U.S. patent application number 11/526632 was filed with the patent office on 2007-04-19 for novel transferase and amylase, process for producing the enzymes, use thereof, and gene coding for the same.
This patent application is currently assigned to Kirin Beer Kabushiki Kaisha. Invention is credited to Akihiro Iwamatsu, Masaru Kato, Masako Kettoku, Kazuo Kobayashi, Toshihiro Komeda, Yutaka Miura.
Application Number | 20070087426 11/526632 |
Document ID | / |
Family ID | 27552582 |
Filed Date | 2007-04-19 |
United States Patent
Application |
20070087426 |
Kind Code |
A1 |
Kato; Masaru ; et
al. |
April 19, 2007 |
Novel transferase and amylase, process for producing the enzymes,
use thereof, and gene coding for the same
Abstract
The invention provides a novel transferase that acts on a
saccharide, as a substrate, composed of at least three sugar units
wherein at least three glucose residues on the reducing end are
linked .alpha.-1,4 so as to transfer the .alpha.-1,4 lingages to a
.alpha.-1, .alpha.-1 linkages; a process for producing the
transferase; a gene coding for the same; and a process for
producing an oligosaccharide by using the same. Also provided are a
novel amylase that has a principal activity of acting on a
saccharide, as a substrate, composed of at least three sugar units
wherein at least three sugar units on the reducing end side are
glucose units and the linkage between the first and the second
glucose units is .alpha.-1, .alpha.-1 while the linkage between the
second and the third glucose units is .alpha.-1,4 so as to liberate
.alpha., .alpha.-trehalose by hydrolyzing the .alpha.-1,4 linkage
and another activity of hydrolyzing the .alpha.-1,4 linkage within
the molecular chain of the substrate and that liberates
disaccharides and/or monosaccharides as the principal final
products; a process for producing the amylase; a gene coding for
the same; and a process for producing .alpha., .alpha.-trehalose by
using a combination of the transferase and the amylase.
Inventors: |
Kato; Masaru; (Takasaki,
JP) ; Miura; Yutaka; (Takasaki, JP) ; Kettoku;
Masako; (Takasaki-shi, JP) ; Iwamatsu; Akihiro;
(Yokohama-shi, JP) ; Kobayashi; Kazuo;
(Takasaki-shi, JP) ; Komeda; Toshihiro;
(Yokohama-shi, JP) |
Correspondence
Address: |
FOLEY AND LARDNER LLP;SUITE 500
3000 K STREET NW
WASHINGTON
DC
20007
US
|
Assignee: |
Kirin Beer Kabushiki Kaisha
|
Family ID: |
27552582 |
Appl. No.: |
11/526632 |
Filed: |
September 26, 2006 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
08750569 |
Feb 24, 1997 |
|
|
|
PCT/JP95/01189 |
Jun 14, 1995 |
|
|
|
11526632 |
Sep 26, 2006 |
|
|
|
Current U.S.
Class: |
435/193 ;
536/23.2 |
Current CPC
Class: |
C12N 9/2417 20130101;
C12N 9/2411 20130101; C12N 9/1048 20130101; C12N 9/2408 20130101;
C12P 19/14 20130101; C12N 9/2414 20130101 |
Class at
Publication: |
435/193 ;
536/023.2 |
International
Class: |
C12N 9/10 20060101
C12N009/10; C07H 21/04 20060101 C07H021/04 |
Foreign Application Data
Date |
Code |
Application Number |
Jun 15, 1994 |
JP |
6-133354 |
Aug 18, 1994 |
JP |
6-194223 |
Oct 31, 1994 |
JP |
6-290394 |
Nov 21, 1994 |
JP |
6-286917 |
Nov 21, 1994 |
JP |
6-311185 |
Apr 21, 1995 |
JP |
7-120673 |
Claims
1-7. (canceled)
8. A DNA fragment comprising a DNA sequence coding for a
transferase, the transferase acting on a substrate saccharide, the
substrate saccharide being composed of at least three sugar units
wherein at least three glucose residues from the reducing end are
.alpha.-1,4-linked, so as to transfer the first .alpha.-1,4 linkage
from the reducing end into an .alpha.-1, .alpha.-1 linkage, and
comprising an amino acid sequence as shown in SEQ ID No. 2 or 4, or
a sequence equivalent to the amino acid sequence shown in SEQ ID
No. 2 or 4 as long as it is able to transfer the first .alpha.-1,4
linkage from the reducing end of said saccharide into an .alpha.-1,
.alpha.-1 linkage.
9. The DNA fragment claimed in claim 8 derived from an
archaebacterium belonging to the order Sulfolobales.
10. The DNA fragment claimed in claim 9 derived from an
archaebacterium belonging to the genus Sulfolobus.
11. The DNA fragment claimed in claim 10 derived from Sulfolobus
solfacaricus strain KM1 (FERM BP-4626).
12. The DNA fragment claimed in claim 10 derived from Sulfolobus
acidocaldarius strain ATCC 33909.
13. A DNA fragment which hybridizes with the base sequence from the
335.sup.th base to the 2518.sup.th base of the base sequence shown
in Sequence No. 1 at 40.degree. C. under an ionic strength of
5.times.SSC, and which codes for a transferase acting on a
substrate saccharide, the substrate saccharide being composed of at
least three sugar units, wherein at least three glucose residues
from the reducing end are .alpha.-1,4-linked, so as to transfer the
first .alpha.-1,4 linkage from the reducing end into an .alpha.-1,
.alpha.-1 linkage; and a DNA fragment which codes for the amino
acid sequence encoded by the foregoing DNA fragment.
14. A DNA fragment which hybridizes with the base sequence from the
1880.sup.th base to the 2257.sup.th base of the base sequence shown
in Sequence No. 1 at 60.degree. C. under an ionic strength of
6.times.SSPE, and which codes for a transferase acting on a
substrate saccharide, the substrate saccharide being composed of at
least three sugar units wherein at least three glucose residues
from the reducing end are .alpha.-1,4-linked, so as to transfer the
first .alpha.-1,4 linkage from the reducing end into an .alpha.-1,
.alpha.-1 linkage; and a DNA fragment which codes for the amino
acid sequence encoded by the foregoing DNA fragment.
Description
CROSS-REFERENCE TO RELATED PATENT APPLICATIONS
[0001] This application is a Division of U.S. application Ser. No.
08/750,569, filed Feb. 24, 1997, incorporated herein by reference
in its entirety, which is a U.S. National stage of
PCT/JP1995/01189, filed Jun. 14, 1995, incorporated herein by
reference in its entirety.
TECHNICAL FIELD
[0002] The present invention relates to:
[0003] I. a novel transferase, a process for producing the same, a
process for producing an oligosaccharide by using the enzyme, a
gene coding for the enzyme, and use thereof; and
[0004] II. a novel amylase, a process for producing the same, a
process for producing .alpha., .alpha.-trehalose by using the
enzyme, a gene coding for the enzyme, and use thereof.
[0005] More specifically, as follows.
[0006] The present invention relates to a novel transferase which
acts on a substrate saccharide, the substrate saccharide being
composed of at least three sugar units wherein at least three
glucose residues from the reducing end are .alpha.-1,4-linked, so
as to transfer the .alpha.-1,4 linkages to .alpha.-1, .alpha.-1
linkages; and a process for producing the transferase. More
particularly, the present invention relates to the above-mentioned
enzyme produced from archaebacteria belonging to the order
Sulfolobales, for example, bacteria of the genus Sulfolobus or
Acidianus.
[0007] Further, the present invention relates to a novel process
for producing trehaloseoligosaccharides or the like by using the
above-mentioned novel enzyme, and more particularly, relates to an
efficient and high-yield process for producing
trehaloseoligosaccharides such as glucosyltrehalose and
maltooligosyltrehaloses by using a maltooligosaccharide or the like
as a raw material.
[0008] Moreover, the present invention relates to a DNA fragment
coding for the above-mentioned novel transferase and to the use of
the DNA fragment in genetic engineering.
[0009] The present invention relates to a novel amylase which acts
on a substrate saccharide, the saccharide being composed of at
least three sugar units wherein at least three sugar units from the
reducing end are glucose residues, so as to liberate principally
monosaccharides and/or disaccharides by hydrolyzing the substrate
from the reducing end; and a process for producing the amylase.
More particularly, the present invention relates to a novel amylase
which has an principal activity of acting on a substrate
saccharide, the substrate saccharide being composed of at least
three sugar units wherein at least three sugar units from the
reducing end side are glucose residues and the linkage between the
first and the second glucose residues from the reducing end side is
.alpha.-1,. .alpha.-1 while the linkage between the second and the
third glucose residues from the reducing end side is .alpha.-1,4,
so as to liberate .alpha.,. .alpha.-trehalose by hydrolyzing the
.alpha.-1,4 linkage between the second and the third glucose
residues; and a process for producing the amylase. The novel
amylase also has another activity of endotype-hydrolyzing one or
more .alpha.-1,4 linkages within the molecular chain of the
substrate, and can be produced by bacteria belonging to the genus
Sulfolobus. This enzyme is available for the starch sugar industry,
textile industry, food industry, and the like.
[0010] Further, the present invention relates to a process for
producing .alpha.,. .alpha.-trehalose, characterized by using the
above novel amylase in combination with the above novel
transferase. In detail, the present invention relates to a process
for producing .alpha.,. .alpha.-trehalose in a high yield by using,
as a raw material, any one of starch, starch hydrolysate and
maltooligosaccharides, or a mixture of maltooligosaccharides, and
as enzymes, the novel transferase and amylase of the present
invention.
[0011] Moreover, the present invention relates to a DNA fragment
coding for the above novel amylase, and use of the DNA fragment in
genetic engineering.
BACKGROUND ART
I. Background Art of Transferase
[0012] Hitherto, in relation to glycosyltransferase acting on
starch and starch hydrolysates such as maltooligosaccharides,
various glucosyltransferases, cyclodextringlucano-transferases
(CGTase), and others have been found [c.f. "Seibutsu-kagaku
Jikken-hou" 25 ("Experimental Methods in Biochemistry", Vol. 25),
`Denpun. Kanren Toushitsu Kouso Jikken-hou` (`Experimental Methods
in Enzymes for Starch and Relating Saccharides`), published by
Gakkai-shuppan-sentah, Bioindustry, Vol. 9, No. 1 (1992), p. 39-44,
and others]. These enzymes transfer a glucosyl group to the
.alpha.-1,2, .alpha.-1,3, .alpha.-1,4, or .alpha.-1,6 linkage.
However, an enzyme which transfers a glucosyl group to the
.alpha.-1,. .alpha.-1 linkage has not been found yet. Though
trehalase has been found as an enzyme which acts on the .alpha.-1,.
.alpha.-1 linkage, trehalose is absolutely the only substrate for
the enzyme, and the equilibrium or the reaction rate lies to the
degrading reaction.
[0013] Recently, oligosaccharides were found to have
physicochemical properties such as moisture-retaining ability,
shape-retaining ability, viscous ability and browning-preventive
ability, and bioactivities such as a low-calorigenetic property, an
anticariogenic property and a bifidus-proliferation activity. In
relation to that, various oligosaccharides such as
maltooligosaccharides, branched-chain oligosaccharides,
fructooligosaccharide, galacto-oligosaccharide, and
xylooligosaccharide have been developed [c.f. "Kammiryo"
("Sweetener")(1989), Medikaru-risahchi-sha (Medical Research
Co.)(1989), Gekkan Fuhdokemikaru (Monthly Foodchemical)(1993),
February p. 21-29, and others].
[0014] Among oligosaccharides, the oligosaccharides which have no
reducing end may include fructooligosaccharides having a structure
composed of sucrose which is not reductive, and being produced by
fructosyltransferase. Meanwhile, among starch hydrolysates such as
maltooligosaccharides, the oligosaccharides which have no reducing
end may include cyclodextrins produced by the above-mentioned
CGTase, .alpha.,. .beta.-trehalose (neotrehalose), and reduced
oligosaccharides chemically synthesized by hydrogenating the
reducing end (oligosaccharide alcohol). These oligosaccharides
having no reducing end have various physicochemical properties and
bioactivities which are not possessed by conventional starch syrups
and maltooligosac-charides. Accordingly, among
maltooligosaccharides, the oligosaccharides the reducing ends of
which are modified with an .alpha.-1,. .alpha.-1 linkage may be
also expected to have the similar physicochemical properties and
bioactivities to those possessed by the above-mentioned
oligosaccharide having no reducing end, since such oligosaccharides
also have no reducing end.
[0015] Here, the oligosaccharides the reducing ends of which are
modified with an .alpha.-1,. .alpha.-1 linkage as described above
may be recognized as a trehaloseoligosaccharide in which .alpha.,.
.alpha.-trehalose is linked with glucose or a
maltooligoshaccharide. Accordingly, such a trehaloseoligosaccharide
may be expected to have the physicochemical properties and
bioactivities which are possessed by the oligosaccharide having no
reducing end, and in addition, may be expected to have the specific
activities as exhibited by .alpha.,. .alpha.-trehalose (c.f.
Japanese Patent Laid-open Publication No. 63-500562).
[0016] Though it was reported that a trace amount of
trehaloseoligosaccharides could be detected in yeast [Biosci.
Biotech. Biochem., 57(7), p. 1220-1221 (1993)], this is the only
report referring to its existence in nature. On the other hand, as
to its synthesis by using an enzyme, though there has been a report
of such synthesis [Abstracts of "1994 Nihon Nougei-kagaku Taikai"
("Annual Meeting of the Japan Society for Bioscience, Biotechnology
and Agrochemistry in 1994"), p. 247], the method described in the
report uses trehalose, which is expensive, as the raw material.
Therefore, production at low cost has not yet been established.
[0017] Recently, Lama, et al. found that a cell extract from the
Sulfolobus solfataricus strain MT-4 (DSM 5833), a species of
archaebacteria, has a thermostable starch-hydrolyzing activity
(Biotech. Forum. Eur. 8, 4, 2-1 (1991)). They further reported that
the activity is also of producing trehalose and glucose from
starch. The above-mentioned report, however, does not at all refer
to the existence of trehaloseoligosaccharides such as
glucosyltrehalose and maltooligosyltrehalose. Moreover, no
investigation in archaebacteria other than the above-mentioned
strain. has been attempted.
[0018] Meanwhile, an efficient process for obtaining the novel
transferase should be established to efficiently produce
trehaloseoligosaccharides.
[0019] Accordingly, mass-production of trehaloseoligosaccharides
requires obtaining this novel transferase in a large amount. For
achievement of this, it is preferable to obtain a gene coding for
such transferase, and to produce the transferase in a genetic
engineering manner. When such a gene can be obtained, it can be
also expected, by using technologies of protein engineering, to
obtain an enzyme having an improved thermostability, an improved pH
stability, and an enhanced reaction rate. No report has, however,
been made about gene cloning of such a gene yet.
[0020] An object of the present invention is to provide a novel
transferase principally catalyzing the production of
trehaloseoligosaccharides such as glucosyltrehalose and
maltooligosyltrehaloses, and a process for producing the enzyme,
and further, to provide a novel, efficient and high-yield process
for producing principally trehalose-oligosaccharides such as
glucosyltrehalose and maltooligosyltrehaloses by using such an
enzyme from a raw material such as maltooligosaccharides.
[0021] Inventors earnestly investigated the trehalose-producing
activity of archaebacteria and found that glucosyltrehalose can be
produced from maltotriose as a substrate by cell extracts from
various archaebacteria such as those belonging to the order
Sulfolobales, and more specifically, the genera Sulfolobus,
Acidianus, and others. Here, though production of trehalose and
glucose was confirmed using an activity-measuring method described
by Lama, et al. in which the substrate is starch, Inventors found
that detection of trehaloseoligosaccha-rides such as
glucosyltrehalose is extremely difficult. Also, Inventors found
that the trehalose-producing activity as found by Lama, et al.
disappears during the step for purification of cell extracts from
archaebacteria. Consequently, the inventors recognized that the
purification and characterization of the enzymes themselves which
have such activities were substantially impossible.
[0022] Under such circumstances, Inventors made further
investigations and conceived a novel activity-measuring method in
which the substrate is a maltooligosaccharide such as maltotriose,
and the index is activity of producing a trehaloseoligosaccharide
such as glucosyl-trehalose. Then, it was found by a practice of the
measuring method that a trehaloseoligosaccharide such as
glucosyltrehalose can be easily detected. Further, the Inventor
attempted to purify the enzyme having such activity from various
bacterial strains, and found, surprisingly, that the enzyme thus
obtained is quite a novel transferase which acts on maltotriose or
a larger saccharide wherein at least three glucose residues from
the reducing end are .alpha.-1,4-linked, and which transfers the
linkage between the glucose residues at the reducing end into an
.alpha.-1,. .alpha.-1 linkage to produce trehaloseoligosaccha-rides
such as glucosyltrehalose. Incidentally, the existence of
trehaloseoligosaccharides which are produced from
maltooligosaccharides or, the like by transferring the linkage
between glucose residues at the reducing-end into an .alpha.-1,.
.alpha.-1 linkage was confirmed by .sup.1H-NMR and .sup.13C-NMR
(c.f. Examples I-1, 7 and 8).
[0023] Inventors further found that such a novel enzyme is
available for producing a large amount of
trehaloseoligosaccharides, for example, glucosyltrehalose and
maltooligosyltrehalose from saccharides such as
maltooligosaccharides, and have accomplished the present
invention.
[0024] Moreover, Inventors isolated the genes coding for such a
novel enzyme, and have now established a process for producing the
novel transferase by using such genes in a genetic engineering
manner.
II. Background Art of Amylase
[0025] "Amylase" is a generic term for the enzymes which hydrolyze
starch. Among them, .alpha.-amylase is an enzyme which
endotype-hydrolyzes an .alpha.-1,4 glucoside linkage. Alpha-amylase
widely exists in the living world. In mammals, .alpha.-amylase can
be found in saliva and pancreatic fluid. In plants, malt has the
enzyme in large amounts. Further, .alpha.-amylase widely exists in
microorganisms. Among them, .alpha.-amylase or the like which is
produced by some fungi belonging to the genus Aspergillus or some
bacteria belonging to the genus Bacillus is utilized in the
industrial fields ["Amirahze" ("Amylase"), edited by Michinori
Nakamura, published by Gakkai-shuppan-sentah, 1986].
[0026] Such .alpha.-amylase is industrially-and widely used for
various purposes, for example, for starch-liquefying processes in
starch sugar industries, and for desizing processes in textile
industries, and therefore, the enzyme is very important from an
industrial view. The following are listed as important conditions
for the starch-liquefying process in "Kouso-Ouyou no Chishiki"
(written by Toshiaki Komaki, published by Sachi-Shobou, 1986): 1)
the starch molecules should be liquefied as completely as possible,
2) the products produced by the liquefaction are favorable for the
purpose of the subsequent saccharifying process, 3) the condition
does not cause retrogradation of the products by the liquefaction,
and 4) the process should be carried out in a high concentration as
much as possible (30-35%) in view of reducing cost. A
starch-liquefying process may be performed, for example, by a
continuous liquefaction method at a constant temperature, or by the
Jet-Cooker method. Ordinarily, a thick starch-emulsion containing
.alpha.-amylase is instantaneously heated to a high temperature
(85-110.degree. C.), and then the .alpha.-amylase is put into
action to perform liquefaction at the same time as starch begins to
be gelatinized and swollen. In other words, the starch-liquefying
process requires a temperature sufficient to cause the starch to
swell before the enzyme can act. Enzymes capable of being used in
such fields are, for example, the above-mentioned thermostable
.alpha.-amylases produced by fungi of the Aspergillus oryzae group
belonging to the genus Aspergillus or bacteria belonging to the
genus Bacillus. In some cases, the addition of calcium is required
for further improving thermostability of these enzymes. In the
starch-liquefying process, once the temperature declines while the
.alpha.-amylase has not yet acted on the starch-micelles which are
swelled and going to be cleaved, starch will be agglutinated again
to form new micelles (insoluble starch) which are rarely liquefied
by .alpha.-amylase. As a result, the liquid sugar thus produced
will be turbid and hard to filtrate, as is a known problem. Some
methods which increase the liquefaction degree, i.e. dextrose
equivalent (DE), are used in order to prevent such an event.
However, in some cases, such as an enzymatic production of maltose,
DE should be maintained as low as possible, namely, the
polymerization degree of the sugar chain should be maintained to a
high degree in order to keep a high yield. Accordingly, when an
enzyme is further used for a process subsequent to a
starch-liquefying process, use of an enzyme thermostable enough for
use in a series of high temperatures will allow the progress of the
reaction without producing slightly soluble starch even by using a
high concentration of starch, and at the same time, such use will
be advantageous in view of process control and sanitary control
because the risk of contamination with microorganisms can be
decreased. Meanwhile, when the enzyme is immobilized in a
bioreactor to use the enzyme recyclically, it is believed to be
important that the enzyme has high stability, and especially high
thermostability, since the enzyme may be exposed to a relatively
high temperature during immobilization. If the enzyme has a low
thermostability, it will possibly be inactivated during the
immobilization procedure. As is obvious from the above, an enzyme
having a high thermostability can be used very advantageously in
several industrial fields, for example, a starch-liquefying
process, and such an enzyme is desired.
[0027] In addition, screening of thermophilic and hyperthermophilic
bacteria has been widely carried out in recent years in order to
obtain thermostable enzymes including amylase. Archaebacteria
belonging to the order Thermococcales and the genus Pyrococcus are
also the objects of screening, and were reported to produce
.alpha.-amylase [Applied and Environmental Microbiology, pp.
1985-1991, (1990); Japanese Patent Laid-open Publication No.
6-62869; and others]. Additionally, archaebacteria belonging to the
genus Sulfolobus are the objects of screening, and isolation of
thermostable enzymes was reported. Here, archaebacteria belonging
to the genus Sulfolobus are taxonomically defined by the following
characteristics: being highly thermophilic: being possible to grow
in a temperature range of 55.degree. C.-88.degree. C.; [0028] being
acidophilic: being possible to grow in a pH range of 1-6; [0029]
being aerobic; and [0030] being sulfur bacteria: being cocci having
irregular form, and a diameter of 0.6-2 .mu.m. Accordingly, if an
archaebacterium belonging to the genus Sulfolobus produces an
amylase, the amylase is expected to be also thermo-stable. Lama, et
al. found that a thermostable starch-hydrolyzing activity exists in
a cell extract from the Sulfolobus solfataricus strain MT-4 (DSM
5833) [Biotech. Forum. Eur. 8, 4, 2-1 (1991)]. This article
reported that .alpha.,. .alpha.-trehalose and glucose can be
produced from starch by this activity. However, purification of the
active substance was performed only partially, and the true
substance exhibiting the activity has not yet been identified. In
addition, the enzymatic characteristics of the activity has not
been clarified at all. The Inventors' investigations, the details
of which will be described below, revealed that the active
substance derived from the above-mentioned bacterial strain and
allowed to act on starch by Lama, et al. was a mixture containing a
plurality of enzymes, and that .alpha.,. .alpha.-trehalose and
glucose are the final products obtained by using the mixture.
[0031] As another characteristic, .alpha.-amylase has an activity
of, at an initial stage, decreasing the quantity of iodo-starch
reaction, namely, an activity of endotype-hydrolyzing
.alpha.-1,4-glucan (liquefying activity). There are several modes
in the reaction mechanism of such liquefying-type amylase. In other
words, it is known that each amylase has common characteristics in
view of endotype-hydrolyzing activity but has individual
characteristics in view of patterns for hydrolyzing
maltooligosaccharides. For example, some recognize a specific site
for hydrolysis of the substrate from the non-reducing end, and
others recognize a specific site for hydrolysis of the substrate
from the reducing end. Further, some hydrolyze the substrate to
principally produce glucose; others to principally produce maltose
or maltooligosaccharides. More specifically, the .alpha.-amylase
derived from pancreas hydrolyzes the .alpha.-1,4 linkage second or
third from the reducing end ["Denpun.Kanren Toushitsu Kouso
Jikken-hou" ("Experimental methods in enzymes for starch and
relating saccharides"), written by Michinori Nakamura and Keiji
Kainuma, published by Gakkai-Shuppan-Sentah, 1989]. The
.alpha.-amylase derived from Bacillus subtilis hydrolyzes the
.alpha.-1,4 linkage sixth from the non-reducing end or third from
the reducing end ["Kouso-Ouyou no Chishiki" ("Knowledge in
Application of Enzymes"), written by Toshiaki Komaki, published by
Sachi-Shobou, 1986]. It is believed that such a difference between
the reaction modes of .alpha.-amylases can be attributed to the
structure of each enzyme, and the "Subsite theory" is proposed for
explanation of these events. Additionally, the existence of an
.alpha.-amylase having transferring activities or condensation
activities has been confirmed. Further, a particular
.alpha.-amylase which produces a cyclodextrin has been found.
[0032] On the other hand, .alpha.,. .alpha.-trehalose consists of
two glucose molecules which are .alpha.-1,. .alpha.-1-linked
together at the reducing group of each molecule. It is known that
.alpha.,. .alpha.-trehalose exists in many living things, plants
and microorganisms of the natural world, and has many function such
as preventing the biomembrane from freezing or drying, and being an
energy source in insects. Recently, .alpha.,. .alpha.-trehalose was
evaluated in the fields of medicine, cosmetics and food as a
protein stabilizer against freezing and drying (Japanese Examined
Patent Publication No. 5-81232, Japanese Patent Laid-open
Publication No. 63-500562, and others). However, .alpha.,.
.alpha.-trehalose is not often used practically. This may be
because no mass-productive process has been established yet.
[0033] Examples of the conventional process for producing .alpha.,.
.alpha.-trehalose are as follows: [0034] A process comprising
extraction from an yeast (Japanese Patent Laid-open Publications
Nos. 5-91890 and 4-360692, and others); [0035] a process comprising
intracellular production by an yeast (Japanese Patent Laid-open
Publication No. 5-292986, European Patent No. 0451896, and others);
and [0036] a process comprising production by a microorganism
belonging to the genus Sclerotium or the genus Rhizoctonia
(Japanese Patent Laid-open Publication No. 3-130084). However,
these processes, as comprising intracellular production, require a
purification process comprising multiple steps for spallation of
bacterial bodies and removal of debris. Meanwhile, several
investigations were made into extracellular production by a
fermentation using a microorganism, for example, a microorganism
belonging to the genus Arthrobacter (Suzuki T, et al., Agric. Biol.
Chem., 33, No. 2, 190, 1969) or the genus Nocardia (Japanese Patent
Laid-open Publication No. 50-154485), and glutamate-producing
bacteria (French Patent No. 2671099, Japanese Patent Laid-open
Publication No. 5-211882, and others). Further, production by a
gene encoding an enzyme for .alpha.,. .alpha.-trehalose metabolism
was attempted (PCT Patent No. 93-17093). Any of the above processes
use glucose or the like as the sugar source, and utilize a
metabolic system which requires ATP and/or UTP as the energy
source. These processes, therefore, require a complicated
purification process to obtain .alpha.,. .alpha.-trehalose from the
culture medium. Moreover, some investigations were attempted into
production by an enzymatic process using, for example, trehalose
phosphorylase (Japanese Examined Patent Publication No. 63-60998),
or trehalase (Japanese Patent Laid-open Publication No. 7-51063).
These processes, however, have some problems in mass-production of
the enzymes, stability of the enzymes, and others. All of the
processes of the prior art as described above have problems such as
a low yield, complexity in the purification process, low
production, and complexity in preparation of the enzyme. Therefore,
a process having industrial applicability has not been established
yet. Under. the circumstances, a process for more efficiently
producing .alpha.,. .alpha.-trehalose is strongly desired to be
established.
[0037] As described above, .alpha.,. .alpha.-trehalose was found
widely in nature, and the existence of it in archaebacteria was
also confirmed (System. Appl. Microbiol. 10, 215, 1988).
Specifically, as mentioned above, Lama, et al. found that a
thermostable starch-hydrolyzing activity exists in a cell extract
from an archaebacterium species, the Sulfolobus solfataricus strain
MT-4 (DSM 5833), and confirmed the existence of .alpha.,.
.alpha.-trehalose in the hydrolyzed product [Biotech. Forum. Eur.
8, 4, 2-1 (1991), cited before]. This article reported that the
activity was of producing .alpha.,. .alpha.-trehalose and glucose
from starch. The article, however, actually reported only an
example in which the substrate was 0.33% soluble starch, the amount
of .alpha.,. .alpha.-trehalose produced thereby was extremely
small, and besides, the ratio of produced .alpha.,.
.alpha.-trehalose to produced glucose was 1:2. Accordingly, an
isolation process is necessary to remove glucose which is produced
in a large amount as a by-product, and the purpose of establishing
a process for mass-producing .alpha.,. .alpha.-trehalose cannot be
achieved at all.
[0038] Inventors, as described above, found that an archaebacteria
belonging to the order Sulfolobales produce a transferase which
acts on a substrate saccharide, the substrate saccharide being
composed of at least three sugar units wherein at least three
glucose residues from the reducing end are
.alpha..alpha.-1,4-linked, so as to transfer the first .alpha.-1,4
linkage from the reducing end into an .alpha.-1,. .alpha.-1
linkage. Further, Inventors invented a process for producing
trehaloseoligosaccharides such as glucosyltrehalose and
maltooligosyltrehaloses from maltooligosaccharides by using this
enzyme. Here, the trehaloseoligosaccharide is a
maltooligosaccharide the reducing end side of which is modified
with an .alpha.-1, .alpha.-1 linkage.
[0039] In the meantime, no report has been made, as far as
Inventors know, as to an formerly-known enzyme capable of acting on
a trehaloseoligosaccharide which is derived from a
maltooligosaccharide by transforming the first linkage from the
reducing end into an .alpha.-1, .alpha.-1 linkage, and capable of
hydrolyzing specifically the .alpha.-1,4 linkage next to the
.alpha.-1, .alpha.-1 linkage to liberate .alpha.,.
.alpha.-trehalose in a high yield. In other words, conventional
amylase cannot hydrolyze trehaloseoligosaccharide specifically at
the .alpha.-1,4 linkage between the second and third glucose
residues from the reducing end side to liberate .alpha.,
.alpha.-trehalose. It will, therefore, markedly benefit the
mass-production of .alpha.,. .alpha.-trehalose if an amylase can be
developed, such amylase being capable of catalyzing the reaction
for producing .alpha., .alpha.-trehalose as well as hydrolyzing the
.alpha.-1,4 linkage in the molecular chain of starch or starch
hydrolysate.
[0040] In addition, mass-production of .alpha., .alpha.-trehalose
requires obtaining the novel amylase in a large amount. For this
purpose, it is preferable to obtain a gene coding for the amylase
and to produce the enzyme in a genetic engineering manner. Further,
if such a gene can be obtained, it can also be expected to obtain,
by using a technology of protein engineering, an enzyme which has
improved thermostability, improved pH stability, and an enhanced
reaction rate.
[0041] An object of the present invention is to provide a novel
amylase which has an activity of endotype-hydrolyzing the
.alpha.-1,4 linkage in the molecular chain of starch or starch
hydrolysate, and which can catalyze the reaction of liberating
.alpha., .alpha.-trehalose, wherein the enzyme acts on a
trehaloseoligosaccharide which is derived from a
maltooligosaccharide by transforming the first linkage from the
reducing end into an .alpha.-1, .alpha.-1 linkage, and hydrolyzes
specifically the .alpha.-1,4 linkage between the second and third
glucose residues from the reducing end side, and is to provide a
process for producing such an enzyme. Another object of the present
invention is to provide a novel process for efficiently producing
.alpha., .alpha.-trehalose in a high yield from a low-cost raw
material such as starch, starch hydrolysate, and
maltooligosaccharides by using the enzyme.
[0042] Inventors energetically investigated starch-hydrolyzing
activity derived from archaebacteria. As a result, Inventors found
that a thermostable starch-hydrolyzing activity exists in cell
extracts from various archaebacteria belonging to the order
Sulfolobales, and more specifically, the genus Sulfolobus. The
saccharides produced by hydrolysis of starch were found to be
glucose and .alpha., .alpha.-trehalose, similar to the description
in the article by Lama, et al. Inventors then examined extracts
from various bacterial strains for characteristics of the
starch-hydrolyzing activity. As a result, Inventors found that the
enzymes produced by those strains are mixtures of enzymes
comprising various endotype or exotype amylases such as liquefying
amylase and glucoamylase, and transferase, in view of enzymatic
activity such as starch-hydrolyzing activity and .alpha.,
.alpha.-trehalose-producing activity. In addition, such enzymatic
activities were found to be attributed to synergism by activities
of these mixed enzymes. Further, when the activity-measuring method
proposed by Lama, et al. is employed in purification of each
enzyme, in which the index is decrement of blue color derived from
iodo-starch reaction, the purification of each enzyme having such
an activity resulted in a low yield on the whole, and such
purification procedure was found to be very difficult. These events
may be attributed to low sensitivity and low quantifying ability of
the activity-measuring method. Moreover, the Inventors' strict
examination revealed that purification and isolation could not be
accomplished at all, in terms of protein, by the
partial-purification method described in the article by Lama, et
al.
[0043] Under such circumstances, Inventors have made further
investigation, and conceived a new activity-measuring method in
which the substrate is a trehaloseoligosaccharide such as
maltotriosyltrehalose, and the index is activity of liberating
.alpha., .alpha.-trehalose. By a practice of this measuring method,
it was revealed that amylase activity can be easily detected using
such a method. Inventors then tried to achieve purification of the
enzyme having such an activity in various bacterial strains, and
finally, succeeded in purification and isolation of such an
amylase. Further, Inventors examined enzymatic characteristics of
the isolated and purified amylase, and found, surprisingly, that
the enzyme thus obtained has a novel action mechanism, namely, has
the following characteristics together: [0044] The enzyme exhibits
an activity of endotype-hydrolyzing starch or starch hydrolysate;
[0045] the enzyme exhibits an activity of hydrolyzing starch
hydrolysate, a maltooligosaccharide or the like from the reducing
end to produce monosaccharides and/or disaccharides; [0046] the
enzyme exhibits a higher reactivity to a saccharide which is
composed of at least three sugar units wherein the linkage between
the first and second glucose residues from the reducing end side is
.alpha.-1, .alpha.-1, and the linkage between the second and third
glucose residues from the same end side is .alpha.-1,4 (for
example, trehaloseoligosaccharides), as compared with the
reactivity to each of the corresponding maltooligosaccharides; and
[0047] the enzyme has an activity of acting on such substrate
saccharides composed of at least three sugar units so as to
liberate .alpha., .alpha.-trehalose by hydrolyzing the .alpha.-1,4
linkage between the second and third glucose residues from the
reducing end side.
[0048] Moreover, Inventors isolated a gene coding for such novel
enzyme, and now, have established a process for producing, in a
genetic engineering manner, a recombinant novel amylase by
utilizing such a gene.
DISCLOSURE OF INVENTION
I. Novel Transferase
[0049] The present invention provides a novel transferase
(hereinafter referred to as "novel transferase of the present
invention", or simply referred to as "the enzyme of the present
invention" or "the present enzyme") which acts on a substrate
saccharide, the substrate saccharide being composed of at least
three sugar units wherein at least three glucose residues from the
reducing end are .alpha.-1,4-linked, so as to transfer the first
.alpha.-1,4 linkage from the reducing end into an .alpha.-1,
.alpha.-1 linkage.
[0050] In another aspect, the present invention provides a novel
transferase which acts on a substrate maltooligosaccharide, all of
the constituting glucose residues of the maltooligosaccharide being
.alpha.-1,4-linked, so as to transfer the first .alpha.-1,4 linkage
from the reducing end into an .alpha.-1, .alpha.-1 linkage.
[0051] Further, the present invention provides a process for
producing the novel transferase of the present invention, wherein a
bacterium capable of producing a transferase having such activities
is cultivated in a culture medium, and the transferase is isolated
and purified from the culture on the basis of an activity-measuring
method in which the substrate is a maltooligosaccharide, and the
index is the activity of producing trehaloseoligosaccharides.
[0052] Moreover, the present invention provides a process for
producing a saccharide having an end composed of a couple of
.alpha.-1, .alpha.-1-linked sugar units, characterized in that the
enzyme of the present invention is used and allowed to act on a
substrate saccharide, the substrate saccharide being composed of at
least three sugar units wherein at least three glucose residues
from the reducing end are .alpha.-1,4-linked, so as to produce the
objective saccharide in which at least three sugar units from the
reducing end side are glucose residues and the linkage between the
first and second glucose residues from the reducing end side is
.alpha.-1, .alpha.-1 while the linkage between the second and third
glucose residues from the reducing end side is .alpha.-1,4.
[0053] Furthermore, the present invention provides a process for
producing a trehaloseoligosaccharide, wherein the enzyme of the
present invention is used, and the substrate is each of
maltooligosaccharides or a mixture thereof.
[0054] Additionally, an object of the present invention is to
provide a gene coding for the transferase.
[0055] Further, another object of the present invention is to
provide a recombinant novel transferase and a process for producing
the same by using the above-mentioned gene.
[0056] Moreover, an object of the present invention is to provide
an efficient process for producing trehaloseoligosaccharides such
as glucosyltrehalose and maltoglucosyltrehalose by using a
recombinant novel transferase.
[0057] Accordingly, the DNA fragment based on the present invention
comprises a gene coding for a novel transferase which acts on a
substrate saccharide, the substrate saccharide being composed of at
least three sugar units wherein at least three glucose residues
from the reducing end are .alpha.-1,4-linked, so as to transfer the
first .alpha.-1,4 linkage from the reducing end into an .alpha.-1,
.alpha.-1 linkage.
[0058] Further, the recombinant novel transferase according to the
present invention is the product achieved by expression of the
above-mentioned DNA fragment.
[0059] Moreover, the process for producing a recombinant novel
transferase according to the present invention comprises: [0060]
culturing a host cell transformed with the above-mentioned gene;
[0061] producing said recombinant novel transferase in the culture;
and [0062] collecting the products. II. Novel Amylase
[0063] The present invention provides a novel amylase which acts on
a substrate saccharide, the substrate saccharide being composed of
at least three sugar units wherein at least three sugar units from
the reducing end are glucose residues, so as to liberate
principally monosaccharides and/or disaccharides by hydrolyzing the
substrate from the reducing end side.
[0064] In another aspect, the present invention provides a novel
amylase which has a principal activity of acting on a substrate
saccharide, the substrate saccharide being composed of at least
three sugar units wherein at least three sugar units from the
reducing end side are glucose residues and the linkage between the
first and the second glucose residues from the reducing end side is
.alpha.-1, .alpha.-1 while the linkage between the second and the
third glucose residues from the reducing end side is .alpha.-1,4,
so as to liberate .alpha., .alpha.-trehalose by hydrolyzing the
.alpha.-1,4 linkage between the second and the third glucose
residues.
[0065] Further, in another aspect, the present invention provides a
novel amylase which also has an activity of endotype-hydrolyzing
one or more .alpha.-1,4 linkages in the molecular chain of the
substrate as well as the above-described activity.
[0066] Moreover, the present invention provides a process for
producing aforementioned amylase, wherein a bacterium capable of
producing the above amylase of the present invention is cultivated
in a culture medium, and then the amylase is isolated and purified
from the culture on the basis of an activity-measuring method; in
which the substrate is a trehaloseoligosaccharide, and the index is
the activity of producing .alpha., .alpha.-trehalose.
[0067] Inventors allowed the above amylase of the present invention
in combination with the aforementioned transferase of the present
invention to act on a glucide raw material such as starch, starch
hydrolysate, and maltooligosaccharides, and found that .alpha.,
.alpha.-trehalose can be efficiently produced thereby with a high
yield.
[0068] Accordingly, the present invention also provides a process
for producing .alpha., .alpha.-trehalose, wherein the above amylase
and transferase of the present invention are used in
combination.
[0069] Additionally, an object of the present invention is to
provide a novel amylase and a gene coding for the same.
[0070] Further, another object of the present invention is to
provide a recombinant novel amylase and a process for producing the
same by using the aforementioned gene.
[0071] Moreover, another object of the present invention is to
provide a process for producing .alpha., .alpha.-trehalose by using
a recombinant novel amylase.
[0072] Therefore, the gene coding for the amylase according to the
present invention comprises a DNA sequence coding for a novel
amylase which has the following activities:
[0073] (1) An activity of endotype-hydrolyzing an .alpha.-1,4
glucoside linkage in a sugar chain;
[0074] (2) an activity of acting on a substrate saccharide, the
substrate saccharide being composed of at least three sugar units
wherein at least three sugar units from the reducing end are
.alpha.-1,4-linked glucose residues, so as to liberate principally
monosaccharides and/or disaccharides by hydrolyzing the substrate
from the reducing end side; and
[0075] (3) a principal activity of acting on a substrate
saccharide, the substrate saccharide being composed of at least
three sugar units wherein at least three sugar units from the
reducing end side are glucose residues and the linkage between the
first and second glucose residues from the reducing end side is .
.alpha.-1, .alpha., .alpha.-1 while the linkage between the second
and third glucose residues from the reducing end side is
.alpha.-1,4, so as to liberate .alpha., .alpha.-trehalose by
hydrolyzing the .alpha.-1,4 linkage between the second and third
glucose residues.
[0076] Further, the recombinant novel amylase according to the
present invention is a product achieved by expression of the
above-described gene.
[0077] Furthermore, the process for producing .alpha.,
.alpha.-trehalose according to the present invention comprises a
step to put the above-described recombinant novel amylase and a
novel transferase into contact with a saccharide of which at least
three glucose residues from the reducing end are
.alpha.-1,4-linked, wherein the transferase can act on a substrate
saccharide, the substrate saccharide being composed of at least
three sugar units wherein at least three glucose residues from the
reducing end are .alpha.-1,4-linked, so as to transfer the first
.alpha.-1,4-linkage from the reducing end into an .alpha.-1,
.alpha.-1 linkage.
BRIEF DESCRIPTION OF THE DRAWINGS
[0078] FIG. 1 is a graph showing the results of an analysis by
TSK-gel Amide-80 HPLC, performed on the product which is obtained
in Example I-1 by using the cell extract derived from the
Sulfolobus solfataricus strain KM1.
[0079] FIG. 2 is a graph showing thermostability of the present
transferase which is obtained in Example I-2 from the Sulfolobus
solfataricus strain KM1.
[0080] FIG. 3 is a graph showing pH stability of the present
transferase which is obtained in Example I-2 from the Sulfolobus
solfataricus strain KM1.
[0081] FIG. 4 is a graph showing reactivity of the present
transferase which is obtained in Example I-2 from the Sulfolobus
solfataricus strain KM1, when examined at each temperature.
[0082] FIG. 5 is a graph showing optimum pH for reaction of the
present transferase which is obtained in Example I-2 from the
Sulfolobus solfataricus strain KM1.
[0083] FIG. 6 is a graph showing patterns of reaction products
derived from maltotriose by using the present transferase which is
obtained in Example I-2 from the Sulfolobus solfataricus strain
KM1.
[0084] FIG. 7 is a graph showing patterns of reaction products
derived from maltotetraose by using the present transferase which
is obtained in Example I-2 from the Sulfolobus solfataricus strain
KM1.
[0085] FIG. 8 is a graph showing patterns of reaction products
derived from maltopentaose by using the present transferase which
is obtained in Example I-2 from the Sulfolobus solfataricus strain
KM1.
[0086] FIG. 9 is a graph showing the results of an analysis by
AMINEX HPX-42A HPLC, performed on the reaction product derived from
a mixture of maltooligosaccharides by using the present transferase
which is obtained in Example I-2 from the Sulfolobus solfataricus
strain KM1.
[0087] FIG. 10 is a graph showing the results of an analysis by
TSK-gel Amide-80 HPLC, performed on the reaction product derived
from maltotriosyltrehalose subjected to reaction with the crude
enzyme solution which is obtained in Example II-1 from the
Sulfolobus solfataricus strain KM1.
[0088] FIG. 11 is a graph showing the results of an analysis by
AMINEX HPX-42A HPLC, performed on the reaction product derived from
soluble starch subjected to reaction with the crude enzyme solution
which is obtained in Example II-1 from the Sulfolobus solfataricus
strain KM1.
[0089] FIG. 12 is a graph showing thermostability of the present
amylase which is obtained in Example II-2 from the Sulfolobus
solfataricus strain KM1.
[0090] FIG. 13 is a graph showing pH stability of the present
amylase which is obtained in Example II-2 from the Sulfolobus
solfataricus strain KM1.
[0091] FIG. 14 is a graph showing reactivity of the present amylase
which is obtained in Example II-2 from the Sulfolobus solfataricus
strain KM1, examined at each reaction temperature.
[0092] FIG. 15 is a graph showing optimum pH for reaction of the
present amylase which is obtained in Example II-2 from the
Sulfolobus solfataricus strain KM1.
[0093] FIG. 16 is a graph showing reactivity of the present amylase
to various substrates, the amylase being obtained in Example II-2
from the Sulfolobus solfataricus strain KM1.
[0094] FIG. 17 contains graphs showing the results of analyses by
AMINEX HPX-42A HPLC, performed on the reaction products derived
from maltopentaose, Amylose DP-17, and soluble starch,
respectively, subjected to reaction with the present amylase which
is obtained in Example II-2 from the Sulfolobus solfataricus strain
KM1.
[0095] FIG. 18 is a graph showing the results of an analysis by
TSK-gel Amide-80 HPLC, performed on the reaction product derived
from maltotriosyltrehalose subjected to reaction with the present
amylase which is obtained in Example II-2 from the Sulfolobus
solfataricus strain KM1.
[0096] FIG. 19 is a graph showing the results of an analysis by
TSK-gel Amide-80 HPLC, performed on the reaction product derived
from maltopentaosyltrehalose subjected to reaction with the present
amylase which is obtained in Example II-2 from the Sulfolobus
solfataricus strain KM1.
[0097] FIG. 20 is a graph showing time-course changes in
disappearance of color generated by iodo, and starch-hydrolyzing
percentage when the present amylase which is obtained in Example
II-2 from the Sulfolobus solfataricus strain KM1 is made to act on
soluble starch.
[0098] FIG. 21 is a graph showing time-course change in
radioactivity of the reaction product derived from radiolabeled
maltopentaose subjected to reaction with the present amylase which
is obtained in Example II-2 from the Sulfolobus solfataricus strain
KM1.
[0099] FIG. 22 is a graph showing time-course change in
radioactivity of the reaction product derived from radiolabeled
maltotriosyltrehalose subjected to reaction with the present
amylase which is obtained in Example II-2 from the Sulfolobus
solfataricus strain KM1.
[0100] FIG. 23 is a graph showing reactivity of .alpha.-amylase
derived from porcine pancreas to various substrates.
[0101] FIG. 24 is a graph showing the results of an analysis by
TSK-gel Amide-80 HPLC, performed on the reaction product derived
from maltopentaosyltrehalose subjected to reaction with
.alpha.-amylase which is derived from porcine pancreas.
[0102] FIG. 25 is a graph showing the results of an analysis by
AMINEX HPX-42A HPLC, performed on the reaction product derived from
soluble starch subjected to reaction with transferase and the
present amylase which is obtained in Example II-2 from the
Sulfolobus solfataricus strain KM1.
[0103] FIG. 26 is an illustration showing the restriction map of
each insertional fragment pKT1, pKT11 or pKT21, containing a gene
which codes for the novel transferase, and is obtained in Example
I-12 from the Sulfolobus solfataricus strain KM1.
[0104] FIG. 27 is an illustration showing a process for
constructing the plasmid pKT22.
[0105] FIG. 28 is a graph showing the results of an analysis by
TSK-gel Amide-80 HPLC, performed on the product derived from
maltotriose by using the recombinant novel transferase.
[0106] FIG. 29 is an illustration showing the restriction map of
the insertional fragment pO9TI containing a gene which codes for
the novel transferase, and-is obtained in Example I-16 from the
Sulfolobus acidocaldarius strain ATCC 33909.
[0107] FIG. 30 is an illustration showing a process for
constructing the plasmid pO9T1.
[0108] FIG. 31 is an illustration showing the homology between the
amino acid sequence of the novel transferase derived from the
Sulfolobus solfataricus strain KM1 and that derived from the
Sulfolobus acidocaldarius strain ATCC 33909.
[0109] FIG. 32 is an illustration showing the homology between the
base sequence of the gene coding for the novel transferase derived
from the Sulfolobus solfataricus strain KM1 and that derived from
the Sulfolobus acidocaldarius strain ATCC 33909.
[0110] FIG. 33 is a graph showing the results of an analysis by
AMINEX HPX-42A HPLC, performed on the product derived from a
maltooligosaccharide mixture by using the recombinant novel
transferase.
[0111] FIG. 34 is an illustration showing the restriction map of
the insertional fragment pKA1 containing a gene which codes for the
novel amylase, and is derived from the Sulfolobus solfataricus
strain KM1.
[0112] FIG. 35 is an illustration showing the restriction map of
pKA2.
[0113] FIG. 36(A) is a graph showing the results of an analysis
performed on the product derived from a maltotriosyltrehalose by
using the recombinant novel amylase according to the present
invention; and FIG. 36(B) is a graph showing the results of an
analysis performed on the product derived from soluble starch by
using the recombinant novel amylase according to the present
invention.
[0114] FIG. 37 is a graph showing time-course changes in
disappearance of color generated by iodo, and starch-hydrolyzing
percentage when the recombinant novel amylase according to the
present invention is made to act on soluble starch.
[0115] FIG. 38 is an illustration showing the restriction map of
the insertional fragment pO9A1 containing a gene which codes for
the novel amylase, and is derived from the Sulfolobus
acidocaldarius strain ATCC 33909.
[0116] FIG. 39 is an illustration showing the process for producing
pO9A1 from pO9A2.
[0117] FIG. 40 is an illustration showing the homology between the
amino acid sequence of the novel amylase derived from the
Sulfolobus acidocaldarius strain ATCC 33909 and that derived from
the Sulfolobus solfataricus strain KM1.
[0118] FIG. 41 is an illustration showing the homology between the
base sequence of the gene coding for the novel amylase derived from
the Sulfolobus acidocaldarius strain ATCC 33909 and that derived
from the Sulfolobus solfataricus strain KM1.
[0119] FIG. 42 is a graph showing the results of an analysis
performed on the product derived from 10% soluble starch subjected
to reaction with the recombinant novel amylase which is obtained in
Example II-19, and the recombinant novel transferase which is
obtained in Example I-20.
DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS
Deposit of Microorganisms
[0120] The below-mentioned novel bacterial strain KM1, which was
substantially purely isolated from nature by the Inventor, was
deposited in the National Research Institutes, the Life Science
Laboratory for Industry on Apr. 1, 1994 as acceptance No. FERM
BP-4626.
[0121] The Escherichia coli strain JM109/pKT22 transformed with the
plasmid pKT22 according to the present invention (c.f.
below-described Example I-14), and the Escherichia coli strain
JM109/pO9T1 transformed with the plasmid pO9T1 (c.f.
below-described Example I-16), which contain the gene coding for
the novel transferase according to the present invention, were
deposited in the National Research Institutes, the Life Science
Laboratory for Industry on Oct. 21, 1994 as acceptance No. FERM
BP-4843 and on May 9, 1995 as the acceptance No. FERM BP-5093,
respectively.
[0122] Further, the Escherichia coli strain JM109/pKA2 transformed
with the plasmid pKA2 according to the present invention (c.f.
below-described Example II-19), and the Escherichia coli strain
JM109/pO9A1 transformed with the plasmid pO9A1 (c.f.
below-described Example II-22), which contain the gene coding for
the novel amylase according to the present invention, were
deposited in the National Research Institutes, the Life Science
Laboratory for Industry on Oct. 31, 1994 as acceptance No. FERM
BP-4857 and on May 9, 1995 as acceptance No. FERM BP-5092,
respectively.
I. Novel Transferase
Microorganisms Producing the Novel Transferase of the Present
Invention
[0123] The archaebacteria which can be used in the present
invention may include the Sulfolobus solfataricus strain ATCC 35091
(DSM 1616), the Sulfolobus solfataricus strain DSM 5833, the
Sulfolobus solfataricus strain KM1 (the below-described novel
bacterial strain which was substantially purely isolated from
nature by Inventors), the Sulfolobus acidocaldarius strain ATCC
33909 (DSM 639), and the Acidianus brierleyi strain DSM 1651.
[0124] As described above, a fairly wide variety of archaebacteria
taxonomically classified under the order Sulfolobales, to which the
genera Sulfolobus and Acidianus belong, may be considered as the
microorganisms which can produce the novel transferase of the
present invention. Here, the archaebacterium belonging to the order
Sulfolobales are taxonomically defined as being highly acidophilic
and thermophilic, being aerobic, and being sulfur bacteria (coccal
bacteria). The aforementioned Acidianus brierleyi strain DSM 1651,
which belongs to the genus Acidianus, had been formerly classified
as Sulfolobus brierleyi strain DSM 1651, and the aforementioned
Sulfolobus solfataricus strain DSM 5833 had been named as
Caldariella acidophila. From these facts, microorganisms which are
closely related to the above-described archaebacteria genetically
or taxonomically and which are capable of producing the enzyme of
the same kind can be used in the present invention.
Sulfolobus solfataricus Strain KM1
[0125] Among the above-illustrated microorganisms, the Sulfolobus
solfataricus strain KM1 is the bacterial strain which Inventors
isolated from a hot spring in Gunma Prefecture, and which exhibits
the following characteristics.
(1) Morphological Characteristics
[0126] The shape and size of the bacterium: Coccoid (no regular
form), and a diameter of 0.6-2 .mu.m. (2) Optimum Growth Conditions
[0127] pH: Capable of growing in pH of 3-5.5, and optimally, in pH
of 3.5-4.5. [0128] Temperature: Capable of growing in a temperature
range of 55.degree. C.-85.degree. C., and optimally in a
temperature range of 75.degree. C.-80.degree. C. [0129] Capable of
metabolize sulfur. (3) Classification in View of Aerobic or
Anaerobic: Aerobic.
[0130] According to the above characteristics, identification of
the bacterial strain was carried out on the basis of Bergey's
Manual of Systematic Bacteriology Volume, 3 (1989). As a result,
the strain was found to be one of Sulfolobus solfataricus, and thus
named as Sulfolobus solfataricus strain KM1.
[0131] In culturing the above bacterial strain, the culture medium
to be used may be either liquid or solid, and ordinarily, a
concussion culturing or a culturing with aeration and stirring is
performed using a liquid culture medium. In other words, the
culture medium to be used is not limited as long as it is suitable
for the bacterial growth, and the suitable examples of such culture
media may include the Sulfolobus solfataricus Medium which is
described in Catalogue of Bacteria and Pharges 18th edition (1992)
published by American Type Culture Collection (ATCC), and in
Catalogue of Strains 5th edition (1993) published by Deutsche
Sammlung von Mikroorganismen und Zellkulturen GmbH (DSM). Starch,
maltooligosaccharide and/or the like may be further added as a
sugar source. Moreover, the culturing conditions are also not
limited as long as they are based on the above-described growable
temperature and pH.
Cultivation of the Microorganisms which Produce the Novel
Transferase of the Present Invention
[0132] The culturing conditions for producing the novel transferase
of the present invention may suitably be selected within ranges in
which the objective transferase can be produced. When a concussion
culturing or a culturing with aeration and stirring using a liquid
medium is employed, the culturing for 2-7 days should suitably be
performed at a pH and a temperature which allow the growth of each
microorganism. The culture medium to be suitably used is, for
example, the Sulfolobus solfataricus Medium which is described in
Catalogue of Bacteria and Pharges 18th edition (1992) published by
American Type Culture Collection (ATCC), and in Catalogue of
Strains 5th edition (1993) published by Deutsche Sammlung von
Mikroorganismen und Zellkulturen GmbH (DSM). Starch,
maltooligosaccharide and/or the like may be further added as a
sugar source.
Purification of the Novel Transferase of the Present Invention
[0133] The novel transferase of the present invention which is
produced by the above-described microorganisms can be extracted as
follows: At first, the bacterial bodies are collected from the
culture obtained in a culturing process as described above by a
publicly-known procedure, for example, by centrifugation; the
resultant is suspended in a proper buffer solution; the bacterial
bodies are then crushed by freeze thawing, a ultrasonic treatment,
grinding and/or the like; and the resultant is centrifuged or
filtrated to obtain a cell extract containing the objective
transferase.
[0134] To purify the novel transferase of the present invention
which is contained in the cell extract, publicly-known processes
for isolation and purification can be employed in proper
combination. Examples of such processes may include a process
utilizing solubility, such as salt precipitation and solvent
precipitation; a process utilizing difference in molecular weight,
such as dialysis, ultrafiltration, gel filtration and
SDS-Polyacryl-amide gel electrophoresis; a process utilizing a
difference in electric charge, such as ion exchange chromatography;
a process utilizing specific affinity, such as affinity
chromatography; a process utilizing a difference in hydrophobicity,
such as hydrophobic chromatography and reversed phase
chromatography; and further, a process utilizing a difference in
isoelectric point, such as isoelectric focusing. Practical examples
of these processes are shown in Examples I-2-I-5 below. Finally,
Native Polyacrylamide gel electrophoresis, SDS-Polyacrylamide gel
electrophoresis or isoelectric focusing is performed to obtain a
purified enzyme which appears therein as a single band.
[0135] As to measurement of activity in the enzyme or
enzyme-containing substance isolated by the above various
purification processes, starch is used as the substrate in the
activity-measuring method offered by Lama, et al. By this method,
though the production of trehalose and glucose can be confirmed,
the production of trehaloseoligosaccharides cannot be detected at
all, and as a serious problem, even the trehalose-producing
activity becomes undetectable due to its disappearance during
purification. Therefore, the purification and characterization of
the true substance of the enzyme activity had been substantially
impossible. Under such circumstances, Inventors employed a new
activity-measuring method in which the substrate is a
maltooligosaccharide such as maltotriose, and the index is activity
of producing a trehaloseoligosaccharide such as glucosyltrehalose.
As a result, isolation and purification of the objective enzyme
could be achieved for the first time by-this method, and finally,
the true substance of the novel transferase activity of the present
invention could be practically purified and specified.
Characteristics of the Novel Transferase According to the Present
Invention
[0136] As examples of the enzyme of the present invention, the
transferases produced by the Sulfolobus solfataricus strain KM1,
the Sulfolobus solfataricus strain DSM 5833, the Sulfolobus
acidocaldarius strain ATCC 33909, and the Acidianus brierleyi
strain DSM 1651, respectively, are taken up, and the enzymatic
characteristics of these transferases are shown in Table 1 below in
summary. Here, data in the table is based on the practical examples
shown in Examples I-6 and 1-7. TABLE-US-00001 TABLE 1 Sulfolobus
Sulfolobus Sulfolobus Acidianus solfataricus solfataricus
acidocaldarius brierleyi Physicochemical properties KM1 DSM5833
ATCC33909 DSM1651 (1) Enzyme action and Acts on glucose polymers
composed of more than maltotriose Substrate specificity wherein
glucoses are .alpha.-1, 4-linked, so as to combine two sugar
moieties from the reducing end into an .alpha.-1, .alpha.-1 linkage
by transfer. Not acts on maltose or glucose. (2) Optimum pH 5.0-6.0
4.5-5.5 4.5-5.5 4.5-5.5 (3) pH Stability 4.0-10.0 4.5-12.0 4.0-10.0
4.0-12.0 (4) Optimum temperature 60-80.degree. C. 70-80.degree. C.
70-80.degree. C. 70-80.degree. C. (5) Thermal stability 85.degree.
C., 6 hr 85.degree. C., 6 hr 85.degree. C., 6 hr 85.degree. C., 6
hr 91% remained 90% remained 90% remained 98% remained (6)
Molecular weight SDS-PAGE 76000 75000 74000 74000 Gel-permeation
54000 56000 56000 135000 (7) Isoelectric point 6.1 5.3 5.6 6.3 (8)
Inhibitor 5 mM CuSO.sub.4 5 mM CuSO.sub.4 5 mM CuSO.sub.4 5 mM
CuSO.sub.4 100% inhibited 100% inhibited 100% inhibited 100%
inhibited
Note 1: Time-course Change
[0137] When maltotriose was used as the substrate,
glucosyltrehalose as a product in the principal reaction, and
besides, equal moles of maltose and glucose were produced as
products in a side reaction.
[0138] When a saccharide having a polymerization degree, n, which
is equal to or higher than that of maltotetraose, was used, a
saccharide of which the glucose residue at the reducing end is
.alpha.-1, .alpha.-1-linked was produced in the principal reaction,
and besides, equal moles of glucose and a saccharide having a
polymerization degree of n-1 were produced in a side reaction.
Note 2: Enzymatic Action/Mode of Enzymatic Reaction
[0139] It is considered that the enzyme has an activity of acting
on maltotriose or a larger saccharide, three glucose residues from
the reducing end of the saccharide being .alpha.-1,4-linked, so as
to transfer the first linkage from the reducing end into an
.alpha.-1, .alpha.-1-linkage. As a side reaction, the enzyme also
has an activity of liberating glucose from a glucose polymer, when,
for example, the concentration of the substrate is low, or the
reaction time is long. The details are as shown in the practical
example of Example I-7.
[0140] The characteristics of the present enzyme have been
described above. As described in the above item titled "Enzymatic
Action/Mode of Enzymatic Reaction", the present enzyme has an
activity of acting on maltotriose or a larger saccharide, three
glucose residues from the reducing end of the saccharide being
.alpha.-1,4-linked, so as to transfer the first linkage from the
reducing end into an .alpha.-1, .alpha.-1-linkage, and such an
activity is quite a novel enzymatic activity. However, as obvious
in the examples below, the characteristics of the present enzyme
other than such enzymatic activities slightly vary according to the
difference in genus or species between the bacterial strains.
Production of Trehaloseoligosaccharides such as Glucosyltrehalose
and Maltooligosyltrehalose
[0141] The present invention provides a process for producing a
saccharide having an end composed of a couple of .alpha.-1,
.alpha.-1-linked sugar units, characterized in that the enzyme of
the present invention is used and allowed to act on a substrate
saccharide, the substrate saccharide being composed of at least
three sugar units wherein at least three glucose residues from the
reducing end are .alpha.-1,4-linked, so as to produce the objective
saccharide in which at least three sugar units from the reducing
end side are glucose residues and the linkage between the first and
second glucose residues from the reducing end side is .alpha.-1,
.alpha.-1 while the linkage between the second and third glucose
residues from the reducing end side is .alpha.-1,4. The process
according to the present invention will be illustrated below with
the most typical example, namely, with a process for producing
trehaloseoligosaccharides such as glucosyltrehalose and
maltooligosyltrehaloses.
[0142] In the process for producing trehaloseoligosaccharides such
as glucosyltrehalose and maltooligosyltrehaloses according to the
present invention, trehaloseoligosaccharides such as
glucosyltrehalose and maltooligosyltrehaloses are produced from a
saccharide such as maltooligosaccharides, typically, from each or a
mixture of maltooligosaccharides by the present enzyme derived from
archaebacteria. Accordingly, the mode of contact between the
present transferase and a saccharide such as maltooligosaccharides
is not specifically limited as long as the present enzyme produced
by archaebacteria can act on the saccharide such as
maltooligosaccharides in such mode. In practice, the following
procedure may ordinarily be performed: A crude enzyme is obtained
from the bacterial bodies or crushed bacterial bodies of an
archaebacterium; and the purified enzyme obtained in each of the
various purification steps, or the enzyme isolated and purified
through various purification means, is made to act directly on a
saccharide such as maltooligosaccharides. Alternatively, the
above-described enzyme may be put into contact with a saccharide
such as maltooligosaccharides in a form of a immobilized enzyme
which is immobilized to a carrier in the usual way. Additionally,
two or more of the present enzymes derived from two or more species
of archaebacteria may coexist and be put into contact with a
saccharide such as maltooligosaccharides.
[0143] The mixture of maltooligosaccharides, which is a typical raw
material of the substrate in the above-described producing process
of the present invention, may be prepared, for example, by properly
hydrolyzing. or acidolyzing starch using an endotype amylase, a
debranching enzyme or the like so that at least three glucose
residues from the reducing end of the product are
.alpha.-1,4-linked. The endotype amylases to be used herein may
include enzymes derived from bacteria belonging to the genus
Bacillus, fungi belonging to the genus Aspergillus, and plants such
as malt, and others. On the other hand, the debranching enzymes to
be used herein may include pullulanase derived from bacteria
belonging to the genus Bacillus, Klebsiella or the like, or
isoamylase derived from bacteria belonging to the genus
Pseudomonas. Further, these enzymes may be used in combination.
[0144] The concentration of a saccharide such as
maltooligosaccharides should be suitably selected within the range
in which the saccharide to be used is dissolved, considering the
specific activity of the present enzyme, the reaction temperature
and others. A range of 0.5-70% is ordinary, and a range of 5-40% is
preferable. The reaction temperature and pH condition in the
reaction of the saccharide with the enzyme should be optimum for
the present transferase. Accordingly, the reaction is performed
ordinarily at 50-85.degree. C. and pH 3.5-6.5, approximately, and
more preferably, at 60-80.degree. C. and pH 4.5-6.0.
[0145] The produced reaction mixture which contains
trehaloseoligosaccharides such as glucosyltrehalose or
maltooligosyltrehalose can be purified according to a
publicly-known process. For example, the obtained reaction mixture
is desalted with an ion-exchange resin; the objective saccharide
fraction is then isolated and crystallized by chromatography using
activated charcoal, an ion-exchange resin (HSO3 type),
cation-exchange resin (Ca type) or the like as a separating
material, and by a subsequent condensation to be optionally
performed; and finally, trehaloseoligosaccharides are yielded
within a high purity.
A Gene Coding for the Novel Transferase
[0146] According to the present invention, a gene coding for the
above novel transferase is further provided. For example, the DNA
fragments illustrated by restriction maps shown in FIGS. 26 and 29
can be listed as DNA fragments comprising a gene coding for the
novel transferase according to the present invention.
[0147] These DNA fragment can be obtain from an archaebacterium
belonging to the order Sulfolobales, and preferably, belonging to
the genus Sulfolobus. More preferably, the fragment can be isolated
from the below-described Sulfolobus solfataricus strain KM1 or
Sulfolobus acidocaldarius strain ATCC 33909. The suitable process
for the isolation from the Sulfolobus solfataricus strain KM1 or
the Sulfolobus acidocaldarius strain ATCC 33909 is illustrated in
detail in the below-described Examples.
[0148] The practical examples of the origin from which the DNA
fragments can be derived may further include the Sulfolobus
solfataricus strains DSM 5354, DSM 5833, ATCC 35091 and ATCC 35092;
the Sulfolobus acidocaldarius strain ATCC 49426; the Sulfolobus
shibatae strain DSM 5389; the Acidianus brierleyi strain DSM 1651;
and others. It is obvious from the following facts that these
archaebacteria can be the origins of the DNA fragments according to
the present invention: The novel transferase gene derived from the
Sulfolobus solfataricus strain KM1 forms a hybrid with the
chromosome DNA derived from each of those archaebacteria in the
below-described hybridization test performed in Example I-17; and
further, the characteristics of the enzymes themselves very closely
resemble each other as described above. Moreover, the results in
the aforementioned Example suggestively indicate that the novel
transferase gene according to the present invention is highly
conserved, specifically in archaebacteria belonging to the order
Sulfolobales.
[0149] The preferable mode for carrying out the present invention
provides a DNA fragment comprising a DNA sequence. coding for the
amino acid sequence shown in Sequence No. 2 or 4 as a suitable
example of the gene coding for the novel transferase of the present
invention. Further, the sequence from 335th base to 2518th base
among the base sequence shown in Sequence No. 1 can be listed as a
suitable example of the DNA sequence coding for the amino acid
sequence shown in Sequence No. 2. The sequence from 816th base to
2855th base among the base sequence shown in Sequence No. 3 can be
listed as a suitable example of the DNA sequence coding for the
amino acid sequence shown in Sequence No. 4.
[0150] In general, when given the amino acid sequence of a protein,
the base sequence coding therefor can be easily determined by
referring to what is called the Codon Table. Therefore, several
base sequences which code for the amino acid sequence shown in
Sequence No. 2 or 4 can be suitably selected. Accordingly, in the
present invention, "the DNA sequence coding for the amino acid
shown in Sequence No. 2" implies the DNA sequence comprising the
sequence from 335th base to 2518th base of the base sequence shown
in Sequence No. 1; and also, the DNA sequences which comprise the
same base sequence as above except that one or more codons are
replaced with the codons having a relationship of degeneracy
therewith, and which still code for the amino acid shown in
Sequence No. 2. Similarly, "the DNA sequence coding for the amino
acid shown in Sequence No. 4" implies the DNA sequence comprising
the sequence from 816th base to 2855th base of the base sequence
shown in Sequence No. 3; and also, the DNA sequences which comprise
the same base sequence as above except that one or more codons are
replaced with the codons having a relationship of degeneracy
therewith, and which still code for the amino acid shown in
Sequence No. 4.
[0151] Further, as described below, the scope of the novel
transferase according to the present invention also includes the
sequences equivalent to the amino acid sequence shown in Sequence
No. 2 or 4. The scope of the DNA fragment according to the present
invention, therefore, further includes the base sequences which
code for such equivalent sequences.
[0152] Incidentally, Inventors surveyed the existence of a base
sequence homologous to the base sequence shown in Sequence No. 1 or
3 through a data bank on base sequences (EMBL) by using
sequence-analyzing software, GENETYX (by Software Development Co.).
As a result, Inventors have confirmed that such a base sequence
does not exist.
[0153] Since the base sequence of the DNA fragment comprising the
sequence from 335th base to 2518th base of the base sequence shown
in Sequence No. 1, and the base sequence of the DNA fragment
comprising the sequence from 816th base to 2518th base of the base
sequence shown in Sequence No. 3 have been determined, a means for
obtaining these DNA fragments is producing them based on a process
for polynucleotide synthesis.
[0154] Further, these sequences can be obtained by using a process
of gene engineering from the above-described archaebacteria
belonging to the order Sulfolobales, and preferably, from the
Sulfolobus solfataricus strain KM1 or the Sulfolobus acidocaldarius
strain ATCC 33909. For example, they can be suitably obtained by a
process described in Molecular Cloning: A Laboratory Manual
[Sambrook, Mainiatis, et al., published by Cold Spring Harbour
Laboratory Press (1989)], and others. The practical method is
illustrated in detail in the below-described examples.
Recombinant Novel Transferase
[0155] Since the gene coding for the novel transferase is provided
as described above, the expressed product from this gene, a
recombinant novel transferase, can be obtained according to the
present invention.
[0156] Suitable examples of the recombinant novel transferase
according to the present invention may include an expressed product
from the DNA fragment illustrated with the restriction map shown in
FIG. 26 or 29.
[0157] Also, the suitable examples may include a polypeptide
comprising the amino acid sequence shown in Sequence No. 2 or 4 of
the Sequence Table, or the equivalent sequence thereof. Here, the
term "equivalent sequence" stands for the amino acid sequence which
basically has the amino acid sequence shown in Sequence No. 2 or 4;
but has undergone insertion, replacement or deletion of some amino
acids, or addition of some amino acids to each terminus; and still
keeps the activity of the novel transferase. The state in which the
equivalent sequence keeps the activity of the novel transferase
means that it keeps an activity sufficient for similar use in
similar conditions as compared to the polypeptide having the
complete sequence shown in Sequence No. 2 or 4, when the activity
is applied in a practical mode for use. Obviously, persons skilled
in the art can select and produce such an "equivalent sequence" by
referring to the sequences shown in Sequence Nos. 2 and 4 without
any special difficulty, since it is revealed in Example I-18 that
the same activity is kept in the enzymes derived from the
Sulfolobus solfataricus strain KM1 and the Sulfolobus
acidocaldarius strain ATCC 33909 though the homology between the
amino acid sequences of the novel transferases from these 2 strains
is 49% when calculated considering gaps.
[0158] As clarified in Example I-17 below, each. of the DNA
fragments having the sequences shown in Sequence Nos. 1 and 3,
respectively, can hybridize with each of DNA fragments derived from
some bacterial strains other than the Sulfolobus solfataricus
strain KM1 and the Sulfolobus acidocaldarius strain ATCC 33909
which are the origins of said DNA fragments, respectively.
Meanwhile, as described above, Inventors have now confirmed the
existence of a novel transferase having very close characteristics
in those bacterial strains. Further, as revealed in Example I-18
below, the homology between the amino acid sequences of the novel
transferases derived from the Sulfolobus solfataricus strain KM1
and the Sulfolobus acidocaldarius strain ATCC 33909 is 49% when
calculated considering gaps. It is, therefore, obvious to persons
skilled in the art that the activity of the novel transferase can
be kept in a sequence which is homologous, to some extent, with the
amino acid sequence shown in Sequence No. 2 or 4.
[0159] Incidentally, Inventors surveyed the existence of a sequence
homologous to the amino acid sequence shown in Sequence No. 2 or 4
through a data bank on amino acid sequences (Swiss prot and
NBRF-PFB) by using sequence-analyzing software, GENETYX (by
Software Development Co.). As a result, Inventors have confirmed
that such a sequence does not exist.
Expression of a Gene Coding for the Novel Transferase
[0160] The recombinant novel transferase according to the present
invention can be produced in a host cell by transforming the host
cell with a DNA molecule, and especially with an expression vector,
which can replicate in the host cell, and contains the DNA fragment
coding for the novel transferase according to the present invention
so as to express the transferase gene.
[0161] The present invention, therefore, further provides a DNA
molecule, and particularly, an expression vector, which contains a
gene coding for the novel transferase according to the present
invention. Such a DNA molecule can be obtained by integrating the
DNA fragment coding for the novel transferase of the present
invention into a vector molecule. According to the preferable mode
for carrying out the present invention, the vector is a
plasmid.
[0162] The DNA molecule according to the present invention can be
prepared on the basis of the process described in the
aforementioned Molecular Cloning: A Laboratory Manual.
[0163] The vector to be used in the present invention can suitably
be selected from viruses, plasmids, cosmid vectors, and others
considering the type of the host cell to be used. For example, a
bacteriophage of .lamda. phage type, a plasmid of pBR or pUC type
can be used when the host cell is Escherichia coli; a plasmid of
pUB type can be used when the host cell is Bacillus subtilis; and a
vector of YEp or YCp type can be used when the host cell is
yeast.
[0164] The plasmid should preferably contain a selective marker for
detection of the transformant, and a drug-resistance marker and an
auxotrophy marker can be used as such a selective marker.
[0165] Further, the DNA molecule as an expression vector according
to the present invention should preferably contain DNA sequences
necessary for expression of the novel transferase gene, for
example, a transcription-controlling signal, a
translation-controlling signal and/or the like such as a promoter,
a transcription-initiating signal, a ribosome-binding site, a
translation-stopping signal, and a transcription-finishing
signal.
[0166] Examples of the promoter to be suitably used may include, as
well as a promoter functional in the host which contains the
insertional fragment, a promoter such as a lactose operon (lac) and
a tryptophan operon (trp) for Escherichia coli, a promoter such as
an alcohol dehydrogenase gene (ADH), an acid phosphatase gene
(PHO), a galactose gene (GAL), and a glyceraldehyde 3-phosphate
dehydrogenase gene (GPD) for yeast.
[0167] Here, the base sequence comprising the sequence from 1st
base to 2578th base of the base sequence shown in Sequence No. 1,
and the base sequence comprising the sequence from 1st base to
3467th base of the base sequence shown in Sequence No. 3 are
recognized as containing the aforementioned sequences necessary for
expression. It is, therefore, also suitable to use these sequences
as they are.
[0168] Moreover, when the host cell is Bacillus subtilis or yeast,
it will be advantageous to use a secretory vector so as to excrete
the recombinant novel transferase outside of the host's body.
[0169] In addition to Escherichia coli, Bacillus subtilis, yeast,
and advanced eukaryotes, can be used as a host cell. Microorganisms
belonging to the genus Bacillus such as Bacillus subtilis are
suitably used. Some strains belonging to this genus are known to
excrete a protein outside of the bacterial body in a large amount.
Therefore, a large amount of the recombinant novel amylase can be
excreted in the culture medium by using a secretory vector. This is
preferable because the purification from the supernant of the
culture will be easy. Further, some strains belonging to the genus
Bacillus are known to excrete a very little amount of protease
outside of the bacterial body. It is preferable to use such strains
because the recombinant novel amylase can be efficiently produced
thereby. Moreover, it will be very advantageous to select a
microorganism which does not produce glucoamylase and to use it as
a host cell, because the recombinant novel transferase of the
present invention which is obtained as a cell extract or a
simply-purified crude enzyme can be directly used for the
below-described production of trehaloseoligosaccharides.
[0170] The recombinant novel transferase produced by the
aforementioned transformant can be obtained as follows: At first,
the above-described host cell is cultivated under proper
conditions; the bacterial bodies are. collected from the resultant
culture by a publicly-known method, for example, by centrifugation,
and suspended in a proper buffer solution; the bacterial bodies are
then crushed by freeze thawing, a ultrasonic treatment, grinding
and/or the like; and the resultant is centrifuged or filtrated to
obtain a cell extract containing the recombinant novel
transferase.
[0171] Purification of the recombinant novel transferase existing
in the cell extract can be performed by a proper combination of
publicly-known processes for isolation and purification. Examples
of the processes may include a process utilizing a difference in
thermostability, such as a heat treatment; a process utilizing a
difference in solubility, such as salt precipitation and solvent
precipitation, a process utilizing a difference in molecular
weight, such as dialysis, ultrafiltration, gel filtration and
SDS-Polyacryl-amide gel electrophoresis; a process utilizing a
difference in electric charge, such as ion exchange chromatography;
a process utilizing specific affinity, such as affinity
chromatography; a process utilizing a difference in hydrophobicity,
such as hydrophobic chromatography and reversed phase
chromatography; and further, a process utilizing a difference in
isoelectric point, such as isoelectric focusing. Since the
recombinant novel transferase is thermostable, the purification can
be very easily performed using heat treatment, by which proteins in
the host can be denatured and made into precipitation suitable for
removal.
Production of Trehaloseoligosaccharides Using the Recombinant Novel
Transferase
[0172] The present invention further provides a process for
producing so called trehaloseoligosaccharide such as
glucosyltrehalose and maltooligosyltrehalose, wherein the
above-described recombinant novel transferase is used.
[0173] Specifically, the process according to the present invention
is a process for producing a trehaloseoligosaccharide in which at
least three sugar units from the reducing end side are glucose
residues and the linkage between the first and second glucose
residues from the reducing end side is .alpha.-1, .alpha.-1 while
the linkage between the second and third glucose residues from the
reducing end side is .alpha.-1,4. And the process comprises putting
the above-described recombinant novel transferase into contact with
a saccharide, the saccharide being composed of at least three sugar
units wherein at least three glucose residues from the reducing end
are .alpha.-1,4-linked.
[0174] Though the saccharide composed of at least three sugar units
in which at least three glucose residues from the reducing end are
.alpha.-1,4-linked is not specifically limited, starch, starch
hydrolysate, maltooligosaccharides, and others can be listed as an
example of such a saccharide. Examples of starch hydrolysate may
include a product produced by properly hydrolyzing or acidolyzing
starch using an endotype amylase, a debranching enzyme or the like
so that at least three glucose residues from the reducing end of
the product are ..alpha.-1,4-linked. Examples of endotype amylase
to be used herein may include enzymes derived from bacteria
belonging to the genus Bacillus, fungi belonging to the genus
Aspergillus, and plants such as malt, and others. On the other
hand, Examples of the debranching enzymes may include pullulanase
derived from bacteria belonging to the genus Bacillus, Klebsiella
or the like, or isoamylase derived from bacteria belonging to the
genus Pseudomonas. Further, these enzymes may be used in
combination.
[0175] The mode and conditions for contact between the recombinant
novel transferase of the present invention and the saccharide
composed of at least three sugar units in which at least three
glucose residues from the reducing end are .alpha.-1,4-linked is
not specifically limited as long as the recombinant novel
transferase can act on the saccharide therein. An example of a
suitable mode for performing the contact in a solution is as
follows. The concentration of a saccharide such as
maltooligosaccha-rides should be suitably selected within the range
in which the saccharide to be used is dissolved, considering the
specific activity of the recombinant novel transferase, the
reaction temperature and others. A range of 0.5-70% is ordinary,
and a range of 5-40% is preferable. The reaction temperature and pH
condition in the reaction of the saccharide with the enzyme should
be optimum for the recombinant novel transferase. Accordingly, the
reaction is performed ordinarily at 50-85.degree. C. and pH
3.5-6.5, approximately, and more preferably, at 60-80.degree. C.
and pH 4.5-6.0.
[0176] Additionally, the purification degree of the recombinant
novel transferase can be properly selected. For example, a crude
enzyme derived from the crushed bodies of a transformant can be
used as it is, and the purified enzyme obtained in each of the
various purification steps can be also used, and further, the
enzyme isolated and purified through various purification means can
be used.
[0177] Alternatively, the above-described enzyme may be put into
contact with a saccharide such as maltooligosaccharides in a form
of a immobilized enzyme which is immobilized to a carrier in the
usual way.
[0178] The produced trehaloseoligosaccharides such as
glucosyltrehalose and maltooligosyltrehalose can be recovered by
purifying the reaction mixture using according to a publicly-known
process. For example, the obtained reaction mixture is desalted
with an ion-exchange resin; the objective saccharide fraction is
then isolated and crystallized by chromatography using activated
charcoal, an ion-exchange resin (HS03 type), cation-exchange resin
(Ca type) or the like as a separating material, and by a subsequent
condensation to be optionally performed; and finally,
trehaloseoligosaccha-rides are yielded within a high purity.
II. Novel Amylase
Microorganisms Producing Novel Amylase of the Present Invention
[0179] Examples of the archaebacteria to be used in the present
invention may include the Sulfolobus solfataricus strain KM1 (the
above-described novel bacterial strain which was substantially
purely isolated from nature by Inventors), the Sulfolobus
solfataricus strain DSM 5833, and the Sulfolobus acidocaldarius
strain ATCC 33909 (DSM 639).
[0180] As described above, a fairly wide variety of archaebacteria
taxonomically classified under the order Sulfolobales may be
considered as the microorganisms which can produce the novel
amylase of the present invention. Here, the archaebacterium
belonging to the order Sulfolobales are taxonomically defined as
being highly acidophilic (capable of growing in a temperature range
of 55-88.degree. C.), being thermophilic (capable of growing in a
pH range of 1-6), being aerobic, and being sulfur bacteria (being
coccal bacteria having no regular form and a diameter of 0.6-2
.mu.m). The aforementioned Sulfolobus solfataricus strain DSM 5833
had formerly been named as Caldariella acidophila. From the fact
like this, microorganisms which are closely related to the
above-described archaebacteria genetically or taxonomically and
which are capable of producing the enzyme of the same kind, and
mutants derived from these strains by treatment with various
mutagens can be used in the present invention.
[0181] Among the above-illustrated microorganisms, the Sulfolobus
solfataricus strain KM1 is the bacterial strain which Inventors
isolated from a hot spring in Gunma Prefecture, and the
characteristics and deposition of this strain are as described
above in detail.
Cultivation of the Microorganisms which Produce the Novel Amylase
of the Present Invention
[0182] The culture conditions for producing the novel amylase of
the present invention may suitably be selected within ranges in
which the objective amylase can be produced. When a concussion
culturing or a culturing with aeration and stirring using a liquid
medium is employed, the culturing for 2-7 days should suitably be
performed at a pH and a temperature which allow the growth of each
microorganism. The culture medium to be suitably used is, for
example, any of the culture media which are described in Catalogue
of Bacteria and Pharges 18th edition (1992) published by American
Type Culture Collection (ATCC), and in Catalogue of Strains 5th
edition (1993) published by Deutsche Sammlung von Mikroorganismen
und Zellkulturen GmbH (DSM). Starch, maltooligosaccharide and/or
the like may be further added as a sugar source.
Purification of the Novel Amylase of the Present Invention
[0183] The novel amylase of the present invention which is produced
by the above-described microorganisms can be extracted as follows:
At first, the bacterial bodies are collected from the culture
obtained in a. culture process as described above by a
publicly-known procedure, for example, by centrifugation; the
resultant is suspended in a proper buffer solution; the bacterial
bodies are then crushed by freeze thawing, an ultrasonic treatment,
grinding and/or the like; and the resultant is centrifuged or
filtrated to obtain a cell extract containing the objective
amylase.
[0184] To purify the novel amylase of the present invention which
is contained in the cell extract, publicly-known processes for
isolation and purification can be employed in a proper combination.
Examples of such processes may include a process utilizing
solubility, such as salt precipitation and solvent precipitation; a
process utilizing a difference in molecular weight, such as
dialysis, ultrafiltration, gel filtration and SDS-Polyacryl-amide
gel electrophoresis; a process utilizing a difference in electric
charge, such as ion exchange chromatography; a process utilizing
specific affinity, such as affinity chromatography; a process
utilizing a difference in hydrophobicity, such as hydrophobic
chromatography and reversed phase chromatography; and further, a
process utilizing a difference in isoelectric point, such as
isoelectric focusing. The practical examples of these processes are
shown in Examples II-2-II-4 below. Finally, Native Polyacrylamide
gel electrophoresis, SDS-Polyacrylamide gel electrophoresis or
isoelectric focusing is performed to obtain a purified enzyme which
appears therein as a single band.
[0185] As to measurement of activity in the enzyme or
enzyme-containing substance isolated by the above various
purification processes, starch is used as the substrate in the
activity-measuring method offered by Lama, et al. By this method,
when various amylases coexist in the reaction system, the
production of starch hydrolysate can be detected. In contrast, when
each of the individually isolated products of these amylases is
used, both of the detecting sensitivity and quantifying ability
become low, and as a serious problem, the starch-hydrolyzing
activity becomes undetectable due to its disappearance during
purification. Therefore, the purification and characterization of
the true substance of the enzyme activity had been substantially
impossible. Under such circumstances, Inventors employed a new
activity-measuring method in which the substrate is a
trehaloseoligosaccharide such as maltotriosyltrehalose, and the
index is activity of hydrolyzing it into .alpha., .alpha.-trehalose
and maltooligosaccharides such as maltotriose. As a result, this
method was found to have an extremely high specificity, detecting
sensitivity and quantifying ability, and isolation and purification
of the objective enzyme could be achieved for the first time, and
finally, the true substance of the novel amylase activity of the
present invention could be practically purified and specified.
Characteristics of the Novel Amylase According to the Present
Invention
[0186] As examples of the enzyme of the present invention, the
amylases produced. by the Sulfolobus solfataricus strain KM1, the
Sulfolobus solfataricus strain DSM 5833, and the Sulfolobus
acidocaldarius strain ATCC 33909 (DSM 639), respectively, are taken
up, and the enzymatic characteristics of these amylases are shown
in Table 2 below in summary. Here, the data in the table are based
on the practical examples shown in Example II-5. TABLE-US-00002
TABLE 2 Sulfolobus Sulfolobus Sulfolobus Physicochemical
solfataricus solfataricus acidocaldarius properties KM1 DSM5833
ATCC33909 (1) Enzyme action Acts on glucose polymers composed of
more and Substrate than maltotriose, so as to hydrolyze by
endo-type specificity and liberates principally monosaccharide or
disaccharide from the reducing end. Especially liberates
.alpha.,.alpha.-trehalose from trehaloseoligo- saccharide wherein
the linkage between two glucoses from the reducing end side is
.alpha.-1,.alpha.-1 while the other linkages are .alpha.-1,4. (2)
Optimum pH 4.5-5.5 4.5-5.5 5.0-5.5 (3) pH Stability 3.5-10.0
3.0-12.0 4.0-13.0 (4) Optimum 70-85.degree. C. 70-85.degree. C.
60-80.degree. C. temperature (5) Thermal stability 85.degree. C., 6
hr 85.degree. C., 6 hr 80.degree. C., 6 hr 100% remained 100
remained 100% remained (6) Molecular weight 61000 62000 64000
SDS-PAGE (7) Isoelectric point 4.8 4.3 5.4 (8) Inhibitor 5 mM
CuSO.sub.4 5 mM CuSO.sub.4 5 mM CuSO.sub.4 100% inhibited 100%
inhibited 100% inhibited
Note 1: Time-course Change
[0187] When soluble starch was used as the substrate, the
iodine-starch complex quickly disappeared in the early stage of the
enzymatic reaction, and subsequently, the hydrolyzing reaction
progressed so as to produce maltose and glucose as principal
products, and maltotriose and maltotetraose in slight amounts.
Note 2: Enzymatic Action/Mode of Enzymatic Reaction
[0188] The present enzyme principally produces glucose and maltose,
and produces small amounts of maltotriose and maltotetraose, when
starch, starch hydrolysate and/or maltooligosaccharide are used as
the substrate. As to the action mechanisms, the present enzyme has
an amylase activity of endotype-hydrolyzing these substrates, and
an activity of producing principally monosaccharide and/or
disaccharide from the reducing end side.
[0189] In particular, the enzyme has a high reactivity to a
saccharide composed of at least three sugar units wherein the
linkage between the first and the second glucose residues from the
reducing end side is .alpha.-1, .alpha.-1 while the linkage between
the second and third glucose residues from the reducing end side is
.alpha.-1,4 (for example, trehaloseoligosaccharide). When these
saccharides are used as the substrate, the enzyme has an activity
of hydrolyzing the .alpha.-1,4 linkage between the second and third
glucose residues from the reducing end side, and specifically
liberates .alpha., .alpha.-trehalose in the early stage of the
reaction.
[0190] Consequently, the present enzyme can be recognized as a
novel amylase. The details are as practically described in Example
II-5.
[0191] The characteristics of the present enzyme have been
described above. However, as is obvious from Table 2 and the
examples below, the characteristics of the present enzyme other
than such enzymatic activities are found to slightly vary according
to the difference in genus or species between the bacterial
strains.
Transferase to be Used in Production of .alpha.,
.alpha.-Trehalose
[0192] The transferase of the present invention which is described
in detail in the above-described item "I. Novel Transferase" can be
used for production of .alpha., .alpha.-trehalose according to the
present invention. Specifically, examples of such a transferase may
include transferases derived from the Sulfolobus solfataricus
strain ATCC 35091 (DSM 1616), the Sulfolobus solfataricus strain
DSM 5833, the Sulfolobus solfataricus strain KM1, the Sulfolobus
acidocaldarius strain ATCC 33909 (DSM 639), and the Acidianus
brierleyi strain DSM 1651.
[0193] These transferases can be produced according to, for
example, the processes described in Examples I-2-1-5 below. The
transferases thus obtained have various characteristics shown in
Example I-6 below.
Production of .alpha., .alpha.-Trehalose
[0194] The present invention provides a process for producing
.alpha., .alpha.-trehalose by using the novel amylase and
transferase of the present invention. The process according to the
present invention will be illustrated below with the most typical
example, namely, with a process for producing .alpha.,
.alpha.-trehalose from a glucide raw material such as starch,
starch hydrolysate and/or maltooligosaccharide. Incidentally, the
probable reaction-mechanisms of the above two enzymes are
considered as follows: At first, the novel amylase of the present
invention acts on starch, starch hydrolysate or
maltooligosaccharide by its endotype-hydrolyzing activity to
produce amylose or maltooligosaccharide; subsequently, the first
.alpha.-1,4 linkage from the reducing end of the resultant amylose
or maltooligosaccharide is transferred into an .alpha.-1, .alpha.-1
linkage by the activity of the transferase; further, the novel
amylase acts again to produce .alpha., .alpha.-trehalose, and
amylose or maltooligosaccharide which is deprived of the
polymerization degree by two; and the amylase or
maltooligosaccharide thus derived undergoes the above reactions
repeatedly, so that .alpha., .alpha.-trehalose would be produced in
a high yield.
[0195] Such reaction mechanisms may be attributed to the specific
reaction-mode as follows, which is possessed by the novel amylase
of the present invention: The enzyme has a higher reactivity to a
saccharide composed of at least three sugar units wherein the
linkage between the first and the second glucose residues from the
reducing end side is .alpha.-1, .alpha.-1 while the linkage between
the second and third glucose residues from the reducing end side is
an .alpha.-1,4 (for example, trehaloseoligosac-charide), as
compared with the reactivity to each of the corresponding
maltooligosaccharide; and the enzyme specifically hydrolyzes the
.alpha.-1,4 linkage between the second and third glucose residues
from the reducing end side of the above saccharide, and liberates
.alpha., .alpha.-trehalose.
[0196] As far as Inventors know, there is no formerly-known amylase
which can act on maltooligosyltrehalose derived from
maltooligosaccharide by modifying the reducing end with an
.alpha.-1, .alpha.-1 linkage, and-which has an activity of
specifically hydrolyzing the .alpha.-1,4 linkage next to the
.alpha.-1, .alpha.-1 linkage to liberate .alpha., .alpha.-trehalose
in a high yield. Accordingly, it has been almost impossible to
produce .alpha., .alpha.-trehalose in a high yield.
[0197] In the process for producing .alpha., .alpha.-trehalose
according to the present invention, the mode of contact between the
present amylase and transferase, and starch, starch hydrolysate
and/or maltooligosaccharides is not specifically limited as long as
the amylase of the present invention (the present enzyme) produced
by archaebacteria can act on the starch, starch hydrolysate and/or
maltooligosaccharides in such mode. In practice, the following
procedure may ordinarily be performed: A crude enzyme is obtained
from the bacterial bodies or crushed bacterial bodies of an
archaebacterium; and the purified enzyme obtained in each of the
various purification steps, or the enzyme isolated and purified
through various purification means, is made to act directly on
glucide such as starch, starch hydrolysate and
maltooligosaccharide. Alternatively, the enzyme thus obtained may
be put into contact with glucide such as starch, starch hydrolysate
and maltooligosaccharide in a form of a immobilized enzyme which is
immobilized to a carrier. Additionally, two or more of the present
enzymes derived from two or more species of archaebacteria may
coexist and be put into contact with glucide such as starch, starch
hydrolysate and maltooligosaccharide.
[0198] In the process for producing .alpha., .alpha.-trehalose
according to the present invention, the above-described amylase and
transferase should be used in amounts within the optimum ranges. An
excess amount of amylase will act on the starch, starch hydrolysate
or maltooligosaccharide on which the transferase have not acted to
modify its reducing end, while an excess amount of transferase
will, in the side reaction, hydrolyze the trehaloseoligo-saccharide
such as maltooligosyltrehalose which has been produced by the
transferase itself, and produce glucose.
[0199] The practical concentrations of the amylase and transferase
relative to the amount of substrate are 1.5 U/ml or higher, and 0.1
U/ml or higher, respectively. Preferably, the concentrations should
be 1.5 U/ml or higher, and 1.0 U/ml or higher, respectively, and
more preferably, 15 U/ml or higher, and 1.0 U/ml or higher,
respectively. Meanwhile, the ratio of amylase concentration to
transferase concentration should be 100-0.075, and preferably,
40-3.
[0200] The concentration of glucide such as starch, starch
hydrolysate and maltooligosaccharide should be suitably selected
within the range in which the glucide to be used is dissolved,
considering the specific activity of each enzyme to be used, the
reaction temperature, and others. A range of 0.5-70% is ordinary,
and a range of 5-40% is preferable. The reaction temperature and pH
condition in the reaction of the glucide with the enzymes should be
optimum for the amylase and the transferase. Accordingly, the
reaction is performed ordinarily at 50-85.degree. C. and pH 3.5-8,
approximately, and more preferably, at 60-75.degree. C. and pH
4.5-6.0.
[0201] Additionally, when the glucide raw material to be used is
starch, starch hydrolysate or the like having a high polymerization
degree, the production of .alpha., .alpha.-trehalose can be further
promoted by using another endotype liquefying amylase together as a
supplement. Such a debranching enzyme as pullulanase and isoamylase
can also be used herein. The endotype amylase, pullulanase,
isoamylase or the like may not be such an enzyme as derived from
archaebacteria, and therefore, it is not specifically limited. For
example, amylase derived from bacteria belonging to the genus
Bacillus, fungi belonging to the genus Aspergillus and plants such
as malt, and others can be used. The debranching enzyme may be
pullulanase (including thermostable pullulanase) derived from
bacteria belonging to the genus Bacillus, Klebsiella or the like,
or isoamylase derived from bacteria belonging to the genus
Pseudomonas. Further, these enzymes may be used in combination.
[0202] However, the addition of an excess amount of amylase will
possibly cause production of glucose and maltose which the
transferase will not act on. Similarly, the addition of an excess
amount of a debranching enzyme will cause a decrease in solubility
of the substrate due to cleavage of the 1,6-linkage, and lead to
production of a highly-viscous and insoluble substance (amylose).
For that reason, the amounts of amylase and the debranching enzyme
should carefully be controlled so as not to produce excessive
glucose, maltose, or an insoluble substance. As to debranching
enzymes, the concentration should be properly selected within a
range in which an insoluble substance is not produced, considering
the specific activity of the present amylase, the reaction
temperature, and the like. Specifically, when the treatment is
performed at 40.degree. C. for one hour, the ordinary concentration
relative to the substrate is within a range of 0.01-100 U/ml, and
preferably, within a range of 0.1-25 U/ml. (As to definition of the
activity of debranching enzymes, please refer to Examples II-6,
II-13 and II-14.) The procedure for treatment with a debranching
enzyme may be either of the following: The substrate is pre-treated
with the debranching enzyme before the .alpha.,
.alpha.-trehalose-producing reaction; or the debranching enzyme is
allowed to coexist with the amylase and transferase at any one of
the stages during the .alpha., .alpha.-trehalose-producing
reaction. Preferably, debranching enzymes should be used one or
more times at any of the stages, and particularly, should be used
one or more times at any of earlier stages. Incidentally, when a
thermostable debranching enzyme is used, similar effects can be
exhibited by only one time of addition at any one of the stages or
earlier stages during the .alpha., .alpha.-trehalose-producing
reaction.
[0203] The produced reaction mixture which contains .alpha.,
.alpha.-trehalose can be purified according to a publicly-known
process. For example, the obtained reaction mixture is desalted
with an ion-exchange resin; the objective saccharide fraction
is-then isolated and crystallized by chromatography using activated
charcoal, an ion-exchange resin (HSO3 type), cation-exchange resin
(Ca type) or the like as a separating material, and by a subsequent
condensation to be optionally performed; and finally, .alpha.,
.alpha.-trehalose is yielded within a high purity.
A Gene Coding for the Novel Amylase
[0204] The present invention further provides a gene coding for the
above novel amylase.
[0205] The practical examples of the gene coding for the novel
amylase according to the present invention may include the DNA
fragments illustrated with restriction maps shown in FIGS. 34 and
38.
[0206] These DNA fragments can be derived from archaebacteria
belonging to the order Sulfolobales, and preferably, can be
isolated from the Sulfolobus solfataricus strain KM1 or the
Sulfolobus acidocaldarius strain ATCC 33909 described below. The
suitable process for isolation from the Sulfolobus solfataricus
strain KM1 or the Sulfolobus acidocaldarius strain ATCC 33909 is
illustrated in detail in the examples below. 101891 Examples of the
origin from which such a DNA fragments can be obtained may also
include the Sulfolobus solfataricus strains DSM 5354, DSM 5833,
ATCC 35091 and ATCC 35092; the Sulfolobus acidocaldarius strain
ATCC 49426; the Sulfolobus shibatae strain DSM 5389; and the
Acidianus brierleyi strain DSM 1651. It is obvious from the
following facts that these archaebacteria can be the origins of the
DNA fragments according to the present invention: The novel amylase
gene derived from the Sulfolobus solfataricus strain KM1 or the
Sulfolobus acidocaldarius strain ATCC 33909 forms a hybrid with the
chromosome DNA derived from each of those archaebacteria in the
below-described hybridization test performed in Example II-24; and
further, the characteristics of the enzymes themselves very closely
resemble each other as described above. Moreover, the results in
the same example suggestively indicate that the novel amylase gene
according to the present invention is highly conserved,
specifically in archaebacteria belonging to the order
Sulfolobales.
[0207] The preferable mode for carrying out the present invention
provides a DNA fragment comprising a DNA sequence coding for the
amino acid sequence shown in Sequence No. 6 or 8 as a suitable
example of the gene coding for the novel amylase of the present
invention. Further, the base sequence from 642nd base to 2315th
base among the base sequence shown in Sequence No. 5 can be listed
as a suitable example of the DNA sequence coding for the amino acid
sequence shown in Sequence No. 6. The sequence from 1176th base to
2843rd base among the base sequence shown in Sequence No. 7 can be
listed as a suitable example of the DNA sequence coding for the
amino acid sequence shown in Sequence No. 8.
[0208] In general, when given the amino acid sequence of a protein,
the base sequence coding therefor can be easily determined by
referring to what is called the Codon Table. Therefore, several
base sequences which code for the amino acid sequence shown in
Sequence No. 6 or 8 can be suitably selected. Accordingly, in the
present invention, "the DNA sequence coding for the amino acid
shown in Sequence No. 6" implies the DNA sequence comprising the
sequence from 642nd base to 2315th base of the base sequence shown
in Sequence No. 5; and also, the DNA sequences which comprise the
same base sequence as above except that one or more codons are
replaced with the codons having a relationship of degeneracy
therewith, and which still code for the amino acid shown in
Sequence No. 6. Similarly, "the DNA sequence coding for the amino
acid shown in Sequence No. 8" implies the DNA sequence comprising
the sequence from 1176th base to 2843rd base of the base sequence
shown in Sequence No. 7; and also, the DNA sequences which comprise
the same base sequence as above except that one or more codons are
replaced with the codons having a relationship of degeneracy
therewith, and which still code for the amino acid shown in
Sequence No. 8.
[0209] Further, as described below, the scope of the novel amylase
according to the present invention also includes the sequences
equivalent to the amino acid sequence shown in Sequence No. 6 or 8.
The scope of the DNA fragment according to the present invention,
therefore, further includes the base sequences which code for such
equivalent sequences.
[0210] Moreover, the scope of the novel amylase according to the
present invention includes a sequence comprising the amino acid
sequence shown in Sequence No. 6 and a Met residue added to the N
terminus of this amino acid sequence. Accordingly, the scope of the
DNA fragment containing the gene coding for the novel amylase of
the present invention also includes the sequence from 639th base to
2315th base of the base sequence shown in Sequence No. 5.
[0211] Incidentally, Inventors surveyed the existence of a base
sequence homologous to the base sequence shown in Sequence No. 5 or
7 through a data bank on base sequences (EMBL) by using
sequence-analyzing software, GENETYX (by Software Development Co.).
As a result, Inventors have confirmed that such a base sequence
does not exist.
[0212] Since the base sequence of the DNA fragment comprising the
sequence from 639th or 642nd base to 2315th base of the base
sequence shown in Sequence No. 5, and the base sequence of the DNA
fragment comprising the sequence from 1176th base to 2843rd base
of-the base sequence shown in Sequence No. 7 have been determined,
a means for obtaining these DNA fragments is producing them based
on a process for polynucleotide synthesis.
[0213] Further, these sequences can be obtained by using a process
of gene engineering from the above-described archaebacteria
belonging to the order Sulfolobales, and preferably, from the
Sulfolobus solfataricus strain KM1 or the Sulfolobus acidocaldarius
strain ATCC 33909. For example, they can be suitably obtained by a
process described in Molecular Cloning: A Laboratory Manual
[Sambrook, Mainiatis, et al., published by Cold Spring Harbour
Laboratory Press (1989)], and others. The practical method is
illustrated in detail in the below-described examples.
Recombinant Novel Amylase
[0214] Since the gene coding for the novel amylase is provided as
described above, the expressed product from this gene, a
recombinant novel amylase, can be obtained according to the present
invention.
[0215] Suitable examples of the recombinant novel amylase according
to the present invention may include an expressed product from the
DNA fragment illustrated with the restriction map shown in FIG. 34
or 38.
[0216] Also, the suitable examples may include a polypeptide
comprising the amino acid sequence shown in Sequence No. 6 or 8 of
the Sequence Table, or the equivalent sequence thereof. Here, the
term "equivalent sequence" stands for the amino acid sequence which
basically has the amino acid sequence shown in Sequence No. 6 or 8;
but has undergone insertion, replacement or deletion of some amino
acids, or addition of some amino acids to each terminus; and still
keeps the activity of the above novel amylase. The state in which
the equivalent sequence keeps the activity of the novel amylase
means that it keeps an activity sufficient for similar use in
similar conditions as compared to the polypeptide having the
complete sequence shown in Sequence No. 6 or 8, when the activity
is applied in a practical mode for use. Obviously, persons skilled
in the art can select and produce such an "equivalent sequence" by
referring to the sequences shown in Sequence Nos. 6 and 8 without
any special difficulty, since it is revealed in Example II-23 that
the same activity is kept in the enzymes derived from the
Sulfolobus solfataricus strain KM1 and the Sulfolobus
acidocaldarius strain ATCC 33909 though the homology between the
amino acid sequences of the novel amylases from these 2 strains is
59% when calculated considering gaps.
[0217] Further, the amino acid sequence which comprises the amino
acid sequence shown in Sequence No. 6 and a Met residue added to
the N terminus of this amino acid sequence is provided according to
another mode for carrying out the present invention. The novel
amylase of the natural type according to the present invention has
the sequence shown in Sequence No. 6. However, as described below,
when the novel amylase is obtained from the genetic information of
the isolated gene by a recombinant technology using said sequence,
the obtained sequence will be found to further have a Met residue
in addition to the amino acid sequence shown in Sequence No. 6.
Additionally, it is obvious that the obtained sequence has an
activity of the novel amylase. Accordingly, the amino acid sequence
to which a Met residue is added is also included within the scope
of the present invention.
[0218] As clarified in Example II-24 below, the DNA fragment having
the sequence from 1393th base to 2116th base of the sequence shown
in Sequence No. 7 can hybridize with each of the DNA fragments
derived from some bacterial strains other than the Sulfolobus
acidocaldarius strain ATCC 33909 and the Sulfolobus solfataricus
strain KM1 which are the origins of said DNA fragment. Meanwhile,
as described above, Inventors have now confirmed the existence of a
novel amylase having very close characteristics in those bacterial
strains. Further, as revealed in Example II-23 below, the homology
between the amino acid sequences of the novel amylases derived from
the Sulfolobus solfataricus strain KM1 and the Sulfolobus
acidocaldarius strain ATCC 33909 is 59% when calculated considering
gaps. It is, therefore, obvious to persons skilled in the art that
the activity of the novel amylase can be kept in a sequence which
is homologous, to some extent, with the amino acid sequence shown
in Sequence No. 6 or 8.
[0219] Incidentally, Inventors surveyed the existence of a sequence
homologous to the amino acid sequence shown in Sequence No. 6 or 8
through a data bank on amino acid sequences (Swiss prot and
NBRF-PFB) by using sequence-analyzing software, GENETYX (by
Software Development Co.). As a result, Inventors have confirmed
that such a sequence does not exist.
Expression of a Gene Coding for the Novel Amylase
[0220] The recombinant novel amylase according to the present
invention can be produced in a host cell by transforming the host
cell with a DNA molecule, and especially with an expression vector,
which can replicate in the host cell, and contains the DNA fragment
coding for the novel amylase according to the present invention so
as to express the amylase gene.
[0221] The present invention, therefore, further provides a DNA
molecule, and particularly, an expression vector, which contains a
gene coding for the novel amylase according to the present
invention. Such a DNA molecule can be obtained by integrating the
DNA fragment coding for the novel amylase of the present invention
into a vector molecule. According to the preferable mode for
carrying out the present invention, the vector is a plasmid.
[0222] The DNA molecule according to the present invention can be
prepared on the basis of the process described in the
aforementioned Molecular Cloning: A Laboratory Manual.
[0223] The vector to be used in the present invention can suitably
be selected from viruses, plasmids, cosmid vectors, and others
considering the type of the host cell to be used. For example, a
bacteriophage of .lamda. phage type, a plasmid of pBR or pUC type
can be used when the host cell is Escherichia coli; a plasmid of
pUB type can be used when the host cell is Bacillus subtilis; and a
vector of YEp or YCp type can be used when the host cell is
yeast.
[0224] The plasmid should preferably contain a selective marker for
detection of the transformant, and a drug-resistance marker and an
auxotrophy marker can be used as such a selective marker.
[0225] Further, the DNA molecule as an expression vector according
to the present invention should preferably contain DNA sequences
necessary for expression of the novel amylase gene, for example, a
transcription-controlling signal, a translation-controlling signal
and/or the like such as a promoter, a transcription-initiating
signal, a ribosome-binding site, a translation-stopping signal, and
a transcription-finishing signal.
[0226] Examples of the promoter to be suitably used may include, as
well as a promoter functional in the host which contains the
insertional fragment, a promoter such as a lactose operon (lac) and
a tryptophan operon (trp) for Escherichia coli, a promoter such as
an alcohol dehydrogenase gene (ADH), an acid phosphatase gene
(PHO), a galactose gene (GAL), and a glyceraldehyde 3-phosphate
dehydrogenase gene (GPD) for yeast.
[0227] Here, the base sequence comprising the sequence from 1st
base to 2691th base of the base sequence shown in Sequence No. 5,
and the base sequence comprising the sequence from 1st base to
3600th base of the base sequence shown in Sequence No. 7 are
expressed in Escherichia coli to efficiently produce the novel
amylase. Accordingly, the DNA sequences shown in Sequence Nos. 5
and 7 are recognized as containing at least sequences necessary for
expression in Escherichia coli. It is, therefore, also suitable to
use these sequences as they are.
[0228] Moreover, when the host cell is Bacillus subtilis or yeast,
it will be advantageous to use a secretory vector so as to excrete
the recombinant novel amylase outside of the host's body.
[0229] In addition to Escherichia coli, Bacillus subtilis, yeast,
and advanced eukaryotes, can be used as a host cell. Microorganisms
belonging to the genus Bacillus such as Bacillus subtilis are
suitably used. Some strains belonging to this genus are known to
excrete a protein outside of the bacterial body in a large amount.
Therefore, a large amount of the recombinant novel amylase can be
excreted in the culture medium by using a secretory vector. This is
preferable because the purification from the supernatant of the
culture will be easy. Further, some strains belonging to the genus
Bacillus are known to excrete a very little amount of protease
outside of the bacterial body. It is preferable to use such strains
because the recombinant novel amylase can be efficiently produced
thereby. Moreover, it will be very advantageous to select a
microorganism which does not produce glucoamylase and to use it as
a host cell, because the recombinant novel amylase of the present
invention which is obtained as a cell extract or a simply-purified
crude enzyme can be directly used for the below-described
production of .alpha., .alpha.-trehalose.
[0230] The recombinant novel amylase produced by the aforementioned
transformant can be obtained as follows: At first, the
above-described host cell is cultivated under proper conditions;
the bacterial bodies are collected from the resultant culture by a
publicly-known method, for example, by centrifugation, and
suspended in a proper buffer solution; the bacterial bodies are
then crushed by freeze thawing, an ultrasonic treatment, grinding
and/or the like; and the resultant is centrifuged or filtrated to
obtain a cell extract containing the recombinant novel amylase.
[0231] Purification of the recombinant novel amylase existing in
the cell extract can be performed by a proper combination of
publicly-known processes for isolation and purification. Examples
of the processes may include a process utilizing a difference in
thermostability, such as a heat treatment; a process utilizing a
difference in solubility, such as salt precipitation and solvent
precipitation, a process utilizing a difference in molecular
weight, such as dialysis, ultrafiltration, gel filtration and
SDS-Polyacrylamide gel electrophoresis; a process utilizing a
difference in electric charge, such as ion exchange chromatography;
a process utilizing specific affinity, such as affinity
chromatography; a process utilizing a difference in hydrophobicity,
such as hydrophobic chromatography and reversed phase
chromatography; and further, a process utilizing a difference in
isoelectric point, such as isoelectric focusing. Since the
recombinant novel amylase is thermostable, the purification can be
very easily performed using heat treatment, by which proteins in
the host can be denatured and made into precipitation suitable for
removal.
Production of .alpha., .alpha.-Trehalose Using the Recombinants
[0232] The present invention further provides a process for
producing .alpha., .alpha.-trehalose by using the above recombinant
novel amylase and the aforementioned recombinant novel
transferase.
[0233] According to the preferable mode for producing .alpha.,
.alpha.-trehalose, the recombinant novel amylase and the
recombinant transferase of the present invention may be mixed and
put into contact at the same time with glucide such as starch,
starch hydrolysate and maltooligosaccharide. Also, it is preferable
to substitute either of the recombinant transferase and the
recombinant novel amylase with a corresponding enzyme derived from
nature.
[0234] The concentration of glucide such as starch, starch
hydrolysate and maltooligosaccharide should be suitably selected
within the range in which the glucide to be used is dissolved,
considering the specific activities of the present enzymes, the
reaction temperature and others. A range of 0.5-70% is ordinary,
and a range of 5-40% is preferable. The reaction temperature and pH
condition in the reaction of the glucide with the enzymes should be
optimum for the recombinant novel amylase and the recombinant novel
transferase. Accordingly, the reaction is performed ordinarily at
50-85.degree. C. and pH 3.5-8, approximately, and more preferably,
at 60-75.degree. C. and pH 4.5-6.0.
[0235] Additionally, when the glucide to be used is starch, starch
hydrolysate, or the like having a high polymerization degree, the
production of .alpha., .alpha.-trehalose can be further promoted by
using another endotype liquefying amylase together as a supplement.
For example, enzymes derived from bacteria belonging to the genus
Bacillus, fungi belonging to the genus Aspergillus, and plants such
as malt, and others can be used as such an endotype liquefying
amylase. The debranching enzyme to be used may be pullulanase
derived from bacteria belonging to the genus Bacillus, Klebsiella
or the like, isoamylase derived from bacteria belonging to the
genus Pseudomonas, or the like. Further, these enzymes may be used
in combination.
[0236] However, the addition of an excess amount of an endotype
liquefying amylase will cause production of glucose and maltose
which the novel transferase will not act on. Similarly, the
addition of an excess amount of pullulanase will cause a decrease
in solubility of the substrate due to cleavage of the 1,6-linkage,
and lead to production of a highly-viscous and insoluble substance
which can not be utilized. For that reason, the amounts of endotype
liquefying amylase and pullulanase should be controlled so as not
to produce excessive glucose, maltose, or an insoluble
substance.
[0237] Any of the procedures may be employed when pullulanase is
used, for example, pre-treating the substrate with pullulanase, or
putting pullulanase into coexistence together with the recombinant
novel amylase and the recombinant novel transferase at any one of
the stages during the .alpha., .alpha.-trehalose-producing
reaction.
[0238] The produced reaction mixture which contains .alpha.,
.alpha.-trehalose can be purified according to a publicly-known
process. For example, the obtained reaction mixture is desalted
with an ion-exchange resin; the objective saccharide fraction is
then isolated and crystallized by chromatography using activated
charcoal, an ion-exchange resin (HS).sub.3 type), cation-exchange
resin (Ca type) or the like as a separating material, and by a
subsequent condensation to be optionally performed; and finally,
.alpha., .alpha.-trehalose is yielded within a high purity.
[0239] The present invention will be further illustrated in detail
with practical examples below, though, needless to say, the scope
of the present invention is not limited to within those
examples.
EXAMPLE I-1
Glucosyltrehalose-Producing Activities of Archaebacteria
[0240] The bacterial strains listed in Table 3 below were examined
for glucosyltrehalose-producing activity. The examination was
performed as follows: The cultivated bacterial bodies of each
strain was crushed by an ultrasonic treatment and centrifuged; the
substrate, maltotriose, was added to the supernatant so that the
final concentration would be 10%; the mixture was then put into a
reaction at 60.degree. C. for 24 hours; after that, the reaction
was stopped by a heat-treatment at 100.degree. C. for 5 min.; and
the glucosyltrehalose thus produced was subjected to a measurement
according to the HPLC analysis under the below-described
conditions. [0241] Column: TOSOH TSK-gel Amide-80 (4.6.times.250
mm) [0242] Solvent: 75% acetonitrile [0243] Flow rate: 1.0 ml/min.
[0244] Temperature: Room temperature [0245] Detector: Refractive
Index Detector
[0246] The enzyme activities were expressed with such a unit as 1
Unit equals the activity of converting maltotriose into 1 .mu.mol
of glucosyltrehalose per hour. Incidentally, in Table 3, the
activity was expressed in terms of units per one gram of bacterial
cell (Units/g-cell).
[0247] FIG. 1(B) is the HPLC chart obtained herein. As is
recognized from the figure, the principal reaction product appeared
slightly behind the non-reacted substrate in the HPLC chart as one
peak without any anomer. The aliquot of this principal reaction
product through TSK-gel Amide-80 HPLC column was subjected to
.sup.1H-NMR analysis and .sup.13C-NMR analysis, and was confirmed
to be glucosyltrehalose. The chemical formula is as follows.
##STR1##
[0248] Consequently, each of the cell extracts from the bacterial
strains belonging to the order Sulfolobales has a
glucosyltrehalose-producing activity, namely, the transferase
activity as the enzyme of the present invention. TABLE-US-00003
TABLE 3 Enzyme activity Strain (Uints/g-cell) Sulfolobus
solfataricus ATCC 35091 6.8 ATCC 35092 6.0 DSM 5354 13.0 DSM 5833
5.6 KM1 13.5 Sulfolobus acidocaldarius ATCC 33909 13.0 ATCC 49426
2.4 Sulfolobus shibatae DSM 5389 12.0 Acidianus brierleyi DSM 1651
6.7
EXAMPLE I-2
Purification of the Present Transferase Derived from the Sulfolobus
solfataricus Strain KM1
[0249] The Sulfolobus solfataricus strain KM1 was cultivated at
75.degree. C. for 3 days in the culture medium which is identified
as No. 1304 in Catalogue of Bacteria and Phages 18th edition (1992)
published by American Type Culture Collection (ATCC), and which
contained 2 g/liter of soluble starch and 2 g/liter of yeast
extract. The cultivated bacteria was collected by centrifugation
and stored at -80.degree. C. The yield of the bacterial cell was
3.3 g/liter.
[0250] Two hundred grams of the bacterial cells obtained above were
suspended in 400 ml of a 50 mM sodium acetate buffer solution (pH
5.5) containing 5 mM of EDTA, and subjected to an ultrasonic
treatment for bacteriolysis at 0.degree. C. for 15 min. The
resultant was then centrifuged to obtain a supernatant, and
ammonium sulfate was added to the supernatant so as to be 60%
saturation.
[0251] The precipitate botained by centrifugation was dissolved in
a 50 mM sodium acetate buffer solution (pH 5.5) containing 1 M of
ammonium sulfate and 5 mM of EDTA, and applied to a hydrophobic
chromatography using the TOSOH TSK-gel Phenyl-TOYOPEARL 650S column
(volume: 800 ml) equilibrated with the same buffer solution as
above. The column was then washed with the same buffer solution,
and the objective transferase was eluted with 600 ml of ammonium
sulfate solution at a linear concentration gradient from 1 M to 0
M. The fractions exhibiting the activity were concentrated using an
ultrafiltration membrane (critical molecular weight: 13,000), and
subsequently, washed and desalted with a 10 mM sodium
acetate-buffer solution (pH 5.5).
[0252] Next, the resultant was subjected to ion-exchange
chromatography using the TOSOH TSK-gel DEAE-TOYOPEARL 650S column
(volume: 300 ml) equilibrated with the same buffer solution. The
column was then washed with the same buffer solution, and the
objective transferase was eluted with 900 ml of sodium chloride
solution at a linear concentration gradient from 0 M to 0.3 M. The
fractions exhibiting the activity were concentrated using an
ultrafiltration membrane (critical molecular weight: 13,000), and
subsequently, washed and desalted with a 50 mM sodium acetate
buffer solution (pH 5.5) containing 0.15 M of sodium chloride and 5
mM of EDTA.
[0253] Subsequent to that, the desalted and concentrated solution
thus obtained was subjected to gel filtration chromatography using
the Pharmacia HiLoad 16/60 Superdex 200 pg column, and the
objective transferase was eluted with the same buffer solution. The
fractions exhibiting the activity were concentrated using an
ultrafiltration membrane (critical molecular weight: 13,000), and
subsequently, washed and desalted with a 50 mM sodium acetate
buffer solution (pH 5.5).
[0254] Next, ammonium sulfate was dissolved in the desalted and
concentrated solution thus obtained so that the concentration of
ammonium sulfate would be 1 M. The resultant was then subjected to
hydrophobic chromatography using TOSOH TSK-gel Phenyl-5PW HPLC
column equilibrated with the same buffer solution. The column was
then washed with the same buffer solution, and the objective
transferase was eluted with 30 ml of ammonium sulfate solution at a
linear concentration gradient from 1 M to 0 M. The fractions
exhibiting the activity were concentrated using an ultrafiltration
membrane (critical molecular weight: 13,000), and subsequently,
washed and desalted with a 10 mM sodium acetate buffer solution (pH
5.0).
[0255] Further, the resultant was subjected to ion-exchange
chromatography using the TOSOH TSK-gel DEAE 5PW HPLC column
equilibrated with the same buffer solution. The column was then
washed with the same buffer solution, and the objective transferase
was eluted with 30 ml of sodium chloride solution at a linear
concentration gradient from 0 M to 0.3 M. The fractions exhibiting
the activity were concentrated using an ultrafiltration membrane
(critical molecular weight: 13,000).
[0256] Finally, Native Polyacrylamide gel electrophoresis,
SDS-Polyacrylamide gel electrophoresis and isoelectric focusing
were performed to obtain the purified enzyme which appeared as
single band.
[0257] Incidentally, the activity was measured in the same manner
as in Example I-1.
[0258] Total enzyme activity, total protein and specific activity
at each of the purification steps are shown in Table 4 below.
TABLE-US-00004 TABLE 4 Total enzyme Total protein Specific activity
Yield Purity Purified fraction activity (units) (mg) (units/mg) (%)
(fold) Crude extract 653 17000 0.038 100 1 60% saturated
(NH.sub.4).sub.2SO.sub.4 625 15000 0.04 95.7 1.1 precipitation
Phenyl 83 533 0.16 12.7 4.2 DEAE 150 31 4.90 23.0 129
Gel-permeation 111 2 55.7 17.0 1466 Phenyl rechromatography 48 0.17
277 7.4 7289 DEAE rechromatography 30 0.05 598 4.6 15737
EXAMPLE I-3
Purification of the Present Transferase Derived from Sulfolobus
solfataricus Strain DSM 5833
[0259] The Sulfolobus solfataricus strain DSM 5833 was cultivated
at 75.degree. C. for 3 days in the culture medium which is
identified as No. 1304 in Catalogue of Bacteria and Phages 18th
edition (1992) published by American Type Culture Collection
(ATCC), and which contained 2 g/liter of soluble starch and 2
g/liter of yeast extract. The cultivated bacteria was collected by
centrifugation and stored at -80.degree. C. The yield of the
bacterial cell was 1.7 g/liter.
[0260] Fifty six grams of the bacterial cells obtained above were
suspended in 100 ml of a 50 mM sodium acetate buffer solution (pH
5.5) containing 5 mM of EDTA, and subjected to an ultrasonic
treatment for bacteriolysis at 0.degree. C. for 15 min. The
resultant was then centrifuged to obtain a supernatant.
[0261] Next, ammonium sulfate was dissolved in the supernatant so
that the concentration of ammonium sulfate would be 1 M. The
resultant was then subjected to hydrophobic chromatography using
TOSOH TSK-gel Phenyl-TOYOPEARL 650S column (volume: 200 ml)
equilibrated with a 50 mM sodium acetate bufier solution (pH 5.5)
containing 1 M of sodium. sulfate and 5 mM of EDTA. The column was
then washed with the same buffer solution, and the objective
transferase was eluted with 600 ml of ammonium sulfate solution at
a linear concentration gradient from 1 M to 0 M. The fractions
exhibiting the activity were concentrated using an ultrafiltration
membrane (critical molecular weight: 13,000), and subsequently,
washed and desalted with a 10 mM Tris-HCl buffer solution (pH
7.5).
[0262] Subsequent to that, the resultant was subjected to
ion-exchange chromatography using the TOSOH TSK-gel DEAE-TOYOPEARL
650S column (volume: 300 ml) equilibrated with the same buffer
solution. The column was then washed with the same buffer solution,
and the objective transferase was eluted with 900 ml of sodium
chloride solution at a linear concentration gradient from 0 M to
0.3 M. The fractions exhibiting the activity were concentrated
using an ultrafiltration membrane (critical molecular weight:
13,000), and subsequently, washed and desalted with a 50 mM sodium
acetate buffer solution (pH 5.5) containing 5 mM of EDTA.
[0263] Next, ammonium sulfate was dissolved in the desalted and
concentrated solution thus obtained so that the concentration of
ammonium sulfate would be 1 M. The resultant was then subjected to
hydrophobic chromatography using TOSOH TSK-gel Phenyl-TOYOPEARL
650S column (volume: 200 ml) equilibrated with the same buffer
solution. The column was then washed with the same buffer solution,
and the objective transferase was eluted with 600 ml of ammonium
sulfate solution at a linear concentration gradient from 1 M to 0
M. The fractions exhibiting the activity were concentrated using an
ulttafiltration membrane (critical molecular weight: 13,000), and
subsequently, washed and desalted with a 50 mM sodium acetate
buffer solution (pH 5.5) containing 0.15 M of sodium chloride and 5
mM of EDTA.
[0264] Further, the desalted and concentrated solution thus
obtained was subjected to gel filtration chromatography using the
Pharmacia HiLoad 16/60 Superdex 200 pg column, and the objective
transferase was eluted with the same buffer solution. The fractions
exhibiting the activity were concentrated using an ultrafiltration
membrane (critical molecular weight: 13,000), and subsequently,
dialyzed with a 25 mM Bis-Tris-HCl buffer solution (pH 6.7).
[0265] Next, the resultant was subjected to a chromatofocusing
using the Pharmacia Mono P HR/5/20 column equilibrated with the
same buffer solution. Immediately after the sample was injected,
the objective transferase was eluted with 10% polybuffer 74-HCl (pH
5.0; manufactured by Pharmacia Co.). The fractions exhibiting the
activity were concentrated using an ultrafiltration membrane
(critical molecular weight: 13,000), and subsequently, dialyzed
with a 25 mM Bis-Tris-HCl buffer solution (pH 6.7).
[0266] Further, another chromatofocusing was performed under the
same conditions, and the objective transferase was eluted. The
fractions exhibiting the activity were concentrated using an
ultrafiltration membrane (critical molecular weight: 13,000), and
subsequently, washed and desalted with a 50 mM sodium acetate
buffer solution (pH 5.5) containing 5 mM of EDTA.
[0267] Finally, Native polyacrylamide gel electrophoresis,
SDS-polyacrylamide gel electrophoresis and isoelectric focusing
were performed to obtain the purified enzyme which appeared as
single band.
[0268] Incidentally, the activity was measured in the same manner
as in Example I-1.
[0269] Total enzyme activity, total protein and specific activity
at each of the purification steps are shown in Table 5 below.
TABLE-US-00005 TABLE 5 Total Specific enzyme Total activity Pu-
activity protein (units/ Yield rity Purified fraction (units) (mg)
mg) (%) (fold) Crude extract 541 10000 0.06 100 1 Phenyl 1039 988
1.05 192 19 DEAE 383 147 2.60 70.7 47 Pheny rechromatography 248
49.5 5.00 45.8 91 Gel-permeation 196 3.69 53.0 36.1 964 Mono P 92
0.32 287 17.0 5218 Mono P rechromatography 64 0.13 494 11.9
8982
EXAMPLE I-4
Purification of the Present Transferase Derived from the Sulfolobus
acidocaldarius Strain ATCC 33909
[0270] The Sulfolobus acidocaldarius strain ATCC 33909 was
cultivated at 75.degree. C. for 3 days in the culture medium which
is identified as No. 1304 in Catalogue of Bacteria and Phages 18th
edition (1992) published by American Type Culture Collection
(ATCC), and which contained 2 g/liter of soluble starch and 2
g/liter of yeast extract. The cultivated bacteria was collected by
centrifugation and stored at -80.degree. C. The yield of the
bacterial cell was 2.9 g/liter.
[0271] Ninety two and a half grams of the bacterial cells obtained
above were suspended in 200 ml of a 50 mM sodium acetate buffer
solution (pH 5.5) containing 5 mM of EDTA, and subjected to an
ultrasonic treatment for bacteriolysis at 0.degree. C. for 15 min.
The resultant was then centrifuged to obtain a supernatant.
[0272] Next, ammonium sulfate was dissolved in the supernatant so
that the concentration of ammonium sulfate would be 1 M. The
resultant was then subjected to hydrophobic chromatography using
TOSOH TSK-gel Phenyl-TOYOPEARL 650S column (volume: 400 ml)
equilibrated with a 50 mM sodium acetate buffer solution (pH 5.5)
containing 1 M of sodium sulfate and 5 mM EDTA. The column was then
washed with the same buffer solution, and the objective transferase
was eluted with 600 ml of ammonium sulfate solution at a linear
concentration gradient from 1 M to 0 M. The fractions exhibiting
the activity were concentrated using an ultrafiltration membrane
(critical molecular weight: 13,000), and subsequently, washed and
desalted with a 10 mM Tris-HCl buffer solution (pH 7.5).
[0273] Subsequent to that, the resultant was subjected to
ion-exchange chromatography using the TOSOH TSK-gel DEAE-TOYOPEARL
650S column (volume: 300 ml) equilibrated with the same buffer
solution. The column was then washed with the same buffer solution,
and the objective transferase was eluted with 900 ml of sodium
chloride solution at a linear concentration gradient from 0 M to
0.3 M. The fractions exhibiting the activity were concentrated
using an ultrafiltration membrane (critical molecular weight:
13,000), and subsequently, washed and desalted with a 50 mM sodium
acetate buffer solution (pH 5.5) containing 5 mM of EDTA.
[0274] Next, ammonium sulfate was dissolved in the desalted and
concentrated solution thus obtained so that the concentration of
ammonium sulfate would be 1 M. The resultant was then subjected to
hydrophobic chromatography using TOSOH TSK-gel Phenyl-TOYOPEARL
650S column (volume: 200 ml) equilibrated with the same buffer
solution. The column was then washed with the same buffer solution,
and the objective transferase was eluted with 600 ml of ammonium
sulfate solution at a linear concentration gradient from 1 M to 0
M. The fractions exhibiting the activity were concentrated using an
ultrafiltration membrane (critical molecular weight: 13,000), and
subsequently, washed and desalted with a 50 mM. sodium acetate
buffer solution (pH 5.5) containing 0.15 M of sodium chloride and 5
mM EDTA.
[0275] Further, the desalted and concentrated solution thus
obtained was subjected to gel filtration chromatography using the
Pharmacia HiLoad 16/60 Superdex 200 pg column, and the objective
transferase was eluted with the same buffer solution. The fractions
exhibiting the activity were concentrated using an ultrafiltration
membrane (critical molecular weight: 13,000), and subsequently,
dialyzed with a 25 mM Bis-Tris-HCl buffer solution (pH 6.7).
[0276] Next, the resultant was subjected to a chromatofocusing
using the Pharmacia Mono P HR/5/20 column equilibrated with the
same buffer solution. Immediately after the sample was injected,
the objective transferase was eluted with 10% polybuffer 74-HCl (pH
5.0; manufactured by Pharmacia Co.). The fractions exhibiting the
activity were concentrated using an ultrafiltration membrane
(critical molecular weight: 13,000), and subsequently, dialyzed
with a 25 mM Bis-Tris-HCl buffer solution (pH 6.7).
[0277] Further, another chromatofocusing was performed under the
same conditions, and the objective transferase was eluted. The
fractions exhibiting the activity were concentrated using an
ultrafiltration membrane (critical molecular weight: 13,000), and
subsequently, washed and desalted with a 50 mM sodium acetate
buffer solution (pH 5.5) containing 5 mM of EDTA.
[0278] Finally, Native polyacrylamide gel electrophoresis,
SDS-polyacrylamide gel electrophoresis and isoelectric focusing
were performed to obtain the purified enzyme which appeared as
single band.
[0279] Incidentally, the activity was measured in the same manner
as in Example I-1.
[0280] Total enzyme activity, total protein and specific activity
at each of the purification steps are shown in Table 6 below.
TABLE-US-00006 TABLE 6 Total Specific enzyme Total activity Pu-
activity protein (units/ Yield rity Purified fraction (units) (mg)
mg) (%) (fold) Crude extract 912 38000 0.24 100 1 Phenyl 559 660
0.85 61.3 3.5 DEAE 806 150 5.40 88.4 23 Phenyl rechromatography 636
35.1 18.1 69.7 75 Gel-permeation 280 2.68 104 30.7 433 Mono P 129
0.35 411 13.8 1713 Mono P 86.9 0.24 362 9.5 1508
rechromatography
EXAMPLE I-5
Purification of the Present Transferase Derived from the Acidianus
brierleyi Strain DSM 1651
[0281] The Acidianus brierleyi strain DSM 1651 was cultivated at
70.degree. C. for 3 days in the culture medium which is identified
as No. 150 in Catalogue of Strains 5th edition (1993) published by
Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH (DSM).
The cultivated bacteria was collected by centrifugation and stored
at -80.degree. C. The yield of the bacterial cell was 0.6
g/liter.
[0282] Twelve grams of the bacterial cells obtained above were
suspended in 120 ml of a 50 mM sodium acetate buffer solution (pH
5.5) containing 5 mM of EDTA, and subjected to an ultrasonic
treatment for bacteriolysis at 0.degree. C. for 1.5 min. The
resultant was then centrifuged to obtain a supernatant.
[0283] Next, ammonium sulfate was dissolved in the supernatant so
that the concentration of ammonium sulfate would be 1 M. The
resultant was then subjected to hydrophobic chromatography using
TOSOH TSK-gel Phenyl-TOYOPEARL 650S column (volume: 200 ml)
equilibrated with a 50 mM sodium acetate buffer solution (pH 5.5)
containing 1 M of sodium sulfate and 5 mM of EDTA. The column was
then washed with the same buffer solution, and the objective
transferase was eluted with 600 ml of ammonium sulfate solution at
a linear concentration gradient from 1 M to 0 M. The fractions
exhibiting the activity were concentrated using an ultrafiltration
membrane (critical molecular weight: 13,000), and subsequently,
washed and. desalted with a 10 mM Tris-HCl buffer solution (pH
7.5).
[0284] Subsequent to that, the resultant was subjected to
ion-exchange chromatography using the TOSOH TSK-gel DEAE-TOYOPEARL
650S column (volume: 300 ml) equilibrated with the same buffer
solution. The column was then washed with the same buffer solution,
and the objective transferase was eluted with 900 ml of sodium
chloride solution at a linear concentration gradient from 0 M to
0.3 M. The fractions exhibiting the activity were concentrated
using an ultrafiltration membrane (critical molecular weight:
13,000), and subsequently, washed and desalted with a 50 mM sodium
acetate buffer solution (pH 5.5) containing 5 mM of EDTA.
[0285] Further, the desalted and concentrated solution thus
obtained was subjected to gel filtration chromatography using the
Pharmacia HiLoad 16/60 Superdex 200 pg column, and the objective
transferase was eluted with the same buffer solution. The fractions
exhibiting the activity were concentrated using an ultrafiltration
membrane (critical molecular weight: 13,000), and subsequently,
dialyzed with a 25 mM Bis-Tris-HCl buffer solution (pH 6.7).
[0286] Next, the resultant was subjected to a chromatofocusing
using the Pharmacia Mono P HR/5/20 column equilibrated with the
same buffer solution. Immediately after the sample. was injected,
the objective transferase was eluted with 10% polybuffer 74-HCl (pH
5.0; manufactured by Pharmacia Co.). The fractions exhibiting the
activity were concentrated using an ultrafiltration membrane
(critical molecular weight: 13,000), and subsequently, washed and
desalted with a 50 mM sodium acetate buffer solution (pH 5.5)
containing 5 mM of EDTA.
[0287] Finally, Native Polyacrylamide gel electrophoresis,
SDS-Polyacrylamide gel electrophoresis and isoelectric focusing
were performed to obtain the purified enzyme which appeared as
single band.
[0288] Incidentally, the activity was measured in the same manner
as in Example I-1.
[0289] Total enzyme activity, total protein and specific activity
at each of the purification steps are shown in Table 7 below.
TABLE-US-00007 TABLE 7 Total enzyme Total Specific activity protein
activity Yield Purity Purified fraction (units) (mg) (units/mg) (%)
(fold) Crude extract 310 264 1.17 100 1 Phenyl 176 19.2 9.20 56.9
7.9 DEAE 70 5.02 13.8 22.5 12 Gel-permeation 54 0.18 298 17.3 255
Mono P 27 0.07 378 8.6 323
EXAMPLE I-6
Examination of the Present Transferase for Various
Characteristics
[0290] The purified enzyme obtained in Example I-2 was examined for
enzymatic characteristics.
[0291] (1) Molecular Weight
[0292] The molecular weight of the purified enzyme in its native
state was measured by gel filtration chromatography using the
Pharmacia HiLoad 16/60 Superdex 200 pg column. Marker proteins
having molecular weights of 200,000, 97,400, 68,000, 43,000,
29,000, 18,400 and 14,300, respectively, were used.
[0293] As a result, the molecular weight of the transferase was
estimated at 54,000.
[0294] Meanwhile, the molecular weight was also measured by
SDS-polyacrylamide gel electrophoresis (gel concentration; 6%).
Marker proteins having molecular weights of 200,000, 116,300,
97,400, 66,300, 55,400, 36,500, 31,000, 21,500 and 14,400,
respectively, were used.
[0295] As a result, the molecular weight of the transferase was
estimated at 76,000.
[0296] The difference between molecular weight values measured by
gel filtration chromatography and SDS-Polyacrylamide gel
electrophoresis may be attributed to a certain interaction which
may be generated between the packed material of the gel filtration
column and proteins. Accordingly, the molecular weight value
estimated by gel filtration does not necessarily represent the
molecular weight of the present enzyme in its native state.
[0297] (2) Isoelectric Point
[0298] The isoelectric point was found to be pH 6.1 by agarose gel
isoelectric focusing.
[0299] (3) Stability
[0300] The stability changes of the obtained enzyme according to
temperature and pH value are shown in FIGS. 2 and 3, respectively.
In measurement, a glycine-HCl buffer solution was used in a pH
range of 3-5, and similarly, a sodium acetate buffer solution in a
pH range of 4-6, a sodium phosphate buffer solution in a pH range
of 5-8, a Tris-HCl buffer solution in a pH range of 8-9, a sodium
bicarbonate buffer solution in a pH range of 9-10, and a KCl-NaOH
buffer solution in a pH range of 11-13, respectively, were also
used.
[0301] The present enzyme was stable throughout the treatment at
85.degree. C. for 6 hours, and also, was stable throughout the
treatment at pH 4.0-10.0 and room temperature for 6 hours.
[0302] (4) Reactivity
[0303] As to the obtained enzyme, reactivity of at various
temperatures and reactivity at various pH are shown in FIGS. 4 and
5, respectively. In measurement, a glycine-HCl buffer solution was
used in a pH range of 3-5 (.quadrature.), similarly, a sodium
acetate buffer solution in a pH range of 4-5.5 (.circle-solid.), a
sodium phosphate buffer solution in a pH range of 5-7.5 (.DELTA.),
and a Tris-HCl buffer solution in a pH range of 8-9 (.diamond.),
respectively, were also used.
[0304] The optimum reaction temperature of the present enzyme is
within 60-80.degree. C., approximately, and the optimum reaction pH
of the present enzyme is within 5.0-6.0, approximately.
[0305] (5) Influence of Various Activators and Inhibitors
[0306] The influence of each substance listed in Table 8, such as
an activating effect or inhibitory effect, was evaluated using
similar activity-measuring method to that in Example I-1.
Specifically, the listed substances were individually added
together with the substrate to the same reaction system as that in
the method for measuring glucosyltrehalose-producing activity
employed in Example I-1. As a result, copper ion and SDS were found
to have inhibitory effects. Though many glucide-relating enzymes
have been found to be activated with calcium ion, the present
enzyme would not be activated with calcium ion. TABLE-US-00008
TABLE 8 Concentration Residual activity Activator/Inhibitor (mM)
(%) Control (not added) 100.0 CaCl.sub.2 5 93.6 MgCl.sub.2 5 111.3
MnCl.sub.2 5 74.2 CuSO.sub.4 5 0.0 CoCl.sub.2 5 88.5 FeSO.sub.4 5
108.3 FeCl.sub.3 5 90.0 AgNO.sub.3 5 121.0 EDTA 5 96.8
2-Mercaptoethanol 5 100.3 Dithiothreitol 5 84.5 SDS 5 0.0 Glucose
0.5 107.3 Trehalose 0.5 107.8 Maltotetraose 0.5 97.4 Malatopentaose
0.5 101.9 Maltohexaose 0.5 91.0 Maltoheptaose 0.5 93.5
[0307] (6) Substrate Specificity
[0308] It was investigated whether or not the present enzyme acts
on each of the substrates listed in Table 9 below to produce its
.alpha.-1, .alpha.-1-transferred isomer. Here, the activity
measurement was performed in the same manner as in Example I-1.
TABLE-US-00009 TABLE 9 Substrate Reactivity Glucose - Maltose -
Maltotriose (G3) + Maltotetraose (G4) ++ Malotopentaose (G5) ++
Maltohexaose (G6) ++ Maltoheptaose (G7) ++ Isomaltotriose -
Isomaltotetraose - Isomaltopentaose - Panose -
[0309] As a result, the present enzyme was found to produce
trehaloseoligosaccharides from the substrates of maltotriose
(G3)-maltoheptaose (G7). Meanwhile, the present enzyme did not act
on any of isomaltotriose, isomaltotetraose, isomaltopentaose or
panose, which have .alpha.-1,6 linkages at 1st to 4th linkages from
the reducing end or have the .alpha.-1,6 linkage at 2nd linkage
from the reducing end.
[0310] Incidentally, each of the purified enzymes which were
obtained in Examples I-3-I-5 and derived from the Sulfolobus
solfataricus strain DSM 5833, the Sulfolobus acidocaldarius strain
ATCC 33909, and the Acidianus brierleyi strain DSM 1651,
respectively, was examined for enzymatic characteristics by using
similar manner. The results are shown in Table 1 above.
EXAMPLE I-7
Production of Glucosyltrehalose and Maltooligosyltrehalose from
Maltooligosaccharides
[0311] As the substrates, maltotriose (G3)-maltoheptaose (G7) were
used in a concentration of 100 mM. The purified enzyme obtained in
Example I-2 was then allowed to act on each of the above substrates
in an amount of 13.5 Units/ml (in terms of the enzyme activity when
the substrate is maltotriose) to produce a corresponding .alpha.-1,
.alpha.-1-transferred isomer. Each product was analyzed by the
method in Example I-1, and investigated its yield and enzyme
activity. The results was shown in Table 10 below. Incidentally, in
Table 10, each enzymatic activity value was expressed with such a
unit as 1 Unit equals the activity of converting the
maltooligosaccharide into 1 .mu.mol of corresponding .alpha.-1,
.alpha.-1-transferred isomer per hour. TABLE-US-00010 TABLE 10
Enzyme activity Yield Substrate (units/ml) (%) Maltotriose (G3)
13.5 44.6 Maltotetraose (G4) 76.3 73.1 Maltopentaose (G5) 111.3
68.5 Maltohexaose (G6) 100.9 63.5 Maltoheptaose (G7) 70.5 68.7
[0312] As is shown in Table 10, the enzyme activity was highest
when the substrate was G5, which exhibited approximately 8 times as
much activity as G3. Further, the yield was 44.6% in G3, while
63.5-73.1% in G4 or larger.
[0313] Additionally, the composition of each product which was
obtained from G3, G4 or G5 assigned for a substrate was
investigated. The results are shown in FIGS. 6-8, respectively.
[0314] Specifically, when maltotriose was used as a substrate,
glucosyltrehalose was produced as a product in the principal
reaction, and in addition, equal moles of maltose and glucose were
produced as products in the side reaction.
[0315] When the substrate was a saccharide having a polymerization
degree, n, which is equal to or higher than that of maltotetraose,
the product in the principal reaction was a saccharide, of which
the polymerization degree is n, and the glucose residue at the
reducing end is .alpha.-1, .alpha.-1-linked. And in addition, equal
moles of glucose and a saccharide having a polymerization degree of
n-1 were produced in the side reaction. Additionally, when the
reaction further progressed in these saccharides, the saccharide
having a polymerization degree of N-1 secondarily underwent the
reactions similar to the above. (Incidentally, in FIGS. 7 and 8,
saccharides indicated as trisaccharide and tetrasaccharide include
non-reacted maltotriose and maltotetraose, respectively, and also
include the saccharides, of which the linkage at an end is
.alpha.-1, .alpha.-1, were produced when the reactions similar to
the above progressed secondarily.) Meanwhile, the production of
such a saccharide as having a polymerization degree of n+1 or
higher, namely, an intermolecularly-transferred isomer, was not
detected. Incidentally, hydrolysis as the side reaction occurred
less frequently when the chain length was the same as or longer
than that of G4.
[0316] The trisaccharide, the tetrasaccharide and the
pentasaccharide which are the principal products from the
substrates, G3, G4 and G5, respectively, were sampled by the
TSK-gel Amide-80 HPLC column as examples of principal products in
the above, and analyzed by .sup.1H-NMR and .sup.13C-NMR. As a
result, it was found that the glucose residue at the reducing end
of each saccharide was .alpha.-1, .alpha.-1-linked, and those
saccharides were recognized as glucosyltrehalose
(.alpha.-D-maltosyl .alpha.-D-glucopyranoside), maltosyltrehalose
(.alpha.-D-maltotriosyl .alpha.-D-glucopyranoside), and
maltotriosyltrehalose (.alpha.-D-maltotetraosyl
.alpha.-D-glucopyranoside), respectively. The chemical formulae of
these saccharides are as follows. ##STR2##
[0317] From the above results, it can be concluded that the enzyme
of the present invention acts on maltotriose or a larger glucose
polymers in which the glucose residues are .alpha.-1,4-linked, and
transfers the first linkage from the reducing end into an
.alpha.-1, .alpha.-1-linkage. Further, the enzyme of the present
invention was found to hydrolyze the first linkage from the
reducing end utilizing a H.sub.2O molecule as the receptor to
liberate a molecule of glucose, as is often observed in
glycosyltransferases.
EXAMPLE I-8
Production of Glucosyltrehalose and Maltooligosyltrehalose from a
Mixture of Maltooligosaccharides
[0318] Production of glucosyltrehalose and various
maltooligosyltrehaloses was attempted by using 10 Units/ml of the
purified enzyme obtained in Example I-2, and by using hydrolysate
of a soluble starch product (manufactured by Nacalai tesque Co.,
special grade) with .alpha.-amylase as the substrate, wherein the
soluble starch product had been hydrolyzed into oligosaccharides
which did not exhibit the color of the iodo-starch reaction, by the
.alpha.-amylase which was the A-0273 derived from Aspergillus
oryzae manufactured by Sigma Co. The resultant reaction mixture was
analyzed by an HPLC analysis method under the conditions below.
[0319] Column: BIORAD AMINEX HPX-42A (7.8.times.300 mm) [0320]
Solvent: Water [0321] Flow rate: 0.6 ml/min. [0322] Temperature:
85.degree. C. [0323] Detector: Refractive Index Detector
[0324] FIG. 9(A) is an HPLC analysis chart obtained herein. As a
control, the HPLC chart of the case performed without the addition
of the present transferase is shown in FIG. 9(B).
[0325] As a result, each of the oligosaccharides as the reaction
products was found to have a retention time shorter than that of
the control product which was produced using amylase only, wherein
the shorter retention time is attributed to the .alpha.-1,
.alpha.-1-transference of the reducing end of the oligosaccharides.
Similar to Example I-7, the trisaccharide, the tetrasaccharide and
the pentasaccharide were sampled and analyzed by .sup.1H-NMR and
.sup.13C-NMR. As a result, it was found that the glucose residue at
the reducing end of each saccharide was .alpha.-1, -1-linked, and
those saccharides were recognized as glucosyltrehalose
(.alpha.-D-maltosyl .alpha.-D-glucopyranoside), maltosyltrehalose
(.alpha.-D-maltotriosyl .alpha.-D-glucopyranoside), and
maltotriosyl-trehalose (.alpha.-D-maltotetraosyl
.alpha.-D-glucopyranoside), respectively. The chemical formulae of
these saccharides are as follows. ##STR3##
[0326] The reagents and materials described below, which were used
in Examples II-1-II-14 (including Comparative Examples II-1 and
II-2, and Referential Examples II-1-II-4), were obtained from the
manufacturers described below, respectively.
[0327] .alpha., .alpha.-trehalose: manufactured by Sigma Co.
[0328] Soluble starch: manufactured by Nacalai tesque Co., special
grade
[0329] Pullulanase derived from Klebsiella pneumoniae: manufactured
by Wako pure chemical Co., #165-15651
[0330] Pine-dex #1 and Pine-dex #3: manufactured by Matsutani
Kagaku Co.
[0331] Maltose (G2): manufactured by Wako pure chemical Co.
[0332] Maltotriose (G3), Maltotetraose (G4), Maltopentaose (G5),
Maltohexaose (G6), Maltoheptaose (G7), and Amylose DP-17:
manufactured by Hayashibara Biochemical Co.
[0333] Amylopectin: manufactured by Nacalai tesque Co., special
grade
[0334] Isomaltose: manufactured by Wako pure chemical Co.
[0335] Isomaltotriose: manufactured by Wako pure chemical Co.
[0336] Isomaltotetraose: manufactured by Seikagaku Kougyou Co.
[0337] Isomaltopentaose: manufactured by Seikagaku Kougyou Co.
[0338] Panose: manufactured by Tokyo Kasei Kougyou Co.
EXAMPLE II-1
Measurement of Trehaloseoligosaccharide-hydrolyzing Activity and
Starch-liquefying Activity Possessed by Archaebacteria
[0339] The bacterial strains listed in Table 11 below were examined
for enzymatic activity. The measurement was performed as follows:
The cultivated cells of each bacterial strain were crushed by
ultrasonic treatment and centrifuged; maltotriosyltrehalose as a
substrate was added to the resultant supernatant, namely, a crude
enzyme solution, so that the final concentration of
maltotriosyltrehalose would be 10 mM; the mixture thus obtained was
subjected to a reaction at 60.degree. C. and pH 5.5 (50 mM sodium
acetate buffer solution); the reaction was then stopped by
heat-treatment at 100.degree. C. for 5 min.; and the .alpha.,
.alpha.-trehalose thus produced was analyzed by an HPLC method
under the conditions below. [0340] Column: TOSOH TSK-gel Amide-80
(4.6.times.250 mm) [0341] Solvent: 72.5% acetonitrile [0342] Flow
rate: 1.0 ml/min. [0343] Temperature: Room temperature [0344]
Detector: Refractive index detector
[0345] The trehaloseoligosaccharide-hydrolyzing activity is
expressed with such a unit as 1 Unit equals the activity of
liberating 1 .mu.mol of .alpha., .alpha.-trehalose per hour from
maltotriosyltrehalose. Incidentally, in Table 11, the activity is
expressed in terms of units per one gram of bacterial cell. Here,
maltotriosyltrehalose was prepared as follows: The purified
transferase derived from the Sulfolobus solfataricus strain KM1 was
added to a 10% maltopentaose solution containing 50 mM of acetic
acid (pH 5.5) so that the concentration of the transferase would be
10 Units/ml; the mixture thus obtained was subjected to a reaction
at 60.degree. C. for 24 hours; and the resultant was subjected to
the above TSK-gel Amide-80 HPLC column to obtain
maltotriosyltrehalose. As to the activity of the purified
transferase derived from the Sulfolobus solfataricus strain KM1, 1
Unit is defined as equalling the activity of producing 1 .mu.mol of
glucosyltrehalose per hour at 60.degree. C. and pH 5.5 when
maltotriose is used as the substrate.
[0346] FIG. 10 is the HPLC chart obtained herein. As is recognized
from the figure, a peak exhibiting the same retention time as that
of .alpha., .alpha.-trehalose without any anomer, and a peak
exhibiting the same retention time as that of maltotriose appeared
in the chart. Additionally, the product of the former peak was
sampled by the TSK-gel Amide-80 HPLC column, and analyzed by
.sup.1H-NMR and .sup.13C-NMR. As a result, the product was
confirmed to be .alpha., .alpha.-trehalose.
[0347] Further, 2% soluble starch contained in a 100 mM sodium
acetate buffer solution (pH 5.5) was subjected to a reaction with
the above crude enzyme solution (the supernatant) at 60.degree. C.
by adding 0.5 ml of the supernatant to 0.5 ml of the starch
solution. Time-course sampling was performed, and to each sample,
twice volume of 1 N HCl was added for stopping the reaction.
Subsequently, two-thirds volume of a 0.1% potassium iodide solution
containing 0.01% of iodine was added, and further, 1.8-fold volume
of water was added. Finally, absorptivity at 620 nm was measured,
and the activity was estimated from the time-course change of the
absorptivity.
[0348] The saccharides produced in the reaction were analyzed by an
HPLC analysis method under the conditions shown below after the
reaction was stopped by treatment at 100.degree. C. for 5 min.
[0349] Column: BIORAD AMINEX HPX-42A (7.8.times.300 mm) [0350]
Solvent: Water [0351] Flow rate: 0.6 ml/min. [0352] Temperature:
85.degree. C. [0353] Detector: Refractive index detector
[0354] As to starch-hydrolyzing activity, 1 Unit is defined as
equalling the amount of the enzyme with which the absorptivity at
620 nm corresponding to the violet color of the starch-iodine
complex decreases at a rate of 10% per 10 min. Incidentally, in
Table 11, the activity was expressed in terms of units per one gram
of bacterial cell. TABLE-US-00011 TABLE 11 Enzyme activity
(uints/g-cell) Hydrolyzing Hydrolyzing activity activity of
trehalose Strain of starch oligosaccharide Sulfolobus solfataricus
ATCC 35091 13.3 118.0 DSM 5354 13.3 116.8 DSM 5833 8.4 94.9 KM1
13.4 293.2 Sulfolobus ATCC 33909 12.5 161.8 acidocaldarius
Sulfolobus shibatae DSM 5389 11.2 281.2
[0355] FIG. 11 shows the results of an analysis by AMINEX HPX-42A
HPLC performed on the products by the reaction with the crude
enzyme solution derived from the Sulfolobus solfataricus strain
KM1.
[0356] From the above results, the cell extract of a bacterial
strain belonging to the genus Sulfolobus was found to have an
activity of hydrolyzing trehaloseoligosaccharides to liberate
.alpha., .alpha.-trehalo-se, and an activity of hydrolyzing starch
to liberate principally monosaccharides or disaccharides.
EXAMPLE II-2
Purification of the Present Amylase Derived from the Sulfolobus
solfataricus Strain KM1
[0357] The Sulfolobus solfatricus strain KM1 was cultivated at
75.degree. C. for 3 days in the culture medium which is identified
as No. 1304 in Catalogue of Bacteria and Phages 18th edition (1992)
published by American Type Culture Collection (ATCC), and which
contained 2 g/liter of soluble starch and 2 g/liter of yeast
extract. The cultivated bacteria was collected by centrifugation
and stored at -80.degree. C. The yield of the bacterial cell was
3.3 g/liter.
[0358] Two hundred grams of the bacterial cells obtained above were
suspended in 400 ml of a 50 mM sodium acetate buffer solution (pH
5.5) containing 5 mM of EDTA, and subjected to ultrasonic treatment
for bacteriolysis at 0.degree. C. for 15 min. The resultant was
then centrifuged to obtain a supernatant, and ammonium sulfate was
added to the supernatant so as to be 60% saturation.
[0359] The precipitate obtained by centrifugation was dissolved in
a 50 mM sodium acetate buffer solution (pH 5.5) containing 1 M of
ammonium sulfate and 5 mM of EDTA, and subjected to hydrophobic
chromatography using the TOSOH TSK-gel Phenyl-TOYOPEARL 650S column
(volume: 800 ml) equilibrated with the same buffer solution as
above. The column was then washed with the same buffer solution,
and the objective amylase was eluted with 600 ml of ammonium
sulfate solution at a linear concentration gradient from 1 M to 0
M. The fractions exhibiting the activity were concentrated using an
ultrafiltration membrane (critical molecular weight: 13,000), and
subsequently, washed and desalted with a 10 mM Tris-HCl buffer
solution (pH 7.5).
[0360] Next, the resultant was subjected to ion-exchange
chromatography using the TOSOH TSK-gel DEAE-TOYOPEARL 650S column
(volume: 300 ml) equilibrated with the same buffer solution. The
column was then washed with the same buffer solution, and the
objective amylase was eluted with 900 ml of sodium chloride
solution at a linear concentration gradient from 0 M to 0.3 M. The
fractions exhibiting the activity were concentrated using an
ultrafiltration membrane (critical molecular weight: 13,000), and
subsequently, washed and desalted with a 50 mM sodium acetate
buffer solution (pH 5.5) containing 0.15 M of sodium chloride and 5
mM of EDTA.
[0361] Subsequent to that, the desalted and concentrated solution
thus obtained was subjected to gel filtration chromatography using
the Pharmacia HiLoad 16/60 Superdex 200 pg column, and the
objective amylase was eluted with the same buffer solution. The
fractions exhibiting the activity were concentrated using an
ultrafiltration membrane (critical molecular weight: 13,000), and
subsequently, washed and desalted with a 25 mM Bis-Tris-HCl buffer
solution (pH 6.3).
[0362] Next, the desalted and concentrated solution thus obtained
was subjected to a chromatofocusing using the Pharmacia Mono P
HR/5/20 column equilibrated with the same buffer solution. The
objective amylase was then eluted with 10% polybuffer 74
(manufactured by Pharmacia Co., and adjusted at pH 4.0 with HCl).
The fractions exhibiting the activity were concentrated using an
ultrafiltration membrane (critical molecular weight: 13,000), and
subsequently, washed and desalted with a 10 mM sodium acetate
buffer solution (pH 6.8).
[0363] Further, to this desalted and concentrated solution, a
quarter volume of a sample buffer [62.5 mM Tris-HCl buffer solution
(pH 6.8), 10% glycerol, 2% SDS, and 0.0125% Bromophenolblue] was
added, and subjected to 10% SDS-Polyacrylamide gel electrophoresis
(SDS-PAGE) (apparatus: BIO-RAD Prep Cell Model 491) to elute the
objective amylase. The fractions exhibiting the activity were
separated and concentrated using an ultrafiltration membrane
(critical molecular weight: 13,000), and subsequently, washed and
desalted with a 10 mM sodium acetate buffer solution (pH 5.5).
[0364] Finally, Native polyacrylamide gel electrophoresis,
SDS-polyacrylamide gel electrophoresis and isoelectric focusing
were performed to obtain the purified enzyme which appeared as
single band.
[0365] Incidentally, for the activity measurement, in this
purification procedure, maltotriosyltrehalose was used as the
substrate, and the same manner as in the TSK-gel Amide-80 HPLC
analysis method shown in Example II-1 was employed. TABLE-US-00012
TABLE 12 Total Specific enzyme Total activity Pu- activity protein
(units/ Yield rity Purified fraction (units) (mg) mg) (%) (fold)
60% saturated (NH.sub.4).sub.2SO.sub.4 58640 17000 3.45 100 1
precipitation Phenyl 52251 1311 39.9 89 12 DEAE 49284 195 253 84 73
Gel-permeation 2197 26.7 82.2 3.7 24 Mono P 1048 0.40 2640 1.8 765
SDS-PAGE 401 0.08 5053 0.7 1465
EXAMPLE II-3
Purification of the Present Amylase Derived from the Sulfolobus
solfataricus Strain DSM 5833
[0366] The Sulfolobus solfataricus strain DSM 5833 was cultivated
at 75.degree. C. for 3 days in the culture medium which is
identified as No. 1304 in Catalogue of Bacteria and Phages 18th
edition (1992) published by American Type Culture Collection
(ATCC), and which contained 2 g/liter of soluble starch and 2
g/liter of yeast extract. The cultivated bacteria was collected by
centrifugation and stored at -80.degree. C. The yield of the
bacterial cell was 1.2 g/liter.
[0367] Twenty five grams of the bacterial cells obtained above were
suspended in 50 ml of a 50 mM sodium acetate buffer solution (pH
5.5) containing 5 mM of EDTA, and subjected to ultrasonic treatment
for bacteriolysis at 0.degree. C. for 15 min. The resultant was
then centrifuged to obtain a supernatant.
[0368] To this supernatant, ammonium sulfate was added so as to be
1 M. The resultant was then subjected to hydrophobic chromatography
using TOSOH TSK-gel Phenyl-TOYOPEARL 650S column (volume: 100 ml)
equilibrated with a 50 mM sodium acetate buffer solution (pH 5.5)
containing 1 M of sodium sulfate and 5 mM of EDTA. The column was
then washed with the same buffer solution, and the objective
amylase was eluted with 300 ml of ammonium sulfate solution at a
linear concentration gradient from 1 M to 0 M. The fractions
exhibiting the activity were concentrated using an ultrafiltration
membrane (critical molecular weight: 13,000), and subsequently,
washed and desalted with a 10 mM Tris-HCl buffer solution (pH
7.5).
[0369] Next, the resultant was subjected to ion-exchange
chromatography using the TOSOH TSK-gel DEAE-TOYOPEARL 650S column
(volume: 100 ml) equilibrated with the same buffer solution. The
column was then washed with the same buffer solution, and the
objective amylase was eluted with 300 ml of sodium chloride
solution at a linear concentration gradient from 0 M to 0.3 M. The
fractions exhibiting the activity were concentrated using an
ultrafiltration membrane (critical molecular weight: 13,000), and
subsequently, washed and desalted with a 50 mM sodium acetate
buffer solution (pH 5.5) containing 0.15 M of sodium chloride and 5
mM of EDTA.
[0370] Subsequent to that, the desalted and concentrated solution
thus obtained was subjected to gel filtration chromatography using
the Pharmacia HiLoad 16/60 Superdex 200 pg column, and the
objective amylase was eluted with the same buffer solution. The
fractions exhibiting the activity were concentrated using an
ultrafiltration membrane (critical molecular weight: 13,000), and
subsequently, washed and desalted with a 25 mM
Bis-Tris-iminodiacetic acid buffer solution (pH 7.1).
[0371] Next, the desalted and concentrated solution thus obtained
was subjected to a chromatofocusing using the Pharmacia Mono P
HR5/20 column equilibrated with the same buffer solution. The
objective amylase was then eluted with 10% Polybuffer 74
(manufactured by Pharmacia, and adjusted at pH 4.0 with
iminodiacetic acid). The fractions exhibiting the activity were
concentrated using an ultrafiltration membrane (critical molecular
weight: 13,000), and subsequently, washed and desalted with a 25 mM
bis-Tris-iminodiacetic acid buffer solution (pH 7.1).
[0372] Further, the desalted and concentrated solution thus
obtained was subjected to a chromatofocusing using the Pharmacia
Mono P HR5/20 column equilibrated with the same buffer solution.
The objective amylase was then eluted with 10% Polybuffer 74
(manufactured by Pharmacia, and adjusted at pH 4.0 with
iminodiacetic acid). The fractions exhibiting the activity were
concentrated using an ultrafiltration membrane (critical molecular
weight: 13,000), and subsequently, washed and desalted with a 50 mM
sodium acetate buffer solution (pH 5.5) containing 0.15 M of sodium
chloride and 5 mM of EDTA.
[0373] Moreover, the desalted and concentrated solution thus
obtained was subjected to gel filtration chromatography using the
TSK-gel G3000SW HPLC column, and the objective amylase was then
eluted with the same buffer solution. The fractions exhibiting the
activity were concentrated using an ultrafiltration membrane
(critical molecular weight: 13,000), and subsequently, washed and
desalted with a 50 mM sodium acetate buffer solution (pH 5.5)
containing 5 mM of EDTA.
[0374] Finally, Native Polyacrylamide gel electrophoresis,
SDS-Polyacrylamide gel electrophoresis and isoelectric focusing
were performed to obtain the purified enzyme which appeared as
single band.
[0375] Incidentally, for the activity measurement, in this
purification procedure, maltosyltrehalose was used as the
substrate, and the same manner as in the TSK-gel Amide-80 HPLC
analysis method shown in Example II-1 was employed.
[0376] Total enzyme activity, total protein and specific activity
at each of the purification steps are shown in Table 13 below.
TABLE-US-00013 TABLE 13 Total enzyme Total Specific activity
protein activity Yield Purity Purified fraction (units) (mg)
(units/mg) (%) (fold) Crude extract 3345 1394 2.40 100 1 Phenyl
2112 266 7.9 63 3.3 DEAE 1365 129 10.6 41 4.4 Gel-permeation 651
7.8 83.5 19 35 Mono P 467 0.76 612 14 255 Mono P 156 0.12 1301 4.7
542 rechromatography Gel-permeation 98 0.01 13652 2.9 5687
rechromatography
EXAMPLE II-4
Purification of the Present Amylase Derived from the Sulfolobus
acidocaldarius Strain ATCC 33909
[0377] The Sulfolobus solfataricus strain ATCC 33909 was cultivated
at 75.degree. C. for 3 days in the culture medium which is
identified as No. 1304 in Catalogue of Bacteria and Phages 18th
edition (1992) published by American Type Culture Collection
(ATCC), and which contained 2 g/liter of soluble starch and 2
g/liter of yeast extract. The cultivated bacteria was collected by
centrifugation and stored at -80.degree. C. The yield of the
bacterial cell was 2.7 g/liter.
[0378] Twenty five grams of the bacterial cells obtained above were
suspended in 50 ml of a 50 mM sodium acetate buffer solution (pH
5.5) containing 5 mM of EDTA, and subjected to ultrasonic treatment
for bacteriolysis at 0.degree. C. for 15 min. The resultant was
then centrifuged to obtain a supernatant.
[0379] To this supernatant, ammonium sulfate was added so as to be
1 M. The resultant was then subjected to hydrophobic chromatography
using TOSOH TSK-gel Phenyl-TOYOPEARL 650S column (volume: 100 ml)
equilibrated with a 50 mM sodium acetate buffer solution (pH 5.5)
containing 1 M of sodium sulfate and 5 mM of EDTA. The column was
then washed with the same buffer solution, and the objective
amylase was eluted with 300 ml of ammonium sulfate solution at a
linear concentration gradient from 1 M to 0 M. The fractions
exhibiting the activity were concentrated using an ultrafiltration
membrane (critical molecular weight: 13,000), and subsequently,
washed and desalted with a 10 mM Tris-HCl buffer solution (pH
7.5).
[0380] Next, the resultant was subjected to ion-exchange
chromatography using the TOSOH TSK-gel DEAE-TOYOPEARL 650S column
(volume: 100 ml) equilibrated with-the same buffer solution. The
column was then washed with the same buffer solution, and the
objective amylase was eluted with 300 ml of sodium chloride
solution at a linear concentration gradient from 0 M to 0.3 M. The
fractions exhibiting the activity were concentrated using an
ultrafiltration membrane (critical molecular weight: 13,000), and
subsequently, washed and desalted with a 50 mM sodium acetate
buffer solution (pH 5.5) containing 0.15 M of sodium chloride and 5
mM of EDTA.
[0381] Subsequent to that, the desalted and concentrated solution
thus obtained was subjected to gel filtration chromatography using
the Pharmacia HiLoad 16/60 Superdex 200 pg column, and the
objective amylase was eluted with the same buffer solution. The
fractions exhibiting the activity were concentrated using an
ultrafiltration membrane (critical molecular weight: 13,000), and
subsequently, washed and desalted with a 50 mM sodium acetate
buffer solution (pH 5.5).
[0382] Next, ammonium sulfate was dissolved in the desalted and
concentrated solution so that the concentration of ammonium sulfate
would be 1 M. The resultant was then subjected to hydrophobic
chromatography using TOSOH TSK-gel Phenyl-5PW HPLC column
equilibrated with the same buffer solution. The column was then
washed with the same buffer solution, and the objective amylase was
eluted with 30 ml of ammonium sulfate solution at a linear
concentration gradient from 1 M to 0 M. The fractions exhibiting
the activity were concentrated using an ultrafiltration membrane
(critical molecular weight: 13,000), and subsequently, washed and
desalted with a 25 mM bis-Tris-iminodiacetic acid buffer solution
(pH 7.1).
[0383] Further, the desalted and concentrated solution thus
obtained was subjected to a chromatofocusing using the Pharmacia
Mono P HR5/20 column equilibrated with the same buffer solution.
The objective amylase was then eluted with 10% Polybuffer 74
(manufactured by Pharmacia, and adjusted at pH 4.0 with
iminodiacetic acid). The fractions exhibiting the activity were
concentrated using an ultrafiltration membrane (critical molecular
weight: 13,000), and subsequently, washed and desalted with a 50 mM
sodium acetate buffer solution (pH 5.5) containing 5 mM of
EDTA.
[0384] Finally, Native Polyacrylamide gel electrophoresis,
SDS-Polyacrylamide gel electrophoresis and isoelectric focusing
were performed to obtain the purified enzyme which appeared as
single band.
[0385] Incidentally, for the activity measurement, in this
purification procedure, maltotriosyltrehalose was used as the
substrate, and the same manner as in the TSK-gel Amide-80 HPLC
analysis method shown in Example II-1 was employed. TABLE-US-00014
TABLE 14 Total enzyme Total Specific activity protein activity
Yield Purity Purified fraction (units) (mg) (units/mg) (%) (fold)
Crude extract 4534 760 5.97 100 1 Phenyl 2428 88.0 27.6 54 4.6 DEAE
927 9.20 101 20 17 Gel-permeation 600 1.10 546 13 92 Phenyl 392
0.16 2449 9.1 411 rechromatography Mono P 120 0.04 3195 2.6 558
EXAMPLE II-5
Examination of the Present Amylase for Various Characteristics
[0386] The purified enzyme obtained in Example II-2 was examined
for enzymatic characteristics.
[0387] (1) Molecular Weight
[0388] The molecular weight was measured by SDS-polyacrylamide gel
electrophoresis (gel concentration; 6%). Marker proteins having
molecular weights of 200,000, 116,300, 97,400, 66,300, 55,400,
36,500, 31,000, 21,500 and 14,400, respectively, were used.
[0389] As a result, the molecular weight of the amylase was
estimated at 61,000.
[0390] (2) Isoelectric Point
[0391] The isoelectric point was found to be pH 4.8 by agarose gel
isoelectric focusing.
[0392] (3) Stability
[0393] The stability changes of the obtained enzyme according to
temperature and pH value are shown in FIGS. 12 and 13,
respectively. The measurement of enzymatic activity was carried out
according to the measurement method in Example II-1 using
maltotriosyltrehalose, and a glycine-HCl buffer solution was used
in a pH range of 3-5, and similarly, a sodium, acetate buffer
solution in a pH range of 4-6, a sodium phosphate buffer solution
in a pH range of 5-8, a Tris-HCl buffer solution in a pH range of
8-9, a sodium bicarbonate buffer solution in a pH range of 9-10,
and a KCl-NaOH buffer solution in a pH range of 11-13.5,
respectively, were also used.
[0394] The present enzyme was stable throughout the treatment at
85.degree. C. for 6 hours, and also, was stable throughout the
treatment at pH 3.5-10.0 and room temperature for 6 hours.
[0395] (4) Reactivity
[0396] As to the obtained enzyme, reactivity at various
temperatures and reactivity at various pH are shown in FIGS. 14 and
15, respectively. The measurement of enzymatic activity was carried
out according to the measurement method in Example II-1 using
maltotriosyltrehalose, and a sodium citrate buffer solution was
used in a pH range of 2-4 (.quadrature.), and similarly, a sodium
acetate buffer solution in a pH range of 4-5.5 (.circle-solid.), a
sodium phosphate buffer solution in a pH range of 5-7.5 (.DELTA.),
and a Tris-HCl buffer solution in a pH range of 8-9 (.diamond.),
respectively, were also used.
[0397] The optimum reaction temperature of the present enzyme is
within 70-85.degree. C., approximately, and the optimum reaction pH
of the present enzyme is within 4.5-5.5, approximately.
[0398] (5) Influence of Various Activators and Inhibitors
[0399] The influence of each substance listed in Table 15, such as
an activating effect or inhibitory effect, was evaluated using
similar activity-measuring method to that in Example II-1.
Specifically, the listed substances were individually added
together with the substrate to the same reaction system as that in
the method for measuring maltotriosyltrehalose-hydrolyzing activity
employed in Example II-1. As a result, copper ion and sodium
dodecyl sulfate (SDS) were found to have inhibitory effects. As to
the inhibitory effect by SDS, however, the enzymatic activity
revived after SDS was removed by dialysis, ultrafiltration or the
like. Though many glucide-relating enzymes have been found to be
activated with calcium ion, the present enzyme would not be
activated with calcium ion. TABLE-US-00015 TABLE 15 Concentration
Residual activity Activator/Inhibitor (mM) (%) Control (not added)
100.0 CaCl.sub.2 5 97.1 MgCl.sub.2 5 93.5 MnCl.sub.2 5 101.8
CuSO.sub.4 5 0 CoCl.sub.2 5 97.1 FeSO.sub.4 5 73.5 FeCl.sub.3 5
38.0 AgNO.sub.3 5 105.7 EDTA 5 106.3 2-Mercaptoethanol 5 141.7
Dithiothreitol 5 116.2 SDS 5 0 Glucose 0.5 109.4
.alpha.,.alpha.-Trehalose 0.5 98.2 Maltotetraose 0.5 108.5
Malatopentaose 0.5 105.8 Maltohexaose 0.5 123.8 Maltoheptaose 0.5
129.2
[0400] (6) Substrate Specificity
[0401] The hydrolyzing properties were analyzed by allowing 25.0
Units/ml (in terms of the enzymatic activity when
maltotriosyltrehalose is used as the substrate) of the present
purified enzyme to act on the various 10 mM substrates (except
amylopectin and soluble starch were used as 2.8% solutions) listed
in Table 16 below, and the hydrolyzed products were also analyzed.
The analysis was performed by TSK-gel Amide-80 HPLC described in
Example II-1, wherein the index was the activity of producing both
monosaccharide and disaccharide when the substrate was each of the
various maltooligosaccharides, Amylose DP-17, amylopectin, soluble
starch, various isomaltooligosaccharides, and panose; the activity
of producing .alpha., .alpha.-trehalose when the substrate was each
of the various trehaloseoligosaccharides, and .alpha.-1,
.alpha.-1-transferred isomer of Amylose DP-17 (the oligosaccharide
derived from Amylose DP-17 by transferring the linkage between the
first and second glucose residues from the reducing end into an
.alpha.-1, .alpha.-1 linkage); and the activity of producing
glucose when the substrate was maltose or .alpha.,
.alpha.-trehalose.
[0402] Incidentally, each enzymatic.activity in Table 16 is
expressed with such a unit as 1 Unit equals the activity of
liberating 1 .mu.mol of each of the monosaccharide and disaccharide
per hour.
[0403] The results are as shown in table 16 below and in FIGS.
16-19. TABLE-US-00016 TABLE 16 Production rate of mono- and
Liberated disaccharides Substrate oligosaccharide (units/ml)
Maltose (G2) Glucose 0.19 Maltotriose (G3) Glucose + G2 0.30
Maltotetraose (G4) Glucose + G2 + G3 0.31 Maltopentaose (G5)
Glucose + G2 + G3 + G4 1.79 Maltohexaose (G6) Glucose + G2 + G4 +
G5 1.74 Maltoheptaose (G7) Glucose + G2 + G5 + G6 1.80 Amylose
DP-17 Glucose + G2 2.35 Amylopectin Glucose + G2 0.33 Soluble
starch Glucose + G2 0.55 .alpha.,.alpha.-Trehalose not decomposed 0
Glucosyltrehalose Glucose + Trehalose 0.04 Maltosyltrehalose G2 +
Trehalose 3.93 Maltotriosyltrehalose G3 + Trehalose 25.0
Maltotetraosyltrehalose G4 + Trehalose 27.3 Maltopentaosyltrehalose
G5 + Trehalose 25.5 Amylose DP-17, .alpha.-1, Trehalose 4.98
.alpha.-1-transferred isomer Isomaltose not decomposed 0
Isomaltotriose not decomposed 0 Isomaltotetraose not decomposed 0
Isomaltopentaose not decomposed 0 Panose not decomposed 0
[0404] Notes: Each of glucosyltrehalose, maltosyltrehalose,
maltotetraosyltrehalose, maltopentaosyltrehalose, and .alpha.-1,
.alpha.-1-transferred isomer of Amylose DP-17 was prepared
according to the method for preparing maltotriosyltrehalose in
Example II-1.
[0405] The results of the analyses by AMINEX HPX-42A HPLC performed
on reaction products from maltopentaose, Amylose DP-17 and soluble
starch are shown in A, B and C of FIG. 17, respectively. Further,
the results of the analyses by TSK-gel Amide-80 HPLC performed on
reaction products from maltotriosyltrehalose and
maltopentaosyltrehalose are shown in FIGS. 18 and 19,
respectively.
[0406] From the results, the present purified enzyme was confirmed
to markedly effectively act on a trehaloseoligo-saccharide, of
which the glucose residue at the reducing end side is .alpha.-1,
.alpha.-1-linked, such as maltotoriosyltrehalose, to liberate
.alpha., .alpha.-trehalose and a corresponding
maltooligosac-charide which has a polymerization degree reduced by
two. Further, the present purified enzyme was confirmed to liberate
principally glucose or maltose from maltose (G2)-maltoheptaose
(G7), amylose, and soluble starch. The present purified enzyme,
however, did not act on .alpha., .alpha.-trehalose, which has an
.alpha.-1, .alpha.-1 linkage; isomaltose, isomaltotriose,
isomaltotetraose and isomaltopentaose, of which all the sugar units
are .alpha.-1,6-linked; and panose, of which the second linkage
from the reducing end is .alpha.-1,6.
[0407] (7) Endotype Amylase Activity
[0408] Two hundred Units/ml (in terms of the enzymatic activity
when maltotriosyltrehalose is used as the substrate) of the present
purified enzyme was allowed to act on soluble starch, and the
time-lapse changes in the coloring degree by the iodo-starch
reaction, and the starch-hydrolyzing rate estimated from the
produced amounts of monosaccharide and disaccharide were analyzed
using the method for measuring starch-hydrolyzing activity
described in Example II-1, and the AMINEX HPX-42A HPLC analyzing
method.
[0409] As shown in FIG. 20, the hydrolyzing rate of the present
purified enzyme at the point where the coloring degree by the
iodo-starch reaction decreased to 50% was as low as 3.7%.
Accordingly, the present purified enzyme was confirmed to have a
property of an endotype amylase.
[0410] (8) Investigation of the Action Mechanism
[0411] Uridinediphosphoglucose [glucose-6-.sup.3H] and
maltotetraose were put into a reaction with glycogen synthase
(derived from rabbit skeletal muscle, G-2259 manufactured by Sigma
Co.) to synthesize maltopentaose, of which the glucose residue of
the non-reducing end was radiolabeled with .sup.3H, and the
maltopentaose was isolated and purified. To 10 mM of this
maltopentaose radiolabeled with .sup.3H as a substrate, 10 Units/ml
(in terms of the enzymatic activity when maltotriose is used as the
substrate) of the purified transferase derived from the Sulfolobus
solfataricus strain KM1 was added and put into a reaction at
60.degree. C. for 3 hours. Maltotriosyltrehalose, of which the
glucose residue of the non-reducing end was radiolabeled with
.sup.3H, was synthesized thereby, and the product was isolated and
purified. [Incidentally, it was confirmed by the following
procedure that the glucose residue of the non-reducing end had been
radiolabeled: The above product was completely decomposed into
glucose and .alpha., .alpha.-trehalose by glucoamylase (derived
from Rhizopus, manufactured by Seikagaku Kou.gyou Co.); the
resultants were sampled by thin-layer chromatography, and their
radioactivities were measured by a liquid scintillation counter; as
a result, radioactivity was not observed in the .alpha.,
.alpha.-trehalose fraction but in the glucose fraction.]
[0412] The above-prepared maltopentaose and maltotriosyltrehalose,
of which the glucose residues of the non-reducing ends were
radiolabeled with .sup.3H, were used as substrates, and were put
into reactions with 50 Units/ml and 5 Units/ml of purified enzyme
obtained. in Example II-2, respectively. Sampling was performed
before the reaction; and 0.5, 1 and 3 hours after the start of the
reaction performed at 60.degree. C. The reaction products were
subjected to development by thin-layer chromatography (Kieselgel 60
manufactured by Merck Co.; solvent: butanol/ethanol/water=5/5/3).
Each spot thus obtained and corresponding to each saccharide was
collected, and its radiation was measured with a liquid
scintillation counter. The results are shown in FIGS. 21 and 22,
respectively.
[0413] As is obvious from FIGS. 21 and 22, when maltopentaose was
used as a substrate, radioactivity was not detected in the
fractions of the hydrolysates, i.e. glucose and maltose, but in the
fractions of maltotetraose and maltotriose. On the other hand, when
maltotriosyltrehalose was used as a substrate, radioactivity was
not detected in the fraction of the hydrolysate, i.e. .alpha.,
.alpha.-trehalo-se, but in the fraction of maltotriose.
[0414] Consequently, as to the action mechanism, the present
purified enzyme was found to have an amylase activity of the
endotype function, and in addition, an activity of principally
producing monosaccharide and disaccharide from the reducing end
side.
[0415] Additionally, each of the purified enzymes obtained in
Examples II-3 and II-4, i.e. derived from the Sulfolobus
solfataricus strain DSM 5833 and the Sulfolobus acidocaldarius
strain ATCC 33909, respectively, was also examined for the
enzymatic characteristics in a similar manner. The results are
shown in Table 2 above.
Comparative Example II-1
Properties of Pancreatic .alpha.-Amylase in Hydrolyzing Various
Oligosaccharides and Analysis of the Hydrolysates
[0416] Swine pancreatic .alpha.-amylase is known to hydrolyze
maltooligosaccharide from the reducing end by two or three sugar
units ["Denpun-Kanren Toushitsu Kouso Jikken-hou" ("Experimental
methods in enzymes for starch and relating saccharides"), p 135,
written by Michinori Nakamura and Keiji Kainuma, published by
Gakkai-Shuppan-Sentah]. Upon this, a swine pancreatic
.alpha.-amylase (manufactured by Sigma Co., A-6255) was analyzed
the hydrolyzing properties and the hydrolysates as a comparative
example for the novel amylase of the present invention.
Specifically, 1 Unit/ml of the swine pancreatic .alpha.-amylase was
allowed to act on 10 mM of each substrate listed in below-described
Table 17 at pH 6.9 and 20.degree. C., wherein 1 Unit is defined as
equalling the amount of the enzyme with which 1 mg per 3 min. of a
reducing saccharide corresponding to maltose is produced at pH 6.9
and 20.degree. C. from starch assigned for the substrate. The
activity of producing disaccharide and trisaccharide was employed
as the index of the enzymatic activity, and the analysis was
performed by the TSK-gel Amide-80 HPLC analyzing method described
in Example II-1.
[0417] Incidentally, the enzymatic activity values in Table 17 were
expressed with such a unit as 1 Unit equals the activity of
liberating 1 .mu.mol of each oligosaccharide per hour.
[0418] The results are shown in Table 17 below and in FIGS. 23 and
24. TABLE-US-00017 TABLE 17 Production rate of di- and Liberated
trisaccharides Substrate oligosaccharide (units/ml) Maltotriose
(G3) not decomposed 0 Maltotetraose (G4) Glucose + G2 + G3 0.49
Maltopentaose (G5) G2 + G3 6.12 Maltohexaose (G6) G2 + G3 + G4 4.44
Maltoheptaose (G7) G2 + G3 + G4 + G5 4.45 Glucosyltrehalose not
decomposed 0 Maltosyltrehalose not decomposed 0
Maltotriosyltrehalose G2 + Glucosyltrehalose 0.03
Maltotetraosyltrehalose G3 + Glucosyltrehalose 2.57
Maltopentaosyltrehalose G3 + Maltosyltrehalose 4.36
[0419] Notes: Each of glucosyltrehalose, maltosyltrehalose,
maltotetraosyltrehalose, and maltopentaosyltrehalose was prepared
according to the method for preparing maltotriosyltrehalose in
Example II-1.
[0420] The results of analyses by TSK-gel Amide-80 HPLC performed
on reaction products from maltopentaosyltrehalose are shown in FIG.
24.
[0421] From the results, the pancreatic amylase was confirmed to
produce, from each of maltotetraose (G4)-maltoheptaose (G7),
maltose or maltotriose, and a corresponding maltooligosaccharide
which had a polymerization degree reduced by two or three; but not
to liberate .alpha., .alpha.-trehalose from
trehaloseoligosaccharides such as glucosyltrehalose and
maltooligosyltrehalose, of which the glucose-residue at the
reducing end side is .alpha.-1, .alpha.-1-linked; and in addition,
to have small reactivity to such trehaloseoligosaccharides.
EXAMPLE II-6
Production of .alpha., .alpha.-Trehalose from Soluble Starch and
Various Starch Hydrolysates
[0422] Production of .alpha., .alpha.-trehalose utilizing the
synergism between enzymes was attempted as follows:
[0423] The enzymes used were 150 Units/ml of the present purified
enzyme obtained in Example II-2, and 10 Units/ml of the purified
transferase derived from the Sulfolobus solfataricus strain
KM1;
[0424] substrates were a soluble starch (manufactured by Nacalai
tesque Co., special grade), as a starch hydrolysate, a soluble
starch which had been subjected to hydrolysis of the .alpha.-1,6
linkages beforehand under the conditions of 40.degree. C. for 1
hour with 25 Units/ml of pullulanase (manufactured by Wako pure.
chemical Co.) derived from Klebsiella pneumoniae, as another starch
hydrolysate, a soluble starch which had been subjected to partial
hydrolysis beforehand under the conditions of 30.degree. C. for 2.5
hours with 12.5 Units/ml of .alpha.-amylase (manufactured by
Boehringer Mannheim Co.) derived from Bacillus amylolichefaciens,
Pine-dex #1 and Pine-dex #3 (both manufactured by Matsutani Kagaku
Co.), each maltooligosaccharide of G3-G7 (manufactured by
Hayashibara Biochemical Co.), and Amylose DP-17 (manufactured by
Hayashibara Biochemical Co.);
[0425] the final concentration of each substrate was 10%; and
[0426] each reaction was performed under the conditions of
60.degree. C. at pH 5.5 for 100 hours, approximately.
[0427] Each reaction mixture was analyzed by the AMINEX HPX-42A
HPLC method described in Example II-1, according to the case in
which soluble starch was used as the substrate.
[0428] After the non-reacted substrate was hydrolyzed with
glucoamylase, the yield of .alpha., .alpha.-trehalose was analyzed
by the TSK-gel Amide-80 HPLC analyzing method described in Example
II-1.
[0429] As to activity of the novel amylase of the present
invention, 1 Unit is defined as the enzymatic activity of
liberating 1 .mu.mol of .alpha., .alpha.-trehalose per hour from
maltotriosyltrehalose, similar to Example II-1.
[0430] As to activity of the purified transferase derived from the
Sulfolobus solfataricus strain KM1, 1 Unit is defined as the
enzymatic activity of producing 1 .mu.mol of glucosyltrehalose per
hour at pH 5.5 and 60.degree. C. from maltotriose assigned for the
substrate.
[0431] As to activity of pullulanase, 1 Unit is defined as the
enzymatic activity of producing 1 .mu.mol of maltotriose per minute
at pH 6.0 and 30.degree. C. from pullulan assigned for the
substrate.
[0432] The results are shown in Table 18 below. TABLE-US-00018
TABLE 18 Yield of Substrate .alpha.,.alpha.-trehalose (%) Soluble
starch 37.0 Pullulanase-treated starch 62.1 Amylase-treated starch
42.2 Pinedex #1 49.9 Pinedex #3 40.4 Maltotriose (G3) 36.4
Maltotetraose (G4) 47.8 Maltopentaose (G5) 60.0 Maltohexaose (G6)
61.8 Maltoheptaose (G7) 67.1 Amylose DP-17 83.5
[0433] The results of the analysis by AMINEX HPX-42A HPLC performed
on the reaction product from the soluble starch are shown in FIG.
25.
[0434] Specifically, when soluble starch was used as the substrate,
.alpha., .alpha.-trehalose was produced in a yield of 37.0%. As to
the various starch hydrolysates, the yield was 62.1% when soluble
starch which had been subjected to hydrolysis of the .alpha.-1,4
linkages was used as the substrate. Further, in the various
maltooligosaccharides and Amylose DP-17, in which all of the
linkages are .alpha.-1,4 linkages, the yields were 36.4-67.1%, and
83.5%, respectively. These results suggest that the yield of the
final product, i.e. .alpha., .alpha.-trehalose, becomes higher when
such a substrate as having a longer .alpha.-1,4-linked
straight-chain is used.
EXAMPLE 11-7
Production of .alpha., .alpha.-Trehalose from Soluble Starch in
Various Enzyme-Concentrations
[0435] Production of .alpha., .alpha.-trehalose utilizing the
synergism between enzymes was attempted by adding the enzymes
having concentrations listed in Table 19, respectively, to a
substrate (final concentration: 10%). Specifically, the enzymes
were the present purified enzyme obtained in Example II-2, and the
purified transferase derived from the Sulfolobus solfataricus
strain KM1; the substrate was a soluble starch which had been
pre-treated under the conditions of 40.degree. C. for 1 hour with
25 Units/ml of pullulanase (manufactured by Wako pure chemical Co.)
derived from Klebsiella pneumoniae; and the reaction was performed
under the conditions of 60.degree. C. at pH 5.5 for 100 hours,
approximately. After the non-reacted substrate was hydrolyzed with
glucoamylase, the reaction mixture was analyzed by the TSK-gel
Amide-80 HPLC analyzing method described in Example II-1 to examine
the yield of the produced .alpha., .alpha.-trehalose.
[0436] As to activity of the novel amylase of the present
invention, 1 Unit is defined as the enzymatic activity of
liberating 1 .mu.mol of .alpha., .alpha.-trehalose per hour from
maltotriosyltrehalose, similar to Example II-1.
[0437] As to activity of the purified transferase derived from the
Sulfolobus solfataricus strain KM1, 1 Unit is defined as the
enzymatic activity of producing 1 .mu.mol of glucosyltrehalose per
hour at pH 5.5 and 60.degree. C. from maltotriose assigned for the
substrate.
[0438] As to activity of pullulanase, 1 Unit is defined as the
enzymatic activity of producing 1 .mu.mol of maltotridse per minute
at pH 6.0 and 30.degree. C. from pullulan assigned for the
substrate.
[0439] The results are shown in Table 19 below. TABLE-US-00019
TABLE 19 Yield of .alpha.,.alpha.-trehalose (%) Concentration of
amylase Concentration of transferase (units/ml) (units/ml) 0.1 1 5
10 20 1.5 7.8 28.0 9.6 8.8 9.7 15 10.0 45.3 34.3 33.6 35.2 150 8.6
51.8 59.3 62.1 65.1 450 1.6 45.1 58.9 61.7 64.2 700 1.3 19.0 39.3
44.5 46.8 2000 1.7 12.9 31.5 40.3 42.7
[0440] As is obvious from the results shown in the table, the yield
of .alpha., .alpha.-trehalose reached its maximum, i.e. 65.1%, in
such a case with 20 Units/ml of the transferase and 150 Units/ml of
the amylase.
Comparative Example II-2
Production of .alpha., .alpha.-Trehalose Using Amylases Derived
from the Other Organisms
[0441] Production of .alpha., .alpha.-trehalose utilizing the
synergism between enzymes was attempted as follows:
[0442] Amylases derived from Bacillus subtilis, Bacillus
licheniformis and Aspergillus oryzae (100200 manufactured by
Seikagaku Kougyou Co, A-3403 and A-0273 manufactured by Sigma Co.,
respectively; all of them are active at 60.degree. C.) were used as
comparative substitutions for the novel amylase of the present
invention;
[0443] the purified transferase used together was derived from the
Sulfolobus solfataricus strain KM1;
[0444] the substrate was a soluble starch (final concentration:
10%) which had been pre-treated under the conditions of 40.degree.
C. and 1 hour with 25 Units/ml of pullulanase (manufactured by Wako
pure chemical Co.) derived from Klebsiella pneumoniae;
[0445] the enzymes having concentrations listed in Table 20,
respectively, was added to the substrate; and
[0446] the reaction was performed under the conditions of
60.degree. C. at pH 5.5 for 100 hours, approximately. After the
non-reacted substrate was hydrolyzed with glucoamylase, the
reaction mixture was analyzed by the TSK-gel Amide-80 HPLC
analyzing method described in Example II-1 to examine the yield of
the produced .alpha., .alpha.-trehalose.
[0447] As to enzymatic activity of each amylase, 1 Unit is defined
as equalling the amount of the enzyme with which the absorptivity
at 620 nm corresponding to the violet color of the starch-iodine
complex decreases at a rate of 10% per 10 min. under the same
reaction conditions as in Example II-1.
[0448] As to activity of the purified transferase derived from the
Sulfolobus solfataricus strain KM1, 1 Unit is defined as the
enzymatic activity of producing 1 .mu.mol of glucosyltrehalose per
hour at pH 5.5 and 60.degree. C. from maltotriose assigned for the
substrate.
[0449] As to activity of pullulanase, 1 Unit is defined as the
enzymatic activity of producing 1 .mu.mol of maltotriose per minute
at pH 6.0 and 30.degree. C. from pullulan assigned for the
substrate.
[0450] The results are shown in Table 20 below. TABLE-US-00020
TABLE 20 Yield of .alpha.,.alpha.-trehalose (%) Concentration
Concentration Yield of of transferase of .alpha.-amylase
.alpha.,.alpha.-trehalose (units/ml) Origin of .alpha.-amylase
(units/ml) (%) 10 Bacillus subtilis 1.0 28.9 10 10.0 27.7 5
Bacillus licheniformis 10.0 26.4 10 10.0 26.8 5 Aspergillus oryzae
1.0 23.2 10 1.0 23.1
[0451] As is obvious from the results shown in the table, though
.alpha., .alpha.-trehalose can be produced by using amylases
derived from the other organisms, the yield in each case is lower
than that in the case using the novel enzyme of the present
invention.
EXAMPLE II-8
Production of .alpha., .alpha.-Trehalose from Amylose DP-17 in
Various Enzyme-Concentrations
[0452] Production of .alpha., .alpha.-trehalose utilizing the
synergism between enzymes was attempted by adding the enzymes
having concentrations listed in Table 21, respectively, to a
substrate (final concentration: 10%). Specifically, the enzymes
were the present purified enzyme obtained in Example II-2, and the
purified transferase derived from the Sulfolobus solfataricus
strain KM1; the substrate was Amylose DP-17 (manufactured by
Hayashibara Biochemical Co.); and the reaction was performed under
the conditions of 60.degree. C. at pH 5.5 for 100 hours,
approximately. After the non-reacted substrate was hydrolyzed with
glucoamylase, the reaction mixture was analyzed by the TSK-gel
Amide-80 HPLC analyzing method described in Example II-1 to examine
the yield of the produced .alpha., .alpha.-trehalose.
[0453] As to activity of the novel amylase of the present
invention, 1 Unit is defined as the enzymatic activity of
liberating 1 .mu.mol of .alpha., .alpha.-trehalose per hour from
maltotriosyltrehalose, similar to Example II-1.
[0454] As to activity of the purified transferase derived from the
Sulfolobus solfataricus strain KM1, 1 Unit is defined as the
enzymatic activity of producing 1 .mu.mol of glucosyltrehalose per
hour at pH 5.5 and 60.degree. C. from maltotriose assigned for the
substrate.
[0455] The results are shown un Table 21 below. TABLE-US-00021
TABLE 21 Yield of .alpha.,.alpha.-trehalose (%) Concentration of
amylase Concentration of transferase (units/ml) (units/ml) 0.1 1 5
10 20 1.5 11.9 46.8 52.1 48.4 40.4 15 25.6 77.9 79.7 81.8 77.4 150
10.7 62.1 76.9 83.4 81.9 200 2.8 47.9 73.2 76.1 79.2 700 1.2 17.0
49.1 61.8 68.4 2000 0.6 9.2 27.5 36.7 48.7
[0456] As is obvious from the results shown in the table, when
Amylose DP-17, which consists of a straight-chain constructed with
.alpha.-1,4-linkages, was used as the substrate, the yield of
.alpha., .alpha.-trehalose reached its maximum, i.e. 83.4%, in such
a case with 10 Units/ml of the transferase and 150 Units/ml of the
amylase.
EXAMPLE II-9
Production of .alpha., .alpha.-Trehalose in Various Concentrations
of Soluble Starch
[0457] Production of .alpha., .alpha.-trehalose utilizing the
synergism between enzymes was attempted by adding the enzymes
having concentrations listed in Table 22, respectively, to a
substrate, the final concentration of which would be adjusted at
5%, 10%, 20% or 30%. Specifically, the enzymes were the present
purified enzyme obtained in Example II-2, and the purified
transferase derived from the Sulfolobus solfataricus strain KM1;
the substrate was soluble starch; and the reaction was performed
under the conditions of 60.degree. C. at pH 5.5 for 100 hours,
approximately. During the reaction, from 0 hours to 96 hours after
the start, a treatment at 40.degree. C. for 1 hour with the
addition of pullulanase (a product derived from Klebsiella
pneumoniae, manufactured by Wako pure chemical Co.) so as to be 5
Units/ml was performed every 12 hours, namely, totaling 9 times
inclusive of the treatment at 0 hours.
[0458] After the non-reacted substrate was hydrolyzed with
glucoamylase, the reaction mixture was analyzed by the TSK-gel
Amide-80 HPLC analyzing method described in Example II-1 to examine
the yield of the produced .alpha., .alpha.-trehalose.
[0459] As to activity of the novel amylase of the present
invention, 1 Unit is defined as the enzymatic activity of
liberating 1 .mu.mol of .alpha., .alpha.-trehalose per hour from
maltotriosyltrehalose, similar to Example II-1.
[0460] As to activity of the purified transferase derived from the
Sulfolobus solfataricus strain KM1, 1 Unit is defined as the
enzymatic activity of producing 1 .mu.mol of glucosyltrehalose per
hour at pH 5.5 and 60.degree. C. from maltotriose assigned for the
substrate.
[0461] As to activity of pullulanase, 1 Unit is defined as the
enzymatic activity of producing 1 .mu.mol of maltotriose per minute
at pH 6.0 and 30.degree. C. from pullulan assigned for the
substrate.
[0462] The results are shown in Table 22 below. TABLE-US-00022
TABLE 22 Concentration Concentration Concentration Yield of of
soluble of transferase of amylase .alpha.,.alpha.-trehalose starch
(%) (units/ml) (units/ml) (%) 5 2 50 76.6 5 150 74.4 10 10 150 77.4
20 150 78.2 20 10 150 75.7 20 150 75.0 30 10 150 71.4 20 150
71.9
[0463] As is obvious from the results shown in the table, the yield
of .alpha., .alpha.-trehalose can be 70% or more even when the
concentration of soluble starch as a substrate was varied in a
range of 5-30%, provided that the concentrations of the amylase and
transferase are adjusted to the optimum conditions.
EXAMPLE II-10
Production of .alpha., .alpha.-Trehalose from Soluble Starch with
Various Pullulanase Treatments
[0464] Production of .alpha., .alpha.-trehalose utilizing the
synergism between enzymes was attempted as follows:
[0465] The enzymes were the present purified enzyme obtained in
Example II-2, and the purified transferase derived from the
Sulfolobus solfataricus strain KM1;
[0466] the substrate was soluble starch (final concentration:
10%);
[0467] the enzymes having concentrations listed in Table 23,
respectively, was added to the substrate; and
[0468] the reaction was performed under the conditions of
60.degree. C. at pH 5.5 for 120 hours, approximately. During the
reaction, one or more of pullulanase treatments were performed
under either of the following schedules: 1 time at 24 hours after
the start (a) (hereinafter, "after the start" will be omitted); 1
time at 48 hours (b); 1 time at 72 hours (c); 1 time at 96 hours
(d); every 24 hours from 24 hours to 96 hours, totaling 4 times
(e); every 12 hours from 0 hours to 96 hours, totaling 9 times
inclusive of the treatment at 0 hours (f); and every 3 hours in the
early stage of the reaction, i.e. from 0 hours to 12 hours,
totaling 5 times inclusive of the treatment at 0 hours, and in
addition, every 12 hours from 24 hours to 96 hours, totaling 7
times (g). Any of the pullulanase treatments were performed under
the conditions of 40.degree. C. for 1 hour after the addition of
pullulanase (a product derived from Klebsiella pneumoniae) so as to
be the concentrations shown in Table 23, respectively.
[0469] After the non-reacted substrate was hydrolyzed with
glucoamylase, the reaction mixture was analyzed by the TSK-gel
Amide-80 HPLC analyzing method described in Example II-1 to examine
the yield of the produced .alpha., .alpha.-trehalose.
[0470] As to activity of the novel amylase of the present
invention, 1 Unit is defined as the enzymatic activity of
liberating 1 .mu.mol of .alpha., .alpha.-trehalose per hour from
maltotriosyltrehalose, similar to Example II-1.
[0471] As to activity of the purified transferase derived from the
Sulfolobus solfataricus strain KM1, 1 Unit is defined as the
enzymatic activity of producing 1 .mu.mol of glucosyltrehalose per
hour at pH 5.5 and 60.degree. C. from maltotriose assigned for the
substrate.
[0472] As to activity of pullulanase, 1 Unit is defined as the
enzymatic activity of producing 1 .mu.mol of maltotriose per minute
at pH 6.0 and 30.degree. C. from pullulan assigned for the
substrate.
[0473] The results are shown in Table 23 below. TABLE-US-00023
TABLE 23 Yield of .alpha.,.alpha.-trehalose (%) Method of
Concentration Concentration Concentration of pullulanase
Pullulanase of amylase of transferase (units/ml) treatment
(units/ml) (units/ml) 0.1 1 2 5 10 25 (a) 150 10 48.0 59.7 62.9
67.6 71.7 (b) 150 10 49.4 60.0 62.2 66.0 71.0 (c) 150 10 49.6 59.7
63.2 66.4 70.0 (d) 150 10 49.2 59.3 62.9 67.0 70.0 (e) 150 10 57.8
69.9 72.6 74.1 (f) 150 10 74.0 76.6 77.4 67.6 150 20 74.4 74.0 78.2
67.0 (g) 150 10 75.7 76.5 80.9 61.9 150 20 75.9 77.9 77.0 71.5
[0474] As is obvious from the results shown in the table, the yield
can be improved by introducing a pullulanase treatment during the
reaction. Particularly, the yield of .alpha., .alpha.-trehalose can
be further improved by a method in which a plurality of pullulanase
treatments are carried out, or a method in which a plurality of
pullulanase treatments are carried out in the early stage of the
reaction. The yield of .alpha., .alpha.-trehalose reached its
maximum, i.e. 80.9%, under the conditions with 10 Units/ml of the
transferase, 150 Units/ml of the amylase, the pullulanase treatment
schedule (g), and 5 Units/ml of the pullulanase.
EXAMPLE II-1
Production of .alpha., .alpha.-Trehalose in Various Concentrations
of Amylose DP-17 and Various Reaction Temperatures
[0475] Production of .alpha., .alpha.-trehalose utilizing the
synergism between enzymes was attempted as follows:
[0476] The present purified enzyme obtained in Example II-2, and
the purified transferase derived from the Sulfolobus solfataricus
strain KM1 were added so as to be 320 Units/g-substrate and 20
Units/g-substrate, respectively;
[0477] the substrate was Amylose DP-17; and
[0478] the reaction was performed for 100 hours, approximately,
with the substrate concentration and reaction temperature shown in
Table 24 or 25.
[0479] After the non-reacted substrate was hydrolyzed with
glucoamylase, the reaction mixture was analyzed by the TSK-gel
Amide-80 HPLC analyzing method described in Example II-1 to examine
the yield of the produced .alpha., .alpha.-trehalose and the
reaction rate.
[0480] As to activity of the novel amylase of the present
invention, 1 Unit is defined as the enzymatic activity of
liberating 1 .mu.mol of .alpha., .alpha.-trehalose per hour from
maltotriosyltrehalose, similar to Example II-1.
[0481] As to activity of the purified transferase derived from the
Sulfolobus solfataricus strain KM1, 1 Unit is defined as the
enzymatic activity of producing 1 .mu.mol of glucosyltrehalose per
hour at pH 5.5 and 60.degree. C. from maltotriose assigned for the
substrate.
[0482] The results are shown in Tables 24 and 25 below.
[0483] Incidentally, as to the reaction rate shown in Table 24, 1
Unit is defined as the rate of liberating 1 .mu.mol of .alpha.,
.alpha.-trehalose per hour. TABLE-US-00024 TABLE 24 Reaction rate
(units/ml) Reaction Substrate concentration (%) temperature
(.degree. C.) 10 20 30 40 40 1.1 1.8 4.8 6.2 50 3.2 8.1 7.7 12.3 60
6.8 16.2 23.8 23.1 70 12.0 29.3 32.3 55.6 80 13.3 30.8 66.9
88.0
[0484] TABLE-US-00025 TABLE 25 Reaction yield (%) Reaction
Substrate concentration (%) temperature (.degree. C.) 10 20 30 40
40 42.7 50.3 42.6 28.8 50 71.0 70.2 64.6 35.2 60 74.6 72.5 66.2
65.8 70 75.1 75.0 65.4 70.7 80 69.3 68.2 68.4 70.9
[0485] As is obvious from the results shown in the tables, when the
reaction temperature is raised to a range of 40-80.degree., the
reaction rate increases depending on the temperature. Further, with
a high substrate concentration (30-40%), the substrate becomes
insoluble and the yield markedly decreases when the temperature is
low (40-50.degree. C.), while the substrate becomes soluble and the
yield can remain high when the temperature is high. The yield
reached to 75.1%.
[0486] From the results of this example, it can be understood that
a preparation at a high temperature in a high concentration will be
possible by using the highly thermostable amylase of the present
invention, and therefore, a process for producing .alpha.,
.alpha.-trehalose advantageous in view of cost and easy handling
can be provided.
EXAMPLE II-12
Production of .alpha., .alpha.-Trehalose Using Thermostable
Pullulanase in Various Concentrations of Soluble Starch and Various
Reaction Temperatures
[0487] Production of .alpha., .alpha.-trehalose utilizing the
synergism between enzymes was attempted as follows:
[0488] The present purified enzyme obtained in Example II-2, the
purified transferase derived from the Sulfolobus solfataricus
strain KM1, and a commercially available thermostable pullulanase
were added so as to be 1280 Units/g-substrate, 80 Units/g-substrate
and 32 Units/g-substrate, respectively, wherein the pullulanase
(Debranching Enzyme Amano, a product derived from Bacillus sp.
manufactured by Amano Pharmaceutical Co.) had been subjected to
TOSHO TSK-gel Phenyl-TOYOPEARL 650S hydrophobic chromatography to
remove coexisting glucoamylase activity and .alpha.-amylase
activity;
[0489] the substrate was soluble starch; and
[0490] hours, approximately, with the substrate concentration and
reaction temperature shown in Table 26 or 27.
[0491] After the non-reacted substrate was hydrolyzed with
glucoamylase, the reaction mixture was analyzed by the TSK-gel
Amide-80 HPLC analyzing method described in Example II-1 to examine
the yield of the produced .alpha., .alpha.-trehalose and the
reaction rate.
[0492] As to activity of the novel amylase of the present
invention, 1 Unit is defined as the enzymatic activity of
liberating 1 .mu.mol of .alpha., .alpha.-trehalose per hour from
maltotriosyltrehalose, similar to Example II-1.
[0493] As to activity of the purified transferase derived from the
Sulfolobus solfataricus strain KM1, 1 Unit is defined as the
enzymatic activity of producing 1 .mu.mol of glucosyltrehalose per
hour at pH 5.5 and 60.degree. C. from maltotriose assigned for the
substrate.
[0494] As to activity of pullulanase, 1 Unit is defined as the
enzymatic activity of producing 1 .mu.mol of maltotriose per minute
at pH 5.5 and 60.degree. C. from pullulan assigned for the
substrate.
[0495] The results are shown in Tables 26 and 27 below.
[0496] Incidentally, as to the reaction rate shown in Table 26, 1
Unit is defined as the rate of liberating 1 .mu.mol of .alpha.,
.alpha.-trehalose per hour. TABLE-US-00026 TABLE 26 Reaction rate
(units/ml) Substrate Reaction concentration (%) temperature
(.degree. C.) 10 20 30 40 15.8 22.8 22.2 50 26.0 50.8 57.5 60 36.5
58.4 96.4
[0497] TABLE-US-00027 TABLE 27 Reaction yield (%) Substrate
Reaction concentration (%) temperature (.degree. C.) 10 20 30 40
53.1 8.9 6.2 50 70.9 56.1 58.6 60 74.1 72.6 71.7
[0498] Incidentally, when the reaction was performed with a
substrate concentration of 10% and a reaction temperature of
60.degree. C. under the same conditions as above except that the
thermostable pullulanase was not added, the yield was 35.0%.
[0499] From the result shown in the tables, it was found that only
one addition of the thermostable pullulanase during the reaction
brings about a yield-improving effect, and that the reaction rate
increases depending on the temperature when the reaction
temperature is raised to a range of 40-60.degree. C. Further, with
a high substrate concentration (20-30%), the substrate becomes
insoluble and the yield markedly decreases when the temperature is
low (40-50.degree. C.), while the substrate becomes soluble and the
yield can remain high when the temperature is high (60.degree. C.).
The yield reached to 74.1%.
EXAMPLE II-13
Production of .alpha., .alpha.-Trehalose from Soluble Starch with
Isoamylase Treatments
[0500] Production of .alpha., .alpha.-trehalose utilizing the
synergism between enzymes was attempted as follows:
[0501] The present purified enzyme obtained in Example II-2, and
the purified transferase derived from the Sulfolobus solfataricus
strain KM1 were added so as to be 1,280 Units/g-substrate and 80
Units/g-substrate, respectively;
[0502] the substrate was soluble starch (final concentration: 10%);
and
[0503] the reaction was performed at 60.degree. C. pH 5.0 for 100
hours, approximately. During the reaction, an isoamylase treatment
was performed every 3 hours in the early stage of the reaction,
i.e. from 0 hours to 12 hours after the start (hereinafter, "after
the start" is omitted), totaling 5 times inclusive of the treatment
at 0 hours, and in addition, every 24 hours from 24 hours to 96
hours, totaling 3 times. Each isoamylase treatment was performed
under the conditions of 40.degree. C. for 1 hour after the addition
of isoamylase (a product derived from Pseudomonas amyloderamosa,
manufactured by Seikagaku Kougyou Co.) so as to be the
concentration shown in Table 28.
[0504] After the non-reacted substrate was hydrolyzed with
glucoamylase, the reaction mixture was analyzed by the TSK-gel
Amide-80 HPLC analyzing method described in Example II-1 to examine
the yield of the produced .alpha., .alpha.-trehalose.
[0505] As to activity of the novel amylase of the present
invention, 1 Unit is defined as the enzymatic activity of
liberating 1 .mu.mol of .alpha., .alpha.-trehalose per hour from
maltotriosyltrehalose, similar to Example II-1.
[0506] As to activity of the purified transferase derived from the
Sulfolobus solfataricus strain KM1, 1 Unit is defined as the
enzymatic activity of producing 1 .mu.mol of glucosyltrehalose per
hour at pH 5.5 and 60.degree. C. from maltotriose assigned for the
substrate.
[0507] The activity of isoamylase was measured as follows: A half
milliliter of 1% soluble starch derived from glutinous rice was
mixed with 0.1 ml of a 0.5 M acetic acid buffer solution (pH 3.5)
and 0.1 ml of an enzyme solution, and subjected to reaction at
40.degree. C.; the absorptivity at 610 nm corresponding to the
violet color of the amylose-iodine complex is measured with a
cuvette having a width of 1 cm ["Denpun-Kanren Toushitsu Kouso
Jikken-hou" ("Experimental methods in enzymes for starch and
relating saccharides"), written by Michinori Nakamura and Keiji
Kainuma, published by Gakkai-Shuppan-Sentah, 1989]; and 1 Unit is
defined as the amount of the enzyme with which the absorptivity
increases by 0.1 per hour.
[0508] The results are shown in Table 28 below. TABLE-US-00028
TABLE 28 Concentration of Reaction yield isoamylase (units/ml) (%)
0 35.0 500 75.7 1000 73.7 2000 71.0
[0509] As is obvious from the results shown in the tables, the
yield can be improved by introducing isoamylase treatments during
the reaction, similar to pullulanase (a product derived from
Klebsiella pneumoniae). The yield of .alpha., .alpha.-trehalose
reached to 75.7%.
EXAMPLE II-14
Production of .alpha., .alpha.-Trehalose from Soluble Starch with a
Treatment Using a Debranching Enzyme Derived from the Sulfolobus
solfataricus Strain KM1
[0510] Production of .alpha., .alpha.-trehalose utilizing the
synergism between enzymes was attempted as follows:
[0511]
[0512] The present purified enzyme obtained in Example II-2,
purified transferase derived from the Sulfolobus solfataricus
strain KM1, and a debranching enzyme derived from the Sulfolobus
solfataricus strain KM1 (the enzyme isolated and purified from the
cell extract according to the method in Referential Example II-3)
were added so as to be 1,280 Units/g-substrate, 80
Units/g-substrate, and the concentration shown in the
below-described table, respectively;
[0513] the substrate was soluble starch (final concentration: 10%);
and
[0514] the reaction was performed at 60.degree. C. and pH 5.0 for
100 hours, approximately.
[0515] After the non-reacted substrate was hydrolyzed with
glucoamylase, the reaction mixture was analyzed by the TSK-gel
Amide-80 HPLC analyzing method described in Example II-1 to examine
the yield of the produced .alpha., .alpha.-trehalose.
[0516] As to activity of the novel amylase of the present
invention, 1 Unit is defined as the enzymatic activity of
liberating 1 .mu.mol of .alpha., .alpha.-trehalose per hour from
maltotriosyltrehalose, similar to Example II-1.
[0517] As to activity of the purified transferase derived from the
Sulfolobus solfataricus strain KM1, 1 Unit is defined as the
enzymatic activity of producing. 1 .mu.mol of glucosyltrehalose per
hour at pH 5.5 and 60.degree. C. from maltotriose assigned for the
substrate.
[0518] The activity of the debranching enzyme derived from the
Sulfolobus solfataricus strain KM1 was measured as follows: A half
milliliter of 1% soluble starch derived from glutinous rice was
mixed with 0.1 ml of a 0.5 M acetic acid buffer solution (pH 5.0)
and 0.1 ml of an enzyme solution, and subjected to reaction at
60.degree. C.; the absorptivity at 610 nm corresponding to the
violet color of the amylose-iodine complex is measured with a
cuvette having a width of 1 cm; and 1 Unit is defined as the amount
of the enzyme with which the absorptivity increases by 0.1 per
hour.
[0519] The results are shown in Table 29 below. TABLE-US-00029
TABLE 29 Concentration of debranching enzyme Reaction yield
(units/ml) (%) 0 35.0 3 69.8 6 69.5 12 68.0 24 67.8
[0520] As is obvious from the results shown in the tables, the
yield can be improved by only one addition of the debranching
enzyme derived from the Sulfolobus solfataricus strain KM1 during
the reaction, similar to pullulanase (Debranching Enzyme Amano, a
product derived from Bacillus sp.). The yield of .alpha.,
.alpha.-trehalose reached to 69.8%.
REFERENTIAL EXAMPLE II-1
Production of Transferred Oligosaccharide by Transferase in Various
Concentrations of Amylose DP-17 and Various Reaction
Temperatures
[0521] Using Amylose DP-17 as a substrate, the corresponding
trehaloseoligosaccharide, of which the glucose residue at the
reducing end side is .alpha.-1, .alpha.-1-linked, was produced by
adding the purified transferase derived from the Sulfolobus
solfataricus strain KM1 so as to be 20 Units/g-substrate, and by
performing the reaction in the substrate concentration and reaction
temperature shown in Table 30 or 31 for 100 hours,
approximately.
[0522] As to the corresponding trehaloseoligosaccharide, of which
the glucose residue at the reducing end is .alpha.-1,
.alpha.-1-linked, the yield and the reaction rate were estimated
from the decrement in the amount of reducing ends which was
measured by the dinitrosalicylate method ["Denpun-Kanren Toushitsu
Kouso Jikken-hou" ("Experimental methods in enzymes for starch and
relating saccharides"), written by Michinbri Nakamura and Keiji
Kainuma, published by Gakkai-Shuppan-Sentah, 1989].
[0523] As to activity of the purified transferase derived from the
Sulfolobus solfataricus strain KM1, 1 Unit is defined as the
enzymatic activity of producing 1 .mu.mol of glucosyltrehalose per
hour at pH 5.5 and 60.degree. C. from maltotriose assigned for the
substrate.
[0524] The results are shown in Tables 30 and 31 below.
[0525] Incidentally, as to the reaction rate shown in Table 30, 1
Unit is defined as the rate of liberating 1 .mu.mol of .alpha.,
.alpha.-trehalose per hour. TABLE-US-00030 TABLE 30 Reaction rate
(units/ml) Substrate Reaction concentration (%) temperature
(.degree. C.) 10 20 30 40 40 0.8 2.9 3.5 4.3 50 3.0 5.5 8.6 8.1 60
1.7 6.5 10.3 16.7 70 4.0 7.0 12.0 19.8 80 3.6 9.4 15.8 20.4
[0526] TABLE-US-00031 TABLE 31 Reaction yield (%) Reaction
Substrate concentration (%) temperature (.degree. C.) 10 20 30 40
40 70.7 74.5 63.4 37.6 50 76.0 72.8 70.5 46.7 60 71.6 75.1 75.3
55.1 70 71.6 70.4 76.6 72.6 80 65.6 64.8 72.7 72.5
[0527] From the result shown in the tables, it was found that the
reaction rate increases depending on the temperature when the
reaction temperature is raised to a range of 40-80.degree. C.
Further, with a high substrate concentration (especially 40%), the
substrate becomes insoluble and the yield markedly decreases when
the temperature is low (40-50.degree. C., while the substrate
becomes soluble and the yield can remain high when the temperature
is high. The yield reached to 76.6%.
REFERENTIAL EXAMPLE II-2
Measuring Solubility of Amylose DP-17 in Water
[0528] Solubility of Amylose DP-17 was measured as follows: By heat
dissolution, 5, 10, 20, 30 and 40% Amylose DP-17 solutions were
prepared, and kept in thermostat baths adjusted at 35, 40, 50, 70
and 80.degree. C., respectively; time-lapse sampling was performed
and the insoluble matters generated in the samples were filtered;
each of the supernatants thus obtained was examined for the
concentration of Amylose DP-17; and the solubility at each
temperature was determined according to the saturation point where
the concentration had been reached to equilibrium.
[0529] The results are shown in Table 32 below. TABLE-US-00032
TABLE 32 Temperature Solubility (.degree. C.) (%(w/vol)) 35 11.3 40
13.0 50 18.9 60 27.6 70 32.3 80 35.3
REFERENTIAL EXAMPLE II-3
Purification of the Debranching Enzyme Derived from the Sulfolobus
solfataricus Strain KM1
[0530] The Sulfolobus solfataricus strain KM1 was cultivated at
75.degree. C. for 3 days in the culture medium which is identified
as No. 1304 in Catalogue of Bacteria and Phages 18th edition (1992)
published by American Type Culture Collection (ATCC), and which
contained 2 g/liter of soluble starch and 2 g/liter of yeast
extract. The cultivated bacteria was collected by centrifugation
and stored at -80.degree. C. The yield of the bacterial cell was
3.3 g/liter.
[0531] Eighty two grams of the bacterial cells obtained above were
suspended in 400 ml of a 50 mM sodium acetate buffer solution (pH
5.5) containing 5 mM of EDTA, and subjected to ultrasonic treatment
for bacteriolysis at 0.degree. C. for 15 min. The resultant was
then centrifuged to obtain a supernatant.
[0532] To this supernatant, ammonium sulfate was added so as to be
1 M. The resultant was then subjected to hydrophobic chromatography
using TOSOH TSK-gel Phenyl-TOYOPEARL 650S column (volume: 800 ml)
equilibrated with a 50 mM sodium acetate buffer solution (pH 5.5)
containing 1 M of sodium sulfate and 5 mM of EDTA. The column was
then washed with the same buffer solution, and the debranching
enzyme was recovered in the fraction passing through the column.
Since amylase, transferase and glucoamylase contained in the
supernatant were retained and adsorbed in the packed material of
the column, Phenyl-TOYOPEARL 650S, the objective debranching enzyme
could be separated therefrom. The fraction exhibiting the activity
was concentrated using an ultrafiltration membrane (critical
molecular weight: 13,000), and subsequently, washed and desalted
with a 10 mM Tris-HCl buffer solution (pH 7.5).
[0533] Next, the resultant was subjected to ion-exchange
chromatography using the TOSOH TSK-gel DEAE-TOYOPEARL 650S column
(volume: 300 ml) equilibrated with the same buffer solution. The
column was then washed with the same buffer solution, and the
objective debranching enzyme was then eluted with 900 ml of sodium
chloride solution at a linear concentration gradient from 0 M to
0.3 M. The fractions exhibiting the activity were concentrated
using an ultrafiltration membrane (critical molecular weight:
13,000), and subsequently, washed and desalted with a 50 mM sodium
acetate buffer solution (pH 5.5) containing 0.15 M of sodium
chloride and 5 mM of EDTA.
[0534] Subsequent to that, the desalted and concentrated solution
thus obtained was subjected to gel filtration chromatography using
the Pharmacia HiLoad 16/60 Superdex 200 pg column, and the
objective debranching enzyme was eluted with the same buffer
solution. The fractions exhibiting the activity were concentrated
using an ultrafiltration membrane (critical molecular weight:
13,000), and subsequently, washed and desalted with a 25 mM
bis-Tris-iminodiacetic acid buffer solution (pH 7.1).
[0535] Next, the desalted and concentrated solution thus obtained
was subjected to a chromatofocusing using the Pharmacia Mono P
HR5/20 column equilibrated with the same buffer solution. The
objective debranching enzyme was then eluted with 10% Polybuffer 74
(manufactured by Pharmacia, and adjusted at pH 4.0 with
iminodiacetic acid). The fractions exhibiting the activity were
concentrated using an ultrafiltration membrane (critical molecular
weight: 13,000), and subsequently, washed and desalted with a 10 mM
Tris-HCl buffer solution (pH 7.5).
[0536] Further, the desalted and concentrated solution thus
obtained was subjected to ion-exchange chromatography using the
TOSOH TSK-gel DATE 5PW HPLC column equilibrated with the same
buffer solution. The column was then washed with the same buffer
solution, and the objective debranching enzyme was then eluted with
30 ml of sodium chloride solution at a linear concentration
gradient from 0 M to 0.3 M. The fractions exhibiting the activity
were concentrated using an ultrafiltration membrane (critical
molecular weight: 13,000) to obtain the partially purified product
(liquid product) of the objective debranching enzyme.
[0537] Incidentally, in this purification procedure, detection of
the objective debranching enzyme was performed by mixing the sample
solution with 2 Units/ml of the purified amylase and 32 Units/ml of
the purified transferase derived from the Sulfolobus solfataricus
strain KM1, and by putting the mixture into a reaction at
60.degree. C. and pH 5.5, wherein the index was the activity of
achieving a higher yield of .alpha., .alpha.-trehalose in
comparison with the reaction without the sample solution.
[0538] The activity of the partially purified debranching enzyme,
obtained by the above-described purification process and derived
from the Sulfolobus solfataricus strain KM1, was measured as
follows: A half milliliter of 1% soluble starch derived from
glutinous rice was mixed with 0.1 ml of a 0.5 M acetic acid buffer
solution (pH 5.0) and 0.1 ml of an enzyme solution, and subjected
to reaction at 60.degree. C.; the absorptivity at 610 nm
corresponding to the violet color of the amylose-iodine complex is
measured with a cuvette having a width of 1 cm; and 1 Unit is
defined as the amount of the enzyme with which the absorptivity
increases by 0.1 per hour.
[0539] The specific activity of the partially purified debranching
enzyme obtained by the above purification procedure was found to be
495 Units/mg.
REFERENTIAL EXAMPLE II-4
Examination of the Debranching Enzyme Derived from the Sulfolobus
solfataricus strain KM1 for Various Characteristics
[0540] The partially purified debranching enzyme obtained in
Referential. Example II-3 was examined for enzymatic
characteristics.
[0541] (1) Action and Substrate Specificity
[0542] The reactivity and action on each substrate were examined
using each the substrate and activity-measuring methods shown in
Table 33 below.
[0543] The dinitrosalicylate method ["Denpun-Kanren Toushitsu Kouso
Jikken-hou" ("Experimental methods in enzymes for starch and
relating saccharides"), written by Michinori Nakamura and Keiji
Kainuma, published by Gakkai-Shuppan-Sentah, 1989] is a method for
quantifying the increased amount of reducing ends generated by
hydrolysis of .alpha.-1,6 linkages.
[0544] The iodine-coloring method is carried out in the same way as
described in Referential Example II-3. Specifically, this is the
method for quantifying the increased amount of straight-chain
amylose generated by hydrolysis of .alpha.-1,6 linkages on the
basis of increased absorptivity at 610 nm corresponding to the
violet color of the amylose-iodine complex.
[0545] Analysis of the hydrolyzed products by liquid chromatography
(HPLC method) was performed for examination of the produced
oligosaccharides by employing the Bio-Rad AMINEX HPX-42A HPLC
analyzing method described in Example II-1. TABLE-US-00033 TABLE 33
Method of enzyme assay Dinitrosalicylate Iodine-coloring HPLC
Substrate method method method Pullulan +++ - Maltotriose Soluble
starch + + - Amylopectin + + - Glutinous rice + + - starch
[0546] As is obvious from the above results, the present
debranching enzyme can 1) generate reducing ends in pullulan and
various kinds of starch; 2) increase the coloring degree in the
iodo-starch reaction; 3) produce maltotriose from pullulan; and
further, 4) as shown in Example II-14, markedly increase the yield
of .alpha., .alpha.-trehalose from soluble starch used as a
substrate when the present debranching enzyme is put into the
reaction with the purified amylase and transferase derived from the
Sulfolobus solfataricus strain KM1, as compared with the reaction
without the addition of the present debranching enzyme. As a
consequence of these facts, the present enzyme is recognized as
hydrolyzing .alpha.-1,6 linkages in starch or pullulan.
[0547] (2) Stability
[0548] The stability of the obtained partially purified enzyme when
treated at various temperatures for 3 hours is shown in Table 34.
TABLE-US-00034 TABLE 34 Temperature Residual activity (.degree. C.)
(%) 50 109.1 60 73.3 65 6.1 70 0
[0549] The present enzyme treated at 60.degree. C. for 3 hours
still retains 73.3% of the initial activity.
[0550] (3) Reactivity
[0551] As to the obtained partially purified enzyme, reactivity at
various temperatures and reactivity at various pH values are shown
in Tables 35 and 36, respectively. In the measurement of enzymatic
activity, a glycine-HCl buffer solution was used in a pH range of
3-5, and similarly, a sodium acetate buffer solution in a pH range
of 4-5.5, and a sodium phosphate buffer solution in a pH range of
5-7.5, respectively, were also used. TABLE-US-00035 TABLE 35
Relative enzyme Reaction pH activity (%) 2.7 1.8 3.1 21.7 3.7 33.1
4.1 74.0 5.1 100.0 5.5 53.7 5.6 37.5 6.0 22.2 6.9 16.1 7.4 11.5 7.7
10.2
[0552] TABLE-US-00036 TABLE 36 Reaction temperature Relative enzyme
(.degree. C.) activity (%) 40 53.8 50 87.0 60 97.6 65 100.0 70
51.4
[0553] The optimum reaction temperature of the present of the
present enzyme is within 60-65.degree. C., approximately, and the
optimum reaction pH of the present enzyme is within 4.0-5.5,
approximately.
[0554] (4) Isoelectric Point
[0555] The isoelectric point was found to be pH 4.4 from the result
of pH measurement performed on the debranching enzyme fraction
isolated by chromatofocusing.
[0556] (5) Influence of Various Activators and Inhibitors
[0557] The influence of each substance listed in Table 37, such as
an activating effect or an inhibitory effect, was evaluated by
adding the substance together with the substrate, and by measuring
the activity in the same manner as that in Referential Example
II-3. As a result, copper ion was found to have inhibitory effects.
Though many glucide-relating enzymes have been found to be
activated with calcium ion, the present enzyme would not be
activated with calcium ion. TABLE-US-00037 TABLE 37 Concentration
Residual activity Activator/Inhibitor (mM) (%) Control (not added)
5 100.0 CaCl.sub.2 5 105.7 MgCl.sub.2 5 82.9 MnCl.sub.2 5 91.2
CuSO.sub.4 5 0.0 CoCl.sub.2 5 87.2 FeSO.sub.4 5 74.1 FeCl.sub.3 5
39.0 2-Mercaptoethanol 5 104.1 Dithiothreitol 5 106.0
EXAMPLE I-9
Determination of the Partial Amino Acid Sequences of the Novel
Transferase Derived from the Sulfolobus solfataricus Strain KM1
[0558] The partial amino acid sequences of the purified enzyme
obtained in Example I-2 were determined by the method disclosed in
Iwamatsu, et al. [Seikagaku (Biochemistry) 63, 139 (1991)].
Specifically, the purified novel transferase was suspended in a
buffer solution for electrophoresis [10% glycerol, 2.5% SDS, 2%
2-mercaptoethanol, 62 mM Tris-HCl buffer solution (pH 6.8)], and
subjected to SDS-polyacrylamide gel electrophoresis. After the
electrophoresis, the enzyme was transferred from the gel to a
polyvinylidene diflorido (PVDF) membrane (ProBlot, manufactured by
Applied Biosystems Co.) by electroblotting (SartoBlot type IIs,
manufactured by Sartorius Co.) with 160 mA for 1 hour.
[0559] After the transfer, the portion to which the enzyme had been
transferred was cut out from the membrane, and soaked in about 300
.mu.l of a buffer solution for reduction [6 M guanidine-HCl, 0.5 M
Tris-HCl buffer solution (pH 3.5) containing 0.3% of EDTA and 2% of
acetonitrile]. One milligram of dithiothreitol was added to this,
and reduction was carried out under an argon atmosphere at
60.degree. C. for 1 hour, approximately. To the resultant, 2.4 mg
of monoiodoacetic acid dissolved in 10 .mu.l of 0.5 N sodium
hydroxide was added and stirred for 20 min. in the dark. The PVDF
membrane was then taken out and washed sufficiently with a 2%
acetonitrile solution, and subsequently, stirred in a 0.1% SDS
solution for 5 min. After being briefly washed with water, the PVDF
membrane was then soaked in 0.5% Polyvinylpyrrolidone-40 dissolved
in 100 mM acetic acid, and was left standing for 30 min. Next, the
PVDF membrane was briefly washed with water and cut into pieces of
1 square mm, approximately. These pieces were then soaked in a
buffer solution for digestion [8% acetonitrile, 90 mM Tris-HCl
buffer solution (pH 9.0)], and after the addition of 1 pmol of the
Achromobacter Protease I (manufactured by Wako pure chemical Co.),
digested at room temperature for 15 hours. The digested products
were separated by reversed phase chromatography using a C8 column
(P-Bondashere 5C8, 300A, 2.1.times.150 mm, manufactured by
Millipore Ltd. Japan) to obtain a dozen or more kinds of peptide
fragments. Using A solvent (0.05% trifluoroacetic acid) and B
solvent (2-propanol:acetonitrile=7:3, containing 0.02% of
trifluoroacetic acid) as elution solvents, the peptides were eluted
with a linear concentration gradient from 2 to 50% relative to B
solution and at a flow rate of 0.25 ml/min. for 40 min. As to the
peptide fragments thus obtained, the amino acid sequences were
determined by the automatic Edman degradation method using a
gas-phase peptide sequencer (Model 470 type, manufactured by
Applied Biosystems Co.).
[0560] Further, the peptide fragments digested with the
Achromobacter Protease I were subjected to second digestion with
Asp-N, and the resultant peptide fragments were isolated under the
same conditions as above to determine their amino acid
sequences.
[0561] From the results, the partial amino acid sequences were
found to be as follows. TABLE-US-00038 Peptide Fragments Digested
with Digested with Achromobacter Protease AP-1: Val Ile Arg Glu Ala
Lys (Sequence No. 9) AP-2: Ile Ser Ile Arg Gln Lys (Sequence No.
10) AP-3: Ile Ile Tyr Val Glu (Sequence No. 11) AP-4: Met Leu Tyr
Val Lys (Sequence No. 12) AP-5: Ile Leu Ser Ile Asn Glu (Sequence
No. 13) Lys AP-6: Val Val Ile Leu Thr Glu (Sequence No. 14) Lys
AP-7: Asn Leu Glu Leu Ser Asp (Sequence No. 15) Pro Arg Val Lys
AP-8: Met Ile Ile Gly Thr Tyr (Sequence No. 16) Arg Leu Gln Leu Asn
Lys AP-9: Val Ala Val Leu Phe Ser (Sequence No. 17) Pro Ile Val
AP-10: Ile Asn Ile Asp Glu Leu (Sequence No. 18) Ile Ile Gln Ser
Lys AP-11: Glu Leu Gly Val Ser His (Sequence No. 19) Leu Tyr Leu
Ser Pro Ile Peptide Fragments Digested with Asp-N DN-1: Asp Glu Val
Phe Arg Glu (Sequence No. 20) Ser DN-2: Asp Tyr Phe Lys (Sequence
No. 21) DN-3: Asp Gly Leu Tyr Asn Pro (Sequence No. 22) Lys DN-4:
Asp Ile Asn Gly Ile Arg (Sequence No. 23) Glu Cys DN-5: Asp Phe Glu
Asn Phe Glu (Sequence No. 24) Lys DN-6: Asp Leu Leu Arg Pro Asn
(Sequence No. 25) Ile DN-7: Asp Ile Ile Glu Asn (Sequence No. 26)
DN-8: Asp Asn Ile Glu Tyr Arg (Sequence No. 27) Gly
EXAMPLE I-10
Preparation of Chromosome DNA of the Sulfolobus solfataricus Strain
KM1
[0562] Bacterial cells of the Sulfolobus solfataricus strain KM1
were obtained according to the process described in Example
I-2.
[0563] To 1 g of the bacterial cells, 10 ml of a 50 mM Tris-HCl
buffer solution (pH 8.0) containing 25% of sucrose, 1 mg/ml of
lysozyme, 1 mM of EDTA, and 150 mM of NaCl was added for making a
suspension, and the suspension was left standing for 30 min. To
this suspension, 0.5 ml of 10% SDS and 0.2 ml of 10 mg/ml
Proteinase K (manufactured by Wako pure chemical Co.) were added,
and the mixture was left standing at 50.degree. C. for 2 hours.
Next, the mixture was subjected to extraction with a
phenol/chloroform solution. The resultant aqueous phase was then
separated and precipitated with ethanol. The precipitated DNA was
twisted around a sterilized glass stick and vacuum-dried after
being washed with a 70% ethanol solution. As the final product, 1.5
mg of the chromosome DNA was obtained.
EXAMPLE I-11
Preparation of DNA Probes Based on the Partial Amino Acid Sequences
and Evaluation of the Probes by PCR Method
[0564] According to information about the partial amino acid
sequences of the novel transferase derived from the Sulfolobus
solfataricus strain KM1, which is determined in Example I-9,
oligonucleotide DNA primers are prepared by using a DNA synthesizer
(Model 381 manufactured by Applied Biosystems Co.). Their sequence
were as follows. [0565] DN-1 [0566] Amino Acid Sequence [0567] N
terminus AspGluPheArgGluSer C terminus [0568] DNA Primer 5'
TTCACGAAAAACCTCATC 3' (Sequence No. 28) [0569] Base Sequence C T TG
T T [0570] DN-8 [0571] Amino Acid Sequence [0572] N terminus
AspAsnIleGluTyrArgGly C terminus [0573] DNA Primer 5'
GATAACATAGAATACAGAGG 3' (Sequence No. 29) [0574] Base Sequence T T
G T G
[0575] PCR was performed using 100 .mu.mol of each primer and 100
ng of the chromosome DNA prepared in Example I-10 and derived from
the Sulfolobus solfataricus strain KM1. The PCR apparatus used
herein was the GeneAmp PCR system Model 9600, manufactured by
Perkin Elmer Co. In the reaction, 30 cycles of steps were carried
out with 100 .mu.l of the total reaction mixture, wherein the 1
cycle was composed of steps at 94.degree. C. for 30 sec., at
50.degree. C. for 1 min., and at 72.degree. C. for 2 min.
[0576] Ten microliters of the resultant reaction mixture was
analyzed by 1% agarose electrophoresis. As a result, it was found
that a DNA fragment having a length of-about 1.2 kb was
specifically amplified.
[0577] The product obtained by the above PCR were blunt-ended, and
subcloned into pUC118 at the Hinc II site. The DNA sequence of the
insertional fragment in this plasmid was determined using a DNA
sequencer, GENESCAN Model 373A manufactured by Applied Biosystems
Co. As a result, the DNA sequence was found to correspond to the
amino acid sequence obtained in Example I-9.
EXAMPLE I-12
Cloning of a Gene Coding for the Novel Transferase Derived from the
Sulfolobus solfataricus Strain KM1
[0578] One hundred micrograms of the chromosome DNA of the
Sulfolobus solfataricus strain KM1, prepared in Example I-10, was
partially digested with a restriction enzyme, Sau 3AI. The reaction
mixture was ultracentrifuged with a density gradient of sucrose to
isolate and purify DNA fragments of 5-10 kb. Then, using T4 DNA
ligase, the above chromosome DNA fragments having lengths of 5-10
kb and derived from the Sulfolobus solfataricus strain KM1 were
ligated with a modified vector which had been prepared from a
plasmid vector, pUC118, by digestion with Bam HI and by
dephosphorylation of the ends with alkaline phosphatase. Next,
cells of the E. coli strain JM109 were transformed with a mixture
containing the modified pUC118 plasmid vectors in which any of the
fragments had been inserted. These cells were cultivated on LB agar
plates containing 50 .mu.g/ml of ampicillin to grow their colonies
and make a DNA library.
[0579] As to this DNA library, screening of the, recombinant
plasmids containing a gene coding for the novel transferase was
performed employing a PCR method as follows.
[0580] At first, the colonies were scraped and suspended in a TE
buffer solution. The suspension was then treated at 100.degree. C.
for 5 min. to crush the bacterial bodies and subjected to PCR in
the same manner as described in Example I-11.
[0581] Next, 10 .mu.l of the reaction mixture obtained in PCR was
analyzed by 1% agarose electrophoresis, and the clones from which a
DNA fragment having a length of about 1.2 kb can be amplified were
assumed to be positive.
[0582] As a result, one positive clone was obtained from 600 of the
transformants. According to analysis of the plasmid extracted from
the clone, it had an insertional fragment of about 8 kb. This
plasmid was named as pKT1.
[0583] Further, the insertional fragment was shortened by
subjecting it to partial digestion with Sau 3AI and PCR in the same
manner as above. As a result, such transformants as containing
plasmids which have insertional fragments of about 3.8 kb and about
4.5 kb were obtained. These plasmids were named as pKT21 and pKT11,
respectively.
[0584] The restriction maps of insertional fragments of these
plasmids are shown in FIG. 26.
[0585] Incidentally, all the restriction enzymes used in the above
examples were commercially available (purchased from Takara Shuzou
Co.).
EXAMPLE I-13
Determination of the Gene Coding for the Novel Transferase Derived
from the Sulfolobus solfataricus Strain KM1
[0586] The base sequence of the partial DNA which is common both in
the insertional fragments, the plasmids pKT11 and pKT21 obtained in
Example I-12, was determined.
[0587] At first, deletion plasmids were prepared from these plasmid
DNAs by using a deletion kit for kilo-sequencing which was
manufactured by Takara Shuzou Co. After that, the DNA sequences of
the insertional fragments in these plasmids were determined by
using a sequenase dye primer sequencing kit, PRISM, a terminator
cycle sequencing kit, Tag Dye Deoxy.TM., both manufactured by
Perkin Elmer Japan Co., and a DNA sequencer, GENESCAN Model 373A,
manufactured by Applied Biosystems Co.
[0588] Among the common sequence, the base sequence from the Sph I
site to an end of pKT21 (from A to B in FIG. 26), and the amino
sequence anticipated therefrom are shown in Sequences No. 1 and No.
2, respectively.
[0589] Sequences corresponding to any of the partial amino acid
sequences obtained in Example I-9, respectively, were recognized in
the above amino acid sequence. This amino acid sequence was assumed
to have 728 amino acid residues and code for a protein, the
molecular weight of which estimated as 82 kDa. This molecular
weight value almost equals the value obtained by SDS-PAGE analysis
of the purified novel transferase derived from the Sulfolobus
solfataricus strain KM1.
EXAMPLE I-14
Production of the Novel Transferase in a Transformant
[0590] A plasmid named as pKT22 was obtained by restricting pKT21,
which was obtained in Example I-12, with Sph I and Xba I, and by
ligating the resultant with pUC119 (manufactured by Takara Shuzou
Co.) which had been restricted with the same restriction
enzymes(the methods are shown in FIG. 27). Except for the
multi-cloning site, the base sequence of the fragment which was
inserted into pKT22 and contains the novel transferase gene equaled
the sequence from the 1st base to the 2578th base of Sequence No.
1.
[0591] The activity of the novel transferase in the transformant
containing this plasmid was examined as follows. At first, the
transformant was cultivated overnight in a LB broth containing 100
.mu.g/ml of ampicillin at 37.degree. C. The cells were collected by
centrifugation and stored at -80.degree. C. The yield of bacterial
cells was 10 g/liter.
[0592] Ten grams of the bacterial cells obtained above were then
suspended in 40 ml of a 50 mM sodium acetate buffer solution (pH
5.5) containing 5 mM of EDTA, subjected to bacteriolysis with an
ultrasonic crushing-treatment at 0.degree. C. for 3 min., and
further, centrifuged to obtain a supernatant. This supernatant was
heat-treated at 75.degree. C. for 30 min., further centrifuged, and
then concentrated with an ultrafiltration membrane (critical
molecular weight: 13,000) to produce a crude enzyme solution (6
Units/ml). Maltotriose, as a substrate, was added so that the final
concentration would be 10%. The reaction was carried out at pH 5.5
(50 mM sodium acetate) and at 60.degree. C. for 24 hours, and
stopped by heat-treatment at 100.degree. C. for 5 min. The produced
glucosyltrehalose was analyzed by the same HPLC analyzing method
used in Example I-1.
[0593] The results of the HPLC analysis are shown in FIG. 28. The
principal reaction-product appeared in the HPLC chart as a peak
without any anomers, exhibiting such a retention time as slightly
behind the non-reacted substrate. Further, the principal product
was isolated using a TSK-gel Amide-80 HPLC column, and analyzed by
.sup.1H-NMR and .sup.13C-NMR to be confirmed as
glucosyltrehalose.
[0594] Consequently, the transformant was found to have the
activity of the novel transferase derived from the Sulfolobus
solfataricus strain KM1. Incidentally, no activity of the novel
transferase was detected in the transformant prepared by
transforming the JM109 with pUC119 alone.
EXAMPLE I-15
Determination of Partial-Amino Acid Sequences of the Novel
Transferase Derived from the Sulfolobus solfataricus Strain KM1
[0595] Partial amino acid sequences of the novel transferase
obtained in Example I-4 were determined according to the process
described in Example I-9. The following are the determined partial
amino acid sequences. TABLE-US-00039 Peptide Fragments Digested
with Achromobacter Protease AP-6: Arg Asn Pro Glu Ala Tyr (Sequence
No. 30) Thr Lys AP-8: Asp His Val Phe Gln Glu (Sequence No. 31) Ser
His Ser AP-10: Ile Thr Leu Asn Ala Thr (Sequence No. 32) Ser Thr
AP-12: Ile Ile Ile Val Glu Lys (Sequence No. 33) AP-13: Leu Gln Gln
Tyr Met Pro (Sequence No. 34) Ala Val Tyr Ala Lys AP-14: Asn Met
Leu Glu Ser (Sequence No. 35) AP-16: Lys Ile Ser Pro Asp Gln
(Sequence No. 36) Phe His Val Phe Asn Gln Lys AP-18: Gln Leu Ala
Glu Asp Phe (Sequence No. 37) Leu Lys AP-19: Lys Ile Leu Gly Phe
Gln (Sequence No. 38) Glu Glu Leu Lys AP-20: Ile Ser Val Leu Ser
Glu (Sequence No. 39) Phe Pro Glu Glu AP-23: Leu Lys Leu Gln Gln
Gly (Sequence No. 40) Ala Ile Tyr AP-28: Gln Val Gln Ile Asn Gln
(Sequence No. 41) Leu Pro Peptide Fragments Digested with Asp-N
DN-1: Asp His Ser Arg Ile (Sequence No. 42) DN-5: Asp Leu Arg Tyr
Tyr Lys (Sequence No. 43) DN-6: Asp Val Tyr Arg Thr Tyr (Sequence
No. 44) Ala Asn Gln Ile Val Lys Glu Cys
EXAMPLE I-16
Cloning of a Gene Coding for the Novel Transferase Derived from the
Sulfolobus acidocaldarius Strain ATCC 33909
[0596] The chromosome DNA of the Sulfolobus acidocaldarius strain
ATCC 33909 was obtained according to the process described in
Example I-10 from bacterial cells obtained according to the process
described in Example I-4. The above chromosome DNA was partially
digested with Sau 3AI and subsequently, ligated to a Bam
HI-restricted arm of EMBL3 (manufactured by STRATAGENE Co.) by
using T4 DNA ligase. Packaging was carried out using Gigapack II
Gold, manufactured by STRATAGENE Co. With the library obtained
above, the E. coli strain LE392 was infected at 37.degree. C. for
15 min., inoculated on NZY agar plates, and incubated at 37.degree.
C. for 8-12 hours, approximately, to form plaques. After being
stored at 4.degree. C. for about 2 hours, DNA was adsorbed on a
nylon membrane (Hybond N+, manufactured by Amersham Co. Baking was
performed at 80.degree. C. for 2 hours after brief washing with
2.times.SSPE. Using the Eco RI-Xba I fragment (corresponding to the
sequence from the 824th base to the 2578th base of Sequence No. 1)
of pKT22 obtained in Example I-14, the probe was labeled with
.sup.32P employing Megaprime DNA labeling system manufactured by
Amersham Co.
[0597] Hybridization was performed overnight under the conditions
of 60.degree. C. with 6.times.SSPE containing 0.5% of SDS. Washing
was performed by treating twice with 2.times.SSPE containing 0.5%
of SDS at room temperature for 10 min.
[0598] Screening was started with 5,000 clones, approximately, and
8 positive clones were obtained. From these clones, a Bam HI
fragment of about 7.6 kbp was obtained and the fragment was
inserted into pUC118 at the corresponding restriction site. The
plasmid thus obtained was named as p09T3. Further, the insertional
fragments of the above clones were partially digested with Sau 3AI
and the obtained fragment of about 6.7 kbp was inserted into pUCI
18 at the Bam HI site. The plasmid thus obtained was named as
pO9T2. The Xba I fragment which was derived from this plasmid and
had about 3.8 kbp was inserted into pUC118 at the corresponding
restriction site. The plasmid thus obtained was named as pO9T1. The
restriction map of this plasmid is shown in FIG. 29, and the
preparation procedure thereof is shown in FIG. 30. As to the above
plasmid pO9T1, the base sequence, principally of the region coding
for the novel transferase, was determined according to the process
described in Example I-13. The base sequence thus determined and
the amino acid sequence anticipated therefrom are shown in
Sequences No. 3 and No. 4, respectively. Sequences corresponding to
any of the partial amino acid sequences obtained in Example I-15,
respectively, were recognized in this amino acid sequence. This
amino acid sequence was assumed to have 680 amino acid residues and
code for a protein, the molecular weight of which was estimated as
80.1 kDa. This molecular weight value almost equals the value
obtained by SDS-PAGE analysis of the purified novel transferase
derived from the Sulfolobus solfataricus strain ATCC 33909.
Additionally, the existence of the activity of the novel
transferase in a transformant containing the plasmid pO9T1 was
confirmed according to the procedure described in Example I-14.
EXAMPLE I-17
Hybridization Tests Between the Gene Coding for the Novel
Transferase Derived from the Sulfolobus solfataricus Strain KM1 and
Chromosome DNAs Derived from the Other Organisms
[0599] Chromosome DNAs were obtained from the Sulfolobus
solfataricus strain DSM 5833, the Sulfolobus shibatae strain DSM
5389, and the E. coli strain JM109, and digested with restriction
enzymes Pst I and Eco RI.
[0600] These digested products were separated by 1% agarose gel
electrophoresis and transferred using the Southern blot technique
to a Hybond-N membrane manufactured by Amersham Japan Co. The Sph
I-Xba I fragment of about 2.6 kbp (corresponding to the sequence
shown in Sequence No. 1, or corresponding to the region of A-B in
FIG. 26), which derived from pKT21 obtained in Example I-12, was
labeled using a DIG system kit manufactured by Boehringer Mannheim
Co., and the resultant was subjected to a hybridization test with
the above-prepared membrane.
[0601] The hybridization was performed under the conditions of
40.degree. C. for 2 hours with 5.times.SSC, and washing was
performed by treating twice with 2.times.SSC containing 0.1% of SDS
at 40.degree. C. for 5 min., and twice with 0.1.times.SSC
containing 0.1% of SDS at 40.degree. C. for 5 min.
[0602] As a result, the Sph I-Xba I fragment could hybridize with a
fragment of about 5.9 kbp derived from the Sulfolobus solfataricus
strain DSM 5833, and with fragments, of about 5.0 kbp and about 0.8
kbp, respectively, derived from the Sulfolobus shibatae strain DSM
5389. On the other hand, no hybrid formation was observed in
fragments derived from the E. coli strain JM109 which was used as a
negative control.
[0603] Further, chromosome DNAs were obtained according to the
procedure described in Example I-10 from the Sulfolobus
solfataricus strains KM1, DSM 5354, DSM 5833, ATCC 35091, and ATCC
35092; the Sulfolobus acidocaldarius strains ATCC 33909, and ATCC
49426; the Sulfolobus shibatae strain DSM 5389; the Acidianus
brierleyi strain DSM 1651; and the E. coli strain JM109, and
digested with restriction enzymes, Hind II, Xba I, and Eco RV.
[0604] These digested products-were separated-by 1% agarose gel
electrophoresis and transferred using the Southern blot technique
to a Hybond-N+membrane manufactured by Amersham Japan Co. The
region (378 bp) from the 1880th base to the 2257th base of Sequence
No. 1 was amplified by PCR and labeled with .sup.32P according to
the procedure described in Example I-16, and the resultant was
subjected to a hybridization test with the above prepared
membrane.
[0605] The hybridization was performed overnight under the
conditions of 60.degree. C. with 6.times.SSPE containing 0.5% of
SDS, and washing was performed by treating twice with 2.times.SSPE
containing 0.1% of SDS at room temperature for 10 min.
[0606] As a result, the following fragments were found to form
hybrids: the fragments of about 4.4 kbp, about 3.7 kbp, about 3.7
kbp, about 0.8 kbp, and about 3.9 kbp derived from the Sulfolobus
solfataricus strains KM1, DSM 5354, DSM 5833, ATCC 35091, and ATCC
35092, respectively; the fragments of about 0.8 kbp, and about 0.8
kbp derived from the Sulfolobus acidocaldarius strains ATCC 33909,
and ATCC 49426, respectively; the fragment of about 4.4 kbp derived
from the Sulfolobus shibatae strain DSM 5389; and the fragment of
about 2.1 kbp derived from the Acidianus brierleyi strain DSM 1651.
On the other hand, no hybrid formation was observed as to the
genome DNA of the strain JM109.
[0607] Moreover, it was confirmed, through data banks of amino acid
sequences (Swiss prot and NBRF-PDB) and a data bank of base
sequences (EMBL), and by using sequence-analyzing software, GENETYX
(produced by Software Development Co.), that there is no sequence
homologous to any of the amino acid sequences and base sequences
within the scopes of Sequences No. 1, No. 2, No. 3, and No. 4.
Consequently, the genes coding for the novel transferases were
found to be highly conserved specifically in archaebacteria
belonging to the order Sulfolobales.
EXAMPLE I-18
Comparisons Between the Base Sequences and Between the Amino Acid
Sequences of the Novel Transferases Derived from the Sulfolobus
solfataricus Strain KM1 and the Sulfolubus acidocaidarius Strain
ATCC 33909
[0608] Considering gapps and using sequence-analyzing software,
GENETYX (produced by Software Development Co.), comparative
analyses-were carried out on the amino acid sequence of the novel
transferase derived from the strain KM1, i.e. Sequence No. 2, and
that derived from the strain ATCC 33909, i.e. Sequence No. 4; and
on the base sequence coding for the novel transferase derived from
the strain KM1, i.e. Sequence No. 1, and that derived from the
strain ATCC 33909, i.e. Sequence No. 3. The results as to the amino
acid sequences are shown in FIG. 31, and the results as to the base
sequences are shown in FIG. 32. In each figure, the upper line
indicates the sequence derived from the strain 33909, the
lower-line indicates the sequence derived from the strain KM1, and
the symbol "*" in the middle line indicates the portions equal in
both strains. Each of the couples indicated with symbol "." in FIG.
31 are a couple of amino acid residues which mutually have similar
characteristics. The homology values are 49% and 57% on the levels
of the amino acid sequences and the base sequences,
respectively.
EXAMPLE I-19
Production of Trehaloseoligosaccharides from a Maltooligosaccharide
Mixture Using the Recombinant Novel Transferase Derived from a
Transformant
[0609] Alpha-amylase-hydrolysate obtained by hydrolyzing soluble
starch (manufactured by Nacalai tesque Co., special grade) into
oligosaccharides which do not cause the iodo-starch reaction was
used as a substrate, wherein the .alpha.-amylase was A-0273
manufactured by Sigma Co. and derived from Aspergillus oryzae.
Production of glucosyltrehalose and various maltooligosyltrehaloses
was attempted by using the crude enzyme solution obtained in
Example I-14 and the above substrate, and according to the reaction
conditions described in Example I-14. The obtained reaction mixture
was analyzed by a HPLC method under the following conditions.
[0610] Column: BIORAD AMINEX HPX-42A (7.8.times.300 mm) [0611]
Solvent: Water [0612] Flow rate: 0.6 ml/min. [0613] Temperature:
85.degree. C. [0614] Detector: Refractive Index Detector
[0615] The results by HPLC analysis are shown in FIG. 33(A), and
the results by HPLC analysis in a case performed without the
recombinant novel transferase are shown in FIG. 33(B). As is
obvious from the results, each of the oligosaccharides as the
reaction products exhibits a retention time shorter than those of
the reaction products produced in the: control group, namely,
produced only with amylase. Next, the principal products, i.e.
trisaccharide, tetrasaccharide, and pentasaccharides derived from
the substrates, i.e. maltotriose (G3), maltotetraose (G4), and
maltopentaose (G5) (all manufactured by Hayashibara Biochemical
Co.), respectively, were isolated using the TSK-gel Amide-80 HPLC
column, and were analyzed by .sup.1H-NMR and .sup.13C-NMR. As a
result, all of such products were found to have a structure in
which the glucose residue at the reducing end is .alpha.-1,
.alpha.-1-linked, and the products were confirmed as
glucosyltrehalose (.alpha.-D-maltosyl .alpha.-D-glucopyranoside),
maltosyltrehalose (.alpha.-D-maltotriosyl
.alpha.-D-glucopyranoside), and maltotriosyltrehalose
(.alpha.-D-malto-tetraosyl .alpha.-D-glucopyranoside),
respectively.
EXAMPLE I-20
Production of Glucosyltrehalose and Maltooligosyltrehalose by Using
the Novel Transferase Derived from a Transformant
[0616] Maltotriose (G3)-Maltoheptaose (G7) (all manufactured by
Hayashibara Baiokemikaru Co.) were used as substrates. The crude
enzyme solution obtained in Example I-14 was lyophilized, and then
suspended in a 50 mM sodium acetate solution (pH 5.5) to make a
concentrated enzyme solution. Each of the substrates was subjected
to reaction with 12.7 Units/ml (in terms of the enzymatic activity
when maltotriose is used as the substrate) of the concentrated
enzyme solution to produce a corresponding .alpha.-1,
.alpha.-1-transferred isomer. Each reaction product was analyzed by
the method described in Example I-1 to examine the yield and the
enzymatic activity. The results are shown in Table 38.
Incidentally, as to the enzymatic activity shown in Table 38, 1
Unit is defined as an enzymatic activity of transferring
maltooligosaccharide to produce 1 .mu.mol per hour of a
corresponding .alpha.-1, .alpha.-1-transferred isomer.
TABLE-US-00040 TABLE 38 Enzyme activity Yield Substrate (unit/ml)
(%) Maltotriose (G3) 12.7 40.8 Maltotetraose (G4) 72.5 69.8
Maltopentaose (G5) 103.5 65.3 Maltohexaose (G6) 87.3 66.5
Maltoheptaose (G7) 60.2 67.9
EXAMPLE II-15
Determination of the Partial Amino Acid Sequences of the Novel
Amylase Derived from the Sulfolobus solfataricus strain KM1
[0617] The partial amino acid sequences of the purified enzyme
obtained in Example II-2 were determined by the method disclosed in
Iwamatsu, et al. [Seikagaku (Biochemistry) 63, 139 (1991)], and the
amino acid sequence of the N terminus side was determined by the
method disclosed in Matsudaira, T. [J. Biol. Chem. 262, 10035-10038
(1987)].
[0618] At first, the purified novel amylase was suspended in a
buffer solution for electrophoresis [10% glycerol, 2.5% SDS, 2%
2-mercaptoethanol, 62 mM Tris-Hcl buffer solution (pH 6.8)], and
subjected to SDS-Polyacrylamide gel electrophoresis. After the
electrophoresis, the enzyme was transferred from the gel to a
polyvinylidene diflorido (PVDF) membrane (ProBlot, manufactured by
Applied Biosystems Co.) by electroblotting (SartoBlot type IIs,
manufactured by Sartorius Co.) with 160 mA for 1 hour.
[0619] After the transfer, the portion to which the enzyme had been
transferred was cut out from the membrane, and soaked in about 300
.mu.l of a buffer solution for reduction [6 M guanidine-HCl, 0.5 M
Tris-HCl buffer solution (pH 3.5) containing 0.3% of EDTA and 2% of
acetonitrile]. One milligram of dithiothreitol was added to this,
and reduction was carried out under an argon atmosphere at
60.degree. C. for 1 hour, approximately. To the resultant, 2.4 mg
of monoiodoacetic acid dissolved in 10 .mu.l of 0.5 N sodium
hydroxide was added and stirred for 20 min. in the dark. The PVDF
membrane was then taken out and washed sufficiently with a 2%
acetonitrile solution, and subsequently stirred in a 0.1% SDS
solution for 5 min. After being briefly washed with water, the PVDF
membrane was then soaked in a 100 mM acetic acid solution
containing 0.5% of Polyvinylpyrrolidone-40, and was left standing
for 30 min. Next, the PVDF membrane was briefly washed with water,
and cut into pieces of 1 square mm, approximately. For
determination of the amino acid sequence of the N terminus side,
these pieces from the membrane were directly analyzed with a
gas-phase sequencer. For determination of the partial amino acid
sequences, these pieces were further soaked in a buffer solution
for digestion [8% acetonitrile, 90 mM Tris-HCl buffer solution (pH
9.0)], and after the addition of 1 pmol of the Achromobacter
Protease I (manufactured by Wako pure chemical Co.), digested at
room temperature spending 15 hours. The digested products were
separated by reversed phase chromatography using a C8 column
(.mu.-Bondashere 5C8, 300A, 2.1.times.150 mm, manufactured by
Millipore Ltd. Japan) to obtain a dozen or more kinds of peptide
fragments. Using A solvent (0.05% trifluoroacetic acid) and B
solvent (2-propanol:acetonitrile=7:3, containing 0.02% of
trifluoroacetic acid) as elution solvents, the peptides were eluted
with a linear concentration gradient from 2 to 50% relative to B
solution and at a flow rate of 0.25 ml/min. for 40 min. As to the
peptide fragments thus obtained, the amino acid sequences were
determined by the automatic Edman degradation method using a
gas-phase peptide sequencer (model 470, manufactured by Applied
Biosystems Co.).
[0620] The amino acid sequence of the N terminus and the partial
amino acid sequences thus determined are as follows. TABLE-US-00041
Amino Acid Sequence of the N Terminus Side Thr Phe Ala Tyr Lys Ile
Asn Glu (Sequence No. 45) Asp Gly Partial Amino Acid Sequences P-6:
Leu Gly Pro Tyr Phe Ser (Sequence No. 46) Gln P-7: Asp Val Phe Val
Tyr Asp (Sequence No. 47) Gly P-10: Tyr Asn Arg Ile Val Ile
(Sequence No. 48) Ala Glu Ser Asp Leu Asn Asp Pro Arg Val Val Asn
Pro
EXAMPLE II-16
Preparation of Chromosome DNA of the Sulfolobus solfataricus Strain
KM1
[0621] The Sulfolobus solfataricus strain KM1 was cultivated at
75.degree. C. for 3 days in the culture medium which is identified
as No. 1304 in Catalogue of Bacteria and Phages 18th edition (1992)
published by American Type Culture Collection (ATCC), and which
contained 2 g/liter of soluble starch and 2 g/liter of yeast
extract. The cultivated bacteria was collected by centrifugation
and stored at -80.degree. C. The yield of the bacterial cell was
3.3 g/liter.
[0622] To 1 g of the bacterial bodies, 10 ml of a 50 mM Tris-HCl
buffer solution (pH 8.0) containing 25% of sucrose, 1 mg/ml of
lysozyme, 1 mM of EDTA, and 150 mM of NaCl was added for making a
suspension, and the suspension was left standing for 30 min. To
this suspension, 0.5 ml of 10% SDS and 0.2 ml of 10 mg/ml
Proteinase K (manufactured by Wako pure chemical Co.) were added,
and the mixture. was left standing at 37.degree. C. for 2 hours.
Next, the mixture was subjected to extraction with a
phenol/chloroform solution, and then subjected to ethanol
precipitation. The precipitated DNA was twisted around a sterilized
glass stick and vacuum-dried after being washed with a 70% ethanol
solution. As the final product, 1.5 mg of the chromosome DNA was
obtained.
EXAMPLE II-17
Expression Cloning of a Gene Coding for the Novel Amylase Derived
from the Sulfolobus solfataricus Strain KM1 by an Activity Staining
Method
[0623] One hundred micrograms of the chromosome DNA of the
Sulfolobus solfataricus strain KM1, prepared in Example II-16, was
partially digested with a restriction enzyme, Sau 3AI. The reaction
mixture was ultracentrifuged with a density gradient of sucrose to
isolate and purify DNA fragments of 5-10 kb. Then, using T4 DNA
ligase, the above chromosome DNA fragments having lengths of 5-10
kb were ligated with a modified vector which had been prepared from
a plasmid vector, pUC118 (manufactured by Takara Shuzou Co.), by
digestion with Bam HI and by dephosphorylation of the ends with
alkaline phosphatase. Next, cells of the E. coli strain JM109
(manufactured by Takara Shuzou Co.) were transformed with a mixture
containing the modified pUC118 plasmid vectors in which any of the
fragments had been inserted. These cells were cultivated on LB agar
plates containing 50 .mu.g/ml of ampicillin to grow their colonies
and make a DNA library.
[0624] Screening of the transformants which have a recombinant
plasmid containing a gene coding for the novel amylase derived from
the Sulfolobus solfataricus strain KM1 was performed by an activity
staining method.
[0625] At first, the obtained transformants were replicated on
filter paper and cultivated on an LB agar plate for colonization.
The filter paper was dipped in a 50 mM Tris-HCl buffer solution (pH
7.5.) containing 1 mg/ml of lysozyme (manufactured by Seikagaku
Kougyou Co.) and 1 mM of EDTA, and was left standing for 30 min.
Subsequently, the filter paper was dipped in 1% Triton-X100
solution for 30 min. for bacteriolysis, and heat-treated at
60.degree. C. for 1 hour to inactivate the enzymes derived from the
host. The filter paper thus treated was then laid on an agar plate
containing 0.2% of soluble starch to progress a reaction at
60.degree. C., overnight. The plate subjected to the reaction was
put under the iodine-vapor atmosphere to make the starch get color.
The colonies which exhibit a halo was recognized as the colonies of
positive clones. As a result, five positive clones were obtained
from 6,000 transformants. According to analysis of the plasmids
extracted from these clones, an insertional fragment of about 4.3
kbp was contained in a plasmid as the shortest insertional
fragment.
[0626] Further, the insertional fragment was shortened by
subjecting it to digestion with Bam HI and the same procedure as
above. As a result, a transformant containing a plasmid which has
an insertional fragment of about 3.5 kb was obtained. This plasmid
was named as pKA1.
[0627] The restriction map of the insertional fragment of this
plasmid is shown in FIG. 34.
EXAMPLE II-18
Determination of the Gene Coding for the Novel Amylase Derived from
the Sulfolobus solfataricus Strain KM1
[0628] The base sequence of the insertional fragment in the
plasmid, pKA1 obtained in Example II-17, (i.e. the DNA of the
region corresponding to the plasmid, pKA2, described below) was
determined.
[0629] At first, a deletion plasmid was prepared from the above
plasmid DNA by using a deletion kit for kilo-sequencing which was
manufactured by Takara Shuzou Co. After that, the DNA sequence of
the insertional fragment in the plasmid were determined by using a
sequenase dye primer sequencing kit, PRISM, a terminator cycle
sequencing kit, Tag Dye Deoxy.TM., both manufactured by Perkin
Elmer Japan Co., and a DNA sequencer, GENESCAN Model 373A,
manufactured by Applied Biosystems Co.
[0630] The base sequence, and the amino sequence anticipated
therefrom are shown in Sequences No. 5 and No. 6, respectively.
[0631] Sequences corresponding to any of the partial amino acid
sequences obtained in Example II-15, respectively, were recognized
in the above amino acid sequence. This amino acid sequence was
assumed to have 558 amino acid residues and code for a protein, the
molecular weight of which estimated as 64.4 kDa. This molecular
weight value almost equals the value, 61.0 kDa, obtained by
SDS-PAGE analysis of the purified novel amylase derived from the
Sulfolobus solfataricus strain KM1.
EXAMPLE II-19
Production of the Recombinant Novel Amylase in a Transformant
[0632] A plasmid, pKA2, was obtained by partially digesting the
plasmid, pKA1, which was obtained in Example II-17, with a
restriction enzyme, Pst I. FIG. 35 shows its restriction map. The
enzymatic activity of the transformant which contains pKA2 was
examined as follows. At first, the above transformant was
cultivated overnight in a LB broth containing 100 .mu.g/ml of
ampicillin at 37.degree. C. The cells collected by centrifugation
were suspended in 4 ml/g-cell of a 50 mM sodium acetate solution
(pH 5.5), and subjected to ultrasonic crushing-treatment and
centrifugation. The supernatant thus obtained was heat-treated at
70.degree. C. for 1 hour to inactivate the amylase derived from the
host cells. The precipitate was removed by centrifugation and the
resultant was concentrated with an ultrafiltration membrane
(critical molecular weight: 13,000) to obtain a crude enzyme
solution which would be used in the following experiments.
[0633] (1) Substrate Specificity
[0634] The hydrolyzing properties and the hydrolyzed products were
analyzed by allowing 35.2 Units/ml of the above crude enzyme
solution to act on the various 10 mM substrates (except amylopectin
and soluble starch were used as 3.0% solutions) listed in Table 39
below. Here, 1 Unit was defined as an enzymatic activity of
producing 1 .mu.mol of .alpha., .alpha.-trehalose per hour from
maltotriosyltrehalose used as the substrate under the conditions
based on those in Example II-1. The analysis was performed by
TSK-gel Amide-80 HPLC described in Example II-1, wherein the index
was the activity of producing both monosaccharide and disaccharide
when the substrate was each of the various maltooligosaccharides,
Amylose DP-17, amylopectin, soluble starch, various
isomaltooligosaccharides, and panose; the activity of producing
.alpha., .alpha.-trehalose when the substrate was each of the
various trehaloseoligosaccharides, and .alpha.-1,
.alpha.-1-transferred isomer of Amylose DP-17 (the oligosaccharide
derived from Amylose DP-17 by transferring the linkage between the
first and second glucose residues from the reducing end side into
an .alpha.-1, .alpha.-1 linkage); and the activity of producing
glucose when the substrate was maltose or .alpha.,
.alpha.-trehalose.
[0635] The results are as shown in Table 39 below.
[0636] Incidentally, each enzymatic activity value in the table is
expressed with such a unit as 1 Unit equals the activity of
liberating 1 .mu.mol of each of the monosaccharide and disaccharide
per hour. TABLE-US-00042 TABLE 39 Production rate of mono- and
Liberated disaccharides Substrate oligosaccharide (units/ml)
Maltose (G2) Glucose 0.15 Maltotriose (G3) Glucose + G2 0.27
Maltotetraose (G4) Glucose + G2 + G3 0.26 Maltopentaose (G5)
Glucose + G2 + G3 + G4 2.12 Amylose DP-17 Glucose + G2 2.45
Amylopectin Glucose + G2 0.20 Soluble starch Glucose + G2 0.35
.alpha.,.alpha.-Trehalose not decomposed 0 Glucosyltrehalose
Glucose + Trehalose 0.01 Maltosyltrehalose G2 + Trehalose 4.52
Maltotriosyltrehalose G3 + Trehalose 35.21 Amylose DP-17,
.alpha.-1, Trehalose 4.92 .alpha.-1-transferred isomer Isomaltose
not decomposed 0 Isomaltotriose not decomposed 0 Isomaltotetraose
not decomposed 0 Isomaltopentaose not decomposed 0 Panose not
decomposed 0
[0637] Further, the analytic results of the reaction products from
maltotriosyltrehalose by TSK-gel Amide-80 HPLC under the conditions
based on those in Example II-1 are shown in FIG. 36(A). Moreover,
the analytic results of the reaction products from soluble starch
by AMINEX HPX-42A HPLC under the conditions described below are
shown in FIG. 36(B). [0638] Column: AMINEX HPX-42A (7.8.times.300
mm) [0639] Solvent: Water [0640] Flow rate: 0.6 ml/min. [0641]
Temperature: 85.degree. C. [0642] Detector: Refractive Index
Detector
[0643] From the above results, the present enzyme was confirmed to
markedly effectively act on a trehaloseoligo-saccharide, of which
the glucose residue at the reducing end is .alpha.-1,
.alpha.-1-1-linked, such as maltotoriosyltrehalose, to liberate
.alpha., .alpha.-trehalose and a corresponding
maltooligosac-charide which has a polymerization degree reduced by
two. Further, the present enzyme was confirmed to liberate
principally glucose or maltose from maltose (G2)-maltopentaose
(G5), amylose, and soluble starch. The present enzyme, however, did
not act on .alpha., .alpha.-trehalose, isomaltose, isomaltotriose,
isomaltotetraose and isomaltopentaose, and panose.
[0644] (2) Endotype Amylase Activity
[0645] One hundred and fifty Units/ml [in terms of the same unit as
that in the above (1)] of the above crude enzyme solution was
allowed to act on soluble starch. The time-lapse change in the
degree of coloring by the iodo-starch reaction was measured under
the same conditions as the method for measuring starch-hydrolyzing
activity in Example II-1. Further, produced amounts of
monosaccharide and disaccharide were measured under the conditions
based on those in the HPLC analysis method which is described in
the above (1), namely, based on those for the above examination of
substrate specificity. From the data thus obtained, a
starch-hydrolyzing rate was estimated.
[0646] The time-lapse change is shown in FIG. 37. As shown in the
figure, the hydrolyzing rate at the point where the coloring degree
by the iodo-starch reaction decreased to 50% was as low as 4.5%.
Accordingly, the present crude enzyme was confirmed to have a
property of an endotype amylase.
[0647] (3) Investigation of the Action Mechanism
[0648] Uridinediphosphoglucose [glucose-6-.sup.3H] and
malto-tetraose were put into a reaction with glycogen synthase
(derived from rabbit skeletal muscle, G-2259 manufactured by Sigma
Co.) to synthesize maltopentaose, of which the glucose residue of
the non-reducing end was radiolabeled with .sup.3H, and the
maltopentaose was isolated and purified. To 10 mM of this
maltopentaose radiolabeled with .sup.3H as a substrate, 10 Units/ml
(in terms of the unit used in Example I-1) of the recombinant novel
transferase obtained in Example I-20 above was added and put into a
reaction at 60.degree. C. for 3 hours. Maltotriosyltrehalose, of
which the glucose residue of the non-reducing end was radiolabeled
with .sup.3H, was synthesized thereby, and the product was isolated
and purified. Incidentally, it was confirmed by the following
procedure that the glucose residue of the non-reducing end had been
radiolabeled: The above product was completely decomposed into
glucose and .alpha., .alpha.-trehalose by glucoamylase (derived
from Rhizopus, manufactured by Seikagaku Kougyou Co.); the
resultants were sampled by thin-layer chromatography, and their
radioactivities were measured by a liquid scintillation counter; as
a result, radioactivity was not observed in the .alpha.,
.alpha.-trehalose fraction but in the glucose fraction.
[0649] The above-prepared maltopentaose and maltotriosyl-trehalose,
of which the glucose residues of the non-reducing ends were
radiolabeled with .sup.3H, were used as substrates, and were put
into reactions with 30 Units/ml and 10 Units/ml of the above crude
enzyme solution, respectively. Sampling was performed before the
reaction and 3 hours after the start of the reaction performed at
60.degree. C. The reaction products were subjected to development
by thin-layer chromatography (Kieselgel 60 manufactured by Merk
Co.; solvent: butanol/ethanol/water=5/5/3). Each spot thus obtained
and corresponding to each saccharide was collected, and its
radiation was measured with a liquid scintillation counter. When
maltopentaose was used as a substrate, radioactivity was not
detected in the fractions of the hydrolysates, i.e. glucose and
maltose, but in the fractions of maltotetraose and maltotriose. On
the other hand, when maltotriosyltrehalose was used as a substrate,
radioactivity was not detected in the fraction of the hydrolysate,
i.e. .alpha., .alpha.-trehalose, but in the fraction of
maltotriose.
[0650] Consequently, as to the action mechanism, the recombinant
novel amylase was found to have an amylase activity of the endotype
function, and in addition, an activity of principally producing
monosaccharide and disaccharide from the reducing end side.
[0651] Incidentally, the manufacturer of the reagents used in the
above experiments are as follows. [0652] .alpha.,
.alpha.-trehalose: Sigma Co. [0653] Maltose (G2): Wako Junyaku Co.
[0654] Maltotriose -Maltopentaose (G3-G5): Hayashibara Baiokemikaru
Co. [0655] Amylose DP-17: Hayashibara Biochemical Co. [0656]
Isomaltose: Wako pure chemical Co. [0657] Isomaltotriose: Wako pure
chemical Co. [0658] Isomaltotetraose: Seikagaku Kougyou Co. [0659]
Isomaltopentaose: Seikagaku Kougyou Co. [0660] Panose: Tokyo Kasei
Kougyou Co. [0661] Amylopectin: Nacalai tesque Co.
EXAMPLE II-20
Determination of Partial Amino Acid Sequences of the Novel Amylase
Derived from the Sulfolobus acidocaldarius Strain ATCC 33909
[0662] The partial amino acid sequences of the purified enzyme
obtained in Example II-4 were determined according to the process
described in Example II-15.
[0663] The partial amino acid sequences are as follows.
TABLE-US-00043 AP-9: Leu Asp Tyr Leu Lys (Sequence No. 49) AP-10:
Lys Arg Glu Ile Pro Asp (Sequence No. 50) Pro Ala Ser Arg Tyr Gln
Pro Leu Gly Val His AP-11: Lys Asp Val Phe Val Tyr (Sequence No.
51) Asp Gly Lys AP-12: His Ile Leu Gln Glu Ile (Se uence No. 52)
Ala Glu Lys AP-16: Lys Leu Trp Ala Pro Tyr (Sequence No. 53) Val
Asn Ser Val AP-17: Met Phe Ser Phe Gly Gly (Sequence No. 54) Asn
AP-18: Asp Tyr Tyr Tyr Gln Asp (Sequence No. 55) Phe Gly Arg Ile
Glu Asp Ile Glu AP-21: Lys Ile Asp Ala Gln Trp (Sequence No. 56)
Val
EXAMPLE II-21
Preparation of DNA Probes Based on the Partial Amino Acid Sequences
of the Novel Amylase Derived from the Sulfolobus acidocaldarius
Strain ATCC 33909
[0664] According to information about the partial amino acid
sequences determined in Example II-20, oligonucleotide DNA primers
are prepared by using a DNA synthesizer (Model 381 manufactured by
Applied Biosystems Co.). Their sequence were as follows. [0665]
AP-10 [0666] Amino Acid Sequence [0667] N terminus Pro Ala Ser Arg
Tyr Gln Pro C terminus [0668] DNA Primer 5' AGCTAGTAGATATCAACC 3'
(Sequence No. 57) [0669] Base Sequence A G C C G [0670] AP-11
[0671] (complementary strand) [0672] Amino Acid Sequence [0673] N
terminus Asp Val Phe Val Tyr Asp Gly Lys C terminus [0674] DNA
Primer 5' TTTTCCATCATAAACAAAAACATC 3' (Sequence No. 58) [0675] Base
Sequence C A G T G T C
[0676] PCR was performed using 100 pmol of each primer and about
100 ng of the chromosome DNA prepared in Example II-16 and derived
from the Sulfolobus acidocaldarius strain ATCC 33909. The PCR
apparatus used herein was Gene Amp PCR system Model 9600,
manufactured by Perkin Elmer Co. In the reaction, 30 cycles of
steps were carried out with 100 .mu.l of the total reaction
mixture, wherein the 1 cycle was composed of steps at 94.degree. C.
for 30 sec., at 54.degree. C. for 30 sec., and at 72.degree. C. for
30 sec. The amplified fragment of about 830 bp was subcloned into a
plasmid, pT7 Blue T-Vector (manufactured by Novagen Co.).
Determination of the base sequence of the insertional fragment in
this plasmid was performed to find sequences corresponding to any
of the amino acid sequences obtained in Example II-20.
EXAMPLE II-22
Cloning of a Gene Coding for the Novel Amylase Derived from the
Sulfolobus acidocaldarius Strain ATCC 33909
[0677] The chromosome DNA of the Sulfolobus acidocaldarius strain
ATCC 33909 was obtained according to the process described in
Example II-16 from bacterial cells obtained according to the
process described in Example II-4. The above chromosome DNA was
partially digested with Sau 3AI, and subsequently, ligated to a Bam
HI-restricted arm of EMBL3 (manufactured by STRATAGENE Co.) by
using T4 DNA ligase. Packaging was carried out using Gigapack II
Gold, manufactured by STRATAGENE Co. With the library obtained
above, the E. coli strain LE392 was infected at 37.degree. C. for
15 min., inoculated on NZY agar plates, and incubated at 37.degree.
C. for 8-12 hours, approximately, to form plaques. After being
stored at 4.degree. C. for about 2 hours, DNA was adsorbed on a
nylon membrane (Hybond N+, manufactured by Amersham Co. Baking was
performed at 80.degree. C. for 2 hours after brief washing with
2.times.SSPE. Using the PCR fragment obtained in Example II-21, the
probe was labeled with .sup.32P employing Megaprime DNA labeling
system manufactured by Amersham Co.
[0678] Hybridization was performed overnight under the conditions
of b 65.degree. C. with 6.times.SSPE containing 0.5% of SDS.
Washing was performed by treating twice with 2.times.SSPE
containing 0.1% of SDS at room temperature for 10 min.
[0679] Screening was started with, 8,000 clones, approximately, and
17 positive clones were obtained. From these clones, a Bam HI
fragment of about 5.4 kbp was obtained and the fragment was
inserted into pUC118 at the corresponding restriction site. The
plasmid thus obtained was named as pO9A2. Further, the DNA of this
plasmid was digested with Sau 3AI to obtain a plasmid named as
pO9A1. The restriction map of the insertional fragment in pO9A1 is
shown in FIG. 38, and the procedure for preparing pO9A1 is shown in
FIG. 39. As to the above plasmid, pO9A1, a deletion plasmid was
prepared using Double-standard Nested Delation Kit manufactured by
Pharmacia Co. The base sequence, principally of the region
corresponding to the structural gene of the novel amylase, was
determined according to the process described in Example II-18. The
base sequence thus determined and the amino acid sequence
anticipated therefrom are shown in Sequences No. 7 and No. 8,
respectively. Sequences corresponding to any of the partial amino
acid sequences obtained in Example II-20, respectively, were
recognized in this amino acid sequence. This amino acid sequence
was assumed to have 556 amino acid residues and code for a protein,
the molecular weight of which was estimated as 64.4 kDa. This
molecular weight value almost equals the value obtained by SDS-PAGE
analysis of the purified novel amylase derived from the Sulfolobus
solfataricus strain ATCC 33909. Additionally, the existence of the
activity of the novel amylase in a transformant containing the
plasmid, pO9A1 was confirmed according to the procedure described
in Example II-19.
EXAMPLE II-23
Homology Between the Base Sequences and Between the Amino Acid
Sequences of the Novel Amylases Derived from the Strain KM1 and the
Strain ATCC 33909
[0680] Considering gapps and using sequence-analyzing software,
GENETYX (produced by Software Development Co.), comparative
analyses were carried out on the amino acid sequence of the novel
amylase derived from the strain KM1, i.e. Sequence No. 6, and that
derived from the strain ATCC 33909, i.e. Sequence No. 8; and on the
base sequence coding for the novel amylase derived from the strain
KM1, i.e. Sequence No. 5, and that derived from the strain ATCC
33909, i.e. Sequence No. 7. The results as to the amino acid
sequences are shown in FIG. 40, and the results as to the base
sequences are shown in FIG. 41. In each figure, the upper line
indicates the sequence derived from the strain 33909, the lower
line indicates the sequence derived from the strain KM1, and the
symbol "*" in the middle line indicates the portions equal in both
strains. Each of the couples indicated with symbol "." in FIG. 40
are a couple of amino acid residues which mutually have similar
characteristics. The homology values are about 59% and 64% on the
levels of the amino acid sequences and the base sequences,
respectively.
EXAMPLE II-24
Hybridization Tests between the Gene Coding for the Novel Amylase
Derived from the Sulfolobus solfataricus Strain KM1 or the
Sulfolobus acidocaldarius Strain ATCC 33909 and Chromosome DNAs
Derived from the Other Organisms
[0681] Chromosome DNAs were obtained from the Sulfolobus
solfataricus strain DSM 5833, the Sulfolobus shibatae strain DSM
5389, the Acidianus brierleyi strain DSM 1651, and the E. coli
strain JM109, and digested with a restriction enzyme Hind III
according to the procedure described in Example II-16.
[0682] These digested products were separated by 1% agarose gel
electrophoresis, and transferred using the Southern blot technique
to a Hybond-N membrane manufactured by Amersham Japan Co. The Pst I
fragment of about 1.9 kbp (corresponding to the sequence from the
1st base to 1845th base of Sequence No. 5), which derived from pKA1
was labeled using a DIG system kit manufactured by Boehringer
Mannheim Co., and the resultant was subjected to a hybridization
test with the above-prepared membrane.
[0683] The hybridization was performed under the conditions of
40.degree. C. for 3 hours with 5.times.SSC, and washing was
performed by treating twice with 2.times.SSC containing 0.1% of SDS
at 40.degree. C. for 5 min., and twice with 0.1.times.SSC
containing 0.1% of SDS at 40.degree. C. for 5 min.
[0684] As a result, the Pst I fragment could hybridize with a
fragment of about 13.0 kbp derived from the Sulfolobus solfataricus
strain DSM 5833, a fragment of about 9.8 kbp derived from the
Sulfolobus shibatae strain DSM 5389, and a fragment of about 1.9
kbp derived from the Acidianus brierleyi strain DSM 1651. On the
other hand, no hybrid formation was observed in fragments derived
from the E. coli strain JM109 which was used as a negative
control.
[0685] Further, chromosome DNAs were obtained according to the
procedure described in Example II-16 from the Sulfolobus
solfataricus strains KM1, DSM 5354, DSM 5833, ATCC 35091, and ATCC
35092; the Sulfolobus acidocaldarius strains ATCC 33909, and ATCC
49426; the Sulfolobus shibatae strain DSM 5389; the Acidianus
brierleyi strain DSM 1651; and the E. coli strain JM109, and
digested with restriction enzymes, Xba I, Hind III, and Eco RV.
These digested products were separated by 1% agarose gel
electrophoresis and transferred using the Southern blot technique
to a Hybond-N+ membrane manufactured by Amersham Japan Co. The
region from the 1393th base to the 2121th base of Sequence No. 7
(obtained by digesting pO9A1 prepared in Example II-22 with
restriction enzymes Eco T22I and Eco RV followed by separation in a
gel) was labeled with .sup.32P according to the procedure described
in Example II-22 to make a probe, and this probe was subjected to a
hybridization test with the above prepared membrane. The
hybridization was performed overnight under the conditions of
60.degree. C. with 6.times.SSPE containing 0.5% of SDS, and washing
was performed by treating twice with 2.times.SSPE containing 0.1%
of SDS at room temperature for 10 min. As a result, the following
fragments were found to form hybrids: the fragments of about 3.6
kbp, about 1.0 kbp, about 0.9 kbp, about 0.9 kbp, and about 1.0 kbp
derived from the Sulfolobus solfataricus strains KM1, DSM 5354, DSM
5833, ATCC 35091, and ATCC 35092, respectively; the fragments of
about 0.9 kbp, and about 0.9 kbp derived from the Sulfolobus
acidocaldarius strains ATCC 33909, and ATCC 49426, respectively;
the fragment of about 1.4 kbp derived from the Sulfolobus shibatae
strain DSM 5389; and the fragment of about 0.9 kbp derived from the
Acidianus brierleyi strain DSM 1651. On the other hand, no hybrid
formation was observed as to the chromosome DNA of the E. coli
strain JM109. Moreover, it was confirmed, through data banks of
amino acid sequences (Swiss prot and NBRF-PDB) and a data bank of
base sequences (EMBL), and by using sequence-analyzing software,
GENETYX (produced by Software Development Co.), that there is no
sequence homologous to any of the amino acid sequences and base
sequences within the scopes of Sequences No. 5, No. 6, No. 7, and
No. 8. Consequently, the genes coding for the novel amylases were
found to be highly conserved specifically in archaebacteria
belonging to the order Sulfolobales.
EXAMPLE III-1
Production of .alpha., .alpha.-Trehalose by Using the Recombinant
Novel Amylase and the Recombinant Novel Transferase
[0686] Production of .alpha., .alpha.-trehalose was attempted by
using the crude recombinant novel amylase obtained in Example
II-19, the concentrated recombinant novel transferase obtained in
Example I-20, and 10% soluble starch (manufactured by Nacalai
tesque Co., special grade); and by supplementally adding
pullulanase. The reaction was performed as follows.
[0687] At first, 10% soluble starch was treated with 0.5-50
Units/ml of pullulanase (derived from Klebsiella pneumoniae, and
manufactured by Wako pure chemical Co.) at 40.degree. C. for 1
hour. To the resultant, the above-mentioned recombinant novel
transferase (10 Units/ml) and the above-mentioned recombinant novel
amylase (150 Units/ml) were added, and the mixture was subjected to
a reaction at pH 5.5 and 60.degree. C. for 100 hours. The reaction
was stopped by heat-treatment at 100.degree. C. for 5 min., and the
non-reacted substrate was hydrolyzed with glucoamylase. The
reaction mixture was analyzed by an HPLC analyzing method under the
conditions described in Example II-1.
[0688] The analysis results by TSK-gel Amide-80 HPLC are shown in
FIG. 42.
[0689] Here, as to enzymatic activity of the recombinant novel
amylase, 1 Unit is defined as the activity of liberating 1 .mu.mol
of .alpha., .alpha.-trehalose per hour from maltotriosyltrehalose.
As to enzymatic activity of the recombinant novel transferase, 1
Unit is defined as the activity of producing 1 .mu.mol of
glucosyltrehalose per hour from maltotriose. As to enzymatic
activity of pullulanase, 1 Unit is defined as the activity of
producing 1 .mu.mol of maltotriose per minute at pH 6.0 and
30.degree. C. from pullulan.
[0690] The yield of .alpha., .alpha.-trehalose was 67% when 50
Units/ml of pullulanase was added. This value suggests that the
recombinant novel amylase can bring about almost the same yield as
the purified novel amylase derived from the Sulfolobus solfataricus
strain KM1 can under the above reaction condition.
INDUSTRIAL APPLICABILITY
[0691] A novel, efficient and high-yield process for producing
trehaloseoligosaccharide, such as glucosyltrehalose and
maltooligosaccharide, and other saccharides from a raw material
such as maltooligosaccharide can be provided by using a novel
transferase which is obtained by an enzyme-producing process
according to the novel purification process of the present
invention, and which can act on saccharides, such as
maltooligosaccharide, to produce trehaloseoligosaccharide, such as
glucosyltrehalose and maltooligosyltrehalose, and other
saccharides.
[0692] A novel, efficient and high-yield process for producing
.alpha.,.alpha.-trehalose from a glucide raw material such as
starch, starch hydrolysate and maltooligosaccharide can be provided
by using the novel amylase of the present invention in combination
with the novel transferase of the present invention.
Sequence CWU 1
1
* * * * *