U.S. patent application number 10/555544 was filed with the patent office on 2007-05-10 for multiple gene transcription activity assay system.
This patent application is currently assigned to NATIONAL INSTITUTE OF ADVANCED INDUSTRIAL SCIENCE AND TECHNOLOGY. Invention is credited to Yoshihiro Nakajima, Yoshihiro Ohmiya.
Application Number | 20070105172 10/555544 |
Document ID | / |
Family ID | 33436407 |
Filed Date | 2007-05-10 |
United States Patent
Application |
20070105172 |
Kind Code |
A1 |
Ohmiya; Yoshihiro ; et
al. |
May 10, 2007 |
Multiple gene transcription activity assay system
Abstract
A gene construct incorporating any of at least two luciferase
genes which emit lights with different colors using an identical
substrate such that the gene can be stably expressed in mammalian
cells.
Inventors: |
Ohmiya; Yoshihiro;
(Ikeda-shi, JP) ; Nakajima; Yoshihiro; (Ikeda-shi,
JP) |
Correspondence
Address: |
KNOBBE MARTENS OLSON & BEAR LLP
2040 MAIN STREET
FOURTEENTH FLOOR
IRVINE
CA
92614
US
|
Assignee: |
NATIONAL INSTITUTE OF ADVANCED
INDUSTRIAL SCIENCE AND TECHNOLOGY
3-1, KASUMIGASEKI 1-CHOME, CHIYODA-KU
TOKYO
JP
1008921
|
Family ID: |
33436407 |
Appl. No.: |
10/555544 |
Filed: |
April 30, 2004 |
PCT Filed: |
April 30, 2004 |
PCT NO: |
PCT/JP04/06362 |
371 Date: |
November 4, 2005 |
Current U.S.
Class: |
435/8 ; 435/191;
435/320.1; 435/325; 435/69.1; 536/23.2 |
Current CPC
Class: |
C12N 2830/90 20130101;
G01N 33/582 20130101; C12N 2830/42 20130101; C07K 14/43504
20130101; C12N 15/85 20130101; C12N 2830/85 20130101; C12N 9/0069
20130101; C12N 2840/203 20130101; C12N 2830/001 20130101; C12N
2840/20 20130101 |
Class at
Publication: |
435/008 ;
435/069.1; 435/191; 435/320.1; 435/325; 536/023.2 |
International
Class: |
C12Q 1/66 20060101
C12Q001/66; C07H 21/04 20060101 C07H021/04; C12P 21/06 20060101
C12P021/06; C12N 9/06 20060101 C12N009/06 |
Foreign Application Data
Date |
Code |
Application Number |
May 6, 2003 |
JP |
2003-127629 |
Dec 5, 2003 |
JP |
2003-407564 |
Claims
1. DNA encoding at least one luciferase selected from the group
consisting a red-emitting luciferase and a green-emitting
luciferase derived from a rail road worm and a green-emitting
luciferase and an orange-emitting luciferase derived from
Rhagophthalmus ohba stably expressed in mammalian cells,
characterized in that (1) the DNA has no binding sequence for an
additional transcription factor in the mammalian cells and has a
codon usage for the mammal.
2. The DNA according to claim 1, characterized in that the mammal
is human and the DNA has at least one nucleotide sequence selected
from the group consisting of SEQ ID NOS:7, 10, 11 and 16.
3. A method for enabling the expression of DNA encoding a
luciferase derived from a rail road worm or Rhagophthalmus ohba in
mammalian cells, characterized by having 1) a step of altering a
cDNA sequence such that no additional transcription factor is
bound; 2) a step of changing a codon usage for insects to that for
mammals in the cDNA sequence; and optionally 3) a step of altering
the cDNA sequence with many restriction enzyme sites due to limited
application at the use.
4. The method according to claim 3, characterized in that an amino
acid sequence of the luciferase is not altered.
5. A polypeptide which is a luciferase with a maximum luminescence
wavelength of 630 nm, represented by: (1) a polypeptide having an
amino acid sequence of SEQ ID NO:4; or (2) a polypeptide having one
or more amino acid substitutions, additions or deletions in the
sequence of SEQ ID NO:4.
6. The polypeptide according to claim 5, expressed in mammalian
cells.
7. A gene construct comprising one or two or more genes of
luciferases which emit light whose wavelength does not
substantially depend on a determining condition and maximum
luminescence wavelength is 535 to 635 mm, which is stably
expressible in mammalian cells.
8. The gene construct according to claim 7 comprising 3 or more
luciferase genes stably expressible in mammalian cells wherein one
or two or more genes of luciferases with a maximum luminescence
wavelength of 460 to 520 nm together with one or two or more genes
of luciferases which emit light whose wavelength does not
substantially depend on a determining condition and maximum
luminescence wavelength is 535 to 635 nm.
9. The gene construct according to claim 7 wherein the luciferase
gene is a gene encoding at least one luciferase selected from the
group consisting of a red-emitting luciferase, green-emitting
luciferase derived from a rail road worm, a green-emitting
luciferase, and an orange-emitting luciferase derived from
Rhagophthalmus ohba stably expressed in mammalian cells.
10. The gene construct according to claim 7 comprising an element
for promoting efficiency of translation and/or an element for
stabilizing mRNA.
11. A gene construct capable of distinctively determining each
light emitted from two or more luciferases, comprising one or two
or more genes of the luciferases which emit light whose wavelength
does not substantially depend on a determining condition and if
necessary a gene of the luciferase which emits light whose
wavelength is different and does not substantially depend on the
determining condition under the control of different promoters.
12. An expression vector containing the gene construct according to
claim 7.
13. Mammalian cells transformed with the gene construct according
to claim 7.
14. Mammalian cells comprising two or more stably expressing genes
of luciferases which emit mutually distinct light whose
luminescence wavelength does not substantially depend on a
determining condition under the control of different promoters in
the mammalian cells.
15. The mammalian cells according to claim 13 wherein two or more
of the above luciferases have a maximum luminescence wavelength of
535 to 635 nm and can emit with one substrate.
16. The mammalian cells according to claim 15 comprising a
red-emitting luciferase gene from a rail road worm and further
comprising at least two or more selected from the group consisting
of a green-emitting luciferase gene from the rail road worm, a
green-emitting luciferase gene from Rhagophthalmus ohba, an
orange-emitting luciferase from Rhagophthalmus ohba, and a
blue-emitting luciferase gene under the control of different
promoters.
17. The mammalian cells according to claim 14 stably expressibly
comprising genes of three or more luciferases which emit mutually
distinct light whose luminescence wavelength does not substantially
depend on a determining condition under the control of different
promoters in the mammalian cells.
18. The mammalian cells according to claim 14 comprising three or
more luciferase genes under the control of different promoters
wherein a first luciferase gene is under the control of a
constantly expressed promoter, a second luciferase gene is under
the control of a toxicity assessing promoter, and remaining one or
more luciferase genes are under the control of a promoter subjected
to assessment.
19. The mammalian cells according to claim 14 comprising three or
more luciferase genes under the control of different promoters
wherein a first luciferase gene is under the control of a
constantly expressed promoter, a second luciferase gene is under
the control of a pseudopromoter, and remaining one or more
luciferase genes are under the control of a promoter subjected to
assessment.
20. The mammalian cells according to claim 14 comprising 4 or more
luciferase genes under the control of different promoters, wherein
a first luciferase gene is under the control of a constantly
expressed promoter, a second luciferase gene is under the control
of a toxicity assessing promoter, a third luciferase gene is under
the control of a promoter of a protein which accepts an external
factor, and remaining one or more luciferase genes are under the
control of a promoter subjected to assessment.
21. The mammalian cells according to claim 14 comprising 4 or more
luciferase genes under the control of different promoters, wherein
a first luciferase gene is under the control of a constantly
expressed promoter, a second luciferase gene is under the control
of a pseudopromoter, a third luciferase gene is under the control
of a promoter of a protein which accepts an exogenous factor, and
remaining one or more luciferase genes are under the control of a
promoter subjected to assessment.
22. The mammalian cells according to claim 14 comprising two
luciferase genes under the control of different promoters, wherein
a first luciferase gene is under the control of a constantly
expressed promoter, and a second luciferase gene is under the
control of a toxicity assessing promoter.
23. The mammalian cells according to claim 14 comprising two
luciferase genes under the control of different promoters, wherein
a first luciferase gene is under the control of a constantly
expressed promoter, and a second luciferase gene is under the
control of a pseudopromoter.
24. A method for screening drugs comprising a step of culturing the
mammalian cells according to claim 18 in the presence of a drug
candidate compound in a medium of the mammalian cells, a step of
quantifying an amount of the above luciferase in the presence or
absence of the candidate compound, and a step of assessing an
effect of the candidate compound on a promoter subjected to
assessment, which is linked to at least one luciferase.
25. A system for multiply determining transcription activity of
each promoter linked to each luciferase before and after a change
of a culture environment by changing the culture environment of the
mammalian cells according to claim 13, and assessing expressed
amounts of two or more luciferases which emit mutually distinct
light whose luminescence wavelength does not depend on a
determining condition.
26. The system according to claim 23 capable of simultaneously
determining expressed amounts of two or more luciferases.
27. The system according to claim 23 capable of determining
expressed amounts of three or more luciferases.
Description
TECHNICAL FIELD
[0001] The present invention relates to a gene construct for
multiply detecting gene transcription activities in living cells by
the use of luciferases which emit different color lights, an
expression vector containing the construct, transformed mammalian
cells containing the construct or the expression vector, a
screening method of drugs using the mammalian cells, and a system
for multiply determining the transcription activities of respective
promoters.
[0002] The invention also relates to a gene and a polypeptide used
for a system where the transcription activity in the living cells
is detected by the use of the luciferase which emits red, orange or
blue color light.
BACKGROUND ART
[0003] In the life science field, a transcription activity of an
intracellular gene has been generally determined, and used for
evaluation of exogenous factors given to cells, and analyses of
intracellular signal transduction or expression of an individual
protein group. The gene transcription activity has been directly
determined by Western blotting and the like, or indirectly
determined using a luciferase gene or a light-emitting enzyme gene
as a reporter gene. In particular, it has been generalized to
quantify the transcription activity based on an emitted light
intensity using a firefly light-emitting enzyme gene. A fluorescent
protein exhibits a fluorescent activity without need of a cofactor
almost simultaneously with its intracellular expression. The
fluorescent protein has been used as a monitor protein for
examining a localization of a protein by the use of the fluorescent
activity in the cell as an indicator, but it is difficult to
quantify it, and it is unlikely to use it as the reporter gene for
the gene expression.
[0004] It is important to analyze a quantitative and temporal
dynamic change of the protein gene expression, but the
transcription activity one gene has been primarily analyzed in
conventional reporter techniques. However recently, a system (dual
assay system, Promega) for determining two transcription activities
by introducing two gene constructs into the cell, i.e., A
transcription active region being inserted in a firefly
light-emitting enzyme gene and B transcription active region being
inserted in a Renilla light-emitting enzyme gene has been
commercially available. However, this method is a system for
determining the transcription activity by adding different
luminescent substrates, respectively, two activities can not be
determined simultaneously, and only two transcription activities
can be determined. Furthermore, since a firefly luciferase is used,
a wavelength thereof is changed due to pH and accurate
determination is difficult.
[0005] Multiple signals are trafficked in a cell, and it is
essential to construct a technique to quantitatively determine the
multiple transcription activities. For example, in a human
biological clock, a Per gene which gives a 24 hour rhythm is
controlled by Clock and BMAL gene products. Thus, to precisely
evaluate the biological clock, it is essential to determine
multiple, at least three transcription activities. Until now, the
transcription activity of an individual gene has been determined by
the use of a firefly luciferase reporter gene, but a dynamic of
only one gene transcription has been observed at a time, and an
interaction of biological clock-related gene expressions has
remained unclear.
[0006] Canceration progresses by abnormal growth of cells caused
with activation of an oncogene or by the abnormal growth of the
cells due to the control release caused along with inactivation of
a tumor suppressing gene. Thus, to evaluate canceration factors and
intracellular signal transduction of the canceration, it is
desirable to determine the gene transcription activity of the
oncogene, the tumor suppressing gene and a mitotic marker gene.
However, in the conventional method, the dynamic of only one gene
transcription has been observed at a time, the transcription
activities of the three gene can not be evaluated at a time, and
thus the interaction of the three genes involved in the canceration
has not been sufficiently understood.
[0007] The transcription of a gene is caused by binding a substance
which suppresses or promotes the gene expression to a particular
sequence present on a gene sequence referred to as a promoter
region upstream of a gene product. An E-box and a cAMP-binding site
are representatives thereof. The gene transcription activity is
determined by inserting a certain length of the promoter region
into an upstream of a reporter gene. Furthermore, a particular
sequence believed to be effective is then synthesized, and inserted
into the upstream of the reporter gene to examine an effect of the
particular sequence. To examine a transcription controlling effect
of the particular sequence, it is necessary to simultaneously
evaluate the transcription activity of the original promoter region
and the transcription activity capable of standardizing the effect
in combination. However, in the conventional method, the
transcription dynamic of only one gene has been observed, and the
particular sequence for the control of the transcription activity
can not be sufficiently evaluated.
[0008] A luciferase is useful as a means to directly observe the
gene transcription activity in the cells, and has been used as a
detection monitor protein of the gene expression. There are a wide
variety of luciferases, but no reporter gene for determining the
transcription activity based on their diversity is available. If
using luciferase genes which emit different color lights as the
reporter genes and different transcriptional active regions are
inserted into mammalian cells, then multiple transcription
activities can be determined. A red-emitting luciferase derived
from a rail road worm has the longest wavelength of luminescence,
is easily discriminated compared to the luciferases derived from a
firefly and a click beetle, and is highly permeable into the cell
due to the red-emitting color. However, the expression of the red
and green-emitting luciferases from the rail road worm has been
successfully done only in Escherichia coli (US 2002/0119542-A1),
and there is no successful example as the system in the mammalian
cells including human cells.
[0009] There is also an example in which the expression of a
luciferase gene from the rail road worm in the mammalian cells was
enabled by modifying a structure of the gene (WO 2003/016839).
[0010] As the luciferase, a luciferase derived from Rhagophthalmus
ohba has been also known.
[0011] The expression of a green-emitting luciferase derived from
Rhagophthalmus ohba has been successfully done in only Escherichia
coli (Ohmiya, Y. Sumiya, M. Viviani, V R. and Ohba N.; Comparative
aspects of a luciferase molecule from the Japanese luminous beetle
Rhagophthalmus ohba. Sci. Rept. Yokosuka City Mus. .47, 31-38,
2000). Based on this sequence, an orange-emitting luciferase
derived from Rhagophthalmus ohba was created and the expression
thereof was also successfully done in Escherichia coli (Viviani, V
R., Uchida, A., Suenaga, N., Ryufuku M. and Ohmiya Y.: Thr-226 is a
key-residue for bioluminescence spectra determination in beetle
luciferases. Biochem. Biophys. Res. Commun., 280, 1286-1291, 2001).
Additionally, as the luciferase, blue-emitting luciferases derived
from a dinoflagellate and Renilla have been also known.
[0012] It is an object of the present invention to construct and
optimize a reporter gene capable of determining or quantifying
multiple transcription activities in a cell simultaneously or at
the same phase, further develop a multiple gene transcription
activity determining system using the reporter gene group, and
utilize the same for cell functional analyses in life science,
further the treatment/examination of pathology and new drug
development.
[0013] It is also another object to make a gene construct by which
a red- or a green-emitting luciferase from a rail road worm is
stably transcribed and stably translated in mammalian cells or in
animals.
[0014] It is also another object to make a gene construct by which
an orange or a green-emitting luciferase from a Rhagophthalmus ohba
is stably transcribed and stably translated in mammalian cells or
in animals.
[0015] This enables to stably determine and visualize a change of
the gene transcription activity in the mammalian cells or in the
animals.
BRIEF DESCRIPTION OF THE DRAWINGS
[0016] FIG. 1 shows an outline of determination for multiple gene
transcription activities and differences from a conventional
method.
[0017] FIG. 2 shows a structure of an expression vector for
mammalian cells and luminescence activity in Hela cells.
[0018] FIG. 3 shows luminescence spectra of a red-emitting
luciferase and a green-emitting luciferase from a rail road worm
produced in cultured mammalian cells.
[0019] FIG. 4 shows intracellular lifespan of a red-emitting
luciferase and a green-emitting luciferase from a rail road worm
produced in cultured mammalian cells.
[0020] FIG. 5 shows a simultaneous luminescence spectrum of a
red-emitting luciferase and a green-emitting luciferase produced in
cultured mammalian cells and property of a filter used for color
identification (transmittance of lights).
[0021] FIG. 6 shows luminescence reaction curves and luminescence
activity determining time of a red-emitting luciferase and a
green-emitting luciferase.
[0022] FIG. 7 shows an abundance ratio and luminescence activity of
a red-emitting luciferase and a green-emitting luciferase (in the
case of using the filter in FIG. 5).
[0023] FIG. 8 shows a result of an actual multiple transcription
activity determination, i.e., simultaneously determining two
transcription activities by lights from a red-emitting luciferase
and a green-emitting luciferase, determining the transcription
activity of a standard gene by the light from a blue-emitting
luciferase, and standardizing the two transcription activities.
[0024] FIG. 9 shows a simultaneous luminescence spectrum of a
red-emitting luciferase, a green-emitting luciferase and a
blue-emitting luciferase produced in cultured mammalian cells and
property of filters used for color identification (transmittance of
lights).
[0025] FIG. 10. shows a result indicating that transcription
activities shown by a red-emitting luciferase and a green-emitting
luciferase were obtained from continuous monitoring of the two
transcription activities.
[0026] FIG. 11 shows an example in which many specimens are
exhaustively analyzed by a primary screening.
[0027] FIG. 12 shows an example in which an individual event is
evaluated by a secondary screening.
[0028] FIG. 13 shows homology of a DNA sequence of a rail road worm
red-emitting luciferase gene mutant (SEQ ID NO:7) of the present
invention with that of a rail road worm wild-type red-emitting
luciferase gene (SEQ ID NO:3).
[0029] FIG. 14 shows homology of a DNA sequence of a rail road worm
red-emitting luciferase gene mutant (SEQ ID NO:7) having a maximum
luminescence wavelength of 630 nm with that of a rail road worm
red-emitting luciferase gene mutant of WO 2003/016839 (SEQ ID NO:6)
having a maximum luminescence wavelength of 622 nm.
[0030] FIG. 15 shows differences in luminescence activity of a
wild-type rail road worm red-emitting luciferase and a mutant rail
road worm red-emitting luciferase.
[0031] FIG. 16 shows luminescence spectra of a mutant (SEQ ID NO:7)
introduced and produced in mammalian cells (mouse NIH3T3 cells, a
thick line) and a rail road wild-type (SEQ ID NO:3) produced in
insect silk worm cells (a thin line).
[0032] FIG. 17 shows homology of a DNA sequence of a Rhagophthalmus
ohba green-emitting luciferase mutant (SEQ ID NO:10) with that of a
wild-type (SEQ ID NO:8).
[0033] FIG. 18 shows difference in luminescence activity of
Rhagophthalmus ohba green-emitting luciferase wild-type and mutant
and Rhagophthalmus ohba orange-emitting luciferase wild type and
mutant.
[0034] FIG. 19 shows an outline of a method for detecting the
expression of three genes by one substrate, a firefly luciferin. In
the method of the present embodiment, determination is performed by
transmitting three transcription activities by red, orange and
green color lights and identifying the respective colors.
[0035] FIG. 20 shows luminescence spectra of a mixture of
Rhagophthalmus ohba green and orange-emitting, rail road worm
red-emitting luciferases and a transmittance curve of a set split
filter.
[0036] FIG. 21 shows abundance ratio and luminescence activity
(when using the filter shown in FIG. 22) of two color luciferases
(combinations of (A) green-red-emitting, (B) green-orange-emitting
and (C) orange-red-emitting luciferases).
[0037] FIG. 22 shows an abundance ratio and luminescence activity
(when using the filter shown in FIG. 20) of three color luciferases
((A) green-orange-emitting luciferases when a red-emitting
luciferase is 1; (B) green-red-emitting luciferases when an
orange-emitting luciferase is 1; and (C) orange-red-emitting
luciferases when a green-emitting luciferase is 1).
DISCLOSURE OF THE INVENTION
[0038] As a result of an intensive study for solving the above
subjects, the present inventor has made a reporter gene construct
capable of distinctively quantifying lights derived from 2 or more,
preferably 3 or more and more preferably 4 or more luciferases
(red-, orange-, green- and blue-emitting) based on the luciferases
which emits different color lights (including red, orange, green
and blue) or various luminescent substrates. According to the
present invention, 2 or more, preferably 3 or more and more
preferably 4 or more gene activities can be determined preferably
simultaneously or at the same phase because an emitted light
intensity derived from each luciferase corresponds to a
transcription activity of each promoter, i.e., the activity of the
gene to which each promoter is originally linked. It is also
possible to precisely determined because a luminescence wavelength
is not changed due to a determining condition (pH, etc). For
example, in one preferable embodiment of the present invention, a
system for determining the transcription activities of multiple
genes simply and highly quantitatively was made by making reporter
gene constructs of a red-emitting luciferase and a green-emitting
luciferase from a railroad worm and a green-emitting luciferase and
an orange-emitting luciferase from Rhagophthalmus ohba, and
simultaneously using luciferase reporter genes of Renilla, a marine
ostracod, a luminescent dinoflagellate, a click beetle, aequorin
and the like.
[0039] Furthermore, the present inventor has found that the
transcription can be easily performed in mammalian cells for a
luciferase which is scarcely expressed or is not expressed at all
in the mammalian cells by (1) altering a cDNA sequence such that no
additional transcription factor is bound and (2) changing a codon
usage (bias of codon use frequencies) for insects to the codon
usage for mammals in the cDNA sequence and further reducing
restriction enzyme sites in the cDNA sequence because the many
restriction enzyme sites limit an application of the cDNA.
[0040] The present invention provides the following polypeptide,
gene, gene construct, mammalian cell, a method for screening drugs
and a system for multiply determining the transcription activities
of the promoters using the mammalian cells.
[0041] 1. DNA encoding at least one luciferase selected from the
group consisting a red-emitting luciferase and a green-emitting
luciferase derived from a rail road worm and a green-emitting
luciferase and an orange-emitting luciferase derived from
Rhagophthalmus ohba stably expressed in mammalian cells,
characterized in that (1) the DNA has no binding sequence for an
additional transcription factor in the mammalian cells and has a
codon usage for the mammal.
[0042] 2. The DNA according to the above 1, characterized in that
the mammal is human and the DNA has at least one nucleotide
sequence selected from the group consisting of SEQ ID NOS:7, 10, 11
and 16.
[0043] 3. A method for enabling the expression of DNA encoding a
luciferase derived from a rail road worm or Rhagophthalmus ohba in
mammalian cells, characterized by having
[0044] 1) a step of altering a cDNA sequence such that no
additional transcription factor is bound;
[0045] 2) a step of changing a codon usage for insects to that for
mammals in the cDNA sequence; and optionally
[0046] 3) a step of altering the cDNA sequence with many
restriction enzyme sites due to limited application at the use.
[0047] 4. The method according to the above 3, characterized in
that an amino acid sequence of the luciferase is not altered.
[0048] 5. A polypeptide which is a luciferase with a maximum
luminescence wavelength of 630 nm, represented by any of the
followings:
[0049] (1) a polypeptide having an amino acid sequence of SEQ ID
NO:4; and
[0050] (2) a polypeptide having one or more amino acid
substitutions, additions or deletions in the sequence of SEQ ID
NO:4.
[0051] 6. The polypeptide according to the above 5, expressed in
mammalian cells.
[0052] 7. A gene construct incorporating one or two or more genes
of luciferases which emit light whose wavelength does not
substantially depend on a determining condition and maximum
luminescence wavelength is 535 to 635 nm, to be stably expressible
in mammalian cells.
[0053] 8. The gene construct according to the above 7 incorporating
3 or more luciferase genes stably expressibly in mammalian cells by
incorporating one or two or more genes of luciferases with a
maximum luminescence wavelength of 460 to 520 nm together with one
or two or more genes of luciferases which emit light whose
wavelength does not substantially depend on a determining condition
and maximum luminescence wavelength is 535 to 635 nm.
[0054] 9. The gene construct according to the above 7 wherein the
above luciferase gene is a gene encoding at least one luciferase
selected from the group consisting of a red-emitting luciferase and
a green-emitting luciferase derived from a rail road worm and a
green-emitting luciferase and an orange-emitting luciferase derived
from Rhagophthalmus ohba stably expressed in mammalian cells.
[0055] 10. The gene construct according to the above 7 comprising
an element for promoting efficiency of translation and/or an
element for stabilizing mRNA.
[0056] 11. A gene construct capable of distinctively determining
each light emitted from two or more luciferases, by incorporating
one or two or more genes of the luciferases which emit light whose
wavelength does not substantially depend on a determining condition
and if necessary a gene of the luciferase which emits light whose
wavelength is different and does not substantially depend on the
determining condition under the control of different promoters.
[0057] 12. An expression vector containing the gene construct
according to any of the above 7 to 11.
[0058] 13. Mammalian cells transformed with the gene construct
according to any of the above 7 to 11 or the expression vector
according to the above 12.
[0059] 14. Mammalian cells stably expressibly incorporating two or
more genes of luciferases which emit mutually distinct light whose
luminescence wavelength does not substantially depend on a
determining condition under the control of different promoters in
the mammalian cells.
[0060] 15. The mammalian cells according to the above 13 or 14
wherein two or more of the above luciferases have maximum
luminescence wavelength of 535 to 635 nm and can emit with one
substrate.
[0061] 16. The mammalian cells according to the above 15 comprising
a red-emitting luciferase gene from a rail road worm and further
comprising at least two or more selected from the group consisting
of a green-emitting luciferase gene from the rail road worm, a
green-emitting luciferase gene from Rhagophthalmus ohba, an
orange-emitting luciferase from Rhagophthalmus ohba, and a
blue-emitting luciferase gene under the control of different
promoters.
[0062] 17. The mammalian cells according to the above 14 stably
expressibly incorporating genes of three or more luciferases which
emit mutually distinct light whose luminescence wavelength does not
substantially depend on a determining condition under the control
of different promoters in the mammalian cells.
[0063] 18. The mammalian cells according to the above 14 having
three or more luciferase genes under the control of different
promoters wherein a first luciferase gene is under the control of a
constantly expressed promoter, a second luciferase gene is under
the control of a toxicity assessing promoter, and remaining one or
more luciferase genes are under the control of a promoter subjected
to assessment.
[0064] 19. The mammalian cells according to the above 14 having
three or more luciferase genes under the control of different
promoters wherein a first luciferase gene is under the control of a
constantly expressed promoter, a second luciferase gene is under
the control of a pseudopromoter, and remaining one or more
luciferase genes are under the control of a promoter subjected to
assessment.
[0065] 20. The mammalian cells according to the above 14 having 4
or more luciferase genes under the control of different promoters,
wherein a first luciferase gene is under the control of a
constantly expressed promoter, a second luciferase gene is under
the control of a toxicity assessing promoter, a third luciferase
gene is under the control of a promoter of a protein which accepts
an external factor, and remaining one or more luciferase genes are
under the control of a promoter subjected to assessment.
[0066] 21. The mammalian cells according to the above 14 having 4
or more luciferase genes under the control of different promoters,
wherein a first luciferase gene is under the control of a
constantly expressed promoter, a second luciferase gene is under
the control of a pseudopromoter, a third luciferase gene is under
the control of a promoter of a protein which accepts an exogenous
factor, and remaining one or more luciferase genes are under the
control of a promoter subjected to assessment.
[0067] 22. The mammalian cells according to the above 14 having two
luciferase genes under the control of different promoters, wherein
a first luciferase gene is under the control of a constantly
expressed promoter, and a second luciferase gene is under the
control of a toxicity assessing promoter.
[0068] 23. The mammalian cells according to the above 14 having two
luciferase genes under the control of different promoters, wherein
a first luciferase gene is under the control of a constantly
expressed promoter, and a second luciferase gene is under the
control of a pseudopromoter.
[0069] 24. A method for screening drugs including a step of
culturing the mammalian cells according to any of the above 18 to
21 in the presence of a drug candidate compound in a medium of the
mammalian cells, a step of quantifying an amount of the above
luciferase in the presence or absence of the candidate compound,
and a step of assessing an effect of the candidate compound on a
promoter subjected to assessment, which is linked to at least one
luciferase.
[0070] 25. A system for multiply determining transcription activity
of each promoter linked to each luciferase before and after a
change of a culture environment by changing the culture environment
of the mammalian cells according to any of the above 13 to 23, and
assessing expressed amounts of two or more luciferases which emit
mutually distinct light whose luminescence wavelength does not
depend on a determining condition.
[0071] 26. The system according to the above 23 for simultaneously
determining expressed amounts of two or more luciferases.
[0072] 27. The system according to the above 23 capable of
determining expressed amounts of three or more luciferases.
[0073] The present invention will be illustrated in detail
below.
[0074] Two or more luciferases in the present invention are
required to emit light whose luminescence wavelength does not
substantially depend on a determining condition (e.g., pH) because
it is important to determine an emitted light intensity from two or
more luciferases and calculate a relative ratio thereof.
[0075] As used herein, "the luminescence wavelength does not
substantially depend on the determining condition" is that even if
a pH, temperature, concentration or the like is changed, a
variation of the maximum luminescence wavelength is 3 nm or less,
preferably 2 nm or less, more preferably 1 nm or less and in
particular, preferably 0.5 nm or less. If a changed amount of the
maximum luminescence wavelength is within this range, when the
expressed amounts of multiple luciferases are quantified by
separating with a filter(s), it is preferable because a mutual
ratio of the luciferases is scarcely changed.
[0076] As used herein, "two or more luciferases which emit mutually
distinct light" means that it is possible to determine the ratio of
emitted light intensities of the mutual lights using a filter
(color filter, band pass filter, etc.). For example, for a
red-emitting luciferase, a green-emitting luciferase from the rail
road worm and an orange-emitting luciferase, a green-emitting
luciferase from Rhagophthalmus ohba, it is possible to determine
the ratio of emitted light intensities of mutual lights by using
the filter to remove the green. To be capable of determining the
ratio of emitted light intensities of the mutual lights, it is
preferable to mutually separate the maximum luminescence
wavelengths by usually 20 nm or more, preferably 30 nm or more,
more preferably 40 nm or more and in particular, preferably 50 nm
or more.
[0077] Preferable luciferases used in the invention include
green-to-red-emitting (including mutants thereof, maximum
luminescence wavelength: 535 to 635 nm, e.g., 540 to 630 nm)
luciferases from the rail road worm, orange- to green-emitting
(including mutants thereof, maximum luminescence wavelength: 530 to
600 nm) luciferases from the click beetle, and orange- to
green-emitting (including mutants thereof, maximum luminescence
wavelength: 550 to 590 nm) luciferases from Rhagophthalmus ohba,
and the like. For example, in the case of the luciferases of the
rail road worm, the red-emitting luciferase with a maximum
luminescence wavelength of 622 nm and the green-emitting luciferase
with a maximum luminescence wavelength of 545 nm have been known
(US 2002/0119542), but the present inventor has identified that
there exist many luciferases which emit lights with 540 to 635 nm
in addition to these two. These luciferases can be all used. For
example, the present inventor has confirmed that the red-emitting
luciferase with a maximum luminescence wavelength of 622 nm
(expressed in insects or Escherichia coli) from the rail road worm
shifts the maximum luminescence wavelength to 630 nm when expressed
in mammalian cells. This red-emitting luciferase with a maximum
luminescence wavelength of 630 nm from the rail road worm was
discovered for the first time by the present inventor.
[0078] When multiple luciferases are used, to distinctively
determine each emitted light using the filter, it is desirable to
mutually separate the maximum luminescence wavelength by 20 nm or
more, preferably 30 nm or more, more preferably 40 nm or more and
in particular, preferably 50 nm. By separating the maximum
luminescence wavelength to this extent, the emitted light
intensities of respective lights can be quantified simultaneously
by using the filter between the maximum luminescence wavelengths,
measuring a transmittance of each light before and after the
filter, and converting.
[0079] For example, the maximum luminescence wavelengths of the
luciferases in FIG. 20 are a red-emitting (630 nm), an orange (580
nm) and a green (550 nm), and these can be sufficiently
separated.
[0080] In particular, when using the luciferases from the rail road
worm and Rhagophthalmus ohba having the multiple luciferases whose
maximum luminescence wavelengths are separated to some extent, it
is possible to simultaneously quantify the emitted light
intensities from the co-expressed multiple luciferases by the use
of one luminescent substrate (e.g., a firefly luciferin can be used
for the luciferases from the rail road worm, Rhagophthalmus ohba
and the click beetle), and the ratio of the expressed amounts of
promoters can be determined precisely. As the luciferase which
emits the light whose luminescence wavelength does not depend on
the determining condition (e.g., pH), it is possible to use Renilla
luciferase, various luciferases of dinoflagellate (including a
total sequence or luminescent domains such as Domains 1, 2 and 3;
JP-2002-335961; Li L., Hong R., Hasting J W., Proc. Natl. Acad.
Sci. USA (1997) 94, 8954), and marine ostracod luciferase by
further combining. When the luciferases from the rail road worm,
Rhagophthalmus ohba and the click beetle are used, the firefly
luciferin can be used, and thus it is possible to reduce the
background. The combination of the dinoflagellate luciferase with
the luciferin is preferable because the background is low.
[0081] In one preferable embodiment of the present invention, it is
possible to quantify the expressed amounts of at least three
promoters with one luciferin by the use of the luciferases from the
rail road worm, Rhagophthalmus ohba (e.g., the red-emitting
luciferase from the rail road worm, the orange-emitting luciferase
and the green-emitting luciferase from Rhagophthalmus ohba) (VR.
Viviani, A. Uchida, N. Suenaga, M. Ryufuku & Y. Ohmiya: Thr-226
is a key-residue for bioluminescence spectra determination in
beetle luciferases (2001) Biochem. Biophys. Res. Communi. 280,
1286-1291). It is also possible to quantify four or more by
combining the blue-emitting luciferase (each luciferase of Renilla,
the dinoflagellate or the marine ostracod). By successfully setting
the filters, it is possible to analyze multiple expressions between
540 to 635 nm (green to red-emitting), and preferably between 540
to 630 nm. Further, one more can be added by a blue-emitting
luciferase whose substrate is different. Therefore, as the
simultaneous determination of the luciferases, it is possible to
simultaneously quantify three or more when the same luciferin is
used, and four or more when the different luciferins are used.
[0082] Conventionally, as the luciferases expressible in the
mammalian cells, the Renilla luciferase and the firefly luciferase
have been known. However, the color of the light emitted from the
firefly luciferase varies from green to yellow depending on the pH
of a cell lysed solution. Therefore, when the expressed amounts of
two or more luciferases are compared, there has been a drawback
that an accuracy is lacked. The blue luminescence derived from the
Renilla luciferase is desirable in that its luminescence wavelength
does not substantially depend on the determining condition, but in
the determination system in which the firefly luciferase is
combined, it is necessary to separately perform both the
quantification using the firefly luciferin and the quantification
using the Renilla luciferin. Thus, there has been a drawback that
simplicity and accuracy are lacked.
[0083] The present inventor focused on the luciferase from the rail
road worm as the luciferase other than Renilla luciferase and the
firefly luciferase, and attempted to express this protein in the
mammalian cells, but could not express the luciferase from the rail
road worm in the mammalian cells using usual expression systems.
This is believed to be a reason why no luciferase other than
Renilla luciferase and the firefly luciferase has been expressed in
the mammalian cells, particularly human cells.
[0084] According to findings until now of the present inventor, in
one preferable embodiment of the invention, what really matters
upon practical application of the rail road worm luciferase, the
Rhagophthalmus ohba luciferase and the marine ostracod luciferase
is that a rail road worm luciferase gene, the Rhagophthalmus ohba
luciferase gene and the marine ostracod luciferase gene are stably
transcribed and stably translated. In a technique used in Example
of the present invention, it has been proven that the practical
application becomes possible by stabilizing transcribed mRNA and
increasing a number of translation frequency. That is, in this
case, it has become possible for the first time that the luciferase
gene from the rail road worm is expressed in the mammalian cells by
inserting a globulin intron to prolong a lifespan of mRNA and
inserting a Kozak sequence to increase the translation
frequency.
[0085] Further techniques in the preferable other embodiments of
the invention include, for example, changing the cDNA sequence from
the codon usage (bias of codon use frequency) for insects to that
for mammals for increasing copy numbers of mRNA, changing the cDNA
sequence such that no additional transcription factor is bound, and
changing the cDNA sequence with many restriction enzyme sites
because the application of such a sequence is limited. Such
techniques were useful for the expression of the luciferase from
the rail road worm and the Rhagophthalmus ohba luciferase in the
mammalian cells. In particular, the change to the codon usage (bias
of codon use frequency) for the mammals and the change of cDNA
sequence such that no additional transcription factor is bound are
more useful.
[0086] The change of the cDNA sequence can be performed by
considering the following order 1) to 4) sequentially:
[0087] 1) the amino acid sequence of the luciferase is not changed
as possible (preferably not changed at all);
[0088] 2) subsequently, the cDNA sequence is changed such that no
additional transcription factor is bound;
[0089] 3) further, the codon usage for the insects is changed to
that for the mammals in the cDNA sequence; and
[0090] 4) if necessary, the cDNA sequence is changed to reduce the
restriction enzyme sites.
[0091] In the above, the expression of the luciferase from the rail
road worm and the Rhagophthalmus ohba luciferase was described, but
the luciferases from other organisms such as a click beetle are
believed to similarly express.
[0092] As used herein, the "luciferase" encompasses a
light-emitting enzyme group such as luciferase which catalyzes a
luciferin photochemical reaction, and also includes those such as
aequorin. A protein having a luminescence action obtained by
changing a luciferin structure, whose catalysis (action where the
luciferin is oxidized to convert a light-emitting substance) is
weak can be included in the luciferase of the present invention as
long as its luminescence wavelength does not substantially depend
on the determining condition (e.g., pH).
[0093] As the luciferases, it is desirable to combine two or more
luciferases which emit the light with the same luminescent
substrate. As preferable luciferases whose luminescence wavelength
is not substantially changed by the determining condition and which
emit the light with the same substrate, a red-emitting luciferase
from the rail road worm and a green-emitting luciferase from the
rail road worm or other luciferases from the rail road worm having
the luminescence wavelength in the range of about 540 to 635 nm,
preferably about 540 to 630 nm, further a green-emitting luciferase
from Rhagophthalmus ohba and an orange-emitting luciferase from
Rhagophthalmus ohba are preferably exemplified. In addition to
them, the luciferases (about 530 to 600 nm) from the click beetle
are also exemplified. In particular, the red-/green-emitting
luciferases from the rail road worm and the orange-/green-emitting
luciferases from Rhagophthalmus ohba are convenient for multiply
quantify the transcription activities of promoters because emitted
light intensities are almost the same when amounts of the
luciferases are the same.
[0094] In the present invention, the mammals include human, cattle,
horse, sheep, monkey, swine, mouse, rat, hamster, guinea pig,
rabbit and dog, and is preferably the human.
[0095] It is preferable that at least two luciferase genes emit
different color lights with the same substrate and their
intracellular lifespan be similar. In this respect, the
red-/green-emitting luciferases from the rail road worm and the
orange-/green-emitting luciferases from Rhagophthalmus ohba are
preferable. In particular, the red-emitting luciferases from the
rail road worm and the orange-/green-emitting luciferases from
Rhagophthalmus ohba are preferable.
[0096] Furthermore, for the quantification of each emitted light
color by a simple apparatus, it is preferable to be capable of
separate by a filter (s) different emitted light colors of at least
one, preferably at least two luciferases whose luminescence
wavelengths used in the invention are not changed by the
determining condition (e.g., pH) and the other luciferase for
standardizing the above luciferases. For example, as shown in FIG.
5, the red-/green-emitting luciferases from the rail road worm is
preferable because they can be easily separated using the filter.
Furthermore, the combination of the red-/green-emitting luciferases
from the rail road worm with the luciferase (maximum luminescence
wavelength: 474 to 480 nm) derived from Renilla or
the-dinoflagellate is particularly preferable because the emitted
lights can be easily separated using two filters as shown in FIG.
10. The lights emitted from the red-emitting luciferases from the
rail road worm and the orange-/green-emitting luciferases from
Rhagophthalmus ohba can be mutually separated using two filters
(FIG. 19).
[0097] The luciferases from the rail road worm as in the above have
been known to express in Escherichia coli, but no expression
thereof in the mammalian cells, particularly human cells has been
known. In fact, even when the expression of the luciferases
(red-emitting, green-emitting) was attempted in the human cells,
the expression could not be induced using an SV40 or CMV promoter
alone which is a representative expression promoter in the
mammalian cells as shown in FIG. 2 and Example 1. In the case of
Rhagophthalmus ohba luciferases, an expression level is too low to
apply practically in the sequence known publicity, but the mutants
of the present invention have the expression levels of 44 times
(green) and 57 times (orange) compared to wild-type luciferase, and
have significant practicability. In the preferable embodiment of
the invention, an expressed amount of the wild-type is insufficient
because the expressed amount of the luciferase with particular
color is evaluated in luminescence spectra using the filter(s).
[0098] Gene sequences of the luciferases (red-emitting,
green-emitting) from the rail road worm are disclosed in US
2002/0119542-A1. A red-emitting luciferase gene (having an error)
in US 2002/0119542-A1 is shown in SEQ ID NO:5. Correct nucleotide
sequences of the luciferases from the rail road worm are shown in
SEQ ID NO:1 (green-emitting luciferase gene) and SEQ ID NO:3
(red-emitting luciferase gene), and correct amino acid sequences
are shown in SEQ ID NO:2 (green-emitting luciferase gene) and SEQ
ID NO:4 (red-emitting luciferase gene).
[0099] As the luciferase gene of the present invention, intact
wild-type or mutant luciferase genes can be used, and it is
possible to use DNA capable of hybridizing with the luciferase gene
under a stringent condition and DNA encoding a polypeptide having
one or more amino acid substitutions, additions, deletions or
insertions in the luciferase and having a luciferase activity as
the luciferase gene.
[0100] In one preferable embodiment, the present inventor has found
by examining various expression systems that it is important for
stable expression of the luciferase in the mammalian cells to
introduce an element for promoting efficiency of the translation
and/or an element for stabilization of mRNA into a gene construct.
As the element for promoting the efficiency of the translation,
Kozak sequence (Ko) and the like are exemplified. As the element
for the stabilization of mRNA, .beta.-globin intron II and the like
are exemplified. To stably express the luciferase in the mammalian
cells, in particular, a partial structure of (globin intron
II)-(Kozak sequence)-(red-/green-emitting luciferase) is
preferable. It has been also confirmed that it is preferable for
stable expression of the luciferase in the mammalian cells to
change the codon usage (bias of codon use frequency) for the
insects to that for the mammals and change the cDNA sequence such
that no additional transcription factor is bound.
[0101] In one preferable embodiment, the gene construct of the
invention can contain a luciferase gene, a promoter, the element
for promoting the efficiency of the translation and/or the element
for the stabilization of mRNA upstream of the gene, and further can
contain an enhancer, IRES, SV40 pA, a drug resistant gene
(Neo.sup.r, etc.) and the like.
[0102] Examples of the preferable gene construct of the present
invention will be shown below. [0103] (1) (CMV enhancer)-(chicken
.beta.-action promoter)-(.beta.-globin intron II)-(Kozak
sequence)-(-/green-emitting luciferase)-(SV40 poly A sequence)
[0104] (2) (CMV enhancer)-(chicken .beta.-action
promoter)-(.beta.-globin intron II)-(Kozak
sequence)-(red-/green-emitting luciferase)-(IRES)-(Neo gene)-(SV40
poly A sequence)
[0105] The gene construct of the invention may be directly
introduced into the mammalian cells, but it is preferable to
incorporate in a vector (e.g., including a plasmid and a viral
vector) to introduce into the mammalian cells. When multiple
luciferases are incorporated expressibly in a gene construct, one
gene construct or expression vector may be introduced into the
mammalian cells, and when one luciferase is incorporated in one
gene construct, multiple gene constructs or expression vectors may
be simultaneously or sequentially introduced into the mammalian
cells according to the standard method.
[0106] As combination of genes desirably determined simultaneously
by the system of the present invention, [0107] clock genes (Per
gene, Clock gene, BMAL gene, etc.) [0108] cancer genes (oncogene,
tumor suppressing gene, mitosis marker gene, etc.) [0109] genes
involved in diseases (pathology corresponding gene, life and death
sensitive apoptosis gene, hormone gene, etc.) [0110] constantly
expressed genes (actin gene, GAPDH (glyceraldehyde phosphate
dehydrogenase) gene, monkey-derived SV40 virus gene, etc) and the
like are exemplified.
[0111] The following application can be performed in the present
invention. [0112] (1) Primary screening: It is important to
simultaneously obtain 3 or more information on the assumption that
many specimens are exhaustively analyzed. Obviously multiple
combinations are thought. Considering drug discovery, it is
necessary to evaluate not only positive points but also negative
toxic points for effects of the drug. Furthermore, changes of two
genes at a transcriptional level reflect a status of a cell itself,
and thus, it is preferable to use a constantly expressed promoter
which indicates the status of the cell as a control. Therefore, in
the drug discovery screening, the following combinations are
exemplified.
[0113] In tables 1 and 2, -/blue-/green-emitting luciferases are
only exemplified, and it goes without saying that the other
luciferases including the orange-emitting luciferase or the
combinations thereof can be used. In particular, the combination of
red-/orange-/green-emitting luciferases from the rail road worm and
Rhagophthalmus ohba is particularly preferable because they can be
simultaneously determined with the firefly luciferin.
[0114] The luciferases with various color can be optionally
selected. TABLE-US-00001 TABLE 1 Drug discovery screening Subject
promoter + green- Evaluation of drug emitting luciferase effect
Toxicity evaluation Evaluation of drug promoter (apoptosis-related)
+ blue- safety emitting luciferase Constantly expressed promoter +
red- Evaluation of cell emitting luciferase condition
Green-/red-emitting: standardization of drug effect
Blue-/red-emitting: standardization of safety
[0115] In this case, the toxicity evaluation and the constant
expression are controls of the promoter subjected to the drug
evaluation, and thus it is also useful to construct in one vector.
A cell itself in which this vector has been incorporated is a basic
cell for screening. TABLE-US-00002 TABLE 2 Search of target
promoter sequence Unspecified promoter (sequence Evaluation of
group whose effect is unknown on drug effect promoter library) +
Green-emitting luciferase Pseudopromoter sequence (random
Evaluation of sequence or nonsense sequence) + Blue- drug safety
emitting luciferase Constantly expressed promoter + red- Evaluation
of emitting luciferase cell condition Green-/-emitting:
standardization of promoter effect Blue-/red-emitting:
standardization of pseudo information
[0116] In this case, the pseudopromoter and the constantly
expressed promoter are controls of the promoter subjected to the
screening, and thus it is also useful (not essential) to construct
in one vector. A cell itself in which this vector has been
incorporated is a basic cell for screening.
[0117] The combination of -/orange-/green-emitting can accomplish
the screenings represented in Tables 1 and 2 using one substrate.
That is, the blue-emitting luciferase is substituted with the
orange-emitting luciferase. In this case, the determination can be
performed using one substrate, and the determining method is
simpler. For determining the blue-emitting luciferase, it is
necessary to lyse cells, but the firefly luciferin permeates into
living cells with a concentration gradient and emits the light, and
thus it is possible to determine three emitted lights in the living
cells. Therefore, this method is characterized in that the
screening can be performed without lysing the cells.
[0118] Meanwhile, the combination of
red-/orange-/green-/blue-emitting has an advantage that an external
factor such as environmental disruptors can be simultaneously
evaluated, and can determine a change of transcription activities
of multiple genes in the cell affected by the external factor. For
example, monitoring of the expression of receptor which directly
captures the external factor is included. TABLE-US-00003 TABLE 3
Unspecified promoter (sequence Evaluation of group whose effect is
unknown on external factor promoter library) + Green-emitting
effect luciferase Pseudopromoter sequence (random Evaluation of
sequence or nonsense sequence) + Blue- external factor emitting
luciferase safety Promoter sequence of accepting Evaluation of
protein of external factor + Orange- accepting emitting luciferase
process of external factor Constantly expressed promoter + red-
Evaluation of emitting luciferase cell condition
Green-/red-emitting: standardization of promoter effect,
Blue-/red-emitting: standardization of pseudo information,
Orange-/red-emitting: standardization of external factor
acceptance, Green-/orange-emitting: evaluation of acceptance and
activation
[0119] In this case, a protein which accepts the external factor, a
protein affected thereby, and further the safety of the cell itself
can be evaluated, and the information which the external factor
gives to the cell can be precisely evaluated by standardizing them
with the control of the protein of the constantly expressed
promoter. Thus, it is also useful (not essential) to construct in
one vector. A cell itself in which this vector has been
incorporated is a basic cell for screening.
[0120] Examples of the primary screening are shown in FIG. 11.
[0121] (2) Secondary screening: It is important to obtain 3 or more
information on the assumption that the focused drug effects and
promoter signals are evaluated. In the drug discovery, multiple
effects of the drug are often assumed. It is also important to know
a gene which indicates the change of cell condition, transient
effects of the drug (e.g., toxicity, shock response, etc.), and
actual effects. For example, as shown in Tables 3 and 4, evaluation
systems of clock-related drug effects can be exemplified.
TABLE-US-00004 TABLE 3 Evaluation system of clock-related drug
effects Drug detection promoter (e.g., Evaluation of toxicity,
shock response, transient effect of etc.) + Green-emitting drug
luciferase Diurnally varying promoter Evaluation of (sequence of
BMAL or Per gene) + Blue- biological clock emitting luciferase Drug
corresponding promoter + Red- Evaluation of emitting luciferase
intracellular effects of drug Blue-/green-/red-emitting: temporal
axis evaluation of drug
[0122] TABLE-US-00005 TABLE 4 Evaluation system of clock-related
drug effects Drug detection promoter (e.g., Evaluation of toxicity,
shock response, transient effect of etc.) + Green-emitting drug
luciferase Diurnally varying promoter Evaluation of (sequence of
BMAL or Per gene) + biological clock Orange-emitting luciferase
Drug corresponding promoter + Red- Evaluation of emitting
luciferase intracellular effects of drug
orange-/green-/red-emitting: temporal axis evaluation of drug
[0123] In particular, as in the above, it is possible to determine
three emitted lights in the living cells using one substrate.
Therefore, the method is characterized in that the drug effect can
be evaluated according to the temporal axis without lysing the
cells.
[0124] A series of operations is performed for the same cells, and
thus the drug effect on the combination (history) of the multiple
operations can be evaluated.
[0125] An example of the secondary screening is shown in FIG.
12.
[0126] As in the above, by preferably simultaneously evaluating
expressed amounts of 2 or more, particularly 3 or more or 4 or more
promoters, when actions for one promoter are evaluated, it is
possible to standardize an activity, toxicity and the like or
standardize pseudo information.
[0127] Furthermore, when a phenomenon where the expressions of
multiple genes are intricately related in the mammal is elucidated,
the system of the present invention is extremely useful.
[0128] In the particularly preferable embodiment of the invention,
the method/system for simultaneously quantifying three or four gene
transcription activities using the red-emitting luciferase gene,
the green-emitting luciferase gene from the rail road worm, the
green-emitting luciferase gene, the orange-emitting luciferase gene
from Rhagophthalmus ohba, and the blue-emitting luciferase gene is
provided. By the use of this system, it is possible to
simultaneously determine multiple transcription activities in the
cells. It is possible to utilize them for the treatment/examination
of pathology and the new drug development.
[0129] At that time, color identification is performed, and the
multiple transcription activities in the cells can be
simultaneously determined by determining the luminescence activity
using the filters specified for the red-, green-, orange- and
blue-emitting. Much information can be simultaneously elicited for
the change in the cells, whose information has been conventionally
difficult to obtain from change information of one transcription
activity, and can be utilized for the treatment of various diseases
and the new drug development.
[0130] In the present invention, the mammalian cells having two
luciferase genes under the control of distinct promoters (1)
wherein a first luciferase gene is under the control of the
constantly expressed promoter and a second luciferase gene is under
the control of the toxicity assessing promoter or (2) wherein the
first luciferase gene is under the control of the constantly
expressed promoter and the second luciferase gene is under
the-pseudopromoter according to claim 14 are useful as intermediate
cells for producing the mammalian cells for drug screening by
further introducing the gene construct in which one or more
luciferase genes are incorporated under the control of promoters
subjected to the evaluation in these mammalian cells.
BEST MODE FOR CARRYING OUT THE INVENTION
[0131] The present invention will be illustrated in more detail
with reference to the following Examples, but it goes without
saying that the invention is not limited to the Examples.
EXAMPLE 1
[0132] A green-emitting luciferase gene and a red-emitting
luciferase gene (SEQ ID NO:1, 3) from a rail road worm are
expressed in Escherichia coli, but the expression thereof can not
be induced in mammalian cells using an SV40 or CMV promoter alone
which is a representative expression promoter in mammals. Thus, a
construct in which Kozak sequence and .beta.-globin intron II which
stabilize the gene expression were inserted, and further chicken
.beta.-actin promoter and CMV enhancer were selected was ligated to
the red- or green-emitting luciferase gene to make a gene
structure, and an enzyme activity was determined. (FIG. 2). This
was compared with a gene structure in which the luciferase gene had
been inserted downstream of the SV40 promoter, CMV promoter or CAG
promoter. Cultured fibroblast cells, NIH3T3 cells were transfected
with each gene using Lipofectamine, and a luminescence activity
after 24 hours in the cells was determined (FIG. 2). For
determining the luminescence activity, a luminescent substrate
mixed solution (supplied from Toyo B-Net Co., Ltd.) and AB-2000
were used as a substrate and as a luminescence determining
apparatus supplied from ATTO Corporation, respectively. To 50 .mu.L
of a cell extract solution, 50 .mu.L of PicaGene was added. As a
result, the highest activity was obtained in the cells into which
the (CMV enhancer)-(chicken .beta.-action promoter)-(.beta.-globin
intron II)-(Kozak sequence)-(red-/green-emitting luciferase)-(SV40
poly A sequence) gene had been introduced. The secondarily highest
activity was obtained in the cells into which the construct in
which (IRES)-(Neo gene)-(SV40 poly A sequence) had been inserted in
place of (SV40 poly A sequence) had been introduced. However, the
SV40 promoter or the CMV promoter alone elicited almost no
activity. But, the activity elicited by the (CMV enhancer)-(chicken
.beta.-action promoter)-(.beta.-globin intron
II)-(red-/green-emitting luciferase)-(IRES)-(Neo gene)-(SV40 poly A
sequence) gene was about 500/1, and the activity elicited by the
(CMV promoter)-(.beta.-globin intron II)-(Kozak
sequence)-(red-/green-emitting luciferase)-(SV40 poly A sequence)
gene was about 10/1 based on the activity elicited by the (CMV
enhancer)-(chicken .beta.-action promoter)-(.beta.-globin intron
II)-(Kozak sequence)-(red-/green-emitting luciferase)-(IRES)-(Neo
gene)-(SV40 poly A sequence) gene. Therefore, it has demonstrated
that it is preferable to insert (.beta.-globin intron II)-(Kozak
sequence) upstream of the enzyme gene, which is a region which does
not directly affect the transcription activity in order to stably
express the green-emitting luciferase gene from the rail road worm
and determine the gene transcription activity. This is believed to
attribute to the promotion of translation efficiency due to the
Kozak sequence and the stabilization of mRNA due to the
.beta.-globin intron II. It has been demonstrated that the
promotion of efficiency of and the stabilization of the transcript
including the luciferase gene are keys for practical
application.
EXAMPLE 2
[0133] Luminescence spectra of the red-emitting luciferase gene and
the green-emitting luciferase gene from the rail road worm
expressed in the mammalian cells were analyzed. To 15 .mu.L of an
extract solution of cells into which the (CMV enhancer)-(chicken
.beta.-action promoter)-(.beta.-globin intron II)-(Kozak
sequence)-(red-/green-emitting luciferase)-(SV40 poly A sequence)
genes which exhibited the highest activity had been introduced, 15
.mu.L of PicaGene was added, and the luminescence spectrum was
determined using a weak luminescence spectrum measuring apparatus
supplied from ATTO Corporation. FIG. 3 shows the luminescence
spectra when the spectrum was expressed singly, the maximum
luminescence wavelengths of 630 nm and 550 nm were observed in the
red-emitting luciferase and the green-emitting luciferase,
respectively. These spectra were not affected by pH and a
surrounding solutions, and were not changed at all.
EXAMPLE 3
[0134] Lifespan in the cells of the red-emitting luciferase gene
and the green-emitting luciferase gene from the rail road worm
expressed in the mammalian cells was evaluated. The cells into
which the (CMV enhancer)-(chicken .beta.-action
promoter)-(.beta.-globin intron II)-(Kozak sequence)-(red-emitting,
green-emitting luciferase)-(IRES)-(Neo gene)-(SV40 poly A sequence)
genes had been introduced were used. Cultured fibroblast cells,
NIH3T3 cells were transfected with the above luciferase gene to be
expressed in the cells by a lipofection method. Forty-eight hours
after the transfection, the medium was replaced with a medium
containing 100 .mu.M of a protein synthesis inhibitor,
cycloheximide, and the cells were cultured for 30 min.
Subsequently, the luminescence activity was determined with time by
the same method as that in Example 1. As a result, for both red and
green-emitting luciferases, the activity was reduced in the similar
time course, and a half life of each enzyme in the cells was about
3.5 hours (FIG. 4).
EXAMPLE 4
[0135] The red-emitting luciferase gene and the green-emitting
luciferase gene from the rail road worm, the (CMV
enhancer)-(chicken .beta.-action promoter)-(.beta.-globin intron
II)-(Kozak sequence)-(red-/green-emitting luciferase)-(SV40 poly A
sequence) genes were co-expressed in the cultured fibroblast cells
NIH3T3. The luminescence spectrum of the red-emitting luciferase
gene and the green-emitting luciferase gene from the rail road worm
in a cell extract solution obtained by lysing the co-expressing
cells was determined by the same technique as that in Example 2.
FIG. 5 shows the luminescence spectrum of the co-expressing cells.
Two peaks were observed because the red-emitting luciferase and the
green-emitting luciferase emit lights. This is a result of
simultaneously determining two gene transcription activities. When
these luminescence activities is determined by a luminometer using
a photomultiplier, a total sum of the luminescence activities of
two red and green-emitting luciferase genes from the rail road is
observed. Thus, to determine only the luminescence activity of the
green-emitting luciferase, the light of the red-emitting luciferase
was cut off. Evaluating from the luminescence spectrum, a cut off
filter of light wavelengths represented by a dot line in FIG. 5 was
selected. By the use of this filter, 8% of the green-emitting
luciferase activity and 76% of red-emitting luciferase activity can
be detected, and by converting it is possible to evaluate emitted
light intensities from the red- and green-emitting luciferases and
abundance thereof.
EXAMPLE 5
[0136] To 50 .mu.L of a cell extract solution containing the
red-emitting luciferase and the green-emitting luciferase, 50 .mu.L
of PicaGene was added, and the luminescence activity was measured
with one min intervals using a dish type luminometer AB2500
supplied from ATTO Corporation to yield luminescence reaction
curves as shown in FIG. 6. The activity was not stabilized within 5
min after the start of the reaction, but both activities were
stabilized after 6 min. Thus, when the luminescence activity in the
cells in which the red-emitting luciferase gene and the
green-emitting luciferase gene had been co-expressed was measured,
the activity was measured at a time zone at which the luminescence
reaction was stable. A measuring procedure is as follows: 1) the
emitted light intensity is measured without a filter (color filter
R54 type supplied from Hoya Corporation) (luminescence activities
of red- and green-emitting luciferases); 2) the filter (color
filter R54 type supplied from Hoya Corporation) determined in
Example 4 is inserted in the luminometer, the emitted light
intensity is measured to make it the luminance activity of the
green-emitting luciferase; and 3) the luminescence activity of the
red-emitting luciferase is calculated by converting a transmittance
of the filter (color filter R54 type supplied from Hoya
Corporation).
EXAMPLE 6
[0137] It was examined in a model experiment whether the
red-emitting luciferase and the green-emitting luciferase at
different abundance ratio can be quantified by the procedure
determined in Example 5. In FIG. 7, for samples in which the
abundance ratio of the red-emitting luciferase and the
green-emitting luciferase had been changed, 1) total intensities of
emitted light were measured; 2) only the green-emitting luciferase
was measured, and 3) the amounts of the red-emitting and
green-emitting luciferases were quantified. As a result, it has
been demonstrated that the luminescence activity is changed in a
linear relationship with the abundance ratio thereof. This
indicates that the amounts of the red-emitting luciferase and the
green-emitting luciferase which have shown different expressed
amounts in the cells can be quantified by the luminometer to which
the color filter (color filter R54 type supplied from Hoya
Corporation) was inserted.
EXAMPLE 7
[0138] To examine an availability of the present system, the gene
transcription activities of two clock genes were measured, and
standardized using simultaneously a promoter which exhibited the
constant gene transcription activity as the third gene
transcription activity. Specifically, the NIH3T3 cells were
co-transfected with an (E54), an element linking an E-box 3, 4, 5
in mouse Per promoter-(chicken .beta.-action
promoter)-(.beta.-globin intron II)-(Kozak sequence)-(red-emitting
luciferase)-(SV40 poly A sequence) gene and an REV-ERV/ROR element
1,2 (RORE) in mouse BMAL1 promoter-(chicken .beta.-action
promoter)-(.beta.-globin intron II)-(Kozak
sequence)-(green-emitting luciferase)-(SV40 poly A sequence) gene,
and a blue-emitting luciferase vector for the standardization
(phRL-TK, Promega) together with human BMAL1, human CLOCK, and
mouse ROR-4 expression vector. After 24 hours, the cells were
lysed, and luciferase luminescence wavelengths in the cells were
analyzed using a spectrometer. As a result, the luminescence
wavelengths from these two luciferases were detected, and these
showed the same luminescence spectrum as that when the individual
luciferase alone was expressed. Thus, the luminescence activity of
the red- and green-emitting luciferases was measured. The
transcription activities obtained by further standardizing these
activity values with the activity value of the blue-emitting
luciferase are shown in FIG. 8. In separate experiments, it has
been known that when BMAL1 and CLOCK proteins are expressed in the
cells, the element (E54) promoter linking the E-box 3, 4, 5 is
activated and an (ROR.alpha.) promoter is inactivated whereas when
the mouse ROR-4 is expressed in the cells, the (RORA) promoter is
highly activated. The activities of the red- and green-emitting
luciferases simultaneously measured in the present experiment
quantitatively show the transcription activity difference of (E54)
promoter and (ROR.alpha.) promoter.
EXAMPLE 8
[0139] The red-emitting luciferase gene and the green-emitting
luciferase gene from the rail road worm, (CMV enhancer)-(chicken
.beta.-action promoter)-(.beta.-globin intron II)-(Kozak
sequence)-(red-/green-emitting luciferase)-(SV40 poly A sequence)
genes and the blue-emitting luciferase vector (phRL-TK, Promega)
were co-expressed in the cultured fibroblast cells NIH3T3. The
co-expressing cells were lysed, and the luminescence spectrum of
the red-emitting luciferase and the green-emitting luciferase from
the rail road worm and the blue-emitting luciferase from Renilla in
a cell extract solution was measured by the same technique as that
in Example 2. FIG. 9 shows the luminescence spectrum of the
co-expressing cells. Three peaks emitted from the red-, green- and
blue-emitting-luciferases were observed, and heights of the peak
reflect heights of respective promoter activities. The
transcription activities of three genes can be evaluated by
converting to the intensity of emitted red, green or blue light
using a an emitted light intensity determining apparatus with
filters capable of identifying the emitted light colors.
EXAMPLE 9
[0140] The NIH3T3 cells were co-transfected with the red-emitting
luciferase gene and the green-emitting luciferase gene from the
rail road worm, (CMV enhancer)-(chicken .beta.-action
promoter)-(.beta.-globin intron II)-(Kozak
sequence)-(red-/green-emitting luciferase)-(SV40 poly A sequence)
genes by lipofection. After culturing for 16 hours, the medium was
replaced with a medium containing 100 nM dexamethasone, and the
cells were cultured for 2 hours. Subsequently, the medium was
replaced with a medium containing 100 pM firefly luciferin, and the
luminescence activity of the red- and green-emitting luciferases
was continuously measured using the dish type luminometer AB2500
supplied from ATTO Corporation. FIG. 10 shows the result of
continuously measuring the transcription activity. If using a
continuous emitted light intensity determining apparatus which
identifies the emitted light colors, it is possible to continuously
measure two transcription activities.
EXAMPLE 10
[0141] To stably express in the mammalian cells, the sequence of
the red-emitting luciferase gene was designed with keeping the
followings in mind. By (1) the changes of 34 transcription factor
binding sites (48 DNA sequences) (Table 4); (2) the changes of 279
DNA sequences for making the codon use frequency close to the
mammalian use frequency (Table 5); and (3) the changes of 15 common
restriction enzyme sites (4 in 45 DNA sequences are the same as
those of the transcription factor binding sites) (Table 6), the
sequence of SEQ ID NO:7 was designed and a construct (SEQ ID NO:7)
was artificially made. This sequence has 77.5% homology with the
wild-type red-emitting luciferase gene (SEQ ID NO:3) from the rail
road worm and 82.8% homology with the red-emitting luciferase
mutant described in WO 2003/016839 (FIGS. 13 and 14).
TABLE-US-00006 TABLE 4 Position Predicted transcription factor
number Mutant sequence (Italic means a mutated part)
Octamer-binding factor 1 89-103 (A99T)
cagcaggactacaattatatcaatcattat ataaatattcttata tt
actgacggaataatcgatgcccatacca Pit1, GHF-1 pituitary specific pou
91-101 (T96C) gcaggactacaattatatcaatcattatat aaatactcgta tattac
domain transcription factor (A99G) tgacggaataatcgatgcccatac Myf5
myogenic bHLH protein 164-178 (C168A)
caatgaagtaatatcatatgctcaaatatt tgaaacaagttgccgct (C171T)
tggcagttagtctagaaaaatatggcttgg E2F, involved in cell cycle 186-200
(A195G) aatattgaaaccagctgccgcttggcagt tagtctagagaaata tgg
regulation, interacts with Rb p107 cttggatcataacaatgttgtggcaat
protein cellular and viral TATA box elements 268-284 (T276C)
gaaaacaacatacacttttttggcccttta attgctgccctatacca (T277C)
aggaataccaatggcaacatcaaatgatat Ikaros 3, potential regulator of
281-293 (A288G) Acttttttggccctttaattgctgctttat accaagggatacc aatg
lymphocyte differentiation gcaacatcaaatgatatgtacacaga cellular and
viral CCAAT box 332-342 (T336C) catcaaatgatatgtacacagaaagggaga
tgatcggccat ttgaat atatcgaaaccatgccttatgttt Mammalian C-type LTR
TATA box 414-440 (C426T) tttattctgaaagtacaaaaacatctagat
tttctcaaaaaagtcat (T429C) agtcattgatagtatgtacgatatcaatgg TCF/LEF-1,
involved in the Wnt 484-500 (C489T) atgtacgatatcaaggcgttgaatgcgta
tttagttttgtttcacg signal transduction pathway
ttatactgatcacgcctttgatccagtgaa X-box binding protein 1 491-505
(T501G) atatcaatggcgttgaatgcgtatttagct ttgtttcacggtata ct
gatcacgcctttgatccagtgaaattta TCF/LEF-1, involvede in the Wnt
511-527 (C516G) gtatttagctttgtttcacgttatactgat cacgcgttcgatccagt
signal transduction pathway (T519C) gaaatttaacccaaaagagtttgatccctt
Hox-1.3, vertebrate homeobox 562-578 (A570G)
tttaacccaaaagagtttgatcccttggaa agaaccgcgctaattat protein (T571C)
gacatcatctggaacaactggattgcctaa COMP1, coperates with myogenic
593-613 (A600C) gaaccgcattaattatgacatcatctggaa caactggcctgcctaaag
proteins in multicomponent complex (T601C) ggg
tagtaataagccatagaagtataactataa Prostate-specific homeodomain
626-638 (A630G) ctggattgcctaaaggggtagtaataagcc ataggagtataac tata
protein NKX3.1 agattcgtccatagcagtgatcccat POU factor Brn-2 (N-Oct
3) 817-833 (A822C) aagaaatttgagggcgaattcttcttaaaa accatccaaaattacaa
aatcgcttctattgtagttcctcctccaat Pu.1 (Pul20) Ets-like transcription
844-860 agggcgaattcttcttaaaaaccatacaaa actacaaaatc gcttct factor
identified in lymphoid attgtagttcctcctccaattatg B-cells Hox-1.3,
vertebrate homeobox protein 880-896 (A888T)
gttcctcctccaattatggtatatttggct aaaagtcctctagtcga (T889C)
tgaatacaatttatcgagcttaacggaaat transcriptional repressor CDP
903-919 (T907C) tttggctaaaagtccattagtcgatgaata caatctgtcgagc ttaa
(A909G) cggaaattgcttgtggagggtctcct complex of Lmo2 bound to Tal-1,
E2A 951-963 (T957C) ggaaattgcttgtggagggtctcctttagg aagagacatcgca
gata proteins, and GATA-1, half-site 2 aagtagcaaagagattgaaagtacat
TCF/LEF-1, involved in the Wnt 967-983 (A975C)
gggtctcctttaggaagagatatcgcagat aaagtagccaagagatt signal
transduction pathway gaaagtacatggaatcctacaaggatatgg
Prostate-specific homeodomain 1036-1048 (T1044G)
ggatatggattaaccgaaacctgcagcgct ctaatactgagcc ccaa protein NKX3.1
tgatcgagaacttaaaaaaggtgcaa transcriptional repressor CDP 1049-1065
(T1053C) ccgaaacctgcagcgctctaatacttagcc ccaacgatagagaactt (C1057A)
aaaaaaggtgcaattggaacgcctatgcca Ribonucleoprotein associated zinc
1066-1086 (A1071G) ctaatacttagccccaatgatcgagaactt
aaaaagggtgcaattgga finger protein MOK-2 (human) acg
cctatgccatatgttcaagttaaagttata Octamer-binding factor 1, 1158-1170
(A1161G) tgggaaggcgctaggaccaagagaaaaagg cgagatttgcttc aaaa
POU-specific domain (A1164T) gtcaaatgcttatgaaaggatatcac Exotropic
viral integration site 1 1182-1198 (A1191G)
aaaaggcgaaatatgcgttcaaaagtcaaat gcttatgaagggctatc encoded factor
(A1194C) acaacaaccgcaagcaactcgtgatgctc Nuclear factor Y (Y-box
binding 1236-1250 (T1242G) tccgcaagcaactcgtgatgctcttgacaa
agatgggtggcttca ta factor) ctggggatcttggatattacgacgaaga
Prostate-specific homeodomain 1309-1321 (A1314G)
gacagatttatctatgtagttgatcgattg aaagagcttatta aata protein NKX3.1
taaaggatatcaggttgcgcctgctg Special AT-rich sequence-binding
1314-1330 (T1317C) atttatctatgtagttgatcgattgaaaga actcatcaaatataaag
protein 1, predominantly expressed (T1320C)
gatatcaggttgcgcctgctgaactggaaa in thymocytes, binds to matrix
attachment regions (MARs) Octamer-binding factor 1 1373-1387
(T1377C) cgcctgctgaactggaaaatctgcttttac aacacccaaatattt ct
gatgcgggtgttattggaattccggacg POU factor Brn-2 (N-Oct 3) 1379-1395
(A1380T) ctgaactggaaaatctgcttttacaacatc ctaatatttctgatgcg
ggtgttattggaattccggacgaatttgct Octamer-binding factor 1 1399-1413
(T1401C) ttacaacatccaaatatttctgatgcgggt gtcattggaattccg ga
cgaatttgctggtcaattaccttccgcg Binding site for a Pbxl/Mesi1
1422-1438 (A1431G) tgcgggtgttattggaattccggacgaatt tgctggtcagttacctt
heterodimer ccgcgtgtgttgtgttagagcctggtaaga GATA-binding factor 2
1548-1560 (A1551C) aactaaacatcttcgaggcggtgtcgtatt tatcgacagtatt
ccaa (T1554C) aaggcccaacaggaaaactcatgaga Cart-1 (cartilage
homeoprotein 1) 1624-1640 (T1636C) gaactccgtgcaatatttgcccgggaacag
gcaaaatcaaaactata a
[0142] TABLE-US-00007 TABLE 5 RED RED- complete mutant Amino Acid
Codon # % # % Met ATG 14 100.0 14 100.0 Trp TGG 1 100.0 1 100.0 Glu
GAA 26 83.9 3 9.7 GAG 5 16.1 28 90.3 Phe TTT 19 76.0 7 28.0 TTC 6
24.0 18 72.0 Asp GAT 25 83.3 16 53.3 GAC 5 16.7 14 46.7 Cys TGT 3
33.3 5 55.6 TGC 6 66.7 4 44.4 His CAT 12 80.0 0 0.0 CAC 3 20.0 15
100.0 Gln CAA 12 80.0 0 0.0 CAG 3 20.0 15 100.0 Asn AAT 13 65.0 2
10.0 AAC 7 35.0 18 90.0 Tyr TAT 17 70.8 9 37.5 TAC 7 29.2 15 62.5
Lys AAA 32 82.1 6 15.4 AAG 7 17.9 33 84.6 Ile ATT 20 43.5 6 13.0
ATC 8 17.4 40 87.0 ATA 18 39.1 0 0.0 *** TAA 1 100.0 1 100.0 TAG 0
0.0 0 0.0 TGA 0 0.0 0 0.0 Thr ACT 11 37.9 0 0.0 ACC 7 24. 21 72.4
ACA 9 31.0 8 27.6 ACG 2 6.9 0 0.0 Pro CCT 11 35.5 15 48.4 CCC 3 9.7
4 12.9 CCA 14 45.2 11 35.5 CCG 3 9.7 1 3.2 Ala GCT 13 37.1 3 8.6
GCC 4 11.4 30 85.7 GCA 14 40.0 0 0.0 GCG 4 11.4 2 5.7 Gly GGT 7
17.5 0 0.0 GGC 9 22.5 34 85.0 GGA 20 50.0 4 10.0 GGG 4 10.0 2 5.0
Val GTT 14 36.8 0 0.0 GTC 6 15.8 5 13.2 GTA 13 34.2 0 0.0 GTG 5
13.2 33 86.8 Arg AGA 8 40.0 8 40.0 AGG 1 5.0 4 20.0 CGT 6 30.0 0
0.0 CGC 1 5.0 4 20.0 CGA 3 15.0 0 0.0 CGG 1 5.0 4 20.0 Ser AGT 8
25.0 2 6.3 AGC 7 21.9 13 40.6 TCT 4 12.5 4 12.5 TCC 1 3.1 13 40.6
TCA 10 31.3 0 0.0 TCG 2 6.3 0 0.0 Leu CTT 13 25.0 1 1.9 CTC 3 5.8 2
3.8 CTA 9 17.3 1 1.9 CTG 4 7.7 47 90.4 TTA 15 28.8 0 0.0 TTG 8 15.4
1 1.9
[0143] TABLE-US-00008 TABLE 6 Sequence Sequence Restriction enzyme
site before change after change 35 BssSI Ctggtg Ctcgga 92 SsPI
Aatatt Aatact 118 ClaI Atcgat Atcgac 146 NdeI Catatg Cctatg 155
SsPI Aatatt Gatttt 189 XbaI Tctaga Cctgga 282 EcoT14I Ccaagg Ccaggg
417 XbaI Tctaga Cctgga 460 EcoRV Gatatc Gacatc 524 ApoI Aaattt
Aagttc 553 EcoT14I Ccttgg Ccctgg 570 PshBI Attaat Gctgat 769 AflIII
Cttaag Ctgaag 790 ApoI Aaattt Aagttt 802 ApoI, EcoRI Gaattc Gagttc
955 EcoRV Gatatc Gacatc 1030 Aor51HI Agcgct Agcgcc 1075 MunI Caattg
Ccatcg 1094 NdeI Catatg Cctatg 1117 EcoRV Gatatc Gacatc 1193 EcoRV
Gatatc Gctacc 1217 BssSI Ctcgt Ccagg 1301 ClaI Atcgat Atcggc 1331
EcoRV Gatatc Gctacc 1381 SspI Aatatt Aacatc 1406 EcoRI, ApoI Gaattc
Gcatcc 1410 AccIII Tccgga Cccaga 1417 ApoI Gaattt Gagttt 1605 SspI
Aatatt Catctt 1613 SmaI Cccggg Cccgcg
EXAMPLE 11
[0144] Vectors in which a wild-type or mutant luciferase gene was
inserted downstream of three kinds of promoters (CMV, SV40 or CAG
{CAG: (CMV enhancer)-(chicken .beta.-action
promoter)-(.beta.-globin intron II)-(Kozak sequence)} were made
(wild-type: CMV-Red, CAG-Red, mutant: CMV-REDm, CAG-REDm). At that
time, the vectors in which an SKL sequence known as a peroxisome
transfer sequence at the C-terminus had been deleted were made
(wild-type: SV40-Red(-SKL), mutant: SV40-REDm(-SKL), CAG-REDm).
[0145] The NIH3T3 cells were transfected with each gene using
Lipofectamine, and the luminescence activity in the cells after 24
hours was measured (FIG. 15). A luminescent substrate mixed
solution (Toyo B-Net Co., Ltd.) and AB2500 supplied from ATTO
Corporation were used as the substrate and as a luminescence
determining apparatus, respectively for the measurement of the
luminescence activity. A sample was made by adding 50 .mu.L of
PicaGene to 50 .mu.L of a cell extract solution. The sample
containing CMV-Red or SV40-Red(-SKL) showed a value of around 1000
RLU whereas the sample containing CMV-REDm or SV40-REDm(-SKL)
showed a value of 2.times.10.sup.7 to 4.times.10.sup.7 RLU. As
shown in FIG. 15, the high activity was observed in the sample
containing CAG-Red, but in the sample containing its mutant, the
activity was increased by about two times. The SKL sequence was
believed to be involved in activity increase, but the activity in
the sample containing SKL was increased by only several %. From
these results, it has been demonstrated that CAG and REDM are
useful as reporter genes for analysis of the expression of
mammalian genes. By the technique in Example 10, it is possible to
stably express the luciferase from rail road worm in the mammalian
cells. Therefore, by the similar procedure, the sequence of the
green-emitting luciferase gene from rail road worm was modified
(SEQ ID NO:16). In the modified sequence, 16 transcription factor
binding sites were modified in the wild-type, and it has 76%
homology with the wild type.
EXAMPLE 12
[0146] The luminescence spectrum of the red-emitting luciferase
gene derived from the rail road worm, expressed in the mammalian
cells was analyzed. To 15 .mu.L of an extract solution of the cells
(NIH3T3 derived from a mouse, Rat-1 derived from a rat, A543 cells
from human) transfected with the CMV-REDm gene whose activity was
the highest, 15 .mu.L of PicaGene was added, and the luminescence
spectrum was measured using a weak luminescence spectrum
determining apparatus supplied from ATTO Corporation. As a
reference, the luminescence spectrum in an extract solution of silk
worm insect cells transfected with the gene described in SEQ ID
NO:3 was also measured. FIG. 16 shows the luminescence spectra
expressed in the mouse NIH3T3 cells (bold line) and silk worm
insect cells (thin line). The maximum luminescence wavelength in
the mouse NIH3T3 cells was 630 nm and that in the silk worm insect
cells was around 622 nm. These spectra were not affected by pH and
the surrounding solution, and were always displayed as the same
spectra. The maximum luminescence wavelength in Rat-1 cells from
the rat and A543 cells from the human was also 630 nm.
EXAMPLE 13
[0147] In order to stably express in the mammalian cells, in the
sequences of wild-type Rhagophthalmus ohba green-emitting
luciferase (the gene sequence and the amino acid sequence are shown
in SEQ ID NOS:8 and 12, respectively.) and the wild-type
Rhagophthalmus ohba orange-emitting luciferase (the gene sequence
and the amino acid sequence are shown in SEQ ID NOS:9 and 13,
respectively.), with keeping the followings in mind, constructs
were artificially made.
[0148] 1) Changes of 15 transcription factor binding sites (20 DNA
sequences) (Table 7)
[0149] 2) Changes of 322 DNA sequences for making the codon use
frequency close to the mammalian codon usage (Table 8).
[0150] 3) Changes of 30 common restriction enzyme sites (2 in 49
DNA sequence are the same as those of the transcription factor
binding sites) (Table 9).
[0151] In Tables 8 and 9, RoLWT represents the wild-type
Rhagophthalmus ohba luciferase, and RoLm represents the mutant
Rhagophthalmus ohba luciferase.
[0152] The gene sequence of the resulting mutant Rhagophthalmus
ohba green-emitting luciferase gene and the amino acid sequence
thereof are shown in SEQ ID NOS:10 and 14, respectively. The gene
sequence of the resulting mutant Rhagophthalmus ohba
orange-emitting luciferase gene and the amino acid sequence thereof
are shown in SEQ ID NOS:11 and 15, respectively.
[0153] The homology between the mutant Rhagophthalmus ohba
green-emitting luciferase gene sequence (SEQ ID NO:10) and the
wild-type Rhagophthalmus ohba green-emitting luciferase gene
sequence (SEQ ID NO:8) is 76.0% (FIG. 17) TABLE-US-00009 TABLE 7
Mutant Predicted transcription factor number Mutant sequence
(Italic means a mutated part) Activator protein 4 64-80 (C69T)
cccagggaccccctggacctgggcaccgcc ggcattcagctctacag (G75C)
agccctgaccaacttctccttcctgaggga RAR-related orphan receptor alpha2
81-97 (A81G) cctgggcaccgccggcatccagctgtacag ggccctgaccaacttct
ccttcctgagggaggccctgatcgacgccc Nuclear factor 1 169-187 (C183T)
gtggtgtcttacgccgacatcctggagaac agctgtagactggctaag t
gctacgagaactacggcctgcgccagaaca Progesterone receptor binding site
237-255 (C243T) gcgccagaacagcgtgatctccgtgtgcag cgagaatagcaccatctt c
ttctaccccgtgatcgccgccctgtacatg Tumor suppressor p53 458-478 (C462T)
tcaagaaggtggtgctgctggacagcaagg aggatatgggcgaggccc (5' half site)
agt gcctgagcaacttcatggcccggtactccg Tumor suppressor p53 563-583
(G573T) tcaagccaagggacttcgacgccaaggagc aggtggcccttattatgt (5' half
site) (C576T) cct cctctggcaccaccggcctgccaaagggcg Zinc finger
transcription factor 850-864 (C858T) atcgagaagtacagaatcccaacaatcgtg
ctggcccctcctgtg at ZBP-89 (C861T) ggtgttcctggccaagagccccctggtg
Nuclear factor 1 865-883 (C879T) atcccaacaatcgtgctggccccccccgtg
atggtgttcctggctaag a gccccctggtggaccagtacgacctgtcca Member of b-zip
family, induced by 950-964 (G960T) gagaggtggccaccggcggcgcccctgtgg
gcaccgaggttgccg tg ER damage/stress, binds to the ERSE
gccgtggccaagcggctgaagatcggcg in association with NF-Y X-box-binding
protein 1 1252-1266 (C1263A) gccatcgacaaggagggctggctgcactcc
ggcgacgtgggatac ta cgacgacgatggccacttcttcgtggtg H6 homeodomain
HMX3/Nkx5.1 1278-1290 (C1281A) ctccggcgacgtgggctactacgacgacga
tggacatttcttc gtgg transcription factor (C1284T)
tggaccggctgaaggagctgatcaag Ribonucleoprotein associated zinc
1302-1322 (G1308A) cgacgatggccacttcttcgtggtggaccg
gctgaaagagctgatcaa finger protein MOK-2 (mouse) gta
caagggctaccaggtggcccccgccgagct Winged helix protein, involved in
1385-1395 (C1389T) Agtggctgctgctccagcacccatccatca aggatgccggc
gtgacc hair keratinization and thymus ggcgtgcccgacgaggccgccggc
epithelium differentiation NF-kappaB (p50) (1502-1516) (G1560A)
ccgagcaggagatcatcgactacatcgccg agcgagtgtctccca cc (C1512T)
aagcgcatccggggcggcgtcgtcttcg Winged helix protein, involved in
1531-1541 (C1536A) gagcgggtgtcccccaccaagcgcatccgg ggcggagtcgt
cttcgt hair keratinization and thymus ggacgacatccccaagggcgccac
epithelium differentiation
[0154] TABLE-US-00010 TABLE 8 RoL WT RoLm Amino Acid Codon # % # %
Met ATG 10 1.84 10 1.84 Trp TGG 2 0.37 2 0.37 Glu GAA 31 5.7 1 0.18
GAG 5 0.92 35 6.43 Phe TTT 11 2.02 0 0 TTC 13 2.39 24 4.41 Asp GAT
15 2.76 3 0.55 GAC 12 2.21 24 4.41 Cys TGT 5 0.92 1 0.18 TGC 5 0.92
9 1.65 His CAT 8 1.47 1 0.18 CAC 2 0.37 9 1.65 Gln CAA 9 1.65 0 0
CAG 4 0.74 13 2.39 Asn AAT 11 2.02 1 0.18 AAC 7 1.29 17 3.12 Tyr
TAT 11 2.02 0 0 TAC 8 1.47 19 3.49 Lys AAA 28 5.15 1 0.18 AAG 12
2.21 39 7.17 Ile ATT 19 3.49 2 0.37 ATC 10 1.84 34 6.25 ATA 7 1.29
0 0 *** TAA 1 0.18 1 0.18 TAG 0 0 0 0 TGA 0 0 0 0 Thr ACT 9 1.65 0
0 ACC 13 2.39 30 5.51 ACA 5 0.92 2 0.37 ACG 5 0.92 0 0 Pro CCT 6
1.1 4 0.74 CCC 8 1.47 16 2.94 CCA 7 1.29 4 0.74 CCG 4 0.74 0 0 Ala
GCT 14 2.57 4 0.74 GCC 10 1.84 35 6.43 GCA 8 1.47 0 0 GCG 6 1.1 0 0
Gly GGT 6 1.1 0 0 GGC 7 1.29 34 6.25 GGA 18 3.31 5 0.92 GGG 8 1.47
0 0 Val GTT 14 2.57 1 0.18 GTC 10 1.84 3 0.55 GTA 17 3.12 1 0.18
GTG 6 1.1 42 7.72 Arg AGA 8 1.47 9 1.65 AGG 4 0.74 7 1.29 CGT 3
0.55 0 0 CGC 4 0.74 3 0.55 CGA 6 0.92 1 0.18 CGG 2 0.37 6 1.1 Ser
AGT 6 1.1 0 0 AGC 8 1.47 14 2.57 TCT 7 1.29 3 0.55 TCC 3 0.55 17
3.12 TCA 3 0.55 0 0 TCG 7 1.29 0 0 Leu TTA 19 3.49 0 0 TTG 16 2.94
0 0 CTT 12 2.21 1 0.18 CTC 1 0.18 4 0.74 CTA 3 0.55 0 0 CTG 6 1.1
52 9.56
[0155] TABLE-US-00011 TABLE 9 Restriciton enzyme site RoLWT ROLm 35
AvaI CTCGAG CCAGGG 35 XhoI CTCGAG CCAGGG 59 PstI CTGCAG CCGCCG 65
ApoI GAATTC GCATTC 65 EcoRI GAATTC GCATTC 70 MunI CAATTG CAGCTC 90
ApoI GAATTT CAACTT 438 ScaI AGTACT GGTGCT 528 ApoI AAATTT AAACTT
532 DraI TTTAAA TTCAAG 618 HincII GTTAAC GCTGAC 618 HpaI GTTAAC
GCTGAC 630 ApoI AAATTT GAACCT 660 BamHI GGATCC GGACCC 744 Psp1406I
AACGTT AACCCT 793 BspT104I TTCGAA TTCGAG 810 Af1II CTTAAG CCTGAG
833 ApoI GAATTC GAATCC 833 EcoRI GAATTC GAATCC 931 AgeI ACCGGT
ACCGGC 1038 PshBI ATTAAT GCTGAT 1050 BspHI TCATGA CCACGA 1113 BglII
AGATCT GGACCT 1165 DraI TTTAAA TTCAAG 1225 ClaI TTTAAA TTCAAG 1273
PshAI GACGATGGTC GACGATGGAC 1296 PvuI CGATCG GGACCG 1302 DraI
TTTAAA GCTGAA 1328 EcoRV GATATC GCTACC 1523 Bst1107I GTATAC
GCATCC
EXAMPLE 14
[0156] Vectors in which the wild-type or mutant luciferase gene
(orange- or green-emitting from Rhagophthalmus ohba) was inserted
downstream of three kinds of the promoters SV40 were made
(wild-type: SV40-RoL (Green) and SV40-RoL (orange), mutant:
SV40-RoL (Green)m and SV40-RoL (Orange)m). The cultured fibroblast
cells, NIH3T3 cells were transfected with each gene using
Lipofectamine Plus, and the luminescence activity in the cells
after 24 hours was measured. A luminescent substrate mixed solution
(supplied from Toyo B-Net Co., Ltd.) and LB9506 supplied from
Berthold were used as a substrate and as a luminescence determining
apparatus, respectively. A sample was made by adding 50 .mu.L of
PicaGene to 50 .mu.L of a cell extract solution. As a result, the
samples containing the wild type SV40-RoL (Green) and SV40-RoL
(orange) exhibited values of about 1.times.10.sup.6 and
4.times.10.sup.5 RLU, respectively whereas the samples containing
mutant SV40-RoL (Green)m and SV40-RoL (Orange)m exhibited values of
5.times.10.sup.8 and 8.times.10.sup.7 RLU, respectively. Comparing
the wild type with the mutant, when the value of the wild-type is
made 1, the activity values were increased by about 44 times and
about 57 times in the mutant green and orange luciferases,
respectively. These results demonstrate that the mutant is useful
as the reporter gene for the analysis of the mammalian gene
expression.
EXAMPLE 15
[0157] An outline of a method for simultaneously determining the
transcription activities of three genes in the mammalian cells
using one substrate is shown in FIG. 19. Three gene vectors in
which the promoter sequence has been inserted upstream of the
red-emitting luciferase gene from the rail road worm, the
green-emitting luciferase gene from Rhagophthalmus ohba and the
orange-emitting luciferase gene from Rhagophthalmus ohba are
co-expressed in the cultured cells. The co-expressing cells after a
certain time course after the treatment of the cells are lysed.
Subsequently, three transcription activities are measured by
separating the luminescence activities of red-emitting luciferase
from the rail road worm, the green-emitting luciferase from
Rhagophthalmus ohba and the orange-emitting luciferase from
Rhagophthalmus ohba in the cell extract solution using the color
filters. Thus, 15 .mu.L of PicaGene was added to 15 .mu.L of the
extract solution of the cells in which the red-emitting luciferase
gene from the rail road worm, the green-emitting luciferase gene
from Rhagophthalmus ohba and the orange-emitting luciferase gene
from Rhagophthalmus ohba were independently expressed. Then the
luminescence spectra were measured using the weak luminescence
spectrum determining apparatus supplied from ATTO Corporation (FIG.
20). As a result of examining the luminescence spectra, it has been
confirmed that color split is possible by selecting the color
filter O-54 type supplied from Hoya Co., Ltd. for splitting the
green and orange lights and selecting the color filter R-60 type
supplied from Hoya Co., Ltd. for splitting the orange and red
lights. The measuring procedure is as follows. (1) The emitted
light intensity is measured without use of the filter (luminescence
activities of the red, orange and green-emitting luciferases). (2)
The color filter O-54 type is inserted in a luminometer and the
emitted light intensity is measured to yield the luminescent
activity of the green-emitting luciferase. (3) The color filter
R-60 type is inserted in the luminometer and the emitted light
intensity is measured to yield the luminescent activity of the
green and orange luminescence activity. (4) The luminescence
activity of the red is calculated by converting the transmittance
of the filters. Further, the activities of three color luciferases
are corrected. This way, it is possible to evaluate the emitted
lights intensities and the abundance of the red-, green- and
orange-emitting luciferases.
EXAMPLE 16
[0158] It has been examined in the model experiment whether two
enzymes with different compositions in the red-, orange- and
green-emitting luciferases whose abundance ratios are different can
be quantified by the procedure determined in Example 15. In FIG. 21
for the red- and green-emitting luciferases (A), the green- and
orange-emitting luciferases (B), and the orange- and red-emitting
luciferases (C), the luminescence activities in samples with
different abundance ratios were obtained by (1) measuring all
emitted light intensities, (2) using the set filter and converting.
As a result, it has been demonstrated that the luminescence
activity is changed in a linear relationship with the abundance
ratio. This suggests that the different amounts of the red-,
orange- and green-emitting luciferases expressed in the mammalian
cells can be quantified by the luminometer in which the filter has
been inserted.
EXAMPLE 17
[0159] It has been examined in the model experiment whether two
enzymes with different compositions can be quantified by making the
amount of one light-emitting enzyme constant in the red-, orange-
and green-emitting luciferases whose abundance ratios are different
by the procedure determined in Example 15. In FIG. 22, for the
orange- and green-emitting luciferases by making the red-emitting
luciferase constant (A), for the green- and red-emitting
luciferases by making the orange-emitting luciferase constant (B),
and for the orange- and red-emitting luciferases by making the
green-emitting luciferase constant (C), the luminescence activities
in samples with different abundance ratios were obtained by (1)
measuring all emitted light intensities, (2) using the set filter
and converting. As a result, it has been demonstrated that the
luminescence activity is changed in a linear relationship with the
abundance ratio. This suggests that the different amounts of the
red-, orange- and green-emitting luciferases expressed in the
mammalian cells can be quantified by the luminometer in which the
filter has been inserted. Therefore, it has been demonstrated that
it is possible to quantify the three luciferases by one substrate,
and that the amounts of transcription activities of three genes can
be measured.
Sequence CWU 0
0
SEQUENCE LISTING <160> NUMBER OF SEQ ID NOS: 65 <210>
SEQ ID NO 1 <211> LENGTH: 1638 <212> TYPE: DNA
<213> ORGANISM: Wild Type Phrixothrix Green Luciferase
<400> SEQUENCE: 1 atggaagaag aaaacattag gcatggagag cgtcctcgtg
atatagtcca tcctggctcg 60 gcaggacaac aattatacca atcattgtat
aaatttgcat cttttcctga agcaataatc 120 gatgctcata caaatgaagt
aatatcatat gctcaaatat ttgaaaccag ctgccgctta 180 gctgttagta
tagaacaata tggcttgaat gaaaacaatg ttgtgggtgt atgcagtgaa 240
aacaatataa acttttttaa tcctgtcctt gctgctttat acttaggaat accagtagca
300 acatcaaatg atatgtacac agatggagag ttaactggtc atttgaatat
atcaaaacca 360 actatcatgt ttagttcaaa gaaagcactc ccgcttattc
tgagagtaca gcaaaatcta 420 agtttcatta aaaaagtcgt agttatcgat
agcatgtacg acattaatgg cgttgaatgc 480 gtatctacct ttgttgcacg
ttatactgac cacacctttg atccattgtc atttacacca 540 aaagattttg
atccccttga aaaaatcgca ttaattatgt catcatctgg aacaactgga 600
ttgcctaagg gtgtagtact gagccataga agtctaacta taagattcgt tcatagcagg
660 gatcccattt atggcactcg tacggttcca caaacatcaa ttctttcctt
agtaccgttc 720 catcatgcct ttggaatgtt tactacatta tcttactttg
tagtaggact taaggttgta 780 atgttgaaga aatttgaggg cgcacttttc
ttaaaaacca tacagaatta caaaatcccc 840 actattgtag tggcccctcc
agttatggtg tttttggcta aaagcccatt agtcgatcaa 900 tacgatttat
cgagcttaac ggaagttgct actggaggag ctcctttagg aaaagatgtc 960
gcagaagcag tagcaaagag gttgaaatta cctggaatca tacaaggata tggattaact
1020 gaaacttgct gcgctgtaat gattacccct cataatgctg tgaaaacagg
ttcaactgga 1080 agacccttgc catacattaa agctaaagtt ttagataacg
ctactgggaa ggcgctagga 1140 ccaggagaaa gaggcgaaat atgctttaaa
agtgaaatga ttatgaaagg atattacaac 1200 aatccggaag caactattga
tactattgac aaagatggtt ggcttcattc tggagatatt 1260 ggatattacg
acgaagatgg aaatttcttt atagttgatc gattgaaaga acttattaaa 1320
tacaagggat atcaggttgc gcctgctgaa ctggaaaatc tgcttttaca acatccaagt
1380 attgctgatg cgggtgttac tggagttccg gacgaatttg ctggacaatt
acctgctgct 1440 tgtgttgtgt tagaatctgg caagacgctg actgaaaagg
aagttcaaga ttttattgca 1500 gcacaagtca ctccaacaaa gcatcttcga
ggcggtgtcg tatttgtaga cagtattccg 1560 aaaggcccta ctggaaaact
catcagaaag gagctccgag aaatatttgc ccagcgagca 1620 ccaaaatcaa
aattataa 1638 <210> SEQ ID NO 2 <211> LENGTH: 545
<212> TYPE: PRT <213> ORGANISM: Wild Type Phrixothrix
Green Luciferase <400> SEQUENCE: 2 Met Glu Glu Glu Asn Ile
Arg His Gly Glu Arg Pro Arg Asp Ile Val 1 5 10 15 His Pro Gly Ser
Ala Gly Gln Gln Leu Tyr Gln Ser Leu Tyr Lys Phe 20 25 30 Ala Ser
Phe Pro Glu Ala Ile Ile Asp Ala His Thr Asn Glu Val Ile 35 40 45
Ser Tyr Ala Gln Ile Phe Glu Thr Ser Cys Arg Leu Ala Val Ser Ile 50
55 60 Glu Gln Tyr Gly Leu Asn Glu Asn Asn Val Val Gly Val Cys Ser
Glu 65 70 75 80 Asn Asn Ile Asn Phe Phe Asn Pro Val Leu Ala Ala Leu
Tyr Leu Gly 85 90 95 Ile Pro Val Ala Thr Ser Asn Asp Met Tyr Thr
Asp Gly Glu Leu Thr 100 105 110 Gly His Leu Asn Ile Ser Lys Pro Thr
Ile Met Phe Ser Ser Lys Lys 115 120 125 Ala Leu Pro Leu Ile Leu Arg
Val Gln Gln Asn Leu Ser Phe Ile Lys 130 135 140 Lys Val Val Val Ile
Asp Ser Met Tyr Asp Ile Asn Gly Val Glu Cys 145 150 155 160 Val Ser
Thr Phe Val Ala Arg Tyr Thr Asp His Thr Phe Asp Pro Leu 165 170 175
Ser Phe Thr Pro Lys Asp Phe Asp Pro Leu Glu Lys Ile Ala Leu Ile 180
185 190 Met Ser Ser Ser Gly Thr Thr Gly Leu Pro Lys Gly Val Val Leu
Ser 195 200 205 His Arg Ser Leu Thr Ile Arg Phe Val His Ser Arg Asp
Pro Ile Tyr 210 215 220 Gly Thr Arg Thr Val Pro Gln Thr Ser Ile Leu
Ser Leu Val Pro Phe 225 230 235 240 His His Ala Phe Gly Met Phe Thr
Thr Leu Ser Tyr Phe Val Val Gly 245 250 255 Leu Lys Val Val Met Leu
Lys Lys Phe Glu Gly Ala Leu Phe Leu Lys 260 265 270 Thr Ile Gln Asn
Tyr Lys Ile Pro Thr Ile Val Val Ala Pro Pro Val 275 280 285 Met Val
Phe Leu Ala Lys Ser Pro Leu Val Asp Gln Tyr Asp Leu Ser 290 295 300
Ser Leu Thr Glu Val Ala Thr Gly Gly Ala Pro Leu Gly Lys Asp Val 305
310 315 320 Ala Glu Ala Val Ala Lys Arg Leu Lys Leu Pro Gly Ile Ile
Gln Gly 325 330 335 Tyr Gly Leu Thr Glu Thr Cys Cys Ala Val Met Ile
Thr Pro His Asn 340 345 350 Ala Val Lys Thr Gly Ser Thr Gly Arg Pro
Leu Pro Tyr Ile Lys Ala 355 360 365 Lys Val Leu Asp Asn Ala Thr Gly
Lys Ala Leu Gly Pro Gly Glu Arg 370 375 380 Gly Glu Ile Cys Phe Lys
Ser Glu Met Ile Met Lys Gly Tyr Tyr Asn 385 390 395 400 Asn Pro Glu
Ala Thr Ile Asp Thr Ile Asp Lys Asp Gly Trp Leu His 405 410 415 Ser
Gly Asp Ile Gly Tyr Tyr Asp Glu Asp Gly Asn Phe Phe Ile Val 420 425
430 Asp Arg Leu Lys Glu Leu Ile Lys Tyr Lys Gly Tyr Gln Val Ala Pro
435 440 445 Ala Glu Leu Glu Asn Leu Leu Leu Gln His Pro Ser Ile Ala
Asp Ala 450 455 460 Gly Val Thr Gly Val Pro Asp Glu Phe Ala Gly Gln
Leu Pro Ala Ala 465 470 475 480 Cys Val Val Leu Glu Ser Gly Lys Thr
Leu Thr Glu Lys Glu Val Gln 485 490 495 Asp Phe Ile Ala Ala Gln Val
Thr Pro Thr Lys His Leu Arg Gly Gly 500 505 510 Val Val Phe Val Asp
Ser Ile Pro Lys Gly Pro Thr Gly Lys Leu Ile 515 520 525 Arg Lys Glu
Leu Arg Glu Ile Phe Ala Gln Arg Ala Pro Lys Ser Lys 530 535 540 Leu
545 <210> SEQ ID NO 3 <211> LENGTH: 1641 <212>
TYPE: DNA <213> ORGANISM: Wild Type Phrixothrix Red
Luciferase <400> SEQUENCE: 3 atggaagaag aaaacattgt gaatggagat
cgtcctcgtg atctagtttt tcctggcaca 60 gcaggactac aattatatca
atcattatat aaatattcat atattactga cggaataatc 120 gatgcccata
ccaatgaagt aatatcatat gctcaaatat ttgaaaccag ctgccgcttg 180
gcagttagtc tagaaaaata tggcttggat cataacaatg ttgtggcaat atgcagtgaa
240 aacaacatac acttttttgg ccctttaatt gctgctttat accaaggaat
accaatggca 300 acatcaaatg atatgtacac agaaagggag atgattggcc
atttgaatat atcgaaacca 360 tgccttatgt tttgttcaaa gaaatcactc
ccatttattc tgaaagtaca aaaacatcta 420 gatttcctta aaaaagtcat
agtcattgat agtatgtacg atatcaatgg cgttgaatgc 480 gtatttagct
ttgtttcacg ttatactgat cacgcctttg atccagtgaa atttaaccca 540
aaagagtttg atcccttgga aagaaccgca ttaattatga catcatctgg aacaactgga
600 ttgcctaaag gggtagtaat aagccataga agtataacta taagattcgt
ccatagcagt 660 gatcccatct atggtactcg tattgctcca gatacatcaa
ttcttgctat agcaccgttc 720 catcatgcct ttggactgtt tactgcacta
gcttactttc cagtaggact taagattgta 780 atggtgaaga aatttgaggg
cgaattcttc ttaaaaacca tacaaaatta caaaatcgct 840 tctattgtag
ttcctcctcc aattatggta tatttggcta aaagtccatt agtcgatgaa 900
tacaatttat cgagcttaac ggaaattgct tgtggagggt ctcctttagg aagagatatc
960 gcagataaag tagcaaagag attgaaagta catggaatcc tacaaggata
tggattaacc 1020 gaaacctgca gcgctctaat acttagcccc aatgatcgag
aacttaaaaa aggtgcaatt 1080 ggaacgccta tgccatatgt tcaagttaaa
gttatagata tcaatactgg gaaggcgcta 1140 ggaccaagag aaaaaggcga
aatatgcttc aaaagtcaaa tgcttatgaa aggatatcac 1200 aacaatccgc
aagcaactcg tgatgctctt gacaaagatg gttggcttca tactggggat 1260
cttggatatt acgacgaaga cagatttatc tatgtagttg atcgattgaa agaacttatt
1320 aaatataaag gatatcaggt tgcgcctgct gaactggaaa atctgctttt
acaacatcca 1380 aatatttctg atgcgggtgt tattggaatt ccggacgaat
ttgctggtca attaccttcc 1440 gcgtgtgttg tgttagagcc tggtaagaca
atgaccgaaa aggaagttca ggattatatt 1500 gcagagctag tcactacaac
taaacatctt cgaggcggtg tcgtatttat agatagtatt 1560 ccaaaaggcc
caacaggaaa actcatgaga aacgaactcc gtgcaatatt tgcccgggaa 1620
caggcaaaat caaaattata a 1641 <210> SEQ ID NO 4
<211> LENGTH: 546 <212> TYPE: PRT <213> ORGANISM:
Wild Type Phrixothrix Red Luciferase <400> SEQUENCE: 4 Met
Glu Glu Glu Asn Ile Val Asn Gly Asp Arg Pro Arg Asp Leu Val 1 5 10
15 Phe Pro Gly Thr Ala Gly Leu Gln Leu Tyr Gln Ser Leu Tyr Lys Tyr
20 25 30 Ser Tyr Ile Thr Asp Gly Ile Ile Asp Ala His Thr Asn Glu
Val Ile 35 40 45 Ser Tyr Ala Gln Ile Phe Glu Thr Ser Cys Arg Leu
Ala Val Ser Leu 50 55 60 Glu Lys Tyr Gly Leu Asp His Asn Asn Val
Val Ala Ile Cys Ser Glu 65 70 75 80 Asn Asn Ile His Phe Phe Gly Pro
Leu Ile Ala Ala Leu Tyr Gln Gly 85 90 95 Ile Pro Met Ala Thr Ser
Asn Asp Met Tyr Thr Glu Arg Glu Met Ile 100 105 110 Gly His Leu Asn
Ile Ser Lys Pro Cys Leu Met Phe Cys Ser Lys Lys 115 120 125 Ser Leu
Pro Phe Ile Leu Lys Val Gln Lys His Leu Asp Phe Leu Lys 130 135 140
Lys Val Ile Val Ile Asp Ser Met Tyr Asp Ile Asn Gly Val Glu Cys 145
150 155 160 Val Phe Ser Phe Val Ser Arg Tyr Thr Asp His Ala Phe Asp
Pro Val 165 170 175 Lys Phe Asn Pro Lys Glu Phe Asp Pro Leu Glu Arg
Thr Ala Leu Ile 180 185 190 Met Thr Ser Ser Gly Thr Thr Gly Leu Pro
Lys Gly Val Val Ile Ser 195 200 205 His Arg Ser Ile Thr Ile Arg Phe
Val His Ser Ser Asp Pro Ile Tyr 210 215 220 Gly Thr Arg Ile Ala Pro
Asp Thr Ser Ile Leu Ala Ile Ala Pro Phe 225 230 235 240 His His Ala
Phe Gly Leu Phe Thr Ala Leu Ala Tyr Phe Pro Val Gly 245 250 255 Leu
Lys Ile Val Met Val Lys Lys Phe Glu Gly Glu Phe Phe Leu Lys 260 265
270 Thr Ile Gln Asn Tyr Lys Ile Ala Ser Ile Val Val Pro Pro Pro Ile
275 280 285 Met Val Tyr Leu Ala Lys Ser Pro Leu Val Asp Glu Tyr Asn
Leu Ser 290 295 300 Ser Leu Thr Glu Ile Ala Cys Gly Gly Ser Pro Leu
Gly Arg Asp Ile 305 310 315 320 Ala Asp Lys Val Ala Lys Arg Leu Lys
Val His Gly Ile Leu Gln Gly 325 330 335 Tyr Gly Leu Thr Glu Thr Cys
Ser Ala Leu Ile Leu Ser Pro Asn Asp 340 345 350 Arg Glu Leu Lys Lys
Gly Ala Ile Gly Thr Pro Met Pro Tyr Val Gln 355 360 365 Val Lys Val
Ile Asp Ile Asn Thr Gly Lys Ala Leu Gly Pro Arg Glu 370 375 380 Lys
Gly Glu Ile Cys Phe Lys Ser Gln Met Leu Met Lys Gly Tyr His 385 390
395 400 Asn Asn Pro Gln Ala Thr Arg Asp Ala Leu Asp Lys Asp Gly Trp
Leu 405 410 415 His Thr Gly Asp Leu Gly Tyr Tyr Asp Glu Asp Arg Phe
Ile Tyr Val 420 425 430 Val Asp Arg Leu Lys Glu Leu Ile Lys Tyr Lys
Gly Tyr Gln Val Ala 435 440 445 Pro Ala Glu Leu Glu Asn Leu Leu Leu
Gln His Pro Asn Ile Ser Asp 450 455 460 Ala Gly Val Ile Gly Ile Pro
Asp Glu Phe Ala Gly Gln Leu Pro Ser 465 470 475 480 Ala Cys Val Val
Leu Glu Pro Gly Lys Thr Met Thr Glu Lys Glu Val 485 490 495 Gln Asp
Tyr Ile Ala Glu Leu Val Thr Thr Thr Lys His Leu Arg Gly 500 505 510
Gly Val Val Phe Ile Asp Ser Ile Pro Lys Gly Pro Thr Gly Lys Leu 515
520 525 Met Arg Asn Glu Leu Arg Ala Ile Phe Ala Arg Glu Gln Ala Lys
Ser 530 535 540 Lys Leu 545 <210> SEQ ID NO 5 <211>
LENGTH: 1760 <212> TYPE: DNA <213> ORGANISM:
Phrixothrix Red Luciferase of US2002-0119542-A1 <400>
SEQUENCE: 5 gtgacagttt agttcagtag aagatttttt tgagatcaaa atggaagaag
aaaacgttgt 60 gaatggagat cgtcctcgtg atctagtttt tcctggcaca
gcaggactac aattatatca 120 atcattatat aaatattcat atattactga
cggaataatc gatgcccata ccaatgaagt 180 aatatcatat gctcaaatat
ttgaaaccag ctgccgcttg gcagttagtc tagaaaaata 240 tggcttggat
cataacaatg ttgtggcaat atgcagtgaa aacaacatac acttttttgg 300
ccctttaatt gctgctttat accaaggaat accaatggca acatcaaatg atatgtacac
360 agaaagggag atgattggcc atttgaatat atcgaaacca tgccttatgt
tttgttcaaa 420 gaaatcactc ccatttattc tgaaagtaca aaaacatcta
gatttcctta aaagagtcat 480 agtcattgat agtatgtacg atatcaatgg
cgttgaatgc gtatttagct ttgattcacg 540 taatactgat cacgcctttg
atccagtgaa atttaaccca aaagagtttg atcccttgga 600 aagaaccgca
ttaattatga catcatctgg aacaactgga ttgcctaaag gggtagtaat 660
aagccataga agtataacta taagattcgt ccatagcagt gatcccatct atggtactcg
720 tattgctcca gatacatcaa ttcttgctat agcaccgttc catcatgcct
ttggactgtt 780 tactgcacta gcttactttc cagtaggact taagattgta
atggtgaaga aatttgaggg 840 cgaattcttc ttaaaaacca tacaaaatta
caaaatcgct tctattgtag ttcctcctcc 900 aattatggta tatttggcta
aaagtccatt agtcgatgaa tacaattgct cgagcttaac 960 ggaaattgct
agtggaggct ctcctttagg aagagatatc gcagataaag tagcaaagag 1020
attgaaagta catggaatcc tacaaggata tggattaacc gaaacctgca gcgctctaat
1080 acttagcccc aatgatcgag aacttaaaaa aggtgcaatt ggaacgccta
tgccatatgt 1140 tcaagttaaa gttatagata tcaatactgg gaaggcgcta
ggaccaagag aaaaaggcga 1200 aatatgcttc aaaagtcaaa tgcttatgaa
aggatatcac aacaatccgc aagcaactcg 1260 tgatgctctt gacaaagatg
gttggcttca tactggggat cttggatatt acgacgaaga 1320 cagatttatc
tatgtagttg atcgattgaa agaacttatt aaatataaag gatatcaggt 1380
tgcgcctgct gaactggaaa atctgctttt acaacatcca aatatttctg atgcgggtgt
1440 tattgaattc cggacgaatt tgctggtcaa ttacctttcc gcgtgtgttg
tgttagagcc 1500 tggtaagaca atgaccgaaa aggaagttca ggattatatt
gcagagctag tcactacaac 1560 taaacatctt cgaggcggtg tcgtatttat
agatagtatt ccaaaaggcc caacaggaaa 1620 actcatgaga aacgaactcc
gagcaatatt tgcccgggaa caggcaaaat caaaattata 1680 agctcaatat
attgctttag ttataaaatg tatgtaatca aattttagaa cctaatacat 1740
tcattgagag cctaaaaaaa 1760 <210> SEQ ID NO 6 <211>
LENGTH: 1641 <212> TYPE: DNA <213> ORGANISM:
Phrixothrix Red Luciferase of WO2003/016839 <400> SEQUENCE: 6
atggaagaag aaaacgtggt gaatggagat cggcctaggg atctggtgtt tcccggcaca
60 gcaggactcc agctgtacca gtcactgtat aagtattcat acatcactga
cgggataatc 120 gacgcccata ccaacgaggt catctcatat gctcagatct
ttgaaacctc ctgccggctg 180 gcagtgtcac tggagaagta tggcctggat
cacaacaatg tggtggccat ctgttctgaa 240 aacaacatac actttttcgg
ccccctgatt gctgccctgt accaaggcat cccaatggca 300 acatcaaacg
acatgtacac agagagggag atgataggcc atctgaacat ctccaagcca 360
tgcctgatgt tctgttcaaa gaaatcactg cccttcattc tgaaggtgca gaagcacctg
420 gactttctga aaaaagtcat agtcattgat tccatgtacg atatcaatgg
cgtggagtgc 480 gtcttctcct ttgtctcgag gtacactgat cacgccttcg
acccagtgaa gttcaacccc 540 aaagagttcg accccctcga aagaaccgcc
ctgattatga catcatctgg gacaactgga 600 ctgcctaagg gggtcgtgat
ctcccacaga tctataacta tcagattcgt ccattcttcc 660 gatcccatct
acggcaccag gattgcccca gacacatcaa ttctggctat cgcacccttc 720
catcacgcct ttggactgtt tactgcactg gcttacttcc ctgtcggact gaagattgtc
780 atggtgaaga aatttgaggg cgagttcttt ctgaaaacca tacaaaatta
caagatcgct 840 tctattgtcg tgcctcctcc tattatggtc tatctggcta
agtcccccct ggtcgatgaa 900 tacaatttat cttctctgac cgaaatcgca
tgcggaggct ctcctctggg gagagacatc 960 gcagataaag tcgccaagag
actgaaagtg catggaatcc tccagggata tgggctgacc 1020 gagacctgtt
ccgctctgat actgtctccc aacgatcggg aactgaaaaa gggggcaatc 1080
ggaaccccta tgccatacgt gcaagtgaaa gtgatcgaca tcaataccgg gaaggccctg
1140 ggaccaagag agaaaggcga gatctgcttc aagtctcaga tgctgatgaa
ggggtatcac 1200 aacaatcctc aggccactag ggatgctctg gacaaggatg
ggtggctgca cactggggac 1260 ctgggatatt acgacgaaga cagatttatc
tatgtcgtgg acaggctgaa agagctgatc 1320 aagtataaag ggtatcaggt
cgcccctgct gagttggaaa acctgctgtt gcagcacccc 1380 aatatctctg
atgccggcgt gattggaatt ccggacgaat ttgctggtca attaccttcc 1440
gcctgtgtgg tgctggagcc tggcaagaca atgaccgaga aagaagtgca ggactacatt
1500 gcagagctgg tcactacaac taaacatctg aggggggggg tcgtctttat
agattccatt 1560 ccaaagggcc caacagggaa actgatgaga aacgaactga
gggcaatctt tgctcgggaa 1620 caggcaaaaa tcgctgtgta a 1641 <210>
SEQ ID NO 7 <211> LENGTH: 1641 <212> TYPE: DNA
<213> ORGANISM: Mutant Phrixothrix Red Luciferase of the
Invention <400> SEQUENCE: 7
atggaagaag agaacatcgt gaatggcgat cgccctcggg atctggtgtt ccctggcaca
60 gccggcctgc agctgtatca gtccctgtat aaatactctt acatcaccga
cggaatcatc 120 gacgcccaca ccaacgaggt gatctcctat gcccagattt
tcgaaacaag ttgccgcctg 180 gccgtgagcc tggagaagta tggcctggat
cacaacaacg tggtggccat ttgcagcgag 240 aacaacatcc acttcttcgg
ccctctgatc gctgccctat accaggggat tccaatggcc 300 acatccaacg
atatgtacac cgagagggag atgatcggcc acctgaacat ctccaagcca 360
tgtctgatgt tctgttccaa gaagtccctg ccattcatcc tgaaggtgca gaagcacctg
420 gactttctca agaaggtgat cgtgatcgac agcatgtacg acatcaacgg
cgtggagtgc 480 gtgttcagtt tcgtgtcccg gtacaccgat cacgcgttcg
atccagtgaa gttcaaccct 540 aaagagtttg atcccctgga gagaaccgcg
ctgatcatga catcctctgg aacaaccggc 600 ctgcctaagg gcgtggtgat
cagccacagg agcatcacca tcagattcgt ccacagcagc 660 gatcccatct
acggcacccg catcgcccca gatacatcca tcctggccat cgcccctttc 720
caccacgcct tcggactgtt taccgccctg gcttactttc cagtgggcct gaagatcgtg
780 atggtgaaaa agtttgaggg cgagttcttc ctgaagacca tccagaacta
caagatcgct 840 tctatcgtgg tgcctcctcc aatcatggtg tatctggcca
agagccctct ggtggatgag 900 tacaatctgt ccagcctgac agagatcgcc
tgtggcggct cccctctggg cagagacatc 960 gccgacaagg tggccaagag
actgaaggtc cacggcatcc tgcagggcta tggcctgacc 1020 gagacctgta
gcgccctgat cctgagcccc aacgatagag agctgaagaa gggcgccatc 1080
ggcaccccta tgccctatgt ccaggtgaag gtgattgaca tcaacaccgg caaagccctg
1140 ggaccaagag agaagggcga gatttgcttc aagagccaga tgctgatgaa
gggctaccac 1200 aacaacccac aggccaccag ggatgccctg gacaaggacg
ggtggctgca caccggcgat 1260 ctgggctact acgacgagga cagattcatc
tatgtggtgg atcggctgaa agagctcatc 1320 aagtacaagg gctaccaggt
ggcccctgcc gagctggaga acttgcttct gcagcaccct 1380 aacatctctg
atgccggcgt catcggcatc ccagacgagt ttgccggcca gctgccttcc 1440
gcctgtgtcg tgctggagcc tggcaagacc atgaccgaga aggaggtgca ggattatatc
1500 gccgagctgg tgaccaccac caagcacctg cggggcggcg tggtgttcat
cgacagcatt 1560 ccgaaaggcc caacaggcaa gctgatgaga aacgagctga
gggccatctt tgcccgcgag 1620 caggccaagt ccaagctgta a 1641 <210>
SEQ ID NO 8 <211> LENGTH: 1632 <212> TYPE: DNA
<213> ORGANISM: Wild Type Rhagophthalmus ohbai Green
Luciferase <400> SEQUENCE: 8 atgcctaatg aaatcatttt acatggggcc
aaacctcgag acccgttaga cctgggaact 60 gcaggaattc aattgtatag
ggctttgacg aatttttcct ttttaaggga agccttgatc 120 gacgctcaca
ccgaggaagt agtatcttac gcggacattt tggaaaacag ctgtcgatta 180
gcaaaatgct acgaaaacta tggattacgc caaaacagcg tcatatcggt gtgcagcgaa
240 aacagcacga tcttcttcta ccccgtaatt gccgctttgt atatgggagt
cataacagca 300 accgtaaatg atagttatac cgaacgggaa ttattggaaa
ccttaaatat atcaaaaccg 360 gaattagtgt tctgctcgaa gaaagccatt
aaaaatatga tggcattgaa aaggaacgtc 420 aattttatta aaaaggtagt
acttttggat agtaaggaag acatgggcga agcccagtgt 480 cttagcaact
ttatggcacg ctattcggaa cccaatttgg acgtaagaaa ttttaaacca 540
cgcgattttg atgctaaaga acaagtcgct ttgatcatgt cctcatcggg aacaaccggg
600 ctgcccaaag gggtcgtgtt aacccatcga aatttaagcg ttcgcttcgt
acactgcaag 660 gatcccttat tcggcacaag aactattcca tcaacttcga
ttttatctat cgttcccttc 720 catcatgcgt ttggaatgtt tacaacgttg
tcttatttta tagtagggct tagagttgta 780 ttactgaaaa gattcgaaga
gaagtttttc ttaagcacca ttgaaaagta cagaattcca 840 actatcgttc
ttgcgccgcc cgtaatggta ttcctagcta agagcccctt agttgatcag 900
tacgatttgt ccagtattag agaagtcgct accggtggcg cacctgttgg aactgaagtg
960 gcagtggccg ttgcgaaacg gttgaaaatt ggcggaatcc ttcagggcta
cggattgacc 1020 gaaacgtgtt gcgccgtatt aattacccct catgacgacg
ttaaaacagg ttctaccggg 1080 agggtagctc cttacgtcca agcgaaaatt
gtagatctta ccaccggaaa atctctgggg 1140 ccaaataaaa gaggagagct
ttgttttaaa agtgagatca ttatgaaggg ctatttcaac 1200 aataaacaag
ctacggaaga agccatcgat aaagaaggat ggttacattc tggagatgtt 1260
gggtattatg acgacgatgg tcatttcttc gtagtcgatc gtttaaagga acttatcaag
1320 tacaagggat atcaagtagc accggctgaa ctggagtggt tgcttttgca
acatccatct 1380 attaaagatg ccggtgttac tggcgttccc gacgaagctg
ctggagaact accaggtgct 1440 tgtatagttc tccaagaagg aaaaagtctt
actgaacaag aaattattga ctatatagcc 1500 gaacgagttt cgccaactaa
acgtatacgt ggtggagtgg tcttcgttga tgatattcct 1560 aaaggggcga
ctggaaaact ggtcagaagt gaattacgaa aacttcttgc tcagaagaaa 1620
tcgaaactat aa 1632 <210> SEQ ID NO 9 <211> LENGTH: 1632
<212> TYPE: DNA <213> ORGANISM: Wild Type
Rhagophthalmus ohbai Orange Luciferase <400> SEQUENCE: 9
atgcctaatg aaatcatttt acatggggcc aaacctcgag acccgttaga cctgggaact
60 gcaggaattc aattgtatag ggctttgacg aatttttcct ttttaaggga
agccttgatc 120 gacgctcaca ccgaggaagt agtatcttac gcggacattt
tggaaaacag ctgtcgatta 180 gcaaaatgct acgaaaacta tggattacgc
caaaacagcg tcatatcggt gtgcagcgaa 240 aacagcacga tcttcttcta
ccccgtaatt gccgctttgt atatgggagt cataacagca 300 accgtaaatg
atagttatac cgaacgggaa ttattggaaa ccttaaatat atcaaaaccg 360
gaattagtgt tctgctcgaa gaaagccatt aaaaatatga tggcattgaa aaggaacgtc
420 aattttatta aaaaggtagt acttttggat agtaaggaag acatgggcga
agcccagtgt 480 cttagcaact ttatggcacg ctattcggaa cccaatttgg
acgtaagaaa ttttaaacca 540 cgcgattttg atgctaaaga acaagtcgct
ttgatcatgt cctcatcggg aacaaccggg 600 ctgcccaaag gggtcgtgtt
aacccatcga aatttaagcg ttcgcttcgt acactgcaag 660 gatcccttat
tcggcaatag aactattcca tcaacttcga ttttatctat cgttcccttc 720
catcatgcgt ttggaatgtt tacaacgttg tcttatttta tagtagggct tagagttgta
780 ttactgaaaa gattcgaaga gaagtttttc ttaagcacca ttgaaaagta
cagaattcca 840 actatcgttc ttgcgccgcc cgtaatggta ttcctagcta
agagcccctt agttgatcag 900 tacgatttgt ccagtattag agaagtcgct
accggtggcg cacctgttgg aactgaagtg 960 gcagtggccg ttgcgaaacg
gttgaaaatt ggcggaatcc ttcagggcta cggattgacc 1020 gaaacgtgtt
gcgccgtatt aattacccct catgacgacg ttaaaacagg ttctaccggg 1080
agggtagctc cttacgtcca agcgaaaatt gtagatctta ccaccggaaa atctctgggg
1140 ccaaataaaa gaggagagct ttgttttaaa agtgagatca ttatgaaggg
ctatttcaac 1200 aataaacaag ctacggaaga agccatcgat aaagaaggat
ggttacattc tggagatgtt 1260 gggtattatg acgacgatgg tcatttcttc
gtagtcgatc gtttaaagga acttatcaag 1320 tacaagggat atcaagtagc
accggctgaa ctggagtggt tgcttttgca acatccatct 1380 attaaagatg
ccggtgttac tggcgttccc gacgaagctg ctggagaact accaggtgct 1440
tgtatagttc tccaagaagg aaaaagtctt actgaacaag aaattattga ctatatagcc
1500 gaacgagttt cgccaactaa acgtatacgt ggtggagtgg tcttcgttga
tgatattcct 1560 aaaggggcga ctggaaaact ggtcagaagt gaattacgaa
aacttcttgc tcagaagaaa 1620 tcgaaactat aa 1632 <210> SEQ ID NO
10 <211> LENGTH: 1632 <212> TYPE: DNA <213>
ORGANISM: Mutant Rhagophthalmus ohbai Green Luciferase of the
Invention <400> SEQUENCE: 10 atggctaacg agatcatcct gcacggcgcc
aagcccaggg accccctgga cctgggcacc 60 gccggcattc agctctacag
ggccctgacc aacttctcct tcctgaggga ggccctgatc 120 gacgcccaca
ccgaggaggt ggtgtcttac gccgacatcc tggagaacag ctgtagactg 180
gctaagtgct acgagaacta cggcctgcgc cagaacagcg tgatctccgt gtgcagcgag
240 aatagcacca tcttcttcta ccccgtgatc gccgccctgt acatgggcgt
gatcaccgcc 300 accgtgaacg acagctacac cgagcgggag ctgctggaga
ccctgaacat ctccaagccc 360 gaactggtgt tctgctccaa gaaggccatc
aagaacatga tggccctgaa gaggaacgtg 420 aacttcatca agaaggtggt
gctgctggac agcaaggagg atatgggcga ggcccagtgc 480 ctgagcaact
tcatggcccg gtactccgag cccaacctgg acgtgagaaa cttcaagcca 540
agggacttcg acgccaagga gcaggtggcc cttattatgt cctcctctgg caccaccggc
600 ctgccaaagg gcgtggtgct gacccacagg aacctgagcg tgcgcttcgt
ccactgcaag 660 gaccccctgt tcggcaccag aaccatcccc tccacctcca
tcctgtccat cgtgcccttc 720 caccacgcct tcggaatgtt cacaaccctg
tcctacttca tcgtgggcct gagagtggtg 780 ctgctgaaga gattcgagga
gaagttcttc ctgagcacca tcgagaagta cagaatccca 840 acaatcgtgc
tggcccctcc tgtgatggtg ttcctggcta agagccccct ggtggaccag 900
tacgacctgt ccagcatcag agaggtggcc accggcggcg cccctgtggg caccgaggtt
960 gccgtggccg tggccaagcg gctgaagatc ggcggcatcc tccagggcta
cggcctgacc 1020 gagacctgct gcgccgtgct gatcaccccc cacgacgacg
tgaagaccgg ctccaccggc 1080 agggtagccc cctacgtgca ggctaagatc
gtggacctga ccaccggcaa gtccctggga 1140 cctaacaaga gaggcgagct
gtgcttcaag agcgagatca tcatgaaggg ctacttcaac 1200 aacaagcagg
ccaccgagga ggccatcgac aaggagggct ggctgcactc cggcgacgtg 1260
ggatactacg acgacgatgg acatttcttc gtggtggacc ggctgaaaga gctgatcaag
1320 tacaagggct accaggtggc ccccgccgag ctggagtggc tgctgctcca
gcacccatcc 1380 atcaaggatg ccggcgtgac cggcgtgccc gacgaggccg
ccggcgagct gcccggcgcc 1440 tgcatcgtgc tccaggaggg caagagcctg
accgagcagg agatcatcga ctacatcgcc 1500 gagcgagtgt ctcccaccaa
gcgcatccgg ggcggagtcg tcttcgtgga cgacatcccc 1560 aagggcgcca
ccggcaagct ggtgagaagc gagctgcgga agctgctggc ccagaagaag 1620
tccaagctgt aa 1632
<210> SEQ ID NO 11 <211> LENGTH: 1632 <212> TYPE:
DNA <213> ORGANISM: Mutant Rhagophthalmus ohbai Orange
Luciferase of the Invention <400> SEQUENCE: 11 atggctaacg
agatcatcct gcacggcgcc aagcccaggg accccctgga cctgggcacc 60
gccggcattc agctctacag ggccctgacc aacttctcct tcctgaggga ggccctgatc
120 gacgcccaca ccgaggaggt ggtgtcttac gccgacatcc tggagaacag
ctgtagactg 180 gctaagtgct acgagaacta cggcctgcgc cagaacagcg
tgatctccgt gtgcagcgag 240 aatagcacca tcttcttcta ccccgtgatc
gccgccctgt acatgggcgt gatcaccgcc 300 accgtgaacg acagctacac
cgagcgggag ctgctggaga ccctgaacat ctccaagccc 360 gaactggtgt
tctgctccaa gaaggccatc aagaacatga tggccctgaa gaggaacgtg 420
aacttcatca agaaggtggt gctgctggac agcaaggagg atatgggcga ggcccagtgc
480 ctgagcaact tcatggcccg gtactccgag cccaacctgg acgtgagaaa
cttcaagcca 540 agggacttcg acgccaagga gcaggtggcc cttattatgt
cctcctctgg caccaccggc 600 ctgccaaagg gcgtggtgct gacccacagg
aacctgagcg tgcgcttcgt ccactgcaag 660 gaccccctgt tcggcaacag
aaccatcccc tccacctcca tcctgtccat cgtgcccttc 720 caccacgcct
tcggaatgtt cacaaccctg tcctacttca tcgtgggcct gagagtggtg 780
ctgctgaaga gattcgagga gaagttcttc ctgagcacca tcgagaagta cagaatccca
840 acaatcgtgc tggcccctcc tgtgatggtg ttcctggcta agagccccct
ggtggaccag 900 tacgacctgt ccagcatcag agaggtggcc accggcggcg
cccctgtggg caccgaggtt 960 gccgtggccg tggccaagcg gctgaagatc
ggcggcatcc tccagggcta cggcctgacc 1020 gagacctgct gcgccgtgct
gatcaccccc cacgacgacg tgaagaccgg ctccaccggc 1080 agggtagccc
cctacgtgca ggctaagatc gtggacctga ccaccggcaa gtccctggga 1140
cctaacaaga gaggcgagct gtgcttcaag agcgagatca tcatgaaggg ctacttcaac
1200 aacaagcagg ccaccgagga ggccatcgac aaggagggct ggctgcactc
cggcgacgtg 1260 ggatactacg acgacgatgg acatttcttc gtggtggacc
ggctgaaaga gctgatcaag 1320 tacaagggct accaggtggc ccccgccgag
ctggagtggc tgctgctcca gcacccatcc 1380 atcaaggatg ccggcgtgac
cggcgtgccc gacgaggccg ccggcgagct gcccggcgcc 1440 tgcatcgtgc
tccaggaggg caagagcctg accgagcagg agatcatcga ctacatcgcc 1500
gagcgagtgt ctcccaccaa gcgcatccgg ggcggagtcg tcttcgtgga cgacatcccc
1560 aagggcgcca ccggcaagct ggtgagaagc gagctgcgga agctgctggc
ccagaagaag 1620 tccaagctgt aa 1632 <210> SEQ ID NO 12
<211> LENGTH: 543 <212> TYPE: PRT <213> ORGANISM:
Wild Type Rhagophthalmus ohbai Green Luciferase <400>
SEQUENCE: 12 Met Pro Asn Glu Ile Ile Leu His Gly Ala Lys Pro Arg
Asp Pro Leu 1 5 10 15 Asp Leu Gly Thr Ala Gly Ile Gln Leu Tyr Arg
Ala Leu Thr Asn Phe 20 25 30 Ser Phe Leu Arg Glu Ala Leu Ile Asp
Ala His Thr Glu Glu Val Val 35 40 45 Ser Tyr Ala Asp Ile Leu Glu
Asn Ser Cys Arg Leu Ala Lys Cys Tyr 50 55 60 Glu Asn Tyr Gly Leu
Arg Gln Asn Ser Val Ile Ser Val Cys Ser Glu 65 70 75 80 Asn Ser Thr
Ile Phe Phe Tyr Pro Val Ile Ala Ala Leu Tyr Met Gly 85 90 95 Val
Ile Thr Ala Thr Val Asn Asp Ser Tyr Thr Glu Arg Glu Leu Leu 100 105
110 Glu Thr Leu Asn Ile Ser Lys Pro Glu Leu Val Phe Cys Ser Lys Lys
115 120 125 Ala Ile Lys Asn Met Met Ala Leu Lys Arg Asn Val Asn Phe
Ile Lys 130 135 140 Lys Val Val Leu Leu Asp Ser Lys Glu Asp Met Gly
Glu Ala Gln Cys 145 150 155 160 Leu Ser Asn Phe Met Ala Arg Tyr Ser
Glu Pro Asn Leu Asp Val Arg 165 170 175 Asn Phe Lys Pro Arg Asp Phe
Asp Ala Lys Glu Gln Val Ala Leu Ile 180 185 190 Met Ser Ser Ser Gly
Thr Thr Gly Leu Pro Lys Gly Val Val Leu Thr 195 200 205 His Arg Asn
Leu Ser Val Arg Phe Val His Cys Lys Asp Pro Leu Phe 210 215 220 Gly
Thr Arg Thr Ile Pro Ser Thr Ser Ile Leu Ser Ile Val Pro Phe 225 230
235 240 His His Ala Phe Gly Met Phe Thr Thr Leu Ser Tyr Phe Ile Val
Gly 245 250 255 Leu Arg Val Val Leu Leu Lys Arg Phe Glu Glu Lys Phe
Phe Leu Ser 260 265 270 Thr Ile Glu Lys Tyr Arg Ile Pro Thr Ile Val
Leu Ala Pro Pro Val 275 280 285 Met Val Phe Leu Ala Lys Ser Pro Leu
Val Asp Gln Tyr Asp Leu Ser 290 295 300 Ser Ile Arg Glu Val Ala Thr
Gly Gly Ala Pro Val Gly Thr Glu Val 305 310 315 320 Ala Val Ala Val
Ala Lys Arg Leu Lys Ile Gly Gly Ile Leu Gln Gly 325 330 335 Tyr Gly
Leu Thr Glu Thr Cys Cys Ala Val Leu Ile Thr Pro His Asp 340 345 350
Asp Val Lys Thr Gly Ser Thr Gly Arg Val Ala Pro Tyr Val Gln Ala 355
360 365 Lys Ile Val Asp Leu Thr Thr Gly Lys Ser Leu Gly Pro Asn Lys
Arg 370 375 380 Gly Glu Leu Cys Phe Lys Ser Glu Ile Ile Met Lys Gly
Tyr Phe Asn 385 390 395 400 Asn Lys Gln Ala Thr Glu Glu Ala Ile Asp
Lys Glu Gly Trp Leu His 405 410 415 Ser Gly Asp Val Gly Tyr Tyr Asp
Asp Asp Gly His Phe Phe Val Val 420 425 430 Asp Arg Leu Lys Glu Leu
Ile Lys Tyr Lys Gly Tyr Gln Val Ala Pro 435 440 445 Ala Glu Leu Glu
Trp Leu Leu Leu Gln His Pro Ser Ile Lys Asp Ala 450 455 460 Gly Val
Thr Gly Val Pro Asp Glu Ala Ala Gly Glu Leu Pro Gly Ala 465 470 475
480 Cys Ile Val Leu Gln Glu Gly Lys Ser Leu Thr Glu Gln Glu Ile Ile
485 490 495 Asp Tyr Ile Ala Glu Arg Val Ser Pro Thr Lys Arg Ile Arg
Gly Gly 500 505 510 Val Val Phe Val Asp Asp Ile Pro Lys Gly Ala Thr
Gly Lys Leu Val 515 520 525 Arg Ser Glu Leu Arg Lys Leu Leu Ala Gln
Lys Lys Ser Lys Leu 530 535 540 <210> SEQ ID NO 13
<211> LENGTH: 543 <212> TYPE: PRT <213> ORGANISM:
Wild Type Rhagophthalmus ohbai Orange Luciferase <400>
SEQUENCE: 13 Met Pro Asn Glu Ile Ile Leu His Gly Ala Lys Pro Arg
Asp Pro Leu 1 5 10 15 Asp Leu Gly Thr Ala Gly Ile Gln Leu Tyr Arg
Ala Leu Thr Asn Phe 20 25 30 Ser Phe Leu Arg Glu Ala Leu Ile Asp
Ala His Thr Glu Glu Val Val 35 40 45 Ser Tyr Ala Asp Ile Leu Glu
Asn Ser Cys Arg Leu Ala Lys Cys Tyr 50 55 60 Glu Asn Tyr Gly Leu
Arg Gln Asn Ser Val Ile Ser Val Cys Ser Glu 65 70 75 80 Asn Ser Thr
Ile Phe Phe Tyr Pro Val Ile Ala Ala Leu Tyr Met Gly 85 90 95 Val
Ile Thr Ala Thr Val Asn Asp Ser Tyr Thr Glu Arg Glu Leu Leu 100 105
110 Glu Thr Leu Asn Ile Ser Lys Pro Glu Leu Val Phe Cys Ser Lys Lys
115 120 125 Ala Ile Lys Asn Met Met Ala Leu Lys Arg Asn Val Asn Phe
Ile Lys 130 135 140 Lys Val Val Leu Leu Asp Ser Lys Glu Asp Met Gly
Glu Ala Gln Cys 145 150 155 160 Leu Ser Asn Phe Met Ala Arg Tyr Ser
Glu Pro Asn Leu Asp Val Arg 165 170 175 Asn Phe Lys Pro Arg Asp Phe
Asp Ala Lys Glu Gln Val Ala Leu Ile 180 185 190 Met Ser Ser Ser Gly
Thr Thr Gly Leu Pro Lys Gly Val Val Leu Thr 195 200 205 His Arg Asn
Leu Ser Val Arg Phe Val His Cys Lys Asp Pro Leu Phe 210 215 220 Gly
Asn Arg Thr Ile Pro Ser Thr Ser Ile Leu Ser Ile Val Pro Phe 225 230
235 240 His His Ala Phe Gly Met Phe Thr Thr Leu Ser Tyr Phe Ile Val
Gly 245 250 255 Leu Arg Val Val Leu Leu Lys Arg Phe Glu Glu Lys Phe
Phe Leu Ser 260 265 270 Thr Ile Glu Lys Tyr Arg Ile Pro Thr Ile Val
Leu Ala Pro Pro Val 275 280 285 Met Val Phe Leu Ala Lys Ser Pro Leu
Val Asp Gln Tyr Asp Leu Ser 290 295 300 Ser Ile Arg Glu Val Ala Thr
Gly Gly Ala Pro Val Gly Thr Glu Val 305 310 315 320 Ala Val Ala Val
Ala Lys Arg Leu Lys Ile Gly Gly Ile Leu Gln Gly 325 330 335 Tyr Gly
Leu Thr Glu Thr Cys Cys Ala Val Leu Ile Thr Pro His Asp 340 345 350
Asp Val Lys Thr Gly Ser Thr Gly Arg Val Ala Pro Tyr Val Gln Ala 355
360 365
Lys Ile Val Asp Leu Thr Thr Gly Lys Ser Leu Gly Pro Asn Lys Arg 370
375 380 Gly Glu Leu Cys Phe Lys Ser Glu Ile Ile Met Lys Gly Tyr Phe
Asn 385 390 395 400 Asn Lys Gln Ala Thr Glu Glu Ala Ile Asp Lys Glu
Gly Trp Leu His 405 410 415 Ser Gly Asp Val Gly Tyr Tyr Asp Asp Asp
Gly His Phe Phe Val Val 420 425 430 Asp Arg Leu Lys Glu Leu Ile Lys
Tyr Lys Gly Tyr Gln Val Ala Pro 435 440 445 Ala Glu Leu Glu Trp Leu
Leu Leu Gln His Pro Ser Ile Lys Asp Ala 450 455 460 Gly Val Thr Gly
Val Pro Asp Glu Ala Ala Gly Glu Leu Pro Gly Ala 465 470 475 480 Cys
Ile Val Leu Gln Glu Gly Lys Ser Leu Thr Glu Gln Glu Ile Ile 485 490
495 Asp Tyr Ile Ala Glu Arg Val Ser Pro Thr Lys Arg Ile Arg Gly Gly
500 505 510 Val Val Phe Val Asp Asp Ile Pro Lys Gly Ala Thr Gly Lys
Leu Val 515 520 525 Arg Ser Glu Leu Arg Lys Leu Leu Ala Gln Lys Lys
Ser Lys Leu 530 535 540 <210> SEQ ID NO 14 <211>
LENGTH: 543 <212> TYPE: PRT <213> ORGANISM: Mutant
Rhagophthalmus ohbai Green Luciferase of the Invention <400>
SEQUENCE: 14 Met Ala Asn Glu Ile Ile Leu His Gly Ala Lys Pro Arg
Asp Pro Leu 1 5 10 15 Asp Leu Gly Thr Ala Gly Ile Gln Leu Tyr Arg
Ala Leu Thr Asn Phe 20 25 30 Ser Phe Leu Arg Glu Ala Leu Ile Asp
Ala His Thr Glu Glu Val Val 35 40 45 Ser Tyr Ala Asp Ile Leu Glu
Asn Ser Cys Arg Leu Ala Lys Cys Tyr 50 55 60 Glu Asn Tyr Gly Leu
Arg Gln Asn Ser Val Ile Ser Val Cys Ser Glu 65 70 75 80 Asn Ser Thr
Ile Phe Phe Tyr Pro Val Ile Ala Ala Leu Tyr Met Gly 85 90 95 Val
Ile Thr Ala Thr Val Asn Asp Ser Tyr Thr Glu Arg Glu Leu Leu 100 105
110 Glu Thr Leu Asn Ile Ser Lys Pro Glu Leu Val Phe Cys Ser Lys Lys
115 120 125 Ala Ile Lys Asn Met Met Ala Leu Lys Arg Asn Val Asn Phe
Ile Lys 130 135 140 Lys Val Val Leu Leu Asp Ser Lys Glu Asp Met Gly
Glu Ala Gln Cys 145 150 155 160 Leu Ser Asn Phe Met Ala Arg Tyr Ser
Glu Pro Asn Leu Asp Val Arg 165 170 175 Asn Phe Lys Pro Arg Asp Phe
Asp Ala Lys Glu Gln Val Ala Leu Ile 180 185 190 Met Ser Ser Ser Gly
Thr Thr Gly Leu Pro Lys Gly Val Val Leu Thr 195 200 205 His Arg Asn
Leu Ser Val Arg Phe Val His Cys Lys Asp Pro Leu Phe 210 215 220 Gly
Thr Arg Thr Ile Pro Ser Thr Ser Ile Leu Ser Ile Val Pro Phe 225 230
235 240 His His Ala Phe Gly Met Phe Thr Thr Leu Ser Tyr Phe Ile Val
Gly 245 250 255 Leu Arg Val Val Leu Leu Lys Arg Phe Glu Glu Lys Phe
Phe Leu Ser 260 265 270 Thr Ile Glu Lys Tyr Arg Ile Pro Thr Ile Val
Leu Ala Pro Pro Val 275 280 285 Met Val Phe Leu Ala Lys Ser Pro Leu
Val Asp Gln Tyr Asp Leu Ser 290 295 300 Ser Ile Arg Glu Val Ala Thr
Gly Gly Ala Pro Val Gly Thr Glu Val 305 310 315 320 Ala Val Ala Val
Ala Lys Arg Leu Lys Ile Gly Gly Ile Leu Gln Gly 325 330 335 Tyr Gly
Leu Thr Glu Thr Cys Cys Ala Val Leu Ile Thr Pro His Asp 340 345 350
Asp Val Lys Thr Gly Ser Thr Gly Arg Val Ala Pro Tyr Val Gln Ala 355
360 365 Lys Ile Val Asp Leu Thr Thr Gly Lys Ser Leu Gly Pro Asn Lys
Arg 370 375 380 Gly Glu Leu Cys Phe Lys Ser Glu Ile Ile Met Lys Gly
Tyr Phe Asn 385 390 395 400 Asn Lys Gln Ala Thr Glu Glu Ala Ile Asp
Lys Glu Gly Trp Leu His 405 410 415 Ser Gly Asp Val Gly Tyr Tyr Asp
Asp Asp Gly His Phe Phe Val Val 420 425 430 Asp Arg Leu Lys Glu Leu
Ile Lys Tyr Lys Gly Tyr Gln Val Ala Pro 435 440 445 Ala Glu Leu Glu
Trp Leu Leu Leu Gln His Pro Ser Ile Lys Asp Ala 450 455 460 Gly Val
Thr Gly Val Pro Asp Glu Ala Ala Gly Glu Leu Pro Gly Ala 465 470 475
480 Cys Ile Val Leu Gln Glu Gly Lys Ser Leu Thr Glu Gln Glu Ile Ile
485 490 495 Asp Tyr Ile Ala Glu Arg Val Ser Pro Thr Lys Arg Ile Arg
Gly Gly 500 505 510 Val Val Phe Val Asp Asp Ile Pro Lys Gly Ala Thr
Gly Lys Leu Val 515 520 525 Arg Ser Glu Leu Arg Lys Leu Leu Ala Gln
Lys Lys Ser Lys Leu 530 535 540 <210> SEQ ID NO 15
<211> LENGTH: 543 <212> TYPE: PRT <213> ORGANISM:
Mutant Rhagophthalmus ohbai Orange Luciferase of the Invention
<400> SEQUENCE: 15 Met Ala Asn Glu Ile Ile Leu His Gly Ala
Lys Pro Arg Asp Pro Leu 1 5 10 15 Asp Leu Gly Thr Ala Gly Ile Gln
Leu Tyr Arg Ala Leu Thr Asn Phe 20 25 30 Ser Phe Leu Arg Glu Ala
Leu Ile Asp Ala His Thr Glu Glu Val Val 35 40 45 Ser Tyr Ala Asp
Ile Leu Glu Asn Ser Cys Arg Leu Ala Lys Cys Tyr 50 55 60 Glu Asn
Tyr Gly Leu Arg Gln Asn Ser Val Ile Ser Val Cys Ser Glu 65 70 75 80
Asn Ser Thr Ile Phe Phe Tyr Pro Val Ile Ala Ala Leu Tyr Met Gly 85
90 95 Val Ile Thr Ala Thr Val Asn Asp Ser Tyr Thr Glu Arg Glu Leu
Leu 100 105 110 Glu Thr Leu Asn Ile Ser Lys Pro Glu Leu Val Phe Cys
Ser Lys Lys 115 120 125 Ala Ile Lys Asn Met Met Ala Leu Lys Arg Asn
Val Asn Phe Ile Lys 130 135 140 Lys Val Val Leu Leu Asp Ser Lys Glu
Asp Met Gly Glu Ala Gln Cys 145 150 155 160 Leu Ser Asn Phe Met Ala
Arg Tyr Ser Glu Pro Asn Leu Asp Val Arg 165 170 175 Asn Phe Lys Pro
Arg Asp Phe Asp Ala Lys Glu Gln Val Ala Leu Ile 180 185 190 Met Ser
Ser Ser Gly Thr Thr Gly Leu Pro Lys Gly Val Val Leu Thr 195 200 205
His Arg Asn Leu Ser Val Arg Phe Val His Cys Lys Asp Pro Leu Phe 210
215 220 Gly Asn Arg Thr Ile Pro Ser Thr Ser Ile Leu Ser Ile Val Pro
Phe 225 230 235 240 His His Ala Phe Gly Met Phe Thr Thr Leu Ser Tyr
Phe Ile Val Gly 245 250 255 Leu Arg Val Val Leu Leu Lys Arg Phe Glu
Glu Lys Phe Phe Leu Ser 260 265 270 Thr Ile Glu Lys Tyr Arg Ile Pro
Thr Ile Val Leu Ala Pro Pro Val 275 280 285 Met Val Phe Leu Ala Lys
Ser Pro Leu Val Asp Gln Tyr Asp Leu Ser 290 295 300 Ser Ile Arg Glu
Val Ala Thr Gly Gly Ala Pro Val Gly Thr Glu Val 305 310 315 320 Ala
Val Ala Val Ala Lys Arg Leu Lys Ile Gly Gly Ile Leu Gln Gly 325 330
335 Tyr Gly Leu Thr Glu Thr Cys Cys Ala Val Leu Ile Thr Pro His Asp
340 345 350 Asp Val Lys Thr Gly Ser Thr Gly Arg Val Ala Pro Tyr Val
Gln Ala 355 360 365 Lys Ile Val Asp Leu Thr Thr Gly Lys Ser Leu Gly
Pro Asn Lys Arg 370 375 380 Gly Glu Leu Cys Phe Lys Ser Glu Ile Ile
Met Lys Gly Tyr Phe Asn 385 390 395 400 Asn Lys Gln Ala Thr Glu Glu
Ala Ile Asp Lys Glu Gly Trp Leu His 405 410 415 Ser Gly Asp Val Gly
Tyr Tyr Asp Asp Asp Gly His Phe Phe Val Val 420 425 430 Asp Arg Leu
Lys Glu Leu Ile Lys Tyr Lys Gly Tyr Gln Val Ala Pro 435 440 445 Ala
Glu Leu Glu Trp Leu Leu Leu Gln His Pro Ser Ile Lys Asp Ala 450 455
460 Gly Val Thr Gly Val Pro Asp Glu Ala Ala Gly Glu Leu Pro Gly Ala
465 470 475 480 Cys Ile Val Leu Gln Glu Gly Lys Ser Leu Thr Glu Gln
Glu Ile Ile 485 490 495 Asp Tyr Ile Ala Glu Arg Val Ser Pro Thr Lys
Arg Ile Arg Gly Gly 500 505 510
Val Val Phe Val Asp Asp Ile Pro Lys Gly Ala Thr Gly Lys Leu Val 515
520 525 Arg Ser Glu Leu Arg Lys Leu Leu Ala Gln Lys Lys Ser Lys Leu
530 535 540 <210> SEQ ID NO 16 <211> LENGTH: 1638
<212> TYPE: DNA <213> ORGANISM: Mutant Phrixothrix
Green Luciferase <400> SEQUENCE: 16 atggaagaag agaacatcag
gcacggcgag cgccctcggg acatcgtcca ccctggctcc 60 gccggccagc
agctgtacca gtccctgtac aagttcgcct ccttccctga ggccatcatc 120
gacgcccaca ccaacgaggt gatctcctac gcccagattt tcgaaaccag ctgccgcctg
180 gccgtgagca tcgagcagta cggcctgaac gagaacaacg tggtgggcgt
ctgtagcgag 240 aacaacatca acttcttcaa ccctgtgctg gccgccctgt
acctcggcat cccagtggcc 300 acctccaacg atatgtacac cgatggcgag
ctgaccggcc acctgaacat ctccaagcca 360 accatcatgt tcagctccaa
gaaggccctg cccctgatcc tgagagtgca gcagaacctg 420 agcttcatca
agaaggtggt ggtgatcgac agcatgtacg acatcaacgg cgtggagtgc 480
gtgtctacct tcgttgcccg gtacaccgac cacaccttcg acccactgtc cttcacccca
540 aaggacttcg accccctgga gaagatcgcc ctgatcatgt catcctccgg
caccaccggc 600 ctgcctaagg gcgtggtgct gagccacaga agcctgacca
tcagattcgt ccacagcagg 660 gaccccatct acggcacccg caccgtgccc
cagacctcca tcctgtccct ggtgccattt 720 caccacgcct tcggcatgtt
caccaccctg tcctacttcg tggtgggcct gaaggtggtg 780 atgctgaaga
agttcgaggg cgccctcttc ctgaagacca tccagaacta caagatccct 840
acaatcgtgg tggcccctcc agtgatggtg ttcctggcta agagcccact ggtggatcag
900 tacgatctgt ccagcctcac cgaggtggct accggcggcg ctcctctggg
caaggatgtg 960 gccgaggctg tggccaagag attgaagctg cctggcatca
tccagggcta cggcctgacc 1020 gagacctgct gcgctgtgat gatcacccct
cacaacgctg tgaagaccgg ctccaccggc 1080 agacccctgc catacatcaa
ggctaaggtg ctggataacg ctaccggcaa agccctggga 1140 ccaggcgaga
gaggcgagat ttgcttcaag agcgagatga tcatgaaggg ctactacaac 1200
aaccctgagg ccaccatcga caccatcgac aaggatggct ggctgcactc tggcgacatc
1260 ggctactacg acgaggatgg caacttcttc atcgtggatc ggctgaaaga
gctgatcaag 1320 tacaagggct accaggtggc ccctgctgag ctggagaact
tgcttctgca gcacccaagc 1380 atcgctgatg ccggcgtgac cggcgtgccc
gacgagttcg ctggccagct gcctgctgct 1440 tgtgtcgtgc tggagtctgg
caagacattg accgagaagg aggtgcaaga tttcatcgcc 1500 gcccaggtga
ccccaactaa gcacctgcgg ggcggcgtgg tgttcgtgga cagcatccct 1560
aaaggcccta ccggcaagct gatcagaaag gagctgcggg agattttcgc ccagagagcc
1620 ccaaagtcca agctgtaa 1638 <210> SEQ ID NO 17 <211>
LENGTH: 75 <212> TYPE: DNA <213> ORGANISM: Phrixothrix
Red Luciferase <400> SEQUENCE: 17 cagcaggact acaattatat
caatcattat ataaatattc ttatattact gacggaataa 60 tcgatgccca tacca 75
<210> SEQ ID NO 18 <211> LENGTH: 71 <212> TYPE:
DNA <213> ORGANISM: Phrixothrix Red Luciferase <400>
SEQUENCE: 18 gcaggactac aattatatca atcattatat aaatactcgt atattactga
cggaataatc 60 gatgcccata c 71 <210> SEQ ID NO 19 <211>
LENGTH: 77 <212> TYPE: DNA <213> ORGANISM: Phrixothrix
Red Luciferase <400> SEQUENCE: 19 caatgaagta atatcatatg
ctcaaatatt tgaaacaagt tgccgcttgg cagttagtct 60 agaaaaatat ggcttgg
77 <210> SEQ ID NO 20 <211> LENGTH: 75 <212>
TYPE: DNA <213> ORGANISM: Phrixothrix Red Luciferase
<400> SEQUENCE: 20 aatatttgaa accagctgcc gcttggcagt
tagtctagag aaatatggct tggatcataa 60 caatgttgtg gcaat 75 <210>
SEQ ID NO 21 <211> LENGTH: 77 <212> TYPE: DNA
<213> ORGANISM: Phrixothrix Red Luciferase <400>
SEQUENCE: 21 gaaaacaaca tacacttttt tggcccttta attgctgccc tataccaagg
aataccaatg 60 gcaacatcaa atgatat 77 <210> SEQ ID NO 22
<211> LENGTH: 73 <212> TYPE: DNA <213> ORGANISM:
Phrixothrix Red Luciferase <400> SEQUENCE: 22 acttttttgg
ccctttaatt gctgctttat accaagggat accaatggca acatcaaatg 60
atatgtacac aga 73 <210> SEQ ID NO 23 <211> LENGTH: 71
<212> TYPE: DNA <213> ORGANISM: Phrixothrix Red
Luciferase <400> SEQUENCE: 23 catcaaatga tatgtacaca
gaaagggaga tgatcggcca tttgaatata tcgaaaccat 60 gccttatgtt t 71
<210> SEQ ID NO 24 <211> LENGTH: 77 <212> TYPE:
DNA <213> ORGANISM: Phrixothrix Red Luciferase <400>
SEQUENCE: 24 tttattctga aagtacaaaa acatctagat tttctcaaaa aagtcatagt
cattgatagt 60 atgtacgata tcaatgg 77 <210> SEQ ID NO 25
<211> LENGTH: 77 <212> TYPE: DNA <213> ORGANISM:
Phrixothrix Red Luciferase <400> SEQUENCE: 25 atgtacgata
tcaatggcgt tgaatgcgta tttagttttg tttcacgtta tactgatcac 60
gcctttgatc cagtgaa 77 <210> SEQ ID NO 26 <211> LENGTH:
75 <212> TYPE: DNA <213> ORGANISM: Phrixothrix Red
Luciferase <400> SEQUENCE: 26 atatcaatgg cgttgaatgc
gtatttagct ttgtttcacg gtatactgat cacgcctttg 60 atccagtgaa attta 75
<210> SEQ ID NO 27 <211> LENGTH: 77 <212> TYPE:
DNA <213> ORGANISM: Phrixothrix Red Luciferase <400>
SEQUENCE: 27 gtatttagct ttgtttcacg ttatactgat cacgcgttcg atccagtgaa
atttaaccca 60 aaagagtttg atccctt 77 <210> SEQ ID NO 28
<211> LENGTH: 77 <212> TYPE: DNA <213> ORGANISM:
Phrixothrix Red Luciferase <400> SEQUENCE: 28 tttaacccaa
aagagtttga tcccttggaa agaaccgcgc taattatgac atcatctgga 60
acaactggat tgcctaa 77 <210> SEQ ID NO 29 <211> LENGTH:
81 <212> TYPE: DNA <213> ORGANISM: Phrixothrix Red
Luciferase <400> SEQUENCE: 29 gaaccgcatt aattatgaca
tcatctggaa caactggcct gcctaaaggg gtagtaataa 60 gccatagaag
tataactata a 81 <210> SEQ ID NO 30 <211> LENGTH: 73
<212> TYPE: DNA <213> ORGANISM: Phrixothrix Red
Luciferase <400> SEQUENCE: 30 ctggattgcc taaaggggta
gtaataagcc ataggagtat aactataaga ttcgtccata 60 gcagtgatcc cat 73
<210> SEQ ID NO 31 <211> LENGTH: 77 <212> TYPE:
DNA <213> ORGANISM: Phrixothrix Red Luciferase <400>
SEQUENCE: 31 aagaaatttg agggcgaatt cttcttaaaa accatccaaa attacaaaat
cgcttctatt 60 gtagttcctc ctccaat 77
<210> SEQ ID NO 32 <211> LENGTH: 71 <212> TYPE:
DNA <213> ORGANISM: Phrixothrix Red Luciferase <400>
SEQUENCE: 32 agggcgaatt cttcttaaaa accatacaaa actacaaaat cgcttctatt
gtagttcctc 60 ctccaattat g 71 <210> SEQ ID NO 33 <211>
LENGTH: 77 <212> TYPE: DNA <213> ORGANISM: Phrixothrix
Red Luciferase <400> SEQUENCE: 33 gttcctcctc caattatggt
atatttggct aaaagtcctc tagtcgatga atacaattta 60 tcgagcttaa cggaaat
77 <210> SEQ ID NO 34 <211> LENGTH: 73 <212>
TYPE: DNA <213> ORGANISM: Phrixothrix Red Luciferase
<400> SEQUENCE: 34 tttggctaaa agtccattag tcgatgaata
caatctgtcg agcttaacgg aaattgcttg 60 tggagggtct cct 73 <210>
SEQ ID NO 35 <211> LENGTH: 73 <212> TYPE: DNA
<213> ORGANISM: Phrixothrix Red Luciferase <400>
SEQUENCE: 35 ggaaattgct tgtggagggt ctcctttagg aagagacatc gcagataaag
tagcaaagag 60 attgaaagta cat 73 <210> SEQ ID NO 36
<211> LENGTH: 77 <212> TYPE: DNA <213> ORGANISM:
Phrixothrix Red Luciferase <400> SEQUENCE: 36 gggtctcctt
taggaagaga tatcgcagat aaagtagcca agagattgaa agtacatgga 60
atcctacaag gatatgg 77 <210> SEQ ID NO 37 <211> LENGTH:
73 <212> TYPE: DNA <213> ORGANISM: Phrixothrix Red
Luciferase <400> SEQUENCE: 37 ggatatggat taaccgaaac
ctgcagcgct ctaatactga gccccaatga tcgagaactt 60 aaaaaaggtg caa 73
<210> SEQ ID NO 38 <211> LENGTH: 77 <212> TYPE:
DNA <213> ORGANISM: Phrixothrix Red Luciferase <400>
SEQUENCE: 38 ccgaaacctg cagcgctcta atacttagcc ccaacgatag agaacttaaa
aaaggtgcaa 60 ttggaacgcc tatgcca 77 <210> SEQ ID NO 39
<211> LENGTH: 81 <212> TYPE: DNA <213> ORGANISM:
Phrixothrix Red Luciferase <400> SEQUENCE: 39 ctaatactta
gccccaatga tcgagaactt aaaaagggtg caattggaac gcctatgcca 60
tatgttcaag ttaaagttat a 81 <210> SEQ ID NO 40 <211>
LENGTH: 73 <212> TYPE: DNA <213> ORGANISM: Phrixothrix
Red Luciferase <400> SEQUENCE: 40 tgggaaggcg ctaggaccaa
gagaaaaagg cgagatttgc ttcaaaagtc aaatgcttat 60 gaaaggatat cac 73
<210> SEQ ID NO 41 <211> LENGTH: 77 <212> TYPE:
DNA <213> ORGANISM: Phrixothrix Red Luciferase <400>
SEQUENCE: 41 aaaaggcgaa atatgcttca aaagtcaaat gcttatgaag ggctatcaca
acaatccgca 60 agcaactcgt gatgctc 77 <210> SEQ ID NO 42
<211> LENGTH: 75 <212> TYPE: DNA <213> ORGANISM:
Phrixothrix Red Luciferase <400> SEQUENCE: 42 tccgcaagca
actcgtgatg ctcttgacaa agatgggtgg cttcatactg gggatcttgg 60
atattacgac gaaga 75 <210> SEQ ID NO 43 <211> LENGTH: 73
<212> TYPE: DNA <213> ORGANISM: Phrixothrix Red
Luciferase <400> SEQUENCE: 43 gacagattta tctatgtagt
tgatcgattg aaagagctta ttaaatataa aggatatcag 60 gttgcgcctg ctg 73
<210> SEQ ID NO 44 <211> LENGTH: 77 <212> TYPE:
DNA <213> ORGANISM: Phrixothrix Red Luciferase <400>
SEQUENCE: 44 atttatctat gtagttgatc gattgaaaga actcatcaaa tataaaggat
atcaggttgc 60 gcctgctgaa ctggaaa 77 <210> SEQ ID NO 45
<211> LENGTH: 75 <212> TYPE: DNA <213> ORGANISM:
Phrixothrix Red Luciferase <400> SEQUENCE: 45 cgcctgctga
actggaaaat ctgcttttac aacacccaaa tatttctgat gcgggtgtta 60
ttggaattcc ggacg 75 <210> SEQ ID NO 46 <211> LENGTH: 77
<212> TYPE: DNA <213> ORGANISM: Phrixothrix Red
Luciferase <400> SEQUENCE: 46 ctgaactgga aaatctgctt
ttacaacatc ctaatatttc tgatgcgggt gttattggaa 60 ttccggacga atttgct
77 <210> SEQ ID NO 47 <211> LENGTH: 75 <212>
TYPE: DNA <213> ORGANISM: Phrixothrix Red Luciferase
<400> SEQUENCE: 47 ttacaacatc caaatatttc tgatgcgggt
gtcattggaa ttccggacga atttgctggt 60 caattacctt ccgcg 75 <210>
SEQ ID NO 48 <211> LENGTH: 77 <212> TYPE: DNA
<213> ORGANISM: Phrixothrix Red Luciferase <400>
SEQUENCE: 48 tgcgggtgtt attggaattc cggacgaatt tgctggtcag ttaccttccg
cgtgtgttgt 60 gttagagcct ggtaaga 77 <210> SEQ ID NO 49
<211> LENGTH: 73 <212> TYPE: DNA <213> ORGANISM:
Phrixothrix Red Luciferase <400> SEQUENCE: 49 aactaaacat
cttcgaggcg gtgtcgtatt tatcgacagt attccaaaag gcccaacagg 60
aaaactcatg aga 73 <210> SEQ ID NO 50 <211> LENGTH: 48
<212> TYPE: DNA <213> ORGANISM: Phrixothrix Red
Luciferase <400> SEQUENCE: 50 gaactccgtg caatatttgc
ccgggaacag gcaaaatcaa aactataa 48 <210> SEQ ID NO 51
<211> LENGTH: 77 <212> TYPE: DNA <213> ORGANISM:
Rhagophthalmus ohbai Green Luciferase <400> SEQUENCE: 51
cccagggacc ccctggacct gggcaccgcc ggcattcagc tctacagagc cctgaccaac
60 ttctccttcc tgaggga 77 <210> SEQ ID NO 52 <211>
LENGTH: 77 <212> TYPE: DNA <213> ORGANISM:
Rhagophthalmus ohbai Green Luciferase <400> SEQUENCE: 52
cctgggcacc gccggcatcc agctgtacag ggccctgacc aacttctcct tcctgaggga
60 ggccctgatc gacgccc 77
<210> SEQ ID NO 53 <211> LENGTH: 79 <212> TYPE:
DNA <213> ORGANISM: Rhagophthalmus ohbai Green Luciferase
<400> SEQUENCE: 53 gtggtgtctt acgccgacat cctggagaac
agctgtagac tggctaagtg ctacgagaac 60 tacggcctgc gccagaaca 79
<210> SEQ ID NO 54 <211> LENGTH: 79 <212> TYPE:
DNA <213> ORGANISM: Rhagophthalmus ohbai Green Luciferase
<400> SEQUENCE: 54 gcgccagaac agcgtgatct ccgtgtgcag
cgagaatagc accatcttct tctaccccgt 60 gatcgccgcc ctgtacatg 79
<210> SEQ ID NO 55 <211> LENGTH: 81 <212> TYPE:
DNA <213> ORGANISM: Rhagophthalmus ohbai Green Luciferase
<400> SEQUENCE: 55 tcaagaaggt ggtgctgctg gacagcaagg
aggatatggg cgaggcccag tgcctgagca 60 acttcatggc ccggtactcc g 81
<210> SEQ ID NO 56 <211> LENGTH: 81 <212> TYPE:
DNA <213> ORGANISM: Rhagophthalmus ohbai Green Luciferase
<400> SEQUENCE: 56 tcaagccaag ggacttcgac gccaaggagc
aggtggccct tattatgtcc tcctctggca 60 ccaccggcct gccaaagggc g 81
<210> SEQ ID NO 57 <211> LENGTH: 75 <212> TYPE:
DNA <213> ORGANISM: Rhagophthalmus ohbai Green Luciferase
<400> SEQUENCE: 57 atcgagaagt acagaatccc aacaatcgtg
ctggcccctc ctgtgatggt gttcctggcc 60 aagagccccc tggtg 75 <210>
SEQ ID NO 58 <211> LENGTH: 79 <212> TYPE: DNA
<213> ORGANISM: Rhagophthalmus ohbai Green Luciferase
<400> SEQUENCE: 58 atcccaacaa tcgtgctggc cccccccgtg
atggtgttcc tggctaagag ccccctggtg 60 gaccagtacg acctgtcca 79
<210> SEQ ID NO 59 <211> LENGTH: 75 <212> TYPE:
DNA <213> ORGANISM: Rhagophthalmus ohbai Green Luciferase
<400> SEQUENCE: 59 gagaggtggc caccggcggc gcccctgtgg
gcaccgaggt tgccgtggcc gtggccaagc 60 ggctgaagat cggcg 75 <210>
SEQ ID NO 60 <211> LENGTH: 75 <212> TYPE: DNA
<213> ORGANISM: Rhagophthalmus ohbai Green Luciferase
<400> SEQUENCE: 60 gccatcgaca aggagggctg gctgcactcc
ggcgacgtgg gatactacga cgacgatggc 60 cacttcttcg tggtg 75 <210>
SEQ ID NO 61 <211> LENGTH: 73 <212> TYPE: DNA
<213> ORGANISM: Rhagophthalmus ohbai Green Luciferase
<400> SEQUENCE: 61 ctccggcgac gtgggctact acgacgacga
tggacatttc ttcgtggtgg accggctgaa 60 ggagctgatc aag 73 <210>
SEQ ID NO 62 <211> LENGTH: 81 <212> TYPE: DNA
<213> ORGANISM: Rhagophthalmus ohbai Green Luciferase
<400> SEQUENCE: 62 cgacgatggc cacttcttcg tggtggaccg
gctgaaagag ctgatcaagt acaagggcta 60 ccaggtggcc cccgccgagc t 81
<210> SEQ ID NO 63 <211> LENGTH: 71 <212> TYPE:
DNA <213> ORGANISM: Rhagophthalmus ohbai Green Luciferase
<400> SEQUENCE: 63 agtggctgct gctccagcac ccatccatca
aggatgccgg cgtgaccggc gtgcccgacg 60 aggccgccgg c 71 <210> SEQ
ID NO 64 <211> LENGTH: 75 <212> TYPE: DNA <213>
ORGANISM: Rhagophthalmus ohbai Green Luciferase <400>
SEQUENCE: 64 ccgagcagga gatcatcgac tacatcgccg agcgagtgtc tcccaccaag
cgcatccggg 60 gcggcgtcgt cttcg 75 <210> SEQ ID NO 65
<211> LENGTH: 71 <212> TYPE: DNA <213> ORGANISM:
Rhagophthalmus ohbai Green Luciferase <400> SEQUENCE: 65
gagcgggtgt cccccaccaa gcgcatccgg ggcggagtcg tcttcgtgga cgacatcccc
60 aagggcgcca c 71
* * * * *