Multiple gene transcription activity assay system

Abstract

A gene construct incorporating any of at least two luciferase genes which emit lights with different colors using an identical substrate such that the gene can be stably expressed in mammalian cells.

Description

TECHNICAL FIELD

[0001] The present invention relates to a gene construct for multiply detecting gene transcription activities in living cells by the use of luciferases which emit different color lights, an expression vector containing the construct, transformed mammalian cells containing the construct or the expression vector, a screening method of drugs using the mammalian cells, and a system for multiply determining the transcription activities of respective promoters.

[0002] The invention also relates to a gene and a polypeptide used for a system where the transcription activity in the living cells is detected by the use of the luciferase which emits red, orange or blue color light.

BACKGROUND ART

[0003] In the life science field, a transcription activity of an intracellular gene has been generally determined, and used for evaluation of exogenous factors given to cells, and analyses of intracellular signal transduction or expression of an individual protein group. The gene transcription activity has been directly determined by Western blotting and the like, or indirectly determined using a luciferase gene or a light-emitting enzyme gene as a reporter gene. In particular, it has been generalized to quantify the transcription activity based on an emitted light intensity using a firefly light-emitting enzyme gene. A fluorescent protein exhibits a fluorescent activity without need of a cofactor almost simultaneously with its intracellular expression. The fluorescent protein has been used as a monitor protein for examining a localization of a protein by the use of the fluorescent activity in the cell as an indicator, but it is difficult to quantify it, and it is unlikely to use it as the reporter gene for the gene expression.

[0004] It is important to analyze a quantitative and temporal dynamic change of the protein gene expression, but the transcription activity one gene has been primarily analyzed in conventional reporter techniques. However recently, a system (dual assay system, Promega) for determining two transcription activities by introducing two gene constructs into the cell, i.e., A transcription active region being inserted in a firefly light-emitting enzyme gene and B transcription active region being inserted in a Renilla light-emitting enzyme gene has been commercially available. However, this method is a system for determining the transcription activity by adding different luminescent substrates, respectively, two activities can not be determined simultaneously, and only two transcription activities can be determined. Furthermore, since a firefly luciferase is used, a wavelength thereof is changed due to pH and accurate determination is difficult.

[0005] Multiple signals are trafficked in a cell, and it is essential to construct a technique to quantitatively determine the multiple transcription activities. For example, in a human biological clock, a Per gene which gives a 24 hour rhythm is controlled by Clock and BMAL gene products. Thus, to precisely evaluate the biological clock, it is essential to determine multiple, at least three transcription activities. Until now, the transcription activity of an individual gene has been determined by the use of a firefly luciferase reporter gene, but a dynamic of only one gene transcription has been observed at a time, and an interaction of biological clock-related gene expressions has remained unclear.

[0006] Canceration progresses by abnormal growth of cells caused with activation of an oncogene or by the abnormal growth of the cells due to the control release caused along with inactivation of a tumor suppressing gene. Thus, to evaluate canceration factors and intracellular signal transduction of the canceration, it is desirable to determine the gene transcription activity of the oncogene, the tumor suppressing gene and a mitotic marker gene. However, in the conventional method, the dynamic of only one gene transcription has been observed at a time, the transcription activities of the three gene can not be evaluated at a time, and thus the interaction of the three genes involved in the canceration has not been sufficiently understood.

[0007] The transcription of a gene is caused by binding a substance which suppresses or promotes the gene expression to a particular sequence present on a gene sequence referred to as a promoter region upstream of a gene product. An E-box and a cAMP-binding site are representatives thereof. The gene transcription activity is determined by inserting a certain length of the promoter region into an upstream of a reporter gene. Furthermore, a particular sequence believed to be effective is then synthesized, and inserted into the upstream of the reporter gene to examine an effect of the particular sequence. To examine a transcription controlling effect of the particular sequence, it is necessary to simultaneously evaluate the transcription activity of the original promoter region and the transcription activity capable of standardizing the effect in combination. However, in the conventional method, the transcription dynamic of only one gene has been observed, and the particular sequence for the control of the transcription activity can not be sufficiently evaluated.

[0008] A luciferase is useful as a means to directly observe the gene transcription activity in the cells, and has been used as a detection monitor protein of the gene expression. There are a wide variety of luciferases, but no reporter gene for determining the transcription activity based on their diversity is available. If using luciferase genes which emit different color lights as the reporter genes and different transcriptional active regions are inserted into mammalian cells, then multiple transcription activities can be determined. A red-emitting luciferase derived from a rail road worm has the longest wavelength of luminescence, is easily discriminated compared to the luciferases derived from a firefly and a click beetle, and is highly permeable into the cell due to the red-emitting color. However, the expression of the red and green-emitting luciferases from the rail road worm has been successfully done only in Escherichia coli (US 2002/0119542-A1), and there is no successful example as the system in the mammalian cells including human cells.

[0009] There is also an example in which the expression of a luciferase gene from the rail road worm in the mammalian cells was enabled by modifying a structure of the gene (WO 2003/016839).

[0010] As the luciferase, a luciferase derived from Rhagophthalmus ohba has been also known.

[0011] The expression of a green-emitting luciferase derived from Rhagophthalmus ohba has been successfully done in only Escherichia coli (Ohmiya, Y. Sumiya, M. Viviani, V R. and Ohba N.; Comparative aspects of a luciferase molecule from the Japanese luminous beetle Rhagophthalmus ohba. Sci. Rept. Yokosuka City Mus. .47, 31-38, 2000). Based on this sequence, an orange-emitting luciferase derived from Rhagophthalmus ohba was created and the expression thereof was also successfully done in Escherichia coli (Viviani, V R., Uchida, A., Suenaga, N., Ryufuku M. and Ohmiya Y.: Thr-226 is a key-residue for bioluminescence spectra determination in beetle luciferases. Biochem. Biophys. Res. Commun., 280, 1286-1291, 2001). Additionally, as the luciferase, blue-emitting luciferases derived from a dinoflagellate and Renilla have been also known.

[0012] It is an object of the present invention to construct and optimize a reporter gene capable of determining or quantifying multiple transcription activities in a cell simultaneously or at the same phase, further develop a multiple gene transcription activity determining system using the reporter gene group, and utilize the same for cell functional analyses in life science, further the treatment/examination of pathology and new drug development.

[0013] It is also another object to make a gene construct by which a red- or a green-emitting luciferase from a rail road worm is stably transcribed and stably translated in mammalian cells or in animals.

[0014] It is also another object to make a gene construct by which an orange or a green-emitting luciferase from a Rhagophthalmus ohba is stably transcribed and stably translated in mammalian cells or in animals.

[0015] This enables to stably determine and visualize a change of the gene transcription activity in the mammalian cells or in the animals.

BRIEF DESCRIPTION OF THE DRAWINGS

[0016] FIG. 1 shows an outline of determination for multiple gene transcription activities and differences from a conventional method.

[0017] FIG. 2 shows a structure of an expression vector for mammalian cells and luminescence activity in Hela cells.

[0018] FIG. 3 shows luminescence spectra of a red-emitting luciferase and a green-emitting luciferase from a rail road worm produced in cultured mammalian cells.

[0019] FIG. 4 shows intracellular lifespan of a red-emitting luciferase and a green-emitting luciferase from a rail road worm produced in cultured mammalian cells.

[0020] FIG. 5 shows a simultaneous luminescence spectrum of a red-emitting luciferase and a green-emitting luciferase produced in cultured mammalian cells and property of a filter used for color identification (transmittance of lights).

[0021] FIG. 6 shows luminescence reaction curves and luminescence activity determining time of a red-emitting luciferase and a green-emitting luciferase.

[0022] FIG. 7 shows an abundance ratio and luminescence activity of a red-emitting luciferase and a green-emitting luciferase (in the case of using the filter in FIG. 5).

[0023] FIG. 8 shows a result of an actual multiple transcription activity determination, i.e., simultaneously determining two transcription activities by lights from a red-emitting luciferase and a green-emitting luciferase, determining the transcription activity of a standard gene by the light from a blue-emitting luciferase, and standardizing the two transcription activities.

[0024] FIG. 9 shows a simultaneous luminescence spectrum of a red-emitting luciferase, a green-emitting luciferase and a blue-emitting luciferase produced in cultured mammalian cells and property of filters used for color identification (transmittance of lights).

[0025] FIG. 10. shows a result indicating that transcription activities shown by a red-emitting luciferase and a green-emitting luciferase were obtained from continuous monitoring of the two transcription activities.

[0026] FIG. 11 shows an example in which many specimens are exhaustively analyzed by a primary screening.

[0027] FIG. 12 shows an example in which an individual event is evaluated by a secondary screening.

[0028] FIG. 13 shows homology of a DNA sequence of a rail road worm red-emitting luciferase gene mutant (SEQ ID NO:7) of the present invention with that of a rail road worm wild-type red-emitting luciferase gene (SEQ ID NO:3).

[0029] FIG. 14 shows homology of a DNA sequence of a rail road worm red-emitting luciferase gene mutant (SEQ ID NO:7) having a maximum luminescence wavelength of 630 nm with that of a rail road worm red-emitting luciferase gene mutant of WO 2003/016839 (SEQ ID NO:6) having a maximum luminescence wavelength of 622 nm.

[0030] FIG. 15 shows differences in luminescence activity of a wild-type rail road worm red-emitting luciferase and a mutant rail road worm red-emitting luciferase.

[0031] FIG. 16 shows luminescence spectra of a mutant (SEQ ID NO:7) introduced and produced in mammalian cells (mouse NIH3T3 cells, a thick line) and a rail road wild-type (SEQ ID NO:3) produced in insect silk worm cells (a thin line).

[0032] FIG. 17 shows homology of a DNA sequence of a Rhagophthalmus ohba green-emitting luciferase mutant (SEQ ID NO:10) with that of a wild-type (SEQ ID NO:8).

[0033] FIG. 18 shows difference in luminescence activity of Rhagophthalmus ohba green-emitting luciferase wild-type and mutant and Rhagophthalmus ohba orange-emitting luciferase wild type and mutant.

[0034] FIG. 19 shows an outline of a method for detecting the expression of three genes by one substrate, a firefly luciferin. In the method of the present embodiment, determination is performed by transmitting three transcription activities by red, orange and green color lights and identifying the respective colors.

[0035] FIG. 20 shows luminescence spectra of a mixture of Rhagophthalmus ohba green and orange-emitting, rail road worm red-emitting luciferases and a transmittance curve of a set split filter.

[0036] FIG. 21 shows abundance ratio and luminescence activity (when using the filter shown in FIG. 22) of two color luciferases (combinations of (A) green-red-emitting, (B) green-orange-emitting and (C) orange-red-emitting luciferases).

[0037] FIG. 22 shows an abundance ratio and luminescence activity (when using the filter shown in FIG. 20) of three color luciferases ((A) green-orange-emitting luciferases when a red-emitting luciferase is 1; (B) green-red-emitting luciferases when an orange-emitting luciferase is 1; and (C) orange-red-emitting luciferases when a green-emitting luciferase is 1).

DISCLOSURE OF THE INVENTION

[0038] As a result of an intensive study for solving the above subjects, the present inventor has made a reporter gene construct capable of distinctively quantifying lights derived from 2 or more, preferably 3 or more and more preferably 4 or more luciferases (red-, orange-, green- and blue-emitting) based on the luciferases which emits different color lights (including red, orange, green and blue) or various luminescent substrates. According to the present invention, 2 or more, preferably 3 or more and more preferably 4 or more gene activities can be determined preferably simultaneously or at the same phase because an emitted light intensity derived from each luciferase corresponds to a transcription activity of each promoter, i.e., the activity of the gene to which each promoter is originally linked. It is also possible to precisely determined because a luminescence wavelength is not changed due to a determining condition (pH, etc). For example, in one preferable embodiment of the present invention, a system for determining the transcription activities of multiple genes simply and highly quantitatively was made by making reporter gene constructs of a red-emitting luciferase and a green-emitting luciferase from a railroad worm and a green-emitting luciferase and an orange-emitting luciferase from Rhagophthalmus ohba, and simultaneously using luciferase reporter genes of Renilla, a marine ostracod, a luminescent dinoflagellate, a click beetle, aequorin and the like.

[0039] Furthermore, the present inventor has found that the transcription can be easily performed in mammalian cells for a luciferase which is scarcely expressed or is not expressed at all in the mammalian cells by (1) altering a cDNA sequence such that no additional transcription factor is bound and (2) changing a codon usage (bias of codon use frequencies) for insects to the codon usage for mammals in the cDNA sequence and further reducing restriction enzyme sites in the cDNA sequence because the many restriction enzyme sites limit an application of the cDNA.

[0040] The present invention provides the following polypeptide, gene, gene construct, mammalian cell, a method for screening drugs and a system for multiply determining the transcription activities of the promoters using the mammalian cells.

[0041] 1. DNA encoding at least one luciferase selected from the group consisting a red-emitting luciferase and a green-emitting luciferase derived from a rail road worm and a green-emitting luciferase and an orange-emitting luciferase derived from Rhagophthalmus ohba stably expressed in mammalian cells, characterized in that (1) the DNA has no binding sequence for an additional transcription factor in the mammalian cells and has a codon usage for the mammal.

[0042] 2. The DNA according to the above 1, characterized in that the mammal is human and the DNA has at least one nucleotide sequence selected from the group consisting of SEQ ID NOS:7, 10, 11 and 16.

[0043] 3. A method for enabling the expression of DNA encoding a luciferase derived from a rail road worm or Rhagophthalmus ohba in mammalian cells, characterized by having

[0044] 1) a step of altering a cDNA sequence such that no additional transcription factor is bound;

[0045] 2) a step of changing a codon usage for insects to that for mammals in the cDNA sequence; and optionally

[0046] 3) a step of altering the cDNA sequence with many restriction enzyme sites due to limited application at the use.

[0047] 4. The method according to the above 3, characterized in that an amino acid sequence of the luciferase is not altered.

[0048] 5. A polypeptide which is a luciferase with a maximum luminescence wavelength of 630 nm, represented by any of the followings:

[0049] (1) a polypeptide having an amino acid sequence of SEQ ID NO:4; and

[0050] (2) a polypeptide having one or more amino acid substitutions, additions or deletions in the sequence of SEQ ID NO:4.

[0051] 6. The polypeptide according to the above 5, expressed in mammalian cells.

[0052] 7. A gene construct incorporating one or two or more genes of luciferases which emit light whose wavelength does not substantially depend on a determining condition and maximum luminescence wavelength is 535 to 635 nm, to be stably expressible in mammalian cells.

[0053] 8. The gene construct according to the above 7 incorporating 3 or more luciferase genes stably expressibly in mammalian cells by incorporating one or two or more genes of luciferases with a maximum luminescence wavelength of 460 to 520 nm together with one or two or more genes of luciferases which emit light whose wavelength does not substantially depend on a determining condition and maximum luminescence wavelength is 535 to 635 nm.

[0054] 9. The gene construct according to the above 7 wherein the above luciferase gene is a gene encoding at least one luciferase selected from the group consisting of a red-emitting luciferase and a green-emitting luciferase derived from a rail road worm and a green-emitting luciferase and an orange-emitting luciferase derived from Rhagophthalmus ohba stably expressed in mammalian cells.

[0055] 10. The gene construct according to the above 7 comprising an element for promoting efficiency of translation and/or an element for stabilizing mRNA.

[0056] 11. A gene construct capable of distinctively determining each light emitted from two or more luciferases, by incorporating one or two or more genes of the luciferases which emit light whose wavelength does not substantially depend on a determining condition and if necessary a gene of the luciferase which emits light whose wavelength is different and does not substantially depend on the determining condition under the control of different promoters.

[0057] 12. An expression vector containing the gene construct according to any of the above 7 to 11.

[0058] 13. Mammalian cells transformed with the gene construct according to any of the above 7 to 11 or the expression vector according to the above 12.

[0059] 14. Mammalian cells stably expressibly incorporating two or more genes of luciferases which emit mutually distinct light whose luminescence wavelength does not substantially depend on a determining condition under the control of different promoters in the mammalian cells.

[0060] 15. The mammalian cells according to the above 13 or 14 wherein two or more of the above luciferases have maximum luminescence wavelength of 535 to 635 nm and can emit with one substrate.

[0061] 16. The mammalian cells according to the above 15 comprising a red-emitting luciferase gene from a rail road worm and further comprising at least two or more selected from the group consisting of a green-emitting luciferase gene from the rail road worm, a green-emitting luciferase gene from Rhagophthalmus ohba, an orange-emitting luciferase from Rhagophthalmus ohba, and a blue-emitting luciferase gene under the control of different promoters.

[0062] 17. The mammalian cells according to the above 14 stably expressibly incorporating genes of three or more luciferases which emit mutually distinct light whose luminescence wavelength does not substantially depend on a determining condition under the control of different promoters in the mammalian cells.

[0063] 18. The mammalian cells according to the above 14 having three or more luciferase genes under the control of different promoters wherein a first luciferase gene is under the control of a constantly expressed promoter, a second luciferase gene is under the control of a toxicity assessing promoter, and remaining one or more luciferase genes are under the control of a promoter subjected to assessment.

[0064] 19. The mammalian cells according to the above 14 having three or more luciferase genes under the control of different promoters wherein a first luciferase gene is under the control of a constantly expressed promoter, a second luciferase gene is under the control of a pseudopromoter, and remaining one or more luciferase genes are under the control of a promoter subjected to assessment.

[0065] 20. The mammalian cells according to the above 14 having 4 or more luciferase genes under the control of different promoters, wherein a first luciferase gene is under the control of a constantly expressed promoter, a second luciferase gene is under the control of a toxicity assessing promoter, a third luciferase gene is under the control of a promoter of a protein which accepts an external factor, and remaining one or more luciferase genes are under the control of a promoter subjected to assessment.

[0066] 21. The mammalian cells according to the above 14 having 4 or more luciferase genes under the control of different promoters, wherein a first luciferase gene is under the control of a constantly expressed promoter, a second luciferase gene is under the control of a pseudopromoter, a third luciferase gene is under the control of a promoter of a protein which accepts an exogenous factor, and remaining one or more luciferase genes are under the control of a promoter subjected to assessment.

[0067] 22. The mammalian cells according to the above 14 having two luciferase genes under the control of different promoters, wherein a first luciferase gene is under the control of a constantly expressed promoter, and a second luciferase gene is under the control of a toxicity assessing promoter.

[0068] 23. The mammalian cells according to the above 14 having two luciferase genes under the control of different promoters, wherein a first luciferase gene is under the control of a constantly expressed promoter, and a second luciferase gene is under the control of a pseudopromoter.

[0069] 24. A method for screening drugs including a step of culturing the mammalian cells according to any of the above 18 to 21 in the presence of a drug candidate compound in a medium of the mammalian cells, a step of quantifying an amount of the above luciferase in the presence or absence of the candidate compound, and a step of assessing an effect of the candidate compound on a promoter subjected to assessment, which is linked to at least one luciferase.

[0070] 25. A system for multiply determining transcription activity of each promoter linked to each luciferase before and after a change of a culture environment by changing the culture environment of the mammalian cells according to any of the above 13 to 23, and assessing expressed amounts of two or more luciferases which emit mutually distinct light whose luminescence wavelength does not depend on a determining condition.

[0071] 26. The system according to the above 23 for simultaneously determining expressed amounts of two or more luciferases.

[0072] 27. The system according to the above 23 capable of determining expressed amounts of three or more luciferases.

[0073] The present invention will be illustrated in detail below.

[0074] Two or more luciferases in the present invention are required to emit light whose luminescence wavelength does not substantially depend on a determining condition (e.g., pH) because it is important to determine an emitted light intensity from two or more luciferases and calculate a relative ratio thereof.

[0075] As used herein, "the luminescence wavelength does not substantially depend on the determining condition" is that even if a pH, temperature, concentration or the like is changed, a variation of the maximum luminescence wavelength is 3 nm or less, preferably 2 nm or less, more preferably 1 nm or less and in particular, preferably 0.5 nm or less. If a changed amount of the maximum luminescence wavelength is within this range, when the expressed amounts of multiple luciferases are quantified by separating with a filter(s), it is preferable because a mutual ratio of the luciferases is scarcely changed.

[0076] As used herein, "two or more luciferases which emit mutually distinct light" means that it is possible to determine the ratio of emitted light intensities of the mutual lights using a filter (color filter, band pass filter, etc.). For example, for a red-emitting luciferase, a green-emitting luciferase from the rail road worm and an orange-emitting luciferase, a green-emitting luciferase from Rhagophthalmus ohba, it is possible to determine the ratio of emitted light intensities of mutual lights by using the filter to remove the green. To be capable of determining the ratio of emitted light intensities of the mutual lights, it is preferable to mutually separate the maximum luminescence wavelengths by usually 20 nm or more, preferably 30 nm or more, more preferably 40 nm or more and in particular, preferably 50 nm or more.

[0077] Preferable luciferases used in the invention include green-to-red-emitting (including mutants thereof, maximum luminescence wavelength: 535 to 635 nm, e.g., 540 to 630 nm) luciferases from the rail road worm, orange- to green-emitting (including mutants thereof, maximum luminescence wavelength: 530 to 600 nm) luciferases from the click beetle, and orange- to green-emitting (including mutants thereof, maximum luminescence wavelength: 550 to 590 nm) luciferases from Rhagophthalmus ohba, and the like. For example, in the case of the luciferases of the rail road worm, the red-emitting luciferase with a maximum luminescence wavelength of 622 nm and the green-emitting luciferase with a maximum luminescence wavelength of 545 nm have been known (US 2002/0119542), but the present inventor has identified that there exist many luciferases which emit lights with 540 to 635 nm in addition to these two. These luciferases can be all used. For example, the present inventor has confirmed that the red-emitting luciferase with a maximum luminescence wavelength of 622 nm (expressed in insects or Escherichia coli) from the rail road worm shifts the maximum luminescence wavelength to 630 nm when expressed in mammalian cells. This red-emitting luciferase with a maximum luminescence wavelength of 630 nm from the rail road worm was discovered for the first time by the present inventor.

[0078] When multiple luciferases are used, to distinctively determine each emitted light using the filter, it is desirable to mutually separate the maximum luminescence wavelength by 20 nm or more, preferably 30 nm or more, more preferably 40 nm or more and in particular, preferably 50 nm. By separating the maximum luminescence wavelength to this extent, the emitted light intensities of respective lights can be quantified simultaneously by using the filter between the maximum luminescence wavelengths, measuring a transmittance of each light before and after the filter, and converting.

[0079] For example, the maximum luminescence wavelengths of the luciferases in FIG. 20 are a red-emitting (630 nm), an orange (580 nm) and a green (550 nm), and these can be sufficiently separated.

[0080] In particular, when using the luciferases from the rail road worm and Rhagophthalmus ohba having the multiple luciferases whose maximum luminescence wavelengths are separated to some extent, it is possible to simultaneously quantify the emitted light intensities from the co-expressed multiple luciferases by the use of one luminescent substrate (e.g., a firefly luciferin can be used for the luciferases from the rail road worm, Rhagophthalmus ohba and the click beetle), and the ratio of the expressed amounts of promoters can be determined precisely. As the luciferase which emits the light whose luminescence wavelength does not depend on the determining condition (e.g., pH), it is possible to use Renilla luciferase, various luciferases of dinoflagellate (including a total sequence or luminescent domains such as Domains 1, 2 and 3; JP-2002-335961; Li L., Hong R., Hasting J W., Proc. Natl. Acad. Sci. USA (1997) 94, 8954), and marine ostracod luciferase by further combining. When the luciferases from the rail road worm, Rhagophthalmus ohba and the click beetle are used, the firefly luciferin can be used, and thus it is possible to reduce the background. The combination of the dinoflagellate luciferase with the luciferin is preferable because the background is low.

[0081] In one preferable embodiment of the present invention, it is possible to quantify the expressed amounts of at least three promoters with one luciferin by the use of the luciferases from the rail road worm, Rhagophthalmus ohba (e.g., the red-emitting luciferase from the rail road worm, the orange-emitting luciferase and the green-emitting luciferase from Rhagophthalmus ohba) (VR. Viviani, A. Uchida, N. Suenaga, M. Ryufuku & Y. Ohmiya: Thr-226 is a key-residue for bioluminescence spectra determination in beetle luciferases (2001) Biochem. Biophys. Res. Communi. 280, 1286-1291). It is also possible to quantify four or more by combining the blue-emitting luciferase (each luciferase of Renilla, the dinoflagellate or the marine ostracod). By successfully setting the filters, it is possible to analyze multiple expressions between 540 to 635 nm (green to red-emitting), and preferably between 540 to 630 nm. Further, one more can be added by a blue-emitting luciferase whose substrate is different. Therefore, as the simultaneous determination of the luciferases, it is possible to simultaneously quantify three or more when the same luciferin is used, and four or more when the different luciferins are used.

[0082] Conventionally, as the luciferases expressible in the mammalian cells, the Renilla luciferase and the firefly luciferase have been known. However, the color of the light emitted from the firefly luciferase varies from green to yellow depending on the pH of a cell lysed solution. Therefore, when the expressed amounts of two or more luciferases are compared, there has been a drawback that an accuracy is lacked. The blue luminescence derived from the Renilla luciferase is desirable in that its luminescence wavelength does not substantially depend on the determining condition, but in the determination system in which the firefly luciferase is combined, it is necessary to separately perform both the quantification using the firefly luciferin and the quantification using the Renilla luciferin. Thus, there has been a drawback that simplicity and accuracy are lacked.

[0083] The present inventor focused on the luciferase from the rail road worm as the luciferase other than Renilla luciferase and the firefly luciferase, and attempted to express this protein in the mammalian cells, but could not express the luciferase from the rail road worm in the mammalian cells using usual expression systems. This is believed to be a reason why no luciferase other than Renilla luciferase and the firefly luciferase has been expressed in the mammalian cells, particularly human cells.

[0084] According to findings until now of the present inventor, in one preferable embodiment of the invention, what really matters upon practical application of the rail road worm luciferase, the Rhagophthalmus ohba luciferase and the marine ostracod luciferase is that a rail road worm luciferase gene, the Rhagophthalmus ohba luciferase gene and the marine ostracod luciferase gene are stably transcribed and stably translated. In a technique used in Example of the present invention, it has been proven that the practical application becomes possible by stabilizing transcribed mRNA and increasing a number of translation frequency. That is, in this case, it has become possible for the first time that the luciferase gene from the rail road worm is expressed in the mammalian cells by inserting a globulin intron to prolong a lifespan of mRNA and inserting a Kozak sequence to increase the translation frequency.

[0085] Further techniques in the preferable other embodiments of the invention include, for example, changing the cDNA sequence from the codon usage (bias of codon use frequency) for insects to that for mammals for increasing copy numbers of mRNA, changing the cDNA sequence such that no additional transcription factor is bound, and changing the cDNA sequence with many restriction enzyme sites because the application of such a sequence is limited. Such techniques were useful for the expression of the luciferase from the rail road worm and the Rhagophthalmus ohba luciferase in the mammalian cells. In particular, the change to the codon usage (bias of codon use frequency) for the mammals and the change of cDNA sequence such that no additional transcription factor is bound are more useful.

[0086] The change of the cDNA sequence can be performed by considering the following order 1) to 4) sequentially:

[0087] 1) the amino acid sequence of the luciferase is not changed as possible (preferably not changed at all);

[0088] 2) subsequently, the cDNA sequence is changed such that no additional transcription factor is bound;

[0089] 3) further, the codon usage for the insects is changed to that for the mammals in the cDNA sequence; and

[0090] 4) if necessary, the cDNA sequence is changed to reduce the restriction enzyme sites.

[0091] In the above, the expression of the luciferase from the rail road worm and the Rhagophthalmus ohba luciferase was described, but the luciferases from other organisms such as a click beetle are believed to similarly express.

[0092] As used herein, the "luciferase" encompasses a light-emitting enzyme group such as luciferase which catalyzes a luciferin photochemical reaction, and also includes those such as aequorin. A protein having a luminescence action obtained by changing a luciferin structure, whose catalysis (action where the luciferin is oxidized to convert a light-emitting substance) is weak can be included in the luciferase of the present invention as long as its luminescence wavelength does not substantially depend on the determining condition (e.g., pH).

[0093] As the luciferases, it is desirable to combine two or more luciferases which emit the light with the same luminescent substrate. As preferable luciferases whose luminescence wavelength is not substantially changed by the determining condition and which emit the light with the same substrate, a red-emitting luciferase from the rail road worm and a green-emitting luciferase from the rail road worm or other luciferases from the rail road worm having the luminescence wavelength in the range of about 540 to 635 nm, preferably about 540 to 630 nm, further a green-emitting luciferase from Rhagophthalmus ohba and an orange-emitting luciferase from Rhagophthalmus ohba are preferably exemplified. In addition to them, the luciferases (about 530 to 600 nm) from the click beetle are also exemplified. In particular, the red-/green-emitting luciferases from the rail road worm and the orange-/green-emitting luciferases from Rhagophthalmus ohba are convenient for multiply quantify the transcription activities of promoters because emitted light intensities are almost the same when amounts of the luciferases are the same.

[0094] In the present invention, the mammals include human, cattle, horse, sheep, monkey, swine, mouse, rat, hamster, guinea pig, rabbit and dog, and is preferably the human.

[0095] It is preferable that at least two luciferase genes emit different color lights with the same substrate and their intracellular lifespan be similar. In this respect, the red-/green-emitting luciferases from the rail road worm and the orange-/green-emitting luciferases from Rhagophthalmus ohba are preferable. In particular, the red-emitting luciferases from the rail road worm and the orange-/green-emitting luciferases from Rhagophthalmus ohba are preferable.

[0096] Furthermore, for the quantification of each emitted light color by a simple apparatus, it is preferable to be capable of separate by a filter (s) different emitted light colors of at least one, preferably at least two luciferases whose luminescence wavelengths used in the invention are not changed by the determining condition (e.g., pH) and the other luciferase for standardizing the above luciferases. For example, as shown in FIG. 5, the red-/green-emitting luciferases from the rail road worm is preferable because they can be easily separated using the filter. Furthermore, the combination of the red-/green-emitting luciferases from the rail road worm with the luciferase (maximum luminescence wavelength: 474 to 480 nm) derived from Renilla or the-dinoflagellate is particularly preferable because the emitted lights can be easily separated using two filters as shown in FIG. 10. The lights emitted from the red-emitting luciferases from the rail road worm and the orange-/green-emitting luciferases from Rhagophthalmus ohba can be mutually separated using two filters (FIG. 19).

[0097] The luciferases from the rail road worm as in the above have been known to express in Escherichia coli, but no expression thereof in the mammalian cells, particularly human cells has been known. In fact, even when the expression of the luciferases (red-emitting, green-emitting) was attempted in the human cells, the expression could not be induced using an SV40 or CMV promoter alone which is a representative expression promoter in the mammalian cells as shown in FIG. 2 and Example 1. In the case of Rhagophthalmus ohba luciferases, an expression level is too low to apply practically in the sequence known publicity, but the mutants of the present invention have the expression levels of 44 times (green) and 57 times (orange) compared to wild-type luciferase, and have significant practicability. In the preferable embodiment of the invention, an expressed amount of the wild-type is insufficient because the expressed amount of the luciferase with particular color is evaluated in luminescence spectra using the filter(s).

[0098] Gene sequences of the luciferases (red-emitting, green-emitting) from the rail road worm are disclosed in US 2002/0119542-A1. A red-emitting luciferase gene (having an error) in US 2002/0119542-A1 is shown in SEQ ID NO:5. Correct nucleotide sequences of the luciferases from the rail road worm are shown in SEQ ID NO:1 (green-emitting luciferase gene) and SEQ ID NO:3 (red-emitting luciferase gene), and correct amino acid sequences are shown in SEQ ID NO:2 (green-emitting luciferase gene) and SEQ ID NO:4 (red-emitting luciferase gene).

[0099] As the luciferase gene of the present invention, intact wild-type or mutant luciferase genes can be used, and it is possible to use DNA capable of hybridizing with the luciferase gene under a stringent condition and DNA encoding a polypeptide having one or more amino acid substitutions, additions, deletions or insertions in the luciferase and having a luciferase activity as the luciferase gene.

[0100] In one preferable embodiment, the present inventor has found by examining various expression systems that it is important for stable expression of the luciferase in the mammalian cells to introduce an element for promoting efficiency of the translation and/or an element for stabilization of mRNA into a gene construct. As the element for promoting the efficiency of the translation, Kozak sequence (Ko) and the like are exemplified. As the element for the stabilization of mRNA, .beta.-globin intron II and the like are exemplified. To stably express the luciferase in the mammalian cells, in particular, a partial structure of (globin intron II)-(Kozak sequence)-(red-/green-emitting luciferase) is preferable. It has been also confirmed that it is preferable for stable expression of the luciferase in the mammalian cells to change the codon usage (bias of codon use frequency) for the insects to that for the mammals and change the cDNA sequence such that no additional transcription factor is bound.

[0101] In one preferable embodiment, the gene construct of the invention can contain a luciferase gene, a promoter, the element for promoting the efficiency of the translation and/or the element for the stabilization of mRNA upstream of the gene, and further can contain an enhancer, IRES, SV40 pA, a drug resistant gene (Neo.sup.r, etc.) and the like.

[0102] Examples of the preferable gene construct of the present invention will be shown below. [0103] (1) (CMV enhancer)-(chicken .beta.-action promoter)-(.beta.-globin intron II)-(Kozak sequence)-(-/green-emitting luciferase)-(SV40 poly A sequence) [0104] (2) (CMV enhancer)-(chicken .beta.-action promoter)-(.beta.-globin intron II)-(Kozak sequence)-(red-/green-emitting luciferase)-(IRES)-(Neo gene)-(SV40 poly A sequence)

[0105] The gene construct of the invention may be directly introduced into the mammalian cells, but it is preferable to incorporate in a vector (e.g., including a plasmid and a viral vector) to introduce into the mammalian cells. When multiple luciferases are incorporated expressibly in a gene construct, one gene construct or expression vector may be introduced into the mammalian cells, and when one luciferase is incorporated in one gene construct, multiple gene constructs or expression vectors may be simultaneously or sequentially introduced into the mammalian cells according to the standard method.

[0106] As combination of genes desirably determined simultaneously by the system of the present invention, [0107] clock genes (Per gene, Clock gene, BMAL gene, etc.) [0108] cancer genes (oncogene, tumor suppressing gene, mitosis marker gene, etc.) [0109] genes involved in diseases (pathology corresponding gene, life and death sensitive apoptosis gene, hormone gene, etc.) [0110] constantly expressed genes (actin gene, GAPDH (glyceraldehyde phosphate dehydrogenase) gene, monkey-derived SV40 virus gene, etc) and the like are exemplified.

[0111] The following application can be performed in the present invention. [0112] (1) Primary screening: It is important to simultaneously obtain 3 or more information on the assumption that many specimens are exhaustively analyzed. Obviously multiple combinations are thought. Considering drug discovery, it is necessary to evaluate not only positive points but also negative toxic points for effects of the drug. Furthermore, changes of two genes at a transcriptional level reflect a status of a cell itself, and thus, it is preferable to use a constantly expressed promoter which indicates the status of the cell as a control. Therefore, in the drug discovery screening, the following combinations are exemplified.

[0113] In tables 1 and 2, -/blue-/green-emitting luciferases are only exemplified, and it goes without saying that the other luciferases including the orange-emitting luciferase or the combinations thereof can be used. In particular, the combination of red-/orange-/green-emitting luciferases from the rail road worm and Rhagophthalmus ohba is particularly preferable because they can be simultaneously determined with the firefly luciferin.

[0114] The luciferases with various color can be optionally selected. TABLE-US-00001 TABLE 1 Drug discovery screening Subject promoter + green- Evaluation of drug emitting luciferase effect Toxicity evaluation Evaluation of drug promoter (apoptosis-related) + blue- safety emitting luciferase Constantly expressed promoter + red- Evaluation of cell emitting luciferase condition Green-/red-emitting: standardization of drug effect Blue-/red-emitting: standardization of safety

[0115] In this case, the toxicity evaluation and the constant expression are controls of the promoter subjected to the drug evaluation, and thus it is also useful to construct in one vector. A cell itself in which this vector has been incorporated is a basic cell for screening. TABLE-US-00002 TABLE 2 Search of target promoter sequence Unspecified promoter (sequence Evaluation of group whose effect is unknown on drug effect promoter library) + Green-emitting luciferase Pseudopromoter sequence (random Evaluation of sequence or nonsense sequence) + Blue- drug safety emitting luciferase Constantly expressed promoter + red- Evaluation of emitting luciferase cell condition Green-/-emitting: standardization of promoter effect Blue-/red-emitting: standardization of pseudo information

[0116] In this case, the pseudopromoter and the constantly expressed promoter are controls of the promoter subjected to the screening, and thus it is also useful (not essential) to construct in one vector. A cell itself in which this vector has been incorporated is a basic cell for screening.

[0117] The combination of -/orange-/green-emitting can accomplish the screenings represented in Tables 1 and 2 using one substrate. That is, the blue-emitting luciferase is substituted with the orange-emitting luciferase. In this case, the determination can be performed using one substrate, and the determining method is simpler. For determining the blue-emitting luciferase, it is necessary to lyse cells, but the firefly luciferin permeates into living cells with a concentration gradient and emits the light, and thus it is possible to determine three emitted lights in the living cells. Therefore, this method is characterized in that the screening can be performed without lysing the cells.

[0118] Meanwhile, the combination of red-/orange-/green-/blue-emitting has an advantage that an external factor such as environmental disruptors can be simultaneously evaluated, and can determine a change of transcription activities of multiple genes in the cell affected by the external factor. For example, monitoring of the expression of receptor which directly captures the external factor is included. TABLE-US-00003 TABLE 3 Unspecified promoter (sequence Evaluation of group whose effect is unknown on external factor promoter library) + Green-emitting effect luciferase Pseudopromoter sequence (random Evaluation of sequence or nonsense sequence) + Blue- external factor emitting luciferase safety Promoter sequence of accepting Evaluation of protein of external factor + Orange- accepting emitting luciferase process of external factor Constantly expressed promoter + red- Evaluation of emitting luciferase cell condition Green-/red-emitting: standardization of promoter effect, Blue-/red-emitting: standardization of pseudo information, Orange-/red-emitting: standardization of external factor acceptance, Green-/orange-emitting: evaluation of acceptance and activation

[0119] In this case, a protein which accepts the external factor, a protein affected thereby, and further the safety of the cell itself can be evaluated, and the information which the external factor gives to the cell can be precisely evaluated by standardizing them with the control of the protein of the constantly expressed promoter. Thus, it is also useful (not essential) to construct in one vector. A cell itself in which this vector has been incorporated is a basic cell for screening.

[0120] Examples of the primary screening are shown in FIG. 11.

[0121] (2) Secondary screening: It is important to obtain 3 or more information on the assumption that the focused drug effects and promoter signals are evaluated. In the drug discovery, multiple effects of the drug are often assumed. It is also important to know a gene which indicates the change of cell condition, transient effects of the drug (e.g., toxicity, shock response, etc.), and actual effects. For example, as shown in Tables 3 and 4, evaluation systems of clock-related drug effects can be exemplified. TABLE-US-00004 TABLE 3 Evaluation system of clock-related drug effects Drug detection promoter (e.g., Evaluation of toxicity, shock response, transient effect of etc.) + Green-emitting drug luciferase Diurnally varying promoter Evaluation of (sequence of BMAL or Per gene) + Blue- biological clock emitting luciferase Drug corresponding promoter + Red- Evaluation of emitting luciferase intracellular effects of drug Blue-/green-/red-emitting: temporal axis evaluation of drug

[0122] TABLE-US-00005 TABLE 4 Evaluation system of clock-related drug effects Drug detection promoter (e.g., Evaluation of toxicity, shock response, transient effect of etc.) + Green-emitting drug luciferase Diurnally varying promoter Evaluation of (sequence of BMAL or Per gene) + biological clock Orange-emitting luciferase Drug corresponding promoter + Red- Evaluation of emitting luciferase intracellular effects of drug orange-/green-/red-emitting: temporal axis evaluation of drug

[0123] In particular, as in the above, it is possible to determine three emitted lights in the living cells using one substrate. Therefore, the method is characterized in that the drug effect can be evaluated according to the temporal axis without lysing the cells.

[0124] A series of operations is performed for the same cells, and thus the drug effect on the combination (history) of the multiple operations can be evaluated.

[0125] An example of the secondary screening is shown in FIG. 12.

[0126] As in the above, by preferably simultaneously evaluating expressed amounts of 2 or more, particularly 3 or more or 4 or more promoters, when actions for one promoter are evaluated, it is possible to standardize an activity, toxicity and the like or standardize pseudo information.

[0127] Furthermore, when a phenomenon where the expressions of multiple genes are intricately related in the mammal is elucidated, the system of the present invention is extremely useful.

[0128] In the particularly preferable embodiment of the invention, the method/system for simultaneously quantifying three or four gene transcription activities using the red-emitting luciferase gene, the green-emitting luciferase gene from the rail road worm, the green-emitting luciferase gene, the orange-emitting luciferase gene from Rhagophthalmus ohba, and the blue-emitting luciferase gene is provided. By the use of this system, it is possible to simultaneously determine multiple transcription activities in the cells. It is possible to utilize them for the treatment/examination of pathology and the new drug development.

[0129] At that time, color identification is performed, and the multiple transcription activities in the cells can be simultaneously determined by determining the luminescence activity using the filters specified for the red-, green-, orange- and blue-emitting. Much information can be simultaneously elicited for the change in the cells, whose information has been conventionally difficult to obtain from change information of one transcription activity, and can be utilized for the treatment of various diseases and the new drug development.

[0130] In the present invention, the mammalian cells having two luciferase genes under the control of distinct promoters (1) wherein a first luciferase gene is under the control of the constantly expressed promoter and a second luciferase gene is under the control of the toxicity assessing promoter or (2) wherein the first luciferase gene is under the control of the constantly expressed promoter and the second luciferase gene is under the-pseudopromoter according to claim 14 are useful as intermediate cells for producing the mammalian cells for drug screening by further introducing the gene construct in which one or more luciferase genes are incorporated under the control of promoters subjected to the evaluation in these mammalian cells.

BEST MODE FOR CARRYING OUT THE INVENTION

[0131] The present invention will be illustrated in more detail with reference to the following Examples, but it goes without saying that the invention is not limited to the Examples.

EXAMPLE 1

[0132] A green-emitting luciferase gene and a red-emitting luciferase gene (SEQ ID NO:1, 3) from a rail road worm are expressed in Escherichia coli, but the expression thereof can not be induced in mammalian cells using an SV40 or CMV promoter alone which is a representative expression promoter in mammals. Thus, a construct in which Kozak sequence and .beta.-globin intron II which stabilize the gene expression were inserted, and further chicken .beta.-actin promoter and CMV enhancer were selected was ligated to the red- or green-emitting luciferase gene to make a gene structure, and an enzyme activity was determined. (FIG. 2). This was compared with a gene structure in which the luciferase gene had been inserted downstream of the SV40 promoter, CMV promoter or CAG promoter. Cultured fibroblast cells, NIH3T3 cells were transfected with each gene using Lipofectamine, and a luminescence activity after 24 hours in the cells was determined (FIG. 2). For determining the luminescence activity, a luminescent substrate mixed solution (supplied from Toyo B-Net Co., Ltd.) and AB-2000 were used as a substrate and as a luminescence determining apparatus supplied from ATTO Corporation, respectively. To 50 .mu.L of a cell extract solution, 50 .mu.L of PicaGene was added. As a result, the highest activity was obtained in the cells into which the (CMV enhancer)-(chicken .beta.-action promoter)-(.beta.-globin intron II)-(Kozak sequence)-(red-/green-emitting luciferase)-(SV40 poly A sequence) gene had been introduced. The secondarily highest activity was obtained in the cells into which the construct in which (IRES)-(Neo gene)-(SV40 poly A sequence) had been inserted in place of (SV40 poly A sequence) had been introduced. However, the SV40 promoter or the CMV promoter alone elicited almost no activity. But, the activity elicited by the (CMV enhancer)-(chicken .beta.-action promoter)-(.beta.-globin intron II)-(red-/green-emitting luciferase)-(IRES)-(Neo gene)-(SV40 poly A sequence) gene was about 500/1, and the activity elicited by the (CMV promoter)-(.beta.-globin intron II)-(Kozak sequence)-(red-/green-emitting luciferase)-(SV40 poly A sequence) gene was about 10/1 based on the activity elicited by the (CMV enhancer)-(chicken .beta.-action promoter)-(.beta.-globin intron II)-(Kozak sequence)-(red-/green-emitting luciferase)-(IRES)-(Neo gene)-(SV40 poly A sequence) gene. Therefore, it has demonstrated that it is preferable to insert (.beta.-globin intron II)-(Kozak sequence) upstream of the enzyme gene, which is a region which does not directly affect the transcription activity in order to stably express the green-emitting luciferase gene from the rail road worm and determine the gene transcription activity. This is believed to attribute to the promotion of translation efficiency due to the Kozak sequence and the stabilization of mRNA due to the .beta.-globin intron II. It has been demonstrated that the promotion of efficiency of and the stabilization of the transcript including the luciferase gene are keys for practical application.

EXAMPLE 2

[0133] Luminescence spectra of the red-emitting luciferase gene and the green-emitting luciferase gene from the rail road worm expressed in the mammalian cells were analyzed. To 15 .mu.L of an extract solution of cells into which the (CMV enhancer)-(chicken .beta.-action promoter)-(.beta.-globin intron II)-(Kozak sequence)-(red-/green-emitting luciferase)-(SV40 poly A sequence) genes which exhibited the highest activity had been introduced, 15 .mu.L of PicaGene was added, and the luminescence spectrum was determined using a weak luminescence spectrum measuring apparatus supplied from ATTO Corporation. FIG. 3 shows the luminescence spectra when the spectrum was expressed singly, the maximum luminescence wavelengths of 630 nm and 550 nm were observed in the red-emitting luciferase and the green-emitting luciferase, respectively. These spectra were not affected by pH and a surrounding solutions, and were not changed at all.

EXAMPLE 3

[0134] Lifespan in the cells of the red-emitting luciferase gene and the green-emitting luciferase gene from the rail road worm expressed in the mammalian cells was evaluated. The cells into which the (CMV enhancer)-(chicken .beta.-action promoter)-(.beta.-globin intron II)-(Kozak sequence)-(red-emitting, green-emitting luciferase)-(IRES)-(Neo gene)-(SV40 poly A sequence) genes had been introduced were used. Cultured fibroblast cells, NIH3T3 cells were transfected with the above luciferase gene to be expressed in the cells by a lipofection method. Forty-eight hours after the transfection, the medium was replaced with a medium containing 100 .mu.M of a protein synthesis inhibitor, cycloheximide, and the cells were cultured for 30 min. Subsequently, the luminescence activity was determined with time by the same method as that in Example 1. As a result, for both red and green-emitting luciferases, the activity was reduced in the similar time course, and a half life of each enzyme in the cells was about 3.5 hours (FIG. 4).

EXAMPLE 4

[0135] The red-emitting luciferase gene and the green-emitting luciferase gene from the rail road worm, the (CMV enhancer)-(chicken .beta.-action promoter)-(.beta.-globin intron II)-(Kozak sequence)-(red-/green-emitting luciferase)-(SV40 poly A sequence) genes were co-expressed in the cultured fibroblast cells NIH3T3. The luminescence spectrum of the red-emitting luciferase gene and the green-emitting luciferase gene from the rail road worm in a cell extract solution obtained by lysing the co-expressing cells was determined by the same technique as that in Example 2. FIG. 5 shows the luminescence spectrum of the co-expressing cells. Two peaks were observed because the red-emitting luciferase and the green-emitting luciferase emit lights. This is a result of simultaneously determining two gene transcription activities. When these luminescence activities is determined by a luminometer using a photomultiplier, a total sum of the luminescence activities of two red and green-emitting luciferase genes from the rail road is observed. Thus, to determine only the luminescence activity of the green-emitting luciferase, the light of the red-emitting luciferase was cut off. Evaluating from the luminescence spectrum, a cut off filter of light wavelengths represented by a dot line in FIG. 5 was selected. By the use of this filter, 8% of the green-emitting luciferase activity and 76% of red-emitting luciferase activity can be detected, and by converting it is possible to evaluate emitted light intensities from the red- and green-emitting luciferases and abundance thereof.

EXAMPLE 5

[0136] To 50 .mu.L of a cell extract solution containing the red-emitting luciferase and the green-emitting luciferase, 50 .mu.L of PicaGene was added, and the luminescence activity was measured with one min intervals using a dish type luminometer AB2500 supplied from ATTO Corporation to yield luminescence reaction curves as shown in FIG. 6. The activity was not stabilized within 5 min after the start of the reaction, but both activities were stabilized after 6 min. Thus, when the luminescence activity in the cells in which the red-emitting luciferase gene and the green-emitting luciferase gene had been co-expressed was measured, the activity was measured at a time zone at which the luminescence reaction was stable. A measuring procedure is as follows: 1) the emitted light intensity is measured without a filter (color filter R54 type supplied from Hoya Corporation) (luminescence activities of red- and green-emitting luciferases); 2) the filter (color filter R54 type supplied from Hoya Corporation) determined in Example 4 is inserted in the luminometer, the emitted light intensity is measured to make it the luminance activity of the green-emitting luciferase; and 3) the luminescence activity of the red-emitting luciferase is calculated by converting a transmittance of the filter (color filter R54 type supplied from Hoya Corporation).

EXAMPLE 6

[0137] It was examined in a model experiment whether the red-emitting luciferase and the green-emitting luciferase at different abundance ratio can be quantified by the procedure determined in Example 5. In FIG. 7, for samples in which the abundance ratio of the red-emitting luciferase and the green-emitting luciferase had been changed, 1) total intensities of emitted light were measured; 2) only the green-emitting luciferase was measured, and 3) the amounts of the red-emitting and green-emitting luciferases were quantified. As a result, it has been demonstrated that the luminescence activity is changed in a linear relationship with the abundance ratio thereof. This indicates that the amounts of the red-emitting luciferase and the green-emitting luciferase which have shown different expressed amounts in the cells can be quantified by the luminometer to which the color filter (color filter R54 type supplied from Hoya Corporation) was inserted.

EXAMPLE 7

[0138] To examine an availability of the present system, the gene transcription activities of two clock genes were measured, and standardized using simultaneously a promoter which exhibited the constant gene transcription activity as the third gene transcription activity. Specifically, the NIH3T3 cells were co-transfected with an (E54), an element linking an E-box 3, 4, 5 in mouse Per promoter-(chicken .beta.-action promoter)-(.beta.-globin intron II)-(Kozak sequence)-(red-emitting luciferase)-(SV40 poly A sequence) gene and an REV-ERV/ROR element 1,2 (RORE) in mouse BMAL1 promoter-(chicken .beta.-action promoter)-(.beta.-globin intron II)-(Kozak sequence)-(green-emitting luciferase)-(SV40 poly A sequence) gene, and a blue-emitting luciferase vector for the standardization (phRL-TK, Promega) together with human BMAL1, human CLOCK, and mouse ROR-4 expression vector. After 24 hours, the cells were lysed, and luciferase luminescence wavelengths in the cells were analyzed using a spectrometer. As a result, the luminescence wavelengths from these two luciferases were detected, and these showed the same luminescence spectrum as that when the individual luciferase alone was expressed. Thus, the luminescence activity of the red- and green-emitting luciferases was measured. The transcription activities obtained by further standardizing these activity values with the activity value of the blue-emitting luciferase are shown in FIG. 8. In separate experiments, it has been known that when BMAL1 and CLOCK proteins are expressed in the cells, the element (E54) promoter linking the E-box 3, 4, 5 is activated and an (ROR.alpha.) promoter is inactivated whereas when the mouse ROR-4 is expressed in the cells, the (RORA) promoter is highly activated. The activities of the red- and green-emitting luciferases simultaneously measured in the present experiment quantitatively show the transcription activity difference of (E54) promoter and (ROR.alpha.) promoter.

EXAMPLE 8

[0139] The red-emitting luciferase gene and the green-emitting luciferase gene from the rail road worm, (CMV enhancer)-(chicken .beta.-action promoter)-(.beta.-globin intron II)-(Kozak sequence)-(red-/green-emitting luciferase)-(SV40 poly A sequence) genes and the blue-emitting luciferase vector (phRL-TK, Promega) were co-expressed in the cultured fibroblast cells NIH3T3. The co-expressing cells were lysed, and the luminescence spectrum of the red-emitting luciferase and the green-emitting luciferase from the rail road worm and the blue-emitting luciferase from Renilla in a cell extract solution was measured by the same technique as that in Example 2. FIG. 9 shows the luminescence spectrum of the co-expressing cells. Three peaks emitted from the red-, green- and blue-emitting-luciferases were observed, and heights of the peak reflect heights of respective promoter activities. The transcription activities of three genes can be evaluated by converting to the intensity of emitted red, green or blue light using a an emitted light intensity determining apparatus with filters capable of identifying the emitted light colors.

EXAMPLE 9

[0140] The NIH3T3 cells were co-transfected with the red-emitting luciferase gene and the green-emitting luciferase gene from the rail road worm, (CMV enhancer)-(chicken .beta.-action promoter)-(.beta.-globin intron II)-(Kozak sequence)-(red-/green-emitting luciferase)-(SV40 poly A sequence) genes by lipofection. After culturing for 16 hours, the medium was replaced with a medium containing 100 nM dexamethasone, and the cells were cultured for 2 hours. Subsequently, the medium was replaced with a medium containing 100 pM firefly luciferin, and the luminescence activity of the red- and green-emitting luciferases was continuously measured using the dish type luminometer AB2500 supplied from ATTO Corporation. FIG. 10 shows the result of continuously measuring the transcription activity. If using a continuous emitted light intensity determining apparatus which identifies the emitted light colors, it is possible to continuously measure two transcription activities.

EXAMPLE 10

[0141] To stably express in the mammalian cells, the sequence of the red-emitting luciferase gene was designed with keeping the followings in mind. By (1) the changes of 34 transcription factor binding sites (48 DNA sequences) (Table 4); (2) the changes of 279 DNA sequences for making the codon use frequency close to the mammalian use frequency (Table 5); and (3) the changes of 15 common restriction enzyme sites (4 in 45 DNA sequences are the same as those of the transcription factor binding sites) (Table 6), the sequence of SEQ ID NO:7 was designed and a construct (SEQ ID NO:7) was artificially made. This sequence has 77.5% homology with the wild-type red-emitting luciferase gene (SEQ ID NO:3) from the rail road worm and 82.8% homology with the red-emitting luciferase mutant described in WO 2003/016839 (FIGS. 13 and 14). TABLE-US-00006 TABLE 4 Position Predicted transcription factor number Mutant sequence (Italic means a mutated part) Octamer-binding factor 1 89-103 (A99T) cagcaggactacaattatatcaatcattat ataaatattcttata tt actgacggaataatcgatgcccatacca Pit1, GHF-1 pituitary specific pou 91-101 (T96C) gcaggactacaattatatcaatcattatat aaatactcgta tattac domain transcription factor (A99G) tgacggaataatcgatgcccatac Myf5 myogenic bHLH protein 164-178 (C168A) caatgaagtaatatcatatgctcaaatatt tgaaacaagttgccgct (C171T) tggcagttagtctagaaaaatatggcttgg E2F, involved in cell cycle 186-200 (A195G) aatattgaaaccagctgccgcttggcagt tagtctagagaaata tgg regulation, interacts with Rb p107 cttggatcataacaatgttgtggcaat protein cellular and viral TATA box elements 268-284 (T276C) gaaaacaacatacacttttttggcccttta attgctgccctatacca (T277C) aggaataccaatggcaacatcaaatgatat Ikaros 3, potential regulator of 281-293 (A288G) Acttttttggccctttaattgctgctttat accaagggatacc aatg lymphocyte differentiation gcaacatcaaatgatatgtacacaga cellular and viral CCAAT box 332-342 (T336C) catcaaatgatatgtacacagaaagggaga tgatcggccat ttgaat atatcgaaaccatgccttatgttt Mammalian C-type LTR TATA box 414-440 (C426T) tttattctgaaagtacaaaaacatctagat tttctcaaaaaagtcat (T429C) agtcattgatagtatgtacgatatcaatgg TCF/LEF-1, involved in the Wnt 484-500 (C489T) atgtacgatatcaaggcgttgaatgcgta tttagttttgtttcacg signal transduction pathway ttatactgatcacgcctttgatccagtgaa X-box binding protein 1 491-505 (T501G) atatcaatggcgttgaatgcgtatttagct ttgtttcacggtata ct gatcacgcctttgatccagtgaaattta TCF/LEF-1, involvede in the Wnt 511-527 (C516G) gtatttagctttgtttcacgttatactgat cacgcgttcgatccagt signal transduction pathway (T519C) gaaatttaacccaaaagagtttgatccctt Hox-1.3, vertebrate homeobox 562-578 (A570G) tttaacccaaaagagtttgatcccttggaa agaaccgcgctaattat protein (T571C) gacatcatctggaacaactggattgcctaa COMP1, coperates with myogenic 593-613 (A600C) gaaccgcattaattatgacatcatctggaa caactggcctgcctaaag proteins in multicomponent complex (T601C) ggg tagtaataagccatagaagtataactataa Prostate-specific homeodomain 626-638 (A630G) ctggattgcctaaaggggtagtaataagcc ataggagtataac tata protein NKX3.1 agattcgtccatagcagtgatcccat POU factor Brn-2 (N-Oct 3) 817-833 (A822C) aagaaatttgagggcgaattcttcttaaaa accatccaaaattacaa aatcgcttctattgtagttcctcctccaat Pu.1 (Pul20) Ets-like transcription 844-860 agggcgaattcttcttaaaaaccatacaaa actacaaaatc gcttct factor identified in lymphoid attgtagttcctcctccaattatg B-cells Hox-1.3, vertebrate homeobox protein 880-896 (A888T) gttcctcctccaattatggtatatttggct aaaagtcctctagtcga (T889C) tgaatacaatttatcgagcttaacggaaat transcriptional repressor CDP 903-919 (T907C) tttggctaaaagtccattagtcgatgaata caatctgtcgagc ttaa (A909G) cggaaattgcttgtggagggtctcct complex of Lmo2 bound to Tal-1, E2A 951-963 (T957C) ggaaattgcttgtggagggtctcctttagg aagagacatcgca gata proteins, and GATA-1, half-site 2 aagtagcaaagagattgaaagtacat TCF/LEF-1, involved in the Wnt 967-983 (A975C) gggtctcctttaggaagagatatcgcagat aaagtagccaagagatt signal transduction pathway gaaagtacatggaatcctacaaggatatgg Prostate-specific homeodomain 1036-1048 (T1044G) ggatatggattaaccgaaacctgcagcgct ctaatactgagcc ccaa protein NKX3.1 tgatcgagaacttaaaaaaggtgcaa transcriptional repressor CDP 1049-1065 (T1053C) ccgaaacctgcagcgctctaatacttagcc ccaacgatagagaactt (C1057A) aaaaaaggtgcaattggaacgcctatgcca Ribonucleoprotein associated zinc 1066-1086 (A1071G) ctaatacttagccccaatgatcgagaactt aaaaagggtgcaattgga finger protein MOK-2 (human) acg cctatgccatatgttcaagttaaagttata Octamer-binding factor 1, 1158-1170 (A1161G) tgggaaggcgctaggaccaagagaaaaagg cgagatttgcttc aaaa POU-specific domain (A1164T) gtcaaatgcttatgaaaggatatcac Exotropic viral integration site 1 1182-1198 (A1191G) aaaaggcgaaatatgcgttcaaaagtcaaat gcttatgaagggctatc encoded factor (A1194C) acaacaaccgcaagcaactcgtgatgctc Nuclear factor Y (Y-box binding 1236-1250 (T1242G) tccgcaagcaactcgtgatgctcttgacaa agatgggtggcttca ta factor) ctggggatcttggatattacgacgaaga Prostate-specific homeodomain 1309-1321 (A1314G) gacagatttatctatgtagttgatcgattg aaagagcttatta aata protein NKX3.1 taaaggatatcaggttgcgcctgctg Special AT-rich sequence-binding 1314-1330 (T1317C) atttatctatgtagttgatcgattgaaaga actcatcaaatataaag protein 1, predominantly expressed (T1320C) gatatcaggttgcgcctgctgaactggaaa in thymocytes, binds to matrix attachment regions (MARs) Octamer-binding factor 1 1373-1387 (T1377C) cgcctgctgaactggaaaatctgcttttac aacacccaaatattt ct gatgcgggtgttattggaattccggacg POU factor Brn-2 (N-Oct 3) 1379-1395 (A1380T) ctgaactggaaaatctgcttttacaacatc ctaatatttctgatgcg ggtgttattggaattccggacgaatttgct Octamer-binding factor 1 1399-1413 (T1401C) ttacaacatccaaatatttctgatgcgggt gtcattggaattccg ga cgaatttgctggtcaattaccttccgcg Binding site for a Pbxl/Mesi1 1422-1438 (A1431G) tgcgggtgttattggaattccggacgaatt tgctggtcagttacctt heterodimer ccgcgtgtgttgtgttagagcctggtaaga GATA-binding factor 2 1548-1560 (A1551C) aactaaacatcttcgaggcggtgtcgtatt tatcgacagtatt ccaa (T1554C) aaggcccaacaggaaaactcatgaga Cart-1 (cartilage homeoprotein 1) 1624-1640 (T1636C) gaactccgtgcaatatttgcccgggaacag gcaaaatcaaaactata a

[0142] TABLE-US-00007 TABLE 5 RED RED- complete mutant Amino Acid Codon # % # % Met ATG 14 100.0 14 100.0 Trp TGG 1 100.0 1 100.0 Glu GAA 26 83.9 3 9.7 GAG 5 16.1 28 90.3 Phe TTT 19 76.0 7 28.0 TTC 6 24.0 18 72.0 Asp GAT 25 83.3 16 53.3 GAC 5 16.7 14 46.7 Cys TGT 3 33.3 5 55.6 TGC 6 66.7 4 44.4 His CAT 12 80.0 0 0.0 CAC 3 20.0 15 100.0 Gln CAA 12 80.0 0 0.0 CAG 3 20.0 15 100.0 Asn AAT 13 65.0 2 10.0 AAC 7 35.0 18 90.0 Tyr TAT 17 70.8 9 37.5 TAC 7 29.2 15 62.5 Lys AAA 32 82.1 6 15.4 AAG 7 17.9 33 84.6 Ile ATT 20 43.5 6 13.0 ATC 8 17.4 40 87.0 ATA 18 39.1 0 0.0 *** TAA 1 100.0 1 100.0 TAG 0 0.0 0 0.0 TGA 0 0.0 0 0.0 Thr ACT 11 37.9 0 0.0 ACC 7 24. 21 72.4 ACA 9 31.0 8 27.6 ACG 2 6.9 0 0.0 Pro CCT 11 35.5 15 48.4 CCC 3 9.7 4 12.9 CCA 14 45.2 11 35.5 CCG 3 9.7 1 3.2 Ala GCT 13 37.1 3 8.6 GCC 4 11.4 30 85.7 GCA 14 40.0 0 0.0 GCG 4 11.4 2 5.7 Gly GGT 7 17.5 0 0.0 GGC 9 22.5 34 85.0 GGA 20 50.0 4 10.0 GGG 4 10.0 2 5.0 Val GTT 14 36.8 0 0.0 GTC 6 15.8 5 13.2 GTA 13 34.2 0 0.0 GTG 5 13.2 33 86.8 Arg AGA 8 40.0 8 40.0 AGG 1 5.0 4 20.0 CGT 6 30.0 0 0.0 CGC 1 5.0 4 20.0 CGA 3 15.0 0 0.0 CGG 1 5.0 4 20.0 Ser AGT 8 25.0 2 6.3 AGC 7 21.9 13 40.6 TCT 4 12.5 4 12.5 TCC 1 3.1 13 40.6 TCA 10 31.3 0 0.0 TCG 2 6.3 0 0.0 Leu CTT 13 25.0 1 1.9 CTC 3 5.8 2 3.8 CTA 9 17.3 1 1.9 CTG 4 7.7 47 90.4 TTA 15 28.8 0 0.0 TTG 8 15.4 1 1.9

[0143] TABLE-US-00008 TABLE 6 Sequence Sequence Restriction enzyme site before change after change 35 BssSI Ctggtg Ctcgga 92 SsPI Aatatt Aatact 118 ClaI Atcgat Atcgac 146 NdeI Catatg Cctatg 155 SsPI Aatatt Gatttt 189 XbaI Tctaga Cctgga 282 EcoT14I Ccaagg Ccaggg 417 XbaI Tctaga Cctgga 460 EcoRV Gatatc Gacatc 524 ApoI Aaattt Aagttc 553 EcoT14I Ccttgg Ccctgg 570 PshBI Attaat Gctgat 769 AflIII Cttaag Ctgaag 790 ApoI Aaattt Aagttt 802 ApoI, EcoRI Gaattc Gagttc 955 EcoRV Gatatc Gacatc 1030 Aor51HI Agcgct Agcgcc 1075 MunI Caattg Ccatcg 1094 NdeI Catatg Cctatg 1117 EcoRV Gatatc Gacatc 1193 EcoRV Gatatc Gctacc 1217 BssSI Ctcgt Ccagg 1301 ClaI Atcgat Atcggc 1331 EcoRV Gatatc Gctacc 1381 SspI Aatatt Aacatc 1406 EcoRI, ApoI Gaattc Gcatcc 1410 AccIII Tccgga Cccaga 1417 ApoI Gaattt Gagttt 1605 SspI Aatatt Catctt 1613 SmaI Cccggg Cccgcg

EXAMPLE 11

[0144] Vectors in which a wild-type or mutant luciferase gene was inserted downstream of three kinds of promoters (CMV, SV40 or CAG {CAG: (CMV enhancer)-(chicken .beta.-action promoter)-(.beta.-globin intron II)-(Kozak sequence)} were made (wild-type: CMV-Red, CAG-Red, mutant: CMV-REDm, CAG-REDm). At that time, the vectors in which an SKL sequence known as a peroxisome transfer sequence at the C-terminus had been deleted were made (wild-type: SV40-Red(-SKL), mutant: SV40-REDm(-SKL), CAG-REDm).

[0145] The NIH3T3 cells were transfected with each gene using Lipofectamine, and the luminescence activity in the cells after 24 hours was measured (FIG. 15). A luminescent substrate mixed solution (Toyo B-Net Co., Ltd.) and AB2500 supplied from ATTO Corporation were used as the substrate and as a luminescence determining apparatus, respectively for the measurement of the luminescence activity. A sample was made by adding 50 .mu.L of PicaGene to 50 .mu.L of a cell extract solution. The sample containing CMV-Red or SV40-Red(-SKL) showed a value of around 1000 RLU whereas the sample containing CMV-REDm or SV40-REDm(-SKL) showed a value of 2.times.10.sup.7 to 4.times.10.sup.7 RLU. As shown in FIG. 15, the high activity was observed in the sample containing CAG-Red, but in the sample containing its mutant, the activity was increased by about two times. The SKL sequence was believed to be involved in activity increase, but the activity in the sample containing SKL was increased by only several %. From these results, it has been demonstrated that CAG and REDM are useful as reporter genes for analysis of the expression of mammalian genes. By the technique in Example 10, it is possible to stably express the luciferase from rail road worm in the mammalian cells. Therefore, by the similar procedure, the sequence of the green-emitting luciferase gene from rail road worm was modified (SEQ ID NO:16). In the modified sequence, 16 transcription factor binding sites were modified in the wild-type, and it has 76% homology with the wild type.

EXAMPLE 12

[0146] The luminescence spectrum of the red-emitting luciferase gene derived from the rail road worm, expressed in the mammalian cells was analyzed. To 15 .mu.L of an extract solution of the cells (NIH3T3 derived from a mouse, Rat-1 derived from a rat, A543 cells from human) transfected with the CMV-REDm gene whose activity was the highest, 15 .mu.L of PicaGene was added, and the luminescence spectrum was measured using a weak luminescence spectrum determining apparatus supplied from ATTO Corporation. As a reference, the luminescence spectrum in an extract solution of silk worm insect cells transfected with the gene described in SEQ ID NO:3 was also measured. FIG. 16 shows the luminescence spectra expressed in the mouse NIH3T3 cells (bold line) and silk worm insect cells (thin line). The maximum luminescence wavelength in the mouse NIH3T3 cells was 630 nm and that in the silk worm insect cells was around 622 nm. These spectra were not affected by pH and the surrounding solution, and were always displayed as the same spectra. The maximum luminescence wavelength in Rat-1 cells from the rat and A543 cells from the human was also 630 nm.

EXAMPLE 13

[0147] In order to stably express in the mammalian cells, in the sequences of wild-type Rhagophthalmus ohba green-emitting luciferase (the gene sequence and the amino acid sequence are shown in SEQ ID NOS:8 and 12, respectively.) and the wild-type Rhagophthalmus ohba orange-emitting luciferase (the gene sequence and the amino acid sequence are shown in SEQ ID NOS:9 and 13, respectively.), with keeping the followings in mind, constructs were artificially made.

[0148] 1) Changes of 15 transcription factor binding sites (20 DNA sequences) (Table 7)

[0149] 2) Changes of 322 DNA sequences for making the codon use frequency close to the mammalian codon usage (Table 8).

[0150] 3) Changes of 30 common restriction enzyme sites (2 in 49 DNA sequence are the same as those of the transcription factor binding sites) (Table 9).

[0151] In Tables 8 and 9, RoLWT represents the wild-type Rhagophthalmus ohba luciferase, and RoLm represents the mutant Rhagophthalmus ohba luciferase.

[0152] The gene sequence of the resulting mutant Rhagophthalmus ohba green-emitting luciferase gene and the amino acid sequence thereof are shown in SEQ ID NOS:10 and 14, respectively. The gene sequence of the resulting mutant Rhagophthalmus ohba orange-emitting luciferase gene and the amino acid sequence thereof are shown in SEQ ID NOS:11 and 15, respectively.

[0153] The homology between the mutant Rhagophthalmus ohba green-emitting luciferase gene sequence (SEQ ID NO:10) and the wild-type Rhagophthalmus ohba green-emitting luciferase gene sequence (SEQ ID NO:8) is 76.0% (FIG. 17) TABLE-US-00009 TABLE 7 Mutant Predicted transcription factor number Mutant sequence (Italic means a mutated part) Activator protein 4 64-80 (C69T) cccagggaccccctggacctgggcaccgcc ggcattcagctctacag (G75C) agccctgaccaacttctccttcctgaggga RAR-related orphan receptor alpha2 81-97 (A81G) cctgggcaccgccggcatccagctgtacag ggccctgaccaacttct ccttcctgagggaggccctgatcgacgccc Nuclear factor 1 169-187 (C183T) gtggtgtcttacgccgacatcctggagaac agctgtagactggctaag t gctacgagaactacggcctgcgccagaaca Progesterone receptor binding site 237-255 (C243T) gcgccagaacagcgtgatctccgtgtgcag cgagaatagcaccatctt c ttctaccccgtgatcgccgccctgtacatg Tumor suppressor p53 458-478 (C462T) tcaagaaggtggtgctgctggacagcaagg aggatatgggcgaggccc (5' half site) agt gcctgagcaacttcatggcccggtactccg Tumor suppressor p53 563-583 (G573T) tcaagccaagggacttcgacgccaaggagc aggtggcccttattatgt (5' half site) (C576T) cct cctctggcaccaccggcctgccaaagggcg Zinc finger transcription factor 850-864 (C858T) atcgagaagtacagaatcccaacaatcgtg ctggcccctcctgtg at ZBP-89 (C861T) ggtgttcctggccaagagccccctggtg Nuclear factor 1 865-883 (C879T) atcccaacaatcgtgctggccccccccgtg atggtgttcctggctaag a gccccctggtggaccagtacgacctgtcca Member of b-zip family, induced by 950-964 (G960T) gagaggtggccaccggcggcgcccctgtgg gcaccgaggttgccg tg ER damage/stress, binds to the ERSE gccgtggccaagcggctgaagatcggcg in association with NF-Y X-box-binding protein 1 1252-1266 (C1263A) gccatcgacaaggagggctggctgcactcc ggcgacgtgggatac ta cgacgacgatggccacttcttcgtggtg H6 homeodomain HMX3/Nkx5.1 1278-1290 (C1281A) ctccggcgacgtgggctactacgacgacga tggacatttcttc gtgg transcription factor (C1284T) tggaccggctgaaggagctgatcaag Ribonucleoprotein associated zinc 1302-1322 (G1308A) cgacgatggccacttcttcgtggtggaccg gctgaaagagctgatcaa finger protein MOK-2 (mouse) gta caagggctaccaggtggcccccgccgagct Winged helix protein, involved in 1385-1395 (C1389T) Agtggctgctgctccagcacccatccatca aggatgccggc gtgacc hair keratinization and thymus ggcgtgcccgacgaggccgccggc epithelium differentiation NF-kappaB (p50) (1502-1516) (G1560A) ccgagcaggagatcatcgactacatcgccg agcgagtgtctccca cc (C1512T) aagcgcatccggggcggcgtcgtcttcg Winged helix protein, involved in 1531-1541 (C1536A) gagcgggtgtcccccaccaagcgcatccgg ggcggagtcgt cttcgt hair keratinization and thymus ggacgacatccccaagggcgccac epithelium differentiation

[0154] TABLE-US-00010 TABLE 8 RoL WT RoLm Amino Acid Codon # % # % Met ATG 10 1.84 10 1.84 Trp TGG 2 0.37 2 0.37 Glu GAA 31 5.7 1 0.18 GAG 5 0.92 35 6.43 Phe TTT 11 2.02 0 0 TTC 13 2.39 24 4.41 Asp GAT 15 2.76 3 0.55 GAC 12 2.21 24 4.41 Cys TGT 5 0.92 1 0.18 TGC 5 0.92 9 1.65 His CAT 8 1.47 1 0.18 CAC 2 0.37 9 1.65 Gln CAA 9 1.65 0 0 CAG 4 0.74 13 2.39 Asn AAT 11 2.02 1 0.18 AAC 7 1.29 17 3.12 Tyr TAT 11 2.02 0 0 TAC 8 1.47 19 3.49 Lys AAA 28 5.15 1 0.18 AAG 12 2.21 39 7.17 Ile ATT 19 3.49 2 0.37 ATC 10 1.84 34 6.25 ATA 7 1.29 0 0 *** TAA 1 0.18 1 0.18 TAG 0 0 0 0 TGA 0 0 0 0 Thr ACT 9 1.65 0 0 ACC 13 2.39 30 5.51 ACA 5 0.92 2 0.37 ACG 5 0.92 0 0 Pro CCT 6 1.1 4 0.74 CCC 8 1.47 16 2.94 CCA 7 1.29 4 0.74 CCG 4 0.74 0 0 Ala GCT 14 2.57 4 0.74 GCC 10 1.84 35 6.43 GCA 8 1.47 0 0 GCG 6 1.1 0 0 Gly GGT 6 1.1 0 0 GGC 7 1.29 34 6.25 GGA 18 3.31 5 0.92 GGG 8 1.47 0 0 Val GTT 14 2.57 1 0.18 GTC 10 1.84 3 0.55 GTA 17 3.12 1 0.18 GTG 6 1.1 42 7.72 Arg AGA 8 1.47 9 1.65 AGG 4 0.74 7 1.29 CGT 3 0.55 0 0 CGC 4 0.74 3 0.55 CGA 6 0.92 1 0.18 CGG 2 0.37 6 1.1 Ser AGT 6 1.1 0 0 AGC 8 1.47 14 2.57 TCT 7 1.29 3 0.55 TCC 3 0.55 17 3.12 TCA 3 0.55 0 0 TCG 7 1.29 0 0 Leu TTA 19 3.49 0 0 TTG 16 2.94 0 0 CTT 12 2.21 1 0.18 CTC 1 0.18 4 0.74 CTA 3 0.55 0 0 CTG 6 1.1 52 9.56

[0155] TABLE-US-00011 TABLE 9 Restriciton enzyme site RoLWT ROLm 35 AvaI CTCGAG CCAGGG 35 XhoI CTCGAG CCAGGG 59 PstI CTGCAG CCGCCG 65 ApoI GAATTC GCATTC 65 EcoRI GAATTC GCATTC 70 MunI CAATTG CAGCTC 90 ApoI GAATTT CAACTT 438 ScaI AGTACT GGTGCT 528 ApoI AAATTT AAACTT 532 DraI TTTAAA TTCAAG 618 HincII GTTAAC GCTGAC 618 HpaI GTTAAC GCTGAC 630 ApoI AAATTT GAACCT 660 BamHI GGATCC GGACCC 744 Psp1406I AACGTT AACCCT 793 BspT104I TTCGAA TTCGAG 810 Af1II CTTAAG CCTGAG 833 ApoI GAATTC GAATCC 833 EcoRI GAATTC GAATCC 931 AgeI ACCGGT ACCGGC 1038 PshBI ATTAAT GCTGAT 1050 BspHI TCATGA CCACGA 1113 BglII AGATCT GGACCT 1165 DraI TTTAAA TTCAAG 1225 ClaI TTTAAA TTCAAG 1273 PshAI GACGATGGTC GACGATGGAC 1296 PvuI CGATCG GGACCG 1302 DraI TTTAAA GCTGAA 1328 EcoRV GATATC GCTACC 1523 Bst1107I GTATAC GCATCC

EXAMPLE 14

[0156] Vectors in which the wild-type or mutant luciferase gene (orange- or green-emitting from Rhagophthalmus ohba) was inserted downstream of three kinds of the promoters SV40 were made (wild-type: SV40-RoL (Green) and SV40-RoL (orange), mutant: SV40-RoL (Green)m and SV40-RoL (Orange)m). The cultured fibroblast cells, NIH3T3 cells were transfected with each gene using Lipofectamine Plus, and the luminescence activity in the cells after 24 hours was measured. A luminescent substrate mixed solution (supplied from Toyo B-Net Co., Ltd.) and LB9506 supplied from Berthold were used as a substrate and as a luminescence determining apparatus, respectively. A sample was made by adding 50 .mu.L of PicaGene to 50 .mu.L of a cell extract solution. As a result, the samples containing the wild type SV40-RoL (Green) and SV40-RoL (orange) exhibited values of about 1.times.10.sup.6 and 4.times.10.sup.5 RLU, respectively whereas the samples containing mutant SV40-RoL (Green)m and SV40-RoL (Orange)m exhibited values of 5.times.10.sup.8 and 8.times.10.sup.7 RLU, respectively. Comparing the wild type with the mutant, when the value of the wild-type is made 1, the activity values were increased by about 44 times and about 57 times in the mutant green and orange luciferases, respectively. These results demonstrate that the mutant is useful as the reporter gene for the analysis of the mammalian gene expression.

EXAMPLE 15

[0157] An outline of a method for simultaneously determining the transcription activities of three genes in the mammalian cells using one substrate is shown in FIG. 19. Three gene vectors in which the promoter sequence has been inserted upstream of the red-emitting luciferase gene from the rail road worm, the green-emitting luciferase gene from Rhagophthalmus ohba and the orange-emitting luciferase gene from Rhagophthalmus ohba are co-expressed in the cultured cells. The co-expressing cells after a certain time course after the treatment of the cells are lysed. Subsequently, three transcription activities are measured by separating the luminescence activities of red-emitting luciferase from the rail road worm, the green-emitting luciferase from Rhagophthalmus ohba and the orange-emitting luciferase from Rhagophthalmus ohba in the cell extract solution using the color filters. Thus, 15 .mu.L of PicaGene was added to 15 .mu.L of the extract solution of the cells in which the red-emitting luciferase gene from the rail road worm, the green-emitting luciferase gene from Rhagophthalmus ohba and the orange-emitting luciferase gene from Rhagophthalmus ohba were independently expressed. Then the luminescence spectra were measured using the weak luminescence spectrum determining apparatus supplied from ATTO Corporation (FIG. 20). As a result of examining the luminescence spectra, it has been confirmed that color split is possible by selecting the color filter O-54 type supplied from Hoya Co., Ltd. for splitting the green and orange lights and selecting the color filter R-60 type supplied from Hoya Co., Ltd. for splitting the orange and red lights. The measuring procedure is as follows. (1) The emitted light intensity is measured without use of the filter (luminescence activities of the red, orange and green-emitting luciferases). (2) The color filter O-54 type is inserted in a luminometer and the emitted light intensity is measured to yield the luminescent activity of the green-emitting luciferase. (3) The color filter R-60 type is inserted in the luminometer and the emitted light intensity is measured to yield the luminescent activity of the green and orange luminescence activity. (4) The luminescence activity of the red is calculated by converting the transmittance of the filters. Further, the activities of three color luciferases are corrected. This way, it is possible to evaluate the emitted lights intensities and the abundance of the red-, green- and orange-emitting luciferases.

EXAMPLE 16

[0158] It has been examined in the model experiment whether two enzymes with different compositions in the red-, orange- and green-emitting luciferases whose abundance ratios are different can be quantified by the procedure determined in Example 15. In FIG. 21 for the red- and green-emitting luciferases (A), the green- and orange-emitting luciferases (B), and the orange- and red-emitting luciferases (C), the luminescence activities in samples with different abundance ratios were obtained by (1) measuring all emitted light intensities, (2) using the set filter and converting. As a result, it has been demonstrated that the luminescence activity is changed in a linear relationship with the abundance ratio. This suggests that the different amounts of the red-, orange- and green-emitting luciferases expressed in the mammalian cells can be quantified by the luminometer in which the filter has been inserted.

EXAMPLE 17

[0159] It has been examined in the model experiment whether two enzymes with different compositions can be quantified by making the amount of one light-emitting enzyme constant in the red-, orange- and green-emitting luciferases whose abundance ratios are different by the procedure determined in Example 15. In FIG. 22, for the orange- and green-emitting luciferases by making the red-emitting luciferase constant (A), for the green- and red-emitting luciferases by making the orange-emitting luciferase constant (B), and for the orange- and red-emitting luciferases by making the green-emitting luciferase constant (C), the luminescence activities in samples with different abundance ratios were obtained by (1) measuring all emitted light intensities, (2) using the set filter and converting. As a result, it has been demonstrated that the luminescence activity is changed in a linear relationship with the abundance ratio. This suggests that the different amounts of the red-, orange- and green-emitting luciferases expressed in the mammalian cells can be quantified by the luminometer in which the filter has been inserted. Therefore, it has been demonstrated that it is possible to quantify the three luciferases by one substrate, and that the amounts of transcription activities of three genes can be measured.

Sequence CWU 0

0

SEQUENCE LISTING <160> NUMBER OF SEQ ID NOS: 65 <210> SEQ ID NO 1 <211> LENGTH: 1638 <212> TYPE: DNA <213> ORGANISM: Wild Type Phrixothrix Green Luciferase <400> SEQUENCE: 1 atggaagaag aaaacattag gcatggagag cgtcctcgtg atatagtcca tcctggctcg 60 gcaggacaac aattatacca atcattgtat aaatttgcat cttttcctga agcaataatc 120 gatgctcata caaatgaagt aatatcatat gctcaaatat ttgaaaccag ctgccgctta 180 gctgttagta tagaacaata tggcttgaat gaaaacaatg ttgtgggtgt atgcagtgaa 240 aacaatataa acttttttaa tcctgtcctt gctgctttat acttaggaat accagtagca 300 acatcaaatg atatgtacac agatggagag ttaactggtc atttgaatat atcaaaacca 360 actatcatgt ttagttcaaa gaaagcactc ccgcttattc tgagagtaca gcaaaatcta 420 agtttcatta aaaaagtcgt agttatcgat agcatgtacg acattaatgg cgttgaatgc 480 gtatctacct ttgttgcacg ttatactgac cacacctttg atccattgtc atttacacca 540 aaagattttg atccccttga aaaaatcgca ttaattatgt catcatctgg aacaactgga 600 ttgcctaagg gtgtagtact gagccataga agtctaacta taagattcgt tcatagcagg 660 gatcccattt atggcactcg tacggttcca caaacatcaa ttctttcctt agtaccgttc 720 catcatgcct ttggaatgtt tactacatta tcttactttg tagtaggact taaggttgta 780 atgttgaaga aatttgaggg cgcacttttc ttaaaaacca tacagaatta caaaatcccc 840 actattgtag tggcccctcc agttatggtg tttttggcta aaagcccatt agtcgatcaa 900 tacgatttat cgagcttaac ggaagttgct actggaggag ctcctttagg aaaagatgtc 960 gcagaagcag tagcaaagag gttgaaatta cctggaatca tacaaggata tggattaact 1020 gaaacttgct gcgctgtaat gattacccct cataatgctg tgaaaacagg ttcaactgga 1080 agacccttgc catacattaa agctaaagtt ttagataacg ctactgggaa ggcgctagga 1140 ccaggagaaa gaggcgaaat atgctttaaa agtgaaatga ttatgaaagg atattacaac 1200 aatccggaag caactattga tactattgac aaagatggtt ggcttcattc tggagatatt 1260 ggatattacg acgaagatgg aaatttcttt atagttgatc gattgaaaga acttattaaa 1320 tacaagggat atcaggttgc gcctgctgaa ctggaaaatc tgcttttaca acatccaagt 1380 attgctgatg cgggtgttac tggagttccg gacgaatttg ctggacaatt acctgctgct 1440 tgtgttgtgt tagaatctgg caagacgctg actgaaaagg aagttcaaga ttttattgca 1500 gcacaagtca ctccaacaaa gcatcttcga ggcggtgtcg tatttgtaga cagtattccg 1560 aaaggcccta ctggaaaact catcagaaag gagctccgag aaatatttgc ccagcgagca 1620 ccaaaatcaa aattataa 1638 <210> SEQ ID NO 2 <211> LENGTH: 545 <212> TYPE: PRT <213> ORGANISM: Wild Type Phrixothrix Green Luciferase <400> SEQUENCE: 2 Met Glu Glu Glu Asn Ile Arg His Gly Glu Arg Pro Arg Asp Ile Val 1 5 10 15 His Pro Gly Ser Ala Gly Gln Gln Leu Tyr Gln Ser Leu Tyr Lys Phe 20 25 30 Ala Ser Phe Pro Glu Ala Ile Ile Asp Ala His Thr Asn Glu Val Ile 35 40 45 Ser Tyr Ala Gln Ile Phe Glu Thr Ser Cys Arg Leu Ala Val Ser Ile 50 55 60 Glu Gln Tyr Gly Leu Asn Glu Asn Asn Val Val Gly Val Cys Ser Glu 65 70 75 80 Asn Asn Ile Asn Phe Phe Asn Pro Val Leu Ala Ala Leu Tyr Leu Gly 85 90 95 Ile Pro Val Ala Thr Ser Asn Asp Met Tyr Thr Asp Gly Glu Leu Thr 100 105 110 Gly His Leu Asn Ile Ser Lys Pro Thr Ile Met Phe Ser Ser Lys Lys 115 120 125 Ala Leu Pro Leu Ile Leu Arg Val Gln Gln Asn Leu Ser Phe Ile Lys 130 135 140 Lys Val Val Val Ile Asp Ser Met Tyr Asp Ile Asn Gly Val Glu Cys 145 150 155 160 Val Ser Thr Phe Val Ala Arg Tyr Thr Asp His Thr Phe Asp Pro Leu 165 170 175 Ser Phe Thr Pro Lys Asp Phe Asp Pro Leu Glu Lys Ile Ala Leu Ile 180 185 190 Met Ser Ser Ser Gly Thr Thr Gly Leu Pro Lys Gly Val Val Leu Ser 195 200 205 His Arg Ser Leu Thr Ile Arg Phe Val His Ser Arg Asp Pro Ile Tyr 210 215 220 Gly Thr Arg Thr Val Pro Gln Thr Ser Ile Leu Ser Leu Val Pro Phe 225 230 235 240 His His Ala Phe Gly Met Phe Thr Thr Leu Ser Tyr Phe Val Val Gly 245 250 255 Leu Lys Val Val Met Leu Lys Lys Phe Glu Gly Ala Leu Phe Leu Lys 260 265 270 Thr Ile Gln Asn Tyr Lys Ile Pro Thr Ile Val Val Ala Pro Pro Val 275 280 285 Met Val Phe Leu Ala Lys Ser Pro Leu Val Asp Gln Tyr Asp Leu Ser 290 295 300 Ser Leu Thr Glu Val Ala Thr Gly Gly Ala Pro Leu Gly Lys Asp Val 305 310 315 320 Ala Glu Ala Val Ala Lys Arg Leu Lys Leu Pro Gly Ile Ile Gln Gly 325 330 335 Tyr Gly Leu Thr Glu Thr Cys Cys Ala Val Met Ile Thr Pro His Asn 340 345 350 Ala Val Lys Thr Gly Ser Thr Gly Arg Pro Leu Pro Tyr Ile Lys Ala 355 360 365 Lys Val Leu Asp Asn Ala Thr Gly Lys Ala Leu Gly Pro Gly Glu Arg 370 375 380 Gly Glu Ile Cys Phe Lys Ser Glu Met Ile Met Lys Gly Tyr Tyr Asn 385 390 395 400 Asn Pro Glu Ala Thr Ile Asp Thr Ile Asp Lys Asp Gly Trp Leu His 405 410 415 Ser Gly Asp Ile Gly Tyr Tyr Asp Glu Asp Gly Asn Phe Phe Ile Val 420 425 430 Asp Arg Leu Lys Glu Leu Ile Lys Tyr Lys Gly Tyr Gln Val Ala Pro 435 440 445 Ala Glu Leu Glu Asn Leu Leu Leu Gln His Pro Ser Ile Ala Asp Ala 450 455 460 Gly Val Thr Gly Val Pro Asp Glu Phe Ala Gly Gln Leu Pro Ala Ala 465 470 475 480 Cys Val Val Leu Glu Ser Gly Lys Thr Leu Thr Glu Lys Glu Val Gln 485 490 495 Asp Phe Ile Ala Ala Gln Val Thr Pro Thr Lys His Leu Arg Gly Gly 500 505 510 Val Val Phe Val Asp Ser Ile Pro Lys Gly Pro Thr Gly Lys Leu Ile 515 520 525 Arg Lys Glu Leu Arg Glu Ile Phe Ala Gln Arg Ala Pro Lys Ser Lys 530 535 540 Leu 545 <210> SEQ ID NO 3 <211> LENGTH: 1641 <212> TYPE: DNA <213> ORGANISM: Wild Type Phrixothrix Red Luciferase <400> SEQUENCE: 3 atggaagaag aaaacattgt gaatggagat cgtcctcgtg atctagtttt tcctggcaca 60 gcaggactac aattatatca atcattatat aaatattcat atattactga cggaataatc 120 gatgcccata ccaatgaagt aatatcatat gctcaaatat ttgaaaccag ctgccgcttg 180 gcagttagtc tagaaaaata tggcttggat cataacaatg ttgtggcaat atgcagtgaa 240 aacaacatac acttttttgg ccctttaatt gctgctttat accaaggaat accaatggca 300 acatcaaatg atatgtacac agaaagggag atgattggcc atttgaatat atcgaaacca 360 tgccttatgt tttgttcaaa gaaatcactc ccatttattc tgaaagtaca aaaacatcta 420 gatttcctta aaaaagtcat agtcattgat agtatgtacg atatcaatgg cgttgaatgc 480 gtatttagct ttgtttcacg ttatactgat cacgcctttg atccagtgaa atttaaccca 540 aaagagtttg atcccttgga aagaaccgca ttaattatga catcatctgg aacaactgga 600 ttgcctaaag gggtagtaat aagccataga agtataacta taagattcgt ccatagcagt 660 gatcccatct atggtactcg tattgctcca gatacatcaa ttcttgctat agcaccgttc 720 catcatgcct ttggactgtt tactgcacta gcttactttc cagtaggact taagattgta 780 atggtgaaga aatttgaggg cgaattcttc ttaaaaacca tacaaaatta caaaatcgct 840 tctattgtag ttcctcctcc aattatggta tatttggcta aaagtccatt agtcgatgaa 900 tacaatttat cgagcttaac ggaaattgct tgtggagggt ctcctttagg aagagatatc 960 gcagataaag tagcaaagag attgaaagta catggaatcc tacaaggata tggattaacc 1020 gaaacctgca gcgctctaat acttagcccc aatgatcgag aacttaaaaa aggtgcaatt 1080 ggaacgccta tgccatatgt tcaagttaaa gttatagata tcaatactgg gaaggcgcta 1140 ggaccaagag aaaaaggcga aatatgcttc aaaagtcaaa tgcttatgaa aggatatcac 1200 aacaatccgc aagcaactcg tgatgctctt gacaaagatg gttggcttca tactggggat 1260 cttggatatt acgacgaaga cagatttatc tatgtagttg atcgattgaa agaacttatt 1320 aaatataaag gatatcaggt tgcgcctgct gaactggaaa atctgctttt acaacatcca 1380 aatatttctg atgcgggtgt tattggaatt ccggacgaat ttgctggtca attaccttcc 1440 gcgtgtgttg tgttagagcc tggtaagaca atgaccgaaa aggaagttca ggattatatt 1500 gcagagctag tcactacaac taaacatctt cgaggcggtg tcgtatttat agatagtatt 1560 ccaaaaggcc caacaggaaa actcatgaga aacgaactcc gtgcaatatt tgcccgggaa 1620 caggcaaaat caaaattata a 1641 <210> SEQ ID NO 4

<211> LENGTH: 546 <212> TYPE: PRT <213> ORGANISM: Wild Type Phrixothrix Red Luciferase <400> SEQUENCE: 4 Met Glu Glu Glu Asn Ile Val Asn Gly Asp Arg Pro Arg Asp Leu Val 1 5 10 15 Phe Pro Gly Thr Ala Gly Leu Gln Leu Tyr Gln Ser Leu Tyr Lys Tyr 20 25 30 Ser Tyr Ile Thr Asp Gly Ile Ile Asp Ala His Thr Asn Glu Val Ile 35 40 45 Ser Tyr Ala Gln Ile Phe Glu Thr Ser Cys Arg Leu Ala Val Ser Leu 50 55 60 Glu Lys Tyr Gly Leu Asp His Asn Asn Val Val Ala Ile Cys Ser Glu 65 70 75 80 Asn Asn Ile His Phe Phe Gly Pro Leu Ile Ala Ala Leu Tyr Gln Gly 85 90 95 Ile Pro Met Ala Thr Ser Asn Asp Met Tyr Thr Glu Arg Glu Met Ile 100 105 110 Gly His Leu Asn Ile Ser Lys Pro Cys Leu Met Phe Cys Ser Lys Lys 115 120 125 Ser Leu Pro Phe Ile Leu Lys Val Gln Lys His Leu Asp Phe Leu Lys 130 135 140 Lys Val Ile Val Ile Asp Ser Met Tyr Asp Ile Asn Gly Val Glu Cys 145 150 155 160 Val Phe Ser Phe Val Ser Arg Tyr Thr Asp His Ala Phe Asp Pro Val 165 170 175 Lys Phe Asn Pro Lys Glu Phe Asp Pro Leu Glu Arg Thr Ala Leu Ile 180 185 190 Met Thr Ser Ser Gly Thr Thr Gly Leu Pro Lys Gly Val Val Ile Ser 195 200 205 His Arg Ser Ile Thr Ile Arg Phe Val His Ser Ser Asp Pro Ile Tyr 210 215 220 Gly Thr Arg Ile Ala Pro Asp Thr Ser Ile Leu Ala Ile Ala Pro Phe 225 230 235 240 His His Ala Phe Gly Leu Phe Thr Ala Leu Ala Tyr Phe Pro Val Gly 245 250 255 Leu Lys Ile Val Met Val Lys Lys Phe Glu Gly Glu Phe Phe Leu Lys 260 265 270 Thr Ile Gln Asn Tyr Lys Ile Ala Ser Ile Val Val Pro Pro Pro Ile 275 280 285 Met Val Tyr Leu Ala Lys Ser Pro Leu Val Asp Glu Tyr Asn Leu Ser 290 295 300 Ser Leu Thr Glu Ile Ala Cys Gly Gly Ser Pro Leu Gly Arg Asp Ile 305 310 315 320 Ala Asp Lys Val Ala Lys Arg Leu Lys Val His Gly Ile Leu Gln Gly 325 330 335 Tyr Gly Leu Thr Glu Thr Cys Ser Ala Leu Ile Leu Ser Pro Asn Asp 340 345 350 Arg Glu Leu Lys Lys Gly Ala Ile Gly Thr Pro Met Pro Tyr Val Gln 355 360 365 Val Lys Val Ile Asp Ile Asn Thr Gly Lys Ala Leu Gly Pro Arg Glu 370 375 380 Lys Gly Glu Ile Cys Phe Lys Ser Gln Met Leu Met Lys Gly Tyr His 385 390 395 400 Asn Asn Pro Gln Ala Thr Arg Asp Ala Leu Asp Lys Asp Gly Trp Leu 405 410 415 His Thr Gly Asp Leu Gly Tyr Tyr Asp Glu Asp Arg Phe Ile Tyr Val 420 425 430 Val Asp Arg Leu Lys Glu Leu Ile Lys Tyr Lys Gly Tyr Gln Val Ala 435 440 445 Pro Ala Glu Leu Glu Asn Leu Leu Leu Gln His Pro Asn Ile Ser Asp 450 455 460 Ala Gly Val Ile Gly Ile Pro Asp Glu Phe Ala Gly Gln Leu Pro Ser 465 470 475 480 Ala Cys Val Val Leu Glu Pro Gly Lys Thr Met Thr Glu Lys Glu Val 485 490 495 Gln Asp Tyr Ile Ala Glu Leu Val Thr Thr Thr Lys His Leu Arg Gly 500 505 510 Gly Val Val Phe Ile Asp Ser Ile Pro Lys Gly Pro Thr Gly Lys Leu 515 520 525 Met Arg Asn Glu Leu Arg Ala Ile Phe Ala Arg Glu Gln Ala Lys Ser 530 535 540 Lys Leu 545 <210> SEQ ID NO 5 <211> LENGTH: 1760 <212> TYPE: DNA <213> ORGANISM: Phrixothrix Red Luciferase of US2002-0119542-A1 <400> SEQUENCE: 5 gtgacagttt agttcagtag aagatttttt tgagatcaaa atggaagaag aaaacgttgt 60 gaatggagat cgtcctcgtg atctagtttt tcctggcaca gcaggactac aattatatca 120 atcattatat aaatattcat atattactga cggaataatc gatgcccata ccaatgaagt 180 aatatcatat gctcaaatat ttgaaaccag ctgccgcttg gcagttagtc tagaaaaata 240 tggcttggat cataacaatg ttgtggcaat atgcagtgaa aacaacatac acttttttgg 300 ccctttaatt gctgctttat accaaggaat accaatggca acatcaaatg atatgtacac 360 agaaagggag atgattggcc atttgaatat atcgaaacca tgccttatgt tttgttcaaa 420 gaaatcactc ccatttattc tgaaagtaca aaaacatcta gatttcctta aaagagtcat 480 agtcattgat agtatgtacg atatcaatgg cgttgaatgc gtatttagct ttgattcacg 540 taatactgat cacgcctttg atccagtgaa atttaaccca aaagagtttg atcccttgga 600 aagaaccgca ttaattatga catcatctgg aacaactgga ttgcctaaag gggtagtaat 660 aagccataga agtataacta taagattcgt ccatagcagt gatcccatct atggtactcg 720 tattgctcca gatacatcaa ttcttgctat agcaccgttc catcatgcct ttggactgtt 780 tactgcacta gcttactttc cagtaggact taagattgta atggtgaaga aatttgaggg 840 cgaattcttc ttaaaaacca tacaaaatta caaaatcgct tctattgtag ttcctcctcc 900 aattatggta tatttggcta aaagtccatt agtcgatgaa tacaattgct cgagcttaac 960 ggaaattgct agtggaggct ctcctttagg aagagatatc gcagataaag tagcaaagag 1020 attgaaagta catggaatcc tacaaggata tggattaacc gaaacctgca gcgctctaat 1080 acttagcccc aatgatcgag aacttaaaaa aggtgcaatt ggaacgccta tgccatatgt 1140 tcaagttaaa gttatagata tcaatactgg gaaggcgcta ggaccaagag aaaaaggcga 1200 aatatgcttc aaaagtcaaa tgcttatgaa aggatatcac aacaatccgc aagcaactcg 1260 tgatgctctt gacaaagatg gttggcttca tactggggat cttggatatt acgacgaaga 1320 cagatttatc tatgtagttg atcgattgaa agaacttatt aaatataaag gatatcaggt 1380 tgcgcctgct gaactggaaa atctgctttt acaacatcca aatatttctg atgcgggtgt 1440 tattgaattc cggacgaatt tgctggtcaa ttacctttcc gcgtgtgttg tgttagagcc 1500 tggtaagaca atgaccgaaa aggaagttca ggattatatt gcagagctag tcactacaac 1560 taaacatctt cgaggcggtg tcgtatttat agatagtatt ccaaaaggcc caacaggaaa 1620 actcatgaga aacgaactcc gagcaatatt tgcccgggaa caggcaaaat caaaattata 1680 agctcaatat attgctttag ttataaaatg tatgtaatca aattttagaa cctaatacat 1740 tcattgagag cctaaaaaaa 1760 <210> SEQ ID NO 6 <211> LENGTH: 1641 <212> TYPE: DNA <213> ORGANISM: Phrixothrix Red Luciferase of WO2003/016839 <400> SEQUENCE: 6 atggaagaag aaaacgtggt gaatggagat cggcctaggg atctggtgtt tcccggcaca 60 gcaggactcc agctgtacca gtcactgtat aagtattcat acatcactga cgggataatc 120 gacgcccata ccaacgaggt catctcatat gctcagatct ttgaaacctc ctgccggctg 180 gcagtgtcac tggagaagta tggcctggat cacaacaatg tggtggccat ctgttctgaa 240 aacaacatac actttttcgg ccccctgatt gctgccctgt accaaggcat cccaatggca 300 acatcaaacg acatgtacac agagagggag atgataggcc atctgaacat ctccaagcca 360 tgcctgatgt tctgttcaaa gaaatcactg cccttcattc tgaaggtgca gaagcacctg 420 gactttctga aaaaagtcat agtcattgat tccatgtacg atatcaatgg cgtggagtgc 480 gtcttctcct ttgtctcgag gtacactgat cacgccttcg acccagtgaa gttcaacccc 540 aaagagttcg accccctcga aagaaccgcc ctgattatga catcatctgg gacaactgga 600 ctgcctaagg gggtcgtgat ctcccacaga tctataacta tcagattcgt ccattcttcc 660 gatcccatct acggcaccag gattgcccca gacacatcaa ttctggctat cgcacccttc 720 catcacgcct ttggactgtt tactgcactg gcttacttcc ctgtcggact gaagattgtc 780 atggtgaaga aatttgaggg cgagttcttt ctgaaaacca tacaaaatta caagatcgct 840 tctattgtcg tgcctcctcc tattatggtc tatctggcta agtcccccct ggtcgatgaa 900 tacaatttat cttctctgac cgaaatcgca tgcggaggct ctcctctggg gagagacatc 960 gcagataaag tcgccaagag actgaaagtg catggaatcc tccagggata tgggctgacc 1020 gagacctgtt ccgctctgat actgtctccc aacgatcggg aactgaaaaa gggggcaatc 1080 ggaaccccta tgccatacgt gcaagtgaaa gtgatcgaca tcaataccgg gaaggccctg 1140 ggaccaagag agaaaggcga gatctgcttc aagtctcaga tgctgatgaa ggggtatcac 1200 aacaatcctc aggccactag ggatgctctg gacaaggatg ggtggctgca cactggggac 1260 ctgggatatt acgacgaaga cagatttatc tatgtcgtgg acaggctgaa agagctgatc 1320 aagtataaag ggtatcaggt cgcccctgct gagttggaaa acctgctgtt gcagcacccc 1380 aatatctctg atgccggcgt gattggaatt ccggacgaat ttgctggtca attaccttcc 1440 gcctgtgtgg tgctggagcc tggcaagaca atgaccgaga aagaagtgca ggactacatt 1500 gcagagctgg tcactacaac taaacatctg aggggggggg tcgtctttat agattccatt 1560 ccaaagggcc caacagggaa actgatgaga aacgaactga gggcaatctt tgctcgggaa 1620 caggcaaaaa tcgctgtgta a 1641 <210> SEQ ID NO 7 <211> LENGTH: 1641 <212> TYPE: DNA <213> ORGANISM: Mutant Phrixothrix Red Luciferase of the Invention <400> SEQUENCE: 7

atggaagaag agaacatcgt gaatggcgat cgccctcggg atctggtgtt ccctggcaca 60 gccggcctgc agctgtatca gtccctgtat aaatactctt acatcaccga cggaatcatc 120 gacgcccaca ccaacgaggt gatctcctat gcccagattt tcgaaacaag ttgccgcctg 180 gccgtgagcc tggagaagta tggcctggat cacaacaacg tggtggccat ttgcagcgag 240 aacaacatcc acttcttcgg ccctctgatc gctgccctat accaggggat tccaatggcc 300 acatccaacg atatgtacac cgagagggag atgatcggcc acctgaacat ctccaagcca 360 tgtctgatgt tctgttccaa gaagtccctg ccattcatcc tgaaggtgca gaagcacctg 420 gactttctca agaaggtgat cgtgatcgac agcatgtacg acatcaacgg cgtggagtgc 480 gtgttcagtt tcgtgtcccg gtacaccgat cacgcgttcg atccagtgaa gttcaaccct 540 aaagagtttg atcccctgga gagaaccgcg ctgatcatga catcctctgg aacaaccggc 600 ctgcctaagg gcgtggtgat cagccacagg agcatcacca tcagattcgt ccacagcagc 660 gatcccatct acggcacccg catcgcccca gatacatcca tcctggccat cgcccctttc 720 caccacgcct tcggactgtt taccgccctg gcttactttc cagtgggcct gaagatcgtg 780 atggtgaaaa agtttgaggg cgagttcttc ctgaagacca tccagaacta caagatcgct 840 tctatcgtgg tgcctcctcc aatcatggtg tatctggcca agagccctct ggtggatgag 900 tacaatctgt ccagcctgac agagatcgcc tgtggcggct cccctctggg cagagacatc 960 gccgacaagg tggccaagag actgaaggtc cacggcatcc tgcagggcta tggcctgacc 1020 gagacctgta gcgccctgat cctgagcccc aacgatagag agctgaagaa gggcgccatc 1080 ggcaccccta tgccctatgt ccaggtgaag gtgattgaca tcaacaccgg caaagccctg 1140 ggaccaagag agaagggcga gatttgcttc aagagccaga tgctgatgaa gggctaccac 1200 aacaacccac aggccaccag ggatgccctg gacaaggacg ggtggctgca caccggcgat 1260 ctgggctact acgacgagga cagattcatc tatgtggtgg atcggctgaa agagctcatc 1320 aagtacaagg gctaccaggt ggcccctgcc gagctggaga acttgcttct gcagcaccct 1380 aacatctctg atgccggcgt catcggcatc ccagacgagt ttgccggcca gctgccttcc 1440 gcctgtgtcg tgctggagcc tggcaagacc atgaccgaga aggaggtgca ggattatatc 1500 gccgagctgg tgaccaccac caagcacctg cggggcggcg tggtgttcat cgacagcatt 1560 ccgaaaggcc caacaggcaa gctgatgaga aacgagctga gggccatctt tgcccgcgag 1620 caggccaagt ccaagctgta a 1641 <210> SEQ ID NO 8 <211> LENGTH: 1632 <212> TYPE: DNA <213> ORGANISM: Wild Type Rhagophthalmus ohbai Green Luciferase <400> SEQUENCE: 8 atgcctaatg aaatcatttt acatggggcc aaacctcgag acccgttaga cctgggaact 60 gcaggaattc aattgtatag ggctttgacg aatttttcct ttttaaggga agccttgatc 120 gacgctcaca ccgaggaagt agtatcttac gcggacattt tggaaaacag ctgtcgatta 180 gcaaaatgct acgaaaacta tggattacgc caaaacagcg tcatatcggt gtgcagcgaa 240 aacagcacga tcttcttcta ccccgtaatt gccgctttgt atatgggagt cataacagca 300 accgtaaatg atagttatac cgaacgggaa ttattggaaa ccttaaatat atcaaaaccg 360 gaattagtgt tctgctcgaa gaaagccatt aaaaatatga tggcattgaa aaggaacgtc 420 aattttatta aaaaggtagt acttttggat agtaaggaag acatgggcga agcccagtgt 480 cttagcaact ttatggcacg ctattcggaa cccaatttgg acgtaagaaa ttttaaacca 540 cgcgattttg atgctaaaga acaagtcgct ttgatcatgt cctcatcggg aacaaccggg 600 ctgcccaaag gggtcgtgtt aacccatcga aatttaagcg ttcgcttcgt acactgcaag 660 gatcccttat tcggcacaag aactattcca tcaacttcga ttttatctat cgttcccttc 720 catcatgcgt ttggaatgtt tacaacgttg tcttatttta tagtagggct tagagttgta 780 ttactgaaaa gattcgaaga gaagtttttc ttaagcacca ttgaaaagta cagaattcca 840 actatcgttc ttgcgccgcc cgtaatggta ttcctagcta agagcccctt agttgatcag 900 tacgatttgt ccagtattag agaagtcgct accggtggcg cacctgttgg aactgaagtg 960 gcagtggccg ttgcgaaacg gttgaaaatt ggcggaatcc ttcagggcta cggattgacc 1020 gaaacgtgtt gcgccgtatt aattacccct catgacgacg ttaaaacagg ttctaccggg 1080 agggtagctc cttacgtcca agcgaaaatt gtagatctta ccaccggaaa atctctgggg 1140 ccaaataaaa gaggagagct ttgttttaaa agtgagatca ttatgaaggg ctatttcaac 1200 aataaacaag ctacggaaga agccatcgat aaagaaggat ggttacattc tggagatgtt 1260 gggtattatg acgacgatgg tcatttcttc gtagtcgatc gtttaaagga acttatcaag 1320 tacaagggat atcaagtagc accggctgaa ctggagtggt tgcttttgca acatccatct 1380 attaaagatg ccggtgttac tggcgttccc gacgaagctg ctggagaact accaggtgct 1440 tgtatagttc tccaagaagg aaaaagtctt actgaacaag aaattattga ctatatagcc 1500 gaacgagttt cgccaactaa acgtatacgt ggtggagtgg tcttcgttga tgatattcct 1560 aaaggggcga ctggaaaact ggtcagaagt gaattacgaa aacttcttgc tcagaagaaa 1620 tcgaaactat aa 1632 <210> SEQ ID NO 9 <211> LENGTH: 1632 <212> TYPE: DNA <213> ORGANISM: Wild Type Rhagophthalmus ohbai Orange Luciferase <400> SEQUENCE: 9 atgcctaatg aaatcatttt acatggggcc aaacctcgag acccgttaga cctgggaact 60 gcaggaattc aattgtatag ggctttgacg aatttttcct ttttaaggga agccttgatc 120 gacgctcaca ccgaggaagt agtatcttac gcggacattt tggaaaacag ctgtcgatta 180 gcaaaatgct acgaaaacta tggattacgc caaaacagcg tcatatcggt gtgcagcgaa 240 aacagcacga tcttcttcta ccccgtaatt gccgctttgt atatgggagt cataacagca 300 accgtaaatg atagttatac cgaacgggaa ttattggaaa ccttaaatat atcaaaaccg 360 gaattagtgt tctgctcgaa gaaagccatt aaaaatatga tggcattgaa aaggaacgtc 420 aattttatta aaaaggtagt acttttggat agtaaggaag acatgggcga agcccagtgt 480 cttagcaact ttatggcacg ctattcggaa cccaatttgg acgtaagaaa ttttaaacca 540 cgcgattttg atgctaaaga acaagtcgct ttgatcatgt cctcatcggg aacaaccggg 600 ctgcccaaag gggtcgtgtt aacccatcga aatttaagcg ttcgcttcgt acactgcaag 660 gatcccttat tcggcaatag aactattcca tcaacttcga ttttatctat cgttcccttc 720 catcatgcgt ttggaatgtt tacaacgttg tcttatttta tagtagggct tagagttgta 780 ttactgaaaa gattcgaaga gaagtttttc ttaagcacca ttgaaaagta cagaattcca 840 actatcgttc ttgcgccgcc cgtaatggta ttcctagcta agagcccctt agttgatcag 900 tacgatttgt ccagtattag agaagtcgct accggtggcg cacctgttgg aactgaagtg 960 gcagtggccg ttgcgaaacg gttgaaaatt ggcggaatcc ttcagggcta cggattgacc 1020 gaaacgtgtt gcgccgtatt aattacccct catgacgacg ttaaaacagg ttctaccggg 1080 agggtagctc cttacgtcca agcgaaaatt gtagatctta ccaccggaaa atctctgggg 1140 ccaaataaaa gaggagagct ttgttttaaa agtgagatca ttatgaaggg ctatttcaac 1200 aataaacaag ctacggaaga agccatcgat aaagaaggat ggttacattc tggagatgtt 1260 gggtattatg acgacgatgg tcatttcttc gtagtcgatc gtttaaagga acttatcaag 1320 tacaagggat atcaagtagc accggctgaa ctggagtggt tgcttttgca acatccatct 1380 attaaagatg ccggtgttac tggcgttccc gacgaagctg ctggagaact accaggtgct 1440 tgtatagttc tccaagaagg aaaaagtctt actgaacaag aaattattga ctatatagcc 1500 gaacgagttt cgccaactaa acgtatacgt ggtggagtgg tcttcgttga tgatattcct 1560 aaaggggcga ctggaaaact ggtcagaagt gaattacgaa aacttcttgc tcagaagaaa 1620 tcgaaactat aa 1632 <210> SEQ ID NO 10 <211> LENGTH: 1632 <212> TYPE: DNA <213> ORGANISM: Mutant Rhagophthalmus ohbai Green Luciferase of the Invention <400> SEQUENCE: 10 atggctaacg agatcatcct gcacggcgcc aagcccaggg accccctgga cctgggcacc 60 gccggcattc agctctacag ggccctgacc aacttctcct tcctgaggga ggccctgatc 120 gacgcccaca ccgaggaggt ggtgtcttac gccgacatcc tggagaacag ctgtagactg 180 gctaagtgct acgagaacta cggcctgcgc cagaacagcg tgatctccgt gtgcagcgag 240 aatagcacca tcttcttcta ccccgtgatc gccgccctgt acatgggcgt gatcaccgcc 300 accgtgaacg acagctacac cgagcgggag ctgctggaga ccctgaacat ctccaagccc 360 gaactggtgt tctgctccaa gaaggccatc aagaacatga tggccctgaa gaggaacgtg 420 aacttcatca agaaggtggt gctgctggac agcaaggagg atatgggcga ggcccagtgc 480 ctgagcaact tcatggcccg gtactccgag cccaacctgg acgtgagaaa cttcaagcca 540 agggacttcg acgccaagga gcaggtggcc cttattatgt cctcctctgg caccaccggc 600 ctgccaaagg gcgtggtgct gacccacagg aacctgagcg tgcgcttcgt ccactgcaag 660 gaccccctgt tcggcaccag aaccatcccc tccacctcca tcctgtccat cgtgcccttc 720 caccacgcct tcggaatgtt cacaaccctg tcctacttca tcgtgggcct gagagtggtg 780 ctgctgaaga gattcgagga gaagttcttc ctgagcacca tcgagaagta cagaatccca 840 acaatcgtgc tggcccctcc tgtgatggtg ttcctggcta agagccccct ggtggaccag 900 tacgacctgt ccagcatcag agaggtggcc accggcggcg cccctgtggg caccgaggtt 960 gccgtggccg tggccaagcg gctgaagatc ggcggcatcc tccagggcta cggcctgacc 1020 gagacctgct gcgccgtgct gatcaccccc cacgacgacg tgaagaccgg ctccaccggc 1080 agggtagccc cctacgtgca ggctaagatc gtggacctga ccaccggcaa gtccctggga 1140 cctaacaaga gaggcgagct gtgcttcaag agcgagatca tcatgaaggg ctacttcaac 1200 aacaagcagg ccaccgagga ggccatcgac aaggagggct ggctgcactc cggcgacgtg 1260 ggatactacg acgacgatgg acatttcttc gtggtggacc ggctgaaaga gctgatcaag 1320 tacaagggct accaggtggc ccccgccgag ctggagtggc tgctgctcca gcacccatcc 1380 atcaaggatg ccggcgtgac cggcgtgccc gacgaggccg ccggcgagct gcccggcgcc 1440 tgcatcgtgc tccaggaggg caagagcctg accgagcagg agatcatcga ctacatcgcc 1500 gagcgagtgt ctcccaccaa gcgcatccgg ggcggagtcg tcttcgtgga cgacatcccc 1560 aagggcgcca ccggcaagct ggtgagaagc gagctgcgga agctgctggc ccagaagaag 1620 tccaagctgt aa 1632

<210> SEQ ID NO 11 <211> LENGTH: 1632 <212> TYPE: DNA <213> ORGANISM: Mutant Rhagophthalmus ohbai Orange Luciferase of the Invention <400> SEQUENCE: 11 atggctaacg agatcatcct gcacggcgcc aagcccaggg accccctgga cctgggcacc 60 gccggcattc agctctacag ggccctgacc aacttctcct tcctgaggga ggccctgatc 120 gacgcccaca ccgaggaggt ggtgtcttac gccgacatcc tggagaacag ctgtagactg 180 gctaagtgct acgagaacta cggcctgcgc cagaacagcg tgatctccgt gtgcagcgag 240 aatagcacca tcttcttcta ccccgtgatc gccgccctgt acatgggcgt gatcaccgcc 300 accgtgaacg acagctacac cgagcgggag ctgctggaga ccctgaacat ctccaagccc 360 gaactggtgt tctgctccaa gaaggccatc aagaacatga tggccctgaa gaggaacgtg 420 aacttcatca agaaggtggt gctgctggac agcaaggagg atatgggcga ggcccagtgc 480 ctgagcaact tcatggcccg gtactccgag cccaacctgg acgtgagaaa cttcaagcca 540 agggacttcg acgccaagga gcaggtggcc cttattatgt cctcctctgg caccaccggc 600 ctgccaaagg gcgtggtgct gacccacagg aacctgagcg tgcgcttcgt ccactgcaag 660 gaccccctgt tcggcaacag aaccatcccc tccacctcca tcctgtccat cgtgcccttc 720 caccacgcct tcggaatgtt cacaaccctg tcctacttca tcgtgggcct gagagtggtg 780 ctgctgaaga gattcgagga gaagttcttc ctgagcacca tcgagaagta cagaatccca 840 acaatcgtgc tggcccctcc tgtgatggtg ttcctggcta agagccccct ggtggaccag 900 tacgacctgt ccagcatcag agaggtggcc accggcggcg cccctgtggg caccgaggtt 960 gccgtggccg tggccaagcg gctgaagatc ggcggcatcc tccagggcta cggcctgacc 1020 gagacctgct gcgccgtgct gatcaccccc cacgacgacg tgaagaccgg ctccaccggc 1080 agggtagccc cctacgtgca ggctaagatc gtggacctga ccaccggcaa gtccctggga 1140 cctaacaaga gaggcgagct gtgcttcaag agcgagatca tcatgaaggg ctacttcaac 1200 aacaagcagg ccaccgagga ggccatcgac aaggagggct ggctgcactc cggcgacgtg 1260 ggatactacg acgacgatgg acatttcttc gtggtggacc ggctgaaaga gctgatcaag 1320 tacaagggct accaggtggc ccccgccgag ctggagtggc tgctgctcca gcacccatcc 1380 atcaaggatg ccggcgtgac cggcgtgccc gacgaggccg ccggcgagct gcccggcgcc 1440 tgcatcgtgc tccaggaggg caagagcctg accgagcagg agatcatcga ctacatcgcc 1500 gagcgagtgt ctcccaccaa gcgcatccgg ggcggagtcg tcttcgtgga cgacatcccc 1560 aagggcgcca ccggcaagct ggtgagaagc gagctgcgga agctgctggc ccagaagaag 1620 tccaagctgt aa 1632 <210> SEQ ID NO 12 <211> LENGTH: 543 <212> TYPE: PRT <213> ORGANISM: Wild Type Rhagophthalmus ohbai Green Luciferase <400> SEQUENCE: 12 Met Pro Asn Glu Ile Ile Leu His Gly Ala Lys Pro Arg Asp Pro Leu 1 5 10 15 Asp Leu Gly Thr Ala Gly Ile Gln Leu Tyr Arg Ala Leu Thr Asn Phe 20 25 30 Ser Phe Leu Arg Glu Ala Leu Ile Asp Ala His Thr Glu Glu Val Val 35 40 45 Ser Tyr Ala Asp Ile Leu Glu Asn Ser Cys Arg Leu Ala Lys Cys Tyr 50 55 60 Glu Asn Tyr Gly Leu Arg Gln Asn Ser Val Ile Ser Val Cys Ser Glu 65 70 75 80 Asn Ser Thr Ile Phe Phe Tyr Pro Val Ile Ala Ala Leu Tyr Met Gly 85 90 95 Val Ile Thr Ala Thr Val Asn Asp Ser Tyr Thr Glu Arg Glu Leu Leu 100 105 110 Glu Thr Leu Asn Ile Ser Lys Pro Glu Leu Val Phe Cys Ser Lys Lys 115 120 125 Ala Ile Lys Asn Met Met Ala Leu Lys Arg Asn Val Asn Phe Ile Lys 130 135 140 Lys Val Val Leu Leu Asp Ser Lys Glu Asp Met Gly Glu Ala Gln Cys 145 150 155 160 Leu Ser Asn Phe Met Ala Arg Tyr Ser Glu Pro Asn Leu Asp Val Arg 165 170 175 Asn Phe Lys Pro Arg Asp Phe Asp Ala Lys Glu Gln Val Ala Leu Ile 180 185 190 Met Ser Ser Ser Gly Thr Thr Gly Leu Pro Lys Gly Val Val Leu Thr 195 200 205 His Arg Asn Leu Ser Val Arg Phe Val His Cys Lys Asp Pro Leu Phe 210 215 220 Gly Thr Arg Thr Ile Pro Ser Thr Ser Ile Leu Ser Ile Val Pro Phe 225 230 235 240 His His Ala Phe Gly Met Phe Thr Thr Leu Ser Tyr Phe Ile Val Gly 245 250 255 Leu Arg Val Val Leu Leu Lys Arg Phe Glu Glu Lys Phe Phe Leu Ser 260 265 270 Thr Ile Glu Lys Tyr Arg Ile Pro Thr Ile Val Leu Ala Pro Pro Val 275 280 285 Met Val Phe Leu Ala Lys Ser Pro Leu Val Asp Gln Tyr Asp Leu Ser 290 295 300 Ser Ile Arg Glu Val Ala Thr Gly Gly Ala Pro Val Gly Thr Glu Val 305 310 315 320 Ala Val Ala Val Ala Lys Arg Leu Lys Ile Gly Gly Ile Leu Gln Gly 325 330 335 Tyr Gly Leu Thr Glu Thr Cys Cys Ala Val Leu Ile Thr Pro His Asp 340 345 350 Asp Val Lys Thr Gly Ser Thr Gly Arg Val Ala Pro Tyr Val Gln Ala 355 360 365 Lys Ile Val Asp Leu Thr Thr Gly Lys Ser Leu Gly Pro Asn Lys Arg 370 375 380 Gly Glu Leu Cys Phe Lys Ser Glu Ile Ile Met Lys Gly Tyr Phe Asn 385 390 395 400 Asn Lys Gln Ala Thr Glu Glu Ala Ile Asp Lys Glu Gly Trp Leu His 405 410 415 Ser Gly Asp Val Gly Tyr Tyr Asp Asp Asp Gly His Phe Phe Val Val 420 425 430 Asp Arg Leu Lys Glu Leu Ile Lys Tyr Lys Gly Tyr Gln Val Ala Pro 435 440 445 Ala Glu Leu Glu Trp Leu Leu Leu Gln His Pro Ser Ile Lys Asp Ala 450 455 460 Gly Val Thr Gly Val Pro Asp Glu Ala Ala Gly Glu Leu Pro Gly Ala 465 470 475 480 Cys Ile Val Leu Gln Glu Gly Lys Ser Leu Thr Glu Gln Glu Ile Ile 485 490 495 Asp Tyr Ile Ala Glu Arg Val Ser Pro Thr Lys Arg Ile Arg Gly Gly 500 505 510 Val Val Phe Val Asp Asp Ile Pro Lys Gly Ala Thr Gly Lys Leu Val 515 520 525 Arg Ser Glu Leu Arg Lys Leu Leu Ala Gln Lys Lys Ser Lys Leu 530 535 540 <210> SEQ ID NO 13 <211> LENGTH: 543 <212> TYPE: PRT <213> ORGANISM: Wild Type Rhagophthalmus ohbai Orange Luciferase <400> SEQUENCE: 13 Met Pro Asn Glu Ile Ile Leu His Gly Ala Lys Pro Arg Asp Pro Leu 1 5 10 15 Asp Leu Gly Thr Ala Gly Ile Gln Leu Tyr Arg Ala Leu Thr Asn Phe 20 25 30 Ser Phe Leu Arg Glu Ala Leu Ile Asp Ala His Thr Glu Glu Val Val 35 40 45 Ser Tyr Ala Asp Ile Leu Glu Asn Ser Cys Arg Leu Ala Lys Cys Tyr 50 55 60 Glu Asn Tyr Gly Leu Arg Gln Asn Ser Val Ile Ser Val Cys Ser Glu 65 70 75 80 Asn Ser Thr Ile Phe Phe Tyr Pro Val Ile Ala Ala Leu Tyr Met Gly 85 90 95 Val Ile Thr Ala Thr Val Asn Asp Ser Tyr Thr Glu Arg Glu Leu Leu 100 105 110 Glu Thr Leu Asn Ile Ser Lys Pro Glu Leu Val Phe Cys Ser Lys Lys 115 120 125 Ala Ile Lys Asn Met Met Ala Leu Lys Arg Asn Val Asn Phe Ile Lys 130 135 140 Lys Val Val Leu Leu Asp Ser Lys Glu Asp Met Gly Glu Ala Gln Cys 145 150 155 160 Leu Ser Asn Phe Met Ala Arg Tyr Ser Glu Pro Asn Leu Asp Val Arg 165 170 175 Asn Phe Lys Pro Arg Asp Phe Asp Ala Lys Glu Gln Val Ala Leu Ile 180 185 190 Met Ser Ser Ser Gly Thr Thr Gly Leu Pro Lys Gly Val Val Leu Thr 195 200 205 His Arg Asn Leu Ser Val Arg Phe Val His Cys Lys Asp Pro Leu Phe 210 215 220 Gly Asn Arg Thr Ile Pro Ser Thr Ser Ile Leu Ser Ile Val Pro Phe 225 230 235 240 His His Ala Phe Gly Met Phe Thr Thr Leu Ser Tyr Phe Ile Val Gly 245 250 255 Leu Arg Val Val Leu Leu Lys Arg Phe Glu Glu Lys Phe Phe Leu Ser 260 265 270 Thr Ile Glu Lys Tyr Arg Ile Pro Thr Ile Val Leu Ala Pro Pro Val 275 280 285 Met Val Phe Leu Ala Lys Ser Pro Leu Val Asp Gln Tyr Asp Leu Ser 290 295 300 Ser Ile Arg Glu Val Ala Thr Gly Gly Ala Pro Val Gly Thr Glu Val 305 310 315 320 Ala Val Ala Val Ala Lys Arg Leu Lys Ile Gly Gly Ile Leu Gln Gly 325 330 335 Tyr Gly Leu Thr Glu Thr Cys Cys Ala Val Leu Ile Thr Pro His Asp 340 345 350 Asp Val Lys Thr Gly Ser Thr Gly Arg Val Ala Pro Tyr Val Gln Ala 355 360 365

Lys Ile Val Asp Leu Thr Thr Gly Lys Ser Leu Gly Pro Asn Lys Arg 370 375 380 Gly Glu Leu Cys Phe Lys Ser Glu Ile Ile Met Lys Gly Tyr Phe Asn 385 390 395 400 Asn Lys Gln Ala Thr Glu Glu Ala Ile Asp Lys Glu Gly Trp Leu His 405 410 415 Ser Gly Asp Val Gly Tyr Tyr Asp Asp Asp Gly His Phe Phe Val Val 420 425 430 Asp Arg Leu Lys Glu Leu Ile Lys Tyr Lys Gly Tyr Gln Val Ala Pro 435 440 445 Ala Glu Leu Glu Trp Leu Leu Leu Gln His Pro Ser Ile Lys Asp Ala 450 455 460 Gly Val Thr Gly Val Pro Asp Glu Ala Ala Gly Glu Leu Pro Gly Ala 465 470 475 480 Cys Ile Val Leu Gln Glu Gly Lys Ser Leu Thr Glu Gln Glu Ile Ile 485 490 495 Asp Tyr Ile Ala Glu Arg Val Ser Pro Thr Lys Arg Ile Arg Gly Gly 500 505 510 Val Val Phe Val Asp Asp Ile Pro Lys Gly Ala Thr Gly Lys Leu Val 515 520 525 Arg Ser Glu Leu Arg Lys Leu Leu Ala Gln Lys Lys Ser Lys Leu 530 535 540 <210> SEQ ID NO 14 <211> LENGTH: 543 <212> TYPE: PRT <213> ORGANISM: Mutant Rhagophthalmus ohbai Green Luciferase of the Invention <400> SEQUENCE: 14 Met Ala Asn Glu Ile Ile Leu His Gly Ala Lys Pro Arg Asp Pro Leu 1 5 10 15 Asp Leu Gly Thr Ala Gly Ile Gln Leu Tyr Arg Ala Leu Thr Asn Phe 20 25 30 Ser Phe Leu Arg Glu Ala Leu Ile Asp Ala His Thr Glu Glu Val Val 35 40 45 Ser Tyr Ala Asp Ile Leu Glu Asn Ser Cys Arg Leu Ala Lys Cys Tyr 50 55 60 Glu Asn Tyr Gly Leu Arg Gln Asn Ser Val Ile Ser Val Cys Ser Glu 65 70 75 80 Asn Ser Thr Ile Phe Phe Tyr Pro Val Ile Ala Ala Leu Tyr Met Gly 85 90 95 Val Ile Thr Ala Thr Val Asn Asp Ser Tyr Thr Glu Arg Glu Leu Leu 100 105 110 Glu Thr Leu Asn Ile Ser Lys Pro Glu Leu Val Phe Cys Ser Lys Lys 115 120 125 Ala Ile Lys Asn Met Met Ala Leu Lys Arg Asn Val Asn Phe Ile Lys 130 135 140 Lys Val Val Leu Leu Asp Ser Lys Glu Asp Met Gly Glu Ala Gln Cys 145 150 155 160 Leu Ser Asn Phe Met Ala Arg Tyr Ser Glu Pro Asn Leu Asp Val Arg 165 170 175 Asn Phe Lys Pro Arg Asp Phe Asp Ala Lys Glu Gln Val Ala Leu Ile 180 185 190 Met Ser Ser Ser Gly Thr Thr Gly Leu Pro Lys Gly Val Val Leu Thr 195 200 205 His Arg Asn Leu Ser Val Arg Phe Val His Cys Lys Asp Pro Leu Phe 210 215 220 Gly Thr Arg Thr Ile Pro Ser Thr Ser Ile Leu Ser Ile Val Pro Phe 225 230 235 240 His His Ala Phe Gly Met Phe Thr Thr Leu Ser Tyr Phe Ile Val Gly 245 250 255 Leu Arg Val Val Leu Leu Lys Arg Phe Glu Glu Lys Phe Phe Leu Ser 260 265 270 Thr Ile Glu Lys Tyr Arg Ile Pro Thr Ile Val Leu Ala Pro Pro Val 275 280 285 Met Val Phe Leu Ala Lys Ser Pro Leu Val Asp Gln Tyr Asp Leu Ser 290 295 300 Ser Ile Arg Glu Val Ala Thr Gly Gly Ala Pro Val Gly Thr Glu Val 305 310 315 320 Ala Val Ala Val Ala Lys Arg Leu Lys Ile Gly Gly Ile Leu Gln Gly 325 330 335 Tyr Gly Leu Thr Glu Thr Cys Cys Ala Val Leu Ile Thr Pro His Asp 340 345 350 Asp Val Lys Thr Gly Ser Thr Gly Arg Val Ala Pro Tyr Val Gln Ala 355 360 365 Lys Ile Val Asp Leu Thr Thr Gly Lys Ser Leu Gly Pro Asn Lys Arg 370 375 380 Gly Glu Leu Cys Phe Lys Ser Glu Ile Ile Met Lys Gly Tyr Phe Asn 385 390 395 400 Asn Lys Gln Ala Thr Glu Glu Ala Ile Asp Lys Glu Gly Trp Leu His 405 410 415 Ser Gly Asp Val Gly Tyr Tyr Asp Asp Asp Gly His Phe Phe Val Val 420 425 430 Asp Arg Leu Lys Glu Leu Ile Lys Tyr Lys Gly Tyr Gln Val Ala Pro 435 440 445 Ala Glu Leu Glu Trp Leu Leu Leu Gln His Pro Ser Ile Lys Asp Ala 450 455 460 Gly Val Thr Gly Val Pro Asp Glu Ala Ala Gly Glu Leu Pro Gly Ala 465 470 475 480 Cys Ile Val Leu Gln Glu Gly Lys Ser Leu Thr Glu Gln Glu Ile Ile 485 490 495 Asp Tyr Ile Ala Glu Arg Val Ser Pro Thr Lys Arg Ile Arg Gly Gly 500 505 510 Val Val Phe Val Asp Asp Ile Pro Lys Gly Ala Thr Gly Lys Leu Val 515 520 525 Arg Ser Glu Leu Arg Lys Leu Leu Ala Gln Lys Lys Ser Lys Leu 530 535 540 <210> SEQ ID NO 15 <211> LENGTH: 543 <212> TYPE: PRT <213> ORGANISM: Mutant Rhagophthalmus ohbai Orange Luciferase of the Invention <400> SEQUENCE: 15 Met Ala Asn Glu Ile Ile Leu His Gly Ala Lys Pro Arg Asp Pro Leu 1 5 10 15 Asp Leu Gly Thr Ala Gly Ile Gln Leu Tyr Arg Ala Leu Thr Asn Phe 20 25 30 Ser Phe Leu Arg Glu Ala Leu Ile Asp Ala His Thr Glu Glu Val Val 35 40 45 Ser Tyr Ala Asp Ile Leu Glu Asn Ser Cys Arg Leu Ala Lys Cys Tyr 50 55 60 Glu Asn Tyr Gly Leu Arg Gln Asn Ser Val Ile Ser Val Cys Ser Glu 65 70 75 80 Asn Ser Thr Ile Phe Phe Tyr Pro Val Ile Ala Ala Leu Tyr Met Gly 85 90 95 Val Ile Thr Ala Thr Val Asn Asp Ser Tyr Thr Glu Arg Glu Leu Leu 100 105 110 Glu Thr Leu Asn Ile Ser Lys Pro Glu Leu Val Phe Cys Ser Lys Lys 115 120 125 Ala Ile Lys Asn Met Met Ala Leu Lys Arg Asn Val Asn Phe Ile Lys 130 135 140 Lys Val Val Leu Leu Asp Ser Lys Glu Asp Met Gly Glu Ala Gln Cys 145 150 155 160 Leu Ser Asn Phe Met Ala Arg Tyr Ser Glu Pro Asn Leu Asp Val Arg 165 170 175 Asn Phe Lys Pro Arg Asp Phe Asp Ala Lys Glu Gln Val Ala Leu Ile 180 185 190 Met Ser Ser Ser Gly Thr Thr Gly Leu Pro Lys Gly Val Val Leu Thr 195 200 205 His Arg Asn Leu Ser Val Arg Phe Val His Cys Lys Asp Pro Leu Phe 210 215 220 Gly Asn Arg Thr Ile Pro Ser Thr Ser Ile Leu Ser Ile Val Pro Phe 225 230 235 240 His His Ala Phe Gly Met Phe Thr Thr Leu Ser Tyr Phe Ile Val Gly 245 250 255 Leu Arg Val Val Leu Leu Lys Arg Phe Glu Glu Lys Phe Phe Leu Ser 260 265 270 Thr Ile Glu Lys Tyr Arg Ile Pro Thr Ile Val Leu Ala Pro Pro Val 275 280 285 Met Val Phe Leu Ala Lys Ser Pro Leu Val Asp Gln Tyr Asp Leu Ser 290 295 300 Ser Ile Arg Glu Val Ala Thr Gly Gly Ala Pro Val Gly Thr Glu Val 305 310 315 320 Ala Val Ala Val Ala Lys Arg Leu Lys Ile Gly Gly Ile Leu Gln Gly 325 330 335 Tyr Gly Leu Thr Glu Thr Cys Cys Ala Val Leu Ile Thr Pro His Asp 340 345 350 Asp Val Lys Thr Gly Ser Thr Gly Arg Val Ala Pro Tyr Val Gln Ala 355 360 365 Lys Ile Val Asp Leu Thr Thr Gly Lys Ser Leu Gly Pro Asn Lys Arg 370 375 380 Gly Glu Leu Cys Phe Lys Ser Glu Ile Ile Met Lys Gly Tyr Phe Asn 385 390 395 400 Asn Lys Gln Ala Thr Glu Glu Ala Ile Asp Lys Glu Gly Trp Leu His 405 410 415 Ser Gly Asp Val Gly Tyr Tyr Asp Asp Asp Gly His Phe Phe Val Val 420 425 430 Asp Arg Leu Lys Glu Leu Ile Lys Tyr Lys Gly Tyr Gln Val Ala Pro 435 440 445 Ala Glu Leu Glu Trp Leu Leu Leu Gln His Pro Ser Ile Lys Asp Ala 450 455 460 Gly Val Thr Gly Val Pro Asp Glu Ala Ala Gly Glu Leu Pro Gly Ala 465 470 475 480 Cys Ile Val Leu Gln Glu Gly Lys Ser Leu Thr Glu Gln Glu Ile Ile 485 490 495 Asp Tyr Ile Ala Glu Arg Val Ser Pro Thr Lys Arg Ile Arg Gly Gly 500 505 510

Val Val Phe Val Asp Asp Ile Pro Lys Gly Ala Thr Gly Lys Leu Val 515 520 525 Arg Ser Glu Leu Arg Lys Leu Leu Ala Gln Lys Lys Ser Lys Leu 530 535 540 <210> SEQ ID NO 16 <211> LENGTH: 1638 <212> TYPE: DNA <213> ORGANISM: Mutant Phrixothrix Green Luciferase <400> SEQUENCE: 16 atggaagaag agaacatcag gcacggcgag cgccctcggg acatcgtcca ccctggctcc 60 gccggccagc agctgtacca gtccctgtac aagttcgcct ccttccctga ggccatcatc 120 gacgcccaca ccaacgaggt gatctcctac gcccagattt tcgaaaccag ctgccgcctg 180 gccgtgagca tcgagcagta cggcctgaac gagaacaacg tggtgggcgt ctgtagcgag 240 aacaacatca acttcttcaa ccctgtgctg gccgccctgt acctcggcat cccagtggcc 300 acctccaacg atatgtacac cgatggcgag ctgaccggcc acctgaacat ctccaagcca 360 accatcatgt tcagctccaa gaaggccctg cccctgatcc tgagagtgca gcagaacctg 420 agcttcatca agaaggtggt ggtgatcgac agcatgtacg acatcaacgg cgtggagtgc 480 gtgtctacct tcgttgcccg gtacaccgac cacaccttcg acccactgtc cttcacccca 540 aaggacttcg accccctgga gaagatcgcc ctgatcatgt catcctccgg caccaccggc 600 ctgcctaagg gcgtggtgct gagccacaga agcctgacca tcagattcgt ccacagcagg 660 gaccccatct acggcacccg caccgtgccc cagacctcca tcctgtccct ggtgccattt 720 caccacgcct tcggcatgtt caccaccctg tcctacttcg tggtgggcct gaaggtggtg 780 atgctgaaga agttcgaggg cgccctcttc ctgaagacca tccagaacta caagatccct 840 acaatcgtgg tggcccctcc agtgatggtg ttcctggcta agagcccact ggtggatcag 900 tacgatctgt ccagcctcac cgaggtggct accggcggcg ctcctctggg caaggatgtg 960 gccgaggctg tggccaagag attgaagctg cctggcatca tccagggcta cggcctgacc 1020 gagacctgct gcgctgtgat gatcacccct cacaacgctg tgaagaccgg ctccaccggc 1080 agacccctgc catacatcaa ggctaaggtg ctggataacg ctaccggcaa agccctggga 1140 ccaggcgaga gaggcgagat ttgcttcaag agcgagatga tcatgaaggg ctactacaac 1200 aaccctgagg ccaccatcga caccatcgac aaggatggct ggctgcactc tggcgacatc 1260 ggctactacg acgaggatgg caacttcttc atcgtggatc ggctgaaaga gctgatcaag 1320 tacaagggct accaggtggc ccctgctgag ctggagaact tgcttctgca gcacccaagc 1380 atcgctgatg ccggcgtgac cggcgtgccc gacgagttcg ctggccagct gcctgctgct 1440 tgtgtcgtgc tggagtctgg caagacattg accgagaagg aggtgcaaga tttcatcgcc 1500 gcccaggtga ccccaactaa gcacctgcgg ggcggcgtgg tgttcgtgga cagcatccct 1560 aaaggcccta ccggcaagct gatcagaaag gagctgcggg agattttcgc ccagagagcc 1620 ccaaagtcca agctgtaa 1638 <210> SEQ ID NO 17 <211> LENGTH: 75 <212> TYPE: DNA <213> ORGANISM: Phrixothrix Red Luciferase <400> SEQUENCE: 17 cagcaggact acaattatat caatcattat ataaatattc ttatattact gacggaataa 60 tcgatgccca tacca 75 <210> SEQ ID NO 18 <211> LENGTH: 71 <212> TYPE: DNA <213> ORGANISM: Phrixothrix Red Luciferase <400> SEQUENCE: 18 gcaggactac aattatatca atcattatat aaatactcgt atattactga cggaataatc 60 gatgcccata c 71 <210> SEQ ID NO 19 <211> LENGTH: 77 <212> TYPE: DNA <213> ORGANISM: Phrixothrix Red Luciferase <400> SEQUENCE: 19 caatgaagta atatcatatg ctcaaatatt tgaaacaagt tgccgcttgg cagttagtct 60 agaaaaatat ggcttgg 77 <210> SEQ ID NO 20 <211> LENGTH: 75 <212> TYPE: DNA <213> ORGANISM: Phrixothrix Red Luciferase <400> SEQUENCE: 20 aatatttgaa accagctgcc gcttggcagt tagtctagag aaatatggct tggatcataa 60 caatgttgtg gcaat 75 <210> SEQ ID NO 21 <211> LENGTH: 77 <212> TYPE: DNA <213> ORGANISM: Phrixothrix Red Luciferase <400> SEQUENCE: 21 gaaaacaaca tacacttttt tggcccttta attgctgccc tataccaagg aataccaatg 60 gcaacatcaa atgatat 77 <210> SEQ ID NO 22 <211> LENGTH: 73 <212> TYPE: DNA <213> ORGANISM: Phrixothrix Red Luciferase <400> SEQUENCE: 22 acttttttgg ccctttaatt gctgctttat accaagggat accaatggca acatcaaatg 60 atatgtacac aga 73 <210> SEQ ID NO 23 <211> LENGTH: 71 <212> TYPE: DNA <213> ORGANISM: Phrixothrix Red Luciferase <400> SEQUENCE: 23 catcaaatga tatgtacaca gaaagggaga tgatcggcca tttgaatata tcgaaaccat 60 gccttatgtt t 71 <210> SEQ ID NO 24 <211> LENGTH: 77 <212> TYPE: DNA <213> ORGANISM: Phrixothrix Red Luciferase <400> SEQUENCE: 24 tttattctga aagtacaaaa acatctagat tttctcaaaa aagtcatagt cattgatagt 60 atgtacgata tcaatgg 77 <210> SEQ ID NO 25 <211> LENGTH: 77 <212> TYPE: DNA <213> ORGANISM: Phrixothrix Red Luciferase <400> SEQUENCE: 25 atgtacgata tcaatggcgt tgaatgcgta tttagttttg tttcacgtta tactgatcac 60 gcctttgatc cagtgaa 77 <210> SEQ ID NO 26 <211> LENGTH: 75 <212> TYPE: DNA <213> ORGANISM: Phrixothrix Red Luciferase <400> SEQUENCE: 26 atatcaatgg cgttgaatgc gtatttagct ttgtttcacg gtatactgat cacgcctttg 60 atccagtgaa attta 75 <210> SEQ ID NO 27 <211> LENGTH: 77 <212> TYPE: DNA <213> ORGANISM: Phrixothrix Red Luciferase <400> SEQUENCE: 27 gtatttagct ttgtttcacg ttatactgat cacgcgttcg atccagtgaa atttaaccca 60 aaagagtttg atccctt 77 <210> SEQ ID NO 28 <211> LENGTH: 77 <212> TYPE: DNA <213> ORGANISM: Phrixothrix Red Luciferase <400> SEQUENCE: 28 tttaacccaa aagagtttga tcccttggaa agaaccgcgc taattatgac atcatctgga 60 acaactggat tgcctaa 77 <210> SEQ ID NO 29 <211> LENGTH: 81 <212> TYPE: DNA <213> ORGANISM: Phrixothrix Red Luciferase <400> SEQUENCE: 29 gaaccgcatt aattatgaca tcatctggaa caactggcct gcctaaaggg gtagtaataa 60 gccatagaag tataactata a 81 <210> SEQ ID NO 30 <211> LENGTH: 73 <212> TYPE: DNA <213> ORGANISM: Phrixothrix Red Luciferase <400> SEQUENCE: 30 ctggattgcc taaaggggta gtaataagcc ataggagtat aactataaga ttcgtccata 60 gcagtgatcc cat 73 <210> SEQ ID NO 31 <211> LENGTH: 77 <212> TYPE: DNA <213> ORGANISM: Phrixothrix Red Luciferase <400> SEQUENCE: 31 aagaaatttg agggcgaatt cttcttaaaa accatccaaa attacaaaat cgcttctatt 60 gtagttcctc ctccaat 77

<210> SEQ ID NO 32 <211> LENGTH: 71 <212> TYPE: DNA <213> ORGANISM: Phrixothrix Red Luciferase <400> SEQUENCE: 32 agggcgaatt cttcttaaaa accatacaaa actacaaaat cgcttctatt gtagttcctc 60 ctccaattat g 71 <210> SEQ ID NO 33 <211> LENGTH: 77 <212> TYPE: DNA <213> ORGANISM: Phrixothrix Red Luciferase <400> SEQUENCE: 33 gttcctcctc caattatggt atatttggct aaaagtcctc tagtcgatga atacaattta 60 tcgagcttaa cggaaat 77 <210> SEQ ID NO 34 <211> LENGTH: 73 <212> TYPE: DNA <213> ORGANISM: Phrixothrix Red Luciferase <400> SEQUENCE: 34 tttggctaaa agtccattag tcgatgaata caatctgtcg agcttaacgg aaattgcttg 60 tggagggtct cct 73 <210> SEQ ID NO 35 <211> LENGTH: 73 <212> TYPE: DNA <213> ORGANISM: Phrixothrix Red Luciferase <400> SEQUENCE: 35 ggaaattgct tgtggagggt ctcctttagg aagagacatc gcagataaag tagcaaagag 60 attgaaagta cat 73 <210> SEQ ID NO 36 <211> LENGTH: 77 <212> TYPE: DNA <213> ORGANISM: Phrixothrix Red Luciferase <400> SEQUENCE: 36 gggtctcctt taggaagaga tatcgcagat aaagtagcca agagattgaa agtacatgga 60 atcctacaag gatatgg 77 <210> SEQ ID NO 37 <211> LENGTH: 73 <212> TYPE: DNA <213> ORGANISM: Phrixothrix Red Luciferase <400> SEQUENCE: 37 ggatatggat taaccgaaac ctgcagcgct ctaatactga gccccaatga tcgagaactt 60 aaaaaaggtg caa 73 <210> SEQ ID NO 38 <211> LENGTH: 77 <212> TYPE: DNA <213> ORGANISM: Phrixothrix Red Luciferase <400> SEQUENCE: 38 ccgaaacctg cagcgctcta atacttagcc ccaacgatag agaacttaaa aaaggtgcaa 60 ttggaacgcc tatgcca 77 <210> SEQ ID NO 39 <211> LENGTH: 81 <212> TYPE: DNA <213> ORGANISM: Phrixothrix Red Luciferase <400> SEQUENCE: 39 ctaatactta gccccaatga tcgagaactt aaaaagggtg caattggaac gcctatgcca 60 tatgttcaag ttaaagttat a 81 <210> SEQ ID NO 40 <211> LENGTH: 73 <212> TYPE: DNA <213> ORGANISM: Phrixothrix Red Luciferase <400> SEQUENCE: 40 tgggaaggcg ctaggaccaa gagaaaaagg cgagatttgc ttcaaaagtc aaatgcttat 60 gaaaggatat cac 73 <210> SEQ ID NO 41 <211> LENGTH: 77 <212> TYPE: DNA <213> ORGANISM: Phrixothrix Red Luciferase <400> SEQUENCE: 41 aaaaggcgaa atatgcttca aaagtcaaat gcttatgaag ggctatcaca acaatccgca 60 agcaactcgt gatgctc 77 <210> SEQ ID NO 42 <211> LENGTH: 75 <212> TYPE: DNA <213> ORGANISM: Phrixothrix Red Luciferase <400> SEQUENCE: 42 tccgcaagca actcgtgatg ctcttgacaa agatgggtgg cttcatactg gggatcttgg 60 atattacgac gaaga 75 <210> SEQ ID NO 43 <211> LENGTH: 73 <212> TYPE: DNA <213> ORGANISM: Phrixothrix Red Luciferase <400> SEQUENCE: 43 gacagattta tctatgtagt tgatcgattg aaagagctta ttaaatataa aggatatcag 60 gttgcgcctg ctg 73 <210> SEQ ID NO 44 <211> LENGTH: 77 <212> TYPE: DNA <213> ORGANISM: Phrixothrix Red Luciferase <400> SEQUENCE: 44 atttatctat gtagttgatc gattgaaaga actcatcaaa tataaaggat atcaggttgc 60 gcctgctgaa ctggaaa 77 <210> SEQ ID NO 45 <211> LENGTH: 75 <212> TYPE: DNA <213> ORGANISM: Phrixothrix Red Luciferase <400> SEQUENCE: 45 cgcctgctga actggaaaat ctgcttttac aacacccaaa tatttctgat gcgggtgtta 60 ttggaattcc ggacg 75 <210> SEQ ID NO 46 <211> LENGTH: 77 <212> TYPE: DNA <213> ORGANISM: Phrixothrix Red Luciferase <400> SEQUENCE: 46 ctgaactgga aaatctgctt ttacaacatc ctaatatttc tgatgcgggt gttattggaa 60 ttccggacga atttgct 77 <210> SEQ ID NO 47 <211> LENGTH: 75 <212> TYPE: DNA <213> ORGANISM: Phrixothrix Red Luciferase <400> SEQUENCE: 47 ttacaacatc caaatatttc tgatgcgggt gtcattggaa ttccggacga atttgctggt 60 caattacctt ccgcg 75 <210> SEQ ID NO 48 <211> LENGTH: 77 <212> TYPE: DNA <213> ORGANISM: Phrixothrix Red Luciferase <400> SEQUENCE: 48 tgcgggtgtt attggaattc cggacgaatt tgctggtcag ttaccttccg cgtgtgttgt 60 gttagagcct ggtaaga 77 <210> SEQ ID NO 49 <211> LENGTH: 73 <212> TYPE: DNA <213> ORGANISM: Phrixothrix Red Luciferase <400> SEQUENCE: 49 aactaaacat cttcgaggcg gtgtcgtatt tatcgacagt attccaaaag gcccaacagg 60 aaaactcatg aga 73 <210> SEQ ID NO 50 <211> LENGTH: 48 <212> TYPE: DNA <213> ORGANISM: Phrixothrix Red Luciferase <400> SEQUENCE: 50 gaactccgtg caatatttgc ccgggaacag gcaaaatcaa aactataa 48 <210> SEQ ID NO 51 <211> LENGTH: 77 <212> TYPE: DNA <213> ORGANISM: Rhagophthalmus ohbai Green Luciferase <400> SEQUENCE: 51 cccagggacc ccctggacct gggcaccgcc ggcattcagc tctacagagc cctgaccaac 60 ttctccttcc tgaggga 77 <210> SEQ ID NO 52 <211> LENGTH: 77 <212> TYPE: DNA <213> ORGANISM: Rhagophthalmus ohbai Green Luciferase <400> SEQUENCE: 52 cctgggcacc gccggcatcc agctgtacag ggccctgacc aacttctcct tcctgaggga 60 ggccctgatc gacgccc 77

<210> SEQ ID NO 53 <211> LENGTH: 79 <212> TYPE: DNA <213> ORGANISM: Rhagophthalmus ohbai Green Luciferase <400> SEQUENCE: 53 gtggtgtctt acgccgacat cctggagaac agctgtagac tggctaagtg ctacgagaac 60 tacggcctgc gccagaaca 79 <210> SEQ ID NO 54 <211> LENGTH: 79 <212> TYPE: DNA <213> ORGANISM: Rhagophthalmus ohbai Green Luciferase <400> SEQUENCE: 54 gcgccagaac agcgtgatct ccgtgtgcag cgagaatagc accatcttct tctaccccgt 60 gatcgccgcc ctgtacatg 79 <210> SEQ ID NO 55 <211> LENGTH: 81 <212> TYPE: DNA <213> ORGANISM: Rhagophthalmus ohbai Green Luciferase <400> SEQUENCE: 55 tcaagaaggt ggtgctgctg gacagcaagg aggatatggg cgaggcccag tgcctgagca 60 acttcatggc ccggtactcc g 81 <210> SEQ ID NO 56 <211> LENGTH: 81 <212> TYPE: DNA <213> ORGANISM: Rhagophthalmus ohbai Green Luciferase <400> SEQUENCE: 56 tcaagccaag ggacttcgac gccaaggagc aggtggccct tattatgtcc tcctctggca 60 ccaccggcct gccaaagggc g 81 <210> SEQ ID NO 57 <211> LENGTH: 75 <212> TYPE: DNA <213> ORGANISM: Rhagophthalmus ohbai Green Luciferase <400> SEQUENCE: 57 atcgagaagt acagaatccc aacaatcgtg ctggcccctc ctgtgatggt gttcctggcc 60 aagagccccc tggtg 75 <210> SEQ ID NO 58 <211> LENGTH: 79 <212> TYPE: DNA <213> ORGANISM: Rhagophthalmus ohbai Green Luciferase <400> SEQUENCE: 58 atcccaacaa tcgtgctggc cccccccgtg atggtgttcc tggctaagag ccccctggtg 60 gaccagtacg acctgtcca 79 <210> SEQ ID NO 59 <211> LENGTH: 75 <212> TYPE: DNA <213> ORGANISM: Rhagophthalmus ohbai Green Luciferase <400> SEQUENCE: 59 gagaggtggc caccggcggc gcccctgtgg gcaccgaggt tgccgtggcc gtggccaagc 60 ggctgaagat cggcg 75 <210> SEQ ID NO 60 <211> LENGTH: 75 <212> TYPE: DNA <213> ORGANISM: Rhagophthalmus ohbai Green Luciferase <400> SEQUENCE: 60 gccatcgaca aggagggctg gctgcactcc ggcgacgtgg gatactacga cgacgatggc 60 cacttcttcg tggtg 75 <210> SEQ ID NO 61 <211> LENGTH: 73 <212> TYPE: DNA <213> ORGANISM: Rhagophthalmus ohbai Green Luciferase <400> SEQUENCE: 61 ctccggcgac gtgggctact acgacgacga tggacatttc ttcgtggtgg accggctgaa 60 ggagctgatc aag 73 <210> SEQ ID NO 62 <211> LENGTH: 81 <212> TYPE: DNA <213> ORGANISM: Rhagophthalmus ohbai Green Luciferase <400> SEQUENCE: 62 cgacgatggc cacttcttcg tggtggaccg gctgaaagag ctgatcaagt acaagggcta 60 ccaggtggcc cccgccgagc t 81 <210> SEQ ID NO 63 <211> LENGTH: 71 <212> TYPE: DNA <213> ORGANISM: Rhagophthalmus ohbai Green Luciferase <400> SEQUENCE: 63 agtggctgct gctccagcac ccatccatca aggatgccgg cgtgaccggc gtgcccgacg 60 aggccgccgg c 71 <210> SEQ ID NO 64 <211> LENGTH: 75 <212> TYPE: DNA <213> ORGANISM: Rhagophthalmus ohbai Green Luciferase <400> SEQUENCE: 64 ccgagcagga gatcatcgac tacatcgccg agcgagtgtc tcccaccaag cgcatccggg 60 gcggcgtcgt cttcg 75 <210> SEQ ID NO 65 <211> LENGTH: 71 <212> TYPE: DNA <213> ORGANISM: Rhagophthalmus ohbai Green Luciferase <400> SEQUENCE: 65 gagcgggtgt cccccaccaa gcgcatccgg ggcggagtcg tcttcgtgga cgacatcccc 60 aagggcgcca c 71

Claims

1. DNA encoding at least one luciferase selected from the group consisting a red-emitting luciferase and a green-emitting luciferase derived from a rail road worm and a green-emitting luciferase and an orange-emitting luciferase derived from Rhagophthalmus ohba stably expressed in mammalian cells, characterized in that (1) the DNA has no binding sequence for an additional transcription factor in the mammalian cells and has a codon usage for the mammal.

2. The DNA according to claim 1, characterized in that the mammal is human and the DNA has at least one nucleotide sequence selected from the group consisting of SEQ ID NOS:7, 10, 11 and 16.

3. A method for enabling the expression of DNA encoding a luciferase derived from a rail road worm or Rhagophthalmus ohba in mammalian cells, characterized by having 1) a step of altering a cDNA sequence such that no additional transcription factor is bound; 2) a step of changing a codon usage for insects to that for mammals in the cDNA sequence; and optionally 3) a step of altering the cDNA sequence with many restriction enzyme sites due to limited application at the use.

4. The method according to claim 3, characterized in that an amino acid sequence of the luciferase is not altered.

5. A polypeptide which is a luciferase with a maximum luminescence wavelength of 630 nm, represented by: (1) a polypeptide having an amino acid sequence of SEQ ID NO:4; or (2) a polypeptide having one or more amino acid substitutions, additions or deletions in the sequence of SEQ ID NO:4.

6. The polypeptide according to claim 5, expressed in mammalian cells.

7. A gene construct comprising one or two or more genes of luciferases which emit light whose wavelength does not substantially depend on a determining condition and maximum luminescence wavelength is 535 to 635 mm, which is stably expressible in mammalian cells.

8. The gene construct according to claim 7 comprising 3 or more luciferase genes stably expressible in mammalian cells wherein one or two or more genes of luciferases with a maximum luminescence wavelength of 460 to 520 nm together with one or two or more genes of luciferases which emit light whose wavelength does not substantially depend on a determining condition and maximum luminescence wavelength is 535 to 635 nm.

9. The gene construct according to claim 7 wherein the luciferase gene is a gene encoding at least one luciferase selected from the group consisting of a red-emitting luciferase, green-emitting luciferase derived from a rail road worm, a green-emitting luciferase, and an orange-emitting luciferase derived from Rhagophthalmus ohba stably expressed in mammalian cells.

10. The gene construct according to claim 7 comprising an element for promoting efficiency of translation and/or an element for stabilizing mRNA.

11. A gene construct capable of distinctively determining each light emitted from two or more luciferases, comprising one or two or more genes of the luciferases which emit light whose wavelength does not substantially depend on a determining condition and if necessary a gene of the luciferase which emits light whose wavelength is different and does not substantially depend on the determining condition under the control of different promoters.

12. An expression vector containing the gene construct according to claim 7.

13. Mammalian cells transformed with the gene construct according to claim 7.

14. Mammalian cells comprising two or more stably expressing genes of luciferases which emit mutually distinct light whose luminescence wavelength does not substantially depend on a determining condition under the control of different promoters in the mammalian cells.

15. The mammalian cells according to claim 13 wherein two or more of the above luciferases have a maximum luminescence wavelength of 535 to 635 nm and can emit with one substrate.

16. The mammalian cells according to claim 15 comprising a red-emitting luciferase gene from a rail road worm and further comprising at least two or more selected from the group consisting of a green-emitting luciferase gene from the rail road worm, a green-emitting luciferase gene from Rhagophthalmus ohba, an orange-emitting luciferase from Rhagophthalmus ohba, and a blue-emitting luciferase gene under the control of different promoters.

17. The mammalian cells according to claim 14 stably expressibly comprising genes of three or more luciferases which emit mutually distinct light whose luminescence wavelength does not substantially depend on a determining condition under the control of different promoters in the mammalian cells.

18. The mammalian cells according to claim 14 comprising three or more luciferase genes under the control of different promoters wherein a first luciferase gene is under the control of a constantly expressed promoter, a second luciferase gene is under the control of a toxicity assessing promoter, and remaining one or more luciferase genes are under the control of a promoter subjected to assessment.

19. The mammalian cells according to claim 14 comprising three or more luciferase genes under the control of different promoters wherein a first luciferase gene is under the control of a constantly expressed promoter, a second luciferase gene is under the control of a pseudopromoter, and remaining one or more luciferase genes are under the control of a promoter subjected to assessment.

20. The mammalian cells according to claim 14 comprising 4 or more luciferase genes under the control of different promoters, wherein a first luciferase gene is under the control of a constantly expressed promoter, a second luciferase gene is under the control of a toxicity assessing promoter, a third luciferase gene is under the control of a promoter of a protein which accepts an external factor, and remaining one or more luciferase genes are under the control of a promoter subjected to assessment.

21. The mammalian cells according to claim 14 comprising 4 or more luciferase genes under the control of different promoters, wherein a first luciferase gene is under the control of a constantly expressed promoter, a second luciferase gene is under the control of a pseudopromoter, a third luciferase gene is under the control of a promoter of a protein which accepts an exogenous factor, and remaining one or more luciferase genes are under the control of a promoter subjected to assessment.

22. The mammalian cells according to claim 14 comprising two luciferase genes under the control of different promoters, wherein a first luciferase gene is under the control of a constantly expressed promoter, and a second luciferase gene is under the control of a toxicity assessing promoter.

23. The mammalian cells according to claim 14 comprising two luciferase genes under the control of different promoters, wherein a first luciferase gene is under the control of a constantly expressed promoter, and a second luciferase gene is under the control of a pseudopromoter.

24. A method for screening drugs comprising a step of culturing the mammalian cells according to claim 18 in the presence of a drug candidate compound in a medium of the mammalian cells, a step of quantifying an amount of the above luciferase in the presence or absence of the candidate compound, and a step of assessing an effect of the candidate compound on a promoter subjected to assessment, which is linked to at least one luciferase.

25. A system for multiply determining transcription activity of each promoter linked to each luciferase before and after a change of a culture environment by changing the culture environment of the mammalian cells according to claim 13, and assessing expressed amounts of two or more luciferases which emit mutually distinct light whose luminescence wavelength does not depend on a determining condition.

26. The system according to claim 23 capable of simultaneously determining expressed amounts of two or more luciferases.

27. The system according to claim 23 capable of determining expressed amounts of three or more luciferases.