCM2 monoclonal antibody of the
invention are further provided. By "kit" is intended any
manufacture (e.g., a package or a container) comprising at least
one reagent, i.e., an antibody, for specifically detecting the
expression of MCM2. The kit may be promoted, distributed, or sold
as a unit for performing the methods of the present invention.
Additionally, the kits may contain a package insert describing the
kit and methods for its use.
[0045] Kits of the invention generally comprise at least one
monoclonal antibody directed to MCM2, chemicals for the detection
of antibody binding, a counterstain, and, optionally, a bluing
agent to facilitate identification of positive staining cells. Any
chemicals that detect antigen-antibody binding may be used in the
kits of the invention. In some embodiments, the detection chemicals
comprise a labeled polymer conjugated to a secondary antibody. For
example, a secondary antibody that is conjugated to an enzyme that
catalyzes the deposition of a chromogen at the antigen-antibody
binding site may be provided. Such enzymes and techniques for using
them in the detection of antibody binding are well known in the
art. In one embodiment, the kit comprises a secondary antibody that
is conjugated to an HRP-labeled polymer. Chromogens compatible with
the conjugated enzyme (e.g., DAB in the case of an HRP-labeled
secondary antibody) and solutions, such as hydrogen peroxide, for
blocking non-specific staining may be further provided. In other
embodiments, antibody binding to a biomarker protein is detected
through the use of a mouse probe reagent that binds to monoclonal
antibodies, followed by addition of a dextran polymer conjugated
with HRP that binds to the mouse probe reagent. Such detection
reagents are commercially available from, for example, Biocare
Medical.
[0046] The kits of the present invention may further comprise a
peroxidase blocking reagent (e.g., hydrogen peroxide), a protein
blocking reagent (e.g., purified casein), and a counterstain (e.g.,
hematoxylin). A bluing agent (e.g., ammonium hydroxide or TBS, pH
7.4, with Tween-20 and sodium azide) may be further provided in the
kit to facilitate detection of positive staining cells. Kits may
also comprise positive and negative control samples for quality
control purposes.
[0047] In another embodiment, the kits of the invention comprise
two MCM2 monoclonal antibodies, more particularly monoclonal
antibodies 27C5.6 and 26H6.19. A kit comprising two MCM2 monoclonal
antibodies and a third antibody directed to topoisomerase II alpha
(Topo2A) is further provided. When multiple antibodies are present
in the kit, each antibody may be provided as an individual reagent
or, alternatively, as an antibody cocktail comprising all of the
antibodies of interest. Furthermore, any or all of the kit reagents
may be provided within containers that protect them from the
external environment, such as in sealed containers. The kits of the
invention are useful in the diagnosis of high-grade cervical
disease and may further include reagents for Pap staining (e.g.,
EA50 and Orange G).
[0048] The compositions of the invention find use in methods for
diagnosing high-grade cervical disease in a patient such as those
disclosed in pending U.S. application Ser. No. 11/087,227, entitled
"Methods and Compositions for the Detection of Cervical Disease,"
filed Mar. 23, 2005, which is herein incorporated by reference in
its entirety. "Diagnosing high-grade cervical disease" is intended
to include, for example, diagnosing or detecting the presence of
cervical disease, monitoring the progression of the disease, and
identifying or detecting cells or samples that are indicative of
high-grade cervical disease. The terms diagnosing, detecting, and
identifying high-grade cervical disease are used interchangeably
herein. By "high-grade cervical disease" is intended those
conditions classified by colposcopy as premalignant pathology,
malignant pathology, moderate to severe dysplasia, and cervical
cancer. Underlying high-grade cervical disease includes
histological identification of CINII, CINIII, HSIL, carcinoma in
situ, adenocarcinoma, and cancer (FIGO stages I-IV).
[0049] The methods of the invention comprise detecting
overexpression of at least one nuclear biomarker that is
selectively overexpressed in high-grade cervical disease. By
"nuclear biomarker" is intended any gene of protein that is
predominantly expressed in the nucleus of the cell. A nuclear
biomarker may be expressed to a lesser degree in other parts of the
cell. By "selectively overexpressed in high-grade cervical disease"
is intended that the nuclear biomarker of interest is overexpressed
in high-grade cervical disease but is not overexpressed in
conditions classified as LSIL, CINI, HPV-infected samples without
any dysplasia present, immature metaplastic cells, and other
conditions that are not considered to be clinical disease. Thus,
detection of the nuclear biomarkers of the invention permits the
differentiation of samples indicative of underlying high-grade
cervical disease from samples that are indicative of benign
proliferation, early-stage HPV infection, or mild dysplasia.
Nuclear biomarkers of particular interest include MCM proteins,
particularly MCM2, and Topo2A.
[0050] In a particular aspect of the invention, the methods
comprise obtaining a cervical sample from a patient, contacting the
sample with at least one MCM2 monoclonal antibody of the invention,
and detecting binding of the antibody to MCM2. In other
embodiments, the sample is contacted with at least two monoclonal
antibodies that specifically bind to MCM2, particularly monoclonal
antibodies 27C5.6 and 26H6.19. In a further embodiment, the sample
is contacted with these two MCM2 monoclonal antibodies and a third
antibody that specifically binds to Topo2A. Techniques for
detecting antibody binding are well known in the art. Antibody
binding to a biomarker of interest may be detected through the use
of chemical reagents that generate a detectable signal that
corresponds to the level of antibody binding and, accordingly, to
the level of biomarker protein expression. Any method for detecting
antibody-antigen binding may used to practice the methods of the
invention.
[0051] As used herein, "cervical sample" refers to any sampling of
cells, tissues, or bodily fluids from the cervix in which
expression of a biomarker can be detected. Examples of such body
samples include but are not limited to gynecological fluids,
biopsies, and smears. Cervical samples may be obtained from a
patient by a variety of techniques including, for example, by
scraping or swabbing an area or by using a needle to aspirate
bodily fluids. Methods for collecting cervical samples are well
known in the art. In particular embodiments, the cervical sample
comprises cervical cells, particularly in a liquid-based
preparation. In one embodiment, cervical samples are collected
according to liquid-based cytology specimen preparation guidelines
such as, for example, the SurePath.RTM. (TriPath Imaging, Inc.) or
the ThinPrep.RTM. preparation (CYTYC, Inc.). Cervical samples may
be transferred to a glass slide for viewing under magnification.
Fixative and staining solutions may be applied to the cells on the
glass slide for preserving the specimen and for facilitating
examination. In one embodiment the cervical sample will be
collected and processed to provide a monolayer sample, as set forth
in U.S. Pat. No. 5,346,831, herein incorporated by reference.
[0052] One of skill in the art will appreciate that any or all of
the steps in the methods of the invention could be implemented by
personnel in a manual or automated fashion. Thus, the steps of
cervical sample preparation, antibody, and detection of antibody
binding may be automated. The methods of the invention may also be
combined with conventional Pap staining techniques to permit a more
accurate diagnosis of high-grade cervical disease.
[0053] The following examples are offered by way of illustration
and not by way of limitation:
EXPERIMENTAL
Example 1
Production of Mouse Monoclonal Antibodies to MCM2
[0054] Mouse monoclonal antibodies specific for MCM2 were
generated. The antigen (an immunogenic polypeptide) was a
full-length recombinant hexahistidine-tagged MCM2 protein. The
antigen was expressed using a baculovirus expression system in Tni
cells. Specifically, the coding sequence for the
hexahistidine-tagged MCM2 (SEQ ID NO:10) was cloned into the
pFastBac1 plasmid (Invitrogen) for expression in Tni cells. Methods
for producing recombinant proteins using baculovirus expression
systems are well known in the art. The tagged MCM2 protein was
purified using a chelating agarose charged with Ni+2 ions (Ni-NTA
from Qiagen) and used as an immunogen. The amino acid sequence of
the immunogenic MCM2 polypeptide is provided in SEQ ID NO:11.
[0055] Mouse immunizations and hybridoma fusions were performed
essentially as described in Kohler et al. (1975) Nature
256:495-496. Mice were immunized with the immunogenic tagged-MCM2
protein in solution. Antibody-producing cells were isolated from
the immunized mice and fused with myeloma cells to form monoclonal
antibody-producing hybridomas. The hybridomas were cultured in a
selective medium. The resulting cells were plated by serial
dilution and assayed for the production of antibodies that
specifically bind MCM2 (and that do not bind to unrelated
antigens). To confirm that the monoclonal antibodies of interest
reacted with the MCM2 protein only and not with the hexahistidine
tag, selected hybridomas were screened against an MCM2-FLAG-tagged
protein. The nucleotide and amino acid sequences for the MCM2-FLAG
protein are set forth in SEQ ID NOs:12 and 13, respectively.
Selected monoclonal antibody (mAb)-secreting hybridomas were then
cultured.
[0056] Antibodies were purified from the culture media supernatants
of "exhausted" hybridoma cells (i.e., cells grown until viability
drops to between 0-15%) using recombinant Protein A-coated resin
(STREAMLINE.RTM., Amersham, Inc.). Antibodies were eluted using low
pH followed by immediate neutralization of pH. Fractions with
significant absorbances at 280 nM were pooled. The resultant pool
was dialyzed against PBS. Purified antibodies were subjected to
further characterization. MCM2 monoclonal antibodies 26H6.19 and
27C5.6 were both determined to be IgG.sub.1, isotypes. Details of
the epitope mapping of these antibodies are described below.
Example 2
Isolation of Monoclonal Antibodies from Hybridoma Cells
[0057] The following procedure is used to isolate monoclonal
antibodies from hybridoma cells:
Media Preparation
[0058] To a sterile 1,000 ml storage bottle, add 100 ml Hyclone
Fetal Bovine Serum (FBS). [0059] Add 10 ml of MEM Non-Essential
Amino Acids Solution. [0060] Add 10 ml of
Penicillin-Streptomycin-L-Glutamine Solution. [0061] QS to
approximately 1000 ml with ExCell 610-HSF media. [0062] Place
sterile cap on bottle and secure tightly. Swirl gently to mix.
[0063] Connect a 1000 ml sterile acetate vacuum filter unit (0.2
.mu.m) to a vacuum pump system. [0064] Gently pour approximately
half of the media solution into sterile acetate vacuum filter unit
and turn on the vacuum. [0065] Once the first half of the media has
been filtered, pour the remaining media into the filter unit and
continue filtering. [0066] After all the media has been filtered,
disconnect the vacuum hose from the vacuum filter unit and turn off
the vacuum pump. Remove the receiver portion of the filter unit
from the filter bottle. Place a new sterile bottle cap on the
bottle. [0067] Store at 2.degree. C. to 10.degree. C. Protect from
light. Initial Hybridoma Cell Culture [0068] Thaw vial of stock
hybridoma frozen culture in a pre-warmed 37.degree. C. H.sub.2O
bath. [0069] Spray the outside of the freeze vial with 70% ethanol.
[0070] Move the thawed vial into the Biological Safety Cabinet.
[0071] Remove the cells from the freeze vial and transfer the cells
to a 15 ml centrifuge tube. [0072] Add 7 ml of cell culture media
drop-wise to the 15 ml centrifuge tube containing the thawed cells.
[0073] Centrifuge the 15 ml centrifuge tube containing the thawed
cells and culture media for 5 minutes at 200 g force. [0074] While
the cells are in the centrifuge, add 45 ml of cell culture media to
a sterile T-225 flask. [0075] After centrifugation, visually
inspect the tube for the presence of a cell pellet. [0076] Remove
the media from the centrifuge tube being careful not to dislodge
the cell pellet. Note: If the cell pellet is disturbed, repeat the
centrifugation step. [0077] Add 5 ml of cell culture media to the
15 ml centrifuge tube containing the pelleted cells. Pipette to
re-suspend the cell pellet into the media. [0078] Transfer the
entire contents of the resuspended cells and culture media into the
T-225 flask containing the 45 ml of media. [0079] Cap the T-225
flask. [0080] Observe for presence of intact cells under the
microscope. Place the T-225 flask immediately into a CO2 incubator
and allow the cells to incubate overnight. Expansion of Hybridoma
Cell Line [0081] Continue to monitor the cell culture for
viability, concentration, and presence of contamination. [0082]
Monitor and adjust the cell suspension from the initial T-225 flask
until the concentration is approximately 600,000 cells/ml to
800,000 cells/ml and a total of 200 to 250 ml of media. [0083]
Dislodge cells and add additional media as needed to meet minimum
cell density requirements. Divide and transfer cell suspension into
one new sterile T-225 flask. Place the 2.times.T-225 flasks into
the CO2 incubator. [0084] Monitor the cells from the 2.times.T-225
flasks until the concentration is approximately 600,000 cells/ml to
800,000 cells/ml, and a total of between 200 to 250 ml of media for
each flask. [0085] Dislodge cells and add additional media as
needed to meet minimum cell density requirements. Divide and
transfer the cell suspensions into 2 additional new sterile T-225
flasks for a total of 4 .times.T-225 flasks. Return all flasks to
the CO2 incubator. [0086] Monitor the cells, and adjust volume in
the 4.times.T-225 flasks until the cell concentration is
approximately 600,000 cells/ml to 800,000 cells/ml with a total
volume of approximately 250 ml per T-225 flask (or approximately
1000 ml total). [0087] Continue to monitor the cells from the
4.times.T-225 flasks until the cells have grown to exhaustion, with
a final viability of 0%-15%. The cell culture supernatant is now
ready for the Clarification Process. Clarification of Supernatant
[0088] Turn on the tabletop centrifuge. Place the 500 ml tube
adapters into the rotor buckets, close the lid and set the
temperature to 4.degree. C. (+/-) 4.degree. C. [0089] Using aseptic
technique, pour the media from all four of the now exhausted T-225
flasks into 2.times.500 ml conical centrifuge tubes. [0090] Make
sure the 2.times.500 ml tubes are balanced. Transfer supernatant
from one tube to the other as necessary to balance them. [0091]
Centrifuge the exhausted supernatant at 1350 g (+/-40 g) for 15
minutes at 2.degree. C. to 10.degree. C. [0092] After
centrifugation is complete, aseptically decant the supernatant into
a sterile 1000 ml storage bottle and secure with a sterile cap.
[0093] Aseptically transfer 1 ml to the microfuge tube. Store
microfuge tube with sample at 2.degree. C. to 10.degree. C.
(Protect from light). [0094] The clarified supernatant sample is
ready for IgG evaluation using the Easy-Titer.RTM. Assay. Buffer
Preparation Binding buffer: [0095] Add approximately 600 ml of DI
H.sub.2O to a clean beaker. [0096] Add 77.28 ml of Boric Acid
solution (4% W/V). Stir at room temperature with a clean stir bar.
[0097] Weigh out 233.76 g of Sodium Chloride and place into the
solution while continuing to stir. [0098] Bring solution up to
approximately 950 ml with DI H.sub.2O and continue to stir. [0099]
When the Sodium Chloride has dissolved and the solution is clear,
adjust the pH to 9.0.+-.0.2 with Sodium Hydroxide. [0100] Remove
the solution to a clean 1000 ml graduated cylinder and QS to 1000
ml with DI H.sub.2O. [0101] Transfer the completed buffer to an
appropriate storage bottle. This buffer may be stored for up to 7
days before use. [0102] Repeat this entire process to prepare an
additional 0.2 liters to 1.0 liter of Binding Buffer. Elution
Buffer [0103] Weigh out 1.725 g of sodium phosphate, monobasic and
place into a clean 250 ml beaker with a clean stir bar. [0104]
Weigh out 3.676 g of sodium citrate and place into the same clean
250 ml beaker. [0105] Add approximately 175 ml of DI H.sub.2O and
stir at room temperature until dissolved. [0106] Weigh out 4.38 g
of Sodium Chloride and place into the solution while continuing to
stir. [0107] Bring solution up to approximately 225 ml with DI
H.sub.2O and continue to stir. [0108] When the Sodium Chloride has
dissolved and the solution is clear, adjust the pH to 3.5.+-.0.2
with Hydrochloric Acid. [0109] Remove the solution to a clean 250
ml graduated cylinder and QS to 250 ml with DI H.sub.2O. [0110]
Connect a 500 ml sterile acetate vacuum filter unit (0.2 .mu.m) to
a vacuum pump system and filter sterilize the solution. [0111]
Remove the filter and close the container with a sterile cap.
Antibody Adsorption [0112] Pour the Clarified Supernatant (.about.1
L) into a clean 4000 ml plastic beaker with a clean stir bar.
[0113] Add an approximately equal amount (.about.1 L) of the
Binding Buffer to the clean 4000 ml plastic beaker containing the
clarified supernatant. Add a clean stir bar. [0114] Cover the
beaker with clean plastic wrap and label "Antibody Binding."
[0115] Calculate the approximate amount of STREAMLINE.RTM. Protein
A that will be needed using the data in Table 1. TABLE-US-00001
TABLE 1 Volume of Protein A Resin Required Volume of Protein A
Quantity IgG (.mu.g/ml) Resin Required in in Supernatant
Milliliters (ml) >180-.ltoreq.200 12.0 >160-.ltoreq.180 11.0
>140-.ltoreq.160 10.0 >120-.ltoreq.140 9.0
>100-.ltoreq.120 8.0 >80-.ltoreq.100 7.0 >60-.ltoreq.80
6.0 >40-.ltoreq.60 4.5 >20-.ltoreq.40 3.5 .ltoreq.20 2.0
[0116] Secure a clean Disposable Column and stopcock assembly to a
ring stand and clamp. Close the stopcock. [0117] Mix appropriate
amount of STREAMLINE Protein A beads by inverting the bottle
several times. Withdraw the required volume and place into the
Disposable Column. [0118] Wash the STREAMLINE Protein A beads with
10 ml of DI H.sub.2O. Open the stopcock and allow the DI H.sub.2O
to drain. Close the stopcock. Repeat with an additional 10 ml of DI
H.sub.2O. [0119] Wash the STREAMLINE Protein A beads with 10 ml of
Binding Buffer. Open the stopcock and allow the Binding Buffer to
drain. Close the stopcock. Repeat with an additional 10 ml of
Binding Buffer. [0120] Resuspend the STREAMLINE Protein A beads in
.about.10 ml of the Clarified Supernatant and Binding Buffer
solution (from the 4000 ml beaker) and transfer 15 the beads into
the 4000 ml beaker containing the Clarified Supernatant and Binding
Buffer solution. Repeat as required to transfer any remaining
beads. When completed, discard the column and stopcock. [0121]
Allow the mixture to mix vigorously at 2.degree. C. to 10C. for
approximately 18 hours. [0122] When mixing is complete, turn off
the stir plate and remove the "Antibody Binding" beaker with the
buffered supernatant and bead suspension back to the lab bench
area. Allow the STREAMLINE Protein A beads to settle to the bottom
of the beaker (approximately 5 minutes). [0123] Secure a clean
Disposable Column and stopcock assembly to a ring stand and clamp.
Close the stopcock. [0124] Label a clean, 250 ml bottle or suitable
container "Column Wash-Post Binding." [0125] Label a clean plastic
beaker "Supernatant-Post Binding." [0126] Decant the supernatant
from the 4000 ml beaker into the clean, labeled, 2 liter plastic
beaker, leaving the beads in the bottom of the 4000 ml beaker.
Cover the 2000 ml beaker containing the "Supernatant-Post Binding"
solution with clean plastic wrap and store at 2.degree. C. to
10.degree. C. [0127] Add approximately 15 ml of Binding Buffer into
the decanted 4000 ml "Antibody Binding" beaker. Resuspend the
STREAMLINE Protein A beads and transfer them to the column. Open
the stopcock and allow the Binding Buffer to drain into the "Column
Wash-Post binding" container. Close the stopcock when drained.
[0128] Transfer any remaining STREAMLINE Protein A beads in the
"Antibody Binding" beaker by adding additional Binding Buffer,
mixing, and transferring to the column as in the preceding steps.
Close the stopcock when drained.
[0129] Calculate the approximate amount of Binding Buffer needed to
wash the STREAMLINE Protein A beads in the column using the data in
Table 2. TABLE-US-00002 TABLE 2 Binding Buffer Volume for Column
Wash Volume of Binding Quantity IgG (.mu.g/ml) Buffer Required in
in Supernatant Milliliters (ml) >180-.ltoreq.200 5 column washes
total with 15.0 ml each >160-.ltoreq.180 5 column washes total
with 15.0 ml each >140-.ltoreq.160 5 column washes total with
12.5 ml each >120-.ltoreq.140 5 column washes total with 12.5 ml
each >100-.ltoreq.120 5 column washes total with 12.5 ml each
>80-.ltoreq.100 5 column washes total with 10.0 ml each
>60-.ltoreq.80 5 column washes total with 10.0 ml each
>40-.ltoreq.60 5 column washes total with 7.5 ml each
>20-.ltoreq.40 5 column washes total with 5.0 ml each .ltoreq.20
5 column washes total with 5.0 ml each
[0130] Wash the STREAMLINE Protein A beads in the column with the
appropriate volume of Binding Buffer for the appropriate number of
washes, continuing to collect the efluent into the "Column
Wash-Post Binding" container. [0131] When completed, close the
stopcock. Store the "Column Wash-Post Binding" container at
2.degree. C. to 10.degree. C.
[0132] Determine the Total Volumes of Elution Buffer and
Neutralization Buffer needed to elute the STREAMLINE Protein A
beads in the column from Table 3. TABLE-US-00003 TABLE 3
Determination of Amount of Elution Buffer and Neutralization Buffer
Volume of Volume of Quantity IgG Total Volume of Total Volume of
Elution Buffer Neutralization (.mu.g/ml) in Elution Buffer
Neutralization Required per Buffer Required per Supernatant
Required (ml) Buffer Required (ml) fraction (ml) fraction (ml)
>180-.ltoreq.200 72 7.2 12 1.2 >160-.ltoreq.180 66 6.6 11 1.1
>140-.ltoreq.160 60 6.0 10 1.0 >120-.ltoreq.140 54 5.4 9 0.9
>100-.ltoreq.120 48 4.8 8 0.8 >80-.ltoreq.100 42 4.2 7 0.7
>60-.ltoreq.80 36 3.6 6 0.6 >40-.ltoreq.60 27 2.7 4.5 0.45
>20-.ltoreq.40 21 2.1 3.5 0.35 .ltoreq.20 12 1.2 2 0.2
[0133] Label 9 sterile conical centrifuge tubes "Eluted Antibody",
Fraction # (1 through 9). [0134] Place the appropriate volume of
Neutralization Buffer required per fraction (as determined from
Table "C" above) into each of the 9 "Eluted Antibody" fraction
tubes and place securely under the column stopcock outlet. [0135]
Elute the STREAMLINE Protein A beads in the column fraction by
fraction with the appropriate volume of Elution Buffer required per
fraction (as determined from Table 3 above) while collecting the
eluate into each of the "Eluted Antibody" tubes containing
Neutralization Buffer. [0136] When the elutions are complete, mix
each "Eluted Antibody" fraction tube gently by swirling several
times. Remove approximately 50 .mu.l of fraction #3 and place on a
pH test paper strip to ensure that the eluate has been neutralized
to an approximate pH between 6.5 to 8.5. If required, add
additional Neutralizing Buffer or Elution Buffer as needed to bring
pH into range. [0137] When pH evaluation is completed, perform an
Absorbance Scan of a sample from each fraction at 280 nm-400 nm to
determine the approximate concentration of IgG in the eluate prior
to proceeding to the Dialysis Process. [0138] Accept fractions as
part of the Eluate Pool if the A280-A400 value is >0.200. [0139]
Reject fractions as part of the Eluate Pool if the A280-A400 value
is <0.200. [0140] Label a sterile conical centrifuge tube
"Eluted Antibody," "Eluate Pool," and combine all fractions that
were Accepted as part of the pool. [0141] Perform an Absorbance
Scan of a sample of the Eluate Pool to determine the approximate
concentration of IgG in the eluate prior to proceeding to the
Dialysis Process. [0142] Estimate the volume of the Eluate Pool and
calculate the approximate total mgs of IgG. [0143] Volume of Eluate
Pool: ______ mls.times.______ IgG mg/ml=______ Total mgs of IgG
Antibody Dialysis [0144] Remove the "Eluted Antibody" tube from
2.degree. C. to 10.degree. C.
[0145] Calculate the approximate length of Dialysis Tubing that
will be needed to dialyze the antibody eluate using the approximate
volume of eluate and the data in Table 4. TABLE-US-00004 TABLE 4
Calculation of Length of Dialysis Tubing Needed Approximate Length
Approximate Approximate Needed for Length Approximate Approximate
Volume/length Length Needed Head Space Sample plus Needed for Total
Length of Volume of Ratio of Dialysis for Eluent of 20% Headspace
Tie Off of Dialysis Tubing Eluent (ml) Tubing Sample (cm) (cm) (cm)
Tubing (cm) Needed (cm) 39.6 2 20 4 24 15 63 36.3 2 18 4 22 15 59
33.0 2 17 3 20 15 55 29.7 2 15 3 18 15 51 26.4 2 13 3 16 15 47 23.1
2 12 2 14 15 43 19.8 2 10 2 12 15 39 14.85 2 7 1 9 15 33 11.55 2 6
1 7 15 29 6.6 2 3 1 4 15 23
[0146] Cut the appropriate length of dialysis tubing required.
(Spectra/Por.RTM. 2 Regenerated Cellulose Membrane, 12,000-14,000
Dalton Molecular Weight Cutoff (MWCO), 16 mm Diameter, Spectrum
Laboratories Inc., Cat. No. 132678) [0147] Hydrate the dialysis
membrane tubing in 1000 ml of DIH.sub.2O for >30 minutes.
[0148] Calculate the approximate volume of Dialysis Buffer needed
to dialyze the antibody eluate using the data in Table 5.
TABLE-US-00005 TABLE 5 Volume of Dialysis Buffer Required Length of
Quantity IgG Final Volume of Dialysis Volume of Dialysis (.mu.g/ml)
in Eluted Antibody in Tubing Needed Buffer (1 .times. PBS)
Supernatant Milliliters (ml) (cm) Needed in Liters
>180-.ltoreq.200 39.6 ml 63 cm 3 complete changes of 4.0 Liters
>160-.ltoreq.180 36.3 ml 59 cm 3 complete changes of 3.6 Liters
>140-.ltoreq.160 33.0 ml 55 cm 3 complete changes of 3.3 Liters
>120-.ltoreq.140 29.7 ml 51 cm 3 complete changes of 3.0 Liters
>100-.ltoreq.120 26.4 ml 47 cm 3 complete changes of 2.6 Liters
>80-.ltoreq.100 23.1 ml 43 cm 3 complete changes of 2.3 Liters
>60-.ltoreq.80 19.8 ml 39 cm 3 complete changes of 1.9 Liters
>40-.ltoreq.60 14.85 ml 33 cm 3 complete changes of 1.5 Liters
>20-.ltoreq.40 11.55 ml 29 cm 3 complete changes of 1.2 Liters
.ltoreq.20 6.6 ml 23 cm 3 complete changes of 0.7 Liters
[0149] Place the appropriate amount of Dialysis Buffer into a
suitable sized plastic beaker. Label the beaker "Dialyzed
Antibody." Add a clean stir bar and place the beaker on a stir
plate inside a refrigerator or cold room at 2.degree. C. to
10.degree. C. [0150] Rinse the dialysis tubing thoroughly in
DI-H.sub.2O. Tie two end knots approximately 7 cm from one end of
the dialysis tubing and secure tightly. [0151] Add approximately 5
ml of DI-H.sub.2O into the dialysis tubing. [0152] Fill the
dialysis tubing with the eluted antibody from the "Eluted Antibody"
collection tube. [0153] Tie two end knots approximately 7 cm from
the remaining open end of the dialysis tubing and secure tightly.
Ensure that the headspace is approximately that as derived from
Table 4. [0154] Place the filled and closed dialysis tubing into
the dialysis reservoir with the appropriate volume of 1.times. PBS
(from Table 5). [0155] Cover the beaker with clean plastic wrap.
Adjust the speed on the stir plate such that the dialysis sample
spins freely, but is not pulled down into the vortex of the
dialysate. Dialysis should take place at 2.degree. C. to 10.degree.
C. with 3 buffer exchanges in total within a 24 hour period.
Antibody Filtration [0156] Label a sterile collection tube
"Dialyzed Antibody." [0157] Remove the dialyzed sample tubing from
the dialysis beaker. Cut the dialysis tubing open at one end and
transfer the dialyzed sample into the "Dialyzed Antibody"
centrifuge tube. [0158] Label another sterile collection tube
"Dialyzed Antibody." [0159] Select a sterile Luer Lok syringe with
adequate capacity to hold the final dialyszed volume. [0160] Attach
an Acrodisc.RTM. Syringe Filter to the opening of the syringe (0.2
.mu.m HT Tuffryn.RTM. Membrane, Low Protein binding, Gelman
Laboratories, Cat. No. 4192). Remove the plunger from the syringe
and while holding the syringe upright, transfer the dialyszed
monoclonal antibody from the "Dialyzed Antibody" tube into the
syringe. Replace the plunger. [0161] Hold the Acrodisc.RTM. Syringe
Filter over the opened, sterile, labeled "Purified Antibody"
collection tube, and depress the syringe plunger to filter the
purified antibody into the "Purified Antibody" tube. [0162] When
filtration is complete, cap the "Purified Antibody" tube and store
at 2.degree. C. to 10.degree. C. [0163] Determine concentration of
purified monoclonal antibody using A280 procedure.
Example 3
[0163] General Method for Epitope Mapping
General Approach
[0164] Epitope mapping is performed to identify the linear amino
acid sequence within an antigenic protein (i.e., the epitope) that
is recognized by a particular monoclonal antibody. A general
approach for epitope mapping requires the expression of the
full-length protein, as well as various fragments (i.e., truncated
forms) of the protein, generally in a heterologous expression
system. These various recombinant proteins are then used to
determine if the specific monoclonal antibody is capable of binding
one or more of the truncated forms of the target protein. Through
the use of reiterative truncation and the generation of recombinant
proteins with overlapping amino acid regions, it is possible to
identify the region that is recognized by the monoclonal antibody
under investigation. Western blot analysis or ELISA is employed to
determine if the specific monoclonal antibody under investigation
is capable of binding one or more of the recombinant protein
fragments. This approach can ultimately identify the peptide
regions that contains the epitope and, in some cases, to refine the
epitope precisely to an 8-11 amino acid sequence.
Construct Design and Creation
[0165] The first step in epitope mapping is the design of nested
gene truncations. Frequently, the gene is divided into four equal
parts for further analysis.
Gene Cloning Strategy
[0166] The general cloning strategy begins with PCR-based
generation of the cloned gene fragments. In order to efficiently
express the cloned fragment, especially when using small amino acid
regions, the cloned fragment is expressed as a fusion protein, i.e.
fused to another carrier protein that is stably expressed in the
system. Green fluorescent protein (GFP) is frequently used as the
carrier protein. GFP is included as a fusion partner to stabilize
the truncation fragments and improve expression during the
subsequent in vitro protein expression step. GFP also permits the
tracking of fusion-protein expression using anti-GFP
antibodies.
[0167] Cloning to create the GFP-protein construct is performed
using either the mega-priming approach or through the use of
plasmid cloning into the pScreen-GFP vector. Generally, the
truncation fragments are fused to GFP and control sequences
necessary for protein expression using a technique called
megapriming.
[0168] Megapriming is the joining of two or more DNA fragments by
annealing homologous regions at the end of the respective fragments
and extending the annealed single-stranded DNA with a thermostable
DNA polymerase. This process creates one large DNA fragment from
two or more smaller fragments, linking them by their shared
sequence. This large fragment is then amplified using standard
PCR.
[0169] If megapriming cannot be used successfully, the truncation
fragments can be cloned into a plasmid containing GFP and
protein-expression control sequences. This cloning creates the
GFP/fragment fusions necessary for epitope mapping. The remainder
of the protocol can then proceed as described below.
Protein Expression
[0170] The expression constructs created by, for example,
megapriming are then introduced into the Rapid Translation System
(RTS). RTS is a cell-free protein expression system derived from E.
coli lysates. This system permits rapid (3-4 hour) expression of
proteins from DNA templates.
[0171] If RTS does not produce adequate levels of protein
expression, then the truncation fragments will be cloned into the
GFP protein-expression plasmid. These fusion plasmids are then
transformed into an E. coli strain optimized for protein
expression. Protein expression is induced in a growing culture of
bacteria and, following outgrowth, the cells are lysed. The
proteins in the complex cell lysate are then separated by
polyacrylamide gel electrophoresis (PAGE), and the remainder of the
protocol is the same as below.
Protein Detection and Epitope Mapping
[0172] Protein fragments produced by RTS are separated using PAGE
and transferred onto nitrocellulose membranes. The membrane-bound
proteins are then exposed to the antibody under investigation in
solution. Antibody/protein binding is identified using colorimetric
techniques known in the art.
[0173] Antibody binding of the full-length protein and some subset
of the truncated protein fragments constitutes a positive result.
If the absence of a particular section of the protein eliminates
antibody binding, then the epitope lies on this fragment.
[0174] If the antibody to be mapped does not recognize protein
bound to nitrocellulose membranes, then alternative methods for
detecting antibody/protein interactions, such as, for example,
ELISA or immunoprecipitation are used. Methods for detecting
antibody/protein interactions are well known in the art.
Refining the Epitope Location
[0175] Since the above-described protocol will only narrow the
location of the epitope down to approximately one-quarter of the
protein, it is necessary to repeat the process on the quarter of
the protein determined to contain the epitope in order to further
resolve the location of the epitope. For a very large protein, it
may be necessary to repeat this process two to three times to
narrow the epitope down to 8-15 amino acids.
Example 4
Characterization of Epitopes for MCM2 Monoclonal Antibodies 27C5.6
and 26H6.19
[0176] Epitope mapping for MCM2 Monoclonal Antibodies 27C5.6 and
26H6.19 was carried out essentially as described in Example 3.
Specifically, PCR was used to create MCM2 gene truncations,
followed by RTS to generate recombinant MCM2 protein fragments, and
finally western blotting to detect antibody binding to MCM2. GFP
was joined with the MCM2 gene truncations in a second round of PCR
to ensure robust and stable expression in RTS.
[0177] The full-length coding sequence for MCM2 (SEQ ID NO:2;
NM.sub.--004526) has a size of 2715 bp. However, the cDNA that was
used to express the recombinant MCM2 protein and that was used to
immunize mice during the production of MCM2 antibodies had a gene
size of 2688 bp (SEQ ID NO:5). The truncated MCM2 cDNA used had a
27 bp region missing at the 5' end of the MCM2 protein,
specifically the fragment ATGGCGGAATCATCGGAATCCTTCACC (SEQ ID
NO:6). The following sequential steps were carried out in order to
epitope map the MCM2-27C5.6 antibody:
[0178] Since the MCM2 gene was large (>1000 bp) and to minimize
the number of iterations of PCR needed, the gene was equally
divided into six regions [1-6] of approximately 400 bp. Overlapping
sequences, which contain homologous sequence to permit mega priming
during a second PCR cycle and restriction sites for a second option
of sub-cloning into pScreen-GFP plasmid, were added to the gene of
interest during the first PCR. The first round of PCR created
fragments of the truncated MCM2 nucleotide sequence (SEQ ID NO:5)
including: region [1] was 1-426 bp, region [1-2] was 1-888 bp,
region [1-3] was 1-1377 bp, region [1-4] was 1-1845 bp, region
[1-5] was 1-2241 bp, region [1-6] was 1-2688 bp, and finally region
[2-6] was 427-2688 bp. Individual regions (example region [5]) were
not expressed to avoid missing epitopes that were present in
junction sequence between regions.
[0179] The first round PCR products of MCM2 were subcloned into
pSCREEN-GFP (BamH1-Xho1), as the fragment sizes were too large for
mega-priming. The only truncation that was unsuccessful was the
full length region [1-6]. The original primers used to amplify the
full-length gene and truncations were engineered to include
restriction sites (5' end BAMH1; 3' end XHO1) to allow direct
subdloning into pSCREEN-GFP.
[0180] The GFP-gene fusions created were used as a template for
protein production in the RTS reaction using the RTS 100 E. coli HY
kit from Roche. The protein products from RTS were acetone
precipitated, loaded directly onto a denaturing polyacrylimide gel,
and analyzed by western blotting. The western blot was probed
directly with the 27C5.6 monoclonal antibody and GFP
antibodies.
[0181] The first round of RTS products were probed with both GFP
antibodies and the MCM2 monoclonal antibody 27C5.6. A positive band
was detected in region [1-3]. The above process was repeated using
the fragment encompassed by region [1-3] as the starting
sequence.
[0182] A second round of RTS produced a positive result for the
27C5.6 antibody in the region MCM2-3Q3
(CQSAGPFEVNMEETIYQNYQRIRIQESP (SEQ ID NO:7); corresponding to amino
acid residues 355 to 382 of SEQ ID NO:1). The above process was
repeated using the fragment encompassed by region MCM2-3Q3 as the
starting sequence.
[0183] A third round of RTS produced a positive result for the
27C5.6 antibody in the region MCM2-3Q3.2 (IYQNYQRIRIQESP (SEQ ID
NO:3); corresponding to amino acid residues 369 to 382 of SEQ ID
NO:1). No positive result was obtained in region MCM2-3Q3.1
(CQSAGPFEVNMEET (SEQ ID NO:8); corresponding to amino acid residues
355 to 368 of SEQ ID NO:1) or in MCM2-3Q3.2 (EVNMEETIYQNYQR (SEQ ID
NO:9); corresponding to amino acid residues 362 to 375 of SEQ ID
NO:1).
Results
[0184] Initial results showed that the epitope for the MCM2
monoclonal antibody 27C5.6 is located within the N-terminal region
of the MCM2 protein. Continued truncations of the MCM2 protein
showed that the epitope recognized by 27C5.6 is located within a
fourteen amino acid region, specifically corresponding to amino
acid residues 369-382 of SEQ ID NO:1 (IYQNYQRIRIQESP (SEQ ID
NO:3)). Additional rounds of RTS may be able to refine the epitope
location further.
[0185] The identical process described above was used to identify
the epitope for MCM2 monoclonal antibody 26H6.19. Initial results
indicated that the epitope was located within the C-terminal region
of the MCM2 protein. The epitope was preliminarily defined to a
twenty-three amino acid region, specifically corresponding to amino
acid residues 688-710 of SEQ ID NO:1 (PSNKEEEGLANGSAAEPAMPNTY (SEQ
ID NO:4)). Further analysis refined the epitope of MCM2 monoclonal
antibody 26H6.19 to a ten amino acid region comprising amino acid
residues 683-692 of SEQ ID NO:1 (HVRHHPSNKE (SEQ ID NO:14)).
Sequence CWU 1
1
14 1 904 PRT Homo sapiens 1 Met Ala Glu Ser Ser Glu Ser Phe Thr Met
Ala Ser Ser Pro Ala Gln 1 5 10 15 Arg Arg Arg Gly Asn Asp Pro Leu
Thr Ser Ser Pro Gly Arg Ser Ser 20 25 30 Arg Arg Thr Asp Ala Leu
Thr Ser Ser Pro Gly Arg Asp Leu Pro Pro 35 40 45 Phe Glu Asp Glu
Ser Glu Gly Leu Leu Gly Thr Glu Gly Pro Leu Glu 50 55 60 Glu Glu
Glu Asp Gly Glu Glu Leu Ile Gly Asp Gly Met Glu Arg Asp 65 70 75 80
Tyr Arg Ala Ile Pro Glu Leu Asp Ala Tyr Glu Ala Glu Gly Leu Ala 85
90 95 Leu Asp Asp Glu Asp Val Glu Glu Leu Thr Ala Ser Gln Arg Glu
Ala 100 105 110 Ala Glu Arg Ala Met Arg Gln Arg Asp Arg Glu Ala Gly
Arg Gly Leu 115 120 125 Gly Arg Met Arg Arg Gly Leu Leu Tyr Asp Ser
Asp Glu Glu Asp Glu 130 135 140 Glu Arg Pro Ala Arg Lys Arg Arg Gln
Val Glu Arg Ala Thr Glu Asp 145 150 155 160 Gly Glu Glu Asp Glu Glu
Met Ile Glu Ser Ile Glu Asn Leu Glu Asp 165 170 175 Leu Lys Gly His
Ser Val Arg Glu Trp Val Ser Met Ala Gly Pro Arg 180 185 190 Leu Glu
Ile His His Arg Phe Lys Asn Phe Leu Arg Thr His Val Asp 195 200 205
Ser His Gly His Asn Val Phe Lys Glu Arg Ile Ser Asp Met Cys Lys 210
215 220 Glu Asn Arg Glu Ser Leu Val Val Asn Tyr Glu Asp Leu Ala Ala
Arg 225 230 235 240 Glu His Val Leu Ala Tyr Phe Leu Pro Glu Ala Pro
Ala Glu Leu Leu 245 250 255 Gln Ile Phe Asp Glu Ala Ala Leu Glu Val
Val Leu Ala Met Tyr Pro 260 265 270 Lys Tyr Asp Arg Ile Thr Asn His
Ile His Val Arg Ile Ser His Leu 275 280 285 Pro Leu Val Glu Glu Leu
Arg Ser Leu Arg Gln Leu His Leu Asn Gln 290 295 300 Leu Ile Arg Thr
Ser Gly Val Val Thr Ser Cys Thr Gly Val Leu Pro 305 310 315 320 Gln
Leu Ser Met Val Lys Tyr Asn Cys Asn Lys Cys Asn Phe Val Leu 325 330
335 Gly Pro Phe Cys Gln Ser Gln Asn Gln Glu Val Lys Pro Gly Ser Cys
340 345 350 Pro Glu Cys Gln Ser Ala Gly Pro Phe Glu Val Asn Met Glu
Glu Thr 355 360 365 Ile Tyr Gln Asn Tyr Gln Arg Ile Arg Ile Gln Glu
Ser Pro Gly Lys 370 375 380 Val Ala Ala Gly Arg Leu Pro Arg Ser Lys
Asp Ala Ile Leu Leu Ala 385 390 395 400 Asp Leu Val Asp Ser Cys Lys
Pro Gly Asp Glu Ile Glu Leu Thr Gly 405 410 415 Ile Tyr His Asn Asn
Tyr Asp Gly Ser Leu Asn Thr Ala Asn Gly Phe 420 425 430 Pro Val Phe
Ala Thr Val Ile Leu Ala Asn His Val Ala Lys Lys Asp 435 440 445 Asn
Lys Val Ala Val Gly Glu Leu Thr Asp Glu Asp Val Lys Met Ile 450 455
460 Thr Ser Leu Ser Lys Asp Gln Gln Ile Gly Glu Lys Ile Phe Ala Ser
465 470 475 480 Ile Ala Pro Ser Ile Tyr Gly His Glu Asp Ile Lys Arg
Gly Leu Ala 485 490 495 Leu Ala Leu Phe Gly Gly Glu Pro Lys Asn Pro
Gly Gly Lys His Lys 500 505 510 Val Arg Gly Asp Ile Asn Val Leu Leu
Cys Gly Asp Pro Gly Thr Ala 515 520 525 Lys Ser Gln Phe Leu Lys Tyr
Ile Glu Lys Val Ser Ser Arg Ala Ile 530 535 540 Phe Thr Thr Gly Gln
Gly Ala Ser Ala Val Gly Leu Thr Ala Tyr Val 545 550 555 560 Gln Arg
His Pro Val Ser Arg Glu Trp Thr Leu Glu Ala Gly Ala Leu 565 570 575
Val Leu Ala Asp Arg Gly Val Cys Leu Ile Asp Glu Phe Asp Lys Met 580
585 590 Asn Asp Gln Asp Arg Thr Ser Ile His Glu Ala Met Glu Gln Gln
Ser 595 600 605 Ile Ser Ile Ser Lys Ala Gly Ile Val Thr Ser Leu Gln
Ala Arg Cys 610 615 620 Thr Val Ile Ala Ala Ala Asn Pro Ile Gly Gly
Arg Tyr Asp Pro Ser 625 630 635 640 Leu Thr Phe Ser Glu Asn Val Asp
Leu Thr Glu Pro Ile Ile Ser Arg 645 650 655 Phe Asp Ile Leu Cys Val
Val Arg Asp Thr Val Asp Pro Val Gln Asp 660 665 670 Glu Met Leu Ala
Arg Phe Val Val Gly Ser His Val Arg His His Pro 675 680 685 Ser Asn
Lys Glu Glu Glu Gly Leu Ala Asn Gly Ser Ala Ala Glu Pro 690 695 700
Ala Met Pro Asn Thr Tyr Gly Val Glu Pro Leu Pro Gln Glu Val Leu 705
710 715 720 Lys Lys Tyr Ile Ile Tyr Ala Lys Glu Arg Val His Pro Lys
Leu Asn 725 730 735 Gln Met Asp Gln Asp Lys Val Ala Lys Met Tyr Ser
Asp Leu Arg Lys 740 745 750 Glu Ser Met Ala Thr Gly Ser Ile Pro Ile
Thr Val Arg His Ile Glu 755 760 765 Ser Met Ile Arg Met Ala Glu Ala
His Ala Arg Ile His Leu Arg Asp 770 775 780 Tyr Val Ile Glu Asp Asp
Val Asn Met Ala Ile Arg Val Met Leu Glu 785 790 795 800 Ser Phe Ile
Asp Thr Gln Lys Phe Ser Val Met Arg Ser Met Arg Lys 805 810 815 Thr
Phe Ala Arg Tyr Leu Ser Phe Arg Arg Asp Asn Asn Glu Leu Leu 820 825
830 Leu Phe Ile Leu Lys Gln Leu Val Ala Glu Gln Val Thr Tyr Gln Arg
835 840 845 Asn Arg Phe Gly Ala Gln Gln Asp Thr Ile Glu Val Pro Glu
Lys Asp 850 855 860 Leu Val Asp Lys Ala Arg Gln Ile Asn Ile His Asn
Leu Ser Ala Phe 865 870 875 880 Tyr Asp Ser Glu Leu Phe Arg Met Asn
Lys Phe Ser His Asp Leu Lys 885 890 895 Arg Lys Met Ile Leu Gln Gln
Phe 900 2 3453 DNA Homo sapiens CDS (58)...(2772) 2 acttttcgcg
cgaaacctgg ttgttgctgt agtggcggag aggatcgtgg tactgct atg 60 Met 1
gcg gaa tca tcg gaa tcc ttc acc atg gca tcc agc ccg gcc cag cgt 108
Ala Glu Ser Ser Glu Ser Phe Thr Met Ala Ser Ser Pro Ala Gln Arg 5
10 15 cgg cga ggc aat gat cct ctc acc tcc agc cct ggc cga agc tcc
cgg 156 Arg Arg Gly Asn Asp Pro Leu Thr Ser Ser Pro Gly Arg Ser Ser
Arg 20 25 30 cgt act gat gcc ctc acc tcc agc cct ggc cgt gac ctt
cca cca ttt 204 Arg Thr Asp Ala Leu Thr Ser Ser Pro Gly Arg Asp Leu
Pro Pro Phe 35 40 45 gag gat gag tcc gag ggg ctc cta ggc aca gag
ggg ccc ctg gag gaa 252 Glu Asp Glu Ser Glu Gly Leu Leu Gly Thr Glu
Gly Pro Leu Glu Glu 50 55 60 65 gaa gag gat gga gag gag ctc att gga
gat ggc atg gaa agg gac tac 300 Glu Glu Asp Gly Glu Glu Leu Ile Gly
Asp Gly Met Glu Arg Asp Tyr 70 75 80 cgc gcc atc cca gag ctg gac
gcc tat gag gcc gag gga ctg gct ctg 348 Arg Ala Ile Pro Glu Leu Asp
Ala Tyr Glu Ala Glu Gly Leu Ala Leu 85 90 95 gat gat gag gac gta
gag gag ctg acg gcc agt cag agg gag gca gca 396 Asp Asp Glu Asp Val
Glu Glu Leu Thr Ala Ser Gln Arg Glu Ala Ala 100 105 110 gag cgg gcc
atg cgg cag cgt gac cgg gag gct ggc cgg ggc ctg ggc 444 Glu Arg Ala
Met Arg Gln Arg Asp Arg Glu Ala Gly Arg Gly Leu Gly 115 120 125 cgc
atg cgc cgt ggg ctc ctg tat gac agc gat gag gag gac gag gag 492 Arg
Met Arg Arg Gly Leu Leu Tyr Asp Ser Asp Glu Glu Asp Glu Glu 130 135
140 145 cgc cct gcc cgc aag cgc cgc cag gtg gag cgg gcc acg gag gac
ggc 540 Arg Pro Ala Arg Lys Arg Arg Gln Val Glu Arg Ala Thr Glu Asp
Gly 150 155 160 gag gag gac gag gag atg atc gag agc atc gag aac ctg
gag gat ctc 588 Glu Glu Asp Glu Glu Met Ile Glu Ser Ile Glu Asn Leu
Glu Asp Leu 165 170 175 aaa ggc cac tct gtg cgc gag tgg gtg agc atg
gcg ggc ccc cgg ctg 636 Lys Gly His Ser Val Arg Glu Trp Val Ser Met
Ala Gly Pro Arg Leu 180 185 190 gag atc cac cac cgc ttc aag aac ttc
ctg cgc act cac gtc gac agc 684 Glu Ile His His Arg Phe Lys Asn Phe
Leu Arg Thr His Val Asp Ser 195 200 205 cac ggc cac aac gtc ttc aag
gag cgc atc agc gac atg tgc aaa gag 732 His Gly His Asn Val Phe Lys
Glu Arg Ile Ser Asp Met Cys Lys Glu 210 215 220 225 aac cgt gag agc
ctg gtg gtg aac tat gag gac ttg gca gcc agg gag 780 Asn Arg Glu Ser
Leu Val Val Asn Tyr Glu Asp Leu Ala Ala Arg Glu 230 235 240 cac gtg
ctg gcc tac ttc ctg cct gag gca ccg gcg gag ctg ctg cag 828 His Val
Leu Ala Tyr Phe Leu Pro Glu Ala Pro Ala Glu Leu Leu Gln 245 250 255
atc ttt gat gag gct gcc ctg gag gtg gta ctg gcc atg tac ccc aag 876
Ile Phe Asp Glu Ala Ala Leu Glu Val Val Leu Ala Met Tyr Pro Lys 260
265 270 tac gac cgc atc acc aac cac atc cat gtc cgc atc tcc cac ctg
cct 924 Tyr Asp Arg Ile Thr Asn His Ile His Val Arg Ile Ser His Leu
Pro 275 280 285 ctg gtg gag gag ctg cgc tcg ctg agg cag ctg cat ctg
aac cag ctg 972 Leu Val Glu Glu Leu Arg Ser Leu Arg Gln Leu His Leu
Asn Gln Leu 290 295 300 305 atc cgc acc agt ggg gtg gtg acc agc tgc
act ggc gtc ctg ccc cag 1020 Ile Arg Thr Ser Gly Val Val Thr Ser
Cys Thr Gly Val Leu Pro Gln 310 315 320 ctc agc atg gtc aag tac aac
tgc aac aag tgc aat ttc gtc ctg ggt 1068 Leu Ser Met Val Lys Tyr
Asn Cys Asn Lys Cys Asn Phe Val Leu Gly 325 330 335 cct ttc tgc cag
tcc cag aac cag gag gtg aaa cca ggc tcc tgt cct 1116 Pro Phe Cys
Gln Ser Gln Asn Gln Glu Val Lys Pro Gly Ser Cys Pro 340 345 350 gag
tgc cag tcg gcc ggc ccc ttt gag gtc aac atg gag gag acc atc 1164
Glu Cys Gln Ser Ala Gly Pro Phe Glu Val Asn Met Glu Glu Thr Ile 355
360 365 tat cag aac tac cag cgt atc cga atc cag gag agt cca ggc aaa
gtg 1212 Tyr Gln Asn Tyr Gln Arg Ile Arg Ile Gln Glu Ser Pro Gly
Lys Val 370 375 380 385 gcg gct ggc cgg ctg ccc cgc tcc aag gac gcc
att ctc ctc gca gat 1260 Ala Ala Gly Arg Leu Pro Arg Ser Lys Asp
Ala Ile Leu Leu Ala Asp 390 395 400 ctg gtg gac agc tgc aag cca gga
gac gag ata gag ctg act ggc atc 1308 Leu Val Asp Ser Cys Lys Pro
Gly Asp Glu Ile Glu Leu Thr Gly Ile 405 410 415 tat cac aac aac tat
gat ggc tcc ctc aac act gcc aat ggc ttc cct 1356 Tyr His Asn Asn
Tyr Asp Gly Ser Leu Asn Thr Ala Asn Gly Phe Pro 420 425 430 gtc ttt
gcc act gtc atc cta gcc aac cac gtg gcc aag aag gac aac 1404 Val
Phe Ala Thr Val Ile Leu Ala Asn His Val Ala Lys Lys Asp Asn 435 440
445 aag gtt gct gta ggg gaa ctg acc gat gaa gat gtg aag atg atc act
1452 Lys Val Ala Val Gly Glu Leu Thr Asp Glu Asp Val Lys Met Ile
Thr 450 455 460 465 agc ctc tcc aag gat cag cag atc gga gag aag atc
ttt gcc agc att 1500 Ser Leu Ser Lys Asp Gln Gln Ile Gly Glu Lys
Ile Phe Ala Ser Ile 470 475 480 gct cct tcc atc tat ggt cat gaa gac
atc aag aga ggc ctg gct ctg 1548 Ala Pro Ser Ile Tyr Gly His Glu
Asp Ile Lys Arg Gly Leu Ala Leu 485 490 495 gcc ctg ttc gga ggg gag
ccc aaa aac cca ggt ggc aag cac aag gta 1596 Ala Leu Phe Gly Gly
Glu Pro Lys Asn Pro Gly Gly Lys His Lys Val 500 505 510 cgt ggt gat
atc aac gtg ctc ttg tgc gga gac cct ggc aca gcg aag 1644 Arg Gly
Asp Ile Asn Val Leu Leu Cys Gly Asp Pro Gly Thr Ala Lys 515 520 525
tcg cag ttt ctc aag tat att gag aaa gtg tcc agc cga gcc atc ttc
1692 Ser Gln Phe Leu Lys Tyr Ile Glu Lys Val Ser Ser Arg Ala Ile
Phe 530 535 540 545 acc act ggc cag ggg gcg tcg gct gtg ggc ctc acg
gcg tat gtc cag 1740 Thr Thr Gly Gln Gly Ala Ser Ala Val Gly Leu
Thr Ala Tyr Val Gln 550 555 560 cgg cac cct gtc agc agg gag tgg acc
ttg gag gct ggg gcc ctg gtt 1788 Arg His Pro Val Ser Arg Glu Trp
Thr Leu Glu Ala Gly Ala Leu Val 565 570 575 ctg gct gac cga gga gtg
tgt ctc att gat gaa ttt gac aag atg aat 1836 Leu Ala Asp Arg Gly
Val Cys Leu Ile Asp Glu Phe Asp Lys Met Asn 580 585 590 gac cag gac
aga acc agc atc cat gag gcc atg gag caa cag agc atc 1884 Asp Gln
Asp Arg Thr Ser Ile His Glu Ala Met Glu Gln Gln Ser Ile 595 600 605
tcc atc tcg aag gct ggc atc gtc acc tcc ctg cag gct cgc tgc acg
1932 Ser Ile Ser Lys Ala Gly Ile Val Thr Ser Leu Gln Ala Arg Cys
Thr 610 615 620 625 gtc att gct gcc gcc aac ccc ata gga ggg cgc tac
gac ccc tcg ctg 1980 Val Ile Ala Ala Ala Asn Pro Ile Gly Gly Arg
Tyr Asp Pro Ser Leu 630 635 640 act ttc tct gag aac gtg gac ctc aca
gag ccc atc atc tca cgc ttt 2028 Thr Phe Ser Glu Asn Val Asp Leu
Thr Glu Pro Ile Ile Ser Arg Phe 645 650 655 gac atc ctg tgt gtg gtg
agg gac acc gtg gac cca gtc cag gac gag 2076 Asp Ile Leu Cys Val
Val Arg Asp Thr Val Asp Pro Val Gln Asp Glu 660 665 670 atg ctg gcc
cgc ttc gtg gtg ggc agc cac gtc aga cac cac ccc agc 2124 Met Leu
Ala Arg Phe Val Val Gly Ser His Val Arg His His Pro Ser 675 680 685
aac aag gag gag gag ggg ctg gcc aat ggc agc gct gct gag ccc gcc
2172 Asn Lys Glu Glu Glu Gly Leu Ala Asn Gly Ser Ala Ala Glu Pro
Ala 690 695 700 705 atg ccc aac acg tat ggc gtg gag ccc ctg ccc cag
gag gtc ctg aag 2220 Met Pro Asn Thr Tyr Gly Val Glu Pro Leu Pro
Gln Glu Val Leu Lys 710 715 720 aag tac atc atc tac gcc aag gag agg
gtc cac ccg aag ctc aac cag 2268 Lys Tyr Ile Ile Tyr Ala Lys Glu
Arg Val His Pro Lys Leu Asn Gln 725 730 735 atg gac cag gac aag gtg
gcc aag atg tac agt gac ctg agg aaa gaa 2316 Met Asp Gln Asp Lys
Val Ala Lys Met Tyr Ser Asp Leu Arg Lys Glu 740 745 750 tct atg gcg
aca ggc agc atc ccc att acg gtg cgg cac atc gag tcc 2364 Ser Met
Ala Thr Gly Ser Ile Pro Ile Thr Val Arg His Ile Glu Ser 755 760 765
atg atc cgc atg gcg gag gcc cac gcg cgc atc cat ctg cgg gac tat
2412 Met Ile Arg Met Ala Glu Ala His Ala Arg Ile His Leu Arg Asp
Tyr 770 775 780 785 gtg atc gaa gac gac gtc aac atg gcc atc cgc gtg
atg ctg gag agc 2460 Val Ile Glu Asp Asp Val Asn Met Ala Ile Arg
Val Met Leu Glu Ser 790 795 800 ttc ata gac aca cag aag ttc agc gtc
atg cgc agc atg cgc aag act 2508 Phe Ile Asp Thr Gln Lys Phe Ser
Val Met Arg Ser Met Arg Lys Thr 805 810 815 ttt gcc cgc tac ctt tca
ttc cgg cgt gac aac aat gag ctg ttg ctc 2556 Phe Ala Arg Tyr Leu
Ser Phe Arg Arg Asp Asn Asn Glu Leu Leu Leu 820 825 830 ttc ata ctg
aag cag tta gtg gca gag cag gtg aca tat cag cgc aac 2604 Phe Ile
Leu Lys Gln Leu Val Ala Glu Gln Val Thr Tyr Gln Arg Asn 835 840 845
cgc ttt ggg gcc cag cag gac act att gag gtc cct gag aag gac ttg
2652 Arg Phe Gly Ala Gln Gln Asp Thr Ile Glu Val Pro Glu Lys Asp
Leu 850 855 860 865 gtg gat aag gct cgt cag atc aac atc cac aac ctc
tct gca ttt tat 2700 Val Asp Lys Ala Arg Gln Ile Asn Ile His Asn
Leu Ser Ala Phe Tyr 870 875 880 gac agt gag ctc ttc agg atg aac aag
ttc agc cac gac ctg aaa agg 2748 Asp Ser Glu Leu Phe Arg Met Asn
Lys Phe Ser His Asp Leu Lys Arg 885 890 895 aaa atg atc ctg cag cag
ttc tga ggccctatgc catccataag gattccttgg 2802 Lys Met Ile Leu Gln
Gln Phe * 900 gattctggtt tggggtggtc agtgccctct gtgctttatg
gacacaaaac cagagcactt 2862 gatgaactcg gggtactagg gtcagggctt
atagcaggat gtctggctgc acctggcatg 2922 actgtttgtt tctccaagcc
tgctttgtgc ttctcacctt tgggtgggat gccttgccag 2982 tgtgtcttac
ttggttgctg aacatcttgc cacctccgag tgctttgtct ccactcagta 3042
ccttggatca gagctgctga gttcaggatg cctgcgtgtg gtttaggtgt tagccttctt
3102 acatggatgt caggagagct
gctgccctct tggcgtgagt tgcgtattca ggctgctttt 3162 gctgcctttg
gccagagagc tggttgaaga tgtttgtaat cgttttcagt ctcctgcagg 3222
tttctgtgcc cctgtggtgg aagagggcac gacagtgcca gcgcagcgtt ctgggctcct
3282 cagtcgcagg ggtgggatgt gagtcatgcg gattatccac tcgccacagt
tatcagctgc 3342 cattgctccc tgtctgtttc cccactctct tatttgtgca
ttcggtttgg tttctgtagt 3402 tttaattttt aataaagttg aataaaatat
aaaaaaaaaa aaaaaaaaaa a 3453 3 14 PRT Artificial Sequence Amino
acid sequence for the MCM2 epitope of monoclonal antibody 27C5.6 3
Ile Tyr Gln Asn Tyr Gln Arg Ile Arg Ile Gln Glu Ser Pro 1 5 10 4 23
PRT Artificial Sequence Amino acid sequence for the MCM2 epitope of
monoclonal antibody 26H6.19 (preliminary) 4 Pro Ser Asn Lys Glu Glu
Glu Gly Leu Ala Asn Gly Ser Ala Ala Glu 1 5 10 15 Pro Ala Met Pro
Asn Thr Tyr 20 5 2688 DNA Artificial Sequence Nucleotide sequence
for truncated MCM2 gene CDS (1)...(2688) Truncated MCM2 gene
lacking 27 bp at 5' end 5 atg gca tcc agc ccg gcc cag cgt cgg cga
ggc aat gat cct ctc acc 48 Met Ala Ser Ser Pro Ala Gln Arg Arg Arg
Gly Asn Asp Pro Leu Thr 1 5 10 15 tcc agc cct ggc cga agc tcc cgg
cgt act gat gcc ctc acc tcc agc 96 Ser Ser Pro Gly Arg Ser Ser Arg
Arg Thr Asp Ala Leu Thr Ser Ser 20 25 30 cct ggc cgt gac ctt cca
cca ttt gag gat gag tcc gag ggg ctc cta 144 Pro Gly Arg Asp Leu Pro
Pro Phe Glu Asp Glu Ser Glu Gly Leu Leu 35 40 45 ggc aca gag ggg
ccc ctg gag gaa gaa gag gat gga gag gag ctc att 192 Gly Thr Glu Gly
Pro Leu Glu Glu Glu Glu Asp Gly Glu Glu Leu Ile 50 55 60 gga gat
ggc atg gaa agg gac tac cgc gcc atc cca gag ctg gac gcc 240 Gly Asp
Gly Met Glu Arg Asp Tyr Arg Ala Ile Pro Glu Leu Asp Ala 65 70 75 80
tat gag gcc gag gga ctg gct ctg gat gat gag gac gta gag gag ctg 288
Tyr Glu Ala Glu Gly Leu Ala Leu Asp Asp Glu Asp Val Glu Glu Leu 85
90 95 acg gcc agt cag agg gag gca gca gag cgg gcc atg cgg cag cgt
gac 336 Thr Ala Ser Gln Arg Glu Ala Ala Glu Arg Ala Met Arg Gln Arg
Asp 100 105 110 cgg gag gct ggc cgg ggc ctg ggc cgc atg cgc cgt ggg
ctc ctg tat 384 Arg Glu Ala Gly Arg Gly Leu Gly Arg Met Arg Arg Gly
Leu Leu Tyr 115 120 125 gac agc gat gag gag gac gag gag cgc cct gcc
cgc aag cgc cgc cag 432 Asp Ser Asp Glu Glu Asp Glu Glu Arg Pro Ala
Arg Lys Arg Arg Gln 130 135 140 gtg gag cgg gcc acg gag gac ggc gag
gag gac gag gag atg atc gag 480 Val Glu Arg Ala Thr Glu Asp Gly Glu
Glu Asp Glu Glu Met Ile Glu 145 150 155 160 agc atc gag aac ctg gag
gat ctc aaa ggc cac tct gtg cgc gag tgg 528 Ser Ile Glu Asn Leu Glu
Asp Leu Lys Gly His Ser Val Arg Glu Trp 165 170 175 gtg agc atg gcg
ggc ccc cgg ctg gag atc cac cac cgc ttc aag aac 576 Val Ser Met Ala
Gly Pro Arg Leu Glu Ile His His Arg Phe Lys Asn 180 185 190 ttc ctg
cgc act cac gtc gac agc cac ggc cac aac gtc ttc aag gag 624 Phe Leu
Arg Thr His Val Asp Ser His Gly His Asn Val Phe Lys Glu 195 200 205
cgc atc agc gac atg tgc aaa gag aac cgt gag agc ctg gtg gtg aac 672
Arg Ile Ser Asp Met Cys Lys Glu Asn Arg Glu Ser Leu Val Val Asn 210
215 220 tat gag gac ttg gca gcc agg gag cac gtg ctg gcc tac ttc ctg
cct 720 Tyr Glu Asp Leu Ala Ala Arg Glu His Val Leu Ala Tyr Phe Leu
Pro 225 230 235 240 gag gca ccg gcg gag ctg ctg cag atc ttt gat gag
gct gcc ctg gag 768 Glu Ala Pro Ala Glu Leu Leu Gln Ile Phe Asp Glu
Ala Ala Leu Glu 245 250 255 gtg gta ctg gcc atg tac ccc aag tac gac
cgc atc acc aac cac atc 816 Val Val Leu Ala Met Tyr Pro Lys Tyr Asp
Arg Ile Thr Asn His Ile 260 265 270 cat gtc cgc atc tcc cac ctg cct
ctg gtg gag gag ctg cgc tcg ctg 864 His Val Arg Ile Ser His Leu Pro
Leu Val Glu Glu Leu Arg Ser Leu 275 280 285 agg cag ctg cat ctg aac
cag ctg atc cgc acc agt ggg gtg gtg acc 912 Arg Gln Leu His Leu Asn
Gln Leu Ile Arg Thr Ser Gly Val Val Thr 290 295 300 agc tgc act ggc
gtc ctg ccc cag ctc agc atg gtc aag tac aac tgc 960 Ser Cys Thr Gly
Val Leu Pro Gln Leu Ser Met Val Lys Tyr Asn Cys 305 310 315 320 aac
aag tgc aat ttc gtc ctg ggt cct ttc tgc cag tcc cag aac cag 1008
Asn Lys Cys Asn Phe Val Leu Gly Pro Phe Cys Gln Ser Gln Asn Gln 325
330 335 gag gtg aaa cca ggc tcc tgt cct gag tgc cag tcg gcc ggc ccc
ttt 1056 Glu Val Lys Pro Gly Ser Cys Pro Glu Cys Gln Ser Ala Gly
Pro Phe 340 345 350 gag gtc aac atg gag gag acc atc tat cag aac tac
cag cgt atc cga 1104 Glu Val Asn Met Glu Glu Thr Ile Tyr Gln Asn
Tyr Gln Arg Ile Arg 355 360 365 atc cag gag agt cca ggc aaa gtg gcg
gct ggc cgg ctg ccc cgc tcc 1152 Ile Gln Glu Ser Pro Gly Lys Val
Ala Ala Gly Arg Leu Pro Arg Ser 370 375 380 aag gac gcc att ctc ctc
gca gat ctg gtg gac agc tgc aag cca gga 1200 Lys Asp Ala Ile Leu
Leu Ala Asp Leu Val Asp Ser Cys Lys Pro Gly 385 390 395 400 gac gag
ata gag ctg act ggc atc tat cac aac aac tat gat ggc tcc 1248 Asp
Glu Ile Glu Leu Thr Gly Ile Tyr His Asn Asn Tyr Asp Gly Ser 405 410
415 ctc aac act gcc aat ggc ttc cct gtc ttt gcc act gtc atc cta gcc
1296 Leu Asn Thr Ala Asn Gly Phe Pro Val Phe Ala Thr Val Ile Leu
Ala 420 425 430 aac cac gtg gcc aag aag gac aac aag gtt gct gta ggg
gaa ctg acc 1344 Asn His Val Ala Lys Lys Asp Asn Lys Val Ala Val
Gly Glu Leu Thr 435 440 445 gat gaa gat gtg aag atg atc act agc ctc
tcc aag gat cag cag atc 1392 Asp Glu Asp Val Lys Met Ile Thr Ser
Leu Ser Lys Asp Gln Gln Ile 450 455 460 gga gag aag atc ttt gcc agc
att gct cct tcc atc tat ggt cat gaa 1440 Gly Glu Lys Ile Phe Ala
Ser Ile Ala Pro Ser Ile Tyr Gly His Glu 465 470 475 480 gac atc aag
aga ggc ctg gct ctg gcc ctg ttc gga ggg gag ccc aaa 1488 Asp Ile
Lys Arg Gly Leu Ala Leu Ala Leu Phe Gly Gly Glu Pro Lys 485 490 495
aac cca ggt ggc aag cac aag gta cgt ggt gat atc aac gtg ctc ttg
1536 Asn Pro Gly Gly Lys His Lys Val Arg Gly Asp Ile Asn Val Leu
Leu 500 505 510 tgc gga gac cct ggc aca gcg aag tcg cag ttt ctc aag
tat att gag 1584 Cys Gly Asp Pro Gly Thr Ala Lys Ser Gln Phe Leu
Lys Tyr Ile Glu 515 520 525 aaa gtg tcc agc cga gcc atc ttc acc act
ggc cag ggg gcg tcg gct 1632 Lys Val Ser Ser Arg Ala Ile Phe Thr
Thr Gly Gln Gly Ala Ser Ala 530 535 540 gtg ggc ctc acg gcg tat gtc
cag cgg cac cct gtc agc agg gag tgg 1680 Val Gly Leu Thr Ala Tyr
Val Gln Arg His Pro Val Ser Arg Glu Trp 545 550 555 560 acc ttg gag
gct ggg gcc ctg gtt ctg gct gac cga gga gtg tgt ctc 1728 Thr Leu
Glu Ala Gly Ala Leu Val Leu Ala Asp Arg Gly Val Cys Leu 565 570 575
att gat gaa ttt gac aag atg aat gac cag gac aga acc agc atc cat
1776 Ile Asp Glu Phe Asp Lys Met Asn Asp Gln Asp Arg Thr Ser Ile
His 580 585 590 gag gcc atg gag caa cag agc atc tcc atc tcg aag gct
ggc atc gtc 1824 Glu Ala Met Glu Gln Gln Ser Ile Ser Ile Ser Lys
Ala Gly Ile Val 595 600 605 acc tcc ctg cag gct cgc tgc acg gtc att
gct gcc gcc aac ccc ata 1872 Thr Ser Leu Gln Ala Arg Cys Thr Val
Ile Ala Ala Ala Asn Pro Ile 610 615 620 gga ggg cgc tac gac ccc tcg
ctg act ttc tct gag aac gtg gac ctc 1920 Gly Gly Arg Tyr Asp Pro
Ser Leu Thr Phe Ser Glu Asn Val Asp Leu 625 630 635 640 aca gag ccc
atc atc tca cgc ttt gac atc ctg tgt gtg gtg agg gac 1968 Thr Glu
Pro Ile Ile Ser Arg Phe Asp Ile Leu Cys Val Val Arg Asp 645 650 655
acc gtg gac cca gtc cag gac gag atg ctg gcc cgc ttc gtg gtg ggc
2016 Thr Val Asp Pro Val Gln Asp Glu Met Leu Ala Arg Phe Val Val
Gly 660 665 670 agc cac gtc aga cac cac ccc agc aac aag gag gag gag
ggg ctg gcc 2064 Ser His Val Arg His His Pro Ser Asn Lys Glu Glu
Glu Gly Leu Ala 675 680 685 aat ggc agc gct gct gag ccc gcc atg ccc
aac acg tat ggc gtg gag 2112 Asn Gly Ser Ala Ala Glu Pro Ala Met
Pro Asn Thr Tyr Gly Val Glu 690 695 700 ccc ctg ccc cag gag gtc ctg
aag aag tac atc atc tac gcc aag gag 2160 Pro Leu Pro Gln Glu Val
Leu Lys Lys Tyr Ile Ile Tyr Ala Lys Glu 705 710 715 720 agg gtc cac
ccg aag ctc aac cag atg gac cag gac aag gtg gcc aag 2208 Arg Val
His Pro Lys Leu Asn Gln Met Asp Gln Asp Lys Val Ala Lys 725 730 735
atg tac agt gac ctg agg aaa gaa tct atg gcg aca ggc agc atc ccc
2256 Met Tyr Ser Asp Leu Arg Lys Glu Ser Met Ala Thr Gly Ser Ile
Pro 740 745 750 att acg gtg cgg cac atc gag tcc atg atc cgc atg gcg
gag gcc cac 2304 Ile Thr Val Arg His Ile Glu Ser Met Ile Arg Met
Ala Glu Ala His 755 760 765 gcg cgc atc cat ctg cgg gac tat gtg atc
gaa gac gac gtc aac atg 2352 Ala Arg Ile His Leu Arg Asp Tyr Val
Ile Glu Asp Asp Val Asn Met 770 775 780 gcc atc cgc gtg atg ctg gag
agc ttc ata gac aca cag aag ttc agc 2400 Ala Ile Arg Val Met Leu
Glu Ser Phe Ile Asp Thr Gln Lys Phe Ser 785 790 795 800 gtc atg cgc
agc atg cgc aag act ttt gcc cgc tac ctt tca ttc cgg 2448 Val Met
Arg Ser Met Arg Lys Thr Phe Ala Arg Tyr Leu Ser Phe Arg 805 810 815
cgt gac aac aat gag ctg ttg ctc ttc ata ctg aag cag tta gtg gca
2496 Arg Asp Asn Asn Glu Leu Leu Leu Phe Ile Leu Lys Gln Leu Val
Ala 820 825 830 gag cag gtg aca tat cag cgc aac cgc ttt ggg gcc cag
cag gac act 2544 Glu Gln Val Thr Tyr Gln Arg Asn Arg Phe Gly Ala
Gln Gln Asp Thr 835 840 845 att gag gtc cct gag aag gac ttg gtg gat
aag gct cgt cag atc aac 2592 Ile Glu Val Pro Glu Lys Asp Leu Val
Asp Lys Ala Arg Gln Ile Asn 850 855 860 atc cac aac ctc tct gca ttt
tat gac agt gag ctc ttc agg atg aac 2640 Ile His Asn Leu Ser Ala
Phe Tyr Asp Ser Glu Leu Phe Arg Met Asn 865 870 875 880 aag ttc agc
cac gac ctg aaa agg aaa atg atc ctg cag cag ttc tga 2688 Lys Phe
Ser His Asp Leu Lys Arg Lys Met Ile Leu Gln Gln Phe * 885 890 895 6
27 DNA Artificial Sequence 5' nucleotide sequence omitted from
truncated MCM2 nucleotide sequence 6 atggcggaat catcggaatc cttcacc
27 7 28 PRT Artificial Sequence MCM2 fragment corresponding to
amino acid residues 355 to 382 of SEQ ID NO1 7 Cys Gln Ser Ala Gly
Pro Phe Glu Val Asn Met Glu Glu Thr Ile Tyr 1 5 10 15 Gln Asn Tyr
Gln Arg Ile Arg Ile Gln Glu Ser Pro 20 25 8 14 PRT Artificial
Sequence MCM2 fragment corresponding to amino acid residues 355 to
368 of SEQ ID NO1 8 Cys Gln Ser Ala Gly Pro Phe Glu Val Asn Met Glu
Glu Thr 1 5 10 9 14 PRT Artificial Sequence MCM2 fragment
corresponding to amino acid residues 362 to 375 of SEQ ID NO1 9 Glu
Val Asn Met Glu Glu Thr Ile Tyr Gln Asn Tyr Gln Arg 1 5 10 10 2718
DNA Artificial Sequence Nucleotide sequence encoding the
hexa-histidine tagged MCM2 immunogenic polypeptide misc_feature
(2698)...(2715) Nucleotide sequence encoding hexa-histidine tag 10
atggcatcca gcccggccca gcgtcggcga ggcaatgatc ctctcacctc cagccctggc
60 cgaagctccc ggcgtactga tgccctcacc tccagccctg gccgtgacct
tccaccattt 120 gaggatgagt ccgaggggct cctaggcaca gaggggcccc
tggaggaaga agaggatgga 180 gaggagctca ttggagatgg catggaaagg
gactaccgcg ccatcccaga gctggacgcc 240 tatgaggccg agggactggc
tctggatgat gaggacgtag aggagctgac ggccagtcag 300 agggaggcag
cagagcgggc catgcggcag cgtgaccggg aggctggccg gggcctgggc 360
cgcatgcgcc gtgggctcct gtatgacagc gatgaggagg acgaggagcg ccctgcccgc
420 aagcgccgcc aggtggagcg ggccacggag gacggcgagg aggacgagga
gatgattgag 480 agcatcgaga acctggagga tctcaaaggc cactctgtgc
gcgagtgggt gagcatggcg 540 ggcccccggc tggagatcca ccaccgcttc
aagaacttcc tgcgcactca cgtcgacagc 600 cacggccaca acgtcttcaa
ggagcgcatc agcgacatgt gcaaagagaa ccgtgagagc 660 ctggtggtga
actatgagga cttggcagcc agggagcacg tgctggccta cttcctgcct 720
gaggcaccgg cggagctgct gcagatcttt gatgaggctg ccctggaggt ggtactggcc
780 atgtacccca agtacgaccg catcaccaac cacatccatg tccgcatctc
ccacctgcct 840 ctggtggagg agctgcgctc gctgaggcag ctgcatctga
accagctgat ccgcaccagt 900 ggggtggtga ccagctgcac tggcgtcctg
ccccagctca gcatggtcaa gtacaactgc 960 aacaagtgca atttcgtcct
gggtcctttc tgccagtccc agaaccagga ggtgaaacca 1020 ggctcctgtc
ctgagtgcca gtcggccggc ccctttgagg tcaacatgga ggagaccatc 1080
tatcagaact accagcgtat ccgaatccag gagagtccag gcaaagtggc ggctggccgg
1140 ctgccccgct ccaaggacgc cattctcctc gcagatctgg tggacagctg
caagccagga 1200 gacgagatag agctgactgg catctatcac aacaactatg
atggctccct caacactgcc 1260 aatggcttcc ctgtctttgc cactgtcatc
ctagccaacc acgtggccaa gaaggacaac 1320 aaggttgctg taggggaact
gaccgatgaa gatgtgaaga tgatcactag cctctccaag 1380 gatcagcaga
tcggagagaa gatctttgcc agcattgctc cttccatcta tggtcatgaa 1440
gacatcaaga gaggcctggc tctggccctg ttcggagggg agcccaaaaa cccaggtggc
1500 aagcacaagg tacgtggtga tatcaacgtg ctcttgtgcg gagaccctgg
cacagcgaag 1560 tcgcagtttc tcaagtatat tgagaaagtg tccagccgag
ccatcttcac cactggccag 1620 ggggcgtcgg ctgtgggcct cacggcgtat
gtccagcggc accctgtcag cagggagtgg 1680 accttggagg ctggggccct
ggttctggct gaccgaggag tgtgtctcat tgatgaattt 1740 gacaagatga
atgaccagga cagaaccagc atccatgagg ccatggagca acagagcatc 1800
tccatctcga aggctggcat cgtcacctcc ctgcaggctc gctgcacggt cattgctgcc
1860 gccaacccca taggagggcg ctacgacccc tcgctgactt tctctgagaa
cgtggacctc 1920 acagagccca tcatctcacg ctttgacatc ctgtgtgtgg
tgagggacac cgtggaccca 1980 gtccaggacg agatgctggc ccgcttcgtg
gtgggcagcc acgtcagaca ccaccccagc 2040 aacaaggagg aggaggggct
ggccaatggc agcgctgctg agcccgccat gcccaacacg 2100 tatggcgtgg
agcccctgcc ccaggaggtc ctgaagaagt acatcatcta cgccaaggag 2160
agggtccacc cgaagctcaa ccagatggac caggacaagg tggccaagat gtacagtgac
2220 ctgaggaaag aatctatggc gacaggcagc atccccatta cggtgcggca
catcgagtcc 2280 atgatccgca tggcggaggc ccacgcgcgc atccatctgc
gggactatgt gatcgaagac 2340 gacgtcaaca tggccatccg cgtgatgctg
gagagcttca tagacacaca gaagttcagc 2400 gtcatgcgca gcatgcgcaa
gacttttgcc cgctaccttt cattccggcg tgacaacaat 2460 gagctgttgc
tcttcatact gaagcagtta gtggcagagc aggtgacata tcagcgcaac 2520
cgctttgggg cccagcagga cactattgag gtccctgaga aggacttggt ggataaggct
2580 cgtcagatca acatccacaa cctctctgca ttttatgaca gtgagctctt
caggatgaac 2640 aagttcagcc acgacctgaa aaggaaaatg atcctgcagc
agttcctcga gggtggtcat 2700 catcatcatc atcattga 2718 11 905 PRT
Artificial Sequence Amino acid sequence for hexa-histidine tagged
MCM2 immunogenic polypeptide Hexa-histidine tag 11 Met Ala Ser Ser
Pro Ala Gln Arg Arg Arg Gly Asn Asp Pro Leu Thr 1 5 10 15 Ser Ser
Pro Gly Arg Ser Ser Arg Arg Thr Asp Ala Leu Thr Ser Ser 20 25 30
Pro Gly Arg Asp Leu Pro Pro Phe Glu Asp Glu Ser Glu Gly Leu Leu 35
40 45 Gly Thr Glu Gly Pro Leu Glu Glu Glu Glu Asp Gly Glu Glu Leu
Ile 50 55 60 Gly Asp Gly Met Glu Arg Asp Tyr Arg Ala Ile Pro Glu
Leu Asp Ala 65 70 75 80 Tyr Glu Ala Glu Gly Leu Ala Leu Asp Asp Glu
Asp Val Glu Glu Leu 85 90 95 Thr Ala Ser Gln Arg Glu Ala Ala Glu
Arg Ala Met Arg Gln Arg Asp 100 105 110 Arg Glu Ala Gly Arg Gly Leu
Gly Arg Met Arg Arg Gly Leu Leu Tyr 115 120 125 Asp Ser Asp Glu Glu
Asp Glu Glu Arg Pro Ala Arg Lys Arg Arg Gln 130 135 140 Val Glu Arg
Ala Thr Glu Asp Gly Glu Glu Asp Glu Glu Met Ile Glu 145 150 155 160
Ser Ile Glu Asn Leu Glu Asp Leu Lys Gly His Ser Val Arg Glu Trp 165
170 175 Val Ser Met Ala Gly Pro Arg Leu Glu Ile His His Arg Phe Lys
Asn 180 185 190 Phe Leu Arg Thr His Val Asp Ser His Gly His Asn Val
Phe Lys Glu 195 200 205 Arg Ile Ser Asp Met Cys Lys Glu Asn Arg Glu
Ser Leu Val Val Asn 210 215 220 Tyr Glu Asp Leu Ala Ala Arg Glu His
Val Leu Ala Tyr Phe Leu Pro 225 230 235 240 Glu Ala Pro Ala Glu Leu
Leu
Gln Ile Phe Asp Glu Ala Ala Leu Glu 245 250 255 Val Val Leu Ala Met
Tyr Pro Lys Tyr Asp Arg Ile Thr Asn His Ile 260 265 270 His Val Arg
Ile Ser His Leu Pro Leu Val Glu Glu Leu Arg Ser Leu 275 280 285 Arg
Gln Leu His Leu Asn Gln Leu Ile Arg Thr Ser Gly Val Val Thr 290 295
300 Ser Cys Thr Gly Val Leu Pro Gln Leu Ser Met Val Lys Tyr Asn Cys
305 310 315 320 Asn Lys Cys Asn Phe Val Leu Gly Pro Phe Cys Gln Ser
Gln Asn Gln 325 330 335 Glu Val Lys Pro Gly Ser Cys Pro Glu Cys Gln
Ser Ala Gly Pro Phe 340 345 350 Glu Val Asn Met Glu Glu Thr Ile Tyr
Gln Asn Tyr Gln Arg Ile Arg 355 360 365 Ile Gln Glu Ser Pro Gly Lys
Val Ala Ala Gly Arg Leu Pro Arg Ser 370 375 380 Lys Asp Ala Ile Leu
Leu Ala Asp Leu Val Asp Ser Cys Lys Pro Gly 385 390 395 400 Asp Glu
Ile Glu Leu Thr Gly Ile Tyr His Asn Asn Tyr Asp Gly Ser 405 410 415
Leu Asn Thr Ala Asn Gly Phe Pro Val Phe Ala Thr Val Ile Leu Ala 420
425 430 Asn His Val Ala Lys Lys Asp Asn Lys Val Ala Val Gly Glu Leu
Thr 435 440 445 Asp Glu Asp Val Lys Met Ile Thr Ser Leu Ser Lys Asp
Gln Gln Ile 450 455 460 Gly Glu Lys Ile Phe Ala Ser Ile Ala Pro Ser
Ile Tyr Gly His Glu 465 470 475 480 Asp Ile Lys Arg Gly Leu Ala Leu
Ala Leu Phe Gly Gly Glu Pro Lys 485 490 495 Asn Pro Gly Gly Lys His
Lys Val Arg Gly Asp Ile Asn Val Leu Leu 500 505 510 Cys Gly Asp Pro
Gly Thr Ala Lys Ser Gln Phe Leu Lys Tyr Ile Glu 515 520 525 Lys Val
Ser Ser Arg Ala Ile Phe Thr Thr Gly Gln Gly Ala Ser Ala 530 535 540
Val Gly Leu Thr Ala Tyr Val Gln Arg His Pro Val Ser Arg Glu Trp 545
550 555 560 Thr Leu Glu Ala Gly Ala Leu Val Leu Ala Asp Arg Gly Val
Cys Leu 565 570 575 Ile Asp Glu Phe Asp Lys Met Asn Asp Gln Asp Arg
Thr Ser Ile His 580 585 590 Glu Ala Met Glu Gln Gln Ser Ile Ser Ile
Ser Lys Ala Gly Ile Val 595 600 605 Thr Ser Leu Gln Ala Arg Cys Thr
Val Ile Ala Ala Ala Asn Pro Ile 610 615 620 Gly Gly Arg Tyr Asp Pro
Ser Leu Thr Phe Ser Glu Asn Val Asp Leu 625 630 635 640 Thr Glu Pro
Ile Ile Ser Arg Phe Asp Ile Leu Cys Val Val Arg Asp 645 650 655 Thr
Val Asp Pro Val Gln Asp Glu Met Leu Ala Arg Phe Val Val Gly 660 665
670 Ser His Val Arg His His Pro Ser Asn Lys Glu Glu Glu Gly Leu Ala
675 680 685 Asn Gly Ser Ala Ala Glu Pro Ala Met Pro Asn Thr Tyr Gly
Val Glu 690 695 700 Pro Leu Pro Gln Glu Val Leu Lys Lys Tyr Ile Ile
Tyr Ala Lys Glu 705 710 715 720 Arg Val His Pro Lys Leu Asn Gln Met
Asp Gln Asp Lys Val Ala Lys 725 730 735 Met Tyr Ser Asp Leu Arg Lys
Glu Ser Met Ala Thr Gly Ser Ile Pro 740 745 750 Ile Thr Val Arg His
Ile Glu Ser Met Ile Arg Met Ala Glu Ala His 755 760 765 Ala Arg Ile
His Leu Arg Asp Tyr Val Ile Glu Asp Asp Val Asn Met 770 775 780 Ala
Ile Arg Val Met Leu Glu Ser Phe Ile Asp Thr Gln Lys Phe Ser 785 790
795 800 Val Met Arg Ser Met Arg Lys Thr Phe Ala Arg Tyr Leu Ser Phe
Arg 805 810 815 Arg Asp Asn Asn Glu Leu Leu Leu Phe Ile Leu Lys Gln
Leu Val Ala 820 825 830 Glu Gln Val Thr Tyr Gln Arg Asn Arg Phe Gly
Ala Gln Gln Asp Thr 835 840 845 Ile Glu Val Pro Glu Lys Asp Leu Val
Asp Lys Ala Arg Gln Ile Asn 850 855 860 Ile His Asn Leu Ser Ala Phe
Tyr Asp Ser Glu Leu Phe Arg Met Asn 865 870 875 880 Lys Phe Ser His
Asp Leu Lys Arg Lys Met Ile Leu Gln Gln Phe Leu 885 890 895 Glu Gly
Gly His His His His His His 900 905 12 2718 DNA Artificial Sequence
Nucleotide sequence encoding the MCM2-FLAG polypeptide 12
atggcatcca gcccggccca gcgtcggcga ggcaatgatc ctctcacctc cagccctggc
60 cgaagctccc ggcgtactga tgccctcacc tccagccctg gccgtgacct
tccaccattt 120 gaggatgagt ccgaggggct cctaggcaca gaggggcccc
tggaggaaga agaggatgga 180 gaggagctca ttggagatgg catggaaagg
gactaccgcg ccatcccaga gctggacgcc 240 tatgaggccg agggactggc
tctggatgat gaggacgtag aggagctgac ggccagtcag 300 agggaggcag
cagagcgggc catgcggcag cgtgaccggg aggctggccg gggcctgggc 360
cgcatgcgcc gtgggctcct gtatgacagc gatgaggagg acgaggagcg ccctgcccgc
420 aagcgccgcc aggtggagcg ggccacggag gacggcgagg aggacgagga
gatgattgag 480 agcatcgaga acctggagga tctcaaaggc cactctgtgc
gcgagtgggt gagcatggcg 540 ggcccccggc tggagatcca ccaccgcttc
aagaacttcc tgcgcactca cgtcgacagc 600 cacggccaca acgtcttcaa
ggagcgcatc agcgacatgt gcaaagagaa ccgtgagagc 660 ctggtggtga
actatgagga cttggcagcc agggagcacg tgctggccta cttcctgcct 720
gaggcaccgg cggagctgct gcagatcttt gatgaggctg ccctggaggt ggtactggcc
780 atgtacccca agtacgaccg catcaccaac cacatccatg tccgcatctc
ccacctgcct 840 ctggtggagg agctgcgctc gctgaggcag ctgcatctga
accagctgat ccgcaccagt 900 ggggtggtga ccagctgcac tggcgtcctg
ccccagctca gcatggtcaa gtacaactgc 960 aacaagtgca atttcgtcct
gggtcctttc tgccagtccc agaaccagga ggtgaaacca 1020 ggctcctgtc
ctgagtgcca gtcggccggc ccctttgagg tcaacatgga ggagaccatc 1080
tatcagaact accagcgtat ccgaatccag gagagtccag gcaaagtggc ggctggccgg
1140 ctgccccgct ccaaggacgc cattctcctc gcagatctgg tggacagctg
caagccagga 1200 gacgagatag agctgactgg catctatcac aacaactatg
atggctccct caacactgcc 1260 aatggcttcc ctgtctttgc cactgtcatc
ctagccaacc acgtggccaa gaaggacaac 1320 aaggttgctg taggggaact
gaccgatgaa gatgtgaaga tgatcactag cctctccaag 1380 gatcagcaga
tcggagagaa gatctttgcc agcattgctc cttccatcta tggtcatgaa 1440
gacatcaaga gaggcctggc tctggccctg ttcggagggg agcccaaaaa cccaggtggc
1500 aagcacaagg tacgtggtga tatcaacgtg ctcttgtgcg gagaccctgg
cacagcgaag 1560 tcgcagtttc tcaagtatat tgagaaagtg tccagccgag
ccatcttcac cactggccag 1620 ggggcgtcgg ctgtgggcct cacggcgtat
gtccagcggc accctgtcag cagggagtgg 1680 accttggagg ctggggccct
ggttctggct gaccgaggag tgtgtctcat tgatgaattt 1740 gacaagatga
atgaccagga cagaaccagc atccatgagg ccatggagca acagagcatc 1800
tccatctcga aggctggcat cgtcacctcc ctgcaggctc gctgcacggt cattgctgcc
1860 gccaacccca taggagggcg ctacgacccc tcgctgactt tctctgagaa
cgtggacctc 1920 acagagccca tcatctcacg ctttgacatc ctgtgtgtgg
tgagggacac cgtggaccca 1980 gtccaggacg agatgctggc ccgcttcgtg
gtgggcagcc acgtcagaca ccaccccagc 2040 aacaaggagg aggaggggct
ggccaatggc agcgctgctg agcccgccat gcccaacacg 2100 tatggcgtgg
agcccctgcc ccaggaggtc ctgaagaagt acatcatcta cgccaaggag 2160
agggtccacc cgaagctcaa ccagatggac caggacaagg tggccaagat gtacagtgac
2220 ctgaggaaag aatctatggc gacaggcagc atccccatta cggtgcggca
catcgagtcc 2280 atgatccgca tggcggaggc ccacgcgcgc atccatctgc
gggactatgt gatcgaagac 2340 gacgtcaaca tggccatccg cgtgatgctg
gagagcttca tagacacaca gaagttcagc 2400 gtcatgcgca gcatgcgcaa
gacttttgcc cgctaccttt cattccggcg tgacaacaat 2460 gagctgttgc
tcttcatact gaagcagtta gtggcagagc aggtgacata tcagcgcaac 2520
cgctttgggg cccagcagga cactattgag gtccctgaga aggacttggt ggataaggct
2580 cgtcagatca acatccacaa cctctctgca ttttatgaca gtgagctctt
caggatgaac 2640 aagttcagcc acgacctgaa aaggaaaatg atcctgcagc
agttcctcga ggactacaaa 2700 gacgacgacg acaagtag 2718 13 905 PRT
Artificial Sequence Amino acid sequence for the MCM2-FLAG
polypeptide 13 Met Ala Ser Ser Pro Ala Gln Arg Arg Arg Gly Asn Asp
Pro Leu Thr 1 5 10 15 Ser Ser Pro Gly Arg Ser Ser Arg Arg Thr Asp
Ala Leu Thr Ser Ser 20 25 30 Pro Gly Arg Asp Leu Pro Pro Phe Glu
Asp Glu Ser Glu Gly Leu Leu 35 40 45 Gly Thr Glu Gly Pro Leu Glu
Glu Glu Glu Asp Gly Glu Glu Leu Ile 50 55 60 Gly Asp Gly Met Glu
Arg Asp Tyr Arg Ala Ile Pro Glu Leu Asp Ala 65 70 75 80 Tyr Glu Ala
Glu Gly Leu Ala Leu Asp Asp Glu Asp Val Glu Glu Leu 85 90 95 Thr
Ala Ser Gln Arg Glu Ala Ala Glu Arg Ala Met Arg Gln Arg Asp 100 105
110 Arg Glu Ala Gly Arg Gly Leu Gly Arg Met Arg Arg Gly Leu Leu Tyr
115 120 125 Asp Ser Asp Glu Glu Asp Glu Glu Arg Pro Ala Arg Lys Arg
Arg Gln 130 135 140 Val Glu Arg Ala Thr Glu Asp Gly Glu Glu Asp Glu
Glu Met Ile Glu 145 150 155 160 Ser Ile Glu Asn Leu Glu Asp Leu Lys
Gly His Ser Val Arg Glu Trp 165 170 175 Val Ser Met Ala Gly Pro Arg
Leu Glu Ile His His Arg Phe Lys Asn 180 185 190 Phe Leu Arg Thr His
Val Asp Ser His Gly His Asn Val Phe Lys Glu 195 200 205 Arg Ile Ser
Asp Met Cys Lys Glu Asn Arg Glu Ser Leu Val Val Asn 210 215 220 Tyr
Glu Asp Leu Ala Ala Arg Glu His Val Leu Ala Tyr Phe Leu Pro 225 230
235 240 Glu Ala Pro Ala Glu Leu Leu Gln Ile Phe Asp Glu Ala Ala Leu
Glu 245 250 255 Val Val Leu Ala Met Tyr Pro Lys Tyr Asp Arg Ile Thr
Asn His Ile 260 265 270 His Val Arg Ile Ser His Leu Pro Leu Val Glu
Glu Leu Arg Ser Leu 275 280 285 Arg Gln Leu His Leu Asn Gln Leu Ile
Arg Thr Ser Gly Val Val Thr 290 295 300 Ser Cys Thr Gly Val Leu Pro
Gln Leu Ser Met Val Lys Tyr Asn Cys 305 310 315 320 Asn Lys Cys Asn
Phe Val Leu Gly Pro Phe Cys Gln Ser Gln Asn Gln 325 330 335 Glu Val
Lys Pro Gly Ser Cys Pro Glu Cys Gln Ser Ala Gly Pro Phe 340 345 350
Glu Val Asn Met Glu Glu Thr Ile Tyr Gln Asn Tyr Gln Arg Ile Arg 355
360 365 Ile Gln Glu Ser Pro Gly Lys Val Ala Ala Gly Arg Leu Pro Arg
Ser 370 375 380 Lys Asp Ala Ile Leu Leu Ala Asp Leu Val Asp Ser Cys
Lys Pro Gly 385 390 395 400 Asp Glu Ile Glu Leu Thr Gly Ile Tyr His
Asn Asn Tyr Asp Gly Ser 405 410 415 Leu Asn Thr Ala Asn Gly Phe Pro
Val Phe Ala Thr Val Ile Leu Ala 420 425 430 Asn His Val Ala Lys Lys
Asp Asn Lys Val Ala Val Gly Glu Leu Thr 435 440 445 Asp Glu Asp Val
Lys Met Ile Thr Ser Leu Ser Lys Asp Gln Gln Ile 450 455 460 Gly Glu
Lys Ile Phe Ala Ser Ile Ala Pro Ser Ile Tyr Gly His Glu 465 470 475
480 Asp Ile Lys Arg Gly Leu Ala Leu Ala Leu Phe Gly Gly Glu Pro Lys
485 490 495 Asn Pro Gly Gly Lys His Lys Val Arg Gly Asp Ile Asn Val
Leu Leu 500 505 510 Cys Gly Asp Pro Gly Thr Ala Lys Ser Gln Phe Leu
Lys Tyr Ile Glu 515 520 525 Lys Val Ser Ser Arg Ala Ile Phe Thr Thr
Gly Gln Gly Ala Ser Ala 530 535 540 Val Gly Leu Thr Ala Tyr Val Gln
Arg His Pro Val Ser Arg Glu Trp 545 550 555 560 Thr Leu Glu Ala Gly
Ala Leu Val Leu Ala Asp Arg Gly Val Cys Leu 565 570 575 Ile Asp Glu
Phe Asp Lys Met Asn Asp Gln Asp Arg Thr Ser Ile His 580 585 590 Glu
Ala Met Glu Gln Gln Ser Ile Ser Ile Ser Lys Ala Gly Ile Val 595 600
605 Thr Ser Leu Gln Ala Arg Cys Thr Val Ile Ala Ala Ala Asn Pro Ile
610 615 620 Gly Gly Arg Tyr Asp Pro Ser Leu Thr Phe Ser Glu Asn Val
Asp Leu 625 630 635 640 Thr Glu Pro Ile Ile Ser Arg Phe Asp Ile Leu
Cys Val Val Arg Asp 645 650 655 Thr Val Asp Pro Val Gln Asp Glu Met
Leu Ala Arg Phe Val Val Gly 660 665 670 Ser His Val Arg His His Pro
Ser Asn Lys Glu Glu Glu Gly Leu Ala 675 680 685 Asn Gly Ser Ala Ala
Glu Pro Ala Met Pro Asn Thr Tyr Gly Val Glu 690 695 700 Pro Leu Pro
Gln Glu Val Leu Lys Lys Tyr Ile Ile Tyr Ala Lys Glu 705 710 715 720
Arg Val His Pro Lys Leu Asn Gln Met Asp Gln Asp Lys Val Ala Lys 725
730 735 Met Tyr Ser Asp Leu Arg Lys Glu Ser Met Ala Thr Gly Ser Ile
Pro 740 745 750 Ile Thr Val Arg His Ile Glu Ser Met Ile Arg Met Ala
Glu Ala His 755 760 765 Ala Arg Ile His Leu Arg Asp Tyr Val Ile Glu
Asp Asp Val Asn Met 770 775 780 Ala Ile Arg Val Met Leu Glu Ser Phe
Ile Asp Thr Gln Lys Phe Ser 785 790 795 800 Val Met Arg Ser Met Arg
Lys Thr Phe Ala Arg Tyr Leu Ser Phe Arg 805 810 815 Arg Asp Asn Asn
Glu Leu Leu Leu Phe Ile Leu Lys Gln Leu Val Ala 820 825 830 Glu Gln
Val Thr Tyr Gln Arg Asn Arg Phe Gly Ala Gln Gln Asp Thr 835 840 845
Ile Glu Val Pro Glu Lys Asp Leu Val Asp Lys Ala Arg Gln Ile Asn 850
855 860 Ile His Asn Leu Ser Ala Phe Tyr Asp Ser Glu Leu Phe Arg Met
Asn 865 870 875 880 Lys Phe Ser His Asp Leu Lys Arg Lys Met Ile Leu
Gln Gln Phe Leu 885 890 895 Glu Asp Tyr Lys Asp Asp Asp Asp Lys 900
905 14 10 PRT Artificial Sequence Amino acid sequence for the MCM2
epitope of monoclonal antibody 26H6.19 (refined) 14 His Val Arg His
His Pro Ser Asn Lys Glu 1 5 10
* * * * *