U.S. patent application number 11/634129 was filed with the patent office on 2007-04-26 for rna interference mediating small rna molecules.
This patent application is currently assigned to Max-Planck-Gesellschaft zur Forderung der Wissenschaften e. V.. Invention is credited to Sayda Mahgoub Elbashir, Winfried Lendeckel, Thomas Tuschl.
Application Number | 20070093445 11/634129 |
Document ID | / |
Family ID | 40529293 |
Filed Date | 2007-04-26 |
United States Patent
Application |
20070093445 |
Kind Code |
A1 |
Tuschl; Thomas ; et
al. |
April 26, 2007 |
RNA interference mediating small RNA molecules
Abstract
Double-stranded RNA (dsRNA) induces sequence-specific
post-transcriptional gene silencing in many organisms by a process
known as RNA interference (RNAi). Using a Drosophila in vitro
system, we demonstrate that 19-23 nt short RNA fragments are the
sequence-specific mediators of RNAi. The short interfering RNAs
(siRNAs) are generated by an RNase III-like processing reaction
from long dsRNA. Chemically synthesized siRNA duplexes with
overhanging 3' ends mediate efficient target RNA cleavage in the
lysate, and the cleavage site is located near the center of the
region spanned by the guiding siRNA. Furthermore, we provide
evidence that the direction of dsRNA processing determines whether
sense or antisense target RNA can be cleaved by the produced siRNP
complex.
Inventors: |
Tuschl; Thomas; (New York,
NY) ; Elbashir; Sayda Mahgoub; (Cambridge, MA)
; Lendeckel; Winfried; (Hohengandern, DE) |
Correspondence
Address: |
ROTHWELL, FIGG, ERNST & MANBECK, P.C.
1425 K STREET, N.W.
SUITE 800
WASHINGTON
DC
20005
US
|
Assignee: |
Max-Planck-Gesellschaft zur
Forderung der Wissenschaften e. V.
Munchen
DE
|
Family ID: |
40529293 |
Appl. No.: |
11/634129 |
Filed: |
December 6, 2006 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10433050 |
Jul 26, 2004 |
|
|
|
PCT/EP01/13968 |
Nov 29, 2001 |
|
|
|
11634129 |
Dec 6, 2006 |
|
|
|
60279661 |
Mar 30, 2001 |
|
|
|
Current U.S.
Class: |
514/44A ;
435/6.11; 514/81; 536/23.1 |
Current CPC
Class: |
C12N 15/113 20130101;
C12N 2310/53 20130101; C12N 2310/321 20130101; C12N 15/1079
20130101; A61K 38/00 20130101; C12N 15/111 20130101; A61P 35/00
20180101; A61P 37/06 20180101; C12N 2310/14 20130101; A61P 37/02
20180101; A61K 9/0019 20130101; A01K 2217/075 20130101; A61P 31/12
20180101; C12N 2330/30 20130101; A61K 48/00 20130101; A61P 43/00
20180101; A61P 37/00 20180101; C12N 2310/321 20130101; C12N
2310/3521 20130101 |
Class at
Publication: |
514/044 ;
514/081; 536/023.1; 435/006 |
International
Class: |
A61K 48/00 20060101
A61K048/00; C07H 21/02 20060101 C07H021/02; C12Q 1/68 20060101
C12Q001/68 |
Foreign Application Data
Date |
Code |
Application Number |
Dec 1, 2000 |
EP |
00126325.0 |
Claims
1. Isolated double-stranded RNA molecule, wherein each RNA strand
has a length from 19-25 nucleotides, wherein said RNA molecule is
capable of target-specific nucleic acid modifications.
2. The RNA molecule of claim 1 wherein at least one strand has a
3'-overhang from 1-5 nucleotides.
3. The RNA molecule of claim 1 capable of target-specific RNA
interference and/or DNA methylation.
4. The RNA molecule of claim 1, wherein each strand has a length
from 19-23, particularly from 20-22 nucleotides.
5. The RNA molecule of claim 2, wherein the 3'-overhang is from 1-3
nucleotides.
6. The RNA molecule of claim 2, wherein the 3'-overhang is
stabilized against degradation.
7. The RNA molecule of claim 1, which contains at least one
modified nucleotide analogue.
8. The RNA molecule of claim 7, wherein the modified nucleotide
analogue is selected from sugar- or backbone modified
ribonucleotides.
9. The RNA molecule according to claim 7, wherein the nucleotide
analogue is a sugar-modified ribonucleotide, wherein the 2'-OH
group is replaced by a group selected from H, OR, R, halo, SH,
SR.sup.1, NH.sub.2, NHR, NR.sub.2 or CN, wherein R is
C.sub.1-C.sub.6 alkyl, alkenyl or alkynyl and halo is F, Cl, Br or
I.
10. The RNA molecule of claim 7, wherein the nucleotide analogue is
a backbone-modified ribonucleotide containing a phosphothioate
group.
11. The RNA molecule of claim 1, which has a sequence having an
identity of at least 50 percent to a predetermined mRNA target
molecule.
12. The RNA molecule of claim 11, wherein the identity is at least
70 percent.
13. A method of preparing a double-stranded RNA molecule of claim 1
comprising the steps: (a) synthesizing two RNA strands each having
a length from 19-25 nucleotides, wherein said RNA strands are
capable of forming a double-stranded RNA molecule, (b) combining
the synthesized RNA strands under conditions, wherein a
double-stranded RNA molecule is formed, which is capable of
target-specific nucleic acid modifications.
14. The method of claim 13, wherein the RNA strands are chemically
synthesized.
15. The method of claim 13, wherein the RNA strands are
enzymatically synthesized.
16. A method of mediating target-specific nucleic acid
modifications in a cell or an organism comprising the steps: (a)
contacting said cell or organism with the double-stranded RNA
molecule of claim 1 under conditions wherein target-specific
nucleic acid modifications can occur, and (b) mediating a
target-specific nucleic acid modification effected by the
double-stranded RNA towards a target nucleic acid having a sequence
portion substantially corresponding to the double-stranded RNA.
17. The method of claim 16, wherein the nucleic acid modification
is RNA interference and/or DNA methylation.
18. The method of claim 16, wherein said contacting comprises
introducing said double-stranded RNA molecule into a target cell in
which the target-specific nucleic acid modification can occur.
19. The method of claim 18 wherein the introducing comprises a
carrier-mediated delivery or injection.
20. Use of the method of claim 16 or determining the function of a
gene in a cell or an organism.
21. Use of the method of claim 16 for modulating the function of a
gene in a cell or an organism.
22. The use of claim 20, wherein the gene is associated with a
pathological condition.
23. The use of claim 22, wherein the gene is a pathogen-associated
gene.
24. The use of claim 23, wherein the gene is a viral gene.
25. The use of claim 22, wherein the gene is a tumor-associated
gene.
26. The use of claim 22, wherein the gene is an autoimmune
disease-associated gene.
27. Pharmaceutical composition containing as an active agent at
least one double-stranded RNA molecule of claim 1 and a
pharmaceutical carrier.
28. The composition of claim 27 for diagnostic applications.
29. The composition of claim 27 for therapeutic applications.
Description
[0001] The present invention relates to sequence and structural
features of double-stranded (ds)RNA molecules required to mediate
target-specific nucleic acid modifications such as RNA-interference
and/or DNA methylation.
[0002] The term "RNA interference" (RNAi) was coined after the
discovery that injection of dsRNA into the nematode C. elegans
leads to specific silencing of genes highly homologous in sequence
to the delivered dsRNA (Fire et al., 1998). RNAi was subsequently
also observed in insects, frogs (Oelgeschlager et al., 2000), and
other animals including mice (Svoboda et al., 2000; Wianny and
Zernicka-Goetz, 2000) and is likely to also exist in human. RNAi is
closely linked to the post-transcriptional gene-silencing (PTGS)
mechanism of co-suppression in plants and quelling in fungi
(Catalanotto et al., 2000; Cogoni and Macino, 1999; Dalmay et al.,
2000; Ketting and Plasterk, 2000; Mourrain et al., 2000; Smardon et
al., 2000) and some components of the RNAi machinery are also
necessary for post-transcriptional silencing by co-suppression
(Catalanotto et al., 2000; Dernburg et al., 2000; ketting and
Plasterk, 2000). The topic has also been reviewed recently (Bass,
2000; Bosher and Labouesse, 2000; Fire, 1999; Plasterk and.
Ketting, 2000; Sharp, 1999; Sijen and Kooter, 2000), see also the
entire issue of Plant Molecular Biology, vol. 43, issue 2/3,
(2000).
[0003] In plants in addition. to PTGS, introduced transgenes can
also lead to transcriptional gene silencing via RNA-directed DNA
methylation of cytosines (see references in Wassenegger, 2000).
Genomic targets as short as 30 bp are methylated in plants in an.
RNA-directed manner (Pelissier, 2000). DNA methylation is also
present in mammals.
[0004] The natural function of RNAi and co-suppression appears to
be protection of the genome against invasion by mobile genetic
elements such as retro-transposons and viruses which produce
aberrant RNA or dsRNA in the host cell when they become active
(Jensen et al, 1999; Ketting et al., 1999; Ratcliff et al., 1999;
Tabara et al., 1999). Specific MRNA degradation prevents transposon
and virus replication although some viruses are able to overcome or
prevent this process by expressing proteins that suppress PTGS
(Lucy et al., 2000; Voinnet et al., 2000).
[0005] DsRNA triggers the specific degradation of homologous RNAs
only within the region of identity with the dsRNA (Zamore et al.,
2000). The dsRNA is processed to 21-23 nt RNA fragments and the
target. RNA cleavage sites are regularly spaced 21-23 nt apart. It
has therefore been suggested that the 21-23 nt fragments are the
guide RNAs for target recognition (Zamore et al., 2000). These
short RNAs were also detected in extracts prepared from D.
melanogaster Schneider 2 cells which were transfected with dsRNA
prior to cell lysis (Hammond et al., 2000), however, the fractions
that displayed sequence-specific nuclease activity also contained a
large fraction of residual dsRNA. The role of the 21-23 nt
fragments in guiding mRNA cleavage is further supported by the
observation that 21-23 nt fragments isolated from processed dsRNA
are able, to some extent, to mediate specific mRNA degradation
(Zamore et al., 2000). RNA molecules of similar size also
accumulate in plant tissue that exhibits PTGS (Hamilton and
Baulcombe, 1999).
[0006] Here, we use the established Drosophila in vitro system
(Tuschl et al., 1999; Zamore et al., 2000) to further explore the
mechanism of RNAi. We demonstrate that short 21 and 22 nt RNAs,
when base-paired with 3' overhanging ends, act as the guide RNAs
for sequence-specific mRNA degradation. Short 30 bp dsRNAs are
unable to mediate RNAi in this system because they are no longer
processed to 21 and 22 nt RNAs. Furthermore, we defined the target
RNA cleavage sites relative to the 21 and 22 nt short interfering
RNAs (siRNAs) and provide evidence that the direction of dsRNA
processing determines whether a sense or an antisense target RNA
can be cleaved by the produced siRNP endonuclease complex. Further,
the siRNAs may also be important tools for transcriptional
modulating, e.g. silencing of mammalian genes by guiding DNA
methylation.
[0007] Further experiments in human in vivo cell culture systems
(HeLa cells) show that double-stranded RNA molecules having a
length of preferably from 19-25 nucleotides have RNAi activity.
Thus, in contrast to the results from Drosophila also 24 and 25 nt
long double-stranded RNA molecules are efficient for RNAi.
[0008] The object underlying the present invention is to provide
novel agents capable of mediating target-specific RNA interference
or other target-specific nucleic acid modifications such as DNA
methylation, said agents having an improved efficacy and safety
compared to prior art agents.
[0009] The solution of this problem is provided by an isolated
double-stranded RNA molecule, wherein each RNA strand has a
length-from. 19-25, particularly from 19-23 nucleotides, wherein
said RNA molecule is capable of mediating target-specific nucleic
acid modifications, particularly RNA interference and/or DNA
methylation. Preferably at least one strand has a 3' overhang from
1-5 nucleotides, more preferably from 1-3 nucleotides and most
preferably 2 nucleotides. The other strand may be blunt-ended or
has up to 6 nucleotides 3' overhang. Also, if both strands of the
dsRNA are exactly 21 or 22 nt, it is possible to observe some RNA
interference when both ends are blunt (0 nt overhang). The RNA
molecule is preferably a synthetic RNA molecule which is
substantially free from contaminants occurring in cell extracts,
e.g. from Drosophila embryos. Further, the RNA molecule is
preferably substantially free from any non-target-specific
contaminants, particularly non-target-specific RNA molecules e.g.
from contaminants occurring in cell extracts.
[0010] Further, the invention relates to the use of isolated
double-stranded RNA molecules, wherein each RNA strand has a length
from 19-25 nucleotides, for mediating, target-specific nucleic acid
modifications, particularly RNAi, in mammalian cells, particularly
in human cells.
[0011] Surprisingly, it was found that synthetic short
double-stranded RNA molecules particularly with overhanging 3'-ends
are sequence-specific mediators of RNAi and mediate efficient
target-RNA cleavage, wherein the cleavage site is located near the
center of the region spanned by the guiding short RNA.
[0012] Preferably, each strand of the RNA molecule has a length
from 20-22 nucleotides (or 20-25 nucleotides in mammalian cells),
wherein the length of each strand may be the same or different.
Preferably, the length of the 3'-overhang reaches from 1-3
nucleotides, wherein the length of the overhang may be the same or
different for each strand. The RNA-strands preferably have
3'-hydroxyl groups. The 5'-terminus preferably comprises a
phosphate, diphosphate, triphosphate or hydroxyl group. The most
effective dsRNAs are composed of two 21 nt strands which are paired
such that 1-3, particularly 2 nt 3' overhangs are present on both
ends of the dsRNA.
[0013] The target RNA cleavage reaction guided by siRNAs is highly
sequence-specific. However, not all positions of a siRNA contribute
equally to target recognition. Mismatches in the center of the
siRNA duplex are most critical and essentially abolish target RNA
cleavage. In contrast, the 3' nucleotide of the siRNA strand (e.g.
position 21) that is complementary to the single-stranded target
RNA, does not contribute to specificity of the target recognition.
Further, the sequence of the unpaired 2-nt 3' overhang of the siRNA
strand with the same polarity as the target RNA is not critical for
target RNA cleavage as only the antisense siRNA strand guides
target recognition. Thus, from the single-stranded overhanging
nucleotides only the penultimate position of the antisense siRNA
(e.g. position 20) needs to match the targeted sense mRNA.
[0014] Surprisingly, the double-stranded RNA molecules of the
present invention exhibit a high in vivo stability in serum or in
growth medium for cell cultures. In order to further enhance the
stability, the 3'-overhangs may be stabilized against degradation,
e.g. they may be selected such that they consist of purine
nucleotides, particularly adenosine or guanosine nucleotides.
Alternatively, substitution of pyrimidine nucleotides by modified
analogues, e.g. substitution of uridine 2 nt 3' overhangs by
2'-deoxythymidine is tolerated and does not affect the efficiency
of RNA interference. The absence of a 2' hydroxyl significantly
enhances the nuclease resistance of the overhang in tissue culture
medium.
[0015] In an especially preferred embodiment of the present
invention the RNA molecule may contain at least one modified
nucleotide analogue. The nucleotide analogues may be located at
positions where the target-specific activity, e.g. the RNAi
mediating activity is not substantially effected, e.g. in a region
at the 5'-end and/or the 3'-end of the double-stranded RNA
molecule. Particularly, the overhangs may be stabilized by
incorporating modified nucleotide analogues.
[0016] Preferred nucleotide analogues are selected from sugar- or
backbone-modified ribonucleotides. It should be noted, however,
that also nucleobase-modified ribonucleotides, i.e.
ribonucleotides, containing a non-naturally occurring nucleobase
instead of a naturally occurring nucleobase such as uridines or
cytidines modified at the 5-position, e.g. 5-(2-amino)propyl
uridine, 5-bromo uridine; adenosines and guanosines modified at the
8-position, e.g. 8-bromo guanosine; deaza nucleotides, e.g.
7-deaza-adenosine; O--and N-alkylated nucleotides, e.g. N6-methyl
adenosine are suitable. In preferred sugar-modified ribonucleotides
the 2' OH-group is replaced by a group selected from H, OR, R,
halo, SH, SR, NH.sub.2, NHR, NR.sub.2 or CN, wherein R is
C.sub.1-C.sub.6 alkyl, alkenyl or alkynyl and halo is F, Cl, Br or
I. In preferred backbone-modified ribonucleotides the phosphoester
group connecting to adjacent ribonucleotides is replaced by a
modified group, e.g. of phosphothioate group. It should be noted
that the above modifications may be combined.
[0017] The sequence of the double-stranded RNA molecule of the
present invention has to have a sufficient identity to a nucleic
acid target molecule in order to mediate target-specific RNAi
and/or DNA methylation. Preferably, the sequence has an identity of
at least 50%, particularly of at least 70% to the desired target
molecule in the double-stranded portion of the RNA molecule. More
preferably, the identity is at least 85% and most preferably 100%
in the double-stranded portion of.the RNA molecule. The identity of
a double-stranded RNA molecule to a predetermined nucleic acid
target molecule, e.g. an mRNA target molecule may be determined as
follows: I = n L .times. 100 ##EQU1## wherein I is the identity in
percent, n is the number of identical nucleotides in the
double-stranded portion of the ds RNA and the target and L is the
length of the sequence overlap of the double-stranded portion of
the dsRNA and the target.
[0018] Alternatively, the identity of the double-stranded RNA
molecule to the target sequence may also be defined including the
3' overhang, particularly an overhang having a length from 1-3
nucleotides. In this case the sequence identity is preferably at
least 50%, more preferably at least 70% and most preferably at
least 85% to the target sequence. For example, the nucleotides from
the 3' overhang and up to 2 nucleotides from the 5' and/or 3'
terminus of the double strand may be modified without significant
loss of activity.
[0019] The double-stranded RNA molecule of the invention may be
prepared by a method comprising the steps: [0020] (a) synthesizing
two RNA strands each having a length from 19-25, e.g. from 19-23
nucleotides, wherein said RNA strands are capable of forming a
double-stranded RNA molecule, wherein preferably at least one
strand has a 3'-overhang from 1-5 nucleotides, [0021] (b) combining
the synthesized RNA strands under conditions, wherein a
double-stranded RNA molecule is formed, which is capable of
mediating target-specific nucleic acid modifications, particularly
RNA interference and/or DNA methylation.
[0022] Methods of synthesizing RNA molecules are known in the art.
In this context, it is particularly referred to chemical synthesis
methods as described in Verma and Eckstein (1998).
[0023] The single-stranded RNAs can also be prepared by enzymatic
transcription from synthetic DNA templates or from DNA plasmids
isolated from recombinant bacteria. Typically, phage RNA
polymerases are used such as T7, T3 or SP6 RNA polymerase (Milligan
and Uhlenbeck (1989)).
[0024] A further aspect of the present invention relates to a
method of mediating target-specific nucleic acid modifications,
particularly RNA interference and/or DNA methylation in a cell or
an organism comprising the steps: [0025] (a) contacting the cell or
organism with the double-stranded RNA molecule of the invention
under conditions wherein target-specific nucleic acid modifications
may occur and [0026] (b) mediating a target-specific nucleic acid
modificiation effected by the double-stranded RNA towards a target
nucleic acid having a sequence portion substantially corresponding
to the double-stranded RNA.
[0027] Preferably the contacting step (a) comprises introducing the
double-stranded RNA molecule into a target cell, e.g. an isolated
target cell, e.g. in cell culture, a unicellular microorganism or a
target cell or a plurality of target cells within a multicellular
organism. More preferably, the introducing step comprises a
carrier-mediated delivery, e.g. by liposomal carriers or by
injection.
[0028] The method of the invention may be used for determining the
function of a gene in a cell or an organism or even for modulating
the function of a gene in a cell or an organism, being capable of
mediating RNA interference. The cell is preferably a eukaryotic
cell or a cell line, e.g. a plant cell or an animal cell, such as a
mammalian cell, e.g. an embryonic cell, a pluripotent stem cell, a
tumor cell, e.g. a teratocarcinoma cell or a virus-infected cell.
The organism is preferably a eukaryotic organism, e.g. a plant or
an animal, such as a mammal, particularly a human.
[0029] The target gene to which the RNA molecule of the invention
is directed may be associated with a pathological condition. For
example, the gene may be a pathogen-associated gene, e.g. a viral
gene, a tumor-associated gene or an autoimmune disease-associated
gene. The target gene may also be a heterologous gene expressed in
a recombinant cell or a genetically altered organism. By
determinating or modulating, particularly, inhibiting the function
of such a gene valuable information and therapeutic benefits in the
agricultural field or in the medicine or veterinary medicine field
may be obtained.
[0030] The dsRNA is usually administered as a pharmaceutical
composition. The administration may be carried out by known
methods, wherein a nucleic acid is introduced into a desired target
cell in vitro or in vivo. Commonly used gene transfer techniques
include calcium phosphate, DEAE-dextran, electroporation and
microinjection and viral methods (Graham, F. L. and van der Eb, A.
J. (1973) Virol. 52, 456; McCutchan, J. H. and Pagano, J. S.
(1968), J. Nati. Cancer Inst. 41, 351; Chu, G. et al (1987), Nucl.
Acids Res. 15, 1311; Fraley, R. et al. (1980), J. Biol. Chem. 255,
10431; Capecchi, M. R. (1980), Cell 22, 479). A recent addition to
this arsenal of techniques for the introduction of DNA into cells
is the use of cationic liposomes (Felgner, P. L. et al. (1987),
Proc. Natl. Acad. Sci USA 84, 7413). Commercially available
cationic lipid formulations are e.g. Tfx 50 (Promega) or
Lipofectamin2000 (Life Technologies).
[0031] Thus, the invention also relates to a pharmaceutical
composition containing as an active agent at least one
double-stranded RNA molecule as described above and a
pharmaceutical carrier. The composition may be used for diagnostic
and for therapeutic applications in human medicine or in veterinary
medicine.
[0032] For diagnostic or therapeutic applications, the composition
may be in form of a solution, e.g. an injectable solution, a cream,
ointment, tablet, suspension or the like. The composition may be
administered in any suitable way, e.g. by injection, by oral,
topical, nasal, rectal application etc. The carrier may be any
suitable pharmaceutical carrier. Preferably, a carrier is used,
which is capable of increasing. the efficacy of the RNA molecules
to enter the target-cells. Suitable examples of such carriers are
liposomes, particularly cationic liposomes. A further preferred
administration method is injection.
[0033] A further preferred application of the RNAi method is a
functional analysis of eukaryotic cells, or eukaryotic non-human
organisms, preferably mammalian cells or organisms and most
preferably human cells, e.g. cell lines such as HeLa or 293 or
rodents, e.g. rats and mice. By transfection with suitable
double-stranded RNA molecules which are homologous to a
predetermined target gene or DNA molecules encoding a suitable
double-stranded RNA molecule a specific knockout phenotype can be
obtained in a target cell, e.g. in cell culture or in a target
organism. Surprisingly it was found that the presence of short
double-stranded RNA molecules does not result in an interferon
response from the host cell or host organism.
[0034] Thus, a further subject matter of the invention is a
eukaryotic cell or a eukaryotic non-human organism exhibiting a
target gene-specific knockout phenotype comprising an at least
partially deficient expression of at least one endogeneous
target-gene wherein said cell or organism is transfected with at
least one double-stranded RNA molecule capable of inhibiting the
expression of at least one endogeneous target gene or with a DNA
encoding at least one double stranded RNA molecule capable of
inhibiting the expression of at least one endogeneous target gene.
It should be noted that the present invention allows a
target-specific knockout of several different endogeneous genes due
to the specificity of RNAi.
[0035] Gehe-specific knockout phenotypes of cells or non-human
organisms, particularly of human cells or non-human mammals may be
used in analytic procedures, e.g. in the functional and/or
phenotypical analysis of complex physiological processes such as
analysis of gene expression profiles and/or proteomes. For example,
one may prepare the knock-out phenotypes of human genes in cultured
cells which are assumed to be regulators of alternative splicing
processes. Among these genes are particularly the members of the SR
splicing factor family, e.g. ASF/SF2, SC35, SRp20, SRp40 or SRp55.
Further, the effect of SR proteins on the mRNA profiles of
predetermined alternatively spliced genes such as CD44 may be
analysed. Preferably the analysis is carried out by high-throughput
methods using oligonucleotide based chips.
[0036] Using RNAi based knockout technologies, the expression of an
endogeneous target gene may be inhibited in a target cell or a
target organism.
[0037] The endogeneous gene may be complemented by an exogeneous
target nucleic acid coding for the target protein or a variant or
mutated form of the target protein, e.g. a gene or a cDNA, which
may optionally be fused to a further nucleic acid sequence encoding
a detectable peptide or polypeptide, e.g. an affinity tag,
particularly a multiple affinity tag. Variants or mutated forms of
the target gene differ from the endogeneous target gene in that
they encode a gene product which differs from the endogeneous gene
product on the amino acid level by substitutions, insertions and/or
deletions of single or multiple amino acids. The variants or
mutated forms may have the same biological activity as the
endogeneous target gene. On the other hand, the variant or mutated
target gene may also have a biblogical activity, which differs from
the biological activity of the endogeneous target gene, e.g. a
partially deleted activity, a completely deleted activity, an
enhanced activity etc.
[0038] The complementation may be accomplished by coexpressing the
polypeptide encoded by the exogeneous nucleic acid, e.g. a fusion
protein comprising the target protein and the affinity tag and the
double stranded RNA molecule for knocking out the endogeneous gene
in the target cell. This coexpression may be accomplished by using
a suitable expression vector expressing both the polypeptide
encoded by the exogeneous nucleic acid, e.g. the tag-modified
target protein and the double stranded RNA molecule or
alternatively by using a combination of expression vectors.
Proteins and protein complexes which are synthesized de novo in the
target cell will contain the exogeneous gene product, e.g. the
modified fusion protein. In order to avoid suppression of the
exogeneous gene product expression by the RNAi duplex molecule, the
nucleotide sequence encoding the exogeneous nucleic acid may be
altered on the DNA level (with or without causing mutations on the
amino acid level) in the part of the sequence which is homologous
to the double stranded RNA molecule. Alternatively, the endogeneous
target gene may be complemented by corresponding nucleotide
sequences from other species, e.g. from mouse.
[0039] Preferred applications for the cell or organism of the
invention is the analysis of gene expression profiles and/or
proteomes. In an especially preferred embodiment an analysis of a
variant or mutant form of one or several target proteins is carried
out, wherein said variant or mutant forms are reintroduced into the
cell or organism by an exogeneous target nucleic acid as described
above. The combination of knockout of an endogeneous gene and
rescue by using mutated, e.g. partially deleted exogeneous target
has advantages compared to the use of a knockout cell. Further,
this method is particularly suitable for identifying functional
domains of the target protein. In a further preferred embodiment a
comparison, e.g. of gene expression profiles and/or proteomes
and/or phenotypic characteristics of at least two cells or
organisms is carried out. These organisms are selected from: [0040]
(i) a control cell or control organism without target gene
inhibition, [0041] (ii) a cell or organism with target gene
inhibition and [0042] (iii) a cell or organism with target gene
inhibition plus target gene complementation by an exogeneous target
nucleic acid.
[0043] The method and cell of the invention are also suitable in a
procedure for identifying and/or characterizing pharmacological
agents, e.g. identifying new pharmacological agents from a
collection of test substances and/or characterizing mechanisms of
action and/or side effects of known pharmacological agents.
[0044] Thus, the present invention also relates to a system for
identifying and/or characterizing pharmacological agents acting on
at least one target protein comprising: [0045] (a) a eukaryotic
cell or a eukaryotic non-human organism capable of expressing at
least one endogeneous target gene coding for said target protein,
[0046] (b) at least one double-stranded RNA molecule capable of
inhibiting the expression of said at least one endogeneous target
gene, and [0047] (c) a test substance or a collection of test
substances wherein pharmacological properties of said test
substance or said collection are to be identified and/or
characterized.
[0048] Further, the system as described above preferably comprises:
[0049] (d) at least one exogeneous target nucleic acid coding for
the target protein or a variant or mutated form of the target
protein wherein said exogeneous target nucleic acid differs from
the endogeneous target gene on the nucleic acid level such that the
expression of the exogeneous target nucleic acid is substantially
less inhibited by the double stranded RNA molecule than the
expression of the endogeneous target gene.
[0050] Furthermore, the RNA knockout complementation method may be
used for preparative purposes, e.g. for the affinity purification
of proteins or protein complexes from eukaryotic cells,
particularly mammalian cells and more particularly human cells. In
this embodiment of the invention, the exogeneous target nucleic
acid preferably codes for a target protein which is fused to an
affinity tag.
[0051] The preparative method may be employed for the purification
of high molecular weight protein complexes which preferably have a
mass of .gtoreq.150 kD and more preferably of .gtoreq.500 kD and
which optionally may contain nucleic acids such as RNA. Specific
examples are the heterotrimeric protein complex consisting of the
20 kD, 60 kD and 90 kD proteins of the U4/U6 snRNP particle, the
splicing factor SF3b from the 17S U2 snRNP consisting of 5 proteins
having molecular weights of 14, 49, 120, 145 and 155 kD and the 25S
U4/U6/U5 tri-snRNP particle containing the U4, U5 and U6 snRNA
molecules and about 30 proteins, which has a molecular weight of
about 1.7 MD.
[0052] This method is suitable for functional proteome analysis in
mammalian cells, particularly human cells.
[0053] Further, the present invention is explained in more detail
in the following figures and examples.
FIGUGRE LEGENDS
[0054] FIG. 1: Double-stranded RNA as short as 38 bp can mediate
RNAi.
[0055] (A) Graphic representation of dsRNAs used for targeting
Pp-luc mRNA. Three series of blunt-ended dsRNAs covering a range of
29 to 504 bp were prepared. The position of the first nucleotide of
the sense strand of the dsRNA is indicated relative to the start
codon of Pp-luc mRNA (p1). (B) RNA interference assay (Tuschl et
al., 1999). Ratios of target Pp-luc to control Rr-luc activity were
normalized to a buffer control (black bar). DsRNAs (5 nM) were
preincubated in Drosophila lysate for 15 min at 25.degree. C. prior
to the addition of 7-methyl-guanosine-capped Pp-luc and Rr-luc
mRNAs (.about.50 pM). The incubation was continued for another hour
and then analyzed by the dual luciferase assay (Promega). The data
are the average from at least four independent
experiments.+-.standard deviation.
[0056] FIG. 2: A 29 bp dsRNA is no longer processed to 21-23 nt
fragments.
[0057] Time course of 21-23 mer formation from processing of
internally. .sup.32P-labeled dsRNAs (5 nM) in the Drosophila
lysate. The length and source of the dsRNA are indicated. An RNA
size marker (M) has been loaded in the left lane and the fragment
sizes are indicated. Double bands at time zero are due to
incompletely denatured dsRNA.
[0058] FIG. 3: Short dsRNAs cleave the mRNA target only once.
[0059] (A) Denaturing gel electrophoreses of the stable 5' cleavage
products produced by 1 h incubation of 10 nM sense or antisense RNA
.sup.32P-labeled at the cap with 10 nM dsRNAs of the p133 series in
Drosophila lysate. Length markers were generated by partial
nuclease T1 digestion and partial alkaline hydrolysis (OH) of the
cap-labeled target RNA. The regions targeted by the dsRNAs are
indicated as black bars on both sides. The 20-23 nt spacing between
the predominant cleavage sites for the 111 bp long dsRNA is shown.
The horizontal arrow indicates unspecific cleavage not due to RNAi.
(B) Position of the cleavage sites on sense and antisense target
RNAs. The sequences of the capped 177 nt sense and 180 nt antisense
target RNAs are represented in antiparallel orientation such that
complementary sequence are opposing each other. The region targeted
by the different dsRNAs are indicated by differently colored bars
positioned between sense and antisense target sequences. Cleavage
sites are indicated by circles: large circle for strong cleavage,
small circle for weak cleavage. The .sup.32P-radiolabeled phosphate
group is marked by an asterisk.
[0060] FIG. 4: 21 and 22 nt RNA fragments are generated by an RNase
III-like mechanism.
[0061] (A) Sequences of .about.21 nt RNAs after dsRNA processing.
The .about.21 nt RNA fragments generated by dsRNA processing were
directionally cloned and sequenced. Oligoribonucleotides
originating from the sense strand of the dsRNA are indicated as
blue lines, those originating from the antisense strand as red
lines. Thick bars are used if the same sequence was present in
multiple clones, the number at the right indicating the frequency.
The target RNA cleavage sites mediated by the dsRNA are indicated
as orange circles, large circle for strong cleavage, small circle
for weak cleavage (see FIG. 3B). Circles on top of the sense strand
indicated cleavage sites within the sense target and circles at the
bottom of the dsRNA indicate cleavage site in the antisense target.
Up to five additional nucleotides were identified in .about.21 nt
fragments derived from the 3' ends of the dsRNA. These nucleotides
are random combinations of predominantly C, G, or A residues and
were most likely added in an untemplated fashion during T7
transcription of the dsRNA-constituting strands. (B)
Two-dimensional TALC analysis of the nucleotide composition of
.about.21 nt RNAs. The .about.21 nt RNAs were generated by
incubatiori of internally radiolabeled 504 bp Pp-luc dsRNA in
Drosophila lysate, gel-purified, and then digested to
mononucleotides with nuclease P1 (top row) or ribonuclease T2
(bottom row). The dsRNA was internally radiolabeled by
transcription in the presence of one of the indicated
.alpha.-.sup.32P nucleoside triphosphates. Radioactivity was
detected by phosphorimaging. Nucleoside 5'-monophosphates,
nucleoside 3'-monophosphates, nucleoside 5',3'-diphosphates, and
inorganic phosphate are indicated as pN, Np, pNp, and p.sub.i,
respectively. Black circles indicate UV-absorbing spots from
non-radioactive carrier nucleotides. The 3',5'-bisphosphates (red
circles) were identified by co-migration with radiolabeled
standards prepared by 5'-phosphorylation of nucleoside
3'-monophosphates with T4 polynucleotide kinase and
.gamma.-.sup.32P-ATP.
[0062] FIG. 5: Synthetic 21 and 22 nt RNAs Mediate Target RNA
Cleavage.
[0063] (A) Graphic representation of control 52 bp dsRNA and
synthetic 21 and 22 nt dsRNAs. The sense strand of 21 and 22 nt
short interfering RNAs (siRNAs) is shown blue, the antisense strand
in red. The sequences of the siRNAs were derived from the cloned
fragments of 52 and 111 bp dsRNAs (FIG. 4A), except for the 22 nt
antisense strand of duplex 5. The siRNAs in duplex 6 and 7 were
unique to the 111 bp dsRNA processing reaction. The two 3'
overhanging nucleotides indicated in green are present in the
sequence of the synthetic antisense strand of duplexes 1 and 3.
Both strands of the control 52 bp dsRNA were prepared by in vitro
transcription and a fraction of transcripts may contain untemplated
3' nucleotide addition. The target RNA cleavage sites directed by
the siRNA duplexes are indicated as orange circles (see legend to
FIG. 4A) and were determined as shown in FIG. 5B. (B) Position of
the cleavage sites on sense and antisense target RNAs. The target
RNA sequences are as described in FIG. 3B. Control 52 bp dsRNA (10
nM) or 21 and 22 nt RNA duplexes 1-7 (100 nM) were incubated with
target RNA for 2.5 h at 25.degree. C. in Drosophila lysate. The
stable 5' cleavage products were resolved on the gel. The cleavage
sites are indicated in FIG. 5A. The region targeted by the 52 bp
dsRNA or the sense (s) or antisense (as) strands are indicated by
the black bars to the side of the gel. The cleavage sites are all
located within the region of identity of the dsRNAs. For precise
determination of the cleavage sites of the antisense strand, a
lower percentage gel was used.
[0064] FIG. 6: Long 3' overhangs on short dsRNAs inhibit RNAi.
[0065] (A) Graphic representation of 52 bp dsRNA constructs. The 3'
extensions of sense and antisense strand are indicated in blue and
red, respectively. The observed cleavage sites on the target RNAs
are represented as orange circles analogous to FIG. 4A and were
determined as shown in FIG. 6B. (B) Position of the cleavage sites
on sense and antisense target RNAs. The target RNA sequences are as
described in FIG. 3B. DsRNA (10 nM) was incubated with target RNA
for 2.5 h at 25.degree. C. in Drosophila lysate. The stable 5'
cleavage products were resolved on the gel. The major cleavage
sites are indicated with a horizontal arrow and also represented in
FIG. 6A. The region targeted by the 52 bp dsRNA is represented as
black bar at both sides of the gel.
[0066] FIG. 7: Proposed Model for RNAi.
[0067] RNAi is predicted to begin with processing of dsRNA (sense
strand in black, antisense strand in red) to predominantly 21 and
22 nt short interfering RNAs (siRNAs). Short overhanging 3'
nucleotides, if present on the dsRNA, may be beneficial for
processing of short dsRNAs. The dsRNA-processing proteins, which
remain to be characterized, are represented as green and blue
ovals, and assembled on the dsRNA in asymmetric fashion. In our
model, this is illustrated by binding of a hypothetical blue
protein or protein domain with the siRNA strand in 3' to 5'
direction while the hypothetical green protein or protein domain is
always bound to the opposing siRNA strand. These proteins or a
subset remain associated with the siRNA duplex and preserve its
orientation as determined by the direction of the dsRNA processing
reaction. Only the siRNA sequence associated with the blue protein
is able to guide target RNA cleavage. The endonuclease complex is
referred to as small interfering ribonucleoprotein complex or
siRNP. It is presumed here, that the endonuclease that cleaves the
dsRNA may also cleave the target RNA, probably by temporarily
displacing the passive siRNA strand not used for target
recognition. The target RNA is then cleaved in the center of the
region recognized by the sequence-complementary guide siRNA.
[0068] FIG. 8: Reporter constructs and siRNA duplexes.
[0069] (a) The firefly (Pp-luc) and sea pansy (Rr-luc) luciferase
reporter gene regions from plasmids pGL2-Control, pGL-3-Control and
pRL-TK (Promega) are illustrated. SV40 regulatory elements, the HSV
thymidine kinase promoter and two introns (lines) are indicated.
The sequence of GL3 luciferase is 95% identical to GL2, but RL is
completely unrelated to both. Luciferase expression from pGL2 is
approx. 10-fold lower than from pGL3 in transfected mammalian
cells. The region targeted by the siRNA duplexes is indicated as
black bar below the coding region of the luciferase genes. (b) The
sense (top) and antisense (bottom) sequences of the siRNA duplexes
targeting GL2, GL3 and RL luciferase are shown. The GL2 and GL3
siRNA duplexes differ by only 3 single nucleotide substitutions
(boxed in gray). As unspecific control, a duplex with the inverted
GL2 sequence, invGL2, was synthesized. The 2 nt 3' overhang of
2'-deoxythymidine is indicated as TT; uGL2 is similar to GL2 siRNA
but contains ribo-uridine 3' overhangs.
[0070] FIG. 9: RNA interference by siRNA duplexes.
[0071] Ratios of target control luciferase were normalized to a
buffer control (bu, black bars); gray bars indicate ratios of
Photinus pyralis (Pp-luc) GL2 or GL3 luciferase to Renilla
reniformis (Rr-luc) RL luciferase (left axis), white bars indicate
RL to GL2 or GL3 ratios (right axis), Panels a, c, e, g and i
describe experiments performed with the combination of pGL2-Control
and pRL-TK reporter plasmids, panels b, d, f, h and j with
pGL3-Control and pRL-TK reporter plasmids. The cell line used for
the interference experiment is indicated at the top of each plot.
The ratios of Pp-luc/Rr-luc for the buffer control (bu) varied
between 0.5 and 10 for pGL2/pRL and between 0.03 and 1 for
pGL3/pRL, respectively, before normalization and between the
various cell lines tested. The plotted data were averaged from
three independent experiments .+-.S.D.
[0072] FIG. 10: Effects of 21 nt siRNA, 50 bp and 500 bp dsRNAs on
luciferase expression in HeLa cells.
[0073] The exact length of the long dsRNAs is indicated below the
bars. Panels a, c and e describe experiments performed with
pGL2-Control and pRL-TK reporter plasmids, panels b, d and f with
pGL3-Control and pRL-TK reporter plasmids. The data were averaged
from two independent experiments.+-.S.D. (a), (b) Absolute Pp-luc
expression, plotted in arbitrary luminescence units. (c), (d)
Rr-luc expression, plotted in arbitrary luminescence units. (e),
(f) Ratios of normalized target to control luciferase. The ratios
of luciferase activity for siRNA duplexes were normalized to a
buffer control (bu, black bars); the luminescence ratios for 50 or
500 bp dsRNAs were normalized to the respective ratios observed for
50 and 500 bp dsRNA from humanized GFP (hG, black bars). It should
be noted that the overall differences in sequences between the 49
and 484 bp dsRNAs targeting GL2 and GL3 are not sufficient to
confer specificity between GL2 and GL3 targets (43 nt uninterrupted
identity in 49 bp segment, 239 nt longest uninterrupted identity in
484 bp segment).
[0074] FIG. 11: Variation of the 3' overhang of duplexes of 21-nt
siRNAs.
[0075] (A) Outline of the experimental strategy. The capped and
polyadenylated sense target mRNA is depicted and the relative
positions of sense and antisense siRNAs are shown. Eight series of
duplexes, according to the eight different antisense strands were
prepared. The siRNA sequences and the number of overhanging
nucleotides were changed in 1-nt steps. (B) Normalized relative
luminescence of target luciferase (Photinus pyralis, Pp-luc) to
control luciferase (Renilla reniformis, Rr-luc) in D. melanogaster
embryo lysate in the presence of 5 nM blunt-ended dsRNAs. The
luminescence ratios determined in the presence of dsRNA were
normalized to the ratio obtained for a buffer control (bu, black
bar). Normalized ratios less than 1 indicate specific interference.
(C-J) Normalized interference ratios for eight series of 21-nt
siRNA duplexes. The sequences of siRNA duplexes are depicted above
the bar graphs. Each panel shows the interference ratio for a set
of duplexes formed with a given antisense guide siRNA and 5
different sense siRNAs. The number of overhanging nucleotides (3'
overhang, positive numbers; 5' overhangs, negative numbers) is
indicated on the x-axis. Data points were averaged from at least 3
independent experiments, error bars represent standard
deviations.
[0076] FIG. 12: Variation of the length of the sense strand of
siRNA duplexes.
[0077] (A) Graphic representation of the experiment. Three 21-nt
antisense strands were paired with eight sense siRNAs. The siRNAs
were changed in length at their 3' end. The 3' overhang of the
antisense siRNA was 1-nt (B), 2-nt (C), or 3-nt (D) while the sense
siRNA overhang was varied for each series. The sequences of the
siRNA duplexes and the corresponding interference ratios are
indicated.
[0078] FIG. 13: Variation of the length of siRNA duplexes with
preserved 2-nt 3' overhangs.
[0079] (A) Graphic representation of the experiment. The 21-nt
siRNA duplex is identical in sequence to the one shown in FIG. 11H
or 12C. The siRNA duplexes were extended to the 3' side of the
sense siRNA (B) or the 5' side of the sense siRNA (C). The siRNA
duplex sequences and the respective interference ratios are
indicated.
[0080] FIG. 14: Substitution of the 2'-hydroxyl groups of the siRNA
ribose residues.
[0081] The 2'-hydroxyl groups (OH) in the strands of siRNA duplexes
were replaced by 2'-deoxy (d) or 2'-O-methyl (Me). 2-nt and 4-nt
2'-deoxy substitutions at the 3'-ends are indicated as 2-nt d and
4-nt d, respectively. Uridine residues were replaced by 2'-deoxy
thymidine.
[0082] FIG. 15: Mapping of sense and antisense target RNA cleavage
by 21-nt siRNA duplexes with 2-nt 3' overhangs.
[0083] (A) Graphic representation of 32P (asterisk) cap-labelled
sense and antisense target RNAs and siRNA duplexes. The position of
sense and antisense target RNA cleavage is indicated by triangles
on top and below the siRNA duplexes, respectively. (B) Mapping of
target RNA cleavage sites. After 2 h incubation of 10 nM target
with 100 nM siRNA duplex in D. melanogaster embryo lysate, the 5'
cap-labelled substrate and the 5' cleavage products were resolved
on sequencing gels. Length markers were generated by partial RNase
T1 digestion (T1) and partial alkaline hydrolysis (OH--) of the
target RNAs. The bold lines to the left of the images indicate the
region covered by the siRNA strands 1 and 5 of the same orientation
as the target.
[0084] FIG. 16: The 5' end of a guide siRNA defines the position of
target RNA cleavage.
[0085] (A, B) Graphic representation of the experimental strategy.
The antisense siRNA was the same in all siRNA duplexes, but the
sense strand was varied between 18 to 25 nt by changing the 3' end
(A) or 18 to 23 nt by changing the 5' end (B). The position of
sense and antisense target RNA cleavage is indicated by triangles
on top and below the siRNA duplexes, respectively. (C, D) Analysis
of target RNA cleavage using cap-labelled sense (top panel) or
antisense (bottom panel) target RNAs. Only the cap labelled 5'
cleavage products are shown. The sequences of the siRNA duplexes
are indicated, and the length of the sense siRNA strands is marked
on top of the panel. The control lane marked with a dash in panel
(C) shows target RNA incubated in absence of siRNAs. Markers were
as described in FIG. 15. The arrows in (D), bottom panel, indicate
the target RNA cleavage sites that differ by 1 nt.
[0086] FIG. 17: Sequence variation of the 3' overhang of siRNA
duplexes.
[0087] The 2-nt 3' overhang (NN, in gray) was changed in sequence
and composition as indicated (T, 2'-deoxythymidine, dG,
2'-deoxyguanosine; asterisk, wild-type siRNA duplex). Normalized
interference ratios were determined as described in FIG. 11. The
wild-type sequence is the same as depicted in FIG. 14.
[0088] FIG. 18: Sequence specificity of target recognition.
[0089] The sequences of the mismatched siRNA duplexes are shown,
modified sequence segments or single nucleotides are underlayed in
gray. The reference duplex (ref) and the siRNA duplexes 1 to 7
contain 2'-deoxythymidine 2-nt overhangs. The silencing efficiency
of the thymidine-modified reference duplex was comparable to the
wild-type sequence (FIG. 17). Normalized interference ratios were
determined as described in FIG. 11.
[0090] FIG. 19: Variation of the length of siRNA duplexes with
preserved 2-nt 3' overhangs.
[0091] The siRNA duplexes were extended to the 3' side of the sense
siRNA (A) or the 5' side of the sense siRNA (B). The siRNA duplex
sequences and the respective interference ratios are indicated. For
HeLa SS6 cells, siRNA duplexes (0.84 .mu.g) targeting GL2
luciferase were transfected together with pGL2-Control and pRL-TK
plasmids. For comparison, the in vitro RNAi activities of siRNA
duplexes tested in D. melanogaster lysate are indicated.
EXAMPLE 1
RNA Interference Mediated by Small Synthetic RNAs
1.1. Experimental Procedures
1.1.1 In Vitro RNAi
[0092] In vitro RNAi and lysate preparations were performed as
described previously (Tuschl et al., 1999; Zamore et al., 2000). It
is critical to use freshly dissolved creatine kinase (Roche) for
optimal ATP regeneration. The RNAi translation assays (FIG. 1) were
performed with dsRNA concentrations of 5 nM and an extended
pre-incubation period of 15 min at 25.degree. C. prior to the
addition of in vitro transcribed, capped and polyadenylated Pp-luc
and Rr-luc reporter mRNAs. The incubation was continued for 1 h and
the relative amount of Pp-luc and Rr-luc protein was analyzed using
the dual luciferase assay (Promega) and a Monolight 3010C
luminometer (PharMingen).
1.1.2 RNA Synthesis
[0093] Standard procedures were used for in vitro transcription of
RNA from PCR templates carrying T7 or SP6 promoter sequences, see
for example (Tuschl et al., 1998). Synthetic RNA was prepared using
Expedite RNA phosphoramidites (Proligo). The 3' adapter
oligonucleotide was synthesized using
dimethoxytrityl-1,4-benzenedimethanol-succinyl-aminopropyl-CPG. The
oligoribonucleotides were deprotected in 3 ml of 32%
ammonia/ethanol (3/1) for 4 h at 55.degree. C. (Expedite RNA) or 16
h at 55.degree. C. (3' and 5' adapter DNA/RNA chimeric
oligonucleotides) and then desilylated and gel-purified as
described previously (Tuschl et al., 1993). RNA transcripts for
dsRNA preparation including long 3' overhangs were generated from
PCR templates that contained a T7 promoter in sense and an SP6
promoter in antisense direction. The transcription template for
sense and antisense target RNA was PCR-amplified with
GCGTAATACGACTCACTATAGAACAATTGCTTTTACAG (underlined, T7 promoter) as
5' primer and ATTTAGGTGACACTATAGGCATAAAGAATTGAAGA (underlined, SP6
promoter) as 3' primer and the linearized Pp-luc plasmid (pGEM-luc
sequence) (Tuschl et al., 1999) as template; the T7-transcribed
sense RNA was 177 nt long with the Pp-luc sequence between pos.
113-273 relative to the start codon and followed by 17 nt of the
complement of the SP6 promoter sequence at the 3' end. Transcripts
for blunt-ended dsRNA formation were prepared by transcription from
two different PCR products which only contained a single promoter
sequence.
[0094] DsRNA annealing was carried out using a phenol/chloroform
extraction. Equimolar concentration of sense and antisense RNA (50
nM to 10 .mu.M, depending on the length and amount available) in
0.3 M NaOAc (pH 6) were incubated for 30 s at 90.degree. C. and
then extracted at room temperature with an equal volume of
phenol/chloroform, and followed by a chloroform extraction to
remove residual phenol. The resulting dsRNA was precipitated by
addition of 2.5-3 volumes of ethanol. The pellet was dissolved in
lysis buffer (100 mM KCl, 30 mM HEPES-KOH, pH 7.4, 2 mM
Mg(OAc).sub.2) and the quality of the dsRNA was verified by
standard agarose gel electrophoreses in 1.times.TAE-buffer. The 52
bp dsRNAs with the 17 nt and 20 nt 3' overhangs (FIG. 6) were
annealed by incubating for 1 min at 95.degree. C., then rapidly
cooled to 70.degree. C. and followed by slow cooling to room
temperature over a 3 h period (50 .mu.l annealing reaction, 1 .mu.M
strand concentration, 300 mM NaCl, 10 mM Tris-HCl, pH 7.5). The
dsRNAs were then phenol/chloroform extracted, ethanol-precipitated
and dissolved in lysis buffer.
[0095] Transcription of internally .sup.32P-radiolabeled RNA used
for dsRNA preparation (FIGS. 2 and 4) was performed using 1 mM ATP,
CTP, GTP, 0.1 or 0.2 mM UTP, and 0.2-0.3 .mu.M -.sup.32P-UTP (3000
Ci/mmol), or the respective ratio for radiolabeled nucleoside
triphosphates other than UTP. Labeling of the cap of the target
RNAs was performed as described previously. The target RNAs were
gel-purified after cap-labeling.
1.1.3 Cleavage Site Mapping
[0096] Standard RNAi reactions were performed by pre-incubating 10
nM dsRNA for 15 min followed by addition of 10 nM cap-labeled
target RNA. The reaction was stopped after a further 2 h (FIG. 2A)
or 2.5 h incubation (FIG. 5B and 6B) by proteinase K treatment
(Tuschl et al., 1999). The samples were then analyzed on 8 or 10%
sequencing gels. The 21 and 22 nt synthetic RNA duplexes were used
at 100 nM final concentration (FIG. 5B).
1.1.4 Cloning of .about.21 nt RNAs
[0097] The 21 nt RNAs were produced by incubation of radiolabeled
dsRNA in Drosophila lysate in absence of target RNA (200 .mu.l
reaction, 1 h incubation, 50 nM dsp111, or 100 nM dsP52 or dsP39).
The reaction mixture was subsequently treated with proteinase K
(Tuschl et al., 1999) and the dsRNA-processing products were
separated on a denaturing 15% polyacrylamide gel. A band, including
a size range of at least 18 to 24 nt, was excised, eluted into 0.3
M NaCl overnight at 4.degree. C. and in siliconized tubes. The RNA
was recovered by ethanol-precipitation and dephosphorylated (30
.mu.l reaction, 30 min, 50.degree. C., 10 U alkaline phosphatase,
Roche). The reaction was stopped by phenol/chloroform extraction
and the RNA was ethanol-precipitated. The 3' adapter
oligonucleotide (pUUUaaccgcatccttctcx: uppercase, RNA; lowercase,
DNA; p, phosphate; x, 4-hydroxymethylbenzyl) Was then ligated to
the dephosphorylated .about.21 nt RNA (20 .mu.l reaction, 30 min,
37.degree. C., 5 .mu.M 3' adapter, 50 mM Tris-HCl, pH 7.6, 10 mM
MgCl.sub.2, 0.2 mM ATP, 0.1 mg/ml acetylated BSA, 15% DMSO, 25 U T4
RNA ligase, Amersham-Pharmacia) (Pan and Uhlenbeck, 1992). The
ligation reaction was stopped by the addition of an equal volume of
8 M urea/50 mM EDTA stopmix and directly loaded on a 15% gel.
Ligation yields were greater 50%. The ligation product was
recovered from the gel and 5'-phosphorylated (20 .mu.l reaction, 30
min, 37.degree. C., 2 mM ATP, 5 U T4 polynucleotide kinase, NEB).
The phosphorylation reaction was stopped by phenol/chloroform
extraction and RNA was recovered by ethanol-precipitation. Next,
the 5' adapter (tactaatacgactcactAAA: uppercase, RNA; lowercase,
DNA) was ligated to the phosphorylaited ligation product as
described above. The new ligation product was gel-purified and
eluted from the gel slice in the presence of reverse transcription
primer (GACTAGCTGGAATTCAAGGATGCGGTTAAA: bold, Eco Rl site) used as
carrier. Reverse transcription (15 .mu.l reaction, 30 min,
42.degree. C., 150 U Superscript II reverse transcriptase, Life
Technologies) was followed by PCR using as 5' primer
CAGCCAACGGAATTCATACGACTCACTAAA (bold, Eco Rl site) and the 3' RT
primer. The PCR product was purified by phenol/chloroform
extraction and ethanol-precipitated. The PCR product was then
digested with Eco Rl (NEB) and concatamerized using T4 DNA ligase
(high conc., NEB). Concatamers of a size range of 200 to 800 bp
were separated on a low-melt agarose gel, recovered from the gel by
a standard melting and phenol extraction procedure, and
ethanol-precipitated. The unpaired ends were filled in by
incubation with Taq polymerase under standard conditions for 15 min
at 72.degree. C. and the DNA product was directly ligated into the
pCR2.1-TOPO vector using the TOPO TA cloning kit (Invitrogen).
Colonies were screened using PCR and M13-20 and M13 Reverse
sequencing primers. PCR products were directly submitted for custom
sequencing (Sequence Laboratories Gottingen GmbH, Germany). On
average, four to five 21 mer sequences were obtained per clone.
1.1.5 2D-TALC Analysis
[0098] Nuclease P1 digestion of radiolabeled, gel-purified siRNAs
and 2D-TALC was carried out as described (Zamore et al., 2000).
Nuclease T2 digestion was performed in 10 .mu.l reactions for 3 h
at 50.degree. C. in 10 mM ammonium acetate (pH 4.5) using 2
.mu.g/.mu.l carrier tRNA and 30 U ribonuclease T2 (Life
Technologies). The migration of non-radioactive standards was
determined by UV shadowing. The identity of
nucleoside-3',5'-disphosphates was confirmed by co-migration of the
T2 digestion products with standards prepared by
5'-.sup.32P-phosphorylation of commercial nucleoside
3'-monophosphates using .gamma.-32P-ATP and T4 polynucleotide
kinase (data not shown).
1.2 Results and Discussion
1.2.1 Length Requirements for Processing of dsRNA to 21 and 22 nt
RNA Fragments
[0099] Lysate prepared from D. melanogaster syncytial embryos
recapitulates RNAi in vitro providing a novel tool for biochemical
analysis of the mechanism of RNAi (Tuschl et al., 1999; Zamore et
al., 2000). In vitro and in vivo analysis of the length
requirements of dsRNA for RNAi has revealed that short dsRNA
(<150 bp) are less effective than longer dsRNAs in degrading
target mRNA (Caplen et al., 2000; Hammond et al., 2000; Ngo et al.,
1998); Tuschl et al., 1999). The reasons for reduction in MRNA
degrading efficiency are not understood. We therefore examined the
precise length requirement of dsRNA for target RNA degradation
under optimized conditions in the Drosophila lysate (Zamore et al.,
2000). Several series of dsRNAs were synthesized and directed
against firefly luciferase (Pp-luc) reporter RNA. The specific
suppression of target RNA expression was monitored by the dual
luciferase assay (Tuschl et al., 1999) (FIGS. 1A and 1B). We
detected specific inhibition of target RNA expression for dsRNAs as
short as 38 bp, but dsRNAs of 29 to 36 bp were not effective in
this process. The effect was independent of the target position and
the degree of inhibition of Pp-luc mRNA expression correlated with
the length of the dsRNA, i.e. long dsRNAs were more effective than
short dsRNAs.
[0100] It has been suggested that the 21-23 nt RNA fragments
generated by processing of dsRNAs are the mediators of RNA
interference and co-suppression (Hamilton and Baulcombe, 1999;
Hammond et al., 2000; Zamore et al., 2000). We therefore analyzed
the rate of 21-23 nt fragment formation for a subset of dsRNAs
ranging in size between 501 to 29 bp. Formation of 21-23 nt
fragments. in Drosophila lysate (FIG. 2) was readily detectable for
39 to 501 bp long dsRNAs but was significantly delayed for the 29
bp dsRNA. This observation is consistent with a role of 21-23 nt
fragments in guiding mRNA cleavage and provides an explanation for
the lack of RNAi by 30 bp dsRNAs. The length dependence of 21-23
mer formation is likely to reflect a biologically relevant control
mechanism to prevent the undesired activation of RNAi by short
intramolecular basepaired structures of regular cellular RNAs.
1.2.2 39 bp dsRNA Mediates Target RNA Cleavage at a Single Site
[0101] Addition of dsRNA and 5'-capped target RNA to the Drosophila
lysate results in sequence-specific degradation of the target RNA
(Tuschl et al., 1999). The target mRNA is only cleaved within the
region of identity with the dsRNA and many of.the target cleavage
sites were separated by.21-23 nt (Zamore et al., 2000). Thus, the
number of cleavage sites for a given dsRNA was expected to roughly
correspond to the length of the dsRNA divided by 21. We mapped the
target cleavage sites on a sense and an ahtisense target RNA which
was 5' radiolabeled at the cap (Zamore et al., 2000) (FIGS. 3A and
3B). Stable 5' cleavage products were separated on a sequencing gel
and the position of cleavage was determined by comparison with a
partial RNase T1 and an alkaline hydrolysis ladder from the target
RNA.
[0102] Consistent with the previous observation (Zamore et al.,
2000), all target RNA cleavage sites were located within the region
of identity to the dsRNA. The sense or the antisense traget was
only cleaved once by 39 bp dsRNA. Each cleavage site was located 10
nt from the 5' end of the region covered by the dsRNA (FIG. 3B).
The 52 bp dsRNA, which shares the same 5' end with the 39 bp dsRNA,
produces the same cleavage site on the sense target, located 10 nt
from the 5' end of the region of identity with the dsRNA, in
addition to two weaker cleavage sites 23 and 24 nt downstream of
the first site. The antisense target was only cleaved once, again
10 nt from the 5' end of the region covered by its respective
dsRNA. Mapping of the cleavage sites for the 38 to 49 bp dsRNAs
shown in FIG. 1 showed that the first and predominant cleavage site
was always located 7 to 10 nt downstream of the region covered by
the dsRNA (data not shown). This suggests that the point of target
RNA cleavage is determined by the end of the dsRNA and could imply
that processing to 21-23 mers starts from the ends of the
duplex.
[0103] Cleavage sites on sense and antisense target for the longer
111 bp dsRNA were much more frequent than anticipated and most of
them appear in clusters separated by 20 to 23 nt (FIGS. 3A and 3B).
As for the shorter dsRNAs, the first cleavage site on the sense
target is 10 nt from the 5' end of the region spanned by the dsRNA,
and the first cleavage site on the antisense target is located 9 nt
from the 5' end of region covered by the dsRNA. It is unclear what
causes this disordered cleavage, but one possibility could be that
longer dsRNAs may not only get processed from the ends but also
internally, or there are some specificity determinants for dsRNA
processing which we do not yet understand. Some irregularities to
the 21-23 nt spacing were also previously noted (Zamore et al.,
2000). To better understand the molecular basis of dsRNA processing
and target RNA recognition, we decided to analyze the sequences of
the 21-23 nt fragments generated by processing of 39, 52, and 111
bp dsRNAs in the Drosophila lysate.
1.2.3 dsRNA is Processed to .21 and 22 nt RNAs by an RNase III-Like
Mechanism
[0104] In order to characterize the 21-23 nt RNA fragments we
examined the 5' and 3' termini of the RNA fragments. Periodate
oxidation of gel-purified 21 -23 nt RNAs followed by
.beta.-elimination indicated the presence of a terminal 2' and 3'
hydroxyl groups. The 21-23 mers were also responsive to alkaline
phosphatase treatment indicating the presence of a 5' terminal
phosphate group. The presence of 5' phosphate and 3' hydroxyl
termini suggests that the dsRNA could be processed by an enzymatic
activity similar to E. coli RNase III (for reviews, see (Dunn,
1982; Nicholson, 1999; Robertson, 1990; Robertson, 1982)).
[0105] Directional cloning of 21-23 nt RNA fragments was performed
by ligation of a 3' and 5' adapter oligonucleotide to the purified
21-23 mers using T4 RNA ligase. The ligation products were reverse
transcribed, PCR-amplified, concatamerized, cloned, and sequenced.
Over 220 short RNAs were sequenced from dsRNA processing reactions
of the 39, 52 and 111 bp dsRNAs (FIG. 4A). We found the following
length distribution: 1% 18 nt, 5% 19 nt, 12% 20 nt, 45% 21 nt, 28%
22 nt, 6% 23 nt, and 2% 24 nt. Sequence analysis of the 5' terminal
nucleotide of the processed fragments indicated that
oligonucleotides with a 5' guanosine were underrepresented. This
bias was most likely introduced by T4 RNA ligase which
discriminates against 5' phosphorylated guanosine as donor
oligonucleotide; no significant sequence bias was seen at the 3'
end. Many of the .about.21 nt fragments derived from the 3' ends of
the sense or antisense strand of the duplexes include 3'
nucleotides that are derived from untemplated addition of
nucleotides during RNA synthesis using T7 RNA polymerase.
Interestingly, a significant number of endogenous Drosophila
.about.21 nt RNAs were also cloned, some of them from LTR and
non-LTR retrotransposons (data not shown). This is consistent with
a possible role for RNAi in transposon silencing.
[0106] The .about.21 nt RNAs appear in clustered groups (FIG. 4A)
which cover the entire dsRNA sequences. Apparently, the processing
reaction cuts the dsRNA by leaving staggered 3' ends, another
characteristic of RNase III cleavage. For the 39 bp dsRNA, two
clusters of .about.21 nt RNAs were found from each
dsRNA-constituting strand including overhanging 3' ends, yet only
one cleavage site was detected on the sense and antisense target
(FIGS. 3A. and 3B). If the .about.21 nt fragments were present as
single-stranded guide RNAs in a complex that mediates mRNA
degradation, it could be assumed that at least two target cleavage
sites exist, but this was not the case. This suggests that the
.about.21 nt RNAs may be present in double-stranded form in the
endonuclease complex but that only one of the strands can be used
for target RNA recognition and cleavage. The use of only one of the
.about.21 nt strands for target cleavage may simply be determined
by the orientation in which the .about.21 nt duplex is bound to the
nuclease complex. This orientation is defined by the direction in
which the original dsRNA was processed.
[0107] The .about.21 mer clusters for the 52 bp and 111 bp dsRNA
are less well defined when compared to the 39 bp dsRNA. The
clusters are spread over regions of 25 to 30 nt most likely
representing several distinct subpopulations of .about.21 nt
duplexes and therefore guiding target cleavage at several nearby
sites. These cleavage regions are still predominantly separated by
20 to 23 nt intervals. The rules determining how regular dsRNA can
be processed to .about.21 nt fragments are not yet understood, but
it was previously observed that the approx. 21-23 nt spacing of
cleavage sites could be altered by a run of uridines (Zamore et
al., 2000). The specificity of dsRNA cleavage by E. coli RNase III
appears to be mainly controlled by antideterminants, i.e. excluding
some specific base-pairs at given positions relative to the
cleavage site (Zhang and Nicholson, 1997).
[0108] To test whether sugar-, base- or cap-modification were
present in processed .about.21 nt RNA fragments, we incubated
radiolabeled 505 bp Pp-luc dsRNA in lysate for 1 h, isolated the
.about.21 nt products, and digested it with P1 or T2 nuclease to
mononucleotides. The nucleotide mixture was then analyzed by 2D
thin-layer chromatography (FIG. 4B). None of the four natural
ribonucleotides were modified as indicated by P1 or T2 digestion.
We have previously analyzed adenosine to inosine conversion in the
.about.21 nt fragments. (after a 2 h incubation) and detected a
small extent (<0.7%) deamination (Zamore et al., 2000); shorter
incubation in lysate (1 h) reduced this inosine fraction to barely
detectable levels. RNase T2, which cleaves 3' of the phosphodiester
linkage, produced nucleoside 3'-phosphate and nucleoside
3',5'-diphosphate, thereby indicating the presence of a 5'-terminal
monophosphate. All four nucleoside 3',5'-diphosphates were detected
and suggest that the internucleotidic linkage was cleaved with
little or no sequence-specificity. In summary, the .about.21 nt
fragments are unmodified and were generated from dsRNA such that
5'-monophosphates and 3'-hydroxyls were present at the 5'-end.
1.2.4 Synthetic 21 and 22 nt RNAs Mediate Target RNA Cleavage
[0109] Analysis of the products of dsRNA processing indicated that
the .about.21 nt fragments are generated by a reaction with all the
characteristics of an RNase III cleavage reaction (Dunn, 1982;
Nicholson, 1999; Robertson, 1990; Robertson, 1982). RNase III makes
two staggered cuts in both strands of the dsRNA, leaving a 3'
overhang of about 2 nt. We chemically synthesized 21 and 22 nt
RNAs, identical in sequence to some of the cloned .about.21 nt
fragments, and tested them for their ability to mediate target RNA
degradation (FIGS. 5A and 5B). The 21 and 22 nt RNA duplexes were
incubated at 100 nM concentrations in the lysate, a 10-fold higher
concentrations than the 52 bp control dsRNA. Under these
conditions, target RNA cleavage is readily detectable. Reducing the
concentration of 21 and 22 nt duplexes from 100 to 10 nM does still
cause target RNA cleavage. Increasing the duplex concentration from
100 nM to 1000 nM however does not further increase target
cleavage, probably due to a limiting protein factor within the
lysate.
[0110] In contrast to 29 or 30 bp dsRNAs that did not mediate RNAi,
the 21 and 22 nt dsRNAs with overhanging 3' ends of 2 to 4 nt
mediated efficient degradation of target RNA (duplexes 1, 3, 4, 6,
FIGS. 5A and 5B). Bluntended 21 or 22 nt dsRNAs (duplexes 2, 5, and
7, FIGS. 5A and 5B) were reduced in their ability to degrade the
target and indicate that overhanging 3' ends are critical for
reconstitution of the RNA-protein nuclease complex. The
single-stranded overhangs may be required for high affinity binding
of the .about.21 nt duplex to the protein components. A 5' terminal
phosphate, although present after dsRNA processing, was not
required to mediate target RNA cleavage and was absent from the
short synthetic RNAs.
[0111] The synthetic 21 and 22 nt duplexes guided cleavage of sense
as well as antisense targets within the region covered by the short
duplex. This is an important result considering that a 39 bp dsRNA
which forms two pairs of clusters of .about.21 nt fragments (FIG.
2), cleaved sense or antisense target only once and not twice. We
interpret this result by suggesting that only one of two strands
present in the .about.21 nt duplex is able to guide target RNA
cleavage and that the orientation of the .about.21 nt duplex in the
nuclease complex is determined by the initial direction of dsRNA
processing. The presentation of an already perfectly processed
.about.21 nt duplex to the invitro system however does allow
formation of the active sequence-specific nuclease complex. with
two possible orientations of the symmetric RNA duplex. This results
in cleavage of sense as well as antisense target within the region
of identity with the 21 nt RNA duplex.
[0112] The target cleavage site is located 11 or 12 nt downstream
of the first nucleotide that is complementary to the 21 or 22 nt
guide sequence, i.e. the cleavage site is near center of the region
covered by the 21 or 22 nt RNAs (FIGS. 4A and 4B). Displacing the
sense strand of a 22 nt duplex by two nucleotides (compare duplexes
1 and 3 in FIG. 5A) displaced the cleavage site of only the
antisense target by two nucleotides. Displacing both sense and
antisense strand by two nucleotides shifted both cleavage sites by
two nucleotides (compare duplexes 1 and 4). We predict that it will
be possible to design a pair of 21 or 22 nt RNAs to cleave a target
RNA at almost any given position.
[0113] The specificity of target RNA cleavage guided by 21 and 22
nt RNAs appears exquisite as no aberrant cleavage sites are
detected (FIG. 5B). It should however be noted, that the
nucleotides present in the 3' overhang of the 21 and 22 nt RNA
duplex may contribute less to substrate recognition than the
nucleotides near the cleavage site. This is based on the
observation that the 3' most nucleotide in the 3' overhang of the
active duplexes 1 or 3 (FIG. 5A) is not complementary to the
target. A detailed analysis of the specificity of RNAi can now be
readily undertaken using synthetic 21 and 22 nt RNAs.
[0114] Based on the evidence that synthetic 21 and 22 nt RNAs with
overhanging 3' ends mediate RNA interference, we propose to name
the .about.21 nt RNAs "short interfering RNAs" or siRNAs and the
respective RNA-protein complex a "small interfering
ribonucleoprotein particle" or siRNP.
1.2.5 3' Overhangs of 20 nt on short dsRNAs inhibit RNAi
[0115] We have shown that short blunt-ended dsRNAs appear to be
processed from the ends of the dsRNA. During our study of the
length dependence of dsRNA in RNAi, we have also analyzed dsRNAs
with 17 to 20 nt overhanging 3' ends and found to our surprise that
they were less potent than blunt-ended dsRNAs. The inhibitory
effect of long 3' ends was particularly pronounced for dsRNAs up to
100 bp but was less dramatic for longer dsRNAs. The effect was not
due to imperfect dsRNA formation based on native gel analysis (data
not shown). We tested if the inhibitory effect of long overhanging
3' ends could be used as a tool to direct dsRNA processing to only
one of the two ends of a short RNA duplex.
[0116] We synthesized four combinations of the 52 bp model dsRNA,
bluntended, 3' extension on only the sense strand, 3'-extension on
only the antisense strand, and double 3' extension on both strands,
and mapped the target RNA cleavage sites after incubation in lysate
(FIGS. 6A. and 6B). The first and predominant cleavage site of the
sense target was lost when the 3' end of the antisense strand of
the duplex was extended, and vice versa, the strong cleavage site
of the antisense target was lost when the 3' end of sense strand of
the duplex was extended. 3' Extensions on both strands rendered the
52 bp dsRNA virtually inactive. One explanation for the dsRNA
inactivation by .about.20 nt 3' extensions could be the association
of single-stranded RNA-binding proteins which could interfere with
the association of one of the dsRNA-processing factors at this end.
This result is also consistent with our model where only one of the
strands of the siRNA duplex in the assembled siRNP is able to guide
target RNA cleavage. The orientation of the strand that guides RNA
cleavage is defined by the direction of the dsRNA processing
reaction. It is likely that the presence of 3' staggered ends may
facilitate the assembly of the processing complex. A block at the
3' end of the sense strand will only permit dsRNA processing from
the opposing 3' end of the antisense strand. This in turn generates
siRNP complexes in which only the antisense strand of the siRNA
duplex is able to guide sense target RNA cleavage. The same is true
for the reciprocal situation.
[0117] The less pronounced inhibitory effect of long 3' extensions
in the case of longer dsRNAs (.gtoreq.500 bp, data not shown)
suggests to us that long dsRNAs may also contain internal
dsRNA-processing signals or may get processed cooperatively due to
the association of multiple cleavage factors.
1.2.6 A Model for dsRNA-Directed mRNA Cleavage
[0118] The new biochemical data update the model for how dsRNA
targets mRNA for destruction (FIG. 7). Double-stranded RNA is first
processed to short RNA duplexes of predominantly 21 and 22 nt in
length and with staggered 3' ends similar to an RNase III-like
reaction (Dunn, 1982; Nicholson, 1999; Robertson, 1982). Based on
the 21-23 nt length of the processed RNA fragments it has already
been speculated that an RNase III-like activity may be involved in
RNAi (Bass, 2000). This hypothesis is further supported by the
presence of 5' phosphates and 3' hydroxyls at the termini of the
siRNAs as observed in RNase III reaction products (Dunn, 1982;
Nicholson, 1999). Bacterial RNase III and the eukaryotic homologs
Rnt1p in S. cerevisiae and Pac1p in S. pombe have been shown to
function in processing of ribosomal RNA as well as snRNA and
snoRNAs (see for example Chanfreau et al., 2000).
[0119] Little is known about the biochemistry of RNase III homologs
from plants, animals or human. Two families of RNase III enzymes
have been identified predominantly by database-guided sequence
analysis or cloning of cDNAs. The first RNase III family is
represented by the 1327 amino acid long D. melanogaster protein
drosha (Acc. AF116572). The C-terminus is composed of two RNase III
and one dsRNA-binding domain and the N-terminus is of unknown
function. Close homologs are also found in C. elegans (Acc.
AF160248) and human (Acc. AF189011) (Filippov et al., 2000; Wu et
al., 2000). The drosha-like human RNase III was recently cloned and
characterized (Wu et al., 2000). The gene is ubiquitously expressed
in human tissues and cell lines, and the protein is localized in
the nucleus and the nucleolus of the cell. Based on results
inferred from antisense inhibition studies, a role of this protein
for rRNA processing was suggested. The second class is represented
by the C. elegans gene K12H4.8 (Acc. S44849) coding for a 1822
amino acid long protein. This protein has an N-terminal RNA
helicase motif which is followed by 2 RNase III catalytic domains
and a dsRNA-binding motif, similar to the drosha RNase III family.
There are close homologs in S. pombe (Acc. Q09884), A. thaliana
(Acc. AF187317) D. melanogaster (Acc. AE003740), and human (Acc.
AB028449) (Filippov et al., 2000; Jacobsen et al., 1999; Matsuda et
al., 2000). Possibly the K12H4.8 RNase III/helicase is the likely
candidate to be involved in RNAi.
[0120] Genetic screens in C. elegans identified rde-1 and rde-4 as
essential for activation of RNAi without an effect on transposon
mobilization or co-suppression (Dernburg .et al., 2000; Grishok et
al., 2000; Ketting and Plasterk, 2000; Tabara et al., 1999). This
led to the hypothesis that these genes are important for dsRNA
processing but are not involved in mRNA target degradation. The
function of both genes is as yet unknown, the rde-1 gene product is
a member of a family of proteins similar to the rabbit protein
elF2C (Tabara et al., 1999), and the sequence of rde-4 has not yet
been described. Future biochemical characterization of these
proteins should reveal their molecular function.
[0121] Processing to the siRNA duplexes appears to start from the
ends of both blunt-ended dsRNAs or dsRNAs with short (1-5 nt) 3'
overhangs, and proceeds in approximately 21-23 nt steps. Long
(.about.20 nt) 3' staggered ends on short dsRNAs suppress RNAi,
possibly through interaction with single-stranded RNA-binding
proteins. The suppression of RNAi by single-stranded regions
flanking short dsRNA and the lack of siRNA formation from short 30
bp dsRNAs may explain why structured regions frequently encountered
in mRNAs do not lead to activation of RNAi.
[0122] Without wishing to be bound by theory, we presume that the
dsRNA-processing proteins or a subset of these remain associated
with the siRNA duplex after the processing reaction. The
orientation of the siRNA duplex relative to these proteins
determines which of the two complementary strands functions in
guiding target RNA degradation. Chemically synthesized siRNA
duplexes guide cleavage of sense as well as antisense target RNA as
they are able to associate with the protein components in either of
the two possible orientation.
[0123] The remarkable finding that synthetic 21 and 22 nt siRNA
duplexes can be used for efficient mRNA. degradation provides new
tools for sequence-specific regulation of gene expression in
functional genomics as well as biomedical studies. The siRNAs may
be effective in mammalian systems where long dsRNAs cannot be used
due to the activation of the PKR response (Clemens, 1997). As such,
the siRNA duplexes represent a new alternative to antisense or
ribozyme therapeutics.
EXAMPLE 2
RNA Interference in Human Tissue Cultures
2.1 Methods
2.1.1 RNA Preparation
[0124] 21 nt RNAs were chemically synthesized using Expedite RNA
phosphoramidites and thymidine phosphoramidite (Proligo, Germany).
Synthetic oligonucleotides were deprotected and gel-purified
(Example 1), followed by Sep-Pak C18 cartridge (Waters, Milford,
Mass., USA) purification (Tuschl,. 1993). The siRNA sequences
targeting GL2 (Acc. X65324) and GL3 luciferase (Acc. U47296)
corresponded to the coding regions 153-173 relative to the first
nucleotide of the start codon, siRNAs targeting RL (Acc. AF025846)
corresponded to region 119-129 after the start codon. Longer RNAs
were transcribed with T7 RNA polymerase from PCR products, followed
by gel and Sep-Pak purification. The 49 and 484 bp GL2 or GL3
dsRNAs corresponded to position. 113-161 and 113-596, respectively,
relative to the start of translation; the 50 and 501 bp RL dsRNAs
corresponded to position 118-167 and 118-618, respectively. PCR
templates for dsRNA synthesis targeting humanized GFP (hG) were
amplified from pAD3 (Kehlenbach, 1998), whereby 501 and 501 bp hG
dsRNA corresponded to position 118-167 and 118-618, respectively,
to the start codon.
[0125] For annealing of siRNAs, 20 .mu.M single strands were
incubated in annealing buffer (100 mM potassium acetate, 30 mM
HEPES-KOH at pH 7.4, 2 mM magnesium acetate) for 1 min at
90.degree. C. followed by 1 h at 37.degree. C. The 37.degree. C.
incubation step was extended overnight for the 50 and 500 bp dsRNAs
and these annealing reactions were performed at 8.4 .mu.M and 0.84
.mu.M strand concentrations, respectively.
2.1.2 Cell Culture
[0126] S2 cells were propagated in Schneider's Drosophila medium
(Life Technologies) supplemented with 10% FBS, 100 units/ml
penicillin and 100 .mu.g/ml streptomycin at 25.degree. C. 293,
NIH/3T3, HeLa S3, COS-7 cells were grown at 37.degree. C. in
Dulbecco's modified Eagle's medium supplemented with 10% FBS, 100
units/ml penicillin and 100 .mu.g/ml streptomycin. Cells were
regularly passaged to maintain exponential growth. 24 h before
transfection at approx. 80% confluency, mammalian cells were
trypsinized and diluted 1:5 with fresh medium without antibiotics
(1-3.times.10.sup.5 cells/ml) and transferred to 24-well plates
(500 .mu.l/well). S2 cells were not trypsinized before splitting.
Transfection was carried out with Lipofectamine 2000 reagent (Life
Technologies) as described by the manufacturer for adherent cell
lines. Per well, 1.0 .mu.g pGL2-Control (Promega) or pGL3-Control
(Promega), 0.1 .mu.g pRL-TK (Promega) and 0.28 .mu.g siRNA duplex
or dsRNA, formulated into liposomes, were applied; the final volume
was 600 .mu.l per well. Cells were incubated 20 h after
transfection and appeared healthy thereafter. Luciferase expression
was subsequently monitored with the Dual luciferase assay
(Promega). Transfection efficiencies were determined by
fluorescence microscopy for mammalian cell lines after
co-transfection of 1.1 .mu.g hGFP-encoding pAD3 and 0.28 .mu.g
invGL2 inGL2 siRNA and were 70-90%. Reporter plasmids were
amplified in XL-1 Blue (Stratagene) and purified using the Qiagen
EndoFree Maxi Plasmid Kit.
2.2 Results and Discussion
[0127] To test whether siRNAs are also capable of mediating RNAi in
tissue culture, we synthesized 21 nt siRNA duplexes with symmetric
2 nt 3' overhangs directed against reporter genes coding for sea
pansy (Renilla reniformis) and two sequence variants of firefly
(Photinus pyralis, GL2 and GL3) luciferases (FIG. 8a, b). The siRNA
duplexes were co-transfected with the reporter plasmid combinations
pGL2/pRL or pGL3/ pRL into D. melanogaster Schneider S2 cells or
mammalian cells using cationic liposomes. Luciferase activities
were determined 20 h after transfection. In all cell lines tested,
we observed specific reduction of the expression of the reporter
genes in the presence of cognate siRNA duplexes (FIG. 9a-j).
Remarkably, the absolute luciferase expression levels were
unaffected by non-cognate siRNAs, indicating-the absence of harmful
side effects by 21 nt RNA duplexes (e.g. FIG. 10a-d for HeLa
cells). In D. melanogaster S2 cells (FIG. 9a, b), the specific
inhibition of luciferases was complete. In mammalian cells, where
the reporter genes were 50- to 100-fold stronger expressed, the
specific suppression was less complete (FIG. 9c-j). GL2 expression
was reduced 3- to 12-fold, GL3 expression 9- to 25-fold and RL
expression 1-to 3-fold, in response to the cognate siRNAs. For 293
cells, targeting of RL luciferase by RL siRNAs was ineffective,
although GL2 and GL3 targets responded specifically (FIG. 9i, j).
The lack of reduction of RL expression in 293 cells may be due to
its 5- to 20-fold higher expression compared to any other mammalian
cell line tested and/or to limited accessibility of the target
sequence due to RNA secondary structure or associated proteins.
Nevertheless, specific targeting of GL2 and GL3 luciferase by the
cognate siRNA duplexes indicated that RNAi is also functioning in
293 cells.
[0128] The 2 nt 3' overhang in all siRNA-duplexes, except for uGL2,
was composed of (2'-deoxy) thymidine. Substituion of uridine by
thymidine in the 3' overhang was well tolerated in the D.
melanogaster in vitro sytem and the sequence of the overhang was
uncritical for target recognition. The thymidine overhang was
chosen, because it is supposed to enhance nuclease resistance of
siRNAs in the tissue culture medium and within transfected cells.
Indeed, the thymidine-modified GL2 siRNA was slightly more potent
than the unmodified uGL2 siRNA in all cell lines tested (FIG. 9a,
c, e, g, i). It is conceivable that further modifications of the 3'
overhanging nucleotides may provide additional benefits to the
delivery and stability of siRNA duplexes.
[0129] In co-transfection experiments, 25 nM siRNA duplexes with
respect to the final volume of tissue culture medium were used
(FIG. 9, 10). Increasing the siRNA concentration to 100 nM did not
enhance the specific silencing effects, but started to affect
transfection efficiencies due to competition for liposome
encapsulation between plasmid DNA and siRNA (data not shown).
Decreasing the siRNA concentration to 1.5 nM did not reduce the
specific silencing effect (data not shown), even though the siRNAs
were now only 2- to 20-fold more concentrated than the DNA
plasmids. This indicates that siRNAs are extraordinarily powerful
reagents for mediating gene silencing and that siRNAs are effective
at concentrations that are several orders of magnitude below the
concentrations applied in conventional antisense or ribozyme gene
targeting experiments.
[0130] In order to monitor the effect of longer dsRNAs on mammalian
cells, 50 and 500 bp dsRNAs cognate to the reporter genes were
prepared. As non-specific control, dsRNAs from humanized GFP (hG)
(Kehlenbach, 1998) was used. When dsRNAs were co-transfected, in
identical amounts (not concentrations) to the siRNA duplexes, the
reporter gene expression was strongly and unspecifically reduced.
This effect is illustrated for HeLa cells as a representative
example (FIG. 10a-d). The absolute luciferase activities were
decreased unspecifically 10- to 20-fold by 50 bp dsRNA and 20- to
200-fold by 500 bp dsRNA co-transfection, respectively. Similar
unspecific effects were observed for COS-7 and NIH/3T3 cells. For
293 cells, a 10- to 20-fold unspecific reduction was observed only
for 500 bp dsRNAs. Un-specific reduction in reporter gene
expression by dsRNA >30 bp was expected as part of the
interferon response.
[0131] Surprisingly, despite the strong unspecific decrease in
reporter gene expression, we reproducibly detected additional
sequence-specific, dsRNA-mediated silencing. The specific silencing
effects, however, were only apparent when the relative reporter
gene activities were normalized to the hG dsRNA controls (FIG. 10e,
f). A 2- to 10-fold specific reduction in response to cognate dsRNA
was observed, also in the other three mammalian cell lines tested
(data not shown). Specific silencing effects with dsRNAs (356-1662
bp) were previously reported in CHO-K1 cells, but the amounts of
dsRNA required to detect a 2- to 4-fold specific reduction were
about 20-fold higher than in our experiments (Ui-Tei, 2000). Also
CHO-K1 cells appear to be deficient in the interferon response. In
another report, 293, NIH/3T3 and BHK-21 cells were tested for RNAi
using luciferase/lacZ reporter combinations and 829 bp specific
lacZ or 717 bp unspecific GFP dsRNA (Caplen, 2000). The failure of
detecting RNAi in this case may be due to the less sensitive
luciferase/lacZ reporter assay and the length differences of target
and control dsRNA. Taken together, our results indicate that RNAi
is active in mammalian cells, but that the silencing effect is
difficult to detect, if the interferon system is activated by dsRNA
>30 bp.
[0132] In summary, we have demonstrated for the first time
siRNA-mediated gene silencing in mammalian cells. The use of short
siRNAs holds great promise for inactivation of gene function in
human tissue culture and the development of gene-specific
therapeutics.
EXAMPLE 3
Specific Inhibition of Gene Expression by RNA Interference
3.1 Materials and Methods
3.1.1 RNA Preparation and RNAi Assay
[0133] Chemical RNA synthesis, annealing, and luciferase-based RNAi
assays were performed as described in Examples 1 or 2 or in
previous publications (Tuschl et al., 1999; Zamore et al., 2000).
All siRNA duplexes were directed against firefly luciferase, and
the luciferase mRNA sequence was derived from pGEM-luc (GenBank
acc. X65316) as described (Tuschl et al., 1999). The siRNA duplexes
were incubated in D. melanogaster RNAi/translation reaction for 15
min prior to addition of mRNAs. Translation-based RNAi assays were
performed at least in triplicates.
[0134] For mapping of sense target RNA cleavage, a 177-nt
transcript was generated, corresponding to the firefly luciferase
sequence between positions 113-273 relative to the start codon,
followed by the 17-nt complement of the SP6 promoter sequence. For
mapping of aritisense target RNA cleavage, a 166-nt transcript was
produced from a template, which was amplified from plasmid sequence
by PCR using 5' primer TAATACGACTCACTATAGAGCCCATATCGTTTCATA (T7
promoter underlined) and 3' primer AGAGGATGGAACCGCTGG. The target
sequence corresponds to the complement of the firefly luciferase
sequence between positions 50-215 relative to the start codon.
Guanylyl transferase labelling was performed as previously
described (Zamore et al., 2000). For mapping of target RNA
cleavage, 100 nM siRNA duplex was incubated with 5 to 10 nM target
RNA in D. melanogaster embryo lysate under standard conditions
(Zamore et al., 2000) for 2 h at 25.degree. C. The reaction was
stopped by the addition of 8 volumes of proteinase K buffer (200 mM
Tris-HCl pH 7.5, 25 mM EDTA, 300 mM NaCl, 2% w/v sodium dodecyl
sulfate). Proteinase K (E.M. Merck, dissolved in water) was added
to a final concentration of 0.6 mg/ml. The reactions were then
incubated for 15 min at 65.degree. C., extracted with
phenol/chloroform/isoamyl alcohol (25:24:1) and precipitated with 3
volumes of ethanol. Samples were located on 6% sequencing gels.
Length standards were generated by partial RNase T1 digestion and
partial base hydrolysis of the cap-labelled sense or antisense
target RNAs.
3.2 Results
3.2.1 Variation of the 3' Overhang in Duplexes of 21-nt siRNAs
[0135] As described above, 2 or 3 unpaired nucleotides at the 3'
end of siRNA duplexes were more efficient in target RNA degradation
than the respective blunt-ended duplexes. To perform a more
comprehensive analysis of the function of the terminal nucleotides,
we synthesized five 21-nt sense siRNAs, each displayed by one
nucleotide relative to the target RNA, and eight 21-nt antisense
siRNAs, each displaced by one nucleotide relative to the target
(FIG. 11A). By combining sense and antisense siRNAs, eight series
of siRNA duplexes with synthetic overhanging ends were generated
covering a range of 7-nt 3' overhang to 4-nt 5' overhang. The
interference of siRNA duplexes was measured using the dual
luciferase assay system (Tuschl et al., 1999; Zamore et al., 2000).
siRNA duplexes were directed against firefly luciferase mRNA, and
sea pansy luciferase mRNA was used as internal control. The
luminescence ratio of target to control luciferase activity was
determined in the presence of siRNA duplex and was normalized to
the ratio observed in the absence of dsRNA. For comparison, the
interference ratios of long dsRNAs (39 to 504 pb) are shown in FIG.
11B. The interference ratios were determined at concentrations of 5
nM for long dsRNAs (FIG. 11A) and at 100 nM for siRNA duplexes
(FIG. 11C-J). The 100 nM concentrations of siRNAs was chosen,
because complete processing of 5 nM 504 bp dsRNA would result in
120 nM total siRNA duplexes.
[0136] The ability of 21-nt siRNA duplexes to mediate RNAi is
dependent on the number of overhanging nucleotides or base pairs
formed. Duplexes with four to six 3' overhanging nucleotides were
unable to mediate RNAi (FIG. 11C-F), as were duplexes with two or
more 5' overhanging nucleotides (FIG. 11G-J). The duplexes with
2-nt 3' overhangs were most efficient in mediating RNA
interference, though the efficiency of silencing was also
sequence-dependent, and up to 12-fold differences were observed for
different siRNA duplexes with 2-nt 3' overhangs (compare FIG.
11D-H). Duplexes with blunted ends, 1-nt 5' overhang or 1- to 3-nt
3' overhangs were sometimes functional. The small silencing effect
observed for the siRNA duplex with 7-nt 3' overhang (FIG. 11C) may
be due to an antisense effect of the long 3' overhang rather than
due to RNAi. Comparison of the efficiency of RNAi between long
dsRNAs (FIG. 11B) and the most effective 21-nt siRNA duplexes (FIG.
11E, G, H) indicates that a single siRNA duplex at 100 nM
concentration can be as effective as 5 nM 504 bp dsRNA.
3.2.2 Length Variation of the Sense siRNA Paired to an Invariant
21-nt Antisense siRNA
[0137] In order to investigate the effect of length of siRNA on
RNAi, we prepared 3 series of siRNA duplexes, combining three 21-nt
antisense strands with eight, 18- to 25-nt sense strands. The 3'
overhang of the antisense siRNA was fixed to 1, 2, or 3 nt in each
siRNA duplex series, while the sense siRNA was varied at its 3' end
(FIG. 12A). Independent of the length of the sense siRNA, we found
that duplexes with 2-nt 3' overhang of anti-sense siRNA (FIG. 12C)
were more active than those with 1- or 3-nt 3' overhang (FIG. 12B,
D). In the first series, with 1-nt 3' overhang of antisense siRNA,
duplexes with a 21- and 22-nt sense siRNAs, carrying a 1- and 2-nt
3' overhang of sense siRNA, respectively, were most active.
Duplexes with 19- to 25-nt sense siRNAs were also able to mediate
RNA, but to a lesser extent. Similarly, in the second series, with
2-nt overhang of antisense siRNA, the 21-nt siRNA duplex with 2-nt
3' overhang was most active, and any other combination with the 18-
to 25-nt sense siRNAs was active to a significant degree. In the
last series, with 3-nt antisense siRNA 3' overhang, only the duplex
with a 20-nt sense siRNA and the 2-nt sense 3' overhang was able to
reduce target RNA expression. Together, these results indicate that
the length of the siRNA as well as the length of the 3' overhang
are important, and that duplexes of 21-nt siRNAs with 2-nt 3'
overhang are optimal for RNAi.
3.2.3 Length Variation of siRNA Duplexes with a Constant 2-nt 3'
Overhang
[0138] We then examined the effect of simultaneously changing the
length of both siRNA strands by maintaining symmetric 2-nt 3'
overhangs (FIG 13A). Two series of siRNA duplexes were prepared
including the 21-nt siRNA duplex of FIG. 11H as reference. The
length of the duplexes was varied between 20 to 25 bp by extending
the base-paired segment at the 3' end of the sense siRNA (FIG. 13B)
or at the 3' end of the antisense siRNA (FIG. 13C). Duplexes of 20
to 23 bp caused specific repression of target luciferase activity,
but the 21-nt siRNA duplex was at least 8-fold more efficient than
any of the other duplexes. 24- and 25-nt siRNA duplexes did not
result in any detectable interference. Sequence-specific effects
were minor as variations on both ends of the duplex produced
similar effects.
5 3.2.4 2'-Deoxy and 2'-O-Methyl-Modified siRNA Duplexes
[0139] To assess the importance of the siRNA ribose residues for
RNAi, duplexes with 21-nt siRNAs and 2-nt 3' overhangs with
2'-deoxy- or 2'-O-methyl-modified strands were examined (FIG. 14).
Substitution of the 2-nt 3' overhangs by 2'-deoxy nucleotides had
no effect, and even the replacement of two additional
riboncleotides adjacent to the overhangs in the paired region,
produced significantly active siRNAs. Thus, 8 out of 42 nt of a
siRNA duplex were replaced by DNA residues without loss of
activity. Complete substitution of one or both siRNA strands by
2'-deoxy residues, however, abolished RNAi, as did substitution by
2'-O-methyl residues.
3.2.5 Definition of Target RNA Cleavage Sites
[0140] Target RNA cleavage positions were previously determined for
22-nt siRNA duplexes and for a 21-nt/22-nt duplex. It was found
that the position of the target RNA cleavage was located in the
centre of the region covered by the siRNA duplex, 11 or 12 nt
downstream of the first nucleotide that was complementary to the
21- or 22-nt siRNA guide sequence. Five distinct 21 -nt siRNA
duplexes with 2-nt 3' overhang (FIG. 15A) were incubated with 5'
cap-labelled sense or antisense target RNA in D. melanogaster
lysate (Tuschl et al., 1999; Zamore et al., 2000). The 5' cleavage
products were resolved on sequencing gels (FIG. 15B). The amount of
sense target RNA cleaved correlates with the efficiency of siRNA
duplexes determined in the translation-based assay, and siRNA
duplexes 1, 2 and 4 (FIG. 15B and 11H, G, E) cleave target RNA
faster than duplexes 3 and 5 (FIG. 15B and 11F, D). Notably, the
sum of radioactivity of the 5' cleavage product and the input
target RNA were not constant over time, and the 5' cleavage
products did not accumulate. Presumably, the cleavage products,
once released from the siRNA-endonuclease complex, are rapidly
degraded due to the lack of either of the poly(A) tail of the
5'-cap.
[0141] The cleavage sites for both, sense and antisense target RNAs
were located in the middle of the region spanned by the siRNA
duplexes. The cleavage sites for each target produced by the 5
different duplexes varied by 1-nt according to the 1-nt
displacement of the duplexes along the target sequences. The
targets were cleaved precisely 11 nt downstream of the target
position complementary to the 3'-most nucleotide of the
sequence-complementary guide siRNA (FIG. 15A, B).
[0142] In order to determine, whether the 5' or the 3' end of the
guide siRNA sets the ruler for target RNA cleavage, we devised the
experimental strategy outlined in FIG. 16A and B. A 21-nt antisense
siRNA, which was kept invariant for this study, was paired with
sense siRNAs that were modified at either of their 5' or 3' ends.
The position of sense and antisense target RNA cleavage was
determined as described above. Changes in the 3' end of the sense
siRNA, monitored for 1-nt 5' overhang to 6-nt 3' overhang, did
neither effect the position of sense nor antisense target RNA
cleavage (FIG. 16C). Changes in the 5' end of the sense siRNA did
no affect the sense target RNA cleavage (FIG. 16D, top panel),
which was expected because the antisense siRNA was unchanged.
However, the antisense target RNA cleavage was affected and
strongly dependent on the 5' end of the sense siRNA (FIG. 16D,
bottom panel). The antisense target was only cleaved, when the
sense siRNA was 20 or 21 nt in size, and the position of cleavage
different by 1-nt, suggesting that the 5' end of the
target-recognizing siRNA sets the ruler for target RNA cleavage.
The position is located between nucleotide 10 and 11 when counting
in upstream direction from the target nucleotide paired to the
5'-most nucleotide of the guide siRNA (see also FIG. 15A).
3.2.6 Sequence Effects and 2'-Deoxy Substitutions in the 3'
Overhang
[0143] A 2-nt 3' overhang is preferred for siRNA function. We
wanted to know, if the sequence of the overhanging nucleotides
contributes to target recognition, or if it is only a feature
required for reconstitution of the endonuclease complex (RISC or
siRNP). We synthesized sense and antisense siRNAs with AA, CC, GG,
UU, and UG 3' overhangs and included the 2'-deoxy modifications TdG
and TT. The wild-type siRNAs contained AA in the sense 3' overhang
and UG in the antisense 3' overhang (AA/UG). All siRNA duplexes
were functional in the interference assay and reduced target
expression at least 5-fold (FIG. 17). The most efficient siRNA
duplexes that reduced target expression more than 10-fold, were of
the sequence type NN/UG, NN/UU, NN/TdG, and NN/TT (N, any
nucleotide). siRNA duplexes with an antisense siRNA 3' overhang of
AA, CC or GG were less active by a factor 2 to 4 when compared to
the wild-type sequence UG or the mutant UU. This reduction in RNAi
efficiency is likely due to the contribution of the penultimate 3'
nucleotide to sequence-specific target recognition, as the 3'
terminal nucleotide was changed from G to U without effect.
[0144] Changes in the sequence of the 3' overhang of the sense
siRNA did not reveal any sequence-dependent effects, which was
expected, because the sense siRNA must not contribute to sense
target mRNA recognition.
3.2.7 Sequence Specifity of Target Recognition
[0145] In order to examine the sequence-specifity of target
recognition, we introduced sequence changes into the paired
segments of siRNA duplexes and determined the efficiency of
silencing. Sequence changes were introduced by inverting short
segments of 3- or 4-nt length or as point mutations (FIG. 18). The
sequence changes in one siRNA strand were compensated in the
complementary siRNA strand to avoid pertubing the base-paired siRNA
duplex structure. The sequence of all 2-nt 3' overhangs was TT (T,
2'-deoxythymidine) to reduce costs of synthesis. The TT/TT
reference siRNA duplex was comparable in RNAi to the wild-type
siRNA duplex AA/UG (FIG. 17). The ability to mediate reporter mRNA
destruction was quantified using the translation-based luminescence
assay. Duplexes of siRNAs with inverted sequence segments showed
dramatically reduced ability for targeting the firefly luciferase
reporter (FIG. 18). The sequence changes located between the 3' end
and the middle of the antisense siRNA completely abolished target
RNA recognition, but mutations near the 5' end of the antisense
siRNA exhibit a small degree of silencing. Transversion of the A/U
base pair located directly opposite of the predicted target RNA
cleavage site, or one nucleotide further away from the predicted
site, prevented target RNA cleavage, therefore indicating that
single mutation within the centre of a siRNA duplex. discriminate
between mismatched targets.
3.3 Discussion
[0146] siRNAs are valuable reagents for inactivation of gene
expression, not only in insect cells, but also in mammalian cells,
with a great potential for therapeutic application. We have
systematically analysed the structural determinants of siRNA
duplexes required to promote efficient target RNA degradation in D.
melanogaster embryo lysate, thus providing rules for the design of
most potent siRNA duplexes. A perfect siRNA duplex is able to
silence gene expression with an efficiency comparable to a 500 bp
dsRNA, given that comparable quantities of total RNA are used.
3.4 The siRNA User Guide
[0147] Efficiently silencing siRNA duplexes are preferably composed
of 21-nt antisense siRNAs, and should be selected to form a 19 bp
double helix with 2-nt 3' overhanging ends. 2'-deoxy substitutions
of the 2-nt 3' overhanging ribonucleotides do not affect RNAi, but
help to reduce the costs of RNA synthesis and may enhance RNAse
resistance of siRNA duplexes. More extensive 2'-deoxy or
2'-O-methyl modifications, however, reduce the ability of siRNAs to
mediate RNAi, probably by interfering with protein association for
siRNAP assembly.
[0148] Target recognition is a highly sequence-specific process,
mediated by the sIRNA complementary to the target. The 3'-most
nucleotide of the guide siRNA does not contribute to specificity of
target recognition, while the penultimate nucleotide of the 3'
overhang affects target RNA cleavage, and a mismatch reduces RNAi
2- to 4-fold. The 5' end of a guide siRNA also appears more
permissive for mismatched target RNA recognition when compared to
the 3' end. Nucleotides in the centre of the siRNA, located
opposite the target RNA cleavage site, are important specificity
determinants and even single nucleotide changes reduce RNAi to
undetectable level. This suggests that siRNA duplexes may be able
to discriminate mutant or polymorphic alleles in gene targeting
experiments, which may become an important feature for future
therapeutic developments.
[0149] Sense and antisense siRNAs, when associated with the protein
components of the endonclease complex or its commitment complex,
were suggested to play distinct roles; the relative orientation of
the siRNA duplex in this complex defines which strand can be used
for target recognition. Synthetic siRNA duplexes have dyad symmetry
with respect to the double-helical structure, but not with respect
to sequence. The association of siRNA duplexes with the RNAi
proteins in the D. melanogaster lysate will lead to formation of
two asymmetric complexes. In such hypothetical complexes, the
chiral environment is distinct for sense and antisense siRNA, hence
their function. The prediction obviously does not apply to
palindromic siRNA sequences, or to RNAi proteins that could
associate as homodimers. To minimize sequence effects, which may
affect the ratio of sense and antisense-targeting siRNPs, we
suggest to use siRNA sequences with identical 3' overhanging
sequences. We recommend to adjust the sequence of the overhang of
the sense siRNA to that of the antisense 3' overhang, because the
sense siRNA does not have a target in typical knock-down
experiments. Asymmetry in reconstitution of sense and
antisense-cleaving siRNPs could be (partially) responsible for the
variation in RNAi efficiency observed for various 21-nt siRNA
duplexes with 2-nt 3' overhangs used in this study (FIG. 14).
Alternatively, the nucleotide sequence at the target site and/or
the accessibility of the target RNA structure may be responsible
for the variation in efficiency for these siRNA duplexes.
RERERENCES
[0150] Bass, B. L. (2000). Double-stranded RNA as a template for
gene silencing. Cell 101, 235-238. [0151] Bosher, J. M., and
Labouesse, M. (2000). RNA interference: genetic wand and genetic
watchdog. Nat. Cell Biol. 2, E31-36. [0152] Caplen, N. J., Fleenor,
J., Fire, A., and Morgan, R. A. (2000). dsRNA-mediated gene
silencing in cultured Drosophila cells: a tissue culture model for
the analysis of RNA interference. Gene 252, 95-105. [0153]
Catalanotto, C., Azzalin, G.,. Macino, G., and Cogoni, C. (2000).
Gene silencing in worms and fungi. Nature 404, 245. [0154]
Chanfreau, G., Buckle, M., and Jacquier, A. (2000). Recognition of
a conserved class of RNA tetraloops by Saccharomyces cerevisiae
RNase III. Proc. Natl. Acad. Sci. USA 97, 3142-3147. [0155]
Clemens, M. J. (1997). PKR--a protein kinase regulated by
double-stranded RNA. Int. J. Biochem. Cell Biol. 29, 945-949.
[0156] Cogoni, C., and Macino, G. (1999). Homology-dependent gene
silencing in plants and fungi: a number of variations on the same
theme. Curr. Opin. Microbiol. 2, 657-662. [0157] Dalmay, T.,
Hamilton, A., Rudd, S., Angell, S., and Baulcombe, D. C. (2000). An
RNA-dependent RNA polymerase gene in Arabidopsis is required for
posttranscriptional gene silencing mediated by a transgene but not
by a virus. Cell 101, 543-553. [0158] Dernburg, A. F., Zalevsky,
J., Colaiacovo, M. P., and Villeneuve, A. M. (2000).
Transgene-mediated cosuppression in the C. elegans germ line. Genes
& Dev. 14, 1578-1583. [0159] Dunn, J. J. (1982). Ribonuclease
III. In The enzymes, vol 15, part B, P. D. Boyer, ed. (New York:
Academic Press), pp. 485-499. [0160] Filippov, V., Solovyev, V.,
Filippova, M., and Gill, S. S. (2000). A novel type of RNase III
family proteins in eukaryotes. Gene 245, 213-221. [0161] Fire, A.
(1999). RNA-triggered gene silencing. Trends Genet. 15, 358-363.
[0162] Fire, A., Xu, S., Montgomery, M. K., Kostas, S. A., Driver,
S. E., and Mello, C. C. (1998). Potent and specific genetic
interference by double-stranded RNA in Caenorhabditis elegans.
Nature 391, 806-811. [0163] Grishok, A., Tabara, H., and Mello, C.
C. (2000). Genetic requirements for inheritance of RNAi in C.
elegans. Science 287, 2494-2497. [0164] Hamilton, A. J., and
Baulcombe, D. C. (1999). A species of small antisense RNA in
posttranscriptional gene silencing in plants. Science 286, 950-952.
[0165] Hammond, S. M., Bernstein, E., Beach, D., and Hannon, G. J.
(2000). An RNA-directed nuclease mediates post-transcriptional gene
silencing in Drosophila cells. Nature 404, 293-296. [0166]
Jacobsen, S. E., Running, M. P., and M., M. E. (1999). Disruption
of an RNA helicase/RNase III gene in Arabidopsis causes unregulated
cell division in floral meristems: Development 126, 5231-5243.
[0167] Jensen, S., Gassama, M. P., and Heidmann, T. (1999). Taming
of transposable elements by homology-dependent gene silencing. Nat.
Genet. 21, 209-212. [0168] Kehlenbach, R. H., Dickmanns, A. &
Gerace, L. (1998). Nucleocytoplasmic shuttling factors including
Ran and CRM1 mediate nuclear export of NFAT In vitro. J. Cell Biol.
141, 863-874. [0169] Kennerdell, J. R., and Carthew, R. W. (1998).
Use of dsRNA-mediated genetic interference to demonstrate that
frizzled and frizzled 2 act in the wingless pathway. Cell 95,
1017-1026. [0170] Ketting, R. F., Haverkamp, T. H., van Luenen, H.
G., and Plasterk, R. H. (1999). Mut-7 of C. elegans, required for
transposon silencing and RNA interference, is a homolog of Werner
syndrome helicase and RNaseD. Cell 99, 133-141. [0171] Ketting, R.
F., and Plasterk, R. H.. (2000). A genetic link between
co-suppression and RNA interference in C. elegans. Nature 404,
296-298. [0172] Lucy, A. P., Guo, H. S., Li, W. X., and Ding, S. W.
(2000). Suppression of post-transcriptional gene silencing by a
plant viral protein localized in the nucleus. EMBO J. 19,
1672-1680. [0173] Matsuda, S., Ichigotani, Y., Okuda, T., Irimura,
T., Nakatsugawa, S., and Hamaguchi, M. (2000). Molecular cloning
and characterization of a novel human gene (HERNA) which encodes a
putative RNA-helicase. Biochim. Biophys. Acta 31, 1-2. [0174]
Milligan, J. F., and Uhlenbeck, O. C. (1989). Synthesis of small
RNAs using T7 RNA polymerase. Methods Enzymol. 180, 51-62. [0175]
Mourrain, P., Beclin, C., Elmayan, T., Feuerbach, F., Godon, C.,
Morel, J. B., Jouette, D., Lacombe, A. M., Nikic, S., Picault, N.,
Remoue, K., Sanial, M., Vo, T. A., and Vaucheret, H. (2000).
Arabidopsis SGS2 and SGS3 genes are required for
posttranscriptional gene silencing and natural virus resistance.
Cell 101, 533-542. [0176] Ngo, H., Tschudi, C., Gull, K., and Ullu,
E. (1998). Double-stranded RNA induces mRNA degradation in
Trypanosoma brucei. Proc. Natl. Acad. Sci. USA 95, 14687-14692.
[0177] Nicholson, A. W. (1999). Function, mechanism and regulation
of bacterial ribonucleases. FEMS Microbiol. Rev. 23, 371-390.
[0178] Oelgeschlager, M., Larrain, J., Geissert, D., and De
Robertis, E. M. (2000). The evolutionarily conserved BMP-binding
protein Twisted gastrulation promotes BMP signalling. Nature 405,
757-763. [0179] Pan, T., and Uhlenbeck, O. C. (1992). In vitro
selection of RNAs that undergo autolytic cleavage with Pb.sup.2+.
Biochemistry 31, 3887-3895. [0180] Pelissier, T., and Wassenegger,
M. (2000). A DNA target of 30 bp is sufficient for RNA-directed
methylation. RNA 6, 55-65. [0181] Plasterk, R. H., and Ketting, R.
F. (2000). The silence of the genes. Curr. Opin. Genet. Dev. 10,
562-567. [0182] Ratcliff, F. G., MacFarlane, S. A., and Baulcombe,
D. C. (1999). Gene Silencing without DNA. RNA-mediated
cross-protection between viruses. Plant Cell 11, 1207-1216. [0183]
Robertson, H. D. (1990). Escherichia coli ribonuclease III. Methods
Enzymol. 181, 189-202. [0184] Robertson, H. D. (1982). Escherichia
coli ribonuclease III cleavage sites. Cell 30, 669-672. [0185]
Romaniuk, E., McLaughlin, L. W., Neilson, T., and Romaniuk, P. J.
(1982). The effect of acceptor oligoribonucleotide sequence on the
T4 RNA ligase reaction. Eur J Biochem 125, 639-643. [0186] Sharp,
P. A. (1999). RNAi and double-strand RNA. Genes & Dev. 13,
139-141. [0187] Sijen, T., and Kooter, J. M. (2000).
Post-transcriptional gene-silencing: RNAs on the attack or on the
defense? Bioessays 22, 520-531. [0188] Smardon, A., Spoerke, J.,
Stacey, S., Klein, M., Mackin, N., and Maine, E. (2000). EGO-1 is
related to RNA-directed RNA polymerase and functions in germ-line
development and RNA interference in C. elegans. Curr. Biol. 10,
169-178. [0189] Svoboda, P., Stein, P., Hayashi, H., and Schultz,
R. M. (2000). Selective reduction of dormant maternal mRNAs in
mouse oocytes by RNA interference. Development 127, 4147-4156.
[0190] Tabara, H., Sarkissian, M., Kelly, W. G., Fleenor, J.,
Grishok, A., Timmons, L., Fire, A., and Mello, C. C. (1999). The
rde-1 gene, RNA interference, and transposon silencing in C.
elegans. Cell 99, 123-132. [0191] Tuschl, T., Ng, M. M., Pieken,
W., Benseler, F., and Eckstein, F. (1993). Importance of exocyclic
base functional groups of central core guanosines. for hammerhead
ribozyme activity. Biochemistry 32, 11658-11.668. [0192] Tusch, T.,
Sharp, P. A., and Bartel, D. P. (1998). Selection in vitro of novel
ribozymes from a partially randomized U2 and U6 snRNA library. EMBO
J. 17, 2637-2650. [0193] Tuschl, T., Zamore, P. D., Lehmann, R.,
Bartel, D. P., and Sharp, P. A. (1999). Targeted mRNA degradation
by double-stranded RNA in vitro. Genes & Dev. 13, 3191-3197.
[0194] Ui-Tei, K., Zenno, S., Miyata, Y. & Saigo, K. (2000).
Sensitive assay of RNA interference in Drosophila and Chinese
hamster cultured cells using firefly luciferase gene as target.
FEBS Letters 479, 79-82. [0195] Verma, S., and Eckstein, F. (1999).
Modified oligonucleotides: Synthesis and strategy for users. Annu.
Rev. Biochem. 67, 99-134. [0196] Voinnet, O., Lederer, C., and
Baulcombe, D. C. (2000). A viral movement protein prevents spread
of the gene silencing signal in Nicotiana benthamiana. Cell 103,
157-167. [0197] Wassenegger, M. (2000). RNA-directed DNA
methylation. Plant Mol. Biol. 43, 203-220. [0198] Wianny, F., and
Zernicka-Goetz, M. (2000). Specific interference with gene function
by double-stranded RNA in early mouse development. Nat. Cell Biol.
2, 70-75. [0199] Wu, H., Xu, H., Miraglia, L. J., and Crooke, S. T.
(2000). Human RNase III is a 160 kDa Protein Involved in
Preribosomal RNA Processing. J. Biol. Chem. 17, 17. [0200] Yang,
D., Lu, H. and Erickson, J. W. (2000) Evidence that processed small
dsRNAs may mediate sequence-specific mRNA degradation during RNAi
in drosophilia embryos. Curr. Biol., 10, 1191-1200. [0201] Zamore,
P. D., Tuschl, T., Sharp, P. A., and Bartel, D. P. (2000). RNAi:
Double-stranded RNA directs the ATP-dependent cleavage of mRNA at
21 to 23 nucleotide intervals. Cell 101, 25-33. [0202] Zhang, K.,
and Nicholson, A. W. (1997). Regulation of ribonuclease III
processing by double-helical sequence antideterminahts. Proc. Natl.
Acad. Sci. USA 94, 13437-13441.
Sequence CWU 1
1
101 1 38 DNA Artificial sequence pGEM-luc sequence from the Pp-luc
plasmid misc_feature (4)..(20) T7 promoter 1 gcgtaatacg actcactata
gaacaattgc ttttacag 38 2 35 DNA Artificial Sequence pGEM-luc
sequence from the Pp-luc plasmid misc_feature (1)..(17) SP6
promoter 2 atttaggtga cactataggc ataaagaatt gaaga 35 3 30 DNA
Artificial sequence reverse transcription primer for cloning RNAs
misc_feature (10)..(15) Eco R1 site 3 gactagctgg aattcaagga
tgcggttaaa 30 4 30 DNA Artificial sequence PCR primer for cloning
RNAs misc_feature (10)..(15) Eco R1 site 4 cagccaacgg aattcatacg
actcactaaa 30 5 36 DNA Artificial sequence PCR primer that
amplifies firefly luciferase sequence in a plasmid misc_feature
(1)..(19) T7 promoter 5 taatacgact cactatagag cccatatcgt ttcata 36
6 18 DNA Artificial sequence PCR primer that amplifies firefly
luciferase sequence in a plasmid 6 agaggatgga accgctgg 18 7 177 RNA
Artificial sequence luciferase gene 7 gaacaauugc uuuuacagau
gcacauaucg aggugaacau cacguacgcg gaauacuucg 60 aaauguccgu
ucgguuggca gaagcuauga aacgauaugg gcugaauaca aaucacagaa 120
ucgucguaug cagugaaaac ucucuucaau ucuuuaugcc uauaguguca ccuaaau 177
8 180 RNA Artificial sequence luciferase gene 8 ggcauaaaga
auugaagaga guuuucacug cauacgacga uucugugauu uguauucagc 60
ccauaucguu ucauagcuuc ugccaaccga acggacauuu cgaaguauuc cgcguacgug
120 auguucaccu cgauaugugc aucuguaaaa gcaauuguuc uauagugagu
cguauuacgc 180 9 39 RNA Artificial sequence luciferase gene 9
gcacauaucg aggugaacau cacguacgcg gaauacuuc 39 10 52 RNA Artificial
sequence luciferase gene 10 gcacauaucg aggugaacau cacguacgcg
gaauacuucg aaauguccgu uc 52 11 111 RNA Artificial sequence
luciferase gene 11 gcacauaucg aggugaacau cacguacgcg gaauacuucg
aaauguccgu ucgguuggca 60 gaagcuauga aacgauaugg gcugaauaca
aaucacagaa ucgucguaug c 111 12 52 RNA Artificial sequence
luciferase gene 12 gcacauaucg aggugaacau cacguacgcg gaauacuucg
aaauguccgu uc 52 13 54 RNA Artificial sequence luciferase gene 13
gaacggacau uucgaaguau uccgcguacg ugauguucac cucgauaugu gcac 54 14
21 RNA Artificial sequence luciferase gene 14 cguacgcgga auacuucgau
u 21 15 21 RNA Artificial sequence luciferase gene 15 ucgaaguauu
ccgcguacgu u 21 16 21 DNA Artificial sequence luciferase gene
misc_feature (1)..(21) molecule is combined DNA/RNA 16 cguacgcgga
auacuucgat t 21 17 21 DNA Artificial sequence luciferase gene
misc_feature (1)..(21) molecule is combined DNA/RNA 17 ucgaaguauu
ccgcguacgt t 21 18 21 DNA Artificial sequence luciferase gene
misc_feature (1)..(21) molecule is combined DNA/RNA 18 cuuacgcuga
guacuucgat t 21 19 21 DNA Artificial sequence luciferase gene
misc_feature (1)..(21) molecule is combined DNA/RNA 19 ucgaaguacu
cagcguaagt t 21 20 21 DNA Artificial sequence luciferase gene
misc_feature (1)..(21) molecule is combined DNA/RNA 20 agcuucauaa
ggcgcaugct t 21 21 21 DNA Artificial sequence luciferase gene
misc_feature (1)..(21) molecule is combined DNA/RNA 21 gcaugcgccu
uaugaagcut t 21 22 21 DNA Artificial sequence luciferase gene
misc_feature (1)..(21) molecule is combined DNA/RNA 22 aaacaugcag
aaaaugcugt t 21 23 21 DNA Artificial sequence luciferase gene
misc_feature (1)..(21) molecule is combined DNA/RNA 23 cagcauuuuc
ugcauguuut t 21 24 21 RNA Artificial sequence luciferase gene 24
aucacguacg cggaauacuu c 21 25 21 RNA Artificial sequence luciferase
gene 25 guauuccgcg uacgugaugu u 21 26 21 RNA Artificial sequence
luciferase gene 26 ucacguacgc ggaauacuuc g 21 27 21 RNA Artificial
sequence luciferase gene 27 cacguacgcg gaauacuucg a 21 28 21 RNA
Artificial sequence luciferase gene 28 acguacgcgg aauacuucga a 21
29 21 RNA Artificial sequence luciferase gene 29 cguacgcgga
auacuucgaa a 21 30 21 RNA Artificial sequence luciferase gene 30
aguauuccgc guacgugaug u 21 31 21 RNA Artificial sequence luciferase
gene 31 aaguauuccg cguacgugau g 21 32 21 RNA Artificial sequence
luciferase gene 32 gaaguauucc gcguacguga u 21 33 21 RNA Artificial
sequence luciferase gene 33 cgaaguauuc cgcguacgug a 21 34 21 RNA
Artificial sequence luciferase gene 34 ucgaaguauu ccgcguacgu g 21
35 21 RNA Artificial sequence luciferase gene 35 uucgaaguau
uccgcguacg u 21 36 21 RNA Artificial sequence luciferase gene 36
uuucgaagua uuccgcguac g 21 37 18 RNA Artificial sequence luciferase
gene 37 cguacgcgga auacuucg 18 38 21 RNA Artificial sequence
luciferase gene 38 uucgaaguau uccgcguacg u 21 39 19 RNA Artificial
sequence luciferase gene 39 cguacgcgga auacuucga 19 40 20 RNA
Artificial sequence luciferase gene 40 cguacgcgga auacuucgaa 20 41
21 RNA Artificial sequence luciferase gene 41 cguacgcgga auacuucgaa
a 21 42 22 RNA Artificial sequence luciferase gene 42 cguacgcgga
auacuucgaa au 22 43 23 RNA Artificial sequence luciferase gene 43
cguacgcgga auacuucgaa aug 23 44 24 RNA Artificial sequence
luciferase gene 44 cguacgcgga auacuucgaa augu 24 45 25 RNA
Artificial sequence luciferase gene 45 cguacgcgga auacuucgaa auguc
25 46 21 RNA Artificial sequence luciferase gene 46 ucgaaguauu
ccgcguacgu g 21 47 21 RNA Artificial sequence luciferase gene 47
cgaaguauuc cgcguacgug a 21 48 20 RNA Artificial sequence luciferase
gene 48 cguacgcgga auacuucgaa 20 49 20 RNA Artificial sequence
luciferase gene 49 cgaaguauuc cgcguacgug 20 50 21 RNA Artificial
sequence luciferase gene 50 cguacgcgga auacuucgaa a 21 51 21 RNA
Artificial sequence luciferase gene 51 ucgaaguauu ccgcguacgu g 21
52 22 RNA Artificial sequence luciferase gene 52 cguacgcgga
auacuucgaa au 22 53 22 RNA Artificial sequence luciferase gene 53
uucgaaguau uccgcguacg ug 22 54 23 RNA Artificial sequence
luciferase gene 54 cguacgcgga auacuucgaa aug 23 55 23 RNA
Artificial sequence luciferase gene 55 uuucgaagua uuccgcguac gug 23
56 24 RNA Artificial sequence luciferase gene 56 cguacgcgga
auacuucgaa augu 24 57 24 RNA Artificial sequence luciferase gene 57
auuucgaagu auuccgcgua cgug 24 58 25 RNA Artificial sequence
luciferase gene 58 cguacgcgga auacuucgaa auguc 25 59 25 RNA
Artificial sequence luciferase gene 59 cauuucgaag uauuccgcgu acgug
25 60 19 RNA Artificial sequence luciferase gene 60 guacgcggaa
uacuucgaa 19 61 20 RNA Artificial sequence luciferase gene 61
ucgaaguauu ccgcguacgu 20 62 22 RNA Artificial sequence luciferase
gene 62 acguacgcgg aauacuucga aa 22 63 22 RNA Artificial sequence
luciferase gene 63 ucgaaguauu ccgcguacgu ga 22 64 23 RNA Artificial
sequence luciferase gene 64 cacguacgcg gaauacuucg aaa 23 65 23 RNA
Artificial sequence luciferase gene 65 ucgaaguauu ccgcguacgu gau 23
66 21 RNA Artificial sequence luciferase gene 66 acguacgcgg
aauacuucga a 21 67 21 RNA Artificial sequence luciferase gene 67
cgaaguauuc cgcguacgug a 21 68 21 RNA Artificial sequence luciferase
gene 68 cacguacgcg gaauacuucg a 21 69 21 RNA Artificial sequence
luciferase gene 69 gaaguauucc gcguacguga u 21 70 21 RNA Artificial
sequence luciferase gene 70 ucacguacgc ggaauacuuc g 21 71 21 RNA
Artificial sequence luciferase gene 71 aaguauuccg cguacgugau g 21
72 21 RNA Artificial sequence luciferase gene 72 aucacguacg
cggaauacuu c 21 73 21 RNA Artificial sequence luciferase gene 73
aguauuccgc guacgugaug u 21 74 18 RNA Artificial sequence luciferase
gene 74 acgcggaaua cuucgaaa 18 75 21 RNA Artificial sequence
luciferase gene 75 ucgaaguauu ccgcguacgu g 21 76 19 RNA Artificial
sequence luciferase gene 76 uacgcggaau acuucgaaa 19 77 20 RNA
Artificial sequence luciferase gene 77 guacgcggaa uacuucgaaa 20 78
21 RNA Artificial sequence luciferase gene 78 cguacgcgga auacuucgaa
a 21 79 22 RNA Artificial sequence luciferase gene 79 acguacgcgg
aauacuucga aa 22 80 23 RNA Artificial sequence luciferase gene 80
cacguacgcg gaauacuucg aaa 23 81 21 DNA Artificial sequence
luciferase gene misc_feature (1)..(21) molecule is combined DNA/RNA
81 cguacgcgga auacuucgat t 21 82 21 DNA Artificial sequence
luciferase gene misc_feature (1)..(21) molecule is combined DNA/RNA
82 ucgaaguauu ccgcguacgt t 21 83 21 DNA Artificial sequence
luciferase gene misc_feature (1)..(21) molecule is combined DNA/RNA
83 augccgcgga auacuucgat t 21 84 21 DNA Artificial sequence
luciferase gene misc_feature (1)..(21) molecule is combined DNA/RNA
84 ucgaaguauu ccgcggcaut t 21 85 21 DNA Artificial sequence
luciferase gene misc_feature (1)..(21) molecule is combined DNA/RNA
85 cguagcgcga auacuucgat t 21 86 21 DNA Artificial sequence
luciferase gene misc_feature (1)..(21) molecule is combined DNA/RNA
86 ucgaaguauu cgcgcuacgt t 21 87 21 DNA Artificial sequence
luciferase gene misc_feature (1)..(21) molecule is combined DNA/RNA
87 cguacgcgag uaacuucgat t 21 88 21 DNA Artificial sequence
luciferase gene misc_feature (1)..(21) molecule is combined DNA/RNA
88 ucgaaguuac ucgcguacgt t 21 89 21 DNA Artificial sequence
luciferase gene misc_feature (1)..(21) molecule is combined DNA/RNA
89 cguacgcgga auuucacgat t 21 90 21 DNA Artificial sequence
luciferase gene misc_feature (1)..(21) molecule is combined DNA/RNA
90 ucgugaaauu ccgcguacgt t 21 91 21 DNA Artificial sequence
luciferase gene misc_feature (1)..(21) molecule is combined DNA/RNA
91 cguacgcgga auacuuagct t 21 92 21 DNA Artificial sequence
luciferase gene misc_feature (1)..(21) molecule is combined DNA/RNA
92 gcuaaguauu ccgcguacgt t 21 93 21 DNA Artificial sequence
luciferase gene misc_feature (1)..(21) molecule is combined DNA/RNA
93 cguacgcggu auacuucgat t 21 94 21 DNA Artificial sequence
luciferase gene misc_feature (1)..(21) molecule is combined DNA/RNA
94 ucgaaguaua ccgcguacgt t 21 95 21 DNA Artificial sequence
luciferase gene misc_feature (1)..(21) molecule is combined DNA/RNA
95 cguacgcgga uuacuucgat t 21 96 21 DNA Artificial sequence
luciferase gene misc_feature (1)..(21) molecule is combined DNA/RNA
96 ucgaaguaau ccgcguacgt t 21 97 39 RNA Artificial sequence
luciferase gene 97 gaaguauucc gcguacguga uguucaccuc gauaugugc 39 98
52 RNA Artificial sequence luciferase gene 98 gaacggacau uucgaaguau
uccgcguacg ugauguucac cucgauaugu gc 52 99 111 RNA Artificial
sequence luciferase gene 99 gcauacgacg auucugugau uuguauucag
cccauaucgu uucauagcuu cugccaaccg 60 aacggacauu ucgaaguauu
ccgcguacgu gauguucacc ucgauaugug c 111 100 18 DNA Artificial
sequence adapter nucleotide for cloning RNAs misc_feature (1)..(1)
phosphorylated misc_feature (1)..(3) RNA misc_feature (1)..(18)
molecule is combined DNA/RNA misc_feature (4)..(18) DNA
misc_feature (18)..(18) base modified with 4-hydroxymethylbenzyl
100 uuuaaccgca tccttctc 18 101 20 DNA Artificial sequence adapter
nucleotide for cloning RNAs misc_feature (1)..(17) DNA misc_feature
(18)..(20) RNA 101 tactaatacg actcactaaa 20
* * * * *