U.S. patent application number 10/577084 was filed with the patent office on 2007-04-19 for optimised micro-organism strains for nadph-consuming biosynthetic pathways.
Invention is credited to Gwenaelle Bestel-Corre, Cedric Boisart, Michel Chateau, Rainer Figge, Benjamin Gonzalez, Philippe Soucaille, Olivier Zink.
Application Number | 20070087403 10/577084 |
Document ID | / |
Family ID | 34508307 |
Filed Date | 2007-04-19 |
United States Patent
Application |
20070087403 |
Kind Code |
A1 |
Bestel-Corre; Gwenaelle ; et
al. |
April 19, 2007 |
Optimised micro-organism strains for nadph-consuming biosynthetic
pathways
Abstract
The invention relates to optimised micro-organism strains for
the biotransformation production of molecules having
NADPH-consuming biosynthetic pathways. The inventive strains can be
used in NADPH-consuming biotransformation methods. Said strains are
characterised in that one or more NADPH-oxidising activities are
limited.
Inventors: |
Bestel-Corre; Gwenaelle;
(Saint Beauzire, FR) ; Boisart; Cedric;
(Chamallieres, FR) ; Chateau; Michel; (Riom,
FR) ; Gonzalez; Benjamin; (Riom, FR) ;
Soucaille; Philippe; (Deyme, FR) ; Figge; Rainer;
(Riom, FR) ; Zink; Olivier; (Mulhouse,
FR) |
Correspondence
Address: |
DORSEY & WHITNEY LLP;INTELLECTUAL PROPERTY DEPARTMENT
SUITE 1500
50 SOUTH SIXTH STREET
MINNEAPOLIS
MN
55402-1498
US
|
Family ID: |
34508307 |
Appl. No.: |
10/577084 |
Filed: |
November 5, 2004 |
PCT Filed: |
November 5, 2004 |
PCT NO: |
PCT/FR04/02846 |
371 Date: |
May 18, 2006 |
Current U.S.
Class: |
435/52 ; 435/106;
435/117; 435/134; 435/136; 435/252.3; 435/254.2; 435/471; 435/483;
435/76 |
Current CPC
Class: |
C12P 7/18 20130101; C12P
13/005 20130101; C12N 9/92 20130101; C12P 13/04 20130101; C12N
9/0036 20130101; C12P 33/16 20130101 |
Class at
Publication: |
435/052 ;
435/106; 435/117; 435/076; 435/134; 435/136; 435/252.3; 435/254.2;
435/471; 435/483 |
International
Class: |
C12P 33/00 20060101
C12P033/00; C12P 19/62 20060101 C12P019/62; C12P 13/04 20060101
C12P013/04; C12P 17/00 20060101 C12P017/00; C12P 7/64 20060101
C12P007/64; C12P 7/40 20060101 C12P007/40; C12N 15/74 20060101
C12N015/74; C12N 1/21 20060101 C12N001/21; C12N 1/18 20060101
C12N001/18 |
Foreign Application Data
Date |
Code |
Application Number |
Nov 6, 2003 |
FR |
0313056 |
Claims
1. A strain of a micro-organism characterized in that one or more
of its NADPH-oxidizing activities have been limited.
2. A strain according to claim 1 characterized in that one or more
of its NADPH-oxidizing activities have been limited by the deletion
of one or more genes coding for at least one of a quinone
oxidoreductase and a soluble transhydrogenase.
3. A strain according to claim 1 characterized in that it has also
undergone modifications that favour one or more of its
NADP.sup.+-reducing enzyme activities.
4. A strain according to claim 3 characterized in that it has
undergone the deletion of one or more genes coding for at least one
of a phosphoglucose isomerase and a phosphofructokinase.
5. A strain according to claim 1 characterized in that it has also
undergone the modification of one or more genes coding for at least
one of a dihydrolipoamide dehydrogenase and a glyceraldehyde
3-phosphate dehydrogenase so as to cause it to utilize NADP
preferentially.
6. A strain according to claim 1 characterized in that it also
overexpresses one or more genes coding for a glucose 6-phosphate
dehydrogenase, or a 6-phosphogluconolactonase, or a
6-phosphogluconate dehydrogenase, or an isocitrate dehydrogenase or
a membrane-bound transhydrogenase.
7. A strain according to claim 1 characterized in that it has also
undergone the deletion of one or more genes coding for a
6-phosphogluconate dehydratase, or a malate synthase, or an
isocitrate lyase or an isocitrate dehydrogenase
kinase/phosphatase.
8. A strain according to claim 1, characterized in that it
comprises one or more endogenous or exogenous genes coding for
enzymes involved in the biotransformation of a substance of
interest.
9. A strain according to claim 1, characterized in that it
comprises one or more selection marker genes.
10. A strain according to claim 1 characterized in that it is
selected from the group consisting of Aspergillus sp., Bacillus
sp., Brevibacterium sp., Clostridium sp., Corynebacterium sp.,
Escherichia sp., Gluconobacter sp., Penicillium sp., Pichia sp.,
Pseudomonas sp., Rhodococcus sp., Saccharomyces sp., Streptomyces
sp., Xanthomonas sp. and Candida sp.
11. A method for the preparation of the strain of claim 1
comprising deleting one or more genes coding for a quinone
oxidoreductase and/or a soluble transhydrogenase, and optionally
deleting one or more genes coding for a phosphoglucose isomerase,
or a phosphofructokinase, or a 6-phosphogluconate dehydratase, or a
malate synthase, or an isocitrate lyase or an isocitrate
dehydrogenase kinase/phosphatase, and optionally modifying one or
more genes coding for at least one of a dihydrolipoamide
dehydrogenase and a glyceraldehyde 3-phosphate dehydrogenase, so as
to cause it to utilize NADP preferentially, which deletions and
modifications are carried out by appropriate means, and optionally
overexpressing one or more genes coding for a glucose 6-phosphate
dehydrogenase, or a 6-phosphogluconolactonase, or a
6-phosphogluconate dehydrogenase, or an isocitrate dehydrogenase or
a membrane transhydrogenase, either by converting the strain by
means of an appropriate vector containing one or more genes coding
for one or more enzymes involved in the biotransformation of at
least one of a substance of interest and one or more selection
marker genes, or by modifying the strength of the endogenous
promoter or promoters controlling the gene or genes to be
overexpressed.
12. A method for the production of a substance of interest formed
by a biosynthesis route of which at least one step is
NADPH-dependent characterized in that it comprises the following
steps: a) growing micro-organisms of the strain of claim 1 in an
appropriate culture medium that favours their growth and contains
substances necessary for carrying out biotransformations by
fermentation or bioconversion, except NADPH; and b) extracting a
substance of interest from the medium and optionally purifying said
substance.
13. The method according to claim 12 characterized in that the
substance of interest is an amino acid, or a vitamin, or a sterol,
or a flavonoid, or a fatty acid, or an organic acid, or a polyol or
a hydroxyester.
Description
[0001] NADP (nicotinamide adenine dinucleotide phosphate), in its
reduced form NADPH, takes part in intracellular redox reactions
involving enzymes with dehydrogenase or reductase activities.
[0002] The present invention concerns strains of microorganisms
optimized for the production, by biotransformation, of substances
with NADPH-consuming biosynthesis routes. The strains according to
the invention can be used in NADPH-consuming biotransformation
processes. The strains defined according to the invention can be
prokaryotic or eukaryotic. In a preferred embodiment, the
prokaryotic strain is a strain of Escherichia coli. In a further
embodiment the eukaryotic strain is a strain of Saccharomyces, in
particular S. cerevisiae.
[0003] The present invention also concerns a process for the
preparation of substances by biotransformation, through growth in
an appropriate medium of a strain optimized according to the
invention, which optimized strain also includes the genetic
elements necessary for the preparation of such substances.
[0004] Biotransformation processes have been developed to allow the
production of required substances in large quantities and at low
cost, while at the same time making profitable use of various
industrial or agricultural by-products.
[0005] There are two main approaches for producing substances of
interest by in vivo biotransformation: [0006] 1) Fermentation,
whereby a substance is produced by a microorganism from a simple
carbon source (e.g. WO0102547, which describes the production of
lysine by fermentation of C. glutamicum in the presence of
glucose). [0007] 2) Bioconversion by a microorganism of a given
co-substrate into a substance of interest (e.g. WO0012745, which
describes the production of derivatives of R-piperidine, and
WO0068397, which describes the production of tagatose). The
co-substrate is not assimilated and is distinct from the carbon
source, which is used solely to produce the biomass and the NADPH
necessary for bioconversion.
[0008] The improvement of a biotransformation process can concern
various factors such as temperature, oxygenation, medium
composition, recovery process, etc. It can also be possible to
modify a microorganism so as to increase the production and/or
excretion of a substance of interest.
[0009] In a fermentation approach, for example, the biosynthesis
route can be improved, for example, by modifying gene regulation or
by modifying genes to change the characteristics of the enzymes
involved, or by optimizing the regeneration of cofactors.
[0010] In a bioconversion approach the emphasis will be placed on
reducing the formation of by-products and optimizing the
regeneration of the cofactors involved in the bioconversion step or
steps.
[0011] Among the cofactors involved in the biotransformations,
NADPH is important in particular for the production of amino acids
(e.g. arginine, proline, isoleucine, methionine, lysine), vitamins
(e.g. pantothenate, phylloquinone, tocopherol), aromatics (e.g.
WO9401564), polyols (e.g. xylitol), polyamines (e.g. spermidine),
hydroxyesters (e.g. ethyl-4-chloro-3-hydroxybutyrate) and other
high added-value substances.
[0012] The present invention concerns a strain of microorganisms
optimized for the production of substances with NADPH-consuming
biosynthesis routes.
[0013] Instead of seeking to optimize the NADPH/NADP.sup.+ ratio in
the microorganism for each biotransformation, the inventors chose
to produce modified microorganisms in order to obtain different
NADPH/NADP.sup.+ ratios, which modified microorganisms were then
used to carry out NADPH-consuming biotransformations.
[0014] According to the invention a strain of microorganism is
taken to mean a set of microorganisms of the same species
comprising at least one microorganism of that species. Thus the
characteristics described for the strain apply to each of the
microorganisms of that strain. Similarly, the characteristics
described for any one of the microorganisms of the strain apply to
the entire set of the microorganisms of that strain.
[0015] The microorganisms optimized according to the invention
include bacteria, yeasts and filamentous moulds, and in particular
bacteria and yeasts belonging to the following species: Aspergillus
sp., Bacillus sp., Brevibacterium sp., Clostridium sp.,
Corynebacterium sp., Escherichia sp., Gluconobacter sp.,
Penicillium sp., Pichia sp., Pseudomonas sp., Rhodococcus sp.,
Saccharomyces sp., Streptomyces sp., Xanthomonas sp., Candida
sp.
[0016] The principle of optimization of the NADPH/NADP.sup.+ ratio
is described below for E. coli and S. cerevisiae. The same
principle can be similarly applied to all microorganisms grown in
aerobic conditions.
[0017] The principle of optimisation of the NADPH/NADP.sup.+ ratio
consists in limiting the enzyme activities involved in the
oxidation of NADPH, and/or favouring the enzyme activities that
allow the reduction of NADP.sup.+. The enzyme activities involved
in the oxidation of NADPH are limited by reducing, and in
particular by inactivating, those activities, especially activities
such as quinone oxidoreductase and/or soluble transhydrogenase. The
enzyme activities that favour the reduction of NADP.sup.+ are
enhanced by setting the carbon flux via the pentose phosphate cycle
and/or by modifying the cofactor specificity of at least one enzyme
so that it uses NADP in preference to NAD, its usual cofactor.
[0018] The strains optimized according to the invention are
obtained by molecular biology methods. Those skilled in the art
know the protocols used to modify the genetic character of
microorganisms. These methods are documented and can be readily
implemented by those skilled in the art (Sambrook et al., 1989
Molecular cloning: a laboratory manual. 2.sup.nd Ed. Cold Spring
Harbor Lab., Cold Spring Harbor, N.Y.).
[0019] The methods used to limit an enzyme activity consist in
modifying the gene that expresses it by means of an appropriate
method, for example by causing one or more mutations in the coding
part of the gene concerned, or by modifying the promoter region, in
particular by replacing it with a sequence that reduces the gene
expression.
[0020] The methods used to inactivate an enzyme consist in
inactivating the product of the expression of the gene concerned by
means of an appropriate method, or in inhibiting the expression of
the gene concerned, or in deleting at least a part of the gene
concerned so that its expression is prevented (for example deleting
part or all of the promoter region necessary for its expression),
or so that the expression product loses its function (for example
by deletion in the coding part of the gene concerned).
[0021] Preferentially, the deletion of a gene comprises the removal
of that gene, and if required its replacement by a selection marker
gene to facilitate the identification, isolation and purification
of the strains optimized according to the invention.
[0022] The inactivation of a gene in E. coli is preferably carried
out by homologous recombination (Datsenko K. A., Wanner B. L.
(2000) One-step inactivation of chromosomal genes in Escherichia
coli K-12 using PCR products. Proc. Natl. Acad. Sci. USA 97:
6640-6645). The principle of a protocol is briefly as follows: a
linear fragment, obtained in vitro, comprising the two regions
flanking the gene, and at least one selection gene located between
these two regions (generally an antibiotic resistance gene), is
introduced into the cell. This fragment thus contains an
inactivated gene. Cells that have undergone a recombination event
and integrated the introduced fragment are then selected by plating
on a selective medium. Cells that have undergone a double
recombination event, in which the wild gene has been replaced by
the inactivated gene, are then selected. This protocol can be
improved by using positive and negative selection systems, in order
to speed up the detection of double recombination events.
[0023] The inactivation of a gene in S. cerevisiae is also
performed preferentially by homologous recombination (Baudin et
al., Nucl. Acids Res. 21, 3329-3330, 1993; Wach et al., Yeast 10,
1793-1808, 1994; Brachmann et al., Yeast. 14:115-32, 1998).
[0024] The processes that favour an enzyme activity involve
stabilizing the product of the expression of the gene concerned by
appropriate means, for example by diminishing its sensitivity to
allosteric effectors, or by enhancing the expression of the gene so
as to increase the quantity of enzyme produced.
[0025] The overexpression of a gene can be achieved by replacing
the promoter of the gene in situ by a strong or inducible promoter.
Alternatively, a replicative plasmid (single or multiple copy) is
introduced into the cell in which the gene to be overexpressed is
under the control of the appropriate promoter. In the case of
modification of Escherichia coli, it is possible, for example, to
use the promoters Plac-o, Ptrc-o, and ptac-o, three strong
bacterial promoters for which the lac operator (lacO) has been
deleted to make them constitutive. In the case of modifications of
Saccharomyces cerevisiae, it is possible, for example, to use the
promoters Ppgk, Padh1, Pgal1, Pgal10.
[0026] The processes that can be used to modify the cofactor
specificity of an enzyme so that it uses NADP in preference to NAD
involve modifying the sequence of the gene that allows the
expression of that enzyme (Bocanegra, J. A. Scrutton, N. S.;
Perham, R. N. (1993) Creation of an NADP-dependent pyruvate
dehydrogenase multienzyme complex by protein engineering.
Biochemistry 32: 2737-2740).
[0027] The strains optimized according to the invention, i.e. with
enhanced capacity for NADP.sup.+ reduction, are characterized by
the attenuation or inactivation of one or more NADPH-oxidizing
enzyme activities, and in particular activities of the quinone
oxidoreductase and/or soluble transhydrogenase type.
[0028] Below are listed some non-limiting examples of activities
and genes of NADPH-oxidizing enzymes: TABLE-US-00001 E. coli S.
cerevisiae Enzyme activity EC number gene gene Alcohol
dehydrogenase 1.1.1.2 yahK ADH6 Aldose reductase 1.1.1.21 GRE3
Shikimate dehydrogenase 1.1.1.25 aroE ARO1 Methylglyoxal reductase
1.1.1.78 GRE2p Gamma-glutamyl phosphate 1.2.1.41 proA PRO2
reductase 2,4-dienoyl coenzyme A 1.3.1.34 fadH reductase Glutamate
dehydrogenase 1.4.1.4 gdhA GDH1, GDH2 Glutamate synthase 1.4.1.13
gltB, gltD GLT1 Methylenetetrahydrofolate 1.5.1.5 folD ADE3, MIS1
dehydrogenase Soluble transhydrogenase 1.6.1.1 udhA Membrane-bound
1.6.1.2 pntA, pntB transhydrogenase Quinone oxidoreductase 1.6.5.5
qor ZTA1 Nitrite reductase 1.7.1.4 nirB, nirD Sulphite reductase
1.8.1.2 cysI, cysJ Sterol demethylase 1.14.13.70 ERG11
4-Hydroxy-3-methylbut- 1.17.1.2 ispH 2-enyl diphosphate reductase
Flavodoxin reductase 1.18.1.2 fpr
[0029] The strains optimized according to the invention (i.e. with
enhanced capacity for NADP.sup.+ reduction) also include
modifications that favour one or more NADP.sup.+-reducing enzyme
activities, and in particular modifications that set the carbon
flux via the pentose phosphate pathway, and/or modifications
concerning the cofactor specificity of at least one enzyme, so that
it utilizes NADP in preference to NAD, its usual cofactor.
[0030] The activities that are susceptible to modification in the
optimized strains according to the invention (i.e. with enhanced
capacity for NADP.sup.+ reduction) to favour one or more
NADP.sup.+-reducing enzyme activities are listed below:
TABLE-US-00002 E. coli S. cerevisiae Enzyme activity EC number gene
gene Phosphoglucose isomerase 5.3.1.9 pgi PGI2 Phosphofructokinase
2.7.1.11 pfkA, pfkB PFK1, PFK2 Glucose 6-phosphate 1.1.1.49 zwf
ZWF1 dehydrogenase 6-Phosphogluconolactonase 3.1.1.31 SOL1, SOL2,
SOL3, SOL4 6-Phosphogluconate 1.1.1.44 gnd GND1, GND2 dehydrogenase
6-Phosphogluconate 4.2.1.12 edd dehydratase Malate synthase 2.3.3.9
aceB DAL7 Isocitrate lyase 4.1.3.1 aceA ICL1 Isocitrate
dehydrogenase 1.1.1.42 icd IDP1, IDP2, IDP3 Isocitrate
dehydrogenase 2.7.1.116 aceK kinase/phosphatase Dihydrolipoamide
1.8.1.4 lpd LPD1 dehydrogenase Glyceraldehyde-3- 1.2.1.12 gapA,
gapC TDH1, TDH2, phosphate dehydrogenase TDH3
[0031] The enzyme activities susceptible to modification in the
optimized strains according to the invention are mainly defined
using the denomination of the protein or gene in E. coli or S.
cerevisiae. However, this usage has a more general meaning
according to the invention, and covers the corresponding enzyme
activities in other microorganisms. Using the sequences of proteins
and genes in E. coli or S. cerevisiae, those skilled in the art can
identify the equivalent genes in microorganisms other than E. coli
or S. cerevisiae.
[0032] The means of identifying homologous sequences and their
percentages of homology are well known to those skilled in the art,
and include, in particular, the BLAST program, which can be used
from the website http://www.ncbi.nlm.nih.gov/BLAST/ with the
default parameters indicated there. The sequences obtained can then
be exploited (e.g. aligned) using, for example, the CLUSTALW
program (http://www.ebi.ac.uk/clustalw/) or the MULTALIN program
(http://prodes.toulouse.inra.fr/multalin/cgi-bin/multalin.pl), with
the default parameters indicated on their websites.
[0033] Alternatively, the CD-Search program
(http://www.ncbi.nih.gov/Structure/cdd/wrpsb.cgi) can be used to
identify the conserved domains in the protein sequences of E. coli
or S. cerevisiae, and to seek the sequences of other microorganisms
presenting the same domain or domains. The conserved domains are
recorded in the CDD database (Conserved domain database;
Marchler-Bauer A, Anderson J B, DeWeese-Scott C, Fedorova N D, Geer
L Y, He S, Hurwitz D I, Jackson J D, Jacobs A R, Lanczycki C J,
Liebert C A, Liu C, Madej T, Marchler G H, Mazumder R, Nikolskaya A
N, Panchenko A R, Rao B S, Shoemaker B A, Simonyan V, Song J S,
Thiessen P A, Vasudevan S, Wang Y, Yamashita R A, Yin J J, Bryant S
H. CDD: a curated Entrez database of conserved domain alignments.
Nucleic Acids Research 31:383-387 (2003)) which groups data of the
PFAM or COG type.
[0034] The PFAMs (Protein FAMilies database of alignments and
hidden Markov models; http://www.sanger.ac.uk/Software/Pfam/) are a
large collection of alignments of protein sequences. Each PFAM
makes it possible to visualize multiple alignments, see protein
domains, evaluate distribution among organisms, access other
databases, and visualize known protein structures.
[0035] The COGs (Clusters of Orthologous Groups of proteins;
http://www.ncbi.nlm.nih.gov/COG/) are obtained by comparing protein
sequences from 43 fully sequenced genomes representing 30 major
phylogenetic lines. Each COG is defined from at least three lines,
thus making it possible to identify ancient conserved domains.
[0036] From consensus sequences identified by these different
methods, it is possible to design degenerate oligonucleotide probes
to clone the corresponding gene in another microorganism. These
routine molecular biology methods are well known to those skilled
in the art and are described, for example, in Sambrook et al. (1989
Molecular cloning: a laboratory manual. 2.sup.nd Ed. Cold Spring
Harbor Lab., Cold Spring Harbor, N.Y.).
[0037] Examples of Genes Coding for Proteins Analogous to the
Soluble Transhydrogenase of E. coli Coded for by the udhA Gene:
TABLE-US-00003 Gene Microorganism sth Azotobacter vinelandii udhA
Salmonella typhimurium LT2 sthA Pseudomonas aeruginosa PA01 sth
Pseudomonas fluorescens sthA Pseudomonas putida KT2440 udhA
Shigella flexneri 2a str. 301 sthA Vibrio cholera sthA Yersinia
pestis
[0038] Examples of Genes Coding for Proteins Analogous to the
Quinone Oxidoreductase of E. coli Coded for by the qor Gene:
TABLE-US-00004 Gene Microorganism qor Bradyrhizobium japonicum USDA
110 qor Brucella suis 1330 CC3759 Caulobacter crescentus mII0505
Mesorhizobium loti qor Mycobacterium tuberculosis H37RV qor
Pseudomonas aeruginosa ZTA1 S. cerevisiae SPCC285.01c
Schizosaccharomyces pombe drgA Synechocystis sp. PCC6803 qorA
Staphylococcus aureus TTC0305 Thermus thermophilus HB8 qor Yersinia
pestis CO92
[0039] The strains optimised according to the invention (i.e. with
enhanced capacity for NADP.sup.+ reduction) are characterized by
the deletion of at least one gene coding for a NADPH-oxidizing
activity, and in particular, the deletion of a gene coding for a
quinone oxidoreductase (e.g. qor, ZTA1) and/or a gene coding for a
soluble transhydrogenase activity (e.g. udhA).
[0040] In a preferred embodiment of the invention the udhA and qor
genes are both deleted.
[0041] In a specific embodiment of the invention the strains
optimized according to the invention are also characterized by the
deletion of one or several genes coding for phosphoglucose
isomerase activity (e.g. pgi, PGI1) and/or phosphofructokinase
activity (e.g. pfkA, PFK1).
[0042] In a further specific embodiment of the invention the
strains optimized according to the invention are also characterized
by the modification of one or several genes coding for
dihydrolipoamide dehydrogenase (e.g. lpd, LPD1) and/or
glyceraldehyde 3-phosphate dehydrogenase (e.g. gapA, TDH1)
activities, which modification consists in causing the enzyme to
prefer NADP over NAD, its usual cofactor.
[0043] The strains of the invention characterized by the deletion
of genes coding for phosphoglucose isomerase and/or
phosphofructokinase activities are particularly well suited to
biotransformation processes.
[0044] To increase the quantity of NADPH available in the
microorganisms optimized according to the invention, it can be
advantageous to overexpress at least one gene coding for one of the
following enzyme activities: glucose 6-phosphate dehydrogenase
(e.g. zwf, ZWF1), 6-phosphogluconolactonase (e.g. SOL1),
6-phosphogluconate dehydrogenase (e.g. gnd, GND1), isocitrate
dehydrogenase (e.g. icd, IDP1) and membrane-bound transhydrogenase
(e.g. pntA), and/or to delete at least one gene coding for one of
the following enzyme activities: phosphogluconate dehydratase (e.g.
edd), malate synthase (e.g. aceB, DAL7), isocitrate lyase (e.g.
aceA, ICL1) and isocitrate dehydrogenase kinase/phosphatase (e.g.
aceK).
[0045] A further object of the present invention is a microorganism
optimized for the production of NADPH as defined above and below,
which microorganism also contains one or several genes coding for
enzyme activities involved in the biotransformation of a substance
of interest, and one or several selection marker genes.
[0046] These genes can be native to the strain optimized by the
invention, or be introduced into the strain optimized by the
invention by conversion using a suitable vector, either by
integration in the genome of the microorganism or by a replicative
vector, which suitable vector bears one or several genes coding for
the relevant enzymes involved in the biotransformation of the
relevant substance of interest and/or the relevant selection
markers.
[0047] These genes include a nucleic acid sequence coding for an
enzyme involved in the biotransformation of the substance of
interest and/or for a selection marker, which coding sequence is
merged with efficient promoter sequences in the prokaryote and/or
eukaryote cell selected for biotransformation. The vector (or
plasmid) can be a shuttle vector between E. coli and another
microorganism.
[0048] The choice of the strain optimized for the NADPH/NADP.sup.+
ratio will be determined according to the type of biotransformation
(fermentation or bioconversion), the total demand for NADPH in the
bioconversion pathway considered, the nature of the carbon source
or sources, the biomass flux demand, etc.
[0049] The deletion of genes coding for phosphoglucose isomerase
and/or phosphofructokinase activities will be necessary if it is
not possible to control the distribution of the carbon flux between
glucolysis and the pentose phosphate pathway. The deletion of genes
coding for phosphoglucose isomerase will be preferred for
fermentations or when the demand for NADPH requires a minimum
reduction flux of 2 moles of NADP.sup.+ per mole of imported
glucose. The deletion of genes coding for phosphofructokinase will
be chosen preferentially for bioconversions or when the demand for
NADPH requires a minimum reduction flux of 3-4 moles of NADP.sup.+
per mole of imported glucose. The modification, as described above
and below, of genes coding for dihydrolipoamide dehydrogenase
and/or glyceraldehyde 3-phosphate dehydrogenase will be carried out
when biotransformations require a minimum reduction flow greater
than 3 moles of NADP.sup.+ per mole of imported glucose and in
particular to optimize the strains E. coli .DELTA.(udhA, qor) or E.
coli .DELTA.(udhA, qor, pgi) or E. coli .DELTA.(udhA, qor, pfkA,
pfkB). The other stated modifications, namely the overexpression of
at least one gene coding for one of the following enzyme
activities: glucose 6-phosphate dehydrogenase,
6-phosphogluconolactonase, 6-phosphogluconate dehydrogenase,
isocitrate dehydrogenase and membrane transhydrogenase, and/or
deletion of at least one gene coding for one of the following
enzyme activities: 6-phosphogluconate dehydratase, malate synthase,
isocitrate lyase or isocitrate dehydrogenase kinase/phosphatase,
can be carried out to fine-tune the optimization of the
NADPH/NADP.sup.+ ratio to the needs of the cell and of the
biotransformation process being considered.
[0050] The present invention also concerns a procedure for
preparing strains optimized according to the invention as defined
above and below, characterized by the deletion of a gene coding for
quinone oxidoreductase or soluble transhydrogenase activities, and
possibly by the deletion of a gene coding for glucose 6-phosphate
dehydrogenase or 6-phosphogluconolactonase activities, and/or by
the modification of at least one gene coding for NAD enzymes, in
particular for dihydrolipoamide dehydrogenase or glyceraldehyde
3-phosphate dehydrogenase, so that they preferentially use NADP,
and if required, by the deletion of at least one gene coding for
6-phosphogluconate dehydratase, malate synthase, isocitrate lyase
or isocitrate dehydrogenase kinase/phosphatase, which deletions and
modifications are carried out by suitable means, and/or
characterized by the overexpression of at least one gene coding for
the following activities: glucose 6-phosphate dehydrogenase,
6-phosphogluconolactonase, 6-phosphogluconate dehydrogenase,
isocitrate dehydrogenase or membrane transhydrogenase, either by
modifying the strain using a suitable vector that allows the
overexpression, or by modifying the strength of the endogenous
promoter controlling the gene that is to be overexpressed.
[0051] In a specific embodiment of the invention, the process for
preparing strains according to the invention also includes the
conversion of the optimized strains with at least one suitable
vector that includes one or more genes coding for one or more
enzymes involved in the biotransformation of a substance of
interest, and one or more selection marker genes.
[0052] A further object of the invention concerns the use of these
strains optimized according to the invention for NADPH-dependent
biotransformations, thereby obtaining an improved biotransformation
yield compared with a strain not optimized for NADPH.
[0053] The biotransformations will be carried out using strains
defined according to the invention in which genes will be expressed
that code for enzyme activities catalyzing NADPH-dependent
reactions. Those skilled in the art can easily identify such
enzymes. They include the following among others: EC 1.1.1.10
L-xylulose reductase, EC 1.1.1.21 methylglyoxal reductase, EC
1.1.1.51 3(or 17).beta.-hydroxysteroid dehydrogenase, EC 1.1.1.54
allyl-alcohol dehydrogenase, EC 1.1.1.80 isopropanol dehydrogenase,
EC 1.1.1.134 dTDP-6-deoxy-L-talose 4-dehydrogenase, EC 1.1.1.149
20.alpha.-hydroxysteroid dehydrogenase, EC 1.1.1.151
21-hydroxysteroid dehydrogenase, EC 1.1.1.189 prostaglandin-E.sub.2
9-reductase, EC 1.1.1.191 indole-3-acetaldehyde reductase EC
1.1.1.207 (-)-menthol dehydrogenase, EC 1.1.1.234 flavanone
4-reductase, EC 1.2.1.50 long-chain-fatty-acyl-CoA reductase, EC
1.3.1.4 cortisone .alpha.-reductase, EC 1.3.1.23 cholestenone
5.beta.-reductase, EC 1.3.1.70 .DELTA..sup.14-sterol reductase, EC
1.4.1.12 2,4-diaminopentanoate dehydrogenase, EC 1.5.1.10
saccharopine dehydrogenase, L-glutamate-forming, EC 1.7.1.6
azobenzene reductase, EC 1.8.1.5 2-oxopropyl-CoM reductase
(carboxylating), EC 1.10.1.1 trans-acenaphthene-1,2-diol
dehydrogenase, EC 1.14.13.7 phenol 2-monooxygenase, EC 1.14.13.12
benzoate 4-mono-oxygenase, EC 1.14.13.26 phosphatidylcholine
12-mono-oxygenase, EC 1.14.13.64 4-hydroxybenzoate 1-hydroxylase,
EC 1.14.13.70 sterol 14-demethylase, EC 1.16.1.5 aquacobalamine
reductase, EC 1.17.1.1 CDP-4-dehydro-6-deoxyglucose reductase, EC
1.18.1.2 ferredoxin-NADP reductase.
[0054] The invention also concerns a process for producing a
substance of interest formed by a biosynthesis route that includes
at least one NADPH-dependent reaction, characterized in that it
comprises the following steps: [0055] a) Growth in culture of
microorganisms optimized according to the invention in an
appropriate culture medium that favours their growth and that
contains the substances necessary to carry out the
biotransformation by fermentation or bioconversion, except NADPH.
[0056] b) Extraction of the substance of interest from the medium
and its purification if necessary.
[0057] Preferably, the substance of interest can be an amino acid,
a vitamin, a sterol, a flavonoid, a fatty acid, an organic acid, a
polyol, or a hydroxyester. Amino acids and their precursors include
in particular lysine, methionine, threonine, proline, glutamic
acid, homoserine, isoleucine, and valine. Vitamins and their
precursors include in particular pantoate, trans-neurosporene,
phylloquinone and tocopherols. Sterols include in particular
squalene, cholesterol, testosterone, progesterone and cortisone.
Flavonoids include in particular frambinone and vestitone. Organic
acids include coumaric acid and 3-hydroxypropionic acid. Polyols
include sorbitol, xylitol and glycerol. Hydroxyesters include
ethyl-3-hydroxybutyrate and ethyl-4-chloro-3-hydroxybutyrate.
[0058] In the case of a bioconversion, the process also includes
the addition to the appropriate culture medium of the substrate
that is to be converted.
[0059] The culture medium mentioned in step b) of the process
according to the invention described above contains at least one
assimilable carbohydrate that can be any of various assimilable
sugars, such as glucose, galactose, sucrose, lactose, molasses, or
by-products of these sugars. A simple source of carbon that is
especially preferred is glucose. Another preferred simple carbon
source is sucrose. The culture medium can also contain one or more
substances (e.g. amino acids, vitamins or mineral salts) that
favour the growth of the microorganism and/or the production of the
substance of interest. In particular, the mineral culture medium
for E. coli can thus have a composition identical or similar to an
M9 medium (Anderson, 1946, Proc. Natl. Acad. Sci. USA 32:120-128),
an M63 medium (Miller, 1992; A Short Course in Bacterial Genetics:
A Laboratory Manual and Handbook for Escherichia coli and Related
Bacteria, Cold Spring Harbor Laboratory Press, Cold Spring Harbor,
N.Y.) or a medium such as that described by Schaefer et al. (1999,
Anal. Biochem. 270: 88-96).
[0060] The biotransformation conditions are set by those skilled in
the art. In particular, the microorganisms are fermented at a
temperature between 20.degree. C. and 55.degree. C., preferably
between 25.degree. C. and 40.degree. C., and preferably at about
30.degree. C. for S. cerevisiae and at about 37.degree. C. for E.
coli.
[0061] The following examples are given for illustration only and
in no way restrict the embodiments or the scope of the
invention.
EXAMPLE 1
Calculation of Theoretical Optimal Yields for the Bioconversion of
Ethylacetoacetate into ethyl-3-hydroxybutyrate
a) Bioconversion with E. coli
[0062] Predictive modelling was carried out using the algorithm
MetOpt.RTM.-Coli, a stoichiometric model developed by the company
METabolic EXplorer, with which it was possible to determine 1) the
maximum production yield of ethyl-3-hydroxybutyrate from
ethylacetoacetate, and 2) the best flux distribution from glucose
to meet the needs for growth and redox equilibria that are
necessary for the cell to grow and reach the maximum bioconversion
yield.
[0063] Specific settings of model variables were 1) a glucose
import flux of 3 mmol.g.sup.-1.h.sup.-1, 2) a variable growth rate
of 0, 0.15 and 0.25 h.sup.-1, 3) a variable membrane-bound
transhydrogenase flux (pntAB) less than or equal to 1
mmol.g.sup.-1.h.sup.-1; the limiting value of the membrane-bound
transhydrogenase flux was determined from the literature (Hanson,
1979; Anderlund et al., 1999; Emmerling et al., 2002), and 4) a
maintenance flux limited at between 5 and 22
mmol.g.sup.-1.h.sup.-1.
[0064] In all cases the model suggested the deletion of the udhA
and qor genes. In practice, however, the strain E. coli
[.DELTA.(udhA, qor)] does not afford a yield equivalent to the
theoretical optimal yield, as it is difficult to maintain a
suitable distribution of carbon flux between the pentose phosphate
pathway and glycolysis, this distribution being variable according
to the growth rate. In practice therefore, the strains E. coli
[.DELTA.(udhA, qor, pfkA, pfkB)] or [.DELTA.(udhA, qor, pgi)] are
preferred, the choice between them depending on the growth rate of
the strain during the bioconversion process.
[0065] The theoretical optimal yields for the bioconversion of
ethylacetoacetate into ethyl-3-hydroxybutyrate were calculated for
different strains of E. coli optimized according to the invention.
TABLE-US-00005 .mu. = 0 .mu. = 0.15 h.sup.-1 .mu. = 0.25 h.sup.-1
.DELTA.(udhA, qor, pgi) 1.82 1.74 1.22 .DELTA.(udhA, qor, pgi) 4.29
3.64 2.43 gapA-NADP-dependent .DELTA.(udhA, qor, pgi) 5.67 3.46
1.99 lpd-NADP-dependent .DELTA.(udhA, qor, pgi) 6.86 4.96 3.33
gapA-NADP-dependent lpd-NADP-dependent .DELTA.(udhA, qor, pfkA,
pfkB) 6.76 4.65 0.19 .DELTA.(udhA, qor, pfkA, pfkB) 8.16 5.54 1.02
gapA-NADP-dependent .DELTA.(udhA, qor, pfkA, pfkB) 8.33 5.60 1.77
lpd-NADP-dependent .DELTA.(udhA, qor, pfkA, pfkB) 9.33 6.38 2.60
gapA-NADP-dependent lpd-NADP-dependent
Theoretical Optimal Yields for the Bioconversion of
Ethylacetoacetate into ethyl-3-hydroxybutyrate (Mol Per Mol of
Glucose) by Strains of E. coli Optimized for NADP.sup.+ Reduction
Capacity
[0066] To further improve the theoretical optimal yield of the
strains optimized according to the invention, additional
modifications can be made, such as the overexpression of at least
one gene that can be zwf, gnd, pntA, pntB or icd and/or the
deletion of at least one gene that can be edd, aceA, aceB or
aceK.
b) Bioconversion with S. cerevisiae
[0067] Predictive modelling was carried out using the algorithm
MetOpt.RTM.-Scere, a stoichiometric model developed by the Company,
with which it was possible to determine 1) the maximum production
yield of ethyl-3-hydroxybutyrate from ethylacetoacetate, 2) the
best flux distribution from glucose to meet the needs of the growth
and redox equilibria necessary for the cell to grow and reach the
maximum bioconversion yield.
[0068] Specific settings of model variables were 1) a glucose
import flux of 3 mmol.g.sup.-1.h.sup.-1, 2) a variable growth rate
of 0, 0.15 and 0.25 h.sup.-1, 3) a maintenance flux de maintenance
less than or equal to 22 mmol.g.sup.-1.h.sup.-1, 4) aldehyde
dehydrogenase reactions (ALD2, ALD3, ALD6) irreversible and set in
the direction acetate+NAD(P)H.fwdarw.acetaldehyde+NAD(P), and 5) no
activities equivalent to udhA or pntA,B.
[0069] The model allowed for mitochondrial and peroxisomal
compartmentalization.
[0070] In all cases, the model suggested the deletion of a gene
coding for an enzyme oxidizing NADPH, and in particular gene ZTA1.
However, in practice, the strain S. cerevisiae [.DELTA.ZTA1] does
not provide a yield equivalent to the theoretical optimum yield, as
it is difficult to maintain a suitable distribution of carbon flux
between the pentose phosphate and glycolysis pathways, because this
distribution varies with the growth rate. In practice it is
preferable to use the strains S. cerevisiae [.DELTA.(ZTA1, PFK1,
PFK2)] or [.DELTA.(ZTA1, PGI1)], the choice between them depending
on rate of growth of the strain during the bioconversion
process.
[0071] The theoretical optimal yields for the bioconversion of
ethylacetoacetate into ethyl-3-hydroxybutyrate were calculated for
different strains of S. cerevisiae optimized according to the
invention. TABLE-US-00006 .mu. = 0 .mu. = 0.15 h.sup.-1 .mu. = 0.25
h.sup.-1 .DELTA.(ZTA1, PGI1) 2.42 2.00 1.73 .DELTA.(ZTA1, PGI1)
4.22 3.50 3.03 TDH1,2,3-NADP-dependent .DELTA.(ZTA1, PGI1) 4.08
3.29 2.77 LPD1-NADP-dependent .DELTA.(ZTA1, PGI1) 6.17 5.01 4.23
TDH1,2,3-NADP-dependent LPD1-NADP-dependent .DELTA.(ZTA1, PFK1,
PFK2) 12.00 8.18 5.64 .DELTA.(ZTA1, PFK1, PFK2) 12.00 9.11 7.19
TDH1,2,3-NADP-dependent .DELTA.(ZTA1, PFK1, PFK2) 12.00 8.44 6.06
LPD1-NADP-dependent .DELTA.(ZTA1, PFK1, PFK2) 12.00 9.28 7.46
TDH1,2,3-NADP-dependent LPD1-NADP-dependent
Theoretical Optimal Yields for the Bioconversion of
Ethylacetoacetate into ethyl-3-hydroxybutyrate (Mol Per Mol of
Glucose) by Strains of S. cerevisiae Optimized for NADP.sup.+
Reduction Capacity
[0072] To further improve the theoretical optimum yield of the
strains optimized according to the invention, additional
modifications can be made, such as the overexpression of at least
one gene that can be ZWF, SOL1, SOL2, SOL3, SOL4, GND1, GND2, IDP1,
IDP2 or IDP3 and/or the deletion of at least one gene that can be
either ICL1 or DAL7.
EXAMPLE 2
Construction of the Strain E. coli [.DELTA.(udhA, qor)]
[0073] The inactivation of the udhA gene was achieved by homologous
recombination using the method described by Datsenko and Wanner
(One-step inactivation of chromosomal genes in Escherichia coli
K-12 using PCR products, Proc. Natl. Acad. Sci. USA, 2000, 97:
6640-6645).
[0074] This method consists in inserting an antibiotic
(chloramphenicol) resistance cassette while at the same time
deleting most of the gene concerned. For this purpose a pair of
oligonucleotides was synthesized, each consisting of 100 pb of
which 80 pb (lower case) were homologous with the gene to be
deleted (e.g. udhA) and 20 pb (upper case) were homologous with the
chloramphenicol resistance cassette. TABLE-US-00007 DudhAF
ggtgcgcgcgtcgcagttatcgagcgttatcaaaatgttggcggcggttg
cacccactggggcaccatcccgtcgaaagcCATATGAATATCCTCCTTAG DudhAR
Cccagaatctcttttgtttcccgatggaacaaaattttcagcgtgcccac
gttcatgccgacgatttgtgcgcgtgccagTGTAGGCTGGAGCTGCTTCG
[0075] The antibiotic cassette carried by the plasmid pKD3 was
amplified by PCR using the oligonucleotides DudhAF and DudhAR. The
PCR product obtained was then introduced by electroporation into
the strain E. coli [pKD46], which carries the gene coding for Red
recombinase, an enzyme that catalyzes homologous recombination. The
chloramphenicol-resistant transformants were then selected and the
insertion of the resistance cassette was checked by PCR analysis
using the oligonucleotides UdhAF and UdhAR: TABLE-US-00008 UdhaF
Ggccgctcaggatatagccagataaatgac UdhaR
Gcgggatcactttactgccagcgctggctg
[0076] The chloramphenicol resistance cassette was then removed. To
do this, the plasmid pCP20 carrying the FLP recombinase acting on
the FRT sites of the chloramphenicol resistance cassette was
introduced into the recombinant strains by electroporation. After a
series of cultures at 42.degree. C., the loss of the antibiotic
resistance cassette was checked by PCR analysis with the
oligonucleotides UdhAF and UdhAR.
[0077] The inactivation of the gene qor was carried out by the same
method using the following oligonucleotides: TABLE-US-00009 DqorF
ggtggcccggaagtacttcaagccgtagagttcactcctgccgatccggc
ggagaatgaaatccaggtcgaaaataaagcCATATGAATATCCTCCTTAG DqorR
cgcccggctttccagaatctcatgcgcacgctgcgcatccttcagcggat
atttctgctgctcggcgacatcgaccttaaTGTAGGCTGGAGCTGCTTCG QorF
Cgcccaacaccgactgctccgcttcgatcg QorR
cagcgttatgaccgctggcgttactaaggg
[0078] For practical reasons it can be useful to delete the two
genes simultaneously. To do this each gene was replaced by a
different antibiotic resistance cassette (e.g. chloramphenicol for
udhA and kanamycin for qor).
[0079] The strain obtained was thus E. coli [.DELTA.(udhA,
qor)].
EXAMPLE 3
Construction of the Plasmid pSK-PgapA-GRE2p, Introduction into the
Strain E. coli [.DELTA.(udhA, qor)] and Bioconversion of
Ethylacetoacetate into ethyl-3-hydroxybutyrate
[0080] The plasmid pSK-PgapA was constructed by insertion of the
promoter gapA in the vector pBluescript-SK (pSK). To do this, the
promoter gapA of E. coli was amplified with polymerase Pwo from
chromosomal DNA.
[0081] The PCR product obtained was then digested by the
restriction enzyme HindIII and ligated to the vector pSK digested
by the restriction enzyme HindIII and dephosphorylated to give the
plasmid pSK-PgapA. The vector pSK carried a replication origin for
E. coli and an ampicillin resistance gene.
[0082] The plasmid pSK-PgapA was then introduced into the strain E.
coli DH5.alpha. for verification of the construction. The
sequencing of the promoter gapA of the plasmid pSK-PgapA with the
oligonucleotide universal M13 forward was then carried out to
confirm the construction.
[0083] The plasmid pSK-PgapA-GRE2p was constructed by insertion of
the gene GRE2p in the plasmid pSK-PgapA. To do this, the gene GRE2p
of Saccharomyces cerevisiae was amplified with polymerase Pwo from
chromosomal DNA using the following oligonucleotides:
TABLE-US-00010 Ome119_GRE2F (NdeI)
Acgtacgtggcatatgcagttttcgtttcaggtgctaacggg Ome120_GRE2R (PstI)
Acgtacctgcagttatattctgccctcaaattttaaaatttggg
[0084] The PCR product obtained was then digested by restriction
enzymes NdeI-PstI and ligated to the vector pSK-PgapA digested by
the restriction enzymes NdeI-PstI and dephosphorylated to give the
plasmid pSK-PgapA-GRE2p. The plasmid pSK-PgapA carried a
replication origin for E. coli and an ampicillin resistance
gene.
[0085] The plasmid pSK-PgapA-GRE2p was then introduced into the
strain E. coli DH5.alpha. to check the construction. The sequencing
of the gene GRE2p of the plasmid pSK-PgapA-GRE2p with the
oligonucleotide universal M13 reverse and universal M13 forward was
then carried out to confirm the construction.
[0086] The validated plasmid was introduced into the strain E. coli
[.DELTA.(udhA, qor)] (Example 2) by electroporation.
[0087] The strain obtained, E. coli [.DELTA.(udhA, qor)
pSK-PgapA-GRE2p], was then grown in minimum medium containing
glucose and ethylacetoacetate. A strain of E. coli
[pSK-PgapA-GRE2p] was grown in the same conditions.
[0088] When growth was completed the following variables were
compared: [0089] The time course of the biomass of each strain
during the bioconversion phase. [0090] The quantity of
ethyl-3-hydroxybutyrate produced in the extracellular medium.
[0091] The quantity of ethyl-3-hydroxybutyrate accumulated in the
cells. [0092] The productivity in terms of ethyl-3-hydroxybutyrate.
[0093] The yield glucose/ethyl-3-hydroxybutyrate.
[0094] It was found that the strain E. coli [.DELTA.(udhA, qor)
pSK-PgapA-GRE2p] gave a greater production yield of
ethyl-3-hydroxybutyrate than the non-optimized strain.
EXAMPLE 4
Construction of the Strain E. coli [.DELTA.(udhA, qor, pgi)
pSK-PgapA-GRE2p] and Bioconversion of Ethylacetoacetate into
ethyl-3-hydroxybutyrate
[0095] The inactivation of the gene pgi was carried out in the
strain E. coli [.DELTA.(udhA, qor)] (Example 2) using the method
described in Example 2, and the following oligonucleotides:
TABLE-US-00011 DpgiF
ccaacgcagaccgctgcctggcaggcactacagaaacacttcgatgaaat
gaaagacgttacgatcgccgatctttttgcTGTAGGCTGGAGCTGCTTCG DpgiR
gcgccacgctttatagcggttaatcagaccattggtcgagctatcgtggc
tgctgatttctttatcatctttcagctctgCATATGAATATCCTCCTTAG pgiF
gcggggcggttgtcaacgatggggtcatgc pgiR
cggtatgatttccgttaaattacagacaag
[0096] The construction was carried out in rich medium (e.g. LB).
The plasmid pSK-PgapA-GRE2p was then introduced into the strain
obtained (Example 3) by electroporation, and the resulting strain
E. coli [.DELTA.(udhA, qor, pgi) pSK-PgapA-GRE2p] was selected on
rich medium.
[0097] The strain obtained was then grown on minimum medium
containing glucose and ethylacetoacetate. A strain of E. coli
[pSK-PgapA-GRE2p] was grown under the same conditions.
[0098] When growth was completed the following variables were
compared: [0099] The time course of the biomass of each strain
during the bioconversion phase. [0100] The quantity of
ethyl-3-hydroxybutyrate produced in the extracellular medium.
[0101] The quantity of ethyl-3-hydroxybutyrate accumulated in the
cells. [0102] The productivity in terms of ethyl-3-hydroxybutyrate.
[0103] The yield glucose/ethyl-3-hydroxybutyrate.
[0104] We observed that the strain E. coli [.DELTA.(udhA, qor, pgi)
pSK-PgapA-GRE2p] gave a greater production yield of
ethyl-3-hydroxybutyrate than the non-optimized strain.
TABLE-US-00012 mol.sub.EHB/mol.sub.Glucose MG1655 pSK-PgapA-GRE2p
0.75 MG1655 .DELTA.(udhA, qor, pgi) pSK-PgapA-GRE2p 2.12
EXAMPLE 5
Construction of the Strain E. coli [.DELTA.(udhA, qor, pgi, edd)
pSK-PgapA-GRE2p] and Bioconversion of Ethylacetoacetate into
ethyl-3-hydroxybutyrate
[0105] The inactivation of the gene edd was carried out in the
strain E. coli [.DELTA.(udhA, qor, pgi)] (Example 4) using the
method described in Example 2, and the following oligonucleotides:
TABLE-US-00013 DeddF (1932582-1932499)
Cgcgcgagactcgctctgcttatctcgcccggatagaacaagcgaaaact
tcgaccgttcatcgttcgcagttggcatgcggTGTAGGCTGGAGCTGCTT CG DeddR
(1930866-1930943)
cgcaaggcgctgaataattcacgtcctgttcccacgcgtgacgcgctcag
gtcaggaatgtgcggttcgcgagcagccCATATGAATATCCTCCTTAG EddF
(1932996-1932968) Gggtagactccattactgaggcgtgggcg EddR
(1930439-1930462) Ccccggaatcagaggaatagtccc
[0106] The construction was carried out in rich medium (e.g. LB).
The plasmid pSK-PgapA-GRE2p was then introduced into the strain
obtained E. coli [.DELTA.(udhA, qor, pgi, edd)] (Example 3) by
electroporation, and the resulting strain E. coli [.DELTA.(udhA,
qor, pgi, edd) pSK-PgapA-GRE2p] was selected on rich medium.
[0107] The strain obtained E. coli [.DELTA.(udhA, qor, pgi, edd)
pSK-PgapA-GRE2p] was then grown in a minimum medium containing
glucose and ethylacetoacetate. A strain E. coli [pSK-PgapA-GRE2p]
was grown under the same conditions.
[0108] When growth was completed the following variables were
compared: [0109] The time course of the biomass of each strain
during the bioconversion phase. [0110] The quantity of
ethyl-3-hydroxybutyrate produced in the extracellular medium.
[0111] The quantity of ethyl-3-hydroxybutyrate accumulated in the
cells. [0112] The productivity in terms of ethyl-3-hydroxybutyrate.
[0113] The yield glucose/ethyl-3-hydroxybutyrate.
[0114] We observed that the strain E. coli [.DELTA.(udhA, qor, pgi,
edd) pSK-PgapA-GRE2p] gave a greater production yield of
ethyl-3-hydroxybutyrate than the non-optimized strain.
EXAMPLE 6
Construction of the Strain E. coli [.DELTA.(udhA, qor, pfkA, pfkB)
pSK-PgapA-GRE2p] and Bioconversion of Ethylacetoacetate into
ethyl-3-hydroxybutyrate
[0115] The inactivation of the genes pfkA and pfkB was carried out
in the strain E. coli [.DELTA.(udhA, qor)] (Example 2) using the
method described in Example 2 and the following oligonucleotides:
TABLE-US-00014 DpfkAF ggt gtg ttg aca agc ggc ggt gat gcg cca ggc
atg aac gcc gca att cgc ggg gtt gtt cgt tct gcg ctg aca gaa
ggTGTAGGCTGGAGCTGCTTCG DpfkAR
Ttcgcgcagtccagccagtcacctttgaacggacgcttcatgttttcgat
agcgtcgatgatgtcgtggtgaaccagctgCATATGAATATCCTCCTTAG PfkAF
Cgcacgcggcagtcagggccgacccgc PfkAR ccctacgccccacttgttcatcgcccg
DpfkBF (1804421-1804499)
gcgccctctctcgatagcgcaacaattaccccgcaaatttatcccgaagg
aaaactgcgctgtaccgcaccggtgttcgTGTAGGCTGGAGCTGCTTCG DpfkBR
(1805320-1805241)
gcgggaaaggtaagcgtaaattttttgcgtatcgtcatgggagcacagac
gtgttccctgattgagtgtggctgcactccCATATGAATATCCTCCTTAG PfkBF
(1803996-1804025) tggcaggatcatccatgacagtaaaaacgg PfkBR
(1805657-1805632) gccggttgcactttgggtaagccccg
[0116] The construction was carried out in rich medium (e.g. LB).
The plasmid pSK-PgapA-GRE2p was then introduced into the strain
obtained E. coli [.DELTA.(udhA, qor, pfkA, pfkB)] (Example 3) by
electroporation, and the resulting strain E. coli [.DELTA.(udhA,
qor, pfkA, pfkB) pSK-PgapA-GRE2p] was selected on rich medium.
[0117] The strain obtained E. coli [.DELTA.(udhA, qor, pfkA, pfkB)
pSK-PgapA-GRE2p] was then grown in minimum medium containing
glucose and ethylacetoacetate. A strain E. coli [pSK-PgapA-GRE2p]
was grown under the same conditions.
[0118] When growth was completed the following variables were
compared: [0119] The time course of the biomass of each strain
during the bioconversion phase. [0120] The quantity of
ethyl-3-hydroxybutyrate produced in the extracellular medium.
[0121] The quantity of ethyl-3-hydroxybutyrate accumulated in the
cells. [0122] The productivity in terms of ethyl-3-hydroxybutyrate.
[0123] The yield glucose/ethyl-3-hydroxybutyrate.
[0124] We observed that the strain E. coli [.DELTA.(udhA, qor,
pfkA, pfkB) pSK-PgapA-GRE2p] gave a greater production yield of
ethyl-3-hydroxybutyrate than the non-optimized strain.
TABLE-US-00015 mol.sub.EHB/mol.sub.Glucose MG1655 pSK-PgapA-GRE2p
0.75 MG1655 .DELTA.(udhA, qor, pfkA, pfkB) 3.46 pSK-PgapA-GRE2p
EXAMPLE 7
Construction of the Strain E. coli [.DELTA.(udhA, qor, pgi, lpd)
plpd*, pSK-PgapA-GRE2p] and Bioconversion of Ethylacetoacetate into
ethyl-3-hydroxybutyrate
[0125] The gene lpd coding for NAD-dependent dihydrolipoamide
dehydrogenase involved in the multienzyme complex pyruvate
dehydrogenase was deleted using the method described in Example 2,
except that the initial strain was the strain E. coli
[.DELTA.(udhA, qor, pgi)] described in Example 4 instead of being a
wild strain. The construction and the selection of the modified
strain were carried out in rich medium (e.g. LB). The strain
obtained was E.coli [.DELTA.(udhA, qor, pgi, lpd)].
[0126] In addition, the plasmid p-lpd* was constructed, which
allows the overexpression of a NADP-dependent dihydrolipoamide
dehydrogenase. There are various possible ways to modify the
cofactor specificity of an enzyme. For example, Bocanegra et al.
(1993) report a method to create a NADP-dependent dihydrolipoamide
dehydrogenase.
[0127] The plasmids p-lpd* and pSK-PgapA-GRE2p were then introduced
by electroporation into the strain E. coli [.DELTA.(udhA, qor, pgi,
lpd)]. Alternatively, lpd* could be cloned on pSK-PgapA-GRE2p,
giving the plasmid pSK-PgapA-GRE2p-lpd* then introduced by
electroporation into the strain E. coli [.DELTA.(udhA, qor, pgi,
lpd)]. The construction and the selection of the modified strain
were carried out in rich medium (e.g. LB).
[0128] The strain E. coli [.DELTA.(udhA, qor, pgi, lpd)
pSK-PgapA-GRE2p, p-lpd*)] obtained was then grown in minimum medium
containing glucose and ethylacetoacetate. A strain E. coli
[pSK-PgapA-GRE2p] was grown under the same conditions.
[0129] When growth was completed the following variables were
compared: [0130] The time course of the biomass of each strain
during the bioconversion phase. [0131] The quantity of
ethyl-3-hydroxybutyrate produced in the extracellular medium.
[0132] The quantity of ethyl-3-hydroxybutyrate accumulated in the
cells. [0133] The productivity in terms of ethyl-3-hydroxybutyrate.
[0134] The yield glucose/ethyl-3-hydroxybutyrate.
[0135] We observed that the strain E. coli [.DELTA.(udhA, qor, pgi,
lpd) pSK-PgapA-GRE2p, p-lpd*)] gave a greater production yield of
ethyl-3-hydroxybutyrate than the non-optimized strain.
EXAMPLE 8
Construction of the Plasmid pRSGK-GRE2p
[0136] The plasmid pYGK was constructed by insertion of the
promoter Ppgk, the multicloning site and the terminator cyc1 of the
vector pYPG2 in the vector pBluescript-SK (pSK). To do this, the
promoter Ppgk, the multicloning site and the terminator cyc1 were
amplified with polymerase Pfu Turbo from the vector pYPG2. The PCR
product obtained was then digested by restriction enzymes
SacII-NotI and ligated to the vector pSK digested by the
restriction enzymes ApaI-SmaI, ligated and digested by the
restriction enzymes NotI-SacII, and dephosphorylated to give the
plasmid pYGK.
[0137] The plasmid pYGK was then introduced into the strain E. coli
DH5.alpha. to verify the construction. The sequencing of the
promoter Ppgk, the multicloning site and the terminator cyc1 of the
plasmid pYGK with the oligonucleotides universal M13 reverse and
universal M13 forward was then carried out to confirm the
construction.
[0138] The plasmid pYGK-GRE2p was then constructed by insertion of
the gene GRE2p in the plasmid pYGK. To do this, the gene GRE2p of
Saccharomyces cerevisiae was amplified with the polymerase Pwo from
chromosomal DNA, using the following oligonucleotides:
TABLE-US-00016 Ome376_Gre2 pYGK F (SmaI)
Acgtacgtcccccgggaaaaatgtcagttttcgtttcaggtgc Ome377_Gre2 pYGK R
(ApaI) ACGTACGGGCCCTTATATTCTGCCCTCAAATTTTAAAATTTGGG
[0139] The PCR product obtained was then digested by the
restriction enzymes ApaI-SmaI and ligated to the vector pYGK
digested by the restriction enzymes ApaI-SmaI and dephosphorylated
to give the plasmid pYGK-GRE2p.
[0140] The plasmid pYGK-GRE2p was then introduced into the strain
E. coli DH5.alpha. to verify the construction. The sequencing of
the gene GRE2p of the plasmid pYGK-GRE2p with the oligonucleotides
universal M13 reverse and universal M13 forward was then carried
out to confirm the construction.
[0141] The plasmid pRSGK-GRE2p was finally obtained by digestion of
the plasmids pYGK-GRE2p and pRS426 with the restriction enzymes
NotI-SacII followed by ligation.
EXAMPLE 9
Construction of the Strain S. cerevisiae [.DELTA.(ZTA1)
pRSGK-GRE2p] and Bioconversion of Ethylacetoacetate into
ethyl-3-hydroxybutyrate
[0142] The inactivation of the gene ZTA1 was carried out by
inserting a marker (antibiotic resistance, auxotrophy) while at the
same time deleting most of the gene concerned. The technique used
is described by Brachmann et al. (Designer deletion strains derived
from Saccharomyces cerevisae S288C: a useful set of strains and
plasmids for PCR-mediated gene disruption and other applications,
Yeast, 1998, 14: 115-32). It is also possible to use the method
described by Wach et al. (New heterologous modules for classical or
PCR-based gene disruptions in Saccharomyces cerevisiae, Yeast,
1994, 10: 1793-1808).
[0143] In all cases a final strain of S. cerevisiae [.DELTA.(ZTA1
)] was obtained into which the plasmid pRSGK-GRE2p (Example 8) was
then introduced.
[0144] Alternatively, it was also possible to introduce the plasmid
pRSGK-GRE2p into an available .DELTA.(ZTA1) strain, for example the
strain EUROSCARF Y33183 (genotype: BY4743; Mat a/.alpha.;
his3D1/his3D1; leu2D0/leu2D0; lys2D0/LYS2; MET15/met15D0;
ura3D0/ura3D0; YBR046c::kanMX4/YBR046c::kanMX4). It was then
possible, after sporulation, to recover a homozygote strain of S.
cerevisiae [.DELTA.(ZTA1) pRSGK-GRE2p].
[0145] The strain S. cerevisiae [.DELTA.(ZTA1) pRSGK-GRE2p]
obtained was then grown in a minimum medium containing glucose and
ethylacetoacetate.
[0146] The control strain S. cerevisiae [pRSGK-GRE2p] was grown
under the same conditions.
[0147] When growth was completed the following variables were
compared: [0148] The time course of the biomass of each strain
during the bioconversion phase. [0149] The quantity of
ethyl-3-hydroxybutyrate produced in the extracellular medium.
[0150] The quantity of ethyl-3-hydroxybutyrate accumulated in the
cells. [0151] The productivity in terms of ethyl-3-hydroxybutyrate.
[0152] The yield glucose/ethyl-3-hydroxybutyrate.
[0153] We found that the strain S. cerevisiae [.DELTA.(ZTA1)
pRSGK-GRE2p] gave a higher production yield of
ethyl-3-hydroxybutyrate than the non-optimized strain.
EXAMPLE 10
Construction of the Strain S. cerevisiae [.DELTA.(ZTA1, PGI1)
pRSGK-GRE2p] and Bioconversion of Ethylacetoacetate into
ethyl-3-hydroxybutyrate
[0154] The inactivation of the gene PGI1 was carried out in the
strain S. cerevisiae [.DELTA.(ZTA1) pRSGK-GRE2p] using the method
described in Example 9, and the following oligonucleotides:
TABLE-US-00017 Dpgi1F
CCAACGCAGACCGCTGCCTGGCAGGCACTACAGAAACACTTCGATGAAAT
GAAAGACGTTACGATCGCCGATCTTTTTGCTGTAGGCTGGAGCTGCTTCG Dpgi1R
GCGCCACGCTTTATAGCGGTTAATCAGACCATTGGTCGAGCTATCGTGGC
TGCTGATTTCTTTATCATCTTTCAGCTCTGCATATGAATATCCTCCTTAG Pgi1F
GCGGGGCGGTTGTCAACGATGGGGTCATGC Pgi1R
CGGTATGATTTCCGTTAAATTACAGACAAG
[0155] Alternatively it was possible to use an available
.DELTA.(PGI1) strain, for example the strain EUROSCARF Y23336 (Mat
.alpha./a; his3D1/his3D1; leu2D0/leu2D0; lys2D0/LYS2;
MET15/met15D0; ura3D0/ura3D0; YBR196c::kanMX4/YBR196c). The strain
was then converted by the plasmid pRSGK-GRE2p (Example 8), and the
deletion of the gene ZTA1 was then carried out using the method
described in Example 9.
[0156] The strain S. cerevisiae [.DELTA.(ZTA1, PGI1) pRSGK-GRE2p]
obtained was then grown in minimal medium containing glucose and
ethylacetoacetate.
[0157] The control strain S. cerevisiae [pRSGK-GRE2p] was grown in
the same conditions.
[0158] When growth was completed the following variables were
compared: [0159] The time course of the biomass of each strain
during the bioconversion phase. [0160] The quantity of
ethyl-3-hydroxybutyrate produced in the extracellular medium.
[0161] The quantity of ethyl-3-hydroxybutyrate accumulated in the
cells. [0162] The productivity in terms of ethyl-3-hydroxybutyrate.
[0163] The yield glucose/ethyl-3-hydroxybutyrate.
[0164] We observed that the strain E. coli [.DELTA.(ZTA1, PGI1)
pRSGK-GRE2p] gave a higher production yield of
ethyl-3-hydroxybutyrate than the non-optimized strain.
EXAMPLE 11
Construction of the Strain S. cerevisiae [.DELTA.(ZTA1, PFK1, PFK2)
pRSGK-GRE2p] and Bioconversion of Ethylacetoacetate into
ethyl-3-hydroxybutyrate
[0165] The genes PFK1 and PFK2 were deleted in the strain S.
cerevisiae [.DELTA.(ZTA1)] using the method described in Example 9,
and the following oligonucleotides: TABLE-US-00018 Dpfk1F
ATGCAATCTCAAGATTCATGCTACGGTGTTGCATTCAGATCTATCATCAC
AAATGATGAAAAGCTTCGTACGCTGCAGGTCG Dpfk1R
TTTGTTTTCAGCGGCTAAAGCGGCTACCTCAGCTCTCAACTTTAATCTAC
CGGACAGGATGGGCCACTAGTGGATCTGATATC Pfk1 int F GCTTTCTTAGAAGCTACCTCCG
Pfk1 int R GAACCGACAAGACCAACAATGG Pfk2 int F CAGTTGTACACTTTGGACCC
Pfk2 int R GATCAGCACCAGTCAAAGAACC
[0166] The strain was then converted by the plasmid pRSGK-GRE2p
(Example 8).
[0167] The strain S. cerevisiae [.DELTA.(ZTA1, PFK1, PFK2)
pRSGK-GRE2p] obtained was then grown in minimum medium containing
glucose and ethylacetoacetate.
[0168] The control strain S. cerevisiae [pRSGK-GRE2p] was grown
under the same conditions.
[0169] When growth was completed the following variables were
compared: [0170] The time course of the biomass of each strain
during the bioconversion phase. [0171] The quantity of
ethyl-3-hydroxybutyrate produced in the extracellular medium.
[0172] The quantity of ethyl-3-hydroxybutyrate accumulated in the
cells. [0173] The productivity in terms of ethyl-3-hydroxybutyrate.
[0174] The yield glucose/ethyl-3-hydroxybutyrate.
[0175] We observed that the strain S. cerevisiae [.DELTA.(ZTA1,
PFK1, PFK2) pRSGK-GRE2p] gave a higher production yield of
ethyl-3-hydroxybutyrate than the non-optimized strain.
TABLE-US-00019 mol.sub.EHB/mol.sub.Glucose S. cerevisiae
[pRSGK-GRE2p] in progress S. cerevisiae [.DELTA.(ZTA1, PFK1, PFK2)
pRSGK-GRE2p] in progress
EXAMPLE 12
Comparison Between Experimental Values and Predictions Using the
Metabolic Model for the Optimization of the Production of
ethyl-3-hydroxybutyrate by Escherichia coli
[0176] We found a close correlation between predictive modelling
(Example 1) and the experimental results described in Examples 3,
4, 5, 6, 7, 9, 10 and 11.
[0177] Examples 1 to 11 above are specific applications of the
patent and do not restrict its scope. Those skilled in the art can
readily adapt these examples for the biotransformation of
substances formed by a NADPH-dependent synthesis. The algorithm
MetOpt.RTM. and the strategy for optimizing a NADPH-dependent
biotransformation process via the optimization of the
NADPH/NADP.sup.+ ratio is validated; this patent thus claims an
application covering all NADPH-dependent biotransformations that
can be modelled and predicted with MetOpt.RTM., or any of its
derivatives, using E. coli, S. cerevisiae or any other
microorganism.
EXAMPLE 13
Calculation of Theoretical Optimal Yields in Fermentation Processes
in E. coli
[0178] Example 12 shows that the models MetOpt.RTM. developed by
the Company are applicable to the bioconversions and should be more
generally applicable to biotransformations such as
fermentations.
[0179] For example, MetOpt.RTM.-Coli model was applied to the
production of cysteine or 3-hydroxypropionate by the fermentation
of glucose in the strains of E. coli optimized according to the
invention. The parameters used were the same as in Example 1,
namely: 1) a glucose import flux of 3 mmol.g.sup.-1.h.sup.-1, 2) a
variable growth rate of 0, 0.15 and 0.25 h.sup.-1, 3) a variable
membrane-bound transhydrogenase flux (pntAB) less than or equal to
1 mmol.g.sup.-1.h.sup.-1; the limiting value of membrane-bound
transhydrogenase flux was determined from the literature (Hanson,
1979; Anderlund et al., 1999; Emmerling et al., 2002), and 4)
maintenance flux limited to between 5 and 22
mmol.g.sup.-1.h.sup.-1.
a) Case of Production of Cysteine by Fermentation of Glucose
[0180] TABLE-US-00020 .mu. = 0 .mu. = 0.15 h.sup.-1 .mu. = 0.25
h.sup.-1 .DELTA.(udhA, qor, pgi) 0.66 0.37 0.09 .DELTA.(udhA, qor,
pgi) 0.78 0.37 0.09 gapA-NADP-dependent .DELTA.(udhA, qor, pgi)
0.78 0.37 0.09 lpd-NADP-dependent .DELTA.(udhA, qor, pgi) 0.78 0.37
0.09 gapA-NADP-dependent lpd-NADP-dependent .DELTA.(udhA, qor,
pfkA, pfkB) 0.40 0.18 0.01 .DELTA.(udhA, qor, pfkA, pfkB) 0.62 0.30
0.06 gapA-NADP-dependent .DELTA.(udhA, qor, pfkA, pfkB) 0.71 0.36
0.13 lpd-NADP-dependent .DELTA.(udhA, qor, pfkA, pfkB) 0.77 0.42
0.17 gapA-NADP-dependent lpd-NADP-dependent
Theoretical Optimal Yields for the Production of Cysteine by
Strains of E. coli Optimized for NADP.sup.+ Reduction Capacity (mol
per mol of Glucose)
[0181] To further improve the theoretical optimal yield of the
strains optimized according to the invention additional
modifications can be made, such as the overexpression of at least
one gene that can be zwf, gnd, pntA, pntB or icd and/or the
deletion of at least one gene that can be edd, aceA, aceB or
aceK.
[0182] In practice, to obtain such yields other modifications have
to be made to the strains optimized according to the invention, for
example by overexpressing the gene cysB as described in the patent
WO0127307, or by modifying the gene cysE as described in the patent
EP0885962.
b) Case of Production of 3-hydroxypropionate by Fermentation of
Glucose
[0183] The production of 3-hydroxypropionate was carried out in
strains of E. coli containing the genes coding for the enzymes of
the 3-hydroxypropionate synthesis pathway, for example the
malonyl-coA reductase of Chloroflexus aurantiacus (Hugler et al.,
Journal of Bacteriology, 2002, 184: 2404-2410). TABLE-US-00021 .mu.
= 0 .mu. = 0.15 h.sup.-1 .mu. = 0.25 h.sup.-1 .DELTA.(udhA, qor,
pgi) 1.33 0.79 0.30 .DELTA.(udhA, qor, pgi) 1.76 0.99 0.30
gapA-NADP-dependent .DELTA.(udhA, qor, pgi) 1.82 0.99 0.30
lpd-NADP-dependent .DELTA.(udhA, qor, pgi) 1.82 0.99 0.30
gapA-NADP-dependent lpd-NADP-dependent .DELTA.(udhA, qor, pfkA,
pfkB) 1.62 0.66 0.03 .DELTA.(udhA, qor, pfkA, pfkB) 1.76 0.79 0.07
gapA-NADP-dependent .DELTA.(udhA, qor, pfkA, pfkB) 1.79 0.84 0.07
lpd-NADP-dependent .DELTA.(udhA, qor, pfkA, pfkB) 1.79 0.84 0.07
gapA-NADP-dependent lpd-NADP-dependent
Theoretical Optimal Yields for the Production of
3-hydroxypropionate by Strains of E. coli Optimized for NADP.sup.+
Reduction Capacity (mol per mol of Glucose)
[0184] To further improve the theoretical optimal yield of the
strains optimized according to the invention, additional
modifications can be made, such as the overexpression of at least
one gene that can be zwf, gnd, pntA, pntB or icd and/or the
deletion of at least one gene that can be edd, aceA, aceB or
aceK.
EXAMPLE 14
Calculation of Theoretical Optimal Yields in Fermentation Processes
in S. cerevisiae; Application to the Production of
Hydrocortisone
[0185] Example 12 shows that the MetOpt.RTM. models developed by
the Company are applicable to bioconversions and should be more
generally applicable to biotransformations such as
fermentations.
[0186] For example, the MetOpt.RTM.-Scere model was applied to the
production of hydrocortisone by fermentation of glucose in the
strains of S. cerevisiae optimized according to the invention. The
parameters used were the same as in Example 1, namely: 1) a glucose
import flux of 3 mmol.g.sup.-1.h.sup.-1, 2) a variable growth rate
of 0, 0.15 and 0.25 h.sup.-1, 3) a maintenance flux less than or
equal to 22 mmol.g.sup.-1.h.sup.-1, 4) reactions of aldehyde
dehydrogenases (ALD2, ALD3, ALD6) irreversible and set in the
direction acetate+NAD(P)H.fwdarw.acetaldehyde+NAD(P), and 5) no
activities equivalent to udhA or pntA,B.
[0187] The model allows for mitochondrial and peroxisomal
compartmentalization.
[0188] This representation of the results demonstrates the real
contribution made by each of the mutations made according to the
invention to the improvement in NADPH production and so to the
improvement in the hydrocortisone production flux.
[0189] The production of hydrocortisone was achieved in strains of
S. cerevisiae containing genes coding for enzymes of the
hydrocortisone synthesis pathway (Szczebara et al., 2003, Nature
Biotechnology, 21: 143-149). TABLE-US-00022 .mu. = 0 .mu. = 0.15
h.sup.-1 .mu. = 0.25 h.sup.-1 .DELTA.(ZTA1, PGI1) 0.12 0.08 0.06
.DELTA.(ZTA1, PGI1) 0.21 0.14 0.10 TDH1,2,3-NADP-dependent
.DELTA.(ZTA1, PGI1) 0.20 0.14 0.10 LPD1-NADP-dependent
.DELTA.(ZTA1, PGI1) 0.21 0.14 0.10 TDH1,2,3-NADP-dependent
LPD1-NADP-dependent
Theoretical Optimal Yields for the Production of Hydrocortisone by
Strains of E. coli Optimized for NADP.sup.+ Reduction Capacity (mol
per mol of Glucose)
[0190] The strains from which the genes PFK1 and PFK2 have been
deleted are unable to produce hydrocortisone, and may not even be
viable. This is because the production of hydrocortisone is limited
more by carbon demand than by NADPH requirement. One solution is to
allow a weak expression of a transhydrogenase type activity in the
yeast. However, modelling shows that the hydrocortisone production
will never be as high as when the PGI1 gene is deleted.
[0191] To further improve the theoretical optimum yield of the
strains optimized according to the invention, additional
modifications can be made, such as the overexpression of at least
one gene that can be ZWF, SOL1, SOL2, SOL3, SOL4, GND1, GND2, IDP1,
IDP2 or IDP3, and/or the deletion of at least one gene that can be
either ICL1 or DAL7.
REFERENCES
[0192] Anderson, E. H. (1946) Growth requirements of
virus-resistant mutants of Escherichia coli strain "B", Proc. Natl.
Acad. Sci. USA 32:120-128 [0193] Baudin, A.; Ozier-Kalogeropoulos,
O.; Denouel, A.; Lacroute, F. and Cullin, C. (1993) A simple and
efficient method for direct gene deletion in Saccharomyces
cerevisiae, Nucl. Acids Res. 21, 3329-3330 [0194] Bocanegra, J. A.
Scrutton, N. S.; Perham, R. N. (1993) Creation of an NADP-dependent
pyruvate dehydrogenase multienzyme complex by protein engineering.
Biochemistry 32: 2737-2740 [0195] Brachmann C B, Davies A, Cost G
J, Caputo E, Li J, Hieter P, Boeke J D. (1998) Designer deletion
strains derived from Saccharomyces cerevisiae S288C: a useful set
of strains and plasmids for PCR-mediated gene disruption and other
applications. Yeast. 14:115-32. [0196] Datsenko, K. A.; Wanner, B.
L. (2000) One-step inactivation of chromosomal genes in Escherichia
coli K-12 using PCR products. Proc. Natl. Acad. Sci. USA 97:
6640-6645 [0197] Miller, 1992; A Short Course in Bacterial
Genetics: A Laboratory Manual and Handbook for Escherichia coli and
Related Bacteria, Cold Spring Harbor Laboratory Press, Cold Spring
Harbor, N.Y. [0198] Sambrook et al. (1989 Molecular cloning: a
laboratory manual. 2.sup.nd Ed. Cold Spring [0199] Harbor Lab.,
Cold Spring Harbor, N.Y. [0200] Schaefer U.; Boos, W.; Takors, R.;
Weuster-Botz, D. (1999) Automated sampling device for monitoring
intracellular metabolite dynamics, Anal. Biochem. 270: 88-96 [0201]
Wach, A.; Brachat, A.; Pohlmann, R.; and Philippsen, P. (1994) New
heterologous modules for classical or PCR-based gene disruptions in
Saccharomyces cerevisiae, Yeast 10, 1793-1808, 1994.
Sequence CWU 1
1
38 1 100 DNA artificial sequence Other information synthetic
oligonucleotide 1 ggtgcgcgcg tcgcagttat cgagcgttat caaaatgttg
gcggcggttg cacccactgg 60 ggcaccatcc cgtcgaaagc catatgaata
tcctccttag 100 2 100 DNA artificial sequence Other information
synthetic oligonucleotide 2 cccagaatct cttttgtttc ccgatggaac
aaaattttca gcgtgcccac gttcatgccg 60 acgatttgtg cgcgtgccag
tgtaggctgg agctgcttcg 100 3 30 DNA artificial sequence Other
information synthetic oligonucleotide 3 ggccgctcag gatatagcca
gataaatgac 30 4 30 DNA artificial sequence Other information
synthetic oligonucleotide 4 gcgggatcac tttactgcca gcgctggctg 30 5
100 DNA artificial sequence Other information synthetic
oligonucleotide 5 ggtggcccgg aagtacttca agccgtagag ttcactcctg
ccgatccggc ggagaatgaa 60 atccaggtcg aaaataaagc catatgaata
tcctccttag 100 6 100 DNA artificial sequence Other information
synthetic oligonucleotide 6 cgcccggctt tccagaatct catgcgcacg
ctgcgcatcc ttcagcggat atttctgctg 60 ctcggcgaca tcgaccttaa
tgtaggctgg agctgcttcg 100 7 30 DNA artificial sequence Other
information synthetic oligonucleotide 7 cgcccaacac cgactgctcc
gcttcgatcg 30 8 30 DNA artificial sequence Other information
synthetic oligonucleotide 8 cagcgttatg accgctggcg ttactaaggg 30 9
43 DNA artificial sequence Other information synthetic
oligonucleotide 9 acgtacgtgg catatgtcag ttttcgtttc aggtgctaac ggg
43 10 44 DNA artificial sequence Other information synthetic
oligonucleotide 10 acgtacctgc agttatattc tgccctcaaa ttttaaaatt tggg
44 11 100 DNA artificial sequence Other information synthetic
oligonucleotide 11 ccaacgcaga ccgctgcctg gcaggcacta cagaaacact
tcgatgaaat gaaagacgtt 60 acgatcgccg atctttttgc tgtaggctgg
agctgcttcg 100 12 100 DNA artificial sequence Other information
synthetic oligonucleotide 12 gcgccacgct ttatagcggt taatcagacc
attggtcgag ctatcgtggc tgctgatttc 60 tttatcatct ttcagctctg
catatgaata tcctccttag 100 13 30 DNA artificial sequence Other
information synthetic oligonucleotide 13 gcggggcggt tgtcaacgat
ggggtcatgc 30 14 30 DNA artificial sequence Other information
synthetic oligonucleotide 14 cggtatgatt tccgttaaat tacagacaag 30 15
102 DNA artificial sequence Other information synthetic
oligonucleotide 15 cgcgcgagac tcgctctgct tatctcgccc ggatagaaca
agcgaaaact tcgaccgttc 60 atcgttcgca gttggcatgc ggtgtaggct
ggagctgctt cg 102 16 98 DNA artificial sequence Other information
synthetic oligonucleotide 16 cgcaaggcgc tgaataattc acgtcctgtt
cccacgcgtg acgcgctcag gtcaggaatg 60 tgcggttcgc gagcagccca
tatgaatatc ctccttag 98 17 29 DNA artificial sequence Other
information synthetic oligonucleotide 17 gggtagactc cattactgag
gcgtgggcg 29 18 24 DNA artificial sequence Other information
synthetic oligonucleotide 18 ccccggaatc agaggaatag tccc 24 19 100
DNA artificial sequence Other information synthetic oligonucleotide
19 ggtgtgttga caagcggcgg tgatgcgcca ggcatgaacg ccgcaattcg
cggggttgtt 60 cgttctgcgc tgacagaagg tgtaggctgg agctgcttcg 100 20
100 DNA artificial sequence Other information synthetic
oligonucleotide 20 ttcgcgcagt ccagccagtc acctttgaac ggacgcttca
tgttttcgat agcgtcgatg 60 atgtcgtggt gaaccagctg catatgaata
tcctccttag 100 21 27 DNA artificial sequence Other information
synthetic oligonucleotide 21 cgcacgcggc agtcagggcc gacccgc 27 22 27
DNA artificial sequence Other information synthetic oligonucleotide
22 ccctacgccc cacttgttca tcgcccg 27 23 99 DNA artificial sequence
Other information synthetic oligonucleotide 23 gcgccctctc
tcgatagcgc aacaattacc ccgcaaattt atcccgaagg aaaactgcgc 60
tgtaccgcac cggtgttcgt gtaggctgga gctgcttcg 99 24 100 DNA artificial
sequence Other information synthetic oligonucleotide 24 gcgggaaagg
taagcgtaaa ttttttgcgt atcgtcatgg gagcacagac gtgttccctg 60
attgagtgtg gctgcactcc catatgaata tcctccttag 100 25 30 DNA
artificial sequence Other information synthetic oligonucleotide 25
tggcaggatc atccatgaca gtaaaaacgg 30 26 26 DNA artificial sequence
Other information synthetic oligonucleotide 26 gccggttgca
ctttgggtaa gccccg 26 27 43 DNA artificial sequence Other
information synthetic oligonucleotide 27 acgtacgtcc cccgggaaaa
atgtcagttt tcgtttcagg tgc 43 28 44 DNA artificial sequence Other
information synthetic oligonucleotide 28 acgtacgggc ccttatattc
tgccctcaaa ttttaaaatt tggg 44 29 100 DNA artificial sequence Other
information synthetic oligonucleotide 29 ccaacgcaga ccgctgcctg
gcaggcacta cagaaacact tcgatgaaat gaaagacgtt 60 acgatcgccg
atctttttgc tgtaggctgg agctgcttcg 100 30 100 DNA artificial sequence
Other information synthetic oligonucleotide 30 gcgccacgct
ttatagcggt taatcagacc attggtcgag ctatcgtggc tgctgatttc 60
tttatcatct ttcagctctg catatgaata tcctccttag 100 31 30 DNA
artificial sequence Other information synthetic oligonucleotide 31
gcggggcggt tgtcaacgat ggggtcatgc 30 32 30 DNA artificial sequence
Other information synthetic oligonucleotide 32 cggtatgatt
tccgttaaat tacagacaag 30 33 82 DNA artificial sequence Other
information synthetic oligonucleotide 33 atgcaatctc aagattcatg
ctacggtgtt gcattcagat ctatcatcac aaatgatgaa 60 aagcttcgta
cgctgcaggt cg 82 34 83 DNA artificial sequence Other information
synthetic oligonucleotide 34 tttgttttca gcggctaaag cggctacctc
agctctcaac tttaatctac cggacaggat 60 gggccactag tggatctgat atc 83 35
22 DNA artificial sequence Other information synthetic
oligonucleotide 35 gctttcttag aagctacctc cg 22 36 22 DNA artificial
sequence Other information synthetic oligonucleotide 36 gaaccgacaa
gaccaacaat gg 22 37 20 DNA artificial sequence Other information
synthetic oligonucleotide 37 cagttgtaca ctttggaccc 20 38 22 DNA
artificial sequence Other information synthetic oligonucleotide 38
gatcagcacc agtcaaagaa cc 22
* * * * *
References