U.S. patent application number 10/558231 was filed with the patent office on 2007-05-03 for ecdysone receptor ligand-binding domain structure.
Invention is credited to Jennifer A. Camichael, Vidana C. Epa, Lloyd Graham, Garry N. Hannan, Ronald J. Hill, Michael C. Lawrence, George O. Lovrecz, Leonie Noyce, Patricia Pilling, David Winkler.
Application Number | 20070099232 10/558231 |
Document ID | / |
Family ID | 31953664 |
Filed Date | 2007-05-03 |
United States Patent
Application |
20070099232 |
Kind Code |
A1 |
Lawrence; Michael C. ; et
al. |
May 3, 2007 |
Ecdysone receptor ligand-binding domain structure
Abstract
The present invention relates to structural studies of the
functional insect ecdysone receptor. More particularly, the
invention relates to the crystal structure of the whitefly ecdysone
receptor ligand-binding domain, specifically that of Bemisia
tabaci, and uses of the crystal and related structural information
to select and screen for compounds that interact with the
receptor.
Inventors: |
Lawrence; Michael C.;
(Newport, AU) ; Pilling; Patricia; (North Fitzroy,
AU) ; Lovrecz; George O.; (North Balwyn, AU) ;
Epa; Vidana C.; (Coburg, AU) ; Camichael; Jennifer
A.; (East Brunswick, AU) ; Noyce; Leonie;
(Marrickville, AU) ; Graham; Lloyd; (North Ryde,
AU) ; Hannan; Garry N.; (Hunters Hill, AU) ;
Winkler; David; (Belgrave, AU) ; Hill; Ronald J.;
(Forestville, AU) |
Correspondence
Address: |
GREENLEE WINNER AND SULLIVAN P C
4875 PEARL EAST CIRCLE
SUITE 200
BOULDER
CO
80301
US
|
Family ID: |
31953664 |
Appl. No.: |
10/558231 |
Filed: |
May 27, 2004 |
PCT Filed: |
May 27, 2004 |
PCT NO: |
PCT/AU04/00713 |
371 Date: |
June 21, 2006 |
Current U.S.
Class: |
435/7.1 |
Current CPC
Class: |
A01N 43/82 20130101;
A01N 43/50 20130101; C07K 2299/00 20130101; A01N 43/76 20130101;
C07H 21/02 20130101; C07K 14/43563 20130101; C07H 21/04 20130101;
A01N 63/50 20200101 |
Class at
Publication: |
435/007.1 |
International
Class: |
G01N 33/53 20060101
G01N033/53 |
Foreign Application Data
Date |
Code |
Application Number |
May 27, 2003 |
AU |
2003902621 |
Claims
1. A crystalline composition comprising the BtEcR/BtUSP heterodimer
ligand binding domain (LBD) or portion thereof of the ecdysone
receptor from Bemisia tabaci.
2. A crystalline composition according to claim 1, wherein the LBD
or portion thereof is co-crystallized with a ligand.
3. A method of selecting or designing a compound that interacts
with an ecdysone receptor and modulates an activity mediated by the
receptor, the method comprising the step of assessing the
stereochemical complementarity between the compound and a
topographic region of the BtEcR/BtUSP heterodimer LBD, wherein the
heterodimer is characterised by: (a) amino acids 179-415 of the
BtEcR monomer and amino acids 300-492 of the BtUSP monomer
positioned at atomic coordinates as shown in Appendix I, or
structural coordinates wherein the backbone atoms of each monomer
has a root mean square deviation from the backbone atoms of their
corresponding partners in either amino acids 179-415 of the BtEcR
monomer or amino acids 300-492 of the BtUSP monomer of not more
than 1.5 .ANG.; or (b) one or more subsets of said amino acids
related to the coordinates of the monomers shown in Appendix I by
whole body translations and/or rotations.
4. The method according to claim 3, wherein the structural
coordinates have a root mean square deviation from the backbone
atoms of said amino acids of not more than 1.0 .ANG..
5. The method according to claim 3, wherein the structural
coordinates have a root mean square deviation from the backbone
atoms of said amino acids of not more than 0.7 .ANG..
6. The method according to claim 3, wherein the topographic region
of the ecdysone receptor to which the compound, or a portion
thereof has stereochemical complementarity is the ligand-binding
pocket of the BtEcR subunit defined by amino acids F194, Q195,
N196, Y198, E199, H200, P201, H226, I227, T228,1230, T231, L233,
T234, L237, I238, F241, S242, V267, M268, M269, F270, R271, M272,
R274, R275, I283, L284, F285, A286, Y296, M301, T304, L308, Y325,
A326, T329, I333, M389, N390, T393, C394, L397, V404, P405, L408
and W412.
7. The method according to claim 3, wherein the topographic region
of the ecdysone receptor to which the compound, or a portion
thereof has stereochemical complementarity is the interface between
the BtEcR and BtUSP subunits defined by BtEcR residues H314, M315,
I331, S335, E336, R337, P338, E347, Q350, E351, I354, E355, K358,
T370, T371, F373, A374, K375, L377, S378, L380, T381, E382, R384,
T385 and N388 and BtUSP residues E342, R383, T386, E387, K391,
E414, E425, E429, Y432, A433, E436, S447, G448, F450, A451, K452,
L454, L455, R456, L457, P458, A459, R461, S462 and L465.
8. The method according to claim 3, wherein the topographic region
of the ecdysone receptor to which the compound, or portion thereof
has stereochemical complementarity is the co-activator/co-repressor
binding groove formed by helices H3 and H4 of the surface of BtEcR
defined by residues I232, V235, Q236, V239, E240, K243, F248, R253,
E254, Q256, I257, L260, K261, S264, S265, M268, S406, F407, L408,
E410, I411 and D413.
9. (canceled)
10. The method according to claim 6, wherein the method comprises
selecting a compound which forms hydrogen bonds with at least one
amino acid residue selected from the group consisting of E199,
I227, T231, T234, R271, A286 Y296, T304, N390 and C394 of the
ligand-binding pocket of the BtEcR LBD, wherein the compound is not
a naturally-occurring ecdysteroid ligand of the ligand-binding
pocket of the receptor.
11. The method according to claim 6, wherein the method comprises
selecting a compound which forms hydrophobic contacts with the side
chains of at least one amino acid residue selected from the group
consisting of P201, I227, T228, I230, M268, M269, R271, M272, R275,
I283, F285, A286, M301, L308, M389, L397, P405, L408 and W412 of
the ligand-binding pocket of the BtEcR subunit, wherein the
compound is not the natural ligand of the ligand-binding pocket of
the receptor.
12. The method according to claim 3, wherein the compound is
selected or designed to interact with the B. tabaci ecdysone
receptor in a manner such as to interfere with the association of
the BtEcR and BtUSP subunits by inhibiting the association of BtEcR
residues H314, M315, I331, S335, E336, R337, P338, E347, Q350,
E351, I354, E355, K358, T370, T371, F373, A374, K375, L377, S378,
V379, L380, T381, E382, R384, T385 and N388 and BtUSP residues
E342, R383, T386, E387, K391, I408, V409, E414, E425, R428, E429,
Y432, A433, E436, S447, G448, F450, A451, K452, L454, L455, R456,
L457, A459, R461, S462 and L465.
13. The method according to claim 3, wherein the compound is
selected or designed to interfere with signalling of the
receptor.
14. The method according to claim 3, wherein the compound is
selected or designed based on the natural ligand of the B. tabaci
ecdysone receptor, the compound being designed or selected such
that it interacts with at least one amino acid selected from the
group consisting of F194, Q195, N196, Y198, E199, H200, P201, H226,
I227, T228, I230, T231, L233, T234, L237, I238, F241, S242, V267,
M268, M269, F270, R271, M272, R274, R275, I283, L284, F285, A286,
Y296, M301, T304, L308, Y325, A326, T329, I333, M389, N390, T393,
C394, L397, V404, P405, L408 and W412.
15. The method according to claim 14, wherein the compound is
selected or designed such that the interaction between the compound
and the B. tabaci ecdysone receptor is preferred over the
interaction of the natural ligand with the B. tabaci ecdysone
receptor.
16. The method according to claim 15, wherein the compound is an
agonist of B. tabaci ecdysone receptor activity.
17. The method according to claim 15, wherein the compound is an
antagonist of B. tabaci ecdysone receptor activity.
18. The method according to claim 3, the method further comprising
the step of obtaining a compound which possesses stereochemical
complementarity to a topographic region of the BtEcR/BtUSP
heterodimer LBD and testing the compound for insecticidal
activity.
19. A computer-assisted method for identifying potential compounds
able to interact with an ecdysone receptor and thereby modulate an
activity mediated by the receptor, using a programmed computer
comprising a processor, an input device, and an output device,
comprising the steps of: (a) inputting into the programmed
computer, through the input device, data comprising the atomic
coordinates of amino acids 179-415 of the BtEcR monomer and amino
acids 300-492 of the BtUSP monomer and ponasterone A positioned at
atomic coordinates as shown in Appendix I, or structural
coordinates wherein the backbone atoms of each monomer has a root
mean square deviation from the backbone atoms of their
corresponding partners in either amino acids 179-415 of the BtEcR
monomer or amino acids 300-492 of the BtUSP monomer of not more
than 1.5 .ANG., or one or more subsets of said amino acids, or one
or more subsets of said amino acids related to the coordinates
shown in Appendix I by whole body translations and/or rotations;
(b) generating, using computer methods, a set of atomic coordinates
of a structure that possesses stereochemical complementarity to the
atomic coordinates of amino acids 179-415 of the BtEcR monomer
and/or amino acids 300-492 of the BtUSP monomer positioned at
atomic coordinates as shown in Appendix I, or structural
coordinates having a root mean square deviation from the backbone
atoms of their corresponding partners in either amino acids 179-415
of the BtEcR monomer or amino acids 300-492 of the BtUSP monomer of
not more than 1.5 .ANG., or one or more subsets of said amino
acids, or one or more subsets of said amino acids related to the
coordinates shown in Appendix I by whole body translations and/or
rotations, thereby generating a criteria data set; (c) comparing,
using the processor, the criteria data set to a computer database
of chemical structures; (d) selecting from the database, using
computer methods, chemical structures which are similar to a
portion of said criteria data set; and (e) outputting, to the
output device, the selected chemical structures which are
complementary to or similar to a portion of the criteria data
set.
20. The method according to claim 19, wherein the structural
coordinates have a root mean square deviation from the backbone
atoms of said amino acids of not more than 1.0 .ANG..
21. The method according to claim 19, wherein the structural
coordinates have a root mean square deviation from the backbone
atoms of said amino acids of not more than 0.7 .ANG..
22. The method according to claim 19, wherein the method further
comprises the step of obtaining a compound with a chemical
structure selected in steps (d) and (e) and testing the compound
for insecticidal activity.
23. The method according claim 19, wherein the subset of amino
acids is that defining the ligand-binding pocket of the BtEcR
subunit, namely F194, Q195, N196, Y198, E199, H200, P201, H226,
I227, T228, I230, T231, L233, T234, L237, I238, F241, S242, V267,
M268, M269, F270, R271, M272, R274, R275, I283, L284, F285, A286,
Y296, M301, T304, L308, Y325, A326, T329, I333, M389, N390, T393,
C394, L397, V404, P405, L408 and W412.
24. The method according to claim 19, wherein the subset of amino
acids is that defining the interface between the BtEcR and BtUSP
subunits defined by BtEcR residues H314, M315, I331, S335, E336,
R337, P338, E347, Q350, E351, I354, E355, K358, T370, T371, F373,
A374, K375, L377, S378, L380, T381, E382, R384, T385 and N388 and
BtUSP residues E342, R383, T386, E387, K391, E414, E425, E429,
Y432, A433, E436, S447, G448, F450, A451, K452, L454, L455, R456,
L457, P458, A459, R461, S462 and L465.
25. The method according to claim 19, wherein the subset of amino
acids is that defining the co-activator/co-repressor binding groove
formed by helices H3 and H4 on the surface of BtEcR defined by
residues I232, V235, Q236, V239, E240, K243, F248, R253, E254,
Q256, I257, L260, K261, S264, S265, M268, S406, F407, L408, E410,
I411 and D413.
26. A method of screening a putative compound having the ability to
modulate the activity of the B. tabaci ecdysone receptor
(BtEcR/BtUSP) or a heterodimer comprising the BtEcR monomer (SEQ ID
No:1) paired with another functional partner protein such as the
retinoic X receptor (RXR), comprising the steps of identifying a
putative compound according to claim 3 or claim 19, and testing the
compound for activity.
27. The method according to claim 26, wherein the testing of the
compound is carried out in vitro.
28. The method according to claim 27, wherein the in vitro test is
a high throughput assay.
29. The method according to claim 26, wherein the testing of the
compound is carried out in vivo employing cell-based or whole
organism-based screens.
30-43. (canceled)
44. A method for evaluating the ability of a chemical entity to
interact with the BtEcR/BtUSP heterodimer LBD, said method
comprising the steps of: (a) creating a computer model of at least
one region of the BtEcR/BtUSP heterodimer LBD using structure
coordinates wherein the root mean square deviation between the
backbone atoms of the (i) the BtEcR component of the model and the
corresponding structure coordinates of amino acids 179-415 of the
BtEcR monomer or (ii) the BtUSP component of the model and the
corresponding structure coordinates of amino acids 300-492 of the
BtUSP monomer, as set forth in Appendix I, are not more than 1.5
.ANG.; (b) employing computational means to perform a fitting
operation between the chemical entity and said computer model of at
least one region of the monomers of the BtEcR/BtUSP heterodimer
LBD; and (c) analysing the results of said fitting operation to
quantify the association between the chemical entity and at least
one region of the BtEcR/BtUSP heterodimer LBD model.
45. The method according to claim 44, wherein the structural
coordinates have a root mean square deviation from the backbone
atoms of said amino acids of not more than 1.0 .ANG..
46. The method according to claim 44, wherein the structural
coordinates have a root mean square deviation from the backbone
atoms of said amino acids of not more than 0.7 .ANG..
47. The method according to claim 44, wherein the region is the
ligand-binding pocket of the BtEcR subunit defined by amino acids
F194, Q195, N196, Y198, E199, H200, P201, H226, I227, T228, I230,
T231, L233, T234, L237, I238, F241, S242, V267, M268, M269, F270,
R271, M272, R274, R275, I283, L284, F285, A286, Y296, M301, T304,
L308, Y325, A326, T329, I333, M389, N390, T393, C394, L397, V404,
P405, L408 and W412.
48. The method according to claim 44, wherein the region is the
interface between the BtEcR and BtUSP subunits defined by BtEcR
residues H314, M315, I331, S335, E336, R337, P338, E347, Q350,
E351, I354, E355, K358, T370, T371, F373, A374, K375, L377, S378,
L380, T381, E382, R384, T385 and N388 and BtUSP residues E342,
R383, T386, E387, K391, E414, E425, E429, Y432, A433, E436, S447,
G448, F450, A451, K452, L454, L455, R456, L457, P458, A459, R461,
S462 and L465.
49. The method according to claim 44, wherein the region is the
co-activator/co-repressor binding groove formed by helices H3 and
H4 of the surface of BtEcR defined by residues I232, V235, Q236,
V239, E240, K243, F248, R253, E254, Q256, I257, L260, K261, S264,
S265, M268, S406, F407, L408, E410, I411 and D413.
50-53. (canceled)
54. An isolated nucleic acid molecule comprising a nucleotide
sequence which encodes at least the LBD of BtEcR, wherein the
nucleotide sequence is selected from the group consisting of: (i) a
nucleotide sequence comprising a sequence having at least 90%
identity to the sequence from nucleotide 535 to nucleotide 1248 of
SEQ ID No: 1 or the complementary nucleotide sequence; (ii) a
nucleotide sequence comprising a sequence that hybridises under
high stringency conditions to the sequence from nucleotide 535 to
nucleotide 1248 of SEQ ID No: 1 or the complementary nucleotide
sequence; and (iii) a nucleotide sequence which encodes a
polypeptide comprising the sequence from amino acid P179 to amino
acid S416 of SEQ ID No: 2.
55-59. (canceled)
60. A nucleic acid molecule according to claim 54, wherein the
nucleic acid molecule comprises a nucleotide sequence which encodes
the polypeptide of SEQ ID No:2.
Description
FIELD OF THE INVENTION
[0001] The present invention relates to structural studies of the
functional insect ecdysone receptor. More particularly, the
invention relates to the crystal structure of the whitefly ecdysone
receptor ligand-binding domain, specifically that of Bemisia
tabaci, and uses of the crystal and related structural information
to select and screen for compounds that interact with the receptor.
Moreover, the crystal structure of the present invention can be
used to predict the structure of the ligand-binding pocket of
functional ecdysone receptors from related species and to guide
site-directed mutagenesis of amino acid residues influencing
discrimination between different ligands.
BACKGROUND OF THE INVENTION
[0002] Carroll Williams in the 1960s pointed out that over 99% of
insect species are either innocuous or beneficial from the human
point of view. Some are even indispensable, e.g. bees via their
role in pollination. Approximately 0.1% of insects are actually
pests. Williams suggested that a new generation of safer
insecticides exhibiting specificity for particular pests might be
developed based on the chemistry of the insect's own hormones
(Williams, 1967; Williams, 1967). The levels of the non-peptide
hormones controlling growth and development, 20-hydroxyecdysone and
juvenile hormone, are precisely controlled. Inappropriate levels of
compounds with ecdysteroid or juvenoid activity lead to major
perturbation of insect development and subsequent lethality.
[0003] A problem with this approach, not initially appreciated,
stems from the efficient mechanisms insects possess for clearing
these hormones by metabolic degradation during normal development.
This problem might be overcome by the discovery of compounds
exhibiting high receptor affinities but with different chemistry to
the native hormones and thus not subject to the host's catabolic
pathways.
[0004] The two non-peptide hormones known to play key roles in
regulating insect growth and development are the steroid moulting
hormone, 20-hydroxyecdysone, hereafter referred to as ecdysone, and
the sesquiterpenoid juvenile hormone, hereafter referred to as JH.
JH is responsible for maintaining larval or nymphal states in
moulting insects in addition to a role in adults in the regulation
of reproductive processes. The titre of ecdysone may rise and fall
as many as six or more times during the life cycle of insects,
regulating, for example, the moulting process between larval
instars, the synthesis of new cuticle, the onset of metamorphosis
(after a decline in JH titre) and aspects of vitellogenesis in the
adult ovary. The giant polytene chromosomes seen in the dipteran
Drosophila melanogaster, have given insights into the complexity of
the response to a rise in ecdysone titre at the level of changes in
gene expression. It was postulated by Ashburner and co-workers
(Ashburner et al., 1974) that ecdysone exerts its action in
regulating gene expression via a protein receptor. A few early
responding genes produce further gene transcription regulatory
proteins that transmit the response to a whole bank of late
responding genes; these regulatory proteins can be detected in
action at the late-responding chromosomal loci (Hill et al.,
1993).
[0005] Over the past decade much progress has been made in
understanding the molecular mechanisms underlying the key role of
ecdysone in controlling insect development. This research has been
led by studies involving the combined power of genetics and
molecular biology employing the fly D. melanogaster. Of particular
importance to the present application has been the elucidation of
the nature of the ecdysone receptor. It has been shown to be a
heterodimer made up of the products of two genes called ecr and usp
(Yao et al., 1993). The protein products of these genes, EcR and
USP, are members of the nuclear receptor superfamily. This family
is characterised by an overall structural plan in which a series of
domains impart, in order from the N-terminus: transcriptional
activation (A/B), DNA binding (C), nuclear localisation (so-called
"linker", D) and ligand binding (E/F). The ligand-binding domain
also imparts transactivation in response to the binding of agonist
ligands.
[0006] Both the EcR and USP subunits of ecdysone receptors have
been cloned from a number of insects--see for example (Koelle et
al., 1991; Hannan & Hill, 1997; Hannan & Hill, 2001; Oro et
al., 1990, WO 99/36520, WO 01/02436).
[0007] Despite the considerable interest in JH since the 1960's,
the nature of its receptor has proven more elusive. Research
reported late in 1997 and subsequent publications suggests that
this long-sought-after receptor may also involve USP (Jones &
Sharp, 1997; Sasorith et al., 2002) but this remains controversial.
Even in the absence of precise knowledge of its receptor, JH has
served as a model for intensive programs of chemical synthesis over
three decades leading to a host of diverse molecules that mimic the
activity of the hormone. Some of these have been registered as
insecticides. Recently, three-dimensional structures have been
solved for monomeric ligand-binding domains of USPs from the
lepidopteran Heliothis virescens (Billas et al., 2001) and the
dipteran D. melanogaster (Clayton et al., 2001).
[0008] Until the 1980's, chemical approaches to the development of
ecdysone mimics were hampered by the structural complexity and
synthetic inaccessibility of the steroids for commercial-scale
field applications. However in 1988, Rohm and Haas Company
scientists (Wing et al., 1988; Wing, 1988) reported that a class of
bisacylhydrazine insecticides, which the company had discovered
serendipitously, were acting primarily via interaction with
ecdysone receptors. Members of this class display remarkable
selectivity at the level of orders within the Insecta, for example
RH-5992 is some two to three orders of magnitude more effective
against Lepidotera than it is against Diptera. This difference
correlates with different dissociation constants for interaction of
the compound with ecdysone receptors from the two insect orders
(Dhadialla et al., 1998). Although subsequent studies (Sundaram et
al., 1998) have demonstrated a contribution in some cases by active
transport clearance, there is little doubt that variation in the
structure of the ecdysone receptors per se between different orders
plays a very significant role in underlying the selectivity of
extant insecticides in this class.
[0009] The selectivity of the bisacylhydrazines for the Lepidoptera
and some Coleoptera has both positive and negative connotations. On
the positive side, we see a harbinger of safer, more
environmentally-friendly insecticides targeting a receptor not only
absent from vertebrates but also exhibiting sufficient variation
across the Insecta to allow discrimination between pests and
friendly or innocuous species. On the negative side, the present
relatively narrow spectrum of activity limits sales and also leaves
a significant number of insect orders that cannot be controlled by
safe ecdysone receptor targeting chemistries. Industry has been
trying to extend the spectrum of activity of agents with this mode
of action but with relatively little success.
[0010] Since much of the selectivity of current agents stems from
variations in the structure of the ecdysone receptor, there is a
need in the art for knowledge of the three-dimensional structures
of the ligand-binding domain of ecdysone receptors, not only to
guide the design of new ligand chemistries, but also to introduce
into this design process an understanding of receptor atomic
features underlying selectivity of action.
[0011] Homology modelling based on the known three-dimensional
structures of other nuclear receptor ligand-binding domains,
including those of retinoic acid receptor and vitamin D receptor
(Wurtz et al., 2000) and those of human thyroid hormone receptor
.beta., human estrogen receptor a and human progesterone receptor
(Kasuya et al., 2003), has been employed to predict the structure
of the corresponding domains of ecdysone receptors for ligand
docking studies. Such approaches do not distinguish between
alternative potential three-dimensional protein structures and
alternative orientations for ligand docking.
[0012] Furthermore, ecdysone receptors and their functional domains
are employed as components of ecdysone switches for the control of
therapeutic genes in mammalian cells and for control of transgenes
more generally in agriculturally important species, both animal and
plant. Knowledge of the three-dimensional structure of the
ligand-binding domain of ecdysone receptors should aid in the
design of safer more effective ligands to act as effectors for such
switches and to guide site-directed mutagenesis to change ligand
preferences of the receptors.
[0013] Accordingly, knowledge of the three-dimensional structure
co-ordinates of the ecdysone receptor, and in particular the
ligand-binding pocket of the receptor, would be useful in
facilitating the design of potential selective agonists/antagonists
which, in turn, are expected to have insecticidal activity and to
include potential safe effectors for ecdysone switches.
SUMMARY OF THE INVENTION
[0014] The present inventors have now obtained three-dimensional
structural information concerning the functional ligand-binding
domain of the ecdysone receptor of Bemisia tabaci (silverleaf
whitefly). The functional B. tabaci ecdysone receptor is a
heterodimeric receptor comprising ecdysone receptor subunit protein
(BtEcR) and ultraspiracle subunit protein (BtUSP). The BtUSP
partner protein associates with the BtEcR receptor protein to
confer greatly enhanced affinity for insect steroids or analogues
thereof. Compounds that typically modulate the activity of the
ecdysone receptor include 20-hydroxyecdysone (henceforth referred
to as "ecdysone"), ponasterone A, muristerone A, analogues of an
ecdysteroid or certain non-steroidal ecdysone receptor agonists or
antagonists, including for example those having dibenzoyl hydrazine
chemistries.
[0015] The information presented in this application can be used to
predict the structure of related members of the ecdysone receptor
family from other species as well as to select and/or design
compounds which interact with the B. tabaci ecdysone receptor and
other ecdysone receptors for use as insecticidally-active
agents.
[0016] In the remainder of this application the term "ecdysone
receptor" is used to denote the functional EcR/USP heterodimer
receptor and the subunits are referred to as EcR and USP.
Specifically the subunits from B. tabaci are referred to as BtEcR
and BtUSP. The term ligand-binding domain will be abbreviated to
LBD.
[0017] Accordingly, in a first aspect the present invention
consists in a crystalline composition comprising BtEcR/BtUSP
heterodimer LBD or portion thereof, or a crystalline composition
comprising BtEcR/BtUSP heterodimer LBD or portion thereof
co-crystallized with a ligand.
[0018] In a second aspect the present invention provides a method
of selecting or designing a compound that interacts with an
ecdysone receptor and modulates an activity mediated by the
receptor, the method comprising the step of assessing the
stereochemical complementarity between the compound and a
topographic region of the BtEcR/BtUSP heterodimer LBD, wherein the
heterodimer LBD is characterised by [0019] (a) amino acids 179-415
of the BtEcR monomer and amino adds 300-492 of the BtUSP monomer
positioned at atomic coordinates as shown in Appendix I, or
structural coordinates wherein the backbone atoms of each monomer
has a root mean square deviation from the backbone atoms of their
corresponding partners in either amino adds 179-415 of the BtEcR
monomer or amino adds 300-492 of the BtUSP monomer of not more than
1.5 .ANG.; or [0020] (b) one or more subsets of said amino adds
related to the coordinates of the monomers shown in Appendix I by
whole body translations and/or rotations.
[0021] By "stereochemical complementarity" we mean that the
compound or a portion thereof makes a sufficient number of
energetically favourable contacts with the receptor, or topographic
region thereof, as to have a net reduction of free energy on
binding to the receptor, or topographic region thereof.
[0022] Stereochemical complementarity or how well a given chemical
compound structure binds or fits to a specified site or cavity in
the protein structure can be measured by using one or more of the
scoring functions available for this purpose. (See for example P.
Ferrara, H. Gohlke, D. J. Price, G. Klebe, and C. L. Brooks III,
Assessing scoring functions for protein-ligand interactions, J.
Med. Chem., vol. 47, 3032-3047(2004).) A specific example of such a
scoring function is X-SCORE (R. Wang, L. Lai, S. Wang, Further
development and validation of empirical scoring functions for
structure-based binding affinity prediction, J. Comput.-Aided Mol.
Des., vol. 16, 11-26(2002)), which is a scoring function that
calculates the dissociation constant of a given protein-ligand
complex, and was constructed by calibrating to experimental data on
a set of 200 protein-ligand complexes.
[0023] By "topographic region" is meant a subset of the molecular
surface (Connolly, 1983) of the BtEcR LBD alone, the BtUSP LBD
alone or the BtEcR/BtUSP heterodimer LBD. This subset may consist
of either a single region or multiple disjoint regions. In this
context the surface of enclosed cavities within the BtEcR/BtUSP
heterodimer LBD or its constituent partners is also treated as part
of the molecular surface.
[0024] In a third aspect the present invention provides a
computer-assisted method for identifying potential compounds able
to interact with an ecdysone receptor and thereby modulate an
activity mediated by the receptor, using a programmed computer
comprising a processor, an input device, and an output device,
comprising the steps of: [0025] (a) inputting into the programmed
computer, through the input device, data comprising the atomic
coordinates of amino adds 179-415 of the BtEcR monomer and amino
adds 300-492 of the BtUSP monomer and ponasterone A positioned at
atomic coordinates as shown in Appendix I, or structural
coordinates wherein the backbone atoms of each monomer has a root
mean square deviation from the backbone atoms of their
corresponding partners in either amino acids 179-415 of the BtEcR
monomer or amino acids 300-492 of the BtUSP monomer of not more
than 1.5 .ANG., or one or more subsets of said amino acids, or one
or more subsets of said amino acids related to the coordinates
shown in Appendix I by whole body translations and/or rotations;
[0026] (b) generating, using computer methods, a set of atomic
coordinates of a structure that possesses stereochemical
complementarity to the atomic coordinates of amino acids 179-415 of
the BtEcR monomer and/or amino acids 300-492 of the BtUSP monomer
positioned at atomic coordinates as shown in Appendix I, or
structural coordinates having a root mean square deviation from the
backbone atoms of their corresponding partners in either amino
acids 179-415 of the BtEcR monomer or amino acids 300-492 of the
BtUSP monomer of not more than 1.5 .ANG., or one or more subsets of
said amino adds, or one or more subsets of said amino adds related
to the coordinates shown in Appendix I by whole body translations
and/or rotations, thereby generating a criteria data set; [0027]
(c) comparing, using the processor, the criteria data set to a
computer database of chemical structures; [0028] (d) selecting from
the database, using computer methods, chemical structures which are
similar to a portion of said criteria data set; and [0029] (e)
outputting, to the output device, the selected chemical structures
which are complementary to or similar to a portion of the criteria
data set.
[0030] In a fourth aspect the present invention provides a computer
for producing a three-dimensional representation of a molecule or
molecular complex, wherein the computer comprises: [0031] (a) a
machine-readable data storage medium comprising a data storage
material encoded with machine-readable data, wherein the machine
readable data comprises the atomic coordinates of amino acids
179-415 of the BtEcR monomer and amino acids 300-492 of the BtUSP
monomer and ponasterone A as shown in Appendix I, or structural
coordinates wherein the backbone atoms of each monomer has a root
mean square deviation from the backbone atoms of their
corresponding partners in either amino acids 179-415 of the BtEcR
monomer or amino acids 300-492 of the BtUSP monomer of not more
than 1.5 .ANG., or one or more subsets of said amino acids, or one
or more subsets of said amino acids related to the coordinates
shown in Appendix I by whole body translations and/or rotations;
[0032] (b) a working memory for storing instructions for processing
the machine-readable data; [0033] (c) a central-processing unit
coupled to the working memory and to the machine-readable data
storage medium, for processing the machine-readable data into the
three dimensional representation; and [0034] (d) an output hardware
coupled to the central processing unit, for receiving the
three-dimensional representation.
[0035] In a fifth aspect the present invention provides a compound
able to modulate an activity mediated by an ecdysone receptor, the
compound being obtained by a method according to the present
invention.
[0036] In a sixth aspect the present invention provides a compound
which possesses stereochemical complementarity to a topographic
region of the BtEcR/BtUSP heterodimer LBD and which modulates an
activity mediated by the receptor, wherein the heterodimer is
characterised by [0037] (a) amino acids 179-415 of the BtEcR
monomer and amino acids 300-492 of the BtUSP monomer positioned at
atomic coordinates as shown in Appendix I, or structural
coordinates wherein the backbone atoms of each monomer has a root
mean square deviation from the backbone atoms of their
corresponding partners in either amino acids 179-415 of the BtEcR
monomer or amino acids 300-415 of the BtUSP monomer of not more
than 1.5 .ANG.; or [0038] (b) one or more subsets of said amino
acids related to the coordinates of the monomers shown in Appendix
I by whole body translations and/or rotations; with the proviso
that the compound is not a naturally occurring ligand of a molecule
of the B. tabaci ecdysone receptor.
[0039] In a seventh aspect, the present invention provides an
insecticidal composition for control of insects which comprises a
compound according to the fifth or sixth aspects of the present
invention and a pharmaceutically acceptable carrier or diluent.
[0040] In yet another aspect, the present invention provides a
method for evaluating the ability of a chemical entity to interact
with an ecdysone receptor LBD, said method comprising the steps of:
[0041] (a) creating a computer model of at least one region of the
BtEcR/BtUSP heterodimer LBD using structure coordinates wherein the
root mean square deviation between the backbone atoms of the (i)
the BtEcR component of the model and the corresponding structure
coordinates of amino acids 179-415 of the BtEcR monomer or (ii) the
BtUSP component of the model and the corresponding structure
coordinates of amino acids 300-492 of the BtUSP monomer as set
forth in Appendix I, are not more than 1.5 .ANG.; [0042] (b)
employing computational means to perform a fitting operation
between the chemical entity and said computer model of at least one
region of the monomers of the BtEcR/BtUSP heterodimer LBD; and
[0043] (c) analysing the results of said fitting operation to
quantify the association between the chemical entity and at least
one region of the BtEcR/BtUSP heterodimer LBD model.
[0044] In another aspect the present invention consists in a method
of assessing the interaction between a compound and the BtEcR/BtUSP
heterodimer LBD, the method comprising exposing a crystalline
composition comprising BtEcR/BtUSP heterodimer LBD or portion
thereof or variant of these to the compound and measuring the level
of binding of the compound to the crystal.
[0045] As will be readily understood by persons skilled in this
field, the methods of the present invention provide a rational
method for designing and selecting compounds which interact with an
ecdysone receptor and specifically that of B. tabaci. In the
majority of cases these compounds will require further development
in order to increase activity. Such further development is routine
in this field and will be assisted by the structural information
provided in this application and screens employing EcR and
optionally USP nucleotide and/or polypeptide sequences. In vitro
competitive binding screens compete unlabelled test compounds
against a labelled ligand (tracer) to observe if they inhibit the
binding of the latter to functional receptor LBDs. In vitro
competition binding screens may utilise LBD sequences or D (linker)
domain sequences linked to LBD sequences. In vivo cell-based
screens employ full-length EcR and optionally full-length USP
nucleotide sequences functionally linked to suitable promoters for
expression in mammalian, insect or yeast cells containing a
suitable reporter gene construct. Alternatively, in vivo cell-based
screens may employ the EF or DEF domain encoding regions of EcR and
optionally of USP nucleotide sequences functionally linked to
nucleotide sequences encoding domains from other transcription
factors. In particular, the BtEcR nucleotide sequence (SEQ ID NO 1)
and/or polypeptide sequence (SEQ ID NO 2) and optionally BtUSP
nucleotide sequence and/or polypeptide sequence or the
corresponding EF or DEF domains may be utilised in screens to
develop improved compounds derived by rational design employing the
B. tabaci EcR/USP crystal structure. It is intended that in
particular embodiments the methods of the present invention
includes such further developmental steps.
[0046] In yet a further aspect, the invention provides a method of
utilizing molecular replacement to obtain structural information
about a molecule or a molecular complex of unknown structure,
comprising the steps of: [0047] (a) crystallising said molecule or
molecular complex; [0048] (b) collecting an X-ray diffraction data
set from said crystallized molecule or molecular complex; [0049]
(c) applying at least a portion of the structure coordinates set
forth in Appendix I to the X-ray diffraction data set to generate a
three-dimensional electron density map of at least a portion of the
molecule or molecular complex whose structure is unknown. The term
"molecular replacement" refers to a method that involves generating
a preliminary model of an ecdysone receptor crystal whose structure
coordinates are unknown, by orienting and positioning a molecule
whose structure coordinates are known (e.g., BtEcR/BtUSP
heterodimer LBD coordinates from Appendix I) within the unit cell
of the unknown crystal so as best to account for the observed
diffraction pattern of the unknown crystal. Phases can then be
calculated from this model and combined with the observed
amplitudes to give an approximate Fourier synthesis of the
structure whose coordinates are unknown. This, in turn, can be
subject to any of the several forms of refinement to provide a
final, accurate structure of the unknown crystal (Lattman, 1985;
Rossmann, 1990).
[0050] As will be clear from the following discussion the present
inventors have also isolated a nucleic add molecule encoding the
BtEcR.
[0051] Accordingly, in a further aspect the present invention
provides an isolated nucleic acid molecule comprising a nucleotide
sequence which encodes at least the LBD of BtEcR, wherein the
nucleotide sequence is selected from the group consisting of:
[0052] (i) a nucleotide sequence comprising a sequence having at
least 90% identity to the sequence from nucleotide 535 to
nucleotide 1248 of SEQ ID NO: 1 or the complementary nucleotide
sequence; [0053] (ii) a nucleotide sequence comprising a sequence
that hybridises under high stringency conditions to the sequence
from nucleotide 535 to nucleotide 1248 of SEQ ID NO: 1 or the
complementary nucleotide sequence; and [0054] (iii) a nucleotide
sequence which encodes a polypeptide comprising the sequence from
amino acid P179 to amino acid S416 of SEQ ID NO: 2.
BRIEF DESCRIPTION OF THE FIGURES
[0055] FIG. 1 Schematic diagram of the structure of the BtEcR/BtUSP
heterodimer LBD with bound ponasterone A shown in the binding
pocket. The BtEcR LBD is shown in grey, whilst the BtUSP LBD is in
black. Individual helices are shown as cylinders and individual
.beta.-strands as arrows. The N- and C-terminii of each molecule
are labelled. Ponasterone A is shown in black with its oxygen atoms
in white. Helix 3 of the BtEcR LBD is rendered transparent in order
to enable viewing of the ponasterone A moeity. The surface of the
binding pocket itself is shown in transparent grey.
[0056] FIG. 2 View of the extended ecdysteroid binding pocket,
showing the surface of the pocket, bound ponasterone A and all
residues that form the walls of the pocket. The pocket is separated
into two parts for clarity--the entire pocket can be re-generated
by rotating the lower image about a vertical axis running in the
plane of the paper and placing it on top of the upper image.
Ponasterone A is shown in black as a "thick" stick representation
in both images with its oxygen atoms represented by black balls.
Surrounding residues that form the cavity are labelled and are
shown as "thin" grey sticks if they are totally conserved across
all species, else they are shown as "thin" black sticks. Individual
atoms within residues are rendered as follows--nitrogen: small
balls, oxygen: medium balls and sulphur: large balls. Again for
clarity, side chain or alternatively backbone atoms are omitted for
individual residues if these groups of atoms do not form any part
of the cavity wall. Hydrogen bonds between individual protein
residues and ponasterone A are shown as black dotted lines. The
molecular surface of the binding pocket is shown in transparent
grey.
[0057] FIG. 3 Stick/CPK diagram of the BtEcR LBD
co-activator/co-repressor binding groove (without H12) with
individual residues labelled. All atoms from residues 231 to 265
are rendered as transparent CPK and a C.alpha. trace to delineate
the groove. Individual residues with putatively capable of
interaction with co-activator/co-repressor proteins are rendered in
black stick format, with nitrogen atoms as small grey balls and
oxygen atoms as large grey balls.
[0058] FIG. 4 An analysis of freshly-prepared recombinant BtEcR LBD
samples by 12% SDS-PAGE, with staining by Coomassie Blue. Samples
were boiled in the presence of 5% (v/v) 2-mercaptoethanol before
loading. M: marker proteins, with molecular masses shown in
kilodaltons (kDa). Lane 1: Immobilised metal-ion affinity
chromatography (IMAC) eluate, showing recombinant BtEcR and BtUSP
LBDs (major doublet) and many additional bands (contaminating
proteins). Lane 2: Concentrated gel filtration eluate, showing
BtEcR and BtUSP LBD's (main doublet) with relatively few
contaminating proteins.
[0059] FIG. 5 Residues defining the terminal end of the major
pocket. The Van der Waals surface for the binding pocket in this
region is shown as a smooth grey surface to the right.
Space-filling representation of ponasterone A in the X-ray
structure of the ligand-receptor complex. The smooth grey surface
to the right represents the Van der Waals surface of the binding
pocket in the region near the alkyl chain of the ecdysteroid.
[0060] FIG. 6 Highly-ranked FlexX docking of ponasterone A
superimposed on the X-ray structure of ponasterone A bound into the
EcR. The dark grey structure represents the x-ray orientation of
ponasterone A and the light grey structure represents one of the
FlexX poses for ponasterone A. The ability of FlexX to dock a
ligand into the receptor can be assessed by the high similarity of
the ponasterone A orientation from docking to that in the X-ray
model.
[0061] FIG. 7 Highly-ranked FlexX docking pose for compound III.
The thiophene ring extends into the lipophilic end of the receptor
pocket, in the region where the C25 end of ponasterone A binds. The
cyclic ester is able to make hydrogen bonds with Asn390 and the
ring nitrogen form a hydrogen bond with Thr231. The phenyl ring
lies in the same position as that of the C/D rings of ponasterone
A.
[0062] FIG. 8 Overlay of the hemipteran B. tabaci and lepidopteran
H virescens ecdysone receptor LBD ponasterone A bound pockets and
superposition of ligands. The HvEcR 1R1K (ponasterone A containing)
and HvEcR 1R20 (synthetic agonist BYI06830 containing) LBDs were
aligned to the BtEcR (ponasterone A containing) LBD by least
squares alignment of the protein C.alpha. backbone atoms. The
ligand agonists are shown in ball and stick format with the BTECR
ponasterone A in "thick" black sticks, the HvEcR 1R1K ponasterone A
in "thick" grey sticks and, the HvEcR 1R20 BYI06830 in "thin" grey
sticks. The carbon atoms are rendered in black, the oxygen atoms in
grey and the nitrogen atoms in white. The BtEcR ponasterone A bound
pocket is shown as a transparent pale grey surface and the HvEcR
1R1K ponasterone A bound pocket surface shown in transparent dark
grey. (For clarity, the surface of the BY106830 bound pocket is not
depicted in the figure.) A pronounced bulge, absent from the BtEcR
ponasterone A bound pocket, is apparent in the HvEcR ponasterone A
bound pocket at top left.
DETAILED DESCRIPTION
[0063] The present inventors have doned BtEcR and BtUSP and
expressed, crystallised and determined the three-dimensional
structure of the BtEcR/BtUSP heterodimer LBD of the ecdysone
receptor from Bemisia tabaci.
[0064] The fold of BtEcR LBD is that of a canonical nuclear hormone
receptor. The secondary structure elements of BtUSP/BtEcR LBD
discerned in this structure are located within the BTECR sequence
as follows: helix H1--residues 182 to 198, helix H2--residues 202
to 211, helix H3--residues 220 to 244, helix H4--residues 252 to
264, helix H5--residues 267 to 275, strand s0--residues 275 to 277,
strand s1--residues 282 to 285, strand s2--residues 288 to 291,
helix H6--residues 292 to 300, helix H7--residues 304 to 319, helix
H8--residues 321 to 334, helix H9--residues 342 to 364, helix
H10--residues 368 to 400 and helix H12--residues 405 to 413. Thus,
the structure of BtEcR LBD comprises .alpha.-helices H1 to H10 and
H12, and .beta.-strands s1 and s2 located between helices H5 and
H6, as shown in FIG. 1. An additional short .beta.-strand (labelled
here as s0) lies between helix H5 and strand s1. Helix H12 in BtEcR
is observed in the so-called agonist conformation (Renaud &
Moras, 2000).
[0065] The structure of the BtEcR LBD was compared with those
available for other nuclear receptors. The closest structural
neighbour was the LBD of retinoic acid receptor (RAR). The
root-mean-square deviation of 206 (out of 237) corresponding
backbone C.sup..alpha. atoms between the BtEcR structure and that
of RAR-.gamma.2 (RCSB id: 1EXA) is 1.29 .ANG.. The major difference
between these structures lies in the conformation of the loop
between helices H1 and H3. In RAR this loop has a random coil
conformation and lies across the outer surface of the s1-s2
.beta.-sheet loop. In EcR the segment contains an intact helix H2
which packs anti-parallel on the N-terminal portion of helix H3 and
interacts with the opposite surface of the s1-s2 .beta.-sheet
loop.
[0066] The ligand ponasterone A was observed to lie in a
totally-enclosed pocket formed by residues F194, Q195, N196, Y198,
E199, H200, P201, H226, I227, T228, I230, T231, L233, T234, L237,
I238, F241, S242, V267, M268, M269, F270, R271, M272, R274, R275,
I283, L284, F285, A286, Y296, M301, T304, L308, Y325, A326, T329,
1333, M389, N390, T393, C394, L397, V404, P405, L408 and W412 (FIG.
2). The pocket has a "J-shaped" architecture, with the major part
(the leg of the "J") accommodating the ligand, plus an ancillary
part (the curved tail of the "J") existing as an extension of the
major part via a narrow channel. The inner wall of the channel
linking the major and ancillary parts of the pocket is formed by
the side chain of residue R271. The accessible volume of the entire
cavity is approximately 766 .ANG..sup.3, whilst the volume of the
ponasterone A itself is 434 .ANG..sup.3, both figures calculated
using VOIDOO (Kleywegt & Jones, 1994). The ancillary cavity
appears unoccupied in the structure presented here. The narrowness
of channel connecting the major and ancillary parts of the pocket
suggests that it in some dynamic states of the protein these two
parts may become disjoint rather than forming a single topological
entity.
[0067] Potential hydrogen bonds between individual protein atoms
and ligand are as follows: A286 N to the ponasterone A hydroxyl at
C-6, T234 O.sup..gamma.1 to the ponasterone A hydroxyl at C-14,
T231 O.sup..gamma.1 to the ponasterone A hydroxyl at C-14, R271 NH1
to the ponasterone A hydroxyl at C-2, E199 O to the ponasterone A
hydroxyl at C-2, E199 O to the ponasterone A hydroxyl at C-3, Y296
OH to the ponasterone A hydroxyl at C-20 (FIG. 2). The remainder of
the contacts between ligands and protein are overwhelmingly
hydrophobic in nature and formed by contacts between the side
chains of residues P201, I227, T228, I230, M268, M269, R271, M272,
R275, 1283, F285, A286, M301, L308, M389, L397, P405, L408 and W412
and the ligand.
[0068] Helix H12 was observed to lie in the so-called agonistic
conformation (Renaud & Moras, 2000) possibly locking the ligand
into the site via the side chain of W412 which hangs into the
ligand-binding site. A salt bridge between BtEcR residues D413 and
K261 appears to stabilize the C-terminus of H12. In this
conformation a co-activator can bind to a site that includes H12
and the surface of the hydrophobic cleft between helices H3 and H4.
The molecular detail of this cleft is presented in FIG. 3. Side
chains forming the cleft and its immediate surrounds include those
of residues I232, V235, Q236, V239, E240, K243, F248, R253, E254,
Q256, I257, L260, K261, S264, and residues S406, F407, L408, E410,
I411 and D413 of H12. Excluding H12, this groove is totally
conserved across all ecdysone receptor sequences except for R253.
This residue lies at the distal end of the binding groove (with
respect to the position of H12 shown in this structure) and it is
unclear at this stage whether or not its side chain interacts
directly with the co-repressor or co-activator upon binding of
these elements.
[0069] The structure of the BtUSP protein resembles that of other
published USP structures (Billas et al., 2001; Clayton et al.,
2001), but with the following major difference. No electron density
was visible for residues prior to V300, i.e. helix H1, and part of
the loop connecting H1 to H3 are totally unobserved. Part of the
volume occupied by these structural elements in other USP
structures is now occupied by the H10-H12 loop. H12 lies in the
so-called antagonistic conformation (Renaud & Moras, 2000)
whilst the helix H11 appears not to be formed. No ligand was
observed in the site corresponding to that occupied by phospholipid
in the two above published structures, and indeed part of that
binding site is now occluded by a repositioning of the H10-H12
loop, and by a repositioning of helix H6 and residues immediately
adjacent to this element (residues 371 to 384). The repositioning
of the H10-H12 loop likely arises from the absence of residues
prior to H3 in our structure, allowing this element to collapse
into the region normally occupied by the H1-H3 loop in the intact
USP ligand-binding domains. Part of the movement of the H10-H12
loop may be caused by the involvement of that loop in a crystal
contact with a neighbouring molecule in our structure.
Alternatively the observed conformation of the H10-H12 loop may be
adopted in solution as well in view of the absence of H1. The
secondary structure elements of BtUSP/BtEcR LBD discerned in this
structure are located within the BtUSP sequence as follows: helix
H3--residues 301 to 321, helix H4--residues 328 to 339, helix
H5--residues 340 to 353, strand s1 residues 359 to 361, strand
s2--residues 365 to 367, helix H6--residues 371 to 376, helix
H7--residues 380 to 396, helix H8--residues 399 to 411, helix
H9--residues 420 to 443, helix H10--residues 448 to 466 and helix
H12--residues 481 to 491.
[0070] The dimeric association between BtEcR and BtUSP
ligand-binding domains resembles that of the corresponding RAR-RXR
complex. These two heterodimeric structures can be overlaid with an
root-mean-square deviation of 1.37 .ANG. for 339 matched
C.sup..alpha. atoms. The interface is formed by EcR residues
contained in H9, H10 and the loop between H8 and H9 on one hand and
USP residues contained in H7, H9, H10 and the loop between H6 and
H7 on the other (see Table 5). Residues involved in the interface
include BtEcR residues H314, M315, I331, S335, E336, R337, P338,
E347, Q350, E351, I354, E355, K358, T370, T371, F373, A374, K375,
L377, S378, L380, T381, E382, R384, T385 and N388 on one hand and
BtUSP residues E342, R383, T386, E387, K391, E414, E425, E429,
Y432, A433, E436, S447, G448, F450, A451, K452, L454, L455, R456,
L457, P458, A459, R461, S462 and L465 on the other. The interface
was estimated by computing all residues with any atom's van der
Waals surface within 1.4 .ANG. of that of any atom of the opposite
chain followed by visual inspection.
[0071] Potential inter-chain salt bridges include those from USP
E429 to EcR K375, USP K391 to EcR E336, USP K391 to EcR E347, USP
K452 to EcR E351 and USP E425 to EcR K375. Out of these, only the
salt bridge between EcR E347 and USP K391 is conserved across all
species (although the Dipteran, Chironomus tentans EcR has Asp at
the position corresponding to E347 in BtEcR), and compounds which
bind to the interface and disrupt a particular salt bridge could be
the basis of specific antagonists.
[0072] Hydrogen bonds occur between the side chains of USP S447 and
the side chain of EcR E355A, between the backbone carbonyl of USP
S447 and the side chain of EcR K358 and between the side chains of
EcR R384 and USP S462. The remainder of the contacts are
hydrophobic in nature. A single phosphate ion is included in the
interface, coordinated by the side chains of the EcR residue R384,
the carbonyl oxygen of EcR residue E336 and the side chains of USP
residues R383, B387 and R456.
[0073] PASS (Brady & Stouten, 2000) shows the existence of a
pocket on the BtEcR surface on the edge of the heterodimeric
interface bounded by residues including A262, S265, E266, R337,
R384, G387, N388 and S391 of BtEcR. PASS also shows the existence
of a pocket on the BtUSP surface on the edge of the heterodimeric
interface bounded by residues including K337, S338, N341, E342,
K416, G464, L465, C467 and H470 of BtUSP.
[0074] Clearly the information provided in this application will
enable rational design/selection of compounds which will interact
with the ecdysone receptor.
[0075] Accordingly, in a first aspect the present invention
consists in a crystalline composition comprising BtEcR/BtUSP
heterodirner LBD or portion thereof, or a crystalline composition
comprising BtEcR/BtUSP heterodimer LBD or portion thereof
co-crystallized with a ligand.
[0076] In a second aspect the present invention provides a method
of selecting or designing a compound that interacts with an
ecdysone receptor and modulates an activity mediated by the
receptor, the method comprising the step of assessing the
stereochemical complementarity between the compound and a
topographic region of the BtEcR/BtUSP heterodimer LBD, wherein the
heterodimer is characterised by [0077] (a) amino acids 179-415 of
the BtEcR monomer and amino adds 300-492 of the BtUSP monomer
positioned at atomic coordinates as shown in Appendix I, or
structural coordinates wherein the backbone atoms of each monomer
has a root mean square deviation from the backbone atoms of their
corresponding partners in either amino acids 179-415 of the BtEcR
monomer or amino adds 300-492 of the BtUSP monomer of not more than
1.5 .ANG.; or [0078] (b) one or more subsets of said amino adds
related to the coordinates of the monomers shown in Appendix I by
whole body translations and/or rotations.
[0079] In a preferred embodiment of this aspect of the invention
the structural coordinates have a root mean square deviation from
the backbone atoms of said amino acids of not more than 1.0 .ANG.,
and more preferably not more than 0.7 .ANG..
[0080] As discussed above the ligand ponasterone A was observed to
lie in a totally-enclosed pocket formed by residues F194, Q195,
N196, Y198, E199, H200, P201, H226, I227, T228, I230, T231, L233,
T234, L237, I238, F241, S242, V267, M268, M269, F270, R271, M272,
R274, R275, I283, L284, F285, A286, Y296, M301, T304, L308, Y325,
A326, T329, I333, M389, N390, T393, C394, L397, V404, P405, L408
and W412. Accordingly, in one embodiment of the second aspect, the
topographic region of the ecdysone receptor to which the compound,
or a portion thereof has stereochemical complementarity is the
ligand-binding pocket of the BtEcR subunit defined by amino acids
F194, Q195, N196, Y198, E199, H200, P201, H226, I227, T228, I230,
T231, L233, T234, L237, I238, F241, S242, V267, M268, M269, F270,
R271, M272, R274, R275, I283, L284, F285, A286, Y296, M301, T304,
L308, Y325, A326, T329, I333, M389, N390, T393, C394, L397, V404,
P405, L408 and W412.
[0081] In another embodiment of the second aspect, the topographic
region of the ecdysone receptor to which the compound, or a portion
thereof has stereochemical complementarity is the interface between
the BtEcR and BtUSP subunits defined by BtEcR residues H314, M315,
I331, S335, E336, R337, P338, E347, Q350, E351, I354, E355, K358,
T370, T371, P373, A374, K375, L377, S378, L380, T381, E382, R384,
T385 and N388 on one hand and BtUSP residues E342, R383, T386,
E387, K391, E414, E425, E429, Y432, A433, E436, S447, G448, F450,
A451, K452, L454, L455, R456, L457, P458, A459, R461, S462 and L465
on the other. in a still further embodiment of the second aspect,
the topographic region of the ecdysone receptor to which the
compound, or a portion thereof has stereochemical complementarity
is the co-activator/ co-repressor binding groove formed by helices
H3 and H4 on the surface of BtEcR defined by residues I232, V235,
Q236, V239, E240, K243, F248, R253, E254, Q256, I257, L260, K261,
S264, S265, M268, S406, P407, L408, E410, I411 and D413. By
"stereochemical complementarity" we mean that the compound or a
portion thereof makes a sufficient number of energetically
favourable contacts with the receptor, or topographic region
thereof, as to have a net reduction of free energy on binding to
the receptor, or topographic region thereof.
[0082] In the preferred embodiment of the second aspect of the
present invention, the method comprises selecting a compound which
has portions that match residues positioned in the topographic
region of the receptor defined by the specified amino add
residues.
[0083] By "match" we mean that the identified portions interact
with the surface residues, for example, via hydrogen bonding or by
enthalpy-reducing Van der Waals interactions which promote
desolvation of the biologically active compound with the receptor,
in such a way that retention of the compound by the receptor is
favoured energetically.
[0084] Preferably, the method comprises selecting a compound which
forms hydrogen bonds with at least one amino acid residue selected
from the group consisting of E199, I227, T231, T234, R271, A286,
Y296, T304, N390 and C394 of the ligand-binding pocket of the BtEcR
LBD, wherein the compound is not a naturally-occurring ecdysteroid
ligand of the ligand-binding pocket of the receptor.
[0085] Still more preferably, the method comprises selecting a
compound which further forms hydrophobic contacts with the side
chains of at least one amino acid residue selected from the group
consisting of P201, I227, T228, I230, M268, M269, R271, M272, R275,
I283, F285, A286, M301, L308, M389, L397, P405, L408 and W412 of
the ligand-binding pocket of the BtEcR subunit, wherein the
compound is not the natural ligand of the ligand-binding pocket of
the receptor.
[0086] In another embodiment crystals of the unliganded EcR/USP
heterodimer are exposed to libraries of compounds according to the
method of (Nienaber et al., 2000). The most potent ligand will bind
preferentially to the crystal and can be identified by difference
electron density maps.
[0087] In a still further embodiment of the second aspect, the
method comprises selecting a compound which is an antagonist of the
B. tabaci ecdysone receptor.
[0088] Alternatively, the method comprises selecting a compound
which is an agonist of the B. tabaci ecdysone receptor.
[0089] It is anticipated that modulation of the activity of the B.
tabaci ecdysone receptor may be achieved by a number of different
means.
[0090] The compound may bind to the receptor so as to interfere
sterically or allosterically with natural steroid ligand binding.
For example. [0091] (a) The compound may bind to the BtEcR
ligand-binding pocket of the receptor such as to decrease the size
of the ligand-binding pocket thereby preventing access of the
ligand to one or more of the specified residues critical for
receptor activity. [0092] (b) The compound may bind at or near the
interface between the BtEcR and BtUSP association interface to
thereby perturb the subunit association for the signalling
competent ligand-receptor complex. [0093] (c) The compound may bind
at a site remote from the BtEcR ligand-binding pocket but disturb
the receptor structure so as to modulate the affinity of
ligand-binding.
[0094] The compound may interfere with association of the BtEcR and
BtUSP subunits of the ecdysone receptor in a number of ways. For
example, the compound may bind to the B. tabaci ecdysone receptor
at or near one or more of the specified residues of the association
interface and by steric overlap and/or electrostatic repulsion
prevent association. Alternatively, the compound may bind so as to
interfere allosterically with association of the subunits. In
addition, the compound may bind to the BtUSP subunit so as to alter
the association of the subunits and thereby modulate the affinity
of the BtEcR subunit for the natural ligand.
[0095] In the preferred form, the compound is selected or designed
to interact with the B. tabaci ecdysone receptor in a manner such
as to interfere with the association of the BtEcR and BtUSP
subunits by inhibiting the association of BtEcR residues H314,
M315, I331, S335, E336, R337, P338, E347, Q350, E351, I354, E355,
K358, T370, T371, F373, A374, K375, L377, S378, V379, L380, T381,
E382, R384, T385 and N388 on one hand and BtUSP residues E342,
R383, T386, E387, K391, I408, V409, E414, E425, R428, E429, Y432,
A433, E436, S447, G448, F450, A451, K452, L454, L455, R456, L457,
A459, R461, S462 and L465 on the other.
[0096] In another preferred form the compound may bind to the
receptor so as to interfere with signalling of the receptor. For
example, the compound may be selected or modified from a known
compound (such as the natural ligand), or identified from a data
base. It would be expected that such a variant would compete with
binding of the natural ligand to the receptor.
[0097] In another preferred embodiment the compound is selected or
designed based on the natural ligand, the compound being designed
or selected such that it interacts with at least one amino add
selected from the group consisting of F194, Q195, N196, Y198, E199,
H200, P201, H226, I227, T228, I230, T231, L233, T234, L237, I238,
F241, S242, V267, M268, M269, F270, R271, M272, R274, R275, I283,
L284, F285, A286, Y296, M301, T304, L308, Y325, A326, T329, I333,
M389, N390, T393, C394, L397, V404, P405, L408 and W412. In a
preferred embodiment, the compound is selected or designed such
that the interaction between the compound and the B. tabaci
ecdysone receptor is preferred over the interaction of the natural
ligand with the B. tabaci ecdysone receptor. Such compounds may be
agonists or antagonists of receptor activity.
[0098] In a preferred embodiment of the second aspect the method
further comprises the step of obtaining a compound which possesses
stereochemical complementarity to a topographic region of the
BtEcR/BtUSP heterodimer LBD and testing the compound for
insecticidal activity.
[0099] In a third aspect the present invention provides a
computer-assisted method for identifying potential compounds able
to interact with an ecdysone receptor and thereby modulate an
activity mediated by the receptor, using a programmed computer
comprising a processor, an input device, and an output device,
comprising the steps of: [0100] (a) inputting into the programmed
computer, through the input device, data comprising the atomic
coordinates of amino acids 179-415 of the BtEcR monomer and amino
acids 300-492 of the BtUSP monomer and ponasterone A positioned at
atomic coordinates as shown in Appendix I, or structural
coordinates wherein the backbone atoms of each monomer has a root
mean square deviation from the backbone atoms of their
corresponding partners in either amino adds 179-415 of the BtEcR
monomer or amino acids 300-492 of the BtUSP monomer of not more
than 1.5 .ANG., or one or more subsets of said amino acids, or one
or more subsets of said amino acids related to the coordinates
shown in Appendix I by whole body translations and/or rotations;
[0101] (b) generating, using computer methods, a set of atomic
coordinates of a structure that possesses stereochemical
complementarity to the atomic coordinates of amino acids 179-415 of
the BtEcR monomer and/or amino acids 300-492 of the BtUSP monomer
positioned at atomic coordinates as shown in Appendix I, or
structural coordinates having a root mean square deviation from the
backbone atoms of their corresponding partners in either amino adds
179-415 of the BtEcR monomer or amino adds 300-492 of the BtUSP
monomer of not more than 1.5 .ANG., or one or more subsets of said
amino acids, or one or more subsets of said amino acids related to
the coordinates shown in Appendix I by whole body translations
and/or rotations, thereby generating a criteria data set; [0102]
(c) comparing, using the processor, the criteria data set to a
computer database of chemical structures; [0103] (d) selecting from
the database, using computer methods, chemical structures which are
similar to a portion of said criteria data set; and [0104] (e)
outputting, to the output device, the selected chemical structures
which are complementary to or similar to a portion of the criteria
data set.
[0105] In a preferred embodiment of this aspect of the invention
the structural coordinates have a root mean square deviation from
the backbone atoms of said amino adds of not more than 1.0 .ANG.,
and more preferably not more than 0.7 .ANG..
[0106] Preferably, the method is used to identify potential
compounds which are insecticidally active agents or safe effectors
for ecdysone switches.
[0107] In a further preferred embodiment of the third aspect the
method further comprises the step of obtaining a compound with a
chemical structure selected in steps (d) and (e), and testing the
compound for insecticidal activity.
[0108] In a preferred embodiment the subset of amino acids is that
defining the ligand-binding pocket of the BtEcR subunit, namely
P194, Q195, N196, Y198, E199, H200, P201, H226, I227, T228, I230,
T231, L233, T234, L237, I238, F241, S242, V267, M268, M269, F270,
R271, M272, R274, R275, I283, L284, F285, A286, Y296, M301, T304,
L308, Y325, A326, T329, I333, M389, N390, T393, C394, L397, V404,
P405, L408 and W412.
[0109] In another embodiment the subset of amino acids is that
defining the interface between the BtEcR and BtUSP subunits defined
by BtEcR residues H314, M315, I331, S335, E336, R337, P338, E347,
Q350, E351, I354, E355, K358, T370, T371, F373, A374, K375, L377,
S378, L380, T381, E382, R384, T385 and N388 on one hand and BtUSP
residues E342, R383, T386, E387, K391, E414, E425, E429, Y432,
A433, E436, S447, G448, F450, A451, K452, L454, L455, R456, L457,
P458, A459, R461, S462 and L465 on the other.
[0110] In a still further embodiment the subset of amino acids is
that defining the co-activator/co-repressor binding groove formed
by helices H3 and H4 on the surface of BtEcR defined by residues
I232, V235, Q236, V239, E240, K243, F248, R253, E254, Q256, I257,
L260, K261, S264, S265, M268, S406, F407, L408, E410, I411 and
D413.
[0111] The present invention also provides a method of screening of
a putative compound having the ability to modulate the activity of
the B. tabaci ecdysone receptor (BtEcR/BtUSP) or a heterodimer
comprising BtEcR (SEQ ID NO 1) paired with another functional
partner protein such as RXR, comprising the steps of identifying a
putative compound according to the second or third aspects, and
testing the compound for activity. In one embodiment, testing is
carried out in vitro. Preferably, the in vitro test is a high
throughput assay. In another embodiment, the test is carried out in
vivo employing cell-based or whole organism-based screens.
[0112] In a fourth aspect the present invention provides a computer
for producing a three-dimensional representation of a molecule or
molecular complex, wherein the computer comprises: [0113] (a) a
machine-readable data storage medium comprising a data storage
material encoded with machine-readable data, wherein the machine
readable data comprises the atomic coordinates of amino acids
179-415 of the BtEcR monomer and amino adds 300-492 of the BtUSP
monomer and ponasterone A as shown in Appendix I, or structural
coordinates wherein the backbone atoms of each monomer has a root
mean square deviation from the backbone atoms of their
corresponding partners in either amino acids 179-415 of the BtEcR
monomer or amino acids 300-492 of the BtUSP monomer of not more
than 1.5 .ANG., or one or more subsets of said amino acids, or one
or more subsets of said amino acids related to the coordinates
shown in Appendix I by whole body translations and/or rotations;
[0114] (b) a working memory for storing instructions for processing
the machine-readable data; [0115] (c) a central-processing unit
coupled to the working memory and to the machine-readable data
storage medium, for processing the machine-readable data into the
three dimensional representation; and [0116] (d) an output hardware
coupled to the central processing unit, for receiving the
three-dimensional representation.
[0117] In a preferred embodiment of this aspect of the invention
the structural coordinates have a root mean square deviation from
the backbone atoms of said amino acids of not more than 1.0 .ANG.,
and more preferably not more than 0.7 .ANG..
[0118] In a preferred embodiment the subset of amino adds is that
defining the ligand-binding pocket of the BtEcR subunit, namely
F194, Q195, N196, Y198, E199, H200, P201, H226, I227, T228, I230,
T231, L233, T234, L237, I238, F241, S242, V267, M268, M269, F270,
R271, M272, R274, R275, I283, L284, F285, A286, Y296, M301, T304,
L308, Y325, A326, T329, I333, M389, N390, T393, C394, L397, V404,
P405, L408 and W412.
[0119] In another embodiment the subset of amino adds is that
defining the interface between the BtEcR and BtUSP subunits defined
by BtEcR residues H314, M315, I331, S335, E336, R337, P338, E347,
Q350, E351, I354, E355, K358, T370, T371, F373, A374, K375, L377,
S378, L380, T381, E382, R384, T385 and N388 on one hand and BtUSP
residues E342, R383, T386, E387, K391, E414, E425, E429, Y432,
A433, E436, S447, G448, F450, A451, K452, L454, L455, R456, L457,
P458, A459, R461, S462 and L465 on the other.
[0120] In a still further embodiment the subset of amino acids is
that defining the co-activator/co-repressor binding groove formed
by helices H3 and H4 on the surface of BtEcR defined by residues
I232, V235, Q236, V239, E240, K243, F248, R253, E254, Q256, I257,
L260, K261, S264, S265, M268, S406, F407, L408, E410, I411 and
D413.
[0121] In a fifth aspect the present invention provides a compound
able to modulate an activity mediated by an ecdysone receptor, the
compound being obtained by a method according to the present
invention.
[0122] In a sixth aspect the present invention provides a compound
which possesses stereochemical complementarity to a topographic
region of the BtEcR/BtUSP heterodimer LBD and which modulates an
activity mediated by the receptor, wherein the heterodimer LBD is
characterised by ( [0123] a) amino acids 179-415 of the BtEcR
monomer and amino acids 300-492 of the BtUSP monomer positioned at
atomic coordinates as shown in Appendix I, or structural
coordinates wherein the backbone atoms of each monomer has a root
mean square deviation from the backbone atoms of their
corresponding partners in either amino adds 179-415 of the BtEcR
monomer or amino acids 300-492 of the BtUSP monomer of not more
than 1.5 .ANG.; or [0124] (b) one or more subsets of said amino
acids related to the coordinates of the monomers shown in Appendix
I by whole body translations and/or rotations; with the proviso
that the compound is not a naturally occurring ligand of a molecule
of the receptor.
[0125] In a preferred embodiment of this aspect of the invention
the structural coordinates have a root mean square deviation from
the backbone atoms of said amino acids of not more than 1.0 .ANG.,
and more preferably not more than 0.7 .ANG..
[0126] In one embodiment the sixth aspect, the topographic region
of the ecdysone receptor to which the compound, or a portion
thereof has stereochemical complementarity is the ligand-binding
pocket of the BtEcR subunit defined by amino adds F194, Q195, N196,
Y198, E199, H200, P201, H226, I227, T228, I230, T231, L233, T234,
L237, I238, F241, S242, V267, M268, M269, F270, R271, M272, R274,
R275, I283, L284, F285, A286, Y296, M301, T304, L308, Y325, A326,
T329, I333, M389, N390, T393, C394, L397, V404, P405, L408 and
W412.
[0127] In another embodiment of the sixth aspect, the topographic
region of the ecdysone receptor to which the compound, or a portion
thereof has stereochemical complementarity is the interface between
the BtEcR and BtUSP subunits, defined by BtEcR residues H314, M315,
I331, S335, E336, R337, P338, E347, Q350, E351, I354, E355, K358,
T370, T371, F373, A374, K375, L377, S378, L380, T381, E382, R384,
T385 and N388 on one hand and BtUSP residues E342, R383, T386,
E387, K391, E414, E425, E429, Y432, A433, E436, S447, G448, F450,
A451, K452, L454, L455, R456, L457, P458, A459, R461, S462 and L465
on the other.
[0128] In still a further embodiment of the sixth aspect the
topographic region of the ecdysone receptor to which the compound,
or a portion thereof has stereochemical complementarity is the
co-activator/co-repressor binding groove formed by helices H3 and
H4 on the surface of BtEcR defined by residues I232, V235, Q236,
V239, E240, K243, F248, R253, E254, Q256, I257, L260, K261, S264,
S265, M268, S406, F407, L408, E410, I411 and D413.
[0129] In a seventh aspect, the present invention provides an
insecticidal composition for control of insects which comprises a
compound according to the fifth or sixth aspects of the present
invention and a pharmaceutically acceptable carrier or diluent.
[0130] In yet another aspect, the present invention provides a
method for evaluating the ability of a chemical entity to interact
with the BtEcR/BtUSP heterodimer LBD, said method comprising the
steps of: [0131] (a) creating a computer model of at least one
region of the BtEcR/BtUSP heterodimer LBD using structure
coordinates wherein the root mean square deviation between the
backbone atoms of (i) the BtEcR component of the model and the
corresponding structure coordinates of amino acids 179-415 of the
BtEcR monomer or (ii) the BtUSP component of the model and the
corresponding structure coordinates of amino adds 300-492 of the
BtUSP monomer, as set forth in Appendix I is not more than 1.5
.ANG.; [0132] (b) employing computational means to perform a
fitting operation between the chemical entity and said computer
model of at least one region of the monomers of the BtEcR/BtUSP
heterodimer LBD; and [0133] (c) analysing the results of said
fitting operation to quantify the association between the chemical
entity and at least one region of the BtEcR/BtUSP heterodimer LBD
model.
[0134] In a preferred embodiment of this aspect of the invention
the structural coordinates have a root mean square deviation from
the backbone atoms of said amino acids of not more than 1.0 .ANG.,
and more preferably not more than 0.7 .ANG..
[0135] In a preferred embodiment the region is the ligand-binding
pocket of the BtEcR subunit defined by amino adds F194, Q195, N196,
Y198, E199, H200, P201, H226, I227, T228, I230, T231, L233, T234,
L237, I238, F241, S242, V267, M268, M269, F270, R271, M272, R274,
R275, I283, L284, F285, A286, Y296, M301, T304, L308, Y325, A326,
T329, I333, M389, N390, T393, C394, L397, V404, P405, L408 and
W412.
[0136] In another embodiment the region is the interface between
the BtEcR and BtUSP subunits defined by BtEcR residues H314, M315,
I331, S335, E336, R337, P338, E347, Q350, E351, I354, E355, K358,
T370, T371, F373, A374, K375, L377, S378, L380, T381, E382, R384,
T385 and N388 on one hand and BtUSP residues E342, R383, T386,
E387, K391, E414, E425, E429, Y432, A433, E436, S447, G448, F450,
A451, K452, L454, L455, R456, L457, P458, A459, R461, S462 and L465
on the other.
[0137] In a still further embodiment the region is the
co-activator/co-repressor binding groove formed by helices H3 and
H4 on the surface of BtEcR defined by residues I232, V235, Q236,
V239, E240, K243, F248, R253, E254, Q256, I257, L260, K261, S264,
S265, M268, S406, F407, L408, E410, I411 and D413.
[0138] As will be readily understood by persons skilled in this
field the methods of the present invention provide a rational
method for designing and selecting compounds which interact with
the ecdysone receptor. In the majority of cases these compounds
will require further development in order to increase activity.
Such further development is routine in this field and will be
assisted by the structural information provided in this
application. It is intended that in particular embodiments the
methods of the present invention includes such further
developmental steps.
[0139] In another aspect the present invention consists in a method
of assessing the interaction between a compound and the BtEcR/BtUSP
heterodimer LBD, the method comprising exposing a crystalline
composition comprising BtEcR/BtUSP heterodimer LBD or portion
thereof or variant of these to the compound and measuring the level
of binding of the compound to the crystal.
[0140] Accordingly, in another aspect the present invention
consists in a method of designing or selecting a compound which
modulates ecdysone receptor signalling, the method comprising
subjecting a compound obtained by a method according to any one of
the previous aspects of the present invention to biological screens
and assessing the ability of the compound to modulate ecdysone
receptor signalling. These screens employ cloned EcR sequences. In
particular they may employ BtEcR nucleic acid sequence (SEQ ID No
1).
[0141] Another aspect of the present invention provides a method to
guide site-directed mutagenesis of the ecdysone receptor
ligand-binding domain to change residues in the ligand-binding
domain and at the dimerisation interface in order to change ligand
preferences.
[0142] For other nuclear receptor LBD's, 3D structural information
has been used to identify residues involved in specific contacts
with ligands. This information has been employed to guide
site-directed mutagenesis of residues leading to directed changes
in ligand specificity. For example, on this basis, a single E353Q
replacement was made in the human estrogen receptor-.alpha. and
found to causes a 9-fold reduction in transactivation potency of
estradiol and a concomitant 10-140-fold increase in potency of
androgens (Ekena et al., 1998).
[0143] Homology modelling has been previously employed to predict
the structure of ecdysone receptor LBDs complexed with ecdysteroids
and dibenzoyl hydrazines. The resultant models have been used to
guide site-directed mutagenesis or interpret its outcomes (Kumar et
al., 2002; Grebe & Spindler-Barth, 2002). However, the X-ray
structure for the B. tabaci ecdysone receptor LBD bound to
ponasterone A described in the present invention reveals the
previous models to inaccurately reflect important aspects of the
LBD protein structures and contacts with ligands. For example,
while one single point mutation, A110P, was observed to decrease
responsiveness of Choristoneura fumiferana EcR to ecdysteroids
without affecting response to non-steroidal ligands RG-102240 and
RG-102317 (Kumar et al., 2002), the molecular interpretation for
the underlying protein-ligand interactions postulated was
incorrect. For example, their model places the alkyl chain of the
bound ecdysteroid ligand close to this key residue, whereas our
X-ray structure shows that it is the A/B rings of the steroid core
that are located close to the corresponding residue in BtEcR
(A286). The B. tabaci crystal structure shows that this A286 lies
in the deepest (i.e. the s1-s2 .beta.-sheet loop) part of the
ligand binding pocket. The line of reasoning advanced by (Kumar et
al., 2002) to interpret the insensitivity of the binding of
dibenzoyl hydrazines to replacement of this Ala residue with larger
residues thus actually suggests that dibenzoyl hydrazine ligands
bind
[0144] more centrally in the cavity of the ligand binding pocket or
closer to its H12 end, rather than occupying the bottom part of the
pocket as suggested by these workers.
[0145] An understanding of the effects involved based on the X-ray
structure of the ecdysone receptor (for B. tabaci) and homology
models derived therefrom (for ecdysone receptors from other
species) will facilitate future site-directed mutagenesis to
achieve desirable changes in ligand selectivity. The actual
residues contacting steroid in the binding site and those involved
in the dimerisation interface in the X-ray structure are set out in
the Results Section below under the sub-heading "Structure
description".
[0146] In yet a further aspect, the invention provides a method of
utilizing molecular replacement to obtain structural information
about a molecule or a molecular complex of unknown structure,
comprising the steps of: [0147] (i) crystallising said molecule or
molecular complex; [0148] (ii) collecting an X-ray diffraction data
set from said crystallized molecule or molecular complex; [0149]
(iii) applying at least a portion of the structure coordinates set
forth in Appendix I to the X-ray diffraction data set to generate a
three-dimensional electron density map of at least a portion of the
molecule or molecular complex whose structure is unknown.
[0150] The term "molecular replacement" refers to a method that
involves generating a preliminary model of an ecdysone receptor
crystal whose structure coordinates are unknown, by orienting and
positioning a molecule whose structure coordinates are known (e.g.
BtEcR/BtUSP LBD heterodimer coordinates from Appendix I) within the
unit cell of the unknown crystal so as best to account for the
observed diffraction pattern of the unknown crystal. Phases can
then be calculated from this model and combined with the observed
amplitudes to give an approximate Fourier synthesis of the
structure whose coordinates are unknown. This, in turn, can be
subject to any of the several forms of refinement to provide a
final, accurate structure of the unknown crystal (Lattman, 1985;
Rossmann, 1990).
[0151] The present inventors have now obtained three dimensional
structural information about the ligand-binding domain of the
ecdysone receptor which enables a more accurate understanding of
how the binding of ligand leads to signal transduction. Such
information provides a rational basis for the development of
ligands for specific applications, something that heretofore could
not have been predicted de novo from available sequence data.
[0152] The precise mechanisms underlying the binding of agonists
and antagonists to the ecdysone receptor are not fully clarified.
However, the binding of good ligands to the receptor site, for
example those with a dissociation constant in the order of
10.sup.-8M or lower, is understood to arise from enhanced
stereochemical complementarity relative to naturally occurring
ecdysone receptor ligands.
[0153] Such stereochemical complementarity, pursuant to the present
invention, is characteristic of a molecule that matches surface
residues the ligand binding pocket of EcR as enumerated by the
coordinates set out in Appendix I. By "match" we mean that the
identified portions interact with the surface residues, for
example, via hydrogen bonding or by non-covalent Van der Waals and
Coulomb interactions which promote desolvation of the biologically
active compound within the site, in such a way that retention of
the biologically active compound within the ligand binding pocket
is favoured energetically.
[0154] Substances which are complementary to the shape and
electrostatics or chemistry of the ligand binding site
characterised by amino acids positioned at atomic coordinates set
out in Appendix I will be able to bind to the receptor, and when
the binding is sufficiently strong, substantially prohibit binding
of the naturally occurring ligands to the site. The substance bound
to the receptor may also, of its own accord and in the absence of
any natural ligand, promote either the agonist or antagonist
conformation of the receptor, and thereby determine the biological
outcomes effected by the receptor.
[0155] It will be appreciated that it is not necessary that the
complementarity between ligands and the receptor site extend over
all residues lining the pocket in order to modulate binding of the
natural ligand.
[0156] In general, the design of a molecule possessing
stereochemical complementarity can be accomplished by means of
techniques that optimise, chemically and/or geometrically, the
"fit" between a molecule and a target receptor. Known techniques of
this sort are reviewed by (Goodford, 1984; Beddell, 1984; Hol,
1986; Sheridan & Venkataraghavan, 1987; Walters et al., 1998;
Verlinde & Hol, 1994; Gane & Dean, 2000; Good, 2001; Langer
& Hoffnann, 2001); the respective contents of which are hereby
incorporated by reference. See also (Blundell et al., 1987) (drug
development based on information regarding receptor structure) and
(Loughney et al., 1999) (database mining application on the growth
hormone receptor).
[0157] There are two preferred approaches to designing a molecule,
according to the present invention, that complements the
stereochemistry of the ecdysone receptor. The first approach is to
dock directly in silico molecules from a three-dimensional
structural database to the receptor site, using mostly, but not
exclusively, geometric criteria to assess the goodness-of-fit of a
particular molecule to the site. In this approach, the number of
internal degrees of freedom (and the corresponding local minima in
the molecular conformation space) is reduced by considering only
the geometric (hard-sphere) interactions of two rigid bodies, where
one body (the active site) contains "pockets" or "grooves" that
form binding sites for the second body (the complementing molecule,
as ligand).
[0158] This approach is illustrated by (Kuntz et al., 1982), and
(Ewing et al., 2001), the contents of which are hereby incorporated
by reference, whose algorithm for ligand design is implemented in a
commercial software package, DOCK version 4.0, distributed by the
Regents of the University of California and further described in a
document, provided by the distributor, which is entitled "Overview
of the DOCK program suite" the contents of which are hereby
incorporated by reference. Pursuant to the Kuntz algorithm, the
shape of the cavity represented by the ecdysone receptor site is
defined as a series of overlapping spheres of different radii. One
or more extant databases of crystallographic data, such as the
Cambridge Structural Database System maintained by Cambridge
University (University Chemical Laboratory, Lensfield Road,
Cambridge CB2 1EW, UK.), the Protein Data Bank maintained by the
Research Collaboratory for Structural Bioinformatics (Rutgers
University, N.J., U.S.A.), LeadQuest (Tripos Associates, Inc., St.
Louis, Mo.), Available Chemicals Directory (Molecular Design Ltd.,
San Leandro, Calif.), and the NCI database (National Cancer
Institute, U.S.A.) is then searched for molecules which approximate
the shape thus defined.
[0159] Molecules identified in this way, on the basis of geometric
parameters, can then be modified to satisfy criteria associated
with chemical complementarity, such as hydrogen bonding, ionic
interactions and Van der Waals interactions. Different scoring
functions can be employed to rank and select the best molecule from
a database. See for example (Bohm & Stahl, 1999). The software
package FlexX, marketed by Tripos Associates, Inc. (St. Louis, Mo.)
is another program that can be used in this direct docking approach
(Rarey et al., 1996).
[0160] The second preferred approach entails an assessment of the
interaction of respective chemical groups ("probes") with the
active site at sample positions within and around the site,
resulting in an array of energy values from which three-dimensional
contour surfaces at selected energy levels can be generated. The
chemical-probe approach to ligand design is described, for example,
by (Goodford, 1984), the contents of which are hereby incorporated
by reference, and is implemented in several commercial software
packages, such as GRID (product of Molecular Discovery Ltd., West
Way House, Elms Parade, Oxford OX2 9LL, U.K.). Pursuant to this
approach, the chemical prerequisites for a site-complementing
molecule are identified at the outset, by probing the active site
with different chemical probes, e.g. water, a methyl group, an
amine nitrogen, a carboxyl oxygen, and a hydroxyl. Favoured sites
for interaction between the active site and each probe are thus
determined, and from the resulting three-dimensional pattern of
such sites a putative complementary molecule can be generated. This
may be done either by programs that can search three-dimensional
databases to identify molecules incorporating desired pharmacophore
patterns or by programs which using the favoured sites and probes
as input perform de novo design.
[0161] Programs suitable for searching three-dimensional databases
to identify molecules bearing a desired pharmacophore include
MACCS-3D and ISIS/3D (Molecular Design Ltd., San Leandro, Calif.)
and Sybyl/3DB Unity (Tripos Associates, Inc., St. Louis, Mo.).
[0162] Programs suitable for pharmacophore selection and design
include DISCO (Abbott Laboratories, Abbott Park, Ill.) and Catalyst
(Accelrys, San Diego, Calif.).
[0163] Databases of chemical structures are available from a number
of sources including Cambridge Crystallographic Data Centre
(Cambridge, U.K.), Molecular Design, Ltd., (San Leandro, Calif.),
Tripos Associates, Inc. (St. Louis, Mo.) and Chemical Abstracts
Service (Columbus, Ohio).
[0164] De novo design programs include Ludi (Biosym Technologies
Inc., San Diego, Calif.), LeapFrog (Tripos Associates, Inc.),
Aladdin (Daylight Chemical Information Systems, Irvine, Calif.) and
LigBuilder (Peking University, China).
[0165] Those skilled in the art will recognize that the design of a
mimetic may require slight structural alteration or adjustment of a
chemical structure designed or identified using the methods of the
invention.
[0166] The invention may be implemented in hardware or software, or
a combination of both. However, preferably, the invention is
implemented in computer programs executing on programmable
computers each comprising a processor, a data storage system
(including volatile and non-volatile memory and/or storage
elements), at least one input device, and at least one output
device. Program code is applied to input data to perform the
functions described above and generate output information. The
output information is applied to one or more output devices, in
known fashion. The computer may be, for example, a personal
computer, microcomputer or workstation of conventional design.
[0167] Each program is preferably implemented in a high level
procedural or object-oriented programming language to communicate
with a computer system. However, the programs can be implemented in
assembly or machine language, if desired. In any case, the language
may be compiled or interpreted language.
[0168] Each such computer program is preferably stored on a storage
medium or device (e.g. ROM or magnetic diskette) readable by a
general or special purpose programmable computer, for configuring
and operating the computer when the storage media or device is read
by the computer to perform the procedures described herein. The
inventive system may also be considered to be implemented as a
computer-readable storage medium, configured with a computer
program, where the storage medium so configured causes a computer
to operate in a specific and predefined manner to perform the
functions described herein.
[0169] Biological assays to measure the activity of ecdysone
receptor agonists and antagonists are well known in the field.
Traditional screens for ecdysone receptor agonists examine
candidate compounds for an ability to induce the moulting or
pupation of whole insect larvae (Becker, 1941; Cymborowski, 1989),
the evagination of imaginal discs (Fristrom J. W. & Yund, 1976)
or morphological transformation of the Drosophila BII cell line
(Clement et al., 1993). More recent assays use mammalian or other
eukaryotic cells that have been co-transfected with a recombinant
ecdysone receptor and a reporter gene linked to an appropriate
response element Both types of screen can also be reformatted to
detect non-agonist ligands (antagonists), which can be recognised
by their ability to inhibit the activation the receptor by an
agonist provided as a standard component of the assay (Yang et al.,
1986; Oberdorster et al., 2001)(Oberdorster et al, 2001). In
addition, there are in vitro binding assays in which intact insect
cells, cell extracts or purified recombinant ecdysone receptors are
incubated with a radioactive ecdysone receptor ligand such as
.sup.3H-ponasterone A. These assays detect both agonists and
antagonists indiscriminately because both types of ligand compete
with the radioactive tracer for binding to the ecdysone receptor
(Yund et al., 1978; Cherbas et al., 1988). In addition, potential
agonists and antagonists may be screened for their ability to
inhibit the binding of europium-labelled ecdysone receptor ligands
to soluble, recombinant ecdysone receptor in a microplate-based
format Europium is a lanthanide fluorophore, the presence of which
can be measured using time-resolved fluorometry. The sensitivity of
this assay matches that achieved by radioisotopes, measurement is
rapid and is performed in a microplate format to allow high-sample
throughput, and the approach is gaining wide acceptance as the
method of choice in the development of screens for receptor
agonists/antagonists (Appell et al., 1998; Inglese et al., 1998).
Binding affinity and inhibitor potency may also be measured for
candidate inhibitors using biosensor technology.
[0170] The three-dimensional structure ligand-binding pocket of the
B. tabadecdysone receptor provided in the present application makes
it possible to predict, by homology modelling methods, the
three-dimensional structure of the ligand-binding pockets of
ecdysone receptors from other organisms. For example, the program
Modeler (Sali & Blundell, 1993) builds homology models from the
satisfaction of spatial restraints derived from the alignment of
the target (i.e. an EcR LBD from other species) with the template
(which would be three-dimensional structure of the BtEcR LBD this
case). Differences in the ligand-binding pockets of different
species can thus be modelled.
[0171] In a further aspect the present invention provides an
isolated nucleic acid molecule comprising a nucleotide sequence
which encodes at least the ligand binding domain of BtEcR, wherein
the nucleotide sequence is selected from the group consisting of:
[0172] (i) a nucleotide sequence comprising a sequence having at
least 90% identity to the sequence from nucleotide 535 to
nucleotide 1248 of SEQ ID NO: 1 or the complementary nucleotide
sequence; [0173] (ii) a nucleotide sequence comprising a sequence
that hybridises under high stringency conditions to the sequence
from nucleotide 535 to nucleotide 1248 of SEQ ID NO: 1 or the
complementary nucleotide sequence; and [0174] (iii) a nucleotide
sequence which encodes a polypeptide comprising the sequence from
amino acid P179 to amino acid S416 of SEQ ID NO: 2.
[0175] In a preferred embodiment the nucleic acid molecule further
comprises a nucleotide sequence selected from the group consisting
of: [0176] (i) a nucleotide sequence comprising a sequence having
at least 90% identity to the sequence from nucleotide 355 to
nucleotide 1248 of SEQ ID NO: 1 or the complementary nucleotide
sequence; [0177] (ii) a nucleotide sequence comprising a sequence
that hybridises under high stringency conditions to the sequence
from nucleotide 355 to nucleotide 1248 of SEQ ID NO: 1 or the
complementary nucleotide sequence; and [0178] (iii) a nucleotide
sequence which encodes a polypeptide comprising the sequence from
amino acid R119 to amino acid S416 of SEQ ID NO: 2.
[0179] In a further preferred embodiment the nucleic acid molecule
comprises a nucleotide sequence selected from the group consisting
of: [0180] (i) a nucleotide sequence comprising a sequence having
at least 90% identity to SEQ ID NO: 1 or the complementary
nucleotide sequence; [0181] (ii) a nucleotide sequence comprising a
sequence that hybridises under high stringency conditions to SEQ ID
NO: 1 or the complementary nucleotide sequence; and [0182] (iii) a
nucleotide sequence which encodes the polypeptide of SEQ ID NO:
2.
[0183] In a further preferred embodiment the level of identity is
at least 95%, more preferably at least 97% and most preferably at
least 99%.
[0184] In a further preferred embodiment the nucleic acid molecule
comprises the sequence set out in SEQ ID NO. 1 or comprises a
nucleotide sequence which encodes the polypeptide of SEQ ID NO.
2.
[0185] In determining whether or not two nucleotide sequences fall
within these percentage limits, those skilled in the art will be
aware that it is necessary to conduct a side-by-side comparison or
multiple alignment of sequences. In such comparisons or alignments,
differences may arise in the positioning of non-identical residues,
depending upon the algorithm used to perform the alignment. In the
present context, reference to a percentage identity between two or
more nucleotide sequences shall be taken to refer to the number of
identical residues between said sequences as determined using any
standard algorithm known to those skilled in the art. For example,
nucleotide sequences may be aligned and their identity calculated
using the BESTFIT programme or other appropriate programme of the
Genetics Computer Group, Inc., University Research Park, Madison,
Wis., United States of America (Devereux et al., 1984)
[0186] The concept of hybridisation under high stringency
conditions is a concept well understood in the art. For the
purposes of defining the level of stringency as used herein "high
stringency" comprises a hybridisation and/or a wash carried out in
0.1.times.SSC-0.2.times.SSC buffer, 0.1% (w/v) SDS at a temperature
of at least 55.degree. C. Conditions for hybridisations and washes
are well understood by one normally skilled in the art. For the
purposes of further clarification only, reference to the parameters
affecting hybridisation between nucleic acid molecules is found in
(Ausubel, 1992), which is herein incorporated by reference.
[0187] Throughout this specification, the word "comprise", or
variations such as "comprises" or "comprising" will be understood
to imply the inclusion of a stated element, integer or step, or
groups of elements, integers or steps, but not the exclusion of any
other element, integer or step, or groups of elements, integers or
steps.
[0188] Any discussion of documents, acts, materials, devices,
articles or the like which has been included in the present
specification is solely for the purpose of providing a context for
the present invention. It is not to be taken as an admission that
any or all of these matters form part of the prior art base or were
common general knowledge in the field relevant to the present
invention as it existed in Australia before the priority date of
each claim of the application.
[0189] In order that the nature of the present invention may be
more dearly understood, preferred forms thereof will now be
described with reference to the following non-limiting
examples.
Experimental
Methods
Cloning and Characterizing the EcR and USP Subunits of the B.
tabaci Ecdysone Receptor
Experimental Animals and RNA Isolation
[0190] Animals were reared and maintained by the CSIRO Division of
Entomology, Canberra. Fourth instar nymphs, collected in our
laboratory in Sydney from the under-side of hibiscus leaves, were
rapidly subjected to total RNA isolation using the guanidine
isothiocynate-CsTFA method (Okayama et al., 1987). mRNA was
subsequently purified using the PolyATract mRNA isolation kit
(Promega) and quantitated in aqueous ethidium bromide under UV
light.
Screening Probe Preparations by PCR
[0191] Animals were collected as described above and B. tabaci
genomic DNA was isolated according to methods described in
(Sambrook et al., 1989). To amplify a homologous B. tabaci EcR
screening probe from the genomic DNA, two degenerate primers were
employed to obtain a 165 bp product encompassing sequence encoding
most of the DNA binding domain (DBD), as described by (Hannan &
Hill, 1997). A product of the correct size was obtained, cloned
into Bluescript SK + (Stratagene), cycle sequenced (ABI Prism,
Perkin-Elmer with gel separation by Australian Genome Research
Facility) in both directions and subjected to database analyses by
BlastA via the Australian National Genomic Information Service. The
information obtained indicated that product encoded the DBD of a
steroid nuclear receptor, with highest identity to L. migratoria
EcR (Genbank accession number AF049136). Similar efforts, using
degenerate primers (Tzertzinis et al., 1994), were unsuccessful in
doning a USP screening probe from the B. tabaci genomic DNA.
However, the use of library cDNA as a template yielded a product of
the correct size (147 bp), and BlastA analysis of the TOPO TA
(Invitrogen) cloned product revealed that this fragment had highest
identity to the USP/RXR family.
cDNA Library Construction and Screening
[0192] A B. tabaci cDNA library was constructed from cDNA that had
been oligo-dT primed (Hannan & Hill, 1997) from 5 .mu.g of high
quality mRNA and cloned into a Lambda ZapII vector employing a
(Stratagene) kit. This primary library, consisting of
1.9.times.10.sup.6 plaque forming units (pfu), was amplified once
to give a titre of 1.5.times.10.sup.9 pfu/ml. Screening for EcR
required the plating of 2.5.times.10.sup.6 pfu on an E. coli XL1
Blue (Stratagene) lawn and screening for USP required
1.5.times.10.sup.6 pfu. Plaques were lifted onto Hybond N
(Amersham) membranes, denatured and fixed according to the
manufacturer's instructions. Probes were labelled and hybridised as
described (Hannan & Hill, 1997). Lambda plaques were converted
to pBK-CMV phagemid vector by the excision method (Stratagene) and
ORF's were cycle sequenced in both directions using multiple
primers and compilation employing the GCG Wisconsin package.
[0193] Library screening with the EcR DBD probe identified four
pBK-CMV clones, three of which (pBK-CMV4, 6 and 8) were truncated
in the LBD at position 1078 bp (methionine is +1). The fourth clone
(pBK-CMV7) was identical at the nucleotide level to the first three
but had a complete LBD (an extra 173 bp) and a 3' UTR with polyA
tail. In total, pBK-CMV7 contained a 2291 bp cDNA insert with an
ORF of 1251 bp encoding a 416 aa protein. BlastN and BlastP
analysis of the ORF/putative peptide revealed similarity to
ecdysone receptor analogues. Specifically, highest identity was to
Locusta migratoria EcR, which was 73% identical at the DNA level
and 79% identical at the peptide level. Alignment of the encoded
peptide (BtEcR) along with that of other arthropods (data not
shown), reveals conservation of the nuclear receptor domains.
Specifically, BtEcR exhibits the characteristic five-domain
structure (A/B, C, D, E, F) with highest conservation (88% and 48%
amino acid sequence identity) observed in the DBD and LBD regions,
respectively. Additionally, we observe the conservation of the P
and D-boxes, the regions thought to mediate hormone response
element (HRE) binding (Zilliacus et al., 1995). We also observed
conservation of the AF-2 ligand dependent activation region (Durand
et al., 1994) with the invariant Glu410 (numbers are from BtEcR)
located in the last helix of the E domain. This Glu along with
Lys261 have been suggested to be implicated in salt bridge
formation on the basis of homology modelling (Wurtz et al., 2000).
The B. tabaci crystal structure does indicate a salt bridge in this
vicinity but it actually involves Lys261 and Asp413 (which is also
highly conserved).
[0194] The library was also screened with the USP DBD probe for the
USP cDNA. In this screen, three positive dones were identified and
after preliminary data base analysis (BlastN and BlastP) one clone,
pBK-CMV21(a), revealed high sequence identity to the USP/RXR
receptor family members (WO 01/02436). Of the remaining two clones,
one showed no significant identity to lodged sequences and the
other corresponded to the Drosophilia Thr3 gene. Thr3 is an orphan
nuclear receptor. pBK-CMV21(a) contains a 4.2 kb cDNA insert,
cloned in the reverse orientation, with a 1491 bp ORF encoding a
496 aa protein. BlastN and BlastP analysis revealed the ORF and
encoded protein had highest similarity to Locusta migratoria RXR,
the two species being 62% and 72% identical at the DNA and protein
level, respectively. Interestingly, the region corresponding to the
USP screening probe does not exactly match done pBK-CMV21(a), the
two only being 72% identical at the DNA level (data not shown).
Amino acid alignment of the putative peptide (BtUSP) along with
USP/RXR from related species (data not shown) revealed the
canonical domain structure (A/B, C, D, E/F) and sequence
conservation strongest in the DNA binding region. We note that for
this region BtUSP retains a perfect P-box and imperfect D-box, the
regions implicated in DNA sequence specificity (Danielsen et al.,
1989; Umesono & Evans, 1989) and a perfect T-box, a region also
thought to direct DNA binding (Chung et al, 1998). Additionally,
the ninth heptad repeat of the LBD, a region thought to direct
heterodimer formation and the selection of HRE's (Perlmann et al.,
1996), is well conserved. Also present is a putative AF-2 site, a
region involved in coactivator binding and transactivation (Le
Douarin et al., 1995). As with EcR, the highest sequence
conservation is observed in the C domain but in contrast to EcR the
E/F domain was less conserved.
In-vitro Translation and Gel Retardation Assays
[0195] Gene integrity was confirmed by coupled reticulocyte lysate
transcription and translation (TNT, Promega). For EcR,
transcription/translation was performed with 1.0 .mu.g of done
pBK-CMV 7 utilizing the T3 promoter of the vector and .sup.35S
methionine incorporation. For USP, however, a 1.7 kb SspI fragment
encompassing the ORF was cloned into pBluescript SK (Stratagene)
and then transcribed from this vector's T3 promoter. This
re-cloning of BtUSP was performed to remove the lengthy (1.3 kb)
5'UTR from the pBK-CMV 21(a) insert. After these reactions, 2 .mu.l
of the mix was electrophoresed in an SDS-polyacrylamide gel
according to the manufacturer's (Promega) instructions and product
was detected by the Molecular Dynamics Phosphorimaging system. As
anticipated, the BtEcR recombinant plasmid produced a 50 kDa
protein (expected size, 47.5 kDa) and BtUSPplasmid produced a 62
kDa protein (expected size, 55.6 kDa).
[0196] DNA binding function was assessed by electrophoretic
mobility shift assay (EMSA). For these experiments, EcR and USP
proteins were translated as above but using unlabelled methionine.
The EcRE probe (hsp27 response element) was prepared by
.alpha.-.sup.32P labelling 5 pmol of annealed oligo
(5'AGCTTCAAGGGTTCAATGCACTTGTCCATCG3' and
5'AGCTCGATGGACAAGTGCATTGAACCCTTGA3') with Klenow (GIGAPRIME
Labelling Kit, Geneworks). This mix was then phenol/chloroform
extracted, ethanol precipitated and resuspended in 100 .mu.l of TE.
Binding and electrophoresis were performed as described by (Molloy,
2000). For a 20 .mu.l reaction mix, 2.5 .mu.l of each translated
extract was incubated with 8.0 .mu.l of BufferA (20 mM HEPES pH
7.9, 100 mM KCI, 2 mM dithiothreitol (DTT), 1 mM EDTA, 20% (v/v)
glycerol), 2 .mu.l of 2% (v/v) NP-40, 1 .mu.l BSA (10 mg/ml), 0.5
.mu.l 2 mg/ml poly (dI-dC).poly(dI-dC), 6 .mu.g single stranded DNA
plus or minus 1 .mu.l of 100 mM MgCl.sub.2. After 20 minutes at
room temperature, 0.05 pmoles of labelled probe was added and the
mix was incubated again for 20 minutes. One sample also had the
addition of excess (1.25 pmoles) unlabelled EcRE DNA. 10 .mu.l of
the mix was analysed by electrophoresis at 4.degree. C., 80 V in a
0.25.times.TBE, 5% polyacrylamide gel. After fixing and drying,
radioactive species were visualized by the Molecular Dynamics
Phosphorimaging system. Once DNA binding conditions had been
established, the reactions were repeated (in the presence of 5mM
MgCl.sub.2) +/-ponasterone A. As before, probe was added after 20
minutes and electrophoresis was at 40 minutes. In one case, the
order of probe and ponasterone A additions were reversed, i.e.
probe was included from the beginning and ponasterone A was added
after 20 minutes.
[0197] The results indicated that BtEcR and BtUSP bind EcRE DNA
only as a heterdodimer and not as homodimers. We observed binding
to be greatly enhanced in the presence of Mg.sup.2+. Binding
specificity also was confirmed by the by successful competition
with unlabelled competitor DNA. The presence of hormone
(ponasterone A) clearly enhanced binding of the receptor
heterodimer to EcRE when compared to binding without hormone.
Again, the binding was specific and the amount of receptor-EcRE
complex was reduced by the inclusion of unlabelled EcRE DNA. Adding
EcRE 20 minutes before the addition of hormone did not increase the
binding of receptor to EcRE.
[0198] The nucleotide and amino acid sequence of BtEcR are set out
in SEQ ID NO. 1 and SEQ ID NO. 2, respectively.
[0199] The conceptually-translated amino add sequence of BtEcR is
416 residues long and displays the five domains typical of a
nuclear receptor. The BtUSP protein is 496 residues in length and
also displays all domains typical of a nuclear receptor. In
functional assays, we demonstrated specific and co-operative
binding of the BtEcR and BtUSP subunits to an ecdysone response
element and showed that this phenomenon was enhanced by the
addition of an ecdysteroid ligand, ponasterone A.
Construction of a Baculovirus for Co-expression of the
Ligand-binding Domains of BtEcR and BtUSP
Step 1: Cloning pFastBacDual metHis.sub.6EcR
[0200] pBK-CMV7 was digested with HaeIII and PstI to excise a 1.3
kb DNA fragment (Fragment A) which encodes the BtEcR D and E
domains.
[0201] Two oligonucleotides were synthesised (1) ncoI metHis.sub.6
upper (CATGGGTATGAGAGGATCGCATCACCATCACCATCACAGG) and (2) ncoI
metHis.sub.6 lower (CCTGTGATGGTGATGGTGATGCGATCCTCTCATACC) treated
with kinase and annealed to construct a DNA duplex (Linker A) which
encodes a hexahistidine tag at the amino terminus of the BtEcR D
domain.
[0202] pFastbac Dual (Invitrogen) was digested with NcoI and NsiI
and treated with phosphatase by standard methods (Sambrook et al.,
1989).
[0203] Fragment A and Linker A were ligated into the NcoI and NsiA
treated pFastBacDual to construct pFastbac metHis.sub.6 EcR.
Step 2: Cloning pFastBacDual His.sub.6EcR FLAG USP
[0204] pBK-CMV21(a) was used as template in a PCR (TdIDNA
polymerase, Promega) with primers (1) avaIIusp5
(TGTCTCGCTATGGGACCGAAAAGAGAAGCC) and (2) pstusp3
(GATAATGCTGCAGATGGTGATAATT) to produce a 1370 bp DNA fragment
(Fragment B) encoding the BtUSP D and E domains. A PsfI site exists
in the 3'UTR of BtUSP but a 5' AvaII site is introduced by primer
avaIIusp5.
[0205] Two oligonucleotides were synthesised (1) BssHuspFLAGupper
(CGCGCTTAACTATGGACTACAAGGACGACGATGACAAGG) and (2) avauspFLAGlower
(GGTCCCTTGTCATCGTCGTCCTTGTAGTCCATAGTTAAG) treated with kinase and
annealed to construct a DNA duplex (Linker B) which encodes a FLAG
tag at the amino terminus of the BtUSP D domain.
[0206] pFastbac metHis.sub.6EcR was digested with BssHI(PauI) and
PstI. Fragment B and Linker B were ligated into the BssHI(PauI) and
PstI treated pFastBacDual to construct pFastbac His.sub.6EcR FLAG
USP.
Step 3. Transposition From pFastbac His.sub.6EcR FLAG USP Into a
Bacmid and Baculovirus Construction.
[0207] The mini-Tn7 expression cassette in the donor plasmid
pFastbac His.sub.6EcR FLAG USP was transposed into a baculovirus
genome by transformation into DH10Bac competent cells and selection
of white colonies. White colonies were colony purified and grown up
in liquid culture. Mini-preparations of Bacmid DNA were made using
a alkaline lysis procedure in which attention was payed to
minimisation of shear forces. The resultant DNA was monitored for
the presence of high molecular weight bacmid DNA by electophoresis
through a 0.5% agarose gel.
[0208] Mid-log phase Sf9 insect cells were transfected with bacmid
DNA using Cellfectin (Invitrogen) and standard procedures and grown
for 72 hours at 27.degree. C. Virus was harvested from the culture
supernatant and titrated by plaque assay.
Expression and Purification of Recombinant Heterodimeric EcR-USP
Ligand-binding Domain
[0209] Pilot-scale expression of recombinant heterodimeric
BtEcR-BtUSP LBD was achieved by infection of suspension cultures of
Sf9, Sf21 and or Hi-5 insect cells in spinner flasks or Schott
bottles on a shaker platform maintained at 27.degree. C. Insect
cells infected with the virus engineered to express BtEcR/BtUSP
ligand-binding domain were shown by gel electrophoresis to contain
the expressed polypeptides corresponding to the two tagged domains.
The recombinant cell lysates had a greatly enhanced ability to bind
the radiolabelled ecdysteroid, [.sup.3H]-ponasterone A, compared to
control cell lysates. These results indicated that the recombinant
virus was expressing functional LBDs that were able to
heterodimerise and form a recombinant B. tabaci receptor LBD that
bound ecdysteroids with high affinity. Equilibrium binding studies
with [.sub.3H]-ponasterone A as ligand gave (by direct curve
fitting) a K.sub.d value of 1.21.+-.0.17 nM.
[0210] Large-scale recombinant protein production was carried out
in a Celligen (New Brunswick Scientific) stirred bioreactor under
controlled conditions (27.degree. C., 35 r.p.m.). Successful 5-6 L
cultures yielded 70-100 g wet cells, which typically contained
about 0.2 mg recombinant LBD protein per gram cells. Heterodimer
could be affinity-purified from cell extracts by using a nickel
chelate resin to capture the His.sub.6-tag of the recombinant EcR
ligand-binding domain. Further purification could be achieved by
subjecting the affinity-purified material to ion exchange
chromatography (Pharmacia Mono-Q) or gel filtration (Pharmacia
Superdex-200). All three chromatography steps were efficient
(>60% yield) and inexpensive. Yields were estimated from
measurements of protein concentration and from binding of
[.sup.3H]-ponasterone A. Identity, integrity and purity were
monitored by SDS-polyacrylamide gel electrophoresis (PAGE;
Coomassie-stained or immunoblotted), non-denaturing PAGE,
non-denaturing isoelectric focussing gels, and mass
spectrometry.
[0211] To purify the recombinant heterodimeric LBD (with bound
ecdysteroid ligand) for crystallization trials, 60-70 g recombinant
cells were lysed by sonication in the presence of excess ligand
(ponasterone A) and the receptor LBD-ligand complex was purified
from the clarified lysate using affinity purification followed by
at least one other chromatography step (see above). In the absence
of reducing conditions, such as prevails in conventional
crystallisation trials, disulphide bonds rapidly form within and/or
between some of the recombinant LBD molecules. Fortunately, the
undesirable disulphide-mediated oligomerisation could be suppressed
by using thiol-specific reagents (iodoacetic acid or iodoacetamide)
to modify the surface-accessible cysteine residues. The chemical
modification was preferably done between the first and second
chromatography steps. However, mass spectrometry suggested that
such modification was introducing chemical microheterogeneity into
the recombinant proteins. A way was therefore found to conduct
crystallisation trials under reducing conditions in a nitrogen
atmosphere (see below), which obviated the need for chemical
modification. Amplified recombinant baculovirus engineered to
express the heterodimeric B. tabaci ligand-binding domain, prepared
as described above, was used to infect a 5-litre culture of Hi-5
insect cells in the a Celligen Bioreactor with a multiplicity of
infection of approximately 1. Harvested at 49 h post-infection,
this culture yielded 65 g wet weight of recombinant insect cells,
which were snap-frozen in liquid nitrogen and stored at -70.degree.
C. The entire batch of cells was later thawed and suspended in 130
ml HEPES buffer containing sufficient ponasterone A to saturate the
anticipated number of ligand-binding sites (100 mM HEPES, 40 mM
KCI, 10% glycerol, 1 M EDTA, 3 mM sodium azide, 52 .mu.M
ponasterone A, 8.9 .mu.M leupeptin, 2.7 .mu.M pepstatin, 1.3 mM
phenylmethanesulphonyl fluoride, 26 mM Na.sub.2S.sub.2O.sub.5, 13
mM 2-mercaptoethanol, pH 7.0, 4.degree. C.) and sonicated to break
open the cells (4 batches of equal volume, each treated with
13.times.5 sec pulses, with 25 sec cooling in salted ice between
each pulse, on a MSE Type 11 74.MK2 sonicator fitted with a 19 mm
diameter probe). The sonicates were recombined (210 ml total
volume) and the ionic strength was then raised by addition of 20.8
ml 4M KCI. This sample was ultracentrifuged to pellet cellular
debris (Beckman 60Ti rotor in Beckman L8-80M Ultracentrifuge: 100
000 g, 2 h, 4.degree. C.). The supernatant was dialysed (Spectrum
Spectra/Por 1 tubing, 40 cm long.times.5 cm diameter) for 3 h at
4.degree. C. against 1100 ml HEPES buffer (25 mM HEPES, 40 mM KCI,
10% glycerol, 1 mM EDTA, 3 mM sodium azide, 10 mM
2-mercaptoethanol, 0.1 .mu.M ponasterone A, pH 7.0) to lower the
ionic strength. The dialysate (which had become cloudy) was
clarified by centrifugation (Beckman JA14 rotor in Beckman J2-21
centrifuge, 12 000 rpm, 30 min, 4.degree. C.). The pH was found to
have dropped below pH 7, so 20 ml 0.5M HEPES pH 7.0 was added
dropwise with stirring (on ice) to elevate it before snap-freezing
the sample in liquid nitrogen and storing it at -70.degree. C. To
resume the purification, the sample was thawed rapidly (by shaking
in a 37.degree. C. water bath) and dialysed (Spectrum Spectra/Por 1
tubing, 40 cm long.times.5 cm diameter) twice for 3 h at 4.degree.
C. against 1100 ml phosphate buffer (50 mM sodium phosphate, 10%
glycerol, 0.3M NaCl, 10 mM mercaptoethanol, 0.1 .mu.M ponasterone
A, 3 mM sodium azide, pH 7.4). The dialysate (200 ml total) was
then snap-frozen in liquid nitrogen and stored at -70.degree.
C.
[0212] In the immobilized metal-ion affinity chromatography (IMAC)
step, Ni-NTA-agarose was used to capture the recombinant
heterodimer by way of the His.sub.6-tag on the BtEcR LBD. Capture,
wash and elution were performed in the presence of
2-mercaptoethanol and ponasterone A, as follows. The frozen
dialysate was thawed rapidly (by shaking in a 37.degree. C. water
bath) and re-clarified (Beckman JA14 rotor in Beckman J2-21
centrifuge, 12 000 rpm, 20 min, 4.degree. C.). To the clarified
protein sample was added 2 ml 2M imidazole, pH 7.4, containing 3 mM
sodium azide. A 12 ml portion of a 50% slurry of Ni-NTA agarose
beads (Qiagen, Cat. 30210) was washed twice with 20 ml phosphate
buffer (50 mM sodium phosphate, 10% glycerol, 0.3M NaCl, 10 nM
2-mercaptoethanol, 3 mM sodium azide, pH 7.4). The washed beads
were combined with the protein sample and the suspension was
rotated slowly (RotoTorque: 10 rpm, 3 h, 4.degree. C.). The beads
were then pelleted by centrifugation (Beckman JA14 rotor in Beckman
J2-21 centrifuge, 10 000 rpm, 20 min, 4.degree. C.). The
supernatant was removed carefully, after which the beads were
transferred to a mini-column (a 20 ml syringe body clamped upright,
with a disc of Whatman filter-paper serving as a frit at the base)
at 4.degree. C. Unbound proteins were removed by washing the column
of beads with 120 ml phosphate buffer (50 mM sodium phosphate, 10%
glycerol, 0.3M NaCl, 10 mM 2-mercaptoethanol, 20 mM imidazole, 0.5
.mu.M ponasterone A, 3 mM sodium azide, pH 7.4) at 4.degree. C.
Specifically-bound proteins were eluted with a buffer containing a
high imidazole concentration (50 mM sodium phosphate, 10% glycerol,
0.3M NaCl, 10 mM 2-mercaptoethanol, 250 mM imidazole, 3 .mu.M
ponasterone A, 3 mM sodium azide, pH 7.4). To maximise recovery,
the elution buffer was applied to the column as 2.times.4.5 ml
aliquots with a 20 min interval between each application. The
eluates were combined and a portion was assayed for protein content
(Pierce Coomassie Plus assay, calibrated using bovine serum
albumin). The IMAC step yielded a total of 41 mg of purified
receptor. This procedure typically yields a preparation in which
the recombinant EcR and USP LBDs are present in approximately equal
amounts. An analysis of the IMAC eluate by reducing SDS-PAGE is
shown (FIG. 4, lane 1). The MAC eluate was snap-frozen in liquid
nitrogen and stored at -70.degree. C.
[0213] To resume the purification, the IMAC eluate was thawed
rapidly by shaking in a 37.degree. C. water bath. Since we had
evidence that the non-denaturing detergent
3-[(3-cholamidopropyl)dimethylammonio]-1-propanesulphonate (CHAPS)
could maximise the extent of high-affinity receptor-ecdysteroid
binding, the IMAC eluate was dialysed (Spectrum Spectra/Por 1
tubing, 150 mm long.times.15 mm diam.) twice for 3 h at 4.degree.
C. against 500 ml CHAPS-containing Tris buffer (50 mM Tris, 230 mM
NaCl, 10% glycerol, 10 mM 2-mercaptoethanol, 0.5 .mu.M ponasterone
A, 2 mM CHAPS, 3 mM sodium azide, pH 7.5). Following this, any
additional ligand-binding capacity was satisfied by incubating the
sample overnight at 4.degree. C. in the presence of CHAPS and a
large excess of ponasterone A; this was done by transferring the
dialysis bag to a 100 ml graduated cylinder containing 100 ml 50 mM
Tris, 230 mM NaCl, 10% glycerol, 10 mM 2-mercaptoethanol, 61 .mu.M
ponasterone A, 2 mM CHAPS, 3 mM sodium azide, pH 7.5, and dialysing
overnight at 4.degree. C. However, since it was also feared that
CHAPS might interfere with crystallisation, this additive was
removed by a subsequent dialysis step into a CHAPS-free Tris
buffer, and CHAPS was omitted from later stages of the
purification. (It was expected that any improvements in
ligand-binding stoichiometry would persist after the removal of the
CHAPS so long as free ponasterone A was maintained at saturating
concentrations). Thus, CHAPS was removed from the sample by
dialysing it (Spectrum Spectra/Por 1 tubing, 150 mm long.times.15
mm diam) twice for 3 h at 4.degree. C. against 1000 ml 50 mM Tris,
230 mM NaCl, 10% glycerol, 2 mM dithiothreitol, 0.5.mu.M
ponasterone A, 3 mM sodium azide, pH 7.5. The dialysate was
supplemented to a final concentration of 3 .mu.M ponasterone A,
snap-frozen in liquid nitrogen, and stored at -70.degree. C. To
resume the purification, the sample was thawed rapidly by shaking
in a 37.degree. C. water bath. The heterodimer sample was then
concentrated by ultrafiltration (Pall MicroSep-10, spun in Beckman
JA-20 rotor in Beckman J2-21 centrifuge, 7500 rpm, 4.degree. C.)
until the volume of retentate was about 0.7 ml. The retentate was
then supplemented with 0.1 ml fresh 16 mM dithiothreitol solution
and incubated on ice, 2 h, to ensure the reduction of any
disulphide bonds that might have formed during the concentration
step. The sample (38 mg protein) was then split into two aliquots
(so as not to overload the column) and each aliquot was purified
identically by high-performance gel filtration chromatography
(Pharmacia Superdex-200 HR 10/30 column, equilibrated at room
temperature in 50 mM Tris, 230 mM NaCl, 10% glycerol, 2 mM
dithiothreitol, 1 .mu.M ponasterone A, 3 mM sodium azide, pH 7.5,
flow rate 0.5 ml/min). The UV absorbance of the column eluate
(monitored at 280 nm) indicated that a significant amount of
material with molecular masses above that expected for the
recombinant heterodimer complex was resolved by the column in each
case. In each case, the absorbance peak for the recombinant
heterodimer itself was sharp and symmetrical, and the eluate
fractions (from both column runs) that corresponded to this
dominant peak were pooled to provide a single sample of purified
heterodimer for further processing. The pooled eluate was
concentrated by ultrafiltration (Pall NanoSep-10, spun in Sigma
1K15 minifuge, 14 000 g, 4.degree. C.). The retentate was
retrieved, combined with washings of the ultrafiltration membrane,
and supplemented to a final concentration of 3 .mu.M ponasterone A.
The concentrated sample was sterilized by spin-filtration (Costar
Spin-X 0.22 .mu.m cellulose acetate filter) and stored at 4.degree.
C. under nitrogen. At this stage, the recombinant heterodimer
sample contained 13.2 mg protein in 0.33 ml buffer (50 mM Tris, 230
mM NaCl, 10% glycerol, 2 mM dithiothreitol, 3 .mu.M ponasterone A,
3 mM sodium azide, pH 7.5). Analysis by SDS-PAGE confirmed the
presence of the purified recombinant BtEcR and BtUSP LBDs, (FIG. 4,
lane 2). Their gene-predicted molecular masses are 35.8 and 30 kDa,
respectively, but we find that recombinant LBDs from the ecdysone
receptors of many insects typically run more slowly than expected
on SDS-PAGE.
[0214] Samples of the purified receptor complex were tested in
crystallisation trials, as described below.
Crystallisation
[0215] Crystals of the BtEcR/BtUSP heterodimer ligand-binding
domain were grown using the hanging drop vapour diffusion method
(McPherson, 1982). The well solution contained 0.1M sodium HEPES
(pH 7.5), 1.0 M ammonium dihydrogen phosphate, 4.5% trehalose and
10 mM dithiothreitol, while the drop solution contained 1 .mu.l of
protein (40 mg/ml) in 50 mM Tris HCI (pH 7.5), 0.23 M sodium
chloride, 10% glycerol, 10 mM dithiothreitol, 3 mM sodium azide,
and 3 .mu.M ponasterone A, mixed with 1 .mu.l of well solution.
Crystals were also found to grow in an alternate well solution
containing 0.1M Citrate (pH 5.2), 7-8.5% PEG 3350, 67 mM
KH.sub.2PO.sub.4 and 10 nM TCEP HCI (Tris(2-carboxyethyl)phosphine
hydrochloride). The drops were set up under a nitrogen atmosphere
and the plates stored at room temperature (20.degree. C.) in a
nitrogen incubator. Crystals appeared after 3 months and had a
maximum dimension of 0.5 mm.
Data Collection
[0216] Crystals were transferred to a solution containing 0.1M
sodium HEPES (pH 7.5), 1.0 M ammonium dihydrogen phosphate, 4.5%
trehalose, 10 mM dithiothreitol and 30% glycerol, mounted in a
cryoloop (Teng, 1990) and frozen in a stream of nitrogen gas at
-160.degree. C. X-ray diffraction data from the crystal were then
collected on a MacSdence X-ray generator equipped with focusing
mirrors, a helium path and a Rigaku R-Axis IV detector. Data
processing was conducted using the HKL suite of software
(Otwinowski & Minor, 1997). Data statistics are presented in
Table 1. The crystal had unit cell dimensions 143.01
.ANG..times.143.01 .ANG..times.84.01 .ANG. and belonged either to
space group P4.sub.12.sub.12 or P4.sub.32.sub.12.
Homology Modelling
[0217] A homology model of the BtEcR/BtUSP ligand-binding domains
heterodimer was constructed using as the template, the crystal
structure of the heterodimeric complex between the ligand-binding
domains of human RAR-.alpha. and mouse RXR-.alpha. (RCSB id: 1DKF).
The A-chain of the structure (mRXR-.alpha.) was the structural
template for USP while the B-chain (hRAR-.alpha.) was the template
for EcR. The fold recognition module of the program ProCeryon
(ProCeryon Biosciences GmbH, Salzburg, Austria) was used to thread
the respective sequences on to the structural templates, and these
alignments, after some manual adjustments, were used as the input
to the program Modeller (Sali & Blundell, 1993) as implemented
within InsightII v. 98.0 (Accelrys, Inc., San Diego, USA) to
generate several three-dimensional models of the target protein
complex. The model with the lowest objective function value was
chosen as the best model, and its quality was checked with the
programs Profiles-3D (Luthy et al., 1992), ProsaII (Sippl, 1993)
and ProCheck (Laskowski et al., 1993). It should be noted that in
this model helix H12 of both EcR and of USP was in the antagonist
conformation, i.e. lying in the groove between helices H3 and H4 of
the respective LBD's (Renaud & Moras, 2000).
Structure Determination
[0218] Structure solution proceeded via molecular replacement using
the program MOLREP (Vagin & Teplyakov, 1997) within the CCP4
software suite (Collaborative Computing Project No. 4, 1994).
Molecular replacement employed all data to a resolution of 4.0
.ANG. within the above homology model as the search structure. The
correct solution exhibited a correlation coefficient of 0.319,
convincingly above the next highest value of 0.278. The space group
was verified to be P43212 and the solution demonstrated viable
crystal packing of the heterodimer model. Crystallographic
refinement then proceeded via simulated annealing within X-PLOR
(Brunger, 1992) which reduced the crystallographic R-factor to
0.331 (Rfree=0.441), confirming that the molecular replacement
solution was substantially correct. Iterative rounds of model
building using O (Jones et al., 1991) and crystallographic
refinement using CNS (Brunger et al., 1998) yielded a model
encompassing residues P179 to V415 of BtEcR and V300 to S492 of
BtUSP (employing the single-letter amino acid code for naming
residues here and throughout). Electron density that could readily
be interpreted as the ligand ponasterone A, was visible in the
anticipated site within the BtEcR LBD (Renaud & Moras, 2000).
The non-planarity of the four-ring moiety allowed unambiguous
assignment of ligand orientation and position. Details of the final
refinement statistics are presented in Table 2. Stereochemical
analysis of the structure showed that only BtEcR residue I180 and
BtUSP residue T363 lay in the disallowed regions of the
Ramachandran plot. Electron density associated with these residues
was poor and their backbone conformation could not be modelled
accurately. However, neither of these residues lay in the vicinity
of the ponasterone A binding site and the accuracy of their
conformation was thus highly unlikely to be of any consequence to
the structural details and implications of the ponasterone A
binding site. Also included in the model are three phosphate ions,
presumably arising from the solution used for crystallization of
the heterodimer.
[0219] The crystallographic R-factors in Table 2 suggested that the
structure was essentially correct to the resolution determined
(viz. 3.07 .ANG.). The observed absence of residues N-terminal of
BtEcR P179 and N-terminal of BtUSP V300 could be due to their being
totally disordered in the crystal or due to their prior removal via
contaminating proteases, or both. Analysis of SDS PAGE gels of
crystals (run under reducing conditions) indicated the presence of
bands at 31 kDa, 26 kDa, 23 kDa and 22 kDa, all of these being
smaller than the apparent molecular weights of the freshly purified
LBDs (FIG. 4, lane 2) and also smaller than the gene-predicted
molecular masses of the intact ligand-binding domains (35.8 and 30
kDa). We thus conclude that partial proteolysis may have
contributed in whole or in part to the absence of these
residues.
RESULTS
Structure Description
[0220] The fold of the BtEcR LBD is that of a canonical nuclear
hormone receptor (FIG. 1). The secondary structure elements of
BtUSP/BtEcR LBD discerned in this structure are located within the
BTECR sequence as follows: helix H1--residues 182 to 198, helix
H2--residues 202 to 211, helix H3--residues 220 to 244, helix
H4--residues 252 to 264, helix H5--residues 267 to 275, strand
s0--residues 275 to 277, strand s1--residues 282 to 285, strand
s2--residues 288 to 291, helix H6--residues 292 to 300, helix
H7--residues 304 to 319, helix H8--residues 321 to 334, helix
H9--residues 342 to 364, helix H10--residues 368 to 400 and helix
H12--residues 405 to 413. Thus it comprises .alpha.-helices H1 to
H10 and H12, and .beta.-strands s1 and s2 located between helices
H5 and H6. An additional short .beta.-strand (labelled here as s0)
lies between helix H5 and strand s1.
[0221] Helix H12 in BtEcR is observed in the so-called agonist
conformation (Renaud & Moras, 2000). The structure of BtEcR was
compared with those available for other nuclear receptors. The
closest structural neighbour was the retinoic add receptor (RAR).
The root-mean-square deviation of 206 (out of 237) corresponding
backbone C.sup..alpha. atoms between the BtEcR structure and that
of RAR-.gamma.2 (RCSB id: 1EXA, in the agonist conformation) is
1.29 .ANG.. The major difference between these structures lies in
the conformation of the loop between helices H1 and H3. In RAR this
loop has a random coil conformation and lies across the outer
surface of the s1-s2 .beta.-sheet loop. In EcR the segment contains
an intact helix H2 which packs anti-parallel on the N-terminal
portion of helix H3 and interacts with the opposite surface of the
s1-s2 .beta.-sheet loop.
[0222] The ligand ponasterone A was observed to lie in a
totally-enclosed pocket formed by residues F194, Q195, N196, Y198,
E199, H200, P201, H226, I227, T228, I230, T231, L233, T234, L237,
I238, F241, S242, V267, M268, M269, F270, R271, M272, R274, R275,
I283, L284, F285, A286, Y296, M301, T304, L308, Y325, A326, T329,
I333, M389, N390, T393, C394, L397, V404, P405, L408 and W412 (FIG.
2). The pocket has a "J-shaped" architecture, with the major part
(the leg of the "J") accommodating the ligand, plus an ancillary
part (the curved tail of the "J") existing as an extension of the
major part via a narrow channel. The inner wall of the channel
linking the major and ancillary parts of the pocket is formed by
the side chain of residue R271. The accessible volume of the entire
cavity is approximately 766 .ANG..sup.3, whilst the volume of the
ponasterone A itself is 434 .ANG..sup.3, both figures calculated
using VOIDOO (Kleywegt & Jones, 1994). The ancillary cavity
appears unoccupied in the structure presented here. The narrowness
of channel connecting the major and ancillary parts of the pocket
suggests that it in some dynamic states of the protein these two
parts may become disjoint rather than forming a single topological
entity.
[0223] Potential hydrogen bonds between individual protein atoms
and ligand are as follows: A286 N to the ponasterone A hydroxyl at
C-6, T234 O.sup..gamma.1 to the ponasterone A hydroxyl at C-14,
T231 O.sup..gamma.1 to the ponasterone A hydroxyl at C-14, R271 NH1
to the ponasterone A hydroxyl at C-2, E199 O to the ponasterone A
hydroxyl at C-2, E199 O to the ponasterone A hydroxyl at C-3, Y296
OH to the ponasterone A hydroxyl at C-20 (FIG. 2). The remainder of
the contacts between ligands and protein are overwhelmingly
hydrophobic in nature and formed by contacts between the side
chains of residues P201, I227, T228, I230, M268, R271, M272, R275,
I283, F285, A286, M301 and W412 and the ligand. The hydrogen bond
between the side-chain of Y296 and the C-20 hydroxyl of ponasterone
A probably explains the importance for high-affinity binding of
having a C-20 hydroxyl group in the ecdysteroid. The Tyr at
position 296 (of BtEcR) is completely conserved across insect
orders, suggesting that this hydrogen bond may be a general feature
of high-affinity ecdysteroid binding by EcR. The significance of
this interaction was not apparent from earlier homology models of
EcR (Wurtz et al., 2000; Kasuya et al., 2003).
[0224] Helix H12 was observed to lie in the so-called agonistic
conformation (Renaud & Moras, 2000) possibly locking the ligand
into the site via the side chain of W412 which hangs into the
ligand-binding site. A salt bridge between BtEcR residues D413 and
K261 appears to stabilize the C-terminus of H12. In this
conformation a co-activator can bind to a site that includes H12
and the surface of the hydrophobic cleft between helices H3 and H4.
The molecular detail of this cleft is presented in FIG. 3. Side
chains forming the deft and its immediate surrounds include those
of residues V235, Q236, V239, E240, K243, F248, R253, Q256, I257,
L260, K261, S264, S265 and M268. This groove is totally conserved
across all ecdysone receptor sequences displayed in Table 5, apart
from the residue R253. This residue lies at the distal end of the
binding groove (with respect to the position of H12 shown in this
structure) and it is unclear at this stage whether or not its side
chain interacts with the co-repressor or co-activator upon binding
of these elements.
[0225] The structure of the BtUSP protein closely resembles that of
other published USP structures (Billas et al., 2001; Clayton et
al., 2001) but with the following major difference. The secondary
structure elements of BtUSP/BtEcR LBD discerned in this structure
are located within the BtUSP sequence as follows: helix
H3--residues 301 to 321, helix H4--residues 328 to 339, helix
H5--residues 340 to 353, strand s1 residues 359 to 361, strand
s2--residues 365 to 367, helix H6--residues 371 to 376, helix
H7--residues 380 to 396, helix H8--residues 399 to 411, helix
H9--residues 420 to 443, helix H10--residues 448 to 466 and helix
H12--residues 481 to 491. No electron density was visible for
residues prior to V300, i.e. helix H1, and part of the loop
connecting H1 to H3 are totally unobserved. Part of the volume
occupied by these structural elements in other USP structures is
now occupied by the H10-H12 loop. H12 lies in the so-called
antagonistic conformation (Renaud & Moras, 2000). The helix H11
appears not to be formed. No ligand was observed in the site
corresponding to that occupied by phospholipid in the two above
published structures, and indeed part of that binding site is now
occluded by a repositioning of the H10-H12 loop, and by a
repositioning of helix H6 and residues immediately adjacent to this
element (residues 371 to 384). The repositioning of the H10-H12
loop likely arises from the absence of residues prior to H3 in our
structure, allowing this element to collapse into the region
normally occupied by the H1-H3 loop in the intact USP
ligand-binding domains. Part of the movement of the H10-H12 loop
may be caused by the involvement of that loop in a crystal contact
with a neighbouring molecule in our structure.
[0226] The dimeric association between BtEcR and BtUSP
ligand-binding domains resembles that of the corresponding RAR-RXR
complex. These two heterodimeric structures can be overlaid with an
root-mean-square deviation of 1.37 .ANG. for 339 matched C.alpha.
atoms. The interface is formed by EcR residues contained in H9, H10
and the loop between H8 and H9 on one hand and USP residues
contained in H7, H9, H10 and the loop between H6 and H7 on the
other (see Table 5). Residues involved in the interface include
BtEcR residues H314, M315, I331, S335, E336, R337, P338, E347,
Q350, E351, I354, E355, K358, T370, T371, F373, A374, K375, L377,
S378, L380, T381, E382, R384, T385 and N388 on one hand and BtUSP
residues E342, R383, T386, E387, K391, E414, E425, E429, Y432,
A433, E436, S447, G448, F450, A451, K452, L454, L455, R456, L457,
P458, A459, R461, S462 and L465 on the other. The interface was
estimated by computing all residues with any atom's van der Waals
surface within 1.4 .ANG. of that of any atom of the opposite chain
followed by visual inspection.
[0227] Potential inter-chain salt bridges include those from USP
E429 to EcR K375, USP K391 to EcR E336, USP K391 to EcR E347, USP
K452 to EcR E351 and USP E425 to EcR K375. Out of these, only the
salt bridge between EcR E347 and USP K391 is conserved across all
species (although the Dipteran Chiromus tentans EcR has Asp instead
of Glu at the position corresponding to residue 347 in BtEcR), and
compounds which bind to the interface and disrupt a particular salt
bridge could be the basis of specific antagonists.
[0228] Hydrogen bonds occur between the side chains of USP S447 and
the side chain of EcR E355A, between the backbone carbonyl of USP
S447 and the side chain of EcR K358 and between the side chains of
EcR R384 and USP S462. The remainder of the contacts are
hydrophobic in nature. A single phosphate ion is included in the
interface, coordinated by the side chains of the EcR residue R384,
the carbonyl oxygen of EcR residue E336 and the side chains of USP
residues R383, E387 and R456.
[0229] PASS (Brady & Stouten, 2000) shows the existence of a
pocket on the BtEcR surface on the edge of the heterodimeric
interface bounded by residues including A262, S265, E266, R337,
R384, G387, N388 and S391 of BtEcR. PASS also shows the existence
of a pocket on the BtUSP surface on the edge of the heterodimeric
interface bounded by residues including K337, S338, N341, E342,
K416, G464, L465, C467 and H470 of BtUSP.
Designing Species-specific Agonists in the EcR Pocket
[0230] Table 3 presents the inter-order variation apparent across a
variety of Insecta EcR LBDs for those residues that line the
ecdysteroid binding pocket observed in the B. tabaci structure.
Analysis of Table 3 indicates that there are differences in the
residues in the ligand binding pocket of EcRs between insect
species. For example, in the hemipteran B. tabaci (resistant to the
bisacylhydrazine compounds) residue 272 is methionine, whereas in
lepidopteran species (susceptible to bisacylhydrazines) the residue
at this position is a smaller valine. Attention has also been drawn
to the potential importance of the residue at this position in
relation to the control spectrum of bisacylhydrazine insecticides
in the communication by Billas et al. (2003) reporting the crystal
structure of the lepidopteran Heliothis virescens EcR/USP
heterodimeric LBD. It is apparent from Table 3 of the present
application that the methionine at position 272 is present in the
Hemiptera, Diptera, Orthoptera and Coleoptera while the residue in
this position of the Lepidoptera is valine. The Lepidoptera,
Diptera and Coleoptera have been shown to be susceptible to
bisacylhydrazines in varying degrees generally correlating with the
binding affinities of their ecdysone receptors for the agonists
(Dhadialla et al, 1998). Furthermore our laboratory has carried out
in vitro binding studies employing purified recombinant LBDs to
demonstrate significant affinity of a dipteran (Lucilia cuprina)
receptor and only very low affinity of the whitefly (B. tabaci)
receptor for RH5992 (unpublished results). Clearly the response to
bisacylhydrazines is not simply dependent on the residue at the
position corresponding to 272 in B. tabaci.
[0231] We propose that the methionine residue at position 272 in B.
tabaci does not act as a single determinant but that it has a
synergistic effect with leucine 308 and methionine 389, and that
the collective length, bulk and charge state of these side chains
may lead to changes in the shape and affinity of the binding pocket
for various agonists/antagonists. A methionine at position 389 is
only found in the Hemiptera and Arachnida. Using this triplet of
residues as an example, and assuming the binding pocket remains
essentially the same in gross topography, the overall reduction in
side-chain bulk at residues 272, 308 and 389 in the lepidopteran
EcR creates an additional bulge in the lepidopteran pocket helping
to accommodate the bisacylhydrazines.
[0232] A comparison of the ecdysteroid binding pockets of the
hemipteran BtEcR and lepidopteran HvEcR shows that the triptych of
residues discussed in the previous paragraph is largely responsible
for differences in the pocket shape near the unoccupied region
adjacent to C22-OH of ponasterone A in BtEcR. In HvEcR this
unoccupied region is extended into a pronounced bulge in the
ecdysteroid bound pocket (see distinct bulge in the HvEcR pocket at
top left of FIG. 8). Least squares alignments of the protein
backbone C-alpha atoms of the EcR domains of all three structures,
BtEcR (ponasterone A bound) HvEcR 1R1K (ponasterone A bound) and
HvEcR 1R20 (synthetic agonist BYI06830 bound) places the A and B
rings of the agonist BYI06830 in the vicinity of, but not enclosed
by, this extra bulge in the HvEcR 1R1K ecdysteroid bound pocket. In
the lepidopteran HvEcR 1R20 structure this bulge is further
extended, probably by induced fit, to accommodate the synthetic
agonist. We propose that in the hemipteran BtEcR structure, the
absence of the bulge in this region of the potential binding pocket
conformation would prevent initial binding of many of the
bisacylhydrazines and subsequent expansion of the bulge by an
induced-fit mechanism.
[0233] Clearly other changes in binding site residues which occur
between orders, as detailed in Table 3, would alter the topography
of the binding site, allowing for taxon-specific design of steroids
or small molecule mimetics, which exploit these differences. Such
design would be implemented using tools available to those skilled
in the art as described above. M389 is found towards the C-terminus
of H10/11 and the pocket opening that is closed by H12 on agonist
binding. M389 makes minimal contact with the ponasterone A ligand;
however, mutation of this residue to a smaller side chain such as
valine, found in the Lepidoptera, or glycine as found in the
Arachnida, could weaken the interaction between H11 and H7. This
weakening appears to open up the binding site towards the
C-terminus of H10/11 revealing the conserved L308 and highly
conserved L386 as forming a hydrophobic indentation, potentially
capable of accommodating ligand antagonist/agonists with bulky
substituents such as a t-butyl group or even a benzene ring as
found in some of the bisacylhydrazines.
[0234] The X-ray structure provides a precise description of the
relative positions in three-dimensional space of the residues
lining the binding pocket of BtEcR. The ecdysteroid ligand,
ponasterone A, fits snugly into the major part of the binding
pocket, with almost all receptor-free volume over the rigid steroid
framework being occupied (FIG. 2).
[0235] However, certain sites of extension are available as
follows. There is a small pocket near the C20/C21 region of the
ecdysteroid which is not fully occupied (as described two
paragraphs above), and a larger volume beyond the terminus of the
steroid alkyl chain which is also unfilled. There is significant
receptor pocket volume not occupied by the ligand below and at the
terminus of the alkyl chain. This larger, partially filled region
is bounded by L408, V404, N390, C394, L408, I227, T228, T231, T393
and P405 as FIG. 5 shows. The region denoted as the ancillary part
of the binding pocket (the curved part of the `J`) may also be
available for occupation by ligands, depending on the accessibility
of this pocket
[0236] Clearly the BtEcR LBD X-ray structure could be used,
together with molecular modelling methods well known to those
skilled in the art, to design modifications of the steroid which
better fill the receptor volume.
[0237] Alternatively, synthetic organic molecules could be designed
by taking account of the properties of the residues lining the
binding site, and using methods such as GRID (Goodford, 1984) to
locate regions favourable for binding of particular substituents.
Such substituents could be linked together by a scaffold or other
molecular framework to present the ligand binding groups in optimum
three-dimensional orientation to interact with complementary
binding groups in the binding site. This can be done manually by a
person skilled in the art, or in an automated fashion using
programs such as LeapFrog (Tripos Associates, Inc., St. Louis,
Mo.).
[0238] Another alternative would be that the three-dimensional
orientation of complementary binding groups in the protein (derived
from knowledge of the X-ray structure of the receptor) could be
used as a pharmacophore query for database searching. This would
identify molecules with correctly oriented functional groups which
would be putative ligands for the receptor.
[0239] Another alternative would be using the shape and properties
of the binding site obtained from the X-ray structure of the
receptor as a database query directly. Programs such as DOCK (Ewing
et al., 2001; Kuntz et al., 1982) and FlexX (Rarey et al., 1996)
can use this type of information to search through databases of
real or hypothetical molecules to find ones with the correct
properties to bind to the receptor.
[0240] An example of how this can be done uses the program FlexX to
dock known and putative ligands into the binding site of the EcR.
The receptor structure was pre-processed to add all hydrogen atoms
to the amino acids, and charges were applied using standard rules.
A region within 6.5 .ANG. of the ponasterone A ligand bound into
the site was used for the FlexX calculations. To assess that the
program was able to use the X-ray data to correctly dock ligands,
the ponasterone A ligand was extracted from the X-ray structure,
energy minimized and re-docked into the binding site. The FlexX
program docked the ponasterone A ligand into a binding pose
essentially identical to that in the X-ray structure (RMS 0.79
.ANG.) with a very favourable docking score (-23.92). The quality
of the docking results can be seen in FIG. 6.
[0241] In another docking experiment with FlexX, the score for the
ponasterone A ligand was -28.4. In the same experiment a number of
other potent EcR steroidal ligands gave the following scores:-
muristerone A -27.6, 20-hydroxyecdysone -29.0, inokosterone -31.7.
The highest ranked poses bound to the EcR in a similar mode to that
of ponasterone A, and they exhibited similar binding scores to that
computed for ponasterone A.
[0242] As a further example, several small synthetic molecules were
docked into the EcR X-ray structure using FlexX. These were:
bisacylhydrazines I and RH5992 (which show negligible binding in
BtEcR competitive binding assay with [.sup.3H]-ponasterone A as
tracer); an oxadiazole derivative II (also negligible binding); an
oxazolidinone derivative III (weak-moderate binding in assay);
thiotetrahydroimidazole derivative IV (weak-moderate binding in
assay). ##STR1##
[0243] FlexX docking calculations were unable to find any binding
poses in the BtEcR pocket which scored well with relatively low
internal energy for the bisacylhydrazines (I and RH5992) and the
oxadiazole derivative (II). However the two weak-moderate binding
ligands, III and IV, were successfully docked into the EcR X-ray
structure with relatively low internal strain and favourable
docking scores (-14.9 and -15.8 respectively). Both of these
compounds had FlexX binding poses which oriented their structures
over the C/D rings of ponasterone A X-ray structure, and the alkyl
chain of the steroid. An example of a successful docking pose for
one of these small, synthetic ligands, the oxazolidinone derivative
III, is given in FIG. 7.
Designing Compounds that Target the BtEcR/BtUSP Interface and Alter
the Quaternary Association of these Molecules.
[0244] In a further aspect of this invention compounds
(non-peptidic, peptidic or peptidomimetic) can be designed that
mimic the USP component of the heterodimer interface. Details of
residues forming this interface and their variation across orders
are given in Table 4. Such compounds may bind to the EcR monomer
and prevent the formation of a functional EcR USP heterodimer. Such
design would utilize the conformational detail of the EcR/USP
interface revealed in this application. Such design would also
utilize the detail of the ligand binding interactions to identify
ligand derivatization sites that could be used to disrupt the
conformations and hence the interactions of the EcR helices
involved in dimerization. Similarly compounds can be designed that
mimic the EcR component of the heterodimer interface and so bind to
the USP component, again preventing formation of the functional
EcR/USP heterodimer.
[0245] Design of such compounds is feasible for the estrogen
receptor, see for example (Yudt & Koide, 2001). Rational
interface peptide design has been demonstrated in a variety of
other protein-protein interactions (Singh et al., 2001; Berezov et
al., 2002).In addition, compounds can be designed/selected so as to
bind into either of the two `pockets` associated with the interface
and form the basis of platforms to create steric hindrance to the
process of heterodimerization and thus inhibit the function of the
ecdysone receptor.
Designing Compounds that Target the BtEcR Co-activator/co-repressor
Binding Cleft
[0246] In a further aspect of this invention compounds can be
designed based on the BtEcR structure to target the
co-activator/co-repressor binding cleft, and thereby be capable of
acting as agents that modulate transactivation (Tran et al., 2001;
Westin et al., 1998). This site is formed by two antiparallel
helices, H3 and H4 and presents a groove into which the
co-activator or co-repressor would bind. Co-activators have a
conserved LXXLL motif (the "NR" box) which has been shown in
studies of other nuclear receptors to form part of an amphipathic
helix which interacts with the H3/H4 cleft via the leucines. Also
involved in this interaction are the highly conserved glutamate in
H12 and lysine in H3. On this basis it becomes possible to those
skilled in the art to design peptides or peptidominmetics that
mimic the binding of the co-activator NR box to the deft, utilizing
the conformational detail of the EcR H3/H4 cleft presented here.
Such compounds would have the potential to modulate the
transactivational state of the receptor. This groove is
substantially conserved across all known EcR sequences (Table
5).
[0247] It will be appreciated by persons skilled in the art that
numerous variations and/or modifications may be made to the
invention as shown in the specific embodiments without departing
from the spirit or scope of the invention as broadly described. The
present embodiments are, therefore, to be considered in all
respects as illustrative and not restrictive.
TABLES
[0248] TABLE-US-00001 TABLE 1 X-ray data collection statistics No.
frames 302 Oscillation angle (.degree.) 0.5 No. measurements 191046
No. reflections 16725 Multiplicity 11.8 (10.5).sup.1 Resolution
range (.ANG.) 30.0-3.07 Completeness (%) 99.9 (100.0)
<I/.sigma.(I)> 19.3 (5.6) .sup.1Numbers in parenthesis refer
to the statistic in the highest resolution shell.
[0249] TABLE-US-00002 TABLE 2 Crystallographic refinement
statistics Resolution range (.ANG.) 100-3.07 Total no. of
reflections used 16756 Crystallographic R-factor 0.203 Free
R-factor (5% of total reflections) 0.275 No. of protein atoms 3475
No. of ligand + solvent atoms 53 Root-mean-square deviation of bond
0.012 lengths from ideality (.ANG.) Root-mean-square deviation of
bond 1.56 angles from ideality (.degree.)
[0250] TABLE-US-00003 TABLE 3 Residues lining the ponasterone A
binding pocket in BtEcR and their inter-order variation across the
sequences lining atoms Hemiptera Diptera Lepidoptera Orthoptera
Coleoptera Arachnida Crustacea F194 2M F Y Y F F Y Y Q195* 4M, 5S Q
Q Q Q Q Q Q N196 1M N, D D D, E N N Q E Y198 4M, 1S Y Y Y Y Y F F
E199 4M, 5S E E E, D E E E E H200 3M, 4S H, A Q Q S H S Q P201* 2M,
3S P P P P P P P H226 2M H, I H, Y Q H H H H I227* 4M, 4S I I I I I
I I T228* 4M, 3S T T T T T T T I230 4M, 4S I, M I, V M I I M I
T231* 2M, 3S T T T T T T T L233* 3M, 3S L L L L L L L T234* 3M, 3S
T T T T T T T L237* 2M, 3S L L L L L L L I238* 4M, 4S I I I I I I I
F241* 2M, 7S F F F F F F F S242 2M, 2S S, A A A A A S S V267 3M, 3S
V, A V V V V V V M268* 3M, 3S M M M M M M M M269* 2M, 4S M M M M M
M M F270 3M, 3S F L L F F L L R271* 4M, 7S R R R R R R R M272 4M,
4S M, V M V M M G A R274* 2M, 6S R R R R R R R R275 1M, 6S R, K R R
R R K R I283 1M, 4S I I V I I I I L284 4M L, V F L, M L L V V F285*
4M, 7S F F F F F F F A286 2M, 1S A A A A V A G Y296* 5S Y Y Y Y Y Y
Y M301 4S M, L M, V M, F M M V L T304 1M, 3S T, A N, T V T T S S
L308 4S L, Q L L M L L L Y325 1M, 4S Y Y Y, F Y Y Y Y A326* 1M, 1S
A A A A A A A T329 3S T T T T T T A I333* 2S I I I I I I I M389 2M,
4S M, E Q K Q Q Q M I N390* 4M 4S N N N N N N N T393 3M, 3S T, L M
M M M M M C394* 2M, 2S C C C C C C C L397* 2S L L L L L L L V404
1M, 3S V L L L L L L P405* 1M, 2S P P P P P P P L408* 3S L L L L L
L L W412* 4S W W W W W W W "*" indicates total conservation across
all sequences considered. The column headed "lining atoms"
indicates the number of side chain atoms (S) and the number of main
chain atoms (M) involved in forming the cavity wall. Underlined
residues are those judged to form the major part of the ponasterone
A binding cavity, the remainder forming the walls of the ancillary
part of the ponasterone A binding cavity.
[0251] TABLE-US-00004 TABLE 4 Residues forming the BtEcR/BtUSP LBD
interface and their inter-order variation across the sequences (a)
BtEcR residues Hemiptera Diptera Lepidoptera Orthoptera Coleoptera
Arachnida Crustacea H314 H, F Q C Q T K S M315 M M M M M M L I331 I
I I, V I I I I S335 S S S S S S S E336 E, S D D E E E E R337 R R R
R R R R P338 P P P P P P P E347 E E E E E E E Q350 Q Q Q Q Q Q Q
E351 E S R E E E E I354 I, L T, I L L L I L E355 E D N E E E E K358
K K, R R K R R K T370 T S, L S, A, P G G K N T371 T, V V V T T N M
F373 F, Y F, Y F, Y F F F F A374 A A G, A A A A A K375 K, R K K, R
K K R K L377 L L L L L L L S378 S G, S G, S S S S N L380 L L L L L
L L T381 T T S, T T T T T E382 E E E E E E E R384 R R R R R R R
T385 T T T, S T T T T N388 N N M, T N N N N (b) BtUSP residues
Hemiptera Diptera Lepidoptera Orthoptera Hymenoptera Coleoptera
E342 E E E E E E R383 R R R R R R T386 T S, C S T S S E387 E E E E
E E K391 K K K K K K E414 E, G D D E E T E425 E, Q E, D D, E, V E T
E E429 E, D E, S E E E E Y432 Y Y Y, F Y Y Y A433 A, V A L, S A G G
E436 E D D E E E S447 S, P D E P A P G448 G G G G G G F450 F F F F
F F A451 A A A A A A K452 K Q A, S K K K L454 L L L L L L L455 L L
L L L L R456 R R R R R R L457 L L L L L L P458 P P P P P P A459 A,
S S S A, S S S R461 R R R R R R S462 S S S S S S L465 L L L L L
L
[0252] TABLE-US-00005 TABLE 5 Residues forming the BtEcR LBD
co-activator/co-repressor binding groove and their inter-order
variation across the sequences. Hemiptera Diptera Lepidoptera
Orthoptera Coleoptera Arachnida Crustacea I232 I I I I I I I V235 V
V V V V V V Q236 Q Q Q Q Q Q Q V239 V V V V V V V E240 E E E E E E
E K243 K K K K K K K F248 F F F F F F F R253 R Q Q R Q R R E254 E E
P, S E E E E Q256 Q Q Q Q Q Q Q I257 I I I I I I I L260 L L L L L L
L K261 K K K K K K K S264 S S S S S S S S265 S S S S S S S M268 M M
M M M M M S406* S, P R, K P P P P P F407* F F F F F F F L408* L L L
L L L L E410* E E E E E E E I411* I V, I I I I I I D413* D D D D D
D D The * identifies residues in H12 that would be expected to
interact with co-activators but their involvement in co-repressor
interactions is unknown.
REFERENCES
[0253] 1. Appell, K. C., Chung, T. D. Y., Solly, K. J. &
Chelsky, D. (1998). Biological characterization of neurokinin
antagonists discovered through screening of a combinatorial
library. J. Biomol. Screen. 3, 19-27. [0254] 2. Ashburner, M.,
Chihara, C., Meltzer, P. & Richards, G. (1974). Temporal
control of puffing activity in polytene chromosomes. Cold Spring
Harb. Symp. Quant Biol. 38, 655-62. [0255] 3. Ausubel, F. M., eds.
(1992). Current protocols in molecular biology Short protocols in
molecular biology: a compendium of methods from Current protocols
in molecular biology/edited by Fredezick M Ausubel . . . [et al.].,
2nd ed. edit., Greene Pub. Associates; Wiley, Brooklyn, N.Y. New
York, N.Y. [0256] 4. Becker, E. (1941). Uber Versuche zur
Anreicherung und physiologische Charakterisierung und Wirkstoffes
der Puparisierung. Biol. Zbl. 61, 360-388. [0257] 5. Beddell, C. R.
(1984). Designing drugs to a fit a macromolecular receptor. Chem.
Soc. Rev. 13, 279-314. [0258] 6. Berezov, A., Chen, J., Liu, Q.,
Zhang, H. T., Greene, M. I. & Murali, R. (2002). Disabling
receptor ensembles with rationally designed interface
peptidomimetics. J. Biol. Chem. 277, 28330-9. [0259] 7. Bernstein,
F. C., Koetzle, T. F., Williams, G. J., Meyer, E. E. Jr, Brice, M.
D., Rodgers, J. R., Kennard, O., Shimanouchi, T. & Tasumi, M.
(1977). The Protein Data Bank: a computer-based archival file for
macromolecular structures. J. Mol. Biol. 112, 535-542. [0260] 8.
Billas, I. M., Moulinier, L., Rochel, N. & Moras, D. (2001).
Crystal structure of the ligand-binding domain of the ultraspiracle
protein USP, the ortholog of retinoid X receptors in insects. J.
Biol Chem. 276, 7465-74. [0261] 9. Billas, I. M., Iwema, T.,
Garnier, J. M., Mitschler, A., Rochel, N., and Moras, D. (2003).
"Structural adaptability in the ligand-binding pocket of the
ecdysone hormone receptor." Nature, 426(6962), 91-96. [0262] 10.
Blundell, T. L., Sibanda, B. L., Stemberg, M. J. & Thornton, J.
M. (1987). Knowledge-based prediction of protein structures and the
design of novel molecules. Nature 326, 347-352. [0263] 11. Bohm, H.
J. & Stahl, M. (1999). Rapid empirical scoring functions in
virtual screening applications. Med. Chem. Res. 9, 445-462. [0264]
12. Brady, G. P. Jr & Stouten, P. F. (2000). Fast prediction
and visualization of protein binding pockets with PASS. J. Comput.
Aided Mol. Des. 14, 383-401. [0265] 13. Brunger, A. T., Adams, P.
D., Clore, G. M., DeLano, W. L., Gros, P., Grosse-Kunstleve, R. W.,
Jiang, J. S., Kuszewski, J., Nilges, M., Pannu, N. S., Read, R. J.,
Rice, L. M., Simonson, T. & Warren, G. L. (1998).
Crystallography & NMR system: A new software suite for
macromolecular structure determination. Acta Crystallogr. D 54,
905-921. [0266] 14. Brunger, A. T. (1992). X-PLOR, Version 3.1: A
system for X-ray and NMR. Yale University Press, New Haven. [0267]
15. Cherbas, P., Cherbas, L., Lee, S. S. & Nakanishi, K.
(1988). 26-[125I]iodoponasterone A is a potent ecdysone and a
sensitive radioligand for ecdysone receptors. Proc. Natl. Acad.
Sci. USA 85, 2096-100. [0268] 16. Chung, A. C., Durica, D. S.,
Clifton, S. W., Roe, B. A. & Hopkins, P. M. (1998). Cloning of
crustacean ecdysteroid receptor and retinoid-X receptor gene
homologs and elevation of retinoid-X receptor mRNA by retinoic
acid. Mol Cell Endocrinol 139, 209-27. [0269] 17. Clayton, G. M.,
Peak-Chew, S. Y., Evans, R. M. & Schwabe, J. W. (2001). The
structure of the ultraspirade ligand-binding domain reveals a
nuclear receptor locked in an inactive conformation. Proc. Natl.
Acad. Sci. USA 98, 1549-1554. [0270] 18. Clement, C. Y., Bradbrook,
D. A., Lafont, R. & Dinan, L. (1993). Assessment of a
microplate-based bioassay for the detection of ecdysteroid-like or
antiecdysteroid activities. Insect Biochem. Mol. Biol. 23, 187-192.
[0271] 19. Collaborative Computing Project No. 4. (1994). The CCP4
suite: programs for protein crystallography. Acta Crystallogr. D
50, 760-763. [0272] 20. Connolly, M. L. (1983). Solvent-accessible
surfaces of proteins and nucleic acids. Science 221, 709-713.
[0273] 21. Cymborowski, B. (1989). Bioassays for ecdysteroids. In
Ecdysone: from Chemistry to Mode of Action (J. Koolman, ed.), pp.
144-149, Thieme Medical Publishers, New York. [0274] 22. Danielsen,
M., Hinck, L. & Ringold, G. M. (1989). Two amino acids within
the knuckle of the first zinc finger specify DNA response element
activation by the glucocorticoid receptor. Cell 57, 1131-1138.
[0275] 23. Devereux, J., Haeberli, P. & Smithies, O. (1984). A
comprehensive set of sequence analysis programs for the VAX.
Nucleic Acids Res. 12, 387-395. [0276] 24. Dhadialla, T. S.,
Carlsor, G. R. & Le, D. P. (1998). New insecticides with
ecdysteroidal and juvenile hormone activity. Annu. Rev. Entomol.
43, 545-69. [0277] 25. Dinan, L., Bourne, P., Whiting, P.,
Tsiteksi, A., Saatov, Z., Dhadialla, T. S., Hormann, R. E., Lafont,
R. & Coll, J. (2002). Synthesis and biological activities of
turkesterone 11.alpha.-acyl derivatives. J. Insect Sci. 3:6. [0278]
26. Durand, B., Saunders, M., Gaudon, C., Roy, B., Losson, R. &
Chambon, P. (1994).
[0279] Activation function 2 (AF-2) of retinoic acid receptor and
9-cis retinoic acid receptor: presence of a conserved autonomous
constitutive activating domain and influence of the nature of the
response element on AF-2 activity. EMBO J. 13, 5370-5382. [0280]
27. Ekena, K., Katzenellenbogen, J. A. & Katzenellenbogen, B.
S. (1998). Determinants of ligand specificity of estrogen
receptor-alpha: estrogen versus androgen discrimination. j Biol.
Chem. 273, 693-699. [0281] 28. Ewing, T. J., Makino, S., Skillman,
A. G. & Kuntz, I. D. (2001). DOCK 4.0: search strategies for
automated molecular docking of flexible molecule databases. J.
Comput. Aided Mol. Des. 15, 411-428. [0282] 29. Fristrom J. W.
& Yund, M. A. (1976). Characteristics of the action of
ecdysones on Drosophila imaginal discs cultured in vitro. In
Invertebrate Tissue Culture Research Applications (K Maramorosch
(Ed.), ed.), pp. 161-178, Academic Press, New York. [0283] 30.
Gane, P. J. & Dean, P. M. (2000). Recent advances in
structure-based rational drug design. Curr. Opin. Struct. Biol. 10,
401-404. [0284] 31. Good, A. (2001). Structure-based virtual
screening protocols. Curr. Opin. Drug Discov. Devel. 4, 301-307.
[0285] 32. Goodford, P. J. (1984). Drug design by the method of
receptor fit. J. Med. Chem. 27, 558-564. [0286] 33. Grebe, M. &
Spindler-Barth, M. (2002). Expression of ecdysteroid receptor and
ultraspirade from Chironomus tentans (Insecta, Diptera) in E. coli
and purification in a functional state. Insect Biochem. Mol. Biol.
32, 167-74. [0287] 34. Hannan, G. N. & Hill, R. J. (1997).
Cloning and characterization of LcEcR: a functional ecdysone
receptor from the sheep blowfly Lucilia cuprina. Insect Biochem.
Mol. Biol. 27, 479-88. [0288] 35. Hannan, G. N. & Hill, R. J.
(2001). LcUSP, an ultraspiracle gene from the sheep blowfly,
Lucilia cuprina: cDNA doning, developmental expression of RNA and
confirmation of function. Insect Biochem. Mol. Biol. 31, 771-81.
[0289] 36. Hill, R. J., Segraves, W. A., Choi, D., Underwood, P. A.
& Macavoy, E. (1993). The reaction with polytene chromosomes of
antibodies raised against Drosophila E75A protein. Insect Biochem
Mol Biol 23, 99-104. [0290] 37. Hol, W. G. J. (1986). Protein
crystallography and computer graphics--on the path to systematic
drug design. Angewandte Chemie 98, 765-777. [0291] 38. Inglese, J.,
Samama, P., Patel, S., Burbaum, J., Stroke, I. L. & Appell, K.
C. (1998). Chemokine receptor-ligand interactions measured using
time-resolved fluorescence. Biochemistry 37, 2372-2377. [0292] 39.
Jones, G. & Sharp, P. A. (1997). Ultraspiracle: an invertebrate
nuclear receptor for juvenile hormones. Proc. Natl. Acad. Sci. USA
94, 13499-503. [0293] 40. Jones, T. A., Zou, J.-Y., Cowan, S. W.
& Kjeldgaard, M. (1991). Improved methods for building protein
models in electron density maps and the location of errors in these
models. Acta Crystallogr. A 47, 110-119. [0294] 41. Kasuya, A.,
Sawada, Y., Tsukamoto, Y., Tanaka, K., Toya, T. & Yanagi, M.
(2003).
[0295] Binding mode of ecdysone agonists to the receptor:
comparative modeling and docking studies. J. Mol. Model (Online) 9,
58-65. [0296] 42. Kleywegt, G. J. & Jones, T. A. (1994).
Detection, delineation, measurement and display of cavities in
macromolecular structures. Acta Crystallogr. D 50, 178-185. [0297]
43. Koelle, M. R., Talbot, W. S., Segraves, W. A., Bender, M. T.,
Cherbas, P. & Hogness, D. S. (1991). The Drosophila EcR gene
encodes an ecdysone receptor, a new member of the steroid receptor
superfamily. Cell 67, 59-77. [0298] 44. Kumar, M. B., Fujimoto, T.,
Potter, D. W., Deng, Q. & Palli, S. R. (2002). A single point
mutation in ecdysone receptor leads to increased ligand
specificity: Implications for gene switch applications. Proc. Natl.
Acad. Sci. USA 99, 14710-14715. [0299] 45. Kuntz, I. D., Blaney, J.
M., Oatley, S. J., Langridge, R. & Ferrin, T. E. (1982). A
geometric approach to macromolecule-ligand interactions. J. Mol.
Biol. 161, 269-288. [0300] 46. Langer, T. & Hoffiann, R. D.
(2001). Virtual Screening: An Effective Tool for Lead Structure
Discovery? Currrent Pharmaceutical Design 7, 509-527. [0301] 47.
Laskowski, R. A., MacArthur, M. W., Moss, D. S. & Thornton, J.
M. (1993). PROCHECK: a program to check the stereochemical quality
of protein structures. J. Appl Crystallogr. 26, 283-291. [0302] 48.
Lattman, E. (1985). Diffraction methods for biological
macromolecules. Use of the rotation and translation functions.
Methods Enzymol. 115, 55-77. [0303] 49. Le Douarin, B., Zechel, C.,
Garnier, J. M., Lutz, Y., Tora, L., Pierrat, P., Heery, D.,
Gronemeyer, H., Chambon, P. & Losson, R. (1995). The N-terminal
part of TIF1, a putative mediator of the ligand- dependent
activation function (AF-2) of nuclear receptors, is fused to B-raf
in the oncogenic protein T18. EMBO J. 14, 2020-2033. [0304] 50.
Loughney, D. A., Murray, W. V. & Jolliffe, L. K. (1999).
Application of virtual screening tols to a protein-protein
interaction: database mining studies on the growth hormone
receptor. Med. Chem. Res. 9, 579-591. [0305] 51. Luthy, R., Bowie,
J. U. & Eisenberg, D. (1992). Assessment of protein models with
three-dimensional profiles. Nature 356, 83-85. [0306] 52.
McPherson, A. (1982). Preparation and analysis of protein crystals.
Wiley, New York. [0307] 53. Molloy, P. L. (2000). Electrophoretic
mobility shift assays. Methods Mol. Biol. 130, 235-246. [0308] 54.
Nienaber, V. L., Richardson, P. L., Klighofer, V., Bouska, J. J.,
Giranda, V. L. & Greer, J. (2000). Discovering novel ligands
for macromolecules using X-ray crystallographic screening. Nat
Biotechnol. 18, 1105-1108. [0309] 55. Oberdorster, E., Clay, M. A.,
Cottam, D. M., Wilmot, F. A., McLachlan, J. A. & Milner, M. J.
(2001). Common phytochemicals are ecdysteroid agonists and
antagonists: a possible evolutionary link between vertebrate and
invertebrate steroid hormones. J. Steroid Biochem. Mol. Biol. 77,
229-238. [0310] 56. Okayama, H., Kawaichi, M., Brownstein M., Lee,
F., Yokota, T. & Arai, K. (1987). High-efficiency cloning of
full-length cDNA; construction and screening of cDNA expression
libraries for mammalian cells. Methods Enzymol. 154,3-28. [0311]
57. Oro, A. E., McKeown, M. & Evans, R. M. (1990). Relationship
between the product of the Drosophila ultraspiracle locus and the
vertebrate retinoid X receptor. Nature 347, 298-301. [0312] 58.
Otwinowski, Z. & Minor, W. (1997). Processing of X-ray
diffraction data collected in oscillation mode. Methods Enzymol.
276,307-326. [0313] 59. Perlmann, T., Umesono, K., Rangarajan, P.
N., Forman, B. M. & Evans, R. M. (1996). Two distinct
dimerization interfaces differentially modulate target gene
specificity of nuclear hormone receptors. Mol. Endocrinol. 10,
958-966. [0314] 60. Rarey, M., Kramer, B., Lengauer, T. &
Klebe, G. (1996). A fast flexible docking method using an
incremental construction algorithm. J. Mol. Biol. 261, 470-489.
[0315] 61. Renaud, J. P. & Moras, D. (2000). Structural studies
on nuclear receptors. Cell Mol. Life Sci. 57, 1748-1769. [0316] 62.
Rossmann, M. G. (1990). The molecular replacement method. Acta
Cyrstallogr. A 46, 73-82. [0317] 63. Sali, A. & Blundell, T. L.
(1993). Comparative protein modelling by satisfaction of spatial
restraints. J. Mol. Biol. 234, 779-815. [0318] 64. Sambrook, J.,
Fritsch, E. F. & Maniatis, T. (1989). Molecular Cloning (2nd
ed.). Cold Spring Harbor Laboratory Press, Cold Spring Harbor.
[0319] 65. Sasorith, S., Billas, I. M. L., Iwema, T., Moras, D.
& Wurtz, J. M. (2002). Structure-based analysis of the
ultraspiracle protein and docling studies of putative ligands. J.
Insect Sci. 2, 1-11. [0320] 66. Sheridan, R. P. &
Venkataraghavan, R. (1987). New methods in computer-aided drug
design. Acc. Chem. Res. 20, 322-329. [0321] 67. Singh, S. K.,
Maithal, K., Balaram, H. & Balaram, P. (2001). Synthetic
peptides as inactivators of multimeric enzymes: inhibition of
Plasmodium falciparum triosephosphate isomerase by interface
peptides. FEBS Lett. 501, 19-23. [0322] 68. Sippl, M. J. (1993).
Recognition of errors in three-dimensional structures of proteins.
Proteins 17, 355-362. [0323] 69. Sundaram, M., Palli, S. R., Krell,
P. J., Sohi, S. S., Dhadialla, T. S. & Retnakaran, A. (1998).
Basis for selective action of a synthetic molting hormone agonist,
RH-5992 on lepidopteran insects. Insect Biochem. Mol. Biol. 28,
693-704. [0324] 70. Teng, T. Y. (1990). Mounting of crystal for
macromolecular crystallography in a free-standing thin film. J.
Appl. Crystallogr. 23, 387-391. [0325] 71. Tran, H. T., Shaaban,
S., Askari, H. B., Walfish, P. G., Raikhel, A. S. & Butt, T. R.
(2001). Requirement of co-factors for the ligand-mediated activity
of the insect ecdysteroid receptor in yeast. J. Mol. Endocrinol.
27, 191-209. [0326] 72. Tzertzinis, G., Malecki, A. & Kafatos,
F. C. (1994). BmCF1, a Bombyx mori RXR-type receptor related to the
Drosophila ultraspiracle. J. Mol. Biol. 238, 479-486. [0327] 73.
Umesono, K. & Evans, R. M. (1989). Determinants of target gene
specificity for steroid/thyroid hormone receptors. Cell 157,
1139-1146. [0328] 74. Vagin, A. & Teplyakov, A. (1997). MOLREP:
an automated program for molecular replacement. J. Appl. Cryst. 30,
1022-1025. [0329] 75. Verlinde, C. L. & Hol, W. G. (1994).
Structure-based drug design: progress, results and challenges.
Structure 2, 577-57. [0330] 76. Walters, W. P., Stahl, M. T. &
Murcko, M. A. (1998). Virtual screening--an overview. Drug
Discovery Today 3, 160-178. [0331] 77. Westin, S., Kurokawa, R.,
Nolte, R. T., Wisely, G. B., McInerney, E. M., Rose, D. W.,
Milburn, M. V., Rosenfeld, M. G. & Glass, C. K. (1998).
Interactions controlling the assembly of nuclear-receptor
heterodimers and co-activators. Nature 395, 199-202. [0332] 78.
Williams, C. D. (1967). The juvenile hormone II. Its role in the
endocrine control of molting, pupation, and adult development of
the cecropia silkworm. Biol. Bull. Woods Hole 121, 572-585. [0333]
79. Williams, C. M. (1967). Third-generation pesticides. Sci. Am.
217, 13-7. [0334] 80. Wing, K. D. (1988). RH5849, a nonsteroidal
ecdysone agonist: effects on a Drosophila cell line. Science 241,
467-9. [0335] 81. Wing, K. D., Slawecki, R. A. & Carlson, G. R.
(1988). RH5849, a nonsteroidal ecdysone agonist, effects on larval
lepidoptera. Science 241, 470-472. [0336] 82. Wurtz, J. M.,
Guillot, B., Fagart, J., Moras, D., Tietjen, K. & Schindler, M.
(2000). A new model for 20-hydroxyecdysone and dibenzoylhydrazine
binding: a homology modeling and docking approach. Protein Sci. 9,
1073-1084. [0337] 83. Yang, G., Hannan, G. N., Lockett, T. J. &
Hill, R. J. (1986). Functional transfer of an elementary ecdysone
gene regulatory system to mammalian cells: transient transfection
and stable cell lines. Eur. J. Entomol. 92, 379-389. [0338] 84.
Yao, T. P., Forman, B. M., Jiang, Z., Cherbas, L., Chen, J. D.,
McKeown, M., Cherbas, P. & Evans, R. M. (1993). Functional
ecdysone receptor is the product of EcR and Ultraspiracle genes.
Nature 366, 476-479. [0339] 85. Yudt, M. R. & Koide, S. (2001).
Preventing estrogen receptor action with dimer-interface peptides.
Steroids 66, 549-58. [0340] 86. Yund, M. A., King, D. S. &
Fristrom, J. W. (1978). Ecdysteroid receptors in imaginal discs of
Drosophila melanogaster. Proc. Natl. Acad. Sci. USA 75,
6039-43.
[0341] 87. Zilliacus J., Wright, A. P., Carlstedt-Duke, J. &
Gustafsson, J. A. (1995. Structural determinants of DNA-binding
specificity be steroid receptors. Mol Endocrinol 9, 389-400.
TABLE-US-00006 APPENDIX I The three-dimensional coordinates of the
BtEcr/BtUSP LBD heterodimer in Protein Databank format (Bernstein
et al., 1977). ATOM 1 CB VAL U 300 12.479 120.374 11.780 1.00 96.45
U ATOM 2 CG1 VAL U 300 13.280 120.902 12.976 1.00 94.22 U ATOM 3
CG2 VAL U 300 12.769 118.881 11.524 1.00 92.13 U ATOM 4 C VAL U 300
10.448 119.789 13.212 1.00 91.04 U ATOM 5 O VAL U 300 10.653
120.175 14.370 1.00 88.24 U ATOM 6 N VAL U 300 10.637 122.069
12.175 1.00 91.77 U ATOM 7 CA VAL U 300 10.938 120.609 12.006 1.00
93.66 U ATOM 8 N SER U 301 9.797 118.659 12.928 1.00 87.56 U ATOM 9
CA SER U 301 9.261 117.778 13.969 1.00 83.83 U ATOM 10 CB SER U 301
8.702 116.493 13.349 1.00 82.36 U ATOM 11 OG SER U 301 8.349
115.553 14.352 1.00 74.68 U ATOM 12 C SER U 301 10.290 117.407
15.028 1.00 84.26 U ATOM 13 O SER U 301 11.489 117.600 14.847 1.00
87.37 U ATOM 14 N ASP U 302 9.812 116.854 16.134 1.00 80.44 U ATOM
15 CA ASP U 302 10.692 116.461 17.223 1.00 75.43 U ATOM 16 CB ASP U
302 9.860 116.236 18.489 1.00 76.98 U ATOM 17 CG ASP U 302 10.571
116.702 19.741 1.00 78.13 U ATOM 18 OD1 ASP U 302 11.038 117.865
19.764 1.00 77.43 U ATOM 19 OD2 ASP U 302 10.656 115.912 20.705
1.00 77.91 U ATOM 20 C ASP U 302 11.445 115.185 16.839 1.00 71.80 U
ATOM 21 O ASP U 302 12.676 115.121 16.897 1.00 68.49 U ATOM 22 N
ILE U 303 10.688 114.170 16.439 1.00 67.67 U ATOM 23 CA ILE U 303
11.266 112.904 16.035 1.00 61.72 U ATOM 24 CB ILE U 303 10.193
111.814 15.922 1.00 56.36 U ATOM 25 CG2 ILE U 303 9.165 112.226
14.886 1.00 50.29 U ATOM 26 CG1 ILE U 303 10.818 110.494 15.476
1.00 53.55 U ATOM 27 CD1 ILE U 303 12.092 110.141 16.184 1.00 49.74
U ATOM 28 C ILE U 303 11.935 113.064 14.679 1.00 64.96 U ATOM 29 O
ILE U 303 12.902 112.376 14.373 1.00 68.02 U ATOM 30 N CYS U 304
11.422 113.973 13.860 1.00 66.56 U ATOM 31 CA CYS U 304 12.003
114.175 12.548 1.00 68.23 U ATOM 32 CB CYS U 304 11.138 115.090
11.694 1.00 62.87 U ATOM 33 SG CYS U 304 10.279 114.150 10.444 1.00
73.57 U ATOM 34 C CYS U 304 13.410 114.717 12.600 1.00 71.44 U ATOM
35 O CYS U 304 14.295 114.194 11.920 1.00 75.51 U ATOM 36 N GLN U
305 13.635 115.756 13.399 1.00 71.15 U ATOM 37 CA GLN U 305 14.978
116.312 13.464 1.00 66.48 U ATOM 38 CB GLN U 305 14.992 117.701
14.120 1.00 74.21 U ATOM 39 CG GLN U 305 14.420 117.759 15.524 1.00
83.63 U ATOM 40 CD GLN U 305 14.512 119.150 16.138 1.00 85.41 U
ATOM 41 OE1 GLN U 305 13.922 120.114 15.628 1.00 84.23 U ATOM 42
NE2 GLN U 305 15.250 119.259 17.245 1.00 83.08 U ATOM 43 C GLN U
305 15.886 115.353 14.199 1.00 57.19 U ATOM 44 O GLN U 305 17.106
115.417 14.037 1.00 56.19 U ATOM 45 N ALA U 306 15.298 114.457
14.997 1.00 48.54 U ATOM 46 CA ALA U 306 16.101 113.458 15.708 1.00
45.61 U ATOM 47 CB ALA U 306 15.261 112.698 16.717 1.00 28.22 U
ATOM 48 C ALA U 306 16.651 112.502 14.647 1.00 47.44 U ATOM 49 O
ALA U 306 17.826 112.159 14.660 1.00 55.69 U ATOM 50 N ALA U 307
15.791 112.100 13.716 1.00 42.85 U ATOM 51 CA ALA U 307 16.157
111.210 12.632 1.00 41.52 U ATOM 52 CB ALA U 307 14.924 110.873
11.825 1.00 43.36 U ATOM 53 C ALA U 307 17.188 111.885 11.740 1.00
42.82 U ATOM 54 O ALA U 307 18.173 111.277 11.325 1.00 42.93 U ATOM
55 N ASP U 308 16.947 113.151 11.448 1.00 43.61 U ATOM 56 CA ASP U
308 17.849 113.911 10.605 1.00 50.98 U ATOM 57 CB ASP U 308 17.300
115.332 10.383 1.00 59.56 U ATOM 58 CG ASP U 308 16.155 115.378
9.349 1.00 77.63 U ATOM 59 OD1 ASP U 308 16.431 115.189 8.136 1.00
77.42 U ATOM 60 OD2 ASP U 308 14.980 115.602 9.745 1.00 83.75 U
ATOM 61 C ASP U 308 19.253 113.961 11.193 1.00 50.06 U ATOM 62 O
ASP U 308 20.232 113.759 10.470 1.00 48.52 U ATOM 63 N ARG U 309
19.343 114.215 12.501 1.00 50.01 U ATOM 64 CA ARG U 309 20.626
114.306 13.212 1.00 46.81 U ATOM 65 CB ARG U 309 20.416 114.928
14.611 1.00 52.16 U ATOM 66 CG ARG U 309 21.719 115.269 15.356 1.00
64.05 U ATOM 67 CD ARG U 309 21.480 115.849 16.754 1.00 72.60 U
ATOM 68 NE ARG U 309 22.329 115.193 17.760 1.00 85.46 U ATOM 69 CZ
ARG U 309 22.274 115.409 19.078 1.00 83.67 U ATOM 70 NH1 ARG U 309
21.406 116.281 19.585 1.00 76.09 U ATOM 71 NH2 ARG U 309 23.078
114.731 19.895 1.00 78.11 U ATOM 72 C ARG U 309 21.261 112.918
13.339 1.00 43.26 U ATOM 73 O ARG U 309 22.461 112.740 13.156 1.00
38.45 U ATOM 74 N GLN U 310 20.429 111.933 13.626 1.00 40.97 U ATOM
75 CA GLN U 310 20.876 110.561 13.793 1.00 41.56 U ATOM 76 CB GLN U
310 19.677 109.664 14.090 1.00 41.72 U ATOM 77 CG GLN U 310 20.043
108.269 14.527 1.00 42.82 U ATOM 78 CD GLN U 310 19.845 108.037
16.008 1.00 43.14 U ATOM 79 OE1 GLN U 310 20.101 106.941 16.498
1.00 51.10 U ATOM 80 NE2 GLN U 310 19.390 109.058 16.730 1.00 41.54
U ATOM 81 C GLN U 310 21.632 110.016 12.589 1.00 41.73 U ATOM 82 O
GLN U 310 22.583 109.243 12.747 1.00 41.77 U ATOM 83 N LEU U 311
21.197 110.398 11.391 1.00 39.72 U ATOM 84 CA LEU U 311 21.866
109.940 10.182 1.00 42.01 U ATOM 85 CB LEU U 311 20.929 110.010
8.990 1.00 33.72 U ATOM 86 CG LEU U 311 19.901 108.911 9.253 1.00
37.21 U ATOM 87 CD1 LEU U 311 18.722 109.006 8.305 1.00 42.07 U
ATOM 88 CD2 LEU U 311 20.620 107.581 9.118 1.00 28.89 U ATOM 89 C
LEU U 311 23.073 110.792 9.958 1.00 42.61 U ATOM 90 O LEU U 311
24.155 110.282 9.701 1.00 47.17 U ATOM 91 N TYR U 312 22.893
112.099 10.075 1.00 44.31 U ATOM 92 CA TYR U 312 24.008 113.006
9.915 1.00 43.52 U ATOM 93 CB TYR U 312 23.604 114.426 10.302 1.00
42.27 U ATOM 94 CG TYR U 312 24.792 115.357 10.330 1.00 51.55 U
ATOM 95 CD1 TYR U 312 25.523 115.604 9.166 1.00 54.42 U ATOM 96 CE1
TYR U 312 26.673 116.375 9.190 1.00 58.59 U ATOM 97 CD2 TYR U 312
25.244 115.920 11.532 1.00 51.32 U ATOM 98 CE2 TYR U 312 26.399
116.696 11.572 1.00 52.75 U ATOM 99 CZ TYR U 312 27.110 116.923
10.393 1.00 60.94 U ATOM 100 OH TYR U 312 28.250 117.704 10.392
1.00 62.51 U ATOM 101 C TYR U 312 25.162 112.540 10.818 1.00 47.20
U ATOM 102 O TYR U 312 26.327 112.512 10.401 1.00 48.75 U ATOM 103
N GLN U 313 24.847 112.178 12.060 1.00 45.21 U ATOM 104 CA GLN U
313 25.890 111.721 12.967 1.00 44.40 U ATOM 105 CB GLN U 313 25.327
111.573 14.384 1.00 43.42 U ATOM 106 CG GLN U 313 25.057 112.909
15.071 1.00 53.09 U ATOM 107 CD GLN U 313 24.580 112.759 16.512
1.00 62.29 U ATOM 108 OE1 GLN U 313 23.510 112.193 16.786 1.00
71.08 U ATOM 109 NE2 GLN U 313 25.371 113.273 17.442 1.00 58.49 U
ATOM 110 C GLN U 313 26.522 110.403 12.483 1.00 46.69 U ATOM 111 O
GLN U 313 27.740 110.199 12.583 1.00 42.76 U ATOM 112 N LEU U 314
25.700 109.515 11.935 1.00 44.18 U ATOM 113 CA LEU U 314 26.205
108.241 11.455 1.00 40.49 U ATOM 114 CB LEU U 314 25.078 107.378
10.894 1.00 37.07 U ATOM 115 CG LEU U 314 25.487 106.015 10.333
1.00 26.82 U ATOM 116 CD1 LEU U 314 25.942 105.112 11.450 1.00
20.92 U ATOM 117 CD2 LEU U 314 24.305 105.419 9.604 1.00 27.59 U
ATOM 118 C LEU U 314 27.211 108.457 10.359 1.00 41.48 U ATOM 119 O
LEU U 314 28.371 108.067 10.471 1.00 48.20 U ATOM 120 N ILE U 315
26.752 109.075 9.283 1.00 40.04 U ATOM 121 CA ILE U 315 27.601
109.321 8.141 1.00 36.91 U ATOM 122 CB ILE U 315 26.784 110.052
7.060 1.00 30.15 U ATOM 123 CG2 ILE U 315 27.582 110.195 5.774 1.00
30.46 U ATOM 124 CG1 ILE U 315 25.569 109.182 6.721 1.00 34.16 U
ATOM 125 CD1 ILE U 315 24.361 109.924 6.166 1.00 33.94 U ATOM 126 C
ILE U 315 28.866 110.078 8.566 1.00 43.49 U ATOM 127 O ILE U 315
29.968 109.764 8.120 1.00 37.56 U ATOM 128 N GLU U 316 28.731
111.041 9.470 1.00 47.27 U ATOM 129 CA GLU U 316 29.905 111.782
9.902 1.00 43.86 U ATOM 130 CB GLU U 316 29.477 113.020 10.704 1.00
50.83 U ATOM 131 CG GLU U 316 30.378 114.251 10.478 1.00 60.61 U
ATOM 132 CD GLU U 316 30.496 114.645 8.997 1.00 70.18 U ATOM 133
OE1 GLU U 316 29.452 114.676 8.297 1.00 69.12 U ATOM 134 OE2 GLU U
316 31.633 114.931 8.536 1.00 72.57 U ATOM 135 C GLU U 316 30.824
110.863 10.723 1.00 43.27 U ATOM 136 O GLU U 316 32.046 110.987
10.673 1.00 47.56 U ATOM 137 N TRP U 317 30.240 109.932 11.470 1.00
37.75 U ATOM 138 CA TRP U 317 31.026 108.998 12.267 1.00 34.00 U
ATOM 139 CB TRP U 317 30.098 108.038 13.010 1.00 31.02 U ATOM 140
CG TRP U 317 30.770 106.786 13.514 1.00 30.93 U ATOM 141 CD2 TRP U
317 30.677 105.464 12.939 1.00 36.63 U ATOM 142 CE2 TRP U 317
31.489 104.612 13.723 1.00 31.60 U ATOM 143 CE3 TRP U 317 29.984
104.921 11.837 1.00 34.52 U ATOM 144 CD1 TRP U 317 31.603 106.682
14.575 1.00 27.55 U ATOM 145 NE1 TRP U 317 32.042 105.381 14.712
1.00 32.28 U ATOM 146 CZ2 TRP U 317 31.641 103.245 13.442 1.00
34.19 U ATOM 147 CZ3 TRP U 317 30.134 103.563 11.556 1.00 37.31 U
ATOM 148 CH2 TRP U 317 30.958 102.741 12.363 1.00 38.29 U ATOM 149
C TRP U 317 31.947 108.198 11.362 1.00 39.77 U ATOM 150 O TRP U 317
33.158 108.126 11.601 1.00 41.36 U ATOM 151 N ALA U 318 31.353
107.595 10.328 1.00 37.36 U ATOM 152 CA ALA U 318 32.080 106.776
9.367 1.00 37.84 U ATOM 153 CB ALA U 318 31.113 106.097 8.414 1.00
32.85 U ATOM 154 C ALA U 318 33.100 107.568 8.578 1.00 37.92 U ATOM
155 O ALA U 318 34.186 107.062 8.285 1.00 35.70 U ATOM 156 N LYS U
319 32.750 108.803 8.223 1.00 38.77 U ATOM 157 CA LYS U 319 33.664
109.648 7.463 1.00 38.43 U ATOM 158 CB LYS U 319 33.133 111.080
7.305 1.00 45.25 U ATOM 159 CG LYS U 319 32.079 111.337 6.210 1.00
37.31 U ATOM 160 CD LYS U 319 31.811 112.825 6.122 1.00 35.09 U
ATOM 161 CE LYS U 319 30.710 113.157 5.148 1.00 50.28 U ATOM 162 NZ
LYS U 319 30.362 114.621 5.151 1.00 53.41 U ATOM 163 C LYS U 319
34.961 109.683 8.230 1.00 39.01 U ATOM 164 O LYS U 319 36.032
109.652 7.622 1.00 43.09 U ATOM 165 N HIS U 320 34.863 109.700
9.562 1.00 34.70 U ATOM 166 CA HIS U 320 36.051 109.746 10.416 1.00
33.00 U ATOM 167 CB HIS U 320 35.813 110.644 11.619 1.00 29.91 U
ATOM 168 CG HIS U 320 35.554 112.066 11.252 1.00 44.90 U ATOM 169
CD2 HIS U 320 36.398 113.109 11.075 1.00 51.89 U ATOM 170 ND1 HIS U
320 34.296 112.533 10.940 1.00 51.08 U ATOM 171 CE1 HIS U 320
34.379 113.803 10.583 1.00 56.48 U ATOM 172 NE2 HIS U 320 35.644
114.177 10.655 1.00 56.71 U ATOM 173 C HIS U 320 36.674 108.450
10.918 1.00 32.75 U ATOM 174 O HIS U 320 37.456 108.498 11.863 1.00
36.77 U ATOM 175 N ILE U 321 36.344 107.309 10.311 1.00 32.76 U
ATOM 176 CA ILE U 321 36.939 106.030 10.720 1.00 30.81 U ATOM 177
CB ILE U 321 36.039 104.819 10.404 1.00 32.67 U ATOM 178 CG2 ILE U
321 36.873 103.557 10.448 1.00 26.36 U ATOM 179 CG1 ILE U 321
34.802 104.788 11.313 1.00 25.98 U ATOM 180 CD1 ILE U 321 35.120
104.784 12.742 1.00 38.19 U ATOM 181 C ILE U 321 38.172 105.883
9.852 1.00 30.90 U ATOM 182 O ILE U 321 38.075 105.950 8.629 1.00
40.52 U ATOM 183 N PRO U 322 39.342 105.684 10.461 1.00 28.11 U
ATOM 184 CD PRO U 322 39.609 105.683 11.907 1.00 29.42 U ATOM 185
CA PRO U 322 40.588 105.540 9.710 1.00 28.24 U ATOM 186 CB PRO U
322 41.553 105.017 10.759 1.00 27.46 U ATOM 187 CG PRO U 322 41.128
105.777 11.954 1.00 32.35 U ATOM 188 C PRO U 322 40.531 104.655
8.484 1.00 28.10 U ATOM 189 O PRO U 322 40.343 103.452 8.604 1.00
40.32 U ATOM 190 N HIS U 323 40.715 105.275 7.316 1.00 26.78 U ATOM
191 CA HIS U 323 40.725 104.621 6.004 1.00 26.63 U ATOM 192 CB HIS
U 323 41.352 103.242 6.102 1.00 25.78 U ATOM 193 CG HIS U 323
42.711 103.264 6.703 1.00 39.81 U ATOM 194 CD2 HIS U 323 43.216
102.640 7.790 1.00 48.36 U ATOM 195 ND1 HIS U 323 43.721 104.060
6.209 1.00 41.57 U ATOM 196 CE1 HIS U 323 44.791 103.926 6.971 1.00
48.87 U ATOM 197 NE2 HIS U 323 44.513 103.072 7.938 1.00 53.44 U
ATOM 198 C HIS U 323 39.404 104.494 5.273 1.00 30.76 U ATOM 199 O
HIS U 323 39.392 104.202 4.083 1.00 31.32 U ATOM 200 N PHE U 324
38.295 104.709 5.970 1.00 35.37 U ATOM 201 CA PHE U 324 36.990
104.584 5.340 1.00 36.68 U ATOM 202 CB PHE U 324 35.886 105.074
6.275 1.00 30.95 U ATOM 203 CG PHE U 324 34.511 104.881 5.707 1.00
38.02 U ATOM 204 CD1 PHE U 324 33.991 103.587 5.532 1.00 32.62 U
ATOM 205 CD2 PHE U 324 33.763 105.979 5.261 1.00 34.48 U ATOM 206
CE1 PHE U 324 32.750 103.397 4.911 1.00 29.22 U ATOM 207 CE2 PHE U
324 32.511 105.800 4.636 1.00 31.30 U ATOM 208 CZ PHE U 324 32.006
104.514 4.460 1.00 25.37 U ATOM 209 C PHE U 324 36.886 105.351
4.015 1.00 41.75 U ATOM 210 O PHE U 324 36.539 104.785 2.970 1.00
38.18 U ATOM 211 N THR U 325 37.185 106.648 4.072 1.00 42.47 U ATOM
212 CA THR U 325 37.104 107.509 2.903 1.00 37.33 U ATOM 213 CB THR
U 325 37.091 108.974 3.289 1.00 32.20 U ATOM 214 OG1 THR U 325
38.139 109.224 4.227 1.00 37.87 U ATOM 215 CG2 THR U 325 35.746
109.344 3.895 1.00 29.55 U ATOM 216 C THR U 325 38.204 107.295
1.900 1.00 38.08 U ATOM 217 O THR U 325 38.262 108.000 0.900 1.00
45.26 U ATOM 218 N GLU U 326 39.086 106.339 2.156 1.00 35.21 U ATOM
219 CA GLU U 326 40.130 106.050 1.197 1.00 35.59 U ATOM 220 CB GLU
U 326 41.426 105.642 1.898 1.00 43.50 U ATOM 221 CG GLU U 326
41.942 106.651 2.935 1.00 52.68 U ATOM 222 CD GLU U 326 43.381
106.359 3.366 1.00 56.78 U ATOM 223 OE1 GLU U 326 43.728 105.172
3.600 1.00 52.62 U ATOM 224 OE2 GLU U 326 44.166 107.324 3.477 1.00
55.12 U ATOM 225 C GLU U 326 39.602 104.923 0.303 1.00 34.41 U ATOM
226 O GLU U 326 40.253 104.499 -0.638 1.00 39.17 U ATOM 227 N LEU U
327 38.414 104.424 0.604 1.00 35.62 U ATOM 228 CA LEU U 327 37.811
103.391 -0.233 1.00 34.31 U ATOM 229 CB LEU U 327 36.799 102.573
0.556 1.00 29.93 U ATOM 230 CG LEU U 327 37.272 101.577 1.587 1.00
28.51 U ATOM 231 CD1 LEU U 327 36.200 101.454 2.633 1.00 31.32 U
ATOM 232 CD2 LEU U 327 37.546 100.223 0.935 1.00 31.78 U ATOM 233 C
LEU U 327 37.077 104.099 -1.380 1.00 34.86 U ATOM 234 O LEU U 327
36.764 105.291 -1.298 1.00 32.50 U ATOM 235 N PRO U 328 36.783
103.368 -2.461 1.00 34.61 U ATOM 236 CD PRO U 328 37.056 101.942
-2.704 1.00 36.41 U ATOM 237 CA PRO U 328 36.081 103.965 -3.601
1.00 36.93 U ATOM 238 CB PRO U 328 35.954 102.792 -4.566 1.00 42.49
U ATOM 239 CG PRO U 328 37.112 101.898 -4.186 1.00 35.91 U ATOM 240
C PRO U 328 34.722 104.507 -3.154 1.00 35.70 U ATOM 241 O PRO U 328
33.939 103.798 -2.539 1.00 40.26 U
ATOM 242 N VAL U 329 34.423 105.752 -3.467 1.00 33.92 U ATOM 243 CA
VAL U 329 33.162 106.304 -3.012 1.00 40.39 U ATOM 244 CB VAL U 329
32.844 107.587 -3.719 1.00 37.74 U ATOM 245 CG1 VAL U 329 31.899
108.388 -2.864 1.00 32.09 U ATOM 246 CG2 VAL U 329 34.131 108.345
-4.006 1.00 46.30 U ATOM 247 C VAL U 329 31.940 105.397 -3.140 1.00
45.16 U ATOM 248 O VAL U 329 31.085 105.387 -2.254 1.00 48.70 U
ATOM 249 N GLU U 330 31.853 104.648 -4.235 1.00 47.59 U ATOM 250 CA
GLU U 330 30.727 103.748 -4.479 1.00 49.23 U ATOM 251 CB GLU U 330
30.852 103.100 -5.862 1.00 57.88 U ATOM 252 CG GLU U 330 31.492
104.010 -6.919 1.00 75.31 U ATOM 253 CD GLU U 330 33.028 104.105
-6.791 1.00 85.37 U ATOM 254 OE1 GLU U 330 33.717 103.102 -7.112
1.00 88.41 U ATOM 255 OE2 GLU U 330 33.545 105.175 -6.370 1.00
81.90 U ATOM 256 C GLU U 330 30.691 102.671 -3.406 1.00 47.32 U
ATOM 257 O GLU U 330 29.619 102.265 -2.959 1.00 47.52 U ATOM 258 N
ASP U 331 31.868 102.202 -3.004 1.00 46.97 U ATOM 259 CA ASP U 331
31.990 101.196 -1.951 1.00 48.96 U ATOM 260 CB ASP U 331 33.414
100.659 -1.932 1.00 49.87 U ATOM 261 CG ASP U 331 33.605 99.555
-2.924 1.00 53.38 U ATOM 262 OD1 ASP U 331 32.709 99.411 -3.783
1.00 56.13 U ATOM 263 OD2 ASP U 331 34.625 98.839 -2.843 1.00 47.10
U ATOM 264 C ASP U 331 31.610 101.797 -0.588 1.00 49.54 U ATOM 265
O ASP U 331 31.048 101.121 0.289 1.00 48.49 U ATOM 266 N GLN U 332
31.930 103.074 -0.421 1.00 44.30 U ATOM 267 CA GLN U 332 31.575
103.789 0.783 1.00 43.21 U ATOM 268 CB GLN U 332 32.120 105.208
0.724 1.00 43.36 U ATOM 269 CG GLN U 332 33.592 105.290 0.982 1.00
47.06 U ATOM 270 CD GLN U 332 34.061 106.702 1.038 1.00 50.14 U
ATOM 271 OE1 GLN U 332 33.377 107.574 1.575 1.00 50.22 U ATOM 272
NE2 GLN U 332 35.235 106.948 0.493 1.00 53.82 U ATOM 273 C GLN U
332 30.050 103.827 0.896 1.00 44.72 U ATOM 274 O GLN U 332 39.500
103.632 1.972 1.00 49.65 U ATOM 275 N VAL U 333 29.362 104.079
-0.214 1.00 42.41 U ATOM 276 CA VAL U 333 27.905 104.118 -0.187
1.00 40.09 U ATOM 277 CB VAL U 333 27.352 104.654 -1.510 1.00 33.88
U ATOM 278 CG1 VAL U 333 25.838 104.693 -1.470 1.00 30.31 U ATOM
279 CG2 VAL U 333 27.882 106.070 -1.729 1.00 33.72 U ATOM 280 C VAL
U 333 27.364 102.723 0.107 1.00 40.39 U ATOM 281 O VAL U 333 26.491
102.535 0.959 1.00 40.57 U ATOM 282 N ILE U 334 27.907 101.742
-0.588 1.00 36.75 U ATOM 283 CA ILE U 334 27.525 100.361 -0.367
1.00 39.58 U ATOM 284 CB ILE U 334 28.405 99.427 -1.207 1.00 42.58
U ATOM 285 CG2 ILE U 334 28.248 97.979 -0.742 1.00 45.90 U ATOM 286
CG1 ILE U 334 28.075 99.618 -2.685 1.00 39.08 U ATOM 287 CD1 ILE U
334 28.839 98.687 -3.563 1.00 41.96 U ATOM 288 C ILE U 334 27.676
99.956 1.105 1.00 41.97 U ATOM 289 O ILE U 334 26.748 99.416 1.721
1.00 41.77 U ATOM 290 N LEU U 335 28.855 100.203 1.662 1.00 38.84 U
ATOM 291 CA LEU U 335 39.093 99.825 3.037 1.00 38.04 U ATOM 292 CB
LEU U 335 30.542 100.127 3.430 1.00 38.86 U ATOM 293 CG LEU U 335
31.569 99.106 2.923 1.00 41.31 U ATOM 294 CD1 LEU U 335 32.952
99.609 3.226 1.00 48.69 U ATOM 295 CD2 LEU U 335 31.358 97.753
3.575 1.00 36.63 U ATOM 296 C LEU U 335 28.125 100.474 4.014 1.00
34.75 U ATOM 297 O LEU U 335 27.690 99.840 4.974 1.00 35.11 U ATOM
298 N LEU U 336 27.780 101.728 3.765 1.00 30.31 U ATOM 299 CA LEU U
336 26.864 102.451 4.635 1.00 32.58 U ATOM 300 CB LEU U 336 27.018
103.970 4.452 1.00 34.63 U ATOM 301 CG LEU U 336 28.050 104.689
5.334 1.00 35.17 U ATOM 302 CD1 LEU U 336 28.378 106.062 4.769 1.00
29.95 U ATOM 303 CD2 LEU U 336 27.496 104.800 6.744 1.00 31.44 U
ATOM 304 C LEU U 336 25.430 102.069 4.353 1.00 35.51 U ATOM 305 O
LEU U 336 24.641 101.884 5.281 1.00 35.28 U ATOM 306 N LYS U 337
25.084 101.951 3.071 1.00 36.77 U ATOM 307 CA LYS U 337 23.713
101.615 2.720 1.00 34.23 U ATOM 308 CB LYS U 337 23.507 101.623
1.206 1.00 41.87 U ATOM 309 CG LYS U 337 22.052 101.329 0.782 1.00
47.78 U ATOM 310 CD LYS U 337 21.822 101.410 -0.726 1.00 43.48 U
ATOM 311 CE LYS U 337 20.514 100.743 -1.064 1.00 42.29 U ATOM 312
NZ LYS U 337 20.043 101.077 -2.425 1.00 54.28 U ATOM 313 C LYS U
337 23.357 100.263 3.289 1.00 33.22 U ATOM 314 O LYS U 337 22.211
100.016 3.656 1.00 37.11 U ATOM 315 N SER U 338 24.354 99.393 3.370
1.00 25.79 U ATOM 316 CA SER U 338 24.168 98.057 3.901 1.00 24.15 U
ATOM 317 CB SER U 338 25.161 97.124 3.203 1.00 21.99 U ATOM 318 OG
SER U 338 25.287 95.885 3.876 1.00 17.90 U ATOM 319 C SER U 338
24.297 97.982 5.449 1.00 30.41 U ATOM 320 O SER U 338 23.490 97.340
6.114 1.00 31.99 U ATOM 321 N GLY U 339 25.301 98.637 6.030 1.00
32.94 U ATOM 322 CA GLY U 339 25.457 98.604 7.476 1.00 28.86 U ATOM
323 C GLY U 339 24.445 99.480 8.201 1.00 28.75 U ATOM 324 O GLY U
339 24.231 99.328 9.402 1.00 26.26 U ATOM 325 N TRP U 340 23.819
100.386 7.448 1.00 25.56 U ATOM 326 CA TRP U 340 22.820 101.334
7.938 1.00 27.93 U ATOM 327 CB TRP U 340 21.893 101.726 6.765 1.00
28.33 U ATOM 328 CG TRP U 340 20.852 102.785 7.075 1.00 32.51 U
ATOM 329 CD2 TRP U 340 20.701 104.069 6.446 1.00 36.24 U ATOM 330
CE2 TRP U 340 19.578 104.698 7.043 1.00 32.10 U ATOM 331 CE3 TRP U
340 21.400 104.752 5.438 1.00 33.50 U ATOM 332 CD1 TRP U 340 19.846
102.700 7.995 1.00 35.61 U ATOM 333 NE1 TRP U 340 19.079 103.838
7.981 1.00 33.30 U ATOM 334 CZ2 TRP U 340 19.146 105.978 6.673 1.00
22.67 U ATOM 335 CZ3 TRP U 340 20.959 106.041 5.069 1.00 22.73 U
ATOM 336 CH2 TRP U 340 19.846 106.630 5.688 1.00 27.61 U ATOM 337 C
TRP U 340 22.007 100.896 9.179 1.00 30.07 U ATOM 338 O TRP U 340
22.245 101.385 10.276 1.00 34.83 U ATOM 339 N ASN U 341 21.067
99.973 9.040 1.00 30.01 U ATOM 340 CA ASN U 341 20.276 99.597
10.204 1.00 29.52 U ATOM 341 CB ASN U 341 19.227 98.570 9.804 1.00
32.18 U ATOM 342 CG ASN U 341 18.089 99.182 9.016 1.00 31.81 U ATOM
343 OD1 ASN U 341 17.206 98.477 8.518 1.00 32.06 U ATOM 344 ND2 ASN
U 341 18.099 100.497 8.900 1.00 28.83 U ATOM 345 C ASN U 341 21.063
99.087 11.411 1.00 31.89 U ATOM 346 O ASN U 341 20.911 99.592
12.526 1.00 34.91 U ATOM 347 N GLU U 342 21.897 98.078 11.208 1.00
31.11 U ATOM 348 CA GLU U 342 22.651 97.553 12.331 1.00 29.94 U
ATOM 349 CB GLU U 342 23.547 96.401 11.908 1.00 26.29 U ATOM 350 CG
GLU U 342 22.814 95.202 11.417 1.00 26.29 U ATOM 351 CD GLU U 342
23.752 94.084 11.035 1.00 36.46 U ATOM 352 OE1 GLU U 342 23.997
93.876 9.828 1.00 30.05 U ATOM 353 OE2 GLU U 342 24.266 93.407
11.953 1.00 53.55 U ATOM 354 C GLU U 342 23.505 98.632 12.965 1.00
33.66 U ATOM 355 O GLU U 342 23.729 98.596 14.166 1.00 39.16 U ATOM
356 N LEU U 343 23.984 99.592 12.178 1.00 29.29 U ATOM 357 CA LEU U
343 24.817 100.634 12.747 1.00 30.23 U ATOM 358 CB LEU U 343 25.555
101.417 11.653 1.00 27.80 U ATOM 359 CG LEU U 343 26.745 100.750
10.930 1.00 32.16 U ATOM 360 CD1 LEU U 343 27.165 101.600 9.723
1.00 23.65 U ATOM 361 CD2 LEU U 343 27.904 100.562 11.880 1.00
16.27 U ATOM 362 C LEU U 343 24.003 101.578 13.619 1.00 35.57 U
ATOM 363 O LEU U 343 24.399 101.870 14.758 1.00 33.58 U ATOM 364 N
LEU U 344 22.865 102.044 13.108 1.00 32.56 U ATOM 365 CA LEU U 344
22.025 102.960 13.881 1.00 37.27 U ATOM 366 CB LEU U 344 20.807
103.428 13.091 1.00 24.92 U ATOM 367 CG LEU U 344 21.049 104.222
11.826 1.00 23.17 U ATOM 368 CD1 LEU U 344 19.729 104.429 11.171
1.00 24.49 U ATOM 369 CD2 LEU U 344 21.715 105.548 12.127 1.00
16.44 U ATOM 370 C LEU U 344 21.517 102.291 15.137 1.00 41.23 U
ATOM 371 O LEU U 344 21.448 102.922 16.194 1.00 46.21 U ATOM 372 N
ILE U 345 21.148 101.018 15.004 1.00 39.57 U ATOM 373 CA ILE U 345
20.607 100.245 16.112 1.00 37.50 U ATOM 374 CB ILE U 345 20.150
98.857 15.627 1.00 36.70 U ATOM 375 CG2 ILE U 345 19.928 97.911
16.816 1.00 33.77 U ATOM 376 CG1 ILE U 345 18.882 99.009 14.792
1.00 31.92 U ATOM 377 CD1 ILE U 345 18.361 97.689 14.247 1.00 36.61
U ATOM 378 C ILE U 345 21.602 100.087 17.244 1.00 34.63 U ATOM 379
O ILE U 345 21.305 100.393 18.385 1.00 33.90 U ATOM 380 N ALA U 346
22.787 99.603 16.922 1.00 34.92 U ATOM 381 CA ALA U 346 23.827
99.402 17.919 1.00 33.34 U ATOM 382 CB ALA U 346 25.079 98.872
17.233 1.00 20.38 U ATOM 383 C ALA U 346 24.125 100.720 18.640 1.00
35.49 U ATOM 384 O ALA U 346 24.349 100.759 19.853 1.00 32.79 U
ATOM 385 N GLY U 347 24.120 101.800 17.864 1.00 39.18 U ATOM 386 CA
GLY U 347 24.386 103.121 18.399 1.00 37.65 U ATOM 387 C GLY U 347
23.359 103.573 19.413 1.00 39.12 U ATOM 388 O GLY U 347 23.711
103.796 20.563 1.00 37.43 U ATOM 389 N PHE U 348 22.095 103.710
19.011 1.00 39.25 U ATOM 390 CA PHE U 348 21.101 104.140 19.975
1.00 34.80 U ATOM 391 CB PHE U 348 19.778 104.588 19.305 1.00 33.33
U ATOM 392 CG PHE U 348 19.037 103.532 18.536 1.00 32.08 U ATOM 393
CD1 PHE U 348 18.522 102.402 19.165 1.00 30.46 U ATOM 394 CD2 PHE U
348 18.760 103.726 17.176 1.00 32.54 U ATOM 395 CE1 PHE U 348
17.735 101.482 18.450 1.00 30.24 U ATOM 396 CE2 PHE U 348 17.976
102.812 16.452 1.00 26.04 U ATOM 397 CZ PHE U 348 17.465 101.694
17.085 1.00 27.51 U ATOM 398 C PHE U 348 20.851 103.128 21.073 1.00
33.35 U ATOM 399 O PHE U 348 20.269 103.477 22.096 1.00 32.57 U
ATOM 400 N SER U 349 21.324 101.894 20.877 1.00 33.74 U ATOM 401 CA
SER U 349 21.174 100.815 21.865 1.00 35.08 U ATOM 402 CB SER U 349
21.520 99.457 21.254 1.00 35.19 U ATOM 403 OG SER U 349 20.413
98.887 20.592 1.00 43.14 U ATOM 404 C SER U 349 22.093 101.056
23.051 1.00 34.96 U ATOM 405 O SER U 349 21.679 101.001 24.210 1.00
35.52 U ATOM 406 N HIS U 350 23.354 101.314 22.738 1.00 33.89 U
ATOM 407 CA HIS U 350 24.354 101.575 23.750 1.00 38.26 U ATOM 408
CB HIS U 350 25.738 101.609 23.115 1.00 37.36 U ATOM 409 CG HIS U
350 26.837 101.892 24.088 1.00 35.12 U ATOM 410 CD2 HIS U 350
27.588 101.058 24.851 1.00 32.12 U ATOM 411 ND1 HIS U 350 27.293
103.166 24.351 1.00 27.40 U ATOM 412 CE1 HIS U 350 28.284 103.103
25.224 1.00 31.15 U ATOM 413 NE2 HIS U 350 28.480 101.834 25.541
1.00 24.80 U ATOM 414 C HIS U 350 24.080 102.891 24.454 1.00 41.29
U ATOM 415 O HIS U 350 24.221 102.971 25.665 1.00 43.64 U ATOM 416
N ARG U 351 23.698 103.917 23.687 1.00 46.27 U ATOM 417 CA ARG U
351 23.390 105.244 24.223 1.00 41.47 U ATOM 418 CB ARG U 351 23.084
106.247 23.107 1.00 40.73 U ATOM 419 CG ARG U 351 22.823 107.679
23.626 1.00 52.88 U ATOM 420 CD ARG U 351 22.703 108.675 22.482
1.00 65.75 U ATOM 421 NE ARG U 351 22.716 110.064 22.939 1.00 78.56
U ATOM 422 CZ ARG U 351 22.786 111.133 22.134 1.00 85.00 U ATOM 423
NH1 ARG U 351 22.852 110.999 20.807 1.00 82.69 U ATOM 424 NH2 ARG U
351 22.800 112.354 22.661 1.00 89.42 U ATOM 425 C ARG U 351 22.200
105.224 25.169 1.00 43.65 U ATOM 426 O ARG U 351 22.019 106.139
25.971 1.00 46.07 U ATOM 427 N SER U 352 21.380 104.193 25.095 1.00
37.12 U ATOM 428 CA SER U 352 20.244 104.182 25.976 1.00 41.58 U
ATOM 429 CB SER U 352 18.961 103.999 25.155 1.00 41.72 U ATOM 430
OG SER U 352 19.142 103.057 24.142 1.00 40.19 U ATOM 431 C SER U
352 20.355 103.155 27.083 1.00 42.37 U ATOM 432 O SER U 352 19.352
102.574 27.494 1.00 44.94 U ATOM 433 N MET U 353 21.572 102.958
27.589 1.00 43.30 U ATOM 434 CA MET U 353 21.803 101.974 28.653
1.00 41.91 U ATOM 435 CB MET U 353 23.288 101.657 28.827 1.00 37.50
U ATOM 436 CG MET U 353 23.872 100.675 27.854 1.00 38.15 U ATOM 437
SD MET U 353 25.607 100.366 28.215 1.00 42.35 U ATOM 438 CE MET U
353 26.326 101.885 27.776 1.00 36.09 U ATOM 439 C MET U 353 21.287
102.486 29.965 1.00 40.18 U ATOM 440 O MET U 353 20.763 101.729
30.784 1.00 38.44 U ATOM 441 N SER U 354 21.453 103.785 30.157 1.00
41.70 U ATOM 442 CA SER U 354 21.023 104.434 31.381 1.00 52.28 U
ATOM 443 CB SER U 354 21.788 105.741 31.561 1.00 50.59 U ATOM 444
OG SER U 354 21.749 106.498 30.357 1.00 62.08 U ATOM 445 C SER U
354 19.516 104.689 31.371 1.00 57.36 U ATOM 446 O SER U 354 18.869
104.579 32.411 1.00 66.59 U ATOM 447 N VAL U 355 18.960 105.021
30.207 1.00 53.96 U ATOM 448 CA VAL U 355 17.528 105.263 30.098
1.00 49.81 U ATOM 449 CB VAL U 355 17.129 105.517 28.631 1.00 48.65
U ATOM 450 CG1 VAL U 355 15.632 105.396 28.471 1.00 38.73 U ATOM
451 CG2 VAL U 355 17.606 106.901 28.190 1.00 42.68 U ATOM 452 C VAL
U 355 16.761 104.046 30.623 1.00 53.60 U ATOM 453 O VAL U 355
17.146 102.901 30.365 1.00 54.54 U ATOM 454 N LYS U 356 15.690
104.293 31.374 1.00 55.40 U ATOM 455 CA LYS U 356 14.887 103.196
31.906 1.00 60.98 U ATOM 456 CB LYS U 356 14.344 103.539 33.294
1.00 67.99 U ATOM 457 CG LYS U 356 13.463 102.430 33.900 1.00 75.32
U ATOM 458 CD LYS U 356 12.748 102.863 35.190 1.00 77.01 U ATOM 459
CE LYS U 356 13.725 103.184 36.330 1.00 79.62 U ATOM 460 NZ LYS U
356 13.051 103.384 37.659 1.00 75.59 U ATOM 461 C LYS U 356 13.723
102.942 30.957 1.00 62.54 U ATOM 462 O LYS U 356 13.055 103.885
30.519 1.00 60.53 U ATOM 463 N ASP U 357 13.487 101.670 30.642 1.00
63.08 U ATOM 464 CA ASP U 357 12.412 101.269 29.734 1.00 67.30 U
ATOM 465 CB ASP U 357 11.083 101.222 30.478 1.00 74.78 U ATOM 466
CG ASP U 357 10.959 99.998 31.355 1.00 88.42 U ATOM 467 OD1 ASP U
357 10.966 98.880 30.794 1.00 93.99 U ATOM 468 OD2 ASP U 357 10.859
100.150 32.599 1.00 97.29 U ATOM 469 C ASP U 357 12.260 102.132
28.483 1.00 67.53 U ATOM 470 O ASP U 357 11.183 102.671 28.208 1.00
66.44 U ATOM 471 N GLY U 358 13.340 102.247 27.715 1.00 66.29 U
ATOM 472 CA GLY U 358 13.281 103.031 26.504 1.00 57.58 U ATOM 473 C
GLY U 358 14.569 103.066 25.712 1.00 57.81 U ATOM 474 O GLY U 358
15.602 102.523 26.118 1.00 59.38 U ATOM 475 N ILE U 359 14.465
103.736 24.568 1.00 53.70 U ATOM 476 CA ILE U 359 15.532 103.943
23.601 1.00 47.56 U ATOM 477 CB ILE U 359 15.116 103.351 22.218
1.00 39.27 U ATOM 478 CG2 ILE U 359 16.111 103.758 21.133 1.00
33.07 U ATOM 479 CG1 ILE U 359 14.988 101.830 22.326 1.00 41.53 U
ATOM 480 CD1 ILE U 359 14.632 101.143 21.032 1.00 47.71 U ATOM 481
C ILE U 359 15.725 105.453 23.435 1.00 50.08 U ATOM 482 O ILE U 359
14.781 106.162 23.126 1.00 50.57 U ATOM 483 N MET U 360 16.931
105.962 23.644 1.00 51.66 U ATOM 484 CA MET U 360 17.153 107.392
23.447 1.00 54.19 U ATOM 485 CB MET U 360 18.253 107.874 24.368
1.00 55.34 U ATOM 486 CG MET U 360 18.559 109.320 24.191 1.00 63.76
U ATOM 487 SD MET U 360 19.630 109.862 25.488 1.00 68.21 U ATOM 488
CE MET U 360 18.423 110.302 26.681 1.00 63.93 U ATOM 489 C MET U
360 17.550 107.636 21.986 1.00 57.24 U ATOM 490 O MET U 360 18.051
106.731 21.331 1.00 62.64 U ATOM 491 N LEU U 361 17.336 108.841
21.466 1.00 56.32 U ATOM 492 CA LEU U 361 17.680 109.124 20.070
1.00 56.54 U
ATOM 493 CB LEU U 361 16.463 108.895 19.171 1.00 52.54 U ATOM 494
CG LEU U 361 15.778 107.526 19.099 1.00 53.61 U ATOM 495 CD1 LEU U
361 14.474 107.633 18.310 1.00 46.05 U ATOM 496 CD2 LEU U 361
16.707 106.520 18.440 1.00 57.61 U ATOM 497 C LEU U 361 18.157
110.556 19.870 1.00 62.43 U ATOM 498 O LEU U 361 17.399 111.493
20.088 1.00 69.23 U ATOM 499 N ALA U 362 19.397 110.732 19.430 1.00
72.75 U ATOM 500 CA ALA U 362 19.945 112.077 19.207 1.00 81.97 U
ATOM 501 CB ALA U 362 19.448 112.637 17.875 1.00 82.62 U ATOM 502 C
ALA U 362 19.582 113.039 20.352 1.00 88.14 U ATOM 503 O ALA U 362
18.788 113.989 20.170 1.00 86.81 U ATOM 504 N THR U 363 20.186
112.762 21.516 1.00 90.21 U ATOM 505 CA THR U 363 20.024 113.509
22.775 1.00 84.69 U ATOM 506 CB THR U 363 20.732 114.906 22.742
1.00 84.81 U ATOM 507 OG1 THR U 363 21.948 114.849 23.508 1.00
74.38 U ATOM 508 CG2 THR U 363 19.823 115.996 23.318 1.00 78.85 U
ATOM 509 C THR U 363 18.579 113.700 23.162 1.00 80.56 U ATOM 510 O
THR U 363 17.762 114.165 22.365 1.00 76.72 U ATOM 511 N GLY U 364
18.271 113.358 24.405 1.00 80.95 U ATOM 512 CA GLY U 364 16.907
113.490 24.853 1.00 79.03 U ATOM 513 C GLY U 364 16.090 112.686
23.863 1.00 78.51 U ATOM 514 O GLY U 364 16.638 111.933 23.049 1.00
79.46 U ATOM 515 N LEU U 365 14.780 112.876 23.903 1.00 72.04 U
ATOM 516 CA LEU U 365 13.866 112.142 23.049 1.00 64.93 U ATOM 517
CB LEU U 365 14.132 112.386 21.557 1.00 54.02 U ATOM 518 CG LEU U
365 12.824 112.119 20.785 1.00 50.92 U ATOM 519 CD1 LEU U 365
11.779 113.069 21.304 1.00 38.89 U ATOM 520 CD2 LEU U 365 12.974
112.315 19.302 1.00 51.79 U ATOM 521 C LEU U 365 13.990 110.657
23.367 1.00 64.92 U ATOM 522 O LEU U 365 14.497 109.863 22.574 1.00
69.33 U ATOM 523 N VAL U 366 13.542 110.297 24.560 1.00 56.23 U
ATOM 524 CA VAL U 366 13.563 108.923 24.978 1.00 53.91 U ATOM 525
CB VAL U 366 13.728 108.814 26.476 1.00 51.37 U ATOM 526 CG1 VAL U
366 13.522 107.380 26.913 1.00 48.12 U ATOM 527 CG2 VAL U 366
15.102 109.303 26.861 1.00 53.75 U ATOM 528 C VAL U 366 12.246
108.291 24.580 1.00 57.47 U ATOM 529 O VAL U 366 11.224 108.464
25.240 1.00 68.08 U ATOM 530 N VAL U 367 12.273 107.578 23.470 1.00
55.00 U ATOM 531 CA VAL U 367 11.100 106.891 22.965 1.00 49.29 U
ATOM 532 CB VAL U 367 11.436 106.249 21.619 1.00 35.95 U ATOM 533
CG1 VAL U 367 10.261 105.484 21.083 1.00 39.11 U ATOM 534 CG2 VAL U
367 11.881 107.314 20.660 1.00 36.47 U ATOM 535 C VAL U 367 10.679
105.789 23.945 1.00 53.36 U ATOM 536 O VAL U 367 11.525 105.036
24.435 1.00 56.64 U ATOM 537 N HIS U 368 9.388 105.706 24.258 1.00
54.80 U ATOM 538 CA HIS U 368 8.915 104.634 25.133 1.00 53.25 U
ATOM 539 CB HIS U 368 8.081 105.170 26.287 1.00 54.77 U ATOM 540 CG
HIS U 368 8.879 105.941 27.285 1.00 58.76 U ATOM 541 CD2 HIS U 368
8.956 107.269 27.534 1.00 58.35 U ATOM 542 ND1 HIS U 368 9.789
105.340 28.126 1.00 63.03 U ATOM 543 CE1 HIS U 368 10.395 106.266
28.850 1.00 62.51 U ATOM 544 NE2 HIS U 368 9.908 107.445 28.509
1.00 60.14 U ATOM 545 C HIS U 368 8.093 103.700 24.280 1.00 50.90 U
ATOM 546 O HIS U 368 7.641 104.062 23.196 1.00 48.41 U ATOM 547 N
ARG U 369 7.898 102.489 24.766 1.00 52.36 U ATOM 548 CA ARG U 369
7.153 101.515 23.996 1.00 52.38 U ATOM 549 CB ARG U 369 6.907
100.271 24.830 1.00 48.03 U ATOM 550 CG ARG U 369 6.370 99.130
24.021 1.00 46.98 U ATOM 551 CD ARG U 369 5.934 98.029 24.947 1.00
54.79 U ATOM 552 NE ARG U 369 4.898 97.229 24.317 1.00 55.68 U ATOM
553 CZ ARG U 369 5.144 96.193 23.533 1.00 55.09 U ATOM 554 NH1 ARG
U 369 6.398 95.842 23.302 1.00 56.98 U ATOM 555 NH2 ARG U 369 4.142
95.517 22.977 1.00 51.49 U ATOM 556 C ARG U 369 5.833 102.060
23.486 1.00 54.06 U ATOM 557 O ARG U 369 5.401 101.731 22.383 1.00
50.17 U ATOM 558 N ASN U 370 5.210 102.922 24.282 1.00 57.80 U ATOM
559 CA ASN U 370 3.914 103.493 23.923 1.00 61.00 U ATOM 560 CB ASN
U 370 3.341 104.296 25.092 1.00 63.08 U ATOM 561 CG ASN U 370 3.963
105.667 25.214 1.00 68.85 U ATOM 562 OD1 ASN U 370 5.139 105.805
25.561 1.00 71.99 U ATOM 563 ND2 ASN U 370 3.175 106.697 24.924
1.00 71.17 U ATOM 564 C ASN U 370 3.906 104.360 22.669 1.00 57.09 U
ATOM 565 O ASN U 370 2.895 104.962 22.343 1.00 58.09 U ATOM 566 N
CYS U 371 5.024 104.431 21.963 1.00 56.66 U ATOM 567 CA CYS U 371
5.080 105.218 20.736 1.00 54.61 U ATOM 568 CB CYS U 371 4.938
106.716 21.036 1.00 52.84 U ATOM 569 SG CYS U 371 6.114 107.406
22.206 1.00 56.83 U ATOM 570 C CYS U 371 6.378 104.914 20.003 1.00
53.71 U ATOM 571 O CYS U 371 7.039 105.791 19.434 1.00 46.06 U ATOM
572 N ALA U 372 6.742 103.638 20.048 1.00 50.90 U ATOM 573 CA ALA U
372 7.916 103.168 19.358 1.00 49.08 U ATOM 574 CB ALA U 372 8.202
101.735 19.748 1.00 46.77 U ATOM 575 C ALA U 372 7.529 103.266
17.882 1.00 49.54 U ATOM 576 O ALA U 372 8.364 103.574 17.032 1.00
44.53 U ATOM 577 N HIS U 373 6.247 103.016 17.595 1.00 52.25 U ATOM
578 CA HIS U 373 5.729 103.093 16.233 1.00 52.88 U ATOM 579 CB HIS
U 373 4.258 102.706 16.171 1.00 49.41 U ATOM 580 CG HIS U 373 3.764
102.502 14.772 1.00 60.05 U ATOM 581 CD2 HIS U 373 3.170 103.351
13.903 1.00 57.01 U ATOM 582 ND1 HIS U 373 3.948 101.317 14.084
1.00 70.47 U ATOM 583 CE1 HIS U 373 3.489 101.451 12.851 1.00 64.76
U ATOM 584 NE2 HIS U 373 3.012 102.674 12.712 1.00 57.34 U ATOM 585
C HIS U 373 5.898 104.508 15.674 1.00 55.40 U ATOM 586 O HIS U 373
6.297 104.675 14.521 1.00 53.94 U ATOM 587 N GLN U 374 5.575
105.528 16.472 1.00 58.34 U ATOM 588 CA GLN U 374 5.765 106.904
16.016 1.00 60.92 U ATOM 589 CB GLN U 374 5.473 107.935 17.121 1.00
72.96 U ATOM 590 CG GLN U 374 4.001 108.340 17.317 1.00 90.65 U
ATOM 591 CD GLN U 374 3.824 109.665 18.108 1.00 96.81 U ATOM 592
OE1 GLN U 374 4.387 109.853 19.198 1.00 95.94 U ATOM 593 NE2 GLN U
374 3.022 110.576 17.553 1.00 99.87 U ATOM 594 C GLN U 374 7.233
107.049 15.634 1.00 56.05 U ATOM 595 O GLN U 374 7.556 107.320
14.480 1.00 54.14 U ATOM 596 N ALA U 375 8.105 106.858 16.627 1.00
50.29 U ATOM 597 CA ALA U 375 9.562 106.968 16.481 1.00 45.90 U
ATOM 598 CB ALA U 375 10.237 106.440 17.733 1.00 36.92 U ATOM 599 C
ALA U 375 10.164 106.285 15.244 1.00 46.33 U ATOM 600 O ALA U 375
11.085 106.810 14.620 1.00 41.94 U ATOM 601 N GLY U 376 9.664
105.106 14.902 1.00 45.56 U ATOM 602 CA GLY U 376 10.186 104.425
13.740 1.00 42.75 U ATOM 603 C GLY U 376 11.000 103.226 14.126 1.00
43.80 U ATOM 604 O GLY U 376 11.761 102.687 13.311 1.00 48.74 U
ATOM 605 N VAL U 377 10.845 102.826 15.381 1.00 39.82 U ATOM 606 CA
VAL U 377 11.552 101.679 15.915 1.00 42.16 U ATOM 607 CB VAL U 377
12.483 102.067 17.072 1.00 38.64 U ATOM 608 CG1 VAL U 377 13.687
102.855 16.538 1.00 41.57 U ATOM 609 CG2 VAL U 377 11.712 102.851
18.108 1.00 24.01 U ATOM 610 C VAL U 377 10.509 100.714 16.431 1.00
47.28 U ATOM 611 O VAL U 377 10.682 100.074 17.479 1.00 50.04 U
ATOM 612 N GLY U 378 9.421 100.611 15.679 1.00 47.61 U ATOM 613 CA
GLY U 378 8.338 99.744 16.087 1.00 42.89 U ATOM 614 C GLY U 378
8.637 98.279 15.932 1.00 41.14 U ATOM 615 O GLY U 378 8.259 97.478
16.761 1.00 48.83 U ATOM 616 N ALA U 379 9.336 97.917 14.876 1.00
45.44 U ATOM 617 CA ALA U 379 9.627 96.511 14.631 1.00 50.56 U ATOM
618 CB ALA U 379 10.009 96.318 13.159 1.00 54.17 U ATOM 619 C ALA U
379 10.712 95.919 15.507 1.00 52.59 U ATOM 620 O ALA U 379 10.821
94.703 15.606 1.00 54.95 U ATOM 621 N ILE U 380 11.497 96.771
16.158 1.00 52.15 U ATOM 622 CA ILE U 380 12.619 96.302 16.957 1.00
43.86 U ATOM 623 CB ILE U 380 13.917 96.838 16.346 1.00 42.13 U
ATOM 624 CG2 ILE U 380 14.102 96.283 14.945 1.00 38.36 U ATOM 625
CG1 ILE U 380 13.844 98.366 16.296 1.00 29.73 U ATOM 626 CD1 ILE U
380 15.114 99.023 15.880 1.00 32.82 U ATOM 627 C ILE U 380 12.638
96.647 18.442 1.00 45.23 U ATOM 628 O ILE U 380 13.364 96.019
19.206 1.00 45.34 U ATOM 629 N PHE U 381 11.856 97.639 18.852 1.00
41.47 U ATOM 630 CA PHE U 381 11.834 98.077 20.250 1.00 39.86 U
ATOM 631 CB PHE U 381 10.536 98.812 20.520 1.00 40.79 U ATOM 632 CG
PHE U 381 10.577 99.631 21.751 1.00 38.51 U ATOM 633 CD1 PHE U 381
11.041 100.945 21.702 1.00 43.23 U ATOM 634 CD2 PHE U 381 10.225
99.076 22.976 1.00 31.79 U ATOM 635 CE1 PHE U 381 11.160 101.712
22.875 1.00 50.56 U ATOM 636 CE2 PHE U 381 10.338 99.820 24.153
1.00 40.15 U ATOM 637 CZ PHE U 381 10.809 101.145 24.107 1.00 46.64
U ATOM 638 C PHE U 381 12.081 97.057 21.393 1.00 38.24 U ATOM 639 O
PHE U 381 13.041 97.195 22.153 1.00 35.88 U ATOM 640 N ASP U 382
11.214 96.057 21.530 1.00 36.81 U ATOM 641 CA ASP U 382 11.370
95.040 22.584 1.00 41.40 U ATOM 642 CB ASP U 382 10.287 93.949
22.481 1.00 48.31 U ATOM 643 CG ASP U 382 8.897 94.435 22.894 1.00
53.81 U ATOM 644 OD1 ASP U 382 8.780 95.150 23.924 1.00 54.60 U
ATOM 645 OD2 ASP U 382 7.919 94.071 22.189 1.00 51.69 U ATOM 646 C
ASP U 382 12.731 94.345 22.594 1.00 39.65 U ATOM 647 O ASP U 382
13.439 94.371 23.592 1.00 41.97 U ATOM 648 N ARG U 383 13.077
93.697 21.487 1.00 43.16 U ATOM 649 CA ARG U 383 14.355 93.000
21.361 1.00 39.23 U ATOM 650 CB ARG U 383 14.447 92.333 19.984 1.00
33.41 U ATOM 651 CG ARG U 383 14.855 90.844 19.953 1.00 43.37 U
ATOM 652 CD ARG U 383 15.016 90.366 18.484 1.00 50.80 U ATOM 653 NE
ARG U 383 15.557 89.018 18.332 1.00 57.23 U ATOM 654 CZ AEG U 383
16.858 88.718 18.348 1.00 74.35 U ATOM 655 NH1 ARG U 383 17.795
89.675 18.511 1.00 59.21 U ATOM 656 NH2 ARG U 383 17.221 87.441
18.196 1.00 76.48 U ATOM 657 C ARG U 383 15.542 93.970 21.575 1.00
38.25 U ATOM 658 O ARG U 383 16.539 93.600 22.189 1.00 38.14 U ATOM
659 N VAL U 384 15.454 95.204 21.083 1.00 31.99 U ATOM 660 CA VAL U
384 16.556 96.127 21.303 1.00 30.96 U ATOM 661 CB VAL U 384 16.273
97.531 20.729 1.00 29.82 U ATOM 662 CG1 VAL U 384 17.224 98.561
21.338 1.00 21.88 U ATOM 663 CG2 VAL U 384 16.485 97.518 19.241
1.00 25.51 U ATOM 664 C VAL U 384 16.838 96.232 22.800 1.00 34.32 U
ATOM 665 O VAL U 384 17.976 96.051 23.233 1.00 41.88 U ATOM 666 N
LEU U 385 15.817 96.493 23.602 1.00 30.94 U ATOM 667 CA LEU U 385
16.029 96.608 25.036 1.00 30.42 U ATOM 668 CB LEU U 385 14.720
96.993 25.724 1.00 28.36 U ATOM 669 CG LEU U 385 14.070 98.331
25.373 1.00 37.72 U ATOM 670 CD1 LEU U 385 12.820 98.477 26.174
1.00 31.55 U ATOM 671 CD2 LEU U 385 14.994 99.495 25.684 1.00 38.29
U ATOM 672 C LEU U 385 16.595 95.351 25.713 1.00 31.91 U ATOM 673 O
LEU U 385 17.476 95.439 26.569 1.00 33.34 U ATOM 674 N THR U 386
16.109 94.179 25.321 1.00 26.65 U ATOM 675 CA THR U 386 16.535
92.940 25.971 1.00 31.55 U ATOM 676 CB THR U 386 15.385 91.910
26.010 1.00 34.28 U ATOM 677 OG1 THR U 386 15.014 91.541 24.677
1.00 44.67 U ATOM 678 CG2 THR U 386 14.171 92.497 26.708 1.00 31.26
U ATOM 679 C THR U 386 17.764 92.215 25.458 1.00 36.23 U ATOM 680 O
THR U 386 18.501 91.638 26.254 1.00 40.01 U ATOM 681 N GLU U 387
17.966 92.219 24.138 1.00 40.86 U ATOM 682 CA GLU U 387 19.108
91.561 23.510 1.00 36.51 U ATOM 683 CB GLU U 387 18.713 91.013
22.137 1.00 38.33 U ATOM 684 CG GLU U 387 17.485 90.160 22.161 1.00
42.62 U ATOM 685 CD GLU U 387 17.482 89.162 23.304 1.00 47.11 U
ATOM 686 OE1 GLU U 387 18.256 88.166 23.254 1.00 44.10 U ATOM 687
OE2 GLU U 387 16.696 89.387 24.256 1.00 42.20 U ATOM 688 C GLU U
387 20.337 92.468 23.350 1.00 36.93 U ATOM 689 O GLU U 387 21.450
91.966 23.160 1.00 37.80 U ATOM 690 N LEU U 388 20.141 93.787
23.401 1.00 28.40 U ATOM 691 CA LEU U 388 21.253 94.710 23.267 1.00
30.94 U ATOM 692 CB LEU U 388 21.128 95.542 21.990 1.00 28.29 U
ATOM 693 CG LEU U 388 21.185 94.698 20.704 1.00 30.69 U ATOM 694
CD1 LEU U 388 20.963 95.564 19.485 1.00 27.49 U ATOM 695 CD2 LEU U
388 22.517 93.980 20.626 1.00 22.93 U ATOM 696 C LEU U 388 21.365
95.623 24.467 1.00 35.06 U ATOM 697 O LEU U 388 22.353 95.562
25.203 1.00 36.04 U ATOM 698 N VAL U 389 20.358 96.450 24.701 1.00
32.72 U ATOM 699 CA VAL U 389 20.456 97.352 25.834 1.00 31.84 U
ATOM 700 CB VAL U 389 19.187 98.198 26.050 1.00 33.37 U ATOM 701
CG1 VAL U 389 19.404 99.110 27.259 1.00 27.98 U ATOM 702 CG2 VAL U
389 18.888 99.043 24.821 1.00 24.09 U ATOM 703 C VAL U 389 20.769
96.626 27.132 1.00 30.80 U ATOM 704 O VAL U 389 21.739 96.963
27.801 1.00 38.49 U ATOM 705 N ALA U 390 19.962 95.636 27.494 1.00
32.86 U ATOM 706 CA ALA U 390 20.193 94.893 28.736 1.00 33.12 U
ATOM 707 CB ALA U 390 19.120 93.861 28.927 1.00 30.29 U ATOM 708 C
ALA U 390 21.561 94.218 28.756 1.00 33.32 U ATOM 709 O ALA U 390
22.336 94.396 29.680 1.00 32.84 U ATOM 710 N LYS U 391 21.867
93.440 27.733 1.00 37.03 U ATOM 711 CA LYS U 391 23.150 92.763
27.681 1.00 38.70 U ATOM 712 CB LYS U 391 23.208 91.883 26.430 1.00
40.17 U ATOM 713 CG LYS U 391 22.157 90.771 26.412 1.00 35.70 U
ATOM 714 CD LYS U 391 22.468 89.712 27.453 1.00 40.05 U ATOM 715 CE
LYS U 391 21.234 88.915 27.878 1.00 45.83 U ATOM 716 NZ LYS U 391
21.521 88.077 29.099 1.00 49.07 U ATOM 717 C LYS U 391 24.328
93.747 27.710 1.00 40.62 U ATOM 718 O LYS U 391 25.410 93.424
28.234 1.00 33.01 U ATOM 719 N MET U 392 24.115 94.942 27.153 1.00
40.44 U ATOM 720 CA MET U 392 25.163 95.974 27.106 1.00 40.66 U
ATOM 721 CB MET U 392 24.731 97.145 26.229 1.00 35.96 U ATOM 722 CG
MET U 392 25.072 96.961 24.791 1.00 33.56 U ATOM 723 SD MET U 392
24.440 98.258 23.783 1.00 40.35 U ATOM 724 CE MET U 392 24.913
97.647 22.178 1.00 27.49 U ATOM 725 C MET U 392 25.473 96.497
28.484 1.00 38.99 U ATOM 726 O MET U 392 26.630 96.648 28.881 1.00
39.17 U ATOM 727 N ARG U 393 24.398 96.790 29.191 1.00 37.45 U ATOM
728 CA ARG U 393 24.453 97.291 30.541 1.00 32.99 U ATOM 729 CB ARG
U 393 23.045 97.654 30.969 1.00 34.44 U ATOM 730 CG ARG U 393
22.929 98.436 32.223 1.00 41.19 U ATOM 731 CD ARG U 393 21.610
99.172 32.177 1.00 47.37 U ATOM 732 NE ARG U 393 20.517 98.254
31.880 1.00 55.20 U ATOM 733 CZ ARG U 393 19.379 98.621 31.302 1.00
60.08 U ATOM 734 NH1 ARG U 393 19.185 99.893 30.958 1.00 50.39 U
ATOM 735 NH2 ARG U 393 18.442 97.709 31.056 1.00 66.60 U ATOM 736 C
ARG U 393 25.025 96.191 31.419 1.00 28.95 U ATOM 737 O ARG U 393
25.947 96.435 32.187 1.00 27.65 U ATOM 738 N GLU U 394 24.505
94.973 31.287 1.00 26.38 U ATOM 739 CA GLU U 394 25.006 93.862
32.089 1.00 32.40 U ATOM 740 CB GLU U 394 24.355 92.548 31.658 1.00
34.10 U ATOM 741 CG GLU U 394 22.857 92.493 31.857 1.00 47.11 U
ATOM 742 CD GLU U 394 22.255 91.185 31.350 1.00 57.63 U ATOM 743
OE1 GLU U 394 23.042 90.269 30.997 1.00 60.19 U
ATOM 744 OE2 GLU U 394 21.005 91.071 31.308 1.00 57.06 U ATOM 745 C
GLU U 394 26.538 93.707 32.056 1.00 33.86 U ATOM 746 O GLU U 394
27.146 93.459 33.082 1.00 33.65 U ATOM 747 N MET U 395 27.161
93.854 30.888 1.00 37.99 U ATOM 748 CA MET U 395 28.613 93.706
30.779 1.00 32.98 U ATOM 749 CB MET U 395 29.005 93.009 29.468 1.00
36.56 U ATOM 750 CG MET U 395 28.678 93.778 28.183 1.00 33.30 U
ATOM 751 SD MET U 395 29.054 92.793 26.707 1.00 37.42 U ATOM 752 CE
MET U 395 30.636 92.184 27.124 1.00 33.07 U ATOM 753 C MET U 395
29.320 95.041 30.854 1.00 35.39 U ATOM 754 O MET U 395 30.538
95.094 30.788 1.00 35.28 U ATOM 755 N LYS U 396 28.567 96.125
30.980 1.00 27.78 U ATOM 756 CA LYS U 396 29.203 97.411 31.059 1.00
29.20 U ATOM 757 CB LYS U 396 30.001 97.486 32.358 1.00 32.38 U
ATOM 758 CG LYS U 396 29.118 97.516 33.605 1.00 43.32 U ATOM 759 CD
LYS U 396 29.916 97.831 34.872 1.00 54.00 U ATOM 760 CE LYS U 396
29.011 97.989 36.092 1.00 57.36 U ATOM 761 NZ LYS U 396 29.788
98.387 37.300 1.00 62.62 U ATOM 762 C LYS U 396 30.108 97.621
29.847 1.00 30.91 U ATOM 763 O LYS U 396 31.296 97.917 29.978 1.00
36.92 U ATOM 764 N MET U 397 29.535 97.448 28.661 1.00 31.95 U ATOM
765 CA MET U 397 30.265 97.620 27.407 1.00 35.62 U ATOM 766 CB MET
U 397 29.401 97.107 26.240 1.00 35.63 U ATOM 767 CG MET U 397
29.977 97.373 24.858 1.00 34.00 U ATOM 768 SD MET U 397 28.756
97.263 23.531 1.00 30.97 U ATOM 769 CE MET U 397 28.855 95.574
23.156 1.00 31.90 U ATOM 770 C MET U 397 30.575 99.109 27.224 1.00
33.23 U ATOM 771 O MET U 397 29.668 99.926 27.139 1.00 36.18 U ATOM
772 N ASP U 398 31.848 99.468 27.152 1.00 32.65 U ATOM 773 CA ASP U
398 32.200 100.879 26.997 1.00 34.42 U ATOM 774 CB ASP U 398 33.582
101.169 27.614 1.00 35.85 U ATOM 775 CG ASP U 398 34.728 100.423
26.925 1.00 35.68 U ATOM 776 OD1 ASP U 398 34.792 100.441 25.677
1.00 38.98 U ATOM 777 OD2 ASP U 398 35.580 99.837 27.633 1.00 29.28
U ATOM 778 C ASP U 398 32.167 101.405 25.559 1.00 39.08 U ATOM 779
O ASP U 398 31.967 100.636 24.598 1.00 35.26 U ATOM 780 N LYS U 399
32.366 102.724 25.441 1.00 37.68 U ATOM 781 CA LYS U 399 32.378
103.450 24.165 1.00 36.84 U ATOM 782 CB LYS U 399 32.656 104.953
24.387 1.00 42.08 U ATOM 783 CG LYS U 399 31.637 105.771 25.183
1.00 48.45 U ATOM 784 CD LYS U 399 32.218 107.182 25.482 1.00 53.38
U ATOM 785 CE LYS U 399 31.441 107.945 26.589 1.00 53.01 U ATOM 786
NZ LYS U 399 32.125 109.197 27.093 1.00 46.97 U ATOM 787 C LYS U
399 33.442 102.926 23.172 1.00 35.69 U ATOM 788 O LYS U 399 33.209
102.897 21.962 1.00 34.85 U ATOM 789 N THR U 400 34.610 102.536
23.673 1.00 26.07 U ATOM 790 CA THR U 400 35.684 102.061 22.814
1.00 29.08 U ATOM 791 CB THR U 400 36.964 101.761 23.627 1.00 32.30
U ATOM 792 OG1 THR U 400 37.430 102.962 24.238 1.00 27.35 U ATOM
793 CG2 THR U 400 38.052 101.229 22.752 1.00 22.92 U ATOM 794 C THR
U 400 35.229 100.794 22.133 1.00 35.87 U ATOM 795 O THR U 400
35.336 100.640 20.905 1.00 38.99 U ATOM 796 N GLU U 401 34.715
99.887 22.953 1.00 36.25 U ATOM 797 CA GLU U 401 34.226 98.604
22.484 1.00 34.75 U ATOM 798 CB GLU U 401 33.757 97.799 23.691 1.00
30.59 U ATOM 799 CG GLU U 401 34.890 97.654 24.684 1.00 35.88 U
ATOM 800 CD GLU U 401 34.537 96.872 25.915 1.00 36.12 U ATOM 801
OE1 GLU U 401 33.547 97.229 26.595 1.00 29.09 U ATOM 802 OE2 GLU U
401 35.271 95.903 26.205 1.00 36.39 U ATOM 803 C GLU U 401 33.110
98.811 21.463 1.00 33.50 U ATOM 804 O GLU U 401 33.123 98.217
20.376 1.00 32.04 U ATOM 805 N LEU U 402 32.162 99.682 21.806 1.00
27.64 U ATOM 806 CA LEU U 402 31.056 99.962 20.924 1.00 21.36 U
ATOM 807 CB LEU U 402 30.185 101.088 21.444 1.00 24.42 U ATOM 808
CG LEU U 402 28.932 101.101 20.566 1.00 24.82 U ATOM 809 CD1 LEU U
402 28.024 99.963 21.003 1.00 35.56 U ATOM 810 CD2 LEU U 402 28.204
102.372 20.704 1.00 21.56 U ATOM 811 C LEU U 402 31.580 100.373
19.586 1.00 24.94 U ATOM 812 O LEU U 402 31.253 99.746 18.586 1.00
32.83 U ATOM 813 N GLY U 403 32.375 101.442 19.561 1.00 24.62 U
ATOM 814 CA GLY U 403 32.945 101.925 18.311 1.00 22.95 U ATOM 815 C
GLY U 403 33.596 100.807 17.518 1.00 27.61 U ATOM 816 O GLY U 403
33.468 100.738 16.303 1.00 26.58 U ATOM 817 N CYS U 404 34.300
99.924 18.219 1.00 31.04 U ATOM 818 CA CYS U 404 34.964 98.784
17.600 1.00 29.61 U ATOM 819 CB CYS U 404 35.710 97.977 18.651 1.00
33.74 U ATOM 820 SG CYS U 404 37.344 98.576 19.006 1.00 30.16 U
ATOM 821 C CYS U 404 33.988 97.861 16.897 1.00 35.64 U ATOM 822 O
CYS U 404 34.179 97.501 15.726 1.00 37.95 U ATOM 823 N LEU U 405
32.952 97.450 17.617 1.00 29.69 U ATOM 824 CA LEU U 405 31.977
96.564 17.020 1.00 31.19 U ATOM 825 CB LEU U 405 30.935 96.136
18.052 1.00 23.77 U ATOM 826 CG LEU U 405 31.439 95.309 19.227 1.00
23.97 U ATOM 827 CD1 LEU U 405 30.371 95.289 20.274 1.00 20.63 U
ATOM 828 CD2 LEU U 405 31.838 93.905 18.782 1.00 13.06 U ATOM 829 C
LEU U 405 31.305 97.259 15.844 1.00 27.59 U ATOM 830 O LEU U 405
31.135 96.668 14.782 1.00 31.16 U ATOM 831 N ARG U 406 30.929
98.517 16.029 1.00 23.58 U ATOM 832 CA ARG U 406 30.272 99.263
14.968 1.00 27.91 U ATOM 833 CB ARG U 406 30.021 100.691 15.418
1.00 20.43 U ATOM 834 CG ARG U 406 28.578 101.027 15.672 1.00 24.55
U ATOM 835 CD ARG U 406 28.504 102.506 15.940 1.00 34.29 U ATOM 836
NE ARG U 406 27.260 103.138 15.517 1.00 34.43 U ATOM 837 CZ ARG U
406 27.092 104.457 15.521 1.00 39.30 U ATOM 838 NH1 ARG U 406
28.087 105.231 15.926 1.00 35.42 U ATOM 839 NH2 ARG U 406 25.953
105.011 15.114 1.00 41.12 U ATOM 840 C ARG U 406 31.106 99.266
13.693 1.00 31.32 U ATOM 841 O ARG U 406 30.575 99.237 12.584 1.00
32.23 U ATOM 842 N SER U 407 32.419 99.298 13.866 1.00 29.69 U ATOM
843 CA SER U 407 33.349 99.305 12.755 1.00 26.40 U ATOM 844 CB SER
U 407 34.711 99.770 13.230 1.00 23.92 U ATOM 845 OG SER U 407
34.570 101.107 13.640 1.00 18.62 U ATOM 846 C SER U 407 33.461
97.959 12.101 1.00 28.35 U ATOM 847 O SER U 407 33.672 97.870
10.893 1.00 28.39 U ATOM 848 N ILE U 408 33.357 96.908 12.907 1.00
33.99 U ATOM 849 CA ILE U 408 33.386 95.554 12.372 1.00 30.44 U
ATOM 850 CB ILE U 408 33.331 94.526 13.492 1.00 23.83 U ATOM 851
CG2 ILE U 408 33.150 93.161 12.896 1.00 11.06 U ATOM 852 CG1 ILE U
408 34.582 94.660 14.365 1.00 20.58 U ATOM 853 CD1 ILE U 408 34.814
93.494 15.302 1.00 24.44 U ATOM 854 C ILE U 408 32.132 95.431
11.489 1.00 32.15 U ATOM 855 O ILE U 408 32.138 94.755 10.464 1.00
35.94 U ATOM 856 N VAL U 409 31.065 96.119 11.894 1.00 31.92 U ATOM
857 CA VAL U 409 29.816 96.134 11.146 1.00 32.54 U ATOM 858 CB VAL
U 409 28.635 96.731 11.992 1.00 34.95 U ATOM 859 CG1 VAL U 409
27.335 96.777 11.170 1.00 26.70 U ATOM 860 CG2 VAL U 409 28.431
95.893 13.251 1.00 24.09 U ATOM 861 C VAL U 409 29.988 96.955 9.878
1.00 31.14 U ATOM 862 O VAL U 409 29.588 96.523 8.816 1.00 38.10 U
ATOM 863 N LEU U 410 30.584 98.138 9.978 1.00 34.55 U ATOM 864 CA
LEU U 410 30.784 98.989 8.797 1.00 32.93 U ATOM 865 CB LEU U 410
31.380 100.337 9.202 1.00 25.79 U ATOM 866 CG LEU U 410 31.701
101.291 8.053 1.00 26.02 U ATOM 867 CD1 LEU U 410 30.479 102.056
7.707 1.00 29.87 U ATOM 868 CD2 LEU U 410 32.825 102.247 8.436 1.00
27.59 U ATOM 869 C LEU U 410 31.705 98.340 7.751 1.00 36.39 U ATOM
870 O LEU U 410 31.441 98.413 6.538 1.00 37.38 U ATOM 871 N PHE U
411 32.782 97.711 8.226 1.00 36.01 U ATOM 872 CA PHE U 411 33.752
97.074 7.345 1.00 36.64 U ATOM 873 CB PHE U 411 35.177 97.147 7.920
1.00 40.37 U ATOM 874 CG PHE U 411 35.781 98.533 7.883 1.00 42.32 U
ATOM 875 CD1 PHE U 411 35.823 99.257 6.696 1.00 40.55 U ATOM 876
CD2 PHE U 411 36.264 99.127 9.036 1.00 39.00 U ATOM 877 CE1 PHE U
411 36.328 100.548 6.662 1.00 37.25 U ATOM 878 CE2 PHE U 411 36.768
100.414 9.001 1.00 42.65 U ATOM 879 CZ PHE U 411 36.798 101.124
7.810 1.00 42.34 U ATOM 880 C PHE U 411 33.394 95.640 7.106 1.00
38.55 U ATOM 881 O PHE U 411 34.123 94.741 7.523 1.00 32.24 U ATOM
882 N ASN U 412 32.270 95.456 6.412 1.00 40.99 U ATOM 883 CA ASN U
412 31.729 94.155 6.048 1.00 39.36 U ATOM 884 CB ASN U 412 30.235
94.148 6.360 1.00 38.79 U ATOM 885 CG ASN U 412 29.476 93.047 5.644
1.00 40.78 U ATOM 886 OD1 ASN U 412 29.958 91.915 5.492 1.00 24.43
U ATOM 887 ND2 ASN U 412 28.255 93.374 5.217 1.00 36.88 U ATOM 888
C ASN U 412 31.998 93.825 4.578 1.00 41.92 U ATOM 889 O ASN U 412
31.423 94.426 3.661 1.00 40.06 U ATOM 890 N PRO U 413 32.902 92.862
4.338 1.00 45.60 U ATOM 891 CD PRO U 413 33.680 92.144 5.365 1.00
41.57 U ATOM 892 CA PRO U 413 33.285 92.424 2.991 1.00 44.83 U ATOM
893 CB PRO U 413 34.516 91.566 3.250 1.00 39.25 U ATOM 894 CG PRO U
413 34.223 90.974 4.588 1.00 39.15 U ATOM 895 C PRO U 413 32.201
91.676 2.234 1.00 45.73 U ATOM 896 O PRO U 413 32.222 91.626 1.002
1.00 52.42 U ATOM 897 N GLU U 414 31.251 91.091 2.956 1.00 43.05 U
ATOM 898 CA GLU U 414 30.183 90.374 2.291 1.00 39.64 U ATOM 899 CB
GLU U 414 29.562 89.320 3.197 1.00 42.37 U ATOM 900 CG GLU U 414
30.499 88.603 4.149 1.00 60.36 U ATOM 901 CD GLU U 414 31.506
87.697 3.463 1.00 71.15 U ATOM 902 OE1 GLU U 414 32.022 86.778
4.147 1.00 71.72 U ATOM 903 OE2 GLU U 414 31.786 87.910 2.256 1.00
74.25 U ATOM 904 C GLU U 414 29.111 91.386 1.911 1.00 42.28 U ATOM
905 O GLU U 414 28.000 91.010 1.542 1.00 41.06 U ATOM 906 N ALA U
415 29.414 92.678 2.033 1.00 44.92 U ATOM 907 CA ALA U 415 28.420
93.676 1.646 1.00 46.88 U ATOM 908 CB ALA U 415 28.942 95.101 1.877
1.00 39.65 U ATOM 909 C ALA U 415 28.148 93.420 0.158 1.00 47.70 U
ATOM 910 O ALA U 415 29.050 93.055 -0.615 1.00 40.83 U ATOM 911 N
LYS U 416 26.890 93.587 -0.216 1.00 50.22 U ATOM 912 CA LYS U 416
26.416 93.351 -1.577 1.00 54.17 U ATOM 913 CB LYS U 416 24.889
93.491 -1.608 1.00 61.27 U ATOM 914 CG LYS U 416 24.209 93.154
-0.266 1.00 67.54 U ATOM 915 CD LYS U 416 24.543 94.157 0.855 1.00
57.37 U ATOM 916 CE LYS U 416 24.303 93.533 2.211 1.00 50.72 U ATOM
917 NZ LYS U 416 22.901 93.042 2.362 1.00 56.29 U ATOM 918 C LYS U
416 27.014 94.280 -2.623 1.00 50.92 U ATOM 919 O LYS U 416 26.849
95.493 -2.551 1.00 51.14 U ATOM 920 N GLY U 417 27.705 93.712
-3.599 1.00 48.01 U ATOM 921 CA GLY U 417 28.281 94.530 -4.654 1.00
49.51 U ATOM 922 C GLY U 417 29.534 95.307 -4.303 1.00 49.64 U ATOM
923 O GLY U 417 30.071 96.041 -5.129 1.00 44.68 U ATOM 924 N LEU U
418 29.991 95.165 -3.066 1.00 54.51 U ATOM 925 CA LEU U 418 31.205
95.837 -2.622 1.00 48.92 U ATOM 926 CB LEU U 418 31.587 95.340
-1.225 1.00 41.73 U ATOM 927 CG LEU U 418 32.899 95.860 -0.671 1.00
35.06 U ATOM 928 CD1 LEU U 418 32.768 97.354 -0.506 1.00 40.21 U
ATOM 929 CD2 LEU U 418 33.224 95.171 0.639 1.00 28.86 U ATOM 930 C
LEU U 418 32.291 95.459 -3.633 1.00 45.94 U ATOM 931 O LEU U 418
32.422 94.297 -4.026 1.00 36.89 U ATOM 932 N LYS U 419 33.069
96.433 -4.060 1.00 45.84 U ATOM 933 CA LYS U 419 34.106 96.134
-5.024 1.00 49.15 U ATOM 934 CB LYS U 419 34.329 97.351 -5.928 1.00
52.16 U ATOM 935 CG LYS U 419 35.194 97.128 -7.152 1.00 56.76 U
ATOM 936 CD LYS U 419 35.818 98.459 -7.609 1.00 70.83 U ATOM 937 CE
LYS U 419 34.778 99.608 -7.755 1.00 77.52 U ATOM 938 NZ LYS U 419
35.404 100.967 -8.007 1.00 72.38 U ATOM 939 C LYS U 419 35.395
95.751 -4.307 1.00 48.58 U ATOM 940 O LYS U 419 35.939 94.670
-4.542 1.00 51.80 U ATOM 941 N SER U 420 35.863 96.619 -3.412 1.00
42.58 U ATOM 942 CA SER U 420 37.110 96.376 -2.695 1.00 44.19 U
ATOM 943 CB SER U 420 37.672 97.697 -2.194 1.00 45.46 U ATOM 944 OG
SER U 420 36.928 98.781 -2.726 1.00 46.57 U ATOM 945 C SER U 420
36.933 95.435 -1.525 1.00 47.56 U ATOM 946 O SER U 420 37.248
95.784 -0.391 1.00 52.59 U ATOM 947 N THR U 421 36.443 94.233
-1.792 1.00 44.38 U ATOM 948 CA THR U 421 36.224 93.283 -0.720 1.00
42.89 U ATOM 949 CB THR U 421 35.577 91.984 -1.239 1.00 38.16 U
ATOM 950 OG1 THR U 421 36.442 91.353 -2.182 1.00 39.40 U ATOM 951
CG2 THR U 421 34.240 92.292 -1.907 1.00 45.42 U ATOM 952 C THR U
421 37.495 92.945 0.044 1.00 43.04 U ATOM 953 O THR U 421 37.505
92.954 1.272 1.00 46.52 U ATOM 954 N GLN U 422 38.575 92.666 -0.670
1.00 44.07 U ATOM 955 CA GLN U 422 39.810 92.331 0.009 1.00 44.59 U
ATOM 956 CB GLN U 422 40.896 91.968 -1.003 1.00 50.43 U ATOM 957 CG
GLN U 422 42.105 91.358 -0.319 1.00 56.93 U ATOM 958 CD GLN U 422
41.709 90.282 0.702 1.00 66.07 U ATOM 959 OE1 GLN U 422 41.338
89.162 0.331 1.00 71.38 U ATOM 960 NE2 GLN U 422 41.776 90.626
1.993 1.00 64.40 U ATOM 961 C GLN U 422 40.289 93.466 0.919 1.00
43.80 U ATOM 962 O GLN U 422 40.727 93.234 2.042 1.00 36.35 U ATOM
963 N GLN U 423 40.206 94.700 0.440 1.00 45.96 U ATOM 964 CA GLN U
423 40.638 95.823 1.256 1.00 43.51 U ATOM 965 CB GLN U 423 40.496
97.120 0.447 1.00 44.53 U ATOM 966 CG GLN U 423 40.954 98.390 1.169
1.00 49.41 U ATOM 967 CD GLN U 423 42.060 98.155 2.198 1.00 51.38 U
ATOM 968 OE1 GLN U 423 43.087 97.541 1.909 1.00 55.81 U ATOM 969
NE2 GLN U 423 41.848 98.655 3.408 1.00 50.67 U ATOM 970 C GLN U 423
39.819 95.862 2.555 1.00 43.42 U ATOM 971 O GLN U 423 40.362 95.696
3.658 1.00 39.70 U ATOM 972 N VAL U 424 38.511 96.066 2.398 1.00
39.62 U ATOM 973 CA VAL U 424 37.543 96.121 3.495 1.00 33.70 U ATOM
974 CB VAL U 424 36.119 96.067 2.908 1.00 32.61 U ATOM 975 CG1 VAL
U 424 35.101 95.797 3.983 1.00 24.92 U ATOM 976 CG2 VAL U 424
35.818 97.385 2.187 1.00 36.03 U ATOM 977 C VAL U 424 37.740 94.988
4.526 1.00 37.29 U ATOM 978 O VAL U 424 37.546 95.162 5.730 1.00
39.08 U ATOM 979 N GLU U 425 38.130 93.819 4.053 1.00 32.96 U ATOM
980 CA GLU U 425 38.366 92.713 4.943 1.00 27.56 U ATOM 981 CB GLU U
425 38.551 91.455 4.117 1.00 24.43 U ATOM 982 CG GLU U 425 39.041
90.274 4.883 1.00 31.65 U ATOM 983 CD GLU U 425 38.097 89.845 5.974
1.00 38.65 U ATOM 984 OE1 GLU U 425 36.902 90.192 5.878 1.00 46.22
U ATOM 985 OE2 GLU U 425 38.551 89.154 6.916 1.00 35.34 U ATOM 986
C GLU U 425 39.593 92.989 5.818 1.00 32.07 U ATOM 987 O GLU U 425
39.536 92.800 7.030 1.00 25.52 U ATOM 988 N ASN U 426 40.694 93.450
5.219 1.00 35.40 U ATOM 989 CA ASN U 426 41.911 93.733 5.993 1.00
39.46 U ATOM 990 CB ASN U 426 43.056 94.262 5.121 1.00 44.98 U ATOM
991 CG ASN U 426 43.538 93.242 4.099 1.00 56.28 U ATOM 992 OD1 ASN
U 426 43.488 92.026 4.332 1.00 60.50 U ATOM 993 ND2 ASN U 426
44.021 93.732 2.964 1.00 53.75 U ATOM 994 C ASN U 426 41.613 94.755
7.058 1.00 39.97 U
ATOM 995 O ASN U 426 42.164 94.690 8.166 1.00 40.06 U ATOM 996 N
LEU U 427 40.747 95.705 6.719 1.00 36.37 U ATOM 997 CA LEU U 427
40.353 96.735 7.669 1.00 34.77 U ATOM 998 CB LEU U 427 39.507
97.801 6.973 1.00 33.42 U ATOM 999 CG LEU U 427 40.177 98.753 5.989
1.00 34.01 U ATOM 1000 CD1 LEU U 427 39.120 99.513 5.193 1.00 28.60
U ATOM 1001 CD2 LEU U 427 41.060 99.710 6.754 1.00 26.72 U ATOM
1002 C LEU U 427 39.563 96.117 8.832 1.00 37.46 U ATOM 1003 O LEU U
427 39.790 96.444 9.996 1.00 36.46 U ATOM 1004 N ARG U 428 38.631
95.226 8.518 1.00 36.70 U ATOM 1005 CA ARG U 428 37.836 94.581
9.564 1.00 39.47 U ATOM 1006 CB ARG U 428 36.839 93.580 8.953 1.00
40.08 U ATOM 1007 CG ARG U 428 35.825 92.988 9.921 1.00 23.37 U
ATOM 1008 CD ARG U 428 35.405 91.634 9.431 1.00 40.22 U ATOM 1009
NE ARG U 428 34.019 91.230 9.725 1.00 43.20 U ATOM 1010 CZ ARG U
428 32.941 91.863 9.283 1.00 27.82 U ATOM 1011 NH1 ARG U 428 33.071
92.943 8.544 1.00 40.71 U ATOM 1012 NH2 ARG U 428 31.742 91.386
9.523 1.00 27.69 U ATOM 1013 C ARG U 428 38.746 93.825 10.515 1.00
37.61 U ATOM 1014 O ARG U 428 38.546 93.840 11.730 1.00 35.39 U
ATOM 1015 N GLU U 429 39.742 93.163 9.938 1.00 37.57 U ATOM 1016 CA
GLU U 429 40.678 92.366 10.699 1.00 39.44 U ATOM 1017 CB GLU U 429
41.512 91.530 9.751 1.00 43.58 U ATOM 1018 CG GLU U 429 40.680
90.717 8.782 1.00 51.00 U ATOM 1019 CD GLU U 429 41.442 89.532
8.227 1.00 54.03 U ATOM 1020 OE1 GLU U 429 42.136 88.874 9.025 1.00
59.29 U ATOM 1021 OE2 GLU U 429 41.341 89.239 7.015 1.00 53.59 U
ATOM 1022 C GLU U 429 41.567 93.166 11.641 1.00 42.36 U ATOM 1023 O
GLU U 429 42.022 92.619 12.649 1.00 45.72 U ATOM 1024 N LYS U 430
41.821 94.442 11.323 1.00 40.65 U ATOM 1025 CA LYS U 430 42.610
95.317 12.204 1.00 36.40 U ATOM 1026 CB LYS U 430 42.848 96.691
11.573 1.00 38.62 U ATOM 1027 CG LYS U 430 43.540 96.660 10.241
1.00 47.84 U ATOM 1028 CD LYS U 430 44.948 96.101 10.323 1.00 54.43
U ATOM 1029 CE LYS U 430 45.672 96.253 8.984 1.00 55.55 U ATOM 1030
NZ LYS U 430 47.129 95.979 9.116 1.00 58.55 U ATOM 1031 C LYS U 430
41.773 95.511 13.469 1.00 29.86 U ATOM 1032 O LYS U 430 42.252
95.277 14.582 1.00 32.21 U ATOM 1033 N VAL U 431 40.525 95.943
13.281 1.00 20.84 U ATOM 1034 CA VAL U 431 39.594 96.137 14.384
1.00 25.88 U ATOM 1035 CB VAL U 431 38.143 96.411 13.873 1.00 23.91
U ATOM 1036 CG1 VAL U 431 37.212 96.606 15.064 1.00 27.22 U ATOM
1037 CG2 VAL U 432 38.091 97.652 12.988 1.00 13.93 U ATOM 1038 C
VAL U 431 39.561 94.901 15.319 1.00 32.07 U ATOM 1039 O VAL U 431
39.465 95.028 16.545 1.00 34.56 U ATOM 1040 N TYR U 432 39.634
93.702 14.750 1.00 29.60 U ATOM 1041 CA TYR U 432 39.610 92.504
15.574 1.00 28.79 U ATOM 1042 CB TYR U 432 39.681 91.250 14.707
1.00 26.26 U ATOM 1043 CG TYR U 432 38.407 90.812 14.019 1.00 28.57
U ATOM 1044 CD1 TYR U 432 38.467 89.932 12.942 1.00 31.46 U ATOM
1045 CE1 TYR U 432 37.338 89.530 12.271 1.00 30.13 U ATOM 1046 CD2
TYR U 432 37.154 91.279 14.413 1.00 35.44 U ATOM 1047 CE2 TYR U 432
36.000 90.877 13.731 1.00 33.27 U ATOM 1048 CZ TYR U 432 36.108
89.998 12.661 1.00 32.17 U ATOM 1049 OH TYR U 432 34.996 89.551
11.979 1.00 35.83 U ATOM 1050 C TYR U 432 40.812 92.512 16.505 1.00
30.84 U ATOM 1051 O TYR U 432 40.716 92.191 17.692 1.00 34.48 U
ATOM 1052 N ALA U 433 41.955 92.869 15.934 1.00 31.75 U ATOM 1053
CA ALA U 433 43.211 92.907 16.657 1.00 28.58 U ATOM 1054 CB ALA U
433 44.318 93.194 15.725 1.00 18.16 U ATOM 1055 C ALA U 433 43.172
93.961 17.709 1.00 29.75 U ATOM 1056 O ALA U 433 43.452 93.689
18.880 1.00 31.28 U ATOM 1057 N ILE U 434 42.838 95.172 17.282 1.00
26.79 U ATOM 1058 CA ILE U 434 42.760 96.313 18.187 1.00 28.71 U
ATOM 1059 CB ILE U 434 42.248 97.533 17.435 1.00 28.12 U ATOM 1060
CG2 ILE U 434 41.861 98.618 18.399 1.00 20.04 U ATOM 1061 CG1 ILE U
434 43.308 97.986 16.431 1.00 32.44 U ATOM 1062 CD1 ILE U 434
42.846 99.059 15.470 1.00 37.48 U ATOM 1063 C ILE U 434 41.844
96.008 19.369 1.00 32.28 U ATOM 1064 O ILE U 434 42.242 96.126
20.521 1.00 31.88 U ATOM 1065 N LEU U 435 40.622 95.590 19.061 1.00
34.58 U ATOM 1066 CA LEU U 435 39.626 95.255 20.064 1.00 30.55 U
ATOM 1067 CB LEU U 435 38.332 94.848 19.383 1.00 24.76 U ATOM 1068
CG LEU U 435 37.245 94.435 20.358 1.00 22.75 U ATOM 1069 CD1 LEU U
435 36.888 95.597 21.287 1.00 14.85 U ATOM 1070 CD2 LEU U 435
36.055 93.992 19.572 1.00 20.23 U ATOM 1071 C LEU U 435 40.061
94.137 21.000 1.00 33.58 U ATOM 1072 O LEU U 435 39.782 94.189
22.193 1.00 36.34 U ATOM 1073 N GLU U 436 40.728 93.115 20.470 1.00
35.92 U ATOM 1074 CA GLU U 436 41.175 92.010 21.307 1.00 36.91 U
ATOM 1075 CB GLU U 436 41.803 90.914 20.448 1.00 39.15 U ATOM 1076
CG GLU U 436 42.215 89.619 21.195 1.00 47.97 U ATOM 1077 CD GLU U
436 43.422 89.797 22.130 1.00 57.74 U ATOM 1078 OE1 GLU U 436
44.370 90.522 21.752 1.00 57.59 U ATOM 1079 OE2 GLU U 436 43.431
89.197 23.237 1.00 59.28 U ATOM 1080 C GLU U 436 42.192 92.546
22.308 1.00 39.00 U ATOM 1081 O GLU U 436 42.077 92.330 23.516 1.00
43.08 U ATOM 1082 N GLU U 437 43.179 93.272 21.806 1.00 33.63 U
ATOM 1083 CA GLU U 437 44.205 93.830 22.666 1.00 33.97 U ATOM 1084
CB GLU U 437 45.288 94.465 21.788 1.00 35.76 U ATOM 1085 CG GLU U
437 45.654 95.892 22.072 1.00 42.35 U ATOM 1086 CD GLU U 437 46.806
95.998 23.013 1.00 46.27 U ATOM 1087 OE1 GLU U 437 47.829 95.318
22.791 1.00 52.89 U ATOM 1088 OE2 GLU U 437 46.690 96.773 23.977
1.00 54.39 U ATOM 1089 C GLU U 437 43.620 94.828 23.666 1.00 37.00
U ATOM 1090 O GLU U 437 44.014 94.850 24.831 1.00 35.19 U ATOM 1091
N TYR U 438 42.655 95.633 23.229 1.00 38.30 U ATOM 1092 CA TYR U
438 42.041 96.622 24.111 1.00 31.99 U ATOM 1093 CB TYR U 438 41.003
97.431 23.367 1.00 21.67 U ATOM 1094 CG TYR U 438 40.195 98.266
24.315 1.00 31.24 U ATOM 1095 CD1 TYR U 438 40.634 99.513 24.705
1.00 27.07 U ATOM 1096 CE1 TYR U 438 39.894 100.282 25.577 1.00
22.39 U ATOM 1097 CD2 TYR U 438 38.983 97.801 24.837 1.00 35.07 U
ATOM 1098 CE2 TYR U 438 38.237 98.573 25.713 1.00 30.79 U ATOM 1099
CZ TYR U 438 38.704 99.817 26.074 1.00 25.62 U ATOM 1100 OH TYR U
438 37.974 100.624 26.909 1.00 33.17 U ATOM 1101 C TYR U 438 41.372
96.015 25.330 1.00 31.47 U ATOM 1102 O TYR U 438 41.455 96.573
26.424 1.00 25.85 U ATOM 1103 N CYS U 439 40.673 94.897 25.123 1.00
31.38 U ATOM 1104 CA CYS U 439 39.992 94.203 26.211 1.00 36.18 U
ATOM 1105 CB CYS U 439 39.130 93.070 25.688 1.00 31.50 U ATOM 1106
SG CYS U 439 37.746 93.633 24.744 1.00 47.00 U ATOM 1107 C CYS U
439 41.020 93.623 27.136 1.00 37.71 U ATOM 1108 O CYS U 439 40.955
93.808 28.342 1.00 43.56 U ATOM 1109 N ARG U 440 41.974 92.914
26.550 1.00 35.22 U ATOM 1110 CA ARG U 440 43.046 92.292 27.302
1.00 33.73 U ATOM 1111 CB ARG U 440 44.042 91.688 26.319 1.00 33.72
U ATOM 1112 CG ARG U 440 44.799 90.454 26.800 1.00 33.46 U ATOM
1113 CD ARG U 440 45.700 89.954 25.690 1.00 36.28 U ATOM 1114 NE
ARG U 440 46.605 91.014 25.248 1.00 49.83 U ATOM 1115 CZ ARG U 440
46.961 91.203 23.982 1.00 58.58 U ATOM 1116 NH1 ARG U 440 46.485
90.394 23.038 1.00 65.49 U ATOM 1117 NH2 ARG U 440 47.780 92.201
23.657 1.00 54.79 U ATOM 1118 C ARG U 440 43.737 93.314 28.209 1.00
37.07 U ATOM 1119 O ARG U 440 43.996 93.045 29.383 1.00 36.27 U
ATOM 1120 N GLN U 441 44.032 94.491 27.664 1.00 38.15 U ATOM 1121
CA GLN U 441 44.685 95.551 28.440 1.00 37.13 U ATOM 1122 CB GLN U
441 45.169 96.684 27.541 1.00 41.00 U ATOM 1123 CG GLN U 441 46.452
96.417 26.807 1.00 36.46 U ATOM 1124 CD GLN U 441 47.543 96.001
27.729 1.00 38.92 U ATOM 1125 OE1 GLN U 441 47.541 96.353 28.918
1.00 36.95 U ATOM 1126 NE2 GLN U 441 48.505 95.252 27.196 1.00
37.41 U ATOM 1127 C GLN U 441 43.790 96.183 29.476 1.00 35.04 U
ATOM 1128 O GLN U 441 44.202 96.334 30.614 1.00 36.54 U ATOM 1129 N
THR U 442 42.580 96.569 29.060 1.00 32.77 U ATOM 1130 CA THR U 442
41.606 97.232 29.929 1.00 33.05 U ATOM 1131 CB THR U 442 40.476
97.923 29.102 1.00 35.63 U ATOM 1132 OG1 THR U 442 41.051 98.748
28.084 1.00 37.35 U ATOM 1133 CG2 THR U 442 39.603 98.811 30.001
1.00 28.11 U ATOM 1134 C THR U 442 40.947 96.338 30.972 1.00 32.93
U ATOM 1135 O THR U 442 40.877 96.715 32.136 1.00 33.34 U ATOM 1136
N TYR U 443 40.454 95.173 30.559 1.00 31.00 U ATOM 1137 CA TYR U
443 39.788 94.234 31.475 1.00 32.69 U ATOM 1138 CB TYR U 443 38.331
94.011 31.067 1.00 26.91 U ATOM 1139 CG TYR U 443 37.568 95.283
30.832 1.00 31.76 U ATOM 1140 CD1 TYR U 443 37.137 96.074 31.908
1.00 23.68 U ATOM 1141 CE1 TYR U 443 36.466 97.271 31.689 1.00
27.05 U ATOM 1142 CD2 TYR U 443 37.306 95.726 29.522 1.00 30.21 U
ATOM 1143 CE2 TYR U 443 36.640 96.925 29.291 1.00 28.42 U ATOM 1144
CZ TYR U 443 36.221 97.692 30.379 1.00 34.16 U ATOM 1145 OH TYR U
443 35.542 98.863 30.143 1.00 37.08 U ATOM 1146 C TYR U 443 40.533
92.916 31.405 1.00 36.13 U ATOM 1147 O TYR U 443 40.115 91.969
30.731 1.00 35.11 U ATOM 1148 N PRO U 444 41.661 92.840 32.107 1.00
41.53 U ATOM 1149 CD PRO U 444 42.276 93.918 32.892 1.00 37.80 U
ATOM 1150 CA PRO U 444 42.501 91.643 32.132 1.00 40.98 U ATOM 1151
CB PRO U 444 43.748 92.120 32.855 1.00 29.62 U ATOM 1152 CG PRO U
444 43.715 93.610 32.698 1.00 37.30 U ATOM 1153 C PRO U 444 41.872
90.442 32.829 1.00 44.98 U ATOM 1154 O PRO U 444 42.137 89.302
32.461 1.00 41.03 U ATOM 1155 N ASP U 445 41.037 90.695 33.831 1.00
50.06 U ATOM 1156 CA ASP U 445 40.432 89.600 34.570 1.00 52.26 U
ATOM 1157 CB ASP U 445 40.207 90.007 36.036 1.00 57.60 U ATOM 1158
CG ASP U 445 41.510 90.407 36.744 1.00 69.88 U ATOM 1159 OD1 ASP U
445 42.602 89.947 36.326 1.00 72.62 U ATOM 1160 OD2 ASP U 445
41.441 91.177 37.731 1.00 79.62 U ATOM 1161 C ASP U 445 39.145
89.094 33.942 1.00 51.13 U ATOM 1162 O ASP U 445 38.335 88.447
34.598 1.00 55.43 U ATOM 1163 N GLN U 446 38.956 89.377 32.663 1.00
43.93 U ATOM 1164 CA GLN U 446 37.769 88.914 31.974 1.00 40.93 U
ATOM 1165 CB GLN U 446 36.891 90.091 31.610 1.00 36.72 U ATOM 1166
CG GLN U 446 36.322 90.767 32.812 1.00 28.56 U ATOM 1167 CD GLN U
446 35.470 91.937 32.460 1.00 32.74 U ATOM 1168 OE1 GLN U 446
34.587 91.855 31.595 1.00 38.58 U ATOM 1169 NE2 GLN U 446 35.709
93.044 33.135 1.00 29.24 U ATOM 1170 C GLN U 446 38.199 88.199
30.724 1.00 44.06 U ATOM 1171 O GLN U 446 38.212 88.798 29.648 1.00
49.92 U ATOM 1172 N SER U 447 38.533 86.918 30.858 1.00 44.27 U
ATOM 1173 CA SER U 447 39.019 86.137 29.724 1.00 49.37 U ATOM 1174
CB SER U 447 39.460 84.743 30.173 1.00 50.92 U ATOM 1175 OG SER U
447 38.340 83.931 30.471 1.00 56.10 U ATOM 1176 C SER U 447 38.043
85.983 28.571 1.00 49.09 U ATOM 1177 O SER U 447 38.468 85.757
27.432 1.00 54.13 U ATOM 1178 N GLY U 448 36.749 86.111 28.845 1.00
41.71 U ATOM 1179 CA GLY U 448 35.791 85.935 27.774 1.00 40.85 U
ATOM 1180 C GLY U 448 35.196 87.190 27.186 1.00 38.14 U ATOM 1181 O
GLY U 448 34.415 87.123 26.239 1.00 40.33 U ATOM 1182 N ARG U 449
35.562 88.340 27.730 1.00 34.32 U ATOM 1183 CA ARG U 449 35.002
89.582 27.249 1.00 31.28 U ATOM 1184 CB ARG U 449 35.658 90.760
27.959 1.00 31.25 U ATOM 1185 CG ARG U 449 35.204 92.103 27.409
1.00 30.81 U ATOM 1186 CD ARG U 449 35.491 93.203 28.385 1.00 28.49
U ATOM 1187 NE ARG U 449 34.317 93.406 29.207 1.00 25.55 U ATOM
1188 CZ ARG U 449 33.560 94.491 29.155 1.00 35.25 U ATOM 1189 NH1
ARG U 449 33.861 95.481 28.326 1.00 29.71 U ATOM 1190 NH2 ARG U 449
32.483 94.569 29.910 1.00 35.38 U ATOM 1191 C ARG U 449 35.053
89.771 25.734 1.00 32.37 U ATOM 1192 O ARG U 449 34.026 90.069
25.115 1.00 24.02 U ATOM 1193 N PHE U 450 36.226 89.590 25.130 1.00
32.68 U ATOM 1194 CA PHE U 450 36.344 89.770 23.685 1.00 33.86 U
ATOM 1195 CB PHE U 450 37.740 89.346 23.208 1.00 32.48 U ATOM 1196
CG PHE U 450 37.964 89.516 21.724 1.00 27.55 U ATOM 1197 CD1 PHE U
450 38.552 88.505 20.986 1.00 18.94 U ATOM 1198 CD2 PHE U 450
37.604 90.694 21.079 1.00 32.79 U ATOM 1199 CE1 PHE U 450 38.783
88.656 19.635 1.00 26.39 U ATOM 1200 CE2 PHE U 450 37.829 90.862
19.720 1.00 31.98 U ATOM 1201 CZ PHE U 450 38.420 89.844 18.996
1.00 28.81 U ATOM 1202 C PHE U 450 35.255 88.994 22.926 1.00 35.97
U ATOM 1203 O PHE U 450 34.476 89.576 22.141 1.00 29.59 U ATOM 1204
N ALA U 451 35.193 87.685 23.147 1.00 34.16 U ATOM 1205 CA ALA U
451 34.165 86.919 22.465 1.00 40.68 U ATOM 1206 CB ALA U 451 34.369
85.403 22.679 1.00 37.32 U ATOM 1207 C ALA U 451 32.763 87.358
22.937 1.00 37.16 U ATOM 1208 O ALA U 451 31.811 87.373 22.149 1.00
30.92 U ATOM 1209 N LYS U 452 32.632 87.742 24.206 1.00 33.43 U
ATOM 1210 CA LYS U 452 31.328 88.149 24.694 1.00 35.13 U ATOM 1211
CB LYS U 452 31.388 88.491 26.194 1.00 33.79 U ATOM 1212 CG LYS U
452 30.100 89.149 26.709 1.00 30.21 U ATOM 1213 CD LYS U 452 29.938
89.171 28.205 1.00 25.99 U ATOM 1214 CE LYS U 452 29.242 87.904
28.704 1.00 33.85 U ATOM 1215 NZ LYS U 452 30.147 86.688 28.723
1.00 45.04 U ATOM 1216 C LYS U 452 30.796 89.325 23.870 1.00 38.79
U ATOM 1217 O LYS U 452 29.623 89.323 23.450 1.00 41.46 U ATOM 1218
N LEU U 453 31.669 90.307 23.632 1.00 36.24 U ATOM 1219 CA LEU U
453 31.346 91.504 22.853 1.00 35.60 U ATOM 1220 CB LEU U 453 32.529
92.491 22.859 1.00 37.67 U ATOM 1221 CG LEU U 453 32.925 93.408
24.017 1.00 37.01 U ATOM 1222 CD1 LEU U 453 34.319 93.957 23.772
1.00 26.98 U ATOM 1223 CD2 LEU U 453 31.929 94.536 24.126 1.00
28.37 U ATOM 1224 C LEU U 453 31.089 91.120 21.399 1.00 36.84 U
ATOM 1225 O LEU U 453 30.185 91.625 20.754 1.00 39.36 U ATOM 1226 N
LEU U 454 31.923 90.236 20.875 1.00 30.51 U ATOM 1227 CA LEU U 454
31.796 89.814 19.502 1.00 27.98 U ATOM 1228 CB LEU U 454 32.978
88.931 19.162 1.00 19.45 U ATOM 1229 CG LEU U 454 34.193 89.742
18.766 1.00 17.60 U ATOM 1230 CD1 LEU U 454 35.314 88.828 18.323
1.00 10.12 U ATOM 1231 CD2 LEU U 454 33.776 90.682 17.625 1.00
16.90 U ATOM 1232 C LEU U 454 30.491 89.081 19.225 1.00 36.94 U
ATOM 1233 O LEU U 454 29.952 89.135 18.103 1.00 40.85 U ATOM 1234 N
LEU U 455 29.976 88.400 20.249 1.00 33.97 U ATOM 1235 CA LEU U 455
28.748 87.645 20.107 1.00 29.01 U ATOM 1236 CB LEU U 455 28.768
86.451 21.045 1.00 20.81 U ATOM 1237 CG LEU U 455 29.785 85.367
20.661 1.00 31.44 U ATOM 1238 CD1 LEU U 455 29.688 84.190 21.655
1.00 28.59 U ATOM 1239 CD2 LEU U 455 29.546 84.885 19.212 1.00
24.17 U ATOM 1240 C LEU U 455 27.434 88.418 20.241 1.00 34.24 U
ATOM 1241 O LEU U 455 26.362 87.828 20.338 1.00 40.87 U ATOM 1242 N
ARG U 456 27.494 89.739 20.246 1.00 34.86 U ATOM 1243 CA ARG U 456
26.258 90.507 20.261 1.00 30.18 U ATOM 1244 CB ARG U 456 26.347
91.717 21.177 1.00 19.46 U ATOM 1245 CG ARG U 456 26.244 91.353
22.611 1.00 26.45 U
ATOM 1246 CD ARG U 456 24.835 91.561 23.174 1.00 36.76 U ATOM 1247
NE ARG U 456 23.845 90.491 22.947 1.00 37.17 U ATOM 1248 CZ ARG U
456 24.110 89.187 22.931 1.00 35.22 U ATOM 1249 NH1 ARG U 456
25.366 88.747 23.109 1.00 31.08 U ATOM 1250 NH2 ARG U 456 23.098
88.328 22.788 1.00 26.55 U ATOM 1251 C ARG U 456 26.073 90.957
18.824 1.00 28.29 U ATOM 1252 O ARG U 456 25.095 91.612 18.482 1.00
28.43 U ATOM 1253 N LEU U 457 27.023 90.577 17.976 1.00 29.12 U
ATOM 1254 CA LEU U 457 26.969 90.955 16.574 1.00 35.79 U ATOM 1255
CB LEU U 457 28.343 90.751 15.924 1.00 32.44 U ATOM 1256 CG LEU U
457 29.240 91.945 16.283 1.00 29.42 U ATOM 1257 CD1 LEU U 457
30.596 91.843 15.600 1.00 20.16 U ATOM 1258 CD2 LEU U 457 28.507
93.239 15.902 1.00 7.52 U ATOM 1259 C LEU U 457 25.864 90.210
15.846 1.00 35.57 U ATOM 1260 O LEU U 457 25.176 90.781 14.994 1.00
37.45 U ATOM 1261 N PRO U 458 25.697 88.917 16.154 1.00 39.69 U
ATOM 1262 CD PRO U 458 26.651 88.043 16.861 1.00 42.46 U ATOM 1263
CA PRO U 458 24.639 88.129 15.520 1.00 40.64 U ATOM 1264 CB PRO U
458 24.874 86.732 16.072 1.00 39.74 U ATOM 1265 CG PRO U 458 26.341
86.690 16.281 1.00 39.34 U ATOM 1266 C PRO U 458 23.328 88.732
16.043 1.00 39.56 U ATOM 1267 O PRO U 458 22.474 89.151 15.285 1.00
37.25 U ATOM 1268 N ALA U 459 23.194 88.803 17.360 1.00 42.78 U
ATOM 1269 CA ALA U 459 21.995 89.371 17.966 1.00 45.25 U ATOM 1270
CB ALA U 459 22.237 89.654 19.453 1.00 50.98 U ATOM 1271 C ALA U
459 21.536 90.644 17.272 1.00 42.47 U ATOM 1272 O ALA U 459 20.336
90.835 17.045 1.00 45.28 U ATOM 1273 N LEU U 460 22.504 91.505
16.964 1.00 36.60 U ATOM 1274 CA LEU U 460 22.288 92.793 16.304
1.00 33.20 U ATOM 1275 CB LEU U 460 23.596 93.582 16.274 1.00 27.00
U ATOM 1276 CG LEU U 460 23.699 94.850 15.426 1.00 22.57 U ATOM
1277 CD1 LEU U 460 22.852 95.941 15.999 1.00 16.07 U ATOM 1278 CD2
LEU U 460 25.142 95.282 15.383 1.00 15.66 U ATOM 1279 C LEU U 460
21.827 92.574 14.885 1.00 32.62 U ATOM 1280 O LEU U 460 21.011
93.318 14.352 1.00 36.27 U ATOM 1281 N ARG U 461 22.388 91.549
14.265 1.00 30.57 U ATOM 1282 CA ARG U 461 22.033 91.214 12.907
1.00 28.42 U ATOM 1283 CB ARG U 461 22.848 90.023 12.421 1.00 23.68
U ATOM 1284 CG ARG U 461 22.351 89.510 11.121 1.00 21.90 U ATOM
1285 CD ARG U 461 22.355 90.634 10.094 1.00 21.59 U ATOM 1286 NE
ARG U 461 23.722 90.984 9.723 1.00 25.86 U ATOM 1287 CZ ARG U 461
24.559 90.155 9.108 1.00 24.69 U ATOM 1288 NH1 ARG U 461 24.173
88.932 8.775 1.00 31.52 U ATOM 1289 NH2 ARG U 461 25.796 90.525
8.867 1.00 13.72 U ATOM 1290 C ARG U 461 20.560 90.872 12.882 1.00
28.82 U ATOM 1291 O ARG U 461 19.788 91.477 12.151 1.00 34.06 U
ATOM 1292 N SER U 462 20.170 89.904 13.701 1.00 23.31 U ATOM 1293
CA SER U 462 18.785 89.476 13.778 1.00 20.62 U ATOM 1294 CB SER U
462 18.634 88.487 14.916 1.00 10.85 U ATOM 1295 OG SER U 462 19.088
87.222 14.478 1.00 24.21 U ATOM 1296 C SER U 462 17.789 90.626
13.932 1.00 25.13 U ATOM 1297 O SER U 462 16.749 90.651 13.258 1.00
27.26 U ATOM 1298 N ILE U 463 18.101 91.570 14.819 1.00 25.00 U
ATOM 1299 CA ILE U 463 17.235 92.719 15.035 1.00 22.59 U ATOM 1300
CB ILE U 463 17.723 93.606 16.213 1.00 21.95 U ATOM 1301 CG2 ILE U
463 16.767 94.803 16.417 1.00 9.54 U ATOM 1302 CG1 ILE U 463 17.754
92.784 17.495 1.00 29.80 U ATOM 1303 CD1 ILE U 463 18.007 93.613
18.746 1.00 36.94 U ATOM 1304 C ILE U 463 17.242 93.543 13.757 1.00
23.31 U ATOM 1305 O ILE U 463 16.273 94.209 13.414 1.00 23.92 U
ATOM 1306 N GLY U 464 18.352 93.503 13.044 1.00 24.89 U ATOM 1307
CA GLY U 464 18.426 94.260 11.809 1.00 33.03 U ATOM 1308 C GLY U
464 17.482 93.699 10.764 1.00 31.59 U ATOM 1309 O GLY U 464 16.797
94.458 10.077 1.00 31.92 U ATOM 1310 N LEU U 465 17.437 92.370
10.648 1.00 30.09 U ATOM 1311 CA LEU U 465 16.574 91.721 9.665 1.00
29.21 U ATOM 1312 CB LEU U 465 16.778 90.196 9.651 1.00 28.45 U
ATOM 1313 CG LEU U 465 18.025 89.446 9.155 1.00 32.34 U ATOM 1314
CD1 LEU U 465 18.509 89.967 7.832 1.00 16.72 U ATOM 1315 CD2 LEU U
465 19.099 89.569 10.168 1.00 36.94 U ATOM 1316 C LEU U 465 15.096
92.018 9.899 1.00 31.95 U ATOM 1317 O LEU U 465 14.296 91.852 8.999
1.00 33.33 U ATOM 1318 N LYS U 466 14.722 92.449 11.100 1.00 33.32
U ATOM 1319 CA LYS U 466 13.323 92.747 11.375 1.00 35.15 U ATOM
1320 CB LYS U 466 13.063 92.648 12.877 1.00 33.26 U ATOM 1321 CG
LYS U 466 13.287 91.263 13.412 1.00 41.55 U ATOM 1322 CD LYS U 466
12.814 91.084 14.855 1.00 53.25 U ATOM 1323 CE LYS U 466 12.802
89.586 15.233 1.00 58.29 U ATOM 1324 NZ LYS U 466 12.566 89.308
16.689 1.00 55.16 U ATOM 1325 C LYS U 466 12.858 94.113 10.826 1.00
40.67 U ATOM 1326 O LYS U 466 11.662 94.425 10.834 1.00 43.41 U
ATOM 1327 N CYS U 467 13.805 94.918 10.342 1.00 42.42 U ATOM 1328
CA CYS U 467 13.501 96.232 9.780 1.00 45.65 U ATOM 1329 CB CYS U
467 14.704 97.150 9.903 1.00 41.08 U ATOM 1330 SG CYS U 467 15.338
97.319 11.533 1.00 44.12 U ATOM 1331 C CYS U 467 13.198 96.093
8.301 1.00 51.69 U ATOM 1332 O CYS U 467 14.115 95.838 7.515 1.00
54.82 U ATOM 1333 N LEU U 468 11.942 96.277 7.905 1.00 52.02 U ATOM
1334 CA LEU U 468 11.587 96.159 6.486 1.00 55.73 U ATOM 1335 CB LEU
U 468 10.107 95.800 6.334 1.00 56.80 U ATOM 1336 CG LEU U 468 9.600
94.477 6.915 1.00 51.27 U ATOM 1337 CD1 LEU U 468 8.101 94.283
6.550 1.00 43.06 U ATOM 1338 CD2 LEU U 468 10.452 93.341 6.373 1.00
34.14 U ATOM 1339 C LEU U 468 11.856 97.455 5.724 1.00 56.78 U ATOM
1340 O LEU U 468 11.130 97.789 4.785 1.00 59.23 U ATOM 1341 N GLU U
469 12.913 98.163 6.120 1.00 55.46 U ATOM 1342 CA GLU U 469 13.264
99.455 5.528 1.00 51.29 U ATOM 1343 CB GLU U 469 12.166 100.452
5.858 1.00 53.54 U ATOM 1344 CG GLU U 469 11.871 100.484 7.366 1.00
50.33 U ATOM 1345 CD GLU U 469 11.356 101.823 7.837 1.00 58.50 U
ATOM 1346 OE1 GLU U 469 10.734 102.528 7.004 1.00 53.57 U ATOM 1347
OE2 GLU U 469 11.564 102.154 9.037 1.00 60.67 U ATOM 1348 C GLU U
469 14.542 99.958 6.185 1.00 49.04 U ATOM 1349 O GLU U 469 15.025
99.352 7.145 1.00 45.50 U ATOM 1350 N HIS U 470 15.089 101.066
5.686 1.00 41.63 U ATOM 1351 CA HIS U 470 16.276 101.617 6.317 1.00
35.57 U ATOM 1352 CB HIS U 470 17.156 102.333 5.304 1.00 42.93 U
ATOM 1353 CG HIS U 470 17.949 101.411 4.433 1.00 50.13 U ATOM 1354
CD2 HIS U 470 19.285 101.191 4.348 1.00 54.17 U ATOM 1355 ND1 HIS U
470 17.366 100.565 3.520 1.00 54.29 U ATOM 1356 CE1 HIS U 470
18.306 99.861 2.909 1.00 53.53 U ATOM 1357 NE2 HIS U 470 19.478
100.225 3.395 1.00 46.80 U ATOM 1358 C HIS U 470 15.778 102.598
7.368 1.00 35.43 U ATOM 1359 O HIS U 470 15.225 103.642 7.034 1.00
33.29 U ATOM 1360 N LEU U 471 15.953 102.257 8.640 1.00 30.44 U
ATOM 1361 CA LEU U 471 15.483 103.105 9.731 1.00 33.39 U ATOM 1362
CB LEU U 471 16.213 102.720 11.025 1.00 35.77 U ATOM 1363 CG LEU U
471 15.997 101.303 11.567 1.00 33.74 U ATOM 1364 CD1 LEU U 471
16.933 101.053 12.723 1.00 32.19 U ATOM 1365 CD2 LEU U 471 14.558
101.135 11.994 1.00 29.88 U ATOM 1366 C LEU U 471 15.577 104.634
9.502 1.00 31.56 U ATOM 1367 O LEU U 471 16.566 105.134 8.992 1.00
32.92 U ATOM 1368 N PHE U 472 14.518 105.343 9.903 1.00 31.99 U
ATOM 1369 CA PHE U 472 14.348 106.803 9.819 1.00 29.89 U ATOM 1370
CB PHE U 472 15.328 107.516 10.754 1.00 29.21 U ATOM 1371 CG PHE U
472 15.469 106.869 12.084 1.00 27.18 U ATOM 1372 CD1 PHE U 472
16.681 106.337 12.478 1.00 32.98 U ATOM 1373 CD2 PHE U 472 14.390
106.751 12.932 1.00 33.76 U ATOM 1374 CE1 PHE U 472 16.811 105.690
13.683 1.00 29.18 U ATOM 1375 CE2 PHE U 472 14.516 106.091 14.161
1.00 30.06 U ATOM 1376 CZ PHE U 472 15.725 105.568 14.527 1.00
36.30 U ATOM 1377 C PHE U 472 14.441 107.442 8.430 1.00 33.97 U
ATOM 1378 O PHE U 472 14.275 108.661 8.290 1.00 31.69 U ATOM 1379 N
PHE U 473 14.676 106.634 7.401 1.00 32.14 U ATOM 1380 CA PHE U 473
14.808 107.182 6.059 1.00 33.71 U ATOM 1381 CB PHE U 473 15.157
106.097 5.049 1.00 17.58 U ATOM 1382 CG PHE U 473 15.498 106.647
3.705 1.00 31.82 U ATOM 1383 CD1 PHE U 473 16.670 107.393 3.522
1.00 30.74 U ATOM 1384 CD2 PHE U 473 14.640 106.459 2.616 1.00
36.15 U ATOM 1385 CE1 PHE U 473 16.983 107.940 2.275 1.00 34.57 U
ATOM 1386 CE2 PHE U 473 14.940 107.000 1.361 1.00 32.37 U ATOM 1387
CZ PHE U 473 16.118 107.742 1.192 1.00 33.69 U ATOM 1388 C PHE U
473 13.626 107.983 5.510 1.00 33.99 U ATOM 1389 O PHE U 473 13.816
109.005 4.868 1.00 39.78 U ATOM 1390 N PHE U 474 12.404 107.545
5.734 1.00 36.94 U ATOM 1391 CA PHE U 474 11.314 108.313 5.172 1.00
43.73 U ATOM 1392 CB PHE U 474 10.131 107.387 4.853 1.00 39.72 U
ATOM 1393 CG PHE U 474 10.459 106.315 3.836 1.00 34.24 U ATOM 1394
CD1 PHE U 474 10.470 104.966 4.195 1.00 36.54 U ATOM 1395 CD2 PHE U
474 10.758 106.653 2.523 1.00 28.23 U ATOM 1396 CE1 PHE U 474
10.768 103.973 3.267 1.00 32.02 U ATOM 1397 CE2 PHE U 474 11.057
105.672 1.585 1.00 29.66 U ATOM 1398 CZ PHE U 474 11.062 104.326
1.961 1.00 36.99 U ATOM 1399 C PHE U 474 10.907 109.506 6.044 1.00
45.36 U ATOM 1400 O PHE U 474 9.974 110.240 5.712 1.00 47.56 U ATOM
1401 N LYS U 475 11.616 109.699 7.153 1.00 47.58 U ATOM 1402 CA LYS
U 475 11.347 110.832 8.036 1.00 49.62 U ATOM 1403 CB LYS U 475
11.546 110.475 9.512 1.00 38.43 U ATOM 1404 CG LYS U 475 10.376
109.777 10.134 1.00 37.81 U ATOM 1405 CD LYS U 475 10.394 109.905
11.648 1.00 34.22 U ATOM 1406 CE LYS U 415 9.368 108.993 12.279
1.00 24.58 U ATOM 1407 NZ LYS U 475 9.543 107.623 11.704 1.00 31.52
U ATOM 1408 C LYS U 475 12.334 111.922 7.668 1.00 53.12 U ATOM 1409
O LYS U 475 12.257 113.050 8.176 1.00 50.05 U ATOM 1410 N LEU U 476
13.271 111.565 6.788 1.00 54.37 U ATOM 1411 CA LEU U 476 14.298
112.498 6.349 1.00 55.80 U ATOM 1412 CB LEU U 476 15.409 111.780
5.586 1.00 46.03 U ATOM 1413 CG LEU U 476 16.380 110.968 6.448 1.00
51.17 U ATOM 1414 CD1 LEU U 476 17.554 110.476 5.596 1.00 51.60 U
ATOM 1415 CD2 LEU U 476 16.879 111.828 7.603 1.00 48.81 U ATOM 1416
C LEU U 476 13.680 113.563 5.482 1.00 61.13 U ATOM 1417 O LEU U 476
12.765 113.289 4.704 1.00 61.06 U ATOM 1418 N VAL U 477 14.188
114.781 5.628 1.00 69.05 U ATOM 1419 CA VAL U 477 13.677 115.924
4.889 1.00 75.86 U ATOM 1420 CB VAL U 477 14.451 117.218 5.297 1.00
75.38 U ATOM 1421 CG1 VAL U 477 15.932 116.920 5.452 1.00 71.51 U
ATOM 1422 CG2 VAL U 477 14.219 118.317 4.278 1.00 74.25 U ATOM 1423
C VAL U 477 13.692 115.722 3.376 1.00 78.42 U ATOM 1424 O VAL U 477
12.658 115.853 2.723 1.00 80.89 U ATOM 1425 N GLY U 478 14.847
115.384 2.819 1.00 77.79 U ATOM 1426 CA GLY U 478 14.920 115.183
1.383 1.00 82.22 U ATOM 1427 C GLY U 478 14.152 113.968 0.900 1.00
84.69 U ATOM 1428 O GLY U 478 13.911 113.030 1.673 1.00 85.31 U
ATOM 1429 N ASN U 479 13.773 113.977 -0.380 1.00 83.70 U ATOM 1430
CA ASN U 479 13.031 112.863 -0.975 1.00 83.67 U ATOM 1431 CB ASN U
479 11.621 113.323 -1.353 1.00 85.15 U ATOM 1432 CG ASN U 479
10.543 112.379 -0.846 1.00 90.54 U ATOM 1433 OD1 ASN U 479 9.355
112.695 -0.914 1.00 97.66 U ATOM 1434 ND2 ASN U 479 10.951 111.210
-0.340 1.00 87.84 U ATOM 1435 C ASN U 479 13.753 112.285 -2.202
1.00 79.08 U ATOM 1436 O ASN U 479 13.276 112.379 -3.335 1.00 78.53
U ATOM 1437 N THR U 480 14.907 111.676 -1.954 1.00 73.32 U ATOM
1438 CA THR U 480 15.722 111.093 -3.011 1.00 68.11 U ATOM 1439 CB
THR U 480 17.147 111.650 -2.957 1.00 68.33 U ATOM 1440 OG1 THR U
480 17.732 111.290 -1.705 1.00 77.35 U ATOM 1441 CG2 THR U 480
17.144 113.162 -3.054 1.00 62.29 U ATOM 1442 C THR U 480 15.789
109.582 -2.816 1.00 63.60 U ATOM 1443 O THR U 480 14.882 108.995
-2.225 1.00 64.45 U ATOM 1444 N SER U 481 16.856 108.960 -3.316
1.00 54.01 U ATOM 1445 CA SER U 481 17.030 107.521 -3.172 1.00
58.62 U ATOM 1446 CB SER U 481 17.533 106.898 -4.467 1.00 62.02 U
ATOM 1447 OG SER U 481 18.908 107.173 -4.665 1.00 59.14 U ATOM 1448
C SER U 481 18.092 107.351 -2.105 1.00 61.40 U ATOM 1449 O SER U
481 18.921 108.234 -1.949 1.00 60.96 U ATOM 1450 N ILE U 482 18.081
106.230 -1.382 1.00 62.19 U ATOM 1451 CA ILE U 482 19.061 106.012
-0.324 1.00 59.95 U ATOM 1452 CB ILE U 482 19.132 104.525 0.152
1.00 63.75 U ATOM 1453 CG2 ILE U 482 19.994 104.415 1.428 1.00
56.37 U ATOM 1454 CG1 ILE U 482 17.737 103.992 0.472 1.00 66.43 U
ATOM 1455 CD1 ILE U 482 17.207 104.421 1.805 1.00 68.96 U ATOM 1456
C ILE U 482 20.436 106.392 -0.852 1.00 63.08 U ATOM 1457 O ILE U
482 21.151 107.172 -0.216 1.00 66.14 U ATOM 1458 N ASP U 483 20.790
105.864 -2.027 1.00 61.42 U ATOM 1459 CA ASP U 483 22.109 106.112
-2.628 1.00 55.14 U ATOM 1460 CB ASP U 483 22.286 105.279 -3.895
1.00 46.69 U ATOM 1461 CG ASP U 483 21.833 103.868 -3.701 1.00
54.41 U ATOM 1462 OD1 ASP U 483 22.701 102.974 -3.646 1.00 44.31 U
ATOM 1463 OD2 ASP U 483 20.594 103.669 -3.575 1.00 59.52 U ATOM
1464 C ASP U 483 22.387 107.564 -2.934 1.00 51.45 U ATOM 1465 O ASP
U 483 23.481 108.051 -2.687 1.00 53.59 U ATOM 1466 N SER U 484
21.410 108.269 -3.476 1.00 48.55 U ATOM 1467 CA SER U 484 21.636
109.665 -3.767 1.00 50.31 U ATOM 1468 CB SER U 484 20.457 110.233
-4.519 1.00 50.14 U ATOM 1469 OG SER U 484 20.387 111.624 -4.289
1.00 63.43 U ATOM 1470 C SER U 484 21.857 110.463 -2.476 1.00 52.59
U ATOM 1471 O SER U 484 22.683 111.387 -2.432 1.00 53.49 U ATOM
1472 N PHE U 485 21.109 110.099 -1.434 1.00 50.76 U ATOM 1473 CA
PHE U 485 21.199 110.746 -0.124 1.00 48.74 U ATOM 1474 CB PHE U 485
20.119 110.208 0.821 1.00 42.60 U ATOM 1475 CG PHE U 485 20.400
110.483 2.274 1.00 50.41 U ATOM 1476 CD1 PHE U 485 20.501 111.790
2.746 1.00 47.90 U ATOM 1477 CD2 PHE U 485 20.623 109.437 3.163
1.00 52.06 U ATOM 1478 CE1 PHE U 485 20.821 112.053 4.068 1.00
37.72 U ATOM 1479 CE2 PHE U 485 20.947 109.694 4.499 1.00 49.14 U
ATOM 1480 CZ PHE U 485 21.047 111.007 4.947 1.00 48.32 U ATOM 1481
C PHE U 485 22.569 110.497 0.498 1.00 51.52 U ATOM 1482 O PHE U 485
23.220 111.417 0.995 1.00 51.80 U ATOM 1483 N LEU U 486 22.986
109.235 0.486 1.00 48.33 U ATOM 1484 CA LEU U 486 24.275 108.838
1.030 1.00 42.40 U ATOM 1485 CB LEU U 486 24.452 107.328 0.894 1.00
35.79 U ATOM 1486 CG LEU U 486 23.728 106.462 1.915 1.00 33.49 U
ATOM 1487 CD1 LEU U 486 23.949 105.002 1.579 1.00 26.67 U ATOM 1488
CD2 LEU U 486 24.243 106.790 3.305 1.00 22.57 U ATOM 1489 C LEU U
486 25.409 109.529 0.298 1.00 46.74 U ATOM 1490 O LEU U 486 26.260
110.184 0.888 1.00 46.00 U ATOM 1491 N LEU U 487 25.417 109.362
-1.010 1.00 52.71 U ATOM 1492 CA LEU U 487 26.447 109.946 -1.844
1.00 51.57 U ATOM 1493 CB LEU U 487 26.095 109.686 -3.299 1.00
51.34 U ATOM 1494 CG LEU U 487 26.974 110.286 -4.374 1.00 50.14 U
ATOM 1495 CD1 LEU U 487 28.435 110.205 -4.001 1.00 49.39 U ATOM
1496 CD2 LEU U 487 26.676 109.529 -5.652 1.00 53.61 U
ATOM 1497 C LEU U 487 26.641 111.438 -1.589 1.00 48.88 U ATOM 1498
O LEU U 487 27.750 111.892 -1.338 1.00 48.29 U ATOM 1499 N SER U
488 25.561 112.201 -1.626 1.00 49.63 U ATOM 1500 CA SER U 488
25.674 113.637 -1.408 1.00 52.15 U ATOM 1501 CB SER U 488 24.370
114.327 -1.829 1.00 48.26 U ATOM 1502 OG SER U 488 23.425 114.316
-0.786 1.00 45.39 U ATOM 1503 C SER U 488 26.022 113.996 0.042 1.00
52.35 U ATOM 1504 O SER U 488 26.669 115.007 0.323 1.00 54.71 U
ATOM 1505 N MET U 489 25.585 113.165 0.968 1.00 52.82 U ATOM 1506
CA MET U 489 25.857 113.414 2.364 1.00 51.60 U ATOM 1507 CB MET U
489 24.988 112.506 3.214 1.00 46.06 U ATOM 1508 CG MET U 489 24.962
112.877 4.656 1.00 53.48 U ATOM 1509 SD MET U 489 23.612 113.978
5.008 1.00 57.03 U ATOM 1510 CE MET U 489 23.857 115.229 3.663 1.00
59.12 U ATOM 1511 C MET U 489 27.334 113.124 2.616 1.00 57.18 U
ATOM 1512 O MET U 489 27.960 113.744 3.480 1.00 59.72 U ATOM 1513 N
LEU U 490 27.888 112.186 1.847 1.00 56.23 U ATOM 1514 CA LEU U 490
29.289 111.810 1.990 1.00 55.97 U ATOM 1515 CB LEU U 490 29.612
110.548 1.181 1.00 42.91 U ATOM 1516 CG LEU U 490 29.308 109.231
1.904 1.00 45.20 U ATOM 1517 CD1 LEU U 490 29.785 108.064 1.089
1.00 44.97 U ATOM 1518 CD2 LEU U 490 29.998 109.206 3.256 1.00
41.97 U ATOM 1519 C LEU U 490 30.203 112.945 1.576 1.00 63.45 U
ATOM 1520 O LEU U 490 31.196 113.206 2.251 1.00 69.94 U ATOM 1521 N
GLU U 491 29.859 113.614 0.472 1.00 69.84 U ATOM 1522 CA GLU U 491
30.619 114.751 -0.064 1.00 68.81 U ATOM 1523 CB GLU U 491 30.415
114.811 -1.578 1.00 66.97 U ATOM 1524 CG GLU U 491 30.716 113.482
-2.293 1.00 72.32 U ATOM 1525 CD GLU U 491 30.162 113.407 -3.726
1.00 78.93 U ATOM 1526 OE1 GLU U 491 30.549 112.473 -4.474 1.00
73.54 U ATOM 1527 OE2 GLU U 491 29.334 114.273 -4.102 1.00 77.88 U
ATOM 1528 C GLU U 491 30.078 116.023 0.609 1.00 70.94 U ATOM 1529 O
GLU U 491 29.054 116.563 0.200 1.00 70.28 U ATOM 1530 N SER U 492
30.754 116.493 1.653 1.00 74.07 U ATOM 1531 CA SER U 492 30.277
117.668 2.376 1.00 79.39 U ATOM 1532 CB SER U 492 29.068 117.266
3.216 1.00 72.71 U ATOM 1533 OG SER U 492 28.556 118.371 3.927 1.00
78.28 U ATOM 1534 C SER U 492 31.344 118.316 3.275 1.00 87.95 U
ATOM 1535 O SER U 492 32.444 117.726 3.408 1.00 93.73 U ATOM 1536
OXT SER U 492 31.074 119.409 3.839 1.00 90.10 U ATOM 1537 CB PRO E
179 49.063 79.237 25.302 1.00 63.97 E ATOM 1538 CG PRO E 179 49.523
80.699 25.165 1.00 57.54 E ATOM 1539 C PRO E 179 47.730 78.002
27.104 1.00 62.42 E ATOM 1540 O PRO E 179 47.490 77.949 28.307 1.00
55.36 E ATOM 1541 N PRO E 179 48.555 80.420 27.318 1.00 59.63 E
ATOM 1542 CD PRO E 179 49.650 81.155 26.643 1.00 64.55 E ATOM 1543
CA PRO E 179 48.032 79.363 26.427 1.00 62.65 E ATOM 1544 N ILE E
180 47.712 76.941 26.281 1.00 63.43 E ATOM 1545 CA ILE E 180 47.477
75.504 26.600 1.00 60.71 E ATOM 1546 CB ILE E 180 48.481 74.973
27.657 1.00 56.02 E ATOM 1547 CG2 ILE E 180 49.882 75.406 27.284
1.00 49.91 E ATOM 1548 CG1 ILE E 180 48.084 75.440 29.052 1.00
56.69 E ATOM 1549 CD1 ILE E 180 48.587 74.527 30.150 1.00 64.15 E
ATOM 1550 C ILE E 180 46.080 74.938 26.962 1.00 59.69 E ATOM 1551 O
ILE E 180 45.474 75.331 27.961 1.00 61.02 E ATOM 1552 N THR E 181
45.605 73.986 26.146 1.00 53.78 E ATOM 1553 CA THR E 181 44.295
73.329 26.312 1.00 48.33 E ATOM 1554 CB THR E 181 43.927 72.425
25.050 1.00 44.47 E ATOM 1555 OG1 THR E 181 43.969 73.171 23.825
1.00 32.66 E ATOM 1556 CG2 THR E 181 42.536 71.818 25.215 1.00
43.04 E ATOM 1557 C THR E 181 44.297 72.377 27.526 1.00 49.61 E
ATOM 1558 O THR E 181 45.224 71.592 27.667 1.00 54.75 E ATOM 1559 N
PRO E 182 43.278 72.436 28.417 1.00 52.24 E ATOM 1560 CD PRO E 182
42.438 73.617 28.652 1.00 59.60 E ATOM 1561 CA PRO E 182 43.213
71.536 29.586 1.00 51.59 E ATOM 1562 CB PRO E 182 42.509 72.364
30.668 1.00 45.60 E ATOM 1563 CG PRO E 182 42.477 73.733 30.159
1.00 53.53 E ATOM 1564 C PRO E 182 42.367 70.303 29.265 1.00 55.33
E ATOM 1565 O PRO E 182 42.700 69.492 28.398 1.00 54.95 E ATOM 1566
N GLU E 183 41.242 70.208 29.983 1.00 64.63 E ATOM 1567 CA GLU E
183 40.258 69.114 29.890 1.00 59.48 E ATOM 1568 CB GLU E 183 39.918
68.677 31.303 1.00 63.94 E ATOM 1569 CG GLU E 183 41.252 68.361
32.006 1.00 67.86 E ATOM 1570 CD GLU E 183 42.391 68.176 30.967
1.00 61.39 E ATOM 1571 OE1 GLU E 183 42.141 67.503 29.928 1.00
56.70 E ATOM 1572 OE2 GLU E 183 43.501 68.717 31.171 1.00 48.71 E
ATOM 1573 C GLU E 183 39.062 69.539 29.083 1.00 56.09 E ATOM 1574 O
GLU E 183 37.914 69.212 29.332 1.00 44.53 E ATOM 1575 N GLN E 184
39.428 70.318 28.087 1.00 58.78 E ATOM 1576 CA GLN E 184 38.567
70.860 27.086 1.00 54.12 E ATOM 1577 CB GLN E 184 39.066 72.249
26.756 1.00 48.24 E ATOM 1578 CG GLN E 184 39.271 73.052 28.012
1.00 45.50 E ATOM 1579 CD GLN E 184 39.414 74.527 27.747 1.00 50.65
E ATOM 1580 OE1 GLN E 184 40.503 74.995 27.406 1.00 40.87 E ATOM
1581 NE2 GLN E 184 38.302 75.282 27.898 1.00 49.00 E ATOM 1582 C
GLN E 184 38.949 69.870 26.015 1.00 55.11 E ATOM 1583 O GLN E 184
38.202 69.589 25.094 1.00 59.90 E ATOM 1584 N GLU E 185 40.151
69.335 26.177 1.00 53.21 E ATOM 1585 CA GLU E 185 40.668 68.340
25.279 1.00 49.10 E ATOM 1586 CB GLU E 185 42.028 67.858 25.755
1.00 51.38 E ATOM 1587 CG GLU E 185 42.739 67.063 24.692 1.00 61.09
E ATOM 1588 CD GLU E 185 42.925 67.889 23.431 1.00 62.65 E ATOM
1589 OE1 GLU E 185 43.446 69.018 23.577 1.00 58.60 E ATOM 1590 OE2
GLU E 185 42.560 67.424 22.318 1.00 60.26 E ATOM 1591 C GLU E 185
39.692 67.173 25.272 1.00 46.01 E ATOM 1592 O GLU E 185 39.426
66.590 24.222 1.00 44.96 E ATOM 1593 N GLU E 186 39.159 66.826
26.443 1.00 42.99 E ATOM 1594 CA GLU E 186 38.200 65.732 26.507
1.00 43.92 E ATOM 1595 CB GLU E 186 37.841 65.329 27.927 1.00 50.55
E ATOM 1596 CG GLU E 186 36.916 64.111 27.932 1.00 54.03 E ATOM
1597 CD GLU E 186 36.276 63.838 29.276 1.00 55.18 E ATOM 1598 OE1
GLU E 186 36.992 63.857 30.301 1.00 55.83 E ATOM 1599 OE2 GLU E 186
35.051 63.588 29.304 1.00 56.58 E ATOM 1600 C GLU E 186 36.929
66.198 25.863 1.00 44.75 E ATOM 1601 O GLU E 186 36.283 65.443
25.131 1.00 46.38 E ATOM 1602 N LEU E 187 36.552 67.439 26.171 1.00
41.28 E ATOM 1603 CA LEU E 187 35.344 68.019 25.597 1.00 34.84 E
ATOM 1604 CB LEU E 187 35.166 69.442 26.107 1.00 27.70 E ATOM 1605
CG LEU E 187 33.949 70.135 25.489 1.00 28.29 E ATOM 1606 CD1 LEU E
187 32.628 69.518 25.994 1.00 25.76 E ATOM 1607 CD2 LEU E 187
34.049 71.604 25.807 1.00 32.95 E ATOM 1608 C LEU E 187 35.363
68.024 24.051 1.00 34.96 E ATOM 1609 O LEU E 187 34.356 67.724
23.384 1.00 35.08 E ATOM 1610 N ILE E 188 36.516 68.376 23.495 1.00
29.71 E ATOM 1611 CA ILE E 188 36.687 68.432 22.060 1.00 30.00 E
ATOM 1612 CB ILE E 188 38.018 69.131 21.687 1.00 24.30 E ATOM 1613
CG2 ILE E 188 38.142 69.293 20.166 1.00 11.17 E ATOM 1614 CG1 ILE E
188 38.046 70.520 22.323 1.00 22.82 E ATOM 1615 CD1 ILE E 188
39.347 71.238 22.144 1.00 20.00 E ATOM 1616 C ILE E 188 36.625
67.033 21.454 1.00 37.51 E ATOM 1617 O ILE E 188 35.999 66.845
20.401 1.00 41.11 E ATOM 1618 N HIS E 189 37.247 66.044 22.091 1.00
34.59 E ATOM 1619 CA HIS E 189 37.173 64.709 21.509 1.00 42.58 E
ATOM 1620 CB HIS E 189 37.961 63.699 22.350 1.00 52.40 E ATOM 1621
CG HIS E 189 39.441 63.862 22.236 1.00 66.69 E ATOM 1622 CD2 HIS E
189 40.188 64.667 21.441 1.00 69.80 E ATOM 1623 ND1 HIS E 189
40.331 63.155 23.015 1.00 71.12 E ATOM 1624 CE1 HIS E 189 41.565
63.522 22.706 1.00 76.28 E ATOM 1625 NE2 HIS E 189 41.506 64.437
21.755 1.00 69.65 E ATOM 1626 C HIS E 189 35.705 64.284 21.384 1.00
41.69 E ATOM 1627 O HIS E 189 35.271 63.746 20.354 1.00 43.43 E
ATOM 1628 N ARG E 190 34.942 64.559 22.432 1.00 34.44 E ATOM 1629
CA ARG E 190 33.540 64.212 22.451 1.00 38.70 E ATOM 1630 CB ARG E
190 32.924 64.607 23.792 1.00 38.89 E ATOM 1631 CG ARG E 190 31.427
64.807 23.737 1.00 36.05 E ATOM 1632 CD ARG E 190 30.892 65.121
25.095 1.00 40.10 E ATOM 1633 NE ARG E 190 31.170 64.036 26.022
1.00 40.47 E ATOM 1634 CZ ARG E 190 32.040 64.137 27.013 1.00 47.56
E ATOM 1635 NH1 ARG E 190 32.705 65.278 27.199 1.00 46.35 E ATOM
1636 NH2 ARG E 190 32.249 63.099 27.806 1.00 44.64 E ATOM 1637 C
ARG E 190 32.746 64.859 21.314 1.00 38.24 E ATOM 1638 O ARG E 190
32.020 64.166 20.593 1.00 36.82 E ATOM 1639 N LEU E 191 32.858
66.175 21.158 1.00 30.98 E ATOM 1640 CA LEU E 191 32.103 66.814
20.105 1.00 34.04 E ATOM 1641 CB LEU E 191 32.219 68.324 20.178
1.00 30.97 E ATOM 1642 CG LEU E 191 31.843 69.007 21.477 1.00 32.34
E ATOM 1643 CD1 LEU E 191 32.052 70.484 21.254 1.00 32.17 E ATOM
1644 CD2 LEU E 191 30.417 68.719 21.879 1.00 22.30 E ATOM 1645 C
LEU E 191 32.583 66.353 18.752 1.00 37.58 E ATOM 1646 O LEU E 191
31.777 66.091 17.866 1.00 41.61 E ATOM 1647 N VAL E 192 33.894
66.247 18.577 1.00 35.14 E ATOM 1648 CA VAL E 192 34.409 65.822
17.286 1.00 34.28 E ATOM 1649 CB VAL E 192 35.950 65.935 17.233
1.00 30.40 E ATOM 1650 CG1 VAL E 192 36.466 65.458 15.902 1.00
18.28 E ATOM 1651 CG2 VAL E 192 36.349 67.376 17.397 1.00 27.26 E
ATOM 1652 C VAL E 192 33.945 64.406 16.967 1.00 34.14 E ATOM 1653 O
VAL E 192 33.745 64.065 15.798 1.00 32.27 E ATOM 1654 N TYR E 193
33.743 63.606 18.015 1.00 34.68 E ATOM 1655 CA TYR E 193 33.280
62.211 17.895 1.00 38.61 E ATOM 1656 CB TYR E 193 33.429 61.502
19.253 1.00 41.45 E ATOM 1657 CG TYR E 193 33.063 60.027 19.294
1.00 37.93 E ATOM 1658 CD1 TYR E 193 34.011 59.040 19.042 1.00
39.12 E ATOM 1659 CE1 TYR E 193 33.692 57.682 19.117 1.00 44.28 E
ATOM 1660 CD2 TYR E 193 31.778 59.625 19.623 1.00 44.95 E ATOM 1661
CE2 TYR E 193 31.441 58.278 19.702 1.00 50.21 E ATOM 1662 CZ TYR E
193 32.399 57.305 19.451 1.00 53.79 E ATOM 1663 OH TYR E 193 32.045
55.967 19.540 1.00 61.14 E ATOM 1664 C TYR E 193 31.816 62.175
17.454 1.00 37.90 E ATOM 1665 O TYR E 193 31.477 61.575 16.444 1.00
40.94 E ATOM 1666 N PHE E 194 30.958 62.829 18.230 1.00 40.65 E
ATOM 1667 CA PHE E 194 29.525 62.900 17.957 1.00 39.80 E ATOM 1668
CB PHE E 194 28.819 63.590 19.115 1.00 38.32 E ATOM 1669 CG PHE E
194 28.760 62.751 20.345 1.00 52.35 E ATOM 1670 CD1 PHE E 194
29.002 63.306 21.596 1.00 53.88 E ATOM 1671 CD2 PHE E 194 28.480
61.386 20.249 1.00 50.61 E ATOM 1672 CE1 PHE E 194 28.970 62.515
22.733 1.00 59.51 E ATOM 1673 CE2 PHE E 194 28.445 60.585 21.374
1.00 41.95 E ATOM 1674 CZ PHE E 194 28.690 61.143 22.620 1.00 54.73
E ATOM 1675 C PHE E 194 29.197 63.613 16.670 1.00 37.86 E ATOM 1676
O PHE E 194 28.162 63.360 16.066 1.00 38.35 E ATOM 1677 N GLN E 195
30.064 64.529 16.264 1.00 34.83 E ATOM 1678 CA GLN E 195 29.854
65.244 15.017 1.00 38.45 E ATOM 1679 CB GLN E 195 30.969 66.277
14.824 1.00 38.16 E ATOM 1680 CG GLN E 195 31.237 66.701 13.391
1.00 32.13 E ATOM 1681 CD GLN E 195 31.768 68.113 13.297 1.00 34.61
E ATOM 1682 OE1 GLN E 195 31.005 69.095 13.290 1.00 33.03 E ATOM
1683 NE2 GLN E 195 33.084 68.228 13.242 1.00 43.63 E ATOM 1684 C
GLN E 195 29.912 64.173 13.937 1.00 39.42 E ATOM 1685 O GLN E 195
28.977 63.974 13.150 1.00 36.82 E ATOM 1686 N ASN E 196 31.037
63.477 13.941 1.00 41.99 E ATOM 1687 CA ASN E 196 31.318 62.403
13.023 1.00 41.31 E ATOM 1688 CB ASN E 196 32.646 61.775 13.450
1.00 45.98 E ATOM 1689 CG ASN E 196 32.971 60.506 12.706 1.00 55.28
E ATOM 1690 OD1 ASN E 196 32.127 59.621 12.541 1.00 59.91 E ATOM
1691 ND2 ASN E 196 34.217 60.393 12.273 1.00 62.85 E ATOM 1692 C
ASN E 196 30.161 61.399 13.095 1.00 40.61 E ATOM 1693 O ASN E 196
29.547 61.069 12.082 1.00 43.29 E ATOM 1694 N GLU E 197 29.843
60.934 14.296 1.00 33.92 E ATOM 1695 CA GLU E 197 28.774 59.963
14.451 1.00 35.85 E ATOM 1696 CB GLU E 197 28.578 59.602 15.907
1.00 35.07 E ATOM 1697 CG GLU E 197 27.342 58.754 16.113 1.00 39.99
E ATOM 1698 CD GLU E 197 27.250 58.206 17.519 1.00 50.67 E ATOM
1699 OE1 GLU E 197 28.078 58.612 18.363 1.00 63.46 E ATOM 1700 OE2
GLU E 197 26.348 57.382 17.787 1.00 46.48 E ATOM 1701 C GLU E 197
27.421 60.346 13.870 1.00 39.95 E ATOM 1702 O GLU E 197 26.810
59.548 13.167 1.00 45.46 E ATOM 1703 N TYR E 198 26.940 61.551
14.156 1.00 40.87 E ATOM 1704 CA TYR E 198 25.643 61.971 13.628
1.00 41.62 E ATOM 1705 CB TYR E 198 24.890 62.790 14.673 1.00 44.79
E ATOM 1706 CG TYR E 198 24.575 62.013 15.919 1.00 43.32 E ATOM
1707 CD1 TYR E 198 25.219 62.305 17.123 1.00 46.37 E ATOM 1708 CE1
TYR E 198 24.942 61.588 18.274 1.00 44.89 E ATOM 1709 CD2 TYR E 198
23.645 60.984 15.895 1.00 33.72 E ATOM 1710 CE2 TYR E 198 23.362
60.262 17.033 1.00 41.24 E ATOM 1711 CZ TYR E 198 24.008 60.569
18.221 1.00 46.02 E ATOM 1712 OH TYR E 198 23.702 59.875 19.363
1.00 43.60 E ATOM 1713 C TYR E 198 25.665 62.739 12.309 1.00 40.33
E ATOM 1714 O TYR E 198 24.735 63.478 12.001 1.00 37.35 E ATOM 1715
N GLU E 199 26.705 62.544 11.510 1.00 42.59 E ATOM 1716 CA GLU E
199 26.798 63.254 10.246 1.00 44.32 E ATOM 1717 CB GLU E 199 28.234
63.271 9.753 1.00 45.64 E ATOM 1718 CG GLU E 199 28.358 63.729
8.323 1.00 60.30 E ATOM 1719 CD GLU E 199 29.612 64.535 8.097 1.00
80.08 E ATOM 1720 OE1 GLU E 199 29.902 64.857 6.918 1.00 88.69 E
ATOM 1721 OE2 GLU E 199 30.299 64.855 9.104 1.00 85.89 E ATOM 1722
C GLU E 199 25.920 62.766 9.116 1.00 42.47 E ATOM 1723 O GLU E 199
25.411 63.571 8.355 1.00 42.38 E ATOM 1724 N HIS E 200 25.752
61.452 8.999 1.00 48.21 E ATOM 1725 CA HIS E 200 24.969 60.879
7.904 1.00 50.56 E ATOM 1726 CB HIS E 200 25.862 59.945 7.067 1.00
51.56 E ATOM 1727 CG HIS E 200 27.160 60.579 6.659 1.00 66.93 E
ATOM 1728 CD2 HIS E 200 27.416 61.710 5.949 1.00 70.41 E ATOM 1729
ND1 HIS E 200 28.388 60.115 7.083 1.00 71.63 E ATOM 1730 CE1 HIS E
200 29.343 60.929 6.662 1.00 68.48 E ATOM 1731 NE2 HIS E 200 28.776
61.906 5.973 1.00 73.24 E ATOM 1732 C HIS E 200 23.746 60.137 8.385
1.00 48.07 E ATOM 1733 O HIS E 200 23.768 59.497 9.435 1.00 47.76 E
ATOM 1734 N PRO E 201 22.640 60.258 7.646 1.00 45.24 E ATOM 1735 CD
PRO E 201 22.407 61.202 6.545 1.00 41.22 E ATOM 1736 CA PRO E 201
21.408 59.565 8.029 1.00 48.15 E ATOM 1737 CB PRO E 201 20.338
60.262 7.188 1.00 43.73 E ATOM 1738 CG PRO E 201 21.101 60.721
5.992 1.00 46.22 E ATOM 1739 C PRO E 201 21.576 58.082 7.693 1.00
51.43 E ATOM 1740 O PRO E 201 22.348 57.726 6.795 1.00 52.90 E ATOM
1741 N SER E 202 20.868 57.219 8.416 1.00 54.88 E ATOM 1742 CA SER
E 202 20.977 55.772 8.202 1.00 54.89 E ATOM 1743 CB SER E 202
20.054 55.012 9.142 1.00 51.86 E ATOM 1744 OG SER E 202 18.719
55.146 8.697 1.00 53.06 E ATOM 1745 C SER E 202 20.621 55.388 6.784
1.00 55.91 E ATOM 1746 O SER E 202 19.596 55.808 6.255 1.00 60.73 E
ATOM 1747 N PRO E 203 21.446 54.551 6.154 1.00 56.97 E
ATOM 1748 CD PRO E 203 22.606 53.808 6.670 1.00 47.11 E ATOM 1749
CA PRO E 203 21.130 54.163 4.776 1.00 56.59 E ATOM 1750 CB PRO E
203 22.259 53.203 4.433 1.00 52.66 E ATOM 1751 CG PRO E 203 22.602
52.614 5.795 1.00 45.14 E ATOM 1752 C PRO E 203 19.725 53.565 4.573
1.00 54.90 E ATOM 1753 O PRO E 203 19.269 53.448 3.437 1.00 54.58 E
ATOM 1754 N GLU E 204 19.039 53.195 5.653 1.00 52.27 E ATOM 1755 CA
GLU E 204 17.691 52.640 5.524 1.00 60.56 E ATOM 1756 CB GLU E 204
17.271 51.958 6.805 1.00 65.25 E ATOM 1757 CG GLU E 204 18.292
51.010 7.350 1.00 87.18 E ATOM 1758 CD GLU E 204 18.017 50.695
8.809 1.00 102.16 E ATOM 1759 OE1 GLU E 204 18.179 51.609 9.654
1.00 104.48 E ATOM 1760 OE2 GLU E 204 17.621 49.541 9.111 1.00
109.20 E ATOM 1761 C GLU E 204 16.703 53.763 5.249 1.00 63.74 E
ATOM 1762 O GLU E 204 15.758 53.607 4.465 1.00 59.93 E ATOM 1763 N
ASP E 205 16.928 54.891 5.927 1.00 67.57 E ATOM 1764 CA ASP E 205
16.097 56.088 5.800 1.00 62.39 E ATOM 1765 CB ASP E 205 16.433
57.085 6.901 1.00 60.01 E ATOM 1766 CG ASP E 205 15.984 56.617
8.259 1.00 60.01 E ATOM 1767 OD1 ASP E 205 15.093 55.744 8.312 1.00
54.54 E ATOM 1768 OD2 ASP E 205 16.505 57.138 9.270 1.00 66.85 E
ATOM 1769 C ASP E 205 16.278 56.758 4.453 1.00 60.40 E ATOM 1770 O
ASP E 205 15.343 57.341 3.918 1.00 61.44 E ATOM 1771 N ILE E 206
17.497 56.693 3.931 1.00 58.45 E ATOM 1772 CA ILE E 206 17.825
57.250 2.625 1.00 57.04 E ATOM 1773 CB ILE E 206 19.361 57.355
2.443 1.00 54.15 E ATOM 1774 CG2 ILE E 206 19.709 57.780 1.021 1.00
41.45 E ATOM 1775 CG1 ILE E 206 19.930 58.357 3.443 1.00 51.02 E
ATOM 1776 CD1 ILE E 206 21.440 58.304 3.548 1.00 65.11 E ATOM 1777
C ILE E 206 17.222 56.299 1.586 1.00 60.40 E ATOM 1778 O ILE E 206
16.886 56.710 0.472 1.00 60.60 E ATOM 1779 N LYS E 207 17.091
55.024 1.966 1.00 65.28 E ATOM 1780 CA LYS E 207 16.484 54.006
1.104 1.00 66.30 E ATOM 1781 CB LYS E 207 16.533 52.609 1.753 1.00
74.28 E ATOM 1782 CG LYS E 207 15.997 51.466 0.852 1.00 78.22 E
ATOM 1783 CD LYS E 207 15.241 50.353 1.618 1.00 79.75 E ATOM 1784
CE LYS E 207 16.129 49.605 2.611 1.00 81.47 E ATOM 1785 NZ LYS E
207 15.502 48.353 3.141 1.00 77.97 E ATOM 1786 C LYS E 207 15.025
54.432 0.958 1.00 62.85 E ATOM 1787 O LYS E 207 14.591 54.757
-0.143 1.00 63.37 E ATOM 1788 N ARG E 208 14.284 54.448 2.072 1.00
55.10 E ATOM 1789 CA ARG E 208 12.883 54.860 2.053 1.00 53.30 E
ATOM 1790 CB ARG E 208 12.403 55.269 3.434 1.00 51.20 E ATOM 1791
CG ARG E 208 12.086 54.150 4.345 1.00 55.85 E ATOM 1792 CD ARG E
208 11.595 54.684 5.675 1.00 66.14 E ATOM 1793 NE ARG E 208 11.687
53.662 6.717 1.00 77.33 E ATOM 1794 CZ ARG E 208 12.812 53.323
7.347 1.00 79.98 E ATOM 1795 NH1 ARG E 208 13.956 53.933 7.052 1.00
76.94 E ATOM 1796 NH2 ARG E 208 12.797 52.360 8.264 1.00 82.91 E
ATOM 1797 C ARG E 208 12.629 56.037 1.136 1.00 55.84 E ATOM 1798 O
ARG E 208 11.614 56.079 0.449 1.00 60.42 E ATOM 1799 N ILE E 209
13.538 57.007 1.136 1.00 58.02 E ATOM 1800 CA ILE E 209 13.361
58.179 0.297 1.00 58.86 E ATOM 1801 CB ILE E 209 14.403 59.276
0.606 1.00 53.27 E ATOM 1802 CG2 ILE E 209 14.405 60.337 -0.493
1.00 52.48 E ATOM 1803 CG1 ILE E 209 14.059 59.938 1.936 1.00 41.03
E ATOM 1804 CD1 ILE E 209 14.868 61.134 2.232 1.00 45.96 E ATOM
1805 C ILE E 209 13.399 57.859 -1.182 1.00 61.16 E ATOM 1806 O ILE
E 209 12.535 58.315 -1.928 1.00 68.46 E ATOM 1807 N VAL E 210
14.380 57.074 -1.615 1.00 61.10 E ATOM 1808 CA VAL E 210 14.464
56.743 -3.035 1.00 66.44 E ATOM 1809 CB VAL E 210 15.785 56.059
-3.376 1.00 60.54 E ATOM 1810 CG1 VAL E 210 16.015 56.173 -4.872
1.00 49.11 E ATOM 1811 CG2 VAL E 210 16.924 56.678 -2.577 1.00
49.95 E ATOM 1812 C VAL E 210 13.315 55.845 -3.519 1.00 70.77 E
ATOM 1813 O VAL E 210 12.790 56.032 -4.618 1.00 74.50 E ATOM 1814 N
ASN E 211 12.935 54.869 -2.701 1.00 70.69 E ATOM 1815 CA ASN E 211
11.846 53.965 -3.043 1.00 70.57 E ATOM 1816 CB ASN E 211 11.959
52.632 -2.301 1.00 74.41 E ATOM 1817 CG ASN E 211 13.300 51.954
-2.503 1.00 78.30 E ATOM 1818 OD1 ASN E 211 14.015 52.225 -3.476
1.00 76.46 E ATOM 1819 ND2 ASN E 211 13.646 51.050 -1.583 1.00
80.75 E ATOM 1820 C ASN E 211 10.582 54.627 -2.587 1.00 71.71 E
ATOM 1821 O ASN E 211 9.880 54.091 -1.734 1.00 73.49 E ATOM 1822 N
ALA E 212 10.308 55.804 -3.128 1.00 73.73 E ATOM 1823 CA ALA E 212
9.107 56.543 -2.770 1.00 76.95 E ATOM 1824 CB ALA E 212 9.397
57.541 -1.640 1.00 72.06 E ATOM 1825 C ALA E 212 8.639 57.274
-4.011 1.00 79.72 E ATOM 1826 O ALA E 212 7.513 57.782 -4.053 1.00
80.85 E ATOM 1827 N ALA E 213 9.507 57.313 -5.024 1.00 79.03 E ATOM
1828 CA ALA E 213 9.187 57.987 -6.280 1.00 85.44 E ATOM 1829 CB ALA
E 213 10.189 57.592 -7.361 1.00 74.35 E ATOM 1830 C ALA E 213 7.766
57.643 -6.728 1.00 92.69 E ATOM 1831 O ALA E 213 7.411 56.471
-6.832 1.00 97.04 E ATOM 1832 N PRO E 214 6.922 58.662 -6.969 1.00
96.04 E ATOM 1833 CD PRO E 214 7.085 60.071 -6.580 1.00 97.64 E
ATOM 1834 CA PRO E 214 5.547 58.414 -7.406 1.00 97.66 E ATOM 1835
CB PRO E 214 4.898 59.793 -7.305 1.00 97.44 E ATOM 1836 CG PRO E
214 5.672 60.454 -6.238 1.00 98.77 E ATOM 1837 C PRO E 214 5.509
57.886 -8.839 1.00 100.95 E ATOM 1838 O PRO E 214 6.551 57.609
-9.448 1.00 99.62 E ATOM 1839 N GLU E 215 4.297 57.759 -9.369 1.00
103.11 E ATOM 1840 CA GLU E 215 4.088 57.287 -10.731 1.00 103.57 E
ATOM 1841 CB GLU E 215 2.587 57.206 -11.013 1.00 105.61 E ATOM 1842
CG GLU E 215 1.748 56.844 -9.792 1.00 110.38 E ATOM 1843 CD GLU E
215 0.278 57.221 -9.949 1.00 115.86 E ATOM 1844 OE1 GLU E 215
-0.015 58.406 -10.237 1.00 115.76 E ATOM 1845 OE2 GLU E 215 -0.587
56.334 -9.774 1.00 119.71 E ATOM 1846 C GLU E 215 4.749 58.302
-11.671 1.00 103.96 E ATOM 1847 O GLU E 215 4.225 59.406 -11.872
1.00 102.63 E ATOM 1848 N GLU E 216 5.901 57.932 -12.231 1.00
103.93 E ATOM 1849 CA GLU E 216 6.641 58.819 -13.133 1.00 102.83 E
ATOM 1850 CB GLU E 216 5.908 58.949 -14.465 1.00 103.19 E ATOM 1851
CG GLU E 216 5.919 57.666 -15.277 1.00 106.65 E ATOM 1852 CD GLU E
216 5.094 57.763 -16.544 1.00 107.70 E ATOM 1853 OE1 GLU E 216
5.312 58.715 -17.323 1.00 111.42 E ATOM 1854 OE2 GLU E 216 4.234
56.884 -16.767 1.00 107.18 E ATOM 1855 C GLU E 216 6.810 60.193
-12.495 1.00 101.72 E ATOM 1856 O GLU E 216 6.120 61.153 -12.857
1.00 98.48 E ATOM 1857 N GLU E 217 7.741 60.267 -11.545 1.00 101.00
E ATOM 1858 CA GLU E 217 8.006 61.492 -10.810 1.00 96.68 E ATOM
1859 CB GLU E 217 9.136 61.271 -9.803 1.00 95.92 E ATOM 1860 CG GLU
E 217 9.075 62.255 -8.647 1.00 92.06 E ATOM 1861 CD GLU E 217 9.841
61.786 -7.433 1.00 87.31 E ATOM 1862 OE1 GLU E 217 9.603 62.357
-6.344 1.00 78.36 E ATOM 1863 OE2 GLU E 217 10.672 60.856 -7.577
1.00 82.01 E ATOM 1864 C GLU E 217 8.327 62.675 -11.712 1.00 95.99
E ATOM 1865 O GLU E 217 9.045 62.546 -12.709 1.00 91.78 E ATOM 1866
N ASN E 218 7.780 63.828 -11.328 1.00 94.78 E ATOM 1867 CA ASN E
218 7.915 65.094 -12.048 1.00 90.55 E ATOM 1868 CB ASN E 218 7.362
66.227 -11.172 1.00 84.77 E ATOM 1869 CG ASN E 218 5.951 65.933
-10.674 1.00 80.53 E ATOM 1870 OD1 ASN E 218 5.067 65.588 -11.460
1.00 84.63 E ATOM 1871 ND2 ASN E 218 5.734 66.067 -9.373 1.00 67.42
E ATOM 1872 C ASN E 218 9.310 65.452 -12.577 1.00 89.43 E ATOM 1873
O ASN E 218 9.467 66.499 -13.221 1.00 84.83 E ATOM 1874 N VAL E 219
10.297 64.585 -12.302 1.00 85.75 E ATOM 1875 CA VAL E 219 11.692
64.734 -12.751 1.00 83.21 E ATOM 1876 CB VAL E 219 11.754 64.884
-14.302 1.00 86.51 E ATOM 1877 CG1 VAL E 219 11.816 66.377 -14.704
1.00 86.68 E ATOM 1878 CG2 VAL E 219 12.940 64.101 -14.855 1.00
84.48 E ATOM 1879 C VAL E 219 12.431 65.909 -12.099 1.00 82.44 E
ATOM 1880 O VAL E 219 13.665 65.933 -12.023 1.00 71.78 E ATOM 1881
N ALA E 220 11.649 66.894 -11.665 1.00 83.97 E ATOM 1882 CA ALA E
220 12.147 68.082 -10.994 1.00 80.39 E ATOM 1883 CB ALA E 220
11.562 69.330 -11.621 1.00 75.61 E ATOM 1884 C ALA E 220 11.622
67.912 -9.590 1.00 82.06 E ATOM 1885 O ALA E 220 11.923 68.690
-8.694 1.00 86.36 E ATOM 1886 N GLU E 221 10.810 66.879 -9.417 1.00
81.39 E ATOM 1887 CA GLU E 221 10.246 66.580 -8.125 1.00 86.99 E
ATOM 1888 CB GLU E 221 8.853 66.022 -8.297 1.00 92.66 E ATOM 1889
CG GLU E 221 7.796 67.052 -8.041 1.00 102.40 E ATOM 1890 CD GLU E
221 7.877 67.609 -6.633 1.00 109.23 E ATOM 1891 OE1 GLU E 221 8.134
66.810 -5.697 1.00 109.14 E ATOM 1892 OE2 GLU E 221 7.673 68.837
-6.465 1.00 109.67 E ATOM 1893 C GLU E 221 11.132 65.590 -7.397
1.00 90.81 E ATOM 1894 O GLU E 221 11.192 65.578 -6.165 1.00 89.18
E ATOM 1895 N GLU E 222 11.828 64.760 -8.167 1.00 94.11 E ATOM 1896
CA GLU E 222 12.733 63.781 -7.583 1.00 94.68 E ATOM 1897 CB GLU E
222 13.042 62.658 -8.584 1.00 98.88 E ATOM 1898 CG GLU E 222 13.844
61.481 -8.021 1.00 101.14 E ATOM 1899 CD GLU E 222 15.339 61.589
-8.301 1.00 104.36 E ATOM 1900 OE1 GLU E 222 15.727 61.583 -9.494
1.00 102.91 E ATOM 1901 OE2 GLU E 222 16.125 61.679 -7.330 1.00
104.65 E ATOM 1902 C GLU E 222 13.997 64.539 -7.205 1.00 92.44 E
ATOM 1903 O GLU E 222 15.042 63.948 -6.946 1.00 99.56 E ATOM 1904 N
ARG E 223 13.895 65.863 -7.204 1.00 83.62 E ATOM 1905 CA ARG E 223
15.001 66.724 -6.816 1.00 73.36 E ATOM 1906 CB ARG E 223 15.361
67.710 -7.927 1.00 68.97 E ATOM 1907 CG ARG E 223 16.254 67.139
-9.003 1.00 74.59 E ATOM 1908 CD ARG E 223 17.702 67.074 -8.553
1.00 80.35 E ATOM 1909 NE ARG E 223 18.530 66.283 -9.463 1.00 87.11
E ATOM 1910 CZ ARG E 223 18.519 64.951 -9.523 1.00 89.83 E ATOM
1911 NH1 ARG E 223 17.725 64.249 -8.720 1.00 89.06 E ATOM 1912 NH2
ARG E 223 19.296 64.317 -10.390 1.00 89.00 E ATOM 1913 C ARG E 223
14.479 67.474 -5.616 1.00 66.94 E ATOM 1914 O ARG E 223 15.141
67.575 -4.595 1.00 72.27 E ATOM 1915 N PHE E 224 13.264 67.984
-5.739 1.00 56.45 E ATOM 1916 CA PHE E 224 12.652 68.729 -4.657
1.00 51.72 E ATOM 1917 CB PHE E 224 11.396 69.426 -5.162 1.00 45.84
E ATOM 1918 CG PHE E 224 10.612 70.114 -4.081 1.00 44.08 E ATOM
1919 CD1 PHE E 224 10.903 71.427 -3.716 1.00 43.29 E ATOM 1920 CD2
PHE E 224 9.575 69.450 -3.427 1.00 33.81 E ATOM 1921 CE1 PHE E 224
10.164 72.063 -2.716 1.00 40.50 E ATOM 1922 CE2 PHE E 224 8.836
70.082 -2.435 1.00 32.02 E ATOM 1923 CZ PHE E 224 9.131 71.389
-2.081 1.00 34.88 E ATOM 1924 C PHE E 224 12.297 67.844 -3.465 1.00
54.07 E ATOM 1925 O PHE E 224 12.523 68.212 -2.313 1.00 52.27 E
ATOM 1926 N ARG E 225 11.730 66.674 -3.746 1.00 59.88 E ATOM 1927
CA ARG E 225 11.338 65.746 -2.689 1.00 55.01 E ATOM 1928 CB ARG E
225 10.632 64.517 -3.275 1.00 57.72 E ATOM 1929 CG ARG E 225 9.791
63.743 -2.259 1.00 58.92 E ATOM 1930 CD ARG E 225 9.419 62.354
-2.766 1.00 58.97 E ATOM 1931 NE ARG E 225 10.605 61.514 -2.893
1.00 65.72 E ATOM 1932 CZ ARG E 225 10.790 60.660 -3.887 1.00 60.47
E ATOM 1933 NH1 ARG E 225 9.857 60.551 -4.812 1.00 66.80 E ATOM
1934 NH2 ARG E 225 11.905 59.946 -3.978 1.00 58.05 E ATOM 1935 C
ARG E 225 12.575 65.307 -1.923 1.00 49.76 E ATOM 1936 O ARG E 225
12.523 65.132 -0.721 1.00 44.61 E ATOM 1937 N HIS E 226 13.688
65.122 -2.623 1.00 49.52 E ATOM 1938 CA HIS E 226 14.916 64.721
-1.956 1.00 50.69 E ATOM 1939 CB HIS E 226 16.000 64.401 -2.988
1.00 56.47 E ATOM 1940 CG HIS E 226 15.992 62.973 -3.446 1.00 61.46
E ATOM 1941 CD2 HIS E 226 16.988 62.181 -3.912 1.00 62.54 E ATOM
1942 ND1 HIS E 226 14.846 62.202 -3.467 1.00 56.15 E ATOM 1943 CE1
HIS E 226 15.136 60.997 -3.925 1.00 56.70 E ATOM 1944 NE2 HIS E 226
16.429 60.958 -4.203 1.00 65.13 E ATOM 1945 C HIS E 226 15.370
65.824 -1.010 1.00 49.73 E ATOM 1946 O HIS E 226 15.709 65.569
0.149 1.00 54.63 E ATOM 1947 N ILE E 227 15.347 67.056 -1.501 1.00
45.93 E ATOM 1948 CA ILE E 227 15.729 68.212 -0.710 1.00 39.16 E
ATOM 1949 CB ILE E 227 15.551 69.481 -1.532 1.00 33.64 E ATOM 1950
CG2 ILE E 227 15.619 70.697 -0.654 1.00 38.70 E ATOM 1951 CG1 ILE E
227 16.637 69.529 -2.596 1.00 39.45 E ATOM 1952 CD1 ILE E 227
16.600 70.746 -3.474 1.00 42.76 E ATOM 1953 C ILE E 227 14.922
68.328 0.584 1.00 38.85 E ATOM 1954 O ILE E 227 15.479 68.506 1.662
1.00 41.38 E ATOM 1955 N THR E 228 13.608 68.206 0.493 1.00 36.96 E
ATOM 1956 CA THR E 228 12.797 68.336 1.692 1.00 39.83 E ATOM 1957
CB THR E 228 11.390 68.903 1.339 1.00 32.96 E ATOM 1958 OG1 THR E
228 10.535 67.865 0.866 1.00 29.56 E ATOM 1959 CG2 THR E 228 11.515
69.940 0.256 1.00 28.02 E ATOM 1960 C THR E 228 12.668 67.072 2.561
1.00 41.84 E ATOM 1961 O THR E 228 12.536 67.162 3.785 1.00 45.14 E
ATOM 1962 N GLU E 229 12.723 65.902 1.941 1.00 41.17 E ATOM 1963 CA
GLU E 229 12.604 64.656 2.680 1.00 42.21 E ATOM 1964 CB GLU E 229
12.345 63.516 1.713 1.00 52.27 E ATOM 1965 CG GLU E 229 11.033
63.628 0.958 1.00 61.58 E ATOM 1966 CD GLU E 229 9.879 62.936 1.663
1.00 67.04 E ATOM 1967 OE1 GLU E 229 9.615 63.279 2.847 1.00 64.96
E ATOM 1968 OE2 GLU E 229 9.244 62.056 1.015 1.00 68.59 E ATOM 1969
C GLU E 229 13.883 64.388 3.458 1.00 43.81 E ATOM 1970 O GLU E 229
13.854 64.107 4.668 1.00 41.33 E ATOM 1971 N ILE E 230 15.013
64.471 2.761 1.00 38.60 E ATOM 1972 CA ILE E 230 16.295 64.242
3.412 1.00 38.64 E ATOM 1973 CB ILE E 230 17.452 64.356 2.401 1.00
33.51 E ATOM 1974 CG2 ILE E 230 18.771 64.116 3.091 1.00 34.50 E
ATOM 1975 CG1 ILE E 230 17.275 63.334 1.288 1.00 30.46 E ATOM 1976
CD1 ILE E 230 18.326 63.439 0.187 1.00 34.35 E ATOM 1977 C ILE E
230 16.529 65.254 4.552 1.00 41.49 E ATOM 1978 O ILE E 230 17.167
64.928 5.549 1.00 42.12 E ATOM 1979 N THR E 231 16.009 66.474 4.398
1.00 38.22 E ATOM 1980 CA THR E 231 16.188 67.526 5.389 1.00 37.71
E ATOM 1981 CB THR E 231 15.690 68.880 4.846 1.00 38.83 E ATOM 1982
OG1 THR E 231 16.599 69.343 3.845 1.00 36.93 E ATOM 1983 CG2 THR E
231 15.596 69.926 5.958 1.00 37.65 E ATOM 1984 C THR E 231 15.488
67.202 6.699 1.00 40.58 E ATOM 1985 O THR E 231 15.800 67.779 7.746
1.00 39.82 E ATOM 1986 N ILE E 232 14.528 66.288 6.642 1.00 38.47 E
ATOM 1987 CA ILE E 232 13.842 65.884 7.856 1.00 37.93 E ATOM 1988
CB ILE E 232 12.709 64.919 7.576 1.00 35.83 E ATOM 1989 CG2 ILE E
232 12.192 64.373 8.864 1.00 37.58 E ATOM 1990 CG1 ILE E 232 11.588
65.633 6.840 1.00 34.90 E ATOM 1991 CD1 ILE E 232 11.049 64.810
5.706 1.00 39.78 E ATOM 1992 C ILE E 232 14.898 65.145 8.651 1.00
37.38 E ATOM 1993 O ILE E 232 15.044 65.347 9.852 1.00 39.17 E ATOM
1994 N LEU E 233 15.628 64.285 7.949 1.00 34.45 E ATOM 1995 CA LEU
E 233 16.723 63.503 8.517 1.00 35.30 E ATOM 1996 CB LEU E 233
17.354 62.611 7.430 1.00 33.51 E ATOM 1997 CG LEU E 233 16.711
61.228 7.214 1.00 30.84 E ATOM 1998 CD1 LEU E 233 15.355 61.186
7.974 1.00 4.40 E
ATOM 1999 CD2 LEU E 233 16.583 60.926 5.695 1.00 23.27 E ATOM 2000
C LEU E 233 17.804 64.391 9.113 1.00 35.91 E ATOM 2001 O LEU E 233
18.360 64.069 10.166 1.00 29.18 E ATOM 2002 N THR E 234 18.094
65.500 8.423 1.00 36.21 E ATOM 2003 CA THR E 234 19.119 66.450
8.848 1.00 36.54 E ATOM 2004 CB THR E 234 19.327 67.593 7.814 1.00
39.35 E ATOM 2005 OG1 THR E 234 19.557 67.043 6.508 1.00 41.29 E
ATOM 2006 CG2 THR E 234 20.528 68.470 8.227 1.00 29.41 E ATOM 2007
C THR E 234 18.741 67.081 10.181 1.00 37.17 E ATOM 2008 O THR E 234
19.550 67.149 11.094 1.00 39.38 E ATOM 2009 N VAL E 235 17.507
67.548 10.299 1.00 35.56 E ATOM 2010 CA VAL E 235 17.086 68.169
11.540 1.00 33.16 E ATOM 2011 CB VAL E 235 15.693 68.793 11.409
1.00 32.20 E ATOM 2012 CG1 VAL E 235 15.227 69.325 12.759 1.00
22.81 E ATOM 2013 CG2 VAL E 235 15.751 69.908 10.388 1.00 25.24 E
ATOM 2014 C VAL E 235 17.097 67.164 12.674 1.00 32.90 E ATOM 2015 O
VAL E 235 17.409 67.509 13.817 1.00 30.52 E ATOM 2016 N GLN E 236
16.777 65.919 12.355 1.00 29.64 E ATOM 2017 CA GLN E 236 16.772
64.883 13.361 1.00 35.12 E ATOM 2018 CB GLN E 236 16.188 63.620
12.778 1.00 40.23 E ATOM 2019 CG GLN E 236 14.822 63.861 12.211
1.00 53.81 E ATOM 2020 CD GLN E 236 14.041 62.588 12.009 1.00 53.35
E ATOM 2021 OE1 GLN E 236 14.462 61.695 11.265 1.00 49.34 E ATOM
2022 NE2 GLN E 236 12.889 62.497 12.672 1.00 53.19 E ATOM 2023 C
GLN E 236 18.182 64.633 13.880 1.00 38.28 E ATOM 2024 O GLN E 236
18.407 64.595 15.098 1.00 46.79 E ATOM 2025 N LEU E 237 19.122
64.465 12.951 1.00 33.28 E ATOM 2026 CA LEU E 237 20.525 64.260
13.276 1.00 28.95 E ATOM 2027 CB LEU E 237 21.331 64.180 11.991
1.00 20.94 E ATOM 2028 CG LEU E 237 21.164 62.888 11.220 1.00 24.35
E ATOM 2029 CD1 LEU E 237 21.703 63.031 9.811 1.00 31.88 E ATOM
2030 CD2 LEU E 237 21.877 61.798 11.981 1.00 12.59 E ATOM 2031 C
LEU E 237 21.023 65.445 14.124 1.00 32.97 E ATOM 2032 O LEU E 237
21.847 65.279 15.031 1.00 34.52 E ATOM 2033 N ILE E 238 20.529
66.644 13.823 1.00 27.69 E ATOM 2034 CA ILE E 238 20.914 67.816
14.582 1.00 26.59 E ATOM 2035 CB ILE E 238 20.332 69.082 13.973
1.00 21.55 E ATOM 2036 CG2 ILE E 238 20.483 70.227 14.948 1.00
19.01 E ATOM 2037 CG1 ILE E 238 21.036 69.366 12.639 1.00 26.28 E
ATOM 2038 CD1 ILE E 238 20.473 70.523 11.831 1.00 19.16 E ATOM 2039
C ILE E 238 20.408 67.669 16.010 1.00 32.55 E ATOM 2040 O ILE E 238
21.132 67.980 16.964 1.00 30.08 E ATOM 2041 N VAL E 239 19.173
67.190 16.168 1.00 30.61 E ATOM 2042 CA VAL E 239 18.644 67.023
17.507 1.00 33.98 E ATOM 2043 CB VAL E 239 17.162 66.625 17.518
1.00 29.85 E ATOM 2044 CG1 VAL E 239 16.647 66.660 18.940 1.00
37.96 E ATOM 2045 CG2 VAL E 239 16.355 67.575 16.706 1.00 35.97 E
ATOM 2046 C VAL E 239 19.428 65.930 18.219 1.00 37.91 E ATOM 2047 O
VAL E 239 19.685 66.032 19.423 1.00 39.77 E ATOM 2048 N GLU E 240
19.806 64.894 17.470 1.00 30.46 E ATOM 2049 CA GLU E 240 20.551
63.767 18.020 1.00 34.21 E ATOM 2050 CB GLU E 240 20.834 62.716
16.938 1.00 49.56 E ATOM 2051 CG GLU E 240 19.662 61.785 16.653
1.00 65.08 E ATOM 2052 CD GLU E 240 18.953 61.378 17.939 1.00 79.27
E ATOM 2053 OE1 GLU E 240 17.993 62.086 18.344 1.00 83.63 E ATOM
2054 OE2 GLU E 240 19.376 60.369 18.561 1.00 84.61 E ATOM 2055 C
GLU E 240 21.851 64.203 18.648 1.00 33.16 E ATOM 2056 O GLU E 240
22.186 63.805 19.760 1.00 37.83 E ATOM 2057 N PHE E 241 22.580
65.027 17.919 1.00 35.09 E ATOM 2058 CA PHE E 241 23.854 65.559
18.375 1.00 33.75 E ATOM 2059 CB PHE E 241 24.552 66.222 17.174
1.00 34.01 E ATOM 2060 CG PHE E 241 25.842 66.924 17.498 1.00 27.48
E ATOM 2061 CD1 PHE E 241 27.056 66.306 17.266 1.00 27.18 E ATOM
2062 CD2 PHE E 241 25.838 68.228 18.004 1.00 32.42 E ATOM 2063 CE1
PHE E 241 28.250 66.972 17.529 1.00 33.13 E ATOM 2064 CE2 PHE E 241
27.032 68.911 18.272 1.00 27.18 E ATOM 2065 CZ PHE E 241 28.238
68.281 18.035 1.00 30.10 E ATOM 2066 C PHE E 241 23.639 66.562
19.524 1.00 32.50 E ATOM 2067 O PHE E 241 24.338 66.527 20.522 1.00
30.55 E ATOM 2068 N SER E 242 22.660 67.448 19.397 1.00 34.08 E
ATOM 2069 CA SER E 242 22.420 68.435 20.447 1.00 38.69 E ATOM 2070
CB SER E 242 21.212 69.303 20.100 1.00 40.24 E ATOM 2071 OG SER E
242 21.477 70.073 18.944 1.00 37.08 E ATOM 2072 C SER E 242 22.220
67.837 21.833 1.00 39.84 E ATOM 2073 O SER E 242 22.591 68.434
22.835 1.00 40.74 E ATOM 2074 N LYS E 243 21.654 66.645 21.896 1.00
42.89 E ATOM 2075 CA LYS E 243 21.397 66.023 23.180 1.00 41.67 E
ATOM 2076 CB LYS E 243 20.298 64.981 23.011 1.00 38.11 E ATOM 2077
CG LYS E 243 18.939 65.557 22.638 1.00 41.39 E ATOM 2078 CD LYS E
243 17.925 64.436 22.447 1.00 43.69 E ATOM 2079 CE LYS E 243 16.573
64.963 22.086 1.00 50.92 E ATOM 2080 NZ LYS E 243 15.715 63.865
21.585 1.00 55.82 E ATOM 2081 C LYS E 243 22.615 65.401 23.856 1.00
38.18 E ATOM 2082 O LYS E 243 22.668 65.274 25.082 1.00 43.36 E
ATOM 2083 N ARG E 244 23.600 65.008 23.070 1.00 36.51 E ATOM 2084
CA ARG E 244 24.787 64.386 23.651 1.00 41.55 E ATOM 2085 CB ARG E
244 25.474 63.478 22.616 1.00 37.53 E ATOM 2086 CG ARG E 244 24.497
62.607 21.818 1.00 46.34 E ATOM 2087 CD ARG E 244 24.227 61.262
22.459 1.00 48.64 E ATOM 2088 NE ARG E 244 25.425 60.432 22.424
1.00 54.52 E ATOM 2089 CZ ARG E 244 25.468 59.163 22.803 1.00 58.12
E ATOM 2090 NH1 ARG E 244 24.366 58.566 23.245 1.00 67.20 E ATOM
2091 NH2 ARG E 244 26.619 58.498 22.765 1.00 59.41 E ATOM 2092 C
ARG E 244 25.759 65.464 24.128 1.00 41.59 E ATOM 2093 O ARG E 244
26.862 65.143 24.594 1.00 39.08 E ATOM 2094 N LEU E 245 25.337
66.730 24.010 1.00 33.30 E ATOM 2095 CA LEU E 245 26.164 67.870
24.412 1.00 33.61 E ATOM 2096 CB LEU E 245 25.776 69.153 23.656
1.00 35.79 E ATOM 2097 CG LEU E 245 25.948 69.308 22.141 1.00 37.15
E ATOM 2098 CD1 LEU E 245 25.622 70.743 21.750 1.00 30.82 E ATOM
2099 CD2 LEU E 245 27.353 68.971 21.727 1.00 26.22 E ATOM 2100 C
LEU E 245 26.071 68.168 25.897 1.00 35.48 E ATOM 2101 O LEU E 245
24.978 68.418 26.433 1.00 38.59 E ATOM 2102 N PRO E 246 27.227
68.149 26.588 1.00 34.31 E ATOM 2103 CD PRO E 246 28.510 67.738
25.993 1.00 29.84 E ATOM 2104 CA PRO E 246 27.380 68.418 28.025
1.00 31.73 E ATOM 2105 CB PRO E 246 28.883 68.555 28.175 1.00 26.92
E ATOM 2106 CG PRO E 246 29.395 67.539 27.200 1.00 23.72 E ATOM
2107 C PRO E 246 26.652 69.705 28.425 1.00 34.47 E ATOM 2108 O PRO
E 246 26.919 70.764 27.891 1.00 26.51 E ATOM 2109 N GLY E 247
25.719 69.614 29.355 1.00 42.98 E ATOM 2110 CA GLY E 247 25.011
70.808 29.760 1.00 44.36 E ATOM 2111 C GLY E 247 23.590 70.854
29.251 1.00 46.41 E ATOM 2112 O GLY E 247 22.739 71.505 29.848 1.00
52.00 E ATOM 2113 N PHE E 248 23.317 70.165 28.152 1.00 45.04 E
ATOM 2114 CA PHE E 248 21.964 70.173 27.598 1.00 43.31 E ATOM 2115
CB PHE E 248 21.927 69.389 26.287 1.00 32.36 E ATOM 2116 CG PHE E
248 20.738 69.697 25.438 1.00 33.24 E ATOM 2117 CD1 PHE E 248
20.616 70.934 24.816 1.00 29.68 E ATOM 2118 CD2 PHE E 248 19.732
68.758 25.259 1.00 40.57 E ATOM 2119 CE1 PHE E 248 19.516 71.233
24.030 1.00 32.10 E ATOM 2120 CE2 PHE E 248 18.621 69.051 24.471
1.00 40.63 E ATOM 2121 CZ PHE E 248 18.516 70.291 23.857 1.00 34.65
E ATOM 2122 C PHE E 248 20.949 69.583 28.586 1.00 41.89 E ATOM 2123
O PHE E 248 19.786 69.973 28.623 1.00 38.90 E ATOM 2124 N ASP E 249
21.409 68.637 29.390 1.00 42.84 E ATOM 2125 CA ASP E 249 20.565
67.990 30.373 1.00 46.68 E ATOM 2126 CB ASP E 249 21.216 66.686
30.794 1.00 49.98 E ATOM 2127 CG ASP E 249 22.575 66.903 31.437
1.00 62.57 E ATOM 2128 OD1 ASP E 249 23.126 65.933 32.000 1.00
70.44 E ATOM 2129 OD2 ASP E 249 23.099 68.045 31.382 1.00 67.68 E
ATOM 2130 C ASP E 249 20.363 68.889 31.603 1.00 47.20 E ATOM 2131 O
ASP E 249 19.433 68.716 32.373 1.00 49.50 E ATOM 2132 N LYS E 250
21.237 69.854 31.802 1.00 45.53 E ATOM 2133 CA LYS E 250 21.080
70.730 32.938 1.00 45.70 E ATOM 2134 CB LYS E 250 22.406 71.450
33.188 1.00 49.35 E ATOM 2135 CG LYS E 250 23.622 70.517 33.347
1.00 56.63 E ATOM 2136 CD LYS E 250 23.506 69.582 34.555 1.00 63.25
E ATOM 2137 CE LYS E 250 24.826 68.887 34.883 1.00 67.60 E ATOM
2138 NZ LYS E 250 25.438 68.134 33.723 1.00 81.91 E ATOM 2139 C LYS
E 250 19.935 71.744 32.697 1.00 48.33 E ATOM 2140 O LYS E 250
19.618 72.560 33.567 1.00 55.90 E ATOM 2141 N LEU E 251 19.309
71.678 31.522 1.00 44.08 E ATOM 2142 CA LEU E 251 18.220 72.591
31.138 1.00 36.71 E ATOM 2143 CB LEU E 251 18.399 73.054 29.685
1.00 31.98 E ATOM 2144 CG LEU E 251 19.714 73.688 29.267 1.00 30.27
E ATOM 2145 CD1 LEU E 251 19.603 74.195 27.846 1.00 26.21 E ATOM
2146 CD2 LEU E 251 20.033 74.827 30.209 1.00 31.20 E ATOM 2147 C
LEU E 251 16.838 71.964 31.252 1.00 34.43 E ATOM 2148 O LEU E 251
16.680 70.748 31.166 1.00 31.57 E ATOM 2149 N ILE E 252 15.827
72.805 31.403 1.00 33.03 E ATOM 2150 CA ILE E 252 14.459 72.310
31.509 1.00 37.31 E ATOM 2151 CB ILE E 252 13.592 73.372 32.252
1.00 37.73 E ATOM 2152 CG2 ILE E 252 14.493 74.225 33.126 1.00
36.05 E ATOM 2153 CG1 ILE E 252 12.925 74.333 31.275 1.00 39.95 E
ATOM 2154 CD1 ILE E 252 12.218 75.477 31.937 1.00 27.77 E ATOM 2155
C ILE E 252 13.889 71.941 30.108 1.00 40.70 E ATOM 2156 O ILE E 252
14.277 72.542 29.101 1.00 36.30 E ATOM 2157 N ARG E 253 12.990
70.952 30.040 1.00 41.30 E ATOM 2158 CA ARG E 253 12.430 70.534
28.751 1.00 47.33 E ATOM 2159 CB ARG E 253 11.251 69.575 28.927
1.00 51.86 E ATOM 2160 CG ARG E 253 11.633 68.166 29.394 1.00 69.36
E ATOM 2161 CD ARG E 253 10.418 67.208 29.302 1.00 81.36 E ATOM
2162 NE ARG E 253 10.298 66.272 30.436 1.00 89.24 E ATOM 2163 CZ
ARG E 253 10.117 66.618 31.720 1.00 87.21 E ATOM 2164 NH1 ARG E 253
10.031 67.898 32.079 1.00 84.79 E ATOM 2165 NH2 ARG E 253 10.022
65.676 32.658 1.00 81.99 E ATOM 2166 C ARG E 253 11.985 71.713
27.901 1.00 48.18 E ATOM 2167 O ARG E 253 12.176 71.731 26.684 1.00
49.82 E ATOM 2168 N GLU E 254 11.386 72.698 28.553 1.00 52.53 E
ATOM 2169 CA GLU E 254 10.903 73.902 27.889 1.00 50.59 E ATOM 2170
CB GLU E 254 10.367 74.897 28.927 1.00 57.10 E ATOM 2171 CG GLU E
254 9.074 74.487 29.649 1.00 66.58 E ATOM 2172 CD GLU E 254 9.212
73.292 30.608 1.00 74.77 E ATOM 2173 OE1 GLU E 254 10.146 73.265
31.451 1.00 71.89 E ATOM 2174 OE2 GLU E 254 8.355 72.381 30.529
1.00 80.85 E ATOM 2175 C GLU E 254 12.037 74.551 27.106 1.00 49.05
E ATOM 2176 O GLU E 254 11.901 74.816 25.905 1.00 43.89 E ATOM 2177
N ASP E 255 13.151 74.796 27.801 1.00 46.39 E ATOM 2178 CA ASP E
255 14.327 75.423 27.207 1.00 47.30 E ATOM 2179 CB ASP E 255 15.284
75.923 28.300 1.00 44.84 E ATOM 2180 CG ASP E 255 14.756 77.171
29.041 1.00 50.25 E ATOM 2181 OD1 ASP E 255 13.728 77.751 28.611
1.00 47.08 E ATOM 2182 OD2 ASP E 255 15.383 77.575 30.053 1.00
38.00 E ATOM 2183 C ASP E 255 15.064 74.495 26.245 1.00 46.83 E
ATOM 2184 O ASP E 255 15.597 74.944 25.239 1.00 45.90 E ATOM 2185 N
GLN E 256 15.099 73.202 26.545 1.00 47.36 E ATOM 2186 CA GLN E 256
15.764 72.265 25.653 1.00 44.16 E ATOM 2187 CB GLN E 256 15.623
70.840 26.155 1.00 39.83 E ATOM 2188 CG GLN E 256 16.328 70.566
27.454 1.00 50.75 E ATOM 2189 CD GLN E 256 16.201 69.116 27.891
1.00 51.86 E ATOM 2190 OE1 GLN E 256 17.093 68.580 28.551 1.00
51.56 E ATOM 2191 NE2 GLN E 256 15.092 68.477 27.535 1.00 51.80 E
ATOM 2192 C GLN E 256 15.082 72.371 24.306 1.00 47.75 E ATOM 2193 O
GLN E 256 15.729 72.557 23.282 1.00 52.70 E ATOM 2194 N ILE E 257
13.760 72.266 24.315 1.00 45.22 E ATOM 2195 CA ILE E 257 12.976
72.329 23.088 1.00 39.99 E ATOM 2196 CB ILE E 257 11.483 72.029
23.401 1.00 34.69 E ATOM 2197 CG2 ILE E 257 10.621 72.336 22.202
1.00 39.38 E ATOM 2198 CG1 ILE E 257 11.326 70.557 23.790 1.00
33.50 E ATOM 2199 CD1 ILE E 257 9.907 70.125 24.072 1.00 38.84 E
ATOM 2200 C ILE E 257 13.120 73.659 22.327 1.00 38.00 E ATOM 2201 O
ILE E 257 13.139 73.697 21.102 1.00 39.30 E ATOM 2202 N ALA E 258
13.243 74.752 23.056 1.00 34.43 E ATOM 2203 CA ALA E 258 13.383
76.048 22.425 1.00 31.32 E ATOM 2204 CB ALA E 258 13.292 77.129
23.474 1.00 26.11 E ATOM 2205 C ALA E 258 14.710 76.149 21.683 1.00
36.70 E ATOM 2206 O ALA E 258 14.735 76.537 20.511 1.00 34.47 E
ATOM 2207 N LEU E 259 15.800 75.807 22.386 1.00 36.87 E ATOM 2208
CA LEU E 259 17.165 75.842 21.856 1.00 35.79 E ATOM 2209 CB LEU E
259 18.164 75.243 22.848 1.00 33.20 E ATOM 2210 CG LEU E 259 18.509
76.009 24.116 1.00 34.52 E ATOM 2211 CD1 LEU E 259 19.679 75.312
24.793 1.00 31.47 E ATOM 2212 CD2 LEU E 259 18.849 77.447 23.784
1.00 30.22 E ATOM 2213 C LEU E 259 17.288 75.065 20.572 1.00 36.97
E ATOM 2214 O LEU E 259 17.930 75.522 19.617 1.00 33.83 E ATOM 2215
N LEU E 260 16.684 73.876 20.593 1.00 34.00 E ATOM 2216 CA LEU E
260 16.663 72.933 19.480 1.00 30.57 E ATOM 2217 CB LEU E 260 15.896
71.677 19.886 1.00 31.05 E ATOM 2218 CG LEU E 260 16.639 70.378
20.192 1.00 36.94 E ATOM 2219 CD1 LEU E 260 17.999 70.651 20.816
1.00 42.80 E ATOM 2220 CD2 LEU E 260 15.778 69.534 21.121 1.00
41.52 E ATOM 2221 C LEU E 260 16.015 73.545 18.262 1.00 31.96 E
ATOM 2222 O LEU E 260 16.593 73.552 17.182 1.00 41.76 E ATOM 2223 N
LYS E 261 14.804 74.056 18.424 1.00 25.94 E ATOM 2224 CA LYS E 261
14.112 74.662 17.309 1.00 28.1.9 E ATOM 2225 CB LYS E 261 12.730
75.126 17.756 1.00 26.86 E ATOM 2226 CG LYS E 261 11.690 74.070
17.942 1.00 24.39 E ATOM 2227 CD LYS E 261 10.661 74.588 18.933
1.00 30.08 E ATOM 2228 CE LYS E 261 9.261 74.465 18.427 1.00 29.30
E ATOM 2229 NZ LYS E 261 9.188 75.240 17.165 1.00 41.92 E ATOM 2230
C LYS E 261 14.902 75.864 16.759 1.00 32.55 E ATOM 2231 O LYS E 261
15.088 76.003 15.543 1.00 38.75 E ATOM 2232 N ALA E 262 15.368
76.728 17.657 1.00 31.41 E ATOM 2233 CA ALA E 262 16.102 77.922
17.264 1.00 34.42 E ATOM 2234 CB ALA E 262 16.422 78.744 18.487
1.00 35.30 E ATOM 2235 C ALA E 262 17.376 77.655 16.474 1.00 38.56
E ATOM 2236 O ALA E 262 17.635 78.311 15.473 1.00 44.36 E ATOM 2237
N CYS E 263 18.175 76.693 16.917 1.00 37.93 E ATOM 2238 CA CYS E
263 19.418 76.392 16.236 1.00 34.78 E ATOM 2239 CB CYS E 263 20.393
75.681 17.195 1.00 40.98 E ATOM 2240 SG CYS E 263 20.184 73.848
17.433 1.00 41.61 E ATOM 2241 C CYS E 263 19.275 75.556 14.978 1.00
34.16 E ATOM 2242 O CYS E 263 20.121 75.649 14.112 1.00 41.65 E
ATOM 2243 N SER E 264 18.218 74.751 14.857 1.00 33.30 E ATOM 2244
CA SER E 264 18.059 73.861 13.694 1.00 31.64 E ATOM 2245 CB SER E
264 16.630 73.301 13.619 1.00 25.54 E ATOM 2246 OG SER E 264 15.703
74.290 13.231 1.00 44.41 E ATOM 2247 C SER E 264 18.486 74.436
12.331 1.00 29.78 E ATOM 2248 O SER E 264 19.457 73.954 11.772 1.00
27.24 E ATOM 2249 N SER E 265 17.791 75.453 11.810 1.00 32.04 E
ATOM 2250 CA SER E 265 18.136 76.071 10.521 1.00 31.46 E ATOM 2251
CB SER E 265 17.128 77.154 10.157 1.00 28.33 E ATOM 2252 OG SER E
265 16.739 77.850 11.326 1.00 45.47 E ATOM 2253 C SER E 265 19.529
76.686 10.458 1.00 32.67 E ATOM 2254 O SER E 265 20.104 76.768
9.381 1.00 40.29 E ATOM 2255 N GLU E 266 20.070 77.149 11.584 1.00
28.39 E ATOM 2256 CA GLU E 266 21.410 77.725 11.566 1.00 25.88 E
ATOM 2257 CB GLU E 266 21.654 78.598 12.796 1.00 22.84 E ATOM 2258
CG GLU E 266 20.888 79.877 12.778 1.00 25.52 E ATOM 2259 CD GLU E
266 21.005 80.647 14.070 1.00 38.74 E ATOM 2260 OE1 GLU E 266
21.291 80.020 15.109 1.00 41.08 E ATOM 2261 OE2 GLU E 266 20.787
81.876 14.062 1.00 49.52 E ATOM 2262 C GLU E 266 22.445 76.610
11.495 1.00 28.30 E ATOM 2263 O GLU E 266 23.337 76.650 10.659 1.00
35.01 E ATOM 2264 N VAL E 267 22.321 75.617 12.372 1.00 29.09 E
ATOM 2265 CA VAL E 267 23.225 74.468 12.393 1.00 31.93 E ATOM 2266
CB VAL E 267 22.868 73.542 13.554 1.00 27.95 E ATOM 2267 CG1 VAL E
267 23.643 72.276 13.464 1.00 32.35 E ATOM 2268 CG2 VAL E 267
23.193 74.211 14.829 1.00 32.98 E ATOM 2269 C VAL E 267 23.174
73.682 11.064 1.00 33.52 E ATOM 2270 O VAL E 267 24.168 73.120
10.614 1.00 37.32 E ATOM 2271 N MET E 268 22.007 73.659 10.443 1.00
30.10 E ATOM 2272 CA MET E 268 21.810 72.991 9.175 1.00 31.44 E
ATOM 2273 CB MET E 268 20.400 73.307 8.677 1.00 33.01 E ATOM 2274
CG MET E 268 19.993 72.670 7.385 1.00 40.68 E ATOM 2275 SD MET E
268 18.434 73.392 6.866 1.00 50.26 E ATOM 2276 CE MET E 268 17.453
72.084 7.257 1.00 59.46 E ATOM 2277 C MET E 268 22.860 73.455 8.158
1.00 36.00 E ATOM 2278 O MET E 268 23.431 72.634 7.435 1.00 36.45 E
ATOM 2279 N MET E 269 23.118 74.766 8.116 1.00 38.01 E ATOM 2280 CA
MET E 269 24.095 75.365 7.192 1.00 33.54 E ATOM 2281 CB MET E 269
24.065 76.891 7.318 1.00 29.18 E ATOM 2282 CG MET E 269 22.688
77.525 7.232 1.00 29.83 E ATOM 2283 SD MET E 269 21.893 77.406
5.629 1.00 36.33 E ATOM 2284 CE MET E 269 20.192 77.383 6.059 1.00
35.76 E ATOM 2285 C MET E 269 25.540 74.848 7.385 1.00 32.59 E ATOM
2286 O MET E 269 26.301 74.760 6.421 1.00 32.25 E ATOM 2287 N PHE E
270 25.923 74.528 8.623 1.00 24.35 E ATOM 2288 CA PHE E 270 27.253
73.974 8.888 1.00 28.18 E ATOM 2289 CB PHE E 270 27.519 73.884
10.394 1.00 30.27 E ATOM 2290 CG PHE E 270 27.954 75.173 11.033
1.00 37.91 E ATOM 2291 CD1 PHE E 270 28.000 75.282 12.424 1.00
34.23 E ATOM 2292 CD2 PHE E 270 28.322 76.275 10.264 1.00 41.91 E
ATOM 2293 CE1 PHE E 270 28.403 76.470 13.041 1.00 38.32 E ATOM 2294
CE2 PHE E 270 28.727 77.473 10.871 1.00 41.49 E ATOM 2295 CZ PHE E
270 28.767 77.569 12.260 1.00 41.60 E ATOM 2296 C PHE E 270 27.300
72.546 8.300 1.00 31.49 E ATOM 2297 O PHE E 270 28.315 72.099 7.746
1.00 25.21 E ATOM 2298 N ARG E 271 26.192 71.824 8.439 1.00 29.59 E
ATOM 2299 CA ARG E 271 26.113 70.474 7.921 1.00 33.01 E ATOM 2300
CB ARG E 271 24.797 69.844 8.329 1.00 29.47 E ATOM 2301 CG ARG E
271 24.907 69.091 9.623 1.00 30.97 E ATOM 2302 CD ARG E 271 23.553
66.707 10.130 1.00 28.88 E ATOM 2303 NE ARG E 271 23.637 67.946
11.371 1.00 29.81 E ATOM 2304 CZ ARG E 271 23.959 66.656 11.446
1.00 35.74 E ATOM 2305 NH1 ARG E 271 24.241 65.954 10.353 1.00
32.07 E ATOM 2306 NH2 ARG E 271 23.959 66.055 12.625 1.00 38.84 E
ATOM 2307 C ARG E 271 26.258 70.472 6.413 1.00 36.29 E ATOM 2308 O
ARG E 271 27.030 69.692 5.860 1.00 35.05 E ATOM 2309 N MET E 272
25.503 71.351 5.762 1.00 35.74 E ATOM 2310 CA MET E 272 25.549
71.495 4.321 1.00 27.95 E ATOM 2311 CB MET E 272 24.566 72.554
3.856 1.00 28.37 E ATOM 2312 CG MET E 272 24.877 73.091 2.477 1.00
28.17 E ATOM 2313 SD MET E 272 24.337 74.810 2.240 1.00 42.72 E
ATOM 2314 CE MET E 272 22.938 74.576 1.238 1.00 32.88 E ATOM 2315 C
MET E 272 26.940 71.936 3.928 1.00 26.79 E ATOM 2316 O MET E 272
27.552 71.365 3.045 1.00 23.84 E ATOM 2317 N ALA E 273 27.452
72.965 4.578 1.00 23.50 E ATOM 2318 CA ALA E 273 28.781 73.425
4.212 1.00 29.19 E ATOM 2319 CB ALA E 273 29.236 74.533 5.153 1.00
27.08 E ATOM 2320 C ALA E 273 29.807 72.287 4.185 1.00 30.27 E ATOM
2321 O ALA E 273 30.670 72.264 3.321 1.00 28.90 E ATOM 2322 N ARG E
274 29.694 71.326 5.102 1.00 35.93 E ATOM 2323 CA ARG E 274 30.662
70.230 5.177 1.00 33.33 E ATOM 2324 CB ARG E 274 30.580 69.531
6.528 1.00 33.92 E ATOM 2325 CG ARG E 274 30.624 70.457 7.705 1.00
36.71 E ATOM 2326 CD ARG E 274 30.645 69.665 8.982 1.00 39.66 E
ATOM 2327 NE ARG E 274 32.000 69.288 9.347 1.00 33.19 E ATOM 2328
CZ ARG E 274 32.359 68.076 9.750 1.00 34.09 E ATOM 2329 NH1 ARG E
274 31.473 67.080 9.841 1.00 22.87 E ATOM 2330 NH2 ARG E 274 33.616
67.867 10.090 1.00 30.93 E ATOM 2331 C ARG E 274 30.529 69.187
4.098 1.00 36.69 E ATOM 2332 O ARG E 274 31.309 68.255 4.045 1.00
44.32 E ATOM 2333 N ARG E 275 29.531 69.320 3.248 1.00 39.84 E ATOM
2334 CA ARG E 275 29.343 68.368 2.169 1.00 42.70 E ATOM 2335 CB ARG
E 275 27.948 67.776 2.250 1.00 36.63 E ATOM 2336 CG ARG E 275
27.762 67.124 3.545 1.00 42.72 E ATOM 2337 CD ARG E 275 28.563
65.885 3.542 1.00 49.94 E ATOM 2338 NE ARG E 275 27.721 64.813
3.043 1.00 65.23 E ATOM 2339 CZ ARG E 275 28.175 63.643 2.627 1.00
67.98 E ATOM 2340 NH1 ARG E 275 29.487 63.402 2.644 1.00 65.23 E
ATOM 2341 NH2 ARG E 275 27.312 62.719 2.220 1.00 66.96 E ATOM 2342
C ARG E 275 29.523 69.149 0.880 1.00 47.12 E ATOM 2343 O ARG E 275
29.007 68.775 -0.184 1.00 46.68 E ATOM 2344 N TYR E 276 30.266
70.245 0.993 1.00 44.28 E ATOM 2345 CA TYR E 276 30.499 71.090
-0.153 1.00 48.82 E ATOM 2346 CB TYR E 276 30.672 72.550 0.262 1.00
47.70 E ATOM 2347 CG TYR E 276 31.082 73.464 -0.881 1.00 49.48 E
ATOM 2348 CD1 TYR E 276 30.233 73.696 -1.966 1.00 51.80 E ATOM 2349
CE1 TYR E 276 30.626 74.537 -3.011 1.00 53.53 E ATOM 2350 CD2 TYR E
276 32.330 74.094 -0.874 1.00 51.84 E ATOM 2351 CE2 TYR E 276
32.732 74.930 -1.908 1.00 46.44 E ATOM 2352 CZ TYR E 276 31.882
75.150 -2.967 1.00 52.03 E ATOM 2353 OH TYR E 276 32.292 76.002
-3.964 1.00 54.71 E ATOM 2354 C TYR E 276 31.715 70.648 -0.904 1.00
50.90 E ATOM 2355 O TYR E 276 32.775 70.435 -0.309 1.00 53.09 E
ATOM 2356 N ASP E 277 31.547 70.510 -2.214 1.00 52.50 E ATOM 2357
CA ASP E 277 32.631 70.114 -3.086 1.00 60.62 E ATOM 2358 CB ASP E
277 32.161 69.120 -4.146 1.00 64.18 E ATOM 2359 CG ASP E 277 33.326
68.424 -4.830 1.00 66.10 E ATOM 2360 OD1 ASP E 277 34.220 69.108
-5.385 1.00 60.79 E ATOM 2361 OD2 ASP E 277 33.346 67.182 -4.799
1.00 70.36 E ATOM 2362 C ASP E 277 33.175 71.341 -3.782 1.00 60.24
E ATOM 2363 O ASP E 277 32.565 71.860 -4.714 1.00 60.67 E ATOM 2364
N ALA E 278 34.330 71.802 -3.336 1.00 59.71 E ATOM 2365 CA ALA E
278 34.922 72.979 -3.936 1.00 65.16 E ATOM 2366 CB ALA E 278 36.284
73.242 -3.315 1.00 63.99 E ATOM 2367 C ALA E 278 35.041 72.850
-5.458 1.00 68.11 E ATOM 2368 O ALA E 278 34.638 73.744 -6.198 1.00
70.52 E ATOM 2369 N GLU E 279 35.572 71.729 -5.927 1.00 71.62 E
ATOM 2370 CA GLU E 279 35.759 71.526 -7.362 1.00 74.80 E ATOM 2371
CB GLU E 279 36.386 70.151 -7.592 1.00 83.39 E ATOM 2372 CG GLU E
279 36.945 69.934 -8.991 1.00 98.26 E ATOM 2373 CD GLU E 279 37.749
68.638 -9.106 1.00 104.83 E ATOM 2374 OE1 GLU E 279 37.181 67.553
-8.829 1.00 107.81 E ATOM 2375 OE2 GLU E 279 38.948 68.709 -9.473
1.00 103.41 E ATOM 2376 C GLU E 279 34.487 71.679 -8.213 1.00 68.90
E ATOM 2377 O GLU E 279 34.387 72.584 -9.040 1.00 68.62 E ATOM 2378
N THR E 280 33.525 70.790 -7.995 1.00 62.18 E ATOM 2379 CA THR E
280 32.257 70.776 -8.719 1.00 55.38 E ATOM 2380 CB THR E 280 31.582
69.399 -8.584 1.00 53.11 E ATOM 2381 OG1 THR E 280 30.881 69.347
-7.337 1.00 59.74 E ATOM 2382 CG2 THR E 280 32.607 68.286 -8.571
1.00 50.32 E ATOM 2383 C THR E 280 31.234 71.812 -8.220 1.00 57.07
E ATOM 2384 O THR E 280 30.085 71.817 -8.686 1.00 55.58 E ATOM 2385
N ASP E 281 31.643 72.671 -7.283 1.00 55.91 E ATOM 2386 CA ASP E
281 30.758 73.678 -6.680 1.00 52.78 E ATOM 2387 CB ASP E 281 30.663
74.932 -7.568 1.00 51.99 E ATOM 2388 CG ASP E 281 29.900 76.093
-6.892 1.00 57.39 E ATOM 2389 OD1 ASP E 281 30.274 76.520 -5.776
1.00 54.28 E ATOM 2390 OD2 ASP E 281 28.924 76.595 -7.490 1.00
60.91 E ATOM 2391 C ASP E 281 29.365 73.081 -6.423 1.00 52.37 E
ATOM 2392 O ASP E 281 28.347 73.586 -6.913 1.00 48.32 E ATOM 2393 N
SER E 282 29.342 71.998 -5.643 1.00 53.44 E ATOM 2394 CA SER E 282
28.105 71.294 -5.303 1.00 52.09 E ATOM 2395 CB SER E 282 27.960
70.070 -6.200 1.00 49.84 E ATOM 2396 OG SER E 282 28.868 69.068
-5.794 1.00 52.87 E ATOM 2397 C SER E 282 28.031 70.833 -3.832 1.00
50.47 E ATOM 2398 O SER E 282 28.975 70.985 -3.062 1.00 50.07 E
ATOM 2399 N ILE E 283 26.889 70.276 -3.452 1.00 46.03 E ATOM 2400
CA ILE E 283 26.705 69.760 -2.109 1.00 45.77 E ATOM 2401 CB ILE E
283 25.578 70.470 -1.370 1.00 44.28 E ATOM 2402 CG2 ILE E 283
25.395 69.843 0.008 1.00 38.20 E ATOM 2403 CG1 ILE E 283 25.905
71.954 -1.258 1.00 44.46 E ATOM 2404 CD1 ILE E 283 24.702 72.840
-1.423 1.00 38.28 E ATOM 2405 C ILE E 283 26.321 68.300 -2.291 1.00
51.61 E ATOM 2406 O ILE E 283 25.237 67.987 -2.785 1.00 56.45 E
ATOM 2407 N LEU E 284 27.218 67.408 -1.891 1.00 48.95 E ATOM 2408
CA LEU E 284 26.998 65.984 -2.029 1.00 42.78 E ATOM 2409 CB LEU E
284 28.317 65.239 -1.838 1.00 46.07 E ATOM 2410 CG LEU E 284 28.257
63.712 -1.744 1.00 48.34 E ATOM 2411 CD1 LEU E 284 27.765 63.121
-3.055 1.00 43.11 E ATOM 2412 CD2 LEU E 284 29.633 63.191 -1.397
1.00 44.44 E ATOM 2413 C LEU E 284 25.997 65.469 -1.032 1.00 43.09
E ATOM 2414 O LEU E 284 26.358 65.177 0.103 1.00 48.13 E ATOM 2415
N PHE E 285 24.744 65.351 -1.452 1.00 39.45 E ATOM 2416 CA PHE E
285 23.699 64.829 -0.575 1.00 39.78 E ATOM 2417 CB PHE E 285 22.365
64.722 -1.329 1.00 37.53 E ATOM 2418 CG PHE E 285 21.562 66.008
-1.379 1.00 36.81 E ATOM 2419 CD1 PHE E 285 22.191 67.260 -1.363
1.00 33.71 E ATOM 2420 CD2 PHE E 285 20.163 65.960 -1.500 1.00
34.34 E ATOM 2421 CE1 PHE E 285 21.438 68.442 -1.472 1.00 28.76 E
ATOM 2422 CE2 PHE E 285 19.395 67.139 -1.613 1.00 29.05 E ATOM 2423
CZ PHE E 285 20.038 68.380 -1.599 1.00 25.56 E ATOM 2424 C PHE E
285 24.078 63.439 -0.036 1.00 46.86 E ATOM 2425 O PHE E 285 25.044
62.813 -0.488 1.00 47.48 E ATOM 2426 N ALA E 286 23.296 62.956
0.926 1.00 53.92 E ATOM 2427 CA ALA E 286 23.515 61.648 1.547 1.00
58.44 E ATOM 2428 CB ALA E 286 22.754 61.559 2.885 1.00 61.45 E
ATOM 2429 C ALA E 286 23.084 60.511 0.620 1.00 56.92 E ATOM 2430 O
ALA E 286 23.152 59.340 0.994 1.00 60.75 E ATOM 2431 N THR E 287
22.618 60.870 -0.575 1.00 56.10 E ATOM 2432 CA THR E 287 22.213
59.893 -1.584 1.00 54.00 E ATOM 2433 CB THR E 287 20.861 60.215
-2.240 1.00 48.15 E ATOM 2434 OG1 THR E 287 20.899 61.526 -2.832
1.00 44.13 E ATOM 2435 CG2 THR E 287 19.749 60.094 -1.234 1.00
40.34 E ATOM 2436 C THR E 287 23.260 59.940 -2.683 1.00 58.66 E
ATOM 2437 O THR E 287 22.983 59.660 -3.841 1.00 62.98 E ATOM 2438 N
ASN E 288 24.469 60.322 -2.315 1.00 59.74 E ATOM 2439 CA ASN E 288
25.547 60.392 -3.276 1.00 61.45 E ATOM 2440 CB ASN E 288 26.004
58.990 -3.609 1.00 55.68 E ATOM 2441 CG ASN E 288 27.445 58.799
-3.297 1.00 58.87 E ATOM 2442 OD1 ASN E 288 28.305 59.406 -3.936
1.00 57.06 E ATOM 2443 ND2 ASN E 288 27.734 57.986 -2.287 1.00
58.96 E ATOM 2444 C ASN E 288 25.253 61.169 -4.559 1.00 64.23 E
ATOM 2445 O ASN E 288 25.977 61.057 -5.548 1.00 62.43 E ATOM 2446 N
GLN E 289 24.187 61.958 -4.533 1.00 65.98 E ATOM 2447 CA GLN E 289
23.807 62.783 -5.669 1.00 65.31 E ATOM 2448 CB GLN E 289 22.279
62.911 -5.729 1.00 69.73 E ATOM 2449 CG GLN E 289 21.509 61.909
-6.583 1.00 67.32 E ATOM 2450 CD GLN E 289 19.988 62.139 -6.498
1.00 75.69 E ATOM 2451 OE1 GLN E 289 19.267 61.956 -7.486 1.00
73.62 E ATOM 2452 NE2 GLN E 289 19.500 62.536 -5.307 1.00 69.96 E
ATOM 2453 C GLN E 289 24.418 64.188 -5.482 1.00 62.08 E ATOM 2454 O
GLN E 289 24.241 64.817 -4.435 1.00 64.89 E ATOM 2455 N PRO E 290
25.190 64.673 -6.463 1.00 55.91 E ATOM 2456 CD PRO E 290 26.100
63.884 -7.308 1.00 54.16 E ATOM 2457 CA PRO E 290 25.738 66.021
-6.256 1.00 54.20 E ATOM 2458 CB PRO E 290 26.983 66.024 -7.133
1.00 46.46 E ATOM 2459 CG PRO E 290 27.414 64.593 -7.085 1.00 52.27
E ATOM 2460 C PRO E 290 24.724 67.087 -6.684 1.00 51.49 E ATOM 2461
O PRO E 290 24.237 67.068 -7.814 1.00 55.18 E ATOM 2462 N TYR E 291
24.386 68.003 -5.782 1.00 47.44 E ATOM 2463 CA TYR E 291 23.434
69.053 -6.116 1.00 46.43 E ATOM 2464 CB TYR E 291 22.458 69.290
-4.954 1.00 42.30 E ATOM 2465 CG TYR E 291 21.343 68.263 -4.929
1.00 43.04 E ATOM 2466 CD1 TYR E 291 21.631 66.892 -4.802 1.00
37.33 E ATOM 2467 CE1 TYR E 291 20.609 65.926 -4.833 1.00 33.09 E
ATOM 2468 CD2 TYR E 291 20.000 68.644 -5.083 1.00 37.03 E ATOM 2469
CE2 TYR E 291 18.971 67.681 -5.110 1.00 33.82 E ATOM 2470 CZ TYR E
291 19.287 66.327 -4.986 1.00 39.67 E ATOM 2471 OH TYR E 291 18.299
65.364 -5.005 1.00 48.43 E ATOM 2472 C TYR E 291 24.173 70.329
-6.468 1.00 48.61 E ATOM 2473 O TYR E 291 25.176 70.660 -5.837 1.00
51.77 E ATOM 2474 N THR E 292 23.686 71.031 -7.489 1.00 48.55 E
ATOM 2475 CA THR E 292 24.291 72.282 -7.952 1.00 49.68 E ATOM 2476
CB THR E 292 24.862 72.103 -9.323 1.00 53.56 E ATOM 2477 OG1 THR E
292 23.830 71.572 -10.167 1.00 57.88 E ATOM 2478 CG2 THR E 292
26.063 71.156 -9.293 1.00 45.92 E ATOM 2479 C THR E 292 23.249
73.395 -8.054 1.00 52.34 E ATOM 2480 O THR E 292 22.073 73.203
-7.705 1.00 53.46 E ATOM 2481 N ARG E 293 23.670 74.561 -8.534 1.00
50.43 E ATOM 2482 CA ARG E 293 22.726 75.667 -8.673 1.00 56.45 E
ATOM 2483 CB ARG E 293 23.365 76.840 -9.426 1.00 60.07 E ATOM 2484
CG ARG E 293 22.452 78.055 -9.641 1.00 65.01 E ATOM 2485 CD ARG E
293 23.089 79.128 -10.557 1.00 70.96 E ATOM 2486 NE ARG E 293
24.363 79.662 -10.053 1.00 79.55 E ATOM 2487 CZ ARG E 293 25.568
79.135 -10.291 1.00 83.43 E ATOM 2488 NH1 ARG E 293 25.687 78.048
-11.038 1.00 92.10 E ATOM 2489 NH2 ARG E 293 26.663 79.689 -9.779
1.00 83.65 E ATOM 2490 C ARG E 293 21.536 75.142 -9.460 1.00 59.86
E ATOM 2491 O ARG E 293 20.395 75.540 -9.225 1.00 58.30 E ATOM 2492
N GLU E 294 21.808 74.231 -10.391 1.00 65.91 E ATOM 2493 CA GLU E
294 20.741 73.671 -11.205 1.00 67.66 E ATOM 2494 CB GLU E 294
21.299 72.777 -12.307 1.00 73.63 E ATOM 2495 CG GLU E 294 20.255
72.425 -13.369 1.00 85.83 E ATOM 2496 CD GLU E 294 20.698 71.291
-14.290 1.00 93.99 E ATOM 2497 OE1 GLU E 294 21.813 71.383 -14.859
1.00 90.76 E ATOM 2498 OE2 GLU E 294 19.922 70.313 -14.451 1.00
96.20 E ATOM 2499 C GLU E 294 19.819 72.865 -10.317 1.00 66.48 E
ATOM 2500 O GLU E 294 18.653 73.228 -10.138 1.00 65.85 E
ATOM 2501 N SER E 295 20.357 71.783 -9.752 1.00 63.31 E ATOM 2502
CA SER E 295 19.602 70.891 -8.870 1.00 56.42 E ATOM 2503 CB SER E
295 20.549 70.198 -7.886 1.00 53.80 E ATOM 2504 OG SER E 295 21.735
69.754 -8.527 1.00 56.54 E ATOM 2505 C SER E 295 18.544 71.661
-8.093 1.00 52.70 E ATOM 2506 O SER E 295 17.344 71.397 -8.227 1.00
44.29 E ATOM 2507 N TYR E 296 19.002 72.630 -7.298 1.00 54.21 E
ATOM 2508 CA TYR E 296 18.099 73.442 -6.476 1.00 57.94 E ATOM 2509
CB TYR E 296 18.857 74.356 -5.504 1.00 53.51 E ATOM 2510 CG TYR E
296 19.457 73.665 -4.308 1.00 51.18 E ATOM 2511 CD1 TYR E 296
20.667 72.962 -4.415 1.00 49.06 E ATOM 2512 CE1 TYR E 296 21.254
72.369 -3.310 1.00 45.23 E ATOM 2513 CD2 TYR E 296 18.844 73.745
-3.063 1.00 47.02 E ATOM 2514 CE2 TYR E 296 19.425 73.156 -1.948
1.00 49.14 E ATOM 2515 CZ TYR E 296 20.631 72.474 -2.079 1.00 47.12
E ATOM 2516 OH TYR E 296 21.234 71.934 -0.968 1.00 47.53 E ATOM
2517 C TYR E 296 17.170 74.315 -7.282 1.00 59.73 E ATOM 2518 O TYR
E 296 16.025 74.522 -6.876 1.00 60.23 E ATOM 2519 N THR E 297
17.660 74.854 -8.401 1.00 59.81 E ATOM 2520 CA THR E 297 16.821
75.712 -9.223 1.00 57.01 E ATOM 2521 CB THR E 297 17.584 76.369
-10.373 1.00 57.33 E ATOM 2522 OG1 THR E 297 18.672 77.147 -9.855
1.00 60.03 E ATOM 2523 CG2 THR E 297 16.653 77.298 -11.131 1.00
52.97 E ATOM 2524 C THR E 297 15.707 74.870 -9.798 1.00 55.04 E
ATOM 2525 O THR E 297 14.567 75.316 -9.848 1.00 52.58 E ATOM 2526 N
VAL E 298 16.043 73.643 -10.199 1.00 51.86 E ATOM 2527 CA VAL E 298
15.073 72.703 -10.763 1.00 51.10 E ATOM 2528 CB VAL E 298 15.741
71.362 -11.201 1.00 53.10 E ATOM 2529 CG1 VAL E 298 14.678 70.404
-11.677 1.00 43.54 E ATOM 2530 CG2 VAL E 298 16.770 71.589 -12.315
1.00 52.63 E ATOM 2531 C VAL E 298 13.975 72.362 -9.759 1.00 52.09
E ATOM 2532 O VAL E 298 12.823 72.199 -10.124 1.00 57.65 E ATOM
2533 N ALA E 299 14.334 72.229 -8.493 1.00 55.66 E ATOM 2534 CA ALA
E 299 13.346 71.906 -7.473 1.00 57.89 E ATOM 2535 CB ALA E 299
14.035 71.374 -6.239 1.00 65.04 E ATOM 2536 C ALA E 299 12.532
73.127 -7.108 1.00 57.74 E ATOM 2537 O ALA E 299 11.611 73.049
-6.300 1.00 60.91 E ATOM 2538 N GLY E 300 12.893 74.258 -7.698 1.00
53.99 E ATOM 2539 CA GLY E 300 12.196 75.496 -7.413 1.00 56.58 E
ATOM 2540 C GLY E 300 12.820 76.312 -6.293 1.00 54.28 E ATOM 2541 O
GLY E 300 12.166 77.180 -5.715 1.00 53.41 E ATOM 2542 N MET E 301
14.087 76.048 -5.991 1.00 53.48 E ATOM 2543 CA MET E 301 14.782
76.762 -4.926 1.00 57.30 E ATOM 2544 CB MET E 301 15.327 75.763
-3.901 1.00 59.17 E ATOM 2545 CG MET E 301 14.397 74.603 -3.580
1.00 61.86 E ATOM 2546 SD MET E 301 13.307 74.869 -2.181 1.00 57.45
E ATOM 2547 CE MET E 301 14.421 74.386 -0.828 1.00 68.06 E ATOM
2548 C MET E 301 15.947 77.587 -5.502 1.00 61.19 E ATOM 2549 O MET
E 301 16.963 77.816 -4.813 1.00 61.18 E ATOM 2550 N GLY E 302
15.791 78.024 -6.757 1.00 56.02 E ATOM 2551 CA GLY E 302 16.819
78.805 -7.427 1.00 48.70 E ATOM 2552 C GLY E 302 17.229 80.094
-6.728 1.00 48.32 E ATOM 2553 O GLY E 302 18.397 80.503 -6.815 1.00
48.00 E ATOM 2554 N ASP E 303 16.273 80.734 -6.048 1.00 44.95 E
ATOM 2555 CA ASP E 303 16.491 81.981 -5.314 1.00 47.27 E ATOM 2556
CB ASP E 303 15.258 82.335 -4.511 1.00 55.66 E ATOM 2557 CG ASP E
303 14.077 82.688 -5.369 1.00 72.49 E ATOM 2558 OD1 ASP E 303
12.947 82.695 -4.811 1.00 84.45 E ATOM 2559 OD2 ASP E 303 14.269
82.970 -6.577 1.00 74.53 E ATOM 2560 C ASP E 303 17.634 81.883
-4.320 1.00 53.13 E ATOM 2561 O ASP E 303 18.690 82.501 -4.479 1.00
58.14 E ATOM 2562 N THR E 304 17.396 81.104 -3.271 1.00 55.42 E
ATOM 2563 CA THR E 304 18.365 80.915 -2.208 1.00 55.06 E ATOM 2564
CB THR E 304 17.707 80.242 -0.980 1.00 56.60 E ATOM 2565 OG1 THR E
304 17.117 78.989 -1.360 1.00 62.37 E ATOM 2566 CG2 THR E 304
16.648 81.150 -0.407 1.00 54.69 E ATOM 2567 C THR E 304 19.620
80.132 -2.574 1.00 52.08 E ATOM 2568 O THR E 304 20.683 80.376
-2.000 1.00 48.46 E ATOM 2569 N VAL E 305 19.516 79.213 -3.529 1.00
51.67 E ATOM 2570 CA VAL E 305 20.672 78.397 -3.898 1.00 50.53 E
ATOM 2571 CB VAL E 305 20.544 77.751 -5.275 1.00 54.93 E ATOM 2572
CG1 VAL E 305 20.739 78.814 -6.381 1.00 51.08 E ATOM 2573 CG2 VAL E
305 21.594 76.643 -5.401 1.00 47.75 E ATOM 2574 C VAL E 305 22.000
79.113 -3.918 1.00 46.99 E ATOM 2575 O VAL E 305 22.971 78.599
-3.379 1.00 41.23 E ATOM 2576 N GLU E 306 22.065 80.292 -4.530 1.00
46.23 E ATOM 2577 CA GLU E 306 23.350 80.971 -4.595 1.00 46.84 E
ATOM 2578 CB GLU E 306 23.287 82.185 -5.513 1.00 51.46 E ATOM 2579
CG GLU E 306 24.683 82.744 -5.884 1.00 61.37 E ATOM 2580 CD GLU E
306 25.688 81.672 -6.364 1.00 65.97 E ATOM 2581 OE1 GLU E 306
25.336 80.876 -7.266 1.00 60.45 E ATOM 2582 OE2 GLU E 306 26.838
81.639 -5.851 1.00 61.39 E ATOM 2583 C GLU E 306 23.901 81.363
-3.238 1.00 44.73 E ATOM 2584 O GLU E 306 25.074 81.124 -2.965 1.00
40.70 E ATOM 2585 N ASP E 307 23.059 81.953 -2.391 1.00 44.04 E
ATOM 2586 CA ASP E 307 23.477 82.340 -1.045 1.00 41.14 E ATOM 2587
CB ASP E 307 22.305 82.889 -0.246 1.00 52.01 E ATOM 2588 CG ASP E
307 21.757 84.161 -0.827 1.00 60.75 E ATOM 2589 OD1 ASP E 307
20.814 84.069 -1.652 1.00 62.82 E ATOM 2590 OD2 ASP E 307 22.283
85.244 -0.464 1.00 64.89 E ATOM 2591 C ASP E 307 24.043 81.145
-0.297 1.00 36.51 E ATOM 2592 O ASP E 307 25.036 81.263 0.414 1.00
33.26 E ATOM 2593 N LEU E 308 23.386 80.001 -0.445 1.00 32.45 E
ATOM 2594 CA LEU E 308 23.827 78.770 0.185 1.00 34.12 E ATOM 2595
CB LEU E 308 22.864 77.639 -0.142 1.00 27.15 E ATOM 2596 CG LEU E
308 21.432 77.848 0.321 1.00 28.39 E ATOM 2597 CD1 LEU E 308 20.546
76.727 -0.217 1.00 28.97 E ATOM 2598 CD2 LEU E 308 21.406 77.907
1.828 1.00 19.33 E ATOM 2599 C LEU E 308 25.211 78.400 -0.328 1.00
39.79 E ATOM 2600 O LEU E 308 26.143 78.191 0.452 1.00 45.71 E ATOM
2601 N LEU E 309 25.346 78.311 -1.644 1.00 38.81 E ATOM 2602 CA LEU
E 309 26.628 77.955 -2.226 1.00 42.34 E ATOM 2603 CB LEU E 309
26.543 77.950 -3.763 1.00 38.54 E ATOM 2604 CG LEU E 309 26.325
76.618 -4.504 1.00 33.64 E ATOM 2605 CD1 LEU E 309 26.794 75.427
-3.659 1.00 32.06 E ATOM 2606 CD2 LEU E 309 24.858 76.473 -4.851
1.00 27.68 E ATOM 2607 C LEU E 309 27.749 78.896 -1.767 1.00 43.90
E ATOM 2608 O LEU E 309 28.866 78.456 -1.467 1.00 42.98 E ATOM 2609
N ARG E 310 27.440 80.187 -1.711 1.00 42.19 E ATOM 2610 CA ARG E
310 28.412 81.183 -1.307 1.00 40.66 E ATOM 2611 CB ARG E 310 27.777
82.570 -1.380 1.00 40.07 E ATOM 2612 CG ARG E 310 28.591 83.705
-0.806 1.00 44.89 E ATOM 2613 CD ARG E 310 27.831 85.033 -0.902
1.00 58.85 E ATOM 2614 NE ARG E 310 27.653 85.436 -2.295 1.00 69.19
E ATOM 2615 CZ ARG E 310 26.649 85.051 -3.080 1.00 75.43 E ATOM
2616 NH1 ARG E 310 25.700 84.251 -2.610 1.00 81.52 E ATOM 2617 NH2
ARG E 310 26.609 85.445 -4.350 1.00 74.42 E ATOM 2618 C ARG E 310
28.919 80.888 0.095 1.00 42.89 E ATOM 2619 O ARG E 310 30.127
80.940 0.354 1.00 42.22 E ATOM 2620 N PHE E 311 28.002 80.558 1.000
1.00 43.01 E ATOM 2621 CA PHE E 311 28.385 80.257 2.373 1.00 40.21
E ATOM 2622 CB PHE E 311 27.172 79.873 3.207 1.00 36.06 E ATOM 2623
CG PHE E 311 27.501 79.624 4.641 1.00 36.68 E ATOM 2624 CD1 PHE E
311 27.874 80.672 5.469 1.00 36.95 E ATOM 2625 CD2 PHE E 311 27.498
78.337 5.152 1.00 35.64 E ATOM 2626 CE1 PHE E 311 28.232 80.435
6.780 1.00 41.04 E ATOM 2627 CE2 PHE E 311 27.854 78.100 6.457 1.00
37.74 E ATOM 2628 CZ PHE E 311 28.226 79.152 7.273 1.00 38.51 E
ATOM 2629 C PHE E 311 29.369 79.103 2.392 1.00 46.01 E ATOM 2630 O
PHE E 311 30.416 79.169 3.051 1.00 49.74 E ATOM 2631 N CYS E 312
29.004 78.040 1.674 1.00 42.54 E ATOM 2632 CA CYS E 312 29.825
76.845 1.564 1.00 37.36 E ATOM 2633 CB CYS E 312 29.220 75.874
0.556 1.00 38.37 E ATOM 2634 SG CYS E 312 27.662 75.132 1.048 1.00
39.43 E ATOM 2635 C CYS E 312 31.213 77.229 1.106 1.00 40.16 E ATOM
2636 O CYS E 312 32.201 76.732 1.636 1.00 46.13 E ATOM 2637 N ARG E
313 31.285 78.112 0.112 1.00 44.10 E ATOM 2638 CA ARG E 313 32.567
78.561 -0.423 1.00 42.60 E ATOM 2639 CB ARG E 313 32.372 79.439
-1.652 1.00 42.81 E ATOM 2640 CG ARG E 313 32.170 78.695 -2.958
1.00 47.52 E ATOM 2641 CD ARG E 313 32.289 79.646 -4.137 1.00 42.88
E ATOM 2642 NE ARG E 313 31.119 80.498 -4.330 1.00 40.06 E ATOM
2643 CZ ARG E 313 29.954 80.041 -4.775 1.00 50.01 E ATOM 2644 NH1
ARG E 313 29.823 78.742 -5.055 1.00 45.76 E ATOM 2645 NH2 ARG E 313
28.938 80.879 -4.977 1.00 43.24 E ATOM 2646 C ARG E 313 33.361
79.340 0.594 1.00 44.06 E ATOM 2647 O ARG E 313 34.555 79.105 0.743
1.00 40.75 E ATOM 2648 N HIS E 314 32.707 80.279 1.281 1.00 45.97 E
ATOM 2649 CA HIS E 314 33.386 81.087 2.285 1.00 47.88 E ATOM 2650
CB HIS E 314 32.449 82.171 2.838 1.00 58.09 E ATOM 2651 CG HIS E
314 33.004 82.914 4.021 1.00 69.52 E ATOM 2652 CD2 HIS E 314 32.496
83.130 5.258 1.00 72.88 E ATOM 2653 ND1 HIS E 314 34.240 83.533
4.006 1.00 78.21 E ATOM 2654 CE1 HIS E 314 34.467 84.093 5.180 1.00
75.35 E ATOM 2655 NE2 HIS E 314 33.425 83.864 5.960 1.00 76.13 E
ATOM 2656 C HIS E 314 33.917 80.210 3.415 1.00 44.87 E ATOM 2657 O
HIS E 314 35.002 80.461 3.949 1.00 42.96 E ATOM 2658 N MET E 315
33.171 79.169 3.769 1.00 41.07 E ATOM 2659 CA MET E 315 33.608
78.274 4.843 1.00 46.97 E ATOM 2660 CB MET E 315 32.445 77.374
5.283 1.00 45.05 E ATOM 2661 CG MET E 315 31.303 78.114 5.987 1.00
44.79 E ATOM 2662 SD MET E 315 31.793 78.853 7.570 1.00 49.50 E
ATOM 2663 CE MET E 315 32.000 77.438 8.591 1.00 41.10 E ATOM 2664 C
MET E 315 34.821 77.428 4.417 1.00 48.06 E ATOM 2665 O MET E 315
35.790 77.237 5.164 1.00 49.75 E ATOM 2666 N CYS E 316 34.755
76.923 3.199 1.00 50.73 E ATOM 2667 CA CYS E 316 35.832 76.124
2.636 1.00 47.71 E ATOM 2668 CB CYS E 316 35.422 75.668 1.244 1.00
49.10 E ATOM 2669 SG CYS E 316 36.479 74.437 0.585 1.00 57.98 E
ATOM 2670 C CYS E 316 37.110 76.962 2.556 1.00 44.65 E ATOM 2671 O
CYS E 316 38.211 76.458 2.708 1.00 39.70 E ATOM 2672 N ALA E 317
36.935 78.259 2.315 1.00 47.36 E ATOM 2673 CA ALA E 317 38.031
79.214 2.201 1.00 39.33 E ATOM 2674 CB ALA E 317 37.510 80.492
1.694 1.00 31.61 E ATOM 2675 C ALA E 317 38.727 79.445 3.520 1.00
39.45 E ATOM 2676 O ALA E 317 39.917 79.736 3.542 1.00 40.04 E ATOM
2677 N MET E 318 37.973 79.326 4.613 1.00 40.99 E ATOM 2678 CA MET
E 318 38.506 79.499 5.964 1.00 38.70 E ATOM 2679 CB MET E 318
37.397 79.880 6.924 1.00 35.12 E ATOM 2680 CG MET E 318 36.922
81.282 6.742 1.00 42.22 E ATOM 2681 SD MET E 318 36.025 81.798
8.198 1.00 49.96 E ATOM 2682 CE MET E 318 34.367 81.205 7.716 1.00
55.22 E ATOM 2683 C MET E 318 39.195 78.252 6.495 1.00 38.83 E ATOM
2684 O MET E 318 39.875 78.295 7.525 1.00 38.43 E ATOM 2685 N LYS E
319 39.001 77.139 5.798 1.00 39.64 E ATOM 2686 CA LYS E 319 39.611
75.891 6.201 1.00 39.52 E ATOM 2687 CB LYS E 319 41.122 76.011
6.052 1.00 36.73 E ATOM 2688 CG LYS E 319 41.584 76.488 4.685 1.00
38.39 E ATOM 2689 CD LYS E 319 43.119 76.570 4.618 1.00 44.38 E
ATOM 2690 CE LYS E 319 43.651 77.125 3.265 1.00 53.58 E ATOM 2691
NZ LYS E 319 43.620 76.171 2.090 1.00 49.79 E ATOM 2692 C LYS E 319
39.231 75.592 7.657 1.00 42.19 E ATOM 2693 O LYS E 319 40.092
75.412 8.519 1.00 41.47 E ATOM 2694 N VAL E 320 37.929 75.558 7.921
1.00 42.30 E ATOM 2695 CA VAL E 320 37.404 75.293 9.257 1.00 39.90
E ATOM 2696 CB VAL E 320 35.907 75.750 9.331 1.00 39.08 E ATOM 2697
CG1 VAL E 320 35.325 75.516 10.715 1.00 28.09 E ATOM 2698 CG2 VAL E
320 35.805 77.219 8.948 1.00 37.65 E ATOM 2699 C VAL E 320 37.517
73.792 9.486 1.00 38.14 E ATOM 2700 O VAL E 320 36.966 73.018 8.720
1.00 40.61 E ATOM 2701 N ASP E 321 38.228 73.357 10.520 1.00 39.20
E ATOM 2702 CA ASP E 321 38.349 71.916 10.739 1.00 38.88 E ATOM
2703 CB ASP E 321 39.713 71.574 11.312 1.00 33.31 E ATOM 2704 CG
ASP E 321 39.871 72.017 12.743 1.00 41.47 E ATOM 2705 OD1 ASP E 321
40.985 72.438 13.105 1.00 41.07 E ATOM 2706 OD2 ASP E 321 38.897
71.929 13.515 1.00 48.12 E ATOM 2707 C ASP E 321 37.262 71.351
11.641 1.00 43.03 E ATOM 2708 O ASP E 321 36.427 72.083 12.166 1.00
50.90 E ATOM 2709 N ASN E 322 37.288 70.043 11.841 1.00 40.47 E
ATOM 2710 CA ASN E 322 36.284 69.382 12.656 1.00 39.16 E ATOM 2711
CB ASN E 322 36.584 67.899 12.740 1.00 42.19 E ATOM 2712 CG ASN E
322 36.518 67.246 11.399 1.00 37.40 E ATOM 2713 OD1 ASN E 322
36.073 67.861 10.434 1.00 39.07 E ATOM 2714 ND2 ASN E 322 36.958
66.007 11.318 1.00 34.55 E ATOM 2715 C ASN E 322 36.044 69.913
14.038 1.00 42.55 E ATOM 2716 O ASN E 322 34.891 70.145 14.410 1.00
45.98 E ATOM 2717 N ALA E 323 37.116 70.090 14.804 1.00 41.77 E
ATOM 2718 CA ALA E 323 36.995 70.611 16.165 1.00 39.19 E ATOM 2719
CB ALA E 323 38.353 70.739 16.788 1.00 37.72 E ATOM 2720 C ALA E
323 36.312 71.975 16.150 1.00 41.04 E ATOM 2721 O ALA E 323 35.353
72.233 16.904 1.00 34.72 E ATOM 2722 N GLU E 324 36.811 72.847
15.278 1.00 36.39 E ATOM 2723 CA GLU E 324 36.262 74.186 15.158
1.00 37.10 E ATOM 2724 CB GLU E 324 37.103 74.998 14.173 1.00 42.36
E ATOM 2725 CG GLU E 324 38.579 74.983 14.512 1.00 43.03 E ATOM
2726 CD GLU E 324 39.385 75.848 13.603 1.00 44.29 E ATOM 2727 OE1
GLU E 324 39.213 75.716 12.376 1.00 45.28 E ATOM 2728 OE2 GLU E 324
40.195 76.651 14.116 1.00 49.48 E ATOM 2729 C GLU E 324 34.812
74.089 14.703 1.00 37.19 E ATOM 2730 O GLU E 324 33.932 74.790
15.219 1.00 36.60 E ATOM 2731 N TYR E 325 34.555 73.212 13.741 1.00
35.43 E ATOM 2732 CA TYR E 325 33.195 73.050 13.280 1.00 33.83 E
ATOM 2733 CB TYR E 325 33.112 72.009 12.177 1.00 28.46 E ATOM 2734
CG TYR E 325 32.815 72.613 10.823 1.00 32.50 E ATOM 2735 CD1 TYR E
325 31.586 73.223 10.553 1.00 30.26 E ATOM 2736 CE1 TYR E 325
31.326 73.781 9.291 1.00 33.88 E ATOM 2737 CD2 TYR E 325 33.766
72.577 9.811 1.00 29.44 E ATOM 2738 CE2 TYR E 325 33.517 73.127
8.570 1.00 29.18 E ATOM 2739 CZ TYR E 325 32.309 73.728 8.301 1.00
31.70 E ATOM 2740 OH TYR E 325 32.119 74.268 7.039 1.00 33.30 E
ATOM 2741 C TYR E 325 32.337 72.631 14.454 1.00 35.84 E ATOM 2742 O
TYR E 325 31.389 73.324 14.802 1.00 38.35 E ATOM 2743 N ALA E 326
32.682 71.520 15.093 1.00 31.20 E ATOM 2744 CA ALA E 326 31.881
71.052 16.207 1.00 30.02 E ATOM 2745 CB ALA E 326 32.488 69.798
16.786 1.00 23.95 E ATOM 2746 C ALA E 326 31.696 72.116 17.291 1.00
33.08 E ATOM 2747 O ALA E 326 30.563 72.490 17.625 1.00 32.67 E
ATOM 2748 N LEU E 327 32.795 72.626 17.834 1.00 27.98 E ATOM 2749
CA LEU E 327 32.686 73.626 18.894 1.00 30.89 E ATOM 2750 CB LEU E
327 34.055 74.198 19.234 1.00 26.93 E ATOM 2751 CG LEU E 327 34.937
73.266 20.036 1.00 24.04 E
ATOM 2752 CD1 LEU E 327 36.389 73.677 19.914 1.00 15.58 E ATOM 2753
CD2 LEU E 327 34.428 73.266 21.464 1.00 20.01 E ATOM 2754 C LEU E
327 31.776 74.757 18.481 1.00 35.13 E ATOM 2755 O LEU E 327 30.962
75.242 19.267 1.00 39.12 E ATOM 2756 N LEU E 328 31.923 75.170
17.231 1.00 33.20 E ATOM 2757 CA LEU E 328 31.139 76.265 16.709
1.00 35.88 E ATOM 2758 CB LEU E 328 31.634 76.617 15.298 1.00 36.15
E ATOM 2759 CG LEU E 328 31.793 78.091 14.915 1.00 28.33 E ATOM
2760 CD1 LEU E 328 32.335 78.935 16.063 1.00 34.96 E ATOM 2761 CD2
LEU E 328 32.724 78.144 13.779 1.00 21.29 E ATOM 2762 C LEU E 328
29.654 75.918 16.718 1.00 35.44 E ATOM 2763 O LEU E 328 28.844
76.687 17.234 1.00 32.20 E ATOM 2764 N THR E 329 29.290 74.758
16.179 1.00 33.93 E ATOM 2765 CA THR E 329 27.882 74.389 16.167
1.00 32.32 E ATOM 2766 CB THR E 329 27.595 73.010 15.454 1.00 27.74
E ATOM 2767 OG1 THR E 329 27.341 72.023 16.449 1.00 29.80 E ATOM
2768 CG2 THR E 329 28.756 72.546 14.579 1.00 17.77 E ATOM 2769 C
THR E 329 27.350 74.328 17.609 1.00 33.95 E ATOM 2770 O THR E 329
26.179 74.646 17.848 1.00 33.69 E ATOM 2771 N ALA E 330 28.199
73.937 18.567 1.00 31.78 E ATOM 2772 CA ALA E 330 27.769 73.861
19.969 1.00 33.28 E ATOM 2773 CB ALA E 330 28.817 73.142 20.814
1.00 31.03 E ATOM 2774 C ALA E 330 27.487 75.258 20.547 1.00 35.12
E ATOM 2775 O ALA E 330 26.546 75.438 21.330 1.00 28.86 E ATOM 2776
N ILE E 331 28.306 76.240 20.161 1.00 32.84 E ATOM 2777 CA ILE E
331 28.134 77.623 20.611 1.00 31.63 E ATOM 2778 CB ILE E 331 29.307
78.508 20.087 1.00 28.80 E ATOM 2779 CG2 ILE E 331 29.148 79.977
20.529 1.00 14.86 E ATOM 2780 CG1 ILE E 331 30.622 77.921 20.594
1.00 22.26 E ATOM 2781 CD1 ILE E 331 31.815 78.798 20.411 1.00
22.39 E ATOM 2782 C ILE E 331 26.778 78.152 20.096 1.00 35.90 E
ATOM 2783 O ILE E 331 26.099 78.948 20.763 1.00 38.07 E ATOM 2784 N
VAL E 332 26.383 77.684 18.911 1.00 36.30 E ATOM 2785 CA VAL E 332
25.123 78.079 18.280 1.00 32.82 E ATOM 2786 CB VAL E 332 25.033
77.598 16.807 1.00 33.28 E ATOM 2787 CG1 VAL E 332 23.624 77.856
16.253 1.00 20.84 E ATOM 2788 CG2 VAL E 332 26.093 78.298 15.956
1.00 27.39 E ATOM 2789 C VAL E 332 23.951 77.474 19.005 1.00 30.96
E ATOM 2790 O VAL E 332 22.933 78.125 19.224 1.00 38.03 E ATOM 2791
N ILE E 333 24.095 76.208 19.358 1.00 32.15 E ATOM 2792 CA ILE E
333 23.033 75.496 20.042 1.00 33.48 E ATOM 2793 CB ILE E 333 23.396
73.996 20.172 1.00 24.45 E ATOM 2794 CG2 ILE E 333 22.414 73.288
21.054 1.00 19.03 E ATOM 2795 CG1 ILE E 333 23.403 73.358 18.789
1.00 20.06 E ATOM 2796 CD1 ILE E 333 23.824 71.910 18.787 1.00
19.42 E ATOM 2797 C ILE E 333 22.716 76.125 21.404 1.00 33.41 E
ATOM 2798 O ILE E 333 21.562 76.100 21.847 1.00 35.50 E ATOM 2799 N
PHE E 334 23.732 76.715 22.033 1.00 28.65 E ATOM 2800 CA PHE E 334
23.593 77.355 23.343 1.00 33.67 E ATOM 2801 CB PHE E 334 24.717
76.917 24.278 1.00 32.69 E ATOM 2802 CG PHE E 334 24.639 75.490
24.672 1.00 36.29 E ATOM 2803 CD1 PHE E 334 23.507 75.003 25.321
1.00 32.87 E ATOM 2804 CD2 PHE E 334 25.686 74.620 24.382 1.00
36.20 E ATOM 2805 CE1 PHE E 334 23.409 73.675 25.675 1.00 31.24 E
ATOM 2806 CE2 PHE E 334 25.598 73.285 24.732 1.00 38.46 E ATOM 2807
CZ PHE E 334 24.450 72.811 25.383 1.00 38.10 E ATOM 2808 C PHE E
334 23.571 78.884 23.290 1.00 39.11 E ATOM 2809 O PHE E 334 24.192
79.576 24.126 1.00 39.08 E ATOM 2810 N SER E 335 22.847 79.410
22.315 1.00 33.86 E ATOM 2811 CA SER E 335 22.742 80.837 22.167
1.00 35.91 E ATOM 2812 CB SER E 335 22.707 81.171 20.689 1.00 32.42
E ATOM 2813 OG SER E 335 23.897 80.693 20.096 1.00 29.88 E ATOM
2814 C SER E 335 21.507 81.354 22.887 1.00 39.38 E ATOM 2815 O SER
E 335 20.399 81.149 22.430 1.00 45.11 E ATOM 2816 N GLU E 336
21.707 82.006 24.030 1.00 43.04 E ATOM 2817 CA GLU E 336 20.597
82.545 24.801 1.00 44.80 E ATOM 2818 CB GLU E 336 21.094 83.297
26.021 1.00 49.84 E ATOM 2819 CG GLU E 336 19.978 84.039 26.739
1.00 64.36 E ATOM 2820 CD GLU E 336 20.432 84.685 28.046 1.00 75.48
E ATOM 2821 OE1 GLU E 336 19.627 85.429 28.668 1.00 70.40 E ATOM
2822 OE2 GLU E 336 21.594 84.443 28.451 1.00 76.31 E ATOM 2823 C
GLU E 336 19.723 83.481 23.991 1.00 47.53 E ATOM 2824 O GLU E 336
20.094 84.642 23.735 1.00 49.22 E ATOM 2825 N ARG E 337 18.559
82.953 23.608 1.00 47.43 E ATOM 2826 CA ARG E 337 17.541 83.665
22.845 1.00 41.04 E ATOM 2827 CB ARG E 337 16.787 82.688 21.951
1.00 38.57 E ATOM 2828 CG ARG E 337 17.636 81.673 21.234 1.00 41.45
E ATOM 2829 CD ARG E 337 17.898 82.058 19.792 1.00 38.02 E ATOM
2830 NE ARG E 337 18.855 81.138 19.188 1.00 45.29 E ATOM 2831 CZ
ARG E 337 19.432 81.322 18.005 1.00 46.67 E ATOM 2832 NH1 ARG E 337
19.142 82.405 17.284 1.00 28.51 E ATOM 2833 NH2 ARG E 337 20.308
80.422 17.555 1.00 41.41 E ATOM 2834 C ARG E 337 16.564 84.212
23.894 1.00 43.46 E ATOM 2835 O ARG E 337 16.553 83.743 25.039 1.00
41.16 E ATOM 2836 N PRO E 338 15.711 85.191 23.516 1.00 47.00 E
ATOM 2837 CD PRO E 338 15.414 85.666 22.153 1.00 43.34 E ATOM 2838
CA PRO E 338 14.749 85.753 24.479 1.00 42.51 E ATOM 2839 CB PRO E
338 14.112 86.905 23.714 1.00 37.53 E ATOM 2840 CG PRO E 338 14.912
87.033 22.417 1.00 38.31 E ATOM 2841 C PRO E 338 13.743 84.665
24.730 1.00 41.36 E ATOM 2842 O PRO E 338 13.797 83.642 24.058 1.00
50.86 E ATOM 2843 N SER E 339 12.830 84.846 25.674 1.00 43.71 E
ATOM 2844 CA SER E 339 11.810 83.807 25.910 1.00 51.70 E ATOM 2845
CB SER E 339 11.104 83.440 24.608 1.00 53.32 E ATOM 2846 OG SER E
339 11.824 82.413 23.939 1.00 58.35 E ATOM 2847 C SER E 339 12.292
82.493 26.545 1.00 52.52 E ATOM 2848 O SER E 339 11.477 81.726
27.052 1.00 55.04 E ATOM 2849 N LEU E 340 13.585 82.189 26.461 1.00
50.66 E ATOM 2850 CA LEU E 340 14.091 80.998 27.121 1.00 46.28 E
ATOM 2851 CB LEU E 340 15.599 80.918 26.997 1.00 40.25 E ATOM 2852
CG LEU E 340 16.288 80.182 25.872 1.00 38.30 E ATOM 2853 CD1 LEU E
340 17.763 80.548 25.914 1.00 44.30 E ATOM 2854 CD2 LEU E 340
16.109 78.696 26.029 1.00 37.84 E ATOM 2855 C LEU E 340 13.768
81.273 28.591 1.00 50.48 E ATOM 2856 O LEU E 340 13.817 82.424
29.027 1.00 51.67 E ATOM 2857 N SER E 341 13.447 80.240 29.361 1.00
50.33 E ATOM 2858 CA SER E 341 13.149 80.444 30.768 1.00 46.30 E
ATOM 2859 CB SER E 341 12.533 79.209 31.375 1.00 44.20 E ATOM 2860
OG SER E 341 12.684 79.286 32.778 1.00 52.17 E ATOM 2861 C SER E
341 14.395 80.782 31.570 1.00 49.57 E ATOM 2862 O SER E 341 14.440
81.792 32.264 1.00 51.49 E ATOM 2863 N GLU E 342 15.410 79.930
31.492 1.00 49.30 E ATOM 2864 CA GLU E 342 16.631 80.193 32.230
1.00 46.56 E ATOM 2865 CB GLU E 342 17.078 78.970 32.996 1.00 54.05
E ATOM 2866 CG GLU E 342 16.055 78.360 33.887 1.00 60.75 E ATOM
2867 CD GLU E 342 16.557 77.045 34.412 1.00 67.98 E ATOM 2868 OE1
GLU E 342 16.856 76.146 33.578 1.00 72.09 E ATOM 2869 OE2 GLU E 342
16.666 76.924 35.650 1.00 69.64 E ATOM 2870 C GLU E 342 17.759
80.602 31.316 1.00 42.61 E ATOM 2871 O GLU E 342 18.784 79.929
31.245 1.00 37.29 E ATOM 2872 N GLY E 343 17.579 81.717 30.627 1.00
40.60 E ATOM 2873 CA GLY E 343 18.623 82.191 29.743 1.00 43.46 E
ATOM 2874 C GLY E 343 20.031 82.226 30.335 1.00 39.18 E ATOM 2875 O
GLY E 343 20.987 81.757 29.690 1.00 37.87 E ATOM 2876 N TRP E 344
20.162 82.782 31.541 1.00 35.69 E ATOM 2877 CA TRP E 344 21.455
82.894 32.217 1.00 41.77 E ATOM 2878 CB TRP E 344 21.261 83.417
33.644 1.00 46.03 E ATOM 2879 CG TRP E 344 20.536 82.476 34.537
1.00 51.15 E ATOM 2880 CD2 TRP E 344 21.122 81.419 35.301 1.00
58.71 E ATOM 2881 CE2 TRP E 344 20.058 80.672 35.862 1.00 56.54 E
ATOM 2882 CE3 TRP E 344 22.448 81.027 35.565 1.00 57.83 E ATOM 2883
CD1 TRP E 344 19.182 82.341 34.669 1.00 50.37 E ATOM 2884 NE1 TRP E
344 18.887 81.258 35.459 1.00 52.67 E ATOM 2885 CZ2 TRP E 344
20.275 79.540 36.657 1.00 56.40 E ATOM 2886 CZ3 TRP E 344 22.665
79.897 36.356 1.00 60.15 E ATOM 2887 CH2 TRP E 344 21.581 79.169
36.896 1.00 58.16 E ATOM 2888 C TRP E 344 22.235 81.576 32.265 1.00
44.23 E ATOM 2889 O TRP E 344 23.474 81.563 32.209 1.00 44.69 E
ATOM 2890 N LYS E 345 21.504 80.469 32.360 1.00 44.02 E ATOM 2891
CA LYS E 345 22.124 79.160 32.429 1.00 47.06 E ATOM 2892 CB LYS E
345 21.127 78.153 33.009 1.00 46.11 E ATOM 2893 CG LYS E 345 21.768
76.843 33.407 1.00 48.67 E ATOM 2894 CD LYS E 345 20.744 75.779
33.786 1.00 58.19 E ATOM 2895 CE LYS E 345 20.045 76.082 35.102
1.00 65.45 E ATOM 2896 NZ LYS E 345 19.499 74.824 35.683 1.00 61.68
E ATOM 2897 C LYS E 345 22.646 78.699 31.057 1.00 51.21 E ATOM 2898
O LYS E 345 23.750 78.140 30.976 1.00 51.22 E ATOM 2899 N VAL E 346
21.867 78.926 29.989 1.00 47.18 E ATOM 2900 CA VAL E 346 22.306
78.552 28.641 1.00 42.50 E ATOM 2901 CB VAL E 346 21.234 78.869
27.546 1.00 37.11 E ATOM 2902 CG1 VAL E 346 21.778 78.546 26.199
1.00 34.24 E ATOM 2903 CG2 VAL E 346 19.997 78.030 27.726 1.00
35.13 E ATOM 2904 C VAL E 346 23.557 79.390 28.359 1.00 41.56 E
ATOM 2905 O VAL E 346 24.545 78.913 27.789 1.00 43.97 E ATOM 2906 N
GLU E 347 23.513 80.639 28.798 1.00 38.53 E ATOM 2907 CA GLU E 347
24.616 81.568 28.607 1.00 41.57 E ATOM 2908 CB GLU E 347 24.278
82.881 29.280 1.00 39.84 E ATOM 2909 CG GLU E 347 25.069 84.033
28.792 1.00 49.68 E ATOM 2910 CD GLU E 347 24.494 85.334 29.295
1.00 68.89 E ATOM 2911 OE1 GLU E 347 25.028 85.866 30.297 1.00
81.64 E ATOM 2912 OE2 GLU E 347 23.499 85.819 28.697 1.00 61.93 E
ATOM 2913 C GLU E 347 25.919 81.047 29.176 1.00 43.24 E ATOM 2914 O
GLU E 347 26.955 81.047 28.512 1.00 41.17 E ATOM 2915 N LYS E 348
25.844 80.610 30.427 1.00 46.94 E ATOM 2916 CA LYS E 348 26.983
80.085 31.171 1.00 47.97 E ATOM 2917 CB LYS E 348 26.526 79.869
32.613 1.00 52.33 E ATOM 2918 CG LYS E 348 27.545 79.271 33.568
1.00 61.82 E ATOM 2919 CD LYS E 348 26.881 79.124 34.941 1.00 71.46
E ATOM 2920 CE LYS E 348 27.773 78.466 35.978 1.00 75.28 E ATOM
2921 NZ LYS E 348 27.124 78.532 37.323 1.00 75.30 E ATOM 2922 C LYS
E 348 27.573 78.795 30.570 1.00 46.87 E ATOM 2923 O LYS E 348
28.794 78.596 30.575 1.00 42.83 E ATOM 2924 N ILE E 349 26.692
77.928 30.065 1.00 43.26 E ATOM 2925 CA ILE E 349 27.082 76.663
29.445 1.00 40.07 E ATOM 2926 CB ILE E 349 25.845 75.789 29.149
1.00 38.98 E ATOM 2927 CG2 ILE E 349 26.245 74.532 28.385 1.00
29.15 E ATOM 2928 CG1 ILE E 349 25.150 75.440 30.462 1.00 35.25 E
ATOM 2929 CD1 ILE E 349 23.920 74.598 30.307 1.00 32.85 E ATOM 2930
C ILE E 349 27.807 76.950 28.138 1.00 43.83 E ATOM 2931 O ILE E 349
28.832 76.337 27.818 1.00 42.49 E ATOM 2932 N GLN E 350 27.262
77.888 27.375 1.00 38.97 E ATOM 2933 CA GLN E 350 27.886 78.253
26.126 1.00 39.89 E ATOM 2934 CB GLN E 350 27.056 79.306 25.410
1.00 37.99 E ATOM 2935 CG GLN E 350 27.766 79.885 24.209 1.00 34.17
E ATOM 2936 CD GLN E 350 27.106 81.140 23.749 1.00 35.92 E ATOM
2937 OE1 GLN E 350 26.843 82.019 24.552 1.00 39.58 E ATOM 2938 NE2
GLN E 350 26.827 81.238 22.461 1.00 31.17 E ATOM 2939 C GLN E 350
29.311 78.773 26.351 1.00 40.10 E ATOM 2940 O GLN E 350 30.212
78.483 25.569 1.00 37.93 E ATOM 2941 N GLU E 351 29.517 79.541
27.416 1.00 39.98 E ATOM 2942 CA GLU E 351 30.843 80.079 27.702
1.00 42.25 E ATOM 2943 CB GLU E 351 30.825 80.814 29.044 1.00 45.08
E ATOM 2944 CG GLU E 351 29.972 82.086 29.014 1.00 66.01 E ATOM
2945 CD GLU E 351 29.961 82.864 30.340 1.00 74.89 E ATOM 2946 OE1
GLU E 351 29.392 83.996 30.385 1.00 66.89 E ATOM 2947 OE2 GLU E 351
30.522 82.334 31.334 1.00 77.72 E ATOM 2948 C GLU E 351 31.916
78.980 27.690 1.00 42.79 E ATOM 2949 O GLU E 351 33.033 79.180
27.227 1.00 43.40 E ATOM 2950 N ILE E 352 31.573 77.803 28.181 1.00
40.39 E ATOM 2951 CA ILE E 352 32.524 76.703 28.196 1.00 36.14 E
ATOM 2952 CB ILE E 352 31.901 75.485 28.860 1.00 38.19 E ATOM 2953
CG2 ILE E 352 32.758 74.270 28.640 1.00 23.85 E ATOM 2954 CG1 ILE E
352 31.684 75.781 30.336 1.00 39.13 E ATOM 2955 CD1 ILE E 352
30.936 74.680 31.072 1.00 46.43 E ATOM 2956 C ILE E 352 33.012
76.312 26.792 1.00 37.13 E ATOM 2957 O ILE E 352 34.195 76.032
26.599 1.00 35.23 E ATOM 2958 N TYR E 353 32.110 76.280 25.815 1.00
36.67 E ATOM 2959 CA TYR E 353 32.509 75.918 24.461 1.00 31.52 E
ATOM 2960 CB TYR E 353 31.299 75.528 23.630 1.00 23.57 E ATOM 2961
CG TYR E 353 30.615 74.299 24.164 1.00 33.24 E ATOM 2962 CD1 TYR E
353 29.497 74.406 24.997 1.00 33.74 E ATOM 2963 CE1 TYR E 353
28.878 73.285 25.519 1.00 33.63 E ATOM 2964 CD2 TYR E 353 31.102
73.026 23.866 1.00 30.53 E ATOM 2965 CE2 TYR E 353 30.497 71.891
24.381 1.00 33.64 E ATOM 2966 CZ TYR E 353 29.383 72.024 25.209
1.00 38.19 E ATOM 2967 OH TYR E 353 28.772 70.897 25.719 1.00 29.68
E ATOM 2968 C TYR E 353 33.250 77.046 23.783 1.00 30.62 E ATOM 2969
O TYR E 353 34.147 76.815 22.974 1.00 32.71 E ATOM 2970 N ILE E 354
32.871 78.274 24.121 1.00 30.90 E ATOM 2971 CA ILE E 354 33.496
79.463 23.553 1.00 27.81 E ATOM 2972 CB ILE E 354 32.832 80.742
24.097 1.00 19.96 E ATOM 2973 CG2 ILE E 354 33.647 81.959 23.696
1.00 15.58 E ATOM 2974 CG1 ILE E 354 31.384 80.804 23.626 1.00
22.76 E ATOM 2975 CD1 ILE E 354 30.692 82.059 23.946 1.00 14.85 E
ATOM 2976 C ILE E 354 34.946 79.452 23.996 1.00 32.14 E ATOM 2977 O
ILE E 354 35.873 79.611 23.198 1.00 33.40 E ATOM 2978 N GLU E 355
35.111 79.237 25.297 1.00 33.87 E ATOM 2979 CA GLU E 355 36.399
79.203 25.943 1.00 29.98 E ATOM 2980 CB GLU E 355 36.159 79.130
27.456 1.00 24.91 E ATOM 2981 CG GLU E 355 37.368 79.460 28.311
1.00 49.56 E ATOM 2982 CD GLU E 355 38.095 80.737 27.876 1.00 62.97
E ATOM 2983 OE1 GLU E 355 37.526 81.854 28.028 1.00 62.84 E ATOM
2984 OE2 GLU E 355 39.244 80.607 27.375 1.00 68.69 E ATOM 2985 C
GLU E 355 37.266 78.044 25.401 1.00 33.04 E ATOM 2986 O GLU E 355
38.481 78.203 25.204 1.00 32.75 E ATOM 2987 N ALA E 356 36.657
76.888 25.137 1.00 31.87 E ATOM 2988 CA ALA E 356 37.411 75.765
24.590 1.00 33.45 E ATOM 2989 CB ALA E 356 36.604 74.484 24.673
1.00 31.24 E ATOM 2990 C ALA E 356 37.802 76.057 23.134 1.00 39.40
E ATOM 2991 O ALA E 356 38.849 75.602 22.681 1.00 41.00 E ATOM 2992
N LEU E 357 36.976 76.803 22.394 1.00 36.52 E ATOM 2993 CA LEU E
357 37.327 77.142 21.015 1.00 32.92 E ATOM 2994 CB LEU E 357 36.178
77.825 20.269 1.00 32.06 E ATOM 2995 CG LEU E 357 36.474 78.270
18.827 1.00 25.48 E ATOM 2996 CD1 LEU E 357 37.017 77.132 17.985
1.00 18.80 E ATOM 2997 CD2 LEU E 357 35.199 78.780 18.219 1.00
22.88 E ATOM 2998 C LEU E 357 38.513 78.083 21.046 1.00 34.90 E
ATOM 2999 O LEU E 357 39.450 77.907 20.262 1.00 36.03 E ATOM 3000 N
LYS E 358 38.475 79.082 21.940 1.00 34.91 E ATOM 3001 CA LYS E 358
39.597 80.024 22.062 1.00 35.86 E ATOM 3002 CB LYS E 358 39.393
81.073 23.177 1.00 30.78 E
ATOM 3003 CG LYS E 358 40.080 82.422 22.858 1.00 35.85 E ATOM 3004
CD LYS E 358 40.114 83.450 24.006 1.00 40.68 E ATOM 3005 CE LYS E
358 40.961 82.961 25.212 1.00 45.86 E ATOM 3006 NZ LYS E 358 40.895
83.850 26.445 1.00 40.64 E ATOM 3007 C LYS E 358 40.848 79.208
22.364 1.00 37.00 E ATOM 3008 O LYS E 358 41.838 79.324 21.652 1.00
35.33 E ATOM 3009 N ALA E 359 40.788 78.367 23.401 1.00 40.86 E
ATOM 3010 CA ALA E 359 41.917 77.513 23.788 1.00 39.35 E ATOM 3011
CB ALA E 359 41.493 76.551 24.855 1.00 40.44 E ATOM 3012 C ALA E
359 42.472 76.732 22.609 1.00 40.83 E ATOM 3013 O ALA E 359 43.680
76.688 22.394 1.00 38.57 E ATOM 3014 N TYR E 360 41.576 76.116
21.846 1.00 38.26 E ATOM 3015 CA TYR E 360 41.956 75.317 20.694
1.00 32.22 E ATOM 3016 CB TYR E 360 40.725 74.614 20.125 1.00 27.64
E ATOM 3017 CG TYR E 360 40.977 73.808 18.858 1.00 25.35 E ATOM
3018 CD1 TYR E 360 41.381 72.483 18.923 1.00 18.24 E ATOM 3019 CE1
TYR E 360 41.611 71.751 17.773 1.00 20.01 E ATOM 3020 CD2 TYR E 360
40.807 74.383 17.588 1.00 25.83 E ATOM 3021 CE2 TYR E 360 41.037
73.659 16.433 1.00 23.29 E ATOM 3022 CZ TYR E 360 41.436 72.337
16.530 1.00 28.18 E ATOM 3023 OH TYR E 360 41.627 71.583 15.386
1.00 25.99 E ATOM 3024 C TYR E 360 42.609 76.146 19.605 1.00 36.45
E ATOM 3025 O TYR E 360 43.680 75.786 19.119 1.00 39.74 E ATOM 3026
N VAL E 361 41.960 77.245 19.216 1.00 36.88 E ATOM 3027 CA VAL E
361 42.467 78.113 18.146 1.00 40.55 E ATOM 3028 CB VAL E 361 41.450
79.225 17.809 1.00 38.45 E ATOM 3029 CG1 VAL E 361 41.931 80.026
16.619 1.00 30.69 E ATOM 3030 CG2 VAL E 361 40.089 78.603 17.523
1.00 36.50 E ATOM 3031 C VAL E 361 43.812 78.744 18.484 1.00 42.98
E ATOM 3032 O VAL E 361 44.695 78.825 17.639 1.00 43.97 E ATOM 3033
N GLU E 362 43.964 79.180 19.729 1.00 49.63 E ATOM 3034 CA GLU E
362 45.214 79.775 20.182 1.00 50.89 E ATOM 3035 CB GLU E 362 45.082
80.354 21.587 1.00 42.81 E ATOM 3036 CG GLU E 362 44.453 81.704
21.618 1.00 48.93 E ATOM 3037 CD GLU E 362 44.243 82.207 23.024
1.00 63.80 E ATOM 3038 OE1 GLU E 362 43.499 81.561 23.799 1.00
70.08 E ATOM 3039 OE2 GLU E 362 44.818 83.262 23.358 1.00 74.63 E
ATOM 3040 C GLU E 362 46.320 78.744 20.195 1.00 52.51 E ATOM 3041 O
GLU E 362 47.405 79.001 19.690 1.00 53.90 E ATOM 3042 N ASN E 363
46.045 77.574 20.764 1.00 57.67 E ATOM 3043 CA ASN E 363 47.052
76.525 20.841 1.00 57.57 E ATOM 3044 CB ASN E 363 46.683 75.528
21.939 1.00 55.13 E ATOM 3045 CG ASN E 363 47.074 76.027 23.314
1.00 60.47 E ATOM 3046 OD1 ASN E 363 48.251 76.028 23.665 1.00
68.73 E ATOM 3047 ND2 ASN E 363 46.095 76.475 24.091 1.00 59.89 E
ATOM 3048 C ASN E 363 47.414 75.817 19.539 1.00 57.23 E ATOM 3049 O
ASN E 363 48.215 74.898 19.549 1.00 60.35 E ATOM 3050 N ARG E 364
46.827 76.229 18.419 1.00 62.49 E ATOM 3051 CA ARG E 364 47.226
75.671 17.129 1.00 71.24 E ATOM 3052 CB ARG E 364 46.214 75.966
16.032 1.00 68.25 E ATOM 3053 CG ARG E 364 44.911 75.255 16.192
1.00 80.52 E ATOM 3054 CD ARG E 364 45.079 73.745 16.101 1.00 88.65
E ATOM 3055 NE ARG E 364 45.647 73.149 17.309 1.00 91.73 E ATOM
3056 CZ ARG E 364 45.827 71.840 17.478 1.00 93.79 E ATOM 3057 NH1
ARG E 364 45.481 70.993 16.512 1.00 92.83 E ATOM 3058 NH2 ARG E 364
46.345 71.372 18.609 1.00 93.18 E ATOM 3059 C ARG E 364 48.442
76.541 16.879 1.00 81.51 E ATOM 3060 O ARG E 364 48.920 76.647
15.744 1.00 84.85 E ATOM 3061 N ARG E 365 48.893 77.170 17.982 1.00
92.03 E ATOM 3062 CA ARG E 365 50.030 78.117 18.098 1.00 96.21 E
ATOM 3063 CB ARG E 365 51.237 77.445 18.803 1.00 95.61 E ATOM 3064
CG ARG E 365 52.264 78.397 19.455 1.00 91.12 E ATOM 3065 CD ARG E
365 51.758 79.135 20.710 1.00 94.23 E ATOM 3066 NE ARG E 365 51.599
78.281 21.899 1.00 104.40 E ATOM 3067 CZ ARG E 365 51.437 78.725
23.156 1.00 105.97 E ATOM 3068 NH1 ARG E 365 51.412 80.027 23.432
1.00 100.30 E ATOM 3069 NH2 ARG E 365 51.290 77.855 24.154 1.00
106.95 E ATOM 3070 C ARG E 365 50.407 78.678 16.729 1.00 99.02 E
ATOM 3071 O ARG E 365 51.579 78.784 16.360 1.00 103.34 E ATOM 3072
N LYS E 366 49.361 79.040 15.992 1.00 99.93 E ATOM 3073 CA LYS E
366 49.463 79.595 14.655 1.00 95.80 E ATOM 3074 CB LYS E 366 48.296
79.085 13.813 1.00 92.63 E ATOM 3075 CG LYS E 366 46.926 79.229
14.505 1.00 81.57 E ATOM 3076 CD LYS E 366 45.835 78.705 13.592
1.00 83.83 E ATOM 3077 CE LYS E 366 44.531 78.450 14.313 1.00 87.71
E ATOM 3078 NZ LYS E 366 43.528 77.810 13.402 1.00 87.24 E ATOM
3079 C LYS E 366 49.362 81.104 14.776 1.00 95.00 E ATOM 3080 O LYS
E 366 48.751 81.616 15.721 1.00 97.66 E ATOM 3081 N PRO E 367
49.991 81.842 13.852 1.00 90.48 E ATOM 3082 CD PRO E 367 51.023
81.481 12.867 1.00 85.71 E ATOM 3083 CA PRO E 367 49.866 83.295
13.972 1.00 86.93 E ATOM 3084 CB PRO E 367 50.800 83.803 12.883
1.00 81.22 E ATOM 3085 CG PRO E 367 51.834 82.743 12.807 1.00 80.89
E ATOM 3086 C PRO E 367 48.387 83.621 13.673 1.00 90.72 E ATOM 3087
O PRO E 367 47.611 82.732 13.291 1.00 93.37 E ATOM 3088 N TYR E 368
47.985 84.874 13.843 1.00 88.30 E ATOM 3089 CA TYR E 368 46.604
85.272 13.558 1.00 87.82 E ATOM 3090 CB TYR E 368 46.191 84.850
12.141 1.00 97.22 E ATOM 3091 CG TYR E 368 47.285 84.791 11.088
1.00 100.81 E ATOM 3092 CD1 TYR E 368 47.913 83.584 10.786 1.00
101.27 E ATOM 3093 CE1 TYR E 368 48.840 83.488 9.773 1.00 103.17 E
ATOM 3094 CD2 TYR E 368 47.629 85.916 10.338 1.00 100.48 E ATOM
3095 CE2 TYR E 368 48.562 85.830 9.310 1.00 103.55 E ATOM 3096 CZ
TYR E 368 49.160 84.605 9.032 1.00 105.22 E ATOM 3097 OH TYR E 368
50.056 84.471 7.989 1.00 112.94 E ATOM 3098 C TYR E 368 45.520
84.749 14.514 1.00 80.96 E ATOM 3099 O TYR E 368 44.380 85.211
14.452 1.00 81.08 E ATOM 3100 N ALA E 369 45.865 83.787 15.368 1.00
70.44 E ATOM 3101 CA ALA E 369 44.932 83.191 16.328 1.00 62.48 E
ATOM 3102 CB ALA E 369 45.687 82.777 17.564 1.00 55.83 E ATOM 3103
C ALA E 369 43.729 84.062 16.725 1.00 62.51 E ATOM 3104 O ALA E 369
42.578 83.624 16.642 1.00 59.98 E ATOM 3105 N THR E 370 43.973
85.293 17.160 1.00 58.77 E ATOM 3106 CA THR E 370 42.855 86.142
17.549 1.00 56.88 E ATOM 3107 CB THR E 370 43.338 87.422 18.308
1.00 52.55 E ATOM 3108 OG1 THR E 370 43.149 88.595 17.492 1.00
40.99 E ATOM 3109 CG2 THR E 370 44.797 87.248 18.723 1.00 43.43 E
ATOM 3110 C THR E 370 42.013 86.512 16.324 1.00 57.87 E ATOM 3111 O
THR E 370 40.783 86.590 16.400 1.00 58.49 E ATOM 3112 N THR E 371
42.667 86.721 15.189 1.00 55.14 E ATOM 3113 CA THR E 371 41.931
87.050 13.982 1.00 53.34 E ATOM 3114 CB THR E 371 42.876 87.608
12.876 1.00 51.68 E ATOM 3115 OG1 THR E 371 42.886 89.053 12.954
1.00 39.83 E ATOM 3116 CG2 THR E 371 42.436 87.112 11.466 1.00
30.79 E ATOM 3117 C THR E 371 41.148 85.835 13.477 1.00 54.94 E
ATOM 3118 O THR E 371 40.052 85.976 12.934 1.00 59.29 E ATOM 3119 N
ILE E 372 41.693 84.637 13.660 1.00 52.00 E ATOM 3120 CA ILE E 372
40.982 83.439 13.221 1.00 46.89 E ATOM 3121 CB ILE E 372 41.881
82.188 13.252 1.00 46.50 E ATOM 3122 CG2 ILE E 372 41.110 80.989
12.767 1.00 46.12 E ATOM 3123 CG1 ILE E 372 43.085 82.388 12.341
1.00 49.39 E ATOM 3124 CD1 ILE E 372 44.280 81.540 12.713 1.00
66.77 E ATOM 3125 C ILE E 372 39.797 83.245 14.156 1.00 43.94 E
ATOM 3126 O ILE E 372 38.676 83.080 13.705 1.00 50.56 E ATOM 3127 N
PHE E 373 40.038 83.281 15.458 1.00 34.23 E ATOM 3128 CA PHE E 373
38.961 83.126 16.430 1.00 33.38 E ATOM 3129 CB PHE E 373 39.517
83.371 17.828 1.00 29.69 E ATOM 3130 CG PHE E 373 38.508 83.204
18.923 1.00 25.05 E ATOM 3131 CD1 PHE E 373 38.117 81.945 19.339
1.00 32.12 E ATOM 3132 CD2 PHE E 373 37.979 84.318 19.573 1.00
33.08 E ATOM 3133 CE1 PHE E 373 37.213 81.799 20.389 1.00 37.40 E
ATOM 3134 CE2 PHE E 373 37.080 84.185 20.618 1.00 33.02 E ATOM 3135
CZ PHE E 373 36.698 82.928 21.032 1.00 36.20 E ATOM 3136 C PHE E
373 37.781 84.082 16.170 1.00 34.09 E ATOM 3137 O PHE E 373 36.609
83.686 16.230 1.00 29.43 E ATOM 3138 N ALA E 374 38.109 85.345
15.896 1.00 38.16 E ATOM 3139 CA ALA E 374 37.110 86.380 15.628
1.00 39.91 E ATOM 3140 CB ALA E 374 37.767 87.770 15.583 1.00 35.72
E ATOM 3141 C ALA E 374 36.378 86.099 14.322 1.00 38.29 E ATOM 3142
O ALA E 374 35.184 86.340 14.224 1.00 38.07 E ATOM 3143 N LYS E 375
37.097 85.599 13.323 1.00 36.27 E ATOM 3144 CA LYS E 375 36.495
85.266 12.042 1.00 34.18 E ATOM 3145 CB LYS E 375 37.568 84.935
11.021 1.00 36.07 E ATOM 3146 CG LYS E 375 38.357 86.088 10.476
1.00 45.35 E ATOM 3147 CD LYS E 375 39.190 85.560 9.313 1.00 57.63
E ATOM 3148 CE LYS E 375 39.943 86.638 8.568 1.00 64.98 E ATOM 3149
NZ LYS E 375 40.527 86.117 7.286 1.00 71.22 E ATOM 3150 C LYS E 375
35.557 84.054 12.180 1.00 33.41 E ATOM 3151 O LYS E 375 34.530
83.985 11.511 1.00 32.39 E ATOM 3152 N LEU E 376 35.921 83.092
13.031 1.00 32.18 E ATOM 3153 CA LEU E 376 35.093 81.906 13.251
1.00 29.18 E ATOM 3154 CB LEU E 376 35.787 80.883 14.164 1.00 26.70
E ATOM 3155 CG LEU E 376 36.957 80.073 13.575 1.00 30.47 E ATOM
3156 CD1 LEU E 376 37.561 79.226 14.664 1.00 35.46 E ATOM 3157 CD2
LEU E 376 36.506 79.181 12.428 1.00 15.68 E ATOM 3158 C LEU E 376
33.791 82.341 13.888 1.00 29.09 E ATOM 3159 O LEU E 376 32.717
82.018 13.387 1.00 27.41 E ATOM 3160 N LEU E 377 33.894 83.096
14.979 1.00 27.74 E ATOM 3161 CA LEU E 377 32.716 83.581 15.682
1.00 29.99 E ATOM 3162 CB LEU E 377 33.122 84.445 16.874 1.00 28.77
E ATOM 3163 CG LEU E 377 33.681 83.778 18.120 1.00 27.79 E ATOM
3164 CD1 LEU E 377 33.787 84.801 19.236 1.00 20.75 E ATOM 3165 CD2
LEU E 377 32.759 82.647 18.523 1.00 23.07 E ATOM 3166 C LEU E 377
31.763 84.382 14.799 1.00 34.20 E ATOM 3167 O LEU E 377 30.549
84.280 14.940 1.00 41.58 E ATOM 3168 N SER E 378 32.313 85.185
13.895 1.00 33.96 E ATOM 3169 CA SER E 378 31.508 86.015 13.009
1.00 32.03 E ATOM 3170 CB SER E 378 32.396 86.822 12.077 1.00 33.38
E ATOM 3171 OG SER E 378 33.048 85.973 11.157 1.00 34.99 E ATOM
3172 C SER E 378 30.591 85.178 12.159 1.00 36.66 E ATOM 3173 O SER
E 378 29.522 85.626 11.748 1.00 38.35 E ATOM 3174 N VAL E 379
31.015 83.960 11.868 1.00 37.35 E ATOM 3175 CA VAL E 379 30.197
83.093 11.057 1.00 36.78 E ATOM 3176 CB VAL E 379 30.862 81.728
10.945 1.00 35.51 E ATOM 3177 CG1 VAL E 379 29.847 80.651 10.612
1.00 37.59 E ATOM 3178 CG2 VAL E 379 31.895 81.805 9.869 1.00 27.07
E ATOM 3179 C VAL E 379 28.793 83.010 11.640 1.00 37.14 E ATOM 3180
O VAL E 379 27.822 82.854 10.902 1.00 40.33 E ATOM 3181 N LEU E 380
28.698 83.172 12.960 1.00 32.84 E ATOM 3182 CA LEU E 380 27.429
83.126 13.685 1.00 28.02 E ATOM 3183 CB LEU E 380 27.692 83.153
15.185 1.00 21.14 E ATOM 3184 CG LEU E 380 28.411 81.949 15.815
1.00 29.29 E ATOM 3185 CD1 LEU E 380 28.117 81.968 17.298 1.00
34.75 E ATOM 3186 CD2 LEU E 380 27.948 80.612 15.249 1.00 22.54 E
ATOM 3187 C LEU E 380 26.438 84.226 13.312 1.00 29.99 E ATOM 3188 O
LEU E 380 25.225 84.042 13.434 1.00 38.27 E ATOM 3189 N THR E 381
26.958 85.370 12.881 1.00 25.84 E ATOM 3190 CA THR E 381 26.132
86.484 12.436 1.00 26.88 E ATOM 3191 CB THR E 381 26.969 87.754
12.264 1.00 15.29 E ATOM 3192 OG1 THR E 381 27.705 87.998 13.456
1.00 15.98 E ATOM 3193 CG2 THR E 383 26.084 88.947 11.974 1.00
16.48 E ATOM 3194 C THR E 381 25.595 86.098 11.052 1.00 32.06 E
ATOM 3195 O THR E 381 24.464 86.407 10.677 1.00 33.96 E ATOM 3196 N
GLU E 382 26.436 85.429 10.279 1.00 34.87 E ATOM 3197 CA GLU E 382
26.042 85.012 8.961 1.00 30.44 E ATOM 3198 CB GLU E 382 27.227
84.374 8.251 1.00 35.97 E ATOM 3199 CG GLU E 382 26.967 84.073
6.769 1.00 57.41 E ATOM 3200 CD GLU E 382 26.250 85.217 6.015 1.00
63.98 E ATOM 3201 OE1 GLU E 382 26.453 86.415 6.402 1.00 59.25 E
ATOM 3202 OE2 GLU E 382 25.509 84.901 5.026 1.00 47.35 E ATOM 3203
C GLU E 382 24.881 84.040 9.096 1.00 28.38 E ATOM 3204 O GLU E 382
23.946 84.078 8.309 1.00 28.70 E ATOM 3205 N LEU E 383 24.919
83.191 10.118 1.00 28.31 E ATOM 3206 CA LEU E 383 23.845 82.228
10.339 1.00 22.49 E ATOM 3207 CB LEU E 383 24.204 81.302 11.495
1.00 16.97 E ATOM 3208 CG LEU E 383 25.357 80.359 11.141 1.00 26.83
E ATOM 3209 CD1 LEU E 383 25.655 79.434 12.289 1.00 20.81 E ATOM
3210 CD2 LEU E 383 25.011 79.564 9.884 1.00 21.75 E ATOM 3211 C LEU
E 383 22.480 82.887 10.566 1.00 23.24 E ATOM 3212 O LEU E 383
21.463 82.372 10.133 1.00 27.48 E ATOM 3213 N ARG E 384 22.441
84.029 11.236 1.00 22.78 E ATOM 3214 CA ARG E 384 21.167 84.718
11.430 1.00 24.73 E ATOM 3215 CB ARG E 384 21.303 85.993 12.288
1.00 22.96 E ATOM 3216 CG ARG E 384 21.825 85.774 13.671 1.00 27.90
E ATOM 3217 CD ARG E 384 20.953 84.840 14.429 1.00 18.45 E ATOM
3218 NE ARG E 384 21.607 84.408 15.654 1.00 35.88 E ATOM 3219 CZ
ARG E 384 21.479 85.008 16.835 1.00 34.93 E ATOM 3220 NH1 ARG E 384
20.708 86.084 16.979 1.00 14.64 E ATOM 3221 NH2 ARG E 384 22.138
84.515 17.876 1.00 32.02 E ATOM 3222 C ARG E 384 20.558 85.124
10.081 1.00 26.38 E ATOM 3223 O ARG E 384 19.338 85.168 9.950 1.00
33.40 E ATOM 3224 N THR E 385 21.353 85.449 9.070 1.00 19.82 E ATOM
3225 CA THR E 385 20.658 85.822 7.871 1.00 27.51 E ATOM 3226 CB THR
E 385 21.451 86.826 6.978 1.00 34.59 E ATOM 3227 OG1 THR E 385
22.673 86.246 6.547 1.00 42.75 E ATOM 3228 CG2 THR E 385 21.737
88.116 7.737 1.00 36.75 E ATOM 3229 C THR E 385 20.286 84.574 7.103
1.00 30.02 E ATOM 3230 O THR E 385 19.223 84.522 6.494 1.00 36.26 E
ATOM 3231 N LEU E 386 21.133 83.553 7.160 1.00 27.82 E ATOM 3232 CA
LEU E 386 20.866 82.311 6.445 1.00 26.77 E ATOM 3233 CB LEU E 386
22.080 81.381 6.533 1.00 17.31 E ATOM 3234 CG LEU E 386 23.232
81.678 5.585 1.00 11.79 E ATOM 3235 CD1 LEU E 386 24.377 80.771
5.881 1.00 29.55 E ATOM 3236 CD2 LEU E 386 22.799 81.476 4.158 1.00
19.90 E ATOM 3237 C LEU E 386 19.634 81.600 7.004 1.00 33.17 E ATOM
3238 O LEU E 386 18.835 81.000 6.261 1.00 32.97 E ATOM 3239 N GLY E
387 19.491 81.674 8.323 1.00 29.30 E ATOM 3240 CA GLY E 387 18.387
81.017 8.979 1.00 31.66 E ATOM 3241 C GLY E 387 17.113 81.760 8.690
1.00 35.31 E ATOM 3242 O GLY E 387 16.025 81.170 8.692 1.00 38.04 E
ATOM 3243 N ASN E 388 17.254 83.063 8.465 1.00 35.06 E ATOM 3244 CA
ASN E 388 16.124 83.938 8.171 1.00 35.25 E ATOM 3245 CB ASN E 388
16.562 85.393 8.258 1.00 34.73 E ATOM 3246 CG ASN E 388 15.441
86.353 7.972 1.00 35.48 E ATOM 3247 OD1 ASN E 388 14.368 86.264
8.554 1.00 38.42 E ATOM 3248 ND2 ASN E 388 15.690 87.294 7.080 1.00
40.60 E ATOM 3249 C ASN E 388 15.684 83.613 6.758 1.00 37.77 E ATOM
3250 O ASN E 388 14.496 83.507 6.461 1.00 33.42 E ATOM 3251 N MET E
389 16.678 83.452 5.893 1.00 38.07 E ATOM 3252 CA MET E 389 16.459
83.097 4.507 1.00 33.49 E ATOM 3253 CB MET E 389 17.788 82.928
3.804 1.00 34.37 E
ATOM 3254 CG MET E 389 17.674 82.389 2.416 1.00 35.98 E ATOM 3255
SD MET E 389 19.307 82.315 1.703 1.00 61.87 E ATOM 3256 CE MET E
389 19.736 80.608 2.072 1.00 48.34 E ATOM 3257 C MET E 389 15.715
81.779 4.456 1.00 33.16 E ATOM 3258 O MET E 389 14.760 81.614 3.699
1.00 37.81 E ATOM 3259 N ASN E 390 16.146 80.823 5.259 1.00 27.59 E
ATOM 3260 CA ASN E 390 15.458 79.562 5.215 1.00 28.20 E ATOM 3261
CB ASN E 390 16.097 78.568 6.166 1.00 30.32 E ATOM 3262 CG ASN E
390 15.584 77.175 5.949 1.00 35.90 E ATOM 3263 OD1 ASN E 390 14.735
76.692 6.706 1.00 31.78 E ATOM 3264 ND2 ASN E 390 16.082 76.518
4.891 1.00 38.32 E ATOM 3265 C ASN E 390 13.978 79.731 5.519 1.00
28.45 E ATOM 3266 O ASN E 390 13.134 79.201 4.797 1.00 28.72 E ATOM
3267 N SER E 391 13.668 80.483 6.572 1.00 30.90 E ATOM 3268 CA SER
E 391 12.282 80.730 6.974 1.00 31.85 E ATOM 3269 CB SER E 391
12.220 81.620 8.217 1.00 32.14 E ATOM 3270 OG SER E 391 12.727
80.950 9.360 1.00 45.82 E ATOM 3271 C SER E 391 11.514 81.393 5.857
1.00 31.51 E ATOM 3272 O SER E 391 10.342 81.097 5.642 1.00 31.42 E
ATOM 3273 N GLU E 392 12.196 82.294 5.158 1.00 35.32 E ATOM 3274 CA
GLU E 392 11.634 83.027 4.042 1.00 37.79 E ATOM 3275 CB GLU E 392
12.646 84.068 3.560 1.00 45.73 E ATOM 3276 CG GLU E 392 12.050
85.146 2.665 1.00 71.70 E ATOM 3277 CD GLU E 392 10.594 85.493
3.038 1.00 81.65 E ATOM 3278 OE1 GLU E 392 10.318 85.713 4.248 1.00
82.26 E ATOM 3279 OE2 GLU E 392 9.733 85.551 2.117 1.00 83.41 E
ATOM 3280 C GLU E 392 11.292 82.029 2.942 1.00 37.32 E ATOM 3281 O
GLU E 392 10.222 82.099 2.357 1.00 40.36 E ATOM 3282 N THR E 393
12.198 81.090 2.676 1.00 34.79 E ATOM 3283 CA THR E 393 11.963
80.045 1.683 1.00 31.23 E ATOM 3284 CB THR E 393 13.169 79.075
1.591 1.00 31.08 E ATOM 3285 OG1 THR E 393 14.331 79.765 1.116 1.00
27.30 E ATOM 3286 CG2 THR E 393 12.856 77.922 0.647 1.00 27.02 E
ATOM 3287 C THR E 393 10.711 79.220 2.074 1.00 32.60 E ATOM 3288 O
THR E 393 9.917 78.822 1.235 1.00 36.48 E ATOM 3289 N CYS E 394
10.527 78.956 3.355 1.00 34.75 E ATOM 3290 CA CYS E 394 9.360
78.182 3.769 1.00 37.83 E ATOM 3291 CB CYS E 394 9.454 77.808 5.240
1.00 30.63 E ATOM 3292 SG CYS E 394 10.513 76.386 5.489 1.00 41.29
E ATOM 3293 C CYS E 394 8.066 78.908 3.519 1.00 38.54 E ATOM 3294 O
CYS E 394 7.069 78.292 3.163 1.00 35.21 E ATOM 3295 N PHE E 395
8.087 80.223 3.711 1.00 40.13 E ATOM 3296 CA PHE E 395 6.903 81.044
3.505 1.00 37.82 E ATOM 3297 CB PHE E 395 7.205 82.518 3.772 1.00
29.50 E ATOM 3298 CG PHE E 395 6.025 83.420 3.567 1.00 29.76 E ATOM
3299 CD1 PHE E 395 4.968 83.421 4.483 1.00 31.00 E ATOM 3300 CD2
PHE E 395 5.938 84.232 2.433 1.00 28.66 E ATOM 3301 CE1 PHE E 395
3.834 84.215 4.272 1.00 30.82 E ATOM 3302 CE2 PHE E 395 4.804
85.032 2.209 1.00 26.06 E ATOM 3303 CZ PHE E 395 3.754 85.022 3.130
1.00 27.11 E ATOM 3304 C PHE E 395 6.459 80.914 2.069 1.00 39.43 E
ATOM 3305 O PHE E 395 5.274 80.746 1.785 1.00 39.90 E ATOM 3306 N
SER E 396 7.437 80.997 1.174 1.00 34.64 E ATOM 3307 CA SER E 396
7.205 80.937 -0.249 1.00 36.33 E ATOM 3308 CB SER E 396 8.474
81.306 -0.970 1.00 32.84 E ATOM 3309 OG SER E 396 8.784 82.633
-0.581 1.00 51.02 E ATOM 3310 C SER E 396 6.683 79.626 -0.743 1.00
39.02 E ATOM 3311 O SER E 396 5.778 79.600 -1.572 1.00 42.24 E ATOM
3312 N LEU E 397 7.246 78.531 -0.247 1.00 43.94 E ATOM 3313 CA LEU
E 397 6.775 77.214 -0.643 1.00 42.57 E ATOM 3314 CB LEU E 397 7.629
76.123 0.000 1.00 37.99 E ATOM 3315 CG LEU E 397 9.079 76.179
-0.432 1.00 31.14 E ATOM 3316 CD1 LEU E 397 9.839 75.035 0.159 1.00
35.00 E ATOM 3317 CD2 LEU E 397 9.131 76.124 -1.929 1.00 40.62 E
ATOM 3318 C LEU E 397 5.330 77.103 -0.173 1.00 41.49 E ATOM 3319 O
LEU E 397 4.520 76.450 -0.799 1.00 49.39 E ATOM 3320 N LYS E 398
5.013 77.767 0.928 1.00 37.15 E ATOM 3321 CA LYS E 398 3.675 77.742
1.473 1.00 39.00 E ATOM 3322 CB LYS E 398 3.724 78.275 2.904 1.00
43.96 E ATOM 3323 CG LYS E 398 2.869 77.504 3.889 1.00 52.32 E ATOM
3324 CD LYS E 398 3.114 75.996 3.792 1.00 59.84 E ATOM 3325 CE LYS
E 398 1.853 75.225 4.218 1.00 65.06 E ATOM 3326 NZ LYS E 398 1.812
73.819 3.706 1.00 68.83 E ATOM 3327 C LYS E 398 2.709 78.571 0.613
1.00 44.04 E ATOM 3328 O LYS E 398 1.513 78.308 0.579 1.00 47.81 E
ATOM 3329 N LEU E 399 3.244 79.569 -0.084 1.00 50.06 E ATOM 3330 CA
LEU E 399 2.476 80.464 -0.947 1.00 42.86 E ATOM 3331 CB LEU E 399
3.303 81.714 -1.247 1.00 43.06 E ATOM 3332 CG LEU E 399 2.649
82.840 -2.039 1.00 42.04 E ATOM 3333 CD1 LEU E 399 1.534 83.421
-1.201 1.00 37.94 E ATOM 3334 CD2 LEU E 399 3.653 83.902 -2.378
1.00 24.82 E ATOM 3335 C LEU E 399 2.181 79.749 -2.246 1.00 43.34 E
ATOM 3336 O LEU E 399 1.043 79.720 -2.717 1.00 48.77 E ATOM 3337 N
LYS E 400 3.240 79.194 -2.826 1.00 45.96 E ATOM 3338 CA LYS E 400
3.174 78.444 -4.078 1.00 49.43 E ATOM 3339 CB LYS E 400 4.580
78.113 -4.567 1.00 47.72 E ATOM 3340 CG LYS E 400 5.514 79.302
-4.753 1.00 47.05 E ATOM 3341 CD LYS E 400 6.930 78.752 -4.789 1.00
55.17 E ATOM 3342 CE LYS E 400 8.009 79.787 -5.015 1.00 51.25 E
ATOM 3343 NZ LYS E 400 9.325 79.087 -4.846 1.00 53.55 E ATOM 3344 C
LYS E 400 2.451 77.140 -3.797 1.00 49.29 E ATOM 3345 O LYS E 400
2.167 76.359 -4.698 1.00 48.52 E ATOM 3346 N ASN E 401 2.159 76.926
-2.523 1.00 49.33 E ATOM 3347 CA ASN E 401 1.494 75.722 -2.051 1.00
51.53 E ATOM 3348 CB ASN E 401 0.045 75.690 -2.502 1.00 53.59 E
ATOM 3349 CG ASN E 401 -0.762 74.657 -1.740 1.00 60.06 E ATOM 3350
OD1 ASN E 401 -1.768 74.151 -2.237 1.00 56.19 E ATOM 3351 ND2 ASN E
401 -0.326 74.342 -0.512 1.00 62.85 E ATOM 3352 C ASN E 401 2.187
74.426 -2.497 1.00 50.38 E ATOM 3353 O ASN E 401 1.641 73.654
-3.279 1.00 47.98 E ATOM 3354 N ARG E 402 3.395 74.201 -1.989 1.00
49.15 E ATOM 3355 CA ARG E 402 4.169 73.017 -2.301 1.00 50.62 E
ATOM 3356 CB ARG E 402 5.515 73.416 -2.866 1.00 56.48 E ATOM 3357
CG ARG E 402 5.397 74.361 -4.038 1.00 64.09 E ATOM 3358 CD ARG E
402 6.740 74.500 -4.694 1.00 71.64 E ATOM 3359 NE ARG E 402 7.126
73.261 -5.359 1.00 72.37 E ATOM 3360 CZ ARG E 402 8.352 73.003
-5.806 1.00 73.62 E ATOM 3361 NH1 ARG E 402 9.320 73.904 -5.649
1.00 65.04 E ATOM 3362 NH2 ARG E 402 8.601 71.849 -6.424 1.00 73.00
E ATOM 3363 C ARG E 402 4.334 72.356 -0.965 1.00 53.42 E ATOM 3364
O ARG E 402 4.430 73.057 0.040 1.00 57.21 E ATOM 3365 N LYS E 403
4.362 71.020 -0.951 1.00 54.79 E ATOM 3366 CA LYS E 403 4.461
70.238 0.293 1.00 52.75 E ATOM 3367 CB LYS E 403 4.269 68.743 0.006
1.00 53.56 E ATOM 3368 CG LYS E 403 2.871 68.363 -0.456 1.00 68.79
E ATOM 3369 CD LYS E 403 2.804 66.872 -0.808 1.00 77.87 E ATOM 3370
CE LYS E 403 1.437 66.457 -1.360 1.00 79.58 E ATOM 3371 NZ LYS E
403 1.277 64.966 -1.360 1.00 81.94 E ATOM 3372 C LYS E 403 5.718
70.399 1.142 1.00 49.96 E ATOM 3373 O LYS E 403 6.812 69.931 0.764
1.00 46.03 E ATOM 3374 N VAL E 404 5.556 71.058 2.291 1.00 38.89 E
ATOM 3375 CA VAL E 404 6.672 71.223 3.205 1.00 40.29 E ATOM 3376 CB
VAL E 404 6.693 72.581 3.922 1.00 41.80 E ATOM 3377 CG1 VAL E 404
8.022 72.711 4.686 1.00 24.81 E ATOM 3378 CG2 VAL E 404 6.448
73.735 2.944 1.00 39.16 E ATOM 3379 C VAL E 404 6.427 70.189 4.293
1.00 48.27 E ATOM 3380 O VAL E 404 5.442 70.290 5.020 1.00 55.74 E
ATOM 3381 N PRO E 405 7.325 69.197 4.440 1.00 45.50 E ATOM 3382 CD
PRO E 405 8.679 69.161 3.858 1.00 42.67 E ATOM 3383 CA PRO E 405
7.173 68.154 5.463 1.00 40.57 E ATOM 3384 CB PRO E 405 8.572 67.580
5.571 1.00 41.08 E ATOM 3385 CG PRO E 405 9.123 67.780 4.203 1.00
40.01 E ATOM 3386 C PRO E 405 6.698 68.714 6.803 1.00 45.93 E ATOM
3387 O PRO E 405 7.339 69.593 7.386 1.00 46.37 E ATOM 3388 N SER E
406 5.586 68.195 7.304 1.00 52.64 E ATOM 3389 CA SER E 406 5.045
68.680 8.568 1.00 57.41 E ATOM 3390 CB SER E 406 3.901 67.787 9.032
1.00 56.58 E ATOM 3391 OG SER E 406 3.121 68.480 9.988 1.00 67.22 E
ATOM 3392 C SER E 406 6.085 68.814 9.693 1.00 59.81 E ATOM 3393 O
SER E 406 6.068 69.798 10.438 1.00 63.18 E ATOM 3394 N PHE E 407
6.983 67.837 9.819 1.00 57.14 E ATOM 3395 CA PHE E 407 8.013 67.877
10.853 1.00 51.13 E ATOM 3396 CB PHE E 407 9.027 66.751 10.625 1.00
48.43 E ATOM 3397 CG PHE E 407 10.186 66.743 11.610 1.00 50.11 E
ATOM 3398 CD1 PHE E 407 9.961 66.780 12.990 1.00 47.64 E ATOM 3399
CD2 PHE E 407 11.501 66.629 11.156 1.00 49.90 E ATOM 3400 CE1 PHE E
407 11.019 66.693 13.891 1.00 37.99 E ATOM 3401 CE2 PHE E 407
12.559 66.544 12.052 1.00 52.16 E ATOM 3402 CZ PHE E 407 12.314
66.574 13.425 1.00 44.66 E ATOM 3403 C PHE E 407 8.722 69.225
10.820 1.00 49.58 E ATOM 3404 O PHE E 407 8.924 69.855 11.868 1.00
48.50 E ATOM 3405 N LEU E 408 9.087 69.650 9.606 1.00 46.20 E ATOM
3406 CA LEU E 408 9.788 70.907 9.376 1.00 46.76 E ATOM 3407 CB LEU
E 408 10.269 70.977 7.928 1.00 40.00 E ATOM 3408 CG LEU E 408
11.276 69.905 7.527 1.00 38.59 E ATOM 3409 CD1 LEU E 408 11.706
70.112 6.089 1.00 40.41 E ATOM 3410 CD2 LEU E 408 12.468 69.961
8.439 1.00 37.21 E ATOM 3411 C LEU E 408 8.920 72.125 9.701 1.00
52.01 E ATOM 3412 O LEU E 408 9.408 73.132 10.233 1.00 55.68 E ATOM
3413 N GLU E 409 7.634 72.043 9.382 1.00 49.74 E ATOM 3414 CA GLU E
409 6.746 73.145 9.684 1.00 50.76 E ATOM 3415 CB GLU E 409 5.387
72.879 9.039 1.00 52.54 E ATOM 3416 CG GLU E 409 5.512 72.621 7.526
1.00 65.10 E ATOM 3417 CD GLU E 409 4.191 72.709 6.761 1.00 69.80 E
ATOM 3418 OE1 GLU E 409 3.226 71.997 7.120 1.00 74.10 E ATOM 3419
OE2 GLU E 409 4.122 73.489 5.788 1.00 71.29 E ATOM 3420 C GLU E 409
6.663 73.266 11.214 1.00 51.62 E ATOM 3421 O GLU E 409 6.819 74.348
11.775 1.00 47.23 E ATOM 3422 N GLU E 410 6.465 72.130 11.876 1.00
53.40 E ATOM 3423 CA GLU E 410 6.371 72.044 13.335 1.00 52.41 E
ATOM 3424 CB GLU E 410 6.220 70.583 13.768 1.00 56.30 E ATOM 3425
CG GLU E 410 5.008 69.847 13.207 1.00 63.66 E ATOM 3426 CD GLU E
410 5.119 68.337 13.360 1.00 65.12 E ATOM 3427 OE1 GLU E 410 4.133
67.627 13.076 1.00 57.01 E ATOM 3428 OE2 GLU E 410 6.202 67.856
13.755 1.00 75.09 E ATOM 3429 C GLU E 410 7.591 72.599 14.060 1.00
50.63 E ATOM 3430 O GLU E 410 7.465 73.224 15.109 1.00 51.62 E ATOM
3431 N ILE E 411 8.774 72.351 13.508 1.00 44.17 E ATOM 3432 CA ILE
E 411 10.016 72.788 14.147 1.00 42.52 E ATOM 3433 CB ILE E 411
11.178 71.838 13.803 1.00 29.79 E ATOM 3434 CG2 ILE E 411 12.472
72.388 14.324 1.00 19.62 E ATOM 3435 CG1 ILE E 411 10.885 70.464
14.389 1.00 26.63 E ATOM 3436 CD1 ILE E 411 12.014 69.562 14.352
1.00 32.83 E ATOM 3437 C ILE E 411 10.455 74.198 13.838 1.00 47.45
E ATOM 3438 O ILE E 411 10.963 74.908 14.710 1.00 45.98 E ATOM 3439
N TRP E 412 10.266 74.596 12.587 1.00 50.84 E ATOM 3440 CA TRP E
412 10.638 75.928 12.158 1.00 47.10 E ATOM 3441 CB TRP E 412 11.106
75.897 10.714 1.00 31.01 E ATOM 3442 CG TRP E 412 12.357 75.111
10.520 1.00 29.88 E ATOM 3443 CD2 TRP E 412 12.802 74.514 9.306
1.00 30.53 E ATOM 3444 CE2 TRP E 412 14.074 73.964 9.554 1.00 29.64
E ATOM 3445 CE3 TRP E 412 12.242 74.378 8.030 1.00 31.08 E ATOM
3446 CD1 TRP E 412 13.356 74.909 11.431 1.00 29.83 E ATOM 3447 NE1
TRP E 412 14.391 74.226 10.858 1.00 26.29 E ATOM 3448 CZ2 TRP E 412
14.804 73.304 8.568 1.00 30.77 E ATOM 3449 CZ3 TRP E 412 12.972
73.721 7.051 1.00 33.89 E ATOM 3450 CH2 TRP E 412 14.235 73.184
7.328 1.00 34.12 E ATOM 3451 C TRP E 412 9.470 76.872 12.287 1.00
53.01 E ATOM 3452 O TRP E 412 9.598 78.044 11.975 1.00 59.24 E ATOM
3453 N ASP E 413 8.334 76.356 12.749 1.00 60.21 E ATOM 3454 CA ASP
E 413 7.127 77.155 12.904 1.00 65.98 E ATOM 3455 CB ASP E 413 7.357
78.308 13.886 1.00 65.12 E ATOM 3456 CG ASP E 413 7.976 77.848
15.206 1.00 73.02 E ATOM 3457 OD1 ASP E 413 7.517 76.827 15.778
1.00 69.22 E ATOM 3458 OD2 ASP E 413 8.918 78.522 15.682 1.00 71.14
E ATOM 3459 C ASP E 413 6.800 77.709 11.529 1.00 73.27 E ATOM 3460
O ASP E 413 6.734 78.919 11.332 1.00 79.88 E ATOM 3461 N VAL E 414
6.617 76.810 10.572 1.00 78.65 E ATOM 3462 CA VAL E 414 6.313
77.195 9.201 1.00 83.57 E ATOM 3463 CB VAL E 414 7.148 76.388 8.201
1.00 81.07 E ATOM 3464 CG1 VAL E 414 6.874 76.876 6.782 1.00 78.91
E ATOM 3465 CG2 VAL E 414 8.605 76.474 8.565 1.00 83.03 E ATOM 3466
C VAL E 414 4.861 76.936 8.841 1.00 91.08 E ATOM 3467 O VAL E 414
4.515 75.832 8.421 1.00 98.61 E ATOM 3468 N VAL E 415 3.998 77.924
9.002 1.00 93.34 E ATOM 3469 CA VAL E 415 2.611 77.707 8.614 1.00
94.81 E ATOM 3470 CB VAL E 415 1.706 77.355 9.848 1.00 90.47 E ATOM
3471 CG1 VAL E 415 1.624 75.834 10.020 1.00 78.74 E ATOM 3472 CG2
VAL E 415 2.269 77.985 11.119 1.00 82.74 E ATOM 3473 C VAL E 415
2.101 78.944 7.876 1.00 97.73 E ATOM 3474 O VAL E 415 2.139 78.927
6.624 1.00 97.64 E ATOM 3475 OXT VAL E 415 1.716 79.926 8.541 1.00
98.46 E ATOM 3476 O1 PON A 1 21.880 64.675 1.836 1.00 39.29 A ATOM
3477 O2 PON A 1 19.250 68.890 4.074 1.00 49.48 A ATOM 3478 O3 PON A
1 24.588 66.480 7.635 1.00 41.10 A ATOM 3479 O4 PON A 1 24.235
64.175 5.968 1.00 45.83 A ATOM 3480 O6 PON A 1 18.231 74.846 1.917
1.00 33.99 A ATOM 3481 O7 PON A 1 20.248 73.129 1.273 1.00 33.86 A
ATOM 3482 C1 PON A 1 24.365 67.114 5.289 1.00 35.43 A ATOM 3483 C2
PON A 1 23.687 66.508 6.523 1.00 38.34 A ATOM 3484 C3 PON A 1
23.150 65.064 6.265 1.00 36.40 A ATOM 3485 C4 PON A 1 22.176 65.084
5.024 1.00 33.74 A ATOM 3486 C5 PON A 1 22.927 65.679 3.758 1.00
31.18 A ATOM 3487 C6 PON A 1 21.955 65.657 2.563 1.00 33.89 A ATOM
3488 C7 PON A 1 21.097 66.795 2.300 1.00 28.82 A ATOM 3489 C8 PON A
1 21.130 67.924 3.082 1.00 37.62 A ATOM 3490 C9 PON A 1 22.125
68.074 4.307 1.00 31.36 A ATOM 3491 C10 PON A 1 23.441 67.156 4.046
1.00 29.60 A ATOM 3492 C11 PON A 1 22.560 69.547 4.592 1.00 32.32 A
ATOM 3493 C12 PON A 1 21.489 70.626 4.357 1.00 38.09 A ATOM 3494
C13 PON A 1 20.762 70.529 2.973 1.00 36.47 A ATOM 3495 C14 PON A 1
20.134 69.048 2.915 1.00 39.30 A ATOM 3496 C15 PON A 1 19.155
69.066 1.737 1.00 40.89 A ATOM 3497 C16 PON A 1 18.747 70.529 1.546
1.00 39.22 A ATOM 3498 C17 PON A 1 19.416 71.300 2.743 1.00 35.47 A
ATOM 3499 C18 PON A 1 21.769 70.748 1.787 1.00 32.19 A ATOM 3500
C19 PON A 1 24.255 67.664 2.827 1.00 24.46 A ATOM 3501 C20 PON A 1
19.466 72.863 2.472 1.00 35.95 A ATOM 3502 C21 PON A 1 20.120
73.624 3.669 1.00 36.02 A ATOM 3503 C22 PON A 1 18.054 73.441 2.175
1.00 32.10 A ATOM 3504 C23 PON A 1 16.966 73.306 3.300 1.00 27.82
A
ATOM 3505 C24 PON A 1 15.596 73.682 2.708 1.00 19.20 A ATOM 3506
C25 PON A 1 14.375 73.327 3.427 1.00 28.59 A ATOM 3507 C26 PON A 1
13.612 72.211 2.623 1.00 27.63 A ATOM 3508 C27 PON A 1 13.497
74.515 3.656 1.00 26.34 A ATOM 3509 P PO4 1 20.235 86.852 20.495
1.00 30.27 ATOM 3510 O1 PO4 1 20.367 87.795 21.734 1.00 30.23 ATOM
3511 O2 PO4 1 21.496 86.086 20.199 1.00 24.49 ATOM 3512 O3 PO4 1
19.795 87.730 19.291 1.00 36.16 ATOM 3513 O4 PO4 1 19.068 85.895
20.750 1.00 32.97 ATOM 3514 P PO4 2 39.059 93.718 35.395 1.00 78.13
ATOM 3515 O1 PO4 2 40.205 94.770 35.302 1.00 80.90 ATOM 3516 O2 PO4
2 39.127 92.675 34.321 1.00 73.64 ATOM 3517 O3 PO4 2 37.709 94.500
35.366 1.00 80.87 ATOM 3518 O4 PO4 2 39.152 93.072 36.788 1.00
87.72 ATOM 3519 P PO4 3 15.547 99.875 0.242 1.00 66.29 ATOM 3520 O1
PO4 3 14.096 99.637 -0.237 1.00 69.21 ATOM 3521 O2 PO4 3 16.172
98.596 0.756 1.00 58.29 ATOM 3522 O3 PO4 3 15.467 101.019 1.344
1.00 49.78 ATOM 3523 O4 PO4 3 16.339 100.404 -1.015 1.00 64.10 ATOM
3524 P PO4 4 20.453 67.865 -11.707 1.00 75.67 ATOM 3525 O1 PO4 4
20.348 66.382 -12.180 1.00 76.23 ATOM 3526 O2 PO4 4 20.722 67.960
-10.231 1.00 79.04 ATOM 3527 O3 PO4 4 19.108 68.571 -12.112 1.00
66.80 ATOM 3528 O4 PO4 4 21.613 68.530 -12.504 1.00 62.79 END
[0342]
Sequence CWU 1
1
2 1 1248 DNA Bemisia tabaci 1 atgtcttcgg gcagctacga cccttatagt
cccaccaatg gaagaatagg gaaagaagag 60 ctttcgccgg cgaatagttt
gaacgggtac agcgtggata gctgcgatgc gtcgcggaag 120 aagaagggag
gcacgggtcg gcagcaggag gagctgtgtc tcgtctgcgg ggaccgcgcc 180
tccggctacc actacaacgc cctcacctgc gaaggctgca agggcttctt ccgtcggagc
240 atcaccaaga atgccgtcta ccagtgtaaa tatggaaata attgtgaaat
cgacatgtac 300 atgaggcgaa aatgccagga gtgtcgtctc aagaagtgtc
tcagcgttgg catgaggcca 360 gaatgtgtag ttcccgaatt ccagtgtgct
gtgaagcgaa aagagaaaaa agcgcaaaag 420 gacaaagata aacctaactc
aacgacgagt tgttctccag atggaatcaa acaagagata 480 gatcctcaaa
ggctggatac agattcgcag ctattgtctg taaatggagt taaacccatt 540
actccagagc aagaagagct catccatagg ctagtttatt ttcaaaatga atatgaacat
600 ccatccccag aggatatcaa aaggatagtt aatgctgcac cagaagaaga
aaatgtagct 660 gaagaaaggt ttaggcatat tacagaaatt acaattctca
ctgtacagtt aattgtggaa 720 ttttctaagc gattacctgg ttttgacaaa
ctaattcgtg aagatcaaat agctttatta 780 aaggcatgta gtagtgaagt
aatgatgttt agaatggcaa ggaggtatga tgctgaaaca 840 gattcgatat
tgtttgcaac taaccagccg tatacgagag aatcatacac tgtagctggc 900
atgggtgata ctgtggagga tctgctccga ttttgtcgac atatgtgtgc catgaaagtc
960 gataacgcag aatatgctct tctcactgcc attgtaattt tttcagaacg
accatctcta 1020 agtgaaggct ggaaggttga gaagattcaa gaaatttaca
tagaagcatt aaaagcatat 1080 gttgaaaatc gaaggaaacc atatgcaaca
accatttttg ctaagttact atctgtttta 1140 actgaactac gaacattagg
gaatatgaat tcagaaacat gcttctcatt gaagctgaag 1200 aatagaaagg
tgccatcctt cctcgaggag atttgggatg ttgtttca 1248 2 416 PRT Bemisia
tabaci 2 Met Ser Ser Gly Ser Tyr Asp Pro Tyr Ser Pro Thr Asn Gly
Arg Ile 1 5 10 15 Gly Lys Glu Glu Leu Ser Pro Ala Asn Ser Leu Asn
Gly Tyr Ser Val 20 25 30 Asp Ser Cys Asp Ala Ser Arg Lys Lys Lys
Gly Gly Thr Gly Arg Gln 35 40 45 Gln Glu Glu Leu Cys Leu Val Cys
Gly Asp Arg Ala Ser Gly Tyr His 50 55 60 Tyr Asn Ala Leu Thr Cys
Glu Gly Cys Lys Gly Phe Phe Arg Arg Ser 65 70 75 80 Ile Thr Lys Asn
Ala Val Tyr Gln Cys Lys Tyr Gly Asn Asn Cys Glu 85 90 95 Ile Asp
Met Tyr Met Arg Arg Lys Cys Gln Glu Cys Arg Leu Lys Lys 100 105 110
Cys Leu Ser Val Gly Met Arg Pro Glu Cys Val Val Pro Glu Phe Gln 115
120 125 Cys Ala Val Lys Arg Lys Glu Lys Lys Ala Gln Lys Asp Lys Asp
Lys 130 135 140 Pro Asn Ser Thr Thr Ser Cys Ser Pro Asp Gly Ile Lys
Gln Glu Ile 145 150 155 160 Asp Pro Gln Arg Leu Asp Thr Asp Ser Gln
Leu Leu Ser Val Asn Gly 165 170 175 Val Lys Pro Ile Thr Pro Glu Gln
Glu Glu Leu Ile His Arg Leu Val 180 185 190 Tyr Phe Gln Asn Glu Tyr
Glu His Pro Ser Pro Glu Asp Ile Lys Arg 195 200 205 Ile Val Asn Ala
Ala Pro Glu Glu Glu Asn Val Ala Glu Glu Arg Phe 210 215 220 Arg His
Ile Thr Glu Ile Thr Ile Leu Thr Val Gln Leu Ile Val Glu 225 230 235
240 Phe Ser Lys Arg Leu Pro Gly Phe Asp Lys Leu Ile Arg Glu Asp Gln
245 250 255 Ile Ala Leu Leu Lys Ala Cys Ser Ser Glu Val Met Met Phe
Arg Met 260 265 270 Ala Arg Arg Tyr Asp Ala Glu Thr Asp Ser Ile Leu
Phe Ala Thr Asn 275 280 285 Gln Pro Tyr Thr Arg Glu Ser Tyr Thr Val
Ala Gly Met Gly Asp Thr 290 295 300 Val Glu Asp Leu Leu Arg Phe Cys
Arg His Met Cys Ala Met Lys Val 305 310 315 320 Asp Asn Ala Glu Tyr
Ala Leu Leu Thr Ala Ile Val Ile Phe Ser Glu 325 330 335 Arg Pro Ser
Leu Ser Glu Gly Trp Lys Val Glu Lys Ile Gln Glu Ile 340 345 350 Tyr
Ile Glu Ala Leu Lys Ala Tyr Val Glu Asn Arg Arg Lys Pro Tyr 355 360
365 Ala Thr Thr Ile Phe Ala Lys Leu Leu Ser Val Leu Thr Glu Leu Arg
370 375 380 Thr Leu Gly Asn Met Asn Ser Glu Thr Cys Phe Ser Leu Lys
Leu Lys 385 390 395 400 Asn Arg Lys Val Pro Ser Phe Leu Glu Glu Ile
Trp Asp Val Val Ser 405 410 415
* * * * *