U.S. patent application number 10/579507 was filed with the patent office on 2007-05-17 for novel use of adenoviruses and nucleic acids that code for said viruses.
Invention is credited to Per Sonne Holm.
Application Number | 20070110719 10/579507 |
Document ID | / |
Family ID | 34635105 |
Filed Date | 2007-05-17 |
United States Patent
Application |
20070110719 |
Kind Code |
A1 |
Holm; Per Sonne |
May 17, 2007 |
Novel use of adenoviruses and nucleic acids that code for said
viruses
Abstract
The present invention is related to the use of a virus,
preferably an adenovirus, for the manufacture of a medicament,
whereby the virus is replication deficient in cells which do not
have YB-1 in the nucleus, and the virus codes for an oncogene or
oncogene product, in particular an oncogene protein, which
transactivates at least one viral gene, preferably an adenoviral
gene, whereby the gene is selected from the group comprising E1B 55
kDa, E4orf6, E4orf3 and E3ADP.
Inventors: |
Holm; Per Sonne;
(Furstenfeldbruck, DE) |
Correspondence
Address: |
WOOD, PHILLIPS, KATZ, CLARK & MORTIMER
500 W. MADISON STREET
SUITE 3800
CHICAGO
IL
60661
US
|
Family ID: |
34635105 |
Appl. No.: |
10/579507 |
Filed: |
November 15, 2004 |
PCT Filed: |
November 15, 2004 |
PCT NO: |
PCT/EP04/12930 |
371 Date: |
May 15, 2006 |
Current U.S.
Class: |
424/93.2 ;
435/456; 514/283; 514/34; 514/44A; 514/575; 530/350 |
Current CPC
Class: |
C12N 7/00 20130101; A61K
31/4745 20130101; C12N 2710/00022 20130101; A61K 31/185 20130101;
A61P 35/00 20180101; C12N 15/86 20130101; C12N 2840/203 20130101;
C12N 2710/10032 20130101; A61P 43/00 20180101; C12N 2710/10332
20130101; C12N 2710/10343 20130101; A61K 48/00 20130101; C12N
2830/00 20130101; A61K 35/761 20130101 |
Class at
Publication: |
424/093.2 ;
530/350; 514/044; 435/456; 514/283; 514/034; 514/575 |
International
Class: |
A61K 48/00 20060101
A61K048/00; C12N 15/861 20060101 C12N015/861; A61K 31/704 20060101
A61K031/704; A61K 31/4745 20060101 A61K031/4745 |
Foreign Application Data
Date |
Code |
Application Number |
Nov 14, 2003 |
DE |
10353262.5 |
Apr 14, 2004 |
DE |
10 2004 018 099.7 |
Claims
1. Use of a virus, preferably an adenovirus, for the manufacture of
a medicament, characterised in that the virus is replication
deficient in cells which lack YB-1 in the nucleus, and whereby the
virus encodes an oncogene or oncogene product, in particular an
oncogene protein, which transactivates at least one viral gene,
preferably an adenoviral gene, whereby the gene is selected from
the group comprising E1B 55 kDa, E4orf6, E4orf3 and E3ADP.
2. Use of a virus, preferably an adenovirus, for the replication in
cells which exhibit YB-1 in the nucleus, characterised in that the
virus is replication deficient in cells which lack YB-1 in the
nucleus, and whereby the virus encodes an oncogene or an oncogene
product, in particular an oncogene protein, which transactivates at
least one viral gene, preferably an adenoviral gene, whereby the
gene is selected from the group comprising E1B 55 kDa, E4orf6,
E4orf3 and E3ADP.
3. Use according to any of claims 1 or 2, characterised in that the
virus, preferably the adenovirus, replicates in cells which have
YB-1 in the nucleus.
4. Use according to any of claims 1 to 3, characterised in that the
viral oncogene protein is E1A and/or the oncogene is the gene
coding for E1A and/or the oncogene protein is E1A.
5. Use according to claim 4, characterised in that the viral
oncogene protein E1A is capable of binding a functional Rb tumor
suppressor gene product.
6. Use according to claim 4, characterised in that the viral
oncogene protein E1A is incapable of binding a functional Rb tumor
suppressor gene product.
7. Use according to any of claims 4 to 6, characterised in that the
viral oncoprotein E1A does not induce nucleus localisation of
YB-1.
8. Use according to any of claims 1 or 3 to 7, characterised in
that the medicament is for patients whose cells are Rb positive or
Rb negative.
9. Use according to claim 8, characterised in that the cells are
those cells which are involved in the formation of the condition
which is to be influenced by the medicament.
10. Use according to any of claims 1 to 9, characterised in that
the cells are Rb negative and the cell nucleus is YB-1 positive,
preferably YB-1 positive in the nucleus independent from the cell
cycle.
11. Use according to any of claims 1 or 3 to 10, characterised in
that the medicament is for the treatment of tumors.
12. Use according to claim 11, characterised in that the cells,
preferably the cells forming the tumor or parts thereof, are
resistant, preferably multiple resistant against pharmacological
agents, preferably anti-tumor agents and more preferably
cytostatics.
13. Use according to claim 12, characterised in that the cells
express, preferably over-express of the membrane-anchored transport
protein P glycoprotein.
14. Use according to any of claims 1 to 13, characterised in that
the cells are p53 positive or p53 negative.
15. Use according to any of claims 5 or 7 to 14, characterised in
that the oncogene protein exhibits one or several mutations or
deletions compared to the wildtype oncogene protein E1A, whereby
the deletion is preferably one selected from the group comprising
deletions of the CR3 region and deletions of the N-terminus and
deletions of the C-terminus.
16. Use according to claim 15, characterised in that the E1A
oncogene protein is capable of binding to Rb.
17. Use according to any of claims 6 to 14, characterised in that
the oncogene protein comprises one or several mutations or
deletions compared to the wildtype oncogene protein, whereby the
deletion is preferably a deletion in the CR1 region and/or CR2
region.
18. Use according to claim 17, characterised in that the oncogene
protein E1A is incapable of binding to Rb.
19. Use according to any of claims 1 to 18, characterised in that
the viral oncogene protein, preferably E1A, is under the control of
a tissue and/or tumor specific promoter.
20. Use according to any of claims 1 to 19, characterised in that
the virus, particularly the adenovirus, codes for YB-1.
21. Use according to claim 20, characterised in that YB-1 is under
the control of a tissue specific and/or tumor specific
promoter.
22. Use according to any of claims 1 to 21, characterised in that
the virus, preferably the adenovirus, codes for at least one
protein, whereby the protein is selected from the group comprising
E4orf6, E4orf3, E1B 55 k and adenoviral E3ADP protein.
23. Use according to any of claims 1 to 22, characterised in that
the cells have YB-1 in the nucleus, preferably that the cells
forming the tumor or part thereof have YB-1 in the nucleus.
24. Use according to any of claims 1 to 23, characterised in that
the tumor comprises YB-1 in the nucleus after induction of the
transport of YB-1 into the nucleus.
25. Use according to claim 24, characterised in that the transport
of YB-1 is triggered by at least one measure selected from the
group comprising irradiation, administration of cytostatics and
hyperthermia.
26. Use according to claim 25, characterised in that the measure is
applied to a cell, an organ or an organism.
27. Use according to any of claims 1 to 26, characterised in that
the virus, preferably the adenovirus, is selected from the group
comprising Ad.DELTA.24, dl922-947, E1Ad/01/07, dlii19/1131, CB 016,
dl520 and viruses lacking an expressed viral oncogene which is
capable of binding a functional Rb tumor suppressor gene
product.
28. Use of a virus, preferably an adenovirus, for the manufacture
of a medicament, whereby the virus, preferably the adenovirus, is
designed such that the replication is controlled by YB-1 through
the activation of the E2-late promoter, preferably the activation
is predominantly controlled through the activation of the E2-late
promoter.
29. Use of a virus, preferably an adenovirus, for replication in
cells which have YB-1 in the nucleus, characterised in that the
virus, preferably the adenovirus, is designed such that the
replication is controlled by YB-1 through the activation of the
E2-late promoter, preferably predominantly through the activation
of the E2-late promoter.
30. Viral oncogene protein, preferably an isolated viral oncogene
protein, characterised in that it comprises the following
characteristics: a) transactivation of at least one viral gene,
whereby the viral gene is selected from the group comprising E1B-55
k, E3ADP and E4orf6 and E4orf3; and b) lack of induction of YB-1 in
a nucleus, preferably in the nucleus of the cell, in which the
viral oncogene protein is present.
31. Viral oncogene protein according to claim 30, characterised in
that the viral oncogene protein is E1A.
32. Viral oncogene protein according to claim 30 or 31,
characterised in that the viral oncogene protein comprises one or
several mutations or deletions compared to the wildtype oncogene
protein, whereby the deletion is preferably selected from the group
comprising deletion of the CR3 region, deletion of the N-terminus
and deletion of the C-terminus.
33. Viral oncogene protein according to claim 32, characterised in
that it is capable of binding to Rb.
34. Viral oncogene protein according to claim 30 or 31,
characterised in that the viral oncogene protein comprises one or
several mutations or deletions, whereby the deletion is preferably
a deletion in the CR1 region and/or the CR2 region of the E1A
oncogene protein.
35. Viral oncogene protein according to claim 34, characterised in
that the viral oncogene protein is incapable of binding to Rb.
36. Use of a viral replication system, preferably an adenoviral
replication system, comprising a nucleic acid coding for a virus,
preferably an adenovirus, according to any of claims 1 to 29, and
comprising a nucleic acid of a helper virus, whereby the nucleic
acid of the helper virus comprises a nucleic acid sequence coding
for YB-1.
37. Use of a viral replication system, preferably an adenoviral
replication system according to claim 36, characterised in that the
viral nucleic acid, preferably the adenoviral nucleic acid and/or
the nucleic acid of the helper virus are present as replicable
vectors.
38. Use of a nucleic acid coding for a virus, preferably an
adenovirus according to any of claims 1 to 29, for the manufacture
of a medicament, preferably for the manufacture of a medicament for
the treatment of tumors.
39. Use according to claim 38, characterised in that the cells,
preferably the cells forming the tumor or parts thereof, have a
resistance, preferably a multiple resistance against
pharmacologically active agents, preferably anti-tumor agents and
more preferably cytostatics.
40. Use of a nucleic acid coding for a virus, preferably an
adenovirus according to any of claims 1 to 29, for replication in
cells which have YB-1 in the nucleus, characterised in that the
virus is replication deficient in cells which do not have YB-1 in
the nucleus, and the virus encodes an oncogene or oncogene product
which transactivates at least one viral gene, preferably an
adenoviral gene, whereby the gene is selected from the group
comprising E1B 55 kDa, E4orf6, E4orf3 and E3ADP.
41. Use of a nucleic acid coding for a virus, preferably an
adenovirus, according to any of claims 1 to 29, for the manufacture
of a medicament, whereby the virus is designed such that the
replication is controlled by YB-1 through the activation of the
E2-late promoter, preferably predominantly through the activation
of the E2-late promoter.
42. Use of a nucleic acid coding for a virus, preferably an
adenovirus, according to any of claims 1 to 29, for replication in
cells, whereby the virus is designed such that the replication is
controlled by YB-1 through the activation of the E2-late promoter,
preferably predominantly through the activation of the E2-late
promoter.
43. Use of a vector comprising a nucleic acid according to any of
claims 36 to 42 for the use according to any of claims 1 to 29.
44. Use of a compound interacting with YB-1 for the
characterisation of cells, cells of a tumor tissue or patients, in
order to determine whether these shall be contacted with and/or
treated by a virus, preferably an adenovirus, according to any of
claims 1 to 29.
45. Use according to claim 44, characterised in that the means is
selected from the group comprising antibodies, anticalines,
aptamers, aptazymes and spiegelmers.
46. Use of the viral oncogene protein according to any of claims 30
to 35 or a nucleic acid coding therefor, for the manufacture of a
virus, preferably an adenovirus, which may be used in connection
with the uses as specified in any of claims 1 to 29.
47. Use of a virus, preferably an adenovirus, according to any of
claims 1 to 29, whereby the virus comprises a nucleic acid coding
for a transgene.
48. Use of a virus, preferably an adenovirus, according to any of
claims 1 to 29, whereby the virus comprises the translation and/or
transcription product of a transgene.
49. Use of an adenoviral replication system according to claim 36
or 37, whereby the nucleic acid of the adenoviral replication
system and/or the nucleic acid of the helper virus comprises a
transgene or a nucleic acid coding for a transgene.
50. Use of a nucleic acid according to any of claims 38 to 42,
whereby the nucleic acid comprises a transgene or a nucleic acid
coding for a transgene.
51. Use according to any of claims 47 to 50, whereby the transgene
is selected from the group comprising prodrug genes, cytokines,
apoptose-inducing genes, tumor suppressor genes, genes for
metalloproteinase inhibitors and genes for angiogenesis
inhibitors.
52. Use according to any of claims 47 to 50, whereby the transgene
is selected from the group comprising nucleic acids for siRNA, for
aptamers, for antisense molecules and for ribozymes, whereby the
siRNA, the aptamer, the antisense molecule and/or the ribozyme are
targeting a target molecule.
53. Use according to claim 52, whereby the target molecule is
selected from the group comprising resistance relevant factors,
anti-apoptosis factors, oncogenes, angiogenesis factors, DNA
synthesis enzymes, DNA repair enzymes, growth factors, receptors
for growth factors, transcription factors, metalloproteinases,
preferably matrix metalloprotein kinases, and plasminogen activator
of the urokinase type.
54. Use according to any of the preceding claims, whereby the
medicament further comprises a pharmaceutically active
compound.
55. Use according to claim 54, whereby the pharmaceutically active
compound is selected from the group comprising cytokines,
metalloproteinase inhibitors, angiogenesis inhibitors, cytostatics,
cell cycle inhibitors, proteosome inhibitors, recombinant
antibodies, inhibitors to the signal transduction cascade and
protein kinase.
56. Use according to any of the proceeding claims, characterized in
that the medicament comprises a combination of at least two agents,
whereby each and any of the agent is individually and independently
selected from the group comprising cytostatics.
57. Use according to claim 56, characterized in that at least two
of the agents address different target molecules.
58. Use according to claim 57, characterized in that at least two
of the agents act through a different mode of action.
59. Use according to any of claims 56 to 58, characterized in that
at least one agent increases the capacity of a cell to be infected
in which the virus replicates.
60. Use according to any of claims 56 to 59, characterized in that
at least one agent influences the availability of a component of
the cell, preferably increases the availability of their component,
whereby the component mediates the uptake of the virus.
61. Use according to any of claims 56 to 60, characterized in that
at least one agent mediates the transport of YB-1 into the nucleus,
preferably increases said transport.
62. Use according to any of claims 56 to 61, characterized in that
at least one agent is a histone deacylase inhibitor.
63. Use according to claim 62, characterized in that the histone
deacylase inhibitor is selected from the group comprising
Trichostatin A, FR 901228, MS-27-275, NVP-LAQ824, PXD101 Apicidin
and Scriptaid.
64. Use according to any of claims 56 to 62, characterized in that
at least one agent is selected from the group comprising
Trichostatin A, FR 901228, MS-27-275, NVP-LAQ824, PXD1O1 Apicidin
and Scriptaid.
65. Use according to any of claims 56 to 64, characterized in that
at least one agent is a topoisomerase inhibitor.
66. Use according to claims 65, characterized in that the
topoisomerase inhibitor is selected from the group comprising
Camptothecin, Irinotecan, Topotecan, DX-8951f, SN-38,
9-aminocamptothecin, 9-nitrocamptothecin, Daunorubicn and
Etoposid.
67. Use according to any of the proceeding claims, characterized in
that the agent comprises Trichostatin A and Irinotecan.
68. Use according to any of the proceeding claims, characterized in
that the virus, in particular the virus according to any of the
proceeding claims, is separated from the at least two agents.
69. Use according to claim 68, characterized in that at least one
unit dosis of the virus is separated from at least one unit dosis
of one or the at least two agents.
70. Kit comprising a virus, preferably a virus according to any of
the proceeding claims, and at least two agents, whereby any agent
is individually and independently selected from the group
comprising cytostatics.
Description
[0001] The present invention relates to the use of adenoviruses as
well as to nucleic acids coding therefor and recombinant viral
oncoprotein.
[0002] A number of therapeutic concepts are currently used in the
treatment of tumors. Apart from using surgery, chemotherapy and
radiotherapy are predominant. All these techniques are, however,
associated with considerable side effects. The use of replication
selective oncolytic viruses provides for a new platform for the
treatment of tumors. In connection therewith a selective intratumor
replication of a viral agent is initiated which results in virus
replication, lysis of the infected tumor cell and spreading of the
virus to adjacent tumor cells. As the replication capabilities of
the virus is limited to tumor cells, normal tissue is spared from
replication and thus from lysis by the virus.
[0003] For the time being, several viral systems are subject to
clinic trials aiming at tumor lysis. One example for such an
adenovirus is dl1520 (Onyx-015) which has been successfully used in
clinical phases I and II (Khuri, F. et al. Nature Medicine 6,
879-885, 2000). Onyx-015 is an adenovirus having a completely
deleted E1B-55 kDa gene. The complete deletion of the E1B 55 kDa
protein of the adenovirus is based on the discovery that
replication and thus lysis of cells is possible with an adenoviral
vector having a p53 deficiency (Kim, D. et al., Proc. Am. Soc.
Clin. Oncol. 17, 391a, 1998), whereby normal cells are not harmed.
More particularly, the E1B-55 kDa gene product is involved in the
inhibition of p53, the transport of viral mRNA and the switching
off the protein synthesis of the host cell. The inhibition of p53
occurs via formation of a complex consisting of p53 and the
adenoviral coded E1B-55 kDa protein and/or a complex consisting of
E1B-55 kDa and E4orf6. p53, coded by TP53, is the starting point
for a complex regulatory mechanism (Zambetti, G. P. et al., FASEB
J. 7, 855-865, 1993), which results, among others, in an efficient
inhibition of the replication in the cell of viruses like
adenovirus. The gene TP 53 is deleted or mutated in about 50% of
all human tumors which results in the absence
of--desired--apoptosis due to chemotherapy or radiation therapy
resulting in an usually unsuccessful tumor treatment.
[0004] A further concept of tumorlytic adenoviruses is based on the
discovery that if the E1A protein is present in a specific deleted
form or comprises one or several mutations, which do not affect the
binding of Rb/E2F and/or p107/E2F and/or p130/E2F, such adenovirus
will not induce the entry of the infected cells into the S phase
and will be capable of replicating in tumor cells which do not have
a functional Rb protein. Additionally, the E1A protein can be
deleted at the N-terminus and comprise one or several mutations in
the region of amino acid positions 1 to 76 of the E1A proteins,
respectively, in order to inhibit the binding of E1A to p300 and
thus to provide for a selective replication in tumor cells. These
approaches are described in an exemplary manner in European patent
EP 0 931 830. Examples for such viruses are Ad.DELTA.24, dl922-947,
E1Ad/01/07 and CB016 (Howe, J. A. et al., Molecular Therapy 2,
485-495, 2000; Fueyo, J. et al., Oncogene 19, 2-12, 2000; Heise, C.
et al., Nature Medicine 6, 11341139, 2001; Balague, C. et al., J.
Virol. 75, 7602-7611, 2001). These adenoviral systems for oncolysis
known in the prior art thus comprise distinct deletions in the E1A
protein, whereby such deletions had been made under the assumption
that a functional Rb protein and complexes consisting of inactive
Rb protein and E2F, respectively, would block an efficient in vivo
replication and in order to provide an adenoviral replication in
vivo in Rb-negative/mutated cells only. These adenoviral systems
according to the prior art are based on E1A in order to control in
vivo replication using the early E2 promoter (engl. E2 early
promoter) and free E2F (Dyson, N. Genes & Development, 12,
2245-2262, 1998).
[0005] A further form of tumorlytic adenoviral systems is based on
the use of selective promoters for specifically expressing the
viral oncogene E1A which provides for a selective replication in
tumor cells (Rodriguez, R. et al., Cancer Res. 57, 2559-2563,
1997).
[0006] As described above, the selection of a cellular background
which is appropriate for the respective concept underlying the mode
of action is important for the various concepts of adenoviral
tumorlytic viruses. In other words, the various adenoviral systems
currently known may only be used if distinct molecular biological
prerequisites are realized. This limits the use of such systems to
distinct patient groups.
[0007] A particular problem in the treatment of tumor diseases
arises once the patients develop a so-called multidrug resistance
(engi. multidrug resistance (MDR)) which represents a particularly
well studied form of resistance of tumors against cytostatics
(Gottesman and Pastan, Annu. Rev. Biochem. 62, 385-427, 1993). It
is based on the overexpression of the membrane-bound transport
protein P-glycoprotein which belongs to the so-called ABC
transporters (Stein, U. et al., JBC 276, 28562-69, 2001, J.
Wijnholds, Novartis Found Symp., 243, 69-79, 2002). Bargou, R. C.
et al. and Oda, Y. et al (Bargou, R. C. et al., Nature Medicine 3,
447-450, 1997; Clin. Cancer Res. 4, 2273-2277, 1998) were able to
show that nuclear localisation of the human transcription factor
YB-1 is directly involved in the activation of the expression of
the P-glycoprotein. Further studies confirmed that YB-1 is
transported into the nucleus by various stress conditions such as
UV irradiation, administration of cytostatics (Koike, K. et al.,
FEBS Lett 17, 390-394, 1997) and hyperthermia (Stein, U. et al.,
JBC 276, 28562-69, 2001). Further studies confirmed that the
nuclear localisation of YB-1 has an impact on one further ABC
transporter. This ABC transporter is referred to as MRP (engl.
multidrug resistance-related protein) and is involved in the
formation of the so-called atypical non-P-glycoprotein dependent
multidrug resistance (Stein, U. et al., JBC 276, 28562-69,
2001).
[0008] The problem underlying the present invention is to provide a
technical teaching and in particular a means which allows to treat
an organism, more particularly a human organism and a group of
patients, respectively, specifically with tumorlytically active
agents. It is a further problem underlying the present invention to
provide a means which is suitable to cause tumorlysis in patients
having tumor diseases which are resistant to cytostatics,
particularly those which have a multidrug resistance.
[0009] According to the present invention the problem is solved in
a first aspect by the use of a virus, preferably an adenovirus, for
the manufacture of a medicament, whereby the virus is replication
deficient in cells which do not have YB-1 in the nucleus, and the
virus codes for an oncogene or oncogene product, preferably an
oncogene protein, which transactivates at least one viral gene in
YB-1 nucleus positive cells, preferably an adenoviral gene, whereby
the gene is selected from the group comprising E1B 55 kDa, E4orf6,
E4orf3 and E3ADP.
[0010] In a second aspect, the problem is solved by the use of a
virus, preferably an adenovirus, for the replication in cells which
have YB-1 in the nucleus, whereby the virus is replication
deficient in cells which do not have YB-1 in the nucleus and the
virus codes for an oncogene or oncogene product, in particular
oncogene protein, which transactivates at least one viral gene,
preferably an adenoviral gene, whereby the gene is selected from
the group comprising E1B 55 kDa, E4orf6, E4orf3 and E3ADP.
[0011] In an embodiment of the two uses according to the invention,
the virus, preferably the adenovirus, replicates in cells which
have YB-1 in the nucleus.
[0012] In a further embodiment of the two uses according to the
invention the viral oncogene protein is E1A and/or the oncogene is
the gene coding for E1A and/or the oncogene protein is E1A.
[0013] In a preferred embodiment the viral oncogene protein E1A is
capable of binding to a functional Rb tumor suppressor gene
product.
[0014] In an alternative embodiment the viral oncogene protein E1A
is not capable of binding to a functional Rb tumor suppressor gene
product.
[0015] In a further embodiment of the two uses according to the
invention the viral oncogene protein E1A is not inducing nuclear
localisation of YB-1.
[0016] In a still further embodiment of the two uses according to
the invention the medicament is for patients the cells of whom are
either Rb-positive or Rb-negative.
[0017] In a preferred embodiment the cells are those cells which
are involved in the formation of the condition which is to be
influenced by the medicament.
[0018] In a further embodiment of the two uses according to the
invention the cells are Rb-negative and are YB-1 positive in the
nucleus, preferably are YB-1 positive in the nucleus independent
from the cell cycle.
[0019] In a still further embodiment of the two uses according to
the invention the medicament is for the treatment of tumors.
[0020] In a still further embodiment of the two uses according to
the invention the cells, particularly the cells forming the tumor
or parts thereof, are resistant to drugs, in particular have a
multidrug resistance, preferably a resistance against anti-tumor
agents and more preferably against cytostatics.
[0021] In a preferred embodiment of the two uses according to the
invention the cells are expressing, preferably overexpressing the
membrane-bound transport protein P-glycoprotein and/or MRP.
[0022] In a further embodiment of the two uses according to the
invention the cells are p53-positive or p53-negative.
[0023] In an embodiment of the two uses according to the invention
the oncogene protein has, compared to the wildtype oncogene protein
E1A, one or several mutations or deletions, whereby the deletion is
preferably selected from the group comprising deletions of the CR3
region and deletions of the N-terminus and deletions of the
C-terminus. In connection therewith it is preferred that the E1A
oncogene protein can bind to Rb.
[0024] In a further embodiment of the two uses according to the
invention the oncogene protein has, compared to the wildtype
oncogene protein, one or several mutations or deletions, whereby
the deletion is preferably in the CR1 region and/or the CR2 region.
It is within the invention that the oncogene protein E1A is
incapable of binding to Rb.
[0025] In an embodiment of the two uses according to the invention
the viral oncogene protein, in particular E1A, is under the control
of a tissue-specific and/or tumor-specific promoter and/or an E1A
promoter, in particular the natural E1A promoter.
[0026] In a further embodiment of the two uses according to the
invention, the virus, in particular the adenovirus, codes for
YB-1.
[0027] In a still further embodiment of the two uses according to
the invention, YB-1 is under the control of a tissue-specific
and/or tumor-specific promoter.
[0028] In a preferred embodiment of the two uses according to the
invention, the virus, in particular the adenovirus, codes at least
for one protein which is selected from the group comprising E4orf6,
E4orf3, E1B 55K and adenoviral E3ADP protein.
[0029] In an alternative embodiment of the two uses according to
the invention, the cells have YB-1 in the nucleus, in particular
the cells forming the tumor or part thereof have YB-1 in the
nucleus.
[0030] In a further embodiment of the two uses according to the
invention, the tumor has YB-1 in the nucleus upon inducing the
transport of YB-1 into the nucleus.
[0031] In a preferred embodiment of the two uses according to the
invention, the transport of YB-1 into the nucleus is triggered
through at least one measure selected from the group comprising
radiation, administration of cytostatics and hyperthermia.
[0032] In a particularly preferred embodiment of the two uses
according to the invention, the measure is applied to a cell, an
organ or an organism.
[0033] In a preferred embodiment of the two uses according to the
invention, the virus, in particular the adenovirus, is selected
from the group comprising Ad.DELTA.24, dl922-947, E1Ad/01/07,
dl1119/1131, CB 016, dl520 and viruses which are lacking an
expressed viral E1A oncogene which is capable of binding a
functional Rb tumor suppressor gene product.
[0034] In a third aspect the problem is solved by the use of a
virus, preferably an adenovirus, for the manufacture of a
medicament, whereby the virus, preferably the adenovirus, is
designed such that the replication is controlled through or by
means of YB-1 through the activation of the E2-late promoter,
preferably predominantly through the activation of the E2-late
promoter. In an embodiment YB-1 is either a transgenic YB-1 or a
cellular, in particular cellular deregulated YB-1. A transgenic
YB-1 is preferably meant to be a YB-1 which is expressed in a cell
by a vector, preferably a or the adenovirus. The E2-late promoter
is preferably the adenoviral E2-late promoter as present in the
wildtype adenovirus, or an E2-late promoter as described herein in
connection with the expression of transgenes.
[0035] In a fourth aspect the problem is solved by the use of a
virus and particular an adenovirus, for the replication in cells
which have YB-1 in the nucleus, whereby the virus, in particular
the adenovirus, is designed such that the replication is controlled
by YB-1 through the activation of the E2-late promoter, preferably
predominantly through the activation of the E2-late promoter. In an
embodiment YB-1 is either a transgenic YB-1 or a cellular, in
particular cellular deregulated YB-1. A transgenic YB-1 as used
herein is preferably a YB-1 which is expressed in a cell by a
vector, preferably a or the adenovirus. The E2-late promoter is
preferably the adenoviral E2-late promoter as present in the
wildtype adenovirus, or an E2-late promoter as described herein in
connection with the use of the expression of transgenes.
[0036] In a preferred embodiment of the third and/or fourth aspect
of the present invention the adenovirus is designed such as
disclosed herein, particularly such as it is designed in order to
be used in accordance with the present invention.
[0037] In a fifth aspect the problem is solved by a viral oncogene
protein, in particular an isolated viral oncogene protein which has
the following characteristics: [0038] a) transactivation of at
least one viral gene in YB-1 nucleus-positive cells, which is
selected from the group comprising E1B-55K, E3ADP. and E4orf6 and
E4orf3; and [0039] b) lacking induction of YB-1 in the nucleus, in
particular in the nucleus of the cell in which the viral oncogene
protein is present.
[0040] In an embodiment the viral oncoprotein is E1A.
[0041] In a further embodiment the viral oncogene protein has,
compared to the wildtype oncogene protein, one or several mutations
or deletions, whereby the deletion is preferably selected from the
group comprising deletion of the CR3 region, deletion of the
N-terminus and deletion of the C-terminus.
[0042] In an embodiment the induction of YB-1 through the viral
oncogene protein is absent when E4orf6 and/or E1B 55 kD is/are not
present in the nucleus exhibiting cell.
[0043] In connection therewith it is intended that the viral
oncogene protein is capable of binding to Rb.
[0044] In an alternative embodiment the viral oncogene protein
comprises one or several mutations or deletions, whereby the
deletion is preferably in the CR1 region and/or the CR2 region of
the E1A oncogene protein. In connection therewith it is intended
that the viral oncogene protein is not able to bind to Rb.
[0045] In a sixth aspect the invention is related to the use of a
viral replication system, preferably an adenoviral replication
system, comprising a nucleic acid which codes for a virus, in
particular an adenovirus as used in accordance with the present
invention, and comprising one nucleic acid of a helper virus,
whereby the nucleic acid of the helper virus comprises a nucleic
acid which codes for YB-1.
[0046] In an embodiment the viral nucleic acid, in particular the
adenoviral nucleic acid, and/or the nucleic acid of the helper
virus are present as a vector which can replicate.
[0047] In a seventh aspect the invention is related to the use of a
nucleic acid coding for a virus, in particular an adenovirus, as it
is used in accordance with the invention, for the manufacture of a
medicament, in particular for the manufacture of a medicament for
the treatment of tumors.
[0048] In an embodiment the cells, in particular the cells forming
the tumor or parts thereof, are resistant, in particular have a
multidrug resistance, against drugs, preferably anti-tumor agents,
and more preferably cytostatics.
[0049] In an eighth aspect the invention is related to the use of a
nucleic acid which codes for a virus, in particular an adenovirus,
as is used in accordance with the present invention, for the
replication in cells which have YB-1 in the nucleus, whereby the
virus is replication deficient in cells which do not have YB-1 in
the nucleus, and the virus codes for an oncogene or oncogene
product which transactivates at least one viral gene, preferably an
adenoviral gene, in YB-1 nucleus-positive cells, whereby the gene
is selected from the group comprising E1B 55 kDa, E4orf6, E4orf3
and E3ADP.
[0050] In a ninth aspect the problem is solved by the use of a
nucleic acid which codes for a virus, preferably an adenovirus, as
is used in accordance with the invention, for the manufacture of a
medicament, whereby the virus is designed such that the replication
is controlled by YB-1 through the activation of the E2-late
promoters, preferably predominantly through the activation of the
E2-late promoter. In an embodiment the YB-1 is either a transgenic
YB-1 or a cellular, in particular cellular deregulated YB-1. A
transgenic YB-1 as used herein is preferably a YB-1 which is
expressed in a cell by a vector, preferably a or the adenovirus.
The E2-late promoter is preferably the adenoviral E2-late promoter
as is present in the wildtype adenovirus, or an E2-late promoter as
described herein in connection with the use of the expression of
transgenes.
[0051] In a tenth aspect the problem is solved by the use of a
nucleic acid which codes for a virus, in particular an adenovirus,
as used in accordance with the invention for replication in cells,
whereby the virus is designed such that the replication is
controlled by YB-1 through the activation of the E2-late promoter,
preferably predominantly through the activation of the E2-late
promoter. In an embodiment the YB-1 is either a transgenic YB-1 or
a cellular, in particular cellular deregulated YB-1. As used
herein, transgenic YB-1 is preferably a YB-1 which is expressed by
a vector in a cell, preferably by a or the adenovirus. The E2-late
promoter is preferably the adenoviral E2-late promoter as present
in wildtype adenovirus, or an E2-late promoter as used in
connection with the expression of transgenes described herein.
[0052] In an eleventh aspect the problem is solved by the use of a
vector comprising one of the previously described nucleic acids,
for the use in accordance with the first or second aspect of the
present invention.
[0053] In a twelfth aspect the invention is related to the use of
an agent interacting with YB-1 for the characterisation of cells,
cells of a tumor tissue or patients, in order to determine whether
these shall be contacted and/or treated with a virus, in particular
an adenovirus, which is used in accordance with the invention.
[0054] In an embodiment the agent is selected from the group
comprising antibodies, anticalines, aptamers, aptazymes and
spiegelmers.
[0055] In a thirteenth aspect the problem is solved by the use of
the viral oncogene protein according to the present invention or a
nucleic acid coding therefor, for the manufacture of a virus, in
particular an adenovirus, which is used in accordance with the
first and second aspect of the present invention.
[0056] In an embodiment the virus comprises a nucleic acid coding
for a transgene.
[0057] In a further embodiment the virus comprises the translation
product and/or the transcription product of a transgene.
[0058] In a preferred embodiment the nucleic acid of the adenoviral
replication system and/or the nucleic acid of the helper virus
comprises a transgene or a nucleic acid coding for a transgene.
[0059] In a still further embodiment the nucleic acid comprises a
transgene or a nucleic acid coding for a transgene.
[0060] In an alternative embodiment the transgene is selected from
the group comprising prodrug genes, cytokines, apoptosis-inducing
genes, tumor suppressor genes, genes for metalloproteinases
inhibitors and genes for angiogenesis inhibitors.
[0061] In an embodiment the transgene is selected from the group
comprising nucleic acids for siRNA, for aptamers, for antisense
molecules and for ribozymes, whereby the siRNA, the aptamers, the
antisense molecules and/or the ribozymes are targeted against a
target molecule.
[0062] In a further embodiment the target molecule is selected from
the group comprising resistance relevant factors, anti-apoptosis
factors, oncogenes, angiogenesis factors, DNA synthesis enzymes,
DNA repair enzymes, growth factors and their receptors,
transcription factors, metalloproteinases, in particular matrix
metalloproteinases, and plasminogen activator of the urokinase
type. In an embodiment the resistance-relevant factors are
preferably selected from the group comprising P-glycoprotein, MRP
and GST, and also comprise nucleic acids coding therefor. In an
embodiment the anti-apoptosis factors are selected from the group
comprising BCL2, and also comprise the nucleic acids coding
therefor. In an embodiment the oncogenes are selected from the
group comprising Ras, in particular mutated Ras, Rb and Myc, and
also comprise nucleic acids coding therefor. In an embodiment the
angiogenesis factors are selected from the group comprising VEGF
and HMG proteins and also comprise the nucleic acids coding
therefor. In an embodiment the DNA synthesis enzymes are selected
from the group comprising telomerase and also comprise nucleic
acids coding therefor. In an embodiment the DNA repair enzymes are
selected from the group which comprises Ku-80, and also comprise
nucleic acids coding therefor. In an embodiment the growth factors
are selected from the group comprising PDGF, EGF and M-CSF, and
comprise also nucleic acids coding therefor. In an embodiment the
receptors are in particular receptors for growth factors, whereby
the growth factors are preferably selected from the group
comprising PDGF, EGF and M-CSF, and also comprise the nucleic acids
coding therefor. In an embodiment the transcription factors are
selected from the group comprising YB-1, and also comprise the
nucleic acid coding therefor. In an embodiment the
metalloproteinases are preferably matrix metalloproteinases. In a
preferred embodiment the matrix metalloproteinases are selected
from the group comprising MMP-1 and MMP-2, and also comprise the
nucleic acids coding therefor. In an embodiment the plasminogen
activators of the urokinase type are selected from the group
comprising uPa-R, and also comprise the nucleic acids coding
therefor.
[0063] In a still further embodiment the medicament comprises
additionally at least one pharmaceutically active compound.
[0064] In a preferred embodiment the pharmaceutically active
compound is selected from the group comprising cytokines,
metalloproteinase inhibitors, angiogenesis inhibitors, cytostatics
such as Irinotecan and CPT-11 against colorectal carcinoma and
Daunorubicin against leukemia, cell cycle inhibitors such as CYC202
which inhibits CDK2/CyclinE kinase activity and can be used against
colorectal tumors (McClue S J, Int. J. Cancer 2002, 102, 463-468)
and BAY 43-9006 which inhibits Raf-1 and is, for example, effective
against mamma carcinoma (Wilhelm S M et al., Cancer Res. 2004, 64,
7099-7109), proteosome inhibitors such as PS-341 which inhibits the
26S proteasome activity and is used against squamous-cell carcinoma
(Fribley A et al., Mol Cell Biol 2004 November; 24(22): 9695-704),
recombinant antibodies such as against the EGF receptor (Herceptin
for breast carcinoma and prostate tumor; H. G. van der Poet,
European Urology 2004, 1-17; Erbitux against head and neck tumors;
Bauman M et al., Radiother. Oncol., 2004, 72, 257-266), and
inhibitors of the signal transduction cascade such as STI 571 which
represses, among others, c-kit and can be used against
gastrointestinal tumors (H. G. van der Poel, European Urology 2004,
45, 1-17), ABT-627, an endothelin inhibitor, which may be used,
among others, against prostate tumors (H. G. van der Poel, European
Urology 2004, 45, 1-17), SU5416 which inhibits phosphorylation of
the VEGF tyrosine kinase receptor and which may be used, among
others, against glioblastoma and prostate cancer (Bischof M et al
Int. J. Radiat. Oncol. Biol. Phys. 2004; 60 (4): 1220-32), ZD1839
which inhibits EGFR tyrosine activity and may be used, among
others, against prostate tumors ( H. G. van der Poel, European
Urology 2004, 45, 1-17); rapamycin derivatives such as CCI-779 and
RAD001 which inhibit mTOR and can be used against prostate tumors.
It is within the present invention that the various adenoviruses
described herein and the adenoviruses to be used in accordance with
the present invention, respectively, can, in principle, be used
with each and any of the aforementioned compounds for each and any
of the indication described herein in connection therewith. In a
particularly preferred embodiment the indication is the one which
is described for any of the previously mentioned pharmaceutically
active compounds.
[0065] In an embodiment the medicament comprises a combination of
at least two agents, whereby any agent is individually and
independently selected from the group comprising cytostatics.
[0066] In a preferred embodiment at least two of the agent act upon
different target molecules.
[0067] In an alternative embodiment at least two of the agents are
active through a different mode of action.
[0068] In an embodiment at least one agents increases the capacity
of a cell to be infected in which the virus replicates.
[0069] In an embodiment at least one agent has an impact on the
availability of a component within the cell, which preferably
increases the availability of the component, whereby the component
mediates the uptake of the virus.
[0070] In an embodiment at least one agent mediates the transport
inof YB-1 to the nucleus, preferably increases said transport.
[0071] In an embodiment at least one agent is a histone deacylase
inhibitor.
[0072] In a preferred embodiment the histone deacylase inhibitor is
selected from the group comprising trichostatine A, FR 901228,
MS-27-275, NVP-LAQ824 and PXD101.
[0073] In an embodiment at least one agent is selected from the
group comprising trichostatin A (against glioblastoma, Kim J H et
al., Int. J. Radiation Oncology Biol. Phys. 2004, 59, 1174-1180),
FR 901228 (against. pancreas tumors, Sato N et al., Int. J. Oncol.
2004, 24, 679-685; MS-27-275 (against prostate tumors; Camphausen K
et al., Clinical Canver Research 2004, 10, 6066-6071), NVP-LAQ824
(against leukemiae; Nimmanapalli R et al., Cancer Res. 2003, 63,
5126-5135; PXD101 (against ovary tumors, Plumb J A et al, Mol.
Cancer Ther. 2003, 2, 721-728), Scriptaid (against breast
carcinoma, Keen J C et al., Breast Cancer Res. Treat. 2003, 81,
177-186), apicidin (against melanoma, Kim S H et al., Biochem.
Biophys. Res. Commun. 2004, 315, 964-970) and CI-994 (against
various tumors, Nemunaitis J J et al., Cancer J. 2003, 9, 58-66).
The mode of action of histone deacetylase inhibitors is, among
others, described in Lindemann R K et al., Cell Cycle 2004, 3,
77-86. It is within the present invention that the various
adenoviruses described herein and the adenoviruses to be used in
accordance with the present invention may be used with the
aforementioned compounds, in principle, for each and any of the
indications described herein in connection therewith. In a
particularly preferred embodiment the indication is one as has been
described for each and any of the aforementioned pharmaceutically
active compounds.
[0074] In an embodiment at least one agent is a topoisomerase
inhibitor.
[0075] In a preferred embodiment the topoisomerase inhibitor is
selected from the group comprising camptothecin, irinotecan,
topotecan, DX-895If, SN-38, 9-aminocamptothecin,
9-nitrocamptothecin, etoposid and daunorubicin. These may be used
against various tumors, for example, colorectal tumors, pancreas
tumors, ovary carcinomas and prostate carcinomas. The fields of
application are, among others, described by Recchia F et al.,
British J. Cancer 2004, 91, 1442-1446; Cantore M et al., Oncology
2004, 67, 93-97; Maurel J. et al., Gynecol. Oncol 2004, 95,
114-119; Amin A. et al., Urol. Oncol. 2004, 22, 398-403; Kindler H
L et al., Invest. New Drugs 2004, 22, 323-327, Ahmad T. et al.,
Expert Opin. Pharmacother. 2004, 5, 2333-2340; Azzariti A. et al.,
Biochem Pharmacol. 2004, 68, 135-144; Le Q T et al., Clinical
Cancer Res. 2004, 10, 5418-5424. It is within the present invention
that the various adenoviruses described herein and the adenoviruses
to be used in accordance with the present invention, respectively,
may in principle be used with the aforementioned compounds for each
and any of the indications described herein in connection
therewith. In a particularly preferred embodiment the indication is
such as described for each of the aforementioned pharmaceutically
active compounds.
[0076] In a particularly preferred embodiment the indication is one
which is described for any of the afore mentioned pharmaceutically
active compounds.
[0077] In a preferred embodiment the means comprises trichostatine
A and irinotecan and daunorubicin.
[0078] In an embodiment the virus, in particular the virus in
accordance with one of the aspects of the present invention, is
separated from the at least two agents.
[0079] In a preferred embodiment at least one unit dosis of the
virus is separated from at least one unit dosis of one or the at
least two agents.
[0080] In a fourteenth aspect the invention is related to a kit
comprising a virus, in particular a virus according to any aspect
of the present invention, and at least two agents, whereby any
agent is individually and independently selected from the group
comprising cytostatics.
[0081] The present invention is based on the surprising finding
that the DNA replication of E1A-modified adenoviruses in YB-1
nucleus-positive tumor cells is based on the activation of the
E2-late promoter. E1A-modified adenoviruses as used herein, are
adenoviruses which (a) do not replicate in YB-1 nucleus-negative
cells or show a reduced, preferably a strongly reduced replication
in YB-1 nucleus-negative cells compared to the respective wildtype,
(b) transactivate at least one viral gene, whereby the gene is in
particular selected from the group comprising E1B-55 kDa, E4orf6,
E4orf3 and E3ADP, and/or (c) do not translocate cellular YB-1
through the adenovirus into the nucleus. Optionally the
adenoviruses used in accordance with the present invention have the
further characteristic that the binding of the adenoviral encoded
E1A protein interferes with the binding of E2F to Rb and is able to
dissolve the respective complex consisting of E2F and Rb,
respectively. Adenoviruses which have at least one or several of
the aforementioned features a) to c), preferably all of features a)
to c), are replication deficient in cells which do not have YB-1 in
the nucleus.
[0082] In an embodiment a strongly reduced replication as used
herein particularly means a replication which, compared to the
wildtype, is reduced by a factor of 2, preferably by a factor of 5,
more preferably by a factor of 10 and most preferably by a factor
of 100. In a preferred embodiment such comparison of the
replication is performed using identical or similar cell lines,
identical or similar virus titers for infection (multiplicity of
infection, MOI, or plaque forming unit, pfu) and/or identical or
similar general experimental conditions. Replication as used herein
particularly means formation of particles. In a further embodiment
the measure for replication can be the extent of viral nucleic acid
synthesis. Methods for the determination of the extent of the viral
nucleic acid synthesis as well as methods for determining particle
formation are known to the ones skilled in the art.
[0083] The findings, methods, uses or nucleic acids, proteins,
replication systems and the like described herein are not
necessarily limited to adenoviruses. In principle, such systems
exist also in other viruses which are herewith also
encompassed.
[0084] A replication which is comparable to wildtype replication,
can be realized upon an infection rate of 1 to 10 pfu/cell compared
to 10 to 100 pfu/cell according to the prior art when using the
viruses according to the present invention or when using the
viruses described herein in accordance with the present
invention.
[0085] Cellular YB-1 as used herein shall mean any YB-1 which is
coded by a cell and preferably is also expressed by a cell, whereby
this YB-1 is present in the cell, preferably prior to the infection
of the respective cell with an adenovirus, preferably an adenovirus
and/or a helpervirus as described herein. It is, however, also
within the present invention that cellular YB-1 is a YB-1 which is
introduced into the cell or produced by such cell upon application
of exogenous measures such as, e. g., infection with a virus, in
particular with an adenovirus.
[0086] Without wishing to be bound by this in the following, the
present inventor assumes that the E2-early promoter, i. e. the
early E2 promoter is not switched on through the human cellular E2F
transcription factor in connection with the replication of the
viruses used herein in accordance with the present invention. The
switching on of the replication is independent of the Rb status of
the cells, i. e. which means that the tumor cells which are
infected using the viruses disclosed herein and which are
preferably lysed subsequently thereafter, may comprise both
functional as well as inactive Rb proteins. Additionally,
adenoviral replication does neither need any functional p53 protein
nor is it affected by its presence, when using the adenoviruses
disclosed herein or under the conditions disclosed herein. Insofar,
the technical teaching departs from the principle underlying the
use of the oncolytic or tumorlytic adenoviruses of the Ad.DELTA.24,
dl922-947, E1Ad/01/07, CB016 type or of those adenoviruses which
are, for example, described in European patent EP 0 931 830, and
into which one or several deletions have been introduced into the
E1A protein under the assumption that intact functional Rb proteins
are an obstacle to an efficient replication in vivo thus providing
an adenoviral replication in vivo only in Rb-negative and
Rb-mutated cells, respectively. These adenoviral systems according
to the prior art are based on E1A in order to control in vivo
replication of adenoviruses by means of the early E2 promoter (E2
early promoter) and "free E2F". Nevertheless, these viruses
according to the prior art may be used in accordance with the
present invention, i. e. for replication in cells which contain
YB-1 in the nucleus independent from the cell cycle.
[0087] The viruses described in said European patent EP 0 931 830
and in particular adenoviruses may be used in accordance with the
present invention. More particularly, the viruses described in said
patent are replication deficient and lack an expressed viral
oncoprotein which is capable of binding a functional Rb tumor
suppressor gene product. The adenovirus can particularly be an
adenovirus which is lacking expressed viral E1A oncoprotein which
is capable of binding a functional tumor suppressor gene product,
in particular Rb. The viral E1A oncoprotein can comprise an
inactivating mutation, for example in the CR1 domain at amino acid
positions 30 to 85 in Ad 5, nucleotide positions 697 to 790 and/or
the CR2 domain at amino acid positions 120 to 139 in Ad 5,
nucleotide positions 920 to 967 which are involved in the binding
of p105 Rb protein, p130 and p107 protein. It can also be intended
that the adenovirus is of type 2 dl 312 or the adenovirus is of
type 5 NT dl 1010.
[0088] Replication ultimately occurs in cells which comprise YB-1
in the nucleus, preferably independent from the cell cycle, which
are thus YB-1 nucleus-positive, when using adenoviruses in
accordance with the invention for the manufacture of a medicament,
in particular for the manufacture of a medicament for the treatment
of tumor diseases, and when using adenoviruses in accordance with
the invention for replication in cells which have YB-1 in the
nucleus. It is particularly noteworthy that the adenoviruses as
such do not replicate in cells which do not have YB-1 in the
nucleus but have YB-1 essentially in the cytoplasm only, or
replicate at a significantly reduced level. Insofar it is necessary
that YB-1 is present in the nucleus for a successful replication of
these viruses. This can, for example, as will be outlined in the
following in more detail, be realized by applying measures to the
cells which result in the expression of YB-1 in the nucleus or in
the presence of YB-1 in the nucleus. A respective measure can, for
example, be the coding and expression, respectively, of YB-1
through adenoviruses used in accordance with the present invention
which in addition to the adenoviral genes also comprise a genetic
information coding for YB-1 and in-particular for the expression of
YB-1. Other measures which result in transport, induction or
expression of YB-1 in the nucleus of the cell, are stress
conditions such as administration of cytostatics, irradiation,
hyperthermia and the like, to the cell and to an organism
containing such cell.
[0089] The adenoviruses which are used in connection with the
present invention, in particular for tumor lysis, are further
characterized such that they do not replicate in cells which do not
have YB-1 in the nucleus, in other words which are YB-1
nucleus-negative.
[0090] A further feature of the adenoviruses which are to be used
in accordance with the invention, is that they code for a viral
oncoprotein which is also referred to herein as oncogene protein,
whereby the oncogene protein is preferably E1A, whereby the
oncogene protein is capable of activating at least one viral gene
which can have an impact on the replication of the virus and/or
cell lysis of the cells infected by the virus. It is preferred that
the influence on replication is such that the virus replicates
better in the presence of the oncogene protein compared to a
situation where the oncogene protein of the respective virus is
lacking. This process is referred to herein also as transactivating
and in particular E1A transactivating, when the transactivation is
mediated through E1A. The term "transactivate" or "transactivation"
describes preferably the process that the respective viral
oncoprotein has an impact on the expression and/or the
transcription of one or several other genes different from the
viral oncoprotein coding gene itself, i. e. is preferably
controlling its expression and/or translation, and in particular
activates this/these. Such viral genes are preferably E1B 55 kDa,
E4orf6, E4orf3 and E3ADP as well as any combination of the
aforementioned genes and gene products, respectively.
[0091] A further, although preferably optional, feature of the
adenoviruses to be used in accordance with the invention, is the
binding to and of tumor suppressor Rb. In principle. it is within
the present invention that the adenoviruses used in accordance with
the present invention bind to Rb or do not bind to Rb. The use of
both alternative embodiments of the adenoviruses is possible
independently from the Rb status of the cell to be treated.
[0092] In order to confer the capability to not bind to Rb, the
following deletions of the E1A oncoprotein are, for example,
possible: Deletion in the CR1 region (amino acid positions 30-85 in
Ad5) and deletion of the CR2 region (amino acid positions 120-139
in AD5). In doing so, the CR3 region is maintained and can have its
transactivating function on the other early viral genes.
[0093] In contrast thereto, the following deletions to the E1A
oncoprotein are in principle possible in order to impart E1A the
capability to bind to Rb: deletion of the CR3 region (amino acid
positions 140-185); deletion of the N-terminus (amino acid
positions 1-29); deletion of amino acid positions 85-119; and
deletion of the C-terminus (amino acid positions 186-289). The
regions recited herein do not interfere with the binding of E2F to
Rb. The transactivating function remains, however, is reduced
compared to wildtype Ad5.
[0094] Such viruses which are known in the prior art are generally
regarded as replication deficient. It is, however, the merit of the
present inventor that he has recognised that they are capable of
replication in a suitable background nevertheless, in particular a
cellular background. Such a suitable cellular background is caused
or provided by the presence of YB-1 in the nucleus, preferably a
cell cycle independent presence of YB-1 in the nucleus. The term
cells or cellular systems, as used herein, comprises fragments of
cells or fractions of cell lysates as well as cells which are
present in vitro, in vivo or in situ. Insofar, the term cellular
systems or cells also comprises cells which are present in a cell
culture, tissue culture, organ culture or in any other tissue or
organ in vivo and in situ, respectively, isolated, in groups or as
part of tissues, organs or organisms or are also present as such in
a preferably living organism. The organism is preferably a
vertebrate organism and more preferably a mammal. It is
particularly preferred that the organism is a human organism.
[0095] Additionally, it is within the present invention that based
on the technical teaching provided herein, new viruses are
generated which have the replication characteristic of the
adenoviruses described herein as well as the one of adenoviruses of
the prior art in cells which are YB-1 nucleus-positive. In other
words, preferably starting from the adenoviruses already known
further viruses can be designed which have the features defined
herein needed for their use in accordance with the present
invention.
[0096] In connection with the present invention the modified E1A
oncoprotein of the various adenoviruses which are to be used in
accordance with the invention, is capable of transactivating the
early viral genes such as, for example, E1B 55K, E4orf3, E4orf6,
E3ADP, in YB-1 nucleus-positive cells. In connection therewith,
there are preferably otherwise no further changes to the viral
genome and the respective adenovirus can otherwise correspond to an
adenovirus of the wildtype or any derivative thereof.
[0097] The viruses disclosed herein which code for a
transactivating oncogene protein in the sense of the present
invention or which comprise such oncogene protein, comprise, for
example, the adenoviruses Ad.DELTA.24, dl922-947, E1Ad/01/07, CB106
and/or the adenoviruses described in European patent EP 0 931 380,
which are each capable of transactivating the early genes, such as
E1B, E2, E3 and/or E4, and are comparable to adenoviruses of the
wildtype, in particular wildtype Ad5. A particular region of the
E1A protein is responsible for transactivation in these cases.
Within various adenovirus serotypes there are three highly
conserved regions in the E1A protein. The CR1 region from amino
acid positions 41-80, the CR2 region from amino acid positions
120-139 and the CR3 region from of amino acid positions 140-188.
The transactivating function is primarily based on the presence of
the CR3 region in the E1A protein. The amino acid sequence of CR3
is unaltered in the aforementioned adenoviruses. This results in a
transactivation of the early genes E1B, E2, E3 and E4 independent
from the presence of YB-1 in the nucleus or in the cytoplasma.
[0098] In the recombinant adenovirus dl520, however, the CR3 region
has been deleted. Thus dl520 expresses a so-called E1A12S protein
which does not comprise the amino acid sequence of the CR3 region.
As a consequence, dl520 can exert a very weak transactivating
function only, in particular on the E2 region, and thus does not
replicate in YB-1 nucleus-negative cells. In YB-1 nucleus-positive
cells YB-1 is transactivating the E2 region and thus allows an
efficient replication of d 1520. This is the basis for the use of
systems like dl520 and of systems on the basis of dl520 for the
purposes disclosed herein, respectively. A further important
difference between both the previously described groups of
adenoviruses, i. e. delta 24 (herein also referred to as
Ad.DELTA.24) and dl520 resides in the fact that with dl520 the
early genes E1B, E3 and E4 are more strongly transactivated in YB-1
nucleus-positive cells compared to YB-1 nucleus-negative cells. In
contrast, there are no or only minor differences with delta 24. The
transactivation effect of dl520 and more particularly of the E1A12S
protein, however, is significantly reduced compared to wildtype
adenovirus. This transactivation is, however, sufficient in order
to allow for an efficient replication in YB-1 nucleus-positive
cells, as shown in example 10. The design of the E1A protein and of
the nucleic acid coding therefor described herein and in particular
in this context such that the E1A protein has one or several
deletions and/or mutations compared to the wildtype oncogene
protein E1A, whereby the deletion is preferably one selected from
the group comprising deletions of the CR3 region and deletions of
the N-terminus and deletions of the C-terminus, including and
particularly preferred those embodiments of the E1A protein as
described in connection with dl520 or Ad.DELTA.24, dl922-947,
E1Ad/01/07, CB106 and/or the adenoviruses described in European
patent EP 0 931 830, are embodiments of viruses, in particular
adenoviruses, the replication of which is controlled by YB-1
through the activation of the E2-late promoter, preferably
predominantly through the activation of the E2-late promoter.
Further embodiments of the E1A protein which allow this form of
replication of adenoviruses, can be generated by the ones skilled
in the art based on the disclosure provided herein.
[0099] In further adenoviruses which are to be newly constructed,
which are also referred to herein as derivatives and which may be
used in accordance with the present invention, typically have an E1
deletion, an E1/E3 deletion and/or an E4 deletion, i. e . the
corresponding adenoviruses are not able to generate functionally
active E1 and/or E3 and/or E4 expression products and respective
products, respectively, or, in other words, these adenoviruses are
only capable to generate functional inactive E1, E3 and/or E4
expression products, whereby a functionally inactive E1, E3 and/or
E4 expression product as such which is either not present as an
expression product at all, whether at the transcription level
and/or the translation level, or it is present in a form in which
it at least is lacking one of the functions it has in wildtype
adenoviruses. The function(s) of the expression product of the
wildtype adenovirus is/are known to the ones skilled in the art
and, for example, described in Russell, W. C., Journal of Virology,
81, 2573-2604, 2000. Russell (supra) describes also principles for
the construction of adenoviruses and adenoviral vectors which are
incorporated herein by reference. It is also within the present
invention that the modified E1A oncoprotein, E1B-55K, E4orf6 and/or
E3ADP (adenoviral death protein (ADP)) (Tollefson, A. et al., J.
Virology, 70, 2296-2306, 1996) is expressed in such a vector either
individually or in any combination. In connection therewith, the
individually named genes as well as the transgenes disclosed herein
and/or the therapeutic transgenes, can be cloned into the E1 and/or
E3 and/or E4 region and be expressed independently by virtue of a
suitable promoter or under the control of a suitable promoter.
Basically, the regions E1, E3 and E4 are similarly suitable as
cloning sites within the adenoviral nucleic acid, whereby the
regions not used for the cloning can, either individually or as a
whole, be present, partially and/or completely deleted. In case
that these regions are present, in particular are present in their
entirety, it is within the present invention that they are either
intact and preferably provide for a translation product and/or a
transcription product, and/or are not intact and preferably do not
provide for a translation product and/transcription product.
Suitable promoters are, among others, those as disclosed herein in
connection with the control and expression, respectively, of E1A,
in particular of the modified E1A.
[0100] Finally, in one embodiment the adenoviruses which are to be
used in accordance with the present invention, are deficient with
regard to E1B, in particular with regard to E1B 19 kDa. As used
herein, the term deficient generally means a condition in which E1B
does not have all of the characteristics inherent to the wildtype
but at least one of these characteristics is absent. The adenoviral
BCL2 homolog E1B 19 k avoids the E1A induced apoptosis by
interaction with the pro-apoptotic proteins Bak and Bax. Because of
this a maximum replication and/or particle formation is possible in
infected cells (Ramya Sundararajan and Eileen White, Journal of
Virology 2001, 75, 7506-7516). The lack of E1B 19 k results in a
better release of the viruses as, if present, it will minimize the
function of the adenoviral death protein. By such a deletion the
virus induced cytopathic effect is increased (Ta-Chiang Liu et al.,
Molecular Therapy, 2004 ) and thus results in a more pronounced
lysis of infected tumor cells. Additionally, the lack of E1B 19 k
causes that TNF-alpha does not exert an influence on the
replication of such recombinant adenoviruses in tumor cells,
whereas in normal cells the treatment results in a reduced
replication and release of infectious viruses. Insofar, selectivity
and specificity are increased (Ta-Chiang Liu et al., Molecular
Therapy 2004, 9, 786-803).
[0101] The adenoviruses which are used in accordance with the
invention disclosed herein, are, basically, known in the prior art
in some embodiments. The adenoviruses used in accordance with the
present invention are preferably recombinant adenoviruses,
particularly also when a change, compared to the wildtype, has been
made in accordance with the technical teaching provided herein. It
is within the skills of those of the art to delete or mutate those
adenoviral nucleic acid sequences which are not essential for the
present invention. Such deletions may, for example, be related to a
part of the nucleic acid coding for E3 and E4 as also described
herein. A deletion of E4 is particularly preferred if such deletion
does not extend to the protein E4orf6, or, in other words, the
adenovirus to be used in accordance with the present invention
codes for E4orf6. In preferred embodiments these adenoviral nucleic
acids may still be packed into the viral capsid and may thus form
infectious particles. The same is true for the use of the nucleic
acids in accordance with the present invention. It should be noted
that in general the adenoviral systems may be deficient with regard
to single or several expression products. In connection therewith
it is to be taken into consideration that this may be either based
on the fact that the nucleic acid coding for such expression
product is completely mutated or deleted or mutated or deleted to
the extent that essentially no expression product is produced
anymore or based on the lack of promoters or transcription factors
which control the expression, or which are active in a manner
different from wildtype, either at the nucleic acid level (lack of
a promoter; cis-acting element) or at the translation system and
the transcription system, respectively (trans-acting elements).
Particularly the latter aspect may be dependent on the cellular
background.
[0102] Apart from using adenoviruses in accordance with the present
invention, which are already known, also novel adenoviruses can be
used to the same extent as has already been disclosed for the other
adenoviruses described herein. The novel adenoviruses according to
the invention result from the technical teaching provided herein.
Particularly preferred representatives are, for example, the
viruses Xvir03 and Xvir03/01 depicted in FIG. 16 and FIG. 17, the
design principle of which is also further illustrated in examples
11 and 12.
[0103] In the case of vector Xvir03 a CMV promoter is cloned into
the E1 region which codes the nucleic acids for E1B 55K and E4orf6,
which are separated by a IRES sequence. In connection therewith the
E3 region may be partially or completely deleted and/or may be
present in a completely intact form. Due to the introduction of
these two genes and the gene products produced therefrom,
respectively, a replication efficiency is created which factually
corresponds to the one of wildtype viruses, whereby the selectivity
of the replication is maintained for cells, particularly tumor
cells, insofar as a replication happens in particular in YB-1
nucleus-positive cells and more particularly in cells in which YB-1
is deregulated. Cells in which YB-1 is deregulated, are preferably
those which show an increased expression of YB-1, preferably
compartment-independent, compared to normal or non-tumor cells. E1B
55k and E4orf6 can also be cloned into the E4 region, whereby the
E3 region can be intact or/and partially or completely deleted.
[0104] A further development of virus Xvir03 is virus Xvir03/01
into which, in a preferred embodiment, therapeutic genes or
transgenes are cloned under the control of a specific promoter, in
particular a tumor-specific or tissue-specific promoter. It is also
within the scope of such a virus that also the E4 region is
functionally inactive, preferably is deleted. The transgenes
described herein may also be cloned into the E4 region, whereby
this may occur in addition or alternative to the cloning of a
transgene into the E3 region and, respectively, the E3 region
remains partially or completely intact. Transgenes as used herein,
may be viral genes, preferably adenoviral genes, which are
preferably not present in the genome and which are not present at
the site of the genome of the wildtype, respectively, where they
are present in the particular virus now, or therapeutic genes.
[0105] Therapeutic genes may be prodrug genes, genes for cytokines,
apoptosis-inducing genes, tumor suppressor genes, genes for
metalloproteinase inhibitors and/or angiogenesis inhibitors.
Additionally, siRNA, aptamers, antisense and ribozymes may be
expressed which are directed against cancer-relevant target
molecules. Preferably, the single or the multiple target molecules
is/are selected from the group comprising resistance relevant
factors, anti-apoptosis factors, oncogenes, angiogenesis factors,
DNA synthesis enzymes, DNA repair enzymes, growth factors and their
receptors, transcription factors, metalloproteinases, in particular
matrix metalloproteinases and plasminogen activator of the
urokinase type. Preferred embodiments thereof have already been
disclosed herein.
[0106] Possible prodrug genes, which may be used in preferred
embodiments, are, for example, cytosine deaminase, thymidine
kinase, carboxypeptidase, uracil phosphoribosyl transferase; purine
nucleoside phosphorylase (PNP); Kirn et al, Trends in Molecular
Medicine, Volume 8, No. 4 (Suppl), 2002; Wybranietz W. A. et al.,
Gene Therapy, 8, 1654-1664, 2001; Niculescu-Duvaz et al., Curr.
Opin. Mol. Therapy, 1, 480.486, 1999; Koyama et al., Cancer Gene
Therapy, 7, 1015-1022, 2000; Rogers et al., Human Gene Therapy, 7,
2235-2245, 1996; Lockett et al., Clinical Cancer Res., 3,
2075-2080, 1997; Vijayakrishna et al., J. Pharmacol. And Exp.
Therapeutics, 304, 1280-1284, 2003.
[0107] Possible cytokines which may be used in preferred
embodiments, are, for example, GM-CSF, TNF-alpha, Il-12, Il-2,
Il-6, CSF, interferon-gamma; Gene Therapy, Advances in
Pharmacology, Volume 40, Editor: J. Thomas August, Academic Press;
Zhang und Degroot, Endocrinology, 144, 1393-1398, 2003; Descamps et
al., J. Mol. Med., 74, 183-189, 1996; Majumdar et al., Cancer Gene
Therapy, 7, 1086-1099, 2000.
[0108] Possible apoptosis inducing genes as may be used in
preferred embodiments, are, for example, decorin: Tralhao et al.,
FASEB J, 17, 464-466, 2003; retinoblastoma 94: Zhang et al., Cancer
Res.,63, 760-765, 2003; Bax and Bad: Zhang et al, Hum. Gene Ther.,
20, 2051-2064, 2002; apoptin: Noteborn and Pietersen, Adv. Exp.
Med. Biol., 465, 153-161, 2000); ADP: Toth et al., Cancer Gene
Therapy, 10, 193-200, 2003; bcl-xs: Sumantran et al., Cancer Res,
55, 2507-2512, 1995; E4orf4: Braithwaite and Russell, Apoptosis, 6,
359-370, 2001; FasL, Apo-1 and Trail: Boehringer Manheim, Guide to
Apoptotic Pathways, Arai et al., PNAC, 94, 13862-13867, 1997; Bims;
Yamaguchi et al., Gene Therapy, 10, 375-385, 2003; GNR163: Oncology
News, 17 Jun., 2000.
[0109] Possible tumor suppressor genes as may be used in preferred
embodiments, are, for example, E1A, p53, p16, p21, p27, MDA-7.
Opalka et al., Cell Tissues Organs, 172, 126-132, 2002, Ji et al.,
Cancer Res., 59, 3333-3339, 1999, Su et al., Oncogene, 22,
1164-1180, 2003.
[0110] Possible angiogenesis inhibitors as may be used in preferred
embodiments are, for example, endostatin, angiostatin: Hajitou et
al., FASEB J., 16, 1802-1804, 2002, and antibodies against VEGF
(Ferrara, N., Semin Oncol 2002 Dec; 29 (6 Suppl 16): 10-4.
[0111] Possible metalloproteinase inhibitors as may be used in
preferred embodiments are, for example, Timp-3, Ahonen et al., Mol
Therapy, 5, 705-715, 2002; PAI-1; Soff et al., J. Clin. Invest.,
96, 2593-2600, 1995; Timp-1, Brandt K. Curr. Gene Therapy, 2,
255-271, 2002.
[0112] siRNA (short interfering RNA) as used in connection with the
present invention, consists of two, preferably two separate RNA
strands, which hybridise with each other due to base
complementarity, i. e. are essentially base paired and preferably
have a length of up to 50 nucleotides, preferably between 18 and 30
nucleotides, more preferably less than 25 nucleotides and most
preferably 21, 22 or 23 nucleotides, whereby these figures refer to
the single strand of the siRNA, in particular to the length of the
stretch of the single strand which hybridises with one, and more
particularly with the second single strand and is base paired
therewith, respectively. siRNA specifically induces or mediates the
degradation of mRNA. The specificity required theretofor is
provided by the sequence of the siRNA and thus its binding site.
The target sequence to be degraded is essentially complementary to
the first or to the second one of the siRNA forming strands.
Although the exact mode of action is still unclear, it is assumed
that siRNA represents a biological strategy for cells to inhibit
certain alleles during development and to protect itself from
viruses. siRNA mediated RNA interference is used for the specific
suppression or even complete knock-out of the expression of a
protein by introducing a gene specific double-stranded RNA. For
higher organisms an siRNA having a length from 19 to 23
nucleotides, is thus particularly preferred as it does not result
in activation of an inspecific defense reaction, the so-called
interleukin response.
[0113] Immediate transfection of double-stranded RNA consisting of
21 nucleotides having symmetric 2-nt long overhangs at the 3' end
was able to mediate RNA interference in mammal cells and was highly
efficient compared to other technologies such as ribozymes and
antisense molecules (Elbashir, S. Harborth J. Lendeckel W. Yalvcin,
A. Weber K Tuschl T: Duplexes of 21-nucleotide RNAs mediate RNA
interference in cultured mammalian cells. Nature 2001, 411:
494-498). Only very few siRNA molecules were necessary so as to
inhibit the expression of the target gene. In order to avoid the
limitations of exogenously administered siRNA which particularly
resides in the transient nature of the interference phenomenon and
the specific delivery of the siRNA molecules, the prior art uses
vectors which allow for an endogenous siRNA expression. For
example, oligonucleotides having a length of 64 nucleotides are
provided which contain the 19 nucleotide long target sequence, both
in sense as well as in antisense orientation, separated through a,
for example, 9 nucleotide long spacer sequence which was introduced
into the vector. The resulting transcript folded into a hairpin
structure having a stem structure of, for example, 19 base pairs.
The loop is rapidly degraded in the cell so that a functional siRNA
is generated (Brummelkamp et al., Science, 296, 550-553, 2002).
[0114] The activity of pRb and E2F, respectively, is regulated
through phosphorylation. The hypophosphorylated form of pRb is
predominantly present in the G1 and M phase. In contrast, the
hyperphosphorylated form of pRb is present in the S and G2 phase.
E2F is released from the complex consisting of E2F and
hypophosphorylated pRb by phosphorylation of pRb. The release of
E2F from the complex consisting of E2F and hypophosphorylated pRb
results in the transcription of E2F dependent genes. The E1A
protein does not only bind to the hypophosphorylated form of pRb,
whereby the binding of E1A to pRb happens mostly through the CR2
region of the E1A protein. Additionally, it also binds to the CR1
region, although with lower affinity (Ben-Israel and Kleiberger,
Frontiers in Bioscience, 7, 1369-1395, 2002; Helt and Galloway,
Carcinogenesis, 24, 159-169, 2003).
[0115] The nucleic acid coding for YB-1 which, in an embodiment of
the adenoviruses to be used in accordance with the present
invention, is part of the adenoviruses, may also comprise a nucleic
acid sequence mediating the transport of YB-1 into the nucleus. The
nucleic acids, adenoviruses and adenoviral systems in accordance
with the invention as well as the adenoviruses known in the prior
art such as, for example, Onyx-015, Ad.DELTA.24, dl922-947,
E1Ad/01/07, CB016, dl 520 and the adenoviruses described in patent
EP 0 931 830, can be used as such or in combination with these
nucleic acids in accordance with the invention in connection
therewith as adenoviruses and adenoviral systems and thus as the
corresponding nucleic acids. Suitable nucleic acid sequences which
mediate nucleus transport, are known to the ones skilled in the art
and, for example, described in (Whittaker, G. R. et al., Virology,
246, 1-23, 1998; Friedberg, E. C., TIBS 17, 347, 1992; Jans, D. A.
et al., Bioessays 2000 Jun; 22(6): 532-44; Yoneda, Y., J. Biocehm.
(Tokyo) 1997 May; 121(5): 811-7; Boulikas, T., Crit. Rev. Eukaryot.
Gene Expr. 1993; 3(3): 193-227; Lyons R H, Mol. Cell Biol., 7,
2451-2456, 1987). In connection with the nucleus transport
mediating nucleic acid sequences, different principles can be used.
One such principle may, for example, be that YB-1 is formed as a
fusion protein together with a signal peptide and is introduced
into the nucleus and that the replication of the adenoviruses
according to the present invention thus occurs.
[0116] A further principle which may be realised in the design of
the adenoviruses used in accordance with the invention, is that
YB-1 can be provided with a transporter sequence which, preferably
starting from synthesis in the cytoplasma, introduces YB-1 into the
cell nucleus or which translocates YB-1 into the cell nucleus, and
promotes viral replication there. An example for a particularly
effective nucleic acid sequence mediating nucleus transport is the
TAT sequence of HIV which is, among other suitable nucleic acid
sequences of that type described in Efthymiadis, A., Briggs, L J,
Jans, D A., JBC 273, 1623-1628, 1998. It is within the present
invention that the adenoviruses which are used in accordance with
the present invention, comprise nucleic acid sequences which code
for peptides coding for nuclear transportation.
[0117] It is within the present invention that YB-1 is present in
its full length, particularly in a form which corresponds to the
wildtype of YB-1. It is within the present invention that YB-1 is
used or present as a derivative, such as, e. g. in shortened or
truncated form. A YB-1 derivative as used or present within the
present invention, is a YB-1 which is capable of binding to the
E2-late promoter and thus activates gene expression of the
adenoviral E2 region. Such derivatives particularly comprise the
YB-1 derivatives disclosed herein. Further derivatives may be
generated by deletion of single or several amino acids at the
N-terminus, at the C-terminus or within the amino acid
sequence.
[0118] With regard to the previously mentioned various further
expressed genes and gene products coded by the adenoviruses, it is
also possible that these are coded in any combination and expressed
in any combination, respectively.
[0119] The use of the adenovirus as disclosed herein as medicaments
and in particular in case of systemic administration can be
improved by a suitable targeting of the adenoviruses. The infection
of tumor cells by adenoviruses depends to a certain extent on the
presence of the coxackievirus-adenovirus receptor CAR and certain
integrins. If these are strongly expressed in cells, in particular
tumor cells, an infection is possible already at very low titers
(pfu/cell). Various strategies have been practiced so far in order
to obtain a so-called re-targeting of the recombinant adenoviruses,
for example, by insertion of heterologuous sequences into the fiber
knob region, use of bi-specific antibodies, coating of the
adenoviruses with polymers, introduction of ligands into the Ad
fiber, the substitution of the serotype 5 knob and fiber shaft and
knop with the serotype 3 knop and Ad 35 fiber shaft and knob,
respectively, and modification of the penton base (Nicklin S. A. et
al., Molecular Therapy 2001, 4, 534-542; Magnusson, M. K. et. al.,
J. of Virology 2001, 75, 7280-7289; Barnett B. G. et al.,
Biochimica et Biophysica Acta 2002, 1575, 1-14). The realization of
such further embodiments and features, respectively, in connection
with the adenoviruses of the present invention and the adenoviruses
used in accordance with the present invention in the various
aspects of the present invention is within scope of the present
invention.
[0120] The present inventor has furthermore surprisingly found that
the efficacy of the viruses described herein and in particular the
viruses used in accordance with the present invention can be
increased by using them in combination with at least two agents
whereby each of the at least two agents is individually and
independently selected from the group comprising cytostatics.
[0121] As used herein in a preferred embodiment, cytostatics are in
particular chemical or biological compounds which, during or after
the administration to a cell or an organism containing a or such
cell, result in the cell no longer growing and/or no longer
dividing or slowing down cell division and/or cell growth.
Cytostatics also comprise compounds which turn into a cytostatic in
the afore-described sense only in the cell or in an organism
containing such cell. Insofar, the term cytostatics also comprises
pre-cytostatics.
[0122] Cytostatics are grouped according to their mode of action.
The following groups are distinguished which, in principle, can all
be used within the present invention:
[0123] Alkylating agents, i. e. chemical compounds which cause
their cytotoxic effect by alkylating phosphate, amino, sulphydryl,
carboxy and hydroxy groups of the nucleic acid as well as proteins.
Such compounds are often cancerogenic themselves. Typical examples
of this group of cytostatics are cis-platin and platin derivatives,
cyclophosphamide, dacarbazine, mitomycin, procarbazine.
[0124] Antimetabolites, i. e. compounds which, due to their
structural similarity or ability for binding block a metabolic
process or affect the same. Within the group of antimetabolites it
is distinguished between structurally similar antimetabolites,
structure changing antimetabolites and the indirectly acting
antimetabolites. The structurally similar antimetabolites compete
due to chemical similarity with the metabolite without exerting the
function thereof. Structure changing antimetabolites bind to the
metabolites which impedes its function or resorption or chemically
modifies the metabolite. Indirectly acting antimetabolites
interfere with the function of the metabolite, for example by the
binding of ions. Typical examples of this group are folic acid
antagonists such as methotrexate, pyrimidine analogues such as
fluorouracil, purine analogues such as azathioprine and
mercaptopurine.
[0125] Mitosis inhibitors, i. e. compounds which inhibit cell
division. Within the group of mitosis inhibitors it is
distinguished between cell division toxins, spindle toxins and
chromosome toxins. Typical examples of this group are taxanes and
vinca alkaloids. The taxanes in turn can be divided into the two
major groups of taxoles and taxoters, whereby a particularly
preferred taxole is paclitaxel, and a particularly preferred
taxoter is docetaxel.
[0126] Antibiotics having an inhibitory effect on the DNA-dependent
RNA polymerase. Typical examples are the anthracyclines, such as,
e. g., bleomycin, daunorubicin, doxorubicin and mitomycin.
[0127] Topoisomerase inhibitors, in particular topoisomerase I
inhibitors. Topoisomerase inhibitors are chemical compounds which
determine the tertiary structure of the DNA by catalysing the
change of the DNA twist number in a three stage process.
Essentially, two forms of topoisomerases are distinguished.
Topoisomerases of type I cleave only a DNA strand and are
ATP-independent, whereas topoisomerase of type II cleave both
strands of a DNA, whereby they are ATP-dependent. Typical examples
for topoisomerase I inhibitors are irinotecan and topotecan, and
for topoisomersae II inhibitors etoposid and daunorubicin.
[0128] Within the present invention at least one and preferably two
agents are selected from the aforementioned group. It is, however,
also within the invention that in particular also three, four or
five different agents are selected. The following comments are made
for the embodiment of the present invention where only two agents
are used together with the virus. These considerations are
basically also applicable to embodiments where more than two agents
are used.
[0129] Preferably the agents differ from each other such that they
address or target different target molecules or are described in
the literature as targeting different molecules. It is within the
present invention that the agent also comprises two or more
different agents which bind to the same target molecule. It is also
within the present invention that one agent binds to a first site
of the target molecule, whereas the second agent binds to a second
site of the target molecule.
[0130] It is also within the present invention that at least two of
the agents are active using different modes of action. Active means
in a preferred embodiment that the cell growth and/or cell division
inhibiting or retarding effect of the chemical compound is mediated
through a different mode of action. In a particularly preferred
embodiment the term active means that the replication efficiency of
a virus, in particular the virus in accordance with the present
invention, of the viruses described herein and of the viruses to be
used in accordance with the present invention, is increased
compared to a scenario where one and/or both of the agents are not
used. As a measure for the efficiency of viral replication
preferably the number of viruses required for cell lysis is used,
preferably expressed as pfu/cell.
[0131] In a particularly preferred embodiment at least one of the
at least two agents is one which increases the infectability of the
cell in which the replication of the virus is to occur, preferably
is to occur in a selective manner, preferably with the virus
described herein and/or the virus to be used in accordance with the
present invention. This can, e. g., be performed by increasing the
uptake of the virus by the cell. The uptake of the virus, in
particular of adenovirus, is, for example, mediated by the
coxsackievirus-adenovirus receptor (CAR) (Mizuguchi und Hayakawa,
GENE 285, 69-77, 2002). An increased expression of CAR is, for
example, caused by trichostatin A (Vigushin et al., Clinical Cancer
Research, 7, 971-976, 2001).
[0132] In a further embodiment one of the at least two agents is
one which increases the availability of a component within the
cell, whereby the component is one which increases the replication
of the virus, preferably the virus described herein and/or the
virus to be used in accordance with the present invention.
[0133] In a further embodiment one of the at least two agents is
one which mediates the transport of YB-1 into the nucleus. Such an
agent can be selected from the group comprising topoisomerase
inhibitors, alkylating agents, antimetabolites and mitosis
inhibitors. Preferred topoisomerase inhibitors are camptothecin,
irinotecan, etoposide and their respective analogues. Preferred
mitosis inhibitors are daunorubicin, doxorubicin, paclitaxel and
docetaxel. Preferred alkylating agents are cis-platin and their
analogues. Preferred antimetabolites are fluorouracil and
methotrexat.
[0134] In a particularly preferred embodiment one of the at least
two agents is one which increases the infectability of the cell, in
particular the expression of CAR, and the second of the at least
two agents is one which increases the transport of YB-1 into the
nucleus, whereby preferably as chemical compound a compound is used
which exhibits the respective required characteristic as preferably
described above.
[0135] In a further embodiment the one of the at least two agents
is a histone deacylase inhibitor. A preferred histone deacylase
inhibitor is one which is selected from the group comprising
trichostatin A, FR901228, MS-27-275, NVP-LAQ824 and PXD101.
Trichostatin A is, for example, described in Vigushin et al.,
Clinical Cancer Research, 7, 971-976, 2001; FR901228 is, for
example, described in Kitazono et al., Cancer Res., 61, 6328-6330,
2001; MS-27-275 is described in Jaboin et al., Cancer Res., 62,
6108-6115, 2002; PXD101 is described in Plumb et al., Mol. Cancer
Ther., 8, 721-728, 2003; NVP-LAQ824 is described in Atadja et al.,
Cancer Res., 64, 689-695, 2004.
[0136] In a still further embodiment the one of the at least two
agents is a topoisomerase inhibitor, preferably a topoisomerase I
inhibitor. A preferred topoisomerse inhibitor is one which is
selected from the group comprising camptothecin, irinotecan,
topotecan, SN-38, 9-aminocamptothecin, 9-nitrocamptothecin,
DX-895If and daunorubicin. Irinotecan and SN-38 are, for example,
described in Gilbert et al., Clinical Cancer Res., 9, 2940-2949,
2003; DX-895IF is described in van Hattum et al., British Journal
of Cancer, 87, 665-672, 2002; camptothecin is described in Avemann
et al., Mol. Cell. Biol., 8, 3026-3034, 1988; 9-aminocamptothecin,
9-nitrocamptothecin are described in Rajendra et al., Cancer Res.,
63, 3228-3233, 2003; daunorubicin is described in M. Binaschi et
al., Mol. Pharmacol., 51, 1053-1059.
[0137] In a particularly preferred embodiment the one of the at
least two agents is a histone deacylase inhibitor and the other one
of the at least two agents is a topoisomerse inhibitor.
[0138] In an embodiment the means according to the present
invention and/or the means prepared in accordance with the present
invention contains the virus separate from one or several of the at
least two agents which are combined with the virus in accordance
with the present invention. It is preferred that the virus is
separate from any agent which is combined with the virus.
Preferably the separation is a spatial separation. The spatial
separation can be such that the virus is present in a different
package than the agent. Preferably the package is a single dose
unit, i. e. the virus and the agent are packed as single dosages or
doses. The single dose units may in turn be combined to form a
package. However, it is also within the present invention that the
single dosages of the virus are combined with one or several single
dosages of one or several of the agents or are packed
therewith.
[0139] The kind of package depends on the way of administration as
known to the one skilled in the art. Preferably the virus will be
present in a lyophilized form or in a suitable liquid phase.
Preferably, the agents will be present in solid form, e. g. as
tablets or capsules, however, are not limited thereto.
Alternatively, also the agents can be present in liquid form.
[0140] It is within the present invention that the virus is
systemically or locally administered. It is also within the present
invention that the agents combined with the virus are systemically
or locally administered individually and independently from each
other or together. Other modes of administration are known to the
ones skilled in the art.
[0141] It is also within the present invention that the virus and
the agents combined with it, are administered in a chronologically
separate manner or at the same time. In connection with a
chronologically separate manner it is preferred that the agents are
administered prior to the administration of the virus. How long the
agent is administered prior to the virus depends on the kind of the
agent used and is obvious for the one skilled in the art from the
mode of action of the agent used. Also the administration of the at
least two agents can occur at the same or at different points in
time. In connection with a chronologically different administration
the points of time again result from the modes of action underlying
the agents and can, based thereon, be determined by the ones
skilled in the art.
[0142] The above considerations, given in connection with the
medicaments according to the present invention which are also
disclosed and referred to herein as pharmaceutical compositions,
are roughly also applicable to any composition, including
compositions as used for the replication of viruses, preferably for
the in vitro replication of viruses in accordance with the present
invention. The above considerations are also applicable to the kit
in accordance with the present invention and the kit to be used in
accordance with the present invention, respectively, which may
apart from the viruses described herein and the viruses to be used
in accordance with the invention, also comprise one agent or a
combination of agents as described herein. Such kits comprise the
virus and/or one or several agents in a form ready for use, and
preferably instructions for use. Furthermore, the above embodiments
apply also to the nucleic acids as disclosed herein, and the
nucleic acids used in accordance with the present invention, and
the replication systems in accordance with the present invention
and the nucleic acids coding therefor, and, respectively, the
replication systems used in accordance with the present invention
and the nucleic acids coding therefor used in accordance with the
present invention.
[0143] The terms adenovirus and adenoviral system shall have
essentially the same meaning within the present invention.
Adenovirus shall particularly refer to the complete viral particle
comprising the capsid and the nucleic acid. The term adenoviral
system particularly focuses on the fact that the nucleic acid shall
be changed compared to the wildtype. Preferably such changes
comprise changes in the structure of the genome of the adenovirus
as may arise from deleting and/or adding and/or mutating promoters,
regulatory sequences and/or coding sequences such as open reading
frames. Additionally, the term adenoviral system is preferably used
in connection with a vector, which is, for example, used in gene
therapy.
[0144] The previously provided comments, including any use as well
as design of the adenoviruses and adenoviral systems, respectively,
apply also to the coding nucleic acids and vice versa.
[0145] In connection with the present invention it is possible that
the adenoviruses to be used in accordance with the present
invention and the nucleic acids coding therefor, respectively, may
be any respective adenoviral nucleic acid which results in a
replication event as such or in combination with further nucleic
acid sequences. It is possible, as explained herein, that by means
of helper virus the sequences and/or gene products required for
replication are provided. To the extent it is referred to coding
nucleic acid sequences and to the extent that such nucleic acid
sequences are known, it is within the invention that not only the
identical sequences used but also sequences derived therefrom. The
term derived sequences shall in particular refer herein to
sequences which still result in a gene product, either a nucleic
acid or a polypeptide, that exhibits a function which corresponds
to one or the function of a non-derived sequence. This can be
determined by simple routine tests known to the one skilled in the
art. An example for such derived nucleic acid sequences are those
nucleic acid sequences which code for the same gene product, in
particular for the same amino acid sequence, however, have a
deviating sequence of bases due to the degeneracy of the genetic
code.
[0146] In a preferred embodiment, with regard to the adenoviruses
according to the present invention and the adenoviral replication
system according to the present invention and the use of them
according to the present invention, respectively, the adenoviral
nucleic acid is deficient for the expression of the oncogene
protein, particularly of the E1A protein, which means that it is
either not coding for the 12S E1A protein or for the 13S E1A
protein, or it is neither coding for the 12S E1A protein nor the
13S E1A protein, or is modified, as defined herein, and that the
adenoviral replication system further comprises a nucleic acid of a
helper virus, whereby the nucleic acid of the helper virus
comprises a nucleic acid sequence which codes for the oncogene
protein, in particular for the E1A protein, which has the following
characteristics and imparts the following characteristics to the
adenovirus, respectively, namely that it preferably is not
replicating in YB-1 nucleus-negative cells but in cells which are
independent from the cell cycle YB-1 nucleus-positive,
transactivating at least one viral gene, in particular E1B 55 kDa,
E4orf6, E4orf3 and/or E3ADP, in YB-1 nucleus-positive cells, and/or
does not translocate cellular YB-1 into the nucleus. It is within
the present invention that the transgenes described herein are
coded individually or together by the helper virus and/or expressed
therefrom.
[0147] In an embodiment of such an adenoviral replication system
according to the present invention the adenoviral nucleic acid
and/or the nucleic acid of the helper virus are furthermore present
as vectors which are capable of replicating.
[0148] It is within the present invention that the coding nucleic
acid(s) coding for the adenoviruses which are used according to the
present invention, is/are present in a vector, preferably in an
expression vector and this expression vector is used in accordance
with the present invention.
[0149] In a further aspect the present invention is also related to
a vector group comprising at least two vectors, whereby the vector
group comprises altogether an adenoviral replication system as
described herein, and the vector group is used in accordance with
the present invention. It is intended that each of the components
of the adenoviral replication system is arranged on an individual
vector, preferably an expression vector.
[0150] Finally, the present invention is related in a further
aspect to the use of a cell for the same purposes as described
herein for the adenoviruses, whereby the cell comprises one or
several nucleic acids which code for the adenoviruses described
herein to be used in accordance with the invention and/or a
respective adenoviral replication system and/or a respective vector
and/or a vector group according to the present invention.
[0151] The previously described constructs of adenoviruses and in
particular their nucleic acids and the nucleic acids coding
therefor, may also be introduced into a cell in parts, particularly
into a tumor cell, whereupon due to the presence of the various
individual components they may act together such as if the
individual components originated from a single nucleic acid and a
single or several adenoviruses, respectively.
[0152] The nucleic acids coding for adenoviruses, adenoviral
systems or parts thereof, which are used in accordance with the
invention, may be present as vectors. Preferably, they are present
as viral vectors. In case of nucleic acids comprising adenoviral
nucleic acids the virus particle is preferably the vector. However,
it is also within the invention that said nucleic acids are present
in a plasmid vector. In any case the vector comprises elements
which provide for the propagation of the inserted nucleic acid, i.
e. replication and optionally expression of the inserted nucleic
acid, and control of them, respectively. Suitable vectors, in
particular expression vectors, and corresponding elements are known
to the ones skilled in the art and, for example, described in
Grunhaus, A., Horwitz, M. S., 1994, Adenoviruses as cloning
vectors. In Rice, C., edit., Seminars in Virology, London: Saunders
Scientific Publications.
[0153] The aspect of the invention that is related to the vector
group, accounts for the previously described embodiment, that the
various elements of the nucleic acid are not necessarily contained
on one vector only. Accordingly, a vector group comprises at least
two vectors. Otherwise, what has been said in relation to the
vectors is also applicable to the vectors and the vector group,
respectively.
[0154] The adenoviruses which are used in accordance with the
invention are characterised by various nucleic acids and gene
products, respectively, disclosed herein, and may otherwise
comprise all those elements known to the one skilled in the art, as
is also the case for adenoviruses of the wildtype (Shenk, T.:
Adenoviridae: The virus and their replication. Fields Virology,
3.sup.rd edition, edit. Fields, B. N., Knipe, D. M., Howley, P. M.
et al., Lippincott-Raven Publishers, Philadelphia, 1996, chapter
67).
[0155] The replication of adenoviruses is a very complex procedure
and usually makes use of the human transcription factor E2F. During
viral infection, first, the "early genes" E1, E2, E3 and E4 are
expressed. The group of the "late genes" is responsible for the
synthesis of the viral structural proteins. For the activation of
both the early as well as the late genes, the E1 region consisting
of the two transcriptional units E1A and E1B, which code for
different E1A and E1B proteins, are critical as the transcription
of the E2, E3 and E4 is induced by them (Nevins, J. R., Cell 26,
213-220, 1981). Additionally, the E1A proteins can induce DNA
synthesis in resting cells and thus initiate the entry into the S
phase (c. f. Boulanger and Blair, 1991). Additionally, they
interact with the tumor suppressors of the Rb class (Whyte, P. et
al., Nature 334, 124-127, 1988). In doing so, the cellular
transcription factor E2F is released. The E2F factors may
subsequently bind to corresponding promoter regions of both
cellular as well as viral genes (in particular to the adenoviral E2
early promoter) and thus initiate transcription and replication
(Nevins, J. R., Science 258, 424-429, 1992).
[0156] The gene products of the E2 region are especially needed for
the initiation and performance, respectively, of the replication,
as they code for three essential proteins. The transcription of the
E2 proteins is controlled by two promoters, the "E2-early
E2F-dependent" promoter which is also referred to herein as
E2-early promoter or early E2 promoter, and the "E2-late" promoter
(Swaminathan and Thimmapaya, The Molecular Repertoire of
Adenoviruses III: Current Topics in Microbiology and Immunology,Vol
199, 177-194, Springer Verlag 1995). Additionally, the products of
the E4 region together with the E1A and E1B-55 kDa protein play an
important role for the activity of E2F and the stability of p53,
respectively. For example, the promoter is even more activated by a
direct interaction of the E4orf6/7 protein coded by the E4 region,
with the heterodimer consisting of E2F and DP1 (Swaminathan and
Thimmapaya, JBC 258, 736-746, 1996). Furthermore, p53 is
inactivated by the complex consisting of E1B-55 kDa and E4orf6
(Steegenga, W. T. et al., Oncogene 16, 349-357, 1998), in order to
successfully complete a lytic infectious cycle. Additionally, the
E1B-55 kDa protein exhibits a further important function insofar as
it promotes by interacting with the E4orf6 protein the export of
viral RNA from the nucleus, whereas the proprietary RNAs of the
cell are retained in the nucleus (Bridge and Ketner, Virology 174,
345-353, 1990). A further important discovery is that the protein
complex consisting of E1B-55 kDa/E4orf6 is localised in the
so-called "viral inclusion bodies". It is assumed that these
structures are the sites of replication and transcription (Ornelles
and Shenk, J. Virology 65, 424-429, 1991).
[0157] A further region which is important for replication and in
particular for the release of adenoviruses, is the E3 region. The
E3 region comprises more particularly the genetic information for a
variety of comparatively small proteins which are not essential for
the adenoviral infectious cycle in vitro, i. e. are not essential
in cell culture. However, they play an important role for the
survival of the virus during an acute and/or latent infection in
vivo, as they have, among others, immune regulatory and apoptotic
function(s) (Marshall S. Horwitz, Virololgie, 279, 1-8, 2001;
Russell, supra). It could be shown that a protein having a size of
about 11.6 kDa induces cell death. The protein was, due to its
function, referred to as ADP--for the english term adenovirus death
protein--(Tollefson, J. Virology, 70, 2296-2306, 1996). The protein
is predominantly formed in the late phase of the infectious
cycle.
[0158] Furthermore, overexpression of the protein results in a
better lysis of the infected cells (Doronin et al., J. Virology,
74, 6147-6155, 2000).
[0159] Furthermore, it is known to the present inventor that E1A
deleted viruses, i. e. in particular viruses which do not have a
12S E1A protein and which also do not express a 13S E1A protein,
can very efficiently replicate at higher MOIs (Nevins J. R., Cell
26, 213-220, 1981), which, however, cannot be realised in any
clinic application. This phenomenon is referred to as "E1A-like
activity" in literature. It is was also known that from the 5
proteins coded by E1A, two proteins, namely the 12S and 13S
protein, control and induce, respectively, expression of the other
adenoviral genes (Nevins, J. R., Cell 26, 213-220, 1981; Boulanger,
P. und Blair, E.; Biochem. J. 275, 281-299, 1991). In connection
therewith it was shown that the transactivating function is
predominantly provided by the CR3 region of the 13S protein (Wong H
K und Ziff E B., J Virol., 68, 4910-20, 1994). Adenoviruses which
have specific deletions in the CR1 and/or CR2 region and/or CR3
region of the 13S protein, are mostly replication-deficient,
however, are still transactivating in some cell lines the viral
genes and promoters, respectively, in particular the E2 region
(Wong H K, Ziff E B., J Virol. 68, 4910-20, 1994; Mymryk, J. S. and
Bayley, S. T., Virus Research 33, 89-97, 1994).
[0160] After infection of a cell, typically a tumor cell, using a
wildtype adenovirus, YB-1 is induced into the nucleus which is
mediated by E1A, E1B-55K and E4orf6, and is co-localised with
E1B-55K in the nucleus in the viral inclusion bodies, which allows
for an efficient replication of the virus in the cell nucleus both
in vitro and in vivo. In connection therewith, it has already been
found earlier that E4orf6 binds to E1B-55K (Weigel, S. and
Dobbelstein , M. J. Virology, 74, 764-772, 2000; Keith N. Leppard,
Seminars in Virology, 8, 301-307, 1998) and thus mediates the
transport and distribution, respectively, of E1B-55K into the
nucleus, which provides for an optimum virus production and
adenoviral replication, respectively. An efficient replication of
the virus in accordance with the present invention is possible due
to the interaction of E1A, E1B-55K and YB-1, and by the complex
consisting of E1B-55K/E4orf6 with YB-1, respectively, and the
co-localisation of YB-1 and E1B-55K in the nucleus in the so-called
viral inclusion bodies and thus the use of the viruses described
herein for replication in cells which are YB-1 nucleus-positive and
for the manufacture of a medicament for the treatment of diseases,
whereby YB-1 nucleus-positive cells are involved. The replication
being thus possible with this cellular background, results in lysis
of the cell, release of the virus and infection and lysis of
adjacent cells, so that in case of an infection of a tumor cell and
a tumor, respectively, finally lysis of the tumor, i. e. oncolysis,
occurs.
[0161] YB-1 belongs to the group of highly conserved factors which
bind to an inverted CAAT sequence, the so-called Y-box. They may be
active in a regulatory manner both at the level of transcription as
well as translation (Wolffe, A. P. Trends in Cell Biology 8,
318-323, 1998). A growing number of Y-box dependant regulatory
pathways is found in the activation but also in the inhibition of
growth and apoptosis associated genes (Swamynathan, S. K. et
al.,FASEB J. 12, 515-522, 1998). Accordingly, YB-1 directly
interacts with p53 (Okamoto, T. et al., Oncogene 19, 6194-6202,
2000), plays an important role in the gene expression of Fas
(Lasham, A. et al., Gene 252, 1-13, 2000), MDR and MRP gene
expression (Stein, U. et al., JBC 276, 28562-69, 2001; Bargou, R.
C. et al., Nature Medicine 3, 447-450, 1997) and in the activation
of topoisomerases and metalloproteinases (Mertens. P. R. et al.,
JBC 272, 22905-22912, 1997; Shibao, K. et al., Int. J. Cancer 83,
732-737, 1999). Additionally, YB-1 is involved in the regulation of
mRNA stability (Chen, C- Y. et al., Genes & Development 14,
1236-1248, 2000) and repair processes (Ohga, T. et al., Cancer Res.
56, 4224-4228, 1996).
[0162] The nuclear localisation of YB-1 in tumor cells results in
E1A independent viral replication whereby in particular neither a
12S E1A protein nor a 13S E1A protein is present in an expressed
form and used, respectively (Holm, P. S. et al. JBC 277,
10427-10434, 2002) and in case of overexpression of the protein
YB-1 in multidrug resistance (multiple resistance). Additionally it
is known that the adenoviral proteins such as e. g. E4orf6 and
E1B-55K have a positive effect on viral replication (Goodrum, F. D.
and Ornelles, D. A, J. Virology 73, 7474-7488, 1999), whereby a
functional E1A protein is responsible for switching on the other
viral gene products (such as E4orf6, E3ADP and E1B-55K) (Nevins J.
R., Cell 26, 213-220, 1981). This, however, does not occur with the
E1A-minus adenoviruses of the prior art in which the 13S E1A
protein is not present. The nuclear localisation of YB-1 in
multidrug resistant cells which have YB-1 in the nucleus, provides
for replication and particle formation, respectively, of such
E1A-minus viruses. In this case, however, the efficiency of viral
replication and particle formation is reduced by several multiples
compared to wildtype Ad5. A combination of YB-1 which is either
already present in the nucleus of the tumor cell, or is induced
into the tumor cell by external factors (e. g. application of
cytostatics or irradiation or hyperthermia), i. e. is prompted to
be present in the nucleus, particularly independent from the cell
cycle, or is introduced as a transgene through a vector, with a
system, preferably with an adenoviral system, which switches on
adenoviral genes, but which does not allow for viral replication,
has been surprisingly found to be a system which mediates a very
efficient viral replication and particle formation through YB-1 and
thus provides oncolysis. Suitable cytostatics are, among others,
those which belong to the following groups: anthracyclines, such as
daunomycin and adriamycin; alkylating agents, such as
cyclophosphamide; alkaloids, such as etoposide; vin-alkaloids, such
as vincristine and vinblastine; antimetabolites such as for example
5-fluorouracil and methrotrexate; platin derivatives, such as for
example cis-platin; topoisomerase inhibitors, such as
camphothecine; and taxanes, such as for example taxole. The
adenoviruses disclosed herein, in particular the recombinant
adenoviruses, which are only capable of replicating in YB-1
nucleus-positive cells, are limited in their capability to
transactivate the viral genes E1B-55K, E4orf6, E4orf3 and E3ADP,
compared to the corresponding transactivating capabilities of
wildtype adenoviruses, in particular wildtype Ad5. The present
inventor has now surprisingly found that these limited
transactivating capabilities may be compensated by the
corresponding genes and in particular by E1B-55K and E4orf6 being
expressed in combination with the nuclear localisation of YB-1. As
shown in the examples herein, viral replication and particle
formation, respectively, is increased under such conditions to a
level which is nearly comparable to the replication and particle
formation behaviour of wildtype adenoviruses.
[0163] It is intended that the medicament in connection with which
or for the manufacture of which the adenoviruses described herein
are used in accordance with the present invention, is usually
applied systematically, although it is also within the present
invention to apply or deliver such medicament locally. The
application is done with the intention that particularly those
cells are infected with the adenovirus and that particularly in
these cells replication occurs, which are involved, preferably in a
causal manner, in the formation of a condition, typically a
disease, for the diagnosis and/or prevention and/or treatment of
which the medicament according to the present invention is
used.
[0164] Such a medicament is preferably for the treatment of tumor
diseases. Among the tumor diseases, those are particularly
preferred in which either YB-1 is already located in the nucleus
due to the mechanism underlying the tumor disease, in particular
the underlying pathological mechanism, or those where the presence
of YB-1 in the nucleus is caused by exogenous measures, whereby the
measures are suitable to transfer YB-1 into the nucleus, induce
YB-1 there or to express YB-1 there. The term tumor or tumor
disease as used herein shall comprise both malignant as well as
benign tumors and respective diseases. It can be intended that the
medicament comprises at least one further pharmaceutically active
compound. The kind and the amount of such further pharmaceutically
active compound will depend on the indication for which the
medicament is to be used. In case the medicament is used for the
treatment and/or prevention of tumor diseases, typically
cytostatics, such as for example cis-platin and taxol,
daunoblastin, daunorubicin, adriamycin (doxorubicin) and/or
mitoxantron or others of the cytostatics or groups of cytostatics
which are described herein, are used.
[0165] The medicament according to the present invention can be
present in various formulations, preferably in a liquid form.
Furthermore, the medicament will contain stabilisers, buffers,
preservatives and such agents which are known to the one skilled in
the art of pharmaceutical formulations.
[0166] The present inventor has surprisingly found that the use in
accordance with the invention of the viruses described herein can
be applied with a very high success rate to tumors which have YB-1
in the nucleus independent from the cell cycle. Normally, YB-1 is
located in the cytoplasm, in particular also in the perinuclear
plasma. During S-phase of the cell cycle, YB-1 can be found in the
cell nucleus of both normal cells as well as tumor cells. This,
however, is not sufficient to provide for viral oncolysis using
thus modified adenoviruses. The comparatively little efficacy of
such attenuated adenoviruses described in the prior art is
ultimately based on their wrong application. In other words, such
adenoviral systems can be used, particularly also with an increased
efficacy, where the molecular biological prerequisites for viral
oncolysis are given when the attenuated or modified viruses as
described herein, are administered. In case of the described
adenoviruses which are to be used in accordance with the invention
as described herein, such as Ad.DELTA.24, dl922-947, E1Ad/01/07,
CB016, dl520 and the recombinant adenoviruses described in European
patent EP 0 931 830, the prerequisites are given in case of tumor
diseases the cells of which show a nuclear localisation of YB-1
independent of the cell cycle. This form of nuclear localisation
may be either caused by the kind of tumor itself or may be caused
by the measures or agents in accordance with the invention which
are described herein. The present invention thus defines a new
group of tumors and tumor diseases, respectively, and thus also of
patients, which can still be treated successfully with the viruses
in accordance with the invention, particularly also with the
attenuated or modified adenoviruses already described in the prior
art.
[0167] A further group of patients which can be treated in
accordance with the present invention using the adenoviruses, some
of which are known and which can be used in accordance with the
present invention, or using the adenoviruses which are described
herein for the first time, in particular using such adenoviruses
which have mutations and deletions, respectively, in the E1A
protein which do not interfere with the binding of Rb/E2f, but
which do not replicate in YB-1 nucleus-negative cells or which have
and show, respectively, a strongly reduced replication as defined
herein, and/or a deleted oncoprotein, particularly E1A, such as,
for example, the viruses Ad.DELTA.24, dl922-947, E1Ad/01/07, CB106
and the adenoviruses described in European patent EP 0 931 830, are
those patients for which it is ensured that by applying or
realising distinct conditions YB-1 is migrating into the nucleus or
is induced there or is transported therein. The use of such
adenoviruses in connection with this group of patients is based on
the finding that the induction of viral replication is based on the
nuclear localisation of YB-1 with subsequent binding of YB-1 to the
E2-late promoter. Due to the findings disclosed herein adenoviruses
such as Ad.DELTA.24, dl922-947, E1Ad/01/07, CB106 and/or the
adenoviruses described in European patent EP 0 931 830 may also
replicate in cells which are YB-1 nucleus-positive and/or in cells
in which YB-1 is deregulated as defined in the present invention.
Insofar, these adenoviruses can, according to the present
invention, be used for the treatment of diseases and groups of
patients, respectively, which/who comprise cells having these
characteristics, particularly when these cells are involved in the
formation of the respective disease to be treated. This is the
basis for the success of Ad.DELTA.24, dl922-947, E1Ad/01/07, CB016
and the adenoviruses described in patent EP 0 931 830 for the
treatment of such tumors, in accordance with the present invention,
which have YB-1 in the nucleus independent of the cell cycle or in
which YB-1 is deregulated in the sense of the present disclosure. A
further group of patients which can be treated in accordance with
the invention using the adenoviruses which are described herein as
being usable in accordance with the invention, and using those
viruses, in particular adenoviruses, which are described herein for
the first time, are those which are YB-1 nucleus-positive and/or
which are YB-1 nucleus-positive as a result of the treatments
described in the following, whereby such treatment is preferably a
medical treatment, and/or those patients which have undergone such
treatment concomitantly with the administration of respective
viruses. It is within the present invention that YB-1
nucleus-positive patients are patients which have YB-1 in the
nucleus independent from the cell cycle in a number of cells
forming a tumor. Among these treatments is the administration of
cytostatics as described herein altogether and/or as used in a
tumor therapy. Additionally, radiation, preferably radiation as
used in a tumor therapy, belongs to this group of treatments.
Radiation means in particular radiation with high energy radiation,
preferably radioactive radiation, preferably as used in tumor
therapy. Hyperthermia and the application of hyperthermia,
preferably hyperthermia as used in tumor therapy, are further
treatments. In a particularly preferred embodiment hyperthermia is
applied locally. Finally, hormon treatment, particularly hormon
treatment as used in tumor therapy, is a further treatment. In
connection with such hormon treatment anti-estrogens and/or
anti-androgens are used. Anti-estrogens such as tamoxifene,
particularly in the therapy of breast cancer, and anti-androgens
such as for example flutamide or cyproterone acetate, are used in
the therapy of prostate cancer.
[0168] It is within the present invention that some of the cells
forming the tumor comprise YB-1 either inherently or after
induction and active introduction into the nucleus, respectively,
or comprise deregulated YB-1 in the sense of the present
disclosure. Preferably, about 5% or any percentage above, i. e. 6%,
7%, 8% etc. of the tumor forming cells are such YB-1
nucleus-positive cells or cells in which YB-1 is present in a
deregulated manner. Nuclear localisation of YB-1 can be induced by
stress applied from outside and by locally applied stress,
respectively. This induction can, for example, occur by means of
radiation, in particular UV radiation, application of cytostatics,
as, among others, already disclosed herein, and hyperthermia. In
connection with hyperthermia it is essential that it can be
realised now in a very specific manner, more particularly in a
locally very specific manner, and may thus also provide for a
specific nuclear localisation of YB-1 in the cell nucleus and,
because of this, provide the prerequisites for a replication of the
adenovirus and thus for cell and tumor lysis, which is preferably
locally limited (Stein U, Jurchott K, Walther W, Bergmann S, Schlag
P M, Royer H D. J Biol Chem. 2001,276(30):28562-9; Hu Z, Jin S,
Scotto K W. J Biol Chem. 2000 Jan. 28; 275(4):2979-85; Ohga T,
Uchiumi T, Makino Y, Koike K, Wada M, Kuwano M, Kohno K. J Biol
Chem. 1998, 273(11):5997-6000).
[0169] The medicament according to the present invention could thus
also be administered to patients and groups of patients, or may be
intended for them, where through appropriate pretreatment or
concomitant treatment a transport of YB-1 is affected, preferably
in the respective tumor cells.
[0170] Based on this technical teaching it is for the person of the
art within his skills to perform suitable modifications
particularly on E1A which, for example, may comprise deletions or
point mutations in order to thus generate various embodiments of
the adenoviruses, which may be used in connection with the use in
accordance with the invention.
[0171] As has already been explained above, the adenoviruses which
are used in accordance with the present invention, are capable of
replicating in such cells and cellular systems, respectively, which
have YB-1 in the nucleus. For answering the question whether the
adenoviruses used in accordance with the present invention are able
to replicate and are thus able to lyse the tumor, the status of the
cells with regard to the presence or absence of Rb, i. e. the
retinoblastome tumor suppressor product, is irrelevant.
Additionally, it is in connection with the use in accordance with
the invention of said adenoviruses, not essential to take into
consideration the p53 status of the infected cells, the cells to be
infected or the cells to be treated, as by using the adenoviral
systems as disclosed herein in connection with YB-1
nucleus-positive cells, i. e. cells which have YB-1 in the nucleus
irrespective of the cell cycle, this p53 status as well as the Rb
status do not have an impact on the performance of the technical
teaching disclosed herein.
[0172] The oncogene and oncogene protein, respectively, in
particular E1A, can be either under the control of the proprietor
natural adenoviral promoters and/or be controlled by means of a
tumor or tissue specific promoter. Suitable non-adenoviral
promoters can be selected from the group comprising cytomegalovirus
promoter, RSV (Rous sarcoma virus) promoter, adenovirus-based
promoter Va I and the non-viral YB-1 promoter (Makino Y. et al.,
Nucleic Acids Res. 1996, 15, 1873-1878). Further promoters which
can be used in connection with each and any aspect of the invention
disclosed herein, comprise the telomerase promoter, the
alpha-fetoprotein (AFP) promoter, the caecinoembryonic antigen
promoter (CEA) (Cao, G., Kuriyama, S., Gao, J., Mitoro, A., Cui,
L., Nakatani, T., Zhang, X., Kikukawa, M., Pan, X., Fukui, H., Qi,
Z. Int. J. Cancer, 78, 242-247, 1998), the L-plastin promoter
(Chung, I., Schwartz, P E., Crystal, RC., Pizzorno, G, Leavitt, J.,
Deisseroth, A B. Cancer Gene Therapy, 6, 99-106, 1999), the
arginine vasopressin promoter (Coulson, J M, Staley, J., Woll, P J.
British J. Cancer, 80, 1935-1944, 1999), the E2f promoter (Tsukada
et al. Cancer Res., 62, 3428 -3477), the uroplakine II promoter
(Zhang et al., Cancer Res., 62, 3743-3750, 2002) and the PSA
promoter (Hallenbeck P L, Chang, Y N, Hay, C, Golightly, D.,
Stewart, D., Lin, J., Phipps, S., Chiang, Y L. Human Gene Therapy,
10, 1721-1733, 1999). Furthermore, the YB-1 dependent E2-late
promoter of adenoviruses as described in German patent application
DE 101 50 984.7, is a promoter which can be used in the present
invention.
[0173] It is known that the telomerase promoter is of crucial
importance in human cells. Accordingly, telomerase activity is
regulated through transcriptional control of the telomerase reverse
transcriptase gene (hTERT), which is the catalytic subunit of the
enzyme. The expression of the telomerase is active in 85% of human
tumor cells. In contrast thereto, it is not active in most of the
normal cells. Exempt therefrom are germ cells and embryonic tissue
(Braunstein, I. et al., Cancer Research, 61, 5529-5536, 2001;
Majumdar, A. S. et al., Gene Therapy 8, 568-578, 2001). More
detailed studies on the hTERT promoter have revealed that fragments
of the promoters 283 bp and 82 bp, respectively, distant from the
initiation codon are sufficient for specific expression in tumor
cells (Braunstein I. et al.; Majumdar A S et al., supra).
Therefore, this promoter and the specific fragments, respectively,
are suitable to provide for a specific expression of a gene and
particularly of a transgene, preferably one of the transgenes
disclosed herein, in tumor cells only. The promoter shall allow the
expression of the modified oncogene, preferably the E1A oncogene
protein, in tumor cells only. Also, in a preferred embodiment, the
expression of a transgene, particularly one which is selected from
the group comprising E4orf6, E1B 55 kD, ADP and YB-1, in such
adenoviral vector is under the control of any of these promoters.
It is also within the present invention that the open reading frame
of the transactivating oncogene protein, in particular of the E1A
protein, is in frame with one or several of the gene products of
the adenoviral system. The open reading frame of the
transactivating E1A protein, however, can also be independent
therefrom.
[0174] The various transgenes, thus also E1B 55 kD, E4orf6, ADP and
the like, in particular if they are viral genes, can, in principle,
be cloned from any respective virus, preferably adenovirus and more
preferably adenovirus AdS. In the prior art furthermore a multitude
of plasmids is described which contain respective genes and from
which these may subsequently be taken and introduced into the
adenoviruses of the present invention as well as into the viruses
used in accordance with the present invention. An example for such
a plasmid which expresses E1B 55 kD, is, for example, described by
Dobbelstein, M. et al., EMBO Journal, 16, 4276-4284, 1997. The
coding region of the E1B 55K gene can be excised together with the
3' non-translating region (the 3'UTR region is preferably located
at the base position 3507-4107 within the adenoviral wildtype
genome), for example from this gene by Bam HI from plasmid pDCRE1B.
The corresponding fragment comprising the E1B 55 kD gene as well as
the 3' non-coding region corresponds to nucleotides 2019-4107 of
adenovirus type 5. It is, however, also within the present
invention that the E1B 55 kD gene is excised by means of
restriction enzyme Bam HI and BfrI and XbaI, respectively, from
said plasmid and is subsequently cloned into the adenovirus. It is
also within the present invention that also analogs thereof and in
particular analogs of the 3'UTR region are used within the present
invention. An analog to the 3'UTR region is any sequence which has
the same effect as the 3'UTR region, in particular the same effect
in relation to the expression of a gene, preferably the E1B 55 kD
gene. Such analogs may be determined by the one skilled in the art
by means of routine experiments, for example by extending and
truncating the 3'UTR region by one or several nucleotides and
subsequently testing whether the thus obtained analog still has the
same effect as the 3'UTR region as described above. In an
embodiment the term 3'UTR region thus also comprises any
analog.
[0175] It is within the present invention that, if not indicated to
the contrary, in case it is referred to viruses of the present
invention it is referred to both the nucleic acid coding therefore
as well as the adenoviral particles, preferably including the
respective nucleic acid. The respective nucleic acid may also be
present as being integrated in a different vector.
[0176] It is intended that with regard to the characteristics of
the cells for the lysis of which the adenoviruses described herein
are used in accordance with the present invention, these are, in an
embodiment, resistant, preferably have a multidrug or multiple
resistance. Resistance as used herein, refers preferably to a
resistance against the cytostatics described herein. This multidrug
resistance preferably goes along with the expression, preferably an
overexpression, of the membrane-bound transport protein
P-glycoprotein which can be used as a marker for determining
respective cells and can thus also be used for tumors and
respective groups of patients having such multidrug resistance. The
term resistance as used herein comprises both the P-glycoprotein
mediated resistance which is also referred to as classical
resistance, as well as atypical resistance which comprises
resistance which is mediated through MRP, or other,
non-P-glycoprotein mediated resistances. A further marker, which
correlates with the expression of YB-1, is topoisomerase II alpha.
Insofar, in a screening for determining whether a patient may be
treated with an expectation of success using the adenoviruses in
accordance with the present invention, expression of topoisomerase
II alpha can be used instead of or in addition to the determination
of YB-1 in the nucleus. A further marker which can basically be
used in a manner similar as P-glycoprotein, is MRP. A further
marker, at least to the extent that the colorectal carcinoma cells
or patients with colorectal carcinoma are concerned, is PCNA (engl.
proliferating cell nuclear antigen) (Hasan S. et al., Nature, 15,
387-391, 2001), as, for example, described by Shibao K. et al.
(Shibao K et al., Int. Cancer, 83, 732-737, 1999). Finally, the
expression of MDR (multiple drug resistance) is a marker in the
aforedescribed sense (Oda Y et al., Clin. Cancer Res., 4,
2273-2277, 1998), at least for breast cancer cells and osteosarcoma
cells. A further possible marker, which can be used in accordance
with the present invention, is p73 (Kamiya, M., Nakazatp, Y., J
Neurooncology 59, 143-149 (2002); Stiewe et al., J. Biol. Chem.,
278, 14230-14236, 2003).
[0177] It is thus a particular advantage of the present invention
that also patients can be treated using the adenoviruses in
accordance with the present invention, as described herein, which
are otherwise deemed as being no longer treatable in the clinical
sense and where a further treatment of the tumor disease according
to the methods of the prior art is no longer possible with a
reasonable expectation of success, in particular where the use of
cytostatics is no longer reasonably possible and can no longer be
successfully performed in the sense of influencing or reducing the
tumor. The term tumor refers herein in general to each and any
tumor or cancer disease which either contains YB-1 in the nucleus
inherently or contains YB-1 in the nucleus, preferably independent
from the cell cycle, as a consequence of realising exogenous
measures as described herein.
[0178] Additionally, the viruses described herein can, in
principle, be used for the treatment of tumors.
[0179] The tumours which can in particular be treated by the
viruses described herein are preferably those tumours which are
selected from the group comprising tumours of the nervous system,
ocular tumours, tumours of the skin, tumours of the soft tissue,
gastrointestinal tumours, tumours of the respiratory system, tumour
of the skeleton, tumours of the endocrine system, tumours of the
female genital system, tumours of a mammary gland, tumours of the
male genital system, tumours of the urinary outflow system, tumours
of the haematopoietic system including mixed and embryonic tumours.
It is within the present invention that these tumours are in
particular resistant tumours as in particular defined herein.
[0180] The group of tumors of the nervous system preferably
comprises: [0181] 1. Tumors of the skull as well as of the brain
(intracranial), preferably astrocytoma, oligodendroglioma,
meningioma, neuroblastoma, ganglioneuroma, ependymoma,
schwannoglioma, neurofibroma, haemangioblastoma, lipoma,
craniopharyngioma, teratoma and chordoma; [0182] 2. Tumors of the
spinal cord and of the vertebral canal, preferably glioblastoma,
meningioma, neuroblastoma, neurofibroma, osteosarcoma,
chondrosarcoma, haemangiosarcoma, fibrosarcoma and multiple
myeloma; and [0183] 3. Tumors of the peripheral nerves, preferably
schwannoglioma, neurofibroma, neurofibrosarcoma and perineural
fibroblastoma.
[0184] The group of the ocular tumors preferably comprises: [0185]
1. Tumors of the eyelids and of the lid glands, preferably adenoma,
adenocarcinoma, papilloma, histiocytoma, mast cell tumor,
basal-cell tumor, melanoma, squamous-cell carcinoma, fibroma and
fibrosarcoma; [0186] 2. Tumors of the conjunctiva and of the
nictitating membrane, preferably squamous-cell carcinoma,
haemangioma, haemangiosarcoma, adenoma, adenocarcinoma,
fibrosarcoma, melanoma and papilloma; and [0187] 3. Tumors of the
orbita, the optic nerve and of the eyeball, preferably
retinoblastoma, osteosarcoma, mast cell tumor, meningioma,
reticular cell tumor, glioma, schwannoglioma, chondroma,
adenocarcinoma, squamous-cell carcinoma, plasma cell tumor,
lymphoma, rhabdomyosarcoma and melanoma.
[0188] The group of skin tumors preferably comprises: [0189] Tumors
of the histiocytoma, lipoma, fibrosarcoma, fibroma, mast cell
tumor, malignant melanoma, papilloma, basal-cell tumor,
keratoacanthoma, haemangiopericytoma, tumors of the hair follicles,
tumors of the sweat glands, tumors of the sebaceous glands,
haemangioma, haemangiosarcoma, lipoma, liposarcoma, malignant
fibrous histiocytoma, plasmacytoma and lymphangioma.
[0190] The group of tumors of the soft-tissues preferably
comprises: [0191] Tumors of the alveolar soft-tissue sarcoma,
epithelioid cell sarcoma, chondrosarcoma of the soft-tissue,
osteosarcoma of the soft-tissues, Ewing's sarcoma of the
soft-tissues, primitive neuroectodermal tumors (PNET),
fibrosarcoma, fibroma, leiomyosarcoma, leiomyoma, liposarcoma,
malignant fibrous histiocytoma, malignant haemangiopericytoma,
haemangioma, haemangiosarcoma, malignant mesenchymoma, malignant
peripheral nerve sheath tumor (MPNST, malignant schwannoglioma,
malignant melanocytic schwannoglioma, rhabdomyosarcoma, synovial
sarcoma, lymphangioma and lymphangiosarcoma.
[0192] The group of gastrointestinal tumors preferably comprises:
[0193] 1. Tumors of the oral cavity and of the tongue, preferably
squamous-cell carcinoma, fibrosarcoma, Merkel cell tumor, inductive
fibroameloblastoma, fibroma, fibrosarcoma, viral papillomatosis,
idiopathic papillomatosis, nasopharyngeal polyps, leiomyosarcoma,
myoblastoma and mast cell tumor; [0194] 2. Tumors of the salivary
glands, preferably adenocarcinoma; [0195] 3. Tumors of the
oesophagus, preferably squamous-cell carcinoma, leiomyosarcoma,
fibrosarcoma, osteosarcoma, Barrett carcinoma and paraoesophageal
tumors; [0196] 4. Tumors of the exocrine pancreas, preferably
adenocarcinoma; and [0197] 5. Tumors of the stomach, preferably
adenocarcinoma, leiomyoma, leiomyosarcoma and fibrosarcoma.
[0198] The group of the tumors of the respiratory system preferably
comprises: [0199] 1. Tumors of the nose and nasal cavity, of the
larynx and of the trachea, preferably squamous-cell carcinoma,
fibrosarcoma, fibroma, lymphosarcoma, lymphoma, haemangioma,
haemangiosarcoma, melanoma, mast cell tumor, osteosarcoma,
chondrosarcoma, oncocytoma (rhabdomyoma), adenocarcinoma and
myoblastoma; and [0200] 2. Tumors of the lung, preferably
squamous-cell carcinoma, fibrosarcoma, fibroma, lymphosarcoma,
lymphoma, haemangioma, haemangiosarcoma, melanoma, mast cell tumor,
osteosarcoma, chondrosarcoma, oncocytoma (rhabdomyoma),
adenocarcinoma, myoblastoma, small-cell carcinoma, non-small cell
carcinoma, bronchial adenocarcinoma, bronchoalveolar adenocarcinoma
and alveolar adenocarcinoma.
[0201] The group of the skeleton tumors preferably comprises:
[0202] osteosarcoma, chondrosarcoma, parosteal osteosarcoma,
haemangiosarcoma, synovial cell sarcoma, haemangiosarcoma,
fibrosarcoma, malignant mesenchymoma, giant-cell tumor, osteoma and
multilobular osteoma.
[0203] The group of the tumors of the endocrine system preferably
comprises: [0204] 1. Tumors of the thyroid gland/parathyroid,
preferably adenoma and adenocarcinoma; [0205] 2. Tumors of the
suprarenal gland, preferably adenoma, adenocarcinoma and
pheochromocytoma (medullosuprarenoma); [0206] 3. Tumors of the
hypothalamus/hypophysis, preferably adenoma and adenocarcinoma;
[0207] 4. Tumors of the endocrine pancreas, preferably insulinoma
(beta cell tumor, APUDom) and Zollinger-Ellison syndrome (gastrin
secernent tumor of the delta cells of the pancreas); and [0208] 5.
as well as multiple endocrine neoplasias (MEN) and
chemodectoma.
[0209] The group of the tumors of the female sexual system tumors
preferably comprises: [0210] 1. Tumors of the ovaries, preferably
adenoma, adenocarcinoma, cystadenoma, and undifferentiated
carcinoma; [0211] 2. Tumors of the uterine, preferably leiomyoma,
leiomyosarcoma, adenoma, adenocarcinoma, fibroma, fibrosarcoma and
lipoma; [0212] 3. Tumors of the cervix, preferably adenocarcinoma,
adenoma, leiomyosarcoma and leiomyoma; [0213] 4. Tumors of the
vagina and vulva, preferably leiomyoma, leiomyosarcoma,
fibroleiomyoma, fibroma, fibrosarcoma, polyps and squamous-cell
carcinoma.
[0214] The group of tumors of the mammary glands preferably
comprises: [0215] fibroadenoma, adenoma, adenocarcinoma,
mesenchymal tumora, carcinoma, carcinosarcoma.
[0216] The group of the tumors of the male sexual system preferably
comprises: [0217] 1. Tumors of the testicles, preferably seminoma,
interstitial-cell tumor and Sertoli cell tumor; [0218] 2. Tumors of
the prostate, preferably adenocarcinoma, undifferentiated
carcinoma, squamous-cell carcinoma, leiomyosarcoma and transitional
cell carcinoma; and [0219] 3. Tumors of the penis and the external
gentials, preferably mast cell tumor and squamous-cell
carcinoma.
[0220] The group of tumors of the urinary outflow system preferably
comprises: [0221] 1. Tumors of the kidney, preferably
adenocarcinoma, transitional cell carcinoma (epithelial tumors),
fibrosarcoma, chondrosarcoma (mesenchymal tumors), Wilm's tumor,
nephroblastoma and embryonal nephroma (embryonal pluripotent
blastoma); [0222] 2. Tumors of the ureter, preferably leiomyoma,
leiomyosarcoma, fibropapilloma, transitional cell carcinoma; [0223]
3. Tumors of the urinary bladder, preferably transitional cell
carcinoma, squamous-cell carcinoma, adenocarcinoma, botryoid
(embryonal rhabdomyosarcoma), fibroma, fibrosarcoma, leiomyoma,
leiomyosarcoma, papilloma and haemangiosarcoma; and [0224] 4.
Tumors of the urethra, preferably transitional cell carcinoma,
squamous-cell carcinoma and leiomyosarcoma.
[0225] The group of tumors of the haematopoietic system preferably
comprises: [0226] 1. Lymphoma, lymphatic leukemia, non-lymphactic
leukemia, myeloproliferative leukemia, Hodgkin's lymphoma,
Non-Hodgkin's lymphoma.
[0227] The group of the mixed and embryonal tumors preferably
comprises: [0228] Haemangiosarcoma, thymoma and mesothelioma.
[0229] Preferably, these tumors are selected from the group
comprising breast cancer, ovary carcinoma, prostate carcinoma,
osteosarcoma, glioblastoma, melanoma, small-cell lung carcinoma and
colorectal carcinoma. Further tumors are those which are resistant
as described herein, preferably those which are multiple resistant,
particularly also those tumors of the group described above.
[0230] The invention is related in a further aspect to a method for
the screening of patients which can be treated using one of the
modified adenoviruses, i. e. an adenovirus as used in accordance
with the present invention such as, for example, Ad.DELTA.24,
dl922-947, E1Ad/01/07, CB016 or the viruses described in European
patent EP 0 931 830, whereby such method comprises the following
steps:
[0231] examining a sample of a tumor tissue and
[0232] determining whether YB-1 is located in the nucleus
independent from the cell cycle.
[0233] The presence of the afore-described markers can be detected
instead of or in addition to YB-1.
[0234] In case that the tumor tissue or a part thereof comprise
YB-1 in the nucleus, in particular independent from cell cycle, the
adenoviruses disclosed therein, can be used in accordance with the
practice of the present invention.
[0235] In an embodiment of the method according to the present
invention the examination of the tumor tissue is done by using an
agent which is selected from the group comprising antibodies
against YB-1, aptamers against YB-1 and spiegelmers against YB-1 as
well as anticalines against YB-1. Basically, the same means can be
produced for the corresponding markers and used accordingly. The
manufacture of antibodies, in particular monoclonal antibodies, is
known to the ones skilled in the art. A further means for specific
detection of YB-1 or the markers, are peptides which bind with a
high affinity to the target structures, in the present case YB-1 or
said markers. In the prior art methods are known such as
phage-display in order to generate such peptides. Typically, a
peptide library is taken as a starting point, whereby individual
peptides have a length of from 8 to 20 amino acids and the size of
the library is about 10.sup.2 to 10.sup.18, preferably 10.sup.8 to
10.sup.15 different peptides. A special form of target molecule
binding polypeptides are the so-called anticalines which are, for
example, described in German patent application DE 197 42 706.
[0236] A further means for specific binding of YB-1 or the
corresponding markers disclosed herein and thus for the detection
of cell cyclus independent localisation of YB-1 in the cellular
nucleus, are the so-called aptamers, i.e. D-nucleic acids which are
present either as RNA or DNA either as a single strand or a double
strand and specifically bind to the target molecule. The generation
of aptamers is, for example, described in European patent EP 0 533
838. A special form of aptamers are the so-called aptazymes, which,
for example, are described by Piganeau, N. et al. (2000), Angew.
Chem. Int. Ed., 39, no. 29, pages 4369-4373. These are special
embodiments of aptamers insofar as they comprise apart from the
aptamer part a ribozyme part and get catalytically active upon
binding or release of the target molecule binding to the aptamer
part and cleave a nucleic acid substrate which goes along with the
generation of a signal.
[0237] A further form of aptamers are the so-called spiegelmers, i.
e. target molecule binding nucleic acids which are made of
L-nucleic acids. The method for the manufacture of such spiegelmers
is, for example, described in WO 98/08856.
[0238] The sample of the tumor tissue can be obtained by puncture
or through surgery. The assessment whether YB-1 is localised in the
nucleus independent from the cell cycle, is frequently done by
using microscopic techniques and/or immuno histoanalysis,
preferably using the antibody or any of the other aforementioned
means. Further means for detecting YB-1 in the nucleus and in
particular for detecting that YB-1 is located there independent
from the cell cycle, are known to the one skilled in the art. For
example, the localisation of YB-1 can be easily detected in stained
tissue sections when screening them. The frequency of the presence
of YB-1 in the nucleus already indicates that the localisation is
independent from the cell cycle. A further option for cell cycle
independent detection of YB-1 in the nucleus resides in the
staining against YB-1 and detection whether YB-1 is localised in
the nucleus and determination of the phase of the cells. This as
well as the detection of YB-1 may also be performed by using the
aforementioned means directed against YB-1. The detection of the
means is done by methods known to the one skilled in the art. By
said agents specifically binding to YB-1 and not to any other
structures within the sample to be analysed, particularly the
cells, their localisation and because of their specific binding to
YB-1 also the localisation of YB-1 can be detected and established
by a suitable labelling of the means. Methods for the labelling of
said means are known to the ones skilled in the art.
[0239] It is within the present invention that the viruses
described herein, whether they are the viruses of the present
invention or whether they are the viruses to be used in accordance
with the present invention, are also used in connection with
diseases, preferably tumor diseases and more preferably tumor
diseases where at least a part of the tumor cells exhibits a
multiple resistance, in particular a multi-drug resistance, in
which YB1 is deregulated. This applies also to each and any other
aspect as described herein in connection with the cells and tumors
to the extent that it refers to cells and diseases where YB1 is
present in the nucleus, preferably independent of the cell
cycle.
[0240] In the following, the present invention shall be further
illustrated by reference to the figures and samples from which new
features, embodiments and advantages may be taken.
[0241] FIG. 1 shows the structural design of the adenoviral vectors
referred to as AdE1/E3-minus herein which are E1/E3-deleted
adenoviruses, of wildtype adenovirus and adenovirus dl520.
[0242] FIG. 2 shows the binding domains of the E1A protein with
regard to the binding of p300, p107 and p105.
[0243] FIG. 3 shows U2OS cells which do not have YB-1 in the
nucleus, after infection with the E1/E3-deleted adenoviruses Ad5,
referred to as E1/E3-minus Ad5, and dl520.
[0244] FIG. 4 shows 257RDB cells which have YB-1 in the nucleus,
after infection with the E1/E3-deleted adenoviruses Ad5, referred
to as E1/E3-minus Ad5, and adenovirus dl520.
[0245] FIG. 5 shows 257RDB cells and U2OS cells after infection
with adenovirus dl119/1131.
[0246] FIG. 6 shows the result of an EMSA analysis which confirms
that YB-1 is present in multidrug resistant cells and cell lines
257RDB, 181 RDB, MCF-7Ad, respectively, whereas YB-1 is not present
in the nucleus of U2OS and HeLa cells.
[0247] FIG. 7 shows the structural design of the E1A protein of
wildtype adenovirus, of adenovirus dl520 and adenovirus
dl1119/1131.
[0248] FIG. 8 is a column diagram showing the replication
efficiency of adenoviruses in the presence of additionally
expressed viral proteins in absolute figures.
[0249] FIG. 9 is a column diagram showing the increase of
replication efficiency of adenoviruses in the presence of
additionally expressed viral proteins.
[0250] FIG. 10 shows wells grown with U2OS cells after crystal
violet staining and infection with dl520 with 10 and 30 pfu/cell,
respectively, and control (K) without administration of
daunorubicine and with the administration of 40 ng daunorubicine
per ml, respectively.
[0251] FIG. 11 shows wells grown with HeLa cells, after crystal
violet staining and infection with dl520 and 10 and 30 pfu/cell and
control (K), respectively, without administration of daunorubicine
and administration of 40 ng daunorubicine per ml, respectively.
[0252] FIG. 12 is a diagram of the tumor volume of tumors having
different origins (RDB257 and HeLa) as a function of time after
treatment with PBS and dl520, respectively.
[0253] FIG. 13 show pictures of sacrificed mice which developed a
tumor based on RDB257 cells after treatment with PBS and
5.times.10.sup.8 pfu dl520, respectively.
[0254] FIG. 14 is the result of a Southern Blot analysis of a cell
extract (of the tumors grown subcutaneously) of RDB257 cells and
HeLa cells after infection with dl520.
[0255] FIG. 15 is a column diagram showing the replication
efficiency and particle formation, respectively, of dl520 and
wildtype adenoviruses in YB-1 nucleus-positive tumor cells (257RDB
and 181RDB) and YB-1 nucleus-negative tumor cells (HeLa, U2OS).
[0256] FIG. 16 shows the structural design of wildtype adenovirus
and adenoviral vector AdXvir03.
[0257] FIG. 17 shows the structural design of adenoviral vector
AdXvir03/01.
[0258] FIG. 18A/B shows wells grown with 181RDB cells (FIGS. 18A)
and 272RDB cells (FIG. 18B) after crystal violet staining and
infection with Ad312 (20 pfu/cell), Xvir03 (5 pfu/cell) and control
(non-infected), whereby crystal violet staining was performed five
days past infection.
[0259] FIG. 19 shows the result of a Southern blot analysis of the
replication behaviour of adenovirus dl 520 in U373 cells with and
without treatment of the cells with irinotecan.
[0260] FIG. 20 shows the result of a Southern blot analysis of the
replication behaviour of adenovirus dl 520 in U373 cells with and
without treatment of the cells with trichostatin A.
[0261] FIG. 21 shows the result of a FACS analysis of U 373 cells
treated with trichostatin with regard to the expression of
coxsackievirus-adenovirus receptor (CAR), represented as percentage
of CAR-positive cells.
[0262] FIG. 22 shows four different panels of cell layers for
illustrating the effect of replicating adenovirus dl 520 and
irinotecan and trichostatin in various combinations;
[0263] FIG. 23 shows a schematic representation of the ORF of E1B
55K with the 3'UTR fragment and the restriction cleavage site Bfr I
at position 3532.
[0264] FIG. 24 shows the sequence of the E1B 55 k 3'UTR region
corresponding to sequence position 3507 to 4174 of wildtype Ad
5.
EXAMPLE 1
Types of E1A modifications as May be Comprised by the Adenoviruses
Which are Used in Accordance With the Invention
[0265] FIG. 1 shows the structural design of adenoviral vectors
AdE1/E3-minus, i. e. E1/E3-deleted adenoviruses, wildtype
adenovirus and adenovirus dl520.
[0266] Adenovirus AdE1/E3-minus does not have a region coding for a
functional E1A or a functional E1B or E3 and is used in the present
experiments as a control for toxicity.
[0267] Wildtype E1A gene codes for a total of 5 proteins which are
generated through alternative splicing of the E1A RNA. Among
others, two different proteins are generated, namely a 289 amino
acid protein and a 243 amino acid protein. dl520 does not code for
the 289 amino acid protein as it has a deletion in the CR3 stretch
of the E1A gene which results in the lack of the 13S gene product.
The adenovirus dl520 which may be used in accordance with the
invention is referred to as 12S-E1A virus by those skilled in the
art. Adenovirus dl347 (Wong und Ziff, J. Virol., 68, 4910-4920,
1994) known in the prior art is also a 12S-E1A virus which can be
used in accordance with the present invention.
[0268] Within the 289 amino acid protein which is encoded by the
13S-E1A mRNA, there are 3 regions which are conserved among various
adenoviral subtypes. These are referred to as CR1, CR2 and CR3.
While CR1 and CR2 are present in both E1A proteins (E1A 12S and E1A
13S), i. e. in both the 289 amino acid and the 243 amino acid
protein, the CR3 region is only present in the bigger one of the
two aforementioned proteins.
[0269] The CR3 region is required for the activation of viral
genes, in particular of E1B, E2, E3 and E4. Viruses which only
comprise the smaller, i. e. 243 amino acid protein are only very
weakly transactivating the viral genes and do not promote
adenoviral replication in those cells which do not have YB-1 in the
nucleus. As YB-1 is present in the nucleus only in tumor cells and
can be detected only there, this vector is suitable to induce
tumor-specific replication.
[0270] Due to the deletion of CR3 in dl520 this adenovirus cannot
translocate cellular YB-1 into the cell's nucleus which is also
referred to herein as translocation, and is thus not in a position
to replicate in cells which are YB-1 nucleus-negative and is thus a
virus which can be used in accordance with the present invention,
whereby this virus comprises the transactivation required in
accordance with the present invention.
EXAMPLE 2
Mode of Action of Adenoviruses in Depending on the Rb Status of
Cells
[0271] FIG. 2 shows the binding domains of the E1A protein with
regard to the binding of p300, p107 and p105. P300, as well as
p107, is a cellular binding protein. The binding of the
retinoblastoma protein (pRb), a tumor suppressor protein, is
mediated through CR1 and CR2. Studies have shown that pRb and
p107/p300 are in combination with the cellular transcription factor
E2F effective in regulating transcription. The wildtype E1A protein
interferes with the binding of E2F to Rb. The thus released E2F
binds to the E2 early promoter and induces adenoviral replication
thereby.
[0272] It is known from the prior art that certain deletions in the
E1A oncoprotein may result in recombinant adenoviral vectors such
as those mentioned in the following, which are capable of
replicating predominantly in Rb-negative cells and can be used in
accordance with the present invention. For example, the adenoviral
vector dl922-947 comprises a deletion in the CR2 region (amino acid
positions 122-129) and the vector CB016 has deletions in the CR1
region (amino acid positions 27-80) and CR2 region (amino acid
positions 122-129). The vector E1Adl01/07 comprises a deletion in
the CR2 region (amino acid positions 111-123). Additionally,
because of an additional deletion at the N-terminus (amino acid
positions 4-25), additionally, there is no binding to protein p300.
The adenoviral vector Ad.DELTA.24 comprises a deletion in the CR2
region (amino acid positions 120-127). The adenoviral vector
described in patent EP 0 931 830 comprises deletions in the CR1
region and CR2 region.
[0273] The binding mechanism of E2F/RB and the release of E2F
mediated through E1A is fundamentally different from the mechanism
underlying the present invention. Unlike assumed in the prior art
it is not the release of E2F from the Rb protein which is
essential, not to say critical for viral replication, but it is the
nuclear localisation of the human transcription factor YB-1. This
transcription factor is, in normal cells, only present in the
cytoplasm over most of the cell cycle. After infection with an
adenovirus it is induced into the nucleus under certain
circumstances or is already present in the nucleus in distinct
cellular systems, such as distinct tumor diseases including, for
example, but not limited thereto, breast cancer, ovary carcinoma,
prostate carcinoma, osteosarcoma, glioblastoma, melanoma, small
cell lung carcinoma and colorectal carcinoma.
EXAMPLE 3
Infection of U2OS Cells
[0274] 100,000 U2OS cells were plated per well. On the next day the
cells were infected with the various adenoviruses as depicted in
FIG. 3. The infection was performed in 500 .mu.l serum free DMEM
medium at 37.degree. C. for 1 h. Subsequently, the infection medium
was removed and replaced by 2 ml complete medium (10% FCS/DMEM).
The analysis was performed after 3 days using crystal violet
staining.
[0275] As may be taken from FIG. 3, the U2OS cells which do not
have YB-1 in the nucleus, show no lysis as illustrated by crystal
violet staining after infection with two different adenoviruses,
namely the E1/E3-deleted adenovirus referred to as E1/E3-minus, and
adenovirus dl520, which can be used in accordance with the present
invention. In connection therewith, first, the medium is removed.
Subsequently, the cells are overlaid with crystal violet (50% ETOH,
3% formaldehyde, 5% acetic acid, 1% crystal violet) and incubated
at room temperature for 5-10 min. Subsequently, the plates having 6
wells are thoroughly rinsed with water and dried at room
temperature.
[0276] This confirms the finding underlying the present invention
that the presence of YB-1 is required in order to induce the
viruses used in accordance with the present invention, to lyse the
infected cells.
EXAMPLE 4
Infection of 257RDB Cells
[0277] 100,000 257RDB cells were plated per well. On the next day
the cells were infected with the various adenoviruses as depicted
in FIG. 4. The infection was performed in 500 .mu.l serum free DMEM
medium for 1 h at 37.degree. C. Subsequently, the infection medium
was removed and replaced by 2 ml complete medium (10% FCS/DMEM).
The analysis was performed after three days using crystal violet
staining.
[0278] The result of this experiment is depicted in FIG. 4. The
adenovirus referred to as E1/E3-minus Ad5 which is E1/E3-deleted,
did not show any lysis at low MOIs (pfu/cell) upon infection of
257RDB cells which have YB-1 in the nucleus. In contrast thereto,
dl520 which, as shown in example 3, does not replicate in YB-1
nucleus-negative cells and at the same time codes with E1A for a
transactivating oncogene protein in accordance with the present
invention, results in a factually complete lysis at an MOI
(multiplicity of infection) of 40 pfu per cell and a still
predominant lysis at an MOI of 10 pfu per cell. It can be concluded
therefrom that dl520 and similar viruses such as described herein
by dl1119/1131 or AdXvir 03, require an MOI which is reduced by
about 1 magnitude (factor of ten) compared to E1-deleted or an
E1/E3-deleted adenovirus which justifies their clinical use.
[0279] As depicted in FIG. 7, the protein E1A of dl520 is
characterised in that the CR3 region thereof is deleted which
results in the transactivation required for the use in accordance
with the present invention and replication in YB-1 nucleus-positive
cells.
EXAMPLE 5
Infection of 257RDB and U2OS Cells With dl1119/1131
[0280] As depicted in FIG. 5, there is no lysis at an MOI of 20 pfu
per cell upon infection of YB-1 nucleus-negative U2OS cells with
adenovirus dl1119/1131 which exhibits a deletion of amino acids
4-138 of the E1A protein and the nucleic acid coding therefor, and
further comprises a stop codon after amino acid 218, whereby the
expressed truncated E1A protein comprises the CR3 region of the
complete E1A protein. As a negative control a non-infected cell
layer was used.
[0281] In contrast thereto, there was factually a complete lysis of
the cell layer at an MOI of 20 pfu per cell under the influence of
adenovirus dl1119/1131 in a cellular system such as 257RDB which
contains YB-1 in the nucleus, i. e. is YB-1 nucleus-positive.
Insofar this example is another proof that a modified E1A oncogene
protein which, as depicted in FIG. 7, comprises, for example, only
the CR3 region and which is lacking the CR1 region and CR2 region,
provides for the required transactivation in YB-1 nucleus-positive
cells which is required for the replication of adenoviruses in
accordance with the present invention, which results in viral
replication. The adenovirus dl1119/1131 is thus a further
adenovirus which can be used in accordance with the present
invention. It is within the present invention that also viruses can
be used which are designed similar to dl1119/1131 with regard to
the CR3 region, but, in contrast thereto, have the CR1 region
and/or CR2 region.
EXAMPLE 6
Detection of Nuclear YB-1 in Multidrug Resistant Cells
[0282] The example is based on the consideration that nuclear YB-1
should bind as a transcription factor to the Y-box (CAAT sequence)
within the mdrl promoter (engl. multiple drug resistance promoter).
In order to detect this, a so-called EMSA analysis (electrophoretic
mobility shift assay) was performed. In connection therewith,
nuclear protein is isolated and subsequently 1-10 .mu.g protein is
incubated together with a short DNA fragment (oligo) at 37.degree.
C. In order to determine nuclear YB-1, the following
oligonucleotide was used: mdrl promoter in contrast to U2O3
(Position -86 to -7): TGAGGCTGATTGGCTGGGCA (the X-box is
underlined).
[0283] This DNA fragment is radioactively labelled at the 5' end
with .sup.32P prior to that. Subsequently, separation is performed
in a native polyacryl amide gel. In case the protein YB-1 is
binding to a sequence in the oligonucleotide, this can be detected
as any non-bound oligonucleotide is migrating faster in the gel
than bound oligonucleotide (Holm, P. S. et al., JBC 277,
10427-10434, 2002; Bargou, R. C. et al., Nature Medicine 3,
447-450, 1997).
[0284] As depicted in FIG. 6, it could be shown with the EMSA
analysis that YB-1 is present in the nucleus of multidrug resistant
cells 257RDB, 181RDB and MCF-7Ad cells in contrast to cell lines
U2OS and HeLa cells.
[0285] The results shown in example 4 and 5 confirm that the
adenoviruses dl520 and dl1119/1131 replicate in YB-1
nucleus-positive cells such as, e. g., 257RDB in contrast to U205,
and induce lysis thereof. This confirms the finding about the use
of the adenoviruses in accordance with the present invention.
Additionally, the results confirm that already a, compared to
wildtype adenovirus, weak transactivation of viral genes in YB-1
nucleus-positive cells through modified or deleted E1A gene
products results in successful replication and lysis of such cells
in the presence of YB-1 in the nucleus, including, for example,
multidrug resistant cells and that the adenoviruses as described
herein, can thus be used in the lysis of such tumors.
EXAMPLE 7
Increase of Replication Efficiency of E1-Minus Adenoviruses
[0286] This example shows that the early viral genes E1B-55K and
E4orf6 can be substituted through transfection with the plasmid
pE4orf6 and infection with the E1/E3-deleted adenovirus Ad-55K.
Ad-55K is an E1/E3 deleted virus, whereby E1B-55K is cloned into E1
and is under the control of CMV (Dobbelstein, M. et al., EMBO
Journal, 16, 4276-4284, 1997). This substitution is necessary with
regard to the fact that AdYB-1, i. e. an adenovirus which expresses
YB-1, does not express these early genes and that the present
inventor has recognised that a substitution of these early genes in
a replication system which contains YB-1 in the nucleus, is capable
of increasing replication efficiency and particle formation
efficiency, respectively, to an extent comparable to the one of
wildtype adenoviruses of type Ad5.
[0287] The following was done:
[0288] Transfection of each 10.sup.5 U2OS cells with the plasmid
pE4orf6 using lipofectamine. The plasmid pE4orf6 carries the DNA
sequence coding for the early viral gene E4orf6 under the control
of CMV.
[0289] 24 h after transfection with the plasmid pE4orf6 the cells
were infected with the YB-1 expressing E1/E3-deleted adenovirus
AdYB-1 (50 pfu/cell) and the E1/E3-deleted E1B-55K adenovirus
Ad-55K (50 pfu/cell). Ad-55K is an E1/E3-deleted virus which
carries as transgene the viral gene E1B-55K under CMV control.
[0290] Subsequently, the cells were removed from the medium (2 ml)
5 days after infection (=post infectionem). The release of the
viral particles from the isolated cells was done by alternating
freezing and thawing for three times (thaw/freeze). Subsequently, a
plaque assay was performed on 293 cells for determining the
generated infectious particles (plaque forming units per ml
(pfu/ml)). The result is depicted in FIGS. 8 and 9. FIGS. 8 shows
the result of the plaque assay, represented in absolute figures.
The most significant difference compared to infection with AdYB-1
alone is shown by transfection with the plasmid pE4orf6 and
co-infection with the two viruses AdYB-1 and Ad-55K. FIG. 9 shows
the result of FIG. 8, whereby the increase of the replication
efficiency is represented as multifold of the replication
determined for AdYB-1. The cells infected with plasmid pE4orf6 and
subsequently with AdYB-1 and E1B-55K (Ad-55K) produced up to 25
times more pfu/ml.
[0291] Based on these results it can be concluded that the
substitution of E1B-55K and E4orf6 increases the number of viruses
formed (pfu/ml) after infection with the E1/E3-deleted adenovirus
AdYB-1 by a factor of up to 25. The additive effects of E1B-55K and
E4orf6 on the production of plaque forming units (pfu) is
significantly higher compared to the effects of each of the two
gene products.
[0292] Control experiments with one plasmid which expresses EGFP,
clearly showed that in the experimental approach chosen only 10% of
the cells were successfully transfected with plasmid pE4orf6. The
number of the particles formed in the cells which express both
E1B-55K and E4orf6 is comparable to the one of human adenovirus
type 5 (wildtype). This confirms the finding underlying the present
invention that the expression of E4orf6 and E1B-55K is, in
combination with the nuclear localisation of YB-1, able to provide
for adenoviral replication and particle formation, in particular of
E1A-deleted adenoviruses, which is comparable to the one of
wildtype Ad5.
EXAMPLE 8
Increased Replication of Adenoviruses Which are Not Replicating in
YB-1 Nucleus-Negative Cells, in YB-1 Nucleus-Positive Cells Upon
Administration of Cytostatics
[0293] It is known in the prior art that the addition of different
cytostatics induces nuclear localisation of the human transcription
factor YB-1. As has been found by the present inventor, YB-1
localised in the nucleus controls adenoviral replication by means
of activation of the adenoviral E2-late promoter. The combination
of both effects can be used in order to provide for specific tumor
lysis.
[0294] In the practising of the oncolytic assays the following
procedure was followed: 200,000 cells (HeLa and U2OS, respectively)
were plated into each well of a 6 well plate. On the next day 40
ng/ml (final concentration) of daunorubicine were added. After 3
hours of incubation the cells were infected with 10 and 30 pfu
dl520/cell, respectively. Subsequently, the cells were incubated in
cytostatic free medium. After 3-5 days the cells were stained using
crystal violet.
[0295] As may be taken from FIGS. 10 and 11, the addition of
daunorubicine induces the replication of dl520 through nuclear
localisation of YB-1. Thus, dl520 creates a bigger tumorlytic
effect in combination with the cytostatic daunorubicine compared to
daunorubicine alone.
EXAMPLE 9
In Vivo Tumor Lysis by dl520
[0296] The HeLa (YB-1 nucleus-negative) and 257RDB (YB-1
nucleus-positive) cells used in this in vivo study, were expanded
under sterile cell culture conditions. Prior to the injection of
the cells into mice (strain CD1NuNu) in order to generate a
subcutaneous tumor, the cells are harvested by trypsinisation,
taken up in DMEM medium (10% FCS), counted and washed with PBS one
time. Subsequently, the cells are centrifuged, the PBS aspired and
the cells are portioned in fresh PBS with the desired cell number.
The cell number which was subcutaneously injected in this study,
was each 5.times.10.sup.6 cells of both cell lines. The injection
was performed subcutaneously into one flank of the animals, whereby
HeLa cells were injected into the right side and 257RDB cells were
injected into the left side for better distinction. The growth of
the tumors was controlled twice a week and thereby the length and
the width of the tumors was measured using vernier calipers. Based
thereon, the tumor volume was calculated based on the following
mathematical formula: 3/4.pi.*a/2*(b/2).sup.2 a=length, b=width
[0297] Once the tumor has reached a volume of 200 to 520 mm.sup.3,
the virus and PBS as negative control, respectively, were
intratumorally applied. The volumes to be injected were identical
and were 50 .mu.l each time. This was repeated on 3 consecutive
days. The overall dosage of applied viruses was 5.times.10.sup.8
pfu. Subsequently, the tumor growth was continued to be documented
twice a week and the volume was calculated. At the end of the study
the mice were sacrificed and the tumors removed for further
analysis.
[0298] The results are depicted in FIGS. 12 and 13.
[0299] FIG. 12 shows a diagram representing the tumor volume as a
function of time and the various treatment schemes. In case the
tumor was formed by RDB257, there was a significant growth of the
tumor to about 438 mm.sup.3 to 1466 mm.sup.3 upon injection of PBS.
Under the influence of the vector dl520 which was used in
accordance with the invention, tumor growth could be reduced
significantly. Starting from a mean tumor size of 344 mm.sup.3, the
tumor size increased only by 21% to a total of 543 mm.sup.3.
[0300] In the present example the tumor consisting of HeLa cells
was used as a control which upon administration of PBS behaved
similarly to the RDB257 based tumor upon administration of PBS.
Tumors based on HeLa cells and treated with dl520, however, still
showed a significant increase in tumor growth starting from 311
mm.sup.3 and increasing to 1954 mm.sup.3.
[0301] FIG. 13 shows a picture of the sacrificed nude mice which
had a tumor grown using RDB257. It can be clearly seen that after
the application of adenovirus dl520 in accordance with the present
invention a significant reduction of the tumor occurred. In the
present case there was even a reduction in the tumor volume (day 1
after administration of virus dl520: 515 mm.sup.3; day 30 after
administration of virus dl520: 350 mm.sup.3).
EXAMPLE 10
Southern Blot of Tumor DNA
[0302] DNA was extracted from a tumor sample which has been taken
from the middle of the tumor developed in example 9. For isolation
the Dneasy Tissue Kit of Qiagen is used. The DNA isolation is done
in accordance with manufacturer's instructions. In accordance
therewith, the DNA was released from the cells through alkaline
lysis. Subsequently, the isolated DNA is purified over a column.
Subsequently, the concentration of the isolated DNA is determined
by photometry at 260 nm. The analysis was performed using 2 .mu.g
of the DNA samples which were digested with 10 units of restriction
enzyme Kpn I. Subsequently, an electrophoretic separation of the
samples was performed in a 0.8% agarose gel. Subsequently, the DNA
was blotted onto a nylon membrane (performed according to the
system of Schleicher & Schuell). The DNA blotted onto the
membrane is hybridised against a specific 1501 bp DNA probe. The
1501 bp DNA probe specifically binds to the 3369 bp Kpn I fragment
within the E2A coding Ad5 sequence. The probe was prepared by PCR
(primer: 5'-GTC GGA GAT CAG ATC CGC GT, 5'-GAT CCT CGT CGT CTT CGC
TT) and radioactively labelled using .sup.32P. Subsequently, the
membrane is washed and exposed to a film.
[0303] The result of the Southern Blot of tumor DNA is depicted in
FIG. 14. The analysis confirms that only dl520 replicates in vitro
in resistant cells RDB257, as depicted in lanes 3, 4 and 5. Lane 1
shows as positive control Ad-5d, lane 6, 7 and 8 show DNA from HeLa
cells which were infected with dl520. As HeLa cells are not YB-1
nucleus positive the virus dl520 did not replicate so that, in
accordance therewith, the E2A sequence could not be detected.
[0304] A further result with dl520 is depicted in FIG. 15. Based on
a plaque assay the particle formation (pfu/ml) was investigated
after infection with dl520 and wildtype adenovirus. Various YB-1
nucleus-positive (257RDB and 181RDB) tumor cells and YB-1
nucleus-negative tumor cells were infected with dl520 and wildtype
adenovirus.
[0305] The following procedure was practiced:
[0306] 100,000-200,000 cells each were plated in so-called plates
having 6 wells (engl. 6 well plates) in L 15 medium (resistant
cells) and DMEM (non-resistant cells) having 10% FCS. After 24 h
infection with dl520 and wildtype adenoviruses (10 pfu/cell) was
performed. 3 days after infection (post infectionem) the viral
particles were released from the cell suspension (3 ml) by
alternating freezing and thawing for three times. Subsequently, a
plaque assay was performed on 293 cells for determining the formed
infectious particles (plaque forming units per ml (pfu/ml)). The
result is depicted in FIG. 15. The result of the plaque assay shows
that dl520 is replicating in YB-1 nucleus-positive cells (257RDB
and 181RDB) similar to wildtype adenovirus. Insofar a replication
efficiency can be observed similar to the one of wildtype
adenoviruses when using, in accordance with the present invention,
the adenoviruses described herein.
EXAMPLE 11
Structural Design of the Adenoviral Vector Xvir03
[0307] FIG. 16 shows the structural design of the adenoviral vector
Xvir03. The adenovirus Xvir03 is a so-called E1/E3-deleted
adenovirus. This means that no E1A, E1B (E1B 55 k and E1B 19K
proteins) and E3 proteins are manufactured which are functional in
adenoviral replication. The deletion of the E1 region extends from
342-3528; the deletion of the E3 region of the base position
27865-30995. As used herein, the term "El-deleted virus" means a
virus in which E1 is no longer functionally active. This can be
achieved by inactivation with an otherwise mostly intact nucleic
acid and amino acid sequence, respectively, however, can also mean
a deletion of the E1 region coding proteins having various sizes.
Because of the lack of the E1A and E1B protein and the nucleic
acids coding therefor, the E4 region, such as E4orf6, is only
weakly expressed (about 1-5% compared to wildtype adenoviruses) or
expressed not at all. The viral genes E1B 55 k and E4orf6 are
expressed in the E1 region by means of the heterologuous CMV
promoter (Clontech: Plasmid pShuttle) introduced into Xvir03.
Instead of the CMV promoter each and any of the promoters as
disclosed herein in connection with the expression of E1A can be
used. The open reading frames of both genes are linked with each
other by means of a so-called IRES sequence (engl. internal
ribosomal entry site) (Pelletier, J. and Sonenberg, N. Nature,
1988, 334, 320-325). This element (Novagen: pCITE) provides for the
expression of 2 proteins from one mRNA.
The Vector was Manufactured as Follows: System Adeno-X of the
Company Clontech
[0308] The plasmid E1B 55 k-pShuttle was created by cloning the
open reading frame of E1B 55 k from pCGNE1B from M. Dobelstein
(University of Marburg) with XbaI and BfrI and BamHI only,
respectively, into the pShuttle vector from Clontech, whereby in
this case the ends are made blunt ended and cloned into the blunt
ended pShuttle. Subsequently, E1B 55 k in pShuttle was linearised
with ApaI, the ends blunt ended and cut with NheI.
[0309] In a second vector, pcDNA3.1(+) (Invitrogen), subsequent to
each other, the IRES element as a PCR product was cloned with
pCITE-4a(+) of the company Novagen as template by means of TA
cloning into the EcoRV cleaving site, and the E4orf6 from the
plasmid pCMV-E4orf6 (M. Dobelstein, University of Marburg) was
cloned by means of BamHI=IRES-E4orf6-pcDNA3.1(+). IRES-E4orf6 in
pcDNA3.1(+) was linearised with NotI, the ends blunt ended and
subsequently the fragment IRES-E4orf6 was cut out with NheI. The
fragment IRES-E4orf6 was linked with the open vector E1B 55
k-pShuttle (blunt, NheI). The cassette was subsequently cloned from
the E1B 55 k-IRES-E4orf6-pShuttle together with the CMV promoter
and the bovine growth hormone (BGH)-PolyA into the .DELTA.E1,
.DELTA.E3 Adeno-X-Plasmid (Clontech) with I-Ceu I and PI-Scel, and
referred to as AdcmvE1B/IRES/E4orf6. Subsequently, the adenovirus
was prepared in accordance with manufacturer's instructions
(Clontech). The adeno plasmid which was linearised with PacI having
the expression element CMV-E1B 55 k-IRES-E4orf6-BGH polyA was
transfected into HEK293 cells and 11 days post transfectionem the
ablating cells were removed together with the medium in order to
release the generated adenoviruses through repeated freeze-thaw
cycles.
[0310] It is within the present invention and feasible for the one
skilled in the art with regard to the technical teaching provided
herein, that other systems such as the system AdEasy of QBIOGENE
and Microbix may be used for the manufacture of the adenoviruses
according to the present invention, preferably the recombinant
adenovirus, in particular those which contain, individually and/or
together, the cassettes E4orf6-IRES-E1B 55 k and YB-1-IRES-E1A12S.
Additionally, individual transgenes may be exchanged between the
cassettes. It is within the present invention that also such
adenoviruses can be manufactured and used in accordance with the
present invention, where the cassette has the following design: E1B
55 k-IRES-E4orf6 and E1A12S-IRES-YB1.
[0311] In connection with the present invention a so called E1/E3
deleted recombinant adenovirus was used which contains the cassette
E4orf6-IRES-E1B 55 k. It is, however, within an embodiment that the
virus comprises only an E1-deletion, which means that the E3-region
remains intact. Optionally, the E4-region may be partially and/or
completely deleted.
[0312] In the manufacture of the vector using different systems it
was proceeded as follows.
[0313] Manufacture of the adenovirus Ad-Xvir 3'UTR having an intact
E3-region with the vector system according to Graham (company
Microbix).
Cloning of the Vector CMV-E4ORF6-IRES-E1B 55 k 3'UTR-PolyA in
pDelta E1sp1A
[0314] For the plasmid E1B 55 k 3'UTR-pShuttle (Clontech) the open
reading frame having the 3'-UTR was prepared by amplification from
the DNA of adenovirus type 5 (E1B 55 k forward
primer=5'-ATGGAGCGAAGAAACCC-3' and E1B 55 k 3 'UTR backward
primer=5'-CACGTCCTGGAAAAAATACAC-3') and introduced in the blunt
ended NheI restriction site, which was provided with T-ends
(TA-cloning) and cloned into the pShuttle plasmid of the company
Clontech. Thus, the transgene was provided with a hCMV-promoter at
the 5' end and with the bovine growth hormone polyadenylation
signal at the 3' end. However, it is also within the present
invention that E1B 55 k is used from the plasmid pCGNE1B from
Dobbelstein (Dobbelstein, M. et al., EMBO Journal, 16, 4276-4284,
1997) by means of Bam HI and blunt ending and TA-cloning,
respectively. The E1B 55 k-3'UTR which has been cloned, is, among
others, described in more detail in FIGS. 23 and 24.
Cloning of the Vector E4ORF6-IRES-pcDNA3.1(+)
[0315] The amplificates E4orf6 using the adenovirus type 5 DNA as
template (E4orf6 forward primer 5'-CTTCAGGATCCATGACTACGTCCGGCG-3'
and E4orf6 backward primer
5'-GAAGTGAATTCCTACATGGGGGTAGAGTCATAATCGT-3') and from the plasmid
pCMVE4-34 kD which has been cut with Bam HI (Dobbelstein et al.,
EMBO, 16, 4276-4284,1997), and the IRES element having the
pCITE-4a(+) of the company Novagen as template (IRES forward
primer=5'-TCCGGTTATTTTCCACCATATTGC-3' and IRES backward
primer=5'-TTATCATCGTGTTTTTCAAAGG-3') were subsequently cloned into
the multiple cloning site of the pcDNA3.1(+)-vector. For such
purpose, primers were used for the E4orf6 transgene which create a
BamHI cleavage site at the 5'-end and a EcoRI cleavage site at the
3'-end of the open reading frame. The amplificate was digested with
the respective restriction enzymes and the ends thereof were made
compatible for the directed cloning into the vector which has been
opened using BamHI and EcoRI. Subsequently, plasmid E4orf6 in
pcDNA3.1(+) was linearized with EcoRV, the T-ends added and the
amplificate cloned into the IRES element. After checking the
correct orientation of the IRES element, the vector was used for
further cloning.
[0316] The linkage of both transgenes with the IRES element
resulted from a cloning of the E4orf6-IRES cassette into the
previously generated plasmid CMV-E1B 55 k 3'UTR-polyA-pShuttle
(Clontech) which was linearized with Noti, blunt ended and
subsequently cut with XbaI. E4orf6-IRES in pcDNA3.1 (+) was
linearized with NotI, the ends made blunt ended and further
digested with NheI. By ligating the E4orf6-IRES insert with the
CMV-E1B 55 k 3'UTR-polyA-pShuttle (Clontech) XVIR-3'UTR was
generated in pShuttle (Clontech).
Generation of the Used Adenoviral Shuttle Vector
[0317] As the shuttle vector p.DELTA.E1sp1A, now used for the
adenoviral generation system of the company Microbix, did neither
contain a CMV promoter nor a bovine growth hormone polyadenylation
signal, these elements were cloned into p.DELTA.E1sp1A. For such
purpose, p.DELTA.E1sp1A was linearized with ClaI, made blunt ended
and cut with EcoRI. The element CMV-MCS (multiple cloning
site)-poly-A was linearized from pShuttle (Clontech) with MfeI, the
ends made blunt ended and further cut with EcoRI. Subsequently, the
cassette (Xvir-3'UTR pShuttle from Clontech) was cloned with PmeI
into the CMV-MCS-poly-A p.DELTA.E1sp1A vector which had also been
cut with PmeI and subsequently dephosphorylated. The cloning
product Xvir-3'UTR-p.DELTA.E1sp1A was used for virus
generation.
Virus Generation
[0318] Xvir-3'UTR-p.DELTA.E1sp1A and pBHGE3 (from Microbix,
contains the E3-region which corresponds to wildtype adenovirus
type 5) was cotransfected into HEK 293 cells, whereupon virus
Ad-Xvir-3'UTR E3 was generated due to recombination of homologous
sequences of both vectors.
Generation of Adenovirus Ad-Xvir3'UTR-AdEASY E3 Using the
AdEASY-System (Company Obiogene)
Generation of the Used Adenoviral Shuttle Vector
[0319] As, for the present used system, the vector pShuttle-AdEASY
did neither contain a CMV-promotor nor the bovine growth hormone
polyadenylation signal, these elements were cloned into
pShuttle-AdEASY. For such purpose, the plasmid was digested with
EcoRI, the ends made blunt ended by fling them up with
T4-polymerase and dNTPs, the backbone was dephosphorylated and both
of the generated digestion products ligated again. By doing so the
restriction recognition site for EcoRI was eliminated. The thus
resulting plasmid was referred to as pShuttle(-EcoRI)-AdEASY.
[0320] Subsequently, the cassette CMV-MCS-polyA from the pShuttle
of Clontech was cut wich MfeI and EcoRI, the ends made blunt ended
and cloned into the vector pShuttle (-EcoRI)-AdEASY which was, for
such purpose, linearized with XbaI, made blunt ended and
dephosphorylated. Thus plasmid CMV-MCS-polyA-pShuttle-AdEASY was
generated. The cassette E4Orf6-IRES-E1B 55 k-3'UTR was cloned into
this plasmid using MluI and EcoRI. By doing so the plasmid
Xvir-3'UTR in pShuttle AdEASY was generated. This was linearized
with Bst11071 and MroI and introduced into BJ5183 (EC) bacteria
together with rescue-plasmid pAdEASY by means of electroporation.
By homologous recombination the adenoviral plasmid
Ad-Xvir-3'UTR-pAdEASY was generated which resulted in virus
production after transfection in HEK293 cells.
Introducing the Wt E3 Region into pAdEASY
[0321] As the E3 region is substantially deleted in plasmid
pAdEASY, the E3 region was cloned from plasmid pAdEASY with SpeI
and PacI into plasmid CMV-MCS-polyA pShuttle (AdEASY) for
reconstruction and thus the plasmid E3E4-pShuttle-AdEASY
generated.
[0322] By restriction with NdeI and religation one out of two NdeI
restriction sites was deleted and so was the multiple cloning site
from the plasmid. By this procedure plasmid
E3E4-pShuttle(-NdeI)-AdEASY was generated.
[0323] Subsequently the 4007 bp wtE3-region fragment from wildtype
adenovirus type 5 was excised by SpeI and NdeI and cloned into the
E3E4-pShuttle (-NdeI)-AdEASY which was opened by SpeI and NdeI. The
thus generated vector was referred to as wtE3E4-pShuttle
(NdeI)-AdEASY.
[0324] Subsequently the wildtype E3E4-region from the E3E4-pShuttle
(-NdeI)-AdEASY was cut with SpeI and PacI and cloned into the
pAdEASY and cut with SpeI and PacI, whereby in plasmid pAdEASY the
E3-region was re-established (pAdEASY-E3). XVir-3'UTR-pAdEASY-E3
was generated by homologous recombination upon transforming BJ5183
(EC) bacteria with plasmids Xvir-3'UTR in pShuttle AdEASY and
pAdEASY-E3.
Manipulation of E4 for All of the Systems Mentioned
[0325] In order to provide space for therapeutic transgenes and in
order to avoid undesired homologous recombination the E4 region in
plasmid E3E4-pShuttle (-NdeI)-AdEASY can be deleted specifically.
For such purpose, the E4orf6 region is shortened by about 0.6 kB,
preferably 629 or 634 bp, by excision with PstI and religation.
This can, as described in FIG. 17, be performed in connection with
Xvir03/01. Respective deletions are also feasible by the one
skilled in the art in different systems for the generation of
recombinant adenovirus.
Cloning of the RGD-Motif in Ad-Xvir 3'UTR-AdEASY E3 in Particular
(Also Applicable to Other Systems)
[0326] For increasing the infectivity the HI Loop of the fibre knob
domain was modified following Dmitriev et al. 1998 (An Adenovirus
Vector with Genetically Modified Fibers Demonstrates Expanded
Tropism via Utilization of a Coxsackievirus and Adenovirus
Receptor-Independent Cell Entry Mechanism): The respective region
was amplified using the primers RGD-Hpa fw
(5'-GAGgttaacCTAAGCACTGCCAAG-3'), RGD-EcoRV rev
(5'-CATAGAGTATGCAGATATCGTTAGTGTTACAGGTTTAGTTTTG-3') and RGD-EcoRV
fw (5'-GTAACACTAACGATATCTGCATACTCTATGTCATTTTCATGG-3') and RGD-Bfr
rev (5'-CAGCGACATGAActtaagTGAGCTGC-3') and thus an EcoRV
restriction site generated. In this restriction site the paired
oligonucleotides were cloned which code for an Arg-Gly-Asp
(RGD)-peptide: RGD-oligo 1
(5'-CACACTAAACGGTACACAGGAAACAGGAGACACAACTTGTGACTGCCGCGGAGACTGTTTCTGCCC-3'-
) and RGD-oligo 2
(5'-GGGCAGAAACAGTCTCCGCGGCAGTCACAAGTTGTGTCTCCTGTTTCCTGTGTACCGTTTAGTGTG-3'-
). Thus, the RGD motif is present in the HI Loop of the fibre knob
domain.
[0327] The vector described above is in principle suitable as are
the other viruses described herein for use in accordance with the
present invention. In particular the afore-described vector is
suitable to replicate and trigger lysis insofar, in cells which are
YB-1 nucleus-positive cells as well as in cells where YB-1 is
deregulated, i. e. is overexpressed compared to normal cells and
non-tumor cells, respectively. The use of this vector particularly
applies to those diseases and groups of patients or groups of
patients which are disclosed in connection with the other
adenoviruses which are described herein to be used in accordance
with the present invention and the other adenoviruses of the
present invention disclosed herein.
EXAMLE 12
Structural Design of the Adenoviral Vector Xvir03/01
[0328] As may be taken from FIG. 17, Xvir03/01 is a further
development of Xvir03. Therapeutic genes such as, for example, the
genes described herein and the transgene can be cloned into the E3
region. Additionally, a deletion was introduced into the E4 region
so as to avoid homologous recombination with the E4orf6 from the
expression cassette of Xvir03. This allows that larger transgenes
can be cloned in this construct. The deleted E3 region contains
SacI, NdeI and NheI cleavage sites for introducing a cassette, into
which, for example, the therapeutic transgenes can be cloned.
However, the E3 region may also stay intact and the therapeutic
genes may be dines into the E4 region. Thus, among others, the
expression of the adenoviral death protein ADP is ensured.
Preparing a Plasmid for Cloning Therapeutic Genes into the E3
Region as Well as for Making Deletions in the E4 Region:
[0329] The pAdenoX-Plasmid of Clontech has a restriction site for
SftuI behind the 3' ITR region which is absent in wildtype
adenovirus. The E3-E4 region was taken from pAdenoX (Clontech) with
the SpeI (position 23644) and SfuI and transferred into pcDNA3.1(+)
(Invitrogen)=pcDNA3.1-E3.DELTA.27865-30995-E4. The bigger part of
E4ORF6, namely 33241-33875 was removed by means of
PstI=pcDNA3.1-E3.DELTA.27865-30995,E4.DELTA.33241-33875. For the
further development of Xvir03 the deleted E3/E4 region from
pcDNA3.1-E3.DELTA.27865-30995, E4.DELTA.33241-33875 was cloned by
means of SfuI and SpeI into plasmid pAdenoX=pAdenoX
E3.DELTA.27865-30995,E4.DELTA.33241-33875.
[0330] The expression cassette was subsequently, as described for
Xvir03, cloned with I-Ceu I and PI-SceI from the E1B 55
k-IRES-E4orf6-pShuttle together with the CMV promoter and the
bovine growth hormone (BGH)-PolyA into pAdenoX
E3.DELTA.27865-30995,E4.DELTA.33241-33875 and referred to as
AdcmvE1B/IRES/E4orf6-.DELTA.E4. Subsequently, the adenovirus was
prepared in accordance with manufacturer's instructions
(Clontech).
[0331] It is within the present invention and feasible for he one
skilled in the art in the light of the present disclosure that
other systems nay be used for the manufacture of the adenoviruses
in accordance with the present invention and in particular the
recombinant adenoviruses, such as the systems of the companies
QBIOGENE and Nicrobix.
[0332] The afore-described vector is in principle useful as are the
other viruses described herein to be used in accordance with the
present invention. In particular the afore-described vector is
suitable to replicate in YB-1 nucleus-positive cells as well as
cells in which YB-1 is deregulated, i. e. is overexpressed compared
to normal cells and non-tumor cells, and to cause lysis insofar.
This vector can also be used for those diseases and groups of
patients and collectives of patients which are disclosed herein for
the other adenoviruses to be used in accordance with the present
invention and the adenoviruses in accordance with the present
invention.
EXAMPLE 13
Oncolytic Effect of Xvir 03 in 257 RDB and 181 RDB Cells
[0333] 100,000 cells (257RDB and 181RDB) were plated per well of a
plate having six wells (engl.: 6 well plate). AT the next day the
cells were, as depicted in FIG. 18, infected with Ad312 (20
pfu/cell) and Xvir03 (5 pfu/cell). The infection was performed in
500 .mu.l serum free DMEM medium at 37.degree. C. for 1 h.
Subsequently, the infection medium was removed and replaced by 2 ml
complete medium (10% FCS/DMEM). The analysis was done by means of
crystal violet staining after 5 days. The result is depicted in
FIGS. 18A and 18B.
[0334] As may be taken from FIGS. 18A and 18B, the multidrug
resistant cells which have YB-1 in the nucleus, show lysis after
infection with Ad312 and Xvir03 only in case of Xvir03 as
represented by the crystal violet staining of the cells. In
connection therewith, first the medium is removed. Subsequently the
cells are covered with crystal violet (50% ETOH, 3% formaldehyde,
5% acetic acid, 1% crystal violet) and incubated at room
temperature for 5-10 min. Subsequently, the six well plates are
thoroughly rinsed with water and dried at room temperature.
[0335] It is known to the present inventor that E1A-deleted viruses
(e. g. Ad312) which, however, are not transactivating adenoviruses
in the sense of the present invention, may replicate very
efficiently at higher MOIs (Nevins J. R., Cell 26, 213-220, 1981),
which, however, cannot be realised in clinical application. This
phenomenon is referred to in the literature as "E1A-like activity".
The adenovirus Ad312 as used herein, is an E1A-deleted virus. At
the titer used (20 pfu/cell), which is still above the clinically
desirable titer, the early adenoviral genes such as E1B 55 k and
E4orf6 are not expressed or expressed only to a very small extent
(Nevins J. R., Cell 26, 213-220, 1981). As already described
herein, these genes and proteins play an important role in viral
replication. In contrast thereto, these genes and proteins,
respectively, are expressed by adenovirus Xvir03 (FIGS. 16). As may
be taken from FIGS. 18A and 18B, the expression of the genes E1B 55
k and E4orf6 will result in an efficient viral replication and cell
lysis at a concomitantly lower infection titer required (expressed
as pfu/cell). This confirms the finding underlying the present
invention, namely that the expression of E4orf6 and E1B-55K (and
the absence of E1A) in combination with nuclear localisation of
YB-1 is capable of inducing a very efficient adenoviral
replication. The titer required therefor of only 1 to 5 pfu/cell
now allows for clinical application.
[0336] This confirms the finding underlying the present invention,
namely that the presence of YB-1 in the nucleus, particularly the
presence independent from the cell cycle, is required in order to
make the viruses which are to be used in accordance with the
present invention, lyse infected cells.
EXAMPLE 14
Replication of Adenovirus in Cells After Addition of Irinotecan
[0337] In order to determine the effect of Irinotecan on adenoviral
replication 10.sup.6 U373 tumour cells were plated in 10 cm.sup.2
Petri dishes. In a first reaction 5 .mu.M Irinotecan was added
after 24 hours. After another 24 hours the cells were infected with
10 pfu/cell dl520. After incubation of 3 days without Irinotecan
DNA was isolated in accordance with the procedure described in
example 10.
[0338] In a parallel reaction the thus prepared U373-cells were not
pre-incubated with Irinotecan. After 48 hours of cultivating the
cells without Irinotecan, they were infected with 10 pfu/cell dl520
and subsequently incubated without Irinotecan for another 3 days.
DNA was isolated as described above.
[0339] Subsequently 2.mu. DNA were digested with restriction enzyme
Kpn I and a Southern Blot analysis performed. A part of the
adenoviral genome (position: 22734-24235) generated by means of PCR
was used as a probe.
[0340] The result is depicted in FIG. 19. FIG. 19 shows that after
incubation with Irinotecan adenoviral replication is significantly
increased in U373 cells after treatment with Irinotecan (lane 2)
compared to untreated control where no incubation with Irinotecan
was performed (lane 1). This means that adenoviral replication is
increased under the influence of Irinotecan.
EXAMPLE 15
Replication of Adenovirus in Cells After Administration of
Trichostatin A
[0341] In order to test the effect of Trichostatin A on adenoviral
replication, 10.sup.6 U373 tumour cells were plated in 10 cm.sup.2
Petri dishes. After 24 hours 0, 0.25, 0.5 and 0.75 .mu.M
Trichostatin A was added. After another 24 hours the cells were
infected with 10 pfu dl520/cell.
[0342] After 3 days of incubation in medium without Trichostatin
DNA was isolated. Subsequently 2 .mu.g DNA were digested with
restriction enzyme Kpn I and a Southern Blot analysis performed. A
part of the adenoviral genome (position: 22734-24235) generated by
means of PCR was used as a probe.
[0343] The result is depicted in FIG. 20. FIG. 20 shows that after
incubation with increasing concentrations of Trichostatin A viral
replication in U373 cells (lanes 2, 3 and 4) is significantly
increased compared to untreated controls where no incubation with
Trichostatin A was performed (lane 1). This means that viral
replication is increased under the influence of Trichostatin A.
EXAMPLE 16
Influencing the Expression of Coxsackievirus-Adenovirus-Receptor
(CAR) on U373 Cells in Response to Addition of Trichostatin A
[0344] 200,000 U373 cells were plated in 6 well plates. After 24
hours the cells were cultivated with 1 .mu.M Trichostatin for 24
hours. After another 24 hours the cells were isolated.
Subsequently, analysis of CAR expression was performed according to
a standard protocol using Facs-analysis and the primary antibody
anti-CAR clone RmcB from the company Upstate, and a rabbit
anti-mouse FITC as secondary antibody (company DAKO).
[0345] The result is depicted in FIG. 21. Without Trichostatin
treatment 11.3% of the cells were CAR-positive, whereas after
incubation of the cells with 1 .mu.M Trichostatin 56.2% of the
cells were CAR-positive. The figures are percentages of the overall
cells used in the test.
[0346] From FIG. 21 it can be taken that under the influence of the
histone deacylase inhibitor Trichostatin A CAR, which is an
important factor for the binding of adenovirus, is expressed at a
higher level and is more available, respectively, which increases
the efficacy of transfection of the thus treated cells.
EXAMPLE 17
Oncolysis of U373 Cells by Adenovirus After Combined Treatment of
the Cells With Irinotecan and Trichostatin A
[0347] 200,000 U373 cells were plated in a 6 well plate. After 24
hours either 2 .mu.M Irinotecan or only 1 .mu.M Trichostatin A or 1
.mu.M Irinotecan+0.5 .mu.M Trichostatin were added to the medium.
After 24 hours of incubation the cells were infected with 10, 20
and 30 pfu/cell dl520. After 3-5 days the analysis was performed
using crystal violet staining. The assays were performed in
duplicate.
[0348] The result is depicted in FIG. 22. The six plates
represented in panel 1 show a complete cell layer which was not
affected by incubation with a combination of Irinotecan and
Trichostatin A as shown by crystal violet staining. The next two
wells of panel 1 show the cell layer after infection with 10 and 20
pfu/cell dl520, respectively. Also under such conditions there is
no lysis of the cells which is due to the absence of replication of
dl520. Thus it is shown that neither dl520 at 10 or 20 pfu/cells
nor 1 .mu.M Irinotecan+0.5 .mu.M Trichostatin A alone are able to
induce cell lysis.
[0349] The further 6 well plates 2, 3 and 4 depicted in FIG. 22,
herein also referred to as panels 2, 3 and 4, were basically
treated in accordance with the foolowing scheme. The individual
wells were inoculated with U373 cells as previously described and
the cells cultivated therein. The wells were inoculated with 10, 20
or 30 pfu/cell dl520 in duplicate, whereby the differences between
the three 6 well plates resided in the kind of cytostatics used. In
panel 2 2 .mu.M Irinotecan, in panel 3 1 .mu.M Trichostatin A and
in panel 4 1 .mu.M Irinotecan and 0.5 .mu.M Trichostatin A was
added to the individual plates.
[0350] In the 6 well plate 2 (panel 2) with 2 .mu.M Irinotecan the
cells were lysed with 30 pfu/cell dl520. In the 6 well plate 3
(panel 3) with 1 .mu.M Trichostatin A the cells were lysed at 20
and 30 pfu/cell dl520. In the 6 well plate 4 (panel 4) with 1 .mu.M
Irenotecan+0.5 .mu.M Trichostatin A the cells, in contrast thereto,
were already lysed at 10 pfu/cell dl 520.
[0351] The test, the results of which are depicted in FIGS. 19 to
23, shows that the combination consisting of
Irinotecan+Trichostatin A+dl520 induces a more effective cell lyses
of tumour cells as any compound alone. This results, on the one
hand, from Trichostatin A increasing CAR-expression and thus
significantly improves infectability of the cells. On the other
hand, Irinotecan translocates YB-1 into the cell nucleus and thus
induces an improved adenoviral replication. Additionally, the
cellular YB-1 is assisting adenoviral replication after infection
with dl520 and is no longer available for DNA-repair processes.
Depending on the point of view, this results in an improved
efficacy of dl520 on the one hand and an increased efficacy of the
cytostatics on the other hand.
[0352] The features of the invention disclosed in the preceding
specification, the claims as well as the figures can both
individually as well as in any combination be important to the
realisation of the invention in its various embodiments.
Sequence CWU 1
1
15 1 20 DNA Artificial misc_feature Probe for determining nucelar
YB-1 1 tgaggctgat tggctgggca 20 2 20 DNA Artificial misc_feature
Primer 2 gtcggagatc agatccgcgt 20 3 20 DNA Artificial misc_feature
Primer 3 gatcctcgtc gtcttcgctt 20 4 17 DNA Artificial misc_feature
Primer 4 atggagcgaa gaaaccc 17 5 21 DNA Artificial misc_feature
Primer 5 cacgtcctgg aaaaaataca c 21 6 27 DNA Artificial
misc_feature Primer 6 cttcaggatc catgactacg tccggcg 27 7 37 DNA
Artificial misc_feature Primer 7 gaagtgaatt cctacatggg ggtagagtca
taatcgt 37 8 24 DNA Artificial misc_feature Primer 8 tccggttatt
ttccaccata ttgc 24 9 22 DNA Artificial misc_feature Primer 9
ttatcatcgt gtttttcaaa gg 22 10 24 DNA Artificial misc_feature
Primer 10 gaggttaacc taagcactgc caag 24 11 43 DNA Artificial
misc_feature Primer 11 catagagtat gcagatatcg ttagtgttac aggtttagtt
ttg 43 12 42 DNA Artificial misc_feature Primer 12 gtaacactaa
cgatatctgc atactctatg tcattttcat gg 42 13 26 DNA Artificial
misc_feature Primer 13 cagcgacatg aacttaagtg agctgc 26 14 66 DNA
Artificial misc_feature Primer 14 cacactaaac ggtacacagg aaacaggaga
cacaacttgt gactgccgcg gagactgttt 60 ctgccc 66 15 66 DNA Artificial
misc_feature Primer 15 gggcagaaac agtctccgcg gcagtcacaa gttgtgtctc
ctgtttcctg tgtaccgttt 60 agtgtg 66
* * * * *