U.S. patent application number 11/466352 was filed with the patent office on 2007-05-03 for combinatorial protein library screening by periplasmic expression.
Invention is credited to George Georgiou, Barrett R. Harvey, Brent L. Iverson.
Application Number | 20070099267 11/466352 |
Document ID | / |
Family ID | 37996892 |
Filed Date | 2007-05-03 |
United States Patent
Application |
20070099267 |
Kind Code |
A1 |
Harvey; Barrett R. ; et
al. |
May 3, 2007 |
COMBINATORIAL PROTEIN LIBRARY SCREENING BY PERIPLASMIC
EXPRESSION
Abstract
The invention overcomes the deficiencies of the prior art by
providing a rapid approach for isolating binding proteins capable
of binding small molecules and peptides. In the technique,
libraries of candidate binding proteins, such as antibody
sequences, are expressed in the periplasm of gram negative bacteria
and mixed with a labeled ligand. In clones expressing recombinant
polypeptides with affinity for the ligand, the concentration of the
labeled ligand bound to the binding protein is increased and allows
the cells to be isolated from the rest of the library. Where
fluorescent labeling of the target ligand is used, cells may be
isolated by fluorescence activated cell sorting (FACS). The
approach is more rapid than prior art methods and avoids problems
associated with the outer surface-expression of ligand fusion
proteins employed with phage display.
Inventors: |
Harvey; Barrett R.; (Austin,
TX) ; Georgiou; George; (Austin, TX) ;
Iverson; Brent L.; (Austin, TX) |
Correspondence
Address: |
FULBRIGHT & JAWORSKI L.L.P.
600 CONGRESS AVE.
SUITE 2400
AUSTIN
TX
78701
US
|
Family ID: |
37996892 |
Appl. No.: |
11/466352 |
Filed: |
August 22, 2006 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10620278 |
Jul 15, 2003 |
7094571 |
|
|
11466352 |
Aug 22, 2006 |
|
|
|
09699023 |
Oct 27, 2000 |
7083945 |
|
|
10620278 |
Jul 15, 2003 |
|
|
|
60396058 |
Jul 15, 2002 |
|
|
|
Current U.S.
Class: |
435/69.1 ;
435/252.33; 435/472; 435/488; 530/350; 536/23.7 |
Current CPC
Class: |
C40B 40/02 20130101;
C12N 15/1086 20130101; C07K 2319/034 20130101; C12N 15/1037
20130101; C12N 15/1034 20130101 |
Class at
Publication: |
435/069.1 ;
435/252.33; 435/488; 530/350; 536/023.7; 435/472 |
International
Class: |
C12P 21/06 20060101
C12P021/06; C07H 21/04 20060101 C07H021/04; C12N 15/74 20060101
C12N015/74; C07K 14/245 20060101 C07K014/245 |
Goverment Interests
[0002] The government may own rights in the present invention
pursuant to the U.S. Army ARO MURI program and the Texas Consortium
for Development of Biological Sensors and in connection with
contract number DADD17-01-D-0001 with the U.S. Army Research
Laboratory.
Claims
1. A method of obtaining a bacterium comprising a nucleic acid
sequence encoding a binding polypeptide having specific affinity
for a target ligand comprising the steps of: (a) providing a Gram
negative bacterium comprising an inner and an outer membrane and a
periplasm, said bacterium expressing a nucleic acid sequence
encoding a candidate binding polypeptide, wherein the candidate
binding polypeptide is exposed within the periplasm of said
bacterium; (b) contacting the bacterium with a labeled ligand under
conditions wherein the labeled ligand is capable of contacting the
binding polypeptide; and (c) selecting said bacterium based on the
presence of said labeled ligand bound to said candidate binding
polypeptide.
2. The method of claim 1, further defined as a method of obtaining
a nucleic acid sequence encoding a binding polypeptide having a
specific affinity for a target ligand, the method further
comprising the step of: (d) cloning a nucleic acid sequence
encoding said candidate binding polypeptide from said
bacterium.
3. The method of claim 1, wherein said nucleic acid sequence is
further defined as operably linked to a leader sequence capable of
directing the expression of said fusion polypeptide to the outer
side of the inner membrane.
4. The method of claim 1, wherein said Gram negative bacterium is
an E. coli bacterium.
5. The method of claim 1, wherein step (a) is further defined as
comprising providing a population of Gram negative bacteria.
6. The method of claim 1, wherein the candidate binding polypeptide
is anchored to the outer side of the inner membrane of said
bacterium.
7. The method of claim 5, wherein said population of bacteria is
further defined as collectively expressing a plurality of nucleic
acid sequences encoding a plurality of candidate binding
polypeptides.
8. The method of claim 2, wherein the bacterium is non-viable.
9. The method of claim 2, wherein the bacterium is viable.
10. The method of claim 2, wherein cloning comprises amplification
of the nucleic acid sequence.
11. The method of claim 7, wherein said plurality of nucleic acid
sequences are further defined as encoding a fusion polypeptide
comprising a candidate binding polypeptide and a polypeptide
anchored to the to the outer side of the inner membrane of the
bacterium.
12. The method of claim 5, wherein said population of bacteria is
obtained by a method comprising the steps of: (a) preparing a
plurality of nucleic acid sequences encoding a plurality of fusion
polypeptides comprising a candidate binding polypeptide and an
inner membrane anchor polypeptide; and (b) transforming a
population of Gram negative bacteria with said DNA inserts.
13. The method of claim 5, wherein said population of Gram negative
bacteria is contacted with said labeled ligand.
14. The method of claim 5, wherein selecting in step (c) is further
defined as comprising at least two rounds of selecting, wherein a
sub-population of bacteria is selected based on the presence of
said labeled ligand bound to said candidate binding polypeptide and
further wherein the sub-population is subjected to at least one
additional selection based on the presence of said labeled ligand
bound to said candidate binding polypeptide.
15. The method of claim 14, wherein from about two to six rounds of
selecting are carried out.
16. The method of claim 14, wherein selecting is carried out by
flow-cytometry or magnetic separation.
17. The method of claim 1, wherein said candidate binding
polypeptide is further defined as an antibody or fragment
thereof.
18. The method of claim 17, wherein said candidate binding
polypeptide is further defined as a scAb, Fab or scFv.
19. The method of claim 1, wherein said candidate binding
polypeptide is further defined as a binding protein of at least 40
amino acids other than an antibody.
20. The method of claim 1, wherein said candidate binding
polypeptide is further defined as comprising less than 39 amino
acids.
21. The method of claim 1, wherein said candidate binding
polypeptide is further defined as an enzyme.
22. The method of claim 1, wherein said labeled ligand is selected
from the group consisting of a peptide, a polypeptide, an enzyme, a
nucleic acid, a small molecule and a synthetic molecule.
23. The method of claim 1, wherein said labeled ligand is further
defined as fluorescently labeled.
24. The method of claim 1, wherein said nucleic acid encoding a
candidate binding polypeptide if further defined as flanked by
known nucleic acid sequences, whereby said nucleic acid is capable
of being amplified following said selection.
25. The method of claim 1, further comprising treating said
bacterium to increase the permeability of the outer membrane of
said bacterium to said labeled ligand.
26. The method of claim 25, wherein treating comprises a method
selected from the group consisting of: treatment with hyperosmotic
conditions, treatment with physical stress, infecting the bacterium
with a phage, treatment with lysozyme, treatment with EDTA,
treatment with a digestive enzyme and treatment with a chemical
that disrupts the outer membrane.
27. The method of claim 26, wherein treating comprises a
combination of said methods.
28. The method of claim 27, wherein treating comprises treatment
with lysozyme and EDTA.
29. The method of claim 25, wherein treating comprises treating the
bacterium with a combination of physical, chemical and enzyme
disruption of the outer membrane.
30. The method of claim 1, wherein said bacterium comprises a
mutation conferring increased permeability of said outer membrane
to said labeled ligand.
31. The method of claim 1, further comprising removing the outer
membrane of said bacterium.
32. The method of claim 1, wherein said bacterium is grown at a
sub-physiological temperature.
33. The method of claim 32, wherein said sub-physiological
temperature is about 25.degree. C.
34. The method of claim 1, further comprising removing labeled
ligand not bound to said candidate binding polypeptide.
35. The method of claim 1, further defined as comprising contacting
the bacterium with at least two labeled ligands.
36. The method of claim 1, wherein said selecting comprises flow
cytometry.
37. The method of claim 1, wherein said selecting comprises
magnetic separation.
38. The method of claim 1, wherein said ligand and said candidate
binding polypeptide are reversibly bound.
39. The method of claim 6, wherein the polypeptide anchored to the
outer side of the inner membrane comprises a transmembrane protein
or fragment thereof.
40. The method of claim 6, wherein the polypeptide anchored to the
outer side of the inner membrane comprises a sequence selected from
the group consisting of: the first two amino acids encoded by the
E. coli NlpA gene, the first six amino acids encoded by the E. coli
NlpA gene, the gene III protein of filamentous phage or a fragment
thereof, an inner membrane lipoprotein or fragment thereof.
41. The method of claim 6, wherein the polypeptide anchored to the
outer side of the inner membrane is anchored via an N- or
C-terminus of the polypeptide.
42. The method of claim 40, wherein the sequence is an inner
membrane lipoprotein or fragment thereof selected from the group
consisting of: AraH, MglC, MalF, MalG, Mal C, MalD, RbsC, RbsC,
ArtM, ArtQ, GliP, ProW, HisM, HisQ, LivH, LivM, LivA, Liv E,Dpp B,
DppC, OppB,AmiC, AmiD, BtuC, FhuB, FecC, FecD,FecR, FepD, NikB,
NikC, CysT, CysW, UgpA, UgpE, PstA, PstC, PotB, PotC,PotH, PotI,
ModB, NosY, PhnM, LacY, SecY, TolC, Dsb,B, DsbD, TonB, TatC, CheY,
TraB, Exb D, ExbB and Aas.
43. A method of obtaining a bacteria comprising a nucleic acid
sequence encoding at least a first binding polypeptide having
specific affinity for a target ligand comprising the steps of: (a)
providing a Gram negative bacterium comprising an inner and an
outer membrane and a periplasm, said bacteria expressing a nucleic
acid sequence encoding a least a candidate binding polypeptide,
wherein the candidate binding polypeptide is exposed within the
periplasm of said bacterium; (b) contacting the bacterium with a
fluorescently labeled ligand under conditions wherein the labeled
ligand is capable of contacting the binding polypeptide; and (c)
selecting said bacterium for the presence of the fluorescently
labeled ligand using FACS.
44. The method of claim 43, further defined as a method of
obtaining a nucleic acid sequence encoding a binding polypeptide
having a specific affinity for a target ligand, the method further
comprising the step of: (d) cloning a nucleic acid sequence
encoding said candidate binding polypeptide from said
bacterium.
45. The method of claim 43, further defined as comprising providing
a population of Gram negative bacteria.
46. The method of claim 45, wherein said population of bacteria is
further defined as collectively expressing a plurality of nucleic
acid sequences encoding a plurality of candidate binding
polypeptides.
47. The method of claim 43, wherein the candidate binding
polypeptide is anchored to the outer side of the inner membrane of
said bacterium.
Description
[0001] This application claims the priority of U.S. Provisional
Patent App. No. 60/396,058, filed Jul. 15, 2002, and is also a
continuation-in-part of U.S. patent application Ser. No.
09/699,023, filed Oct. 27, 2000. The entire disclosures of the
foregoing applications are incorporated herein by reference.
BACKGROUND OF THE INVENTION
[0003] 1. Field of the Invention
[0004] The present invention relates generally to the field of
protein engineering. More particularly, it concerns improved
methods for the screening of combinatorial libraries of
polypeptides to allow isolation of ligand binding polypeptides.
[0005] 2. Description of Related Art
[0006] The isolation of polypeptides that either bind to ligands
with high affinity and specificity or catalyze the enzymatic
conversion of a reactant (substrate) into a desired product is a
key process in biotechnology. Ligand-binding polypeptides,
including proteins and enzymes with a desired substrate specificity
can be isolated from large libraries of mutants, provided that a
suitable screening method is available. Small protein libraries
composed of 10.sup.3-10.sup.5 distinct mutants can be screened by
first growing each clone separately and then using a conventional
assay for detecting clones that exhibit specific binding. For
example, individual clones expressing different protein mutants can
be grown in microtiter well plates or separate colonies on
semisolid media such as agar plates. To detect binding the cells
are lysed to release the proteins and the lysates are transferred
to nylon filters, which are then probed using radiolabeled or
fluorescently labeled ligands (DeWildt et al. 2000). However, even
with robotic automation and digital image systems for detecting
binding in high density arrays, it is not feasible to screen large
libraries consisting of tens of millions or billions of clones. The
screening of libraries of that size is required for the de novo
isolation of enzymes or protein binders that have affinities in the
subnanomolar range.
[0007] The screening of very large protein libraries has been
accomplished by a variety of techniques that rely on the display of
proteins on the surface of viruses or cells (Ladner et al. 1993).
The underlying premise of display technologies is that proteins
engineered to be anchored on the external surface of biological
particles (i.e., cells or viruses) are directly accessible for
binding to ligands without the need for lysing the cells. Viruses
or cells displaying proteins with affinity for a ligand can be
isolated in a variety of ways including sequential
adsorption/desorption form inmobilized ligand, by magnetic
separations or by flow cytometry (Ladner et al. 1993, U.S. Pat. No.
5,223,409, Ladner et al 1998, U.S. Pat. No. 5,837,500, Georgiou et
al. 1997, Shusta et al. 1999).
[0008] The most widely used display technology for protein library
screening applications is phage display. Phage display is a
well-established and powerful technique for the discovery of
proteins that bind to specific ligands and for the engineering of
binding affinity and specificity (Rodi and Makowski, 1999). In
phage display, a gene of interest is fused in-frame to phage genes
encoding surface-exposed proteins, most commonly pIII. The gene
fusions are translated into chimeric proteins in which the two
domains fold independently. Phage displaying a protein with binding
affinity for a ligand can be readily enriched by selective
adsorption onto immobilized ligand, a process known as "panning".
The bound phage is desorbed from the surface, usually by acid
elution, and amplified through infection of E. coli cells. Usually,
4-6 rounds of panning and amplification are sufficient to select
for phage displaying specific polypeptides, even from very large
libraries with diversities up to 10.sup.10. Several variations of
phage display for the rapid enrichment of clones displaying tightly
binding polypeptides have been developed (Duenas and Borrebaeck,
1994; Malmborg et al., 1996; Kjaer et al., 1998; Burioni et al.,
1998; Levitan, 1998; Mutuberria et al., 1999; Johns et al.,
2000).
[0009] One of the most significant applications of phage display
technology has been the isolation of high affinity antibodies
(Dall'Acqua and Carter, 1998; Hudson et al., 1998; Hoogenboom et
al., 1998; Maynard and Georgiou, 2000). Very large and structurally
diverse libraries of scFv or F.sub.AB fragments have been
constructed and have been used successfully for the in vitro
isolation of antibodies to a multitude of both synthetic and
natural antigens (Griffiths et al., 1994; Vaughan et al., 1996;
Sheets et al., 1998; Pini et al., 1998; de Haard et al., 1999;
Knappik et al., 2000; Sblattero and Bradbury, 2000). Antibody
fragments with improved affinity or specificity can be isolated
from libraries in which a chosen antibody had been subjected to
mutagenesis of either the CDRs or of the entire gene CDRs (Hawkins
et al., 1992; Low et al., 1996; Thompson et al., 1996; Chowdhury
and Pastan, 1999). Finally, the expression characteristics of scFv,
notorious for their poor solubility, have also been improved by
phage display of mutant libraries (Deng et al., 1994; Coia et al.,
1997).
[0010] However, several spectacular successes notwithstanding, the
screening of phage-displayed libraries can be complicated by a
number of factors. First, phage display imposes minimal selection
for proper expression in bacteria by virtue of the low expression
levels of antibody fragment gene III fusion necessary to allow
phage assembly and yet sustain cell growth (Krebber et al., 1996,
1997). As a result, the clones isolated after several rounds of
panning are frequently difficult to produce on a preparative scale
in E. coli. Second, although phage displayed proteins may bind a
ligand, in some cases their un-fused soluble counterparts may not
(Griep et al., 1999). Third, the isolation of ligand-binding
proteins and more specifically antibodies having high binding
affinities can be complicated by avidity effects by virtue of the
need for gene III protein to be present at around 5 copies per
virion to complete phage assembly. Even with systems that result in
predominantly monovalent protein display, there is nearly always a
small fraction of clones that contain multiple copies of the
protein. Such clones bind to the immobilized surface more tightly
and are enriched relative to monovalent phage with higher
affinities (Deng et al., 1995; MacKenzie et al., 1996, 1998).
Fourth, theoretical analysis aside (Levitan, 1998), panning is
still a "black box" process in that the effects of experimental
conditions, for example the stringency of washing steps to remove
weakly or non-specifically bound phage, can only be determined by
trial and error based on the final outcome of the experiment.
Finally, even though pIII and to a lesser extent the other proteins
of the phage coat are generally tolerant to the fusion of
heterologous polypeptides, the need to be incorporated into the
phage biogenesis process imposes biological constraints that can
limit library diversity. Therefore, there is a great need in the
art for techniques capable of overcoming these limitations.
[0011] Protein libraries have also been displayed on the surface of
bacteria, fungi, or higher cells. Cell displayed libraries are
typically screened by flow cytometry (Georgiou et al. 1997,
Daugherty et al. 2000). However, just as in phage display, the
protein has to be engineered for expression on the outer cell
surface. This imposes several potential limitations. For example,
the requirement for display of the protein on the surface of a cell
imposes biological constraints that limit the diversity of the
proteins and protein mutants that can be screened. Also, complex
proteins consisting of several polypeptide chains cannot be readily
displayed on the surface of bacteria, filamentous phages or yeast.
As such, there is a great need in the art for technology which
circumvents all the above limitations and provides an entirety
novel means for the screening of very large polypeptide
libraries.
SUMMARY OF THE INVENTION
[0012] In one aspect, the invention provides a method of obtaining
a bacterium comprising a nucleic acid sequence encoding a binding
polypeptide having specific affinity for a target ligand comprising
the steps of: (a) providing a Gram negative bacterium comprising an
inner and an outer membrane and a periplasm, said bacterium
expressing a nucleic acid sequence encoding a candidate binding
polypeptide in the periplasm of said bacterium; (b) contacting the
bacterium with a labeled ligand capable of diffusing into said
periplasm; and (c) selecting said bacterium based on the presence
of said labeled ligand bound to said candidate binding polypeptide.
In one embodiment of the invention, the method comprises the steps
of: (a) providing a Gram negative bacterium expressing a nucleic
acid sequence encoding a fusion polypeptide comprising a candidate
binding polypeptide and a polypeptide anchored to the outer side of
the inner membrane of the bacterium; (b) contacting the bacterium
with a labeled ligand capable of diffusing into the bacterium; and
(c) selecting the bacterium based on the presence of the labeled
ligand bound to the candidate binding polypeptide.
[0013] In certain embodiments of the invention, the method may be
further defined as a method of obtaining a nucleic acid sequence
encoding a binding polypeptide having a specific affinity for a
target ligand, the method further comprising the step of: (d)
cloning a nucleic acid sequence encoding the candidate binding
polypeptide from the bacterium. In the method, the nucleic acid
sequence may be further defined as operably linked to a leader
sequence capable of directing the expression of the fusion
polypeptide to the outer side of the inner membrane.
[0014] In one embodiment of the invention, the Gram negative
bacterium is an E. coli bacterium. In certain further embodiments
of the invention, the method may be further defined as comprising
use of a population of Gram negative bacteria. Such a population
may collectively express a plurality of fusion polypeptides
comprising a plurality of candidate binding polypeptides. The
population may be obtained by a method comprising the steps of: (a)
preparing a plurality of nucleic acid sequences encoding a
plurality of fusion polypeptides comprising a candidate binding
polypeptide and a inner membrane anchor polypeptide; and (b)
transforming a population of Gram negative bacteria with the DNA
inserts. In the method, the population of Gram negative bacteria
may be contacted with the labeled ligand.
[0015] In one embodiment of the invention, a candidate binding
polypeptide is further defined as an antibody or fragment thereof
or, alternatively, may be a binding protein other than an antibody.
The candidate binding polypeptide may also be further defined as an
enzyme. The labeled ligand may comprise a peptide, polypeptide,
enzyme, nucleic acid and/or synthetic molecule. The labeled ligand
may be labeled by any suitable means, including fluorescently
labeled. In certain embodiments of the invention, the nucleic acid
encoding a candidate binding polypeptide if further defined as
flanked by known nucleic acid sequences, whereby the nucleic acid
is capable of being amplified following the selection.
[0016] In certain embodiments of the invention, the method of
obtaining a bacterium comprising a nucleic acid sequence encoding a
binding polypeptide comprises treating the bacterium to increase
the permeability of the outer membrane of the bacterium to the
labeled ligand. Treating may comprise, in one embodiment of the
invention, treating the bacterium with hyperosmotic conditions,
treating the bacterium with physical stress and/or treating the
bacterium with a phage. The method may comprise removing the outer
membrane of the bacterium or alternatively using mutant bacteria
having a defective outer membrane that allows the diffusion of
polypeptides of various molecular weights. The method may also
comprise growing the bacterium at a sub-physiological temperature,
including about 25.degree. C. The method may still further comprise
removing labeled ligand not bound to the candidate binding
polypeptide.
[0017] Selecting in accordance with the invention may comprise any
suitable method. In one embodiment of the invention, the selection
comprises flow cytometry (e.g., fluorescence activated cell sorting
(FACS)). In another embodiment, the selection comprises magnetic
separation. The ligand and candidate binding polypeptide may be
reversibly bound. The polypeptide may be anchored to the outer side
of the inner membrane by any suitable anchor, including an
N-terminal fusion to a 6 residue sequence derived from the native
E. coli lipoprotein NlpA,, any transmemebrane protein or fragment
thereof, and the gene III protein of filamentous phage or a
fragment thereof.
[0018] In still yet another aspect, the invention provides an
isolated antibody or fragment thereof that binds immunologically to
Bacillus anthracis protective antigen with an affinity Kd of
between about 140 pM and about 21 pM as determined by surface
plasmon resonance. Such an antibody or fragment thereof may be
further defined as binding immunologically to Bacillus anthracis
protective antigen with a binding affinity Kd of between about 96
pM and about 21 pM and/or between about 35 pM and about 21 pM. The
isolated antibody or fragment thereof may still further be defined
as comprising an Fc domain of IgA, IgD, IgE, IgG or IgM. The
antibody may be a humanized antibody and may be a human antibody.
In certain embodiments, the isolated antibody or fragment thereof
comprises an scFv fragment and antibody constant regions forming a
monovalent antibody portion of at least 40 kDa.
[0019] In still yet another aspect, the invention provides an
isolated antibody or fragment thereof that binds immunologically to
Bacillus anthracis protective antigen and comprises the variable
light and variable heavy chain of SEQ ID NO:21, with the exception
that the variable light and variable heavy chain comprise a
modification selected from the group consisting of: I21V, S22G,
L33S, Q38R, L46F, Q55L, S56P, T74A, S76N, Q78L, L94P, S7P, K19R,
S30N, T57S, K62R, K64E, T68I, and M80L; wherein said I21V, S22G,
L33S, Q38R, L46F, Q55L, S56P, T74A, S76N, Q78L and L94P are in the
variable light chain and wherein said S7P, K19R, S30N, T57S, K62R,
K64E, T68I and M80L are in the variable heavy chain. In certain
embodiments of the invention, the isolated antibody or fragment
thereof may be defined as comprising from about two to at all of
said modifications, including about 3, 4, 5, 6, 7, 8, 9, 10, 11,
12, 13, 14, 15, 16, 17, 18 or all of the modifications, including
all possible combinations of the foregoing modifications.
[0020] In certain aspects of the invention, the isolated antibody
or fragment thereof is further defined as binding immunologically
to Bacillus anthracis protective antigen with an affinity Kd of
between about 140 pM and about 21 pM as determined by surface
plasmon resonance. In further embodiments of the invention the
antibody or fragment thereof comprises Q55L and S56P. The isolated
antibody or fragment thereof may comprising the variable light
and/or variable heavy chain of SEQ ID NO:22 or SEQ ID NO:24. In one
embodiment, the isolated antibody or fragment thereof comprises SEQ
ID NO:22 and/or SEQ ID NO:24. The isolated antibody or fragment
thereof may be further defined as a scAb, Fab or SFv and may also
be further defined as comprising an Fc domain of IgA, IgD, IgE, IgG
or IgM. The isolated antibody or fragment thereof may be a
humanized antibody and may be human. In particular embodiments, the
isolated antibody or fragment thereof comprises an scFv fragment
and antibody constant regions forming a monovalent antibody portion
of at least 40 kDa.
[0021] In still yet another aspect, the invention provides an
isolated nucleic acid encoding an antibody or fragment thereof
provided by the invention. In one embodiment, the nucleic acid
encodes the variable light chain of SEQ ID NO:23 and/or SEQ ID
NO:25. In another embodiment, the nucleic acid encodes the variable
heavy chain of SEQ ID NO:23 and/or SEQ ID NO:25. In yet another
embodiment, nucleic acid encodes the polypeptide of SEQ ID NO:23
and, in another embodiment, the polypeptide of SEQ ID NO:25.
BRIEF DESCRIPTION OF THE DRAWINGS
[0022] The following drawings form part of the present
specification and are included to further demonstrate certain
aspects of the present invention. The invention may be better
understood by reference to one or more of these drawings in
combination with the detailed description of specific embodiments
presented herein.
[0023] FIG. 1A-C: Selective identification of Antigen targets with
APEx. APEx expressed scFvs in E. coli represented as indicated.
Shows scFvs expressed that bind small molecules, (A)
digoxigenin-Bodipy FL, (B) methamphetamine-FL; or ScFvs expressed
that bind peptides (C) e.g., peptide 18aa.
[0024] FIG. 2A-B: Detection of ScFvs on the Surface of
Spheroplasts. APEx expressed scFvs in E. coli represented as
indicated. ScFvs expressed were capable of binding large antigens,
e.g., PA-Cy5 (83 kD), Phycoerythrin-digoxigenin (240kD). Provides
evidence that scFvs expressed via APEx are accessible to large
proteins.
[0025] FIG. 3A-B: Detection of ScFvs for Larger Target Antigen
conjugated fluorophores.
[0026] FIG. 4: Maturation of methamphetamine binding scFv for
Meth-FL probe.
[0027] FIG. 5: Analysis of clone designated mutant 9 with higher
mean FL signal than the parent anti-methamphetamine scFv. The scFvs
expressed via anchored periplasmic expression are as indicated.
[0028] FIG. 6: A schematic diagram showing the principle of
Anchored Periplasmic Expression (APEx) for the flow cytometry based
isolation of high affinity antibody fragments.
[0029] FIG. 7: Examples of targets visualized by APEx. (A)
Fluorescence distribution of ABLEC.TM. cells expressing PA specific
(14B7) and digoxigenin specific (Dig) scFv and labeled with 200 nM
Bodipy.TM. conjugated fluorescent antigens. Histograms represent
the mean fluorescence intensity of 10,000 E. Coli events. (B)
Histograms of cells expressing 14B7 or Dig scFv labeled with 200 nM
of the 240 kDa digoxigenin-phycoerythrin conjugate.
[0030] FIG. 8: Analysis of anti-PA antibody fragments selected
using APEx (A) Signal Plasmon Resonance (SPR) analysis of anti-PA
scAb binding to PA. (B) Table of affinity data acquired by SPR. (C)
FC Histogram of anti-PA scFv in pAPEx1 expressed in E. coli and
labeled with 200 nM PA-Bodipy.TM. conjugate as compared with
anti-methamphetamine (Meth) scfv negative control.
[0031] FIG. 9: N-Terminal vs. C-Terminal anchoring strategy
comparison. (A) Anti-digoxigenin Dig scfv, anti-PA M18 scFv and
anti-methamphetamine Meth scFv expressed as N-terminal fusions in
the pAPEx1 vector in E. coli specifically label with 200 nM of
their respective antigen. (B) C-terminal fusions of same scFv in
pAK200 vector specifically labeled with 200 nM of their respective
antigen.
[0032] FIG. 10: View from the top of the antibody binding pocket
showing the conformation and amino acid substitutions in the 1H,
M5, M6 and M18 sequences.
[0033] FIG. 11: Alignment of 14B7 scFv (SEQ ID NO:21) and M18 scFv
(SEQ ID NO:23) sequences showing variable heavy and variable light
chains and mutations made to improve binding affinity.
DESCRIPTION OF ILLUSTRATIVE EMBODIMENTS
[0034] The invention overcomes the limitations of the prior art by
providing a novel method for isolating binding polypeptides,
including antibodies or antibody fragments, that recognize specific
molecular targets. In the technique, a library of polypeptide
(e.g., antibody or other binding polypeptides) mutants can be
constructed and expressed in Gram negative bacteria. The mutant
polypeptides can be expressed as fusion proteins that are anchored
on the inner (cytoplasmic) membrane of the bacterium facing the
periplasm. A fusion polypeptide is a polypeptide comprised of two
or more starting polypeptides linked to form a continuous
polypeptide. The polypeptides linked are typically derived from
distinct sources. Subsequently, the periplasmic (outer) membrane of
the bacterium is made permeable using a variety of chemical,
physical or other treatments or using mutations that result in
increased permeability. Permeabilization of the bacterial outer
membrane renders the polypeptides anchored on the membrane
accessible to target large molecules added to the external
solution.
[0035] The display of heterologous proteins on microbial scaffolds
has attractive applications in many different areas including
vaccine development, bioremediation and protein engineering. In
Gram negative bacteria there have been display systems designed
which by virtue of a N or C terminal chimera fusion, proteins are
displayed to the cell surface. Although there have been many
different strategies used to direct protein localization, including
fusions to outer membrane proteins, lipoproteins, surface
structural proteins and leader peptides, many share the same
limitations. One limitation is the size of the protein which can be
displayed. Many display scaffolds can only tolerate a few hundred
amino acids, which significantly limits the scope of proteins which
can be displayed. Also, display implies that the protein of
interest is situated such that it can interact with its
environment, yet the major limitation of many of these systems is
that the architecture of the outer surface of gram negative
bacteria and in particular the presence of lipopolysaccharide (LPS)
molecules having steric limitations that inhibit the binding of
externally added ligands. Another limitation arises from the
requirement that the displayed protein is localized on the external
surface of the outer membrane. For this purpose the polypeptide
must first be secreted across the cytoplasmic membrane must then
transverse the periplasmic space and finally it must be assemble
properly in the outer membrane. A binding polypeptide may be any
type of molecule of at least two amino acid residues capable of
binding a given ligand. By binding it is meant that immunological
interaction takes place. Biosynthetic limitations restrict the
kinds of proteins that can be displayed in this fashion. For
example, large polypeptides (e.g., alkaline phosphatase) cannot be
displayed on the E. coli surface (Stathopoulos et al., 1996).
[0036] In accordance with the invention, the limitations of the
prior techniques can be overcome by the display of proteins
anchored to the outer surface of the inner membrane. It was
demonstrated using the technique that, by utilizing conditions that
permeabilize the outer membrane, E. coli expressing inner membrane
anchored scFv antibodies (approx. 30 kDa in size) can be labeled
with a target antigen conjugated, for example, to a fluorophore and
can subsequently be used to sort protein libraries utilizing flow
cytometry for isolation of gain of function mutants.
[0037] Following disruption of the outer bacterial membrane, which
is well known to those of skill in the art and may comprise, for
example, use of Tris-EDTA-lysozyme, labeled antigens with sizes up
to at least 240 kDa can be detected. With fluorescent labeling,
cells may be isolated by flow cytometry and the DNA of isolated
clones rescued by PCR. Using two rounds of APEx, the inventors
demonstrate that the affinity of a neutralizing antibody to the
Bacillus anthracis protective antigen (PA) was improved over
120-fold, exhibiting a final K.sub.D=35 pM.
[0038] In one embodiment of the invention, target molecules are
labeled with fluorescent dyes. Thus, bacterial clones expressing
polypeptides that recognize the target molecule bind to the
fluorescently labeled target and in turn become fluorescent. The
fluorescent bacteria expressing the desired binding proteins can
then be enriched from the population using automated techniques
such as flow cytometry.
[0039] The polypeptide library can be attached to the periplasmic
face of the inner membrane of E. coli or other Gram negative
bacteria via fusion to an inner membrane anchor polypeptide. One
anchor that can be used comprises the first six amino acids of the
NlpA (New Lipoprotein A) gene of E coli. However, other single
transmembrane or polytropic membrane proteins or peptide sequences
can also be used for anchoring purposes.
[0040] One benefit of the technique is that anchoring candidate
binding polypeptides to the periplasmic face of the inner membrane
allows the permeabilization of the bacterial outer membrane, which
would normally limit the accessibility of the polypeptides to
labeled target molecules. The anchoring of the binding polypeptide
to the periplasmic face of the membrane prevents it from being
released from the cell when the outer membrane is compromised. The
technique can thus be used for the isolation of large binding
polypeptides and ligands, including antibodies and other binding
proteins from combinatorial libraries. The technique not only
provides a high signal-to-noise ratio, but also allows the
isolation of polypeptide or antibody binders to very large antigen
molecules. Because the method allows selection of targets of
greater size, there is the potential for use in the selection of
targets such as specific antigen markers expressed on cells
including tumor cells such as melanoma or other specific types of
tumor cells. Tumor specific antibodies have shown great promise in
the treatment of cancer.
[0041] The periplasm comprises the space defined by the inner and
outer membranes of a Gram-negative bacterium. In wild-type E. coli
and other Gram negative bacteria, the outer membrane serves as a
permeability barrier that severely restricts the diffusion of
molecules greater than 600 Da into the periplasmic space (Decad and
Nikado, 1976). Conditions that increase the permeability of the
outer membrane, allowing larger molecules to diffuse in the
periplasm, have two deleterious effects in terms of the ability to
screen libraries: (a) the cell viability is affected to a
significant degree and (b) the diffusion of molecules into the cell
is accompanied by the diffusion of proteins and other
macromolecules.
[0042] The inventors, by anchoring candidate binding polypeptides
to the outer (periplasmic) side of the inner membrane, or
expressing candidate binding polypeptides in soluble form in the
periplasm, have identified techniques that allow fluorescent
conjugates of ligands and polypeptides to pass the outer membrane
and bind to candidate binding proteins and remain bound to the
inner membrane. Therefore, in bacterial cells expressing
recombinant polypeptides with affinity for the ligand, the labeled
ligand bound to the binding protein can be detected, allowing the
bacteria to be isolated from the rest of the library. Where
fluorescent labeling of the target ligand is used, cells may
efficiently be isolated by flow cytometry (fluorescence activated
cell sorting (FACS)). With this approach, existing libraries of
expressed fusion proteins in bacteria can be easily tested for
ligand binding without the need for subcloning into a phage or
outer cell surface display systems.
[0043] Periplasmic expression may also be carried out in accordance
with the invention by expression in soluble form. Techniques for
soluble expression in the periplasm and screening of candidate
binding proteins that may be used in accordance with the invention
are described in detail in U.S. patent application Ser. No.
09/699,023, filed Oct. 27, 2000, the entire disclosure of which is
specifically incorporated herein by reference.
I. Anchored Periplasmic Expression
[0044] Prior art methods of both phage display and bacterial cell
surface display suffer from a limitation in that the protein is
required, by definition, to be physically displayed on the outer
surface of the vehicle used, to allow unlimited access to the
targets (immobilized for phage or fluorescently conjugated ligands
for flow cytometry) (U.S. Pat. No. 5,223,409, the disclosure of
which is specifically incorporated herein by reference in its
entirety). However, certain proteins are known to be poorly
displayed on phage (Maenaka et al., 1996; Corey et al., 1993) and
the toxic effects of outer cell surface display have been treated
at length (Daugherty et al., 1999). Further, there is no
lipopolysaccharide to interfere with binding on the inner
membrane.
[0045] Herein, the inventors have described a technique in which
binding proteins can be expressed on the periplasmic face of the
inner membrane as fusion proteins yet still be accessible to
relatively large ligands. As used herein, the term "binding
polypeptide" includes not only antibodies, but also fragments of
antibodies, as well as any other peptides, including proteins
potentially capable of binding a given target molecule. The
antibody or other binding peptides may be expressed with the
invention as fusion polypeptides with polypeptides capable of
serving as anchors to the periplasmic face of the inner membrane.
Such a technique may be termed "Anchored Periplasmic Expression" or
"APEx".
[0046] The periplasmic compartment is contained between the inner
and outer membranes of Gram negative cells (see, e.g., Oliver,
1996). As a sub-cellular compartment, it is subject to variations
in size, shape and content that accompany the growth and division
of the cell. Within a framework of peptidoglycan heteroploymer is a
dense mileau of periplasmic proteins and little water, lending a
gel-like consistency to the compartment (Hobot et al., 1984; van
Wielink and Duine, 1990). The peptidoglycan is polymerized to
different extents depending on the proximity to the outer membrane,
close-up it forms the murein sacculus that affords cell shape and
resistance to osmotic lysis.
[0047] The outer membrane (see Nikaido, 1996) is composed of
phospholipids, porin proteins and, extending into the medium,
lipopolysaccharide (LPS). The molecular basis of outer membrane
integrity resides with LPS ability to bind divalent cations (Mg2+
and Ca2+) and link each other electrostatically to form a highly
ordered quasi-crystalline ordered "tiled roof" on the surface
(Labischinski et al., 1985). The membrane forms a very strict
permeability barrier allowing passage of molecules no greater than
around 650 Da (Burman et al., 1972; Decad and Nikaido, 1976) via
the porins. The large water filled porin channels are primarily
responsible for allowing free passage of mono and disaccharides,
ions and amino acids in to the periplasm compartment (Naeke, 1976;
Nikaido and Nakae, 1979; Nikaido and Vaara, 1985). With such strict
physiological regulation of access by molecules to the periplasm it
may appear, at first glance, inconceivable that APEx should work
unless the ligands employed are at or below the 650 Da exclusion
limit or are analogues of normally permeant compounds. However, the
inventors have shown that ligands greater than 2000 Da in size can
diffuse into the periplasm without disruption of the periplasmic
membrane. Such diffusion can be aided by one or more treatments of
a bacterial cell, thereby rendering the outer membrane more
permeable, as is described herein below.
II. Anchor-less Display Library Screening
[0048] Prior art methods of both phage display and bacterial cell
surface display suffer from a limitation in that the protein is
required, by definition, to be physically displayed on the surface
of the vehicle used, to allow unlimited access to the targets
(immobilized for phage or fluorescently conjugated ligands for
FACS) (U.S. Pat. No. 5,223,409, the disclosure of which is
specifically incorporated herein by reference in its entirety).
Certain proteins are known to be poorly displayed on phage (Maenaka
et al., 1996; Corey et al., 1993) and the toxic effects of cell
surface display have been treated at length (Daugherty et al.,
1999). The proteins to be displayed also need to be expressed as
fusion proteins, which may alter their function. The selection
constraints imposed by any display system may, therefore, limit the
application to relatively small and "simple" proteins and deny
access to a multitude of large and complex multisubunit species.
The latter are very likely to be incapable of partaking efficiently
in the complex process of phage assembly termination or
outer-membrane translocation without very serious effects on host
cell viability.
[0049] Herein, conditions are described whereby expressed binding
proteins, for example, an antibody, may be targeted to the
periplasmic compartment of E. coli and yet are amenable to binding
ligands and peptides. As used herein, the term "binding protein"
includes not only antibodies, but also fragments of antibodies, as
well as any other polypeptide or protein potentially capable of
binding a given target molecule. As well as being anchored, the
antibody or other binding proteins may be expressed with the
invention directly and not as fusion proteins. Such a technique may
be termed "anchor-less-display" (ALD). To understand how it may
work, one needs to be aware of the location in which it
functions.
[0050] The periplasmic compartment is contained between the inner
and outer membranes of Gram negative cells (see, e.g., Oliver,
1996). As a sub-cellular compartment, it is subject to variations
in size, shape and content that accompany the growth and division
of the cell. Within a framework of peptidoglycan heteroploymer is a
dense mileau of periplasmic proteins and little water, lending a
gel-like consistency to the compartment (Hobot et al., 1984; van
Wielink and Duine, 1990). The peptidoglycan is polymerized to
different extents depending on the proximity to the outer membrane,
close-up it forms the murein sacculus that affords cell shape and
resistance to osmotic lysis.
[0051] The outer membrane (see Nikaido, 1996) is composed of
phospholipids, porin proteins and, extending into the medium,
lipopolysaccharide (LPS). The molecular basis of outer membrane
integrity resides with LPS ability to bind divalent cations (Mg2+
and Ca2+) and link each other electrostatically to form a highly
ordered quasi-crystalline ordered "tiled roof" on the surface
(Labischinski et al., 1985). The membrane forms a very strict
permeability barrier of allowing passage of molecules no greater
than around 650 Da (Burman et al., 1972; Decad and Nikaido, 1976)
via the porins. The large water filled porin channels are primarily
responsible for allowing free passage of mono and disaccharides,
ions and amino acids in to the periplasm compartment (Naeke, 1976;
Nikaido and Nakae, 1979; Nikaido and Vaara, 1985). With such strict
physiological regulation of access by molecules to the periplasm it
may appear, at first glance, inconceivable that ALD should work
unless the ligands employed are at or below the 650 Da exclusion
limit or are analogues of normally permeant compounds. However, the
inventors have shown that ligands can diffuse into the periplasm
for ALD. Such diffusion can be aided by one or more treatments of a
bacterial cell, thereby rendering the outer membrane more
permeable, as is described herein below.
III. Permeabilization of the Outer Membrane
[0052] In one embodiment of the invention, methods are employed for
increasing the permeability of the outer membrane to one or more
labeled ligand. This can allow screening access of labeled ligands
otherwise unable to cross the outer membrane. However, certain
classes of molecules, for example, hydrophobic antibiotics larger
than the 650 Da exclusion limit, can diffuse through the bacterial
outer membrane itself, independent of membrane porins (Farmer et
al., 1999). The process may actually permeabilize the membrane on
so doing (Jouenne and Junter, 1990). Such a mechanism has been
adopted to selectively label the periplasmic loops of a cytoplasmic
membrane protein in vivo with a polymyxin B nonapeptide (Wada et
al., 1999). Also, certain long chain phosphate polymers (100 Pi)
appear to bypass the normal molecular sieving activity of the outer
membrane altogether (Rao and Torriani, 1988).
[0053] Conditions have been identified that lead to the permeation
of ligands into the periplasm without loss of viability or release
of the expressed proteins from the cells, but the invention may be
carried out without maintenance of the outer membrane. By anchoring
candidate binding polypeptides to the outer side of the inner
(cytoplasmic) membrane using fusion polypeptides, the need for
maintenance of the outer membrane (as a barrier to prevent the
leakage of the biding protein from the cell) to detect bound
labeled ligand is removed. As a result, cells expressing binding
proteins anchored to the outer (periplasmic) face of the
cytoplasmic membrane can be fluorescently labeled simply by
incubating with a solution of fluorescently labeled ligand in cells
that either have a partially permeabilized membrane or a nearly
completely removed outer membrane.
[0054] The permeability of the outer membrane of different strains
of bacterial hosts can vary widely. It has been shown previously
that increased permeability due to OmpF overexpression was caused
by the absence of a histone like protein resulting in a decrease in
the amount of a negative regulatory mRNA for OmpF translation
(Painbeni et al., 1997). Also, DNA replication and chromosomal
segregation is known to rely on intimate contact of the replisome
with the inner membrane, which itself contacts the outer membrane
at numerous points. A preferred host for library screening
applications is E. coli ABLEC strain, which additionally has
mutations that reduce plasmid copy number.
[0055] The inventors have also noticed that treatments such as
hyperosmotic shock can improve labeling significantly. It is known
that many agents including, calcium ions (Bukau et al., 1985) and
even Tris buffer (Irvin et al., 1981) alter the permeability of the
outer-membrane. Further, the inventors found that phage infection
stimulates the labeling process. Both the filamentous phage inner
membrane protein pIII and the large multimeric outer membrane
protein pIV can alter membrane permeability (Boeke et al., 1982)
with mutants in pIV known to improve access to maltodextrins
normally excluded (Marciano et al., 1999). Using the techniques of
the invention, comprising a judicious combination of strain, salt
and phage, a high degree of permeability was achieved (Daugherty et
al., 1999). Cells comprising anchored binding polypeptides bound to
fluorescently labeled ligands can then be easily isolated from
cells that express binding proteins without affinity for the
labeled ligand using flow cytometry or other related techniques.
However, it will typically be desired to use less disruptive
techniques in order to maintain the viability of cells. EDTA and
Lysozyme treatments may also be useful in this regard.
IV. Anchored Periplasmic Expression
[0056] In one embodiment of the invention, bacterial cells are
provided expressing fusion polypeptides on the outer face of the
inner membrane. Such a fusion polypeptide may comprise a fusion
between a candidate binding polypeptide and a polypeptide serving
as an anchor to the outer face of the inner membrane. It will be
understood to those of skill in the art that additional polypeptide
sequences may be added to the fusion polypeptide and not depart
from the scope of the invention. One example of such a polypeptide
is a linker polypeptide serving to link the anchor polypeptide and
the candidate binding polypeptide. The general scheme behind the
invention comprises the advantageous expression of a heterogeneous
collection of candidate binding polypeptides.
[0057] Anchoring to the inner membrane may be achieved by use of
the leader peptide and the first six amino acids of an inner
membrane lipoprotein. One example of an inner membrane lipoprotein
is NlpA (new lipoprotein A). The first six amino acid of NlpA can
be used as an N terminal anchor for protein to be expressed to the
inner membrane. NlpA was identified and characterized in
Escherichia coli as a non-essential lipoprotein that exclusively
localizes to the inner membrane (Yu, 1986; Yamaguchi, 1988).
[0058] As with all prokaryotic lipoproteins, NipA is synthesized
with a leader sequence that targets it for translocation across the
inner membrane via the Sec pathway. Once the precursor protein is
on the outer side of the inner membrane the cysteine residue of the
mature lipoprotein forms a thioether bond with diacylglyceride. The
signal peptide is then cleaved by signal peptidase II and the
cysteine residue is aminoacylated (Pugsley, 1993). The resulting
protein with its lipid modified cysteine on its N terminus can then
either localize to the inner or outer membrane. It has been
demonstrated that this localization is determined by the second
amino acid residue of the mature lipoprotein (Yamaguchi, 1988).
Aspartate at this position allows the protein to remain anchored
via its N terminal lipid moiety to the inner membrane, whereas any
other amino acid in the second position generally directs the
lipoprotein to the outer membrane (Gennity and Inouye, 1992). This
is accomplished by proteins LolA, LolB and the ATP dependant ABC
transporter complex LoICDE (Yakushi, 2000, Masuda 2002). NlpA has
aspartate as its second amino acid residue and therefore remains
anchored within the inner membrane.
[0059] It has been reported that by changing amino acid 2 of
lipoproteins to an Arginine (R) will target them to reside in the
inner membrane (Yakushi, 1997). Therefore all lipoproteins in E.
coli (and potentially other Gram negative bacteria) can be anchor
sequences. All that is required is a signal sequence and an
arginine at amino acid 2 position. This construct could be designed
artificially using an artificial sec signal sequence followed by
the sec cleavage region and coding for cysteine as amino acid 1 and
arginine as amino acid 2 of the mature protein. Transmembrane
proteins could also potentially be used as anchor sequences
although this will require a larger fusion construct.
[0060] Examples of anchors that may find use with the invention
include lipoproteins, Pullulanase of K. pneumoniae, which has the
CDNSSS mature lipoprotein anchor, phage encoded celB, and E. coli
acrE (envC). Examples of inner membrane proteins which can be used
as protein anchors include: AraH, MglC, MalF, MalG, Mal C, MalD,
RbsC, RbsC, ArtM, ArtQ, GlnP, ProW, HisM, HisQ, LivH, LivM, LivA,
Liv E,Dpp B, DppC, OppB,AmiC, AmiD, BtuC, FhuB, FecC, FecD,FecR,
FepD, NikB, NikC, CysT, CysW, UgpA, UgpE, PstA, PstC, PotB,
PotC,PotH, PotI, ModB, NosY, PhnM, LacY, SecY, TolC, Dsb,B, DsbD,
TonB, TatC, CheY, TraB, Exb D, ExbB and Aas. Further, a single
transmembrane loop of any cytoplasmic protein can be used as a
membrane anchor.
[0061] The preparation of diverse populations of fusion proteins in
the context of phage display is known (see, e.g., U.S. Pat. No.
5,571,698). Similar techniques may be employed with the instant
invention by linking the protein of interest to an anchor for the
periplasmic face of the cytoplasmic membrane instead of, for
example, the amino-terminal domain of the gene III coat protein of
the filamentous phage M13, or another surface-associated molecule.
Such fusions can be mutated to form a library of structurally
related fusion proteins that are expressed in low quantity on the
periplasmic face of the cytoplasmic membrane in accordance with the
invention. As such, techniques for the creation of heterogeneous
collections of candidate molecules which are well known to those of
skill in the art in conjunction with phage display, can be adapted
for use with the invention. Those of skill in the art will
recognize that such adaptations will include the use of bacterial
elements for expression of fusion proteins anchored to the
periplasmic face of the inner membrane, including, promoter,
enhancers or leader sequences. The current invention provides the
advantage relative to phage display of not requiring the use of
phage or expression of molecules on the outer cell surface, which
may be poorly expressed or may be deleterious to the host cell.
[0062] Examples of techniques that could be employed in conjunction
with the invention for creation of diverse candidate binding
proteins and/or antibodies include the techniques for expression of
immunoglobulin heavy chain libraries described in U.S. Pat. No.
5,824,520. In this technique, a single chain antibody library is
generated by creating highly divergent, synthetic hypervariable
regions. Similar techniques for antibody display are given by U.S.
Pat. No. 5,922,545. These sequences may then be fused to nucleic
acids encoding an anchor sequence for the periplasmic face of the
inner membrane of Gram negative bacteria for the expression of
anchored fusion polypeptides.
[0063] Methods for creation of fusion proteins are well known to
those of skill in the art (see, for example, U.S. Pat. No.
5,780,279). One means for doing so comprises constructing a gene
fusion between a candidate binding polypeptide and an anchor
sequence and mutating the binding protein encoding nucleic acid at
one or more codons, thereby generating a family of mutants. The
mutated fusion proteins can then be expressed in large populations
of bacteria. Those bacteria in which a target ligand binds, can
then be isolated and the corresponding nucleic acid encoding the
binding protein can be cloned.
V. Screening Candidate Molecules
[0064] The present invention provides methods for identifying
molecules capable of binding a target ligand. The binding
polypeptides screened may comprise large libraries of diverse
candidate substances, or, alternatively, may comprise particular
classes of compounds selected with an eye towards structural
attributes that are believed to make them more likely to bind the
target ligand. In one embodiment of the invention, the candidate
binding protein is an antibody, or a fragment or portion thereof.
In other embodiments of the invention, the candidate molecule may
be another binding protein.
[0065] To identify a candidate molecule capable of binding a target
ligand in accordance with the invention, one may carry out the
steps of: providing a population of Gram negative bacterial cells
comprising fusion proteins between candidate binding polypeptides
and a sequence anchored to the periplasmic face of the inner
membrane; admixing the bacteria and at least a first labeled target
ligand capable of contacting the candidate binding polypeptide and
identifying at least a first bacterium expressing a molecule
capable of binding the target ligand.
[0066] In the aforementioned method, the binding between the
anchored candidate binding protein and the labeled ligand will
prevent diffusing out of the cell. In this way, molecules of the
labeled ligand can be retained in the periplasm of the bacterium.
Alternatively, the periplasm can be removed, whereby the anchoring
will cause retention of the bound candidate molecule. The labeling
may then be used to isolate the cell expressing a binding
polypeptide capable of binding the target ligand, and in this way,
the gene encoding the binding polypeptide isolated. The molecule
capable of binding the target ligand may then be produced in large
quantities using in vivo or ex vivo expression methods, and then
used for any desired application, for example, for diagnostic or
therapeutic applications, as described below.
[0067] As used herein the term "candidate molecule" or "candidate
polypeptide" refers to any molecule or polypeptide that may
potentially have affinity for a target ligand. The candidate
substance may be a protein or fragment thereof, including a small
molecule such as synthetic molecule. The candidate molecule may in
one embodiment of the invention, comprise an antibody sequence or
fragment thereof. Such sequences may be particularly designed for
the likelihood that they will bind a target ligand.
[0068] Binding polypeptides or antibodies isolated in accordance
with the invention also may help ascertain the structure of a
target ligand. In principle, this approach yields a pharmacore upon
which subsequent drug design can be based. It is possible to bypass
protein crystallography altogether by generating anti-idiotypic
antibodies to a functional, pharmacologically active antibody. As a
mirror image of a mirror image, the binding site of anti-idiotype
would be expected to be an analog of the original antigen. The
anti-idiotype could then be used to identify and isolate peptides
from banks of chemically- or biologically-produced peptides.
Selected peptides would then serve as the pharmacore.
Anti-idiotypes may be generated using the methods described herein
for producing antibodies, using an antibody as the antigen. On the
other hand, one may simply acquire, from various commercial
sources, small molecule libraries that are believed to meet the
basic criteria for binding the target ligand. Such libraries could
be provided by way of nucleic acids encoding the small molecules or
bacteria expressing the molecules.
[0069] A. Cloning of Binding Protein Coding Sequences
[0070] The binding affinity of an antibody or other binding protein
can, for example, be determined by the Scatchard analysis of Munson
& Pollard (1980). After a bacterial cell is identified that
produces molecules of the desired specificity, affinity, and/or
activity, the corresponding coding sequence may be cloned. In this
manner, DNA encoding the molecule can be isolated and sequenced
using conventional procedures (e.g., by using oligonucleotide
probes that are capable of binding specifically to genes encoding
the antibody or binding protein).
[0071] Once isolated, the antibody or binding protein DNA may be
placed into expression vectors, which can then transfected into
host cells such as simian COS cells, Chinese hamster ovary (CHO)
cells, or myeloma cells that do not otherwise produce
immunoglobulin protein, to obtain the synthesis of binding protein
in the recombinant host cells. The DNA also may be modified, for
example, by substituting the coding sequence for human heavy and
light chain constant domains in place of the homologous murine
sequences (Morrison, et al., 1984), or by covalently joining to the
immunoglobulin coding sequence all or part of the coding sequence
for a non-immunoglobulin polypeptide. In that manner, "chimeric" or
"hybrid" binding proteins are prepared that have the desired
binding specificity.
[0072] Typically, such non-immunoglobulin polypeptides are
substituted for the constant domains of an antibody, or they are
substituted for the variable domains of one antigen-combining site
of an antibody to create a chimeric bivalent antibody comprising
one antigen-combining site having specificity for the target ligand
and another antigen-combining site having specificity for a
different antigen.
[0073] Chimeric or hybrid antibodies also may be prepared in vitro
using known methods in synthetic protein chemistry, including those
involving crosslinking agents. For example, immunotoxins may be
constructed using a disulfide exchange reaction or by forming a
thioether bond. Examples of suitable reagents for this purpose
include iminothiolate and methyl-4-mercaptobutyrimidate.
[0074] It will be understood by those of skill in the art that
nucleic acids may be cloned from viable or inviable cells. In the
case of inviable cells, for example, it may be desired to use
amplification of the cloned DNA, for example, using PCR. This may
also be carried out using viable cells either with or without
further growth of cells.
[0075] B. Maximization of Protein Affinity for Ligands
[0076] In a natural immune response, antibody genes accumulate
mutations at a high rate (somatic hypermutation). Some of the
changes introduced will confer higher affinity, and B cells
displaying high-affinity surface immunoglobulin. This natural
process can be mimicked by employing the technique known as "chain
shuffling" (Marks et al., 1992). In this method, the affinity of
"primary" human antibodies obtained in accordance with the
invention could be improved by sequentially replacing the heavy and
light chain V region genes with repertoires of naturally occurring
variants (repertoires) of V domain genes obtained from unimmunized
donors. This technique allows the production of antibodies and
antibody fragments with affinities in the nM range. A strategy for
making very large antibody repertoires was described by Waterhouse
et al., (1993), and the isolation of a high affinity human antibody
directly from such large phage library was reported by Griffith et
al., (1994). Gene shuffling also can be used to derive human
antibodies from rodent antibodies, where the human antibody has
similar affinities and specificities to the starting rodent
antibody. According to this method, which is also referred to as
"epitope imprinting", the heavy or light chain V domain gene of
rodent antibodies obtained by the phage display technique is
replaced with a repertoire of human V domain genes, creating
rodent-human chimeras. Selection of the antigen results in
isolation of human variable regions capable of restoring a
functional antigen-binding site, i.e. the epitope governs
(imprints) the choice of partner. When the process is repeated in
order to replace the remaining rodent V domain, a human antibody is
obtained (see PCT patent application WO 93/06213, published Apr. 1,
1993). Unlike traditional humanization of rodent antibodies by CDR
grafting, this technique provides completely human antibodies,
which have no framework or CDR residues of rodent origin.
[0077] C. Labeled Ligands
[0078] In one embodiment of the invention, an antibody or binding
protein is isolated which has affinity for a labeled ligand. By
permeabilization and/or removal of the periplasmic membrane of a
Gram negative bacterium in accordance with the invention, labeled
ligands of potentially any size could be screened. In the absence
of removal of the periplasmic membrane, it will typically be
preferable that the labeled ligand is less that 50,000 Da in size
in order to allow efficient diffusion of the ligand across the
bacterial periplasmic membrane.
[0079] As indicated above, it will typically be desired in
accordance with the invention to provide a ligand which has been
labeled with one or more detectable agent(s). This can be carried
out, for example, by linking the ligand to at least one detectable
agent to form a conjugate. For example, it is conventional to link
or covalently bind or complex at least one detectable molecule or
moiety. A "label" or "detectable label" is a compound and/or
element that can be detected due to specific functional properties,
and/or chemical characteristics, the use of which allows the ligand
to which it is attached to be detected, and/or further quantified
if desired. Examples of labels which could be used with the
invention include, but are not limited to, enzymes, radiolabels,
haptens, fluorescent labels, phosphorescent molecules,
chemiluminescent molecules, chromophores, luminescent molecules,
photoaffinity molecules, colored particles or ligands, such as
biotin.
[0080] In one embodiment of the invention, a visually-detectable
marker is used such that automated screening of cells for the label
can be carried out. In particular, fluorescent labels are
beneficial in that they allow use of flow cytometry for isolation
of cells expressing a desired binding protein or antibody. Examples
of agents that may be detected by visualization with an appropriate
instrument are known in the art, as are methods for their
attachment to a desired ligand (see, e.g., U.S. Pat. Nos.
5,021,236; 4,938,948; and 4,472,509, each incorporated herein by
reference). Such agents can include paramagnetic ions; radioactive
isotopes; fluorochromes; NMR-detectable substances and substances
for X-ray imaging. Types of fluorescent labels that may be used
with the invention will be well known to those of skill in the art
and include, for example, Alexa 350, Alexa 430, AMCA, BODIPY
630/650, BODIPY 650/665, BODIPY-FL, BODIPY-R6G, BODIPY-TMR,
BODIPY-TRX, Cascade Blue, Cy3, Cy5,6-FAM, Fluorescein
Isothiocyanate, HEX, 6-JOE, Oregon Green 488, Oregon Green 500,
Oregon Green 514, Pacific Blue, REG, Rhodamine Green, Rhodamine
Red, Renographin, ROX, TAMRA, TET, Tetramethylrhodamine, and/or
Texas Red.
[0081] Magnetic screening techniques are well known to those of
skill in the art (see, for example, U.S. Pat. No. 4,988,618, U.S.
Pat. No. 5,567,326 and U.S. Pat. No. 5,779,907). Examples of
paramagnetic ions that could be used as labels in accordance with
such techniques include ions such as chromium (III), manganese
(II), iron (III), iron (II), cobalt (II), nickel (II), copper (II),
neodymium (III), samarium (III), ytterbium (III), gadolinium (III),
vanadium (II), terbium (III), dysprosium (III), holmium (III)
and/or erbium (III). Ions useful in other contexts include but are
not limited to lanthanum (III), gold (III), lead (II), and
especially bismuth (III).
[0082] Another type of ligand conjugate contemplated in the present
invention are those where the ligand is linked to a secondary
binding molecule and/or to an enzyme (an enzyme tag) that will
generate a colored product upon contact with a chromogenic
substrate. Examples of such enzymes include urease, alkaline
phosphatase, (horseradish) hydrogen peroxidase or glucose oxidase.
In such instances, it will be desired that cells selected remain
viable. Preferred secondary binding ligands are biotin and/or
avidin and streptavidin compounds. The use of such labels is well
known to those of skill in the art and are described, for example,
in U.S. Pat. Nos. 3,817,837; 3,850,752; 3,939,350; 3,996,345;
4,277,437; 4,275,149 and 4,366,241; each incorporated herein by
reference.
[0083] Molecules containing azido groups also may be used to form
covalent bonds to proteins through reactive nitrene intermediates
that are generated by low intensity ultraviolet light (Potter &
Haley, 1983). In particular, 2- and 8-azido analogues of purine
nucleotides have been used as site-directed photoprobes to identify
nucleotide-binding proteins in crude cell extracts (Owens &
Haley, 1987; Atherton et al., 1985). The 2- and 8-azido nucleotides
have also been used to map nucleotide-binding domains of purified
proteins (Khatoon et al., 1989; King et al, 1989; and Dholakia et
al., 1989) and may be used as ligand binding agents.
[0084] Labeling can be carried out by any of the techniques well
known to those of skill in the art. For instance, ligands can be
labeled by contacting the ligand with the desired label and a
chemical oxidizing agent such as sodium hypochlorite, or an
enzymatic oxidizing agent, such as lactoperoxidase. Similarly, a
ligand exchange process could be used. Alternatively, direct
labeling techniques may be used, e.g., by incubating the label, a
reducing agent such as SNCl.sub.2, a buffer solution such as
sodium-potassium phthalate solution, and the ligand. Intermediary
functional groups on the ligand could also be used, for example, to
bind labels to a ligand in the presence of
diethylenetriaminepentaacetic acid (DTPA) or ethylene
diaminetetracetic acid (EDTA).
[0085] Other methods are also known in the art for the attachment
or conjugation of a ligand to its conjugate moiety. Some attachment
methods involve the use of an organic chelating agent such as
diethylenetriaminepentaacetic acid anhydride (DTPA);
ethylenetriaminetetraacetic acid; N-chloro-p-toluenesulfonamide;
and/or tetrachloro-3.alpha.-6.alpha.-diphenylglycouril-3 attached
to the ligand (U.S. Pat. Nos. 4,472,509 and 4,938,948, each
incorporated herein by reference). Ligands also may be reacted with
an enzyme in the presence of a coupling agent such as
glutaraldehyde or periodate. Conjugates with fluorescein markers
can be prepared in the presence of these coupling agents or by
reaction with an isothiocyanate. In U.S. Pat. No. 4,938,948,
imaging of breast tumors is achieved using monoclonal antibodies
and the detectable imaging moieties are bound to the antibody using
linkers such as methyl-p-hydroxybenzimidate or
N-succinimidyl-3-(4-hydroxyphenyl)propionate.
[0086] The ability to specifically label periplasmic expressed
proteins with appropriate fluorescent ligands also has applications
other than library screening. Specifically labeling with
fluorescent ligands and flow cytometry can be used for monitoring
production during protein manufacturing. While flow cytometry has
been used previously for the analysis of bacterial cells, it has
not been used for the specific labeling and quantitation of
periplasmic proteins. However, a large number of commercially
important proteins including IGF-1 several interleukins, enzymes
such as urokinase-type plasminogen activator, antibody fragments,
inhibitors (e.g., Bovine pancreatic trypsin inhibitor) are
expressed in recombinant bacteria in a form secreted into the
periplasmic space. The level of production of such proteins within
each cell in a culture can be monitored by utilizing an appropriate
fluorescent ligand and flow cytometric analysis, according to the
techniques taught by the present invention.
[0087] Generally, monitoring protein expression requires cell lysis
and detection of the protein by immunological techniques or
following chromatographic separation. However, ELISA or western
blot analysis is time-consuming and does not provide information on
the distribution of expression among a cell population and cannot
be used for on-line monitoring (Thorstenson et al., 1997; Berrier
et al., 2000). In contrast, FACS labeling is rapid and simple and
can well be applied to online monitoring of industrial size
fermentations of recombinant proteins expressed in Gram-negative
bacteria. Similarly, the invention could be used to monitor the
production of a particular byproduct of a biological reaction. This
also could be used to measure the relative concentration or
specific activity of an enzyme expressed in vivo in a bacterium or
provided ex vivo.
[0088] Once a ligand-binding protein, such as an antibody, has been
isolated in accordance with the invention, it may be desired to
link the molecule to at least one agent to form a conjugate to
enhance the utility of that molecule. For example, in order to
increase the efficacy of antibody molecules as diagnostic or
therapeutic agents, it is conventional to link or covalently bind
or complex at least one desired molecule or moiety. Such a molecule
or moiety may be, but is not limited to, at least one effector or
reporter molecule. Effector molecules comprise molecules having a
desired activity, e.g., cytotoxic activity. Non-limiting examples
of effector molecules which have been attached to antibodies
include toxins, anti-tumor agents, therapeutic enzymes,
radio-labeled nucleotides, antiviral agents, chelating agents,
cytokines, growth factors, and oligo- or poly-nucleotides. By
contrast, a reporter molecule is defined as any moiety which may be
detected using an assay. Techniques for labeling such a molecule
are known to those of skill in the art and have been described
herein above.
[0089] Labeled binding proteins such as antibodies which have been
prepared in accordance with the invention may also then be
employed, for example, in immunodetection methods for binding,
purifying, removing, quantifying and/or otherwise generally
detecting biological components such as protein(s), polypeptide(s)
or peptide(s). Some immunodetection methods include enzyme linked
immunosorbent assay (ELISA), radioimmunoassay (RIA),
immunoradiometric assay, fluoroimmunoassay, chemiluminescent assay,
bioluminescent assay, and Western blot to mention a few. The steps
of various useful immunodetection methods have been described in
the scientific literature, such as, e.g., Doolittle MH and Ben-Zeev
O, 1999; Gulbis B and Galand P, 1993; and De Jager R et al., 1993,
each incorporated herein by reference. Such techniques include
binding assays such as the various types of enzyme linked
immunosorbent assays (ELISAs) and/or radioimmunoassays (RIA) known
in the art.
[0090] The ligand-binding molecules, including antibodies, prepared
in accordance with the present invention may also, for example, in
conjunction with both fresh-frozen and/or formalin-fixed,
paraffin-embedded tissue blocks prepared for study by
immunohistochemistry (IHC). The method of preparing tissue blocks
from these particulate specimens has been successfully used in
previous IHC studies of various prognostic factors, and/or is well
known to those of skill in the art (Abbondanzo et al., 1990).
VI. Automated Screening with Flow Cytometry
[0091] In one embodiment of the invention, fluorescence activated
cell sorting (FACS) screening or other automated flow cytometric
techniques may be used for the efficient isolation of a bacterial
cell comprising a labeled ligand bound to a candidate molecule and
linked to the outer face of the cytoplasmic membrane of the
bacteria. Instruments for carrying out flow cytometry are known to
those of skill in the art and are commercially available to the
public. Examples of such instruments include FACS Star Plus,
FACScan and FACSort instruments from Becton Dickinson (Foster City,
Calif.) Epics C from Coulter Epics Division (Hialeah, Fla.) and
MoFlo from Cytomation (Colorado Springs, Colo.).
[0092] Flow cytometric techniques in general involve the separation
of cells or other particles in a liquid sample. Typically, the
purpose of flow cytometry is to analyze the separated particles for
one or more characteristics thereof, for example, presence of a
labeled ligand or other molecule. The basis steps of flow cytometry
involve the direction of a fluid sample through an apparatus such
that a liquid stream passes through a sensing region. The particles
should pass one at a time by the sensor and are categorized base on
size, refraction, light scattering, opacity, roughness, shape,
fluorescence, etc.
[0093] Rapid quantitative analysis of cells proves useful in
biomedical research and medicine. Apparati permit quantitative
multiparameter analysis of cellular properties at rates of several
thousand cells per second. These instruments provide the ability to
differentiate among cell types. Data are often displayed in
one-dimensional (histogram) or two-dimensional (contour plot,
scatter plot) frequency distributions of measured variables. The
partitioning of multiparameter data files involves consecutive use
of the interactive one- or two-dimensional graphics programs.
[0094] Quantitative analysis of multiparameter flow cytometric data
for rapid cell detection consists of two stages: cell class
characterization and sample processing. In general, the process of
cell class characterization partitions the cell feature into cells
of interest and not of interest. Then, in sample processing, each
cell is classified in one of the two categories according to the
region in which it falls. Analysis of the class of cells is very
important, as high detection performance may be expected only if an
appropriate characteristic of the cells is obtained.
[0095] Not only is cell analysis performed by flow cytometry, but
so too is sorting of cells. In U.S. Pat. No. 3,826,364, an
apparatus is disclosed which physically separates particles, such
as functionally different cell types. In this machine, a laser
provides illumination which is focused on the stream of particles
by a suitable lens or lens system so that there is highly localized
scatter from the particles therein. In addition, high intensity
source illumination is directed onto the stream of particles for
the excitation of fluorescent particles in the stream. Certain
particles in the stream may be selectively charged and then
separated by deflecting them into designated receptacles. A classic
form of this separation is via fluorescent-tagged antibodies, which
are used to mark one or more cell types for separation.
[0096] Other examples of methods for flow cytometry that could
include, but are not limited to, those described in U.S. Pat. Nos.
4,284,412; 4,989,977; 4,498,766; 5,478,722; 4,857,451; 4,774,189;
4,767,206; 4,714,682; 5,160,974; and 4,661,913, each of the
disclosures of which are specifically incorporated herein by
reference.
[0097] For the present invention, an important aspect of flow
cytometry is that multiple rounds of screening can be carried out
sequentially. Cells may be isolated from an initial round of
sorting and immediately reintroduced into the flow cytometer and
screened again to improve the stringency of the screen. Another
advantage known to those of skill in the art is that nonviable
cells can be recovered using flow cytometry. Since flow cytometry
is essentially a particle sorting technology, the ability of a cell
to grow or propagate is not necessary. Techniques for the recovery
of nucleic acids from such non-viable cells are well known in the
art and may include, for example, use of template-dependent
amplification techniques including PCR.
VII. Nucleic Acid-Based Expression Systems
[0098] Nucleic acid-based expression systems may find use, in
certain embodiments of the invention, for the expression of
recombinant proteins. For example, one embodiment of the invention
involves transformation of Gram negative bacteria with the coding
sequences of fusion polypeptides comprising a candidate antibody or
other binding protein having affinity for a selected ligand and the
expression of such molecules on the cytoplasmic membrane of the
Gram negative bacteria. In other embodiments of the invention,
expression of such coding sequences may be carried, for example, in
eukaryotic host cells for the preparation of isolated binding
proteins having specificity for the target ligand. The isolated
protein could then be used in one or more therapeutic or diagnostic
applications.
[0099] A. Methods of Nucleic Acid Delivery
[0100] Certain aspects of the invention may comprise delivery of
nucleic acids to target cells. For example, bacterial host cells
may be transformed with nucleic acids encoding candidate molecules
potentially capable binding a target ligand, In particular
embodiments of the invention, it may be desired to target the
expression to the cytoplasmic membrane of the bacteria.
Transformation of eukaryotic host cells may similarly find use in
the expression of various candidate molecules identified as capable
of binding a target ligand.
[0101] Suitable methods for nucleic acid delivery for
transformation of a cell are believed to include virtually any
method by which a nucleic acid (e.g., DNA) can be introduced into
such a cell, or even an organelle thereof. Such methods include,
but are not limited to, direct delivery of DNA such as by injection
(U.S. Pat. Nos. 5,994,624, 5,981,274, 5,945,100, 5,780,448,
5,736,524, 5,702,932, 5,656,610, 5,589,466 and 5,580,859, each
incorporated herein by reference), including microinjection (Harlan
and Weintraub, 1985; U.S. Pat. No. 5,789,215, incorporated herein
by reference); by electroporation (U.S. Pat. No. 5,384,253,
incorporated herein by reference); by calcium phosphate
precipitation (Graham and Van Der Eb, 1973; Chen and Okayama, 1987;
Rippe et al., 1990); by using DEAE-dextran followed by polyethylene
glycol (Gopal, 1985); by direct sonic loading (Fechheimer et al.,
1987); by liposome mediated transfection (Nicolau and Sene, 1982;
Fraley et al., 1979; Nicolau et al., 1987; Wong et aL, 1980; Kaneda
et al., 1989; Kato et al., 1991); by microprojectile bombardment
(PCT Application Nos. WO 94/09699 and 95/06128; U.S. Pat. Nos.
5,610,042; 5,322,783 5,563,055, 5,550,318, 5,538,877 and 5,538,880,
and each incorporated herein by reference); by agitation with
silicon carbide fibers (Kaeppler et al., 1990; U.S. Pat. Nos.
5,302,523 and 5,464,765, each incorporated herein by reference); by
Agrobacterium-mediated transformation (U.S. Pat. Nos. 5,591,616 and
5,563,055, each incorporated herein by reference); or by
PEG-mediated transformation of protoplasts (Omirulleh et al., 1993;
U.S. Pat. Nos. 4,684,611 and 4,952,500, each incorporated herein by
reference); by desiccation/inhibition-mediated DNA uptake (Potrykus
et al., 1985). Through the application of techniques such as these,
organelle(s), cell(s), tissue(s) or organism(s) may be stably or
transiently transformed.
[0102] 1. Electroporation
[0103] In certain embodiments of the present invention, a nucleic
acid is introduced into a cell via electroporation. Electroporation
involves the exposure of a suspension of cells and DNA to a
high-voltage electric discharge. In some variants of this method,
certain cell wall-degrading enzymes, such as pectin-degrading
enzymes, are employed to render the target recipient cells more
susceptible to transformation by electroporation than untreated
cells (U.S. Pat. No. 5,384,253, incorporated herein by reference).
Alternatively, recipient cells can be made more susceptible to
transformation by mechanical wounding.
[0104] 2. Calcium Phosphate
[0105] In other embodiments of the present invention, a nucleic
acid is introduced to the cells using calcium phosphate
precipitation. Human KB cells have been transfected with adenovirus
5 DNA (Graham and Van Der Eb, 1973) using this technique. Also in
this manner, mouse L(A9), mouse C127, CHO, CV-1, BHK, NIH3T3 and
HeLa cells were transfected with a neomycin marker gene (Chen and
Okayama, 1987), and rat hepatocytes were transfected with a variety
of marker genes (Rippe et al., 1990).
[0106] B. Vectors
[0107] Vectors may find use with the current invention, for
example, in the transformation of a Gram negative bacterium with a
nucleic acid sequence encoding a candidate polypeptide which one
wishes to screen for ability to bind a target ligand. In one
embodiment of the invention, an entire heterogeneous "library" of
nucleic acid sequences encoding target polypeptides may be
introduced into a population of bacteria, thereby allowing
screening of the entire library. The term "vector" is used to refer
to a carrier nucleic acid molecule into which a nucleic acid
sequence can be inserted for introduction into a cell where it can
be replicated. A nucleic acid sequence can be "exogenous," or
"heterologous", which means that it is foreign to the cell into
which the vector is being introduced or that the sequence is
homologous to a sequence in the cell but in a position within the
host cell nucleic acid in which the sequence is ordinarily not
found. Vectors include plasmids, cosmids, viruses (bacteriophage,
animal viruses, and plant viruses), and artificial chromosomes
(e.g., YACs). One of skill in the art may construct a vector
through standard recombinant techniques, which are described in
Maniatis et al., 1988 and Ausubel et al., 1994, both of which
references are incorporated herein by reference.
[0108] The term "expression vector" refers to a vector containing a
nucleic acid sequence coding for at least part of a gene product
capable of being transcribed. In some cases, RNA molecules are then
translated into a protein, polypeptide, or peptide. In other cases,
these sequences are not translated, for example, in the production
of antisense molecules or ribozymes. Expression vectors can contain
a variety of "control sequences," which refer to nucleic acid
sequences necessary for the transcription and possibly translation
of an operably linked coding sequence in a particular host
organism. In addition to control sequences that govern
transcription and translation, vectors and expression vectors may
contain nucleic acid sequences that serve other functions as well
and are described infra.
[0109] 1. Promoters and Enhancers
[0110] A "promoter" is a control sequence that is a region of a
nucleic acid sequence at which initiation and rate of transcription
are controlled. It may contain genetic elements at which regulatory
proteins and molecules may bind such as RNA polymerase and other
transcription factors. The phrases "operatively positioned,"
"operatively linked," "under control," and "under transcriptional
control" mean that a promoter is in a correct functional location
and/or orientation in relation to a nucleic acid sequence to
control transcriptional initiation and/or expression of that
sequence. A promoter may or may not be used in conjunction with an
"enhancer," which refers to a cis-acting regulatory sequence
involved in the transcriptional activation of a nucleic acid
sequence.
[0111] A promoter may be one naturally associated with a gene or
sequence, as may be obtained by isolating the 5' non-coding
sequences located upstream of the coding segment and/or exon. Such
a promoter can be referred to as "endogenous." Similarly, an
enhancer may be one naturally associated with a nucleic acid
sequence, located either downstream or upstream of that sequence.
Alternatively, certain advantages will be gained by positioning the
coding nucleic acid segment under the control of a recombinant or
heterologous promoter, which refers to a promoter that is not
normally associated with a nucleic acid sequence in its natural
environment. A recombinant or heterologous enhancer refers also to
an enhancer not normally associated with a nucleic acid sequence in
its natural environment. Such promoters or enhancers may include
promoters or enhancers of other genes, and promoters or enhancers
isolated from any other prokaryotic, viral, or eukaryotic cell, and
promoters or enhancers not "naturally occurring," i.e., containing
different elements of different transcriptional regulatory regions,
and/or mutations that alter expression. In addition to producing
nucleic acid sequences of promoters and enhancers synthetically,
sequences may be produced using recombinant cloning and/or nucleic
acid amplification technology, including PCR.TM., in connection
with the compositions disclosed herein (see U.S. Pat. No.
4,683,202, U.S. Pat. No. 5,928,906, each incorporated herein by
reference). Furthermore, it is contemplated that the control
sequences that direct transcription and/or expression of sequences
within non-nuclear organelles such as mitochondria, chloroplasts,
and the like, can be employed as well.
[0112] Naturally, it will be important to employ a promoter and/or
enhancer that effectively directs the expression of the DNA segment
in the cell type, organelle, and organism chosen for expression.
One example of such promoter that may be used with the invention is
the E. coli arabinose promoter. Those of skill in the art of
molecular biology generally are familiar with the use of promoters,
enhancers, and cell type combinations for protein expression, for
example, see Sambrook et al. (1989), incorporated herein by
reference. The promoters employed may be constitutive,
tissue-specific, inducible, and/or useful under the appropriate
conditions to direct high level expression of the introduced DNA
segment, such as is advantageous in the large-scale production of
recombinant proteins and/or peptides. The promoter may be
heterologous or endogenous.
[0113] 2. Initiation Signals and Internal Ribosome Binding
Sites
[0114] A specific initiation signal also may be required for
efficient translation of coding sequences. These signals include
the ATG initiation codon or adjacent sequences. Exogenous
translational control signals, including the ATG initiation codon,
may need to be provided. One of ordinary skill in the art would
readily be capable of determining this and providing the necessary
signals. It is well known that the initiation codon must be
"in-frame" with the reading frame of the desired coding sequence to
ensure translation of the entire insert. The exogenous
translational control signals and initiation codons can be either
natural or synthetic. The efficiency of expression may be enhanced
by the inclusion of appropriate transcription enhancer
elements.
[0115] 3. Multiple Cloning Sites
[0116] Vectors can include a multiple cloning site (MCS), which is
a nucleic acid region that contains multiple restriction enzyme
sites, any of which can be used in conjunction with standard
recombinant technology to digest the vector (see Carbonelli et al.,
1999, Levenson et al., 1998, and Cocea, 1997, incorporated herein
by reference.) "Restriction enzyme digestion" refers to catalytic
cleavage of a nucleic acid molecule with an enzyme that functions
only at specific locations in a nucleic acid molecule. Many of
these restriction enzymes are commercially available. Use of such
enzymes is understood by those of skill in the art. Frequently, a
vector is linearized or fragmented using a restriction enzyme that
cuts within the MCS to enable exogenous sequences to be ligated to
the vector. "Ligation" refers to the process of forming
phosphodiester bonds between two nucleic acid fragments, which may
or may not be contiguous with each other. Techniques involving
restriction enzymes and ligation reactions are well known to those
of skill in the art of recombinant technology.
[0117] 4. Termination Signals
[0118] The vectors or constructs prepared in accordance with the
present invention will generally comprise at least one termination
signal. A "termination signal" or "terminator" is comprised of the
DNA sequences involved in specific termination of an RNA transcript
by an RNA polymerase. Thus, in certain embodiments, a termination
signal that ends the production of an RNA transcript is
contemplated. A terminator may be necessary in vivo to achieve
desirable message levels.
[0119] Terminators contemplated for use in the invention include
any known terminator of transcription described herein or known to
one of ordinary skill in the art, including but not limited to, for
example, rhp dependent or rho independent terminators. In certain
embodiments, the termination signal may be a lack of transcribable
or translatable sequence, such as due to a sequence truncation.
[0120] 5. Origins of Replication
[0121] In order to propagate a vector in a host cell, it may
contain one or more origins of replication sites (often termed
"ori"), which is a specific nucleic acid sequence at which
replication is initiated. Alternatively an autonomously replicating
sequence (ARS) can be employed if the host cell is yeast.
[0122] 6. Selectable and Screenable Markers
[0123] In certain embodiments of the invention, cells containing a
nucleic acid construct of the present invention may be identified
in vitro or in vivo by including a marker in the expression vector.
Such markers would confer an identifiable change to the cell
permitting easy identification of cells containing the expression
vector. Generally, a selectable marker is one that confers a
property that allows for selection. A positive selectable marker is
one in which the presence of the marker allows for its selection,
while a negative selectable marker is one in which its presence
prevents its selection. An example of a positive selectable marker
is a drug resistance marker.
[0124] Usually the inclusion of a drug selection marker aids in the
cloning and identification of transformants, for example, genes
that confer resistance to neomycin, puromycin, hygromycin, DHFR,
GPT, zeocin and histidinol are useful selectable markers. In
addition to markers conferring a phenotype that allows for the
discrimination of transformants based on the implementation of
conditions, other types of markers including screenable markers
such as GFP, whose basis is colorimetric analysis, are also
contemplated. Alternatively, screenable enzymes such as herpes
simplex virus thymidine kinase (tk) or chloramphenicol
acetyltransferase (CAT) may be utilized. One of skill in the art
would also know how to employ immunologic markers, possibly in
conjunction with FACS analysis. The marker used is not believed to
be important, so long as it is capable of being expressed
simultaneously with the nucleic acid encoding a gene product.
Further examples of selectable and screenable markers are well
known to one of skill in the art.
[0125] C. Host Cells
[0126] As used herein, the terms "cell," "cell line," and "cell
culture" may be used interchangeably. All of these terms also
include their progeny, which is any and all subsequent generations.
It is understood that all progeny may not be identical due to
deliberate or inadvertent mutations. In the context of expressing a
heterologous nucleic acid sequence, "host cell" refers to a
prokaryotic cell, and it includes any transformable organism that
is capable of replicating a vector and/or expressing a heterologous
gene encoded by a vector. A host cell can, and has been, used as a
recipient for vectors. A host cell may be "transfected" or
"transformed," which refers to a process by which exogenous nucleic
acid is transferred or introduced into the host cell. A transformed
cell includes the primary subject cell and its progeny.
[0127] In particular embodiments of the invention, a host cell is a
Gram negative bacterial cell. These bacteria are suited for use
with the invention in that they posses a periplasmic space between
the inner and outer membrane and, particularly, the aforementioned
inner membrane between the periplasm and cytoplasm, which is also
known as the cytoplasmic membrane. As such, any other cell with
such a periplasmic space could be used in accordance with the
invention. Examples of Gram negative bacteria that may find use
with the invention may include, but are not limited to, E. coli,
Pseudomonas aeruginosa, Vibrio cholera, Salmonella typhimurium,
Shigella flexneri, Haemophilus influenza, Bordotella pertussi,
Erwinia amylovora, Rhizobium sp. The Gram negative bacterial cell
may be still further defined as bacterial cell which has been
transformed with the coding sequence of a fusion polypeptide
comprising a candidate binding polypeptide capable of binding a
selected ligand. The polypeptide is anchored to the outer face of
the cytoplasmic membrane, facing the periplasmic space, and may
comprise an antibody coding sequence or another sequence. One means
for expression of the polypeptide is by attaching a leader sequence
to the polypeptide capable of causing such directing.
[0128] Numerous prokaryotic cell lines and cultures are available
for use as a host cell, and they can be obtained through the
American Type Culture Collection (ATCC), which is an organization
that serves as an archive for living cultures and genetic materials
(www.atcc.org). An appropriate host can be determined by one of
skill in the art based on the vector backbone and the desired
result. A plasmid or cosmid, for example, can be introduced into a
prokaryote host cell for replication of many vectors. Bacterial
cells used as host cells for vector replication and/or expression
include DH5.alpha., JM109, and KC8, as well as a number of
commercially available bacterial hosts such as SURE.RTM. Competent
Cells and SOLOPACK.TM. Gold Cells (STRATAGENE.RTM., La Jolla).
Alternatively, bacterial cells such as E. coli LE392 could be used
as host cells for bacteriophage.
[0129] Many host cells from various cell types and organisms are
available and would be known to one of skill in the art. Similarly,
a viral vector may be used in conjunction with a prokaryotic host
cell, particularly one that is permissive for replication or
expression of the vector. Some vectors may employ control sequences
that allow it to be replicated and/or expressed in both prokaryotic
and eukaryotic cells. One of skill in the art would further
understand the conditions under which to incubate all of the above
described host cells to maintain them and to permit replication of
a vector. Also understood and known are techniques and conditions
that would allow large-scale production of vectors, as well as
production of the nucleic acids encoded by vectors and their
cognate polypeptides, proteins, or peptides.
[0130] D. Expression Systems
[0131] Numerous expression systems exist that comprise at least a
part or all of the compositions discussed above. Such systems could
be used, for example, for the production of a polypeptide product
identified in accordance with the invention as capable of binding a
particular ligand. Prokaryote- -based systems can be employed for
use with the present invention to produce nucleic acid sequences,
or their cognate polypeptides, proteins and peptides. Many such
systems are commercially and widely available. Other examples of
expression systems comprise of vectors containing a strong
prokaryotic promoter such as T7, Tac, Trc, BAD, lambda pL,
Tetracycline or Lac promoters, the pET Expression System and an E.
coli expression system.
[0132] E. Candidate Binding Proteins and Antibodies
[0133] In certain aspects of the invention, candidate antibodies or
other recombinant polypeptides, including proteins and short
peptides potentially capable of binding a target ligand are
expressed on the cytoplasmic membrane of a host bacterial cell. By
expression of a heterogeneous population of such antibodies or
other binding polypeptides, those antibodies having a high affinity
for a target ligand may be identified. The identified antibodies
may then be used in various diagnostic or therapeutic applications,
as described herein.
[0134] As used herein, the term "antibody" is intended to refer
broadly to any immunologic binding agent such as IgG, IgM, IgA, IgD
and IgE. The term "antibody" is also used to refer to any
antibody-like molecule that has an antigen binding region, and
includes antibody fragments such as Fab', Fab, F(ab').sub.2, single
domain antibodies (DABs), Fv, scFv (single chain Fv), and
engineering multivalent antibody fragments such as dibodies,
tribodies and multibodies. The techniques for preparing and using
various antibody-based constructs and fragments are well known in
the art. Means for preparing and characterizing antibodies are also
well known in the art (See, e.g., Antibodies: A Laboratory Manual,
Cold Spring Harbor Laboratory, 1988; incorporated herein by
reference).
[0135] Once an antibody having affinity for a target ligand is
identified, the antibody or ligand binding polypeptide may be
purified, if desired, using filtration, centrifugation and various
chromatographic methods such as HPLC or affinity chromatography.
Fragments of such polypeptides, including antibodies, can be
obtained from the antibodies so produced by methods which include
digestion with enzymes, such as pepsin or papain, and/or by
cleavage of disulfide bonds by chemical reduction. Alternatively,
antibody or other polypeptides, including protein fragments,
encompassed by the present invention can be synthesized using an
automated peptide synthesizer.
[0136] A molecular cloning approach comprises one suitable method
for the generation of a heterogeneous population of candidate
antibodies that may then be screened in accordance with the
invention for affinity to target ligands. In one embodiment of the
invention, combinatorial immunoglobulin phagemid can be prepared
from RNA isolated from the spleen of an animal. By immunizing an
animal with the ligand to be screened, the assay may be targeted to
the particular antigen. The advantages of this approach over
conventional techniques are that approximately 10.sup.4 times as
many antibodies can be produced and screened in a single round, and
that new specificities are generated by H and L chain combination
which further increases the chance of finding appropriate
antibodies.
VIII. Manipulation and Detection of Nucleic Acids
[0137] In certain embodiments of the invention, it may be desired
to employ one or more techniques for the manipulation, isolation
and/or detection of nucleic acids. Such techniques may include, for
example, the preparation of vectors for transformation of host
cells as well as methods for cloning selected nucleic acid segments
from a transgenic cell. Methodology for carrying out such
manipulations will be well known to those of skill in the art in
light of the instant disclosure.
[0138] Nucleic acids used as a template for amplification may be
isolated from cells, tissues or other samples according to standard
methodologies (Sambrook et al., 1989). In certain embodiments,
analysis may be performed on whole cell or tissue homogenates or
biological fluid samples without substantial purification of the
template nucleic acid. The nucleic acid may be genomic DNA or
fractionated or whole cell RNA. Where RNA is used, it may be
desired to first convert the RNA to a complementary DNA.
[0139] The term "primer," as used herein, is meant to encompass any
nucleic acid that is capable of priming the synthesis of a nascent
nucleic acid in a template-dependent process. Typically, primers
are oligonucleotides from ten to twenty and/or thirty base pairs in
length, but longer sequences can be employed. Primers may be
provided in double-stranded and/or single-stranded form, although
the single-stranded form is preferred.
[0140] Pairs of primers designed to selectively hybridize to
nucleic acids corresponding to a selected nucleic acid sequence are
contacted with the template nucleic acid under conditions that
permit selective hybridization. Depending upon the desired
application, high stringency hybridization conditions may be
selected that will only allow hybridization to sequences that are
completely complementary to the primers. In other embodiments,
hybridization may occur under reduced stringency to allow for
amplification of nucleic acids contain one or more mismatches with
the primer sequences. Once hybridized, the template-primer complex
is contacted with one or more enzymes that facilitate
template-dependent nucleic acid synthesis. Multiple rounds of
amplification, also referred to as "cycles," are conducted until a
sufficient amount of amplification product is produced.
[0141] The amplification product may be detected or quantified. In
certain applications, the detection may be performed by visual
means. Alternatively, the detection may involve indirect
identification of the product via chemiluminescence, radioactive
scintigraphy of incorporated radiolabel or fluorescent label or
even via a system using electrical and/or thermal impulse signals
(Affymax technology; Bellus, 1994).
[0142] A number of template dependent processes are available to
amplify the oligonucleotide sequences present in a given template
sample. One of the best known amplification methods is the
polymerase chain reaction (referred to as PCR.TM.) which is
described in detail in U.S. Pat. Nos. 4,683,195, 4,683,202 and
4,800,159, and in Innis et al., 1988, each of which is incorporated
herein by reference in their entirety.
[0143] A reverse transcriptase PCR.TM. amplification procedure may
be performed to quantify the amount of mRNA amplified. Methods of
reverse transcribing RNA into cDNA are well known (see Sambrook et
al., 1989). Alternative methods for reverse transcription utilize
thermostable DNA polymerases. These methods are described in WO
90/07641. Polymerase chain reaction methodologies are well known in
the art. Representative methods of RT-PCR are described in U.S.
Pat. No. 5,882,864.
[0144] Another method for amplification is ligase chain reaction
("LCR"), disclosed in European Application 320 308, incorporated
herein by reference in its entirety. U.S. Pat. No. 4,883,750
describes a method similar to LCR for binding probe pairs to a
target sequence. A method based on PCR.TM. and oligonucleotide
ligase assay (OLA), disclosed in U.S. Pat. No. 5,912,148, may also
be used.
[0145] Alternative methods for amplification of target nucleic acid
sequences that may be used in the practice of the present invention
are disclosed in U.S. Pat. Nos. 5,843,650, 5,846,709, 5,846,783,
5,849,546, 5,849,497, 5,849,547, 5,858,652, 5,866,366, 5,916,776,
5,922,574, 5,928,905, 5,928,906, 5,932,451, 5,935,825, 5,939,291
and 5,942,391, GB Application No. 2 202 328, and in PCT Application
No. PCT/US89/01025, each of which is incorporated herein by
reference in its entirety.
[0146] Qbeta Replicase, described in PCT Application No.
PCT/US87/00880, may also be used as an amplification method in the
present invention. In this method, a replicative sequence of RNA
that has a region complementary to that of a target is added to a
sample in the presence of an RNA polymerase. The polymerase will
copy the replicafive sequence which may then be detected.
[0147] An isothermal amplification method, in which restriction
endonucleases and ligases are used to achieve the amplification of
target molecules that contain nucleotide
5'-[alpha-thio]-triphosphates in one strand of a restriction site
may also be useful in the amplification of nucleic acids in the
present invention (Walker et al., 1992). Strand Displacement
Amplification (SDA), disclosed in U.S. Pat. No. 5,916,779, is
another method of carrying out isothermal amplification of nucleic
acids which involves multiple rounds of strand displacement and
synthesis, i.e., nick translation.
[0148] Other nucleic acid amplification procedures include
transcription-based amplification systems (TAS), including nucleic
acid sequence based amplification (NASBA) and 3SR (Kwoh et al.,
1989; Gingeras et aL, PCT Application WO 88/10315, incorporated
herein by reference in their entirety). European Application No.
329 822 disclose a nucleic acid amplification process involving
cyclically synthesizing single-stranded RNA ("ssRNA"), ssDNA, and
double-stranded DNA (dsDNA), which may be used in accordance with
the present invention.
[0149] PCT Application WO 89/06700 (incorporated herein by
reference in its entirety) discloses a nucleic acid sequence
amplification scheme based on the hybridization of a promoter
region/primer sequence to a target single-stranded DNA ("ssDNA")
followed by transcription of many RNA copies of the sequence. This
scheme is not cyclic, i.e., new templates are not produced from the
resultant RNA transcripts. Other amplification methods include
"race" and "one-sided PCR" (Frohman, 1990; Ohara et al., 1989).
IX. EXAPMLES
[0150] The following examples are included to demonstrate preferred
embodiments of the invention. It should be appreciated by those of
skill in the art that the techniques disclosed in the examples
which follow represent techniques discovered by the inventor to
function well in the practice of the invention, and thus can be
considered to constitute preferred modes for its practice. However,
those of skill in the art should, in light of the present
disclosure, appreciate that many changes can be made in the
specific embodiments which are disclosed and still obtain a like or
similar result without departing from the spirit and scope of the
invention.
Example 1
Demonstration of Anchored Periplasmic Expression to Target Small
Molecules and Peptides
[0151] The ability of scFvs displayed by APEx to target small
molecules and peptides is shown in FIGS. 1A-1B and in FIG. 1C,
respectively. Three cultures of Escherichia coli containing fusions
of the first six amino acids of NlpA (to serve as a inner membrane
targeting sequence for APEx analysis) to either an
anti-methamphetamine, anti-digoxin, or anti-peptide scfv were grown
up and induced for protein expression as described below. Cells of
each construct were then labeled in 5.times.PBS buffer with 200 nM
concentrations of methamphetamine-FL (FIG. 1A), digoxigenin-bodipy
(FIG. 1B), or 200 nM peptide(18mer)-BodipyFL (FIG. 1C). The data
presented shows a histogram representation of 10,000 events from
each of the labeled cell cultures. The results demonstrate the
ability of scfvs displayed by APEx to bind to their specific
antigen conjugated fluorophore, with minimal crossreactivity to
non-specific ligands.
Example 2
Demonstration of Recognition of Ab Fragments by Anchored
Periplasmic Expression
[0152] To demonstrate that the scFv is accessible to larger
proteins, it was first demonstrated that polyclonal antibody serum
against human Ab fragments or mouse Ab fragments would recognize
scFvs derived from each displayed on the E. coli inner membrane by
anchored periplasmic expression. Escherichia coli expressing a
mouse derived scFv via anchored periplasmic expression (FIG. 2A) or
expressing a human derived scFv via anchored periplasmic expression
(FIG. 2B) were labeled as described below with either anti-mouse
polyclonal IgG (H+L)-Alexa-FL or anti-human polyclonal IgG
(Fab)-FITC. Results (FIG. 2A, 2B) in the form of histogram
representations of 10000 events of each demonstrated that the
anti-human polyclonal (approximately 150 kDa in size) recognized
the human derived scFv specifically while the anti-mouse polyclonal
(150 kDa) recognized the mouse derived scFv.
Example 3
Demonstration of the Ability of scFvs Displayed by Anchored
Periplasmic Expression to Specifically Bind Large Antigen
Conjugated Fluorophores
[0153] To demonstrate the ability of scFvs displayed via anchored
periplasmic expression to specifically bind to large antigen
conjugated fluorophores, E. coli were induced and labeled as
described below expressing, via anchored periplasmic expression, an
anti-protective antigen(PA) scFv (PA is one component of the
anthrax toxin: a 83 kDa protein) or an anti-digoxigenin scFv.
Histogram data of 10,000 events demonstrated specific binding to a
PA-Cy5 antigen conjugated flourophore as compared to the cells
expressing the an anti-digoxigenin scFv (FIG. 3A). To further
illustrate this point, digoxigenin was coupled to
phycoerythrin(PE), a 240 kDa fluorescent protein. Cells were
labeled with this conjugate as described below. It was found that
E. coli (10,000 events) expressing the anti-digoxigenin scFv via
anchored periplasmic expression were labeled with the large
PE-digoxigenin conjugate while those expressing a non-specific scFv
via anchored periplasmic expression show little fluorescence (FIG.
3B).
Example 4
Demonstration of Selecting for Improved scFv Variants from a
Library of scFvs by Flow Cytometric Selection.
[0154] Scans were carried out of polyclonal Escherichia coli
expressing, via anchored periplasmic expression, a mutagenic
library of an scFv with affinity to methamphetamine. Through two
rounds of sorting and re-sorting using a Methamphetamine conjugated
fluorophore, a sub-population of the library was isolated. (FIG.
4)
[0155] Individual clones from this library were labeled with the
same Methamphetamine flourophore and analyzed as described below.
Shown in FIG. 5 is an example of a clone, designated mutant 9, that
had a higher mean FL signal than the parent anti-methamphetamine
scFv.
Example 5
Materials and Methods
[0156] A. Vector Construction
[0157] The leader peptide and first six amino acids of the mature
NlpA protein were generated by whole cell PCR (Perken Elmer) on
XL1-blue Escherichia coli, (Stratagene) using primers BRH#08 5'
GAAGGAGATATACATATGAAACTGACAACACATCATCTA 3'(SEQ ID NO:6) and BRH#9
5' CTGGGCCATGGCCGGCTGGGCCTCGCTGCTACTCTGGTCGCAACC 3', (SEQ ID NO:7)
VENT polymerase (New England Biolabs) and dNTPs (Roche). This was
then cut with Nde1 and Sfi1 restriction endonucleases and cloned
between a lac promoter and a multiple cloning site (MCS) in a E.
coli expression vector with the following elements down stream of
the MCS: myc and his tag, Cm resistance marker, colE1 origin and
lac I. ScFvs of interest were then cloned into the MCS and the
vector was transformed into AbleC E. coli (Stratagene).
[0158] B. Expression
[0159] E. coli cells are inoculated in TB media+2% glucose and 30
mg/l chloramphenicol to an OD600 of 0.1. Cells are grown for 2
hours at 37 C. and then cooled to 25 C. for 30 minutes. They are
then induced at 25 C. with 1 mM IPTG for 4 hrs.
[0160] Mutagenic libraries of scFv sequences were constructed using
mutagenic PCR methods as described by Fromant M, et al. (1995)
utilizing the original scFv sequence as a template. These mutagenic
products were then cloned into the above mentioned APEx expression
vector, transformed into ABLEC E. coli and plated on agar plates
with SOC media containing 2% glucose and 30 ug/ml chloramphenicol.
Following overnight incubation at 30 C., the E. coli were scraped
from the plates, frozen in 15% glycerol aliquots and stored at -80
C. for future flow cytometric sorting.
[0161] C. Labeling Strategies
[0162] Following induction, cells are either incubated in
5.times.PBS with 200 nM probe for 45 minutes or are resuspended in
350 .mu.l of 0.75M sucrose, 100 mM Tris. 35 .mu.l of lysozyme at 10
mg/ml is then added followed by 700 .mu.l of 1 mM EDTA added
dropwise with gentle shaking. This is allowed to sit on ice for 10
min followed by the addition of 50 .mu.l of 0.5M MgCl2. After an
additional 10 minutes on ice the suspension is centrifuged at
13,200 g for 1 minute, decanted and resuspended in 500 .mu.l
1.times.PBS. The cells are then labeled with 200 nM of probe for 45
minutes, and are then analyzed by flow cytometry and selected for
improved fluorescence.
[0163] D. Strains and Plasmids
[0164] Strain ABLE.TM.C (Stratagene) was used for screening with
APEx. E. coli strains TG1 and HB2151 were provided with the Griffin
library. ABLET.TM.C and ABLE.TM.K were purchased from Stratagene
and helper phage M13K07 from Pharmacia. A positive control for FACS
analysis of a phage display vehicle was constructed by replacing a
pre-existing scFv in pHEN2 with the 26.10 scFv to create pHEN2.dig.
The negative control was pHEN2.thy bearing the anti-thyroglobulin
scFv provided with the Griffin.1 library. The P.sub.tac vector was
a derivative of pIMS120 (Hayhurst, 2000).
[0165] E. Phage Panning
[0166] The Griffin.1 library is a semi-synthetic scFv library
derived from a large repertoire of human heavy and light chains
with part or all of the CDR3 loops randomly mutated and recombined
in vivo (Griffiths et al., 1994). The library represents one
potential source of candidate binding polypeptides for screening by
anchored periplasmic expression in accordance with the invention.
The library was rescued and subjected to five rounds of panning
according to the web-site instruction manual
(www.mrc-cpe.cam.ac.uk/.about.phage/g1p.html), summarized in
Example 9, below. Immunotubes were coated with 10 .mu.gml.sup.-1
digoxin-BSA conjugate and the neutralized eluates were halved and
used to infect either TG-1 for the next round of phage panning, or
ABLE.TM. C for FACS analysis.
[0167] Eluate titers were monitored to indicate enrichment of
antigen binding phage. To confirm reactivity, a polyclonal phage
ELISA of purified, titer normalized phage stocks arising from each
round was performed on digoxin-ovalbumin conjugate. The percentage
of positive clones arising in rounds 3, 4 and 5 was established by
monoclonal phage ELISA of 96 isolates after each round. A positive
was arbitrarily defined as an absorbance greater than 0.5 with a
background signal rarely above 0.01. MvaI fingerprinting was
applied to 24 positive clones from rounds 3, 4 and 5.
[0168] F. FACS Screening
[0169] For scanning with APEx expression, glycerol stocks of E.
coli carrying the APEx construct were grown and labeled as
described in section B and C. Following labeling cells were washed
once in PBS and scanned. In the aforementioned studies using bodipy
or FL labeled antigen, a 488 nm laser for excitation was used,
while with Cy5 a 633 nm laser was used. Scanning was accomplished
on a FACSCalibur (BD) using the following instrument settings:
Sidescatter trigger V 400, Threshold 250, Forward scatter E01, FL1
V 400 FL2 V 400 (488 nm ex), FL4 V 700 (633 nm ex).
[0170] Sorting with APEx expression was as follows: all sorts were
performed using a MoFlo FC (Cytomation). Previously described
libraries were grown and labeled as described in section B and C,
washed once with PBS and sorted for increased FL intensity.
Subsequent rounds of sorting were applied until polyclonal scans of
the population demonstrate enrichment. (See FIG. 4) Individual
clones were then picked and analyzed for FL activity.
[0171] For other studies, an aliquot of phagemid containing,
ABLE.TM.C glycerol stock was scraped into 1 ml of 2.times.TY (2%
glucose, 100 .mu.g/ml.sup.-1 ampicillin) to give an OD at 600 nm of
approximately 0.1 cm.sup.-1. After shaking vigorously at 37.degree.
C. for 2 h, IPTG was added to 1 mM and the culture shaken at
25.degree. C. for 4 h. 50 .mu.l of culture was labeled with 100 nM
BODIPY.TM.M-digoxigenin (Daugherty et al., 1999) in 1 ml of
5.times.PBS for 1 h at room temperature with moderate agitation.
For the last 10 min of labeling, propidium iodide was added to 2
.mu.g/ml.sup.-1. Cells were pelleted and resuspended in 100 .mu.l
of labeling mix. Scanning was performed with Becton-Dickinson
FACSort, collecting 10.sup.4 events at 1500 s.sup.-1.
[0172] For FACS library sorting, the cells were grown in terrific
broth and induced with 0.1 mMIPTG. Sorting was performed on
10.sup.6 events (10.sup.7 for round 2) in exclusion mode at 1000
s.sup.-1. Collected sort liquor was passed through 0.7 .mu.m
membrane filters and colonies allowed to grow after placing the
filter on top of SOC agar plus appropriate antibiotics at
30.degree. C. for 24 h.
[0173] E. Analysis of Phage Clones
[0174] Screening phage particles by ELISA is summarized as follows.
Binding of phage in ELISA is detected by primary sheep anti-M13
antisera (CP laboratories or 5 prime-3 prime) followed by a
horseradish peroxidase (HRP) conjugated anti-sheep antibody
(Sigma). Alternatively, a HRP-anti-M13 conjugate can be used
(Pharmacia). Plates can be blocked with 2% MPBS or 3% BSA-PBS. For
the polyclonal phage ELISA, the technique is generally as follows:
coat MicroTest III flexible assay plates (Falcon) with 100 .mu.l
per well of protein antigen. Antigen is normally coated overnight
at 4.degree. C. at a concentration of 10-100 .mu.g/ml in either PBS
or 50 mM sodium hydrogen carbonate, pH 9.6. Rinse wells 3 times
with PBS, by flipping over the ELISA plates to discard excess
liquid, and fill well with 2% MPBS or 3% BSA-PBS for 2 hr at
37.degree. C. Rinse wells 3 times with PBS. Add 10 .mu.l PEG
precipitated phage from the stored aliquot of phage from the end of
each round of selection (about 10.sup.10 tfu.). Make up to 100
.mu.l with 2% MPBS or 3% BSA-PBS. Incubate for 90 min at rt.
Discard the test solution and wash three times with PBS-0.05% Tween
20, then 3 times with PBS. Add appropriate dilution of HRP-anti-M13
or sheep anti-M13 antisera in 2% MPBS or 3% BSA-PBS. Incubate for
90 min at rt, and wash three times with PBS-0.05% Tween 20, then 3
times with PBS. If sheep anti-M13 antisera is used, incubate for 90
min at rt, with a suitable dilution of HRP-anti-sheep antisera in
2% MPBS or 3% BSA and wash three times with PBS-0.05% Tween 20,
then 3 times with PBS. Develop with substrate solution (100
.mu.g/ml TMB in 100 mM sodium acetate, pH 6.0, add 10 .mu.l of 30%
hydrogen peroxide per 50 ml of this solution directly before use).
Add 100 .mu.l to each well and leave at rt for 10 min. A blue color
should develop. Stop the reaction by adding 50 .mu.l 1 M sulfuric
acid. The color should turn yellow. Read the OD at 450 mn and at
405 nm. Subtract OD 405 from OD 450.
[0175] Monoclonal phage ELISA can be summarized as follows. To
identify monoclonal phage antibodies the pHEN phage particles need
to be rescued: Inoculate individual colonies from the plates in C10
(after each round of selection) into 100 .mu.l 2.times.TY
containing 100 .mu.g/ml ampicillin and 1% glucose in 96-well plates
(Corning `Cell Wells`) and grow with shaking (300 rpm.) overnight
at 30.degree. C. Use a 96-well transfer device to transfer a small
inoculum (about 2 .mu.l) from this plate to a second 96-well plate
containing 200 .mu.l of 2.times.TY containing 100 .mu.g/ml
ampicillin and 1% glucose per well. Grow shaking at 37.degree. C.
for 1 hr. Make glycerol stocks of the original 96-well plate, by
adding glycerol to a final concentration of 15%, and then storing
the plates at -70.degree. C. To each well (of the second plate) add
VCS-M13 or M13KO7 helper phage to an moi of 10. Stand for 30 min at
37.degree. C. Centrifuge at 1,800 g. for 10 min, then aspirate off
the supernatant. Resuspend pellet in 200 .mu.l 2.times.TY
containing 100 .mu.g/ml ampicillin and 50 .mu.g/ml kanamycin. Grow
shaking overnight at 30.degree. C. Spin at 1,800 g for 10 min and
use 100 .mu.l of the supernatant in phage ELISA as detailed
above.
[0176] Production of antibody fragments is summarized as follows:
the selected pHEN needs to be infected into HB2151 and then induced
to give soluble expression of antibody fragments for ELISA. From
each selection take 10 .mu.l of eluted phage (about 10.sup.5 t.u.)
and infect 200 .mu.l exponentially growing HB2151 bacteria for 30
min at 37.degree. C. (waterbath). Plate 1, 10, 100 .mu.l, and 1:10
dilution on TYE containing 100 .mu.g/ml ampicillin and 1% glucose.
Incubate these plates overnight at 37.degree. C. Pick individual
colonies into 100 .mu.l 2.times.TY containing 100 .mu.g/ml
ampicillin and 1% glucose in 96-well plates (Corning `Cell Wells`),
and grow with shaking (300 rpm.) overnight at 37.degree. C. A
glycerol stock can be made of this plate, once it has been used to
inoculate another plate, by adding glycerol to a final
concentration of 15% and storing at -70.degree. C. Use a 96-well
transfer device to transfer a small inocula (about 2 .mu.l) from
this plate to a second 96-well plate containing 200 .mu.l fresh
2.times.TY containing 100 .mu.g/ml ampicillin and 0.1% glucose per
well. Grow at 37.degree. C., shaking until the OD at 600 nm is
approximately 0.9 (about 3 hr). Once the required OD is reached add
25 .mu.l 2.times.TY containing 100 .mu.g/ml ampicillin and 9 mM
IPTG (final concentration 1 mM IPTG). Continue shaking at
30.degree. C. for a further 16 to 24 hr. Coat MicroTest III
flexible assay plates (Falcon) with 100 .mu.l per well of protein
antigen.
[0177] Antigen is normally coated overnight at rt at a
concentration of 10-100 .mu.g/ml in either PBS or 50 mM sodium
hydrogen carbonate, pH 9.6. The next day rinse wells 3 times with
PBS, by flipping over the ELISA plates to discard excess liquid,
and block with 200 .mu.l per well of 3% BSA-PBS for 2 hr at
37.degree. C. Spin the bacterial plate at 1,800 g for 10 min and
add 100 .mu.l of the supernatant (containing the soluble scFv) to
the ELISA plate for 1 hr at rt. Discard the test solution and wash
three times with PBS. Add 50 .mu.l purified 9E10 antibody (which
detects myc-tagged antibody fragments) at a concentration of 4
.mu.g/ml in 1% BSA-PBS and 50 .mu.l of a 1:500 dilution of
HRP-anti-mouse antibody in 1% BSA-PBS. Incubate for 60 min at rt,
and wash three times with PBS-0.05% Tween 20, then 3 times with
PBS. Develop with substrate solution (100 .mu.g/ml TMB in 100 mM
sodium acetate, pH 6.0. Add 10 .mu.l of 30% hydrogen peroxide per
50 ml of this solution directly before use). Add 100 .mu.l to each
well and leave at rt for 10 min. A blue color should develop. Stop
the reaction by adding 50 .mu.l 1 M sulphuric acid. The color
should turn yellow. Read the OD at 450 nm and at 405 nm. Subtract
OD 405 from OD 450.
[0178] Inserts in the library can be screened by PCR screening
using the primers designated LMB3: CAG GAA ACA GCT ATG AC (SEQ ID
NO:1) and Fd seq1: GAA TTT TCT GTA TGA GG (SEQ ID NO:2). For
sequencing of the VH and VL, use is recommend of the primers
FOR_LinkSeq: GCC ACC TCC GCC TGA ACC (SEQ ID NO:3) and pHEN-SEQ:
CTA TGC GGC CCC ATT CA (SEQ ID NO:4).
Example 6
Antibody Affinity Maturation
[0179] Short et. al., (1995) isolated a 26-10 mutant, designated
A4-19, having an equilibrium dissociation constant (K.sub.D) for
digoxin of 300 pM as measured by surface plasmon resonance. A4-19
contains 3 amino acid substitutions in heavy chain CDR1
(V.sub.H:T30->P, V.sub.H:D31->S and V.sub.H:M34->Y). It
was examined whether mutants with increased binding affinity can be
obtained by soluble periplasmic expression/FACS screening even when
starting with an antibody that already exhibits very tight binding.
Three light chain CDR3 residues that make contact (V.sub.L:T91,
V.sub.L:P96) or are in close proximity to (V.sub.L:V94) the digoxin
hapten (Jeffrey et al., 1993) were randomized using an NNS (S=G or
C) strategy (Daugherty et al. 1998). A library of
2.5.times.10.sup.6 transformants expressed in the periplasm via the
pe1B leader was generated and screened using two rounds of FACS. In
the first round of screening, cells labeled with 100 nM of the
fluorescent probe were washed once with PBS and sorted using
recovery mode in which the instrument collects all fluorescent
events even if a non-fluorescent particle is detected in the same
element of fluid as a fluorescent particle. Operation in recovery
mode provided a better assurance that very rare cells would be
collected but at the expense of purity.
[0180] Collected cells were re-grown, labeled, washed and then
incubated with a 50-fold excess (50 .mu.M) of free digoxin for
various times (15 min to 90 min). Cells that retained the desired
level of fluorescence were isolated by sorting using exclusion
mode, in which, coincident fluorescent and non-fluorescent events
were rejected and thus a higher degree of purity was obtained. The
rate of fluorescence decay for the pool of cells obtained following
incubation with non-fluorescent competitor for various times was
measured. A slightly faster rate compared to the starting A4-19
antibody was observed for the earlier time points (<60 minutes
incubation with competitor) but the rate was reduced for the 60 min
and 90 min populations. 5 random clones from the cell population
obtained after 60 min of competition and 13 clones from the 90 min
pool were picked at random and sequenced (Table 1). A strong
sequence consensus was clearly evident. The hapten binding kinetics
of the purified antibodies were determined by SPR and the results
are shown in Table 1. The corresponding amino acid sequences are
given by SEQ ID NOs:8-19. It should be noted that upon purification
and analysis by gel filtration FPLC none of the mutants was found
to dimerize. All of the mutants examined displayed association rate
constants (k.sub.on) indistinguishable from that of the starting
A4-19 antibody (0.9.+-.0.2.times.10.sup.6 M.sup.-1). The k.sub.diss
of the clones isolated after 60 min of competition were the same or
faster than that of A4-19. Clones isolated after 90 minutes of
competition exhibited slower k.sub.diss in solution. One clone,
90.3, exhibited a 2-fold slower dissociation rate constant
resulting in a K.sub.D of 150 pM. Thus, the library screening
methodology of the invention allowed specific labeling to isolate a
better mutant, even when starting with an antibody that already
exhibited a sub-nanomolar K.sub.D. Interestingly, but not
surprisingly, the effect of the three heavy chain CDR1 mutations
present in 4-19 and the two mutations in residues 94 and 96 of the
light chain were additive. TABLE-US-00001 TABLE 1 Heavy and light
chain CDR3 amino acid sequences (SEQ ID NOs: 8-20) of mutants
isolated by 60 min (clones 60.1-60.4 and 90 minutes (clones
90.1-90.6) off-rate selection. Light Chain Sequence 90 . . . 96
Off-rate/s Wild Type 26-10 scFv QTTHVPP 8.4 .times. 10.sup.-4 A14-9
QTTHVPP 2.7 .times. 10.sup.-4 60.1 (1 clone) QTTHSPA 5.5 .times.
10.sup.-4 60.2 (2) QTTHLPT 2.8 .times. 10.sup.-4 60.3 (1) QTTHTPP
ND 60.4 (1) QTTHLPA ND 90.1 (1) QTTHIPT 3.2 .times. 10.sup.-4 90.2
(1) QTTHVPP 2.7 .times. 10.sup.-4 90.3 (7) QTTHVPA 2.2 .times.
10.sup.-4 90.4 (1) QTTHIPA 1.4 .times. 10.sup.-4 90.5 (3) QTTHLPA
ND 90.6 (1) QTTHVPC ND Number of identical clones shown in
parenthesis. ND: Not Determined.
Example 7
Maximizing the Fluorescence Signal
[0181] The fluorescence intensity of cells. expressing scFv
antibodies in soluble form in the periplasm was strongly dependent
on the E. coli strain used and on the growth conditions. With the
26-10 antibody, the maximum fluorescence intensity was obtained
when the cells were grown at 25.degree. C. Growth at
sub-physiological temperature has several beneficial effects.
Expression of scFv at low temperature (i.e., 25.degree. C.)
facilitates the proper folding of the scFv both directly, by
slowing the folding pathway and indirectly by decreasing plasmid
copy number to reduce expression load. Indeed, direct expression of
scFv at 37.degree. C. generally yields little or no soluble protein
(for example see Gough et al., 1999). Outer membrane composition is
also altered at non-physiological temperatures resulting in
increased permeability (Martinez et al., 1999). Rather dramatic
differences among various E. coli strains were noticed. Among
several strains tested, the highest fluorescence intensities were
obtained in ABLE.TM.C. A preliminary analysis of protein expression
and outer membrane protein profile in this strain indicated that
the higher fluorescent signal was not due to the pcnB mutation
which reduces the copy number of ColE1 origin plasmids but rather,
due to differences in cell envelope protein composition. In fact,
the stronger staining of ABLE.TM.C was not related to a higher
level of protein expression relative to other strains as deduced by
ELISA and Western blotting.
[0182] Fluorescent labeling under hyperosmotic conditions, resulted
in significantly greater fluorescence. A 5-7 fold increase in
fluorescence was obtained when the cells were incubated in
5.times.PBS during labeling (a mean FL1>150 compared to 20-30
for cells incubated in regular PBS). However, the increased signal
came at a cost, as cell viability decreased considerably. Such a
decrease in viability may be undesirable when screening highly
diverse libraries of proteins, whose expression may already have a
deleterious effect on the host cell. Similarly, co-infection with
filamentous phages such as M13KO7 induces the phage shock response,
which among other things, results in an increase in outer membrane
permeability. M13 K07 infection resulted in a 3-fold increase in
the mean fluorescence of the population. However, as with
hyperosmotic shock the viability of the culture, as determined by
propidium iodide staining was somewhat decreased.
[0183] Labeling of the cells with fluorescent ligand followed by
incubation with a large excess of free ligand results in a
time-dependent decrease in the mean fluorescence intensity. The
rate of the fluorescence decay reflects the dissociation rate of
the antibody-antigen complex (Daugherty et al., 2000). For digoxin
the rate of fluorescence decay was found to be about 3-4 times
slower compared to the dissociation rate measured with the purified
antibody using BIACORE. The lower rate of fluorescence decay
compared to the dissociation rate of the antibody/antigen complex
in vitro stems from several effects including the collision
frequency between ligands and cells, the concentration of antibody
in the periplasm and, of course, the rate of diffusion through the
outer membrane (see Martinez et al., (1996) for an analysis of
kinetics in the periplasmic space). As may be expected, the ratio
of the rate of fluorescence decay in the periplasm relative to the
in vitro determined k.sub.off rate is antigen dependent.
Example 8
Fluorescence Detection and Enrichment of Cells Expressing scFv
Antibodies in Soluble Form in the Periplasm
[0184] The 26-10 scFv antibody binds with high affinity to cardiac
glycosides such as digoxin and digoxigenin (KD of the purified
antibodies for digoxin and digoxigenin are
0.9.+-.0.2.times.10.sup.-9 M.sup.-1 and 2.4.+-.0.4.times.10.sup.-9
M.sup.-1, respectively, Chen et al., 1999). The 26-10 scFv and its
variant have been used extensively as a model system to understand
the effect of mutations in the CDRs and in the framework regions on
hapten binding (Schilbach et al., 1992; Short et al., 1995;
Daugherty et al., 1998, 2000; Chen et al., 1999). A derivative of
the 26-10 scFv was expressed in soluble form under the E. coli
arabinose promoter and with the pelB leader peptide that allows
secretion in the E. coli periplasm. The resulting plasmid vector
(pBAD30pe1B-Dig) was transformed in the ara.sup.- E. coli strain
LMG194 and protein synthesis was induced with 0.2% w/v arabinose.
It was observed that upon incubation with 200 nM of
digoxigenin-BODIPY.TM., cells that had been grown at 25.degree. C.
became strongly fluorescent and the fluorescence signal was
retained even after extensive washing to remove non-specifically
bound ligand. The labeling of the cells with a probe having a M.W.
which is significantly higher than the generally accepted size
limit of about 600 Da for the permeation of hydrophilic solutes in
the periplasm (Decad and Nikaido, 1976) raised the possibility that
the fluorescence signal was mainly due to non-viable, permeabilized
cells. However, staining with the viability stain propidium iodide,
which binds specifically to membrane damaged cells by virtue of
intercalating with the normally inaccessible nucleic acids,
revealed that >90% of the cells were not permeable to the dye.
This is similar to the proportion of intact cells in control E.
coli cultures harvested in late exponential phase.
[0185] Cells expressing the 26-10 antibody in the periplasm in
soluble form could be enriched from a large excess of E. coli
transformed with vector alone in a single round of sorting.
Specifically, LMG194 (pBAD30pe1B-Dig) were mixed with a 10,000 fold
excess of E. coli containing empty vector (pBAD30). The former
cells are resistant to both ampicillin and chloramphenicol
(amp.sup.r, Cm.sup.r) whereas the latter are resistant to
ampicillin only (amp.sup.r). 4 hours after induction with 0.2% w/v
arabinose, the cells were then labeled with 100 nM
digoxigenin-BODIPY.TM. for 1 hour and fluorescent cells were
isolated by FACS. Following re-growth of the sorted cells and
re-labeling as above, the population exhibited a five to eight-fold
increase in the mean fluorescence intensity (FL1=20 vs FL1=4 for
the pre-sort cell mixture). The fraction of scFv-expressing clones
in the enriched population was estimated from the number of ampr
clones that were also Cm.sup.r. 80% of the amp.sup.r colonies were
also Cm.sup.r indicating that fluorescence labeling and cell
sorting gave an enrichment of well over 1,000-fold in a single
round
Example 9
Increased Cell Permeability at Sub-Optimum Temperature
[0186] The fluorescence intensity of cells expressing scFv
antibodies in soluble form in the periplasm was strongly dependent
on the E. coli strain used and on the growth conditions. With the
26-10 antibody, the maximum fluorescence intensity was obtained
when the cells were grown at 25.degree. C. Growth at
sub-physiological temperature has several beneficial effects.
Expression of scFv at low temperature (i.e., 25.degree. C.)
facilitates the proper folding of the scFv both directly, by
slowing the folding pathway and indirectly by decreasing plasmid
copy number to reduce expression load. Indeed, direct expression of
scFv at 37.degree. C. generally yields little or no soluble protein
(for example see Gough et al., 1999). Outer membrane composition is
also altered at non-physiological temperatures resulting in
increased permeability (Martinez et al., 1999). Rather dramatic
differences among various E. coli strains were noticed. Among
several strains tested, the highest fluorescence intensities were
obtained in ABLE.TM.C. A preliminary analysis of protein expression
and outer membrane protein profile in this strain indicated that
the higher fluorescent signal was not due to the pcnB mutation
which reduces the copy number of ColE1 origin plasmids but rather,
due to differences in cell envelope protein composition. In fact,
the stronger staining of ABLE.TM.C was not related to a higher
level of protein expression relative to other strains as deduced by
ELISA and Western blotting.
[0187] Fluorescent labeling under hyperosmotic conditions, resulted
in significantly greater fluorescence. A 5-7 fold increase in
fluorescence was obtained when the cells were incubated in
5.times.PBS during labeling (a mean FL1>150 compared to 20-30
for cells incubated in regular PBS). However, the increased signal
came at a cost, as cell viability decreased considerably. Such a
decrease in viability may be undesirable when screening highly
diverse libraries of proteins, whose expression may already have a
deleterious effect on the host cell. Similarly, co-infection with
filamentous phages such as M13KO7 induces the phage shock response,
which among other things, results in an increase in outer membrane
permeability. M13 KO7 infection resulted in a 3-fold increase in
the mean fluorescence of the population. However, as with
hyperosmotic shock the viability of the culture, as determined by
propidium iodide staining was somewhat decreased.
[0188] Labeling of the cells with fluorescent ligand followed by
incubation with a large excess of free ligand results in a
time-dependent decrease in the mean fluorescence intensity. The
rate of the fluorescence decay reflects the dissociation rate of
the antibody-antigen complex (Daugherty et al., 2000). For digoxin,
the rate of fluorescence decay was found to be about 3-4 times
slower compared to the dissociation rate measured with the purified
antibody using BIACORE. The lower rate of fluorescence decay
compared to the dissociation rate of the antibody/antigen complex
in vitro stems from several effects including the collision
frequency between ligands and cells, the concentration of antibody
in the periplasm and, of course, the rate of diffusion through the
outer membrane (see Martinez et al., 1996) for an analysis of
kinetics in the periplasmic space). As may be expected, the ratio
of the rate of fluorescence decay in the periplasm relative to the
in vitro determined k.sub.off rate is antigen dependent.
Example 10
Analysis and Screening of Repertoire Antibody Libraries by FACS
[0189] Antibodies can be isolated de novo, i.e., without animal
immunization, by screening large, repertoire libraries that contain
a wide variety of antibody sequences. The screening of such large
libraries is well established (Nissim et al. 1994, Winter et al.
1994, Griffith et al. 1994, Knappik et al. 2000). So far, all the
large antibody repertoire libraries available have been constructed
for use with phage display. However, libraries constructed for
phage display can also be used for the expression of proteins
within the bacterial periplasmic space, either anchored to the
inner membrane or in soluble form. In particular, for low protein
copy number display on filamentous bacteriophage, recombinant
polypeptides are expressed as N-terminal fusions to pIII. During
the course of phage biogenesis, pIII fusions are first targeted to
the periplasm and anchored in the inner membrane by a small
C-terminal portion of pIII. As phage are released, the scFv-pIII
fusion is incorporated alongside wild-type pIII at the terminus of
the phage, thereby concluding the assembly process (Rakonjac and
Model, 1998; Rakonjac et al., 1999). In the most widely used
vectors for phage display, an amber codon is placed between the
N-terminal scFv and the pIII gene. Thus, in a suitable E. coli
suppressor strain, full-length scFv-pIII fusion protein is produced
for displaying the scFv whereas in a non-supressor strain only
soluble scFv is expressed. Alternatively, by including an inner
membrane anchor peptide in the fusion, anchored expression can be
achieved.
[0190] The degree of suppression with phage display varies with
vector and strain but tends to allow only 10% read-through. Thus,
as a consequence of the biology of phage display, all amber-codon
containing libraries result in a degree of periplasmic expression
regardless of host. Hence, it was of great interest to explore
whether FACS can aid the isolation of ligand binding proteins from
pre-existing, highly diverse, naive libraries (Griffiths et al.,
1994; Vaughan et al., 1996; Sheets et al., 1998; Pini et al., 1998;
de Haard et al., 1999; Knappik et al., 2000; Sblattero and
Bradbury, 2000).
[0191] Conventional screening was performed of a phage library by
phage panning enriched phage expressing scFvs specific for the
cardiac glycoside digoxin from a naive antibody repertoire library.
The panning process was performed on a BSA conjugate and the
screening was performed on an ovalbumin conjugate to reduce the
incidence of protein and hapten-protein interface binders. 24
positive isolates from pan 4 shared the same fingerprint and DNA
sequencing of 6 clones confirmed the same heavy and light chain
sequence ("dig1") with one of six ("dig2") having a unique HCDR3
and LCDR3 combination. Repeated screening of the phage library both
under identical and under different conditions resulted only in the
isolation of clones with the same DNA fingerprint.
[0192] FACS analysis of the phage rescued in E. coli ABLE.TM.C
after each round of panning reveals an increase in mean
fluorescence at round 3 which mirrors the phage ELISA signals.
Significant enrichment of binding clones using a single round of
FACS was obtained starting with the population obtained from the
3.sup.rd round of phage panning. This result is consistent with the
enrichment profiles obtained during the course of the panning
experiment. FACS screening and sorting 10.sup.6 cells from rounds
3, 4 and 5 resulted in the isolation of positive clones at a
frequency of 30, 80 and 100% respectively.
[0193] Out of 14 clones isolated by FACS from the round 3
population, 5 were found to be positive for binding to digoxin.
Importantly, three of the clones corresponded to a different
antibody that was missed by phage panning (herein known as "dig3").
The remaining 2 were the dig1 clone. This result demonstrates that
FACS screening of libraries expressed in the periplasmic space and
labeled with fluorescent ligands results in the isolation of clones
that cannot be isolated by other library screening
methodologies.
Example 11
Summary of Methodology for Use of the Griffin.1 Library
[0194] Methodology for using the Griffin.1 library can be
summarized as follows. The Griffin.1 library is a scFv phagemid
library made from synthetic V-gene segments. The library was made
by recloning the heavy and light chain variable regions from the
lox library vectors (Griffiths et al., 1994) into the phagemid
vector pHEN2. A kit for use of the library will contain a tube of
the synthetic scFv Library (1 ml), a glycerol stock of the positive
control (TG1 containing an anti-thyroglobulin clone), a glycerol
stock of the negative control (TG1 containing pHEN2), a glycerol
stock of E. coli TG1 (Gibson, 1984) suppressor strain (K12,
del(lac-pro), supE, thi, hsdD5/F'traD36, proA+B+, lacIq,
lacZdelM15) for propagation of phage particles (the strain supplied
is a T-phage resistant variant of this), a glycerol stock of E.
coli HB2151 (Carter et al., 1985) and non-suppressor strain (K12,
ara, del(lac-pro), thi/F'proA+B+, lacIq, lacZdelM15) for expression
of antibody fragments. The library is kept frozen at -70.degree. C.
until needed.
[0195] The strains are plated and then are grown up as overnight
cultures (shaking at 37.degree. C.) of each in 2.times.TY
containing 100 .mu.g/ml ampicillin and 1% glucose. Cultures are
diluted 1:100 with 2.times.TY (2.times.TY is 16 g Typtone, 10 g
Yeast Extract and 5 g NaCl in 1 liter) containing 100 .mu.g/ml
ampicillin and 1% glucose and the phagemids rescued by following
the procedures described below. A 1:100 mixture is used of positive
and the negative control together for one round of selection on
immunotubes, coated with thyroglobulin.
[0196] The protocol for use of the library is summarized as
follows. Phage/phagemid infect F+-E. coli via the sex pili. For sex
pili production and efficient infection E. coli must be grown at
37.degree. C. and be in log phase (OD at 600 nm of 0.4-0.6).
Throughout the following protocol such a culture is needed. It can
be prepared as follows: transfer a bacterial colony from a minimal
media plate into 5 ml of 2.times.TY medium and grow shaking
overnight at 37.degree. C. Next day, subculture by diluting 1:100
into fresh 2.times.TY medium, grow shaking at 37.degree. C. until
OD 0.4-0.6 and then infect with phage. A variety of helper phages
are available for the rescue of phagemid libraries. VCS-M13
(Stratagene) and M13KO7 (Pharmacia) can be purchased in small
aliquots, larger quantities for rescue of phagemid libraries can be
prepared as follows: Infect 200 .mu.l E. coli TG1 (or other
suitable strain) at OD 0.2 with 10 .mu.l serial dilutions of helper
phage (in order to get well separated plaques) at 37.degree. C.
(waterbath) without shaking for 30 min. Add to 3 ml molten H-top
agar (42.degree. C.) and pour onto warm TYE (note 7) plates. Allow
to set and then incubate overnight at 37.degree. C. Pick a small
plaque into 3-4 ml of an exponentially growing culture of TG1 (see
above). Grow for about 2 hr shaking at 37.degree. C. Inoculate into
500 ml 2.times.TY in a 2 liter flask and grow as before for 1 hr
and then add kanamycin (25 .mu.g/ml in water) to a final
concentration of 50-70 .mu.g/ml. Grow for a further 8-16 hr. Spin
down bacteria at 10,800 g for 15 min. To the phage supernatant add
1/5 volume PEG/NaCl (20% polyethylene glycol 6000-2.5 M NaCl) and
incubate for a minimum of 30 min on ice. Spin 10,800 g for 15 min.
Resuspend pellet in 2 ml TE and filter sterilize the stock through
a 0.45 .mu.n filter (Minisart NML; Sartorius). Titre the stock and
then dilute to about 1.times.1012 p.f.u./ml. Store aliquots at
-20.degree. C. All spins are performed at 4.degree. C., unless
otherwise stated.
[0197] For growth of the library, the procedure is summarized as
follows: inoculate the whole of the bacterial library stock (about
1'10.sup.10 clones) into 500 ml 2.times.TY containing 100 .mu.g/ml
ampicillin and 1% glucose. Grow with shaking at 37.degree. C. until
the OD at 600 nm is 0.5, this should take about 1.5-2 hours. Infect
25 ml (1.times.1010 bacteria) from this culture with VCS-M13 or
M13KO7 helper phage by adding helper phage in the ratio of 1:20
(number of bacterial cells:helper phage particles, taking into
account that 1 OD bacteria at 600 nm =around 8.times.108
bacteria/ml).
[0198] Spin the infected cells at 3,300 g for 10 min. Resuspend the
pellet gently in 30 ml of 2.times.TY containing 100 .mu.g/ml
ampicillin and 25 .mu.g/ml kanamycin. Add 470 ml of prewarned
2.times.TY containing 100 .mu.g/ml ampicillin and 25 .mu.g/ml
kanamycin and incubate shaking at 30.degree. C. overnight. The
phage can be concentrated and any soluble antibodies removed (as in
TG1 suppression of the amber stop codon encoded at the junction of
the antibody gene and gIII is never complete) by precipitating with
Polyethylene glycol (PEG) 6000. Spin the culture from A6 at 10,800
g for 10 min (or 3,300 g for 30 min). Add 1/5 volume PEG/NaCl (20%
Polyethylene glycol 6000, 2.5 M NaCl) to the supernatant. Mix well
and leave for 1 hr or more at 4.degree. C. Spin 10,800 g for 30
min. Resuspend the pellet in 40 ml water and add 8 ml PEG/NaCl. Mix
and leave for 20 min or more at 4.degree. C. Spin at 10,800 g for
10 min or 3,300 g for 30 min and then aspirate off the supernatant.
Respin briefly and then aspirate off any remaining PEG/NaCl.
Resuspend the pellet in 5 ml PBS and spin 11,600 g for 10 min in a
microcentrifuge to remove most of the remaining bacterial debris.
Store the phage supernatant at 4.degree. C. for short term storage
or in PBS, 15% glycerol for longer term storage at -70.degree. C.
To titre the phage stock dilute 1 .mu.l phage in 1 ml PBS and use 1
.mu.l of this to infect 1 ml of TG1 at an OD600 0.4-0.6. Plate 50
.mu.l of this, 50 .mu.l of a 1:102 dilution and 50 .mu.l of a 1:104
on TYE plates containing 100 .mu.g/ml ampicillin and 1% glucose and
grow overnight at 37.degree. C. Phage stock should be
10.sup.12-10.sup.13/ml.
[0199] Selection on immunotubes is summarized as follows. Coat
Nunc-immunotube (Maxisorp Cat. No. 4-44202) overnight with 4 ml of
the required antigen. The efficiency of coating can depend on the
antigen concentration, the buffer and the temperature. Usually
10-100 .mu.g/ml antigen in PBS or 50 mM sodium hydrogen carbonate,
pH 9.6 at room temperature (rt), is used. Next day wash tube 3
times with PBS (simply pour PBS into the tube and then pour it
immediately out again). Fill tube to brim with 2% MPBS. Cover and
incubate at 37.degree. C. (or rt according to the stability of
antigen) for 2 hr to block. Wash tube 3 times with PBS. Add
10.sup.12 to 10.sup.13 cfu. phage, from A13, in 4 ml of 2% MPBS.
Incubate for 30 min at rt rotating continuously on an
under-and-over turntable and then stand for at least a further 90
min at rt. Throw away the unbound phage in the supernatant. For the
first round of selection wash tubes 10 times with PBS containing
0.1% Tween-20, then 10 times with PBS to remove the detergent. Each
washing step is performed by pouring buffer in and immediately out.
For the second and subsequent rounds of selection wash tubes 20
times with PBS containing 0.1% Tween-20, then 20 times with PBS.
Shake out the excess PBS from the tube and elute phage by adding 1
ml 100 mM triethylamine (700 .mu.l triethylamine (7.18 M) in 50 ml
water, diluted on day of use) and rotating continuously for 10 min
on an under-and-over turntable. During the incubation, tubes are
prepared with 0.5 ml 1M Tris, pH 7.4 ready to add the eluted 1 ml
phage, from 7, for quick neutralization. Phage can be stored at
4.degree. C. or used to infect TG1 as described above. After
elution add another 200 .mu.l of 1M Tris, pH 7.4 to the immunotube
to neutralize the remaining phage in the tube. Take 9.25 ml of an
exponentially growing culture of TG1 and add 0.75 ml of the eluted
phage. Also add 4 ml of the TG1 culture to the immunotube. Incubate
both cultures for 30 min at 37.degree. C. (waterbath) without
shaking to allow for infection. Pool the 10 ml and 4 ml of the
infected TG1 bacteria and take 100 .mu.l to make 4-5 100-fold
serial dilutions. Plate these dilutions on TYE containing 100
.mu.g/ml ampicillin and 1% glucose. Grow overnight at 37.degree. C.
Take the remaining infected TG1 culture and spin at 3,300 g for 10
min. Resuspend the pelleted bacteria in 1 ml of 2.times.TY and
plate on a large Nunc Bio-Assay dish (Gibco-BRL (note 8)) of TYE
containing 100 .mu.g/ml ampicillin and 1% glucose. Grow at
30.degree. C. overnight, or until colonies are visible.
[0200] For further rounds of selection, add 5-6 ml of 2.times.TY,
15% glycerol to the Bio-Assay dish of cells and loosen the cells
with a glass spreader. After inoculating 50-100 .mu.l of the
scraped bacteria to 100 ml of 2.times.TY containing 100 .mu.g/ml
ampicillin and 1% glucose, store the remaining bacteria at
-70.degree. C. Once again it is a good idea to check starting OD at
600 nm is=<0.1. Grow the bacteria with shaking at 37.degree. C.
until the OD at 600 nm is 0.5 (about 2 hr). Infect 10 ml of this
culture with VCS-M13 or M13KO7 helper phage by adding helper phage
in the ratio of 1:20 (number of bacterial cells:helper phage
particles, taking into account that 1 OD bacteria at 600 nm=around
8.times.108 bacteria/ml). Incubate without shaking in a 37.degree.
C. water bath for 30 min. Spin the infected cells at 3,300 g for 10
min. Resuspend the pellet gently in 50 ml of 2.times.TY containing
100 .mu.g/ml ampicillin and 25 .mu.g/ml kanamycin and incubate
shaking at 30.degree. C. overnight. Take 40 ml of the overnight
culture and spin at 10,800 g for 10 min or 3,300 g for 30 min. Add
1/5 volume (8 ml) PEG/NaCl (20% Polyethylene glycol 6000, 2.5 M
NaCl) to the supernatant. Mix well and leave for 1 hr or more at
4.degree. C. Spin 10,800 g for 10 min or 3,300 g for 30 min and
then aspirate off the supernatant. Respin briefly and then aspirate
off any remaining dregs of PEG/NaCl. Resuspend the pellet in 2 ml
PBS and spin 11, 600 g for 10 min in a micro centrifuge to remove
most of the remaining bacterial debris. 1 ml of this phage can be
stored at 4.degree. C. and the other 1 ml aliquot can be used for
the next round of selection. Repeat the selection for another 2-3
rounds.
[0201] Screening phage particles by ELISA is summarized as follows.
Binding of phage in ELISA is detected by primary sheep anti-M13
antisera (CP laboratories or 5 prime-3 prime) followed by a
horseradish peroxidase (HRP) conjugated anti-sheep antibody
(Sigma). Alternatively, a HRP-anti-M13 conjugate can be used
(Pharmacia). Plates can be blocked with 2% MPBS or 3% BSA-PBS. For
the polyclonal phage ELISA, the technique is generally as follows:
coat MicroTest III flexible assay plates (Falcon) with 100 .mu.l
per well of protein antigen. Antigen is normally coated overnight
at rt at a concentration of 10-100 .mu.g/ml in either PBS or 50 mM
sodium hydrogen carbonate, pH 9.6. Rinse wells 3 times with PBS, by
flipping over the ELISA plates to discard excess liquid, and block
with 200 l per well of 2% MPBS or 3% BSA-PBS for 2 hr at 37.degree.
C. Rinse wells 3 times with PBS. Add 10 .mu.l PEG precipitated
phage from the stored aliquot of phage from the end of each round
of selection (about 10.sup.10 cfu.). Make up to 100 .mu.l with 2%
MPBS or 3% BSA-PBS. Incubate for 90 min at rt. Discard the test
solution and wash three times with PBS-0.05% Tween 20, then 3 times
with PBS. Add appropriate dilution of HRP-anti-M13 or sheep
anti-M13 antisera in 2% MPBS or 3% BSA-PBS. Incubate for 90 min at
rt, and wash three times with PBS-0.05% Tween 20, then 3 times with
PBS. If sheep anti-M13 antisera is used, incubate for 90 min at rt,
with a suitable dilution of HRP-anti-sheep antisera in 2% MPBS or
3% BSA and wash three times with PBS-0.05% Tween 20, then 3 times
with PBS. Develop with substrate solution (100 .mu.g/ml TMB in 100
mM sodium acetate, pH 6.0. Add 10 .mu.l of 30% hydrogen peroxide
per 50 ml of this solution directly before use). Add 100 .mu.l to
each well and leave at rt for 10 min. A blue color should develop.
Stop the reaction by adding 50 .mu.l M sulphuric acid. The color
should turn yellow. Read the OD at 450 nm and at 405 nm. Subtract
OD 405 from OD 450.
[0202] Monoclonal phage ELISA can be summarized as follows. To
identify monoclonal phage antibodies the pHEN phage particles need
to be rescued: Inoculate individual colonies from the plates in C10
(after each round of selection) into 100 .mu.l 2.times.TY
containing 100 .mu.g/ml ampicillin and 1% glucose in 96-well plates
(Corning `Cell Wells`) and grow with shaking (300 rpm.) overnight
at 37.degree. C. Use a 96-well transfer device to transfer a small
inoculum (about 2 .mu.l) from this plate to a second 96-well plate
containing 200 .mu.l of 2.times.TY containing 100 .mu.g/ml
ampicillin and 1% glucose per well. Grow shaking at 37.degree. C.
for 1 hr. Make glycerol stocks of the original 96-well plate, by
adding glycerol to a final concentration of 15%, and then storing
the plates at -70.degree. C. To each well (of the second plate) add
25 .mu.l 2.times.TY containing 100 g/ml ampicillin, 1% glucose and
109 pfu VCS-M13 or M13KO7 helper phage. Stand for 30 min at
37.degree. C., then shake for 1 hr at 37.degree. C. Spin 1,800 g.
for 10 min, then aspirate off the supernatant. Resuspend pellet in
200 .mu.l 2.times.TY containing 100 .mu.g/ml ampicillin and 50
.mu.g/ml kanamycin. Grow shaking overnight at 30.degree. C. Spin at
1,800 g for 10 min and use 100 .mu.l of the supernatant in phage
ELISA as detailed above.
[0203] Production of soluble antibody fragments is summarized as
follows: the selected pHEN needs to be infected into HB2151 and
then induced to give soluble expression of antibody fragments for
ELISA. From each selection take 10 .mu.l of eluted phage (about 105
t.u.) and infect 200 .mu.l exponentially growing HB2151 bacteria
for 30 min at 37.degree. C. (waterbath). Plate 1, 10, 100 .mu.l,
and 1:10 dilution on TYE containing 100 .mu.g/ml ampicillin and 1%
glucose. Incubate these plates overnight at 37.degree. C. Pick
individual colonies into 100 .mu.l 2.times.TY containing 100
.mu.g/ml ampicillin and 1% glucose in 96-well plates (Corning `Cell
Wells`), and grow with shaking (300 rpm.) overnight at 37.degree.
C. A glycerol stock can be made of this plate, once it has been
used to inoculate another plate, by adding glycerol to a final
concentration of 15% and storing at -70.degree. C. Use a 96-well
transfer device to transfer a small inocula (about 2 .mu.l) from
this plate to a second 96-well plate containing 200 .mu.l fresh
2.times.TY containing 100 .mu.g/ml ampicillin and 0.1% glucose per
well. Grow at 37.degree. C., shaking until the OD at 600 nm is
approximately 0.9 (about 3 hr). Once the required OD is reached add
25 .mu.l 2.times.TY containing 100 .mu.g/ml ampicillin and 9 mM
IPTG (final concentration 1 mM IPTG). Continue shaking at
30.degree. C. for a further 16 to 24 hr. Coat MicroTest III
flexible assay plates (Falcon) with 100 l per well of protein
antigen. Antigen is normally coated overnight at rt at a
concentration of 10-100 .mu.g/ml in either PBS or 50 mM sodium
hydrogen carbonate, pH 9.6. The next day rinse wells 3 times with
PBS, by flipping over the ELISA plates to discard excess liquid,
and block with 200 .mu.l per well of 3% BSA-PBS for 2 hr at
37.degree. C. Spin the bacterial plate at 1,800 g for 10 min and
add 100 .mu.l of the supernatant (containing the soluble scFv) to
the ELISA plate for 1 hr at rt. Discard the test solution and wash
three times with PBS. Add 50 .mu.l purified 9E10 antibody (which
detects myc-tagged antibody fragments) at a concentration of 4
.mu.g/ml in 1% BSA-PBS and 50 .mu.l of a 1:500 dilution of
HRP-anti-mouse antibody in 1% BSA-PBS. Incubate for 60 min at rt,
and wash three times with PBS-0.05% Tween 20, then 3 times with
PBS. Develop with substrate solution (100 .mu.g/ml TMB in 100 mM
sodium acetate, pH 6.0. Add 10 .mu.l of 30% hydrogen peroxide per
50 ml of this solution directly before use). Add 100 .mu.l to each
well and leave at rt for 10 min. A blue color should develop. Stop
the reaction by adding 50 .mu.l 1 M sulphuric acid. The color
should turn yellow. Read the OD at 450 nm and at 405 nm. Subtract
OD 405 from OD 450.
[0204] Inserts in the library can be screened by PCR screening
using the primers designated LMB3: CAG GAA ACA GCT ATG AC (SEQ ID
NO:1) and Fd seq1: GAA TTT TCT GTA TGA GG (SEQ ID NO:2). For
sequencing of the VH and VL, use is recommend of the primers
FOR_LinkSeq: GCC ACC TCC GCC TGA ACC (SEQ ID NO:3) and pHEN-SEQ:
CTA TGC GGC CCC ATT CA (SEQ ID NO:4).
Example 12
Isolation of scFV Antibodies Specific to TNB from a Repertoire
Library
[0205] This example summarizes the screening of a repertoire
antibody library to the ligand TNB (trinitrobenzene). Library
screening was initiated by first carrying out three rounds of phage
panning of a repertoire library (Griffin--1 library) using standard
protocols (see Example 9, also described in
www.mrc-cpe.cam.ac.uk/.about.phage/g1p.html). Phage rescued from
various rounds of panning were used to infect the E. coli ABLE C.
The cells were grown to mid-exponential phase, induced for
expression of scFv antibodies in soluble form as described above
and labeled with 100 nM TNBS conjugated to the fluorescent dye Cy5.
The labeled cells were analyzed by flow cytometry using a
Cytomation MoFlo instrument equipped with a 5 mM diode laser
emitting at 633 nm. Highly fluorescent clones were isolated on
membrane filters and analyzed further. Three out of 10 clones
isolated by FACS were analyzed further and found to exhibit strong
binding to a TNBS-BSA conjugate. Sequence analysis confirmed that
one of the TNBS specific clones had also been found by phage
display. However, the two other clones isolated by soluble
periplasmic expression of the library and FACS screening did not
correspond to any of the clones isolated by phage panning.
Example 13
Detection of Oligonucleotide Probes by Antibodies Expressed in
Soluble Form in the E. coli Periplasm
[0206] This example shows that modified oligonucleotides can
diffuse through the outer membrane of bacteria. An oligonucleotide
with the sequence 5'-digoxigenin-AAAAA-fluoroscein-3' (designated
dig-5A-FL, molecular weight of 2,384 Da, SEQ ID NO:5) containing
four nuclease resistant phosphorothioate linkages between the five
A residues was synthesized and purified (RP HPLC) by Integrated DNA
Technologies, IA. The digoxigenin moiety of this oligonucleotide
can be recognized by scFv antibodies specific to digoxin
(anti-digoxin scFv). Cells expressing the anti-digoxin scFv in the
periplasm may bind 5A-F1 which in turn should render the cells
fluorescent, provided that the probe molecule can diffuise through
the outer membrane.
[0207] ABLE.TM.C cells expressing periplasmic scFv specific for
either atrazine (Hayhurst 2000) as a negative control or
digoxigenin were incubated in 5.times. strength PBS together with
either 100 nM of digoxigenin-BODIPY.TM. or 100 nM of dig-5A-FL.
Propidium iodine was also added to serve as a viability stain.
Viable cells were gated on the basis of propidium iodine exclusion
(to identify cells with an intact membrane) and side scatter.
Approximately 10,000 cells were analyzed at a rate of 1,000 events
per second. The resulting data are shown in FIG. 3. Cells
expressing an unrelated anti-atrazine antibody that does not bind
to the probe exhibited only background fluorescence. In contrast,
cells displaying the anti-digoxin scFv antibody became clearly
labeled with both the digoxigenin-BODIPY.TM. as well as with
5-A-FL. The latter probe gave a signal that was clearly higher than
that observed with the control cells. Even though 5-A-FL gave a
lower fluorescence intensity compared to the smaller and uncharged
the digoxigenin-BODIPY, the signal obtained with the former probe
was sufficient for the screening of scFv libraries by FACS.
Example 14
Flow Cytometric Discrimination of E. coli Expressing the Fusarium
solani Lipase Cutinase Using Commercial Fluorescent Substrates
[0208] This example demonstrates that commercially available
fluorescent substrates can be used to specifically label E. coli
cells displaying relevant enzymes in the periplasm. Surprisingly,
the soluble fluorescent product of these reactions is sufficiently
retained within the cell to allow for the discrimination and
selection of enzyme expressing E. coli from non-enzyme expressing
bacteria.
[0209] The gene encoding Fusarium solani lipase cutinase was
constructed by total gene synthesis and placed downstream of the
strong inducible promoter pBAD in plasmid pBAD18Cm. Protein
expression from the pBAD promoter is beneficial for the screening
of protein libraries by FACS (Daugherty et al. 1999). The resulting
plasmid encoding the cutinase gene was designated pKG3-53-1.
pKG3-53-1, and pBAD18Cm as a control, were both transformed into
DH5a. In this example, the ability to discriminate cells expressing
cutinase (DH5a(pKG3-53-1)) from control cells was determined using
two different commercially available substrates: Fluorescein
dibutyrate or LysoSensor Green DND-189 (LSG) (both from Molecular
Probes, OR). The latter is a positively charged fluorescent probe
that detects pH changes in the cell occurring due to ester
hydrolysis by the enzyme.
[0210] Cells were grown overnight with vigorous shaking at
37.degree. C. in terrific broth/chloramphenicol 50 .mu.g/ml
(TB/Cm). Subcultures were made from 100 .mu.l of overnight culture
in 10 ml of TB/Cm(50 .mu.g/ml). These subcultures were grown with
vigorous shaking at 37.degree. C. to OD.sub.600=0.6. Four ml
aliquots of the subcultures were pelleted at 3650 rpm for 20
minutes in a Beckman Allegra 6R Centrifuge. The supernatant was
removed, and the pellets were resuspended in 4 ml of M9 minimal
media containing 0.2% glucose and chloramphenicol (Cm) at 50
.mu.g/ml. Arabinose, from a 20% stock, was added to a final
concentration of 0.2%. The cultures were induced at 25.degree. C.
with vigorous shaking for 4 hours. Subsequently, 2 ml aliquots of
the induced cultures were pelleted at 8000 rpm for 10 minutes in an
Eppendorf 5415C Centrifuge, washed with fresh media and pelleted
again at 8000 rpm for 10 min. The washed pellets were resuspended
in M9 salts media without glucose to an optical density
OD.sub.600=1.0. The stock solution was diluted 1:10 and 1 ml of the
diluted cell suspension was mixed with 0.1 ml 0.1 mM Fluorescein
dibutyrate (FDB) stock solution in dimethyl sulfoxide (DMSO). The
final FDB concentration was 10 .mu.M. Reactions were allowed to
proceed at 37.degree. C. for 30 minutes. The labeled cells were
immediately analyzed on a Becton Dickinson FACSort equipped with an
Ar 488 nm laser. The fluorescence distribution of the cutinase
expressing cells and the control cells is shown in FIG. 9A.
[0211] The utility of a second probe for the discrimination between
positive (enzyme expressing) and control cells was also examined.
E. coli expressing cutinase from the pKG3-53-4 plasmid, and
negative cells (expressing the unmodified pBAD18Cm plasmid) were
grown, induced and washed as above. The pellet was washed with 1%
sucrose, pelleted again, and resuspended in fresh 1% sucrose to
OD.sub.600=1.0. This stock solution of cells was kept on ice.
[0212] For labeling, a LysoSensor Green DND-189 (LSG, Molecular
Probes) stock solution was prepared to 1 mM in DMSO. Also, a 1 M
4-Nitrophenyl Butyrate stock solution was prepared in DMSO. Cell
labeling was initiated by first diluting the cell stock solution,
adding the LSG to a final concentration of 1 .mu.M and diluting the
4-Nitrophenyl Butyrate 1:1000 to give a final concentration of 1
.mu.M. The enzymatic hydrolysis of 4-Nitrophenyl Butyrate by the
cells was allowed to proceed at 25.degree. C. for 5 minutes and the
cells were then immediately analyzed on a Becton Dickinson FACSort
as above. The fluorescence distribution of the cutinase expressing
cells and the control cells stained with the LysoSensor Green
DND-189 probe is shown in FIG. 9B.
Example 15
Use of Anchored Periplasmic Expression to Isolate Antibodies With
Over a 120-Fold Improvement in Affinity for the Bacillus anthracis
Protective Antigen
[0213] The screening of large libraries requires a physical link
between a gene, the protein it encodes, and the desired function.
Such a link can be established using a variety of in vivo display
technologies that have proven invaluable for mechanistic studies,
for biotechnological purposes and for proteomics research (Hoess,
2001; Hayhurst and Georgiou, 2001; Wittrup, 2000).
[0214] APEx is an alternative approach that allows screening by
flow cytometry (FC). FC combines high throughput with real-time,
quantitative, multi-parameter analysis of each library member. With
sorting rates on the order of more than 400 million cells per hour,
commercial FC machines can be employed to screen libraries of the
size accessible within the constraints of microbial transformation
efficiencies. Furthermore, -multi-parameter FC can provide valuable
information regarding the function of each and every clone in the
library in real time, thus helping to guide the library
construction process and optimize sorting conditions (Boder and
Wittrup, 2000; Daugherty et al., 2000).
[0215] Bacterial and yeast protein display in combination with FC
has been employed for the engineering of high affinity antibodies
to a variety of ligands (Daugherty et al., 1999; Boder et aL,
2000). However, the requirement for the display of proteins on cell
surfaces imposes a number of biological constraints that can impact
library screening applications. Processes such as the unfolded
protein response in eucaryotes or the stringency of protein sorting
to the outer membrane of Gram-negative bacteria limit the diversity
of the polypeptides that are actually compatible with surface
display (Sagt et al., 2002; Sathopoulos et al., 1996). In addition,
microbial surfaces are chemically complex structures whose
macromolecular composition can interfere with protein:ligand
recognition. This problem is particularly manifest in Gram-negative
bacteria because the presence of lipopolysaccharides on the outer
membrane presents a steric barrier to protein:ligand recognition, a
fact that likely contributed to the evolution of specialized
appendages, such as pili or fimbriae (Hultgren et al., 1996).
[0216] APEx overcomes the biological constraints and antigen access
limitations of previous display strategies, enabling the efficient
isolation of antibodies to virtually any size antigen. In APEx,
proteins are tethered to the external (periplasmic) side of the E.
coli cytoplasmic membrane as either N- or C-terminal fusions, thus
eliminating biological constraints associated with the display of
proteins on the cell surface. Following chemical/enzymatic
permeabilization of the bacterial outer membrane, E. coli cells
expressing anchored scFv antibodies can be specifically labeled
with fluorescent antigens, of at least 240 kDa, and analyzed by FC.
By using APEx the inventors have demonstrated the efficient
isolation of antibodies with markedly improved ligand affinities,
including an antibody fragment to the protective antigen of
Bacillus anthracis with an affinity that was increased over
120-fold.
[0217] A. Anchored Periplasmic Expression and Detection of Ligand
Binding
[0218] For screening applications, an ideal expression system
should minimize cell toxicity or growth abnormalities that can
arise from the synthesis of heterologous polypeptides (Daugherty et
al., 2000). Use of APEx avoids the complications that are
associated with transmembrane protein fusions (Miroux and Walker,
1996; Mingarro et al., 1997). Unlike membrane proteins, bacterial
lipoproteins are not known to require the SRP or YidC pathways for
membrane anchoring (Samuelson et al., 2000). Lipoproteins are
secreted across the membrane via the Sec pathway and once in the
periplasm, a diacylglyceride group is attached through a thioether
bond to a cysteine residue on the C-terminal side of the signal
sequence. The signal peptide is then cleaved by signal peptidase
II, the protein is fatty acylated at the modified cysteine residue,
and finally the lipophilic fatty acid inserts into the membrane,
thereby anchoring the protein (Pugsley, 1993; Seydel et al., 1999;
Yajushi et al., 2000).
[0219] A sequence encoding the leader peptide and first six amino
acids of the mature NlpA (containing the putative fatty acylation
and inner membrane targeting sites) was employed for anchoring scFv
antibodies to the periplasmic face of the inner membrane. NlpA is a
non-essential E. coli lipoprotein that exclusively localizes to the
inner membrane (Yu et al., 1986; Yamaguchi et al., 1988). Of
particular note is the aspartate residue adjacent to the fatty
acylated cysteine residue that is thought to be a consensus residue
for inner membrane targeting (Yamaguchi et aL, 1988). NlpA fusions
to the 26-10 anti-digoxin/digoxigenin (Dig) scFv and to the anti-B.
anthracis protective antigen (PA) 14B7 scFv were constructed and
expressed from a lac promoter in E. coli. Following induction of
the NlpA-[scFv] synthesis using IPTG, the cells were incubated with
EDTA and lysozyme to disrupt the outer membrane and the cell wall.
The permeabilized cells were mixed with the respective antigens
conjugated to the fluorescent dye BODIPY.TM. (200 nM) and the cell
fluorescence was determined by flow cytometry. Treated cells
expressing the NlpA-[14B7 scFv] and the NlpA-[Dig scFv] exhibited
an approximate 9-fold and 16-fold higher mean fluorescence
intensity, respectively, compared to controls (FIG. 7A). Only
background fluorescence was detected when the cells were mixed with
unrelated fluorescent antigen, indicating negligible background
binding under the conditions of the study.
[0220] To further evaluate the ability of antibody fragments
anchored on the cytoplasmic membrane to bind bulky antigens, the
inventors examined the ability of the NlpA-[Dig scFv] to recognize
digoxigenin conjugated to the 240 kDa fluorescent protein
phycoerythrin (PE). The conjugate was mixed with cells expressing
NlpA-[Dig scFv] and treated with EDTA-lysozyme. A high cell
fluorescence was observed indicating binding of digoxigenin-PE
conjugate by the membrane anchored antibody (FIG. 7B). Overall, the
accumulated data demonstrated that in cells treated with
Tris-EDTA-lysozyme, scFvs anchored on the cytoplasmic membrane can
readily bind to ligands ranging from small molecules to proteins of
at least up to 240 kDa in molecular weight. Importantly, labeling
with digoxigenin-PE followed by one round of flow cytometry
resulted in an over 500-fold enrichment of bacteria expressing
NlpA-[Dig scFv] from cells expressing a similar fusion with a scFv
having unrelated antigen specificity.
[0221] B. Library Screening by APEx
[0222] A library of 1.times.10.sup.7 members was constructed by
error-prone PCR of the gene for the anti-PA 14B7 scFv and was fused
to the NlpA membrane anchoring sequence. DNA sequencing of 12
library clones selected at random revealed an average of 2%
nucleotide substitutions per gene. Following induction of
NlpA-[14B7 mutant scFv] synthesis with IPTG, the cells were treated
with Tris-EDTA-lysozyme, washed, and labeled with 200 nM
PA-BODIPY.TM.. Inner membrane integrity was monitored by staining
with propidium iodide (PI). A total of 2.times.10.sup.8 bacteria
were sorted using an ultra-high throughput Cytomation Inc. MoFlo
droplet deflection flow cytometer selectively gating for low PI
fluorescence (630 mn emission) and high BODIPY.TM. fluorescence.
Approximately 5% of the cells sorted with the highest 530 nm
fluorescence (FL1) were collected, immediately restained with PI
alone and resorted as above. Since no antigen was added during this
second sorting cycle, only cells expressing antibodies that have
slow dissociation kinetics remain fluorescent. The plating
efficiency of this population was low, presumably due to a
combination of potential scFv toxicity (Somerville et al., 1994;
Hayhurst and Harris, 1999), Tris-EDTA-lysozyme treatment and
exposure to the high shear flow cytometry environment. Therefore,
to avoid loss of potentially high affinity clones, DNA encoding
scFvs was rescued by PCR.TM. amplification of the approximately
1.times.10.sup.4 fluorescent events recovered by sorting. It should
be noted that the conditions used for PCR.TM. amplification result
in the quantitative release of cellular DNA from the cells which
have partially hydrolyzed cell walls due to the Tris-EDTA-lysozyme
treatment during labeling. Following 30 rounds of PCR.TM.
amplification, the DNA was ligated into pAPEx1 and transformed into
fresh E. coli. A second round of sorting was performed exactly as
above, except that in this case only the most fluorescent 2% of the
population was collected and then immediately resorted to yield
approximately 5,000 fluorescent events.
[0223] The scFv DNA from the second round was amplified by PCR.TM.
and ligated into pMoPac16 (Hayhurst et al., 2003) for expression of
the antibody fragments in soluble form in the scAb format. A scAb
antibody fragment is comprised of an scFv in which the light chain
is fused to a human kappa constant region. This antibody fragment
format exhibits better periplasmic solubility compared to scFvs
(Maynard et al., 2002; Hayhurst, 2000). 20 clones in the scAb
format were picked at random and grown in liquid cultures.
Following induction with IPTG, periplasmic proteins were isolated
and the scAb proteins were rank-ordered with respect to their
relative antigen dissociation kinetics, using surface plasmon
resonance (SPR) analysis. 11 of the 20 clones exhibited slower
antigen dissociation kinetics compared to the 14B7 parental
antibody. The 3 scAbs with the slowest antigen dissociation
kinetics were produced in large scale and purified by Ni
chromatography followed by gel filtration FPLC. Interestingly, all
the library-selected clones exhibited excellent expression
characteristics and resulted in yields of between 4-8 mg of
purified protein per L in shake flask culture. Detailed BIACore
analysis indicated that all 3 clones exhibit a substantially lower
K.sub.D for PA compared to the parental 14B7 antibody (FIG. 8A and
8B). The improved K.sub.D resulted primarily from slower antigen
dissociation, (i.e. slower k.sub.off). The highest affinity clone,
M18, exhibited K.sub.D of 35 pM, with a k.sub.off of
4.2.times.10.sup.-5 M.sup.-1 sec.sup.-1 which corresponds to a
M18-PA half life of 6.6 hours. This represents over 120-fold
affinity improvement compared to the parental antibody 14B7
(K.sub.D=4.3 nM as determined by BIACore 3000). The mutations
identified are given in FIG. 8B and a schematic showing the
conformation of the 1H, M5, M6 and M18 antibodies is given in FIG.
10. The mutations for M5 were as follows: in the light chain, Q38R,
Q55L, S56P, T74A, Q78L and in the heavy chain, K62R. For M6, the
mutations were as follows: S22G, L33S, Q55L, S56P, Q78L AND L94 P,
and in the heavy chain, S7P, K19R, S30N, T68I and M80L. For M18,
the mutations were as follows: in the light chain, I21V, L46F,
S56P, S76N, Q78L and L94P, and in the heavy chain, S30N, T57S, K64E
and T68. FIG. 11 shows an alignment of 14B7 scFv (SEQ ID NO:21) and
M18 scFv (SEQ ID NO:23) sequences indicating the variable heavy and
variable light chains and mutations made. The nucleic acids
encoding these sequences are given in SEQ ID NO:20 and SEQ ID
NO:22, respectively.
[0224] The fluorescence intensity of Tris-EDTA-lysozyme
permeabilized cells expressing NlpA fusions to the mutant
antibodies varied in proportion to the antigen binding affinity.
(FIG. 8C) For example, cells expressing the NlpA-[M18 scFv] protein
displayed a mean fluorescence of 250 whereas the cells that
expressed the parental 14B7 scFv exhibited a mean fluorescence of
30, compared to a background fluorescence of around 5 (FIG. 8B).
Antibodies with intermediate affinities displayed intermediate
fluorescence intensities in line with their relative affinity rank.
The ability to resolve cells expressing antibodies exhibiting
dissociation constants as low as 35 pM provides a reasonable
explanation for why three unique very high affinity variants could
be isolated and is indicative of the fine resolution that can be
obtained with flow cytometric analysis.
[0225] The 3 clones analyzed in detail, M5, M6 and M18, contained
7, 12, and 11 amino acid substitutions, respectively. In earlier
studies using phage display (Maynard et al., 2002), the inventors
isolated a variant of the 14B7 scfv by three cycles, each
consisting of 1) mutagenic error prone PCR.TM., 2) five rounds of
phage panning and 3) DNA shuffling of the post-panning clones. The
best clone isolated in that study, 1H, contained Q55L and S56P
substitutions and exhibited a K.sub.D of 150 pM (as determined by a
BIACore3000). These two mutations likely increase the
hydrophobicity of the binding pocket adding to the mounting
evidence that an increase in hydrophobic interactions is a dominant
effect in antibody affinity maturation (Li et al., 2003). The same
amino acid substitutions are also found in the M5 and M6 clones
isolated by APEx. However, the presence of the additional mutations
in these two clones conferred a further increase in affinity. It is
noteworthy that the M5, M6 and M18 were isolated following a single
round of asexual PCR.TM. yet they all had higher affinity relative
to the best antibody that could be isolated by phage display, even
following multiple rounds of sexual mutagenesis and selection.
[0226] M18, the highest affinity clone isolated by APEx, contained
the S56P mutation but lacked the Q55L substitution found in 1H, M5,
and M6. When the Q55L substitution was introduced into M18 by site
specific mutagenesis, the resultant ScAb exhibited a further
improvement in antigen binding (K.sub.D=21 pM) with a k.sub.on of
1.1.times.10.sup.6 M.sup.-1 sec.sup.-1 and a k.sub.off of
2.4.times.10.sup.-5 sec.sup.-1, corresponding to a complex half
life of 11.6 hours. However, the introduction of this mutation
reduced the yield of purified protein more than 5-fold to 1.2 mg/L
in shake flask culture. The modified M18 sequence is given in SEQ
ID NO:25 and the nucleic acid encoding this sequence is given in
SEQ ID NO:24.
[0227] C. APEx of Phage Displayed scFv Antibodies
[0228] Numerous antibody fragments to important therapeutic and
diagnostic targets have been isolated from repertoire libraries
screened by phage display. It is desirable to develop a means for
rapid antigen binding analysis and affinity maturation of such
antibodies without the need for time consuming subcloning steps.
Antibodies are most commonly displayed on filamentous phage via
fusion to the N-tenninus of the phage gene 3 minor coat protein
(g3p) (Barbas et aL, 1991). During phage morphogenesis, g3p becomes
transiently attached to the inner membrane via its extreme
C-terminus, before it can be incorporated onto the growing virion
(Boeke and Model, 1982). The antibody fragments are thus both
anchored and displayed in the periplasmic compartment. Therefore,
the inventors evaluated whether g3p fusion proteins can be
exploited for antibody library screening purposes using the APEx
format. The high affinity anti-PA M18 scFv discussed above, the
anti-digoxin/digoxigenin 26-10 scFv, and an anti-methamphetamine
scFv (Meth) were cloned in frame to the N-terminus of g3p
downstream from a lac promoter in phagemid pAK200, which is widely
used for phage display purposes and utilizes a short variant of
gene III for g3p display (Krebber et al., 1997). Following
induction with IPTG, cells expressing scFv-g3p fusions were
permeabilized by Tris-EDTA-lysozyme and labeled with the respective
fluorescent antigens (FIG. 9). High fluorescence was obtained for
all three scFvs only when incubated with their respective antigens.
Significantly, the mean fluorescence intensity of the scFvs fused
to the N-terminus of g3p was comparable to that obtained by fusion
to the C-terminus of the NlpA anchor. The results in FIG. 9
demonstrate that: (i) large soluble domains can be tethered
N-terminally to a membrane anchor; (ii) antibody fragments cloned
into phagemids for display on filamentous phage can be readily
analyzed by flow cytometry using the APEx format, and (iii) scFv
antibodies can be anchored on the cytoplasmic membrane either as N-
or C-terminal fusions without loss of antigen binding.
[0229] D. Discussion
[0230] The inventors have developed a allowing efficient selection
of high affinity ligand-binding proteins, and particularly scFv
antibodies, from combinatorial libraries. In one aspect, APEx is
based on the anchoring of proteins to the outer side of the inner
membrane, followed by disruption of the outer membrane prior to
incubation with fluorescently labeled antigen and FC sorting. This
strategy offers several advantages over previous bacterial
periplasmic and surface display approaches: 1) by utilizing a fatty
acylated anchor to retain the protein in the inner membrane, a
fusion as short as 6 amino acids is all that was required for the
successful display, potentially decreasing deleterious effects that
larger fusions may impose; 2) the inner membrane lacks molecules
such as LPS or other complex carbohydrates that can sterically
interfere with large antigen binding to displayed antibody
fragments; 3) the fusion must only traverse one membrane before it
is displayed; 4) both N- and C-terminal fusion strategies can be
employed; and 5) APEx can be used directly for proteins expressed
from popular phage display vectors. This latter point is
particularly important because it enables hybrid library screening
strategies, in which clones from a phage panning experiment can be
quantitatively analyzed or sorted further by flow cytometry without
the need for any subcloning steps.
[0231] APEx can be employed for the detection of antigens ranging
from small molecules (e.g. digoxigenin and methamphetamine <1
kDa) to phycoerythrin conjugates (240 kDa). In fact, the
phycoerythrin conjugate employed in FIG. 3B is not meant to define
an upper limit for antigen detection, as it is contemplated that
larger proteins may be used as well.
[0232] In the example, genes encoding scFvs that bind the
fluorescently labeled antigen, were rescued from the sorted cells
by PCR.TM.. An advantage of this approach is that it enables the
isolation of clones that are no longer viable due to the
combination of potential scFv toxicity, Tris-EDTA-lysozyme
disruption, and FC shear forces. In this way, diversity of isolated
clones is maximized. Yet another advantage of PCR.TM. rescue is
that the amplification of DNA from pooled cells can be carried out
under mutagenic conditions prior to subcloning. Thus, following
each round of selection random mutations can be introduced into the
isolated genes, simplifying further rounds of directed evolution
(Hanes and Pluckthun, 1997). Further, PCR.TM. conditions that favor
template switching among the protein encoding genes in the pool may
be employed during the amplification step to allow recombination
among the selected clones. It is likely that PCR.TM. rescue would
be advantageous in other library screening formats as well.
[0233] An important issue with any library screening technology is
the ability to express isolated clones at a high level. Existing
display formats involve fusion to large anchoring sequences which
can influence the expression characteristics of the displayed
proteins. For this reason, scFvs that display well may not
necessarily be amenable to high expression in soluble form as
non-fusion proteins (Hayhurst et al., 2003). In contrast, the short
(6 amino acid) tail that may be used for N-terminal tethering of
proteins onto the cytoplasmic membrane in the current invention is
unlikely to affect the expression characteristics of the fusion.
Consistent with this hypothesis, all three affinity enhanced clones
to the anthrax PA toxin isolated by APEx exhibited excellent
soluble expression characteristics despite having numerous amino
acid substitutions. Similarly, well-expressing clones have been
obtained in the affinity maturation of a methamphetamine antibody,
suggesting that the isolation of clones that can readily be
produced in soluble form in bacteria at a large scale might be an
intrinsic feature of selections with the invention.
[0234] In this example, the inventors employed APEx for affinity
maturation purposes and have engineered scFvs to the B. anthracis
protective antigen exhibiting K.sub.D values as low as 21 pM. The
scFv binding site exhibiting the highest affinity for PA has been
humanized, converted to full length IgG and its neutralizing
potential to anthrax intoxication is being evaluated in preclinical
studies. In addition to affinity maturation, APEx can be exploited
for several other protein engineering applications including the
analysis of membrane protein topology, whereby a scFv antibody
anchored in a periplasmic loop is able to bind fluorescent antigen
and serves as a fluorescent reporter, and also, the selection of
enzyme variants with enhanced function. Notably, APEx can be
readily adapted to enzyme library sorting, as the cell envelope
provides sites for retention of enzymatic catalytic products,
thereby enabling selection based directly on catalytic turnover
(Olsen et al., 2000). The inventors are also evaluating the
utilization of APEx for the screening of ligands to membrane
proteins. In conclusion, it has been demonstrated that anchored
periplasmic expression has the potential to facilitate
combinatorial library screening and other protein engineering
applications.
[0235] E. Materials and Methods
[0236] 1. Recombinant DNA Techniques
[0237] The leader peptide and first six amino acids of the mature
NlpA protein flanked by NdeI and SfiI sites was amplified by whole
cell PCR of XL1-Blue (Stratagene, CA) using primers BRH#08
5'-GAAGGAGATATACATATGAAACTGACAACACATCATCTA-3' (SEQ ID NO:6) and
BRH#09 5'-CTGGGCCATGGCCGGCTGGGCCTCGCTGCTACTCTGGTCGCAACC-3' (SEQ ID
NO:7). The resulting NlpA fragment was used to replace the pe1B
leader sequence of pMoPac1 (Hayhurst et al., 2003) via NdeI and
SfiI to generate pAPEx1. scFv specific for digoxin (Chen et al.,
1999), Bacillus anthracis protective antigen PA (Maynard et al.,
2002) and methamphetamine were inserted downstream of the NlpA
fragment in pAPEx1 via the non-compatible Sfi1 sites. Corresponding
g3p fusions of the scFv were made by cloning the same genes into
phage display vector pAK200 (Krebber et aL, 1997).
[0238] 2. Growth Conditions
[0239] E. coli ABLE C.TM. (Stratagene) was the host strain used
throughout. E. coli transformed with the pAPEx1 or pAK200
derivatives were inoculated in terrific broth (TB) supplemented
with 2% glucose and chloramphenicol at 30 ug/ml to an OD600 of 0.1.
Cell growth and induction were performed as described previously
(Chen et al., 2001). Following induction, the cellular outer
membrane was permeabilized as described (Neu and Heppel, 1965).
Briefly, cells (equivalent to approx 1 ml of 20 OD600) were
pelleted and resuspended in 350 .mu.l of ice-cold solution of 0.75M
sucrose, 0.1M Tris-HCl pH8.0, 100 .mu.g/ml hen egg lysozyme. 700
.mu.l of ice-cold 1 mM EDTA was gently added and the suspension
left on ice for 10 min. 50 .mu.l of 0.5M MgCl.sub.2 was added and
the mix left on ice for a further 10 min. The resulting cells were
gently pelleted and resuspended in phosphate buffered saline
(1.times.PBS) with 200 nM probe at room temperature for 45 min,
before evaluation by FC.
[0240] 3. Fluorescent Probe
[0241] The synthesis of digoxigenin-BODIPY has been described
previously (Daugherty et al., 1999). Methamphetamine-fluorescein
conjugate was a gift from Roche Diagnostics. Purified PA protein
kindly provided by S. Leppla NIH, was conjugated to BODIPY.TM. at a
1 to 7 molar ratio with bodipy FL SE D-2184 according to the
manufacturers instructions. Unconjugated BODIPY.TM. was removed by
dialysis.
[0242] To synthesize digoxigenin-phycoerythrin, R-phycoerythrin and
3-amino-3-dioxydigxigenin hemisuccinamide, succinimidyl ester
(Molecular Probes) were conjugated at a 1 to 5 molar ratio
according to the manufacturers instructions. Free digoxigenin was
removed by dialysis in excess PBS.
[0243] 4. Affinity Maturation of scFv Libraries with FC
[0244] Libraries were made from the 14B7 parental scFv using error
prone PCR using standard techniques (Fromant et al., 1995) and
cloned into the pAPEx1 expression vector. Upon transformation,
induction and labeling the cells were then stained with propidium
iodide (PI emission 617 nm) to monitor inner membrane integrity.
Cells were analyzed on a MoFlo (Cytomation) droplet deflection flow
cytometer using 488 nm Argon laser for excitation. Cells were
selected based on improved fluorescence in the Fluorescein/Bodipy
FL emission spectrum detecting through a 530/40 band pass filter
and for the absence of labeling in PI emission detecting through a
630/40 band pass filter.
[0245] E. coli captured after the first sort were immediately
resorted through the flow cytometer. Subsequently, the scFv genes
in the sorted cell suspension were amplified by PCR.TM.. Once
amplified, the mutant scFv genes were then recloned into pAPEx1
vector, retransformed into cells and then grown overnight on agar
plates at 30.degree. C. The resulting clones were subjected to a
second round of sorting plus resorting as above, before scFv genes
were subcloned into pMoPac16 (Hayhurst et aL, 2003) for expression
of scAb protein.
[0246] 5. Surface Plasmon Resonance Analysis
[0247] Monomeric scAb proteins were purified by IMAC/size-exclusion
FPLC as described previously (Hayhurst et al., 2003). Affinity
measurements were obtained via SPR using a BIACore3000 instrument.
Approximately 500RUs of PA was coupled to a CM5 chip using EDC/NHS
chemistry. BSA was similarly coupled and used for in line
subtraction. Kinetic analysis was performed at 25.degree. C. in BIA
HBS-EP buffer at a flow rate 100 .mu.l/min. Five two fold dilutions
of each antibody beginning at 20 nM were analyzed in
triplicate.
[0248] All of the methods disclosed and claimed herein can be made
and executed without undue experimentation in light of the present
disclosure. While the compositions and methods of this invention
have been described in terms of preferred embodiments, it will be
apparent to those of skill in the art that variations may be
applied to the methods and in the steps or in the sequence of steps
of the method described herein without departing from the concept,
spirit and scope of the invention. More specifically, it will be
apparent that certain agents which are both chemically and
physiologically related may be substituted for the agents described
herein while the same or similar results would be achieved. All
such similar substitutes and modifications apparent to those
skilled in the art are deemed to be within the spirit, scope and
concept of the invention as defined by the appended claims.
REFERENCES
[0249] The following references, to the extent that they provide
exemplary procedural or other details supplementary to those set
forth herein, are specifically incorporated herein by reference.
[0250] Abbondanzo et al., Am J Pediatr Hematol Oncol, 12(4):480-9,
1990. [0251] Almendro et al., J Immunol. 157:5411, 1996. [0252]
Angel et al., Cell, 49:729, 1987b. [0253] Angel et al., Mol. Cell.
Biol., 7:2256, 1987a. [0254] Atchison and Perry, Cell, 46:253,
1986. [0255] Atchison and Perry, Cell, 48:121, 1987. [0256]
Atherton et al., Biol. of Reproduction, 32:155, 1985. [0257]
Banerji et al., Cell, 27:299, 1981. [0258] Banerji et al., Cell,
35:729, 1983. [0259] Barbas et al., Proc. Natl. Acad. Sci. USA,
88:7978-7982, 1991. [0260] Bellus, J. Macromol. Sci. Pure Appl.
Chem., RS3241(1):1355-1376, 1994. [0261] Berberian et al., Science,
261:1588-1591, 1993. [0262] Berkhout et al., Cell, 59:273, 1989.
[0263] Berrier et al., J. Bacteriol., 182:248, 2000. [0264] Blanar
et al., EMBO J., 8:1139, 1989. [0265] Boder and Wittrup, Methods
Enzymol., 328:430-444, 2000. [0266] Boder et al., Proc. Natl. Acad.
Sci. USA, 97:10701-10705, 2000. [0267] Bodine and Ley, EMBO J.,
6:2997, 1987. [0268] Boeke and Model, Proc. NatL. Acad. Sci. USA,
79:5200-5204, 1982. [0269] Boeke et al., Mol. Gen. Genet., 186:
1982. [0270] Boshart et al., Cell, 41:521, 1985. [0271] Bosze et
al, EMBO J., 5:1615, 1986. [0272] Braddock et al., Cell, 58:269,
1989. [0273] Bukau et al., J. Bacteriol., 163:61, 1985. [0274]
Bulla and Siddiqui, J. Virol., 62:1437, 1986. [0275] Burioni et
al., Res. Virol., 149:327, 1998. [0276] Burman et al., J.
Bacteriol., 112:1364, 1972. [0277] Campbell and Villarreal, Mol.
Cell. Biol., 8:1993, 1988. [0278] Campere and Tilghman, Genes and
Dev., 3:537, 1989. [0279] Campo et al., Nature, 303:77, 1983.
[0280] Carter et al., Nucleic Acids Res 13:4431, 1985. [0281]
Celander and Haseltine, J. Virology, 61:269, 1987. [0282] Celander
et al., J. Virology, 62:1314, 1988. [0283] Chandler et al., Cell,
33:489, 1983. [0284] Chang et al., Mol. Cell. Biol., 9:2153, 1989.
[0285] Chatterjee et al., Proc. Nat'l Acad. Sci. USA., 86:9114,
1989. [0286] Chen et al., J. Mol. Biol., 293:865, 1999. [0287] Chen
et al., Nat. Biotechnol., 19:537-542, 2001. [0288] Chen et al.,
Protein Eng., 12:349-356, 1999. [0289] Choi et al., Cell, 53:519,
1988. [0290] Chowdhury and Pastan, Nat. Biotech., 17:568, 1999.
[0291] Cleary et al., Trends Microbiol., 4:131-136, 1994. [0292]
Coffin, In: Virology, ed., New York: Raven Press, pp. 1437-1500,
1990. [0293] Cohen et al., Proc. Nat'l Acad. Sci. USA 75:472, 1987.
[0294] Coia et al., Gene 201:203, 1997. [0295] Corey etal., Gene,
128:129, 1993. [0296] Costa et al., Mol. Cell. Biol., 8:81, 1988.
[0297] Cripe et al., EMBO J., 6:3745, 1987. [0298] Culotta and
Hamer, MoL Cell. Biol., 9:1376, 1989. [0299] Dall'Acqua and Carter,
Curr. Opin. Struct. Biol., 8:443, 1998. [0300] Dandolo et al., J.
Virology, 47:55, 1983. [0301] Daugherty et al., J. Immunol.
Methods. 243:211, 2000. [0302] Daugherty et al., Proc. Natl. Acad.
Sci. USA, 97:2029-2034, 2000. [0303] Daughertyetal., Prot. Eng.,
11:825, 1998. [0304] Daugherty et al., Protein Eng., 12:613-621,
1999. [0305] De Haard etal., J. Biol. Chem., 274:18218, 1999.
[0306] De Jager R et al., Semin Nucl Med 23:165, 1993. [0307] De
Villiers et al., Nature, 312:242, 1984. [0308] De Wildt et al.,
Nat. Biotechnol. 18:, 989, 2000. [0309] Decad and Nikaido, J.
Bacteriol., 128:325, 1976. [0310] Deng etal., J. Biol. Chem.,
269:9533, 1994. [0311] Deng et al., Proc. Natl. Acad. Sci. USA.
92:4992, 1995. [0312] Deschamps et al., Science, 230:1174, 1985.
[0313] Dholakia et al., J. Biol. Chem., 264, 20638-20642, 1989.
[0314] Doolittle MH and Ben-Zeev O, Methods Mol Biol., 109:215,
1999. [0315] Duenas and Borrebaeck, Biotechnology, 12:999, 1994.
[0316] Edbrooke et al., Mol. Cell. Biol., 9:1908, 1989. [0317]
Edlund et al., Science, 230:912, 1985. [0318] Farmer et al., FEMS
Microbiol. Lett., 176:11, 1999. [0319] Feldhaus et al., Nat
Biotechnol., 21:163-170, 2003. [0320] Feng and Holland, Nature,
334:6178, 1988. [0321] Firak and Subramanian, Mol. Cell. Biol.,
6:3667, 1986. [0322] Frohman, In: PCR PROTOCOLS: A GUIDE TO METHODS
AND APPLICATIONS, Academic Press, N.Y., 1990. [0323] Fromant et
al., Anal. Biochem., 224:347-353, 1995. [0324] Fujita et al., Cell,
49:357, 1987. [0325] Gennity and Inouye J. Bacteriol 174(7):2095,
1992 [0326] Georgiou et al, Nat. Biotechnol. 15:29, 1997. [0327]
Georgiou, Adv. Protein Chem., 55:293-315, 2000. [0328] Gilles et
al., Cell, 33:717, 1983. [0329] Gloss et al, EMBO J., 6:3735, 1987.
[0330] Godbout et al., Mol. Cell. Biol., 8:1169, 1988. [0331]
Goodbourn and Maniatis, Proc. Nat'l Acad. Sci. USA, 85:1447, 1988.
[0332] Goodboum et al., Cell, 45:601, 1986. [0333] Gough et al., J.
Immunol. Met., 228:97, 1999. [0334] Greene et al., Immunology
Today, 10:272, 1989. [0335] Griep et al., Prot. Exp. Purif., 16:63,
1999. [0336] Griffiths et al., EMBO J., 13: 3245, 1994. [0337]
Grosschedl and Baltimore, Cell, 41:885, 1985. [0338] Gulbis and
Galand, Hum Pathol 24:1271, 1993. [0339] Hanes and Pluckthun, Proc.
Natl. Acad. Sci. USA, 94:4937-4942, 1997. [0340] Haslinger and
Karin, Proc. Nat'l Acad. Sci. USA., 82:8572, 1985. [0341] Hauber
and Cullen, J. Virology, 62:673, 1988. [0342] Hawkins et al., J.
Mol. Biol., 226:889, 1992. [0343] Hayhurst and Georgiou, Curr.
Opin. Chem. Biol., 5:683-689, 2001. [0344] Hayhurst and Harris,
Protein Expr. Purif., 15:336-343, 1999. [0345] Hayhurst et al., J.
Immunol. Methods, 276:185-196, 2003. [0346] Hayhurst, Protein Expr.
Purif., 18:1-10, 2000. [0347] Hearing et al., J. Virol.,
67:2555-2558, 1987. [0348] Hen etal., Nature, 321:249, 1986. [0349]
Hensel et al., Lymphokine Res., 8:347, 1989. [0350] Herr and
Clarke, Cell, 45:461, 1986. [0351] Hirochika et al., J. Virol.,
61:2599, 1987. [0352] Hirsch et al., Mol Cell. Biol., 10:1959,
1990. [0353] Hobot et al., J. Bacteriol. 160:143, 1984. [0354]
Hoess, Chem. Rev., 101:3205-3218, 2001. [0355] Holbrook et al.,
Virology, 157:211, 1987. [0356] Hoogenboom et al., Adv. Drug.
Deliv. Rev., 31:5, 1998. [0357] Horlick and Benfield, Mol. Cell.
Biol., 9:2396, 1989. [0358] Hsiung et al, Biotechnology, 4:991,
1994. [0359] Huang et al., Cell, 27:245, 1981. [0360] Hudson and
Souriau, Nat. Med. 9:129-134, 2003. [0361] Hudson, Curr. Opin.
Biotechnol., 9:395, 1998. [0362] Hultgren et al., Bacterial
Adhesins Assembly, Vol. 2., 1996. [0363] Hwang et al., Mol. Cell.
Biol., 10:585, 1990. [0364] Imagawa et al., Cell, 51:251, 1987.
[0365] Imbra and Karin, Nature, 323:555, 1986. [0366] Imler et al.,
Mol. Cell. Biol., 7:2558, 1987. [0367] Imperiale and Nevins, Mol.
Cell. Biol., 4:875, 1984. [0368] Innis et al., ProcNatl Acad Sci
USA. 85:9436, 1988. [0369] Irvin et al., J. Bacteriol., 145:1397,
1981. [0370] Jakobovits et al., Mol. Cell. Biol., 8:2555, 1988.
[0371] Jameel and Siddiqui, Mol. Cell. Biol., 6:710, 1986. [0372]
Jaynes et al., Mol. Cell. Biol., 8:62, 1988. [0373] Jeffrey et al.,
Proc. Natl. Acad. Sci. USA. 90:10310, 1993. [0374] Johns et al., J.
Immunol. Methods, 239:137, 2000. [0375] Johnson et al., Mol. Cell.
Biol., 9:3393, 1989. [0376] Jouenne and Junter, FEMS Microbiol.
Lett., 56:313, 1990. [0377] Kadesch and Berg, Mol. Cell. Biol.,
6:2593, 1986. [0378] Kang et al., Science, 240:1034-1036, 1988.
[0379] Karin et al., Mol. Cell. Biol., 7:606, 1987. [0380] Katinka
et al., Cell, 20:393, 1980. [0381] Katinka et al., Nature, 290:720,
1981. [0382] Kawamoto et al., Mol. Cell. Biol., 8:267, 1988. [0383]
Khatoon et al., Ann. of Neurology, 26, 210-219, 1989. [0384]
Kiledjian et al., Mol. Cell. Biol., 8:145, 1988. [0385] King et
al., J. Biol. Chem., 269:10218, 1989. [0386] Kjaer et al., FEBS
Lett., 431:448, 1998. [0387] Klamut et al., Mol. Cell. Biol.,
10:193, 1990. [0388] Knappick et al., J. Mol. Biol., 296:57, 2000.
[0389] Koch et al., Mol. Cell. Biol., 9:303, 1989. [0390] Kohler et
al., Methods Enzymol., 178:3, 1989. [0391] Kraus et al., FEBS
Lett., 428:165, 1998. [0392] Krebberetal., Gene, 178:71, 1996.
[0393] Krebber et al., J. Immunol. Methods, 201:35-55, 1997. [0394]
Kreier et al., Infection, Resistance and Imnunity, Harper &
Row, New York, (1991)). [0395] Kriegler and Botchan, In: Eukaryotic
Viral Vectors, Y. Gluzman, ed., Cold Spring Harbor: Cold Spring
Harbor Laboratory, NY, 1982. [0396] Kriegler et al., Cell, 38:483,
1984a. [0397] Kriegler et al., Cell, 53:45, 1988. [0398] Kriegler
et al., In: Cancer Cells 2/Oncogenes and Viral Genes, Van de Woude
et al eds, Cold Spring Harbor, Cold Spring Harbor Laboratory,
1984b. [0399] Kriegler et al., In: Gene Expression, D. Hamer and M.
Rosenberg, eds., New York: Alan R. Liss, 1983. [0400] Kuhl et al.,
Cell, 50:1057, 1987. [0401] Kunz et al., Nucl. Acids Res., 17:1121,
1989. [0402] Kwoh et al, Proc Natl Acad Sci USA. 86:1173, 1989.
[0403] Labischinski et al., J. Bacteriol., 162:9, 1985. [0404]
Lareyre et al., J Biol Chem., 274:8282, 1999. [0405] Larsen et al.,
Proc. Nat'l Acad. Sci. USA., 83:8283, 1986. [0406] Laspia et al.,
Cell, 59:283, 1989. [0407] Latimer et al., Mol. Cell. Biol.,
10:760, 1990. [0408] Lee et al., J. Auton Nerv Syst. 74:86, 1997
[0409] Lee et al., Nature, 294:228, 1981. [0410] Lenert et al.,
Science, 248:1639-1643, 1990. [0411] Levinson et al., Nature,
295:79, 1982. [0412] Levitan, J. Mol. Biol., 277:893, 1998. [0413]
Li et al., Nat. Struct. Biol., 10:482-488, 2003. [0414] Lin et al.,
Mol. Cell. Biol., 10:850, 1990. [0415] Luria et al, EMBO J.,
6:3307, 1987. [0416] Lusky and Botchan, Proc. Nat'l Acad. Sci.
USA., 83:3609, 1986. [0417] Lusky et al., Mol. Cell. Biol., 3:1108,
1983. [0418] MacKenzie and To, J. Immunol. Methods, 220:39, 1998.
[0419] MacKenzie etal., J. Biol. Chem., 271:1527, 1996. [0420]
Maenaka et al., Biochem Biophys Res Commun., 218:682, 1996. [0421]
Majors and Vannus, Proc. Nat'l Acad. Sci. USA., 80:5866, 1983.
[0422] Mahnborg et al., J. Immunol. Methods, 198:51, 1996. [0423]
Marciano et al., Science 284:1516, 1999. [0424] Marks et al.,
Bio/Technol. 10:779, 1992. [0425] Marks et al., J. Mol. Biol.,
222:581, 1991. [0426] Martinez et al., Biochemistry, 35:1179, 1996.
[0427] Martinez et al., J. Biotechnol., 71:59, 1999. [0428] Masuda
K et al. PNAS 99(11):7390, 2002. [0429] Maynard et al., Nat.
Biotechnol., 20:597-601, 2002. [0430] McNeall et al., Gene, 76:81,
1989. [0431] Miksicek et al., Cell, 46:203, 1986. [0432] Mingarro
et al., Trends Biotechnol., 15:432-437, 1997. [0433] Miroux and
Walker, J. Mol. Biol., 260:289-298, 1996. [0434] Mitchell et al.,
Ann. N.Y. Acad. Sci., 690:153, 1993. [0435] Mordacq and Linzer,
Genes and Dev., 3:760, 1989. [0436] Moreau et al., Nucl. Acids
Res., 9:6047, 1981. [0437] Morrison, et al., Proc. Nat'l. Acad. Sci
USA. 81:6851, 1984. [0438] Muesing et al., Cell, 48:691, 1987.
[0439] Munson & Pollard, Anal. Biochem. 107:220, 1980. [0440]
Mutuberriaetal., J. Immunol. Methods, 231:65, 1999. [0441] Nakae,
J. Biol. Chem., 251:2176, 1976. [0442] Neu and Heppel, J. Biol.
Chem., 240:3685-3692, 1965. [0443] Nikaido and Nakae, Adv. Microb.
Physiol., 20:163, 1979. [0444] Nikaido and Vaara, Microbiol Rev.
49:1, 1985. [0445] Nissim et al., EMBO J., 13:692, 1994. [0446]
Nomoto et al., Gene, 236:259, 1999. [0447] Ohara et al., "One-sided
polymerase chain reaction: the amplification of cDNA," [0448] Oka
et al, Proc. Natl. Acad. Sci. U.S.A., Vol 82, pp 7212-7216,
November 1985 [0449] Olsen et al., Nat. Biotechnol, 18:1071-1074,
2000. [0450] O'Shannessy et al., J. Immun. Meth., 99, 153-161,
1987. [0451] Owens & Haley, J. Biol. Chem., 259:14843-14848,
1987. [0452] Painbeni et al., Proc Natl. Acad. Sci. USA, 94:6712,
1997. [0453] Palmiter et al., Nature, 300:611, 1982. [0454] Pech et
al., Mol. Cell. Biol., 9:396, 1989. [0455] Perez-Stable and
Constantini, Mol. Cell. Biol., 10:1116, 1990. [0456] Picard and
Schaffler, Nature, 307:83, 1984. [0457] Pini et al., J. Biol.
Chem., 273:21769, 1998. [0458] Pinkert et al., Genes and Dev.,
1:268, 1987. [0459] Ponta et al., Proc. Nat'l Acad. Sci. USA.,
82:1020, 1985. [0460] Porton et al., Mol. Cell. Biol., 10:1076,
1990. [0461] Potter & Haley, Meth. in Enzymol., 91, 613-633,
1983. [0462] Pugsley, Microbiol. Rev., 57:50-108, 1993. [0463]
Queen and Baltimore, Cell, 35:741, 1983. [0464] Quinn et al., Mol
Cell. Biol., 9:4713, 1989. [0465] Rakonjac and Model, J. Mol.
Biol., 282:25, 1998. [0466] Rakonjac et al., J. Mol. Biol.,
289:1253, 1999. [0467] Rao and Torriani, J. Bacteriol., 170, 5216,
1988. [0468] Redondo et al., Science, 247:1225, 1990. [0469]
Reisman and Rotter, Mol. Cell. Biol., 9:3571, 1989. [0470] Resendez
Jr. et al., Mol. Cell. Biol., 8:4579, 1988. [0471] Ripe et al.,
Mol. Cell. Biol., 9:2224, 1989. [0472] Rittling et al., Nucl. Acids
Res., 17:1619, 1989. [0473] Rodi and Makowski, Curr. Opin.
Biotechnol., 10:87-93, 1999. [0474] Rosen et al., Cell, 41:813,
1988. [0475] Sagt et al., Appl. Environ. Microbiol., 68:2155-2160,
2002. [0476] Sakai et al., Genes and Dev., 2:1144, 1988. [0477]
Sambrook et al., In: Molecular Cloning: A Laboratory Manual, Vol.
1, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.,
Ch. 7,7.19-17.29, 1989. [0478] Samuelson et al., Nature,
406:637-641, 2000. [0479] Sasso et al., J. Immunol., 142:2778-2783,
1989. [0480] Satake et al., J. Virology, 62:970, 1988. [0481]
Sblattero and Bradbury, Nat. Biotechnol., 18:75, 2000. [0482]
Schaffner et al., J. Mol. Biol., 201:81, 1988. [0483] Searle et
al., Mol. Cell. Biol., 5:1480, 1985. [0484] Seydel et al., Mol.
Microbiol., 34:810-821, 1999. [0485] Sharp and Marciniak, Cell,
59:229, 1989. [0486] Shaul and Ben-Levy, EMBO J., 6:1913, 1987.
[0487] Sheets et al., Proc. Natl. Acad. Sci. USA., 95:6157, 1998.
[0488] Sherman et al., Mol. Cell. Biol., 9:50, 1989. [0489] Shorki
et al., J. Immunol., 146:936-940, 1991. [0490] Shusta et al., J.
Mol. Biol., 292:949, 1999. [0491] Silvermann et al., J. Clin.
Invest., 96:417-426, 1995. [0492] Sleigh and Lockett, J. EMBO,
4:3831, 1985. [0493] Smith, Science, 228:1315-1317, 1985. [0494]
Somerville et al., Appl. Microbiol. Biotechnol., 42:595-603, 1994.
[0495] Spalholz et al., Cell, 42:183, 1985. [0496] Spandau and Lee,
J. Virology, 62:427, 1988. [0497] Spandidos and Wilkie, EMBO J.,
2:1193, 1983. [0498] Stathopoulos et al., Appl. Microbiol.
Biotechnol., 45:112-119, 1996. [0499] Stephens and Hentschel,
Biochem. J, 248:1, 1987. [0500] Stuart et al., Nature, 317:828,
1985. [0501] Sullivan and Peterlin, Mol. Cell. Biol., 7:3315, 1987.
[0502] Swartzendruber and Lehmnan, J. Cell. Physiology, 85:179,
1975. [0503] T. J. Gibson, PhD thesis, University of Cambridge
(1984).
[0504] Takebe et al., Mol. Cell. Biol., 8:466, 1988. [0505]
Tavernier et al., Nature, 301:634, 1983. [0506] Taylor and
Kingston, Mol. Cell. Biol., 10:165, 1990a. [0507] Taylor and
Kingston, Mol. Cell. Biol., 10:176, 1990b. [0508] Taylor et al., J.
Biol. Chem., 264:15160, 1989. [0509] Thiesen et al., J. Virology,
62:614, 1988. [0510] Thompson et al., J. Mol. Biol. 256, 77,
1999????. [0511] Thorstenson et al., J. Bacteriol., 179:5333, 1997.
[0512] Tomlinson et al., J. Mol. Biol. 227:776, 1992. [0513]
Tronche et al., Mol. Biol. Med., 7:173, 1990. [0514] Tronche et
al., Mol. Cell. Biol., 9:4759, 1989. [0515] Trudel and Constantini,
Genes and Dev., 6:954, 1987. [0516] Tsumaki et al., J Biol Chem.
273:22861, 1998. [0517] Van Wielink and Duine, Trends Biochem Sci.,
15:136, 1990. [0518] Vannice and Levinson, J. Virology, 62:1305,
1988. [0519] Vasseur et al., Proc. Natl. Acad. Sci. USA., 77:1068,
1980. [0520] Vaughan et al., Nat. Biotechnol., 14:309, 1996. [0521]
Walker et al., Nucleic Acids Res. 20:1691, 1992 [0522] Wang and
Calame, Cell, 47:241, 1986. [0523] Waterhouse et al., Nucl. Acids
Res. 21, 2265-2266 (1993) [0524] Watson, M. Nucleic Acids Research,
Vol 12, No. 13, 1984, pp. 5145-5164), [0525] Weber et al., Cell,
36:983, 1984. [0526] Weinberger et al. Mol. Cell. Biol., 8:988,
1984. [0527] Winoto and Baltimore, Cell, 59:649, 1989. [0528]
Winter et al, Ann. Rev. Immunol. 12: 433, 1994. [0529] Wittrup,
Nat. Biotechnol., 18:1039-1040, 2000. [0530] Wu et al., Biochem
Biophys Res Commun. 233:221, 1997. [0531] Yakushi et al., Nat.
Cell. Biol., 2:212-218, 2000. [0532] Yakushi T. et al. Journal of
Bacteriology 179(9):2857, 1997. [0533] Yamaguchi and Inouye.,
Journal of Bacteriology 170 no.8: 3747, 1988. [0534] Yamaguchi et
al., Cell, 53:423-432, 1988. [0535] Yu et al., J. Biol. Chem.,
261:2284-2288, 1986. [0536] Yutzey et al. Mol. Cell. Biol., 9:1397,
1989. [0537] Zhao-Emonet et al., Gene Ther. 6:1638, 1999.
Sequence CWU 1
1
25 1 17 DNA Artificial Sequence Description of Artificial Sequence
Synthetic Primer 1 caggaaacag ctatgac 17 2 17 DNA Artificial
Sequence Description of Artificial Sequence Synthetic Primer 2
gaattttctg tatgagg 17 3 18 DNA Artificial Sequence Description of
Artificial Sequence Synthetic Primer 3 gccacctccg cctgaacc 18 4 17
DNA Artificial Sequence Description of Artificial Sequence
Synthetic Primer 4 ctatgcggcc ccattca 17 5 5 DNA Artificial
Sequence Description of Artificial Sequence Synthetic Primer 5
aaaaa 5 6 39 DNA Artificial Sequence Description of Artificial
Sequence Synthetic Primer 6 gaaggagata tacatatgaa actgacaaca
catcatcta 39 7 45 DNA Artificial Sequence Description of Artificial
Sequence Synthetic Primer 7 ctgggccatg gccggctggg cctcgctgct
actctggtcg caacc 45 8 7 PRT Artificial Sequence Description of
Artificial Sequence Synthetic Peptide 8 Gln Thr Thr His Val Pro Pro
1 5 9 7 PRT Artificial Sequence Description of Artificial Sequence
Synthetic Peptide 9 Gln Thr Thr His Val Pro Pro 1 5 10 7 PRT
Artificial Sequence Description of Artificial Sequence Synthetic
Peptide 10 Gln Thr Thr His Ser Pro Ala 1 5 11 7 PRT Artificial
Sequence Description of Artificial Sequence Synthetic Peptide 11
Gln Thr Thr His Leu Pro Thr 1 5 12 7 PRT Artificial Sequence
Description of Artificial Sequence Synthetic Peptide 12 Gln Thr Thr
His Thr Pro Pro 1 5 13 7 PRT Artificial Sequence Description of
Artificial Sequence Synthetic Peptide 13 Gln Thr Thr His Thr Pro
Pro 1 5 14 7 PRT Artificial Sequence Description of Artificial
Sequence Synthetic Peptide 14 Gln Thr Thr His Ile Pro Thr 1 5 15 7
PRT Artificial Sequence Description of Artificial Sequence
Synthetic Peptide 15 Gln Thr Thr His Val Pro Pro 1 5 16 7 PRT
Artificial Sequence Description of Artificial Sequence Synthetic
Peptide 16 Gln Thr Thr His Val Pro Ala 1 5 17 7 PRT Artificial
Sequence Description of Artificial Sequence Synthetic Peptide 17
Gln Thr Thr His Ile Pro Ala 1 5 18 7 PRT Artificial Sequence
Description of Artificial Sequence Synthetic Peptide 18 Gln Thr Thr
His Leu Pro Ala 1 5 19 7 PRT Artificial Sequence Description of
Artificial Sequence Synthetic Peptide 19 Gln Thr Thr His Val Pro
Cys 1 5 20 741 DNA Artificial Sequence Description of Artificial
Sequence Synthetic Primer 20 gatattcaga tgacacagac tacatcctcc
ctgtctgcct ctctgggaga cagagtcacc 60 atcagttgca gggcaagtca
ggacattagg aattatttaa actggtatca gcagaaacca 120 gatggaactg
ttaaactcct gatctactac acatcaagat tacagtcagg agtcccatca 180
aggttcagtg gcagtgggtc tggaacagat tattctctca ccattagcaa ccaggagcaa
240 gaagatattg gcacttactt ttgccaacag ggtaatacgc ttccgtggac
gttcggtgga 300 ggcaccaagc tggaaataaa acgtggtggt ggtggttctg
gtggtggtgg ttctggcggc 360 ggcggctccg gtggtggtgg atccgaggtc
caactgcaac agtctggacc tgagctggtg 420 aagcctgggg cctcagtgaa
gatttcctgc aaagattctg gctacgcatt cagtagctct 480 tggatgaact
gggtgaagca gaggcctgga cagggtcttg agtggattgg acggatttat 540
cctggagatg gagatactaa ctacaatggg aagttcaagg gcaaggccac actgactgca
600 gacaaatcct ccagcacagc ctacatgcag ctcagcagcc tgacctctgt
ggactctgcg 660 gtctatttct gtgcaagatc ggggttacta cgttatgcta
tggactactg gggtcaagga 720 acctcagtca ccgtctcctc g 741 21 247 PRT
Artificial Sequence Description of Artificial Sequence Synthetic
Peptide 21 Asp Ile Gln Met Thr Gln Thr Thr Ser Ser Leu Ser Ala Ser
Leu Gly 1 5 10 15 Asp Arg Val Thr Ile Ser Cys Arg Ala Ser Gln Asp
Ile Arg Asn Tyr 20 25 30 Leu Asn Trp Tyr Gln Gln Lys Pro Asp Gly
Thr Val Lys Leu Leu Ile 35 40 45 Tyr Tyr Thr Ser Arg Leu Gln Ser
Gly Val Pro Ser Arg Phe Ser Gly 50 55 60 Ser Gly Ser Gly Thr Asp
Tyr Ser Leu Thr Ile Ser Asn Gln Glu Gln 65 70 75 80 Glu Asp Ile Gly
Thr Tyr Phe Cys Gln Gln Gly Asn Thr Leu Pro Trp 85 90 95 Thr Phe
Gly Gly Gly Thr Lys Leu Glu Ile Lys Arg Gly Gly Gly Gly 100 105 110
Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser 115
120 125 Glu Val Gln Leu Gln Gln Ser Gly Pro Glu Leu Val Lys Pro Gly
Ala 130 135 140 Ser Val Lys Ile Ser Cys Lys Asp Ser Gly Tyr Ala Phe
Ser Ser Ser 145 150 155 160 Trp Met Asn Trp Val Lys Gln Arg Pro Gly
Gln Gly Leu Glu Trp Ile 165 170 175 Gly Arg Ile Tyr Pro Gly Asp Gly
Asp Thr Asn Tyr Asn Gly Lys Phe 180 185 190 Lys Gly Lys Ala Thr Leu
Thr Ala Asp Lys Ser Ser Ser Thr Ala Tyr 195 200 205 Met Gln Leu Ser
Ser Leu Thr Ser Val Asp Ser Ala Val Tyr Phe Cys 210 215 220 Ala Arg
Ser Gly Leu Leu Arg Tyr Ala Met Asp Tyr Trp Gly Gln Gly 225 230 235
240 Thr Ser Val Thr Val Ser Ser 245 22 741 DNA Artificial Sequence
Description of Artificial Sequence Synthetic Primer 22 gatattcaga
tgacacagac tacatcctcc ctgtctgcct ctctgggaga cagagtcacc 60
gtcagttgca gggcaagtca ggacattagg aattatttaa actggtatca gcagaaacca
120 gacggaactg ttaaattcct gatctactac acatcaagat tacagccagg
agtcccatca 180 aggttcagtg gcagtgggtc tggaacagat tattccctca
ccattaacaa cctggagcag 240 gaagatattg gcacttactt ttgccaacag
ggcaatacgc ctccgtggac gttcggtgga 300 ggcaccaagc tggaaataaa
acgtggtgga ggtggttctg atggtggtgg ttctggcggc 360 ggcggctccg
gtggtggtgg atccgaggtc caactgcaac agtctggacc tgagctggtg 420
aagcctgggg cctcagtgaa gatttcctgc aaagattctg gctacgcatt caatagctct
480 tggatgaact gggtgaagca gaggcctgga cagggtcttg agtggattgg
acggatttat 540 cctggagatg gagattctaa ctacaatggg aaattcgagg
gcaaggccat actgactgca 600 gacaaatcct ccagcacagc ctacatgcag
ctcagcagcc tgacctctgt ggactctgcg 660 gtctatttct gtgcaagatc
ggggttgcta cgttatgcta tggactactg gggtcaagga 720 acctcagtca
ccgtctcctc g 741 23 247 PRT Artificial Sequence Description of
Artificial Sequence Synthetic Peptide 23 Asp Ile Gln Met Thr Gln
Thr Thr Ser Ser Leu Ser Ala Ser Leu Gly 1 5 10 15 Asp Arg Val Thr
Val Ser Cys Arg Ala Ser Gln Asp Ile Arg Asn Tyr 20 25 30 Leu Asn
Trp Tyr Gln Gln Lys Pro Asp Gly Thr Val Lys Phe Leu Ile 35 40 45
Tyr Tyr Thr Ser Arg Leu Gln Pro Gly Val Pro Ser Arg Phe Ser Gly 50
55 60 Ser Gly Ser Gly Thr Asp Tyr Ser Leu Thr Ile Asn Asn Leu Glu
Gln 65 70 75 80 Glu Asp Ile Gly Thr Tyr Phe Cys Gln Gln Gly Asn Thr
Pro Pro Trp 85 90 95 Thr Phe Gly Gly Gly Thr Lys Leu Glu Ile Lys
Arg Gly Gly Gly Gly 100 105 110 Ser Asp Gly Gly Gly Ser Gly Gly Gly
Gly Ser Gly Gly Gly Gly Ser 115 120 125 Glu Val Gln Leu Gln Gln Ser
Gly Pro Glu Leu Val Lys Pro Gly Ala 130 135 140 Ser Val Lys Ile Ser
Cys Lys Asp Ser Gly Tyr Ala Phe Asn Ser Ser 145 150 155 160 Trp Met
Asn Trp Val Lys Gln Arg Pro Gly Gln Gly Leu Glu Trp Ile 165 170 175
Gly Arg Ile Tyr Pro Gly Asp Gly Asp Ser Asn Tyr Asn Gly Lys Phe 180
185 190 Glu Gly Lys Ala Ile Leu Thr Ala Asp Lys Ser Ser Ser Thr Ala
Tyr 195 200 205 Met Gln Leu Ser Ser Leu Thr Ser Val Asp Ser Ala Val
Tyr Phe Cys 210 215 220 Ala Arg Ser Gly Leu Leu Arg Tyr Ala Met Asp
Tyr Trp Gly Gln Gly 225 230 235 240 Thr Ser Val Thr Val Ser Ser 245
24 741 DNA Artificial Sequence Description of Artificial Sequence
Synthetic Primer 24 gatattcaga tgacacagac tacatcctcc ctgtctgcct
ctctgggaga cagagtcacc 60 gtcagttgca gggcaagtca ggacattagg
aattatttaa actggtatca gcagaaacca 120 gacggaactg ttaaattcct
gatctactac acatcaagat tactgccagg agtcccatca 180 aggttcagtg
gcagtgggtc tggaacagat tattccctca ccattaacaa cctggagcag 240
gaagatattg gcacttactt ttgccaacag ggcaatacgc ctccgtggac gttcggtgga
300 ggcaccaagc tggaaataaa acgtggtgga ggtggttctg atggtggtgg
ttctggcggc 360 ggcggctccg gtggtggtgg atccgaggtc caactgcaac
agtctggacc tgagctggtg 420 aagcctgggg cctcagtgaa gatttcctgc
aaagattctg gctacgcatt caatagctct 480 tggatgaact gggtgaagca
gaggcctgga cagggtcttg agtggattgg acggatttat 540 cctggagatg
gagattctaa ctacaatggg aaattcgagg gcaaggccat actgacagca 600
gacaaatcct ccagcacagc ctacatgcag ctcagcagcc tgacctctgt ggactctgcg
660 gtctatttct gtgcaagatc ggggttgcta cgttatgcta tggactactg
gggtcaagga 720 acctcagtca ccgtctcctc g 741 25 247 PRT Artificial
Sequence Description of Artificial Sequence Synthetic Peptide 25
Asp Ile Gln Met Thr Gln Thr Thr Ser Ser Leu Ser Ala Ser Leu Gly 1 5
10 15 Asp Arg Val Thr Val Ser Cys Arg Ala Ser Gln Asp Ile Arg Asn
Tyr 20 25 30 Leu Asn Trp Tyr Gln Gln Lys Pro Asp Gly Thr Val Lys
Phe Leu Ile 35 40 45 Tyr Tyr Thr Ser Arg Leu Leu Pro Gly Val Pro
Ser Arg Phe Ser Gly 50 55 60 Ser Gly Ser Gly Thr Asp Tyr Ser Leu
Thr Ile Asn Asn Leu Glu Gln 65 70 75 80 Glu Asp Ile Gly Thr Tyr Phe
Cys Gln Gln Gly Asn Thr Pro Pro Trp 85 90 95 Thr Phe Gly Gly Gly
Thr Lys Leu Glu Ile Lys Arg Gly Gly Gly Gly 100 105 110 Ser Asp Gly
Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser 115 120 125 Glu
Val Gln Leu Gln Gln Ser Gly Pro Glu Leu Val Lys Pro Gly Ala 130 135
140 Ser Val Lys Ile Ser Cys Lys Asp Ser Gly Tyr Ala Phe Asn Ser Ser
145 150 155 160 Trp Met Asn Trp Val Lys Gln Arg Pro Gly Gln Gly Leu
Glu Trp Ile 165 170 175 Gly Arg Ile Tyr Pro Gly Asp Gly Asp Ser Asn
Tyr Asn Gly Lys Phe 180 185 190 Glu Gly Lys Ala Ile Leu Thr Ala Asp
Lys Ser Ser Ser Thr Ala Tyr 195 200 205 Met Gln Leu Ser Ser Leu Thr
Ser Val Asp Ser Ala Val Tyr Phe Cys 210 215 220 Ala Arg Ser Gly Leu
Leu Arg Tyr Ala Met Asp Tyr Trp Gly Gln Gly 225 230 235 240 Thr Ser
Val Thr Val Ser Ser 245
* * * * *
References