U.S. patent application number 11/595552 was filed with the patent office on 2007-03-15 for methods of ameliorating symptoms of herpes infection using immunomodulatory polynucleotide sequences.
Invention is credited to Gary Van Nest.
Application Number | 20070060540 11/595552 |
Document ID | / |
Family ID | 26884207 |
Filed Date | 2007-03-15 |
United States Patent
Application |
20070060540 |
Kind Code |
A1 |
Van Nest; Gary |
March 15, 2007 |
Methods of ameliorating symptoms of herpes infection using
immunomodulatory polynucleotide sequences
Abstract
The invention provides new methods of preventing and/or treating
herpes virus infections, particularly reducing infection, one or
more symptoms and recurrence of one or more symptoms of herpes
simplex virus infection. A polynucleotide comprising an
immunostimulatory sequence (an "ISS") is administered to an
individual which is at risk of being exposed to alphaherpesvirinae,
has been exposed to alphaherpesvirinae or is infected with
alphaherpesvirinae. The ISS is administered without any
alphaherpesvirinae antigens. Administration of the ISS results in
reduced incidence, recurrence, and severity of one or more symptoms
of alphaherpesvirinae infection
Inventors: |
Van Nest; Gary; (Martinez,
CA) |
Correspondence
Address: |
MORRISON & FOERSTER LLP
755 PAGE MILL RD
PALO ALTO
CA
94304-1018
US
|
Family ID: |
26884207 |
Appl. No.: |
11/595552 |
Filed: |
November 10, 2006 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
09802518 |
Mar 9, 2001 |
7157437 |
|
|
11595552 |
Nov 10, 2006 |
|
|
|
60188556 |
Mar 10, 2000 |
|
|
|
Current U.S.
Class: |
514/44R |
Current CPC
Class: |
A61K 39/39 20130101;
A61K 31/7105 20130101; A61P 31/12 20180101; A61P 31/22 20180101;
A61K 2039/55561 20130101 |
Class at
Publication: |
514/044 |
International
Class: |
A61K 48/00 20060101
A61K048/00 |
Claims
1. A method for preventing a symptom of herpes simplex virus
infection in an individual at risk of exposure to herpes simplex
virus, comprising administering a composition comprising a
polynucleotide comprising an immunostimulatory sequence (ISS) to
said individual, wherein the ISS comprises the sequence 5'-C, G-3',
wherein a herpes simplex virus antigen is not administered in
conjunction with administration of said composition, and wherein
said composition is administered in an amount sufficient to prevent
a symptom of herpes simplex virus infection.
2. The method of claim 1, wherein the ISS comprises the sequence
5'-T, C, G-3'.
3. The method of claim 1, wherein the ISS comprises the sequence
5'-purine, purine, C, G, pyrimidine, pyrimidine, C, G-3' or
5'-purine, purine, C, G, pyrimidine, pyrimidine, C, C-3'.
4. The method of claim 3, wherein the ISS comprises a sequence
selected from the group consisting of
5'-AACGTTCC-3',5'-AACGTTCG-3', 5'-GACGTTCC-3' and
5'-GACGTTCG-3'.
5. The method of claim 1, wherein the ISS comprises the sequence
5'-TGACTGTGAACGTTCGAGATGA-3' (SEQ ID NO:1).
6. The method of claim 1, wherein the ISS comprises the sequence
5'-TCGTCGAACGTTCGTTAACGTTCG-3' (SEQ ID NO:9).
7. The method of claim 1, wherein the individual is a mammal.
8. (canceled)
9. The method of claim 1, wherein the herpes simplex virus is a
herpes simplex virus 2 (HSV-2) virus.
10-35. (canceled)
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application claims the priority benefit of U.S.
Provisional application 60/188,556, filed Mar. 10, 2000, which is
hereby incorporated herein by reference in its entirety.
TECHNICAL FIELD
[0002] This invention is in the field of immunomodulatory
polynucleotides, more particularly their use in ameliorating or
preventing herpes virus infection and/or symptoms of herpes virus
infection.
BACKGROUND ART
[0003] Herpes viruses cause a number of significant disorders.
Herpes simplex viruses (HSV) can be neurovirulent (e.g., infect and
replicate in central nervous system tissue), although HSV
infections of the brain are rare. HSV infections in neonates and
immunosuppressed individuals can be severe. Herpes simplex virus-1
(HSV-1) is primarily responsible for orolabial herpetic lesions,
although genital herpes may also be caused by HSV-1. Herpes simplex
virus-2 (HSV-2) is the primary cause of genital herpes, and genital
herpes caused by HSV-2 are generally more severe than genital
herpes due to HSV-1. Additionally, HSV-2 represents a greater
public health threat, as HSV-2 infection is associated with certain
genital tract cancers and can be transmitted from mother to child
during vaginal delivery.
[0004] A primary infection with the herpes virus varicella zoster
virus (VZV) results in the human disease varicella, also known as
chicken pox. Primary infection leads to latent infection of dorsal
root ganglia cells, giving rise to a reservoir of virus which can
be reactivated. Reactivation of latent VZV gives rise to a
condition referred to as herpes zoster or shingles. Both primary
and reactivated VZV infections give rise to cutaneous lesions,
although varicella symptoms can include mucosal lesions as
well.
[0005] Genital HSV-2 is among the most commonly sexually
transmitted infectious diseases in women. Clinical infection occurs
in 20-30% of adults (Parr et al. (1997) J. Reprod. Immunol.
36:77-92; Burke et. al. (1994) J. Infect. Dis. 170:1110-1119),
while up to 85% of females can develop HSV-2 antibodies in their
lifetime (Kinghorn (1996) Scand. J. Infect. Dis. Suppl. 100:20-25).
The frequency of recurrences can be as often as monthly, at times
lasting several days. Stanberry et al. (1986) J. Infect. Dis.
153:1055-1061. Complications may be significant, frequently
resulting in sociopathologic morbidity, adenopathy, encephalitis
neurologic syndromes. Neonatal infection may be high as 1:2000
births, usually caused by retrograde spread of HSV-2 or from fetal
passage through an infected genital tract. Mortality (up to 85% in
untreated infected newborns) results from disseminated
intravascular coagulation, destructive encephalitis and other
neurological maladies. Stanberry (1993) Rev. Med. Virol.
3:37-46.
[0006] The incidence of genital HSV-2 continues to escalate. An
estimated 700,000 new cases occur each year in the U.S. alone.
Reactivation is common, resulting in an estimated 25 million cases
of recurrent genital herpes each year. Transmission commonly occurs
through unprotected sexual contact, particularly during periods of
asymptomatic viral shedding, and results in heightened morbidity
and mortality when perinatal fetal transmission occurs. Current
treatment of genital HSV-2 includes antiviral drugs that are merely
palliative, controlling symptoms and exacerbations without
providing a cure. Additionally, these chemotherapeutics are costly
and may be associated with adverse reactions and potential drug
interactions. Vaccines are a more desirable alternative to drug
treatment or prophylaxis, and have been developed against HSV-2 to
limit transmission or recurrence. Specific vaccines that have shown
efficacy in animal models and clinical studies used attenuated
virus, recombinant HSV-2 surface proteins or their corresponding
cDNA. Their utility, however, is counterbalanced by the need of
parenteral administration, often with poorly tolerated and
unapproved adjuvants, and with less than desired clinical efficacy
in humans and patient acceptability.
[0007] Clinical control of HSV-2 currently is limited to the use of
topical, oral or intravenous antiviral drugs. These agents may be
effective in controlling symptoms, and may diminish transmission
and recurrence rates, but are not curative. These drugs also do not
prevent transmission, particularly during asymptomatic viral
shedding. Clear prevention of transmission or recurrence from
latency would be a preferred method of clinical control.
Immunologic prophylaxis against HSV-2 through vaccination has,
therefore, emerged as a therapeutic alternative to chemotherapy.
More specifically, highly targeted immunogenic components
responsible for virus-host propagation, such as glycoprotein D,
have provided the most appropriate strategy for immunization.
Stokes et al. (1997) Virus Res. 50:159-174.
[0008] A host of studies using attenuated or inactive viruses or
their components have demonstrated some utility as vaccines.
Stanberry (1995) Trends Microbiol. 3:244-247. More recently,
recombinant HSV-2 surface protein vaccines, particularly HSV-2
glycoprotein D (gD2), have shown greater efficacy in stimulating
immune responses while limiting duration and severity of
recurrences. Stanberry et al. (1988) J. Infect. Dis. 157:156-163;
Straus (1994) Lancet 343:1460-1463; Straus (1997) J. Infect. Dis.
176:1129-1134; Langenberg (1995) Ann. Intern. Med. 122:889-898. The
gD2 is an integral membrane protein, present in the viral envelope
and is required for viral attachment and subsequent propagation in
the host cell. The mature protein is composed of 368 residues, the
C-terminal portion containing the transmembrane region. Multiple
glycosylation sites (three N-linked and two to three O-linked)
exist. While peptide fragments or bacterially-expressed expressed
gD proteins possess antigenic properties, glycosylation appears
necessary in eliciting maximal immunogenic responses, suggesting
that eukaryotic cell expression vectors are more appropriate for
generating this protein antigen. Stokes et al. (1997); Damhoff et
al. (1994) J. Chromatogr. 676:43-49.
[0009] Others have demonstrated that nucleic acid vaccines, such as
plasmid DNA encoding gD2, can also effectively immunize against
HSV-2 by stimulation of both cellular and humoral immune responses.
Bourne et al. (1996) J. Infect. Dis. 173:800-807; Bourne et al.
(1996) Vaccine 14:1230-1234. However, all these vaccines were
designed for parenteral administration, often containing unapproved
or poorly tolerated adjuvants.
[0010] Meanwhile, nontraditional routes of antigen delivery, such
as mucosal vaccination, have emerged as effective immunization
alternatives. A body of evidence suggests that mucosal vaccination
may provide more effective immunization against pathogens such as
HSV-2, in essence, by inhibiting cellular attachment or
neutralizing toxins at the point of exposure, e.g., within the
genital mucosa, prior to pathogen and host interaction. Clements
(1997) Nature Biotech. 15:622-623. These immune responses were
amplified significantly with co-administration of adjuvants, such
as cholera toxin .beta.-subunit.
[0011] The concept of providing immune protection specifically
through vaginal vaccination also has been proposed to be an
effective alternative to parenteral vaccination. Parr et al.
(1997); Clements (1997) Nature Biotech. 71:1497-1504; Uehling et
al. (1991) J Urol. 146:223; Uehling et al. (1994) J. Urol.
152:2308-2311; Uehling et al. (1994) J Urol. 151:213. In animal
models, this route of vaccination using inactivated urinary tract
pathogens resulted in an increased IgA response in vaginal and
urinary secretions with a decrease in clinically apparent
re-infection. Uehling et al. (1991); Uehling et al. (1994) J. Urol.
151:213. Similarly in mice, attenuated strains of HSV-2 applied
intravaginally induced humoral (particularly,
immunization-stimulated IgG) and cellular immunity in both sera and
vaginal secretions. Parr et al. (1997); McDermott et al. (1970) J.
Gen. Virol. 71:1497-1504. Vaginally-administered mucosal adjuvants,
in particular cholera toxin .beta.-subunit, significantly raise IgA
and IgG levels in the genital mucosa. (Johannsson et al. (1998)
Inf. Immun. 66:514-520. These studies support the concept that
mucosal associated lymphoid tissue participates in the generation
of local immune-mediated protection. Furthermore, unlike parenteral
vaccines, mucosal vaccination, such as a vaginal delivery,
precludes the necessity of a pyrogen-free vaccine, causes fewer
adverse reactions, and is amenable to routine booster
immunizations.
[0012] Administration of certain DNA sequences, generally known as
immunostimulatory sequences or "ISS," induces an immune response
with a Th1-type bias as indicated by secretion of Th1-associated
cytokines. The Th1 subset of helper cells is responsible for
classical cell-mediated functions such as delayed-type
hypersensitivity and activation of cytotoxic T lymphocytes (CTLs),
whereas the Th2 subset functions more effectively as a helper for
B-cell activation. The type of immune response to an antigen is
generally influenced by the cytokines produced by the cells
responding to the antigen. Differences in the cytokines secreted by
Th1 and Th2 cells are believed to reflect different biological
functions of these two subsets. See, for example, Romagnani (2000)
Ann. Allergy Asthma Immunol. 85:9-18.
[0013] Administration of an immunostimulatory polynucleotide with
an antigen results in a Th1-type immune response to the
administered antigen. Roman et al. (1997) Nature Med. 3:849-854.
For example, mice injected intradermally with Escherichia coli (E.
coli) .beta.-galactosidase (.beta.-Gal) in saline or in the
adjuvant alum responded by producing specific IgG1 and IgE
antibodies, and CD4.sup.+ cells that secreted IL-4 and IL-5, but
not IFN-.gamma., demonstrating that the T cells were predominantly
of the Th2 subset. However, mice injected intradermally (or with a
tyne skin scratch applicator) with plasmid DNA (in saline) encoding
.beta.-Gal and containing an ISS responded by producing IgG2a
antibodies and CD4.sup.+ cells that secreted IFN-.gamma., but not
IL-4 and IL-5, demonstrating that the T cells were predominantly of
the Th1 subset. Moreover, specific IgE production by the plasmid
DNA-injected mice was reduced 66-75%. Raz et al. (1996) Proc. Natl.
Acad. Sci. USA 93:5141-5145. In general, the response to naked DNA
immunization is characterized by production of IL-2, TNF.alpha. and
IFN-.gamma. by antigen-stimulated CD4.sup.+ T cells, which is
indicative of a Th1-type response. This is particularly important
in treatment of allergy and asthma as shown by the decreased IgE
production. The ability of immunostimulatory polynucleotides to
stimulate a Th1-type immune response has been demonstrated with
bacterial antigens, viral antigens and with allergens (see, for
example, WO 98/55495).
[0014] Other references describing ISS include: Krieg et al. (1989)
J. Immunol. 143:2448-2451; Tokunaga et al. (1992) Microbiol.
Immunol. 36:55-66; Kataoka et al. (1992) Jpn. J. Cancer Res.
83:244-247; Yamamoto et al. (1992) J. Immunol. 148:4072-4076;
Mojcik et al. (1993) Clin. Immuno. and Immunopathol. 67:130-136;
Branda et al. (1993) Biochem. Pharmacol. 45:2037-2043; Pisetsky et
al. (1994) Life Sci. 54(2):101-107; Yamamoto et al. (1994a)
Antisense Research and Development. 4:119-122; Yamamoto et al.
(1994b) Jpn. J. Cancer Res. 85:775-779; Raz et al. (1994) Proc.
Natl. Acad. Sci. USA 91:9519-9523; Kimura et al. (1994) J. Biochem.
(Tokyo) 116:991-994; Krieg et al. (1995) Nature 374:546-549;
Pisetsky et al. (1995) Ann. N.Y. Acad. Sci. 772:152-163; Pisetsky
(1996a) J. Immunol. 156:421-423; Pisetsky (1996b) Immunity
5:303-310; Zhao et al. (1996) Biochem. Pharmacol. 51:173-182; Yi et
al. (1996) J. Immunol. 156:558-564; Krieg (1996) Trends Microbiol.
4(2):73-76; Krieg et al. (1996) Antisense Nucleic Acid Drug Dev.
6:133-139; Klinman et al. (1996) Proc. Natl. Acad. Sci USA.
93:2879-2883; Raz et al. (1996); Sato et al. (1996) Science
273:352-354; Stacey et al. (1996) J. Immunol. 157:2116-2122; Ballas
et al. (1996) J. Immunol. 157:1840-1845; Branda et al. (1996) J.
Lab. Clin. Med. 128:329-338; Sonehara et al. (1996) J. Interferon
and Cytokine Res. 16:799-803; Klinman et al. (1997) J. Immunol.
158:3635-3639; Sparwasser et al. (1997) Eur. J. Immunol.
27:1671-1679; Roman et al. (1997); Carson et al. (1997) J. Exp.
Med. 186:1621-1622; Chace et al. (1997) Clin. Immunol. and
Immunopathol. 84:185-193; Chu et al. (1997) J. Exp. Med.
186:1623-1631; Lipford et al. (1997a) Eur. J. Immunol.
27:2340-2344; Lipford et al. (1997b) Eur. J. Immunol. 27:3420-3426;
Weiner et al. (1997) Proc. Natl. Acad. Sci. USA 94:10833-10837;
Macfarlane et al. (1997) Immunology 91:586-593; Schwartz et al.
(1997) J. Clin. Invest. 100:68-73; Stein et al. (1997) Antisense
Technology, Ch. 11 pp. 241-264, C. Lichtenstein and W. Nellen,
Eds., IRL Press; Wooldridge et al. (1997) Blood 89:2994-2998;
Leclerc et al. (1997) Cell. Immunol. 179:97-106; Kline et al.
(1997) J. Invest. Med. 45(3):282A; Yi et al. (1998a) J. Immunol.
160:1240-1245; Yi et al. (1998b) J. Immunol. 160:4755-4761; Yi et
al. (1998c) J. Immunol. 160:5898-5906; Yi et al. (1998d) J.
Immunol. 161:4493-4497; Krieg (1998) Applied Antisense
Oligonucleotide Technology Ch. 24, pp. 431-448, C. A. Stein and A.
M. Krieg, Eds., Wiley-Liss, Inc.; Krieg et al. (1998a) Trends
Microbiol. 6:23-27; Krieg et al. (1998b) J. Immunol. 161:2428-2434;
Krieg et al. (1998c) Proc. Natl. Acad. Sci. USA 95:12631-12636;
Spiegelberg et al. (1998) Allergy 53(45S):93-97; Horner et al.
(1998) Cell Immunol. 190:77-82; Jakob et al. (1998) J. Immunol.
161:3042-3049; Redford et al. (1998) J. Immunol. 161:3930-3935;
Weeratna et al. (1998) Antisense & Nucleic Acid Drug
Development 8:351-356; McCluskie et al. (1998) J. Immunol.
161(9):4463-4466; Gramzinski et al. (1998) Mol. Med. 4:109-118; Liu
et al. (1998) Blood 92:3730-3736; Moldoveanu et al. (1998) Vaccine
16: 1216-1224; Brazolot Milan et al. (1998) Proc. Natl. Acad. Sci.
USA 95:15553-15558; Broide et al. (1998) J. Immunol. 161:7054-7062;
Broide et al. (1999) Int. Arch. Allergy Immunol. 118:453-456;
Kovarik et al. (1999) J. Immunol. 162:1611-1617; Spiegelberg et al.
(1999) Pediatr. Pulmonol. Suppl. 18:118-121; Martin-Orozco et al.
(1999) Int. Immunol. 11:1111-1118; EP 468,520; WO 96/02555; WO
97/28259; WO 98/16247; WO 98/18810; WO 98/37919; WO 98/40100; WO
98/52581; WO 98/55495; WO 98/55609 and WO 99/11275. See also Elkins
et al. (1999) J. Immunol. 162:2291-2298, WO 98/52962, WO 99/33488,
WO 99/33868, WO 99/51259 and WO 99/62923. See also Zimmermann et
al. (1998) J. Immunol. 160:3627-3630; Krieg (1999) Trends
Microbiol. 7:64-65; U.S. Pat. Nos. 5,663,153, 5,723,335, 5,849,719
and 6,174,872. See also WO 99/56755, WO 00/06588, WO 00/16804; WO
00/21556; WO 00/67023 and WO 01/12223.
[0015] There exists a need in the art for effective treatments of
herpes virus infections.
[0016] All publications and patent applications cited herein are
hereby incorporated by reference in their entirety.
DISCLOSURE OF THE INVENTION
[0017] The invention provides methods of suppressing, ameliorating
and/or preventing herpes virus infection in an individual using
immunostimulatory polynucleotide sequences. Accordingly, in one
aspect, the invention provides methods of preventing, palliating,
ameliorating, reducing and/or eliminating one or more symptoms of
herpes virus infection, preferably herpes simplex virus infection,
without administering an alphaherpesvirinae antigen. A
polynucleotide comprising an immunostimulatory sequence (an "ISS")
is administered to an individual who is at risk of being exposed to
alphaherpesvirinae, has been exposed to alphaherpesvirinae or is
infected with alphaherpesvirinae. The ISS-containing polynucleotide
is administered without any alphaherpesvirinae antigens (i.e.,
alphaherpesvirinae antigen is not co-administered). Administration
of the ISS results in reduced incidence, recurrence, and/or
severity of one or more symptoms of alphaherpesvirinae
infection.
[0018] In one embodiment, the invention provides methods for
preventing a symptom of alphaherpesvirinae infection in an
individual at risk of being exposed to alphaherpesvirinae which
entail administering an effective amount of a composition
comprising a polynucleotide comprising an immunostimulatory
sequence (ISS) (i.e., an amount of the composition sufficient to
prevent a symptom of alphaherpesvirinae infection) to the
individual, wherein the ISS comprises the sequence 5'-C, G-3' and
wherein an alphaherpesvirinae antigen is not administered in
conjunction with administration of the composition (i.e., antigen
is not administered with the ISS-containing polynucleotide),
thereby preventing a symptom of alphaherpesvirinae infection.
[0019] Another embodiment of the invention provides methods for
preventing a symptom of alphaherpesvirinae infection in an
individual who has been exposed to alphaherpesvirinae which entail
administering an effective amount of a composition comprising a
polynucleotide comprising an ISS to the individual, wherein the ISS
comprises the sequence 5'-C, G-3' and wherein an alphaherpesvirinae
antigen is not administered in conjunction with administration of
the composition, thereby preventing a symptom of alphaherpesvirinae
infection.
[0020] Another embodiment of the invention provides methods of
reducing severity of a symptom of alphaherpesvirinae infection in
an individual infected with alphaherpesvirinae by administering an
effective amount of a composition comprising a polynucleotide
comprising an ISS to the individual, wherein the ISS comprises the
sequence 5'-C, G-3' and wherein an alphaherpesvirinae antigen is
not administered in conjunction with administration of the
composition, thereby reducing severity of a symptom of
alphaherpesvirinae infection. In a further embodiment, the
invention provides methods of reducing the level of viral shedding
in an infected individual with alphaherpesvirinae, such as HSV-1 or
HSV-2.
[0021] Another embodiment of the invention provides methods of
suppressing an alphaherpesvirinae infection in an individual
infected with or at risk of being infected with alphaherpesvirinae
which entail administering an effective amount of a composition
comprising a polynucleotide comprising an ISS to the individual,
wherein the ISS comprises the sequence 5'-C, G-3' and wherein an
alphaherpesvirinae antigen is not administered in conjunction with
administration of the composition, thereby suppressing an
alphaherpesvirinae infection.
[0022] Another embodiment of the invention provides methods of
delaying development of an alphaherpesvirinae infection and/or a
symptom of alphaherpesvirinae infection in an individual infected
or at risk of being infected with alphaherpesvirinae which entail
administering an effective amount of a composition comprising a
polynucleotide comprising an ISS to the individual, wherein the ISS
comprises the sequence 5'-C, G-3' and wherein an alphaherpesvirinae
antigen is not administered in conjunction with administration of
the composition, thereby delaying development of an
alphaherpesvirinae infection and/or a symptom of alphaherpesvirinae
infection.
[0023] Another embodiment of the invention provides methods of
reducing duration of an alphaherpesvirinae infection in an
individual infected or at risk of being infected with
alphaherpesvirinae which entail administering an effective amount
of a composition comprising a polynucleotide comprising an ISS to
the individual, wherein the ISS comprises the sequence 5'-C, G-3'
and wherein an alphaherpesvirinae antigen is not administered in
conjunction with administration of the composition, thereby
delaying development of an alphaherpesvirinae infection.
[0024] In another embodiment, the invention provides methods of
reducing recurrence of a symptom of alphaherpesvirinae infection in
an individual infected with alphaherpesvirinae which entail
administering an effective amount of a composition comprising a
polynucleotide comprising an ISS to the individual, wherein the ISS
comprises the sequence 5'-C, G-3' and wherein an alphaherpesvirinae
antigen is not administered in conjunction with administration of
the composition, thereby reducing recurrence of a symptom of
alphaherpesvirinae infection.
[0025] In another aspect, the invention provides kits for use in
ameliorating and/or preventing a symptom of alphaherpesvirinae
infection in an individual infected with, exposed to or at risk of
being exposed to alphaherpesvirinae. The kits comprise a
composition comprising a polynucleotide comprising an ISS, wherein
the ISS comprises the sequence 5'-C, G-3' and wherein the kit does
not comprise an alphaherpesvirinae antigen, and the kits comprise
instructions for administration of the composition to an individual
infected with, exposed to or at risk of being exposed to
alphaherpesvirinae.
[0026] In some embodiments of the methods and kits of the
invention, the ISS comprises the sequence 5'-purine, purine, C, G,
pyrimidine, pyrimidine, C, G-3' or 5'-purine, purine, C, G,
pyrimidine, pyrimidine, C, C-3'. In further embodiments of the
methods and kits, the ISS comprises a sequence selected from the
group consisting of AACGTTCC, AACGTTCG, GACGTTCC, and GACGTTCG.
[0027] In some embodiments of the methods and kits of the
invention, the ISS comprises the sequence 5'-T, C, G-3'. In some
embodiments of the methods and kits of the invention, the ISS
comprises the sequence TGACTGTGAACGTTCGAGATGA (SEQ ID NO:1).
[0028] In some embodiments of the methods and kits of the
invention, the individual is a mammal. In further embodiments, the
mammal is human.
[0029] In some embodiments of the methods and kits of the
invention, the alphaherpesvirinae is a herpes simplex virus. In
further embodiments of the methods and kits of the invention, the
herpes simplex virus is a herpes simplex virus 1 (HSV-1) virus or a
herpes simplex virus 2 (HSV-2) virus.
[0030] In some embodiments of the methods and kits of the
invention, the alphaherpesvirinae is varicella zoster virus
(VZV).
BRIEF DESCRIPTION OF THE DRAWINGS
[0031] FIG. 1 summarizes results of ISS treatment of mice infected
with HSV-2. The graph depicts animal survival following a lethal
challenge dose of HSV-2 and subsequent treatment regimens. Animals
that received an ISS treatment demonstrated improved survival as
compared to animals that received non-ISS oligonucleotide
treatments, PBS or no treatment.
[0032] FIG. 2 summarizes results of ISS treatment of guinea pigs
infected with HSV-2. The graphs depict cumulative mean herpetic
lesions over the observation period in groups of animals receiving
a single ISS treatment ("ISS 1"), receiving a total of three ISS
treatments ("ISS 3") or receiving PBS alone ("sham").
[0033] FIG. 3 summarizes results of ISS treatment of guinea pigs
infected with HSV-2. The graph depicts cumulative mean herpetic
lesions over the observation period in groups of animals receiving
a single ISS treatment, a single non-ISS oligonucleotide treatment,
21 acyclovir treatments or no treatment.
[0034] FIG. 4 is a graphical depiction of the average number of
genomic equivalents per shedding event from herpetic lesions in
guinea pigs.
MODES FOR CARRYING OUT THE INVENTION
[0035] We have discovered methods of preventing and/or treating
herpes virus infections. The invention provides methods of using
immunomodulatory polynucleotides that induce anti-viral
cell-mediated immune responses and promote anti-herpes virus
effects. The methods described herein are applicable to
alphaherpesvirinae, (e.g., herpes simplex viruses as well as
varicella zoster virus), and are particularly applicable to
preventing and/or treating herpes simplex virus infection. A
polynucleotide comprising an immunostimulatory sequence (an "ISS")
is administered to an individual who is at risk of being exposed to
alphaherpesvirinae, has been exposed to alphaherpesvirinae or is
infected with alphaherpesvirinae. Administration of the ISS without
co-administration of a herpes virus antigen results in reduced
incidence, recurrence and/or severity of one or more symptoms of
alphaherpesvirinae infection in an animal model of herpes virus
infection.
[0036] The invention also relates to kits for ameliorating and/or
preventing a symptom of herpes virus infection in exposed
individuals. The kits, which do not contain an alphaherpesvirinae
antigen, comprise a polynucleotide comprising an ISS and
instructions describing the administration of an ISS-containing
polynucleotide to an individual for the intended treatment.
[0037] As the Examples illustrate, administration of ISS to an
art-accepted model of herpes virus infection in mice, namely mice
infected with HSV-2, we have shown that treatment with ISS resulted
in decreased incidence (i.e., individuals showing symptoms of HSV-2
infection), improved survival and delays in both appearance of
symptoms and time to death in symptomatic individuals.
Additionally, in an art-accepted model of acute and recurrent
herpes simplex virus disease, namely guinea pigs infected with
HSV-2, we have shown that treatment with ISS resulted in a
significant reduction of lesion recurrences and a significant
reduction in the level of viral shedding. An advantage to a
reduction in viral shedding. Since the level of virus shedding is
correlated with viral transmission, ISS treatment may be effective
in a reduction in viral transmission. Significantly, in contrast to
previous reports of immune modulation by ISS, we report clinical
efficacy of ISS in this viral context.
General Techniques
[0038] The practice of the present invention will employ, unless
otherwise indicated, conventional techniques of molecular biology
(including recombinant techniques), microbiology, cell biology,
biochemistry and immunology, which are within the skill of the art.
Such techniques are explained fully in the literature, such as,
Molecular Cloning: A Laboratory Manual, second edition (Sambrook et
al., 1989); Oligonucleotide Synthesis (M. J. Gait, ed., 1984);
Animal Cell Culture (R. I. Freshney, ed., 1987); Methods in
Enzymology (Academic Press, Inc.); Handbook of Experimental
Immunology (D. M. Weir & C. C. Blackwell, eds.); Gene Transfer
Vectors for Mammalian Cells (J. M. Miller & M. P. Calos, eds.,
1987); Current Protocols in Molecular Biology (F. M. Ausubel et
al., eds., 1987); PCR: The Polymerase Chain Reaction, (Mullis et
al., eds., 1994); Current Protocols in Immunology (J. E. Coligan et
al., eds., 1991); The Immunoassay Handbook (David Wild, ed.,
Stockton Press NY, 1994); and Methods of Immunological Analysis (R.
Masseyeff, W. H. Albert, and N. A. Staines, eds., Weinheim: VCH
Verlags gesellschaft mbH, 1993).
Definitions
[0039] The term "herpes virus" refers to a virus which is a member
of the family herpesviridae. Herpes viruses comprise a linear DNA
genome contained in a capsid. The capsid comprises 162 capsomeres
and is approximately 100-110 nm in diameter. The capsid is
surrounded by an amorphous tegument and enclosed by a envelope
covered with viral glycoprotein spikes. "Human" herpes viruses
(i.e., herpes viruses which infect human cells) include herpes
simplex virus 1 (HSV-1, also known as human herpesvirus 1), herpes
simplex virus 2 (HSV-2, also known as human herpesvirus 2),
varicella-zoster virus (VZV, also known as human herpesvirus 3),
Epstein-Barr virus (EBV, also known as human herpesvirus 4),
cytomegalovirus (CMV, also known as human herpesvirus 5), as well
as human herpesviruses 6, 7, and 8. HSV-1, HSV-2 and VZV are human
members of the subfamily alphaherpesvirinae. "Varicella zoster
virus" or "VZV" refers to VZV which infects human cells.
Alphaherpesvirinae are characterized by a short reproductive cycle,
efficient destruction of infected cells, and the ability to
establish latent infections. Active alphaherpesvirinae infections
result in cutaneous, mucosal and/or sensory neuron lesions.
[0040] "Herpes simplex viruses" include HSV-1 and HSV-2.
[0041] "Exposure" to a virus denotes encounter with virus which
allows infection, such as, for example, upon contact with an
infected individual.
[0042] An individual is "seronegative" for a virus if antibodies
specific to the virus cannot be detected in blood or serum samples
from the individual using methods standard in the art, such as
ELISA. Conversely, an individual is "seropositive" for a virus if
antibodies specific for the virus can be detected in blood or serum
samples from the individual using methods standard in the art, such
as ELISA. An individual is said to "seroconvert" for a virus when
antibodies to the virus can be detected in blood or serum from an
individual who was previously seronegative.
[0043] An individual who is "at risk of being exposed" to a herpes
virus is an individual who may encounter the virus such that the
virus infects the individual (i.e., virus enters cells and
replicates). In the context of HSV-1, given the high prevalence of
HSV-1 infection, an individual at risk of being exposed to HSV-1 is
any individual who is seronegative for HSV-1. In the context of
HSV-2, an individual at risk of being exposed to the virus is an
individual who is seronegative for HSV-2 and who is engaging in one
or more high risk behaviors (i.e., oral sex or sexual relations
without the use of barrier prophylactics). An individual at risk of
being exposed to VZV is an individual who comes in close proximity
to another individual who has active primary or recurrent VZV
lesions.
[0044] "Suppressing" herpes virus infection indicates any aspect of
viral infection, such as viral replication, time course of
infection, amount (titer) of virus, lesions, and/or one or more
symptoms is curtailed, inhibited, or reduced (in terms of severity
and/or duration) in an individual or a population of individuals
treated with an ISS-containing polynucleotide in accordance with
the invention as compared to an aspect of viral infection in an
individual or a population of individuals not treated in accordance
with the invention. Reduction in viral titer includes, but is not
limited to, elimination of the virus from an infected site or
individual. Viral infection can be assessed by any means known in
the art, including, but not limited to, measurement of virus
particles, viral nucleic acid or viral antigens and detection of
one or more symptoms of viral infection and detection and/or
measurement of anti-virus antibodies. Anti-virus antibodies are
widely used to detect and monitor viral infection and generally are
commercially available.
[0045] "Palliating" a disease or one or more symptoms of a disease
or infection means lessening the extent and/or time course of
undesirable clinical manifestations of a disease state or infection
in an individual or population of individuals treated with an ISS
in accordance with the invention.
[0046] As used herein, "delaying" development of a viral infection
or a symptom of viral infection means to defer, hinder, slow,
retard, stabilize, and/or postpone development of the disease or
symptom when compared to not using the method(s) of the invention.
This delay can be of varying lengths of time, depending on the
history of the disease and/or individual being treated. As is
evident to one skilled in the art, a sufficient or significant
delay can, in effect, encompass prevention, in that the individual
does not develop the disease.
[0047] "Reducing severity of a symptom" or "ameliorating a symptom"
of viral infection means a lessening or improvement of one or more
symptoms of viral infection as compared to not administering an
ISS-containing polynucleotide. "Reducing severity" also includes
shortening or reduction in duration of a symptom. For
alphaherpesvirinae, these symptoms are well known in the art and
include, but are not limited to, cutaneous or mucosal lesions
(e.g., cutaneous, oral or genital herpetic sores) and viral
shedding (e.g., virus excretion).
[0048] "Reducing duration of viral infection" means the length of
time of viral infection (usually indicated by symptoms) is reduced,
or shortened, as compared to not administering an ISS-containing
polynucleotide.
[0049] "Preventing a symptom of infection" by a herpes virus means
that the symptom does not appear after exposure to the virus.
[0050] "Reducing recurrence" refers to a reduction in frequency,
severity and/or quantity of one or more recurrent viral symptoms in
an infected individual or a population of infected individuals.
When applied to a population of individuals, "reducing recurrence"
means a reduction in the mean or median frequency, severity,
quantity and/or duration of recurrent viral symptoms.
[0051] The term "infected individual", as used herein, refers to an
individual who has been infected by a herpes virus. For
alphaherpesvirinae, symptoms of infection include seropositivity
(for any of the alphaherpesvirinae), orolabial herpetic lesions
(for HSV-1), genital herpetic lesions (for HSV-2 and occasionally
for HSV-1), the disease varicella, also known as the chicken pox
(for VZV), as well as other symptoms known in the art.
[0052] A "biological sample" encompasses a variety of sample types
obtained from an individual and can be used in a diagnostic or
monitoring assay. The definition encompasses blood and other liquid
samples of biological origin, solid tissue samples such as a biopsy
specimen or tissue cultures or cells derived therefrom, and the
progeny thereof. The definition also includes samples that have
been manipulated in any way after their procurement, such as by
treatment with reagents, solubilization, or enrichment for certain
components, such as proteins or polynucleotides. The term
"biological sample" encompasses a clinical sample, and also
includes cells in culture, cell supernatants, cell lysates, serum,
plasma, biological fluid, and tissue samples.
[0053] "Viral titer" is a term well known in the art and indicates
the amount of virus in a given biological sample. Amount of virus
are indicated by various measurements, including, but not limited
to, amount of viral nucleic acid; presence of viral particles;
replicating units (RU); plaque forming units (PFU). Generally, for
fluid samples such as blood and urine, amount of virus is
determined per unit fluid, such as milliliters. For solid samples
such as tissue samples, amount of virus is determined per weight
unit, such as grams. Methods for determining amount of virus are
known in the art and described herein.
[0054] An "individual" is a vertebrate, preferably a mammal, more
preferably a human. Mammals include, but are not limited to,
humans, farm animals, sport animals, rodents, primates and certain
pets. Vertebrates also include, but are not limited to, birds
(i.e., avian individuals) and reptiles (i.e., reptilian
individuals).
[0055] The term "ISS" as used herein refers to polynucleotide
sequences that effect a measurable immune response as measured in
vitro, in vivo and/or ex vivo. Examples of measurable immune
responses include, but are not limited to, antigen-specific
antibody production, secretion of cytokines, activation or
expansion of lymphocyte populations such as NK cells, CD4.sup.+ T
lymphocytes, CD8.sup.+ T lymphocytes, B lymphocytes, and the like.
Preferably, the ISS sequences preferentially activate a Th1-type
response. A polynucleotide for use in methods of the invention
contains at least one ISS.
[0056] As used interchangeably herein, the terms "polynucleotide"
and "oligonucleotide" include single-stranded DNA (ssDNA),
double-stranded DNA (dsDNA), single-stranded RNA (ssRNA) and
double-stranded RNA (dsRNA), modified oligonucleotides and
oligonucleosides or combinations thereof. The polynucleotide can be
linearly or circularly configured, or the polynucleotide can
contain both linear and circular segments.
[0057] "Adjuvant" refers to a substance which, when added to an
immunogenic agent such as antigen, nonspecifically enhances or
potentiates an immune response to the agent in the recipient host
upon exposure to the mixture.
[0058] An "effective amount" or a "sufficient amount" of a
substance is an amount sufficient to effect beneficial or desired
results, including clinical results. An effective amount can be
administered in one or more administrations. A "therapeutically
effective amount" is an amount to effect beneficial clinical
results, including, but not limited to, alleviation of one or more
symptoms associated with viral infection as well as prevention of
disease (e.g., prevention of one or more symptoms of
infection).
[0059] A microcarrier is considered "biodegradable" if it is
degradable or erodable under normal mammalian physiological
conditions. Generally, a microcarrier is considered biodegradable
if it is degraded (i.e., loses at least 5% of its mass and/or
average polymer length) after a 72 hour incubation at 37.degree. C.
in normal human serum. Conversely, a microcarrier is considered
"nonbiodegradable" if it is not degraded or eroded under normal
mammalian physiological conditions. Generally, a microcarrier is
considered nonbiodegradable if it not degraded (i.e., loses less
than 5% of its mass and/or average polymer length) after at 72 hour
incubation at 37.degree. C. in normal human serum.
[0060] The term "immunostimulatory sequence-microcarrier complex"
or "ISS-MC complex" refers to a complex of an ISS-containing
polynucleotide and a microcarrier. The components of the complex
may be covalently or non-covalently linked. Non-covalent linkages
may be mediated by any non-covalent bonding force, including by
hydrophobic interaction, ionic (electrostatic) bonding, hydrogen
bonds and/or van der Waals attractions. In the case of hydrophobic
linkages, the linkage is generally via a hydrophobic moiety (e.g.,
cholesterol) covalently linked to the ISS.
[0061] As used herein, the term "comprising" and its cognates are
used in their inclusive sense; that is, equivalent to the term
"including" and its corresponding cognates.
[0062] As used herein, the singular form "a", "an", and "the"
includes plural references unless indicated otherwise. For example,
"a" symptom of viral infection includes one or more additional
symptoms.
Methods of the Invention
[0063] The invention provides methods for preventing one or more
symptoms of herpes virus infection, treating, reducing severity of
and/or delaying development of one or more symptoms of herpes virus
infection and reducing recurrence of one or more symptoms of herpes
virus infection by administering an ISS-containing polynucleotide
(used interchangeably herein with "ISS") to an individual without
administering a herpes virus antigen. The herpes virus may be any
of the alphaherpesvirinae, preferably one of the herpes simplex
viruses. An ISS-containing composition which does not include a
herpes virus antigen is administered to an individual at risk of
exposure to, exposed to, infected with and/or exhibiting one or
more symptoms of infection by alphaherpesvirinae. Individuals
receiving ISS are preferably mammal, more preferably human. In
accordance with the invention, herpes virus antigen is not
administered to the individual in conjunction with administration
of an ISS (i.e., is not administered in a separate administration
at or about the time of administration of the ISS). In some
embodiments, the level (e.g., magnitude or amount) of viral
shedding is reduced after administration of ISS.
[0064] In some embodiments, the individual is at risk of being
exposed to virus. Determination of an at risk individual is based
on one or more factors that are associated with disease development
and are generally known by, or can be assessed by, a skilled
clinician. At risk individuals may be especially suitable
candidates to receive ISS, as these individuals are generally
considered to be particularly susceptible to developing symptoms of
infection, which could also further lead to other complications.
For example, in the context of HSV-1 infection, any non-infected
individual is considered at risk, due to the wide spread prevalence
of HSV-1 infection. In the context of HSV-2 infection, an
individual at risk is an individual who practices unsafe sexual
practices (e.g., engages in oral-genital or genital-genital contact
without the use of barrier-type prophylactics). Other examples of
at risk individuals are those who are immunocompromised. An
individual at risk of being exposed to VZV is an individual who
comes in close proximity to another individual who has active
primary or recurrent VZV lesions.
[0065] In other embodiments, the individual is, or has been,
exposed to and/or infected by virus. Exposure to virus is generally
indicated by sufficient contact with an infected individual or
infected location. Exposure can also be indicated by development of
one or more symptoms associated with viral infection. Infection by
virus may be indicated by any of the above, as well as detection of
virus or anti-virus antibodies (i.e., the individual becomes
seropositive) in a biological sample from the individual.
ISS
[0066] The methods of this invention entail administering a
polynucleotide comprising an ISS (or a composition comprising such
a polynucleotide). In accordance with the present invention, the
immunomodulatory polynucleotide contains at least one ISS, and can
contain multiple ISSs. The ISSs can be adjacent within the
polynucleotide, or they can be separated by additional nucleotide
bases within the polynucleotide. Alternately, multiple ISSs may be
delivered as individual polynucleotides.
[0067] ISS have been described in the art and may be readily
identified using standard assays which indicate various aspects of
the immune response, such as cytokine secretion, antibody
production, NK cell activation and T cell proliferation. See, e.g.,
WO 97/28259; WO 98/16247; WO 99/11275; Krieg et al. (1995);
Yamamoto et al. (1992); Ballas et al. (1996); Klinman et al.
(1997); Sato et al. (1996); Pisetsky (1996a); Shimada et al. (1986)
Jpn. J. Cancer Res. 77:808-816; Cowdery et al. (1996) J. Immunol.
156:4570-4575; Roman et al. (1997); and Lipford et al. (1997a).
[0068] The ISS can be of any length greater than 6 bases or base
pairs and generally comprises the sequence 5'-cytosine, guanine-3',
preferably greater than 15 bases or base pairs, more preferably
greater than 20 bases or base pairs in length. As is well-known in
the art, the cytosine of the 5'-cytosine, guanine-3' sequence is
unmethylated. An ISS may also comprise the sequence 5'-purine,
purine, C, G, pyrimidine, pyrimidine, C, G-3'. An ISS may also
comprise the sequence 5'-purine, purine, C, G, pyrimidine,
pyrimidine, C, C-3'. As indicated in polynucleotide sequences
below, an ISS may comprise (i.e., contain one or more of) the
sequence 5'-T, C, G-3'. In some embodiments, an ISS may comprise
the sequence 5'-C, G, pyrimidine, pyrimidine, C, G-3' (such as
5'-CGTTCG-3'). In some embodiments, an ISS may comprise the
sequence 5'-C, G, pyrimidine, pyrimidine, C, G, purine, purine-3'.
In some embodiments, an ISS comprises the sequence 5'-purine,
purine, C, G, pyrimidine, pyrimidine-3' (such as 5'-AACGTT-3').
[0069] In some embodiments, an ISS may comprise the sequence
5'-purine, T, C, G, pyrimidine, pyrimidine-3'.
[0070] In some embodiments, an ISS-containing polynucleotide is
less than about any of the following lengths (in bases or base
pairs): 10,000; 5,000; 2500; 2000; 1500; 1250; 1000; 750; 500; 300;
250; 200; 175; 150; 125; 100; 75; 50; 25; 10. In some embodiments,
an ISS-containing polynucleotide is greater than about any of the
following lengths (in bases or base pairs): 8; 10; 15; 20; 25; 30;
40; 50; 60; 75; 100; 125; 150; 175; 200; 250; 300; 350; 400; 500;
750; 1000; 2000; 5000; 7500; 10000; 20000; 50000. Alternately, the
ISS can be any of a range of sizes having an upper limit of 10,000;
5,000; 2500; 2000; 1500; 1250; 1000; 750; 500; 300; 250; 200; 175;
150; 125; 100; 75; 50; 25; or 10 and an independently selected
lower limit of 8; 10; 15; 20; 25; 30; 40; 50; 60; 75; 100; 125;
150; 175; 200; 250; 300; 350; 400; 500; 750; 1000; 2000; 5000;
7500, wherein the lower limit is less than the upper limit.
[0071] In some embodiments, the ISS comprises any of the following
sequences: TABLE-US-00001 GACGCTCC; GACGTCCC; GACGTTCC; GACGCCCC;
AGCGTTCC; AGCGCTCC; AGCGTCCC; AGCGCCCC; AACGTCCC; AACGCCCC;
AACGTTCC; AACGCTCC; GGCGTTCC; GGCGCTCC; GGCGTCCC; GGCGCCCC;
GACGCTCG; GACGTCCG; GACGCCCG; GACGTTCG; AGCGCTCG; AGCGTTCG;
AGCGTCCG; AGCGCCCG; AACGTCCG; AACGCCCG; AACGTTCG; AACGCTCG;
GGCGTTCG; GGCGCTCG; GGCGTCCG; GGCGCCCG.
In some embodiments, the immunomodulatory polynucleotide comprises
the sequence 5'-TGACTGTGAACGTTCGAGATGA-3' (SEQ ID NO:1).
[0072] In some embodiments, the ISS comprises any of the following
sequences: TABLE-US-00002 GACGCU; GACGUC; GACGUU; GACGUT; GACGTU;
AGCGUU; AGCGCU; AGCGUC; AGCGUT; AGCGTU; AACGUC; AACGUU; AACGCU;
AACGUT; AACGTU; GGCGUU; GGCGCU; GGCGUC; GGCGUT; GGCGTU.
[0073] In some embodiments, the ISS comprises any of the following
sequences: GABGCTCC; GABGTCCC; GABGTTCC; GABGCCCC; AGBGTTCC;
AGBGCTCC; AGBGTCCC; AGBGCCCC; AABGTCCC; AABGCCCC; AABGTTCC;
AABGCTCC; GGBGTTCC; GGBGCTCC; GGBGTCCC; GGBGCCCC; GABGCTCG;
GABGTCCG; GABGCCCG; GABGTTCG; AGBGCTCG; AGBGTTCG; AGBGTCCG;
AGBGCCCG; AABGTCCG; AABGCCCG; AABGTTCG; AABGCTCG; GGBGTTCG;
GGBGCTCG; GGBGTCCG; GGBGCCCG; GABGCTBG; GABGTCBG; GABGCCBG;
GABGTTBG; AGBGCTBG; AGBGTTBG; AGBGTCBG; AGBGCCBG; AABGTCBG;
AABGCCBG; AABGTTBG; AABGCTBG; GGBGTTBG; GGBGCTBG; GGBGTCBG;
GGBGCCBG, where B is 5-bromocytosine.
[0074] In some embodiments, the ISS comprises any of the following
sequences: GABGCUCC; GABGUCCC; GABGUTCC; GABGTUCC; GABGUUCC;
AGBGUUCC; AGBGTUCC; AGBGUTCC; AGBGCUCC; AGBGUCCC; AABGUCCC;
AABGUUCC; AABGUTCC; AABGTUCC; AABGCUCC; GGBGUUCC; GGBGUTCC;
GGBGTUCC; GGBGCUCC; GGBGUCCC; GABGCUCG; GABGUCCG; GABGUUCG;
GABGUTCG; GABGTUCG; AGBGCUCG; AGBGUUCG; AGBGUTCG; AGBGTUCG;
AGBGUCCG; AABGUCCG; AABGUUCG; AABGUTCG; AABGTUCG; AABGCUCG;
GGBGUUCG; GGBGUTCG; GGBGTUCG; GGBGCUCG; GGBGUCCG; GABGCUBG;
GABGUCBG; GABGUUBG; GABGUTBG; GABGTUBG; AGBGCUBG; AGBGUUBG;
AGBGUCBG; AGBGUTBG; AGBGTUBG; AABGUCBG; AABGUUBG; AABGUTBG;
AABGTUBG; AABGCUBG; GGBGUUBG; GGBGUTBG; GGBGTUBG; GGBGCUBG;
GGBGUCBG, where B is 5-bromocytosine.
[0075] In other embodiments, the ISS comprises any of the
sequences: 5'-TGACCGTGAACGTTCGAGATGA-3' (SEQ ID NO:2);
5'-TCATCTCGAACGTTCCACAGTCA-3' (SEQ ID NO:3);
5'-TGACTGTGAACGTTCCAGATGA-3' (SEQ ID NO:4);
5'-TCCATAACGTTCGCCTAACGTTCGTC-3' (SEQ ID NO: 5);
5'-TGACTGTGAABGTTCCAGATGA-3' (SEQ ID NO:6), where B is
5-bromocytosine; 5'-TGACTGTGAABGTTCGAGATGA-3' (SEQ ID NO:7), where
B is 5-bromocytosine and 5'-TGACTGTGAABGTTBGAGATGA-3' (SEQ ID
NO:8), where B is 5-bromocytosine.
[0076] In some embodiments, the immunomodulatory polynucleotide
comprises the sequence 5'-TCGTCGAACGTTCGTTAACGTTCG-3' (SEQ ID
NO:9).
[0077] An ISS and/or ISS-containing polynucleotide may contain
modifications. Modifications of ISS include any known in the art,
but are not limited to, modifications of the 3'-OH or 5'-OH group,
modifications of the nucleotide base, modifications of the sugar
component, and modifications of the phosphate group. Various such
modifications are described below.
[0078] An ISS may be single stranded or double stranded DNA, as
well as single or double-stranded RNA or other modified
polynucleotides. An ISS may or may not include one or more
palindromic regions, which may be present in the motifs described
above or may extend beyond the motif. An ISS may comprise
additional flanking sequences, some of which are described herein.
An ISS may contain naturally-occurring or modified, non-naturally
occurring bases, and may contain modified sugar, phosphate, and/or
termini. For example, phosphate modifications include, but are not
limited to, methyl phosphonate, phosphorothioate, phosphoramidate
(bridging or non-bridging), phosphotriester and phosphorodithioate
and may be used in any combination. Other non-phosphate linkages
may also be used. Preferably, polynucleotides of the present
invention comprise phosphorothioate backbones. Sugar modifications
known in the field, such as 2'-alkoxy-RNA analogs, 2'-amino-RNA
analogs and 2'-alkoxy- or amino-RNA/DNA chimeras and others
described herein, may also be made and combined with any phosphate
modification. Examples of base modifications include, but are not
limited to, addition of an electron-withdrawing moiety to C-5
and/or C-6 of a cytosine of the ISS (e.g., 5-bromocytosine,
5-chlorocytosine, 5-fluorocytosine, 5-iodocytosine).
[0079] The ISS can be synthesized using techniques and nucleic acid
synthesis equipment which are well known in the art including, but
not limited to, enzymatic methods, chemical methods, and the
degradation of larger polynucleotide sequences. See, for example,
Ausubel et al. (1987); and Sambrook et al. (1989). When assembled
enzymatically, the individual units can be ligated, for example,
with a ligase such as T4 DNA or RNA ligase. U.S. Pat. No.
5,124,246. Polynucleotide degradation can be accomplished through
the exposure of an polynucleotide to a nuclease, as exemplified in
U.S. Pat. No. 4,650,675.
[0080] The ISS can also be isolated using conventional
polynucleotide isolation procedures. Such procedures include, but
are not limited to, hybridization of probes to genomic or cDNA
libraries and synthesis of particular native sequences by the
polymerase chain reaction.
[0081] Circular ISS can be isolated, synthesized through
recombinant methods, or chemically synthesized. Where the circular
ISS is obtained through isolation or through recombinant methods,
the ISS will preferably be a plasmid. The chemical synthesis of
smaller circular oligonucleotides can be performed using any method
described in the literature. See, for instance, Gao et al. (1995)
Nucleic Acids Res. 23:2025-2029; and Wang et al. (1994) Nucleic
Acids Res. 22:2326-2333.
[0082] The techniques for making polynucleotides and modified
polynucleotides are known in the art. Naturally occurring DNA or
RNA, containing phosphodiester linkages, is generally synthesized
by sequentially coupling the appropriate nucleoside phosphoramidite
to the 5'-hydroxy group of the growing polynucleotide attached to a
solid support at the 3'-end, followed by oxidation of the
intermediate phosphite triester to a phosphate triester. Once the
desired polynucleotide sequence has been synthesized, the
polynucleotide is removed from the support, the phosphate triester
groups are deprotected to phosphate diesters and the nucleoside
bases are deprotected using aqueous ammonia or other bases. See,
for example, Beaucage (1993) "Oligodeoxyribonucleotide Synthesis"
in Protocols for Oligonucleotides and Analogs, Synthesis and
Properties (Agrawal, ed.) Humana Press, Totowa, N.J.; Warner et al.
(1984) DNA 3:401 and U.S. Pat. No. 4,458,066.
[0083] The ISS can also contain phosphate-modified polynucleotides.
Synthesis of polynucleotides containing modified phosphate linkages
or non-phosphate linkages is also know in the art. For a review,
see Matteucci (1997) "Oligonucleotide Analogs: an Overview" in
Oligonucleotides as Therapeutic Agents, (D. J. Chadwick and G.
Cardew, ed.) John Wiley and Sons, New York, N.Y. The phosphorous
derivative (or modified phosphate group) which can be attached to
the sugar or sugar analog moiety in the polynucleotides of the
present invention can be a monophosphate, diphosphate,
triphosphate, alkylphosphonate, phosphorothioate,
phosphorodithioate or the like. The preparation of the above-noted
phosphate analogs, and their incorporation into nucleotides,
modified nucleotides and polynucleotides, per se, is also known and
need not be described here in detail. Peyrottes et al. (1996)
Nucleic Acids Res. 24:1841-1848; Chaturvedi et al. (1996) Nucleic
Acids Res. 24:2318-2323; and Schultz et al. (1996) Nucleic Acids
Res. 24:2966-2973. For example, synthesis of phosphorothioate
polynucleotides is similar to that described above for naturally
occurring polynucleotides except that the oxidation step is
replaced by a sulfurization step (Zon (1993) "Oligonucleoside
Phosphorothioates" in Protocols for Oligonucleotides and Analogs,
Synthesis and Properties (Agrawal, ed.) Humana Press, pp. 165-190).
Similarly the synthesis of other phosphate analogs, such as
phosphotriester (Miller et al. (1971) JACS 93:6657-6665),
non-bridging phosphoramidates (Jager et al. (1988) Biochem.
27:7247-7246), N3' to P5' phosphoramidates (Nelson et al. (1997)
JOC 62:7278-7287) and phosphorodithioates (U.S. Pat. No. 5,453,496)
has also been described. Other non-phosphorous based modified
polynucleotides can also be used (Stirchak et al. (1989) Nucleic
Acids Res. 17:6129-6141). Polynucleotides with phosphorothioate
backbones can be more immunogenic than those with phosphodiester
backbones and appear to be more resistant to degradation after
injection into the host. Braun et al. (1988) J. Immunol.
141:2084-2089; and Latimer et al. (1995) Mol. Immunol.
32:1057-1064.
[0084] ISS-containing polynucleotides used in the invention can
comprise ribonucleotides (containing ribose as the only or
principal sugar component), deoxyribonucleotides (containing
deoxyribose as the principal sugar component), or, as is known in
the art, modified sugars or sugar analogs can be incorporated in
the ISS. Thus, in addition to ribose and deoxyribose, the sugar
moiety can be pentose, deoxypentose, hexose, deoxyhexose, glucose,
arabinose, xylose, lyxose, and a sugar "analog" cyclopentyl group.
The sugar can be in pyranosyl or in a furanosyl form. In the ISS,
the sugar moiety is preferably the furanoside of ribose,
deoxyribose, arabinose or 2'-O-alkylribose, and the sugar can be
attached to the respective heterocyclic bases either in .alpha. or
.beta. anomeric configuration. Sugar modifications include, but are
not limited to, 2'-alkoxy-RNA analogs, 2'-amino-RNA analogs and
2'-alkoxy- or amino-RNA/DNA chimeras. The preparation of these
sugars or sugar analogs and the respective "nucleosides" wherein
such sugars or analogs are attached to a heterocyclic base (nucleic
acid base) per se is known, and need not be described here, except
to the extent such preparation can pertain to any specific example.
Sugar modifications may also be made and combined with any
phosphate modification in the preparation of an ISS.
[0085] The heterocyclic bases, or nucleic acid bases, which are
incorporated in the ISS can be the naturally-occurring principal
purine and pyrimidine bases, (namely uracil or thymine, cytosine,
adenine and guanine, as mentioned above), as well as
naturally-occurring and synthetic modifications of said principal
bases.
[0086] Those skilled in the art will recognize that a large number
of "synthetic" non-natural nucleosides comprising various
heterocyclic bases and various sugar moieties (and sugar analogs)
are available in the art, and that as long as other criteria of the
present invention are satisfied, the ISS can include one or several
heterocyclic bases other than the principal five base components of
naturally-occurring nucleic acids. Preferably, however, the
heterocyclic base in the ISS includes, but is not limited to,
uracil-5-yl, cytosin-5-yl, adenin-7-yl, adenin-8-yl, guanin-7-yl,
guanin-8-yl, 4-aminopyrrolo[2.3-d]pyrimidin-5-yl,
2-amino-4-oxopyrolo[2,3-d]pyrimidin-5-yl,
2-amino-4-oxopyrrolo[2.3-d]pyrimidin-3-yl groups, where the purines
are attached to the sugar moiety of the ISS via the 9-position, the
pyrimidines via the 1-position, the pyrrolopyrimidines via the
7-position and the pyrazolopyrimidines via the 1-position.
[0087] The ISS may comprise at least one modified base as
described, for example, in the commonly owned international
application WO 99/62923. As used herein, the term "modified base"
is synonymous with "base analog", for example, "modified cytosine"
is synonymous with "cytosine analog." Similarly, "modified"
nucleosides or nucleotides are herein defined as being synonymous
with nucleoside or nucleotide "analogs." Examples of base
modifications include, but are not limited to, addition of an
electron-withdrawing moiety to C-5 and/or C-6 of a cytosine of the
ISS. Preferably, the electron-withdrawing moiety is a halogen. Such
modified cytosines can include, but are not limited to,
azacytosine, 5-bromocytosine, bromouracil, 5-chlorocytosine,
chlorinated cytosine, cyclocytosine, cytosine arabinoside,
5-fluorocytosine, fluoropyrimidine, fluorouracil,
5,6-dihydrocytosine, 5-iodocytosine, hydroxyurea, iodouracil,
5-nitrocytosine, uracil, and any other pyrimidine analog or
modified pyrimidine.
[0088] The preparation of base-modified nucleosides, and the
synthesis of modified polynucleotides using said base-modified
nucleosides as precursors, has been described, for example, in U.S.
Pat. Nos. 4,910,300, 4,948,882, and 5,093,232. These base-modified
nucleosides have been designed so that they can be incorporated by
chemical synthesis into either terminal or internal positions of an
polynucleotide. Such base-modified nucleosides, present at either
terminal or internal positions of an polynucleotide, can serve as
sites for attachment of a peptide or other antigen. Nucleosides
modified in their sugar moiety have also been described (including,
but not limited to, e.g., U.S. Pat. Nos. 4,849,513, 5,015,733,
5,118,800, 5,118,802) and can be used similarly.
[0089] The ISS used in the methods of the invention may be produced
as ISS-microcarrier complexes. ISS-microcarrier complexes comprise
an ISS-containing polynucleotide bound to a microcarrier (MC).
ISS-MC complexes comprise an ISS bound to the surface of a
microcarrier (i.e., the ISS is not encapsulated in the MC),
adsorbed within a microcarrier (e.g., adsorbed to PLGA beads), or
encapsulated within a MC (e.g., incorporated within liposomes).
[0090] ISS-containing oligonucleotides bound to microparticles
(SEPHAROSE.RTM. beads) have previously been shown to have
immunostimulatory activity in vitro (Liang et al., (1996), J. Clin.
Invest. 98:1119-1129). However, recent results show that
ISS-containing oligonucleotides bound to gold, latex and magnetic
particles are not active in stimulating proliferation of 7TD1
cells, which proliferate in response to ISS-containing
oligonucleotides (Manzel et al., (1999), Antisense Nuc. Acid Drug
Dev. 9:459-464).
[0091] Microcarriers are not soluble in pure water, and are less
than about 50-60 .mu.m in size, preferably less than about 10 .mu.m
in size, more preferably from about 10 nm to about 10 .mu.m, 25 nm
to about 5 .mu.m, 50 nm to about 4.5 .mu.m or 1.0 .mu.m to about
2.0 .mu.m in size. Microcarriers may be any shape, such as
spherical, ellipsoidal, rod-shaped, and the like, although
spherical microcarriers are normally preferred. Preferred
microcarriers have sizes of or about 50 nm, 200 nm, 1 .mu.m, 1.2
.mu.m, 1.4 .mu.m, 1.5 .mu.m, 1.6 .mu.m, 1.8 .mu.m, 2.0 .mu.m, 2.5
.mu.m or 4.5 .mu.m. The "size" of a microcarrier is generally the
"design size" or intended size of the particles stated by the
manufacturer. Size may be a directly measured dimension, such as
average or maximum diameter, or may be determined by an indirect
assay such as a filtration screening assay. Direct measurement of
microcarrier size is typically carried out by microscopy, generally
light microscopy or scanning electron microscopy (SEM), in
comparison with particles of known size or by reference to a
micrometer. As minor variations in size arise during the
manufacturing process, microcarriers are considered to be of a
stated size if measurements show the microcarriers are +about 5-10%
of the stated measurement. Size characteristics may also be
determined by dynamic light scattering. Alternately, microcarrier
size may be determined by filtration screening assays. A
microcarrier is less than a stated size if at least 97% of the
particles pass through a "screen-type" filter (i.e., a filter in
which retained particles are on the surface of the filter, such as
polycarbonate or polyethersulfone filters, as opposed to a "depth
filter" in which retained particles lodge within the filter) of the
stated size. A microcarrier is larger than a stated size if at
least about 97% of the microcarrier particles are retained by a
screen-type filter of the stated size. Thus, at least about 97%
microcarriers of about 10 .mu.m to about 10 nm in size pass through
a 10 .mu.m pore screen filter and are retained by a 10 nm screen
filter.
[0092] As above discussion indicates, reference to a size or size
range for a microcarrier implicitly includes approximate variations
and approximations of the stated size and/or size range. This is
reflected by use of the term "about" when referring to a size
and/or size range, and reference to a size or size range without
reference to "about" does not mean that the size and/or size range
is exact.
[0093] Microcarriers may be solid phase (e.g., polystyrene beads)
or liquid phase (e.g., liposomes, micelles, or oil droplets in an
oil and water emulsion). Liquid phase microcarriers include
liposomes, micelles, oil droplets and other lipid or oil-based
particles. One preferred liquid phase microcarrier is oil droplets
within an oil-in-water emulsion. Preferably, oil-in-water emulsions
used as microcarriers comprise biocompatible substituents such as
squalene. Liquid phase microcarriers are normally considered
nonbiodegradable, but may be biodegradable liquid phase
microcarriers may be produced by incorporation of one or more
biodegradable polymers in the liquid microcarrier formulation. In
one preferred embodiment, the microcarrier is oil droplets in an
oil-in-water emulsion prepared by emulsification of squalene,
sorbitan trioleate, TWEEN 80.RTM. in an aqueous pH buffer.
[0094] Solid phase microcarriers for use in ISS-microcarrier
complexes may be made from biodegradable materials or
nonbiodegradable materials, and may include or exclude agarose or
modified agarose microcarriers. Useful solid phase biodegradable
microcarriers include, but are not limited to: biodegradable
polyesters, such as poly(lactic acid), poly(glycolic acid), and
copolymers (including block copolymers) thereof, as well as block
copolymers of poly(lactic acid) and poly(ethylene glycol);
polyorthoesters such as polymers based on
3,9-diethylidene-2,4,8,10-tetraoxaspiro[5.5]undecane (DETOSU);
polyanhydrides such as poly(anhydride) polymers based on sebacic
acid, p-(carboxyphenoxy)propane, or p-(carboxyphenoxy)hexane;
polyanhydride imides, such as polyanhydride polymers based on
sebacic acid-derived monomers incorporating amino acids (i.e.,
linked to sebacic acid by imide bonds through the amino-terminal
nitrogen) such as glycine or alanine; polyanhydride esters;
polyphosphazenes, especially poly(phosphazenes) which contain
hydrolysis-sensitive ester groups which can catalyze degradation of
the polymer backbone through generation of carboxylic acid groups
(Schacht et al. (1996) Biotechnol. Bioeng. 1996:102); and
polyamides such as poly(lactic acid-co-lysine). A wide variety of
nonbiodegradable materials suitable for manufacturing microcarriers
are also known, including, but not limited to polystyrene,
polyethylene, latex, gold, and ferromagnetic or paramagnetic
materials. Solid phase microcarriers may be covalently modified to
incorporate one or more moieties for use in linking the ISS, for
example by addition of amine groups for covalent linking using
amine-reactive crosslinkers.
[0095] The ISS-microcarrier complexes may be covalently or
non-covalently linked. Covalently linked ISS-MC complexes may be
directly linked or be linked by a crosslinking moiety of one or
more atoms (typically the residue of a crosslinking agent). The ISS
may be modified to allow or augment binding to the MC (e.g., by
incorporation of a free sulfhydryl for covalent crosslinking or
addition of a hydrophobic moieties such as lipids, steroids,
sterols such as cholesterol, and terpenes, for hydrophobic
bonding), although unmodified ISS may be used for formation of
non-covalent ISS-MC complex formation by electrostatic interaction
or by base pairing (e.g., by base pairing at least one portion of
the ISS with a complementary oligonucleotide bound to the
microcarrier). ISS-containing polynucleotides may be linked to
solid phase microcarriers or other chemical moieties to facilitate
ISS-MC complex formation using conventional technology known in the
art, such as use of available heterobifunctional crosslinkers
(e.g., succinimidyl 4-(N-maleimidomethyl)cyclohexane-1-carboxylate
or its sulfo-derivatives for covalently linking an
amine-derivatized microcarrier and an ISS modified to contain a
free sulfhydryl) or by addition of compounds such as cholesterol
(e.g., by the method of Godard et al. (1995) Eur. J. Biochem.
232:404-410) to facilitate binding to hydrophobic microcarriers
such as oil droplets in oil-in-water emulsions. Alternatively,
modified nucleosides or nucleotides, such as are known in the art,
can be incorporated at either terminus, or at internal positions in
the ISS. These can contain blocked functional groups which, when
deblocked, are reactive with a variety of functional groups which
can be present on, or attached to, the microcarrier or a moiety
which would facilitate binding to a microcarrier. Certain
embodiments of noncovalently linked ISS-MC complexes utilize a
binding pair (e.g., an antibody and its cognate antigen or biotin
and streptavidin or avidin), where one member of the binding pair
is bound to the ISS and the microcarrier is derivatized with the
other member of the binding pair (e.g., a biotinylated ISS and a
streptavidin-derivatized microcarrier may be combined to form a
noncovalently linked ISS-MC complex).
[0096] Non-covalent ISS-MC complexes bound by electrostatic binding
typically exploit the highly negative charge of the polynucleotide
backbone. Accordingly, microcarriers for use in non-covalently
bound ISS-MC complexes are generally positively charged (e.g.,
cationic) at physiological pH (e.g., about pH 6.8-7.4). The
microcarrier may intrinsically possess a positive charge, but
microcarriers made from compounds not normally possessing a
positive charge may be derivatized or otherwise modified to become
positively charged (e.g., cationic). For example, the polymer used
to make the microcarrier may be derivatized to add positively
charged groups, such as primary amines. Alternately, positively
charged compounds may be incorporated in the formulation of the
microcarrier during manufacture (e.g., positively charged
surfactants may be used during the manufacture of poly(lactic
acid)/poly(glycolic acid) copolymers to confer a positive charge on
the resulting microcarrier particles.
[0097] Solid phase microspheres are prepared using techniques known
in the art. For example, they can be prepared by emulsion-solvent
extraction/evaporation technique. Generally, in this technique,
biodegradable polymers such as polyanhydrates,
poly(alkyl-.alpha.-cyanoacrylates) and poly(.alpha.-hydroxy
esters), for example, poly(lactic acid), poly(glycolic acid),
poly(D,L-lactic-co-glycolic acid) and poly(caprolactone), are
dissolved in a suitable organic solvent, such as methylene
chloride, to constitute the dispersed phase (DP) of emulsion. DP is
emulsified by high-speed homogenization into excess volume of
aqueous continuous phase (CP) that contains a dissolved surfactant,
for example, polyvinylalcohol (PVA) or polyvinylpyirrolidone (PVP).
Surfactant in CP is to ensure the formation of discrete and
suitably-sized emulsion droplet. The organic solvent is then
extracted into the CP and subsequently evaporated by raising the
system temperature. The solid microparticles are then separated by
centrifugation or filtration, and dried, for example, by
lyophilization or application of vacuum, before storing at
4.degree. C.
[0098] Generally, to prepare cationic microspheres, cationic lipids
or polymers, for example,
1,2-dioleoyl-1,2,3-trimethylammoniopropane (DOTAP),
cetyltrimethylammonium bromide (CTAB) or polylysine, are added
either to DP or CP, as per their solubility in these phases.
[0099] Physico-chemical characteristics such as mean size, size
distribution and surface charge of dried microspheres may be
determined. Size characteristics are determined, for example, by
dynamic light scattering technique and the surface charge was
determined by measuring the zeta potential.
[0100] Generally, ISS-containing polynucleotides can be adsorbed
onto the cationic microspheres by overnight aqueous incubation of
ISS and the particles at 4.degree. C. Microspheres are
characterized for size and surface charge before and after ISS
association. Selected batches may then evaluated for activity as
described herein.
Administration
[0101] An ISS-containing polynucleotide may be administered before,
during and/or after exposure to a herpes virus. An ISS
polynucleotide may also be administered before, during and/or after
infection by a herpes virus. An ISS polynucleotide may also be
administered before or after onset of symptoms of herpes virus
infection. Accordingly, administration of ISS-containing
polynucleotide may be at various times with respect to exposure to,
infection by and/or onset of symptoms of infection by virus.
Further, there may be one or more administrations. If the
ISS-containing polynucleotide is administered on multiple
occasions, the ISS may be administered on any schedule selected by
the clinician, such as daily, every other day, every three days,
every four days, every five days, every six days, weekly, biweekly,
monthly or at ever longer intervals (which may or may not remain
the same during the course of treatment). Where multiple
administrations are given, the ISS-containing polynucleotide may be
given in 2, 3, 4, 5, 6, 7, 8, 9, 10 or more separate
administrations.
[0102] When ISS-containing polynucleotide is administered to an
individual at risk of exposure to virus (i.e., before infection),
ISS-containing polynucleotide is preferably administered less than
about 14 days before exposure to virus, preferably less than about
10 days before exposure to virus, more preferably less than about 7
days before exposure to virus, even more preferably less than about
5 days before exposure to virus. In some embodiments,
ISS-containing polynucleotide is administered about 3 days before
exposure to virus.
[0103] In a further embodiment, the ISS-containing polynucleotide
is administered after exposure to a herpes virus, but prior to
appearance of symptoms. This embodiment is particularly relevant
with respect to HSV-2 and VZV. Preferably, the ISS-containing
polynucleotide is administered less than about three days after
exposure, more preferably less than about one day, 12 hours, six
hours or two hours after exposure, if the time of exposure is known
or suspected.
[0104] In another embodiment, the ISS-containing polynucleotide is
administered after appearance of at least one symptom of herpes
virus infection. Preferably, ISS-containing polynucleotide is
administered within about 28, 21, 14, 7, 5 or 3 days following
appearance of a symptom of herpes virus infection. However, some
infected individuals exhibiting symptoms will already have
undertaken one or more courses of treatment with another therapy.
In such individuals, or in individuals who failed to appreciate the
import of their symptoms, the ISS-containing polynucleotide may be
administered at any point following infection.
[0105] Additionally, treatments employing an ISS-containing
polynucleotide may also be employed in conjunction with other
treatments or as `second line` treatments employed after failure of
a `first line` treatment. Treatments for herpes virus infection are
known in the art.
[0106] ISS polynucleotides may be formulated in any form known in
the art, such as dry powder, semi-solid or liquid formulations. For
parenteral administration ISS polynucleotides preferably
administered in a liquid formulation, although solid or semi-solid
formulations may also be acceptable, particularly where the ISS
polynucleotide is formulated in a slow release depot form. ISS
polynucleotides are generally formulated in liquid or dry powder
form for topical administration, although semi-solid formulations
may be useful.
[0107] ISS polynucleotide formulations may contain additional
components such as salts, buffers, bulking agents, osmolytes,
antioxidants, detergents, surfactants and other
pharmaceutically-acceptable excipients as are known in the art.
Generally, liquid ISS polynucleotide formulations made in USP water
for injection and are sterile, isotonic and pH buffered to a
physiologically-acceptable pH, such as about pH 6.8 to 7.5.
[0108] ISS-containing polynucleotides may be formulated in delivery
vehicles such as liposomes, oil/water emulsion or slow release
depot formulations. Methods of formulating polynucleotides in such
forms are well known in the art.
[0109] ISS-containing polynucleotide formulations may also include
or exclude immunomodulatory agents such as adjuvants and
immunostimulatory cytokines, which are well known in the art.
[0110] A suitable dosage range or effective amount is one that
provides the desired reduction of symptoms and/or suppression of
viral infection and depends on a number of factors, including the
particular herpes virus, ISS sequence of the polynucleotide,
molecular weight of the polynucleotide and route of administration.
Dosages are generally selected by the physician or other health
care professional in accordance with a variety of parameters known
in the art, such as severity of symptoms, history of the patient
and the like. Generally, for an ISS-containing polynucleotide of
about 20 bases, a dosage range may be selected from, for example,
an independently selected lower limit such as about 0.1, 0.25, 0.5,
1, 2, 5, 10, 20, 30 40, 50 60, 80, 100, 200, 300, 400 or 500
.mu.g/kg up to an independently selected upper limit, greater than
the lower limit, of about 60, 80, 100, 200, 300, 400, 500, 750,
1000, 1500, 2000, 3000, 4000, 5000, 6000, 7000, 8000, 9000 or
10,000 .mu.g/kg. For example, a dose may be about any of the
following: 0.1 to 100 .mu.g/kg, 0.1 to 50 .mu.g/kg, 0.1 to 25
.mu.g/kg, 0.1 to 10 .mu.g/kg, 1 to 500 .mu.g/kg, 100 to 400
.mu.g/kg, 200 to 300 .mu.g/kg, 1 to 100 .mu.g/kg, 100 to 200
.mu.g/kg, 300 to 400 .mu.g/kg, 400 to 500 .mu.g/kg, 500 to 1000
.mu.g/kg, 500 to 5000 .mu.g/kg, or 500 to 10,000 .mu.g/kg.
Generally, parenteral routes of administration require higher doses
of ISS compared to more direct application to infected tissue, as
do ISS-containing polynucleotides of increasing length.
[0111] Polynucleotides comprising an ISS may be administered by
systemic (e.g., parenteral) or local (e.g., topical)
administration.
[0112] In one embodiment, the ISS-containing polynucleotide(s) is
topically administered. Topical administration may be at the site
of infection (e.g. genital region in the case of HSV-2), it may be
at a site of a symptom (e.g., a herpetic lesion) or it may be at
the site of possible exposure to herpes virus (e.g., genital
region).
[0113] In another embodiment, the ISS-containing polynucleotide(s)
is injected locally into the area of lesion(s). Intralesional
injection may be at the site of infection (e.g., genital region in
the case HSV-2) or it may be at a site of a symptom (e.g., a
herpetic lesion).
[0114] In other embodiments, the ISS-containing polynucleotide is
administered parenterally. Parenteral routes of administration
include, but are not limited to, transdermal, transmucosal,
nasopharyngeal, pulmonary and direct injection. Parenteral
administration by injection may be by any parenteral injection
route, including, but not limited to, intravenous (IV),
intraperitoneal (IP), intramuscular (IM), subcutaneous (SC) and
intradermal (ID) routes. Transdermal and transmucosal
administration may be accomplished by, for example, inclusion of a
carrier (e.g., dimethylsulfoxide, DMSO), by application of
electrical impulses (e.g., iontophoresis) or a combination thereof.
A variety of devices are available for transdermal administration
which may be used in accordance with the invention.
[0115] Nasopharyngeal and pulmonary routes of administration
include, but are not limited to, intranasal, inhalation,
transbronchial and transalveolar routes. The ISS-containing
polynucleotide may thus be administered by inhalation of aerosols,
atomized liquids or powders. Devices suitable for administration by
inhalation of ISS-containing compositions include, but are not
limited to, nebulizers, atomizers, vaporizers, and metered-dose
inhalers. Nebulizers, atomizers, vaporizers and metered-dose
inhalers filled with or employing reservoirs containing
formulations comprising the ISS-containing polynucleotide(s) are
among a variety of devices suitable for use in inhalation delivery
of the ISS-containing polynucleotide(s). Other methods of
delivering to respiratory mucosa include delivery of liquid
formulations, such as by nose drops.
[0116] IV, IP, IM and ID administration may be by bolus or infusion
administration. For SC administration, administration may be by
bolus, infusion or by implantable device; such as an implantable
minipump (e.g., osmotic or mechanical minipump) or slow release
implant. The ISS polynucleotide(s) may also be delivered in a slow
release formulation adapted for IV, IP, IM, ID or SC
administration. Administration by inhalation is preferably
accomplished in discrete doses (e.g., via a metered dose inhaler),
although delivery similar to an infusion may be accomplished
through use of a nebulizer. Administration via the transdermal and
transmucosal routes may be continuous or pulsatile.
Assessment
[0117] In some embodiments, administration of an ISS-containing
polynucleotide results in prevention, palliation, and/or
improvement in one or more symptoms of herpes virus infection. The
exact form of prevention, palliation or improvement will depend on
the particular herpes virus, but includes reduction in size and/or
duration of herpetic lesions (for all alphaherpesvirinae),
reduction in symptoms of varicella (for VZV) or reduction in
frequency or number of recurrent herpetic lesions (for all
alphaherpesvirinae). In some embodiments, administration of an
ISS-containing polynucleotide results in a reduction in viral titer
(which indicates suppression of viral infection). In other
embodiments, viral shedding (e.g., virus excretion) is reduced. In
some embodiments, the level (e.g., magnitude or amount) of viral
shedding is reduced. Viral shedding can occur with or without
symptoms at the time of primary, initial or recurrent infection and
may be detected, for example, by examination of tissue scrapings
from suspected areas of infection for the presence of virus or
virus nucleic acid. In other embodiments, viral infection is
suppressed, which may be indicated by any one or more of a number
of parameters, including, but not limited to, extent of one or more
symptoms and viral titer. In other embodiments, recurrence, which
is generally indicated by appearance of one or more symptoms
associated with infection, is reduced.
[0118] Symptoms of infection may be assessed before and after
administration of ISS-containing polynucleotide by the individual
or the clinician. As will be apparent to one of skill in the art,
the symptoms will vary depending on the particular herpes virus and
the site of the symptoms. Symptoms of herpes simplex virus
infection, which are well known in the art, include herpetic
lesion, viral shedding, and, in some cases, neurovirulence.
Symptoms of VZV infection include cutaneous and mucosal varicella
lesions and fever and in recurrences, cutaneous lesions and
neuropathy, particular of sensory nerves.
[0119] Viral titer may be assessed in biological samples using
standard methods of the art. Levels of viral nucleic acid may be
assessed by isolating nucleic acid from the sample and blot
analysis using a viral polynucleotide sequence as a probe, or PCR
analysis. Another method is to perform in situ hybridization with
virus-specific probes. Other assays include biological measures
such as quantitation of plaque forming units (PFU) or virus induced
cytopathic effects (CPE), such as formation of syncytia. Extent or
amount of viral particles may be measured from any infected area,
such as infected tissue or mucosal discharge. When the sample is a
liquid, viral titer is calculated in some indication of number or
amount of virus or virus particles (e.g., infectious particles,
plaque forming units, infectious doses, or median tissue culture
infectious doses (TCID 50)) per unit volume. In solid samples, such
as a tissue sample, viral titer is calculated in virus particles
per unit weight. Reduction is indicated by comparing viral titer to
viral titer measured at an earlier time point, and/or comparing to
an estimated titer (based, for example, on animal or clinical
studies) that represents untreated infection.
Kits of the Invention
[0120] The invention provides kits for carrying out the methods of
the invention. Accordingly, a variety of kits are provided. The
kits may be used for any one or more of the following (and,
accordingly, may contain instructions for any one or more of the
following uses): treating alphaherpesvirinae infection in an
individual infected with alphaherpesvirinae; reducing viral
shedding (including reducing the probability and/or risk of
alphaherpesvirinae transmission); preventing alphaherpesvirinae
infection in an individual at risk of being infected with
alphaherpesvirinae; preventing alphaherpesvirinae infection in an
individual who has been exposed to alphaherpesvirinae; preventing
one or more symptoms of alphaherpesvirinae infection in an
individual at risk of being exposed to alphaherpesvirinae;
preventing one or more symptoms of alphaherpesvirinae infection in
an individual who has been exposed to alphaherpesvirinae; reducing
severity one or more symptoms of alphaherpesvirinae infection in an
individual infected with alphaherpesvirinae; reducing recurrence of
one or more symptoms of alphaherpesvirinae infection in an
individual infected with alphaherpesvirinae; suppressing an
alphaherpesvirinae infection in an individual infected with or at
risk of being infected with alphaherpesvirinae; delaying
development of an alphaherpesvirinae infection and/or a symptom of
alphaherpesvirinae infection in an individual infected or at risk
of being infected with alphaherpesvirinae; reducing duration of an
alphaherpesvirinae infection in an individual infected or at risk
of being infected with alphaherpesvirinae. As is understood in the
art, any one or more of these uses would be included in
instructions directed to treating or preventing alphaherpesvirinae
infection.
[0121] The kits of the invention comprise one or more containers
comprising an ISS-containing polynucleotide and a set of
instructions, generally written instructions although electronic
storage media (e.g., magnetic diskette or optical disk) containing
instructions are also acceptable, relating to the use and dosage of
the ISS-containing polynucleotide for the intended treatment (e.g.,
preventing one or more symptoms of alphaherpesvirinae infection in
an individual at risk of being exposed to alphaherpesvirinae,
preventing one or more symptoms of alphaherpesvirinae infection in
an individual who has been exposed to alphaherpesvirinae, reducing
severity of one or more symptoms of alphaherpesvirinae infection in
an individual infected with alphaherpesvirinae, and/or reducing
recurrence of one or more symptoms of alphaherpesvirinae infection
in an individual infected with alphaherpesvirinae). The
instructions included with the kit generally include information as
to dosage, dosing schedule, and route of administration for the
intended treatment. The containers of ISS may be unit doses, bulk
packages (e.g., multi-dose packages) or sub-unit doses.
[0122] The kits of the invention do not include any packages or
containers which contain viral antigens from the alphaherpesvirinae
the kit is intended to be used to treat. Accordingly, neither the
container comprising the ISS-containing polynucleotide nor any
other containers in the kit contain alphaherpesvirinae viral
antigens.
[0123] The ISS component of the kit may be packaged in any
convenient, appropriate packaging. For example, if the ISS is a
freeze-dried formulation, an ampoule with a resilient stopper is
normally used, so that the drug may be easily reconstituted by
injecting fluid through the resilient stopper. Ampoules with
non-resilient, removable closures (e.g., sealed glass) or resilient
stoppers are most conveniently used for injectable forms of ISS.
Also, prefilled syringes may be used when the kit is supplied with
a liquid formulation of the ISS-containing polynucleotide. The kit
may contain the ISS in an ointment for topical formulation in
appropriate packaging. Also contemplated are packages for use in
combination with a specific device, such as an inhaler, nasal
administration device (e.g., an atomizer) or an infusion device
such as a minipump.
[0124] As stated above, any ISS-containing polynucleotide described
herein may be used, such as, for example, any polynucleotide
comprising any of the following ISS: the sequence 5'-cytosine,
guanine-3', the sequence 5'-T, C, G-3', the sequence 5'-C, G,
pyrimidine, pyrimidine, C, G-3', the sequence 5'-purine, purine, C,
G, pyrimidine, pyrimidine, C, G-3', the sequence 5'-purine, purine,
C, G, pyrimidine, pyrimidine, C, C-3'; the sequence SEQ ID NO: 1;
the sequence SEQ ID NO: 9; the sequence 5'-purine, purine, B, G,
pyrimidine, pyrimidine-3' wherein B is 5-bromocytosine or the
sequence 5'-purine, purine, B, G, pyrimidine, pyrimidine, C, G-3'
wherein B is 5-bromocytosine.
[0125] The following Examples are provided to illustrate, but not
limit, the invention.
EXAMPLES
Example 1
Delay of HSV Disease Development in Mice by Administration of
ISS
[0126] Outbred Swiss Webster mice, vaginally infected with HSV-2
strain 186, were used as a model of HSV infection. In these
animals, the first indication of viral infection is hair loss and
erythema (HLE) near the vagina occurring, on average, 5 days after
inoculation. The next stage of infection is indicated by chronic
wetness (CW) due to loss of bladder control, on average, 6 days
after inoculation. A portion (about 50% of infected mice) of the
animals develop hind limb paralysis (HLP) at approximately the same
time point. Death, which is often preceded by evidence of CNS
disease, occurs an average of 7-9 days after viral inoculation.
[0127] Mice were prepared for infection by an initial two-dose
treatment with depopriven to synchronize cycles and to thin the
vaginal epithelium. Vaginal mucous was removed by swabbing with
calcium alginate, then a lethal challenge dose (determined by
titration) of HSV-2 strain 186 was delivered by
positive-displacement pipettor. Inoculated mice were randomly
grouped into one of 4 treatment groups (n=15/group). Animals in
group 1 received no treatment and served as a control for the
study. Animals in the second and third groups were treated
topically with 100 .mu.g of an ISS-containing phosphorothioate
oligonucleotide (5'-TGACTGTGAACGTTCGAGATGA-3') (SEQ ID NO:1)
suspended in phosphate-buffered saline (PBS). The groups were
treated 2 or 6 hours after inoculation. As a vehicle control, group
four was treated with PBS alone.
[0128] Treatment with ISS resulted in decreased incidence (i.e.,
individuals showing symptoms of HSV-2 infection), improved survival
and delays in both appearance of symptoms and time to death in
symptomatic individuals. For those individuals which died during
the experiment, average time to death was increased by an average
of over two days in animals treated with ISS two hours after
infection. Log rank analysis of the data indicated a statistical
difference for both ISS treatment times compared to either the no
treatment or PBS vehicle-treated groups (p=0.0014 and 0.0146,
respectively). The data from this experiment are summarized in
Table 1 (PI, post-inoculation). TABLE-US-00003 TABLE 1 Time to Time
Group Incidence Survival Symptoms to Death No Treatment 15/15
(100%) 0/15 (0%) 4.73 d 8.1 d ISS 2 h PI 9/15 (60%) 6/15 (40%) 6.6
d 12 d 155 6 h PI 12/15 (80%) 4/15 (27%) 5.75 d 10.6 d PBS 6 h PI
15/15 (100%) 0/15 (0%) 4.9 d 9.5 d
[0129] In another experiment, inoculated mice were randomly grouped
into 8 treatment groups (n=16/group). Animals in the groups
received treatments as outlined in Table 2 below. The groups were
treated 2 hours after virus inoculation. TABLE-US-00004 TABLE 2
Group Treatment 1 ISS; 5'-TGACTGTGAACGTTCGAGATGA-3' (SEQ ID NO:1) 2
ISS; 5'-TCGTCGAACGTTCGTTAACGTTCG-3' (SEQ ID NO:9) 3 + 4 non-ISS;
5'-TGACTGTGAAGGTTAGAGATGA-3' (SEQ ID NO:10) 5 non-ISS;
5'-TGACTGTGAACCTTAGAGATGA-3' (SEQ ID NO:11) 6 PBS 7 No Treatment 8
Acyclovir (ACV)
[0130] In sum, treatment with ISS resulted in decreased incidence
(i.e., individuals showing symptoms of HSV-2 infection), improved
survival and delays in both appearance of symptoms and time to
death in symptomatic individuals. For example, survival results of
this experiment are depicted in FIG. 1. The survival curves for the
animals treated with the two ISS oligonucleotides are
indistinguishable from each other and are both significantly
different from those of the groups treated with non-ISS
oligonucleotides and PBS and the untreated group.
Example 2
Reduction of HSV Lesions in Guinea Pies by Administration of
ISS
[0131] Recurrent HSV-2 disease and aspects of the primary disease,
including vesicular ulcerative lesion formation and asymptomatic
shedding, are effectively modeled by inoculation of the guinea pig
vagina with HSV-2 (Milligan et al. (1995) Virol. 206:234-241). In
the guinea pig model, animals are infected by instillation of HSV-2
after calcium-alginate swabbing as described in Example 1. Three to
five days after inoculation, cutaneous lesions develop and in some
cases urinary retention is observed. The animals are scored daily
for lesion severity using a 4 point scale (Bourne et al. (1996) J.
Infect. Dis. 173:800-807). Primary disease resolves by 14 days
after inoculation (day 14 post-inoculation, d14 PI). From day 15
through 70 after inoculation, the animals are scored daily for the
development of recurrent lesions. The frequency of recurrence is a
significant outcome measure as it indicates any impact on latency
and reactivation that a therapy may have. This model has proved to
be a very effective system for testing of antivirals and vaccines
(Bourne et al. (1996) Vaccine 14(13):1230-1234; Stanberry (1989)
Antiviral Res. 11:203-214; Stanberry et al. (1990) Antiviral Res.
13:277-286).
[0132] Swiss Hartley guinea pigs (Charles River Laboratories) were
intravaginally inoculated with HSV-2 strain MS by simply delivering
virus to the vagina, then followed through the primary infection
(d14 PI). Animals that did not display herpetic lesions were
eliminated from further study. The remaining animals were randomly
assigned to one of three study groups (n=16/group). To assess the
impact of the ISS therapy upon recurrent lesion development, two of
the three study groups were treated with 200 .mu.g of the
ISS-containing polynucleotide of Example 1
(5'-TGACTGTGAACGTTCGAGATGA-3') (SEQ ID NO:1) suspended in PBS 21
days post inoculation. The third group received an injection of PBS
alone. One of the two ISS treated groups received two additional
ISS injections on days 42 and 63 post-inoculation (PI) (Group #3).
Daily scoring of recurrent lesions was completed on each animal to
determine the impact of ISS on recurrence frequency. These scores
were averaged daily for each groups and the cumulative totals are
depicted in FIG. 2. The graph on the left shows the period of time
immediately following the first ISS injection (days 22-41), while
the graph on the right shows the data over the entire observation
period (day 22 through day 78).
[0133] Statistical analysis (ANOVA) of the results showed a
significant reduction in the frequency of recurrences following ISS
therapy (p=0.012). No difference was observed among the groups
prior to ISS treatment. Although the results between multiple and
single treatments were not statistically significant (p>0.05),
data trends suggested that multiple treatments may further reduce
recurrences.
[0134] In another experiment, guinea pigs were intravaginally
inoculated with 5.times.10.sup.5 pfu HSV-2, strain MS, as described
above. The infected animals were divided into groups and received
treatments as outlined in Table 3. TABLE-US-00005 TABLE 3 Group
Treatment 1 ISS; 5'-TGACTGTGAACGTTCGAGATGA-3'; (SEQ ID NO:1) 1 mg
in PBS; once at 21 days post inoculation 2 non-ISS;
5'-TGACTGTGAAGGTTAGAGATGA-3'; (SEQ ID NO:10) 1 mg in PBS; once at
21 days post inoculation 3 No Treatment 4 Acycloyir (ACV); 3
times/day for 7 days starting at 6 hours post inoculation
[0135] Recurrent disease was monitored from day 15-56 post
inoculation. Vaginal swabs of animals were done on days 21-43 and
PCR analysis performed to determine the level of viral shedding. To
evaluate the effect of ISS therapy on recurrent disease, cumulative
number of recurrent lesions were monitored over time and the mean
calculated for the group. Results from this experiment are depicted
in FIG. 3. A single topical treatment with ISS at day 21
significantly decreased the cumulative mean recurrent lesion days
compared to animals treated with non-ISS control oligonucleotide or
untreated animals. The acyclovir (ACV) group also showed a
significant reduction in cumulative recurrent mean lesion days,
however this group received a total of 21 treatments spread over 7
days to achieve this effect.
[0136] The frequency of viral shedding was 20% of days for all
groups. Thus, the frequency of viral shedding was unaffected by ISS
treatment. However, as shown in FIG. 4, the magnitude of viral
shedding was significantly reduced in the group receiving a single
topical treatment with ISS as compared to the control groups. The p
value (p<0.001) was calculated by ANOVA analysis using Dunn's
Multiple Comparison test and is valid for both the untreated group
and the non-ISS control oligonucleotide group. Magnitude of virus
shedding is correlated with viral transmission. Since ISS treatment
resulted in a reduction in the magnitude of viral shedding, ISS
treatment may be effective in a reduction in viral
transmission.
Example 3
ISS Demonstrates No Direct Activity on Viral Replication
[0137] As demonstrated in the following experiment, ISS appears to
have no direct activity on viral replication.
[0138] Vero cells, a cell line derived from African Green monkey
kidney, were pre-treated with varying concentrations of ISS or
non-ISS oligonucleotides for varying times prior to the addition of
HSV-1 or HSV-2. Oligonucleotides were used at 1 .mu.g/ml or 10
.mu.g/ml and the cells were incubated with the oligonucleotides for
30 seconds, 10 minutes or 24 hours. Viral titers were calculated as
a percent of control titer generated by cells not treated with the
oligonucleotides. The experimental conditions and results are
summarized in Table 4 (NA=not available). The data are expressed as
percent of control titer. TABLE-US-00006 TABLE 4 1 .mu.g/ml 10
.mu.g/ml Oligonucleotide 30 sec 10 min 24 hr 30 sec 10 min 24 hr
Cells infected with HSV-1 SEQ ID NO: 1 98 96 89 100 102 82 SEQ ID
NO: 9 129 95 87 122 96 78 SEQ ID NO: 11 132 98 97 141 100 94 SEQ ID
NO: 10 100 99 101 96 100 97 Cells infected with HSV-2 SEQ ID NO: 1
101 98 99 101 101 99 SEQ ID NO: 9 119 NA NA 136 NA NA SEQ ID NO: 11
111 NA NA 129 100 98 SEQ ID NO: 10 98 96 103 103 97 99
[0139] HSV-1 or HSV-2 virus was pre-treated with varying
concentrations of ISS or non-ISS oligonucleotides for 10 minutes
prior to adding the mixture to plated Vero cells. Oligonucleotides
were used at 1 .mu.g/ml or 10 .mu.g/ml. Viral titers were
calculated as a percent of control titer generated by cells not
treated with the oligonucleotides. The experimental conditions and
results are summarized in Table 5. The data are expressed as
percent of control titer. TABLE-US-00007 TABLE 5 HSV-1 HSV-2 10 10
Oligonucleotide 1 .mu.g/ml .mu.g/ml control 1 .mu.g/ml .mu.g/ml
control SEQ ID NO: 1 101 109 100 96 102 100 SEQ ID NO: 9 100 100 99
101 97 99 SEQ ID NO: 11 98 101 100 100 97 103 SEQ ID NO: 10 102 103
102 98 106 101
[0140] As shown in Tables 4 and 5, incubating the cells with ISS
prior to HSV infection in vitro and incubating HSV virus with ISS
prior to infecting cells in vitro has no effect on the viral titers
from the infected cells as compared to controls.
[0141] The present invention has been detailed both by direct
description and by example. Equivalents and modifications of the
present invention will be apparent to those skilled in the art, and
are encompassed within the scope of the invention.
Sequence CWU 1
1
11 1 22 DNA Artificial Sequence Polynucleotide containing CG 1
tgactgtgaa cgttcgagat ga 22 2 22 DNA Artificial Sequence
Polynucleotide containing CG 2 tgaccgtgaa cgttcgagat ga 22 3 23 DNA
Artificial Sequence Polynucleotide containing CG 3 tcatctcgaa
cgttccacag tca 23 4 22 DNA Artificial Sequence Polynucleotide
containing CG 4 tgactgtgaa cgttccagat ga 22 5 26 DNA Artificial
Sequence Polynucleotide containing CG 5 tccataacgt tcgcctaacg
ttcgtc 26 6 22 DNA Artificial Sequence Polynucleotide containing
(5-bromocytosine)G misc_feature (1)...(22) n = 5-bromocytosine 6
tgactgtgaa ngttccagat ga 22 7 22 DNA Artificial Sequence
Polynucleotide containing (5-bromocytosine)G misc_feature
(1)...(22) n = 5-bromocytosine 7 tgactgtgaa ngttcgagat ga 22 8 22
DNA Artificial Sequence Polynucleotide containing
(5-bromocytosine)G misc_feature (1)...(22) n = 5-bromocytosine 8
tgactgtgaa ngttngagat ga 22 9 24 DNA Artificial Sequence
Polynucleotide containing CG 9 tcgtcgaacg ttcgttaacg ttcg 24 10 22
DNA Artificial Sequence Polynucleotide not containing CG 10
tgactgtgaa ggttagagat ga 22 11 22 DNA Artificial Sequence
Polynucleotide not containing CG 11 tgactgtgaa ccttagagat ga 22
* * * * *