U.S. patent application number 11/643615 was filed with the patent office on 2007-05-24 for oligonucleotides useful for detecting and analyzing nucleic acids of interest.
Invention is credited to Carsten Alsbo, Peter Arctander, Daniel C. Jeffares, Sakari Kauppinen, Soren Mork, Tobias Mourier, Peter S. Nielsen, Niels Tolstrup, Niels Tommerup, Henrik Vissing.
Application Number | 20070117144 11/643615 |
Document ID | / |
Family ID | 43216788 |
Filed Date | 2007-05-24 |
United States Patent
Application |
20070117144 |
Kind Code |
A1 |
Kauppinen; Sakari ; et
al. |
May 24, 2007 |
Oligonucleotides useful for detecting and analyzing nucleic acids
of interest
Abstract
The invention features improved nucleic acids and methods for
expression profiling of mRNAs, identifying and profiling of
particular mRNA splice variants, and detecting mutations,
deletions, or duplications of particular exons or other splice
variants, e.g., alterations associated with a disease such as
cancer, in a nucleic acid sample, e.g., a biological sample or a
patient sample.
Inventors: |
Kauppinen; Sakari; (Smorum,
DK) ; Alsbo; Carsten; (Koge, DK) ; Nielsen;
Peter S.; (Birkerod, DK) ; Jeffares; Daniel C.;
(Kobenhavn N, DK) ; Mourier; Tobias; (Kobenhavn N,
DK) ; Mork; Soren; (Valby, DK) ; Arctander;
Peter; (Askeby, DK) ; Tommerup; Niels;
(Albertslund, DK) ; Tolstrup; Niels; (Klampenborg,
DK) ; Vissing; Henrik; (Virum, DK) |
Correspondence
Address: |
CLARK & ELBING LLP
101 FEDERAL STREET
BOSTON
MA
02110
US
|
Family ID: |
43216788 |
Appl. No.: |
11/643615 |
Filed: |
December 21, 2006 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10690487 |
Oct 21, 2003 |
|
|
|
11643615 |
Dec 21, 2006 |
|
|
|
60420278 |
Oct 21, 2002 |
|
|
|
Current U.S.
Class: |
435/5 ;
435/6.13 |
Current CPC
Class: |
C07H 21/00 20130101;
C07H 19/06 20130101; C07H 23/00 20130101; C07H 19/16 20130101 |
Class at
Publication: |
435/006 |
International
Class: |
C12Q 1/68 20060101
C12Q001/68 |
Foreign Application Data
Date |
Code |
Application Number |
May 19, 2003 |
DK |
PA 2003 00752 |
Claims
1. A method for detecting the presence of one or more target
nucleic acids in a sample, said method comprising incubating a
labeled nucleic acid sample with one or more first nucleic acids
that are (i) a non-naturally-occurring nucleic acid with a melting
temperature that is at least 3.degree. C. higher than that of the
corresponding control nucleic acid with 2'-deoxynucleotides;
wherein said nucleic acid is capable of hybridizing to a first
region within a first exon of a target nucleic acid and to a second
region within a second exon of said target nucleic acid that is
adjacent to said first exon; (ii) a non-naturally-occurring nucleic
acid with a melting temperature that is at least 3.degree. C.
higher than that of the corresponding control nucleic acid with
2'-deoxynucleotides; wherein said nucleic acid is capable of
hybridizing to a first region within an exon of a target nucleic
acid and to a second region within an intron of said target nucleic
acid that is adjacent to said exon; (iii) a non-naturally-occurring
nucleic acid with a melting temperature that is at least 3.degree.
C. higher than that of the corresponding control nucleic acid with
2'-deoxynucleotides; wherein said nucleic acid is capable of
hybridizing to a first region within a first intron of a target
nucleic acid and to a second region within a second intron of said
target nucleic acid that is adjacent to said first intron; (iv) a
non-naturally-occurring nucleic acid with a capture efficiency that
is at least 10% greater than that of a corresponding control
nucleic acid with 2'-deoxynucleotides at the temperature equal to
the melting temperature of said nucleic acid; wherein said nucleic
acid is capable of hybridizing to a first region within a first
exon of a target nucleic acid and to a second region within a
second exon of said target nucleic acid that is adjacent to said
first exon; (v) a non-naturally-occurring nucleic acid with a
capture efficiency that is at least 10% greater than that of a
corresponding control nucleic acid with 2'-deoxynucleotides at the
temperature equal to the melting temperature of said nucleic acid;
wherein said nucleic acid is capable of hybridizing to a first
region within an exon of a target nucleic acid and to a second
region within an intron of said target nucleic acid that is
adjacent to said exon; (vi) a non-naturally-occurring nucleic acid
with a capture efficiency that is at least 10% greater than that of
a corresponding control nucleic acid with 2'-deoxynucleotides at
the temperature equal to the melting temperature of said nucleic
acid; wherein said nucleic acid is capable of hybridizing to a
first region within a first intron of a target nucleic acid and to
a second region within a second intron of said target nucleic acid
that is adjacent to said first intron; (vii) an LNA capable of
hybridizing to a first region within a first exon of a target
nucleic acid and to a second region within a second exon of said
target nucleic acid that is adjacent to said first exon; (viii) an
LNA capable of hybridizing to a first region within an exon of a
target nucleic acid and to a second region within an intron of said
target nucleic acid that is adjacent to said exon; or (ix) an LNA
capable of hybridizing to a first region within a first intron of a
target nucleic acid and to a second region within a second intron
of said target nucleic acid that is adjacent to said first intron;
or one or more populations of first nucleic acids that are (x) a
population of nucleic acid of (i)-(ix); (xi) a population of
nucleic acids that includes a non-naturally-occurring nucleic acid
with a melting temperature that is at least 3.degree. C. higher
than that of the corresponding control nucleic acid with
2'-deoxynucleotides; wherein said nucleic acid is capable of
hybridizing to only one exon or to only one intron of a target
nucleic acid; (xii) a population of nucleic acids that includes a
non-naturally-occurring nucleic acid with a capture efficiency that
is at least 10% greater than that of a corresponding control
nucleic acid with 2'-deoxynucleotides at the temperature equal to
the melting temperature of said nucleic acid; wherein said nucleic
acid is capable of hybridizing to only one exon or to only one
intron of a target nucleic acid; or (xiii) a population of nucleic
acids that includes a nucleic acid that is an LNA capable of
hybridizing to only one exon or to only one intron of a target
nucleic acid; under conditions that allow at least one target
nucleic acid to hybridize to at least one of said first nucleic
acids.
2. The method of claim 1, wherein hybridization is detected between
at least 5 target nucleic acids and said first nucleic acids.
3. The method of claim 1, further comprising identifying one or
more hybridized target nucleic acids.
4. The method of claim 1, further comprising determining the amount
of one or more hybridized target nucleic acids.
5. The method of claim 4, wherein one or more target nucleic acids
are labeled with a fluorescent group, and wherein the determination
of the amount of said hybridized target nucleic acid comprises one
or more of the following: (a) adjusting for the varying intensity
of an excitation light source used for detection of said
hybridization, (b) adjusting for photobleaching of said fluorescent
group, andor (c) comparing the fluorescent intensity of said
hybridized target nucleic acid(s) to the fluorescent intensity of a
different sample of hybridized nucleic acids.
6. The method of claim 1, wherein said target nucleic acids are
cDNA molecules reverse transcribed from a sample.
7. The method of claim 6, wherein said target nucleic acids are
fragmented using E. Coli Uracil-DNA Glycosylase.
8. The method of claim 7, wherein said target nucleic acids are
fragmented to an average size of 300 nucleotides.
9. The method of claim 7, wherein said target nucleic acids are
fragmented to an average size of 200 nucleotides.
10. The method of claim 7, wherein said target nucleic acids are
fragmented to an average size of 100 nucleotides.
11. The method of claim 7, wherein said target nucleic acids are
fragmented to an average size of 50 nucleotides.
12. The method of claim 1, wherein said target nucleic acids are
cRNA molecules amplified from a sample
13. The method of claim 12, wherein said target nucleic acids are
fragmented using alkaline hydrolysis.
14. The method of claim 1, further comprising determining the
presence or absence of an MRNA splice variant of interest in said
sample or determining the presence or absence of a mutation,
deletion, andor duplication of an exon of interest.
15. The method of claim 1, wherein the sample comprises nucleic
acids that are amplified using one or more primers specific for an
exon of a target nucleic acid, and wherein said method comprises
determining the presence or absence of an MRNA splice variant with
said exon in said sample.
16. The method of claim 15, wherein one or more of said primers are
specific for an exon or exon-exon junction of interest, and said
method comprises determining the presence or absence of a nucleic
acid with said exon in said sample.
17. The method of claim 1, wherein said first nucleic acids are
covalently bonded to a solid support by reaction of a nucleoside
phosphoramidite with an activated solid support, and subsequent
reaction of a nucleoside phosphoramide with an activated nucleotide
or nucleic acid bound to said solid support.
18. The method of claim 1, further comprising contacting said
target nucleic acid with a second nucleic acid or a population of
second nucleic acids that binds to a different region of the target
molecule than said first nucleic acid.
19. The method of claim 1, further comprising performing expression
profiling or comparative genomic hybridization.
20. The method of claim 1, wherein said nucleic acid (i) is
incubated with said labeled nucleic acid sample.
21. The method of claim 1, wherein said nucleic acid (ii) is
incubated with said labeled nucleic acid sample.
22. The method of claim 1, wherein said nucleic acid (iii) is
incubated with said labeled nucleic acid sample.
23. The method of claim 1, wherein said nucleic acid (iv) is
incubated with said labeled nucleic acid sample.
24. The method of claim 1, wherein said nucleic acid (v) is
incubated with said labeled nucleic acid sample.
25. The method of claim 1, wherein said nucleic acid (vi) is
incubated with said labeled nucleic acid sample.
26. The method of claim 1, wherein said nucleic acid (vii) is
incubated with said labeled nucleic acid sample.
27. The method of claim 1, wherein said nucleic acid (viii) is
incubated with said labeled nucleic acid sample.
28. The method of claim 1, wherein said nucleic acid (ix) is
incubated with said labeled nucleic acid sample.
29. The method of claim 1, wherein in said first nucleic acid of
(i)-(ix) the length of said first region and the length of said
second region are between 3 and 50 nucleotides, inclusive, and said
first nucleic acid of (i)-(ix) is incubated with said labeled
nucleic acid sample.
30. The method of claim 29, wherein the length of said first region
and the length of said second region are between 10 and 40
nucleotides, inclusive.
31. The method of claim 30, wherein the length of said first region
and the length of said second region are between 20 and 30
nucleotides, inclusive.
32. The method of claim 1, wherein in said first nucleic acid of
(i)-(ix) said first region and said second region are of the same
length, and said first nucleic acid of (i)-(ix) is incubated with
said labeled nucleic acid sample.
33. The method of claim 1, wherein in said first nucleic acid of
(i)-(ix) said first region and said second region are of a
different length, and said first nucleic acid of (i)-(ix) is
incubated with said labeled nucleic acid sample.
34. The method of claim 1, wherein said population of (x) is
incubated with said labeled nucleic acid sample.
35. The method of claim 1, wherein said population of (xi) is
incubated with said labeled nucleic acid sample.
36. The method of claim 1, wherein said population of (xii) is
incubated with said labeled nucleic acid sample.
37. The method of claim 1, wherein said population of (xiii) is
incubated with said labeled nucleic acid sample.
38. The method of claim 1, wherein said nucleic acid of (ii), (v)
or (viii) is a non-naturally occurring nucleic acid with a melting
temperature that is at least 3.degree. C. higher than that of the
corresponding control nucleic acid with 2'-deoxynucleotides;
wherein said nucleic acid is capable of hybridizing to only one
exon or to only one intron of a target nucleic acid, and said
nucleic acid of (ii), (v) or (viii) is incubated with said labeled
nucleic acid sample.
39. The method of claim 1, wherein said nucleic acid of (ii), (v)
or (viii) is a non-naturally-occurring nucleic acid with a capture
efficiency that is at least 10% greater than that of a
corresponding control nucleic acid with 2'-deoxynucleotides at the
temperature equal to the melting temperature of said nucleic acid;
wherein said nucleic acid is capable of hybridizing to only one
exon or to only one intron of a target nucleic acid, and said
nucleic acid of (ii), (v) or (viii) is incubated with said labeled
nucleic acid sample.
40. The method of claim 1, wherein said nucleic acid of (ii), (v)
or (viii) comprises an LNA capable of hybridizing to only one exon
or to only one intron of a target nucleic acid, and said nucleic
acid of (ii), (v) or (viii) is incubated with said labeled nucleic
acid sample.
41. The method of claim 1, wherein in said population of (x)-(xiii)
said nucleic acid is between 15 and 150 nucleotides in length,
inclusive, and said population of (x)-(xiii) is incubated with said
labeled nucleic acid sample.
42. The method of claim 1, wherein in said population of (x)-(xiii)
said nucleic acid is between 5 and 100 nucleotides in length,
inclusive, and said population of (x)-(xiii) is incubated with said
labeled nucleic acid sample.
43. The method of claim 42, wherein said nucleic acid is between 20
and 80 nucleotides in length, inclusive.
44. The method of claim 43, wherein said nucleic acid is between 30
and 60 nucleotides in length, inclusive.
45. The method of claim 44, wherein said nucleic acid is 40
nucleotides in length.
46. The method of claim 44, wherein said nucleic acid is 50
nucleotides in length.
47. The method of claim 1 wherein said nucleic acid of (i)-(ix) is
between 8 and 70 nucleotides in length and is incubated with said
labeled nucleic acid sample.
48. The method of claim 47 wherein said nucleic acid of(i)-(ix) is
between 9 and 50 nucleotides in length.
49. The method of claim 48 wherein said nucleic acid of(i)-(ix) is
between 12 and 40 nucleotides in length.
50. The method of claim 49 wherein said nucleic acid of (i)-(ix) is
between 15 and 35 nucleotides in length.
51. The method of claim 1, wherein in said population of (x)-(xiii)
at least 5% of the nucleotides in said nucleic acid are LNA units,
and said population of (x)-(xiii) is incubated with said labeled
nucleic acid sample.
52. The method of claim 51, wherein at least 10% of the nucleotides
in said nucleic acid are LNA units.
53. The method of claim 52, wherein at least 20% of the nucleotides
in said nucleic acid are LNA units.
54. The method of claim 1, wherein in said population of (x)-(xiii)
every second nucleotide in said nucleic acid is an LNA unit, and
said population of (x)-(xiii) is incubated with said labeled
nucleic acid sample.
55. The method of claim 1, wherein in said population of (x)-(xiii)
every third nucleotide in said nucleic acid is an LNA unit, and
said population of (x)-(xiii) is incubated with said labeled
nucleic acid sample.
56. The method of claim 1, wherein in said population of (x)-(xiii)
every fourth nucleotide in said nucleic acid is an LNA unit, and
said population of (x)-(xiii) is incubated with said labeled
nucleic acid sample.
57. The method of claim 1, wherein in said population of (x)-(xiii)
every fifth nucleotide in said nucleic acid is an LNA unit, and
said population of (x)-(xiii) is incubated with said labeled
nucleic acid sample.
58. The method of claim 1, wherein in said population of (x)-(xiii)
every sixth nucleotide in said nucleic acid is an LNA unit, and
said population of (x)-(xiii) is incubated with said labeled
nucleic acid sample.
59. The method of claim 1, wherein in said population of (x)-(xiii)
every second and every third nucleotide, every second and every
fourth nucleotide, every second and every fifth nucleotide, every
second and every sixth nucleotide, every third and every fourth
nucleotide, every third and every fifth nucleotide, every third and
every sixth nucleotide, every fourth and every fifth nucleotide,
every fourth and every sixth nucleotide, andor every fifth and
every sixth nucleotide in said nucleic acid is an LNA unit, and
said population of (x)-(xiii) is incubated with said labeled
nucleic acid sample.
60. The method of claim 59, wherein every second, every third, and
every fourth nucleotide in said nucleic acid is an LNA unit.
61. The method of claim 1, wherein in said population of (x)-(xiii)
said nucleic acid comprises two or more contiguous LNA units, and
said population of (x)-(xiii) is incubated with said labeled
nucleic acid sample.
62. The method of claim 61, wherein said nucleic acid comprises at
least 4 contiguous LNA units.
63. The method of claim 62, wherein said nucleic acid comprises at
least 5 contiguous LNA units.
64. The method of claim 61, wherein the number of contiguous LNA
units is between 5 and 20% of the total length of said nucleic
acid.
65. The method of claim 64, wherein the number of contiguous LNA
units is between 10 and 15% of the total length of said nucleic
acid.
66. The method of claim 61, wherein at least one LNA unit in said
nucleic acid is capable of hybridizing to a first region within a
first exon of a target nucleic acid, and at least one LNA unit in
said nucleic acid is capable of hybridizing to a second region
within a second exon of said target nucleic acid that is adjacent
to said first exon.
67. The method of claim 66, wherein at least two LNA units in said
nucleic acid hybridize to a first region within a first exon of a
target nucleic acid, and at least two LNA units in said nucleic
acid hybridize to a second region within a second exon of said
target nucleic acid that is adjacent to said first exon.
68. The method of claim 67, wherein at least three LNA units in
said nucleic acid hybridize to a first region within a first exon
of a target nucleic acid, and at least three LNA units in said
nucleic acid hybridize to a second region within a second exon of
said target nucleic acid that is adjacent to said first exon.
69. The method of claim 1, wherein in said population of (x)-(xiii)
the 5' terminal nucleotide of said nucleic acid is not an LNA unit,
and said population of (x)-(xiii) is incubated with said labeled
nucleic acid sample.
70. The method of claim 1, wherein in said population of (x)-(xiii)
the 5' terminal nucleotide of said nucleic acid is an LNA unit, and
said population of (x)-(xiii) is incubated with said labeled
nucleic acid sample.
71. The method of claim 1, wherein in said population of (x)-(xiii)
the 3' terminal nucleotide of said nucleic acid is not an LNA unit,
and said population of (x)-(xiii) is incubated with said labeled
nucleic acid sample.
72. The method of claim 1, wherein in said population of (x)-(xiii)
said nucleic acid can distinguish between different nucleic acids
that cannot be distinguished using a naturally-occurring control
nucleic acid, and said population of (x)-(xiii) is incubated with
said labeled nucleic acid sample.
73. The method of claim 72, wherein said control nucleic acid
consists of only 2'-deoxynucleotides.
74. The method of claim 72, wherein said different nucleic acids
are mRNA splice variants.
75. The method of claim 1, wherein in said population of (x)-(xiii)
said nucleic acid comprises one or more universal bases, and said
population of (x)-(xiii) is incubated with said labeled nucleic
acid sample.
76. The method of claim 75, wherein said universal base is located
at the 5' or 3' terminus of said nucleic acid.
77. The method of claim 75, wherein one or more universal bases are
located at the 5' and 3' termini of said nucleic acid.
78. The method of claim 75, wherein all of said nucleic acids of
said population have the same number of universal bases.
79. The method of claim 75, wherein said universal base is inosine,
pyrene, 3-nitropyrrole, or 5-nitroindole.
80. The method of claim 1, wherein in said population of (x)-(xiii)
said nucleic acid comprises at least one LNA A or LNA T, and said
population of (x)-(xiii) is incubated with said labeled nucleic
acid sample.
81. The method of claim 1, wherein in said population of (x)-(xiii)
each nucleic acid in said population comprises at least one LNA A
or LNA T, and said population of (x)-(xiii) is incubated with said
labeled nucleic acid sample.
82. The method of claim 81, wherein all of the adenine and
thymine-containing nucleotides in said LNA are LNA A and LNA T,
respectively.
83. The method of claim 1, wherein in said population of (x)-(xiii)
said nucleic acid comprises a at least one 2,6,-diaminopurine or
2-thio-thymine base, and said population of (x)-(xiii) is incubated
with said labeled nucleic acid sample.
84. The method of claim 1, wherein in said population of(x)-(xiii)
at least 5% of the nucleic acids in said population are LNA, and
said population of (x)-(xiii) is incubated with said labeled
nucleic acid sample.
85. The method of claim 1, wherein in said population of(x)-(xiii)
at least 10% of the nucleic acid in said population are LNA, and
said population of (x)-(xiii) is incubated with said labeled
nucleic acid sample.
86. The method of claim 1, wherein said population of (x)-(xiii)
comprises nucleic acids that together hybridize to at least 10% of
the nucleic acids expressed by a particular cell or tissue, and
said population of(x)-(xiii) is incubated with said labeled nucleic
acid sample.
87. The method of claim 86, nucleic acids together hybridize to at
least 50% of the exons of a target nucleic acid.
88. The method of claim 1, wherein in said population of (x)-(xiii)
said nucleic acid does not form a hairpin that would otherwise
inhibit its binding to a target nucleic acid, and said population
of (x)-(xiii) is incubated with said labeled nucleic acid
sample.
89. The method of claim 1, wherein in said population of (x)-(xiii)
opposing nucleotides in a palindrome pair or opposing nucleotides
in inverted repeats of said nucleic acid are not both LNA units,
and said population of (x)-(xiii) is incubated with said labeled
nucleic acid sample.
90. The method of claim 1, wherein in said population of (x)-(xiii)
said nucleic acid forms less than 3 intramolecular base-pairs, and
said population of (x)-(xiii) is incubated with said labeled
nucleic acid sample.
91. The method of claim 1, wherein in said population of (x)-(xiii)
said nucleic acid does not have LNA-5-nitroindole:
LNA-5-nitroindole intramolecular base-pairs, and said population of
(x)-(xiii) is incubated with said labeled nucleic acid sample.
92. The method of claim 1, wherein in said population of (x)-(xiii)
said nucleic acid has a LNA unit with a 2,6,-diaminopurine,
2-aminopurine, 2-thio-thymine, 2-thio-uracil, inosine, or
hypoxanthine base, and said population of (x)-(xiii) is incubated
with said labeled nucleic acid sample.
93. The method of claim 1, wherein in said population of (x)-(xiii)
said nucleic acid has a 2'O, 4C-methylene linkage, and said
population of (x)-(xiii) is incubated with said labeled nucleic
acid sample.
94. The method of claim 1, wherein in said population of (x)-(xiii)
one or more nucleic acids are LNA/DNA, LNA/RNA, or LNA/DNA/RNA
chimeras, and said population of (x)-(xiii) is incubated with said
labeled nucleic acid sample.
95. The method of claim 1, wherein in said population of (x)-(xiii)
said nucleic acid has a melting temperature that is at least
10.degree. C. higher than that of the corresponding control nucleic
acid with 2'-deoxynucleotides, and said population of (x)-(xiii) is
incubated with said labeled nucleic acid sample.
96. The method of claim 95, wherein said nucleic acid has a melting
temperature that is at least 20.degree. C. higher than that of the
corresponding control nucleic acid with 2'-deoxynucleotides.
97. The method of claim 1, wherein in said population of (x)-(xiii)
said nucleic acid has a capture efficiency that is at least 100%
greater than that of the corresponding control nucleic acid with
2'-deoxynucleotides at the temperature equal to the melting
temperature of said nucleic acid, and said population of (x)-(xiii)
is incubated with said labeled nucleic acid sample.
98. The method of claim 97, wherein said nucleic acid has a capture
efficiency that is at least 400% greater than that of the
corresponding control nucleic acid with 2'-deoxynucleotides at the
temperature equal to the melting temperature of said nucleic
acid.
99. The method of claim 1, wherein in said population of (x)-(xiii)
said nucleic acids are covalently bonded to a solid support, and
said population of (x)-(xiii) is incubated with said labeled
nucleic acid sample.
100. The method of claim 99, wherein said nucleic acids are in a
predefined arrangement.
101. The method of claim 1, wherein said population of (x)-(xiii)
comprises at least 10 different nucleic acids, and said population
of (x)-(xiii) is incubated with said labeled nucleic acid
sample.
102. The method of claim 101, wherein said population of (x)-(xiii)
comprises at least 100 different nucleic acids.
103. The method of claim 102, wherein said population of (x)-(xiii)
comprises at least 500 different nucleic acids.
104. The method of claim 103, wherein said population of (x)-(xiii)
comprises at least 1,000 different nucleic acids.
105. The method of claim 104, wherein said population of (x)-(xiii)
comprises at least 5,000 different nucleic acids.
106. A method for classifying a test nucleic acid sample comprising
a target nucleic acid, said method comprising the steps of: (a)
incubating a test nucleic acid sample with one or more nucleic
acids probes that are (i) a non-naturally-occurring nucleic acid
with a melting temperature that is at least 3.degree. C. higher
than that of the corresponding control nucleic acid with
2'-deoxynucleotides; wherein said nucleic acid is capable of
hybridizing to a first region within a first exon of a target
nucleic acid and to a second region within a second exon of said
target nucleic acid that is adjacent to said first exon; (ii) a
non-naturally-occurring nucleic acid with a melting temperature
that is at least 3.degree. C. higher than that of the corresponding
control nucleic acid with 2'-deoxynucleotides; wherein said nucleic
acid is capable of hybridizing to a first region within an exon of
a target nucleic acid and to a second region within an intron of
said target nucleic acid that is adjacent to said exon; (iii) a
non-naturally-occurring nucleic acid with a melting temperature
that is at least 3.degree. C. higher than that of the corresponding
control nucleic acid with 2'-deoxynucleotides; wherein said nucleic
acid is capable of hybridizing to a first region within a first
intron of a target nucleic acid and to a second region within a
second intron of said target nucleic acid that is adjacent to said
first intron; (iv) a non-naturally-occurring nucleic acid with a
capture efficiency that is at least 10% greater than that of a
corresponding control nucleic acid with 2'-deoxynucleotides at the
temperature equal to the melting temperature of said nucleic acid;
wherein said nucleic acid is capable of hybridizing to a first
region within a first exon of a target nucleic acid and to a second
region within a second exon of said target nucleic acid that is
adjacent to said first exon; (v) a non-naturally-occurring nucleic
acid with a capture efficiency that is at least 10% greater than
that of a corresponding control nucleic acid with
2'-deoxynucleotides at the temperature equal to the melting
temperature of said nucleic acid; wherein said nucleic acid is
capable of hybridizing to a first region within an exon of a target
nucleic acid and to a second region within an intron of said target
nucleic acid that is adjacent to said exon; (vi) a
non-naturally-occurring nucleic acid with a capture efficiency that
is at least 10% greater than that of a corresponding control
nucleic acid with 2'-deoxynucleotides at the temperature equal to
the melting temperature of said nucleic acid; wherein said nucleic
acid is capable of hybridizing to a first region within a first
intron of a target nucleic acid and to a second region within a
second intron of said target nucleic acid that is adjacent to said
first intron; (vii) an LNA capable of hybridizing to a first region
within a first exon of a target nucleic acid and to a second region
within a second exon of said target nucleic acid that is adjacent
to said first exon; (viii) an LNA capable of hybridizing to a first
region within an exon of a target nucleic acid and to a second
region within an intron of said target nucleic acid that is
adjacent to said exon; or (ix) an LNA capable of hybridizing to a
first region within a first intron of a target nucleic acid and to
a second region within a second intron of said target nucleic acid
that is adjacent to said first intron; or one or more populations
of first nucleic.acid probes that are (x) a population of nucleic
acid of (i)-(ix); (xi) a population of nucleic acids that includes
a non-naturally-occurring nucleic acid with a melting temperature
that is at least 3.degree. C. higher than that of the corresponding
control nucleic acid with 2'-deoxynucleotides; wherein said nucleic
acid is capable of hybridizing to only one exon or to only one
intron of a target nucleic acid; (xii) a population of nucleic
acids that includes a non-naturally-occurring nucleic acid with a
capture efficiency that is at least 10% greater than that of a
corresponding control nucleic acid with 2'-deoxynucleotides at the
temperature equal to the melting temperature of said nucleic acid;
wherein said nucleic acid is capable of hybridizing to only one
exon or to only one intron of a target nucleic acid; or (xiii) a
population of nucleic acids that includes a nucleic acid that is an
LNA capable of hybridizing to only one exon or to only one intron
of a target nucleic acid; under conditions that allow at least one
of the nucleic acids in said test sample to hybridize to at least
one nucleic acid probe; (b) detecting a hybridization pattern of
said test nucleic acid sample; and (c) comparing said hybridization
pattern to a hybridization pattern of a first nucleic acid
standard, whereby said comparison indicates whether or not said
test sample has the same classification as said first standard.
107. The method of claim 106, further comprising comparing a
hybridization pattern of said test nucleic acid sample to a
hybridization pattern of a second standard.
108. The method of claim 106, wherein at least.5 target nucleic
acids hybridize to said nucleic acid probes.
109. The method of claim 106, further comprising identifying a
hybridized target nucleic acid.
110. The method of claim 106, further comprising determining the
amount of said hybridized target nucleic acid.
111. The method of claim 106, wherein said target nucleic acids are
labeled with fluorescent groups.
112. The method of claim 111, wherein said determination comprises
scaling for the varying labeling efficiency for the different
fluorescent groups used for detection of said hybridization.
113. The method of claim 111, wherein said determination comprises
adjusting for the varying intensity of the excitation light source
used for detection of said hybridization.
114. The method of claim 111, wherein said determination comprises
adjusting for photobleaching of said fluorescent group.
115. The method of claim 111, wherein said comparison comprises
adjusting for a difference in the amount of said nucleic acid
probes used for hybridization to said test sample and said first
standard.
116. The method of claim 111, wherein said comparison comprises
adjusting for a difference in the buffer used for hybridization to
said test sample and said first standard.
117. The method of claim 116, wherein said difference is a
difference in Na.sup.+ concentration.
118. The method of claim 111, wherein said first nucleic acid
standard is labeled with a different fluorescent group.
119. The method of claim 106, wherein said target nucleic acids are
cDNA molecules reverse transcribed from a sample.
120. The method of claim 119, wherein said target nucleic acids are
fragmented using E. coli Uracil-DNA Glycosylase.
121. The method of claim 120, wherein said target nucleic acids are
fragmented to an average size of 300 nucleotides.
122. The method of claim 120, wherein said target nucleic acids are
fragmented to an average size of 200 nucleotides.
123. The method of claim 120, wherein said target nucleic acids are
fragmented to an average size of 100 nucleotides.
124. The method of claim 120, wherein said target nucleic acids are
fragmented to an average size of 50 nucleotides.
125. The method of claim 106, wherein said target nucleic acids are
cRNA molecules amplified from a sample.
126. The method of claim 125, wherein said target nucleic acids are
fragmented using alkaline hydrolysis.
127. The method of claim 106, further comprising determining the
presence or absence of an mRNA splice variant of interest in said
sample.
128. The method of claim 127, wherein said mRNA splice variant is
indicative of a disease, disorder, or condition.
129. The method of claim 128, wherein said disease is cancer.
130. The method of claim 106, further comprising determining the
presence or absence of a mutation, deletion, andor duplication of
an exon of interest.
131. The method of claim 130, wherein said mutation, deletion,
andor duplication is indicative of a disease, disorder, or
condition.
132. The method of claim 131, wherein said disease is cancer.
133. The method of claim 106, wherein the sample comprises nucleic
acids that are amplified using one or more primers specific for an
exon of a target nucleic acid, and wherein said method involves
determining the presence or absence of an mRNA splice variant with
said exon in said sample.
134. The method of claim 133, wherein one or more of said primers
are specific for an exon or exon-exon junction of interest, and
said method involves determining the presence or absence of a
nucleic acid with said exon in said sample.
135. The method of claim 106, wherein said first nucleic acids are
covalently bonded to a solid support by reaction of a nucleoside
phosphoramidite with an activated solid support, and subsequent
reaction of a nucleoside phosphoramide with an activated nucleotide
or nucleic acid bound to said solid support.
136. A method of selecting a nucleic acid for a population of
nucleic acids, said method comprising the steps of: (a) determining
the melting temperature of a nucleic acid, determining the ability
of said nucleic acid to self-anneal, determining the ability of
said nucleic acid to hybridize to one or more exons or introns of a
target nucleic acid, andor determining the ability of said nucleic
acid to hybridize to a non-target nucleic acid, and (b) selecting
said nucleic acid for inclusion or exclusion from said population
based on the determination in step (a), wherein said nucleic acid
is a nucleic acid that is (i) a non-naturally-occurring nucleic
acid with a melting temperature that is at least 3.degree. C.
higher than that of the corresponding control nucleic acid with
2'-deoxynucleotides; wherein said nucleic acid is capable of
hybridizing to a first region within a first exon of a target
nucleic acid and to a second region within a second exon of said
target nucleic acid that is adjacent to said first exon; (ii) a
non-naturally-occurring nucleic acid with a melting temperature
that is at least 3.degree. C. higher than that of the corresponding
control nucleic acid with 2'-deoxynucleotides; wherein said nucleic
acid is capable of hybridizing to a first region within an exon of
a target nucleic acid and to a second region within an intron of
said target nucleic acid that is adjacent to said exon; (iii) a
non-naturally-occurring nucleic acid with a melting temperature
that is at least 3.degree. C. higher than that of the corresponding
control nucleic acid with 2'-deoxynucleotides; wherein said nucleic
acid is capable of hybridizing to a first region within a first
intron of a target nucleic acid and to a second region within a
second intron of said target nucleic acid that is adjacent to said
first intron; (iv) a non-naturally-occurring nucleic acid with a
capture efficiency that is at least 10% greater than that of a
corresponding control nucleic acid with 2'-deoxynucleotides at the
temperature equal to the melting temperature of said nucleic acid;
wherein said nucleic acid is capable of hybridizing to a first
region within a first exon of a target nucleic acid and to a second
region within a second exon of said target nucleic acid that is
adjacent to said first exon; (v) a non-naturally-occurring nucleic
acid with a capture efficiency that is at least 10% greater than
that of a corresponding control nucleic acid with
2'-deoxynucleotides at the temperature equal to the melting
temperature of said nucleic acid; wherein said nucleic acid is
capable of hybridizing to a first region within an exon of a target
nucleic acid and to a second region within an intron of said target
nucleic acid that is adjacent to said exon; (vi) a
non-naturally-occurring nucleic acid with a capture efficiency that
is at least 10% greater than that of a corresponding control
nucleic acid with 2'-deoxynucleotides at the temperature equal to
the melting temperature of said nucleic acid; wherein said nucleic
acid is capable of hybridizing to a first region within a first
intron of a target nucleic acid and to a second region within a
second intron of said target nucleic acid that is adjacent to said
first intron; (vii) an LNA capable of hybridizing to a first region
within a first exon of a target nucleic acid and to a second region
within a second exon of said target nucleic acid that is adjacent
to said first exon; (viii) an LNA capable of hybridizing to a first
region within an exon of a target nucleic acid and to a second
region within an intron of said target nucleic acid that is
adjacent to said exon; (ix) an LNA capable of hybridizing to a
first region within a first intron of a target nucleic acid and to
a second region within a second intron of said target nucleic acid
that is adjacent to said first intron; or (x) a nucleic acid that
has least one LNA unit and that is capable of hybridizing to only
one exon or to only one intron of a target nucleic acid.
137. A method of detecting a target nucleic acid in a sample, said
method comprising incubating a nucleic acid sample with a
fluorescently labeled nucleic acid probe that comprises: (i) a
non-naturally-occurring nucleic acid with a melting temperature
that is at least 3.degree. C. higher than that of the corresponding
control nucleic acid with 2'-deoxynucleotides; wherein said nucleic
acid is capable of hybridizing to a first region within a first
exon of a target nucleic acid and to a second region within a
second exon of said target nucleic acid that is adjacent to said
first exon; (ii) a non-naturally-occurring nucleic acid with a
melting temperature that is at least 3.degree. C. higher than that
of the corresponding control nucleic acid with 2'-deoxynucleotides;
wherein said nucleic acid is capable of hybridizing to a first
region within an exon of a target nucleic acid and to a second
region within an intron of said target nucleic acid that is
adjacent to said exon; (iii) a non-naturally-occurring nucleic acid
with a melting temperature that is at least 3.degree. C. higher
than that of the corresponding control nucleic acid with
2'-deoxynucleotides; wherein said nucleic acid is capable of
hybridizing to a first region within a first intron of a target
nucleic acid and to a second region within a second intron of said
target nucleic acid that is adjacent to said first intron; (iv) a
non-naturally-occurring nucleic acid with a capture efficiency that
is at least 10% greater than that of a corresponding control
nucleic acid with 2'-deoxynucleotides at the temperature equal to
the melting temperature of said nucleic acid; wherein said nucleic
acid is capable of hybridizing to a first region within a first
exon of a target nucleic acid and to a second region within a
second exon of said target nucleic acid that is adjacent to said
first exon; (v) a non-naturally-occurring nucleic acid with a
capture efficiency that is at least 10% greater than that of a
corresponding control nucleic acid with 2'-deoxynucleotides at the
temperature equal to the melting temperature of said nucleic acid;
wherein said nucleic acid is capable of hybridizing to a first
region within an exon of a target nucleic acid and to a second
region within an intron of said target nucleic acid that is
adjacent to said exon; (vi) a non-naturally-occurring nucleic acid
with a capture efficiency that is at least 10% greater than that of
a corresponding control nucleic acid with 2'-deoxynucleotides at
the temperature equal to the melting temperature of said nucleic
acid; wherein said nucleic acid is capable of hybridizing to a
first region within a first intron of a target nucleic acid and to
a second region within a second intron of said target nucleic acid
that is adjacent to said first intron; (vii) an LNA capable of
hybridizing to a first region within a first exon of a target
nucleic acid and to a second region within a second exon of said
target nucleic acid that is adjacent to said first exon; (viii) an
LNA capable of hybridizing to a first region within an exon of a
target nucleic acid and to a second region within an intron of said
target nucleic acid that is adjacent to said exon; or (ix) an LNA
capable of hybridizing to a first region within a first intron of a
target nucleic acid and to a second region within a second intron
of said target nucleic acid that is adjacent to said first intron;
or a population of fluorescently labeled nucleic acid probes that
comprises: (x) a population of nucleic acids of (i)-(ix); (xi) a
population of nucleic acids that includes a non-naturally-occurring
nucleic acid with a melting temperature that is at least 3.degree.
C. higher than that of the corresponding control nucleic acid with
2'-deoxynucleotides; wherein said nucleic acid is capable of
hybridizing to only one exon or to only one intron of a target
nucleic acid; (xii) a population of nucleic acids that includes a
non-naturally-occurring nucleic acid with a capture efficiency that
is at least 10% greater than that of a corresponding control
nucleic acid with 2'-deoxynucleotides at the temperature equal to
the melting temperature of said nucleic acid; wherein said nucleic
acid is capable of hybridizing to only one exon or to only one
intron of a target nucleic acid; or (xiii) a population of nucleic
acids that includes a nucleic acid that is an LNA capable of
hybridizing to only one exon or to only one intron of a target
nucleic acid; under conditions that allow at least one target
nucleic acid to hybridize to at least one of said nucleic acid
probes; and detecting said probes via fluorescent in situ
hybridization.
138. The method of claim 137, wherein said probe or said population
of probes comprise LNA in every other or every third position of
the nucleotide sequence.
139. The method of claim 137, wherein said probe or said population
of probes are used for the detection of a repetitive element.
140. The method of claim 139, wherein said repetitive element is a
centromeric alpha-repeat or a telomeric repeat.
141. The method of claim 139, wherein said repetitive element is in
human chromosome 13 or 21.
142. The method of claim 137, wherein said probe or said population
of probes are used for the detection of a single base pair
difference between repetitive sequences or for the detection of
single copy sequences.
143. The method of claim 142, wherein said repetitive sequences is
in human chromosome 13 or 21.
144. The method of claim 142, wherein said repetitive element is a
centromeric alpha-repeat.
145. The method of claim 137, wherein said hybridization occurs
without a denaturation step.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application is a divisional of U.S. application Ser.
No. 10/690,487, filed Oct. 21, 2003, which claims priority to U.S.
Provisional Application No. 60/420,278, filed on Oct. 21, 2002 and
Danish Application No. PA 2003 00752, filed on May 19, 2003, each
of which is hereby incorporated by reference.
REFERENCE TO COMPUTER PROGRAM LISTING APPENDIX AND SEQUENCE LISTING
SUBMITTED ON COMPACT DISC
[0002] A compact disc containing the files:
50287.007002_oligod.txt, 60 kB; 50287.007002_dyp.txt, 52 kB;
50287.007002_expression_array_param.txt, 3 kB;
50287.007002_tmprediction.txt, 3 kB;
50287.007002_tmthermodynamic.txt, 47 kB, all created on Oct. 19,
2003, and 50287.007003_SEQLIST.TXT, 203 kB, created on Dec. 20,
2006, has been submitted in duplicate and is hereby incorporated by
reference.
BACKGROUND OF THE INVENTION
[0003] The invention relates to nucleic acids and methods for
expression profiling of mRNAs, identifying and profiling of
particular mRNA splice variants, and detecting mutations,
deletions, or duplications of particular exons, e.g., alterations
associated with a disease such as cancer, in a nucleic acid sample,
e.g., a patient sample. The invention furthermore relates to
methods for detecting nucleic acids by fluorescence in situ
hybridization.
[0004] The field of the invention is oligonucleotides (e.g.,
oligonucleotide arrays) that are useful for detecting nucleic acids
of interest and for detecting differences between nucleic acid
samples (e.g, such as samples from a cancer patient and a healthy
patient).
[0005] DNA chip technology utilizes minituarized arrays of DNA
molecules immobilized on solid surfaces for biochemical analyses.
The power of DNA microarrays as experimental tools relies on the
specific molecular recognition via complementary base-pairing,
which makes them highly useful for massive parallel analyses. In
the post-genomic era, microarray technology has thus become the
method of choice for many hybridization-based assays, such as
expression profiling, SNP detection, DNA re-sequencing, and
genotyping on a genomic scale.
[0006] Expression microarrays are capable of profiling gene
expression patterns of tens of thousands of genes in a single
experiment. Hence, this technology provides a powerful tool for
deciphering complex biological systems, and thereby greatly
facilitates research in basic biology and living processes, as well
as disease diagnostics, theranostics, and drug development. In a
typical cell, the mRNAs are distributed in three frequency classes:
(i) superprevalent (10-20% of the total mRNA mass); (ii)
intermediate (40-45%); and (iii) low-abundant mRNAs (40-45%). It is
therefore of utmost importance that the dynamic range and
sensitivity of the expression arrays are optimal, especially when
analyzing expression levels of messages or mRNA splice variants
belonging to the low-abundant class.
[0007] The recent explosion of interest in DNA microarray
technology has been sparked by two key innovations. The first was
the use of non-porous solid support, such as glass or polymer as
opposed to nylon or nitrocellulose filters, which has facilitated
miniaturization and fluorescence-based detection. Roughly 20,000
cDNAs can be robotically spotted onto a microscope slide and
hybridized with a double-labeled probe. The second was the
development of methods for high-density spatial synthesis of
oligonucleotides. The two key array technologies are outlined in
the following.
Oligonucleotide Arrays
[0008] An efficient strategy for oligonucleotide microarray
manufacturing involves DNA synthesis on solid surfaces using
combinatorial chemistry. Most of the current technology is
developed by Affymetrix and Rosetta Inpharmatics. Glass is
currently preferred as the synthesis support because of its inert
chemical properties and low level of intrinsic fluorescence as well
as the ability to chemically derivatize the surface. Of the three
approaches currently used to manufacture oligonucleotide arrays,
the light-directed deprotection method is the most effective one in
generating high density microchips. A single round of synthesis
involves light-directed deprotection, followed by nucleotide
coupling. Photolithographic masking is used to control the regions
of the chip designated for illumination. Affymetrix uses a
combination of photolithography and combinatorial chemistry to
manufacture its GeneChip Arrays. Using technologies adapted from
the semiconductor industry, GeneChip manufacturing begins with a
5-inch square quartz wafer. Initially the quartz is washed to
ensure uniform hydroxylation across its surface. The wafer is
placed in a bath of silane, which reacts with the hydroxyl groups
of the quartz and forms a matrix of covalently linked molecules.
The distance between these silane molecules determines the probes'
packing density, allowing arrays to hold over 500,000 features
within 1.28 square centimeters. The principal disadvantage of this
method is that a significant amount of chip design work and cost is
associated with the mask design. Once a set of masks has been made,
a large number of chips can be produced at a reasonable cost. The
current pricing of oligonucleotide arrays available from Affymetrix
are in the range of 5-10 fold more expensive than cDNA
microarrays.
[0009] DNA-DNA hybridization using oligonucleotide chips is clearly
different from that of cDNA microarrays. Hybridizations involving
oligos are much more sensitive to the GC content of individual
heteroduplexes. In addition, single base mismatches have a
pronounced effect on the hybridization reassociation of short
oligos, and point mutations can thus be readily detected using
oligo chips.
cDNA Microarrays
[0010] cDNA microarrays containing large DNA segments such as cDNAs
are generated by physically depositing small amounts of each DNA of
interest onto known locations on glass surfaces. Two technologies
for printing microarrays are (1) mechanical microspotting, and (2)
ink-jetting. Mechanical microspotting has been extensively used at,
e.g., Stanford University, and it utilizes pins or capillaries to
deposit small quantities of DNA onto known addresses using motion
control systems. Recent advances in microspotting technology using
modem arraying robots allow for the preparation of 100 microarrays
containing over 10,000 features in less than 12 hours. A DNA
arrayer is relatively easy to set up, and the cost is usually low
compared to on-chip oligoarrayers. cDNA microarrays are capable of
profiling gene expression patterns of tens of thousands of genes in
a single experiment. To compare the relative abundance of the
arrayed gene sequences in two DNA or RNA samples, e.g., the total
mRNA isolated from two different cell populations, the two samples
are first labeled using two different fluorescent dyes such as Cy-3
and Cy-5. The labeled samples are mixed and hybridized to the
clones on the array slide. After the hybridization, laser
excitation of the incorporated, fluorescent target molecules yields
an emission with a characteristic spectra, which is measured with a
confocal laser scanner. The monochrome images from the scanner are
imported to the software in which the images are pseudo-colored and
merged. Data from a single hybridization is viewed as a normalized
ratio in which significant deviations from the ratio are indicative
of either increased or decreased expression levels relative to the
reference sample. Data from multiple experiments can be examined
using any number of data mining tools.
Current Status of Array Technology
[0011] It has now become clear that cDNA microarrays, originally
developed by Pat Brown and co-workers at the Stanford University,
are sensitive, but may not be sufficiently specific with respect
to, e.g., discrimination of homologous transcripts in gene families
and alternatively spliced isoforms. On the other hand, the
Affymetrix GeneChip system is specific, but may not be sensitive
enough. This lack of sensitivity may explain why Affymetrix uses
16.times.26-mer perfect match capture probes together with
16.times.25-mer mismatch probes per transcript in its expression
profiling chips resulting in enormous data sets in genome-wide
arrays. Therefore, the finctional genomics field is in the process
of switching, as they run out of samples, from existing
PCR-amplified cDNA fragment libraries for microarraying to custom
longmer oligonucleotide arrays comprising transcript-specific
oligonucleotide capture probes typically in the range of 30-mers to
80-mers, thus addressing both specificity and sensitivity.
Alternative Splicing
[0012] As the field of genomics research is shifting from the
acquisition of genome sequences to high-throughput finctional
genomics, there is an increasing need to understand the dynamics
within the genetic regulation as well as RNA and protein sequences
in order to elucidate gene expression in all its complexity. A
common feature for eukaryotic genes is that they are composed of
protein-encoding exons and introns. Introns (intra-genic-regions)
are non-coding DNA which interrupt the exons. Introns are
characterized by being excised from the pre-mRNA molecule in RNA
splicing, as the sequences on each side of the intron are spliced
together. RNA splicing not only provides functional mRNA, but is
also responsible for generating additional diversity. This
phenomenon is called alternative splicing, which results in the
production of different mRNAs from the same gene. The mRNAs that
represent isoforms arising from a single gene can differ by the use
of alternative exons or retention of an intron that disrupts two
exons. This process often leads to different protein products that
may have related or drastically different, even antagonistic,
cellular functions. There is increasing evidence indicating that
alternative splicing is very widespread (Croft et al. Nature
Genetics, 2000). Recent studies have revealed that at least 60% of
the roughly 35,000 genes in the human genome are alternatively
spliced. Clearly, by combining different types of modifications and
thus generating different possible combinations of transcripts of
different genes, alternative splicing is a potent mechanism for
generating protein diversity. Analysis of the spliceome, in turn,
represents a novel approach to both functional genomics and
pharmacogenomics.
Antisense Transcription in Eukaryotes
[0013] RNA-mediated gene regulation is widespread in higher
eukaryotes and complex genetic phenomena like RNA interference,
co-suppression, transgene silencing, imprinting, methylation, and
possibly position-effect variegation and transvection, all involve
intersecting pathways based on or connected to RNA signalling
(Mattick 2001; EMBO reports 2, 11: 986-991). Recent studies
indicate that antisense transcription is a very common phenomenon
in the mouse and human genomes (Okazaki et al. 2002; Nature 420:
563-573; Yelin et al. 2003, Nature Biotechnol.). Thus, antisense
modulation of gene expression in e.g. human cells may be a common
regulatory mechanism. In light of this, the present invention
provides novel tools, in which non-naturally occurring nucleic
acids, such as LNA oligonucleotides, can be designed to silence or
modulate the regulation of a given mRNA by non-coding antisense
RNA, by designing a complementary sense LNA oligonucleotide for the
regulatory antisense RNA. This has a high potential in target
identification, target validation and therapeutic use of LNA
oligonucleotides as modulating and silencing sense nucleic acid
agents.
Misplaced Control of Alternative Splicing can Cause Disease
[0014] The detection of the detailed structure of all transcripts
is an important goal for molecular characterization of a cell or
tissue. Without the ability to detect and quantify the splice
variants present in one tissue, the transcript content or the
protein content cannot be described accurately. Molecular medical
research shows that many cancers result in altered levels of splice
variants, so an accurate method to detect and quantify these
transcripts is required. Mutations that produce an aberrant splice
form can also be the primary cause of such severe diseases such as
spinal muscular dystrophy and cystic fibrosis.
[0015] Much of the study of human disease, indeed much of genetics
is based upon the study of a few model organisms. The evolutionary
stability of alternative splicing patterns and the degree to which
splicing changes according to mutations and environmental and
cellular conditions influence the relevance of these model systems.
At present, there is little understanding of the rates at which
alternative splicing patterns change, and the factors influencing
these rates. Table 1 shows a set of genes that are known to be
alternatively spliced and that are orthologs of known human disease
genes. TABLE-US-00001 TABLE 1 C. elegans disease orthologs that are
known to be differentially spliced in C. elegans. Disease C.
elegans gene BLAST E value brABL1 M79.1A 1.00E-162 X-Linked
Lymphoprol.-SH2D1A M79.1A 2.00E-58 Cyclin Dep. Kinase 4-CDK4
F18H3.5A 1.00E-124 HNPCC*-PMS2 H12C20.2A 1.00E-123
Neurofibromatosis 2-NF2 C01G8.5A 5.00E-163 Duchenne MD+-DMD
F32B4.3A 0.00E+00 Coffin-Lowry-RPS6KA3 T01H8.1A 2.00E-13 Septooptic
Dysplasia-HESX1 Y113G7A.6A 1.00E-152 Non-Insulin Dep. Diabet.-PCSK1
F11A6.1A 1.00E-166 Bartter's-SLC12A1 Y37A1C.1A 1.00E-167
Gitelmans-SLC12A3 Y37A1C.1A 0.00E+00 Hered. Spherocytosis-ANK1
B0350.2A 1.00E-09 Darier-White-SERCA K11D9.2A 0.00E+00
Spondyloepip.Dysp.-COL2A1 F01G12.5A/let-2 9.00E-20
[0016] Previously, other microarray analyses have been performed
with the aim of detecting either splicing of RNA transcripts per se
in yeast, or of detecting putative exon skipping splicing events in
rat tissues, but neither of these approaches had sufficient
resolution to estimate quantities of splice variants, a factor that
could be essential to an understanding of the changes in cell life
cycle and disease.
[0017] Thus, improved methods are needed for nucleic acid
amplification, hybridization, and classification. Desirable methods
can distinguish between mRNA splice variants and quantitate the
amount of each variant in a sample. Other desirable methods can
detect differences in expressions patterns between patient nucleic
acid samples and nucleic acid standards.
SUMMARY OF THE INVENTION
[0018] The present invention demonstrates the usefulness of
LNA-modified oligonucleotides in the construction of highly
specific and sensitive microarrays for expression profiling (e.g.,
mRNA splice variant detection) and comparative genomic
hybridization. The invention provides novel technology platforms
based on nucleic acids with LNA or other high affinity nucleotides
for sensitive and specific assessment of alternative splicing using
microarray technology. As opposed to high-density cDNA or DNA
oligonucleotide microarrays, LNA microarrays are able to
discriminate between highly homologous as well as differentially
spliced transcripts. The invention furthermore provides methods for
highly sensitive and specific nucleic acid detection by
fluorescence in situ hybridization using LNA-modified
oligonucleotides. The present methods greatly facilitate the
analysis of gene expression patterns from a particular species,
tissue, cell type. The analysis of the human spliceome provides
important information for pharmacogenetics. Thus, the present
methods are highly valuable in medical research and diagnostics as
well as in drug development and toxicological studies.
[0019] In general, the invention features populations of high
affinity nucleic acids that have duplex stabilizing properties and
thus are useful for a variety of nucleic acid detection,
amplification, and hybridization methods (e.g., expression or mRNA
splice variant profiling). Some of these oligonucleotides contain
novel nucleotides created by combining specialized synthetic
nucleobases with an LNA backbone, thus creating high affinity
oligonucleotides with specialized properties such as reduced
sequence discrimination for the complementary strand or reduced
ability to form intramolecular double stranded structures. The
invention also provides improved methods for identifying nucleic
acids in a sample and for classifying a nucleic acid sample by
comparing its pattern of hybridization to an array to the
corresponding pattern of hybridization of one or more standards to
the array (e.g., comparative genomic hybridization).
[0020] Other desirable modified bases have decreased ability to
self-anneal or to form duplexes with oligonucleotides containing
one or more modified bases. The invention also provides arrays of
nucleic acids containing these modified bases that have a decreased
variance in melting temperature and/or an increased capture
efficiency compared to naturally-occurring nucleic acids. These
arrays as well as the oligonucleotides in solution can be used in a
variety of applications for the detection, characterization,
identification, and/or amplification of one or more target nucleic
acids. These oligonucleotides and oligonucleotides of the invention
in general can also be used for solution assays, such as
homogeneous assays.
Merged Probes
[0021] In one aspect, the invention features a
non-naturally-occurring nucleic acid with a melting temperature
that is at least 3, 5, 8, 10, 12, 15, 20, 25, 30, 35, or 40.degree.
C. higher than that of the corresponding control nucleic acid with
2'-deoxynucleotides. The nucleic acid hybridizes to a first region
within a first exon of a target nucleic acid and to a second region
within a second exon of the target nucleic acid that is adjacent to
the first exon.
[0022] In a related aspect, the invention provides a
non-naturally-occurring nucleic acid with a melting temperature
that is at least 3, 5, 8, 10, 12, 15, 20, 25, 30, 35, or 40.degree.
C. higher than that of the corresponding control nucleic acid with
2'-deoxynucleotides. The nucleic acid hybridizes to a first region
within an exon of a target nucleic acid and to a second region
within an intron of the target nucleic acid that is adjacent to the
exon.
[0023] In another aspect, the invention features a
non-naturally-occurring nucleic acid with a melting temperature
that is at least 3, 5, 8, 10, 12, 15, 20, 25, 30, 35, or 40.degree.
C. higher than that of the corresponding control nucleic acid with
2'-deoxynucleotides. The nucleic acid hybridizes to a first region
within a first intron of a target nucleic acid and to a second
region within a second intron of the target nucleic acid that is
adjacent to the first intron.
[0024] In yet another aspect, the invention provides a nucleic acid
that is a non-naturally-occurring nucleic acid with a capture
efficiency that is at least 10, 25, 50, 100, 150, 200, 500, 800,
1000, or 1200% greater than that of a corresponding control nucleic
acid with 2'-deoxynucleotides at the temperature equal to the
melting temperature of the nucleic acid. The nucleic acid
hybridizes to a first region within a first exon of a target
nucleic acid and to a second region within a second exon of the
target nucleic acid that is adjacent to the first exon.
[0025] In a related aspect, the invention features a nucleic acid
that is a non-naturally-occurring nucleic acid with a capture
efficiency that is at least 10, 25, 50, 100, 150, 200, 500, 800,
1000, or 1200% greater than that of a corresponding control nucleic
acid with 2'-deoxynucleotides at the temperature equal to the
melting temperature of the nucleic acid. The nucleic acid
hybridizes to a first region within an exon of a target nucleic
acid and to a second region within an intron of the target nucleic
acid that is adjacent to the exon.
[0026] In yet another aspect, the invention provides a nucleic acid
that is a non-naturally-occurring nucleic acid with a capture
efficiency that is at least 10, 25, 50, 100, 150, 200, 500, 800,
1000, or 1200% greater than that of a corresponding control nucleic
acid with 2'-deoxynucleotides at the temperature equal to the
melting temperature of the nucleic acid. The nucleic acid
hybridizes to a first region within a first intron of a target
nucleic acid and to a second region within a second intron of the
target nucleic acid that is adjacent to the first intron.
[0027] In desirable embodiments, the nucleic acids of the invention
featuring a non-naturally occurring nucleic acid exhibit increased
duplex stability due to slower rates of dissociation of the nucleic
acid complexes (the off-rate) (Christensen et al. 2001, Biochem. J.
354: 481-484).
[0028] In one aspect of the invention the structure of desirable
adenosine, thymine, guanine and cytosine analogs are those
disclosed in PCT Publication No. WO 97/12896, Formula 5, 6, 7, 8,
9, 10, 11, 12 and 13. These modified bases may be incorporated as
part of an LNA, DNA, or RNA unit and used any of the oligomers of
the invention.
[0029] In still another aspect, the invention features a nucleic
acid that is an LNA (i.e., a nucleic acids with one or more LNA
units) and that hybridizes to a first region within a first exon of
a target nucleic acid and to a second region within a second exon
of the target nucleic acid that is adjacent to the first exon.
[0030] In another aspect, the invention features a nucleic acid
that is an LNA and that hybridizes to a first region within an exon
of a target nucleic acid and to a second region within an intron of
the target nucleic acid that is adjacent to the exon.
[0031] In one aspect, the invention provides nucleic acid that is
an LNA and that hybridizes to a first region within a first intron
of a target nucleic acid and to a second region within a second
intron of the target nucleic acid that is adjacent to the first
intron.
[0032] In desirable embodiments of any of the above aspects, the
length of the segment of the nucleic acid hybridizing to the first
region and the length of the segment of the nucleic acid
hybridizing to the second region are between 3 and 50 nucleotides,
10 and 40 nucleotides, or 20 and 30 nucleotides, inclusive. The
length of the segment of the nucleic acid hybridizing to the first
region and the length of the segment of the nucleic acid
hybridizing to the second region may be the same length or
different lengths. Desirably, the nucleic acid containing LNA units
are symmetrically spaced on both sides of a junction between either
two exons, an exon and an intron, or two introns, or alternatively,
the nucleic acid containing LNA units are spaced on both sides of a
junction based on equalized duplex melting temperatures of the
segments. Desirably, the nucleic acid has one or more LNA units
within 5, 4, 3, 2, or 1 nucleotides of a junction between either
two exons, an exon and an intron, or two introns.
[0033] In another aspect, the invention features a population of
nucleic acids that includes one or more nucleic acids of any one of
the above aspects.
Internal Probes
[0034] In another aspect, the invention features a
non-naturally-occurring nucleic acid with a melting temperature
that is at least 3, 5, 8, 10, 12, 15, 20, 25, 30, 35, or 40.degree.
C. higher than that of the corresponding control nucleic acid with
2'-deoxynucleotides. The nucleic acid hybridizes to only one exon
or to only one intron of a target nucleic acid.
[0035] In a related aspect, the invention features a
non-naturally-occurring nucleic acid with a capture efficiency that
is at least 10, 25, 50, 100, 150, 200, 500, 800, 1000, or 1200%
greater than that of a corresponding control nucleic acid with
2'-deoxynucleotides at the temperature equal to the melting
temperature of the nucleic acid. The nucleic acid hybridizes to
only one exon or to only one intron of a target nucleic acid.
[0036] In another aspect, the invention features a nucleic acid
that is an LNA and that hybridizes to only one exon or to only one
intron of a target nucleic acid.
[0037] In desirable embodiments of the above aspects for nucleic
acids that hybridizes to only one exon or only one intron, the
nucleic acid does not hybridize to both an exon and an intron.
[0038] In another aspect, the invention features a population of
nucleic acids that includes one or more nucleic acids of any one of
the above aspects.
Pharmaceutical Compositions and Nucleic Acid Populations
[0039] In another aspect, the invention features a pharmaceutical
composition that includes one or more of the nucleic acids of the
invention and a pharmaceutically acceptable carrier, such as one of
the carriers described herein.
[0040] In another aspect, the invention features a population of
two or more nucleic acids of the invention. The populations of
nucleic acids of the invention may contain any number of unique
molecules. For example, the population may contain as few as 10,
10.sup.2, 10.sup.4, or 10.sup.5 unique molecules or as many as
10.sup.7, 10.sup.8, 10.sup.9 or more unique molecules. In desirable
embodiments, at least 1, 5, 10, 50, 100 or more of the
polynucleotide sequences are a non-naturally-occurring sequence.
Desirably, at least 20, 40, or 60% of the unique polynucleotide
sequences are non-naturally-occurring sequences. Desirably, the
nucleic acids are all the same length; however, some of the
molecules may differ in length.
Desirable Embodiments of Any of the Above Aspects
[0041] In desirable embodiments of any of the above aspects, the
length of one or more nucleic acids (e.g., nucleic acids in a
nucleic acid population of the invention) is between 15 and 150
nucleotides, 5 and 100 nucleotides, 20 and 80 nucleotides, or 30
and 60 nucleotides in length, inclusive. In particular embodiments,
the nucleic acid is 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18,
19, 20, 30, 40, 50 nucleotides or at least 60, 70, 80, 90, 100,
120, or 130 nucleotides in length. In additional embodiments, the
nucleic acid is between 8 and 40 nucleotides, such as between 9 and
30, or 12 and 25, or 15 and 20 nucleotides. Desirably, at least 5,
10, 15, 20, 30, 40, 50, 60, or 70% of the nucleotides in the
nucleic acid are LNA units. In desirable embodiments, every second
nucleotide, every third, every fourth nucleotide, every fifth
nucleotide, or every sixth nucleotide in the nucleic acid is an LNA
unit. In various embodiments, (i) every second and every third
nucleotide, (ii) every second and every fourth nucleotide, (iii)
every second and every fifth nucleotide, (iv) every second and
every sixth nucleotide, (v) every third and every fourth
nucleotide, (vi) every third and every fifth nucleotide, (vii)
every third and every sixth nucleotide, (viii) every fourth and
every fifth nucleotide, (ix) every fourth and every sixth
nucleotide, and/or (x) every fifth and every sixth nucleotide in
the nucleic acid is an LNA unit. Desirably, every second, every
third, and every fourth nucleotide in the nucleic acid is an LNA
unit. In desirable embodiments, the nucleic acids of the invention
have one or more of the following substitution patterns which is
repeated throughout the nucleic acids: XxXx, xXxX, XxxXxx, xXxxXx,
xxXxxX, XxxxXxxx, xXxxxXxx, xxXxxxXx, or xxxXxxxX in which "X"
denotes an LNA unit and "x" denotes a DNA or RNA unit. In some
embodiments, the nucleotides that are not LNA units are
naturally-occuring DNA or RNA nucleotides.
[0042] In various embodiments, the nucleic acid comprises two or
more contiguous LNA units. Desirably, the nucleic acid comprises at
least 2, 3, 4, 5, 6, 7, or 8 contiguous LNA units. In desirable
embodiments, the number of contiguous LNA units is between 5 and
20% or 10 and 15% of the total length of the nucleic acid. In a
particular embodiment, 5 contiguous nucleotides of a 50-mer merged
probe are LNA units. In one embodiment, the nucleic acid does not
have greatly extended stretches of modified DNA or RNA residues,
e.g. greater than about 4, 5, 6, 7, or 8 consecutive modified DNA
or RNA residues. According to this embodiment, one or more
non-modified DNA or RNA units are present after a consecutive
stretch of about 3, 4, 5, 6, 7, or 8 modified nucleic acids.
[0043] Other desirable nucleic acids have an LNA substitution
pattern that results in the formation of negligible secondary
structure by the nucleic acids with itself. In one such embodiment,
the nucleic acids do not form hairpins or do not form other
secondary structures that would otherwise inhibit or prevent their
binding to a target nucleic acid. Desirably, opposing nucleotides
in a palindrome pair or opposing nucleotides in inverted repeats or
in reverse complements are not both LNA units. In various
embodiments, the nucleic acids in the first population form less
than 3, 2, or 1 intramolecular base-pairs or base-pairs between two
identical molecules. In desirable embodiments, the nucleic acid
does not have LNA-5-nitroindole: LNA-5-nitroindole intramolecular
base-pairs.
[0044] In other desirable embodiments, at least one LNA unit (e.g.,
at least 2, 3, 4, 5, 6, 7, 8, 9, or 10 LNA units) in the nucleic
acid hybridizes to a first region within a first exon of a target
nucleic acid and at least one LNA unit (e.g., at least 2, 3, 4, 5,
6, 7, 8, 9, or 10 LNA units) in the nucleic acid hybridizes to a
second region within a second exon of the target nucleic acid that
is adjacent to the first exon. The number of LNA units that bind to
each region can be the same or different. In some embodiments, the
5' terminal nucleotide of the nucleic acid is or is not an LNA
unit. Desirably, the 3' terminal nucleotide of the nucleic acid is
not an LNA unit (e.g., the nucleic acid may contain a 3' terminal
naturally-occurring nucleotide).
[0045] Desirably, the nucleic acid can distinguish between
different nucleic acids (e.g., mRNA splice variants) that cannot be
distinguished using a naturally-occurring control nucleic acid
(e.g., a control nucleic acid that consists of only
2'-deoxynucleotides such as a control nucleic acid of the same
length as the nucleic acid of the invention). Desirably, the
hybridization intensity of the nucleic acid for an exon of interest
is at least 2, 3, 4, 5, 6, or 10 fold greater than the
hybridization intensity of the nucleic acid for another exon in the
same target nucleic acid (e.g., mRNA) or in another nucleic acid.
Desirably, the hybridization intensity of the nucleic acid for
target nucleic acid is at least 2, 3, 4, 5, 6, or 10 fold greater
than the hybridization intensity for a non-target nucleic acid with
less than 99, 95, 90, 80, 70, or 60% sequence identity to the
target nucleic acid.
[0046] Desirably, all of the nucleic acids of the population or all
of the nucleic acids of a subpopulation of the population are the
same length. In some embodiments, the population includes one or
more nucleic acids of a different length. In some embodiments,
longer nucleic acids contain one or more nucleotides with universal
bases. For example, nucleotides with universal bases can be used to
increase the thermal stability of nucleic acids that would
otherwise have a thermal stability lower than some or all of the
nucleic acids in the population. In some embodiments, one or more
nucleic acids have a universal base located at the 5' or 3'
terminus of the nucleic acid. In desirable embodiments, one or more
(e.g., 2, 3, 4, 5, 6, or more) universal bases are located at the
5' and 3' termini of the nucleic acid. Desirably, all of the
nucleic acids in the population have the same number of universal
bases. Desirable universal bases include inosine, pyrene,
3-nitropyrrole, and 5-nitroindole.
[0047] In desirable embodiments, the nucleic acid has at least one
LNA A or LNA T. In some embodiments, each nucleic acid has at least
one LNA A or LNA T. Desirably, all of the adenine and
thymine-containing nucleotides in the LNA are LNA A and LNA T,
respectively. In some embodiments, a nucleic acid with a increased
capture efficiency or melting temperature compared to a control
nucleic acid has at least one LNA T or LNA C. In some embodiments,
all of the thymine and cytosine-containing nucleotides in the LNA
are LNA T and LNA C, respectively. In some embodiments, a nucleic
acid with an increased specificity or decreased
self-complementarity compared to a control nucleic acid has at
least one LNA A or LNA C. In some embodiments, all of the adenine
and cytosine-containing nucleotides in the LNA are LNA A and LNA C,
respectively. Desirably, at least 10, 20, 25, 30, 40, 50, 60, 70,
80, 90, or 100% of the nucleic acids in the population have one ore
more LNA units.
[0048] In desirable embodiments, the LNA has at least one
2,6,-diaminopurine, 2-aminopurine, 2-thio-thymine, 2-thio-uracil,
inosine, or hypoxanthine base. Desirably, the LNA has a nucleotide
with a 2'O, 4'C-methylene linkage between the 2' and 4' position of
a sugar moiety. In some embodiments, one or more nucleic acids in
the first population are LNA/DNA, LNA/RNA, or LNA/DNA/RNA
chimeras.
[0049] In desirable embodiments of any of the above aspects, the
variance in the melting temperature of the population is at least
10, 20, 30, 40, 50, 60, or 70% less than the variance in the
melting temperature of the corresponding control population of
nucleic acids of the same length with 2'-deoxynucleotides (e.g.,
DNA nucleotides) instead of LNA units or other modified or
non-naturally-occurring units. In desirable embodiments, the
standard deviation in melting temperature is less than 10, 9.5, 9,
8.5, 8, 7.5, 7, 6.5, or 6. In certain embodiment, the range in
melting temperatures for nucleic acids in the population is less
than 70, 60, 50, 40, 30, or 20.degree. C. Desirably, the variance
in the melting temperature of the population is less than 59, 50,
40, 30, 25, 20, 15, 10, or 5.degree. C.
[0050] In still other embodiments, the nucleic acids are covalently
bonded to a solid support. Desirably, the nucleic acids are in a
predefined arrangement. In various embodiments, the first
population has at least 10; 100; 1,000; 5,000; 10,000; 100,000; or
1,000,000 different nucleic acids. Desirably, the nucleic acids in
the population together hybridize to at least 10, 20, 30, 40, 50,
60, 70, 80, 90, 95, or 100% of the exons of a target nucleic acid.
In desirable embodiments, the population includes nucleic acids
that together hybridize to at least 10, 20, 30, 40, 50, 60, 70, 80,
90, 95, or 100% of the nucleic acids expressed by a particular cell
or tissue. In some embodiments, the population includes nucleic
acids that together hybridize to at least one exon from at least 1,
5, 10, 20, 25, 30, 40, 50, 60, 70, 80, 90, or 100% of the nucleic
acid sequences expressed by a particular cell or tissue at a given
point in time (e.g., an expression array with sequences
corresponding to the sequences of mRNA molecules expressed by a
particular cell type or a cell under a particular set of
conditions). In some embodiments, the plurality of nucleic acids
are used as PCR primers or FISH probes.
[0051] Desirable modified bases of the present invention when
incorporated into the central position of a 9-mer oligonucleotide
(all other eight residues or units being natural DNA or RNA units
with natural bases) exhibit a T.sub.m difference equal to or less
than about 15, 12, 10, 9, 8, 7, 6, 5, 4, 3 or 2.degree. C. upon
hybridizing to the four complementary oligonucleotide variants that
are identical except for the unit corresponding to the LNA unit,
where each variant has one of the natural bases uracil, cytosine,
thymine, adenine or guanine. That is, the highest and the lowest
T.sub.m (referred to herein as the T.sub.m differential) obtained
with such four complementary sequences is 15, 12, 10, 9, 8, 7, 6,
5, 4, 3 or 2.degree. C. or less.
[0052] Modified nucleic acid oligomers of the invention desirably
contain at least one LNA unit, such as an LNA unit with a modified
nucleobase. Modified nucleobases or nucleosidic bases desirably
base-pair with adenine, guanine, cytosine, uracil, or thymine.
Exemplary oligomers contain 2 to 100, 5 to 100, 4 to 50, 5 to 50, 5
to 30, or 8 to 15 nucleic acid units. In some embodiments, one or
more LNA units with natural nucleobases are incorporated into the
oligonucleotide at a distance from the LNA unit having a modified
base of 1 to 6 (e.g., 1 to 4) bases. In certain embodiments, at
least two LNA units with natural nucleobases are flanking an LNA
unit having a modified base. Desirably, at least two LNA units
independently are positioned at a distance from the LNA unit having
the modified base of 1 to 6 (e.g., 1 to 4 bases).
[0053] Desirable modified nucleobases or nucleosidic bases for use
in nucleic acid compositions of the invention include optionally
substituted carbon alicyclic or carbocyclic aryl groups (i.e., only
carbon ring members), particularly multi-ring carbocyclic aryl
groups such as groups having 2, 3, 4, 5, 6, 7, or 8 linked,
particularly fused carbocyclic aryl moieties. Optionally
substituted pyrene is also desirable. Such nucleobases or
nucleosidic bases can provide significant performance results, as
demonstrated in the examples which follow. Heteroalicyclic and
heteroaromatic nucleobases or nucleosidic bases also are suitable.
In some embodiments, the carbocyclic moiety is linked to the
1'-position of the LNA unit through a linker (e.g., a branched or
straight alkylene or alkenylene).
[0054] Desirable LNA units have a carbon or hetero alicyclic ring
with four to six ring members, e.g. a furanose ring, or other
alicyclic ring structures such as a cyclopentyl, cycloheptyl,
tetrahydropyranyl, oxepanyl, tetrahydrothiophenyl, pyrrolidinyl,
thianyl, thiepanyl, piperidinyl, and the like. In one aspect, at
least one ring atom of the carbon or hetero alicyclic group is
taken to form a further cyclic linkage to thereby provide a
multi-cyclic group. The cyclic linkage may include one or more,
typically two atoms, of the carbon or hetero alicyclic group. The
cyclic linkage also may include one or more atoms that are
substituents, but not ring members, of the carbon or hetero
alicyclic group. Other desirable LNA units are compounds having a
substituent on the 2'-position of the central sugar moiety (e.g.,
ribose or xylose), or derivatives thereof, which favors the
C3'-endo conformation, commonly referred to as the North (or simply
N for short) conformation. These LNA units include ENA
(2'-O,4'-C-ethylene-bridged nucleic acids such as those disclosed
in WO 00/47599) units as well as non-bridged riboses such as 2'-F
or 2'-O-methyl.
[0055] For any of the above aspects, an exemplary control nucleic
acid has .beta.-D-2-deoxyribose instead of one or more bicyclic or
sugar groups of a LNA unit or other modified or
non-naturally-occurring units in a nucleic acid of the first
population. In some embodiments, the nucleic acid or population of
the invention and the control nucleic acid or population only have
naturally-occurring nucleobases. If a nucleic acid in the nucleic
acid or population of the invention has one or more
non-naturally-occurring nucleobases, the capture efficiency of the
corresponding control nucleic acid is calculated as the average
capture efficiency for all of the nucleic acids that have either A,
T, C, G or mC (methyl Cytosin) in each position corresponding to a
non-naturally-occurring nucleobase in the nucleic acid in the first
population.
Complex of Target Nucleic Acids and Nucleic Acid Probes
[0056] In one aspect, the invention features a complex of one or
more target nucleic acids and nucleic acid of the invention (e.g.,
nucleic acid probes) in which one or more target nucleic acids are
hybridized to a plurality of nucleic acids of the invention.
Desirably, at least 2, 3, 4, 5, 6, 7, 10, 15, 20, 30, or 40
different target nucleic acids are hybridized. In some embodiments,
the target nucleic acids are cDNA molecules reverse transcribed
from a patient sample or cRNA molecules amplified from a patient
sample using a T7 RNA polymerase-based linear amplification system
or the like. The target nucleic acids are labeled prior to
hybridization to the nucleic acids of invention.
Methods for Detecting or Amplifying Target Nucleic Acids
[0057] In one aspect, the invention features a method for detecting
the presence of one or more target nucleic acids in a sample. This
method involves incubating a nucleic acid sample with one or more
nucleic acids of the invention under conditions that allow at least
one target nucleic acid to hybridize to at least one of the nucleic
acids of the invention. Desirably, hybridization is detected for at
least 2, 3, 4, 5, 6, 8, 10, or 12 target nucleic acids. In some
embodiments, the method further includes contacting the target
nucleic acid with a second nucleic acid or a population of second
nucleic acids that binds to a different region of the target
molecule than the first nucleic acid. Desirably, the method further
involves identifying one or more hybridized target nucleic acids
and/or determining the amount of one or more hybridized target
nucleic acids. In desirable embodiments, the method further
includes determining the presence or absence of an mRNA splice
variant of interest in the sample and/or determining the presence
or absence of a mutation, deletion, and/or duplication of an exon
of interest. In some embodiments, the mutation, deletion, and/or
duplication is indicative of a disease, disorder, or condition,
such as cancer.
[0058] In desirable embodiments of any of the above detection
methods, at least 5, 10, 15, 20, 30, 40, 50, 80, 100, 150, 200, or
more target nucleic acids hybridize to the nucleic acids of the
invention. Desirably, the method is repeated under one or more
different incubation conditions. In particular embodiments, the
method is repeated at 1, 3, 5, 8, 10, 15, 20, 30, 40 or more
different temperatures, cation concentrations (e.g., concentrations
of monovalent cations such as Na.sup.+ and K.sup.+ or divalent
cations such as Mg.sup.2+ and Ca.sup.2+), denaturants (e.g.,
hydrogen bond donors or acceptors that interfere with the hydrogen
bonds keeping the base-pairs together such as formamide or urea).
Desirably, the method also includes identifying the target nucleic
acid hybridized to the nucleic acids of the invention and/or
determining the amount of the target nucleic acid hybridized to the
nucleic acids of the invention. In particular embodiments, the
target nucleic acids are labeled with a fluorescent group. In
certain embodiments, the labeling is repeated using different
fluorescent groups (e.g., labelling for so-called dye-swap labeling
experiments).
[0059] In desirable embodiments, the determination of the amount of
bound target nucleic acid involves one or more of the following:
(i) adjusting for the varying intensity of the excitation light
source used for detection of the hybridization, (ii) adjusting for
photobleaching of the fluorescent group, and/or (iii) comparing the
fluorescent intensity of the target nucleic acid(s) hybridized to
the nucleic acids of the invention of nucleic acids to the
fluorescent intensity of a different sample of nucleic acids
hybridized to the nucleic acids of the invention (e.g., a different
sample hybridized to the same population of nucleic acids of the
invention on the same or a different solid support such as the same
chip or a different chip). Desirably, this comparison in
fluorescent intensity involves adjusting for a difference in the
amount of the nucleic acids of the invention used for hybridization
to each sample and/or adjusting for a difference in the buffer
(e.g., a difference in Mg.sup.2+ concentration) used for
hybridization to each sample or scaling for different labeling
efficiencies with different fluorochromes.
[0060] Desirably, the target nucleic acids are cDNA molecules
reverse transcribed from a patient sample or cRNA molecules
amplified using a T7 RNA polymerase-based linear amplification
system or the like from a patient sample. In particular
embodiments, the sample has nucleic acids that are amplified using
one or more primers specific for an exon of a target nucleic acid,
and the method involves determining the presence or absence of an
mRNA splice variant with the exon in the sample. Desirably, one or
more of the primers are specific for an exon or exon-exon junction
of a pathogen of interest, and the method involves determining the
presence or absence of a nucleic acid with the exon in the
sample.
[0061] In a desirable embodiment, the nucleic acids of the
invention are covalently bonded to a solid support by reaction of a
nucleoside phosphoramidite with an activated solid support, and
subsequent reaction of a nucleoside phosphoramide with an activated
nucleotide or nucleic acid bound to the solid support. In some
embodiments, the solid support or the growing nucleic acid bound to
the solid support is activated by illumination, a photogenerated
acid, or electric current.
[0062] In another aspect, the invention features a method for
amplifying a target nucleic acid molecule. The method involves (a)
incubating a first nucleic acid of the invention with a target
nucleic acid under conditions that allow the first nucleic acid to
bind the target nucleic acid; and (b) extending the first nucleic
acid with the target nucleic acid as a template. Desirably, the
method further involves contacting the target nucleic acid with a
second nucleic acid (e.g., a second nucleic acid of the invention)
that binds to a different region of the target nucleic acid than
the first nucleic acid. In various embodiments, the sequence of the
target nucleic acid is known or unknown.
[0063] In one aspect, the invention features a method of detecting
a nucleic acid of a pathogen (e.g., a nucleic acid in a sample such
as a blood or urine sample from a mammal). This method involves
contacting a nucleic acid probe of the invention (e.g., a probe
specific for an exon or a mRNA from a particular pathogen or family
of pathogens) with a nucleic acid sample under conditions that
allow the probe to hybridize to at least one nucleic acid in the
sample. The probe is desirably at least 60, 70, 80, 90, 95, or 100%
complementary to a nucleic acid of a pathogen (e.g., a bacteria,
virus, or yeast such as any of the pathogens described herein).
Hybridization between the probe and a nucleic acid in the sample is
detected, indicating that the sample contains the corresponding
nucleic acid from a pathogen. In some embodiments, the method is
used to determine what strain of a pathogen has infected a mammal
(e.g., a human) by determining whether a particular nucleic acid is
present in the sample. In other embodiments, the probe has a
universal base in a position corresponding to a nucleotide that
varies among different strains of a pathogen, and thus the probe
detects the presence of a nucleic acid from any of a multiple of
pathogenic strains.
Methods for Classifying Nucleic Acids Samples
[0064] In one aspect, the invention features a method for
classifying a test nucleic acid sample including target nucleic
acids. This method involves (a) incubating a test nucleic acid
sample with a one or more nucleic acids of the invention under
conditions that allow at least one of the nucleic acids in the test
sample to hybridize to at least one nucleic acid of the invention,
(b) detecting a hybridization pattern of the test nucleic acid
sample, and (c) comparing the hybridization pattern to a
hybridization pattern of a first nucleic acid standard, whereby the
comparison indicates whether or not the test sample has the same
classification as the first standard. Desirably, the method also
includes comparing a hybridization pattern of the test nucleic acid
sample to a hybridization pattern of a second standard. In various
embodiments, a hybridization pattern of the test nucleic acid
sample is compared to at least 3, 4, 5, 8, 10, 15, 20, 30, 40, or
more standards.
[0065] Desirably, the method also includes identifying the
hybridized target nucleic acid and/or determining the amount of
hybridized target nucleic acid. In particular embodiments, the
target nucleic acids are labeled with a fluorescent group.
Desirably, the first nucleic acid standard is labeled with a
different fluorescent group. The fluorescence of the target nucleic
acids and the first nucleic acid standard can be detected
simultaneously or sequentially.
[0066] In desirable embodiments, the method further includes
determining the presence or absence of an mRNA splice variant of
interest in the sample and/or determining the presence or absence
of a mutation, deletion, and/or duplication of an exon of interest.
In some embodiments, the mutation, deletion, and/or duplication is
indicative of a disease, disorder, or condition, such as
cancer.
[0067] In desirable embodiments, the determination of the amount of
bound target nucleic acid involves one or more of the following:
(i) adjusting for the varying intensity of the excitation light
source used for detection of the hybridization, (ii) adjusting for
photobleaching of the fluorescent group, and/or (iii) comparing the
fluorescent intensity of the target nucleic acid(s) hybridized to
the nucleic acids of the invention to the fluorescent intensity of
a different sample of nucleic acids hybridized to the nucleic acids
of the invention (e.g., a different sample hybridized to same set
of nucleic acids of the invention on the same or a different solid
support such as the same chip or a different chip). Desirably, this
comparison in fluorescent intensity involves adjusting for a
difference in the amount of the plurality used for hybridization to
each sample and/or adjusting for a difference in the buffer (e.g.,
a difference in Mg.sup.2+ concentration) used for hybridization to
each sample.
[0068] Desirably, the nucleic acids in the population together
hybridize to at least 10, 20, 30, 40, 50, 60, 70, 80, 90, 95, or
100% of the exons of a target nucleic acid. In desirable
embodiments, the population includes nucleic acids that together
hybridize to at least 10, 20, 30, 40, 50, 60, 70, 80, 90, 95, or
100% of the nucleic acids expressed by a particular cell or tissue.
In some embodiments, the population includes nucleic acids that
together hybridize to at least one exon from at least 1, 5, 10, 20,
25, 30, 40, 50, 60, 70, 80, 90, or 100% of the nucleic acid
sequences expressed by a particular cell or tissue at a given point
in time (e.g., an expression array with sequences corresponding to
the sequences of mRNA molecules expressed by a particular cell type
or a cell under a particular set of conditions). Desirably, the
method further includes using a nucleic acid or a region of a
nucleic acid that is present in a first test sample but not present
in a first standard or not present in a second test sample as a
probe or primer for the detection, amplification, or
characterization of the nucleic acid.
[0069] In desirable embodiments of any of the above methods, at
least 5, 10, 15, 20, 30, 40, 50, 80, 100, 150, 200, or more target
nucleic acids hybridize to the nucleic acids of the invention.
Desirably, the method is repeated under one or more different
incubation or hybridization conditions. In particular embodiments,
the method is repeated at 1, 3, 5, 8, 10, 15, 20, 30, 40 or more
different temperatures, cation concentrations (e.g., concentration
of monovalent cations such as Na.sup.+ and K.sup.+ or divalent
cations such as Mg.sup.2+ and Ca.sup.2), denaturants (e.g.,
hydrogen bond donors or acceptors that interfere with the hydrogen
bonds keeping the base-pairs together such as formamide or
urea).
[0070] In particular embodiments, the sample has nucleic acids that
are amplified using one or more primers specific for an exon of a
target nucleic acid, and the method involves determining the
presence or absence of an mRNA splice variant with the exon in the
sample. Desirably, one or more of the primers are specific for an
exon or exon-exon junction of a pathogen of interest, and the
method involves determining the presence or absence of a nucleic
acid with the exon in the sample.
[0071] Desirably, the comparison of the hybridization pattern of a
patient nucleic acid sample to that of one or more standards is
used to determine whether or not a patient has a particular
disease, disorder, condition, or infection or an increased risk for
a particular disease, disorder, condition, or infection. In some
embodiments, the comparison is used to determine what pathogen has
infected a patient and to select a therapeutic for the treatment of
the patient. Desirably, the comparison is used to select a
therapeutic for the treatment or prevention of a disease or
disorder in the patient. In yet other embodiments, the comparison
is used to include or exclude the patient from a group in a
clinical trial. Desirably, the comparison is used to compare the
expression of nucleic acids (e.g., mRNA splice forms associated
with toxicity) in the presence and absence of a candidate compound
(e.g., a lead compound for drug development). In other embodiments,
the comparison is used to determine differences in expression of
nucleic acids (e.g., mRNA splice variants) under particular
conditions (e.g., under different environmental stress conditions)
or at different developmental time points. In particular
embodiments, the expression of one or more members from a
particular enzyme class (e.g., protein kinase splice variants) is
measured.
[0072] In a desirable embodiment, the nucleic acids of the
invention are covalently bonded to a solid support by reaction of a
nucleoside phosphoramidite with an activated solid support, and
subsequent reaction of a nucleoside phosphoramide with an activated
nucleotide or nucleic acid bound to the solid support. In some
embodiments, the solid support or the growing nucleic acid bound to
the solid support is activated by illumination, a photogenerated
acid, or electric current.
[0073] The use of a variety of different monomers in the nucleic
acids of the invention offers a means to "fine tune" the chemical,
physical, biological, pharmacokinetic, and pharmacological
properties of the nucleic acids thereby facilitating improvement in
their safety and efficacy profiles when used as a therapeutic
drug.
Applications for the Nucleic Acids of the Invention
[0074] In another aspect, the invention features the use of one ore
more nucleic acids of the invention for the detection,
amplification, or classification of a nucleic acid of interest or a
population of nucleic acids of interest.
[0075] In another aspect, the invention features the use of one or
more nucleic acids of the invention for alternative mRNA splice
variant detection, expression profiling, comparative genomic
hybridization, or real-time PCR. In exemplary real-time PCR
applications, the nucleic acids are used to determine the amount of
one or more target nucleic acids (e.g., mRNA splice variants) in a
sample. In particular embodiments, fluorescently labeled RT-PCR
products from the amplification of a test nucleic acid sample are
hybridized to a population of nucleic acids of the invention.
Desirably, the amount of one or more RT-PCR products is measured to
determine the amount of the corresponding nucleic acid in the
initial sample.
[0076] In yet another aspect, the invention features the use of a
nucleic of the invention as a PCR primer or FISH probe.
Methods for Selecting a Population of Nucleic Acid
[0077] In one aspect, the invention features a method of selecting
a nucleic acid for a population of nucleic acids. This method
involves (a) determining the melting temperature of a nucleic acid
of the invention, determining the ability of the nucleic acid to
self-anneal, determining the ability of the nucleic acid to
hybridize to one or more exons or introns of a target nucleic acid,
and/or determining the ability of the nucleic acid to hybridize to
a non-target nucleic acid, and (b) selecting the nucleic acid for
inclusion or exclusion from the population based on the
determination in step (a). In desirable embodiments, step (a) is
performed for at least 2, 3, 4, 5, 6, 10, 20, 50, 100, 200, 500,
1,000, 5,000 or more nucleic acids, and a subset of the nucleic
acids are selected for inclusion in the population based on the
determination in step (a). Desirably, the nucleic acids with the
highest melting temperatures and/or ability to hybridize to one or
more exons or introns of a target nucleic acid are selected.
Desirably, the nucleic acids with the lowest ability to self-anneal
and/or hybridize to a non-target nucleic acid are selected.
Databases with Hybridization Patterns of Nucleic Acids Samples
and/or Standards
[0078] The invention also features a variety of databases. These
databases are useful for storing the information obtained in any of
the methods of the invention. These databases may also be used in
the diagnosis of disease or an increased risk for a disease or in
the selection of a desirable therapeutic for a particular patient
or class of patients.
[0079] Accordingly, in one such aspect, the invention provides an
electronic database including at least 1, 10, 10.sup.2, 10.sup.3,
5.times.10.sup.3, 10.sup.4, 10.sup.5, 10.sup.6, 10.sup.7, 10.sup.8,
or 10.sup.9 records of a nucleic acid of interest or a population
of nucleic acids of interest (e.g., one or more nucleic acids in a
standard or in a test nucleic acid sample) correlated to records of
its hybridization pattern to a plurality of nucleic acids of the
invention under one or more incubation conditions (e.g., one or
more temperatures, denaturant concentrations, or salt
concentrations).
[0080] In another aspect, the invention features computer including
the database of the above aspect and a user interface (i) capable
of displaying a hybridization pattern for a nucleic acid of
interest or a population of nucleic acids of interest whose record
is stored in the computer or (ii) capable of displaying a nucleic
acid of interest (e.g., displaying the polynucleotide sequence or
another identifying characteristic of the nucleic acid of interest)
or a population of nucleic acids of interest that produces a
hybridization pattern whose record is stored in the computer.
[0081] Methods for Silencing a Target Nucleic Acid in a Cell or
Animal One method for inhibiting specific gene expression involves
the use of antisense or double stranded oligonucleotides, which are
complementary to a specific target messenger RNA (mRNA) sequence,
such as a specific mRNA splice variant. Of special interest are
oligonucleotides with a modified backbone (such as LNA or
phosphorothioate) that are not readily degraded by endonucleases in
the target cells.
[0082] In one aspect, the invention features the use of a nucleic
acid of the invention for the manufacture of a pharmaceutical
composition for treatment of a disease curable by an antisense or
RNAi technology.
[0083] In one aspect, the invention provides a method for
inhibiting the expression of a target nucleic acid in a cell. The
method involves introducing into the cell a nucleic acid of the
invention in an amount sufficient to specifically attenuate
expression of the target nucleic acid. The introduced nucleic acid
has a nucleotide sequence that is essentially complementary to a
region of desirably at least 20 nucleotides of the target nucleic
acid. Desirably, the cell is in a mammal.
[0084] In a related aspect, the invention provides a method for
preventing, stabilizing, or treating a disease, disorder, or
condition associated with a target nucleic acid in a mammal. This
method involves introducing into the mammal a nucleic acid of the
invention in an amount sufficient to specifically attenuate
expression of the target nucleic acid, wherein the introduced
nucleic acid has a nucleotide sequence that is essentially
complementary to a region of desirably at least 20 nucleotides of
the target nucleic acid.
[0085] In another aspect, the invention provides a method for
preventing, stabilizing, or treating a pathogenic infection in a
mammal by introducing into the mammal a nucleic acid of the
invention in an amount sufficient to specifically attenuate
expression of a target nucleic acid of a pathogen. The introduced
nucleic acid has a nucleotide sequence that is essentially
complementary to a region of desirably at least 20 nucleotides of
the target nucleic acid.
[0086] In desirable embodiments of the therapeutic methods of the
above aspects, the mammal is a human. In some embodiments, the
introduced nucleic acid is single stranded or double stranded.
[0087] With respect to the therapeutic methods of the invention, it
is not intended that the administration of nucleic acids to a
mammal be limited to a particular mode of administration, dosage,
or frequency of dosing; the present invention contemplates all
modes of administration, including oral, intraperitoneal,
intramuscular, intravenous, intraarticular, intralesional,
subcutaneous, or any other route sufficient to provide a dose
adequate to prevent or treat a disease (e.g., a disease associated
with the expression of a target nucleic acid that is silenced with
a nucleic acid of the invention). One or more nucleic acids may be
administered to the mammal in a single dose or multiple doses. When
multiple doses are administered, the doses may be separated from
one another by, for example, one week, one month, one year, or ten
years. It is to be understood that, for any particular subject,
specific dosage regimes should be adjusted over time according to
the individual need and the professional judgment of the person
administering or supervising the administration of the
compositions.
[0088] Exemplary mammals that can be treated using the methods of
the invention include humans, primates such as monkeys, animals of
veterinary interest (e.g., cows, sheep, goats, buffalos, and
horses), and domestic pets (e.g., dogs and cats). Exemplary cells
in which one or more target genes can be silenced using the methods
of the invention include invertebrate, plant, bacteria, yeast, and
vertebrate (e.g., mammalian or human) cells.
[0089] Optimum dosages for gene silencing applications may vary
depending on the relative potency of individual oligonucleotides,
and can generally be estimated based on EC.sub.50 values found to
be effective in in vitro and in vivo animal models. In general,
dosage is from 0.001 .mu.g to 100 g per kg of body weight (e.g.,
0.001 .mu.g/kg to 1 g/kg), and may be given once or more daily,
weekly, monthly or yearly, or even once every 2 to 20 years (U.S.
Pat. No. 6,440,739). Persons of ordinary skill in the art can
easily estimate repetition rates for dosing based on measured
residence times and concentrations of the drug in bodily fluids or
tissues. Following successful treatment, it may be desirable to
have the patient undergo maintenance therapy to prevent the
recurrence of the disease state, wherein the oligonucleotide is
administered in maintenance doses, ranging from 0.001 ug to 100 g
per kg of body weight (e.g., 0.001 .mu.g/kg to 1 g/kg), once or
more daily, to once every 20 years. If desired, conventional
treatments may be used in combination with the nucleic acids of the
present invention.
[0090] Suitable carriers include, but are not limited to, saline,
buffered saline, dextrose, water, glycerol, ethanol, and
combinations thereof. The composition can be adapted for the mode
of administration and can be in the form of, for example, a pill,
tablet, capsule, spray, powder, or liquid. In some embodiments, the
pharmaceutical composition contains one or more pharmaceutically
acceptable additives suitable for the selected route and mode of
administration. These compositions may be administered by, without
limitation, any parenteral route including intravenous,
intra-arterial, intramuscular, subcutaneous, intradermal,
intraperitoneal, intrathecal, as well as topically, orally, and by
mucosal routes of delivery such as intranasal, inhalation, rectal,
vaginal, buccal, and sublingual. In some embodiments, the
pharmaceutical compositions of the invention are prepared for
administration to vertebrate (e.g., mammalian) subjects in the form
of liquids, including sterile, non-pyrogenic liquids for injection,
emulsions, powders, aerosols, tablets, capsules, enteric coated
tablets, or suppositories.
Exemplary Oligomers of the Invention and Methods for Synthesizing
them
[0091] In desirable embodiments, the invention features a method of
synthesizing a nucleic acid. This method involves synthesizing a
2-thio-uridine nucleoside or nucleotide of formula IV using a
compound of formula VIII, IX, X, XI, or XII as shown below. The
nucleoside, nucleoside phosphoramidite, or nucleotide is
incorporated into a nucleic acid of the invention. ##STR1##
[0092] In a particular embodiment, nucleobase thiolation is
performed on the O2 position of compound XI to form compound IV. In
another embodiment, sulphurization on both O2 and O4 in compound
VIII generates a 2,4-dithio-uridine nucleoside or nucleotide of
formula X which is converted into compound IV. In yet another
embodiment, a cyclic ether of formula XI is transferred into
compound IV or a 2-O-alkyl-uridine nucleoside or nucleotide of
formula XII through reaction with the 5' position. In other
embodiments, a 2-O-alkyl-uridine nucleoside or nucleotide of
formula XII is generated by direct alkylation of a uridine
nucleoside or nucleotide of formula VIII.
[0093] In desirable embodiments R.sup.4 and R.sup.2 are each
independently alkyl (e.g., methyl or ethyl), acyl (e.g., acetyl or
benzoyl), or any appropriate protecting group such as silyl,
4,4'-dimethoxytrityl, monomethoxytrityl, or
trityl(triphenylmethyl). R.sup.5'' is any appropriate protecting
group such as silyl, 4,4'-dimethoxytrityl, monomethoxytrityl,
trityl(triphenylmethyl), acetyl, benzoyl, or benzyl. In desirable
embodiments, R.sup.5 is hydrogen, alkyl (e.g., methyl or ethyl),
1-propynyl, thiazol-2-yl, pyridine-2-yl, thien-2-yl, imidazol-2-yl,
(4/5-methyl)-thiazol-2-yl, 3-(iodoacetamido)propyl,
4-[N,N-bis(3-aminopropyl)amino]butyl), or halo (e.g., chloro,
bromo, iodo, fluoro).
[0094] The group --OR.sup.3' in the formulas IV, VIII, IX, X, XI,
and XII is any of the groups listed for R.sup.3 or R.sup.3' in
formula Ia or formula Ib or listed for R.sup.3 or R.sup.3* in
formula IIa, Scheme A, or Scheme B, or the group --OR.sup.3' or
R.sup.3' in the formulas IV, VIII, IX, X, XI, and XII is selected
from the group consisting of H, --OH,
P(O(CH.sub.2).sub.2CN)N(iPr).sub.2,
P(O(CH.sub.2).sub.2CN)N(iPr).sub.2, phosphate, phosphorothioate,
phosphorodithioate, phosphoramidate, phosphoroselenoate,
phosphorodiselenoate, alkylphosphotriester, methyl phosphonate,
halo (e.g., chloro, fluoro, iodo, or bromo), optionally substituted
aryl, (e.g., phenyl or benzyl), alkyl (e.g, methyl or ethyl),
alkoxy (e.g., methoxy), acyl (e.g., acetyl or benzoyl), aroyl,
aralkyl, hydroxy, hydroxyalkyl, alkoxy, aryloxy, aralkoxy, nitro,
cyano, carboxy, alkoxycarbonyl, aryloxycarbonyl, aralkoxycarbonyl,
acylamino, aroylamine, alkylsulfonyl, arylsulfonyl,
heteroarylsulfonyl, alkylsulfinyl, arylsulfinyl,
heteroarylsulfinyl, alkylthio, arylthio, heteroarylthio,
aralkylthio, heteroaralkylthio,amidino, amino, carbamoyl,
sulfamoyl, alkene, alkyne, protecting groups (e.g., silyl,
4,4'-dimethoxytrityl, monomethoxytrityl, or
trityl(triphenylmethyl)), linkers (e.g., a linker containing an
amine, ethylene glycol, quinone such as anthraquinone), detectable
labels (e.g., radiolabels or fluorescent labels), and biotin.
[0095] The group --OR.sup.5' in the formulas IV, and VIII, IX, X,
and XII is any of the groups listed for R.sup.5 or R.sup.5' in
formula Ia or formula Ib or listed for R.sup.5 or R.sup.5* in
formula IIa, Scheme A, or Scheme B, or the group --OR.sup.5' or
R.sup.5' in the formulas IV, and VIII, IX, X, and XII is selected
from the group consisting of H, --OH,
P(O(CH.sub.2).sub.2CN)N(iPr).sub.2,
P(O(CH.sub.2).sub.2CN)N(iPr).sub.2, phosphate, phosphorothioate,
phosphorodithioate, phosphoramidate, phosphoroselenoate,
phosphorodiselenoate, alkylphosphotriester, methyl phosphonate,
halo (e.g., chloro, fluoro, iodo, or bromo), optionally substituted
aryl, (e.g., phenyl or benzyl), alkyl (e.g, methyl or ethyl),
alkoxy (e.g., methoxy), acyl (e.g. acetyl or benzoyl), aroyl,
aralkyl, hydroxy, hydroxyalkyl, alkoxy, aryloxy, aralkoxy, nitro,
cyano, carboxy, alkoxycarbonyl, aryloxycarbonyl, aralkoxycarbonyl,
acylamino, aroylamine, alkylsulfonyl, arylsulfonyl,
heteroarylsulfonyl, alkylsulfinyl, arylsulfinyl,
heteroarylsulfinyl, alkylthio, arylthio, heteroarylthio,
aralkylthio, heteroaralkylthio,amidino, amino, carbamoyl,
sulfamoyl, alkene, alkyne, protecting groups (e.g., silyl,
4,4'-dimethoxytrityl, monomethoxytrityl, or
trityl(triphenylmethyl)), linkers (e.g., a linker containing an
amine, ethylene glycol, quinone such as anthraquinone), detectable
labels (e.g., radiolabels or fluorescent labels), and biotin.
[0096] In yet another aspect, the invention features a method of
synthesizing a nucleic acid. This method involves synthesizing a
2-thiopyrimidine nucleoside or nucleotide of formula IV using a
compound of formula III or compounds of the formula I, II, and III
as shown below. The nucleoside, nucleoside phosphoramidite, or
nucleotide is incorporated into a nucleic acid of the invention.
##STR2##
[0097] In some embodiments, lewis acid-catalyzed condensation of a
substituted sugar of formula I and a substituted 2-thio-uracil of
formula II results in a substituted 2-thio-uridine nucleoside or
nucleotide of the formula III. In some embodiments, a compound of
formula III is converted into a LNA 2-thiouridine nucleoside or
nucleotide of formula IV.
[0098] In desirable embodiments R.sup.4' and R.sup.5' are, e.g.,
methanesulfonyloxy, p-toluenesulfonyloxy, or any appropriate
protecting group such as silyl, 4,4'-dimethoxytrityl,
monomethoxytrityl, trityl(triphenylmethyl), acetyl, benzoyl, or
benzyl, R.sup.1' is, e.g., acetyl, benzoyl, alkoxy (e.g., methoxy).
R.sup.2' is, e.g.,acetyl or benzoyl, and R.sup.3' is any
appropriate protecting group such as silyl, 4,4'-dimethoxytrityl,
monomethoxytrityl, trityl(triphenylmethyl), acetyl, or benzoyl. In
desirable embodiments, R.sup.5 is hydrogen, alkyl (e.g. methyl or
ethyl), 1-propynyl, thiazol-2-yl, pyridine-2-yl, thien-2-yl,
imidazol-2-yl, (4/5-methyl)-thiazol-2-yl, 3-(iodoacetamido)propyl,
4-[N,N-bis(3-aminopropyl)amino]butyl), or halo (e.g., chloro,
bromo, iodo, fluoro).
[0099] The group --OR.sup.3' in the formulas I, III, and IV is any
of the groups listed for R.sup.3 or R.sup.3' in formula Ia or
formula Ib or listed for R.sup.3 or R.sup.3* in formula IIa, Scheme
A, or Scheme B, or the group --OR.sup.3' or R.sup.3' in the
formulas I, III, and IV is selected from the group consisting of H,
--OH, P(O(CH.sub.2).sub.2CN)N(iPr).sub.2, phosphate,
phosphorothioate, phosphorodithioate, phosphoramidate,
phosphoroselenoate, phosphorodiselenoate, alkylphosphotriester,
methyl phosphonate, halo (e.g., chloro, fluoro, iodo, or bromo),
optionally substituted aryl, (e.g., phenyl or benzyl), alkyl (e.g,
methyl or ethyl), alkoxy (e.g., methoxy), acyl (e.g. acetyl or
benzoyl), aroyl, aralkyl, hydroxy, hydroxyalkyl, alkoxy, aryloxy,
aralkoxy, nitro, cyano, carboxy, alkoxycarbonyl, aryloxycarbonyl,
aralkoxycarbonyl, acylamino, aroylamine, alkylsulfonyl,
arylsulfonyl, heteroarylsulfonyl, alkylsulfinyl, arylsulfinyl,
heteroarylsulfinyl, alkylthio, arylthio, heteroarylthio,
aralkylthio, heteroaralkylthio,amidino, amino, carbamoyl,
sulfamoyl, alkene, alkyne, protecting groups (e.g., silyl,
4,4'-dimethoxytrityl, monomethoxytrityl, or
trityl(triphenylmethyl)), linkers (e.g., a linker containing an
amine, ethylene glycol, quinone such as anthraquinone), detectable
labels (e.g., radiolabels or fluorescent labels), and biotin.
[0100] The group R.sup.5' in the formulas I, III, and IV is any of
the groups listed for R.sup.5 or R.sup.5' in formula Ia or formula
Ib or listed for R.sup.5 or R.sup.5* in formula IIa, Scheme A, or
Scheme B, or R.sup.5' in the formulas I, III, and IV is selected
from the group consisting of H, --OH,
P(O(CH.sub.2).sub.2CN)N(iPr).sub.2, phosphate, phosphorothioate,
phosphorodithioate, phosphoramidate, phosphoroselenoate,
phosphorodiselenoate, alkylphosphotriester, methyl phosphonate,
halo (e.g., chloro, fluoro, iodo, or bromo), optionally substituted
aryl, (e.g., phenyl or benzyl), alkyl (e.g, methyl or ethyl),
alkoxy (e.g., methoxy), acyl (e.g. acetyl or benzoyl), aroyl,
aralkyl, hydroxy, hydroxyalkyl, alkoxy, aryloxy, aralkoxy, nitro,
cyano, carboxy, alkoxycarbonyl, aryloxycarbonyl, aralkoxycarbonyl,
acylamino, aroylamine, alkylsulfonyl, arylsulfonyl,
heteroarylsulfonyl, alkylsulfinyl, arylsulfinyl,
heteroarylsulfinyl, alkylthio, arylthio, heteroarylthio,
aralkylthio, heteroaralkylthio,amidino, amino, carbamoyl,
sulfamoyl, alkene, alkyne, protecting groups (e.g., silyl,
4,4'-dimethoxytrityl, monomethoxytrityl, or
trityl(triphenylmethyl)), linkers (e.g., a linker containing an
amine, ethylene glycol, quinone such as anthraquinone), detectable
labels (e.g., radiolabels or fluorescent labels), and biotin.
[0101] In still another aspect, the invention features a method of
synthesizing a nucleic acid. This method involves synthesizing a
2-thiopyrimidine nucleoside or nucleotide of formula IV using a
compound of formula VII, compounds of the formula V, VI, and VII,
or compounds of the formula I, V, VI, and VII as shown below. The
nucleoside, nucleoside phosphoramidite, or nucleotide is
incorporated into a nucleic acid of the invention. ##STR3##
[0102] In some embodiments, a 2-thio-uridine nucleoside or
nucleotide of the formula IV is synthesized through ring-synthesis
of the nucleobase by reaction of an amino sugar of the formula V
and a substituted isothiocyanate of the formula VI.
[0103] In desirable embodiments, R.sup.4' and R.sup.5' are each
idenpendently, e.g., methanesulfonyloxy, p-toluenesulfonyloxy, or
any appropriate protecting group such as silyl,
4,4'-dimethoxytrityl, monomethoxytrityl, trityl(triphenylmethyl),
acetyl, benzoyl, or benzyl. R.sup.1' is, e.g., acetyl or benzoyl or
alkoxy (e.g., methoxy), and R.sup.2' is, e.g., acetyl or benzoyl,
R.sup.3' is any appropriate protecting group such as silyl,
4,4'-dimethoxytrityl, monomethoxytrityl, trityl(triphenylmethyl),
acetyl, or benzoyl. R.sup.5 are R.sup.6 each idenpendently, e.g.,
hydrogen or alkyl (e.g. methyl or ethyl). R.sup.6 can also be,
e.g., an appropriate protecting group such as silyl,
4,4'-dimethoxytrityl, monomethoxytrityl, or
trityl(triphenylmethyl). In desirable embodiments, R.sup.5 is
hydrogen or methyl, and R.sup.6 is methyl or ethyl.
[0104] The group --OR.sup.3' in the formulas I, V, VII, and IV is
any of the groups listed for R.sup.3 or R.sup.3' in formula Ia or
formula Ib or listed for R.sup.3 or R.sup.3* in formula Ia, Scheme
A, or Scheme B, or the group --OR.sup.3' or R.sup.3' in the
formulas I, V, VII, and IV is selected from the group consisting of
H, --OH, P(O(CH.sub.2).sub.2CN)N(iPr).sub.2, phosphate,
phosphorothioate, phosphorodithioate, phosphoramidate,
phosphoroselenoate, phosphorodiselenoate, alkylphosphotriester,
methyl phosphonate, halo (e.g., chloro, fluoro, iodo, or bromo),
optionally substituted aryl, (e.g., phenyl or benzyl), alkyl (e.g,
methyl or ethyl), alkoxy (e.g., methoxy), acyl (e.g. acetyl or
benzoyl), aroyl, aralkyl, hydroxy, hydroxyalkyl, alkoxy, aryloxy,
aralkoxy, nitro, cyano, carboxy, alkoxycarbonyl, aryloxycarbonyl,
aralkoxycarbonyl, acylamino, aroylamine, alkylsulfonyl,
arylsulfonyl, heteroarylsulfonyl, alkylsulfinyl, arylsulfinyl,
heteroarylsulfinyl, alkylthio, arylthio, heteroarylthio,
aralkylthio, heteroaralkylthio,amidino, amino, carbamoyl,
sulfamoyl, alkene, alkyne, protecting groups (e.g., silyl,
4,4'-dimethoxytrityl, monomethoxytrityl, or
trityl(triphenylmethyl)), linkers (e.g., a linker containing an
amine, ethylene glycol, quinone such as anthraquinone), detectable
labels (e.g., radiolabels or fluorescent labels), and biotin.
[0105] R.sup.5' in the formulas I, V, VII, and IV is any of the
groups listed for R.sup.5 or R.sup.5' in formula Ia or formula Ib
or listed for R.sup.5 or R.sup.5* in formula IIa, Scheme A, or
Scheme B, or R.sup.5' in the formulas I, V, VII, and IV is selected
from the group consisting of H, --OH,
P(O(CH.sub.2).sub.2CN)N(iPr).sub.2 phosphate, phosphorothioate,
phosphorodithioate, phosphoramidate, phosphoroselenoate,
phosphorodiselenoate, alkylphosphotriester, methyl phosphonate,
halo (e.g., chloro, fluoro, iodo, or bromo), optionally substituted
aryl, (e.g., phenyl or benzyl), alkyl (e.g, methyl or ethyl),
alkoxy (e.g., methoxy), acyl (e.g. acetyl or benzoyl), aroyl,
aralkyl, hydroxy, hydroxyalkyl, alkoxy, aryloxy, aralkoxy, nitro,
cyano, carboxy, alkoxycarbonyl, aryloxycarbonyl, aralkoxycarbonyl,
acylamino, aroylamine, alkylsulfonyl, arylsulfonyl,
heteroarylsulfonyl, alkylsulfinyl, arylsulfinyl,
heteroarylsulfinyl, alkylthio, arylthio, heteroarylthio,
aralkylthio, heteroaralkylthio,amidino, amino, carbamoyl,
sulfamoyl, alkene, alkyne, protecting groups (e.g., silyl,
4,4'-dimethoxytrityl, monomethoxytrityl, or
trityl(triphenylmethyl)), linkers (e.g., a linker containing an
amine, ethylene glycol, quinone such as anthraquinone), detectable
labels (e.g., radiolabels or fluorescent labels), and biotin.
[0106] In another aspect, the invention features a method of
synthesizing a nucleic acid. This method involves synthesizing a
2-thiopyrimidine nucleoside as shown below. In desirable
embodiments, the method further comprises reacting one or both
compounds of the formula 4 with a phosphodiamidite (e.g.,
2-cyanoethyl tetraisopropylphosphorodiamidite) to produce the
corresponding nucleoside phosphoramidite. The nucleoside,
nucleoside phosphoramidite, or nucleotide is incorporated into a
nucleic acid of the invention. ##STR4##
[0107] In some embodiments, a glycosyl-donor is coupled to a
nucleobase as shown in pathway A. In other embodiments, ring
synthesis of the nucleobase is performed as show in pathway B. In
still other embodiments, LNA-T diol is modified as shown in pathway
C.
[0108] In desirable embodiments, R is hydrogen, methyl, 1-propynyl,
thiazol-2-yl, pyridine-2-yl, thien-2-yl, imidazol-2-yl,
(4/5-methyl)-thiazol-2-yl, 3-(iodoacetamido)propyl,
4-[N,N-bis(3-aminopropyl)amino]butyl, or halo (e.g., chloro, bromo,
iodo, fluoro). Desirably, R.sub.1, R.sub.2, and R.sub.3 are each
any appropriate protecting group such as acetyl, benzyl, silyl,
4,4'-dimethoxytrityl, monomethoxytrityl, or
trityl(triphenylmethyl).
[0109] In another aspect, the invention features a method of
synthesizing a nucleic acid. This method involves synthesizing a
2-thiopyrimidine nucleoside or nucleotide of formula 4 using a
compound of formula 3, compounds of the formula 2 and 3, or
compounds of the formula 1, 2, 3, and 4 as shown below. The
nucleoside, nucleoside phosphoramidite, or nucleotide is
incorporated into a nucleic acid of the invention. This method can
also be performed using any other appropriate protecting groups
instead of Bn (benzyl), Ac (acetyl), or Ms (methansulfonyl).
##STR5##
[0110] In desirable embodiments, the method further comprises
reacting one or both compounds of the formula 4 with a
phosphodiamidite (e.g., 2-cyanoethyl
tetraisopropylphosphorodiamidite) to produce the corresponding
nucleoside phosphoramidite.
[0111] In another aspect, the invention features a method of
synthesizing a nucleic acid. This method involves synthesizing a
nucleoside or nucleotide of formula 10 or 11 using a compound of
any one of the formula 6-9, compounds of the formula 5 and any one
of the formulas 6-9, or compounds of the formula 4, 5, and any one
of the formulas 6-9 as shown below. The nucleoside, nucleoside
phosphoramidite, or nucleotide is incorporated into a nucleic acid
of the invention. This method can also be performed using any other
appropriate protecting groups instead of DMT, Bn, Ac, or Ms.
##STR6##
[0112] In some embodiments, a compound of formula 4 is used as a
glycosyl donor in a coupling reaction with silylated hypoxantine to
form a compound of the formula 5. In certain embodiments, a
compound of the formula 5 is used in a ring closing reaction to
forma compound of the formula 6. Desirably, deprotection of the
5'-hydroxy group of compound 6 is performed by displacing the
5'-O-mesyl group with sodium benzoate to produce a compound of the
formula 7 that is converted into a compound of the formula 8 after
saponification of the 5'-benzoate. In some embodiments, compound 8
is converted to a DMT-protected compound 9 prior to debenzylation
of the 3'-O-hydroxy group. In desirable embodiments, a
phosphoramidite of the formula 11 is generated by phosphitylation
of a nucleoside of the formula 10.
[0113] In desirable embodiments, the R.sub.1 is H or
P(O(CH.sub.2).sub.2CN)N(iPr).sub.2. In other embodiments, the group
R.sub.1 or --OR.sub.1 is any of the groups listed for R.sup.3 or
R.sup.3' in formula Ia or formula Ib or listed for R.sup.3 or
R.sup.3* in formula IIa, Scheme A, or Scheme B, or the group
--OR.sub.1 or R.sub.1 is selected from the group consisting of
--OH, P(O(CH.sub.2).sub.2CN)N(iPr).sub.2, phosphate,
phosphorothioate, phosphorodithioate, phosphoramidate,
phosphoroselenoate, phosphorodiselenoate, alkylphosphotriester,
methyl phosphonate, halo (e.g., chloro, fluoro, iodo, or bromo),
optionally substituted aryl, (e.g., phenyl or benzyl), alkyl (e.g,
methyl or ethyl), alkoxy (e.g., methoxy), acyl (e.g. acetyl or
benzoyl), aroyl, aralkyl, hydroxy, hydroxyalkyl, alkoxy, aryloxy,
aralkoxy, nitro, cyano, carboxy, alkoxycarbonyl, aryloxycarbonyl,
aralkoxycarbonyl, acylamino, aroylamine, alkylsulfonyl,
arylsulfonyl, heteroarylsulfonyl, alkylsulfinyl, arylsulfinyl,
heteroarylsulfinyl, alkylthio, arylthio, heteroarylthio,
aralkylthio, heteroaralkylthio,amidino, amino, carbamoyl,
sulfamoyl, alkene, alkyne, protecting groups (e.g., silyl,
4,4'-dimethoxytrityl, monomethoxytrityl, or
trityl(triphenylmethyl)), linkers (e.g., a linker containing an
amine, ethylene glycol, quinone such as anthraquinone), detectable
labels (e.g., radiolabels or fluorescent labels), and biotin.
[0114] In another aspect, the invention features a method of
synthesizing a nucleic acid. This method involves synthesizing a
nucleoside or nucleotide of formula 20 or 21 as shown below, in
which compound 4 is the same sugar shown in the above aspect. The
nucleoside, nucleoside phosphoramidite, or nucleotide is
incorporated into a nucleic acid of the invention. This method can
also be performed using any other appropriate protecting groups
instead of DMT, Bn, Bz (benzoyl), Ac, or Ms. Additionally, the
method can be performed with any other halogen (e.g., fluoro or
bromo) instead of chloro. ##STR7## ##STR8##
[0115] In desirable embodiments to promote the ring closing
reaction, a solution of compound 14 in aqueous 1,4-dioxane is
treated with sodium hydroxide to give a bicyclic compound 15. In
some embodiments, sodium benzoate is used for displacement of
5'-mesylate of compound 15 to give compound 16. In some
embodiments, compound 17 is formed by reaction of compound 16 with
sodium azide. In some embodiments, compound 18 is produced by
saponification of the 5'-benzoate of compound 17. In certain
embodiments, hydrogenation of compound 18 produces compound 19. In
certain embodiments, the peracelation method is used to benzolylate
the 2- and 6-amino groups of compound 19, yielding 20, which is
desirably converted into the phosphoramidite compound 21.
[0116] In a related aspect, the invention features a derivative of
a compound of the formula 20 or 21 as described in the above aspect
in which 3'-OH or --OP(O(CH.sub.2).sub.2CN)N(iPr).sub.2 group is
replaced by any other group is selected from the group consisting
of phosphorothioate, phosphorodithioate, phosphoramidate,
phosphoroselenoate, phosphorodiselenoate, alkylphosphotriester,
methyl phosphonate, halo (e.g., chloro, fluoro, iodo, or bromo),
optionally substituted aryl, (e.g., phenyl or benzyl), alkyl (e.g,
methyl or ethyl), alkoxy (e.g., methoxy), acyl (e.g. acetyl or
benzoyl), aroyl, aralkyl, hydroxy, hydroxyalkyl, alkoxy, aryloxy,
aralkoxy, nitro, cyano, carboxy, alkoxycarbonyl, aryloxycarbonyl,
aralkoxycarbonyl, acylamino, aroylamine, alkylsulfonyl,
arylsulfonyl, heteroarylsulfonyl, alkylsulfinyl, arylsulfinyl,
heteroarylsulfinyl, alkylthio, arylthio, heteroarylthio,
aralkylthio, heteroaralkylthio,amidino, amino, carbamoyl,
sulfamoyl, alkene, alkyne, protecting groups (e.g., silyl,
4,4'-dimethoxytrityl, monomethoxytrityl, or
trityl(triphenylmethyl)), linkers (e.g., a linker containing an
amine, ethylene glycol, quinone such as anthraquinone), detectable
labels (e.g., radiolabels or fluorescent labels), and biotin.
##STR9##
[0117] In yet another aspect, the invention features a method of
synthesizing a nucleic acid. This method involves synthesizing a
nucleoside or nucleotide of formula 20 or 21 as shown below. The
nucleoside, nucleoside phosphoramidite, or nucleotide is
incorporated into a nucleic acid of the invention. This method can
also be performed using any other appropriate protecting groups
instead of DMT.
[0118] In some embodiments, compound 17 is formed by reaction of
compound 7 with 1,3-dichloro-1,1,3,3-tetraisopropyldisiloxane.
Desirably, compound 18 is formed by reaction of compound 17 with
phenoxyacetic anhydride. In some embodiments, compound 19 is
generated by reaction of compound 18 with acid. Desirably, compound
20 is produced by reacting compound 19 with DMT-Cl. In desirably
embodiments, compound 20 is reacted with 2-cyanoethyl
tetraisopropylphosphorodiamidite to give the phosphoramidite
21.
[0119] In desirable embodiments, the R is H or
P(O(CH.sub.2).sub.2CN)N(iPr).sub.2. In other embodiments, the R or
--OR is any of the groups listed for R.sup.3 or R.sup.3' in formula
Ia or formula Ib or listed for R.sup.3 or R.sup.3* in formula IIa,
Scheme A, or Scheme B, or the group --OR or R is selected from the
group consisting of --OH, P(O(CH.sub.2).sub.2CN)N(iPr).sub.2,
phosphate, phosphorothioate, phosphorodithioate, phosphoramidate,
phosphoroselenoate, phosphorodiselenoate, alkylphosphotriester,
methyl phosphonate, halo (e.g., chloro, fluoro, iodo, or bromo),
optionally substituted aryl, (e.g., phenyl or benzyl), alkyl (e.g,
methyl or ethyl), alkoxy (e.g., methoxy), acyl (e.g. acetyl or
benzoyl), aroyl, aralkyl, hydroxy, hydroxyalkyl, alkoxy, aryloxy,
aralkoxy, nitro, cyano, carboxy, alkoxycarbonyl, aryloxycarbonyl,
aralkoxycarbonyl, acylamino, aroylamine, alkylsulfonyl,
arylsulfonyl, heteroarylsulfonyl, alkylsulfinyl, arylsulfinyl,
heteroarylsulfinyl, alkylthio, arylthio, heteroarylthio,
aralkylthio, heteroaralkylthio,amidino, amino, carbamoyl,
sulfamoyl, alkene, alkyne, protecting groups (e.g., silyl,
4,4'-dimethoxytrityl, monomethoxytrityl, or
trityl(triphenylmethyl)), linkers (e.g., a linker containing an
amine, ethylene glycol, quinone such as anthraquinone), detectable
labels (e.g., radiolabels or fluorescent labels), and biotin.
[0120] In yet another aspect, the invention features a method of
synthesizing a nucleic acid. This method involves synthesizing a
nucleoside or nucleotide of formula 24 or 25 as shown below. The
nucleoside, nucleoside phosphoramidite, or nucleotide is
incorporated into a nucleic acid of the invention. This method can
also be performed using any other appropriate protecting groups
instead of Bz, Bn, and DMT. Additionally, the method can be
performed with any other halogen (e.g., fluoro or bromo) instead of
chloro. ##STR10##
[0121] In some embodiments, the compound 16 is formed from
compounds 4, 14, and 15 as illustrated in an aspect above.
Desirably, the 5'-O-benzoyl group of compound 16 is hydrolyzed by
aqueous sodium hydroxyde to give compound 22. Compound 23 is
desirably produced by incubation of compound 22 in the presence of
paladium hydroxide and ammonium formate. Desirably, the 2-amine of
compound 23 is selectively protected with an amidine group after
treatment with N,N-dimethylformamide dimethyl acetal to yield
compound 24. In some embodiments, the diol 24 is 5'-O-DMT protected
and 3'-O-phosphitylated produce the phosphoramidite LNA-2AP
compound 25.
[0122] In some embodiments, compound 25 has one of the following
groups instead of the P(O(CH.sub.2).sub.2CN)N(iPr).sub.2 group: any
of the groups listed for R.sup.3 or R.sup.3' in formula Ia or
formula Ib or listed for R.sup.3 or R.sup.3* in formula IIa, Scheme
A, or Scheme B, or a group selected from the group consisting of
--OH, phosphate, phosphorothioate, phosphorodithioate,
phosphoramidate, phosphoroselenoate, phosphorodiselenoate,
alkylphosphotriester, methyl phosphonate, halo (e.g., chloro,
fluoro, iodo, or bromo), optionally substituted aryl, (e.g., phenyl
or benzyl), alkyl (e.g, methyl or ethyl), alkoxy (e.g., methoxy),
acyl (e.g. acetyl or benzoyl), aroyl, aralkyl, hydroxy,
hydroxyalkyl, alkoxy, aryloxy, aralkoxy, nitro, cyano, carboxy,
alkoxycarbonyl, aryloxycarbonyl, aralkoxycarbonyl, acylamino,
aroylamine, alkylsulfonyl, arylsulfonyl, heteroarylsulfonyl,
alkylsulfinyl, arylsulfinyl, heteroarylsulfinyl, alkylthio,
arylthio, heteroarylthio, aralkylthio, heteroaralkylthio, amidino,
amino, carbamoyl, sulfamoyl, alkene, alkyne, protecting groups
(e.g., silyl, 4,4'-dimethoxytrityl, monomethoxytrityl, or
trityl(triphenylmethyl)), linkers (e.g., a linker containing an
amine, ethylene glycol, quinone such as anthraquinone), detectable
labels (e.g., radiolabels or fluorescent labels), and biotin.
[0123] In another aspect, the invention features a nucleic acid of
the invention that includes a compound of the formula 6pCor the
product of a compound of the formula 6pC treated with ammonia as
described herein. In a related aspect, the invention features a
method of synthesizing a nucleic acid that involves performing one
or more of the steps described herein for the synthesis of a
compound of the formula 6pCor the product of a compound of the
formula 6pC treated with ammonia.
[0124] In yet another aspect, the invention features a method of
synthesizing a nucleic acid. This method involves one or more of
any of the nucleosides or nucleotides of the invention with (i) any
other nucleoside or nucleotide of the invention, (ii) any other
nucleoside or nucleotide of formula Ia, formula lb, formula IIa,
Scheme A, or Scheme B, and/or (iii) any naturally-occurring
nucleoside or nucleotide. Desirably, the method involves reacting
one or more nucleoside phosphoramidites of any of the above aspects
with a nucleotide or nucleic acid.
Methods for Synthesis of Nucleic Acids on a Solid Support
[0125] In another aspect, the invention provides a method for the
synthesis of a population of nucleic acids (e.g., a population of
nucleic acids of the invention) on a solid support. This method
involves the reaction of a plurality of nucleoside phosphoramidites
with an activated solid support (e.g., a solid support with an
activated linker) and the subsequent reaction of a plurality of
nucleoside phosphoramidites with activated nucleotides or nucleic
acids bound to the solid support.
[0126] In some embodiments of any of the above aspects, the solid
support or the growing nucleic acid bound to the solid support is
activated by illumination, a photogenerated acid, or electric
current. In desirable embodiments, one or more spots or regions
(e.g., a region with an area of less than 1 cm.sup.2, 0.1 cm.sup.2,
0.01 cm.sup.2, 1 mm.sup.2, or 0.1 mm.sup.2 that desirably contains
one particular nucleic acid monomer or oligomer) on the solid
support are irradiated to produce a photogenerated acid that
removes the 5'-OH protecting group of one or more nucleic acid
monomers or oligomers to which a nucleotide is subsequently added.
In other embodiments, an electric current is applied to one or more
spots or regions (e.g., a region with an area of less than 1
cm.sup.2, 0.1 cm.sup.2, 0.01 cm.sup.2, 1 mm.sup.2, or 0.1 mm.sup.2
that desirably contains one particular nucleic acid monomer or
oligomer) on the solid support to remove an electrochemically
sensitive protecting group of one or more nucleic acid monomers or
oligomers to which a nucleotide is subsequently added. In still
other embodiments, one or more spots or regions (e.g., a region
with an area of less than 1 cm.sup.2, 0.1 cm.sup.2, 0.01 cm.sup.2,
1 mm.sup.2, or 0.1 mm.sup.2 that desirably contains one particular
nucleic acid monomer or oligomer) on the solid support are
irradiated to remove a photosensitive protecting group of one or
more nucleic acid monomers or oligomers to which a nucleotide is
subsequently added. In various embodiments, the solid support
(e.g., chip, coverslip, microscope glass slide, quartz, or silicon)
is less than 1, 0.5, 0.1. or 0.05 mm thick.
Methods for the Synthesis of Nucleic Acids
[0127] In another aspect, the invention features a method of
reacting a population of nucleic acids of the invention with one or
more nucleic acids. This method involves incubating an immobilized
population of nucleic acids of the invention with a solution that
includes one or more probes (e.g., at least 2, 3, 4, 5, 10, 15, 20,
30, 40, 50, 60, 80, 100, or 150 different nucleic acids) and one or
more target nucleic acids (e.g., at least 2, 3, 4, 5, 10, 15, 20,
30, 40, 50, 60, 80, 100, or 150 different target nucleic acids).
The incubation is performed in the presence of a ligase under
conditions that allow the ligase to covalently react one or more
immobilized nucleic acids with one or more nucleic acid probes in
solution that hybridize to the same target nucleic acid. Desirably,
at least 2, 5, 10, 15, 20, 30, 40, 50, 80, or 100 pairs of
immobilized nucleic acids and nucleic acid probes are ligated. In
various embodiments, the incubation occurs between 15 and
45.degree. C., such as between 20 and 40.degree. C. or between 25
and 35.degree. C.
Desirable Embodiments of Any of the Aspects of the Invention
[0128] In other embodiments of any of various aspects of the
invention, a nucleic acid probe or primer specifically hybridizes
to a target nucleic acid but does not substantially hybridize to
non-target molecules, which include other nucleic acids in a cell
or biological sample having a sequence that is less than 99, 95,
90, 80, or 70% identical or complementary to that of the target
nucleic acid. Desirably, the amount of the these non-target
molecules hybridized to, or associated with, the nucleic acid probe
or primer, as measured using standard assays, is 2-fold, desirably
5-fold, more desirably 10-fold, and most desirably 50-fold lower
than the amount of the target nucleic acid hybridized to, or
associated with, the nucleic acid probe or primer. In other
embodiments, the amount of a target nucleic acid hybridized to, or
associated with, the nucleic acid probe or primer, as measured
using standard assays, is 2-fold, desirably 5-fold, more desirably
10-fold, and most desirably 50-fold greater than the amount of a
control nucleic acid hybridized to, or associated with, the nucleic
acid probe or primer. In certain embodiments, the nucleic acid
probe or primer is substantially complementary (e.g., at least 80,
90, 95, 98, or 100% complementary) to a target nucleic acid or a
group of target nucleic acids from a cell. In other embodiments,
the probe or primer is homologous to multiple RNA or DNA molecules,
such as RNA or DNA molecules from the same gene family. In other
embodiments, the probe or primer is homologous to a large number of
RNA or DNA molecules. In desirable embodiments, the probe or primer
binds to nucleic acids which have polynucleotide sequences that
differ in sequence at a position that corresponds to the position
of a universal base in the probe or primer. Examples of control
nucleic acids include nucleic acids with a random sequence or
nucleic acids known to have little, if any, affinity for the
nucleic acid probe or primer. In some embodiments, the target
nucleic acid is an RNA, DNA, or cDNA molecule.
[0129] Desirably, the association constant (K.sub.a) of the nucleic
acid toward a complementary target molecule is higher than the
association constant of the complementary strands of the double
stranded target molecule. In some desirable embodiments, the
melting temperature of a duplex between the nucleic acid and a
complementary target molecule is higher than the melting
temperature of the complementary strands of the double stranded
target molecule.
[0130] In some embodiments, the LNA-pyrene is in a position
corresponding to the position of a non-base (e.g., a unit without a
base) in another nucleic acid, such as a target nucleic acid.
Incorporation of pyrene in a DNA strand that is hybridized against
the four natural bases decreases the T.sub.m by -4.5.degree. C. to
-6.8.degree. C.; however, incorporation of pyrene in a DNA strand
in a position opposite a non-base only decreases the T.sub.m by
-2.3.degree. C. to -4.6.degree. C., most likely due to the better
accommodation of the pyrene in the B-type duplex (Matray and Kool,
J. Am. Chem. Soc. 120, 6191, 1998). Thus, incorporation on
LNA-pyrene into a nucleic acid in a position opposite a non-base
(e.g., a unit without a base or a unit with a small group such as a
noncyclic group instead of a base) in a target nucleic acid may
also minimize any potential decrease in T.sub.m due to the pyrene
substitution.
[0131] In various embodiments, the number of molecules in the
plurality of nucleic acids of the invention is at least 2, 4, 5, 6,
7, 8, or 10-fold greater than the number of molecules in the test
nucleic acid sample. In some embodiments, a LNA is a
triplex-forming oligonucleotide.
[0132] In desirable embodiments of any of the aspects of the
invention, the target nucleic acids (e.g., cDNA molecules reverse
transcribed from a patient sample or cRNA molecules amplified from
a patient sample using a T7 RNA polymerase-based amplification
system or the like) are fragmented using an enzyme such as a
uracil-DNA glycosylase (e.g., E. coli uracil-DNA glycosylase) or
using chemical hydrolysis such as alkaline hydrolysis. In various
embodiments, the average size of the fragmented nucleic acids is
between 300 and 50 nucleic acids, such as approximately 300, 200,
100, or 50 nucleotides.
Advantages
[0133] The present invention has a variety of advantages related to
nucleic acid analysis methods. The ability to equalize melting
temperatures of a series of nucleic acids is generally applicable
and desirable in all situations where more than one sequence is
used simultaneously (e.g. DNA arrays with more than one capture
probe, PCR and especially multiplex PCR, homogeneous assays such as
Taqman and Molecular beacon). Sample preparation of specific
sequences (e.g., DNA or RNA extraction using capture probes on
filters or magnetic beads) is another area where melting
temperature equalization of specific probe sequences is useful.
[0134] For example, the invention provides high affinity
nucleotides (e.g., LNA and other high affinity nucleotides with a
modified base and/or backbone) that can be used, e.g., arrays of
the invention. In particular, the nucleic acids of the invention
containing LNA units exhibited a suprising ability to discriminate
between different mRNA splice variants compared to
naturally-occurring nucleic acids. If desired, universal bases can
be added as part of flanking regions in capture probes (e.g.,
probes of an array) to stabilize hybridization with high affinity
nucleotides in the capture probes. Replacement of one or more DNA-t
nucleotides with LNA-T and/or replacement of one or more DNA-a
nucleotides with LNA-A reduces the variability of melting
temperatures for capture probes of similar length but different GC
and AT content by desirably at least 10, 20, 30, 40 or 50%.
Additionally, replacement of one or more DNA-t nucleotides with
LNA-T and/or replacement of one or more DNA-c with LNA-C increases
the stability of a large number of capture probes, while desirably
avoiding self-complementary sequences with LNA:LNA base-pairs
within a capture probe that would otherwise reduce or eliminate the
binding of target molecules to the probe. Although a general T and
C substitution may not reduce the variability of melting
temperatures of the probes, this substitution increases the melting
temperature and binding efficiency of many capture probes that
contain these two nucleotides.
[0135] The invention also provides a general substitution algorithm
for enhancement of the hybridization signal of a test nucleic acid
sample by inclusion of high affinity monomers (e.g., LNA and other
high affinity nucleotides with a modified base and/or backbone) in
the array. This method increases the stability and binding affinity
of capture probes while avoiding substitutions in positions that
may form self-complementary base-pairs which may otherwise inhibit
binding to a target molecule. The substitution algorithm is broadly
useful for specialized arrays, as well as for PCR primers and FISH
probes.
[0136] Other features and advantages of the invention will be
apparent from the following detailed description.
Definitions
[0137] When used herein, the term "LNA" (Locked Nucleoside
Analogues) refers to nucleoside analogues (e.g., bicyclic
nucleoside analogues, e.g., as disclosed in WO 9914226) either
incorporated in an oligonucleotide or as a discrete chemical
species (e.g., LNA nucleoside and LNA nucleotide). Furthermore, the
term "LNA" includes the compounds as described in the present
specificatiion including the compounds described in Example 17.
[0138] The term "monomeric LNA" may, e.g., refer to the monomers
LNA A, LNA T, LNA C, or any other LNA monomers.
[0139] By "LNA unit" is meant an individual LNA monomer (e.g., an
LNA nucleoside or LNA nucleotide) or an oligomer (e.g., an
oligonucleotide or nucleic acid) that includes at least one LNA
monomer. LNA units as disclosed in WO 99/14226 are in general
particularly desirable modified nucleic acids for incorporation
into an oligonucleotide of the invention. Additionally, the nucleic
acids may be modified at either the 3' and/or 5' end by any type of
modification known in the art. For example, either or both ends may
be capped with a protecting group, attached to a flexible linking
group, attached to a reactive group to aid in attachment to the
substrate surface, etc. Desirable LNA units and their method of
synthesis also are disclosed in WO 0056746, WO 0056748, WO 0066604,
Morita et al., Bioorg. Med. Chem. Lett. 12(1):73-76, 2002;
Hakansson et al., Bioorg. Med. Chem. Lett. 11(7):935-938, 2001;
Koshkin et al., J. Org. Chem. 66(25):8504-8512, 2001; Kvaerno et
al., J. Org. Chem. 66(16):5498-5503, 2001; Hakansson et al, J. Org.
Chem. 65(17):5161-5166, 2000; Kvaemo et al., J. Org. Chem.
65(17):5167-5176, 2000; Pfundheller et al., Nucleosides Nucleotides
18(9):2017-2030, 1999; and Kumar et al., Bioorg. Med. Chem. Lett.
8(16):2219-2222, 1998.
[0140] By "LNA modified oligonucleotide" is meant a oligonucleotide
comprising at least one LNA monomeric unit of the general scheme A,
described infra, having the below described illustrative examples
of modifications: ##STR11## wherein X is selected from --O--,
--S--, --N(R.sup.N)--, --C(R.sup.6R.sup.6*)--,
--O--C(R.sup.7R.sup.7*)--, --C(R.sup.6R.sup.6*)--O--,
--S--C(R.sup.7R.sup.7*)--, --C(R.sup.6R.sup.6*)--S--,
--N(R.sup.N*)--C(R.sup.7R.sup.7*)--,
--C(R.sup.6R.sup.6*)--N(R.sup.N)--, and --C(R.sup.6
R.sup.6*)--C(R.sup.7R.sup.7*).
[0141] B is selected from a modified base as discussed above e.g.
an optionally substituted carbocyclic aryl such as optionally
substituted pyrene or optionally substituted pyrenylmethylglycerol,
or an optionally substituted heteroalicylic or optionally
substituted heteroaromatic such as optionally substituted
pyridyloxazole, optionally substituted pyrrole, optionally
substituted diazole or optionally substituted triazole moieties;
hydrogen, hydroxy, optionally substituted C.sub.1-4-alkoxy,
optionally substituted C.sub.1-4-alkyl, optionally substituted
C.sub.1-4-acyloxy, nucleobases, DNA intercalators, photochemically
active groups, thermochemically active groups, chelating groups,
reporter groups, and ligands.
[0142] P designates the radical position for an intemucleoside
linkage to a succeeding monomer, or a 5'-terminal group, such
intemucleoside linkage or 5'-terminal group optionally including
the substituent R.sup.5. One of the substituents R.sup.2, R.sup.2*,
R.sup.3, and R.sup.3* is a group P* which designates an
internucleoside linkage to a preceding monomer, or a 2'/3'-terminal
group. The substituents of R.sup.1*, R.sup.4*, R.sup.5, R.sup.5*,
R.sup.6, R.sup.6*, R.sup.7, R.sup.7*, R.sup.N, and the ones of
R.sup.2, R.sup.2*, R.sup.3, and R.sup.3* not designating P* each
designates a biradical comprising about 1-8 groups/atoms selected
from --C(R.sup.aR.sup.b)--, --C(R.sup.a).dbd.C(R.sup.a)--,
--C(R.sup.a).dbd.N--, --C(R.sup.a)--O--, --O--,
--Si(R.sup.a).sub.2--, --C(R.sup.a)--S, --S--, --SO.sub.2--,
--C(R.sup.a)--N(R.sup.b)--, --N(R.sup.a)--, and >C=Q, wherein Q
is selected from --O--, --S--, and --N(R.sup.a)--, and R.sup.a and
R.sup.b each is independently selected from hydrogen, optionally
substituted C.sub.1-12-alkyl, optionally substituted
C.sub.2-12-alkenyl, optionally substituted C.sub.2-12-alkynyl,
hydroxy, C.sub.1-12-alkoxy, C.sub.2-12-alkenyloxy, carboxy,
C.sub.1-12-alkoxycarbonyl, C.sub.1-12-alkylcarbonyl, formyl, aryl,
aryloxy-carbonyl, aryloxy, arylcarbonyl, heteroaryl,
hetero-aryloxy-carbonyl, heteroaryloxy, heteroarylcarbonyl, amino,
mono- and di(C.sub.1-6-alkyl)amino, carbamoyl, mono- and
di(C.sub.1-6-alkyl)-amino-carbonyl,
amino-C.sub.1-6-alkyl-aminocarbonyl, mono- and
di(C.sub.1-6-alkyl)amino-C.sub.1-6-alkyl-aminocarbonyl,
C.sub.1-6-alkyl-carbonylamino, carbamido, C.sub.1-6-alkanoyloxy,
sulphono, C.sub.1-6-alkylsulphonyloxy, nitro, azido, sulphanyl,
C.sub.1-6-alkylthio, halogen, DNA intercalators, photochemically
active groups, thermochemically active groups, chelating groups,
reporter groups, and ligands, where aryl and heteroaryl may be
optionally substituted, and where two geminal substituents R.sup.a
and R.sup.b together may designate optionally substituted methylene
(.dbd.CH.sub.2), and wherein two non-geminal or geminal
substituents selected from R.sup.a, R.sup.b, and any of the
substituents R.sup.1*, R.sup.2, R.sup.2*, R.sup.3, R.sup.3*,
R.sup.4*, R.sup.5, R.sup.5*, R.sup.6 and R.sup.6*, R.sup.7, and
R.sup.7* which are present and not involved in P, P* or the
biradical(s) together may form an associated biradical selected
from biradicals of the same kind as defined before; the pair(s) of
non-geminal substituents thereby forming a mono- or bicyclic entity
together with (i) the atoms to which said non-geminal substituents
are bound and (ii) any intervening atoms.
[0143] Each of the substituents R.sup.1*, R.sup.2, R.sup.2*,
R.sup.3, R.sup.4*, R.sup.5, R.sup.5*, R.sup.6 and R.sup.6*,
R.sup.7, and R.sup.7* which are present and not involved in P, P*
or the biradical(s), is independently selected from hydrogen,
optionally substituted C.sub.1-12-alkyl, optionally substituted
C.sub.2-12-alkenyl, optionally substituted C.sub.2-12-alkynyl,
hydroxy, C.sub.1-12-alkoxy, C.sub.2-12-alkenyloxy, carboxy,
C.sub.1-12-alkoxycarbonyl, C.sub.1-12-alkylcarbonyl, formyl, aryl,
aryloxy-carbonyl, aryloxy, arylcarbonyl, heteroaryl,
heteroaryloxy-carbonyl, heteroaryloxy, heteroarylcarbonyl, amino,
mono- and di(C.sub.1-6-alkyl)amino, carbamoyl, mono- and
di(C.sub.1-6-alkyl)-amino-carbonyl,
amino-C.sub.1-6-alkyl-aminocarbonyl, mono- and
di(C.sub.1-6-alkyl)amino-C.sub.1-6-alkyl-aminocarbonyl,
C.sub.1-6-alkyl-carbonylamino, carbamido, C.sub.1-6-alkanoyloxy,
sulphono, C.sub.1-6-alkylsulphonyloxy, nitro, azido, sulphanyl,
C.sub.1-6-alkylthio, halogen, DNA intercalators, photochemically
active groups, thermochemically active groups, chelating groups,
reporter groups, and ligands, where aryl and heteroaryl may be
optionally substituted, and where two geminal substituents together
may designate oxo, thioxo, imino, or optionally substituted
methylene, or together may form a spiro biradical consisting of a
1-5 carbon atom(s) alkylene chain which is optionally interrupted
and/or terminated by one or more heteroatoms/groups selected from
--O--, --S--, and --(NR.sup.N)-- where R.sup.N is selected from
hydrogen and C.sub.1-4-alkyl, and where two adjacent (non-geminal)
substituents may designate an additional bond resulting in a double
bond; and R.sup.N*, when present and not involved in a biradical,
is selected from hydrogen and C.sub.1-4-alkyl; and basic salts and
acid addition salts thereof.
[0144] Exemplary 5', 3', and/or 2' terminal groups include --H,
--OH, halo (e.g., chloro, fluoro, iodo, or bromo), optionally
substituted aryl, (e.g., phenyl or benzyl), alkyl (e.g, methyl or
ethyl), alkoxy (e.g., methoxy), acyl (e.g. acetyl or benzoyl),
aroyl, aralkyl, hydroxy, hydroxyalkyl, alkoxy, aryloxy, aralkoxy,
nitro, cyano, carboxy, alkoxycarbonyl, aryloxycarbonyl,
aralkoxycarbonyl, acylamino, aroylamine, alkylsulfonyl,
arylsulfonyl, heteroarylsulfonyl, alkylsulfinyl, arylsulfinyl,
heteroarylsulfinyl, alkylthio, arylthio, heteroarylthio,
aralkylthio, heteroaralkylthio,amidino, amino, carbamoyl,
sulfamoyl, alkene, alkyne, protecting groups (e.g., silyl,
4,4'-dimethoxytrityl, monomethoxytrityl, or
trityl(triphenylmethyl)), linkers (e.g., a linker containing an
amine, ethylene glycol, quinone such as anthraquinone), detectable
labels (e.g., radiolabels or fluorescent labels), and biotin.
[0145] It is understood that references herein to a nucleic acid
unit, nucleic acid residue, LNA unit, or similar term are inclusive
of both individual nucleoside units and nucleotide units and
nucleoside units and nucleotide units within an
oligonucleotide.
[0146] A "modified base" or other similar term refers to a
composition (e.g., a non-naturally occuring nucleobase or
nucleosidic base) which can pair with a natural base (e.g.,
adenine, guanine, cytosine, uracil, and/or thymine) and/or can pair
with a non-naturally occurring nucleobase or nucleosidic base.
Desirably, the modified base provides a T.sub.m differential of 15,
12, 10, 8, 6, 4, or 2.degree. C. or less as described herein.
Exemplary modified bases are described in EP 10 72 679 and WO
97/12896.
[0147] By "nucleobase" is meant the naturally occurring nucleobases
adenine (A), guanine (G), cytosine (C), thymine (T) and uracil (U)
as well as non-naturally occurring nucleobases such as xanthine,
diaminopurine, 8-oxo-N.sup.6-methyladenine, 7-deazaxanthine,
7-deazaguanine, N.sup.4,N.sup.4-ethanocytosin,
N.sup.6,N.sup.6-ethano-2,6-diaminopurine, 5-methylcytosine (mC),
5-(C.sup.3-C.sup.6)-alkynyl-cytosine, 5-fluorouracil,
5-bromouracil, pseudoisocytosine,
2-hydroxy-5-methyl-4-triazolopyridin, isocytosine, isoguanine,
inosine and the "non-naturally occurring" nucleobases described in
Benner et al., U.S. Pat. No. 5,432,272 and Susan M. Freier and
Karl-Heinz Altmann, Nucleic Acids Research, 1997, vol. 25, pp
4429-4443. The term "nucleobase" thus includes not only the known
purine and pyrimidine heterocycles, but also heterocyclic analogues
and tautomers thereof. Further naturally and non-naturally
occurring nucleobases include those disclosed in U.S. Pat. No.
3,687,808 (Merigan, et al.), in Chapter 15 by Sanghvi, in Antisense
Research and Application, Ed. S. T. Crooke and B. Lebleu, CRC
Press, 1993, in Englisch et al., Angewandte Chemie, International
Edition, 1991, 30, 613-722 (see especially pages 622 and 623, and
in the Concise Encyclopedia of Polymer Science and Engineering, J.
I. Kroschwitz Ed., John Wiley & Sons, 1990, pages 858-859,
Cook, Anti-Cancer Drug Design 1991, 6, 585-607, each of which are
hereby incorporated by reference in their entirety). The term
"nucleosidic base" or "base unit" is further intended to include
compounds such as heterocyclic compounds that can serve like
nucleobases including certain "universal bases" that are not
nucleosidic bases in the most classical sense but serve as
nucleosidic bases. Especially mentioned as universal bases are
3-nitropyrrole, optionally substituted indoles (e.g.,
5-nitroindole), and optionally substituted hypoxanthine. Other
desirable universal bases include, pyrrole, diazole or triazole
derivatives, including those universal bases known in the art.
[0148] As described herein, various groups of an LNA unit may be
optionally substituted. A "substituted" group such as a nucleobase
or nucleosidic base and the like may be substituted by other than
hydrogen at one or more available positions, typically 1 to 3 or 4
positions, by one or more suitable groups such as those disclosed
herein. Suitable groups that may be present on a "substituted"
group include e.g. halogen such as fluoro, chloro, bromo and iodo;
cyano; hydroxyl; nitro; azido; alkanoyl such as a C.sub.1-6
alkanoyl group such as acyl and the like; carboxamido; alkyl groups
including those groups having 1 to about 12 carbon atoms, or 1, 2,
3, 4, 5, or 6 carbon atoms; alkenyl and alkynyl groups including
groups having one or more unsaturated linkages and from 2 to 12
carbon, or 2, 3, 4, 5 or 6 carbon atoms; alkoxy groups including
those having one or more oxygen linkages and from 1 to about 12
carbon atoms, or 1, 2, 3, 4, 5 or 6 carbon atoms; aryloxy such as
phenoxy; alkylthio groups including those moieties having one or
more thioether linkages and from 1 to about 12 carbon atoms, or 1,
2, 3, 4, 5 or 6 carbon atoms; alkylsulfinyl groups including those
moieties having one or more sulfinyl linkages and from 1 to about
12 carbon atoms, or 1, 2, 3, 4, 5, or 6 carbon atoms; alkylsulfonyl
groups including those moieties having one or more sulfonyl
linkages and from 1 to about 12 carbon atoms, or 1, 2, 3, 4, 5, or
6 carbon atoms; aminoalkyl groups such as groups having one or more
N atoms and from 1 to about 12 carbon atoms, or 1, 2, 3, 4, 5 or 6
carbon atoms; carbocyclic aryl having 6 or more carbons; aralkyl
having 1 to 3 separate or fused rings and from 6 to about 18 carbon
ring atoms, with benzyl being a desirable group; aralkoxy having 1
to 3 separate or fused rings and from 6 to about 18 carbon ring
atoms, with O-benzyl being a desirable group; or a heteroaromatic
or heteroalicyclic group having 1 to 3 separate or fused rings with
3 to about 8 members per ring and one or more N, O or S atoms, e.g.
coumarinyl, quinolinyl, pyridyl, pyrazinyl, pyrimidyl, furyl,
pyrrolyl, thienyl, thiazolyl, oxazolyl, imidazolyl, indolyl,
benzofuranyl, benzothiazolyl, tetrahydrofuranyl, tetrahydropyranyl,
piperidinyl, morpholino and pyrrolidinyl.
[0149] By "oxy-LNA monomer or unit" is meant any nucleoside or
nucleotide which contains an oxygen atom in a 2'-4' linkage.
[0150] A "non-oxy-LNA" monomer or unit is broadly defined as any
nucleoside or nucleotide which does not contain an oxygen atom in a
2'-4'-linkage. Examples of non-oxy-LNA monomers include
2'-deoxynucleotides (DNA) or nucleotides (RNA) or any analogues of
these monomers which are not oxy-LNA, such as for example the
thio-LNA and amino-LNA described herein with respect to formula la
and in Singh et al. J. Org. Chem. 1998, 6, 6078-9, and the
derivatives described in Susan M. Freier and Karl-Heinz Altmann,
Nucleic Acids Research, 1997, vol 25, pp 4429-4443.
[0151] By "universal base" is meant a naturally-occurring or
desirably a non-naturally occurring compound or moiety that can
pair with a natural base (e.g., adenine, guanine, cytosine, uracil,
and/or thymine), and that has a T.sub.m differential of 15, 12, 10,
8, 6, 4, or 2.degree. C. or less as described herein.
[0152] By "oligonucleotide," "oligomer," or "oligo" is meant a
successive chain of monomers (e.g., glycosides of heterocyclic
bases) connected via intemucleoside linkages. The linkage between
two successive monomers in the oligo consist of 2 to 4, desirably
3, groups/atoms selected from --CH.sub.2--, --O--, --S--,
--NR.sup.H--, >C.dbd.O, >C.dbd.NR.sup.H, >C.dbd.S,
--Si(R'').sub.2--, --SO--, --S(O).sub.2--, --P(O).sub.2--,
--PO(BH.sub.3)--, --P(O,S)--, --P(S).sub.2--, --PO(R'')--,
--PO(OCH.sub.3)--, and --PO(NHR.sup.H)--, where R.sup.H is selected
from hydrogen and C.sub.1-4-alkyl, and R'' is selected from
C.sub.1-6-alkyl and phenyl. Illustrative examples of such linkages
are --CH.sub.2--CH.sub.2--CH.sub.2--, --CH.sub.2--CO--CH.sub.2--,
--CH.sub.2--CHOH--CH.sub.2--, --O--CH.sub.2--O--,
--O--CH.sub.2--CH.sub.2--, --O--CH.sub.2--CH.dbd. (including
R.sup.5 when used as a linkage to a succeeding monomer),
--CH.sub.2--CH.sub.2--O--, --NR.sup.H--CH.sub.2--CH.sub.2--,
--CH.sub.2--CH.sub.2--NR.sup.H--, --CH.sub.2--NR.sup.H--CH.sub.2--,
--O--CH.sub.2--CH.sub.2--NR.sup.H--, --NR.sup.H--CO--O--,
--NR.sup.H--CO--NR.sup.H--, --NR.sup.H--CS--NR.sup.H--,
--NR.sup.H--C(.dbd.NR.sup.H)--NR.sup.H--,
--NR.sup.H--CO--CH.sub.2NR.sup.H--, --O--CO--O--,
--O--CO--CH.sub.2--O--, --O--CH.sub.2--CO--O--,
--CH.sub.2--CO--NR.sup.H--, --O--CO--NR.sup.H--,
--NR.sup.H--CO--CH.sub.2--, --O--CH.sub.2--CO--NR.sup.H--,
--O--CH.sub.2--CH.sub.2--NR.sup.H--, --CH.dbd.N--O--,
--CH.sub.2--NR.sup.H--O--, --CH.sub.2--O--N.dbd. (including R.sup.5
when used as a linkage to a succeeding monomer),
--CH.sub.2--O--NR.sup.H--, --CO--NR.sup.H--CH.sub.2--,
--CH.sub.2--NR.sup.H--O--, --CH.sub.2--NR.sup.H--CO--,
--O--NR.sup.H--CH.sub.2--, --O--NR.sup.H--, --O--CH.sub.2--S--,
--S--CH.sub.2--O--, --CH.sub.2--CH.sub.2--S--,
--O--CH.sub.2--CH.sub.2--S--, --S--CH.sub.2--CH.dbd. (including
R.sup.5 when used as a linkage to a succeeding monomer),
--S--CH.sub.2--CH.sub.2--, --S--CH.sub.2--CH.sub.2--O--,
--S--CH.sub.2--CH.sub.2--S--, --CH.sub.2--S--CH.sub.2--,
--CH.sub.2--SO--CH.sub.2--, --CH.sub.2--SO.sub.2--CH.sub.2--,
--O--SO--O--, --O--S(O).sub.2--O--, --O--S(O).sub.2--CH.sub.2--,
--O--S(O).sub.2--NR.sup.H--, --NR.sup.H--S(O).sub.2--CH.sub.2--,
--O--S(O).sub.2--CH.sub.2--, --O--P(O).sub.2--O--,
--O--P(O,S)--O--, --O--P(S).sub.2--O--, --S--P(O).sub.2--O--,
--S--P(O,S)--O--, --S--P(S).sub.2--O--, --O--P(O).sub.2--S--,
--O--P(O,S)--S--, --O--P(S).sub.2--S--, --S--P(O).sub.2--S--,
--S--P(O,S)--S--, --S--P(S).sub.2--S--, --O--PO(R'')--O--,
--O--PO(OCH.sub.3)--O--, --O--PO(OCH.sub.2CH.sub.3)--O--,
--O--PO(OCH.sub.2CH.sub.2S--R)--O--, --O--PO(BH.sub.3)--O--,
--O--PO(NHR.sup.N)--O--, --O--P(O).sub.2--NR.sup.H--,
--NR.sup.H--P(O).sub.2--O--, --O--P(O,NR.sup.H)--O--,
--CH.sub.2--P(O).sub.2--O--, --O--P(O).sub.2--CH.sub.2--, and
--O--Si(R'').sub.2--O--; among which --CH.sub.2--CO--NR.sup.H--,
--CH.sub.2--NR.sup.H--O--, --S--CH.sub.2--O--,
--O--P(O).sub.2--O--, --O--P(O,S)--O--, --O--P(S).sub.2--O--,
--NR.sup.H--P(O).sub.2--O--, --O--P(O,NR.sup.H)--O--,
--O--PO(R'')--O--, --O--PO(CH.sub.3)--O--, and
--O--PO(NHR.sup.N)--O--, where R.sup.H is selected form hydrogen
and C.sub.1-4-alkyl, and R'' is selected from C.sub.1-6-alkyl and
phenyl, are especially desirable. Further illustrative examples are
given in Mesmaeker et. al., Current Opinion in Structural Biology
1995, 5, 343-355 and Susan M. Freier and Karl-Heinz Altmann,
Nucleic Acids Research, 1997, vol 25, pp 4429-4443. The left-hand
side of the intemucleoside linkage is bound to the 5-membered ring
as substituent P* at the 3'-position, whereas the right-hand side
is bound to the 5'-position of a preceding monomer.
[0153] By "succeeding monomer" is meant the neighboring monomer in
the 5'-terminal direction, and by "preceding monomer" is meant the
neighboring monomer in the 3'-terminal direction.
[0154] By "LNA spiked oligo" is meant an oligonucleotide, such as a
DNA oligonucleotide, wherein at least one unit (and preferably not
all units) has been substituted by the corresponding LNA nucleoside
monomer.
[0155] The term "T.sub.m" is used in reference to the "melting
temperature." The melting temperature is the temperature at which
50% of a population of double-stranded nucleic acid molecules
becomes dissociated into single strands. The equation for
calculating the T.sub.m of nucleic acids is well-known in the art.
The T.sub.m of a hybrid nucleic acid is often estimated using a
formula adopted from hybridization assays in 1 M salt, and commonly
used for calculating T.sub.m for PCR primers: T.sub.m=[(number of
A+T).times.2.degree. C.+(number of G+C).times.4.degree. C.]. C. R.
Newton et al. PCR, 2nd Ed., Springer-Verlag (New York: 1997), p.
24. This formula was found to be inaccurate for primers longer that
20 nucleotides. Id. Other more sophisticated computations exist in
the art which take structural as well as sequence characteristics
into account for the calculation of T.sub.m. A calculated T.sub.m
is merely an estimate; the optimum temperature is commonly
determined empirically.
[0156] A nucleic acid compound that has a T.sub.m differential of a
specified amount (e.g., less than 15, 12, 10, 8, 6, 4, 2, or
1.degree. C.) means the nucleic acid exhibits that specified
T.sub.m differential when incorporated into a specified 9-mer
oligonucleotide with respect to the four complementary variants, as
defined immediately below.
[0157] Unless otherwise indicated, a T.sub.m differential provided
by a particular modified base is calculated by the following
protocol (steps a) through d)):
[0158] a) incorporating the modified base of interest into the
following oligonucleotide 5'-d(GTGAMATGC), wherein M is the
modified base;
[0159] b) mixing 1.5.times.10.sup.-6M of the oligonucleotide having
incorporated therein the modified base with each of
1.5.times.10.sup.-6M of the four oligonucleotides having the
sequence 3'-d(CACTYTACG), wherein Y is A, C, G, T, respectively, in
a buffer of 10 mM sodium phosphate, 100 mM sodium chloride, 0.1 mM
EDTA, pH 7.0;
[0160] c) allowing the oligonucleotides to hybridize; and
[0161] d) detecting the T.sub.m for each of the four hybridized
nucleotides by heating the hybridized nucleotides and observing the
temperature at which the maximum of the first derivative of the
melting curve recorded at a wavelength of 260 nm is obtained.
[0162] Unless otherwise indicated, a T.sub.m differential for a
particular modified base is determined by subtracting the highest
T.sub.m value determined in steps a) through d) immediately above
from the lowest T.sub.m value determined by steps a) through d)
immediately above.
[0163] By "variance in T.sub.m" is meant the variance in the values
of the melting temperatures for a population of nucleic acids. The
T.sub.m for each nucleic acid is determined by experimentally
measuring or computationally predicting the temperature at which
50% of a population double-stranded molecules with the sequence of
the nucleic acid becomes dissociated into single strands. For a
nucleic acid with only A, T, C, G, and/or U bases, the T.sub.m is
the temperature at which 50% of a population of 100% complementary
double-stranded molecules with the sequence of the nucleic acid
becomes dissociated into single strands. For determining the
T.sub.m variance when a nucleic acid has one or more nucleobases
other than A, T, C, G, or U, the T.sub.m of this "modified" nucleic
acid is approximated by determining the T.sub.m for each possible
double stranded molecule in which one strand is the modified
nucleic acid and the other strand has either A, T, C, or G in each
position corresponding to a nucleobase other than A, T, C, G, or U
in the modified nucleic acid. For example, if the modified nucleic
acid has the sequence XMX in which X is 0, 1, or more A, T, C, G,
or U bases and M is any other nucleobase or nucleosidic base, the
T.sub.m is calculated for each possible double stranded molecule in
which one strand is XMX and the other strand is X'YX' in which X'
is the base complementary to the corresponding X base and Y is
either A, T, C, or G. The average is then calculated for the
T.sub.m values for each possible double stranded molecule (i.e.,
four possible duplexes per modified nucleobase or nucleoside base
in the modified nucleic acid) and used as the approximate T.sub.m
value for the modified nucleic acid.
[0164] By "capture efficiency" is meant the amount of target
nucleic acid(s) bound to a particular nucleic acid or a population
of nucleic acids. Standard methods can be used to calculate the
capture efficiency by measuring the amount of bound target nucleic
acid(s) and/or measuring the amount of unbound target nucleic
acid(s). The capture efficiency of a nucleic acid or nucleic acid
population of the invention is typically compared to the capture
efficiency of a control nucleic acid or nucleic acid population
under the same incubation conditions (e.g., using same buffer and
temperature).
[0165] For example, a control nucleic acid may have
.beta.-D-2-deoxyribose instead of one or more bicyclic or sugar
groups of a LNA unit or other modified or non-naturally-occurring
units in a nucleic acid of the invention. In some embodiments, the
nucleic acid of the invention and the control nucleic acid only
have naturally-occurring nucleobases. If a nucleic acid of the
invention has one or more non-naturally-occurring nucleobases, the
capture efficiency of the corresponding control nucleic acid is
calculated as the average capture efficiency for all of the nucleic
acids that have either A, T, C, or G in each position corresponding
to a non-naturally-occurring nucleobase in the nucleic acid of the
invention.
[0166] Monomers are referred to as being "complementary" if they
contain nucleobases that can form hydrogen bonds according to
Watson-Crick base-pairing rules (e.g., G with C, A with T, or A
with U) or other hydrogen bonding motifs such as for example
diaminopurine with T, inosine with C, and pseudoisocytosine with
G.
[0167] By "substantially complementarity" is meant having a
sequence that is at least 60, 70, 80, 90, 95, or 100% complementary
to that of another sequence. Sequence complementarity is typically
measured using sequence analysis software with the default
parameters specified therein (e.g., Sequence Analysis Software
Package of the Genetics Computer Group, University of Wisconsin
Biotechnology Center, 1710 University Avenue, Madison, Wis. 53705).
This software program matches similar sequences by assigning
degrees of homology to various substitutions, deletions, and other
modifications.
[0168] The term "homology" refers to a degree of complementarity.
There can be partial homology or complete homology (i.e.,
identity). A partially complementary sequence that at least
partially inhibits a completely complementary sequence from
hybridizing to a target nucleic acid is referred to using the
functional term "substantially homologous."
[0169] When used in reference to a double-stranded nucleic acid
sequence such as a cDNA or genomic clone, the term "substantially
homologous" refers to a probe that can hybridize to a strand of the
double-stranded nucleic acid sequence under conditions of low
stringency, e.g. using a hybridization buffer comprising 20%
formamide in 0.8M saline/0.08M sodium citrate (SSC) buffer at a
temperature of 37.degree. C. and remaining bound when subject to
washing once with that SSC buffer at 37.degree. C.
[0170] When used in reference to a single-stranded nucleic acid
sequence, the term "substantially homologous" refers to a probe
that can hybridize to (i.e., is the complement of) the
single-stranded nucleic acid template sequence under conditions of
low stringency, e.g. using a hybridization buffer comprising 20%
formamide in 0.8M saline/0.08M sodium citrate (SSC) buffer at a
temperature of 37.degree. C. and remaining bound when subject to
washing once with that SSC buffer at 37.degree. C.
[0171] By "internal probe" is meant a nucleic acid (e.g., a probe
or primer) that hybridizes to either only one exon or only one
intron of a nucleic acid (e.g., mRNA). The internal probe may
hybridize to the 5' end of the exon or intron, the 3' end of the
exon or intron, or between the 5' end and the 3' end of the exon or
intron. Desirably, the internal probe is at least 90, 95, 96, 97,
98, 99, or 100% identical to the corresponding region of a target
nucleic acid.
[0172] By "merged probe" is meant a nucleic acid (e.g., a probe or
primer) that hybridizes to more than one exon and/or intron of a
nucleic acid (e.g., mRNA). Desirably, the merged probe hybridizes
to two consecutive exons (e.g., exons in a mature mRNA transcript
that may or may not be consecutive in the corresponding DNA
molecule). In another desirable embodiment, the merged probe
hybridizes to an exon and the consecutive intron. In desirable
embodiments, the merged probe hybridizes to the same number of
nucleotides in each exon or to the same number of nucleotides in
the exon and intron. In various embodiments, the length of the
region of the merged probe that hybridizes to one exon differs by
less than 60, 40, 20, 10, or 5% from the length of the region of
the merged probe that hybridizes to the other exon or to the
intron. Desirably, the merged probe is at least 90, 95, 96, 97, 98,
99, or 100% identical to the corresponding region of a target
nucleic acid.
[0173] By "poly-T.sub.20 tail" is meant a DNA polymer consisting of
20 DNA-t units added by polymerase chain reaction as a tail to a
nucleic acid sequence, which is subsequently cloned in a plasmid
vector allowing in vitro synthesis of poly(A).sub.20 polyadenylated
RNA.
[0174] By "mixmer" or "mixmer probe" is meant a nucleic acid (e.g.,
a probe or primer) that contains at least one LNA unit and at least
one RNA or DNA unit (e.g., a naturally-occurring RNA or DNA
unit).
[0175] By "corresponding unmodified reference nucleobase" is meant
a nucleobase that is not part of an LNA unit and is in the same
orientation as the nucleobase in an LNA unit.
[0176] By "mutation" is meant an alteration in a
naturally-occurring or reference nucleic acid sequence, such as an
insertion, deletion, frameshift mutation, silent mutation, nonsense
mutation, or missense mutation. Desirably, the amino acid sequence
encoded by the nucleic acid sequence has at least one amino acid
alteration from a naturally-occurring sequence.
[0177] By "selecting" is meant substantially partitioning a
molecule from other molecules in a population. Desirably, the
partitioning provides at least a 2-fold, desirably, a 30-fold, more
desirably, a 100-fold, and most desirably, a 1,000-fold enrichment
of a desired molecule relative to undesired molecules in a
population following the selection step. The selection step may be
repeated a number of times, and different types of selection steps
may be combined in a given approach. The population desirably
contains at least 10.sup.9 molecules, more desirably at least
10.sup.11, 10.sup.13, or 10.sup.14 molecules and, most desirably,
at least 10.sup.15 molecules.
[0178] By a "population" is meant more than one nucleic acid. A
"population" according to the invention desirably means more than
10.sup.1, 10.sup.2, 10.sup.3, or 10.sup.4 different molecules.
[0179] By "photochemically active groups" is meant compounds which
are able to undergo chemical reactions upon irradiation with light.
Illustrative examples of finctional groups are quinones, especially
6-methyl-1,4-naphtoquinone, anthraquinone, naphtoquinone, and
1,4-dimethyl-anthraquinone, diazirines, aromatic azides,
benzophenones, psoralens, diazo compounds, and diazirino
compounds.
[0180] By "thermochemically reactive group" is meant a functional
group which is able to undergo thermochemically-induced covalent
bond formation with other groups. Illustrative examples of
functional parts of thermochemically reactive groups are carboxylic
acids, carboxylic acid esters such as activated esters, carboxylic
acid halides such as acid fluorides, acid chlorides, acid bromide,
acid iodides, carboxylic acid azides, carboxylic acid hydrazides,
sulfonic acids, sulfonic acid esters, sulfonic acid halides,
semicarbazides, thiosemicarbazides, aldehydes, ketones, primary
alcohols, secondary alcohols, tertiary alcohols, phenols, alkyl
halides, thiols, disulphides, primary amines, secondary amines,
tertiary amines, hydrazines, epoxides, maleimides, and boronic acid
derivatives.
[0181] By "chelating group" is meant a molecule that contains more
than one binding site and frequently binds to another molecule,
atom, or ion through more than one binding site at the same time.
Examples of functional parts of chelating groups are iminodiacetic
acid, nitrilotriacetic acid, ethylenediamine tetraacetic acid
(EDTA), and aminophosphonic acid.
[0182] By "reporter group" is meant a group which is detectable
either by itself or as a part of an detection series. Examples of
functional parts of reporter groups are biotin, digoxigenin,
fluorescent groups (e.g., groups which are able to absorb
electromagnetic radiation, e.g. light or X-rays, of a certain
wavelength, and which subsequently reemit the energy absorbed as
radiation of longer wavelength; such as dansyl
(5-dimethylamino)-1-naphthalenesulfonyl), DOXYL
(N-oxyl-4,4-dimethyloxazolidine), PROXYL
(N-oxyl-2,2,5,5-tetramethylpyrrolidine), TEMPO
(N-oxyl-2,2,6,6-tetramethylpiperidine), dinitrophenyl, acridines,
coumarins, Cy3 and Cy5 (trademarks for Biological Detection
Systems, Inc.), erythrosine, coumaric acid, umbelliferone, Texas
red, rhodamine, tetramethyl rhodamine, Rox,
7-nitrobenzo-2-oxa-1-diazole (NBD), pyrene, fluorescein, Europium,
Ruthenium, Samarium, and other rare earth metals), radioisotopic
labels, chemiluminescence labels (i.e., labels that are detectable
via the emission of light during a chemical reaction), spin labels
(a free radical e.g., substituted organic nitroxides) or other
paramagnetic probes (e.g., Cu.sup.2+ or Mg.sup.2+) bound to a
biological molecule being detectable by the use of electron spin
resonance spectroscopy), enzymes (such as peroxidases, alkaline
phosphatases, .beta.-galactosidases, and glycose oxidases),
antigens, antibodies, haptens (e.g., groups which are able to
combine with an antibody, but which cannot initiate an immune
response by itself, such as peptides and steroid hormones), carrier
systems for cell membrane penetration, fatty acid units, steroid
moieties (cholesteryl), vitamin A, vitamin D, vitamin E, folic acid
peptides for specific receptors, groups for mediating endocytose,
epidermal growth factor (EGF), bradykinin, and platelet derived
growth factor (PDGF). Especially desirable groups are biotin,
fluorescein, Texas Red, rhodamine, dinitrophenyl, digoxigenin,
Ruthenium, Europium, Cy5, and Cy3.
[0183] By "ligand" is meant a compound which binds. Ligands can
comprise functional groups such as aromatic groups (such as
benzene, pyridine, naphthalene, anthracene, and phenanthrene),
heteroaromatic groups (such as thiophene, furan, tetrahydrofuran,
pyridine, dioxane, and pyrimidine), carboxylic acids, carboxylic
acid esters, carboxylic acid halides, carboxylic acid azides,
carboxylic acid hydrazides, sulfonic acids, sulfonic acid esters,
sulfonic acid halides, semicarbazides, thiosemicarbazides,
aldehydes, ketones, primary alcohols, secondary alcohols, tertiary
alcohols, phenols, alkyl halides, thiols, disulphides, primary
amines, secondary amines, tertiary amines, hydrazines, epoxides,
maleimides, C.sub.1-C.sub.20 alkyl groups optionally interrupted or
terminated with one or more heteroatoms such as oxygen atoms,
nitrogen atoms, and/or sulphur atoms, optionally containing
aromatic or mono/polyunsaturated hydrocarbons, polyoxyethylene such
as polyethylene glycol, oligo/polyamides such as
poly-.alpha.-alanine, polyglycine, polylysine, peptides,
oligo/polysaccharides, oligo/polyphosphates, toxins, antibiotics,
cell poisons, and steroids. "Affinity ligands" include functional
groups or biomolecules that have a specific affinity for sites on
particular proteins, antibodies, poly- and oligosaccharides, and
other biomolecules.
[0184] It should be understood that the above-mentioned specific
examples under DNA intercalators, photochemically active groups,
thermochemically active groups, chelating groups, reporter groups,
and ligands correspond to the "active/functional" part of the
groups in question. For the person skilled in the art it is
furthermore clear that DNA intercalators, photochemically active
groups, thermochemically active groups, chelating groups, reporter
groups, and ligands are typically represented in the form M-K-
where M is the "active/functional" part of the group in question
and where K is a spacer through which the "active/functional" part
is attached to the 5- or 6-membered ring. Thus, it should be
understood that the group B, in the case where B is selected from
DNA intercalators, photochemically active groups, thermochemically
active groups, chelating groups, reporter groups, and ligands, has
the form M-K-, where M is the "active/finctional" part of the DNA
intercalator, photochemically active group, thermochemically active
group, chelating group, reporter group, and ligand, respectively,
and where K is an optional spacer comprising 1-50 atoms, desirably
1-30 atoms, in particular 1-15 atoms, between the 5- or 6-membered
ring and the "active/functional" part.
[0185] By "spacer" is meant a thermochemically and photochemically
non-active distance-making group and is used to join two or more
different moieties of the types defmed above. Spacers are selected
on the basis of a variety of characteristics including their
hydrophobicity, hydrophilicity, molecular flexibility and length
(e.g., Hermanson et. al., "Immobilized Affinity Ligand Techniques,"
Academic Press, San Diego, Calif. (1992). Generally, the length of
the spacers is less than or about 400 .ANG., in some applications
desirably less than 100 .ANG.. The spacer, thus, comprises a chain
of carbon atoms optionally interrupted or terminated with one or
more heteroatoms, such as oxygen atoms, nitrogen atoms, and/or
sulphur atoms. Thus, the spacer K may comprise one or more amide,
ester, amino, ether, and/or thioether functionalities, and
optionally aromatic or mono/polyunsaturated hydrocarbons,
polyoxyethylene such as polyethylene glycol, oligo/polyamides such
as poly-.alpha.-alanine, polyglycine, polylysine, peptides,
oligosaccharides, or oligo/polyphosphates. Moreover the spacer may
consist of combined units thereof. The length of the spacer may
vary, taking into consideration the desired or necessary
positioning and spatial orientation of the "active/functional" part
of the group in question in relation to the 5- or 6-membered ring.
In particularl embodiments, the spacer includes a chemically
cleavable group. Examples of such chemically cleavable groups
include disulphide groups cleavable under reductive conditions and
peptide fragments cleavable by peptidases.
[0186] By "target nucleic acid" or "nucleic acid target" is meant a
particular nucleic acid sequence of interest. Thus, the "target"
can exist in the presence of other nucleic acid molecules or within
a larger nucleic acid molecule.
[0187] By "solid support" is meant any rigid or semi-rigid material
to which a nucleic acid binds or is directly or indirectly
attached. The support can be any porous or non-porous water
insoluble material, including without limitation, membranes,
filters, chips, slides, wafers, fibers, magnetic or nonmagnetic
beads, gels, tubing, strips, plates, rods, polymers, particles,
microparticles, capillaries, and the like. The support can have a
variety of surface forms, such as wells, trenches, pins, channels
and pores.
[0188] By an "array" is meant a fixed pattern of at least two
different immobilized nucleic acids on a solid support. Desirably,
the array includes at least 10.sup.2, more desirably, at least
10.sup.3, and, most desirably, at least 10.sup.4 different nucleic
acids.
[0189] By "antisense nucleic acid" is meant a nucleic acid,
regardless of length, that is complementary to a coding strand or
mRNA of interest. In some embodiments, the antisense molecule
inhibits the expression of only one nucleic acid, and in other
embodiments, the antisense molecule inhibits the expression of more
than one nucleic acid. Desirably, the antisense nucleic acid
decreases the expression or biological activity of a nucleic and or
encoded protein by at least 20, 40, 50, 60, 70, 80, 90, 95, or
100%. An antisense molecule can be introduced, e.g., to an
individual cell or to whole animals, for example, it may be
introduced systemically via the bloodstream. Desirably, a region of
the antisense nucleic acid or the entire antisense nucleic acid is
at least 70, 80, 90, 95, 98, or 100% complementary to a coding
sequence, regulatory region (5' or 3' untranslated region), or an
mRNA of interest. Desirably, the region of complementarity includes
at least 5, 10, 20, 30, 50, 75,100, 200, 500, 1000, 2000 or 5000
nucleotides or includes all of the nucleotides in the antisense
nucleic acid.
[0190] In some embodiments, the antisense molecule is less than
200, 150, 100, 75, 50, or 25 nucleotides in length. In other
embodiments, the antisense molecule is less than 50,000; 10,000;
5,000; or 2,000 nucleotides in length. In certain embodiments, the
antisense molecule is at least 200, 300, 500, 1000, or 5000
nucleotides in length. In some embodiments, the number of
nucleotides in the antisense molecule is contained in one of the
following ranges: 5-15 nucleotides, 16-20 nucleotides, 21-25
nucleotides, 26-35 nucleotides, 36-45 nucleotides, 46-60
nucleotides, 61-80 nucleotides, 81-100 nucleotides, 101-150
nucleotides, or 151-200 nucleotides, inclusive. In addition, the
antisense molecule may contain a sequence that is less than a
full-length sequence or may contain a full-length sequence.
[0191] By "double stranded nucleic acid" is meant a nucleic acid
containing a region of two or more nucleotides that are in a double
stranded conformation. In various embodiments, the double stranded
nucleic acids consist entirely of LNA units or a mixture of LNA
units, ribonucleotides, and/or deoxynucleotides. The double
stranded nucleic acid may be a single molecule with a region of
self-complementarity such that nucleotides in one segment of the
molecule base-pair with nucleotides in another segment of the
molecule. Alternatively, the double stranded nucleic acid may
include two different strands that have a region of complementarity
to each other. Desirably, the regions of complementarity are at
least 70, 80, 90, 95, 98, or 100% identical. Desirably, the region
of the double stranded nucleic acid that is present in a double
stranded conformation includes at least 5, 10, 20, 30, 50, 75,100,
200, 500, 1000, 2000 or 5000 nucleotides or includes all of the
nucleotides in the double stranded nucleic acid. Desirable double
stranded nucleic acid molecules have a strand or region that is at
least 70, 80, 90, 95, 98, or 100% identical to a coding region or a
regulatory sequence (e.g., a transcription factor binding site, a
promoter, or a 5' or 3' untranslated region) of a nucleic acid of
interest. In some embodiments, the double stranded nucleic acid is
less than 200, 150, 100, 75, 50, or 25 nucleotides in length. In
other embodiments, the double stranded nucleic acid is less than
50,000; 10,000; 5,000; or 2,000 nucleotides in length. In certain
embodiments, the double stranded nucleic acid is at least 200, 300,
500, 1000, or 5000 nucleotides in length. In some embodiments, the
number of nucleotides in the double stranded nucleic acid is
contained in one of the following ranges: 5-15 nucleotides, 16-20
nucleotides, 21-25 nucleotides, 26-35 nucleotides, 36-45
nucleotides, 46-60 nucleotides, 61-80 nucleotides, 81-100
nucleotides, 101-150 nucleotides, or 151-200 nucleotides,
inclusive. In addition, the double stranded nucleic acid may
contain a sequence that is less than a full-length sequence or may
contain a full-length sequence.
[0192] In some embodiments, the double stranded nucleic acid
inhibits the expression of only one nucleic acid, and in other
embodiments, the double stranded nucleic acid molecule inhibits the
expression of more than one nucleic acid. Desirably, the nucleic
acid decreases the expression or biological activity of a nucleic
acid of interest or a protein encoded by a nucleic acid of interest
by at least 20, 40, 50, 60, 70, 80, 90, 95, or 100%. A double
stranded nucleic acid can be introduced, e.g., to an individual
cell or to whole animals, for example, it may be introduced
systemically via the bloodstream.
[0193] In various embodiments, the double stranded nucleic acid or
antisense molecule includes one or more LNA nucleotides, one or
more universal bases, and/or one or more modified nucleotides in
which the 2' position in the sugar (e.g., ribose or xylose)
contains a halogen (such as fluorine group) or contains an alkoxy
group (such as a methoxy group) which increases the half-life of
the double stranded nucleic acid or antisense molecule in vitro or
in vivo compared to the corresponding double stranded nucleic acid
or antisense molecule in which the corresponding 2' position
contains a hydrogen or an hydroxyl group. In yet other embodiments,
the double stranded nucleic acid or antisense molecule includes one
or more linkages between adjacent nucleotides other than a
naturally-occurring phosphodiester linkage. Examples of such
linkages include phosphoramide, phosphorothioate, and
phosphorodithioate linkages. Desirably, the double stranded or
antisense molecule is purified.
[0194] By "purified" is meant separated from other components that
naturally accompany it. Typically, a factor is substantially pure
when it is at least 50%, by weight, free from proteins, antibodies,
and naturally-occurring organic molecules with which it is
naturally associated. Desirably, the factor is at least 75%, more
desirably, at least 90%, and most desirably, at least 99%, by
weight, pure. A substantially pure factor may be obtained by
chemical synthesis, separation of the factor from natural sources,
or production of the factor in a recombinant host cell that does
not naturally produce the factor. Nucleic acids and proteins may be
purified by one skilled in the art using standard techniques such
as those described by Ausubel et al. (Current Protocols in
Molecular Biology, John Wiley & Sons, New York, 2000). The
factor is desirably at least 2, 5, or 10 times as pure as the
starting material, as measured using polyacrylamide gel
electrophoresis, column chromatography, optical density, HPLC
analysis, or western analysis (Ausubel et al., supra). Desirable
methods of purification include immunoprecipitation, column
chromatography such as immunoaffinity chromatography, magnetic bead
immunoaffinity purification, and panning with a plate-bound
antibody.
[0195] By "treating, stabilizing, or preventing a disease,
disorder, or condition" is meant preventing or delaying an initial
or subsequent occurrence of a disease, disorder, or condition;
increasing the disease-free survival time between the disappearance
of a condition and its reoccurrence; stabilizing or reducing an
adverse symptom associated with a condition; or inhibiting or
stabilizing the progression of a condition. Desirably, at least 20,
40, 60, 80, 90, or 95% of the treated subjects have a complete
remission in which all evidence of the disease disappears. In
another desirable embodiment, the length of time a patient survives
after being diagnosed with a condition and treated with a nucleic
acid of the invention is at least 20, 40, 60, 80, 100, 200, or even
500% greater than (i) the average amount of time an untreated
patient survives or (ii) the average amount of time a patient
treated with another therapy survives.
[0196] By "treating, stabilizing, or preventing cancer" is meant
causing a reduction in the size of a tumor, slowing or preventing
an increase in the size of a tumor, increasing the disease-free
survival time between the disappearance of a tumor and its
reappearance, preventing an initial or subsequent occurrence of a
tumor, or reducing an adverse symptom associated with a tumor. In
one desirable embodiment, the number of cancerous cells surviving
the treatment is at least 20, 40, 60, 80, or 100% lower than the
initial number of cancerous cells, as measured using any standard
assay. Desirably, the decrease in the number of cancerous cells
induced by administration of a nucleic acid of the invention (e.g.,
a nucleic acid with substantial complementarily to a nucleic acid
associated with cancer such as an oncogene) is at least 2, 5, 10,
20, or 50-fold greater than the decrease in the number of
non-cancerous cells. In yet another desirable embodiment, the
number of cancerous cells present after administration of a nucleic
acid of the invention is at least 2, 5, 10, 20, or 50-fold lower
than the number of cancerous cells present prior to the
administration of the compound or after administration of a buffer
control. Desirably, the methods of the present invention result in
a decrease of 20, 40, 60, 80, or 100% in the size of a tumor as
determined using standard methods. Desirably, at least 20, 40, 60,
80, 90, or 95% of the treated subjects have a complete remission in
which all evidence of the cancer disappears. Desirably, the cancer
does not reappear or reappears after at least 5, 10, 15, or 20
years.
[0197] Exemplary cancers that can be treated, stabilized, or
prevented using the above methods include prostate cancers, breast
cancers, ovarian cancers, pancreatic cancers, gastric cancers,
bladder cancers, salivary gland carcinomas, gastrointestinal
cancers, lung cancers, colon cancers, melanomas, brain tumors,
leukemias, lymphomas, and carcinomas. Benign tumors may also be
treated or prevented using the methods and nucleic acids of the
present invention.
[0198] By "infection" is meant the invasion of a host animal by a
pathogen (e.g., a bacteria, yeast, or virus). For example, the
infection may include the excessive growth of a pathogen that is
normally present in or on the body of an animal or growth of a
pathogen that is not normally present in or on the animal. More
generally, an infection can be any situation in which the presence
of a pathogen population(s) is damaging to a host. Thus, an animal
is "suffering" from an infection when an excessive amount of a
pathogen population is present in or on the animal's body, or when
the presence of a pathogen population(s) is damaging the cells or
other tissue of the animal. In one embodiment, the number of a
particular genus or species of pathogen is at least 2, 4, 6, or 8
times the number normally found in the animal.
[0199] A bacterial infection may be due to gram positive and/or
gram negative bacteria. In desirable embodiments, the bacterial
infection is due to one or more of the following bacteria:
Chlamydophila pneumoniae, C. psittaci, C. abortus, Chlamydia
trachomatis, Simkania negevensis, Parachlamydia acanthamoebae,
Pseudomonas aeruginosa, P. alcaligenes, P. chlororaphis, P.
fluorescens, P. luteola, P. mendocina, P. monteilii, P.
oryzihabitans, P. pertocinogena, P. pseudalcaligenes, P. putida, P.
stutzeri, Burkholderia cepacia, Aeromonas hydrophilia, Escherichia
coli, Citrobacterfreundii, Salmonella typhimurium, S. typhi, S.
paratyphi, S. enteritidis, Shigella dysenteriae, S. flexneri, S.
sonnei, Enterobacter cloacae, E. aerogenes, Klebsiella pneumoniae,
K. oxytoca, Serratia marcescens, Francisella tularensis, Morganella
morganii, Proteus mirabilis, Proteus vulgaris, Providencia
alcalifaciens, P. rettgeri, P. stuartii, Acinetobacter
calcoaceticus, A. haemolyticus, Yersinia enterocolitica, Y. pestis,
Y. pseudotuberculosis, Y. intermedia, Bordetella pertussis, B.
parapertussis, B. bronchiseptica, Haemophilus influenzae, H.
parainfluenzae, H. haemolyticus, H. parahaemolyticus, H. ducreyi,
Pasteurella multocida, P. haemolytica, Branhamella catarrhalis,
Helicobacter pylori, Campylobacterfetus, C. jejuni, C. coli,
Borrelia burgdorferi, V. cholerae, V. parahaemolyticus, Legionella
pneumophila, Listeria monocytogenes, Neisseria gonorrhea, N.
meningitidis, Kingella dentrificans, K. kingae, K. oralis,
Moraxella catarrhalis, M. atlantae, M. lacunata, M.
nonliquefaciens, M osloensis, M phenylpyruvica, Gardnerella
vaginalis, Bacteroides fragilis, Bacteroides distasonis,
Bacteroides 3452A homology group, Bacteroides vulgatus, B. ovalus,
B. thetaiotaomicron, B. uniformis, B. eggerthii, B. splanchnicus,
Clostridium difficile, Mycobacterium tuberculosis, M. avium, M.
intracellulare, M. leprae, C. diphtheriae, C. ulcerans, C.
accolens, C. afermentans, C. amycolatum, C. argentorense, C. auris,
C. bovis, C. confusum, C. coyleae, C. durum, C. falsenii, C.
glucuronolyticum, C. imitans, C. jeikeium, C. kutscheri, C.
kroppenstedtii, C. lipophilum, C. macginleyi, C. matruchoti, C.
mucifaciens, C. pilosum, C. propinquum, C. renale, C. riegelii, C.
sanguinis, C. singulare, C. striatum, C. sundsvallense, C.
thomssenii, C. urealyticum, C. xerosis, Streptococcus pneumoniae,
S. agalactiae, S. pyogenes, Enterococcus avium, E. casseliflavus,
E. cecorum, E. dispar, E. durans, E. faecalis, E. faecium, E.
flavescens, E. gallinarum, E. hirae, E. malodoratus, E. mundtii, E.
pseudoavium, E. raffinosus, E. solitarius, Staphylococcus aureus,
S. epidermidis, S. saprophyticus, S. intermedius, S. hyicus, S.
haemolyticus, S. hominis, and/or S. saccharolyticus. Desirably, a
nucleic acid is administered in an amount sufficient to prevent,
stabilize, or inhibit the growth of a pathogenic bacteria or to
kill the bacteria.
[0200] In various embodiments, the viral infection relevant to the
methods of the invention is an infection by one or more of the
following viruses: West Nile virus (e.g., Samuel, "Host genetic
variability and West Nile virus susceptibility," Proc. Natl. Acad.
Sci. USA Aug. 21, 2002; Beasley, Virology 296:17-23, 2002),
Hepatitis, picomarirus, polio, HIV, coxsacchie, herpes (e.g.,
zoster, simplex, EBV, or CMV), adenovirus, retrovius, falvi, pox,
rhabdovirus, picorna virus (e.g., coxsachie, entero, hoof and
mouth, polio, or rhinovirus), St. Louis encephalitis, Epstein-Barr,
myxovirus, JC, coxsakievirus B, togavirus, measles, paramyxovirus,
echovirus, bunyavirus, cytomegalovirus, varicella-zoster, mumps,
equine encephalitis, lymphocytic choriomeningitis, rabies, simian
virus 40, polyoma virus, parvovirus, papilloma virus, primate
adenovirus, and/or BK.
[0201] By "mammal in need of treatment" is meant a mammal in which
a disease, disorder, or condition is treated, stabilized, or
prevented by the administration of a nucleic acid of the
invention.
[0202] Other aspects and embodiments of the invention are in the
detailed description and claims below. Additionally, other nucleic
acids and methods described in U.S. Ser. No. 10/105,639 (Jakobsen
et al., "Modified Oligonucleotides and Uses Thereof") or U.S. Ser.
No. 60/410,061 (Ramsing et al., "Populations of Oligonucleotides
with Duplex Stabilizing Properties and Uses Thereof") which are
hereby incorporated by reference, can be used in the present
invention.
BRIEF DESCRIPTION OF THE DRAWINGS
[0203] FIG. 1 shows the structures of selected nucleotide monomers:
DNA (T), LNA (T.sup.L), pyrene DNA (Py), 2'-OMe-RNA [2'-OMe(T)],
abasic LNA (Ab.sup.L), phenyl LNA (17a), and pyrenyl LNA (17d).
[0204] FIG. 2 illustrates the chemical structures of Selective
Binding Complementary (SBC) nucleotides.
[0205] FIG. 3 shows the base-pairing between modified bases and
naturally-occurring nucleotides. These modified bases may be
incorporated as part of an LNA, DNA, or RNA unit and used any of
the oligomers of the invention.
[0206] FIG. 4A and 4B show the sensitivity of 50-mer LNA capture
probes compared to 50-mer DNA capture probes. SW15-specific 50-mer
DNA oligonucleotides (green bars) and 50-mer capture probes with an
LNA nucleotide incorporated at every third nucleotide position (red
bars) were printed at the oligo concentration indicated below. The
slides were hybridized at 65.degree. C. in 3.times.SSC (FIG. 4A)
and at 70.degree. C. in 3.times.SSC (FIG. 4B).
[0207] FIGS. 5A and 5B show the specificity of 40-mer LNA capture
probes (red bars) compared to DNA capture probes (green bars). The
hybridizations were carried out at 65.degree. C. in 3.times.SSC.
Bars 1 and 7 represent perfectly matched duplexes, bars 2 and 8, 3,
and 9, 4 and 10, 5 and 11, and 6 and 12 represent duplexes with 1,
2, 3, 4, 5 mismatches, respectively. The in vitro RNA used was SW15
in FIG. 5A and TH14 in FIG. 5B.
[0208] FIG. 6 shows the detection principle for alternative exon
skipping in the C. elegans let-2 gene using LNA oligonucleotide
capture probes and comparative expression profiling.
[0209] FIG. 7 shows the detection of alternative splicing of C.
elegans Let-2 exon 9 and 10 using LNA-modified capture probes.
[0210] FIGS. 8A and 8B show the comparison of DNA and LNA-modified
oligonucleotide capture probes in the specific capture of the C.
elegans T01D3.3 mRNA, exon 4.
[0211] FIG. 9 illustrates the LNA exon-exon junction (merged) probe
concept.
[0212] FIG. 10A and 10B show the capture probe specificity for the
C. elegans T01D3.3 mRNA, exon 4 (FIG. 10A) and exon 5 (FIG. 10B) as
validated by short complementary target oligonucleotides.
[0213] FIG. 11 shows the construction of the recombinant splice
variants in the in vitro transcription vector. The small bars show
the location of the hybridization for the oligonucleotide capture
probes used in this example. The sequences of the capture probes
are described herein.
[0214] FIGS. 12A (LNA probes) and 12B (DNA control probes) show the
detection of splice variant #1 and #2, respectively using merged
capture probes in a comparative, two-color hybridization.
[0215] FIG. 13 shows the sensitivity of 50-mer LNA capture probes
compared to 50-mer DNA capture probes. SW15-specific 50-mer DNA
oligonucleotides and 50-mer capture probes with an LNA nucleotide
incorporated at every second (LNA2) or third (LNA3) nucleotide
position. The slides were hybridized at 65.degree. C. in
3.times.SSC.
[0216] FIG. 14 is a bar graph of the signal intensities of a
patient DNA sample hybridized to an array of the invention. The
names of the probes in FIGS. 14 and 17 match, although the numbers
used in FIG. 14 are abbreviated, e.g., probe No. 10580 Menkes.14
50NH2C6-2.LNA in
[0217] FIG. 17 corresponds to the second probe counted from the
left "14.2" LNA in the lower graph of FIG. 14.
[0218] FIG. 15 is a graph comparing the spot intensity for probes
of the invention with different LNA substitution patterns.
[0219] FIG. 16 is a bar graph of the spot intensity for LNA probes
for different exons.
[0220] FIG. 17 is a table of comparative genome hybridization (CGH)
capture probe sequences.
[0221] FIG. 18 is a flow chart of the steps of oligo design
software of the invention. The OligoDesign software features LNA
modified oligonucleotide secondary structure prediction, LNA spiked
oligonucleotide melting temperature prediction, genome wide cross
hybridization prediction, secondary structure prediction of the
target, and recognition and filtering of the target in the genome.
These features are determined for each possible probe of the query
gene and presented to an artificial neural network. The probes are
then ranked according to the neural network prediction and the top
scoring probes are returned.
[0222] FIGS. 19A-19F are a schematic illustration of the
OligoDesign software of the invention.
[0223] FIG. 20 illustrates photo-activated immobilization of
nucleic acids of the invention, which enables polarized coupling of
anthraquinone (AQ)-linked LNA oligonucleotides onto the polymer
surface. No pretreatment of the slide is needed. A covalent bond is
formed between the oligonucleotide and the polymer using a UV
source, e.g. Stratalinker.
[0224] FIG. 21 illustrates an injection-molded polymer slide.
Finger indents ease slide handling. The slide has a well-defined
printing and hybridization window, frosted surface for
identification and orientation, and space for barcodes.
[0225] FIG. 22 illustrates spot quality on different slides that
can be used to immobilize nucleic acids of the invention. The
hydrophobic slide surface ensures that extremely homogenous spots
are generated when hydrophilic spotting solution is applied to the
surface. A high spot quality is obtained on the Immobilizer.TM.
polymer slide compared to a glass slide when using a spot-to-spot
distance of 150 .mu.M. The high-quality arrays simplify downstream
image analyses.
[0226] FIG. 23 is a schematic illustration of a method of the
invention.
[0227] FIG. 24 is a table of exemplary target nucleic acids
(Holstege et al. (1998)( Cell 95, 717-728, and Causton et al.
(2001) Mol. Biol. Cell 12, 323-337).
[0228] FIG. 25 is a graph of Cy5 intensity. Yeast actin 1-specific
50-mer capture probes were synthesized as DNA and DNA/LNA mixmer
oligonucleotides. LNA-substituted mixmer capture probes contain an
LNA at every 4.sup.th, 5.sup.th, and 6.sup.th nucleotide position
(LNA.sub.--4, LNA.sub.--5, LNA.sub.--6). On-chip melting profiles
demonstrate a 8-10.degree. C. increase in T.sub.m obtained with LNA
capture probes.
[0229] FIG. 26A illustrates the heat-shock response in yeast. The
array was hybridized with Cy3-labeled standard and Cy5-labelled
heat-shock yeast cDNA. FIG. 26B also illustrates the heat-shock
response in yeast. The microarray data were normalized using yeast
actin 1. The ssa4 gene encoding heat shock protein HSP70 is
up-regulated over 2-fold. Expression of the gual gene is
down-regulated.
[0230] FIG. 27A compares expression of wild-type and ssa4 mutant
yeast. The array was hybridized with Cy3-labeled wild-type and
Cy5-labelled ssa4 mutant yeast cDNA. FIG. 27B also compares
wild-type and ssa4 yeast. The hybridization data were normalized
using yeast actin 1. ssa4 is detected in the wild-type yeast
strain, but not in the ssa4 knock-out strain.
[0231] FIG. 28 illustrates mRNA splicing.
[0232] FIG. 29 is a picture showing gel electrophoresis of
fragmented cDNA from the yeast wild-type strain. The molecular
marker (lane 1 and 9) is from Life technologies, USA. Lanes 2-8
represents the UDG-fragmented cDNA 1-7 according to the different
dUTP/dTTP ratios in Table 18.
[0233] FIG. 30 is a graph of the log ratios of the normalized
fluorescence intensities from the wild-type yeast strain (signal)
and those from the .DELTA.ssa4 yeast strain (noise) as a function
of capture probe position in the 3' region of the SSA4 mRNA.
[0234] FIG. 31 is a schematic illustration of mRNA splicing.
[0235] FIG. 32 is a schematic illustration of alternative mRNA
splicing.
[0236] FIG. 33 is a schematic illustration of probes of the
invention.
[0237] FIG. 34 is a schematic illustration of probes of the
invention.
[0238] FIG. 35 illustrates an exemplary computer for use in the
methods of the invention.
[0239] FIGS. 36a-36d show the sensitivity and specificity of LNA
oligonucleotide capture probes (black solid bars) compared to DNA
capture probes (white, open bars) on expression microarrays.
Fluorescence intensity is shown in arbitrary units (relative
measurements). The arrays comprising 50-mer and 40-mer perfect
match and 1-5 mismatch capture probes were hybridized at 65.degree.
C. in 3.times.SSC with Cy3-labelled cDNA from 10 .mu.g C. elegans
total RNA spiked with yeast a) SWI5 RNA and c) THI4 RNA. FIGS. 36b
and 36d demonstrate the improved mismatch discrimination with the
50-mer LNA probes by increasing the hybridization temperature from
65.degree. C. to 70.degree. C. hybridized with Cy3-labelled cDNA
from 10 .mu.g C. elegans total RNA spiked with yeast b) SWI5 RNA
and d) THI4 RNA.
[0240] FIG. 37 shows the expected (black, solid bars) and observed
(white, open bars) fold-of-change in the expression levels of the
Cy3-ULS-labelled yeast HSP78 spike RNA as measured by on-chip
capture using three different 25-mer oligonucleotide capture probes
(DNA control, LNA-T substituted, LNA.sub.--3 substituted in which
every third nucleotide was substituted with an LNA monomer). In the
hybridization experiment, one ng of HSP78 in vitro spike RNA or 200
pg HSP78 in vitro spike RNA was used, respectively. Thus, the fold
change of the HSP78 RNA in the two hybridizations in the comparison
is 5-fold. Fourteen additional synthetic in vitro mRNA spike
controls were included in the hybridisation solution as a
semi-complex background RNA mixture. Seven of these spikes were
used as normalization controls, the remaining seven were used as
negative controls. Hybridization temperature was 65.degree. C. for
16 hours, and post-hybridization washes as described. Both LNA_T
and LNA.sub.--3 substituted 25-mer probes are capable of providing
highly accurate measurements for fold-of-changes in gene expression
levels, as depicted in FIG. 37. Under these conditions the DNA
capture probes did not hybridize.
[0241] FIG. 38 shows the measured intensity levels by on-chip
capture using three different 25-mer oligonucleotide capture probe
designs (DNA control, LNA_T substituted and LNA C and T substituted
probes). One (1) ng biotin-labeled HSP78 target was used in the
hybridization experiments, followed by staining with Streptavidin
Phycoerythrin. The LNA_T and LNA_TC substituted 25-mer capture
probes show a significantly enhanced on-chip capture of the HSP78
RNA target, compared to the DNA 25-mer control probes under four
different hybridization stringency conditions in dicated on the
graph.
[0242] FIG. 39 shows the detection of alternatively spliced mRNAs
using LNA-substituted 50-mer oligonucleotide capture probes. Parts
per million (ppm) calculations indicate spike transcripts per total
transcripts in the hybridisation mix. Calculations are based on an
average C. elegans RNA being 1000 nucleotides as in Hill et al.
(2000) Science 290:809-812. The 50-mer LNA-DNA mixmer capture
probes, substituted with an LNA nucleotide at every third
nucleotide position, are able to provide highly accurate
measurements for fold-changes in the expression of three
homologous, alternatively spliced mRNA variants in the
concentration range of 1000 ppm to 10 ppm. The quantification of
the splice isoforms was carried out using a set of both internal,
exon-specific probes and merged, splice junction specific probes,
printed onto microarrays and hybridized with complex cDNA target
pools spiked with different cloned artificial splice isoforms in
which the middle exon was either alternatively skipped or excluded
completely resulting in the three different splice isoforms;
01-INS3-03, 01-INS4-03 and 01-03.
[0243] FIG. 40 shows the detection of alternatively spliced mRNAs
using LNA-substituted 40-mer oligonucleotide capture probes. Parts
per million (ppm) calculations indicate spike transcripts per total
transcripts in the hybridisation mix. Calculations are based on an
average C. elegans RNA being 1000 nucleotides as in Hill et al.
(2000) Science 290:809-812. The 40-mer LNA-DNA mixmer capture
probes, substituted with an LNA nucleotide at every third
nucleotide position, are able to provide highly accurate
measurements for fold-changes in the expression of three
homologous, alternatively spliced mRNA variants in the
concentration range of 1000 ppm to 10 ppm. The quantification of
the splice isoforms was carried out using a set of both internal,
exon-specific probes and merged, splice junction specific probes,
printed onto microarrays and hybridized with complex cDNA target
pools spiked with different cloned artificial splice isoforms in
which the middle exon was either alternatively skipped or excluded
completely resulting in the three different splice isoforms;
01-INS3-03, 01-INS4-03 and 01-03.
[0244] FIGS. 41A-41E show the comparison of different LNA/DNA
mixmer oligonucleotide probes in the detection of human satellite-2
repeats by fluorescence in situ hybridization. Experiment
conditions: 6.4 pmoles of Cy3 labeled probe was hybridized for 30
minutes at 37.degree. C., after simultaneous denaturation of the
target and the probe at 75.degree. C. for 5 minutes. A. LNA-2
giving signals on chromosomes 1, 16, 9 and 15, B. LNA-3 giving
bright signals on chromosomes 1, 16 and 9, C. Dispersed LNA giving
signals on chromosomes 1 and 16 only, D. LNA Block giving smaller
signals on chromosome 1, E. DNA control oligonucleotide FISH probe
giving no signals on any of the chromosomes.
[0245] FIG. 42. Illustrates the hybridisation of the Cy3-labelled
human telomere repeat specific, LNA-2 substituted oligonucleotide
probe on human metaphase chromosomes resulted in prominent signals
on the telomeres.
DETAILED DESCRIPTION OF THE INVENTION
Detection and Analysis of mRNA Splice Variants
[0246] Alternative splicing is the process by which different
mature messenger RNAs are produced from the same pre-mRNA. Because
the mRNA composition of a given cell determines the proteins
present in a cell, this process is an important aspect of a cells
gene expression profile. Current investigations of transcriptomes
(i.e., the total complexity of RNA transcripts produced by an
organism) indicate that at least 50-60% of the genes of complex
eukaryotes produce more than one splice variant. The present
invention provides a novel method for detecting and quantifying the
levels of splice variants in complex mRNA pools using LNA
discriminating probes and high-throughput LNA oligonucleotide
microarray technology. The detection concept which uses internal
LNA exon probes and/or splice-variant specific exon-exon junction
or exon-intron or intron-exon (so-called merged) probes is depicted
in FIG. 9.
[0247] Internal, exon-specific (or intron-specific) LNA
oligonucleotide probes are designed and used to detect the relative
levels of a given exon (or intron) in complex mRNA pools using
oligonucleotide microarray technology or similar techniques.
Exon-exon LNA junction probes are designed for multiple or all
possible exon-exon combinations or exon-intron combinations. The
LNA discriminating probes are highly specific and superior compared
to DNA oligonucleotides due to the higher .DELTA.Tm of LNA probes.
These probes can be used to determine the sequential order of each
sub-element (i.e., exon structure or exon-intron structure) in a
given alternatively spliced mRNA isoform, thus giving the exact
composition of the mRNA. Subsequently, the ratios of each splice
variant can be quantified using the combined readouts from both
internal and merged LNA probes and control probes. The invention is
applicable both in single fluor (single channel) or comparative
two-fluor (two channel) microarray hybridizations.
[0248] Several "artificial," alternatively spliced mRNA molecules
may be constructed in an in vitro transcription vector for the
production of clean IVT RNA. Both internal and junction-specific
LNA oligonucleotide capture probes are designed, synthesized, and
spotted onto, e.g., Exiqon's polymer microarray platform. The
resulting splice-specific microarray is used to validate the LNA
discriminating probe concept by spiking the in vitro RNAs
individually as well as in different ratios into a complex RNA
background for fluorochrome-labelling and array hybridization.
[0249] The internal and merged probes of the invention can also be
used in any standard method for the analysis of mRNA splice
variants (see, for example, Yeakley et al, Nature Biotechnology
20:353-358, 2002; Clark et al., Science 296:907-910, 2002; Mutch et
al., Genome Biology 2(12):preprint00009.1-0009.31, 2001).
Exemplary Applications of Internal and/or Merged Probes
[0250] The internal and/or merged probes of the invention can also
be used for gene expression profiling of alternative splice
variants, oligonucleotide expression microarrays, real-time PCR,
and profiling of alternatively spliced mRNAs using microtiterplate
assays or fiber-optic arrays.
[0251] Detection and characterization of alternative splicing is
particularly useful for the study and treatment of human disease
(exonhit website, "Inaugural Splicing 2002 Concludes: Alternative
Splicing May Make All the Difference in Discovering the Origin of
Disease). In particular, RNA splicing is now widely recognized as a
means to generate protein diversity. Alternative splicing is a key
mechanism for regulating gene expression, and any mutation or
defect in its regulation can impact considerably cell finctions.
Therefore, it is likely to be an important source of novel gene and
protein targets implicated in human pathology. Industry has long
recognized the need for innovative discovery technologies that
focuses on the origin of disease for the development of novel
diagnostics and therapeutics.
[0252] In particular, there are many examples of human pathologies
caused by alterations in normal patterns of alternative RNA
splicing. Because a large number of human genes undergo alternative
splicing, the protein isoforms that result from this process
represent a major source of targets for commercial development of
therapies and diagnostics. In particular, splicing processes play a
significant role in the onset and development of cardiovascular,
muscular, CNS diseases, and cancer. Early evidence indicates the
origin of many diseases can be identified by examining alternative
splicing--which leads to the point of intervention for discovering
future generations of drugs. The study of splicing enables the
discovery of new mechanisms underlying disease progression.
Comparative Genomic Hybridization
[0253] Comparative Genomic Hybridization (CGH) is a powerful
technology for detection of unbalanced chromosome rearrangements
and holds much promise for screening and identification of
interstitial submicroscopic rearrangements that otherwise cannot be
detected using classical cytogenetic or FISH technologies. The
adaptation of CGH onto an oligo microarray platform allows
detection of small single exon deletion/duplications on a genome
wide scale. There is a strong need for developing microarrays that
can detect, e.g., single exon aberrations. This detection can be
achieved by employing LNA mixmer oligos as capture probes for
individual exons in selected genes.
[0254] A model system for these methods is the Menkes loci. Menkes
disease is a lethal-X linked recessive disorder associated with
copper metabolism disturbance leading to death in early childhood.
The Menkes locus has been mapped to Xq13. The gene spans about 150
kb genomic region, contains 23 exons, and encodes a 8.5 kb gene
transcript. The gene for Menkes disease (now designated as ATP7A)
encodes a 1500 amino acid membrane-bound Cu-binding P-type ATPase
(ATP7A). The 8.5 kb transcript is expressed in all tissues from
normal individuals (though only trace amounts are present in
liver), but is diminished or absent in Menkes disease patients.
Several different kinds of mutations, like chromosome aberrations,
point mutations and partial gene deletions affecting ATP7A have
been identified in MD patients. 50-mer capture probes with LNA
spiked in every second, third, and fourth position have been
designed for every exon (23 exons) representing ATP7A, using the
OligoDesign software tool, described herein. The C6-amino-linked
capture probes were spotted onto Immobilizer slides and hybridized
with patient samples with Cy3 fluorescent dye and a known reference
genomic sample with Cy5. After mixing equal amounts of the labelled
DNA, the probe is hybridized it to array. The ratio of Cy5 signal
to Cy3 for each clone indicates differences in chromosome/DNA
material. For example, the Cy5 signal is higher than Cy3 if the
patient genome has a deletion, and is lower if there is
duplication. In regions that are unchanged, the Cy5:Cy3 ratio is
1:1. These methods can be used to analyze a number of
well-characterized Menkes patients with a range of partial
deletions of ATP7A.
[0255] LNA oligonucleotide-based CGH makes it possible to assess a
large number of chromosomal aberrations that are being screen for
in the cytogenetic clinic. In contrast, standard FISH analysis
typically only detects large chromosomal rearrangements. In
desirable embodiments, an array that contains a series of
overlapping probes is used to detect a chromosomal deletion in a
nucleic acid sample, such as a patient sample.
Clinical Diagnostics
[0256] Clinical diagnosis is a key element in healthcare management
and point-of-care. A large number of analyses in the hospitals are
based on the use of robust, cost efficient, sensitive and highly
specific diagnostic tests. Thus, the diagnosis of various diseases
is performed with a high selectivity and reliability, resulting in
confirmation of medical diagnosis, choice of therapy and follow-up
treatment as well as prevention. In addition to its importance in
the quality of healthcare provided to patients, clinical diagnosis
also contributes to the control of healthcare costs. The field of
clinical diagnostics involves analyzing biological fluid samples
(blood, urine, etc.) or biopsies collected from patients in order
to establish the diagnosis of diseases, whether of infectious,
metabolic, endocrine or cancerous origin. Medical analysis of
infectious diseases involves testing and identifying the
micro-organisms causing the infection e.g. testing for and
identifying a micro-organism in blood and determining its
susceptibility to antibiotics or detecting an antigen-antibody
reaction produced as a response to an attack by a micro-organism in
the human body, e.g. testing for antibodies for the diagnosis of
hepatitis. The accurate diagnosis of metabolic and endocrine
diseases and cancers, resulting in a disease phenotype with a
bodily imbalance, involves the measurement of diagnostic substances
or elements present in the biological fluids or biopsies. These
substances are examined and results are interpreted with reference
to known normal values.
Use of Diagnostic Kits in Microbiological Control
[0257] The pharmaceutical, cosmetics and agri-food industries are
being confronted with increasingly strict quality standards. Thus,
the purpose of industrial microbiological control testing is to
detect and measure the presence of potentially pathogenic microbial
contaminants throughout the manufacturing process from raw
materials to the finished products, as well as in the production
environment. The obtained results are subsequently compared to the
current regulatory guidelines and industry standards.
Application of Molecular Biological Techniques to In Vitro
Diagnostics
[0258] Recently, several different molecular biological techniques
have been used successfully in accurate quantification of RNA
levels in clinical diagnosis as well as in microbiological control.
The applications are wide-ranging and include methods for
quantification of the regulation and expression of drug resistance
markers in tumour cells, monitoring of the responses to
chemotherapy, measuring the biodistribution and transcription of
gene-encoded therapeutics, molecular assessment of the tumor stage
in a given cancer, detecting circulating tumor cells in cancer
patients and detection of bacterial and viral pathogens. The
reverse transcription polymerase chain reaction (RT-PCR) is the
most sensitive method for the detection of mRNA, including low
abundant mRNAs, often obtained from limited tissue samples in
clinical diagnostics. The application of fluorescence techniques to
RT-PCR combined with suitable instrumentation has led to
development of quantitative RT-PCR methods, combining
amplification, detection and quantification in a closed system
avoid from contamination and with minimized hands-on time. The two
most commonly used quantitative RT-PCR techniques are the Taqman
RT-PCR assay (ABI, Foster City, USA) and the Lightcycler assay
(Roche, USA). A third method applied to detection and
quantification of RNA levels is real-time nucleic acid sequence
based amplification (NASBA) combined with molecular beacon
detection molecules. NASBA is a singe-step isothermal RNA-specific
amplification method that amplifies mRNA in a double stranded DNA
environment, and this method has recently proven useful in the
detection of various mRNAs and in the detection of both viral and
bacterial RNA in clinical samples. Finally, the recent explosion in
microarray technology holds the promise of using microarrays in
clinical diagnostics. For example van't Veer et al. (Nature 2002:
415, 31) describe the successful use of microarrays in obtaining
digital mRNA signatures from breast tumors and the use of these
signatures in the precise prediction of the clinical outcome of
breast cancer in patients.
[0259] The success of exploiting molecular biological techniques in
diagnostics and diagnostic kits depends on continuous optimization
of the technologies and the development of new robust and
cost-effective technology platforms for producing accurate,
reproducible and valid clinical data. Locked nucleic acid (LNA)
oligonucleotides constitute a novel class of bicyclic RNA analogs
having an exceptionally high affinity and specificity toward their
complementary DNA and RNA target molecules. Besides increased
thermal stability, LNA-containing oligonucleotides show
significantly increased mismatch discrimination, and allow full
control of the melting temperature across microarray
hybridizations. The LNA chemistry is completely compatible with
conventional DNA phosphoramidite chemistry and thus LNA substituted
oligonucleotides can be designed to optimize performance. LNA
oligonucleotides would be well-suited for large-scale clinical
studies providing highly accurate genotyping by direct competitive
hybridization of two allele-specific LNA probes to e.g. microarrays
of immobilized patient amplicons. In addition, the use of LNA
substituted oligonucleotides would increase both sensitivity and
specificity in detection and quantification of mRNA levels in
clinical samples, either by quantitative RT-PCR, quantitative NASBA
or oligonucleotide microarrays, compared with DNA probes.
Application of LNA oligonucleotides into diagnostic kits would thus
significantly enhance their performance. Finally, the use of LNA
substituted oligonucleotides would increase the sensititity and
specificity in the detection of alternatively spliced mRNA isoforms
and non-coding RNAs either by homogeneous assays (Taqman assay,
Lightcycler assay, NASBA) or by oligonucleotide microarrays in a
massive parallel analysis setup.
Optimized Nucleic Acids of the Invention
[0260] Decreasing the variation in melting temperatures (T.sub.m)
of a population of nucleic acids allows the nucleic acids to
hybridize to target molecules under similar binding conditions,
thereby simplifying the simultaneous hybridization of multiple
nucleic acids. Similar melting temperatures also allow the same
hybridization conditions to be used for multiple experiments, which
is particularly useful for assays involving hybridization to
nucleic acids of varying "AT" content. For example, current methods
often require less stringent conditions for hybridization of
nucleic acids with high "AT" content compared to nucleic acids with
low "AT" content. Due to this variation in hybridization
stringency, current methods may require significant trial and error
to optimize the hybridization conditions for each experiment.
[0261] To overcome limitations in current nucleic acid
hybridization and/or amplification techniques, we have developed
populations of nucleic acid probes or primers with minimal
variation in melting temperature (U.S. Ser. No. 60/410,061). For
example, the unique properties of LNA nucleotide analogs increase
their binding affinity for DNA and RNA. The stability of duplexes
can generally be ranked as follows:
DNA:DNA<DNA:RNA<RNA:RNA.ltoreq.LNA:DNA<LNA:RNA<LNA:LNA.
The DNA:DNA duplex is thus the least stable and the LNA:LNA duplex
the most stable. The affinity of the LNA nucleotides A and T
corresponds approximately to the affinity of DNA G and C to their
complementary bases. General substitution of one or more A and T
nucleotides with LNA A and LNA T in DNA oligonucleotides is
therefore a simple way of equalizing differences in T.sub.m.
Furthermore, the mean melting temperature is increased
significantly, which is often important for shorter
oligonucleotides. For example, predictions of melting temperature
of all possible 9-mer oligonucleotides have shown that the mean
temperature increases from 39.7.degree. C. to 59.3.degree. C. by
substituting all DNA A and T nucleotides with LNA A and T
nucleotides. The variance in T.sub.m of all 9-mers furthermore
decreases from 59.6.degree. C. for DNA oligonucleotides to only
4.7.degree. C. for the LNA substituted oligonucleotides. The
estimations are based on the latest LNA T.sub.m prediction
algorithms such as those disclosed herein, which have a variance of
6-7.degree. C.
[0262] If desired, the capture efficiency of one or more nucleic
acids can be increased by including any of the high affinity
nucleotides (e.g., LNA units) described herein within the nucleic
acids. The examples herein also provide algorithms for optimizing
the substitution patterns of the nucleic acids to minimize
self-complementarity that may otherwise inhibit the binding of the
nucleic acids to target molecules.
[0263] For various applications of the nucleic acids and arrays of
the invention, LNA A and LNA T substitutions are made to equalize
the melting temperatures of the nucleic acids. In other
embodiments, LNA A and LNA C substitutions are made to minimize
self-complementarity and to increase specificity. LNA C and LNA T
substitutions also minimize self-complementarity. Additionally,
oligonucleotides containing LNA C and LNA T are desirable because
these modified nucleotides are easy to synthesis and are especially
useful for applications such as antisense technology in which
minimizing cost is especially desirable.
[0264] The following non-limiting examples are illustrative of the
invention. All documents mentioned herein are incorporated herein
by reference in their entirety. In the following Examples, compound
reference numbers designate the compound as shown in Scheme 1 and 2
herein.
EXAMPLE 1
The Use of LNA-Modified Oligonucleotides in Microarrays Provide
Significantly Improved Sensitivity and Specificity in Expression
Profiling
[0265] This example demonstrates the advantages of using LNA
oligonucleotide microarrays in gene expression profiling
experiments. Capture probes for the Saccharomyces cerevisiae genes
SWI5 (YDR146C) and THI4 (YGR144W) were designed as 50-mer standard
DNA and different LNA/DNA "mixmer" oligonucleotides (i.e.,
oligonucleotides containing both LNA and DNA nucleotides)
respectively, for comparison (Table 2). In addition, 40-mer
oligonucleotides were designed as truncated versions of the 50-mer
capture probes (Table 2). The specificity of the LNA oligoarrays
was addressed by introducing 1-5 consecutive mismatches positioned
in the middle of 40-mer LNA/DNA mixmer capture probes with LNA in
every fourth position. To assess the sensitivity of DNA versus LNA
capture probes in complex hybridization mixtures, in vitro
synthesized yeast RNA for either SWI5 or THI4 was spiked into
Caenorhabditis elegans total RNA for cDNA target synthesis. These
experiments are described further below.
Cultivation of Caenorhabditis elegans Worms
[0266] Mixed stage C. elegans cultures were grown according to
standard methods. Samples were harvested by centrifugation at
3,000.times.g, suspended in RNA Later storage buffer (Ambion, USA),
and immediately frozen in liquid nitrogen.
RNA Extraction
[0267] RNA was extracted from the worm samples using the
FastRNA.RTM. Kit, GREEN (Q-BIO) essentially according to the
suppliers' instructions.
In Vitro RNA Synthesis
[0268] Amplification of the yeast genes was performed using
standard PCR with yeast genomic DNA as the template. In the first
step, a forward primer containing a restriction enzyme site and a
reverse primer containing a universal linker sequence were used. In
the second PCR reaction, the reverse primer was exchanged with a
nested primer containing a poly-T20 tail and a restriction enzyme
site. The DNA fragments were ligated into the pTRIamp18 vector
(Ambion, USA) using the Quick Ligation Kit (New England Biolabs,
USA) according to the supplier's instructions and transformed into
E. coli DH-5.alpha. by standard methods. The PCR clones were
sequenced using M13 forward and M13 reverse primers on an ABI 377
(Applied Biosystems, USA). Synthesis of in vitro RNA was carried
out using the MEGAscript.TM. T7 Kit (Ambion, USA) according to the
manufacturer's instructions.
Design and Synthesis of the LNA Capture Probes
[0269] To design the capture probes, regions with unique mRNA
sequence of the selected target genes were identified. The optimal
50-mer oligonucleotide sequences with respect to T.sub.m,
self-complementarity, and secondary structure were selected. LNA
modifications were incorporated to increase affinity and
specificity.
Printing of the LNA Microarrays
[0270] The microarrays were printed on Immobilizer.TM. MicroArray
Slides (Exiqon, Denmark) using the Biochip One Arrayer from Packard
Biochip technologies (Packard, USA). The arrays were printed with a
spot volume of 2.times.300 pl of a 10 .mu.M capture probe solution.
Four replicas of the capture probes were printed on each slide.
Synthesis of Fluorochrome Labelled First Strand cDNA from Total
RNA
[0271] Ten ng of S. cerevisiae in vitro synthesized RNA (either
SWI5 or THI4) was combined with 10 .mu.g of C. elegans total RNA
and 5 .mu.g oligo dT primer (T20VN) in an RNase free,
pre-siliconized 1.5 mL tube, and the final volume was adjusted with
DEPC-water to 8 .mu.L. The reaction mixture was heated at
+70.degree. C. for 10 minutes, quenched on ice for 5 minutes, and
spun for 20 seconds, followed by addition of 1 .mu.L
SUPERase-In.TM. (20 U/.mu.L, RNAse inhibitor, Ambion, USA), 4 .mu.L
5.times. RTase buffer (Invitrogen, USA), 2 .mu.L 0.1 M DTT
(Invitrogen, USA), 1 .mu.L dNTP (20 mM DATP, dGTP, dTTP; 0.4 mM
dCTP in DEPC-water, Amersham Pharmacia Biotech, USA), and 3 .mu.L
Cy3.TM.-dCTP or Cy5.TM.-dCTP (Amersham Pharmacia Biotech, USA).
First strand cDNA synthesis was carried out by adding 1 .mu.L of
Superscript.TM. II (Invitrogen, 200 U/mL), mixing, and incubating
the reaction mixture for one hour at 42.degree. C. An additional 1
.mu.L of Superscript.TM. II was added, and the cDNA synthesis
reaction mixture was incubated for an additional one hour at
42.degree. C.; the reaction was stopped by heating at 70.degree. C.
for 5 minutes, and quenching on ice for 2 minutes. The RNA was
hydrolyzed by adding 3 .mu.L of 0.5 M NaOH, and incubating at
70.degree. C. for 15 minutes. The samples were neutralized by
adding 3 .mu.L of 0.5 M HCl, and purified by adding 450 .mu.L
1.times.TE buffer, pH 7.5 to the neutralized sample and
transferring the samples onto a Microcon-30 concentrator. The
samples were centrifuged at 14000.times.g in a microcentrifuge for
.about.8 minutes, the flow-through was discarded and the washing
step was repeated twice by refilling the filter with 450 .mu.l
1.times.TE buffer and by spinning for .about.12 minutes.
Centrifugation was continued until the volume was reduced to 5
.mu.L, and finally the labelled cDNA probe was eluted by inverting
the Microcon-30 tube and spinning at 1000.times.g for 3
minutes.
Hybridization with Fluorochrome-Labelled cDNA
[0272] The arrays were hybridized overnight using the following
protocol. The Cy3.TM. or Cy5.TM.-labelled cDNA samples were
combined in one tube followed by addition of 3 .mu.L 20.times.SSC
(3.times.SSC final), 0.5 .mu.L 1 M HEPES, pH 7.0 (25 mM final), 25
.mu.g yeast tRNA (1.25 .mu.g/.mu.L final), 10 .mu.g PolyA blocker
(0.5 .mu.g/.mu.L final), 0.6 .mu.L 10% SDS (0.3% fmal), and
DEPC-treated water to 20 .mu.L final volume. The labelled cDNA
target sample was filtered in a Millipore 0.22 micron spin column
according to the manufacturer's instructions (Millipore, USA), and
the probe was denatured by incubating the reaction at 100.degree.
C. for 2 minutes. The sample was cooled at 20-25.degree. C. for 5
minutes by spinning at maximum speed in a microcentrifuge. A
LifterSlip (Erie Scientific Company, USA) was carefully placed on
top of the microarray spotted on Immobilizer.TM. MicroArray Slide,
and the hybridization mixture was applied to the array from the
side. An aliquot of 30 .mu.L of 3.times.SSC was added to both ends
of the hybridization chamber, and the Immobilizer.TM. MicroArray
Slide was placed in the hybridization chamber. The chamber was
sealed watertight and incubated at 65.degree. C. for 16-18 hours
submerged in a water bath. After hybridization, the slide was
removed carefully from the hybridization chamber and washed using
the following protocol. The Lifterslip coverslip was washed off in
2.times.SSC, pH 7.0 containing 0.1% SDS at room temperature for one
minute, followed by washing of the microarrays subsequently in
1.0.times.SSC, pH 7.0 at room temperature for one minute, and then
in 0.2.times.SSC, pH 7.0 at room temperature for one minute.
Finally, the slides were washed for 5 seconds in 0.05.times.SSC, pH
7.0. The slides were then dried by centrifugation in a swinging
bucket rotor at approximately 600 rpm for 5 minutes.
Data Analysis
[0273] Following washing and drying, the slides were scanned using
a ScanArray 4000XL scanner (Perkin-Elmer Life Sciences, USA), and
the array data were processed using the GenePix.TM. Pro 4.0
software package (Axon, USA).
Results
[0274] Incorporation of LNA nucleotides at every third nucleotide
position in standard 50-mer expression array oligonucleoitde
capture probes resulted in a 3-fold increase in fluorescence
intensity levels, when hybridized under standard stringency
conditions (FIGS. 4A and 4B). When the hybridization temperature is
increased from 65.degree. C. to 70.degree. C., the capture of the
SWI5 spike mRNA by LNA 50-mer oligos is increased by 8-fold
relative to the DNA controls. Thus, it can clearly be concluded
that oligonucleotides containing LNA units are more sensitive in
expression profiling compared to oligonucleotides containing only
DNA units. The specificity of 40-mer LNA/DNA mixmer capture probes
in the discrimination of highly homologous target sequences was
addressed by introducing 1-5 consecutive mismatches in the middle
of SWI5 and THI4 capture oligos together with the corresponding DNA
controls. As demonstrated in FIGS. 5A and 5B, the LNA-spiked (LNA
modification at every fourth nucleotide position) 40-mer triple
mismatch oligos showed a 3-fold signal intensity decrease relative
to the perfectly matched duplexes, whereas the corresponding 40-mer
standard DNA capture probes did not form duplexes under standard
hybridization stringency. Further, the 40-mer perfect match LNA
capture probes showed a 5-fold to 14-fold increase in the intensity
levels compared to DNA oligonucleotides under standard
hybridization conditions. Capture probes of other lengths and/or
with other LNA substitution patterns can be used similarly.
[0275] Table 2. DNA and LNA-modified SWI5 (YDR146C) and THI4
(YGR144W) oligonucleotide capture probes. LNA modifications are
depicted by uppercase letters in the sequence, mt denotes the
number of mismatches (bolded) in the center of the oligonucleotide
with respect to its target cDNA (mRNA), and "mC" denotes LNA methyl
cytosine. (SEQ ID NOs:) TABLE-US-00002 Oligo Name Sequence
YDR146C-40 acggggattatggtttcgccaatgaaaacta atcaaaggt YDR146C-40_mt1
acggggattatggtttcgcctatgaaaacta atcaaaggt YDR146C-40_mt2
acggggattatggtttcgcgtatgaaaacta atcaaaggt YDR146C-40_mt3
acggggattatggtttcgggtatgaaaacta atcaaaggt YDR146C-40_mt4
acggggattatggtttcgggtttgaaaacta atcaaaggt YDR146C-40_mt5
acggggattatggtttcgggttagaaaacta atcaaaggt YDR146C-40_LNA4
acGgggAttaTggtTtcgmCcaaTgaaAact AatcAaagGt YDR146C-40_LNA4_mt1
acGgggAttaTggtTtcgmCctaTgaaAact AatcAaagGt YDR146C-40_LNA4_mt2
acGgggAttaTggtTtcgmCgtaTgaaAact AatcAaagGt YDR146C-40_LNA4_mt3
acGgggAttaTggtTtcgGgtaTgaaAactA atcAaagGt YDR146C-40_LNA4_mt4
acGgggAttaTggtTtcgGgttTgaaAactA atcAaagGt YDR146C-40_LNA4_mt5
acGgggAttaTggtTtcgGgttAgaaAactA atcAaagGt YDR146C-50
tgggaatggaacggggattatggtttcgcca atgaaaactaatcaaaggt YDR146C-50_mt1
tgggaatggaacggggattatggtatcgcca atgaaaactaatcaaaggt YDR146C-50_mt2
tgggaatggaacggggattatggtaacgcca atgaaaactaatcaaaggt YDR146C-50_mt3
tgggaatggaacggggattatggtaaggcca atgaaaactaatcaaaggt YDR146C-50_mt4
tgggaatggaacggggattatggaaaggcca atgaaaactaatcaaaggt YDR146C-50_mt5
tgggaatggaacggggattatggaaagccca atgaaaactaatcaaaggt YDR146C-50_LNA2
TgGgAaTgGaAcGgGgAtTaTgGtTtmCgmC cAaTgAaAamCtAaTcAaAgGt
YDR146C-50_LNA3 TggGaaTggAacGggGatTatGgtTtcGccA atGaaAacTaaTcaAagGt
YDR146C-50_LNA4 TgggAatgGaacGgggAttaTggtTtcgmCc
aaTgaaAactAatcAaagGt YDR146C-50_LNA5
TgggaAtggaAcgggGattaTggttTcgccA atgaAaactAatcaAaggt YDR146C-50_LNA6
TgggaaTggaacGgggatTatggtTtcgccA atgaaAactaaTcaaagGt
YDR146C-50_LNA3_mt1 TggGaaTggAacGggGatTatGgtAtcGccA
atGaaAacTaaTcaAagGt YDR146C-50_LNA3_mt2
TggGaaTggAacGggGatTatGgtAacGccA atGaaAacTaaTcaAagGt
YDR146C-50_LNA3_mt3 TggGaaTggAacGggGatTatGgtAagGccA
atGaaAacTaaTcaAagGt YDR146C-50_LNA3_mt4
TggGaaTggAacGggGatTatGgaAagGccA atGaaAacTaaTcaAagGt
YDR146C-50_LNA3_mt5 TggGaaTggAacGggGatTatGgaAagmCcc
AatGaaAacTaaTcaAagGt YGR144W-40 ttgctgaactggatggattaaaccgtatggg
tccaacttt YGR144W-40_mt1 ttgctgaactggatggatttaaccgtatggg tccaacttt
YGR144W-40_mt2 ttgctgaactggatggatataaccgtatggg tccaacttt
YGR144W-40_mt3 ttgctgaactggatggatattaccgtatggg tccaacttt
YGR144W-40_mt4 ttgctgaactggatggatatttccgtatggg tccaacttt
YGR144W-40_mt5 ttgctgaactggatggatatttgcgtatggg tccaacttt
YGR144W-40_LNA4 ttGctgAactGgatGgatTaaamCcgtAtgg GtccAactTt
YGR144W-40_LNA4_mt1 ttGctgAactGgatGgatTtaamCcgtAtgg GtccAactTt
YGR144W-40_LNA4_mt2 ttGctgAactGgatGgatAtaamCcgtAtgg GtccAactTt
YGR144W-40_LNA4_mt3 ttGctgAactGgatGgatAttamCcgtAtgg GtccAactTt
YGR144W-40_LNA4_mt4 ttGctgAactGgatGgatAtttmCcgtAtgg GtccAactTt
YGR144W-40_LNA4_mt5 ttGctgAactGgatGgatAtttGcgtAtggG tccAactTt
YGR144W-50 ggtatggaagttgctgaactggatggattaa accgtatgggtccaacttt
YGR144W-50_mt1 ggtatggaagttgctgaactggatcgattaa accgtatgggtccaacttt
YGR144W-50_mt2 ggtatggaagttgctgaactggatccattaa accgtatgggtccaacttt
YGR144W-50_mt3 ggtatggaagttgctgaactggaaccattaa accgtatgggtccaacttt
YGR144W-50_mt4 ggtatggaagttgctgaactggaacctttaa accgtatgggtccaacttt
YGR144W-50_mt5 ggtatggaagttgctgaactggaacctataa accgtatgggtccaacttt
YGR144W-50_LNA3 GgtAtgGaaGttGctGaamCtgGatGgaTta
AacmCgtAtgGgtmCcaActTt YGR144W-50_LNA3_mt1
GgtAtgGaaGttGctGaamCtgGatmCgaTt aAacmCgtAtgGgtmCcaActTt
YGR144W-50_LNA3_mt2 GgtAtgGaaGttGctGaamCtgGatmCcaTt
aAacmCgtAtgGgtmCcaActTt YGR144W-50_LNA3_mt3
GgtAtgGaaGttGctGaamCtgGaamCcaTt aAacmCgtAtgGgtmCcaActTt
YGR144W-50_LNA3_mt4 GgtAtgGaaGttGctGaamCtgGaamCctTt
aAacmCgtAtgGgtmCcaActTt YGR144W-50_LNA3_mt5
GgtAtgGaaGttGctGaamCtgGaamCctAt aAacmCgtAtgGgtmCcaActTt
EXAMPLE 2
Detection of Alternative Splice Isoforms Using Exon-Specific,
Internal LNA Capture Probes in the Caenorhabditis elegans Gene
Let-2
Capture Probe Design
Finding the Regions of Interest
[0276] From the database "intronerator" (W. Jim Kent and Al M.
Zahler, "The Intronerator: exploring introns and alternative
splicing in C. elegans," Nucleic Acids Research Jan. 1, 2000;
28(1):91-93 and "Conservation, Regulation, Synteny, and Introns in
a Large-scale C. briggsae-C. elegans Genomic Alignment" in Genome
Research August, 2000; 10(8):1115-1125) as well as scientific
literature, the C. elegans Let-2 gene encoding type IV collagen was
found according to the following criteria. The generation of mature
mRNA desirably involves either complete exon or intron skipping.
ESTs (expressed sequence tags) desirably indicate different
isoforms. If ESTs were only different from the gene annotation(s),
this could simply mean that the prediction is wrong, and nothing
more. Desirably, there are different EST splice indications in
different developmental stages. Two gene prediction algorithms
(e.g., GeneFinder and Genie) desirably agree upon the number of
genes in a coding segment. Exons of interest (e.g., exons being
skipped and their flanking exons) in the C. elegans gene T01D3.3
desirably exceed 70 base-pairs. Other genes of interest may be
selected using one or more of the above criteria or using other
criteria, such as the medical relevance of the gene.
Determining Melting Temperatures and Palindromic Properties of the
C. elegans Let-2 Gene/Exons 8, 9, 10, and 11-Specific Capture
Probes
[0277] The script PICK70 (which was kindly provided by Jingchun Zhu
from the Joe DeRisi Laboratory and which is publicly available) was
used to run a sliding 50 base-pair window across the regions in
which an oligonucleotide capture probe should be designed. The
output data were saved for later.
Determining the Uniqueness of the Regions
[0278] All regions were compared using a publicly available BLAST
program to the complete set of annotated transcripts from the C.
elegans genome downloaded from NCBI. For each region a list with
the location of all BLAST hits was made.
Choice of Desirable T.sub.m for Capture Probes
[0279] From the PICK70 output, the distribution of melting
temperatures for all possible oligonucleotides was collected. As
these centered around approximately 80.degree. C., this temperature
was chosen as the desirable temperature.
[0280] For each region, an oligonucleotide with a palindromic value
below 100 (default value in PICK70, value based on Smith-Waterman
algorithm) and with a melting temperature closest to 80.degree. C.
was picked. The location of the oligonucleotide within the region
was then compared to the list made using the above BLAST search. If
the oligonucleotide did not coincide with a BLAST hit exceeding
around 25 (consecutive) base-pairs, this oligonucleotide sequence
was chosen as a 50-mer capture probe. Otherwise, a new oligo
sequence was picked from the PICK70 output.
Checking Probe Sequences
[0281] The selected 50-mer oligonucleotide sequences were "BLASTed"
against the C. elegans transcripts again, as described above.
Accounting for the Introns.
[0282] The oligonucleotide sequences were "BLASTed" against the
complete C. elegans genome. The matches were run against a list
made from the GenBank reports of the complete genome, indexing
whether positions in the genome were genic or intergenic.
[0283] It was checked to determine whether new hits to genic
regions appeared (compared to the initial BLAST search using the
PICK70 output). If this was not case, the oligonucleotide sequences
were selected for capture probe synthesis.
Design of the LNA-Modified Capture Probes
[0284] For the LNA-modified oligonucleotide capture probes, every
fourth DNA nucleotide was substituted with an LNA nucleotide, as
shown in Table 3. The oligonucleotides were synthesized with an
anthraquinone (AQ) moiety at the 5'-end of each oligonucleotide
(e.g., as described in allowed U.S. Ser. No. 09/611,833), followed
by a hexaethyleneglycol tetramer linker region and the LNA/DNA
mixmer capture oligonucleotide sequence. TABLE-US-00003 TABLE 3 C.
elegans let-2 gene/exons 8, 9, 10, and 11-specific capture probes
(SEQ ID NOs:) Sequence (LNA = uppercase, Capture probe DNA =
lowercase letters) CE42.08-OHEG4
GgctGgatmCcccAggaAaccmCaggAatcGgaaGca tTggamCcaaAaggAg
CE42.09-OHEG4 mCaccGgatmCcggmCtcaAttgTcggAcctmCgcgG
aaamCcctGgagAaaaGg CE42.10-OHEG4
TccgmCcagGcccAatcGcctmCcacmCatgTccaAg ggAaccAttaTcggTc
CE42.11-OHEG4 GagcmCaggAgagGgagGtcaAcgcGgttAcccAgga
AatgGaggActcTc
Strains and Growth Conditions
[0285] C. elegans wild-type strain (Bristol-N2) was maintained on
nematode growth medium (NG) plates seeded with Escherichia coli
strain OP50 at 20.degree. C., and the eggs and L1 larvae were
prepared as described in Hope, I. A. (ed.) "C. elegans--A Practical
Approach ", Oxford University Press 1999. The samples were
immediately flash frozen in liquid N.sub.2 and stored at
-80.degree. C. until RNA isolation.
Isolation of Total RNA
[0286] A 100 .mu.l aliquot of packed C. elegans worms from a L1
larvae population was homogenized using the FastPrep Bio 101 from
Kem-En-Tec for 1 minute at speed 6 followed by isolation of total
RNA from the extracts using the FastPrep Bio 101 kit (Kem-En-Tec)
according to the manufacturer's instructions. A 50 .mu.l aliquot of
packed C. elegans eggs was homogenized in lysis buffer (RNeasy
total RNA purification kit, QIAGEN) containing quartz sand for 3
minutes using a Pellet Pestle Motor followed by isolation of total
RNA according to the manufacturer's manual.
[0287] The eluted total RNA from worms (L1 larvae) as well as eggs
was ethanol precipitated for 24 hours at -20.degree. C. by addition
of 2.5 volumes of 96% EtOH and 0.1 volume of 3M Na-acetate, pH 5.2
(Ambion, USA), followed by centrifugation of the total RNA sample
for 30 minutes at 13200 rpm. The total RNA pellet was air-dried and
redissolved in 6 .mu.l (worms) or 2.5 .mu.l (eggs) of
diethylpyrocarbonate (DEPC)-treated water (Ambion, USA) and stored
at -80.degree. C.
Reverse Transcription (RT)-PCR
[0288] Total RNA (1.5 .mu.g) from eggs or 1 .mu.g total RNA from
worms (L1 larvae) were mixed with 5 .mu.g oligo(dT)12-18 primer
(Amersham Pharmacia Biotech, USA) and 0.5 .mu.g of random hexamers,
pd(N).sub.6 (Amersham Pharmacia Biotech, USA) and DEPC-treated
water to a final volume of 7 .mu.l. The mixture was heated at
70.degree. C. for 10 minutes, quenched on ice for 5 minutes,
followed by addition of 20 units of Superasin RNase inhibitor
(Ambion, USA), 4 .mu.l of 5.times. Superscript buffer (Life
Technologies, USA), 2 .mu.l of 100 mM DTT, 1 .mu.l of dNTP solution
(20 mM each DATP, dGTP, dTTP and dCTP, Amersham Pharmacia Biotech,
USA), and 3 .mu.l of DEPC-treated water.
[0289] The primers were pre-annealed at 37.degree. C. for 5
minutes, followed by addition of 400 units of Superscipt II reverse
transcriptase (Invitrogen, USA). First strand cDNA synthesis was
carried out at 37.degree. C. for 30 minutes, followed by 2 hours at
42.degree. C., and the reaction was stopped by incubation at
70.degree. C. for 5 minutes, followed by incubation on ice for 5
minutes.
[0290] Unincorporated dNTPs were removed by gel filtration using
MicroSpin S-400 HR columns as described below. The column was
pre-spun for 1 minute at 735.times.g in a 1.5 ml tube, and the
column was placed in a new 1.5 ml tube. The cDNA sample was slowly
applied to the top center of the resin and spun at 735.times.g for
2 minutes. The eluate was collected. The volume of the eluate was
adjusted to 50 .mu.l with TE-buffer pH 7.0 before being used as the
template for linear PCR. Four .mu.l template (RT from eggs or
worms) was combined with 1 .mu.l dNTP solution (10 mM each dATP,
dGTP, dTTP and dCTP, Amersham Phamacia Biotech, USA), 1 .mu.l of
each primer (20 .mu.M CE42.07 sense:
gatcgaattcctccaggagagaagggagatg (SEQ ID NO:), and CE42.12
antisense: 5'gatcaagcttatctcttcctgggtatccagctt (SEQ ID NO:)), 5
.mu.l 10.times. AmpliTaq Gold Polymerase buffer, 5 .mu.l 25 mM
MgCl.sub.2, 0.5 .mu.l AmpliTaq Gold DNA polymerase (5 U/.mu.l,
Applied Biosystems), 2 .mu.l Cy3-dCTP (Amersham Phamacia Biotech,
USA) (eggs) or 2 .mu.l Cy5-dCTP (Amersham Pharmacia Biotech, USA)
(worms), and 31.5 .mu.l DEPC-treated water to a final volume of 50
.mu.l. The PCR reactions were carried out using the following
program: 95.degree. C. for 5 minutes followed by 30 cycles of PCR
using the following cycling program (denaturation at 95.degree. C.
for 45 seconds, annealing at 60.degree. C. for 30 seconds, and
extension at 72.degree. C. for 1 minute) followed by a final
extension step at 72.degree. C. for 10 minutes and incubation on
ice for 5 minutes.
[0291] Purification of the PCR amplicons from eggs as well as worms
was performed using a Qiaquick PCR purification kit (QIAGEN)
according to the manufacturer's instructions.
Fluorochrome-Labeling of the Let-2 cDNA Fragments Using Primer
Extension
[0292] Four (4) .mu.l template (RT from eggs or worms) was combined
with 1 .mu.l dNTP solution (10 mM each dATP, dGTP, dTTP and dCTP,
Amersham Phamacia Biotech, USA), 1 .mu.l of each primer (20 .mu.M
CE42.12 antisense 5'gatcaagcttatctcttcctgggtatccagctt (SEQ ID
NO:)), 5 .mu.l 10.times. AmpliTaq Gold Polymerase buffer, 5 .mu.l
25 mM MgCl.sub.2, 0.5 .mu.l AmpliTaq Gold DNA polymerase (5
U/.mu.l, Applied Biosystems), 2 .mu.l Cy3-dCTP (Amersham Phamacia
Biotech, USA) (eggs) or 2 .mu.l Cy5-dCTP (Amersham Phamacia
Biotech, USA) (worms), and 31.5 .mu.l DEPC-treated water to a final
volume of 50 .mu.l. The PCR reactions were carried out using the
following program: 95.degree. C. for 5 minutes followed by 30
cycles of PCR using the following cycling program (denaturation at
95.degree. C. for 45 seconds annealing at 60.degree. C. for 30
seconds extension at 72.degree. C. for 1 minute) followed by a
final extension step at 72.degree. C. for 10 minutes and incubation
on ice for 5 minutes.
[0293] Purification of the PCR amplicons from eggs as well as worms
were performed using a Qiaquick PCR purification kit (QIAGEN)
according to the manufacturer's instructions. Unincorporated dNTP
nucleotides were removed by gel filtration using MicroSpin S-400 HR
columns as described above before the eluted, fluorochrome-labelled
DNA fragments were stored at -20.degree. C. in the dark until
microarray hybridization.
Printing and Coupling of the C. elegans Let-2 Exon 8-11
Microarrays
[0294] The C. elegans gene Let-2/exon 8-11 capture probes were
synthesized with a 5' anthraquinone (AQ)-modification, followed by
a hexaethyleneglycol-4 (HEG4) linker (Table 3). The capture probes
were first diluted to a 10 .mu.M final concentration in 100 mM
Na-phosphate buffer pH 7.0 and spotted on Euray COP microarray
slides using the Biochip Arrayer One (Packard Biochip Technologies)
with a spot volume of 300 pl and 300 .mu.m between the spots.
[0295] The capture probes were immobilized onto the microarray
slide by UV irradiation in a Stratalinker for 90 seconds at full
power (Stratagene, USA). Non-immobilized capture probe
oligonucleotides were removed from the slides by washing the slides
for 1/2 hour in 30% acetone before rising in milli-Q H.sub.2O.
After washing, the slides were centrifuged at 800 rpm for 2 minutes
and stored in a slide box until microarray hybridization.
Comparative Hybridization of the C. elegans Microarrays and
Post-Hybridization Washes
[0296] The slides were hybridized with 2.5 .mu.l of the
Cy3-labelled and 2.5 .mu.l of the Cy5-labelled target preparation
from eggs and worms, respectively, as described above (see "Reverse
transcription (RT)-PCR" section) in 25 .mu.l of hybridization
solution, containing 25 mM HEPES, pH 7.0, 3.times.SSC, 0.3% SDS,
and 25 .mu.g of yeast tRNA. The target probe was filtered in a
Millipore 0.22 micron spin column (Ultrafree-MC, Millipore, USA),
denatured by incubation at 100.degree. C. for 5 minutes, cooled at
room temperature for 5 minutes, and then carefully applied onto the
prepared microarray. One-third of a cover slip was laid over the
microarray, and the hybridization was performed for 16-18 hours at
65.degree. C. in a hybridization chamber (DieTech, model Joe
deRisi, USA).
[0297] Following hybridization, the slides were washed sequentially
by plunging gently in 2.times.SSC/0.1% SDS at room temperature
until the cover slip falls off into the washing solution, then in
1.times.SSC pH 7.0 (150 mM NaCl, 15 mM Sodium Citrate) at room
temperature for 1 minute, then in 0.2.times.SSC, pH 7.0 (30 mM
NaCl, 3 mM Sodium Citrate) at room temperature for 1 minute, and
finally in 0.05.times.SSC (7.5 mM NaCl, 0.75 mM Sodium Citrate) for
5 seconds, followed by drying of the slides by spinning at 500 rpm
for 5 minutes. The slides were stored in a slide box in the dark
until scanning.
Microarray Data Analysis
[0298] The C. elegans let-2 gene microarray was scanned in an
ArrayWoRx Scanner (Applied Precision, USA) using an exposure time
of 5 seconds, resolution of 5.0, and high (high level) sensitivity.
The hybridization data were analyzed using the ArrayVision image
analysis software package 5.1 (IMAGING Research Inc., USA). The
detection principle for alternative exon skipping the C. elegans
let-2 gene is shown in FIG. 6. As demonstrated in FIG. 7, analysis
of the comparative hybridization data from the C. elegans Let-2
exon 8-11 array demonstrates detection of alternative exon skipping
of the let-2 exon 9 (eggs) and exon 10 (L1 larvae) using
LNA-modified 50-mer capture probes. Capture probes of other lengths
and/or with other LNA substitution patterns can be used
similarly.
EXAMPLE 3
Improved Sensitivity in the Specific Detection of the C. elegans
Gene T01D3.3 Exon 4 Using LNA-Modified Oligonucleotide Capture
Probes
[0299] Capture Probe Design: The design method of exon-specific
capture probes for the C. elegans gene T01D3.3 exon 4 has been
described in example 2.
[0300] Design of the LNA-modified Capture Probes. For the
LNA-spiked oligonucleotide capture probes, every fourth DNA
nucleotide was substituted with an LNA nucleotide, as shown in
Table 4. TABLE-US-00004 TABLE 4 C. elegans gene TO1D3.3/exon
4-specific capture probes. (SEQ ID NOs:) Sequence (LNA = uppercase,
Capture probes DNA = lowercase letters) CEgene26.04-70
ggctggaacagaagtttgttggtgcgtgacaa ggtatggaagaagattatccggaaaagaaagc
aaagac CEgene26.04-50 ggctggaacagaagtttgttggtgcgtgacaa
ggtatggaagaagattat CEgene26.04-40 ggctggaacagaagtttgttggtgcgtgacaa
ggtatgga CEgene26.04-30 gaacagaagtttgttggtgcgtgacaaggt
CEgene26.04-50HEG2 GgctGgaamCagaAgttTgttGgtgmCgtgAc
aaGgtaTggaAgaaGattAt CEgene26.04-50HEG4
GgctGgaamCagaAgttTgttGgtgmCgtgAc aaGgtaTggaAgaaGattAt
CEgene26.04-40HEG2 GgctGgaamCagaAgttTgttGgtgmCgtgAc aaGgtaTgga
CEgene26.04-40HEG4 GgctGgaamCagaAgttTgttGgtgmCgtgAc aaGgtaTgga
CEgene26.04-30HEG2 GaacAgaaGtttGttgGtgcGtgamCaagGt
CEgene26.04-30HEG4 GaacAgaaGtttGttgGtgcGtgamCaagGt
Cultivation of Caenorhabditis elegans Worms
[0301] Mixed stage C. elegans cultures were grown according to
standard methods. Samples were harvested by centrifugation at
3000.times.g, suspended in RNA Later (Ambion, USA), and immediately
frozen in liquid nitrogen.
mRNA Isolation from C. elegans Mixed Stages Worms
[0302] Poly(A).sup.+RNA was isolated from the worm samples using
the Pick-Pen (Bio-Nobile, Finland) Starter kit combined with the
KingFisher mRNA purification kit (ThermoLabsystems, Finland)
according to the manufacturer's instructions. The yield was 1-2
.mu.g poly(A).sup.+RNA from approximately 50 mg of C. elegans
worms.
Synthesis of Fluorochrome Labelledfirst Strand cDNA from C. elegans
mRNA
[0303] One .mu.g of C. elegans poly(A).sup.+RNA was combined with 2
.mu.g oligo dT primer (T20VN) in an RNase free, pre-siliconized 1.5
mL tube, and the final volume was adjusted with DEPC-water to 8
.mu.L. The reaction mixture was heated at +70.degree. C. for 10
minutes, quenched on ice 5 minutes, spun for 20 seconds, followed
by addition of 1 .mu.L SUPERase-In.TM. (20 U/.mu.L, RNAse
inhibitor, Ambion, USA), 4 .mu.L 5.times. RTase buffer (Invitrogen,
USA), 2 .mu.L 0.1 M DTT (Invitrogen, USA), 1 .mu.L dNTP (20 mM
dATP, dGTP, dTTP; 4 mM dCTP in DEPC-water, Amersham Pharmacia
Biotech, USA), and 3 .mu.L Cy3.TM.-dCTP (Amersham Pharmacia
Biotech, USA). First strand cDNA synthesis was carried out by
adding 1 .mu.L of Superscript.TM. II (Invitrogen, 200 U/mL),
mixing, and incubating the reaction mixture for one hour at
42.degree. C. An additional 1 .mu.L of Superscript.TM. II was added
and the cDNA synthesis reaction mixture was incubated for an
additional one hour at 42.degree. C.; the reaction was stopped by
heating at 70.degree. C. for 5 minutes, and quenching on ice for 2
minutes. The RNA was hydrolyzed by adding 3 .mu.L of 0.5 M NaOH and
incubating at 70.degree. C. for 15 minutes. The samples were
neutralized by adding 3 .mu.L of 0.5 M HCl and purified by adding
450 .mu.L 1.times.TE buffer, pH 7.5 to the neutralized sample and
transferring the samples onto a Microcon-30 concentrator. The
samples were centrifuged at 14000.times.g in a microcentrifuge for
.about.8 minutes, the flow-through was discarded, and the washing
step was repeated twice by refilling the filter with 450 .mu.l
1.times.TE buffer and by spinning for .about.12 minutes.
Centrifugation was continued until the volume was reduced to 5
.mu.L, and finally the labelled cDNA probe was eluted by inverting
the Microcon-30 tube and spinning at 1000.times.g for 3
minutes.
Printing and Coupling of the C. elegans Microarrays
[0304] The C. elegans gene T01D3.3/exon 4 capture probes were
synthesized with a 5' anthraquinone (AQ)-modification, followed by
either a hexaethyleneglycol-2 or a hexaethyleneglycol-4 (HEG2/HEG4)
linker (Table 4). The capture probes were first diluted to a 10
.mu.M final concentration in 100 mM Na-phosphate buffer pH 7.0,
followed by a two-fold dilution series (10 .mu.M, 5 .mu.M, 2.5
.mu.M, 1.25 .mu.M, 0.625 .mu.M, 0.31 .mu.M, and 0.155 .mu.M) and
spotted on Exiqon's polycarbonate microarray slides using the
Biochip Arrayer One (Packard Biochip Technologies, USA) with a spot
volume of 3.times.300 pl and 400 .mu.m between the spots. The
capture probes were immobilized onto the microarray slide by UV
irradiation in a Stratalinker for 90 seconds at full power
(Stratagene, USA). Non-immobilized capture probe oligonucleotides
were removed from the slides by washing the slides for 24 hours in
milli-Q H.sub.2O. After washing, the slides were dried in an oven
at 37.degree. C. for 30 minutes and stored in a slide box until
microarray hybridization.
Hybridization with Cy3-Labelled cDNA
[0305] The arrays were hybridized overnight using the following
protocol. The Cy3.TM.-labelled cDNA sample was combined with 3
.mu.L 20.times.SSC (3.times.SSC final), 0.5 .mu.L 1 M HEPES, pH 7.0
(25 mM final), 25 .mu.g yeast tRNA (1.25 .mu.g/.mu.L final), 10
.mu.g PolyA blocker (0.5 .mu.g/.mu.L final), 0.6 .mu.L 10% SDS
(0.3% final), and DEPC-treated water to 20 .mu.L final volume. The
labelled cDNA target sample was filtered in a Millipore 0.22 micron
spin column according to the manufacturer's instructions
(Millipore, USA), and the probe was denatured by incubating the
reaction at 100.degree. C. for 2 minutes. The sample was cooled at
20-25.degree. C. for 5 minutes by spinning at maxium speed in a
microcentrifuge, and then carefully applied on top of the
microarray. A cover slip was laid over the microarray and the
hybridization was performed for 16 hours at 63.degree. C. in a
hybridization chamber (Corning, USA) submerged in a water bath,
with an aliquot of 30 .mu.L of 3.times.SSC added to both ends of
the hybridization chamber to prevent evaporation. After
hybridization, the slide was removed carefully from the
hybridization chamber and washed using the following protocol. The
coverslip was washed offin 2.times.SSC, pH 7.0 containing 0.1% SDS
at room temperature for one minute, followed by washing of the
microarrays subsequently in 1.0.times.SSC, pH 7.0 at room
temperature for one minute, and then in 0.2.times.SSC, pH 7.0 at
room temperature for one minute. Finally, the slides were washed
for 5 seconds in 0.05.times.SSC, pH 7.0. The slides were then dried
by centrifugation in a swinging bucket rotor at approximately 600
rpm for 5 minutes.
Microarray Data Analysis
[0306] The C. elegans gene T01D3.3 exon 4 array was scanned in an
ArrayWoRx Scanner (Applied Precision, USA) using an exposure time
of 5 seconds, resolution of 5.0, and high (high level) sensitivity.
The hybridization data were analyzed using the ArrayVision image
analysis software package 5.1 (IMAGING Research Inc., USA). As
shown in FIGS. 8A and 8B, analysis of the hybridization data from
the C. elegans gene 26/T01D3.3 exon 4 array demonstrates that the
use of LNA-modified capture probes for the C. elegans T01D3.3 exon
results in 5-fold increased sensitivity in exon 4 capture compared
to the corresponding DNA oligonucleotide capture probe controls
printed on the same microarray. Capture probes of other lengths
and/or with other LNA substitution patterns can be used
similarly.
EXAMPLE 4
Assessment of Capture Probe Specificity for the C. elegans Gene
T01D3.3 Exons 4 and 5 Using Synthetic Antisense Target Oligos
Capture probe design: Exon-specific capture probes for the C.
elegans gene T01D3.3 exons 4 and 5 were designed as described in
Example 2.
[0307] Design of the LNA-modified capture probes: For the
LNA-spiked oligonucleotide capture probes, every fourth DNA
nucleotide was substituted with an LNA nucleotide, as shown in
Table 5: C. elegans gene T01D3.3/exons 4 and 5-specific capture
probes and synthetic target oligonucleotides. TABLE-US-00005 TABLE
5 (SEQ ID NOs:) Sequence (LNA = uppercase, Capture probes DNA =
lowercase letters) CEgene26.04-70 ggctggaacagaagtttgttggtgcgtga
caaggtatggaagaagattatccggaaaa gaaagcaaagac CEgene26.05-70
tatgtggcgcgaatgagcaatattcagca tgtttctcctcttgtcaaccatcatgtca
agatccttcaac CEgene26.04-50 ggctggaacagaagtttgttggtgcgtga
caaggtatggaagaagattat CEgene26.05-50 tatgtggcgcgaatgagcaatattcagca
tgtttctcctcttgtcaacca CEgene26.04-40 ggctggaacagaagtttgttggtgcgtga
caaggtatgga CEgene26.05-40 tatgtggcgcgaatgagcaatattcagca
tgtttctcctc CEgene26.04-30 gaacagaagtttgttggtgcgtgacaagg t
CEgene26.05-30 tatgtggcgcgaatgagcaatattcagca t CEgene26.04-50HEG2
GgctGgaamCagaAgttTgttGgtgmCgt gAcaaGgtaTggaAgaaGattAt
CEgene26.04-50HEG4 GgctGgaamCagaAgttTgttGgtgmCgt
gAcaaGgtaTggaAgaaGattAt CEgene26.05-50HEG2
TatgTggcGcgaAtgaGcaaTattmCagc AtgtTtctmCctcTtgtmCaacmCa
CEgene26.05-50HEG4 TatgTggcGcgaAtgaGcaaTattmCagc
AtgtTtctmCctcTtgtmCaacmCa CEgene26.04-40HEG2
GgctGgaamCagaAgttTgttGgtgmCgt gAcaaGgtaTgga CEgene26.04-40HEG4
GgctGgaamCagaAgttTgttGgtgmCgt gAcaaGgtaTgga CEgene26.05-40HEG2
TatgTggcGcgaAtgaGcaaTattmCagc AtgtTtctmCctc CEgene26.05-40HEG4
TatgTggcGcgaAtgaGcaaTattmCagc AtgtTtctmCctc CEgene26.04-30HEG2
GaacAgaaGtttGttgGtgcGtgamCaag Gt CEgene26.04-30HEG4
GaacAgaaGtttGttgGtgcGtgamCaag Gt CEgene26.05-30HEG2
TatgTggcGcgaAtgaGcaaTattmCagc At CEgene26.05-30HEG4
TatgTggcGcgaAtgaGcaaTattmCagc At Target oligos
CEgene26.04-biotarget accttgtcacgcaccaacaaacttctgtt c
CEgene26.05-biotarget atgctgaatattgctcattcgcgccacat a
Printing and Coupling of the C. elegans Gene T01D3.3/Exon 4-5
Microarrays
[0308] The C. elegans gene T01D3.3/exon 4-5 capture probes were
synthesized with a 5' anthraquinone (AQ)-modification, followed by
either a hexaethyleneglycol-2 or a hexaethyleneglycol-4 (HEG2/HEG4)
linker (Table 5). The capture probes were first diluted to a 10
.mu.M final concentration in 100 mM Na-phosphate buffer pH 7.0,
followed by a two-fold dilution series (10 .mu.M, 5 .mu.M, 2.5
.mu.M, 1.25 .mu.M, 0.625 .mu.M, 0.31, .mu.M, and 0.155 .mu.M) and
spotted on Euray polycarbonate microarray slides using the Biochip
Arrayer One (Packard Biochip Technologies) with a spot volume of
3.times.300 pl and 400 .mu.m between the spots. The capture probes
were immobilized onto the microarray slide by UV irradiation in a
Stratalinker for 90 seconds at full power (Stratagene, USA).
Non-immobilized capture probe oligonucleotides were removed from
the slides by washing the slides for 24 hours in milli-Q H.sub.2O.
After washing, the slides were dried in an oven at 37.degree. C.
for 30 minutes, and stored in a slide box until microarray
hybridization.
Hybridization of the C. elegans Microarrays and Post-Hybridization
Washes
[0309] The slides were hybridized with a high (saturated)
concentration of 1 .mu.M of each gene T01D3.3, exon 4 or 5 target
oligo (Table 5) in 50 .mu.l of hybridization solution, containing
25 mM HEPES, pH 7.0, 3.times.SSC, 0.22% SDS, and 0.8 .mu.g/.mu.l of
poly(A) blocker. The target probes were filtered in a Millipore
0.45 micron spin column (Ultrafree-MC, Millipore, USA), denatured
by incubation at 100.degree. C. for 2 minutes, cooled at room
temperature for 5 minutes, and then carefully applied onto the
prepared microarray. One-half of a cover slip was laid over the
microarray, and the hybridization was performed for 16-18 hours at
63.degree. C. in a hybridization chamber (Corning, USA).
[0310] Following hybridization, the slides were washed sequentially
by plunging gently in 1.times.SSCT (150 mM NaCl, 15 mM Sodium
Citrate+Tween 20) at room temperature for one minute, then in
0.2.times.SSCT (30 mM NaCl, 3 mM Sodium Citrate+Tween 20) at room
temperature for one minute, and finally in Milli Q water, followed
by drying of the slides in an oven at 37.degree. C. for 30 minutes.
The slides were Cy5 labelled using a Cy5-straptavidin target.
Thirty .mu.l of a Cy5-streptavidin (2.mu.g/ml in 1.times.SSCT) were
carefully applied onto the hybridized microarray and incubated one
hour at room temperature before an additional washing step were
performed in 1.times.SSCT (150 mM NaCl, 15 mM Sodium Citrate+Tween
20) at room temperature for one minute, then in 0.2.times.SSCT (30
mM NaCl, 3 mM Sodium Citrate+Tween 20) at room temperature for one
minute, and finally in Milli Q water. Following washing, the slides
were drying in an oven at 37.degree. C. for 30 minutes and stored
in a slide box in the dark until scanning.
Microarray Data Analysis
[0311] The C. elegans gene T01D3.3 exon 4-5 microarray was scanned
in an ArrayWoRx Scanner (Applied Precision, USA) using an exposure
time of 5 seconds, resolution of 5.0, and high (high level)
sensitivity. The hybridization data were analyzed using the
ArrayVision image analysis software package 5.1 (IMAGING Research
Inc., USA). As shown in FIGS. 10A and 10B, analysis of the
hybridization data from the C. elegans gene 26/T01D3.3 array
demonstrates that both the DNA as well as the LNA capture probes
for the C. elegans T01D3.3 exons 4 (FIG. 10A) and exon 5 (FIG.
10B), respectively are highly specific with a very low level of
cross-hybridization between their respective target
oligonucleotides. The exon-specific design of the oligonucleotide
capture probes is thus validated. Capture probes of other lengths
and/or with other LNA substitution patterns can be used
similarly.
EXAMPLE 5
Detection of Alternatively Spliced Isoforms Using Internal
Exon-Specific, and Exon-Exon Junction-Specific (Merged)
LNA-Modified Capture Probes
Oligonucleotide Design for Microarrays.
[0312] Methods for designing exon-specific internal oligonucleotide
capture probes has been described in Example 2.
Design of the LNA-Modified Capture Probes
[0313] For the LNA-modified oligonucleotide capture probes, every
third DNA nucleotide was substituted with an LNA nucleotide. The
probes designed to capture the junction of the recombinant splice
variants were designed with LNA modifications in a block of five
consecutive LNAs nucleotides, two on the 5' side of the splice
junction and three on the 3' side of the splice junction. All
capture probes are shown in Table 6. TABLE-US-00006 TABLE 6
Internal, exon-specific and merged, exon-exon junction specific
oligonucleotide capture probes. (SEQ ID NOs:) Sequence (LNA =
uppercase, Capture probes DNA lowercase letters) gene78.01a
cctgaaagtagatttgttatttccgaaacgcc ttctcccgttcttaagtc gene78.01b
catataccacaaatagtccctcaaaaatcaca agaaaactcacaacactg gene78.03a
gatttgcagcggtggtaaaaagtatgaaaacg tggtaattaaaaggtctc gene78.03b
ccaatgaaaactaatcaaaggtaaacgtggat cccatggcaattcccggg gene78.m01INS3
caacactgcccagaggttcaatcgatccgatg atcctaatgaaggcgccc gene78.mINS303
gtccagtatcgtccatcatagtatcgataaat atgtgaaggaaatgcctg gene78.m01INS4
caacactgcccagaggttcaatcgatgtgtga taggatcagtgttcaggg gene78.mINS403
gaaggcgaaggagactgctaatatcgataaat atgtgaaggaaatgcctg
gene78.01a_50_LNA3 mCctGaAgaTttGttAttTccGaaAcgmCctT
ctmCccGttmCttAagTc gene78.01b_50_LNA3
mCatAtamCcamCaaAtaGtcmCctmCaaAaa TcamCaaGaaAacTcamCaamCacTg
gene78.03a_50_LNA3 GatTtgmCagmCggTggTaaAaaGtaTgaAaa
mCgtGgtAatTaaAagGtcTc gene78.03b_50_LNA3
mCcaAtgAaaActAatmCaaAggTaaAcgTgg AtcmCcaTggmCaaTtcmCcgGg
gene78.m01INS3_50_ caacactgcccagaggttcaatcGATmCmCga block
tgatcctaatgaaggcgccc gene78.mINS303_50_
gtccagtatcgtccatcatAGTATcgataaat block atgtgaaggaaatgcctg
gene78.m01INS4_50_ caacactgcccagaggttcaatcGATGTgtga block
taggatcagtgttcaggg gene78.mINS403_50_
gaaggcgaaggagactgctAArATcgataaat block atgtgaaggaaatgcctg
Printing and Coupling of the Splice Isoform-Specific
Microarrays
[0314] The splice variant capture probes were synthesized with a 5'
anthraquinone (AQ)-modification, followed by a hexaethyleneglycol-2
(HEG2) linker. The capture probes were first diluted to a 20 .mu.M
final concentration in 100 mM Na-phosphate buffer pH 7.0, and
spotted on the Immobilizer polymer microarray slides (Exiqon,
Denmark) using the Biochip Arrayer One (Packard Biochip
Technologies, USA) with a spot volume of 2.times.300 pl and 300
.mu.m between the spots. The capture probes were immobilized onto
the microarray slide by UV irradiation in a Stratalinker with 2300
.mu.joules (Stratagene, USA). Non-immobilized capture probe
oligonucleotides were removed from the slides by washing the slides
two times 15 minutes in 1.times.SSC. After washing, the slides were
dried by centrifugation at 1000.times.g for 2 minutes, and stored
in a slide box until microarray hybridization.
Construction of Splice Variant Vectors
[0315] The recombinant splice variant constructs were cloned into
the Triamp18 vector (Ambion, USA). The constructs were sequenced to
confirm their construction. The plasmid clones were transformed
into E. coli XL10-Gold (Stratagene, USA).
Triamp18/SWI5 Vector Construct
[0316] Genomic DNA was prepared from a wild-type standard
laboratory strain of Saccharomyces cerevisiae using the Nucleon MiY
DNA extraction kit (Amersham Biosciences, USA) according to the
supplier's instructions. Amplification of the partial yeast gene
was performed using standard PCR with yeast genomic DNA as the
template. In the first step of amplification, a forward primer
containing a restriction enzyme site and a reverse primer
containing a universal linker sequence were used. In this step, 20
base-pairs were added to the 3'-end of the amplicon, next to the
stop codon. In the second step of amplification, the reverse primer
was exchanged with a nested primer containing a poly-T.sub.20 tail
and a restriction enzyme site. The SWI5 amplicon contains 730 bp of
the SWI5 ORF plus a 20 bp universal linker sequence and a
poly-A.sub.20 tail. The PCR primers used were YDR146C-For-EcoRI
(acgtgaattcaaatacagacaatgaaggagatga) (SEQ ID NO:), YDR146C-Rev-Uni
(gatccccgggaattgccatgttacctttgattagttttcattggc (SEQ ID NO:)), and
Uni-polyT-BamHI (acgtggatcctttttttttttttttttttgatccccgggaattgccatg
(SEQ ID NO:)).
[0317] The PCR amplicon was cleaved with the restriction enzymes
EcoRI and BamHI. The DNA fragment was ligated into the pTRIampl 8
vector (Ambion, USA) using the Quick Ligation Kit (New England
Biolabs, USA) according to the supplier's instructions and
transformed into E. coli DH-5.alpha. by standard methods.
Construction of the Recombinant Splice Variant #1
(Triamp18/swi5-Rubisco)
[0318] The Arabidopsis thaliana Rubisco small subunit ssu2b gene
fragment (gi17064721) was amplified from genomic DNA using primers
named DJ305 (5'-ACTATGATGGACGATACTGGAC-3' (SEQ ID NO:)) and DJ306
(5'-ATTGGATCGATCCGATGATCCTAATGAAGGC-3' (SEQ ID NO:)), containing
ClaI restriction site linkers. The purified PCR fragment was
digested with ClaI and then cloned into the swi5 (gI:7839148)
vector at the unique ClaI site (atcgat) giving each insert a
flanking sequence from the original yeast SWI5 insert (named exonOl
and exon 03, FIG. 11). The product was inserted in the reverse
orientation, so that the insert sequence is as follows:
TABLE-US-00007 (SEQ ID NO:)
AtcgatCCGATGATCCTAATGAAGGCGCCCGGGTACTCCTTCTTGCATTC
TTCAACTTCCTTCAACACTTGAGCGGAGTCGGTGCATCCGAACAATGGAA
GCTTCCACATTGTCCAGTATCGTCCATCATAGTatcgat.
[0319] Nucleotide sequence analysis revealed a difference between
the sequence of A. thaliana rubisco expected from the GenBank
database and that obtained from all sequenced constructs and PCR
products. Position 30 in the Rubisco insert is "C" rather than the
expected "A." This SNP was probably created by PCR. None of the
oligonucleotide capture probes used in the example cover this
region. The Rubisco sequence in Genbank is TCCTAATGAAGGCGCCA (SEQ
ID NO:), and the sequence obtained from the plasmid contruct is
TCCTAATGAAGGCGCCC (SEQ ID NO:).
Construction of the Recombinant Splice Variant # 2
(Triamp18/swi5-Lea)
[0320] The Arabidopsis thaliana Lea gene (gi1526423) was amplified
from genomic DNA with primers named DJ307
(5'-GGAATTATCGATGTGTGATAGGATCAGTGTTCAG-3' (SEQ ID NO:)), and DJ308
(5'-AATTGGATCGATATTAGCAGTCTCCTTCGCC-3' (SEQ ID NO:)), including the
ClaI linker sites as above. The PCR fragment was digested with ClaI
cloned into the yeast SWI5 IVT construct as above at the unique
ClaI site.
[0321] The fragment was inserted in the forward orientation,
resulting in the following insert sequence: TABLE-US-00008 (SEQ ID
NO:) atcgatGTGTGATAGGTTCAGTGTTCAGGGCTGTCCAAGGAACGTATGAG
CATGCGAGAGACGCTGTAGTTGGAAAAACCCACGAAGCGGCTGAGTCTAC
CAAAGAAGGAGCTCAGATAGCTTCAGAGAAAGCGGTTGGAGCAAAGGACG
CAACCGTCGAGAAAGCTAAGGAAACCGCTGATTATACTGCGGAGAAGGTG
GGTGAGTATAAAGACTATACGGTTGATAAAGCTAAAGAGGCTAAGGACAC
AACTGCAGAGAAGGCGAAGGAGACTGCTAATatcgat.
In Vitro RNA Preparation from Splice Variant Vectors
[0322] In vitro RNA from the splice variants were made using the
MEGAscript.TM. high yield transcription kit according to the
manufacturer's instructions (Ambion, USA). The yield of IVT RNA was
quantified at a Nanodrop spectrophotometer (Nanodrop Technologies,
USA, FIG. 11).
Isolation of Total RNA from C. elegans
[0323] C. elegans wild-type strain (Bristol-N2) was maintained on
nematode growth medium (NG) plates seeded with Escherichia coli
strain OP50 at 20.degree. C., and the mixed stages of the nematode
were prepared as described by Hope (ed.) ("C. elegans--A Practical
Approach", Oxford University Press 1999). The samples were
immediately flash frozen in liquid N.sub.2 and stored at
-80.degree. C. until RNA isolation.
[0324] A 100 .mu.l aliquot of packed C. elegans worms from a mixed
stage population was homogenized using the FastPrep Bio101 from
Kem-En-Tec for one minute, speed 6 followed by isolation of total
RNA from the extracts using the FastPrep Bio101 kit (Kem-En-Tec)
according to the manufacturer's instructions.
[0325] The eluted total RNA was ethanol precipitated for 24 hours
at -20.degree. C. by addition of 2.5 volumes of 96% EtOH and 0.1
volume of 3M Na-acetate, pH 5.2 (Ambion, USA), followed by
centrifugation of the total RNA sample for 30 minutes at 13200 rpm.
The total RNA pellet was air-dried and redissolved in 10 .mu.l of
diethylpyrocarbonate (DEPC)-treated water (Ambion, USA) and stored
at -80.degree. C.
Fluorochrome-Labelling of the Target
[0326] Ten (10) .mu.g total RNA from C. elegans and 1 ng of in
vitro RNA from Splice variant #1 were combined with 5 .mu.g
anchored oligo(dT.sub.20) primer and DEPC-treated water to a final
volume of 8 .mu.l. The mixture was heated at 70.degree. C. for 10
minutes, quenched on ice for 5 minutes, followed by addition of 20
units of Superasin RNase inhibitor (Ambion, USA),1 .mu.l dNTP
solution (10 mM each dATP, dGTP, dTTP and 0.4 mM dCTP, and 3 .mu.l
Cy5-dCTP, Amersham Biosciensces, USA), 4 .mu.l 5.times. RTase
buffer (Invitrogen), 2.mu.l 0.1 mM DTT (Invitrogen), 400 units of
Superscript II reverse transcriptase (Invitrogen, USA), and
DEPC-treated water to 20 .mu.l final volume.
[0327] A parallel set-up was made with 10 .mu.g total RNA from C.
elegans and 1 ng of in vitro RNA from Splice variant #2, labelling
with Cy3-dCTP. Both cDNA syntheses were carried out at 42.degree.
C. for 2 hours, and the reactions were stopped by incubation at
70.degree. C. for 5 minutes, followed by incubation on ice for 5
minutes.
[0328] Unincorporated dNTPs were removed by gel filtration using
MicroSpin S-400 HR columns as described below. The column was
pre-spun for one minute at 1500.times.g in a 1.5 ml tube, and the
column was placed in a new 1.5 ml tube. The cDNA sample was slowly
applied to the top center of the resin and spun 1500-.times.g for 2
minutes. The eluate was collected. RNA was degraded by adding 3
.mu.l of 0.5 M NaOH. The solution was mixed well and incubated at
70.degree. C. for 15 minutes. The solution was neutralized by
adding 3 .mu.l of 0.5 M HCl and mixed well.
[0329] Then, 450 .mu.l 1.times.TE, pH 7.5 was added to the
neutralized sample, and the sample was transferred onto a
Microcon-30 concentrator (prior to use, 500 .mu.l 1.times.TE was
spun through the column to remove residual glycerol). The samples
were spun at 14000.times.g in a micro centrifuge for 12 minutes,
and the volume was checked. Spinning was continued until the volume
was reduced to 5 .mu.l. The labelled cDNA probe was eluted by
inverting the Microcon-30 tube and spinning at 1000.times.g for 3
minutes. The Microcon filter was checked for proper elution.
Comparative Hybridization of the Splice Variant Microarrays and
Post-Hybridization Washes
[0330] The Cy3 and Cy5-labelled cDNA samples, respectively, were
combined in one tube. The following was added: 3.75 .mu.l
20.times.SSC (3.times.SSC fmal, pass through 0.22 .mu.filter prior
to use to remove particulates), yeast tRNA (1 .mu.g/.mu.l final),
0.625 .mu.l 1 M HEPES, pH 7.0 (25 mM final, pass through 0.22
.mu.filter prior to use to remove particulates), 0.75 .mu.l 10% SDS
(0.3% final), and DEPC-water to 25 .mu.l final volume. The labelled
cDNA target sample was filtered in Millipore 0.22 .mu.l filter spin
column (Ultrafree-MC, Millipore, USA) according to the
manufacturer's instructions, followed by incubation of the reaction
mixture at 100.degree. C. for 2-5 minutes. The cDNA probes were
cooled at room temperature for 2-5 minutes by spinning at maxium
speed in a microcentrifuge. A LifterSlip (Erie Scientific Company,
USA) was carefully placed on top of the microarray spotted on
Immobilizer.TM. MicroArray Slide, and the hybridization mixture was
applied to the array from the side. An aliquot of 30 .mu.L of
3.times.SSC was added to both ends of the hybridization chamber,
and the Immobilizer.TM. MicroArray Slide was placed in the
hybridization chamber (DieTech, USA). The chamber was sealed
watertight and incubated at 65.degree. C. for 16-18 hours submerged
in a water bath. After hybridization, the slide was removed
carefully from the hybridization chamber and washed using the
following protocol.
[0331] The slides were washed sequentially by plunging gently in
2.times.SSC/0.1% SDS at room temperature until the cover slip falls
of into the washing solution, then in 1.times.SSC pH 7.0 (150 mM
NaCl, 15 mM Sodium Citrate) at room temperature for one minute,
then in 0.2.times.SSC, pH 7.0 (30 mM NaCl, 3 mM Sodium Citrate) at
room temperature for one minute, and finally in 0.05.times.SSC (7.5
mM NaCl, 0.75 mM Sodium Citrate) for 5 seconds, followed by drying
of the slides by spinning at 1000.times.g for 2 minutes. The slides
were stored in a slide box in the dark until scanning.
Microarray Data Analysis
[0332] The splice variant microarray was scanned in a ScanArray
4000XL confocal laser scanner (Packard Instruments, USA). The
hybridization data were analyzed using the GenePix Pro 4.01
microarray analysis software (Axon, USA).
[0333] In the data analysis, the experimental variation in the
labelling efficiency between the two fluorescent dyes was
normalized (scaled) as follows. The average signal intensities from
the "exon1" and "exon3" internal capture probes (Table 6), were
used to calculate normalization factor of 2.75. This factor was
multiplied to the signal intensity values from the Cy-3 target.
[0334] Analysis of the data from the specific detection of the two
recombinant splice variants in a complex RNA pool demonstrates that
the merged capture probes containing a LNA block have significantly
higher signals and a very low level of cross-hybridization,
compared to the DNA capture probes (FIGS. 12A and 12B). In
addition, the specific detection of the two artificial splice
variants #1 and #2 is validated with the results from LNA-modified
oligonucleotide capture probes. Capture probes of other lengths
and/or with other LNA substitution patterns can be used similarly.
In contrast, the corresponding DNA oligonucleotide capture probes
fail to detect splice variant #1 (FIG. 12B).
EXAMPLE 6
The Use of LNA-Modified Oligonucleotides in Microarrays Provides
Significantly Improved Sensitivity in Expression Profiling
[0335] This example demonstrates the advantages of using LNA
oligonucleotide microarrays in gene expression profiling
experiments. Capture probes for the Saccharomyces cerevisiae gene
SWI5 (YDR146C) were designed as 50-mer standard DNA and two
different LNA-modified oligonucleotides with LNA substitutions at
every second or every third nucleotide position, respectively, for
comparison (Table 7). To assess the sensitivity of DNA versus LNA
capture probes, hybridizations with different amounts of
biotin-labelled antisense oligonucleotides in a 10-fold dilution
series were performed.
Design and Synthesis of the LNA Capture Probes
[0336] To design capture probes, regions with unique mRNA sequence
of the selected target genes were identified. Optimized 50-mer
oligonucleotide sequences with respect to T.sub.m,
self-complementarity, and secondary structure were selected. LNA
modifications were incorporated to increase affinity and
specificity. The biotin-labelled antisense DNA target
oligonucleotide corresponds to the reverse complement sequence.
Printing of the LNA Microarrays
[0337] The microarrays were printed on Immobilizer.TM. MicroArray
Slides (Exiqon, Denmark) using the Biochip One Arrayer from Packard
Biochip technologies (Packard, USA). The arrays were printed with a
spot volume of 2.times.300 .mu.l of a 10 .mu.M (final
concentration) capture probe dilution. Four replicas of the capture
probes were printed on each slide
Hybridization with Biotin-Labelled Antisense Oligonucleotide
[0338] The arrays were hybridized overnight using the following
protocol. The desired amount of biotin-labelled oligonucleotide was
combined in one tube followed by addition of 3 .mu.L 20.times.SSC
(3.times.SSC final), 0.5 .mu.L 1 M HEPES, pH 7.0 (25 mM final), 25
.mu.g yeast tRNA (1.25 .mu.g/.mu.L final), 0.6 .mu.L 10% SDS (0.3%
final), and DEPC-treated water to 20 .mu.L final volume. The
biotin-labelled target sample was filtered in a Millipore 0.22
micron spin column according to the manufacturer's instructions
(Millipore, USA), and the probe was denatured by incubating the
reaction at 100.degree. C. for 2 minutes. The sample was cooled at
20-25.degree. C. for 5 minutes by spinning at maxium speed in a
microcentrifuge. A LifterSlip (Erie Scientific Company, USA) was
carefully placed on top of the microarray spotted on
Immobilizer.TM. MicroArray Slide, and the hybridization mixture was
applied to the array from the side. An aliquot of 30 .mu.L of
3.times.SSC was added to both ends of the hybridization chamber,
and the Immobilizer.TM. MicroArray Slide was placed in the
hybridization chamber. The chamber was sealed watertight and
incubated at 65.degree. C. for 16-18 hours submerged in a water
bath. After hybridization, the slide was removed carefully from the
hybridization chamber and washed using the following protocol. The
Lifterslip coverslip was washed off in 2.times.SSC, pH 7.0
containing 0.1% SDS at room temperature for 1 minute, followed by
washing of the microarrays subsequently in 10.times.SSC, pH 7.0 at
room temperature for 1 minute, and then in 0.2.times.SSC, pH 7.0 at
room temperature for 1 minute. Finally, the slides were washed for
5 seconds in 0.05.times.SSC, pH 7.0. The slides were then dried by
centrifugation in a swinging bucket rotor at approximately 200 G
for 2 minutes. To visualize the biotin containing duplexes, an
aliquot of 40 .mu.L of the 2 .mu.g/ml streptavidin-Cy3 in
1.times.SSC+0.05% Tween solution was applied to the slide as
described for the hybridization mixture above. The slide was
incubated in a humidified chamber for 1 hour at room temperature.
The coverslip was washed off in 1.times.SSC+0.05% Tween for 1
minute, followed by wash in 0.2.times.SSC+0.05% Tween for 1 minute
and then 10 seconds in MilliQ-water. The slide was dried by
centrifugation in a swinging bucket rotor for 2 minutes at 200
G.
Data Analysis
[0339] Following washing and drying, the slides were scanned using
a ScanArray 4000XL scanner (Perkin-Elmer Life Sciences, USA), and
the array data were processed using the GenePix.TM. Pro 4.0
software package (Axon, USA).
Results
[0340] Incorporation of LNA nucleotides at every second or third
nucleotide position in standard 50-mer expression array
oligonucleotide capture probes results in a 2-7-fold increase in
fluorescence intensity levels using an unsaturated target
concentration and hybridizing under standard stringency conditions
(FIG. 13). Thus, it can clearly be concluded that the LNA
oligonucleotides are more sensitive in expression profiling
compared to DNA oligonucleotides.
[0341] Table 7. DNA and LNA-modified SWI5 (YDR146C) oligonucleotide
capture probes. LNA modifications are depicted by uppercase letters
in the sequence; "mC" denotes LNA methyl cytosine. (SEQ ID NO:)
TABLE-US-00009 Oligo Name Sequence YDR146C-50
tgggaatggaacggggattatggtttcgccaatg aaaactaatcaaaggt YDR146C-50_LNA2
TgGgAaTgGaAcGgGgAtTaTgGtTtmCgmCcAa TgAaAamCtAaTcAaAgGt
YDR146C-50_LNA3 TggGaaTggAacGggGatTatGgtTtcGccAatG
aaAacTaaTcaAagGt
EXAMPLE 7
The Use of LNA-Modified Oligonucleotides in Microarrays Provides
Significantly Improved Sensitivity in Comparative Genome
Hybridization (CGH).
[0342] This example demonstrates the advantages of using LNA
oligonucleotide microarrays in Comparative Genome Hybridization
(CGH) experiments. Capture probes for all 23 exons of the Menkes
gene (ATP7A) were designed as 50-mer standard DNA and different
LNA/DNA mixmer oligonucleotides, respectively, for comparison (FIG.
17). The C6-amino-linked capture probes were applied to Immobilizer
slides and hybridized with patient DNA samples labelled with a Cy3
fluorescent dye.
Design and Synthesis of the LNA Capture Probes
[0343] To design the capture probes, regions comprising individual
exons of the Menkes gene were identified. The optimal 50-mer
oligonucleotide sequences with respect to T.sub.m,
self-complementarity, and secondary structure were selected for
each exon. LNA modifications were incorporated to increase affinity
and specificity. A software tool "OligoDesign", which automatically
designs capture probes that are optimized for sequence specificity,
T.sub.m, self-complementarity, secondary structure, and LNA
modifications was used for oligonucleotide design.
Results
[0344] Fluorescent Cy3 labelled patient genomic DNA was hybridized
to microarrays spotted with the CGH capture probes listed in FIG.
17. Compared to DNA capture probes, capture probes with LNA in
every second position (LNA-2) had a significantly better capture
rate of non-amplified labelled genomic patient DNA as shown in
FIGS. 14-16. Capture probes of other lengths and/or with other LNA
substitution patterns can be used similarly.
EXAMPLE 8
Expression Profiling of Stress and Toxicity in Caenorhabditis
elegans using LNA Oligonucleotide Microarrays
[0345] This example demonstrates the use of the C. elegans LNA tox
oligoarray in gene expression profiling experiments in the nematode
Caenorhabditis elegans. The C. elegans tox oligoarray monitors the
expression of a selection of 110 genes relevant for general stress
response and for the metabolism of toxic compounds. Two different
capture probes for each of these target genes were designed and
included in the LNA tox array. In addition, the C. elegans LNA tox
oligoarray contained capture probes providing control for cDNA
synthesis efficiency and the developmental stage of the nematode.
Capture probes for constitutively expressed genes for data set
normalization were also included on the C. elegans LNA tox
oligoarray.
Cultivation of C. elegans Worms
[0346] or all cultures, the sample was divided into two, and one
half of the sample was used as the control, the other was used as
the treated sample. Worm samples were harvested and sucrose cleaned
by standard methods. For heat shock treatment, the heat shock
sample was added to S-media preheated to 33.degree. C. in a 1 L
flask suspended in a water bath at 33.degree. C., the other sample
was added to a 1 L flask with S-media at 25.degree. C. Both samples
were shaken at approximately 100 rpm for an hour. For Lansoprazole
treatment, 0.5 mL of 10 mg/mL Lansoprazole (Sigma) in DMSO was
added to each 500 mL volume of S-media culture after 28 hours of
growth from L1. At the same time, 0.5 mL of DMSO was added to the
control. Incubation was for 24 hours. Samples were then harvested
by centrifugation at 3000.times.g suspended in RNALater.TM.
(Ambion) and immediately frozen in liquid nitrogen.
RNA Extraction
[0347] RNA was extracted from the worm samples using the
FastRNA.RTM. Kit, GREEN (Q-BIO) essentially according to the
suppliers' instructions.
Design and Synthesis of the LNA Capture Probes
[0348] To design the capture probes, regions with unique mRNA
sequence of the selected target genes were identified. The optimal
50-mer oligonucleotide sequences with respect to T.sub.m,
self-complementarity, and secondary structure were selected. LNA
modifications were incorporated to increase affinity and
specificity.
Printing of the LNA Microarrays
[0349] The microarrays were printed on Immobilizer.TM. MicroArray
Slides (Exiqon, Denmark) using the Biochip One Arrayer from Packard
Biochip technologies (Packard, USA). The arrays were printed with a
spot volume of 2.times.300 Pl of a 10 .mu.M capture probe solution.
Four replicas of the capture probes were printed on each slide.
Synthesis of Fluorochrome Labelled First Strand cDNA from Total
RNA
[0350] 15 .mu.g of C. elegans total RNA was combined with 5 .mu.g
oligo dT primer (T20VN) in an RNase free, pre-siliconized 1.5 mL
tube, and the final volume was adjusted with DEPC-water to 8 .mu.L.
The reaction mixture was heated at +70.degree. C. for 10 minutes,
quenched on ice 5 minutes, spin 20 seconds, followed by addition of
1 .mu.L SUPERase-In.TM. (20 U/.mu.L, Ambion, USA), 4 .mu.L 5.times.
RTase buffer (Invitrogen, USA), 2 .mu.L 0.1 M DTT (Invitrogen,
USA), 1 .mu.L dNTP (20 mM dATP, dGTP, dTTP; 0.4 mM dCTP in
DEPC-water, Amersham Pharmacia Biotech, USA), and 3 .mu.L
Cy3.TM.-dCTP or Cy5.TM.-dCTP (Amersham Pharmacia Biotech, USA).
First strand cDNA synthesis was carried out by adding 1 .mu.L of
Superscript.TM. II (Invitrogen, 200 U/mL), mixing, and incubating
the reaction mixture for 1 hour at 42.degree. C. An additional 1
.mu.L of Superscript.TM. II was added, and the cDNA synthesis
reaction mixture was incubated for an additional 1 hour at
42.degree. C.; the reaction was stopped by heating at 70.degree. C.
for 5 minutes, and quenching on ice for 2 minutes. The RNA was
hydrolyzed by adding 3 .mu.L of 0.5 M NaOH, and incubating at
70.degree. C. for 15 minutes. The samples were neutralized by
adding 3 .mu.L of 0.5 M HCl, and purified by adding 450 .mu.L
1.times.TE buffer, pH 7.5 to the neutralized sample and
transferring the samples onto a Microcon-30 concentrator. The
samples were centrifuged at 14000.times.g in a microcentrifuge for
.about.8 minutes, the flow-through was discarded, and the washing
step was repeated twice by refilling the filter with 450 .mu.l
1.times.TE buffer and by spinning for .about.12 minutes.
Centrifugation was continued until the volume was reduced to 5
.mu.L, and finally the labelled cDNA probe was eluted by inverting
the Microcon-30 tube and spinning at 1000.times.g for 3
minutes.
Hybridization with Fluorochrome-Labelled cDNA
[0351] The arrays were hybridized overnight using the following
protocol. The Cy3.TM. and Cy5.TM.-labelled cDNA samples were
combined in one tube followed by addition of 3 .mu.L 20.times.SSC
(3.times.SSC final), 0.5 .mu.L 1 M HEPES, pH 7.0 (25 mM final), 25
.mu.g yeast tRNA (1.25 .mu.g/.mu.L final), 0.6 .mu.L 10% SDS (0.3%
final), and DEPC-treated water to 20 .mu.L final volume. The
labelled cDNA target sample was filtered in a Millipore 0.22 micron
spin column according to the manufacturer's instructions
(Millipore, USA), and the probe was denatured by incubating the
reaction at 100.degree. C. for 2 minutes. The sample was cooled at
20-25.degree. C. for 5 minutes by spinning at maximum speed in a
microcentrifuge. A LifterSlip (Erie Scientific Company, USA) was
carefully placed on top of the microarray spotted on
Immobilizer.TM. MicroArray Slide, and the hybridization mixture was
applied to the array from the side. An aliquot of 30 .mu.L of
3.times.SSC was added to both ends of the hybridization chamber,
and the Immobilizer.TM. MicroArray Slide was placed in the
hybridization chamber. The chamber was sealed watertight and
incubated at 65.degree. C. for 16-18 hours submerged in a water
bath. After hybridisation, the slide was removed carefully from the
hybridization chamber and washed using the following protocol. The
Lifterslip coverslip was washed off in 2.times.SSC, pH 7.0
containing 0.1% SDS at room temperature for 1 minute, followed by
washing of the microarrays subsequently in 1.0.times.SSC, pH 7.0 at
room temperature for 1 minute, and then in 0.2.times.SSC, pH 7.0 at
room temperature for 1 minute. Finally, the slides were washed for
5 seconds in 0.05.times.SSC, pH 7.0. The slides were then dried by
centrifugation in a swinging bucket rotor at approximately 200 G
for 2 minutes. The slide was then ready for scanning.
Data Analysis.
[0352] Following washing and drying, the slides were scanned using
a ScanArray 4000XL scanner (Perkin-Elmer Life Sciences, USA), and
the array data were processed using the GenePix.TM. Pro 4.0
software package (Axon, USA). The data in each image was normalized
so that the ratio of means of all of the features is equal to
1.
Results
[0353] Use of LNA-modified oligonucleotide capture probes in the C.
elegans LNA tox oligoarray clearly allows the identification of
distinct expression profiles for C. elegans genes relevant for
general stress response and for the metabolism of toxic compounds.
TABLE-US-00010 TABLE 12 Expression profiling using LNA
Oligonucleotide Microarrays. Log2 transformed fold of changes for
five selected genes in the two expression profiling experiments.
Protein name (clone name) Heat shock Lansoprazole HSP70 (F44E5.4/5)
4.11 nd CYP37A (F01D5.9) nd 0.98 Ubiquitin (M7.1) 0.16 -0.12
Histone 1Q (C01B10.5) -1.49 nd HSP90 (C47E8.5) nd -1.17
[0354] TABLE-US-00011 TABLE 13 LNA-modified oligonucleotide capture
probes. LNA modifications are depicted by uppercase letters in the
sequence; "mC" denotes LNA methyl cytosine. (SEQ ID NOs:) Oligo
Name Sequence CEABC_C34G6.4_u293_LNA3
TgcmCatTgcAcgGgcActTgtTcgAtcTccTtcTgtTttActTttGgaTg
CEABC_C34G6.4_u375_LNA3
TcaTtcTagGatTgcmCagAtgGttAtgAtamCtcAtgTcgGagAgaAagGa
CEABC_F57C12.4_u15_LNA3
mCcaAtgTtgTttAatTggTtgTaaTgtmCttGatGacmCtgmCatAatmCatAt
CEABC_F57C12.4_u480_LNA3
mCacAagAtcmCtgTgtTgtTctmCcgGaamCaaTgaAaaTgaActTagAtcmCa
CEABC_F57C12.5_u111_LNA3
TacTtgTtcTcgAcaAagGttGtgTagmCcgAgtTtgAcamCtcmCgaAgaAa
CEABC_F57C12.5_u444_LNA3
TgaActTggAtcmCctTctTtgmCatTtaGcgAtgAtcAaaTttGggAagmCg
CEABC_K08E7.9_d8_LNA3
TcaTtaAttTtgTgtAgcTttmCttTctmCgaTttTtgmCacGatmCttTccmCc
CEABC_K08E7.9_u51_LNA3
AggGtgmCctActAcaAacTgamCccAaaAgcAgaTgamCcgAgaAgaAatAa
CEABC_Y39D8C.1_u37_LNA3
AttGaaAgcGacGcgGaaAgtGccAtgTatTtcTaaTttTgtTttmCttTa
CEABC_Y39D8C.1_u422_LNA3
TtgTcaGcaTatmCaaGagTagAtaTggAagTggAtamCacTctGctAatmCc
CEADH_H24K24.3a_d3_LNA3
mCacmCttAttGcgTtcAatTttTgtTtcmCacmCtamCtamCtamCgaAtamCgtTg
CEADH_H24K24.3a_u50_LNA3
TcamCaaGggAgaGagTctGcgGtcGgtGctGgcGttmCgaGaaAatAtaAc
CEAPEX_R09B3.1_u191_LNA3
mCatGcaTccmCgamCgaGaaGaaGtamCtcAttTtgGagTtaTctGgcGaaTt
CEAPEX_R09B3.1_u37_LNA3
GacmCatGctmCcgGtcGtcAtgmCaaAtcGacTtcTaaAttGctTctGatTa
CEAPO_C35D10.9_u15_LNA3
TtgmCatGctGttAaaAccTatmCgtGtamCaaTatTgcmCtgTatAttmCccmCt
CEAPO_C35D10.9_u609_LNA3
TggmCacAgcTtaAtaAcaAatTggAaaGtcGagGatTagTcgGtgTtgAa
CEAPO_C48D1.2_u176_LNA3
GacAcamCgcAaaGgaTatGgaTgtTgtTgaGctGctGacTgaAgtmCaaTa
CEAPO_C48D1.2_u23_LNA3
AgcAcgAaamCtcTgcmCgtmCtaAaaTtcActmCgtGatTcaTtgmCccAatTg
CEAPO_F20C5.1_u453_LNA3
AtgGtcAtamCtcTaaAatGggmCagAacTtcAacmCaaAtcAttmCtcGtcAg
CEAPO_F20C5.1_u96_LNA3
AacmCcgAgcTtgmCcgmCaaAgtGcaAgaAaaTtaTagAacGaaTgaAacAg
CEATPase_B0365.3_u31_LNA3
GgaTggGtcGagmCgtGagAccTacTacTaaAgaAcaGctTgtGaaTctTt
CEATPase_B0365.3_u386_LNA3
mCaamCgtTctmCgaTtcmCtamCggAcaAgaAtgGacmCtaTgcmCaamCagAaaGa
CEATPase_C17H12.14_u356_LNA3
TgcTcgTtaTccAgcTatTttGaaGggActTgtmCatGcaAggActTctTc
CEATPase_C17H12.14_u89_LNA3
mCcgTttAgaGctTatTgcTaamCcaGatTgtmCccAcaAgtmCagAacAgcTc
CEATPase_F55F3.3_u215_LNA3
TgamCggAcgmCtamCtamCccAtaTgtAttTgtTccAtcTtamCcaGcaAccAa
CEATPase_F55F3.3_u275_LNA3
AgcTacTtcAttmCgamCaaGgaAcaTctmCggAaaAgtmCaaGtamCatmCccGg
CEATPase_Y49A3A.2_u103_LNA3
AaaTtcAagGatmCcaGttGccGatGgtGaaGccAagAttmCgcAagGatTa
CEATPase_Y49A3A.2_u272_LNA3
mCgaTcgTttmCtgmCccAttmCtamCaaGacTgtmCggTatGctmCaaGaaTatGa
CECALR_Y38A10A.5_u238_LNA3
TcaGgaAcgAtcTttGacAacAttAtcAtcAccGacTctGttGagGagGc
CECALR_Y38A10A.5_u296_LNA3
TgaActmCtamCtcTtaTgaAagmCtgGggAgcmCatmCggAttmCgaTttGtgGc
CECAT_Y54G11A.5b_u137_LNA3
GaamCttTgcAggGccGctmCggGgaAtgTcaTgaTttmCatTatTaaGggAa
CECAT_Y54G11A.5b_u189_LNA3
GtcAatTctGggAgaAggTgtTggAtamCcgGggmCtcGggAgaGaaTgtGc
CECC_C03D6.3_u275_LNA3
AtgTaaAgaAggAatGctTccmCgaAtgGatTggAtaTttAttTgtmCcaGa
CECC_C03D6.3_u430_LNA3
GgamCcgAaaTttGtgmCagmCatGtcGgamCacGaaAttGatGgtmCtcAttTt
CECC_C07G2.3_d9_LNA3
mCagAcamCgaAggTtamCgaTagAtaAccAtcTctmCaaAgtmCtaTcgAccTc
CECC_C07G2.3_u44_LNA3
mCgamCgaTgtGcgTgtTccTgamCgaTgaAagAatGggAtaTtaAgaAaamCc
CECC_Y46G5A.2_u331_LNA3
TtgTgcTccAtcGctGctmCcgmCttAcaGacTtgAcaAcgmCtcAccTttGc
CECC_Y46G5A.2_u385_LNA3
AatGagmCggTtgTgcmCgtGtgAcgTcamCttmCgtmCacAgtGttGctmCtamCt
CECoA_C29F3.1_u316_LNA3
AaaTtgAcamCcaAtcAaaTctGtcTcaTctmCctGagGacmCgtmCaamCttmCg
CECoA_C29F3.1_u392_LNA3
AatmCttTgtGtamCggAgaTggGgcAaaAggmCagmCaaGaaAgtAaamCcaAg
CECoA_F08A8.4_u1094_LNA3
AggAcaAggGgcActActGgcAcaGgcTttGatTatTgcAgtGagAtaTt
CECoA_F08A8.4_u1260_LNA3
TtaAtgGagGtgAcaAtgGgtTccTtgGatTcgAtaAatTccGagTgcmCc
CECoA_F59F4.1_u109_LNA3
GctmCttmCtcmCagTggGctmCaaAatAgtmCaamCtcAacAgaTcgGaaGttmCt
CECoA_F59F4.1_u424_LNA3
AaaGctTcgAgaTggmCacGttmCgtmCtgTatmCtcGtgAagAacTtaTtgmCa
CECoA_Y25C1A.13_u115_LNA3
GatTcgmCtgAacTttAtcAagAcgTggAatAtgAgcmCagmCtcmCtgTcgAc
CECoA_Y25C1A.13_u451_LNA3
GatmCttAtcAccGcgTgcGatAttmCgaGtaGctTcamCagGatGcgAttTt
CECOL_C27H5.5_u493_LNA3
GgaAagGaaGgaTccAttmCtcAgcTctGcamCttmCcamCcaTcaGagmCcaTg
CECOL_C27H5.5_u680_LNA3
TggAtamCaaGgaGggAtcTggmCagTggTggAtcTggAagTggTggAtaTg
CECOQ_ZC395.2_u199_LNA3
TtgAaaGaamCtcmCttGccGacGatmCctGaaAcamCacAaaGaaTtgmCtgAa
CECOQ_ZC395.2_u400_LNA3
AtgTggGatGagGagAaaGaamCatTtaGatAcaAtgGaaAgaTtaGctGc
CECRYZ_F39B2.3_u171_LNA3
AggmCtgAgcTctTggActTtgGcaTcaAcaTtgTctmCatTctTgaAggAa
CECRYZ_F39B2.3_u222_LNA3
TtaTggTtamCagAagGagmCtgTttAcgGtgTagmCatTggGaaTgtmCttmCc
CECyclin_R02F2.1a_u24_LNA3
mCacTtcAacmCaamCtcmCgtGttAatmCaaGcaAgcmCgcmCacmCatmCtaAtgAg
CECyclin_R02F2.1a_u312_LNA3
TctmCatTgcTcgTcgAggmCtamCcaAcaAacActGgcAatAccmCaaTtaAt
CECyclin_ZC168.4_u203_LNA3
TaaGaaAgtmCatTgaGgaTgcTgtmCgcTttGctmCgcmCgaAgtmCtcGtaTa
CECyclin_ZC168.4_u273_LNA3
AagTtcAtcmCtgTtgAcgGaaTcgAggmCggAgaAtgmCtgTatmCggTcaTt
CECYP_B0213.15_u133_LNA3
AcaGgaAatAtgAttTtgGatTtcGatTttGaaTcgGttGgtGctGccmCc
CECYP_B0213.15_u202_LNA3
GctGagmCtgTatTtgGctAgtGaaAtgTgtGttTttGatActTtaAatGa
CECYP_B0304.3_u38_LNA3
AcgAggTttGgaTcamCaaTcaGaaTtcTgtGaaAtaAgcGttTttTggGa
CECYP_B0304.3_u89_LNA3
AgtTctmCggTctAacAgtGtcTccmCgtTgaAtaTtcTtgTaaAatmCacAc
CECYP_C03G6.14_u706_LNA3
AtgAccActmCaaAatActGctAaaAgaTttGcaGcgGcaGaaGccGttAa
CECYP_C03G6.14_u768_LNA3
TtgAtaTggmCtgTacmCtgTatGgtTttTgaGgamCgtTttTtaGgaGtcGa
CECYP_C03G6.15_d9_LNA3
AttTatTcaTtcAtcmCatGtaAacTgtAtaTttTgaAttTgtGttGtaAa
CECYP_C03G6.15_u148_LNA3
GccAaaGcaGaaTtgTatTtgAtcTtcGgtAacmCttmCtcmCttmCgcTacAa
CECYP_C06B3.3_u102_LNA3
AttTtgAatmCttmCtgGgaAaaTgcmCatmCcamCtcGagAaamCcgTtcmCgtTt
CECYP_C06B3.3_u474_LNA3
mCtaAcgGagGatmCtcGccAatTatmCttTgaGagAcaAaamCtgAaamCtcmCt
CECYP_C12D5.7_u399_LNA3
AtcTagTccmCaaTgaAtcTccmCacAtgmCtgTtamCtcGtgAtgTtcAacTc
CECYP_C12D5.7_u65_LNA3
TttTgcTttmCatmCgcAaaAgcTcaAgaTtamCacAtgTcaGgtmCaaGccAa
CECYP_C45H4.17_u27_LNA3
mCcgmCgamCttTaaAgaGaaGatmCatAaaTttGcaTtgTttTttGttTgtAt
CECYP_C45H4.17_u598_LNA3
mCgaGggTgaTtcGgaGacTttmCagTaaTgtmCcaActTtcAaaTgtTtgmCa
CECYP_C45H4.2_u110_LNA3
TagAtamCaaGatAcaTccmCtcAaaAgaAggmCctAccGtcAatGgcmCaaAg
CECYP_C45H4.2_u429_LNA3
TcaAcgmCgtmCtaTaaAtgAatmCacAacGagGtaTcaAcaTtcTccmCccTg
CECYP_C49C8.4_u363_LNA3
AtgmCtgAtgTtgAaaTtgmCtgGctAccGtaTtcmCaaAagAtamCtgTaaTc
CECYP_C49C8.4_u883_LNA3
AtgAatmCcaTggmCttGgamCatmCtcmCcgTttTtcAagGgaTatAaaAatGt
CECYP_C49G7.8_d6_LNA3
AtgmCaamCgaAttAgtGaaAaaTtcAtcmCtgGaaTaaAaaAtaAttmCtaAa
CECYP_C49G7.8_u795_LNA3
AtcGctAcgAcaAtcTttmCcgAtgmCctTcgAagTttmCgaAagmCttTctmCt
CECYP_F01D5.9_u374_LNA3
GagGtcGgtGgaGgaGgaAgtGgaAatTgamCggmCaaAatmCctGccmCaaGg
CECYP_F01D5.9_u46_LNA3
mCccTctTtgGgaTttmCcamCtcAagTttActGttmCggmCagmCagTgaTatAa
CECYP_F08F3.7_u25_LNA3
GagTtgGttmCcamCagAatGctTagGacGttTaaAttmCgtmCacAaamCttTt
CECYP_F08F3.7_u401_LNA3
mCaaTatGgtTccmCatTttAgcAacTcaTatGaamCacAgaAgaTgtmCctTg
CECYP_F14F7.2_u397_LNA3
GaaAaaGgcGtcGacAttTtaTgtGacAcgTggAcamCttmCacTatGacAa
CECYP_F14F7.2_u68_LNA3
TaaTtgAatTacGggTctTttGtamCatAttAatTttAgtAtamCttTgtGa
CECYP_F42A9.5_u435_LNA3
AtaTcaAtgmCaamCtaTtaAtgAatmCacAacGtcTtgmCcaAtcTtcTccmCg
CECYP_F42A9.5_u55_LNA3
GgaGtgActAtgAaaGcaAagAgtTacmCgaTtgAaamCtgAaaGacAgamCa
CECYP_K07C6.3_u3_LNA3
AatmCttTaaTgaTaaTttAtgGgaTctGtaTttmCtcTttmCtgTcaAtaAa
CECYP_K07C6.3_u354_LNA3
AtgAgcmCcamCaaAtgTaaAagGatAcgAgaTtgAttmCggGaamCagTcaTg
CECYP_K07C6.4_u118_LNA3
AtcmCtgmCgaTatGacAttAagmCcamCatGgtTctGaamCctTcaAcaGaaGa
CECYP_K07C6.4_u87_LNA3
mCtgAacmCttmCaamCagAagAtaAacTtcmCgtAtaGcgmCtgGaaAaamCtcmCt
CECYP_K07C6.5_u7_LNA3
AttTaaAggAatTcamCagmCtcAaaAaaTaaTaamCtamCcgGttmCagAgaTt
CECYP_K07C6.5_u99_LNA3
AatTtgAgcmCacAtgGcaAgtTatmCaamCagAggAgamCaaTgcmCgtAcaGt
CECYP_K09A11.3_u362_LNA3
TgamCatTctActTaaAggGaaGaaAatAccAacTggTacmCctTgtAttTg
CECYP_K09A11.3_u48_LNA3
TcamCcamCaaAgcmCatAcaTatGcgAgcTagTtcmCtcAggmCtgmCttAaamCc
CECYP_K09A11.4_u238_LNA3
TtcGacAaaActAttTtgGaaAgaAcaAtcmCcaTtcAgtGtcGgcAaamCg
CECYP_K09A11.4_u68_LNA3
TctGacAacAaaGccAtamCacGtgmCcgActAatTccAcaAtcAgcTagAa
CECYP_K09D9.2_u151_LNA3
TtgGcaAaaGcaGaaTtgTatTtaAtcTttGgaAacmCtcmCttmCttmCgcTa
CECYP_K09D9.2_u866_LNA3
TgaAtcTttmCaaActTatmCacTccTttTaaTacTacmCgtTccTgtTtgGa
CECYP_T10B9.10_u410_LNA
AttGagAttGtaTccAttGgcGtcTctTgtTcamCaaTcgAaaAtgTctmCa
CECYP_T10B9.10_u56_LNA
AacTgcTacTatTgcGccAtcAagTgtGctGctmCaaActTaaAtcmCagGt
CECYP_T10B9.7_u102_LNA3
TtgAgamCagGaaAtaAgamCtaGaaTtcmCttTgaAacTggTggGaaGtgmCt
CECYP_T10B9.7_u267_LNA3
AagAtgTcaAagAatTcaAgcmCagAacGatGgtmCcamCcgAcgAgcmCatTa
CECYP_T19B10.1_u100_LNA3
AttGaamCcaActmCtgAaaTatAatGacAcaAaamCcaTgtmCtgGaaGtgGt
CECYP_T19B10.1_u319_LNA3
GgcAatGtgAcaAtaTctmCcaAtgGttmCttmCacAgcAatmCatmCacGtgTt
CECYP_Y49C4A.9_u121_LNA3
mCtaTtcAatmCgaTatTttAtcAcamCcaTccAgtGctGgamCctmCcaTcaTt
CECYP_Y49C4A.9_u413_LNA3
GtcTcaGagAtgTgtAaaTttActTccmCtgmCaaTttGttTcamCgcAacTa
CECYP_ZK177.5_u394_LNA3
TtcmCgaAtgTttmCcaAttGggActGaaGttTcaAgaGtcAccmCagAaaAa
CECYP_ZK177.5_u445_LNA3
GatmCcaGcaTctTccAagmCttAcaTtcmCtcmCgtGctTgtAtcAagGaaAc
CEDAO_C47A10.5_d9_LNA3
TttGaaAacmCtgTttTatTatTaaAatAgaTaaTtgAttAgtTctGtamCg
CEDAO_C47A10.5_u269_LNA3
AtamCgtTgcActGcaTccGgcTatGagGgaGccAaaAatmCttAggGgaGt
CEDC_C01A2.3_u373_LNA3
GcamCttmCcaTtcAtcTctGcaGctActAtgGctTtgGtgAcaAaaGttGg
CEDC_C01A2.3_u96_LNA4
mCcgTccAaaAgaAtgmCcaTctmCacAagTctTgaAatmCttAtaAagGtaGt
CEDC_C34F6.1_u301_LNA3
GagGgaTcaAcaGtaAccTcgTgcGgtAttGacAagGgaTgtmCcgGaaGg
CEDC_C34F6.1_u450_LNA3
GatGgtTctTcgAtcGcaAacAaaAcaGatGtgmCtcmCatTtamCatAcgGa
CEDC_F33D11.3_u126_LNA3
AtgGagAaaAtgGatmCtgAtgGagTtgmCagGaaGtgAtgGagmCtcmCagGa
CEDC_F33D11.3_u14_LNA3
TgaAtcTccAtaAatTatTcaAtgTttmCcaAatAttTaaTttAtcAatTg
CEDC_F46E10.2_u392_LNA3
GctmCaamCacGgtAggAtcmCtaTggAacmCgtmCggAggAgcAggmCctmCggAg
CEDC_F46E10.2_u54_LNA3
mCgtGacAacmCtcTtaTttAttTctGtaAaamCtgAttmCgcmCaaActTttGt
CEDC_F56G4.2_u382_LNA3
GaaGctTtcAaamCcaAatGagTtcmCttmCccGgaAtcmCcaAagAatAccAa
CEDC_F56G4.2_u82_LNA3
AcaAtgAaaAgaGagGatGgaAagGaaAtcGaaGtcTctGttmCttGacGa
CEDO_M162.2_u103_LNA3
GatGagGtamCatAacTttGtgTgcAgtTatAggmCcaTctAcaGtamCctGc
CEDC_M162.2_u480_LNA3
TtcmCatmCatmCacTaamCcgAttGtcmCtgAcaTtgAtgGccAaamCcaGggAa
CEDC_R10E4.11_u274_LNA3
TcamCatTatmCgaAcaAgtActAgtAagmCatGctGtgAtgGagTgcmCgcTa
CEDC_R10E4.11_u397_LNA3
mCacGgaGatmCacGacAtcAaaGcgGatTgcTtaGagTgtGgaAacmCgtmCt
CEDC_T04C9.1_u321_LNA3
ActAtcTacGtgGcamCgtTggActmCatmCatmCgaTggGaamCgamCgtAtaAg
CEDC_T04C9.1_u64_LNA3
TctmCtgGccAgtTcamCttTgtGatmCaaTctmCagAttmCgtmCcamCacAagAt
CEDC_W02A2.3_u32_LNA3
mCtamCttmCcgmCaaGaaGgcmCcgTcgTttmCtaAtcGatmCgaAcaTctmCacAC
CEDC_W02A2.3_u374_LNA3
AtgGatGatmCgamCccActTgcmCacTgamCccAcaAtcmCcgmCacTcamCtamCc
CEDC_W05G11.3_u153_LNA3
AagAcgGagAggmCtgGagAgaAcgGtamCcgAtgGagAgcmCagGaamCtgAt
CEDC_W05G11.3_u51_LNA3
mCcamCccAggAggAggGatAcaAgaGaaGaaAgtAcaGatTctmCcaActAa
CEDC_ZK863.5_u256_LNA3
AgtTtcAcamCttmCttTttGccGttTtgGttmCccGttAtcAatmCcaTtgAt
CEDC_ZK863.5_u324_LNA3
mCttTtaTatTctmCatmCaaTttGttTccTacTtgGtcAgcTgaGgaTcgTt
CEEPHX_Y55B1BR.4_u161_LNA3
TtcGgcAcaAatGgaGcaAaaGtaTcgTggTtaTtgTgaTgcGatTatTc
CEEPHX_Y55B1BR.4_u93_LNA3
mCtamCtaTgaAtgAgcTcamCtgGacTcaTttAtcAacTcgAgtmCaaAagmCc
CEER_18S_u388_LNA3
GttGgcGaaTctTcgGgtTcgTatAacTtcTtaGagGgaTaaGcgGtgTt
CEER_18S_u82_LNA3
GaamCtgAttmCgaGaaGagTggGgamCtgTcgmCttmCgaGgtTtaAcgActTc
CEER_26S_u342_LNA3
TgtTatTgcGaaAgtAatmCctGctTagTacGagAggAacAgcGggTtcAa
CEER_26S_u38_LNA3
TgcAtamCgamCttGgtmCtcTtgGtcAagGtgTtgTatTcaGtaGagmCagTc
CEFOXO_R13H8.1b_u331_LNA3
TgtGctmCagAatmCcamCttmCttmCgaAatmCcaAttGtgmCcaAgcActAacTt
CEFOXO_R13H8.1b_u393_LNA3
TtaAgamCggAacmCaaTtgmCtcmCacmCacmCatmCatAccAcgAgtTgaAcaGt
CEGAPDH_K10B3.7_u21_LNA3
AcaTtgmCtamCcaAggmCctAagmCcgmCttmCaaAttmCtcTaaGtcTgaAatGa
CEGAPDH_K10B3.7_u727_LNA3
GttGagTccAccGgaGtcTtcAccAccAtcGagAagGccAatGctmCacTt
CEGBA_F11E6.1a_u232_LNA3
AgtAaaTtcmCttmCcamCgtGgaTctActmCgtGtgTtcAcaAagAtcGagGg
CEGBA_F11E6.1a_u451_LNA3
GgtmCcaAtaAtgGgaGacTggTtcmCgcGcaGaaAgtTatGcaGatGatAt
CEGLU_C02A12.1_u264_LNA3
AgaAaamCttmCgtTggAccmCtgmCtaAggAgaAgtAttTcaAgcTtcTgaGc
CEGLU_C02A12.1_u55_LNA3
GagmCacmCcgAagmCtcAagmCcaTatTtgGaaAcaAgamCcaTacTctTcaAa
CEGLU_C46F11.2_u271_LNA3
GttAccmCtcTacAaaTctmCgcTtcAatmCcaAtgTtgTtcGcaGtcAccAa
CEGLU_C46F11.2_u45_LNA3
mCcgAagAgcTcgTtamCtaTgcGagGagGtgTgaAgcmCggAatAatTttTt
CEGLU_F26E4.12_u109_LNA3
AagTtcTtgGttGgamCgcGatGggAaaAttAtcAagAgaTttGgamCcaAc
CEGLU_F26E4.12_u480_LNA3
AcgAttTcaAcgTcaAaaAtgmCtaAtgGtgAtgAcgTgtmCacTttmCggAt
CEGLU_R07B1.4_u166_LNA3
AccTggGttGatGttTttGcgGctGaaAgtTtcTccAagmCtcAttGatTa
CEGLU_R07B1.4_u38_LNA3
GaaGtamCgtmCtcmCcaAagAaaAgcTacmCccAgcTtaAggmCatTgcAcaAt
CEGLU_T09A12.2_u220_LNA3
GcgmCcaGatAtgTatTcaAagAtcGagGtaAatGgtmCagAacActmCatmCc
CEGLU_T09A12.2_u335_LNA3
AatmCtamCagGgaAaaAggAttTcgAgtTgcmCgcGttTccAtgmCaaTcaAt
CEGLU_T28A11.11_u299_LNA3
AgaTggmCaaAgaAgcAtamCatAacTgaAacTctTccmCggGgaGctActAc
CEGLU_T28A11.11_u54_LNA3
TgaAtaAacGggmCcgAacTaaAtcmCatTcgTcaGtgGaaAtgGgaAacAa
CEGPD_B0035.5_u256_LNA3
GtcmCgtmCttmCctGatGctTatGaamCgcmCtaTttmCtcGaaGtaTtcAtgGg
CEGPD_B0035.5_u478_LNA3
TgtGgaAaaGctmCtcAacGagAagAaaGcaGaaGttmCgtAtamCaaTtcAa
CEHSP_C09B8.6_d8_LNA3
AtaTcgmCcgmCctGctTccTcamCcaAccmCgaAtaAcgmCaamCaaAaamCttTa
CEHSP_C09B8.6_u286_LNA3
AagAgcmCcamCtcAtcAagGatGaaAgtGatGgaAagActmCttmCgtmCtcAg
CEHSP_C12C8.1_u127_LNA3
mCaaGatAttTtaAcaAaaAtgmCatmCaamCaaGaaGccmCaaTcaGgtTccGg
CEHSP_C12C8.1_u1531_LNA3
mCttGggmCatTctGtamCggGatGctGtcAttActGtgmCctGcaTatTttAa
CEHSP_C47E8.5_u310_LNA3
AagAagmCatmCtcGaaAtcAacmCcaGacmCacGctAtcAtgAagAcamCttmCg
CEHSP_C47E8.5_u361_LNA3
AtgAaaGctmCaaGctmCttmCgtGatTccTctActAtgGgaTacAtgGccGc
CEHSP_F26D10.3_u276_LNA3
TtaAgcAgamCcaTtgAggAcgAgaAgcTcaAggAtaAgaTcaGccmCagAa
CEHSP_F26D10.3_u397_LNA3
mCgtmCttTccAagGatGacAttGaamCgcAtgGtcAacGaaGctGagAaaTa
CEHSP_F43D9.4_u169_LNA3
GtcGacTtgGctmCacAtcmCacAccGtcAtcAacAagGaaGgamCagAtgAc
CEHSP_F43D9.4_u275_LNA3
mCaaTctTgaGggAcamCgtTctmCacmCatTgaGggAcamCcamCgaGgtmCaaGa
CEHSP_F44E5.4/5_u123_LNA3
TcamCtaAaaTgcAccAatmCtgGacAatmCttmCtgmCttmCtgmCtgGatGcgmCt
CEHSP_F44E5.4/5_u380_LNA3
TcaTgaAgcTaaAcaAttmCgaAaaGgaAgaTggTgaAcaAcgGgaAcgTg
CEHSP_F52E1.7_u175_LNA3
AagTatAacmCttmCcaAcaGggGtcmCgtmCcaGaamCaaAtcAagTccGaaTt
CEHSP_F52E1.7_u448_LNA3
TttAacmCatGgcmCgcAgaTtcTtcGatGacGtcGacTttGatmCgcmCacAt
CEHSP_F54D5.8 u252_LNA3
GcgTcgAaaAgaTctmCccTgaAgtmCtgmCatTgamCtgGccTtgAtaTtaTg
CEHSP_F54D5.8_u318_LNA3
AcaTagTctTcgTcaTcaAggAtaAgcmCacAccmCgaAatTcaAgcGagAg
CEHUS_H26D21.1_u117_LNA3
TcgmCcaAcamCtcGgamCacGtgmCcaAaaTgaAtaTcaTctmCaaAtcGaaTg
CEHUS_H26D21.1_u478_LNA3
GtcGaaGttAgaAatmCcaGaaGccGatAttGttTctmCatmCaaAttmCcaAt
CEMRE_ZC302.1_u169_LNA3
ActActmCgtGgaAgaTccAatAaaGttGttTcaAcgmCgamCaaAtcGatTc
CEMRE_ZC302.1_u292_LNA3
GgcAgtGaaGatGaaGtgGcaAatTctGatGaaGaaAtgGgaAgcAgtAt
CEMTL_T08G5.10_d127_LNA3
TtgTcaAcgAccAgaAgcAaaAatTatGggAatmCgcGatAaaAttmCaaGg
CEMTL_T08G5.10_u45_LNA3
GatGcaAgtGtgmCcaActGcgAatGtgmCtcAggmCtgmCtcAttAatTtgAa
CENAP_D2096.8_u356_LNA3
GacGatAtgTtcGatTtcmCcaGgaGagGacGgtGatGatGtgTcaGacTt
CENAP_D2096.8_u70_LNA3
GacGatAtgTtcGatTtcmCcaGgaGagGacGgtGatGatGtgTcaGacTt
CEPAI_F56D12.5_u241_LNA3
GagGtcGtcGtaAtcmCacAagGctmCcaAgaAagmCaaGtgmCtcGacAttTc
CEPAI_F56D12.5_u301_LNA3
GatActTttGgcAagmCtcGttmCcaAtcAagAagGagGtcAtcmCcaGatmCg
CEPDI_C07A12.4_u28_LNA3
GatGagGagGgamCacAccGagmCtcTaaAtcmCacAttmCcaAtamCagTtcAa
CEPDI_C07A12.4_u433_LNA3
mCttAtgTccGaaGatAtcmCcaGagGatTggGacAagAacmCcaGtcAagAt
CEPDI_C14B1.1_u119_LNA3
TacmCccAgtmCgamCtaTgaTggAgamCagAaamCctmCgaGaaGttmCgaAgaAt
CEPDI_C1481.1_u358_LNA3
mCtcGtcGccTccAacTtcAacGaaAttGccmCttGatGaaAccAagActGt
CEPGK_T03F1.3_d9_LNA3
TtcTatTgtTtaTtcmCttGccmCaaTagTgtAttTgtAttTatTctTtcTc
CEPGK_T03F1.3_u424_LNA3
mCaaAtcmCatmCtcmCcaGtgGatTtcGtcAttGctGacAagTtcGccGagGa
CEPON_E01A2.7_u223_LNA3
GttTctGatTcgAcamCttTatGgamCcaTctmCaaGttmCtgmCgaGttTctTt
CEPON_E01A2.7_u79_LNA3
GggAaamCaaAtgAttGttGgtAcaGtaGccmCgcmCctGctAttmCacTgtGa
CEPPGB_F13D12.6_u44_LNA3
mCgaGcamCatmCatmCcaAtcGttmCctGttmCaamCaaGgcmCttmCtaAtcGttAg
CEPPGB_F13D12.6_u440_LNA3
TgaTgaGagmCccAgtAacmCaaTtaTttGaamCcgTcaGgaTgtGcgTaaGg
CEPPS_T14G10.1_d2_LNA3
mCgtmCtaAtcGaaGaaGggGatmCgtGggmCaaTcaTaamCtaAttAacmCttmCa
CEPPS_T14G10.1_u240_LNA3
mCaaTggmCtcmCagGtcTttmCtgmCtcTtcAtaTacTtcmCatTccGagTtgmCt
CEPRDX_R07E5.2_u405_LNA3
GttmCtcTtgGagmCtgAagTtgTcgmCgtGctmCgtGtgAttmCtcActTctmCt
CEPRDX_R07E5.2_u42_LNA3
TcgmCtamCcaGcaAggAatActTcaAcaAggTcaAcaAgtGatmCacAcaGa
CEPYC_D2023.2_u256_LNA3
AagGaaAttGtaActmCgcmCcaAgaGctmCtcmCcaGgtGtcmCgtGgamCatAt
CEPYC_D2023.2_u427_LNA3
TtgActGgaTtgGagAttGcgGaaGaaGttGatGttGaaAtcGagAgtGg
CERAD_F10G7.4_u169_LNA3
GccAagTctmCaaGcaAtaAgtGttGatmCaaTcaGagmCcaTacGgaGagAt
CERAD_F10G7.4_u267_LNA3
AtaTtgAgamCttmCggGacAagmCggActTctmCatmCtgTcamCagmCaamCtgmCc
CERAD_F32A11.2_u250_LNA3
GatmCcgmCagAgaAtcGagTatTtcmCtcTcgAgamCccAtgGatAtcAacTg
CERAD_F32A11.2_u380_LNA3
TccGttAagAagmCtcActGgaAaaAcamCacGgcTcgAacGaaAttGgaAt
CERAD_T04H1.4_u274_LNA3
AatTtgGatGagAgcAaaGtgGaaGgaAtgGctAtcGttTtgGcaGatAt
CERAD_T04H1.4_u375_LNA3
GtgmCtgGtcAaaAaaTgcTtgmCttmCgtTgcTtaTtcGcaTtgmCacTcgmCa
CERAD_W06D4.6_u325_LNA3
mCttmCgaGaamCtcTtcAagTtgGaaTcaAcaGtgGcaTcgGatAcamCatGa
CERAD_W06D4.6_u34_LNA3
GtgmCctTctGaaGccGaaGaaAacGacGatTagTtaAatGttTccAagTt
CERAD_Y116A8C.13_u289_LNA3
GatAaaAtcGatAgcGacGacGatGagGaaGccGatGatGagGagmCtcGa
CERAD_Y116A8C.13_u59_LNA3
GcaGgtGgaTacGgaTgtGgaGctGacTttTgcGttTtaTcaAgaAtcTc
CERAD_Y39A1A.23_u221_LNA3
TccmCgtAgaAgtAgaAatGctAgaAgaAccTgaAcaAgaAgaTcaAgaAa
CERAD_Y39A1A.23_u276_LNA3
TgcAagAtgTcaGtaTtgAaamCaaTtcmCtgTagAgamCccmCcgAagAaaAt
CERAD_Y41C4A.14_u509_LNA3
AgtmCtcGtaTccGggAatGttTcaGccTgtGaaAatGctTgtTgaAgamCg
CERAD_Y41C4A.14_u731_LNA3
mCttmCaaAacmCgtmCgcTttTaaGgaTacAggAacGtgGcamCgcTtcmCgaGg
CERAD_Y43C5A.6_u131_LNA3
mCagAttGtamCctTcgAaaAggAaaAggAgaGaaTcgmCgtmCgcAaaAatGg
CERAD_Y43C5A.6_u429_LNA3
TgaTggmCttTgaTtaTtcGagmCagGagmCaaTgaTgtmCcgAgaGtcGttAt
CERFC_F31E3.3_u128_LNA3
mCaaTgamCgaGaaTatTggAgtAatGggGaaActGgtTgcGacTtgmCgaAa
CERFC_F31E3.3_u55_LNA3
TtgGaaAacAatmCtcmCtcGacTttmCtgmCtcActmCttmCgtGaaActAtcmCa
CERPL_K11H12.2_d1_LNA3
TctTgtTatTttAttTtgTttTggGctTgtTccGaaAatGaaAtgGttGt
CERPL_K11H12.2_u172_LNA3
mCaaTggAtcAccAagmCcaGttmCacAagmCacmCgtGagmCaaAgaGgamCtcC
CERT_F36A4.7_u1396_LNA3
mCttTgtGatGtgAtgActGcgAagGgamCacTtgAtgGctAttAcgAgamCa
CERT_F36A4.7_u2302_LNA3
GagmCcaGctActmCagAtgAcamCtcAacAcgTtcmCatTatGcaGgaGttTc
CERT_F36A4.7_u289_LNA3
TacActmCcaTccTcgmCcgAcaTacAatmCcaAcaTctmCcamCgcGgaTtcTc
CERT_F36A4.7_u2919_LNA3
AtgGagAagAtgGttTggAtgGaaTgtGggTtgAgaAtcAgaAtaTgcmCg
CERT_F36A4.7_u4269_LNA3
AacmCggGatAccGtgTcgAacGtcAcaTgaAagAtgGcgAtaTaaTcgTc
CERT_F36A4.7_u5485_LNA3
GagGagAttAaamCgcAtgTcaGtgGctmCatGtcGagTttmCcaGaaGtcTa
CESLC_F52F12.1a_u249_LNA3
AgaTatTgcmCtcTacTtaTcaTggGccTgaTggmCttTgtmCtgmCcgGtaTt
CESLC_F52F12.1a_u76_LNA3
GaaTctmCaamCcamCttmCtgGaamCccmCatAcamCcaAtgGatAgaAgamCggAg
CESLC_K11G9.5_u400_LNA3
GttGttmCttTttTccGtgAtcTttTcaTgtTtaTgtmCtgAacGtgGcaGg
CESLC_K11G9.5_u462_LNA3
GacTcgTtgGtgTctTgcTagGatGtcTtgGgtTcaTtcmCtcAatmCgtTg
CESLC_Y32F6B.1_u179_LNA3
GtamCtgGgcTcgAggGctGaaActAatmCgaAgaAgaAacTccAgaAgaTa
CESLC_Y32F6B.1_u280_LNA3
GgaTcaTgcTctGttTacGacActGatGagTtaAgaGtcAgamCtgmCacGt
CESLC_Y37A1C.1a_u104_LNA3
mCgaTggTtcTtcTcgTctAtcAtaTcgGggTagTtgmCcgAagTgtTgaAa
CESLC_Y37A1C.1a_u404_LNA3
mCaaAtcGaamCtgGtaTaaAggAggAccGacGgaGacGaaTttGaamCgaGa
CESLC_Y70G10A.3_u383_LNA3
AttmCgaTcaAagAacTctGgcTctmCggmCgtTaamCtgGacAttTgtTcgTc
CESLC_Y70G10A.3_u46_LNA3
mCtcmCccGagmCagGcgAttAttmCacGctAgtTatGctmCaaAtgTgaTctGt
CESOD_C15F1.7_u435_LNA3
mCcgGtamCtaTctGgaTcamCacAgaAgtmCcgAaaAtgAccAggmCagTtaTt
CESOD_C15F1.7_u9_LNA3
mCccAgtGacTacmCtgAatmCgcGtcTctGaaTctmCcamCacAatTccTacTa
CESOD_F10D11.1_u326_LNA3
GgaGttGctmCacmCgcAatTaaGagmCgamCttmCggAtcTctGgaTaaTctTc
CESOD_F10D11.1_u477_LNA3
AaaTtgAggAaaAgcTtcAcgAggmCggTctmCcaAagGaaAcgTcaAagAa
CESULT_EEEDB.2_u316_LNA3
mCaaTcgTacmCatGaaAgaAgtTggAagmCcamCgtGcaAgaGaaGaaAtcmCa
CESULT_EEED8.2_u82_LNA3
AagAagAttmCctGacmCagAgaGacTcamCgtGctTacmCcaAgaAgcAtcTa
CESULT_Y113G7A.11_u252_LNA3
AgcAttGgtGgaAatAcgAaaTggmCatGggAagAgaAacmCccTctmCaaTt
CESULT_Y113G7A.11_u96_LNA3
mCtgGttAcgGtaGtgTatGgtmCccTgtmCctmCtcAgaAtgmCaaAtaTgtmCg
CESULT_Y67A10A.4_u108_LNA3
TctAcgTcgAtgGaaAagmCcgAttTaamCaaTcaAagmCcaAcaAcgmCagTt
CESULT_Y67A10A.4_u327_LNA3
GgaAagGtgmCcaAaaAgtTgamCagmCaaTtgGagGatmCttAttmCatTgcmCa
CETOPO_K12D12.1_u398_LNA3
AgaTgaTgaTgaAgtTccTgcAaaGaaGccTgcTccAgcGaaGaaAgcTg
CETOPO_K12D12.1_u449_LNA3
AaaAccTcgTacTggAaaAggAgcTgcGaaAgcGgaAgtTatmCgaTttGt
CETOPO_M01E5.5b_u256_LNA3
GagAagGccmCagAagAagTacGacAgamCtgAagGagmCagTtgAaaAagTt
CETOPO_M01E5.5b_u429_LNA3
TtcTgtmCatAcaAtcGtgmCtaAtcGgcAggTtgmCgaTccTttGtaAccAt
CEUbi_F25B5.4_u186_LNA3
AagmCttmCggAcamCcaTtgAgaAtgTcaAagmCcaAaaTccAggAtaAggAg
CEUbi_F25B5.4_u2_LNA3
AatmCgaAccmCatmCaaTtcActmCgtTatTccTccTcgAtcTccGttmCaaGt
CEUbi_F29B9.6_u145_LNA3
mCtgAacmCatmCcaAatAttGaaGatmCcaGctmCagGctGaaGccTatmCagAt
CEUbi_F29B9.6_u230_LNA3
mCgtGtgmCttAtcTctTctGgaTgaAaamCaaGgaTtgGaaGccGtcAatmCt
CEUbi_M7.1_u239_LNA3
mCggAagmCatmCtgmCctTgamCatTctmCcgTtcGcaGtgGtcGccGgcTctG
CEUbi_M7.1_u53_LNA3
AaaGtamCgcTatGtgAggAggmCtaAcamCcaTtcAtaTaaGaamCgcAgcmCa
CEUGT_F39G3.1_u40_LNA3
TgtTgcmCgtAgaAgaGagActAaaAc1AagAacGatTgaTtgAagGtcTg
CEUGT_F39G3.1_u466_LNA3
TacAatTctTtgmCagGaaGcaAtaTccGccGgaGtcmCccmCttAtcActAt
CEUGT_M88.1_u480_LNA3
mCtcAcgGagGttAtaAttmCtaTgcAggAggmCaaTttmCtgmCtgGagTtcmCa
CEUGT_M88.1_u72_LNA3
AccGttTcaTgaGagmCtgTaaTcaGgtGttGttTctGtaAaaAgtGtgAa
YAL009W_u145_LNA3
GtgGatGtgAaaTtaGtcmCtcAacmCccAgaGcaTttAgtGcaGagAttAg
YAL009W_u341_LNA3
GcaGttTaaTgtGaaGctAgtTaaAgtAcaGtcTacGtgGgamCgaGaaAt
YAL059W_u262_LNA3
AttGccAagTccAttTctmCgtGccAagTacAttmCaaAatAcaAgaAagGc
YAL059W_u51_LNA3
AgamCtcmCtamCaaAtaGatTcgGtgTccTgcmCagAcgAtgTtgAagAatAg
YER109C_u109_LNA3
TtgAagTttGggAatAttGgtAtgGttGaaGacmCaaGgamCcgGatTacGa
YER109C_u436_LNA3
GagGcgmCaaGtaGgcAatGatTcaAgaAgtAgtAaaGgcAatmCgtAacAc
YHR152W_u128_LNA3
TgaGcamCaaAgtTaaGatGttmCggAaaGaaAaaGaaAgtmCaaTccTatGa
YHR152W_u510_LNA3
mCaaGtgAccAatmCagmCacGcamCggmCttmCcaTccTcaAgamCtgAtaTtamCc
YKL130C_u211_LNA3
AttAaaTgcGcaGatGagGacGgaAcgAatAtcGgaGaaActGatAatAt YKL130C_u85_LNA3
GatGgtAagmCtgAgcGccTtgGacGaaGaaTttGatGttGtcGctActAa
YKL178C_u199_LNA3
TacGtcAcgmCaaGgamCagAgcTttGacGacGaaAtaTcamCttGgaGgaTt
YKL178C_u367_LNA3
TctmCccTgtGtaGgtAcamCcaAtaTcamCaaGcgmCatTtcTatGtcGacTa
YLR443W_u179_LNA3
TgcTaamCacmCagTttAgamCcaTggAaaTccmCacmCgcAaaTatAagmCaaTg
YLR443W_u86_LNA3
GcaGgamCatAagAttmCcgGtcAagmCaamCgamCagTgaAgaAagTatGcaAa
YOR092W_u251_LNA3
mCcgTctAgtGaaAgcGggAtgGctAaaTtgGgaAaamCgamCaaGatGttAt
YOR092W_u82_LNA3
GatGctTcaAtaTccTttGatGgtmCgtTagTttAccAttTttGgtGtcTt
YPL263C_u132_LNA3 CatTtgAgtTatGtgAagAccGttGgtGggAaaGaaGagAtcAggTg
YPL263C_u257_LNA3
GtcTtgGctAccAcamCccAaaAccGttmCgaAacTttAagAgcAttmCtamCt
EXAMPLE 9
Performance Analysis of LNA Oligonucleotide Capture Probes Designed
to Detect Ratios of Splice Variants in mRNA Pools
Oligonucleotide Design for Microarrays.
[0355] The methods for designing exon-specific internal
oligonucleotide capture probes are described above.
Design of the LNA-Modified Capture Probes
[0356] For the internal LNA-modified oligonucleotide capture
probes, every third DNA nucleotide was substituted with an LNA
nucleotide. The probes designed to capture the junction of the
recombinant splice variants were designed with LNA modifications in
a block of five consecutive LNAs nucleotides, two on the 5' side of
the splice junction and three on the 3' side of the splice
junction. All capture probes are shown in Table 14. TABLE-US-00012
TABLE 14 Interna1, exon-specific and merged, exon-exon junction
specific oligonucleotide capture probes used in this example. (SEQ
ID NOs:) Sequence (LNA = uppercase, Capture probes DNA lowercase
letters) gene78.01a_50_LNA3 mCctGaaAgtAgaTttGttAttTccGaaAcgm
CctTctmCccGttmCttAagTc gene78.01b_50_LNA3
mCatAtamCcamcaaAtaGtcmCctmCaaAaa TcamCaaGaaAacTcamCaamCacTg
gene78.03a_50_LNA3 GatTtgmCagmCggTggTaaAaaGtaTgaAaa
mCgtGgtAatTaaAagGtcTc gene78.03b_50_LNA3
mCcaAtgAaaActAatmcaaAggTaaAcgTgg AtcmCcaTggmCaaTtcmCcgGg
gene78.m01INS3_50_ caacactgcccagaggttcaatcGATmCmCga block
tgatcctaatgaaggcgccc gene78.mINS303_50_
gtccagtatcgtccatcatAGTATcgataaat block atgtgaaggaaatgcctg
gene78.m01INS4_50_ caacactgcccagaggttcaatcGATGTgtga block
taggatcagtgttcaggg gene78.mINS403_50_
gaaggcgaaggagactgctAATATcgataaat block atgtgaaggaaatgcctg
Printing and Coupling of the Splice Isoform-Specific
Microarrays
[0357] The splice variant capture probes were synthesized with a 5'
anthraquinone (AQ)-modification, followed by a hexaethyleneglycol-2
(HEG2) linker. The capture probes were first diluted to a 20 .mu.M
final concentration in 100 mM Na-phosphate buffer pH 7.0, and
spotted on the Immobilizer polymer microarray slides (Exiqon,
Denmark) using the Biochip Arrayer One (Packard Biochip
Technologies, USA) with a spot volume of 2.times.300 pl and 300
.mu.m between the spots. The capture probes were immobilized onto
the microarray slide by UV irradiation in a Stratalinker with 2300
.mu.joules (Stratagene, USA). Non-immobilized capture probe
oligonucleotides were removed from the slides by washing the slides
two times 15 minutes in 1.times.SSC. After washing, the slides were
dried by centrifugation at 1000.times.g for 2 minutes, and stored
in a slide box until microarray hybridization.
Construction of Splice Variant Vectors
[0358] The recombinant splice variant constructs were cloned into
the Triamp18 vector (Ambion, USA). The constructs were sequenced to
confirm their construction. The plasmid clones were transformed
into E. coli XL10-Gold (Stratagene, USA).
Triamp18/SWI5 Vector Construct
[0359] Genomic DNA was prepared from a wild type standard
laboratory strain of Saccharomyces cerevisiae using the Nucleon MiY
DNA extraction kit (Amersham Biosciences, USA) according to the
supplier's instructions. Amplification of the partial yeast gene
was performed using standard PCR using yeast genomic DNA as
template. In the first step of amplification, a forward primer
containing a restriction enzyme site and a reverse primer
containing a universal linker sequence were used. In this step, 20
bp was added to the 3'-end of the amplicon, next to the stop codon.
In the second step of amplification, the reverse primer was
exchanged with a nested primer containing a poly-T.sub.20 tail and
a restriction enzyme site. The SWI5 amplicon contains 730 bp of the
SWI5 ORF plus 20 bp universal linker sequence and a poly-A.sub.20
tail.
[0360] The PCR primers used were; TABLE-US-00013 YDR146C-For-EcoRI:
(SEQ ID NO:) acgtgaattcaaatacagacaatgaaggagatga YDR146C-Rev-Uni:
(SEQ ID NO:) gatccccgggaattgccatgttacctttgattagttttcattggc
Uni-polyT-BamHI: (SEQ ID NO:)
acgtggatccttttttttttttttttttttgatccccgggaattg ccatg,
[0361] The PCR amplicon was cut with the restriction enzymes,
EcoRI+BamHI. The DNA fragment was ligated into the pTRIamp18 vector
(Ambion, USA) using the Quick Ligation Kit (New England Biolabs,
USA) according to the supplier's instructions and transformed into
E. coli DH-5.alpha. by standard methods.
Construction of the Recombinant Splice Variant #1
(Triamp18/swi5-Rubisco)
[0362] The Arabidopsis thaliana Rubisco small subunit ssu2b gene
fragment (gi17064721) was amplified from genomic DNA by primers
named DJ305 5'-ACTATGATGGACGATACTGGAC-3' (SEQ ID NO:) and DJ306
5'-ATTGGATCGATCCGATGATCCTAATGAAGGC-3' (SEQ ID NO:), containing ClaI
restriction site linkers. The purified PCR fragment was digested
with ClaI and then cloned into the swi5 (gI:7839148) vector at the
unique ClaI site (atcgat) giving each insert a flanking sequence
from the original yeast SWI5 insert (named exon01 and exon 03, FIG.
11). The product was inserted in the reverse orientation, so that
the insert sequence is: TABLE-US-00014 (SEQ ID NO:)
atcgatCCGATGATCCTAATGAAGGCGCCCGGGTACTCCTTCTTGCATTC
TTCAACTTCCTTCAACACTTGAGCGGAGTCGGTGCATCCGAACAATGGAA
GCTTCCACATTGTCCAGTATCGTCCATCATAGTatcgat
[0363] Nucleotide sequence analysis revealed a difference between
the sequence of A. thaliana rubisco expected from the GenBank
database and that obtained from all sequenced constructs and PCR
products. Position 30 in the Rubisco insert is "C" rather than the
expected "A". This SNP was probably created by PCR. None of the
oligonucleotide capture probes used in the example cover this
region. Rubisco sequence in genbank is TCCTAATGAAGGCGCCA (SEQ ID
NO:). The sequence obtained from the plasmid contruct is
TCCTAATGAAGGCGCCC (SEQ ID NO:).
Construction of the Recombinant Splice Variant # 2
(Triamp18/swi5-Lea)
[0364] The Arabidopsis thaliana Lea gene (gi1526423) was amplified
from genomic DNA with primers named DJ307
5'-GGAATTATCGATGTGTGATAGGATCAGTGTTCAG-3' (SEQ ID NO:) and DJ308
5'-AATTGGATCGATATTAGCAGTCTCCTTCGCC-3' (SEQ ID NO:) including the
ClaI linker sites as above. The PCR fragment was digested with ClaI
cloned into the yeast SWI5 IVT construct as above at the unique
ClaI site. The fragment was inserted in the forward orientation,
resulting in the following insert sequence: TABLE-US-00015 (SEQ ID
NO:) atcgatGTGTGATAGGTTCAGTGTTCAGGGCTGTCCAAGGAACGTATGAG
CATGCGAGAGACGCTGTAGTTGGAAAAACCCACGAAGCGGCTGAGTCTAC
CAAAGAAGGAGCTCAGATAGCTTCAGAGAAAGCGGTTGGAGCAAAGGACG
CAACCGTCGAGAAAGCTAAGGAAACCGCTGATTATACTGCGGAGAAGGTG
GGTGAGTATAAAGACTATACGGTTGATAAAGCTAAAGAGGCTAAGGACAC
AACTGCAGAGAAGGCGAAGGAGACTGCTAATatcgat.
Preparation of Target In Vitro RNA Preparation from Splice Variant
Vectors
[0365] In vitro RNA from the splice variants were made using the
MEGAscript.TM. high yield transcription kit according to the
manufacturer's instructions (Ambion, USA). The yield of IVT RNA was
quantified at a Nanodrop spectrophotometer (Nanodrop Technologies,
USA).
Isolation of Total RNA from C. elegans
[0366] C. elegans wild-type strain (Bristol-N2) was maintained on
nematode growth medium (NG) plates seeded with Escherichia coli
strain OP50 at 20.degree. C., and the mixed stages of the nematode
were prepared as described in Hope, I. A. (ed.) "C. elegans--A
Practical Approach", Oxford University Press 1999. The samples were
immediately flash frozen in liquid N.sub.2 and stored at
-80.degree. C. until RNA isolation.
[0367] A 100 .mu.l aliquot of packed C. elegans worms from a mixed
stage population was homogenized using the FastPrep Bio101 from
Kem-En-Tec for 1 minute, speed 6 followed by isolation of total RNA
from the extracts using the FastPrep Bio101 kit (Kem-En-Tec)
according to the manufacturer's instructions. The eluted total RNA
was ethanol precipitated for 24 hours at -20.degree. C. by addition
of 2.5 volumes of 96% EtOH and 0.1 volume of 3M Na-acetate, pH 5.2
(Ambion, USA), followed by centrifugation of the total RNA sample
for 30 minutes at 13200 rpm. The total RNA pellet was air-dried and
redissolved in 10 .mu.l of diethylpyrocarbonate (DEPC)-treated
water (Ambion, USA) and stored at -80.degree. C.
Fluorochrome-Labelling of the Target
[0368] The following fluorochrome-labelled cDNA targets were
synthesized to test the performance of `merged` probes that span
exon borders. Synthetic RNAs corresponding to the splice variant #1
(exon01-INS3-exon03 (1-INS3-3) and splice variant #2
(exon01-INS4-exon03 (1-INS3-3) were spiked into 10 .mu.g of C.
elegans reference total RNA sample in two different ratios. The
first target pool (KU007) contained 10 ng of splice variant #1
(1-INS3-3) transcript and 2 ng of variant #2 (1-INS4-3) transcript,
a ratio of 5:1. The second target pool (KU008) contained 2 ng
variant #1 (1-INS3-3) transcript and 10 ng of splice variant #2
(1-INS4-3) transcript, a ratio of 1:5. Both mRNA pools were
combined in separate labeling reactions with 5 .mu.g anchored
oligo(dT.sub.20) primer and DEPC-treated water to a final volume of
8 .mu.l. The mixture was heated at 70.degree. C. for 10 minutes,
quenched on ice for 5 minutes, followed by addition of 20 units of
Superasin RNase inhibitor (Ambion, USA), 1 .mu.l dNTP solution (10
mM each dATP, dGTP, dTTP and 0.4 mM dCTP, and 3 .mu.l Cy5-dCTP,
Amersham Biosciensces, USA), 4 .mu.l 5.times. RTase buffer
(Invitrogen), 2.mu.l 0.1 mM DTT (Invitrogen), 400 units of
Superscript II reverse transcriptase (Invitrogen, USA) and
DEPC-treated water to 20 .mu.l final volume. Background
hybridization to merged capture probes was monitored in both
hybridizations using the other fuor channel with 10 .mu.g of C.
elegans reference RNA alone labeled with Cy3-dCTP, according to the
labeling method described above for the splice variant spikes. All
four cDNA syntheses were carried out at 42.degree. C. for 2 hours,
and the reaction was stopped by incubation at 70.degree. C. for 5
minutes, followed by incubation on ice for 5 minutes.
[0369] Unincorporated dNTPs were removed by gel filtration using
MicroSpin S-400 HR columns as described below. The column was
pre-spun for 1 minute at 1500.times.g in a 1.5 ml tube, and the
column was placed in a new 1.5 ml tube. The cDNA sample was slowly
to the top center of the resin, spun 1500-.times.g for 2 minutes,
and the eluate was collected. The RNA was hydrolyzed by adding 3
.mu.l of 0.5 M NaOH, mixing, and incubating at 70.degree. C. for 15
minutes. The samples were neutralized by adding 3 .mu.l of 0.5 M
HCl and mixing, followed by addition of 450 .mu.l 1.times.TE, pH
7.5 to the neutralized sample and transfer onto a Microcon-30
concentrator (prior to use, 500 .mu.l 1.times.TE was spun through
the column to remove residual glycerol). The samples were
centrifuged at 14000-.times.g in a microcentrifuge for 12 minutes.
Spinning was continued until volume was reduced to 5 .mu.l. The
labelled cDNA probes were eluted by inverting the Microcon-30 tube
and spinning at 1000-.times.g for 3 minutes.
Microarray Hybridization
[0370] The fluorochrome-labelled cDNA samples, respectively, were
combined (the two different ratios separately). The following were
added: 3.75 .mu.l 20.times.SSC (3.times.SSC final, which was passed
through a 0.22 .mu.filter prior to use to remove particulates)
yeast tRNA (1 .mu.g/.mu.l final) 0.625 .mu.l 1 M HEPES, pH 7.0 (25
mM final, which was passed through 0.22.mu. filter prior to use to
remove particulates) 0.75 .mu.l 10% SDS (0.3% final) and DEPC-water
to 25 .mu.l final volume. The labelled cDNA target samples were
filtered in Millipore 0.22.mu. filter spin column (Ultrafree-MC,
Millipore, USA) according to the manufacturer's instructions,
followed by incubation of the reaction mixture at 100.degree. C.
for 2-5 minutes. The cDNA probes were cooled at room temp for 2-5
minutes by spinning at maximum speed in a microcentrifuge. A
LifterSlip (Erie Scientific Company, USA) was carefully placed on
top of the microarray spotted on Immobilizer.TM. MicroArray Slide,
and the hybridization mixture was applied to the array from the
side. An aliquot of 30 .mu.L of 3.times.SSC was added to both ends
of the hybridization chamber, and the Immobilizer.TM. MicroArray
Slide was placed in the hybridization chamber (DieTech, USA). The
chamber was sealed watertight and incubated at 65.degree. C. for
16-18 hours submerged in a water bath. After hybridization, the
slide was removed carefully from the hybridization chamber and
washed using the following protocol. The slides were washed
sequentially by plunging gently in 2.times.SSC/0.1% SDS at room
temperature until the cover slip falls off into the washing
solution, then in 1.times.SSC pH 7.0 (150 mM NaCl, 15 mM Sodium
Citrate) at room temperature for 1 minute, then in 0.2.times.SSC,
pH 7.0 (30 mM NaCl, 3 mM Sodium Citrate) at room temperature for 1
minute, and finally in 0.05.times.SSC (7.5 mM NaCl, 0.75 mM Sodium
Citrate) for 5 seconds, followed by drying of the slides by
spinning at 1000.times.g for 2 minutes. The slides were stored in a
slide box in the dark until scanning.
Microarray Data Analysis
[0371] The splice variant microarray was scanned in a ScanArray
4000XL confocal laser scanner (Packard Instruments, USA). The
hybridization data were analysed using the GenePix Pro 4.01
microarray analysis software (Axon, USA). Only the Cy5 (650 nm)
data were examined as both hybridizations produced comparable, and
acceptably low, signal from the C. elegans reference RNA alone (Cy3
channel).
Normalization
[0372] Data was normalized so that it could be compared between
hybridizations. Both hybridizations contained the same amount of
RNA from synthetic exons 01 and exons 03 (10+2 ng), so signal from
the capture probes designed to internal regions of these exons is
expected to be equal. The ratio of raw Cy5 signal between the two
different labeled cDNA target pools, designated as KU007 and KU008
hybridizations, for each probe corresponding to either of these
exons was calculated, that is for each probe i we calculated the
ratio probeiKU007/probeiKU008). The average of all of these ratios
was used as the normalization ratio.
Expectations of Normalized Data.
[0373] To reflect the proportions of RNA spiked into the
hybridization, the ratio of signal in hybridization KU007/KU008
should be 5 for probes designed to exon junctions of the INS3
splice variant #1 and 0.2 for probes corresponding to 1-INS4 splice
variant #2. Data was log.sub.2 transformed: log.sub.2(5)=+2.32,
log.sub.2(0.2)=-2.32. The merged probe corresponding to the exon
01-exon 03 border desirably produces a consistently low value that
is desirably independent of which transcript was more abundant,
i.e., log.sub.2(ratio)=0.
Array Results
[0374] Results are summarized in Table 15. 50-mer capture probes
containing LNA in a block spanning exon-exon junctions were
consistent in producing the expected ratios. TABLE-US-00016 TABLE
15 LNA 50-mer block probes are most consistent in producing overall
data closest to expected ratios. Expected Observed ratio (log2)
with merged Capture probe ratio (log2) LNA block capture probes
gene78.m0103 0.00 -0.24 gene78.m01INS3 2.32 2.93 gene78.m01INS4
-2.32 -2.39 gene78.mINS303 2.32 3.11 gene78.mINS403 -2.32 -0.86
EXAMPLE 10
Improved Signal-to-Noise Ratios Using LNA Oligonucleotide Capture
Probes Combined with cDNA Target Fragmentation with the E. coli
Uracil-DNA Glycosylase
Capture Probe Design
[0375] The capture probes were designed to a 602-nucleotide
sequence in the 3'-region of the Yeast (S. cerevisiae) 70 kDa heat
shock protein (SSA4) gene. The 602-base pair sequence is shown in
Table 16. For the LNA-spiked oligonucleotide capture probes, every
third DNA nucleotide was substituted with a LNA nucleotide. All
capture probes are shown in Table 17.
[0376] Table 16. Six hundred and two (602) base pair sequence
stretch of the S. cerevisiae ssa4 gene. The underlined segments
indicate the position of the capture probes. First underline is
equal to capture probe YER103W-554, second underline is equal to
capture probe YER103W-492 and so forth. (SEQ ID NO:) TABLE-US-00017
ggtgaaaggacaaggacaaaagacaacaatctactgggtaaatttgagttgagcggtattccacccgctccaag-
aggcgtaccac
aaattgaagttacatttgatatcgatgcaaatggtattctgaacgtatctgccgttgaaaaaggtactggtaaa-
tctaacaagat
tacaattactaacgataagggaagattatcgaaggaagatatcgataaaatggttgctgaggcagaaaagttca-
aggccgaagat
gaacaagaagctcaacgtgttcaagctaagaatcagctagaatcgtacgcgtttactttgaaaaattctgtgag-
cgaaaataact
tcaaggagaaggtgggtgaagaggatgccaggaaattggaagccgccgcccaagatgctataaattggttagat-
gcttcgcaagc
ggcctccaccgaggaatacaaggaaaggcaaaaggaactagaaggtgttgcaaaccccattatgagtaaatttt-
acggagctgca
ggtggtgccccaggagcaggcccagttccgggtgctggagcaggccccactggagcaccagacaacggcccaac-
ggttgaagagg ttgattag
[0377] TABLE-US-00018 TABLE 17 Capture probes for the SSA4 tile
array. (SEQ ID NOs:) Oligo Name Sequence YER103W-1-DNA
gccccactggagcaccagacaacggcccaacgg ttgaagaggttgattag YER103W-38-DNA
gccccaggagcaggcccagttccgggtgctgga gcaggccccactggagc YER103W-73-DNA
ccattatgagtaaattttacggagctgcaggtg gtgccccaggagcaggc YER103W-92-DNA
ctagaaggtgttgcaaaccccattatgagtaaa ttttacggagctgcagg YER103W-127-DNA
cctccaccgaggaatacaaggaaaggcaaaagg aactagaaggtgttgca YER103W-200-DNA
ggtgaagaggatgccaggaaattggaagccgcc gcccaagatgctataaa YER103W-245-DNA
actttgaaaaattctgtgagcgaaaataacttc aaggagaaggtgggtga YER103W-272-DNA
aagaatcagctagaatcgtacgcgtttactttg aaaaattctgtgagcga YER103W-336-DNA
aatggttgctgaggcagaaaagttcaaggccga agatgaacaagaagctc YER103W-393-DNA
taacaagattacaattactaacgataagggaag attatcgaaggaagata YER103W-447-DNA
cgatgcaaatggtattctgaacgtatctgccgt tgaaaaaggtactggta YER103W-492-DNA
acccgctccaagaggcgtaccacaaattgaagt tacatttgatatcgatg YER103W-554-DNA
ggtgaaaggacaaggacaaaagacaacaatcta ctgggtaaatttgagtt YER103W-1-LNA1
GccmCcamCtgGagmCacmCagAcaAcgGccmC aamCggTtgAagAggTtgAttAg
YER103W-38-LNA1 GccmCcaGgaGcaGgcmCcaGttmCcgGgtGct
GgaGcaGgcmCccActGgaGc YER103W-73-LNA1
mCcaTtaTgaGtaAatTttAcgGagmCtgmCag GtgGtgmCccmCagGagmCagGc
YER103W-92-LNA1 mCtaGaaGgtGttGcaAacmCccAttAtgAgtA
aaTttTacGgaGctGcaGg YER103W-127-LNA1
mCctmCcamCcgAggAatAcaAggAaaGgcAaa AggAacTagAagGtgTtgmCa
YER103W-200-LNA1 GgtGaaGagGatGccAggAaaTtgGaaGccGcc
GccmCaaGatGctAtaAa YER103W-245-LNA1
ActTtgAaaAatTctGtgAgcGaaAatAacTtc AagGagAagGtgGgtGa
YER103W-272-LNA1 AagAatmCagmCtaGaaTcgTacGcgTttActT
tgAaaAatTctGtgAgcGa YER103W-336-LNA1
AatGgtTgcTgaGgcAgaAaaGttmCaaGgcmC gaAgaTgaAcaAgaAgcTc
YER103W-393-LNA1 TaamCaaGatTacAatTacTaamCgaTaaGggA
agAttAtcGaaGgaAgaTa YER103W-447-LNA1
mCgaTgcAaaTggTatTctGaamCgtAtcTgcm CgtTgaAaaAggTacTggTa
YER103W-492-LNA1 AccmCgcTccAagAggmCgtAccAcaAatTgaA
gtTacAttTgaTatmCgaTg YER103W-554-LNA1
GgtGaaAggAcaAggAcaAaaGacAacAatmCt amCtgGgtAaaTttGagTt Control
capture probes YFL039C-50 acaagaatacgacgaaagtggtccatctatcgt
tcaccacaagtgtttct YFL039C-50_LNA3 AcaAgaAtamCgamCgaAagTggTccAtcTatm
CgtTcamCcamCaaGtgTttmCt YDR146C-50
tgggaatggaacggggattatggtttcgccaat gaaaactaatcaaaggt YDR146C-50_LNA3
TggGaaTggAacGggGatTatGgtTtcGccAat GaaAacTaaTcaAagGt
Printing and Coupling of the Yeast SSA4 Tile Microarrays
[0378] The SSA4 capture probes were synthesized with a 5'
anthraquinone (AQ)-modification, followed by a hexaethyleneglycol-2
(HEG2) linker. The capture probes (Table 17) were first diluted to
a 20 .mu.M final concentration in 100 mM Na-phosphate buffer pH
7.0, and spotted on the Immobilizer microarray slides (Exiqon,
Denmark) using the Biochip Arrayer One (Packard Biochip
Technologies) with a spot volume of 2.times.300 pl and 400 .mu.m
between the spots. The capture probes were immobilized onto the
microarray slide by UV irradiation in a Stratalinker with 2300
.mu.joules (Stratagene, USA). Non-immobilized capture probe
oligonucleotides were removed from the slides by washing the slides
two times 15 minutes in 1.times.SSC. After washing, the slides were
dried by centrifugation at 1000.times.g for 2 minutes, and stored
in a slide box until microarray hybridization.
Yeast Cultures
[0379] Saccharomyces cerevisiae wild-type (BY4741, MATa;
his3.DELTA.1; leu2.DELTA.0; met15.DELTA.0; ura3.DELTA.0) and
.DELTA.ssa4 (MATa; his3.DELTA.1; leu2.DELTA.0; met15AO;
ura3.DELTA.0; YER103w::kanMX4) mutant strains (EUROSCARF) were
grown in YPD at 30.degree. C. until the A.sub.600 density of the
cultures reached 0.8. Half of the cultures were collected by
centrifugation and resuspended in one volume of 40.degree. C.
preheated YPD. Incubation was continued for an additional 30
minutes at 30.degree. C. or 40.degree. C. for the standard and
heat-shocked cultures, respectively. Cells were harvested by
centrifugation and stored at -80.degree. C.
RNA Extraction
[0380] Total RNA was extracted using the FastRNA Kit-RED (BIO 101)
according to suppliers' instructions. The quantity and quality of
the RNA preparations were examined by standard spectrophotometry on
a NanoDrop ND-1000 I(USA) and by gel electrophoresis. Only high
quality RNA preparations were used for microarray analyses.
Fluorochrome-Labelling of the Target
[0381] A total of seven cDNA assay mixtures were produced; each
with ten (10) .mu.g total RNA from wtand combined with 5 .mu.g
anchored oligo(dT.sub.20) primer and DEPC-treated water to a final
volume of 8 .mu.l. The mixtures were heated at 70.degree. C. for 10
minutes, quenched on ice for 5 minutes, followed by addition of 20
units of Superasin RNase inhibitor (Ambion, USA), 3 .mu.l Cy3-dCTP
(Amersham Biosciences), 10 mM final concentration of dATP and dGTP,
4 .mu.l 5.times. RTase buffer (Invitrogen), 2 .mu.l 0.1 mM DTT
(Invitrogen), 400 units of Superscript II reverse transcriptase
(Invitrogen, USA), dUTP and dTTP accordingly to Table 18, and
DEPC-treated water to 20 .mu.l final volume. A parallel set-up was
made with 10 .mu.g total RNA from .DELTA.ssa4 for target cDNA
labelling with Cy5-dCTP. All cDNA syntheses were carried out at
42.degree. C. for 2 hours, and the reaction was stopped by
incubation at 70.degree. C. for 5 minutes, followed by incubation
on ice for 5 minutes. Each cDNA pool (except the unfragmented
control pool) was incubated at 37.degree. C. for 2 hours with 2
units of Uracil-DNA Glycosylase (UDG, New England Biolabs, USA) and
by addition of 2.4 .mu.l (1.times. final concentration in the
reaction mixture) of UDG reaction buffer. The enzyme was
heat-inactivated at 95.degree. C. for 10 minutes. Unincorporated
dNTPs were removed by gel filtration using MicroSpin S-400 HR
columns as described in Example 9. TABLE-US-00019 TABLE 18 dUTP and
dTTP ratios in cDNA target labelling. Assay # Final conc. dUTP
Final conc. dTTP 1 0.5 0 2 0.25 0.25 3 0.125 0.375 4 0.05 0.45 5
0.025 0.475 6 0.0125 0.4875 7 0 0.5
Gel Electrophoresis of the cDNA Target Pools
[0382] 0.5 .mu.l of each of the seven fragmented cDNA pools were
analysed on a 2% agarose-gel. The data show that the cDNA is
fragmented linearly with respect to the concentration of dUTP used
in the synthesis. FIG. 29 shows the gel electrophoresis of
fragmented cDNA from the yeast wild-type strain.
Comparative Hybridization of the SSA4 Tile Array with
Fluorochrome-Labelled Wild-Type and .DELTA.ssa4 cDNA Target Pools
and Post-Hybridization Washes
[0383] The fluorochrome-labelled cDNA samples, respectively, were
combined (the different UDG-fragmented samples separately). The
following were added: 3.75 .mu.l 20.times.SSC (3.times.SSC final,
pass through 0.22.mu. filter prior to use to remove particulates)
yeast tRNA (1 .mu.g/.mu.l final) 0.625 .mu.l 1 M HEPES, pH 7.0 (25
mM final, pass through 0.22.mu. filter prior to use to remove
particulates) 0.75 .mu.l 10% SDS (0.3% final) and DEPC-water to 25
.mu.l final volume. The labelled cDNA target samples were filtered
in Millipore 0.22.mu. filter spin column (Ultrafree-MC, Millipore,
USA) according to the manufacturer's instructions, followed by
incubation of the reaction mixture at 100.degree. C. for 2-5
minutes. The cDNA probes were cooled at room temp for 2-5 minutes
by spinning at maximum speed in a microcentrifuge. A LifterSlip
(Erie Scientific Company, USA) was carefully placed on top of the
SSA4 microarrays spotted on ImmobilizerTm MicroArray Slide, and the
hybridization mixture was applied to the array from the side. An
aliquot of 30 .mu.L of 3.times.SSC was added to both ends of the
hybridization chamber, and the slide was placed in the
hybridization chamber (DieTech, USA). The chamber was sealed
watertight and incubated at 65.degree. C. for 16-18 hours submerged
in a water bath. After hybridization, the slide was removed
carefully from the hybridization chamber and washed using the
following protocol. The slides were washed sequentially by plunging
gently in 2.times.SSC/0.1% SDS at room temperature until the cover
slip falls of into the washing solution, then in 1.times.SSC pH 7.0
(150 mM NaCl, 15 mM Sodium Citrate) at room temperature for 1
minute, then in 0.2.times.SSC, pH 7.0 (30 mM NaCl, 3 mM Sodium
Citrate) at room temperature for 1 minute, and finally in
0.05.times.SSC (7.5 mM NaCl, 0.75 mM Sodium Citrate) for 5 seconds,
followed by drying of the slides by spinning at 1000.times.g for 2
minutes. The slides were stored in a slide box in the dark until
scanning.
Microarray Data Analysis
[0384] The slides were scanned in a ScanArray 4000XL confocal laser
scanner (Packard Instruments, USA). The hybridization data were
analysed using the GenePix Pro 4.01 microarray analysis software
(Axon, USA).
[0385] In the data analysis, the differences in labelling
efficiency between the two fluorescent dyes were scaled by using an
internal normalization approach. The average signal intensities
from the control capture probes (Table 17) were used to calculate
the normalization factor. This factor was multiplied to the signal
intensity values from the Cy-3 target. Analysis of the data
demonstrates that capture probes with LNA in every third position
have up to 5.2 fold higher signal-to-noise ratios, compared to the
DNA capture probes (FIG. 30).
EXAMPLE 11
Interpretation of Splice Array Data Using LNA Discriminating
Probes
[0386] This example illustrates the interpretation of microarray
analysis of alternative mRNA splicing. Different LNA capture probe
design types are formalized, and the expression constant O is
introduced as a measurement of alternative splicing.
Introduction
[0387] The eukaryotic pre-mRNA is the subject of Splicing and
Alternative Splicing, hence sequences refer to RNA sequences,
Original sequence refers to pre-mRNA, and splice forms refer to
mRNA sequences. The splicing is conducted by a cellular machinery
named the spliceosome. The terms exons and introns can be used to
refer to regions of pre-RNA sequences (or more specifically a
single splice form). It is noted that a part of the corresponding
DNA/pre-mRNA sequence that is an exon (not excised) in one splice
form can potentially be absent in another splice form (e.g., partly
absent in exon truncation and completely absent in exon skipping).
Thus, the terms "constant regions" and "variable regions" (see
below) are useful for characterizing the process of identifying
different splice forms.
[0388] Splicing can be defined as the production of a new sequence
via the excision of part(s) of an original sequence (FIG. 31).
Alternative splicing can be defined as the production of more than
one novel sequence via the excision of different parts of the
original sequence. When comparing two different splice forms, they
can be divided into a constant region that is shared by both
sequences and a variable region by which the two splice forms
differ (FIG. 32).
[0389] Alternative splicing can be categorized in terms of (i)
whether or not the variable region is flanked by a single constant
region or surrounded by two constant regions, (ii) the size of the
variable region (e.g., exon skipping/intron retention vs. extension
and truncation) [(intron/exon) 5' and 3'], and (iii) the number of
variable regions (and hence the number of splice forms).
Capture Probe Design
[0390] Capture Probe design can be divided into 3 distinct types
according to their position: Merged Probes (MP) or Junction Probes,
Unique Internal Probes (UIP), and Shared Internal Probes (SIP)
(FIG. 33). Considering the case of a single variable region
surrounded by constant regions, there are several different
possible capture probe positions for each type (FIG. 34).
Data Interpretation
[0391] The aim of the analyses can be to determine (i) whether a
given original sequence is subject to alternative splicing (i.e.,
whether there is more than one splice form present), and (ii)
whether there is a difference in alternative splicing of the
original sequence between two biological samples (i.e., whether the
proportions between the two splice forms differ between biological
samples). The analysis can also be used for data validation.
[0392] Possible biases in the microarray platform include (a) noise
in terms of non-specific binding and subsequent false signal, (b)
differences in dye labeling efficiency, (c) differences in capture
probe affinity, (d) differences in sample conditions (e.g., number
of cells, and amount of RNA), and (e) differences in reverse
transcriptase efficiency of different splice forms. Biases can be
corrected for by various means of normalization and/or
standardization.
Data Analysis
[0393] In order to analyze the expression of the different splice
forms, the expression constant O is introduced. O denotes the
relation between the proportions of the signals (capture probes a
and b) between the labeled extracts from biological samples
(labeled with Cy5 & Cy3). That is, (Cy5a/Cy3a)=(Cy5b/Cy3b)*O
or, .0. = ( Cy .times. .times. 5 .times. a / Cy .times. .times. 3
.times. a ) / ( Cy .times. .times. 5 .times. b / Cy .times. .times.
3 .times. b ) = ( Cy .times. .times. 5 .times. a * Cy .times.
.times. 3 .times. b ) / ( Cy .times. .times. 5 .times. b * Cy
.times. .times. 3 .times. a ) .times. and , ##EQU1## .0. = ( Cy
.times. .times. 5 .times. a / Cy5b ) / ( Cy .times. .times. 3
.times. a / Cy .times. .times. 3 .times. b ) = ( Cy .times. .times.
5 .times. a * Cy .times. .times. 3 .times. b ) / ( Cy .times.
.times. 3 .times. a * Cy .times. .times. 5 .times. b ) = ( Cy
.times. .times. 5 .times. a * Cy .times. .times. 3 .times. b ) / (
Cy .times. .times. 5 .times. a * Cy .times. .times. 3 .times. b )
.function. [ same .times. .times. as .times. .times. above ]
##EQU1.2##
[0394] Considering normalization due to different biases and given
a sample normalization factor S due to differences between the
samples in terms of amounts of RNA, RT-efficiency, dye properties,
etc. and a probe normalization factor P due to differences in
probes in terms of affinity, position in target sequence, etc., the
following equations apply.
For two probes: a and b, a*P=b
For two samples Cy5 & Cy3, Cy5*S=Cy3,
Thus, considering two probes from two samples the signals are:
[0395] CySa*P*S [0396] Cy5b*S [0397] Cy3a*P [0398] Cy3b With
respect to O: .0. = .times. [ ( Cy .times. .times. 5 .times. a * P
* S ) / ( Cy .times. .times. 3 .times. a * P ) ] / [ ( Cy .times.
.times. 5 .times. b * S ) / ( Cy .times. .times. 3 .times. b ) ] =
.times. ( Cy .times. .times. 5 .times. a * P * S * Cy .times.
.times. 3 .times. b ) / ( Cy .times. .times. 3 .times. a * P * Cy5
.times. .times. b * S ) = .times. ( Cy .times. .times. 5 .times. a
* Cy .times. .times. 3 .times. b * P * S ) / ( Cy .times. .times. 3
.times. a * Cy .times. .times. 5 .times. b * P * S ) = .times. ( Cy
.times. .times. 5 .times. a * Cy .times. .times. 3 .times. b ) / (
Cy .times. .times. 3 .times. a * Cy .times. .times. 5 .times. b ) *
( P * S ) / ( P * S ) = .times. ( Cy .times. .times. 5 .times. a *
Cy .times. .times. 3 .times. b ) / ( Cy .times. .times. 3 .times. a
* Cy .times. .times. 5 .times. b ) * 1 = .times. ( Cy .times.
.times. 5 .times. a * Cy .times. .times. 3 .times. b ) / ( Cy
.times. .times. 3 .times. a * Cy .times. .times. 5 .times. b )
.function. [ same .times. .times. as .times. .times. without
.times. .times. normalization ] ##EQU2## Note that the calculation
of O is not affected by the normalization factors S and P, hence it
is not necessary to normalize the array data when interpreting
alternative splice arrays with the use of the Expression constant
O. Properties of O
[0399] If O=1, there is no difference in the proportions of the
targets of capture probes a and b in the two samples. Even in the
case of alternative splicing, it is not possible to determine
whether there is more than a single splice form present using this
particular method. If O.noteq.1, there is a difference in the
proportions of the targets of capture probes a and b in the two
samples, thus there is a difference in splice pattern and therefore
there must be more than one splice form present.
Comparing O's
[0400] O can be compared between different transcripts to determine
whether they have correlated expression, and O's from sets of
capture probes from the same transcript (different probes) can be
averaged.
EXAMPLE
[0401] Considering a simple example of a single large variable
region surrounded by constant regions using a combination of a
Merged Probe and a Shared Internal Probe. Calculating O of a single
splice form can be performed using the following equation:
O=(Cy5MP*Cy3SIP)/(Cy3MP*Cy5SIP) If O=1, there is no difference in
the proportions of the targets of capture probes a and b in the two
samples, and it may not be possible to determine whether multiple
splice forms are present using this particular method. If
O.noteq.1, there is a difference in the proportions of the targets
of capture probes a and b, thus there is a difference in splice
pattern and therefore there must be more than one splice form
present. Conclusions
[0402] It is possible to infer difference in expression level of
two capture probe targets from two tissues when one is comparing
the proportions of signals from one capture probe with the
proportion of signals from the other probe. In contrast, single
signals may be subject to biases from normalizations and
standardizations for each probe and sample.
EXAMPLE 12
Exemplary Microarrays
[0403] The nucleic acid arrays of the invention can be generated by
standard methods for either synthesis of nucleic acid probes that
are then bonded to a solid support or synthesis of the nucleic acid
probes on a solid support (e.g., by sequential addition of
nucleotides to a reactive group on the solid support). In desirable
methods for on-chip synthesis of the capture probes, photogenerated
acids are produced in light-irradiate sites of the chip and used to
deprotect the 5'-OH group of nucleic acid monomers and oligomers
(e.g., to remove an acid-labile protecting group such as 5'-O-DMT)
to which a nucleotide is to be added (Gao et al., Nucleic Acid
Research 29:4744-4750, 2001). Standard methods can also be used to
label the nucleic acids in a test sample with, e.g., a fluorescent
label, incubate the labeled nucleic acid sample with the array, and
remove any unbound or weakly bound test nucleic acids from the
array. Exemplary methods are described, for example, in U.S. Pat.
Nos. 6,410,229; 6,406,844; 6,403,957; 6,403,320; 6,403,317;
6,346,413; 6,344,316; 6,329,143; 6,310,189; 6,309,831; 6,309,823;
6,261,776; 6,239,273; 6,238,862; 6,156,501; 5,945,334; 5,919,523;
5,889,165; 5,885,837; 5,744,305; 5,445,934; 5,800,9927; and
5,874,219.
[0404] In an exemplary method for synthesis of an array, capture
probes were immobilized using AQ technology with a HEG5 linker
(U.S. Pat. No. 6,033,784) onto an Immobilizer.TM. slide. An
exemplary chip consists of 288 spots in four replicates (i.e., 1152
spots) with a pitch of 250 .mu.m, and an exemplary hybridization
buffer is 5.times.SSCT (i.e., 750 mM NaCl, 75 mM Sodium Citrate, pH
7.2, 0.05% Tween) and 10 mM MgCl.sub.2. An exemplary target is a
45-mer oligonucleotide with Cy5 at the 5' end and with a final
concentration in the hybridization solution of 1 .mu.M.
[0405] Hybridization was performed with 200 .mu.L hybridization
solution in a hybridization chamber created by attaching a
CoverWell.TM. gasket to the Immobilizer slide. The incubation was
conducted overnight at 4.degree. C. After hybridization, the
hybridization solution was removed, and the chamber was flushed
with 3.times.1.0 mL hybridization buffer described above without
any target nucleic acid. A coverWell.TM. chamber was then filled
with 200 L hybridization solution without target. The slide was
observed with a Zeiss Axioplan 2 epifluorescence microscope with a
5.times. Fluar objective and a Cy5 filterset from OMEGA. The
temperature of the microscope stage was controlled with a Peltier
element. Thirty-five images at each temperature were acquired
automatically with a Photometrics camera, automated shutter, and
motorized microscope stage. The images were acquired, stitched
together, calibrated and stored in stack by the software package
"MetaVue"
[0406] Arrays can be generated using capture probes of any desired
length (e.g., arrays of pentamers, hexamers, or heptamers.) In
various embodiments, 1, 2, 3, 4, 5, 6, 7, 8, or more nucleotides of
the probes are LNA nucleotides. Desirably, at least 1, 2, 3, 5, 7,
9, or all of the A and T nucleotides in the probes are LNA A and
LNA T nucleotides. LNA nucleotides can be placed in any position of
the capture probe, such as at the 5' terminus, between the 5' and
3' termini, or at the 3' terminus. LNA nucleotides may be
consecutive or may be separated by one or more other nucleotides.
The microarrays can be used to analyze target nucleic acids of any
"AT" or "GC" content, and are especially useful for analyzing
nucleic acids with high "AT" content because of the increased
affinity of the microarrays of the present invention for such
nucleic acids compared to traditional microarrays. Desirably, the
array has at least 100, 200, 300, 400, 500, 600, 800, 1000, 2000,
5000, 8000, 10000, 15000, 20000, or more different probes. If
desired, nucleotides with a universal base can be included in the
capture probes to increase the T.sub.m of the capture probes (e.g.,
capture probes of less than 7, 6, 5, or 4 nucleotides). Exemplary
"non-discriminatory" nucleotides include inosine, random
nucleotides, 5 nitro-indole, LNA, inosine, and LNA 2-aminopurine.
In desirable embodiments, 1, 2, 3, 4, 5, or more nucleotides with a
universal base are located at the 5' and/or 3' termini of the
capture probes.
EXAMPLE 13
Exemplary Application of Nucleic Acids of the Invention
[0407] An exemplary application of these methods includes comparing
hybridization patterns of cDNA or cRNA from a patient sample to
classify early-tumors or detect an infection or a diseased state.
The microarrays of the invention may also be used as a general tool
to analyze the PCR products generated by amplification of a test
sample with PCR primers for one or more nucleic acids of interest.
For example, PCR primers can be used to amplify nucleic acids with
a particular exon or exon-exon combination, and then the PCR
products can be identified and/or quantified using a microarray of
the invention. For identification of splice variants, PCR primers
to specific exons can be used to amplify nucleic acids that are
then applied to a microarray for detection and/or quantification as
described herein. To detect microbial pathogens, species-specific
PCR primers (e.g., primers specific for an exon whose sequence
differs among species) can be used to amplify nucleic acids in a
sample for subsequent analysis using a microarray. For example, the
hybridization pattern of the PCR products to the array can be used
to distinguish between different bacteria, viruses, or yeast and
even between different strains of the same pathogenic species. In
particular embodiments, the array is used to determine whether a
patient sample contains a bacteria strain that is known to be
resistant or susceptible to particular antibiotics or contains a
virus or yeast strain known to be resistant or susceptible to
certain drugs. Changes in product composition or raw material
origin can also be detected using a microarray. The arrays can also
be used to determine the composition of mRNA cocktails.
[0408] Exemplary environmental microbiology applications of these
arrays include identification of major rRNA types in contaminated
soil samples and classification of microbial isolates. These rRNA
amplificates are formed from rRNA by rtPCR or from the rDNA gene by
conventional PCR. Numerous general and selective primers for
different groups of organisms have been published. Most frequently
an almost full length amplificate of the 16S rDNA gene is used
(e.g., the primers 26F and 1492R). For purifying rRNA from a soil
sample, standard methods such as one or more commercial extraction
kits from companies such as QIAGEN ("Rneasy", Q-biogene "RNA PLUS,"
or "Total RNA safe" can be used.
EXAMPLE 14
Methods for Minimizing the Variance in Melting Temperatures in
Nucleic Acid Populations of the Invention
[0409] Any simultaneous use of more than one primer or probe is
made difficult because the involved primers or probes must work
under the same conditions. An indication of whether or not two or
more primers or probes will work under the same conditions is the
relative T.sub.ms at which the hybridized oligonucleotides
dissociate. In cases where probes are applied for specific
detection of homologous sequences such as splice variants, the
.DELTA.T.sub.m is of importance. .DELTA.T.sub.m expresses the
difference between T.sub.m of the match and the T.sub.m of the
mismatch hybridizations. Generally, the larger .DELTA.T.sub.m
obtained, the more specific detection of the sequence of interest.
In addition, a large .DELTA.T.sub.m facilitates more probes to be
used simultaneously and in this way a higher degree of multiplexity
can be applied.
[0410] High affinity nucleotide analogs such a LNA can be also be
used universally to equalize the melting properties of
oligonucleotides with different AT and CG content. The increased
affinity of LNA adenosine and LNA thymidine corresponds
approximately to the normal affinity of DNA guanine and DNA
cytosine. An overall substitution of all DNA-A and DNA-T with LNA-A
and LNA-T results in melting properties that are nearly sequence
independent but only depend on the length of the oligonucleotide.
This may be important for design of oligonucleotide probes used in
large multiplex analysis. The effect of LNA A and T substitutions
has been evaluated by predicting the T.sub.m value of all possible
9-mer oligonucleotides with different universal substitutions. The
distribution of the 262,000 T.sub.m-values exhibits a very
homogeneous T.sub.m value for universally LNA A and T substituted
oligonucleotides. The standard deviation of the melting temperature
for all 9-mers drops from 7.7.degree. C. for pure DNA to only
2.2.degree. C. for LNA A and T substituted oligonucleotides. This
equalizing effect may also be utilized for photomediated on-chip
synthesis of oligonucleotides.
[0411] It is often difficult to design probes and primers with the
same range of melting temperature due to the variance in A/T and
G/C content of the probing sites. Highly A/T rich regions typically
give lower T.sub.m values. Furthermore, if single mismatches are to
be resolved, G/T mismatches are known to contribute little to
.DELTA.T.sub.m. As discussed above, the use of LNA is a desirable
way to solve problems related to multiplex use of primers and
probes. LNA offers the possibility to adjust T.sub.m and increase
the .DELTA.T.sub.m at the same time. LNA increases T.sub.m with
4-8.degree. C./substitution and increases .DELTA.T.sub.m in many
cases (Table 9). TABLE-US-00020 TABLE 9 Demonstration of LNA
controlled increase of T.sub.m and .DELTA. T.sub.m. (SEQ ID NOs:)
Single T.sub.mof LNA: Perfect match mismatch DNA Duplexes
3'-ACGACCAC-5' 3'-ACGGCCAC-5' .DELTA.T.sub.m LNA 8-mer 71.degree.
C. 45.degree. C. 26.degree. C. 5'-TGCTGGTG-3' DNA 8-mer 35.degree.
C. 25.degree. C. 10.degree. C. 5'-TGCTGGTG-3'
[0412] As LNA can be mixed with DNA during standard oligonucleotide
synthesis, LNA can be placed at optimal positions in probes in
order to adjust T.sub.m. The specificity of PCR may also be
enhanced by the use of LNA in primers, or probes, and this
facilitates a higher degree of multiplexity. By incorporation of
LNA, the T.sub.m of the primers or probes can be adjusted to work
at the same temperature. Amplification or hybridization is more
specific when LNA is included in primers or probes. This is due to
the LNA increased .DELTA.T.sub.m, which relates to higher
specificity. Once .DELTA.T.sub.m of the primers or probes is high,
more primers or probes can potentially be brought to work
together.
Prediction of T.sub.m
[0413] LNA can be used to enhance any experiment that is based on
hybridization. The series of algorithms described herein have been
developed to predict the optimal use of LNA. Melting properties of
129 different LNA substituted capture probes hybridized described
herein to their corresponding DNA targets were measured in solution
using UV-spectrophotometry. The data set was divided into a
training set with 90 oligonucleotides and a test set with 39
oligonucleotides. The training set was used for training of both
linear regression models and neural networks. Neural networks
trained with nearest neighbour information, length, and DNA/LNA
neighbour effect are efficient for prediction of T.sub.m with the
given set of data.
Applications of the Normalization of Thermal Stability by LNA A and
T Nucleotide Substitutions
[0414] All assays in which DNA/RNA hybridization is conducted may
benefit from the use of LNA in terms of increased specificity and
quality. Exemplary uses include sequencing, primer extension
assays, PCR amplification, such as multiplex PCR, allele specific
PR amplification, molecular beacons, (e.g., nucleic acids be
multiplexed with one colour based on multiple T.sub.m's), Taq-man
probes, in situ hybridization probes (e.g., chromosomal and
bacterial 16S rRNA probes), capture probes to the mRNA poly-A tail,
capture probes for microarray detection of SNPs, capture probes for
expression microarrays (sensitivity increased 5-8 times), and
capture probes for assessment of alternative mRNA splicing.
EXAMPLE 15
Exemplary Methods for the Prediction of Melting Temperatures for
Nucleic Acid Populations of the Invention
[0415] LNA units have different melting properties than DNA and RNA
nucleotides. Until recently, thermodynamical models for melting
temperature prediction have existed for DNA and RNA only, but not
for LNA. Now a T.sub.m prediction model for LNA/DNA mixed
oligonucleotides has been developed (John SantaLucia, Jr. (1998)
Proc. Natl. Acad. Sci. 95 1460-1465 and Tostesen et al. "Prediction
of Melting Temperature for LNA (Locked Nucleic Acid) Modified
Oligonucleotides" Bioinformatics 2002, Bergen, Norway Apr. 4-7
2002). The T.sub.m prediction tool is available on-line at the
Exiqon website (www.LNA-Tm.com and
http://www.exiqon.com/Poster/Tmpred-ET-view.pdf).
[0416] Numerous applications in molecular biology are based on the
ability of DNA and RNA to hybridize in a temperature dependent
manner (e.g. the microarray techniques, PCR reactions and blotting
techniques). The melting properties of nucleic acid duplexes, in
particular the melting temperature T.sub.m, are crucial for optimal
design of such experiments. T.sub.m is usually computed using a
two-state thermodynamical model (Breslauer, Meth. Enzymol.,
259:221-242, 1995). Several different groups have estimated model
parameters for nearest neighbors in the sequence based on
experimental data (for a review see SantaLucia, Proc. Natl. Acad.
Sci., 95:1460-1465, 1998).
[0417] The model described herein predicts the T.sub.m of duplexes
of mixed LNA/DNA oligonucleotides hybridized to their complementary
DNA strands. DNA monomers are denoted with lowercase letters, and
LNA monomers are denoted with uppercase letters, e.g., there are
eight types of monomers in the mixed strand: a, c, g, t, A, C, G
and T. The model is based on the formula (SantaLucia, 1998, supra;
Allawi et al., Biochemistry 36:10581-10594, 1997). T m = .DELTA.
.times. .times. H .DELTA. .times. .times. S + R ln .function. ( C -
C m / 2 ) + 0.368 .times. ( L - 1 ) .times. ln .function. [ Na + ]
, ##EQU3## in which the salt concentration [Na+] enters as an
entropic correction together with the oligonucleotide
concentrations. R is the gas constant, C and C.sub.m are the
concentrations of the two strands where C.gtoreq.C.sub.m, and L is
the length of the strands. For self-complementary sequences,
C-C.sub.m/2 is replaced by the total strand concentration C.sub.T
and a symmetry correction of -1.4 cal/kmol is added to .DELTA.S
(SantaLucia, 1998, supra).
[0418] The LNA model differs from SantaLucia's DNA model in the way
the changes in enthalpy .DELTA.H and entropy .DELTA.S are
calculated. As in SantaLucia's model, they depend on nearest
neighbor sequence information and special contributions for the
terminal base-pairs in the two ends of the duplex. However, with
eight types of monomers (LNA and DNA) the increased number of
nearest neighbor combinations requires more model parameters to be
determined and hence more data.
Parameter Reduction
[0419] Usually .DELTA.H and .DELTA.S are calculated as a sum of
contributions from all nearest neighbor pairs in the sequence. The
inclusion of LNA doubles the number of monomer types and quadruples
the number of possible nearest neighbor pairs. Parameter reduction
strategies are used for matching the model complexity to limited
data sets. A strategy for reducing model complexity is to sum
.DELTA.H from single base-pair contributions, which do not take the
influence of adjacent nucleotides into account. However, nearest
neighbor contributions are added as a correction term to the single
base-pair contributions.
[0420] Another strategy is to use hierarchically reduced monomer
alphabets. Here, similar monomers are identified with the same
letter. A four-letter alphabet, {w,s,W,S}, defines classes
according to binding strength: w={a,t}, s={c,g}, W={A,T} and
S={C,G}. The smallest alphabet, {D,L}, simply identifies the
monomer type: DNA or LNA. As an example, the sequence GcTAAcTt can
be written as SsWWWsWw or as LDLLLDLD.
[0421] The principle is to split .DELTA.H and .DELTA.S into
contributions that depend on different levels of detail of the
sequence. The fine levels of detail require many parameters to be
determined, while the coarse levels need fewer parameters. The more
detailed contributions can then be treated as minor corrections,
thus effectively reducing the total number of model parameters.
Training
[0422] Model parameters were determined using data from melting
experiments on hundreds of oligonucleotides. The oligonucleotides
were random sequences with lengths between 8 and 20 and a
percentage of LNA between 20 and 70. Melting curves were obtained
using a Perkin-Elmer UV .lamda.-40 spectrophotometer, but only the
T.sub.m values were used for modeling. Model parameters were
adjusted using a gradient descent algorithm that minimizes the
error function E = data set .times. 1 N .times. ( T m pred - T m
exp ) 2 , ##EQU4## i.e., the distance between predicted and
experimental T.sub.m values. Many different models were trained in
this way and their performance was evaluated on test sets distinct
from the training data. Seven reliable models were chosen and
combined to form the committee model implemented at the Exiqon
website (www.LNA-Tm.com.) Machine Learning and Thermodynamics
[0423] The aim of this work has been to estimate T.sub.m values as
accurately as possible. To this end, a machine learning approach
has been adopted in which the prediction of the physical .DELTA.H
and .DELTA.S quantities is less important. The parameters of this
model may be inaccurate as thermodynamic quantities. First, the
gradient descent algorithm produces a broad ensemble of models in
which the .DELTA.H and .DELTA.S parameters can vary substantially,
while maintaining an accuracy in the predicted T.sub.m. Second, the
thermodynamic meaning of .DELTA.H and .DELTA.S is based on a
two-state assumption, which may not be realistic in every case.
Even short oligonucleotides can form different secondary structures
or melt through multiple-state transitions (Tostesen et al., J.
Phys. Chem. B. 105:1618-1630, 2001). Third, the use of an optical
instrument instead of a calorimetric instrument (DSC) introduces an
error in the measured .DELTA.H and .DELTA.S. Nevertheless, the
uncertain thermodynamic interpretation of the .DELTA.H and .DELTA.S
model parameters does not imply that the T.sub.m prediction model
is unreliable.
Results
[0424] The T.sub.m prediction model has been tested on two data
sets that were not used during the training process. One set
consisted of pure DNA oligonucleotides without LNA monomers and had
a standard deviation of the residuals (SEP) of 1.57 degrees. The
other set consisted of mixed oligonucleotides with both LNA and DNA
and had a SEP of 5.25 degrees. The difference in prediction
accuracy between the two types of oligonucleotides suggests that
T.sub.m prediction of mixed strands is a more complex task than
T.sub.m prediction of pure DNA. This is possibly due to
irregularities in the duplex helical structure induced by the LNA
monomers (Nielsen et al., Bioconjug. Chem. 11:228-238, 2000). The
obtained prediction accuracy is in both cases adequate for most
biological applications. In conclusion, the reduced nearest
neighbor model implemented at the Exiqon website (www.LNA-Tm.com)
can predict T.sub.m surprisingly well for both types of
oligonucleotides. This indicates that the parameter reduction
strategy is applicable for other types of modified
oligonucleotides.
EXAMPLE 16A
Algorithm to Optimize the Substitution Pattern of Nucleic Acids of
the Invention
[0425] High affinity nucleotides such as LNA and other nucleotides
that are conformationally restricted to prefer the C3'-endo
conformation or nucleotides with a modified backbone and/or
nucleobase stabilize a double helix configuration. As these effects
are generally additive, the most stable duplex between a high
affinity capture oligonucleotide and an unmodified target
oligonucleotide should generally arise when all nucleotides in the
capture probe or primer are replaced by their high affinity
analogue. The most stable duplex should thus be formed between a
fully modified LNA capture probe and the corresponding DNA/RNA
target molecule. Such a fully modified capture probe should be more
efficient in capturing target molecules, and the resulting duplex
is more thermally stable.
[0426] However, many high affinity nucleotides (e.g., as LNA) have
an even higher affinity for other high affinity nucleotides (e.g.,
as LNA) than for DNA/RNA. A fully modified capture probe may thus
form duplexes with itself, or if it is long enough, internal
hairpins that are even more stable than duplexes with the desired
target molecule. Probes with even a small inverse repeat segment
where all constituent positions are substituted with high affinity
nucleotides may bind to itself and be unable to bind the target.
Thus, a sequence dependent substitution pattern is desirably used
to avoid substitutions in positions that may form
self-complementary base-pairs.
[0427] For example, a computer algorithm can be used to
automatically determine the optimal substitution pattern for any
given capture probe sequence according to the following two
criteria. First, the difference between the stability of (i) the
duplex formed between the capture probe and the target molecule and
(ii) the best possible duplex between two capture probes should be
above a certain threshold. If this is not possible, then the
substitution pattern with the largest possible difference is
chosen. Second, the capture probe should contain as many
substitutions as possible in order to bind as much target as
possible at any given temperature and to increase the thermal
stability of the formed duplex. Alternatively, the second criterion
is substituted with the following alternative criterion to obtain
capture probes with similar thermal stability. The number and
position of capture probe substitutions should be adjusted so that
all the duplexes between capture probes and targets have a similar
thermal stability (i.e., T.sub.m equalization).
[0428] For oligonucleotide capture probes such, incomplete matches
between target and capture probe are likely to be a reproducible
feature of the recorded biosignatures. For short probes, the second
criterion for increasing thermal stability is more desirable that
the alternative second criterion for T.sub.m equalization. For long
capture probes and PCR primers, the second alternative criterion is
desirably used since T.sub.m equalization is desirable for these
probes and primers.
[0429] An exemplary algorithm works as follows. For each nucleotide
sequence in an array of length n, all possible substitution
patterns, i.e., 2.sup.n different sequences are evaluated. Each
evaluation consist of estimating the energetic stability of the
duplex between the substituted capture sequence and a perfect match
unmodified target ("target duplex") and the energetic 30 stability
of the most stable duplex that can be formed between two
substituted capture probes themselves ("self duplex").
[0430] The energetic stability estimate for a duplex may be
calculated, e.g., using a Smith-Waterman algorithm with the
following scoring matrix. Gap .times. .times. initiation .times.
.times. penalty .times. : .times. - 8 ##EQU5## Gap .times. .times.
continuation .times. .times. penalty .times. : .times. - 50
##EQU5.2## a c g t A C G T a - 2 c - 2 - 2 g - 2 3 - 2 t 2 - 2 1 -
2 A - 3 - 3 - 3 4 - 3 C - 3 - 3 6 - 3 - 3 - 3 G - 3 6 - 3 2 - 3 9 -
3 T 4 - 3 2 - 3 6 - 3 3 - 3 ##EQU5.3## This scoring matrix was
partly based on the best parameter fit to a large (over 1000)
number of melting curves of different DNA and LNA containing
duplexes and partly by visual scoring of test capture probe
efficiency. If desired, this scoring matrix may be optimized by
optimizing the parameter fit as well as increasing or optimizing
the dataset used to obtain these parameters.
[0431] As an example of these calculations, the heptamer sequence
ATGCAGA in which each position can be either an LNA or a DNA
nucleotide is used. The target duplex formed between a fully
modified capture probes with this sequence and its unmodified
target receive a score of 34 as illustrated below. TABLE-US-00021
Capture sequence: A-T-G-C-A-G-A | | | | | | | Target sequence:
t-a-c-g-t-c-t Score: 4+4+6+6+4+6+4 = 34
[0432] The most stable self duplex that can be formed between two
modified capture probes has an almost equivalent energetic
stability with a score of 30 as illustrated below. TABLE-US-00022
Capture sequence: A-T-G-C-A-G-A | | | | Target sequence:
A-G-A-C-G-T-A Score: +6+9+9+6 = 30
[0433] Thus, the capture probe efficiency of a fully modified probe
is likely reduced by its propensity to form a stable duplex with
itself. In contrast, by choosing a slightly different substitution
pattern, ATGcaGA in which capital letters represent LNA
nucleotides, the stability of the target duplex is reduced slightly
from 34 to 29. TABLE-US-00023 Capture sequence: A-T-G-c-a-G-A | | |
| | | | Target sequence: t-a-c-g-t-c-t Score: 4+4+6+3+2+6+4 =
29
[0434] However, the most stable self complementary duplex that can
be formed is reduced much more from 30 to 20, as illustrated below.
TABLE-US-00024 Capture sequence: A-T-G-c-a-G-A | | | | Target
sequence: A-G-a-c-G-T-A Score: +4+6+6+4 = 20
[0435] The difference between the stability of the desired target
duplex and the undesired self duplex can be further increased by
using the capture sequence AtgcaGA where the target duplex has a
score of 24. TABLE-US-00025 Capture sequence: A-t-g-c-a-G-A | | | |
| | | Target sequence: t-a-c-g-t-c-t Score: 4+2+3+3+2+6+4 = 24
[0436] Whereas the score of the self duplex is only 10, as shown
below. TABLE-US-00026 Capture sequence: A-t-g-c-a-G-A | | | |
Target sequence: A-G-a-c-g-t-A Score: +2+3+3+2 = 10
The additional destabilization of the self duplex is generally not
required if the difference in stability between the target duplex
and self duplex is above a threshold of 25% of the target duplex
stability, as illustrated below. Discrimination for
ATGCAGA=(34-30)/34=12%<threshold (25%) Discrimination for
ATGcaGA=(29-20)/29=31%.gtoreq.threshold (25%) Discrimination for
ATGCAGA=(24-10)/24=58%.gtoreq.threshold (25%) Thus, ATCcaGA is the
substitution pattern with the highest degree of substitution for
which the stability of the target duplex is adequately more stable
than the stability of the best self duplex (e.g., above 25%).
[0437] This algorithm can be used to determine desirable
substitution patterns for any size capture probe or any given probe
sequence. The following simple design rules may also be applied for
probe design, especially for short probes. The best self alignment
for the corresponding DNA capture probe in the sequence is
determined using a simple Smith-Waterman scoring matrix of: a c g t
a - 2 c - 2 - 2 g - 2 3 - 2 t 2 - 2 1 - 2 ##EQU6## Additionally,
all possible positions in the sequence are substituted, with the
exception of desirably avoiding the substitution of both bases of a
self-complementary base-pair. The most stable self duplex thus does
not contain any LNA:LNA base-pairs but only LNA:DNA basepairs.
EXAMPLE 16B
Computer Code for a Preferred Software Program of the Invention
[0438] Exemplary programs are provided in the Computer Program
Listing Appendix submitted on compact disc herewith. The oligod
program (50287.007002_oligod.txt) takes a gene sequence as input
and returns sequences for LNA spiked oligonucleotides. The dyp
program (50287.007002_dyp.txt) is used by oligod to predict the
secondary structure and self annealing properties of the
oligonucleotides. The expression_array_param file
(50287.007002_expression_array_param.txt) contains parameters used
by the oligod program. 50287.007002_tmprediction.txt contains code
for a T.sub.m prediction program, and
50287.007002_tmthermodynamic.txt contains code for a T.sub.m
thermodynamic model.
Exemplary Computer
[0439] Any of the methods described herein may be implemented using
virtually any computer. FIG. 35 shows such an exemplary computer
system. Computer system 2 includes internal and external
components. The internal components include a processor 4 coupled
to a memory 6. The external components include a mass-storage
device 8, e.g., a hard disk drive, user input devices 10, e.g., a
keyboard and a mouse, a display 12, e.g., a monitor, and usually, a
network link 14 capable of connecting the computer system to other
computers to allow sharing of data and processing tasks. Programs
are loaded into the memory 6 of this system 2 during operation.
These programs include an operating system 16, e.g., Microsoft
Windows, which manages the computer system, software 18 that
encodes common languages and functions to assist programs that
implement the methods of this invention, and software 20 that
encodes the methods of the invention in a procedural language or
symbolic package. Languages that can be used to program the methods
include, without limitation, Visual C/C.sup.++ from Microsoft. In
preferred applications, the methods of the invention are programmed
in mathematical software packages that allow symbolic entry of
equations and high-level specification of processing, including
algorithms used in the execution of the programs, thereby freeing a
user of the need to program procedurally individual equations or
algorithms. An exemplary mathematical software package useful for
this purpose is Matlab from Mathworks (Natick, Mass.). Using the
Matlab software, one can also apply the Parallel Virtual Machine
(PVM) module and Message Passing Interface (MPI), which supports
processing on multiple processors. This implementation of PVM and
MPI with the methods herein is accomplished using methods known in
the art. Alternatively, the software or a portion thereof is
encoded in dedicated circuitry by methods known in the art.
EXAMPLE 17
Exemplary Locked Nucleic Acids (LNA)
[0440] As disclosed in WO 99/14226, LNA are DNA analogues that form
DNA- or RNA-heteroduplexes with exceptionally high thermal
stability. LNA units include bicyclic compounds as shown
immediately below where ENA refers to 2'O,4'C-ethylene-bridged
nucleic acids: ##STR12##
[0441] References herein to Locked Nucleoside Analogues, LNA units,
LNA monomers, or similar terms are inclusive of such compounds as
disclosed in WO 99/14226, WO 00/56746, WO 00/56748, and WO
00/66604.
[0442] Desirable LNA monomers and oligomers share some chemical
properties of DNA and RNA; they are water soluble, can be separated
by agarose gel electrophoresis, and can be ethanol
precipitated.
[0443] Desirable LNA monomers and oligonucleotide units include
nucleoside units having a 2'-4' cyclic linkage, as described in the
International Patent Application WO 99/14226 and WO 0056746, WO
0056748, and WO 0066604. Desirable LNA monomers structures are
exemplified in the formulae Ia and Ib below. In formula Ia the
configuration of the furanose is denoted D-.beta., and in formula
Ib the configuration is denoted L-.alpha.. Configurations which are
composed of mixtures of the two, e.g. D-.beta. and L-.alpha., are
also included. ##STR13##
[0444] In Ia and Ib, X is oxygen, sulfur and carbon; B is a
universal or modified base (particularly non-natural occurring
base) e.g. pyrene and pyridyloxazole derivatives, pyrenyl,
pyrenylmethylglycerol moieties, all of which may be optionally
substituted. Other desirable universal bases include, pyrrole,
diazole or triazole moieties, all of which may be optionally
substituted, and other groups e.g. modified adenine, cytosine,
5-methylcytosine, isocytosine, pseudoisocytosine, guanine, thymine,
uracil, 5-bromouracil, 5-propynyluracil, 5-propyny-6-fluoroluracil,
5-methylthiazoleuracil, 6-aminopurine, 2-aminopurine, inosine,
diaminopurine, 7-propyne-7-deazaadenine, 7-propyne-7-deazaguanine.
R.sup.1, R.sup.2 or R.sup.2', R.sup.3 or R.sup.3', R.sup.5 and
R.sup.5' are hydrogen, methyl, ethyl, propyl, propynyl, aminoalkyl,
methoxy, propoxy, methoxy-ethoxy, fluoro, or chloro.
[0445] P designates the radical position for an internucleoside
linkage to a succeeding monomer, or a 5'-terminal group, R.sup.3 or
R.sup.3' is an internucleoside linkage to a preceding monomer, or a
3'-terminal group. The internucleotide linkage may be a phosphate,
phosphorothioate, phosphorodithioate, phosphoramidate,
phosphoroselenoate, phosphorodiselenoate, alkylphosphotriester, or
methyl phosphonate. The intemucleotide linkage may also contain
non-phosphorous linkers, hydroxylamine derivatives (e.g.
--CH.sub.2--NCH.sub.3--O--CH.sub.2--), hydrazine derivatives, e.g.
--CH.sub.2--NCH.sub.3--NCH.sub.3--CH.sub.2, amid derivatives, e.g.
--CH.sub.2--CO--NH--CH.sub.2--, CH.sub.2--NH--CO--CH.sub.2--. In
Ia, R.sup.4' and R.sup.2' together designate --CH.sub.2--O--,
--CH.sub.2--S--, --CH.sub.2--NH--,--CH.sub.2--NMe--,
--CH.sub.2--CH.sub.2--O--, --CH.sub.2--CH.sub.2--S--,
--CH.sub.2--CH.sub.2--NH--, or --CH.sub.2--CH.sub.2--NMe- where the
oxygen, sulfur or nitrogen, respectively, is attached to the
2'-position. In Formula lb, R.sup.4' and R.sup.2 together designate
--CH.sub.2--O--, --CH.sub.2--S--, --CH.sub.2--NH--,
--CH.sub.2--NMe--, --CH.sub.2--CH.sub.2--O--,
--CH.sub.2--CH.sub.2--S--, --CH.sub.2--CH.sub.2--NH--, or
--CH.sub.2--CH.sub.2--NMe- where the oxygen, sulphur or nitrogen,
respectively, is attached to the 2-position (R.sup.2
configuration).
[0446] Desirable LNA monomer structures are structures in which X
is oxygen (Formula Ia and Ib); B is a universal base such as
pyrene; R.sup.1, R.sup.2 or R.sup.2', R.sup.3 or R.sup.3', R.sup.5
and R.sup.5' are hydrogen; P is a phosphate, phosphorothioate,
phosphorodithioate, phosphoramidate, and methyl phosphomates;
R.sup.3 or R.sup.3' is an intemucleoside linkage to a preceding
monomer, or a 3'-terminal group. In Formula Ia, R.sup.4' and
R.sup.2' together designate --CH.sub.2--O--, --CH.sub.2--S--,
--CH.sub.2--NH--, --CH.sub.2--NMe-, --CH.sub.2--CH.sub.2--O--,
--CH.sub.2--CH.sub.2--S--, --CH.sub.2--CH.sub.2--NH--, or
--CH.sub.2--CH.sub.2--NMe- where the oxygen, sulphur or nitrogen,
respectively, is attached to the 2'-position, and in Formula Ib,
R.sup.4' and R.sup.2 together designate --CH.sub.2--O--,
--CH.sub.2--S--, --CH.sub.2--NH--,--CH.sub.2--NMe-,
--CH.sub.2--CH.sub.2--O--, --CH.sub.2--CH.sub.2--S--,
--CH.sub.2--CH.sub.2--NH--, or --CH.sub.2--CH.sub.2--NMe- where the
oxygen, sulphur or nitrogen, respectively, is attached to the
2'-position in the R.sup.2 configuration.
[0447] Particularly desirable LNA monomer for incorporation into an
oligonucleotide of the invention include those of the following
formula IIa ##STR14## wherein X oxygen, sulfur, nitrogen,
substituted nitrogen, carbon and substituted carbon, and desirably
is oxygen; B is a modified base as discussed above e.g. an
optionally substituted carbocyclic aryl such as optionally
substituted pyrene or optionally substituted pyrenylmethylglycerol,
or an optionally substituted heteroalicylic or optionally
substituted heteroaromatic such as optionally substituted
pyridyloxazole. Other desirable universal bases include, pyrrole,
diazole or triazole moieties, all of which may be optionally
substituted; R.sup.1*, R.sup.2, R.sup.3, R.sup.5 and R.sup.5* are
hydrogen; P designates the radical position for an intemucleoside
linkage to a succeeding monomer, or a 5'-terminal group, R.sup.3*
is an intemucleoside linkage to a preceding monomer, or a
3'-terminal group; and R.sup.2* and R.sup.4* together designate
--O--CH.sub.2-- or --CH.sub.2--CH.sub.2--O-- where the oxygen is
attached in the 2'-position, or a linkage of --(CH.sub.2).sub.n--
where n is 2, 3 or 4, desirably 2, or a linkage of --S--CH.sub.2--
or --NH--CH.sub.2--.
[0448] LNA units of formula IIa where R.sup.2* and R.sup.4* contain
oxygen are sometimes referred to herein as "oxy-LNA"; units of
formula Ia where R.sup.2* and R.sup.4* contain sulfur are sometimes
referred to herein as "thio-LNA"; and units of formula Ia where
R.sup.2* and R.sup.4 contain nitrogen are sometimes referred to
herein as "amino-LNA". For many applications, oxy-LNA units are
desirable modified nucleic acid units of oligonucleotides of the
invention.
[0449] Particularly desirable LNA monomers for use in
oligonucleotides of the invention are 2'-deoxyribonucleotides,
ribonucleotides, and analogues thereof that are modified at the
2'-position in the ribose, such as 2'-O-methyl, 2'-fluoro,
2'-trifluoromethyl, 2'-O-(2-methoxyethyl), 2'-O-aminopropyl,
2'-O-dimethylamino-oxyethyl, 2'-O-fluoroethyl or 2'-O-propenyl, and
analogues wherein the modification involves both the 2'and 3'
position, desirably such analogues wherein the modifications links
the 2'- and 3'-position in the ribose, such as those described in
Nielsen et al., J. Chem. Soc., Perkin Trans. 1, 1997, 3423-33, and
in WO 99/14226, and analogues wherein the modification involves
both the 2'- and 4'-position, desirably such analogues wherein the
modifications links the 2'- and 4'-position in the ribose, such as
analogues having a --CH.sub.2--S-- or a --CH.sub.2--NH-- or a
--CH.sub.2--NMe- bridge (see Singh et al. J. Org. Chem. 1998, 6,
6078-9). Although LNA monomers having the .beta.-D-ribo
configuration are often the most applicable, other configurations
also are suitable for purposes of the invention. Of particular use
are .alpha.-L-ribo, the .beta.-D-xylo and the .alpha.-L-xylo
configurations (see Beier et al., Science, 1999, 283, 699 and
Eschemnoser, Science, 1999, 284, 2118), in particular those having
a 2'-4' --CH.sub.2--S--, --CH.sub.2--NH--, --CH.sub.2--O-- or
--CH.sub.2--NMe- bridge.
[0450] In another desirable embodiment, LNA modified
oligonucleotides used in this invention comprises oligonucleotides
containing at least one LNA monomeric unit of the general scheme A
above, wherein X, B, P are defined as above. One of the
substituents R.sup.2, R.sup.2*, R.sup.3, and R.sup.3* is a group P*
which designates an intemucleoside linkage to a preceding monomer,
or a 2'/3'-terminal group. Two of the substituents of R.sup.1*,
R.sup.2, R.sup.2 *, R.sup.3, R.sup.4*, R.sup.5, R.sup.5*, R.sup.6,
R.sup.6*, R.sup.7, and R.sup.7* when taken together designate a
biradical structure selected from
--(CR*R*).sub.r-M-(CR*R*).sub.s--,
--(CR*R*).sub.r-M-(CR*R*).sub.s-M-, -M-(CR*R*).sub.r+s-M-,
-M-(CR*R*).sub.r-M-(CR*R*).sub.s--, --(CR*R*).sub.r+s--, -M-,
-M-M-, wherein each M is independently selected from --O--, --S--,
--Si(R*).sub.2--, --N(R*)--, >C.dbd.O, --C(.dbd.O)--N(R*)--, and
--N(R*)--C(.dbd.O)--. Each R* and R.sup.1(1*)--R.sup.7(7*), which
are not involved in the biradical, are independently selected from
hydrogen, halogen, azido, cyano, nitro, hydroxy, mercapto, amino,
mono- or di(C.sub.1-6-alkyl)amino, optionally substituted
C.sub.1-6-alkoxy, optionally substituted C.sub.1-6-alkyl, DNA
intercalators, photochemically active groups, thermochemically
active groups, chelating groups, reporter groups, and ligands,
and/or two adjacent (non-geminal) R* may together designate a
double bond, and each of r and s is 0-4 with the proviso that the
sum r+s is 1-5.
[0451] Examples of LNA units are shown scheme B: ##STR15##
##STR16## Scheme B wherein the groups, X and B are defined as
above. P designates the radical position for an intemucleoside
linkage to a succeeding monomer, nucleoside such as an
L-nucleoside, or a 5'-terminal group, such intemucleoside linkage
or 5'-terminal group optionally including the substituent R . One
of the substituents R.sup.2 or R.sup.2*, R.sup.3 and R.sup.3* is a
group P* which designates an internucleoside linkage to a preceding
monomer, or a 2'/3'-terminal group.
[0452] Desirable nucleosides are L-nucleosides such as for example,
derived dinucleoside monophosphates. The nucleoside can be
comprised of either a beta-D, a beta-L or an alpha-L nucleoside.
Desirable nucleosides may be linked as dimers wherein at least one
of the nucleosides is a beta-L or alpha-L. B may also designate the
pyrimidine bases cytosine, 5-methyl-cytosine, thymine, uracil, or
5-fluorouridine (5-FUdR) other 5-halo compounds, or the purine
bases, adenosine, guanosine or inosine.
[0453] As discussed above, a variety of LNA units may be employed
in the monomers and oligomers of the invention including bicyclic
and tricyclic DNA or RNA having a 2'-4' or 2'-3' sugar linkages;
2'-O,4'-C-methylene-.beta.-D-ribofuranosyl moiety, known to adopt a
locked C3'-endo RNA-like furanose conformation. Illustrative
modified structures that may be included in oligonucleotides of the
invention are shown in FIG. 1. Other nucleic acid units that may be
included in an oligonucleotide of the invention may comprise
2'-deoxy-2'-fluoro ribonucleotides; 2'-O-methyl ribonucleotides;
2'-O-methoxyethyl ribonucleotides; peptide nucleic acids;
5-propynyl pyrimidine ribonucleotides; 7-deazapurine
ribonucleotides; 2,6-diaminopurine ribonucleotides; and
2-thio-pyrimidine ribonucleotides, and nucleotides with other sugar
groups (e.g. xylose).
[0454] Oligonucleotides containing LNA are readily synthesized by
standard phosphoramidite chemistry. The flexibility of the
phosphoramidite synthesis approach further facilitates the easy
production of LNA oligos carrying all types of standard linkers,
fluorophores and reporter groups.
EXAMPLE 18
Selective Binding Complementary (SBC) Nucleotides
[0455] Selective Binding Complementary (SBC) nucleotides are unable
to form stable hybrids with each other, yet are able to form
stable, sequence-specific hybrids with complementary unmodified
strands of nucleic acids. Thus, the reduced ability of SBC
oligonucleotides to form intramolecular hydrogen bond base-pairs
between regions of substantially complementary sequence causes a
reduced level of secondary structure. Self-complementarity is an
important issue in nucleic acid technologies as reported for DNA,
PNA and LNA, and in different biological applications especially in
the field of homogeneous assays. LNA:LNA duplexes are the most
thermally stable nucleic acid type duplex system known, making the
reduction of self-complementarity even more important.
[0456] Exemplary SBC oligonucleotides contain 2-amino-A (D) and
.sup.2ST incorporated in the same oligonucleotide as replacements
of A and T, respectively. The SBC name refers to the fact that D
and .sup.2ST form a destabilised base-pair compared to the A-T
base-pair, but D-T and .sup.2ST-A base-pairs are normally more
stable than the original A-T base-pair. Exemplary SBC-G nucleotides
include inosine or LNA-inosine, and exemplary SBC-C nucleotides
inclue PyrroloPyr, LNA-PyrroloPyr, .sup.2SC, and LNAu-.sup.2SC
(FIG. 3). Other exemplary SBC nucleotides are shown in FIGS. 2 and
3. If desired, SBC nucleotides may be incorporated into the nucleic
acids and arrays of the invention, using standard methods.
[0457] The systems disclosed herein can provide significant nucleic
acid probes for universal hybridization. In particular, universal
hybridization can be accomplished with a conformationally
restricted monomer, including a desirable pyrene LNA monomer.
Universal hybridization behavior also can be accomplished in an RNA
context. Additionally, the binding affinity of probes for universal
hybridization can be increased by the introduction of high affinity
monomers without compromising the base-pairing selectivity of bases
neighboring the universal base.
[0458] Incorporation of one or more modified nucleobases or
nucleosidic bases into an oligonucleotide can provide significant
advantages. Among other things, LNA oligonucleotides can often
self-hybridize, rather than hybridize to another oligonucleotide.
Use of one or more modified bases with the LNA units can modulate
the propensity of the oligonucleotide to form double stranded
structures with other oligonucleotides containing modified
nucleobases including internal duplex formation, thereby inhibiting
undesired self-hybridization.
EXAMPLE 19
Exemplary Methods for Synthesizing LNA-2-thiopyrimidine Nucleosides
and Nucleotides
[0459] 2-Thiopyrimidine nucleosides can be prepared in several ways
as described below. For example, the 2-thiouridine-nucleosides (IV)
can be synthesized from a substituted uridine nucleoside (VIII) as
described in the scheme below. By protection of the O4-position
(IX) on the nucleobase thionation can be performed, O2 position,
which results in the 2-thio-uridine nucleoside (IV). Performing
sulphurisation on both O2 and O4 results in 2,4-dithio-uridine
nucleoside (X) which may be transformed into the 2-thio-uridine
nucleoside (IV) (Saladino, et. al., Tetrahedron, 1996, 52, 6759).
Another way is to generate a cyclic ether (XI) through reaction
with the 5' position this product can then be transformed to the
2-thio-uridine nucleoside (IV) or the 2-O-alkyl-uridine nucleoside
(XII). The 2-O-alkyl-uridine nucleoside (XII) can also be generated
by direct alkylation of the uridine nucleoside (VIII). Treatment of
the 2-O-alkyl-uridine nucleoside (XII) can also be transformed into
the 2-thio-uridine nucleoside (Brown et. al., J. Chem. Soc. 1957,
868; Singer, et. al., Proc. Natl. Acad. Sci. USA, 1983, 80, 4884;
Rajur and McLaughlin, Tetrahedron Lett., 1992, 33, 6081).
##STR17##
[0460] In another method, lewis acid-catalyzed condensation of a
properly substituted sugar (I) and a substituted 2-thio-uracil (II)
can result in a substituted 2-thio-uridine nucleoside of the
structure (III) which by further synthetic manipulations can be
transformed into the LNA 2-thiouridine nucleoside (IV) (Hamamura
et. al., Moffatt, J. Med. Chem., 1972, 15, 1061; Bretner et. al.,
J. Med. Chem., 1993, 36, 3611). ##STR18##
[0461] Using a properly substituted amino-sugar (V), a
2-thio-uridine nucleoside can be synthesized through ring-synthesis
of the nucleobase by reaction of the amino sugar (V) and an
substituted isothiocyanate(VI), yielding the substituted LNA
2-thio-uracil nucleoside (VI) (Shaw and Warrener, J. Chem. Soc.
1957, 153; Cusack et al., J. Chem. Soc. Perkin 1, 1973, 1721).
##STR19##
EXAMPLE 20
Exemplary Methods for Synthesizing .sup.2sT-LNA
[0462] Three different strategies for synthesis of .sup.2sT-LNA are
outlined in the Summary of the Invention section. Strategy A
involves coupling a glycosyl-donor and a nucleobase, using standard
methodology for synthesis of existing LNA monomers. Strategy B
involves ring synthesis of the nucleobase. This strategy is
desirable because the availability of 1-amino-LNA enables
introduction of a variety of new nucleobases. Strategy C includes
modification of T-LNA; the easy synthesis of LNA-T diol makes this
an attractive pathway.
[0463] In a desirable embodiment, .sup.2sT-LNA is synthesized as
illustrated in the scheme below. ##STR20##
[0464] In particular, the known coupling sugar 1,2-di-O-acetyl-3,5
di-O-benzyl, 4-C-mesyloxymethyl, .alpha.,.beta.-D-ribofuranose 1
was coupled with the nucleobase 2-thio-thymidine in a Vorbruggen
type reaction. Thus, the nucleobase was silyilated and condensed
with the sugar using SnCl.sub.4 as catalyst to promote the reaction
affording nucleoside 2. Mass spectrometry and NMR subsequently
identified the isolated product as the desired one. NMR data were
compared with published data of a 2-thio-thymindine derivative
(Kuimelis and Nambiar, Nucleic Acid Res., 1994, 22, 1429-1436) in
order to validate the correct attachment point of the
nucleobase.
[0465] Subsequently, a base mediated ring-closing reaction afforded
the di-benzylated LNA derivative 3 in 77% yield. The signals in the
.sup.1H-NMR spectrum of the compound appeared as singlets, thus
proving that the cyclization had occurred to give the LNA skeleton,
in which the 1'-H and 2'-H are perpendicular to each other causing
the .sup.3J.sub.1',2' to be 0 Hz. MALDI mass spectrometry was
likewise used for the identification of the compound.
[0466] The LNA derivative was protected at the nucleobase with the
toluoyl protective group to give 4. This group is well known for
the protection of 2-thio-thymidine derivatives, (Kuimelis and
Nambiar, Nucleic Acid Res., 1994, 22, 1429-1436). The protection of
the nucleobase occurs at both the N-3 and the O-4 position and
hence the compound is isolated as a mixture of two compounds. NMR
shows that the ratio of the two isomers in the isolated mixture is
2:1.
[0467] These methods are described further below.
1-(2-O-acetyl-3-O, 5-O-dibenzyl,
4-C-mesyloxymethyl-.beta.-D-ribofuranosyl)-2-thio-thymine (2)
[0468] 1,2-di-O-acetyl-3,5di-O-dibenzyl, 4-C-mesyloxymethyl,
.alpha.,.beta.-D-ribofuranose (1, 2.0g, 3.83 mmol) and
2-thio-thymine (552 mg, 3.89 mmol) were co-evaporated with
anhydrous acetonitrile (100 ml) and redissolved in anhydrous
acetonitrile (80 ml), N,O-bistrimethylsilylacetamide (1.5,
5.85mmol) was added, and the reaction was stirred at 80.degree. C.
for one hour. The mixture was cooled to 0.degree. C., SnCl.sub.4
(0.9 ml, 7.66 mmol) was added, and the reaction was left to stir
for 24 hours. The reaction mixture was diluted with EtOAc and
washed with NaHCO.sub.3 and subsequently with water. The organic
phase was dried (Na.sub.2SO.sub.4) and evaporated to dryness. The
product was purified using column chromatography, giving the
thio-thymidine derivative 2 (1.1 g, 1.82 mmol, 40%) as a white
foam. R.sub.f (10% THF/dichloromethane): 0.75. MALDI-MS: 627 (M+Na)
.sup.13C-NMR (CDCl.sub.3): .delta.=174.40, 169.29, 159.89, 136.13,
136.51, 136.05, 128.62, 128.56, 128.41, 128.29, 128.07, 127.89,
12767, 116.18, 91.41, 86.21, 75.59, 75.31, 74.46, 74.22, 73.61,
69.25, 69.04, 37.52, 20.62, 11.91
(1R,3R,4R,7S)-7-(benzyloxy)-1-(benzyloxymethyl)-3-(2-thiothymidine)-2,5-di-
oxabicyclo[2.2.1]heptane (3)
[0469] 1-(2-O-acetyl-3-O, 5-O-dibenzyl,
4-C-mesyloxymethyl-.beta.-D-ribofuranosyl)-2-thio-thymine (2, 630
mg, 1.04 mmol) was dissolved in dioxane (15 ml) and water (8 ml),
and aqueous NaOH (2M, 5 ml) was added, and the reaction was left to
stir at room temperature for one hour. The yellow solution was
neutralized with HCl (1M, 6 ml) affording a precipitation. The
mixture was diluted with dichloromethane and ethyl acetate causing
an emulsion. After separation, the aqueous phase extracted with
ethyl acetate, and the combined organic phase was dried
(Na.sub.2SO.sub.4) and evaporated to dryness. The compound was
purified by column chromatography (0-2, then 5%
THF/dichloromethane), giving the ring closed compound 3 as a white
foam (370 mg, 0.79 mmol, 77%). R.sub.f (2% MeOH/dichloromethane):
0.23.
[0470] MALDI-MS: 488 (M+Na) .sup.13C-NMR (CDCl.sub.3):
.delta.=173.14, 160.39, 137.20, 136.63, 136.00, 128.46, 128.34,
128.02, 127.66, 115.52, 90.29, 87.77, 77.39,75.26, 73.77, 72.07,
71.70, 64.15, 30.17, 12.33
[0471] .sup.1H-NMR (CDCl.sub.3): .delta.=9.87 (s, 1H), 7.69 (d, 1.1
Hz, 1H), 7.26-7.37 (m, 10H), 6.13 (s, 1H), 4.84 (s, 1H), 4.66 (d,
J=11.3 Hz, 1H), 4.61 (s, 2H), 4.52 (d, 11.5 Hz, 1H), 4.04 (d, J=7.7
Hz, 1H), 3.93 (s, 1H), 3.88 (d, J=11.0 Hz, 1H), 3.82 (d, J=7.7 Hz,
1H), 3.82 (d, J=10.8 Hz, 1H), 1.59 (d, J=1.1 Hz, 3H)
(1R,3R,4R,7S)-7-(benzyloxy)-1-(benzyloxymethyl)-3-(2-thio-N3/O4-toluoyl-th-
ymidine)-2,5-dioxabicyclo[2.2.1]heptane (4)
[0472]
(1R,3R,4R,7S)-7-(benzyloxy)-1-(benzyloxymethyl)-3-(2-thiothymidine-
)-2,5-dioxabicyclo[2.2.1]heptane (3, 290 mg, 0.62 mmol) was
dissolved in anhydrous pyridine and diisopropylethylamine (0.2 ml,
1.15 mmol), toluoyl chloride (0.25 ml, 1.89 mmol) was added, and
the reaction mixture was stirred at room temperature for three
hours. After completion, the reaction mixture was diluted with
dichloromethane, and the reaction was quenched by addition of
water. The phases were separated, and the organic phase was dried
(Na.sub.2SO.sub.4) and evaporate to dryness. The residue was
co-evaporated with toluene. The product was purified by column
chromatography (0-1% MeOH/dichloromethane) to give nucleoside 4 as
a white foam (320 mg, 0.55 mmol, 89%). R.sub.f (2%
MeOH/dichloromethane): 0.78.
[0473] MALDI-MS: 606 (M+Na) .sup.13C-NMR (CDCl.sub.3):
.delta.=171.98, 168.30, 160.30, 145.92, 145.82, 137.22, 136.65,
135.98, 130.39, 130.27, 129.85, 129.50, 128.51, 128.41, 128.08,
127.73, 115.11, 90.10, 87.81, 76.01, 75.80, 75.39, 75.01, 73.83,
72.19, 72.09, 71.74, 64.15, 21.75, 12.40.
EXAMPLE 21
Exemplary Methods for Synthesizing LNA-I, LNA-D, and LNA-2AP
[0474] 2'-O, 4'-C-methylene linked (LNA) nucleosides containing
hypoxanthine (or inosine) (LNA-I), 2,6-diaminopurine (LNA-D), and
2-aminopurine (LNA-2AP) nucleobases were efficiently prepared via
convergent syntheses. The nucleosides were converted into
phosphoramidite monomers and incorporated into LNA oligonucleotides
using an automated phosphoramidite method. The complexing
properties of oligonucleotides containing these LNA nucleosides
were assessed against perfect and singly mismatch DNA. ##STR21##
Hypoxantine, the base found in the nucleotides inosine and
deoxyinosine, is considered as a guanine analogue in nucleic
acids.
[0475] Oligonucleotides containing 2,6-diaminopurine replacements
for adenines are expected to bind more strongly to their
complementary sequences especially as part of A-type helixes due to
the potential formation of three hydrogen bounds with thymine or
uracil. The reported effect of 2,6-diaminopurine deoxyriboside (D)
on the stability of polynucleotide duplexes reaches, on average,
about 1.5.degree. C. per modification. Higher stabilization effects
for mismatches were observed for D nucleosides involved in
formation of duplexes prone to form A-type helixes. LNA D and LNA
2'-OMe-D are expected to have increased stabilization and mismatch
discrimination. LNA can be used in combination with 2-thio-T for
construction of selectively binding complementary oligonucleotides.
Taking into consideration the extremely high stability of LNA:LNA
duplexes, this approach might be very useful for constructing of
LNA containing capture probes and antisense reagents including
drugs.
[0476] 2-Aminopurine (2-AP) is a fluorescent nucleobase (emission
at 363 mn), which is useful for probing nucleic acids structure and
dynamics and for hybridizing with thymine in Watson-crick geometry.
LNA-I, LNA-D, and/or LNA-2AP may be used in the nucleic acids of
the present invention, e.g., to increase the priming efficiency of
DNA oligonucleotides in PCR experiments and to construct
selectively binding complementary agents.
Synthesis of LNA-I
[0477] The convergent method adopted for preparation of LNA
monomers (Koshkin et al., J. Org. Chem. 66:8504, 2001) was
successfully applied for syntheses of the modified LNA nucleotides
1-3. The synthetic route to LNA-I phosphoramidite 11 is depicted in
the scheme below. The previously described 4-C-branched furanose 4
(Koshkin et al., supra) was used as a glycosyl donor in coupling
reaction with silylated hypoxantine by the method of Vorbruggen et
al. (Vorbruggen et al., Chem. Ber. 114:1234, 1981; Vorbruggen et
al., Chem. Ber. 114:1256, 1981; and Vorbrugen, Acta Biochim. Pol.,
43:25, 1996). The reaction resulted in high yield formation of
desired .beta.-configurated nucleoside derivative 5. However,
analogous to the coupling reaction of 4 with protected guanines,
the formation of undesired N-7 isomer (ratio of N-9/N-7=4:1) was
also detected. The mixture of the isomers was used for the ring
closing reaction and protected LNA nucleoside 6 was isolated in 68%
yield as a crystalline compound. The correct structure of the
isolated isomer was confirmed later by chemical conversion of LNA-I
into LNA-A nucleoside (vide infra). Deprotection of the 5'-hydroxy
group of 6 was accomplished via two-step procedure developed for
the syntheses of other LNA nucleosides (Koshkin et al., supra).
First, 5'-O-mesyl group was displaced by sodium benzoate to produce
nucleoside 7. The latter was converted into 5'-hydroxy derivative 8
after saponification of the 5'-benzoate. Direct removal of the
3'-O-benzyl group from compound 8 was unsuccessful under the
conditions tested due to a solubility problem. Therefore, compound
8 was converted to DMT-protected nucleoside 9 prior to catalytic
debenzylation of the 3'-O-hydroxy group. The phosphoramidite 11 was
finally afforded via standard phosphitylation (McBride et al.,
Tetrahedron Lett. 24:245, 1983; Sinha et al., Tetrahedron Lett.
24:5843, 1983; and Sinha et al., Nucleic Acids Res. 12:4539, 1984)
of the nucleoside 10. In order to verify the correct orientation of
the glycoside bond (N-9 isomer) in synthesized LNA-I nucleoside,
compound 7 was successfully converted into the known LNA-A
derivative 13 (Koshkin et al., supra) (Scheme 2). Thus, a treatment
of 7 with phosphoryl chloride according to the procedure reported
by Martin (Helv. Chim. Acta 78:486, 1995) resulted in a high yield
formation of 6-chloropurine derivative 12. The adenosine derivative
13 was derived from 12 after reaction with ammonia.
Exemplary Analytical Data
[0478] Data for compound 8 includes the following: mp
302-305.degree. C. (dec). .sup.1H NMR (DMSO-d.sub.6): .delta. 8.16,
(s, 1H), 8.06 (s, 1H), 7.30-7.20 (m, 5H), 5.95 (s, 1H), 4.69 (s,
1H), 4.63 (s, 2H), 4.28 (s, 1H), 3.95 (d, J=7.7, 1H), 3.83 (m, 3H).
.sup.13C NMR (DMSO-d.sub.6): .delta. 156.6, 147.3, 146.1, 137.9,
137.3, 128.3, 127.6, 127.5, 124.5, 88.2, 85.4, 77.0, 72.1, 71.3,
56.7. MALDI-MS m/z: (M+H).sup.+. Anal. Calcd for
C.sub.18H.sub.18N.sub.4O.sub.5.5/12 H.sub.2O: C, 57,21; H, 5.02; N,
14.82. Found: C, 57,47; H, 4.95; N, 14.17.
[0479] Analysis of compound 11 indicated that .sup.31P NMR
(DMSO-d.sub.6): .delta. 148.90. ##STR22## Exemplary Experimental
Conditions
(1R,3R,4R,7S)-7-(2-Cyanoethoxy(diisopropylamino)phosphinoxy)-1-(4,4'-dimet-
hoxytrityloxymethyl)-3-(hyroxanthin-9-yl)-dioxabicyclo[2.2.1]heptane
(11)
[0480] Compound 10 (530 mg, 0.90 mmol, described previously, (see
for example, WO 00/56746) was dissolved in anhydrous EtOAc (5 mL)
and cooled in an ice-bath. DIPEA (0.47 mL, 2.7 mmol) and (250
.mu.L, 1.1 mmol) were added under intensive stirring. Formation of
insoluble material was observed, and CH.sub.2Cl.sub.2 (3 mL) was
added to produce a clear solution. More
2-cyanoethyl-N,N-diisopropylphosphoramidochloridite (200 .mu.L,
0.88 mmol) was added after one hour, and the mixture was stirred
overnight. EtOAc (30 mL) was added, the mixture was washed with
sat. NaHCO.sub.3 (2.times.50 mL), brine (50 mL), dried
(Na.sub.2SO.sub.4), and concentrated to a solid residue.
Purification by silica gel HPLC (1-5% MeOH/CH.sub.2Cl.sub.2 v/v,
containing 0.1% of pyridine) gave compound 11 (495 mg, 75%) as a
white solid material. .sup.31P NMR (DMSO-d.sub.6): .delta.
148.90.
Synthesis of LNA-D
[0481] Taking advantage of a high availability of the natural
deoxy- and riboguanosines, a number of effective methods were
developed for their conversion into 2,6-diaminopurine (D)
nucleosides (Fathi et al., Tetrahedron Lett. 31:319, 1990; Gryaznov
et al., Tetrahedron Lett., 35:2489, 1994; and Lakshman et al., Org.
Lett., 2:927, 2000). However, the production of LNA-G nucleoside is
a multi-step synthetic procedure. ##STR23##
[0482] For the synthesis of LNA-D nucleoside, a novel synthesis
method was developed that employed a common convergent scheme,
related to the strategy used earlier for the synthesis of its
anhydrohexitol counterpart (Boudou et al., Nucleic Acids Res.
27:1450, 1999). In particular, a properly protected carbohydride
unit was conjugated with 6-chloro-2-aminopurine to give a stable
6-chloro intermediate derivative (scheme below) which was further
converted into desired diaminopurine nucleoside. ##STR24##
[0483] Thus, it was shown that glycosylation of
2-chloro-6-aminopurine with compound 4 resulted in highly
stereoselective formation of the nucleoside derivative 14. To
promote the ring closing reaction, a solution of 14 in aqueous
1,4-dioxane was treated with 10-fold excess of sodium ##STR25##
##STR26## hydroxide to give bicyclic compound 15 in 87% yield. The
standard reaction with sodium benzoate in hot DMF was then
successfully applied for displacement of 5'-mesylate of 15.
Notably, this reaction proceeded in very selective manner and no
side products originating from the modification of the nucleobase
were detected. The desired compound 16 was precipitated from the
reaction mixture after addition of water. In order to introduce the
6-amino group into nucleobase structure, intermediate 6-azido
derivative 17 was synthesized via reaction of 16 with sodium azide.
The nucleoside derivative 18 was isolated as a crystalline compound
after saponification of the 5'-benzoate of 17. Subsequent catalytic
hydrogenation of 18 on palladium hydroxide resulted in simultaneous
reduction of 6-azido and 3'-benzyl groups to give LNA-D diol 19
after crystallization from water. By the use of peracelation
method, 2- and 6-amino groups of 19 were benzoylated at the next
step to give the nucleobase protected derivative 20, which was in
the standard way further converted into phosphoramidite monomer 21.
This phosphoramidite has been produced in a quantity of 0.5 grams.
Exemplary Analytical Data
[0484] Data for compound 19 includes the following: .sup.1H NMR
(DMSO-d.sub.6): .delta. 7.81 (s, 1H), 6.78 (br s, 2H), 5.91 (br s,
2H), 5.71 (s, 1H), 5.66 (br s, 1H), 5.04 (br s, 1H), 4.31 (s, 1H),
4.20 (s, 1 H), 3.90 (d, J=7.7 Hz, 1 H), 3.77 (m, 2H), 3.73 (d,
J=7.7 Hz, 1 H). .sup.13C NMR (DMSO-d.sub.6): .delta. 160.5, 156.2,
150.9, 134.2, 113.4, 88.3, 85.0, 79.3, 71.5, 70.0, 56.8. MALDI-MS
m/z: 295.0 (M+H).sup.+. Anal. Calcd for
C.sub.11H.sub.14N.sub.6O.sub.4.1.5 H.sub.2O: C, 41,12; H, 5.33; N,
26.15. Found: C, 41.24; H, 5.19; N, 25.80.
[0485] The .sup.31P NMR (DMSO-d.sub.6) spectrum for compound 24
contained signals at .delta. 149.19 and 148.98.
[0486] Data for compound 23 includes the following: crystallized
from MeOH. mp. 227.5-229.degree. C. (dec). .sup.1H NMR
(DMSO-d.sub.6): .delta. 8.60 (s, 1H), 8.15 (s, 1H), 6.64 (br s,
2H), 5.82 (s, 1H), 5.71 (br s, 1H), 5.04 (br s, 1H), 4.40 (s, 1H),
4.21 (s, lH), 3.92 (d, J=7.7 Hz, 1H), 3.79 (m, 2H), 3.75 (d, J=7.7
Hz, 1H). .sup.13CNMR(DMSO-d.sub.6): .delta. 160.6, 152.0, 149.4,
139.3, 127.1, 88.6, 84.8, 79.1, 71.6, 70.2, 56.8. MALDI-MS m/z:
334.7 (M+H).sup.+.
[0487] For protected compound 23, the .sup.31P NMR (DMSO-d.sub.6)
spectrum has a signal at 148.93 and 148.85.
Exemplary Experimental Conditions
(1S,3R,4R,7S)-3-(2-amino-6-chloropurin-9-yl)-7-benzyloxy-1-methanesulfonox-
ymethyl-2,5-dioxabicyclo[2.2.1]heptane (15)
[0488] To a solution of compound 14 (40 g, 64.5 mmol) in
1,4-dioxane (300 mL) was added 1 M NaOH (350 mL). The mixture was
stirred for one hour at 0.degree. C., neutralized with AcOH (40
mL), and washed with CH.sub.2Cl.sub.2 (2.times.200 mL). The
combined organic layers were dried (Na.sub.2SO.sub.4) and
concentrated under reduced pressure. The solid residue was purified
by silica gel flash chromatography to give compound 15 (27.1 g,
87%) as a white solid material. .sup.1H NMR (CDCl.sub.3): .delta.
7.84 (s, 1H), 7.32-7.26 (m, 5H), 5.91 (s, 1H), 4.73 (s, 1H), 4.66
(d, J=11.7 Hz, 1H), 4.61 (d, J=11.7 Hz, 1H), 4.59 (s, 2H), 4.31 (s,
1H), 4.18 (d, J=8.0 Hz, 2H), 3.99 (d, J=7.9 Hz, 1H), 3.05 (s, 3H).
.sup.13C NMR (CDCl.sub.3) .delta. 158.9, 152.2, 151.4, 139.1,
136.4, 128.4, 128.2, 127.7, 125.3, 86.5, 85.2, 77.2, 76.8, 72.4,
72.1, 64.0, 37.7. MALDI-MS m/z 482.1 [M+H].sup.+.
(1S,3R,4R,7S)-3-(2-amino-6-chloropurin-9-yl)-1-benzoyloxymethyl-7-benzylox-
y-2,5-dioxabicyclo[2.2.1]heptane (16)
[0489] A mixture of sodium benzoate (7.78 g, 54 mmol) and compound
15 13 g, 27 mmol) was suspended in anhydrous DMF (150 mL) and
stirred for two hours at 105.degree. C. Ice-cold water (500 mL) was
added to the solution under intensive stirring. The precipitate was
filtered off, washed with water, and dried in vacuo. The
intermediate product 16 (8 g) was used for ext step without further
purification. Analytical sample was additionally purified by silica
gel HPLC (0-2% MeOH/CH.sub.2Cl.sub.2 v/v). .sup.1H NMR (CDCl.sub.3)
.delta. 7.98-7.95 (m, 2H), 7.79 (s, 1H), 7.62-7.58 (m, 1H),
7.48-7.44 (m, 2H), 7.24 (m, 5H), 5.93 (s, 1H), 4.80 (d, J=12.6 Hz,
1H), 4.77 (s, 1H), 4.67 (d, J=11.9 Hz, 1H), 4.65 (d, J=12.6 Hz,
1H), 4.56 (d, J=11.9 Hz, 1H), 4.27 (d, J=8.0 Hz, 1H), 4.25 (s, 1H),
4.08 (d, J=7.9 Hz, 1H). .sup.13C NMR (CDCl.sub.3) .delta. 165.7,
158.8, 152.1, 151.3, 138.9, 136.4, 133.4, 129.4, 129.0, 128.5,
128.4, 128.2, 127.6, 125.4, 86.4, 85.7, 77.2, 76.7, 72.5, 72.3,
59.5. MALDI-MS m/z 508.0 [M+H].sup.+.
(1S,3R,4R,7S)-3-(2-amino-6-azidopurin-9-yl)-7-benzyloxy-1-hydroxymethyl-2,-
5-dioxabicyclo[2.2.1]heptane (18)
[0490] All the amount of compound 16 from the previous experiment
was dissolved in anhydrous DMSO (100 mL) and NaN.sub.3 (5.4 g, 83
mmol) was added. The mixture was stirred for two hours at
100.degree. C. and cooled to room temperature. Water (400 ml) was
added, and the mixture was stirred for 30 minutes at 0.degree. C.
(ice-bath) to give a yellowish precipitate 17. The precipitate was
filtered off, washed with water, and dissolved in THF (25 mL). 2M
NaOH (30 mL) was then added to the solution, and after 15 minutes
of stirring the mixture was neutralized with AcOH (4 mL). The
mixture was concentrated to approximately 1/2 of its volume and
cooled in an ice-bath. The titel compound was collected by
filtration, washed with cold water, and dried in vacuo.
[0491] Yield: 8.8 g (79% from 15). .sup.1H NMR (DMSO-d.sub.6)
.delta. 8.53 (br s, 2H), 8.23 (s, 1H), 7.31-7.26 (m, 5H), 6.00 (s,
1H), 5.26 (t, J=5.7 Hz, 1 H), 4.76 (s, 1H), 4.64 (s, 1H), 4.31 (s,
1H), 3.99 (d, J=7.9 Hz, 1H), 3.88-3.85 (m, 3H). .sup.13C NMR
(DMSO-d.sub.6) .delta. 146.0, 144.0, 143.8, 137.9, 137.0, 128.3,
127.7, 127.6, 112.3, 88.3, 85.6, 77.1, 77.0, 72.2, 71.4, 56.8.
MALDI-MS m/z 384.7 [M+H].sup.+ for 2,6-diaminopurine product, 410.5
[M+H].sup.+. Anal. Calcd for C.sub.18H.sub.18N.sub.8O.sub.4: C,
52.68; H, 4.42; N, 27.30. Found: C, 52.62; H, 4.36; N, 26.94.
(1S,3R,4R,7S)-3-(2,6-Diaminopurin-9-yl)-7-hydroxy-1-hydroxymethyl-2,5-diox-
abicyclo[2.2.1]heptane (19)
[0492] To a suspension of compound 18 (8 g, 19.5 mmol) in MeOH (100
mL) were added Pd(OH).sub.2/C (20%, 5.5 g) and HCO.sub.2NH.sub.4
(3g). The mixture was refluxed for 30 minutes and more
HCO.sub.2NH.sub.4 (3g) was added. After refluxing for further 30
minutes, the catalyst was filtered off and washed with boiling
MeOH/H.sub.2O (1/1 v/v, 200 mL). The combined filtrates were
concentrated to approximately 100 mL and cooled in an ice-bath. The
precipitate was filtered off, washed with ice-cold H.sub.2O and
dried in vacuo to give compound 19 (5.4 g, 94%) as a white solid
material. .sup.1H NMR (DMSO-d.sub.6): .delta. 7.81 (s, 1H), 6.78
(br s, 2H), 5.91 (br s, 2H), 5.71 (s, 1H), 5.66 (br s, 1H), 5.04
(br s, 1H), 4.31 (s, 1H), 4.20 (s, 1H), 3.90 (d, J=7.7 Hz, 1H),
3.77 (m, 2H), 3.73 (d, J=7.7 Hz, 1 H). .sup.13C NMR (DMSO-d.sub.6)
.delta. 160.5, 156.2, 150.9, 134.2, 113.4, 88.3, 85.0, 79.3, 71.5,
70.0, 56.8. MALDI-MS m/z: 295.0 (M+H).sup.+. Anal. Calcd for
C.sub.11H.sub.14N.sub.6O.sub.4.1.5 H.sub.2O: C, 41,12; H, 5.33; N,
26.15. Found: C, 41.24; H, 5.19; N, 25.80.
(1S,3R,4R,7S)-3-(2,6-Di-(N-benzoylamino)purin-9-yl)-7-hydroxy-1-hydroxymet-
hyl-2,5-dioxabicyclo[2.2.1]heptane (20)
[0493] A solution of compound 19 (0.5 g, 1.7 mmol) in anhydrous
pyridine (20 mL) was cooled in an ice-bath and benzoyl chloride
(1.5 mL, 12.9 mmol) was added under intensive stirring. The mixture
was allowed to warm to room temperature and was stirred overnight.
Ethanol (20 mL) and 2 M NaOH (20 mL) were added, and the mixture
was stirred for an additional hour. EtOAc (75 mL) was added and the
solution was washed with water (2.times.50 mL). The combined
aqueous layers were washed with CH.sub.2Cl.sub.2 (2.times.50 mL).
The combined organic phases were dried (Na.sub.2SO.sub.4) and
concentrated under reduced pressure to a solid residue. The residue
was suspended in Et.sub.2O (75 mL, under refluxing for 30 minutes)
and cooled in an ice-bath. The product was collected by filtration,
washed with cold Et.sub.2O, and dried in vacuo to give compound 20
(530 mg, 62%) as a slightly yellow solid material.
(1R,3R,4R,
7S)-3-(2,6-Di-(N-benzoylamino)purin-9-yl)-1-(4,4'-dimethoxytrit-
yloxymethyl)-7-hydroxy-2,5-dioxabicyclo[2.2.1]heptane (21)
[0494] Compound 20 (530 mg, 1.06 mmol) was co-evaporated with
anhydrous pyridine (2.times.20 mL) and dissolved in anhydrous
piridine (10 mL). DMT-Cl (600 mg, 1.77 mmol) was added, and the
solution was stirred overnight at rt. The mixture was diluted with
EtOAc (100 mL), washed with saturated NaHCO.sub.3 (100 mL) and
brine (50 mL). Organic layer was dried over Na.sub.2SO.sub.4 and
concentrated under reduced pressure. Purification by silica gel
HPLC (20-100% EtOAc/hexane v/v, containing 0.1% of pyridine) gave
compound 21 (670 mg, 79%) as a white solid material.
[0495] .sup.1H NMR (CD.sub.3OD): .delta. 8.41 (s, 1H), 8.15-8.03
(m, 4H), 7.71-7.22 (m, 15H), 6.92-6.86 (m, 4H), 6.23 (s, 1H), 4.77
(s, 1H), 4.62 (s, 1H), 4.03 (d, J=7.9 Hz, 1H), 3.99 (d, J=7.9 Hz,
1H), 3.79 (s, 6H), 3.67 (d, J=10.9 Hz, 1H), 3.54 (d, J=10.8 Hz,
1H),. MALDI-MS m/z: 826 (M+Na).sup.+. Anal. Calcd for
C.sub.46H.sub.40N.sub.6O.sub.8.H.sub.2O: C, 67.14; H, 5.14; N,
10.21. Found: C, 67.24; H, 4.97; N, 10.11.
(1R,3R,4R,7S)-7-(2-Cyanoethoxy(diisopropylamino)phosphinoxy)-3-(2,6-di-(N--
benzoylamino)purin-9-yl)-1-(4,4'-dimethoxytrityloxymethyl)-2,5-dioxabicycl-
o[2.2.1]heptane (21)
[0496] To a stirred solution of compound 20 (640 mg, 0.8 mmol) in
anhydrous DMF (5 mL) were added DIPEA (420 L, 2.4 mmol) and
2-cyanoethyl-N,N-diisopropylphosphoramidochloridite (300 .mu.L, 1.2
mmol). The mixture was stirred for 1.5 hours at room temperature,
diluted with EtOAc (100 mL), and washed with saturated NaHCO.sub.3
(2.times.100 mL) and brine (50 mL). Organic layer was dried
(Na.sub.2SO.sub.4) and concentrated under reduced pressure to give
a yellow solid residue. Purification by silica gel HPLC (20-100%
EtOAc/hexene containing 0.1% of pyridine) gave compound 21 (590 mg,
74%) as a white solid material. .sup.31P NMR (DMSO-d.sub.6) .delta.
149.19, 148.98.
Synthesis of Pac-Protected LNA-D Amidite
[0497] The following scheme illustrates a method for synthesizing a
Pac-protected version of LNA-D amidite. ##STR27## Compound 17
[0498] Compound 7 (1 g, 3.39 mmol) was co-evaporated with anhydrous
DMF (2.times.10 mL) and dissolved in DMF (10 mL). Imidazole (0.69
g, 10.17 mmol) and 1,3-dichloro-1,1,3,3-tetraisopropyldisiloxane
(1.4 mL, 4.37 mmol) were added, and the mixture was stirred
overnight. H.sub.2O (100 mL) was added under intensive stirring to
precipitate nucleoside material. The precipitate was filtered off,
washed with H.sub.2O, and dried in vacuo. Crystallization from
ethanol gave compound 17 (1.15 g, 63%) as a white solid material.
MALDI-MS: m/z 537.3 (M+H).sup.+.
Compound 18.
[0499] To a solution of compound 17 (1.15 g, 2.14 mmol) in
anhydrous pyridine (5 mL) was a dded phenoxyacetic anhydride (2 g,
7.0 mmol) and the mixture was stirred for four hours. EtOAc (100
mL) was added, and the solution was washed with sat. NaHCO.sub.3
(2.times.100 mL), brine (50 mL), dried (Na.sub.2SO.sub.4), and
concentrated to a solid residue. Purific ation by silica gel HPLC
(50-100% v/v EtOAc/hexane) gave compound 18 (1.65 g, 95%) as a
white solid material. MALDI-MS: m/z 827.3 (M+Na).sup.+.
(1S,3R,4R,7S)-3-(2,6-Di-(N-phenoxyacetylamino)purin-9-yl)-7-hydroxy-1-hydr-
oxymethyl-2,5-dioxabicyclo[2.2.1]heptane (19)
[0500] To a solution of compound 18 (0.96 g, 1.19 mmol) in
anhydrous THF (10 mL) was added Et.sub.3N.3HF (0.2 mL) and the
mixture was stirred overnight at room temperature. The formed
precipitate was collected by filtration and washed with THF (5 mL)
and pentane (5 mL) to give after drying compound 19 (650 mg, 97%)
as a white solid material. MALDI-MS: m/z 563.0 (M+H).sup.+.
(1R,3R,4R,7S)-3-(2,6-Di-(N-phenoxyacetylamino)-purin-9-yl)-1-(4,4'-dimetho-
xytrityloxymethyl)-7-hydroxy-2,5-dioxabicyclo[2.2.1]heptane
(20)
[0501] To a solution of compound 19 (650 mg, 1.15 mmol) was added
DMT-Cl (500 mg, 1.48 mmol). The mixture was stirred for five hours,
diluted with EtOAc (100 mL), and washed with sat. NaHCO.sub.3
(2.times.100 mL). The organic layer was dried and concentrated to a
solid residue. Crystallization from EtOAc gave compound 20 (810 mg,
81%) as a white solid material.
(1R,3R,4R,7S)-7-(2-Cyanoethoxy(diisopropylaniino)phosphinoxy)-3-(2,6-di-(N-
-phenoxyacetylamino)-purin-9-yl)-1-(4,4'-dimethoxytrityloxymethyl)-2,5-dio-
xabicyclo[2.2.1]heptane (21)
[0502] To a solution of compound 20 (800 mg, 0.92 mmol) in
anhydrous DMF (10 mL) were added 0.75 M solution of DCI in EtOAc
(0.7 mL) and 2-cyanoethyl tetraisopropylphosphorodiamidite (0.32
mL, 1.01 mmol). The mixture was stirred at room temperature
overnight and EtOAc (75 mL) was added. The resulting solution was
washed with sat. NaHCO.sub.3 and brine, dried and concentrated to a
solid residue. Purification by silica gel HPLC (30-100% v/v
EtOAc/hexane, containing 0.1% of pyridine) gave phosphoramidite 21
(550 mg, 56%) as a white solid material.
[0503] .sup.31P NMR (DMSO-d.sub.6): .delta. 149.08, 148.8.
Synthesis of LNA-2AP
[0504] The intermediate derivative 16 was also used for the
synthesis of LNA-2AP nucleoside. First, the 5'-O-benzoyl group of
16 was hydrolyzed by aqueous sodium hydroxide to give the
nucleoside derivative 22 in 72% yield. The conditions of catalytic
transfer hydrogenation usually used for removal of the 3'-O-benzyl
group turned out to be suitable for complete dechlorination of the
nucleobase of 22. Thus, totally deprotected LNA-2AP nucleoside 23
was afforded in high yield after refluxing of the methanolic
solution of 22 in the presence of paladium hydroxide and ammonium
formate. The 2-amine of 23 was selectively protected with an
amidine group after treatment with N,N-dimethylformamide dimethyl
acetal. The resulting diol 24 was then 5'-O-DMT protected and
3'-O-phosphitylated to yield the desired phosphoramidite LNA-2AP
monomer 25 (McBride et al., J. Am. Chem. Soc. 108:2040, 1986).
##STR28## Exemplary Experimental Conditions
(1S,3R,4R,7S)-3-(2-amino-6-chloropurin-9-yl)-7-benzyloxy-1-hydroxymethyl-2-
,5-dioxabicyclo[2.2.1]heptane (22)
[0505] To a solution of compound 16 (3 g, 5.92 mmol) in 1,4-dioxane
(20 mL) was added 2 M NaOH (20 mL) and the mixture was stirred for
one hour. AcOH (3 mL) was added, and the solvents were removed
under reduced pressure. The solid residue was re-dissolved in 20%
MeOH/EtAc (50 mL), washed with NaHCO.sub.3 (2.times.50 mL), dried
(Na.sub.2SO.sub.4) and concentrated to a solid residue. The residue
was purified by silica gel column chromatography (1-2% MeOH/EtAc
v/v) to give compound 22 (1.72 g, 72%) as a white solid
material.
(1S,3R,4R,7S)-3-(2-aminopurin-9-yl)-7-hydroxy-1-hydroxymethyl-2,5-dioxabic-
yclo[2.2.1]heptane (23)
[0506] To a solution of compound 22 (0.72 g, 1.79 mmol) in
MeOH/dioxane (1/1 v/v) were added Pd(OH).sub.2/C (20%, 0.5 g) and
HCO.sub.2NH.sub.4 (1.5 g, 23.8 mmol). The mixture was stirred under
refluxing for 30 minutes and cooled to room temperature. The
catalyst was filtered off and washed with MeOH. The combined
filtrates were concentrated under reduced pressure to yield
compound 23 (0.44 g, 89%) as a white solid material. Analytical
sample was crystallized from MeOH. mp. 227.5-229.degree. C. (dec).
.sup.1H NMR (DMSO-d.sub.6): .delta. 8.60 (s, 1H), 8.15 (s, 1H),
6.64 (br s, 2H), 5.82 (s, 1H), 5.71 (br s, 1H), 5.04 (br s, 1H),
4.40 (s, 1H), 4.21 (s, 1H), 3.92 (d, J=7.7 Hz, 1H), 3.79 (m, 2H),
3.75 (d, J=7.7 Hz, 1H). .sup.13C NMR (DMSO-d.sub.6): .delta. 160.6,
152.0, 149.4, 139.3, 127.1, 88.6, 84.8, 79.1, 71.6, 70.2, 56.8.
(1R,3R,4R,7S)-1-(4,4'-dimethoxytrityloxymethyl)-3-(2-N-(dimethylaminomethy-
lidene)aminopurin-9-yl)-7-hydroxy-2,5-dioxabicyclo[2.2.1]heptane
(5' DMT protected version of 24)
[0507] Compound 23 (0.4 g, 1.43 mmol) was co-evaporated with
anhydrous DMF (10 mL) and dissolved in DMF (15 mL).
N,N-Dimethylformamide dimethylacetal (0.8 mL) was added and the
solution was stirred for three days at room temperature. Water (5
mL) was added, and the solvents were removed under reduced
pressure. The solid residue was co-evaporated with anhydrous
pyridine (2.times.10 mL) and dissolved in anhydrous pyridine (5
mL). DMT-Cl (0.7 g, 2.1 mmol) was added, the solution was stirred
for four hours, diluted with EtOAc (50 mL), and washed with
NaHCO.sub.3 (2.times.50 mL) and brine (50 mL). Organic layer was
dried (Na.sub.2SO.sub.4) and concentrated to a yellow solid
residue. Purification by silica gel HPLC (1-6%
MeOH/CH.sub.2Cl.sub.2 v/v, containing 0.1% of pyridine) gave the 5'
DMT protected version of compound 24 (0.87 g, 87%) as a white solid
material.
(1R,3R,4R,7S)-7-(2-Cyanoethoxy(diisopropylamiino)phosphinoxy)-1-(4,4'-dime-
thoxytrityloxymethyl)-3-(2-N-(dimethylaminomethylidene)aminopurin-9-yl)-2,-
5-dioxabicyclo[2.2.1]heptane (25)
[0508] The 5' DMT protected version of compound 24 (0.5 g, 0.79
mmol) was dissolved in anhydrous DMF (10 mL) and DIPEA (350 .mu.L)
and 2-cyanoethyl-N,N-diisopropylphosphoramidochloridite (250 .mu.L)
were added. The mixture was stirred for one hour, diluted with
EtOAc (50 mL), washed with saturated NaHCO.sub.3 (2.times.100 mL)
and brine (50 mL), dried (Na.sub.2SO.sub.4), and concentrated to a
solid residue. Purification by silica gel HPLC (0-3%
MeOH/CH.sub.2Cl.sub.2 v/v, containing 0.1% of pyridine) gave
compound 25 (0.42 g, 64%) as a white solid material. .sup.31P NMR
(DMSO-d.sub.6) .delta. 148.93, 148.85.
Synthesis of Oligomers
[0509] Along with previously described LNA phosphoramidites
(Koshkin et al., supra; and Pedersen et al., Synthesis p. 802,
2002), the phosphoramidite monomers 11, 21, and 25 were
successfully applied for automated oligonucleotide synthesis
(Caruthers, Acc. Chem. Res. 24:278, 1991) to produce the LNA
oligomers depicted in Table 9. Oligonucleotide syntheses were
performed on a 0.2 .mu.mol scale using an Expedite synthesizer
(Applied Biosystems) with the recommended commercial reagents.
Standard protocols for DNA synthesis were used, except that the
coupling time was extended to 5 minutes and the oxidation time was
extended to 30 second cycles. Deprotection of the oligonucleotides
were performed by treatment with concentrated ammonium hydroxide
for five hours at 60.degree. C. After that, the LNA-D containing
oligonucleotides were additionally treated with AMA (concentrated
ammonium hydroxide/40% aqueous MeNH.sub.2; 1/1 v/v) for one hour at
60.degree. C. All the synthesized oligonucleotides were purified by
RP-HPLC, and their structures were verified by MALDI-TOF mass
spectra.
[0510] The complexing properties of oligonucleotides containing new
LNA monomers 1-3 were assessed. Comparative binding data from an
8-mer LNA sequence is shown in Table 9 as the melting temperatures
against complementary single stranded DNA. An exemplary sequence
for this comparison is GACATAGG, which is the central part of a
capture probe used for SNP detection in GluclVS7-7asA (A:a mismatch
position). The thermal stabilities of reference DNA duplexes
(entries 1-7, Table 9) can be directly compared with their LNA
counterparts (entries 8-14). The hybridizing ability of all LNA
8-mers is superior to that of isosequencial DNA oligonucleotides.
The average melting temperatures of DNA and LNA 8-mers against
complementary DNAs typically differ by about 40.degree. C. The
replacement of one internal LNA-A nucleotide by LNA-D resulted in
the further stabilization of the complementary duplex (i.e.,
compare entries 8 and 11) by 6.2.degree. C. Interestingly, the
analogous replacement made in an DNA octamer destabilized the
corresponding duplex by 0.5.degree. C. (i.e., entries 1 and 4).
D-nucleosides may facilitate a B to A helix transition, because the
A-type structure of an LNA:DNA duplex is more suitable for
effective D:t pairing. This stabilizing effect is expected to be
even more pronounced for LNA:RNA duplexes, which can be very useful
for construction of antisense or other gene-silencing reagents. The
mismatch discrimination ability of the D-nucleoside was also
studied (entry 11). In comparison to LNA-A (entry 8) D-nucleoside
demonstrated remarkable increased mismatch discrimination against
DNA-g nucleoside. TABLE-US-00027 TABLE 9 Melting temperatures (Tm)
of the complementary DNA-DNA and LNA-DNA duplexes..sup.a Oligo- Tm
(.+-. 0.5.degree. C.) of the duplexes with nucleotide complementary
deoxynucleotide Entry structure 3'-ctgtatcc 3'-ctgaatcc 3'-ctggatcc
3'-ctgcatcc 1 5'-gacatagg 23.8 <10 <10 <10 2 5'-gacttagg
<10 22.6 <10 <10 3 5'-gacgtagg <10 <10 <10 25.0 4
5'-gacdtagg 23.3 <10 <10 <10 5 5'-gdcdtdgg 33.4 <10
<10 17.7 6 5'-gacitagg <10 <10 <10 20.9 7 5'-gacxtagg
<10 <10 <10 <10 8 5'-GACATAGG 61.6 38.2 43.4 40.6 9
5'-GACTTAGG 28.0 60.7 36.4 23.5 10 5'-GACGTAGG 55.0 32.sup.b
41.sup.b 70.9 11 5'-GACDTAGG 67.8 42.2 41.4 52.4 12 5'-GDCDTDGG
78.3 55.9 54.7 63.8 13 5'-GACITAGG 53.1 48.2 43.0 59.9 14
5'-GACXTAGG 60.8 45.5 44.0 53.9 .sup.aThe melting temperatures (Tm
values) were obtained as a maxima of the first derivative of the
corresponding melting curves (optical density at 260 nm versus
temperature). Concentration of the duplexes: 2.5 .mu.M. Buffer: 0.1
M NaCl; 10 mM Na-phosphate (pH 7.0); 1 mM EDTA. .sup.bLow
cooperativity of transitions (accuracy .+-. 1.degree. C.). Modified
monomers (LNA are in CAPITALs): I = inosine; D = 2,6-diaminopurine;
X = 2-aminopurine.
[0511] TABLE-US-00028 TABLE 10 The mismatch discrimination effect
of the chimeric LNA-DNA 12-mers containing LNA-A or LNA-D
nucleosides against the point of mutation (SEQ ID NOs:). Tm (.+-.
0.5.degree. C.) of the comple- The structure mentary duplexes with
DNA oligo- of LNA-DNA nucleotides (.DELTA. Tm between singly
oligonucleotide mismatched and perfect duplexes HNFas128A-2
caacatcccaca caacaacccaca tGtggGATGttg 61.0 45.9 (-15.1)
tGtggGDTGttg 65.5 49.7 (-15.8) Gluc53as-A aagagtccagtg aagaggccagtg
cAmCtgGAmCtctt 61.5 50.6 (-10.9) cAmCtgGDmCtctt 65.3 45.4 (-19.9)
.sup.aConcentration of duplexes: 2 .mu.M; Buffer: see Table 9.
[0512] TABLE-US-00029 TABLE 11 Melting temperatures of the LNA and
DNA duplexes (LNAs are CAPITALIZED) containing 2-thio-deoxy-
thymidine (s) and diaminopurineriboside (d). See Table 9 for
experimental conditions. oligo T.sub.m (.+-. 0.5.degree. C.) of
complementary duplexes with structure 3'-ctgtatcc 3'-ctgsatcc
3'-CTGsATCC 3'-CTGtATCC 3'-CTGTATCC 5'-gacatagg 23.8 27 54.4 49.4
54.6 5'-gacdtagg 23.3 <6 45.4 55.2 60.5 5'-GACATAGG 61.6 64.6
87* 88 88 5'-GACDTAGG 67.8 59.4 80 >90 >90 *T.sub.m values in
the shaded cells were measured in low salt buffers (1 mM
Na-phosphate, pH 7.0). Low cooperativity of the transitions was
observed (accuracy .+-. 1.5.degree. C.)
EXAMPLE 22
Exemplary Methods for Synthesizing LNA-PyrroloPyr-SBC-C
[0513] The furanopyrimidine phosphoramidite 6pC used for
incorporation of the pyrroloC analogue can be synthesized from
LNA-U through a series of reactions as illustrated below and in
FIG. 6. Starting from LNA-U 1pC iodine can be introduced on the 5
position on the nucleobase (Chang and Welch, J. Med. Chem. 1963, 6,
428). This compound can be used in a Sonogashira type palladium
coupling reaction (Sonogashira, Tohda and Hagihara, Tetrahedron
Lett. 1975, 4467) resulting in the 5-ethynyl-LNA-U 3pC. The
5-ethynyl-LNA-U 3pC can be transformed to the furanopyrimidie LNA
analogue 4pC when reacted with Cul, and then transformed into the
DMT-protected phosphoramidite 6pC (Woo, Meyer, and Gamper, Nucleic
Acids Res., 1996, 24, 2470). LNA-PyrroloPyr-SBC-C is formed when
6pC or an oligonucleotide containing 6pC is deprotected with
ammonia. ##STR29##
EXAMPLE 23
Exemplary Modified Bases such as Universal Bases
[0514] Desirable modified bases are covalently linked to the
1'-position of a furanosyl ring, particularly to the 1'-position of
a 2',4'-linked furanosyl ring, especially to the 1'-position of a
2'-O,4'-C-methylene-beta-D-ribofuranosyl ring.
[0515] As discussed above, other desirable modified bases contain
one or more carbon alicyclic or carbocyclic aryl units, i.e.
non-aromatic or aromatic cyclic units that contain only carbon
atoms as ring members. Modified bases that contain carbocyclic aryl
groups are generally desirable, particularly a moiety that contains
multiple linked aromatic groups, particularly groups that contain
fused rings. That is, optionally substituted polynuclear aromatic
groups are especially desirable such as optionally substituted
naphthyl, optionally substituted anthracenyl, optionally
substituted phenanthrenyl, optionally substituted pyrenyl,
optionally substituted chrysenyl, optionally substituted
benzanthracenyl, optionally substituted dibenzanthracenyl,
optionally substituted benzopyrenyl, with substituted or
unsubstituted pyrenyl being particularly desirable.
[0516] Without being bound by any theory, it is believed that such
carbon alicyclic and/or carbocyclic aryl modified bases can
increase hydrophobic interaction with neighboring bases of an
oligonucleotide. Those interactions can enhance the stability of a
hybridized oligo pair, without necessity of interactions between
bases of the distinct oligos of the hybridized pair.
[0517] Again without being bound by any theory, it is further
believed that such hydrophobic interactions can be particularly
favored by platelike stacking of neighboring bases, i.e.
intercalation. Such intercalation will be promoted if the base
comprises a moiety with a relatively planar extended structure,
such as provided by an aromatic group, particularly a carbocyclic
aryl group having multiple fused rings. This is indicated by the
increases in T.sub.m values exhibited by oligos having LNA units
with pyrenyl nucleobases relative to comparable oligos having LNA
units with naphthyl nucleobases.
[0518] Modified bases that contain one or more heteroalicyclic or
heteroaromatic groups also are suitable for use in LNA units,
particularly such non-aromatic and aromatic groups that contains
one or more N, O or S atoms as ring members, particularly at least
one sulfur atom, and from 5 to about 8 ring members. Also desirable
is a nucleo base that contains two or more fused rings, where at
least one of the rings is a heteroalicyclic or heteroaromatic group
containing 1, 2, or 3 N, O, or S atoms as ring members.
[0519] In general, desirable are modified bases that contain 2, 3,
4, 5, 6, 7 or 8 fused rings, which may be carbon alicyclic,
heteroalicyclic, carbocyclic aryl and/or heteroaromatic; more
desirably modified bases that contain 3, 4, 5, or 6 fused rings,
which may be carbon alicyclic, heteroalicyclic, carbocyclic aryl
and/or heteroaromatic, and desirably the fused rings are each
aromatic, particularly carbocyclic aryl.
[0520] In some embodiments, the base is not an optionally
substituted oxazole, optionally substituted imidazole, or
optionally substituted isoxazole modified base.
[0521] Other suitable modified bases for use in LNA units in
accordance with the invention include optionally substituted
pyridyloxazole, optionally substituted pyrenylmethylglycerol,
optionally substituted pyrrole, optionally substituted diazole and
optionally substituted triazole groups.
[0522] Desirable modified bases of the present invention when
incorporated into an oligonucleotide containing all LNA units or a
mixture of LNA and DNA or RNA units will exhibit substantially
constant T.sub.m values upon hybridization with a complementary
oligonucleotide, irrespective of the bases present on the
complementary oligonucleotide.
[0523] In some embodiments, one or more of the common RNA or
commonly used derivatives thereof, such as 2'-O-methyl, 2'-fluoro,
2'-allyl, and 2'-O-methoxyethoxy derivatives are combined with at
least one nucleotide with a universal base to generate an
oligonucleotide having between five to 100 nucleotides.
[0524] Modified nucleic acid compounds may comprise a variety of
nucleic acid units e.g. nucleoside and/or nucleotide units. As
discussed above, an LNA nucleic acid unit has a carbon or hetero
alicyclic ring with four to six ring members, e.g. a furanose ring,
or other alicyclic ring structures such as a cyclopentyl,
cycloheptyl, tetrahydropyranyl, oxepanyl, tetrahydrothiophenyl,
pyrrolidinyl, thianyl, thiepanyl, piperidinyl, and the like.
[0525] In an aspect of the invention, at least one ring atom of the
carbon or hetero alicyclic group is taken to form a further cyclic
linkage to thereby provide a multi-cyclic group. The cyclic linkage
may include one or more, typically two atoms, of the carbon or
hetero alicyclic group. The cyclic linkage also may include one or
more atoms that are substituents, but not ring members, of the
carbon or hetero alicyclic group.
[0526] Unless indicated otherwise, an alicyclic group as referred
to herein is inclusive of group having all carbon ring members as
well as groups having one or more hetero atom (e.g. N, O, S or Se)
ring members. The disclosure of the group as a "carbon or hetero
alicyclic group" further indicates that the alicyclic group may
contain all carbon ring members (i.e. a carbon alicyclic) or may
contain one or more hetero atom ring members (i.e. a hetero
alicyclic). Alicyclic groups are understood not to be aromatic, and
typically are fully saturated within the ring (i.e. no endocyclic
multiple bonds).
[0527] Desirably, the alicyclic ring is a hetero alicyclic, i.e.
the alicyclic group has one or more hetero atoms ring members,
typically one or two hetero atom ring members such as O, N, S or
Se, with oxygen being often desirable.
[0528] The one or more cyclic linkages of an alicyclic group may be
comprised completely of carbon atoms, or generally more desirable,
one or more hetero atoms such as O, S, N or Se, desirably oxygen
for at least some embodiments. The cyclic linkage will typically
contain one or two or three hetero atoms, more typically one or two
hetero atoms in a single cyclic linkage.
[0529] The one or more cyclic linkages of a nucleic acid compound
of the invention can have a number of alternative configurations
and/or configurations. For instance, cyclic linkages of nucleic
acid compounds of the invention will include at least one alicyclic
ring atom. The cyclic linkage may be disubstituted to a single
alicyclic atom, or two adjacent or non-adjacent alicyclic ring
atoms may be included in a cyclic linkage. Still further, a cyclic
linkage may include a single alicyclic ring atom, and a further
atom that is a substituent but not a ring member of the alicyclic
group.
[0530] For instance, as discussed above, if the alicyclic group is
a furanosyl-type ring, desirable cyclic linkages include the
following: C-1', C-2'; C-2', C-3'; C-2', C-4'; or a C-2', C-5'
linkage.
[0531] A cyclic linkage will typically comprise, in addition to the
one or more alicyclic group ring atoms, 2 to 6 atoms in addition to
the alicyclic ring members, more typically 3 or 4 atoms in addition
to the alicyclic ring member(s).
[0532] The alicyclic group atoms that are incorporated into a
cyclic linkage are typically carbon atoms, but hetero atoms such as
nitrogen of the alicyclic group also may be incorporated into a
cyclic linkage.
[0533] Specifically desirable modified nucleic acids for use
oligonucleotides of the invention include locked nucleic acids as
disclosed in WO99/14226 (which include bicyclic and tricyclic DNA
or RNA having a 2'-4' or 2'-3' sugar linkages); 2'-deoxy-2'-fluoro
ribonucleotides; 2'-O-methyl ribonucleotides; 2'-O-methoxyethyl
ribonucleotides; peptide nucleic acids; 5-propynyl pyrimidine
ribonucleotides; 7-deazapurine ribonucleotides; 2,6-diaminopurine
ribonucleotides; and 2-thio-pyrimidine ribonucleotides.
[0534] LNA units as disclosed in WO 99/14226 are in general
particularly desirable modified nucleic acids for incorporation
into an oligonucleotide of the invention. Additionally, the nucleic
acids may be modified at either the 3' and/or 5' end by any type of
modification known in the art. For example, either or both ends may
be capped with a protecting group, attached to a flexible linking
group, attached to a reactive group to aid in attachment to the
substrate surface, etc. Desirable LNA units also are disclosed in
WO 0056746, WO 0056748, and WO 0066604.
[0535] Desirable syntheses of pyrene-LNA monomers is shown in the
following Schemes 1 and 2. In the below Schemes 1 and 2, the
compound reference numerals are also referred to in the examples
below. ##STR30## TABLE-US-00030 ##STR31## ##STR32## ##STR33##
Scheme 2 ##STR34## 12-17 Ar a phenyl b 4-fluoro-3-methylphenyl c
1-naphthyl d 1-pyrenyl e 2,4,5-trimethylphenyl
[0536] A wide variety of modified nucleic acids may be employed,
including those that have 2'-modification of hydroxyl, 2'-O-methyl,
2'-fluoro, 2'-trifluoromethyl, 2'-O-(2-methoxyethyl),
2'-O-aminopropyl, 2'-O-dimethylamino-oxyethyl, 2'-O-fluoroethyl or
2'-O-propenyl. The nucleic acid may further include a 3'
modification, desirably where the 2'- and 3'-position of the ribose
group is linked. The nucleic acid also may contain a modification
at the 4'-position, desirably where the 2'- and 4'-positions of the
ribose group are linked such as by a 2'-4' link of --CH.sub.2--S--,
--CH.sub.2--NH--, or --CH.sub.2--NMe- bridge.
[0537] The nucleotide also may have a variety of configurations
such as .alpha.-D-ribo, .beta.-D-xylo, or .alpha.-L-xylo
configuration.
[0538] The intemucleoside linkages of the units of oligos of the
invention may be natural phosphorodiester linkages, or other
linkages such as --O--P(O).sub.2--O--, --O--P(O,S)--O--,
--O--P(S).sub.2--O--, --NR.sup.H--P(O).sub.2--O--,
--O--P(O,NR.sup.H)--O--, --O--PO(R'')--O--, --O--PO(CH.sub.3)--O--,
and --O--PO(NHR.sup.N)--O--, where R.sup.H is selected from
hydrogen and C.sub.1-4-alkyl, and R'' is selected from
C.sub.1-6-alkyl and phenyl.
[0539] A further desirable group of modified nucleic acids for
incorporation into oligomers of the invention include those of the
following formula: ##STR35## wherein X is --O--; B is a modified
base as discussed above e.g. an optionally substituted carbocyclic
aryl such as optionally substituted pyrene or optionally
substituted pyrenylmethylglycerol, or an optionally substituted
heteroalicylic or optionally substituted heteroaromatic such as
optionally substituted pyridyloxazole. Other desirable universal
bases include, pyrrole, diazole or triazole moieties, all of which
may be optionally substituted. R.sup.1* is hydrogen.
[0540] P designates the radical position for an intemucleoside
linkage to a succeeding monomer, or a 5'-terminal group, such
intemucleoside linkage or 5'-terminal group optionally including
the substituent R.sup.5, R.sup.5 being hydrogen or included in an
intemucleoside linkage. R.sup.3* is a group P* which designates an
internucleoside linkage to a preceding monomer, or a 3'-terminal
group. One or two pairs of non-geminal substituents selected from
the present substituents of R.sup.2, R.sup.2*, R.sup.3, R.sup.4*,
may designate a biradical consisting of 1-4 groups/atoms selected
from --C(R.sup.aR.sup.b)--, --C(R.sup.a).dbd.C(R.sup.a)--,
--C(R.sup.a).dbd.N--, --O--, --S--, --SO.sub.2--, --N(R.sup.a)--,
and >C=Z. Z is selected from --O--, --S--, and --N(R.sup.a)--,
and R.sup.a and R.sup.b each is independently selected from
hydrogen, optionally substituted C.sub.1-6-alkyl, optionally
substituted C.sub.2-6-alkenyl, hydroxy, C.sub.1-6-alkoxy,
C.sub.2-6-alkenyloxy, carboxy, C.sub.1-6-alkoxycarbonyl,
C.sub.1-6-alkylcarbonyl, formyl, amino, mono- and
di(C.sub.1-6-alkyl)amino, carbamoyl, mono- and
di(C.sub.1-6-alkyl)-amino-carbonyl,
amino-C.sub.1-6-alkyl-aminocarbonyl, mono- and
di(C.sub.1-6-alkyl)amino-C.sub.1-6-alkyl-aminocarbonyl,
C.sub.1-6-alkyl-carbonylamino, carbamido, C.sub.1-6-alkanoyloxy,
sulphono, C.sub.1-6-alkylsulphonyloxy, nitro, azido, sulphanyl,
C.sub.1-6-alkylthio, halogen, photochemically active groups,
thermochemically active groups, chelating groups, reporter groups,
and ligands, the possible pair of non-geminal substituents thereby
forming a monocyclic entity together with (i) the atoms to which
the non-geminal substituents are bound and (ii) any intervening
atoms; and each of the substituents R.sup.2, R.sup.2*, R.sup.3,
R.sup.4* which are present and not involved in the possible
biradical is independently selected from hydrogen, optionally
substituted C.sub.1-6-alkyl, optionally substituted
C.sub.2-6-alkenyl, hydroxy, C.sub.1-6-alkoxy, C.sub.2-6-alkenyloxy,
carboxy, C.sub.1-6-alkoxycarbonyl, C.sub.1-6-alkylcarbonyl, formyl,
amino, mono- and di(C.sub.1-6-alkyl)amino, carbamoyl, mono- and
di(C.sub.1-6-alkyl)-amino-carbonyl,
amino-C.sub.1-6-alkyl-aminocarbonyl, mono- and
di(C.sub.1-6-alkyl)amino-C.sub.1-6-alkyl-aminocarbonyl,
C.sub.1-6-alkyl-carbonylamino, carbamido, C.sub.1-6-alkanoyloxy,
sulphono, C.sub.1-6-alkylsulphonyloxy, nitro, azido, sulphanyl,
C.sub.1-6-alkylthio, halogen, photochemically active groups,
thermochemically active groups, chelating groups, reporter groups,
and ligands; and basic salts and acid addition salts thereof.
[0541] Modified nucleobases and nucleosidic bases may comprise a
cyclic unit (e.g. a carbocyclic unit such as pyrenyl) that is
joined to a nucleic unit, such as a 1'-position of furasonyl ring
through a linker, such as a straight of branched chain alkylene or
alkenylene group. Alkylene groups suitably having from 1 (i.e.
--CH.sub.2--) to about 12 carbon atoms, more typically 1 to about 8
carbon atoms, still more typically 1 to about 6 carbon atoms.
Alkenylene groups suitably have one, two or three carbon-carbon
double bounds and from 2 to 12 carbon atoms, more typically 2 to 8
carbon atoms, still more typically 2 to 6 carbon atoms.
EXAMPLE 24
Exemplary Nucleic Acid Monomers and Oligomers
[0542] Desirable LNA units include those that contain a
furanosyl-type ring and one or more of the following linkages:
C-1', C-2'; C-2', C-3'; C-2', C-4'; or a C-2', C-5' linkage. A
C-2', C-4' is particularly desirable. In another aspect of the
invention, desirable LNA units are compounds having a substituent
on the 2'-position of the central sugar moiety (e.g., ribose or
xylose), or derivatives thereof, which favors the C3'-endo
conformation, commonly referred to as the North (or simply N for
short) conformation. Desirable LNA In various embodiments, the
oligonucleotide has at least one LNA unit with a modified base as
disclosed herein. Suitable oligonucleotides also may contain
natural DNA or RNA units (e.g., nucleotides) with natural bases, as
well as LNA units that contain natural bases. Furthermore, the
oligonucleotides of the invention also may contain modified DNA or
RNA, such as 2'-O-methyl RNA, with natural or modified nucleobases
(e.g., pyrene). Desirable oligonucleotides contain at least one of
and desirably both of 1) one or more DNA or RNA units (e.g.,
nucleotides) with natural bases, and 2) one or more LNA units with
natural bases, in addition to LNA units with a modified base. In
other embodiments, the nucleic acid does not contain a modified
base.
[0543] Oligonucleotides of the invention desirably contain at least
50 percent or more, more desirably 55, 60, 65, or 70 percent or
more of non-modified or natural DNA or RNA units (e.g.,
nucleotides) or units other than LNA units based on the total
number of units or residues of the oligo. A non-modified nucleic
acid as referred to herein means that the nucleic acid upon
incorporation into a 10-mer oligomer will not increase the T.sub.m
of the oligomer in excess of 1.degree. C. or 2.degree. C. More
desirably, the non-modified nucleic acid unit (e.g., nucleotide) is
a substantially or completely "natural" nucleic acid, i.e.
containing a non-modified base of uracil, cytosine,
5-methyl-cytosine, thymine, adenine or guanine and a non-modified
pentose sugar unit of .beta.-D-ribose (in the case of RNA) or
.beta.-D-2-deoxyribose (in the case of DNA).
[0544] Oligonucleotides of the invention suitably may contain only
a single modified (i.e. LNA) nucleic acid unit, but desirably an
oligonucleotide will contain 2, 3, 4 or 5 or more modified nucleic
acid units. Typically desirable is where an oligonucleotide
contains from about 5 to about 40 or 45 percent modified (LNA)
nucleic acid units, based on total units of the oligo, more
desirably where the oligonucleotide contains from about 5 or 10
percent to about 20, 25, 30 or 35 percent modified nucleic acid
units, based on total units of the oligo.
[0545] Typical oligonucleotides that contain one or more LNA units
with a modified base as disclosed herein suitably contain from 3 or
4 to about 200 nucleic acid repeat units, with at least one unit
being an LNA unit with a modified base, more typically from about 3
or 4 to about 5, 6, 7, 8, 9, 10, 15, 20, 30, 40, 50, 60, 70, 80,
90, 100, 110, 120, 130, 140 or 150 nucleic acid units, with 1, 2,
3, 4, 5, 6, 7, 8, 9, or 10 LNA units with a modified base being
present.
[0546] As discussed above, particularly desirable oligonucleotides
contain a non- modified DNA or RNA unit at the 3' terminus and a
modified DNA or RNA unit at one position upstream from (generally
referred to hereing as the -1 or penultimate position) the 3'
terminal non-modified nucleic acid unit. In some embodiments, the
modified base is at the 3' terminal position of a nucleic acid
primer, such as a primer for the detection of a single nucleotide
polymorphism. Other particularly desirable nucleic acids have an
LNA unit with or without a modified base in the 5' and/or 3'
terminal position.
[0547] Also desirable are oligonucleotides that do not have an
extended stretches of modified DNA or RNA units, e.g. greater than
about 4, 5 or 6 consecutive modified DNA or RNA units. That is,
desirably one or more non-modified DNA or RNA will be present after
a consecutive stretch of about 3, 4 or 5 modified nucleic
acids.
[0548] Generally desirable are oligonucleotides that contain a
mixture of LNA units that have non-modified or natural nucleobases
(i.e., adenine, guanine, cytosine, 5-methyl-cytosine, uracil, or
thymine) and LNA units that have modified bases as disclosed
herein.
[0549] Particularly desirable oligonucleotides of the invention
include those where an LNA unit with a modified base is interposed
between two LNA units each having non-modified or natural bases
(adenine, guanine, cytosine, 5-methyl-cytosine, uracil, or thymine.
The LNA "flanking" units with natural base moieties may be directly
adjacent to the LNA with modified base moiety, or desirably is
within 2, 3, 4 or 5 nucleic acid units of the LNA unit with
modified base. Nucleic acid units that may be spaced between an LNA
unit with a modified base and an LNA unit with natural nucleobasis
suitably are DNA and/or RNA and/or alkyl-modified RNA/DNA units,
typically with natural base moieties, although the DNA and or RNA
units also may contain modified base moieties.
[0550] The oligonucleotides of the present invention are comprised
of at least about one universal base. Oligonucleotides of the
present can also be comprised, for exmple, of between about one to
six 2'-Ome-RNA unit, at least about two LNA units and at least
about one LNA pyrene unit.
EXAMPLE 25
Exemplary Target Nucleic Acids
[0551] In the practice of the present invention, target genes may
be suitably single-stranded or double-stranded DNA or RNA; however,
single-stranded DNA or RNA targets are desirable. It is understood
that the target to which the nucleic acids of the invention are
directed include allelic forms of the targeted gene and the
corresponding mRNAs including splice variants. There is substantial
guidance in the literature for selecting particular sequences for
nucleic acids with LNA or other high affinity nucleotides given a
knowledge of the sequence of the target polynucleotide, e.g.,
Peyman and Ulmann, Chemical Reviews, 90:543-584, 1990; Crooke, Ann.
Rev. Pharmacol. Toxicol., 32:329-376 (1992); and Zamecnik and
Stephenson, Proc. Natl. Acad. Sci., 75:280-284 (1974). Desirable
mRNA targets include the 5' cap site, tRNA primer binding site, the
initiation codon site, the mRNA donor splice site, and the mRNA
acceptor splice site, e.g., Goodchild et al., U.S. Pat. No.
4,806,463.
EXAMPLE 26
Exemplary Applications of Present Methods
[0552] The chimeric oligos of the present invention are highly
suitable for a variety of diagnostic purposes such as for the
isolation, purification, amplification, detection, identification,
quantification, or capture of nucleic acids such as DNA, mRNA or
non-protein coding cellular RNAs, such as tRNA, rRNA, snRNA and
scRNA, or synthetic nucleic acids, in vivo or in vitro.
[0553] The oligomer can comprise a photochemically active group, a
thermochemically active group, a chelating group, a reporter group,
or a ligand that facilitates the direct or indirect detection of
the oligomer or the immobilization of the oligomer onto a solid
support. Such group are typically attached to the oligo when it is
intended as a probe for in situ hybridization, in Southern
hybridization, Dot blot hybridization, reverse Dot blot
hybridization, or in Northern hybridization.
[0554] When the photochemically active group, the thermochemically
active group, the chelating group, the reporter group, or the
ligand includes a spacer (K), the spacer may suitably comprise a
chemically cleavable group.
[0555] An additional object of the present invention is to provide
oligonucleotides which combines an increased ability to
discriminate between complementary and mismatched targets with the
ability to act as substrates for nucleic acid active enzymes such
as for example DNA and RNA polymerases, ligases, phosphatases. Such
oligonucleotides may be used for instance as primers for sequencing
nucleic acids and as primers in any of the several well known
amplification reactions, such as the PCR reaction.
[0556] Introduction of LNA monomers with natural bases into either
DNA, RNA, or pure LNA oligonucleotides can result in extremely high
thermal stability of duplexes with complementary DNA or RNA, while
at the same time obeying the Watson-Crick base-pairing rules. In
general, the thermal stability of heteroduplexes is increased
3-8.degree. C. per LNA monomer in the duplex. Oligonucleotides
containing LNA can be designed to be substrates for polymerases
(e.g., Taq polymerase), and PCR based on LNA primers is more
discriminatory towards single base mutations in the template DNA
compared to normal DNA-primers (e.g., allele specific PCR).
Furthermore, very short LNA oligos (e.g. 5-mers or 8-mers) which
have high T.sub.m's when compared to similar DNA oligos can be used
as highly specific catching probes with outstanding discriminatory
power towards single base mutations (e.g., SNP detection).
[0557] LNA oligonucleotides are capable of hybridizing with
double-stranded DNA target molecules as well as RNA secondary
structures by strand invasion as well as of specifically blocking a
wide selection of enzymatic reactions such as, digestion of
double-stranded DNA by restriction endonucleases; and digestion of
DNA and RNA with deoxyribonucleases and ribonucleases,
respectively.
[0558] In a further aspect, oligonucleotides of the invention may
be used to construct new affinity pairs with exhibit enhanced
specificity towards each other. The affinity constants can easily
be adjusted over a wide range and a vast number of affinity pairs
can be designed and synthesized. One part of the affinity pair can
be attached to the molecule of interest (e.g. proteins, amplicons,
enzymes, polysaccharides, antibodies, haptens, peptides, etc.) by
standard methods, while the other part of the affinity pair can be
attached to e.g. a solid support such as beads, membranes,
micro-titer plates, sticks, tubes, etc. The solid support may be
chosen from a wide range of polymer materials such as for instance
polypropylene, polystyrene, polycarbonate or polyethylene. The
affinity pairs may be used in selective isolation, purification,
capture and detection of a diversity of the target molecules.
[0559] Oligonucleotides of the invention also may be employed as
probes in the purification, isolation and detection of for instance
pathogenic organisms such as viral, bacteria and fungi etc.
Oligonucleotides of the invention also may be used as generic tools
for the purification, isolation, amplification and detection of
nucleic acids from groups of related species such as for instance
rRNA from gram-positive or gram negative bacteria, fungi, mammalian
cells etc.
[0560] Oligonucleotides of the invention also may be employed as an
aptamer in molecular diagnostics, e.g. in RNA mediated catalytic
processes, in specific binding of antibiotics, drugs, amino acids,
peptides, structural proteins, protein receptors, protein enzymes,
saccharides, polysaccharides, biological cofactors, nucleic acids,
or triphosphates or in the separation of enantiomers from racemic
mixtures by stereospecific binding.
[0561] Oligonucleotides of the invention also may be used for
labeling of cells, e.g. in methods wherein the label allows the
cells to be separated from unlabelled cells.
[0562] Oligonucleotides also may be conjugated to a compound
selected from proteins, amplicons, enzymes, polysaccharides,
antibodies, haptens, and peptides.
[0563] Kits are also provided containing one or more
oligonucleotides of the invention for the isolation, purification,
amplification, detection, identification, quantification, or
capture of natural or synthetic nucleic acids. The kit typically
will contain a reaction body, e.g. a slide or biochip. One or more
oligonucleotides of the invention may be suitably immobilized on
such a reaction body.
[0564] The invention also provides methods for using kits of the
invention for carrying out a variety of bioassays, e.g. for
diagnostic purposes. Any type of assay wherein one component is
immobilized may be carried out using the substrate platforms of the
invention. Bioassays utilizing an immobilized component are well
known in the art. Examples of assays utilizing an immobilized
component include for example, immunoassays, analysis of
protein-protein interactions, analysis of protein-nucleic acid
interactions, analysis of nucleic acid-nucleic acid interactions,
receptor binding assays, enzyme assays, phosphorylation assays,
diagnostic assays for determination of disease state, genetic
profiling for drug compatibility analysis, and SNP detection (U.S.
Pat. Nos. 6,316,198; 6,303,315).
[0565] Identification of a nucleic acid sequence capable of binding
to a biomolecule of interest can be achieved by immobilizing a
library of nucleic acids onto the substrate surface so that each
unique nucleic acid was located at a defined position to form an
array. The array would then be exposed to the biomolecule under
conditions which favored binding of the biomolecule to the nucleic
acids. Non-specifically binding biomolecules could be washed away
using mild to stringent buffer conditions depending on the level of
specificity of binding desired. The nucleic acid array would then
be analyzed to determine which nucleic acid sequences bound to the
biomolecule. Desirably the biomolecules would carry a fluorescent
tag for use in detection of the location of the bound nucleic
acids.
[0566] Oligonucleotides of the invention can be employed in a wide
range of applications, particularly those applications involving a
hybridization reaction. Oligonucleotides also may be used in DNA
sequencing aiming at improved throughput in large-scale, shotgun
genome sequencing projects, improved throughput in capillary DNA
sequencing (e.g. ABI prism 3700) as well as at an improved method
for 1) sequencing large, tandemly repeated genomic regions, 2)
closing gaps in genome sequencing projects and 3) sequencing of
GC-rich templates. In DNA sequencing, oligonucleotide sequencing
primers are combined with LNA enhancer elements for the
read-through of GC-rich and/or tandemly repeated genomic regions,
which often present many challenges for genome sequencing projects.
LNA may increase the specificity of certain sequencing primers and
thus facilitate selection of a particular version of a repeated
sequence and possibly also use strand invasion to open up
recalcitrant GC rich sequences.
[0567] The incorporation of one or more universal nucleosides into
the oligomer makes bonding to unknown bases possible and allows the
oligonucleotide to match ambiguous or unknown nucleic acid
sequences.
[0568] As discussed above, oligonucleotides of the invention may be
used for therapeutic applications, e.g. as an antisense, antigene
or ribozyme or double stranded nucleic acid therapeutic agents. In
these therapeutic methods, one or more oligonucleotides of the
invention is administered as desired to a patient suffering from or
susceptible the targeted disease or disorder, e.g. a viral
infection.
[0569] In an exemplary in vitro method for measuring the ability of
a nucleic acid of the invention to silence a target gene, cells are
cultured in standard medium supplemented with 1% fetal calf serum
as previously described (Lykkesfeld et al., Int. J. Cancer
61:529-534, 1995). At the start of the experiment cells are
approximately 40% confluent. The serum containing medium is removed
and replaced with serum-free medium. Transfection is performed
using, e.g., Lipofectin (GibcoBRL cat. No 18292-011) diluted 40X in
medium without serum and combined with the oligo to a concentration
of 750 nM oligo, 0.8 ug/ml Lipofectin. Then, the medium is removed
from the cells and replaced with the medium containing
oligo-Lipofectin complex. The cells are incubated at 37.degree. C.
for 6 hours, rinsed once with medium without serum and incubated
for a further 18 hours in DME/F12 with 1% FCS at 37.degree. C.
Standard methods are used to measure the level of mRNA or protein
encoded by the target gene to measure the level of gene
silencing.
[0570] It is also contemplated that information on the structures
assumed by a target nucleic acid may be used in the design of the
probes, such that regions that are known or suspected to be
involved in folding may be chosen as hybridization sites. Such an
approach will reduce the number of probes that are likely to be
needed to distinguish between targets of interest.
[0571] There are many methods used to obtain structural information
involving nucleic acids, including the use of chemicals that are
sensitive to the nucleic acid structure, such as
phenanthroline/copper, EDTA-Fe.sup.2+, cisplatin, ethylnitrosourea,
dimethyl pyrocarbonate, hydrazine, dimethyl sulfate, and bisulfite.
Enzymatic probing using structure-specific nucleases from a variety
of sources, such as the Cleavase.TM. enzymes (Third Wave
Technologies, Inc., Madison, Wis.), Taq DNA polymerase, E. coli DNA
polymerase I, and eukaryotic structure-specific endonucleases
(e.g., human, murine and Xenopus XPG enzymes, yeast RAD2 enzymes),
murine FEN-1 endonucleases (Harrington and Lieber, Genes and
Develop., 3:1344 [1994]) and calf thymus 5' to 3' exonuclease
(Murante et al., J. Biol. Chem., 269:1191 [1994]). In addition,
enzymes having 3' nuclease activity such as members of the family
of DNA repair endonucleases (e.g., the RrpI enzyme from Drosophila
melanogaster, the yeast RAD1/RAD10 complex and E. coli Exo III),
are also suitable for examining the structures of nucleic
acids.
[0572] If analysis of structure as a step in probe selection is to
be used for a segment of nucleic acid for which no information is
available concerning regions likely to form secondary structures,
the sites of structure-induced modification or cleavage must be
identified. It is most convenient if the modification or cleavage
can be done under partially reactive conditions (i.e., such that in
the population of molecules in a test sample, each individual will
receive only one or a few cuts or modifications). When the sample
is analyzed as a whole, each reactive site should be represented,
and all the sites may be thus identified. Using a Cleavase Fragment
Length Polymorphism.TM. cleavage reaction as an example, when the
partial cleavage products of an end labeled nucleic acid fragment
are resolved by size (e.g., by electrophoresis), the result is a
ladder of bands indicating the site of each cleavage, measured from
the labeled end. Similar analysis can be done for chemical
modifications that block DNA synthesis; extension of a primer on
molecules that have been partially modified will yield a nested set
of termination products. Determining the sites of
cleavage/modification may be done with some degree of accuracy by
comparing the products to size markers (e.g., commercially
available fragments of DNA for size comparison) but a more accurate
measure is to create a DNA sequencing ladder for the same segment
of nucleic acid to resolve alongside the test sample. This allows
rapid identification of the precise site of cleavage or
modification.
EXAMPLE 27
General Reaction Conditions for Synthesis of Some Compounds of the
Invention
[0573] Reactions were conducted under an atmosphere of nitrogen
when anhydrous solvents were used. All reactions were monitored by
thin-layer chromatography (TLC) using EM reagent plates with
fluorescence indicator (SiO.sub.2-60, F-254). The compounds were
visualized under UV light and by spraying with a mixture of 5%
aqueous sulfuric acid and ethanol followed by heating. Silica gel
60 (particle size 0.040-0.063 mm, Merck) was used for flash column
chromatography. NMR spectra were recorded at 300 MHz for .sup.1H
NMR, 75.5 MHz for .sup.13C NMR and 121.5 MHz for .sup.31P NMR on a
Varian Unity 300 spectrometer. .delta.-Values are in ppm relative
to tetramethyl silane as internal standard (.sup.1H and .sup.13C
NMR) and relative to 85% H.sub.3PO.sub.4 as external standard
(.sup.31P NMR). Coupling constants are given in Hertz. The
assignments, when given, are tentative, and the assignments of
methylene protons, when given, may be interchanged. Bicyclic
compounds are named according to the Von Bayer nomenclature. Fast
atom bombardment mass spectra (FAB-MS) were recorded in positive
ion mode on a Kratos MS50TC spectrometer. The composition of the
oligonucleotides were verified by MALDI-MS on a Micromass Tof Spec
E mass spectrometer using a matrix of diammonium citrate and
2,6-dihydroxyacetophenone.
EXAMPLE 28
Synthesis of
1,2-O-Isopropylidene-5-O-methanesulfonyl-4-C-methanesulfonyloxymethyl-3-O-
-(p-methoxybenzyl)-.alpha.-D-ribofuranose [Compound 2 in Scheme 1
above]
[0574] Mesyl chloride (8.6 g, 7.5 mmol) was dropwise added to a
stirred solution of
4-C-hydroxymethyl-1,2-O-isopropylidene-3-O-p-methoxybenzyl-.alpha.-D-ribo-
furanose [R. Yamaguchi, T. Imanishi, S. Kohgo, H. Horie and H.
Ohrui, Biosci. Biotechnol. Biochem., 1999, 63, 736] (1, 10.0 g,
29.4 mmol) in anhydrous pyridine (30 cm.sup.3) and the reaction
mixture was stirred overnight at room temperature. The mixture was
evaporated to dryness under reduced pressure to give a residue
which was co-evaporated with toluene (2.times.25 cm.sup.3),
dissolved in CH.sub.2Cl.sub.2 (200 cm.sup.3) and washed
successively with saturated aqueous NaHCO.sub.3 (2.times.100
cm.sup.3) and brine (50 cm.sup.3). The organic phase was dried
(Na.sub.2SO.sub.4), filtered and evaporated to dryness under
reduced pressure. The colorless viscous oil obtained was purified
by column chromatography [0.5-1% (v/v) MeOH in CH.sub.2Cl.sub.2 as
eluent], followed by crystallization from MeOH to give furanose 2
as a white solid material (13.6 g, 93%); R.sub.f 0.57
(CH.sub.2Cl.sub.2/MeOH 95:5, v/v); .delta..sub.H (CDC1.sub.3) 7.30
(2 H, d, J 8.7), 6.90 (2 H, d, J 8.5), 5.78 (1 H, d, J 3.7), 4.86
(1 H, d, J 12.0), 4.70 (1 H, d, J 11.4), 4.62 (1 H, dd, J 5.0 and
3.8), 4.50 (1 H, d, J 11.1), 4.39 (1 H, d, J 12.3), 4.31 (1 H, d, J
11.0), 4.17 (1 H, d, J 5.1), 4.11 (1 H, d, J 11.0), 3.81 (3 H, s),
3.07 (3 H, s), 2.99 (3 H, s), 1.68 (3 H, s), 1.34 (3 H, s);
.delta..sub.c (CDCl.sub.3) 159.8, 129.9, 128.8, 114.1, 114.0,
104.5, 83.2, 78.0, 77.9, 72.6, 69.6, 68.8, 55.4, 38.1, 37.5, 26.3,
25.7.
EXAMPLE 29
Synthesis of Methyl
5-O-methanesulfonyl-4-C-methanesulfonyloxymethyl-3-O-(p-methoxybenzyl)-D--
ribofuranoside [Compound 3 in Scheme 1 above]
[0575] A suspension of furanoside 2 (13.5 g, 27.2 mmol) in a
mixture of H.sub.2O (45 cm.sup.3) and 15% HCl in MeOH (450
cm.sup.3, w/w) was stirred at room temperature for 72 h. The
mixture was carefully neutralized by addition of saturated aqueous
NaHCO.sub.3 (100 cm.sup.3) followed by NaHCO.sub.3 (s) whereupon
the mixture was evaporated to dryness under reduced pressure.
H.sub.2O (100 cm.sup.3) was added, and extraction was performed
with EtOAc (3.times.100 cm.sup.3). The combined organic phase was
washed with brine (100 cm.sup.3), dried (Na.sub.2SO.sub.4),
filtered and then evaporated to dryness under reduced pressure. The
residue was coevaporated with toluene (2.times.25 cm.sup.3) and
purified by column chromatography [1-2% (v/v) MeOH in
CH.sub.2Cl.sub.2] to give furanoside 3 as an anomeric mixture
(clear oil, 11.0 g, 86%, ratio between anomers ca. 6:1); R.sub.f
0.39, 0.33 (CH.sub.2Cl.sub.2/MeOH 95:5, v/v); .delta..sub.H
(CDCl.sub.3, major anomer only) 7.28 (2 H, d, J 8.4), 6.91 (2 H, d,
J 8.9), 4.87 (1 H, s), 4.62 (1 H, d, J 11.4), 4.53 (1 H, d, J
11.2), 4.41 (2 H, s), 4.31 (1 H, d, J 9.8), 4.24(1 H, d, J 4.6),
4.06 (1 H, d, J 10.0), 3.98 (1 H, br s), 3.81 (3 H, s), 3.33 (3 H,
s), 3.06 (3 H, s), 3.03 (3 H,s); .delta..sub.c (CDCl.sub.3, major
anomer only) 160.0, 130.1, 128.5, 114.3, 107.8, 81.7, 81.2, 73.8,
73.6, 69.7, 69.6, 55.5, 55.4, 37.5, 37.4.
EXAMPLE 30
Synthesis of
(1R,3RS,4R,7S)-1-Methanesulfonyloxymethyl-3-methoxy-7-(p-methoxybenzyloxy-
)-2,5-dioxabicyclo[2.2.1]heptane [Compound 4 in Scheme 1 above]
[0576] To a stirred solution of the anomeric mixture of Compound 3
(10.9 g, 23.2 mmol) in anhydrous DMF (50 cm.sup.3) at 0.degree. C.
was during 10 min added sodium hydride (2.28 g of a 60% suspension
in mineral oil (w/w), 95.2 mmol) and the mixture was stirred for 12
h at room temperature. Ice-cold H.sub.2O (200 cm.sup.3) was slowly
added and extraction was performed using EtOAc (3.times.200
cm.sup.3). The combined organic phase was washed successively with
saturated aqueous NaHCO.sub.3 (2.times.100 cm.sup.3) and brine (50
cm.sup.3), dried (Na.sub.2SO.sub.4), filtered and evaporated to
dryness under reduced pressure. The residue was purified by column
chromatography [0.5-1% (v/v) MeOH in CH.sub.2Cl.sub.2 ] to give
first the major isomer (6.42 g, 74%) and then [1.5% (v/v) MeOH in
CH.sub.2Cl.sub.2 ] the minor isomer (1.13 g, 13%), both as clear
oils; R.sub.f 0.56, 0.45 (CH.sub.2Cl.sub.2IMeOH 95:5, v/v);
.delta..sub.H (CDCl.sub.3, major isomer) 7.16 (2 H, d, J 8.8), 6.74
(2 H, d, J 8.4), 4.65 (1 H, s), 4.42-4.32 (4 H, m), 3.95-3.94 (2 H,
m), 3.84 (1 H, d, J 7.4), 3.66 (3 H, s), 3.54 (1 H, d, J 7.4), 3.21
(3 H, s), 2.90 (3 H, s); .delta..sub.c (CDCl.sub.3, major isomer)
159.6, 129.5,129.3, 114.0, 105.3, 83.2, 78.6, 77.2, 72.1, 71.8,
66.3, 55.6, 55.4, 37.8; .delta..sub.H (CDCl.sub.3, minor isomer)
7.27 (2 H, d, J 8.9), 6.89 (2 H, d, J 8.6), 4.99 (1 H, s),
4.63-4.39 (4 H, m), 4.19 (1 H, s), 4.10-3.94 (2 H, m), 3.91 (1 H,
s), 3.81 (3 H, s), 3.47 (3 H, s), 3.05 (3 H, s); .delta..sub.c
(CDCl.sub.3, minor isomer) 159.7, 129.6, 129.5, 114.1, 104.4, 86.4,
79.3, 77.1, 72.3, 71.9, 66.2, 56.4, 55.4, 37.7.
EXAMPLE 31
Synthesis of
(1R,4R,7S)-1-Acetoxymethyl-3-methoxy-7-(p-methoxybenzyloxy)-2,5-dioxabicy-
clo[2.2.1]heptane [Compound 5 in Scheme 1]
[0577] To a stirred solution of furanoside 4 (major isomer, 6.36 g,
17.0 mmol) in dioxane (25 cm.sup.3) was added 18-crown-6 (9.0 g,
34.1 mmol) and KOAc (8.4 g, 85.6 mmol). The stirred mixture was
heated under refluxed for 12 h and subsequently evaporated to
dryness under reduced pressure. The residue was dissolved in
CH.sub.2Cl.sub.2 (100 cm.sup.3) and washing was performed,
successively, with saturated aqueous NaHCO.sub.3 (2 .times.5O
cm.sup.3) and brine (50 cm.sup.3). The separated organic phase was
dried (Na.sub.2SO4), filtered and evaporated to dryness under
reduced pressure. The residue was purified by column chromatography
[1% (v/v) MeOH in CH.sub.2Cl.sub.2] to give furanoside 5 as a white
solid material (one anomer, 5.23 g, 91%); R.sub.f 0.63
(CH.sub.2Cl.sub.2/MeOH 95:5, v/v); .delta..sub.H (CDCl.sub.3)
7.27-7.24 (2 H, m), 6.90-6.87 (2 H, m), 4.79 (1 H, s), 4.61 (1 H,
d, J 11.0), 4.49 (2 H, m), 4.28 (1 H, d, J 11.0), 4.04(3 H, m),
3.80(3 H, s), 3.68 (1 H, m), 3.36 (3 H, s), 2.06(3 H, s);
.delta..sub.c (CDCl.sub.3) 170.7, 159.5, 129.5, 129.4, 113.9,
105.1, 83.3, 78.9, 77.2, 72.0, 71.9, 61.0, 55.4, 55.3, 20.8.
EXAMPLE 32
Synthesis of
(1S,4R,7S)-1-Hydroxymethyl-3-methoxy-7-(p-methoxybenzyloxy)-2,5-dioxabicy-
clo[2.2.1]heptane [Compound 6 in Scheme 1]
[0578] A solution of furanoside 5 (one anomer, 5.16 g, 15.3 mmol)
in saturated methanolic ammonia (200 cm.sup.3) was stirred at room
temperature for 48 h. The reaction mixture was evaporated to
dryness under reduced pressure, coevaporated with toluene
(2.times.50 cm.sup.3), and the residue purified by column
chromatography [2-3% (v/v) MeOH in CH.sub.2Cl.sub.2] to give
furanoside 6 as a white solid material (one anomer, 3.98 g, 88%);
R.sub.f 0.43 (CH.sub.2Cl.sub.2/MeOH 95:5, v/v); .delta..sub.H
(CDCl.sub.3) 7.27 (2 H, d, J 8.6), 6.88 (2 H, d, J 8.9), 4.79 (1 H,
s), 4.59 (1 H, d, J 11.3), 4.53 (1 H, d, J 11.4), 4.09 (2 H, s),
3.97 (1 H, d, J 7.5), 3.86 (2 H, br s), 3.80 (3 H, s), 3.75-3.62 (2
H, m), 3.37 (3 H, s); .delta..sub.c (CDCl.sub.3) 159.4, 129.7,
129.3, 113.9, 105.2, 85.6, 78.3, 77.4, 71.9, 71.8, 58.8, 55.5,
55.3.
EXAMPLE 33
(1S,4R,7S)-3-Methoxy-7-(p-methoxybenzyloxy)-1-(p-methoxybenzyloxymethyl)-2-
,5-dioxabicyclo[2.2.1]heptane [Compound 7 in Scheme 1]
[0579] To a stirred solution of furanoside 6 (one anomer, 3.94 g,
13.3 mmol) in anhydrous DMF (50 cm.sup.3) at 0.degree. C. was added
a suspension of NaH [60% in mineral oil (w/w), 1.46 g, 60.8 mmol]
followed by dropwise addition ofp-methoxybenzyl chloride (2.74 g,
17.5 mmol). The mixture was allowed to warm to room temperature and
stirring was continued for another 4 h whereupon ice-cold H.sub.2O
(50 cm.sup.3) was dropwise added. The mixture was extracted with
CH.sub.2Cl.sub.2 (3.times.100 cm.sup.3) and the combined organic
phase was washed with brine (100 cm.sup.3), dried
(Na.sub.2SO.sub.4), filtered, evaporated to dryness under reduced
pressure and coevaporated with toluene (3.times.50 cm.sup.3). The
residue (4.71 g) tentatively assigned as a mixture of 7 and
aldehyde 11 was used in the preparation of 11 (see below) without
further purification.
EXAMPLE 34
4-C-Methanesulfonyloxymethyl-3,5-di-O-(p-methoxybenzyl)-1,2-O-isopropylide-
ne-.alpha.-D-ribofuranose [Compound 9 in Scheme 1]
[0580]
4-C-Hydroxymethyl-3,5-di-O-(p-methoxybenzyl)-1,2-O-isopropylidene--
.alpha.-D-ribofuranose [R. Yamaguchi, T. Imanishi, S. Kohgo, H.
Horie and H. Ohrui, Biosci. Biotechnol. Biochem., 1999, 63, 736]
(8, 3.2 g, 6.95 mmol) was mesylated using MsCl (2.00 g, 17.5 mmol)
and pyridine (10 cm.sup.3) following the procedure described for 2.
After work-up, the colorless viscous oil was purified by column
chromatography [1% (v/v) MeOH in CH.sub.2Cl.sub.2] to give
derivative 9 in 89% yield (3.17 g) as a clear oil; R.sub.f 0.45
(CH.sub.2Cl.sub.2/MeOH 98:2, v/v); .delta..sub.H (CDCl.sub.3) 7.22
(2 H, d, J 8.9), 7.18 (2 H, d, J 8.7), 6.86 (4 H, d, J 8.3), 5.76
(1 H, d, J 3.8), 4.83 (1 H, d, J 12.0), 4.64 (1 H, d, J 11.6), 4.59
(1 H, m), 4.49-4.35 (4 H, m), 4.24 (1 H, d, J 5.3), 3.80 (6 H, s),
3.56 (1 H, d, J 10.5), 3.45 (1 H, d, J 10.5), 3.06 (3 H, s), 1.67
(3 H, s), 1.33 (3 H, s); .delta..sub.c (CDCl.sub.3) 159.6, 159.4,
129.9, 129.8, 129.7, 129.5, 129.4, 129.3, 114.0, 113.9, 113.8,
113.7, 113.6, 104.5, 84.9, 78.6, 78.1, 73.4, 72.4, 71.0, 69.9,
55.3, 38.0, 26.4, 25.9.
EXAMPLE 35
Methyl
4-C-methanesulfonyloxymethyl-3,5-di-O-(p-methoxybenzyl)-D-ribofuran-
ose [Compound 10 in Scheme 1]
[0581] Methanolysis of furanoside 9 (3.1 g, 5.76 mmol) was
performed using a mixture of a solution of 15% HCl in MeOH (w/w,
120 cm.sup.3) and H.sub.2O (12 cm.sup.3) following the procedure
described for the synthesis of 3. After work-up, the crude product
was purified by column chromatography [0.5-1% (v/v) MeOH in
CH.sub.2Cl.sub.2] to give the major anomer of 10 (1.71 g, 58%) and
[1-1.5% (v/v) MeOH in CH.sub.2Cl.sub.2] the minor anomer of 10
(0.47 g, 16%), both as clear oils; R.sub.f 0.31, 0.24
(CH.sub.2Cl.sub.2MeOH 98:2, v/v); .delta..sub.H (major anomer,
CDCl.sub.3) 159.8, 159.5, 129.9, 129.8, 129.6, 129.5, 129.0, 114.2,
114.1, 114.0, 113.9, 107.9, 84.7, 79.9, 74.2, 73.5, 73.5, 70.2,
64.4, 55.6, 55.4, 37.4.
EXAMPLE 36
Alternative Preparation of Compound 7 in Scheme 1
[0582] Ring closure of furanoside 10 (major anomer, 1.68 g, 3.28
mmol) was achieved using NaH (60% suspension in mineral oil (w/w),
0.32 g, 13.1 mmol) in anhydrous DMF (10 cm.sup.3) following the
procedure described for the synthesis of 4 to give a crude product
tentatively assigned as a mixture of furanoside 7 and aldehyde 11
(see below) (1.13 g).
EXAMPLE 37
(2R,3S,4S)-4-Hydroxy-3-(p-methoxybenzyloxy)-4-(p-methoxybenzyloxymethyl)-t-
etrahydrofuran-2-carbaldehyde [Compound 11 in Scheme 1]
[0583] A solution of crude furanoside 7 (as a mixture with 11 as
prepared as described above, 5.80 g) in 80% glacial acetic acid
(100 cm.sup.3) was stirred at 50 .degree. C. for 4 h. The solvent
was distilled off under reduced pressure and the residue was
successively coevaporated with absolute ethanol (3.times.25
cm.sup.3) and toluene (2.times.25 cm.sup.3) and purified by column
chromatography [4-5% (v/v) MeOH in CH.sub.2Cl.sub.2 ] to give
aldehyde 11 as a colorless oil (4.60 g); R.sub.f 0.37
(CH.sub.2Cl.sub.2/MeOH 95:5, v/v); .delta..sub.H CDCl.sub.3) 9.64
(1 H, br s), 7.27-7.17 (4 H, m), 6.87-6.84 (4 H, m), 4.59 (1 H, d,
J 11.6), 4.51-4.41 (2 H, m), 4.35 (1 H, s), 3.92-3.90 (2 H, m),
3.79 (6 H, s), 3.77-3.68 (3 H, m), 3.55 (2 H, br s); .delta..sub.c
(CDCl.sub.3) 203.6, 159.5, 159.4, 129.7, 129.6, 129.5, 129.2,
114.0, 113.9, 113.8, 87.3, 86.7, 81.0, 75.1, 73.4, 71.6, 67.6,
55.3.
EXAMPLE 38
General Procedure for the Reaction of Aryl Magnesium Bromides with
Aldehyde 11 to Give Compounds 12a-e in Scheme 2
[0584] A solution of aldehyde 11 (Scheme 2) in anhydrous THF (10
cm.sup.3) was added dropwise during 5 min to a stirred solution of
the aryl magnesium bromide dissolved in anhydrous THF at 0.degree.
C. The mixture was allowed to heat to room temperature and stirred
for 12 h. The mixture was evaporated to dryness under reduced
pressure and the residue diluted with CH.sub.2Cl.sub.2 and washed
several times with saturated aqueous NH.sub.4C1. The organic phase
was dried (Na.sub.2SO.sub.4), filtered, and evaporated to dryness
under reduced pressure. Column chromatography of the crude product
obtained afforded the compounds 12a-e as shown in Scheme 2.
EXAMPLE 38a
Synthesis of
(2S,3S,4S)-4-Hydroxy-2-[(R)-hydroxy(phenyl)methyl]-4-(p-methoxybenzyloxy)-
-3-(p-methoxybenzyloxymethyl) tetrahydrofuran [Compound 12a of
Scheme 2]
[0585] Grignard reaction of phenylmagnesium bromide (1.0 M solution
in THF, 14.2 cm.sup.3, 14.2 mmol) with aldehyde 11 (515 mg, 1.28
mmol) afforded 12a as shown in Scheme 2. The crude product was
purified by column chromatography [4% (v/v) MeOH in
CH.sub.2Cl.sub.2] to give tetrahydrofuran 12a (540 mg, 88%) as a
colorless oil; R.sub.f 0.34 (CH.sub.2Cl.sub.2/MeOH 95:5, v/v);
.delta..sub.H (CDCl.sub.3) 7.40-7.19 (7 H, m), 6.91-6.73 (6 H, m),
4.73 (1 H, d, J 6.4), 4.48 (2 H, s), 4.08 (2 H, s), 3.88 (1 H, d, J
9.4), 3.79 (1 H, m), 3.78 (3 H, s), 3.76 (3 H, s), 3.75-3.69 (2 H,
m), 3.50 (1 H, d, J 9.4), 3.45 (1 H, s), 3.42 (1 H, br s), 3.26 (1
H, br s); .delta..sub.c (CDCl.sub.3) 159.5, 159.3, 140.7, 129.7,
129.6, 129.5, 129.2, 128.5, 128.0, 127.3, 113.9, 113.8, 113.7,
89.4, 84.6, 81.8, 75.3, 74.7, 73.5, 71.6, 69.3, 55.3; m/z (FAB) 503
[M+Na].sup.+, 479 [M-H].sup.+, 461 [M-H--H.sub.2O].sup.+.
EXAMPLE 38b
Synthesis of
(2S,3S,4S)-4-Hydroxy-2-[(R)-hydroxy(4-fluoro-3-methylphenyl)-methyl]-4-(p-
-methoxybenzyloxy)-3-(p-methoxybenzyloxymethyl)tetrahydrofuran
[Compound 12b of Scheme 2]
[0586] Grignard reaction of 4-fluoro-3-methylphenylmagnesium
bromide (1.0 M solution in THF, 15.0 cm.sup.3, 15.0 mmol) with
aldehyde 11 (603 mg, 1.5 mmol) afforded 12b as shown in Scheme 2.
The crude product was purified by column chromatography [4-5% (v/v)
MeOH in CH.sub.2Cl.sub.2] to give tetrahydrofuran 12b (611 mg, 85%)
as a colorless oil; R.sub.f 0.34 (CH.sub.2Cl.sub.2/MeOH 95:5, v/v);
.delta..sub.H CDCl.sub.3) 7.24-7.12 (5 H, m), 6.98-6.84 (5 H, m),
6.77 (1 H, d, J 8.5), 4.65 (1 H, dd, J 2.8 and 6.4), 4.49 (2 H, s),
4.15 (2 H, s), 4.01 (1 H, dd, J 2.3 and 6.5), 3.87 (1 H, d, J 9.3),
3.79 (3H, s), 3.78 (3 H, s), 3.76-3.68 (2 H, m), 3.52 (1 H, s),
3.47 (1 H, d, J 10.3), 3.42 (1 H, d, J 2.9), 3.22 (1 H, s), 2.24 (3
H, d, J 0.8); .delta..sub.c (CDCl.sub.3) 162.7, 159.5, 159.4,
136.2, 136.1, 130.3, 130.2, 129.7, 129.6, 129.5, 129.4, 129.1,
126.1, 126.0, 115.1, 114.8, 114.0, 113.9, 113.8, 89.3, 84.5, 81.8,
75.3, 74.0, 73.5, 71.7, 69.2, 55.4, 55.3, 14.7 (d, J 3.9); m/z
(FAB) 535 [M+Na].sup.+, 511 [M-H].sup.+, 493
[M-H--H.sub.2O].sup.+.
EXAMPLE 38c
Synthesis of
(2S,3S,4S)-4-Hydroxy-2-[(R)-hydroxy(1-naphtyl)methyl]-4-(p-methoxybenzylo-
xy)-3-(p-methoxybenzyloxymethyl)tetrahydrofuran [Compound 12c of
Scheme 2]
[0587] 1-Bromonaphthalene (1.55 g, 7.5 mmol) was added to a stirred
mixture of magnesium turnings (182 mg, 7.5 mmol) and iodine (10 mg)
in THF (10 cm.sup.3). The mixture was stirred at 40 .degree. C. for
1 h whereupon it was allowed to cool to room temperature. A
solution of aldehyde 11 (603 mg, 1.5 mmol) in THF (10 cm.sup.3) was
added slowly and the reaction was stirred for 12 h. The crude
product was purified by column chromatography [4-5% (v/v) MeOH in
CH.sub.2Cl.sub.2] to give tetrahydrofuran 12c (756 mg, 95%) as a
colorless oil; R.sub.f 0.35 (CH.sub.2Cl.sub.2/MeOH 95:5, v/v);
.delta..sub.H (CDCl.sub.3) 8.08 (1 H, m), 7.86 (1 H, m), 7.79 (1 H,
d, J 8.2), 7.72 (1 H, d, J 7.2), 7.49-7.44 (3H, m), 7.18 (2 H, d, J
8.4), 6.84 (2 H, d, J 8.6), 6.74 (2 H, d, J 8.7), 6.68 (2 H, d, J
8.8), 5.52 (1 H, dd, J 3.7 and 5.6), 4.45 (2 H, s), 4.34 (1 H, dd,
J 2.5 and 5.9), 4.03 (1 H, d, J 11.0), 3.96 (1 H, d, J 11.0), 3.93
(1 H, d, J 9.5), 3.80 (1 H, d, J 9.3), 3.77 (3 H, s), 3.75 (1 H, d,
J 2.6), 3.72 (3 H, s), 3.68 (1 H, d, J 9.3), 3.56 (1 H, d, J 3.7),
3.49 (1 H, d, J 9.3), 3.34 (1 H, s); .delta..sub.c (CDCl.sub.3)
159.5, 159.3, 136.3, 134.0, 131.0, 129.7, 129.6, 129.5, 129.4,
129.0, 128.6, 128.2, 125.6, 125.5, 123.5, 114.0, 113.8, 113.7,
88.7, 84.7, 81.9, 75.5, 73.5, 71.7, 71.3, 69.3, 55.4, 55.3; m/z
(FAB) 553 [M+Na].sup.+, 529 [M-H].sup.+, 511
[M-H--H.sub.2O].sup.+.
EXAMPLE 38d
(2S,3S,4S)-4-Hydroxy-2-[(R)-hydroxy(1-pyrenyl)methyl]-4-(p-methoxy-benzylo-
xy)-3-(p-methoxybenzyloxymethyl)tetrahydrofuran [Compound 12d of
Scheme 2]
[0588] Tetrahydrofuran 12d was synthesized from aldehyde 11 (515
mg, 1.28 mmol), 1-bromopyrene (1.0 g, 3.56 mmol), magnesium
turnings (155 mg, 6.4 mmol), iodine (10 mg) and THF (20 cm.sup.3)
following the procedure described for synthesis of compound 12c.
The crude product was purified by column chromatography [3-4% (v/v)
MeOH in CH.sub.2Cl.sub.2] to give tetrahydrofuran 12d (690 mg, 89%)
as a pale yellow solid; R.sub.f 0.35 (CH.sub.2Cl.sub.2/MeOH 95:5,
v/v); .delta..sub.H (CDCl.sub.3) 8.23 (2 H, d, J 8.4 and 9.2),
8.19-8.13 (3 H, m), 8.05-7.99 (4 H, m), 7.14 (2 H, d, J 8.8), 6.82
(2 H, d, J 9.0), 6.30 (2 H, d, J 8.7), 6.20 (2 H, d, J 8.6), 5.87
(1 H, d, J 7.2), 4.43 (2 H, s), 4.41 (1 H, m), 4.01 (1 H, d, J
9.4), 3.91 (1 H, d, J 11.8), 3.86 (1 H, d, J 9.2), 3.77 (1 H, d, J
1.9), 3.76 (3 H, s), 3.70-3.64 (3 H, m), 3.52-3.45 (1 H, m), 3.44
(3 H, s); .delta..sub.c (CDCl.sub.3) 159.5, 158.9, 133.9, 131.4,
131.1, 130.7, 129.7, 129.5, 129.2, 128.9, 128.5, 127.8, 127.7,
127.5, 126.0, 125.5, 125.3, 125.2, 125.1, 125.0, 124.9, 122.9,
113.9, 113.3, 89.5, 83.5, 82.0, 75.7, 73.4, 71.3, 71.0, 69.3, 55.3,
55.0; m/z (MALDI) 627 [M+Na].sup.+, 609 [M++Na-H.sub.2O].sup.+.
EXAMPLE 38e
(2S,3S,4S)-4-Hydroxy-2-[(R)-hydroxy(2,4,5-trimethylphenyl)methyl]-4-(p-met-
hoxybenzyloxy)-3-(p-methoxybenzyloxymethyl) tetrahydrofuran
[Compound 12e of Scheme 2]
[0589] Tetrahydrofuran 12e was synthesized from aldehyde 11 (515
mg, 1.28 mmol), 1-bromo-2,4,5-trimethylbenzene (1.28 g, 6.4 mmol),
magnesium turnings (155 mg, 6.4 mmol), iodine (10 mg) and THF (20
cm.sup.3) following the procedure described for synthesis of
compound 12c. The crude product was purified by column
chromatography [3-4% (v/v) MeOH in CH.sub.2Cl.sub.2] to give
tetrahydrofuran 12e (589 mg, 88%) as a colorless oil; R.sub.f 0.34
(CH.sub.2Cl.sub.2/MeOH 95:5, v/v); .delta..sub.H (CDCl.sub.3) 7.25
(2 H, d, J 8.7), 7.21 (2 H, d, J 8.9), 6.90 (1 H, s), 6.87 (1 H,
s), 6.85 (2 H, d, J 8.9), 6.76 (2 H, d, J 8.7), 4.95 (1 H, dd, J
3.6 and 5.9), 4.48 (2 H, s), 4.18-4.08 (3 H, m), 3.89 (1 H, d, J
9.6), 3.80 (1 H, m), 3.79 (3 H, s), 3.77 (3 H, s), 3.71 (1 H, d, J
9.2), 3.64 (1 H, d, J 2.6), 3.51 (1 H, d, J 9.4), 3.24 (1 H, s),
3.18 (1 H, d, J 3.4), 2.25 (3 H,s), 2.22 (3 H,s), 2.21 (3 H, s);
.delta..sub.c (CDCl.sub.3) 159.5, 159.3, 136.0, 135.8, 134.2,
132.5,132.0, 129.8, 129.7, 129.6, 129.5, 128.5,113.9, 113.8, 88.6,
84.7, 81.7, 75.4, 73.5, 71.7, 70.9, 69.4, 55.3, 19.5, 19.4, 19.0;
m/z (FAB) 545 [M+Na].sup.+, 521 [M-H].sup.+, 503
[M-H--H.sub.2O].sup.+.
EXAMPLE 39
General Procedure for the Cyclization of 12a-e to Give Compounds
13a-e as Shown in Scheme 2.
[0590] N,N',N'-Tetramethylazodicarboxamide (TMAD) was added in one
portion to a stirred solution of the compounds 12a-e as shown in
Scheme 2 and tributylphosphine in benzene at 0.degree. C. The
mixture was stirred for 12 h at room temperature whereupon it was
diluted with diethyl ether (50 cm.sup.3). The organic phase was
washed successively with saturated aqueous NH.sub.4Cl (2.times.20
cm.sup.3) and brine (25 cm.sup.3), dried (Na.sub.2SO.sub.4),
filtered and evaporated to dryness under reduced pressure. The
crude product obtained was purified by column chromatography
[1.5-2% (v/v) MeOH in CH.sub.2Cl.sub.2] to give compounds 13a-e as
shown in Scheme 2.
Example 39a
(1S,3S,4R,7S)-7-(p-Methoxybenzyloxy)-1-(p-methoxybenzyloxymethyl)-3-phenyl-
-2,5-dioxabicyclo[2.2.1]heptane [Compound 13a of Scheme 2]
[0591] Cyclization of compound 12a (540 mg, 1.13 mmol) in the
presence of TMAD (310 mg, 1.8 mmol), PBu.sub.3 (364 mg, 1.8 mmol)
and benzene (10 cm.sup.3) followed by the general work-up procedure
and column chromatography afforded compound 13a as a colorless oil
(400 mg, 77%); R.sub.f 0.51 (CH.sub.2Cl.sub.2/MeOH 98:2, v/v);
.delta..sub.H (CDCl.sub.3) 7.36-7.33 (7 H, m), 7.10 (2 H, d, J
8.3), 6.88 (2 H, d, J 8.7), 6.78(2 H, d, J 8.7), 5.17 (1 H, s,
H-3), 4.59 (2 H, br s, --CH.sub.2(MPM)), 4.43 (1 H, d, J
11.3,-CH.sub.2(MPM)), 4.34 (1 H, d, J 11.3,-CH.sub.2(MPM)), 4.19 (1
H, s, H-4), 4.09 (1 H, d, J 7.7, H-6), 4.06 (1 H, d, J 7.7, H-6),
4.01 (1 H, s, H-7), 3.82-3.77 (5 H, m, --C.sub.1-CH.sub.2--O--,
OCH.sub.3), 3.76 (3 H, s, --OCH.sub.3); .delta..sub.c (CDCl.sub.3)
159.4, 159.3, 139.4 (C-1'), 130.3, 129.7, 129.5, 129.3, 128.5,
127.5, 125.4, 113.9, 113.8, 85.9 (C-1), 84.1 (C-3), 81.1 (C-4),
77.4 (C-7), 73.7 (--CH.sub.2(MPM)), 73.4 (C-6), 71.8
(--CH.sub.2(MPM)), 66.3 (--C.sub.1--CH.sub.2--O--), 55.4
(--OCH.sub.3), 55.3 (--OCH.sub.3); m/z (FAB) 467
[M+Na-H.sub.2O].sup.+, 461 [M-H].sup.+.
EXAMPLE 39b
(1S,3S,4R,7S)-3-(4-Fluoro-3-methylphenyl)-7-(p-methoxybenzyloxy)-1-(p-meth-
oxybenzyloxymethyl)-2,5-dioxabicyclo[2.2.1]heptane [Compound 13b of
Scheme 2]
[0592] Cyclization of compound 12b (550 mg, 1.08 mmol) in the
presence of TMAD (275 mg, 1.6 mmol), PBu.sub.3 (325 mg, 1.6 mmol)
and benzene (10 cm.sup.3) followed by the general work-up procedure
and column chromatography afforded compound 13b as a colorless oil
(445 mg, 84%); R.sub.f 0.52 (CH.sub.2Cl.sub.2/MeOH 98:2, v/v);
.delta..sub.H (CDCl.sub.3) 7.28 (2 H, d, J 8.7), 7.11 (2 H, d, J
8.6), 7.08-7.09 (2 H, m, H-2' and H-6'), 6.94 (1 H, dd, J 8.5 and
9.2, H-5'), 6.88 (2 H, d, J 8.6), 6.79 (2 H, d, J 8.4), 5.08(1 H,
s, H-3), 4.62-4.55 (2 H, m, --CH.sub.2(MPM)), 4.45 (1 H, d, J 11.1,
--CH.sub.2(MPM)), 4.36 (1 H, d, J 11.6,--CH.sub.2(MPM)), 4.13 (1 H,
s, H-4), 4.07, 4.03 (1 H each, 2d, J 7.6 each, H-6), 3.99 (1 H, s,
H-7), 3.81 (2 H, m, --C.sub.1-CH.sub.2--O--), 3.80 (3 H, s,
--OCH.sub.3), 3.77 (3 H, s, --OCH.sub.3), 2.23 (3 H, d, J 1.6,
Ar--CH.sub.3); .delta..sub.c (CDCl.sub.3) 162.3 (C-4'), 159.4,
159.3, 134.8, 134.7, 130.3, 129.6, 129.5, 129.2, 128.5, 128.4,
128.3, 124.2, 115.1, 114.8, 113.9, 113.8,85.9 (C-1), 83.5 (C-3),
81.0 (C-4), 77.1 (C-7), 73.6 (--CH.sub.2(MPM)), 73.4 (C-6), 71.8
(--CH.sub.2(MPM)), 66.2 (--C.sub.1, --CH.sub.2--O--), 55.4
(--OCH.sub.3), 55.3 (--OCH.sub.3), 14.7 ( d, J 3.3, Ar--CH.sub.3);
m/z (FAB) 494 [M].sup.+, 493 [M-H].sup.+.
EXAMPLE 39c
(1S,3S,4R,7S)-7-(p-Methoxybenzyloxy)-1-(p-methoxybenzyloxymethyl)-3-(1-nap-
hthyl)-2,5-dioxabicyclo[2.2.1]heptane [Compound 13c of Scheme
2]
[0593] Cyclization of compound 12c (700 mg, 1.32 mmol) in the
presence of TMAD (345 mg, 2.0 mmol), PBu.sub.3 (405 mg, 2.0 mmol)
and benzene (15 cm.sup.3) followed by the general work-up procedure
and column chromatography afforded compound 13c as a colorless oil
(526 mg, 78%); R.sub.f 0.53 (CH.sub.2Cl.sub.2/MeOH 98:2, v/v);
.delta..sub.H (CDCl.sub.3) 7.91-7.86 (2 H, m), 7.78 (1 H, d, J
8.2), 7.73 (1 H, d, J 7.1), 7.53-7.46 (3 H, m), 7.32 (2 H, d, J
8.7), 7.04 (2 H, d, J 8.7), 6.90 (2 H, d, J 8.3), 6.71 (2 H, d, J
8.6), 5.79 (1 H, s, H-3), 4.67-4.61 (2 H, m, --CH.sub.2(MPM)), 4.43
(1 H, s, H-4), 4.38 (1 H, d, J 11.2, --CH.sub.2(MPM)), 4.27 (1 H,
d, J 10.9, --CH.sub.2(MPM)), 4.16 (2 H, br s, H-6), 4.08 (1 H, s,
H-7), 3.91, 3.87 (1 H each, 2d, J 11.0 each, --Cl--CH.sub.2--O--),
3.81 (3 H, s, --OCH.sub.3), 3.72 (3 H, s, --OCH.sub.3);
.delta..sub.c (CDCl.sub.3) 159.3, 134.6 (C-1'), 133.5, 130.3,
129.8, 129.7, 129.4, 129.3, 128.9, 128.1, 126.4, 125.8, 125.6,
123.8, 122.7, 113.9, 113.7, 85.7 (C-1), 82.3 (C-3), 79.9 (C-4),
78.2 (C-7), 73.7 (--OCH.sub.2(MPM)), 73.5 (C-6), 71.8
(--OCH.sub.2(MPM)), 66.3 (--C.sub.1--CH.sub.2--O--), 55.4
(--OCH.sub.3), 55.3 (--OCH.sub.3); m/z (FAB) 512 [M].sup.+, 511
[M-H].sup.+.
EXAMPLE 39d
(1S,3S,4R,7S)-7-(p-Methoxybenzyloxy)-1-(p-methoxybenzyloxymethyl)-3-(1-pyr-
enyl)-2,5-dioxabicyclo[2.2.1]heptane [Compound 13d of Scheme 2]
[0594] Cyclization of compound 12d (650 mg, 1.08 mmol) in the
presence of TMAD (275 mg, 1.6 mmol), PBu.sub.3 (325 mg, 1.6 mmol)
and benzene (10 cm.sup.3) followed by the general work-up procedure
and column chromatography afforded compound 13d as a pale yellow
solid (496 mg, 79%); R.sub.f 0.53 (CH.sub.2Cl.sub.2/MeOH 98:2,
v/v); .delta..sub.H (CDCl.sub.3) 8.29 (1 H, d, J 8.2), 8.18-8.12 (5
H, m), 8.08-8.01 (2 H, m), 7.96 (1 H, d, J 7.5), 7.35 (2 H, d, J
8.5), 6.97 (2 H, d, J 8.9), 6.92 (2 H, d, J 8.8), 6.60 (2 H, d, J
8.8), 6.09 (1 H, s, H-3), 4.71-4.65 (2 H, m, --CH.sub.2(MPM)), 4.49
(1 H, s, H-4), 4.34 (1 H, d, J 11.4, --CH.sub.2(MPM)), 4.23 (1 H,
d, J 11. 1, --CH.sub.2(MPM)), 4.25 (1 H, d, J 7.6, H-6), 4.21 (1 H,
d, J 7.8, H-6), 4.16 (1 H, s, H-7), 3.95-3.94 (2 H, m,
--C.sub.1--CH.sub.2--O--), 3.81 (3 H, s, --OCH.sub.3), 3.59 (3 H,
s, --OCH.sub.3); .delta..sub.c (CDCl.sub.3) 159.4, 159.3, 132.2
(C-1'), 131.4, 130.8, 130.7, 130.4, 129.5, 129.4, 128.0,127.5,
127.4, 126.9, 126.1, 125.6, 125.4, 124.9, 124.8, 124.7, 123.6,
122.0, 113.9, 113.7,85.9 (C-1), 82.7 (C-3), 80.6 (C-4), 77.9 (C-7),
73.9 (--OCH.sub.2(MPM)), 73.5 (C-6), 71.8 (--OCH.sub.2(MPM)), 66.3
(--C.sub.1--CH.sub.2--O--), 55.4 (--OCH.sub.3), 55.2 (--OCH.sub.3);
m/z (FAB) 587 [M+H].sup.+, 586 [M].sup.+.
EXAMPLE 39e
(1S,3S,4R,7S)-7-(p-Methoxybenzyloxy)-1-(p-methoxybenzyloxymethyl)-3-(2,4,5-
-trimethylphenyl)-2,5-dioxa bicyclo[2.2.1]heptane [Compound 13e of
Scheme 2]
[0595] Cyclization of compound 12e (550 mg, 1.05 mmol) in the
presence of TMAD (275 mg, 1.6 mmol), PBu.sub.3 (325 mg, 1.6 mmol)
and benzene (10 cm.sup.3) followed by the general work-up procedure
and column chromatography afforded compound 13e as a colorless oil
(425 mg, 80%); R.sub.f 0.52 (CH.sub.2Cl.sub.2/MeOH 98:2, v/v);
.delta..sub.H (CDCl.sub.3) 7.30 (2 H, d, J 9.0), 7.24 (1 H, s,
H-6'), 7.13 (2 H, d, J 8.9), 6.89(1 H, s, H-3'), 6.88 (2 H, d, J
8.8), 6.79 (2 H, d, J 8.6), 5.18 (1 H, s, H-3), 4.64-4.57 (2 H, m,
--CH.sub.2(MPM)), 4.46 (1 H, d, J 11.2, --CH.sub.2(MPM)), 4.36 (1
H, d, J 11.5, --CH.sub.2(MPM)), 4.18 (1 H, s, H-4), 4.14 (1 H, s,
H-7), 4.09 (1 H, d, J 7.9, H-6), 4.04 (1 H, d, J 7.7, H-6), 3.86 (2
H, s, --C.sub.1--CH.sub.2--O--), 3.80 (3 H, s, --OCH.sub.3), 3.76
(3H, s, --OCH.sub.3), 2.21 (6 H, s, 2.times.Ar--CH.sub.3), 2.17 (3
H, s, Ar--CH.sub.3); .delta..sub.c (CDCl.sub.3) 159.4, 159.3, 135.5
(C-1'), 134.4, 134.0, 131.7, 131.3, 130.5, 129.9, 129.4, 129.2,
127.2, 113.9, 113.8, 85.6 (C-1), 82.4 (C-3), 79.4 (C-4), 77.6
(C-7), 73.5 (--OCH.sub.2(MPM)), 73.4 (C-6), 71.8
(--OCH.sub.2(MPM)), 66.3 (--C.sub.1--CH.sub.2--O--), 55.4
(--OCH.sub.3), 55.3 (--OCH.sub.3), 19.5 (--CH.sub.3), 19.3
(--CH.sub.3), 18.4 (--CH.sub.3); m/z (FAB) 504 [M].sup.+, 503
[M-H].sup.+.
EXAMPLE 40
General Procedure for the Oxidative Removal of the p-methoxybenzyl
Groups to Give Compounds 14a-e as Shown in Scheme 2
[0596] To a stirred solution of Compound 13a-e in CH.sub.2Cl.sub.2
(containing a small amount of H.sub.2O) at room temperature, was
added 2,3-dichloro-5,6-dicyanoquinone (DDQ) which resulted in an
immediate appearance of a deep greenish-black color which slowly
faded into pale brownish-yellow. The reaction mixture was
vigorously stirred at room temperature for 4 h. The precipitate was
removed by filtration through a short pad of silica gel and washed
with EtOAc. The combined filtrate was washed, successively, with
saturated aqueous NaHCO.sub.3 (2.times.25 cm.sup.3) and brine (25
cm.sup.3). The separated organic phase was dried
(Na.sub.2SO.sub.4), filtered and evaporated to dryness under
reduced pressure. The crude product obtained was purified by column
chromatography [4-5% (v/v) MeOH in CH.sub.2Cl.sub.2] to give
compounds 14a-e.
EXAMPLE 40a
(1S,3S,4R,7S)-7-Hydroxy-1-hydroxymethyl-3-phenyl-2,5-dioxabicyclo[2.2.1]-h-
eptane [Compound 14a of Scheme 2]
[0597] Compound 13a (400 mg, 0.86 mmol) was treated with DDQ (600
mg, 2.63 mmol) in a mixture of CH.sub.2Cl.sub.2 (10 cm.sup.3) and
H.sub.2O (0.5 cm.sup.3). After the general work-up procedure and
column chromatography, compound 14a was obtained as a white solid
material (128 mg, 66%); R.sub.f 0.30 (CH.sub.2Cl.sub.2/MeOH 9:1,
v/v); .delta..sub.H ((CD.sub.3).sub.2CO/CD.sub.3OD;
(CD.sub.3).sub.2CO was added to the compound followed by addition
of CD.sub.3OD until a clear solution appeared) 7.40-7.22 (5 H, m),
4.99 (1 H, s), 4.09 (1 H, s), 4.04 (1 H, s), 4.01(1 H, d, J 7.7),
3.86 (1 H, d, J 7.7), 3.90 (2 H, br s), 3.77 (2 H, br s);
.delta..sub.c ((CD.sub.3).sub.2CO/CD.sub.3OD; (CD.sub.3).sub.2CO
was added to the compound followed by addition of CD.sub.3OD until
a clear solution appeared) 140.0, 128.2, 127.2, 125.4, 87.2, 83.7,
83.5, 72.3, 70.2, 58.4; m/z (FAB) 223 [M+H].sup.+.
EXAMPLE 40b
(1S,3S,4R,7S)-3-(4-Fluoro-3-methylphenyl)-7-hydroxy-1-hydroxymethyl-2,5-di-
oxabicyclo[2.2.]heptane [Compound 14b of Scheme 2]
[0598] Compound 13b (400 mg, 0.81 mmol) was treated with DDQ (570
mg, 2.5 mmol) in a mixture of CH.sub.2Cl.sub.2 (10 cm.sup.3) and
H.sub.2O (0.5 cm.sup.3). After the general work-up procedure and
column chromatography, compound 14b was obtained as a white solid
material (137 mg, 67%); R.sub.f 0.31 (CH.sub.2Cl.sub.2/MeOH 9:1,
v/v); .delta..sub.H (CD.sub.3OD) 7.23 (1 H, d, J 8.1), 7.19 (1 H,
m), 6.99 (1 H, dd, J 8.5 and 9.3), 4.99 (1 H, s), 4.09 (1 H, s),
4.06 (1 H, s), 4.03 (1 H, d, J 7.6), 3.93-3.91 (3 H, m), 2.25 (3 H,
d, J 1.4); .delta..sub.c (CD.sub.3OD) 161.9 (d, J 243.3), 136.4 (d,
J 3.4), 129.6 (d, J 5.0), 126.1 (d, J 22.8), 125.5 (d, J 8.0),
115.7 (d, J 22.9), 88.5, 85.0, 84.3, 73.5, 71.3, 59.4, 14.5 (d, J
3.7); m/z (FAB) 255 [M+H].sup.+.
EXAMPLE 40c
(1S,3S,4R,7S)-7-Hydroxy-1-hydroxymethyl-3-(1-naphthyl)-2,5-dioxabicyclo-[2-
.2.1]heptane [Compound 14b of Scheme 2]
[0599] Compound 13c (475 mg, 0.93 mmol) was treated with DDQ (600
mg, 2.63 mmol) in a mixture of CH.sub.2Cl.sub.2 (10 cm.sup.3) and
H.sub.2O (0.5 cm.sup.3). After the general work-up procedure and
column chromatography, compound 14c was obtained as a white solid
material (170 mg, 67%); R.sub.f 0.31 (CH.sub.2Cl.sub.2MeOH 9:1,
v/v); .delta..sub.H CDCl.sub.3/CD.sub.3OD; CD.sub.3OD was added to
the compound followed by addition of CDCl.sub.3 until a clear
solution appeared) 7.94-7.86 (2 H, m), 7.80-7.74 (2 H, m),
7.55-7.46 (3 H, m), 5.74 (1 H, s), 4.56 (2 H, br s), 4.37 (1 H, s),
4.24 (1 H, s), 4.17-4.11 (2 H, m), 4.04 (2 H, br s); .delta..sub.c
(CDCl.sub.3/CD.sub.3OD; CD.sub.3OD was added to the compound
followed by addition of CDCl.sub.3 until a clear solution appeared
134.7, 134.0, 130.2, 129.3, 128.6, 126.8, 126.2, 125.8, 123.8,
122.8, 87.4, 83.1, 82.2, 73.1, 71.5, 59.0; m/z (FAB) 273
[M+H].sup.+, 272 [M].sup.+.
Example 40d
(1S,3S,4R,7S)-7-Hydroxy-1-hydroxymethyl-3-(1-pyrenyl)-2,5-dioxabicyclo-[2.-
2.1]heptane [Compound 14d of Scheme 2]
[0600] Compound 13d (411 mg, 0.7 mmol) was treated with DDQ (570
mg, 2.5 mmol) in a mixture of CH.sub.2Cl.sub.2 (10 cm.sup.3) and
H.sub.2O (0.5 cm.sup.3). After the general work-up procedure and
column chromatography, compound 14d was obtained as a white solid
material (182 mg, 75%); R.sub.f 0.32 (CH.sub.2Cl.sub.2MeOH 9:1,
v/v); .delta..sub.H (CDCl.sub.3/CD.sub.3OD; CD.sub.3OD was added to
the compound followed by addition of CDCl.sub.3 until a clear
solution appeared) 8.32 (1 H, d, J 7.8), 8.23-8.18 (5 H, m), 8.06
(2 H, br s), 8.01(1 H, d, J7.6), 6.06 (1 H, s), 4.47 (1 H, s),
4.36(1 H, s), 4.27-4.18 (2 H, m), 4.10 (2 H, br s); .delta..sub.c
(CDCl.sub.3CD.sub.3OD) 132.2, 131.0, 128.5, 127.8, 127.3, 126.5,
125.9, 125.7, 125.1, 123.6, 122.1, 87.7, 83.7, 82.6, 73.1, 71.4,
58.9; mz (FAB) 347 [M+H].sup.+, 346 [M].sup.+.
Example 40e
(1S,3S,4R,7S)-7-Hydroxy-1-hydroxymethyl-3-(2,4,5-trimethylphenyl)-2,5-diox-
abicyclo[2.2.1]heptane [Compound 14e of Scheme 2]
[0601] Compound 13e (355 mg, 0.7 mmol) was treated with DDQ (570
mg, 2.5 mmol) in a mixture of CH.sub.2Cl.sub.2 (10 cm.sup.3) and
H.sub.2O (0.5 cm.sup.3). After the general usual work-up procedure
and column chromatography, compound 14e was obtained as a white
solid material (120 mg, 65%); R.sub.f 0.31 (CH.sub.2Cl.sub.2MeOH
9:1, vv); .delta..sub.H (CDCl.sub.3CD.sub.3OD; CD.sub.3OD was added
to the compound followed by addition of CDCl.sub.3 until a clear
solution appeared) 7.23 (1 H, s), 6.92 (1 H, s), 5.14 (1 H, s),
4.26 (1 H, s), 4.10 (1 H, s), 4.08, (1 H, d, J7.7), 4.00-3.95 (3 H,
m), 2.23 (6 H, s), 2.21 (1 H, s); .delta..sub.c
(CDCl.sub.3/CD.sub.3OD; CD.sub.3OD was added to the compound
followed by addition of CDCl.sub.3 until a clear solution appeared)
135.6, 133.9, 133.8, 131.7, 131.2, 126.6, 86.6, 82.1, 81.9, 72.3,
70.6, 58.5, 19.2, 19.0, 18.1; mz (FAB) 265 [M+H].sup.+, 264
[M].sup.+.
Example 41
General Procedure for Dimethoxytritylation of Compounds 14a-e to
give Compounds 15a-e as Shown in Scheme 2.
[0602] 4,4'-Dimethoxytrityl chloride (DMTCl) was added in one
portion to a stirred solution of compound 14a-e in anhydrous
pyridine. After stirring the mixture at room temperature for 4 h,
methanol (0.2 cm.sup.3) was added and the resulting mixture was
evaporated to dryness under reduced pressure. The residue was
coevaporated with anhydrous CH.sub.3CN (2.times.5 cm.sup.3) and
anhydrous toluene (2.times.5 cm.sup.3) and then dissolved in
CH.sub.2Cl.sub.2 (20 cm.sup.3, traces of acid removed by filtration
through a short pad of basic alumina). The resulting solution was
washed, successively, with saturated aqueous NaHCO.sub.3
(2.times.10 cm.sup.3) and brine (10 cm.sup.3). The separated
organic phase was dried (Na.sub.2SO.sub.4), filtered and evaporated
to dryness under reduced pressure. The crude product obtained was
purified by column chromatography [0.25- 0.50% (v/v) MeOH in
CH.sub.2Cl.sub.2, containing 0.5% Et.sub.3N] affording compounds
15a-e.
Example 41a
(1R,3S,4R,7S)-1-(4,4'-Dimethoxytrityloxymethyl)-7-hydroxy-3-phenyl-2,5-dio-
xabicyclo[2.2.1]heptane [Compound 15a of Scheme 2]
[0603] Dimethoxytritylation of compound 14a (108 mg, 0.49 mmol)
using DMTC1 (214 mg, 0.63 mmol) in anhydrous pyridine (2 cm.sup.3)
followed by the general work-up procedure and column chromtography
afforded compound 15a as a white solid material (180 mg, 71%);
R.sub.f 0.31 (CH.sub.2Cl.sub.2MeOH 98:2, v/v); & (CDCl.sub.3)
7.66-7.21 (14 H, m), 6.84 (4 H, d, J 8.8), 5.19 (1 H, s), 4.29 (1
H, s), 4.13 (1 H, s), 4.07 (1 H, d, J8.4), 4.01 (1 H, d, J8.3),
3.78 (6 H, s), 3.55 (1 H, d, J 10.2), 3.50 (1 H, d, J 10.7), 2.73
(1 H, br s); .delta..sub.c (CDCl.sub.3) 158.6, 149.8, 144.9, 139.4,
136.2, 135.9, 135.8, 130.3, 130.2, 128.5, 128.3, 128.0, 127.6,
126.9, 125.4, 123.9, 113.3, 86.4, 86.0, 83.8, 83.4, 73.0, 71.6,
60.2, 55.3; mz (FAB) 525 [M+H].sup.+, 524 [M].sup.+.
Example 41b
(1R,3S,4R,7S)-1-(4,4'-Dimethoxytrityloxymethyl)-3-(4-fluoro-3-methylphenyl-
)-7-hydroxy-2,5-dioxabicyclo[2.2.1]heptane [Compound 15b of Scheme
2]
[0604] Dimethoxytritylation of compound 14b (95 mg, 0.38 mmol)
using DMTCl (129 mg, 0.42 mmol) in anhydrous pyridine (2 cm.sup.3)
followed by the general work-up procedure and column chromatography
afforded compound 15b as a white solid material (126 mg, 61%);
R.sub.f 0.32 (CH.sub.2Cl.sub.2/MeOH 98:2, v/v);
.delta..sub.H(CDCl.sub.3) 7.53-7.15 (11 H, m), 6.97 (1 H, dd, J 8.7
and 8.9), 6.84 (4 H, d, J 8.8), 5.11 (1 H, s), 4.26 (1 H, d, J
3.9), 4.08 (1 H, s), 4.03 (1 H, d, J 8.0), 3.95 (1 H, d, J 8.0),
3.78 (6 H, s), 3.54 (1 H, d, J 10.5), 3.47 (1 H, d, J 10.1), 2.26
(3 H, d, J 1.5), 2.08 (1 H, br s); .delta..sub.c (CDCl.sub.3) 160.8
(d, J244.1), 158.7, 144.9, 135.9, 134.7, 134.6, 130.3, 130.2,
130.1, 128.5, 128.4, 128.3, 128.0, 127.0, 125.2, 124.9, 124.4,
124.3, 115.2, 114.9, 113.4, 86.5, 86.0, 83.7, 83.0, 72.9, 71.7,
60.1, 55.3, 14.8 (d, J 3.1); mz (FAB) 556 [M].sup.+.
Example 41c
1R,3S,4R,7S)-1-(4,4'-Dimethoxytrityloxymethyl)-7-hydroxy-3-(1-naphthyl)-2,-
5-dioxabicyclo[2.2.1]heptane [Compound 15c of Scheme 2]
[0605] Dimethoxytritylation of compound 14c (125 mg, 0.46 mmol)
using DMTCl (170 mg, 0.5 mmol) in anhydrous pyridine (2 cm.sup.3)
followed by the general work-up procedure and column chromatography
afforded compound 15c as a white solid material (158 mg, 60%);
R.sub.f 0.35 (CH.sub.2Cl.sub.2/MeOH 98:2, v/v); & (CDCl.sub.3)
7.95-7.86 (3 H, m), 7.79 (1 H, d, J 8.3), 7.58-7.41 (9 H, m),
7.35-7.23 (3 H, m), 6.86 (4 H, d, J 8.8), 5.80 (1 H, s), 4.36 (1 H,
s), 4.32 (1 H, d, J 6.5), 4.17 (1 H, d, J 8.3), 4.06 (1 H, d, J
8.0), 3.78 (6 H, s), 3.62-3.56 (2 H, m), 2.00 (1 H, d, J 6.6);
.delta..sub.c (CDCl.sub.3) 158.7, 144.9, 136.0, 135.9, 134.5,
133.6, 130.3, 129.8, 129.0, 128.3, 128.2, 128.1, 127.0, 126.5,
125.9, 125.6, 123.9, 122.6, 113.4, 86.6, 85.7, 82.5, 81.7, 73.1,
72.6, 60.2, 55.3; mz (FAB) 575 [M+H].sup.+, 574 [M].sup.+.
Example 41d
(1R,3S,4R,7S)-1-(4,4'-Dimethoxytrityloxymethyl)-7-hydroxy-3-(1-pyrenyl)-2,-
5-dioxabicyclo[2.2.1]heptane [Compound 15d of Scheme 2]
[0606] Dimethoxytritylation of the compound 14d (130 mg, 0.38 mmol)
using DMTCl (140 mg, 0.42 mmol) in anhydrous pyridine (2 cm.sup.3)
followed by the general work-up procedure and column chromatography
afforded compound 15d as a white solid material (147 mg, 61%);
R.sub.f 0.37 (CH.sub.2Cl.sub.2MeOH 98:2, v/v); .delta..sub.H
(CDCl.sub.3) 8.46 (1 H, d, J 8.0), 8.19-8.00 (7 H, m), 7.61 (2 H,
dd, J 1.6 and 7.4), 7.48 (4 H, d, J8.3), 7.35 (2 H, dd, J7.2 and
7.5), 7.25 (1 H, m), 7.15 (1 H, m), 6.88 (4 H, d, J9.0), 6.10 (1 H,
s), 4.46 (1 H, s), 4.43 (1 H, br s), 4.25 (1 H, d, J8.1), 4.12 (1
H, d, J 8.1), 3.79 (6H, s), 3.71-3.63 (2 H, m), 2.22 (1 H, br s);
.delta..sub.c (CDCl.sub.3) 158.7, 149.8, 144.9, 136. 1, 136.0,
135.9, 132.1, 131.4, 130.9, 130.6, 130.3, 130.2, 129.2, 129.1,
128.4, 128.3, 128.2, 128.1, 127.5, 127.4, 127.0, 126.9, 126.2,
125.5, 125.4, 124.9, 124.8, 124.7, 123.8, 123.7, 121.9, 113.4,
86.6, 86.1, 83.2, 82.2, 73.2, 72.4, 60.3, 55.3; mz (FAB) 649
[M+H].sup.+, 648 [M].sup.+.
Example 41e
(1R,3S,4R,7S)-1-(4,4'-Dimethoxytrityloxymethyl)-7-hydroxy-3-(2,4,5-trimeth-
ylphenyl)-2,5-dioxabicyclo[2.2.1]heptane [Compound 15e of Scheme
2]
[0607] Dimethoxytritylation of compound 14e (80 mg, 0.3 mmol) using
DMTCl (113 mg, 0.33 mmol) in anhydrous pyridine (2 cm.sup.3)
followed by the general work-up procedure and column chromatography
afforded compound 15e as a white solid material (134 mg, 78%);
R.sub.f 0.32 (CH.sub.2Cl.sub.2MeOH 98:2, v/v); .delta..sub.H
CDCl.sub.3) 7.55 (2 H, d, J7.9), 7.45-7.42 (4 H, m), 7.32-7.21 (4
H, m), 6.93 (1 H, s), 6.84 (4 H, d, J 8.2), 5.20 (1 H, s), 4.40 (1
H, s), 4.08 (1 H, s), 4.04 (1 H, d, J 8.3), 3.95 (1 H, d, J 8.2),
3.78 (6 H, s), 3.56 (1 H, d, J 10.5), 3.47 (1 H, d, J 10.2), 2.24
(3 H, s), 2.22 (3 H, s), 2.19 (3 H, s); .delta..sub.c (CDCl.sub.3)
158.6, 145.0, 136.0, 135.7, 134.4, 134.2, 131.8, 131.3,130.3,
130.2, 128.3, 128.0, 127.2, 126.9, 113.3, 86.4, 85.7, 82.1, 81.8,
73.0, 71.8, 60.2, 55.3, 19.6, 19.3, 18.4; mz (FAB) 567 [M+H].sup.+,
566 [M].sup.+.
Example 42
General Procedure for Synthesis of the Phosphoramidite Derivatives
16a-e as Shown in Scheme 2
[0608] 2-Cyanoethyl N,N'-diisopropylphosphoramidochloridite was
added dropwise to a stirred solution of nucleoside 15a-e and
N,N'-diisopropylethylamine (DIPEA) in anhydrous CH.sub.2Cl.sub.2 at
room temperature. After stirring the mixture at room temperature
for 6 h, methanol (0.2 cm.sup.3) was added and the resulting
mixture diluted with EtOAc (20 cm.sup.3, containing 0.5% Et.sub.3N,
v/v). The organic phase was washed, successively, with saturated a.
NaHCO.sub.3 (2.times.10 cm.sup.3) and brine (10 cm.sup.3). The
separated organic phase was dried (Na.sub.2SO.sub.4), filtered and
evaporated to dryness under reduced pressure. The residue obtained
was purified by column chromatography [25-30% (v/v) EtOAc in
n-hexane containing 0.5% Et.sub.3N] to give the amidites 16a-e.
Example 42a
Synthesis of
(1R,3S,4R,7S)-7-[2-Cyanoethoxy(diisopropylamino)phosphinoxy]-1-(4,4'-dime-
thoxytrityloxymethyl)-3-phenyl-2,5-dioxabicyclo[2.2.1] heptane
[Compound 16a of Scheme 2]
[0609] Treatment of compound 15a (170 mg, 0.32 mmol) with
2-cyanoethyl N,N'-diisopropylphosphoramidochloridite (85 mg, 0.36
mmol) in the presence of DIPEA (0.4cm.sup.3) and anhydrous
CH.sub.2Cl.sub.2 (2.0 cm.sup.3) followed by the general work-up
procedure and column chromatography afforded phosphoramidite 16a as
a white solid material (155 mg, 66%); R.sub.f 0.45, 0.41
(CH.sub.2C.sub.2/MeOH 98:2, v/v); .delta..sub.P (CDCl.sub.3) 149.3,
148.9.
Example 42b
(1R,3S,4R,7S)-7-[2-Cyanoethoxy(diisopropylamino)phosphinoxy]-1-(4,4'-dimet-
hoxytrityloxymethyl)-3-(4-fluoro-3-methylphenyl)-2,5-dioxabicyclo[2.2.1]he-
ptane [Compound 16b of Scheme 2]
[0610] Treatment of compound 15b (95 mg, 0.17 mmol) with
2-cyanoethyl N,N'-diisopropylphosphoramidochloridite (53 mg, 0.22
mmol) in the presence of DIPEA (0.3cm.sup.3) and anhydrous
CH.sub.2Cl.sub.2 (2.0 cm.sup.3) followed by the general work-up
procedure and column chromatography afforded phosphoramidite 16b as
a white solid material (85 mg, 66%); R.sub.f 0.45, 0.41
(CH.sub.2Cl.sub.2/MeOH 98:2, v/v); .delta..sub.P (CDCl.sub.3)
149.3, 148.8.
Example 42c
Synthesis of
(1R,3S,4R,7S)-7-[2-Cyanoethoxy(diisopropylamino)phosphinoxyl-1-(4,4'-dime-
thoxytrityloxymethyl)-3-(1-naphthyl)-2,5-dioxabicyclo[2.2.1]heptane
[Compound 16c of Scheme 2]
[0611] Treatment of compound 5c (158 mg, 0.28 mmol) with
2-cyanoethyl N,N'-diisopropylphosphoramidochloridite (75.7 mg, 0.32
mmol) in the presence of DIPEA (0.4cm.sup.3) and anhydrous
CH.sub.2Cl.sub.2 (2.0 cm.sup.3) followed by the general work-up
procedure and column chromatography afforded phosphoramidite 16c as
a white solid material (127 mg, 60%); R.sub.f 0.47, 0.44
(CH.sub.2Cl.sub.2MeOH 98:2, v/v); .delta..sub.P (CDCl.sub.3) 149.2,
149.1.
Example 42d
Synthesis of (1R,3S,4R,7S)-7-[2-Cyanoethoxy(diisopropylamino)
phosphinoxy]-1-(4,4'-dimethoxytrityloxymethyl)-3-(1-pyrenyl)-2,5-dioxabic-
yclo[2.2.1]heptane [Compound 16d of Scheme 2]
[0612] Treatment of compound 15d (140 mg, 0.22 mmol) with
2-cyanoethyl N,N'-diisopropylphosphoramidochloridite (64 mg, 0.27
mmol) in the presence of DIPEA (0.3cm.sup.3) and anhydrous
CH.sub.2Cl.sub.2 (2.0 cm.sup.3) followed by the general work-up
procedure and column chromatography afforded phosphoramidite 16d as
a white solid material (124 mg, 68%); R.sub.f 0.51, 0.47
(CH.sub.2Cl.sub.2/MeOH 98:2, v/v); .delta..sub.P (CDCl.sub.3)
149.4, 149.1.
Example 42e
Synthesis of (1R,3S,4R,7S)-7-[2-Cyanoethoxy(diisopropylamino)
phosphinoxy]-1-(4,4'-dimethoxytrityloxymethyl)-3-(2,4,5-trimethylphenyl)--
2,5-dioxabicyclo[2.2.1]heptane [Compound 16e of Scheme 2]
[0613] Treatment of compound 15e (130 mg, 0.23 mmol) with
2-cyanoethyl N,N-diisopropylphosphoramidochloridite (64 mg, 0.27
mmol) in the presence of DIPEA (0.3cm.sup.3) and anhydrous
CH.sub.2Cl.sub.2 (2.0 cm.sup.3) followed by the general work-up
procedure and column chromatography afforded phosphoramidite 16e as
a white solid material (111 mg, 63%); R.sub.f 0.44, 0.42
(CH.sub.2Cl.sub.2/MeOH 98:2, v/v); .delta..sub.P (CDCl.sub.3)
149.0.
Example 43
Synthesis, Deprotection and Purification of Oligonucleotides
[0614] All oligomers were prepared using the phosphoramidite
approach on a Biosearch 8750 DNA synthesizer in 0.2 mol scale on
CPG solid supports (BioGenex). The stepwise coupling efficiencies
for phosphoramidites 16a-c (10 min coupling time) and
phosphoramidites 16d and 16e (20 min coupling time) were >96%
and for unmodified deoxynucleoside and ribonucleoside
phosphoramidites (with standard coupling time) generally >99%,
in all cases using 1H-tetrazole as activator. After standard
deprotection and cleavage from the solid support using 32% aqueous
ammonia (12 h, 55.degree. C.), the oligomers were purified by
precipitation from ethanol. The composition of the oligomers were
verified by MALDI-MS analysis and the purity (>80%) by capillary
gel electrophoresis. Selected MALDI-MS data ([M-H].sup.-;
found/calcd.: ON3 2731/2733; ON4 2857/2857; ON6 3094/3093).
Example 44
Thermal Denaturation Studies
[0615] The thermal denaturation experiments were performed on a
Perkin-Elmer UVNVIS spectrometer fitted with a PTP-6 Peltier
temperature-programming element using a medium salt buffer solution
(10 mM sodium phosphate, 100 mM sodium chloride, 0.1 mM EDTA, pH
7.0). Concentrations of 1.5 mM of the two complementary strands
were used assuming identical extinction coefficients for modified
and unmodified oligonucleotides. The absorbance was monitored at
260 nm while raising the temperature at a rate of 1.degree. C. per
min. The melting temperatures (Tm values) of the duplexes were
determined as the maximum of the first derivatives of the melting
curves obtained.
Example 45
Synthesis of Compounds 16a-16e and Oligomers Containing Monomers
17a-17e
[0616] LNA containing the derivatives 17a-17e (FIG. 1, Scheme1,
Scheme 2), were synthesized, all based on the LNA-type
2'-O,4'-C-methylene-.beta.-D-ribofuranosyl moiety which is known to
adopt a locked C3'-endo RNA-like furanose conformation [S. Obika,
D. Nanbu, Y. Hari, K. Morio, Y. In, T. Ishida, and T. Imanishi,
Tetrahedron Lett., 1997, 38, 8735; S. K. Singh, P. Nielsen, A. A.
Koshkin and J. Wengel, Chem. Commun., 1998, 455; A. A. Koshkin, S.
K. Singh, P. Nielsen, V. K. Rajwanshi, R. Kumar, M. Meldgaard, C.
E. Olsen and J. Wengel, Tetrahedron, 1998, 54, 3607; S. Obika, D.
Nanbu, Y. Hari, J. Andoh, K. Morio, T. Doi and T. Imanishi,
Tetrahedron Lett., 1998, 39, 5401]. The syntheses of the
phosphoramidite building blocks 16a-16e suitable for incorporation
of the LNA-type aryl C-glycosides 17a-17e are shown in Scheme 1 and
Scheme 2 and described in details in the experimental section. In
the design of an appropriate synthetic route, it was decided to
utilize a reaction similar to one described recently in the
literature. Thus, stereoselective attack of Grignard reagents of
various heterocycles on a carbonyl group of an aldehyde
corresponding to aldehyde 11 (Scheme 2) but with two O-benzyl
groups instead of the two p-methoxybenzyl groups of aldehyde 11
(Scheme 2) has been reported to furnish locked-C-nucleosides [S.
Obika, Y. Hari, K. Morio and T. Imanishi, Tetrahedron Lett., 2000,
41, 215; S. Obika, Y. Hari, K. Morio and T. Imanishi, Tetrahedron
Lett., 2000, 41, 221]. The key intermediate in the synthetic route
selected herein, namely the novel aldehyde 11 was synthesized from
the known furanoside 1 [R. Yamaguchi, T. Imanishi, S. Kohgo, H.
Horie and H. Ohrui, Biosci. Biotechnol. Biochem.,1999, 63, 736]
following two different routes. In general, O-(p-Methoxy)benzyl
protection was desirable instead of O-benzyl protection as removal
of the benzyl protection at a later stage (i.e. 13->14) could
also likely result in the cleavage of the benzylic O--C.sub.1 bond
present, e.g., in compounds 13 and 14 (Scheme 2). In one route to
give aldehyde 11, regioselectivep-methoxybenzylation of the
furanoside 1, followed by mesylation and methanolysis yielded the
anomeric mixture of the methyl furanosides 9. Base induced
cyclization followed by acetyl hydrolysis afforded the aldehyde 11
in approximately 24% overall yield from 1 (Scheme 1 and Scheme 2).
This yield was improved to following a different strategy. Thus,
di-O-mesylation of 1 followed by methanolysis and base induced
intramolecular nucleophilic attack from the 2-OH group afforded the
cyclized anomeric mixture of methyl furanoside 4. Substitution of
the remaining mesyloxy group of 4 with an acetate group, followed
by deacetylation, p-methoxybenzylation and then acetyl hydrolysis
afforded the required aldehyde 11 (Scheme 1).
[0617] Coupling of the aldehyde 11 with different aryl Grignard
reagents yielded selectively one epimer of each of the compounds
12a-e in good yields (see experimental section for further details
on this and other synthetic steps). Each of the diols 12a-e was
cyclized under Mitsunobu conditions (TMAD, PBu.sub.3) to afford the
bicyclic .beta.-C-nucleoside derivatives 13a-e. Oxidative removal
of thep-methoxybenzyl protections was achieved in satisfactory
yields using DDQ. Subsequent, selective 4,4'-dimethoxytritylation
(to give compounds 15a-e) followed by phosphorylation afforded the
phosphoramidite building blocks 16a-e in satisfactory yields. The
configuration of compounds 13, and thus also compounds 11, 12 and
14-17 were assigned based on 1 H NMR spectroscopy, including NOE
experiments.
[0618] All oligomers were prepared in the 0.2 mol scale using the
phosphoramidite approach. The stepwise coupling efficiencies for
phosphoramidites 16a-c (10 min coupling time) and phosphoramidites
16d and 16e (20 min coupling time) were >96% and for unmodified
deoxynucleoside and ribonucleoside phosphoramidites (with standard
coupling time) generally >99%, in all cases using IH-tetrazole
as activator. After standard deprotection and cleavage from the
solid support using 32% aqueous ammonia (12 h, 55.degree. C.), the
oligomers were purified by precipitation from ethanol. The
composition of the oligomers were verified by MALDI-MS analysis and
the purity (>80%) by capillary gel electrophoresis.
Example 46
Thermal Denaturation Studies to Evaluate Hybridization
Properties
[0619] The hybridization of the oligonucleotides ON1-ON11 (Table 8
below) toward four 9-mer DNA targets with the central base being
each of four natural bases were studied by thermal denaturation
experiments (T.sub.m measurements; see the experimental section for
details). Compared to the DNA reference ON1, introduction of one
abasic LNA monomer Ab.sup.L (ON2) has earlier been reported to
prevent the formation of a stable duplex above 0.degree. C. (only
evaluated with adenine as the opposite base) [L. Kv.ae butted.rno
and J. Wengel, Chem. Commun., 1999, 657]. With the phenyl monomer
17a (ON3), T.sub.m values in the range of 5-12.degree. C. was
observed. Thus, the phenyl moiety stabilizes the duplexes compared
to Ab.sup.L, but universal hybridization is not achieved as a
preference for a central adenine base in the complementary target
strand is indicated (Table 8). In addition, significant
destabilization compared to the ON1:DNA reference duplex was
observed. Results similar to those obtained for ON3 were obtained
for oligomers isosequential with ON3 but containing 17b, 17c or 17e
instead of 17a as the central monomer (Table 8, ON7, ON8 and ON9,
respectively). TABLE-US-00031 TABLE 8 Thermal denaturation
experiments (T.sub.m values shown) for ON1-ON11 towards DNA
complements with each of the four natural bases in the central
position.sup.a DNA target: 3'-d(CACTYTACG) Y: A C G T ON1
5'-d(GTGATATGC) 28 11 12 19 ON2 5'-d(GTGAAb.sup.LATGC) <3 n.d.
n.d. n.d. ON3 5'-d(GTGA17aATGC) 12 5 6 7 ON4 5'-d(GTGA17dATGC) 18
17 18 19 ON5 5'-d[2'-OMe(GTGATATGC)] 35 14 19 21 ON6
5'-d[2'-OMe(GT.sup.LGA17dAT.sup.LGC)] 39 38 37 40 ON7
5'-d(GTGA17bATGC) 15 7 6 8 ON8 5'-d(GTGA17cATGC) 15 7 6 9 ON9
5'-d(GTGA17eATGC) 13 6 6 7 ON10
5'-d[2'-OMe(GT.sup.LGA17bAT.sup.LGC)] 31 25 26 27 ON11
5'-d[2'-OMe(GT.sup.LGA17cAT.sup.LGC)] 34 27 27 32 .sup.aMelting
temperatures (T.sub.m values/.degree. C.) measured as the maximum
of the first derivative of the melting curve (A.sub.260 vs
temperature) recorded in medium salt buffer (10 mM sodium
phosphate, 100 mM sodium chloride, 0.1 mM EDTA, pH 7.0) using 1.5
.mu.M concentrations of the two strands; A = adenine monomer, C =
cytosine monomer, G = guanine monomer, T = thymine monomer; See
FIG. 1 and/or Scheme 2 for structures of T.sup.L, Ab.sup.L and
17a-17e; #DNA sequences are shown as d(sequence) and 2'-OMe-RNA
sequences as 2'-OMe(sequence); "n.d." denotes "not determined". The
data reported for ON1 have been reported earlier [A. A. Koshkin, S.
K. Singh, P. Nielsen, V. K. Rajwanshi, R. Kumar, M. Meldgaard, C.
E. Olsen and J. Wengel, Tetrahedron, 1998, 54, 3607]. The data
reported for ON2 has been reported earlier [L. Kv.ae butted.rno and
J. Wengel, Chem. Commun., 1999, 657].
[0620] The pyrene LNA nucleotide 17d (in ON4) displays more
encouraging properties (Table 8). Firstly, the binding affinity
towards all four complements is increased compared to ON3
(containing 17a). Secondly, universal hybridization is observed as
shown by the four Tm values all being within 17-19.degree. C. With
respect to universal hybridization, 17d thus parallels the pyrene
DNA derivative Py [T. J. Matray and E. T. Kool, J Am. Chem. Soc.,
1998, 120, 6191], but the decrease in thermal stability compared to
the ON1:DNA reference is more pronounced for 17d (.about.10.degree.
C.) than reported for Py (.about.5.degree. C. in a 12-mer
polypyrimidine DNA sequence) [T. J. Matray and E. T. Kool, J. Am.
Chem. Soc., 1998, 120, 6191]. It therefore appears that stacking
(or intercalation) by theO pyrene moiety is not favored by the
conformational restriction of the furanose ring of 17d, although
comparison of the thermal stabilities of ON2, ON3 and ON4 strongly
indicate interaction of the pyrene moiety within the helix.
[0621] When measured against an RNA target [3'-r(CACUAUACG)], the
T.sub.m values (using identical experimental conditions as for the
experiments descried above) of ON3 was 11.9.degree. C. and of ON4
was 12.7.degree. C. For oligomers ON7, ON8 and ON9 (Table 8), the
corresponding T.sub.m values were 11.7, 8.8 and 10.2.degree. C.,
respectively.
Example 47
The Effect of Pyrene LNA Monomers in an RNA-Like Strand.
[0622] ON5, ON6, ON10 and ON11 (see Table 8 above), were
synthesized. The former being composed entirely of 2'-OMe-RNA
monomers and the latter three of six 2'-OMe-RNA monomers (see FIG.
1), two LNA thymine monomers T.sup.L (see FIG. 1), and one central
LNA pyrene monomer 17d (oligomer ON6), or one central monomer 17b
(ON10) or 17c (ON11). A sequence corresponding to ON6 but with
three T.sup.L monomers has earlier been shown to forrn a duplex
with complementary DNA of very high thermal stability. ON6 is
therefore suitable for evaluation of the effect of introducing
high-affinity monomers around a universal base. As seen in Table 8,
the 2'-OMe-RNA reference ON5 binds to the DNA complement with
slightly increased thermal stability and conserved Watson-Crick
discrimination (compared to the DNA reference ON1). Indeed, the
LNA2'-OMe-RNA chimera ON6 displays universal hybridization behavior
as revealed from the four T.sub.m values (37, 38, 39 and 40.degree.
C.). All four T.sub.m values obtained for ON6 are higher than the
T.sub.m values obtained for the two fully complementary reference
duplexes ON1:DNA (T.sub.m=28.degree. C.) and ON5:DNA
(T.sub.m=35.degree. C.).
[0623] These novel data demonstrate that the pyrene LNA monomer 17d
display universal hybridization behavior both in a DNA context
(ON4) and in an RNA-like context (ON6), and that the problem of
decreased affinity of universal hybridization probes can be solved
by the introduction of high-affinity monomers, e.g. 2'-OMe-RNA
andor LNA monomers. Increased affinities compared to ON7 and ON8
were obtained for ON10 and ON11, respectively, but universal
hybridization behavior was not obtained as a preference for a
central adenine base in the complementary target strand is
indicated (Table 8 above).
Example 48
Base-Pairing Selectivity in Hybridization Probes
[0624] A systematic thermal denaturation study with ON6 (Table 11)
was performed to determine base-pairing selectivity. For each of
the four DNA complements (DNA target strands; monomer Y=A, C,G or
T) used in the study shown in Table 8 above, ON6, containing a
central pyrene LNA monomer 17d, was hybridized with all four base
combinations in the neighboring position towards the 3'-end of ON6
(DNA target strands; monomer Z=A, C, G or T, monomer X=T) and the
same towards the 5'-end of ON6 (DNA target strands; monomer X=A, C,
G or T, monomer Z=T). In all eight subsets of four data points,
satisfactory to excellent Watson-Crick discrimination was observed
between the match and the three mismatches (Table 11 below,
.DELTA.T.sub.m values in the range of 5-25.degree. C.).
TABLE-US-00032 TABLE 11 Thermal denaturation experiments (T.sub.m
values shown) to evaluate the base-pairing selectivity of the bases
neighboring the universal pyrene LNA monomer 17d in the
2'-OMe-RNA/LNA chimera ON6. In the target strand
[3'-d(CAC-XYZ-ACG)], the central three bases XYZ are varied among
each of the four natural bases.sup.a
5'-[2'-OMe(GT.sup.LG-A17dA-T.sup.LGC)] 3'-d(CAC-X Y Z-ACG) XYZ
T.sub.m/.degree. C. XYZ T.sub.m/.degree. C. XYZ T.sub.m/.degree. C.
XYZ T.sub.m/.degree. C. TAA 26 TCA 22 TGA 22 TTA 29 TAC 26 TCC 29
TGC 26 TTG 31 TAG 24 TCG 24 TGG 30 TTC 32 TAT 39 TCT 38 TGT 37 TTT
40 AAT 18 ACT 27 AGT 22 ATT 28 CAT 30 CCT 31 CGT 27 CTT 35 GAT 14
GCT 28 GGT 16 GTT 27 TAT 39 TCT 38 TGT 37 TTT 40 .sup.aSee caption
below Table 8 for abbreviations and conditions used; The data for
matched neighboring bases (X = Z = T) are shown in bold.
[0625] The results reported herein have several important
implications for the design of probes for universal hybridization:
(1) Universal hybridization is possible with a conformationally
restricted monomer as demonstrated for the pyrene LNA monomer; (2)
Universal hybridization behavior is feasible in an RNA context; (3)
The binding affinity of probes for universal hybridization can be
increased by the introduction of high-affinity monomers without
compromising the universal hybridization and the base-pairing
selectivity of bases neighboring the universal base.
[0626] Based on the results reported herein, that chimeric
oligonucleotides comprising pyrene and other known universal bases
attached at various backbones (e.g. LNA-type monomers, ribofuranose
monomers or deoxyribose monomers in 2'-OMe-RNALNA chimeric oligos)
likewise will display attractive properties with respect to
universal hybridization behavior. For example, an oligomer
identical with the 2'-OMe-RNALNA oligo ON6 but with the 17d monomer
substituted by a pyrenyl-2'-OMe-ribonucleotide monomer.
Example 49
Chimeric Oligonucleotides
[0627] These chimeric oligonucleotides are comprised of pyrene and
other known universal bases attached at various backbones (e.g.
LNA-type monomers, ribofuranose monomers or deoxyribose monomers in
2'-OMe-RNALNA oligos). Experimentation with these chimeric
oligonucleotides are for evaluating the possibility of obtaining
similar results to the 2'-OMe-RNA/LNA oligo ON6 at a lower cost,
for example, by substituting py.sup.L with a
pyrenyl-2'-OMe-ribonucleotide monomer.
Example 50
The Use of LNA Oligonucleotide Microarrays Provides Superior
Sensitivity and Specificity in Expression Profiling
A. In Vitro Synthesis of the Yeast Spike RNAs
[0628] Amplification of the yeast genes was carried out by standard
two-step PCR using yeast genomic DNA as template (21). In the
second PCR, a poly-T.sub.20 tail was inserted in the amplicon. The
DNA fragments were ligated into the pTRIamp 18 vector (Ambion, USA)
using the Quick Ligation Kit (New England Biolabs, USA) according
to the manufacturers instructions and transformed into E. coli
DH-50.alpha. (21). Synthesis of in vitro RNA was done using the
MEGAscript.TM. T7 Kit (Ambion, USA) according to the manufacturers
instructions.
B. Design of the LNA Expression Arrays
[0629] Capture probes were designed using the OligoDesign.TM.
software as described in the previous examples.
C. Printing and hybridisation of the LNA expression microarrays
[0630] The LNA oligonucleotide microarrays were printed onto
Immobilizerm MicroArray Slides (Exiqon, Denmark) using the Packard
Biochip I Arrayer (Packard, USA), with a spot volume of 2.times.300
pl of a 10 .mu.M capture probe solution. Four replicas of each
capture probe were printed on each slide. Mixed staged
Caenorhabditis elegans worm cultures were cultivated according to
standard protocols. RNA was extracted from worm samples using the
FastRNA Kit, GREEN (Q-BIO, USA) according to the supplier's
instructions. Fluorochrome-labelled first strand cDNA was
synthesized from worm total RNA or in vitro synthesized RNA as
described (22) followed by purification of the cDNA target,
hybridisation of the microarrays overnight at 65.degree. C.,
washing of the slides and drying of the arrays (22). The slides
were scanned using a ScanArray 4000 XL scanner (Perkin-Elmer, USA),
and the array data were processed using the GenePix.TM. Pro 4.0
software package (Axon, USA).
D. Assessment of Sensitivity and Specificity in LNA Expression
Microarrays
[0631] To enable direct comparisons between LNA and DNA capture
probes in measuring gene expression levels, specific
oligonucleotide capture probes for the Saccharomyces cerevisiae
genes SWI5 and THI4 were designed in the 3'-end of the two ORFs.
The capture probes were synthesized as 50-mer DNA and corresponding
LNA-modified oligonucleotides, respectively, with an LNA
substitution at every 3rd nucleotide position. In addition, 40-mer
DNA and LNA oligonucleotides were designed as truncated versions of
the 50-mer capture probes, along with oligonucleotides with 1 to 5
consecutive mismatches positioned centrally in the 50-mer and
40-mer capture probes. All capture probes were synthesized with an
anthraquinone group at the 5'-end and a hexaethyleneglycol dimer
linker region (HEG2 spacer arm) enabling photocoupling onto polymer
microarray slides as described in U.S. Pat. No. 6,531,591.
[0632] To assess the sensitivity and specificity of the
oligonucleotide microarrays, in vitro synthesized yeast RNA for
either SWI5 or THI4 was spiked into C. elegans total RNA for cDNA
target synthesis followed by hybridization of the microarrays with
fluorochrome-labelled cDNA target pools. The incorporation of LNA
nucleotides into 50-mer DNA oligonucleotide capture probes results
in a 3 to 4-fold increase in fluorescence intensity levels, when
hybridized with the spiked, complex cDNA target pools under
standard stringency conditions (FIGS. 36a and 36c). The sensitivity
increase is even more pronounced, 5 to 12-fold, when 40-mer LNA
capture probes are employed. None of the yeast capture probes
showed cross-hybridization to C. elegans cDNA target control
without yeast spike RNA under the same conditions.
[0633] The specificity of the oligonucleotide capture probes was
examined using a panel of LNA mismatch oligonucleotides together
with the DNA controls. As demonstrated in FIGS. 36a and 36c, the
fluorescence intensities obtained with the LNA-modified 40-mer
triple mismatch oligonucleotides show a 3-fold intensity decrease
relative to the perfectly matched duplexes. In contrast, the
corresponding 40-mer standard DNA capture probes are neither
capable of forming stable duplexes nor discriminating between the
perfect match and mismatched targets under standard hybridization
stringency conditions, resulting in low intensity values from all
40-mer DNA capture probes (FIGS. 36a and 36c). Interestingly,
mismatch discrimination with the 50-mer LNA probes could be
significantly improved by increasing the hybridization temperature
from 65.degree. C. to 70.degree. C. (FIGS. 36b and 36d), without
compromising their capture sensitivity. By comparison, the signal
intensities from all 50-mer DNA capture probes including the
perfect match oligonucleotides were reduced under the same
conditions (FIGS. 36b and 36d). Considered together, our results
strongly support the contention that LNA oligonucleotide capture
probes are significantly more sensitive and specific than DNA
probes, being able to discriminate between highly homologous (90%)
mRNAs with a 5 to 10-fold increase in sensitivity.
[0634] In a typical cell, mRNAs can be subdivided into three
kinetic classes: (i) highly abundant (30-90% of the total mRNA
mass, 0.1% of the sequence complexity); (ii) medium abundant (50 %
mass, 2-5% of complexity); and (iii) low-abundant mRNAs (<1%
mass, >90% of complexity). In addition, alternative splicing has
been shown to be prevalent in higher eukaryotes, where at least 50%
of the genes appear to be alternatively spliced, thereby generating
additional diversity within the transcriptome. It is thus of utmost
importance that the dynamic range, sensitivity and specificity of
the expression profiling technology used are optimal, especially
when analyzing expression levels of messages and mRNA splice
variants belonging to the low-abundant class of high mRNA sequence
complexity. A common problem for all DNA oligonucleotide
microarrays is the need for an adequate compromise with respect to
the sensitivity and specificity of the platform. In the present
example LNA oligonucleotide microarrays perform better in
expression profiling than microarrays with corresponding DNA
probes. Our results clearly demonstrate that both the specificity
and sensitivity in target molecule capture can be improved using
LNA oligonucleotide microarrays, enabling discrimination between
highly homologous mRNAs and alternative splice variants with a
simultaneous increase in sensitivity.
[0635] FIGS. 36a-36d shows the sensitivity and specificity of LNA
oligonucleotide capture probes (black bars) compared to DNA capture
probes (white bars) on expression microarrays. Fluorescence
intensity is shown in arbitrary units (relative measurements). The
arrays comprising 50-mer and 40-mer perfect match and 1-5 mismatch
capture probes were hybridized at 65.degree. C in 3.times.SSC with
Cy3-labelled cDNA from 10 .mu.g C. elegans total RNA spiked with
yeast a) SWI5 RNA and c) THI4 RNA. Demonstration of improved
mismatch discrimination with the 50-mer LNA probes by increasing
the hybridization temperature from 65.degree. C. to 70.degree. C.
hybridized with Cy3-labelled cDNA from 10 .mu.g C. elegans total
RNA spiked with yeast b) SWI5 RNA and d) THI4 RNA.
Example 51
Improved Sensitivity in the On-Chip Capture of Yeast HSP78 mRNA
Using LNA-Substituted 25-mer Oligonucleotide Capture Probes
A. Capture Probe Design
[0636] Unique capture probes for the yeast HSP78 gene were designed
using the OligoDesign software, described in FIGS. 19A-19F. The
design options used were: (i) length of each oligonucleotide probe
was 25 nucleotides; (ii) Blast word length 7; (iii) Blast
expectation cut-off 1000; other options were as default; 24 DNA
capture probes were selected. Furthermore, three different
LNA-substituted probes were designed based on the sequences of the
24 DNA capture probes, selected by OligoDesign: optimal LNA_T,
optimal LNA_TC and LNA.sub.--3. In the LNA_T design the DNA t
nucleotides were substituted with LNA_T. For the LNA_TC design, LNA
T and C nucleotides were used to substitute DNA t and c. In the
LNA.sub.--3 design every third DNA nucleotide was substituted with
the corresponding LNA nucleotide. For the LNA_T and LNA_TC design,
no blocks of LNAs were allowed; in addition the LNAs were
substituted in a pattern providing a more narrow duplex melting
temperature range compared to the DNA Tm range. In addition, an
equivalent set of capture probes with a single mismatch in the
central nucleotide position was designed. Altogether, 192 capture
probes were designed including a anthraquinone (AQ29) 5'-modifier
and a hexaethyleneglycol dimer (HEG2) at the 5' end of each
probe--as shown in Table 13.
B. Determination of the Duplex Melting Temperatures (Tm).
[0637] The duplex melting temperatures of the DNA, LNA T and LNA TC
designed probes were measured using the Perkin Elmer Lambda 40
Spectrophotometer and according to Wahlestedt et al. PNAS 97/10
2000. All oligos were measured twice and if the replica values
deviated more than 1.degree. C., then a third or a fourth
measurement was carried out. The average Tm for each
oligonucleotide duplex is presented in Table 14.
C. In Vitro Synthesis of Fluorochrome-Labeled Yeast HSP78 RNA
[0638] C1. Genomic DNA was prepared from a wild type standard
laboratory strain of Saccharomyces cerevisiae using the Nucleon MiY
DNA extraction kit (Amersham Biosciences) according to supplier's
instructions.
[0639] C2. PCR amplification of the partial yeast gene was done by
standard PCR using yeast genomic DNA as template. In the first step
of amplification, a forward primer containing a restriction enzyme
site and a reverse primer containing a universal linker sequence
were used. In this step 20 bp was added to the 3'-end of the
amplicon, next to the stop codon. In the second step of
amplification, the reverse primer was exchanged with a nested
primer containing a poly-T.sub.20 tail and a restriction enzyme
site. The SWI5 amplicon contains 730 bp of the SWI5 ORF plus 20 bp
universal linker sequence and a poly-A.sub.20 tail.
[0640] The PCR primers used were: TABLE-US-00033 YDR258C-For-SacI:
(SEQ ID NO:) acgtgagctcttttgacatgtcagaatttcaag YDR258C-Rev-Uni:
(SEQ ID NO:) gatccccgggaattgccatgttacttttcagcttcctcttcaac
Uni-polyT-BamHI: (SEQ ID NO:)
acgtggatccttttttttttttttttttttgatccccgggaattgcc atg,
C3. Plasmid DNA Constructs
[0641] The PCR amplicon was cut with the restriction enzymes,
EcoRI+BamHI. The DNA fragment was ligated into the pTRIamp 18
vector (Ambion) using the Quick Ligation Kit (New England Biolabs)
according to the supplier's instructions and transformed into E.
coli DH-5.alpha. by standard methods.
C4. DNA Sequencing
[0642] To verify the cloning of the PCR amplicon, plasmid DNA was
sequenced using M 13 forward and M13 reverse primers and analysed
on an ABI 377.
C5. Biotin Labeling of cRNA
[0643] One .mu.g of plasmid containing the HSP78 sequence was
linearized with restriction enzyme BamHI (Amersham Pharmacia
Biotech, USA) for 2 hours at 37.degree. C. The RNA was labeled with
biotin-CTP and biotin-UTP using the Message AMP aRNA kit from
Ambion (USA) according to the manufacturer's instructions.
Following hybridisation, the slides were stained with Streptavidin
Phycoerythrin (Molecular Probes, S-866, USA) according to the
GeneChip Expression Analysis Technical Manual (Affymetrix, USA)
C6. Fluorochrome Labeling of Spike RNA
[0644] In vitro synthesized spike RNA from the HSP78 plasmid
construct was labeled with either Cy3-ULS or CyS-ULS (Amersham
Biosciences, USA) according to the manufacturer's instructions,
followed by filtration through a ProbeQuant G50 Micro Column and
Microcon30 (Millipore, USA). The labeling efficiency was monitored
using the Nanodrop spectrophotometer (Nanodrop Technologies,
USA)
D. Microarray Fabrication
[0645] The microarrays were printed on Immobilizer.TM. MicroArray
Slides (Exiqon, Denmark) using the MicroGrid II from Biorobotics
(UK) using a 20 .mu.M capture probe solution for each
oligonucleotide probe. Four replicas of each capture probe were
printed on the slides.
E. Hybridization with Fluorochrome-Labelled cRNA
[0646] The arrays were hybridized for 16 hours using the following
protocol. The labelled RNA samples were hybridized in a
hybridization solution (20 .mu.L final volume) containing
3.times.SSC (final concentration), 25 mM HEPES, pH 7.0 (final
concentration), 1.25 pgPL yeast tRNA, 0.3% SDS. The labeled RNA
target sample was filtered in a Millipore 0.22 micron spin column
according to the manufacturer's instructions (Millipore, USA), and
the probe was denatured by incubating the reaction at 100.degree.
C. for 2 min. The sample was cooled at 20-25.degree. C. for 5 min.
by spinning at max speed in a microcentrifuge. A LifterSlip (Erie
Scientific Company, USA) was carefully placed on top of the
microarray spotted on ImmobilizerTm MicroArray Slide and the
hybridization mixture was applied to the array from the side. An
aliquot of 30 .mu.L of 3.times.SSC was added to both ends of the
hybridization chamber, and the Immobilizer.TM. MicroArray Slide was
placed in the hybridization chamber. The chamber was sealed
watertight and incubated at 45.degree. C., 55.degree. C. or
65.degree. C. for 16-18 hours submerged in a water bath. After
hybridisation, the slide was removed carefully from the
hybridization chamber and washed using the following protocol. The
Lifterslip coverslip was washed off in 6.times.SSC, pH 7.0
containing 0.1% Tween20 at 50.degree. C. for 15 min., followed by
washing of the microarrays in 0.4.times.SSC, pH 7.0 at 50.degree.
C. for 30 min. Finally the slides were washed for 5 seconds in
0.05.times.SSC, pH 7.0. The slides were then dried by
centrifugation in a swinging bucket rotor at approximately 200 G
for 2 min.
F. Data Analysis.
[0647] Following washing and drying, the slides were scanned using
a ScanArray 4000XL scanner (Perkin-Elmer Life Sciences, USA), and
the array data were processed using the GenePix.TM. Pro 4.0
software package (Axon, USA).
G. Results
G1. Duplex Melting Temperatures
[0648] The Tm data clearly shows that LNA-substituted
oligonucleotide capture probes have a significantly increased
average duplex melting temperature compared to the corresponding
DNA probes. Furthermore, the difference in melting temperature
between the perfectly matched (PM) and single mismatched (MM)
probes, designated as ATm, is significantly higher than the
corresponding AT.sub.m for DNA probes (Table 12). TABLE-US-00034
TABLE 12 The average difference in melting temperature between the
perfectly matched (PM) and single mismatched (MM) probes in
different capture probe designs. The observed difference between
the DNA and LNA substituted probes is statistically significant as
revealed by a t-Test; Two-Sample Assuming Unequal Variances.
Average Max Min .DELTA. Tm St.dev. T-Test MM-DNA 60.4 68.5 54.3
MM-LNA T 67.6 74 58.1 MM-LNA TC 72.0 79.3 61.6 PM-DNA 66.3 72.8 61
5.9 1.52 PM-LNA T 74.2 80.8 66.3 6.6 1.32 0.047 PM-LNA TC 80.0 86.8
71.4 8.0 2.65 0.001/0.017
G2. Microarray Hybridization Results
[0649] Both LNA_T and LNA.sub.--3 substituted 25-mer probes are
capable of providing highly accurate measurements for
fold-of-changes in gene expression levels, as depicted in FIG. 37.
The DNA capture probes did not provide any hybridisation signals
under the given microarray hybridisation conditions (FIG. 37). FIG.
37 shows the expected (black bars) and observed (white bars)
fold-of-change in the expression levels of the Cy3-ULS labelled
HSP78 spike RNA as measured by on-chip capture using different
oligonucleotide capture probes. In the hybridization experiment, 1
ng HSP78 in vitro spike RNA or 200 pg HSP78 in vitro spike RNA was
used, respectively. Thus, the fold change of the HSP78 RNA in the
two hybridizations in the comparison is 5-fold. Fourteen additional
synthetic in vitro mRNA spike controls were included in the
hybridisation solution as a semi-complex background RNA mixture.
Seven of these spikes were used as normalization controls, the
other seven were used as negative controls. Hybridization
temperature was 65.degree. C. for 16 hours, and post-hybridization
washes as described above. Under these conditions the DNA capture
probes did not produce hybridization signals. FIG. 38 shows
measured intensity levels by on-chip capture using three different
25-mer oligonucleotide capture probe designs. One (1) ng
biotin-labeled HSP78 target was used in the hybridization
experiments, followed by staining with Streptavidin Phycoerythrin.
The LNA_T and LNA_TC substituted 25-mer capture probes show a
significantly enhanced on-chip capture of the HSP78 RNA target,
compared to the DNA 25-mer control probes under four different
hybridization stringency conditions. TABLE-US-00035 TABLE 13 Design
of the yeast HSP78 capture probes. YDR258C denotes the ORF name of
the S. cerevisiae HSP78 gene. The numbers refer to the nucleotide
position from the 3'-end of the HSP78 mRNA sequence. PM = perfectly
matched probe, MM = single mismatch probe, LNA substitutions are
depicted by capital letters, .sup.mC denotes LNA methyl-C (SEQ ID
NOs:) Oligo name Sequence Oligo name Sequence YDR258C_PM_043
tttggtagcacgacaagcttagtat YDR258C_PM_043T TTTggTagcacgacaagcTTagTat
YDR258C_PM_078 cactctaacagtttcgccgtttcta YDR258C_PM_078T
cacTcTaacagtTtcgccgTTTcTa YDR258C_PM_124 gttgccatggagttcaaaatctgtc
YDR258C_PM_124T gTTgccaTggagTtcaaaaTcTgTc YDR258C_PM_164
tcaatggccttgcaccatataattg YDR258C_PM_164T TcaaTggccTTgcaccaTaTaaTTg
YDR258C_PM_201 tcagttagccaatccttcgcttcat YDR258C_PM_201T
TcagTTagccaaTccTTcgcTTcat YDR258C_PM_249 tttttcggccaaacgatcttgaatt
YDR258C_PM_249T TtTTTcggccaaacgaTcTTgaaTt YDR258C_PM_295
attgacctcaaaactttcttggata YDR258C_PM_295T aTTgaccTcaaaacTTTcTTggaTa
YDR258C_PM_356 gatgaactcaggtggataggatctt YDR258C_PM_356T
gaTgaacTcaggTggaTaggaTcTt YDR258C_PM_424 accatcatcacccaactttgtgtcg
YDR258C_PM_424T accaTcaTcacccaacTTTgTgTcg YDR258C_PM_433
cccaactttgtgtcgtttaataaaa YDR258C_PM_433T cccaacTTTgTgTcgTTTaaTaaaa
YDR258C_PM_486 caatgatcgtgttacggaaatcaac YDR258C_PM_486T
caaTgaTcgTgtTacggaaaTcaac YDR258C_PM_515 tggcctagggaatcggtcagcttac
YDR258C_PM_515T TggccTagggaaTcggTcagcTTac YDR258C_PM_566
ttggaaacatcggggtgcgcttttt YDR258C_PM_566T TTggaaacaTcggggTgcgcTTTTt
YDR258C_PM_569 gaaacatcggggtgcgctttttcaa YDR258C_PM_569T
gaaacaTcggggTgcgcTTTTTcaa YDR258C_PM_604 aaaacgacagcataaggctttcttc
YDR258C_PM_604T aaaacgacagcaTaaggcTTrcTTc YDR258C_PM_631
gacagcctcagttaattggccacca YDR258C_PM_631T gacagccTcagtTaaTTggccacca
YDR258C_PM_686 ccgattaaacgagagacagtatgct YDR258C_PM_686T
ccgaTTaaacgagagacagTaTgct YDR258C_PM_757 atcaaataggaattcagctaaagcc
YDR258C_PM_757T aTcaaaTaggaaTTcagcTaaagcc YDR258C_PM_813
gacctaagaacataaagctggcaat YDR258C_PM_813T gaccTaagaacaTaaagcTggcaat
YDR258C_PM_823 ataaagctggcaataggtctctttt YDR258C_PM_823T
aTaaagcTggcaaTaggTcTcTTTt YDR258C_PM_870 agacgtacagcatcagaaatagcag
YDR258C_PM_870T agacgTacagcaTcagaaaTagcag YDR258C_PM_888
aaatagcagcaatggcctcgtcttg YDR258C_PM_888T aaaTagcagcaaTggccTcgTcTTg
YDR258C_PM_890 atagcagcaatggcctcgtcttggc YDR258C_PM_890T
aTagcagcaaTggccTcgTcTTggc YDR258C_PM_896 gcaatggcctcgtcttggccaacga
YDR258C_PM_896T gcaaTggccTcgTcTTggccaacga YDR258C_PM_043
TtTggTagmCamCgamCaagmCtTagTat YDR258C_PM_LNA3_043
TttGgtAgcAcgAcaAgcTtaGtat TC YDR258C_PM_078
mCamCtmCtaamCagtTtcgmCcgTtTmCTa YDR258C_PM_LNA3_078
mCacTctAacAgtTtcGccGttTcta TC YDR258C_PM_124
gTtgmCmCaTggagTtmCaaaaTmCtgTc YDR258C_PM_LNA3_124
GttGccAtgGagTtcAaaAtcTgtc TC YDR258C_PM_164
TmCaaTggmCcTTgmCacmCaTaTaaTTg YDR258C_PM_LNA3_164
TcaAtgGccTtgmCacmCatAtaAttg TC YDR258C_PM_201
TmCagTtagcmCaaTcmCtTmCgmCttmCat YDR258C_PM_LNA3_424
AccAtcAtcAccmCaamCttTgtGtcg TC YDR258C_PM_249
TtTtTmCggmCmCaaamCgatmCtTgaaTt YDR258C_PM_LNA3_486
mCaaTgaTcgTgtTacGgaAatmCaac TC YDR258C_PM_295
aTTgamCmCTmGaaaamCTTtmCTTggaTa YDR258C_PM_LNA3_515
TggmCctAggGaaTcgGtcAgcTtac TC YDR258C_PM_356
gaTgaamCTmCaggTggaTaggaTmCTt YDR258C_PM_LNA3_566
TtgGaaAcaTcgGggTgcGctTttt TC YDR258C_PM_424
amCcaTcaTcacmCmCaaccTtgTgtmCg YDR258C_PM_LNA3_569
GaaAcaTcgGggTgcGctTttTcaa TC YDR258C_PM_433
mCmCmCaacTTtgTgTcgTTTaaTaaaa YDR258C_PM_LNA3_604
AaaAcgAcaGcaTaaGgcTttmCttc TC YDR258C_PM_486
mCaaTgaTmCgTgtTamCggaaaTmCaac YDR258C_PM_LNA3_757
AtcAaaTagGaaTtcAgcTaaAgcc TC YDR258C_PM_515
TggmCcTagggaaTmCggTcagmCtTac YDR258C_PM_LNA3_813
GacmCtaAgaAcaTaaAgcTggmCaat TC YDR258C_PM_566
TTggaaamCatmCggggTgmCgctTtTt YDR258C_PM_LNA3_823
AtaAagmCtgGcaAtaGgtmCtcTttt TC YDR258C_PM_569
gaaamCaTmCggggTgmCgctttTtmCaa YDR258C_PM_LNA3_870
AgamCgtAcaGcaTcaGaaAtaGcag TC YDR258C_PM_604
aaaamCgamCagmCaTaaggmCTtTmCtTc YDR258C_PM_LNA3_888
AaaTagmCagmCaaTggmCctmCgtmCttg TC YDR258C_PM_631
gamCagmCcTcagtTaaTTggcmCacmCa YDR258C_PM_LNA3_890
AtaGcaGcaAtgGccTcgTctTggc TC YDR258C_PM_686
mCmCgaTTaaamCgagagamCagTaTgmCt YDR258C_PM_LNA3_896
GcaAtgGccTcgTctTggmCcaAcga TC YDR258C_PM_757
aTmCaaaTaggaaTtmCagmCTaaagmCc YDR258C_PM_LNA3_631
GacAgcmCtcAgtTaaTtgGccAcca TC YDR258C_PM_813
gamCmCTaagaamCaTaaagmCTggmCaat YDR258C_PM_LNA3_686
mCcgAttAaamCgaGagAcaGtaTgct TC YDR258C_PM_823
aTaaagmCTggmCaaTaggTmCTcTTTt YDR258C_PM_LNA3_356
GatGaamCtcAggTggAtaGgaTctt TC YDR258C_PM_870
agamCgTamCagmCaTmCagaaaTagmCag YDR258C_PM_LNA3_201
TcaGttAgcmCaaTccTtcGctTcat TC YDR258C_PM_888
aaaTagmCagmCaaTggmCcTmCgTctTg YDR258C_PM_LNA3_249
TttTtcGgcmCaaAcgAtcTtgAatt TC YDR258C_PM_890
aTagmCagcaaTggmCcTcgtmCtTggc YDR258C_PM_LNA3_295
AttGacmCtcAaaActTtcTtgGata TC YDR258C_PM_896
gcaatggcctmCgTmCttggccaacga YDR258C_PM_LNA3_433
mCccAacTttGtgTcgTttAatAaaa TC YDR258C_MM_043
tttggtagcacgtcaagcttagtat YDR258C_MM_043T TTTggTagcacgtcaagcTTagTat
YDR258C_MM_078 cactctaacagtatcgccgtttcta YDR258C_MM_078T
cacTcTaacagtatcgccgTTTcTa YDR258C_MM_124 gttgccatggagatcaaaatctgtc
YDR258C_MM_124T gTTgccaTggagatcaaaaTcTgTc YDR258C_MM_164
tcaatggccttggaccatataattg YDR258C_MM_164T TcaaTggccTTggaccaTaTaaTTg
YDR258C_MM_201 tcagttagccaaaccttcgcttcat YDR258C_MM_201T
TcagTTagccaaaccTTcgcTTcat YDR258C_MM_249 tttttcggccaatcgatcttgaatt
YDR258C_MM_249T TtTTTcggccaatcgaTcTTgaaTt YDR258C_MM_295
attgacctcaaatctttcttggata YDR258C_MM_295T aTTgaccTcaaatcTTTcTTggaTa
YDR258C_MM_356 gatgaactcaggaggataggatctt YDR258C_MM_356T
gaTgaacTcaggaggaTaggaTcTt YDR258C_MM_424 accatcatcaccgaactttgtgtcg
YDR258C_MM_424T accaTcaTcaccgaacTTTgTgTcg YDR258C_MM_433
cccaactttgtgacgtttaataaaa YDR258C_MM_433T cccaacTTTgTgacgTTTaaTaaaa
YDR258C_MM_486 caatgatcgtgtaacggaaatcaac YDR258C_MM_486T
caaTgaTcgTgtaacggaaaTcaac YDR258C_MM_515 tggcctagggaaacggtcagcttac
YDR258C_MM_51ST TggccTagggaaacggTcagcTTac YDR258C_MM_566
ttggaaacatcgcggtgcgcttttt YDR258C_MM_566T TTggaaacaTcgcggTgcgcTTTTt
YDR258C_MM_569 gaaacatcggggagcgctttttcaa YDR258C_MM_569T
gaaacaTcggggagcgcTTTTTcaa YDR258C_MM_604 aaaacgacagcaaaaggctttcttc
YDR258C_MM_604T aaaacgacagcaaaaggcTTTcTTc YDR258C_MM_631
gacagcctcagtaaattggccacca YDR258C_MM_631T
gacagccTcagtaaaTTggccacca YDR258C_MM_686 ccgattaaacgacagacagtatgct
YDR258C_MM_686T ccgaTTaaacgacagacagTaTgct YDR258C_MM_757
atcaaataggaaatcagctaaagcc YDR258C_MM_757T aTcaaaTaggaaatcagcTaaagcc
YDR258C_MM_813 gacctaagaacaaaaagctggcaat YDR258C_MM_813T
gaccTaagaacaaaaagcTggcaat YDR258C_MM_823 ataaagctggcattaggtctctttt
YDR258C_MM_823T aTaaagcTggcaaaaggTcTcTTTt YDR258C_MM_870
agacgtacagcaacagaaatagcag YDR258C_MM_870T agacgTacagcaacagaaaTagcag
YDR258C_MM_888 aaatagcagcaaaggcctcgtcttg YDR258C_MM_888T
aaaTagcagcaaaggccTcgTcTTg YDR258C_MM_890 atagcagcaatgccctcgtcttggc
YDR258G_MM_890T aTagcagcaaTgcccTcgTcTTggc YDR258C_MM 896
gcaatggcctcgacttggccaacga YDR258C_MM_896T gcaaTggccTcgacTTggccaacga
YDR258C_MM_043 TtTggTagmCamCgtcaagmCtTagTat YDR258C_MM_LNA3_043
TttGgtAgcAcgTcaAgcTtaGtat TC YDR258C_MM_078
mCamCtmCtaamCagtatcgmCcgTtTmCTa YDR258C_MM_LNA3_078
mCacTctAacAgtAtcGccGttTcta TC YDR258C_MM_124
gTtgmCmCaTggagatmCaaaaTmCtgTc YDR258C_MM_LNA3_124
GttGccAtgGagAtcAaaAtcTgtc TC YDR258C_MM_164
TmCaaTggmCcTTggacmCaTaTaaTTg YDR258C_MM_LNA3_164
TcaAtgGccTtgGacmCatAtaAttg TC YDR258C_MM_201
tmCagTtagcmCaaacctTcgmCttmCat YDR258C_MM_LNA3_201
TcaGttAgcmCaaAccTtcGctTcat TC YDR258C_MM_249
TtTtTmCggmCmCaatcgatmCtTgaaTt YDR258C_MM_LNA3_249
TttTtcGgcmCaaTcgAtcTtgAatt TC YDR258C_MM_295
aTTgamCmCTmCaaatcTTmCTTggaTa YDR258C_MM_LNA3_295
AttGacmCtcAaaTctTtcTtgGata TC YDR258C_MM_356
gaTgaamCTmCaggaggaTaggaTmCTt YDR258C_MM_LNA3_356
GatGaamCtcAggAggAtaGgaTctt TC YDR258C_MM_424
amCcaTcaTcacccaaccTtgTgtmCg YDR258C_MM_LNA3_424
AccAtcAtcAccGaamCttTgtGtcg TC YDR258C_MM_433
mCmCmCaacTTtgTgacgTTTaaTaaaa YDR258C_MM_LNA3_433
mCccAacTttGtgAcgTttAatAaaa TC YDR258C_MM_486
mCaaTgaTmCgTgttamCggaaaTmCaac YDR258C_MM_LNA3_486
mCaaTgaTcgTgtAacGgaAatmGaac TC YDR258C_MM_515
TggmCcTagggaaacggTcagmCtTac YDR258C_MM_LNA3_515
TggmCctAggGaaAcgGtcAgcTtac TC YDR258C_MM_566
TTggaaamGatmCgcggTgmCgctTtTt YDR258C_MM_LNA3_566
TtgGaaAcaTcgmCggTgcGctTttt TC YDR258C_MM_569
gaaamCaTmCggggagmCgctttTtmCaa YDR258C_MM_LNA3_569
GaaAcaTcgGggAgcGctTttTcaa TC YDR258C_MM_604
aaaamCgamCagmCaaaaggmCTtTmCtTc YDR258C_MM_LNA3_604
AaaAcgAcaGcaAaaGgcTttmCttc TC YDR258C_MM_631
gamCagmCcTcagtaaaTTggcmCacmCa YDR258C_MM_LNA3_631
GacAgcmCtcAgtAaaTtgGccAcca TC YDR258C_MM_686
mCmCgaTTaaamCgacagamCagTaTgmCt YDR258C_MM_LNA3_686
mCcgAttAaamCgamCagAcaGtaTgct TC YDR258C_MM_757
aTmCaaaTaggaaatmCagmCTaaagmCc YDR258C_MM_LNA3_757
AtcAaaTagGaaAtcAgcTaaAgcc TC YDR258C_MM_813
gamCmCTaagaamCaaaaagmCTggmCaat YDR258C_MM_LNA3_813
GacmCtaAgaAcaAaaAgcTggmCaat TC YDR258C_MM_823
aTaaagmCTggmCattaggTmCTcTTTt YDR258C_MM_LNA3_823
AtaAagmCtgGcaTtaGgtmCtcTttt TC YDR258C_MM_870
agamCgTamCagmCaacagaaaTagmCag YDR258C_MM_LNA3_870
AgamCgtAcaGcaAcaGaaAtaGcag TC YDR258C_MM_888
aaaTagmCagmCaaaggmCcTmCgTctTg YDR258C_MM_LNA3_888
AaaTagmCagmCaaAggmCctmCgtmCttg TC YDR258C_MM_890
aTagmCagcaaTgcccTcgtmCtTggc YDR258C_MM_LNA3_890
AtaGcaGcaAtgmCccTcgTctTggc TC YDR258C_MM_896
gmCaaTggcctmCgactggccaamCga YDR258C_MM_LNA3_896
GcaAtgGccTcgActTggmCcaAcga TC
[0650] TABLE-US-00036 TABLE 14 Duplex melting temperatures (Tm) for
the 144 different 25-mer oligo- nucleotide capture probes. The
design column denotes the sequence design of the probe. PM =
perfectly matched probe, MM = single mis- match probe, LNA
substitutions are depicted by capital letters, .sup.mC denotes LNA
methyl-C (SEQ ID NOs:) Average duplex Probe Oligonucleotide
Complementary melting number target name target sequence Design
temp. (.degree. C.) 12696 YDR258C_Tm_predic_043
tttggtagcacgtcaagcttagtat MM-DNA 59.2 12699 YDR258C_Tm_predic_078
cactctaacagtatcgccgtttcta MM-DNA 61.1 12694 YDR258C_Tm_predic_124
gttgccatggagatcaaaatctgtc MM-DNA 60 12700 YDR258C_Tm_predic_164
tcaatggccttggaccatataattg MM-DNA 59.5 12693 YDR258C_Tm_predic_201
tcagttagccaaaccttcgcttcat MM-DNA 61.4 12698 YDR258C_Tm_predic_249
tttttcggccaatcgatcttgaatt MM-DNA 58.8 12702 YDR258C_Tm_predic_295
attgacctcaaatctttcttggata MM-DNA 54.5 12692 YDR258C_Tm_predic_356
gatgaactcaggaggataggatctt MM-DNA 58.2 12680 YDR258C_Tm_predic_424
accatcatcaccgaactttgtgtcg MM-DNA 63.6 12703 YDR258C_Tm_predic_433
cccaactttgtgacgtttaataaaa MM-DNA 56.2 12681 YDR258C_Tm_predic_486
caatgatcgtgtaacggaaatcaac MM-DNA 59.3 12682 YDR258C_Tm_predic_515
tggcctagggaaacggtcagcttac MM-DNA 65.2 12683 YDR258C_Tm_predic_566
ttggaaacatcgcggtgcgcttttt MM-DNA 61.5 12684 YDR258C_Tm_predic_569
gaaacatcggggagcgctttttcaa MM-DNA 63.8 12701 YDR258C_Tm_predic_604
aaaacgacagcaaaaggctttcttc MM-DNA 58.8 12685 YDR258C_Tm_predic_631
gacagcctcagtaaattggccacca MM-DNA 64.8 12686 YDR258C_Tm_predic_686
ccgattaaacgacagacagtatgct MM-DNA 57.1 12687 YDR258C_Tm_predic_757
atcaaataggaaatcagctaaagcc MM-DNA 54.3 12688 YDR258C_Tm_predic_813
gacctaagaacaaaaagctggcaat MM-DNA 58.2 12697 YDR258C_Tm_predic_823
ataaagctggcattaggtctctttt MM-DNA 58.4 12695 YDR258C_Tm_predic_870
agacgtacagcaacagaaatagcag MM-DNA 61.2 12689 YDR258C_Tm_predic_888
aaatagcagcaaaggcctcgtcttg MM-DNA 64 12690 YDR258C_Tm_predic_890
atagcagcaatgccctcgtcttggc MM-DNA 62.9 12691 YDR258C_Tm_predic_896
gcaatggcctcgacttggccaacga MM-DNA 68.5 12720 YDR258C_Tm_predic_043T
TTTggTagcacgtcaagcTTagTat MM-T 68.6 12723 YDR258C_Tm_predic_078T
cacTcTaacagtatcgccgTTTcTa MM-T 69.7 12718 YDR258C_Tm_predic_124T
gTTgccaTggagatcaaaaTcTgTc MM-T 69.2 12724 YDR258C_Tm_predic_164T
TcaaTggccTTggaccaTaTaaTTg MM-T 69.7 12717 YDR258C_Tm_predic_201T
TcagTTagccaaaccTTcgcTTcat MM-T 69.4 12722 YDR258C_Tm_predic_249T
TtTTTcggccaatcgaTcTTgaaTt MM-T 65.9 12726 YDR258C_Tm_predic_295T
aTTgaccTcaaatcTTTcTTggaTa MM-T 65.1 12716 YDR258C_Tm_predic_356T
gaTgaacTcaggaggaTaggaTcTt MM-T 64.9 12704 YDR258C_Tm_predic_424T
accaTcaTcaccgaacTTTgTgTcg MM-T 74 12727 YDR258C_Tm_predic_433T
cccaacTTTgTgacgTTTaaTaaaa MM-T 66.5 12705 YDR258C_Tm_predic_486T
caaTgaTcgTgtaacggaaaTcaac MM-T 65.2 12706 YDR258C_Tm_predic_515T
TggccTagggaaacggTcagcTTac MM-T 71.6 12707 YDR258C_Tm_predic_566T
TTggaaacaTcgcggTgcgcTTTTt MM-T 68.6 12708 YDR258C_Tm_predic_569T
gaaacaTcggggagcgcTTTTTcaa MM-T 69.9 12725 YDR258C_Tm_predic_604T
aaaacgacagcaaaaggcTTTcTTc MM-T 65.9 12709 YDR258C_Tm_predic_631T
gacagccTcagtaaaTTggccacca MM-T 68.8 12710 YDR258C_Tm_predic_686T
ccgaTTaaacgacagacagTaTgct MM-T 63.5 12711 YDR258C_Tm_predic_757T
aTcaaaTaggaaatcagcTaaagcc MM-T 58.1 12712 YDR258C_Tm_predic_813T
gaccTaagaacaaaaagcTggcaat MM-T 61.1 12721 YDR258C_Tm_predic_823T
aTaaagcTggcaaaaggTcTcTTTt MM-T 67.2 13 + 14 12719
YDR258C_Tm_predic_870T agacgTacagcaacagaaaTagcag MM-T 65 12713
YDR258C_Tm_predic_888T aaaTagcagcaaaggccTcgTcTTg MM-T 70.4 12714
YDR258C_Tm_predic_890T aTagcagcaaTgcccTcgTcTTggc MM-T 71.3 12715
YDR258C_Tm_predic_896T gcaaTggccTcgacTTggccaacga MM-T 73.7 12744
YDR258C_Tm_predic_043TC TtTggTagmCamCgtcaagmCtTagTat MM-TC 73.3
12747 YDR258C_Tm_predic_078TC mCamCtmCtaamCagtatcgmCcgTtTmCTa MM-TC
75.2 12742 YDR258C_Tm_predic_124TC gTtgmCmCaTggagatmCaaaaTmCtgTc
MM-TC 61.6 12748 YDR258C_Tm_predic_164TC
TmCaaTggmCcTTggacmCaTaTaaTTg MM-TC 74.8 12741
YDR258C_Tm_predic_201TC tmCagTtagcmCaaacctTcgmCttmCat MM-TC 70.6
12746 YDR258C_Tm_predic_249TC TtTtTmCggmCmCaatcgatmCtTgaaTt MM-TC
71 12750 YDR258C_Tm_predic_295TC aTTgamCmCTmCaaatcmmCTTggaTa MM-TC
72.2 12740 YDR258C_Tm_predic_356TC gaTgaamCTmCaggaggaTaggaTmCTt
MM-TC 70.4 12728 YDR258C_Tm_predic_4241C
amCcaTcaTcacccaaccTtgTgtmCg MM-TC 70.2 13 + 16 12751
YDR258C_Tm_predic_4331C mCmCmCaacTTtgTgacgTTTaaTaaaa MM-TC 67.6
12730 YDR258C_Tm_predic_515TC TggmCcTagggaaacggTcagmCtTac MM-TC
75.5 12731 YDR258C_Tm_predic_566TC TTggaaamCatmCgcggTgmCgctTtTt
MM-TC 72 12732 YDR258C_Tm_predic_569TC
gaaamCaTmCggggagmCgctttTtmCaa MM-TC 74.8 12749
YDR258C_Tm_predic_604TC aaaamCgamCagmCaaaaggmCTtTmCtTc MM-TC 72
12733 YDR258C_Tm_predic_631TC gamCagmCcTcagtaaaTTggcmCacmCa MM-TC
77.4 12734 YDR258C_Tm_predic_686TC mCmCgaTTaaamCgacagamCagTaTgmCt
MM-TC 70.2 12735 YDR258C_Tm_predic_757TC
aTmCaaaTaggaaatmCagmCTaaagmCc MM-TC 64.6 12736
YDR258C_Tm_predic_813TC gamCmCTaagaamCaaaaagmCTggmCaat MM-TC 71.4
12745 YDR258C_Tm_predic_823TC aTaaagmCTggmCattaggTmCTcTTTt MM-TC 74
12743 YDR258C_Tm_predic_870TC agamCgTamCagmCaacagaaaTagmCag MM-TC
73.6 12737 YDR258C_Tm_predic_888TC aaaTagmCagmCaaaggmCcTmCgTctTg
MM-TC 79.3 12738 YDR258C_Tm_predic_890TC
aTagmCagcaaTgcccTcgtmCtTggc MM-TC 71.5 12739
YDR258C_Tm_predic_896TC gcaatggcctmCgamCttggccaacga MM-TC 73.1
12768 YDR258C_Tm_predic_043_PM tttggtagcacgacaagcttagtat PM-DNA
65.7 12771 YDR258C_Tm_predic_078_PM cactctaacagtttcgccgtttcta
PM-DNA 66.3 12766 YDR258C_Tm_predic_124_PM
gttgccatggagttcaaaatctgtc PM-DNA 65.8 12772
YDR258C_Tm_predic_164_PM tcaatggccttgcaccatataattg PM-DNA 64 12765
YDR258C_Tm_predic_201_PM tcagttagccaatccttcgcttcat PM-DNA 66.1
12770 YDR258C_Tm_predic_249_PM tttttcggccaaacgatcttgaatt PM-DNA 65
12774 YDR258C_Tm_predic_295_PM attgacctcaaaactttcttggata PM-DNA
61.8 12764 YDR258C_Tm_predic_356_PM gatgaactcaggtggataggatctt
PM-DNA 64 12752 YDR258C_Tm_predic_424_PM accatcatcacccaactttgtgtcg
PM-DNA 67.5 12775 YDR258C_Tm_predic_433_PM
cccaactttgtgtcgtttaataaaa PM-DNA 61 12753 YDR258C_Tm_predic_486_PM
caatgatcgtgttacggaaatcaac PM-DNA 64.2 12754
YDR258C_Tm_predic_515_PM tggcctagggaatcggtcagcttac PM-DNA 70.1
12755 YDR258C_Tm_predic_566_PM ttggaaacatcggggtgcgcttttt PM-DNA
70.8 12756 YDR258C_Tm_predic_569_PM gaaacatcggggtgcgctttttcaa
PM-DNA 68.7 12773 YDR258C_Tm_predic_604_PM
aaaacgacagcataaggctttcttc PM-DNA 64.5 12757
YDR258C_Tm_predic_631_PM gacagcctcagttaattggccacca PM-DNA 70.2
12758 YDR258C_Tm_predic_686_PM ccgattaaacgagagacagtatgct PM-DNA
65.4 12759 YDR258C_Tm_predic_757_PM atcaaataggaattcagctaaagcc
PM-DNA 61.5 12760 YDR258C_Tm_predic_813_PM
gacctaagaacataaagctggcaat PM-DNA 63.5 12769
YDR258C_Tm_predic_823_PM ataaagctggcaataggtctctttt PM-DNA 63.6
12767 YDR258C_Tm_predic_870_PM agacgtacagcatcagaaatagcag PM-DNA
66.6 12761 YDR258C_Tm_predic_888_PM aaatagcagcaatggcctcgtcttg
PM-DNA 69.2 12762 YDR258C_Tm_predic_890_PM
atagcagcaatggcctcgtcttggc PM-DNA 72.7 12763
YDR258C_Tm_predic_896_PM gcaatggcctcgtcttggccaacga PM-DNA 72.8
12792 YDR258C_Tm_predic_043T_PM TTTggTagcacgacaagcTTagTat PM-T 74.2
12795 YDR258C_Tm_predic_078T PM cacTcTaacagtTtcgccgTTTcTa PM-T 75.5
12790 YDR258C_Tm_predic_124T_PM gTTgccaTggagTtcaaaaTcTgTc PM-T 74.7
12796 YDR258C_Tm_predic_164T_PM TcaaTggccTTgcaccaTaTaaTTg PM-T 74
12789 YDR258C_Tm_predic_201T_PM TcagTTagccaaTccTTcgcTTcat PM-T 75.7
12794 YDR258C_Tm_predic_249T_PM TtTTTcggccaaacgaTcTTgaaTt PM-T 71
12798 YDR258C_Tm_predic_295T_PM aTTgaccTcaaaacTTTcTTggaTa PM-T 70.2
12788 YDR258C_Tm_predic_356T_PM gaTgaacTcaggTggaTaggaTcTt PM-T 71
12776 YDR258C_Tm_predic_424T_PM accaTcaTcacccaacTTTgTgTcg PM-T 79.2
12799 YDR258C_Tm_predic_433T_PM cccaacTTTgTgTcgTTTaaTaaaa PM-T 75.1
12777 YDR258C_Tm_predic_486T_PM caaTgaTcgTgtTacggaaaTcaac PM-T 72.2
12778 YDR258C_Tm_predic_51ST_PM TggccTagggaaTcggTcagcTTac PM-T 76.9
12779 YDR258C_Tm_predic_566T_PM TTggaaacaTcggggTgcgcTTTTt PM-T 76.7
12780 YDR258C_Tm_predic_569T_PM gaaacaTcggggTgcgcTTTTTcaa PM-T 78
12797 YDR258C_Tm_predic_604T_PM aaaacgacagcaTaaggcTTTcTTc PM-T 71.7
12781 YDR258C_Tm_predic_631T_PM gacagccTcagtTaaTTggccacca PM-T 75.4
12782 YDR258C_Tm_predic_686T_PM ccgaTTaaacgagagacagTaTgct PM-T 72.2
12783 YDR258C_Tm_predic_757T_PM aTcaaaTaggaaTTcagcTaaagcc PM-T 66.3
12784 YDR258C_Tm_predic_813T_PM gaccTaagaacaTaaagcTggcaat PM-T 67.5
12793 YDR258C_Tm_predic_823T_PM aTaaagcTggcaaTaggTcTcTTTt PM-T 74.3
12791 YDR258C_Tm_predic_870T_PM agacgTacagcaTcagaaaTagcag PM-T 71.4
12785 YDR258C_Tm_predic_888T_PM aaaTagcagcaaTggccTcgTcTTg PM-T 77.2
12786 YDR258C_Tm_predic_890T_PM aTagcagcaaTggccTcgTcTTggc PM-T
80.1
12787 YDR258C_Tm_predic_896T_PM gcaaTggccTcgTcTTggccaacga PM-T 80.8
12816 YDR258C_Tm_predic_043TC_PM TtTggTagmCamCgamCaagmCtTagTat
PM-TC 79 12819 YDR258C_Tm_predic_078TC_PM
mCamCtmCtaamCagtTtcgmCcgTtTmCTa PM-TC 81.9 12814
YDR258C_Tm_predic_124TC_PM gTtgmCmCaTggagTtmCaaaaTmCtgTc PM-TC 78.3
12820 YDR258C_Tm_predic_164TC_PM TmCaaTggmCcTTgmCacmCaTaTaaTTg
PM-TC 83.5 12813 YDR258C_Tm_predic_201TC_PM
TmCagTtagcmCaaTcmCtTmCgmCttmCat PM-TC 81.8 12818
YDR258C_Tm_predic_249TC_PM TtTtTmCggmCmCaaamCgatmCtTgaaTt PM-TC
77.8 12822 YDR258C_Tm_predic_295TC_PM
aTTgamCmCTmCaaaamCTTtmCTTggaTa PM-TC 75.6 12812
YDR258C_Tm_predic_356TC_PM gaTgaamCTmCaggTggaTaggaTmCTt PM-TC 77.3
12800 YDR258C_Tm_predic_424TC_PM amCcaTcaTcacmCmCaaccTtgTgtmCg
PM-TC 74.2 12823 YDR258C_Tm_predic_433TC_PM
mCmCmcaacTTtgTgTcgTTTaaTaaaa PM-TC 74.8 12729
YDR258C_Tm_predic_486TC_PM mCaaTgaTmCgTgttamCggaaaTmCaac PM-TC 75.5
12802 YDR258C_Tm_predic_515TC_PM TggmCcTagggaaTmCggTcagmCtTac PM-TC
83.6 12803 YDR258C_Tm_predic_566TC_PM TTggaaamCatmCggggTgmCgctTtTt
PM-TC 80.8 12804 YDR258C_Tm_predic_569TC_PM
gaaamCaTmCggggTgmCgctttTtmCaa PM-TC 83.2 12821
YDR258C_Tm_predic_604TC_PM aaaamCgamCagmCaTaaggmCTtTmCtTc PM-TC 79
12805 YDR258C_Tm_predic_631TC_PM gamCagmCcTcagtTaaTTggcmCacmCa
PM-TC 82.5 12806 YDR258C_Tm_predic_686TC_PM
mCmCgaTTaaamCgagagamCagTaTgmCt PM-TC 79.4 12807
YDR258C_Tm_predic_757TC_PM aTmCaaaTaggaaTtmCagmCTaaagmCc PM-TC 71.4
12808 YDR258C_Tm_predic_813TC_PM gamCmCTaagaamCaTaaagmCTggmCaat
PM-TC 78.9 12817 YDR258C_Tm_predic_823TC_PM
aTaaagmCTggmCaaTaggTmCTcTTTt PM-TC 81.2 12815
YDR258C_Tm_predic_870TC_PM agamCgTamCagmCaTmCagaaaTagmCag PM-TC
81.9 12809 YDR258C_Tm_predic 888TC_PM aaaTagmCagmCaaTggmCcTmCgTctTg
PM-TC 86.8 12810 YDR258C_Tm_predic_890TC_PM
aTagmCagcaaTggmCcTcgtmCtTggc PM-TC 83 12811
YDR258C_Tm_predic_896TC_PM gcaatggcctmCgTmCttggccaacga PM-TC
79.3
Example 52
Performance Analysis of LNA Substituted Oligonucleotide Capture
Probes Designed to Detect Splice Variants in Complex RNA Pools
A. Oligonucleotide design for microarrays. Thie methods for
designing exon-specific internal oligonucleotide capture probes has
been described in example 2.
A1. Design of the LNA-Modifield capture probes
[0651] For the internal LNA-modifield oligonucleotide capture
probes, every third DNA nucleotide was substituted with an LNA
nucleotide. The probes designed to capture the splice junction of
the recombinant splice variants were designed with LNa
substitutions at every third nucleotide position. All capture
probes are shown in Table 15. TABLE-US-00037 TABLE 15 Internal,
exon-specific and merged, exon-exon splice junction specific
oligonucleotide capture probes used in the example. Capital letters
denote LNA nucleotides and .sub.mC LNA methyl-cytosine (SEQ ID
NOs:) EQ No. Oligo Name Sequence 10716 >gene78.01a
cctgaaagtagatttgttatttccgaaacgccttctcccgttcttaagtc 10717
>gene78.01b catataccacaaatagtccctcaaaaatcacaagaaaactcacaacactg
10718 >gene78.03a
gatttgcagcggtggtaaaaagtatgaaaacgtggtaattaaaaggtctc 10719
>gene78.03b ccaatgaaaactaatcaaaggtaaacgtggatcccatggcaattcccggg
10720 >gene78.m0103
cacaacactgcccagaggttcaatcgataaatatgtgaaggaaatgcctg 10721
>gene78.m01INS3
caacactgcccagaggttcaatcgatccgatgatcctaatgaaggcgccc 10722
>gene78.mINS303
gtccagtatcgtccatcatagtatcgataaatatgtgaaggaaatgcctg 10723
>gene78.INS3 ctccttcttgcattcttcaacttccttcaacacttgagcggagtcggtgc
10724 >gene78.m01INS4
caacactgcccagaggttcaatcgatgtgtgataggatcagtgttcaggg 10725
>gene78.mINS403
gaaggcgaaggagactgctaatatcgataaatatgtgaaggaaatgcctg 10726
>gene78.INS4a gaacgtatgagcatgcgagagacgctgtagttggaaaaacccacgaagcg
10727 >gene78.INS4b
gaaaccgctgattatactgcggagaaggtgggtgagtataaagactatac 11345
>gene78.01a_40 aagtagatttgttatttccgaaacgccttctcccgttctt 11346
>gene78.01b_40 accacaaatagtccctcaaaaatcacaagaaaactcacaa 11347
>gene78.03a_40 gcagcggtggtaaaaagtatgaaaacgtggtaattaaaag 11348
>gene78.03b_40 gaaaactaatcaaaggtaaacgtggatcccatggcaattc 11349
>gene78.m0103_40 cactgcccagaggttcaatcgataaatatgtgaaggaaat 11350
>gene78.m01INS3_40 ctgcccagaggttcaatcgatccgatgatcctaatgaagg
11351 >gene78.mINS303_40
gtatcgtccatcatagtatcgataaatatgtgaaggaaat 11352 >gene78.INS3_40
tcttgcattcttcaacttccttcaacacttgagcggagtc 11353
>gene78.m01INS4_40 ctgcccagaggttcaatcgatgtgtgataggatcagtgtt
11354 >gene78.mINS403_40
cgaaggagactgctaatatcgataaatatgtgaaggaaat 11355 >gene78.INS4a_40
tatgagcatgcgagagacgctgtagttggaaaaacccacg 11356 >gene78.INS4b_40
cgctgattatactgcggagaaggtgggtgagtataaagac 11357
>gene78.01a_50_LNA3
mCctGaaAgtAgaTttGttAttTccGaaAcgmCctTctmCccGttmCttAagTc 11358
>gene78.01b_50_LNA3
mCatAtamCcamCaaAtaGtcmCctmCaaAaaTcamCaaGaaAacTcamCaamCacTg 11359
>gene78.03a_50_LNA3
GatTtgmCagmCggTggTaaAaaGtaTgaAaamCgtGgtAatTaaAagGtcTc 11360
>gene78.03b_50_LNA3
mCcaAtgAaaActAatmCaaAggTaaAcgTggAtcmCcaTggmCaaTtcmCcgGg 11361
>gene78.m0103_50_LNA3
mCacAacActGccmCagAggTtcAatmCgaTaaAtaTgtGaaGgaAatGccTg 11362
>gene78.m01INS3_50_LNA3
mCaamCacTgcmCcaGagGttmCaaTcgAtcmCgaTgaTccTaaTgaAggmCgcmCc 11363
>gene78.mINS303_50_LNA3
GtcmCagTatmCgtmCcaTcaTagTatmCgaTaaAtaTgtGaaGgaAatGccTg 11364
>gene78.INS3_50_LNA3
mCtcmCttmCttGcaTtcTtcAacTtcmCttmCaamCacTtgAgcGgaGtcGgtGc 11365
>gene78.m01INS4_50_LNA3
mCaamCacTgcmCcaGagGttmCaaTcgAtgTgtGatAggAtcAgtGttmCagGg 11366
>gene78.mINS403_50_LNA3
GaaGgcGaaGgaGacTgcTaaTatmCgaTaaAtaTgtGaaGgaAatGccTg 11367
>gene78.INS4a_50_LNA3
GaamCgtAtgAgcAtgmCgaGagAcgmCtgTagTtgGaaAaamCccAcgAagmCg 11368
>gene78.INS4b_50_LNA3
GaaAccGctGatTatActGcgGagAagGtgGgtGagTatAaaGacTatAc 11369
>gene78.01a_40_LNA3 aAgtAgaTttGttAttTccGaaAcgmCctTctmCccGttmCtt
11370 >gene78.01b_40_LNA3
amCcamCaaAtaGtcmCctmCaaAaaTcamCaaGaaAacTcamCaa 11371
>gene78.03a_40_LNA3 gmCagmCggTggTaaAaaGtaTgaAaamCgtGgtAatTaaAag
11372 >gene78.03b_40_LNA3
gAaaActAatmCaaAggTaaAcgTggAtcmCcaTggmCaaTtc 11373
>gene78.m0103_40_LNA3 cActGccmCagAggTtcAatmCgaTaaAtaTgtGaaGgaAat
11374 >gene78.m01INS3_40_LNA3
cTgcmCcaGagGttmCaaTcgAtcmCgaTgaTccTaaTgaAgg 11375
>gene78.mINS303_40_LNA3
gTatmCgtmCcaTcaTagTatmCgaTaaAtaTgtGaaGgaAat 11376
>gene78.INS3_40_LNA3
tmCttGcaTtcTtcAacTtcmCttmCaamCacTtgAgcGgaGtc 11377
>gene78.m01INS4_40_LNA3
cTgcmCcaGagGttmCaaTcgAtgTgtGatAggAtcAgtGtt 11378
>gene78.mINS403_40_LNA3
cGaaGgaGacTgcTaaTatmCgaTaaAtaTgtGaaGgaAat 11379
>gene78.INS4a_40_LNA3
tAtgAgcAtgmCgaGagAcgmCtgTagTtgGaaAaamCccAcg 11380
>gene78.INS4b_40_LNA3
cGctGatTatActGcgGagAagGtgGgtGagTatAaaGac
B. Printing and Coupling of the Splice Isoform-Specific
Microarrays
[0652] The splice variant capture probes were synthesized with a 5'
anthraquinone (AQ)-modification, followed by a hexaethyleneglycol-2
(HEG2) linker. The capture probes were first diluted to a 20 tM
final concentration in 100 mM Na-phosphate buffer pH 7.0, and
spotted on the Immobilizer polymer microarray slides (Exiqon,
Denmark) using the Biochip Arrayer One (Packard Biochip
Technologies, USA) with a spot volume of 2.times.300 pl and 300
.mu.m between the spots. The capture probes were immobilized onto
the microarray slide by UV irradiation in a Stratalinker with 2300
.mu.joules (Stratagene, USA). Non-immobilized capture probe
oligonucleotides were removed from the slides by washing the slides
two times 15 min. in 1.times.SSC. After washing, the slides were
dried by centrifugation at 1000.times.g for 2 min., and stored in a
slide box until microarray hybridization.
C. Construction of the Splice Variant Clones
[0653] The recombinant splice variant constructs were cloned into
the Triampl8 vector (Ambion, USA). The constructs were sequenced to
confirm their construction. The plasmid clones were transformed
into E. coli XL10-Gold (Stratagene, USA).
[0654] Genomic DNA was prepared from a wild type standard
laboratory strain of Saccharomyces cerevisiae using the Nucleon MiY
DNA extraction kit (Amersham Biosciences, USA) according to the
supplier's instructions. Amplification of the partial yeast gene
was done by standard PCR using yeast genomic DNA as template. In
the first step of amplification, a forward primer containing a
restriction enzyme site and a reverse primer containing a universal
linker sequence were used. In this step 20 bp was added to the
3'-end of the amplicon, next to the stop codon. In the second step
of amplification, the reverse primer was exchanged with a nested
primer containing a poly-T.sub.20 tail and a restriction enzyme
site. The SWI5 amplicon contains 730 bp of the SWI5 ORF plus 20 bp
universal linker sequence and a poly-A20 tail.
[0655] The PCR primers used were; TABLE-US-00038 YDR146C-For-EcoRI:
(SEQ ID NO:) acgtgaattcaaatacagacaatgaaggagatga YDR146C-Rev-Uni:
(SEQ ID NO:) gatccccgggaattgccatgttacctttgattagttttcattggc
Uni-polyT-BamHI: (SEQ ID NO:)
acgtggatccttttttttttttttttttttgatccccgggaattgcca tg,
[0656] The PCR amplicon was cut with the restriction enzymes,
EcoRI+BamHI. The DNA fragment was ligated into the pTRIamp 18
vector (Ambion, USA) using the Quick Ligation Kit (New England
Biolabs, USA) according to the supplier's instructions and
transformed into E. coli DH-5.alpha. by standard methods.
C1. Construction of the Recombinant Slice Variant #1
(Triampl8swi5-Rubisco)
[0657] The Arabidopsis thaliana Rubisco small subunit ssu2b gene
fragment (gi17064721) was amplified from genomic DNA by primers
named DJ305 5'-ACTATGATGGACGATACTGGAC-3' (SEQ ID NO:) and DJ306
5'-ATTGGATCGATCCGATGATCCTAATGAAGGC-3' (SEQ ID NO:), containing ClaI
restriction site linkers. The purified PCR fragment was digested
with ClaI and then cloned into the swi5 (gI:7839148) vector at the
unique ClaI site (atcgat) giving each insert a flanking sequence
from the original yeast SWI5 insert (named exon01 and exon 03, see
FIG. 19). The product was inserted in the reverse orientation, so
that the insert sequence is: TABLE-US-00039 (SEQ ID NO:)
atcgatCCGATGATCCTAATGAAGGCGCCCGGGTACTCCTTCTTGCATTC
TTCAACTTCCTTCAACACTTGAGCGGAGTCGGTGCATCCGAACAATGGAA
GCTTCCACATTGTCCAGTATCGTCCATCATAGTatcgat
[0658] Nucleotide sequence analysis revealed a difference between
the sequence of A. thaliana Rubisco expected from the GenBank
database and that obtained from all sequenced constructs and PCR
products. Position 30 in the Rubisco insert is C rather than the
expected A. This SNP was probably created by PCR. None of the
oligonucleotide capture probes used in the example cover this
region. TABLE-US-00040 Rubisco seq. in genbank (SEQ ID NO:)
TCCTAATGAAGGCGCCA The sequence obtained from the plasmid contruct
(SEQ ID NO:) TCCTAATGAAGGCGCCC
C2. Construction of the Recombinant Splice Variant # 2 (Triamp
18swi5-lea)
[0659] The Arabidopsis thaliana Lea gene (gi 1526423) was amplified
from genomic DNA with primers named DJ307
5'-GGAATTATCGATGTGTGATAGGATCAGTGTTCAG-3' (SEQ ID NO:), and DJ308
5'-AATTGGATCGATATTAGCAGTCTCCTTCGCC-3' (SEQ ID NO:), including the
ClaI linker sites as above. The PCR fragment was digested with ClaI
cloned into the yeast SWI5 IVT construct as above at the unique
ClaI site.
[0660] The fragment was inserted in the forward orientation,
resulting in the following insert sequence: TABLE-US-00041 (SEQ ID
NO:) atcgatGTGTGATAGGTTCAGTGTTCAGGGCTGTCCAAGGAACGTATGAG
CATGCGAGAGACGCTGTAGTTGGAAAAACCCACGAAGCGGCTGAGTCTAC
CAAAGAAGGAGCTCAGATAGCTTCAGAGAAAGCGGTTGGAGCAAAGGACG
CAACCGTCGAGAAAGCTAAGGAAACCGCTGATTATACTGCGGAGAAGGTG
GGTGAGTATAAAGACTATACGGTTGATAAAGCTAAAGAGGCTAAGGACAC
AACTGCAGAGAAGGCGAAGGAGACTGCTAATatcgat.
[0661] FIG. 11 shows the construction of the recombinant splice
variants in the in vitro transcription vector. The small bars show
the location of the oligonucleotide capture probes used in this
example. The sequences of the capture probes are shown in Table
15.
D. Preparation of Target
D1. In Vitro RNA Preparation from Splice Variant Vectors
[0662] In vitro RNA from the splice variants were made using the
MEGAscriptTm high yield transcription kit according to the
manufacturer's instructions (Ambion, USA). The yield of IVT RNA was
quantified at a Nanodrop spectrophotometer (Nanodrop Technologies,
USA)
D2. Isolation of Total RNA from C. elegans
[0663] Strains and growth conditions: C. elegans wild-type strain
(Bristol-N2) was maintained on nematode growth medium (NG) plates
seeded with Escherichia coli strain OP50 at 20.degree. C., and the
mixed stages of the nematode were prepared as described in Hope, I.
A. (ed.) "C. elegans--A Practical Approach", Oxford University
Press 1999. The samples were immediately flash frozen in liquid
N.sub.2 and stored at -80.degree. C. until RNA isolation.
[0664] A 100 .mu.l aliquot of packed C. elegans worms from a mixed
stage population was homogenized using the FastPrep Bio101 from
Kem-En-Tec for 1 min, speed 6 followed by isolation of total RNA
from the extracts using the FastPrep Biol101 kit (Kem-En-Tec)
according to the manufacturer's instructions. The eluted total RNA
was ethanol precipitated for 24 hours at -20.degree. C. by addition
of 2.5 volumes of 96% EtOH and 0.1 volume of 3M Na-acetate, pH 5.2
(Ambion, USA), followed by centrifugation of the total RNA sample
for 30 min at 13200 rpm. The total RNA pellet was air-dried and
redissolved in 10 .mu.I of diethylpyrocarbonate (DEPC)-treated
water (Ambion, USA) and stored at -80.degree. C.
E. Fluorochrome-Labelling of the Target
[0665] The following fluorochrome-labelled cDNA targets were
synthesized to test the performance of `merged` splice junction
probes that encompass exon borders. Synthetic RNAs corresponding to
three artificial splice variants; #1 (exon01-INS3-exon03
(1-INS3-3), #2 (exon01-INS4-exon03) (01-INS3-3) and #3 without the
middle exon (01-03) were spiked into 10 .mu.g of C. elegans
reference total RNA samples in various combinations and
concentrations prior to fluorochrome-labelling with either Cy3 or
Cy5 as indicated in Table 16. At the same time 10 .mu.g of C.
elegans reference total RNA was labeled with Cy3 for control
experiments. Hybridizations were performed with Cy3- and Cy5
labeled C. elegans RNA +spike RNA mix. The details of RNA samples
and synthetic RNA spikes are shown in Table 16. The RNA samples
were combined in individual labeling reactions with 5 1 .mu.g
anchored oligo(dT.sub.20) primer and DEPC-treated water to a final
volume of 8 .mu.l. The mixture was heated at 70.degree. C. for 10
min, quenched on ice for 5 min, followed by addition of 20 units of
Superasin RNase inhibitor (Ambion, USA), 1 .mu.l dNTP solution (10
mM each dATP, dGTP, dTTP and 0.4 mM dCTP, and 3 .mu.l of Cy3-dCTP
or Cy5-dCTP, Amersham Biosciensces, USA), 4 .mu.l 5.times.RTase
buffer (Invitrogen), 2 .mu.l 0.1 mM DTT (Invitrogen), 400 units of
Superscript II reverse transcriptase (Invitrogen, USA) and
DEPC-treated water to 20 .mu.l final volume. Background
hybridization to merged capture probes was monitored with 10.mu.g
of C. elegans reference RNA alone labeled with Cy3-dCTP; according
to the labeling method described above for the splice variant
spikes. All cDNA syntheses were carried out at 42.degree. C. for 2
hours, and the reaction was stopped by incubation at 70.degree. C.
for 5 min., followed by incubation on ice for 5 min.
[0666] Unincorporated dNTPs were removed by gel filtration using
MicroSpin S-400 HR columns as described in the following: Pre-spin
the column 1 min at 1500.times.g in a 1.5 ml tube and place the
column in a new 1.5 ml tube. Slowly apply the cDNA sample to the
top centre of the resin, spin 1500.times.g for 2 min and collect
the eluate. The RNA was hydrolyzed by adding 3 .mu.l of 0.5 M NaOH,
mixing and incubating at 70.degree. C. for 15 min. The samples were
neutralized by adding 3 .mu.l of 0.5 M HCl and mixing, followed by
addition of 450 .mu.l 1.times.TE, pH 7.5 to the neutralized sample
and transfer onto a Microcon-30 concentrator (prior to use, spin
500 .mu.l 1.times.TE through the column to remove residual
glycerol). The samples were centrifuged at 14000.times.g in a
microcentrifuge for 12 min. Spinning was continued until volume was
reduced to 5 .mu.l. The labelled cDNA probes were eluted by
inverting the Microcon-30 tube and spinning at 1000.times.g
TABLE-US-00042 TABLE 16 Synthetic splice variant RNAs spiked into
C. elegans samples*. Spike RNA Observed ratio STDEV Observed ratio
STDEV concentration Ratio Splice variant RNAs LNA 50mer LNA 50mer
LNA 40mer LNA 40mer Expected ratio 1000 ppm 5 Cy3: spike 01-INS3-03
0.76 0.05 0.61 0.19 0.83 1 Cy3: spike 01-03 0.24 0.05 0.39 0.19
0.17 1 Cy5: spike 01-INS3-03 0.16 0.04 0.06 0.03 0.17 5 Cy5: spike
01-03 0.84 0.04 0.94 0.03 0.83 1000 ppm 5 Cy3: spike 01-INS3-03
0.77 0.11 0.68 0.22 0.83 1 Cy3: spike 01-INS4-03 0.23 0.11 0.32
0.22 0.17 1 Cy5: spike 01-INS3-03 0.12 0.04 0.11 0.15 0.17 5 Cy5:
spike 01-INS4-03 0.88 0.04 0.89 0.15 0.83 1000 ppm 5 Cy3: spike
01-INS3-03 0.88 0.08 0.87 0.10 0.83 1 Cy3: spike 01-INS4-03 0.12
0.08 0.13 0.10 0.17 1 Cy5: spike 01-INS3-03 0.22 0.12 0.15 0.12
0.17 5 Cy5: spike 01-INS4-03 0.78 0.12 0.85 0.12 0.83 100 ppm 5
Cy3: spike 01-INS3-03 0.89 0.15 0.11 0.08 0.83 1 Cy3: spike
01-INS4-03 0.11 0.15 0.89 0.08 0.17 1 Cy5: spike 01-INS3-03 0.48
0.2 0.57 0.31 0.17 5 Cy5: spike 01-INS4-03 0.52 0.2 0.43 0.31 0.83
10 ppm 5 Cy3: spike 01-INS3-03 0.61 0.2 0.09 0.14 0.83 1 Cy3: spike
01-INS4-03 0.39 0.2 0.91 0.14 0.17 1 Cy5: spike 01-INS3-03 0.34
0.18 0.19 0.22 0.17 5 Cy5: spike 01-INS4-03 0.66 0.18 0.81 0.22
0.83 *Parts per million (ppm) calculations indicate spike
transcripts per total transcripts in the hybridisation mix.
Calculations are based on an average C. elegans RNA being 1000
nucleotides as in Hill et al. (2000). Science 290: 809-812.
F. Microaray Hydridization
[0667] The fluorochrome-labelled cDNA samples, respectively, were
combined. The following was added: 3.75 .mu.l 20.times.SSC
(3.times.SSC final, pass through 0.22.mu. filter prior to use to
remove particulates) yeast tRNA (1 .mu.g/.mu.l final) 0.625 .mu.l 1
M HEPES, pH 7.0 (25 mM final, pass through 0.22.mu. filter water
prior to use to remove particulates) 0.75 .mu.l 10% SDS (0.3%
final) and DEPC-water to 25 .mu.l final volume. The labelled cDNA
target samples were filtered in Millipore 0.22.mu. fil;ter umn
(Ultrafree-MC, Millipore, USA) according to the manufacturer's
instructionms, followed by incubation of the reaction mixture at
100.degree. C. for 2-5 min. The cDNA probes were cooled at room
temp for 2-5 min by spinning at max speed in a microcentrifuge. A
LifterSlip (Erie Scientific Company, USA) was carefully placed on
top of the microarray spotted on Imrobilizer.TM. MicroArray Slide
and the hybridization mixture was applied to the array from the
side. An aliquot of 30 .mu.L of 3.times.SSC was added to both ends
of the hybridization chamber, and the Immobilizer.TM. MicroArray
Slide was placed in the hybridization chamber (DieTech, USA). The
chamber was sealed watertight and incubated at 65.degree. C. for
16-18 hours submerged in a water bath. After hybridisation, the
slide was removed carefully from the hybridization chamber and
washed using the following protocol. The slides were washed
sequentially by plunging gently in 2.times.SSC/0.1% SDS at room
temperature until the cover slip falls of into the washing
solution, then in 1.times.SSC pH 7.0 (150 mM NaCl, 15 mM Sodium
Citrate) at room temperature for 1 min, then in 0.2 .times.SSC, pH
7.0 (30 mM NaCl, 3 mM Sodium Citrate) at room temperature for 1
min, and finally in 0.05 .times.SSC (7.5 mM NaCl, 0.75 mM Sodium
Citrate) for 5 sec, followed by drying of the slides by spinning at
1000.times.g for 2 min. The slides were stored in a slide box in
the dark until scanning.
G. Microarray Data Analysis.
[0668] The splice variant microarray was scanned in a ScanArray
4OOOXL confocal laser scanner (Packard Instruments, USA). The
hybridisation data were analysed using the GenePix Pro 4.01
microarray analysis software (Axon, USA). The C. elegans reference
RNA alone converted to first strand cDNA and labelled with Cy3-dCTP
did not produce significant fluorescence intensity signals from the
LNA substituted spike RNA specific capture probes.
G1. A Mathematical Formula for Analysis of the Microarray Data. for
Alternative Splicing
[0669] One of the major limitations to comparative microarray
hybridisation assays is that only identical probes can be compared
between samples. Different alternative splice forms are detected
using different probes, and this will tell directly if one splice
form is more abundant in a given tissue compared to another.
However, the estimation of the ratios between splice forms in a
single tissue is not directly accessible. Given an example similar
to that described below we employ the following calculations to
calculate quantities of splice variants from array data. The
theoretical justification is shown. To our knowledge this
justification has not been used by any previous analysis.
[0670] The above scenario is tested in a comparative hybridisation,
with two channels: I & II (signal from probe2 in channel I is
called probe2(I), and so forth). Probel hybridises to both splice
forms, Probe2 hybridises to A only, Probe3 hybridises to B
only.
Since every transcript will hybridise to probel, and every
transcript will hybridise to either probe2 or probe3, there exists
some relationship between the following: probe1(I).about.{probe2(I)
and probe3(I)}. probe1(II).about.{probe2(II) and probe3(II)}. For
simplicity we assume that systematic differences between channels
have already been eliminated through normalisation, although this
is not essential.
[0671] We now imagine a factor (x) that will transform the signal
of probe2 into a value directly comparable to probe I. Likewise we
imagine factor (y) for probe3. As long as we are not facing
saturation in the hybridisations, the assumption of a linear
relationship between absolute probe signals is reasonable.
The introduction of variables x & y will give the following
equations: probe1(I)=(x)probe2(I)+(y)probe3(I).
probe1(II)=(x)probe2(II)+(y)probe3(II). Since all signals are
measurable, the above is two linear equations with two unknown
variables, that can easily be solved. Further the ratio between
(x)probe2(I) & (y)probe3(I) will provide the ratio between
splice form A and B in channel I. Similarly, the ratio of
(x)probe2(II) to (y)probe3(II) is used for channel II. Data
Normalization is not Required for this Method.
[0672] In the above equations, probe1 denotes all probes that will
hybridize to both spliceforms, probe2 denotes probes that
specifically will hybridize to spliceform A but not B, and probe3
denotes probes that will specifically hybridize to spliceform B but
not A.
[0673] In the case where two spliceforms consist of gene78 with two
different inserts middle exons (INS3& INS4), probes can be
grouped as in Table 20 (only LNA 40mers are considered here):
TABLE-US-00043 TABLE 20 Probes that will hybridize to Probes that
will hybridize to Probes that will hybridize to both constructs
INS3 constructs only INS4 constructs only Gene78.01a_40_LNA3
Gene78.INS3_40_LNA3 Gene78.INS4_40_LNA3 Gene78.01b_40_LNA3
Gene78.m01INS3_40_LNA3 Gene78.m01INS4_40_LNA3 Gene78.03a_40_LNA3
Gene78.mINS303_40_LNA3 Gene78.mINS403_40_LNA3
Gene78.03b_40_LNA3
[0674] The equations can be solved with any combinations of one
representative from each probe group. This gives a total of 48
(4.times.3.times.3) possible ways of solving the equations. The
estimated quantities of the constructs are given as the average of
all possible solutions (equations yielding non-positive solutions
are ignored). This was done for all comparative hybridizations.
Note that when comparing with gene78 with no insert, only 12
equations are possible (The, since the artificial splice variant
construct with no insert has only one specific probe). The results
from analysis of the microarray hybridization data from the RNA
pools spiked with different splice isoforms at different ratios and
concentrations are shown in FIGS. 39 and 40.
RESULTS
[0675] FIG. 39 shows detection of alternatively spliced mRNAs using
LNA-substituted 50-mer oligonucleotide capture probes in a bar
diagram format. FIG. 40 shows detection of alternatively spliced
mRNAs using LNA-substituted 40-mer oligonucleotide capture probes.
Both 50-mer and 40-mer LNA-DNA mixmer substituted oligonucleotide
capture probes, substituted with an LNA nucleotide at every third
nucleotide position, were able to provide highly accurate
measurements for fold-changes in the expression of three
homologous, alternatively spliced mRNA variants in the
concentration range of 1000 ppm to 10 ppm. The quantification of
the splice isoforms was carried out using a set of both internal,
exon-specific probes and merged, splice junction specific probes,
printed onto microarrays and hybridized with complex cDNA target
pools spiked with different cloned artificial splice isoforms in
which the middle exon was either alternatively skipped or excluded
completely resulting in the three different splice isoforms;
01-INS3-03, 01-INS4-03 and 01-03.
Example 53
Expression Profiling of Toxicological Responses in Caenorhabditis
Elegans Using LNA Oligonucleotide Microarrays and
Beta-Naphthoflavone and Primaquine as Model Compounds
[0676] The present patent example demonstrates the use of the
Exiqon C. elegans LNA tox oligoarray in gene expression profiling
experiments in the nematode Caenorhabditis elegans. The C. elegans
tox oligoarray will monitor the expression of a selection of 110
genes relevant for general stress response and for the metabolism
of toxic compounds. Two different capture probes for each of these
target genes have been designed, and included on the LNA tox array.
In addition, the C. elegans LNA tox oligoarray contains capture
probes providing control for cDNA synthesis efficiency and the
developmental stage of the nematode. Capture probes for
constitutively expressed genes for data set normalization is also
included on the C. elegans LNA tox oligoarray.
A. Cultivation of C. Elegans Worms
[0677] For all cultures the sample is divided into two, and one
half of the sample is used as the control, the other as the treated
sample. Worm samples are harvested and sucrose cleaned by standard
methods. For heat shock treatment: the heat shock sample is added
to S-media preheated to 33.degree. C. in a 1 L flask suspended in a
water bath at 33.degree. C., the other sample is added to a 1 L
flask with S-media at 25.degree. C. Both samples are shaken at
approximately 100 rpm. for an hour. For .beta.-naphthoflavone and
primaquine treatment: 0.5 mL of 5 mgmL .beta.-naphthoflavone in
DMSO or 0.5 mL of 20 mgmL primaquine in DMSO were added to each 500
mL volume of S-media culture after 28 hours of growth from L1. At
the same time 0.5 mL of DMSO was added to the control. Incubation
was for 24 hours. Samples are then harvested by centrifugation at
3000.times.g suspended in RNALater.TM. (Ambion) and immediately
frozen in liquid nitrogen.
B. RNA Extraction
[0678] RNA was extracted from the worm samples using the FastRNAS
Kit, GREEN (Q-BIO) essentially according to the suppliers'
instructions.
C. Design and Synthesis of the LNA Capture Probes
[0679] Capture probes were designed using an in-house developed
software. Regions with unique mRNA sequence of the selected target
genes were identified. The optimal 50-mer oligonucleotide sequences
with respect to Tm, self-complementarity and secondary structure
were selected. LNA modifications were incorporated to increase
affinity and specificity.
D. Printing of the LNA Microarrays
[0680] The microarrays were printed on Immobilizer.TM. MicroArray
Slides (Exiqon, Denmark) using the MicroGrid II from Biorobotics
(UK). The arrays were printed with a 10 .mu.M capture probe
solution. Two replicas of the capture probes were printed on each
slide.
E. Synthesis of Fluorochrome Labelled First Strand cDNA from Total
RNA
[0681] 15 .mu.g of C. elegans total RNA was combined with 5 .mu.g
oligo dT primer (T20VN) in an RNase free, pre-siliconized 1.5 mL
tube, and the final volume was adjusted with DEPC-water to 14.5
.mu.L. The reaction mixture was heated at +70.degree. C. for 10
min., quenched on ice 5 min., spin 20 seconds, followed by addition
of 1 .mu.L SUPERase-In.TM. (20U/.mu.L, Ambion, USA), 6 .mu.L
5.times.RTase buffer (Invitrogen, USA), 3 .mu.L 0.1 M DTT
(Invitrogen, USA), 1.5 .mu.L dNTP (20 mM dATP, dGTP, dTTP; 4 mM
dCTP in DEPC-water, Amersham Biosciences, USA), and 3 .mu.L
Cy3.TM.-dCTP or Cy5.TM.-dCTP (Amersham Biosciences, USA). First
strand cDNA synthesis was carried out by adding 1 .mu.L of
Superscript.TM. II (Invitrogen, 200 U/.mu.L), mixing and incubating
the reaction mixture for 1 hour at 42.degree. C. An additional 1
.mu.L of Superscript.TM. II was added and the cDNA synthesis
reaction mixture was incubated for an additional 1 hour at
42.degree. C.; the reaction was stopped by heating at 70.degree. C.
for 5 min., and quenching on ice for 2 min. The RNA was hydrolyzed
by adding 5 .mu.L of 1 M NaOH, and incubating at 70.degree. C. for
15 min. The samples were neutralized by adding 5 .mu.L of 1 M HCl,
and purified by adding 450 .mu.L 1.times.TE buffer, pH 7.5 to the
neutralized sample and transferring the samples onto a Microcon-30
concentrator. The samples were centrifuged at 14000.times.g in a
microcentrifuge for 8 min, the flow-through was discarded and the
washing step was repeated twice by refilling the filter with 450
.mu.l 1.times.TE buffer and by spinning for .about.12 min.
centrifugation was continued until the volume was reduced to about
5 .mu.L, and finally the labelled cDNA probe was eluted by
inverting the Microcon-30 tube and spinning at 1000.times.g for 3
min.
F. Synthesis of Fluorochrome Labelled cRNA from Total RNA
[0682] First and second strand cDNA syntheses were made using the
MessageAmp.TM. aRNA Kit (Ambion) according to suppliers'
instructions. Five microgram of C. elegans total RNA was used as
template for cDNA syntheses. Syntheses of fluorescent cRNA were
made according to the MessageAmp.TM. aRNA Kit (Ambion) protocol
with minor modifications. Cy3.TM.-UTP or Cy5.TM.-UTP (6 .mu.l of a
5 mM solution Amersham Biosciences, USA) replaced biotin-CTP. The
final concentration of ATP, CTP, and GTP was 7.5 mM whereas the
concentration of UTP was reduced to 4.9 mM.
G. Hybridization with Fluorochrome-Labelled cDNA or cRNA
[0683] The arrays were hybridized overnight using the following
protocol. The Cy3.TM. and Cy5.TM.-labelled cDNA or cRNA samples
were combined in one tube followed by addition of 3 .mu.L
20.times.SSC (3.times.SSC final), 0.5 .mu.L 1 M HEPES, pH 7.0 (25
mM final), 25 .mu.g yeast tRNA (1.25 .mu.g/.mu.L final), 0.6 .mu.L
10% SDS (0.3% final), and DEPC-treated water to 20.mu.L final
volume. The labelled cDNA target sample was filtered in a Millipore
0.22 micron spin column according to the manufacturer's
instructions (Millipore, USA), and the probe was denatured by
incubating the reaction at 100.degree. C. for 2 min. The sample was
cooled at 20-25.degree. C. for 5 min. by spinning at max speed in a
microcentrifuge. A LifterSlip (Erie Scientific Company, USA) was
carefully placed on top of the microarray spotted on
Immobilizer.TM. MicroArray Slide and the hybridization mixture was
applied to the array from the side. An aliquot of 30 .mu.L of
3.times.SSC was added to both ends of the hybridization chamber,
and the Immobilizer.TM. MicroArray Slide was placed in the
hybridization chamber. The chamber was sealed watertight and
incubated at 65.degree. C. for 16-18 hours submerged in a water
bath. After hybridisation, the slide was removed carefully from the
hybridization chamber and washed using the following protocol. The
Lifterslip coverslip was washed off in 2.times.SSC, pH 7.0
containing 0. 1% SDS at room temperature for 1 min., followed by
washing of the microarrays subsequently in 1 .OxSSC, pH 7.0 at room
temperature for 1 min, and then in 0.2.times.SSC, pH 7.0 at room
temperature for 1 min. Finally the slides were washed for 5 seconds
in 0.05.times.SSC, pH 7.0. The slides were then dried by
centrifugation in a swinging bucket rotor at approximately 200 G
for 2 min. The slide is now ready for scanning.
H. Data Analysis.
[0684] Following washing and drying, the slides were scanned using
a ScanArray 4000XL scanner (Perkin-Elmer Life Sciences, USA), and
the array data were processed using the GenePix.TM. Pro 4.0
software package (Axon, USA). The data in each image was normalized
so that the ratio of means of all of the features is equal to
1.
Results
[0685] Use of LNA-modified oligonucleotide capture probes in
Exiqons C. elegans LNA tox oligoarray clearly allows the
identification of distinct expression profiles for C. elegans genes
relevant for general stress response and for the metabolism of
toxic compounds. TABLE-US-00044 TABLE 17 Expression profiling using
LNA Oligonucleotide Microarrays. Log2 transformed fold of changes
for selected genes in the two expression profiling experiments
hybridised with cRNA target. Tox compound beta- Gene name
Primaquine naphthoflavone ABC_C34G6.4 1.01 ABC_F57C12.4 -1.11
CYP_C03G6.15 2.35 CYP_C06B3.3 2.47 CYP_C49G7.8 2.40 CYP_F14F7.2
-1.24 -1.03 CYP_K07C6.5 2.68 CYP_K09D9.2 2.14 DC_W05G11.3 1.16
ER_26S -1.09 -1.01 HSP_C47E8.5 1.17 HSP_F26D10.3 1.05 HSP_F43D9.4
1.27 NAP_D2096.8 1.14 PPGB_F13D12.6 1.08 1.21 RAD_Y116A8C.133 1.13
RPL_K11H12.2 1.15 1.42 Ubi_F25B5.4 1.37 Oligo Name Sequence
CECAT_Y54G11A.5b_u189_LNA3
GtcAatTctGggAgaAggTgtTggAtamCcgGggmCtcGggAgaGaaTgtGc
CECC_C03D6.3_u275_LNA3
AtgTaaAgaAggAatGctTccmCgaAtgGatTggAtaTttAttTgtmCcaGa
CECC_C03D6.3_u430_LNA3
GgamCcgAaaTttGtgmCagmCatGtcGgamCacGaaAttGatGgtmCtcAttTt
CECC_C07G2.3_d9_LNA3
mCagAcamCgaAggTtamCgaTagAtaAccAtcTctmCaaAgtmCtaTcgAccTc
CECC_C07G2.3_u44_LNA3
mCgamCgaTgtGcgTgtTccTgamCgaTgaAagAatGggAtaTtaAgaAaamCc
CECC_Y46G5A.2_u331_LNA3
TtgTgcTccAtcGctGctmCcgmCttAcaGacTtgAcaAcgmCtcAccTttGc
CECC_Y46G5A.2_u385_LNA3
AatGagmCggTtgTgcmCgtGtgAcgTcamCttmCgtmCacAgtGttGctmCtamCt
CECoA_C29F3.1_u31 6_LNA3
AaaTtgAcamCcaAtcAaaTctGtcTcaTctmCctGagGacmCgtmCaamCttmCg
CECoA_C29F3.1_u392_LNA3
AatmCttTgtGtamCggAgaTggGgcAaaAggmCagmCaaGaaAgtAaamCcaAg
CECoA_F08A8.4_u1094_LNA3
AggAcaAggGgcActActGgcAcaGgcTttGatTatTgcAgtGagAtaTt
CECoA_F08A8.4_u1260_LNA3
TtaAtgGagGtgAcaAtgGgtTccTtgGatTcgAtaAatTccGagTgcmCc
CECoA_F59F4.1_u109_LNA3
GctmCttmCtcmCagTggGctmCaaAatAgtmCaamCtcAacAgaTcgGaaGttmCt
CECoA_F59F4.1_u424_LNA3
AaaGctTcgAgaTggmCacGttmCgtmCtgTatmCtcGtgAagAacTtaTtgmCa
CECoA_Y25C1A.13_u115_LNA3
GatTcgmCtgAacTttAtcAagAcgTggAatAtgAgcmCagmCtcmCtgTcgAc
CECoA_Y25C1A.13_u451_LNA3
GatmCttAtcAccGcgTgcGatAttmCgaGtaGctTcamCagGatGcgAttTt
CECOL_C27H5.5_u493_LNA3
GgaAagGaaGgaTccAttmCtcAgcTctGcamCttmCcamCcaTcaGagmCcaTg
CECOL_C27H5.5_u680_LNA3
TggAtamCaaGgaGggAtcTggmCagTggTggAtcTggAagTggTggAtaTg
CECOQ_ZC395.2_u199_LNA3
TtgAaaGaamCtcmCttGccGacGatmCctGaaAcamCacAaaGaaTtgmCtgAa
CECOQ_ZC395.2_u400_LNA3
AtgTggGatGagGagAaaGaamCatTtaGatAcaAtgGaaAgaTtaGctGc
CECRYZ_F39B2.3_u171_LNA3
AggmCtgAgcTctTggActTtgGcaTcaAcaTtgTctmCatTctTgaAggAa
CECRYZ_F39B2.3_u222_LNA3
TtaTggTtamCagAagGagmCtgTttAcgGtgTagmCatTggGaaTgtmCttmCc
CECyclin_R02F2.1a_u24_LNA3
mCacTtcAacmCaamCtcmCgtGttAatmCaaGcaAgcmCgcmCacmCatmCtaAtgAg
CECyclin_R02F2.1a_u312_LNA3
TctmCatTgcTcgTcgAggmCtamCcaAcaAacActGgcAatAccmCaaTtaAt
CECyclin_ZC168.4_u203_LNA3
TaaGaaAgtmCatTgaGgaTgcTgtmCgcTttGctmCgcmCgaAgtmCtcGtaTa
CECyclin_ZC168.4_u273_LNA3
AagTtcAtcmCtgTtgAcgGaaTcgAggmCggAgaAtgmCtgTatmCggTcaTt
CECYP_B0213.15_u133_LNA3
AcaGgaAatAtgAttTtgGatTtcGatTttGaaTcgGttGgtGctGccmCc
CECYP_B0213.15_u202_LNA3
GctGagmCtgTatTtgGctAgtGaaAtgTgtGttTttGatActTtaAatGa
CECYP_B0304.3_u38_LNA3
AcgAggTttGgaTcamCaaTcaGaaTtcTgtGaaAtaAgcGttTttTggGa
CECYP_B0304.3_u89_LNA3
AgtTctmCggTctAacAgtGtcTccmCgtTgaAtaTtcTtgTaaAatmCacAc
CECYP_C03G6.14_u706_LNA3
AtgAccActmCaaAatActGctAaaAgaTttGcaGcgGcaGaaGccGttAa
CECYP_C03G6.14_u768_LNA3
TtgAtaTggmCtgTacmCtgTatGgtTttTgaGgamCgtTttTtaGgaGtcGa
CECYP_C03G6.15_d9_LNA3
AttTatTcaTtcAtcmCatGtaAacTgtAtaTttTgaAttTgtGttGtaAa
CECYP_C03G6.15_u148_LNA3
GccAaaGcaGaaTtgTatTtgAtcTtcGgtAacmCttmCtcmCttmCgcTacAa
CECYP_C06B3.3_u102_LNA3
AttTtgAatmCttmCtgGgaAaaTgcmCatmCcamCtcGagAaamCcgTtcmCgtTt
CECYP_C06B3.3_u474_LNA3
mCtaAcgGagGatmCtcGccAatTatmCttTgaGagAcaAaamCtgAaamCtcmCt
CECYP_C12D5.7_u399_LNA3
AtcTagTccmCaaTgaAtcTccmCacAtgmCtgTtamCtcGtgAtgTtcAacTc
CECYP_C12D5.7_u65_LNA3
TttTgcTttmCatmCgcAaaAgcTcaAgaTtamCacAtgTcaGgtmCaaGccAa
CECYP_C45H4.17_u27_LNA3
mCcgmCgamCttTaaAgaGaaGatmCatAaaTttGcaTtgTttTttGttTgtAt
CECYP_C45H4.17_u598_LNA3
mCgaGggTgaTtcGgaGacTttmCagTaaTgtmCcaActTtcAaaTgtTtgmCa
CECYP_C45H4.2_u110_LNA3
TagAtamCaaGatAcaTccmCtcAaaAgaAggmCctAccGtcAatGgcmCaaAg
CECYP_C45H4.2_u429_LNA3
TcaAcgmCgtmCtaTaaAtgAatmCacAacGagGtaTcaAcaTtcTccmCccTg
CECYP_C49C8.4_u363_LNA3
AtgmCtgAtgTtgAaaTtgmCtgGctAccGtaTtcmCaaAagAtamCtgTaaTc
CECYP_C49C8.4_u883_LNA3
AtgAatmCcaTggmCttGgamCatmCtcmCcgTttTtcAagGgaTatAaaAatGt
CECYP_C49G7.8_d6_LNA3
AtgmCaamCgaAttAgtGaaAaaTtcAtcmCtgGaaTaaAaaAtaAttmCtaAa
CECYP_C49G7.8_u795_LNA3
AtcGctAcgAcaAtcTttmCcgAtgmCctTcgAagTttmCgaAagmCttTctmCt
CECYP_F01D5.9_u374_LNA3
GagGtcGgtGgaGgaGgaAgtGgaAatTgamCggmCaaAatmCctGccmCaaGg
CECYP_F01D5.9_u46_LNA3
mCccTctTtgGgaTttmCcamCtcAagTttActGttmCggmCagmCagTgaTatAa
CECYP_F08F3.7_u25_LNA3
GagTtgGttmCcamCagAatGctTagGacGttTaaAttmCgtmCacAaamCttTt
CECYP_F08F3.7_u401_LNA3
mCaaTatGgtTccmCatTttAgcAacTcaTatGaamCacAgaAgaTgtmCctTg
CECYP_F14F7.2_u397_LNA3
GaaAaaGgcGtcGacAttTtaTgtGacAcgTggAcamCttmCacTatGacAa
CECYP_F14F7.2_u68_LNA3
TaaTtgAatTacGggTctTttGtamCatAttAatTttAgtAtamCttTgtGa
CECYP_F42A9.5_u435_LNA3
AtaTcaAtgmCaamCtaTtaAtgAatmCacAacGtcTtgmCcaAtcTtcTccmCg
CECYP_F42A9.5_u55_LNA3
GgaGtgActAtgAaaGcaAagAgtTacmCgaTtgAaamCtgAaaGacAgamCa
CECYP_K07C6.3_u3_LNA3
AatmCttTaaTgaTaaTttAtgGgaTctGtaTttmCtcTttmCtgTcaAtaAa
CECYP_K07C6.3_u354_LNA3
AtgAgcmCcamCaaAtgTaaAagGatAcgAgaTtgAttmCggGaamCagTcatg
CECYP_K07C6.4_u118_LNA3
AtcmCtgmCgaTatGacAttAagmCcamCatGgtTctGaamCctTcaAcaGaaGa
CECYP_K07C6.4_u87_LNA3
mCtgAacmCttmCaamCagAagAtaAacTtcmCgtAtaGcgmCtgGaaAaamCtcmCt
CECYP_K07C6.5_u7_LNA3
AttTaaAggAatTcamCagmCtcAaaAaaTaaTaamCtamCcgGttmCagAgaTt
CECYP_K07C6.5_u99_LNA3
AatTtgAgcmCacAtgGcaAgtTatmCaamCagAggAgamCaaTgcmCgtAcaGt
CECYP_K09A11.3_u362_LNA3
TgamCatTctActTaaAggGaaGaaAatAccAacTggTacmCctTgtAttTg
CECYP_K09A11.3_u48_LNA3
TcamCcamCaaAgcmCatAcaTatGcgAgcTagTtcmCtcAggmCtgmCttAaamCc
CECYP_K09A11.4_u238_LNA3
TtcGacAaaActAttTtgGaaAgaAcaAtcmCcaTtcAgtGtcGgcAaamCg
CECYP_K09A11.4_u68_LNA3
TctGacAacAaaGccAtamCacGtgmCcgActAatTccAcaAtcAgcTagAa
CECYP_K09D9.2_u151_LNA3
TtgGcaAaaGcaGaaTtgTatTtaAtcTttGgaAacmCtcmCttmCttmCgcTa
CECYP_K09D9.2_u866_LNA3
TgaAtcTttmCaaActTatmCacTccTttTaaTacTacmCgtTccTgtTtgGa
CECYP_T10B9.10_u410_LNA
AttGagAttGtaTccAttGgcGtcTctTgtTcamCaaTcgAaaAtgTctmCa
CECYP_T10B9.10_u56_LNA
AacTgcTacTatTgcGccAtcAagTgtGctGctmCaaActTaaAtcmCagGt
CECYP_T10B9.7_u102_LNA3
TtgAgamCagGaaAtaAgamCtaGaaTtcmCttTgaAacTggTggGaaGtgmCt
CECYP_T10B9.7_u267_LNA3
AagAtgTcaAagAatTcaAgcmCagAacGatGgtmCcamCcgAcgAgcmCatTa
CECYP_T19B10.1_u100_LNA3
AttGaamCcaActmCtgAaaTatAatGacAcaAaamCcaTgtmCtgGaaGtgGt
CECYP_T19B10.1_u319_LNA3
GgcAatGtgAcaAtaTctmCcaAtgGttmCttmCacAgcAatmCatmCacGtgTt
CECYP_Y49C4A.9_u121_LNA3
mCtaTtcAatmCgaTatTttAtcAcamCcaTccAgtGctGgamCctmCcaTcaTt
CECYP_Y49C4A.9_u413_LNA3
GtcTcaGagAtgTgtAaaTttActTccmCtgmCaaTttGttTcamCgcAacTa
CECYP_ZK177.5_u394_LNA3
TtcmCgaAtgTttmCcaAttGggActGaaGttTcaAgaGtcAccmCagAaaAa
CECYP_ZK177.5_u445_LNA3
GatmCcaGcaTctTccAagmCttAcaTtcmCtcmCgtGctTgtAtcAagGaaAc
CEDAO_C47A10.5_d9_LNA3
TttGaaAacmCtgTttTatTatTaaAatAgaTaaTtgAttAgtTctGtamCg
CEDAO_C47A10.5_u269_LNA3
AtamCgtTgcActGcaTccGgcTatGagGgaGccAaaAatmCttAggGgaGt
CEDC_C01A2.3_u373_LNA3
GcamCttmCcaTtcAtcTctGcaGctActAtgGctTtgGtgAcaAaaGttGg
CEDC_C01A2.3_u96_LNA4
mCcgTccAaaAgaAtgmCcaTctmCacAagTctTgaAatmCttAtaAagGtaGt
CEDC_C34F6.1_u301_LNA3
GagGgaTcaAcaGtaAccTcgTgcGgtAttGacAagGgaTgtmCcgGaaGg
CEDC_C34F6.1_u450_LNA3
GatGgtTctTcgAtcGcaAacAaaAcaGatGtgmCtcmCatTtamCatAcgGa
CEDC_F33D11.3_u126_LNA3
AtgGagAaaAtgGatmCtgAtgGagTtgmCagGaaGtgAtgGagmCtcmCagGa
CEDC_F33D11.3_u14_LNA3
TgaAtcTccAtaAatTatTcaAtgTttmCcaAatAttTaaTttAtcAatTg
CEDC_F46E10.2_u392_LNA3
GctmCaamCacGgtAggAtcmCtaTggAacmCgtmCggAggAgcAggmCctmCggAg CEDC_F46E
10.2_u54_LNA3
mCgtGacAacmCtcTtaTttAttTctGtaAaamCtgAttmCgcmCaaActTttGt
CEDC_F56G4.2_u382_LNA3
GaaGctTtcAaamCcaAatGagTtcmCttmCccGgaAtcmCcaAagAatAccAa
CEDC_F56G4.2_u82_LNA3
AcaAtgAaaAgaGagGatGgaAagGaaAtcGaaGtcTctGttmCttGacGa
CEDC_M162.2_u103_LNA3
GatGagGtamCatAacTttGtgTgcAgtTatAggmCcaTctAcaGtamCctGc
CEDC_M162.2_u480_LNA3
TtcmCatmCatmCacTaamCcgAttGtcmCtgAcaTtgAtgGccAaamCcaGggAa
CEDC_R10E4.11_u274_LNA3
TcamCatTatmCgaAcaAgtActAgtAagmCatGctGtgAtgGagTgcmCgcTa
CEDC_R10E4.11_u397_LNA3
mCacGgaGatmCacGacAtcAaaGcgGatTgcTtaGagTgtGgaAacmCgtmCt
CEDC_T04C9.1_u32_1_LNA3
ActAtcTacGtgGcamCgtTggActmCatmCatmCgaTggGaamCgamCgtAtaAg
CEDC_T04C9.1_u64_LNA3
TctmCtgGccAgtTcamCttTgtGatmCaaTctmCagAttmCgtmCcamCacAagAt
CEDC_W02A2.3_u32_LNA3
mCtamCttmCcgmCaaGaaGgcmCcgTcgTttmCtaAtcGatmCgaAcaTctmCacAc
CEDC_W02A2.3_u374_LNA3
AtgGatGatmCgamCccActTgcmCacTgamCccAcaAtcmCcgmCacTcamCtamCc
CEDC_W05G11.3_u153_LNA3
AagAcgGagAggmCtgGagAgaAcgGtamCcgAtgGagAgcmCagGaamCtgAt
CEDC_W05G11.3_u51_LNA3
mCcamCccAggAggAggGatAcaAgaGaaGaaAgtAcaGatTctmCcaActAa
CEDC_ZK863.5_u256_LNA3
AgtTtcAcamCttmCttTttGccGttTtgGttmCccGttAtcAatmCcaTtgAt
CEDC_ZK863.5_u324_LNA3
mCttTtaTatTctmCatmCaaTttGttTccTacTtgGtcAgcTgaGgaTcgTt
CEEPHX_Y55B1BR.4_u161_LNA3
TtcGgcAcaAatGgaGcaAaaGtaTcgTggTtaTtgTgaTgcGatTatTc
CEEPHX_Y55B1BR.4_u93_LNA3
mCtamCtaTgaAtgAgcTcamCtgGacTcaTttAtcAacTcgAgtmCaaAagmCc
CEER_18S_u388_LNA3
GttGgcGaaTctTcgGgtTcgTatAacTtcTtaGagGgaTaaGcgGtgTt
CEER_18S_u82_LNA3
GaamCtgAttmCgaGaaGagTggGgamCtgTcgmCttmCgaGgtTtaAcgActTc
CEER_26S_u342_LNA3
TgtTatTgcGaaAgtAatmCctGctTagTacGagAggAacAgcGggTtcAa
CEER_26S_u38_LNA3
TgcAtamCgamCttGgtmCtoTtgGtcAagGtgTtgtatTcaGtaGagmCagTc
CEFOXO_R13H8.1b_u331_LNA3
TgtGctmCagAatmCcamCttmCttmCgaAatmCcaAttGtgmCcaAgcActAacTt
CEFOXO_R13H8.1b_u393_LNA3
TtaAgamCggAacmCaaTtgmCtcmCacmCacmCatmCatAccAcgAgtTgaAcaGt
CEGAPDH_K10B3.7_u21_LNA3
AcaTtgmCtamCcaAggmCctAagmCcgmCttmCaaAttmCtcTaaGtcTgaAatGa
CEGAPDH_K1083.7_u727_LNA3
GttGagTccAccGgaGtcTtcAccAccAtcGagAagGccAatGctmCacTt
CEGBA_F11E6.1a_u232_LNA3
AgtAaaTtcmCttmCcamCgtGgaTctActmCgtGtgTtcAcaAagAtcGagGg
CEGBA_F11E6.1a_u451_LNA3
GgtmCcaAtaAtgGgaGacTggTtcmCgcGcaGaaAgtTatGcaGatcatAt
CEGLU_C02A12.1_u264_LNA3
AgaAaamCttmCgtTggAccmCtgmCtaAggAgaAgtAttTcaAgcTtcTgaGc
CEGLU_C02A12.1_u55_LNA3
GagmCacmCcgAagmCtcAagmCcaTatTtgGaaAcaAgamCcaTacTctTcaAa
CEGLU_C46F11.2_u271_LNA3
GttAccmCtcTacAaaTctmCgcTtcAatmCcaAtgTtgTtcGcaGtcAccAa
CEGLU_C46F11.2_u45_LNA3
mCcgAagAgcTcgTtamCtaTgcGagGagGtgTgaAgcmCggAatAatTttTt
CEGLU_F26E4.12_u109_LNA3
AagTtcTtgGttGgamCgcGatGggAaaAttAtcAagAgaTttGgamCcaAc
CEGLU_F26E4.12_u480_LNA3
AcgAttTcaAcgTcaAaaAtgmCtaAtgGtgAtgAcgTgtmCacTttmCggAt
CEGLU_R07B1.4_u166_LNA3
AccTggGttGatGttTttGcgGctGaaAgtTtcTccAagmCtcAttGatTa
CEGLU_R07B1.4_u38_LNA3
GaaGtamCgtmCtcmCcaAagAaaAgcTacmCccAgcTtaAggmCatTgcAcaAt
CEGLU_T09A12.2_u220_LNA3
GcgmCcaGatAtgTatTcaAagAtcGagGtaAatGgtmCagAacActmCatmCc
CEGLU_T09A12.2_u335_LNA3
AatmCtamCagGgaAaaAggAttTcgAgtTgcmCgcGttTccAtgmCaaTcaAt
CEGLU_T28A11.11_u299_LNA3
AgaTggmCaaAgaAgcAtamCatAacTgaAacTctTccmCggGgaGctActAc
CEGLU_T28A11.11_u54_LNA3
TgaAtaAacGggmCcgAacTaaAtcmCatTcgTcaGtgGaaAtgGgaAacAa
CEGPD_B0035.5_u256_LNA3
GtcmCgtmCttmCctGatGctTatGaamCgcmCtaTttmCtcGaaGtaTtcAtgGg
CEGPD_B0035.5_u478_LNA3
TgtGgaAaaGctmCtcAacGagAagAaaGcaGaaGttmCgtAtamCaaTtcAa
CEHSP_C09B8.6_d8_LNA3
AtaTcgmCcgmCctGctTccTcamCcaAccmCgaAtaAcgmCaamCaaAaamCttTa
CEHSP_C0988.6_u286_LNA3
AagAgcmCcamCtcAtcAagGatGaaAgtGatGgaAagActmCttmCgtmCtcAg
CEHSP_C12C8.1_u127_LNA3
mCaaGatAttTtaAcaAaaAtgmCatmCaamCaaGaaGccmCaaTcaGgtTccGg
CEHSP_01208.1_u1531_LNA3
mCttGggmCatTctGtamCggGatGctGtcAttActGtgmCctGcaTatTttAa
CEHSP_C47E8.5_u310_LNA3
AagAagmCatmCtcGaaAtcAacmCcaGacmCacGctAtcAtgAagAcamCttmCg
CEHSP_C47E8.5_u361_LNA3
AtgAaaGctmCaaGctmCttmCgtGatTccTctActAtgGgaTacAtgGccGc
CEHSP_F26D10.3_u276_LNA3
TtaAgcAgamCcaTtgAggAcgAgaAgcTcaAggAtaAgaTcaGccmCagAa
CEHSP_F26D10.3_u397_LNA3
mCgtmCttTccAagGatGacAttGaamCgcAtgGtcAacGaaGctGagAaaTa
CEHSP_F43D9.4_u169_LNA3
GtcGacTtgGctmCacAtcmCacAccGtcAtcAacAagGaaGgamCagAtgAc
CEHSP_F43D9.4_u275_LNA3
mCaaTctTgaGggAcamCgtTctmCacmCatTgaGggAcamCcamCgaGgtmCaaGa
CEHSP_F44E5.4/5_u123_LNA3
TcamCtaAaaTgcAccAatmCtgGacAatmCttmCtgmCttmCtgmCtgGatGcgmCt
CEHSP_F44E5.4/5_u380_LNA3
TcaTgaAgcTaaAcaAttmCgaAaaGgaAgaTggTgaAcaAcgGgaAcgTg
CEHSP_F52E1.7_u175_LNA3
AagTatAacmCttmCcaAcaGggGtcmCgtmCcaGaamCaaAtcAagTccGaaTt
CEHSP_F52E1.7_u448_LNA3
TttAacmCatGgcmCgcAgaTtcTtcGatGacGtcGacTttGatmCgcmCacAt
CEHSP_F54D5.8_u252_LNA3
GcgTcgAaaAgaTctmCccTgaAgtmCtgmCatTgamCtgGccTtgAtaTtaTg
CEHSP_F54D5.8_u318_LNA3
AcaTagTctTcgTcaTcaAggAtaAgcmCacAccmCgaAatTcaAgcGagAg CEHUS_H26D2
1.1_u117_LNA3
TcgmCcaAcamCtcGgamCacGtgmCcaAaaTgaAtaTcaTctmCaaAtcGaaTg
CEHUS_H26D21.1_u478_LNA3
GtcGaaGttAgaAatmCcaGaaGccGatAttGttTctmCatmCaaAttmCcaAt
CEMRE_ZC302.1_u169_LNA3
ActActmCgtGgaAgaTccAatAaaGttGttTcaAcgmCgamCaaAtcGatTc
CEMRE_ZC302.1_u292_LNA3
GgcAgtGaaGatGaaGtgGcaAatTctGatGaaGaaAtgGgaAgcAgtAt
CEMTL_T08G5.10_d127_LNA3
TtgTcaAcgAccAgaAgcAaaAatTatGggAatmCgcGatAaaAttmCaaGg
CEMTL_TOBG5.10_u45_LNA3
GatGcaAgtGtgmCcaActGcgAatGtgmCtcAggmCtgmCtcAttAatTtgAa
CENAP_D2096.8_u356_LNA3
GacGatAtgTtcGatTtcmCcaGgaGagGacGgtGatGatGtgTcaGacTt
CENAP_D2096.8_u70_LNA3
GacGatAtgTtcGatTtcmCcaGgaGagGacGgtGatGatGtgTcaGacTt
CEPAI_F56D12.5_u241_LNA3
GagGtcGtcGtaAtcmCacAagGctmCcaAgaAagmCaaGtgmCtcGacAttTc
CEPAI_F56D12.5 u301_LNA3
GatActTttGgcAagmCtcGttmCcaAtcAagAagGagGtcAtcmCcaGatmCg
CEPDI_C07A12.4 u28_LNA3
GatGagGagGgamCacAccGagmCtcTaaAtcmCacAttmCcaAtamCagTtcAa
CEPDI_C07A12.4_u433_LNA3
mCttAtgTccGaaGatAtcmCcaGagGatTggGacAagAacmCcaGtcAagAt
CEPDI_C14B1.1_u119_LNA3
TacmCccAgtmCgamCtaTgaTggAgamCagAaamCctmCgaGaaGttmCgaAgaAt
CEPDI_C14B1.1_u358_LNA3
mCtcGtcGccTccAacTtcAacGaaAttGccmCttGatGaaAccAagActGt
CEPGK_T03F1.3_d9_LNA3
TtcTatTgtTtaTtcmCttGccmCaaTagTgtAttTgtAttTatTctTtcTc
CEPGK_T03F1.3_u424_LNA3
mCaaAtcmCatmCtcmCcaGtgGatTtcGtcAttGctGacAagTtcGccGagGa
CEPON_E01A2.7_u223_LNA3
GttTctGatTcgAcamCttTatGgamCcaTctmCaaGttmCtgmCgaGttTctTt
CEPON_E01A2.7_u79_LNA3
GggAaamCaaAtgAttGttGgtAcaGtaGccmCgcmCctGctAttmCacTgtGa
CEPPGB_F13D12.6_u44_LNA3
mCgaGcamCatmCatmCcaAtcGttmCctGttmCaamCaaGgcmCttmCtaAtcGttAg
CEPPGB_F13D12.6_u440_LNA3
TgaTgaGagmCccAgtAacmCaaTtaTttGaamCcgTcaGgaTgtGcgTaaGg
CEPPS_T14G10.1_d2_LNA3
mCgtmCtaAtcGaaGaaGggGatmCgtGggmCaaTcaTaamCtaAttAacmCttmCa
CEPPS_T14G10.1_u240_LNA3
mCaaTggmCtcmCagGtcTttmCtgmCtcTtcAtaTacTtcmCatTccGagTtgmCt
CEPRDX_R07E5.2_u405_LNA3
GttmCtcTtgGagmCtgAagTtgTcgmCgtGctmCgtGtgAttmCtcActTctmCt
CEPRDX_R07E5.2_u42_LNA3
TcgmCtamCcaGcaAggAatActTcaAcaAggTcaAcaAgtGatmCacAcaGa
CEPYC_D2023.2_u256_LNA3
AagGaaAttGtaActmCgcmCcaAgaGctmCtcmCcaGgtGtcmCgtGgamCatAt
CEPYC_D2023.2_u427_LNA3
TtgActGgaTtgGagAttGcgGaaGaaGttGatGttGaaAtcGagAgtGg
CERAD_F10G7.4_u169_LNA3
GccAagTctmCaaGcaAtaAgtGttGatmCaaTcaGagmCcaTacGgaGagAt
CERAD_F10G7.4_u267_LNA3
AtaTtgAgamCttmCggGacAagmCggActTctmCatmCtgTcamCagmCaamCtgmCc
CERAD_F32A11.2_u250_LNA3
GatmCcgmCagAgaAtcGagTatTtcmCtcTcgAgamCccAtgGatAtcAacTg
CERAD_F32A11.2_u380_LNA3
TccGttAagAagmCtcActGgaAaaAcamCacGgcTcgAacGaaAttGgaAt
CERAD_T04H1.4_u274_LNA3
AatTtgGatGagAgcAaaGtgGaaGgaAtgGctAtcGttTtgGcaGatAt
CERAD_T04H1.4_u375_LNA3
GtgmCtgGtcAaaAaaTgcTtgmCttmCgtTgcTtaTtcGcaTtgmCacTcgmCa
CERAD_W06D4.6_u325_LNA3
mCttmCgaGaamCtcTtcAagTtgGaaTcaAcaGtgGcaTcgGatAcamCatGa
CERAD_W06D4.6_u34_LNA3
GtgmCctTctGaaGccGaaGaaAacGacGatTagTtaAatGttTccAagTt
CERAD_Y116A8C.13_u289_LNA3
GatAaaAtcGatAgcGacGacGatGagGaaGccGatGatGagGagmCtcGa
CERAD_Y116ABC.13_u59_LNA3
GcaGgtGgaTacGgaTgtGgaGctGacTttTgcGttTtaTcaAgaAtcTc
CERAD_Y39A1A.23_u221_LNA3
TccmCgtAgaAgtAgaAatGctAgaAgaAccTgaAcaAgaAgaTcaAgaAa
CERAD_Y39A1A.23_u276_LNA3
TgcAagAtgTcaGtaTtgAaamCaaTtcmCtgTagAgamCccmCcgAagAaaAt
CERAD_Y41C4A.14_u509_LNA3
AgtmCtcGtaTccGggAatGttTcaGccTgtGaaAatGctTgtTgaAgamCg
CERAD_Y41C4A.14_u731_LNA3
mCttmCaaAacmCgtmCgcTttTaaGgaTacAggAacGtgGcamCgcTtcmCgaGg
CERAD_Y43C5A.6_u131_LNA3
mCagAttGtamCctTcgAaaAggAaaAggAgaGaaTcgmCgtmCgcAaaAatGg
CERAD_Y43C5A.6_u429_LNA3
TgaTggmCttTgaTtaTtcGagmCagGagmCaaTgaTgtmCcgAgaGtcGttAt
CERFC_F31E3.3_u128_LNA3
mCaaTgamCgaGaaTatTggAgtAatGggGaaActGgtTgcGacTtgmCgaAa
CERFC_F31E3.3_u55_LNA3
TtgGaaAacAatmCtcmCtcGacTttmCtgmCtcActmCttmCgtGaaActAtcmCa
CERPL_K11H12.2_d1_LNA3
TctTgtTatTttAttTtgTttTggGctTgtTccGaaAatGaaAtgGttGt
CERPL_K11H12.2_u172_LNA3
mCaaTggAtcAccAagmCcaGttmCacAagmCacmCgtGagmCaaAgaGgamCtcAc
CERT_F36A4.7_u1396_LNA3
mCttTgtGatGtgAtgActGcgAagGgamCacTtgAtgGctAttAcgAgamCa
CERT_F36A4.7_u2302_LNA3
GagmCcaGctActmCagAtgAcamCtcAacAcgTtcmCatTatGcaGgaGttTc
CERT_F36A4.7_u289_LNA3
TacActmCcaTccTcgmCcgAcaTacAatmCcaAcaTctmCcamCgcGgaTtcTc
CERT_F36A4.7_u2919_LNA3
AtgGagAagAtgGttTggAtgGaaTgtGggttgAgaAtcAgaAtaTgcmCg
CERT_F36A4.7_u4269_LNA3
AacmCggGatAccGtgTcgAacGtcAcaTgaAagAtgGcgAtaTaaTcgTc
CERT_F36A4.7_u5485_LNA3
GagGagAttAaamCgcAtgTcaGtgGctmCatGtcGagTttmCcaGaaGtcTa
CESLC_F52F12.1a_u249_LNA3
AgaTatTgcmCtcTacTtaTcaTggGccTgaTggmCttTgtmCtgmCcgGtaTt
CESLC_F52F12.1a_u76_LNA3
GaaTctmCaamCcamCttmCtgGaamCccmCatAcamCcaAtgGatAgaAgamCggAg
CESLC_K11G9.5_u400_LNA3
GttGttmCttTttTccGtgAtcTttTcaTgtTtaTgtmCtgAacGtgGcaGg
CESLC_K11G9.5_u462_LNA3
GacTcgTtgGtgTctTgcTagGatGtcTtgGgtTcaTtcmCtcAatmCgtTg
CESLC_Y32F6B.1_u179_LNA3
GtamCtgGgcTcgAggGctGaaActAatmCgaAgaAgaAacTccAgaAgaTa
CESLC_Y32F6B.1_u280_LNA3
GgaTcaTgcTctGttTacGacActGatGagTtaAgaGtcAgamCtgmCacGt
CESLC_Y37A1C.1a_u104_LNA3
mCgaTggTtcTtcTcgTctAtcAtaTcgGggTagTtgmCcgAagTgtTgaAa
CESLC_Y37A1C.1a_u404_LNA3
mCaaAtcGaamCtgGtaTaaAggAggAccGacGgaGacGaaTttGaamCgaGa
CESLC_Y70G10A.3_u383_LNA3
AttmCgaTcaAagAacTctGgcTctmCggmCgtTaamCtgGacAttTgtTcgTc
CESLC_Y70G10A.3_u46_LNA3
mCtcmCccGagmCagGcgAttAttmCacGctAgtTatGctmCaaAtgTgaTctGt
CESOD_C15F1.7_u435_LNA3
mCcgGtamCtaTctGgaTcamCacAgaAgtmCcgAaaAtgAccAggmCagTtaTt
CESOD_C15F1.7_u9_LNA3
mCccAgtGacTacmCtgAatmCgcGtcTctGaaTctmCcamCacAatTccTacTa
CESOD_F10D11.1_u326_LNA3
GgaGttGctmCacmCgcAatTaaGagmCgamCttmCggAtcTctGgaTaaTctTc
CESOD_F10D11.1_u477_LNA3
AaaTtgAggAaaAgcTtcAcgAggmCggTctmCcaAagGaaAcgTcaAagAa
CESULT_EEED8.2_u316_LNA3
mCaaTcgTacmCatGaaAgaAgtTggAagmCcamCgtGcaAgaGaaGaaAtcmCa
CESULT_EEED8.2_u82_LNA3
AagAagAttmCctGacmCagAgaGacTcamCgtGctTacmCcaAgaAgcAtcTa
CESULT_Y113G7A.11_u252_LNA3
AgcAttGgtGgaAatAcgAaaTggmCatGggAagAgaAacmCccTctmCaaTt
CESULT_Y113G7A.11_u96_LNA3
mCtgGttAcgGtaGtgTatGgtmCccTgtmCctmCtcAgaAtgmCaaAtaTgtmCg
CESULT_Y67A10A.4_u108_LNA3
TctAcgTcgAtgGaaAagmCcgAttTaamCaaTcaAagmCcaAcaAcgmCagTt
CESULT_Y67A10A.4_u327_LNA3
GgaAagGtgmCcaAaaAgtTgamCagmCaaTtgGagGatmCttAttmCatTgcmCa
CETOPO_K12D12.1_u398_LNA3
AgaTgaTgaTgaAgtTccTgcAaaGaaGccTgcTccAgcGaaGaaAgcTg
CETOPO_K12D12.1_u449_LNA3
AaaAccTcgTacTggAaaAggAgcTgcGaaAgcGgaAgtTatmCgaTttGt
CETOPO_M01E5.5b_u256_LNA3
GagAagGccmCagAagAagTacGacAgamCtgAagGagmCagTtgAaaAagTt
CETOPO_M01E5.5b_u429_LNA3
TtcTgtmCatAcaAtcGtgmCtaAtcGgcAggTtgmCgaTccTttGtaAccAt
CEUbi_F25B5.4_u186_LNA3
AagmCttmCggAcamCcaTtgAgaAtgTcaAagmCcaAaaTccAggAtaAggAg
CEUbi_F25B5.4_u2_LNA3
AatmCgaAccmCatmCaaTtcActmCgtTatTccTccTcgAtcTccGttmCaaGt
CEUbI_F29B9.6_u145_LNA3
mCtgAacmCatmCcaAatAttGaaGatmCcaGctmCagGctGaaGccTatmCagAt
CEUbi_F29B9.6_u230_LNA3
mCgtGtgmCttAtcTctTctGgaTgaAaamCaaGgaTtgGaaGccGtcAatmCt
CEUbi_M7.1_u239_LNA3
mCggAagmCatmCtgmCctTgamCatTctmCcgTtcGcaGtgGtcGccGgcTctG
CEUbi_M7.1_u53_LNA3
AaaGtamCgcTatGtgAggAggmCtaAcamCcaTtcAtaTaaGaamCgcAgcmCa
CEUGT_F39G3.1_u40_LNA3
TgtTgcmCgtAgaAgaGagActAaaActAagAacGatTgaTtgAagGtcTg
CEUGT_F39G3.1_u466_LNA3
TacAatTctTtgmCagGaaGcaAtaTccGccGgaGtcmCccmCttAtcActAt
CEUGT_M88.1_u480_LNA3
mCtcAcgGagGttAtaAttmCtaTgcAggAggmCaaTttmCtgmCtgGagTtcmCa
CEUGT_M88.1_u72_LNA3
AccGttTcaTgaGagmCtgTaaTcaGgtGttGttTctGtaAaaAgtGtgAa
YAL009W_u145_LNA3
GtgGatGtgAaaTtaGtcmCtcAacmCccAgaGcaTttAgtGcaGagAttAg
YAL009W_u341_LNA3
GcaGttTaaTgtGaaGctAgtTaaAgtAcaGtcTacGtgGgamCgaGaaAt
YAL059W_u262_LNA3
AttGccAagTccAttTctmCgtGccAagTacAttmCaaAatAcaAgaAagGc
YAL059W_u51_LNA3
AgamCtcmCtamCaaAtaGatTcgGtgTccTgcmCagAcgAtgTtgAagAatAg
YER109C_u109_LNA3
TtgAagTttGggAatAttGgtAtgGttGaaGacmCaaGgamCcgGatTacGa
YER109C_u436_LNA3
GagGcgmCaaGtaGgcAatGatTcaAgaAgtAgtAaaGgcAatmCgtAacAc
YHR152W_u128_LNA3
TgaGcamCaaAgtTaaGatGttmCggAaaGaaAaaGaaAgtmCaaTccTatGa
YHR152W_u510_LNA3
mCaaGtgAccAatmCagmCacGcamCggmCttmCcaTccTcaAgamCtgAtaTtamCc
YKL130C_u211_LNA3
AttAaaTgcGcaGatGagGacGgaAcgAatAtcGgaGaaActGatAatAt YKL130C_u85_LNA3
GatGgtAagmCtgAgcGccTtgGacGaaGaaTttGatGttGtcGctActAa
YKL178C_u199_LNA3
TacGtcAcgmCaaGgamCagAgcTttGacGacGaaAtaTcamCttGgaGgaTt
YKL178C_u367_LNA3
TctmCccTgtGtaGgtAcamCcaAtaTcamCaaGcgmCatTtcTatGtcGacTa
YLR443W_u179_LNA3
TgcTaamCacmCagTttAgamCcaTggAaaTccmCacmCgcAaaTatAagmCaaTg
YLR443W_u86_LNA3
GcaGgamCatAagAttmCcgGtcAagmCaamCgamCagTgaAgaAagTatGcaAa YOR092W
u251_LNA3 mCcgTctAgtGaaAgcGggAtgGctAaaTtgGgaAaamCgamCaaGatGttAt
YOR092W_u82_LNA3
GatGctTcaAtaTccTttGatGgtmCgtTagTttAccAttTttGgtGtcTt
YPL263C_u132_LNA3
AgtmCatTtgAgtTatGtgAagAccGttGgtGggAaaGaaGagAtcAggTg
YPL263C_u257_LNA3
GtcTtgGctAccAcamCccAaaAccGttmCgaAacTttAagAgcAttmCtamCt
Example 54
Evaluation of Different LNA Substituted Oligonucleotides as Probes
for Fluorescence in Situ Hybridization (FISH) on Metaphase
Chromosomes and Interphase Nuclei
[0686] Locked Nucleic Acids (LNA) constitute a novel class of DNA
analogues that have an exceptionally high affinity towards
complementary DNA and RNA. Using human classical satellite-2 repeat
sequence clusters as targets, we demonstrate that LNAIDNA mixmer
oligonucleotides are excellent probes for FISH combining high
binding affinity with short hybridization time and even with the
ability to hybridize without prior termal denaturation of the
template. The development of molecular probes and image analysis
has made fluorescence in situ hybridization (FISH) a powerful
investigative tool. Although FISH has proved to be a useful
technique in many areas, it is a fairly time-consuming procedure
with limitations in sensitivity. Probes with higher DNA affinity
may potentially reduce the time needed for hybridization and the
sensitivity of the technique. Thus, improvement in hybridization
characteristics has been reported for the DNA mimic peptide nucleic
acid (PNA). This example describes the development of LNA
substituted oligonucleotides as probes for fluorescence in situ
hybridization on metaphase chromosomes and interphase nuclei. In
each experiment a different LNA substituted oligonucleotide of the
same 23-bp human satellite-2 repeat sequence
(attccattcgattccattcgatc) have been used, cf. Jeanpierre, M.
(1994). Human satellites 2 and 3. Annals of Genetics 37, 163-171.
Oligomers with various LNA content, different labels, and
hybridization conditions have been used and compared with each
other and the optimal conditions have been determined for an
efficient LNA-FISH protocol.
A. Materials and Methods
A1. Chromosome Preparations
[0687] Chromosome preparations were made by standard methods from
peripheral lymphocyte cultures of normal males. Slides were
prepared 1-4 days prior to an experiment and treated with RNAse (10
.mu.g/.mu.l) at 37.degree. C. for one hour before
hybridization.
A2. Probe Preparation
[0688] The 23bp human satellite-2 repeat sequence,
attccattcgattccattcgatc, was used to prepare the LNADNA mixmers
with different content and sequence order of LNA modifications
(Table 19). All mixmers were labeled in the 5' end with either Cy3
or biotin. Biotin amidite was purchased from Applied Biosystems and
Cy3 amidite was purchased from Amersham Bioscience. A DNA
oligonucleotide of the same sequence without any LNA modifications
was used as a control in each experiment.
A3. Fluorescence in Situ Hybridization
[0689] FISH was carried out as described by Silahtaroglu A N,
Hacihanefioglu S, Guven G S, Cenani A, Wirth J, Tommerup N, Tumer
Z. (1998) Not para-, not peri-, but centric inversion of chromosome
12. J Med Genet. 35(8):682-4. (1); with the following modifications
including: The amounts of probe were 6.4, 10, 13.4 and 20 pmoles.
Denaturation of the target DNA and the probe were performed at
75.degree. C. for 5 minutes either separately using 70% formamide
or simultaneously under the coverslip in the presence of the
hybridization mixture containing 50% formamide. In addition the
effect of denaturation was also tested. Two alternative
hybridization mixtures were used: 50% formamide/2.times.SSC (pH
7.0) 10% dextran sulphate or 2.times.SSC (pH 7.0)/10% dextran
sulphate. Hybridization times included 30 min, 1 hr, 2 hrs, 3 hrs
and overnight. Hybridization temperatures included: 37.degree. C.,
55.degree. C., 60.degree. C. and 72.degree. C. Post washing was
either as for standard FISH (1), or with 50% formamide/2.times.SSC
at 60.degree. C., or without formamide. Hybridization signals with
biotin labeled LNA substituted oligonucleotide probes were
visualized indirectly using two layers of fluorescein-labeled
avidin (Vector Labs) linked by a biotinylated anti-avidin molecule,
which amplified the signal 8-64 times. The hybridization of Cy3
labeled molecules however, was visualized directly after a short
washing procedure. Slides were mounted in Vectashield (Vector
Laboratories) containing 4'-6'-diamidino-2-phenylindole (DAPI). The
whole procedure was carried out in the dark. The signals were
visualized using a Leica DMRB epifluorescence microscope equipped
with a SenSys charge-coupled device camera (Photometrics, Tucson,
AZ), and IPLAB Spectrum Quips FISH software (Applied Imaging
international Ltd, Newcastle, UK) within two days after
hybridization.
B. Results and Discussion
[0690] Satellite-II DNA, composed of multiple repeats of a 23 bp
and a 26 bp sequence, is especially concentrated in the large
heterochromatic regions of human chromosomes 1 and 16, but is also
found in the heterochromatic regions of chromosomes 9, Y, 15 and in
other minor sites like the short armssatellites of the acrocentric
chromosomes and some centromeric regions. Classical satellite DNA
can be visualised by FISH with traditional genomic and DNA
oligonucleotide probes (see Kokalj-Vokac N, Alemeida A,
Gerbault-Seureau M, Malfoy B, Dutrillaux B. (1993) Two-color FISH
characterization of i(1 q) and der(1; 16) in human breast cancer
cells. Genes Chromosomes Cancer. 7, 8-14; and Tagarro I,
Fernandez-Peralta A M, Gonzales-Aguilera J J. (1994) Chromosomal
localization of human satellites 2 and 3 by a FISH method using
oligonucleotides as probes. Hum Genet. 93(4):383-8). Due to this
and the presence of distinct major and minor sites of satellite-2
DNA in the genome, we used the 23-bp satellite-2 repeat sequence,
attccattcgattccattcgatc, as a convenient model to test the
efficiency of various DNA/LNA mixmers for FISH analysis and the
effect of different experimental conditions by recording the
number, location and strength of signals on each metaphase. To
compare the efficiency of mixmers with different LNA content (Table
19) and to optimize the LNA-FISH protocol, different conditions
were tried at each step of a standard FISH protocol as described in
Materials and Methods. All LNA substituted oligonucleotides (LNADNA
mixmer oligonucleotides) for human satellite-2 sequence gave very
prominent signals when used as FISH probes. In general, the signal
on chromosome 1 was always stronger and appeared earlier, followed
by signals on chromosomes 16, 9, Y, 15, other acrocentric
chromosomes and the centromeric regions of other chromosomes,
respectively (FIG. 41). In general, biotin labeled mixmers gave
stronger signals with a higher background, whereas Cy3-labeled
molecules gave a significantly lower background.
B1. Effect of LNA Content of the LNA Substituted Oligonucleotides
(LNADNA Mixmers)
[0691] The LNA-2 molecule which had every other nucleotide modified
as LNA. (aTtCcAtTcGaTtCcAtTcGaTc (SEQ ID NO:)) gave the best
results in all the experiment performed. The LNA-3 molecule, with
every third oligonucleotide modified as LNA,
(aTtcCatTcgAtTccAttCgaTc (SEQ ID NO:)) also gave hybridization
signals, but with less efficiency than the LNA-2 probes.
Preferably, an LNA-2 oligonucleotide molecule has an LNA unit at
every other nucleotide position in the sequence and an LNA-3
oligonuclotide molecule has an LNA unit at every third position of
the sequence. However, minor deviations, e.g. in one position or
less than 5-10 percent of the nucleotide positions in the sequence
may still provide the general features of an LNA-2 or an LNA-3
molecule.
[0692] The Dispersed LNA (aTtccatTcgaTtccAttcgaTc (SEQ ID NO:)),
which had 5 dispersed LNA modifications, was less efficient in
short term hybridization, but gave signals on both chromosomes 1
and 16 after overnight hybridizations. LNA/DNA mixmers with 3 LNA
Blocks (aTTCcattcgATTccattcGATc (SEQ ID NO:)) was comparably
inferior as a FISH-probe.
B2. Effect of Amount of the LNA/DNA Mixmers
[0693] The initial experiments performed with 20 pmol of LNA/DNA
mixmer resulted in bright and large signals, but with an extremely
high background. Thus, lower concentrations were tested (13.4 pmol,
10 pmol and 6.4 pmol). The concentration giving the optimal signal
to noise ratio was found to be 6.4 pmol.
B3. Effect of Denaturation
[0694] The signals on the major sites of hybridization (1 q, 16 q)
were equally bright after both types of denaturation. However,
smaller and weaker signals were observed on the minor sites with
the simultaneous denaturation protocol. To check the potential
"strand invasion" property of LNA, some of the experiments were
performed without a denaturation step. As expected, no signals were
obtained by the control DNA oligonucleotide probe. In contrast,
hybridization signals on chromosomes 1 and 16 were observed after
overnight hybridization with LNA probes, with LNA-2 mixmer giving
the best signals. Compared to the signals obtained in experiments
involving a denaturation step, the signals were smaller, but
prominent and without any background.
B4. Effect of Hybridization Time, Temperature and
Post-Hybridization Washes
[0695] Although signals could be observed after only 30 min of
hybridization, the optimal hybridization time and temperature for
LNA-2, which gave the best signals, was 1 hr at 37.degree. C. A
3.times.5 min wash with 0.1.times.SSC60.degree. C. and
4.times.SSC/0.05% Tween37.degree. C., respectively, followed by a 5
min PBS wash was found to be sufficient for washing the slides
after hybridization with DNA-LNA mixmers. There was no specific
difference between a wash with 50% formamide at 42.degree. C. or
60.degree. C.
[0696] The signals faded away in most of the slides within two
days. When hybridized with directly labeled LNA, the whole slide
was stained with Cy3 after three days. Thus, slides had to be
analyzed within 48 hours after hybridization.
C. Conclusion
[0697] The experiment have demonstrated, that LNA substituted
oligonucleotides are very efficient FISH probes. LNA substituted
oligonucleotide probes gave strong signals after only 1 hr of
hybridization, and it was possible to omit the use of formamide
both from the denaturation and from the post hybridization washing
steps and still obtain a very good signal to noise ratio. The
ability of LNA to hybridize without prior denaturation could be due
to a strand invasion property of LNA and this warrants further
investigation with other LNA probes and at different conditions.
Based on the combined results of these experiments, the optimal
LNA-FISH procedure was defined as follows: 6.4 pmoles of Cy-3
labeled LNA-2 probe was denatured together with the target at
75.degree. C. for 5 minutes, and hybridized for one hour then
followed by a short post wash without any formamide (3.times.5
minutes 0.1.times.SSC at 60.degree. C.; 2.times.5 Sminutes
4.times.SSC/0.05% Tween at 37.degree. C.; 5 minute PBS). The FISH
experiments indicate that LNA containing probes would be valuable
for the detection of a variety of other repetitive elements, such
as centromeric a-repeats and telomeric repeats. In addition, the
superior hybridization characteristics of LNA containing
oligonucleotides could lead to detection of single base pair
differences between repetitive sequences as well as single copy
sequences.
[0698] C1. FIG. 41 shows a comparison of different LNA/DNA mixmer
oligonucleotides. Experiment conditions: 6.4 pmoles of Cy3 labeled
probe was hybridized for 30 minutes at 37.degree. C., after
simultaneous denaturation of the target and the probe at 75.degree.
C. for 5 minutes. A. LNA-2 giving signals on chromosomes 1, 16, 9
and 15, B. LNA-3 giving bright signals on chromosomes 1, 16 and 9,
C. Dispersed LNA giving signals on chromosomes 1 and 16 only, D.
LNA Block giving smaller signals on chromosome 1, E. DNA oligo
giving no signals on any of the chromosomes. TABLE-US-00045 TABLE
19 DNA/LNA mixmers for human satellite 2 repeat sequence used in
this study. (SEQ ID NOs:) LNA Name FISH probe sequences monomers
Tm* DNA oligo attccattcgattccattcgatc 0 60 Dispersed_LNA
aTtccatTcgaTtccAttcgaTc 5 71 LNA-3 aTtcCatTcgAtTccAttCgaTc 8 77 LNA
Blocks aTTCcattcgATTccattcGATc 9 73 LNA-2 ATtCcAtTcGaTtCcAtTcGaTc
11 84 LNA modifications are depicted in capital letters and *Tm
values for each molecule have been calculated using Exiqon's Tm
Prediction program accessible at http://lna-tm.com/ and as appears
in FIGS. 19A-19F herein.
Example 55
Highly Efficient Fluorescence in Situ Hybridization (FISH) Using an
LNA Probe Specific for Human Telomere Repeat
1. Chromosome Preparations
[0699] Chromosome preparations were made by standard methods from
peripheral lymphocyte cultures of two normal males. Slides were
prepared 1-6 days prior to an experiment and treated with RNAse (10
.mu.g/.mu.l) at 37.degree. C. for one hour before
hybridization.
2. FISH Probe Preparation
[0700] A Cy3-labelled, LNA-2 design of the 24-bp telomere sequence
(ttagggttagggttagggttaggg) representing 4 blocks of 6-bp telomere
repeat (ttaggg) was used as a probe. A DNA oligomer of the same
sequence without any LNA modifications was used as a control in
each experiment.
3. Fluorescence in Situ Hybridization
[0701] FISH was carried out as described previously (Silahtaroglu
et al, 1998) with the following modifications. The amount of probe
was 5 pmoles. Denaturation of the target DNA and the probe were
performed at 75.degree. C. for 5 minutes simultaneously under the
coverslip in the presence of hybridization mix containing 50%
formamide. Slides were washed after 30 min. hybridization at
37.degree. C. Post washing steps included a 2.times.5 min
0.1.times.SSC at 60.degree. C.; 5min 2.times.SSC at 37.degree. C.;
3 min 4.times.SSC0.05% Tween20 at 37.degree. C. and 5 min PBS.
Slides were mounted in Vectashield (Vector Laboratories) containing
4'-6'-diamidino-2-phenylindole (DAPI). The whole procedure was
carried out in the dark. The signals were visualized using a Leica
DMRB epifluorescence microscope equipped with a SenSys
charge-coupled device camera (Photometrics, Tucson, Ariz.), and
IPLAB Spectrum Quips FISH software (Applied Imaging international
Ltd., Newcastle, UK).
4. Results
[0702] The human telomere repeat specific LNA oligonucleotide probe
gave prominent signals on the telomeres, when used as a FISH probe
(FIG. 42), whereas no signals could be detected with the
corresponding DNA control probe when using the hybridization
conditions specified above. Thus, the experiments described here
for human telomere repeat, demonstrates that LNA substituted
oligonucleotides are highly efficient as FISH probes.
5. REFERENCES
[0703] Silahtaroglu, A. N., Hacihanefioglu, S., Guven, G. S.,
Cenani, A., Wirth, J., Tommerup, N., Tumer, Z.(1 998) Not para-,
not peri-, but centric inversion of chromosome 12. Journal of
Medical Genetics 35(8), 682-684.
Example 56
Fluorescence in situ Hybridization Hsing Chromosome-21 Specific
Centromere LNA Probes.
1. Chromosome Preparations
[0704] Chromosome preparations were made by standard methods from
peripheral lymphocyte cultures of a normal female. Slides were
prepared 5 days prior to use. Before use slides were treated with
RNAse A (10 .mu.g/.mu.l) at 37.degree. C. for one hour and
proteinase K for 10 minutes washed, with 2.times.SSC 3 times 3 min,
before dehydration through a cold ethanol series.
2. Probe Preparation
[0705] A 5' biotin-labelled, LNA substituted 15-mer FISH probe
(aCcCaGcCaAaGgAg (SEQ ID NO:), LNA uppercase, DNA lowercase) and a
5' biotin-labelled LNA substituted 24-mer FISH probe
(TgTgTaCcCaGcCaAaGgAgTtGa (SEQ ID NO:), LNA uppercase, DNA
lowercase) specific for the centromeric human chromosome 21
alphaRI(680) locus alpha-satellite repeat were used as probes.
Biotin-labelled DNA probes of the same sequence without any LNA
modifications were used as controls in each experiment.
[0706] 3. Fluorescence in situ Hybridization FISH was carried out
as described previously (Silahtaroglu et al, 1998) with the
following modifications. The amount of probe was 1 .mu.M for 1 the
5-mer chromocsome 21 FISH probe and 1.4 .mu.M for the 24.mer FISH
probe. Denaturation of the target DNA and the probe were performed
simultaneously at 79.degree. C. for 4 minutes under the coverslip
in the presence of hybridization mix containing 50% formamide.
Slides were washed after 40 min. hybridization at RT. Post washing
steps included a 2.times.5 min 0.1.times.SSC at 65.degree. C.; 5
min 3 min 4.times.SSC/0.05% Tween20 at 37.degree. C. Slides are
then incubated 10 min with 1% blocking reagent and a layer of
Flourescein conjugated Avidin (Vector Labs) has been applied for 20
minutes at 37.degree. C. After a 3 times 3 minute wash with
4.times.SSC0.05% Tween20, slides are dehydrated and mounted in
Vectashield (Vector Laboratories) containing
4'-6'-diamidino-2-phenylindole (DAPI). The whole procedure was
carried out in the dark. The signals were visualized using a Leica
DMRB epifluorescence microscope equipped with a SenSys
charge-coupled device camera (Photometrics, Tucson, Ariz.), and
IPLAB Spectrum Quips FISH software (Applied Imaging international
Ltd., Newcastle, UK).
4. Results
[0707] The LNA substituted 15-mer oligonucleotide probe specific
for the centromeric human chromosome 21 alphaRI(680) locus
alpha-satellite repeat gave prominent signals on chromosome 21,
when used as a FISH probe, whereas no signals could be detected
with the corresponding DNA control probe when using the
hybridization conditions specified above. The LNA substituted
24-mer oligonucleotide probe specific for the centromeric
alphaRI(680) locus alpha-satellite repeat gave prominent signals
both on chromosomes 13 and 21, when used as a FISH probe, while no
signals were observed with the DNA control probe. This is expected,
since the aforementioned chromosomes differ only at one nucleotide
position in the given probe sequence. On the other hand, the
results obtained by the 15-mer LNA FISH probe clearly demonstrates
that the LNA substituted probe is capable of discriminating a
single mismatch between chromosomes 13 and 21 in the centromeric
alpha-satellite repeat. Thus, the experiments described here for
the centromeric repeat-specific LNA probes in the human chromosome
21, demonstrates that LNA substituted oligonucleotides are highly
efficient as FISH probes and can be used in diagnosis of chromosome
21 trisomy.
OTHER EMBODIMENTS
[0708] From the foregoing description, it will be apparent that
variations and modifications may be made to the invention described
herein to adopt it to various usages and conditions. The foregoing
description of the invention is merely illustrative thereof, and it
understood that variations and modifications can be effected
without departing from the scope or spirit of the invention.
[0709] All publications, patent applications, and patents mentioned
in this specification are herein incorporated by reference to the
same extent as if each independent publication, patent, or patent
application was specifically and individually indicated to be
incorporated by reference.
[0710] Other embodiments are in the claims.
[0711] What is claimed is:
* * * * *
References