U.S. patent application number 11/607073 was filed with the patent office on 2007-04-19 for interleukin-12 as an adjuvant for paramyxoviridae vaccines.
This patent application is currently assigned to Vanderbilt University. Invention is credited to Barney S. Graham, Yi-Wei Tang.
Application Number | 20070087016 11/607073 |
Document ID | / |
Family ID | 23238354 |
Filed Date | 2007-04-19 |
United States Patent
Application |
20070087016 |
Kind Code |
A1 |
Graham; Barney S. ; et
al. |
April 19, 2007 |
Interleukin-12 as an adjuvant for paramyxoviridae vaccines
Abstract
A method is disclosed of reducing viral replication of a virus
of the paramyxoviridae family in a host, comprising administering
to the host an antigen of the virus in combination with an
effective adjuvant amount of interleukin-12 (IL-12). Human viruses
of the paramyxoviridae family include paramyxoviruses (e.g.,
parainfluenza virus 1, parainfluenza virus 2, parainfluenza virus 3
and parainfluenza virus 4), morbilliviruses (e.g., measles virus)
and pneumoviruses (e.g., respiratory syncytial virus); other
non-human viruses of the paramyxoviridae family include canine
distemper virus, bovine respiratory syncytial virus, Newcastle
disease virus and rhinderpest virus. A composition is also
disclosed comprising a mixture of an antigen of a virus of the
Paramyxoviridae family and an effective adjuvant amount of
interleukin-12 (IL-12).
Inventors: |
Graham; Barney S.;
(Nashville, TN) ; Tang; Yi-Wei; (Nashville,
TN) |
Correspondence
Address: |
WYETH/FINNEGAN HENDERSON, LLP
901 NEW YORK AVENUE, NW
WASHINGTON
DC
20001-4413
US
|
Assignee: |
Vanderbilt University
|
Family ID: |
23238354 |
Appl. No.: |
11/607073 |
Filed: |
December 1, 2006 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
09452931 |
Dec 2, 1999 |
|
|
|
11607073 |
Dec 1, 2006 |
|
|
|
08980160 |
Nov 26, 1997 |
6071893 |
|
|
09452931 |
Dec 2, 1999 |
|
|
|
08318480 |
Oct 5, 1994 |
|
|
|
08980160 |
Nov 26, 1997 |
|
|
|
Current U.S.
Class: |
424/204.1 ;
424/130.1 |
Current CPC
Class: |
C07K 2317/52 20130101;
A61K 39/155 20130101; A61K 2039/55538 20130101; C12N 2760/18534
20130101; C07K 16/1027 20130101; A61K 39/12 20130101; A61K 2039/57
20130101; A61K 2039/5252 20130101; A61P 31/14 20180101; A61K 39/39
20130101 |
Class at
Publication: |
424/204.1 ;
424/130.1 |
International
Class: |
A61K 39/395 20060101
A61K039/395; A61K 39/12 20060101 A61K039/12 |
Goverment Interests
GOVERNMENT SUPPORT
[0002] The invention was supported, in whole or in part, by a grant
ROA-AI-33933 from the National Institutes of Health. The Government
has certain rights in the invention.
Claims
1-18. (canceled)
19. A composition for reducing replication of a virus of the
Paramyxoviridae family in a host, comprising a mixture of an
antigen of the virus and an effective adjuvant amount of
interleukin-12.
20. A composition of claim 19 wherein the virus of the
Paramyxoviridae family is selected from the group consisting of:
parainfluenza virus 1, parainfluenza virus 2, parainfluenza virus
3, parainfluenza virus 4, mumps virus, measles virus, respiratory
syncytial virus, canine distemper virus, bovine respiratory
syncytial virus, Newcastle disease virus and rhinderpest virus.
21. A composition of claim 19 wherein the antigen is selected from
the group consisting of: the fusion glycoprotein, the
hemagglutinin-neuraminidase, the G glycoprotein, and an inactivated
Paramyxoviridae.
22. A composition of claim 19 wherein the composition optionally
contains one or more of other adjuvants, pharmaceutically
acceptable surfactants, excipients, carriers, diluents, vehicles,
sweetening agents, flavoring agents, and coloring agents.
23. A composition of claim 19 wherein the antigen is present as a
polynucleotide and is expressed in vivo.
24. A composition of claim 19 wherein the virus of the
Paramyxoviridae family is respiratory syncytial virus.
25. A composition of claim 24 wherein the antigen is selected from
the group consisting of: the fusion glycoprotein, the G
glycoprotein, and an inactivated respiratory syncytial virus.
26. A composition of claim 24 wherein the composition optionally
contains one or more of other adjuvants, pharmaceutically
acceptable surfactants, excipients, carriers, diluents, vehicles,
sweetening agents, flavoring agents, and coloring agents.
27. A composition of claim 24 wherein the antigen is present as a
polynucleotide and is expressed in vivo.
Description
RELATED APPLICATION(S)
[0001] This application is a Continuation of U.S. application Ser.
No. 08/980,160 filed on Nov. 26, 1997, which is a Continuation of
U.S. application Ser. No. 08/318,480 filed on Oct. 5, 1994. The
entire teachings of U.S. application Ser. No. 08/980,160 and U.S.
application Ser. No. 08/318,480 are incorporated herein by
reference.
BACKGROUND OF THE INVENTION
[0003] Respiratory syncytial virus (RSV), a member of the
Pneumovirus genus of the Paramyxoviridae family, is an important
cause of respiratory disease in infants and children (Connors, M.,
et al., J. of Virol., 66:7444-7451 (1992). The immunological basis
for the differing susceptibility among individuals, and for the
limited age range at which severe illness occurs, remains
unclear.
[0004] The major impediment to advancing new candidate vaccines
directed against RSV to clinical trials is an incomplete
understanding of the vaccine-enhanced illness caused by
formalin-inactivated RSV vaccines in the 1960's. Clinical trials of
a formalin-activated alum-precipitated RSV vaccine in the 1960's
showed that the vaccine elicited complement-binding antibodies but
failed to protect against infection in children. In addition, the
illness after subsequent infection was unusually severe with some
deaths, and an increased rate of hospitalization (Kapikian, A. Z.,
et al. Amer. J. Epidem., 89:405 (1969); Fulginti, V. A., et al,
Amer. J. Epidem., 89:435 (1969); Kim, W. H., Amer. J. Epidemol.,
89:422 (1969); Chin, J. R., et al. Amer. J. Epidem., 89:449
(1969)). A similar enhanced illness can be induced in mice
previously immunized with the formalin-inactivated vaccine upon RSV
infection, but not in mice immunized with live RSV (Conners, M., et
al., J. Virol. 66:7441 (1992); Graham, B. S., et al., Immunol.
151:2032 (1993); Alwan, W. H., et al., J. Exp. Med. 179:81 (1994)).
Clinical trials of live attenuated RSV vaccine products have not
been associated with enhanced illness. Although the live RSV
vaccines did not result in enhanced pulmonary disease upon natural
infection, the vaccines were, in other respects, as equally
unsuccessful as the formalin-inactivated alum-precipitated RSV
vaccines (Kim, W. H., et al., Pediatrics, 48:745 (1971); Kim, W.
H., et al., Pediatrics, 52:56 (1973); Belshe, R. B., et al., J.
Infect. Dis., 145:311 (1982); Wright, R. B., et al., Infect.
Immun., 37:397 (1982). Temperature-sensitive mutants of RSV,
cold-adapted RSV or live RSV given parenterally have been
considered unsuccessful as vaccines because of high rates of
reversion to wild-type, unacceptable virulence or lack of
immunogenicity in the appropriate age group (Graham, B. S., et al.,
J. of Immun., 151:2032-2040 (1993).
[0005] Thus, a need exists for development of efficacious methods
of vaccination against RSV and for vaccine compositions.
SUMMARY OF THE INVENTION
[0006] The present invention is based on the discovery that IL-12
has a potent adjuvant effect for immunizing against Paramyxoviridae
virus infection. In one embodiment, the invention comprises a
method of reducing viral replication of a virus of the
paramyxoviridae family in a host (e.g., mammalian, including human,
and avian) comprising administering to the host an antigen of the
virus in combination with an effective adjuvant amount of
interleukin-12 (IL-12). Human viruses of the Paramyxoviridae family
include paramyxoviruses (e.g., parainfluenza virus 1, parainfluenza
virus 2, parainfluenza virus 3, parainfluenza virus 4 and mumps
virus), morbilliviruses (e.g., measles virus) and pneumoviruses
(e.g., respiratory syncytial virus); other non-human viruses of the
Paramyxoviridae family include canine distemper virus, bovine RSV,
Newcastle disease virus and rhinderpest virus. In one embodiment,
the invention relates to a method of reducing replication of the
respiratory syncytial virus (RSV) in a host comprising
administering to the host an antigen of RSV in combination with an
effective adjuvant amount of IL-12. Thus, the present invention
also relates to a method of eliciting an immune response against
viruses of the Paramyxoviridae family in a host, comprising
administering to the host an antigen of a virus of the
Paramyxoviridae family in combination with an effective adjuvant
amount of IL-12. The present invention also relates to a method of
immunizing a host against RSV comprising administering to the host
a mixture comprising an antigen of respiratory syncytial virus in
combination with an effective adjuvant amount of
interleukin-12.
[0007] In addition, the present invention relates to a composition
comprising a mixture of an antigen of a virus of the
Paramyxoviridae family and an effective adjuvant amount of
interleukin-12 (IL-12). In one embodiment, the invention relates to
a composition comprising an antigen of the respiratory syncytial
virus and IL-12.
[0008] As shown herein, exogenous. IL-12 treatment administered at
the time of immunization with RSV antigen, diminishes RSV
replication and increases endogenous IL-12 mRNA expression at the
time of subsequent RSV challenge. This results in a shift from a
Th2 to a Th1-like pattern of cytokine expression and a consequent
shift in antibody isotype utilization. These results demonstrate
that IL-12 is a potent adjuvant for Paramyxoviridae vaccines.
BRIEF DESCRIPTION OF THE DRAWINGS
[0009] FIG. 1 is a bar graph of IL-12 treatment versus log 10
plaque forming units (pfu)/gram lung from the plaque assay
illustrating that IL-12 administered at the time of immunization
has a marked effect on the reduction of viral replication.
[0010] FIG. 2 is a bar graph of IL-12 treatment versus averaged
.alpha.-tubulin-normalized density from the mRNA Northern blots
illustrating that IL-12 enhanced Th1 cell differentiation and
produced a shift from a Th2 to a Th1-like response in mice
immunized with inactivated RSV immunogen.
DETAILED DESCRIPTION OF THE INVENTION
[0011] The present invention relates to a method of reducing viral
replication of a virus of the Paramyxoviridae family in a host
(e.g., mammal, includimg human, avian) comprising, administering to
the host, a mixture of an antigen of the virus and an effective
adjuvant amount of interleukin-12 (IL-12). Although the method of
the present invention is exemplified using RSV, the method can be
used to reduce viral replication of a variety of viruses from the
Paramyxoviridae family which include human paramyxoviridae viruses,
such as paramyxoviruses (e.g., parainfluenza virus 1, parainfluenza
virus 2, parainfluenza virus 3, parainfluenza virus 4 and mumps
virus), morbilliviruses (e.g., measles virus) and pneumoviruses
(e.g., respiratory syncytial virus). Other non-human viruses of the
Paramyxoviridae family include canine distemper virus, bovine RSV,
Newcastle disease virus and rhinderpest virus. In one embodiment,
the method of the present invention is used to reduce viral
replication of respiratory syncytial virus (RSV) in a host, and
comprises administering to the host an RSV antigen and an effective
adjuvant amount of IL-12.
[0012] In another embodiment, the method of the present invention
is used to elicit an immune response against a virus of the
Paramyxoviridae family in a host, comprising administering to the
host an antigen of the virus and an effective adjuvant amount of
IL-12. In addition, the present invention relates to a method of
immunizing a host against RSV comprising administering to the host
a mixture comprising an RSV antigen and an effective adjuvant
amount of IL-12.
[0013] An antigen of a virus of the Paramyxoviridae family includes
use of the whole virus (e.g., inactivated or live, attenuated whole
virus), an antigenic portion of the virus, and recombinantly
produced virus or portions thereof or fusion proteins. In addition,
antigens of the present invention include nucleic acid sequences
which encode an antigen of a virus of the Paramyxoviridae family.
Antigenic portions of the viruses of the Paramyxoviridae family
include the fusion glycoprotein (F protein) and the
hemagglutinin-neuraminidase of the parainfluenza viruses 1, 2, 3,
4; the F protein and the hemagglutinin-neuraminidase of the mumps
virus; the F protein and the hemagglutinin-neuraminidase of the
measles virus; and the F protein and the G glycoprotein of the RSV.
Other antigenic portions of the Paramyxoviridae family of viruses
which can be used in the methods and compositions of the present
invention, can be determined by those of ordinary skill in the
art.
[0014] The IL-12 of the present invention can be obtained from a
suitable source for use in the present method. For example, IL-12
can be purified from natural sources (e.g., human, animal),
produced by chemical synthesis or produced by recombinant DNA
techniques as described in Example 1. In addition, the IL-12 of the
present invention include nucleic acid sequences encoding IL-12, as
well as the RNAs encoded by such nucleic acid sequences. As used
herein, "interleukin-12" and "IL-12" refer to interleukin 12, its
individual subunits, fragments thereof which exhibit IL-12 adjuvant
activity and functional equivalents of "interleukin-12" and "IL-2".
Functional equivalents of "interleukin-12" and "IL-12" include
modified IL-12 protein such that the resulting IL-12 product has
the same adjuvant activity as the IL-12 described herein, and
nucleic acid sequences which through the degeneracy of the genetic
code encode the same peptide gene product as IL-12 and having the
IL-12 adjuvant activity described herein. For example, a functional
equivalent of "interleukin-12" and "IL-12" can contain a "silent"
codon or amino acid substitution (e.g., substitution of one acidic
amino acid for another acidic amino acid; or substitution of one
codon encoding a hydrophobic amino acid to another codon encoding a
hydrophobic amino acid).
[0015] IL-12, a heterodimeric cytokine predominantly excreted by
the macrophage cells, has been reported to enhance NK cell and CTL
activity, to stimulate the differentiation of Th1 cells, and to
induce production of cytokines, such as IFN-.gamma. (Gately, M. K.,
et al, Cell. Immunol. 143:127 (1992); Naume, B., et al, J. Immunol.
148:2429 (1992); Hsieh, C. S., et al Science 260:547 (1993);
Manetti, R., et al J. Exp. Med. 177:1199 (1993); Chan, S. H., etal,
J. Exp. Med. 173:869 (1991); D'Andrea, A., et al, J. Exp. Med.
176:1387 (1992); Macatonia, S. E., et al, Int. Immunol. 5:1119
(1993); Tripp, C. S., et al, Proc. Natl. Acad. Sci. USA 90:3725
(1993)). IL-12 formerly referred to as natural killer cell
stimulatory factor or cytotoxic lymphocyte maturation factor
functions to activate and to link the innate and acquired immune
responses (Kobayashi, M., et al J. Exp. Med. 170:827 (1989); Stern,
A. S., et al Proc. Natl. Acad. Sci. USA 87:6808 (1990); Locksley,
R. M., et al Proc. Natl. Acad. Sci. USA 90:5879 (1993)). IL-12
promotes differentiation of uncommitted T helper cells towards the
Type 1 (Th1) phenotype (Hsieh, C. S., et al Science 260:547 (1993);
Manetti, R., et al J. Exp. Med. 177:1199 (1993)). This results in a
characteristic constellation of cytokines, such as IFN-.gamma., and
generally promotes cell-mediated immunity (Chan, S.H., et al, J.
Exp. Med. 173:869 (1991); D'Andrea, A., et al, J. Exp. Med.
176:1387 (1992) Macatonia, S. E., et al, Int. Immunol. 5:1119
(1993); Gately, M. K., et al, Cell. Immunol. 143:127 (1992) Naume,
B., et al, J. Immunol. 148:2429 (1992)). IL-12 has been
demonstrated to enhance the immune response and to improve
protective immunity in several infectious disease models, including
Listeriosis, Leishmaniasis, Toxoplasmosis and lymphocytic
choriomeningitis virus infection (Tripp, C. S., et al, Proc. Natl.
Acad. Sci. USA 90:3725 (1993); Heinzel, F. P., et al J. Exp. Med.
177:1505 (1993); Sypek, J. P., et al J. Exp. Med. 177:1797 (1993);
Afonso, L. C., et al, Science 263:235 (1994); Gazzinelli, R. T., et
al, Proc. Natl. Acad. Sci. USA 90:6115 (1993); Khan, I. A., et al
Infect. Immun. 62:1639 (1994); Orange, J. S. et al, J Immunol.
152:1253 (1994)). The purification and cloning of IL-12 are
disclosed in PCT publication nos. WO 92/05256 and WO 90/05147, and
in European patent publication no. 322,827 (identified as
"CLMF").
[0016] Interleukin-12 or IL-12 is a mammalian cytokine which
exhibits numerous immunologic effects, including modulation of T
cell response to antigens (see, for example, PCT publication nos.
WO 92/05256 and WO 90/05147, wherein IL-12 is identified as
"NKSF"). It has also been suggested generally that IL-12 might have
some application as a vaccine adjuvant (Scott, P., Science,
260:496-497(1993); Trichieri, G., Immunology Today,
14:335-338(1993)).
[0017] In the method of the present invention, an effective
adjuvant amount of IL-12 is administered in combination with an
antigen of a virus of the Paramyxoviridae family. That is, the
IL-12 is administered at a time closely related to immunization of
the host with the viral antigen, so that an enhanced immune
response in the host is produced relative to the immunization of a
host in which IL-12 is not administered. Thus, the IL-12 can be
administered prior to, preferably just prior to, immunization, at
the time of immunization (i.e., simultaneously) or after
immunization (i.e. subsequently). In addition, the IL-12 can be
administered prior to immunization with the viral antigen of the
Paramyxoviridae family, followed by subsequent injections of IL-12
after immunization with the antigen.
[0018] The IL-12 and the antigen can be administered to a host in a
variety of ways. The routes of administration include intradermal,
transdermal (e.g., slow release polymers), intramuscular,
intraperitoneal, intravenous, subcutaneous, oral, epidural and
intranasal routes. Any other convenient route of administration can
be used, for example, infusion or bolus injection, or absorption
through epithelial or mucocutaneous linings. In addition, the IL-12
and the antigen of the Paramyxoviridae virus can be administered
together with other components or biologically active agents, such
as other known adjuvants (e.g., alum, MPL, QS21), pharmaceutically
acceptable surfactants (e.g., glycerides), excipients (e.g.,
lactose), carriers, diluents and vehicles. If desired, certain
sweetening, flavoring and/or coloring agents can also be added.
[0019] The IL-12 and the antigen can be administered as a
prophylactic vaccine to hosts which are either infected or
uninfected with the virus. The IL-12 and the antigen can also be
administered as a therapeutic vaccine to infected hosts and can
result in amelioration or elimination of the disease state caused
by the infecting virus.
[0020] Further, the antigen and/or IL-12 can be administered by in
vivo expression of polynucleotides encoding such into a mammalian
subject. For example, the IL-12 or the Paramyxoviridae antigen can
be administered to a host using live vectors, wherein the live
vectors containing IL-12 and/or antigen nucleic acid sequences are
administered under conditions in which the antigen and/or IL-12 are
expressed in vivo. For example, a host can be injected with a
vector which encodes and expresses an antigen of a virus of the
Paramyxoviridae family in vivo in combination with IL-12 protein or
peptide, or in combination with a vector which encodes and
expresses the IL-12 protein in vivo. Alternatively, a host can be
injected with a vector which encodes and expresses IL-12 in vivo in
combination with a Paramyxoviridae antigen in peptide or protein
form, or in combination with a vector which encodes and expresses a
Paramyxoviridae antigen in vivo. A single vector containing the
sequences encoding a Paramyxoviridae antigen and the IL-12 protein
are also useful in the methods and compositions of the present
invention.
[0021] Several expression vector systems are available commercially
or can be reproduced according to recombinant DNA and cell culture
techniques. For example, vector systems such as the yeast or
vaccinia virus expression systems, or virus vectors can be used in
the methods and compositions of the present invention (Kaufman, R.
J., A J. of Meth. in Cell and Molec. Biol., 2:221-236 (1990)).
Other techniques using naked plasmids or DNA, and cloned genes
encapsidated in targeted liposomes or in erythrocytes ghosts, can
be used to introduce the IL-12 and/or Paramyxoviridae antigen
polynucleotides into the host (Freidman, T., Science, 244:1275-1281
(199); Rabinovich, N. R., et al., Science, 265:1401-1404 (1994)).
The construction of expression vectors and the transfer of vectors
and nucleic acids into various host cells can be accomplished using
genetic engineering techniques, as described in manuals like
Molecular Cloning and Current Protocols in Molecular Biology, which
are hereby incorporated by reference, or by using commercially
available kits (Sambrook, J., et al., Molecular Cloning, Cold
Spring Harbor Press, 1989; Ausubel, F. M., et al., Current
Protocols in Molecular Biology, Greene Publishing Associates and
Wiley-Interscience, 1989).
[0022] The amount of antigen used in the methods and compositions
of the present invention is an amount which produces an effective
immunostimulatory response in the host. An effective adjuvant
amount of IL-12 is an amount such that when administered, it
results in an enhanced immune response relative to the immune
response when an effective adjuvant amount of IL-12 is not
administered. In addition, the amount of antigen from a virus of
the Paramyxoviridae family and IL-12 used to immunize the host will
vary depending on a variety of factors, including the antigen
employed, the size, age, body weight, general health, sex and diet
of the host, and the time of administration, duration or particular
qualities of the Paramyxoviridae virus being vaccinated against.
Adjustment and manipulation of established dosage ranges are well
within the ability of those skilled in the art.
[0023] The formulation and route of delivery of vaccine products
can influence the induction of T helper lymphocyte subsets and may
thereby affect disease expression after viral challenge (Graham, B.
S., et al, Immunol. 151:2032 (1993)). Depletion of IL-4 at the time
of immunization by neutralizing monoclonal antibody induces a Th2
to Th1-like immune response shift, accompanied by an improved
clinical outcome and an increased CD8+ cytotoxic T lymphocyte (CTL)
activity (Tang, Y.-W., et al, J. Clin. Invest. (1994)). This was
associated with an increased expression of endogenous IL-12 message
at the time of challenge in the anti-IL-4 treated mice. These
findings suggest that selective activation of the Th2-like cell
subset may be responsible for RSV vaccine induced
immunopotentiation of disease and that IL-12 may be associated with
shifting the response away from Th2 to a more Th1-like
response.
[0024] Replication of RSV is markedly reduced after live RSV
challenge in mice given IL-12. Use of IL-12 as an adjuvant in a
composition comprised of an antigen from RSV and IL-12 also induced
a shift from a Th2 to a Th1-like immune response in mice after RSV
challenge. While the IL-12 adjuvant effect was potent for reduction
of RSV replication, it is more important for use as a vaccine
adjuvant to decrease illness following challenge by RSV. The use of
cytokines as adjuvants can allow one to control the immune
parameters induced by immunization to improve protective effects
and decrease the negative effects of a vaccine for RSV. The effects
of IL-12 on the immune responses to RSV vaccination as measured
after live virus challenge in the BALB/c mouse model are described
in the Examples. The results indicate that IL-12 acts as a potent
adjuvant and is a useful product to include in RSV vaccines.
[0025] As described in Example 1, BALB/c mice were immunized with
inactivated whole virus intramuscularly, and murine recombinant
IL-12 was administered intraperitoneally for 5 successive days
starting at one day before immunization or challenge. The mice were
challenged with live virus 4 weeks later. The viral replication in
lungs 4 days after challenge was assessed. IL-12 administered at
the time of immunization had a marked effect on the reduction of
viral replication. Log 10 pfu per lung was reduced from 6.9 in
RSV-immunized control mice without IL-12 administration to 3.8 in
immunized mice with IL-12 administration (FIG. 1). In contrast,
IL-12 administration at the time of challenge did not have
significant effect on the viral replication (FIG. 1).
[0026] The effects of different delivery routes for IL-12 is
described in Example 2. IL-12 was administered either
intraperitoneally as described in Example 1, or intramuscularly
mixed with the RSV immunogen. Table 1 shows the effect of either
intraperitoneal or intramuscular delivery of IL-12 on the reduction
of viral replication. A single dosage of IL-12 given simultaneously
with immunogen had the same effect on the reduction of viral
replication compared to the 5-dosage intraperitoneal regimen. IL-12
as a specific immunomodulator only worked in RSV immunized mice,
having no effects on the unprimed mice (FIG. 1, Table 1). These
data demonstrate that IL-12 exerts a potent adjuvant effect on the
inactivated RSV immunogen.
[0027] The patterns of immunoglobulin isotypes produced in response
to immunization are indirect indicators of the types of cytokines
produced in vivo. IgG2a is produced in mice as a consequence of Th1
cell activation, whereas IL-4 promotes the production of IgG1
(Burstein, H. J. et al, J. Immunol. 147:2950 (1991); Finkelman, F.
D., et al, Annu Rev. Immunol. 8:303 (1990); Morris, S. C., et al,
J. Immunol. 152:1047 (1994)). As described in Example 3, blinded
assays of serum RSV-specific immunoglobulin isotype titers in
RSV-immunized mice receiving IL-12 showed that IL-12 induced
significantly more RSV-specific IgG2a antibody and significantly
less IgG1 antibody compared to immunized mice not given IL-12. The
pattern of IgG2a and IgG1 RSV-specific antibody response was
similar whether IL-12 was given intramuscularly or
intraperitoneally (Table 2).
[0028] The pattern of antibody isotype utilization induced by IL-12
suggests that in vivo IL-12 administration can promote the
differentiation of antigen-specific CD4+ Th1 cells and inhibit the
development of Th2 cells in response to the inactivated RSV
intramuscular immunization. The pattern of cytokine mRNA expression
in lungs was directly examined as described in Example 4. Lung
tissues from immunized mice, with or without IL-12 treatment, were
harvested at 4 days after live virus challenge. The cytokine mRNAs
for IFN-.gamma., IL-4, IL-6, IL-10, and IL-12, were measured by
Northern blot analysis. There were no obvious differences in IL-6
and IL-10 mRNA levels among mice with different treatments.
However, the lungs from mice treated with IL-12 at the time of
either immunization or challenge contained more IFN-.gamma.
relative to IL-4 compared to control mice that did not receive
IL-12 (FIG. 2). Increased IL-12 MRNA expression occurred in the
mice treated with IL-12 at the time of immunization, while IL-12
administration at challenge did not increase IL-12 mRNA expression
(FIG. 2). These data suggest that IL-12 enhanced Th1 cell
differentiation and produced a shift from a Th2 to a Th1-like
response in mice immunized with the inactivated RSV immunogen.
[0029] RSV-specific cytotoxic T lymphocyte (CTL) activity in lungs
of immunized mice was assessed to evaluate whether IL-12
administration enhanced cell-mediated immunity as a positive
modulatory effector. As described in Example 5, a direct CTL assay
using lung lymphocytes was employed which does not include in vitro
stimulation (Tang, Y.-W., et al, J. Clin. Invest. (1994)). There
was no difference in CTL activity between groups that received or
did not receive IL-12 treatment at the time of immunization. This
result, which was repeated in two consecutive experiments, further
suggests the Th1-like cytokine pattern was a product of CD4+ T
cells. It is reasonable to expect that altering the dose of IL-12
would induce a greater CD8+ response which would alter the illness
pattern.
[0030] As described in Example 5, even though IL-12 has a dramatic
effect on the reduction of RSV replication in lungs, there was not
significant difference in the clinical outcome, including weight
loss and illness score between groups. The simple shift in the
pattern of cytokine expression was therefore not predictive of a
change in illness. This suggests that the cell populations
responsible for cytokine production can be key determinants of
illness and not cytokines themselves. For example, mice treated
with anti-IL-4 at the time of immunization also had increased
IFN-.gamma. expression in lungs at the time of challenge. However,
the anti-IL-4 treatment resulted in diminished illness that was
associated with increased CD8+ CTL activity (Tang, Y.-W., et al, J.
Clin. Invest. (1994)). In the case of anti-IL-4 treated mice, it
may be that the IFN-.gamma. was a product of CD8+ T cells, whereas
in IL-12 treated mice, CD4+ T cells are a more likely source.
[0031] Adjusting the dose of IL-12 can alter its properties. A
recent study of IL-12 on immune responses to lymphocytic
choriomeningitis (LCMV) infection showed that low doses of IL-12
enhanced immunicity to LCMV infection as demonstrated by increased
splenic CD8+ T cell numbers and decreased LCMV replication.
However, high doses of IL-12, equivalent to those used in the
examples, impaired resistance against LCMV infection as
demonstrated by reduced virus-specific CTL activity and increased
viral replication (Orange, J. S. et al, J. Immunol. 152:1253
(1994)). It may therefore be possible to adjust the dose of IL-12
or its method of delivery to maintain the effect on viral
inhibition, but to also impact illness.
[0032] The invention is further illustrated in the following
examples.
EXEMPLIFICATION
Example 1
Immunization of Mice with RSV and IL-12
[0033] Mice: Pathogen-free female BALB/c mice, 8 to 10 months old,
were purchased from Charles River Laboratories (Raleigh, N.C.) and
cared for according to the "Guide for the Care and Use of
Laboratory Animals" as previously described (Graham, B. S., et al,
J. Med. Virol. 26:153 (1988)).
[0034] RSV Immunogen and Virus: Preparation of the
formalin-inactivated alum-precipitated RSV and preparation of stock
of the A2 strain of RSV have been previously reported (Graham, B.
S., et al, Immunol. 151:2032 (1993)). Both the vaccine preparation
and the challenge stock were derived from the A2 strain of RSV.
[0035] Murine Cytokine IL-12: Murine recombinant IL-12 was
expressed from cloned cDNAs (Schoenhaut, D. S., et al, J. Immunol.
148:3433 (1992)). The lot used in this paper was MRB021693-1.2
(Genetics Institute, Cambridge, Mass.) with a specific activity of
5.6.times.10.sup.6 units/mg as determined by PHA blast assay (Wolf,
S. F., et al, J. Exp. Med. 146:3074 (1991)). Concentrated aliquots
of IL-12 were stored at -70.degree. C. and diluted in
phosphate-buffered saline with 1% normal mouse serum (1% PBS).
[0036] Immunization: Mice were immunized with formalin-inactivated
alum-precipitated RSV containing 2.2.times.10.sup.6 pfu equivalents
of virus antigen intramuscularly, and challenged with 10.sup.7 pfu
of live RSV intranasally 4 weeks later as previously described
(Graham, B. S., et al, Immunol. 151:2032 (1993)); Tang, Y.-W., et
al, J. Clin. Invest. (1994)). IL-12 was administered
intraperitoneally for 5 successive days, starting at one day before
immunization at a dose of 1 .mu.g/mouse. Control mice received 1%
phosphate buffered saline (PBS) on the same schedule.
[0037] The viral replication in lungs 4 days after challenge was
assessed by plaque assay. Mouse serum samples were collected on the
day of and two weeks after live RSV challenge.
[0038] Plaque Assays and Neutralization Tests: Two-day old HEp-2
monolayers, 80% confluent in Costar 12-well plates, were used for
plaque assay and neutralization tests. The assays were performed as
described previously (Graham, B. S., et al, J. Med. Virol. 26:153
(1988)).
[0039] IL-12 administered at the time of immunization has a marked
effect on the reduction of viral replication. Log 10 pfu per lung
was reduced from 6.9 in RSV-immunized control mice without IL-12
administration to 3.8 in immunized mice with IL-12 administration.
In contrast, IL-12 administration at the time of challenge did not
have significant effect on the viral replication. See FIG. 1. (Log
10 pfu/gram lung is shown as arithmetic means.+-.S.D.; KV denotes
killed virus)
Example 2
Effect of Delivery Route of IL-12 on its Adjuvant Ability
[0040] The effect of a different delivery route of the adjuvant
IL-12 was assessed. IL-12 was administered intraperitoneally as
described in Example 1 to one group of mice. To another group of
mice, IL-12 was administered intramuscularly mixed with the RSV
antigen. The control mice were either mock immunized or treated
with IL-12 alone without antigen. Table 1 summarizes the results of
the experiment which show that a single dosage of IL-12 given
simultaneously with immunogen had the same effect on the reduction
of viral replication compared to the 5-dosage intraperitoneal
regimen. IL-12 as a specific immunomodulator only worked in RSV
immunized mice, having no effects on the unprimed mice. See FIG. 1
and Table 1. These data demonstrate that IL-12 exerted a potent
adjuvant effect on the inactivated RSV immunogen.
Example 3
Assay of Immunoglobulin Isotype Titers in RSV-immunized Mice
Receiving IL-12
[0041] The patterns of immunoglobulin isotypes produced in
RSV-immunized mice receiving IL-12 was examined. Mouse serum
samples were collected on the day of and two weeks after live RSV
challenge.
[0042] RSV-Specific Immunoglobulin Isotype ELISA: All serologic
assays were performed by a person blinded to the experimental
groups. BCH4 and BC cells were bound to the solid phase on Immulon
II 96-well plates (NUNC, Denmark). Serial diluted mouse serum
samples were added to each well. Plates were incubated, washed, and
goat anti-murine IgG1 or IgG2a conjugated to alkaline phosphatase
(Southern Biotechnology, Birmingham, Ala.) diluted 1:1000 was
added, respectively. After another incubation, plates were washed
and substrate was added for 30 minutes at room temperature and
OD.sub.405 was determined (Graham, B. S., et al, Immunol. 151:2032
(1993); Tang, Y.-W., et al, J. Clin. Invest. (1994)). A serum
dilution was considered positive if the mean optical density of two
BCH4 cell wells was greater than twice that of BC-coated wells and
greater than 0.1.
[0043] The results demonstrate that IL-12 induced significantly
more RSV-specific IgG2a antibody and significantly less IgG1
antibody compared to immunized mice not given IL-12. The pattern of
IgG2a and IgG1 RSV-specific antibody response was similar whether
IL-12 was given intramuscularly or intraperitoneally. See Table
2.
Example 4
Pattern of Cytokine mRNA Expression in Lungs from Mice Immunized
with and without IL-12
[0044] Lung tissues from immunized mice, with and without IL-12
treatment, were harvested at 4 days after live virus challenge. The
cytokine mRNAs for IFN-.gamma., IL-4, IL-6, IL-10 and IL-12 were
measured by Northern blot analysis.
[0045] mRNA Extraction, Northern Blotting, and Cytokine Detection:
The total RNA from whole lungs was extracted and polyA RNA
isolated, electrophoretically separated and transferred to membrane
as previously described (Graham, B. S., et al, Immunol. 151:2032
(1993); Tang, Y.-W., et al, J. Clin. Invest. (1994)). Hybridization
with .sup.32P oligonucleotide probes were performed as previously
described (Graham, B. S., et al, Immunol. 151:2032 (1993)). After
washing, membranes were exposed to Kodak X-omat film at -70.degree.
C. Laser densitometry was performed with an LKB UltroScan XL using
GelScan XL software (Pharmacia Fine Chemicals, Piscataway, N.J.).
Oligonucleotide probes for murine IL-4, IL-10, IFN-.gamma., IL-6
were purchased from R &: D Systems (Minneapolis, Minnesota) or
Clontech Laboratory Inc. (Palo Alto, Calif.). A cocktail of
oligonucleotides designed for detecting IL-12 was based on the
murine IL-12 sequence spanning predicted splice sites based on
those identified in the human IL-12 sequence. (Schoenhaut, D. S.,
et al, J. Immunol. 148:3433 (1992)). From 5' to 3':
[0046] p-40: TABLE-US-00001 p-40: TGAGGACACATCTTGCTTTGCTGCGAGCTG,
(SEQ. ID. NO:1) TCCCGCCTTTGCATTGGACTTCGGTGATG, (SEQ. ID. NO:2) and
CAACGTTGCATCCTAGGATCGGACCCTGCA; (SEQ. ID. NO:3) p-35:
GCCAGGCAACTCTCGTTCTTGTGTAGTTCC, (SEQ. ID. NO:4) and
GCGTTGATGGCCTGGAACTCTGTCTGGTAC. (SEQ. ID. NO:5)
[0047] Cytokine mRNA Northern blots (2 samples per group) with
averaged .alpha.-tubulin-normalized densities are shown in FIG. 2.
There were no obvious differences in IL-6 and IL-10 RNA levels
among mice with different treatments. However, the lungs from mice
treated with IL-12 at the time of either immunization or challenge
contained more IFN-.gamma. relative to IL-4 compared to control
mice that did not receive IL-12 (FIG. 2). An increased IL-12 mRNA
expression occurred in the mice treated with IL-12 at the time of
immunization, while IL-12 administration at challenge did not
increase IL-12 mRNA expression (FIG. 2). These data suggested that
IL-12 enhanced Th1 cell differentiation and produced a shift from a
Th2 to a Th1-like response in mice immunized with the inactivated
RSV immunogen.
Example 5
RSV-specific Cytotoxic T Lymphocyte (CTL) Activity in Lungs of
Immunized Mice
[0048] RSV-specific CTL activity in lungs of immunized mice was
assessed to evaluate whether IL-12 administration enhanced
cell-mediated immunity as a positive modulatory effector. A direct
CTL assay using lung lymphocytes was employed which does not
include in vitro stimulation (Tang, Y.-W., et al, J. Clin. Invest.
(1994)).
[0049] Cytotoxicity T Cell Assays: Whole lung lymphocytes were
isolated by Ficoll-Hypaque (1.09 specific gravity) cushion
centrifugation. BCH4 and BC target cells labeled with .sup.51Cr
(Dupont-New England Nuclear, Boston, Mass.) were incubated with
effector cells for 4 hours at 37.degree. C. in 96-well microtiter
plates as described (Tang, Y.-W., et al, J. Clin. Invest. (1994)).
The spontaneous and total release were obtained by treating the
target cells with 10% RPMI and 5% Triton X-100 detergent,
respectively. Each point was the mean from three replicate wells.
The specific release of .sup.51Cr from target cells was defined as
100.times. (sample cpm-background cpm)/(total cpm-background
cpm).
[0050] There was no difference in CTL activity between groups that
received or did not receive IL-12 treatment at the time of
immunization. This result was repeated in two consecutive
experiments and further suggests the Th1-like cytokine pattern was
a product of CD4+ T cells. Even though IL-12 has a dramatic effect
on the reduction of RSV replication in lungs, there was no
significant difference in the clinical outcome, including weight
loss and illness score between groups. Illness assessment,
including weight loss and clinical scores were performed as
previously described (Tang, Y.-W., et al, J. Clin. Invest. (1994)).
The simple shift in the pattern of cytokine expression was
therefore not predictive of a change in illness. This suggests that
the cell population responsible for cytokine production may be a
key determinant of illness and not cytokines themselves. For
example, mice treated with anti-IL-4 at the time of immunization
also had increased IFN-.gamma. expression in lungs at the time of
challenge. However, the anti-IL-4 treatment resulted in diminished
illness that was associated with increased CD8+ CTL activity (Tang,
Y.-W., et al, J. Clin. Invest. (1994)). In the case of anti-IL-4
treated mice, it may be that the IFN-.gamma. was a product of CD8+
T cells, whereas in IL-12 treated mice, CD4+ T cells were a more
likely source. TABLE-US-00002 TABLE 1 IL-12 Administered Either
Intraperitoneally or Intramuscularly Reduces Virus Replication in
Lungs and Noses IL-12 Log 10 pfu/gram Log 10 pfu/ Group N Immunogen
Route Lung* Nose* 1 5 KV -- 6.56 .+-. 0.44 3.73 .+-. 0.15 2 5 KV IP
4.75 .+-. 0.25.dagger. 2.61 .+-. 0.23.dagger-dbl. 3 5 KV IM 4.44
.+-. 0.55.dagger. 2.80 .+-. 0.34.dagger-dbl. 4 5 Mock -- 6.55 .+-.
0.32 3.73 .+-. 0.29 5 5 Mock IP 6.51 .+-. 0.34 3.21 .+-. 0.27 *Mean
.+-. S.D. .dagger.p < 0.001 compared to Log 10 pfu/gram lung in
group 1 .dagger-dbl.p < 0.001 compared to log 10 pfu/nose in
group 1 KV killed virus IP intraperitoneal IM intramuscularly
[0051] TABLE-US-00003 TABLE 2 IL-12 Administered Alters
RSV-Specific Serum Immunoglobulin Isotype Titers at and Two Weeks
After RSV Challenge IL-12 At Challenge 2 Weeks After Challenge
Group Immunogen Route IgG1 IgG2a IgG1 IgG2a 1 KV -- <80 (0/5)*
<80 (0/5) 640.0 .+-. 2.2 (4/4) 269.1 .+-. 4.2 (2.4) 2 KV IP
<80 (0/5) 557.2 .+-. 6.4.dagger. (3/5) 121.3 .+-.
1.9.dagger-dbl. (2/5) 640.0 .+-. 6.7.dagger-dbl..dagger-dbl. (3/5)
3 KV IM <80 (0/5) 367.6 .+-. 4.1 (3/5) <80 (0/5) 905.1 .+-.
4.2.dagger-dbl..dagger-dbl. (3.4) 4 Mock -- <80 (0/5) <80
(0/5) <80 (0/5) 113.1 .+-. 2.1 (1/4) 5 Mock IP <80 (0/5)
<80 (0/5) <80 (0/5) 139.3 .+-. 2.5 (2/5) *Number
converted/number tested .dagger.Geometric mean titer .+-. S.D.
Negative samples were assigned a titer value of 80 for statistical
calculations. .dagger-dbl.p < 0.01 compared to IgG1 2 weeks
after challenge in group 1 .dagger-dbl..dagger-dbl.p > 0.5
compared to IgG2a 2 weeks after challenge in group 1 KV killed
virus IP intraperitoneal IM intramuscular
[0052]
Sequence CWU 1
1
* * * * *