U.S. patent application number 11/439440 was filed with the patent office on 2007-05-10 for small interfering rna mediated transcriptional gene silencing in mammalian cells.
This patent application is currently assigned to City of Hope. Invention is credited to Daniela Castanotto, Kevin V. Morris, Gerd Pfeiffer, John J. Rossi, Stella Tommasi.
Application Number | 20070104688 11/439440 |
Document ID | / |
Family ID | 46325536 |
Filed Date | 2007-05-10 |
United States Patent
Application |
20070104688 |
Kind Code |
A1 |
Rossi; John J. ; et
al. |
May 10, 2007 |
Small interfering RNA mediated transcriptional gene silencing in
mammalian cells
Abstract
The present invention relates to transcriptional gene silencing
(TGS) in mammalian, including human, cells that is mediated by
small interfering RNA (siRNA) molecules. The present invention also
relates to a method for directing histone and/or DNA methylation in
mammalian, including human, cells. It has been found that siRNAs
can be used to direct methylation of DNA in mammalian, including
human, cells.
Inventors: |
Rossi; John J.; (Alta Loma,
CA) ; Castanotto; Daniela; (Pasadena, CA) ;
Pfeiffer; Gerd; (Bradbury, CA) ; Tommasi; Stella;
(South Pasadena, CA) ; Morris; Kevin V.; (San
Diego, CA) |
Correspondence
Address: |
ROTHWELL, FIGG, ERNST & MANBECK, P.C.
1425 K STREET, N.W.
SUITE 800
WASHINGTON
DC
20005
US
|
Assignee: |
City of Hope
Duarte
CA
|
Family ID: |
46325536 |
Appl. No.: |
11/439440 |
Filed: |
May 24, 2006 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10776635 |
Feb 12, 2004 |
|
|
|
11439440 |
May 24, 2006 |
|
|
|
60447013 |
Feb 13, 2003 |
|
|
|
60683782 |
May 24, 2005 |
|
|
|
Current U.S.
Class: |
424/93.2 ;
424/450; 435/456; 435/458; 514/44A |
Current CPC
Class: |
C12N 2310/14 20130101;
C12N 2310/111 20130101; C12N 15/111 20130101; C12N 15/1135
20130101; C12N 2310/53 20130101; A61P 43/00 20180101; C12N 15/63
20130101 |
Class at
Publication: |
424/093.2 ;
514/044; 424/450; 435/456; 435/458 |
International
Class: |
A61K 48/00 20060101
A61K048/00; A61K 9/127 20060101 A61K009/127; C12N 15/86 20060101
C12N015/86; C12N 15/88 20060101 C12N015/88 |
Goverment Interests
[0002] This application was made with Government support under
Grant Nos. AI29329, AI42552, RO1 HL07470 and R01 HL83473 funded by
the National Institutes of Health Bethesda, Md. and under Grant No.
5P30 CA33572-21 funded by National Cancer Institute, Bethesda, Md.
The federal government may have certain rights in this invention.
Claims
1. A method of reducing gene expression of a target gene in a cell
comprising exposing said cell to an siRNA molecule which is
specific for a target sequence in the target gene, wherein the
siRNA molecule causes reduced gene expression.
2. The method of claim 1, wherein the siRNA molecule is directed to
the promoter region of the gene.
3. The method of claim 1, wherein the siRNA molecule binds to a
sequence within about 150 bp of the transcription start site.
4. The method of claim 1, wherein the antisense strand of the siRNA
molecule is specific for the target sequence.
5. The method of claim 1, wherein the siRNA molecule increases
methylation of histones associated with the target gene.
6. The method of claim 5, wherein the methylation of histones is
mediated by Ago1.
7. The method of claim 1, wherein the cell is a mammalian cell.
8. The method of claim 7, wherein the mammalian cell is a human
cell.
9. The method of claim 1, wherein said siRNA contains about 18-29
base pairs.
10. The method of claims 9, wherein said siRNA contains about 18-21
base pairs.
11. The method of claims 9, wherein said siRNA contains about 18-23
base pairs.
12. The method of claims 9, wherein said siRNA contains about 19-23
base pairs.
13. The method of claims 9, wherein said siRNA contains about 24-28
base pairs.
14. The method of claims 9, wherein said siRNA contains about 21-26
base pairs.
15. The method of claim 1, wherein the cell is exposed to the siRNA
by introducing into the cell DNA sequences encoding a sense strand
and a antisense strand of the siRNA, wherein the siRNA is expressed
in the cell.
16. The method of claim 15, wherein the introducing is accomplished
using at least one vector.
17. The method of claim 16, wherein the vector is a plasmid
vector.
18. The method of claim 16, wherein the vector is a viral
vector.
19. The method of claim 18, wherein the viral vector is a
retroviral vector, a lentiviral vector, or an adenoviral
vector.
20. The method of claim 16, wherein the vector is an
adeno-associated vector.
21. The method of claim 16, wherein the introducing takes place in
vivo.
22. The method of claim 16, wherein the introducing takes place in
vitro.
23. The method of claim 16, wherein the introducing is achieved via
transformation, transduction, transfection, or infection.
24. The method of claim 16, wherein said introducing is achieved
via a liposome.
25. The method of claim 16, wherein said introducing is achieved
via a liposome.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] The present application is a continuation-in-part of U.S.
patent application Ser. No. 10/776,635 filed 12 Feb. 2004. U.S.
patent application Ser. No. 10/776,635 is related to and claims
priority under 35 U.S.C. .sctn. 119(e) to U.S. provisional patent
application Ser. No. 60/447,013 filed 13 Feb. 2003. The present
application is further related to and claims priority under 35
U.S.C. .sctn. 119(e) to U.S. provisional patent application Ser.
No. 60/683,782 filed 24 May 2005. Each of these applications is
incorporated herein by reference.
BACKGROUND OF THE INVENTION
[0003] The present invention relates to transcriptional gene
silencing (TGS) in mammalian, including human, cells that is
mediated by small interfering RNA (siRNA) molecules. The present
invention also relates to a method for directing histone and/or DNA
methylation in mammalian, including human, cells. It has been found
that siRNAs can be used to direct methylation of DNA in mammalian,
including human, cells.
[0004] The publications and other materials used herein to
illuminate the background of the invention, and in particular,
cases to provide additional details respecting the practice, are
incorporated by reference, and for convenience are referenced in
the following text by author and date and are listed alphabetically
by author in the appended bibliography.
[0005] RNA interference (RNAi) is a process in which double
stranded RNA (ds RNA) induces the postranscriptional degradation of
homologous transcripts, and has been observed in a variety of
organisms including plants, fungi, insects, protozans, and mammals
(Moss et al., 2001; Bernstein et al., 2001; Elbashir, et al.,
2001a, 2001b). RNAi is initiated by exposing cells to dsRNA either
via transfection or endogenous expression. Double-stranded RNAs are
processed into 21 to 23 nucleotide (nt) fragments known as siRNA
(small interfering RNAs) (Elbashir et al., 2001a, 2001b). These
siRNAs form a complex known as the RNA Induced Silencing Complex or
RISC (Bernstein et al., 2001; Hammond et al. 2001), which functions
in homologous target RNA destruction. In mammalian systems, the
sequence specific RNAi effect can be observed by introduction of
siRNAs either via transfection or endogenous expression of 21-23
base transcripts or longer hairpin precursors. Use of siRNAs evades
the dsRNA induced interferon and PKR pathways that lead to
non-specific inhibition of gene expression. (Elbashir et al., 2001
a).
[0006] The discovery of siRNAs permitted RNAi to be used as an
experimental tool in higher eukaryotes. Typically, siRNAs are
chemically synthesized as 21mers with a central 19 bp duplex region
and symmetric 2-base 3'-overhangs on the termini. These duplexes
are transfected into cells lines, directly mimicking the products
made by Dicer in vivo. Most siRNA sequences can be administered to
cultured cells or to animals without eliciting an interferon
response (Heidel et la., 2004; Ma et al., 2005; Judge et al.,
2005). There are some reports that particular motifs can induce
such a response when delivered via lipids (Judge et al., 2005;
Sledz et al., 2003; Homung eta l., 2005), although a
cyclodextrin-containing polycation system has been shown to deliver
siRNA containing one such putative immunostimulatory motif that
achieves target gene down-regulation in mice without triggering an
interferon response (Hu-Lieskovan et al., 2005), even in a
disseminated tumor model.
[0007] It has been recently described that chemically synthesized
RNA duplexes of 25-30 base length can have as much as a 100-fold
increase in potency compared with 21mers at the same location. At
the site most extensively examined in this study, EGFPS1, only
minor differences in potency were seen between duplexes with blunt,
3'-overhang or 5'-overhang ends, and a blunt 27mer duplex was most
potent (Kim et al., 2005). Increased potency has similarly been
described for 29mer stem short hairpin RNAs (shRNAs) when compared
with 19mer stem hairpins (Siolas et al., 2005). While the primary
function of Dicer is generally thought to be cleavage of long
substrate dsRNAs into short siRNA products, Dicer also introduces
the cleaved siRNA duplexes into nascent RISC in Drosophila (Lee et
al., 2004); Pharm et al., 2004; Tomari et al., 2004). Dicer is
involved in RISC assembly and is itself part of the pre-RISC
complex (Sontheimer et al., 2005). The observed increased potency
obtained using longer RNAs in triggering RNAi is theorized to
result from providing Dicer with a substrate (27mer) instead of a
product (21mer) and that this improves the rate or efficiency of
entry of the siRNA duplex into RISC.
[0008] Not all 27mers show this kind of increased potency. It is
well known that shifting a 21mer siRNA by a few bases along the
mRNA sequence can change its potency by 10-fold or more (Holen et
al., 2002); Harborth et al., 2003; Reynolds et al., 2004).
Different products that result from dicing can have different
functional potency, and control of the dicing reaction may be
necessary to best utilize Dicer-substrate RNAs in RNAi. The EGFPS1
blunt 27mer studied in Kim et al. (2005) is diced into two distinct
21mers. Vermeulen and colleagues reported studies where synthetic
61mer duplex RNAs were digested using recombinant human Dicer in
vitro and examined for cut sites using a .sup.32P-end-labeled gel
assay system. Heterogeneous cleavage patterns were observed and the
presence of blunt versus 3'-overhang ends altered precise cleavage
sites (Vermeulen et al., 2005). Dicing patterns were studied at a
variety of sites using different duplex designs to see if cleavage
products could be predicted. It has been found that a wide variety
of dicing patterns can result from blunt 27mer duplexes. An
asymmetric duplex having a single 2-base 3'-overhang generally has
a more predictable and limited dicing pattern where a major
cleavage site is located 21-22 bases from the overhang. Including
DNA residues at the 3' end of the blunt side of an asymmetric
duplex further limits heterogeneity in dicing patterns and makes it
possible to design 27mer duplexes that result in predictable
products after dicing.
[0009] It has been found that position of the 3'-overhang
influences potency and asymmetric duplexes having a 3'-overhang on
the antisense strand are generally more potent than those with the
3'-overhang on the sense strand (Rose et al., 2005). This can be
attributed to asymmetrical strand loading into RISC, as the
opposite efficacy patterns are observed when targeting the
antisense transcript. Novel designs described here that incorporate
a combination of asymmetric 3'-overhang with DNA residues in the
blunt end offer a reliable approach to design Dicer-substrate RNA
duplexes for use in RNAi applications. See also U.S. published
application Nos. 2005/0244858 A1 and 2005/0277610 A1, each
incorporated herein by reference.
[0010] Recently, several groups have demonstrated that siRNAs can
be effectively transcribed by Pol III promoters in human cells and
elicit target specific mRNA degradation. (Lee et al., 2002;
Miyagishi et al., 2002; Paul et al., 2002; Brummelkamp et al.,
2002; Ketting et al., 2001). These siRNA encoding genes have been
transiently transfected into human cells using plasmid or episomal
viral backbones for delivery. Transient siRNA expression can be
useful for rapid phenotypic determinations preliminary to making
constructs designed to obtain long term siRNA expression. Of
particular interest is the fact that not all sites along a given
mRNA are equally sensitive to siRNA mediated downregulation.
(Elbashir et al., 2001 a; Lee et al., 2001; Yu et al., 2002; Holen
et al., 2002).
[0011] In contrast to post-transcriptional silencing involving
degradation of mRNA by short siRNAs, the use of long siRNAs to
methylate DNA has been shown to provide an alternate means of gene
silencing in plants. (Hamilton et al., 2002). In higher order
eukaryotes, DNA is methylated at cytosines located 5' to guanosine
in the CpG dinucleotide. This modification has important regulatory
effects on gene expression, especially when involving CpG-rich
areas known as CpG islands, located in the promoter regions of many
genes. While almost all gene-associated islands are protected from
methylation on autosomal chromosomes, extensive methylation of CpG
islands has been associated with transcriptional inactivation of
selected imprinted genes and genes on the inactive X-chromosomes of
females. Aberrant methylation of normally unmethylated CpG islands
has been documented as a relatively frequent event in immortalized
and transformed cells and has been associated with transcriptional
inactivation of defined tumor suppressor genes in human cancers. In
this last situation, promoter region hypermethylation stands as an
alternative to coding region mutations in eliminating tumor
suppression gene function. (Herman et al., 1996).
[0012] U.S. published application No. 2004/0096843 A1, incorporated
herein by reference, is directed to methods for producing
double-stranded, interfering RNA molecules in mammalian cells.
These methods overcome prior limitations to the use of siRNA as a
therapeutic agent in vertebrate cells, including the need for
short, highly defined RNAs to be delivered to target cells other
than through the use of synthetic, duplexed RNAs delivered
exogenously to cells. U.S. published application No. 2004/0091918
A1, incorporated herein by reference, is directed to methods and
kits for synthesis of siRNA expression kits.
[0013] Small interfering RNA (siRNA) mediated transcriptional gene
silencing (TGS) was first observed in doubly transformed tobacco
plants which exhibited a suppressed phenotype of the transformed
transgene. Careful analysis indicated that methylation of the
targeted gene was involved in the suppression(Matzke et al., 1989).
TGS mediated by dsRNAs was further substantiated in plants infected
with a cytoplasmic dsRNA virus; nuclear transgenes with promoters
homologous to sequences in the virus were found to be silenced
(Wassenegger et al., 1994; Wassenegger, 2000). siRNAs that target
promoter sequences have also been shown to cause TGS in the yeast
S. pombe and in Drosophila (Pal-Bhadra et al., 2002; Schramke and
Allshire, 2003). Transcriptional silencing by siRNA most likely
functions as a genome defense mechanisms that target chromatin
modifications to endogenous silent loci such as transposons and
repeated sequences (Seitz et al., 2003; Soifer et al., 2005). In
plants and yeast siRNA-induced silencing is accompanied by DNA
methylation of homologous sequences, de novo DNA methylation in
Arabidopsis thaliana requires siRNA metabolizing factors, and
maintenance of S. pombe centromeric heterochromatin depends on
siRNA-directed histone H3 lysine 9 methylation (Chan et al., 2004;
Jones et al., 2001; Mette et al., 2000; Volpe et al., 2002;
Zilberman et al., 2003).
[0014] While dsRNAs induce sequence-specific methylation of DNA in
plants and yeast, regulating gene expression at the transcriptional
level, it was not known until recently how applicable this
phenomenon was in mammalian cells. Recent reports have documented
that siRNAs targeted to 2 different genes, specifically the
promoter regions, can induce transcriptional silencing via histone
and DNA methylation in human cells (Morris et al., 2004b; Kawasaki
and Taira, 2004; Kawasaki et al., 2005). While these reports were
intriguing many questions regarding the underlying mechanism
remained.
[0015] It is desired to utilize this activity and to use siRNAs to
induce transcriptional gene silencing in cells.
SUMMARY OF THE INVENTION
[0016] The present invention relates to transcriptional gene
silencing (TGS) in mammalian, including human, cells that is
mediated by small interfering RNA (siRNA) molecules. The present
invention also relates to a method for directing histone and/or DNA
methylation in mammalian, including human, cells.
[0017] In one aspect of the invention, it has been found that
siRNAs can be used to direct methylation of histones and/or DNA in
mammalian, including human, cells.
[0018] In a second aspect of the invention, it has been found that
the antisense strand from siRNA directed against a promoter
sequence binds DNMT3A to induce histone H3 lysine-27 methylation
and transcriptional gene silencing in an RNA polymerase II
dependant manner.
[0019] In a third aspect of the invention, it has been found that
Argonaute 1 (Ago1) is required for siRNA mediated histone H3
lysine-9 di-methylation (H3K9.sup.me.sup.2+). It has also been
found that Ago1 associates with RNA polymerase II (RNAPII), and
that Ago1 and RNAPII co-localize to epigenetically silenced genomic
loci, suggesting the involvement of an RNA component that is
recognized by Ago1. Furthermore, the HIV-1 TAR RNA-binding protein
2 (TRBP2) is enriched at silenced promoters, along with histone H3
lysine-27 tri-methylation (H3K27.sup.me3+), a histone methyl-mark
that recruits the Polycomb group (PcG) repressor proteins. Thus, it
has been found that Ago1 is involved in the initiation and
spreading of siRNA mediated TGS, as well as transcriptional
silencing at facultative heterochromatin, linking the RNAi
machinery with RNAPII transcription and histone regulated control
of gene expression.
[0020] In accordance with these findings, the present invention
provides a method of reducing gene expression of a target gene
using an siRNA molecule. In one embodiment, the siRNA molecule
increases methylation of histones associated with the target gene.
In a second embodiment, the siRNA molecule is directed to the
promoter region of the gene. In a third embodiment, the siRNA
molecule binds to a sequence within about 150 bp of the
transcription start site.
[0021] In one aspect, the present invention provides a method for
TGS in a mammalian, including human, cell comprising exposing or
introducing into the cell a siRNA which is specific for a target
sequence in the promoter region of a gene to be silenced.
[0022] In another aspect, the present invention provides a method
for TGS in a mammalian, including human, cell comprising
introducing into the cell DNA sequences encoding a sense strand and
an antisense strand of an siRNA which is specific for a target
sequence in the promoter region of a gene to be silenced,
preferably under conditions permitting expression of the siRNA in
the cell, and wherein the siRNA induces histone modifications
characteristic of silent chromatin and/or methylation of the
gene.
[0023] In a further aspect, the present invention provides a method
for TGS in a mammalian, including human, cell comprising
introducing into the cell an siRNA molecule which is specific for a
target sequence in the promoter region of a gene to be silenced and
which interacts with Ago1 to direct transcriptional silencing of
the gene of interest.
[0024] In a still further aspect, the present invention provides
siRNA molecules, each comprising a sense strand and an antisense
strand, wherein the antisense strand has a sequence sufficiently
complementary to a promoter region of a gene of interest to direct
TGS of the gene of interest.
[0025] In another aspect, the present invention provides
pharmaceutical compositions containing the disclosed siRNA
molecules.
BRIEF DESCRIPTION OF THE FIGURES
[0026] FIGS. 1A-1D show a schematic representation of a polymerase
chain reaction (PCR) strategy used to yield U6 transcription
cassettes expressing siRNAs. The 5' PCR primer is complementary to
the 5' end of the U6 promoter and is standard for all PCR
reactions. FIG. 1A: The 3' PCR primer is complementary to sequences
at the 3' end of the U6 promoter and is followed by the sense or
antisense sequences, a stretch of four to six deoxyadenosines (Ter)
and an additional stuffer-Tag sequence. The adenosines are the
termination signal for the U6 Pol III promoter; therefore, any
sequence added after this signal will not be transcribed by the Pol
III polymerase and will not be part of the siRNA. FIG. 1B: The
sense and antisense sequences are linked by a 9 nt loop and are
inserted in the cassette by a two-step PCR reaction. FIG. 1C: The
sense and antisense sequences linked by a 9-nucleotide loop and
followed by the stretch of adenosines and by the Tag sequences are
included in a single 3' primer. FIG. 1D: Complete PCR expression
cassette obtained by the PCR reaction. To amplify and identify
functional siRNAs from the transfected cells, or to increase the
yield of the PCR product shown in D, a nested PCR can be performed
using the universal 5' U6 primer and a 3' primer complementary to
the Tag sequence, as indicated in the figure.
[0027] FIG. 2 shows the results of a methylation specific PCR (MSP)
analysis of the RASSF1A promoter in siRNA transfected cells.
[0028] FIG. 3 illustrates DNA sequences of the RASSF1A promoter
that became methylated in siRNA transfected cells.
[0029] FIG. 4 shows the results of RASSF1A intracellular expression
in stable clones and cell populations (siPR28) transfected with
specific shRNAs.
[0030] FIG. 5 shows the results of RASSF1A intracellular expression
in stable clones transfected with 28 nucleotides shRNAs.
[0031] FIG. 6 shows the results of RNA down-regulation by shRNA
directed against the RASSF1A promoter, as detected by transient
transfections and quantitative PCR.
[0032] FIGS. 7A-7B show siRNA induced histone methylation. FIG. 7A:
MPG transfected EF52 siRNA induces histone methylation. Histone 3
Lysine 9 (H3K9) di-methylation and histone 3 Lysine 27 (H3K27)
tri-methylation was determined from 293T cells transfected with
EF52 or the control CCR5 siRNAs (10 nM) using the nuclear specific
amphipathic peptide MPG (Morris et al., 1997). Forty-eight hours
post-transfection ChiP assays were performed specifically for the
EF1a promoter (Morris et al., 2004b). Results represent 2
independent experiments with standard deviations shown. FIG. 7B:
Nuclear specific delivery is required for Histone methylation. MPG
and Lipofectamine trasnsfection reagents were used to transfect
EF52-Cy3+ siRNAs into 293T cells. Forty eight hours following
transfection cultures were collected and a ChiP assay run. Results
of a single experiment are shown.
[0033] FIGS. 8A-8C show siRNA pulldown assays and their results.
FIG. 8A: Detection of flag-tagged DNMTs or HP1s bound to siRNA
EF52. Schematic methodology is shown for detecting biotin labeled
siRNA which are bound by flag-tagged DNMTs. FIG. 8B:
Co-immunoprecipitation ChiP/siRNA assay. Methodology for performing
a H3K9 or H3K27 ChiP followed by a biotin/avidin pulldown for
detecting siRNA EF52 associated with histone methyl marks (H3K9 or
H3K27). FIG. 8C: Triple immunoprecipitation assay. Methodology is
shown for performing first a ChiP for H3K27 followed by a
flag-immunoprecipitation followed by a biotin/avidin pulldown for
biotin labeled siRNA. The resultant elutes were utilized in PCR for
the targeted EF1A promoter.
[0034] FIGS. 9A-9E show the expression of the flagged proteins.
FIG. 9A Biotin labeled EF52 siRNAs pulldown DNMT3A. Whole cell
lysates from transfected 293T cells expressed detectable amounts of
all flag-tagged expressed DNMT proteins (Table 1) with the
exception of DNMT 3B1. FIG. 9B: Recombinant HP1 alpha and beta were
also expressed at appreciable levels in whole cell lysates while
HP1-gamma exhibiting a reduced expression. FIG. 9C: Following siRNA
EF52-Biotin incubation with whole cell extracts (A&B) and
subsequent pull-down (FIG. 8A) only DNMT 3A, 3A2 and 3B2 were
detectable while the control Mock, Prp2, and DNMT-1 (MT-1) were not
co-immunoprecipitated with the EF52 siRNA. FIG. 9D: Flag-tagged
DNMT1 and DNMT3A transfected 293T lysates (whole cell extracts,
refer to FIG. 8A) were generated and incubated with a total of 500
nM siRNA biotin labeled Sense (S), antisense (AS), or both sense
and antisense (S/AS), and the control sense and antisense without a
biotin label (-). FIG. 9E: Antisense and the Sense/Antisense siRNA
EF52 binds DNMT3A but not DNMT1.
[0035] FIG. 10 shows detection of the antisense strand in flag-tag
pulldowns. Flag-tagged DNMT3A and control (mock lysates alone) were
incubated with 500 nM of siRNA EF52 and bound siRNA detected by
binding of the radiolabelled probe to the respective target strand,
sense or antisense. Results are representative of a single
experiment.
[0036] FIG. 11A-11E show analysis of siRNA and H3K27. FIG. 11A:
Detection of antisense siRNA/H3K27 and targeted EF1A promoter as
one complex. Biotin labeled antisense siRNA EF52 co-precipitates
(.about.4.8 fold greater concentration relative to no antibody
control) with tri-methylated H3K27 in a ChiP/RNA
co-immunoprecipitation. FIG. 11B: Biotin labeled antisense siRNA
EF52 co-precipitates with H3K27, flag-tagged DNMT3A and the
targeted EF1A promoter. FIG. 11C: HIV-1 U3 specific antisense
siRNAs LTR-247 and LTR-362 suppress Tat induced luciferase
expression in TZM-B 1 cells. Results from a single experiment are
shown. FIG. 11D: Antisense siRNAs targeting the U3 region of the
HIV-1 LTR inhibit Tat mediated activation of fire fly luciferase in
1G5 cells. Results are from two independent experiments and
standard deviations are shown. FIG. 11E: Treatment of 293T cells
with alpha amanatin (0.05 .mu.g/ml) 24 hrs following transfection
with siRNA EF52 reduces H3K9 methylation .about.60% relative to no
antibody control to levels comparable to CCR5 siRNA transfected
cultures (not shown). Results from one experiment are shown.
[0037] FIG. 12 shows LTR specific siRNAs induce silencing of Tat
mediated expression of fire fly luciferase. HIV-1 U3 LTR specific
siRNAs (Table 2) targeting either subtype B or subtype c were
co-transfected with pCMV-Tat expression plasmid into TZM-B1 (Wei et
al., 2002) cells and luciferase expression determined 48 hrs later.
Results from two independent experiments are shown with standard
deviations.
[0038] FIG. 13 shows a model for siRNA mediated TGS in human cells
on the basis of the results up to this figure. SiRNAs are
introduced by nuclear specific MPG based transfection (Morris et
al., 2004b) into the target cells (1). Once inside the nucleus the
antisense strand of the siRNA (AS-siRNA) is bound by DNMT3A (data
not shown) (2). (DNMT3b may also bind siRNA)(Jeffery and Nakielny,
2004; K. V. data not shown). Next the AS-siRNA/DNMT3a complex may
interact directly or already be bound by HDACs and/or Suv39H1 (Fuks
et al., 2003; Fuks et al. 2001) (3). The AS-siRNA probably then
directs either the AS-siRNA/DNMT3A complex with or without the
HDACs and/or Suv39H1 to the targeted promoter region, possibly via
an interaction with a non-coding transcript that is associated with
the targeted chromatin (4) where HDAC can deacetylate the
respective histones (H3K9 and/or H3K27). The deacetylation of H3K9
and H3K27 would then permit histone methyltransferases such as
Suv39H1 to methylate H3K9 and possibly H3K27 resulting in initial
silencing of transcription (5). If the silencing is re-enforced the
gene may become methylated and permanently silenced.
[0039] FIG. 14 shows CCR5 promoter-targeted knockdown of GFP
expression. Suppression of CCR5 expressed GFP by promoter-specific
siRNAs at 48 hrs post-transfection. Error bars represent standard
deviations from n=3 independent experiments.
[0040] FIGS. 15A-15C show that synthetic siRNAs and expressed
shRNAs mediate transcriptional gene silencing of the CCR5 and
RASSF1A promoters. FIG. 15A: GFP mRNA expression in R61
(promoter-specific) or R5 (CCR5 mRNA-specific) control
siRNA-treated 293T CCR5-GFP cells, and RASSF1A mRNA expression in
HeLa cells stably expressing an shRNA (RASSF1A promoter-specific)
or control vector alone, as determined by real-time quantitative
RT-PCR (qRT-PCR) and normalized to GAPDH levels (at 24 hrs
post-siRNA transfection for GFP samples). Error bars represent
standard error of the mean (s.e.m.) for n=4 (GFP) and n=3 (RASSF1A)
independent samples, respectively. FIG. 15B: Chromatin
immunoprecipitation (ChIP) of the CCR5 promoter (at the R61 siRNA
target site or 100-300 bp downstream) using anti-H3K9.sup.me2+
antibody in extracts from R61 or R5 control siRNA-treated cells at
24 hrs post-siRNA transfection. Error bars represent s.e.m. for n=3
independent experiments. FIG. 15C: Time-course ChIP of the CCR5
promoter using anti-H3K9.sup.me2+ antibody in extracts from R61 or
R5 control siRNA-treated cells at 12 and 24 hrs post-siRNA
transfection.
[0041] FIG. 16 shows low levels of DNA methylation at targeted
promoters. DNA methylation at the R61 or R5 control siRNA-targeted
CCR5 promoter in 293T CCR5-GFP cells, and DNA methylation at the
endogenous RASSF1A promoter in HeLa stable cells expressing
promoter-specific shRNA or control vector, using an AvaI or
ApaI-based DNA methylation assay of the CCR5 and RASSF1A promoters,
respectively. Error bars represent standard error of the mean
(s.e.m.) for n=3 independent samples.
[0042] FIGS. 17A-17C show that Argonaute 1 protein associates with
the targeted CCR5 and RASSF1A promoters and RNA polymerase II. FIG.
17A: ChIP of the CCR5 promoter (at the R61 siRNA target site or
100-300 bp downstream) in extracts from 293T CCR5-GFP cells
transfected with R61 or R5 control siRNAs at 18 hrs post-siRNA
transfection, and ChIP of the endogenous RASSF1A promoter in
extracts from promoter shRNA-expressing or control
vector-expressing HeLa stable cells, using anti-Ago1 antibody.
Error bars represent s.e.m. for n=3 independent experiments. FIG.
17B: Time-course ChIP of the CCR5 promoter performed at 6 hr
intervals post-R61 or R5 control siRNA transfection. FIG. 17C:
Whole cell extracts (WCE) from 293T CCR5-GFP cells and anti-RNAPII
immunoprecipitates from RNase A untreated (-RNase A) or treated
(+RNase A) extracts, analyzed by western blot using anti-Ago1
antibody.
[0043] FIGS. 18A-18B Argonaute 2 does not associate with the siRNA
targeted CCR5 promoter. ChIP was performed using anti-Ago2 antibody
on the CCR5-GFP promoter in 293T CCR5-GFP cells transfected with
either R61 or R5 control siRNAs at 18 hrs post-siRNA transfection
(FIG. 18A) or on the endogenously silenced CCR5 promoter in HEK 293
cells using anti-Ago2 antibody or no antibody controls (FIG. 18B).
Error bars represent s.e.m. for n=3 independent experiments.
[0044] FIGS. 19A-19C show that Argonaute 1 is required for histone
methylation and transcriptional silencing. FIG. 19A: Whole cell
extracts (WCE) and extracts from 293T CCR5-GFP cells treated with
Ago1 mRNA-specific siRNA [Ago1(-)] at 48 hrs post-Ago1 siRNA
transfection and analyzed by western blotting using anti-Ago1
antibody. GFP was included as a loading control. FIG. 19B: 293T
CCR5-GFP cells transfected with R61 siRNA at 24 hrs post-R5 control
siRNA [Ago1(+)] or Ago1 siRNA [Ago1(-)] transfection, as determined
by qRT-PCR and normalized to GAPDH levels at 24 hrs post-R61 siRNA
transfection. Error bars represent s.e.m. for n=3 independent
samples. FIG. 19C: ChIP of the CCR5 promoter using anti-Ago1 or
anti-H3K9.sup.me2+ antibody in R61 or R5 control siRNA-treated
Ago1(-) 293T CCR5-GFP cells at 24 hrs post-R61 or R5 control siRNA
transfection and 48 hrs post-Ago1 siRNA transfection. Error bars
represent s.e.m. for n=3 independent experiments.
[0045] FIGS. 20A-20C show that Argonaute 1, RNA polymerase II,
H3K27.sup.me3+, and TRBP are enriched at the endogenously silenced
CCR5 promoter. ChIP of the endogenous CCR5 promoter in untreated
HEK 293 (FIG. 20A) and HeLa (FIG. 20B) cell extracts, using
anti-Ago1, anti-RNAPII, and anti-H3K27.sup.me3+ antibodies or no
antibody controls and normalized to input values. Error bars
represent s.e.m. for n=3 independent experiments. FIG. 20C: ChiP of
the endogenous RASSF1A promoter in extracts from promoter
shRNA-expressing or control vector-expressing HeLa stable cells,
and ChIP of the endogenous CCR5 promoter in HeLa cell extracts,
using anti-TRBP antiserum. Error bars represent s.e.m. for n=3
independent experiments.
[0046] FIG. 21 shows a model for the mechanism of Ago1 directed
TGS. The transcriptional silencing complex (TSC) may contain Ago1,
TRBP, siRNA, and histone methyltransferases EZH2 (H3K27.sup.me3+)
and G9a (H3K9.sup.me2+). The tri-methlation of H3K would
subsequently allow for the Polycomb group repressor complexes to
bind to H3K27.sup.me3+ and recruit DNMT3a, locking in an
epigenetically silent state. DNMT3a has also been shown to
co-immunoprecipitate with both the antisense strand of the siRNA
and the H.sub.3K27.sup.me3+ methyl-mark (Weinberg et al.,
2006).
[0047] FIG. 22 shows that Polycomb group protein EZH2 is enriched
at the RASSF1A and CCR5 promoters. ChIP of the endogenously
expressed RASSF1A promoter in extracts from promoter
shRNA-expressing or control vector-expressing HeLa stable cells,
and ChIP of the endogenously silenced CCR5 promoter in HeLa cell
extracts, using anti-EZH2 antibody. Error bars represent s.e.m. for
n=3 independent experiments.
[0048] FIG. 23 shows that Argonaute 1 is enriched at the Polycomb
group target MYT1 promoter. ChIP of the endogenous Polycomb group
target MYT1 promoter in untreated HeLa extracts, using anti-Ago1,
anti-EZH2, and anti-H3K27.sup.me3+ antibodies or no antibody
controls and normalized to input values. Error bars represent
s.e.m. for n=3 independent experiments.
DETAILED DESCRIPTION OF THE INVENTION
[0049] The present invention relates to transcriptional gene
silencing (TGS) in mammalian, including human, cells that is
mediated by small interfering RNA (siRNA) molecules. The present
invention also relates to a method for directing histone and/or DNA
methylation in mammalian, including human, cells.
[0050] Small interfering RNAs (siRNAs) silence genes at the
transcriptional and post-transcriptional level in human cells. As
shown herein siRNAs are able to direct transcription gene silencing
via a number of mechanisms including, but not limited to, the
methylation of human genes and/or associated histones in both the
promoter and coding regions of the gene. In addition, although
siRNA mediated transcriptional gene silencing (TGS) was recently
reported (Morris et al., 2004b) the mechanism remained relatively
unknown. As shown herein, we have expanded on this initial
observation to address the mechanism of siRNA mediated TGS by
screening the binding potential of DNA methyltransferases (DNMT) 1,
3A, 3A2, 3B1, 3B2, and heterochromatin proteins (HP1-alpha, beta,
and gamma) to the promoter targeted EF52 siRNAs. Interestingly,
DNMT3A, 3A2, 3B1 and 3B2 bound EF52 with DNMT3A displaying the most
robust binding. DNMT3A co-immunoprecipitated with the antisense
strand of the EF52 siRNA, the targeted EF1 alpha promoter, and the
corresponding silent state histone methyl mark. Moreover, the
induction of a silent state histone methylation mark by the EF52
siRNA was contingent on RNA polymerase II (Pol-II). The
functionality of the antisense strand to induce TGS was also
confirmed by targeting the U3 region of the promoter/LTR of HIV-1.
These data implicate a functional link between siRNA mediated
targeting of genomic regions (including promoters), DNA methylation
and DNA methyltransferases (DNMTs), and chromatin remodeling
complexes (Suv39H1 and HDACs) in human cells. Moreover, the
observations suggest that the antisense strand can induce TGS, this
interaction is via an antisense/DNA interaction and requires Pol-II
to putatively open up the targeted promoter and as such presents a
completely new methodology to transcriptionally silence Pol-II
promoter expressed genes.
[0051] In one aspect of the invention, design elements to promote
TGS are shown herein for the siRNA EF52 to the EF1A promoter which
was previously shown to induce transcriptional silence of the EF1A
promoter (Morris et al., 2004b). Previous studies have demonstrated
that transcriptional inhibition was associated with de novo DNA
methylation within the siRNA-targeted sequence, and was relieved
with the drugs 5'azacytidine (5'-AzaC) and trichostatin A (TSA),
inhibitors of DNA methylation and histone deacetylation
respectively. Notably, gene silencing required the siRNAs access to
the nucleus in order to down-regulate transcription. We demonstrate
here that siRNA induced histone methylation (Histone 3 Lysine 9 and
Histone 3 Lysine 27, H3K9 and H3K27, respectively) of the targeted
promoter is dependent on nuclear specific delivery of the EF52
siRNA, is the result of the antisense strand, and requires RNA
polymerase II. Moreover, we show direct evidence that siRNA EF52
binds DNMT3A in a strand specific manner and co-immunoprecipitated
not only with the flag-tagged DNMT3A but also the targeted promoter
in a H3K27 methyl-specific manner. The observations of strand
specific siRNA mediated TGS was substantiated by targeting the U3
region of the HIV-1 LTR/promoter.
[0052] In a second aspect of the invention, we describe the role of
Argonaute 1 (Ago1) in directing transcriptional silencing at both
the chemokine receptor CCR5 (HIV-1 co-receptor) and the tumor
suppressor RASSF1A promoters. Ago1 is required for siRNA mediated
histone H3 lysine-9 di-methylation (H3K9.sup.me2+) at the targeted
CCR5 promoter, and knockdown of Ago1 results in the loss of
H3K9.sup.me2+, disrupting the overall potency of TGS.
Co-immunoprecipitations indicate that Ago1 associates with RNA
polymerase II (RNAPII), and chromatin immunoprecipitations (ChiP)
of endogenously silenced CCR5 promoters show that Ago1 and RNAPII
co-localize to epigenetically silenced genomic loci, suggesting the
involvement of an RNA component that is recognized by Ago1.
Furthermore, the HIV-1 TAR RNA-binding protein 2 (TRBP2) is
enriched at silenced promoters, along with histone H3 lysine-27
tri-methylation (H3K27.sup.me3+) , a histone methyl-mark that
recruits the Polycomb group (PcG) repressor proteins. Our results
suggest that Ago1 is involved in the initiation and spreading of
siRNA mediated TGS, as well as transcriptional silencing at
facultative heterochromatin, linking the RNAi machinery with RNAPII
transcription and histone regulated control of gene expression.
[0053] In a third aspect of the invention, a model for siRNA
mediated TGS in human cells involving a transcriptional silencing
complex (TSC) containing Ago1, TRBP2, siRNA, and possibly chromatin
remodeling factors (i.e. HDAC-1, G9a, EZH2, DNMT3a). The TSC may be
directed by siRNAs to their target promoters in an RNAPII-dependent
manner, and the observation here that Ago1 associates with RNAPII
suggests that RNAPII may provide a docking site for the TSC. Upon
siRNA loading into the TSC, the antisense strand may guide the TSC
to a low copy promoter-specific RNA (pRNA) that corresponds to the
siRNA targeted promoter. This would allow for the formation of an
RNA:RNA duplex between the antisense strand of the siRNA and either
a nascent pRNA while it is being transcribed or a pRNA that is
already a component of the local chromatin structure. Recognition
of the siRNA target site would potentially stall the pRNA-scanning
TSC:RNAPII complex and initiate the formation of facultative
heterochromatin by recruiting histone methyltransferases and
possibly PcG repressor complexes, which have recently been linked
to Ago1 and the RNAi machinery in Drosophila. The inclusion of
TRBP2 in the TSC suggests a potentially important role for this
protein in Ago1 mediated RNA binding.
[0054] An alternative model implicated by the observed spreading of
TGS and facultative heterochromatin from a promoter nucleation site
would involve the siRNA antisense strand-directed TSC:RNAPII
complex moving along the targeted RNAPII-transcribed promoter/gene,
potentially modifying the H3 histones as they are reconstituted
into nucleosomes immediately following transcription. Both of these
models, or an amalgamation of the two, would necessitate the
involvement of RNAPII, which is consistent with recent evidence
that RNAPII function is required for histone methylation and TGS at
siRNA-targeted promoters in human cells and in S. Pombe, suggesting
an Ago1 and RNAPII-dependent mechanism of transcriptional silencing
that is evolutionarily conserved. Additionally, the recent
discovery and characterization of a vast array of small (21- to
26-nt), non-coding RNAs is changing the classical understanding of
gene regulation, and taken together with the data presented here,
suggests that these non-coding RNAs may play a more profound role
in writing the histone code and regulating gene expression at the
level of DNA.
[0055] Thus, the present invention provides a method of reducing
gene expression of a target gene using an siRNA molecule. In one
embodiment, the siRNA molecule increases methylation of histones
associated with the target gene. In a second embodiment, the siRNA
molecule is directed to the promoter region of the gene. In a third
embodiment, the siRNA molecule binds to a sequence within about 150
bp of the transcription start site. As used herein, the term
transcriptional start site refers to the nucleotide in a gene from
which transcription is initiated and lies between the TATA box
(TATA or TATAA sequences) and the translation initiation site.
[0056] In one aspect, the present invention provides a method for
TGS in a mammalian, including human, cell comprising exposing or
introducing into the cell a siRNA which is specific for a target
sequence in the promoter region of a gene to be silenced.
[0057] In another aspect, the present invention provides a method
for TGS in a mammalian, including human, cell comprising
introducing into the cell DNA sequences encoding a sense strand and
an antisense strand of an siRNA which is specific for a target
sequence in the promoter region of a gene to be silenced,
preferably under conditions permitting expression of the siRNA in
the cell, and wherein the siRNA induces histone modifications
characteristic of silent chromatin and/or methylation of the
gene.
[0058] In a further aspect, the present invention provides a method
for TGS in a mammalian, including human, cell comprising
introducing into the cell an siRNA molecule which is specific for a
target sequence in the promoter region of a gene to be silenced and
which interacts with Ago1 to direct transcriptional silencing of
the gene of interest.
[0059] In a still further aspect, the present invention provides
siRNA molecules, each comprising a sense strand and an antisense
strand, wherein the antisense strand has a sequence sufficiently
complementary to a promoter region of a gene of interest to direct
TGS of the gene of interest.
[0060] In another aspect, the present invention provides
pharmaceutical compositions containing the disclosed siRNA
molecules.
[0061] Possible target genes for TGS in a mammalian, including
human, cell include those associated with disease, including those
involved with response to infectious agents (e.g., bacteria,
viruses, fungi, etc.), cancer genes, genes leading to disease, or
any gene for which TGS is desired.
[0062] The siRNA molecule may have different forms, including a
single strand, a paired double strand (dsRNA) or a hairpin (shRNA)
and can be produced, for example, either sythetically or by
expression in cells. In one embodiment, DNA sequences for encoding
the sense and antisense strands of the siRNA molecule to be
expressed directly in mammalian cells can be produced by methods
known in the art, including but not limited to, methods described
in U.S. published application Nos. 2004/0171118 A1, 2005/0244858 A1
and 2005/0277610 A1, each incorporated herein by reference.
[0063] In one aspect of the invention, DNA sequences encoding a
sense strand and an antisense strand of a siRNA specific for a
target sequence of a gene are introduced into mammalian cells for
expression. To target more than one sequence in the gene (such as
different promoter region sequences and/or coding region
sequences), separate siRNA-encoding DNA sequences specific to each
targeted gene sequence can be introduced simultaneously into the
cell. In accordance with another embodiment, mammalian cells may be
exposed to multiple siRNAs that target multiple sequences in the
gene.
[0064] The siRNA molecules generally contain about 19 to about 30
base pairs, and preferably are designed to cause methylation of the
targeted gene sequence. In one embodiment, the siRNA molecules
contain about 19-23 base pairs, and preferably about 21 base pairs.
In another embodiment, the siRNA molecules contain about 24-28 base
pairs, and preferably about 26 base pairs. In a further embodiment,
the dsRNA has an asymmetric structure, with the sense strand having
a 25-base pair length, and the antisense strand having a 27-base
pair length with a 2 base 3'-overhang. In another embodiment, this
dsRNA having an asymmetric structure further contains 2
deoxynucleotides at the 3'end of the sense strand in place of two
of the ribonucleotides. Individual siRNA molecules also may be in
the form of single strands, as well as paired double strands
("sense" and "antisense") and may include secondary structure such
as a hairpin loop. Individual siRNA molecules could also be
delivered as precursor molecules, which are subsequently altered to
give rise to active molecules. Examples of siRNA molecules in the
form of single strands include a single stranded anti-sense siRNA
against a non-transcribed region of a DNA sequence (e.g. a promoter
region).
[0065] The sense and antisense strands anneal under biological
conditions, such as the conditions found in the cytoplasm of a
cell. In addition, a region of one of the sequences, particularly
of the antisense strand, of the dsRNA has a sequence length of at
least 19 nucleotides, wherein these nucleotides are adjacent to the
3'end of antisense strand and are sufficiently complementary to a
nucleotide sequence of the RNA produced from the target gene.
[0066] The precursor RNAi molecule, may also have one or more of
the following additional properties: (a) the antisense strand has a
right shift from the typical 21mer and (b) the strands may not be
completely complementary, i.e., the strands may contain simple
mismatch pairings. A "typical" 21mer siRNA is designed using
conventional techniques, such as described above. This 21mer is
then used to design a right shift to include 1-7 additional
nucleotides on the 5' end of the 21mer. The sequence of these
additional nucleotides may have any sequence. Although the added
ribonucleotides may be complementary to the target gene sequence,
full complementarity between the target sequence and the siRNA is
not required. That is, the resultant siRNA is sufficiently
complementary with the target sequence. The first and second
oligonucleotides are not required to be completely complementary.
They only need to be substantially complementary to anneal under
biological conditions and to provide a substrate for Dicer that
produces a siRNA sufficiently complementary to the target sequence.
In one embodiment, the dsRNA has an asymmetric structure, with the
antisense strand having a 25-base pair length, and the sense strand
having a 27-base pair length with a 2 base 3'-overhang. In another
embodiment, this dsRNA having an asymmetric structure further
contains 2 deoxynucleotides at the 3'end of the antisense
strand.
[0067] Suitable dsRNA compositions that contain two separate
oligonucleotides can be linked by a third structure. The third
structure will not block Dicer activity on the dsRNA and will not
interfere with the directed destruction of the RNA transcribed from
the target gene. In one embodiment, the third structure may be a
chemical linking group. Many suitable chemical linking groups are
known in the art and can be used. Alternatively, the third
structure may be an oligonucleotide that links the two
oligonucleotides of the dsRNA is a manner such that a hairpin
structure is produced upon annealing of the two oligonucleotides
making up the dsRNA composition. The hairpin structure will not
block Dicer activity on the dsRNA and will not interfere with the
directed destruction of the RNA transcribed from the target
gene.
[0068] The sense and antisense sequences may be attached by a loop
sequence. The loop sequence may comprise any sequence or length
that allows expression of a functional siRNA expression cassette in
accordance with the invention. In a preferred embodiment, the loop
sequence contains higher amounts of uridines and guanines than
other nucleotide bases. The preferred length of the loop sequence
is about 4 to about 9 nucleotide bases, and most preferably about 8
or 9 nucleotide bases.
[0069] In another embodiment of the present invention, the dsRNA,
i.e., the precursor RNAi molecule, has several properties which
enhances its processing by Dicer. According to this embodiment, the
dsRNA has a length sufficient such that it is processed by Dicer to
produce an siRNA and at least one of the following properties: (i)
the dsRNA is asymmetric, e.g., has a 3' overhang on the sense
strand and (ii) the dsRNA has a modified 3' end on the antisense
strand to direct orientation of Dicer binding and processing of the
dsRNA to an active siRNA. According to this embodiment, the longest
strand in the dsRNA comprises 24-30 nucleotides. In one embodiment,
the sense strand comprises 24-30 nucleotides and the antisense
strand comprises 22-28 nucleotides. Thus, the resulting dsRNA has
an overhang on the 3' end of the sense strand. The overhang is 1-3
nucleotides, such as 2 nucleotides. The antisense strand may also
have a 5' phosphate.
[0070] Modifications can be included in the dsRNA, i.e., the
precursor RNAi molecule, so long as the modification does not
prevent the dsRNA composition from serving as a substrate for
Dicer. In one embodiment, one or more modifications are made that
enhance Dicer processing of the dsRNA. In a second embodiment, one
or more modifications are made that result in more effective RNAi
generation. In a third embodiment, one or more modifications are
made that support a greater RNAi effect. In a fourth embodiment,
one or more modifications are made that result in greater potency
per each dsRNA molecule to be delivered to the cell. Modifications
can be incorporated in the 3'-terminal region, the 5'-terminal
region, in both the 3'-terminal and 5'-terminal region or in some
instances in various positions within the sequence. With the
restrictions noted above in mind any number and combination of
modifications can be incorporated into the dsRNA. Where multiple
modifications are present, they may be the same or different.
Modifications to bases, sugar moieties, the phosphate backbone, and
their combinations are contemplated. Either 5'-terminus can be
phosphorylated.
[0071] In another embodiment, the antisense strand is modified for
Dicer processing by suitable modifiers located at the 3' end of the
antisense strand, i.e., the dsRNA is designed to direct orientation
of Dicer binding and processing. Suitable modifiers include
nucleotides such as deoxyribonucleotides, dideoxyribonucleotides,
acyclonucleotides and the like and sterically hindered molecules,
such as fluorescent molecules and the like. Acyclonucleotides
substitute a 2-hydroxyethoxymethyl group for the
2'-deoxyribofuranosyl sugar normally present in dNMPs. Other
nucleotide modifiers could include 3'-deoxyadenosine (cordycepin),
3'-azido-3'-deoxythymidine (AZT), 2',3'-dideoxyinosine (ddI),
2',3'-dideoxy-3'-thiacytidine (3TC),
2',3'-didehydro-2',3'-dideoxythymidine (d4T) and the monophosphate
nucleotides of 3'-azido-3'-deoxythymidine (AZT),
2',3'-dideoxy-3'-thiacytidine (3TC) and
2',3'-didehydro-2',3'-dideoxythymidine (d4T). In one embodiment,
deoxynucleotides are used as the modifiers. When nucleotide
modifiers are utilized, 1-3 nucleotide modifiers, or 2 nucleotide
modifiers are substituted for the ribonucleotides on the 3' end of
the antisense strand. When sterically hindered molecules are
utilized, they are attached to the ribonucleotide at the 3' end of
the antisense strand. Thus, the length of the strand does not
change with the incorporation of the modifiers. In another
embodiment, the invention contemplates substituting two DNA bases
in the dsRNA to direct the orientation of Dicer processing. In a
further invention, two terminal DNA bases are located on the 3' end
of the antisense strand in place of two ribonucleotides forming a
blunt end of the duplex on the 5' end of the sense strand and the
3' end of the antisense strand, and a two-nucleotide RNA overhang
is located on the 3'-end of the sense strand. This is an asymmetric
composition with DNA on the blunt end and RNA bases on the
overhanging end.
[0072] Examples of modifications contemplated for the phosphate
backbone include phosphonates, including methylphosphonate,
phosphorothioate, and phosphotriester modifications such as
alkylphosphotriesters, and the like. Examples of modifications
contemplated for the sugar moiety include 2'-alkyl pyrimidine, such
as 2'-O-methyl, 2'-fluoro, amino, and deoxy modifications and the
like (see, e.g., Amarzguioui et al., 2003). Examples of
modifications contemplated for the base groups include abasic
sugars, 2-O-alkyl modified pyrimidines, 4-thiouracil,
5-bromouracil, 5-iodouracil, and 5-(3-aminoallyl)-uracil and the
like. Locked nucleic acids, or LNA's, could also be incorporated.
Many other modifications are known and can be used so long as the
above criteria are satisfied. Examples of modifications are also
disclosed in U.S. Pat. Nos. 5,684,143, 5,858,988 and 6,291,438 and
in U.S. published patent application No. 2004/0203145 A1, each
incorporated herein by reference. Other modifications are disclosed
in Herdewijn (2000), Eckstein (2000), Rusckowski et al. (2000),
Stein et al. (2001) and Vorobjev et al. (2001), each incorporated
herein by reference.
[0073] Additionally, the siRNA structure can be optimized to ensure
that the oligonucleotide segment generated from Dicer's cleavage
will be the portion of the oligonucleotide that is most effective
in inhibiting gene expression. For example, in one embodiment of
the invention a 27-bp oligonucleotide of the dsRNA structure is
synthesized wherein the anticipated 21 to 22-bp segment that will
inhibit gene expression is located on the 3'-end of the antisense
strand. The remaining bases located on the 5'-end of the antisense
strand will be cleaved by Dicer and will be discarded. This cleaved
portion can be homologous (i.e., based on the sequence of the
target sequence) or non-homologous and added to extend the nucleic
acid strand.
[0074] RNA may be produced enzymatically or by partial/total
organic synthesis, and modified ribonucleotides can be introduced
by in vitro enzymatic or organic synthesis. In one embodiment, each
strand is prepared chemically. Methods of synthesizing RNA
molecules are known in the art, in particular, the chemical
synthesis methods as described in Verma and Eckstein (1998) or as
described herein.
[0075] In another aspect, the present invention provides for a
pharmaceutical composition comprising the siRNA of the present
invention. The siRNA sample can be suitably formulated and
introduced into the environment of the cell by any means that
allows for a sufficient portion of the sample to enter the cell to
induce gene silencing, if it is to occur. Many formulations for
dsRNA are known in the art and can be used so long as siRNA gains
entry to the target cells so that it can act. See, e.g., U.S.
published patent application Nos. 2004/0203145 A1 and 2005/0054598
A1, each incorporated herein by reference. For example, siRNA can
be formulated in buffer solutions such as phosphate buffered saline
solutions, liposomes, micellar structures, and capsids.
Formulations of siRNA with cationic lipids can be used to
facilitate transfection of the dsRNA into cells. For example,
cationic lipids, such as lipofectin (U.S. Pat. No. 5,705,188,
incorporated herein by reference), cationic glycerol derivatives,
and polycationic molecules, such as polylysine (published PCT
International Application WO 97/30731, incorporated herein by
reference), can be used. Suitable lipids include Oligofectamine,
Lipofectamine (Life Technologies), NC388 (Ribozyme Pharmaceuticals,
Inc., Boulder, Colo.), or FuGene 6 (Roche) all of which can be used
according to the manufacturer's instructions.
[0076] It can be appreciated that the method of introducing siRNA
into the environment of the cell will depend on the type of cell
and the make up of its environment. For example, when the cells are
found within a liquid, one preferable formulation is with a lipid
formulation such as in lipofectamine and the siRNA can be added
directly to the liquid environment of the cells. Lipid formulations
can also be administered to animals such as by intravenous,
intramuscular, or intraperitoneal injection, or orally or by
inhalation or other methods as are known in the art. When the
formulation is suitable for administration into animals such as
mammals and more specifically humans, the formulation is also
pharmaceutically acceptable. Pharmaceutically acceptable
formulations for administering oligonucleotides are known and can
be used. In some instances, it may be preferable to formulate siRNA
in a buffer or saline solution and directly inject the formulated
dsRNA into cells, as in studies with oocytes. The direct injection
of dsRNA duplexes may also be done. For suitable methods of
introducing siRNA see U.S. published patent application No.
2004/0203145 A1, incorporated herein by reference.
[0077] Suitable amounts of siRNA must be introduced and these
amounts can be empirically determined using standard methods.
Typically, effective concentrations of individual siRNA species in
the environment of a cell will be about 50 nanomolar or less 10
nanomolar or less, or compositions in which concentrations of about
1 nanomolar or less can be used. In other embodiment, methods
utilize a concentration of about 200 picomolar or less and even a
concentration of about 50 picomolar or less can be used in many
circumstances.
[0078] The method can be carried out by addition of the siRNA
compositions to any extracellular matrix in which cells can live
provided that the siRNA composition is formulated so that a
sufficient amount of the siRNA can enter the cell to exert its
effect. For example, the method is amenable for use with cells
present in a liquid such as a liquid culture or cell growth media,
in tissue explants, or in whole organisms, including animals, such
as mammals and especially humans.
[0079] Expression of a target gene can be determined by any
suitable method now known in the art or that is later developed. It
can be appreciated that the method used to measure the expression
of a target gene will depend upon the nature of the target gene.
For example, when the target gene encodes a protein the term
"expression" can refer to a protein or transcript derived from the
gene. In such instances the expression of a target gene can be
determined by measuring the amount of mRNA corresponding to the
target gene or by measuring the amount of that protein. Protein can
be measured in protein assays such as by staining or immunoblotting
or, if the protein catalyzes a reaction that can be measured, by
measuring reaction rates. All such methods are known in the art and
can be used. Where the gene product is an RNA species expression
can be measured by determining the amount of RNA corresponding to
the gene product. The measurements can be made on cells, cell
extracts, tissues, tissue extracts or any other suitable source
material.
[0080] The determination of whether the expression of a target gene
has been reduced can be by any suitable method that can reliably
detect changes in gene expression. Typically, the determination is
made by introducing into the environment of a cell undigested siRNA
such that at least a portion of that siRNA enters the cytoplasm and
then measuring the expression of the target gene. The same
measurement is made on identical untreated cells and the results
obtained from each measurement are compared.
[0081] The siRNA can be formulated as a pharmaceutical composition
which comprises a pharmacologically effective amount of a siRNA and
pharmaceutically acceptable carrier. A pharmacologically or
therapeutically effective amount refers to that amount of a siRNA
effective to produce the intended pharmacological, therapeutic or
preventive result. The phrases "pharmacologically effective amount"
and "therapeutically effective amount" or simply "effective amount"
refer to that amount of a RNA effective to produce the intended
pharmacological, therapeutic or preventive result. For example, if
a given clinical treatment is considered effective when there is at
least a 20% reduction in a measurable parameter associated with a
disease or disorder, a therapeutically effective amount of a drug
for the treatment of that disease or disorder is the amount
necessary to effect at least a 20% reduction in that parameter.
[0082] The phrase "pharmaceutically acceptable carrier" refers to a
carrier for the administration of a therapeutic agent. Exemplary
carriers include saline, buffered saline, dextrose, water,
glycerol, ethanol, and combinations thereof. For drugs administered
orally, pharmaceutically acceptable carriers include, but are not
limited to pharmaceutically acceptable excipients such as inert
diluents, disintegrating agents, binding agents, lubricating
agents, sweetening agents, flavoring agents, coloring agents and
preservatives. Suitable inert diluents include sodium and calcium
carbonate, sodium and calcium phosphate, and lactose, while corn
starch and alginic acid are suitable disintegrating agents. Binding
agents may include starch and gelatin, while the lubricating agent,
if present, will generally be magnesium stearate, stearic acid or
talc. If desired, the tablets may be coated with a material such as
glyceryl monostearate or glyceryl distearate, to delay absorption
in the gastrointestinal tract. The pharmaceutically acceptable
carrier of the disclosed dsRNA composition may be micellar
structures, such as a liposomes, capsids, capsoids, polymeric
nanocapsules, or polymeric microcapsules.
[0083] Polymeric nanocapsules or microcapsules facilitate transport
and release of the encapsulated or bound dsRNA into the cell. They
include polymeric and monomeric materials, especially including
polybutylcyanoacrylate. A summary of materials and fabrication
methods has been published (see Kreuter, 1991). The polymeric
materials which are formed from monomeric and/or oligomeric
precursors in the polymerization/nanoparticle generation step, are
per se known from the prior art, as are the molecular weights and
molecular weight distribution of the polymeric material which a
person skilled in the field of manufacturing nanoparticles may
suitably select in accordance with the usual skill.
[0084] Suitably formulated pharmaceutical compositions of this
invention can be administered by any means known in the art such as
by parenteral routes, including intravenous, intramuscular,
intraperitoneal, subcutaneous, transdermal, airway (aerosol),
rectal, vaginal and topical (including buccal and sublingual)
administration. In some embodiments, the pharmaceutical
compositions are administered by intravenous or intraparenteral
infusion or injection.
[0085] In general a suitable dosage unit of siRNA will be in the
range of 0.001 to 0.25 milligrams per kilogram body weight of the
recipient per day, or in the range of 0.01 to 20 micrograms per
kilogram body weight per day, or in the range of 0.01 to 10
micrograms per kilogram body weight per day, or in the range of
0.10 to 5 micrograms per kilogram body weight per day, or in the
range of 0.1 to 2.5 micrograms per kilogram body weight per day.
Pharmaceutical composition comprising the siRNA can be administered
once daily. However, the therapeutic agent may also be dosed in
dosage units containing two, three, four, five, six or more
sub-doses administered at appropriate intervals throughout the day.
In that case, the siRNA contained in each sub-dose must be
correspondingly smaller in order to achieve the total daily dosage
unit. The dosage unit can also be compounded for a single dose over
several days, e.g., using a conventional sustained release
formulation which provides sustained and consistent release of the
siRNA over a several day period. Sustained release formulations are
well known in the art. In this embodiment, the dosage unit contains
a corresponding multiple of the daily dose. Regardless of the
formulation, the pharmaceutical composition must contain siRNA in a
quantity sufficient to inhibit expression of the target gene in the
animal or human being treated. The composition can be compounded in
such a way that the sum of the multiple units of siRNA together
contain a sufficient dose.
[0086] Data can be obtained from cell culture assays and animal
studies to formulate a suitable dosage range for humans. The dosage
of compositions of the invention lies within a range of circulating
concentrations that include the ED.sub.50 (as determined by known
methods) with little or no toxicity. The dosage may vary within
this range depending upon the dosage form employed and the route of
administration utilized. For any compound used in the method of the
invention, the therapeutically effective dose can be estimated
initially from cell culture assays. A dose may be formulated in
animal models to achieve a circulating plasma concentration range
of the compound that includes the IC.sub.50 (i.e., the
concentration of the test compound which achieves a half-maximal
inhibition of symptoms) as determined in cell culture. Such
information can be used to more accurately determine useful doses
in humans. Levels of dsRNA in plasma may be measured by standard
methods, for example, by high performance liquid
chromatography.
[0087] In a further aspect, the present invention relates to a
method for TGS in a mammalian, including human, cell. The method
comprises introducing the siRNA into the appropriate cell. The term
"introducing" encompasses a variety of methods of introducing DNA
into a cell, either in vitro or in vivo. Such methods include
transformation, transduction, transfection, and infection. Vectors
are useful and preferred agents for introducing DNA encoding the
siRNA molecules into cells. The introducing may be accomplished
using at least one vector. Possible vectors include plasmid vectors
and viral vectors. Viral vectors include retroviral vectors,
lentiviral vectors, or other vectors such as adenoviral vectors or
adeno-associated vectors. In one embodiment, the DNA sequences are
included in separate vectors, while in another embodiment, the DNA
sequences are included in the same vector. The DNA sequences may be
inserted into the same vector as a multiple cassettes unit.
Alternate delivery of siRNA molecules or DNA encoding siRNA
molecules into cells or tissues may also be used in the present
invention, including liposomes, chemical solvents, electroporation,
viral vectors, pinocytosis, phagocytosis and other forms of
spontaneous or induced cellular uptake of exogenous material, as
well as other delivery systems known in the art.
[0088] Suitable promoters include those promoters that promote
expression of the interfering RNA molecules once operatively
associated or linked with sequences encoding the RNA molecules.
Such promoters include cellular promoters and viral promoters, as
known in the art. In one embodiment, the promoter is an RNA Pol III
promoter, which preferably is located immediately upstream of the
DNA sequences encoding the interfering RNA molecule. Various viral
promoters may be used, including, but not limited to, the viral
LTR, as well as adenovirus, SV40, and CMV promoters, as known in
the art.
[0089] In one embodiment, the invention uses a mammalian U6 RNA Pol
III promoter, and more preferably the human U6snRNA Pol III
promoter, which has been used previously for expression of short,
defined ribozyme transcripts in human cells (Bertrand et al., 1997;
Good et al., 1997). The U6 Pol III promoter and its simple
termination sequence (four to six uridines) were found to express
siRNAs in cells. Appropriately selected interfering RNA or siRNA
encoding sequences can be inserted into a transcriptional cassette,
providing an optimal system for testing endogenous expression and
function of the RNA molecules.
[0090] In a further aspect, the invention provides a method for TGS
in a mammalian, including human, cell comprising introducing into
the cell DNA sequences encoding a sense strand and an antisense
strand of an siRNA, which is specific for a target sequence in the
gene to be silenced, preferably under conditions permitting
expression of the siRNA in the cell, and wherein the siRNA directs
methylation of said gene of interest. In an embodiment, methylation
is directed to a sequence in the promoter region of the gene.
Alternately, methylation is directed to a sequence in the coding
region. Target sequences can be any sequence in a gene that has the
potential for methylation. In a preferred embodiment, the target
sequences may contain CpG islands. The directed methylation can
lead to inactivation of the gene. To target more than one sequence
in the gene (such as different promoter region sequences and/or
coding region sequences), separate siRNA-encoding DNA sequences
specific to each targeted gene sequence can be introduced
simultaneously into the cell. In addition, cells may be exposed to
multiple siRNAs that target multiple sequences in the gene.
[0091] Once a target sequence or sequences have been identified for
methylation in accordance with the invention, the appropriate siRNA
can be produced, for example, either synthetically or by expression
in cells. In a one embodiment, the DNA sequences encoding the sense
and antisense strands of the siRNA molecule can be generated by
PCR. In another embodiment, the siRNA encoding DNA is cloned into a
vector, such as a plasmid or viral vector, to facilitate transfer
into mammals. In another embodiment, siRNA molecules may be
synthesized using chemical or enzymatic means.
[0092] To facilitate nuclear retention and increase the level of
methylation, the sense and antisense strands of the siRNA molecule
may be expressed in a single stranded form, for example as a stem
loop structure, as described above. Alternatively, or in
concomitance, the factor(s) involved in the active cellular
transport of siRNA's, such as Exportin 5, may be downregulated
employing synthetic siRNA, antisense, ribozymes, or any other
nucleic acid, antibody or drug, proven to be effective in
downregulating the gene(s) of interest.
[0093] The procedure for a PCR-based approach is depicted
schematically in FIG. 1 and illustrated in Example 1. In one
embodiment, a universal primer that is complementary to the 5' end
of the human U6 promoter is used in a PCR reaction along with a
primer(s) complementary to the 3' end of the promoter, which primer
harbors appended sequences which are complementary to the sense or
antisense siRNA genes (FIG. 1A). The sense or antisense sequences
are followed by a transcription terminator sequence (Ter), which is
preferably a stretch of 4-6 deoxyadenosines, and more preferably a
stretch of 6 deoxyadenosines, and by a short additional
"stuffer-tag" sequence that may include a restriction site for
possible cloning at a later stage. The resulting PCR products
include the U6 promoter sequence, the siRNA sense or antisense
encoding sequence, a terminator sequence, and a short tag sequence
at the 3' terminus of the product.
[0094] In another embodiment, both the sense and antisense
sequences can be included in the same cassette (FIG. 1B, 1C and
1D). In this case a nucleotide loop, preferably containing 9
nucleotides, is inserted between the sense and antisense siRNA
sequences. The resulting single PCR product includes the U6
promoter, the siRNA sense and antisense encoding sequences in the
form of a stem-loop, the Pol III terminator sequence, and the
"stuffer" tag sequence (FIG. 1D). To construct this cassette two 3'
primers are used. The first PCR reaction employs the 5' U6
universal (or "common") primer and a 3' primer complementary to a
portion of the U6 promoter, followed by sequences complementary to
the siRNA sense encoding sequence and the 9 nt. loop (FIG. 1B).
Preferably one microliter of this first reaction is re-amplified in
a second PCR reaction that employs the same 5' U6 primer and a 3'
primer harboring sequences complementary to the 9 nt. loop appended
to the antisense strand, Ter and "stuffer" tag sequence (FIG.
1B).
[0095] In another embodiment, a one step PCR reaction is conducted
with a single 3' primer that harbors the sense, loop, antisense,
Ter and "stuffer" tag sequences (FIG. 1C).
[0096] The practice of the present invention employs, unless
otherwise indicated, conventional techniques of chemistry,
molecular biology, microbiology, recombinant DNA, genetics,
immunology, cell biology, cell culture and transgenic biology,
which are within the skill of the art. See, e.g., Maniatis et al.,
Molecular Cloning (Cold Spring Harbor Laboratory Press, Cold Spring
Harbor, N.Y., 1982); Sambrook et al., Molecular Cloning, 2nd Ed.
(Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.,
1989); Sambrook and Russell, Molecular Cloning, 3rd Ed. (Cold
Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 2001);
Ausubel et al., Current Protocols in Molecular Biology (John Wiley
& Sons, updated through 2005); Glover, DNA Cloning (IRL Press,
Oxford, 1985); Anand, Techniques for the Analysis of Complex
Genomes, (Academic Press, New York, 1992); Guthrie and Fink, Guide
to Yeast Genetics and Molecular Biology (Academic Press, New York,
1991); Harlow and Lane, Antibodies, (Cold Spring Harbor Laboratory
Press, Cold Spring Harbor, N.Y., 1998); Jakoby and Pastan, 1979;
Nucleic Acid Hybridization (B. D. Hames & S. J. Higgins eds.
1984); Transcription And Translation (B. D. Hames & S. J.
Higgins eds. 1984); Culture Of Animal Cells (R. I. Freshney, Alan
R. Liss, Inc., 1987); Immobilized Cells And Enzymes (IRL Press,
1986); B. Perbal, A Practical Guide To Molecular Cloning (1984);
the treatise, Methods In Enzymology (Academic Press, Inc., N.Y.);
Gene Transfer Vectors For Mammalian Cells (J. H. Miller and M. P.
Calos eds., 1987, Cold Spring Harbor Laboratory); Immunochemical
Methods In Cell And Molecular Biology (Mayer and Walker, eds.,
Academic Press, London, 1987); Handbook Of Experimental Immunology,
Volumes I-IV (D. M. Weir and C. C. Blackwell, eds., 1986); Riott,
Essential Immunology, 6th Edition, (Blackwell Scientific
Publications, Oxford, 1988); Hogan et al., Manipulating the Mouse
Embryo, (Cold Spring Harbor Laboratory Press, Cold Spring Harbor,
N.Y., 1986); Westerfield, M., The zebrafish book. A guide for the
laboratory use of zebrafish (Danio rerio), 4th Ed., (Univ. of
Oregon Press, Eugene, Oreg., 2000).
EXAMPLES
[0097] The present invention can be described by reference to the
following Examples, which are offered by way of illustration and
are not intended to limit the invention in any manner. Standard
techniques well known in the art or the techniques specifically
described below were utilized.
[0098] Furthermore, the following summary of the Examples is not
intended to be limiting to each respective Example and full details
can be found in the respective priority documents. TABLE-US-00001
Examples 1-6 (USSN 10/446,635) Examples 7-12 (USSN 60/683,782)
Examples 13-18 (this application) siRNA induces DNA methylation
siRNA induces methylation of histones Ago1 recruits histone
methyltransferase associated w/target gene Reduces or increases
target gene Reduces target gene expression Reduces target gene
expression. Ago1 expression directs siRNA mediated TGS siRNA
.about.21-28 bps, 19-23 bps, siRNA .about.18-29 bps, .about.18-23
bps, 21-26 nt noncoding RNAs 21 bps, 24-28 bps, 26 bps, 28 bps
.about.18-21 bps siRNA complementary to RASSF1A Anti-sense siRNA
EF52 binding to DNMT3A Ago1 associates w/target promoters (CCR5
region directs methylation of directs methylation of histones
related and RASSF1A) via an interaction with RASSF1A gene promoter
leading to to target gene leading to reduction of RNAPII leading to
TGS reduced RASSF1A expression target gene expression Transitional
silencing complex (TSC): Ago1, TRBP2, siRNA and possibly chromatin
remodeling factors
Example 1
[0099] Expression of Short Hairpin RNAs Complementary to Regions of
RASSF1A
[0100] This example demonstrates expression of short hairpin RNAs
that are complementary to regions of a human tumor suppressor gene
RASSF1A. The consequences of this expression were monitored by
determining the patterns of DNA methylation in the promoter and
part of the coding region of this gene, which is also susceptible
to methylation in cancer cells. The DNA sequence of the RASSF1A
gene is depicted below:
[0101] RASSF1A Promoter (SEQ ID NO:2): TABLE-US-00002 ggggctctgc
gagagcgcgc ccagccccgc cttcgggccc cacagtccct gcacccaggt ttccattgcg
cggctctcct cagctccttc ccgccgccca gtctggatcc tgggggaggc gctgaagtcg
gggcccgccc tgtggccccg cccggcccgc gcttgct gcccaaagcc
[0102] RASSF1A transcript (SEQ ID NO:3): TABLE-US-00003 agcgaagcac
gggcccaaCC GGgccatgtc gggggagcct gagctcattg agctgcggga gctggcaccc
gctgggcgcg ctgggaaggg ccgcacccgg ctggagcgtg ccaacgcgct gcgcatcgcg
cggggcaccg cgtgcaaccc cacacggcag ctggtccctg gccgtggcca ccgcttccag
cccgcggggc ccgccacgca cacgtggtgc gacctctgtg gcgacttcat ctggggcgtc
gtgcgcaaag gcctgcagtg cgcgcgtgag tagtggcccc gcgcgcctac
[0103] agc is where transcription probably starts [0104] atg is the
methionine codon [0105] The bolded sequences were targeted by
siRNAs of the invention.
[0106] PCR reactions are performed using a plasmid containing the
human U6 promoter as template to yield U6 transcription cassettes
expressing siRNAs. The 5' oligonucleotide (5'U6 universal primer)
is complementary to 29 nucleotides at the 5' end of the U6 promoter
(bold italics indicate the nucleotides complementary to those on
the promoter).
[0107] 5'U6 Mlu primer: TABLE-US-00004 (SEQ ID NO: 4) 5' AATCGA
ACGCGT 3' Mlu I U6
[0108] This U6 common 5' primer, used for all PCR steps, binds to
the 5' end of the U6 promoter and includes an Mlu I restriction
site for cloning purposes. The 3' oligonucleotides, which contain
either the sense, antisense, or both siRNA-coding sequences
(siDNAs), are depicted in FIG. 1 and described herein. The last 20
nucleotides at the 3' end of all 3' PCR primers are complementary
to the last 20 nucleotides of the U6 promoter which is: 5'GTGGAAAGG
ACGAAACACCG3' (SEQ ID NO:5). All PCR reactions were carried out as
follows: 1 min. at 94.degree. C., 1 min. at 55.degree. C. and 1
min. at 72.degree. C. for 30 cycles. The PCR products can be
directly transfected into cells (e.g., with prior cloning into an
expression vector), in which event the PCR primers can be kinased
with non-radioactive ATP prior to amplification and purified on
Quiagen columns prior to using them in the PCR reactions. The PCR
products also can be purified on Quiagen columns.
[0109] The 3' primers used to make siRNA expression cassettes are
depicted below:
[0110] Primers used to make PCR products encoding siRNA's
complementary to the promoter region of the RASSF1A gene:
[0111] 3'PR 1 (SEQ ID NO:6) TABLE-US-00005 5'CTACACAAA
GGCGGGCCCCGACTTCAGCG C GGTGTTTCGTCCTTTCCACAA 3' loop si-sense +1
U6
[0112] 3'PR 2 (SEQ ID NO:7) TABLE-US-00006 5'AACTC GAATTC AAAAAA
GCGCTGAAGTCGGGGCCCGCC CTACACAAA 3' EcoRI Ter. si-antisense Loop
[0113] Primers used to make PCR products encoding siRNA's
complementary to the transcribed region of the RASSF1A gene:
[0114] 3'TR 1 (SEQ ID NO:8) TABLE-US-00007 5'CTACACAAA
CGACATGGCCCGGTTGGGCC C GGTGTTTCGTCCTTTCCACAA 3' loop si-sense +1
U6
[0115] 3'TR 2 (SEQ ID NO:9) TABLE-US-00008 5'AACTC GAATTC AAAAAA
GGGCCCAACCGGGCCATGTCG CTACACAAA 3' EcoRI Ter. si-antisense Loop
Example 2
[0116] HeLa Cells Stably Transfected with the siRNA Expression
Constructs
[0117] HeLa cells, which include in their genome the RASSF1A gene,
were stably transfected with the siRNA expression constructs
produced by the method shown above. The final siRNAs-containing PCR
products were digested with MluI and EcoRI and cloned in the same
sites of the pcDNA3.1 vector (Invitrogen) for expression in the
mammalian cells. Digestion of pcDNA3.1 with MluI and EcoRi allows
the replacement of the CMV promoter with the U6 siRNA cassettes.
The Neomycin gene is the marker gene for selection in mammalian
cells. Cells were selected for G418 resistance. Cells were
monitored either in mixed population or clones of transfected
cells.
[0118] Stable cell lines expressing all different siRNAs and 8
individual single clones for each of the siRNA expressing cells
have thus far been obtained.
Example 3
[0119] Methods to Determine Methylation
[0120] Bisulfite: In the mixed cell population, genomic DNA was
isolated and treated with bisulfite, which changes unmethylated
cytosines to thymidines. Methylated cytosines remain as cytosine.
Thus, if the siRNAs direct methylation of the targeted sequences of
the RASSF1A shown in Example 1, these DNAs will not be modified by
bisulfite in the methylated region.
[0121] MSP Assay: PCR primers specific for either methylated or
unmethylated nucleotides were used in PCR reactions in accordance
with the Methylation-specific PCR assay (MSP assay) described in
Herman et al. Results showed that the siRNA that targets the
promoter region and the siRNA that targets the RASSF1A transcript,
were directing methylation of the RASSF1A gene. The MSP assay is
sensitive and specific for methylation of virtually any block of
CpG sites in a CpG island. The assay uses primers designed to
distinguish methylated from unmethylated DNA in bisulfite-modified
DNA, taking advantage of the sequence differences resulting from
bisulfite modification. Unmodified DNA or DNA incompletely reacted
with bisulfite can also be distinguished, since marked sequence
differences exist between these DNAs.
[0122] FIG. 2 shows results of the MSP analysis of the RASSF1A
promoter in siRNA transfected cells. In the figure, H.sub.2O
represents a water control used in the PCR reactions. The following
additional abbreviations were also used:
[0123] pcDNA: Cells transfected only with the vector (no siRNA)
[0124] siRASSF1Amut: Cells transfected with the mutant siRNA
vector
[0125] siRASSF1Aprom: Cells transfected with the siRNA vector
directed against the RASSF1A promoter sequences
[0126] siRASSF1Atx: Cells transfected with the siRNA vector
directed against the RASSF1A transcript
[0127] Melanoma: a control for RASSF1A methylation. This is DNA
from a melanoma tumor, which is methylated in the RASSF1A
promoter.
[0128] M, size markers
[0129] m, MSP done with primers specific for a methylated RASSF1A
promoter
[0130] u, MSP done with primers specific for an unmethylated
RASSF1A promoter
[0131] The following primers were used in the MSP reaction:
methylated DNA-specific primers, M210 (5' GGGTTTTGCGAGAGCGCG 3')
(SEQ ID NO:10) and M211 (5'GCTAACAAACGC GAACCG 3') (SEQ ID NO:11)
or unmethylated DNA-specific primers UM240 (5' GGGGTTTTGT
GAGAGTGTGTTTAG 3') (SEQ ID NO:12) and UM241 (5'
TAAACACTAACAAACACAAAC CAAAC 3') (SEQ ID NO:13) (Liu, L. et al.,
2002).
[0132] Restriction Analysis: Restriction analyses with an enzyme
that recognizes only the methylated sequence (BstU1), also
confirmed the presence of methylated sites in the RASSF1A gene.
[0133] Sequencing: Specific deoxynucleotide primed sequencing
revealed that 14 out of 17 potential methylation sites analyzed in
the RASSF1A gene were methylated in cell populations expressing the
siRNA directed against the RASSF1A promoter, and 17 out of 17 sites
were methylated in cells expressing the siRNA directed against a
CpG island in the RASSF1A transcript. Results are shown in FIG. 3.
The level of methylation in the promoter region was higher in some
of the single clones analyzed. Specific integration sites of siRNAs
in the cellular genome (by using the appropriate delivering vector)
could be used to achieve complete promoter methylation.
[0134] Sequence data were obtained by sequencing of the PCR
products obtained from the MSP reactions of Example 4 (FIG. 2). In
FIG. 3, sample designation is the same as in FIG. 2. FIG. 3 shows
the RASSF1A promoter sequence relative to the ATG translation start
site (i.e. -30 indicates 30 nucleotides upstream). Open circles
represent unmethylated cytosines at CG sequences. Closed circles
indicate methylated cytosines at CG sequences.
Example 4
[0135] Negative Control
[0136] As a negative control, DNA was extracted from cells
expressing a mutated siRNA, was analyzed, and showed no effects on
the methylation of the RASSF1A gene. In this analysis, PCR products
were produced as described in Example 1, but using the 3' primers
shown below. For the mutant there were two transversions (CCGG to
GGCC) and one transition (C to T) to make sure it would be
inactive.
[0137] Mutant primers against transcribed region:
[0138] 3'MT 1 (SEQ ID NO:14) TABLE-US-00009 (c) (ccgg) 5'CTACACAAA
CGATATGGCGGCCTTGGGCC C GGTGTTTCGTCCTTTCCACAA 3' loop si-sense +1
U6
[0139] 3'MT 2 (SEQ ID NO:15) TABLE-US-00010 5'AACTC GAATTC AAAAAA
GGGCCCAAGGCCGCCATATCG CTACACAAA 3' EcoRI Ter. si-antisense Loop
Example 5
[0140] Reduction of RASSF1A Intracellular Expression in Cells
Transfected with shRNAs Directed Against Promoter Sequences
[0141] FIG. 4 shows the reduction of RASSF1A RNA transcripts
detected by reverse transcriptase PCR (RT-PCR) reactions. Hela
cells were transfected with shRNAs directed against promoter
sequences of RASSF1A. Cells were collected after 48-56 hr. and the
RNA was extracted using RNA STAT60 as suggested by the
manufacturer. Quantitative PCR reactions were performed by
preparing 100 .mu.l PCR mixes containing standard PCR buffer,
dNTPs, 1 .mu.g of each RNA sample, and two 3' primers specific to
either the RASSF1A transcript or to the GAPDH cellular gene. GAPDH
is used as an internal control to verify the integrity and amount
of RNA analyzed in each reaction. After the samples were heated at
80.degree. C. for 1 minute and slow cooled to room temperature,
they were thoroughly mixed and divided into two 50 .mu.l aliquots.
1-2 units of reverse transcriptase were added to half of the
reactions while the other half were used as controls to exclude DNA
contaminations. All samples were placed at 37.degree. C. for 5
minute to complete the extension reactions. Following the
extensions (and cDNA synthesis) the samples were thoroughly mixed
and divided once again into two 25 .mu.l aliquots. The specific 5'
primers for the RASSF1A or the GAPDH were added to the 25 .mu.l
aliquots and the PCR reactions were completed as for the
methylation-specific PCR assay.
[0142] As shown in FIG. 4, representative clonal cell lines from
cells transfected with the 21 nucleotides shRNAs directed against
the RASSF1A promoter (21c1, 21c2, 21c3), and the Hela cell
population transfected with a 28 nucleotides shRNA (sh28) were
analyzed for decreased RNA expression. Clonal cell lines tranfected
with the shRNA mutant (Mtc1, Mtc2, Mtc3) were also analyzed as
controls. After normalization with the GAPDH internal control, a
clear and specific RASSF1A RNA down-regulation can be detected in
two of the three clones expressing shRNA directed against promoter
sequences, but in none of the mutant shRNA clones used as controls.
The -RT controls showed no DNA contamination. These results
indicate that specific shRNA methylation of the RASSF1A promoter
results in down-regulation of the intracellular RASSF1A
transcripts.
Example 6
[0143] Decreased Expression of RASSF1A Transcripts
[0144] Several clonal HeLa cell lines transfected with 28
nucleotides shRNAs directed against the promoter sequences were
analyzed by Reverse Transcriptase dependent PCRs as described in
Example 8. The results shown in FIG. 5 show decrease expression of
RASSF1A transcripts in many of the clones analyzed. Similar results
were obtained by expressing the shRNAs from lentiviral vector
backbones (not shown), which may be the method of choice (but not
the only method) for long-term expression of shRNAs and gene
silencing. The results obtained with the clonal cell lines
transfected with the various shRNAs are summarized in FIG. 6.
[0145] The above demonstrates the invention's utility for, among
other things, designing and using siRNAs to direct DNA methylation
in either a promoter region or certain coding region of a gene.
Directing promoter methylation of a gene by targeting siRNAs
against CpG islands of RNA transcripts should be a potent inhibitor
of intracellular gene expression.
Example 7
[0146] Methods Used for Examples 8-12
[0147] Chromatin immunoprecipitation assay (CHiP): Chromatin
immunoprecipitation was performed on 4.0.times.10.sup.6 293T
transfected with siRNA EF52 or control CCR5 (10 NM using MPG 3
.mu.l/ml of media) (Morris et al., 2004b). Forty-eight hours
following transfection cultures were collected and ChiP assay
performed as described (Strahl-Bolsinger et al., 1997). Cultures
were specifically probed with anti-dimethyl-Histone H3 (Lys9) and
anti-trimethyl-Histone H3 (Lys27) (Upstate catalog #07-441 and
07-449, respectively). The final elutes were assayed using PCR 30
cycles of 94:55:72.degree. C. with primers 803 and 804 which
specifically overlap the targeted EF1 alpha promoter (Morris et
al., 2004a) and quantitated using the IDV values determined from
analysis with the Alpha Innotech.
[0148] Detection of Flag-tagged proteins in biotin labeled siRNA
pulldowns: A total of 4.0.times.10.sup.6 293T cells were
transfected with 15 .mu.g of one of 9 Flag-tagged expression
vectors (DNMT-1, 3A, 3A2, 3B1, 3B2, HP1-alpha, HP1-beta, HP1-gamma,
or the negative control helicase Prp2) using Lipofectamine
2000.TM.m. All DNMTs were supplied by A. Riggs and all HP1s were a
gift R. Losson (Nielsen et al., 2001). (2) Forty-eight hours later
the cell lysates (cytoplasmic and nuclear fractions) were isolated
each in 500 .mu.l of lysis buffer (1 mM PMSF, 20 units RNasin, 10
mM Tris-HCl pH 7.4, 10 mM NaCl, 3 mM MgCl.sub.2, 0.1 mM DTT, and
0.5% NP40). (3) A mixture of 125 .mu.l of cytoplasmic and nuclear
fractions were incubated for 3 hrs at 4.degree. C. with 500 nM
5'Biotin end-labeled EF52. Next Dynal Avidin/magnetic beads
(7.times.10.sup.7 beads) were washed in lysate buffer and then
added directly to the siRNA/Flag-Tagged containing lysates and
incubated at 4.degree. C. for 1 hr. The siRNA/Flag complexes were
pulled-down by magnetic bead binding and washed 5.times.'s in
lysate buffer. Finally, the bound protein complexes were eluted
from the Avidin-biotin bound beads/siRNA by incubation in 100 .mu.l
of elution buffer (Tris-Cl pH 6.0, 1 mM EDTA, 2.0 M NaCl, 0.5 M
MgCl.sub.2) at 55.degree. C. for 5 minutes. The eluted protein
complexes were electrophoresed in denaturing PAGE and subjected to
western blot analysis with an anti-Flag antibody.
[0149] Detection of siRNAs from Flag-tag pulldowns: Flag-tagged
DNMT1 and 3A were as described previously. The cell
lysates/extracts were then incubated with either the siRNA EF52,
sense (S) or antisense (AS) EF52 (500 nM) for 3 hrs at 4.degree. C.
Next, a flag-tag immunoprecipitation was performed for each DNMT
complex containing the putative bound siRNAs followed by
deproteinization of the complex, phenol/chloroform extraction, and
release of the bound siRNA. Detection of the released siRNA, either
sense or antisense, was performed according to Weinberg et al.
(2006).
[0150] ChiP/biotin-RNA co-immunoprecipitation: A total of
4.0.times.10.sup.6 293T cells were plated and 24 hrs later
transfected with 100 nM EF52 biotin labeled siRNA (antisense alone)
using MPG (3 .mu.l/ml of media). Forty eight hours following the
siRNA/MPG transfection cultures were collected and a ChiP assay
performed as described previously with a slight modification.
Following the immunoprecipitation with the H3K27 tri-methyl
specific antibody the elutes were incubated with 100 .mu.l
(6-7.times.10.sup.8 beads/ml) of Dynabeads.TM. M-280 Streptaviden
pre-washed in 2.times. wash buffer (50 mM Tris HCl, 400 mM NaCl pH
7.4). The elute/bead slurry was incubated at 4.degree. C. for 15
minutes on an orbital shaker followed by capture with a magnetic
bead separator. The captured beads were washed 3 times in 2.times.
wash buffer and then eluted in 100 .mu.l of 2.times. elute buffer
(10 mM Tris-HCL (pH 6.0), 1 mM EDTA and 2.0 M NaCl) at 65.degree.
C. for 5 minutes. The resultant elutes were then reverse
cross-linked and DNA recovered by phenol/chloroform extraction
followed by PCR 35 cycles of 94:55:72.degree. C. for the EF1 alpha
promoter with primers 803 and 804 (Morris et al., 2004a).
[0151] ChiP/DNMT3A-Flag/biotin-RNA co-immunoprecipitation: A total
of 4.0.times.10.sup.6 293T cells were plated and 24 hrs later
transfected with 100 nM EF52 biotin labeled siRNA (antisense or
sense alone) using MPG (3 .mu.l/ml of media). Forty eight hours
following the sense or antisense siRNA/MPG transfection cultures
were collected and a ChiP assay performed as described previously
with a slight modification. Following the immunoprecipitation with
the H3K27 tri-methyl specific antibody the elutes were incubated
overnight with 40 .mu.l of EZVIEW.TM. Red anti-Flag M2 affinity gel
beads (Sigma.TM.). Next the bound beads were washed 3 times with
TBS-Mod Buffer (50 mM Tris HCl, 400 mM NaCl pH 7.4) and then eluted
by competition with 3.times. Flag-peptide 15 .mu.g. The resultant
elutes were then transferred to 100 .mu.l (6-7.times.10.sup.8
beads/ml) of Dynabeads.TM. M-280 Streptaviden pre-washed in
2.times. wash buffer (50 mM Tris HCl, 400 mM NaCl pH 7.4). The
elute/bead slurry was incubated at 4.degree. C. for 15 minutes on
an orbital shaker followed by capture with a magnetic bead
separator. The captured beads were washed 3 times in 2.times. wash
buffer and then eluted in 100 .mu.l of 2.times. elute buffer (10 mM
Tris-HCL (pH 6.0), 1 mM EDTA and 2.0 M NaCl) at 65.degree. C. for 5
minutes. The resultant elutes were then reverse cross-linked and
DNA recovered by phenouchloroform extraction followed by PCR 35
cycles of 94:55:72.degree. C. for the EF1 alpha promoter with
primers 803 and 804 (Morris et al., 2004a).
[0152] HIV-1 U3 LTR Targeting: Small interfering RNAs were
constructed following established protocols (Ambion Silencer.TM.).
EF1-alpha siRNA target sites were: EF52 5'-AAG GTG GCG CGG GGT AAA
CTG-3' (SEQ ID NO:16), and the control GFP mRNA specific 5'-AAC GAT
GCC ACC TAC GGC AAG-3' (kit control; SEQ ID NO:17), and negative
control CCR5 specific 5'-AAT TCT TTG GCC TGA ATA ATT-3' (SEQ ID
NO:18). Synthetic 5' end biotin labeled EF52 sense (S) 5'-CCA CCG
CGC CCC AUU UGA CAA-3' (SEQ ID NO:19), antisense (AS) 5'AAG GUG GCG
CGG GGU AAA CUG-3' (SEQ ID NO:20) and urnodified sense and
antisense siRNAs used in co-immunoprecipitation assays were
constructed at the City of Hope Beckman Research Institute DNA, RNA
and Peptide Synthesis Facility. To generate the sense/antisense
(S/AS) biotin end-labeled siRNAs equivalent volumes of 100 .mu.M of
the sense and antisense siRNAs were mixed together and incubated at
65.degree. C. for 5 minutes followed by a 5 minute incubation on
ice. HIV-1 U3 LTR targeted siRNAs were constructed and cloned into
pCR4-TOPO (Invitrogen.TM.) by PCR using the 5' U6+1 as described
(Lee et al., 2002) with 3' primers; LTR-247(S): 5'AAA AAA AAG TGT
TAG AGT GGA GGT TTG CGG TGT TTC GTC CTT TCC ACA A-3' (SEQ ID
NO:21), LTR-362(AS): 5'AAA AAA AAG AAA GTC CCC AGC GGA AAG CGG TGT
TTC GTC CTT TCC ACA A-3' (SEQ ID NO:22), GFP(AS): 5'AAA AAA AAC GAT
GCC ACC TAC GGC AAG CGG TGT TTC GTC CTT TCC ACA A-3' (SEQ ID
NO:23), GFP(S): 5'AAA AAA AAC TTG CCG TAG GTG GCA TCG CGG TGT TTC
GTC CTT TCC ACA A-3' (SEQ ID NO:24), LTR-247c(AS): 5'-AAA AAA AAG
TAT TAA AGT GGA AGT TTG CGG TGT TTC GTC CTT TCC ACA A-3' (SEQ ID
NO:25), LTR-247c(S): 5'-AAA AAA AAC AAA CTT CCA CTT TAA TAC GGT GTT
TCG TCC TTT CCA CAA-3' (SEQ ID NO:26), LTR-362c(AS): 5'-AAA AAA AAC
TTT CCA CTG GGG CGT TCC GGT GTT TCG TCC TTT CCA CAA-3' (SEQ ID
NO:27), LTR-362c(S): 5'-AAA AAA AAG GAA CGC CCC AGT GGA AAG CGG TGT
TTC GTC CTT TCC ACA A-3' (SEQ ID NO:28). The resultant clones were
co-transfected with the HIV-1 Tat expression plasmid pTatdsRed2
(Unwalla et al., 2004) into 4.0.times.10.sup.5 U3-Luciferase
indicator cells TZM-BI obtained through the NIH AIDS Research and
Reference Reagent Program, Division of AIDS, NIAID, (Wei et al.,
2002; Platt et al., 1998). Twenty-four and/or forty eight hours
later luciferase expression was determined using the
Dual-LuciferaseR Reporter Assay System (Promega.TM.) and a
Veritas.TM. microplate luminometer from Turner Biosystems following
the manufactures protocols.
[0153] Alpha-Amanatin mediated suppression of siRNA induced TGS:
Chromatin immunoprecipitation was performed on 4.0.times.10.sup.6
293T transfected with siRNA EF52 or control CCR5 (10 nM using MPG 3
.mu.l/ml of media) (Morris et al., 2004b). Twenty-four hours
following MPG mediated siRNA transfection cultures 1/2 of the
cultures were exposed to Alpha amanatin (0.05 .mu.g/ml) and 24 hrs
later collected and ChiP assay performed as described
(Strahl-Bolsinger et al. 1997). Cultures were specifically probed
with anti-dimethyl-Histone H3 (Lys9)(Upstate catalog #07-441 and
-7-449 respectively). The final elutes were assayed using PCR 30
cycles of 94:55:72.degree. C. and 15,15 and 30 seconds respectively
with primers 803 and 804 which specifically overlap the targeted
EF1 alpha promoter (Morris et al., 2004a).
Example 8
[0154] EF52 siRNA Induces Histone Methylation
[0155] siRNA EF52 is homologous to a sequence in the EFLA promoter
and has been shown to induce TGS of endogenous EF1A (Morris et al.,
2004b). The EF52 mediated TGS of endogenous EF1A was shown to
involve both histone and DNA methylation. Moreover, silencing of
promoters by DNA methylation has been shown to be preceded by
histone methylation (Mutskov and Felsenfeld, 2004). To investigate
the histone methyl mark induced by siRNA EF52 we transfected 293T
cells with either EF52 or the control CCR5 siRNA (Morris et al.,
2004b) using the nuclear specific peptide MPG (Morris et la., 2003;
Morris et al., 1997). EF52 treated cultures exhibited a pronounced
increase in H3K9 and H3K27 methylation relative to controls (FIG.
7A). Moreover, the induction of H3K9 methylation was contingent on
nuclear specific delivery of the EF52 siRNA (FIG. 7B).
Example 9
[0156] EF52 siRNA Pulldown DNMT3A
[0157] Transcriptional gene silencing by siRNAs in human cells
involves some level of DNA methylation (Morris et al., 2004b;
Kawasaki and Taira, 2004), indicating that DNA methyltransferases
might be involved mechanistically in the observed silencing. To
determine the mechanism underlying previously observed TGS in human
cells we developed an siRNA pull-down assay (FIG. 8) and screened
the binding potential of DNA methyltransferases (DNMT) 1, 3A, 3A2,
3B1, 3B2, and heterochromatin proteins (HP1-alpha, beta, and gamma)
to the promoter targeted EF52 siRNAs (Table 1). Expression of each
of the flag-tagged proteins was detected in the whole cell lysates
with the exception of DNMT 3B1 and HP1-gamma, which had low to no
expression (FIGS. 9A and 9B, respectively). Remarkably, when the
whole cell lysates (FIGS. 9A-9B) were incubated in the presence of
5' biotin end labeled EF52 siRNA and the complexes pulled-down with
avidin bound magnetic beads only DNMT 3A, 3A2 and 3B2 were eluted
(FIG. 9C). While the control Prp2, Mock, and DNMT-1 (MT1) showed no
binding to the EF52 biotin labeled siRNAs (FIGS. 9A-9C). The
binding of DNMT3A was similar to previously reported findings of
siRNAs binding in vitro to mouse DNMT3A (Jeffery and Nakielny,
2004).
[0158] Next we wanted to determine if there was any strand
specificity in the DNMT3A/EF52 siRNA binding, as strand specific
binding could be indicative of the underlying mechanism of siRNA
mediated TGS. To determine the specificity of binding we incubated
biotin 5' end labeled sense, antisense, sense/antisense and control
non-biotin labeled sense/antisense siRNAs with DNMT1 and DNMT3A
containing extracts (FIG. 9D). Interestingly, the antisense strand
of EF52 showed significantly increased binding potential that was
comparable to the biotin-sense/antisense treatment alone (FIG. 9E).
A similar observation was gained by performing a DNMT-Flag
immunoprecipitation followed by probing with radiolabelled siRNAs
(sense or antisense) (FIG. 10). These data suggest that the
antisense strand may direct the observed siRNA mediated TGS through
interactions with DNMT3A. TABLE-US-00011 TABLE 1 DNMTs and HP1s
used in siRNA pull-down experiments. Flag-Tagged protein Function
DNMT-1 Maintenance DNA methyltransferase, also involved in (MT1)
methylation during embryogenesis (8) DNMT-3A De novo methylation,
involved in methylation during embryogenesis and transcriptional
repression (8, 9) DNMT-3A2 De novo methyltransferase (8) DNMT-3B1
De novo methylation, involved in methylation during embryogenesis
and transcriptional repression (8, 9) DNMT-3B2 Involved in
methylation during embryogenesis (8) HP1-alpha Involved in
transcriptional silencing by tethering DNA and bind core histones
(10, 11) HP1-beta Involved in transcriptional silencing by
tethering DNA and bind core histones (10, 11) HP1-gamma Involved in
transcriptional silencing by tethering DNA and bind core histones
(10, 11) PRP2 Negative control: RNA dependent RNA-ATpase (12, 13)
All flag-tagged DNMTs were a gift from A. Riggs (COH/BRI), HP1
(alpha, beta, gamma) were a gift R. Losson, Institute de Genetique
et de Biologie Moleculaire et Cellulaire, France, and PRP2 was a
gift from R J Lin (COH/BRI).
Example 10
[0159] Histone Methylation and siRNA Specificity
[0160] Unlike RNA interference, transcriptional silencing in
mammalian cells is mediated by a combination of chromatin
modifications that include histone deacetylation and cytosine DNA
methylation (Bird and Wolffe, 1999). Silencing by EF52 siRNA was
completely relieved by treating the cells with TSA and 5'-AzaC,
drugs that inhibit histone deacetylases and DNA methyltransferases
respectively (Morris et al., 2004b) and data presented here clearly
shows H3K9 and H3K27 methylation is involved in the observed siRNA
induced TGS of EF1A. To explore the link between histone 3 lysine
methylation and siRNA specificity to the targeted promoter we
performed a ChiP/RNA co-immunoprecipitation assay (as depicted in
FIG. 8B). A .about.4.8 fold increase in detectable EF52 targeted
promoter relative to the no antibody control was observed in
H3K27/antisense EF52 siRNA co-immunoprecipitates indicating H3K27,
antisense siRNA EF52, and the targeted EF1A promoter EF1A
co-localize in vivo (FIG. 11A). The observation(s) that 1) siRNAs
bind DNMT3A (FIG. 9A-9D and Jeffery and Nakielny (2004)), 2) siRNA
mediated TGS is reversible with the addition of both 5-AzaC and TSA
(Morris et al., 2004b) and 3) Histone 3 lysine methylation (FIG.
7A) is present offers some clues to the underlying complex involved
in siRNA mediated TGS in human cells.
[0161] To investigate the core complex involved in siRNA EF52
mediated TGS we performed a triple-immunoprecipitation assay (as
depicted in FIG. 8C). This assay consists of first a CHiP for H3K27
followed by a Flag-Tagged DNMT3A immunoprecipitation and then a
siRNA biotin/avidin pulldown followed by a PCR for the targeted
promoter in the final elute. Interestingly, the antisense EF52
strand was enriched .about.2 and 3.5 fold relative to the no
antibody and sense alone controls respectively (FIG. 11B). Notably
the triple-immunoprecipitation was relatively inefficient with the
antisense elute containing only .about.7.6% of the control input
(FIG. 11B).
Example 11
[0162] Antisense Strand of siRNA Directs TGS
[0163] The observation that the antisense strand of the siRNA is
preferentially detected in the co-immunoprecipitation assays
suggest that the antisense can function alone to direct TGS. To
determined if the antisense alone can direct TGS we designed
plasmids expressing from the U6 promoter either the antisense,
sense, or both sense/antisense targeting the U3 region of the HIV-1
LTR/promoter. Indeed, both U3 LTR specific siRNAs (Table 2) and
remarkably, the antisense showed a profound and robust suppression
of U3 expressed luciferase relative to controls in TZM-B1 cells
(FIG. 12 and 11E). However, while TZM-B1 cells contain an
integrated lentiviral vector expressing luciferase from the HIV-1
LTR they also contain the 3' LTR (Wei et al., 2002). As such it is
possible that some of the observed suppression was the result of
the antisense siRNAs binding the 3' LTR and thus inhibiting
luciferase expression in a PTGS based fashion. To determine if the
antisense siRNAs can function to induce TGS we transfected 1G5
cells containing the LTR expressing the luciferase with an SV40
poly-A (Aguilar-Cordorva et al., 1994). Interestingly, only the
antisense LTR-247 siRNA (Table 2) induced TGS (FIG. 11). These data
clearly suggest that the antisense strand of the siRNA directs
transcriptional silencing in human cells as well as suggest that
fundamental differences in target site accessibility might also be
present (i.e. LTR-362 overlaps the NF-kB binding site and LTR-247
does not, Table 2). TABLE-US-00012 TABLE 2 siRNAs used in the HIV-1
U3 Targeting. Sequence (Target) siRNA (Position) (SEQ ID NO:) % GC
247 (249-267 in LTR GTGTTAGAGTGGAGGTTTG (29) 47.4 of HIV subtype B)
362 (354-372 in LTR CTTTCCGCTGGGGACTTTC (30) 57.9 of HIV subtype B)
247c (249-267 in LTR GTATTAAAGTGGAAGTTTG (31) 31.5 of HIV subtype
C) 362c (354-372 in LTR CTTTCCACTGGGGCGTTCC (32) 63.2 of HIV
subtype C) GFP (108-126 in GFP CGATGCCACCTACGGCAAG (33) 63.2 mRNA)
R5 Control (787-805 TTCTTTGGCCTGAATAATT (34) 31.6 in CCR5 mRNA)
Example 12
[0164] Transcription Required for siRNA Mediated TGS
[0165] The observation that the antisense strand of the siRNA is
preferentially involved in siRNA mediated TGS suggest a mechanism
that may be an antisense siRNA/RNA interaction (possibly non-coding
RNA, personal communication R. Allshire) or an antisense siRNA/DNA
interaction is present in the siRNA promoter targeting. The
observation that only LTR-247 can mediate TGS of the U3 from HIV-1
LTR also supports a promoter accessibility or siRNA/DNA
interaction. Regardless, both possibilities suggest that
transcription may be required for the initiation of siRNA mediated
TGS. To determine if transcription is required for siRNA mediated
TGS we performed EF52 (treatment) or CCR5 (control) MPG mediated
transfections and 24 hrs later treated 1/2 of the cultures with
alpha amanatin (0.05 .mu.g/ml) to inhibit RNA polymerase II
(Pol-II) and then assayed for Histone 3 Lysine 9 methylation.
Importantly, alpha amanatin treatment inhibited siRNA EF52 mediated
Histone 3 Lysine 9 methylation (FIG. 11E) suggesting that RNA
Pol-II mediated transcription is required for siRNA mediated
TGS.
[0166] The initial discovery that promoter targeted siRNAs can
induce gene silencing in human cells proved that small RNAs in
mammals, Drosophila, C. elegans and plants can regulate gene
expression by three conserved mechanisms: transcriptional gene
silencing, mRNA degradation and translational inhibition. While
there are many functional similarities between siRNA mediated TGS
in mammals, Drosophila, C. elegans and plants the underlying
mechanism may be somewhat varied. Data presented here suggests that
the de novo DNA methyltransferase enzymes of the DNMT3 family are
possibly guided by the small RNAs to the targeted promoter. The
observation that DNMT-1 does not bind siRNA EF52 while DNMT3A and
3B (data not shown) do suggests that the de novo methyltransferases
bind dsRNA independent of the DNA binding domain (Datta et al.,
2003; Xie et al., 1999). Interestingly, DNMT3A has been shown to
bind siRNAs (Jeffery and Nakielny, 2004) as well as associate with
histone deacetylase 1 (HDAC1), the histone methyltransferase
(Suv39H1), and HP1 (Fuks et al., 2003). Moreover, the observation
that the antisense strand of EF52 preferentially binds DNMT3A and
co-immunoprecipitates in vivo with DNMT3A, H3K27, and the targeted
promoter and is efficacious in suppressing HIV-1 Tat induced U3
mediated transcription suggests a mechanism of action.
[0167] The emerging model for the mechanism of siRNA mediated TGS
in human cells is proposed to operate temporally as: 1) the siRNA
is either unwound and/or binds DNMT3A and then acted on by a
helicase which then 2) allows the antisense strand to direct the
DNMT3a to the targeted promoter leading ultimately to promoter site
recognition. Next, 3) the DNMT3a/antisense siRNA complex may
contain or then recruit HDAC-1 and Suv39H1 (Datta et al., 2003;
Fuks et al., 2003; Fuks et al., 2001) which could 4) lead to the
removal of the acetate and subsequent methylation of histone 3
lysine 9 and/or lysine 27 (Kawasaki and Taira, 2004) (FIG. 13). The
result of H3K9 and/or H3K27 methylation is the suppression of the
particular targeted genes expression (Mutskov and Felsenfeld, 2004;
Bachman et al., 2001). Finally, if the gene silencing is
re-enforced and positively selected for by the cell and it's local
environment then DNA methylation and permanent silencing of the
antisense siRNA targeted gene may ensue. Indeed HDAC-1,
DNMT3a/siRNA and the NuRD chromatin remodeling complex (Jeffery and
Nakielny, 2004; Datta et al., 2003; Zhang et al., 1999) can all be
linked indicating one potential pathway to siRNA mediated TGS.
Interestingly, the observation that there is strand specificity in
the observed co-immunoprecipitations suggests two models for
siRNA/promoter recognition; 1) there is an antisense siRNA and
non-coding RNA interaction at the core of the targeting or 2) the
unwinding of promoter DNA by RNA polymerase II allows for an
antisense/DNA interaction to occur leading to promoter site
recognition and subsequent silencing.
[0168] Short interfering RNAs (siRNAs) have been shown to silence
genes at the transcriptional level in human cells (Morris et al.,
2004b; Kawasaki and Taira, 2004; Kawasaki et al., 2005). Using
human cells, we show that EF1A promoter-directed siRNA EF52 binds
DNMT3A and directs histone methylation whereas controls do not. The
binding of siRNA to DNMT3A was specific and showed a strand
preference that co-immunoprecipitated with H3K27 and the targeted
promoter. These results are the first demonstration that promoter
directed siRNAs bind DNMT3A and co-localize to the targeted
promoter and as such suggest a mechanism for siRNA mediated TGS in
human cells. Importantly, the observation that siRNAs direct
histone methylation and this effect is reversed by the inhibition
of RNA Pol-II suggests that transcription is required for siRNA
mediated TGS as well as that siRNAs may function to direct and/or
write the histone code. Taken together these data propose that
siRNAs mediate control of DNA in an RNA Pol-II mediated fashion
through epigenetic modifications specifically involving histone 3
methylation and DNMT3A. These findings propose that dsRNA,
specifically the antisense strand, plays a pivotal and
underappreciated role in regulating the cell that could be
conceptualized to be used therapeutically in treating virtually any
ailment affecting humans.
Example 13
[0169] Materials and Methods for Examples 14-18
[0170] Cell culture: We sequestered a reporter system that contains
the CCR5 promoter driving expression of a marker gene (red-shifted
GFP). The vector pR5-GFPsg143 contains .about.3 kb of CCR5
promoter, intron, and exons 1 and 2 (Guignard et al., 1998;
Moriuchi et al., 1997; Mummidi et al., 1997) and drives the
expression of red-shifted GFP (a gift from Dr. G. N. Pavlakis)
(Rosati et al., 2001). A total of 4.0.times.10.sup.6 293T cells
were transfected with vector pR5-GFPsg143 (5 .mu.g, Lipofectamine
2000.TM.) and neomycin-selected (800Ag/ml) to generate the stable
cell population (293T CCR5-GFP). HeLa stable cells expressing
RASSF1A promoter-specific shRNAs or control vector alone were
previously generated in our lab (a gift from Dr. D. Castanotto)
(Costanotto et al., 2005).
[0171] siRNA screening: To screen CCR5 promoter-specific siRNAs for
knockdown of GFP expression, a total of 9.4.times.10.sup.5 293T
CCR5-GFP cells were plated/well in a 12-well plate and 24 hrs later
transfected with the respective promoter-specific siRNAs (Table 3)
and the CCR5 mRNA control siRNA (10 nM) using MPG at a 10:1 charge
ratio (MPG:siRNA), as described in Morris et al. (2004b) and Morris
et al. (1997). The respective siRNAs were constructed from
oligonucleotides following previously established methodologies for
T7 expressed siRNA synthesis (Ambion Silencer.TM.m). 48 hrs
post-transfection, cultures were collected for fluorescence
activated cell sorting (FACS) analysis of GFP expression.
TABLE-US-00013 TABLE 3 CCR5 Specific siRNAs R5-25
5'-GCCAAAGCUUUUUAUUCUAaa-3' (SEQ ID NO: 35)
3'-aaCGGUUUCGAAAAAUAAGAU-5' (SEQ ID NO: 36) R5-61
5'-GCCCAGAGGGCAUCUUGUGaa-3' (SEQ ID NO: 37)
3'-aaCGGGUCUCCCGUAGAACAC-5' (SEQ ID NO: 38) R5-149
5'-CCGCCAAGAGAGCUUGAUAaa-3' (SEQ ID NO: 39)
3'-aaGGCGGUUCUCUCGAACUAU-5' (SEQ ID NO: 40) R5-854
5'-GCCCGUAAAUAAACUUUCAaa-3' (SEQ ID NO: 41)
3'-aaCGGGCAUUUAUUUGAAAGU-5' (SEQ ID NO: 42) R5-
5'-AAUUCUUUGGCCUGAAUAAaa-3' (SEQ ID NO: 43) Con-
3'-aaUUAAGAAACCGGACUUAUU-5' (SEQ ID NO: 44) trol
[0172] Chromatin immunoprecipitation: ChIP assays (Strahl-Bolsinger
et al., 1997) were performed on 4.0.times.10 293T CCR5-GFP cells
transfected with 30 nM of synthetic (generated by IDT, Coralville,
Iowa) R61 siRNA or control R5 siRNA using Lipofectamine 2000w.
Treated cultures were formaldehyde cross-linked (1%, 10 min, room
temp (RIT)) and then the reaction was stopped by adding glycine at
a final concentration of 0.125 M (10 min, R/T). The cells were then
washed twice in 1.times.PBS+1/1000 PMSF (stock PMSF at 0.5M),
resuspended in 600 .mu.l of ChIP lysis buffer (50 mM HEPES pH 7.5,
140 mM NaCl, 10% Triton X100, 0.1% NaD, 1/1000 PMSF) and incubated
on ice (10 min). Next, the samples were centrifuged (5,000 rpm, 5
min, 4.degree. C.), resuspended in 600 .mu.l ChIP lysis buffer,
incubated on ice (10 min) and then sonicated (Branson 50 cell
machine, 6 intervals with 20 second pulses and 2 min rests). The
sonicated samples were then centrifuged (14,000 rpm, 10 min,
4.degree. C.) and the supernatants removed and pre-cleared with 30
.mu.l protein A/Salmon Sperm (Upstate, Charlottesville, Va.,
catalog #16-157) (15 min, 4.degree. C., rotating platform). The
pre-cleared supernatants were then centrifuged (14,000 rpm, 5 min,
4.degree. C.) and supernatants removed and divided into equivalent
aliquots. The partitioned samples were incubated with no antibody
(control), anti-H3K9.sup.me2+ (Upstate catalog #07-441), anti-Ago1
(Upstate catalog #07-599), anti-RNAPII (Abcam, Cambridge, Mass.,
catalog # ab817), anti-H3K27.sup.me3+ (Upstate catalog #07-449),
anti-TRBP antiserum (a gift from Dr. A. Gatignol) (Duarte et al.,
2000), and anti-Ago2 (Upstate catalog #07-590) (3 hrs to overnight,
4.degree. C., rotating platform). The samples were then treated
with 10 .mu.l Protein A/Salmon Sperm (Upstate), (15 min, R/T,
rotating platform), pulled-down (10,000 rpm, 1 min, 4.degree. C.),
and washed. The no antibody control supernatants were saved and
used as input controls. The washes consisted of 2 washes with 1 ml
of ChIP lysis buffer, 2 washes with 1 ml ChIP lysis buffer high
salt (50 mM HEPES pH 7.5, 500 mM NaCl, 1% Triton X100, 0.1% NaD,
1/1000 PMSF), followed by 2 washes with 1 ml ChIP wash buffer (10
mM Tris pH 8.0, 250 mM LiCl, 0.5% NP-40, 0.5% NaD, 1 mM EDTA). For
each wash the samples were incubated (3 min, R/T, rotating
platform), followed by centrifugation (14,000 rpm, 3 min, R/T).
After the final wash the complexes were eluted by two treatments of
100 .mu.l elution buffer (50 mM Tris pH 8.0, 1% SDS, 10 mM EDTA)(10
min, 65.degree. C.), followed by centrifugation (14,000 rpm, 3 min,
R/T). The eluted complexes along with the initial aliquot used in
the no antibody control (200 .mu.l) were then reverse cross-linked
by adding 1 .mu.l RNase A (10 mg/ml) and 20 .mu.l of 5M NaCl to
each sample and incubated (4-6 hrs, 65.degree. C.). The reverse
cross-linked samples were then treated (10 .mu.l of 0.5M EDTA, 20
.mu.l of 1M Tris-HCl pH 6.5, 2 .mu.l of 10 mg/ml Proteinase K)(1
hr, 45.degree. C.) and the DNA recovered by Phenol/Chloroform
extraction and assayed using real-time PCR (40 cycles of
94:55:72.degree. C. at 30:30:30 seconds) with primers 5'chip-2
5'-GGG GTC TCA TTT GCC TTC TTA GAG ATC ACA-3' (SEQ ID NO:45) and
3'chip-3 5'-TAA GTA TAT GGT CAA GTT CAG GTT C-3' (SEQ ID NO:46)
that specifically overlap the CCR5 promoter R61 siRNA target site,
standardized to plasmid pR5-GFPsg143, and normalized to input
values. To determine the extent of Ago1 and H3K9.sup.me2+
spreading, primers 5'walk-15'-GTC TTC TCA GCT CTG CTG ACA ATA CT-3'
(SEQ ID NO:47) and 3'walk-25'-GGA TTT TCA CTC TGT TCA CTA TTT TGT
TGC-3' (SEQ ID NO:48) that overlap a region .about.100 to 300 bp
downstream of the CCR5 promoter R61 siRNA target site were used.
For RASSF1A promoter ChIP experiments, primers 5'ras-1 5'-GAA GGA
AGG GCA AGG CGG GGG GGG CTC TGC-3' (SEQ ID NO:49) and 3'ras-1
5'-GGC CCG GTT GGG CCC GTG CTT CGC T-3' (SEQ ID NO:50) were
used.
[0173] qRT-PCR amplification: SuperScript.TM. III Platinum SYBR
Green One-Step qRT-PCR kit (Invitrogen, Carlsbad, Calif.) was used
to amplify GFP, RASSF1A, and GAPDH transcript levels from total RNA
isolated with RNA STAT-60 .TM. (Tel-Test, Friendswood, Tex.), using
GFP and GAPDH primers as previously described (Morris et al.,
2004b). RASSF1A primers used were URFIA 5'-TGG TGC GAC CTC TGT GGC
GAC TT-3' (SEQ ID NO:51) and RT45'-GAT GAA GCC TGT GTA AGA ACC GTC
CT-3' (SEQ ID NO:52) as previously described (Costanotto et al.,
2005).
[0174] Western analysis and RNase treatment: Total protein from
293T CCR5-GFP whole cell extracts, anti-RNAPII (Abcam, Cambridge,
Mass., catalog # ab817) immunoprecipitates, anti-RNAPII
immunoprecipitates from cell extracts treated for 30 min in 50
.mu.g /ml RNase A (Sigma, St. Louis, Mo.) at 25.degree. C., and
extracts from Ago1 siRNA treated [Ago1(-)] or control R5 siRNA
treated [Ago1(+)] 293T CCR5-GFP cells were heated (5 min,
95.degree. C.), separated by electrophoresis in 4-12% SDS
polyacrylamide electrophoresis, transferred to PVDF membranes,
probed with anti-Ago1 (Upstate catalog # 07-599), and developed
with anti-rabbit horseradish peroxidase-labelled antibodies
(Amersham Biosciences, Pittsburgh, Pa.) and Luminol detection
reagent (Fisher, Hampton, N.H.).
[0175] Promoter methylation analysis: Genomic DNA was digested for
1 hour with Ava I (New England Biolabs, Ipswich, Mass.) or Apa I
(New England Biolabs) at 37.degree. C. for R61 or R5 control siRNA
treated 293T CCR5-GFP cells or RASSF1A shRNA or control vector
expressing HeLa stable cells, respectively and used as templates
for promoter specific real-time PCR (40 cycles of 94:55:72.degree.
C. at 30:30:30 seconds) with ChIP primers for the CCR5 and RASSF1A
promoters. PCR amplification indicates that the Ava I or Apa I
sites within the targeted promoter sequences are methylated and as
such protected from enzyme digestion. All values were normalized to
equivalent amounts of undigested genomic DNA samples incubated in
NEBuffer #4 alone.
Example 14
[0176] siRNA Mediated Silencing of CCR5 Promoter
[0177] To measure the levels of siRNA mediated silencing at the
targeted CCR5 promoter, we generated a stable cell line expressing
CCR5 promoter-driven green fluorescent protein (293T CCR5-GFP).
Four candidate siRNAs with sequence homology to the CCR5-GFP
promoter (Table 3) were screened for inhibition of GFP expression
at 48 hrs post-siRNA transfection, with two siRNAs (R61 and R149)
showing .about.50% reduction of protein levels (FIG. 14). GFP mRNA
levels were measured at 24 hrs post-siRNA transfection using
real-time quantitative RT-PCR (qRT-PCR) and normalized to GAPDH
levels. In cells treated with promoter-specific R61 siRNA, we
observed .about.69% knockdown of GFP mRNA transcript levels when
compared to R5 control siRNA (CCR5 mRNA-specific) transfected cells
(FIG. 15A), similar to previous observations with siRNAs targeted
to RNAPII promoters (Morris et al., 2004b; Weinberg et al., 2006;
Ting et al., 2005). Furthermore, we examined siRNA mediated TGS at
the endogenous RASSF1A promoter using HeLa cell lines stably
expressing a short hairpin RNA (shRNA) targeted to the RASSF1A
promoter or a control vector not expressing an shRNA (Castanotto et
al., 2005). RASSF1A mRNA transcript levels exhibited .about.74%
knockdown by promoter-targeted shRNAs in this constitutively
expressed setting (FIG. 15A).
Example 15
[0178] siRNA Mediated Induction of Silent Histone Modifications
[0179] Previous work has shown that siRNA mediated TGS correlates
with silent histone methylation marks, and H3K9.sup.me2+ and
H3K27.sup.me3+ have been found to associate with siRNA targeted
promoters (Weinberg et al., 2006; Ting et al., 2005). To determine
whether the CCR5 promoter-specific R61 siRNA could induce silent
histone modifications, we screened the CCR5-GFP promoter
specifically at regions overlapping the R61 siRNA target site using
chromatin immunoprecipitation (ChIP) for H3K9.sup.me2+. A
.about.14-fold enrichment of H3K9.sup.me2+ was observed at 24 hrs
post-R61 siRNA transfection, relative to R5 control siRNA
transfected cells (FIG. 15B) and consistent with previously
observed epigenetic modifications (Weinberg et al., 2006; Ting et
al., 2005). To test whether spreading of H3K9.sup.me2+ to adjacent
nucleosomes was occurring, we performed ChIP experiments using PCR
primers spanning a region .about.100 to 300 bp downstream of the
R61 siRNA target site. A .about.7-fold enrichment of H3K9.sup.me2+
was observed downstream of the promoter target site (FIG. 15B).
Time-course ChIPs of the CCR5-GFP promoter showed an increase in
H3K9.sup.me2+ at the targeted promoter between 12 and 24 hrs
post-siRNA transfection (FIG. 15C). However, only a negligible
amount of DNA methylation was observed at the targeted CCR5-GFP
promoter, while a slight increase in DNA methylation occurred when
constitutively expressed shRNAs were targeted to the RASSF1A
promoter (FIG. 16).
Example 16
[0180] Contribution of Ago1 or Ago2 to siRNA Mediated Promoter
Silencing
[0181] We next investigated whether Ago1 or Ago2 might contribute
to siRNA mediated promoter silencing, as Ago1 directs the induction
and spreading of H3K9.sup.me2+ and TGS in S. Pombe (Verdel et al.,
2004; Noma et al., 2004), and Ago2 is a component of the
well-characterized RNA-induced silencing complex (RISC) in human
cells (Liu et al., 2004). ChIP experiments in 293T CCR5-GFP cells
transfected with R61 or R5 control siRNAs showed an .about.18-fold
enrichment of Ago1 at the CCR5-GFP promoter in R61 siRNA
transfected cells (FIG. 17A). Interestingly, a .about.14-fold
enrichment of Ago1 downstream of the R61 target site was also
observed (FIG. 17A), suggesting that spreading of Ago1 may direct
and/or associate with downstream histone modifications, leading to
the spreading of TGS along the targeted gene. Additionally, Ago1
was also enriched at the shRNA-targeted endogenous RASSF1A promoter
(FIG. 17A). We did not, however, observe enrichment of Ago2 in our
ChIP experiments in 293T CCR5-GFP cells transfected with R61 or R5
control siRNAs (FIG. 18). To determine the temporal nature of Ago1
association with siRNA targeted promoters, time-course ChIPs were
conducted at 6 hr intervals from 12 to 30 hrs post-siRNA
transfection in 293T CCR5-GFP cells. The time-course ChIP
experiments demonstrated a transient association between Ago1 and
the targeted promoter (FIG. 17B), correlating with a concomitant
increase in H3K9.sup.me2+ (FIG. 15C). These data suggest that Ago1
directs siRNA mediated TGS of RNAPII promoters and acts upstream of
the histone modification pathway.
[0182] Recent reports in S. Pombe (Kato et al., 2005) and in human
cells (Weinberg et al., 2006) have also demonstrated that RNAPII is
required for siRNA mediated TGS. To determine whether RNAPII
associates with Ago1, we performed co-immunoprecipitations from
293T CCR5-GFP cell extracts and found that Ago1
co-immunoprecipitated with RNAPII (FIG. 17C). To test whether this
association between Ago1 and RNAPII was via a single-stranded RNA
intermediate that is transcribed through promoter regions, 293T
CCR5-GFP cell extracts were treated with RNase A. RNase A treatment
had no effect on the ability of RNAPII to co-immunoprecipitate Ago1
(FIG. 17C), suggesting a direct protein-protein interaction between
an Ago1-containing transcriptional silencing complex and
RNAPII.
Example 17
[0183] RNAi Mediated Knockdown of Ago1
[0184] RNAi mediated knockdown of Ago1 was next used to investigate
the requirement of Ago1 in directing di-methylation of H3K9 and
silencing gene expression. 293T CCR5-GFP cells were transfected
with a validated, Ago1 mRNA-specific siRNA (Meister et al., 2004),
and knockdown of Ago1 expression was determined at 48 hrs post-Ago1
siRNA transfection (FIG. 19A). Ago1 siRNA treated cells [Ago1(-)]
or R5 control siRNA treated cells [Ago1(+)] were transfected with
promoter-specific R61 siRNAs at 24 hrs following the Ago1 siRNA or
R5 control siRNA transfections. GFP transcript levels were markedly
elevated in Ago1(-) cells at 24 hrs post-R61 siRNA transfection,
relative to R61-transfected Ago1(+) cells which exhibited typical
levels of Ago1 expression (FIG. 19B). Knockdown of Ago1 resulted in
the loss of Ago1 binding at the targeted CCR5-GFP promoter in ChIP
experiments, which also correlated with a noticeable reduction in
the levels of H3K9 (FIG. 19C). These data indicate that Ago1
localization to the targeted promoter region is required for H3K9
di-methylation and siRNA mediated TGS in human cells.
Example 18
[0185] ChIP Analysis of Endogenous CCR5 Promoter
[0186] Evluation of the endogenous CCR5 promoter in HEK 293 and
HeLa cells through ChIP experiments revealed that Ago1 also
localized to the epigenetically silenced CCR5 promoter in both cell
types (FIGS. 20A and 20B). Ago2 was not observed in HEK 293 cells
in our ChIP experiments of the endogenous CCR5 promoter (FIG. 18),
analogous to our Ago2 ChIP data at the siRNA targeted CCR5-GFP
promoter in 293T CCR5-GFP cells. Supporting our observation that
RNAPII co-immunoprecipitates with Ago1 at epigenetically silenced
promoters, RNAPII was also present at the silenced CCR5 promoters
in both HEK 293 and HeLa cells, as determined by ChIP (FIGS. 20A
and 20B). These data suggest that low levels of RNAPII
transcription of endogenously silenced promoters are required to
maintain an epigenetically silent state. Enrichment of
H3K27.sup.me3+ was observed at the endogenous CCR5 promoters in
both cell types (FIGS. 20A and 20B), indicating the presence of a
histone mark that is known to recruit the PcG repressor proteins to
regions of facultative heterochromatin.
[0187] A recently characterized component of the RNAi machinery is
the HIV-1 TAR RNA-binding protein 2 (TRBP2), a double-stranded
RNA-binding protein that has been shown to be a component of the
effector complex RISC (Forstemann et al., 2005; Gatignol et al.,
2005; Gregory et al., 2005; Haase et al., 2005; Lee et al., 2006).
We sought to determine whether TRBP2 might also be associated with
Ago1 in a nuclear transcriptional silencing complex. We utilized
anti-TRBP2 antiserum (kindly supplied by A. Gatignol) to perform
ChIPs of the CCR5 and RASSF1A promoters in HeLa cells. TRBP2 was
enriched at the endogenous CCR5 promoter in HeLa cells at levels
similar to Ago1 enrichment (.about.5.23 and 18 5.59-fold
enrichment, respectively) (FIGS. 20B and 20C), suggesting a nuclear
transcriptional silencing complex composed of Ago1 and TRBP2.
Furthermore, TRBP2 localized to the shRNA-targeted and Ago1
enriched RASSF1A promoter (FIG. 20C). These findings suggest an
endogenous mechanism of transcriptional regulation involving
several components of the RNAi machinery, RNAPII transcription, and
Polycomb group proteins, all of which may act in concert to mediate
formation and maintenance of facultative heterochromatin.
[0188] The current paradigm for the mechanism of TGS in human cells
involves H3K9, H3K27, and DNA methylation at the siRNA targeted
promoters (Morris et al., 2004b; Castanotto et al., 2005; Buhler et
al., 2005; Janowski et al., 2005; Zhang et al., 2005; Suzuki et
al., 2005), although the requirement of DNA methylation for TGS in
human cells is still uncertain (Ting et al., 2005; Janowski et al.,
2005; Park et al., 2004; Svoboda et al., 2004) and may possibly be
promoter-dependent. Data presented here reveal that Ago1 directs
siRNA mediated TGS by associating with targeted promoters through
an interaction with RNAPII. The finding that Ago1 is required for
siRNA mediated promoter silencing and H3K9.sup.me2+, coupled with
the observation that transient association of Ago1 at the targeted
promoter corresponds with an increase in H3K9.sup.me2+, suggests
that Ago1 functions upstream of chromatin modifications that
silence gene expression by recruiting specific histone
methyltransferases such as G9a (H3K9.sup.me2+) and/or EZH2
(H3K27.sup.me3+) (Vire et al., 2006).
[0189] Along with previously published observations (Morris et al.,
2004b; Weinberg et al., 2006; Ting et al., 200; Buhler et al.,
2005; Suzuki et al., 2005), the findings presented here suggest a
putative model for siRNA mediated TGS in human cells involving a
transcriptional silencing complex (TSC) containing Ago1, TRBP2,
siRNA, and possibly chromatin remodeling factors (i.e. HDAC-1, G9a,
EZH2, DNMT3a) (Weinberg et al., 2006; Morris et al., 2005) (FIG.
21). The TSC may be directed by siRNAs to their target promoters in
an RNAPII-dependent manner (Weinberg et al., 2005), and the
observation here that Ago1 associates with RNAPII suggests that
RNAPII may provide a docking site for the TSC. Upon siRNA loading
into the TSC, the antisense strand (Weinberg et al., 2006) may
guide the TSC to a low copy promoter-specific RNA (PRNA) that
corresponds to the siRNA targeted promoter (manuscript in
preparation: Han, Kim, Rossi, Morris). This would allow for the
formation of an RNA:RNA duplex between the antisense strand of the
siRNA and either a nascent pRNA while it is being transcribed or a
pRNA that is already a component of the local chromatin structure
(Maison et al., 2002). Recognition of the siRNA target site would
potentially stall the pRNA-scanning TSC:RNAPII complex and initiate
the formation of facultative heterochromatin by recruiting histone
methyltransferases and possibly PcG repressor complexes, which have
recently been linked to Ago1 and the RNAi machinery in Drosophila
(Grimaud et al., 2006). The inclusion of TRBP2 in the TSC suggests
a potentially important role for this protein in Ago1 mediated RNA
binding.
[0190] An alternative model implicated by the observed spreading of
TGS and facultative heterochromatin from a promoter nucleation site
would involve the siRNA antisense strand-directed TSC:RNAPII
complex moving along the targeted RNAPII-transcribed promoter/gene,
potentially modifying the H3 histones as they are reconstituted
into nucleosomes immediately following transcription. Both of these
models, or an amalgamation of the two, would necessitate the
involvement of RNAPII, which is consistent with recent evidence
that RNAPII function is required for histone methylation and TGS at
siRNA-targeted promoters in human cells (Weinberg et al., 2006) and
in S. Pombe (Kato et al.., 2005), suggesting an Ago1 and
RNAPII-dependent mechanism of transcriptional silencing that is
evolutionarily conserved. Additionally, the recent discovery and
characterization of a vast array of small (21- to 26-nt),
non-coding RNAs is changing the classical understanding of gene
regulation (Katayama et al., 2005), and taken together with the
data presented here, suggests that these non-coding RNAs may play a
more profound role in writing the histone code (Jenuwein and Allis,
2001) and regulating gene expression at the level of DNA.
Example 19
[0191] Additional Data Supporting Ago1 Involvement
[0192] We have generated new data that further supports the
connection between Argonaute 1 directed transcriptional gene
silencing (TGS) and Polycomb group mediated epigenetic silencing in
human cells. We have performed chromatin immunoprecipitations in
HeLa cells with a recently acquired antibody (Upstate) against the
H3K27.sup.me3+ histone methyltransferase and Polycomb group protein
EZH2. Our CHIP data shows enrichment of EZH2 at the shRNA-targeted
RASSF1A promoter (FIG. 22), suggesting that an Ago1 containing
transcriptional silencing complex (TSC) may recruit EZH2 to
epigenetically silence the targeted RASSF1A promoter. Furthermore,
EZH2 was also found to be enriched at the endogenously silenced
CCR5 promoter (FIG. 22), which we previously demonstrated was also
enriched for Ago1 (FIG. 20B), suggesting that Ago1 is involved in
the mechanism of endogenous epigenetic silencing at regions of
facultative heterochromatin. Recent genome-wide mapping for
Polycomb components in human cells has also shown that CCR5 is a
Polycomb target gene (Bracken et al., 2006).
[0193] Additionally, the low levels of DNA methylation that we have
observed at the shRNA-targeted RASSF1A promoter (FIG. 14;
Castanotto et al. 2005) may result from the recruitment of DNMT3a,
shown to associate with promoter-targeting siRNA (Weinberg et al.,
2006), by EZH2, which has recently been shown to recruit DNMT3a
(Vire et al., 2005).
[0194] We also performed ChIPs in HeLa cells of the human Polycomb
target promoter MYT1 (Kirmizis et al., 2004) and found enrichment
of Ago1, EZH2, and H3K27.sup.me3+ at this epigenetically silenced
promoter (FIG. 23). Collectively, these data provide additional
evidence in support of the connection between RNAi and Polycomb
silencing in human cells.
[0195] The use of the terms "a" and "an" and "the" and similar
referents in the context of describing the invention (especially in
the context of the following claims) are to be construed to cover
both the singular and the plural, unless otherwise indicated herein
or clearly contradicted by context. The terms "comprising,"
"having," "including," and "containing" are to be construed as
open-ended terms (i.e., meaning "including, but not limited to,")
unless otherwise noted. Recitation of ranges of values herein are
merely intended to serve as a shorthand method of referring
individually to each separate value falling within the range,
unless otherwise indicated herein, and each separate value is
incorporated into the specification as if it were individually
recited herein. All methods described herein can be performed in
any suitable order unless otherwise indicated herein or otherwise
clearly contradicted by context. The use of any and all examples,
or exemplary language (e.g., "such as") provided herein, is
intended merely to better illuminate the invention and does not
pose a limitation on the scope of the invention unless otherwise
claimed. No language in the specification should be construed as
indicating any non-claimed element as essential to the practice of
the invention.
[0196] It will be appreciated that the methods and compositions of
the instant invention can be incorporated in the form of a variety
of embodiments, only a few of which are disclosed herein.
Embodiments of this invention are described herein, including the
best mode known to the inventors for carrying out the invention.
Variations of those embodiments may become apparent to those of
ordinary skill in the art upon reading the foregoing description.
The inventors expect skilled artisans to employ such variations as
appropriate, and the inventors intend for the invention to be
practiced otherwise than as specifically described herein.
Accordingly, this invention includes all modifications and
equivalents of the subject matter recited in the claims appended
hereto as permitted by applicable law. Moreover, any combination of
the above-described elements in all possible variations thereof is
encompassed by the invention unless otherwise indicated herein or
otherwise clearly contradicted by context.
BIBLIOGRAPHY
[0197] E. Aguilar-Cordova, E. (1994). A sensitive reporter cell
line for HIV-1 tat activity, HIV-1 inhibitors, and T cell
activation effects. AIDS Res Hum Retroviruses 10:295-301.
[0198] Amarzguioui, M. et al. (2003). Tolerance for Mutation and
Chemical Modifications in a siRNA. Nucleic Acids Research
31:589-595.
[0199] Bachman, K. E. et al. (2001). Dnmt3a and Dnmt3b are
transcriptional repressors that exhibit unique localization
properties to heterochromatin. J Biol Chem 276:32282-32287.
[0200] Bernstein, E. et al. (2001) Role for a bidentate
ribonuclease in the initiation step of RNA interference. Nature
409:363-366.
[0201] Bertrand, E. et al. (1997). The expression cassette
determines the functional activity of ribozymes in mammalian cells
by controlling their intracellular localization. RNA 3:75-88.
[0202] Bird, A. P. and Wolffe, A. P. (1999). Methylation-induced
repression--belts, braces, and chromatin. Cell 99:451-.454
[0203] Bracken, A. P. and N. Dietrich, et al. (2006). "Genome-wide
mapping of Polycomb target genes unravels their roles in cell fate
transitions." Genes Dev 20(9): 1123-1136.
[0204] Brummelkamp, T. R. et al. (2002). A system for stable
expression of short interfering RNAs in mammalian cells. Science
296(5567):550-553.
[0205] Castanotto, D. et al. (2005). "Short hairpin RNA-directed
cytosine (CpG) methylation of the RASSF1A gene promoter in HeLa
cells." Mol Ther 12(1):179-183.
[0206] Chan, S. W. et al. (2004). RNA silencing genes control de
novo DNA methylation. Science 303:1336.
[0207] Datta, J. (2003). Biochemical fractionation reveals
association of DNA methyltransferase (Dnmt) 3b with Dnmtl and that
of Dnmt 3a with a histone H3 methyltransferase and Hdac1. J Cell
Biochem 88:855-864.
[0208] Duarte, M. et al. (2000). Characterization of TRBP1 and
TRBP2. Stable stem-loop structure at the 5' end of TRBP2 mRNA
resembles HIV-1 TAR and is not found in its processed pseudogene. J
Biomed Sci 7:494-506.
[0209] Eckstein, F. (2000). Phosphorothioate oligodeoxynucleotides:
what is their origin and what is unique about them? Antisense
Nucleic Acid Drug Dev 10: 117-21.
[0210] Elbashir, S. M. et al. (2001a). Duplexes of 21-nucleotide
RNAs mediate RNA interference in cultured mammalian cells. Nature
411:494-498.
[0211] Elbashir, S. M. et al. (2001b). RNA interference is mediated
by 21- and 22-nucleotide RNAs. Genes & Dev 15:188-200.
[0212] Fuks, F. et al. (2001). Dnmt3a binds deacetylases and is
recruited by a sequence-specific repressor to silence
transcription. EMBO J 20:2536-2544.
[0213] Fuks, F. et al. (2003). The DNA methyltransferases associate
with HP1 and the SUV39H1 histone methyltransferase. Nucleic Acids
Res 31:2305-2312.
[0214] Good, P. D. et al. (1997). Expression of small, therapeutic
RNAs in human cell nuclei. Gene Ther 4:45-54.
[0215] Guignard, F. et al. (1998). Gene organization and promoter
function for CC chemokine receptor 5 (CCR5). J Immunol
160:985-992.
[0216] Hamilton, A. et al. (2002). Two classes of short interfering
RNA in RNA silencing. EMBO J 21:4671-4679.
[0217] Hammond, S. M., et al. (2001). Argonaute2, a link between
genetic and biochemical analyses of RNAi. Science
293(5532):1146-1150.
[0218] Harborth, J. et al. (2003). Sequence, chemical, and
structural variation of small interfering RNAs and short hairpin
RNAs and the effect on mammalian gene silencing. Antisense Nucleic
Acid Drug Dev 13:83-105.
[0219] Heidel, J. D. et al. (2004). Lack of interferon response in
animals to naked siRNAs. Nat Biotechnol 22:1579-1582.
[0220] Herdewijn, P. (2000). Heterocyclic modifications of
oligonucleotides and antisense technology. Antisense Nucleic Acid
Drug Dev 10:297-310.
[0221] Holen, T. et al. (2002). Positional effects of short
interfering RNAs targeting the human coagulation trigger tissue
factor. Nucleic Acids Res 30:1757-1766.
[0222] Hornung, V. et al. (2005). Sequence-specific potent
induction of IFN-alpha by short interfering RNA in plasmacytoid
dendritic cells through TLR7. Nature Med 11:263-270.
[0223] Hu-Lieskovan, S. et al. (2005). Sequence-specific knockdown
of EWS-FLI1 by targeted, non-viral delivery of siRNA inhibits tumor
growth in a murine model of metastatic Ewing's sarcoma. Cancer Res
65(19):8984-92.
[0224] Jeffery, L. and Nakielny, S. (2004). Components of the DNA
methylation system of chromatin control are RNA-binding proteins. J
Biol Chem 279:49479-49487.
[0225] Jones, L. et al. (2001). RNA-directec transcriptional gene
silencing in plants can be inherited independently of the RNA
trigger and requires Met1 for maintenance. Cur Biol 11:747-757.
[0226] Judge, A. D. et al. (2005). Sequence-dependent stimulation
of the mammalian innate immune response by synthetic siRNA. Nat
Biotechnol 23:457-462.
[0227] Kawasaki, H. and Taira, K. (2004). Induction of DNA
methylation and gene silencing by short interfering RNAs in human
cells. Nature 431:211-217.
[0228] Kawasaki, H., et al. (2005). siRNA induced transcriptional
gene silencing in mammalian cells. Cell Cycle 4:442-448.
[0229] Ketting, R. F. et al. (2001). Dicer functions of RNA
interference and in synthesis of small RNA involved in
developmental timing in C. elegans. Genes Dev 15(20):2654-2659.
[0230] Kim, D. H. et al. (2005). Synthetic dsRNA Dicer substrates
enhance RNAi potency and efficacy. Nat Biotechnol 23:222-226.
[0231] Kim, E.-J. et al. (2005). IFI16 Is an Essential Mediateor of
Growth Inhibition, but Not Differentiation, Induced by the Leukemia
Inhibitory Factor/JAK/Stat Pathway in Medullary Thyroid Carcinoma
Cells. J Biol Chem 280(6):4913-4920.
[0232] Kirmizis, A. et al. (2004). "Silencing of human polycomb
target genes is associated with methylation of histone H3 Lys 27."
Genes Dev 18(13):1592-605.
[0233] Kreuter, J. (1991). Nanoparticles-preparation and
applications. In: Microcapsules and nanoparticles in medicine and
pharmacy, Donbrow M., ed, CRC Press, Boca Raton, Fla., pp.
125-14.
[0234] Lee, N. S. et al. (2002). Expression of small interfering
RNAs targeted against HIV-1 rev transcripts in human cells. Nature
Biotechnology 19:500505-.
[0235] Lee, Y. S. et al. (2004). Distinct roles for Drosophila
Dicer-1 and Dicer-2 in the siRNA/miRNA silencing pathways. Cell
117:69-81.
[0236] Ma, Z. et al. (2005). Cationic lipids enhance siRNA-mediated
interferon response in mice. Biochem Biophys Res Commun
330:755-759.
[0237] Matzke, M. A. et al. (1989). Reversible methylation and
inactivation of marker genes in sequentially transformed tobacco
plants. EMBO J 8: 643-649.
[0238] Mette, M. F. (2000). Transcriptional silencing and promoter
methylation triggered by double-stranded RNA. EMBO Journal
19:5194-5201.
[0239] Miyagishi, M. and Taira, K. (2002). U6 promoter driven
siRNAs with four uridine 3' overhangs efficiently suppress targeted
gene expression in mammalian cells. Nat Biotechnol
20(5):497-500.
[0240] Moriuchi, H. et al. (1997). Cloning and analysis of the
promoter region of CCR5, a coreceptor for HIV-1 entry. J Immunol
159:5441-5449 (1997).
[0241] Morris, K. V. et al. (2003). The effects of HHV-8 vMIP-II on
SIVmac251 infection and replication competent and incompetent
SIVmac239Delta3 vectors. Virus Res 94:103-112.
[0242] Morris, K. V. et al. (2004a). Transduction of cell lines and
primary cells by FIV-packaged HIV vectors. Mol Ther 10:181-190.
[0243] Morris, K. V. et al. (2004b). Small interfering RNA-induced
transcriptional gene silencing in human cells. Science
305:1289-1292.
[0244] Morris, M. C. et al. (1997). A new peptide vector for
efficient delivery of oligonucleotides into mammalian cells.
Nucleic Acids Res 25:2730-2736.
[0245] Mummidi, S. et al. (1997). The human CC chemokine receptor 5
(CCR5) gene. Multiple transcripts with 5'-end heterogeneity, dual
promoter usage, and evidence for polymorphisms within the
regulatory regions and noncoding exons. J Biol Chem
272:30662-30671.
[0246] Mutskov, V. and Felsenfeld, G. (2004). Silencing of
transgene transcription precedes methylation of promoter DNA and
histone H3 lysine 9. EMBO J 23:138-149.
[0247] Nielsen, A. L. et al. (2001). Heterochromatin formation in
mammalian cells: interaction between histones and HP1 proteins. Mol
Cell 7:729-739.
[0248] Pal-Bhadra, M et al. (2002). RNAi related mechanisms affect
both transcriptional and posttranscriptional transgene silencing in
Drosophila. Molecular Cell 9(2):315-327.
[0249] Paul, C. P. et al. (2002). Effective expression of small
interfering RNA in human cells. Nat Biotechnol 20(5):505-508.
[0250] Pham, J. W. et al. (2004). A Dicer-2-dependent 80s complex
cleaves targeted mRNAs during RNAi in Drosophila. Cell
117:83-94.
[0251] Platt, E. J. et al. (1998). Effects of CCR5 and CD4 cell
surface concentrations on infections by macrophagetropic isolates
of human immunodeficiency virus type 1. J Virol 72:2855-2864.
[0252] Reynolds, A. et al. (2004). Rational siRNA design for RNA
interference. Nat Biotechnol 22:326-330.
[0253] Rosati, M. et al. (2001). CCAAT-enhancer-binding protein
beta (C/EBP beta) activates CCR5 promoter: increased C/EBP beta and
CCR5 in T lymphocytes from HIV-1-infected individuals. J Immunol
167:1654-1662.
[0254] Rose, S. D. et al. (2005). Functional polarity is introduced
by Dicer processing of short substrate RNAs. Nucleic Acids Research
33(13):4140-4156.
[0255] Rusckowski, M. et al. (2000). Biodistribution and metabolism
of a mixed backbone oligonucleotide (GEM 231) following single and
multiple dose administration in mice. Antisense Nucleic Acid Drug
Dev 10:333-345.
[0256] Schramke, V. and Allshire, R. (2003). Hairpin RNAs and
retrotransposon LTRs effect RNAi and chromatin-based gene
silencing. Science 301:1069-1074.
[0257] Seitz, H. et al. (2003). Imprinted microRNA genes
transcribed antisense to a reciprocally imprinted
retrotransposon-like gene. Nat Genet 34:261-262.
[0258] Sledz, C. A. et al. (2003). Activation of the interferon
system by short-interfering RNAs. Nature Cell Biol 5:834-839.
[0259] Soifer, H. S. (2005). A potential role for RNA interference
in controlling the activity of the human LINE-1 retrotranspson.
Nucleic Acids Res 33:846-856.
[0260] Sontheimer, E. J. (2005). Assembly and function of RNA
silencing complexes. Nature Rev Mol Cell Biol, 6:127-138.
[0261] Stein, D. A. et al. (2001). Inhibition of Vesivirus
infections in mammalian tissue culture with antisense morpholino
oligomers. Antisense Nucleic Acid Drug Dev 11:317-25.
[0262] Strahl-Bolsinger, S. et al. (1997). SIR2 and SIR4
interactions differ in core and extended telomeric heterochromatin
in yeast. Genes Dev 11:83-93.
[0263] Tomari, Y. et al. (2004). A protein sensor for siRNA
asymmetry. Science 306:1377-1380.
[0264] Unwalla, H. J. et al. (2004). Negative feedback inhibition
of HIV-1 by TAT-inducible expression of siRNA. Nat Biotechnol
22:1573-1578.
[0265] Vermeulen, A. et al. (2005). The contributions of dsRNA
structure to Dicer specificity and efficiency. RNA 11:674-682.
[0266] Vire, E. et al. (2006). "The Polycomb group protein EZH2
directly controls DNA methylation." Nature 439(7078):871-874.
[0267] Volpe, T. A. (2002). Regulation of heterochromatic silencing
and histone H3 lysine-9 methylation by RNAi. Science
297:1833-1837.
[0268] Vorobjev, P. E. et al. (2001). Nuclease resistance and RNase
H sensitivity of oligonucleotides bridged by oligomethylenediol and
oligoethylene glycol linkers. Antisense Nucleic Acid Drug Dev
11:77-85.
[0269] Wassenegger, M. (2000). RNA-directed DNA methylation. Plant
Mol Biol 43:203-220.
[0270] Wassenegger, M., et al. (1994). RNA-directed de novo
methylation of genomic sequences in plants. Cell 76:567-576
(1994).
[0271] Wei, X. et al. (2002). Emergence of resistant human
immunodeficiency virus type 1 in patients receiving fusion
inhibitor (T-20) monotherapy. Antimicrob Agents Chemother
46:1896-1905.
[0272] Xie, S. et al. (1999). Cloning, expression and chromosome
locations of the human DNMT3 gene family. Gene 236:87-95.
[0273] Weinberg, M. S. et al. (2006). The antisense strand of small
interfering RNAs directs histone methylation and transcriptional
gene silencing in human cells. RNA 12:256-262.
[0274] Yu, J. Y. et al. (2002). RNA interference by expression of
short-interfering RNAs and hairpin RNAs in mammalian cells. Proc
Natl Acad Sci USA 99(9):6047-6052.
[0275] Zhang, Y. et al. (1999). Analysis of the NuRD subunits
reveals a histone deacetylase core complex and a connection with
DNA methylation. Genes Dev 13:1924-1935.
[0276] Zilberman, D. et al. (2003). ARGONAUTE4 control of
locus-specific siRNA accumulation and DNA and histone methylation.
Science 299:716-719.
Sequence CWU 1
1
52 1 176 DNA Homo sapiens 1 ggggctctgc gagagcgcgc ccagccccgc
cttcgggccc cacagtccct gcacccaggt 60 ttccattgcg cggctctcct
cagctccttc ccgccgccca gtctggatcc tgggggaggc 120 gctgaagtcg
gggcccgccc tgtggccccg cccggcccgc gcttgctagc gcccaa 176 2 180 DNA
Homo sapiens 2 ggggctctgc gagagcgcgc ccagccccgc cttcgggccc
cacagtccct gcacccaggt 60 ttccattgcg cggctctcct cagctccttc
ccgccgccca gtctggatcc tgggggaggc 120 gctgaagtcg gggcccgccc
tgtggccccg cccggcccgc gcttgctagc gcccaaagcc 180 3 300 DNA Homo
sapiens 3 agcgaagcac gggcccaacc gggccatgtc gggggagcct gagctcattg
agctgcggga 60 gctggcaccc gctgggcgcg ctgggaaggg ccgcacccgg
ctggagcgtg ccaacgcgct 120 gcgcatcgcg cggggcaccg cgtgcaaccc
cacacggcag ctggtccctg gccgtggcca 180 ccgcttccag cccgcggggc
ccgccacgca cacgtggtgc gacctctgtg gcgacttcat 240 ctggggcgtc
gtgcgcaaag gcctgcagtg cgcgcgtgag tagtggcccc gcgcgcctac 300 4 41 DNA
Artificial PCR primer 4 aatcgaacgc gtggatccaa ggtcgggcag gaagagggcc
t 41 5 20 DNA Homo sapiens 5 gtggaaagga cgaaacaccg 20 6 51 DNA
Artificial PCR primer 6 ctacacaaag gcgggccccg acttcagcgc ggtgtttcgt
cctttccaca a 51 7 47 DNA Artificial PCR primer 7 aactcgaatt
caaaaaagcg ctgaagtcgg ggcccgccct acacaaa 47 8 51 DNA Artificial PCR
primer 8 ctacacaaac gacatggccc ggttgggccc ggtgtttcgt cctttccaca a
51 9 47 DNA Artificial PCR primer 9 aactcgaatt caaaaaaggg
cccaaccggg ccatgtcgct acacaaa 47 10 18 DNA Artificial MSP primer 10
gggttttgcg agagcgcg 18 11 18 DNA Artificial MSP primer 11
gctaacaaac gcgaaccg 18 12 24 DNA Artificial MSP primer 12
ggggttttgt gagagtgtgt ttag 24 13 26 DNA Artificial MSP primer 13
taaacactaa caaacacaaa ccaaac 26 14 51 DNA Artificial PCR primer 14
ctacacaaac gatatggcgg ccttgggccc ggtgtttcgt cctttccaca a 51 15 47
DNA Artificial PCR primer 15 aactcgaatt caaaaaaggg cccaaggccg
ccatatcgct acacaaa 47 16 21 DNA Homo sapiens 16 aaggtggcgc
ggggtaaact g 21 17 21 DNA Aequorea victoria 17 aacgatgcca
cctacggcaa g 21 18 21 DNA homo sapiens 18 aattctttgg cctgaataat t
21 19 21 RNA homo sapiens 19 ccaccgcgcc ccauuugaca a 21 20 21 RNA
homo sapiens 20 aagguggcgc gggguaaacu g 21 21 49 DNA Artificial PCR
primer 21 aaaaaaaagt gttagagtgg aggtttgcgg tgtttcgtcc tttccacaa 49
22 49 DNA Artificial PCR primer 22 aaaaaaaaga aagtccccag cggaaagcgg
tgtttcgtcc tttccacaa 49 23 49 DNA Artificial PCR primer 23
aaaaaaaacg atgccaccta cggcaagcgg tgtttcgtcc tttccacaa 49 24 49 DNA
Artificial PCR primer 24 aaaaaaaact tgccgtaggt ggcatcgcgg
tgtttcgtcc tttccacaa 49 25 49 DNA Artificial PCR primer 25
aaaaaaaagt attaaagtgg aagtttgcgg tgtttcgtcc tttccacaa 49 26 48 DNA
Artificial PCR primer 26 aaaaaaaaca aacttccact ttaatacggt
gtttcgtcct ttccacaa 48 27 48 DNA Artificial PCR primer 27
aaaaaaaact ttccactggg gcgttccggt gtttcgtcct ttccacaa 48 28 49 DNA
Artificial PCR primer 28 aaaaaaaagg aacgccccag tggaaagcgg
tgtttcgtcc tttccacaa 49 29 19 DNA Human immunodeficiency virus 29
gtgttagagt ggaggtttg 19 30 19 DNA Human immunodeficiency virus 30
ctttccgctg gggactttc 19 31 19 DNA Human immunodeficiency virus 31
gtattaaagt ggaagtttg 19 32 19 DNA Human immunodeficiency virus 32
ctttccactg gggcgttcc 19 33 19 DNA Aequorea victoria 33 cgatgccacc
tacggcaag 19 34 19 DNA homo sapiens 34 ttctttggcc tgaataatt 19 35
21 RNA Artificial siRNA sense strand 35 gccaaagcuu uuuauucuaa a 21
36 21 RNA Artificial siRNA antisense strand 36 uagaauaaaa
agcuuuggca a 21 37 21 RNA Artificial siRNA sense strand 37
gcccagaggg caucuuguga a 21 38 21 RNA Artificial siRNA antisense
strand 38 cacaagaugc ccucugggca a 21 39 21 RNA Artificial siRNA
sense strand 39 ccgccaagag agcuugauaa a 21 40 21 RNA Artificial
siRNA antisense strand 40 uaucaagcuc ucuuggcgga a 21 41 21 RNA
Artificial siRNA sense strand 41 gcccguaaau aaacuuucaa a 21 42 21
RNA Artificial siRNA antisense strand 42 ugaaaguuua uuuacgggca a 21
43 21 RNA Artificial siRNA sense strand 43 aauucuuugg ccugaauaaa a
21 44 21 RNA Artificial siRNA antisense strand 44 uuauucaggc
caaagaauua a 21 45 30 DNA Artificial PCR Primer 45 ggggtctcat
ttgccttctt agagatcaca 30 46 25 DNA Artificial PCR primer 46
taagtatatg gtcaagttca ggttc 25 47 26 DNA Artificial PCR primer 47
gtcttctcag ctctgctgac aatact 26 48 30 DNA Artificial PCR primer 48
ggattttcac tctgttcact attttgttgc 30 49 30 DNA Artificial PCR primer
49 gaaggaaggg caaggcgggg ggggctctgc 30 50 25 DNA Artificial PCR
primer 50 ggcccggttg ggcccgtgct tcgct 25 51 23 DNA Artificial PCR
primer 51 tggtgcgacc tctgtggcga ctt 23 52 26 DNA Artificial PCR
primer 52 gatgaagcct gtgtaagaac cgtcct 26
* * * * *