U.S. patent application number 11/269021 was filed with the patent office on 2007-05-10 for methods and kits for nucleic acid amplification.
Invention is credited to Robert C. Getts, James Kadushin, Kelly Sensinger.
Application Number | 20070105124 11/269021 |
Document ID | / |
Family ID | 38004191 |
Filed Date | 2007-05-10 |
United States Patent
Application |
20070105124 |
Kind Code |
A1 |
Getts; Robert C. ; et
al. |
May 10, 2007 |
Methods and kits for nucleic acid amplification
Abstract
Compositions and methods are provided for amplifying nucleic
acid molecules. The nucleic acid molecules can be used in various
research and diagnostic applications, such as gene expression
studies involving nucleic acid microarrays.
Inventors: |
Getts; Robert C.;
(Collegeville, PA) ; Sensinger; Kelly; (Perkasie,
PA) ; Kadushin; James; (Gilbertsville, PA) |
Correspondence
Address: |
Datascope Investment Corp.
14 Philips Parkway
Montvale
NJ
07645
US
|
Family ID: |
38004191 |
Appl. No.: |
11/269021 |
Filed: |
November 8, 2005 |
Current U.S.
Class: |
435/6.12 ;
435/91.2 |
Current CPC
Class: |
C12Q 1/6853 20130101;
C12Q 1/6865 20130101; C12Q 1/6853 20130101; C12Q 2525/143 20130101;
C12Q 2521/107 20130101 |
Class at
Publication: |
435/006 ;
435/091.2 |
International
Class: |
C12Q 1/68 20060101
C12Q001/68; C12P 19/34 20060101 C12P019/34 |
Claims
1. A method for synthesizing at least one asRNA molecule directly
from at least one sRNA molecule, comprising: a) providing at least
one sRNA molecule having a 5' end and a 3' end, said 3' end
comprising a first nucleotide sequence corresponding to the partial
5' end of the template strand of a RNA polymerase recognition
sequence; b) annealing to the 3' end of said sRNA molecule a primer
having a 5' end and a 3' end, said primer comprising a second
nucleotide sequence corresponding to at the 5' end of the
non-template strand of said RNA polymerase recognition sequence
sufficient in length to anneal to said first nucleotide sequence
corresponding to the partial 5' end of the template strand of said
RNA polymerase recognition sequence; c) extending the 3' end of
said primer such that a double stranded RNA/DNA duplex is formed;
d) degrading at least the 3' portion of the RNA strand of said
double stranded RNA/DNA duplex, thereby providing at least a
partially single stranded DNA molecule having a single stranded 5'
end, said 5' end comprising a third nucleotide sequence
corresponding to the complete non-template strand of said RNA
polymerase recognition sequence; e) synthesizing at least a
partially double stranded DNA molecule from said at least partially
single stranded DNA molecule such that said third nucleotide
sequence corresponding to the complete non-template strand of said
RNA polymerase recognition sequence is converted into a double
stranded RNA polymerase promoter; and f) initiating RNA
transcription using an RNA polymerase which recognizes said double
stranded RNA polymerase promoter, thereby synthesizing at least one
asRNA molecule directly from at least one sRNA molecule.
2. The method of claim 1, wherein in step e) the double stranded
RNA polymerase promoter is a bacteriophage promoter.
3. The method of claim 1, wherein in step d) the RNA strand of the
double stranded RNA/DNA duplex is substantially completely degraded
using a RNase enzyme separate from reverse transcriptase.
4. The method of claim 3, wherein step e) comprises addition of an
exogenous primer.
5. The method of claim 4, the exogenous primer comprises a
nucleotide sequence of sufficient complementarity such that it
anneals to the at least partially single stranded DNA molecule.
6. The method of claim 5, wherein the exogenous primer anneals to
the 3' most nucleotides of the at least partially single stranded
DNA molecule.
7. The method of claim 5, wherein the exogenous primer is
complementary to a complementary to naturally occurring
gene-specific sequence on the at least partially single stranded
DNA molecule.
8. The method of claim 5, wherein the exogenous primer is
complementary to a complementary to an engineered sequence on the
at least partially single stranded DNA molecule.
9. The method of claim 1, wherein in step d) the RNA strand of the
double stranded RNA/DNA duplex is partially degraded using a
reverse transcriptase having RNAse activity without the addition of
a separate RNase enzyme.
10. The method of claim 9, wherein in step e) a remaining portion
of the RNA strand serves as a primer for second strand DNA
synthesis.
11. The method of claim 1, wherein step f) comprises initiating RNA
transcription in the presence of fluorescently labeled
nucleotides.
12. The method of claim 1, wherein step f) comprises RNA
transcription initiating in the presence of amino allyl
nucleotides.
13. The method of claim 1, wherein step a) comprises: g) providing
at least one RNA molecule having a 5' end and a 3' end; and
synthesizing at least one single stranded cDNA molecule from said
RNA molecule or molecules using a primer having a 5' extension
comprising a fourth nucleotide sequence corresponding to the
partial 3' end of the non-template strand of the RNA polymerase
recognition sequence.
14. The method of claim 13, wherein the primer is a random primer,
an oligodT primer or a combination thereof.
15. The method of claim 13, further comprising: (h) attaching an
oligodeoxynucleotide tail having a 5' end and 3' end onto the 3'
end of the cDNA molecule or molecules; (i) annealing to said
oligodeoxynucleotide tail a single stranded RNA/DNA composite
bridge oligonucleotide comprising a 5' RNA portion and a 3' DNA
sequence portion, such that the RNA portion remains single
stranded; (j) extending the 3' end of said oligodeoxynucleotide
tail, such that said single stranded RNA portion becomes a double
stranded RNA/DNA duplex; (k) degrading the RNA portion of said
RNA/DNA duplex, thereby exposing a 3' single stranded DNA tail; (l)
annealing to said 3' single stranded DNA tail a single stranded
promoter template comprising at least one RNA polymerase
recognition sequence; (m) extending said 3' single stranded DNA
tail such that said at least one single stranded RNA polymerase
recognition sequence is converted into at least one RNA polymerase
promoter; (n) and initiating RNA transcription using a RNA
polymerase which recognizes said at least one RNA polymerase
promoter, thereby providing at least one sRNA molecule having a 5'
end and a 3' end, said 3' end comprising a first nucleotide
sequence corresponding to the partial 5' end of the template strand
of a RNA polymerase recognition sequence.
16. The method of claim 15, wherein steps 1) through m) are
performed substantially at the same time.
17. The method of claim 15, wherein in step 1) the single stranded
promoter template comprises a first RNA polymerase recognition
sequence and a second RNA polymerase recognition sequence 3' to
said first recognition sequence, wherein said first and second RNA
polymerase recognition sequence are different.
18. The method of claim 17, wherein the first and second RNA
polymerase recognition sequences are bacteriophage RNA polymerase
recognition sequences.
19. The method of claim 17, wherein in step n) RNA transcription is
initiated using a RNA polymerase which recognizes said the first
RNA polymerase recognition sequence.
20. The method of claim 19, further comprising: (o) synthesizing at
least one cDNA molecule having a 5' end and 3' end from the sRNA
molecule or molecules using a primer having a nucleotide sequence
corresponding to the fourth nucleotide sequence of the 5' extension
of the primer in step g), thereby forming a double stranded
sRNA/cDNA duplex; (p) degrading the sRNA portion of said sRNA/cDNA
duplex, thereby providing a single stranded cDNA molecule; (q)
annealing to said single stranded cDNA molecule a single stranded
promoter oligonucleotide complementary to the second different RNA
polymerase recognition sequence such that a second different RNA
polymerase promoter is formed; and (r) initiating RNA transcription
using an RNA polymerase which recognizes said second different RNA
polymerase promoter, thereby providing at least one sRNA molecule
having a 5' end and a 3' end, said 3' end comprising a first
nucleotide sequence corresponding to the partial 5' end of the
template strand of a RNA polymerase recognition sequence.
21. The method of claim 20, wherein the first and second RNA
polymerase recognition sequences are bacteriophage RNA polymerase
recognition sequences.
22. A method for synthesizing at least one cDNA molecule directly
from at least one sRNA molecule, comprising: a) providing at least
one sRNA molecule having a 5' end and a 3' end, said 3' end
comprising a first nucleotide sequence corresponding to the partial
5' end of the template strand of a RNA polymerase recognition
sequence; b) annealing to the 3' end of said sRNA molecule a primer
having a 5' end and a 3' end, said primer comprising a second
nucleotide sequence corresponding to at the 5' end of the
non-template strand of said RNA polymerase recognition sequence
sufficient in length to anneal to said first nucleotide sequence
corresponding to the partial 5' end of the template strand of said
RNA polymerase recognition sequence; and c) extending the 3' end of
said primer with reverse transcriptase, thereby synthesizing at
least one cDNA molecule directly from at least one sRNA
molecule.
23. The method of claim 22, wherein step c) comprises extending the
3' end of the primer in the presence of detectably labeled
nucleotides.
24. The method of claim 23, wherein the detectable labeled
nucleotides are fluorescently labeled nucleotides.
25. The method of claim 23, wherein the detectable labeled
nucleotides are amino allyl nucleotides.
26. The method of claim 22, wherein the primer in step b) further
comprises a capture nucleotide sequence at its 5' end.
27. The method of claim 26, further comprising indirectly labeling
the cDNA molecule or molecules with a molecule comprising a
nucleotide sequence complementary to the capture nucleotide
sequence.
28. The method of claim 27, wherein the molecule is a nucleic acid
dendrimer.
29. A method for probing a nucleic acid microarray, comprising:
contacting a nucleic acid microarray with at least one asRNA
molecule synthesized by the method of claim 1.
30. A method for probing a nucleic acid microarray, comprising:
contacting a nucleic acid microarray with at least one cDNA
molecule synthesized by the method of claim 22.
31. A kit for synthesizing asRNA molecules and/or cDNA molecules
directly from a sRNA molecule, comprising: one or more first
primers comprising a nucleotide sequence corresponding to at least
a portion of the 5' end of the non-template strand of a RNA
polymerase recognition sequence; and instructional materials for
synthesizing asRNA and/or molecules directly from sRNA molecules
using said first primer.
32. The kit of claim 31, further comprising one or more reagents
and instructional materials for synthesizing sRNA molecules from
which asRNA and/or cDNA molecules can be directly synthesized.
33. The kit of claim, 32 comprising: one or more second primers
having a 5' extension comprising a nucleotide sequence
corresponding to the partial 3' end of the non-template strand of a
RNA polymerase recognition sequence.
34. The kit of claim 33, further comprising a single stranded
promoter template comprising at least one RNA polymerase
recognition sequence; and a single stranded RNA/DNA composite
bridge oligonucleotide comprising a RNA sequence 5' of a DNA
sequence.
35. The kit of claim 34, further comprising one or more third
primers comprising a nucleotide sequence corresponding to the
nucleotide sequence of the 5' extension of the second primer or
primers; and a single stranded promoter oligonucleotide
complementary to a second RNA polymerase recognition sequence of
the promoter template.
Description
FIELD OF THE INVENTION
[0001] The present invention relates generally to compositions and
methods for amplifying nucleic acid molecules.
BACKGROUND OF THE INVENTION
[0002] Microarray technology has become a powerful tool for
generating and analyzing gene expression profiles. Microarray
expression analysis, however, generally demands large amounts of
RNA that are often not available (see Wang et al., BioTechniques
34:394 (2003)). Several RNA amplification techniques have been
developed to overcome this problem. These techniques, however,
generally suffer from a phenomenon known as amplification bias
(see, e.g., U.S. Pat. No. 6,582,906). In these cases, the amplified
population of RNA molecules does not proportionally represent the
population of RNA molecules existing in the original sample.
[0003] For example, in the method disclosed by Eberwine and
colleagues (see, e.g., U.S. Pat. Nos. 5,545,522; 5,716,785;
5,891,636; 5,958,688; and 6,291,170), a compound oligonucleotide is
utilized for the amplification, wherein the compound
oligonucleotide is provided with both a T7 promoter and a primer. A
cDNA copy is created of an initial mRNA transcript using the
compound oliognucleotide, with subsequent second strand synthesis
to create a cDNA that is double stranded. RNA amplification is
conducted via the promoter portion of the compound oligonucleotide,
with transcription proceeding off of the cDNA's second strand.
Since the second strand is used for transcription, the Eberwine
method produces amplified RNA that is antisense to the initial mRNA
sequence (termed cRNA or aRNA).
[0004] The Eberwine method, however, introduces a 3' bias during
each of its steps due to the incomplete processivities (i.e., the
inability of an enzyme to remain attached to a nucleic acid
molecule) of the enzymes utilized and the positioning of the RNA
polymerase promoter (see, e.g., U.S. Pat. No. 6,582,906 and U.S.
Patent Publication No. US2003/0104432). For example, the compound
oligonucleotide used to produce first strand cDNA places the
promoter at the 5' end of the cDNA, which corresponds to the 3' end
of the message. This coupled with the inability of RNA polymerase
to complete transcription of some templates (due perhaps to long
polyA tail regions or interference from secondary and tertiary
structures in the template) can result in a 3' bias in the
amplified antisense RNA population. In addition, if second strand
cDNA synthesis by DNA polymerase is incomplete, these cDNAs will
lack functional promoters, resulting in a reduced representation of
the original RNA molecule (or possibly a complete absence) in the
amplified population.
[0005] Applicants' copending patent applications U.S. patent
application Ser. Nos. 10/979,052, 11/150,794 and 11/210,602, and
International Application No. PCT/US2004/014325, each specifically
incorporated herein by reference in its entirety, disclose methods
for attaching or synthesizing RNA polymerase promoters onto the 3'
ends of cDNA molecules. In vitro transcription is initiated by
addition of RNA polymerase, resulting in the synthesis of sense RNA
(sRNA) molecules having the same orientation as the original RNA
molecules from which the cDNA molecules were synthesized. For
downstream applications, such as gene expression studies, the sRNA
molecules can be reverse transcribed into cDNA molecules or used in
aRNA amplification reactions using the Eberwine method described
above.
[0006] Reverse transcription of the sRNA molecules, however,
provides no further amplification of the original nucleic acid
sequences, limiting its use when small amounts of RNA are involved.
Eberwine's aRNA method, while providing amplification, often
results in large amounts of non-specific artifacts due to the use
of a compound oligonucleotide containing an intact T7 promoter.
[0007] It would be desirable to provide methods and kits for
synthesizing antisense RNA (asRNA) molecules directly from sRNA
molecules which provides increased amplification with low amounts
of non-specific artifacts.
SUMMARY OF THE INVENTION
[0008] Applicants have invented methods for the synthesis of asRNA
molecules directly from sRNA molecules, wherein a partial RNA
polymerase recognition sequence at the 3' ends of sRNA molecules is
converted into a complete RNA polymerase recognition sequence and
ultimately into a double stranded RNA polymerase promoter.
Subsequent RNA transcription using an RNA polymerase that
recognizes the double stranded RNA polymerase promoter results in
the production of amplified asRNA molecules. Applicants have
discovered that this method of promoter formation and amplification
provides lower amounts of non-specific artifacts compared to
traditional aRNA amplification methods involving intact promoter
primers.
[0009] Accordingly, one aspect of the present invention is directed
to a method for synthesizing at least one asRNA molecule directly
from at least one sRNA molecule, comprising: [0010] a) providing at
least one sRNA molecule having a 5' end and a 3' end, said 3' end
comprising a first nucleotide sequence corresponding to the partial
5' end of the template strand of a RNA polymerase recognition
sequence; [0011] b) annealing to the 3' end of said sRNA molecule a
primer having a 5' end and a 3' end, said primer comprising a
second nucleotide sequence corresponding to at the 5' end of the
non-template strand of said RNA polymerase recognition sequence
sufficient in length to anneal to said first nucleotide sequence
corresponding to the partial 5' end of the template strand of said
RNA polymerase recognition sequence; [0012] c) extending the 3' end
of said primer such that a double stranded RNA/DNA duplex is
formed; [0013] d) degrading at least the 3' portion of the RNA
strand of said double stranded RNA/DNA duplex, thereby providing at
least a partially single stranded DNA molecule having a single
stranded 5' end, said 5' end comprising a third nucleotide sequence
corresponding to the complete non-template strand of said RNA
polymerase recognition sequence; [0014] e) synthesizing at least a
partially double stranded DNA molecule from said at least partially
single stranded DNA molecule such that said third nucleotide
sequence corresponding to the complete non-template strand of said
RNA polymerase recognition sequence is converted into a double
stranded RNA polymerase promoter; and [0015] f) initiating RNA
transcription using an RNA polymerase which recognizes said double
stranded RNA polymerase promoter, thereby synthesizing at least one
asRNA molecule directly from at least one sRNA molecule.
[0016] In some embodiments, the at least partially double strand
stranded DNA molecule is synthesized by performing second strand
DNA synthesis with an exogenous primer. In other embodiments, the
at least partially double strand stranded DNA molecule is
synthesized by extending a remaining 5' portion of the RNA strand
of the double stranded RNA/DNA duplex.
[0017] As described more fully below, the sRNA molecule can be
provided by attaching one or more RNA polymerase promoters to the
3' end of a cDNA molecule, followed by one or more rounds of RNA
transcription with RNA polymerases which recognizes the RNA
polymerase promoters. The cDNA molecule can be provided by
contacting a RNA molecule with a primer having a 5' extension
comprising a fourth nucleotide sequence corresponding to the
complement of the first nucleotide sequence in the presence of a
reverse transcriptase. Such reverse transcription primers include
oligodT primers, random primers or combinations thereof. Upon
reverse transcription of the RNA molecule and subsequent RNA
transcription of the resulting cDNA molecule, the fourth nucleotide
sequence of the reverse transcription primer becomes the first
nucleotide sequence at the 3' end of the sRNA molecule.
[0018] Applicants have also invented kits for the synthesis of
asRNA molecules directly from sRNA molecules, wherein a partial RNA
polymerase recognition sequence at the 3' ends of sRNA molecules is
converted into a complete RNA polymerase recognition sequence and
ultimately into a double stranded RNA polymerase promoter.
[0019] Accordingly, another aspect of the present invention is
directed to a kit for synthesizing one or more asRNA molecules
directly from a sRNA molecule, comprising: one or more primers
comprising a nucleotide sequence corresponding to at least a
portion of the 5' end of the non-template strand of an RNA
polymerase recognition sequence; and instructional materials for
synthesizing asRNA molecules directly from sRNA molecules using
said primer. In some embodiments, the kit further comprises
reagents and instructional materials for synthesizing sRNA
molecules from which asRNA molecules can be directly
synthesized.
BRIEF DESCRIPTION OF THE DRAWINGS
[0020] Other objects and features of the present invention will
become apparent from the following detailed description considered
in connection with the accompanying drawings. It is to be
understood, however, that the drawings are designed as an
illustration only and not as a definition of the limits of the
invention.
[0021] FIGS. 1a-i is a schematic representation that depicts an
embodiment for synthesis of sRNA molecules according to the methods
of the present invention;
[0022] FIGS. 2a-d is a schematic representation that depicts an
embodiment for synthesis of asRNA molecules directly from sRNA
molecules according to the methods of the present invention;
and
[0023] FIG. 3 is a photograph that depicts sRNA and as RNA produced
by the methods of the prsent invention visualized on a 1% agarose
gel stained with ethidium bromide.
DETAILED DESCRIPTION OF THE INVENTION
[0024] The methods of the present invention utilize routine
techniques in the field of molecular biology. Basic texts
disclosing general molecular biology methods include Sambrook et
al., Molecular Cloning, A Laboratory Manual (3d ed. 2001) and
Ausubel et al., Current Protocols in Molecular Biology (1994).
[0025] The present invention relates to methods and kits for
amplifying nucleic acid molecules. The terms "nucleic acid
molecule", "RNA molecule", "sRNA molecule", "asRNA molecule", "aRNA
molecule, "cRNA molecule", "DNA molecule", and "cDNA molecule" are
each intended to cover a single molecule, a plurality of molecules
of a single species, and a plurality of molecules of different
species.
[0026] The methods of the present invention generally comprise
converting a partial RNA polymerase recognition sequence at the 3'
ends of sRNA molecules into a complete RNA polymerase recognition
sequence and ultimately into a double stranded RNA polymerase
promoter. Subsequent RNA transcription using an RNA polymerase that
recognizes the double stranded RNA polymerase promoter results in
the production of amplified asRNA molecules. Such asRNA molecules
find utility in various downstream applications, including gene
expression studies involving nucleic acid microarrays. The methods
of present invention are particularly suited for amplification of
RNA from small numbers of cells, including single cells, which can
be purified from complex cellular samples using, e.g.,
micromanipulation, fluorescence-activated cell sorting (FACS) and
laser microdissection techniques (see Player et al., Expert Rev.
Mol. Diagn. 4:831 (2004)).
[0027] The term "RNA polymerase recognition sequence" is intended
to cover both single stranded and double stranded nucleotide
sequences. When in single stranded form, the nucleotide sequence
corresponds to the template or non-template strand of a
double-stranded RNA polymerase promoter. "Template strand" refers
to a strand of nucleic acid on which a complementary copy is
synthesized from nucleotides or nucleotide analogs through the
activity of a template-dependent nucleic acid polymerase.
"Non-template strand" refers to the nucleic acid strand that is
complimentary to the template strand. When in double stranded form,
the nucleotide sequences correspond to both the template and
non-template strands of a double-stranded RNA polymerase
promoter.
[0028] Any method for producing sRNA molecules can be used as the
source of such molecules in the methods of the present invention,
so long as their 3' ends comprise a nucleotide sequence
corresponding to the partial 5' end of the template strand of a RNA
polymerase recognition sequence. For example, the sRNA molecules
can be produced by in vitro transcription of cDNA molecules
containing one or more RNA polymerase promoters at their 3' ends.
Such methods include those disclosed in Applicants' copending
patent applications U.S. patent Ser. Nos. 10/979,052, 11/150,794
and 11/210,602, and International Application No.
PCT/US2004/014325, as well as in U.S. patent application Ser. Nos.
10/805,171, 10/302,675, 10/206,613 and 10/075,335 (each of which is
specifically incorporated herein by reference in its entirety).
Commercial kits are also available for the production of sRNA
molecules, such as, e.g., the SMART.TM. mRNA Amplification Kit
(Clontech, Mountain View, Calif.) and the ArrayIt MiniAmp mRNA
Amplification Kit (ArrayIt, Sunnyvale, Calif.).
[0029] To ensure that the 3' ends of the sRNA molecules comprise a
nucleotide sequence corresponding to the partial 5' end of the
template strand of a RNA polymerase recognition sequence, the cDNA
molecules are provided by reverse transcription of an RNA molecule
of interest with a primer having a 5' extension comprising a
nucleotide sequence corresponding to the partial 3' end of the
non-template strand of the RNA polymerase recognition sequence. The
length of the 5' extension generally ranges from about 2 to about
19 nucleotides in length, preferably from about 8 to about 12
nucleotides in length.
[0030] Upon reverse transcription of the RNA molecule of interest
and subsequent in vitro transcription of the resulting cDNA
molecule, the nucleotide sequence of the primer extension is
converted into the 3' nucleotide sequence of the sRNA molecule
corresponding to the partial 5' end of the template strand of the
RNA polymerase recognition sequence. Any RNA polymerase recognition
sequence can be used in the methods described herein, so long as it
is specifically recognized by an RNA polymerase. Preferably, the
RNA polymerase recognition sequence used is recognized by a
bacteriophage RNA polymerase, such as T7, T3, or SP6 RNA
polymerase. An exemplary T7 RNA polymerase recognition sequence is
TAATACGACTCACTATAGGG (SEQ ID NO: 1). An exemplary T3 RNA polymerase
recognition sequence is AATTAACCCTCACTAAAGGG (SEQ ID NO: 2). An
exemplary SP6 RNA polymerase recognition sequence is
AATTTAAGGTGACACTATAGAA (SEQ ID NO: 3).
[0031] For example, with reference to FIG. 1 (an embodiment
previously described in Applicants' copending U.S. patent
application Ser. No. 11/210,602, specifically incorporated herein
by reference in its entirety), RNA molecules (e.g., mRNA, hnRNA,
rRNA, tRNA, miRNA, snoRNA, non-coding RNAs) from a source of
interest are reversed transcribed into cDNA molecules using a
primer having the required 5' extension (in the case of FIG. 1, the
partial 5' end of the template strand of the T7 promoter) (see FIG.
1a). The RNA may be obtained from any tissue or cell source,
including virion, prokaryotic, and eukaryotic sources found in any
biological or environmental sample. Preferably, the source is
eukaryotic tissue, more preferably mammalian tissue, even more
preferably human tissue.
[0032] Any reverse transcriptase can be used in the reverse
transcription reaction, including thermostable and RNase H.sup.-
reverse transcriptases. Preferably, a RNase H.sup.- reverse
trancriptase is used. Numerous methods and commercial kits for the
synthesis of cDNA molecules are well known in the art. Examples
include the Superscript.TM. Double Strand cDNA Synthesis kit
(Invitrogen, Carlsbad, Calif.), the Array 50.TM., Array 35.TM. and
Array 900.TM. Detection kits (Genisphere, Hatfield, Pa.), and the
CyScribe.TM. Post-Labelling kit (Amersham, Piscataway, N.J.).
[0033] Suitable reverse transcription primers containing the
required 5' extension include single stranded oligodeoxynucleotides
comprising an oligodT tail at their 3' ends, the tail generally
ranging from about 10 to about 30 nucleotides in length, preferably
from about 17 to about 24 nucleotides in length, which anneal to
RNA containing a 3' polyA tail (e.g., mRNA). If the RNA of interest
does not naturally contain a 3' polyA tail (e.g., miRNA), a polyA
tail can be attached to the RNA molecules using poly(A) polymerase
(PAP) in the presence of ATP. PolyA tailing kits are commercially
available and include, e.g., the Poly(A) Tailing Kit (Ambion,
Austin, Tex.). Three-primer blocked RNAs can be enzymatically
treated to allow tailing using, e.g., calf intestinal alkaline
phosphatase or RNase 3.
[0034] Alternatively, the reverse transcription reaction can be
initiated using a random primer having the required 5' extension,
the random nucleotide portion generally ranging from about 4 to
about 20 nucleotides in length, preferably from about 6 to about 9
nucleotides in length, which anneals to various positions along the
length of each original mRNA transcript. One of ordinary skill in
the art will recognize that the use of a random primer can
ultimately result in the production of sRNA molecules that are
better representative of the entire length of each original mRNA
transcript than those produced using an oligodT primer.
Additionally, the use of a random primer to generate cDNA in the
initial steps of the disclosed methods means that RNA that would
normally be exempt from amplification, such as degraded RNA or RNA
derived from bacteria, can be used to produce amplified sRNA
molecules.
[0035] In some embodiments, the 3' terminal nucleotide of the
reverse transcription primer (oligodT primer, random primer, or
both) is a nucleotide or nucleotide analog that is not a substrate
for terminal deoxynucleotide transferase but can be extended by
reverse transcriptase, such as a ribonucleotide. Such primers are
not extendable with terminal deoxynucleotidyl transferase (TdT),
and thus will not be tailed and amplified in the steps shown in
FIGS. 1b-1f.
[0036] Following first strand cDNA synthesis, the resulting first
round cDNA molecules are generally purified (see FIG. 1b). While
not degrading the RNA prior to cDNA purification is preferred, cDNA
that has been purified following RNA degradation works equally well
in the methods of the present invention. Any method that degrades
RNA can be used, such as treatment with NaOH or RNase H (whether
supplied in the form of a RNase H.sup.+ reverse transcriptase or as
a separate enzyme). Alternatively, the RNA can be left intact, with
the first round cDNA molecules purified from RNA/cDNA duplexes.
Numerous methods and kits exist for the purification of DNA
molecules, including, e.g., the MinElute.TM. PCR Purification Kit
(Qiagen, Valencia, Calif.). If a reverse transcription primer is
used for first strand cDNA synthesis in which the 3' terminal
nucleotide is a ribonucleotide, DNA purification can be omitted.
This may reduce sample loss and increase amplification yield, which
is particularly important when manipulating RNA from small numbers
of cells.
[0037] Following first round cDNA purification, a single stranded
oligodeoxynucleotide tail is generally attached to the 3' end of
the cDNA molecules (see FIG. 1b). The use of such
oligodeoxynucleotide tails allows whole populations of nucleic acid
molecules to be amplified, rather than just specific sequences. The
oligodeoxynucleotide tail can be incorporated by any means that
attaches deoxynucleotides to DNA. Preferably, the
oligodeoxynucleotide tail is attached to the cDNA using terminal
deoxynucleotidyl transferase, or other suitable enzyme, in the
presence of appropriate deoxynucleotides. Preferably, the
oligodeoxynucleotide tail is a homopolymeric tail (i.e., polydA,
polydG, polydC, or polydT). Preferably, the oligodeoxynucleotide
tail is a polydA tail, generally ranging from about 3 to greater
than 500 nucleotides in length, preferably from about 20 to about
100 nucleotides in length. Applicants have found that the use of a
polydA tail reduces the number of artifacts resulting from
non-specific amplification.
[0038] Following attachment of the single stranded oligonucleotide
tail to the 31 ends of the cDNA molecules, a single stranded
RNA/DNA composite bridge oligonucleotide comprising a 5' RNA
portion and a 3' DNA portion is annealed to the 3'
oligodeoxynucleotide tail (see FIG. 1c). This is accomplished
through complementary base pairing between the 3'
oligodeoxynucleotide tail and at least a portion of the 3' DNA
portion of the RNA/DNA composite bridge oligonucleotide. For
example, if oligonucleotide tail is a polydA tail, the 3' DNA
portion of the RNA/DNA composite bridge oligonucleotide will
contain a series of thymidines at its 3' end, generally ranging
from about 3 to greater than 50 nucleotides in length, preferably
from about 10 to about 30 nucleotides in length. The particular
deoxynucleotide sequence of the 3' DNA portion of the RNA/DNA
composite bridge oligonucleotide does not have to be perfectly
complementary to the particular nucleotide sequence of the
oligodeoxynucleotide tail at the 3' ends of the cDNA molecules, nor
do their lengths need to match exactly, for the sequences to be
considered complementary to each other. Those of skill in the art
will recognize that what is required is that there be sufficient
complementarity between the two sequences so that the RNA/DNA
composite bridge oligonucleotide can anneal to the
oligodeoxynucleotide tail at the 3' end of the cDNA molecules.
[0039] In some embodiments, rather than attaching a single stranded
oligodeoxynucleotide tail to the 3' ends of the cDNA molecules, a
single stranded RNA/DNA composite bridge oligonucleotide in which
the DNA portion comprises random nucleotides is annealed to the
cDNA molecules. Again, the use of such a random composite bridge
oligonucleotide allows whole populations of nucleic acid molecules
to be amplified, rather than just specific sequences. The random
DNA portion of the composite oligonucleotide generally ranges from
about 3 to greater than 50 nucleotides in length, preferably from
about 6 to about 20 nucleotides in length. Only those bridge
oligonucleotides that hybridize to the 3' ends of the cDNA
molecules will result in the synthesis of functional RNA polymerase
promoters as described below. Hybridization is preferably performed
at about 37.degree. C. to about 55.degree. C., more preferably at
45.degree. C. to about 50.degree. C.
[0040] In addition to the 3' DNA portion (whether random or
defined), the composite bridge oligonucleotide contains a 5' RNA
portion which remains single stranded (i.e., unannealed) following
the annealing of the 3' DNA portion of the composite bridge
oligonucleotide to the 3' oligodeoxynucleotide tail. The 5' RNA
portion generally ranges from about 3 to greater than 50
nucleotides in length, preferably from about 10 to about 30
nucleotides in length. Preferably, the particular sequence of the
5' RNA portion is not substantially homologous to any known nucleic
acid sequence, nor is it substantially self-complementary or
complementary to any portion of the single stranded RNA polymerase
promoter template described below.
[0041] The RNA/DNA composite bridge oligonucleotide can be blocked
at its 3' end if desired, such that it is not extendable with a DNA
polymerase (see FIG. 1c). As such, the addition of reverse
transcriptase with both RNA-dependent and DNA-dependent DNA
polymerase activity (e.g., MMLV reverse transcriptase, AMV reverse
transcriptase, RBst DNA polymerase (Epicentre Technologies,
Madison, Wis.)) and dNTPs extends the single stranded 3'
oligonucleotide tail at the 3' ends of the cDNA molecules such that
the RNA portion of the bridge oligonucleotide becomes a double
stranded RNA/DNA duplex, but does not catalyze the synthesis of
second strand cDNA (see FIG. 1c). The RNA/DNA composite bridge
oligonucleotide can be blocked by any means that renders it
incapable of being extended with DNA polymerase, such as by
including terminal blocking groups, compounds, or moieties either
attached during or after synthesis. Preferably, the RNA/DNA
composite bridge oligonucleotide is blocked with a 3' amino
modifier, a 3' deoxyterminator, or a 3' dideoxyterminator. A
suitable blocker should not be restricted to any of those described
herein and can include any moiety that will prevent a DNA
polymerase from extending the 3' terminus of the RNA/DNA composite
bridge oligonucleotide.
[0042] Following extension of the 3' oligonucleotide tail to form a
RNA/DNA duplex, the RNA portion of the duplex (i.e., the RNA
portion of the bridge oligonucleotide) is degraded with RNase to
expose a 3' single stranded DNA tail on the cDNA molecules (see
FIG. 1d). Preferably, the RNase is RNase H, although other RNases,
such as RNase 1 and RNase A can be used. The RNase can be provided
as part of the reverse transcriptase or as a separate enzyme. The
RNase is preferably added at substantially the same time as the
reverse transcriptase and the bridge oligonucleotide (see FIG.
1c).
[0043] Following degradation of RNA portion of the RNA/DNA duplex,
a single stranded RNA polymerase promoter template is attached to
the exposed 3' single stranded DNA tail on the cDNA molecules (see
FIG. 1e). This is accomplished through complementary base pairing
between the exposed 3' single stranded DNA tail and a complementary
series of nucleotides present at the 3' end of the single stranded
promoter template, generally ranging from about 3 to greater than
50 nucleotides in length, preferably from about 10 to about 30
nucleotides in length.
[0044] The single stranded promoter template contains at its 5' end
at least one RNA polymerase recognition sequence. The promoter
template can be composed of RNA and/or DNA, and can be blocked or
unblocked at its 3' end. When composed of both RNA and DNA, the 3'
portion of the promoter template that hybridizes to the exposed DNA
tail on the cDNA molecules is preferably DNA, while the 5'
unhybridized portion is RNA. For performing multiple rounds of sRNA
synthesis, the promoter template preferably contains at least a
second different RNA polymerase recognition sequence 3' to the
first recognition sequence (i.e., a "tandem promoter template"; see
FIG. 1c) (see Applicants' co-pending U.S. patent application Ser.
No. 11/150,794, specifically incorporated herein by reference in
its entirety). Again, any RNA polymerase recognition sequence can
be used, so long as it is specifically recognized by an RNA
polymerase. Preferably, the RNA polymerase recognition sequence(s)
used is recognized by a bacteriophage RNA polymerase, such as T7,
T3, or SP6 RNA polymerase. The RNA polymerase promoter template is
preferably added at substantially the same time as the reverse
transcriptase, bridge oligonucleotide and RNase (e.g., in the same
reaction vessel) (see FIG. 1c), although each of the reactions can
be performed separately.
[0045] Following attachment, the reverse transcriptase from FIG.
1c, having DNA-dependant DNA polymerase activity, extends the
exposed 3' single stranded DNA tail on the cDNA molecules and
converts the single stranded promoter template into one or more
double stranded RNA polymerase promoters (in the case of FIG. 1, T7
and T3 promoters) (see FIG. 1e). Even unblocked promoter templates
are not extended during the reaction because reverse transcriptase
lacks 5' b3' exonuclease and strand displacement activities.
Alternatively, or in addition, to reverse transcriptase, a DNA
polymerase, such as T4 DNA polymerase, T7 DNA polymerase, or
Sequenase.TM. (USB Corporation, Cleveland, Ohio), all of which lack
5'43 3' exonuclease and strand displacement activities, can be used
to extend the exposed 3' single stranded DNA tail on the cDNA
molecules and convert the single stranded promoter template into a
double stranded RNA polymerase promoter. Klenow enzyme has even
been shown in the present system to convert the promoter template
into a RNA polymerase promoter without extending the template when
added near the end of the reverse transcriptase/RNase promoter
synthesis reaction(s) (e.g., about 5 min to about 15 min before the
completion of promoter synthesis). The use of such DNA polymerases
may prevent or correct incorporation errors associated with the use
of reverse transcriptase alone.
[0046] To further ensure that unblocked promoter templates are not
extended during the promoter synthesis reaction(s), a nucleotide
extension can be included at the 3' end of an unblocked single
stranded promoter template. This 3' terminal nucleotide extension,
downstream of the complementary 3' series of deoxynucleotides used
to attach the promoter template to the exposed 3' single stranded
DNA tail on the cDNA molecules, comprises a series of nucleotides
identical to the 5' end of the remaining DNA portion of bridge
oligonucleotide, generally ranging from about 3 to about 10
nucleotides in length. As such, the 3' extension, which would bind
to the cDNA molecules but for the presence of the remaining DNA
portion of bridge oligonucleotide, functions to prevent access to
the gap or nick present between the promoter template and the
remaining DNA portion of the bridge oligonucleotide during promoter
synthesis (see FIG. 1e). Thus, any potential strand displacement
during promoter synthesis is prevented as long as a DNA polymerase
incapable of degrading the 3' nucleotide extension is used in the
synthesis reactions(s) (e.g., Klenow exo.sup.-).
[0047] In some embodiments, rather than enzymatically synthesizing
a double stranded RNA polymerase promoter from a single stranded
promoter template, a double stranded RNA polymerase promoter having
a template strand and a non-template strand is attached to the 3'
ends of the first round cDNA molecules by DNA ligation (see
Applicant's co-pending International Patent Application No.
PCT/US2004/014325, specifically incorporated herein by reference in
its entirety). The double stranded RNA polymerase promoter contains
at its 5' end (relative to the non-template strand) at least one
RNA polymerase recognition sequence. For performing multiple rounds
of sRNA synthesis, the double stranded RNA polymerase promoter
preferably contains at least a second different RNA polymerase
recognition sequence 3' to the first recognition sequence (i.e., a
"tandem promoter template") (see Applicants' co-pending U.S. patent
application Ser. No. 11/150,794, specifically incorporated herein
by reference in its entirety). Attachment of the promoter is
facilitated by complementary base pairing between the exposed 3'
single stranded DNA tail on the cDNA molecules and an overhang
sequence at the 3' end of the non-template strand of the double
stranded RNA polymerase promoter that contains a complementary
series of nucleotides, generally ranging from about 3 to greater
than 50 nucleotides in length, preferably from about 10 to about 30
nucleotides in length. Once properly positioned, the double
stranded promoter is attached to the cDNA molecule by ligation of
the 5' end of the template strand of the promoter to the 3' end of
the exposed single stranded DNA tail. Any DNA ligase can be used in
the ligation reaction. Preferably, the DNA ligase is T4 DNA
ligase.
[0048] When performing a promoter synthesis reaction (see FIG. 1e),
second strand cDNA can be optionally synthesized by using a random
primer. The random primer will anneal at various positions along
the first strand cDNA and be extended by any DNA-dependant DNA
polymerase activity during promoter synthesis. The various second
strand cDNA fragments can be optionally ligated together to form a
single second strand cDNA molecule. Such second strand cDNA
molecules may stabilize (i.e., remove secondary and tertiary
structure) the first strand cDNA during in vitro transcription,
resulting in a higher yield of sRNA molecules.
[0049] Following synthesis or attachment of double stranded RNA
polymerase promoter, in vitro transcription is initiated by the
addition of ribonucleotides and a RNA polymerase that recognizes
the promoter (see FIG. 1f). This provides sRNA molecules having a
partial RNA polymerase recognition sequence at their 3' ends. If a
tandem promoter template was attached to the cDNA molecules (see
FIG. 1e), in vitro transcription is preferably initiated using a
RNA polymerase that recognizes the first 5' promoter (in the case
of FIG. 1, the T7 promoter) (see FIG. 1f). This facilitates second
round sRNA synthesis described in further detail below. Methods and
kits for performing in vitro transcription are well known in the
art and include the MEGAscript.TM. Transcription Kit (Ambion) and
the AmpliScribe.TM. High Yield Transcription Kits (Epicentre
Technologies).
[0050] Additional rounds of sRNA synthesis can be performed by
reverse transcribing the resulting first round sRNA molecules
(i.e., second round cDNA molecules) and re-attaching or
re-synthesizing a double stranded RNA polymerase promoter onto the
second-round cDNA molecules as just described (see FIGS. 1a-1e),
followed by a second round of in vitro transcription with RNA
polymerase.
[0051] If, however, a tandem promoter template was attached to the
first round cDNA molecules (see FIG. 1e), and in vitro
transcription initiated using a RNA polymerase that recognizes the
first 5' promoter (see FIG. 1f), additional rounds of sRNA
synthesis can be performed without the need for re-attachment or
re-synthesis of the double stranded RNA polymerase promoter (see
Applicants' co-pending U.S. patent application Ser. No. 11/150,794,
specifically incorporated herein by reference in its entirety).
[0052] Briefly, the first round sRNA molecules are subjected to a
second round of synthesis by first reverse transcribing the sRNA
molecules into first strand cDNA molecules (i.e. second round cDNA
synthesis) using a primer comprising a nucleotide sequence
complementary to the RNA polymerase recognition sequence at the 3'
ends of the first round sRNA molecules (i.e., "corresponding" to
the specific nucleotide sequence of the 5' extension of the reverse
transcription primer used for first round cDNA synthesis in the
step shown in FIG. 1a) (see FIG. 1g). This ensures that the second
round sRNA molecules also contain the same partial RNA polymerase
recognition sequence at their 3' ends as the first round sRNA
molecules.
[0053] Following second round cDNA synthesis, the RNA strand is
degraded using NaOH or preferably RNase H prior to optional
purification of the first strand cDNA molecules (see FIG. 1h).
Similarly, an RNase H.sup.+ reverse transcriptase can be used, such
as MMLV.
[0054] Following RNA degradation, a single stranded promoter
oligonucleotide complementary to the second different 3' RNA
polymerase recognition sequence is annealed to the second round
cDNA molecules through complementary base pairing (see FIG. 1h).
This base pairing forms a second RNA polymerase promoter, from
which a second round of in vitro transcription (i.e., second round
sRNA molecules) is initiated by the addition of ribonucleotides and
a RNA polymerase that recognizes the second promoter (in the case
of FIG. 1, the T3 promoter) (see FIG. 1i). This provides second
round sRNA molecules having a partial RNA polymerase recognition
sequence at their 3' ends. By incorporating additional different
RNA polymerase recognition sequences into the promoter template,
additional rounds of sRNA synthesis can be performed as described
(e.g., third round sRNA molecules, etc.). Further, by heat
inactivating all enzymes between steps or before addition of RNA
polymerase, using methods familiar to one skilled in the art,
linear, rather than exponential, amplification can be maintained.
Such linear amplification is better suited for various downstream
applications, such as gene expression studies.
[0055] In some embodiments, rather than inactivating the reverse
transcriptase following second round cDNA synthesis and annealing a
single stranded promoter oligonucleotide complementary to the
second different RNA polymerase recognition sequence, the RNA
strand is degraded using Rnase H and the tandem promoter is
regenerated by the binding of excess single stranded tandem
promoter template (from the first round) to the 3' ends of the
second round cDNA molecules and the DNA-dependent DNA polymerase
activity of the still-active reverse transcriptase (see Applicants'
co-pending U.S. patent application Ser. No. 11/150,794,
specifically incorporated herein by reference in its entirety). A
second round of in vitro transcription can then be initiated by the
addition of an RNA polymerase that recognizes either the first or
second promoter. Again, the reverse transcriptase is generally heat
inactivated just prior to addition of RNA polymerase to maintain
the linearity of the amplification. Those of skill in the art will
recognize that the single stranded promoter template in these
embodiments need not contain two RNA polymerase recognition
sequences in tandem. Rather, the promoter template can contain a
single RNA polymerase recognition sequence, which can be used in
place of the tandem promoter template to produce first and second
round sRNA molecules.
[0056] The sRNA molecules resulting from the above-described
processes (or any other suitable process) can then be converted
into templates for the direct synthesis of asRNA molecules by first
reverse transcribing them with a primer comprising a nucleotide
sequence corresponding to at least the 5' end of the non-template
strand of the RNA polymerase recognition sequence (see FIG. 2a).
The nucleotide sequence is of sufficient length to anneal to the
nucleotide sequence at the 3' ends of the sRNA molecules
corresponding to the partial 5' end of the template strand of the
RNA polymerase recognition sequence, preferably from about 2 to
about 19 nucleotides in length, preferably from about 8 to about 12
nucleotides in length.
[0057] Extension of the primer with reverse transcriptase produces
a double stranded RNA/DNA duplex, the DNA portion of which now
contains a nucleotide sequence corresponding to the complete
non-template strand of the RNA polymerase recognition sequence at
its 5' end (see FIG. 2a). At least the 3' portion of the RNA strand
of the RNA/DNA duplex is degraded (see FIG. 2b), thereby providing
at least a partially single stranded DNA molecule having a single
stranded 5' end comprising a nucleotide sequence corresponding to
the complete non-template strand of the RNA polymerase recognition
sequence.
[0058] The RNA strand of the RNA/DNA duplex can be substantially
completely degraded using a RNase enzyme separate from reverse
transcriptase, such as RNase H (see FIG. 2b). Addition of an
exogenous primer in the presence of a DNA polymerase produces a
double strand stranded DNA molecule such that the nucleotide
sequence at the 5' end of the first DNA strand corresponding to the
complete non-template strand of said RNA polymerase recognition
sequence is converted into a double stranded RNA polymerase
promoter (see FIG. 2c).
[0059] The exogenous primer will comprise a nucleotide sequence of
sufficient complementarity such that it anneals to the first DNA
strand, preferably to the 3' region of the first DNA strand. More
preferably, the exogenous primer anneals to the 3' most nucleotides
of the first DNA strand. This ensures that most or all of the
information present in each sRNA molecule or a particular sRNA
molecule is captured during second strand DNA synthesis.
[0060] The exogenous primer can comprise any nucleotide sequence as
long as it is complementary to a sequence of the first DNA strand
known to the end-user. This sequence can either be naturally
occurring or can be engineered by processes such as, e.g., those
described above. For example, if an RNA/DNA composite bridge
oligonucleotide was used as shown in FIG. 1c, the exogenous primer
can comprise a nucleotide sequence corresponding to the complement
of at least a portion of the DNA portion of the bridge
oligonucleotide, as shown in FIG. 2c. If a polydA tail was attached
to the cDNA molecules as shown in FIG. 1b (or in a similar method),
the exogenous primer can comprise a series of thymidines of
sufficient length to anneal to the first DNA strand in the step
shown in FIG. 2c. Alternatively, the exogenous primer can comprise
a naturally occurring gene-specific sequence, such that
gene-specific asRNA molecules can be produced by in vitro
transcription in the step shown in FIG. 2d.
[0061] In the in vitro transcription reaction, addition of
ribonucleotides and a RNA polymerase that recognizes the promoter
formed in the step shown in FIG. 2c results in the synthesis of
asRNA molecules directly from sRNA molecules (see FIG. 2d), thereby
providing an additional round of RNA amplification.
[0062] Alternatively, the RNA strand of the RNA/DNA duplex can be
partially degraded using a reverse transcriptase having RNAse
activity, such as, e.g., AMV reverse transcriptase or MMLV RNase
H.sup.+, without the addition of a separate RNase enzyme. In this
one-step embodiment, the RNase activity of the reverse
transcriptase degrades the RNA template strand essentially while
synthesizing the complementary cDNA strand, thereby leaving a
remaining portion of the RNA strand which can serve as a primer for
second strand DNA synthesis. Again, addition of ribonucleotides and
a RNA polymerase that recognizes the resulting promoter results in
the synthesis of asRNA molecules directly from sRNA molecules,
providing an additional round of RNA amplification.
[0063] The resulting asRNA molecules may represent up to a
billion-fold amplification of each target RNA and can be used
directly in gene expression studies. For example, the in vitro
transcription reaction (see FIG. 2d) can be performed in the
presence of detectably labeled nucleotides, such as fluorescently
labeled nucleotides, to produce directly labeled asRNA molecules.
Such nucleotides include nucleotides labeled with Cy3 and Cy5.
[0064] In alternative embodiments, the asRNA molecules are labeled
indirectly following their synthesis. For example, in vitro
transcription reaction can be performed in the presence amino allyl
nucleotides (e.g., amino allyl UTP), followed by coupling to a NHS
ester label (e.g., biotin, Cy dye).
[0065] In some embodiments, labeled cDNA molecules are synthesized
rather than asRNA molecules. For example, the reverse transcription
reaction shown in FIG. 2a can be performed in the presence of
detectably labeled nucleotides, such as fluorescently labeled
nucleotides (e.g., Cy3 and Cy5 labeled nucleotides), to produce
directly labeled cDNA molecules, or the reaction can be performed
in the presence amino allyl nucleotides (e.g., amino allyl UTP),
followed by coupling to a NHS ester label (e.g., biotin, Cy dye),
to produce indirectly labeled cDNA molecules.
[0066] Alternatively, the reverse transcription primer used in FIG.
2a can comprise a capture nucleotide sequence at its 5' end in
addition to the nucleotide sequence necessary to anneal to the
nucleotide sequence at the 3' ends of the sRNA molecules. Any
defined nucleotide sequence can function as the capture nucleotide
sequence, generally ranging from about 10 to about 100 nucleotides
in length, preferably from about 25 to about 35 nucleotides in
length. Preferably, the capture nucleotide sequence shares no
significant homology with any known gene sequence.
[0067] The capture nucleotide sequence becomes incorporated into
the cDNA molecules during the reverse transcription reaction shown
in FIG. 2a. The resulting capture nucleotide sequence-containing
cDNA molecules can be labeled indirectly using, e.g., 3DNA.TM.
dendrimer technology (Genisphere, Hatfield, PA). The surfaces of
these dendrimers comprise multiple nucleotide sequences
complementary to the capture nucleotide sequence, as well as
multiple attachment sites for labeled (e.g., Cy dye)
oligonucleotides. Such dendritic nucleic acid reagents are further
described in Nilsen et al., J. Theor. Biol., 187:273 (1997); Stears
et al., Physiol. Genomics, 3:93 (2000); and U.S. Pat. Nos.
5,175,270; 5,484,904; 5,487,973; 6,072,043; 6,110,687; and
6,117,631, each of which is specifically incorporated herein by
reference in its entirety.
[0068] The labeled asRNA and cDNA molecules are useful as reagents
for gene expression studies. The labeled molecules can be annealed
to a nucleic acid microarray containing complementary
polynucleotides (e.g., probes). As used herein, "microarray" is
intended to include any solid support containing nucleic acid
probes, including slides, chips, membranes, beads, and microtiter
plates. Examples of commercially available microarrays include the
GeneChip.RTM. microarray (Affymetrix, Santa Clara, Calif.),
CodeLink.TM. microarray (Amersham Biosciences, Piscataway, N.J.),
Agilent (Palo Alto, Calif.) Oligo microarray, and OciChip.TM.
microarray (Ocimum Biosolutions, Indianapolis, Ind.). If the asRNA
and cDNA molecules are labeled indirectly, they can be labeled
either prior to or following microarray hybridization.
[0069] The methods and compositions of the present invention can be
conveniently packaged in kit form. Such kits can be used in various
research and diagnostic applications. For example, methods and kits
of the present invention can be used to facilitate a comparative
analysis of expression of one or more genes in different cells or
tissues, different subpopulations of the same cells or tissues,
different physiological states of the same cells or tissue,
different developmental stages of the same cells or tissue, or
different cell populations of the same tissue. Such analyses can
reveal statistically significant differences in the levels of gene
expression, which, depending on the cells or tissues analyzed, can
then be used to facilitate diagnosis of various disease states.
[0070] A wide variety of kits may be prepared according to present
invention. For example, a kit may include one or more primers
comprising a nucleotide sequence corresponding to at least a
portion of the 5' end of the non-template strand of a RNA
polymerase recognition sequence; and instructional materials for
synthesizing asRNA molecules directly from sRNA molecules using
said primer.
[0071] In addition, or alternatively, the kit can include reagents
and instructional materials for synthesizing sRNA molecules from
which asRNA molecules can be directly synthesized. For example, the
kit may include one or more reverse transcription primers having a
5' extension comprising a nucleotide sequence corresponding to the
partial 3' end of the non-template strand of a RNA polymerase
recognition sequence; a single stranded promoter template
comprising at least one RNA polymerase recognition sequence; a
single stranded RNA/DNA composite bridge oligonucleotide comprising
a RNA sequence 5' of a DNA sequence; and instructional materials
for synthesizing sRNA molecules from which asRNA molecules can be
directly synthesized.
[0072] For performing additional rounds of sRNA synthesis, the kit
can further include one or more second round reverse transcription
primers comprising a nucleotide sequence corresponding to the
nucleotide sequence of the 5' extension of a first round reverse
transcription primer or primers; and a single stranded promoter
oligonucleotide complementary to a second RNA polymerase
recognition sequence of the promoter template and the appropriate
instructional materials.
[0073] While the instructional materials typically comprise written
or printed materials, they are not limited to such. Any medium
capable of storing such instructions and communicating them to an
end user is contemplated by this invention. Such media include, but
are not limited to, electronic storage media (e.g., magnetic discs,
tapes, cartridges, chips), optical media (e.g., CD ROM), and the
like. Such media may include addresses to internet sites that
provide such instructional materials.
[0074] The kits of the present invention may further include one or
more of the following components or reagents: one or more reverse
transcriptases (RNase H.sup.+ and/or RNase H.sup.-); an RNase
inhibitor (e.g., Superase-In.TM.); an RNase (e.g., RNase H); an
enzyme for attaching an oligodeoxynucleotide tail onto the 3' ends
of single stranded cDNA molecules (e.g., terminal deoxynucleotidyl
transferase); an enzyme for attaching an oligoribonucleotide tail
onto the 3' ends of RNA molecules (e.g., poly(A) polymerase); one
or more DNA-dependent DNA polymerases (e.g., Klenow enzyme); an
enzyme for ligating a double stranded RNA polymerase promoter onto
the 3' ends of single stranded DNA molecules (e.g., T4 DNA ligase);
one or more RNA-dependent RNA polymerases (e.g., T7 polymerase, T3
polymerase, SP6 polymerase); one or primers comprising a capture
nucleotide sequence; one or more second strand DNA synthesis
primers; dNTP mix (e.g., dATP, dCTP, dGTP, dTTP); dATP; NTP mix
(e.g., ATP, CTP, GTP, UTP); low UTP NTP mix; labeled nucleotides;
reaction buffers; salts; nuclease-free water; and/or containers,
vials, reaction tubes, and the like compatible with the synthesis
of asRNA molecules directly from sRNA molecules according to the
methods of the present invention. The components and reagents may
be provided in containers with suitable storage media.
[0075] Specific embodiments according the present invention will
now be described in the following examples. The examples are
illustrative only, and are not intended to limit the remainder of
the disclosure in any way.
EXAMPLES
Example 1
One Round of sRNA Synthesis Followed by asRNA Synthesis
1. First Strand cDNA Synthesis
[0076] For each RNA sample, purified using the RNAqueous.RTM. Kit
(Ambion), the following RNA/primer mix was prepared on ice: [0077]
1-8 .mu.l total RNA (not exceeding 2 ng) [0078] 2 .mu.l first round
oligodT sequence specific RT primer (50 ng/.mu.l) (5'-CTC ACT ATA
GGG TTT TTT TTT TTT TTT TTT V-3', where V.dbd.C, G or A
deoxyribonucleotides; SEQ ID NO: 4) [0079] 1 .mu.l first round
random sequence specific RT primer (2.times. by mass of RNA)
(5'-CTC ACT ATA GGG NNN NNN NNN-3, where N=A, G, C or T
deoxyribonucleotides at random; SEQ ID NO: 5) [0080] RNase-free
water to 11 .mu.l
[0081] The first round RT primers have a 5' extension comprising a
nucleotide sequence corresponding to the partial 3' end of the
non-template strand of the T7 promoter. The RNA/primer mixture was
heated at 80.degree. C. for 10 minutes and immediately cooled on
ice for 1-2 min. The mixture was then mixed with 9 .mu.l of a
Master Mixture solution to bring the final volume to 20 .mu.l
containing 1.times. RT buffer (50 mM Tris-HCl (pH 8.3), 75 mM KCl,
3 mM MgCl.sub.2), 10 mM dithiothreitol (DTT), 0.5 mM each dNTP, 10
U Superase-In.TM. (Ambion), and 200 U Superscript.TM. II reverse
transcriptase (Invitrogen). The mixture was briefly centrifuged and
incubated at 42.degree. C. for 2 hrs. Following a brief
centrifugation, the reaction was adjusted to 100 .mu.l with
1.times. TE (10 mM Tris-HCl, pH 8.0, 1 mM EDTA).
2. cDNA Purification
[0082] The reaction was purified using the MinElute.TM. PCR
Purification Kit (Qiagen) according to the manufacturer's protocol.
Briefly, the cDNA reaction was adjusted to 600 .mu.l with PB buffer
provided by the manufacturer. The cDNA reaction was applied to the
MinElute.TM. column and microfuged for 1 minute. The flow-through
in the collection tube was discarded, and the column washed with
750 .mu.l PE buffer provided by the manufacturer. The flow-through
in the collection tube was discarded, and the column washed with
500 .mu.l 80% ethanol. The flow-through in the collection tube was
discarded, and the column microfuged with the cap open for 5
minutes to dry the resin. The column was placed in a clean 1.5 ml
microfuge tube, and the column membrane incubated with 10 .mu.l EB
buffer provided by the manufacturer for 2 minutes at room
temperature. The first strand cDNA molecules were eluted by
microfugation for 2 minutes.
3. Tailing of First Strand cDNA
[0083] The first strand cDNA molecules were heated at 80.degree. C.
for 10 minutes and immediately cooled on ice for 1-2 min. The cDNA
molecules in 10 .mu.l were then mixed with 10 .mu.l of a Master
Mixture solution to bring the final volume to 20 .mu.l containing
1.times. Tailing buffer (10 mM Tris-HCl, pH 7.0, 10 mM MgCl.sub.2),
0.04 mM dATP, and 15 U terminal deoxynucleotidyl transferase (Roche
Diagnostics, Indianapolis Ind.). The mixture was briefly
centrifuged and incubated at 37.degree. C. for 2 min. The reaction
was stopped by heating at 80.degree. C. for 10 min and cooled at
room temperature for 1-2 minutes.4. T7/T3 Promoter Synthesis
[0084] One .mu.l of T7/T3 RNA polymerase promoter template
oligonucleotide (5'-TAA TAC GAC TCA CTA TAG GGA GAA ATT AAC CCT CAC
T-3'; SEQ ID NO: 6) (100 ng/.mu.l) and 1 .mu.l of RNA/DNA composite
bridge oligonucleotide (5'-rGrArA rArUrU rArArC rCrCrU rCrArC rUAA
AGG GAT TTT TTT TTT TTT T-3'; SEQ ID NO: 7) (100 ng/.mu.l)
containing a 3' amino modifier was added to the oligodA-tailed cDNA
molecules and the mixture incubated at 37.degree. C. for 10 min to
anneal the strands. The T7/T3 RNA polymerase promoter template
contains a T7 RNA polymerase promoter template 5' to a T3 RNA
polymerase recognition sequence. The tailed cDNA molecules/bridge
oligonucleotide/promoter template mixture was then mixed with 3
.mu.l of a Master Mixture solution to bring the final volume to 25
.mu.l containing 1.times. Polymerase buffer (10 mM Tris-HCl, pH
7.0, 10 mM MgCl.sub.2), 0.4 mM each dNTP, 200 U Superscript II
reverse transcriptase (Invitrogen) and 2 U RNase H (Invitrogen).
The mixture was briefly centrifuged and incubated at 37.degree. C.
for 30 minutes. The reaction was stopped by heating at 65.degree.
C. for 15 min and placed on ice.
5. T7 In Vitro Sense Transcription
[0085] One-half of the promoter synthesis reaction (12.5 .mu.l) was
heated at 37.degree. C. for 10-15 min to re-anneal the T7T3
promoter strands and then mixed with 12.5 .mu.l of a Master Mixture
solution to bring the final volume to 25 .mu.l containing 1.times.
Reaction buffer, 7.5 mM each rNTP, and 2 .mu.l T7 RNA polymerase
(MEGAscript.TM. Transcription Kit, Ambion). The mixture was briefly
centrifuged and incubated in a thermocycler with a heated lid at
37.degree. C. for 4-16 hrs. Alternatively, the mixture was
incubated in a 37.degree. C. heat block for 15 min, followed by
incubation in an air hybridization oven at 37.degree. for 4-16 hrs.
It is essential to avoid evaporation and condensation of the
reaction during this step.
6. Reverse Transcription of First Round sRNA
[0086] Fifty ng of sRNA in a volume of 4 .mu.l was mixed with 2
.mu.l of antisense RT primer (100 ng/.mu.l) (5'-CAT TAA TAC GAC TCA
CTA TAG G-3'; SEQ ID NO: 8) and heated at 80.degree. C. for 10 min.
The antisense RT primer comprises a nucleotide sequence
corresponding to the non-template strand of the T7 promoter and is
therefore of sufficient length to anneal to the nucleotide sequence
at the 3' ends of the sRNA molecules. The reaction was immediately
iced for 2 min, briefly centrifuged, and returned to ice. The
mixture was then mixed with 4 .mu.l of a Master Mixture solution to
bring the final volume to 10 .mu.l containing 1.times. RT buffer
(50 mM Tris-HCl (pH 8.3), 75 mM KCl, 3 mM MgCl.sub.2), 10 mM
dithiothreitol (DTT), 0.5 mM each dNTP, 10 U Superase-In.TM.
(Ambion), and 200 U MMLV reverse transcriptase (RNase H.sup.+)
(Promega). The mixture was briefly centrifuged and incubated at
42.degree. C. for 2 hrs. The reaction was stopped by heating at
80.degree. C. for 10 min and cooled at room temperature for 1-2
minutes.
T7 In Vitro Antisense Transcription
[0087] The reverse transcription reaction was heated to 37.degree.
C. for 10-15 min and then mixed with 14.5 .mu.l of a Master Mixture
solution to bring the final volume to 24.5 .mu.l containing
1.times. Reaction buffer, 7.5 mM each rNTP, and 2 .mu.l T7 RNA
polymerase (MEGAscript.TM. Transcription Kit, Ambion). The mixture
was briefly centrifuged and incubated in a thermocycler with a
heated lid at 37.degree. C. for 4-16 hrs. Alternatively, the
mixture was incubated in a 37.degree. C. heat block for 15 min,
followed by incubation in an air hybridization oven at 37.degree.
for 4-16 hrs. It is essential to avoid evaporation and condensation
of the reaction during this step.
[0088] Replicate amplifications were performed starting with 50 ng
of sRNA or water alone (negative control). On average, 25-30 .mu.g
of amplified asRNA was recovered after amplifying 50 ng of sRNA vs.
0.5-1 .mu.g of non-specific amplification product when using only
water in the reverse transcription reaction. Sense and antisense
RNAs were run on a 1% agarose gel to visualize the product size
(see FIG. 3, lanes 2 and 3). Generally, the products ranged in size
from about 0.1 to 4 kb, which reflects the normal size distribution
of mRNA.
Example 2
Two Rounds of sRNA Synthesis followed by asRNA Synthesis
1. First Strand cDNA Synthesis
[0089] For each RNA sample, purified using the RNAqueous.RTM. Kit
(Ambion), the following RNA/primer mix was prepared on ice: [0090]
1-8 .mu.l total RNA (not exceeding 2 ng) [0091] 2 .mu.l first round
oligodT sequence specific RT primer (50 ng/.mu.l) (5'-CTC ACT ATA
GGG TTT TTT TTT TTT TTT TTT V-3', where V.dbd.C, G or A
deoxyribonucleotides; SEQ ID NO: 4) [0092] 1 .mu.l first round
random sequence specific RT primer (2.times. by mass of RNA)
(5'-CTC ACT ATA GGG NNN NNN NNN-3, where N=A, G, C or T
deoxyribonucleotides at random; SEQ ID NO: 5) RNase-free water to
11 .mu.l
[0093] The first round RT primers have a 5' extension comprising a
nucleotide sequence corresponding to the partial 3' end of the
non-template strand of the T7 promoter. The RNA/primer mixture was
heated at 80.degree. C. for 10 minutes and immediately cooled on
ice for 1-2 min. The mixture was then mixed with 9 .mu.l of a
Master Mixture solution to bring the final volume to 20 .mu.l
containing 1.times. RT buffer (50 mM Tris-HCl (pH 8.3), 75 mM KCl,
3 mM MgCl.sub.2), 10 mM dithiothreitol (DTT), 0.5 mM each dNTP, 10
U Superase-In.TM. (Ambion), and 200 U Superscript.TM. II reverse
transcriptase (Invitrogen). The mixture was briefly centrifuged and
incubated at 42.degree. C. for 2 hrs. Following a brief
centrifugation, the reaction was adjusted to 100 .mu.l with
1.times. TE (10 mM Tris-HCl, pH 8.0, 1 mM EDTA).
2. cDNA Purification
[0094] The reaction was purified using the MinElute.TM. PCR
Purification Kit (Qiagen) according to the manufacturer's protocol.
Briefly, the cDNA reaction was adjusted to 600 .mu.l with PB buffer
provided by the manufacturer. The cDNA reaction was applied to the
MinElute.TM. column and microfuged for 1 minute. The flow-through
in the collection tube was discarded, and the column washed with
750 .mu.l PE buffer provided by the manufacturer. The flow-through
in the collection tube was discarded, and the column washed with
500 .mu.l 80% ethanol. The flow-through in the collection tube was
discarded, and the column microfuged with the cap open for 5
minutes to dry the resin. The column was placed in a clean 1.5 ml
microfuge tube, and the column membrane incubated with 10 .mu.l EB
buffer provided by the manufacturer for 2 minutes at room
temperature. The first strand cDNA molecules were eluted by
microfugation for 2 minutes.
3. Tailing of First Strand cDNA
[0095] The first strand cDNA molecules were heated at 80.degree. C.
for 10 minutes and immediately cooled on ice for 1-2 min. The cDNA
molecules in 10 .mu.l were then mixed with 10 .mu.l of a Master
Mixture solution to bring the final volume to 20 .mu.l containing
1.times. Tailing buffer (10 mM Tris-HCl, pH 7.0, 10 mM MgCl.sub.2),
0.04 mM dATP, and 15 U terminal deoxynucleotidyl transferase (Roche
Diagnostics). The mixture was briefly centrifuged and incubated at
37.degree. C. for 2 min. The reaction was stopped by heating at
80.degree. C. for 10 min and cooled at room temperature for 1-2
minutes.
4. T7/T3 Promoter Synthesis
[0096] One .mu.l of T7/T3 RNA polymerase promoter template
oligonucleotide (5'-TAA TAC GAC TCA CTA TAG GGA GAA ATT AAC CCT CAC
T-3'; SEQ ID NO: 6) (100 ng/.mu.l) and 1 .mu.l of RNA/DNA composite
bridge oligonucleotide (5'-rGrArA rArUrU rArArC rCrCrU rCrArC rUAA
AGG GAT TTT TTT TTT TTT T-3'; SEQ ID NO: 7) (100 ng/.mu.l)
containing a 3' amino modifier was added to the oligodA-tailed cDNA
molecules and the mixture incubated at 37.degree. C. for 10 min to
anneal the strands. The T7/T3 RNA polymerase promoter template
contains a T7 RNA polymerase promoter template 5' to a T3 RNA
polymerase recognition sequence. The tailed cDNA molecules/bridge
oligonucleotide/promoter template mixture was then mixed with 3
.mu.l of a Master Mixture solution to bring the final volume to 25
.mu.l containing 1.times. Polymerase buffer (10 mM Tris-HCl, pH
7.0, 10 mM MgCl.sub.2), 0.4 mM each dNTP, 200 U Superscript II
reverse transcriptase (Invitrogen) and 2 U RNase H (Invitrogen).
The mixture was briefly centrifuged and incubated at 37.degree. C.
for 30 minutes. The reaction was stopped by heating at 65.degree.
C. for 15 min and placed on ice.
5. T7 In Vitro Sense Transcription
[0097] One-half of the promoter synthesis reaction (12.5 .mu.l) was
heated at 37.degree. C. for 10-15 min to re-anneal the T7T3
promoter strands and then mixed with 12.5 .mu.l of a Master Mixture
solution to bring the final volume to 25 .mu.l containing 1.times.
Reaction buffer, 7.5 mM each rNTP, and 2 .mu.l T7 RNA polymerase
(MEGAscript.TM. Transcription Kit, Ambion). The mixture was briefly
centrifuged and incubated in a thermocycler with a heated lid at
37.degree. C. for 4-16 hrs. Alternatively, the mixture was
incubated in a 37.degree. C. heat block for 15 min, followed by
incubation in an air hybridization oven at 37.degree. for 4-16 hrs.
It is essential to avoid evaporation and condensation of the
reaction during this step.
6. Reverse Transcription of First Round sRNA
[0098] Twenty-five .mu.l of first round sRNA was-mixed with 1 .mu.l
second round RT primer (500 ng/.mu.l) (5'-CTC ACT ATA GG-3'; SEQ ID
NO: 9) and heated at 80.degree. C. for 10 min. The second round RT
primer contains a nucleotide sequence corresponding to the specific
nucleotide sequence of the 5' extension of the first round RT
primers. The reaction was immediately iced for 2 min, briefly
centrifuged, and returned to ice. One .mu.l dNTP mix (10 mM each)
and 1 .mu.l Superscript.TM. II reverse transcriptase (200 U/.mu.p;
Invitrogen) was added, and the RT reaction incubated at 42.degree.
C. for 1 hr. One .mu.l RNase H (2 U/.mu.l) (Invitrogen) was added,
and the reaction incubated at 37.degree. C. for 20 min. The
reaction was then incubated at 65.degree. C. to stop enzyme
activity.
7. T3 Promoter Formation
[0099] Two .mu.l of T3 promoter oligonucleotide (50 ng/.mu.l)
(5'-GAA ATT AAC CCT CAC TAA AGG G-3'; SEQ ID NO: 10) was added to
the second round cDNA reaction. The T3 oligonucleotide is
complementary to the T3 RNA polymerase recognition sequence of the
initial T7/T3 RNA polymerase promoter template. The reaction was
incubated at 37.degree. for 10 min to anneal the strands.
8. T3 In Vitro Sense Transcription
[0100] The T3 promoter synthesis reaction was mixed with 19 .mu.l
of a Master Mixture solution to bring the final volume to 25 .mu.l
containing 1.times. Reaction buffer, 7.5 mM each rNTP, and 2 .mu.l
T3 RNA polymerase (MEGAscript.TM. Transcription Kit, Ambion). The
mixture was briefly centrifuged and incubated in a thermocycler
with a heated lid at 37.degree. C. for 4-16 hrs. Alternatively, the
mixture was incubated in a 37.degree. C. heat block for 15 min,
followed by incubation in an air hybridization oven at 37.degree.
for 4-16 hrs. It is essential to avoid evaporation and condensation
of the reaction during this step.
9. sRNA Purification and Quantitation
[0101] The second round sRNA molecules were purified using the
RNeasy Kit (Qiagen) following manufacturer's protocol for RNA
cleanup. The purified sRNA molecules were eluted twice in 50 .mu.l
RNase-free water and quantified by UV-spectrophotometry in
0.1.times. TE Buffer, pH 8.0 at a wavelength ratio of 260/280.
10. Reverse Transcription of Second Round sRNA
[0102] Fifty ng of second round sRNA in a volume of 4 .mu.l was
mixed with 2 .mu.l of antisense RT primer (100 ng/.mu.l) (5'-CAT
TAA TAC GAC TCA CTA TAG G-3'; SEQ ID NO: 8) and heated at
80.degree. C. for 10 min. The antisense RT primer comprises a
nucleotide sequence corresponding to the non-template strand of the
T7 promoter and is therefore of sufficient length to anneal to the
nucleotide sequence at the 3' ends of the second round sRNA
molecules. The reaction was immediately iced for 2 min, briefly
centrifuged, and returned to ice. The mixture was then mixed with 4
.mu.l of a Master Mixture solution to bring the final volume to 10
.mu.l containing 1.times. RT buffer (50 mM Tris-HCl (pH 8.3), 75 mM
KCl, 3 mM MgCl.sub.2), 10 mM dithiothreitol (DTT), 0.5 mM each
dNTP, 10 U Superase-In.TM. (Ambion), and 200 U MMLV reverse
transcriptase (RNase H.sup.+) (Promega). The mixture was briefly
centrifuged and incubated at 42.degree. C. for 2 hrs. The reaction
was stopped by heating at 80.degree. C. for 10 min and cooled at
room temperature for 1-2 minutes.
11. T7 In Vitro Antisense Transcription
[0103] The reverse transcription reaction heated to 37.degree. C.
for 10-15 min and then mixed with 14.5 .mu.l of a Master Mixture
solution to bring the final volume to 24.5 .mu.l containing
1.times. Reaction buffer, 7.5 mM each rNTP, and 2 .mu.l T7 RNA
polymerase (MEGAscript Transcription Kit, Ambion). The mixture was
briefly centrifuged and incubated in a thermocycler with a heated
lid at 37.degree. C. for 4-16 hrs. Alternatively, the mixture was
incubated in a 37.degree. C. heat block for 15 min, followed by
incubation in an air hybridization oven at 37.degree. for 4-16 hrs.
It is essential to avoid evaporation and condensation of the
reaction during this step.
[0104] Replicate amplifications were performed starting with 50 ng
of sRNA or water alone (negative control). On average, 25-30 .mu.g
of amplified asRNA was recovered after amplifying 50 ng of sRNA vs.
0.5-1 .mu.g of non-specific amplification product when using only
water in the reverse transcription reaction. Sense and antisense
RNAs were run on a 1% agarose gel to visualize the product size
(see FIG. 3, lanes 4 and 5). Generally, the products ranged in size
from about 0.1 to 4 kb, which reflects the normal size distribution
of mRNA. This size range was maintained even after two rounds of
sRNA synthesis.
Example 3
[0105] A kit for performing one or more rounds of sRNA synthesis
followed by asRNA synthesis was assembled with the following
components: [0106] First round oligodT reverse transcription primer
having a 5' extension comprising a nucleotide sequence
corresponding to the partial 3' end of the non-template strand of
the T7 promoter (50 ng/.mu.l); [0107] First round random reverse
transcription primer having a 5' extension comprising a nucleotide
sequence corresponding to the partial 3' end of the non-template
strand of the T7 promoter (250 ng/.mu.l); [0108] 5.times. reverse
transcription buffer (250 mM Tris-HCl, pH 8.3, 375 mM KCl, 15 MM
MgCl.sub.2, 0.1 M DTT); [0109] dNTP mix (10 mM each dATP, dCTP,
dGTP, dTTP); [0110] Superase-In.TM. RNase Inhibitor (Ambion);
[0111] 0.2 mM dATP; [0112] 10.times. tailing buffer (100 mM
Tris-HCl, pH 7.0, 100 mM MgCl.sub.2); [0113] Terminal
deoxynucleotidyl transferase (7.5 U/.mu.l); [0114] RNA/DNA
composite bridge oligonucleotide (100 ng/.mu.l); [0115] T7/T3 RNA
polymerase promoter template (50 ng/.mu.l); [0116] NTP mix (ATP,
GTP, CTP, and UTP) (75 mM each); [0117] Low UTP NTP mix (75 mM ATP,
75 mM GTP, 75 mM CTP, and 25 mM UTP); [0118] 10.times. RNA
polymerase reaction buffer (Ambion); [0119] Second round reverse
transcription primer comprising a nucleotide sequence corresponding
to the specific nucleotide sequence of the 5' extension of the
first round reverse transcription primers (50 ng/.mu.l); [0120] T7
promoter oligonucleotide (50 ng/.mu.l); [0121] T3 promoter
oligonucleotide (50 ng/.mu.l); [0122] T7 enzyme mix (Ambion);
[0123] T3 enzyme mix (Ambion); [0124] RNase H (2 U/.mu.l); [0125]
Antisense reverse transcription primer comprising a nucleotide
sequence corresponding to the non-template strand of the T7
promoter (50 ng/.mu.l); [0126] MMLV reverse transcriptase RNase
H.sup.+ (Invitrogen); and [0127] Nuclease-free water.
[0128] The components were placed in numbered vials and placed in a
container with a printed instruction manual for multiple rounds of
sRNA synthesis using the kit components.
[0129] All publications cited in the specification, both patent
publications and non-patent publications, are indicative of the
level of skill of those skilled in the art to which this invention
pertains. All these publications are herein fully incorporated by
reference to the same extent as if each individual publication were
specifically and individually indicated as being incorporated by
reference.
[0130] Although the invention herein has been described with
reference to particular embodiments, it is to be understood that
these embodiments are merely illustrative of the principles and
applications of the present invention. It is therefore to be
understood that numerous modifications may be made to the
illustrative embodiments and that other arrangements may be devised
without departing from the spirit and scope of the present
invention as defined by the following claims.
* * * * *