U.S. patent application number 11/607709 was filed with the patent office on 2007-04-19 for compounds, compositions and methods for the treatment of diseases characterized by a-33 related antigens.
Invention is credited to Avi Ashkenazi, Sherman Fong, Audrey Goddard, Austin L. Gurney, Mary A. Napier, Daniel Tumas, William I. Wood.
Application Number | 20070087007 11/607709 |
Document ID | / |
Family ID | 46300908 |
Filed Date | 2007-04-19 |
United States Patent
Application |
20070087007 |
Kind Code |
A1 |
Ashkenazi; Avi ; et
al. |
April 19, 2007 |
Compounds, compositions and methods for the treatment of diseases
characterized by A-33 related antigens
Abstract
The present invention relates to compositions and methods of
treating and diagnosing disorders characterized the by the presence
of antigens associated with inflammatory diseases and/or cancer,
and nucleotide sequences, including expressed sequence tags (ESTs),
oligonucleotide probes, polypeptides, vectors and host cells
expressing such antigens PRO301, PRO362 or PRO245.
Inventors: |
Ashkenazi; Avi; (San Mateo,
CA) ; Fong; Sherman; (Alameda, CA) ; Goddard;
Audrey; (San Francisco, CA) ; Gurney; Austin L.;
(Belmont, CA) ; Napier; Mary A.; (Hillsborough,
CA) ; Tumas; Daniel; (Orinda, CA) ; Wood;
William I.; (Hillsborough, CA) |
Correspondence
Address: |
HELLER EHRMAN LLP
275 MIDDLEFIELD ROAD
MENLO PARK
CA
94025-3506
US
|
Family ID: |
46300908 |
Appl. No.: |
11/607709 |
Filed: |
November 30, 2006 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10785433 |
Feb 24, 2004 |
|
|
|
11607709 |
Nov 30, 2006 |
|
|
|
09953499 |
Sep 14, 2001 |
6838554 |
|
|
10785433 |
Feb 24, 2004 |
|
|
|
09254465 |
Mar 5, 1999 |
6410708 |
|
|
09953499 |
Sep 14, 2001 |
|
|
|
PCT/US98/24855 |
Nov 20, 1998 |
|
|
|
09254465 |
Mar 5, 1999 |
|
|
|
PCT/US98/19437 |
Sep 17, 1998 |
|
|
|
09254465 |
Mar 5, 1999 |
|
|
|
60066364 |
Nov 21, 1997 |
|
|
|
Current U.S.
Class: |
424/155.1 |
Current CPC
Class: |
C07K 14/705 20130101;
G01N 2800/7095 20130101; C07K 2317/24 20130101; C07K 14/47
20130101; G01N 33/6893 20130101; A61K 38/00 20130101; C07K 2319/00
20130101; C07K 16/28 20130101; Y02A 50/30 20180101; C07K 2319/30
20130101; A61K 39/395 20130101; G01N 33/57484 20130101 |
Class at
Publication: |
424/155.1 |
International
Class: |
A61K 39/395 20060101
A61K039/395 |
Claims
1. A method for inhibiting tumor angiogenesis, comprising
administering to a patient in need an effective amount of a
polypeptide having at least 95% sequence identity to the
polypeptide of SEQ ID NO: 1, wherein said polypeptide is capable of
inhibiting VEGF-stimulated proliferation of endothelial cells.
2. The method of claim 1 wherein said polypeptide comprises amino
acids 28 to 235 of the polypeptide of SEQ ID NO: 1.
3. The method of claim 1 wherein said polypeptide comprises amino
acids 28 to 299 of the polypeptide of SEQ ID NO: 1.
4. A pharmaceutical composition comprising an effective amount of a
polypeptide having at least 95% sequence identity to the
polypeptide of SEQ ID NO: 1, wherein said polypeptide is capable of
inhibiting VEGF-stimulated proliferation of endothelial cells, and
instructions for administering said composition to inhibit tumor
angiogenesis.
5. The pharmaceutical composition of claim 4 wherein said
polypeptide comprises amino acids 28 to 235 of the polypeptide of
SEQ ID NO: 1.
6. The pharmaceutical composition of claim 4 wherein said
polypeptide comprises amino acids 28 to 299 of the polypeptide of
SEQ ID NO: 1.
Description
CROSS REFERENCES TO RELATED APPLICATIONS
[0001] This application is a continuation application of U.S.
application Ser. No. 10/785,433, filed Feb. 24, 2004 which is a
divisional of co-pending U.S. application Ser. No. 09/953,499 filed
Sep. 14, 2001, which is a continuation of, and claims priority
under 35 USC .sctn.120 to, U.S. application Ser. No. 09/254,465
filed Mar. 5, 1999, which is a continuation of and claims priority
under 35 USC .sctn.120 to PCT Application No. PCT/US98/24855 filed
Nov. 20, 1988, which claims priority under 35 USC .sctn.119 to U.S.
Provisional Patent Application No. 60/066,364, filed Nov. 21, 1997,
and where PCT Application PCT/US98/24855 is also a
continuation-in-part of PCT/US98/19437 filed Sep. 17, 1998, the
disclosures of which are expressly incorporated herein by
reference.
FIELD OF THE INVENTION
[0002] The present invention relates generally to the
identification, isolation and recombinant production of novel DNA
and novel polypeptides the presence of which is associated with
inflammatory diseases (inflammation associated antigens) and/or
cancer, and to compositions and methods for the diagnosis and
treatment of conditions characterized by such antigens.
BACKGROUND OF THE INVENTION
[0003] The inflammatory response is complex and is mediated by a
variety of signaling molecules produced locally by mast cells,
nerve endings, platelets, leucocytes and complement activation.
Certain of these signaling molecules cause the endothelial cell
lining to become more porous and/or even to express selectins which
act as cell surface molecules which recognize and attract
leucocytes through specific carbohydrate recognition. Stronger
leucocyte binding is mediated by integrins, which mediate leukocyte
movement through the endothelium. Additional signaling molecules
act as chemoattractants, causing the bound leucocytes to crawl
towards the source of the attractant. Other signaling molecules
produced in the course of an inflammatory response escape into the
blood and stimulate the bone marrow to produce more leucocytes and
release them into the blood stream.
[0004] Inflammation is typically initiated by an antigen, which can
be virtually any molecule capable of initiating an immune response.
Under normal physiological conditions these are foreign molecules,
but molecules generated by the organism itself can serve as the
catalyst as is known to occur in various disease states.
[0005] T-cell proliferation in a mixed lymphocyte culture or mixed
lymphocyte reaction (MLR) is an established indication of the
ability of a compound to stimulate the immune system. In an
inflammatory response, the responding leucocytes can be
neutrophilic, eosinophilic, monocytic or lymphocytic. Histological
examination of the affected tissues provides evidence of an immune
stimulating or inhibiting response. See Current Protocols in
Immunology, ed. John E. Coligan, 1994, John Wiley and Sons,
Inc.
[0006] Inflammatory bowel disease (IBD) is a term used to
collectively describe gut disorders including both ulcerative
colitis (UC) and Crohn's disease, both of which are classified as
distinct disorders, but share common features and likely share
pathology. The commonality of the diagnostic criteria can make it
difficult to precisely determine which of the two disorders a
patients has; however the type and location of the lesion in each
are typically different. UC lesions are characteristically a
superficial ulcer of the mucosa and appear in the colon, proximal
to the rectum. CD lesions are characteristically extensive linear
fissures, and can appear anywhere in the bowel, occasionally
involving the stomach, esophagus and duodenum.
[0007] Conventional treatments for IBD usually involve the
administration of antiinflammatory or immunosuppressive agents,
such as sulfasalazine, corticosteroids,
6-mercaptopurine/azathoprine, or cyclosporine all of which only
bring partial relief to the afflicted patient. However when
antiinflammatory/immunosuppresive therapies fail, colectomies are
the last line of defense. Surgery is required for about 30% of CD
patients within the first year after diagnosis, with the likelihood
for operative procedure increasing about 5% annually thereafter.
Unfortunately, CD also has a high rate of reoccurrence as about 5%
of patients require subsequent surgery after the initial year. UC
patients further have a substantially increased risk of developing
colorectal cancer. Presumably this is due to the recurrent cycles
of injury to the epithelium, followed by regrowth, which
continually increases the risk of neoplastic transformation.
[0008] A recently discovered member of the immunoglobulin
superfamily known as Junctional Adhesion Molecule (JAM) has been
identified to be selectively concentrated at intercellular
junctions of endothelial and epithelial cells of different origins.
Martin-Padura, I. et al., J. Cell Biol. 142(1): 117-27 (1998). JAM
is a type I integral membrane protein with two extracellular,
intrachain disulfide loops of the V-type. JAM bears substantial
homology to A33 antigen (FIG. 1 or FIG. 18). A monoclonal antibody
directed to JAM was found to inhibit spontaneous and
chemokine-induced monocyte transmigration through an endothelial
cell monolayer in vitro. Martin-Padura, supra.
[0009] It has been recently discovered that JAM expression is
increased in the colon of CRF 2-4 -/- mice with colitis. CRF 2-4
-/- (IL-10R subunit knockout mice) develop a spontaneous colitis
mediated by lymphocytes, monocytes and neutrophils. Several of the
animals also developed colon adenocarcinoma. As a result, it is
foreseeable likely that the compounds of the invention are
expressed in elevated levels in or otherwise associated with human
diseases such as inflammatory bowel disease, other inflammatory
diseases of the gut as well as colorectal carcinoma.
[0010] The compounds of the invention also bear significant
homology to A33 antigen, a known colorectal cancer-associated
marker. The A33 antigen is expressed in more than 90% of primary or
metastatic colon cancers as well as normal colon epithelium. In
carcinomas originating from the colonic mucosa, the A33 antigen is
expressed homogeneously in more than 95% of all cases. The A33
antigen, however, has not been detected in a wide range of other
normal tissues, i.e., its expression appears to be organ specific.
Therefore, the A33 antigen appears to play an important role in the
induction of colorectal cancer.
[0011] Since colon cancer is a widespread disease, early diagnosis
and treatment is an important medical goal. Diagnosis and treatment
of colon cancer can be implemented using monoclonal antibodies
(mAbs) specific therefore having fluorescent, nuclear magnetic or
radioactive tags. Radioactive gene, toxins and/or drug tagged mAbs
can be used for treatment in situ with minimal patient description.
mAbs can also be used to diagnose during the diagnosis and
treatment of colon cancers. For example, when the serum levels of
the A33 antigen are elevated in a patient, a drop of the levels
after surgery would indicate the tumor resection was successful. On
the other hand, a subsequent rise in serum A33 antigen levels after
surgery would indicate that metastases of the original tumor may
have formed or that new primary tumors may have appeared.
[0012] Such monoclonal antibodies can be used in lieu of, or in
conjunction with surgery and/or other chemotherapies. For example,
preclinical analysis and localization studies in patients infected
with colorectal carcinoma with a mAb to A33 are described in Welt
et al., J. Clin. Oncol. 8: 1894-1906 (1990) and Welt et al., J.
Clin. Oncol. 12: 1561-1571 (1994), while U.S. Pat. No. 4,579,827
and U.S. Ser. No. 424,991 (E.P. 199,141) are directed to the
therapeutic administration of monoclonal antibodies, the latter of
which relates to the application of anti-A33 mAb.
SUMMARY OF THE INVENTION
[0013] The present invention further concerns compositions and
methods for the diagnosis and treatment of inflammatory diseases in
mammals, including humans. The present invention is based on the
identification of proteins (including agonist and antagonist
antibodies) which either stimulate or inhibit the immune response
in mammals. Inflammatory diseases can be treated by suppressing the
inflammatory response. Molecules that enhance an inflammatory
response stimulate or potentiate the immune response to an antigen.
Molecules which stimulate an inflammatory response can be inhibited
where suppression of the inflammatory response would be beneficial.
Molecules which stimulate the inflammatory response can be used
therapeutically where enhancement of the inflammatory response
would be beneficial. Such stimulatory molecules can also be
inhibited where suppression of the inflammatory response would be
of value. Neutralizing antibodies are examples of molecules that
inhibit molecules having immune stimulatory activity and which
would be beneficial in the treatment of inflammatory diseases.
Molecules which inhibit the inflammatory response can also be
utilized (proteins directly or via the use of antibody agonists) to
inhibit the inflammatory response and thus ameliorate inflammatory
diseases.
[0014] Accordingly, the proteins of the invention are useful for
the diagnosis and/or treatment (including prevention) of immune
related diseases. Antibodies which bind to stimulatory proteins are
useful to suppress the inflammatory response. Antibodies which bind
to inhibitory proteins are useful to stimulate inflammatory
response and the immune system. The proteins and antibodies of the
invention are also useful to prepare medicines and medicaments for
the treatment of inflammatory and immune related diseases.
[0015] In one embodiment, the invention concerns antagonists and
agonists of a PRO301, PRO362 or PRO245 polypeptide that inhibits
one or more of the functions or activities of PRO301, PRO362 or
PRO245 polypeptide.
[0016] In another embodiment, the invention concerns a method for
determining the presence of a PRO301, PRO362 or PRO245 polypeptide
comprising exposing a cell suspected of containing the polypeptide
to an anti-PRO301, anti-PRO362 or anti-PRO245 antibody and
determining binding of the antibody to the cell.
[0017] In yet another embodiment, the present invention relates to
a method of diagnosing an inflammatory related disease in a mammal,
comprising detecting the level of expression of a gene encoding a
PRO301, PRO362 or PRO245 polypeptide (a) in a test sample of tissue
cells obtained from the mammal, and (b) in a control sample of
known normal tissue cells of the same cell type, wherein a higher
expression level in the test sample indicates the presence of an
inflammatory disease in the mammal.
[0018] In another embodiment, the present invention relates to
method of diagnosing an inflammatory disease in a mammal,
comprising (a) contacting an anti-PRO30 1, anti-PRO362 or
anti-PRO245 antibody with a test sample of tissue culture cells
obtained from the mammal, and (b) detecting the formation of a
complex between the antibody and the PRO301, PRO362 or PRO245
polypeptide. The detection may be qualitative or quantitative, and
may be performed in comparison with monitoring the complex
formation in a control sample of known normal tissue cells of the
same cell type. A larger quantity of complexes formed in the test
sample indicates the presence of tumor in the mammal from which the
test tissue cells were obtained. The antibody preferably carries a
detectable label. Complex formation can be monitored, for example,
by light microscopy, flow cytometry, fluorimetry, or other
techniques known in the art. The test sample is usually obtained
from an individual suspected of having a deficiency or abnormality
relating to the inflammatory response.
[0019] In another embodiment, the present invention relates to a
diagnostic kit, containing an anti-PRO301, anti-PRO362 or
anti-PRO245 antibody and a carrier (e.g., a buffer) in suitable
packaging. The kit preferably contains instructions for using the
antibody to detect the PRO301, PRO362 polypeptide.
[0020] In a further embodiment, the invention concerns an article
of manufacture, comprising:
[0021] a container;
[0022] a label on the container; and
[0023] a composition comprising an active agent contained within
the container; wherein the composition is effective for stimulating
or inhibiting an inflammatory response in a mammal, the label on
the container indicates that the composition can be used to treat
an inflammatory disease, and the active agent in the composition is
an agent stimulating or inhibiting the expression and/or activity
of the PRO301, PRO362 or PRO245 polypeptide. In a preferred aspect,
the active agent is a PRO301, PRO362 or PRO245 polypeptide or an
anti-PRO301, anti-PRO362 or anti-PRO245 antibody.
[0024] A further embodiment is a method for identifying a compound
capable of inhibiting the expression and/or activity of a PRO301,
PRO362 or PRO245 polypeptide by contacting a candidate compound
with a PRO301, PRO362 or PRO245 polypeptide under conditions and
for time sufficient to allow these two compounds to interact. In a
specific aspect, either the candidate compound or the PRO301,
PRO362 or PRO245 polypeptide is immobilized on a solid support. In
another aspect, the non-immobilized component carries a detectable
label.
[0025] In yet a further aspect, the invention relates to a method
of treating an inflammatory disease, by administration of an
effective therapeutic amount of a PRO301, PRO362 or PRO245
antagonist to a patient in need thereof for the treatment of a
disease selected from: inflammatory bowel disease, systemic lupus
erythematosis, rheumatoid arthritis, juvenile chronic arthritis,
spondyloarthropathies, systemic sclerosis (scleroderma), idiopathic
inflammatory myopathies (dermatomyositis, polymyositis), Sjogren's
syndrome, systemic vaculitis, sarcoidosis, autoimmune hemolytic
anemia (immune pancytopenia, paroxysmal nocturnal hemoglobinuria),
autoimmune thrombocytopenia (idiopathic thrombocytopenic purpura,
immune-mediated thrombocytopenia), thyroiditis (Grave's disease,
Hashimoto's thyroiditis, juvenile lymphocytic thyroiditis, atrophic
thyroiditis), diabetes mellitus, immune-mediated renal disease
(glomerulonephritis, tubulointerstitial nephritis), demyelinating
diseases of the central and peripheral nervous systems such as
multiple sclerosis, idiopathic polyneuropathy, hepatobiliary
diseases such as infectious hepatitis (hepatitis A, B, C, D, E and
other nonhepatotropic viruses), autoimmune chronic active
hepatitis, primary biliary cirrhosis, granulomatous hepatitis, and
sclerosing cholangitis, inflammatory and fibrotic lung diseases
(e.g., cystic fibrosis, eosinophilic pneumonias, idiopathic
pulmonary fibrosis and hypersensitivity pneumonitis),
gluten-sensitive enteropathy, Whipple's disease, autoimmune or
immune-mediated skin diseases including bullous skin diseases,
erythema multiforme and contact dermatitis, psoriasis, allergic
diseases of the lung such as eosinophilic pneumonias, idiopathic
pulmonary fibrosis and hypersensitivity pneumonitis,
transplantation associated diseases including graft rejection and
graft-verus host disease.
[0026] In a further embodiment, the present invention provides a
method of diagnosing tumor in a mammal, comprising detecting the
level of expression of a gene encoding a PRO201, 362 or PRO245
polypeptide (a) in a test sample of tissue cells obtained from the
mammal, and (b) in a control sample of known normal tissue cells of
the same cell type, wherein a higher expression level in the test
sample indicates the presence of tumor in the mammal from which the
test tissue cells were obtained.
[0027] In another embodiment, the present invention provides a
method of diagnosing tumor in a mammal, comprising (a) contacting
an anti-PRO301, anti-PRO362 or anti-PRO245 antibody with a test
sample of the tissue cells obtained from the mammal, and (b)
detecting the formation of a complex between the anti-PRO301,
anti-PRO362 or anti-PRO245 and the PRO301, PRO362 or PRO245
polypeptide in the test sample. The detection may be qualitative or
quantitative, and may be performed in comparison with monitoring
the complex formation in a control sample of known normal tissue
cells of the same cell type. A larger quantity of complexes formed
in the test sample indicates the presence of tumor in the mammal
from which the test tissue cells were obtained. The antibody
preferably carries a detectable label. Complex formation can be
monitored, for example, by light microscopy, flow cytometry,
fluorimetry, or other techniques known in the art. Preferably, the
test sample is obtained from an individual mammal suspected to have
neoplastic cell growth or proliferation (e.g., cancerous
cells).
[0028] In another embodiment, the present invention provides a
cancer diagnostic kit, comprising an anti-PRO301, PRO362 or PRO245
antibody and a carrier (e.g. a buffer) in suitable packaging. The
kit preferably contains instructions for using the antibody to
detect the PRO301, PRO362 or PRO245 polypeptide.
[0029] In yet another embodiment, the invention provides a method
for inhibiting the growth of tumor cells comprising exposing a cell
which overexpresses a PRO301, PRO362 or PRO245 polypeptide to an
effective amount of an agent inhibiting the expression and/or
activity of the PRO301, PRO362 or PRO245 polypeptide. The agent
preferably is an anti-PRO301, anti-PRO362 or anti-PRO245
polypeptide, a small organic and inorganic peptide, phosphopeptide,
antisense or ribozyme molecule, or a triple helix molecule. In a
specific aspect, the agent, e.g., anti-PRO301, anti-PRO362 or
anti-PRO245 antibody induces cell death. In a further aspect, the
tumor cells are further exposed to radiation treatment and/or a
cytotoxic or chemotherapeutic agent.
[0030] In a further embodiment, the invention concerns an article
of manufacture, comprising:
[0031] a container;
[0032] a label on the container, and a composition comprising an
active agent contained within the container; wherein the
composition is effective for inhibiting the growth of tumor cells,
the label on the container indicates that the composition can be
used for treating conditions characterized by overexpression of a
PRO301, PRO362 or PRO245 polypeptide, and the active agent in the
composition is an agent inhibiting the expression and/or activity
of the PRO301, PRO362 or PRO245 polypeptide. In a preferred aspect,
the active agent is an anti-PRO301, anti-PRO362 or anti-PRO245
antibody.
[0033] In a further embodiment, the invention provides an isolated
nucleic acid molecule having at least about 80% sequence identity
to (a) a DNA molecule encoding a PRO301 polypeptide comprising the
sequence of amino acids 28 to 258 of FIG. 2 (SEQ ID NO: 1), or (b)
the complement of the DNA molecule of (a). The sequence identity
preferably is about 85%, more preferably about 90%, most preferably
about 95%. In one aspect, the isolated nucleic acid has at least
about 80%, preferably at least about 85%, more preferably at least
about 90%, and most preferably at least about 95% sequence identity
with a polypeptide having amino acid residues about 28 to 235 of
FIG. 2 (SEQ ID NO: 1). Preferably, the highest degree of sequence
identity occurs within the extracellular domains (amino acids 28 to
235 of FIG. 2, SEQ ID NO: 1). In a further embodiment, the isolated
nucleic acid molecule comprises DNAencoding a PRO301 polypeptide
having amino acid residues 28 to 299 of FIG. 2 (SEQ ID NO: 1), or
is complementary to such encoding nucleic acid sequence, and
remains stably bound to it under at least moderate, and optionally,
under high stringency conditions. In another aspect, the invention
provides a nucleic acid of the full length protein of clone
DNA40628, deposited with the ATCC under accession number ATCC
209432, alternatively the coding sequence of clone DNA40628,
deposited under accession number ATCC 209432.
[0034] In another embodiment, the invention provides an isolated
nucleic acid molecule comprising DNA encoding a PRO362 polypeptide.
In one aspect, the isolated nucleic acid comprises DNA encoding the
PRO362 polypeptide having amino acid residues 1 to 321 of FIG. 3
(SEQ ID NO: 2), or is complementary to such encoding nucleic acid
sequence, and remains stably bound to it under at least moderate,
and optionally, under high stringency conditions. In another
aspect, the isolated nucleic acid comprises DNA encoding the PRO362
polypeptide having amino acid residues 1 to X or FIG. 3 (SEQ ID NO:
2), where X is any amino acid residue from 271 to 280, or is
complementary to such encoding nucleic acid sequence, and remains
stably bound to it under at least moderate, and optionally, under
high stringency conditions. The isolated nucleic acid sequence may
comprise the cDNA insert of the DNA45416-1251 vector deposited on
Feb. 5, 1998 as ATCC 209620 which includes the nucleotide sequence
encoding PRO362.
[0035] In yet another embodiment, the invention provides isolated
nucleic acid molecules that hybridize to the complement of the
nucleic acid molecules encoding the PRO301, PRO362 or PRO245
polypeptides. The nucleic acid preferably is DNA, and hybridization
occurs under stringent conditions. Such nucleic acid molecules can
act as antisense molecules of the inflammation associated antigens
identified herein, which, in turn, can find use in the modulation
of the inflammation associated antigens, or as antisense primers in
amplification reactions. Furthermore, such sequences can be used as
part of ribozyme and/or triple helix sequence which, in turn, may
be used in regulation of the inflammation associated antigens.
[0036] In yet another embodiment, the invention provides a vector
comprising DNA encoding PRO301 or a PRO362 polypeptide. A host cell
comprising such a vector is also provided. By way of example, the
host cells may be CHO cells, E. coli, or yeast. A process for
producing PRO301 or PRO362 polypeptides is further provided and
comprises culturing host cells under conditions suitable for
expression of PRO301 or PRO362 and recovering the same from the
cell culture.
[0037] In yet another embodiment, the invention provides isolated
PRO301 polypeptide. In particular, the invention provides isolated
native sequence PRO301 polypeptide, which in one embodiment,
includes an amino acid sequence comprising the extracellular domain
residues 28 to 235 of FIG. 2 (SEQ ID NO: 1). Native PRO301
polypeptides with or without the native signal sequence (amino
acids 1 to 27 in FIG. 2 (SEQ ID NO: 1), and with or without the
initiating methionine are specifically included. Additionally, the
sequences of the invention may also comprise the transmembrane
domain (residues 236 to 258 in FIG. 2)(SEQ ID NO: 1) and/or the
intracellular domain (residue 259 to 299 in FIG. 2)(SEQ ID NO: 1).
Alternatively, the invention provides a PRO301 polypeptide encoded
by the nucleic acid deposited under accession number ATCC
209432.
[0038] In yet another embodiment, the invention provides isolated
PRO362 polypeptide. In particular, the invention provides isolated
native sequence PRO362, which in one aspect, includes an amino acid
sequence comprising residues 1 to 321 of FIG. 3 (SEQ ID NO: 2). An
additional embodiment of the present invention is directed to an
isolated extracellular domain of a PRO362 polypeptide comprising
amino acids 1 to X of the FIG. 2 (SEQ ID NO: 2), wherein X is any
amino acid residue 271-280. Optionally, the PRO362 polypeptide is
obtained or is obtainable by expressing the polypeptide encoded by
the cDNA insert of the DNA45416-1251 vector deposited on Feb. 5,
1998 as ATCC Deposit No.209620.
[0039] In yet another embodiment, the invention provides chimeric
molecules comprising a PRO301 or PRO362 polypeptide fused to a
heterologous polypeptide or amino acid sequence. An example of such
a chimeric molecule comprises a PRO301 or PRO362 polypeptide fused
to an epitope tag sequence or a Fc region of an immunoglobulin.
[0040] In yet another embodiment, the invention provides an
expressed sequence tag (EST) comprising the nucleotide sequences
identified as: DNA35936 (SEQ ID NO: 3) in FIG. 4A, consen01 (SEQ ID
NO: 4) in FIG. 4B and consen02 (DNA42257)(SEQ ID NO: 5).
[0041] In another embodiment, the present invention provides an
isolated antibody which binds a PRO301 or PRO362 polypeptide. In
one aspect, the antibody mimics the activity of a PRO301 or PRO362
polypeptide (an agonist antibody) or conversely the antibody
inhibits or neutralizes the activity of a PRO301 or PRO362
polypeptide (antagonist antibody). In another aspect, the antibody
is a monoclonal antibody, which preferably contains nonhuman
complementarity determining region (CDR) residues and human
framework region (FR) residues. The antibody may be labeled and/or
immobilized on a solid support. In a further aspect, the antibody
is affinity matured, an antibody fragment, a single-chain antibody,
or an anti-idiotypic antibody.
[0042] In another embodiment, the invention provides a composition
containing a PRO301 or PRO362 polypeptide or an agonist or
antagonist antibody in admixture with a carrier or excipient. In
one aspect, the composition contains a therapeutically affective
amount of the peptide or antibody. In another aspect, when the
composition contains an inflammation stimulating molecule, the
composition is useful for: (a) increasing infiltration of
inflammatory cells into a tissue of a mammal in need thereof, (b)
stimulating or enhancing an immune response in a mammal in need
thereof, or (c) increasing the proliferation of T-lymphocytes in a
mammal in need thereof in response to an antigen. In a further
aspect, when the composition contains an inflammatory inhibiting
molecule, the composition is useful for: (a) decreasing
infiltration of inflammatory cells into a tissue of a mammal in
need thereof, (b) inhibiting or reducing an inflammatory response
in a mammal in need thereof, or (c) decreasing the proliferation of
T-lymphocytes in a mammal in need thereof in response to an
antigen. In another aspect, the composition contains a further
active ingredient, which may, for example, be a further antibody or
a cytotoxic or chemotherapeutic agent. Preferably, the composition
is sterile.
[0043] In a further embodiment, the invention concerns nucleic acid
encoding an anti-PRO301 and anti-PRO362 antibody, and vectors and
recombinant host cells comprising such nucleic acid. In a still
further embodiment, the invention concerns a method for producing
such an antibody by culturing a host cell transformed with nucleic
acid encoding the antibody under conditions such that the antibody
is expressed, and recovering the antibody from the cell
culture.
BRIEF DESCRIPTION OF THE DRAWINGS
[0044] FIG. 1 show a comparison between the polypeptides encoded by
A33 antigen (SEQ ID NO: 6), DNA40628 (SEQ ID NO: 1), DNA45416 (SEQ
ID NO: 2), DNA35638 (SEQ ID NO: 9) and JAM (SEQ ID NO: 10).
[0045] FIG. 2 shows the derived amino acid sequence (SEQ ID NO: 1)
of a native sequence PRO301 polypeptide. This polypeptide is 299
amino acids long, having signal sequence at residue 1 to 27, an
extracellular domain at residue 28 to about 235, Ig superfamily
homology at residue 94 to 235, a potential transmembrane domain at
residue 236 to about 258, and an intracellular domain at about
residue 259 to 299.
[0046] FIG. 3 shows the amino acid sequence (SEQ ID NO: 2) derived
from nucleotides 119-1081 of the nucleotide sequence shown in FIGS.
6A and 6B (DNA45416, SEQ ID NO: 7). Also shown in FIG. 3 as
underlines are the locations of a glycosoaminoglycan site and a
transmembrane domain.
[0047] FIG. 4A shows the consensus assembly DNA35936 (SEQ ID NO:
3), and FIG. 4B shows consen01 (SEQ ID NO: 4) which were both used
in the isolation of DNA40628 (SEQ ID NO: 11). FIG. 4C shows
consen02 (DNA42257) (SEQ ID NO: 5) which was used in the isolation
of DNA45416 (SEQ ID NO: 7).
[0048] FIG. 5 shows the nucleotide sequence of a native sequence
DNA40628 cDNA (SEQ ID NO: 11), which is a native sequence PRO301
cDNA also designated as "UNQ264" and/or "DNA40628-1216".
[0049] FIGS. 6A & B show a nucleotide sequence DNA45416 (SEQ ID
NO: 7) which is a native sequence PRO362 cDNA also designated as
"UNQ317" and/or "DNA45416-1251". Also presented is the initiator
methionine and the protein translation for a full-length PRO362
polypeptide (SEQ ID NO: 2).
[0050] FIG. 7 shows the nucleotide sequence (SEQ ID NO: 8) of a
native sequence PRO245 cDNA, wherein the nucleotide sequence is
designated as "UNQ219" and/or "DNA35638".
[0051] FIG. 8 shows the oligonucleotide sequences OL12162
(35936.f1)(SEQ ID NO: 12), OL12163 (35936.p1)(SEQ ID NO: 13),
OL12164 (35936.f2)(SEQ ID NO: 14), OL12165 (35936.r1)(SEQ ID NO:
15), OL12166 (35936.f3)(SEQ ID NO: 16), OL12167 (35936.r2)(SEQ ID
NO: 17) which were used in the isolation of DNA40628.
[0052] FIG. 9 shows a double stranded representation of the
DNA42257 (consen02) (SEQ ID NO: 5) along with the locations of five
oligonucleotide primers, showed in underline, all used in the
isolation of DNA45416 (SEQ ID NO: 7). The oligonucleotides depicted
are: 42257.f1 (SEQ ID NO: 18), 42257.f2 (SEQ ID NO: 19), 42257.r1
(SEQ ID NO: 20),42257.r2 (SEQ ID NO: 21) and 42257.p1 (SEQ ID NO:
22).
[0053] FIG. 10 describes the Blast score, match and percent
homology alignment between 2 overlapping fragments of DNA40628 and
A33_HUMAN, a human A33 antigen precursor. FIG. 10A compares the
coded residues beginning at nucleotide position 121 to 816 of
DNA40628 (SEQ ID NO: 23) with the coded residues beginning at
nucleotides 17 to 284 of A33_HUMAN (SEQ ID NO: 24); FIG. 10B
compares the coded residues beginning at nucleotides 112 to 810
(SEQ ID NO: 25) with the coded residues beginning at nucleotides 12
to 284 (SEQ ID NO: 26), respectively.
[0054] FIG. 11 shows the derived amino acid sequence of a native
sequence PRO245 polypeptide (SEQ ID NO: 9) encoded by the
nucleotide sequence of FIG. 7 (DNA35638, SEQ ID NO: 8).
[0055] FIG. 12 indicates a 25.3% identity between the amino acid
sequence encoded by DNA40628 (SEQ ID NO: 1) and A33 antigen (SEQ ID
NO: 6).
[0056] FIG. 13 indicates a 20.8% identity between the amino acid
sequence encoded by DNA45416 (SEQ ID NO: 2) and A33 antigen (SEQ ID
NO: 6).
[0057] FIG. 14 indicates a 24.3% identity between the amino acid
sequence encoded by DNA35638 (SEQ ID NO: 9) and A33 antigen (SEQ ID
NO: 6).
[0058] FIG. 15 indicates a 67.6% identity between the amino acid
sequence encoded by DNA40628 (SEQ ID NO: 1) and JAM (SEQ ID NO:
10).
[0059] FIG. 16 indicates a 23.3% identity between the amino acid
sequence encoded by DNA45416 (SEQ ID NO: 2) and JAM (SEQ ID NO:
10).
[0060] FIG. 17 indicates a 34.2% identity between the amino acid
sequence encoded by DNA35638 (SEQ ID NO: 29) and JAM (SEQ ID NO:
10).
[0061] FIG. 18 indicates a 26% identity between the amino acid
sequence encoded by A33 antigen (SEQ ID NO: 6) and JAM (SEQ ID NO:
10).
[0062] FIG. 19 shows the results of the dot blot hybridization
procedure described in Example 8.
[0063] FIG. 20 shows the results of the Taqman mRNA expression
assay described in Example 9.
[0064] FIG. 21 shows the binding of protein encoded by DNA40628 to
human neutrophils as described in Example 7.
DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS
I. DEFINITIONS
[0065] The terms "PRO301", "PRO362, "PRO245", or "PRO301
polypeptide," "PRO362 polypeptide," "PRO245 polypeptide" and
"cancer associated antigen" when used herein encompass native
sequence PRO301, PRO362 or PRO245, respectively and variants
thereof (which are further defined herein). The PRO301, PRO362 or
PRO245 may be isolated from a variety of sources, such as from
human tissue types or from another source, or prepared by
recombinant or synthetic methods.
[0066] The terms "inflammatory disease" means a disease in which a
component of the immune system of a mammal causes, mediates or
otherwise contributes to an inflammatory response contributing to
the morbidity in the mammal. Also included are diseases in which
stimulation or intervention of the inflammatory response has an
ameliorative effect on progression of the disease. Included within
this term are immune-mediated inflammatory diseases.
[0067] The term "T-cell mediated" disease means a disease in which
T cells directly or indirectly mediate or otherwise contribute to
the morbidity in a mammal. The T cell mediated disease by be
associated with cell mediated effects, lymphokine mediated effects,
etc. and even effects associated with B cells if the B cells are
stimulated, for example, by the lymphokines secreted by T
cells.
[0068] Examples of immune-related and inflammatory diseases, some
of which are T cell mediated, which can be treated according to the
invention include: inflammatory bowel disease, systemic lupus
erythematosis, rheumatoid arthritis, juvenile chronic arthritis,
spondyloarthropathies, systemic sclerosis (scleroderma), idiopathic
inflammatory myopathies (dermatomyositis, polymyositis), Sjogren's
syndrome, systemic vaculitis, sarcoidosis, autoimmune hemolytic
anemia (immune pancytopenia, paroxysmal nocturnal hemoglobinuria),
autoimmune thrombocytopenia (idiopathic thrombocytopenic purpura,
immune-mediated thrombocytopenia), thyroiditis (Grave's disease,
Hashimoto's thyroiditis, juvenile lymphocytic thyroiditis, atrophic
thyroiditis), diabetes mellitus, immune-mediated renal disease
(glomerulonephritis, tubulointerstitial nephritis), demyelinating
diseases of the central and peripheral nervous systems such as
multiple sclerosis, idiopathic polyneuropathy, hepatobiliary
diseases such as infectious hepatitis (hepatitis A, B, C, D, E and
other nonhepatotropic viruses), autoimmune chronic active
hepatitis, primary biliary cirrhosis, granulomatous hepatitis, and
sclerosing cholangitis, inflammatory and fibrotic lung diseases
(e.g., cystic fibrosis), gluten-sensitive enteropathy, Whipple's
disease, autoimmune or immune-mediated skin diseases including
bullous skin diseases, erythema multiforme and contact dermatitis,
psoriasis, allergic diseases of the lung such as eosinophilic
pneumonias, idiopathic pulmonary fibrosis and hypersensitivity
pneumonitis, transplantation associated diseases including graft
rejection and graft-verus host disease.
[0069] "Tumor", as used herein, refers to all neoplastic cell
growth and proliferation whether malignant or benigh, and all
pre-cancerous cells and tissues.
[0070] The terms "cancer" and "cancerous" refer to or describe the
physiological condition in mammals that is typcially characterized
by unregulated cell growth. Examples of cancer include but are not
limited to, carcinoma, lymphoma, blastoma, sarcoma, and leukemia.
More particular examples of such cancers include breast cancer,
prostate cancer, colon cancer, squamous cell cancer, small-cell
lung cancer, non-small cell lung cancer, gastrointestinal cancer,
pancreatic cancer, glioblastoma, cervical cancer, ovarian cancer,
liver cancer, bladder cancer, hepatoma, colorectal cancer,
endometrial carcinoma, salivary gland carcinoma, kidney cancer,
liver cancer, vulval cancer, thyroid cancer, hepatic carcinoma and
various types of head and neck cancer.
[0071] "Treatment" is an intervention performed with the intention
of preventing the development or altering the pathology of a
disorder. Accordingly, "treatment" refers to both therapeutic
treatment and prophylactic or preventative measures. Those in need
of treatment include those already with the disorder as well as
those in which the disorder is to be prevented. In treatment of an
immune related disease, a therapeutic agent may directly decrease
or increase the magnitude of response of a component of the immune
response, or render the disease more susceptible to treatment by
other therapeutic agents, e.g., antibiotics, antifungals,
anti-inflammatory agents, chemotherapeutics, etc.
[0072] The "pathology" of an immune related disease includes all
phenomena that compromise the well-being of the patient. This
includes, without limitation, abnormal or uncontrollable cell
growth (neutrophilic, eosinophilic, monocytic, lymphocytic cells),
antibody production, auto-antibody production, complement
production, interference with the normal functioning of neighboring
cells, release of cytokines or other secretory products at abnormal
levels, suppression or aggravation of any inflammatory or
immunological response, infiltration of inflammatory cells
(neutrophilic, eosinophilic, monocytic, lymphocytic) into cellular
spaces, etc.
[0073] The terms "mammal" as used herein refers to any mammal
classified as a mammal, including humans, domestic and farm
animals, and zoo, sports or pet animals such horses, pigs, cattle,
dogs, cats and ferrets, etc. In a preferred embodiment of the
invention, the mammal is a human.
[0074] Administration "in combination with" one or more further
therapeutic agents includes simultaneous (concurrent) and
consecutive administration in any order.
[0075] The term "cytotoxic agent" as used herein refers to a
substance that inhibits or prevents the function of cells and/or
causes destruction of cells. The term is intended to include
radioactive isotopes (e.g. I.sup.131, I.sup.125, Y.sup.90 and
Re.sup.186), chemotherapeutic agents, and toxins such a
enzymatically active toxins of bacterial, fungal, plant or animal
origin, or fragments thereof.
[0076] A "chemotherapeutic agent" is a compound useful in the
treatment of cancer. Examples of chemotherapeutic agents include
adriamycin, doxorubicin, epirubicin, 5-fluorouracil, cytosine
arabinoside ("Ara-C"), cyclophosphamide, thiotepa, busulfan,
cytoxin, taxoids, e.g. paclitaxel (Taxol.RTM., Bristol-Myers Squibb
Oncology, Princeton, N.J.) and doxetaxel (Taxotere.RTM.,
Rhone-Poulenc Roher, Antony, France), toxotere, methotrexate,
cisplatin, melphalan, vinblastine, bleomycin, etoposide,
ifosfamide, mitomycin C, mitoxantrone, vincristine (Loucristine),
vinorelbine, carboplatin, teniposide, daunomycin, carminomycin,
aminopterin, dactinomycin, mitomycins, esperamicins (see U.S. Pat.
No. 4,675,187), melphalan and other related nitrogen mustards. Also
included in this definition are hormonal agents that act to
regulate or inhibit hormonal action on tumors such as tamoxifen and
onapristone.
[0077] A "growth inhibitory agent" when used herein refers to a
compound or composition which inhibits growth of a cell, especially
cancers cells expressing or overexpressing any of the genes
identified herein, either in vitro or in vivo. Thus, the growth
inhibitory agent is one which significantly reduces the percentage
of cells expressing or overexpressing such genes in S phase.
Examples of growth inhibitory agents include agents that block cell
cycle progression (at a place other than S phase), such as agents
that induce G1 arrest and M-phase arrest. Classical M-phase
blockers include the vinca alkaloids (vincristine and vinblastine),
taxol, and topo II inhibitors such as doxorubicin, epirubicin,
daunorubicin, etoposide, and bleomycin. Those agents that arrest G1
also spill over into S-phase arrest, for example, DNA alkylating
agents such tamoxifen, prednisone, dacarbazine, mechlorethamine,
cisplatin, methotrexate, 5-fluorouracil, and ara-C. Further
information can be found in The Molecular Basis of Cancer,
Mendelsohn and Israel, eds., Chapter 1, entitled "Cell cycle
regulation, oncogens, and antineoplastic drugs" by Murakami et al.
(W B Saunders, Philadelphia, 1995), especially page 13.
[0078] The term "cytokine" is a generic term for proteins released
by one cell population which act on another cell as intercellular
mediators. Examples of such cytokines are lymphokines, monokines,
and traditional polypeptide hormones. Included among the cytokines
are growth hormone such as human growth hormone, N-methionyl human
growth hormone, and bovine growth hormone, parathyroid hormone,
thyroxine, insulin, proinsulin, relaxin, prorelaxin, glycoprotein
hormones such as follicle stimulating hormone (FSH), thyroid
stimulating hormone (TSH), and luteinizing hormone (LH), hepatic
growth factor, fibroblast growth factor, prolactin, placental
lactogen, tumor necrosis factor-.alpha. and -.beta.,
mullerian-inhibiting substance, mouse gonadotropin-associated
peptide, inhibin, activin, vascular endothelial growth factor,
integrin, thrombopoietin (TPO), nerve growth factors such as
NGF-.beta., platelet-growth factor, transforming growth factors
(TGFs) such as TGF-.alpha. and TGF-.beta., insulin-like growth
factor-I and -II, erythropoietin (EPO), osteoinductive factors,
interferons such as interferon-.alpha., -.beta., and -.gamma.;
colony stimulating factors (CSFs) such as macrophage-CSF (M-CSF),
granulocyte-macrophage-CSF (GM-CSF), and granulocyte-CSF (G-CSF),
interleukins (ILs) such as IL-1, IL-1.alpha., IL-2, IL-3, IL-4,
IL-5, IL-6, IL-7, IL-8, IL-9, IL-11, IL-12, a tumor necrosis factor
such as TNF-.alpha. or TNF-.beta., and other polypeptide factors
including LIF and kit ligand (KL). As used herein, the term
cytokine includes proteins from natural sources or from recombinant
cell culture and biologically active equivalents of the native
sequence cytokines.
[0079] "Therapeutically effective amount" is the amount of active
PRO301, PRO362 or PRO245 antagonist or agonist which is required to
achieve a measureable inhibition or stimulation, as the case may
be, of the inflammatory response.
[0080] A "native sequence PRO301, PRO362 or PRO245", comprises a
polypeptide having the same amino acid sequence as a PRO301, PRO362
or PRO245, respectively, derived from nature. Such native sequence
PRO301, PRO362 or PRO245 can be isolated from nature or can be
produced by recombinant or synthetic means. The term "native
sequence PRO301", "native sequence PRO362" or "native sequence
PRO245" specifically encompasses naturally-occurring truncated or
secreted forms of PRO301, PRO362 or PRO245, respectively (e.g., an
extracellular domain sequence), naturally-occurring variant forms
(e.g., alternatively spliced forms) and naturally-occurring allelic
variants of PRO301, PRO362 or PRO245, respectively.
[0081] In one embodiment, the native sequence PRO301 is a mature or
full-length native sequence PRO301 comprising amino acids 1 to 299
of FIG. 2 (SEQ ID NO: 1), with or without the N-terminal signal
sequence, with or without the initiating methionine at position 1,
with or without the potential transmembrane domain at position 236
to about 258, and with or without the intracellular domain at about
position 259 to 299.
[0082] In another embodiment, the native sequence PRO362
polypeptide is an extracellular domain of the full-length PRO362
protein comprising amino acids 1 to X of the amino acid sequence
shown in FIG. 3 (SEQ ID NO: 2) where X is any amino acid residue
271-280. Optionally, the PRO362 polypeptide is obtained or
obtainable by expressing the polypeptide encoded by the cDNA insert
of the vector DNA45416-1251 deposited on Feb. 5, 1998 as ATCC
Deposit No.: 209620.
[0083] In yet another embodiment, the native sequence PRO245
polypeptide is a mature or full-length native sequence PRO245
polypeptide comprising amino acids 1 to 312 of FIG. 11 (SEQ ID NO:
9).
[0084] The "PRO301 or PRO362 extracellular domain" or "PRO301 or
PRO362 ECD" refers to a form of the PRO301 or PRO362 polypeptide,
respectively, which is essentially free of the transmembrane and
cytoplasmic domains of the respective full length molecules.
Ordinarily, PRO301 ECD or PRO362 ECD will have less than 1% of such
transmembrane and/or cytoplasmic domains and preferably, will have
less than 0.5% of such domains. Optionally, PRO301 polypeptide ECD
will comprise amino acid residues about 28 to about 235 of FIG. 2
(SEQ ID NO: 1), while PRO362 polypeptide ECD will comprise amino
acid residues 1 to X of FIG. 3 (SEQ ID NO: 2), where X is any amino
acid from 271-280. It will be understood that any transmembrane
domain identified for the PRO301 or PRO362 polypeptides of the
present invention is identified pursuant to criteria routinely
employed in the art for identifying that type of hydrophobic
domain. The exact boundaries of a transmembrane domain may vary but
most likely by no more than about 5 amino acids at either end of
the domain as initially identified. Accordingly, the PRO301 or
PRO362 polypeptide ECD may optionally comprise amino acids 1 to X
of FIG. 3 (SEQ ID NO: 2), wherein X is any one of amino acid
residues 271 to 280 of FIG. 3 (SEQ ID NO: 2).
[0085] "PRO301 variant" or "PRO245 variant" means an active PRO301
as defined below having at least about 80% amino acid sequence
identity to (a) a DNA molecule encoding a PRO301 polypeptide, with
or without its native signal sequence, with or without the
initiating methionine, with or without the potential transmembrane
domain, and with or without the intracellular domain or (b) the
complement of the DNA molecule of (a). In a particular embodiment,
the PRO301 variant has at least about 80% amino acid sequence
homology with the PRO301 having the deduced amino acid sequence
shown in FIG. 1 (SEQ ID NO: 1) for a full-length native sequence
PRO301. Such PR0301 variants include, for instance, PRO301
polypeptides wherein one or more amino acid residues are added, or
deleted, at the N-- or C-terminus of the sequence of FIG. 2 (SEQ ID
NO: 1). Preferably, the nucleic acid or amino acid sequence
identity is at least about 85%, more preferably at least about 90%,
and even more preferably at least about 95%.
[0086] "PRO362 variant" means an active PRO362 polypeptide as
defined below having at least about 80% amino acid sequence
identity with the PRO362 polypeptide having the deduced amino acid
sequence shown in FIG. 3 (SEQ ID NO: 2) for a full-length native
sequence PRO362 polypeptide. Such PRO362 polypeptide variants
include, for instance, PRO362 polypeptides wherein one or more
amino acid residues are added, or deleted, at the N-- or C-terminus
of the sequence of FIG. 3 (SEQ ID NO: 2). Ordinarily, a PRO362
polypeptide variant will have at least about 80% amino acid
sequence identity, preferably at least about 85% amino acid
sequence identity, more preferably at least about 90% amino acid
sequence identity and even more preferably at least about 95% amino
acid sequence identity with the amino acid sequence of FIG. 3 (SEQ
ID NO: 2).
[0087] "Percent (%) amino acid sequence identity" with respect to
the PRO301, PRO362 or PRO245 sequences identified herein is defined
as the percentage of amino acid residues in a candidate sequence
that are identical with the amino acid residues in the PRO301,
PRO362 or PRO245 sequence, respectively, after aligning the
sequences and introducing gaps, if necessary, to achieve the
maximum percent sequence identity, and not considering any
conservative substitutions as part of the sequence identity.
Alignment for purposes of determining percent amino acid sequence
identity can be achieved in various ways that are within the skill
in the art, for instance, using publicly available computer
software such as BLAST, BLAST-2, ALIGN or Megalign (DNASTAR)
software. Those skilled in the art can determine appropriate
parameters for measuring alignment, including any algorithms needed
to achieve maximal alignment over the full length of the sequences
being compared.
[0088] "Percent (%) nucleic acid sequence identity" with respect to
the PRO301-, PRO362- or PRO245-encoding sequences identified herein
(e.g., DNA40628, DNA45416, DNA35638) is defined as the percentage
of nucleotides in a candidate sequence that are identical with the
nucleotides in the PRO301 -, PRO362- or PRO245-encoding sequence,
respectively, after aligning the sequences and introducing gaps, if
necessary, to achieve the maximum percent sequence identity.
Alignment for purposes of determining percent nucleic acid sequence
identity can be achieved in various ways that are within the skill
in the art, for instance, using publicly available computer
software such as BLAST, BLAST-2, ALIGN or Megalign (DNASTAR)
software. Those skilled in the art can determine appropriate
parameters for measuring alignment, including any algorithms needed
to achieve maximal alignment over the full length of the sequences
being compared.
[0089] "Isolated," when used to describe the various polypeptides
disclosed herein, means polypeptide that has been identified and
separated and/or recovered from a component of its natural
environment. Contaminant components of its natural environment are
materials that would typically interfere with diagnostic or
therapeutic uses for the polypeptide, and may include enzymes,
hormones, and other proteinaceous or non-proteinaceous solutes. In
preferred embodiments, the polypeptide will be purified (1) to a
degree sufficient to obtain at least 15 residues of N-terminal or
internal amino acid sequence by use of a spinning cup sequenator,
or (2) to homogeneity by SDS-PAGE under non-reducing or reducing
conditions using Coomassie blue or, preferably, silver stain.
Isolated polypeptide includes polypeptide in situ within
recombinant cells, since at least one component of the PRO301
natural environment will not be present. Ordinarily, however,
isolated polypeptide will be prepared by at least one purification
step.
[0090] An "isolated" DNA40628 nucleic acid molecule is a nucleic
acid molecule that is identified and separated from at least one
contaminant nucleic acid molecule with which it is ordinarily
associated in the natural source of the DNA40628 nucleic acid. An
isolated DNA40628 nucleic acid molecule is other than in the form
or setting in which it is found in nature. Isolated DNA40628
nucleic acid molecules therefore are distinguished from the
DNA40628 nucleic acid molecule as it exists in natural cells.
However, an isolated DNA40628 nucleic acid molecule includes
DNA40628 nucleic acid molecules contained in cells that ordinarily
express DNA40628 where, for example, the nucleic acid molecule is
in a chromosomal location different from that of natural cells.
[0091] An "isolated" PRO301- PRO362- or PRO245-polypeptide encoding
nucleic acid molecule is a nucleic acid molecule that is identified
and separated from at least one contaminant nucleic acid molecule
with which it is ordinarily associated in the natural source of the
PRO301- PRO362- or PRO245 polypeptide encoding nucleic acid. An
isolated PRO301- PRO362- or PRO245 polypeptide encoding nucleic
acid molecule is other than in the form or setting in which it is
found in nature. Isolated PRO301- PRO362- or PRO245 polypeptide
encoding nucleic acid molecules therefore are distinguished from
the DNA40628 nucleic acid molecule as it exists in natural cells.
However, an isolated PRO301- PRO362- or PRO245 polypeptide en
coding nucleic acid molecule includes PRO301- PRO362- or PRO245
polypeptide encoding nucleic acid molecules contained in cells that
ordinarily express PRO301- PRO362- or PRO245 polypeptide encoding
where, for example, the nucleic acid molecule is in a chromosomal
location different from that of natural cells.
[0092] The term "control sequences" refers to DNA sequences
necessary for the expression of an operably linked coding sequence
in a particular host organism. The control sequences that are
suitable for prokaryotes, for example, include a promoter,
optionally an operator sequence, and a ribosome binding site.
Eukaryotic cells are known to utilize promoters, polyadenylation
signals, and enhancers.
[0093] Nucleic acid is "operably linked" when it is placed into a
functional relationship with another nucleic acid sequence. For
example, DNA for a presequence or secretory leader is operably
linked to DNA for a polypeptide if it is expressed as a preprotein
that participates in the secretion of the polypeptide; a promoter
or enhancer is operably linked to a coding sequence if it affects
the transcription of the sequence; or a ribosome binding site is
operably linked to a coding sequence if it is positioned so as to
facilitate translation. Generally, "operably linked" means that the
DNA sequences being linked are contiguous, and, in the case of a
secretory leader, contiguous and in reading phase. However,
enhancers do not have to be contiguous. Linking is accomplished by
ligation at convenient restriction sites. If such sites do not
exist, the synthetic oligonucleotide adaptors or linkers are used
in accordance with conventional practice.
[0094] The term "antibody" is used in the broadest sense and
specifically covers single anti-PRO301, anti-PRO362 or anti-PRO245
monoclonal antibodies (including agonist, antagonist, and
neutralizing antibodies) and anti-PRO301, anti-PRO362 or
anti-PRO245 antibody compositions with polyepitopic specificity.
The term "monoclonal antibody" as used herein refers to an antibody
obtained from a population of substantially homogeneous antibodies,
i.e., the individual antibodies comprising the population are
identical except for possible naturally-occurring mutations that
may be present in minor amounts.
[0095] "Active" or "activity" for the purposes herein refers to
form(s) of PRO301, PRO362 or PRO245 which retain the biologic
and/or immunologic activities of native or naturally-occurring
PRO301. A preferred activity is the ability to bind to and affect,
e.g., block or otherwise modulate, an activity of antigen binding.
The activity preferably involves the regulation, activity of cancer
and or viral associated antigens.
[0096] "Stringency" of hybridization reactions is readily
determinable by one of ordinary skill in the art, and generally is
an empirical calculation dependent upon probe length, washing
temperature, and salt concentration. In general, longer probes
require higher temperatures for proper annealing, while shorter
probes need lower temperatures. Hybridization generally depends on
the ability of denatured DNA to reanneal when complementary strands
are present in an environment below their melting temperature. The
higher the degree of desired homology between the probe and
hybridizable sequence, the higher the relative temperature that can
be used. As a result, it follows that higher relative temperatures
would tend to make the reaction conditions more stringent, while
lower temperatures less so. For additional details and explanation
of stringency of hybridization reactions, see Ausubel et al.,
Current Protocols in Molecular Biology, Wiley Interscience
Publishers, (1995).
[0097] "Stringent conditions" or "high stringency conditions", as
defined herein, may be identified by those that: (1) employ low
ionic strength and high temperature for washing, for example 0.015
M sodium chloride/0.0015 M sodium citrate/0.1% sodium dodecyl
sulfate at 50.degree. C.; (2) employ during hybridization a
denaturing agent, such as formamide, for example, 50% (v/v)
formamide with 0.1% bovine serum albumin/0.1% Ficoll/0.1%
polyvinylpyrrolidone/50 mM sodium phosphate buffer at pH 6.5 with
750 mM sodium chloride, 75 mM sodium citrate at 42 C; or (3) employ
50% formamide, 5.times.SSC (0.75 M NaCl, 0.075 M sodium citrate),
50 mM sodium phosphate (pH 6.8), 0.1% sodium pyrophosphate,
5.times.Denhardt's solution, sonicated salmon sperm DNA (50
.mu.g/ml), 0.1% SDS, and 10% dextran sulfate at 42.degree. C., with
washes at 42.degree. C. in 0.2.times.SSC chloride/sodium citrate)
and 50% formamide at 55 C, followed by a high-stringency wash
consisting of 0.1.times.SSC containing EDTA at 55.degree. C.
[0098] "Moderately stringent conditions" may be identified as
described by Sambrook et al., Molecular Cloning: A Laboratory.
Manual, New York: Cold Spring Harbor Press, 1989, and include the
use of washing solution and hybridization conditions (e.g.,
temperature, ionic strength and % SDS) less stringent that those
described above. An example of moderately stringent conditions is
overnight incubation at 37.degree. C. in a solution comprising: 20%
formamide, 5.times.SSC (150 mM NaCl, 15 mM trisodium citrate), 50
mM sodium phosphate (pH 7.6), 5.times.Denhardt's solution, 10%
dextran sulfate, and 20 mg/mL denatured sheared salmon sperm DNA,
followed by washing the filters in 1.times.SSC at about
37-50.degree. C. The skilled artisan will recognize how to adjust
the temperature, ionic strength, etc. as necessary to accommodate
factors such as probe length and the like.
[0099] The term "epitope tagged" when used herein refers to a
chimeric polypeptide comprising a polypeptide of the invention
fused to a "tag polypeptide". The tag polypeptide has enough
residues to provide an epitope against which an antibody can be
made, yet is short enough such that it does not interfere with
activity of the polypeptide to which it is fused. The tag
polypeptide preferably also is fairly unique so that the antibody
does not substantially cross-react with other epitopes. Suitable
tag polypeptides generally have at least six amino acid residues
and usually between about 8 and 50 amino acid residues (preferably,
between about 10 and 20 amino acid residues).
[0100] "Active" or "activity" in the context of variants of the
polypeptide of the invention refers to form(s) of proteins of the
invention which retain the biologic and/or immunologic activities
of a native or naturally-occurring polypeptide of the
invention.
[0101] "Biological activity" in the context of an antibody or
another molecule that can be identified by the screening assays
disclosed herein (e.g. an organic or inorganic small molecule,
peptide, etc.) is used to refer to the ability of such molecules to
induce or inhibit infiltration of inflammatory cells into a tissue,
to stimulate or inhibit T-cell proliferation and to stimulate or
inhibit lymphokine release by cells. Another preferred activity is
increased vascular permeability or the inhibition thereof.
[0102] The term "antagonist" is used in the broadest sense, and
includes any molecule that partially or fully blocks, inhibits, or
neutralizes a biological activity of a native polypeptide of the
invention disclosed herein. In a similar manner, the term "agonist"
is used in the broadest sense and includes any molecule that mimics
a biological activity of a native polypeptide of the invention
disclosed herein. Suitable agonist or antagonist molecules
specifically include agonist or antagonist antibodies or antibody
fragments, fragments or amino acid sequence variants of native
polypeptides of the invention, peptides, small organic molecules,
etc.
[0103] A "small molecule" is defined herein to have a molecular
weight below about 600 daltons.
[0104] "Antibodies" (Abs) and "immunoglobulins" (Igs) are
glycoproteins having the same structural characteristics. While
antibodies exhibit binding specificity to a specific antigen,
immunoglobulins include both antibodies and other antibody-like
molecules which lack antigen specificity. Polypeptides of the
latter kind are, for example, produced at low levels by the lymph
system and at increased levels by myelomas. The term "antibody" is
used in the broadest sense and specifically covers, without
limitation, intact monoclonal antibodies, polyclonal antibodies,
multispecific antibodies (e.g. bispecific antibodies) formed from
at least two intact antibodies, and antibody fragments so long as
they exhibit the desired biological activity.
[0105] "Native antibodies" and "native immunoglobulins" are usually
heterotetrameric glycoproteins of about 150,000 daltons, composed
of two identical light (L) chains and two identical heavy (H)
chains. Each light chain is linked to a heavy chain by one covalent
disulfide bond, while the number of disulfide linkages varies among
the heavy chains of different immunoglobulin isotypes. Each heavy
and light chain also has regularly spaced intrachain disulfide
bridges. Each heavy chain has at one end a variable domain
(V.sub.H) followed by a number of constant domains. Each light
chain has a variable domain at one end (V.sub.L) and a constant
domain at its other end; the constant domain of the light chain is
aligned with the first constant domain of the heavy chain, and the
light chain variable domain is aligned with the variable domain of
the heavy chain. Particular amino acid residues are believed to
form an interface between the light and heavy chain variable
domains.
[0106] The term "variable" refers to the fact that certain portions
of the variable domains differ extensively in sequence among
antibodies and are used in the binding and specificity of each
particular antibody for its particular antigen. However, the
variability is not evenly distributed throughout the variable
domains of antibodies. It is concentrated in three segments called
complementarity-determining regions (CDRs) or hypervariable regions
both in the light-chain and the heavy-chain variable domains. The
more highly conserved portions of variable domains are called the
framework (FR). The variable domains of native heavy and light
chains each comprise four FR regions, largely adopting a beta-sheet
configuration, connected by three CDRs, which form loops
connecting, and in some cases forming part of, the beta-sheet
structure. The CDRs in each chain are held together in close
proximity by the FR regions and, with the CDRs from the other
chain, contribute to the formation of the antigen-binding site of
antibodies (see Kabat et al., NIH Publ. No. 91-3242, Vol. I, pages
647-669 (1991)). The constant domains are not involved directly in
binding an antibody to an antigen, but exhibit various effector
functions, such as participation of the antibody in
antibody-dependent cellular toxicity.
[0107] "Antibody fragments" comprise a portion of an intact
antibody, preferably the antigen binding or variable region of the
intact antibody. Examples of antibody fragments include Fab, Fab',
F(ab').sub.2, and Fv fragments; diabodies; linear antibodies
(Zapata et al., Protein Eng. 8(10):1057-1062 [1995]); single-chain
antibody molecules; and multispecific antibodies formed from
antibody fragments.
[0108] Papain digestion of antibodies produces two identical
antigen-binding fragments, called "Fab" fragments, each with a
single antigen-binding site, and a residual "Fc" fragment. The
designation "Fe" reflects the ability to crystallize readily.
Pepsin treatment yields an F(ab').sub.2 fragment that has two
antigen-combining sites and is still capable of cross-linking
antigen.
[0109] "Fv" is the minimum antibody fragment which contains a
complete antigen-recognition and -binding site. This region
consists of a dimer of one heavy- and one light-chain variable
domain in tight, non-covalent association. It is in this
configuration that the three CDRs of each variable domain interact
to define an antigen-binding site on the surface of the
V.sub.H-V.sub.L dimer. Collectively, the six CDRs confer
antigen-binding specificity to the antibody. However, even a single
variable domain (or half of an Fv comprising only three CDRs
specific for an antigen) has the ability to recognize and bind
antigen, although at a lower affinity than the entire binding
site.
[0110] The Fab fragment also contains the constant domain of the
light chain and the first constant domain (CH1) of the heavy chain.
Fab' fragments differ from Fab fragments by the addition of a few
residues at the carboxy terminus of the heavy chain CH1 domain
including one or more cysteines from the antibody hinge region.
Fab'-SH is the designation herein for Fab' in which the cysteine
residue(s) of the constant domains bear a free thiol group.
F(ab').sub.2 antibody fragments originally were produced as pairs
of Fab' fragments which have hinge cysteines between them. Other
chemical couplings of antibody fragments are also known.
[0111] The "light chains" of antibodies (immunoglobulins) from any
vertebrate species can be assigned to one of two clearly distinct
types, called kappa (.kappa.) and lambda (.lamda.), based on the
amino acid sequences of their constant domains.
[0112] Depending on the amino acid sequence of the constant domain
of their heavy chains, immunoglobulins can be assigned to different
classes. There are five major classes of immunoglobulins: IgA, IgD,
IgE, IgG, and IgM, and several of these may be further divided into
subclasses (isotypes), e.g., IgG1, IgG2, IgG3, IgG4, IgA, and IgA2.
The heavy-chain constant domains that correspond to the different
classes of immunoglobulins are called .alpha., .delta., .epsilon.,
.gamma., and .mu., respectively. The subunit structures and
three-dimensional configurations of different classes of
immunoglobulins are well known.
[0113] The term "monoclonal antibody" as used herein refers to an
antibody obtained from a population of substantially homogeneous
antibodies, i.e., the individual antibodies comprising the
population are identical except for possible naturally occurring
mutations that may be present in minor amounts. Monoclonal
antibodies are highly specific, being directed against a single
antigenic site. Furthermore, in contrast to conventional
(polyclonal) antibody preparations which typically include
different antibodies directed against different determinants
(epitopes), each monoclonal antibody is directed against a single
determinant on the antigen. In addition to their specificity, the
monoclonal antibodies are advantageous in that they are synthesized
by the hybridoma culture, uncontaminated by other immunoglobulins.
The modifier "monoclonal" indicates the character of the antibody
as being obtained from a substantially homogeneous population of
antibodies, and is not to be construed as requiring production of
the antibody by any particular method. For example, the monoclonal
antibodies to be used in accordance with the present invention may
be made by the hybridoma method first described by Kohler et al.,
Nature, 256:495 [1975], or may be made by recombinant DNA methods
(see, e.g., U.S. Pat. No. 4,816,567). The "monoclonal antibodies"
may also be isolated from phage antibody libraries using the
techniques described in Clackson et al., Nature, 352:624-628 [1991]
and Marks et al., J. Mol. Biol., 222: 581-597 (1991), for example.
See also U.S. Pat. Nos. 5,750,373, 5,571,698, 5,403,484 and
5,223,409 which describe the preparation of antibodies using
phagemid and phage vectors.
[0114] The monoclonal antibodies herein specifically include
"chimeric" antibodies (immunoglobulins) in which a portion of the
heavy and/or light chain is identical with or homologous to
corresponding sequences in antibodies derived from a particular
species or belonging to a particular antibody class or subclass,
while the remainder of the chain(s) is identical with or homologous
to corresponding sequences in antibodies derived from another
species or belonging to another antibody class or subclass, as well
as fragments of such antibodies, so long as they exhibit the
desired biological activity (U.S. Pat. No.4,816,567; Morrison et
al., Proc. Natl. Acad. Sci. USA, 81:6851-6855 [1984]).
[0115] "Humanized" forms of non-human (e.g., murine) antibodies are
chimeric immunoglobulins, immunoglobulin chains or fragments
thereof (such as Fv, Fab, Fab', F(ab').sub.2 or other
antigen-binding subsequences of antibodies) which contain minimal
sequence derived from non-human immunoglobulin. For the most part,
humanized antibodies are human immunoglobulins (recipient antibody)
in which several or all residues from a complementarity-determining
region (CDR) of the recipient are replaced by residues from a CDR
of a non-human species (donor antibody) such as mouse, rat or
rabbit having the desired specificity, affinity, and capacity. In
some instances, certain Fv framework region (FR) residues of the
human immunoglobulin can also be replaced by corresponding
non-human residues. Furthermore, humanized antibodies may comprise
residues which are found neither in the recipient antibody nor in
the imported CDR or framework sequences. These modifications are
made to further refine and maximize antibody performance. In
general, the humanized antibody will comprise substantially all of
at least one, and typically two, variable domains, in which all or
substantially all of the CDR regions correspond to those of a
non-human immunoglobulin and all or substantially all of the FR
regions are those of a human immunoglobulin sequence. The humanized
antibody optimally also will comprise at least a portion of an
immunoglobulin constant region (Fc), typically that of a human
immunoglobulin. For further details, see Jones et al., Nature, 321:
522-525 (1986); Reichmann et al., Nature, 332: 323-329 [1988]; and
Presta, Curr. Op. Struct. Biol., 2: 593-596 (1992). The humanized
antibody includes a "primatized" antibody where the antigen-binding
region of the antibody is derived from an antibody produced by
immunizing macaque monkeys with the antigen of interest. Antibodies
containing residues from Old World monkeys are also possible within
the invention. See, for example, U.S. Pat. Nos. 5,658,570;
5,693,780; 5,681,722; 5,750,105; and 5,756,096.
[0116] "Single-chain Fv" or "sFv" antibody fragments comprise the
V.sub.H and V.sub.L domains of antibody, wherein these domains are
present in a single polypeptide chain. Preferably, the Fv
polypeptide further comprises a polypeptide linker between the
V.sub.H and V.sub.L domains which enables the sFv to form the
desired structure for antigen binding. For a review of sFv see
Pluckthun in The Pharmacology of Monoclonal Antibodies, vol. 113,
Rosenburg and Moore eds., Springer-Verlag, New York, pp. 269-315
(1994).
[0117] The term "diabodies" refers to small antibody fragments with
two antigen-binding sites, which fragments comprise a heavy-chain
variable domain (V.sub.H) connected to a light-chain variable
domain (V.sub.L) in the same polypeptide chain (V.sub.H-V.sub.L).
By using a linker that is too short to allow pairing between the
two domains on the same chain, the domains are forced to pair with
the complementary domains of another chain and create two
antigen-binding sites. Diabodies are described more fully in, for
example, EP 404,097; WO 93/11161; and Hollinger et al., Proc. Natl.
Acad. Sci. USA, 90: 6444-6448 (1993).
[0118] An "isolated" antibody is one which has been identified and
separated and/or recovered from a component of its natural
environment. Contaminant components of its natural environment are
materials which would interfere with diagnostic or therapeutic uses
for the antibody, and may include enzymes, hormones, and other
proteinaceous or nonproteinaceous solutes. In preferred
embodiments, the compound of the invention will be purified (1) to
greater than 95% by weight of the compound as determined by the
Lowry method, and most preferably more than 99% by weight, (2) to a
degree sufficient to obtain at least 15 residues of N-terminal or
internal amino acid sequence by use of a spinning cup sequenator,
or (3) to homogeneity by SDS-PAGE under reducing or nonreducing
conditions using Coomassie blue or, preferably, silver stain.
Isolated compound, e.g. antibody or polypeptide, includes the
compound in situ within recombinant cells since at least one
component of the compound's natural environment will not be
present. Ordinarily, however, isolated compound will be prepared by
at least one purification step.
[0119] The word "label" when used herein refers to a detectable
compound or composition which is conjugated directly or indirectly
to the compound, e.g. antibody or polypeptide, so as to generate a
"labeled" compound. The label may be detectable by itself (e.g.
radioisotope labels or fluorescent labels) or, in the case of an
enzymatic label, may catalyze chemical alteration of a substrate
compound or composition which is detectable.
[0120] By "solid phase" is meant a non-aqueous matrix to which the
compound of the present invention can adhere. Examples of solid
phases encompassed herein include those formed partially or
entirely of glass (e.g., controlled pore glass), polysaccharides
(e.g., agarose), polyacrylamides, polystyrene, polyvinyl alcohol
and silicones. In certain embodiments, depending on the context,
the solid phase can comprise the well of an assay plate; in others
it is a purification column (e.g., an affinity chromatography
column). This term also includes a discontinuous solid phase of
discrete particles, such as those described in U.S. Pat. No.
4,275,149.
[0121] A "liposome" is a small vesicle composed of various types of
lipids, phospholipids and/or surfactant which is useful for
delivery of a drug (such as the anti-ErbB2 antibodies disclosed
herein and, optionally, a chemotherapeutic agent) to a mammal. The
components of the liposome are commonly arranged in a bilayer
formation, similar to the lipid arrangement of biological
membranes.
[0122] As used herein, the term "immunoadhesin" designates
antibody-like molecules which combine the binding specificity of a
heterologous protein (an "adhesin") with the effector functions of
immunoglobulin constant domains. Structurally, the immunoadhesins
comprise a fusion of an amino acid sequence with the desired
binding specificity which is other than the antigen recognition and
binding site of an antibody (i.e., is "heterologous"), and an
immunoglobulin constant domain sequence. The adhesin part of an
immunoadhesin molecule typically is a contiguous amino acid
sequence comprising at least the binding site of a receptor or a
ligand. The immunoglobulin constant domain sequence in the
immunoadhesin may be obtained from any immunoglobulin, such as
IgG-1, IgG-2, IgG-3, or IgG-4 subtypes, IgA (including IgA-1 and
IgA-2), IgE, IgD or IgM.
II. COMPOSITIONS AND METHODS OF THE INVENTION
A. Preparation of the PRO301, PRO362 or PRO245 Polypeptides
[0123] 1. Full-length PRO301, PRO362 or PRO245 Polypeptides
[0124] The present invention provides newly identified and isolated
nucleotide sequences encoding polypeptides referred to in the
present application as PRO301, PRO362 or PRO245. In particular,
Applicants have identified and isolated cDNA encoding a PRO301,
PRO362 or PRO245 polypeptide, as disclosed in further detail in the
Examples below. Using BLAST and FastA sequence alignment computer
programs, Applicants found that a full-length native sequence
PRO301 (FIG. 2, SEQ ID NO: 1), PRO362 (FIG. 3, SEQ ID NO: 3) and
PRO245 (FIG. 11, SEQ ID NO: 9) have significant homology to both
A33 antigen and JAM. (See FIGS. 1, 12-18). Accordingly, it is
presently believed that PRO301 disclosed in the present application
is a newly identified member of the A33 antigen protein family and
may be associated with inflammatory disorders such as inflammatory
bowel disease as well as human neoplastic diseases such as
colorectal cancer.
[0125] 2. PRO301, PRO362 or PRO245 Variants
[0126] In addition to the full-length native sequence PRO301,
PRO362 or PRO245 described herein, it is contemplated that PRO301,
PRO362 or PRO245 variants can be prepared. PRO301, PRO362 or PRO245
variants can be prepared by introducing appropriate nucleotide
changes into the PRO301, PRO362 or PRO245 DNA, respectively, or by
synthesis of the desired PRO301, PRO362 or PRO245 polypeptides.
Those skilled in the art will appreciate that-amino acid changes
may alter post-translational processes of the PRO301, PRO362 or
PRO245, such as changing the number or position of glycosylation
sites or altering the membrane anchoring characteristics.
[0127] Variations in the native full-length sequence PRO301, PRO362
or PRO245 or in various domains of the PRO301, PRO362 or PRO245
described herein, can be made, for example, using any of the
techniques and guidelines for conservative and non-conservative
mutations set forth, for instance, in U.S. Pat. No. 5,364,934.
Variations may be a substitution, deletion or insertion of one or
more codons encoding the PRO301, PRO362 or PRO245 that results in a
change in the amino acid sequence of the PRO301, PRO362 or PRO245
as compared with the native sequence PRO301, PRO362 or PRO245.
Optionally the variation is by substitution of at least one amino
acid with any other amino acid in one or more of the domains of the
PRO301, PRO362 or PRO245. Guidance in determining which amino acid
residue may be inserted, substituted or deleted without adversely
affecting the desired activity may be found by comparing the
sequence of the PRO301, PRO362 or PRO245 with that of homologous
known protein molecules and minimizing the number of amino acid
sequence changes made in regions of high homology. Amino acid
substitutions can be the result of replacing one amino acid with
another amino acid having similar structural and/or chemical
properties, such as the replacement of a leucine with a serine,
i.e., conservative amino acid replacements. Insertions or deletions
may optionally be in the range of 1 to 5 amino acids. The variation
allowed may be determined by systematically making insertions,
deletions or substitutions of amino acids in the sequence and
testing the resulting variants for activity in the in vitro assay
described in the Examples below.
[0128] The variations can be made using methods known in the art
such as oligonucleotide-mediated (site-directed) mutagenesis,
alanine scanning, and PCR mutagenesis. Site-directed mutagenesis
[Carter et al., Nucl. Acids Res, 13:4331 (1986); Zoller et al.,
Nucl. Acids Res., 10:6487 (1987)], cassette mutagenesis [Wells et
al., Gene, 34:315 (1985)], restriction selection mutagenesis [Wells
et al., Philos. Trans. R. Soc. London SerA, 317:415 (1986)] or
other known techniques can be performed on the cloned DNA to
produce the PRO301 variant DNA.
[0129] Scanning amino acid analysis can also be employed to
identify one or more amino acids along a contiguous sequence. Among
the preferred scanning amino acids are relatively small, neutral
amino acids. Such amino acids include alanine, glycine, serine, and
cysteine. Alanine is typically a preferred scanning amino acid
among this group because it eliminates the side-chain beyond the
beta-carbon and is less likely to alter the main-chain conformation
of the variant. Alanine is also typically preferred because it is
the most common amino acid. Further, it is frequently found in both
buried and exposed positions [Creighton, The Proteins, (W. H.
Freeman & Co., New York); Chothia, J. Mol. Biol., 150:1
(1976)]. If alanine substitution does not yield adequate amounts of
variant, an isoteric amino acid can be used.
[0130] 3. Modifications of PRO301, PRO362 or PRO245
[0131] Covalent modifications of PRO301, PRO362 or PRO245 are
included within the scope of this invention. One type of covalent
modification includes reacting targeted amino acid residues of the
PRO301, PRO362 or PRO245 with an organic derivatizing agent that is
capable of reacting with selected side chains or the N-- or
C-terminal residues of the PRO301, PRO362 or PRO245. Derivatization
with bifunctional agents is useful, for instance, for crosslinking
PRO301 to a water-insoluble support matrix or surface for use in
the method for purifying anti-PRO301 antibodies, and vice-versa.
Commonly used crosslinking agents include, e.g.,
1,1-bis(diazoacetyl)-2-phenylethane, glutaraldehyde,
N-hydroxysuccinimide esters, for example, esters with
4-azido-salicylic acid, homobifunctional imidoesters, including
disuccinimidyl esters such as
3,3'-dithiobis(succinimidyl-propionate), bifunctional maleimides
such as bis-N-maleimido-1,8-octane and agents such as
methyl-3-[(p-azidophenyl)dithio]propioimidate.
[0132] Other modifications include deamidation of glutaminyl and
asparaginyl residues to the corresponding glutamyl and aspartyl
residues, respectively, hydroxylation of proline and lysine,
phosphorylation of hydroxyl groups of seryl or threonyl residues,
methylation of the .A-inverted.-amino groups of lysine, arginine,
and histidine side chains [T. E. Creighton, Proteins: Structure and
Molecular Properties, W.H. Freeman & Co., San Francisco, pp.
79-86 (1983)], acetylation of the N-terminal amine, and amidation
of any C-terminal carboxyl group.
[0133] Another type of covalent modification of the PRO301, PRO362
or PRO245 polypeptide included within the scope of this invention
comprises altering the native glycosylation pattern of the
polypeptide. "Altering the native glycosylation pattern" is
intended for purposes herein to mean deleting one or more
carbohydrate moieties found in native sequence PRO301, PRO362 or
PRO245, and/or adding one or more glycosylation sites that are not
present in the native sequence PRO301, PRO362 or PRO245, and/or
alteration of the ratio and/or composition of the sugar residues
attached to the glycosylation site(s).
[0134] Addition of glycosylation sites to the PRO301, PRO362 or
PRO245polypeptide may be accomplished by altering the amino acid
sequence. The alteration may be made, for example, by the addition
of, or substitution by, one or more serine or threonine residues to
the native sequence PRO301, PRO362 or PRO245 (for O-linked
glycosylation sites). The PRO301, PRO362 or PRO245 amino acid
sequence may optionally be altered through changes at the DNA
level, particularly by mutating the DNA encoding the PRO301, PRO362
or PRO245 polypeptide at preselected bases such that codons are
generated that will translate into the desired amino acids.
[0135] Another means of increasing the number of carbohydrate
moieties on the PRO301, PRO362 or PRO245 polypeptide is by chemical
or enzymatic coupling of glycosides to the polypeptide. Such
methods are described in the art, e.g., in WO 87/05330 published 11
Sep. 1987, and in Aplin and Wriston, CRC Crit. Rev. Biochem., pp.
259-306 (1981).
[0136] Removal of carbohydrate moieties present on the PRO301,
PRO362 or PRO245 polypeptide may be accomplished chemically or
enzymatically or by mutational substitution of codons encoding for
amino acid residues that serve as targets for glycosylation.
Chemical deglycosylation techniques are known in the art and
described, for instance, by Hakimuddin, et al., Arch. Biochem.
Biophys., 259:52 (1987) and by Edge et al., Anal. Biochem., 118:131
(1981). Enzymatic cleavage of carbohydrate moieties on polypeptides
can be achieved by the use of a variety of endo- and
exo-glycosidases as described by Thotakura et al., Meth. Enzymol.,
138:350 (1987).
[0137] Another type of covalent modification of PRO301, PRO362 or
PRO245 comprises linking the PRO301, PRO362 or PRO245 polypeptide
to one of a variety of nonproteinaceous polymers, e.g.,
polyethylene glycol, polypropylene glycol, or polyoxyalkylenes, in
the manner set forth in U.S. Pat. Nos. 4,640,835; 4,496,689;
4,301,144; 4,670,417; 4,791,192 or 4,179,337.
[0138] The PRO301, PRO362 or PRO245 of the present invention may
also be modified in a way to form a chimeric molecule comprising
PRO301, PRO362 or PRO245 fused to another, heterologous polypeptide
or amino acid sequence. In one embodiment, such a chimeric molecule
comprises a fusion of the PRO301, PRO362 or PRO245 with a tag
polypeptide which provides an epitope to which an anti-tag antibody
can selectively bind. The epitope tag is generally placed at the
amino- or carboxyl-terminus of the PRO301, PRO362 or PRO245. The
presence of such epitope-tagged forms of the PRO301, PRO362 or
PRO245 can be detected using an antibody against the tag
polypeptide. Also, provision of the epitope tag enables the PRO301,
PRO362 or PRO245 to be readily purified by affinity purification
using an anti-tag antibody or another type of affinity matrix that
binds to the epitope tag. In an alternative embodiment, the
chimeric molecule may comprise a fusion of the PRO301, PRO362 or
PRO245 with an immunoglobulin or a particular region of an
immunoglobulin. For a bivalent form of the chimeric molecule, such
a fusion could be to the Fc region of an IgG molecule.
[0139] Various tag polypeptides and their respective antibodies are
well known in the art. Examples include poly-histidine (poly-his)
or poly-histidine-glycine (poly-his-gly) tags; the flu HA tag
polypeptide and its antibody 12CA5 [Field et al., Mol. Cell. Biol.,
8:2159-2165 (1988)]; the c-myc tag and the 8F9, 3C7, 6E10, G4, B7
and 9E10 antibodies thereto [Evan et al., Molecular and Cellular
Biology, 5:3610-3616 (1985)]; and the Herpes Simplex virus
glycoprotein D (gD) tag and its antibody [Paborsky et al., Protein
Engineering, 3(6):547-553 (1990)]. Other tag polypeptides include
the Flag-peptide [Hopp et al., BioTechnology, 6:1204-1210 (1988)];
the KT3 epitope peptide [Martin et al., Science, 255:192-194
(1992)]; an .alpha.-tubulin epitope peptide [Skinner et al., J.
Biol. Chem., 266:15163-15166 (1991)]; and the T7 gene 10 protein
peptide tag [Lutz-Freyermuth et al., Proc. Natl. Acad. Sci. USA,
87:6393-6397 (1990)].
[0140] 4. Production and Isolation of PRO301. PRO362 or PRO245
[0141] The description below relates primarily to production of
PRO301, PRO362 or PRO245 by culturing cells transformed or
transfected with a vector containing PRO301, PRO362 or PRO245
nucleic acid. It is, of course, contemplated that alternative
methods, which are well known in the art, may be employed to
prepare PRO301, PRO362 or PRO245. For instance, the PRO301, PRO362
or PRO245 sequence, or portions thereof, may be produced by direct
peptide synthesis using solid-phase techniques [see, e.g., Stewart
et al., Solid-Phase Peptide Synthesis, W.H. Freeman Co., San
Francisco, Calif. (1969); Merrifield, J. Am. Chem. Soc.,
85:2149-2154 (1963)]. In vitro protein synthesis may be performed
using manual techniques or by automation. Automated synthesis may
be accomplished, for instance, using an Applied Biosystems Peptide
Synthesizer (Foster City, Calif.) using manufacturer's
instructions. Various portions of the PRO301, PRO362 or PRO245 may
be chemically synthesized separately and combined using chemical or
enzymatic methods to produce the full-length PRO301, PRO362 or
PRO245.
[0142] a. Isolation of DNA Encoding PRO301, PRO362 or PRO245
[0143] DNA encoding PRO301, PRO362 or PRO245 may be obtained from a
cDNA library prepared from tissue believed to possess the PRO301,
PRO362 or PRO245 mRNA and to express it at a detectable level.
Accordingly, human PRO301, PRO362 or PRO245 DNA can be conveniently
obtained from a cDNA library prepared from human tissue, such as
described in the Examples. The PRO301-, PRO362- or PRO245-encoding
gene may also be obtained from a genomic library or by
oligonucleotide synthesis.
[0144] Libraries can be screened with probes (such as antibodies to
the PRO301, PRO362 or PRO245 or oligonucleotides of at least about
20-80 bases) designed to identify the gene of interest or the
protein encoded by it. Screening the cDNA or genomic library with
the selected probe may be conducted using standard procedures, such
as described in Sambrook et al., Molecular Cloning: A Laboratory
Manual (New York: Cold Spring Harbor Laboratory Press, 1989). An
alternative means to isolate the gene encoding PRO301, PRO362 or
PRO245 is to use PCR methodology [Sambrook et al., supra;
Dieffenbach et al., PCR Primer: A Laboratory Manual (Cold Spring
Harbor Laboratory Press, 1995)].
[0145] The Examples below describe techniques for screening a cDNA
library. The oligonucleotide sequences selected as probes should be
of sufficient length and sufficiently unambiguous that false
positives are minimized. The oligonucleotide is preferably labeled
such that it can be detected upon hybridization to DNA in the
library being screened. Methods of labeling are well known in the
art, and include the use of radiolabels like .sup.32P-labeled ATP,
biotinylation or enzyme labeling. Hybridization conditions,
including moderate stringency and high stringency, are provided in
Sambrook et al., supra.
[0146] Sequences identified in such library screening methods can
be compared and aligned to other known sequences deposited and
available in public databases such as GenBank or other private
sequence databases. Sequence identity (at either the amino acid or
nucleotide level) within defined regions of the molecule or across
the full-length sequence can be determined through sequence
alignment using computer software programs such as BLAST, BLAST-2,
ALIGN, DNAstar, and INHERIT which employ various algorithms to
measure homology.
[0147] Nucleic acid having protein coding sequence may be obtained
by screening selected cDNA or genomic libraries using the deduced
amino acid sequence disclosed herein for the first time, and, if
necessary, using conventional primer extension procedures as
described in Sambrook et al., supra, to detect precursors and
processing intermediates of mRNA that may not have been
reverse-transcribed into cDNA.
[0148] b. Selection and Transformation of Host Cells
[0149] Host cells are transfected or transformed with expression or
cloning vectors described herein for PRO301, PRO362 or PRO245
production and cultured in conventional nutrient media modified as
appropriate for inducing promoters, selecting transformants, or
amplifying the genes encoding the desired sequences. The culture
conditions, such as media, temperature, pH and the like, can be
selected by the skilled artisan without undue experimentation. In
general, principles, protocols, and practical techniques for
maximizing the productivity of cell cultures can be found in
Mammalian Cell Biotechnology: A Practical Approach, M. Butler, ed.
(IRL Press, 1991) and Sambrook et al., supra.
[0150] Methods of transfection are known to the ordinarily skilled
artisan, for example, CaPO.sub.4 and electroporation. Depending on
the host cell used, transformation is performed using standard
techniques appropriate to such cells. The calcium treatment
employing calcium chloride, as described in Sambrook et al., supra,
or electroporation is generally used for prokaryotes or other cells
that contain substantial cell-wall barriers. Infection with
Agrobacterium tumefaciens is used for transformation of certain
plant cells, as described by Shaw et al., Gene, 23:315 (1983) and
WO 89/05859 published 29 Jun. 1989. For mammalian cells without
such cell walls, the calcium phosphate precipitation method of
Graham and van der Eb, Virology, 52:456-457 (1978) can be employed.
General aspects of mammalian cell host system transformations have
been described in U.S. Pat. No. 4,399,216. Transformations into
yeast are typically carried out according to the method of Van
Solingen et al., J. Bact., 130:946 (1977) and Hsiao et al., Proc.
Natl. Acad. Sci. (USA), 76:3829 (1979). However, other methods for
introducing DNA into cells, such as by nuclear microinjection,
electroporation, bacterial protoplast fusion with intact cells, or
polycations, e.g., polybrene, polyornithine, may also be used. For
various techniques for transforming mammalian cells, see Keown et
al., Methods in Enzymology, 185:527-537 (1990) and Mansour et al.,
Nature, 336:348-352 (1988).
[0151] Suitable host cells for cloning or expressing the DNA in the
vectors herein include prokaryote, yeast, or higher eukaryote
cells. Suitable prokaryotes include but are not limited to
eubacteria, such as Gram-negative or Gram-positive organisms, for
example, Enterobacteriaceae such as E. coli. Various E. coli
strains are publicly available, such as E. coli K12 strain MM294
(ATCC 31,446); E. coli X1776 (ATCC 31,537); E. coli strain W3110
(ATCC 27,325) and K5 772 (ATCC 53,635).
[0152] In addition to prokaryotes, eukaryotic microbes such as
filamentous fungi or yeast are suitable cloning or expression hosts
for PRO301-, PRO362- or PRO245-encoding vectors. Saccharomyces
cerevisiae is a commonly used lower eukaryotic host
microorganism.
[0153] Suitable host cells for the expression of glycosylated
PRO301, PRO362 or PRO245 are derived from multicellular organisms.
Examples of invertebrate cells include insect cells such as
Drosophila S2 and Spodoptera Sf9, as well as plant cells. Examples
of useful mammalian host cell lines include Chinese hamster ovary
(CHO) and COS cells. More specific examples include monkey kidney
CV1 line transformed by SV40 (COS-7, ATCC CRL 1651); human
embryonic kidney line (293 or 293 cells subcloned for growth in
suspension culture, Graham et al., J. Gen Virol., 36:59 (1977));
Chinese hamster ovary cells/-DHFR (CHO, Urlaub and Chasin, Proc.
Natl. Acad. Sci. USA, 77:4216 (1980)); mouse sertoli cells (TM4,
Mather, Biol. Reprod., 23:243-251 (1980)); human lung cells (W138,
ATCC CCL 75); human liver cells (Hep G2, HB 8065); and mouse
mammary tumor (MMT 060562, ATCC CCL51). The selection of the
appropriate host cell is deemed to be within the skill in the
art.
[0154] c. Selection and Use of a Replicable Vector
[0155] The nucleic acid (e.g., cDNA or genomic DNA) encoding
PRO301, PRO362 or PRO245 may be inserted into a replicable vector
for cloning (amplification of the DNA) or for expression. Various
vectors are publicly available. The vector may, for example, be in
the form of a plasmid, cosmid, viral particle, or phage. The
appropriate nucleic acid sequence may be inserted into the vector
by a variety of procedures. In general, DNA is inserted into an
appropriate restriction endonuclease site(s) using techniques known
in the art. Vector components generally include, but are not
limited to, one or more of a signal sequence, an origin of
replication, one or more marker genes, an enhancer element, a
promoter, and a transcription termination sequence. Construction of
suitable vectors containing one or more of these components employs
standard ligation techniques which are known to the skilled
artisan.
[0156] The PRO301, PRO362 or PRO245 may be produced recombinantly
not only directly, but also as a fusion polypeptide with a
heterologous polypeptide, which may be a signal sequence or other
polypeptide having a specific cleavage site at the N-terminus of
the mature protein or polypeptide. In general, the signal sequence
may be a component of the vector, or it may be a part of the
PRO301, PRO362 or PRO245 DNA that is inserted into the vector. The
signal sequence may be a prokaryotic signal sequence selected, for
example, from the group of the alkaline phosphatase, penicillinase,
lpp, or heat-stable enterotoxin II leaders. For yeast secretion the
signal sequence may be, e.g., the yeast invertase leader, alpha
factor leader (including Saccharomyces and Kluyveromyces"-factor
leaders, the latter described in U.S. Pat. No. 5,010,182), or acid
phosphatase leader, the C. albicans glucoamylase leader (EP 362,179
published 4 Apr. 1990), or the signal described in WO 90/13646
published 15 Nov. 1990. In mammalian cell expression, mammalian
signal sequences may be used to direct secretion of the protein,
such as signal sequences from secreted polypeptides of the same or
related species, as well as viral secretory leaders.
[0157] Both expression and cloning vectors contain a nucleic acid
sequence that enables the vector to replicate in one or more
selected host cells. Such sequences are well known for a variety of
bacteria, yeast, and viruses. The origin of replication from the
plasmid pBR322 is suitable for most Gram-negative bacteria, the 2:
plasmid origin is suitable for yeast, and various viral origins
(SV40, polyoma, adenovirus, VSV or BPV) are useful for cloning
vectors in mammalian cells.
[0158] Expression and cloning vectors will typically contain a
selection gene, also termed a selectable marker. Typical selection
genes encode proteins that (a) confer resistance to antibiotics or
other toxins, e.g., ampicillin, neomycin, methotrexate, or
tetracycline, (b) complement auxotrophic deficiencies, or (c)
supply critical nutrients not available from complex media, e.g.,
the gene encoding D-alanine racemase for Bacilli.
[0159] An example of suitable selectable markers for mammalian
cells are those that enable the identification of cells competent
to take up the PRO301, PRO362 or PRO245 nucleic acid, such as DHFR
or thymidine kinase. An appropriate host cell when wild-type DHFR
is employed is the CHO cell line deficient in DHFR activity,
prepared and propagated as described by Urlaub et al., Proc. Natl.
Acad. Sci. USA, 77:4216 (1980). A suitable selection gene for use
in yeast is the trp1 gene present in the yeast plasmid YRp7
[Stinchcomb et al., Nature, 282:39(1979); Kingsman et al., Gene,
7:141 (1979); Tschemper et al., Gene, 10:157 (1980)]. The trp1 gene
provides a selection marker for a mutant strain of yeast lacking
the ability to grow in tryptophan, for example, ATCC No. 44076 or
PEP4-1 [Jones, Genetics, 85:12 (1977)].
[0160] Expression and cloning vectors usually contain a promoter
operably linked to the PRO301, PRO362 or PRO245 nucleic acid
sequence to direct mRNA synthesis. Promoters recognized by a
variety of potential host cells are well known. Promoters suitable
for use with prokaryotic hosts include the .beta.-lactamase and
lactose promoter systems [Chang et al., Nature, 275:615 (1978);
Goeddel et al., Nature, 281:544 (1979)], alkaline phosphatase, a
tryptophan (trp) promoter system [Goeddel, Nucleic Acids Res.,
8:4057 (1980); EP 36,776], and hybrid promoters such as the tac
promoter [deBoer et al., Proc. Natl. Acad. Sci. USA, 80:21-25
(1983)]. Promoters for use in bacterial systems also will contain a
Shine-Dalgarno (S.D.) sequence operably linked to the DNA encoding
PRO301, PRO362 or PRO245.
[0161] Examples of suitable promoting sequences for use with yeast
hosts include the promoters for 3-phosphoglycerate kinase [Hitzeman
et al., J. Biol. Chem., 255:2073 (1980)] or other glycolytic
enzymes [Hess et al., J. Adv. Enzyme Reg., 7:149 (1968); Holland,
Biochemistry, 17:4900 (1978)], such as enolase,
glyceraldehyde-3-phosphate dehydrogenase, hexokinase, pyruvate
decarboxylase, phosphofructokinase, glucose-6-phosphate isomerase,
3-phosphoglycerate mutase, pyruvate kinase, triosephosphate
isomerase, phosphoglucose isomerase, and glucokinase.
[0162] Other yeast promoters, which are inducible promoters having
the additional advantage of transcription controlled by growth
conditions, are the promoter regions for alcohol dehydrogenase 2,
isocytochrome C, acid phosphatase, degradative enzymes associated
with nitrogen metabolism, metallothionein,
glyceraldehyde-3-phosphate dehydrogenase, and enzymes responsible
for maltose and galactose utilization. Suitable vectors and
promoters for use in yeast expression are further described in EP
73,657.
[0163] PRO301, PRO362 or PRO245 transcription from vectors in
mammalian host cells is controlled, for example, by promoters
obtained from the genomes of viruses such as polyoma virus, fowlpox
virus (UK 2,211,504 published 5 Jul. 1989), adenovirus (such as
Adenovirus 2), bovine papilloma virus, avian sarcoma virus,
cytomegalovirus, a retrovirus, hepatitis-B virus and Simian Virus
40 (SV40), from heterologous mammalian promoters, e.g., the actin
promoter or an immunoglobulin promoter, and from heat-shock
promoters, provided such promoters are compatible with the host
cell systems.
[0164] Transcription of a DNA encoding the PRO301, PRO362 or PRO245
by higher eukaryotes may be increased by inserting an enhancer
sequence into the vector. Enhancers are cis-acting elements of DNA,
usually about from 10 to 300 bp, that act on a promoter to increase
its transcription. Many enhancer sequences are now known from
mammalian genes (globin, elastase, albumin, .alpha.-fetoprotein,
and insulin). Typically, however, one will use an enhancer from a
eukaryotic cell virus. Examples include the SV40 enhancer on the
late side of the replication origin (bp 100-270), the
cytomegalovirus early promoter enhancer, the polyoma enhancer on
the late side of the replication origin, and adenovirus enhancers.
The enhancer may be spliced into the vector at a position 5' or 3'
to the PRO301, PRO362 or PRO245 coding sequence, but is preferably
located at a site 5' from the promoter.
[0165] Expression vectors used in eukaryotic host cells (yeast,
fungi, insect, plant, animal, human, or nucleated cells from other
multicellular organisms) will also contain sequences necessary for
the termination of transcription and for stabilizing the mRNA. Such
sequences are commonly available from the 5' and, occasionally 3',
untranslated regions of eukaryotic or viral DNAs or cDNAs. These
regions contain nucleotide segments transcribed as polyadenylated
fragments in the untranslated portion of the mRNA encoding PRO301,
PRO362 or PRO245.
[0166] Still other methods, vectors, and host cells suitable for
adaptation to the synthesis of PRO301, PRO362 or PRO245 in
recombinant vertebrate cell culture are described in Gething et
al., Nature, 293:620-625 (1981); Mantei et al., Nature, 281:40-46
(1979); EP 117,060; and EP 117,058.
[0167] d. Detecting Gene Amplification/Expression
[0168] Gene amplification and/or expression may be measured in a
sample directly, for example, by conventional Southern blotting,
Northern blotting to quantitate the transcription of mRNA [Thomas,
Proc. Natl. Acad. Sci. USA, 77:5201-5205 (1980)], dot blotting (DNA
analysis), or in situ hybridization, using an appropriately labeled
probe, based on the sequences provided herein. Alternatively,
antibodies may be employed that can recognize specific duplexes,
including DNA duplexes, RNA duplexes, and DNA-RNA hybrid duplexes
or DNA-protein duplexes. The antibodies in turn may be labeled and
the assay may be carried out where the duplex is bound to a
surface, so that upon the formation of duplex on the surface, the
presence of antibody bound to the duplex can be detected.
[0169] Gene expression, alternatively, may be measured by
immunological methods, such as immunohistochemical staining of
cells or tissue sections and assay of cell culture or body fluids,
to quantitate directly the expression of gene product. Antibodies
useful for immunohistochemical staining and/or assay of sample
fluids may be either monoclonal or polyclonal, and may be prepared
in any mammal. Conveniently, the antibodies may be prepared against
a native sequence PRO301, PRO362 or PRO245 polypeptide or against a
synthetic peptide based on the DNA sequences provided herein or
against exogenous sequence fused to PRO301, PRO362 or PRO245 DNA
and encoding a specific antibody epitope.
[0170] e. Purification of Polypeptide
[0171] Forms of PRO301, PRO362 or PRO245 may be recovered from
culture medium or from host cell lysates. If membrane-bound, it can
be released from the membrane using a suitable detergent solution
(e.g. Triton-X 100) or by enzymatic cleavage. Cells employed in
expression of PRO301, PRO362 or PRO245 can be disrupted by various
physical or chemical means, such as freeze-thaw cycling,
sonication, mechanical disruption, or cell lysing agents.
[0172] It may be desired to purify PRO301, PRO362 or PRO245 from
recombinant cell proteins or polypeptides. The following procedures
are exemplary of suitable purification procedures: by fractionation
on an ion-exchange column; ethanol precipitation; reverse phase
HPLC; chromatography on silica or on a cation-exchange resin such
as DEAE; chromatofocusing; SDS-PAGE; ammonium sulfate
precipitation; gel filtration using, for example, Sephadex G-75;
protein A Sepharose columns to remove contaminants such as IgG; and
metal chelating columns to bind epitope-tagged forms of the PRO301,
PRO362 or PRO245. Various methods of protein purification may be
employed and such methods are known in the art and described for
example in Deutscher, Methods in Enzymology, 182 (1990); Scopes,
Protein Purification: Principles and Practice, Springer-Verlag, New
York (1982). The purification step(s) selected will depend, for
example, on the nature of the production process used and the
particular PRO301, PRO362 or PRO245 produced.
[0173] 2. Tissue Distribution
[0174] The location of tissues expressing the polypeptides of the
invention can be identified by determining mRNA expression in
various human tissues. The location of such genes provides
information about which tissues are most likely to be affected by
the stimulating and inhibiting activities of the polypeptides of
the invention. The location of a gene in a specific tissue also
provides sample tissue for the activity blocking assays discussed
below.
[0175] Gene expression in various tissues may be measured by
conventional Southern blotting, Northern blotting to quantitate the
transcription of mRNA (Thomas, Proc. Natl. Acad. Sci. USA,
77:5201-5205 [1980]), dot blotting (DNA analysis), or in situ
hybridization, using an appropriately labeled probe, based on the
sequences provided herein. Alternatively, antibodies may be
employed that can recognize specific duplexes, including DNA
duplexes, RNA duplexes, and DNA-RNA hybrid duplexes or DNA-protein
duplexes.
[0176] Gene expression in various tissues, alternatively, may be
measured by immunological methods, such as immunohistochemical
staining of tissue sections and assay of cell culture or body
fluids, to quantitate directly the expression of gene product.
Antibodies useful for immunohistochemical staining and/or assay of
sample fluids may be either monoclonal or polyclonal, and may be
prepared in any mammal. Conveniently, the antibodies may be
prepared against a native sequence of a polypeptide of the
invention or against a synthetic peptide based on the DNA sequences
encoding the polypeptide of the invention or against an exogenous
sequence fused to a DNA encoding a polypeptide of the invention and
encoding a specific antibody epitope. General techniques for
generating antibodies, and special protocols for Northern blotting
and in situ hybridization are provided below.
[0177] 3. Antibody Binding Studies
[0178] The activity of the polypeptides of the invention can be
further verified by antibody binding studies, in which the ability
of anti-PRO301, anti-PRO362 or anti-PRO245 antibodies to inhibit
the effect of the PRO301, PRO362 or PRO245 polypeptides on tissue
cells is tested. Exemplary antibodies include polyclonal,
monoclonal, humanized, bispecific, and heteroconjugate antibodies,
the preparation of which will be described hereinbelow.
[0179] Antibody binding studies may be carried out in any known
assay method, such as competitive binding assays, direct and
indirect sandwich assays, and immunoprecipitation assays. Zola,
Monoclonal Antibodies: A Manual of Techniques, pp. 147-158 (CRC
Press, Inc., 1987).
[0180] Competitive binding assays rely on the ability of a labeled
standard to compete with the test sample analyte for binding with a
limited amount of antibody. The amount of target protein in the
test sample is inversely proportional to the amount of standard
that becomes bound to the antibodies. To facilitate determining the
amount of standard that becomes bound, the antibodies preferably
are insolubilized before or after the competition, so that the
standard and analyte that are bound to the antibodies may
conveniently be separated from the standard and analyte which
remain unbound.
[0181] Sandwich assays involve the use of two antibodies, each
capable of binding to a different immunogenic portion, or epitope,
of the protein to be detected. In a sandwich assay, the test sample
analyte is bound by a first antibody which is immobilized on a
solid support, and thereafter a second antibody binds to the
analyte, thus forming an insoluble three-part complex. See, e.g.,
U.S. Pat. No. 4,376,110. The second antibody may itself be labeled
with a detectable moiety (direct sandwich assays) or may be
measured using an anti-immunoglobulin antibody that is labeled with
a detectable moiety (indirect sandwich assay). For example, one
type of sandwich assay is an ELISA assay, in which case the
detectable moiety is an enzyme.
[0182] For immunohistochemistry, the tissue sample may be fresh or
frozen or may be embedded in paraffin and fixed with a preservative
such as formalin, for example.
[0183] 4. Cell-Based Assays
[0184] Cell-based assays and animal models for immune related
diseases can be used to further understand the relationship between
the genes and polypeptides identified herein and the development
and pathogenesis of immune related disease.
[0185] In a different approach, cells of a cell type known to be
involved in a particular immune related disease are transfected
with the cDNAs described herein, and the ability of these cDNAs to
stimulate or inhibit immune function is analyzed. Suitable cells
can be transfected with the desired gene, and monitored for immune
function activity. Such transfected cell lines can then be used to
test the ability of poly- or monoclonal antibodies or antibody
compositions to inhibit or stimulate immune function, for example
to modulate T-cell proliferation or inflammatory cell infiltration.
Cells transfected with the coding sequences of the genes identified
herein can further be used to identify drug candidates for the
treatment of immune related diseases.
[0186] In addition, primary cultures derived from transgenic
animals (as described below) can be used in the cell-based assays
herein, although stable cell lines are preferred. Techniques to
derive continuous cell lines from transgenic animals are well known
in the art (see, e.g. Small et al., Mol. Cell. Biol. 5, 642-648
[1985]).
[0187] One suitable cell based assay is the mixed lymphocyte
reaction (MLR). Current Protocols in Immunology, unit 3.12; edited
by J E Coligan, A M Kruisbeek, D H Marglies, E M Shevach, W
Strober, National Institutes of Health, Published by John Wiley
& Sons, Inc. In this assay, the ability of a test compound to
stimulate the proliferation of activated T cells is assayed. A
suspension of responder T cells is cultured with allogeneic
stimulator cells and the proliferation of T cells is measured by
uptake of tritiated thymidine. This assay is a general measure of T
cell reactivity. Since the majority of T cells respond to and
produce IL-2 upon activation, differences in responsiveness in this
assay in part reflect differences in IL-2 production by the
responding cells. The MLR results can be verified by a standard
lymphokine (IL-2) detection assay. Current Protocols in Immunology,
supra, 3.15, 6.3.
[0188] A proliferative T cell response in an MLR assay may be due
to a mitogenic response or may be due to a stimulatory response by
the T cells. Additional verification of the T cell stimulatory
activity of the polypeptides of the invention can be obtained by a
costimulation assay. T cell activation requires an antigen specific
signal mediated through the major histocompatability complex (MHC)
and a costimulatory signal mediated through a second ligand binding
interaction, for example, the B7(CD80, CD86)/CD28 binding
interaction. CD28 crosslinking increases lymphokine secretion by
activated T cells. T cell activation has both negative and positive
controls through the binding of ligands which have a negative or
positive effect. CD28 and CTLA-4 are related glycoproteins in the
Ig superfamily which bind to B7. CD28 binding to B7 has a positive
costimulation effect of T cell activation; conversely, CTLA-4
binding to B7 has a negative T cell deactivating effect. Chambers,
C. A. and Allison, J. P., Curr. Opin. Immunol. (1997) 9:396.
Schwartz, R. H., Cell (1992) 71:1065; Linsey, P. S. and Ledbetter,
J. A., Annu. Rev. Immunol. (1993) 11:191; June, C. H. et al,
Immunol. Today (1994) 15:321; Jenkins, M. K., Immunity (1994)
1:405. In a costimulation assay, the polypeptides of the invention
are assayed for T cell costimulatory or inhibitory activity.
[0189] Polypeptides of the invention, as well as other compounds of
the invention, which are stimulators (costimulators) of T cell
proliferation, as determined by MLR and costimulation assays,for
example, are useful in treating immune related diseases
characterized by poor, suboptimal or inadequate immune function.
These diseases are treated by stimulating the proliferation and
activation of T cells (and T cell mediated immunity) and enhancing
the immune response in a mammal through administration of a
stimulatory compound, such as the stimulating polypeptides of the
invention. The stimulating polypeptide may be a PRO301, PRO362 or
PRO245 polypeptide or an agonist antibody therefor. Immunoadjuvant
therapy for treatment of tumors, described in more detail below, is
an example of this use of the stimulating compounds of the
invention. Antibodies which bind to inhibitory polypeptides
function to enhance the immune response by removing the inhibitory
effect of the inhibiting polypeptides. This effect is seen in
experiments using anti-CTLA-4 antibodies which enhance T cell
proliferation, presumably by removal of the inhibitory signal
caused by CTLA-4 binding. Walunas, T. L. et al, Immunity (1994)
1:405. This use is also validated in experiments with 4-1BB
glycoprotein, a member of the tumor necrosis factor receptor family
which binds to a ligand (4-1BBL) expressed on primed T cells and
signals T cell activation and growth. Alderson, M. E. et al., J.
Immunol. (1994) 24:2219. Inhibition of 4-1BB binding by treatment
with an anti-4-1BB antibody increases the severity of
graft-versus-host disease and may be used to eradicate tumors.
Helistrom, I. and Helistrom, K. E., Crit. Rev. Immunol. (1998)
18:1.
[0190] On the other hand, polypeptides of the invention, as well as
other compounds of the invention, which are inhibitors of T cell
proliferation/activation and/or lymphokine secretion, can be
directly used to suppress the immune response. These compounds are
useful to reduce the degree of the immune response and to treat
immune related diseases characterized by a hyperactive,
superoptimal, or autoimmune response. Alternatively, antibodies
which bind to the stimulating polypeptides of the invention and
block the stimulating effect of these molecules can be used to
suppress the T cell mediated immune response by inhibiting T cell
proliferation/activation and/or lymphokine secretion. Blocking the
stimulating effect of the polypeptides suppresses the immune
response of the mammal.
[0191] 5. Animal Models
[0192] The results of the cell based in vitro assays can be further
verified using in vivo animal models and assays for T-cell
function. A variety of well known animal models can be used to
further understand the role of the genes identified herein in the
development and pathogenesis of immune related disease, and to test
the efficacy of candidate therapeutic agents, including antibodies,
and other antagonists of the native polypeptides, including small
molecule antagonists. The in vivo nature of such models makes them
particularly predictive of responses in human patients. Animal
models of immune related diseases include both non-recombinant and
recombinant (transgenic) animals. Non-recombinant animal models
include, for example, rodent, e.g., murine models. Such models can
be generated by introducing cells into syngeneic mice using
standard techniques, e.g. subcutaneous injection, tail vein
injection, spleen implantation, intraperitoneal implantation,
implantation under the renal capsule, etc.
[0193] Contact hypersensitivity is a simple in vivo assay of cell
mediated immune function. In this procedure, epidermal cells are
exposed to exogenous haptens which give rise to a delayed type
hypersensitivity reaction which is measured and quantitated.
Contact sensitivity involves an initial sensitizing phase followed
by an elicitation phase. The elicitation phase occurs when the
epidermal cells encounter an antigen to which they have had
previous contact. Swelling and inflammation occur, making this an
excellent model of human allergic contact dermatitis. A suitable
procedure is described in detail in Current Protocols in
Immunology, Eds. J. E. Cologan, A. M. Kruisbeek, D. H. Margulies,
E. M. Shevach and W. Strober, John Wiley & Sons, Inc., 1994,
unit 4.2. See also Grabbe, S. and Schwarz, T, Immun. Today
19(1):37-44 (1998).
[0194] Graft-versus-host disease occurs when immunocompetent cells
are transplanted into immunosuppressed or tolerant patients. The
donor cells recognize and respond to host antigens. The response
can vary from life threatening severe inflammation to mild cases of
diarrhea and weight loss. Graft-versus-host disease models provide
a means of assessing T cell reactivity against MHC antigens and
minor transplant antigens. A suitable procedure is described in
detail in Current Protocols in Immunology, supra, unit 4.3.
[0195] An animal model for skin allograft rejection is a means of
testing the ability of T cells to mediate in vivo tissue
destruction which is indicative of and a measure of their role in
anti-viral and tumor immunity. The most common and accepted models
use murine tail-skin grafts. Repeated experiments have shown that
skin allograft rejection is mediated by T cells, helper T cells and
killer-effector T cells, and not antibodies. Auchincloss, H. Jr.
and Sachs, D. H., Fundamental Immunology, 2nd ed., W. E. Paul ed.,
Raven Press, New York, 1989, 889-992. A suitable procedure is
described in detail in Current Protocols in Immunology, supra, unit
4.4. Other transplant rejection models which can be used to test
the compounds of the invention are the allogeneic heart transplant
models described by Tanabe, M. et al, Transplantation (1994) 58:23
and Tinubu, S. A. et al, J. Immunol. (1994) 4330-4338.
[0196] Animal models for delayed type hypersensitivity provides an
assay of cell mediated immune function as well. Delayed type
hypersensitivity reactions are a T cell mediated in vivo immune
response characterized by inflammation which does not reach a peak
until after a period of time has elapsed after challenge with an
antigen. These reactions also occur in tissue specific autoimmune
diseases such as multiple sclerosis (MS) and experimental
autoimmune encephalomyelitis (EAE, a model for MS). A suitable
procedure is described in detail in Current Protocols in
Immunology, above, unit 4.5.
[0197] EAE is a T cell mediated autoimmune disease characterized by
T cell and mononuclear cell inflammation and subsequent
demyelination of axons in the central nervous system. EAE is
generally considered to be a relevant animal model for MS in
humans. Bolton, C., Multiple Sclerosis (1995) 1:143. Both acute and
relapsing-remitting models have been developed. The compounds of
the invention can be tested for T cell stimulatory or inhibitory
activity against immune mediated demyelinating disease using the
protocol described in Current Protocols in Immunology, above, units
15.1 and 15.2. See also the models for myelin disease in which
oligodendrocytes or Schwann cells are grafted into the central
nervous system as described in Duncan, I. D. et al, Molec. Med.
Today (1997) 554-561.
[0198] An animal model for arthritis is collagen-induced arthritis.
This model shares clinical, histological and immunological
characteristics of human autoimmune rheumatoid arthritis and is an
acceptable model for human autoimmune arthritis. Mouse and rat
models are characterized by synovitis, erosion of cartilage and
subchondral bone. The compounds of the invention can be tested for
activity against autoimmune arthritis using the protocols described
in Current Protocols in Immunology, above, units 15.5. See also the
model using a monoclonal antibody to CD18 and VLA-4 integrins
described in lssekutz, A. C. et al., Immunology (1996) 88:569.
[0199] A model of asthma has been described in which
antigen-induced airway hyper-reactivity, pulmonary eosinophilia and
inflammation are induced by sensitizing an animal with ovalbumin
and then challenging the animal with the same protein delivered by
aerosol. Several animal models (guinea pig,. rat, non-human
primate) show symptoms similar to atopic asthma in humans upon
challenge with aerosol antigens. Murine models have many of the
features of human asthma. Suitable procedures to test the compounds
of the invention for activity and effectiveness in the treatment of
asthma are described by Wolyniec, W. W. et al, Am. J. Respir. Cell
Mol. Biol. (1998) 18:777 and the references cited therein.
[0200] Additionally, the compounds of the invention can be tested
on animal models for psoriasis like diseases. Evidence suggests a T
cell pathogenesis for psoriasis. The compounds of the invention can
be tested in the scid/scid mouse model described by Schon, M. P. et
al, Nat. Med. (1997) 3:183, in which the mice demonstrate
histopathologic skin lesions resembling psoriasis. Another suitable
model is the human skin/scid mouse chimera prepared as described by
Nickoloff, B. J. et al, Am. J. Path. (1995) 146:580.
[0201] Recombinant (transgenic) animal models can be engineered by
introducing the coding portion of the genes identified herein into
the genome of animals of interest, using standard techniques for
producing transgenic animals. Animals that can serve as a target
for transgenic manipulation include, without limitation, mice,
rats, rabbits, guinea pigs, sheep, goats, pigs, and non-human
primates, e.g. baboons, chimpanzees and monkeys. Techniques known
in the art to introduce a transgene into such animals include
pronucleic microinjection (Hoppe and Wanger, U.S. Pat. No.
4,873,191); retrovirus-mediated gene transfer into germ lines
(e.g., Van der Putten et al., Proc. Natl. Acad. Sci. USA 82,
6148-615 [1985]); gene targeting in embryonic stem cells (Thompson
et al., Cell 56, 313-321 [1989]); electroporation of embryos (Lo,
Mol. Cel. Biol. 3, 1803-1814 [1983]); sperm-mediated gene transfer
(Lavitrano et al., Cell 57, 717-73 [1989]). For review, see, for
example, U.S. Pat. No.4,736,866.
[0202] For the purpose of the present invention, transgenic animals
include those that carry the transgene only in part of their cells
("mosaic animals"). The transgene can be integrated either as a
single transgene, or in concatamers, e.g., head-to-head or
head-to-tail tandems. Selective introduction of a transgene into a
particular cell type is also possible by following, for example,
the technique of Lasko et al., Proc. Natl. Acad. Sci. USA 89,
623-636 (1992).
[0203] The expression of the transgene in transgenic animals can be
monitored by standard techniques. For example, Southern blot
analysis or PCR amplification can be used to verify the integration
of the transgene. The level of mRNA expression can then be analyzed
using techniques such as in situ hybridization, Northern blot
analysis, PCR, or immunocytochemistry.
[0204] The animals may be further examined for signs of immune
disease pathology, for example by histological examination to
determine infiltration of immune cells into specific tissues.
Blocking experiments can also be performed in which the transgenic
animals are treated with the compounds of the invention to
determine the extent of the T cell proliferation stimulation or
inhibition of the compounds. In these experiments, blocking
antibodies which bind to the polypeptide of the invention, prepared
as described above, are administered to the animal and the effect
on immune function is determined.
[0205] Alternatively, "knock out" animals can be constructed which
have a defective or altered gene encoding a polypeptide identified
herein, as a result of homologous recombination between the
endogenous gene encoding the polypeptide and altered genomic DNA
encoding the same polypeptide introduced into an embryonic cell of
the animal. For example, cDNA encoding a particular polypeptide can
be used to clone genomic DNA encoding that polypeptide in
accordance with established techniques. A portion of the genomic
DNA encoding a particular polypeptide can be deleted or replaced
with another gene, such as a gene encoding a selectable marker
which can be used to monitor integration. Typically, several
kilobases of unaltered flanking DNA (both at the 5' and 3' ends)
are included in the vector [see e.g., Thomas and Capecchi, Cell,
51:503 (1987) for a description of homologous recombination
vectors]. The vector is introduced into an embryonic stem cell line
(e.g., by electroporation) and cells in which the introduced DNA
has homologously recombined with the endogenous DNA are selected
[see e.g., Li et al., Cell, 69:915 (1992)]. The selected cells are
then injected into a blastocyst of an animal (e.g., a mouse or rat)
to form aggregation chimeras [see e.g., Bradley, in
Teratocarcinomas and Embryonic Stem Cells: A Practical Approach, E.
J. Robertson, ed. (IRL, Oxford, 1987), pp. 113-152]. A chimeric
embryo can then be implanted into a suitable pseudopregnant female
foster animal and the embryo brought to term to create a "knock
out" animal. Progeny harboring the homologously recombined DNA in
their germ cells can be identified by standard techniques and used
to breed animals in which all cells of the animal contain the
homologously recombined DNA. Knockout animals can be characterized
for instance, for their ability to defend against certain
pathological conditions and for their development of pathological
conditions due to absence of the polypeptide.
[0206] 6. ImmunoAdjuvant Therapy
[0207] In one embodiment, compounds of the invention having an
immunostimulatory effect can be used in immunoadjuvant therapy for
the treatment of tumors (cancer). It is now well established that T
cells recognize human tumor specific antigens. One group of tumor
antigens, encoded by the MAGE, BAGE and GAGE families of genes, are
silent in all adult normal tissues, but are expressed in
significant amounts in tumors, such as melanomas, lung tumors, head
and neck tumors, and bladder carcinomas. DeSmet, C. et al, (1 996)
Proc. Natl. Acad. Sci. USA, 93:7149. It has been shown that
costimulation of T cells induces tumor regression and an antitumor
response both in vitro and in vivo. Melero, I. et al, Nature
Medicine (1997) 3:682; Kwon, E. D. et al, Proc. Natl. Acad. Sci.
USA (1997) 94:8099; Lynch, D. H. et al, Nature Medicine (1997)
3:625; Finn, O. J. and Lotze, M. T., J. Immunol. (1998) 21:114. The
stimulatory compounds of the invention can be administered as
adjuvants, alone or together with a growth regulating agent,
cytotoxic agent or chemotherapeutic agent, to stimulate T cell
proliferation/activation and an antitumor response to tumor
antigens. The growth regulating, cytotoxic, or chemotherapeutic
agent may be administered in conventional amounts using known
administration regimes. Immunostimulating activity by the compounds
of the invention allows reduced amounts of the growth regulating,
cytotoxic, or chemotherapeutic agents thereby potentially lowering
the toxicity to the patient.
[0208] Cancer is characterized by the increase in the number of
abnormal, or neoplastic, cells derived from a normal tissue which
proliferate to form a tumor mass, the invasion of adjacent tissues
by these neoplastic tumor cells, and the generation of malignant
cells which eventually spread via the blood or lymphatic system to
regional lymph nodes and to distant sites (metastasis). In a
cancerous state a cell proliferates under conditions in which
normal cells would not grow. Cancer manifests itself in a wide
variety of forms, characterized by different degrees of
invasiveness and aggressiveness.
[0209] Alteration of gene expression is intimately related to the
uncontrolled cell growth and de-differentiation which are a common
feature of all cancers. The genomes of certain well studied tumors
have been found to show decreased expression of recessive genes,
usually referred to as tumor suppression genes, which would
normally function to prevent malignant cell growth, and/or
overexpression of certain dominant genes, such as oncogenes, that
act to promote malignant growth. Each of these genetic changes
appears to be responsible for importing some of the traits that, in
aggregate, represent the full neoplastic phenotype (Hunter, Cell
64, 1129 [1991]; Bishop, Cell 64, 235-248 [1991]).
[0210] A well known mechanism of gene (e.g. oncogene)
overexpression in cancer cells is gene amplification. This is a
process where in the chromosome of the ancestral cell multiple
copies of a particular gene are produced. The process involves
unscheduled replication of the region of chromosome comprising the
gene, followed by recombination of the replicated segments back
into the chromosome (Alitalo et al., Adv. Cancer Res. 47, 235-281
[1986]). It is believed that the overexpression of the gene
parallels gene amplification, i.e. is proportionate to the number
of copies made.
[0211] Proto-oncogenes that encode growth factors and growth factor
receptors have been identified to play important roles in the
pathogenesis of various human malignancies, including breast
cancer. For example, it has been found that the human ErbB2 gene
(erbB2, also known as her2, or c-erbB-2), which encodes a 185-kd
transmembrane glycoprotein receptor (p185.sup.HER2; HER2) related
to the epidermal growth factor receptor (EGFR), is overexpressed in
about 25% to 30% of human breast cancer (Slamon et al., Science
235:177-182 [1987]; Slamon et al., Science 244:707-712 [1989]).
[0212] It has been reported that gene amplification of a
protooncogen is an event typically involved in the more malignant
forms of cancer, and could act as a predictor of clinical outcome
(Schwab et al., Genes Chromosomes Cancer 1, 181-193 [1990]; Alitalo
et al., supra). Thus, erbB2 overexpression is commonly regarded as
a predictor of a poor prognosis, especially in patients with
primary disease that involves axillary lymph nodes (Slamon et al.,
[1987] and [1989], supra; Ravdin and Chamness, Gene 159:19-27
[1995]; and Hyn Stern, Biochim Biophys Acta 1198:165-184 [1994]),
and has been linked to sensitivity and/or resistance to hormone
therapy and chemotherapeutic regimens, including CMF
(cyclophosphamide, methotrexate, and fluoruracil) and
anthracyclines (Baselga et al., Oncology 11(3 Suppl 1):43-48
[1997]). However, despite the association of erbB2 overexpression
with poor prognosis, the odds of HER2-positive patients responding
clinically to treatment with taxanes were greater than three times
those of HER2-negative patients (Ibid). A recombinant humanized
anti-ErbB2 (anti-HER2) monoclonal antibody (a humanized version of
the murine anti-ErbB2 antibody 4D5, referred to as rhuMAb HER2 or
Herceptin7) has been clinically active in patients with
ErbB2-overexpressing metastatic breast cancers that had received
extensive prior anticancer therapy. (Baselga et al., J. Clin.
Oncol. 14:737-744 [1996]).
[0213] 7. Screening Assays for Drug Candidates
[0214] Screening assays for drug candidates are designed to
identify compounds that bind or complex with the polypeptides
encoded by the genes identified herein or a biologically active
fragment thereof, or otherwise interfere with the interaction of
the encoded polypeptides with other cellular proteins. Such
screening assays will include assays amenable to high-throughput
screening of chemical libraries, making them particularly suitable
for identifying small molecule drug candidates. Small molecules
contemplated include synthetic organic or inorganic compounds,
including peptides, preferably soluble peptides,
(poly)peptide-immunoglobulin fusions, and, in particular,
antibodies including, without limitation, poly- and monoclonal
antibodies and antibody fragments, single-chain antibodies,
anti-idiotypic antibodies, and chimeric or humanized versions of
such antibodies or fragments, as well as human antibodies and
antibody fragments. The assays can be performed in a variety of
formats, including protein-protein binding assays, biochemical
screening assays, immunoassays and cell based assays, which are
well characterized in the art.
[0215] All assays are common in that they call for contacting the
drug candidate with a polypeptide encoded by a nucleic acid
identified herein under conditions and for a time sufficient to
allow these two components to interact.
[0216] In binding assays, the interaction is binding and the
complex formed can be isolated or detected in the reaction mixture.
In a particular embodiment, the polypeptide encoded by the gene
identified herein or the drug candidate is immobilized on a solid
phase, e.g. on a microtiter plate, by covalent or non-covalent
attachments. Non-covalent attachment generally is accomplished by
coating the solid surface with a solution of the polypeptide and
drying. Alternatively, an immobilized antibody, e.g. a monoclonal
antibody, specific for the polypeptide to be immobilized can be
used to anchor it to a solid surface. The assay is performed by
adding the non-immobilized component, which may be labeled by a
detectable label, to the immobilized component, e.g. the coated
surface containing the anchored component. When the reaction is
complete, the non-reacted components are removed, e.g. by washing,
and complexes anchored on the solid surface are detected. When the
originally non-immobilized component carries a detectable label,
the detection of label immobilized on the surface indicates that
complexing occurred. Where the originally non-immobilized component
does not carry a label, complexing can be detected, for example, by
using a labeled antibody specifically binding the immobilized
complex.
[0217] If the candidate compound interacts with but does not bind
to a particular protein encoded by a gene identified herein, its
interaction with that protein can be assayed by methods well known
for detecting protein-protein interactions. Such assays include
traditional approaches, such as, cross-linking,
co-immunoprecipitation, and co-purification through gradients or
chromatographic columns. In addition, protein-protein interactions
can be monitored by using a yeast-based genetic system described by
Fields and co-workers [Fields and Song, Nature (London) 340,
245-246 (1989); Chien et al., Proc. Natl. Acad. Sci. USA 88,
9578-9582 (1991)] as disclosed by Chevray and Nathans [Proc. Natl.
Acad. Sci. USA 89, 5789-5793 (1991)]. Many transcriptional
activators, such as yeast GAL4, consist of two physically discrete
modular domains, one acting as the DNA-binding domain, while the
other one functioning as the transcription activation domain. The
yeast expression system described in the foregoing publications
(generally referred to as the "two-hybrid system") takes advantage
of this property, and employs two hybrid proteins, one in which the
target protein is fused to the DNA-binding domain of GAL4, and
another, in which candidate activating proteins are fused to the
activation domain. The expression of a GAL1-lacZ reporter gene
under control of a GAL4-activated promoter depends on
reconstitution of GAL4 activity via protein-protein interaction.
Colonies containing interacting polypeptides are detected with a
chromogenic substrate for .beta.-galactosidase. A complete kit
(MATCHMAKER.TM.) for identifying protein-protein interactions
between two specific proteins using the two-hybrid technique is
commercially available from Clontech. This system can also be
extended to map protein domains involved in specific protein
interactions as well as to pinpoint amino acid residues that are
crucial for these interactions.
[0218] In order to find compounds that interfere with the
interaction of a gene identified herein and other intra- or
extracellular components can be tested, a reaction mixture is
usually prepared containing the product of the gene and the intra-
or extracellular component under conditions and for a time allowing
for the interaction and binding of the two products. To test the
ability of a test compound to inhibit binding, the reaction is run
in the absence and in the presence of the test compound. In
addition, a placebo may be added to a third reaction mixture, to
serve as positive control. The binding (complex formation) between
the test compound and the intra- or extracellular component present
in the mixture is monitored as described above. The formation of a
complex in the control reaction(s) but not in the reaction mixture
containing the test compound indicates that the test compound
interferes with the interaction of the test compound and its
reaction partner.
[0219] 8. Compositions and Methods for the Treatment of Immune
Related Diseases
[0220] The compositions useful in the treatment of immune related
diseases include, without limitation, antibodies, small organic and
inorganic molecules, peptides, phosphopeptides, antisense and
ribozyme molecules, triple helix molecules, etc. that inhibit or
stimulate immune function, for example, T cell
proliferation/activation, lymphokine release, or immune cell
infiltration.
[0221] For example, antisense RNA and RNA molecule act to directly
block the translation of mRNA by hybridizing to targeted mRNA and
preventing protein translation. When antisense DNA is used,
oligodeoxyribonucleotides derived from the translation initiation
site, e.g. between about -10 and +10 positions of the target gene
nucleotide sequence, are preferred.
[0222] Ribozymes are enzymatic RNA molecules capable of catalyzing
the specific cleavage of RNA. Ribozymes act by sequence-specific
hybridization to the complementary target RNA, followed by
endonucleolytic cleavage. Specific ribozyme cleavage sites within a
potential RNA target can be identified by known techniques. For
further details see, e.g. Rossi, Current Biology 4, 469-471 (1994),
and PCT publication No. WO 97/33551 (published Sep. 18, 1997).
[0223] Nucleic acid molecules in triple helix formation used to
inhibit transcription should be single-stranded and composed of
deoxynucleotides. The base composition of these oligonucleotides is
designed such that it promotes triple helix formation via Hoogsteen
base pairing rules, which generally require sizeable stretches of
purines or pyrimidines on one strand of a duplex. For further
details see, e.g. PCT publication No. WO 97/33551, supra.
[0224] These molecules can be identified by any or any combination
of the screening assays discussed above and/or by any other
screening techniques well known for those skilled in the art.
[0225] 9. Antibodies
[0226] Among the most promising drug candidates according to the
present invention are antibodies and antibody fragments which may
inhibit (antagonists) or stimulate (agonists) T cell proliferation,
leucocyte infiltration, etc. Exemplary antibodies include
polyclonal, monoclonal, humanized, bispecific and heteroconjugate
antibodies.
[0227] a. Polyclonal Antibodies
[0228] Methods of preparing polyclonal antibodies are known to
skilled artisan. Polyclonal antibodies can be raised in a mammal,
for example, by one or more injections of an immunizing agent, and,
if desired, an adjuvant. Typically, the immunizing agent and/or
adjuvant will be injected in the mammal by multiple subcutaneous or
intraperitoneal injections. The immunizing agent may include the
PRO301, PRO362 or PRO245 polypeptide of the invention or a fusion
protein thereof. It may be useful to conjugate the immunizing agent
to a protein known to be immunogenic in the mammal being immunized.
Examples of such immunogenic proteins include but are not limited
to keyhole limpet hemocyanin, serum albumin, bovine thyroglobulin,
and soybean trypsin inhibitor. Examples of adjuvants which may be
employed include Freund's complete adjuvant and MPL-TDM adjuvant
(monophosphoryl Lipid A, synthetic trehalose dicorynomycolate). The
immunization protocol may be selected by one skilled in the art
without undue experimentation.
[0229] b. Monoclonal Antibodies
[0230] Antibodies which recognize and bind to the polypeptides of
the invention or which act as antagonists thereto may,
alternatively be monoclonal antibodies. Monoclonal antibodies may
be prepared using hybridoma methods, such as those described by
Kohler and Milstein, Nature, 256:495 (1975). In a hybridoma method,
a mouse, hamster, or other appropriate host animal, is typically
immunized with an immunizing agent to elicit lymphocytes that
produce or are capable of producing antibodies that will
specifically bind to the immunizing agent. Alternatively, the
lymphocytes may be immunized in vitro.
[0231] The immunizing agent will typically include the PRO301,
PRO362 or PRO245 polypeptide of the invention, an antigenic
fragment or a fusion protein thereof. Generally, either peripheral
blood lymphocytes ("PBLs") are used if cells of human origin are
desired, or spleen cells or lymph node cells are used if non-human
mammalian sources are desired. The lymphocytes are then fused with
an immortalized cell line using a suitable fusing agent, such as
polyethylene glycol, to form a hybridoma cell [Goding, Monoclonal
Antibodies: Principles and Practice, Academic Press, (1986) pp.
59-103]. Immortalized cell lines are usually transformed mammalian
cells, particularly myeloma cells of rodent, bovine and human
origin. Usually, rat or mouse myeloma cell lines are employed. The
hybridoma cells may be cultured in a suitable culture medium that
preferably contains one or more substances that inhibit the growth
or survival of the unfused, immortalized cells. For example, if the
parental cells lack the enzyme hypoxanthine guanine phosphoribosyl
transferase (HGPRT or HPRT), the culture medium for the hybridomas
typically will include hypoxanthine, aminopterin, and thymidine
("HAT medium"), which substances prevent the growth of
HGPRT-deficient cells.
[0232] Preferred immortalized cell lines are those that fuse
efficiently, support stable high level expression of antibody by
the selected antibody-producing cells, and are sensitive to a
medium such as HAT medium. More preferred immortalized cell lines
are murine myeloma lines, which can be obtained, for instance, from
the Salk Institute Cell Distribution Center, San Diego, Calif. and
the American Type Culture Collection, Rockville, Md. Human myeloma
and mouse-human heteromyeloma cell lines also have been described
for the production of human monoclonal antibodies [Kozbor, J.
Immunol., 133:3001 (1984); Brodeur et al., Monoclonal Antibody
Production Techniques and Applications, Marcel Dekker, Inc., New
York, (1987) pp. 51-63].
[0233] The culture medium in which the hybridoma cells are cultured
can then be assayed for the presence of monoclonal antibodies
directed against the polypeptide of the invention or having similar
activity as the polypeptide of the invention. Preferably, the
binding specificity of monoclonal antibodies produced by the
hybridoma cells is determined by immunoprecipitation or by an in
vitro binding assay, such as radioimmunoassay (RIA) or
enzyme-linked immunoabsorbent assay (ELISA). Such techniques and
assays are known in the art. The binding affinity of the monoclonal
antibody can, for example, be determined by the Scatchard analysis
of Munson and Pollard, Anal. Biochem., 107:220 (1980).
[0234] After the desired hybridoma cells are identified, the clones
may be subcloned by limiting dilution procedures and grown by
standard methods [Goding, supra]. Suitable culture media for this
purpose include, for example, Dulbecco's Modified Eagle's Medium
and RPMI-1640 medium. Alternatively, the hybridoma cells may be
grown in vivo as ascites in a mammal.
[0235] The monoclonal antibodies secreted by the subclones may be
isolated or purified from the culture medium or ascites fluid by
conventional immunoglobulin purification procedures such as, for
example, protein A-Sepharose, hydroxyapatite chromatography, gel
electrophoresis, dialysis, or affinity chromatography.
[0236] The monoclonal antibodies may also be made by recombinant
DNA methods, such as those described in U.S. Pat. No. 4,816,567.
DNA encoding the monoclonal antibodies of the invention can be
readily isolated and sequenced using conventional procedures (e.g.,
by using oligonucleotide probes that are capable of binding
specifically to genes encoding the heavy and light chains of murine
antibodies). The hybridoma cells of the invention serve as a
preferred source of such DNA. Once isolated, the DNA may be placed
into expression vectors, which are then transfected into host cells
such as simian COS cells, Chinese hamster ovary (CHO) cells, or
myeloma cells that do not otherwise produce immunoglobulin protein,
to obtain the synthesis of monoclonal antibodies in the recombinant
host cells. The DNA also may be modified, for example, by
substituting the coding sequence for human heavy and light chain
constant domains in place of the homologous murine sequences [U.S.
Pat. No. 4,816,567; Morrison et al., supra] or by covalently
joining to the immunoglobulin coding sequence all or part of the
coding sequence for a non-immunoglobulin polypeptide. Such a
non-immunoglobulin polypeptide can be substituted for the constant
domains of an antibody of the invention, or can be substituted for
the variable domains of one antigen-combining site of an antibody
of the invention to create a chimeric bivalent antibody.
[0237] The antibodies are preferably monovalent antibodies. Methods
for preparing monovalent antibodies are well known in the art. For
example, one method involves recombinant expression of
immunoglobulin light chain and modified heavy chain. The heavy
chain is truncated generally at any point in the Fc region so as to
prevent heavy chain crosslinking. Alternatively, the relevant
cysteine residues are substituted with another amino acid residue
or are deleted so as to prevent crosslinking.
[0238] In vitro methods are also suitable for preparing monovalent
antibodies. Digestion of antibodies to produce fragments thereof,
particularly, Fab fragments, can be accomplished using routine
techniques known in the art.
[0239] c. Human and Humanized Antibodies
[0240] The antibodies of the invention may further comprise
humanized antibodies or human antibodies. Humanized forms of
non-human (e.g., murine) antibodies are chimeric immunoglobulins,
immunoglobulin chains or fragments thereof (such as Fv, Fab, Fab',
F(ab').sub.2 or other antigen-binding subsequences of antibodies)
which contain minimal sequence derived from non-human
immunoglobulin. Humanized antibodies include human immunoglobulins
(recipient antibody) in which residues from a complementary
determining region (CDR) of the recipient are replaced by residues
from a CDR of a non-human species (donor antibody) such as mouse,
rat or rabbit having the desired specificity, affinity and
capacity. In some instances, Fv framework residues of the human
immunoglobulin are replaced by corresponding non-human residues.
Humanized antibodies may also comprise residues which are found
neither in the recipient antibody nor in the imported CDR or
framework sequences. In general, the humanized antibody will
comprise substantially all of at least one, and typically two,
variable domains, in which all or substantially all of the CDR
regions correspond to those of a non-human immunoglobulin and all
or substantially all of the FR regions are those of a human
immunoglobulin consensus sequence. The humanized antibody optimally
also will comprise at least a portion of an immunoglobulin constant
region (Fc), typically that of a human immunoglobulin [Jones et
al., Nature, 321:522-525 (1986); Riechmann et al., Nature,
332:323-329 (1988); and Presta, Curr. Op. Struct. Biol., 2:593-596
(1992)].
[0241] Methods for humanizing non-human antibodies are well known
in the art. Generally, a humanized antibody has one or more amino
acid residues introduced into it from a source which is non-human.
These non-human amino acid residues are often referred to as
"import" residues, which are typically taken from an "import"
variable domain. Humanization can be essentially performed
following the method of Winter and coworkers [Jones et al., Nature,
321:522-525 (1986); Riechmann et al., Nature, 332:323-327 (1988);
Verhoeyen et al., Science, 239:1534-1536 (1988)], by substituting
rodent CDRs or CDR sequences for the corresponding sequences of a
human antibody. Accordingly, such "humanized" antibodies are
chimeric antibodies (U.S. Pat. No. 4,816,567), wherein
substantially less than an intact human variable domain has been
substituted by the corresponding sequence from a non-human species.
In practice, humanized antibodies are typically human antibodies in
which some CDR residues and possibly some FR residues are
substituted by residues from analogous sites in rodent
antibodies.
[0242] Human antibodies can also be produced using various
techniques known in the art, including phage display libraries
[Hoogenboom and Winter, J. Mol. Biol., 227:381 (1991); Marks et
al., J. Mol. Biol., 222:581 (1991)]. The techniques of Cole et al.
and Boerner et al. are also available for the preparation of human
monoclonal antibodies (Cole et al., Monoclonal Antibodies and
Cancer Therapy, Alan R. Liss, p. 77 (1985); Boerner et al., J.
Immunol., 147(1):86-95 (1991); U.S. Pat. No. 5,750,373]. Similarly,
human antibodies can be made by introducing of human immunoglobulin
loci into transgenic animals, e.g., mice in which the endogenous
immunoglobulin genes have been partially or completely inactivated.
Upon challenge, human antibody production is observed, which
closely resembles that seen in humans in all respects, including
gene rearrangement, assembly, and antibody repertoire. This
approach is described, for example, in U.S. Pat. Nos. 5,545,807;
5,545,806; 5,569,825; 5,625,126; 5,633,425; 5,661,016, and in the
following scientific publications: Marks et al., Bio/Technology 10,
779-783 (1992); Lonberg et al., Nature 368 856-859 (1994);
Morrison, Nature 368, 812-13 (1994); Fishwild et al.,
Nature.sub.--Biotechnology 14, 845-51 (1996); Neuberger, Nature
Biotechnology 14, 826 (1996); Lonberg and Huszar, Intern. Rev.
Immunol. 13 65-93 (1995).
[0243] d. Bispecific Antibodies
[0244] Bispecific antibodies are monoclonal, preferably human or
humanized, antibodies that have binding specificities for at least
two different antigens. In the present case, one of the binding
specificities may be for the polypeptide of the invention, the
other one is for any other antigen, and preferably for a
cell-surface protein or receptor or receptor subunit.
[0245] Methods for making bispecific antibodies are known in the
art. Traditionally, the recombinant production of bispecific
antibodies is based on the coexpression of two immunoglobulin
heavy-chain/light-chain pairs, where the two heavy chains have
different specificities (Milstein and Cuello, Nature, 305:537-539
[1983]). Because of the random assortment of immunoglobulin heavy
and light chains, these hybridomas (quadromas) produce a potential
mixture of ten different antibody molecules, of which only one has
the correct bispecific structure. The purification of the correct
molecule is usually accomplished by affinity chromatography steps.
Similar procedures are disclosed in WO 93/08829, published 13 May
1993, and in Traunecker et al., EMBO J., 10:3655-3659 (1991).
[0246] Antibody variable domains with the desired binding
specificities (antibody-antigen combining sites) can be fused to
immunoglobulin constant domain sequences. The fusion preferably is
with an immunoglobulin heavy-chain constant domain, comprising at
least part of the hinge, CH2, and CH3 regions. It is preferred to
have the first heavy-chain constant region (CH1) containing the
site necessary for light-chain binding present in at least one of
the fusions. DNAs encoding the immunoglobulin heavy-chain fusions
and, if desired, the immunoglobulin light chain, are inserted into
separate expression vectors, and are cotransfected into a suitable
host organism. For further details of generating bispecific
antibodies see, for example, Suresh et al., Methods in Enzymology,
121:210 (1986).
[0247] e. Heteroconjugate Antibodies
[0248] Heteroconjugate antibodies are composed of two covalently
joined antibodies. Such antibodies have, for example, been proposed
to target immune system cells to unwanted cells [U.S. Pat. No.
4,676,980], and for treatment of HIV infection [WO 91/00360; WO
92/200373; EP 03089]. It is contemplated that the antibodies may be
prepared in vitro using known methods in synthetic protein
chemistry, including those involving crosslinking agents. For
example, immunotoxins may be constructed using a disulfide exchange
reaction or by forming a thioether bond. Examples of suitable
reagents for this purpose include iminothiolate and
methyl-4-mercaptobutyrimidate and those disclosed, for example, in
U.S. Pat. No. 4,676,980.
[0249] f. Effector Function Engineering
[0250] It may be desirable to modify the antibody of the invention
with respect to effector function, so as to enhance the
effectiveness of the antibody in treating an immune related
disease, for example. For example cysteine residue(s) may be
introduced in the Fc region, thereby allowing interchain disulfide
bond formation in this region. The homodimeric antibody thus
generated may have improved internalization capability and/or
increased complement-mediated cell killing and antibody-dependent
cellular cytotoxicity (ADCC). See Caron et al., J. Exp Med.
176:1191-1195 (1992) and Shopes, B., J. Immunol. 148:2918-2922
(1992). Homodimeric antibodies with enhanced anti-tumor activity
may also be prepared using heterobifunctional cross-linkers as
described in Wolff et al. Cancer Research 53:2560-2565 (1993).
Alternatively, an antibody can be engineered which has dual Fc
regions and may thereby have enhanced complement lysis and ADCC
capabilities. See Stevenson et al., Anti-Cancer Drug Design,
3:219-230 (1989).
[0251] g. Immunoconjugates
[0252] The invention also pertains to immunoconjugates comprising
an antibody conjugated to a cytotoxic agent such as a
chemotherapeutic agent, toxin (e.g. an enzymatically active toxin
of bacterial, fungal, plant or animal origin, or fragments
thereof), or a radioactive isotope (i.e., a radioconjugate).
[0253] Chemotherapeutic agents useful in the gen eration of such
immunoconjugates have been described above. Enzymatically active
toxins and fragments thereof which can be used include diphtheria A
chain, nonbinding active fragments of diphtheria toxin, exotoxin A
chain (from Pseudomonas aeruginosa), ricin A chain, abrin A chain,
modeccin A chain, alpha-sarcin, Aleurites fordii proteins, dianthin
proteins, Phytolaca americana proteins (PAPI, PAPII, and PAP-S),
momordica charantia inhibitor, curcin, crotin, sapaonaria
officinalis inhibitor, gelonin, mitogellin, restrictocin,
phenomycin, enomycin and the tricothecenes. A variety of
radionuclides are available for the production of radioconjugated
antibodies. Examples include .sup.212Bi, .sup.131I, .sup.131In,
.sup.90Y and .sup.186Re.
[0254] Conjugates of the antibody and cytotoxic agent are made
using a variety of bifunctional protein coupling agents such as
N-succinimidyl-3-(2-pyridyldithiol) propionate (SPDP),
iminothiolane (IT), bifunctional derivatives of imidoesters (such
as dimethyl adipimidate HCL), active esters (such as disuccinimidyl
suberate), aldehydes (such as glutareldehyde), bis-azido compounds
(such as bis (p-azidobenzoyl) hexanediamine), bis-diazonium
derivatives (such as bis-(p-diazoniumbenzoyl)-ethylenediamine),
diisocyanates (such as tolyene 2,6-diisocyanate), and bis-active
fluorine compounds (such as 1,5-difluoro-2,4-dinitrobenzene). For
example, a ricin immunotoxin can be prepared as described in
Vitetta et al., Science 238: 1098 (1987). Carbon-14-labeled
1-isothiocyanatobenzyl-3-methyidiethylene triaminepentaacetic acid
(MX-DTPA) is an exemplary chelating agent for conjugation of
radionucleotide to the antibody. See WO94/11026.
[0255] In another embodiment, the antibody may be conjugated to a
"receptor" (such streptavidin) for utilization in tisue
pretargeting wherein the antibody-receptor conjugate is
administered to the patient, followed by removal of unbound
conjugate from the circulation using a clearing agent and then
administration of a "ligand" (e.g. avidin) which is conjugated to a
cytotoxic agent (e.g. a radionucleotide).
[0256] h. Immunoliposomes
[0257] The proteins, antibodies, etc. disclosed herein may also be
formulated as immunoliposomes. Liposomes containing the antibody
are prepared by methods known in the art, such as described in
Epstein et al., Proc. Natl. Acad. Sci. USA, 82:3688 (1985); Hwang
et al., Proc. Natl Acad. Sci. USA, 77:4030 (1980); and U.S. Pat.
Nos. 4,485,045 and 4,544,545. Liposomes with enhanced circulation
time are disclosed in U.S. Pat. No. 5,013,556.
[0258] Particularly useful liposomes can be generated by the
reverse phase evaporation method with a lipid composition
comprising phosphatidylcholine, cholesterol and PEG-derivatized
phosphatidylethanolamine (PEG-PE). Liposomes are extruded through
filters of defined pore size to yield liposomes with the desired
diameter. Fab' fragments of the antibody of the present invention
can be conjugated to the liposomes as described in Martin et
al.,.sub.--J. Biol. Chem. 257: 286-288 (1982) via a disulfide
interchange reaction. A chemotherapeutic agent (such as
doxorubicin) may be optionally contained within the liposome. See
Gabizon et al., J. National Cancer Inst. 81(19)1484 (1989).
[0259] 10. Pharmaceutical Compositions
[0260] The active molecules of the invention, polypeptides and
antibodies, as well as other molecules identified by the screening
assays disclosed above, can be administered for the treatment of
inflammatory diseases, in the form of pharmaceutical
compositions.
[0261] Therapeutic formulations of the active molecule, preferably
a PRO301, PRO362 or PRO245 polypeptide or antibody of the
invention, are prepared for storage by mixing the active molecule
having the desired degree of purity with optional pharmaceutically
acceptable carriers, excipients or stabilizers (Remington's
Pharmaceutical Sciences 16th edition, Osol, A. Ed. [1980]), in the
form of lyophilized formulations or aqueous solutions. Acceptable
carriers, excipients, or stabilizers are nontoxic to recipients at
the dosages and concentrations employed, and include buffers such
as phosphate, citrate, and other organic acids; antioxidants
including ascorbic acid and methionine; preservatives (such as
octadecyidimethylbenzyl ammonium chloride; hexamethonium chloride;
benzalkonium chloride, benzethonium chloride; phenol, butyl or
benzyl alcohol; alkyl parabens such as methyl or propyl paraben;
catechol; resorcinol; cyclohexanol; 3-pentanol; and m-cresol); low
molecular weight (less than about 10 residues) polypeptides;
proteins, such as serum albumin, gelatin, or immunoglobulins;
hydrophilic polymers such as polyvinylpyrrolidone; amino acids such
as glycine, glutamine, asparagine, histidine, arginine, or lysine;
monosaccharides, disaccharides, and other carbohydrates including
glucose, mannose, or dextrins; chelating agents such as EDTA;
sugars such as sucrose, mannitol, trehalose or sorbitol;
salt-forming counter-ions such as sodium; metal complexes (e.g.
Zn-protein complexes); and/or non-ionic surfactants such as
TWEEN.TM., PLURONICS.TM. or polyethylene glycol (PEG).
[0262] Compounds identified by the screening assays of the present
invention can be formulated in an analogous manner, using standard
techniques well known in the art.
[0263] Lipofections or liposomes can also be used to deliver the
polypeptide, antibody, or an antibody fragment, into cells. Where
antibody fragments are used, the smallest inhibitory fragment which
specifically binds to the binding domain of the target protein is
preferred. For example, based upon the variable region sequences of
an antibody, peptide molecules can be designed which retain the
ability to bind the target protein sequence. Such peptides can be
synthesized chemically and/or produced by recombinant DNA
technology (see, e.g. Marasco et al., Proc. Natl. Acad. Sci. USA
90, 7889-7893 [1993]).
[0264] The formulation herein may also contain more than one active
compound as necessary for the particular indication being treated,
preferably those with complementary activities that do not
adversely affect each other. Alternatively, or in addition, the
composition may comprise a cytotoxic agent, cytokine or growth
inhibitory agent. Such molecules are suitably present in
combination in amounts that are effective for the purpose
intended.
[0265] The active molecules may also be entrapped in microcapsules
prepared, for example, by coascervation techniques or by
interfacial polymerization, for example, hydroxymethylcellulose or
gelatin-microcapsules and poly-(methylmethacylate) microcapsules,
respectively, in colloidal drug delivery systems (for example,
liposomes, albumin microspheres, microemulsions, nano-particles and
nanocapsules) or in macroemulsions. Such techniques are disclosed
in Remington's Pharmaceutical Sciences 16th edition, Osol, A. Ed.
(1980).
[0266] The formulations to be used for in vivo administration must
be sterile. This is readily accomplished by filtration through
sterile filtration membranes.
[0267] Sustained-release preparations may be prepared. Suitable
examples of sustained-release preparations include semipermeable
matrices of solid hydrophobic polymers containing the antibody,
which matrices are in the form of shaped articles, e.g. films, or
microcapsules. Examples of sustained-release matrices include
polyesters, hydrogels (for example,
poly(2-hydroxyethyl-methacrylate), or poly(vinylalcohol)),
polylactides (U.S. Pat. No. 3,773,919), copolymers of L-glutamic
acid and .gamma. ethyl-L-glutamate, non-degradable ethylene-vinyl
acetate, degradable lactic acid-glycolic acid copolymers such as
the LUPRON DEPOT .TM. (injectable microspheres composed of lactic
acid-glycolic acid copolymer and leuprolide acetate), and
poly-D-(-)-3-hydroxybutyric acid. While polymers such as
ethylene-vinyl acetate and lactic acid-glycolic acid enable release
of molecules for over 100 days, certain hydrogels release proteins
for shorter time periods. When encapsulated antibodies remain in
the body for a long time, they may denature or aggregate as a
result of exposure to moisture at 37 C, resulting in a loss of
biological activity and possible changes in immunogenicity.
Rational strategies can be devised for stabilization depending on
the mechanism involved. For example, if the aggregation mechanism
is discovered to be intermolecular S--S bond formation through
thio-disulfide interchange, stabilization may be achieved by
modifying sulfhydryl residues, lyophilizing from acidic solutions,
controlling moisture content, using appropriate additives, and
developing specific polymer matrix compositions.
[0268] 11. Methods of Treatment
[0269] It is contemplated that the polypeptides, antibodies and
other active compounds of the present invention may be used to
treat various inflammatory diseases and conditions, such as T cell
mediated diseases, including those characterized by infiltration of
leucocyte cells into a tissue, stimulation of T-cell proliferation,
inhibition of T-cell proliferation, increased or decreased vascular
permeability or the inhibition thereof.
[0270] The compounds of the invention (e.g., PRO301, PRO362,
PRO245) encode new members of a family of proteins characterized by
homology to A33 antigen. The proinflammatory nature of the
compounds of the invention is indicated in the in vitro assays
below.
[0271] The proteins encoded by the DNA40628, DNA45416 and DNA35638
compounds of the invention [(SEQ ID NO: 1, SEQ ID NO: 2 and SEQ ID
NO: 9), respectively], share homology with identity with junctional
adhesion molecule (JAM), Martin-Padura et al., J. Cell Biol. 1998
142(1): 117-27. The most substantial identity is shared by the
PRO301 protein encoded by DNA40628 (SEQ ID NO: 1) at 67%. JAM is
involved in the recruitment of monocytes in response to MCP-1,
MCP-3 and LPS in vivo. Antibodies to JAM block monocyte
transmigration in vivo. JAM is localized to the murine epithelia
and endothelia as a junctional adhesion molecule for monocyte
transmigration. Other leukocytes may also use JAM, but no
information supports this notion. JAM is elevated in the colon of
mice with colitis and likely plays a role in the recruitment of
monocytes or leukocytes into the colonic lesion.
[0272] Exemplary conditions or disorders to be treated with the
polypeptides, antibodies and other compounds of the invention,
include, but are not limited to inflammatory bowel disease (i.e,
ulcerative colitis, Crohn's disease), systemic lupus erythematosis,
rheumatoid arthritis, juvenile chronic arthritis,
spondyloarthropathies, systemic sclerosis (scleroderma), idiopathic
inflammatory myopathies (dermatomyositis, polymyositis), Sjogren's
syndrome, systemic vasculitis, sarcoidosis, autoimmune hemolytic
anemia (immune pancytopenia, paroxysmal nocturnal hemoglobinuria),
autoimmune thrombocytopenia (idiopathic thrombocytopenic purpura,
immune-mediated thrombocytopenia), thyroiditis (Grave's disease,
Hashimoto's thyroiditis, juvenile lymphocytic thyroiditis, atrophic
thyroiditis), diabetes mellitus, immune-mediated renal disease
(glomerulonephritis, tubulointerstitial nephritis), demyelinating
diseases of the central and peripheral nervous systems such as
multiple sclerosis, idiopathic demyelinating polyneuropathy or
Guillain-Barre syndrome, and chronic inflammatory demyelinating
polyneuropathy, hepatobiliary diseases such as infectious hepatitis
(hepatitis A, B, C, D, E and other non-hepatotropic viruses),
autoimmune chronic active hepatitis, primary biliary cirrhosis,
granulomatous hepatitis, and sclerosing cholangitis, inflammatory
and fibrotic lung diseases such as cystic fibrosis,
gluten-sensitive enteropathy, and Whipple's disease, autoimmune or
immune-mediated skin diseases including bullous skin diseases,
erythema multiforme and contact dermatitis, psoriasis, allergic
diseases such as asthma, allergic rhinitis, atopic dermatitis, food
hypersensitivity and urticaria, immunologic diseases of the lung
such as eosinophilic pneumonias, idiopathic pulmonary fibrosis and
hypersensitivity pneumonitis, transplantation associated diseases
including graft rejection and graft-versus-host-disease.
[0273] In systemic lupus erythematosus, the central mediator of
disease is the production of auto-reactive antibodies to self
proteins/tissues and the subsequent generation of immune-mediated
inflammation. Antibodies either directly or indirectly mediate
tissue injury. Though T lymphocytes have not been shown to be
directly involved in tissue damage, T lymphocytes are required for
the development of auto-reactive antibodies. The genesis of the
disease is thus T lymphocyte dependent. Multiple organs and systems
are affected clinically including kidney, lung, musculoskeletal
system, mucocutaneous, eye, central nervous system, cardiovascular
system, gastrointestinal tract, bone marrow and blood.
[0274] Rheumatoid arthritis (RA) is a chronic systemic autoimmune
inflammatory disease that mainly involves the synovial membrane of
multiple joints with resultant injury to the articular cartilage.
The pathogenesis is T lymphocyte dependent and is associated with
the production of rheumatoid factors, auto-antibodies directed
against self IgG, with the resultant formation of immune complexes
that attain high levels in joint fluid and blood. These complexes
in the joint may induce the marked infiltrate of lymphocytes and
monocytes into the synovium and subsequent marked synovial changes;
the joint space/fluid if infiltrated by similar cells with the
addition of numerous neutrophils. Tissues affected are primarily
the joints, often in symmetrical pattern. However, extra-articular
disease also occurs in two major forms. One form is the development
of extra-articular lesions with ongoing progressive joint disease
and typical lesions of pulmonary fibrosis, vasculitis, and
cutaneous ulcers. The second form of extra-articular disease is the
so called Felty's syndrome which occurs late in the RA disease
course, sometimes after joint disease has become quiescent, and
involves the presence of neutropenia, thrombocytopenia and
splenomegaly. This can be accompanied by vasculitis in multiple
organs with formations of infarcts, skin ulcers and gangrene.
Patients often also develop rheumatoid nodules in the subcutis
tissue overlying affected joints; the nodules late stage have
necrotic centers surrounded by a mixed inflammatory cell
infiltrate. Other manifestations which can occur in RA include:
pericarditis, pleuritis, coronary arteritis, intestitial
pneumonitis with pulmonary fibrosis, keratoconjunctivitis sicca,
and rhematoid nodules.
[0275] Juvenile chronic arthritis is a chronic idiopathic
inflammatory disease which begins often at less than 16 years of
age. Its phenotype has some similarities to RA; some patients which
are rhematoid factor positive are classified as juvenile rheumatoid
arthritis. The disease is sub-classified into three major
categories: pauciarticular, polyarticular, and systemic. The
arthritis can be severe and is typically destructive and leads to
joint ankylosis and retarded growth. Other manifestations can
include chronic anterior uveitis and systemic amyloidosis.
[0276] Spondyloarthropathies are a group of disorders with some
common clinical features and the common association with the
expression of HLA-B27 gene product. The disorders include:
ankylosing sponylitis, Reiter's syndrome (reactive arthritis),
arthritis associated with inflammatory bowel disease, spondylitis
associated with psoriasis, juvenile onset spondyloarthropathy and
undifferentiated spondyloarthropathy. Distinguishing features
include sacroileitis with or without spondylitis; inflammatory
asymmetric arthritis; association with HLA-B27 (a serologically
defined allele of the HLA-B locus of class I MHC); ocular
inflammation, and absence of autoantibodies associated with other
rheumatoid disease. The cell most implicated as key to induction of
the disease is the CD8+ T lymphocyte, a cell which targets antigen
presented by class I MHC molecules. CD8+ T cells may react against
the class I MHC allele HLA-B27 as if it were a foreign peptide
expressed by MHC class I molecules. It has been hypothesized that
an epitope of HLA-B27 may mimic a bacterial or other microbial
antigenic epitope and thus induce a CD8+ T cells response.
[0277] Systemic sclerosis (scleroderma) has an unknown etiology. A
hallmark of the disease is induration of the skin; likely this is
induced by an active inflammatory process. Scleroderma can be
localized or systemic; vascular lesions are common and endothelial
cell injury in the microvasculature is an early and important event
in the development of systemic sclerosis; the vascular injury may
be immune mediated. An immunologic basis is implied by the presence
of mononuclear cell infiltrates in the cutaneous lesions and the
presence of anti-nuclear antibodies in many patients. ICAM-1 is
often upregulated on the cell surface of fibroblasts in skin
lesions suggesting that T cell interaction with these cells may
have a role in the pathogenesis of the disease. Other organs
involved include: the gastrointestinal tract: smooth muscle atrophy
and fibrosis resulting in abnormal peristalsis/motility; kidney:
concentric subendothelial intimal proliferation affecting small
arcuate and interlobular arteries with resultant reduced renal
cortical blood flow, results in proteinuria, azotemia and
hypertension; skeletal muscle: atrophy, interstitial fibrosis;
inflammation; lung: interstitial pneumonitis and interstitial
fibrosis; and heart: contraction band necrosis,
scarring/fibrosis.
[0278] Idiopathic inflammatory myopathies including
dermatomyositis, polymyositis and others are disorders of chronic
muscle inflammation of unknown etiology resulting in muscle
weakness. Muscle injury/inflammation is often symmetric and
progressive. Autoantibodies are associated with most forms. These
myositis-specific autoantibodies are directed against and inhibit
the function of components, proteins and RNA's, involved in protein
synthesis.
[0279] Sjogren's syndrome is due to immune-mediated inflammation
and subsequent functional destruction of the tear glands and
salivary glands. The disease can be associated with or accompanied
by inflammatory connective tissue diseases. The disease is
associated with autoantibody production against Ro and La antigens,
both of which are small RNA-protein complexes. Lesions result in
keratoconjunctivitis sicca, xerostomia, with other manifestations
or associations including bilary cirrhosis, peripheral or sensory
neuropathy, and palpable purpura.
[0280] Systemic vasculitis are diseases in which the primary lesion
is inflammation and subsequent damage to blood vessels which
results in ischemia/necrosis/degeneration to tissues supplied by
the affected vessels and eventual end-organ dysfunction in some
cases. Vasculitides can also occur as a secondary lesion or
sequelae to other immune-inflammatory mediated diseases such as
rheumatoid arthritis, systemic sclerosis, etc., particularly in
diseases also associated with the formation of immune complexes.
Diseases in the primary systemic vasculitis group include: systemic
necrotizing vasculitis: polyarteritis nodosa, allergic angiitis and
granulomatosis, polyangiitis; Wegener's granulomatosis;
lymphomatoid granulomatosis; and giant cell arteritis.
Miscellaneous vasculitides include: mucocutaneous lymph node
syndrome (MLNS or Kawasaki's disease), isolated CNS vasculitis,
Behet's disease, thromboangiitis obliterans (Buerger's disease) and
cutaneous necrotizing venulitis. The pathogenic mechanism of most
of the types of vasculitis listed is believed to be primarily due
to the deposition of immunoglobulin complexes in the vessel wall
and subsequent induction of an inflammatory response either via
ADCC, complement activation, or both.
[0281] Sarcoidosis is a condition of unknown etiology which is
characterized by the presence of epithelioid granulomas in nearly
any tissue in the body; involvement of the lung is most common. The
pathogenesis involves the persistence of activated macrophages and
lymphoid cells at sites of the disease with subsequent chronic
sequelae resultant from the release of locally and systemically
active products released by these cell types.
[0282] Autoimmune hemolytic anemia including autoimmune hemolytic
anemia, immune pancytopenia, and paroxysmal noctural hemoglobinuria
is a result of production of antibodies that react with antigens
expressed on the surface of red blood cells (and in some cases
other blood cells including platelets as well) and is a reflection
of the removal of those antibody coated cells via complement
mediated lysis and/or ADCC/Fc-receptor-mediated mechanisms.
[0283] In autoimmune thrombocytopenia including thrombocytopenic
purpura, and immune-mediated thrombocytopenia in other clinical
settings, platelet destruction/removal occurs as a result of either
antibody or complement attaching to platelets and subsequent
removal by complement lysis, ADCC or FC-receptor mediated
mechanisms.
[0284] Thyroiditis including Grave's disease, Hashimoto's
thyroiditis, juvenile lymphocytic thyroiditis, and atrophic
thyroiditis, are the result of an autoimmune response against
thyroid antigens with production of antibodies that react with
proteins present in and often specific for the thyroid gland.
Experimental models exist including spontaneous models: rats (BUF
and BB rats) and chickens (obese chicken strain); inducible models:
immunization of animals with either thyroglobulin, thyroid
microsomal antigen (thyroid peroxidase).
[0285] Type I diabetes mellitus or insulin-dependent diabetes is
the autoimmune destruction of pancreatic islet .E-backward. cells;
this destruction is mediated by auto-antibodies and auto-reactive T
cells. Antibodies to insulin or the insulin receptor can also
produce the phenotype of insulin-non-responsiveness.
[0286] Immune mediated renal diseases, including glomerulonephritis
and tubulointerstitial nephritis, are the result of antibody or T
lymphocyte mediated injury to renal tissue either directly as a
result of the production of autoreactive antibodies or T cells
against renal antigens or indirectly as a result of the deposition
of antibodies and/or immune complexes in the kidney that are
reactive against other, non-renal antigens. Thus other
immune-mediated diseases that result in the formation of
immune-complexes can also induce immune mediated renal disease as
an indirect sequelae. Both direct and indirect immune mechanisms
result in inflammatory response that produces/induces lesion
development in renal tissues with resultant organ function
impairment and in some cases progression to renal failure. Both
humoral and cellular immune mechanisms can be involved in the
pathogenesis of lesions.
[0287] Demyelinating diseases of the central and peripheral nervous
systems, including Multiple Sclerosis; idiopathic demyelinating
polyneuropathy or Guillain-Barr syndrome; and Chronic Inflammatory
Demyelinating Polyneuropathy, are believed to have an autoimmune
basis and result in nerve demyelination as a result of damage
caused to oligodendrocytes or to myelin directly. In MS there is
evidence to suggest that disease induction and progression is
dependent on T lymphocytes. Multiple Sclerosis is a demyelinating
disease that is T lymphocyte-dependent and has either a
relapsing-remitting course or a chronic progressive course. The
etiology is unknown; however, viral infections, genetic
predisposition, environment, and autoimmunity all contribute.
Lesions contain infiltrates of predominantly T lymphocyte mediated,
microglial cells and infiltrating macrophages; CD4+T lymphocytes
are the predominant cell type at lesions. The mechanism of
oligodendrocyte cell death and subsequent demyelination is not
known but is likely T lymphocyte driven.
[0288] Inflammatory and Fibrotic Lung Disease, including
eosinophilic pneumonias, idiopathic pulmonary fibrosis and
hypersensitivity pneumonitis may involve a disregulated
immune-inflammatory response. Inhibition of that response would be
of therapeutic benefit.
[0289] Autoimmune or Immune-mediated Skin Disease including Bullous
Skin Diseases, Erythema Multiforme, and Contact Dermatitis are
mediated by auto-antibodies, the genesis of which is T
lymphocyte-dependent.
[0290] Psoriasis is a T lymphocyte-mediated inflammatory disease.
Lesions contain infiltrates of T lymphocytes, macrophages and
antigen processing cells, and some neutrophils.
[0291] Allergic diseases, including asthma; allergic rhinitis;
atopic dermatitis; food hypersensitivity; and urticaria are T
lymphocyte dependent. These diseases are predominantly mediated by
T lymphocyte induced inflammation, IgE mediated-inflammation or a
combination of both.
[0292] Transplantation associated diseases, including Graft
rejection and Graft-Versus-Host-Disease (GVHD) are T
lymphocyte-dependent; inhibition of T lymphocyte function is
ameliorative.
[0293] Other diseases in which intervention of the immune and/or
inflammatory response have benefit are Infectious disease including
but not limited to viral infection (including but not limited to
AIDS, hepatitis A, B, C, D, E) bacterial infection, fungal
infections, and protozoal and parasitic infections (molecules (or
derivatives/agonists) which stimulate the MLR can be utilized
therapeutically to enhance the immune response to infectious
agents), diseases of immunodeficiency
(molecules/derivatives/agonists) which stimulate the MLR can be
utilized therapeutically to enhance the immune response for
conditions of inherited, acquired, infectious induced (as in HIV
infection), or iatrogenic (i.e. as from chemotherapy)
immunodeficiency), and neoplasia.
[0294] It has been demonstrated that some human cancer patients
develop an antibody and/or T lymphocyte response to antigens on
neoplastic cells. It has also been shown in animal models of
neoplasia that enhancement of the immune response can result in
rejection or regression of that particular neoplasm. Molecules that
enhance the T lymphocyte response in the MLR have utility in vivo
in enhancing the immune response against neoplasia. Molecules which
enhance the T lymphocyte proliferative response in the MLR (or
small molecule agonists or antibodies that affected the same
receptor in an agonistic fashion) can be used therapeutically to
treat cancer. Molecules that inhibit the lymphocyte response in the
MLR also function in vivo during neoplasia to suppress the immune
response to a neoplasm; such molecules can either be expressed by
the neoplastic cells themselves or their expression can be induced
by the neoplasm in other cells. Antagonism of such inhibitory
molecules (either with antibody, small molecule antagonists or
other means) enhances immune-mediated tumor rejection.
[0295] Additionally, inhibition of molecules with proinflammatory
properties may have therapeutic benefit in reperfusion injury;
stroke; myocardial infarction; atherosclerosis; acute lung injury;
hemorrhagic shock; burn; sepsis/septic shock; acute tubular
necrosis; endometriosis; degenerative joint disease and
pancreatis.
[0296] The PRO301, 362 and PRO245 compounds of the present
invention, e.g. polypeptides or antibodies, are administered to a
mammal, preferably a human, in accord with known methods, such as
intravenous administration as a bolus or by continuous infusion
over a period of time, by intramuscular, intraperitoneal,
intracerobrospinal, subcutaneous, intra-articular, intrasynovial,
intrathecal, oral, topical, or inhalation (intranasal,
intrapulmonary) routes. Intravenous or inhaled administration of
polypeptides and antibodies is preferred.
[0297] In immunoadjuvant therapy, other therapeutic regimens, such
administration of an anti-cancer agent, may be combined with the
administration of the proteins, antibodies or compounds of the
instant invention. For example, the patient to be treated with the
immunoadjuvants of the invention may also receive an anti-cancer
agent (chemotherapeutic agent) or radiation therapy. Preparation
and dosing schedules for such chemotherapeutic agents may be used
according to manufacturers' instructions or as determined
empirically by the skilled practitioner. Preparation and dosing
schedules for such chemotherapy are also described in Chemotherapy
Service Ed., M. C. Perry, Williams & Wilkins, Baltimore, Md.
(1992). The chemotherapeutic agent may precede, or follow
administration of the immunoadjuvant or may be given simultaneously
therewith. Additionally, an anti-oestrogen compound such as
tamoxifen or an anti-progesterone such as onapristone (see, EP
616812) may be given in dosages known for such molecules.
[0298] It may be desirable to also administer antibodies against
other immune disease associated or tumor associated antigens, such
as antibodies which bind to CD20, CD11a, CD18, ErbB2, EGFR, ErbB3,
ErbB4, or vascular endothelial factor (VEGF). Alternatively, or in
addition, two or more antibodies binding the same or two or more
different antigens disclosed herein may be coadministered to the
patient. Sometimes, it may be beneficial to also administer one or
more cytokines to the patient. In one embodiment, the polypeptides
of the invention are coadministered with a growth inhibitory agent.
For example, the growth inhibitory agent may be administered first,
followed by a polypeptide of the invention. However, simultaneous
administration or administration first is also contemplated.
Suitable dosages for the growth inhibitory agent are those
presently used and may be lowered due to the combined action
(synergy) of the growth inhibitory agent and the polypeptide of the
invention.
[0299] For the treatment or reduction in the severity of immune
related disease, the appropriate dosage of an a compound of the
invention will depend on the type of disease to be treated, as
defined above, the severity and course of the disease, whether the
agent is administered for preventive or therapeutic purposes,
previous therapy, the patient's clinical history and response to
the compound, and the discretion of the attending physician. The
compound is suitably administered to the patient at one time or
over a series of treatments. Preferably, it is desireable to
determine the dose-response curve and the pharmaceutical
composition of the invention first in vitro, and then in useful
animal models prior to testing in humans.
[0300] For example, depending on the type and severity of the
disease, about 1 .mu.g/kg to 15 mg/kg (e.g. 0.1-20 mg/kg) of
polypeptide or antibody is an initial candidate dosage for
administration to the patient, whether, for example, by one or more
separate administrations, or by continuous infusion. A typical
daily dosage might range from about 1 ug/kg to 100 mg/kg or more,
depending on the factors mentioned above. For repeated
administrations over several days or longer, depending on the
condition, the treatment is sustained until a desired suppression
of disease symptoms occurs. However, other dosage regimens may be
useful. The progress of this therapy is easily monitored by
conventional techniques and assays.
[0301] 12. Articles of Manufacture
[0302] In another embodiment of the invention, an article of
manufacture containing materials useful for the diagnosis or
treatment of the disorders described above is provided. The article
of manufacture comprises a container and a label. Suitable
containers include, for example, bottles, vials, syringes, and test
tubes. The containers may be formed from a variety of materials
such as glass or plastic. The container holds a composition which
is effective for diagnosing or treating the condition and may have
a sterile access port (for example the container may be an
intravenous solution bag or a vial having a stopper pierceable by a
hypodermic injection needle). The active agent in the composition
is usually a polypeptide or an antibody of the invention. The label
on, or associated with, the container indicates that the
composition is used for diagnosing or treating the condition of
choice. The article of manufacture may further comprise a second
container comprising a pharmaceutically-acceptable buffer, such as
phosphate-buffered saline, Ringer's solution and dextrose solution.
It may further include other materials desirable from a commercial
and user standpoint, including other buffers, diluents, filters,
needles, syringes, and package inserts with instructions for
use.
[0303] 13. Diagnosis and Prognosis of Immune Related Disease
[0304] Cell surface proteins, such as proteins which are
overexpressed in certain immune related diseases, are excellent
targets for drug candidates or disease treatment. The same proteins
along with secreted proteins encoded by the genes amplified in
immune related disease states find additional use in the diagnosis
and prognosis of these diseases. For example, antibodies directed
against the protein products of genes amplified in multiple
sclerosis, rheumatoid arthritis, or another immune related disease,
can be used as diagnostics or prognostics.
[0305] For example, antibodies, including antibody fragments, can
be used to qualitatively or quantitatively detect the expression of
proteins encoded by amplified or overexpressed genes ("marker gene
products"). The antibody preferably is equipped with a detectable,
e.g. fluorescent label, and binding can be monitored by light
microscopy, flow cytometry, fluorimetry, or other techniques known
in the art. These techniques are particularly suitable, if the
overexpressed gene encodes a cell surface protein Such binding
assays are performed essentially as decribed above.
[0306] In situ detection of antibody binding to the marker gene
products can be performed, for example, by immunofluorescence or
immunoelectron microscopy. For this purpose, a histological
specimen is removed from the patient, and a labeled antibody is
applied to it, preferably by overlaying the antibody on a
biological sample. This procedure also allows for determining the
distribution of the marker gene product in the tissue examined. It
will be apparent for those skilled in the art that a wide variety
of histological methods are readily available for in situ
detection.
[0307] The following examples are offered for illustrative purposes
only, and are not intended to limit the scope of the present
invention in any way.
[0308] All patent and literature references cited in the present
specification are hereby incorporated by reference in their
entirety.
EXAMPLES
[0309] Commercially available reagents referred to in the examples
were used according to manufacturer's instructions unless otherwise
indicated. The source of those cells identified in the following
examples, and throughout the specification, by ATCC accession
numbers is the American Type Culture Collection, Rockville, Md.
Example 1
Isolation of cDNA clones Encoding Human PRO301
[0310] The extracellular domain (ECD) sequences (including the
secretion signal sequence, if any) from about 950 known secreted
proteins from the Swiss-Prot public database were used to search
EST databases. The EST databases included public EST databases
(e.g., GenBank), a proprietary EST database (LIFESEQ.RTM., Incyte
Pharmaceuticals, Palo Alto, Calif.). The search was performed using
the computer program BLAST or BLAST2 [Altschul et al., Methods in
Enzymology, 266:460-480 (1996); as a comparison of the ECD protein
sequences to a 6 frame translation of the EST sequences. Those
comparisons resulting in a BLAST score of 70 (or in some cases, 90)
or greater that did not encode known proteins were clustered and
assembled into consensus DNA sequences with the program "phrap"
(Phil Green, University of Washington, Seattle, Wash.
[0311] A consensus DNA sequence encoding DNA35936 was assembled
using phrap. In some cases, the consensus DNA sequence was extended
using repeated cycles of blast and phrap to extend the consensus
sequence as far as possible using the three sources of EST
sequences listed above.
[0312] Based on this consensus sequence, oligonucleotides were
synthesized: 1) to identify by PCR a cDNA library that contained
the sequence of interest, and 2) for use as probes to isolate a
clone of the full-length coding sequence. Forward and reverse PCR
primers (notated as *.f and *.r, respectively) may range from 20 to
30 nucleotides (typically about 24), and are designed to give a PCR
product of 100-1000 bp in length. The probe sequences (notated as
*.p) are typically 40-55 bp (typically about 50) in length. In some
cases, additional oligonucleotides are synthesized when the
consensus sequence is greater than 1-1.5 kbp. In order to screen
several libraries for a source of a full-length clone, DNA from the
libraries was screened by PCR amplification, as per Ausubel et al.,
Current Protocols in Molecular Biology, with the PCR primer pair. A
positive library was then used to isolate clones encoding the gene
of interest by the in vivo cloning procedure suing the probe
oligonucleotide and one of the PCR primers.
[0313] In order to screen several libraries for a source of a
full-length clone, DNA from the libraries was screened by PCR
amplification with the PCR primer pair identified above. A positive
library was then used to isolate clones encoding the PRO301 gene
using the probe oligonucleotide and one of the PCR primers.
[0314] RNA for construction of the cDNA libraries was isolated from
human fetal kidney. The cDNA libraries used to isolated the cDNA
clones were constructed by standard methods using commercially
available reagents (e.g., Invitrogen, San Diego, Calif.; Clontech,
etc.) The cDNA was primed with oligo dT containing a NotI site,
linked with blunt to SalI hemikinased adaptors, cleaved with NotI,
sized appropriately by gel electrophoresis, and cloned in a defined
orientation into a suitable cloning vector (such as pRKB or pRKD;
pRK5B is a precursor of pRK5D that does not contain the SfiI site;
see, Holmes et al., Science, 253:1278-1280 (1991)) in the unique
XhoI and NotI sites.
[0315] A cDNA clone was sequenced in its entirety. The full length
nucleotide sequence of native sequence DNA40628 is shown in FIG. 5
(SEQ ID NO: 11). Clone DNA40628 contains a single open reading
frame with an apparent translational initiation site at nucleotide
positions 52-54 (FIG. 5; SEQ ID NO: 11). The predicted polypetide
precursor is 299 amino acids long with a predicted molecular weight
of 32583 daltons and pI of 8.29. Clone DNA40628 has been deposited
with ATCC and is assigned ATCC deposit No. 209432.
[0316] Based on a BLAST and FastA sequence alignment analysis of
the full-length sequence, PRO301 encoded by DNA40628 shows amino
acid sequence identity to A33 antigen precursor (30%) and coxsackic
and adenovirus receptor protein (29%).
[0317] The oligonucleotide sequences used in the above procedure
were the following: TABLE-US-00001 OL12162 (35936.f1) (SEQ ID
NO:12) TCGGGGAGCTGTGTTCTGTTTCCC OL12163 (35936.p1) (SEQ ID NO:13)
TGATCGCGATGGGGACAAAGGCGCAAGCTCGAGAGGAAACTGTTGTGCCT OL12164
(35936.f2) (SEQ ID NO:14) AGACGTGGTTCAAAGATGGG OL12165 (35936.r1)
(SEQ ID NO:15) TAGGAAGAGTTGCTGAAGGCACGG OL12166 (35936.f3) (SEQ ID
NO:16) TTGCCTTACTCAGGTGCTAC OL12167 (35936.r2) (SEQ ID NO:17)
ACTCAGCAGTGGTAGGAAAG
Example 2
Isolation of cDNA Clones Encoding Human PRO362
[0318] The extracellular domain (ECD) sequences (including the
secretion signal, if any) of about 950 known secreted proteins from
the Swiss-Prot public protein database were used to search
expressed sequences tag (EST) databases. The EST databases included
public EST databases (e.g., GenBank) and a proprietary EST DNA
database (LIFESEQ.RTM., Incyte Pharmaceuticals, Palo Alto, Calif.).
The search was performed using the computer program BLAST or
BLAST-2 (e.g., Altshul et al., Methods in Enzymology 266: 460-480
(1996)) as a comparison of the ECD protein sequences to a 6 frame
translation of the EST sequence. Those comparisons resulting in a
BLAST score 70 (or in some cases 90) or greater that did not encode
known proteins were clustered and assembled into consensus DNA
sequences with the program "phrap" (Phil Green, University of
Washington, Seattle, Wash.
[0319] A consensus DNA sequence was assembled relative to other EST
sequences using phrap. This consensus sequence is herein designated
DNA42257 (SEQ ID NO: 5) (see FIG. 4C). Based on the DNA42257 (SEQ
ID NO: 5) consensus sequence shown in FIG. 4C, oligonucleotides
were sythesized: 1) to identify by PCR a cDNA library that
contained the sequence of interest, and 2) for use as probes to
isolate a clone of the full-length coding sequence for PRO362.
Forward and reverse PCR primers generally range from 20 to 30
mucleotides and are often designed to give a PCR product of about
100-1000 bp in length. The probe sequences are typically 40-55 bp
in length. In some cases, additional oligonucleotides are
synthesized when the consensus sequence is greater than about 1-1.5
kbp. In order to screen several libraries for a full-length clone,
DNA from the libraries was screened by PCR amplification, as per
Ausubel et al., Current Protocols in Molecular Biology, with the
PCR primer pair. A positive library was then used to isolate clones
encoding the gene of interest using the probe oligonucleotide and
one of the primer pairs.
[0320] PCR primers (forward and reverse) were synthesized:
TABLE-US-00002 forward PCR primer 1 (42257.f1) (SEQ ID NO:18)
5'-TATCCCTCCAATTGAGCACCCTGG-3' forward PCR primer 2 (42257.f2) (SEQ
ID NO:19) 5'-GTCGGAAGACATCCCAACAAG-3' reverse PCR primer 1
(42257.r1) (SEQ ID NO:20) 5'-CTTCACAATGTCGCTGTGCTGCTC-3' reverse
PCR primer 2 (42257.r2 (SEQ ID NO:21)
5'-AGCCAAATCCAGCAGCTGGCTTAC-3'
[0321] Additionally, a synthetic oligonucleotide hybridization
probe was constructed from the consenus DNA42257 sequence which had
the following nucleotide sequence:
[0322] Hybridization probe (42257.p1) TABLE-US-00003 (SEQ ID NO:22)
5'-TGGATGACCGGAGCCACTACACGTGTGAAGTCACCTGGCAGACTCCT GAT-3'.
[0323] In order to screen several libraries for a source of a
full-length clone, DNA from the libraries was screened by PCR
amplification with the PCR primer pairs identified above. A
positive library was then used to isolate clones encoding the
PRO362 gene using the probe oligonucleotide and one of the PCR
primers.
[0324] RNA for construction of the cDNA libraries was isolated from
human fetal brain tissue (LIB153). The cDNA libraries used to
isolate the cDNA clones were constructed by standard methods using
commercially available reagents such as those from Invitrogen, San
Diego, Calif. The cDNA was primed with oligo dT containing a NotI
site linked with blunt to SalI hemikinased adaptors, cleaved with
NotI, sized appropriately be gel electrophoresis, and cloned in a
defined orientation into a suitable cloning vector (such as pRKB or
pRKD; pRK5B is a precursor of pRK5D that does not contain the SfiI
site; see Holmes et al., Science 253: 1278-1280 (1991)) in the
unique XhoI and NotI sites.
[0325] DNA sequencing of the clones isolated as described gave the
full-length DNA sequence for an isolated PRO362 [herein designated
as UNQ317 (DNA45416-1251)(SEQ ID NO: 7).
[0326] The entire nucleotide sequence of UNQ317 (DNA45416-1251) is
shown in FIG. 6 (SEQ ID NO: 7). Clone UNQ367 (DNA45416-125 1) (SEQ
ID NO: 7) contains a single open reading frame with an apparent
translational initiation site at nucleotide positions 1082-1084
(FIG. 6, SEQ ID NO: 7). The predicted polypeptide precursor is 321
amino acids long (FIG. 3, SEQ ID NO: 2). The full-length PRO362
protein shown if FIG. 3 has an estimated molecular weight of about
35,544 daltons and a pI of about 8:51. Analysis of the full-length
PRO362 polypeptide as shown in FIG. 3 (SEQ ID NO: 2) evidences the
presence of a glycosaminoglycan attachment site at about amino acid
149 to about amino acid 152 and a transmembrane domain from about
amino acid 276 to about amino acid 306. Clone UNQ317
(DNA45416-1251) has been deposited with ATCC desposit No.:
209620.
Example 3
Isolation of cDNA Clones Encoding Human PRO245
[0327] The extracellular domain (ECD) sequences (including the
secretion signal, if any) of about 950 known secreted proteins from
the Swiss-Prot public protein database were used to search
expressed sequences tag (EST) databases. The EST databases included
public EST databases (e.g., GenBank) and a proprietary EST DNA
database (LIFESEQ.RTM., Incyte Pharmaceuticals, Palo Alto, Calif.).
The search was performed using the computer program BLAST or
BLAST-2 (e.g., Altshul et al., Methods in Enzymology 266: 460-480
(1996)) as a comparison of the ECD protein sequences to a 6 frame
translation of the EST sequence. Those comparisons resulting in a
BLAST score 70 (or in some cases 90) or greater that did not encode
known proteins were clustered and assembled into consensus DNA
sequences with the program "phrap" (Phil Green, University of
Washington, Seattle, Wash.
[0328] A consensus DNA sequence was assembled relative to other EST
sequences, wherein the consensus sequence is herein designated
DNA30954 (SEQ ID NO: 27). Based on the DNA30954 consensus sequence,
oligonucleotides were synthesized to identify by PCR a cDNA library
that contained the sequence of interest and for use as probes to
isolate a clone of the full-length coding sequence for PRO245.
[0329] A pair of PCR primers (forward and reverse) were
synthesized: TABLE-US-00004 forward PCR primer (SEQ ID NO:28)
5'-ATCGTTGTGAAGTTAGTGCCCC-3' reverse PCR primer (SEQ ID NO:29)
5'-ACCTGCGATATCCAACAGAATTG-3'
[0330] Forward and reverse PCR primers generally range from 20 to
30 mucleotides and are often designed to give a PCR product of
about 100-1000 bp in length. The probe sequences are typically
40-55 bp in length. In some cases, additional oligonucleotides are
synthesized when the consensus sequence is greater than about 1-1.5
kbp. In order to screen several libraries for a full-length clone,
DNA from the libraries was screened by PCR amplification, as per
Ausubel et al., Current Protocols in Molecular Biology, with the
PCR primer pair.
[0331] Additionally, a synthetic oligonucleotide hybridization
probes was constructed from the consensus DNA30954 sequences which
had the following nucleotide sequence:
[0332] hybridization probe: TABLE-US-00005 (SEQ ID NO:30)
5'-GGAAGAGGATACAGTCACTCTGGAAGTATTAGTGGCTCCAGCAGTT CC-3'
[0333] In order to screen several libraries for a source of a
full-length clone, DNA form the libraries was screened by PCR
amplification with the PCR primer pair identified above. A positive
library was then used to isolated clones encoding the PRO245 gene
using the probe oligonucleotide and one of the PCR primers.
[0334] RNA for construction of the cDNA libraries was isolated from
human fetal liver tissue. The cDNA libraries used to isolate the
cDNA clones were constructed by standrd methods using commercially
available reagents such as those from Invitrogen, San Diego, Calif.
The cDNA was primed with oligo cT containing a notI site, linked
with blunt to SalI hemokinased adaptors, cleaved with NotI, sized
appropriately by gel electrophoresis, and cloned in a defined
orientation into a suitable cloning vector (such as pRKB or pRKD;
pRK5B is a precursor of pRK5D that does not contain the SfiI site;
see Holmes et al., Science 253: 1278-1280 (1991)) in the unique
XhoI and NotI sites.
[0335] DNA sequencing of the clones isolated as described above
gave the full-length DNA sequence for a native sequence PRO245
[herein designated as UNQ219 (DNA35638)(SEQ ID NO: 8)] and the
derived protein sequence (SEQ ID NO: 9).
[0336] The entire nucleotide sequence of UNQ219 (DNA35638) is shown
in FIG. 7 (SEQ ID NO: 8). Clone UNQ219 (DNA35638)(SEQ ID NO: 8)
contains a single open reading frame with an apparent translational
initiation site at nucleotide positions 89-91 [Kozak et al., supra]
and ending at the stop codon at nucleotide positions 1025-1027
(FIG. 7, SEQ ID NO: 8). The predicted polypeptide precursor is 312
amino acids long (FIG. 11)(SEQ ID NO: 9). Clone UNQ219 (DNA35638)
has been deposited with the ATCC on Sep. 17, 1997 and is assigned
ATCC deposit No. 209265.
Example 4
Inhibition of VEGF Stimulated Proliferation of Endothelial Cell
Growth
[0337] Bovine adrenal cortical capillary endothelial (ACE) cells
(from primary culture, maximum 12-14 passages) were plated on
96-well microtiter plates (Amersham Life Science) at a density of
500 cells/well per 100 .mu.L in low glucose DMEM, 10% calf serum, 2
mM glutamine, 1.times.pen/strept and fungizone, supplemented with 3
ng/mL VEGF. Controls were plated the same way but some did not
include VEGF. A test sample of the PRO301 and PRO245 polypeptide
was added in a 100 .mu.l volume for a 200 mcL final volume. Cells
were incubated for 6-7 days at 37.degree. C. The media was
aspirated and the cells washed 1.times. with PBS. An acid
phosphatase reaction mixture (100 .mu.L, 0.1M sodium acetate, pH
5.5, 0.1% Triton-100, 10 mM p-nitrophenyl phosphate) was added.
After incubation for 2 hours at 37.degree. C., the reaction was
stopped by addition of 10 mcL 1N NaOH. OD was measured on
microtiter plate reader at 405 nm. Controls were no cells, cells
alone, cells+FGF (5 ng/mL), cells+VEGF (3 ng/mL), cells+VEGF (3
ng/ml)+TGF-.beta. (1 ng/ml), and cells+VEGF (3 ng/mL)+LIF (5
ng/mL). (TGF-.beta. at a 1 ng/ml concentration is known to block
70-90% of VEGF stimulated cell proliferation.)
[0338] The results were assessed by calculating the percentage
inhibition of VEGF (3 ng/ml) stimulated cells proliferation,
determined by measuring acid phosphatase activity at OD.sub.405 nm,
(1) relative to cells without stimulation, and (2) relative to the
reference TGF-.beta. inhibition of VEGF stimulated activity. The
results, shown in Table 1, are indicative of the utility of the
PRO301 and PRO245 polypeptide in the inhibition of cell growth,
especially cancer therapy and specifically in inhibiting tumor
angiogenesis. TABLE-US-00006 TABLE 1 % Proliferation Compound
Tested Concentation relative to control DNA40628 protein (SEQ ID
NO: 1) 7.0 nM 1.02 DNA40628 protein (SEQ ID NO: 1) 70.0 nM 0.88
DNA40628 protein (SEQ ID NO: 1) 700.0 nM 0.44 DNA40628 protein (SEQ
ID NO: 1) 0.01% 0.92 DNA40628 protein (SEQ ID NO: 1) 0.1% 0.85
DNA40628 protein (SEQ ID NO: 1) 1.0% 0.68 DNA35638 protein (SEQ ID
NO: 9) 0.01% 0.76 DNA35638 protein (SEQ ID NO: 9) 0.1% 0.35
DNA35638 protein (SEQ ID NO: 9) 1.0% 0.11 DNA35638 protein (SEQ ID
NO: 9) 0.48 nM 1.03 DNA35638 protein (SEQ ID NO: 9) 4.8 nM 0.95
DNA35638 protein (SEQ ID NO: 9) 48.0 nM 0.49
Example 5
Stimulatory Activity in Mixed Lymphocyte Reaction (MLR) Assay
[0339] This example shows that the polypeptides of the invention
are active as a stimulator of the proliferation of stimulated
T-lymphocytes. Compounds which stimulate proliferation of
lymphocytres are useful therapeutically where enhancement of an
inflammatory response is beneficial. Compounds which inhibit
proliferation of lymphocytes are useful therapeutically where
suppression of inflammatory response. A therapeutic agent may take
the form of antagonists of the polypeptide of the invention, for
example, murine-human chimeric, humanized or human antibodies
against the polypeptide.
[0340] The basic protocol for this assay is described in Current
Protocol in Immunology, Unit 3.12, J. E. Coligan, A. M. Kruisbeek,
D H Marglies, E M Shevach and W Strober, Eds, National Institute of
Health, Published by John Wiley & Sons, Inc.
[0341] More specifically, in one assay variant, peripheral blood
mononuclear cells (PBMC) are isolated from mammalian individuals,
for example a human volunteer, by leukopheresis (one done will
supply stimulatory PBMCs, the other donor will supply responder
PBMCs). If desired, the cells are frozen in fetal bovine serum and
DMSO after isolation. Frozen cells may be thawed overnight in assay
media (37.degree. C., 5% CO.sub.2) and then washed and resuspended
to 3.times.10.sup.6 cells/ml of assay media (RPMI; 10% fetal bovine
serum, 1% penicillin/streptomycin, 1% glutamine, 1% HEPES, 1%
non-essential amino acids, 1% pyruvate).
[0342] The stimulator of PBMCs are prepared by irradiating the
cells (about 3000 Rads). The assay is prepared by plating in
triplicate wells a mixture of: 100 .mu.l of test sample diluted to
1% of 0.1%; 50 .mu.l of irradiated stimulator cells and 50 .mu.l of
responder PBMC cells. 100 .mu.L of cell culture media or 100 ml of
CD4-IgG is used as the control. The wells are then incubated at
37.degree. C., 5% CO.sub.2 for 4 days. On day 5, each well pulsed
with tritiated thymidine (1.0 mC/well; Amersham). After hours the
cells are washed 3 times and then the uptake of the label is
evaluated.
[0343] In another variant of this assay, PBMC's are isolated from
the spleens of Balb/c mice and C57B6 mice. The cells are teased
from freshly harvested spleens in assay media (RPMI; 10% fetal
bovine serum, 1% penicillin/streptomycin, 1% glutamine, 1% HEPES,
1% non-essential amino acids, 1% pyruvate) and the PBMCs are
isolated by overlaying these cells over Lympholyte M (Organon
Teknika), centrifuging at 2000 rpm for 20 minutes, collecting ans
washing the mononuclear cell layer in assay media and resuspending
the cells to 1.times.10.sup.7 cells/ml of asssay media. The assay
is then conducted as described above. The results of this assay for
compounds of the invention are shown below in Table 2. Positive
increases over control are considered positive with increases of
greater than or equal to 180% being preferred. However, any value
greater than control indicates a stimulatory effect for the test
protein. TABLE-US-00007 TABLE 2 Percent Increase Compound
Concentration over Control DNA40628 protein (SEQ ID NO: 1) 0.1%
181.7 DNA40628 protein (SEQ ID NO: 1) 1.0% 187.3 DNA40628 protein
(SEQ ID NO: 1) 0.1% 193.4 DNA40628 protein (SEQ ID NO: 1) 1.0%
204.1 DNA45416 protein (SEQ ID NO: 2) 0.1% 87.4 DNA45416 protein
(SEQ ID NO: 2) 1.0% 180.2 DNA35638 protein (SEQ ID NO: 9) 0.1%
189.7 DNA35638 protein (SEQ ID NO: 9) 0.1% 193.7 DNA35638 protein
(SEQ ID NO: 9) 1.0% 212.5 DNA35638 protein (SEQ ID NO: 9) 1.0%
300.5
Example 6
Inflammatory Cell Infiltrates into Guinea Pig Skin
[0344] The following example shows that the polypeptides of the
invention are proinflammatory in that they stimulate inflammatory
cell infiltrates (i.e., neutrophilic, eosinophilic, monocytic or
lymphocytic) into guinea pig skin. The assay described herein
monitors the capacity of each protein to induce an inflammatory
cell infiltrate into the skin of a guinea pig. Compounds which
stimulate inflammatory infiltration are useful therapeutically were
enhancement of an inflammatory response is beneficial. Compounds
which inhibit proliferation of lymphocytes are useful
therapeutically where suppression of an inflammatory response is
beneficial. A therapeutic agent may take the form of antagonists of
the polypeptides of the invention, for example, murine-human
chimeric, humanized or human antibodies against the
polypeptide.
[0345] Hairless guinea pigs (Charles River Labs) weighing 350 grams
or more are anesthetized with ketamine (75-80 mg/kg body weight)
and Xylazine (5 mg/kg body weight) intramuscularly. The protein
samples are injected intradermally onto the backs of each animal at
a volume of 100 .mu.l per injection site. There are approximately
16-24 injection sites per animal. One mL of Evans blue dye (1% in
physiological buffered saline) is injected intracardially. The
animals are euthanized after 6 hours. Each skin injection site is
biopsied and fixed in formalin. The skins are prepared for
histopathological evaluation. Each site is evaluated for
inflammatory cell infiltration into the skin. Sites with visible
inflammatory cells are scored as positive. Samples inducing an
inflammatory cell infiltrate are scored as proinflammatory
substances. TABLE-US-00008 TABLE 3 Compound Proinflammatory
activity DNA40628 protein (SEQ ID NO: 1) + DNA45416 protein (SEQ ID
NO: 2) + DNA35638 protein (SEQ ID NO: 9) + Negative control -
Example 7
Interaction with Human Neutrophils
[0346] The following example shows the ability of the polypeptides
of the invention to bind to human neutrophils, a molecule
associated with inflammation and the inflammatory response.
[0347] Neutrophils isolated from the blood of human donors (PMN) as
described in Scan. J. Clin. Lab Invest. Suppl. 97: 51-76 (1968),
were incubated with an Ig-fusion of protein encoded by DNA40628
(prepared as discussed in the following examples) or a negative
control humanized antibody.
[0348] The PMNs were resuspended in a microfuge tube in PBS at a
density of 2.times.10.sup.6 cell equivalents per condition. The
cells were washed twice with ice cold PBS and pelleted at
400.times.g between washes. The PMN cells were blocked with 0.5%
BSA in PBS (blocking reagent) at 4.degree. C. for 1 hour. After the
incubation, * the cells were further washed two additional times
with blocking reagent. The PMNs were pelleted after the final wash
and resuspended in 1 ml of blocking buffer at 0.1 .mu.g/ml in both
DNA40628 protein and control antibody. The incubation was carried
out for 2 hours at 4.degree. C. The PMN cells were gently
resuspended every 15 minutes on ice, then washed and pelleted 5
times in blocking buffer, with each wash lasting 5 minutes at
4.degree. C. and pelleting occurring at 400.times.g. A 1:1000
dilution of goat and anti-human IgG Fc specific-alkaline
phosphatase-conjugated in the blocking buffer was then applied to
the PMN cells. The PMN cells were incubated for 1 hour at 4.degree.
C., with gently mixing every 15 minutes on ice. The PMN cells were
then washed 5 times with blocking buffer, resuspended in the
appropriate substrate for alkaline phosphatase and distributed in 4
equi-100 .mu.l aliquots onto a microtiter plate. Color development
was read at O.D. 405. The results are shown in FIG. 21.
Example 8
Dot Blot Tissue Hybridization
[0349] A human RNA master blot (Clontech) was hybridized overnight
at 65.degree. C. in Expresshyb.RTM. buffer (Clontech) per the
manufacturer's instructions with 100 nM of psoralen-biotin labeled
DNA40628 cDNA probe (SEQ ID NO: 7). Streptavidin-alkaline
phosphatase was used to detect the biotinylated probe. The blot was
developed with CDP-star substrate (Ambion) and exposed for various
times on Biomax film (Kodak). A cDNA hybridization analysis of
human tissues show that DNA40628 mRNA is expressed in many tissues
except the cerebellum and spinal cord FIG. 19. DNA40628 mRNA is
highly expressed in the colon, prostate, stomach, ovary, salivary
gland, kidney, lung, trachea and placenta.
Example 9
Gene Product Overexpression
[0350] This example shows that genes encoding various proteins
indicated in FIG. 20 are overexpressed in colitic colon of CRF2-4
-/- "knock out" mice. Therapeutic agents may take the form of
antagonists of the indicated gene products, for example,
murine-human chimeric, humanized or human antibodies
thereagainst.
[0351] CRF 2-4 -/- mice (Spencer et al., J. Exp. Med. 187, 571-578
(1998)), are animals which have a subunit of the gene encoding the
IL-10 receptor removed. The mice are unresponsive to the
downregulatory functions of IL-10 for macrophage activation, and
cannot downregulate response to lipopolysaccharide triggering of
macrophage TNF-.alpha. secretion. They develop a chronic colitis
which can lead to colonic adenocarcinoma.
[0352] The probes for the proteins indicated in FIG. 20 were
created from mRNA templates for the indicated gene products and
used in the 5'-nuclease assay (e.g., TaqMan.TM.) and real-time
quantitative PCR (e.g., ABI Prizm 7700 Sequence Detection
System.TM. (Perkin-Elmer, Applied Biosystems Division, Foster City,
Calif.). The results are resported in delta CT units. One unit
corresponds to 1 PCR cycle or approximately a 2-fold amplification
relative to normal, two units correspond to 4-fold, 3 units to
8-fold, etc. Quantitation was obtained using primers and a
TaqMan.TM. fluorescent tagged-mRNA derived from the tested
inflammatory-related gene products indicated in FIG. 20. Regions of
the indicated gene products which are most likely to contain unique
nucleic acid sequences and which are least likely to have spliced
out introns are preferred for the primer derivation, e.g.
3'-untranslated region.
[0353] The 5'-nuclease assay reaction is a fluorescent PCR-based
technique which makes use of the 5'-exonuclease activity of Taq DNA
polymerase enzyme to monitor amplification in real time. Two
oligonucleotide primers are used to generate an amplicon typical of
a PCR reaction. A third oligonucleotide, or probe, is designed to
detect nucleotide sequence located between the two PCR primers. The
probe is non-extendible by Taq DNA polymerase enzyme, and is
labeled with a reported fluorescent dye and a quencher fluorescent
dye. Any laser-induced emission from the reporter dye is quenched
by the quenching dye when the two dyes are located close together
as they are on the probe. During the amplification reaction, the
probe is cleaved by the Taq DNA polymerase enzyme in a
template-dependent manner. The resultant probe fragments
disassociate in solution, and the signal from the release reporter
dye is free from the quenching effect of the second fluorophore.
One molecule of reporter dye is liberated for each new moleucle
synthesized, and detection of the unquenched reporter dye provided
the basis for quantitative interpretation of the data.
[0354] The 5'-nuclease procedure is run on a real-time quantiative
PCR device such as the ABI Prism 7700.TM. Sequence Detection. The
system consists of a thermocycler, laser, charge-coupled device
(CCD) camera and computer. The system amplifies samples in a
96-well format on a thermocycler. During amplification,
laser-induced fluorescent signal is collected in real-time through
fiber optics cables for all 96 wells, and detected at the CCD. The
system includes software for running the instrument and for
analyzing the data.
[0355] The 5'-nuclease assay data are initially expressed as Ct, or
the threshold cycle. This is defined as the cycle at which the
reporter signal accumulates above the background level of
fluorescence. The Ct values are used as quantitative measurement of
the relative number of starting copies of a particular target
sequence in a nucleic acid sample.
[0356] The results of the mRNA amplification are shown in FIG. 20.
Expression in wild-type animals were compared with CRF2.4 KO
animals with beta-actin as the reference standard. Four animals
were measured in each group. All four KO animals were diagnosed
with colitis and in addition, three of these had colon
adenocarcinoma.
[0357] FIG. 18 shows that JAM mRNA is increased 3.3-fold in the
colon of CRF2-4 -/- mice with colitis. These mice are IL-10
receptor knock outs that develop a spontaneous colitis mediated by
lymphocytes, monocytes and neutrophils. IL-10suppresses the
inflammatory response by modulating expression of certain
inflammatory cytokines.
[0358] As a result, it is likely that PRO301, PRO362 and PRO245
would also have elevated expression in inflammatory human disease,
such as inflammatory bowel disease and other inflammatory diseases
of the gut.
Example 10
Induction of Endothelial Cell Apoptosis
[0359] The ability of the polypeptides of the invention to induce
apoptosis in endothelial cells was tested in human venous umbilical
vein endothelial cells (HUVEC, Cell Systems). The first day, the
cells were plated on 96-well microtiter plates (Amersham Life
Sciences, cytostar-T scintillating microplate, RPNQ160, sterile,
tissue-culture treated, individually wrapped), in 10% serum
(CSG-medium, Cell Systems), at a density of 2.times.10.sup.4 cells
per well in a total volume of 100 .mu.l. The second day, PRO301 and
PRO245 polypeptide encoded by DNA40628 and DNA35638, respectively,
was added in triplicate at dilutions of 1%, 0.33% and 0.11%. On the
third day, the ability of the PRO301 and PRO245 polypeptides to
induce apoptosis was determined using a commerically available kit,
Apoptosis Detection Kit (R&D Systems, Minnesota) in which
annexin V, a member of the calcium and phospholipid binding
proteins, is used to detect apoptosis, following the protocol
recommended by the manufacturer. Fluroescein-labeled annexin V and
propidium iodide were added to the cells. Analysis was performed
with cytometers equipped with a single laser emitting excitation
light at 488 nm. In this test, live cells will not stain with
either fluorochrome, necrotic cells will stain with both
fluorochromes, and cells undergoing apoptosis will stain only with
the annexin V-FITC reagent. The annexin V-FITC generated signal was
detected in the FITC signal detector. The results are indicated in
the Table 4 below. TABLE-US-00009 TABLE 4 % over background
Compound tested Concentration fluorescence DNA40628 protein (SEQ ID
NO: 1) 0.11% 115.8 DNA40628 protein (SEQ ID NO: 1) 0.33% 199.3
DNA40628 protein (SEQ ID NO: 1) 1.0% 335.6 DNA35638 protein (SEQ ID
NO: 9) 0.11% 77.6 DNA35638 protein (SEQ ID NO: 9) 0.33% 143.7
DNA35638 protein (SEQ ID NO: 9) 1.0% 146.0 DNA35638 protein (SEQ ID
NO: 9) 6.82 nM 67.2 DNA35638 protein (SEQ ID NO: 9) 20.46 nM 102.6
DNA35638 protein (SEQ ID NO: 9) 62.0 nM 118.8
[0360] The ability of the protein compounds of the invention to
induce endothelial cell apoptosis, particularly in combination with
the disruption of cell junction formation as indicated in Example 4
is indicative that the compounds play roles in cell adhesion and
transmigration. Similar to murine JAM, the compounds are likely
cell junction molecules in epithelia and endothelia, which explains
their broad tissue distribution. The disruption of the induction of
endothelial cell apoptosis supports a role in cell growth and
apoptosis.
Example 11
In Vitro Antitumor Assay
[0361] The antiproliferative activity of the PRO301 and PRO362
polypeptides of the invention was determined in the
investigational, disease-orientated in vitro anti-cancer drug
discovery assay of the National Cancer Institute (NCI), using
sulforhodamine B (SRB) dye binding assay essentially as described
by Skehan et al., J. Natl. Cancer Inst. 82: 1107-1112 (1990). The
60 tumor cell lines employed in this study ("the NCI panel") as
well as conditions for their maintenance and culture in vitro have
been described by Monks et al., J. Natl. Cancer Inst. 83: 757-766
(1991). The purpose of this screen is to initially evaluate the
cytotoxic and/or cytostatic activity of the test compounds against
different types of tumors (Monks et al., supra, Boyd, Cancer:
Princ. Pract. Oncol. Update 3(10): 1-12 (1989)).
[0362] Cell from approximately 60 human tumor cell lines were
harvested with trypsin/EDTA (Gibco), washed once, resuspended in
IMEM and their viability was determined. The cell suspensions were
added by pipet (100 .mu.L volume) into separate 96-well microtiter
plates. The cell density for the 60-day incubation was less than
for the 20 day incubation to prevent overgrowth. Inoculates were
allowed a preincubation period of 24 hours at 37.degree. C. for
stabilization. Dilutions at twice the intended test concentration
were added at time zero in 100 ml aliquots to the microtiter plates
wells (1:2 dilution). Test compounds were evaluated at give
half-log dilutions (1000 to 100,000 fold). Incubations took place
for two days and six days in a 5% CO.sub.2 atmosphere and 100%
humidity.
[0363] After incubation, the medium was removed and the cells were
fixed in 0.1 ml of 10% trichloroacetic acid at 40.degree. C. The
plates were rinsed five times with deionized water, dried, stained
for 30 minutes with 0.1 ml of 0.4% sulforhodamine B dye (Sigma)
dissolved in 1% acetic acid, rinsed four times with 1% acetic acid
to remove unbound dye, dried, and the stain was extracted for five
minutes with 0.1 ml of 10 mM Tris base
[tris(hydroxymethyl)aminomethane], pH 10.5. The absorbance (OD) of
sulforhodamine B at 492 nm was measured using a
computer-interfaced, 96-well microtiter plate reader.
[0364] A test sample is considered positive if it shows at least
50% growth inhibitory effect at one or more concentrations. The
results are shown in the following tables, where the abbreviations
are as follows: [0365] NSCL=non-small lung carcinoma [0366]
CNS=central nervous system
[0367] Leuk=leukemia TABLE-US-00010 TABLE 5 Concen- Length Tumor
cell line Test compound tration of assay Type Designation DNA40628
protein 0.075 nM 6 Colon HCC-2998 (SEQ ID NO: 1) Melanoma M14
DNA40638 protein 700 nM 6 Melanoma M14 (SEQ ID NO: 1) DNA40628
protein 152 nM 6 Colon SR (SEQ ID NO: 1) Melanoma LOX IMVI DNA40628
protein 15.2 nM 6 Melanoma LOX IMVI (SEQ ID NO: 1) DNA40628 protein
0.85 nM 6 NSCL HOP62 (SEQ ID NO: 1) Ovarian OVCAR-3 Prostate PC3
DNA45416 protein 15 nM 2 Ovarian SK-OV-3 (SEQ ID NO: 2) DNA45416
protein 15 nM 6 NSCL NCI-H322M (SEQ ID NO: 2) Prostate PC-3
DNA45416 protein 4.7 nM 6 Melanoma LOX IMVI (SEQ ID NO: 2) DNA45416
protein 47 nM 6 NSCL NCI-H322M (SEQ ID NO: 2) Colon Colo 205
DNA45416 protein 152 nM 2 CNS SR-295 (SEQ ID NO: 2) Breast T047D
DNA45416 protein 152 nM 6 Leuk SR, HL-60 (TB), (SEQ ID NO: 2)
MOLT-4, K 562 NSCL NCI-H23, EKVX Colon HCC-2998 CNS U251 Melanoma
UACC-62, UACC-257, LOX IMVI DNA35638 protein 0.35 nM 2 NSCL HOP92
(SEQ ID NO: 9) Ovarian OVCAR-4 DNA35638 protein 0.35 nM 2 Leuk SR
(SEQ ID NO: 9) DNA35638 protein 0.35 nM 6 Colon HCC-2998 (SEQ ID
NO: 9) DNA35638 protein 3.5 nM 6 Leuk SR (SEQ ID NO: 9) Colon
SW-620 DNA35638 protein 6.2 nM 6 Colon HCT-116 (SEQ ID NO: 9)
DNA35638 protein 6.2 nM 6 Leuk RPMI-8226 (SEQ ID NO: 9)
Example 12
Use of PRO301. PRO362 or PRO245 as a Hybridization Probe
[0368] The following method describes use of a nucleotide sequence
encoding a PRO301, PRO362 or PRO245 as a hybridization probe.
[0369] DNA comprising the coding sequence of native sequence
PRO301, PRO362 or PRO245 (as shown in FIGS. 5-7, SEQ ID NO: 11, 7
and 8), respectively, is employed as a probe to screen for
homologous DNAs (such as those encoding naturally-occurring
variants of PRO301, PRO362 or PRO245, respectively) in human tissue
cDNA libraries or human tissue genomic libraries.
[0370] Hybridization and washing of filters containing either
library DNAs is performed under the following high stringency
conditions. Hybridization of radiolabeled PRO301-, PRO362- or
PRO245-derived probe to the filters is performed in a solution of
50% formamide, 5.times.SSC, 0.1% SDS, 0.1% sodium pyrophosphate, 50
mM sodium phosphate, pH 6.8, 2.times.Denhardt's solution, and 10%
dextran sulfate at 42.degree. C. for 20 hours. Washing of the
filters is performed in an aqueous solution of 0.1.times.SSC and
0.1% SDS at 42.degree. C.
[0371] DNAs having a desired sequence identity with the DNA
encoding a full-length native sequence PRO301, PRO362 or PRO245 can
then be identified using standard techniques known in the art.
Example 13
Expression of PRO301, PRO362 or PRO245 in E. coli
[0372] This example illustrates preparation of an unglycosylated
form of PRO301, PRO362 or PRO245 by recombinant expression in E.
coli.
[0373] The DNA sequence encoding PRO301, PRO362 or PRO245 is
initially amplified using selected PCR primers. The primers should
contain restriction enzyme sites which correspond to the
restriction enzyme sites on the selected expression vector. A
variety of expression vectors may be employed. An example of a
suitable vector is pBR322 (derived from E. coli; see Bolivar et
al., Gene, 2:95 (1977)) which contains genes for ampicillin and
tetracycline resistance. The vector is digested with restriction
enzyme and dephosphorylated. The PCR amplified sequences are then
ligated into the vector. The vector will preferably include
sequences which encode for an antibiotic resistance gene, a trp
promoter, a polyhis leader (including the first six STII codons,
polyhis sequence, and enterokinase cleavage site), the PRO301,
PRO362 or PRO245 coding region, lambda transcriptional terminator,
and an argU gene.
[0374] The ligation mixture is then used to transform a selected E.
coli strain using the methods described in Sambrook et al., supra.
Transformants are identified by their ability to grow on LB plates
and antibiotic resistant colonies are then selected. Plasmid DNA
can be isolated and confirmed by restriction analysis and DNA
sequencing.
[0375] Selected clones can be grown overnight in liquid culture
medium such as LB broth supplemented with antibiotics. The
overnight culture may subsequently be used to inoculate a larger
scale culture. The cells are then grown to a desired optical
density, during which the expression promoter is turned on.
[0376] After culturing the cells for several more hours, the cells
can be harvested by centrifugation. The cell pellet obtained by the
centrifugation can be solubilized using various agents known in the
art, and the solubilized PRO301, PRO362 or PRO245 protein can then
be purified using a metal chelating column under conditions that
allow tight binding of the protein.
[0377] PRO301 was expressed in E. coli in a poly-His tagged form,
using the following procedure. The DNA encoding PRO301 was
initially amplified using selected PCR primers. The primers
contained restriction enzyme sites which correspond to the
restriction enzyme sites on the selected expression vector, and
other useful sequences providing for efficient and reliable
translation initiation, rapid purification on a metal chelation
column, and proteolytic removal with enterokinase. The
PCR-amplified, poly-His tagged sequences were then ligated into an
expression vector, which was used to transform an E. coli host
based on strain 52 (W3110 fuhA(tonA) Ion galE rpoHts(htpRts)
clpP(lacIq). Transformants were first grown in LB containing 50
mg/ml carbenicillin at 30/C with shaking until an O.D.600 of 3-5
was reached. Cultures were then diluted 50-100 fold into CRAP media
(prepared by mixing 3.57 g (NH.sub.4).sub.2SO.sub.4, 0.71 g sodium
citrateA2H2O, 1.07 g KCl, 5.36 g Difco yeast extract, 5.36 g
Sheffield hycase SF in 500 mL water, as well as 110 mM MPOS, pH
7.3, 0.55% (w/v) glucose and 7 mM MgSO.sub.4) and grown for
approximately 20-30 hours at 30/C with shaking. Samples were
removed to verify expression by SDS-PAGE analysis, and the bulk
culture is centrifuged to pellet the cells. Cell pellets were
frozen until purification and refolding.
[0378] E. coli paste from 0.5 to 1 L fermentations (6-10 g pellets)
was resuspended in 10 volumes (w/v) in 7 M guanidine, 20 mM Tris,
pH 8 buffer. Solid sodium sulfite and sodium tetrathionate is added
to make final concentrations of 0.1 M and 0.02 M, respectively, and
the solution was stirred overnight at 4/C. This step results in a
denatured protein with all cysteine residues blocked by
sulfitolization. The solution was centrifuged at 40,000 rpm in a
Beckman Ultracentifuge for 30 min. The supernatant was diluted with
3-5 volumes of metal chelate column buffer (6 M guanidine, 20 mM
Tris, pH 7.4) and filtered through 0.22 micron filters to clarify.
Depending the clarified extract was loaded onto a 5 ml Qiagen
Ni-NTA metal chelate column equilibrated in the metal chelate
column buffer. The column was washed with additional buffer
containing 50 mM imidazole (Calbiochem, Utrol grade), pH 7.4. The
protein was eluted with buffer containing 250 mM imidazole.
Fractions containing the desired protein were pooled and stored at
4/C. Protein concentration was estimated by its absorbance at 280
nm using the calculated extinction coefficient based on its amino
acid sequence.
[0379] The protein was refolded by diluting sample slowly into
freshly prepared refolding buffer consisting of: 20 mM Tris, pH
8.6, 0.3 M NaCl, 2.5 M urea, 5 mM cysteine, 20 mM glycine and 1 mM
EDTA. Refolding volumes were chosen so that the final protein
concentration was between 50 to 100 micrograms/ml. The refolding
solution was stirred gently at 4/C for 12-36 hours. The refolding
reaction was quenched by the addition of TFA to a final
concentration of 0.4% (pH of approximately 3). Before further
purification of the protein, the solution was filtered through a
0.22 micron filter and acetonitrile was added to 2-10% final
concentration. The refolded protein was chromatographed on a Poros
R1/H reversed phase column using a mobile buffer of 0.1% TFA with
elution with a gradient of acetonitrile from 10 to 80%. Aliquots of
fractions with A280 absorbance were analyzed on SDS polyacrylamide
gels and fractions containing homogeneous refolded protein were
pooled. Generally, the properly refolded species of most proteins
are eluted at the lowest concentrations of acetonitrile since those
species are the most compact with their hydrophobic interiors
shielded from interaction with the reversed phase resin. Aggregated
species are usually eluted at higher acetonitrile concentrations.
In addition to resolving misfolded forms of proteins from the
desired form, the reversed phase step also removes endotoxin from
the samples.
[0380] Fractions containing the desired folded PRO301 protein,
respectively, were pooled and the acetonitrile removed using a
gentle stream of nitrogen directed at the solution. Proteins were
formulated into 20 mM Hepes, pH 6.8 with 0.14 M sodium chloride and
4% mannitol by dialysis or by gel filtration using G25 Superfine
(Pharmacia) resins equilibrated in the formulation buffer and
sterile filtered.
Example 14
Expression of PRO301, PRO362 or PRO245 in Mammalian Cells
[0381] This example illustrates preparation of a glycosylated form
of a PRO301, PRO362 or PRO245 by recombinant expression in
mammalian cells.
[0382] The vector, pRK5 (see EP 307,247, published Mar. 15, 1989),
is employed as the expression vector. Optionally, the PRO301,
PRO362 or PRO245 DNA is ligated into pRK5 with selected restriction
enzymes to allow insertion of the PRO301, PRO362 or PRO245 DNA
using ligation methods such as described in Sambrook et al., supra.
The resulting vector is called pRK5-PRO301, pRK5-PRO362 or
pRK5-PRO245, respectively.
[0383] In one embodiment, the selected host cells may be 293 cells.
Human 293 cells (ATCC CCL 1573) are grown to confluence in tissue
culture plates in medium such as DMEM supplemented with fetal calf
serum and optionally, nutrient components and/or antibiotics. About
10 .mu.g pRK5-PRO301, pRK5-PRO362 or pRK5-PRO245 DNA is mixed with
about 1 .mu.g DNA encoding the VA RNA gene [Thimmappaya et al.,
Cell, 31:543 (1982)] and dissolved in 500 .mu.l of 1 mM Tris-HCl,
0.1 mM EDTA, 0.227 M CaCl.sub.2. To this mixture added, dropwise,
500 .mu.l of 50 mM HEPES (pH 7.35), 280 mM NaCl, 1.5 mM NaPO.sub.4,
and a precipitate is allowed to form for 10 minutes at 25.degree.
C. The precipitate is suspended and added to the 293 cells and
allowed to settle for about four hours at 37.degree. C. The culture
medium is aspirated off and 2 ml of 20% glycerol in PBS is added
for 30 seconds. The 293 cells are then washed with serum free
medium, fresh medium is added and the cells are incubated for about
5 days.
[0384] Approximately 24 hours after the transfections, the culture
medium is removed and replaced with culture medium (alone) or
culture medium containing 200 .mu.Ci/ml .sup.35S-cysteine and 200
.mu.Ci/ml .sup.35S-methionine. After a 12 hour incubation, the
conditioned medium is collected, concentrated on a spin filter, and
loaded onto a 15% SDS gel. The processed gel may be dried and
exposed to film for a selected period of time to reveal the
presence of PRO301, PRO362 or PRO245 polypeptide. The cultures
containing transfected cells may undergo further incubation (in
serum free medium) and the medium is tested in selected
bioassays.
[0385] In an alternative technique, PRO301, PRO362 or PRO245 DNA
may be introduced into 293 cells transiently using the dextran
sulfate method described by Somparyrac et al., Proc. Natl. Acad.
Sci., 12:7575 (1981). 293 cells are grown to maximal density in a
spinner flask and 700 .mu.g pRK5-PRO301, pRK5-PRO362 or pRK5-PRO245
DNA is added. The cells are first concentrated from the spinner
flask by centrifugation and washed with PBS. The DNA-dextran
precipitate is incubated on the cell pellet for four hours. The
cells are treated with 20% glycerol for 90 seconds, washed with
tissue culture medium, and re-introduced into the spinner flask
containing tissue culture medium, 5 .mu.g/ml bovine insulin and 0.1
.mu.g/ml bovine transferrin. After about four days, the conditioned
media is centrifuged and filtered to remove cells and debris. The
sample containing expressed PRO301, PRO362 or PRO245 can then be
concentrated and purified by any selected method, such as dialysis
and/or column chromatography.
[0386] In another embodiment, PRO301, PRO362 or PRO245 can be
expressed in CHO cells. The pRK5-PRO301, pRK5-PRO362 or pRK5-PRO245
can be transfected into CHO cells using known reagents such as
CaPO.sub.4 or DEAE-dextran. As described above, the cell cultures
can be incubated, and the medium replaced with culture medium
(alone) or medium containing a radiolabel such as
.sup.35S-methionine. After determining the presence of PRO301,
PRO362 or PRO245 polypeptide, the culture medium may be replaced
with serum free medium. Preferably, the cultures are incubated for
about 6 days, and then the conditioned medium is harvested. The
medium containing the expressed PRO301, PRO362 or PRO245 can then
be concentrated and purified by any selected method.
[0387] Epitope-tagged PRO301, PRO362 or PRO245 may also be
expressed in host CHO cells. The PRO301, PRO362 or PRO245 may be
subcloned out of the pRK5 vector. The subclone insert can undergo
PCR to fuse in frame with a selected epitope tag such as a poly-his
tag into a Baculovirus expression vector. The poly-his tagged
PRO301, PRO362 or PRO245 insert can then be subcloned into a SV40
driven vector containing a selection marker such as DHFR for
selection of stable clones. Finally, the CHO cells can be
transfected (as described above) with the SV40 driven vector.
Labeling may be performed, as described above, to verify
expression. The culture medium containing the expressed poly-His
tagged PRO301, PRO362 or PRO245 can then be concentrated and
purified by any selected method, such as by Ni.sup.2+-chelate
affinity chromatography.
[0388] PRO301, PRO362 and PRO245 were expressed in CHO cells by
both a transient and stable expression procedure.
[0389] Stable expression in CHO cells was performed using the
following procedure. The proteins were expressed as an IgG
construct (immunoadhesin), in which the coding sequences for the
soluble forms (e.g. extracellular domains) of the respective
proteins were fused to an IgG1 constant region sequence containing
the hinge, CH2 and CH2 domains and/or as a poly-His tagged
form.
[0390] Following PCR amplification, the respective DNAs were
subcloned in a CHO expression vector using standard techniques as
described in Ausubel et al., Current Protocols of Molecular
Biology, Unit 3.16, John Wiley and Sons (1997). CHO expression
vectors are constructed to have compatible restriction sites 5 and
3 of the DNA of interest to allow the convenient shuttling of cDNA
s. The vector used expression in CHO cells is as described in Lucas
et al., Nucl. Acids Res. 24: 9 (1774-1779 (1996), and uses the SV40
early promoter/enhancer to drive expression of the cDNA of interest
and dihydrofolate reductase (DHFR). DHFR expression permits
selection for stable maintenance of the plasmid following
transfection.
[0391] Twelve micrograms of the desired plasmid DNA were introduced
into approximately 10 million CHO cells using commercially
available transfection reagents Superfect.sup. (Quiagen),
Dosper.sup. or Fugene.sup. (Boehringer Mannheim). The cells were
grown and described in Lucas et al., supra. Approximately
3.times.10.sup.-7 cells are frozen in an ampule for further growth
and production as described below.
[0392] The ampules containing the plasmid DNA were thawed by
placement into water bath and mixed by vortexing. The contents were
pipetted into a centrifuge tube containing 10 mLs of media and
centrifuged at 1000 rpm for 5 minutes. The supernatant was
aspirated and the cells were resuspended in 10 mL of selective
media (0.2 :m filtered PS20 with 5% 0.2 :m diafiltered fetal bovine
serum). The cells were then aliquoted into a 100 mL spinner
containing 90 mL of selective media. After 1-2 days, the cells were
transferred into a 250 mL spinner filled with 150 mL selective
growth medium and incubated at 37EC. After another 2-3 days, a 250
mL, 500 mL and 2000 mL spinners were seeded with 3.times.10.sup.5
cells/mL. The cell media was exchanged with fresh media by
centrifugation and resuspension in production medium. Although any
suitable CHO media may be employed, a production medium described
in U.S. Pat. No. 5,122,469, issued Jun. 16, 1992 was actually used.
3 L production spinner is seeded at 1.2.times.10.sup.6 cells/mL. On
day 0, the cell number and pH were determined. On day 1, the
spinner was sampled and sparging with filtered air was commenced.
On day 2, the spinner was sampled, the temperature shifted to 33
EC, and 30 mL of 500 g/L glucose and 0.6 mL of 10% antifoam (e.g.,
35% polydimethylsiloxane emulsion, Dow Corning 365 Medical Grade
Emulsion). Throughout the production, pH was adjusted as necessary
to keep at around 7.2. After 10 days, or until viability dropped
below 70%, the cell culture was harvested by centrifugation and
filtering through a 0.22 :m filter. The filtrate was either stored
at 4 EC or immediately loaded onto columns for purification.
[0393] For the poly-His tagged constructs, the proteins were
purified using a Ni--NTA column (Qiagen). Before purification,
imidazole was added to the conditioned media to a concentration of
5 mM. The conditioned media was pumped onto a 6 ml Ni-NTA column
equilibrated in 20 mM Hepes, pH 7.4, buffer containing 0.3 M NaCl
and 5 mM imidazole at a flow rate of 4-5 ml/min. at 4 EC. After
loading, the column was washed with additional equilibration buffer
and the protein eluted with equilibration buffer containing 0.25 M
imidazole. The highly purified protein was subsequently desalted
into a storage buffer containing 10 mM Hepes, 0.14 M NaCl and 4%
mannitol, pH 6.8, with a 25 ml G25 Superfine (Pharmacia) column and
stored at -80 EC.
[0394] Immunoadhesin (Fc containing) constructs of were purified
from the conditioned media as follows. The conditioned medium was
pumped onto a 5 ml Protein A column (Pharmacia) which had been
equilibrated in 20 mM Na phosphate buffer, pH 6.8. After loading,
the column was washed extensively with equilibration buffer before
elution with 100 mM citric acid, pH 3.5. The eluted protein was
immediately neutralized by collecting 1 ml fractions into tubes
containing 275 :L of 1 M Tris buffer, pH 9. The highly purified
protein was subsequently desalted into storage buffer as described
above for the poly-His tagged proteins. The homogeneity was
assessed by SDS polyacrylamide gels and by N-terminal amino acid
sequencing by Edman degradation.
[0395] PRO301, PRO362 and PRO245 was also produced by transient
expression in COS cells.
Example 15
Expression of PRO301, PRO362 or PRO245 in Yeast
[0396] The following method describes recombinant expression of
PRO301, PRO362 or PRO245 in yeast.
[0397] First, yeast expression vectors are constructed for
intracellular production or secretion of PRO301, PRO362 or PRO245
from the ADH2/GAPDH promoter. DNA encoding PRO301, PRO362 or
PRO245, a selected signal peptide and the promoter is inserted into
suitable restriction enzyme sites in the selected plasmid to direct
intracellular expression of PRO301, PRO362 or PRO245. For
secretion, DNA encoding PRO301, PRO362 or PRO245 can be cloned into
the selected plasmid, together with DNA encoding the ADH2/GAPDH
promoter, the yeast alpha-factor secretory signalaeader sequence,
and linker sequences (if needed) for expression of PRO301, PRO362
or PRO245.
[0398] Yeast cells, such as yeast strain AB110, can then be
transformed with the expression plasmids described above and
cultured in selected fermentation media. The transformed yeast
supernatants can be analyzed by precipitation with 10%
trichloroacetic acid and separation by SDS-PAGE, followed by
staining of the gels with Coomassie Blue stain.
[0399] Recombinant PRO301, PRO362 or PRO245 can subsequently be
isolated and purified by removing the yeast cells from the
fermentation medium by centrifugation and then concentrating the
medium using selected cartridge filters. The concentrate containing
PRO301, PRO362 or PRO245 may further be purified using selected
column chromatography resins.
Example 16
Expression of PRO301, PRO362 or PRO245 in Baculovirus-Infected
Insect Cells
[0400] The following method describes recombinant expression of
PRO301, PRO362 or PRO245 in Baculovirus-infected insect cells.
[0401] The PRO301, PRO362 or PRO245 is fused upstream of an epitope
tag contained with a baculovirus expression vector. Such epitope
tags include poly-his tags and immunoglobulin tags (like Fc regions
of IgG). A variety of plasmids may be employed, including plasmids
derived from commercially available plasmids such as pVL1393
(Novagen). Briefly, the PRO301, PRO362 or PRO245 or the desired
portion of the PRO301, PRO362 or PRO245 (such as the sequence
encoding the extracellular domain of a transmembrane protein) is
amplified by PCR with primers complementary to the 5' and 3'
regions. The 5' primer may incorporate flanking (selected)
restriction enzyme sites. The product is then digested with those
selected restriction enzymes and subcloned into the expression
vector.
[0402] Recombinant baculovirus is generated by co-transfecting the
above plasmid and BaculoGold.TM. virus DNA (Pharmingen) into
Spodoptera frugiperda ("Sf9") cells (ATCC CRL 1711) using
lipofectin (commercially available from GIBCO-BRL). After 4-5 days
of incubation at 28.degree. C., the released viruses are harvested
and used for further amplifications. Viral infection and protein
expression is performed as described by O'Reilley et al.,
Baculovirus expression vectors: A laboratory Manual, Oxford: Oxford
University Press (1994).
[0403] Expressed poly-his tagged PRO301, PRO362 or PRO245 can then
be purified, for example, by Ni.sup.2+-chelate affinity
chromatography as follows. Extracts are prepared from recombinant
virus-infected Sf9 cells as described by Rupert et al., Nature,
362:175-179 (1993). Briefly, Sf9 cells are washed, resuspended in
sonication buffer (25 mL Hepes, pH 7.9; 12.5 mM MgCl.sub.2; 0.1 mM
EDTA; 10% Glycerol; 0.1% NP-40; 0.4 M KCl), and sonicated twice for
20 seconds on ice. The sonicates are cleared by centrifugation, and
the supernatant is diluted 50-fold in loading buffer (50 mM
phosphate, 300 mM NaCl, 10% Glycerol, pH 7.8) and filtered through
a 0.45 Fm filter. A Ni.sup.2+-NTA agarose column (commercially
available from Qiagen) is prepared with a bed volume of 5 mL,
washed with 25 mL of water and equilibrated with 25 mL of loading
buffer. The filtered cell extract is loaded onto the column at 0.5
mL per minute. The column is washed to baseline A.sub.280 with
loading buffer, at which point fraction collection is started.
Next, the column is washed with a secondary wash buffer (50 mM
phosphate; 300 mM NaCl, 10% Glycerol, pH 6.0), which elutes
nonspecifically bound protein. After reaching A.sub.280 baseline
again, the column is developed with a 0 to 500 mM Imidazole
gradient in the secondary wash buffer. One mL fractions are
collected and analyzed by SDS-PAGE and silver staining or western
blot with Ni.sup.2+-NTA-conjugated to alkaline phosphatase
(Qiagen). Fractions containing the eluted His.sub.10-tagged PRO301,
PRO362 or PRO245 are pooled and dialyzed against loading
buffer.
[0404] Alternatively, purification of the IgG tagged (or Fc tagged)
PRO301, PRO362 or PRO245 can be performed using known
chromatography techniques, including for instance, Protein A or
protein G column chromatography.
[0405] PRO301, PRO362 and PRO245 were expressed in baculovirus
infected Sf9 insect cells. While the expression was actually
performed in a 0.5-2 L scale, it can be readily scaled up for
larger (e.g. 8 L) preparations. The proteins were expressed as an
IgG construct (immunoadhesin), in which the protein extracellular
region was fused to an IgG1 constant region sequence containing the
hinge, CH2 and CH3 domains and/or in poly-His tagged forms.
[0406] Following PCR amplification, the respective coding sequences
were subcloned into a baculovirus expression vector (pb.PH.IgG for
IgG fusions and pb.PH.His.c for poly-His tagged proteins), and the
vector and Baculogold baculovirus DNA (Pharmingen) were
co-transfected into 105 Spodoptera frugiperda ("Sf9") cells (ATCC
CRL 1711), using Lipofectin (Gibco BRL). pb.PH.IgG and pb.PH.His
are modifications of the commercially available baculovirus
expression vector pVL1393 (Pharmingen), with modified polylinker
regions to include the His or Fc tag sequences. The cells were
grown in Hink's TNM-FH medium supplemented with 10% FBS (Hyclone).
Cells were incubated for 5 days at 28/C. The supernatant was
harvested and subsequently used for the first viral amplification
by infecting Sf9 cells in Hink's TNM-FH medium supplemented with
10% FBS at an approximate multiplicity of infection (MOI) of 10.
Cells were incubated for 3 days at 28/C. The supernatant was
harvested and the expression of the constructs in the baculovirus
expression vector was determined by batch binding of 1 ml of
supernatant to 25 mL of Ni-NTA beads (QIAGEN) for histidine tagged
proteins or Protein-A Sepharose CL-4B beads (Pharmacia) for IgG
tagged proteins followed by SDS-PAGE analysis comparing to a known
concentration of protein standard by Coomassie blue staining.
[0407] The first viral amplification supernatant was used to infect
a spinner culture (500 ml) of Sf9 cells grown in ESF-921 medium
(Expression Systems LLC) at an approximate MOI of 0.1. Cells were
incubated for 3 days at 28/C. The supernatant was harvested and
filtered. Batch binding and SDS-PAGE analysis was repeated, as
necessary, until expression of the spinner culture was
confirmed.
[0408] The conditioned medium from the transfected cells (0.5 to 3
L) was harvested by centrifugation to remove the cells and filtered
through 0.22 micron filters. For the poly-His tagged constructs,
the protein construct were purified using a Ni-NTA column (Qiagen).
Before purification, imidazole was added to the conditioned media
to a concentration of 5 mM. The conditioned media were pumped onto
a 6 ml Ni--NTA column equilibrated in 20 mM Hepes, pH 7.4, buffer
containing 0.3 M NaCl and 5 mM imidazole at a flow rate of 4-5
ml/min. at 4/C. After loading, the column was washed with
additional equilibration buffer and the protein eluted with
equilibration buffer containing 0.25 M imidazole. The highly
purified protein was subsequently desalted into a storage buffer
containing 10 mM Hepes, 0.14 M NaCl and 4% mannitol, pH 6.8, with a
25 ml G25 Superfine (Pharmacia) column and stored at -80/C.
[0409] Immunoadhesin (Fc containing) constructs of proteins were
purified from the conditioned media as follows. The conditioned
media were pumped onto a 5 ml Protein A column (Pharmacia) which
had been equilibrated in 20 mM Na phosphate buffer, pH 6.8. After
loading, the column was washed extensively with equilibration
buffer before elution with 100 mM citric acid, pH 3.5. The eluted
protein was immediately neutralized by collecting 1 ml fractions
into tubes containing 275 mL of 1 M Tris buffer, pH 9. The highly
purified protein was subsequently desalted into storage buffer as
described above for the poly-His tagged proteins. The homogeneity
of the proteins was verified by SDS polyacrylamide gel (PEG)
electrophoresis and N-terminal amino acid sequencing by Edman
degradation.
[0410] PRO301, PRO362 and PRO245 were also expressed in baculovirus
infected High-5 cells using an analogous procedure. High-5 cells
were grown to a confluency of 50% at 27.degree. C., no CO.sub.2, no
penicillin no streptomycin. For each 150 mm plate, 30 .mu.g of pIE
based vector containing PRO301, PRO362 or PRO245 was mixed with 1
ml Ex-Cell medium (Media: Ex-cell 401, 1/100 L-Glu JRH Biosciences,
#14401-78P, note: medium is light sensitive), and in a separate
tube, 100 .mu.l of Cell Fectin (GibcoBRL #10362-010) was mixed with
1 ml of Ec-Cell medium. The pIE1-1 and pIE1-2 vectors are designed
for constitutive expression of recombinant proteins from the
baculovirus ie1 promoter in stably-transformed insect cells
(Cartier, J. L., et al., J. Virol. 68, 7728-7737)(1994). The
plasmids differ only in the orientation of the multiple cloning
sites and contain all promoter sequences known to be important for
ie1-mediated gene expression in uninfected insect cells as well as
the hr5 enhancer element. pIE1-1 and pIE1-2 include the ie1
translation initiation site and can be used to produce fusion
proteins.
[0411] The two solutions were combined and allowed to incubate at
room temperature for 15 minutes. 8 ml of Ex-Cell media was added to
the 2 ml of DNA/CellFectin mix and is layered on High-5 cells
previously washed with Ex-Cell media. The plate was incubated in
darkness for 1 hour at room temperature. The DNA/CellFectin mix was
aspirated, and the cells washed once with Ex-Cell to remove excess
Cellfectin. Fresh Ex-cell medium (30 ml) was added and the cells
incubated for 3 days at 28.degree. C. The supernatent was harvested
and the expression of PRO301, PRO362 or PRO245 was determined by
batch binding in a manner simliar to that described for Sf9
cells.
Example 17
Preparation of Antibodies that Bind PRO301, PRO362 and PRO245
[0412] This example illustrates preparation of monoclonal
antibodies which can specifically bind PRO301, PRO362 and
PRO245.
[0413] Techniques for producing the monoclonal antibodies are known
in the art and are described, for instance, in Goding, supra.
Immunogens that may be employed include purified PRO301, PRO362 and
PRO245, fusion proteins containing PRO301, PRO362 and PRO245, and
cells expressing recombinant PRO301, PRO362 and PRO245 on the cell
surface. Selection of the immunogen can be made by the skilled
artisan without undue experimentation.
[0414] Mice, such as Balb/c, are immunized with the PRO301, PRO362
and PRO245 immunogen emulsified in complete Freund's adjuvant and
injected subcutaneously or intraperitoneally in an amount from
1-100 micrograms. Alternatively, the immunogen is emulsified in
MPL-TDM adjuvant (Ribi Immunochemical Research, Hamilton, Mont.)
and injected into the animal's hind foot pads. The immunized mice
are then boosted 10 to 12 days later with additional immunogen
emulsified in the selected adjuvant. Thereafter, for several weeks,
the mice may also be boosted with additional immunization
injections. Serum samples may be periodically obtained from the
mice by retro-orbital bleeding for testing in ELISA assays to
detect PRO301, PRO362 and PRO245 antibodies.
[0415] After a suitable antibody titer has been detected, the
animals "positive" for antibodies can be injected with a final
intravenous injection of PRO301, PRO362 and PRO245. Three to four
days later, the mice are sacrificed and the spleen cells are
harvested. The spleen cells are then fused (using 35% polyethylene
glycol) to a selected murine myeloma cell line such as P3X63AgU.1,
available from ATCC, No. CRL 1597. The fusions generate hybridoma
cells which can then be plated in 96 well tissue culture plates
containing HAT (hypoxanthine, aminopterin, and thymidine) medium to
inhibit proliferation of non-fused cells, myeloma hybrids, and
spleen cell hybrids.
[0416] The hybridoma cells will be screened in an ELISA for
reactivity against PRO301, PRO362 and PRO245. Determination of
"positive" hybridoma cells secreting the desired monoclonal
antibodies against PRO301, PRO362 and PRO245 is within the skill in
the art.
[0417] The positive hybridoma cells can be injected
intraperitoneally into syngeneic Balb/c mice to produce ascites
containing the anti-PRO301, anti-PRO362 or anti-PRO245 monoclonal
antibodies. Alternatively, the hybridoma cells can be grown in
tissue culture flasks or roller bottles. Purification of the
monoclonal antibodies produced in the ascites can be accomplished
using ammonium sulfate precipitation, followed by gel exclusion
chromatography. Alternatively, affinity chromatography based upon
binding of antibody to protein A or protein G can be employed.
Deposit of Material
[0418] The following materials have been deposited with the
American Type Culture Collection, 10801 University Boulevard,
Manassas, Va. 20110-2209, USA (ATCC): TABLE-US-00011 Designation
ATCC Dep. No. Deposit Date pRK5-based plasmid 209432 Nov. 7, 1997
DNA40628-1216 DNA45416-1251 209620 Feb. 5, 1998 DNA35638-1141
209265 Sep. 16, 1997
[0419] These deposits were made under the provisions of the
Budapest Treaty on the International Recognition of the Deposit of
Microorganisms for the Purpose of Patent Procedure and the
Regulations thereunder (Budapest Treaty). This assures maintenance
of a viable culture of the deposit for 30 years from the date of
deposit. The deposit will be made available by ATCC under the terms
of the Budapest Treaty, and subject to an agreement between
Genentech, Inc. and ATCC, which assures that all restrictions
imposed by the depositor on the availability to the public of the
deposited material will be irrevocably removed upon the granting of
the pertinent U.S. patent, assures permanent and unrestricted
availability of the progeny of the culture of the deposit to the
public upon issuance of the pertinent U.S. patent or upon laying
open to the public of any U.S. or foreign patent application,
whichever comes first, and assures availability of the progeny to
one determined by the U.S. Commissioner of Patents and Trademarks
to be entitled thereto according to 35 USC '122 and the
Commissioner's rules pursuant thereto (including 37 CFR .sctn.1.14
with particular reference to 886 OG 638).
[0420] The assignee of the present application has agreed that if a
culture of the materials on deposit should die or be lost or
destroyed when cultivated under suitable conditions, the materials
will be promptly replaced on notification with another of the same.
Availability of the deposited material is not to be construed as a
license to practice the invention in contravention of the rights
granted under the authority of any government in accordance with
its patent laws.
[0421] The foregoing written specification is considered to be
sufficient to enable one skilled in the art to practice the
invention. The present invention is not to be limited in scope by
the construct deposited, since the deposited embodiment is intended
as a single illustration of certain aspects of the invention and
any constructs that are functionally equivalent are within the
scope of this invention. The deposit of material herein does not
constitute an admission that the written description herein
contained is inadequate to enable the practice of any aspect of the
invention, including the best mode thereof, nor is it to be
construed as limiting the scope of the claims to the specific
illustrations that it represents. Indeed, various modifications of
the invention in addition to those shown and described herein will
become apparent to those skilled in the art from the foregoing
description and fall within the scope of the appended claims.
Sequence CWU 1
1
30 1 299 PRT Homo sapiens 1 Met Gly Thr Lys Ala Gln Val Glu Arg Lys
Leu Leu Cys Leu Phe 1 5 10 15 Ile Leu Ala Ile Leu Leu Cys Ser Leu
Ala Leu Gly Ser Val Thr 20 25 30 Val His Ser Ser Glu Pro Glu Val
Arg Ile Pro Glu Asn Asn Pro 35 40 45 Val Lys Leu Ser Cys Ala Tyr
Ser Gly Phe Ser Ser Pro Arg Val 50 55 60 Glu Trp Lys Phe Asp Gln
Gly Asp Thr Thr Arg Leu Val Cys Tyr 65 70 75 Asn Asn Lys Ile Thr
Ala Ser Tyr Glu Asp Arg Val Thr Phe Leu 80 85 90 Pro Thr Gly Ile
Thr Phe Lys Ser Val Thr Arg Glu Asp Thr Gly 95 100 105 Thr Tyr Thr
Cys Met Val Ser Glu Glu Gly Gly Asn Ser Tyr Gly 110 115 120 Glu Val
Lys Val Lys Leu Ile Val Leu Val Pro Pro Ser Lys Pro 125 130 135 Thr
Val Asn Ile Pro Ser Ser Ala Thr Ile Gly Asn Arg Ala Val 140 145 150
Leu Thr Cys Ser Glu Gln Asp Gly Ser Pro Pro Ser Glu Tyr Thr 155 160
165 Trp Phe Lys Asp Gly Ile Val Met Pro Thr Asn Pro Lys Ser Thr 170
175 180 Arg Ala Phe Ser Asn Ser Ser Tyr Val Leu Asn Pro Thr Thr Gly
185 190 195 Glu Leu Val Phe Asp Pro Leu Ser Ala Ser Asp Thr Gly Glu
Tyr 200 205 210 Ser Cys Glu Ala Arg Asn Gly Tyr Gly Thr Pro Met Thr
Ser Asn 215 220 225 Ala Val Arg Met Glu Ala Val Glu Arg Asn Val Gly
Val Ile Val 230 235 240 Ala Ala Val Leu Val Thr Leu Ile Leu Leu Gly
Ile Leu Val Phe 245 250 255 Gly Ile Trp Phe Ala Tyr Ser Arg Gly His
Phe Asp Arg Thr Lys 260 265 270 Lys Gly Thr Ser Ser Lys Lys Val Ile
Tyr Ser Gln Pro Ser Ala 275 280 285 Arg Ser Glu Gly Glu Phe Lys Gln
Thr Ser Ser Phe Leu Val 290 295 2 321 PRT Homo sapiens 2 Met Gly
Ile Leu Leu Gly Leu Leu Leu Leu Gly His Leu Thr Val 1 5 10 15 Asp
Thr Tyr Gly Arg Pro Ile Leu Glu Val Pro Glu Ser Val Thr 20 25 30
Gly Pro Trp Lys Gly Asp Val Asn Leu Pro Cys Thr Tyr Asp Pro 35 40
45 Leu Gln Gly Tyr Thr Gln Val Leu Val Lys Trp Leu Val Gln Arg 50
55 60 Gly Ser Asp Pro Val Thr Ile Phe Leu Arg Asp Ser Ser Gly Asp
65 70 75 His Ile Gln Gln Ala Lys Tyr Gln Gly Arg Leu His Val Ser
His 80 85 90 Lys Val Pro Gly Asp Val Ser Leu Gln Leu Ser Thr Leu
Glu Met 95 100 105 Asp Asp Arg Ser His Tyr Thr Cys Glu Val Thr Trp
Gln Thr Pro 110 115 120 Asp Gly Asn Gln Val Val Arg Asp Lys Ile Thr
Glu Leu Arg Val 125 130 135 Gln Lys Leu Ser Val Ser Lys Pro Thr Val
Thr Thr Gly Ser Gly 140 145 150 Tyr Gly Phe Thr Val Pro Gln Gly Met
Arg Ile Ser Leu Gln Cys 155 160 165 Gln Ala Arg Gly Ser Pro Pro Ile
Ser Tyr Ile Trp Tyr Lys Gln 170 175 180 Gln Thr Asn Asn Gln Glu Pro
Ile Lys Val Ala Thr Leu Ser Thr 185 190 195 Leu Leu Phe Lys Pro Ala
Val Ile Ala Asp Ser Gly Ser Tyr Phe 200 205 210 Cys Thr Ala Lys Gly
Gln Val Gly Ser Glu Gln His Ser Asp Ile 215 220 225 Val Lys Phe Val
Val Lys Asp Ser Ser Lys Leu Leu Lys Thr Lys 230 235 240 Thr Glu Ala
Pro Thr Thr Met Thr Tyr Pro Leu Lys Ala Thr Ser 245 250 255 Thr Val
Lys Gln Ser Trp Asp Trp Thr Thr Asp Met Asp Gly Tyr 260 265 270 Leu
Gly Glu Thr Ser Ala Gly Pro Gly Lys Ser Leu Pro Val Phe 275 280 285
Ala Ile Ile Leu Ile Ile Ser Leu Cys Cys Met Val Val Phe Thr 290 295
300 Met Ala Tyr Ile Met Leu Cys Arg Lys Thr Ser Gln Gln Glu His 305
310 315 Val Tyr Glu Ala Ala Arg 320 3 390 DNA Homo Sapien 3
cttcttgcca actggtatca ccttcaagtc cgtgacacgg gaagacactg 50
ggacatacac ttgtatggtc tctgaggaag gcggcaacag ctatggggag 100
gtcaaggtca agctcatcgt gcttgtgcct ccatccaagc ctacagttaa 150
catcccctcc tctgccacca ttgggaaccg ggcagtgctg acatgctcag 200
aacaagatgg ttccccacct tctgaataca cctggttcaa agatgggata 250
gtgatgccta cgaatcccaa aagcacccgt gccttcagca actcttccta 300
tgtcctgaat cccacaacag gagagctggt ctttgatccc ctgtcagcct 350
ctgatactgg agaatacagc tgtgaggcac ggaatgggta 390 4 726 DNA Homo
Sapien 4 tctcagtccc ctcgctgtag tcgcggagct gtgttctgtt tcccaggagt 50
ccttcggcgg ctgttgtgct caggtgcgcc tgatcgcgat ggggacaaag 100
gcgcaagctc gagaggaaac tgttgtgcct cttcatattg gcgatcctgt 150
tgtgctccct ggcattgggc agtgttacag ttgcactctt ctgaacctga 200
agtcagaatt cctgagaata atcctgtgaa gttgtcctgt gcctactcgg 250
gcttttcttc tccccgtgtg gagtggaagt ttgaccaagg agacaccacc 300
agactcgttt gctataataa caagatcaca gcttcctatg aggaccgggt 350
gaccttcttg ccaactggta tcaccttcaa gtccgtgaca cgggaagaca 400
ctgggacata cacttgtatg gtctctgagg aaggcggcaa cagctatggg 450
gaggtcaagg tcaagctcat cgtgcttgtg cctccatcca agcctacagt 500
taacatcccc tcctctgcca ccattgggaa ccgggcagtg ctgacatgct 550
cagaacaaga tggttcccca ccttctgaat acacctggtt caaagatggg 600
atagtgatgc ctacgaatcc caaaagcacc cgtgccttca gcaactcttc 650
ctatgtcctg aatcccacaa caggagagct ggtctttgat cccctgtcag 700
cctctgatac tggagaatac agctgt 726 5 1503 DNA Homo Sapien 5
gcaggcaaag taccagggcc gcctgcatgt gagccacaag gttccaggag 50
atgtatccct ccaattgagc accctggaga tggatgaccg gagccactac 100
acgtgtgaag tcacctggca gactcctgat ggcaaccaag tcgtgagaga 150
taagattact gagctccgtg tccagaaact ctctgtctcc aagcccacag 200
tgacaactgg cagcggttat ggcttcacgg tgccccaggg aatgaggatt 250
agccttcaat gccagggttc ggggttctcc tcccatcagt tatatttggt 300
ataagcaaca gactaataac cagggaaccc atcaaagtag caaccctaag 350
taccttactc ttcaagcctg cggtgatagc cgactcaggc tcctatttct 400
gcactgccaa gggccaggtt ggctctgagc agcacagcga cattgtgaag 450
tttgtggtca aagactcctc aaagctactc aagaccaaga ctgaggcacc 500
tacaaccatg acatacccct tgaaagcaac atctacagtg aagcagtcct 550
gggactggac cactgacatg gatggctacc ttggagagac cagtgctggg 600
ccaggaaaga gcctgcctgt ctttgccatc atcctcatca tctccttgtg 650
ctgtatggtg gtttttacca tggcctatat catgctctgt cggaagacat 700
cccaacaaga gcatgtctac gaagcagcca gggcacatgc cagagaggcc 750
aacgactctg gagaaaccat gagggtggcc atcttcgcaa gtggctgctc 800
cagtgatgag ccaacttccc agaatctggg gcaacaacta ctctgatgag 850
ccctgcatag gacaggagta ccagatcatc gcccagatca atggcaacta 900
cgcccgcctg ctggacacag ttcctctgga ttatgagttt ctggccactg 950
agggcaaaag tgtctgttaa aaatgcccca ttaggccagg atctgctgac 1000
ataattgcct agtcagtcct tgccttctgc atggccttct tccctgctac 1050
ctctcttcct ggatagccca aagtgtccgc ctaccaacac tggagccgct 1100
gggagtcact ggctttgccc tggaatttgc cagatgcatc tcaagtaagc 1150
cagctgctgg atttggctct gggcccttct agtatctctg ccgggggctt 1200
ctggtactcc tctctaaata ccagagggaa gatgcccata gcactaggac 1250
ttggtcatca tgcctacaga cactattcaa ctttggcatc ttgccaccag 1300
aagacccgag gggaggctca gctctgccag ctcagaggac cagctatatc 1350
caggatcatt tctctttctt cagggccaga cagcttttaa ttgaaattgt 1400
tatttcacag gccagggttc agttctgctc ctccactata agtctaatgt 1450
tctgactctc tcctggtgct caataaatat ctaatcataa cagcaaaaaa 1500 aaa
1503 6 319 PRT Homo sapiens 6 Met Val Gly Lys Met Trp Pro Val Leu
Trp Thr Leu Cys Ala Val 1 5 10 15 Arg Val Thr Val Asp Ala Ile Ser
Val Glu Thr Pro Gln Asp Val 20 25 30 Leu Arg Ala Ser Gln Gly Lys
Ser Val Thr Leu Pro Cys Thr Tyr 35 40 45 His Thr Ser Thr Ser Ser
Arg Glu Gly Leu Ile Gln Trp Asp Lys 50 55 60 Leu Leu Leu Thr His
Thr Glu Arg Val Val Ile Trp Pro Phe Ser 65 70 75 Asn Lys Asn Tyr
Ile His Gly Glu Leu Tyr Lys Asn Arg Val Ser 80 85 90 Ile Ser Asn
Asn Ala Glu Gln Ser Asp Ala Ser Ile Thr Ile Asp 95 100 105 Gln Leu
Thr Met Ala Asp Asn Gly Thr Tyr Glu Cys Ser Val Ser 110 115 120 Leu
Met Ser Asp Leu Glu Gly Asn Thr Lys Ser Arg Val Arg Leu 125 130 135
Leu Val Leu Val Pro Pro Ser Lys Pro Glu Cys Gly Ile Glu Gly 140 145
150 Glu Thr Ile Ile Gly Asn Asn Ile Gln Leu Thr Cys Gln Ser Lys 155
160 165 Glu Gly Ser Pro Thr Pro Gln Tyr Ser Trp Lys Arg Tyr Asn Ile
170 175 180 Leu Asn Gln Glu Gln Pro Leu Ala Gln Pro Ala Ser Gly Gln
Pro 185 190 195 Val Ser Leu Lys Asn Ile Ser Thr Asp Thr Ser Gly Tyr
Tyr Ile 200 205 210 Cys Thr Ser Ser Asn Glu Glu Gly Thr Gln Phe Cys
Asn Ile Thr 215 220 225 Val Ala Val Arg Ser Pro Ser Met Asn Val Ala
Leu Tyr Val Gly 230 235 240 Ile Ala Val Gly Val Val Ala Ala Leu Ile
Ile Ile Gly Ile Ile 245 250 255 Ile Tyr Cys Cys Cys Cys Arg Gly Lys
Asp Asp Asn Thr Glu Asp 260 265 270 Lys Glu Asp Ala Arg Pro Asn Arg
Glu Ala Tyr Glu Glu Pro Pro 275 280 285 Glu Gln Leu Arg Glu Leu Ser
Arg Glu Arg Glu Glu Glu Asp Asp 290 295 300 Tyr Arg Gln Glu Glu Gln
Arg Ser Thr Gly Arg Glu Ser Pro Asp 305 310 315 His Leu Asp Gln 7
2181 DNA Homo sapiens 7 cccacgcgtc cgcccacgcg tccgcccacg ggtccgccca
cgcgtccggg 50 ccaccagaag tttgagcctc tttggtagca ggaggctgga
agaaaggaca 100 gaagtagctc tggctgtgat ggggatctta ctgggcctgc
tactcctggg 150 gcacctaaca gtggacactt atggccgtcc catcctggaa
gtgccagaga 200 gtgtaacagg accttggaaa ggggatgtga atcttccctg
cacctatgac 250 cccctgcaag gctacaccca agtcttggtg aagtggctgg
tacaacgtgg 300 ctcagaccct gtcaccatct ttctacgtga ctcttctgga
gaccatatcc 350 agcaggcaaa gtaccagggc cgcctgcatg tgagccacaa
ggttccagga 400 gatgtatccc tccaattgag caccctggag atggatgacc
ggagccacta 450 cacgtgtgaa gtcacctggc agactcctga tggcaaccaa
gtcgtgagag 500 ataagattac tgagctccgt gtccagaaac tctctgtctc
caagcccaca 550 gtgacaactg gcagcggtta tggcttcacg gtgccccagg
gaatgaggat 600 tagccttcaa tgccaggctc ggggttctcc tcccatcagt
tatatttggt 650 ataagcaaca gactaataac caggaaccca tcaaagtagc
aaccctaagt 700 accttactct tcaagcctgc ggtgatagcc gactcaggct
cctatttctg 750 cactgccaag ggccaggttg gctctgagca gcacagcgac
attgtgaagt 800 ttgtggtcaa agactcctca aagctactca agaccaagac
tgaggcacct 850 acaaccatga catacccctt gaaagcaaca tctacagtga
agcagtcctg 900 ggactggacc actgacatgg atggctacct tggagagacc
agtgctgggc 950 caggaaagag cctgcctgtc tttgccatca tcctcatcat
ctccttgtgc 1000 tgtatggtgg tttttaccat ggcctatatc atgctctgtc
ggaagacatc 1050 ccaacaagag catgtctacg aagcagccag gtaagaaagt
ctctcctctt 1100 ccatttttga ccccgtccct gccctcaatt ttgattactg
gcaggaaatg 1150 tggaggaagg ggggtgtggc acagacccaa tcctaaggcc
ggaggccttc 1200 agggtcagga catagctgcc ttccctctct caggcacctt
ctgaggttgt 1250 tttggccctc tgaacacaaa ggataattta gatccatctg
ccttctgctt 1300 ccagaatccc tgggtggtag gatcctgata attaattggc
aagaattgag 1350 gcagaagggt gggaaaccag gaccacagcc ccaagtccct
tcttatgggt 1400 ggtgggctct tgggccatag ggcacatgcc agagaggcca
acgactctgg 1450 agaaaccatg agggtggcca tcttcgcaag tggctgctcc
agtgatgagc 1500 caacttccca gaatctgggc aacaactact ctgatgagcc
ctgcatagga 1550 caggagtacc agatcatcgc ccagatcaat ggcaactacg
cccgcctgct 1600 ggacacagtt cctctggatt atgagtttct ggccactgag
ggcaaaagtg 1650 tctgttaaaa atgccccatt aggccaggat ctgctgacat
aattgcctag 1700 tcagtccttg ccttctgcat ggccttcttc cctgctacct
ctcttcctgg 1750 atagcccaaa gtgtccgcct accaacactg gagccgctgg
gagtcactgg 1800 ctttgccctg gaatttgcca gatgcatctc aagtaagcca
gctgctggat 1850 ttggctctgg gcccttctag tatctctgcc gggggcttct
ggtactcctc 1900 tctaaatacc agagggaaga tgcccatagc actaggactt
ggtcatcatg 1950 cctacagaca ctattcaact ttggcatctt gccaccagaa
gacccgaggg 2000 aggctcagct ctgccagctc agaggaccag ctatatccag
gatcatttct 2050 ctttcttcag ggccagacag cttttaattg aaattgttat
ttcacaggcc 2100 agggttcagt tctgctcctc cactataagt ctaatgttct
gactctctcc 2150 tggtgctcaa taaatatcta atcataacag c 2181 8 1295 DNA
Homo sapiens 8 cccagaagtt caagggcccc cggcctcctg cgctcctgcc
gccgggaccc 50 tcgacctcct cagagcagcc ggctgccgcc ccgggaagat
ggcgaggagg 100 agccgccacc gcctcctcct gctgctgctg cgctacctgg
tggtcgccct 150 gggctatcat aaggcctatg ggttttctgc cccaaaagac
caacaagtag 200 tcacagcagt agagtaccaa gaggctattt tagcctgcaa
aaccccaaag 250 aagactgttt cctccagatt agagtggaag aaactgggtc
ggagtgtctc 300 ctttgtctac tatcaacaga ctcttcaagg tgattttaaa
aatcgagctg 350 agatgataga tttcaatatc cggatcaaaa atgtgacaag
aagtgatgcg 400 gggaaatatc gttgtgaagt tagtgcccca tctgagcaag
gccaaaacct 450 ggaagaggat acagtcactc tggaagtatt agtggctcca
gcagttccat 500 catgtgaagt accctcttct gctctgagtg gaactgtggt
agagctacga 550 tgtcaagaca aagaagggaa tccagctcct gaatacacat
ggtttaagga 600 tggcatccgt ttgctagaaa atcccagact tggctcccaa
agcaccaaca 650 gctcatacac aatgaataca aaaactggaa ctctgcaatt
taatactgtt 700 tccaaactgg acactggaga atattcctgt gaagcccgca
attctgttgg 750 atatcgcagg tgtcctggga aacgaatgca agtagatgat
ctcaacataa 800 gtggcatcat agcagccgta gtagttgtgg ccttagtgat
ttccgtttgt 850 ggccttggtg tatgctatgc tcagaggaaa ggctactttt
caaaagaaac 900 ctccttccag aagagtaatt cttcatctaa agccacgaca
atgagtgaaa 950 atgtgcagtg gctcacgcct gtaatcccag cactttggaa
ggccgcggcg 1000 ggcggatcac gaggtcagga gttctagacc agtctggcca
atatggtgaa 1050 accccatctc tactaaaata caaaaattag ctgggcatgg
tggcatgtgc 1100 ctgcagttcc agctgcttgg gagacaggag aatcacttga
acccgggagg 1150 cggaggttgc agtgagctga gatcacgcca ctgcagtcca
gcctgggtaa 1200 cagagcaaga ttccatctca aaaaataaaa taaataaata
aataaatact 1250 ggtttttacc tgtagaattc ttacaataaa tatagcttga tattc
1295 9 312 PRT Homo sapiens 9 Met Ala Arg Arg Ser Arg His Arg Leu
Leu Leu Leu Leu Leu Arg 1 5 10 15 Tyr Leu Val Val Ala Leu Gly Tyr
His Lys Ala Tyr Gly Phe Ser 20 25 30 Ala Pro Lys Asp Gln Gln Val
Val Thr Ala Val Glu Tyr Gln Glu 35 40 45 Ala Ile Leu Ala Cys Lys
Thr Pro Lys Lys Thr Val Ser Ser Arg 50 55 60 Leu Glu Trp Lys Lys
Leu Gly Arg Ser Val Ser Phe Val Tyr Tyr 65 70 75 Gln Gln Thr Leu
Gln Gly Asp Phe Lys Asn Arg Ala Glu Met Ile 80 85 90 Asp Phe Asn
Ile Arg Ile Lys Asn Val Thr Arg Ser Asp Ala Gly 95 100 105 Lys Tyr
Arg Cys Glu Val Ser Ala Pro Ser Glu Gln Gly Gln Asn 110 115 120 Leu
Glu Glu Asp Thr Val Thr Leu Glu Val Leu Val Ala Pro Ala 125 130 135
Val Pro Ser Cys Glu Val Pro Ser Ser Ala Leu Ser Gly Thr Val 140 145
150 Val Glu Leu Arg Cys Gln Asp Lys Glu Gly Asn Pro Ala Pro Glu 155
160 165 Tyr Thr Trp Phe Lys Asp Gly Ile Arg Leu Leu Glu Asn Pro Arg
170 175 180 Leu Gly Ser Gln Ser Thr Asn Ser Ser Tyr Thr Met Asn Thr
Lys 185 190 195 Thr Gly Thr Leu Gln Phe
Asn Thr Val Ser Lys Leu Asp Thr Gly 200 205 210 Glu Tyr Ser Cys Glu
Ala Arg Asn Ser Val Gly Tyr Arg Arg Cys 215 220 225 Pro Gly Lys Arg
Met Gln Val Asp Asp Leu Asn Ile Ser Gly Ile 230 235 240 Ile Ala Ala
Val Val Val Val Ala Leu Val Ile Ser Val Cys Gly 245 250 255 Leu Gly
Val Cys Tyr Ala Gln Arg Lys Gly Tyr Phe Ser Lys Glu 260 265 270 Thr
Ser Phe Gln Lys Ser Asn Ser Ser Ser Lys Ala Thr Thr Met 275 280 285
Ser Glu Asn Val Gln Trp Leu Thr Pro Val Ile Pro Ala Leu Trp 290 295
300 Lys Ala Ala Ala Gly Gly Ser Arg Gly Gln Glu Phe 305 310 10 300
PRT Mus musculus 10 Met Gly Thr Glu Gly Lys Ala Gly Arg Lys Leu Leu
Phe Leu Phe 1 5 10 15 Thr Ser Met Ile Leu Gly Ser Leu Val Gln Gly
Lys Gly Ser Val 20 25 30 Tyr Thr Ala Gln Ser Asp Val Gln Val Pro
Glu Asn Glu Ser Ile 35 40 45 Lys Leu Thr Cys Thr Tyr Ser Gly Phe
Ser Ser Pro Arg Val Glu 50 55 60 Trp Lys Phe Val Gln Gly Ser Thr
Thr Ala Leu Val Cys Tyr Asn 65 70 75 Ser Gln Ile Thr Ala Pro Tyr
Ala Asp Arg Val Thr Phe Ser Ser 80 85 90 Ser Gly Ile Thr Phe Ser
Ser Val Thr Arg Lys Asp Asn Gly Glu 95 100 105 Tyr Thr Cys Met Val
Ser Glu Glu Gly Gly Gln Asn Tyr Gly Glu 110 115 120 Val Ser Ile His
Leu Thr Val Leu Val Pro Pro Ser Lys Pro Thr 125 130 135 Ile Ser Val
Pro Ser Ser Val Thr Ile Gly Asn Arg Ala Val Leu 140 145 150 Thr Cys
Ser Glu His Asp Gly Ser Pro Pro Ser Glu Tyr Ser Trp 155 160 165 Phe
Lys Asp Gly Ile Ser Met Leu Thr Ala Asp Ala Lys Lys Thr 170 175 180
Arg Ala Phe Met Asn Ser Ser Phe Thr Ile Asp Pro Lys Ser Gly 185 190
195 Asp Leu Ile Phe Asp Pro Val Thr Ala Phe Asp Ser Gly Glu Tyr 200
205 210 Tyr Cys Gln Ala Gln Asn Gly Tyr Gly Thr Ala Met Arg Ser Glu
215 220 225 Ala Ala His Met Asp Ala Val Glu Leu Asn Val Gly Gly Ile
Val 230 235 240 Ala Ala Val Leu Val Thr Leu Ile Leu Leu Gly Leu Leu
Ile Phe 245 250 255 Gly Val Trp Phe Ala Tyr Ser Arg Gly Tyr Phe Glu
Thr Thr Lys 260 265 270 Lys Gly Thr Ala Pro Gly Lys Lys Val Ile Tyr
Ser Gln Pro Ser 275 280 285 Thr Arg Ser Glu Gly Glu Phe Lys Gln Thr
Ser Ser Phe Leu Val 290 295 300 11 2181 DNA Homo sapiens 11
cccacgcgtc cgcccacgcg tccgcccacg ggtccgccca cgcgtccggg 50
ccaccagaag tttgagcctc tttggtagca ggaggctgga agaaaggaca 100
gaagtagctc tggctgtgat ggggatctta ctgggcctgc tactcctggg 150
gcacctaaca gtggacactt atggccgtcc catcctggaa gtgccagaga 200
gtgtaacagg accttggaaa ggggatgtga atcttccctg cacctatgac 250
cccctgcaag gctacaccca agtcttggtg aagtggctgg tacaacgtgg 300
ctcagaccct gtcaccatct ttctacgtga ctcttctgga gaccatatcc 350
agcaggcaaa gtaccagggc cgcctgcatg tgagccacaa ggttccagga 400
gatgtatccc tccaattgag caccctggag atggatgacc ggagccacta 450
cacgtgtgaa gtcacctggc agactcctga tggcaaccaa gtcgtgagag 500
ataagattac tgagctccgt gtccagaaac tctctgtctc caagcccaca 550
gtgacaactg gcagcggtta tggcttcacg gtgccccagg gaatgaggat 600
tagccttcaa tgccaggctc ggggttctcc tcccatcagt tatatttggt 650
ataagcaaca gactaataac caggaaccca tcaaagtagc aaccctaagt 700
accttactct tcaagcctgc ggtgatagcc gactcaggct cctatttctg 750
cactgccaag ggccaggttg gctctgagca gcacagcgac attgtgaagt 800
ttgtggtcaa agactcctca aagctactca agaccaagac tgaggcacct 850
acaaccatga catacccctt gaaagcaaca tctacagtga agcagtcctg 900
ggactggacc actgacatgg atggctacct tggagagacc agtgctgggc 950
caggaaagag cctgcctgtc tttgccatca tcctcatcat ctccttgtgc 1000
tgtatggtgg tttttaccat ggcctatatc atgctctgtc ggaagacatc 1050
ccaacaagag catgtctacg aagcagccag gtaagaaagt ctctcctctt 1100
ccatttttga ccccgtccct gccctcaatt ttgattactg gcaggaaatg 1150
tggaggaagg ggggtgtggc acagacccaa tcctaaggcc ggaggccttc 1200
agggtcagga catagctgcc ttccctctct caggcacctt ctgaggttgt 1250
tttggccctc tgaacacaaa ggataattta gatccatctg ccttctgctt 1300
ccagaatccc tgggtggtag gatcctgata attaattggc aagaattgag 1350
gcagaagggt gggaaaccag gaccacagcc ccaagtccct tcttatgggt 1400
ggtgggctct tgggccatag ggcacatgcc agagaggcca acgactctgg 1450
agaaaccatg agggtggcca tcttcgcaag tggctgctcc agtgatgagc 1500
caacttccca gaatctgggc aacaactact ctgatgagcc ctgcatagga 1550
caggagtacc agatcatcgc ccagatcaat ggcaactacg cccgcctgct 1600
ggacacagtt cctctggatt atgagtttct ggccactgag ggcaaaagtg 1650
tctgttaaaa atgccccatt aggccaggat ctgctgacat aattgcctag 1700
tcagtccttg ccttctgcat ggccttcttc cctgctacct ctcttcctgg 1750
atagcccaaa gtgtccgcct accaacactg gagccgctgg gagtcactgg 1800
ctttgccctg gaatttgcca gatgcatctc aagtaagcca gctgctggat 1850
ttggctctgg gcccttctag tatctctgcc gggggcttct ggtactcctc 1900
tctaaatacc agagggaaga tgcccatagc actaggactt ggtcatcatg 1950
cctacagaca ctattcaact ttggcatctt gccaccagaa gacccgaggg 2000
aggctcagct ctgccagctc agaggaccag ctatatccag gatcatttct 2050
ctttcttcag ggccagacag cttttaattg aaattgttat ttcacaggcc 2100
agggttcagt tctgctcctc cactataagt ctaatgttct gactctctcc 2150
tggtgctcaa taaatatcta atcataacag c 2181 12 24 DNA artificial
sequence Synthetic oligonucleotide probe 12 tcgcggagct gtgttctgtt
tccc 24 13 50 DNA artificial sequence Synthetic oligonucleotide
probe 13 tgatcgcgat ggggacaaag gcgcaagctc gagaggaaac tgttgtgcct 50
14 20 DNA artificial sequence Synthetic oligonucleotide probe 14
acacctggtt caaagatggg 20 15 24 DNA artificial sequence Synthetic
oligonucleotide probe 15 taggaagagt tgctgaaggc acgg 24 16 20 DNA
artificial sequence Synthetic oligonucleotide probe 16 ttgccttact
caggtgctac 20 17 20 DNA artificial sequence Synthetic
oligonucleotide probe 17 actcagcagt ggtaggaaag 20 18 24 DNA
artificial sequence Synthetic oligonucleotide probe 18 tatccctcca
attgagcacc ctgg 24 19 21 DNA artificial sequence Synthetic
oligonucleotide probe 19 gtcggaagac atcccaacaa g 21 20 24 DNA
artificial sequence Synthetic oligonucleotide probe 20 cttcacaatg
tcgctgtgct gctc 24 21 24 DNA artificial sequence Synthetic
oligonucleotide probe 21 agccaaatcc agcagctggc ttac 24 22 50 DNA
artificial sequence Synthetic oligonucleotide probe 22 tggatgaccg
gagccactac acgtgtgaag tcacctggca gactcctgat 50 23 260 PRT Homo
sapiens 23 Leu Ala Leu Gly Ser Val Thr Val His Ser Ser Glu Pro Glu
Val 1 5 10 15 Arg Ile Pro Glu Asn Asn Pro Val Lys Leu Ser Cys Ala
Tyr Ser 20 25 30 Gly Phe Ser Ser Pro Arg Val Glu Trp Lys Phe Asp
Gln Gly Asp 35 40 45 Thr Thr Arg Leu Val Cys Tyr Asn Asn Lys Ile
Thr Ala Ser Tyr 50 55 60 Glu Asp Arg Val Thr Phe Leu Pro Thr Gly
Ile Thr Phe Lys Ser 65 70 75 Val Thr Arg Glu Asp Thr Gly Thr Tyr
Thr Cys Met Val Ser Glu 80 85 90 Glu Gly Gly Asn Ser Tyr Gly Glu
Val Lys Val Lys Leu Ile Val 95 100 105 Leu Val Pro Pro Ser Lys Pro
Thr Val Asn Ile Pro Ser Ser Ala 110 115 120 Thr Ile Gly Asn Arg Ala
Val Leu Thr Cys Ser Glu Gln Asp Gly 125 130 135 Ser Pro Pro Ser Glu
Tyr Thr Trp Phe Lys Asp Gly Ile Val Met 140 145 150 Pro Thr Asn Pro
Lys Ser Thr Arg Ala Phe Ser Asn Ser Ser Tyr 155 160 165 Val Leu Asn
Pro Thr Thr Gly Glu Leu Val Phe Asp Pro Leu Ser 170 175 180 Ala Ser
Asp Thr Gly Glu Tyr Ser Cys Glu Ala Arg Asn Gly Tyr 185 190 195 Gly
Thr Pro Met Thr Ser Asn Ala Val Arg Met Glu Ala Val Glu 200 205 210
Arg Asn Val Gly Val Ile Val Ala Ala Val Leu Val Thr Leu Ile 215 220
225 Leu Leu Gly Ile Leu Val Phe Gly Ile Trp Phe Ala Tyr Ser Arg 230
235 240 Gly His Phe Asp Arg Thr Lys Lys Gly Thr Ser Ser Lys Lys Val
245 250 255 Ile Tyr Ser Gln Pro 260 24 270 PRT Homo sapiens 24 Val
Arg Val Thr Val Asp Ala Ile Ser Val Glu Thr Pro Gln Asp 1 5 10 15
Val Leu Arg Ala Ser Gln Gly Lys Ser Val Thr Leu Pro Cys Thr 20 25
30 Tyr His Thr Ser Thr Ser Ser Arg Glu Gly Leu Ile Gln Trp Asp 35
40 45 Lys Leu Leu Leu Thr His Thr Glu Arg Val Val Ile Trp Pro Phe
50 55 60 Ser Asn Lys Asn Tyr Ile His Gly Glu Leu Tyr Lys Asn Arg
Val 65 70 75 Ser Ile Ser Asn Asn Ala Glu Gln Ser Asp Ala Ser Ile
Thr Ile 80 85 90 Asp Gln Leu Thr Met Ala Asp Asn Gly Thr Tyr Glu
Cys Ser Val 95 100 105 Ser Leu Met Ser Asp Leu Glu Gly Asn Thr Lys
Ser Arg Val Arg 110 115 120 Leu Leu Val Leu Val Pro Pro Ser Lys Pro
Glu Cys Gly Ile Glu 125 130 135 Gly Glu Thr Ile Ile Gly Asn Asn Ile
Gln Leu Thr Cys Gln Ser 140 145 150 Lys Glu Gly Ser Pro Thr Pro Gln
Tyr Ser Trp Lys Arg Tyr Asn 155 160 165 Ile Leu Asn Gln Glu Gln Pro
Leu Ala Gln Pro Ala Ser Gly Gln 170 175 180 Pro Val Ser Leu Lys Asn
Ile Ser Thr Asp Thr Ser Gly Tyr Tyr 185 190 195 Ile Cys Thr Ser Ser
Asn Glu Glu Gly Thr Gln Phe Cys Asn Ile 200 205 210 Thr Val Ala Val
Arg Ser Pro Ser Met Asn Val Ala Leu Tyr Val 215 220 225 Gly Ile Ala
Val Gly Val Val Ala Ala Leu Ile Ile Ile Gly Ile 230 235 240 Ile Ile
Tyr Cys Cys Cys Cys Arg Gly Lys Asp Asp Asn Thr Glu 245 250 255 Asp
Lys Glu Asp Ala Arg Pro Asn Arg Glu Ala Tyr Glu Glu Pro 260 265 270
25 263 PRT Homo sapiens 25 Leu Cys Ser Leu Ala Leu Gly Ser Val Thr
Val His Ser Ser Glu 1 5 10 15 Pro Glu Val Arg Ile Pro Glu Asn Asn
Pro Val Lys Leu Ser Cys 20 25 30 Ala Tyr Ser Gly Phe Ser Ser Pro
Arg Val Glu Trp Lys Phe Asp 35 40 45 Gln Gly Asp Thr Thr Arg Leu
Val Cys Tyr Asn Asn Lys Ile Thr 50 55 60 Ala Ser Tyr Glu Asp Arg
Val Thr Phe Leu Pro Thr Gly Ile Thr 65 70 75 Phe Lys Ser Val Thr
Arg Glu Asp Thr Gly Thr Tyr Thr Cys Met 80 85 90 Val Ser Glu Glu
Gly Gly Asn Ser Tyr Gly Glu Val Lys Val Lys 95 100 105 Leu Ile Val
Leu Val Pro Pro Ser Lys Pro Thr Val Asn Ile Pro 110 115 120 Ser Ser
Ala Thr Ile Gly Asn Arg Ala Val Leu Thr Cys Ser Glu 125 130 135 Gln
Asp Gly Ser Pro Pro Ser Glu Tyr Thr Trp Phe Lys Asp Gly 140 145 150
Ile Val Met Pro Thr Asn Pro Lys Ser Thr Arg Ala Phe Ser Asn 155 160
165 Ser Ser Tyr Val Leu Asn Pro Thr Thr Gly Glu Leu Val Phe Asp 170
175 180 Pro Leu Ser Ala Ser Asp Thr Gly Glu Tyr Ser Cys Glu Ala Arg
185 190 195 Asn Gly Tyr Gly Thr Pro Met Thr Ser Asn Ala Val Arg Met
Glu 200 205 210 Ala Val Glu Arg Asn Val Gly Val Ile Val Ala Ala Val
Leu Val 215 220 225 Thr Leu Ile Leu Leu Gly Ile Leu Val Phe Gly Ile
Trp Phe Ala 230 235 240 Tyr Ser Arg Gly His Phe Asp Arg Thr Lys Lys
Gly Thr Ser Ser 245 250 255 Lys Lys Val Ile Tyr Ser Gln Pro 260 26
273 PRT Homo sapiens 26 Leu Cys Ala Val Arg Val Thr Val Asp Ala Ile
Ser Val Glu Thr 1 5 10 15 Pro Gln Asp Val Leu Arg Ala Ser Gln Gly
Lys Ser Val Thr Leu 20 25 30 Pro Cys Thr Tyr His Thr Ser Thr Ser
Ser Arg Glu Gly Leu Ile 35 40 45 Gln Trp Asp Lys Leu Leu Leu Thr
His Thr Glu Arg Val Val Ile 50 55 60 Trp Pro Phe Ser Asn Lys Asn
Tyr Ile His Gly Glu Leu Tyr Lys 65 70 75 Asn Arg Val Ser Ile Ser
Asn Asn Ala Glu Gln Ser Asp Ala Ser 80 85 90 Ile Thr Ile Asp Gln
Leu Thr Met Ala Asp Asn Gly Thr Tyr Glu 95 100 105 Cys Ser Val Ser
Leu Met Ser Asp Leu Glu Gly Asn Thr Lys Ser 110 115 120 Arg Val Arg
Leu Leu Val Leu Val Pro Pro Ser Lys Pro Glu Cys 125 130 135 Gly Ile
Glu Gly Glu Thr Ile Ile Gly Asn Asn Ile Gln Leu Thr 140 145 150 Cys
Gln Ser Lys Glu Gly Ser Pro Thr Pro Gln Tyr Ser Trp Lys 155 160 165
Arg Tyr Asn Ile Leu Asn Gln Glu Gln Pro Leu Ala Gln Pro Ala 170 175
180 Ser Gly Gln Pro Val Ser Leu Lys Asn Ile Ser Thr Asp Thr Ser 185
190 195 Gly Tyr Tyr Ile Cys Thr Ser Ser Asn Glu Glu Gly Thr Gln Phe
200 205 210 Cys Asn Ile Thr Val Ala Val Arg Ser Pro Ser Met Asn Val
Ala 215 220 225 Leu Tyr Val Gly Ile Ala Val Gly Val Val Ala Ala Leu
Ile Ile 230 235 240 Ile Gly Ile Ile Ile Tyr Cys Cys Cys Cys Arg Gly
Lys Asp Asp 245 250 255 Asn Thr Glu Asp Lys Glu Asp Ala Arg Pro Asn
Arg Glu Ala Tyr 260 265 270 Glu Glu Pro 27 413 DNA Homo Sapien 27
ctcgagccgc tcgagccgtg cggggaaata tcgttgtgaa gttagtgccc 50
catctgagca aggccaaaac ctggaagagg atacagtcac tctggaagta 100
ttagtggctc cagcagttcc atcatgtgaa gtaccctctt ctgctctgag 150
tggaactgtg gtagagctac gatgtcaaga caaagaaggg aatccagctc 200
ctgaatacac atggtttaag gatggcatcc gtttgctaga aaatcccaga 250
cttggctccc aaagcaccaa cagctcatac acaatgaata caaaaactgg 300
aactctgcaa tttaatactg tttccaaact ggacactgga gaatattcct 350
gtgaagcccg caattctgtt ggatatcgca ggtgtcctgg ggaaacgaat 400
gcaagtagat gat 413 28 22 DNA artificial sequence Synthetic
oligonucleotide probe 28 atcgttgtga agttagtgcc cc 22 29 23 DNA
artificial sequence Synthetic oligonucleotide probe 29 acctgcgata
tccaacagaa ttg 23 30 48 DNA artificial sequence Synthetic
oligonucleotide probe 30 ggaagaggat acagtcactc tggaagtatt
agtggctcca gcagttcc 48
* * * * *