U.S. patent application number 11/334333 was filed with the patent office on 2007-04-19 for high artemisinin yielding plant genotype 'cim-arogya'.
This patent application is currently assigned to COUNCIL OF SCIENTIFIC AND INDUSTRIAL RESEARCH. Invention is credited to Ravi Prakash Bansal, Rajendra Singh Bhakuni, Mahendra Pandurang Darokar, Anil Kumar Gupta, Madan Mohan Gupta, Suman Preet Singh Khanuja, Anuraddha Kumar, Raj Kishori Lal, Shilpi Paul, Govind Ram, Ajit Kumar Shasany, Anil Kumar Singh, Sudeep Tandon, Ram Kishor Verma.
Application Number | 20070089211 11/334333 |
Document ID | / |
Family ID | 35055892 |
Filed Date | 2007-04-19 |
United States Patent
Application |
20070089211 |
Kind Code |
P1 |
Khanuja; Suman Preet Singh ;
et al. |
April 19, 2007 |
High Artemisinin yielding plant genotype 'CIM-Arogya'
Abstract
The present invention is related to the development of a novel,
distinct high herb and artemisinin yielding genotype of Artemisia
annua obtained through systematic marker assisted breeding followed
by selection of uniform population in a methodical way wherein the
genotype is distinct, uniform and stably maintainable by continuous
rouging of off types in the population using DNA marker at early
seedling stage from nursery itself and suitable for commercial
cultivation.
Inventors: |
Khanuja; Suman Preet Singh;
(Lucknow, IN) ; Paul; Shilpi; (Lucknow, IN)
; Shasany; Ajit Kumar; (Lucknow, IN) ; Gupta; Anil
Kumar; (Lucknow, IN) ; Darokar; Mahendra
Pandurang; (Lucknow, IN) ; Gupta; Madan Mohan;
(Lucknow, IN) ; Verma; Ram Kishor; (Lucknow,
IN) ; Ram; Govind; (Lucknow, IN) ; Kumar;
Anuraddha; (Lucknow, IN) ; Lal; Raj Kishori;
(Lucknow, IN) ; Bansal; Ravi Prakash; (Lucknow,
IN) ; Singh; Anil Kumar; (Lucknow, IN) ;
Bhakuni; Rajendra Singh; (Lucknow, IN) ; Tandon;
Sudeep; (Lucknow, IN) |
Correspondence
Address: |
Ladas & Parry LLP
26 West 61 Street
New York
NY
10023
US
|
Assignee: |
COUNCIL OF SCIENTIFIC AND
INDUSTRIAL RESEARCH
|
Family ID: |
35055892 |
Appl. No.: |
11/334333 |
Filed: |
January 18, 2006 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10811244 |
Mar 26, 2004 |
|
|
|
11334333 |
Jan 18, 2006 |
|
|
|
Current U.S.
Class: |
PLT/258 |
Current CPC
Class: |
A01H 6/14 20180501; A01H
5/02 20130101 |
Class at
Publication: |
PLT/258 |
International
Class: |
A01H 5/00 20060101
A01H005/00 |
Claims
1. A new and distinct genotype of Artemisia annua `CIM-Arogya`,
developed through marker assisted breeding, possessing the
following combination of characters: Genus Artemisia Species annua
Family Asteraecae Common name Qinghao Plant height 280-305 cm Plant
canopy Oval Growth habit Erect Branching sympodial branching
pattern Stem: ingle, round hard woody green (137D) Stem width 5-12
cm (app) Number of Branches: primary branches: 55-65 Secondary
branches per primary branch: 50-60 Tertiary branches per secondary
branch: 37-45 Range of length of Internodes Main stem--4-6 cm at
bottom; 10-12 cm at middle, 2-5 cm at the top Primary branch 2-5 cm
at bottom, 8-11 cm at middle, 2-4 cm at the top Secondary branch
8-11 cm at the bottom, 5-7 cm at the middle, 1-3 cm at the top
Tertiary branch 3-5 cm at the bottom, 1-3 cm at the middle, 0.5-1.5
cm at the top Leaf--Green (137 B) Texture--Thin and flexible
Surface--Smooth non pubescent Shape--Pinnately compound leaf
Margin--Pinnetisected Tip--Acute Petiol length--2.5-3.50 cm Lamina
length--5-7 cm Lamina width--4-5 cm Inflorescence--Capitulum (head)
Flower--Arranged in whorls. Colour yellow group (7A) Two types of
flowers Disc florets and Ray florets. Disc florets are bisexual and
ray florets are unisexual (female) Colour Greenish yellow 2-3 mm in
diameter Receptacles Glabrous Calyx Bracteates Corolla Sympelatous,
tubular top split in to 5 lobes in Disc florets and 2-3 lobes in
Ray florets (legulate) Androecium 5 stamens, Anther lobes are fused
and filaments are free Colour Yellowish Gynoecium Unilocular,
inferior bifid stigma. Colour yellowish Time of flowering--198
days. Seed setting 240 days (app) Artemisinin content 0.9 to 1.1%
Artemesinic acid 0.002-0.004% Oil content 0.35-0.45% alternate
deeply dissected aromatic leaves ranging between 2.5 to 5.0 cm in
length. tiny yellow nodding flowers (capitula) capitula in loose
panicle containing numerous central bisexual florets and marginal
pistillate florets receptacle is glabrous florets and receptacle
bear abundant 10-celled biseriate trichomes globular canopy dry
leaf yield of about 50 Q per hectare flowers (7A) arranged in a
head or Capitulum.
Description
FIELD OF THE PRESENT INVENTION
[0001] The present invention was related to the development of a
novel, distinct high herb and artemisinin yielding genotype of
Artemisia annua obtained through systematic marker assisted
breeding followed by selection of uniform population in a
methodical way. This invention further relates to marker assisted
breeding to reach the high artemisinin yielding genotype. The
genotype is distinct, uniform and stably maintainable by continuous
rouging of off types in the population using DNA marker at early
seedling stage from nursery itself and suitable for commercial
cultivation.
BACKGROUND AND PRIOR ART REFERENCES OF THE PRESENT INVENTION
[0002] Many Artemisia species are cited by early herbalists
including Theophrastus in the third century B.C (Einarson and Link,
1976), Pliny (Bostock and Riley, 1855-1857) and Dioscorides
(Gunther, 1959) in the first century BC. Wormwood (probably the
species A. judaica) is mentioned in the Bible (Rev 8:10, 11). In
340 AD, Ge Hong prescribed aerial part of Artemisia for the
treatment of fever in the "Chinese hand book of prescriptions for
emergency treatments" and in 1527, Li Shi Zhen, a Chinese
herbalist/pharmacologists mentioned the use of huang hua hao (or
yellow flower, later identified as A. annua) for treatment of
children's fever and qinghao (A. apiacea) as a treatment for the
disease now known as malaria.
[0003] The plant Artemisia annua (family: Asteraceae) produces a
sesquiterpenoid lactone endoperoxide named artemisinin which is a
promising antimalarial drug effective against Plasmodium
falciparum, Plasmodium vivax at nanomolar concentration.
Artemisinins are active against Schistosoma mansoni and S.
japonicum in-vitro and in-vivo in experiments in animals. These
schistosomes, like malarial parasites, degrade haemoglobin and
produce hemozoin. These compounds are also active against
Leishmania major, Toxoplasma gondii and Pnenmocystic carinii
in-vitro and against P. carinii in-vivo. Artemisinins have
immunosuppressive activity and also potential anticancer activity.
For these activities, the doses of artemisinin required are
substantially higher than the dose for antimalarial activities.
According to Meshnick et at., (1996) (Microbiological Reviews
6:301-315) the antimalarial endoperoxides including artemisinin,
dihydroartemisinin and arteethers, are not likely to be useful for
other therapeutic purposes except against malarial parasites.
[0004] Although artemisinin rapidly suppresses the activity of
parasites like Plasmodium vivax and P. falciparum, problems with
high rate of recrudescence (>10% recrudescence infections),
short half life persist. Hence, there is a need to develop new
drugs against quinolone resistant pathogenic bacteria. It is a
known fact that clinically used antibacterial broad spectrum
compounds such as quinolones which exhibit DNA gyrase activity of
Mycobacterium sp. (causing tuberculosis), Haemophilus sp. and
Haemophilus influenzae are gradually becoming ineffective due to
the occurrence of mutatious in gyrase genes and their natural
selection under continuous use of such drug. The compound .alpha.
arteether developed as antimalarial drugs by Central Drug Research
Institute (CDRI), Lucknow, India and Central Institute of Medicinal
& Aromatic Plants (CIMAP), Lucknow, India, after phase II
clinical trial is a stable derivative of artemisinin. Earlier we
have found a novel property of .alpha.-arteether as being effective
against the gyr A mutant strains of E. coli but ineffective against
wild type strains (U.S. Pat. No. 6,127,405). Also we have developed
a strategic and novel composition comprising .alpha. arteether and
nalidixic acid or quinolone drugs which is useful as an advanced
generation drug to counter the resistance development itself and
having a potential to be used in treating infectious diseases and
in inhibiting the resistance developed due to mutation in the gyr A
gene of bacteria, particularly in those cases where drug resistant
strains are known to appear very frequently (U.S. Pat. No.
6,423,741). We have already reported a genotype `Jeevanraksha`
earlier yielding more than 1% artemisinin (Sushil Kumar, S
Banerjee, S Dwivedi, M M Gupta, R K Verma, D C Jain, S P S Khanuja,
A K Mathur, G D Bagchi, M Zehra, V K Mehta, A A Naqvi, S Paul, G
Ram, M Ram, D Saikia, R S Sangwan, T R Santha Kumar, A K Shasany, M
P Darokar, A K Singh, A Singh (1999) Registration of Jeevanraksha
and Suraksha varieties of the antimalarial medicinal plant
Artemisia annua. Jour. Med. Arom. Plant Sci. 21: 47-48.) and the
method to increase yield through harvesting management (U.S. Pat.
No. 6,393,763).
[0005] It is always beneficial to have diversity in genotypes in
different background than a single genotype for commercial
cultivation. With this objective a novel genotype was developed
through a novel method of DNA marker assisted breeding.
OBJECTS OF THE PRESENT INVENTION
[0006] The main object of the present invention is to develop a
novel, distinct high herb and artemisinin yielding genotype of
Artemisia annua.
SUMMARY OF THE PRESENT INVENTION
[0007] The present invention was related to the development of a
novel, distinct high herb and artemisinin yielding genotype of
Artemisia annua obtained through systematic marker assisted
breeding followed by selection of uniform population in a
methodical way. This invention further relates to marker assisted
breeding to reach the high artemisinin yielding genotype. The
genotype is distinct, uniform and stably maintainable by continuous
rouging of off types in the population using DNA marker at early
seedling stage from nursery itself and suitable for commercial
cultivation.
DETAILED DESCRIPTION OF THE PRESENT INVENTION
[0008] Accordingly, the present invention relates to a new and
distinct genotype of Artemisia annua `CIM-Arogya`, developed
through marker assisted breeding, possessing the following
combination of characters: [0009] Genus: Artemisia [0010] Species:
annua [0011] Family: Asteraecae [0012] Common name: Qinghao [0013]
Plant height: 280-305 cm [0014] Plant canopy: Oval [0015] Growth
habit: Erect [0016] Branching: sympodial branching pattern [0017]
Stem: Single, round hard woody green (137D) Stem width 5-12 cm
(app) [0018] Number of branches: [0019] Primary branches.--55-65.
[0020] Secondary branches per primary branch.--50-60. [0021]
Tertiary branches per secondary branch.--37-45. [0022] Range of
length of internodes: [0023] Main stem.--4-6 cm at bottom, 10-12 cm
at middle, 2-5 cm at the top. [0024] Primary branch.--2-5 cm at
bottom, 8-11 cm at middle, 2-4 cm at the top. [0025] Secondary
branch.--8-11 cm at the bottom, 5-7 cm at the middle, 1-3 cm at the
top. [0026] Tertiary branch.--3-5 cm at the bottom, 1-3 cm at the
middle, 0.5-1.5 cm at the top. [0027] Leaf: Green (137 B) [0028]
Texture.--Thin and flexible. [0029] Surface.--Smooth non pubescent.
[0030] Shape.--Pinnately compound leaf. [0031]
Margin.--Pinnetisected. [0032] Tip.--Acute. [0033] Petiol
length.--2.5-3.50 cm. [0034] Lamina length.--5-7 cm. [0035] Lamina
width.--4-5 cm. [0036] Inflorescence.--Capitulum (head). [0037]
Flower.--arranged in whorls. Colour yellow group (7A). [0038] Two
types of flowers.--Disc florets and Ray florets. Disc florets are
bisexual and ray florets are unisexual (female). [0039]
Colour.--Greenish yellow 2-3mm in diameter. [0040]
Receptacles.--Glabrous. [0041] Calyx.--Bracteates. [0042]
Corolla.--Sympelatous, tubular top split in to 5 lobes in Disc
florets and 2-3 lobes in Ray florets (legulate). [0043] Androecium:
5 stamens, Anther lobes are fused and filaments are free [0044]
Colour.--Yellowish. [0045] Gynoecium: Unilocular, inferior bifid
stigma [0046] Colour.--yellowish. [0047] Time of flowering: 198
days. [0048] Seed setting: 240 days (app) [0049] Artemisinin
content: 0.9 to 1.1% [0050] Artemesinic acid: 0.002-0.004% [0051]
Oil content: 0.35-0.45% [0052] Alternate deeply dissected aromatic
leaves: ranging between 2.5 to 5.0 cm in length. tiny yellow
nodding flowers (capitula) capitula in loose panicle containing
numerous central bisexual florets and marginal pistillate florets
receptacle is glabrous florets and receptacle bear abundant
10-celled biseriate trichomes globular canopy dry leaf yield of
about 50 Q per hectare flowers (7A) arranged in a head or
Capitulum,
BRIEF DESCRIPTION OF THE ACCOMPANYING DRAWINGS
[0053] FIG. 1 shows the plant along with its architecture
"CIM-Arogya"
[0054] The research on genome analysis is being taken up as a
necessity to understand the genomic constitution of individuals in
terms of DNA content, nature and variations etc. The data from
gnome analysis are of direct relevance to molecular plant breeding
in which morphological characters can be tagged to unique DNA
sequences and then inheritance patterns of DNA markers can be
utilized to confirm the presence of traits even before expression.
Techniques are available to differentiate even similar looking
individuals of a population on the basis of DNA sequence variation.
Some recent important discoveries from application point of view
towards genetic analysis include Restriction endonucleases mapping
and Polymerised Chain Reaction for amplifying DNA sequences from
traces. These discoveries have led to the means and techniques used
to study the differences or uniqueness in the DNA sequences
otherwise known as Polymorphism in the DNA. The tools like RAPD,
AFLP, RFLP, micro-satellite and many others were invented earlier
and used in literature extensively for differentiating and marking
the plants for different characters.
Development of Marker Correlating to High Content of Artemisinin in
the Plant Artemisia annua.
Selection of Genotypes
[0055] The seeds of ten chemotypic accessions of the plant
Artemisia annua were selected from Kashmir and further studies were
carried out in Lucknow field station. Seeds of A. annua were sown
in pots with mixture of soil and FYM (farmyard manure) in the ratio
of 1:1 and germination in glass house conditions during the month
of November of the years 1998-2001. The seedlings having 10 cm
height were transplanted with spacing 50 cm between rows and 30 cm
between plants. The soil of experimental field was sandy loam in
texture and neutral in reaction (pH 7.6). The plots were fertilized
with FYM (Farm yard manure) @20 kg\ha before transplanting for
obtaining optimum performance. Plots were prepared 3 m.times.3 m
size with irrigation channels. For Hybridization, six seed lots
were selected out of 10 seedlots (obtained from Kashmir in the year
1998) were transplanted in alternative rows. From the next year
(1999) on wards the progeny seedlings of the chemotypically
selected plants were planted again in alternate rows. All the
seedlings were checked for artemisinin content after extraction.
About 0.1 g dry powdered plant material was extracted in 10 ml of
hexane by heating at 60.degree. C. for 3 minutes and left for
overnight at room temperature. Then extract was filtered and
evaporated on water bath at 50.degree. C. After evaporation extract
was dissolved in 1 ml hexane and used in TLC. Properly (20.times.20
cm E-MEREK) dissolved extract was spotted in TLC plates at 1 cm
apart along with standard (1 mg\ml). Spotted TLC plate was dipped
in solvent (mobile phase) Hexane:Diethyl ether (1:1) Plate was
dried in air and dipped in developing reagent Glacial acetic
acid:conc. Sulphuric acid:Anisaldehyde (50:1:0.5 ml) and heated at
120.degree. C. for 10-15 minutes and then Stabilized and scanned
(540 nm, visible) (Densitometer CAMAG: Switzerland). The TLC plates
were scanned and the artemisinin content of individual progeny
plants were quantified. From the analysis the plants producing
trace (0.10% or less) artemisinin and the plants producing more
than 0.4% artemisinin were selected and finally 10 plants from each
category were taken for DNA analysis.
DNA Isolation and PCR Amplifications
[0056] DNA was isolated from the leaf tissue essentially according
to the protocol described earlier (Khanuja S P S, Shasany A K,
Darokar M P, Sushil Kumar (1999) Rapid Isolation of PCR Amplifiable
DNA from the Dry and Fresh Samples of Plants Producing Large
Amounts of Secondary Metabolites and Essential oils by Modified
CTAB Procedure. Plant Molecular Biology Reporter, 17, 74.).
Polymerase chain reactions (PCRs) were carried out in 25 .mu.l
volume. A reaction tube contained 25 ng of DNA, 0.2 unit of Taq DNA
polymerase, 100 .mu.M of each dNTPs, 1.5 mM MgCl.sub.2 and 5 pmol
of decanucleotide primers. The amplifications were carried out
using the DNA Engine thermal cycler (MJ Research, USA) using
94.degree. C., 35.degree. C. and 72.degree. C. temperatures for 40
cycles (Khanuja S P S, Shasany A K, Srivastava A, Sushil Kumar
(2000). Assessment of genetic relationships in Mentha species.
Euphytica, 111, 121-125.). The amplified products were separated on
1.2% agarose gel containing 0.5 .mu.g ml.sup.-1 of ethidium bromide
and photographed with Image master VDS (Pharmacia). The bands were
analyzed using Image master 1D elite software and the graphic
phenogram of the genetic relatedness among the accessions was
produced by means of UPGMA (unweighted pair group method with
arithmetic average) cluster analysis. Custom-made decanucleotide
primers were synthesised in the laboratory on Applied Biosystems
392 DNA-RNA Synthesizer and were designated as MAP01 to MAP20.
[0057] The sequences of the primers MAP01 to MAP20 were AAATCGGAGC,
GTCCTACTCG, GTCCTTAGCG, TGCGCGATCG, AACGTACGCG, GCACGCCGGA,
CACCCTGCGC, CTATCGCCGC, CGGGATCCGC, GCGAATTCCG, CCCTGCAGGC,
CCAAGCTTGC, GTGCAATGAG, AGGATACGTG, AAGATAGCGG, GGATCTGAAC,
TTGTCTCAGG, CATCCCGAAC, GGACTCCACG, AGCCTGACGC, respectively. The
other sets of primers used included kit J, O and T, each consisting
of 20 random decamer primers, procured from Operon Technologies
Inc., USA.
[0058] All the RAPD profiles thus generated were analyzed for bands
always appearing with all the high artemisinin containing genotypes
(more than 0.4%) and absent in the genotypes containing trace or no
artemisinin. We could detect a band at approximately 850 base pair
region amplified with the primer 5'CCAAGCTTGC3' (MAP 12, Sequence
ID 1) which consistently showed its presence in the genotypes
containing more than 0.4% artemisinin and absent in the genotypes
with trace or no artemisinin. This finding was interesting
considering the complex nature of the artemisinin biosynthetic
pathway. For all other primers the amplified products showed
variable positions in these genotypes and could not be correlated.
The presence of the band in the segregating populations having high
artemisinin could be ascertained as the samples of 10 analyzed
plants having high artemisinin were drawn from different
populations. Similarly, the sample of 10 plants for trace or no
artemisinin drawn from different populations could show always the
absence of the band. As all the plants analyzed were from the same
initial population the genes for artemisinin biosynthesis were
assumed to be normal. So the presence and absence of the band could
be correlated to the regulatory function associated with the
expression of some of the genes associated with the biosynthetic
pathway. But certainly the DNA band of about 850 base pair size
could be correlated with the biosynthesis of more than 0.4%
artemisinin in Artemisia annua.
[0059] In the next steps the DNA fragment described earlier was
eluted out from the agarose gel and (since the fragment was
amplified with the primer containing Hind III restriction site)
restricted with Hind III restriction enzyme (Recognition and
restriction site 5'AAGCTT3'). Similarly, pBluescript II SK(+)
procured from Stratagene Inc. was used to clone the fragment at the
Hind III site using T4 DNA ligase enzyme available commercially.
Escherichia coli strain DH5.alpha., procured from Stratagene Inc
again was transformed with this constructed plasmid and transformed
cells were isolated on agar plates containing nutrient broth and
ampicillin. All the experiments were performed according to the
protocol Sambrook et al (1988).
[0060] This fragment was sequenced completely with the help of M13
forward and T3 reverse primer (the sequence sites are present in
the plasmid pBluescript II SK(+) and the nucleotide sequence is
given below. TABLE-US-00001 1 AAGCTTGCTG AACGCATCGG TGTTACTGCC
GCAGCCCGTG AACTCAGCCT GTATGAATCA 61 CAACTCTACA ACTGGCGCAG
TAAACAGCAA AATCAGCAGA CGTCTTCTGA ACGTGAACTG 121 GAGATGTCTA
CCGAGATTGC ACGTCTCAAA CGCCAGCTGG CAGAACGGGA TGAAGAGCTG 181
GCTATCCTCC AAAAGGCCGC GACATACTTC GCGAAGCGCC TGAAATGAAG TATGTCTTTA
241 TTGAAAAACA TCAGGCTGAG TTCAGCATCA AAGCAATGTG CCGCGTGCTC
CGGGTGGCCC 301 GCAGCGGCTG GTATACGTGG GTGTCAGCGG CGGACAAGGA
TAAGCCCGCG TAAGCAGTTC 361 CGCCAACACT GCACAGGG GG TTGTCTCGCG
GGTTTTACCC CGGGTCAAAC AAGCGTTACC 421 GGTGCCCCAC GCTTGACCGG
ATGACCTGCG GTGCTCAGGG TTACCCTTTA ACGTAAAAAA 481 CCCGTGGCGG
CAAGCTTGCC CGGTCAGGGA CTGAAGGCAA AGGCCTCCCG GAAGTTCAGC 541
CCGGTCAGCT ACCGCGGCAC ACGGGCCTGC CTGTGTCAGA AAATCTGTTG GAGCAGGATT
601 TTTACGCCCA GTGGCCCGAA CCAGAAGTGG GCAGGAGACA TCACGTACTT
ACGTACAGAT 661 GAAGGCTGGC TGTATCTGGC AGTGGTCATT GACCTGTGGT
CACGTGCCGT TATTGGCTGG 721 TCAATGTCGC CACGCATGAC GGCGCAACTG
GCCTGCGATG CCCTGCAGAT GGCGCTGTGG 781 CGGCGTAAGA GGCCCCGGAA
CGTTATCGTT CACACGGACC GTGGAGGCCA GTACTGTTCA 841 GCAGATTATC
AGGCGCAACT GAAGCGGCAT AATCTGCGTG GAAGTATGAG CGCAAAAGGT 901
TGCTGCTACG ATAATGCCTG CGTGGAAAGC TT
[0061] Based on the sequence at the ends forward and reverse
primers were synthesized with the sequence TABLE-US-00002 Forward
Primer 5'CCAAGCTTGCTGAACGCATCGG3' Reverse primer
5'CCAAGCTTGCCACGCAGGCATTATC3'
[0062] These sequences were used to amplify the genomic DNA of
Artemisia annua (both high content of artemisinin and low content
of artemisinin). The plant genomic DNA with high artemisinin
content could generate a band of 936 bp where as in plants
containing low amount of artemisinin the absence of the band was
conspicuous.
Use of the Marker to Generate a Population of Plants with High
Artemisinin Content.
[0063] In the first year polycross nursery was designed with
alternate male and female line chosen among the seedlots. These
plants were randomly picked up from the nursery raised from the 6
selected seed lots. The plants, which were designated as female
(270 plants), were analyzed for artemisinin content, which were
selected for further experimentation. Seed sample were collected
from these selected plants (13 in number) containing high amount of
artemisinin (0.15 to 0.20%) and planted again in a polycross
nursery in the second year. Next year 180 plants were analyzed for
artemisinin content and 13 plants containing 0.45 to 0.50%
artemisinin were selected for planting in the third year. At this
point 10 plants With more than 0.4% artemisinin and 10 plants
containing trace amount artemisinin were taken for DNA isolation to
develop SCAR marker as described previously. The SCAR marker was
used to select plants from the nursery raised from the seeds
selected 13 seedlots, and 12 plants from each seedlots showing the
presence of SCAR marker were selected for random crossing among the
plants in the third year. Randomly plants were analyzed for
artemisinin content and among 150 plants analyzed 20 plants having
artemisinin 0.8 to 1.0% were selected for next year (fourth year)
planting. The seeds from these plants were grown in the nursery and
12 SCAR positive plants from each seed lot were grown randomly to
facilitate cross pollination. From these 200 plants were analysed
for artemisinin content and 11 plants were selected having 1.0 to
1.16% artemisinin content. Simultaneously, increase in the mean
artemisinin content of the plants analysed every year were
calculated. ##STR1## Genetic Advancement
[0064] The key metabolite synthesis (Artemisinin content) was
studied for genetic advancement which showed an upward trend
beginning with 17.33% increase in the mean artemisinin content for
the first year, crossing 50% in second year, 60% in third year and
remaining at 42.06% in fourth year. The advancement in artemisinin
content was calculated as per Singh and Chaudhary (1977) (Singh R K
and Chaudhary B D (1977). Biometrical methods in quantitative
genetic analysis. Kalyani Publications, New Delhi.
[0065] The seeds obtained from these selected plants four single
plant seed lots (CIMAP-G1, CIMAP-G2, CIMAP-G3, CIMAP-G4) were
evaluated in the field at CIMAP Farm, Lucknow, Utterpradesh,
Lucknow, India.
[0066] Experimental (Agronomic) Details Artemisia annua Evaluation
Trials at CIMAP Research Farm. TABLE-US-00003 Component (s) 2001-02
2002-03 Design RBD RBD Genotypes (with check) Five Five Manuring
(FYM) 10t/ha 10t/ha Fertilization (NPK) 80:40:40 80:40:40 Row to
row distance 50 cm 50 cm Plant to plant distance 30 cm 30 cm Plot
size 12.5 sq m (Net) 15.75 sq m (Net) DOT 23/02/02 10/03/03 DOH (I)
03/06/02 (100 DAP) 02/06/03 (84 DAP) DOH (II) 29/07/02 (156 DAP)
31/07/03 (143 DAP) DOH (III) 13/09/02 (202 DAP) 11/09/03 (185 DAP)
DOH (Seed) 16/12/02 28/11/03 *50 kg/ha N was applied after every
cut (harvest) DOT: Date of transplantation DOH: Date of
harvesting
[0067] Four selected genotypes from these lots were selected among
each other and with the best check `Jeevan Raksha`. Herb yield data
with regard to advanced lines of Artemisia annua along with the
check during the evaluation trials at CIMAP research farm, Lucknow
has been provided below. The genotype CIMAP-G2 (CIM-Arogya) yielded
maximum dry leaves compared to other genotypes in the trial.
TABLE-US-00004 Fresh herb (q/ha) Dry leaves (q/ha) Genotype 2001-02
2002-03 2001-02 2002-03 CIMAP-G1 523.6 466.67 55.56 48.09 CIMAP-G2
553.0 478.45 58.40 48.89 CIMAP-G3 559.8 444.45 56.04 45.71 CIMAP-G4
422.0 439.69 42.00 46.27 Jeevan Raksha 438.4 426.19 43.60 42.30
F-value 7.55** 6.2** 10.79** 6.31** gm 499.36 451.11 51.12 46.25
sem 23.6 8.5 2.34 10.02 cv 9.45 3.77 9.16 4.41 cd (1%) 101.88 36.71
10.11 4.4 cd (5%) 72.7 26.19 7.21 3.14
[0068] The plant genotype of Artemisia annua of the invention was
named as `CIM-Arogya` and referred in the same name in the patent
document. The genotype can be grown as a uniform population of high
artemisinin yielding plants with rouging at nursery
Taxonomic Description of `CIM-Arogya`
[0069] The plant is usually single stemmed reaching about 2 m in
height with alternate branches and alternate deeply dissected
aromatic leaves ranging from 2.5 to 5.0 cm in length. Tiny greenish
yellow nodding flowers (capitula) only 2 or numerous imbricate
bracts enclose 3 mm in diameter. Capitula is displayed in loose
panicle containing numerous central bisexual florets and marginal
pistillate florets, the latter extruding stigmas prior to the
central flower. The receptacles is glabrous, not chaffy and
triangular in shape. Both florets and receptacle bear abundant
10-celled biseriate glandular trichomes, which are the source of
artemisinin and highly aromatic volatile oils (essential oil).
[0070] The colour codes are in accordance with the "RHS colour
chart published by The Royal Horticultural Society, 80 Vincent
Square, London SW1P 2PE, 1995.
[0071] The genotype `CIM-Arogya` possessing the traits of increased
herb yield than the other check varieties and genotypes. The
genotype is having higher biomass leading to high artemisinin
yield. Its genetic make up is distinct in terms of DNA profile. The
genotype in the population has expressed a genetic enhancement of
artemisinin content to a very high content of artemisinin through
strategic marker aided selection indicating the distinctiveness
from the parent genotype. The plant has a unique globular
canopy.
[0072] Randomly Amplified Polymorphic DNA analysis: The RAPD
analysis of the genotype `CIM-Arogya` were unambiguously able to
establish its distinct identity as completely different from the
check genotypes. The 20 MAP primers (MAP 01 to MAP 20) synthesized
in the laboratory using ABI 392 DNA synthesizer, with the sequence
AAATCGGAGC, GTCCTACTCG, GTCCTTAGCG, TGCGCGATCG, AACGTACGCG,
GCACGCCGGA, CACCCTGCGC, CTATCGCCGC, CGGGATCCGC, GCGAATTCCG,
CCCTGCAGGC, CCAAGCTTGC, GTGCAATGAG, AGGATACGTG, AAGATAGCGG,
GGATCTGAAC, TTGTCTCAGG, CATCCCGAAC, GGACTCCACG, AGCCTGACGC were
used for the analysis to differentiate among the genotypes.
[0073] From RAPD analysis the profiles were studied and similarity
indices were calculated which were put into a matrix. This matrix
was used to produce a graphic phenogram by means of UPGMA
(unweighted pair group method with arithmetic average) cluster
analysis. As represented in the phenogram provided below (FIG. 1)
the clone of the invention is quite different from the other
varieties.
Sequence CWU 1
1
23 1 10 DNA ARTIFICIAL MAP Primer 1 aaatcggagc 10 2 10 DNA
ARTIFICIAL MAP Primer 2 gtcctactcg 10 3 10 DNA ARTIFICIAL MAP
Primer 3 gtccttagcg 10 4 10 DNA ARTIFICIAL MAP Primer 4 tgcgcgatcg
10 5 10 DNA ARTIFICIAL MAP Primer 5 aacgtacgcg 10 6 10 DNA
ARTIFICIAL MAP Primer 6 gcacgccgga 10 7 10 DNA ARTIFICIAL MAP
Primer 7 caccctgcgc 10 8 10 DNA ARTIFICIAL MAP Primer 8 ctatcgccgc
10 9 10 DNA ARTIFICIAL MAP Primer 9 cgggatccgc 10 10 10 DNA
ARTIFICIAL MAP Primer 10 gcgaattccg 10 11 10 DNA ARTIFICIAL MAP
Primer 11 ccctgcaggc 10 12 10 DNA ARTIFICIAL MAP Primer 12
ccaagcttgc 10 13 10 DNA ARTIFICIAL MAP Primer 13 gtgcaatgag 10 14
10 DNA ARTIFICIAL MAP Primer 14 aggatacgtg 10 15 10 DNA ARTIFICIAL
MAP Primer 15 aagatagcgg 10 16 10 DNA ARTIFICIAL MAP Primer 16
ggatctgaac 10 17 10 DNA ARTIFICIAL MAP Primer 17 ttgtctcagg 10 18
10 DNA ARTIFICIAL MAP Primer 18 catcccgaac 10 19 10 DNA ARTIFICIAL
MAP Primer 19 ggactccacg 10 20 10 DNA ARTIFICIAL MAP Primer 20
agcctgacgc 10 21 932 DNA ARTIFICIAL MAP Primer 21 aagcttgctg
aacgcatcgg tgttactgcc gcagcccgtg aactcagcct gtatgaatca 60
caactctaca actggcgcag taaacagcaa aatcagcaga cgtcttctga acgtgaactg
120 gagatgtcta ccgagattgc acgtctcaaa cgccagctgg cagaacggga
tgaagagctg 180 gctatcctcc aaaaggccgc gacatacttc gcgaagcgcc
tgaaatgaag tatgtcttta 240 ttgaaaaaca tcaggctgag ttcagcatca
aagcaatgtg ccgcgtgctc cgggtggccc 300 gcagcggctg gtatacgtgg
gtgtcagcgg cggacaagga taagcccgcg taagcagttc 360 cgccaacact
gcacaggggg ttgtctcgcg ggttttaccc cgggtcaaac aagcgttacc 420
ggtgccccac gcttgaccgg atgacctgcg gtgctcaggg ttacccttta acgtaaaaaa
480 cccgtggcgg caagcttgcc cggtcaggga ctgaaggcaa aggcctcccg
gaagttcagc 540 ccggtcagct accgcggcac acgggcctgc ctgtgtcaga
aaatctgttg gagcaggatt 600 tttacgccca gtggcccgaa ccagaagtgg
gcaggagaca tcacgtactt acgtacagat 660 gaaggctggc tgtatctggc
agtggtcatt gacctgtggt cacgtgccgt tattggctgg 720 tcaatgtcgc
cacgcatgac ggcgcaactg gcctgcgatg ccctgcagat ggcgctgtgg 780
cggcgtaaga ggccccggaa cgttatcgtt cacacggacc gtggaggcca gtactgttca
840 gcagattatc aggcgcaact gaagcggcat aatctgcgtg gaagtatgag
cgcaaaaggt 900 tgctgctacg ataatgcctg cgtggaaagc tt 932 22 22 DNA
ARTIFICIAL MAP Primer 22 ccaagcttgc tgaacgcatc gg 22 23 26 DNA
ARTIFICIAL MAP Primer 23 ccaagcttgc cacgcagggc attatc 26
* * * * *