Homogentisate prenyl transferase ("HPT") nucleic acids and polypeptides, and uses thereof

Abstract

The present invention is in the field of plant genetics and biochemistry. More specifically, the present invention relates to genes and polypeptides associated with the tocopherol biosynthesis pathway, namely those encoding homogentisate prenyl transferase activity, and uses thereof.

Description

[0001] This application claims priority to U.S. No. 60/365,202 filed Mar. 19, 2002, the disclosure of which is incorporated herein by reference in its entirety.

[0002] The present invention is in the field of plant genetics and biochemistry. More specifically, the present invention relates to genes and polypeptides associated with the tocopherol biosynthesis pathway, namely those encoding homogentisate prenyl transferase activity, and uses thereof.

[0003] Isoprenoids are ubiquitous compounds found in all living organisms. Plants synthesize a diverse array of greater than 22,000 isoprenoids (Connolly and Hill, Dictionary of Terpenoids, Chapman and Hall, New York, N.Y. (1992)). In plants, isoprenoids play essential roles in particular cell functions such as production of sterols, contributing to eukaryotic membrane architecture, acyclic polyprenoids found in the side chain of ubiquinone and plastoquinone, growth regulators like abscisic acid, gibberellins, brassinosteroids or the photosynthetic pigments chlorophylls and carotenoids. Although the physiological role of other plant isoprenoids is less evident, like that of the vast array of secondary metabolites, some are known to play key roles mediating the adaptative responses to different environmental challenges. In spite of the remarkable diversity of structure and function, all isoprenoids originate from a single metabolic precursor, isopentenyl diphosphate (IPP) (Wright, (1961) Annu. Rev. Biochem., 20:525-548; and Spurgeon and Porter, In: Biosynthesis of Isoprenoid Compounds, Porter and Spurgeon (eds.) John Wiley, NY, Vol. 1, pp. 1-46 (1981)).

[0004] A number of unique and interconnected biochemical pathways derived from the isoprenoid pathway leading to secondary metabolites, including tocopherols, exist in chloroplasts of higher plants. Tocopherols not only perform vital functions in plants, but are also important from mammalian nutritional perspectives. In plastids, tocopherols account for up to 40% of the total quinone pool. Tocopherols are an important component of mammalian diets. Epidemiological evidence indicates that tocopherol supplementation can result in decreased risk for cardiovascular disease and cancer, can aid in immune function, and is associated with prevention or retardation of a number of degenerative disease processes in humans (Traber and Sies, Annu. Rev. Nutr., 16:321-347 (1996)). Tocopherol functions, in part, by stabilizing the lipid bilayer of biological membranes (Skrypin and Kagan, Biochim. Biophys. Acta, 815:209 (1995); Kagan, N.Y. Acad. Sci., p. 121 (1989); Gomez-Fernandez et al., Ann. N. Y. Acad. Sci., p. 109 (1989)), reducing polyunsaturated fatty acid (PUFA) free radicals generated by lipid oxidation (Fukuzawa et al., Lipids, 17:511-513 (1982)), and scavenging oxygen free radicals, lipid peroxy radicals and singlet oxygen species (Diplock et al., Ann. N Y Acad. Sci., 570:72 (1989); Fryer, Plant Cell Environ., 15(4):381-392 (1992)).

[0005] The compound .alpha.-tocopherol, which is often referred to as vitamin E, belongs to a class of lipid-soluble antioxidants that includes .alpha., .beta., .gamma., and .delta.-tocopherols and .alpha., .beta., .gamma., and .delta.-tocotrienols. Although .alpha., .beta., .gamma., and .delta.-tocopherols and .alpha., .beta., .gamma., and .delta.-tocotrienols are sometimes referred to collectively as "vitamin E", vitamin E is more appropriately defined chemically as .alpha.-tocopherol. Vitamin E, or .alpha.-tocopherol, is significant for human health, in part because it is readily absorbed and retained by the body, and therefore has a higher degree of bioactivity than other tocopherol species (Traber and Sies, Annu. Rev. Nutr., 16:321-347 (1996)). Other tocopherols, however, such as .beta., .gamma., and .delta.-tocopherols also have significant health and nutritional benefits.

[0006] Tocopherols are primarily synthesized only by plants and certain other photosynthetic organisms, including cyanobacteria. As a result, mammalian dietary tocopherols are obtained almost exclusively from these sources. Plant tissues vary considerably in total tocopherol content and tocopherol composition, with .alpha.-tocopherol the predominant tocopherol species found in green, photosynthetic plant tissues. Leaf tissue can contain from 10-50 .mu.g of total tocopherols per gram fresh weight, but most of the world's major staple crops (e.g., rice, corn, wheat, potato) produce low to extremely low levels of total tocopherols, of which only a small percentage is .alpha.-tocopherol (Hess, Vitamin E, .alpha.-tocopherol, In: Antioxidants in Higher Plants, R. Alscher and J. Hess, (eds.), CRC Press, Boca Raton., pp. 111-134 (1993)). Oil seed crops generally contain much higher levels of total tocopherols, but .alpha.-tocopherol is present only as a minor component in most oilseeds (Taylor and Barnes, Chemy Ind., October:722-726 (1981)).

[0007] The recommended daily dietary intake of 15-30 mg of vitamin E is quite difficult to achieve from the average American diet. For example, it would take over 750 grams of spinach leaves, in which .alpha.-tocopherol comprises 60% of total tocopherols, or 200-400 grams of soybean oil to satisfy this recommended daily vitamin E intake. While it is possible to augment the diet with supplements, most of these supplements contain primarily synthetic vitamin E, having eight stereoisomers, whereas natural vitamin E is predominantly composed of only a single isomer. Furthermore, supplements tend to be relatively expensive, and the general population is disinclined to take vitamin supplements on a regular basis. Therefore, there is a need in the art for compositions and methods that either increase the total tocopherol production or increase the relative percentage of .alpha.-tocopherol produced by plants.

[0008] In addition to the health benefits of tocopherols, increased .alpha.-tocopherol levels in crops have been associated with enhanced stability and extended shelf life of plant products (Peterson, Cereal-Chem., 72(1):21-24 (1995); Ball, Fat-soluble vitamin assays in food analysis. A comprehensive review, London, Elsevier Science Publishers Ltd. (1988)). Further, tocopherol supplementation of swine, beef, and poultry feeds has been shown to significantly increase meat quality and extend the shelf life of post-processed meat products by retarding post-processing lipid oxidation, which contributes to the undesirable flavor components (Sante and Lacourt, J. Sci. Food Agric., 65(4):503-507 (1994); Buckley et al., J. of Animal Science, 73:3122-3130 (1995)).

[0009] Tocopherol Biosynthesis

[0010] The plastids of higher plants exhibit interconnected biochemical pathways leading to secondary metabolites including tocopherols. The tocopherol biosynthetic pathway in higher plants involves condensation of homogentisic acid and phytylpyrophosphate to form 2-methylphytylplastoquinol (Fiedler et al., Planta, 155:511-515 (1982); Soll et al., Arch. Biochem. Biophys., 204:544-550 (1980); Marshall et al., Phytochem., 24:1705-1711 (1985)). This plant tocopherol pathway can be divided into four parts: 1) synthesis of homogentisic acid (HGA), which contributes to the aromatic ring of tocopherol; 2) synthesis of phytylpyrophosphate, which contributes to the side chain of tocopherol; 3) joining of HGA and phytylpyrophosphate via a homogentisate prenyl transferase followed by a subsequent cyclization; and 4) S-adenosyl methionine dependent methylation of an aromatic ring, which affects the relative abundance of each of the tocopherol species. See FIG. 1.

[0011] Various genes and their encoded proteins that are involved in tocopherol biosynthesis include those listed in the table below: TABLE-US-00001 Gene ID Enzyme name tyrA Bifunctional prephenate dehydrogenase slr1736 Homogentisate prenyl transferase from Synechocystis ATPT2 Homogentisate prenyl transferase from Arabidopsis thaliana DXS 1-Deoxyxylulose-5-phosphate synthase DXR 1-Deoxyxylulose-5-phosphate reductoisomerase GGPPS Geranylgeranyl pyrophosphate synthase HPPD p-Hydroxyphenylpyruvate dioxygenase AANT1 Adenylate transporter slr1737 Tocopherol cyclase IDI Isopentenyl diphosphate isomerase GGH Geranylgeranyl diphosphate reductase GMT Gamma Methyl Transferase tMT2 Tocopherol methyl transferase 2 MT1 Methyl transferase 1 gcpE (E)-4-hydroxy-3-methylbut-2-enyl diphosphate synthase

[0012] The "Gene IDs" given in the table above identify the gene associated with the listed enzyme. Any of the Gene IDs listed in the table appearing herein in the present disclosure refer to the gene encoding the enzyme with which the Gene ID is associated in the table.

[0013] As used herein, HPT, HPT2, PPT, slr1736, and ATPT2 each refer to proteins or genes encoding proteins that have the same activity.

[0014] Synthesis of Homogentisic Acid

[0015] Homogentisic acid is the common precursor to both tocopherols and plastoquinones. In at least some bacteria the synthesis of homogentisic acid is reported to occur via the conversion of chorismate to prephenate and then to p-hydroxyphenylpyruvate via a bifunctional prephenate dehydrogenase. Examples of bifunctional bacterial prephenate dehydrogenase enzymes include the proteins encoded by the tyrA genes of Erwinia herbicola and Escherichia coli. The tyrA gene product catalyzes the production of prephenate from chorismate, as well as the subsequent dehydrogenation of prephenate to form p-hydroxyphenylpyruvate (p-HPP), the immediate precursor to homogentisic acid. p-HPP is then converted to homogentisic acid by hydroxyphenylpyruvate dioxygenase (HPPD). In contrast, plants are believed to lack prephenate dehydrogenase activity, and it is generally believed that the synthesis of homogentisic acid from chorismate occurs via the synthesis and conversion of the intermediate arogenate. Since pathways involved in homogentisic acid synthesis are also responsible for tyrosine formation, any alterations in these pathways can also result in the alteration in tyrosine synthesis and the synthesis of other aromatic amino acids.

[0016] Synthesis of Phytylpyrophosphate

[0017] Tocopherols are a member of the class of compounds referred to as the isoprenoids. Other isoprenoids include carotenoids, gibberellins, terpenes, chlorophyll and abscisic acid. A central intermediate in the production of isoprenoids is isopentenyl diphosphate (IPP). Cytoplasmic and plastid-based pathways to generate IPP have been reported. The cytoplasmic based pathway involves the enzymes acetoacetyl CoA thiolase, HMGCoA synthase, HMGCoA reductase, mevalonate kinase, phosphomevalonate kinase, and mevalonate pyrophosphate decarboxylase.

[0018] Recently, evidence for the existence of an alternative, plastid based, isoprenoid biosynthetic pathway emerged from studies in the research groups of Rohmer and Arigoni (Eisenreich et al., Chem. Bio., 5:R221-R233 (1998); Rohmer, Prog. Drug. Res., 50:135-154 (1998); Rohmer, Comprehensive Natural Products Chemistry, Vol. 2, pp. 45-68, Barton and Nakanishi (eds.), Pergamon Press, Oxford, England (1999)), who found that the isotope labeling patterns observed in studies on certain eubacterial and plant terpenoids could not be explained in terms of the mevalonate pathway. Arigoni and coworkers subsequently showed that 1-deoxyxylulose, or a derivative thereof, serves as an intermediate of the novel pathway, now referred to as the MEP pathway (Rohmer et al., Biochem. J., 295:517-524 (1993); Schwarz, Ph.D. thesis, Eidgenossiche Technische Hochschule, Zurich, Switzerland (1994)). Recent studies showed the formation of 1-deoxyxylulose 5-phosphate (Broers, Ph.D. thesis, Eidgenossiche Technische Hochschule, Zurich, Switzerland (1994)) from one molecule each of glyceraldehyde 3-phosphate (Rohmer, Comprehensive Natural Products Chemistry, Vol. 2, pp. 45-68, Barton and Nakanishi (eds.), Pergamon Press, Oxford, England (1999)) and pyruvate (Eisenreich et al., Chem. Biol., 5:R223-R233 (1998); Schwarz supra; Rohmer et al., J. Am. Chem. Soc., 118:2564-2566 (1996); and Sprenger et al., Proc. Natl. Acad. Sci. (U.S.A.), 94:12857-12862 (1997)) by an enzyme encoded by the dxs gene (Lois et al., Proc. Natl. Acad. Sci. (U.S.A.), 95:2105-2110 (1997); and Lange et al., Proc. Natl. Acad. Sci. (U.S.A.), 95:2100-2104 (1998)). 1-Deoxyxylulose 5-phosphate can be further converted into 2-C-methylerythritol 4-phosphate (Arigoni et al., Proc. Natl. Acad. Sci. (U.S.A.), 94:10600-10605 (1997)) by a reductoisomerase encoded by the dxr gene (Bouvier et al., Plant Physiol, 117:1421-1431 (1998); and Rohdich et al., Proc. Natl. Acad. Sci. (U.S.A.), 96:11758-11763 (1999)).

[0019] Reported genes in the MEP pathway also include ygbP, which catalyzes the conversion of 2-C-methylerythritol 4-phosphate into its respective cytidyl pyrophosphate derivative and ygbB, which catalyzes the conversion of 4-phosphocytidyl-2-C-methyl-D-erythritol into 2-C-methyl-D-erythritol, 3,4-cyclophosphate. These genes are tightly linked on the E. coli genome (Herz et al., Proc. Natl. Acad. Sci. (U.S.A.), 97(6):2485-2490 (2000)).

[0020] Once IPP is formed by the MEP pathway, it is converted to GGDP by GGPDP synthase, and then to phytylpyrophosphate, which is the central constituent of the tocopherol side chain.

[0021] Combination and Cyclization

[0022] Homogentisic acid is combined with either phytyl-pyrophosphate or solanyl-pyrophosphate by homogentisate prenyl transferase (HPT) forming 2-methylphytyl plastoquinol or 2-methylsolanyl plastoquinol, respectively. 2-methylsolanyl plastoquinol is a precursor to the biosynthesis of plastoquinones, while 2-methylphytyl plastoquinol is ultimately converted to tocopherol.

[0023] Methylation of the Aromatic Ring

[0024] The major structural difference between each of the tocopherol subtypes is the position of the methyl groups around the phenyl ring. Both 2-methylphytyl plastoquinol and 2-methylsolanyl plastoquinol serve as substrates for the plant enzyme 2-methylphytylplastoquinol/2-methylsolanylplastoquinol methyltransferase (Tocopherol Methyl Transferase 2; Methyl Transferase 2; MT2; tMT2), which is capable of methylating a tocopherol precursor. Subsequent methylation at the 5 position of .gamma.-tocopherol by .gamma.-tocopherol methyl-transferase (GMT) generates the biologically active .alpha.-tocopherol.

[0025] Some plants e.g. soy produce substantial amounts of delta and subsequently beta-tocopherol in their seed. The formation of .delta.-tocopherol or .beta.-tocopherol can be prevented by the overexpression of tMT2, resulting in the methylation of the .delta.-tocopherol precursor, 2-methyl phytyl plastoquinone to form 2,3-dimethyl-5-phytyl plastoquinone followed by cyclization with tocopherol cyclase to form .gamma.-tocopherol and a subsequent methylation by GMT to form .alpha.-tocopherol. In a possible alternative pathway, .beta.-tocopherol is directly converted to .alpha.-tocopherol by tMT2 via the methylation of the 3 position (see, for example, Biochemical Society Transactions, 11:504-510 (1983); Introduction to Plant Biochemistry, 2.sup.nd edition, Chapter 11 (1983); Vitamin Hormone, 29:153-200 (1971); Biochemical Journal, 109:577 (1968); and, Biochemical and Biophysical Research Communication, 28(3):295 (1967)). Since all potential mechanisms for the generation of .alpha.-tocopherol involve catalysis by tMT2, plants that are deficient in this activity accumulate .delta.-tocopherol and .beta.-tocopherol. Plants which have increased tMT2 activity tend to accumulate .gamma.-tocopherol and .alpha.-tocopherol. Since there is limited GMT activity in the seeds of many plants, these plants tend to accumulate .gamma.-tocopherol.

[0026] There is a need in the art for nucleic acid molecules encoding enzymes involved in tocopherol biosysnthesis, as well as related enzymes and antibodies for the enhancement or alteration of tocopherol production in plants. There is a further need for transgenic organisms expressing those nucleic acid molecules involved in tocopherol biosynthesis, which are capable of nutritionally enhancing food and feed sources.

SUMMARY OF THE INVENTION

[0027] The present invention includes and provides a substantially purified nucleic acid molecule encoding an amino acid sequence selected from the group consisting of SEQ ID NOs: 5, 9-11, 57-58, and 90.

[0028] The present invention includes and provides a substantially purified polypeptide molecule comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 5, 9-11, 57-58, and 90.

[0029] The present invention includes and provides an antibody capable of specifically binding a polypeptide comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 5, 9-11, 57-58, and 90.

[0030] The present invention includes and provides a substantially purified nucleic acid molecule encoding a polypeptide having homogentisate prenyl transferase activity comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 43 and 44.

[0031] The present invention includes and provides a substantially purified polypeptide having homogentisate prenyl transferase activity comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 43 and 44.

[0032] The present invention includes and provides a transformed plant comprising an introduced nucleic acid molecule encoding a polypeptide comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 5, 9-11, 43-44, 57-58, and 90, and complements thereof.

[0033] The present invention includes and provides a transformed plant comprising an introduced first nucleic acid molecule encoding a polypeptide comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 5, 9-11, 43-44, 57-58, and 90, and complements thereof, and an introduced second nucleic acid molecule encoding an enzyme selected from the group consisting of tyrA, prephenate dehyrogenase, tocopherol cyclase, dxs, dxr, GMT, MT1, tMT2, GCPE, GGPPS, HPPD, AANT1, IDI, GGH, and complements thereof.

[0034] The present invention includes and provides a transformed plant comprising a nucleic acid molecule comprising an introduced promoter region which functions in plant cells to cause the production of an mRNA molecule, wherein said introduced promoter region is linked to a transcribed nucleic acid molecule having a transcribed strand and a non-transcribed strand, wherein said transcribed strand is complementary to a nucleic acid molecule encoding a polypeptide selected from the group consisting of SEQ ID NOs: 5, 9-11, 43-44, 57-58, and 90, and wherein said transcribed nucleic acid molecule is linked to a 3' non-translated sequence that functions in the plant cells to cause termination of transcription and addition of polyadenylated ribonucleotides to a 3' end of the mRNA sequence.

[0035] The present invention includes and provides a method of producing a plant having a seed with an increased total tocopherol level comprising: (A) transforming said plant with an introduced nucleic acid molecule encoding a polypeptide comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 5, 9-11, 43-44, 57-58, and 90; and (B) growing said transformed plant.

[0036] The present invention includes and provides a method of producing a plant having a seed with an increased total tocopherol level comprising: (A) transforming said plant with an introduced first nucleic acid molecule, wherein said first nucleic acid molecule encodes a polypeptide having an amino acid sequence selected from the group consisting of SEQ ID NOs: 5, 9-11, 43-44, 57-58, and 90, and an introduced second nucleic acid molecule encoding an enzyme selected from the group consisting of tyrA, prephenate dehydrogenase, tocopherol cyclase, dxs, dxr, GMT, MT1, tMT2, GGPPS, GCPE, HPPD, AANT1, IDI, GGH, and complements thereof; and (B) growing said transformed plant.

[0037] The present invention includes and provides a seed derived from a transformed plant comprising an introduced nucleic acid molecule encoding a polypeptide comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 5, 9-11, 43-44, 57-58, and 90.

[0038] The present invention includes and provides a seed derived from a transformed plant comprising an introduced first nucleic acid molecule encoding an introduced polypeptide comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 5, 9-11, 43, 44, 57, 58, and 90 and an introduced second nucleic acid encoding an enzyme selected from the group consisting of tyrA, prephenate dehydrogenase, tocopherol cyclase, dxs, dxr, GMT, MT1, GCPE, tMT2, GGPPS, HPPD, AANT1, IDI, GGH, and complements thereof.

[0039] The present invention includes and provides a substantially purified polypeptide comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 39-42, 46-49, and 92-95 wherein said amino acid sequence is not derived from a nucleic acid molecule that is derived from Nostoc punctiforme, Anabaena, Synechocystis, Zea mays, Glycine max, Arabidopsis thaliana, Oryza sativa, Trichodesmium erythraeum, Chloroflexus aurantiacus, wheat, leek, canola, cotton, or tomato. The present invention includes and provides said substantially purified polypeptide wherein more than one more amino acid sequence is selected from the group consisting of SEQ ID NOs: 39-42, 46-49, and 92-95.

[0040] The present invention includes and provides a substantially purified nucleic acid molecule encoding a polypeptide comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 39-42, 46-49, and 92-95 wherein said nucleic acid molecule is not derived from Nostoc punctiforme, Anabaena, Synechocystis, Zea mays, Glycine max, Arabidopsis thaliana, Oryza sativa, Trichodesmium erythraeum, Chloroflexus aurantiacus, wheat, leek, canola, cotton, or tomato. The present invention includes and provides said nucleic acid molecule wherein the polypeptide further comprises more than one amino acid sequence selected from the group consisting of SEQ ID NOs: 39-42, 46-49, and 92-95.

[0041] The present invention includes and provides a substantially purified nucleic acid molecule encoding a polypeptide comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 39-42, 46-49, and 92-95 wherein said nucleic acid molecule is not derived from Nostoc punctiforme, Anabaena, Synechocystis, Zea mays, Glycine max, Arabidopsis thaliana, Oryza sativa, Sulfolobus, Aeropyum, Trichodesmium erythraeum, Chloroflexus aurantiacus, sorghum, wheat, tomato, or leek. The present invention includes and provides said nucleic acid molecule wherein the polypeptide further comprises more than one amino acid sequence selected from the group consisting of SEQ ID NOs: 39-42, 46-49 and 92-95.

[0042] The present invention includes and provides a plant transformed with a nucleic acid molecule encoding a polypeptide comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 39-42, 46-49, and 92-95 wherein said nucleic acid molecule is not derived from Nostoc punctiforme, Anabaena, Synechocystis, Zea mays, Glycine max, Arabidopsis thaliana, Oryza sativa, Sulfolobus, Aeropyum, Trichodesmium erythraeum, Chloroflexus aurantiacus, sorghum, wheat, tomato, or leek. The present invention includes and provides said nucleic acid molecule wherein the polypeptide further comprises more than one amino acid sequence selected from the group consisting of SEQ ID NOs: 39-42, 46-49, and 92-95.

[0043] The present invention includes and provides a substantially purified polypeptide comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 39-42, 46-49, and 92-95 wherein said polypeptide does not comprise any of the amino acid sequences set forth in sequence listings in WO 00/68393 (which sequences are incorporated herein by reference); WO 00/63391 (which sequences are incorporated herein by reference); WO 01/62781 (which sequences are incorporated herein by reference); or WO 02/33060 (which sequences are incorporated herein by reference); and does not comprise SEQ ID NOs: 1-11, 43-45, 57-58, 61-62, or 90 from the present application.

[0044] The present invention includes and provides a substantially purified polypeptide comprising more than onean amino acid sequence selected from the group consisting of SEQ ID NOs: 39-42, 46-49, and 92-95.

[0045] The present invention includes and provides a substantially purified nucleic acid molecule encoding a polypeptide comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 39-42, 46-49, and 92-95 wherein said nucleic acid molecule does not comprise any of the nucleic acid sequences set forth in sequence listings in WO 00/68393; WO 00/63391; WO 01/62781; or WO 02/33060; and does not comprise SEQ ID NOs: 27-36, 59-60, 88-89, and 91 from the present application, or the gene with Genebank Accession Nos. AI 897027 or AW 563431 The present invention includes and provides said nucleic acid molecule wherein the polypeptide further comprises more than one amino acid sequence selected from the group consisting of SEQ ID NOs: 39-42, 46-49, and 92-95.

[0046] The present invention includes and provides a plant transformed with a nucleic acid molecule encoding a polypeptide comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 39-42, 46-49, and 92-95 wherein said nucleic acid molecule does not comprise any of the nucleic acid sequences set forth in sequence listings in WO 00/68393; WO 00/63391; WO 01/62781; or WO 02/33060; and does not comprise SEQ ID NOs: 27-36; 59-60, 88-89, and 91 from the present application, or the gene with Genebank Accession Nos. AI 897027 or AW 563431. The present invention includes and provides said nucleic acid molecule wherein the polypeptide further comprises more than one amino acid sequence selected from the group consisting of SEQ ID NOs: 39-42, 46-49, and 92-95.

[0047] The present invention includes and provides a substantially purified nucleic acid molecule comprising a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 31, 34-36, 59-60, and 91.

[0048] The present invention includes and provides for homogentisate prenyl transferases discovered using one or more of the alignments of FIGS. 2a-2c, 3a-3c, 24a-24b, 25a-25b, 33a-33c, 34a-34b, 35a-35b and 36.

Description of the Nucleic and Amino Acid Sequences

[0049] SEQ ID NO: 1 sets forth a Nostoc punctiforme homogentisate prenyl transferase polypeptide.

[0050] SEQ ID NO: 2 sets forth an Anabaena homogentisate prenyl transferase polypeptide.

[0051] SEQ ID NO: 3 sets forth a Synechocystis homogentisate prenyl transferase polypeptide.

[0052] SEQ ID NO: 4 sets forth a Zea mays homogentisate prenyl transferase polypeptide (HPT1).

[0053] SEQ ID NO: 5 sets forth a Glycine max homogentisate prenyl transferase polypeptide (HPT1-2).

[0054] SEQ ID NO: 6 sets forth a Glycine max homogentisate prenyl transferase polypeptide (HPT1-1).

[0055] SEQ ID NO: 7 sets forth an Arabidopsis thaliana homogentisate prenyl transferase polypeptide (HPT1).

[0056] SEQ ID NO: 8 sets forth a partial Cuphea pulcherrima homogentisate prenyl transferase polypeptide.

[0057] SEQ ID NO: 9 sets forth a leek homogentisate prenyl transferase polypeptide (HPT1).

[0058] SEQ ID NO: 10 sets forth a wheat homogentisate prenyl transferase polypeptide (HPT1).

[0059] SEQ ID NO: 11 sets forth a Cuphea pulcherrima homogentisate prenyl transferase polypeptide (HPT1).

[0060] SEQ ID NOs: 12-15 represent domains from SEQ ID NOs: 1-8.

[0061] SEQ ID NOs: 16-26 set forth primer sequences.

[0062] SEQ ID NO: 27 sets forth a nucleic acid molecule encoding a Nostoc punctiforme homogentisate prenyl transferase polypeptide.

[0063] SEQ ID NO: 28 sets forth a nucleic acid molecule encoding an Anabaena homogentisate prenyl transferase polypeptide.

[0064] SEQ ID NO: 29 sets forth a nucleic acid molecule encoding a Synechocystis homogentisate prenyl transferase polypeptide.

[0065] SEQ ID NO: 30 sets forth a nucleic acid molecule encoding a Zea mays homogentisate prenyl transferase polypeptide (HPT1).

[0066] SEQ ID NO: 31 sets forth a nucleic acid molecule encoding a Glycine max homogentisate prenyl transferase polypeptide (HPT1-2).

[0067] SEQ ID NO: 32 sets forth a nucleic acid molecule encoding a Glycine max homogentisate prenyl transferase polypeptide (HPT1-1).

[0068] SEQ ID NO: 33 sets forth a nucleic acid molecule encoding an Arabidopsis thaliana homogentisate prenyl transferase polypeptide (HPT1).

[0069] SEQ ID NO: 34 sets forth a nucleic acid molecule encoding a Cuphea pulcherrima homogentisate prenyl transferase polypeptide (HPT1).

[0070] SEQ ID NO: 35 sets forth a nucleic acid molecule encoding a leek homogentisate prenyl transferase polypeptide (HPT1).

[0071] SEQ ID NO: 36 sets forth a nucleic acid molecule encoding a wheat homogentisate prenyl transferase polypeptide (HPM1).

[0072] SEQ ID NOs: 37-38 set forth primer sequences.

[0073] SEQ ID NOs: 39-42 set forth domains from SEQ ID NOs: 1-7 and 9-11.

[0074] SEQ ID NO: 43 sets forth a homogentisate prenyl transferase polypeptide from Trichodesmium erythraeum.

[0075] SEQ ID NO: 44 sets forth a homogentisate prenyl transferase polypeptide from Chloroflexus aurantiacus.

[0076] SEQ ID NO: 45 sets forth a putative sequence for an Arabidopsis thaliana homogentisate prenyl transferase polypeptide (HPT2).

[0077] SEQ ID NOs: 46-49 represent domains from SEQ ID NOs: 1-4, 6-7, 9-11, 57-58 and 91.

[0078] SEQ ID NOs: 50-56 set forth primer sequences.

[0079] SEQ ID NO: 57 sets forth an Arabidopsis thaliana homogentisate prenyl transferase polypeptide (HPT2).

[0080] SEQ ID NO: 58 sets forth an Oryza sativa homogentisate prenyl transferase polypeptide (HPT2).

[0081] SEQ ID NO: 59 sets forth a nucleic acid molecule encoding an Arabidopsis thaliana homogentisate prenyl transferase polypeptide (HPT2).

[0082] SEQ ID NO: 60 sets forth a nucleic acid molecule encoding an Oryza sativa homogentisate prenyl transferase polypeptide (HPT2).

[0083] SEQ ID NO: 61 sets forth a putative homogentisate prenyl transferase polypeptide from Arabidopsis thaliana (HPT2).

[0084] SEQ ID NO: 62 sets forth a putative homogentisate prenyl transferase polypeptide from Arabidopsis thaliana (HPT2).

[0085] SEQ ID NO: 63 sets forth an EST from Arabidopsis thaliana.

[0086] SEQ ID NO: 64 sets forth an EST from Medicago truncatula.

[0087] SEQ ID NO: 65 sets forth an EST from Medicago truncatula developing stem.

[0088] SEQ ID NO: 66 sets forth an EST from Medicago truncatula developing stem.

[0089] SEQ ID NO: 67 sets forth an EST from Medicago truncatula developing stem.

[0090] SEQ ID NO: 68 sets forth an EST from mixed potato tissues.

[0091] SEQ ID NO: 69 sets forth an EST from Arabidopsis thaliana, Columbia ecotype flower buds.

[0092] SEQ ID NO: 70 sets forth an EST from Arabidopsis thaliana.

[0093] SEQ ID NO: 71 sets forth an EST from Medicago truncatula.

[0094] SEQ ID NO: 72 sets forth an EST from Glycine max.

[0095] SEQ ID NOs: 73-83 and 84-87 set forth primer sequences.

[0096] SEQ ID NO: 88 sets forth a nucleic acid molecule encoding a homogentisate prenyl transferase polypeptide from cyanobacteria Trichodesmium erythraeum.

[0097] SEQ ID NO: 89 sets forth a nucleic acid molecule encoding a homogentisate prenyl transferase polypeptide from photobacteria Chloroflexus aurantiacus.

[0098] SEQ ID NO: 90 sets forth a Glycine max homogentisate prenyl transferase polypeptide (HPT2).

[0099] SEQ ID NO: 91 sets forth a nucleic acid molecule encoding a homogentisate prenyl transferase polypeptide from Glycine max (HPT2).

[0100] SEQ ID NOs: 92-95 represent domains from SEQ ID NOs: 1-4, 6-7, 9-11, 43-44, 57-58, and 90.

[0101] Note: cyanobacteria and photobbacteria have one HPT. Plants have both HPT1 and HPT2. In soy, there are two variations of HPT1, HPT1-1 and HPT1-2, as well as HPT2.

BRIEF DESCRIPTION OF THE FIGURES

[0102] FIG. 1 is a schematic diagram of the tocopherol biosynthetic pathway.

[0103] FIGS. 2a-2c depicts a sequence alignment for several homogentisate prenyl transferase polypeptides SEQ ID NOs: 1-8).

[0104] FIGS. 3a-3c depicts a sequence alignment for several homogentisate prenyl transferase polypeptides (SEQ ID NOs: 1-7, and 9-11).

[0105] FIG. 4 provides a schematic of the expression construct pCGN10800.

[0106] FIG. 5 provides a schematic of the expression construct pCGN10801.

[0107] FIG. 6 provides a schematic of the expression construct pCGN10803.

[0108] FIG. 7 provides a schematic of the expression construct pCGN10822.

[0109] FIG. 8 provides bar graphs of HPLC data obtained from seed extracts of transgenic Arabidopsis containing pCGN10822, which provides of the expression of the ATPT2 sequence (SEQ ID NO: 33), in the sense orientation, from the napin promoter. Provided are graphs for .alpha., .gamma., and .delta.-tocopherols, as well as total tocopherol for 22 transformed lines, as well as a nontransformed (wild-type) control.

[0110] FIG. 9 provides a bar graph of HPLC analysis of seed extracts from Arabidopsis plants transformed with a pCGN10803 (lines 1387 through 1624, enhanced 35S-ATPT2, in the antisense orientation), a nontransformed (wt) control, and an empty vector transformed control.

[0111] FIG. 10 provides a schematic of the expression construct pMON36581.

[0112] FIG. 11 provides a schematic of the expression construct pMON69933.

[0113] FIG. 12 provides a schematic of the expression construct pMON69924.

[0114] FIG. 13 provides a schematic of the expression construct pMON69943.

[0115] FIG. 14 provides a bar graph of total tocopherol levels in recombinant soy lines.

[0116] FIG. 15 depicts pMON 69960.

[0117] FIG. 16 depicts pMON 36525.

[0118] FIG. 17 depicts pMON 69963.

[0119] FIG. 18 depicts pMON 69965.

[0120] FIG. 19 depicts pMON 10098.

[0121] FIG. 20 depicts pMON 69964.

[0122] FIG. 21 depicts pMON 69966.

[0123] FIG. 22 depicts results of seed total tocopherol analysis.

[0124] FIG. 23 depicts results of seed total tocopherol analysis.

[0125] FIG. 24 depicts the alignments of SEQ ID NOs: 1-4, 6-7, 9-11, 57, and 90.

[0126] FIG. 25 depicts motifs V through VIII, SEQ ID NOs: 46-49.

[0127] FIG. 26 depicts a sequence tree derived from a multiple alignment shown from SEQ ID NOs: 1-7, 9-11, 43, 44, 57-58, and 90.

[0128] FIG. 27 depicts pMON81028.

[0129] FIG. 28 depicts pMON81023.

[0130] FIG. 29 depicts pMON36596.

[0131] FIG. 30 depicts pET30a(+) vector.

[0132] FIG. 31 depicts pMON69993.

[0133] FIG. 32 depicts pMON69992.

[0134] FIGS. 33a-33c depicts a sequence alignment for several homogentisate prenyl transferase polypeptide SEQ ID NOs: 1-4, 6-7, 9-11, 43-44, 57-58, and 90.

[0135] FIG. 34 depicts motifs IX through XII, SEQ ID NOs: 92-95.

[0136] FIG. 35 depicts motifs I-IV, SEQ ID NOs: 39-42.

[0137] FIG. 36 depicts motifs A-D.

DETAILED DESCRIPTION

[0138] The present invention provides a number of agents, for example, nucleic acid molecules and polypeptides associated with the synthesis of tocopherol, and provides uses of such agents.

[0139] Agents

[0140] The agents of the present invention will preferably be "biologically active" with respect to either a structural attribute, such as the capacity of a nucleic acid to hybridize to another nucleic acid molecule, or the ability of a protein to be bound by an antibody (or to compete with another molecule for such binding). Alternatively, such an attribute may be catalytic and thus involve the capacity of the agent to mediate a chemical reaction or response. The agents will preferably be "substantially purified". The term "substantially purified", as used herein, refers to a molecule separated from substantially all other molecules normally associated with it in its native environmental conditions. More preferably a substantially purified molecule is the predominant species present in a preparation. A substantially purified molecule may be greater than about 60% free, preferably about 75% free, more preferably about 90% free, and most preferably about 95% free from the other molecules (exclusive of solvent) present in the natural mixture. The term "substantially purified" is not intended to encompass molecules present in their native environmental conditions.

[0141] The agents of the present invention may also be recombinant. As used herein, the term recombinant means any agent (e.g., DNA, peptide etc.), that is, or results, however indirectly, from human manipulation of a nucleic acid molecule.

[0142] It is understood that the agents of the present invention may be labeled with reagents that facilitate detection of the agent (e.g., fluorescent labels, Prober et al., Science, 238:336-340 (1987); Albarella et al., EP 144 914; chemical labels, Sheldon et al., U.S. Pat. No. 4,582,789; Albarella et al., U.S. Pat. No. 4,563,417; modified bases, Miyoshi et al., EP 119 448).

[0143] Nucliec Acid Molecules

[0144] Agents of the present invention include nucleic acid molecules. In a preferred aspect of the present invention the nucleic acid molecule comprises a nucleic acid sequence that encodes a homogentisate prenyl transferase. As used herein, a homogentisate prenyl transferase is any plant protein that is capable of specifically catalyzing the formation of 2-methyl-6-phytylbenzoquinol (2-methyl-6-geranylgeranylbenzoquinol) from phytyl-DP (GGDP) and homogentisate.

[0145] An example of a more preferred homogentisate prenyl transferase is a polypeptide with the amino acid sequence selected from the group consisting of SEQ ID NOs: 5, 9-11, 43-44, 55, 58, and 90. In a more preferred embodiment, the homogentisate prenyl transferase is encoded by any nucleic acid molecule encoding an amino acid sequence selected from the group consisting of SEQ ID NOs: 5, 9-11, 43-44, 55, 58, and 90.

[0146] In another preferred aspect of the present invention the nucleic acid molecule of the present invention comprises a nucleic acid sequence encoding a polypeptide selected from the group consisting of SEQ ID NOs: 5, 9-11, 43-44, 55, 58, and 90, and complements thereof and fragments of either.

[0147] In another preferred aspect of the present invention the nucleic acid molecule of the present invention comprises a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 31, 34-36, 59-60, and 91.

[0148] In another embodiment, the present invention includes nucleic acid molecules encoding polypeptides having a region of conserved amino acid sequence shown in any of FIGS. 2a-2c, 3a-3c, 24a-24b, 25a-25b, 33a-33c, 34a-34b, 35a-b and 36, and complements of those nucleic acid molecules. In a preferred embodiment, the present invention includes nucleic acid molecules encoding polypeptides comprising a sequence selected from the group consisting of SEQ ID NOs: 39-42, 46-49, and 92-95, and complements of those nucleic acid molecules. The present invention includes and provides said nucleic acid molecule wherein the polypeptide further comprises more than one amino acid sequence selected from the group consisting of SEQ ID NOs: 39-42, 46-49, and 92-95.

[0149] In a further preferred embodiment the present invention includes nucleic acid molecules encoding polypeptides comprising two or more, three or more, or four sequences selected from the group consisting of SEQ ID NOs: 39-42, 46-49, and 92-95, and complements of those nucleic acid molecules. In another embodiment, the present invention includes nucleic acid molecules encoding polypeptides having homogentisate prenyl transferase activity and a region of conserved amino acid sequence shown in any of FIGS. 2a-2c, 3a-3c, 24a-24b, 25a-25b, 33a-33c, 34a-34b, 35a-35b and 36, and complements of those nucleic acid molecules. In a preferred embodiment, the present invention includes nucleic acid molecules encoding polypeptides having homogentisate prenyl transferase activity and comprising a sequence selected from the group consisting of SEQ ID NOs: 39-42, 46-49, and 92-95 and complements of those nucleic acid molecules. The present invention includes and provides said nucleic acid molecule wherein the polypeptide further comprises more than one amino acid sequence selected from the group consisting of SEQ ID NOs: 39-42, 46-49, and 92-95.

[0150] In a further preferred embodiment the present invention includes nucleic acid molecules encoding polypeptides having homogentisate prenyl transferase activity and comprising two or more, three or more, or four sequences selected from the group consisting of SEQ ID NOs: 39-42, 46-49, and 92-95, and complements of those nucleic acid molecules. In another embodiment, the present invention includes nucleic acid molecules, excluding nucleic acid molecules derived from Nostoc punctiforme, Anabaena, Synechocystis, Zea mays, Glycine max, Arabidopsis thaliana, Oryza sativa, Trichodesmium erythraeum, Chloroflexus aurantiacus, wheat, leek, canola, cotton, or tomato, encoding polypeptides having a region of conserved amino acid sequence shown in any of FIGS. 2a-2c, 3a-3c, 24a-24b, 25a-25b, 33a-33c, 34a-34b, 35a-35b and 36, and complements of those nucleic acid molecules. In a preferred embodiment, the present invention includes nucleic acid molecules, excluding nucleic acid molecules derived from Nostoc punctiforme, Anabaena, Synechocystis, Zea mays, Glycine max, Arabidopsis thaliana, Oryza sativa, Trichodesmium erythraeum, Chloroflexus aurantiacus, wheat, leek, canola, cotton, or tomato, encoding polypeptides comprising a sequence selected from the group consisting of SEQ ID NOs: 39-42, 46-49, and 92-95 and complements of those nucleic acid molecules. The present invention includes and provides said nucleic acid molecule wherein the polypeptide further comprises more than one amino acid sequence selected from the group consisting of SEQ ID NOs: 39-42, 46-49, and 92-95.

[0151] In a further preferred embodiment the present invention includes nucleic acid molecules, excluding nucleic acid molecules derived from Nostoc punctiforme, Anabaena, Synechocystis, Zea mays, Glycine max, Arabidopsis thaliana, Oryza sativa, Trichodesmium erythraeum, Chloroflexus aurantiacus, wheat, leek, canola, cotton, or tomato, encoding polypeptides comprising two or more, three or more, or four sequences selected from the group consisting of SEQ ID NOs: 39-42, 46-49, and 92-95.

[0152] In another embodiment, the present invention includes nucleic acid molecules, excluding nucleic acid molecules derived from Nostoc punctiforme, Anabaena, Synechocystis, Zea mays, Glycine max, Arabidopsis thaliana, Oryza sativa, Trichodesmium erythraeum, Chloroflexus aurantiacus, wheat, leek, canola, cotton, Sulfolobus, Aeropyum, sorghum, or tomato, encoding polypeptides having homogentisate prenyl transferase activity and a region of conserved amino acid sequence shown in any of FIGS. 2a-2c, 3a-3c, 24a-24b, 25a-25b, 33a-33c, 34a-34b, 35a-35b and 36 and complements of those nucleic acid molecules. In a preferred embodiment, the present invention includes nucleic acid molecules, excluding nucleic acid molecules derived from Nostoc punctiforme, Anabaena, Synechocystis, Zea mays, Glycine max, Arabidopsis thaliana, Oryza sativa, Trichodesmium erythraeum, Chloroflexus aurantiacus, wheat, leek, canola, cotton, or tomato, encoding polypeptides having homogentisate prenyl transferase activity and comprising a sequence selected from the group consisting of SEQ ID NOs: 39-42, 46-49, and 92-95. The present invention includes and provides said nucleic acid molecule wherein the polypeptide further comprises more than one amino acid sequence selected from the group consisting of SEQ ID NOs: 39-42, 46-49, and 92-95.

[0153] In a further preferred embodiment the present invention includes nucleic acid molecules, excluding nucleic acid molecules derived from Nostoc punctiforme, Anabaena, Synechocystis, Zea mays, Glycine max, Arabidopsis thaliana, Oryza sativa, Trichodesmium erythraeum, Chloroflexus aurantiacus, wheat, leek, canola, cotton, or tomato, encoding polypeptides having homogentisate prenyl transferase activity and comprising two or more, three or more, or four sequences selected from the group consisting of SEQ ID NOs: 39-42, 46-49, and 92-95.

[0154] In one embodiment of a method of the present invention, any of the nucleic acid sequences or polypeptide sequences, or fragments of either, of the present invention can be used to search for related sequences. In a preferred embodiment, a member selected from the group consisting of SEQ ID NOs: 5, 9-11, 43-44, 57-58, and 90 is used to search for related sequences. In a preferred embodiment, a member selected from the group consisting of SEQ ID NOs: 31, 34-36, 59-60, 88-89, and 91 is used to search for related sequences. In another embodiment, any of the motifs or regions of conserved sequence shown in FIGS. 2a-2c, 3a-3c, 24a-24b, 25a-25b, 33a-33c, 34a-34b, 35a-35b and 36 are used to search for related amino acid sequences. In a preferred embodiment, a member selected from the group consisting of SEQ ID NOs: 39-42 and 46-49 is used to search for related sequences. In one embodiment, one or more of SEQ ID NOs: 39-42, 46-49, and 92-95 is used to search for related sequences. As used herein, "search for related sequences" means any method of determining relatedness between two sequences, including, but not limited to, searches that compare sequence homology: for example, a PBLAST search of a database for relatedness to a single amino acid sequence. Other searches may be conducted using profile based methods, [0155] such as the HMM (Hidden Markov model) META-MEME [0156] (http://metameme.sdsc.edu/mhmm-links.html), PSI-BLAST [0157] (http://www.ncbi.nlm.nih.gov/BLAST/). The present invention includes and provides for homogentisate prenyl transferases discovered using one or more of the alignments of FIGS. 2a-2c, 3a-3c, 24a-24b, 25a-25b, 33a-33c, 34a-34b, 35a-35b and 36.

[0158] As used herein, a nucleic acid molecule is said to be "derived from" a particular organism, species, ecotype, etc., when the sequence of the nucleic acid molecule originated from that organism, species, ecotype, etc. "Derived from" therefore includes copies of nucleic acid molecules derived through, for example, PCR, as well as synthetically generated nucleic acid molecules having the same nucleic acid sequence as the original organism, species, ecotype, etc. Likewise, a polypeptide is said to be "derived from" a nucleic acid molecule when that nucleic acid molecule is used to code for the polypeptide, whether the polypeptide is enzymatically generated from the nucleic acid molecule or synthesized based on the sequence information inherent in the nucleic acid molecule.

[0159] The present invention includes the use of the above-described conserved sequences and fragments thereof in transgenic plants, other organisms, and for other uses, including, without limitation, as described below.

[0160] In another preferred aspect of the present invention a nucleic acid molecule comprises nucleotide sequences encoding a plastid transit peptide operably fused to a nucleic acid molecule that encodes a protein or fragment of the present invention.

[0161] In another preferred embodiment of the present invention, the nucleic acid molecules of the present invention encode mutant tocopherol homogentisate prenyl transferase enzymes. As used herein, a mutant enzyme is any enzyme that contains an amino acid that is different from the amino acid in the same position of a wild type enzyme of the same type.

[0162] It is understood that in a further aspect of nucleic acid sequences of the present invention, the nucleic acids can encode a protein that differs from any of the proteins in that one or more amino acids have been deleted, substituted or added without altering the function. For example, it is understood that codons capable of coding for such conservative amino acid substitutions are known in the art.

[0163] In one aspect of the present invention the nucleic acids of the present invention are said to be introduced nucleic acid molecules. A nucleic acid molecule is said to be "introduced" if it is inserted into a cell or organism as a result of human manipulation, no matter how indirect. Examples of introduced nucleic acid molecules include, without limitation, nucleic acids that have been introduced into cells via transformation, transfection, injection, and projection, and those that have been introduced into an organism via conjugation, endocytosis, phagocytosis, etc.

[0164] One subset of the nucleic acid molecules of the present invention is fragment nucleic acids molecules. Fragment nucleic acid molecules may consist of significant portion(s) of, or indeed most of, the nucleic acid molecules of the present invention, such as those specifically disclosed. Alternatively, the fragments may comprise smaller oligonucleotides (having from about 15 to about 400 nucleotide residues and more preferably, about 15 to about 30 nucleotide residues, or about 50 to about 100 nucleotide residues, or about 100 to about 200 nucleotide residues, or about 200 to about 400 nucleotide residues, or about 275 to about 350 nucleotide residues).

[0165] A fragment of one or more of the nucleic acid molecules of the present invention may be a probe and specifically a PCR probe. A PCR probe is a nucleic acid molecule capable of initiating a polymerase activity while in a double-stranded structure with another nucleic acid. Various methods for determining the structure of PCR probes and PCR techniques exist in the art. Computer generated searches using programs such as Primer3 (www-genome.wi.mit.edu/cgi-bin/primer/primer3.cgi), STSPipeline (www-genome.wi.mit.edu/cgi-bin/www-STS_Pipeline), or GeneUp (Pesole et al., BioTechniques, 25:112-123 (1998)), for example, can be used to identify potential PCR primers.

[0166] Nucleic acid molecules or fragments thereof of the present invention are capable of specifically hybridizing to other nucleic acid molecules under certain circumstances. Nucleic acid molecules of the present invention include those that specifically hybridize to those nucleic acid molecules disclosed herein, such as those encoding any of SEQ ID NOs: 5, 9-11, 43-44, 57-58, and 90, and complements thereof. Nucleic acid molecules of the present invention include those that specifically hybridize to a nucleic acid molecules comprising a member selected from the group consisting of SEQ ID NOs: 31, 34-36, 59-60, and 91, and complements thereof.

[0167] As used herein, two nucleic acid molecules are said to be capable of specifically hybridizing to one another if the two molecules are capable of forming an anti-parallel, double-stranded nucleic acid structure.

[0168] A nucleic acid molecule is said to be the "complement" of another nucleic acid molecule if they exhibit complete complementarity. As used herein, molecules are said to exhibit "complete complementarity" when every nucleotide of one of the molecules is complementary to a nucleotide of the other. Two molecules are said to be "minimally complementary" if they can hybridize to one another with sufficient stability to permit them to remain annealed to one another under at least conventional "low-stringency" conditions. Similarly, the molecules are said to be "complementary" if they can hybridize to one another with sufficient stability to permit them to remain annealed to one another under conventional "high-stringency" conditions. Conventional stringency conditions are described by Sambrook et al., Molecular Cloning, A Laboratory Manual, 2nd Ed., Cold Spring Harbor Press, Cold Spring Harbor, N.Y. (1989), and by Haymes et al., Nucleic Acid Hybridization, A Practical Approach, IRL Press, Washington, D.C. (1985). Departures from complete complementarity are therefore permissible, as long as such departures do not completely preclude the capacity of the molecules to form a double-stranded structure. Thus, in order for a nucleic acid molecule to serve as a primer or probe it need only be sufficiently complementary in sequence to be able to form a stable double-stranded structure under the particular solvent and salt concentrations employed.

[0169] Appropriate stringency conditions which promote DNA hybridization are, for example, 6.0.times. sodium chloride/sodium citrate (SSC) at about 45.degree. C., followed by a wash of 2.0.times.SSC at 20-25.degree. C., are known to those skilled in the art or can be found in Current Protocols in Molecular Biology, John Wiley & Sons, NY (1989), 6.3.1-6.3.6. For example, the salt concentration in the wash step can be selected from a low stringency of about 2.0.times.SSC at 50.degree. C. to a high stringency of about 0.2.times.SSC at 65.degree. C. In addition, the temperature in the wash step can be increased from low stringency conditions at room temperature, about 22.degree. C., to high stringency conditions at about 65.degree. C. Both temperature and salt may be varied, or either the temperature or the salt concentration may be held constant while the other variable is changed.

[0170] In a preferred embodiment, a nucleic acid of the present invention will specifically hybridize to one or more of the nucleic acid molecules described herein and complements thereof, such as those encoding any of SEQ ID NOs: 5, 9-11, 43-44, 57-58, and 90, under moderately stringent conditions, for example at about 2.0.times.SSC and about 65.degree. C.

[0171] In a particularly preferred embodiment, a nucleic acid of the present invention will include those nucleic acid molecules that specifically hybridize to one or more nucleic acid molecules encoding any of SEQ ID NOs: 5, 9-11, 43-44, 57-58, and 90, and complements thereof, under high stringency conditions such as 0.2.times.SSC and about 65.degree. C.

[0172] In one aspect of the present invention, the nucleic acid molecules of the present invention have one or more nucleic acid sequences encoding SEQ ID NOs: 5, 9-11, 43-44, 57-58, and 90, or complements thereof. In another aspect of the present invention, one or more of the nucleic acid molecules of the present invention share between about 100% and about 90% sequence identity with one or more of the nucleic acid sequences encoding SEQ ID NOs: 5, 9-11, 43-44, 57-58, and 90, and complements thereof, and fragments of either. In a further aspect of the present invention, one or more of the nucleic acid molecules of the present invention share between about 100% and about 95% sequence identity with one or more of the nucleic acid sequences encoding SEQ ID NOs: 5, 9-11, 43-44, 57-58, and 90, and complements thereof, and fragments of either. In a more preferred aspect of the present invention, one or more of the nucleic acid molecules of the present invention share between about 100% and about 98% sequence identity with one or more of the nucleic acid sequences encoding SEQ ID NOs: 5, 9-11, 43-44, 57-58, and 90, and complements thereof, and fragments of either. In an even more preferred aspect of the present invention, one or more of the nucleic acid molecules of the present invention share between about 100% and about 99% sequence identity with one or more of the sequences encoding SEQ ID NOs: 5, 9-11, 43-44, 57-58, and 90, and complements thereof, and fragments of either.

[0173] In a preferred embodiment the percent identity calculations are performed using BLASTN or BLASTP (default, parameters, version 2.0.8, Altschul et al., Nucleic Acids Res., 25:3389-3402 (1997)).

[0174] A nucleic acid molecule of the present invention can also encode a homolog polypeptide. As used herein, a homolog polypeptide molecule or fragment thereof is a counterpart protein molecule or fragment thereof in a second species (e.g., corn rubisco small subunit is a homolog of Arabidopsis rubisco small subunit). A homolog can also be generated by molecular evolution or DNA shuffling techniques, so that the molecule retains at least one functional or structure characteristic of the original polypeptide (see, for example, U.S. Pat. No. 5,811,238).

[0175] In another embodiment, the homolog is selected from the group consisting of alfalfa, Arabidopsis, barley, Brassica campestris, Brassica napus, oilseed rape, broccoli, cabbage, canola, citrus, cotton, garlic, oat, Allium, flax, an ornamental plant, peanut, pepper, potato, rapeseed, rice, rye, sorghum, strawberry, sugarcane, sugarbeet, tomato, wheat, poplar, pine, fir, eucalyptus, apple, lettuce, lentils, grape, banana, tea, turf grasses, sunflower, soybean, corn, Phaseolus, crambe, mustard, castor bean, sesame, cottonseed, linseed, safflower, and oil palm. More particularly, preferred homologs are selected from canola, corn, Brassica campestris, Brassica napus, oilseed rape, soybean, crambe, mustard, castor bean, peanut, sesame, cottonseed, linseed, rapeseed, safflower, oil palm, flax, and sunflower. In an even more preferred embodiment, the homolog is selected from the group consisting of canola, rapeseed, corn, Brassica campestris, Brassica napus, oilseed rape, soybean, sunflower, safflower, oil palms, and peanut. In a particularly preferred embodiment, the homolog is soybean. In a particularly preferred embodiment, the homolog is canola. In a particularly preferred embodiment, the homolog is oilseed rape.

[0176] In a preferred embodiment, nucleic acid molecules encoding SEQ ID NOs: 5, 9-11, 43-44, 57-58, and 90, and complements thereof, and fragments of either; or more preferably encoding SEQ ID NOs: 5, 9-11, 43-44, 57-58, and 90, and complements thereof, can be utilized to obtain such homologs.

[0177] In another further aspect of the present invention, nucleic acid molecules of the present invention can comprise sequences that differ from those encoding a polypeptide or fragment thereof due to the fact that a polypeptide can have one or more conservative amino acid changes, and nucleic acid sequences coding for the polypeptide can therefore have sequence differences. It is understood that codons capable of coding for such conservative amino acid substitutions are known in the art.

[0178] It is well known in the art that one or more amino acids in a native sequence can be substituted with other amino acid(s), the charge and polarity of which are similar to that of the native amino acid, i.e., a conservative amino acid substitution. Conservative substitutes for an amino acid within the native polypeptide sequence can be selected from other members of the class to which the amino acid belongs. Amino acids can be divided into the following four groups: (1) acidic amino acids; (2) basic amino acids; (3) neutral polar amino acids; and (4) neutral nonpolar amino acids. Representative amino acids within these various groups include, but are not limited to, (1) acidic (negatively charged) amino acids such as aspartic acid and glutamic acid; (2) basic (positively charged) amino acids such as arginine, histidine, and lysine; (3) neutral polar amino acids such as glycine, serine, threonine, cysteine, cystine, tyrosine, asparagine, and glutamine; and (4) neutral nonpolar (hydrophobic) amino acids such as alanine, leucine, isoleucine, valine, proline, phenylalanine, tryptophan, and methionine.

[0179] Conservative amino acid substitution within the native polypeptide sequence can be made by replacing one amino acid from within one of these groups with another amino acid from within the same group. In a preferred aspect, biologically functional equivalents of the proteins or fragments thereof of the present invention can have ten or fewer conservative amino acid changes, more preferably seven or fewer conservative amino acid changes, and most preferably five or fewer conservative amino acid changes. The encoding nucleotide sequence will thus have corresponding base substitutions, permitting it to encode biologically functional equivalent forms of the polypeptides of the present invention.

[0180] It is understood that certain amino acids may be substituted for other amino acids in a protein structure without appreciable loss of interactive binding capacity with structures such as, for example, antigen-binding regions of antibodies or binding sites on substrate molecules. Because it is the interactive capacity and nature of a protein that defines that protein's biological functional activity, certain amino acid sequence substitutions can be made in a protein sequence and, of course, its underlying DNA coding sequence and, nevertheless, a protein with like properties can still be obtained. It is thus contemplated by the inventors that various changes may be made in the peptide sequences of the proteins or fragments of the present invention, or corresponding DNA sequences that encode said peptides, without appreciable loss of their biological utility or activity. It is understood that codons capable of coding for such amino acid changes are known in the art.

[0181] In making such changes, the hydropathic index of amino acids may be considered. The importance of the hydropathic amino acid index in conferring interactive biological function on a protein is generally understood in the art (Kyte and Doolittle, J. Mol. Biol., 157:105-132 (1982)). It is accepted that the relative hydropathic character of the amino acid contributes to the secondary structure of the resultant polypeptide, which in turn defines the interaction of the protein with other molecules, for example, enzymes, substrates, receptors, DNA, antibodies, antigens, and the like.

[0182] Each amino acid has been assigned a hydropathic index on the basis of its hydrophobicity and charge characteristics (Kyte and Doolittle, J. Mol. Biol., 157:105-132 (1982)); these are isoleucine (+4.5), valine (+4.2), leucine (+3.8), phenylalanine (+2.8), cysteine/cystine (+2.5), methionine (+1.9), alanine (+1.8), glycine (-0.4), threonine (-0.7), serine (-0.8), tryptophan (-0.9), tyrosine (-1.3), proline (-1.6), histidine (-3.2), glutamate (-3.5), glutamine (-3.5), aspartate (-3.5), asparagine (-3.5), lysine (-3.9), and arginine (4.5).

[0183] In making such changes, the substitution of amino acids whose hydropathic indices are within .+-.2 is preferred, those that are within .+-.1 are particularly preferred, and those within .+-.0.5 are even more particularly preferred.

[0184] It is also understood in the art that the substitution of like amino acids can be made effectively on the basis of hydrophilicity. U.S. Pat. No. 4,554,101 states that the greatest local average hydrophilicity of a protein, as governed by the hydrophilicity of its adjacent amino acids, correlates with a biological property of the protein.

[0185] As detailed in U.S. Pat. No. 4,554,101, the following hydrophilicity values have been assigned to amino acid residues: arginine (+3.0), lysine (+3.0), aspartate (+3.0.+-.1), glutamate (+3.0.+-.1), serine (+0.3), asparagine (+0.2), glutamine (+0.2), glycine (0), threonine (-0.4), proline (-0.5.+-.1), alanine (-0.5), histidine (-0.5), cysteine (-1.0), methionine (-1.3), valine (-1.5), leucine (-1.8), isoleucine (-1.8), tyrosine (-2.3), phenylalanine (-2.5), and tryptophan (-3.4).

[0186] In making such changes, the substitution of amino acids whose hydrophilicity values are within .+-.2 is preferred, those that are within .+-.1 are particularly preferred, and those within .+-.0.5 are even more particularly preferred.

[0187] In a further aspect of the present invention, one or more of the nucleic acid molecules of the present invention differ in nucleic acid sequence from those for which a specific sequence is provided herein because one or more codons has been replaced with a codon that encodes a conservative substitution of the amino acid originally encoded.

[0188] Agents of the present invention include nucleic acid molecules that encode at least about a contiguous 10 amino acid region of a polypeptide of the present invention, more preferably at least about a contiguous 25, 40, 50, 100, or 125 amino acid region of a polypeptide of the present invention.

[0189] In a preferred embodiment, any of the nucleic acid molecules of the present invention can be operably linked to a promoter region that functions in a plant cell to cause the production of an mRNA molecule, where the nucleic acid molecule that is linked to the promoter is heterologous with respect to that promoter. As used herein, "heterologous" means not naturally occurring together.

[0190] The nature of the coding sequences of non-plant genes can distinguish them from plant genes as well as many other heterologous genes expressed in plants. For example, the average A+T content of bacteria can be higher than that for plants. The A+T content of the genomes (and thus the genes) of any organism are features of that organism and reflect its evolutionary history. While within any one organism genes have similar A+T content, the A+T content can vary tremendously from organism to organism. For example, some Bacillus species have among the most A+T rich genomes while some Steptomyces species are among the least A+T rich genomes (about 30 to 35% A+T).

[0191] Due to the degeneracy of the genetic code and the limited number of codon choices for any amino acid, most of the "excess" A+T of the structural coding sequences of some Bacillus species, for example, are found in the third position of the codons. That is, genes of some Bacillus species have A or T as the third nucleotide in many codons. Thus A+T content in part can determine codon usage bias. In addition, it is clear that genes evolve for maximum function in the organism in which they evolve. This means that particular nucleotide sequences found in a gene from one organism, where they may play no role except to code for a particular stretch of amino acids, have the potential to be recognized as gene control elements in another organism (such as transcriptional promoters or terminators, polyA addition sites, intron splice sites, or specific mRNA degradation signals). It is perhaps surprising that such misread signals are not a more common feature of heterologous gene expression, but this can be explained in part by the relatively homogeneous A+T content (about 50%) of many organisms. This A+T content plus the nature of the genetic code put clear constraints on the likelihood of occurrence of any particular oligonucleotide sequence. Thus, a gene from E. coli with a 50% A+T content is much less likely to contain any particular A+T rich segment than a gene from B. thuringiensis. The same can be true between genes in a bacterium and genes in a plant, for example.

[0192] Any of the nucleic acid molecules of the present invention can be altered via any methods known in the art in order to make the codons within the nucleic acid molecule more appropriate for the organism in which the nucleic acid molecule is located. That is, the present invention includes the modification of any of the nucleic acid molecules disclosed herein to improve codon usage in a host organism.

[0193] It is preferred that regions comprising many consecutive A+T bases or G+C bases are disrupted since these regions are predicted to have a higher likelihood to form hairpin structure due to self-complementarity. Therefore, insertion of heterogeneous base pairs would reduce the likelihood of self-complementary secondary structure formation which are known to inhibit transcription and/or translation in some organisms. In most cases, the adverse effects may be minimized by using sequences which do not contain more than five consecutive A+T or G+C.

[0194] Protein and Peptide Molecules

[0195] A class of agents includes one or more of the polypeptide molecules encoded by a nucleic acid agent of the present invention. A particular preferred class of proteins is that having an amino acid sequence selected from the group consisting of SEQ ID NOs: 5, 9-11, 43-44, 57-58, and 90, and fragments thereof.

[0196] In another embodiment, the present invention includes polypeptides having a region of conserved amino acid sequence shown in any of FIGS. 2a-2c, 3a-3c, 24a-24b, 25a-25b, 33a-33c, 34a-34b, 35a-35b and 36. In an embodiment, the present invention includes polypeptides comprising a sequence selected from the group consisting of SEQ ID NOs: 39-42, 46-49, and 92-95. The present invention includes and provides said substantially purified polypeptide wherein more than one amino acid sequence is selected from the group consisting of SEQ ID NOs: 39-42, 46-49, and 92-95. In a further preferred embodiment the present invention includes polypeptides comprising two or more, three or more, or four sequences selected from the group consisting of SEQ ID NOs: 39-42, 46-49, and 92-95.

[0197] In another embodiment, the present invention includes polypeptides having homogentisate prenyl transferase activity and a region of conserved amino acid sequence shown in any of FIGS. 2a-2c, 3a-3c, 25a-25c, 33a-33c, 34a-34b, 35a-35b and 36. In an embodiment, the present invention includes polypeptides having homogentisate prenyl transferase activity and comprising a sequence selected from the group consisting of SEQ ID NOs: 39-42, 46-49, and 92-95. The present invention includes and provides said substantially purified polypeptide wherein more than one amino acid sequence is selected from the group consisting of SEQ ID NOs: 39-42, 46-49, and 92-95.

[0198] In a further preferred embodiment the present invention includes polypeptides having homogentisate prenyl transferase activity and comprising two or more, three or more, or four sequences selected from the group consisting of SEQ ID NOs: 39-42, 46-49, and 92-95.

[0199] In another embodiment, the present invention includes polypeptides having a region of conserved amino acid sequence shown in any of FIGS. 2a-2c, 3a-3c, 24a-24b, 25a-25c, 33a-33c, 34a-34b, 35a-35b or 36, excluding polypeptides derived from nucleic acid molecules derived from Nostoc punctiforme, Anabaena, Synechocystis, Zea mays, Glycine max, Arabidopsis thaliana, Oryza sativa, Trichodesmium erythraeum, Chloroflexus aurantiacus, wheat, leek, canola, cotton, Sulfolobus, Aeropyum, sorghum, or tomato. In a preferred embodiment, the present invention includes polypeptides comprising a sequence selected from the group consisting of SEQ ID NOs: 39-42, 46-49, and 92-95 excluding polypeptides derived from nucleic acid molecules derived from Nostoc punctiforme, Anabaena, Synechocystis, Zea mays, Glycine max, Arabidopsis thaliana, Oryza sativa, Trichodesmium erythraeum, Chloroflexus aurantiacus, wheat, leek, canola, cotton, or tomato. The present invention includes and provides said substantially purified polypeptide wherein more than onethe amino acid sequence is selected from the group consisting of SEQ ID NOs: 39-42,46-49, and 92-95.

[0200] In a further preferred embodiment the present invention includes polypeptides comprising two or more, three or more, or four sequences selected from the group consisting of SEQ ID NOs: 39-42, 46-49, and 92-95, excluding polypeptides derived from nucleic acid molecules derived from Nostoc punctiforme, Anabaena, Synechocystis, Zea mays, Glycine max, Arabidopsis thaliana, Oryza sativa, Trichodesmium erythraeum, Chloroflexus aurantiacus, wheat, leek, canola, cotton, or tomato.

[0201] In another embodiment, the present invention includes polypeptides having homogentisate prenyl transferase activity and a region of conserved amino acid sequence shown in any of FIGS. 2a-2c, 3a-3c, 25a-25c, 33a-33c, 34a-34b, 35a-35b or 36, excluding polypeptides derived from nucleic acid molecules derived from Nostoc punctiforme, Anabaena, Synechocystis, Zea mays, Glycine max, Arabidopsis thaliana, Oryza sativa, Trichodesmium erythraeum, Chloroflexus aurantiacus, wheat, leek, canola, cotton, or tomato. In a preferred embodiment, the present invention includes polypeptides having homogentisate prenyl transferase activity and comprising a sequence selected from the group consisting of SEQ ID NOs: 39-42, 46-49, and 92-95, excluding polypeptides derived from nucleic acid molecules derived from Nostoc punctiforme, Anabaena, Synechocystis, Zea mays, Glycine max, Arabidopsis thaliana, Oryza sativa, Trichodesmium erythraeum, Chloroflexus aurantiacus, wheat, leek, canola, cotton, or tomato. The present invention includes and provides said substantially purified polypeptide wherein more than one amino acid sequence is selected from the group consisting of SEQ ID NOs: 39-42, 46-49, and 92-95.

[0202] In a further preferred embodiment the present invention includes polypeptides having homogentisate prenyl transferase activity and comprising two or more, three or more, or four sequences selected from the group consisting of SEQ ID NOs: 39-42, 46-49, and 92-95, excluding polypeptides derived from nucleic acid molecules derived from Nostoc punctiforme, Anabaena, Synechocystis, Zea mays, Glycine max, Arabidopsis thaliana, Oryza sativa, Trichodesmium erythraeum, Chloroflexus aurantiacus, wheat, leek, canola, cotton, or tomato.

[0203] Polypeptide agents may have C-terminal or N-terminal amino acid sequence extensions. One class of N-terminal extensions employed in a preferred embodiment are plastid transit peptides. When employed, plastid transit peptides can be operatively linked to the N-terminal sequence, thereby permitting the localization of the agent polypeptides to plastids. In an embodiment of the present invention, any suitable plastid targeting sequence can be used. Where suitable, a plastid targeting sequence can be substituted for a native plastid targetting sequence, for example, for the CTP occurring natively in the tocopherol homogentisate prenyl transferase protein. In a further embodiment, a plastid targeting sequence that is heterologous to any homogentisate prenyl transferase protein or fragment described herein can be used. In a further embodiment, any suitable, modified plastid targetting sequence can be used. In another embodiment, the plastid targeting sequence is a CTP1 sequence (see WO 00/61771).

[0204] In a preferred aspect a protein of the present invention is targeted to a plastid using either a native transit peptide sequence or a heterologous transit peptide sequence. In the case of nucleic acid sequences corresponding to nucleic acid sequences of non-higher plant organisms such as cynobacteria, such nucleic acid sequences can be modified to attach the coding sequence of the protein to a nucleic acid sequence of a plastid targeting peptide.

[0205] As used herein, the terms "protein", "peptide molecule", or "polypeptide" include any molecule that comprises five or more amino acids. It is well known in the art that protein, peptide, or polypeptide molecules may undergo modification, including post-translational modifications, such as, but not limited to, disulfide bond formation, glycosylation, phosphorylation, or oligomerization. Thus, as used herein, the terms "protein", "peptide molecule", or "polypeptide" include any protein that is modified by any biological or non-biological process. The terms "amino acid" and "amino acids" refer to all naturally occurring L-amino acids. This definition is meant to include norleucine, norvaline, ornithine, homocysteine, and homoserine.

[0206] One or more of the protein or fragments thereof, peptide molecules, or polypeptide molecules may be produced via chemical synthesis, or more preferably, by expression in a suitable bacterial or eukaryotic host. Suitable methods for expression are described by Sambrook et al., In: Molecular Cloning, A Laboratory Manual, 2nd Edition, Cold Spring Harbor Press, Cold Spring Harbor, N.Y. (1989) or similar texts.

[0207] A "protein fragment" is a peptide or polypeptide molecule whose amino acid sequence comprises a subset of the amino acid sequence of that protein. A protein or fragment thereof that comprises one or more additional peptide regions not derived from that protein is a "fusion" protein. Such molecules may be derivatized to contain carbohydrate or other moieties (such as keyhole limpet hemocyanin). Fusion protein or peptide molecules of the present invention are preferably produced via recombinant means.

[0208] Another class of agents comprises protein, peptide molecules, or polypeptide molecules, or fragments or fusions thereof comprising SEQ ID NOs: 5, 9-11, 43-44, 57-58, and 90, and fragments thereof in which conservative, non-essential, or non-relevant amino acid residues have been added, replaced, or deleted. Computerized means for designing modifications in protein structure are known in the art (Dahiyat and Mayo, Science, 278:82-87 (1997)).

[0209] A protein, peptide, or polypeptide of the present invention can also be a homolog protein, peptide, or polypeptide. As used herein, a homolog protein, peptide, or polypeptide or fragment thereof is a counterpart protein, peptide, or polypeptide or fragment thereof in a second species. A homolog can also be generated by molecular evolution or DNA shuffling techniques, so that the molecule retains at least one functional or structure characteristic of the original (see, for example, U.S. Pat. No. 5,811,238).

[0210] In another embodiment, the homolog is selected from the group consisting of alfalfa, Arabidopsis, barley, broccoli, cabbage, canola, citrus, cotton, garlic, oat, Allium, flax, an ornamental plant, peanut, pepper, potato, rapeseed, rice, rye, sorghum, strawberry, sugarcane, sugarbeet, tomato, wheat, poplar, pine, fir, eucalyptus, apple, lettuce, lentils, grape, banana, tea, turf grasses, sunflower, soybean, corn, and Phaseolus. More particularly, preferred homologs are selected from canola, rapeseed, corn, Brassica campestris, Brassica napus, oilseed rape, soybean, crambe, mustard, castor bean, peanut, sesame, cottonseed, linseed, safflower, oil palm, flax, and sunflower. In an even more preferred embodiment, the homolog is selected from the group consisting of canola, rapeseed, corn, Brassica campestris, Brassica napus, oilseed rape, soybean, sunflower, safflower, oil palms, and peanut. In a preferred embodiment, the homolog is soybean. In a preferred embodiment, the homolog is canola. In a preferred embodiment, the homolog is oilseed rape.

[0211] In a preferred embodiment, the nucleic acid molecules of the present invention or complements and fragments of either can be utilized to obtain such homologs.

[0212] Agents of the present invention include proteins and fragments thereof comprising at least about a contiguous 10 amino acid region preferably comprising at least about a contiguous 20 amino acid region, even more preferably comprising at least about a contiguous 25, 35, 50, 75, or 100 amino acid region of a protein of the present invention. In another preferred embodiment, the proteins of the present invention include between about 10 and about 25 contiguous amino acid region, more preferably between about 20 and about 50 contiguous amino acid region, and even more preferably between about 40 and about 80 contiguous amino acid region.

[0213] Plant Constructs and Plant Transformants

[0214] One or more of the nucleic acid molecules of the present invention may be used in plant transformation or transfection. Exogenous genetic material may be transferred into a plant cell and the plant cell regenerated into a whole, fertile, or sterile plant. Exogenous genetic material is any genetic material, whether naturally occurring or otherwise, from any source that is capable of being inserted into any organism.

[0215] In a preferred aspect of the present invention the exogenous genetic material comprises a nucleic acid sequence of the present invention, more preferably one that encodes homogentisate prenyl transferase. In another preferred aspect of the present invention the exogenous genetic material of the present invention comprises a nucleic acid sequence encoding an amino acid sequence selected from the group consisting of SEQ ID NOs: 5, 9-11, 43-44, 57-58, and 90, and complements thereof and fragments of either. In a further aspect of the present invention the exogenous genetic material comprises a nucleic acid sequence encoding an amino acid sequence selected from the group consisting of SEQ ID NOs: 5, 9-11, 43-44, 57-58, and 90, and fragments of SEQ ID NOs: 5, 9-11, 43-44, 57-58, and 90.

[0216] In an embodiment of the present invention, exogenous genetic material encoding a homogentisate prenyl transferase enzyme or fragment thereof is introduced into a plant with one or more additional genes. In one embodiment, preferred combinations of genes include a nucleic acid molecule of the present invention and one or more of the following genes: tyrA (e.g., WO 02/089561 and Xia et al., J. Gen. Microbiol., 138:1309-1316 (1992)), tocopherol cyclase (e.g., WO 01/79472), prephenate dehydrogenase, dxs (e.g. Lois et al., Proc. Natl. Acad. Sci. (U.S.A.), 95(5):2105-2110 (1998)), dxr (e.g., U.S. Pub. 2002/0108814A and Takahashi et al., Proc. Natl. Acad. Sci. (U.S.A.), 95 (17), 9879-9884 (1998)), GGPPS (e.g., Bartley and Scolnik, Plant Physiol., 104:1469-1470 (1994)), HPPD (e.g., Norris et al., Plant Physiol., 117:1317-1323 (1998)), GMT (e.g., U.S. application Ser. No. 10/219,810, filed Aug. 16, 2002), tMT2 (e.g., U.S. application Ser. No. 10/279,029, filed Oct. 24, 2002), AANT1 (e.g., WO 02/090506), IDI (E.C.:5.3.3.2; Blanc et al., In: Plant Gene Register, PRG96-036; and Sato et al., DNA Res., 4:215-230 (1997)), GGH (Gra.beta.es et al., Planta. 213-620 (2001)), or a plant ortholog and an antisense construct for homogentisic acid dioxygenase (Kridl et al., Seed Sci. Res., 1:209:219 (1991); Keegstra, Cell, 56(2):247-53 (1989); Nawrath, et al., Proc. Natl. Acad. Sci. (U.S.A.), 91:12760-12764 (1994); Cyanobase, www.kazusa.or.jp/cyanobase; Smith et al., Plant J., 11:83-92 (1997); WO 00/32757; ExPASy Molecular Biology Server, http://us.expasy.org/enzyme; MT1 WO 00/10380; gcpE, WO 02/12478; Saint Guily et al., Plant Physiol., 100(2):1069-1071 (1992); Sato et al., J. DNA Res., 7(1):31-63 (2000)). In such combinations, in some crop plants, e.g., canola, a preferred promoter is a napin promoter and a preferred plastid targeting sequence is a CTP1 sequence. It is preferred that gene products are targeted to the plastid.

[0217] In a preferred combination a nucleic acid molecule encoding a homogentisate prenyl transferase polypeptide and a nucleic acid molecule encoding any of the following enzymes: tyrA, prephenate dehydrogenase, tocopherol cyclase, dxs, dxr, GGPPS, HPPD, tMT2, MT1, GCPE, AANT1, IDI, GGH, GMT, or a plant ortholog and an antisense construct for homogentisic acid dioxygenase are introduced into a plant.

[0218] For any of the above combinations, a nucleic acid molecule encoding a homogentisate prenyl transferase polypeptide encodes a polypeptide comprising a sequence selected from the group consisting of SEQ ID NOs: 5, 9-11, 43-44, 57-58, and 90. In another preferred embodiment, a nucleic acid molecule encoding a homogentisate prenyl transferase polypeptide encodes a polypeptide comprising one or more of SEQ ID NOs: 39-42, 46-49, and 92-95. In a preferred embodiment, the homogentisate prenyl transferase polypeptide does not have an amino acid sequence that is derived from a nucleic acid derived from Nostoc punctiforme, Anabaena, Synechocystis, Zea mays, Glycine max, Arabidopsis thaliana, Oryza sativa, wheat, leek, canola, cotton, or tomato.

[0219] Such genetic material may be transferred into either monocotyledons or dicotyledons including, but not limited to canola, corn, soybean, Arabidopsis phaseolus, peanut, alfalfa, wheat, rice, oat, sorghum, rapeseed, rye, tritordeum, millet, fescue, perennial ryegrass, sugarcane, cranberry, papaya, banana, safflower, oil palms, flax, muskmelon, apple, cucumber, dendrobium, gladiolus, chrysanthemum, liliacea, cotton, eucalyptus, sunflower, Brassica campestris, Brassica napus, oilseed rape, turfgrass, sugarbeet, coffee and dioscorea (Christou, In: Particle Bombardment for Genetic Engineering of Plants, Biotechnology Intelligence Unit. Academic Press, San Diego, Calif. (1996)), with canola, corn, Brassica campestris, Brassica napus, oilseed rape, rapeseed, soybean, crambe, mustard, castor bean, peanut, sesame, cottonseed, linseed, safflower, oil palm, flax, and sunflower preferred, and canola, rapeseed, corn, Brassica campestris, Brassica napus, oilseed rape, soybean, sunflower, safflower, oil palms, and peanut preferred. In a more preferred embodiment, the genetic material is transferred into canola. In another more preferred embodiment, the genetic material is transferred into oilseed rape. In another particularly preferred embodiment, the genetic material is transferred into soybean.

[0220] Transfer of a nucleic acid molecule that encodes a protein can result in expression or overexpression of that polypeptide in a transformed cell or transgenic plant. One or more of the proteins or fragments thereof encoded by nucleic acid molecules of the present invention may be overexpressed in a transformed cell or transformed plant. Such expression or overexpression may be the result of transient or stable transfer of the exogenous genetic material.

[0221] In a preferred embodiment, expression or overexpression of a polypeptide of the present invention in a plant provides in that plant, relative to an untransformed plant with a similar genetic background, an increased level of tocopherols.

[0222] In a preferred embodiment, expression or overexpression of a polypeptide of the present invention in a plant provides in that plant, relative to an untransformed plant with a similar genetic background, an increased level of .alpha.-tocopherols.

[0223] In a preferred embodiment, expression or overexpression of a polypeptide of the present invention in a plant provides in that plant, relative to an untransformed plant with a similar genetic background, an increased level of .gamma.-tocopherols.

[0224] In a preferred embodiment, expression or overexpression of a polypeptide of the present invention in a plant provides in that plant, relative to an untransformed plant with a similar genetic background, an increased level of .delta.-tocopherols.

[0225] In a preferred embodiment, expression or overexpression of a polypeptide of the present invention in a plant provides in that plant, relative to an untransformed plant with a similar genetic background, an increased level of .beta.-tocopherols.

[0226] In a preferred embodiment, expression or overexpression of a polypeptide of the present invention in a plant provides in that plant, relative to an untransformed plant with a similar genetic background, an increased level of tocotrienols.

[0227] In a preferred embodiment, expression or overexpression of a polypeptide of the present invention in a plant provides in that plant, relative to an untransformed plant with a similar genetic background, an increased level of .alpha.-tocotrienols.

[0228] In a preferred embodiment, expression or overexpression of a polypeptide of the present invention in a plant provides in that plant, relative to an untransformed plant with a similar genetic background, an increased level of .gamma.-tocotrienols.

[0229] In a preferred embodiment, expression or overexpression of a polypeptide of the present invention in a plant provides in that plant, relative to an untransformed plant with a similar genetic background, an increased level of .delta.-tocotrienols.

[0230] In a preferred embodiment, expression or overexpression of a polypeptide of the present invention in a plant provides in that plant, relative to an untransformed plant with a similar genetic background, an increased level of .beta.-tocotrienols.

[0231] In a preferred embodiment, expression or overexpression of a polypeptide of the present invention in a plant provides in that plant, relative to an untransformed plant with a similar genetic background, an increased level of plastoquinols.

[0232] In any of the embodiments described herein, an increase in .gamma.-tocopherol, .alpha.-tocopherol, or both can lead to a decrease in the relative proportion of .beta.-tocopherol, .delta.-tocopherol, or both. Similarly, an increase in .gamma.-tocotrienol, .alpha.-tocotrienol, or both can lead to a decrease in the relative proportion of .beta.-tocotrienol, .delta.-tocotrienol, or both.

[0233] In another embodiment, expression overexpression of a polypeptide of the present invention in a plant provides in that plant, or a tissue of that plant, relative to an untransformed plant or plant tissue, with a similar genetic background, an increased level of a homogentisate prenyl transferase protein or fragment thereof.

[0234] In some embodiments, the levels of one or more products of the tocopherol biosynthesis pathway, including any one or more of tocopherols, .alpha.-tocopherols, .gamma.-tocopherols, .delta.-tocopherols, .beta.-tocopherols, tocotrienols, .alpha.-tocotrienols, .gamma.-tocotrienols, .delta.-tocotrienols, .beta.-tocotrienols are increased by greater than about 10%, or more preferably greater than about 25%, 35%, 50%, 75%, 80%, 90%, 100%, 150%, 200%, 1,000%, 2,000%, or 2,500%. The levels of products may be increased throughout an organism such as a plant or localized in one or more specific organs or tissues of the organism. For example, the levels of products may be increased in one or more of the tissues and organs of a plant including without limitation: roots, tubers, stems, leaves, stalks, fruit, berries, nuts, bark, pods, seeds and flowers. A preferred organ is a seed.

[0235] In some embodiments, the levels of one or more products of the tocopherol biosynthesis pathway, including any one or more of tocopherols, .alpha.-tocopherols, .gamma.-tocopherols, .delta.-tocopherols, .beta.-tocopherols, tocotrienols, .alpha.-tocotrienols, .gamma.-tocotrienols, .delta.-tocotrienols, .beta.-tocotrienols are increased so that they constitute greater than about 10%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% of the total tocopherol content of the organism or tissue. The levels of products may be increased throughout an organism such as a plant or localized in one or more specific organs or tissues of the organism. For example, the levels of products may be increased in one or more of the tissues and organs of a plant including without limitation: roots, tubers, stems, leaves, stalks, fruit, berries, nuts, bark, pods, seeds and flowers. A preferred organ is a seed.

[0236] In a preferred embodiment, expression of enzymes involved in tocopherol, tocotrienol or plastoquinol synthesis in the seed will result in an increase in .gamma.-tocopherol levels due to the absence of significant levels of GMT activity in those tissues. In another preferred embodiment, expression of enzymes involved in tocopherol, tocotrienol, or plastoquinol synthesis in photosyhthetic tissues will result in an increase in .alpha.-tocopherol due to the higher levels of GMT activity in those tissues relative to the same activity in seed tissue.

[0237] In another preferred embodiment, the expression of enzymes involved in tocopherol, tocotrienol, or plastoquinol synthesis in the seed will result in an increase in the total tocopherol, tocotrienol, or plastoquinol level in the plant.

[0238] In some embodiments, the levels of tocopherols or a species such as .alpha.-tocopherol may be altered. In some embodiments, the levels of tocotrienols may be altered. Such alteration can be compared to a plant with a similar background.

[0239] In another embodiment, either the .alpha.-tocopherol level, .alpha.-tocotrienol level, or both of plants that natively produce high levels of either .alpha.-tocopherol, .alpha.-tocotrienol or both (e.g., sunflowers), can be increased by the introduction of a gene coding for a homogentisate prenyl transferase enzyme.

[0240] In a preferred aspect, a similar genetic background is a background where the organisms being compared share about 50% or greater of their nuclear genetic material. In a more preferred aspect a similar genetic background is a background where the organisms being compared share about 75% or greater, even more preferably about 90% or greater of their nuclear genetic material. In another even more preferable aspect, a similar genetic background is a background where the organisms being compared are plants, and the plants are isogenic except for any genetic material originally introduced using plant transformation techniques.

[0241] In another preferred embodiment, expression or overexpression of a polypeptide of the present invention in a transformed plant may provide tolerance to a variety of stress, e.g. oxidative stress tolerance such as to oxygen or ozone, UV tolerance, cold tolerance, or fungal/microbial pathogen tolerance.

[0242] As used herein in a preferred aspect, a tolerance or resistance to stress is determined by the ability of a plant, when challenged by a stress such as cold to produce a plant having a higher yield than one without such tolerance or resistance to stress. In a particularly preferred aspect of the present invention, the tolerance or resistance to stress is measured relative to a plant with a similar genetic background to the tolerant or resistance plant except that the plant reduces the expression, expresses, or over expresses a protein or fragment thereof of the present invention.

[0243] Exogenous genetic material may be transferred into a host cell by the use of a DNA vector or construct designed for such a purpose. Design of such a vector is generally within the skill of the art (see, Plant Molecular Biology: A Laboratory Manual, Clark (ed.), Springer, NY (1997)).

[0244] A construct or vector may include a plant promoter to express the polypeptide of choice. In a preferred embodiment, any nucleic acid molecules described herein can be operably linked to a promoter region which functions in a plant cell to cause the production of an mRNA molecule. For example, any promoter that functions in a plant cell to cause the production of an mRNA molecule, such as those promoters described herein, without limitation, can be used. In a preferred embodiment, the promoter is a plant promoter.

[0245] A number of promoters that are active in plant cells have been described in the literature. These include the nopaline synthase (NOS) promoter (Ebert et al., Proc. Natl. Acad. Sci. (U.S.A.), 84:5745-5749 (1987)), the octopine synthase (OCS) promoter (which is carried on tumor-inducing plasmids of Agrobacterium tumefaciens), the caulimovirus promoters such as the cauliflower mosaic virus (CaMV) 19S promoter (Lawton et al., Plant Mol. Biol., 9:315-324 (1987)) and the CaMV 35S promoter (Odell et al., Nature, 313:810-812 (1985)), the figwort mosaic virus 35S-promoter, the light-inducible promoter from the small subunit of ribulose-1,5-bis-phosphate carboxylase (ssRUBISCO), the Adh promoter (Walker et al., Proc. Natl. Acad. Sci. (U.S.A.), 84:6624-6628 (1987)), the sucrose synthase promoter (Yang et al., Proc. Natl. Acad. Sci. (U.S.A.), 87:4144-4148 (1990)), the R gene complex promoter (Chandler et al., The Plant Cell, 1:1175-1183 (1989)) and the chlorophyll a/b binding protein gene promoter, etc. These promoters have been used to create DNA constructs that have been expressed in plants; see, e.g., WO 84/02913. The CaMV 35S promoters are preferred for use in plants. Promoters known or found to cause transcription of DNA in plant cells can be used in the present invention.

[0246] For the purpose of expression in source tissues of the plant, such as the leaf, seed, root or stem, it is preferred that the promoters utilized have relatively high expression in these specific tissues. Tissue-specific expression of a protein of the present invention is a particularly preferred embodiment. For this purpose, one may choose from a number of promoters for genes with tissue- or cell-specific or enhanced expression. Examples of such promoters reported in the literature include the chloroplast glutamine synthetase GS2 promoter from pea (Edwards et al., Proc. Natl. Acad. Sci. (U.S.A.), 87:3459-3463 (1990)), the chloroplast fructose-1,6-biphosphatase (FBPase) promoter from wheat (Lloyd et al., Mol. Gen. Genet., 225:209-216 (1991)), the nuclear photosynthetic ST-LS1 promoter from potato (Stockhaus et al., EMBO J., 8:2445-2451 (1989)), the serine/threonine kinase (PAL) promoter and the glucoamylase (CHS) promoter from Arabidopsis thaliana. Also, reported to be active in photosynthetically active tissues are the ribulose-1,5-bisphosphate carboxylase (RbcS) promoter from eastern larch (Larix laricina), the promoter for the cab gene, cab6, from pine (Yamamoto et al., Plant Cell Physiol., 35:773-778 (1994)), the promoter for the Cab-1 gene from wheat (Fejes et al., Plant Mol. Biol., 15:921-932 (199 0)), the promoter for the CAB-1 gene from spinach (Lubberstedt et al., Plant Physiol., 104:997-1006 (1994)), the promoter for the cab1R gene from rice (Luan et al., Plant Cell., 4:971-981 (1992)), the pyruvate, orthophosphate dikinase (PPDK) promoter from corn (Matsuoka et al., Proc. Natl. Acad. Sci. (U.S.A.), 90:9586-9590 (1993)), the promoter for the tobacco Lhcb1*2 gene (Cerdan et al., Plant Mol. Biol., 33:245-255 (1997)), the Arabidopsis thaliana SUC2 sucrose-H+ symporter promoter (Truernit et al., Planta., 196:564-570 (1995)) and the promoter for the thylakoid membrane proteins from spinach (psaD, psaF, psaE, PC, FNR, atpC, atpD, cab, rbcS). Other promoters for the chlorophyll a/b-binding proteins may also be utilized in the present invention, such as the promoters for LhcB gene and PsbP gene from white mustard (Sinapis alba; Kretsch et al., Plant Mol. Biol., 28:219-229 (1995)).

[0247] For the purpose of expression in sink tissues of the plant, such as the tuber of the potato plant, the fruit of tomato, or the seed of corn, wheat, rice and barley, it is preferred that the promoters utilized in the present invention have relatively high expression in these specific tissues. A number of promoters for genes with. tuber-specific or tuber-enhanced expression are known, including the class I patatin promoter (Bevan et al., EMBO J., 8:1899-1906 (1986); Jefferson et al., Plant Mol. Biol., 14:995-1006 (1990)), the promoter for the potato tuber ADPGPP genes, both the large and small subunits, the sucrose synthase promoter (Salanoubat and Belliard, Gene, 60:47-56 (1987), Salanoubat and Belliard, Gene, 84:181-185 (1989)), the promoter for the major tuber proteins including the 22 kd protein complexes and protease inhibitors (Hannapel, Plant Physiol., 101:703-704 (1993)), the promoter for the granule-bound starch synthase gene (GBSS) (Visser et al., Plant Mol. Biol., 17:691-699 (1991)) and other class I and II patatins promoters (Koster-Topfer et al., Mol. Gen. Genet., 219:390-396 (1989); Mignery et al., Gene., 62:2744 (1988)).

[0248] Other promoters can also be used to express a polypeptide in specific tissues, such as seeds or fruits. Indeed, in a preferred embodiment, the promoter used is a seed specific promoter. Examples of such promoters include the 5' regulatory regions from such genes as napin (Kridl et al., Seed Sci. Res., 1:209:219 (1991)), phaseolin (Bustos et al., Plant Cell, 1(9):839-853 (1989)), soybean trypsin inhibitor (Riggs et al., Plant Cell, 1(6):609-621 (1989)), ACP (Baerson et al., Plant Mol. Biol., 22(2):255-267 (1993)), stearoyl-ACP desaturase (Slocombe et al., Plant Physiol., 104(4):167-176 (1994)), soybean .alpha.' subunit of .beta.-conglycinin (soy 7s, (Chen et al., Proc. Natl. Acad. Sci., 83:8560-8564 (1986))), and oleosin (see, for example, Hong et al., Plant Mol. Biol., 34(3):549-555 (1997)). Further examples include the promoter for .beta.-conglycinin (Chen et al., Dev. Genet., 10:112-122 (1989)). Also included are the zeins, which are a group of storage proteins found in corn endosperm. Genomic clones for zein genes have been isolated (Pedersen et al., Cell, 29:1015-1026 (1982), and Russell et al., Transgenic Res., 6(2):157-168) and the promoters from these clones, including the 15 kD, 16 kD, 19 kD, 22 kD, 27 kD and genes, could also be used. Other promoters known to function, for example, in corn include the promoters for the following genes: waxy, Brittle, Shrunken 2, Branching enzymes I and II, starch synthases, debranching enzymes, oleosins, glutelins and sucrose synthases. A particularly preferred promoter for corn endosperm expression is the promoter for the glutelin gene from rice, more particularly the Osgt-1 promoter (Zheng et al., Mol. Cell Biol., 13:5829-5842 (1993)). Examples of promoters suitable for expression in wheat include those promoters for the ADPglucose pyrosynthase (ADPGPP) subunits, the granule bound and other starch synthase, the branching and debranching enzymes, the embryogenesis-abundant proteins, the gliadins and the glutenins. Examples of such promoters in rice include those promoters for the ADPGPP subunits, the granule bound and other starch synthase, the branching enzymes, the debranching enzymes, sucrose synthases and the glutelins. A particularly preferred promoter is the promoter for rice glutelin, Osgt-1. Examples of such promoters for barley include those for the ADPGPP subunits, the granule bound and other starch synthase, the branching enzymes, the debranching enzymes, sucrose synthases, the hordeins, the embryo globulins and the aleurone specific proteins. A preferred promoter for expression in the seed is a napin promoter. Another preferred promoter for expression is an Arcelin 5 promoter.

[0249] Root specific promoters may also be used. An example of such a promoter is the promoter for the acid chitinase gene (Samac et al., Plant Mol. Biol., 25:587-596 (1994)). Expression in root tissue could also be accomplished by utilizing the root specific subdomains of the CaMV35S promoter that have been identified (Lam et al., Proc. Natl. Acad. Sci. (U.S.A.), 86:7890-7894 (1989)). Other root cell specific promoters include those reported by Conkling et al., Plant Physiol., 93:1203-1211 (1990).

[0250] Other preferred promoters include 7.alpha.' (Beachy et al., EMBO J., 4:3047 (1985); Schuler et al., Nucleic Acid Res., 10(24):8225-8244 (1982)); USP 88 and enhanced USP 88 (U.S. Patent Application No. 60/377,236, filed May 3, 2002, incorporated herein by reference); and 7S.alpha., (U.S. patent application Ser. No. 10/235,618).

[0251] Additional promoters that may be utilized are described, for example, in U.S. Pat. Nos. 5,378,619; 5,391,725; 5,428,147; 5,447,858; 5,608,144; 5,608,144; 5,614,399; 5,633,441; 5,633,435; and 4,633,436. In addition, a tissue specific enhancer may be used (Fromm et al., The Plant Cell, 1:977-984 (1989)).

[0252] Constructs or vectors may also include, with the coding region of interest, a nucleic acid sequence that acts, in whole or in part, to terminate transcription of that region. A number of such sequences have been isolated, including the Tr7 3' sequence and the NOS 3' sequence (Ingelbrecht et al., The Plant Cell, 1:671-680 (1989); Bevan et al., Nucleic Acids Res., 11:369-385 (1983)). Regulatory transcript termination regions can be provided in plant expression constructs of this present invention as well. Transcript termination regions can be provided by the DNA sequence encoding the gene of interest or a convenient transcription termination region derived from a different gene source, for example, the transcript termination region that is naturally associated with the transcript initiation region. The skilled artisan will recognize that any convenient transcript termination region that is capable of terminating transcription in a plant cell can be employed in the constructs of the present invention.

[0253] A vector or construct may also include regulatory elements. Examples of such include the Adh intron 1 (Callis et al., Genes and Develop., 1:1183-1200 (1987)), the sucrose synthase intron (Vasil et al., Plant Physiol., 91:1575-1579 (1989)) and the TMV omega element (Gallie et al., The Plant Cell, 1:301-311 (1989)). These and other regulatory elements may be included when appropriate.

[0254] A vector or construct may also include a selectable marker. Selectable markers may also be used to select for plants or plant cells that contain the exogenous genetic material. Examples of such include, but are not limited to: a neo gene (Potrykus et al., Mol. Gen. Genet., 199:183-188 (1985)), which codes for kanamycin resistance and can be selected for using kanamycin, RptII, G418, hpt etc.; a bar gene which codes for bialaphos resistance; a mutant EPSP synthase gene (Hinchee et al., Bio/Technology, 6:915-922 (1988); Reynaerts et al., Selectable and Screenable Markers. In: Gelvin and Schilperoort, Plant Molecular Biology Manual, Kluwer, Dordrecht (1988); Reynaerts et al., Selectable and Screenable Markers. In: Gelvin and Schilperoort, Plant Molecular Biology Manual, Kluwer, Dordrecht (1988)), aadA (Jones et al., Mol. Gen. Genet. (1987)), which encodes glyphosate resistance; a nitrilase gene which confers resistance to bromoxynil (Stalker et al., J. Biol. Chem., 263:6310-6314 (1988)); a mutant acetolactate synthase gene (ALS) which confers imidazolinone or sulphonylurea resistance (EP 0 154 204 (Sep. 11, 1985)), ALS (D'Halluin et al., Bio/technology, 10:309-314 (1992)), and a methotrexate resistant DHFR gene (Thillet et al., J. Biol. Chem., 263:12500-12508 (1988)).

[0255] A vector or construct may also include a transit peptide. Incorporation of a suitable chloroplast transit peptide may also be employed (EP 0 218 571). Translational enhancers may also be incorporated as part of the vector DNA. DNA constructs could contain one or more 5' non-translated leader sequences, which may serve to enhance expression of the gene products from the resulting mRNA transcripts. Such sequences may be derived from the promoter selected to express the gene or can be specifically modified to increase translation of the mRNA. Such regions may also be obtained from viral RNAs, from suitable eukaryotic genes, or from a synthetic gene sequence. For a review of optimizing expression of transgenes, see Koziel et al., Plant Mol. Biol., 32:393-405 (1996). A preferred transit peptide is CTP1.

[0256] A vector or construct may also include a screenable marker. Screenable markers may be used to monitor expression. Exemplary screenable markers include: a .beta.-glucuronidase or uidA gene (GUS) which encodes an enzyme for which various chromogenic substrates are known (Jefferson, Plant Mol. Biol, Rep., 5:387-405 (1987); Jefferson et al., EMBO J., 6:3901-3907 (1987)); an R-locus gene, which encodes a product that regulates the production of anthocyanin pigments (red color) in plant tissues (Dellaporta et al., Stadler Symposium, 11:263-282 (1988)); a .beta.-lactamase gene (Sutcliffe et al., Proc. Natl. Acad. Sci. (U.S.A.), 75:3737-3741 (1978)), a gene which encodes an enzyme for which various chromogenic substrates are known (e.g., PADAC, a chromogenic cephalosporin); a luciferase gene (Ow et al., Science, 234:856-859 (1986)); a xylE gene (Zukowsky et al., Proc. Natl. Acad. Sci. (U.S.A.), 80:1101-1105 (1983)) which encodes a catechol dioxygenase that can convert chromogenic catechols; an .alpha.-amylase gene (Ikatu et al., Bio/Technol., 8:241-242 (1990)); a tyrosinase gene (Katz et al., J. Gen. Microbiol., 129:2703-2714 (1983)) which encodes an enzyme capable of oxidizing tyrosine to DOPA and dopaquinone which in turn condenses to melanin; an .alpha.-galactosidase, which will turn a chromogenic .alpha.-galactose substrate.

[0257] Included within the terms "selectable or screenable marker genes" are also genes that encode a secretable marker whose secretion can be detected as a means of identifying or selecting for transformed cells. Examples include markers that encode a secretable antigen that can be identified by antibody interaction, or even secretable enzymes that can be detected catalytically. Secretable proteins fall into a number of classes, including small, diffusible proteins that are detectable, (e.g., by ELISA), small active enzymes that are detectable in extracellular solution (e.g., .alpha.-amylase, .beta.-lactamase, phosphinothricin transferase), or proteins that are inserted or trapped in the cell wall (such as proteins that include a leader sequence such as that found in the expression unit of extension or tobacco PR-S). Other possible selectable and/or screenable marker genes will be apparent to those of skill in the art.

[0258] There are many methods for introducing transforming nucleic acid molecules into plant cells. Suitable methods are believed to include virtually any method by which nucleic acid molecules may be introduced into a cell, such as by Agrobacterium infection or direct delivery of nucleic acid molecules such as, for example, by PEG-mediated transformation, by electroporation or by acceleration of DNA coated particles, and the like. (Potrykus, Ann. Rev. Plant Physiol. Plant Mol. Biol., 42:205-225 (1991); Vasil, Plant Mol. Biol., 25:925-937 (1994)). For example, electroporation has been used to transform corn protoplasts (Fromm et al., Nature, 312:791-793 (1986)).

[0259] Other vector systems suitable for introducing transforming DNA into a host plant cell include but are not limited to binary artificial chromosome (BIBAC) vectors (Hamilton et al., Gene, 200:107-116 (1997)); and transfection with RNA viral vectors (Della-Cioppa et al., Ann. N.Y. Acad. Sci. (1996), 792 (Engineering Plants for Commercial Products and Applications, 57-61). Additional vector systems also include plant selectable YAC vectors such as those described in Mullen et al., Molecular Breeding, 4:449-457 (1988).

[0260] Technology for introduction of DNA into cells is well known to those of skill in the art. Four general methods for delivering a gene into cells have been described: (1) chemical methods (Graham and van der Eb, Virology, 54:536-539 (1973)); (2) physical methods such as microinjection (Capecchi, Cell, 22:479-488 (1980)), electroporation (Wong and Neumann, Biochem. Biophys. Res. Commun., 107:584-587 (1982); Fromm et al., Proc. Natl. Acad. Sci. (U.S.A.), 82:5824-5828 (1985); U.S. Pat. No. 5,384,253); the gene gun (Johnston and Tang, Methods Cell Biol., 43:353-365 (1994)); and vacuum infiltration (Bechtold et al., C.R. Acad. Sci. Paris, Life Sci., 316:1194-1199 (1993)); (3) viral vectors (Clapp, Clin. Perinatol., 20:155-168 (1993); Lu et al., J. Exp. Med., 178:2089-2096 (1993); Eglitis and Anderson, Biotechniques, 6:608-614 (1988)); and (4) receptor-mediated mechanisms (Curiel et al., Hum. Gen. Ther., 3:147-154 (1992), Wagner et al., Proc. Natl. Acad. Sci. (U.S.A.), 89:6099-6103 (1992)).

[0261] Acceleration methods that may be used include, for example, microprojectile bombardment and the like. One example of a method for delivering transforming nucleic acid molecules into plant cells is microprojectile bombardment. This method has been reviewed by Yang and Christou (eds.), Particle Bombardment Technology for Gene Transfer, Oxford Press, Oxford, England (1994). Non-biological particles (microprojectiles) may be coated with nucleic acids and delivered into cells by a propelling force. Exemplary particles include those comprised of tungsten, gold, platinum and the like.

[0262] A particular advantage of microprojectile bombardment, in addition to it being an effective means of reproducibly transforming monocots, is that neither the isolation of protoplasts (Cristou et al., Plant Physiol., 87:671-674 (1988)) nor the susceptibility to Agrobacterium infection is required. An illustrative embodiment of a method for delivering DNA into corn cells by acceleration is a biolistics .alpha.-particle delivery system, which can be used to propel particles coated with DNA through a screen, such as a stainless steel or Nytex screen, onto a filter surface covered with corn cells cultured in suspension. Gordon-Kamm et al., describes the basic procedure for coating tungsten particles with DNA (Gordon-Kamm et al., Plant Cell, 2:603-618 (1990)). The screen disperses the tungsten nucleic acid particles so that they are not delivered to the recipient cells in large aggregates. A particle delivery system suitable for use with the present invention is the helium acceleration PDS-1000/He gun, which is available from Bio-Rad Laboratories (Bio-Rad, Hercules, Calif.) (Sanford et al., Technique, 3:3-16 (1991)).

[0263] For the bombardment, cells in suspension may be concentrated on filters. Filters containing the cells to be bombarded are positioned at an appropriate distance below the microprojectile stopping plate. If desired, one or more screens are also positioned between the gun and the cells to be bombarded.

[0264] Alternatively, immature embryos or other target cells may be arranged on solid culture medium. The cells to be bombarded are positioned at an appropriate distance below the microprojectile stopping plate. If desired, one or more screens are also positioned between the acceleration device and the cells to be bombarded. Through the use of techniques set forth herein one may obtain 1000 or more loci of cells transiently expressing a marker gene. The number of cells in a focus that express the exogenous gene product 48 hours post-bombardment often ranges from one to ten, and average one to three.

[0265] In bombardment transformation, one may optimize the pre-bombardment culturing conditions and the bombardment parameters to yield the maximum numbers of stable transformants. Both the physical and biological parameters for bombardment are important in this technology. Physical factors are those that involve manipulating the DNA/microprojectile precipitate or those that affect the flight and velocity of either the macro- or microprojectiles. Biological factors include all steps involved in manipulation of cells before and immediately after bombardment, the osmotic adjustment of target cells to help alleviate the trauma associated with bombardment and also the nature of the transforming DNA, such as linearized DNA or intact supercoiled plasmids. It is believed that pre-bombardment manipulations are especially important for successful transformation of immature embryos.

[0266] In another alternative embodiment, plastids can be stably transformed. Methods disclosed for plastid transformation in higher plants include the particle gun delivery of DNA containing a selectable marker and targeting of the DNA to the plastid genome through homologous recombination (Svab et al., Proc. Natl. Acad. Sci. (U.S.A.), 87:8526-8530 (1990); Svab and Maliga, Proc. Natl. Acad. Sci. (U.S.A.), 90:913-917 (1993); Staub and Maliga, EMBO J., 12:601-606 (1993); U.S. Pat. Nos. 5,451,513 and 5,545,818).

[0267] Accordingly, it is contemplated that one may wish to adjust various aspects of the bombardment parameters in small scale studies to fully optimize the conditions. One may particularly wish to adjust physical parameters such as gap distance, flight distance, tissue distance and helium pressure. One may also minimize the trauma reduction factors by modifying conditions that influence the physiological state of the recipient cells and which may therefore influence transformation and integration efficiencies. For example, the osmotic state, tissue hydration and the subculture stage or cell cycle of the recipient cells may be adjusted for optimum transformation. The execution of other routine adjustments will be known to those of skill in the art in light of the present disclosure.

[0268] Agrobacterium-mediated transfer is a widely applicable system for introducing genes into plant cells because the DNA-can be introduced into whole plant tissues, thereby bypassing the need for regeneration of an intact plant from a protoplast. The use of Agrobacterium-mediated plant integrating vectors to introduce DNA into plant cells is well known in the art. See, for example, the methods described by Fraley et al., Bio/Technology, 3:629-635 (1985) and Rogers et al., Methods Enzymol., 153:253-277 (1987). Further, the integration of the Ti-DNA is a relatively precise process resulting in few rearrangements. The region of DNA to be transferred is defined by the border sequences and intervening DNA is usually inserted into the plant genome as described (Spielmann et al., Mol. Gen. Genet., 205:34 (1986)).

[0269] Modern Agrobacterium transformation vectors are capable of replication in E. coli as well as Agrobacterium, allowing for convenient manipulations as described (Klee et al., In: Plant DNA Infectious Agents, Hohn and Schell (eds.), Springer-Verlag, NY, pp. 179-203 (1985)). Moreover, technological advances in vectors for Agrobacterium-mediated gene transfer have improved the arrangement of genes and restriction sites in the vectors to facilitate construction of vectors capable of expressing various polypeptide coding genes. The vectors described have convenient multi-linker regions flanked by a promoter and a polyadenylation site for direct expression of inserted polypeptide coding genes and are suitable for present purposes (Rogers et al., Methods Enzymol., 153:253-277 (1987)). In addition, Agrobacterium containing both armed and disarmed Ti genes can be used for the transformations. In those plant strains where Agrobacterium-mediated transformation is efficient, it is the method of choice because of the facile and defined nature of the gene transfer.

[0270] A transgenic plant formed using Agrobacterium transformation methods typically contains a single gene on one chromosome. Such transgenic plants can be referred to as being heterozygous for the added gene. More preferred is a transgenic plant that is homozygous for the added structural gene; i.e., a transgenic plant that contains two added genes, one gene at the same locus on each chromosome of a chromosome pair. A homozygous transgenic plant can be obtained by sexually mating (selfing) an independent segregant, transgenic plant that contains a single added gene, germinating some of the seed produced and analyzing the resulting plants produced for the gene of interest.

[0271] It is also to be understood that two different transgenic plants can also be mated to produce offspring that contain two independently segregating, exogenous genes. Selfing of appropriate progeny can produce plants that are homozygous for both added, exogenous genes that encode a polypeptide of interest. Back-crossing to a parental plant and out-crossing with a non-transgenic plant are also contemplated, as is vegetative propagation.

[0272] Transformation of plant protoplasts can be achieved using methods based on calcium phosphate precipitation, polyethylene glycol treatment, electroporation and combinations of these treatments (see, for example, Potrykus et al., Mol. Gen. Genet., 205:193-200 (1986); Lorz et al., Mol. Gen. Genet., 199:178 (1985); Fromm et al., Nature, 319:791 (1986); Uchimiya et al., Mol. Gen. Genet., 204:204 (1986); Marcotte et al., Nature, 335:454-457 (1988)).

[0273] Application of these systems to different plant strains depends upon the ability to regenerate that particular plant strain from protoplasts. Illustrative methods for the regeneration of cereals from protoplasts are described (Fujimura et al., Plant Tissue Culture Letters, 2:74 (1985); Toriyama et al., Theor. Appl. Genet., 205:34 (1986); Yamada et al., Plant Cell Rep., 4:85 (1986); Abdullah et al., Biotechnology, 4:1087 (1986)).

[0274] To transform plant strains that cannot be successfully regenerated from protoplasts, other ways to introduce DNA into intact cells or tissues can be utilized. For example, regeneration of cereals from immature embryos or explants can be effected as described (Vasil, Biotechnology, 6:397 (1988)). In addition, "particle gun" or high-velocity microprojectile technology can be utilized (Vasil et al., Bio/Technology, 10:667 (1992)).

[0275] Using the latter technology, DNA is carried through the cell wall and into the cytoplasm on the surface of small metal particles as described (Klein et al., Nature, 328:70 (1987); Klein et al., Proc. Natl. Acad. Sci. (U.S.A.), 85:8502-8505 (1988); McCabe et al., Bio/Technology, 6:923 (1988)). The metal particles penetrate through several layers of cells and thus allow the transformation of cells within tissue explants.

[0276] Other methods of cell transformation can also be used and include but are not limited to introduction of DNA into plants by direct DNA transfer into pollen (Hess et al., Intern Rev. Cytol., 107:367 (1987); Luo et al., Plant Mol Biol. Reporter, 6:165 (1988)), by direct injection of DNA into reproductive organs of a plant (Pena et al., Nature, 325:274 (1987)), or by direct injection of DNA into the cells of immature embryos followed by the rehydration of desiccated embryos (Neuhaus et al., Theor. Appl. Genet., 75:30 (1987)).

[0277] The regeneration, development and cultivation of plants from single plant protoplast transformants or from various transformed explants is well known in the art (Weissbach and Weissbach, In: Methods for Plant Molecular Biology, Academic Press, San Diego, Calif., (1988)). This regeneration and growth process typically includes the steps of selection of transformed cells, culturing those individualized cells through the usual stages of embryonic development through the rooted plantlet stage. Transgenic embryos and seeds are similarly regenerated. The resulting transgenic rooted shoots are thereafter planted in an appropriate plant growth medium such as soil.

[0278] The development or regeneration of plants containing the foreign, exogenous gene that encodes a protein of interest is well known in the art. Preferably, the regenerated plants are self-pollinated to provide homozygous transgenic plants. Otherwise, pollen obtained from the regenerated plants is crossed to seed-grown plants of agronomically important lines. Conversely, pollen from plants of these important lines is used to pollinate regenerated plants. A transgenic plant of the present invention containing a desired polypeptide is cultivated using methods well known to one skilled in the art.

[0279] There are a variety of methods for the regeneration of plants from plant tissue. The particular method of regeneration will depend on the starting plant tissue and the particular plant species to be regenerated.

[0280] Methods for transforming dicots, primarily by use of Agrobacterium tumefaciens and obtaining transgenic plants have been published for cotton (U.S. Pat. Nos. 5,004,863; 5,159,135; and 5,518,908); soybean (U.S. Pat. Nos. 5,569,834 and 5,416,011; McCabe et al., Biotechnology, 6:923 (1988); Christou et al., Plant Physiol., 87:671-674 (1988)); Brassica (U.S. Pat. No. 5,463,174); peanut (Cheng et al., Plant Cell Rep., 15:653-657 (1996), McKently et al., Plant Cell Rep., 14:699-703 (1995)); papaya; pea (Grant et al., Plant Cell Rep., 15:254-258 (1995)); and Arabidopsis thaliana (Bechtold et al., C.R. Acad. Sci. Paris, Life Sci., 316:1194-1199 (1993)). The latter method for transforming Arabidopsis thaliana is commonly called "dipping" or vacuum infiltration or germplasm transformation.

[0281] Transformation of monocotyledons using electroporation, particle bombardment and Agrobacterium have also been reported. Transformation and plant regeneration have been achieved in asparagus (Bytebier et al., Proc. Natl. Acad. Sci. (U.S.A.), 84:5354 (1987)); barley (Wan and Lemaux, Plant Physiol, 104:37 (1994)); corn (Rhodes et al., Science, 240:204 (1988); Gordon-Kamm et al., Plant Cell, 2:603-618 (1990); Fromm et al., Bio/Technology, 8:833 (1990); Koziel et al., Bio/Technology, 11:194 (1993); Armstrong et al., Crop Science, 35:550-557 (1995)); oat (Somers et al., Bio/Technology, 10:1589 (1992)); orchard grass (Horn et al., Plant Cell Rep., 7:469 (1988)); rice (Toriyama et al., Theor Appl. Genet., 205:34 (1986); Part et al., Plant Mol. Biol., 32:1135-1148 (1996); Abedinia et al., Aust. J. Plant Physiol., 24:133-141 (1997); Zhang and Wu, Theor. Appl. Genet., 76:835 (1988); Zhang et al., Plant Cell Rep., 7:379 (1988); Battraw and Hall, Plant Sci., 86:191-202 (1992); Christou et al., Bio/Technology, 9:957 (1991)); rye (De la Pena et al., Nature, 325:274 (1987)); sugarcane (Bower and Birch, Plant J., 2:409 (1992)); tall fescue (Wang et al., Bio/Technology, 10:691 (1992)); and wheat (Vasil et al., Bio/Technology, 10:667 (1992); U.S. Pat. No. 5,631,152).

[0282] Assays for gene expression based on the transient expression of cloned nucleic acid constructs have been developed by introducing the nucleic acid molecules into plant cells by polyethylene glycol treatment, electroporation, or particle bombardment (Marcotte et al., Nature, 335:454-457 (1988); Marcotte et al., Plant Cell, 1:523-532 (1989); McCarty et al., Cell, 66:895-905 (1991); Hattori et al., Genes Dev., 6:609-618 (1992); Goff et al., EMBO J., 9:2517-2522 (1990)). Transient expression systems may be used to functionally dissect gene constructs (see generally, Mailga et al., Methods in Plant Molecular Biology, Cold Spring Harbor Press, NY (1995)).

[0283] Any of the nucleic acid molecules of the present invention may be introduced into a plant cell in a permanent or transient manner in combination with other genetic elements such as vectors, promoters, enhancers, etc. Further, any of the nucleic acid molecules of the present invention may be introduced into a plant cell in a manner that allows for expression or overexpression of the protein or fragment thereof encoded by the nucleic acid molecule.

[0284] Cosuppression is the reduction in expression levels, usually at the level of RNA, of a particular endogenous gene or gene family by the expression of a homologous sense construct that is capable of transcribing mRNA of the same strandedness as the transcript of the endogenous gene (Napoli et al., Plant Cell, 2:279-289 (1990); van der Krol et al., Plant Cell, 2:291-299 (1990)). Cosuppression may result from stable transformation with a single copy nucleic acid molecule that is homologous to a nucleic acid sequence found with the cell (Prolls and Meyer, Plant J., 2:465-475 (1992)) or with multiple copies of a nucleic acid molecule that is homologous to a nucleic acid sequence found with the cell (Mittlesten et al., Mol. Gen. Genet., 244:325-330 (1994)). Genes, even though different, linked to homologous promoters may result in the cosuppression of the linked genes (Vaucheret, C.R. Acad. Sci. III, 316:1471-1483 (1993); Flavell, Proc. Natl. Acad. Sci. (U.S.A.), 91:3490-3496 (1994)); van Blokland et al., Plant J., 6:861-877 (1994); Jorgensen, Trends Biotechnol., 8:340-344 (1990); Meins and Kunz, In: Gene Inactivation and Homologous Recombination in Plants, Paszkowski (ed.), pp. 335-348, Kluwer Academic, Netherlands (1994)).

[0285] It is understood that one or more of the nucleic acids of the present invention may be introduced into a plant cell and transcribed using an appropriate promoter with such transcription resulting in the cosuppression of an endogenous protein.

[0286] Antisense approaches are a way of preventing or reducing gene function by targeting the genetic material (Mol et al., FEBS Lett., 268:427-430 (1990)). The objective of the antisense approach is to use a sequence complementary to the target gene to block its expression and create a mutant cell line or organism in which the level of a single chosen protein is selectively reduced or abolished. Antisense techniques have several advantages over other "reverse genetic" approaches. The site of inactivation and its developmental effect can be manipulated by the choice of promoter for antisense genes or by the timing of external application or microinjection. Antisense can manipulate its specificity by selecting either unique regions of the target gene or regions where it shares homology to other related genes (Hiatt et al., In: Genetic Engineering, Setlow (ed.), Vol. 11, New York: Plenum 49-63 (1989)).

[0287] Antisense RNA techniques involve introduction of RNA that is complementary to the target mRNA into cells, which results in specific RNA:RNA duplexes being formed by base pairing between the antisense substrate and the target mRNA (Green et al., Annu. Rev. Biochem., 55:569-597 (1986)). Under one embodiment, the process involves the introduction and expression of an antisense gene sequence. Such a sequence is one in which part or all of the normal gene sequences are placed under a promoter in inverted orientation so that the "wrong" or complementary strand is transcribed into a noncoding antisense RNA that hybridizes with the target mRNA and interferes with its expression (Takayama and Inouye, Crit. Rev. Biochem. Mol. Biol., 25:155-184 (1990)). An antisense vector is constructed by standard procedures and introduced into cells by transformation, transfection, electroporation, microinjection, infection, etc. The type of transformation and choice of vector will determine whether expression is transient or stable. The promoter used for the antisense gene may influence the level, timing, tissue, specificity, or inducibility of the antisense inhibition.

[0288] It is understood that the activity of a protein in a plant cell may be reduced or depressed by growing a transformed plant cell containing a nucleic acid molecule whose non-transcribed strand encodes a protein or fragment thereof. A preferred protein whose activity can be reduced or depressed, by any method, is a homogentisate prenyl transferase.

[0289] Posttranscriptional gene silencing (PTGS) can result in virus immunity or gene silencing in plants. PTGS is induced by dsRNA and is mediated by an RNA-dependent RNA polymerase, present in the cytoplasm, which requires a dsRNA template. The dsRNA is formed by hybridization of complementary transgene mRNAs or complementary regions of the same transcript. Duplex formation can be accomplished by using transcripts from one sense gene and one antisense gene colocated in the plant genome, a single transcript that has self-complementarity, or sense and antisense transcripts from genes brought together by crossing. The dsRNA-dependent RNA polymerase makes a complementary strand from the transgene mRNA and RNAse molecules attach to this complementary strand (cRNA). These cRNA-RNase molecules hybridize to the endogene mRNA and cleave the single-stranded RNA adjacent to the hybrid. The cleaved single-stranded RNAs are further degraded by other host RNases because one will lack a capped 5' end and the other will lack a poly (A) tail (Waterhouse et al., PNAS, 95:13959-13964 (1998)).

[0290] It is understood that one or more of the nucleic acids of the present invention may be introduced into a plant cell and transcribed using an appropriate promoter with such transcription resulting in the posttranscriptional gene silencing of an endogenous transcript.

[0291] Antibodies have been expressed in plants (Hiatt et al., Nature, 342:76-78 (1989); Conrad and Fielder, Plant Mol. Biol., 26:1023-1030 (1994)). Cytoplasmic expression of a scFv (single-chain Fv antibody) has been reported to delay infection by artichoke mottled crinkle virus. Transgenic plants that express antibodies directed against endogenous proteins may exhibit a physiological effect (Philips et al., EMBO J., 16:4489-4496 (1997); Marion-Poll, Trends in Plant Science, 2:447-448 (1997)). For example, expressed anti-abscisic antibodies have been reported to result in a general perturbation of seed development (Philips et al., EMBO J., 16:4489-4496 (1997)).

[0292] Antibodies that are catalytic may also be expressed in plants (abzymes). The principle behind abzymes is that since antibodies may be raised against many molecules, this recognition ability can be directed toward generating antibodies that bind transition states to force a chemical reaction forward (Persidas, Nature Biotechnology, 15:1313-1315 (1997); Baca et al., Ann. Rev. Biophys. Biomol. Struct., 26:461-493 (1997)). The catalytic abilities of abzymes may be enhanced by site directed mutagenesis. Examples of abzymes are, for example, set forth in U.S. Pat. Nos. 5,658,753; 5,632,990; 5,631,137; 5,602,015; 5,559,538; 5,576,174; 5,500,358; 5,318,897; 5,298,409; 5,258,289; and 5,194,585.

[0293] It is understood that any of the antibodies of the present invention may be expressed in plants and that such expression can result in a physiological effect. It is also understood that any of the expressed antibodies may be catalytic.

[0294] The present invention also provides for parts of the plants, particularly reproductive or storage parts, of the present invention. Plant parts, without limitation, include seed, endosperm, ovule and pollen. In a particularly preferred embodiment of the present invention, the plant part is a seed. In one embodiment the seed is a constituent of animal feed.

[0295] In another embodiment, the plant part is a fruit, more preferably a fruit with enhanced shelf life. In another preferred embodiment, the fruit has increased levels of a tocopherol. In another preferred embodiment, the fruit has increased levels of a tocotrienol.

[0296] The present invention also provides a container of over about 10,000, more preferably about 20,000, and even more preferably about 40,000 seeds where over about 10%, more preferably 25%, more preferably 50%, and even more preferably 75% or 90% of the seeds are seeds derived from a plant of the present invention.

[0297] The present invention also provides a container of over about 10 kg, more preferably 25 kg, and even more preferably 50 kg seeds where over about 10%, more preferably 25%, more preferably 50%, and even more preferably 75% or 90% of the seeds are seeds derived from a plant of the present invention.

[0298] Any of the plants or parts thereof of the present invention may be processed to produce a feed, meal, protein, or oil preparation, including oil preparations high in total tocopherol content and oil preparations high in any one or more of each tocopherol component listed herein. A particularly preferred plant part for-this purpose is a seed. In a preferred embodiment the feed, meal, protein or oil preparation is designed for livestock animals or humans, or both. Methods to produce feed, meal, protein and oil preparations are known in the art. See, for example, U.S. Pat. Nos. 4,957,748; 5,100,679; 5,219,596; 5,936,069; 6,005,076; 6,146,669; and 6,156,227. In a preferred embodiment, the protein preparation is a high protein preparation. Such a high protein preparation preferably has a protein content of greater than about 5% w/v, more preferably 10% w/v, and even more preferably 15% w/v. In a preferred oil preparation, the oil preparation is a high oil preparation with an oil content derived from a plant or part thereof of the present invention of greater than about 5% w/v, more preferably 10% w/v, and even more preferably 15% w/v. In a preferred embodiment the oil preparation is a liquid and of a volume greater than about 1, 5, 10, or 50 liters. The present invention provides for oil produced from plants of the present invention or generated by a method of the present invention. Such an oil may exhibit enhanced oxidative stability. Also, such oil may be a minor or major component of any resultant product. Moreover, such oil may be blended with other oils. In a preferred embodiment, the oil produced from plants of the present invention or generated by a method of the present invention constitutes greater than about 0.5%, 1%, 5%, 10%, 25%, 50%, 75%, or 90% by volume or weight of the oil component of any product. In another embodiment, the oil preparation may be blended and can constitute greater than about 10%, 25%, 35%, 50%, or 75% of the blend by volume. Oil produced from a plant of the present invention can be admixed with one or more organic solvents or petroleum distillates.

[0299] Plants of the present invention can be part of or generated from a breeding program. The choice of breeding method depends on the mode of plant reproduction, the heritability of the trait(s) being improved, and the type of cultivar used commercially (e.g., F.sub.1 hybrid cultivar, pureline cultivar, etc.). Selected, non-limiting approaches, for breeding the plants of the present invention are set forth below. A breeding program can be enhanced using marker assisted selection of the progeny of any cross. It is further understood that any commercial and non-commercial cultivars can be utilized in a breeding program. Factors such as, for example, emergence vigor, vegetative vigor, stress tolerance, disease resistance, branching, flowering, seed set, seed size, seed density, standability, and threshability etc. will generally dictate the choice.

[0300] For highly heritable traits, a choice of superior individual plants evaluated at a single location will be effective, whereas for traits with low heritability, selection should be based on mean values obtained from replicated evaluations of families of related plants. Popular selection methods commonly include pedigree selection, modified pedigree selection, mass selection, and recurrent selection. In a preferred embodiment a backcross or recurrent breeding program is undertaken.

[0301] The complexity of inheritance influences choice of the breeding method. Backcross breeding can be used to transfer one or a few favorable genes for a highly heritable trait into a desirable cultivar. This approach has been used extensively for breeding disease-resistant cultivars. Various recurrent selection techniques are used to improve quantitatively inherited traits controlled by numerous genes. The use of recurrent selection in self-pollinating crops depends on the ease of pollination, the frequency of successful hybrids from each pollination, and the number of hybrid offspring from each successful cross.

[0302] Breeding lines can be tested and compared to appropriate standards in environments representative of the commercial target area(s) for two or more generations. The best lines are candidates for new commercial cultivars; those still deficient in traits may be used as parents to produce new populations for further selection.

[0303] One method of identifying a superior plant is to observe its performance relative to other experimental plants and to a widely grown standard cultivar. If a single observation is inconclusive, replicated observations can provide a better estimate of its genetic worth. A breeder can select and cross two or more parental lines, followed by repeated selfing and selection, producing many new genetic combinations.

[0304] The development of new cultivars requires the development and selection of varieties, the crossing of these varieties and the selection of superior hybrid crosses. The hybrid seed can be produced by manual crosses between selected male-fertile parents or by using male sterility systems. Hybrids are selected for certain single gene traits such as pod color, flower color, seed yield, pubescence color, or herbicide resistance, which indicate that the seed is truly a hybrid. Additional data on parental lines, as well as the phenotype of the hybrid, influence the breeder's decision whether to continue with the specific hybrid cross.

[0305] Pedigree breeding and recurrent selection breeding methods can be used to develop cultivars from breeding populations. Breeding programs combine desirable traits from two or more cultivars or various broad-based sources into breeding pools from which cultivars are developed by selfing and selection of desired phenotypes. New cultivars can be evaluated to determine which have commercial potential.

[0306] Pedigree breeding is used commonly for the improvement of self-pollinating crops. Two parents who possess favorable, complementary traits are crossed to produce an F.sub.1. A F.sub.2 population is produced by selfing one or several F.sub.1's. Selection of the best individuals from the best families is carried out. Replicated testing of families can begin in the F.sub.4 generation to improve the effectiveness of selection for traits with low heritability. At an advanced stage of inbreeding (i.e., F.sub.6 and F.sub.7), the best lines or mixtures of phenotypically similar lines are tested for potential release as new cultivars.

[0307] Backcross breeding has been used to transfer genes for a simply inherited, highly heritable trait into a desirable homozygous cultivar or inbred line, which is the recurrent parent. The source of the trait to be transferred is called the donor parent. The resulting plant is expected to have the attributes of the recurrent parent (e.g., cultivar) and the desirable trait transferred from the donor parent. After the initial cross, individuals possessing the phenotype of the donor parent are selected and repeatedly crossed (backcrossed) to the recurrent parent. The resulting parent is expected to have the attributes of the recurrent parent (e.g., cultivar) and the desirable trait transferred from the donor parent.

[0308] The single-seed descent procedure in the strict sense refers to planting a segregating population, harvesting a sample of one seed per plant, and using the one-seed sample to plant the next generation. When the population has been advanced from the F.sub.2 to the desired level of inbreeding, the plants from which lines are derived will each trace to different F.sub.2 individuals. The number of plants in a population declines each generation due to failure of some seeds to germinate or some plants to produce at least one seed. As a result, not all of the F.sub.2 plants originally sampled in the population will be represented by a progeny when generation advance is completed.

[0309] In a multiple-seed procedure, breeders commonly harvest one or more pods from each plant in a population and thresh them together to form a bulk. Part of the bulk is used to plant the next generation and part is put in reserve. The procedure has been referred to as modified single-seed descent or the pod-bulk technique.

[0310] The multiple-seed procedure has been used to save labor at harvest. It is considerably faster to thresh pods with a machine than to remove one seed from each by hand for the single-seed procedure. The multiple-seed procedure also makes it possible to plant the same number of seeds of a population each generation of inbreeding.

[0311] Descriptions of other breeding methods that are commonly used for different traits and crops can be found in one of several reference books (e.g., Fehr, Principles of Cultivar Development, Vol. 1, pp. 2-3 (1987)).

[0312] A transgenic plant of the present invention may also be reproduced using apomixis. Apomixis is a genetically controlled method of reproduction in plants where the embryo is formed without union of an egg and a sperm. There are three basic types of apomictic reproduction: 1) apospory where the embryo develops from a chromosomally unreduced egg in an embryo sac derived from the nucleus; 2) diplospory where the embryo develops from an unreduced egg in an embryo sac derived from the megaspore mother cell; and 3) adventitious embryony where the embryo develops directly from a somatic cell. In most forms of apomixis, pseudogamy, or fertilization of the polar nuclei to produce endosperm is necessary for seed viability. In apospory, a nurse cultivar can be used as a pollen source for endosperm formation in seeds. The nurse cultivar does not affect the genetics of the aposporous apomictic cultivar since the unreduced egg of the cultivar develops parthenogenetically, but makes possible endosperm production. Apomixis is economically important, especially in transgenic plants, because it causes any genotype, no matter how heterozygous, to breed true. Thus, with apomictic reproduction, heterozygous transgenic plants can maintain their genetic fidelity throughout repeated life cycles. Methods for the production of apomictic plants are known in the art. See, U.S. Pat. No. 5,811,636.

[0313] Other Organisms

[0314] A nucleic acid of the present invention may be introduced into any cell or organism such as a mammalian cell, mammal, fish cell, fish, bird cell, bird, algae cell, algae, fungal cell, fungi, or bacterial cell. A protein of the present invention may be produced in an appropriate cell or organism. Preferred host and transformants include: fungal cells such as Aspergillus, yeasts, mammals, particularly bovine and porcine, insects, bacteria, and algae. Particularly preferred bacteria are Agrobacterium tumefaciens and E. coli.

[0315] Methods to transform such cells or organisms are known in the art (EP 0 238 023; Yelton et al., Proc. Natl. Acad. Sci. (U.S.A.), 81:1470-1474 (1984); Malardier et al., Gene, 78:147-156 (1989); Becker and Guarente, In: Abelson and Simon (eds.), Guide to Yeast Genetics and Molecular Biology, Method Enzymol., Vol. 194, pp. 182-187, Academic Press, Inc., NY; Ito et al., J. Bacteriology, 153:163 (1983); Hinnen et al., Proc. Natl. Acad. Sci. (U.S.A.), 75:1920 (1978); Bennett and LaSure (eds.), More Gene Manipualtionins in fungi, Academic Press, CA (1991)). Methods to produce proteins of the present invention are also known (Kudla et al., EMBO, 9:1355-1364 (1990); Jarai and Buxton, Current Genetics, 26:2238-2244 (1994); Verdier, Yeast, 6:271-297 (1990); MacKenzie et al., Journal of Gen. Microbiol., 139:2295-2307 (1993); Hartl et al., TIBS, 19:20-25 (1994); Bergenron et al., TIBS, 19:124-128 (1994); Demolder et al., J. Biotechnology, 32:179-189 (1994); Craig, Science, 260:1902-1903 (1993); Gething and Sambrook, Nature, 355:33-45 (1992); Puig and Gilbert, J., Biol. Chem., 269:7764-7771 (1994); Wang and Tsou, FASEB Journal, 7:1515-1517 (1993); Robinson et al., Bio/Technology, 1:381-384 (1994); Enderlin and Ogrydziak, Yeast, 10:67-79 (1994); Fuller et al., Proc. Natl. Acad. Sci. (U.S.A.), 86:1434-1438 (1989); Julius et al., Cell, 37:1075-1089 (1984); Julius et al., Cell, 32:839-852 (1983)).

[0316] In a preferred embodiment, overexpression of a protein or fragment thereof of the present invention in a cell or organism provides in that cell or organism, relative to an untransformed cell or organism with a similar genetic background, an increased level of tocopherols.

[0317] In a preferred embodiment, overexpression of a protein or fragment thereof of the present invention in a cell or organism provides in that cell or organism, relative to an untransformed cell or organism with a similar genetic background, an increased level of .alpha.-tocopherols.

[0318] In a preferred embodiment, overexpression of a protein or fragment thereof of the present invention in a cell or organism provides in that cell or organism, relative to an untransformed cell or organism with a similar genetic background, an increased level of .gamma.-tocopherols.

[0319] In another preferred embodiment, overexpression of a protein or fragment thereof of the present invention in a cell or organism provides in that cell or organism, relative to an untransformed cell or organism with a similar genetic background, an increased level of .alpha.-tocotrienols.

[0320] In another preferred embodiment, overexpression of a protein or fragment thereof of the present invention in a cell or organism provides in that cell or organism, relative to an untransformed cell or organism with a similar genetic background, an increased level of .gamma.-tocotrienols.

[0321] Antibodies

[0322] One aspect of the present invention concerns antibodies, single-chain antigen binding molecules, or other proteins that specifically bind to one or more of the protein or peptide molecules of the present invention and their homologs, fusions or fragments. In a particularly preferred embodiment, the antibody specifically binds to a protein having the amino acid sequence set forth in SEQ I) NOs: 5, 9-11, 43-44, 57-58, and 90, or fragments thereof. Antibodies of the present invention may be used to quantitatively or qualitatively detect the protein or peptide molecules of the present invention, or to detect post translational modifications of the proteins. As used herein, an antibody or peptide is said to "specifically bind" to a protein or peptide molecule of the present invention if such binding is not competitively inhibited by the presence of non-related molecules.

[0323] Nucleic acid molecules that encode all or part of the protein of the present invention can be expressed, via recombinant means, to yield protein or peptides that can in turn be used to elicit antibodies that are capable of binding the expressed protein or peptide. Such antibodies may be used in immunoassays for that protein. Such protein-encoding molecules, or their fragments may be a "fusion" molecule (i.e., a part of a larger nucleic acid molecule) such that, upon expression, a fusion protein is produced. It is understood that any of the nucleic acid molecules of the present invention may be expressed, via recombinant means, to yield proteins or peptides encoded by these nucleic acid molecules.

[0324] The antibodies that specifically bind proteins and protein fragments of the present invention may be polyclonal or monoclonal and may comprise intact immunoglobulins, or antigen binding portions of immunoglobulins fragments (such as (F(ab'), F(ab').sub.2)), or single-chain immunoglobulins producible, for example, via recombinant means. It is understood that practitioners are familiar with the standard resource materials that describe specific conditions and procedures for the construction, manipulation and isolation of antibodies (see, for example, Harlow and Lane, In: Antibodies: A Laboratory Manual, Cold Spring Harbor Press, Cold Spring Harbor, N.Y. (1988)).

[0325] As discussed below, such antibody molecules or their fragments may be used for diagnostic purposes. Where the antibodies are intended for diagnostic purposes, it may be desirable to derivatize them, for example with a ligand group (such as biotin) or a detectable marker group (such as a fluorescent group, a radioisotope or an enzyme).

[0326] The ability to produce antibodies that bind the protein or peptide molecules of the present invention permits the identification of mimetic compounds derived from those molecules. These mimetic compounds may contain a fragment of the protein or peptide or merely a structurally similar region and nonetheless exhibits an ability to specifically bind to antibodies directed against that compound.

[0327] Exemplary Uses

[0328] Nucleic acid molecules and fragments thereof of the present invention may be employed to obtain other nucleic acid molecules from the same species (nucleic acid molecules from corn may be utilized to obtain other nucleic acid molecules from corn). Such nucleic acid molecules include the nucleic acid molecules that encode the complete coding sequence of a protein and promoters and flanking sequences of such molecules. In addition, such nucleic acid molecules include nucleic acid molecules that encode for other isozymes or gene family members. Such molecules can be readily obtained by using the above-described nucleic acid molecules or fragments thereof to screen cDNA or genomic libraries. Methods for forming such libraries are well known in the art.

[0329] Nucleic acid molecules and fragments thereof of the present invention may also be employed to obtain nucleic acid homologs. Such homologs include the nucleic acid molecules of plants and other organisms, including bacteria and fungi, including the nucleic acid molecules that encode, in whole or in part, protein homologues of other plant species or other organisms, sequences of genetic elements, such as promoters and transcriptional regulatory elements. Such molecules can be readily obtained by using the above-described nucleic acid molecules or fragments thereof to screen cDNA or genomic libraries obtained from such plant species. Methods for forming such libraries are well known in the art. Such homolog molecules may differ in their nucleotide sequences from those coding for one or more of SEQ ID NOs: 5, 9-11, 43-44, 57-58, and 90, and complements thereof because complete complementarity is not needed for stable hybridization. The nucleic acid molecules of the present invention therefore also include molecules that, although capable of specifically hybridizing with the nucleic acid molecules may lack "complete complementarity".

[0330] Any of a variety of methods may be used to obtain one or more of the above-described nucleic acid molecules (Zamechik et al., Proc. Natl. Acad. Sci. (U.S.A.), 83:4143-4146 (1986); Goodchild et al., Proc. Natl. Acad. Sci. (U.S.A.), 85:5507-5511 (1988); Wickstrom et al., Proc. Natl. Acad. Sci. (U.S.A.), 85:1028-1032 (1988); Holt et al., Molec. Cell. Biol., 8:963-973 (1988); Gerwirtz et al., Science, 242:1303-1306 (1988); Anfossi et al., Proc. Natl. Acad. Sci. (U.S.A.), 86:3379-3383 (1989); Becker et al., EMBO J., 8:3685-3691 (1989)). Automated nucleic acid synthesizers may be employed for this purpose. In lieu of such synthesis, the disclosed nucleic acid molecules may be used to define a pair of primers that can be used with the polymerase chain reaction (Mullis et al., Cold Spring Harbor Symp. Quant. Biol., 51:263-273 (1986); Erlich et al., EP 50 424; EP 84 796; EP 258 017; EP 237 362; Mullis, EP 201 184; Mullis et al., U.S. Pat. No. 4,683,202; Erlich, U.S. Pat. No. 4,582,788; and Saiki et al., U.S. Pat. No. 4,683,194) to amplify and obtain any desired nucleic acid molecule or fragment.

[0331] Promoter sequences and other genetic elements, including but not limited to transcriptional regulatory flanking sequences, associated with one or more of the disclosed nucleic acid sequences can also be obtained using the disclosed nucleic acid sequence provided herein. In one embodiment, such sequences are obtained by incubating nucleic acid molecules of the present invention with members of genomic libraries and recovering clones that hybridize to such nucleic acid molecules thereof. In a second embodiment, methods of "chromosome walking", or inverse PCR may be used to obtain such sequences (Frohman et al., Proc. Natl. Acad. Sci. (U.S.A.), 85:8998-9002 (1988); Ohara et al., Proc. Natl. Acad. Sci. (U.S.A.), 86:5673-5677 (1989); Pang et al., Biotechniques, 22:1046-1048 (1977); Huang et al., Methods Mol. Biol., 69:89-96 (1997); Huang et al., Method Mol. Biol., 67:287-294 (1997); Benkel et al., Genet. Anal., 13:123-127 (1996); Hartl et al., Methods Mol. Biol., 58:293-301 (1996)). The term "chromosome walking" means a process of extending a genetic map by successive hybridization steps.

[0332] The nucleic acid molecules of the present invention may be used to isolate promoters of cell enhanced, cell specific, tissue enhanced, tissue specific, developmentally or environmentally regulated expression profiles. Isolation and functional analysis of the 5' flanking promoter sequences of these genes from genomic libraries, for example, using genomic screening methods and PCR techniques would result in the isolation of useful promoters and transcriptional regulatory elements. These methods are known to those of skill in the art and have been described (see, for example, Birren et al., Genome Analysis: Analyzing DNA, 1, (1997), Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.). Promoters obtained utilizing the nucleic acid molecules of the present invention could also be modified to affect their control characteristics. Examples of such modifications would include but are not limited to enhancer sequences. Such genetic elements could be used to enhance gene expression of new and existing traits for crop improvement.

[0333] Another subset of the nucleic acid molecules of the present invention includes nucleic acid molecules that are markers. The markers can be used in a number of conventional ways in the field of molecular genetics. Such markers include nucleic acid molecules encoding SEQ ID NOs: 5, 9-11, 43-44, 57-58, and 90, and complements thereof, and fragments of either that can act as markers and other nucleic acid molecules of the present invention that can act as markers.

[0334] Genetic markers of the present invention include "dominant" or "codominant" markers. "Codominant markers" reveal the presence of two or more alleles (two per diploid individual) at a locus. "Dominant markers" reveal the presence of only a single allele per locus. The presence of the dominant marker phenotype (e.g., a band of DNA) is an indication that one allele is in either the homozygous or heterozygous condition. The absence of the dominant marker phenotype (e.g., absence of a DNA band) is merely evidence that "some other" undefined allele is present. In the case of populations where individuals are predominantly homozygous and loci are predominately dimorphic, dominant and codominant markers can be equally valuable. As populations become more heterozygous and multi-allelic, codominant markers often become more informative of the genotype than dominant markers. Marker molecules can be, for example, capable of detecting polymorphisms such as single nucleotide polymorphisms (SNPs).

[0335] The genomes of animals and plants naturally undergo spontaneous mutation in the course of their continuing evolution (Gusella, Ann. Rev. Biochem., 55:831-854 (1986)). A "polymorphism" is a variation or difference in the sequence of the gene or its flanking regions that arises in some of the members of a species. The variant sequence and the "original" sequence co-exist in the species' population. In some instances, such co-existence is in stable or quasi-stable equilibrium.

[0336] A polymorphism is thus said to be "allelic", in that, due to the existence of the polymorphism, some members of a population may have the original sequence (i.e., the original "allele") whereas other members may have the variant sequence (i.e., the variant "allele"). In the simplest case, only one variant sequence may exist and the polymorphism is thus said to be di-allelic. In other cases, the species' population may contain multiple alleles and the polymorphism is termed tri-allelic, etc. A single gene may have multiple different unrelated polymorphisms. For example, it may have a di-allelic polymorphism at one site and a multi-allelic polymorphism at another site.

[0337] The variation that defines the polymorphism may range from a single nucleotide variation to the insertion or deletion of extended regions within a gene. In some cases, the DNA sequence variations are in regions of the genome that are characterized by short tandem repeats (STRs) that include tandem di- or tri-nucleotide repeated motifs of nucleotides. Polymorphisms characterized by such tandem repeats are referred to as "variable number tandem repeat" ("VNTR") polymorphisms. VNTRs have been used in identity analysis (Weber, U.S. Pat. No. 5,075,217; Armour et al., FEBS Lett., 307:113-115 (1992); Jones et al., Eur. J. Haematol., 39:144-147 (1987); Horn et al., PCT Application WO 91/14003; Jeffreys, EP 370 719; Jeffreys, U.S. Pat. No. 5,175,082; Jeffreys et al., Amer. J. Hum. Genet., 39:11-24 (1986); Jeffreys et al., Nature, 316:76-79 (1985); Gray et al., Proc. R. Acad. Soc. Lond., 243:241-253 (1991); Moore et al., Genomics, 10:654-660 (1991); Jeffreys et al., Anim. Genet., 18:1-15 (1987); Hillel et al., Anim. Genet., 20:145-155 (1989); Hillel et al., Genet., 124:783-789 (1990)).

[0338] The detection of polymorphic sites in a sample of DNA may be facilitated through the use of nucleic acid amplification methods. Such methods specifically increase the concentration of polynucleotides that span the polymorphic site, or include that site and sequences located either distal or proximal to it. Such amplified molecules can be readily detected by gel electrophoresis or other means.

[0339] In an alternative embodiment, such polymorphisms can be detected through the use of a marker nucleic acid molecule that is physically linked to such polymorphism(s). For this purpose, marker nucleic acid molecules comprising a nucleotide sequence of a polynucleotide located within 1 mb of the polymorphism(s) and more preferably within 100 kb of the polymorphism(s) and most preferably within 10 kb of the polymorphism(s) can be employed.

[0340] The identification of a polymorphism can be determined in a variety of ways. By correlating the presence or absence of it in a plant with the presence or absence of a phenotype, it is possible to predict the phenotype of that plant. If a polymorphism creates or destroys a restriction endonuclease cleavage site, or if it results in the loss or insertion of DNA (e.g., a VNTR polymorphism), it will alter the size or profile of the DNA fragments that are generated by digestion with that restriction endonuclease. As such, organisms that possess a variant sequence can be distinguished from those having the original sequence by restriction fragment analysis. Polymorphisms that can be identified in this manner are termed "restriction fragment length polymorphisms" (RFLPs) (Glassberg, UK Patent Application 2135774; Skolnick et al., Cytogen. Cell Genet., 32:58-67 (1982); Botstein et al., Ann. J. Hum. Genet., 32:314-331 (1980); Fischer et al., PCT Application WO 90/13668; Uhlen, PCT Application WO 90/11,369).

[0341] Polymorphisms can -also be identified by Single Strand Conformation Polymorphism (SSCP) analysis (Elles, Methods in Molecular Medicine: Molecular Diagnosis of Genetic Diseases, Humana Press (1996)); Orita et al., Genomics, 5:874-879 (1989)). A number of protocols have been described for SSCP including, but not limited to, Lee et al., Anal. Biochem., 205:289-293 (1992); Suzuki et al., Anal. Biochem., 192:82-84 (1991); Lo et al., Nucleic Acids Research, 20:1005-1009 (1992); Sarkar et al., Genomics, 13:441-443 (1992). It is understood that one or more of the nucleic acids of the present invention, may be utilized as markers or probes to detect polymorphisms by SSCP analysis.

[0342] Polymorphisms may also be found using a DNA fingerprinting technique called amplified fragment length polymorphism (AFLP), which is based on the selective PCR amplification of restriction fragments from a total digest of genomic DNA to profile that DNA (Vos et al., Nucleic Acids Res., 23:4407-4414 (1995)). This method allows for the specific co-amplification of high numbers of restriction fragments, which can be visualized by PCR without knowledge of the nucleic acid sequence. It is understood that one or more of the nucleic acids of the present invention may be utilized as markers or probes to detect polymorphisms by AFLP analysis or for fingerprinting RNA.

[0343] Polymorphisms may also be found using random amplified polymorphic DNA (RAPD) (Williams et al., Nucl. Acids Res., 18:6531-6535 (1990)) and cleaveable amplified polymorphic sequences (CAPS) (Lyamichev et al., Science, 260:778-783 (1993)). It is understood that one or more of the nucleic acid molecules of the present invention, may be utilized as markers or probes to detect polymorphisms by RAPD or CAPS analysis.

[0344] Single Nucleotide Polymorphisms (SNPs) generally occur at greater frequency than other polymorphic markers and are spaced with a greater uniformity throughout a genome than other reported forms of polymorphism. The greater frequency and uniformity of SNPs means that there is greater probability that such a polymorphism will be found near or in a genetic locus of interest than would be the case for other polymorphisms. SNPs are located in protein-coding regions and noncoding regions of a genome. Some of these SNPs may result in defective or variant protein expression (e.g., as a result of mutations or defective splicing). Analysis (genotyping) of characterized SNPs can require only a plus/minus assay rather than a lengthy measurement, permitting easier automation.

[0345] SNPs can be characterized using any of a variety of methods. Such methods include the direct or indirect sequencing of the site, the use of restriction enzymes (Botstein et al., Am. J. Hum. Genet., 32:314-331 (1980); Konieczny and Ausubel, Plant J., 4:403-410 (1993)), enzymatic and chemical mismatch assays (Myers et al., Nature, 313:495-498 (1985)), allele-specific PCR (Newton et al., Nucl. Acids Res., 17:2503-2516 (1989); Wu et al., Proc. Natl. Acad. Sci. (U.S.A.), 86:2757-2760 (1989)), ligase chain reaction (Barany, Proc. Natl. Acad. Sci. (U.S.A.), 88:189-193 (1991)), single-strand conformation polymorphism analysis (Labrune et al., Am. J. Hum. Genet., 48:1115-1120 (1991)), single base primer extension (Kuppuswamy et al., Proc. Natl. Acad. Sci. (U.S.A.), 88:1143-1147 (1991), Goelet, U.S. Pat. No. 6,004,744; Goelet, U.S. Pat. No. 5,888,819), solid-phase ELISA-based oligonucleotide ligation assays (Nikiforov et al., Nucl. Acids Res., 22:4167-4175 (1994)), dideoxy fingerprinting (Sarkar et al., Genomics, 13:441-443 (1992)), oligonucleotide fluorescence-quenching assays (Livak et al., PCR Methods Appl., 4:357-362 (1995a)), 5'-nuclease allele-specific hybridization TaqMan.TM. assay (Livak et al., Nature Genet., 9:341-342 (1995)), template-directed dye-terminator incorporation (TDI) assay (Chen and Kwok, Nucl. Acids Res., 25:347-353 (1997)), allele-specific molecular beacon assay (Tyagi et al., Nature Biotech., 16:49-53 (1998)), PinPoint assay (Haff and Smirnov, Genome Res., 7:378-388 (1997)), dCAPS analysis (Neff et al., Plant J., 14:387-392 (1998)), pyrosequencing (Ronaghi et al., Analytical Biochemistry, 267:65-71 (1999); Ronaghi et al., WO 98/13523; Nyren et al., WO 98/28440; www.pyrosequencing.com), using mass spectrometry, e.g. the Masscode.TM. system (Howbert et al., WO 99/05319; Howbert et al., WO 97/27331; www.rapigene.com; Becker et al., WO 98/26095; Becker et al., WO 98/12355; Becker et al., WO 97/33000; Monforte et al., U.S. Pat. No. 5,965,363), invasive cleavage of oligonucleotide probes (Lyamichev et al., Nature Biotechnology, 17:292-296; www.twt.com), and using high density oligonucleotide arrays (Hacia et al., Nature Genetics, 22:164-167; www.affymetrix.com).

[0346] Polymorphisms may also be detected using allele-specific oligonucleotides (ASO), which, can be for example, used in combination with hybridization based technology including Southern, Northern, and dot blot hybridizations, reverse dot blot hybridizations and hybridizations performed on microarray and related technology.

[0347] The stringency of hybridization for polymorphism detection is highly dependent upon a variety of factors, including length of the allele-specific oligonucleotide, sequence composition, degree of complementarity (i.e., presence or absence of base mismatches), concentration of salts and other factors such as formamide and temperature. These factors are important both during the hybridization itself and during subsequent washes performed to remove target polynucleotide that is not specifically hybridized. In practice, the conditions of the final, most stringent wash are most critical. In addition, the amount of target polynucleotide that is able to hybridize to the allele-specific oligonucleotide is also governed by such factors as the concentration of both the ASO and the target polynucleotide, the presence and concentration of factors that act to "tie up" water molecules, so as to effectively concentrate the reagents (e.g., PEG, dextran, dextran sulfate, etc.), whether the nucleic acids are immobilized or in solution, and the duration of hybridization and washing steps.

[0348] Hybridizations are preferably performed below the melting temperature (T.sub.m) of the ASO. The closer the hybridization and/or washing step is to the T.sub.m, the higher the stringency. T.sub.m for an oligonucleotide may be approximated, for example, according to the following formula: T.sub.m=81.5+16.6.times.(log 10[Na+])+0.41.times.(% G+C)-675/n; where [Na+] is the molar salt concentration of Na+ or any other suitable cation and n=number of bases in the oligonucleotide. Other formulas for approximating T.sub.m are available and are known to those of ordinary skill in the art.

[0349] Stringency is preferably adjusted so as to allow a given ASO to differentially hybridize to a target polynucleotide of the correct allele and a target polynucleotide of the incorrect allele. Preferably, there will be at least a two-fold differential between the signal produced by the ASO hybridizing to a target polynucleotide of the correct allele and the level of the signal produced by the ASO cross-hybridizing to a target polynucleotide of the incorrect allele (e.g., an ASO specific for a mutant allele cross-hybridizing to a wild-type allele). In more preferred embodiments of the present invention, there is at least a five-fold signal differential. In highly preferred embodiments of the present invention, there is at least an order of magnitude signal differential between the ASO hybridizing to a target polynucleotide of the correct allele and the level of the signal produced by the ASO cross-hybridizing to a target polynucleotide of the incorrect allele.

[0350] While certain methods for detecting polymorphisms are described herein, other detection methodologies may be utilized. For example, additional methodologies are known and set forth, in Birren et al., Genome Analysis, 4:135-186; A Laboratory Manual. Mapping Genomes, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (1999); Maliga et al., Methods in Plant Molecular Biology. A Laboratory Course Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (1995); Paterson, Biotechnology Intelligence Unit: Genome Mapping in Plants, R.G. Landes Co., Georgetown, Tex., and Academic Press, San Diego, Calif. (1996); The Corn Handbook, Freeling and Walbot, (eds.), Springer-Verlag, New York, N.Y. (1994); Methods in Molecular Medicine: Molecular Diagnosis of Genetic Diseases, Elles, (ed.), Humana Press, Totowa, N.J. (1996); Clark, (ed.), Plant Molecular Biology: A Laboratory Manual, Springer-Verlag, Berlin, Germany (1997).

[0351] Factors for marker-assisted selection in a plant breeding program are: (1) the marker(s) should co-segregate or be closely linked with the desired trait; (2) an efficient means of screening large populations for the molecular marker(s) should be available; and (3) the screening technique should have high reproducibility across laboratories and preferably be economical to use and be user-friendly.

[0352] The genetic linkage of marker molecules can be established by a gene mapping model such as, without limitation, the flanking marker model reported by Lander and Botstein, Genetics, 121:185-199 (1989) and the interval mapping, based on maximum likelihood methods described by Lander and Botstein, Genetics, 121:185-199 (1989) and implemented in the software package MAPMAKER/QTL (Lincoln and Lander, Mapping Genes Controlling Quantitative Traits Using MAPMAKER/QTL, Whitehead Institute for Biomedical Research, MA (1990). Additional software includes Qgene, Version 2.23 (1996), Department of Plant Breeding and Biometry, 266 Emerson Hall, Cornell University, Ithaca, N.Y. Use of Qgene software is a particularly preferred approach.

[0353] A maximum likelihood estimate (MLE) for the presence of a marker is calculated, together with an MLE assuming no QTL effect, to avoid false positives. A log.sub.10 of an odds ratio (LOD) is then calculated as: LOD=log.sub.10 (MLE for the presence of a QTL/MLE given no linked QTL).

[0354] The LOD score essentially indicates how much more likely the data are to have arisen assuming the presence of a QTL than in its absence. The LOD threshold value for avoiding a false positive with a given confidence, say 95%, depends on the number of markers and the length of the genome. Graphs indicating LOD thresholds are set forth in Lander and Botstein, Genetics, 121:185-199 (1989) and further described by Ar s and Moreno-Gonzalez, Plant Breeding, Hayward et al., (eds.) Chapman & Hall, London, pp. 314-331 (1993).

[0355] In a preferred embodiment of the present invention the nucleic acid marker exhibits a LOD score of greater than 2.0, more preferably 2.5, even more preferably greater than 3.0 or 4.0 with the trait or phenotype of interest. In a preferred embodiment, the trait of interest is altered tocopherol levels or compositions or altered tocotrienol levels or compositions.

[0356] Additional models can be used. Many modifications and alternative approaches to interval mapping have been reported, including the use of non-parametric methods (Kruglyak and Lander, Genetics, 139:1421-1428 (1995)). Multiple regression methods or models can also be used, in which the trait is regressed on a large number of markers (Jansen, Biometrics in Plant Breeding, van Oijen and Jansen (eds.), Proceedings of the Ninth Meeting of the Eucarpia Section Biometrics in Plant Breeding, The Netherlands, pp. 116-124 (1994); Weber and Wricke, Advances in Plant Breeding, Blackwell, Berlin, 16 (1994)). Procedures combining interval mapping with regression analysis, whereby the phenotype is regressed onto a single putative QTL at a given marker interval and at the same time onto a number of markers that serve as "cofactors", have been reported by Jansen and Stam, Genetics, 136:1447-1455 (1994); and Zeng, Genetics, 136:1457-1468 (1994). Generally, the use of cofactors reduces the bias and sampling error of the estimated QTL positions (Utz and Melchinger, Biometrics in Plant Breeding, van Oijen and Jansen (eds.), Proceedings of the Ninth Meeting of the Eucarpia Section Biometrics in Plant Breeding, The Netherlands, pp.195-204 (1994), thereby improving the precision and efficiency of QTL mapping (Zeng, Genetics, 136:1457-1468 (1994)). These models can be extended to multi-environment experiments to analyze genotype-environment interactions (Jansen et al., Theo. Appl. Genet., 91:33-37 (1995)).

[0357] It is understood that one or more of the nucleic acid molecules of the present invention may be used as molecular markers. It is also understood that one or more of the protein molecules of the present invention may be used as molecular markers.

[0358] In a preferred embodiment, the polymorphism is present and screened for in a mapping population, e.g. a collection of plants capable of being used with markers such as polymorphic markers to map genetic position of traits. The choice of appropriate mapping population often depends on the type of marker systems employed (Tanksley et al., J. P. Gustafson and R. Appels (eds.). Plenum Press, NY, pp. 157-173 (1988)). Consideration must be given to the source of parents (adapted vs. exotic) used in the mapping population. Chromosome pairing and recombination rates can be severely disturbed (suppressed) in wide crosses (adapted x exotic) and generally yield greatly reduced linkage distances. Wide crosses will usually provide segregating populations with a relatively large number of polymorphisms when compared to progeny in a narrow cross (adapted x adapted).

[0359] An F.sub.2 population is the first generation of selfing (self-pollinating) after the hybrid seed is produced. Usually a single F.sub.1 plant is selfed to generate a population segregating for all the genes in Mendelian (1:2:1) pattern. Maximum genetic information is obtained from a completely classified F.sub.2 population using a codominant marker system (rather, Measurement of Linkage in Heredity: Methuen and Co., (1938)). In the case of dominant markers, progeny tests (e.g., F.sub.3, BCF.sub.2) are required to identify the heterozygotes, in order to classify the population. However, this procedure is often prohibitive because of the cost and time involved in progeny testing. Progeny testing of F.sub.2 individuals is often used in map construction where phenotypes do not consistently reflect genotype (e.g., disease resistance) or where trait expression is controlled by a QTL. Segregation data from progeny test populations (e.g., F.sub.3 or BCF.sub.2) can be used in map construction. Marker-assisted selection can then be applied to cross progeny based on marker-trait map associations (F.sub.2, F.sub.3), where linkage groups have not been completely disassociated by recombination events (i.e., maximum disequilibrium).

[0360] Recombinant inbred lines (RIL) (genetically related lines; usually >F.sub.5, developed from continuously selfing F.sub.2 lines towards homozygosity) can be used as a mapping population. Information obtained from dominant markers can be maximized by using RIL because all loci are homozygous or nearly so. Under conditions of tight linkage (i.e., about <10% recombination), dominant and co-dominant markers evaluated in RIL populations provide more information per individual than either marker type in backcross populations (Reiter et al., Proc. Natl. Acad. Sci. (U.S.A.), 89:1477-1481 (1992)). However, as the distance between markers becomes larger (i.e., loci become more independent), the information in RIL populations decreases dramatically when compared to codominant markers.

[0361] Backcross populations e.g., generated from a cross between a successful variety (recurrent parent) and another variety (donor parent) carrying a trait not present in the former) can be utilized as a mapping population. A series of backcrosses to the recurrent parent can be made to recover most of its desirable traits. Thus a population is created consisting of individuals nearly like the recurrent parent but each individual carries varying amounts or mosaic of genomic regions from the donor parent. Backcross populations can be useful for mapping dominant markers if all loci in the recurrent parent are homozygous and the donor and recurrent parent have contrasting polymorphic marker alleles (Reiter et al., Proc. Natl. Acad. Sci. (U.S.A.), 89:1477-1481 (1992)). Information obtained from backcross populations using either codominant or dominant markers is less than that obtained from F.sub.2 populations because one, rather than two, recombinant gamete is sampled per plant. Backcross populations, however, are more informative (at low marker saturation) when compared to RILs as the distance between linked loci increases in RIL populations (i.e., about 0.15% recombination). Increased recombination can be beneficial for resolution of tight linkages, but may be undesirable in the construction of maps with low marker saturation.

[0362] Near-isogenic lines (NIL) (created by many backcrosses to produce a collection of individuals that is nearly identical in genetic composition except for the trait or genomic region under interrogation) can be used as a mapping population. In mapping with NILs, only a portion of the polymorphic loci is expected to map to a selected region.

[0363] Bulk segregant analysis (BSA) is a method developed for the rapid identification of linkage between markers and traits of interest (Michelmore et al., Proc. Natl. Acad. Sci. (U.S.A.), 88:9828-9832 (1991)). In BSA, two bulked DNA samples are drawn from a segregating population originating from a single cross. These bulks contain individuals that are identical for a particular trait (resistant or susceptible to particular disease) or genomic region but arbitrary at unlinked regions (i.e., heterozygous). Regions unlinked to the target region will not differ between the bulked samples of many individuals in BSA.

[0364] In an aspect of the present invention, one or more of the nucleic molecules of the present invention are used to determine the level (i.e., the concentration of mRNA in a sample, etc.) in a plant (preferably canola, corn, Brassica campestris, oilseed rape, rapeseed, soybean, crambe, mustard, castor bean, peanut, sesame, cottonseed, linseed, safflower, oil palm, flax or sunflower) or pattern (i.e., the kinetics of expression, rate of decomposition, stability profile, etc.) of the expression of a protein encoded in part or whole by one or more of the nucleic acid molecule of the present invention (collectively, the "Expression Response" of a cell or tissue).

[0365] As used herein, the Expression Response manifested by a cell or tissue is said to be "altered" if it differs from the Expression Response of cells or tissues of plants not exhibiting the phenotype. To determine whether a Expression Response is altered, the Expression Response manifested by the cell or tissue of the plant exhibiting the phenotype is compared with that of a similar cell or tissue sample of a plant not exhibiting the phenotype. As will be appreciated, it is not necessary to re-determine the Expression Response of the cell or tissue sample of plants not exhibiting the phenotype each time such a comparison is made; rather, the Expression Response of a particular plant may be compared with previously obtained values of normal plants. As used herein, the phenotype of the organism is any of one or more characteristics of an organism (e.g., disease resistance, pest tolerance, environmental tolerance such as tolerance to abiotic stress, male sterility, quality improvement or yield etc.). A change in genotype or phenotype may be transient or permanent. Also as used herein, a tissue sample is any sample that comprises more than one cell. In a preferred aspect, a tissue sample comprises cells that share a common characteristic (e.g., Derived from root, seed, flower, leaf, stem or pollen etc.).

[0366] In one aspect of the present invention, an evaluation can be conducted to determine whether a particular mRNA molecule is present. One or more of the nucleic acid molecules of the present invention are utilized to detect the presence or quantity of the mRNA species. Such molecules are then incubated with cell or tissue extracts of a plant under conditions sufficient to permit nucleic acid hybridization. The detection of double-stranded probe-mRNA hybrid molecules is indicative of the presence of the mRNA; the amount of such hybrid formed is proportional to the amount of mRNA. Thus, such probes may be used to ascertain the level and extent of the mRNA production in a plant's cells or tissues. Such nucleic acid hybridization may be conducted under quantitative conditions (thereby providing a numerical value of the amount of the mRNA present). Alternatively, the assay may be conducted as a qualitative assay that indicates either that the mRNA is present, or that its level exceeds a user set, predefined value.

[0367] A number of methods can be used to compare the expression response between two or more samples of cells or tissue. These methods include hybridization assays, such as northerns, RNAse protection assays, and in situ hybridization. Alternatively, the methods include PCR-type assays. In a preferred method, the expression response is compared by hybridizing nucleic acids from the two or more samples to an array of nucleic acids. The array contains a plurality of suspected sequences known or suspected of being present in the cells or tissue of the samples.

[0368] An advantage of in situ hybridization over more conventional techniques for the detection of nucleic acids is that it allows an investigator to determine the precise spatial population (Angerer et al., Dev. Biol., 101:477-484 (1984); Angerer et al., Dev. Biol., 112:157-166 (1985); Dixon et al., EMBO J., 10:1317-1324 (1991)). In situ hybridization may be used to measure the steady-state level of RNA accumulation (Hardin et al., J. Mol. Biol., 202:417-431 (1989)). A number of protocols have been devised for in situ hybridization, each with tissue preparation, hybridization and washing conditions (Meyerowitz, Plant Mol. Biol. Rep., 5:242-250 (1987); Cox and Goldberg, In: Plant Molecular Biology: A Practical Approach, Shaw (ed.), pp. 1-35, IRL Press, Oxford (1988); Raikhel et al., In situ RNA hybridization in plant tissues, In: Plant Molecular Biology Manual, Vol. B9:1-32, Kluwer Academic Publisher, Dordrecht, Belgium (1989)).

[0369] In situ hybridization also allows for the localization of proteins within a tissue or cell (Wilkinson, In Situ Hybridization, Oxford University Press, Oxford (1992); Langdale, In Situ Hybridization In: The Corn Handbook, Freeling and Walbot (eds.), pp. 165-179, Springer-Verlag, NY (1994)). It is understood that one or more of the molecules of the present invention, preferably one or more of the nucleic acid molecules or fragments thereof of the present invention or one or more of the antibodies of the present invention may be utilized to detect the level or pattern of a protein or mRNA thereof by in situ hybridization.

[0370] Fluorescent in situ hybridization allows the localization of a particular DNA sequence along a chromosome, which is useful, among other uses, for gene mapping, following chromosomes in hybrid lines, or detecting chromosomes with translocations, transversions or deletions. In situ hybridization has been used to identify chromosomes in several plant species (Griffor et al., Plant Mol. Biol., 17:101-109 (1991); Gustafson et al., Proc. Natl. Acad. Sci. (U.S.A.), 87:1899-1902 (1990); Mukai and Gill, Genome, 34:448-452 (1991); Schwarzacher and Heslop-Harrison, Genome, 34:317-323 (1991); Wang et al., Jpn. J. Genet., 66:313-316 (1991); Parra and Windle, Nature Genetics, 5:17-21 (1993)). It is understood that the nucleic acid molecules of the present invention may be used as probes or markers to localize sequences along a chromosome.

[0371] Another method to localize the expression of a molecule is tissue printing. Tissue printing provides a way to screen, at the same time on the same membrane many tissue sections from different plants or different developmental stages (Yomo and Taylor, Planta, 112:35-43 (1973); Harris and Chrispeels, Plant Physiol., 56:292-299 (1975); Cassab and Varner, J. Cell. Biol., 105:2581-2588 (1987); Spruce et al., Phytochemistry, 26:2901-2903 (1987); Barres et al., Neuron, 5:527-544 (1990); Reid and Pont-Lezica, Tissue Printing: Tools for the Study of Anatomy, Histochemistry and Gene Expression, Academic Press, New York, N.Y. (1992); Reid et al., Plant Physiol., 93:160-165 (1990); Ye et al., Plant J., 1:175-183 (1991)).

[0372] One skilled in the art can refer to general reference texts for detailed descriptions of known techniques discussed herein or equivalent techniques. These texts include Current Protocols in Molecular Biology, Ausubel et al., (eds.), John Wiley & Sons, NY (1989), and supplements through September (1998), Molecular Cloning, A Laboratory Manual, Sambrook et al., 2.sup.nd Ed., Cold Spring Harbor Press, Cold Spring Harbor, N.Y. (1989), Genome Analysis: A Laboratory Manual 1: Analyzing DNA, Birren et al., Cold Spring Harbor Press, Cold Spring Harbor, N.Y. (1997); Genome Analysis: A Laboratory Manual 2: Detecting Genes, Birren et al., Cold Spring Harbor Press, Cold Spring Harbor, N.Y. (1998); Genome Analysis: A Laboratory Manual 3: Cloning Systems, Birren et al., Cold Spring Harbor Press, Cold Spring Harbor, N.Y. (1999); Genome Analysis: A Laboratory Manual 4: Mapping Genomes, Birren et al., Cold Spring Harbor Press, Cold Spring Harbor, N.Y. (1999); Plant Molecular Biology: A Laboratory Manual, Clark, Springer-Verlag, Berlin, (1997); Methods in Plant Molecular Biology, Maliga et al., Cold Spring Harbor Press, Cold Spring Harbor, N.Y. (1995). These texts can, of course, also be referred to in making or using an aspect of the present invention. It is understood that any of the agents of the present invention can be substantially purified and/or be biologically active and/or recombinant.

[0373] Having now generally described the present invention, the same will be more readily understood through reference to the following examples that are provided by way of illustration, and are not intended to be limiting of the present invention, unless specified.

EXAMPLE 1

Identification of Homogentisate Prenyl Transferase Sequences

[0374] This example sets forth methods used to analyze homogentisate prenyl transferase sequences from various sources in order to identify motifs common to homogentisate prenyl transferase that are contained therein.

[0375] Homogentisate prenyl transferase sequences from Soy, Arabidopsis, Corn and Cuphea (partial) are cloned and sequenced from EST sequences found in an EST database. Synechocystis, Nostoc, and Anabaena are obtained from Genbank. These sequences (representing SEQ ID NOs: 1-8) are then aligned with respect to each other using the multiple alignment software ClustalX, which is described by Thompson et al., Nucleic Acids Research, 24:4876-4882 (1997). The multiple alignment of the protein sequences is visualized and edited using Genedoc, which is described by Nicholas et al., EMBNEW.NEWS, 4:14 (1997).

[0376] Using the aforementioned multiple alignment tool, four motifs (A-D) are identified, as shown in FIGS. 2a-2c, wherein motifs A-D are set forth. These motifs are represented by SEQ ID NOs: 12-15. The Cuphea sequence is removed from motif D because the sequence had multiple errors towards the 3' end that generated apparent frame shift errors.

[0377] The specificity of these motifs is demonstrated using a Hidden Markov Model (HMM) that is built using an HMMER(version 2.2g) software package (Eddy, Bioinformatics, 14:755-763 (1998)). A HMM search is performed on a cDNA sequence database containing full insert sequence from different plant species. This search identifies two new homogentisate prenyl transferase sequences (SEQ ID NOs: 9-10) in addition to several partial homogentisate prenyl transferase sequences. The two new homogentisate prenyl transferase sequences identified are from leek and wheat. This search also identifies a complete Cuphea sequence (SEQ ID NO: 11) with no errors. A second alignment is generated using the aforementioned multiple alignment tool, as shown in FIGS. 3a-3c. This alignment has the leek, wheat, and full Cuphea sequences incorporated. Motifs I-IV (SEQ ID NOs: 39-42) are shown.

[0378] Specificity is also tested by using each motif sequence to search the non-redundant amino acid database downloaded from Genbank available through NCBI. All four motifs identify three homogentisate prenyl transferase found in the aforementioned non-redundant amino acid database, as follows: Nostoc, Synechocystis, Arabidopsis. Motifs II and IV also identified some genomic variants of an uncharacterized Arabidopsis protein. Motifs I and III only identified known homogentisate prenyl transferase at an E value of 0.001 or lower.

EXAMPLE 2

Preparation of Expression Constructs

[0379] A plasmid containing the napin cassette derived from pCGN3223 (described in U.S. Pat. No. 5,639,790, the entirety of which is incorporated herein by reference) is modified to make it more useful for cloning large DNA fragments containing multiple restriction sites, and to allow the cloning of multiple napin fusion genes into plant binary transformation vectors. An adapter comprised of the self annealed oligonucleotide of sequence CGCGATTTAAATGGCGCGCCCTGCAGGCGGCCGCCTGCAGGGCGCGCCATTTAAAT (SEQ ID NO: 16) is ligated into the cloning vector pBC SK+ (Stratagene) after digestion with the restriction endonuclease BssHII to construct vector pCGN7765. Plasmids pCGN3223 and pCGN7765 are digested with NotI and ligated together. The resultant vector, pCGN7770, contains the pCGN7765 backbone with the napin seed specific expression cassette from pCGN3223.

[0380] The cloning cassette pCGN7787 comprises essentially the same regulatory elements as pCGN7770, with the exception that the napin regulatory regions of pCGN7770 have been replaced with the double CaMV 35S promoter and the polyadenylation and transcriptional termination region.

[0381] A binary vector for plant transformation, pCGN5139, is constructed from pCGN1558 (McBride and Summerfelt, Plant Molecular Biology, 14:269-276 (1990)). The polylinker of pCGN1558 is replaced as a HindIII/Asp718 fragment with a polylinker containing unique restriction endonuclease sites, AscI, PacI, XbaI, SwaI, BamHI, and NotI. The Asp718 and HindIII restriction endonuclease sites are retained in pCGN5139.

[0382] A series of binary vectors are constructed to allow for the rapid cloning of DNA sequences into binary vectors containing transcriptional initiation regions (promoters) and transcriptional termination regions.

[0383] The plasmid pCGN8618 is constructed by ligating oligonucleotides 5'-TCGAGGATCCGCGGCCGCAAGCTTCCTGCAGG-3' (SEQ ID NO: 17) and 5'-TCGACCTGCAGGAAGCTTGCGGCCGCGGATCC-3' (SEQ ID NO: 18) into SalII/XhoI-digested pCGN7770. A fragment containing the napin promoter, polylinker and napin 3' region is excised from pCGN8618 by digestion with Asp718I; the fragment is blunt-ended by filling in the 5' overhangs with Klenow fragment then ligated into pCGN5139 that is digested with Asp7181 and HindIII and blunt-ended by filling in the 5' overhangs with Klenow fragment. A plasmid containing the insert oriented so that the napin promoter is closest to the blunted Asp718I site of pCGN5139 and the napin 3' is closest to the blunted HindIII site is subjected to sequence analysis to confirm both the insert orientation and the integrity of cloning junctions. The resulting plasmid is designated pCGN8622.

[0384] The plasmid pCGN8619 is constructed by ligating oligonucleotides 5'-TCGACCTGCAGGAAGCTTGCGGCCGCGGATCC-3' (SEQ ID NO: 19) and 5'-TCGAGGATCCGCGGCCGCAAGCTTCCTGCAGG-3' (SEQ ID NO: 20) into SalI/XhoI-digested pCGN7770. A fragment containing the napin promoter, polylinker and napin 3' region is removed from pCGN8619 by digestion with Asp718I; the fragment is blunt-ended by filling in the 5' overhangs with Klenow fragment then ligated into pCGN5139 that is digested with Asp7181 and HindIII and blunt-ended by filling in the 5' overhangs with Klenow fragment. A plasmid containing the insert oriented so that the napin promoter is closest to the blunted Asp7181 site of pCGN5139 and the napin 3' is closest to the blunted HindIII site is subjected to sequence analysis to confirm both the insert orientation and the integrity of cloning junctions. The resulting plasmid is designated pCGN8623.

[0385] The plasmid pCGNS620 is constructed by ligating oligonucleotides 5'-TCGAGGATCCGCGGCCGCAAGCTTCCTGCAGGAGCT-3' (SEQ ID NO: 21) and 5'-CCTGCAGGAAGCTTGCGGCCGCGGATCC-3' (SEQ ID NO: 22) into SalI/SacI-digested pCGN7787. A fragment containing the d35S promoter, polylinker and trial 3' region is removed from pCGN8620 by complete digestion with Asp718I and partial digestion with NotI. The fragment is blunt-ended by filling in the 5' overhangs with Klenow fragment then ligated into pCGN5139 that is digested with Asp718I and HindIII and blunt-ended by filling in the 5' overhangs with Klenow fragment. A plasmid containing the insert oriented so that the d35S promoter is closest to the blunted Asp718I site of pCGN5139 and the tml 3' is closest to the blunted HindIII site is subjected to sequence analysis to confirm both the insert orientation and the integrity of cloning junctions. The resulting plasmid is designated pCGN8624.

[0386] The plasmid pCGN8621 is constructed by ligating oligonucleotides 5'-TCGACCTGCAGGAAGCTTGCGGCCGCGGATCCAGCT-3' (SEQ ID NO: 23) and 5'-GGATCCGCGGCCGCAAGCTTCCTGCAGG-3' (SEQ ID NO: 24) into SalI/SacI-digested pCGN7787. A fragment containing the d35S promoter, polylinker and tml 3' region is removed from pCGN8621 by complete digestion with Asp718I and partial digestion with NotI.

[0387] The fragment is blunt-ended by filling in the 5' overhangs with Klenow fragment then ligated into pCGN5139 that had been digested with Asp718I and HindIII and blunt-ended by filling in the 5' overhangs with Klenow fragment A plasmid containing the insert oriented so that the d35S promoter is closest to the blunted Asp718I site of pCGN5139 and the tml 3' is closest to the blunted HindIII site is subjected to sequence analysis to confirm both the insert orientation and the integrity of cloning junctions. The resulting plasmid is designated pCGN8625.

[0388] The plasmid construct pCGN8640 is a modification of pCGN8624 described above. A 938bp PstI fragment isolated from transposon Tn7 which encodes bacterial spectinomycin and streptomycin resistance (Fling et al., Nucleic Acids Research, 13(19):7095-7106 (1985)), a determinant for E. coli and Agrobacterium selection, is blunt-ended with Pfu polymerase. The blunt-ended fragment is ligated into pCGN8624 that had been digested with SpeI and blunt-ended with Pfu polymerase. The region containing the PstI fragment is sequenced to confirm both the insert orientation and the integrity of cloning junctions.

[0389] The spectinomycin resistance marker is introduced into pCGN8622 and pCGN8623 as follows. A 7.7 Kbp AvrII-SnaBI fragment from pCGN8640 is ligated to a 10.9 Kbp AvrII-SnaBI fragment from pCGN8623 or pCGN8622, described above. The resulting plasmids are pCGN8641 and pCGN8643, respectively.

[0390] The plasmid pCGN8644 is constructed by ligating oligonucleotides 5'-GATCACCTGCAGGAAGCTTGCGGCCGCGGATCCAATGCA-3' (SEQ ID NO: 25) and 5' TTGGATCCGCGGCCGCAAGCTTCCTGCAGGT-3' (SEQ ID NO: 26) into BamHI-PstI digested pCGN8640.

[0391] Synthetic oligonucleotides are designed for use in Polymerase Chain Reactions (PCR) to amplify the coding sequences of each of the nucleic acids that encode the polypeptides of SEQ ID NOs: 1-7, 9-11, 43-44, 57-58, and 90 for the preparation of expression constructs.

[0392] The coding sequences of each of the nucleic acids that encode the polypeptides of SEQ ID NOs: 1-7, 9-11, 43-44, 57-58, and 90 are all amplified and cloned into the TopoTA vector (Invitrogen). Constructs containing the respective homogentisate prenyl transferase sequences are digested with NotI and Sse8387I and cloned into the turbobinary vectors described above.

[0393] Synthetic oligonucleotides were designed for use in Polymerase Chain Reactions (PCR) to amplify SEQ ID NO: 33 for the preparation of expression constructs and are provided in the table below: TABLE-US-00002 Restriction Site Sequence SEQ ID NO: 5' NotI GGATCCGCGGCCGCACAATGG 37 AGTCTCTGCTCTCTAGTTCT 3' SseI GGATCCTGCAGGTCACTTCAAA 38 AAAGGTAACAGCAAGT

[0394] SEQ ID NO: 33 was amplified using the respective PCR primers shown in the table above and cloned into the TopoTA vector (Invitrogen). Constructs containing the respective homogentisate prenyl transferase sequences were digested with NotI and Sse8387I and cloned into the turbobinary vectors described above.

[0395] SEQ ID NO: 33 was cloned in the sense orientation into pCGN8640 to produce the plant transformation construct pCGN10800 (FIG. 4). SEQ ID NO: 33 is under control of the enhanced 35S promoter.

[0396] SEQ ID NO: 33 was also cloned in the antisense orientation into the construct pCGN8641 to create pCGN10801 (FIG. 5). This construct provides for the antisense expression of SEQ ID NO: 33 from the napin promoter.

[0397] SEQ ID NO: 33 was also cloned in the sense orientation into the vector pCGN8643 to create the plant transformation construct pCGN10822 (FIG. 7). This construct provides for the sense expression of SEQ ID NO: 33 from the napin promoter.

[0398] SEQ ID NO: 33 was also cloned in the antisense orientation into the vector pCGN8644 to create the plant transformation construct pCGN10803 (FIG. 6). This construct provides for the antisense expression of SEQ ID NO: 33 from the enhanced 35S promoter.

EXAMPLE 3

Plant Transformation

[0399] Transgenic Brassica plants are obtained by Agrobacterium-mediated transformation as described by Radke et al., Theor. Appl. Genet., 75:685-694 (1988); Plant Cell Reports, 11:499-505 (1992). Transgenic Arabidopsis thaliana plants may be obtained by Agrobacterium-mediated transformation as described by Valverkens et al., Proc. Nat. Acad. Sci., 85:5536-5540 (1988), or as described by Bent et al., Science, 265:1856-1860 (1994), or Bechtold et al., C.R. Acad. Sci. Life Sciences, 316:1194-1199 (1993). Other plant species may be similarly transformed using related techniques.

[0400] Alternatively, microprojectile bombardment methods, such as described by Klein et al., Bio/Technology, 10:286-291 may also be used to obtain nuclear transformed plants.

EXAMPLE 4

Identification of Additional Homogentisate Prenyl Transferase

[0401] In order to identify additional homogentisate prenyl transferase, motifs identified through sequence homology are used to search a database of cDNA sequences containing full insert sequences. The cDNA database is first translated in all six frames and then a HMM search is done using a HMM model built for the motifs. All HMM hits are annotated by performing a blast search against a non-redundant amino acid database. All motifs are sensitive and identify homogentisate prenyl transferase sequences present in the database. Novel homogentisate prenyl transferase sequences are thereby discovered.

EXAMPLE 5

Transgenic Plant Analysis

[0402] Arabidopsis plants transformed with constructs for the sense or antisense expression of the homogentisate prenyl transferase proteins are analyzed by High Performance Liquid Chromatography (HPLC) for altered levels of total tocopherols and tocotrienols, as well as altered levels of specific tocopherols and tocotrienols (e.g. .alpha., .beta., .gamma., and .delta.-tocopherol/tocotrienol).

[0403] Extracts of leaves and seeds are prepared for HPLC as follows. For seed extracts, 10 mg of seed is added to 1 g of microbeads (Biospec) in a sterile microfuge tube to which 500 ul 1% pyrogallol (Sigma Chem)/ethanol is added. The mixture is shaken for 3 minutes in a mini Beadbeater (Biospec) on "fast" speed. The extract is filtered through a 0.2 um filter into an autosampler tube. The filtered extracts are then used in HPLC analysis described below.

[0404] Leaf extracts are prepared by mixing 30-50 mg of leaf tissue with 1 g microbeads and freezing in liquid nitrogen until extraction. For extraction, 500 ul 1% pyrogallol in ethanol is added to the leaf/bead mixture and shaken for 1 minute on a Beadbeater (Biospec) on "fast" speed. The resulting mixture is centrifuged for 4 minutes at 14,000 rpm and filtered as described above prior to HPLC analysis.

[0405] HPLC is performed on a Zorbax silica HPLC column (4.6 mm.times.250 mm), using a fluorescent detection monitor, with excitation and emission spectra set at 290 nm and 336 nm, respectively. Solvent A is hexane and solvent B is methyl-t-butyl ether. The injection volume is 20 ul, the flow rate is 1.5 ml/min, the run time is 12 min (40.degree. C.) using the table below: TABLE-US-00003 Time Solvent A Solvent B 0 min. 90% 10% 10 min. 90% 10% 11 min. 25% 75% 12 min. 90% 10%

[0406] Tocopherol standards in 1% pyrogallol/ethanol are also run for comparison (alpha tocopherol, gamma tocopherol, beta tocopherol, delta tocopherol, and tocopherol (tocol) (all from Matreya, State College, Pa., or Calbiochem, La Jolla, Calif.)).

[0407] Standard curves for alpha, beta, delta, and gamma tocopherol are calculated using Chemstation software. The absolute amount of component x is: Absolute amount of x=Response.sub.x.times.RF.sub.x.times.dilution factor where Response.sub.x is the area of peak x, RF.sub.x, is the response factor for component x (Amount.sub.x/Response.sub.x) and the dilution factor is 500 ul. The ng/mg tissue is found by: total ng component/mg plant tissue.

[0408] Results of the HPLC analysis of seed extracts of transgenic Arabidopsis lines containing pMON10822 for the expression of SEQ ID NO: 33 from the napin promoter are provided in FIG. 8.

[0409] HPLC analysis results of Arabidopsis seed tissue expressing the SEQ ID NO: 33 sequence from the napin promoter (pMON10822) demonstrates an increased level of tocopherols in the seed. Total tocopherol levels are increased as much as 50 to 60% over the total tocopherol levels of non-transformed (wild-type) Arabidopsis plants (FIG. 8).

[0410] Results of the HPLC analysis of seed extracts of transgenic Arabidopsis lines 1387-1624 containing pMON10803 for the antisense expression of SEQ ID NO: 33 from the enhanced 35S promoter are provided in FIG. 9. Two lines, 1393 and 1401, show a substantial reduction in overall tocopherol levels, supporting the position that HPT is a homogentisate prenyl transferase involved in the synthesis of tocopherol.

[0411] Results of the HPLC analysis of seed extracts of transgenic Arabidopsis lines containing constructs for the expression of SEQ ID NOs: 5, 9-11, 43-44, 57-58, and 90 are obtained.

[0412] Results of the HPLC analysis of seed extracts of transgenic Arabidopsis lines containing constructs for the expression of SEQ ID NOs: 5, 9-11, 43-44, 57-58, and 90 from the enhanced 35S promoter are obtained.

EXAMPLE 6

Expression of a Homogentisate Prenyl Transferase as Single Gene, and in Combination with HPPD and tyrA in Soy

[0413] The Arabidopsis homogentisate prenyl transferase (ATPT2) (SEQ ID NO: 33) was cloned in a soy binary vector harboring an Arcelin 5 expression cassette. This expression cassette consisted of an Arcelin 5-promoter, a multi cloning site, and the Arcelin 5 3'-untranslated sequence in the order as described. Vector construction for this construct and the following constructs was performed using standard cloning techniques well established in the art and described in lab manuals such as (Sambrook et al. 2001). The resulting binary vector for soy seed-specific expression of ATPT2 was designated pMON36581 (FIG. 10). Similarly the Synechocystis homogentisate prenyl transferase (slr1736) (SEQ ID NO: 29) was fused to a chloroplast target peptide (CTP1), and cloned into the Arcelin 5 soy seed-specific expression cassette. The resulting binary plasmid was designated pMON69933 (FIG. 11). An additional binary plasmid for seed-specific co-expression of the Arabidopsis p-hydroxyphenylpyruvate dioxygenase (HPPD.sub.At) and the bifunctional prephenate dehydrogenase from Erwinia herbicola (tyrA.sub.Eh) (see WO 02/089561) was constructed by fusing the HPPD.sub.At-gene and the tyrA.sub.Eh-gene to the chloroplast target peptides, CTP2, and CTP1, respectively. These fusion genes were subsequently cloned into the multi cloning site of soy seed-specific expression cassettes consisting of the p7S.alpha.'-promoter, a multi cloning site, and the E9 3'-untranslated region. The HPPD.sub.At expression cassette was cloned into a binary vector downstream of the tyrA.sub.Eh expression cassette resulting in the formation of pMON69924 (FIG. 12).

[0414] A fourth plasmid was constructed by cloning the Arcelin 5-expression cassette for slr1736 (SEQ ID NO: 29), downstream of the HPPD.sub.At, and the tyrA.sub.Eh expression cassettes, resulting in the formation of pMON69943 (FIG. 13).

[0415] Each of these binary constructs was transformed into soybean. R1 seed pools from plants harboring these constructs were analyzed for tocopherol content and composition. For constructs pMON36581 and pMON69933, the seed for analysis were chosen at random. Seed from plants transformed with pMON69924 and pMON69943 showed a segregating dark phenotype. This phenotype has been associated with the presence of increased levels of homogentisic acid as a result of the expression of trans genes HPPD and tyrA. Seed without dark coloration did have wild-type tocopherol levels and were not transgenic. For this reason colored seed were chosen for analysis of plants transformed with pMON69924 or pMON69943. For the impact of the HPT expression on total tocopherol accumulation in a single gene vector, or in a multi gene vector, seed from non-transformed soy, or seed transformed with pMON69924 served as controls, respectively. FIG. 14 summarizes the tocopherol data obtained from these experiments. While expression of ATPT2 or slr1736 increased total tocopherol and tocotrienol levels in soy moderately, the impact of HPT expression in the context of a multi gene vector was much more pronounced. FIG. 14 demonstrates a significantly increased level of tocopherol and tocotrienol accumulation for pMON69943 compared to pMON69924 lines. These data suggest that combination of an HPT with tyrA, and HPPD can substantially enhance tocopherol biosynthesis in soy.

[0416] Western analysis is carried out to detect the transgene expression in tissues harboring the gene of interest (GOI) expression cassette using the GOI protein specific antibody. Northern analysis is done for detecting the mRNA level of the transgene using the GOI sequence specific radiolabelled probe.

EXAMPLE 7

Identification of Additional Homogentisate Prenyl Transferase Sequences

[0417] In an analysis of the non-redundant amino acid database, Motifs II and IV (SEQ ID NOs: 40 and 42 identified in addition to HPT sequences, two genomic variants of Arabidopsis thaliana sequence related to HPTs (SEQ ID NOs: 61-62). These sequences are based on insillico prediction from genomic sequence by gene prediction algorithms. Further bioinformatic analysis showed that these sequences encoded an additional homogentisate prenyl transferase related to HPT. Both sequences (SEQ ID NOs: 61-62) were used to search the non-redundant amino acid database. The BLAST search results indicated that these sequences are related most to HPT sequences from cyanobacteria (SEQ ID NOs: 1-3) and Arabidopsis (SEQ ID NO: 7).

[0418] Alignment of gi15229898 (970 aa)(SEQ ID NO: 61) and gi10998133 (441 aa) (SEQ ID NO: 62) showed that: [0419] a) C terminal half of gi15229898 (SEQ ID NO: 61) overlaps with gi10998133 (SEQ ID NO: 62); [0420] b) the last 40-50 aa in the C terminal portions of these two proteins do not align; and [0421] c) the N terminal of gi 15229898 does not align also with HPTs (SEQ ID NOs: 1-7, and 9-11). These findings indicate discrepancy in the coding sequence prediction reported in Genbank.

[0422] In order to verify the predicted sequence, the BAC sequence of the Arabidopsis genome corresponding to the region was downloaded from Genbank (gi|12408742|gb|AC016795.6|ATAC016795, 100835 bp). Coding sequences were predicted from this BAC clone using the FGENESH (Solovyev V.V. (2001) Statistical approaches in Eukaryotic gene prediction: in Handbook of Statistical genetics (eds. Balding D. et al.), John Wiley & Sons, Ltd., p. 83-127) gene prediction program. FGENESH predicted 28 proteins from this BAC clone. To identify new homogentisate prenyl transferase proteins among 28 FGENESH predicted proteins, all 28 predicted proteins were blasted against the non-redundant amino acid database. FGENESH predicted protein No. 25 (402aa) (SEQ ID NO: 45) was most similar to gi10998133 (441 aa) (SEQ ID NO: 62), C terminal half of gi15229898 (970 aa) (SEQ ID NO: 61) and HPTs (SEQ ID NOs: 1-7, and 9-11.)

[0423] To provide functional and transcriptional evidence and to confirm the coding sequence for this gene, plant EST sequences database comprising proprietary and public sequence was searched. We found several ESTs (SEQ ID NOs: 63-72) which match the N terminal and C terminal portions of this gene. The new gene was named HPT2 (SEQ ID NO: 59) from Arabidopsis. The HPT2 (SEQ ID NO: 57) sequence is quite distinct from HPT1 (SEQ ID NO: 7).

[0424] HPT2 (SEQ ID NO: 57) from Arabidopsis is also known as Tocopherol Synthase (TS). Present data suggests that the overexpression of TS leads to a similar increase in the amount of overall tocopherol, over the wild type, as with HPT1 (SEQ ID NO: 33). However, the enzymes may have different biochemical characteristics because the overexpression of TS results in less production of the delta tocopherol than the overexpression of HPT1 (SEQ ID NO: 33).

[0425] The presence of chloroplast transit peptide in the HPT2 Arabidopsis sequence (SEQ ID NOs: 45 and 57) was verified using ChloroP program (Olof Emanuelsson1, Henrik Nielsen1, 2, and Gunnar von Heijne1ChloroP, a neural network-based method for predicting chloroplast transit peptides and their cleavage sites. Protein Science: 8: 978-984, 1999).

[0426] In addition to SEQ ID NOs: 1, 7, and 9-11(HPT), SEQ ID NOs: 57-58, and 90 (HPT2) were added to the alignment, see FIGS. 24-25 and the resulting motifs analyzed. Motif V (SEQ ID NO: 46), VII (SEQ ID NO: 48), and VIII (SEQ ID NO: 49) are specific to HPT and HPT2 sequences. A HMM search of the non-redundant amino acid database using these motifs identified only cyanobacteria (SEQ ID NOs: 1-3, and 43), photobacteria (SEQ ID NO: 44), and plant HPTs (SEQ ID NOs: 7, and 61-62). Motif VII (SEQ ID NO: 48) identified distantly related ubiA prenyl transerase from bacteria in addition to homogentisate prenyl transferase. However, the sensitivity of Motif VII to homogentisate prenyl transferase was higher. Homogentisate prenyl transferases had lower e-values by several orders and higher alignment score (higher than 30). HPT2 sequences are distinct from HPT and cyanobacterial HPTs as demonstrated by the sequence dendogram in FIG. 26.

[0427] SEQ ID NOs: 43-44 were added to an alignment with SEQ ID NOs: 1-4, 6-7, 9-11, 57-58, and 91, see FIGS. 33-34, and the resulting motifs (SEQ ID NOs: 92-95, Motifs IX-XII) were analyzed. Specificity of these motifs to homogentisate prenyl transferases was confirmed by HMM search. A non redundant database containing more than 1.34M sequence was searched using HMM models built from the alignments shown in FIG. 34 for Motifs IX-XII. E value limits for the search was set at 1.0. All four motifs identified only homogentisate prenyl transferase from cyanobacteria, photobacteria and Arabidopsis. Upper E values limits for Motif IX, X, XI, and XII were 0.9, 11E10E.sup.-11, 0.03, 8E10.sup.-8 respectively. The small size of motifs resulted in higher E values for Motif IX and XI.

EXAMPLE 8

Transformation and Expression of a Wild Type Arabidopsis HPT2 Gene in Sense and Antisense Orientations with Respect to Seed-specific and Constitutive Promoters in Arabidopsis thialiana

[0428] The HPT2 full-length cDNA (SEQ ID NO: 59) is excised from an EST clone, CPR230005 (pMON69960-FIG. 15), with SalI and NotI enzymes, blunt-ended and cloned in between the napin promoter and napin 3' end at blunt-ended SalI site in sense and antisense orientations with respect to the napin promoter in pMON36525 (FIG. 16) to generate recombinant binary vectors pMON69963 (FIG. 17) and pMON69965 (FIG. 18), respectively. The sequence of the HPT2 cDNA is confirmed by sequencing with napin 5'-sense (5'-GTGGCTCGGCTTCACTTTTTAC-3') (SEQ ID NO: 50) and napin 3'-antisense (5'-CCACACTCATATCACCGTGG-3') (SEQ ID NO: 51) primers using standard sequencing methodology. The HPT2 cDNA used to generate the pMON69963 and pMON69965 is also cloned in between the enhanced 35S promoter and E9-3' end at blunt-ended BglII and BamHI sites of pMON10098 (FIG. 19) to generate the pMON69964 (FIG. 20) and pMON69966 (FIG. 21) in sense and antisense orientations with respect to the enhanced 35S promoter, respectively. Additional HPT2 internal primers synthesized to completely sequence the whole HPT2 cDNA are listed in the table below:

[0429] A list of primers used for confirming the HPT2 cDNA sequence. TABLE-US-00004 Primer Description Sequence BXK169 HPT2/CPR23005/sense 5'-CAGTGCTGGATAGAATTGCCCGGTTCC-3' (SEQ ID NO: 52) BXK170 HPT2/CPR23005/sense 5'-GAGATCTATCAGTGCAGTCTGCTTGG-3' (SEQ ID NO: 53) BXK171 HPT2/CPR23005/antisense 5'-GGGACAAGCATTTTTATTGCAAG-3' (SEQ ID NO: 54) BXK172 HPT2/CPR23005/antisense 5'-GCCAAGATCACATGTGCAGGAATC-3' (SEQ ID NO: 55) BXK173 HPT2/CPR23005/sense 5'-GTGGAGTGCACCTGTGGCGTTCATC-3' (SEQ ID NO: 56)

[0430] The plant binary vectors pMON69963, and pMON69965 are used in Arabidopsis thaliana plant transformation to direct the sense and antisense expression of the HPT2, in the embryo. The binary vectors pMON69964, and pMON69966 are used in Arabidopsis thaliana plant transformation for sense and antisense expression of the HPT2 in whole plant. The binary vectors are transformed into ABI strain Agrobacterium cells by electroporation (Bio-Rad Electroprotocol Manual, Dower et al., Nucleic Acids Res., 16:6127-6145 (1988)). Transgenic Arabidopsis thaliana plants are obtained by Agrobacterium-mediated transformation as described by Valverkens et al., Proc. Nat. Acad. Sci., 85:5536-5540 (1988), Bent et al., Science, 265:1856-1860 (1994), and Bechtold et al., C.R. Acad. Sci., Life Sciences, 316:1194-1199 (1993). Transgenic plants are selected by sprinkling the transformed T.sub.1 seeds onto the selection plates containing MS basal salts (4.3 g/L), Gamborg'a B-5, 500X (2.0 g/L), sucrose (10 g/L), MES (0.5 g/L), phytagar (8 g/L), carbenicillin (250 mg/L), cefotaxime (100 mg/L), plant preservation medium (2 ml/L), and kanamycin (60 mg/L) and then vernalizing them at 4.degree. C. in the absence of light for 2-4 days. The seeds are transferred to 23.degree. C., and 16/8 hours light/dark cycle for 5-10 days until seedlings emerge. Once one set of true leaves are formed on the kanamycin resistant seedlings, they are transferred to soil and grown to maturity. The transgenic lines generated through kanamycin selection are grown under two different light conditions. One set of the transgenic lines are grown under 16 hrs light and 8 hrs dark and another set of the transgenic lines are grown under 24 hrs light to study the effect of light on seed tocopherol levels. The T.sub.2 seed harvested from the transformants is analyzed for tocopherol content. The results from the seed total tocopherol analysis from lines grown under both normal and high light conditions are presented in FIGS. 22 and 23. Seed-specific overexpression of HPT2 under normal and high light conditions produced a significant 1.6- and 1.5-fold increase in total tocopherol levels (alpha=0.05; Tukey-Kramer HSD) (SAS institute, 2002, JPM version 5.0).

[0431] Expression of HPT2 using the constitutive promoter, e35S, produced about 20% increase in seed total tocopherol levels as compared to control under both light conditions. Maximum tocopherol level reduction in lines harboring the enhanced 35S::HPT2 antisense construct was 20%. Overall, the significant increase in seed total tocopherol level in the Arabidopsis thaliana lines harboring the HPT2 driven by the napin promoter suggests that HPT2 plays a key role in tocopherol biosynthesis.

[0432] Western analysis is carried out to detect the transgene expression in tissues harboring the gene of interest (GOI) expression cassette using the GOI protein specific antibody. Northern analysis is done for detecting the mRNA level of the transgene using the GOI sequence specific radiolabelled probe.

EXAMPLE 9

Preparation of Plant Binary Vector for Expression of HPT2 from Arabidopsis in Combination with Tocopherol Pathway Genes

[0433] To investigate the combinatorial effect of HPT2 with other key enzymes in the pathway, a plant binary vector containing seed-specifically expressed hydroxyphenylpyruvate dioxygenase (HPPD), bifunctional prephenate dehydrogenase tyrA, and HPT2 (pMON81028-FIG. 27) is prepared. The pMON81028 is made by exercising the pNapin::HPT2::Napin 3' expression cassette from pMON81023 (FIG. 28) with Bsp120I and NotI enzymes and ligating it to pMON36596 (FIG. 29) at NotI site. The pMON36596 contains the pNapin::CTP2::HPPD::Napin 3' and pNapin::CTP1::TyrA::Napin 3' expression cassettes. The pMON81028 is transformed into Arabidopsis thaliana plant using the method described in Example 8.

EXAMPLE 10

Preparation of Construct for Bacterial Expression of HPT2 from Arabidopsis

[0434] The EST clone CPR23005 containing the HPT2 full length cDNA is used as a template for PCR to amplify the HPT2 cDNA fragment codes for the mature form of the HPT2 protein. Two sets of PCR products are generated to clone at the pET30a(+) vector (Novagen, Inc.) (FIG. 30) to produce HPT2 protein with and without his tag. The primer set BXK174 (5'-CACATATGGCATGTTCTCAGGTTGGTGCTGC-3') (SEQ ID NO: 84) and BXK176 (5'-GCGTCGACCTAGAGGAAGGGGAATAACAG-3') (SEQ ID NO: 85) is used for cloning HPT2 at the NdeI and SalI sites of pET30a(+), behind the T7 promoter to generate mature HPT2 protein without the his tag. The resulting recobmbinant vector is named pMON69993 (FIG. 31). The primer set BXK175 (5'-CAACCATGGCATGTTCTCAGGTTGGTGCTGC-3') (SEQ ID NO: 86) and BXK176 (5'-GCGTCGACCTAGAGGAAGGGGAATAACAG-3') (SEQ ID NO: 87) is used to generate HPT2 PCR product to clone at the NcoI and SalI sites of pET30a(+) to produce mature HPT2 with his tag. The recombinant vector is named as pMON69992 (FIG. 32). The pMON69993 and pMON69992 is used for producing bacterial expressed HPT2 to carry out enzyme assays to confirm its homogentisate prenyl transferase activity and specificity towards geranylgeranyl pyrophosphosphate, phytyl pyrophophaste and solanyl pyrophosphate substrates.

Sequence CWU 1

1

95 1 322 PRT Nostoc punctiforme 1 Met Ser Gln Ser Ser Gln Asn Ser Pro Leu Pro Arg Lys Pro Val Gln 1 5 10 15 Ser Tyr Phe His Trp Leu Tyr Ala Phe Trp Lys Phe Ser Arg Pro His 20 25 30 Thr Ile Ile Gly Thr Ser Leu Ser Val Leu Ser Leu Tyr Leu Ile Ala 35 40 45 Ile Ala Ile Ser Asn Asn Thr Ala Ser Leu Phe Thr Thr Pro Gly Ser 50 55 60 Leu Ser Pro Leu Phe Gly Ala Trp Ile Ala Cys Leu Cys Gly Asn Val 65 70 75 80 Tyr Ile Val Gly Leu Asn Gln Leu Glu Asp Val Asp Ile Asp Lys Ile 85 90 95 Asn Lys Pro His Leu Pro Leu Ala Ser Gly Glu Phe Ser Gln Gln Thr 100 105 110 Gly Gln Leu Ile Val Ala Ser Thr Gly Ile Leu Ala Leu Val Met Ala 115 120 125 Trp Leu Thr Gly Pro Phe Leu Phe Gly Met Val Thr Ile Ser Leu Ala 130 135 140 Ile Gly Thr Ala Tyr Ser Leu Pro Pro Ile Arg Leu Lys Gln Phe Pro 145 150 155 160 Phe Trp Ala Ala Leu Cys Ile Phe Ser Val Arg Gly Thr Ile Val Asn 165 170 175 Leu Gly Leu Tyr Leu His Tyr Ser Trp Ala Leu Lys Gln Ser Gln Thr 180 185 190 Ile Pro Pro Val Val Trp Val Leu Thr Leu Phe Ile Leu Val Phe Thr 195 200 205 Phe Ala Ile Ala Ile Phe Lys Asp Ile Pro Asp Ile Glu Gly Asp Arg 210 215 220 Leu Tyr Asn Ile Thr Thr Phe Thr Ile Lys Leu Gly Ser Gln Ala Val 225 230 235 240 Phe Asn Leu Ala Leu Trp Val Ile Thr Val Cys Tyr Leu Gly Ile Ile 245 250 255 Leu Val Gly Val Leu Arg Ile Ala Ser Val Asn Pro Ile Phe Leu Ile 260 265 270 Thr Ala His Leu Ala Leu Leu Val Trp Met Trp Trp Arg Ser Leu Ala 275 280 285 Val Asp Leu Gln Asp Lys Ser Ala Ile Ala Gln Phe Tyr Gln Phe Ile 290 295 300 Trp Lys Leu Phe Phe Ile Glu Tyr Leu Ile Phe Pro Ile Ala Cys Phe 305 310 315 320 Leu Ala 2 318 PRT Anabaena sp. 2 Met Asn Gln Ser Ser Gln Asp Arg Pro Leu Arg Pro Lys Pro Leu Gln 1 5 10 15 Ser Ser Phe Gln Trp Leu Tyr Ala Phe Trp Lys Phe Ser Arg Pro His 20 25 30 Thr Ile Ile Gly Thr Ser Leu Ser Val Leu Gly Leu Tyr Leu Ile Ser 35 40 45 Ile Ala Val Ser Ser Thr Gly Phe Ala Leu Thr Gln Ile Asn Ser Val 50 55 60 Leu Gly Ala Trp Leu Ala Cys Leu Cys Gly Asn Val Tyr Ile Val Gly 65 70 75 80 Leu Asn Gln Leu Glu Asp Ile Glu Ile Asp Lys Val Asn Lys Pro His 85 90 95 Leu Pro Leu Ala Ser Gly Glu Phe Ser Arg Lys Gln Gly Arg Ile Ile 100 105 110 Val Ile Leu Thr Gly Ile Thr Ala Ile Val Leu Ala Trp Leu Asn Gly 115 120 125 Pro Tyr Leu Phe Gly Met Val Ala Val Ser Leu Ala Ile Gly Thr Ala 130 135 140 Tyr Ser Leu Pro Pro Ile Arg Leu Lys Gln Phe Pro Phe Trp Ala Ala 145 150 155 160 Leu Cys Ile Phe Ser Val Arg Gly Thr Ile Val Asn Leu Gly Leu Tyr 165 170 175 Leu His Phe Ser Trp Leu Leu Gln Asn Lys Gln Ser Ile Pro Leu Pro 180 185 190 Val Trp Ile Leu Thr Val Phe Ile Leu Ile Phe Thr Phe Ala Ile Ala 195 200 205 Ile Phe Lys Asp Ile Pro Asp Met Glu Gly Asp Arg Leu Tyr Asn Ile 210 215 220 Thr Thr Leu Thr Ile Gln Leu Gly Pro Gln Ala Val Phe Asn Leu Ala 225 230 235 240 Met Trp Val Leu Thr Val Cys Tyr Leu Gly Met Val Ile Ile Gly Val 245 250 255 Leu Arg Leu Gly Thr Ile Asn Ser Val Phe Leu Val Val Thr His Leu 260 265 270 Val Ile Leu Cys Trp Met Trp Met Gln Ser Leu Ala Val Asp Ile His 275 280 285 Asp Lys Thr Ala Ile Ala Gln Phe Tyr Gln Phe Ile Trp Lys Leu Phe 290 295 300 Phe Leu Glu Tyr Leu Met Phe Pro Ile Ala Cys Leu Leu Ala 305 310 315 3 308 PRT Synechocystis sp. 3 Met Ala Thr Ile Gln Ala Phe Trp Arg Phe Ser Arg Pro His Thr Ile 1 5 10 15 Ile Gly Thr Thr Leu Ser Val Trp Ala Val Tyr Leu Leu Thr Ile Leu 20 25 30 Gly Asp Gly Asn Ser Val Asn Ser Pro Ala Ser Leu Asp Leu Val Phe 35 40 45 Gly Ala Trp Leu Ala Cys Leu Leu Gly Asn Val Tyr Ile Val Gly Leu 50 55 60 Asn Gln Leu Trp Asp Val Asp Ile Asp Arg Ile Asn Lys Pro Asn Leu 65 70 75 80 Pro Leu Ala Asn Gly Asp Phe Ser Ile Ala Gln Gly Arg Trp Ile Val 85 90 95 Gly Leu Cys Gly Val Ala Ser Leu Ala Ile Ala Trp Gly Leu Gly Leu 100 105 110 Trp Leu Gly Leu Thr Val Gly Ile Ser Leu Ile Ile Gly Thr Ala Tyr 115 120 125 Ser Val Pro Pro Val Arg Leu Lys Arg Phe Ser Leu Leu Ala Ala Leu 130 135 140 Cys Ile Leu Thr Val Arg Gly Ile Val Val Asn Leu Gly Leu Phe Leu 145 150 155 160 Phe Phe Arg Ile Gly Leu Gly Tyr Pro Pro Thr Leu Ile Thr Pro Ile 165 170 175 Trp Val Leu Thr Leu Phe Ile Leu Val Phe Thr Val Ala Ile Ala Ile 180 185 190 Phe Lys Asp Val Pro Asp Met Glu Gly Asp Arg Gln Phe Lys Ile Gln 195 200 205 Thr Leu Thr Leu Gln Ile Gly Lys Gln Asn Val Phe Arg Gly Thr Leu 210 215 220 Ile Leu Leu Thr Gly Cys Tyr Leu Ala Met Ala Ile Trp Gly Leu Trp 225 230 235 240 Ala Ala Met Pro Leu Asn Thr Ala Phe Leu Ile Val Ser His Leu Cys 245 250 255 Leu Leu Ala Leu Leu Trp Trp Arg Ser Arg Asp Val His Leu Glu Ser 260 265 270 Lys Thr Glu Ile Ala Ser Phe Tyr Gln Phe Ile Trp Lys Leu Phe Phe 275 280 285 Leu Glu Tyr Leu Leu Tyr Pro Leu Ala Leu Trp Leu Pro Asn Phe Ser 290 295 300 Asn Thr Ile Phe 305 4 399 PRT Zea mays 4 Met Asp Ala Leu Arg Leu Arg Pro Ser Leu Leu Pro Val Arg Pro Gly 1 5 10 15 Ala Ala Arg Pro Arg Asp His Phe Leu Pro Pro Cys Cys Ser Ile Gln 20 25 30 Arg Asn Gly Glu Gly Arg Ile Cys Phe Ser Ser Gln Arg Thr Gln Gly 35 40 45 Pro Thr Leu His His His Gln Lys Phe Phe Glu Trp Lys Ser Ser Tyr 50 55 60 Cys Arg Ile Ser His Arg Ser Leu Asn Thr Ser Val Asn Ala Ser Gly 65 70 75 80 Gln Gln Leu Gln Ser Glu Pro Glu Thr His Asp Ser Thr Thr Ile Trp 85 90 95 Arg Ala Ile Ser Ser Ser Leu Asp Ala Phe Tyr Arg Phe Ser Arg Pro 100 105 110 His Thr Val Ile Gly Thr Ala Leu Ser Ile Val Ser Val Ser Leu Leu 115 120 125 Ala Val Gln Ser Leu Ser Asp Ile Ser Pro Leu Phe Leu Thr Gly Leu 130 135 140 Leu Glu Ala Val Val Ala Ala Leu Phe Met Asn Ile Tyr Ile Val Gly 145 150 155 160 Leu Asn Gln Leu Phe Asp Ile Glu Ile Asp Lys Val Asn Lys Pro Thr 165 170 175 Leu Pro Leu Ala Ser Gly Glu Tyr Thr Leu Ala Thr Gly Val Ala Ile 180 185 190 Val Ser Val Phe Ala Ala Met Ser Phe Gly Leu Gly Trp Ala Val Gly 195 200 205 Ser Gln Pro Leu Phe Trp Ala Leu Phe Ile Ser Phe Val Leu Gly Thr 210 215 220 Ala Tyr Ser Ile Asn Leu Pro Tyr Leu Arg Trp Lys Arg Phe Ala Val 225 230 235 240 Val Ala Ala Leu Cys Ile Leu Ala Val Arg Ala Val Ile Val Gln Leu 245 250 255 Ala Phe Phe Leu His Ile Gln Thr Phe Val Phe Arg Arg Pro Ala Val 260 265 270 Phe Ser Arg Pro Leu Leu Phe Ala Thr Gly Phe Met Thr Phe Phe Ser 275 280 285 Val Val Ile Ala Leu Phe Lys Asp Ile Pro Asp Ile Glu Gly Asp Arg 290 295 300 Ile Phe Gly Ile Arg Ser Phe Ser Val Arg Leu Gly Gln Lys Lys Val 305 310 315 320 Phe Trp Ile Cys Val Gly Leu Leu Glu Met Ala Tyr Ser Val Ala Ile 325 330 335 Leu Met Gly Ala Thr Ser Ser Cys Leu Trp Ser Lys Thr Ala Thr Ile 340 345 350 Ala Gly His Ser Ile Leu Ala Ala Ile Leu Trp Ser Cys Ala Arg Ser 355 360 365 Val Asp Leu Thr Ser Lys Ala Ala Ile Thr Ser Phe Tyr Met Phe Ile 370 375 380 Trp Lys Leu Phe Tyr Ala Glu Tyr Leu Leu Ile Pro Leu Val Arg 385 390 395 5 411 PRT Glycine max (ppt2) 5 Met Asp Ser Leu Leu Leu Arg Ser Phe Pro Asn Ile Asn Asn Ala Ser 1 5 10 15 Ser Leu Thr Thr Thr Gly Ala Asn Phe Ser Arg Thr Lys Ser Phe Ala 20 25 30 Asn Ile Tyr His Ala Ser Ser Tyr Val Pro Asn Ala Ser Trp His Asn 35 40 45 Arg Lys Ile Gln Lys Glu Tyr Asn Phe Leu Arg Phe Arg Trp Pro Ser 50 55 60 Leu Asn His His Tyr Lys Gly Ile Glu Gly Ala Cys Thr Cys Lys Lys 65 70 75 80 Cys Asn Ile Lys Phe Val Val Lys Ala Thr Ser Glu Lys Ser Leu Glu 85 90 95 Ser Glu Pro Gln Ala Phe Asp Pro Lys Ser Ile Leu Asp Ser Val Lys 100 105 110 Asn Ser Leu Asp Ala Phe Tyr Arg Phe Ser Arg Pro His Thr Val Ile 115 120 125 Gly Thr Ala Leu Ser Ile Ile Ser Val Ser Leu Leu Ala Val Glu Lys 130 135 140 Ile Ser Asp Ile Ser Pro Leu Phe Phe Thr Gly Val Leu Glu Ala Val 145 150 155 160 Val Ala Ala Leu Phe Met Asn Ile Tyr Ile Val Gly Leu Asn Gln Leu 165 170 175 Ser Asp Val Glu Ile Asp Lys Ile Asn Lys Pro Tyr Leu Pro Leu Ala 180 185 190 Ser Gly Glu Tyr Ser Phe Glu Thr Gly Val Thr Ile Val Ala Ser Phe 195 200 205 Ser Ile Leu Ser Phe Trp Leu Gly Trp Val Val Gly Ser Trp Pro Leu 210 215 220 Phe Trp Ala Leu Phe Val Ser Phe Val Leu Gly Thr Ala Tyr Ser Ile 225 230 235 240 Asn Val Pro Leu Leu Arg Trp Lys Arg Phe Ala Val Leu Ala Ala Met 245 250 255 Cys Ile Leu Ala Val Arg Ala Val Ile Val Gln Leu Ala Phe Phe Leu 260 265 270 His Met Gln Thr His Val Tyr Lys Arg Pro Pro Val Phe Ser Arg Pro 275 280 285 Leu Ile Phe Ala Thr Ala Phe Met Ser Phe Phe Ser Val Val Ile Ala 290 295 300 Leu Phe Lys Asp Ile Pro Asp Ile Glu Gly Asp Lys Val Phe Gly Ile 305 310 315 320 Gln Ser Phe Ser Val Arg Leu Gly Gln Lys Pro Val Phe Trp Thr Cys 325 330 335 Val Thr Leu Leu Glu Ile Ala Tyr Gly Val Ala Leu Leu Val Gly Ala 340 345 350 Ala Ser Pro Cys Leu Trp Ser Lys Ile Phe Thr Gly Leu Gly His Ala 355 360 365 Val Leu Ala Ser Ile Leu Trp Phe His Ala Lys Ser Val Asp Leu Lys 370 375 380 Ser Lys Ala Ser Ile Thr Ser Phe Tyr Met Phe Ile Trp Lys Leu Phe 385 390 395 400 Tyr Ala Glu Tyr Leu Leu Ile Pro Phe Val Arg 405 410 6 395 PRT Glycine max (ppt1) 6 Met Asp Ser Met Leu Leu Arg Ser Phe Pro Asn Ile Asn Asn Ala Ser 1 5 10 15 Ser Leu Ala Thr Thr Gly Ser Tyr Leu Pro Asn Ala Ser Trp His Asn 20 25 30 Arg Lys Ile Gln Lys Glu Tyr Asn Phe Leu Arg Phe Arg Trp Pro Ser 35 40 45 Leu Asn His His Tyr Lys Ser Ile Glu Gly Gly Cys Thr Cys Lys Lys 50 55 60 Cys Asn Ile Lys Phe Val Val Lys Ala Thr Ser Glu Lys Ser Phe Glu 65 70 75 80 Ser Glu Pro Gln Ala Phe Asp Pro Lys Ser Ile Leu Asp Ser Val Lys 85 90 95 Asn Ser Leu Asp Ala Phe Tyr Arg Phe Ser Arg Pro His Thr Val Ile 100 105 110 Gly Thr Ala Leu Ser Ile Ile Ser Val Ser Leu Leu Ala Val Glu Lys 115 120 125 Ile Ser Asp Ile Ser Pro Leu Phe Phe Thr Gly Val Leu Glu Ala Val 130 135 140 Val Ala Ala Leu Phe Met Asn Ile Tyr Ile Val Gly Leu Asn Gln Leu 145 150 155 160 Ser Asp Val Glu Ile Asp Lys Ile Asn Lys Pro Tyr Leu Pro Leu Ala 165 170 175 Ser Gly Glu Tyr Ser Phe Glu Thr Gly Val Thr Ile Val Ala Ser Phe 180 185 190 Ser Ile Leu Ser Phe Trp Leu Gly Trp Val Val Gly Ser Trp Pro Leu 195 200 205 Phe Trp Ala Leu Phe Val Ser Phe Val Leu Gly Thr Ala Tyr Ser Ile 210 215 220 Asn Val Pro Leu Leu Arg Trp Lys Arg Phe Ala Val Leu Ala Ala Met 225 230 235 240 Cys Ile Leu Ala Val Arg Ala Val Ile Val Gln Leu Ala Phe Phe Leu 245 250 255 His Ile Gln Thr His Val Tyr Lys Arg Pro Pro Val Phe Ser Arg Ser 260 265 270 Leu Ile Phe Ala Thr Ala Phe Met Ser Phe Phe Ser Val Val Ile Ala 275 280 285 Leu Phe Lys Asp Ile Pro Asp Ile Glu Gly Asp Lys Val Phe Gly Ile 290 295 300 Gln Ser Phe Ser Val Arg Leu Gly Gln Lys Pro Val Phe Trp Thr Cys 305 310 315 320 Val Ile Leu Leu Glu Ile Ala Tyr Gly Val Ala Leu Leu Val Gly Ala 325 330 335 Ala Ser Pro Cys Leu Trp Ser Lys Ile Val Thr Gly Leu Gly His Ala 340 345 350 Val Leu Ala Ser Ile Leu Trp Phe His Ala Lys Ser Val Asp Leu Lys 355 360 365 Ser Lys Ala Ser Ile Thr Ser Phe Tyr Met Phe Ile Trp Lys Leu Phe 370 375 380 Tyr Ala Glu Tyr Leu Leu Ile Pro Phe Val Arg 385 390 395 7 393 PRT Arabidopsis thaliana 7 Met Glu Ser Leu Leu Ser Ser Ser Ser Leu Val Ser Ala Ala Gly Gly 1 5 10 15 Phe Cys Trp Lys Lys Gln Asn Leu Lys Leu His Ser Leu Ser Glu Ile 20 25 30 Arg Val Leu Arg Cys Asp Ser Ser Lys Val Val Ala Lys Pro Lys Phe 35 40 45 Arg Asn Asn Leu Val Arg Pro Asp Gly Gln Gly Ser Ser Leu Leu Leu 50 55 60 Tyr Pro Lys His Lys Ser Arg Phe Arg Val Asn Ala Thr Ala Gly Gln 65 70 75 80 Pro Glu Ala Phe Asp Ser Asn Ser Lys Gln Lys Ser Phe Arg Asp Ser 85 90 95 Leu Asp Ala Phe Tyr Arg Phe Ser Arg Pro His Thr Val Ile Gly Thr 100 105 110 Val Leu Ser Ile Leu Ser Val Ser Phe Leu Ala Val Glu Lys Val Ser 115 120 125 Asp Ile Ser Pro Leu Leu Phe Thr Gly Ile Leu Glu Ala Val Val Ala 130 135 140 Ala Leu Met Met Asn Ile Tyr Ile Val Gly Leu Asn Gln Leu Ser Asp 145 150 155 160 Val Glu Ile Asp Lys Val Asn Lys Pro Tyr Leu Pro Leu Ala Ser Gly 165 170 175 Glu Tyr Ser Val Asn Thr Gly Ile Ala Ile Val Ala Ser Phe Ser Ile 180 185 190 Met Ser Phe Trp Leu Gly Trp Ile Val Gly Ser Trp Pro Leu Phe Trp 195 200 205 Ala Leu Phe Val Ser Phe Met Leu Gly Thr Ala Tyr Ser Ile Asn Leu 210 215 220 Pro Leu Leu Arg Trp Lys Arg Phe Ala Leu Val Ala Ala Met Cys Ile 225 230 235 240 Leu Ala Val Arg Ala Ile Ile Val Gln Ile Ala Phe Tyr Leu His Ile 245 250 255 Gln Thr His Val Phe Gly Arg Pro Ile Leu Phe Thr Arg Pro Leu Ile 260 265 270 Phe Ala Thr Ala Phe Met Ser Phe Phe Ser Val

Val Ile Ala Leu Phe 275 280 285 Lys Asp Ile Pro Asp Ile Glu Gly Asp Lys Ile Phe Gly Ile Arg Ser 290 295 300 Phe Ser Val Thr Leu Gly Gln Lys Arg Val Phe Trp Thr Cys Val Thr 305 310 315 320 Leu Leu Gln Met Ala Tyr Ala Val Ala Ile Leu Val Gly Ala Thr Ser 325 330 335 Pro Phe Ile Trp Ser Lys Val Ile Ser Val Val Gly His Val Ile Leu 340 345 350 Ala Thr Thr Leu Trp Ala Arg Ala Lys Ser Val Asp Leu Ser Ser Lys 355 360 365 Thr Glu Ile Thr Ser Cys Tyr Met Phe Ile Trp Lys Leu Phe Tyr Ala 370 375 380 Glu Tyr Leu Leu Leu Pro Phe Leu Lys 385 390 8 361 PRT Cuphea pulcherrima 8 Met Arg Met Glu Ser Leu Leu Leu Asn Ser Phe Ser Pro Ser Pro Ala 1 5 10 15 Gly Gly Lys Ile Cys Arg Ala Asp Thr Tyr Lys Lys Ala Tyr Phe Ala 20 25 30 Thr Ala Arg Cys Asn Thr Leu Asn Ser Leu Asn Lys Asn Thr Gly Glu 35 40 45 Tyr His Leu Ser Arg Thr Arg Gln Arg Phe Thr Phe His Gln Asn Gly 50 55 60 His Arg Thr Tyr Leu Val Lys Ala Val Ser Gly Gln Ser Leu Glu Ser 65 70 75 80 Glu Pro Glu Ser Tyr Pro Asn Asn Arg Trp Asp Tyr Val Lys Ser Ala 85 90 95 Ala Asp Ala Phe Tyr Arg Phe Ser Arg Pro His Thr Ile Ile Gly Thr 100 105 110 Ala Leu Ser Ile Val Ser Val Ser Leu Leu Ala Val Glu Lys Leu Pro 115 120 125 Glu Leu Asn Ser Met Phe Phe Thr Gly Leu Leu Glu Val Ile Leu Ala 130 135 140 Ala Leu Phe Met Asn Ile Tyr Ile Val Gly Leu Asn Gln Leu Ser Asp 145 150 155 160 Ile Asp Ile Asp Lys Val Asn Lys Pro Tyr Leu Pro Leu Ala Ser Gly 165 170 175 Glu Phe Ser Val Gly Thr Gly Val Thr Ile Val Thr Ser Phe Leu Ile 180 185 190 Met Ser Phe Trp Leu Gly Trp Val Val Gly Ser Trp Pro Leu Phe Trp 195 200 205 Ala Leu Phe Ile Ser Phe Val Leu Gly Thr Ala Tyr Ser Ile Asp Met 210 215 220 Pro Met Leu Arg Trp Lys Arg Ser Ala Val Val Ala Ala Leu Cys Ile 225 230 235 240 Leu Ala Val Arg Ala Val Ile Val Gln Ile Ala Phe Phe Leu His Met 245 250 255 Gln Met His Val Tyr Gly Arg Ala Ala Ala Leu Ser Arg Pro Val Ile 260 265 270 Phe Ala Thr Gly Phe Met Ser Phe Phe Ser Ile Val Ile Ala Leu Phe 275 280 285 Lys Asp Ile Pro Asp Ile Glu Gly Asp Lys Ile Phe Gly Ile Arg Ser 290 295 300 Phe Thr Val Arg Leu Gly Gln Glu Arg Val Phe Trp Ile Cys Ile Ser 305 310 315 320 Leu Leu Glu Met Ala Tyr Ala Val Ala Leu Trp Val Leu Arg Ala Arg 325 330 335 Gly Arg Lys Lys His Ala Asp Gly Val Ser Ala Ser Glu Phe Phe Leu 340 345 350 Ser Ile Ser Gly Gly Arg Lys Asn Leu 355 360 9 395 PRT Allium porrum 9 Met Leu Ser Met Asp Ser Leu Leu Thr Lys Pro Val Val Ile Pro Leu 1 5 10 15 Pro Ser Pro Val Cys Ser Leu Pro Ile Leu Arg Gly Ser Ser Ala Pro 20 25 30 Gly Gln Tyr Ser Cys Arg Asn Tyr Asn Pro Ile Arg Ile Gln Arg Cys 35 40 45 Leu Val Asn Tyr Glu His Val Lys Pro Arg Phe Thr Thr Cys Ser Arg 50 55 60 Ser Gln Lys Leu Gly His Val Lys Ala Thr Ser Glu His Ser Leu Glu 65 70 75 80 Ser Gly Ser Glu Gly Tyr Thr Pro Arg Ser Ile Trp Glu Ala Val Leu 85 90 95 Ala Ser Leu Asn Val Leu Tyr Lys Phe Ser Arg Pro His Thr Ile Ile 100 105 110 Gly Thr Ala Met Gly Ile Met Ser Val Ser Leu Leu Val Val Glu Ser 115 120 125 Leu Ser Asp Ile Ser Pro Leu Phe Phe Val Gly Leu Leu Glu Ala Val 130 135 140 Val Ala Ala Leu Phe Met Asn Val Tyr Ile Val Gly Leu Asn Gln Leu 145 150 155 160 Phe Asp Ile Glu Ile Asp Lys Val Asn Lys Pro Asp Leu Pro Leu Ala 165 170 175 Ser Gly Glu Tyr Ser Pro Arg Ala Gly Thr Ala Ile Val Ile Ala Ser 180 185 190 Ala Ile Met Ser Phe Gly Ile Gly Trp Leu Val Gly Ser Trp Pro Leu 195 200 205 Phe Trp Ala Leu Phe Ile Ser Phe Val Leu Gly Thr Ala Tyr Ser Ile 210 215 220 Asn Leu Pro Phe Leu Arg Trp Lys Arg Ser Ala Val Val Ala Ala Ile 225 230 235 240 Cys Ile Leu Ala Val Arg Ala Val Ile Val Gln Leu Ala Phe Phe Leu 245 250 255 His Ile Gln Ser Phe Val Phe Lys Arg Pro Ala Ser Phe Thr Arg Pro 260 265 270 Leu Ile Phe Ala Thr Ala Phe Met Ser Phe Phe Ser Val Val Ile Ala 275 280 285 Leu Phe Lys Asp Ile Pro Asp Ile Asp Gly Asp Lys Ile Phe Gly Ile 290 295 300 His Ser Phe Ser Val Arg Leu Gly Gln Glu Arg Val Phe Trp Ile Cys 305 310 315 320 Ile Tyr Leu Leu Glu Met Ala Tyr Thr Val Val Met Val Val Gly Ala 325 330 335 Thr Ser Ser Cys Leu Trp Ser Lys Cys Leu Thr Val Ile Gly His Ala 340 345 350 Ile Leu Gly Ser Leu Leu Trp Asn Arg Ala Arg Ser His Gly Pro Met 355 360 365 Thr Lys Thr Thr Ile Thr Ser Phe Tyr Met Phe Val Trp Lys Leu Phe 370 375 380 Tyr Ala Glu Tyr Leu Leu Ile Pro Phe Val Arg 385 390 395 10 400 PRT Triticum sp. 10 Met Asp Ser Leu Arg Leu Arg Pro Ser Ser Leu Arg Ser Ala Pro Gly 1 5 10 15 Ala Ala Ala Ala Arg Arg Arg Asp His Ile Leu Pro Ser Phe Cys Ser 20 25 30 Ile Gln Arg Asn Gly Lys Gly Arg Val Thr Leu Ser Ile Gln Ala Ser 35 40 45 Lys Gly Pro Thr Ile Asn His Cys Lys Lys Phe Leu Asp Trp Lys Tyr 50 55 60 Ser Asn His Arg Ile Ser His Gln Ser Ile Asn Thr Ser Ala Lys Ala 65 70 75 80 Gly Gln Ser Leu Gln Pro Glu Thr Glu Ala His Asp Pro Ala Ser Phe 85 90 95 Trp Lys Pro Ile Ser Ser Ser Leu Asp Ala Phe Tyr Arg Phe Ser Arg 100 105 110 Pro His Thr Ile Ile Gly Thr Ala Leu Ser Ile Val Ser Val Ser Leu 115 120 125 Leu Ala Val Glu Ser Leu Ser Asp Ile Ser Pro Leu Phe Leu Thr Gly 130 135 140 Leu Leu Glu Ala Val Val Ala Ala Leu Phe Met Asn Ile Tyr Ile Val 145 150 155 160 Gly Leu Asn Gln Leu Phe Asp Ile Glu Ile Asp Lys Val Asn Lys Pro 165 170 175 Thr Leu Pro Leu Ala Ser Gly Glu Tyr Ser Pro Ala Thr Gly Val Ala 180 185 190 Ile Val Ser Val Phe Ala Ala Met Ser Phe Gly Leu Gly Trp Val Val 195 200 205 Gly Ser Pro Pro Leu Phe Trp Ala Leu Phe Ile Ser Phe Val Leu Gly 210 215 220 Thr Ala Tyr Ser Val Asn Leu Pro Tyr Phe Arg Trp Lys Arg Ser Ala 225 230 235 240 Val Val Ala Ala Leu Cys Ile Leu Ala Val Arg Ala Val Ile Val Gln 245 250 255 Leu Ala Phe Phe Leu His Ile Gln Thr Phe Val Phe Arg Arg Pro Ala 260 265 270 Val Phe Ser Lys Pro Leu Ile Phe Ala Thr Ala Phe Met Thr Phe Phe 275 280 285 Ser Val Val Ile Ala Leu Phe Lys Asp Ile Pro Asp Ile Glu Gly Asp 290 295 300 Arg Ile Phe Gly Ile Gln Ser Phe Ser Val Arg Leu Gly Gln Ser Lys 305 310 315 320 Val Phe Trp Thr Cys Val Gly Leu Leu Glu Val Ala Tyr Gly Val Ala 325 330 335 Ile Leu Met Gly Val Thr Ser Ser Ser Leu Trp Ser Lys Ser Leu Thr 340 345 350 Val Val Gly His Ala Ile Leu Ala Ser Ile Leu Trp Ser Ser Ala Arg 355 360 365 Ser Ile Asp Leu Thr Ser Lys Ala Ala Ile Thr Ser Phe Tyr Met Leu 370 375 380 Ile Trp Arg Leu Phe Tyr Ala Glu Tyr Leu Leu Ile Pro Leu Val Arg 385 390 395 400 11 393 PRT Cuphea pulcherrima 11 Met Arg Met Glu Ser Leu Leu Leu Asn Ser Phe Ser Pro Ser Pro Ala 1 5 10 15 Gly Gly Lys Ile Cys Arg Ala Asp Thr Tyr Lys Lys Ala Tyr Phe Ala 20 25 30 Thr Ala Arg Cys Asn Thr Leu Asn Ser Leu Asn Lys Asn Thr Gly Glu 35 40 45 Tyr His Leu Ser Arg Thr Arg Gln Arg Phe Thr Phe His Gln Asn Gly 50 55 60 His Arg Thr Tyr Leu Val Lys Ala Val Ser Gly Gln Ser Leu Glu Ser 65 70 75 80 Glu Pro Glu Ser Tyr Pro Asn Asn Arg Trp Asp Tyr Val Lys Ser Ala 85 90 95 Ala Asp Ala Phe Tyr Arg Phe Ser Arg Pro His Thr Ile Ile Gly Thr 100 105 110 Ala Leu Ser Ile Val Ser Val Ser Leu Leu Ala Val Glu Lys Leu Pro 115 120 125 Glu Leu Asn Ser Met Phe Phe Thr Gly Leu Leu Glu Val Ile Leu Ala 130 135 140 Ala Leu Phe Met Asn Ile Tyr Ile Val Gly Leu Asn Gln Leu Ser Asp 145 150 155 160 Ile Asp Ile Asp Lys Val Asn Lys Pro Tyr Leu Pro Leu Ala Ser Gly 165 170 175 Glu Phe Ser Val Gly Thr Gly Val Thr Ile Val Thr Ser Phe Leu Ile 180 185 190 Met Ser Phe Trp Leu Gly Trp Val Val Gly Ser Trp Pro Leu Phe Trp 195 200 205 Ala Leu Phe Ile Ser Phe Val Leu Gly Thr Ala Tyr Ser Ile Asp Met 210 215 220 Pro Met Leu Arg Trp Lys Arg Ser Ala Val Val Ala Ala Leu Cys Ile 225 230 235 240 Leu Ala Val Arg Ala Val Ile Val Gln Ile Ala Phe Phe Leu His Met 245 250 255 Gln Met His Val Tyr Gly Arg Ala Ala Ala Leu Ser Arg Pro Val Ile 260 265 270 Phe Ala Thr Gly Phe Met Ser Phe Phe Ser Ile Val Ile Ala Leu Phe 275 280 285 Lys Asp Ile Pro Asp Ile Glu Gly Asp Lys Ile Phe Gly Ile Arg Ser 290 295 300 Phe Thr Val Arg Leu Gly Gln Glu Arg Val Phe Trp Ile Cys Ile Ser 305 310 315 320 Leu Leu Glu Met Ala Tyr Ala Val Ala Ile Leu Val Gly Ser Thr Ser 325 330 335 Pro Tyr Leu Trp Ser Lys Val Ile Thr Val Ser Gly His Val Val Leu 340 345 350 Ala Ser Ile Leu Trp Gly Arg Ala Lys Ser Ile Asp Phe Lys Ser Lys 355 360 365 Ala Ala Leu Thr Ser Phe Tyr Met Phe Ile Trp Lys Leu Phe Tyr Ala 370 375 380 Glu Tyr Leu Leu Ile Pro Leu Val Arg 385 390 12 14 PRT artificial sequence Conserved Motif MISC_FEATURE (3)..(3) x = w or y MISC_FEATURE (4)..(4) x = k or r MISC_FEATURE (11)..(11) x = i or v 12 Ala Phe Xaa Xaa Phe Ser Arg Pro His Thr Xaa Ile Gly Thr 1 5 10 13 26 PRT artificial sequence Conserved Motif MISC_FEATURE (2)..(2) x = v or i MISC_FEATURE (11)..(11) x = e, w, f, or s MISC_FEATURE (13)..(13) x = v or i MISC_FEATURE (14)..(14) x = d or e MISC_FEATURE (17)..(17) x = k or r MISC_FEATURE (18)..(18) x = i or v MISC_FEATURE (22)..(22) x = h, n, t or y 13 Asn Xaa Tyr Ile Val Gly Leu Asn Gln Leu Xaa Asp Xaa Xaa Ile Asp 1 5 10 15 Xaa Xaa Asn Lys Pro Xaa Leu Pro Leu Ala 20 25 14 16 PRT artificial sequence Conserved Motif MISC_FEATURE (3)..(3) x = i or l MISC_FEATURE (7)..(7) x = i or v MISC_FEATURE (10)..(10) x = i or m MISC_FEATURE (14)..(14) x = r or k MISC_FEATURE (15)..(15) x = l, q, i, or v MISC_FEATURE (16)..(16) x = y or f 14 Ile Ala Xaa Phe Lys Asp Xaa Pro Asp Xaa Glu Gly Asp Xaa Xaa Xaa 1 5 10 15 15 17 PRT artificial sequence Conserved Motif MISC_FEATURE (1)..(1) x = f or c MISC_FEATURE (3)..(3) x = q or m MISC_FEATURE (10)..(10) x = f or y MISC_FEATURE (11)..(11) x = i, l, or a MISC_FEATURE (15)..(15) x = i, m, or l MISC_FEATURE (16)..(16) x = f, y, i, or l 15 Xaa Tyr Xaa Phe Ile Trp Lys Leu Phe Xaa Xaa Glu Tyr Leu Xaa Xaa 1 5 10 15 Pro 16 56 DNA artificial sequence Synthetic Primer Sequence 16 cgcgatttaa atggcgcgcc ctgcaggcgg ccgcctgcag ggcgcgccat ttaaat 56 17 32 DNA artificial sequence Synthetic Primer Sequence 17 tcgaggatcc gcggccgcaa gcttcctgca gg 32 18 32 DNA artificial sequence Synthetic Primer Sequence 18 tcgacctgca ggaagcttgc ggccgcggat cc 32 19 32 DNA artificial sequence Synthetic Primer Sequence 19 tcgacctgca ggaagcttgc ggccgcggat cc 32 20 32 DNA artificial sequence Synthetic Primer Sequence 20 tcgaggatcc gcggccgcaa gcttcctgca gg 32 21 36 DNA artificial sequence Synthetic Primer Sequence 21 tcgaggatcc gcggccgcaa gcttcctgca ggagct 36 22 28 DNA artificial sequence Synthetic Primer Sequence 22 cctgcaggaa gcttgcggcc gcggatcc 28 23 36 DNA artificial sequence Synthetic Primer Sequence 23 tcgacctgca ggaagcttgc ggccgcggat ccagct 36 24 28 DNA artificial sequence Synthetic Primer Sequence 24 ggatccgcgg ccgcaagctt cctgcagg 28 25 39 DNA artificial sequence Synthetic Primer Sequence 25 gatcacctgc aggaagcttg cggccgcgga tccaatgca 39 26 31 DNA artificial sequence Synthetic Primer Sequence 26 ttggatccgc ggccgcaagc ttcctgcagg t 31 27 969 DNA Nostoc punctiforme 27 atgagccaga gttctcaaaa cagccctttg ccacgcaaac ctgttcaatc atatttccat 60 tggttatacg ctttctggaa attctctcgc cctcacacga ttattggtac aagtctgagt 120 gtgttgagtt tgtatttaat tgctattgcc attagtaata ataccgcttc tttattcact 180 actcccggct ccctaagccc tctcttcggc gcatggattg cttgtctatg tggcaatgtt 240 tacattgtag ggctgaatca attagaagat gttgatattg acaagattaa taaacctcat 300 ttaccgttgg catcaggtga gttttctcaa cagacgggac aattaattgt tgcatctact 360 gggattttgg cactagttat ggcgtggcta actgggccat tcttgtttgg catggtaaca 420 attagtttgg ccattggtac tgcttattct ttaccgccaa ttcgcttaaa acagtttccc 480 ttttgggcag cgctgtgtat tttttcggta cgcggcacga ttgttaattt aggattgtat 540 ttgcactata gttgggcgct gaaacaaagc caaacaattc cgcctgtggt gtgggtgctg 600 acattgttta ttttggtgtt tacctttgcg atcgcaatct ttaaagatat cccagatata 660 gaaggcgatc gcctctacaa tattactact ttcacgatta aactagggtc ccaagctgtg 720 tttaatctag ctctttgggt gataactgtc tgttatctag ggataattct ggtaggagtg 780 ctacgcatcg cttcagttaa ccccattttt ctgataactg ctcatttggc gctgttggtt 840 tggatgtggt ggcggagttt ggcggtagac ttacaagata aaagtgcgat cgctcaattc 900 taccaattta tctggaaact cttttttata gaatatctaa tttttcctat cgcctgcttt 960 ttggcttag 969 28 957 DNA Anabaena sp. 28 atgaaccaaa gttcccaaga cagaccgttg cgacctaaac cattgcaatc atcttttcag 60 tggctttatg ctttttggaa attttcccgc ccacacacaa ttattggcac aagtctcagt 120 gttttgggct tatatttaat ttctatcgcc gtcagttcca ccggttttgc cctgacgcag 180 ataaactccg ttttaggagc atggctggcc tgtctctgtg gcaatgttta tattgtgggg 240 ttaaatcaat tagaagatat tgaaattgat aaagttaata aacctcattt acctctagct 300 tcgggagaat ttagccgcaa acaaggacgg ataattgtaa ttctcacggg aattaccgcc 360 atagtattag cttggttaaa tggcccttat ttatttggta tggtggcggt gagtttagcc 420 attggtactg cctattcttt accaccaatt cgtttaaaac agtttccctt ttgggcggcc 480 ttgtgtattt tttcagtaag gggaacgatt gttaatttag gattatatct gcacttcagt 540 tggctactac agaataaaca gtcaattcct ctacctgtat ggatattaac ggtatttatt 600 ttaatattta cctttgcgat cgccatcttt aaagatatcc ctgatatgga aggcgatcgc 660 ctctacaata ttaccactct caccatccaa ctagggccac aagctgtctt taatttggca 720 atgtgggtat taacggtttg ctacttgggt atggtgataa ttggtgtgct gcggctaggt 780 acaattaact cagtgtttct ggtcgtgact catttagtaa ttctctgttg gatgtggatg 840 cagagtttag ccgtagacat acatgacaaa acggcgatcg ctcaattcta tcaatttatt 900 tggaagctct ttttcctaga atatttaatg tttcccattg cctgtctttt agcttaa 957 29 927 DNA Synechocystis sp. 29 atggcaacta tccaagcttt ttggcgcttc tcccgccccc ataccatcat tggtacaact 60 ctgagcgtct gggctgtgta tctgttaact attctcgggg atggaaactc agttaactcc 120 cctgcttccc tggatttagt gttcggcgct tggctggcct gcctgttggg taatgtgtac 180 attgtcggcc tcaaccaatt

gtgggatgtg gacattgacc gcatcaataa gccgaatttg 240 cccctagcta acggagattt ttctatcgcc cagggccgtt ggattgtggg actttgtggc 300 gttgcttcct tggcgatcgc ctggggatta gggctatggc tggggctaac ggtgggcatt 360 agtttgatta ttggcacggc ctattcggtg ccgccagtga ggttaaagcg cttttccctg 420 ctggcggccc tgtgtattct gacggtgcgg ggaattgtgg ttaacttggg cttattttta 480 ttttttagaa ttggtttagg ttatcccccc actttaataa cccccatctg ggttttgact 540 ttatttatct tagttttcac cgtggcgatc gccattttta aagatgtgcc agatatggaa 600 ggcgatcggc aatttaagat tcaaacttta actttgcaaa tcggcaaaca aaacgttttt 660 cggggaacct taattttact cactggttgt tatttagcca tggcaatctg gggcttatgg 720 gcggctatgc ctttaaatac tgctttcttg attgtttccc atttgtgctt attagcctta 780 ctctggtggc ggagtcgaga tgtacactta gaaagcaaaa ccgaaattgc tagtttttat 840 cagtttattt ggaagctatt tttcttagag tacttgctgt atcccttggc tctgtggtta 900 cctaattttt ctaatactat tttttag 927 30 1569 DNA Zea mays 30 ccacgcgtcc gcccggccaa gggatggacg cgcttcgcct acggccgtcc ctcctctccg 60 tgcggcccgg cgcggcccgc ccgcgagatc attttctacc accatgttgt tccatacaac 120 gaaatggtga aggacgaatt tgcttttcta gccaaaggac ccaaggtcct accttgcatc 180 accatcagaa attcttcgaa tggaaatcct cctattgtag gatatcacat cgatcattaa 240 atacttctgt taatgcttcg gggcaacagc tgcagtctga acctgaaaca catgattcta 300 caaccatctg gagggcaata tcatcttctc tagatgcatt ttacagattt tcccggccac 360 atactgtcat aggaacagca ttaagcatag tctcagtttc ccttctagct gtccagagct 420 tgtctgatat atcacctttg ttcctcactg gtttgctgga ggcagtggta gctgcccttt 480 tcatgaatat ctatattgtt ggactgaacc agttattcga cattgagata gacaaggtta 540 acaagccaac tcttccattg gcatctgggg aatacacccc tgcaactggg gttgcaatag 600 tttcggtctt tgccgctatg agctttggcc ttggatgggc tgttggatca caacctctgt 660 tttgggctct tttcataagc tttgttcttg ggactgcata ttcaatcaat ctgccgtacc 720 ttcgatggaa gagatttgct gttgttgcag cactgtgcat attagcagtc cgtgcagtga 780 ttgttcagct ggcctttttt ctccacattc agacttttgt tttcaggaga ccggcagtgt 840 tttctaggcc attattattt gcaactggat ttatgacgtt cttctctgtt gtaatagcac 900 tattcaagga tatacctgac atcgaaggag accgcatatt cgggatccga tccttcagcg 960 tccggttagg gcaaaagaag gtcttttgga tctgcgttgg cttgcttgag atggcctaca 1020 gcgttgcgat actgatggga gctacctctt cctgtttgtg gagcaaaaca gcaaccatcg 1080 ctggccattc catacttgcc gcgatcctat ggagctgcgc gcgatcggtg gacctgacga 1140 gcaaagccgc aataacgtcc ttctacatgt tcatctggaa gctgttctac gcggagtacc 1200 tgctcatccc tctggtgcgg tgagcgcgag gcgaggtggt ggcagacgga tcggcgtcgg 1260 cggggcggca aacaactcca cgggagaact tgagtgccgg aagtaaactc ccgtttgaaa 1320 gttgaagcgt gcaccaccgg caccgggcag agagagacac ggtggctgga tggatacgga 1380 tggccccccc aataaattcc cccgtgcatg gtaccccacg ctgcttgatg atatcccatg 1440 tgtccgggtg atcgtctcta gagagattgg ttgcacaacg tccaacatag cccgtaggta 1500 ttgctaccac tgctagtatg atactccttc ctagtccttg ccaaaaaaaa aaaaaaaaaa 1560 aaaaaaaag 1569 31 1236 DNA Glycine max (ppt2) 31 atggattcac tgcttcttcg atctttccct aatattaata acgcctcttc tctcaccacc 60 actggtgcaa atttctccag gactaaatct ttcgccaaca tttaccatgc aagttcttat 120 gtgccaaatg cttcatggca caataggaaa atccaaaaag aatataattt tttgaggttt 180 cggtggccaa gtttgaacca tcattacaaa ggcattgagg gagcgtgtac atgtaaaaaa 240 tgtaatataa aatttgttgt gaaagcgacc tctgaaaaat ctcttgagtc tgaacctcaa 300 gcttttgatc caaaaagcat tttggactct gtcaagaatt ccttggatgc tttctacagg 360 ttttccaggc ctcacacagt tattggcaca gcattaagca taatttctgt gtctcttctt 420 gctgttgaga aaatatcaga tatatctcca ttatttttta ctggtgtgtt ggaggctgtg 480 gttgctgccc tgtttatgaa tatttatatt gttggtttga atcaattgtc tgatgttgaa 540 atagacaaga taaacaagcc gtatcttcca ttagcatctg gggaatattc ctttgaaact 600 ggtgtcacta ttgttgcatc tttttcaatt ctgagttttt ggcttggctg ggttgtaggt 660 tcatggccat tattttgggc cctttttgta agctttgtgc taggaactgc ttattcaatc 720 aatgtgcctc tgttgagatg gaagaggttt gcagtgcttg cagcgatgtg cattctagct 780 gttcgggcag taatagttca acttgcattt ttccttcaca tgcagactca tgtgtacaag 840 aggccacctg tcttttcaag accattgatt tttgctactg cattcatgag cttcttctct 900 gtagttatag cactgtttaa ggatatacct gacattgaag gagataaagt atttggcatc 960 caatcttttt cagtgcgttt aggtcagaag ccggtgttct ggacttgtgt tacccttctt 1020 gaaatagctt atggagtcgc cctcctggtg ggagctgcat ctccttgtct ttggagcaaa 1080 attttcacgg gtctgggaca cgctgtgctg gcttcaattc tctggtttca tgccaaatct 1140 gtagatttga aaagcaaagc ttcgataaca tccttctata tgtttatttg gaagctattt 1200 tatgcagaat acttactcat tccttttgtt agatga 1236 32 1188 DNA Glycine max (ppt1) 32 atggattcga tgcttcttcg atcttttcct aatattaaca acgcttcttc tctcgccacc 60 actggttctt atttgccaaa tgcttcatgg cacaatagga aaatccaaaa agaatataat 120 tttttgaggt ttcggtggcc aagtttgaac caccattaca aaagcattga aggagggtgt 180 acatgtaaaa aatgtaatat aaaatttgtt gtgaaagcga cctctgaaaa atcttttgag 240 tctgaacccc aagcttttga tccaaaaagc attttggact ctgtcaagaa ttccttggat 300 gctttctaca ggttttccag acctcacaca gttattggca cagcattaag cataatttct 360 gtgtccctcc ttgctgttga gaaaatatca gatatatctc cattattttt tactggtgtg 420 ttggaggctg tggttgctgc cctgtttatg aatatttata ttgttggttt gaatcaattg 480 tctgatgttg aaatagacaa gataaacaag ccgtatcttc cattagcatc tggggaatat 540 tcctttgaaa ctggtgtcac tattgttgca tctttttcaa ttctgagttt ttggcttggc 600 tgggttgtag gttcatggcc attattttgg gccctttttg taagctttgt gctaggaact 660 gcttattcaa tcaatgtgcc tctgttgaga tggaagaggt ttgcagtgct tgcagcgatg 720 tgcattctag ctgttcgggc agtaatagtt caacttgcat ttttccttca catccagact 780 catgtataca agaggccacc tgtcttttca agatcattga tttttgctac tgcattcatg 840 agcttcttct ctgtagttat agcactgttt aaggatatac ctgacattga aggagataaa 900 gtatttggca tccaatcttt ttcagtgcgt ttaggtcaga agccggtatt ctggacttgt 960 gttatccttc ttgaaatagc ttatggagtc gccctcctgg tgggagctgc atctccttgt 1020 ctttggagca aaattgtcac gggtctggga cacgctgttc tggcttcaat tctctggttt 1080 catgccaaat ctgtagattt gaaaagcaaa gcttcgataa catccttcta tatgtttatt 1140 tggaagctat tttatgcaga atacttactc attccttttg ttagatga 1188 33 1182 DNA Arabidopsis thaliana 33 atggagtctc tgctctctag ttcttctctt gtttccgctg ctggtgggtt ttgttggaag 60 aagcagaatc taaagctcca ctctttatca gaaatccgag ttctgcgttg tgattcgagt 120 aaagttgtcg caaaaccgaa gtttaggaac aatcttgtta ggcctgatgg tcaaggatct 180 tcattgttgt tgtatccaaa acataagtcg agatttcggg ttaatgccac tgcgggtcag 240 cctgaggctt tcgactcgaa tagcaaacag aagtctttta gagactcgtt agatgcgttt 300 tacaggtttt ctaggcctca tacagttatt ggcacagtgc ttagcatttt atctgtatct 360 ttcttagcag tagagaaggt ttctgatata tctcctttac ttttcactgg catcttggag 420 gctgttgttg cagctctcat gatgaacatt tacatagttg ggctaaatca gttgtctgat 480 gttgaaatag ataaggttaa caagccctat cttccattgg catcaggaga atattctgtt 540 aacaccggca ttgcaatagt agcttccttc tccatcatga gtttctggct tgggtggatt 600 gttggttcat ggccattgtt ctgggctctt tttgtgagtt tcatgctcgg tactgcatac 660 tctatcaatt tgccactttt acggtggaaa agatttgcat tggttgcagc aatgtgtatc 720 ctcgctgtcc gagctattat tgttcaaatc gccttttatc tacatattca gacacatgtg 780 tttggaagac caatcttgtt cactaggcct cttattttcg ccactgcgtt tatgagcttt 840 ttctctgtcg ttattgcatt gtttaaggat atacctgata tcgaagggga taagatattc 900 ggaatccgat cattctctgt aactctgggt cagaaacggg tgttttggac atgtgttaca 960 ctacttcaaa tggcttacgc tgttgcaatt ctagttggag ccacatctcc attcatatgg 1020 agcaaagtca tctcggttgt gggtcatgtt atactcgcaa caactttgtg ggctcgagct 1080 aagtccgttg atctgagtag caaaaccgaa ataacttcat gttatatgtt catatggaag 1140 ctcttttatg cagagtactt gctgttacct tttttgaagt ga 1182 34 1374 DNA Cuphea pulcherrima 34 ccacgcgtcc ggctggtttg tgggttttgc gagcacgagg aaggaaaaaa catgcggatg 60 gagtctctgc ttctgaattc tttctctcca tctccggcgg gaggaaaaat ttgtagggcc 120 gatacttaca agaaggccta cttcgcaact gcgaggtgca acacattgaa cagcctcaac 180 aagaatacag gtgaatatca tctcagcaga acccgacaac ggttcacatt tcaccaaaat 240 ggtcacagaa cttacctagt caaggcagtg tccgggcagt ccctggagtc tgagcccgaa 300 agttacccta acaataggtg ggattatgtc aaaagtgctg ctgatgcctt ctaccggttt 360 tctcgtcccc acacaattat aggcactgcg ttgagcatag tatcggtttc gcttcttgct 420 gtagagaagt tgcctgaatt gaattcaatg tttttcactg gcttattgga ggtgattttg 480 gctgccctct tcatgaatat atatattgtc ggtttgaatc agttgtctga tatagacatt 540 gacaaggtaa acaagccgta tcttcccctg gcatcaggag aattctcggt tggaactggg 600 gttaccattg taacatcctt cttgattatg agcttttggc tggggtgggt tgtcggttca 660 tggcccttgt tttgggccct tttcatcagt tttgtgcttg gaacagcata ctcaatcgat 720 atgccaatgc tcagatggaa gagatctgca gttgtggctg cactgtgcat tctagctgtt 780 cgggccgtga ttgttcagat agcgtttttt ttgcacatgc agatgcatgt gtatggaaga 840 gcagctgcac tttctcggcc tgtaatattt gccacaggct ttatgagctt cttttctatt 900 gttattgcgt tgtttaagga cattcctgac atagaaggtg ataaaatatt tgggatccgg 960 tcattcactg ttcgtctggg ccaagaacgg gttttctgga tatgcatatc acttctcgaa 1020 atggcttatg ctgttgcgat tcttgttggg tcgacgtctc cctatctttg gagcaaagtc 1080 atcacggttt cgggtcatgt tgtgttggcc tccatactat ggggacgagc caagtctatc 1140 gactttaaga gcaaagcagc actaacctcc ttctacatgt ttatttggaa gctattttac 1200 gcagaatact tgcttatacc gcttgtacga tgagctttcg ggatcagaac attacattat 1260 cgtaaactga acaatttaga attgcatatt gttcagatga cagctccatc ttggcaataa 1320 aatttgatat gaatgtctct gatccaaaaa aaaaaaaaaa aaaaaaaaaa aaag 1374 35 1486 DNA Allium porrum 35 gcacgagttt tgaagaatgt taagcatgga ctccctcctt accaagccag ttgtaatacc 60 tctgccttct ccagtttgtt cactaccaat cttgcgaggc agttctgcac cagggcagta 120 ttcatgtaga aactacaatc caataagaat tcaaaggtgc ctcgtaaatt atgaacatgt 180 gaaaccaagg tttacaacat gtagtaggtc tcaaaaactt ggtcatgtaa aagccacatc 240 cgagcattct ttagaatctg gatccgaagg atacactcct agaagcatat gggaagccgt 300 actagcttca ctgaatgttc tatacaaatt ttcacgacct cacacaataa taggaacagc 360 aatgggcata atgtcagttt ctttgcttgt tgtcgagagc ctatccgata tttctcctct 420 gttttttgtg ggattattag aggctgtggt tgctgcattg tttatgaatg tttacattgt 480 aggtctgaat caattatttg acatagaaat agacaaggtc aataaacctg atcttcctct 540 tgcatctgga gaatactcac caagagctgg tactgctatt gtcattgctt cagccatcat 600 gagctttggc attggatggt tagttggctc ttggccatta ttctgggcgc tttttattag 660 tttcgttctt ggcactgcat attcaatcaa tctaccattt ctaagatgga agagatccgc 720 cgttgttgca gcaatatgta tccttgctgt acgagcagtt atagtccagc tcgccttttt 780 cttacacata cagagttttg ttttcaaaag accagcaagt ttcacaaggc cattgatatt 840 tgcaactgcc ttcatgagct tcttctcagt tgttattgct ctatttaagg atatacctga 900 tatagacgga gacaaaatat ttggcatcca ttctttcagc gtgcgccttg gccaggagag 960 ggtgttttgg atatgtatat atctccttga gatggcctac actgttgtca tggttgttgg 1020 agctacttcc tcatgcctat ggagcaaatg cttaacagtg ataggtcatg caattcttgg 1080 gtcgttactt tggaatcgtg ctagatctca tggaccaatg accaaaacca ctattacatc 1140 tttttatatg ttcgtgtgga agctcttcta tgctgagtac ttgctcattc cttttgtaag 1200 atgagggttt atgacctaca tggaaaagaa tcgcaagaga agatgagtag ataatggagg 1260 cagaaatggc tggaattaac aacgctttaa ttgtcatctt aaaaacggag agttctttca 1320 acaattgcag atcatttctc cttaattata ttcatgttgt atgttgtgtt aaagattatc 1380 attgaatgac aatagcctat gttgaattta ggatatccag tggttttctt tgttcttttt 1440 taagaattta ttcacagaaa aatgaagtaa aaaaaaaaaa aaaaaa 1486 36 1670 DNA Triticum sp. 36 ccacgcgtcc ggtcccactg cccgcccccc acccgcgcgc cgccgcggcg atggactcgc 60 tccgcctccg gccgtcctcg ctccgctccg cgcccggcgc cgccgccgcc cgccggcgag 120 atcatattct accatcattt tgttcgatcc aacgaaatgg taaagggcga gttactttgt 180 ccatccaagc atccaaaggc cctaccatta atcactgtaa aaagttcttg gattggaaat 240 attccaacca taggatatca catcaatcaa taaatacttc tgcaaaagct gggcaatcgc 300 tacagcctga aactgaagca cacgatcctg caagcttctg gaagccaata tcatcttctc 360 tggacgcgtt ctacaggttt tctcggccac ataccatcat aggaacagca ctaagcatag 420 tctcagtttc ccttctagct gtcgagagct tatctgatat ttcgcccttg ttcctcactg 480 gtttgctgga ggcagtggtg gctgctcttt ttatgaacat ctatattgtt ggattgaatc 540 agttgttcga cattgaaatt gacaaggtta acaagccaac tcttccacta gcatctgggg 600 aatactctcc tgcaactgga gttgcaatag tgtcagtatt tgcagccatg agctttggcc 660 ttggatgggt tgttggatca ccacctctgt tttgggctct ttttattagc tttgttcttg 720 gaactgctta ttcagtcaat ctgccgtact ttcgatggaa gagatctgct gttgttgcag 780 cactctgcat attagcagtg cgtgcggtga ttgttcaact ggcatttttt ctccacattc 840 agacatttgt tttcagaagg ccggcagtct tttcaaagcc attgatattt gcaactgcct 900 tcatgacatt cttctcagtt gtaatagcat tattcaagga tatacccgat attgaagggg 960 accgcatctt tggaattcaa tcttttagtg ttagattagg tcaaagcaag gttttctgga 1020 cttgtgttgg tctacttgag gttgcctacg gtgttgcgat actgatgggg gtaacttctt 1080 ccagtttgtg gagcaaatct ctaactgttg tgggccatgc aatcctcgcc agcatcttgt 1140 ggagcagcgc acggtccatc gacttgacaa gcaaagctgc gataacatcc ttctacatgc 1200 tcatctggag gctgttctac gcggagtacc tgctcatccc tctggtgaga tgaggaccga 1260 caagcagccc acggaagaac ttcagtgccg gagtacagct gtgcgaatcc atttgaattt 1320 cggatggtca cggaccgcgc ccaataaaac tcccagagcc ttgccccggt acatcgttga 1380 ttttccagcc atgaatggtg agatcaccac ctaaagatgg ataacctccc catgtaccca 1440 agctgggcca ggtgagctgt agtttagttg atgctagcga gcaacaactc ctgcagcagg 1500 cacgcggctg cctggaaaat aaggctcccc actcccaatt acattctgtt gtacggtttt 1560 agtacttgtg aattttgctc tggtccgttg ttgtctagga tgtttggaac attgcgcaga 1620 ctttcttata tcttaccggg aggggtgaat tggcaaaaaa aaaaaaaaag 1670 37 41 DNA artificial sequence Primer Sequence 37 ggatccgcgg ccgcacaatg gagtctctgc tctctagttc t 41 38 38 DNA artificial sequence Primer Sequence 38 ggatcctgca ggtcacttca aaaaaggtaa cagcaagt 38 39 14 PRT artificial sequence Conserved Motif MISC_FEATURE (1)..(1) x = a or v MISC_FEATURE (2)..(2) x = f or l MISC_FEATURE (3)..(3) x = w or y MISC_FEATURE (4)..(4) x = k or r MISC_FEATURE (11)..(11) x = i or v 39 Xaa Xaa Xaa Xaa Phe Ser Arg Pro His Thr Xaa Ile Gly Thr 1 5 10 40 26 PRT artificial sequence Conserved Motif MISC_FEATURE (2)..(2) x = i or l MISC_FEATURE (11)..(11) x = w, e, s, or f MISC_FEATURE (13)..(13) x = v or i MISC_FEATURE (14)..(14) x = d or e MISC_FEATURE (17)..(17) x = r or k MISC_FEATURE (18)..(18) x = i or v MISC_FEATURE (23)..(23) x = n, h, y, t, or d 40 Asn Xaa Tyr Ile Val Gly Leu Asn Gln Leu Xaa Asp Xaa Xaa Ile Asp 1 5 10 15 Xaa Xaa Asn Lys Pro Xaa Leu Pro Leu Ala 20 25 41 16 PRT artificial sequence Conserved Motif MISC_FEATURE (3)..(3) x = i or l MISC_FEATURE (7)..(7) x = v or i MISC_FEATURE (10)..(10) x = m or i MISC_FEATURE (11)..(11) x = e or d MISC_FEATURE (14)..(14) x = r or k MISC_FEATURE (15)..(15) x = i, v, l, or q MISC_FEATURE (16)..(16) x = y or f 41 Ile Ala Xaa Phe Lys Asp Xaa Pro Asp Xaa Xaa Gly Asp Xaa Xaa Xaa 1 5 10 15 42 17 PRT artificial sequence Conserved Motif MISC_FEATURE (1)..(1) x = f or c MISC_FEATURE (3)..(3) x = m or q MISC_FEATURE (4)..(4) x = f or l MISC_FEATURE (5)..(5) x = i or v MISC_FEATURE (7)..(7) x = k or r MISC_FEATURE (10)..(10) x = f or y MISC_FEATURE (11)..(11) x = l, i or a MISC_FEATURE (15)..(15) x = l, m, or i MISC_FEATURE (16)..(16) x = f, y, l, or i 42 Xaa Tyr Xaa Xaa Xaa Trp Xaa Leu Phe Xaa Xaa Glu Tyr Leu Xaa Xaa 1 5 10 15 Pro 43 349 PRT Trichodesmium erythraeum 43 Met Gly Lys Ile Ala Gly Ser Gln Gln Gly Lys Ile Thr Thr Asn Trp 1 5 10 15 Leu Gln Lys Tyr Val Pro Trp Leu Tyr Ser Phe Trp Lys Phe Ala Arg 20 25 30 Pro His Thr Ile Ile Gly Thr Ser Leu Ser Val Leu Ala Leu Tyr Ile 35 40 45 Ile Ala Met Gly Asp Arg Ser Asn Phe Phe Asp Lys Tyr Phe Phe Leu 50 55 60 Tyr Ser Leu Ile Leu Leu Leu Ile Thr Trp Ile Ser Cys Leu Cys Gly 65 70 75 80 Asn Ile Tyr Ile Val Gly Leu Asn Gln Leu Glu Asp Ile Glu Ile Asp 85 90 95 Arg Ile Asn Lys Pro His Leu Pro Ile Ala Ala Gly Glu Phe Ser Arg 100 105 110 Phe Ser Gly Gln Ile Ile Val Val Ile Thr Gly Ile Leu Ala Leu Ser 115 120 125 Phe Ala Gly Leu Gly Gly Pro Phe Leu Leu Gly Thr Val Gly Ile Ser 130 135 140 Leu Ala Ile Gly Thr Ala Tyr Ser Leu Pro Pro Ile Arg Leu Lys Arg 145 150 155 160 Phe Pro Val Leu Ala Ala Leu Cys Ile Phe Thr Val Arg Gly Val Ile 165 170 175 Val Asn Leu Gly Ile Phe Leu Ser Phe Val Trp Gly Phe Glu Lys Val 180 185 190 Glu Glu Val Ser Gly Gly Leu Ile Lys Trp Met Gly Glu Leu Gly Glu 195 200 205 Val Val Leu Leu Gln Lys Ser Leu Met Val Pro Glu Ile Pro Leu Thr 210 215 220 Val Trp Ala Leu Thr Leu Phe Val Ile Val Phe Thr Phe Ala Ile Ala 225 230 235 240 Ile Phe Lys Asp Ile Pro Asp Ile Glu Gly Asp Arg Gln Tyr Asn Ile 245 250 255 Asn Thr Phe Thr Ile Lys Leu Gly Ala Phe Ala Val Phe Asn Leu Ala 260 265 270 Arg Trp Val Leu Thr Phe Cys Tyr Leu Gly Met Val Met Val Gly Val 275 280 285 Val Trp Leu Ala Ser Val Asn Leu Phe Phe Leu Val Ile Ser His Leu 290 295 300 Leu Ala Leu Gly Ile Met Trp Trp Phe Ser Gln Arg Val Asp Leu His 305 310 315 320 Asp Lys Lys Ala Ile Ala Asp Phe Tyr Gln Phe Ile Trp Lys Leu Phe 325 330 335 Phe Leu Glu Tyr Leu Ile Phe Pro Met Ala Cys Phe Phe 340 345 44 300 PRT Chloroflexus aurantiacus 44 Met Arg Lys Gln Leu Arg Leu Leu Ile Glu Phe Ala Arg Pro His Thr 1 5 10 15 Val Ile Ala Thr Ser Val Gln Val Leu Thr Met Leu Ile Ile Val Ile 20 25 30 Gly Trp His Pro Pro Thr Leu Glu Leu Val Gly Leu Val Gly Val Thr 35 40 45 Leu Val Val Cys Leu Ala Leu Asn Leu Tyr Val Val Gly Val Asn Gln 50 55

60 Leu Thr Asp Val Ala Ile Asp Arg Ile Asn Lys Pro Trp Leu Pro Val 65 70 75 80 Ala Ala Gly Gln Leu Ser Ser Asp Ala Ala Gln Arg Ile Val Ile Ser 85 90 95 Ala Leu Phe Ile Ala Leu Thr Gly Ala Ala Met Leu Gly Pro Pro Leu 100 105 110 Trp Trp Thr Val Ser Ile Ile Ala Leu Ile Gly Ser Leu Tyr Ser Leu 115 120 125 Pro Pro Leu Arg Leu Lys Arg His Pro Leu Ala Ala Ala Leu Ser Ile 130 135 140 Ala Gly Ala Arg Gly Val Ile Ala Asn Leu Gly Leu Ala Phe His Tyr 145 150 155 160 Gln Tyr Trp Leu Asp Ser Glu Leu Pro Ile Thr Thr Leu Ile Leu Val 165 170 175 Ala Thr Phe Phe Phe Gly Phe Ala Met Val Ile Ala Leu Tyr Lys Asp 180 185 190 Leu Pro Asp Asp Arg Gly Asp Arg Leu Tyr Gln Ile Glu Thr Leu Thr 195 200 205 Thr Arg Leu Gly Pro Gln Arg Val Leu His Leu Gly Arg Ile Leu Leu 210 215 220 Thr Ala Cys Tyr Leu Leu Pro Ile Ala Val Gly Leu Trp Ser Leu Pro 225 230 235 240 Thr Phe Ala Ala Ala Phe Leu Ala Leu Ser His Val Val Val Ile Ser 245 250 255 Val Phe Trp Leu Val Ser Met Arg Val Asp Leu Gln Arg Arg Gln Ser 260 265 270 Ile Ala Ser Phe Tyr Met Phe Leu Trp Gly Ile Phe Tyr Thr Glu Phe 275 280 285 Ala Leu Leu Ser Ile Tyr Arg Leu Thr Tyr Thr Leu 290 295 300 45 402 PRT Arabidopsis thaliana 45 Met Glu Leu Ser Ile Ser Gln Ser Pro Arg Val Arg Phe Ser Ser Leu 1 5 10 15 Ala Pro Arg Phe Leu Ala Ala Ser His His His Arg Pro Ser Val His 20 25 30 Leu Ala Gly Lys Phe Ile Ser Leu Pro Arg Asp Val Arg Phe Thr Ser 35 40 45 Leu Ser Thr Ser Arg Met Arg Ser Lys Phe Val Ser Thr Asn Tyr Arg 50 55 60 Lys Ile Ser Ile Arg Ser Val Cys Ala Phe Cys Asn Gly Thr His Lys 65 70 75 80 Ser Arg Tyr Tyr Gln Ala Cys Ser Gln Val Gly Ala Ala Glu Ser Asp 85 90 95 Asp Pro Val Leu Asp Arg Ile Ala Arg Phe Gln Asn Ala Cys Trp Arg 100 105 110 Phe Leu Arg Pro His Thr Ile Arg Gly Thr Ala Leu Gly Ser Thr Ala 115 120 125 Leu Val Thr Arg Ala Leu Ile Glu Asn Thr His Leu Ile Lys Trp Ser 130 135 140 Leu Val Leu Lys Ala Leu Ser Gly Leu Leu Ala Leu Ile Cys Gly Asn 145 150 155 160 Gly Tyr Ile Val Gly Ile Asn Gln Ile Tyr Asp Ile Gly Ile Asp Lys 165 170 175 Val Asn Lys Pro Tyr Leu Pro Ile Ala Ala Gly Asp Leu Ser Val Gln 180 185 190 Ser Ala Trp Leu Leu Val Ile Phe Phe Ala Ile Ala Gly Leu Leu Val 195 200 205 Val Gly Phe Asn Phe Gly Pro Phe Ile Thr Ser Leu Tyr Ser Leu Gly 210 215 220 Leu Phe Leu Gly Thr Ile Tyr Ser Val Pro Pro Leu Arg Met Lys Arg 225 230 235 240 Phe Pro Val Ala Ala Phe Leu Ile Ile Ala Thr Val Arg Gly Phe Leu 245 250 255 Leu Asn Phe Gly Val Tyr His Ala Thr Arg Ala Ala Leu Gly Leu Pro 260 265 270 Phe Gln Trp Ser Ala Pro Val Ala Phe Ile Thr Ser Phe Val Thr Leu 275 280 285 Phe Ala Leu Val Ile Ala Ile Thr Lys Asp Leu Pro Asp Val Glu Gly 290 295 300 Asp Arg Lys Phe Gln Ile Ser Thr Leu Ala Thr Lys Leu Gly Val Arg 305 310 315 320 Asn Ile Ala Phe Leu Gly Ser Gly Leu Leu Leu Val Asn Tyr Val Ser 325 330 335 Ala Ile Ser Leu Ala Phe Tyr Met Pro Gln Val Phe Arg Gly Ser Leu 340 345 350 Met Ile Pro Ala His Val Ile Leu Ala Ser Gly Leu Ile Phe Gln Thr 355 360 365 Trp Val Leu Glu Lys Ala Asn Tyr Thr Lys Glu Ala Ile Ser Gly Tyr 370 375 380 Tyr Arg Phe Ile Trp Asn Leu Phe Tyr Ala Glu Tyr Leu Leu Phe Pro 385 390 395 400 Phe Leu 46 12 PRT Artificial Conserved Motif MISC_FEATURE (1)..(1) x = w or y MISC_FEATURE (2)..(2) x = r or k MISC_FEATURE (4)..(4) x = l or s MISC_FEATURE (9)..(9) x = i or v MISC_FEATURE (10)..(10) x = i or r 46 Xaa Xaa Phe Xaa Arg Pro His Thr Xaa Xaa Gly Thr 1 5 10 47 26 PRT Artificial Conserved Motif MISC_FEATURE (2)..(2) x = v, i, or g MISC_FEATURE (7)..(7) x = i or l MISC_FEATURE (10)..(10) x = i or l MISC_FEATURE (11)..(11) x = s, f, y, or e MISC_FEATURE (13)..(13) x = v or i MISC_FEATURE (14)..(14) x = r, s, g, e, or d MISC_FEATURE (17)..(17) x = k or r MISC_FEATURE (18)..(18) x = v or i MISC_FEATURE (22)..(22) x = y, d, t, n, or h MISC_FEATURE (25)..(25) x = i or l 47 Asn Xaa Tyr Ile Val Gly Xaa Asn Gln Xaa Xaa Asp Xaa Xaa Ile Asp 1 5 10 15 Xaa Xaa Asn Lys Pro Xaa Leu Pro Xaa Ala 20 25 48 14 PRT Arabidopsis thaliana MISC_FEATURE (3)..(3) x = l or i MISC_FEATURE (4)..(4) x = f or t MISC_FEATURE (7)..(7) x = l, i, or v MISC_FEATURE (10)..(10) x = i, v, or m MISC_FEATURE (11)..(11) x = e or d 48 Ile Ala Xaa Xaa Lys Asp Xaa Pro Asp Xaa Xaa Gly Asp Arg 1 5 10 49 23 PRT Artificial Conserved Motif MISC_FEATURE (2)..(2) x = d, e, t, a, or s MISC_FEATURE (3)..(3) x = a, e, s, or t MISC_FEATURE (4)..(4) x = i or l MISC_FEATURE (5)..(5) x = s, t, or a MISC_FEATURE (6)..(6) x = q, g, or s MISC_FEATURE (7)..(7) x = f, y, or c MISC_FEATURE (9)..(9) x = q, m, or r MISC_FEATURE (10)..(10) x = f or l MISC_FEATURE (11)..(11) x = i or v MISC_FEATURE (13)..(13) x = n or k MISC_FEATURE (16)..(16) x = y or f MISC_FEATURE (17)..(17) x = a, l, or i MISC_FEATURE (21)..(21) x = f, i, l, or m MISC_FEATURE (22)..(22) x = f, l, i, or y MISC_FEATURE (20)..(20) x = a, i, or l 49 Lys Xaa Xaa Xaa Xaa Xaa Xaa Tyr Xaa Xaa Xaa Trp Xaa Leu Phe Xaa 1 5 10 15 Xaa Glu Tyr Xaa Xaa Xaa Pro 20 50 22 DNA Artificial Primer 50 gtggctcggc ttcacttttt ac 22 51 20 DNA Artificial Primer 51 ccacactcat atcaccgtgg 20 52 27 DNA Artificial Primer 52 cagtgctgga tagaattgcc cggttcc 27 53 26 DNA Artificial Primer 53 gagatctatc agtgcagtct gcttgg 26 54 23 DNA Artificial Primer 54 gggacaagca tttttattgc aag 23 55 24 DNA Artificial Primer 55 gccaagatca catgtgcagg aatc 24 56 24 DNA Artificial Primer 56 gccaagatca catgtgcagg aatc 24 57 386 PRT Arabidopsis thaliana 57 Met Glu Leu Ser Ile Ser Gln Ser Pro Arg Val Arg Phe Ser Ser Leu 1 5 10 15 Ala Pro Arg Phe Leu Ala Ala Ser His His His Arg Pro Ser Val His 20 25 30 Leu Ala Gly Lys Phe Ile Ser Leu Pro Arg Asp Val Arg Phe Thr Ser 35 40 45 Leu Ser Thr Ser Arg Met Arg Ser Lys Phe Val Ser Thr Asn Tyr Arg 50 55 60 Lys Ile Ser Ile Arg Ala Cys Ser Gln Val Gly Ala Ala Glu Ser Asp 65 70 75 80 Asp Pro Val Leu Asp Arg Ile Ala Arg Phe Gln Asn Ala Cys Trp Arg 85 90 95 Phe Leu Arg Pro His Thr Ile Arg Gly Thr Ala Leu Gly Ser Thr Ala 100 105 110 Leu Val Thr Arg Ala Leu Ile Glu Asn Thr His Leu Ile Lys Trp Ser 115 120 125 Leu Val Leu Lys Ala Leu Ser Gly Leu Leu Ala Leu Ile Cys Gly Asn 130 135 140 Gly Tyr Ile Val Gly Ile Asn Gln Ile Tyr Asp Ile Gly Ile Asp Lys 145 150 155 160 Val Asn Lys Pro Tyr Leu Pro Ile Ala Ala Gly Asp Leu Ser Val Gln 165 170 175 Ser Ala Trp Leu Leu Val Ile Phe Phe Ala Ile Ala Gly Leu Leu Val 180 185 190 Val Gly Phe Asn Phe Gly Pro Phe Ile Thr Ser Leu Tyr Ser Leu Gly 195 200 205 Leu Phe Leu Gly Thr Ile Tyr Ser Val Pro Pro Leu Arg Met Lys Arg 210 215 220 Phe Pro Val Ala Ala Phe Leu Ile Ile Ala Thr Val Arg Gly Phe Leu 225 230 235 240 Leu Asn Phe Gly Val Tyr His Ala Thr Arg Ala Ala Leu Gly Leu Pro 245 250 255 Phe Gln Trp Ser Ala Pro Val Ala Phe Ile Thr Ser Phe Val Thr Leu 260 265 270 Phe Ala Leu Val Ile Ala Ile Thr Lys Asp Leu Pro Asp Val Glu Gly 275 280 285 Asp Arg Lys Phe Gln Ile Ser Thr Leu Ala Thr Lys Leu Gly Val Arg 290 295 300 Asn Ile Ala Phe Leu Gly Ser Gly Leu Leu Leu Val Asn Tyr Val Ser 305 310 315 320 Ala Ile Ser Leu Ala Phe Tyr Met Pro Gln Val Phe Arg Gly Ser Leu 325 330 335 Met Ile Pro Ala His Val Ile Leu Ala Ser Gly Leu Ile Phe Gln Thr 340 345 350 Trp Val Leu Glu Lys Ala Asn Tyr Thr Lys Glu Ala Ile Ser Gly Tyr 355 360 365 Tyr Arg Phe Ile Trp Asn Leu Phe Tyr Ala Glu Tyr Leu Leu Phe Pro 370 375 380 Phe Leu 385 58 379 PRT Oryza sativa 58 Met Ala Ser Leu Ala Ser Pro Pro Leu Pro Cys Arg Ala Ala Ala Thr 1 5 10 15 Ala Ser Arg Ser Gly Arg Pro Ala Pro Arg Leu Leu Gly Pro Pro Pro 20 25 30 Pro Pro Ala Ser Pro Leu Leu Ser Ser Ala Ser Ala Arg Phe Pro Arg 35 40 45 Ala Pro Cys Asn Ala Ala Arg Trp Ser Arg Arg Asp Ala Val Arg Val 50 55 60 Cys Ser Gln Ala Gly Ala Ala Gly Pro Ala Pro Leu Ser Lys Thr Leu 65 70 75 80 Ser Asp Leu Lys Asp Ser Cys Trp Arg Phe Leu Arg Pro His Thr Ile 85 90 95 Arg Gly Thr Ala Leu Gly Ser Ile Ala Leu Val Ala Arg Ala Leu Ile 100 105 110 Glu Asn Pro Gln Leu Ile Asn Trp Trp Leu Val Phe Lys Ala Phe Tyr 115 120 125 Gly Leu Val Ala Leu Ile Cys Gly Asn Gly Tyr Ile Val Gly Ile Asn 130 135 140 Gln Ile Tyr Asp Ile Arg Ile Asp Lys Val Asn Lys Pro Tyr Leu Pro 145 150 155 160 Ile Ala Ala Gly Asp Leu Ser Val Gln Thr Ala Trp Leu Leu Val Val 165 170 175 Leu Phe Ala Ala Ala Gly Phe Ser Ile Val Val Thr Asn Phe Ile Leu 180 185 190 Phe Ile Thr Ser Leu Tyr Cys Leu Ala Leu Phe Leu Gly Thr Ile Tyr 195 200 205 Ser Val Pro Pro Phe Arg Leu Lys Arg Tyr Arg Ala Pro Ala Cys Leu 210 215 220 Ile Ile Ala Thr Val Arg Gly Phe Leu Arg Asn Leu Gly Val Tyr Tyr 225 230 235 240 Ala Thr Arg Ala Ala Leu Gly Leu Thr Phe Gln Trp Ser Ser Pro Val 245 250 255 Ala Phe Ile Thr Cys Phe Val Thr Leu Phe Ala Leu Val Ile Ala Ile 260 265 270 Thr Lys Asp Leu Pro Asp Val Glu Gly Asp Arg Lys Tyr Gln Ile Ser 275 280 285 Thr Leu Ala Thr Lys Leu Gly Val Arg Asn Ile Ala Phe Leu Gly Ser 290 295 300 Gly Leu Leu Ile Ala Asn Tyr Val Ala Ala Ile Ala Val Ala Phe Leu 305 310 315 320 Met Pro Gln Ala Phe Arg Arg Thr Val Met Val Pro Val His Ala Ala 325 330 335 Leu Ala Val Gly Ile Ile Phe Gln Thr Trp Val Leu Glu Gln Ala Lys 340 345 350 Tyr Thr Lys Asp Ala Ile Ser Gln Tyr Tyr Arg Phe Ile Trp Asn Leu 355 360 365 Phe Tyr Ala Glu Tyr Ile Phe Phe Pro Leu Ile 370 375 59 1423 DNA Arabidopsis thaliana 59 ctctcactac agaacataca caagtataat tcgtcgatcg acccacgcgt ccggcagagc 60 aaagagtttt tgtgtggcta gtggcatcaa tggagctctc gatctcacaa tcaccgcgtg 120 ttcggttctc gtctctggcg cctcgtttct tagcagcttc tcatcatcat cgtccttctg 180 tgcatttagc tgggaagttt ataagcctcc ctcgagatgt tcgcttcacg agcttatcaa 240 cttcaagaat gcggtccaaa tttgtttcaa ccaattatag aaaaatctca atccgggcat 300 gttctcaggt tggtgctgct gagtctgatg atccagtgct ggatagaatt gcccggttcc 360 aaaatgcttg ctggagattt cttagacccc atacaatccg cggaacagct ttaggatcca 420 ctgccttggt gacaagagct ttgatagaga acactcattt gatcaaatgg agtcttgtac 480 taaaggcact ttcaggtctt cttgctctta tttgtgggaa tggttatata gtcggcatca 540 atcagatcta cgacattgga atcgacaaag tgaacaaacc atacttgcca atagcagcag 600 gagatctatc agtgcagtct gcttggttgt tagtgatatt ttttgcgata gcagggcttt 660 tagttgtcgg atttaacttt ggtccattca ttacaagcct atactctctt ggcctttttc 720 tgggaaccat ctattctgtt ccacccctca gaatgaaaag attcccagtt gcagcatttc 780 ttattattgc cacggtacga ggtttccttc ttaactttgg tgtgtaccat gctacaagag 840 ctgctcttgg acttccattt cagtggagtg cacctgtggc gttcatcaca tcttttgtga 900 cactgtttgc actggtcatt gctattacaa aggaccttcc tgatgttgaa ggagatcgaa 960 agttccaaat atcaaccctg gcaacaaaac ttggagtgag aaacattgca ttcctcggtt 1020 ctggacttct gctagtaaat tatgtttcag ccatatcact agctttctac atgcctcagg 1080 tttttagagg tagcttgatg attcctgcac atgtgatctt ggcttcaggc ttaattttcc 1140 agacatgggt actagaaaaa gcaaactaca ccaaggaagc tatctcagga tattatcggt 1200 ttatatggaa tctcttctac gcagagtatc tgttattccc cttcctctag ctttcaattt 1260 catggtgagg atatgcagtt ttctttgtat atcattcttc ttcttctttg tagcttggag 1320 tcaaaatcgg ttccttcatg tacatacatc aaggatatgt ccttctgaat ttttatatct 1380 tgcaataaaa atgcttgtcc caaaaaaaaa aaaaaaaaaa aaa 1423 60 1841 DNA Oryza sativa 60 ctcaccgaca ccatccgtag gtcttccagg agctccttcc tgccacgtca tcaatggcga 60 tgatgggtgg ctgacagtca aacgctcccc acgcctcctc cccttccccc ctctctccct 120 ccatggcttc cctcgcctcc cctcctctcc cctgccgcgc cgccgccacc gccagccgca 180 gcgggcgtcc tgctccgcgc ctcctcggcc ctccgccgcc gcccgcttcc cctctcctct 240 cctccgcttc ggcgcgcttc ccgcgtgccc cctgcaacgc cgcacgctgg agccggcgcg 300 acgccgtgcg ggtttgctct caagctggtg cagctggacc agccccatta tcgaagacat 360 tgtcagacct caaggattcc tgctggagat ttttacggcc acatacaatt cgaggaactg 420 ccttgggatc catagcatta gttgctagag ctttgataga gaacccccaa ctgataaatt 480 ggtggttggt attcaaagcg ttctatgggc tcgtggcgtt aatctgtggc aatggttaca 540 tcgttgggat caatcagatc tatgacatta gaatcgataa ggtaaacaag ccatatttac 600 caattgctgc cggtgatctc tcagttcaga cagcatggtt attggtggta ttatttgcag 660 ctgcgggatt ttcaattgtt gtgacaaact ttatactttt cattacctct ctatactgcc 720 ttgctctatt tcttggcacc atatactctg ttcctccatt cagacttaag agatatcgtg 780 cgcctgcatg ccttatcatt gcaacggtcc gcggttttct ccgcaacttg ggtgtgtact 840 atgctactag agcagcactg ggtcttacat tccaatggag ctcgcctgtt gctttcatta 900 catgcttcgt gactttattt gctttggtca ttgctataac caaagatctc ccagatgttg 960 aaggggatcg gaagtatcaa atatcaactt tggcgacaaa gctcggtgtc agaaacattg 1020 catttcttgg ctctggttta ttgatagcaa attatgttgc tgctattgct gtagcttttc 1080 tcatgcctca ggctttcagg cgcactgtaa tggtgcctgt gcatgctgcc cttgccgttg 1140 gtataatttt ccagacatgg gttctggagc aagcaaaata tactaaggat gctatttcac 1200 agtactaccg gttcatttgg aatctcttct atgctgaata catcttcttc ccgttgatat 1260 agagaccaag caatctgata tggtctgcat gttgagtgcg gcaaaaacta gaagcccata 1320 tgaacagtgg gagtaaggga acgaacatgc catccatggg aagactctga taactctctc 1380 tcgcccgggc tgtaaagggt aagcactgtt gtgcatatat atgaaaggaa ggtgataaag 1440 cagggatgct aaattgctac tgggatcctc aaaggcttat agtggtcatc agtggaatgt 1500 gccttaataa tttggttacc tagcagagca agtttttgca ggttattagg taatatcttt 1560 gagggaatga acttagattt cattgtttta aggtctggtc acacaacggg tagtagtgct 1620 ggagcggcaa aagacgacct tgttttacac taccaaggga ggttaactct agttttcatg 1680 tgaccactta ccttgagagt tgagaccatg gaatcacttg tcgactcctc ggcttgtata 1740 tttctagtgt cagcatttgc attctcctcc acacttgtac ttgaagagtt gaagacaact 1800 tttttgtttg tgtatttctg gagtgtcagc atttgcattc c 1841 61 970 PRT Arabidopsis thaliana 61 Met Asp Pro Pro Val Ser Asp Leu Glu Ser Ile Glu Asp Gln Lys Glu 1 5 10 15 Gly Gly Pro Ser Phe His Cys Asp Leu Tyr Asp Thr Gln Val Val His 20 25 30 Lys Ile Ala Gln Val Phe Leu Pro Gly Leu Ala Thr Ala Cys Val Asp 35 40 45 Asn Thr Thr Gly Asp Ile Phe Arg Ser Pro Gly Ser Val Ala Ala Asp 50 55 60 Ile Arg Lys Glu Met Ile Glu Tyr Leu Thr Arg Arg Ser Glu Thr Phe 65 70 75 80 Val Ala Glu His Ile Val Leu Gln Gly Gly Ser Glu Ile Glu Ala Ser 85 90 95 His Asp Pro Phe Asp Ile Ile Ser Asp Phe Ile Asp Asp Phe Ala Thr 100 105 110 Ser Lys Arg Asn Leu Phe

Ser Arg Val Ser Gly Trp Met Leu Ser Glu 115 120 125 Arg Arg Glu Asp Asn Ile Asp Asp Phe Ala Gln Glu Met Glu Ile Ser 130 135 140 Gly Phe Trp Leu Thr Asp His Arg Glu Gly Ile Ala Gln Thr Leu Leu 145 150 155 160 Lys Asn Val Asp Phe Lys Ser Ser Ala His Cys Glu Met Lys Phe Gln 165 170 175 Thr Glu Gly Glu Leu Ala Glu His Ala Met Asn Cys Gly Tyr Arg Thr 180 185 190 Met Asn Cys Glu Asn Glu Gly Cys Thr Ala Val Phe Cys Ala Asn Gln 195 200 205 Met Glu Asn His Asp Ser Val Cys Pro Phe Lys Ile Ile Pro Cys Glu 210 215 220 Gln Asn Cys Ser Glu Ser Ile Met Arg Arg Asp Met Asp Arg His Cys 225 230 235 240 Ile Thr Val Cys Pro Met Lys Leu Val Asn Cys Pro Phe His Ser Val 245 250 255 Gly Cys Leu Ser Asp Val His Gln Cys Glu Val Gln Gln His His Leu 260 265 270 Asp Asn Val Ser Ser His Leu Met Tyr Ile Leu Arg Ser Ile Tyr Lys 275 280 285 Glu Ala Ser Leu Asp Asp Leu Lys Pro Arg Ala Glu Gln Ile Gln Gln 290 295 300 Leu Ser Thr Arg Leu Ser Glu Ala Arg Asn Ala Arg Ser Leu Thr Asn 305 310 315 320 Leu Val Lys Glu Ile Asp Gly Lys Leu Gly Pro Leu Glu Ile Lys Pro 325 330 335 Lys Ile Val Thr Asp Ser Glu Ser Asp Lys Pro Glu Asn Thr Glu Lys 340 345 350 Lys Ala Leu Glu Glu Ala Glu Ile Lys Glu Lys Pro Glu Thr Ser Asn 355 360 365 Leu Lys Ala Val Thr Leu Glu Gln Thr Ala Arg Glu Ala Pro Glu Asp 370 375 380 Lys Leu Val Ser Lys Glu Val Asp Ala Ala Met Val Lys Glu Ala Ala 385 390 395 400 Lys Lys Val Ser Glu Ala Glu Ile Ala Asp Asn Val Asn Glu Glu Gly 405 410 415 Glu Leu Lys Ala Gln Lys Leu Leu Glu Ile Gly Glu Phe Ile Lys Glu 420 425 430 Gly Asp Asn Asn Ser Ala Asp Asp Leu Ser Glu Arg Thr Glu Thr Lys 435 440 445 Ala Pro Glu Val Val Val Met Asp Glu Ala Arg Glu Glu Glu Asp Ser 450 455 460 Val Glu Thr Lys Asp Thr Arg Thr Tyr Glu Thr Ile Arg Gly Leu Glu 465 470 475 480 Ile Glu Ala Asn Glu Met Ile Asp Glu Glu Thr Lys Lys Ser Thr Glu 485 490 495 Thr Lys Thr Glu Ala Pro Ser Arg Ile Val Met Asp Lys Glu Gly Asp 500 505 510 Glu Glu Thr Lys Lys Ser Thr Glu Thr Glu Thr Glu Ala Pro Ser Arg 515 520 525 Ile Val Met Glu Thr Glu Lys Asp Glu Glu Thr Met Asn Ser Arg Ala 530 535 540 Arg Ala Ser Asp Glu Ala Glu Ala Leu Ser Lys Ser Ser Gln Val Ala 545 550 555 560 Ser Met Glu Leu Ser Ile Ser Gln Ser Pro Arg Val Arg Phe Ser Ser 565 570 575 Leu Ala Pro Arg Phe Leu Ala Ala Ser His His His Arg Pro Ser Val 580 585 590 His Leu Ala Gly Lys Phe Ile Ser Leu Pro Arg Asp Val Arg Phe Thr 595 600 605 Ser Leu Ser Thr Ser Arg Met Arg Ile Leu Ala Val Ala Leu Thr Phe 610 615 620 Lys Ser Arg Cys Val Tyr Val Asn Tyr Glu Ile Pro Lys Asp Gln Ile 625 630 635 640 Leu Val Gly Ala Ala Glu Ser Asp Asp Pro Val Leu Asp Arg Ile Ala 645 650 655 Arg Phe Gln Asn Ala Cys Trp Arg Phe Leu Arg Pro His Thr Ile Arg 660 665 670 Gly Thr Ala Leu Gly Ser Thr Ala Leu Val Thr Arg Ala Leu Ile Glu 675 680 685 Asn Thr His Leu Ile Lys Trp Ser Leu Val Leu Lys Ala Leu Ser Gly 690 695 700 Leu Leu Ala Leu Ile Cys Gly Asn Gly Tyr Ile Val Gly Ile Asn Gln 705 710 715 720 Ile Tyr Asp Ile Gly Ile Asp Lys Val Asn Lys Pro Tyr Leu Pro Ile 725 730 735 Ala Ala Gly Asp Leu Ser Val Gln Ser Ala Trp Leu Leu Val Ile Phe 740 745 750 Phe Ala Ile Ala Gly Leu Leu Val Val Gly Phe Asn Phe Gly Pro Phe 755 760 765 Ile Thr Ser Leu Tyr Ser Leu Gly Leu Phe Leu Gly Thr Ile Tyr Ser 770 775 780 Val Pro Pro Leu Arg Met Lys Arg Phe Pro Val Ala Ala Phe Leu Ile 785 790 795 800 Ile Ala Thr Val Arg Gly Phe Leu Leu Asn Phe Gly Val Tyr His Ala 805 810 815 Thr Arg Ala Ala Leu Gly Leu Pro Phe Gln Trp Ser Ala Pro Val Ala 820 825 830 Phe Ile Thr Ser Phe Val Thr Leu Phe Ala Leu Val Ile Ala Ile Thr 835 840 845 Lys Asp Leu Pro Asp Val Glu Gly Asp Arg Lys Phe Gln Ile Ser Thr 850 855 860 Leu Ala Thr Lys Leu Gly Val Arg Asn Ile Ala Phe Leu Gly Ser Gly 865 870 875 880 Leu Leu Leu Val Asn Tyr Val Ser Ala Ile Ser Leu Ala Phe Tyr Met 885 890 895 Pro Gln Tyr Ala Ala Leu Lys Arg Pro Thr Leu Leu Ser Phe Asn Asn 900 905 910 Glu Gln Val Phe Arg Gly Ser Leu Met Ile Pro Ala His Val Ile Leu 915 920 925 Ala Ser Gly Leu Ile Phe Gln Thr Trp Val Leu Glu Lys Ala Asn Tyr 930 935 940 Thr Lys Glu Ala Ile Ser Gly Tyr Tyr Arg Phe Ile Trp Asn Leu Phe 945 950 955 960 Tyr Ala Glu Tyr Leu Leu Phe Pro Phe Leu 965 970 62 441 PRT Arabidopsis thaliana 62 Met Glu Leu Ser Ile Ser Gln Ser Pro Arg Val Arg Phe Ser Ser Leu 1 5 10 15 Ala Pro Arg Phe Leu Ala Ala Ser His His His Arg Pro Ser Val His 20 25 30 Leu Ala Gly Lys Phe Ile Ser Leu Pro Arg Asp Val Arg Phe Thr Ser 35 40 45 Leu Ser Thr Ser Arg Met Arg Ser Lys Phe Val Ser Thr Asn Tyr Arg 50 55 60 Lys Ile Ser Ile Arg Ser Val Cys Ala Phe Cys Asn Gly Thr His Lys 65 70 75 80 Ser Arg Tyr Tyr Gln Ala Cys Ser Gln Val Gly Ala Ala Glu Ser Asp 85 90 95 Asp Pro Val Leu Asp Arg Ile Ala Arg Phe Gln Asn Ala Cys Trp Arg 100 105 110 Phe Leu Arg Pro His Thr Ile Arg Gly Thr Ala Leu Gly Ser Thr Ala 115 120 125 Leu Val Thr Arg Ala Leu Ile Glu Asn Thr His Leu Ile Lys Trp Ser 130 135 140 Leu Val Leu Lys Ala Leu Ser Gly Leu Leu Ala Leu Ile Cys Gly Asn 145 150 155 160 Gly Tyr Ile Val Gly Ile Asn Gln Ile Tyr Asp Ile Gly Ile Asp Lys 165 170 175 Val Asn Lys Pro Tyr Leu Pro Ile Ala Ala Gly Asp Leu Ser Val Gln 180 185 190 Ser Ala Trp Leu Leu Val Ile Phe Phe Ala Ile Ala Gly Leu Leu Val 195 200 205 Val Gly Phe Asn Phe Gly Pro Phe Ile Thr Ser Leu Tyr Ser Leu Gly 210 215 220 Leu Phe Leu Gly Thr Ile Tyr Ser Val Pro Pro Leu Arg Met Lys Arg 225 230 235 240 Phe Pro Val Ala Ala Phe Leu Ile Ile Ala Thr Val Arg Gly Phe Leu 245 250 255 Leu Asn Phe Gly Val Tyr His Ala Thr Arg Ala Ala Leu Gly Leu Pro 260 265 270 Phe Gln Trp Ser Ala Pro Val Ala Phe Ile Thr Ser Phe Val Thr Leu 275 280 285 Phe Ala Leu Val Ile Ala Ile Thr Lys Asp Leu Pro Asp Val Glu Gly 290 295 300 Asp Arg Lys Phe Gln Ile Ser Thr Leu Ala Thr Lys Leu Gly Val Arg 305 310 315 320 Asn Ile Ala Phe Leu Gly Ser Gly Leu Leu Leu Val Asn Tyr Val Ser 325 330 335 Ala Ile Ser Leu Ala Phe Tyr Met Pro Gln Tyr Ala Ala Leu Lys Arg 340 345 350 Pro Thr Leu Leu Ser Phe Asn Asn Glu Gln Val Phe Arg Gly Ser Leu 355 360 365 Met Ile Pro Ala His Val Ile Leu Ala Ser Gly Leu Ile Phe Gln Thr 370 375 380 Trp Val Leu Glu Lys Ala Asn Tyr Thr Lys Ser Ile Cys Tyr Ser Pro 385 390 395 400 Ser Ser Ser Phe Gln Phe His Gly Glu Asp Met Gln Phe Ser Leu Tyr 405 410 415 Ile Ile Leu Leu Leu Leu Cys Ser Leu Glu Ser Lys Ser Val Pro Ser 420 425 430 Cys Thr Tyr Ile Lys Asp Met Ser Phe 435 440 63 155 DNA Arabidopsis thaliana 63 gtgtggctag tggcatcaat ggagctctcg atctcacaat caccgcgtgt tcggttctcg 60 tctctggcgc ctcgtttctt agcagcttct catcatcatc gtccttctgt gcatttagct 120 gggaagttta taagcctccc tcgagatgtt cgctt 155 64 626 DNA Medicago truncatula 64 gctccttatg gagctctcta cttcttcatc atcttctctt cattcacatt ccataattcc 60 cacatggaat tccaaaaact actactcttt caaaccaccc atttcagcta agtccacaac 120 cccaaaatct tccaaacggt ttggttcaat tgggctgcac catcatcatc acacaagttt 180 ctctgctcat gtttcaaaac cgaagagaca gtgtaaaccc atttccatca gggcctgcag 240 tgaagttgga gctgctggat ctgatcgtcc atttgctgac aaagttttag attttaaaga 300 tgcattctgg agatttttaa ggccacatac tatccgtggg acagcattag gctcttttgc 360 tttggtgtca agagcgttga ttgagaactc aaatctgata aagtggtctc ttttgttgaa 420 agcactctct ggactttttg ctctgatttg tgggaatggt tatatagttg gcatcaatca 480 aatatatgat atcggcattg acaaggtaaa caaaccttat ttacctatag ctgcaggaga 540 tctttctgtc caatctgcat ggtacttggt tatattcttt gcagcagctg gccttttgac 600 tgtaggattg aactttggat ctttta 626 65 651 DNA Medicago truncatula 65 cttcagctcc ttatggagct ctctacttct tcatcatctt ctcttcattc acattccata 60 attcccacat ggaattccaa aaactactac tctttcaaac cacccatttc agctaagtcc 120 acaaccccaa aatcttccaa acggtttggt tcaattgggc tgcaccatca tcatcacaca 180 agtttctctg ctcatgtttc aaaaccgaag agacagtgta aacccatttc catcagggcc 240 tgcagtgaag ttggagctgc tggatctgat cgtccatttg ctgacaaagt tttagatttt 300 aaagatgcat tctggagatt tttaaggcca catactatcc gtgggacagc attaggctct 360 tttgctttgg tgtcaagagc gttgattgag aactcaaatc tgataaagtg gtctcttttg 420 ttgaaagcac tctctggact ttttgctctg atttgtggga atggttatat agttggcatc 480 aatcaaatat atgatatcgg cattgacaag gtaaacaaac cttatttacc tatagctgca 540 ggagatcttt ctgtccaatc tgcatggtac ttggttatat tctttgcagc agctggcctt 600 ttgactgtag gattgaactt tggatcttta ttttttctct ttactccttc g 651 66 651 DNA Medicago truncatula 66 cttcagctcc ttatggagct ctctacttct tcatcatctt ctcttcattc acattccata 60 attcccacat ggaattccaa aaactactac tctttcaaac cacccatttc agctaagtcc 120 acaaccccaa aatcttccaa acggtttggt tcaattgggc tgcaccatca tcatcacaca 180 agtttctctg ctcatgtttc aaaaccgaag agacagtgta aacccatttc catcagggcc 240 tgcagtgaag ttggagctgc tggatctgat cgtccatttg ctgacaaagt tttagatttt 300 aaagatgcat tctggagatt tttaaggcca catactatcc gtgggacagc attaggctct 360 tttgctttgg tgtcaagagc gttgattgag aactcaaatc tgataaagtg gtctcttttg 420 ttgaaagcac tctctggact ttttgctctg atttgtggga atggttatat agttggcatc 480 aatcaaatat atgatatcgg cattgacaag gtaaacaaac cttatttacc tatagctgca 540 ggagatcttt ctgtccaatc tgcatggtac ttggttatat tctttgcagc agctggcctt 600 ttgactgtag gattgaactt tggatcttta ttttttctct ttactccttc g 651 67 614 DNA Medicago truncatula 67 gttgagtgtt gcttcagctc cttatggagc tctctacttc ttcatcatct tctcttcatt 60 cacattccat aattcccaca tggaattcca aaaactacta ctctttcaaa ccacccattt 120 cagctaagtc cacaacccca aaatcttcca aacggtttgg ttcaattggg ctgcaccatc 180 atcatcacac aagtttctct gctcatgttt caaaaccgaa gagacagtgt aaacccattt 240 ccatcagggc ctgcagtgaa gttggagctg ctggatctga tcgtccattt gctgacaaag 300 ttttagattt taaagatgca ttctggagat ttttaaggcc acatactatc cgtgggacag 360 cattaggctc ttttgctttg gtgtcaagag cgttgattga gaactcaaat ctgataaagt 420 ggtctctttt gttgaaagca ctctctggac tttttgctct gatttgtggg aatggttata 480 tagttggcat caatcaaata tatgatatcg gcattgacaa ggtaaacaaa ccttatttac 540 ctatagctgc aggagatctt tctgtaccaa tctgcatggt acttggttat attctttgca 600 acagctggcc tttt 614 68 560 DNA Solanum tuberosum 68 gacccttttc ccatatattt atccacttac caccttatcc tcttgaggtt gaacaaattc 60 attcttcctt tggtatggag atacagggtg ttacaataga caaaattgac tcacacaaga 120 aacattccat ctcctaagga tagattgatg aatttcctaa gaatatacaa caacaggata 180 aataaattct ccatcccccc catctctata gacaattttc ctttgcaaac cagaaagaaa 240 acttgcattt cttcgaggtc catcgaacaa aaacctttat caagtagatt ttagatgaaa 300 ggaaagatga tgtactccgc atagaaaaga ttccatataa atctatagta tgctgagatt 360 gcttccttgg tgtaatttgc tctttccaac aaccatgcct ggaaaactaa acacgatgct 420 aagatgacat gtacaggtat catcaagcta cacctgaatg cttggggcat gtatattgct 480 gcaactacag caccaatgta atttgttaat aatagaccag aaccaaggaa tgctatgttt 540 ctcacaccaa gctttgttgc 560 69 371 DNA Arabidopsis thaliana 69 caattggtac aagcattttt attgcaagat ataaaaattc agaaggacat atccttgatg 60 tatgtacatg aaggaaccga ttttgactcc aagctacaaa gaagaagaag aatgatatac 120 aaagaaaact gcatatcctc accatgaaat tgaaagctag aggaagggga ataacagata 180 ctctgcgtag aagagattcc atataaaccg ataatatcct gagatagctt ccttggtgta 240 gtttgctttt tctagtaccc atgtctggaa aattaagcct gaagccaaga tcacatgtgc 300 aggaatcatc aagctacctc taaaaacctg aggcatgtag aaagctagtg atatggctga 360 aacataattt a 371 70 357 DNA Arabidopsis thaliana 70 ggtacaagca tttttattgc aagatataaa aattcagaag gacatatcct tgatgtatgt 60 acatgaagga accgattttg actccaagct acaaagaaga agaagaatga tatacaaaga 120 aaactgcata tcctcaccat gaaattgaaa gctagaggaa ggggaataac agatactctg 180 cgtagaagag attccatata aaccgataat atcctgagat agcttccttg gtgtagtttg 240 ctttttctag tacccatgtc tggaaaatta agcctgaagc caagatcaca ctggttgcag 300 gaactcatca agctaccctc taaaaaaacc gtgaggcaac tgctaggaaa acaggcc 357 71 560 DNA Medicago truncatula misc_feature (537)..(537) unknown 71 tgccacaggc tttcaggaga tggttactga taccagctca tgcaatattt gcttcaagct 60 taatttacca ggtgcagata ttagaaaaag caaattatac aaaggaagca atatcaggat 120 tctatcgatt catatggaat ctgttctatg ccgagtatgc attatttcct ttcatctagc 180 aaactgtgct acatttttac ttggaaaaat tgcacacatg catccaaaaa tgcagcggtt 240 gcttgaccaa agccggtcaa taagacaaag ccgttcaata agaaaaatct tagttatatc 300 gagtatctat tcttaaagta ttaacaattt tttttaatgg tttgagtaaa tttttgtata 360 tagtatagtg cttcctttta atgagatgta ttgccatgag aattgtatac aacggccaga 420 tttcatttgt gttggaacaa attccactgg tgaatgtgat aatatactca tgtgaactct 480 acccaaaaat aaaataaaat aaaaaaaaaa aaaaaaaaaa aaaaataaaa aaaaaanaaa 540 aataaaaaaa cgtcgagggg 560 72 713 DNA Glycine max misc_feature (13)..(13) unknown misc_feature (679)..(679) unknown misc_feature (681)..(683) unknown misc_feature (686)..(693) unknown misc_feature (28)..(29) unknown misc_feature (634)..(635) unknown misc_feature (637)..(637) unknown misc_feature (643)..(643) unknown misc_feature (658)..(660) unknown misc_feature (664)..(664) unknown misc_feature (669)..(670) unknown misc_feature (672)..(674) unknown 72 aaatgcgatg ganagccgat gacgcctnna tatacaaaaa tactcattaa aaaaatagct 60 agtttactaa ttgatacttg agacaacaaa gaagatctct ctaactatgc acgtatgcac 120 cttttcccaa gaaaaatgta gcaaggcttg ctatatgaaa ggaaatattg catactcagc 180 atagaacaga ttccatatga atcgatagaa tcctgatatt gcatccttgg tataatttgc 240 ttgttctaat atccatgcct ggtaaatcaa gcttattgca aaaatcgtat gagccggtat 300 gagtaaccaa cgcctgaaag cctgaggcat ataaattgct gccaaaacag aaacaatata 360 gttcaccaac aaaattccag aaccaaggaa agcaatgttc cgaactccta attttgtggc 420 aaaggttgat atctgatact tgcgatctcc ttcaacatca ggaagatctt ttgttatagc 480 aattaccagt gcgaaaaatg ttacaaatgt tgtgataaaa accacaggag agctccattc 540 aaatgcaagc ccaagggcag ctctagtggc atagtacaca ccaaagttaa agagaaaacc 600 ccgaaccgtg gcaattataa gaaatgctgc aacnngnaag cgnttcattc taaatggnnn 660 aacngaatnn annntaccna nnnaannnnn nnntgtgtaa agagaaaaaa tga 713 73 56 DNA Artificial Primer 73 cgcgatttaa atggcgcgcc ctgcaggcgg ccgcctgcag ggcgcgccat ttaaat 56 74 32 DNA Artificial Primer 74 tcgaggatcc gcggccgcaa gcttcctgca gg 32 75 32 DNA Artificial Primer 75 tcgacctgca ggaagcttgc ggccgcggat cc 32 76 32 DNA Artificial Primer 76 tcgacctgca ggaagcttgc ggccgcggat cc 32 77 32 DNA Artificial Primer 77 tcgaggatcc gcggccgcaa gcttcctgca gg 32 78 36 DNA Artificial Primer 78 tcgaggatcc gcggccgcaa gcttcctgca ggagct 36 79 28 DNA Artificial Primer 79 cctgcaggaa gcttgcggcc gcggatcc 28 80 36 DNA Artificial Primer 80 tcgacctgca ggaagcttgc ggccgcggat ccagct 36 81 28 DNA Artificial Primer 81 ggatccgcgg ccgcaagctt cctgcagg 28 82 39 DNA Artificial Primer 82 gatcacctgc

aggaagcttg cggccgcgga tccaatgca 39 83 31 DNA Artificial Primer 83 ttggatccgc ggccgcaagc ttcctgcagg t 31 84 31 DNA Artificial Primer 84 cacatatggc atgttctcag gttggtgctg c 31 85 29 DNA Artificial Primer 85 gcgtcgacct agaggaaggg gaataacag 29 86 31 DNA Artificial Primer 86 caaccatggc atgttctcag gttggtgctg c 31 87 29 DNA Artificial Primer 87 gcgtcgacct agaggaaggg gaataacag 29 88 1290 DNA Trichodesmium erythraeum 88 atgggaaaaa ttgctggttc tcaacaggga aaaattacaa cgaattggct acaaaaatat 60 gtgccatggc tttatagttt ttggaagttt gctcgcccac atacgattat tggtacatcg 120 ttaagtgtgc tggctttata tataattgcc atgggcgatc gctctaattt ttttgacaaa 180 tatttttttt tatacagctt aattctgtta ttgataactt ggattagttg tttatgtgga 240 atgggaaaaa ttgctggttc tcaacaggga aaaattacaa cgaattggct acaaaaatat 300 gtgccatggc tttatagttt ttggaagttt gctcgcccac atacgattat tggtacatcg 360 ttaagtgtgc tggctttata tataattgcc atgggcgatc gctctaattt ttttgacaaa 420 tatttttttt tatacagctt aattctgtta ttgataactt ggattagttg tttatgtgga 480 aatatttata tagtaggatt aaatcaatta gaggatatag aaatagatag gattaataag 540 cctcatctcc ctatagctgc tggtgagttt tctcgttttt ctggtcaaat aattgtggta 600 ataacgggta ttttggcttt gagttttgcc gggttggggg gacctttttt gttgggtaca 660 gtggggataa gtttggcaat tggtacggct tattctttac ctcctattcg attaaaaaga 720 tttcctgttt tggccgcatt atgtattttt actgtgcggg gagttattgt taatttgggt 780 atatttttaa gctttgtttg ggggtttgaa aaggttgagg aggtttcagg aggtttaatt 840 aaatggatgg gtgagttggg tgaggttgtt ctacttcaaa aaagcttgat ggttccagaa 900 attcctctga cggtatgggc tttaactttg tttgtgatag tatttacttt tgctattgct 960 atttttaagg atattccaga tattgagggt gaccgtcaat ataatattaa tacgtttacg 1020 attaagttgg gagcatttgc tgtttttaat ttggcaaggt gggtattgac tttttgctat 1080 ctgggtatgg tgatggtggg tgtagtttgg ttggcgagtg ttaatttatt ttttttggtg 1140 attagtcatt tattggcttt gggtataatg tggtggttta gtcaaagggt agatctgcat 1200 gataaaaagg cgatcgctga tttttatcaa tttatttgga aattattttt cctggaatat 1260 ctaatttttc ctatggcttg ttttttttaa 1290 89 903 DNA Chloroflexus aurantiacus 89 atgcgcaaac agctacgcct gctcattgaa tttgcccgtc cccacaccgt cattgctacc 60 agcgtccagg ttctgaccat gctgatcatc gtgatcggct ggcacccacc aacgctcgaa 120 ctggtgggac tggtcggggt gacgctcgtt gtctgtctgg cgctcaatct ctacgtagtc 180 ggcgtgaatc aactgaccga tgtggcgatt gatcggatca acaagccatg gctaccggtt 240 gctgccggtc agctttcatc ggatgctgcg caacgtattg ttatcagtgc cctgtttatt 300 gccctgaccg gtgcggctat gctcggccca ccgctctggt ggacggtgag tatcatcgcg 360 ctgatcggtt cactctactc gctccccccg ctgcgcttga agcgtcatcc cctcgctgcg 420 gccctcagta ttgccggtgc ccgcggggtg attgccaatc tcggcctggc cttccactat 480 cagtactggt tagatagcga attgccgatc acgaccctga tcctggtggc aaccttcttt 540 ttcggtttcg ctatggtgat cgcgctctat aaagacttgc ccgatgatcg cggtgatcgg 600 ttgtatcaga tcgagaccct gaccacgcgc ctcggcccgc agcgagtgct gcacctgggc 660 agaatcttgc tcaccgcctg ttatctgctt ccgattgccg tcggtctctg gtcgctgccg 720 acttttgccg ccgcgttcct ggccctcagc catgtggtcg ttatcagtgt tttctggctg 780 gtcagtatgc gcgttgatct gcaacgccgg caatcgattg ccagttttta tatgtttctg 840 tgggggattt tttataccga atttgccctg cttagcattt atcgtctgac gtataccctc 900 tga 903 90 389 PRT Glycine max 90 Met Glu Leu Ser Leu Ser Pro Thr Ser His Arg Val Pro Ser Thr Ile 1 5 10 15 Pro Thr Leu Asn Ser Ala Lys Leu Ser Ser Thr Lys Ala Thr Lys Ser 20 25 30 Gln Gln Pro Leu Phe Leu Gly Phe Ser Lys His Phe Asn Ser Ile Gly 35 40 45 Leu His His His Ser Tyr Arg Cys Cys Ser Asn Ala Val Pro Glu Arg 50 55 60 Pro Gln Arg Pro Ser Ser Ile Arg Ala Cys Thr Gly Val Gly Ala Ser 65 70 75 80 Gly Ser Asp Arg Pro Leu Ala Glu Arg Leu Leu Asp Leu Lys Asp Ala 85 90 95 Cys Trp Arg Phe Leu Arg Pro His Thr Ile Arg Gly Thr Ala Leu Gly 100 105 110 Ser Phe Ala Leu Val Ala Arg Ala Leu Ile Glu Asn Thr Asn Leu Ile 115 120 125 Lys Trp Ser Leu Phe Phe Lys Ala Phe Cys Gly Leu Phe Ala Leu Ile 130 135 140 Cys Gly Asn Gly Tyr Ile Val Gly Ile Asn Gln Ile Tyr Asp Ile Ser 145 150 155 160 Ile Asp Lys Val Asn Lys Pro Tyr Leu Pro Ile Ala Ala Gly Asp Leu 165 170 175 Ser Val Gln Ser Ala Trp Phe Leu Val Ile Phe Phe Ala Ala Ala Gly 180 185 190 Leu Ser Ile Ala Gly Leu Asn Phe Gly Pro Phe Ile Phe Ser Leu Tyr 195 200 205 Thr Leu Gly Leu Phe Leu Gly Thr Ile Tyr Ser Val Pro Pro Leu Arg 210 215 220 Met Lys Arg Phe Pro Val Ala Ala Phe Leu Ile Ile Ala Thr Val Arg 225 230 235 240 Gly Phe Leu Leu Asn Phe Gly Val Tyr Tyr Ala Thr Arg Ala Ser Leu 245 250 255 Gly Leu Ala Phe Glu Trp Ser Ser Pro Val Val Phe Ile Thr Thr Phe 260 265 270 Val Thr Phe Phe Ala Leu Val Ile Ala Ile Thr Lys Asp Leu Pro Asp 275 280 285 Val Glu Gly Asp Arg Lys Tyr Gln Ile Ser Thr Phe Ala Thr Lys Leu 290 295 300 Gly Val Arg Asn Ile Ala Phe Leu Gly Ser Gly Ile Leu Leu Val Asn 305 310 315 320 Tyr Ile Val Ser Val Leu Ala Ala Ile Tyr Met Pro Gln Ala Phe Arg 325 330 335 Arg Trp Leu Leu Ile Pro Ala His Thr Ile Phe Ala Ile Ser Leu Ile 340 345 350 Tyr Gln Ala Arg Ile Leu Glu Gln Ala Asn Tyr Thr Lys Asp Ala Ile 355 360 365 Ser Gly Phe Tyr Arg Phe Ile Trp Asn Leu Phe Tyr Ala Glu Tyr Ala 370 375 380 Ile Phe Pro Phe Ile 385 91 1427 DNA Glycine max 91 ttgcaatgta acattatgaa atatgttaat ggcattacgt caaagtaaaa ggaaatagta 60 tcacatttat atacaacaat actcatttta aaaaaataat gatagctagt ttaccaattg 120 acacttgata aacaaagatc tctctaacta tgcacgtatg caccttttcc caagaaaaaa 180 gtagcaaggt ttgctatatg aaaggaaata ttgcatactc agcatagaac agattccata 240 tgaatcgata gaatcctgat attgcatcct tggtataatt tgcttgttct aatattcgtg 300 cctggtaaat caagcttatt gcaaaaattg tatgagctgg tatgagtaac caacgcctga 360 aagcctgagg catataaatt gctgccaaaa cagaaacaat ataattcacc agcaaaattc 420 cagaaccaag gaaagcaatg ttccgaactc ctaattttgt agcaaaggtt gatatctgat 480 acttgcgatc accttcaaca tcaggaagat cttttgttat agcaattacc agtgcgaaaa 540 atgttacaaa tgttgtgata aaaaccacag gagagctcca ttcaaatgca agcccaaggg 600 aagctctagt ggcatagtac acaccaaagt taaggagaaa accacgtacc gtggcaatta 660 taagaaatgc tgcaacagga aagcgtttca tcctcaatgg aggaacagaa tagatggttc 720 ccaagaaaag gccaagtgtg taaagagaaa aaatgaaagg cccaaagttc aaccctgcaa 780 tcgacaggcc agctgctgca aaaaatataa ccaagaacca tgcagattgg acagaaagat 840 ctccagcagc tataggtaaa taaggtttgt ttaccttgtc aatgctaatg tcatagattt 900 gattgatgcc aactatataa ccattcccac aaatcagggc aaaaagacca cagaaagctt 960 tgaaaaaaag agaccacttt atcaaattcg tgttctcaat caatgctctt gccaccaaag 1020 caaatgaacc tagtgctgta ccacgtatag tatgtggcct taaaaatctc caacaagcat 1080 ctttcaaatc taaaagtctt tcagctaatg gacgatcaga tccagaagct ccaactccag 1140 tgcaagccct tatggaactg ggtctttggg gtctctcggg aacagcattt gagcagcatc 1200 tgtaactgtg atggtgcaac ccaattgagt tgaagtgttt ggaaaatcct aagaacaaag 1260 gttgttgtga cttggtggcc ttagtggatg atagtttagc ggaattcaaa gtgggaattg 1320 tggaaggaac acgatgtgaa gttggagaga gtgagagctc cataaggagc tgagcacagc 1380 aaacgagaaa acactccaaa tttcagacgc aacgcaaggc aaaaacc 1427 92 12 PRT Artificial Conserved Motif MISC_FEATURE (1)..(1) x = w, i, or y MISC_FEATURE (2)..(2) x = r, e, or k MISC_FEATURE (4)..(4) x = l, a, or s MISC_FEATURE (4)..(4) x = l, a, or s MISC_FEATURE (9)..(9) x = i or v MISC_FEATURE (10)..(10) x = i or r MISC_FEATURE (11)..(11) x = g or a 92 Xaa Xaa Phe Xaa Arg Pro His Thr Xaa Xaa Xaa Thr 1 5 10 93 26 PRT Artificial Conserved Motif MISC_FEATURE (2)..(2) x = v, i, l, or g MISC_FEATURE (7)..(7) x = i, l, or v MISC_FEATURE (10)..(10) x = i or l MISC_FEATURE (11)..(11) x = s, f, y, e, w, or t MISC_FEATURE (13)..(13) x = v or i MISC_FEATURE (14)..(14) x = r, s, g, e, d, or a MISC_FEATURE (17)..(17) x = k or r MISC_FEATURE (18)..(18) x = v or i MISC_FEATURE (22)..(22) x = y, d, t, w, n, or h MISC_FEATURE (25)..(25) x = i, v, or l 93 Asn Xaa Tyr Ile Val Gly Xaa Asn Gln Xaa Xaa Asp Xaa Xaa Ile Asp 1 5 10 15 Xaa Xaa Asn Lys Pro Xaa Leu Pro Xaa Ala 20 25 94 14 PRT Artificial Conserved Motif MISC_FEATURE (3)..(3) x = l or i MISC_FEATURE (4)..(4) x = f, t, or y MISC_FEATURE (7)..(7) x = l, i, or v MISC_FEATURE (10)..(10) x = i, v, m, or d MISC_FEATURE (11)..(11) x = e, d, or r MISC_FEATURE (14)..(14) x = r or k 94 Ile Ala Xaa Xaa Lys Asp Xaa Pro Asp Xaa Xaa Gly Asp Xaa 1 5 10 95 23 PRT Artificial Conserved Motif MISC_FEATURE (1)..(1) x = k or r MISC_FEATURE (2)..(2) x = d, e, q, t, a, k, or s MISC_FEATURE (3)..(3) x = a, e, s, or t MISC_FEATURE (4)..(4) x = i or l MISC_FEATURE (5)..(5) x = s, t, or a MISC_FEATURE (6)..(6) x = q, g, d, or s MISC_FEATURE (7)..(7) x = f, y, or c MISC_FEATURE (9)..(9) x = q, m, or r MISC_FEATURE (10)..(10) x = f or l MISC_FEATURE (11)..(11) i, v, or l MISC_FEATURE (13)..(13) x = n, k, or g MISC_FEATURE (14)..(14) x = l or i MISC_FEATURE (16)..(16) x = y or f MISC_FEATURE (17)..(17) x = a, l, i, or t MISC_FEATURE (19)..(19) x = y or f MISC_FEATURE (20)..(20) x = a, i, or l MISC_FEATURE (21)..(21) x = f, i, l, or m MISC_FEATURE (22)..(22) x = f, l, i, or y MISC_FEATURE (23)..(23) x = p or s 95 Xaa Xaa Xaa Xaa Xaa Xaa Xaa Tyr Xaa Xaa Xaa Trp Xaa Xaa Phe Xaa 1 5 10 15 Xaa Glu Xaa Xaa Xaa Xaa Xaa 20

Claims

1. (canceled)

2. A substantially purified polypeptide molecule comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 5, 9-11, 57-58, and 90.

3-29. (canceled)

30. A substantially purified polypeptide comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 39-42, 46-49, and 92-95, wherein said amino acid sequence is not derived from a nucleic acid molecule that is derived from Nostoc punctiforme, Anabaena, Synechocystis, Zea mays, Glycine max, Arabidopsis thaliana, Oryza sativa, Trichodesmium erythraeum, Chloroflexus aurantiacus, wheat, leek, canola, cotton, or tomato.

31. The polypeptide of claim 30, wherein more than one amino acid sequence is selected from the group consisting of SEQ ID NOs: 39-42, 46-49, and 92-95.

32. The polypeptide of claim 31, wherein said amino acid is not derived from a nucleic acid that is derived from Sulfolobus, Aeropyrum, or sorghum.

33-38. (canceled)

39. A substantially purified polypeptide comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 39-42, 46-49, and 92-95, wherein said amino acid sequence does not comprise any of the amino acid sequences set forth in sequence listings in WO 00/68393, WO 00/63391, WO 01/62781, or WO 02/33060, and does not comprise SEQ ID NOs: 1-11, 43-45, 57-58, 61-62, and 90 from the present application.

40. The polypeptide of claim 39, wherein more than one amino acid sequence is selected from the group consisting of SEQ ID NOs: 39-42, 46-49, and 92-95.

41-44. (canceled)

45. A substantially purified polypeptide with homogentisate prenyl transferase activity comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 43-44.

46-49. (canceled)

50. Homogentisate prenyl transferase polypeptide sequences identified using any of the alignments set forth in the group consisting of FIGS. 2a-2c, 3a-3c, 24a-24b, 25a-25b, 33a-33c, 34a-34b, and 35a-35b in a profile based model, excluding the amino acid sequences set forth in sequence listings in WO 00/68393, WO 00/63391, WO 01/62781, or WO 02/33060 and do not comprise SEQ ID NOs: 1-11, 43-45, 57-58, 61-62, and 91 from the present application.

51. Homogentisate prenyl transferase polypeptide sequences identified using any of the alignments set forth in FIGS. 2a-2c, 3a-3c, 24a-24b, 25a-25b, 33a-33c, 34a-34b, and 35a-35b in a profile based model, wherein said amino acid sequence is not derived from a nucleic acid molecule that is derived from Nostoc punctiforme, Anabaena, Synechocystis, Zea mays, Glycine max, Arabidopsis thaliana, Oryza sativa, wheat, leek, canola, cotton, or tomato.

52. The homogentisate prenyl transferase of claim 50, wherein the profile based model is an HMM model.

53. The homogentisate prenyl transferase of claim 52, wherein the profile based sequence search method is a HMM model generated using HMMER package version 2.2 g with default parameters.