U.S. patent application number 11/540430 was filed with the patent office on 2007-03-08 for compositions and methods of using angiopoietin-like 4 protein.
Invention is credited to Stuart Bunting, Hanspeter Gerber, Xiao Huan Liang.
Application Number | 20070054856 11/540430 |
Document ID | / |
Family ID | 35787695 |
Filed Date | 2007-03-08 |
United States Patent
Application |
20070054856 |
Kind Code |
A1 |
Gerber; Hanspeter ; et
al. |
March 8, 2007 |
Compositions and methods of using angiopoietin-like 4 protein
Abstract
ANGPTL4 compositions and methods of using such compositions, and
agonists or antagonists thereof, for the diagnosis and treatment of
diseases or disorders are included, including methods to modulate
cell proliferation, cell adhesion, and cell migration.
Inventors: |
Gerber; Hanspeter; (San
Francisco, CA) ; Bunting; Stuart; (Half Moon Bay,
CA) ; Liang; Xiao Huan; (Redwood City, CA) |
Correspondence
Address: |
HELLER EHRMAN LLP
275 MIDDLEFIELD ROAD
MENLO PARK
CA
94025-3506
US
|
Family ID: |
35787695 |
Appl. No.: |
11/540430 |
Filed: |
September 28, 2006 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
11185204 |
Jul 19, 2005 |
|
|
|
11540430 |
Sep 28, 2006 |
|
|
|
60589875 |
Jul 20, 2004 |
|
|
|
Current U.S.
Class: |
514/13.3 ;
424/145.1; 514/1.9; 514/16.4; 514/19.1; 514/19.3; 514/44A |
Current CPC
Class: |
A61P 37/04 20180101;
A01K 2227/105 20130101; A61P 3/04 20180101; A61P 29/00 20180101;
A61K 2039/505 20130101; A61P 3/06 20180101; A61P 37/06 20180101;
A61P 1/04 20180101; A01K 67/0276 20130101; A01K 2217/075 20130101;
C07K 16/2839 20130101; A61P 3/00 20180101; A01K 2267/03 20130101;
A61P 1/16 20180101; C12N 2710/10343 20130101; A61P 17/06 20180101;
A61P 35/00 20180101; A61P 19/02 20180101; A61P 11/06 20180101; C07K
14/515 20130101; C07K 2317/76 20130101; A61P 37/02 20180101; A61K
38/00 20130101; A61P 9/00 20180101; C07K 16/22 20130101; A61P 43/00
20180101 |
Class at
Publication: |
514/012 ;
514/044; 424/145.1 |
International
Class: |
A61K 38/17 20070101
A61K038/17; A61K 48/00 20070101 A61K048/00; A61K 39/395 20060101
A61K039/395 |
Claims
1. A method of stimulating proliferation of hepatocytes, the method
comprising: administering an effective amount of an
angiopoietin-like 4 protein (ANGPTL4) to a population of
hepatocytes or pre-hepatocytes thereby stimulating
proliferation.
2. The method of claim 1, wherein the hepatocytes are in a
subject.
3. The method of claim 2, wherein the subject is a human.
4. The method of claim 1, wherein the ANGPTL4 comprises amino acid
residues 23 to 406 of human ANGPTL4.
5. The method of claim 1, wherein the ANGPTL4 comprises amino acid
residues 184 to 406 of human ANGPTL4.
6. The method of claim 1, wherein administration step comprises
administering a nucleic acid sequence than encodes for the
ANGPTL4.
7. A method of stimulating proliferation of hepatocytes, the method
comprising: administering an effective amount of an agent that
stimulates production of an ANGPTL4 in hepatocytes or
pre-hepatocytes, thereby stimulating proliferation.
8. A method of inhibiting proliferation of hepatocytes, the method
comprising administering an effective amount of an ANGPTL4
antagonist to a population of hepatocytes or pre-hepatocytes.
9. The method of claim 8, wherein the antagonist is an agent that
inhibits ANGPTL4 protein production in the hepatocyte.
10. The method of claim 8, wherein the agent is an antisense or
ribozyme molecule.
11. The method of claim 8, wherein the ANGPTL4 antagonist is an
anti-ANGPTL4 antibody.
12. The method of claim 8, wherein the ANGPTL4 antagonist is an
anti-.alpha.V.beta.5 antibody.
13. A method of inducing cell adhesion of hepatocytes, the method
comprising: administering an effective amount of a composition
comprising an ANGPTL4 to a population of hepatocytes, thereby
inducing the cell adhesion of hepatocytes.
14. The method of claim 13, wherein the ANGPTL4 comprises amino
acid residues 23 to 406 of human ANGPTL4.
15. The method of claim 13, wherein the ANGPTL4 comprises amino
acids residues 185 to 406 of human ANGPTL4.
16. The method of claim 13, wherein the composition comprises the
ANGPTL4 with a carrier.
17. A method of inhibiting cell adhesion of hepatocytes, the method
comprising: administering an effective amount of a composition
comprising an ANGPTL4 antagonist to a population of hepatocytes,
thereby inhibiting the cell adhesion of the hepatocytes.
18. The method of claim 17, wherein the antagonist is an
anti-ANGPTL4 antibody.
19. The method of claim 17, wherine the antagonist is an
anti-.alpha.V.beta.5 antibody.
20. A method of stimulating proliferation of pre-adipocytes, the
method comprising: administering an effective amount of a
composition comprising an ANGPTL4 or agonist to a population of
preadipocytes, thereby inducing the proliferation of
pre-adipocytes.
21. The method of claim 20, wherein the preadipocytes are in a
subject.
22. The method of claim 20, wherein the subject is a human.
23. The method of claim 20, wherein the composition comprises the
ANGPTL4 with a carrier.
24. The method of claim 20, wherein the ANGPTL4 comprises amino
acid residues 23 to 406 of human ANGPTL4.
25. The method of claim 24, wherein the ANGPTL4 comprises amino
acid residues from about 23 to about 162.
26. A method of inhibiting the proliferation of pre-adipocytes, the
method comprising administering an effective amount of a
composition comprising an ANGPTL4 antagonist to a population of
preadipocytes.
27. The method of claim 26, wherein the ANGPTL4 antagonist is an
anti-ANGPTL4 antibody.
28. A method of inhibiting a biological activity of ANGPTL4, the
method comprising administering an ANGPTL4 antagonist that binds to
C-terminal of ANGPTL4.
29. The method of claim 28, wherein the ANGPTL4 antagonist is an
anti-ANGPTL4 antibody.
30. The method of claim 28, wherein the ANGPTL4 antagonist is an
anti-.alpha.V.beta.5 antibody.
31. The method of claim 28, wherein the ANGPTL4 antagonist blocks
Angptl4 from binding to .alpha.V.beta.5.
32. The method of claim 28, wherein the biological activity
comprises inducing cell proliferation or cell differentiation.
33. An antibody that binds to C-terminal of ANGPTL4.
34. The antibody of claim 32, wherein the antibody is a
neutralizing antibody.
35. A composition comprising a variant of ANGPTL4, wherein the
variant ANGPTL4 is not proleolytically processed.
36. The composition of claim 35, wherein the variant of ANGPTL4
comprises an alteration of amino acid 162 and/or 164.
37. The composition of claim 36, wherein the alteration is a
substitution.
38. The composition of claim 37, wherein the substitution is at
position 162 and at position 164.
Description
RELATED APPLICATIONS
[0001] This application is a continuation application and claims
the benefit under 35 U.S.C. .sctn. 120 of copending U.S. patent
application Ser. No. 11/185,204, filed on Jul. 19, 2005, which
claims the benefit, under 35 U.S.C. .sctn. 119, of U.S. Provisional
Patent Application Ser. No. 60/589,875 filed Jul. 20, 2004, the
contents of which are incorporated herein by reference.
FIELD OF THE INVENTION
[0002] The invention concerns angiopoietin-like 4 protein
(ANGPTL4). The invention relates to compositions and methods of
using ANGPTL4 and agonists and antagonists thereof, for the
diagnosis and treatment of diseases or disorders.
BACKGROUND OF THE INVENTION
[0003] Angiopoietin-like 4 protein (ANGPTL4) is a member of the
angiopoietin family of secreted proteins. Conserved regions of the
angiopoietin family include a coiled-coil domain and a C-terminal
fibrinogen (FBN)-like domain. See, e.g., Kim et al., Biochem. J.
346:603-610 (2000). Other members of the family include
angiopoietin 1, angiopoietin 2 and angiopoietin 3. Angiopoietin 1,
angiopoietin 2 and angiopoietin3/angiopoietin 4 bind to Tie2
receptor. See, e.g., Davis et al., Cell 87, 1161-1169 (1996);
Maisonpierre et al., Science 277, 55-60 (1997); Valenzuela et al,
Proc. Natl. Acad. Sci. USA 96, 1904-1909 (1999); and, U.S. Pat.
Nos. 5,521,073; 5,650,490; and, 5,814,464. Angiopoietin 1 and 4
appear to be an agonist for the Tie2 receptor, while Angiopoietin 2
and 3 appear to be an antagonist (and possibly an agonist) for the
Tie2 receptor. See, e.g., Folkman & D'Amore, Cell, 87:1153-1155
(1996); Suri et al., Cell, 87:1171-1180 (1996); Masionpierre et
al., Science 277:55-60 (1997); and, Ward & Dumont, Seminars in
Cell & Developmental Biology, 13:19-27 (2002). The Tie2
receptor belongs to a family of endothelial cell specific receptors
tyrosine kinases, which also include the Tie1 orphan receptor.
Another member of the family, angiopoietin-like 3 protein was found
to bind to integrin .alpha..sub.v.beta..sub.3. See, e.g., US patent
application 20030215451 and Camenisch et al., J. Biol. Chem.,
277(19): 17281-17290 (2002).
[0004] ANGPTL4 is known by other terms. For example, ANGPTL4 is
also known as hepatic fibrinogen/angiopoietin-related protein
(HFARP) (Kim et al., Biochem. J. 346:603-610 (2000)), PPAR.gamma.
angiopoietin related protein (PGAR) (Yoon, et al., Mol. Cell Biol.,
20:5343-5349 (2000)), and fasting induced adipose factor (FIAF)
(Kerten et al., J. Biol. Chem., 275:28488-28493 (2000)).
[0005] In vitro and in vivo studies and characterizations of
ANGPTL4 can provide valuable identification and discovery of
therapeutics and/or treatments useful in the prevention,
amelioration or correction of diseases or dysfunctions associated
with ANGPTL4 activity and/or expression. For example, tissue
culture studies and genetically engineered mice have proven to be
invaluable tools for the functional dissection of biological
processes relevant to human disease, including immunology, cancer,
neurobiology, cardiovascular biology, obesity and many others.
There is a need to discover and understand the many biological
functions of ANGPTL4. The invention addresses these and other
needs, as will be apparent upon review of the following
disclosure.
SUMMARY OF THE INVENTION
[0006] The invention concerns angiopoietin-like 4 protein
(ANGPTL4). The invention provides the use of ANGPTL4 or subsequence
thereof, or an agonist or antagonist thereof, to treat conditions
or diseases characterized by aberrant ANGPTL4 expression or
activity, and/or involving ANGPTL4 expression and/or activity.
[0007] Methods of modulating the proliferation of hepatocytes by
ANGPTL4, or agonists or antagonists thereof, are provided. In
certain embodiments, methods include inducing the proliferation of
hepatocytes. For example, a method comprises administering an
effective amount of an ANGPTL4 or ANGPTL4 agonist to a population
of hepatocytes or pre-hepatocytes thereby inducing proliferation.
In one aspect, the administration step comprises administering a
nucleic acid that encodes for the ANGPTL4. Alternatively or
additionally, an effective amount of an agent that induces
production of ANGPTL4 in a hepatocyte or pre-hepatocyte can be
administered to stimulate proliferation. ANGPTL4 or agonists of
ANGPTL4 can be used in the treatment of liver dysfunction, diseases
and damage by administering an effective amount of an ANGPTL4 or
agonist. In one aspect, the ANGPTL4 is provided by a nucleic acid
encoding the ANGPTL4. In one embodiment of the invention, an
ANGPTL4 agonist is an agonist for an .alpha..sub.V.beta..sub.5
receptor.
[0008] Methods for inhibiting the proliferation of hepatocytes are
also provided. In certain embodiments, the method includes
administering an effective amount of a composition comprising an
ANGPTL4 antagonist to a population of hepatocytes or
pre-hepatocytes. In one aspect, the ANGPTL4 antagonist is an agent
that inhibits ANGPTL4 protein production, e.g., an antisense or
ribozyme molecule. In one aspect, the ANGPTL4 antagonist is an
anti-ANGPTL4 antibody. In another aspect, the ANGPTL4 antagonist is
an anti-.alpha..sub.V.beta..sub.5 antagonist antibody. In one
embodiment, the ANGPTL4 antagonist is an ANGPTL4-SiRNA. ANGPTL4
antagonists can be used in the treatment, e.g., of liver cancer or
undesired liver hypertrophy, by administering an effective amount
of the ANGPTL4 antagonist to the hepatocytes.
[0009] Methods for modulating cell adhesion of hepatocytes are also
provided. In certain embodiments, the methods include inducing cell
adhesion of hepatocytes by administering an effective amount of a
composition comprising an ANGPTL4 or ANGPTL4 agonist to a
population of hepatocytes. In other embodiments, the methods
include inhibiting cell adhesion of hepatocytes by administering an
effective amount of a composition comprising an ANGPTL4 antagonist
to a population of hepatocytes, thereby inhibiting cell adhesion of
the hepatocytes.
[0010] In addition to modulating proliferation and cell adhesion of
hepatocytes, which are involved in lipid homeostasis, ANGPTL4
modulates triglyceride and cholesterol levels in serum, and
stimulates pre-adipocyte proliferation, which are also involved in
lipid homeostasis. The invention provides methods of modulating a
number of various aspects of lipid homeostasis. For example,
methods of the invention include stimulating proliferation of
pre-adipocytes by administering an effective amount of a
composition comprising an ANGPTL4 or ANGPTL4 agonist to a
population of preadipocytes, thereby inducing the proliferation of
pre-adipocytes. Methods of inhibiting the proliferation of
pre-adipocytes are also provided. For example, methods include
administering an effective amount of a composition comprising an
ANGPTL4 antagonist to a population of preadipocytes. Methods of
modulation cell migration of pre-adipocytes is also included. For
example, methods of the invention include inducing cell migration
of pre-adipocytes by administering an effective amount of ANGPTL4
or ANGPTL4 agonist to a population of pre-adipocytes. Methods of
inhibiting cell migration of pre-adipocytes is also provided, which
include, e.g., administering an effective amount of an ANGPTL4
antagonist to a population of pre-adipocytes, thereby inhibiting
cell migration.
[0011] Methods of modulating serum levels of triglycerides or
cholesterol in a subject are also provided in the invention. For
example, methods include administering an effective amount of a
composition comprising an ANGPTL4 or ANGPTL4 agonist or an ANGPTL4
antagonist to a subject, thereby modulation the serum levels of
triglycerides and/or cholesterol in a subject. In one embodiment,
an ANGPTL4 or ANGPTL4 agonist is administered, which results in an
accumulation of triglycerides and/or cholesterol in the serum of a
subject compared to a control. In another embodiment, an effective
amount of an ANGPTL4 antagonist is administered to a subject,
thereby reducing the level of at least one triglyceride, free fatty
acids and/or cholesterol in the serum of the subject. In certain
embodiments of the invention, a control is serum from a subject
before treatment, or a subject with no treatment or reduced
treatment, etc.
[0012] An ANGPTL4 and ANGPTL4 modulator (agonist or antagonist
thereof) can be used in treatment of lipid homeostasis disorders by
administering an effective amount of the molecule to a subject. See
"Lipid homeostasis disorder" under the definitions herein. For
example, a method comprises administering to a subject a
composition comprising ANGPTL4 antagonist in an amount effective to
treat hyperlipidemia.
[0013] Methods of treating obesity and/or reducing total body mass
in a subject are also provided. For example, a method includes
administering to a subject an effective amount of ANGPTL4
modulator, thereby treating obesity and/or reducing total body mass
in the subject compared to no treatment or treatment with a
control. In one embodiment, adiposity (fat) of a subject is
reduced. In this manner, conditions related to obesity can also be
treated, e.g., cardiovascular disease, diabetes, etc.
[0014] In certain embodiments of the invention, the cells, e.g.,
the hepatocytes, pre-adipocytes, are in a subject. Typically, the
subject is a human.
[0015] An ANGPTL4 of the invention includes full-length protein as
well as biological active molecules, e.g., residues corresponding
the N-terminal, N-terminal coiled-coil domain, C-terminal,
C-terminal fibrinogen-like domain, or ANGPTL4 (1-183), ANGPTL4
(23-183), ANGPTL4 (1 to about 162), ANGPTL4 (about 162-406),
ANGPTL4 (23-406), or ANGPTL4 (184-406) amino acid subsequence of
human ANGPTL4, and/or mANGPTL4 (1-183), mANGPTL4 (23-183), mANGPTL4
(1 to about 165), mANGPTL4 (23 to about 165), mANGPTL4 (23-410) or
mANGPTL4 (184-410) amino acid subsequence of the murine ANGPTL4.
Other subsequences also include, but not limited to, e.g., 40-183,
60-183, 80-183, 100-183, 120-183, 140-183, 40-406, 60-406, 80-406,
100-406, 120-406, 140-406, and 160-406 of mANGPTL4 and, e.g.,
40-183, 60-183, 80-183, 100-183, 120-183, 140-183, 40-410, 60-410,
80-410, 100-410, 120-410, 140-410 and 160-410 of mANGPTL4. Agonists
ANGPTL4 include molecules that activate ANGPTL4 or produce ANGPTL4
activities, e.g., active polypeptides, small molecules, and
molecules that increase activity or expression of ANGPTL4. ANGPTL4
agonists also include .alpha..sub.V.beta..sub.5 agonists.
[0016] ANGPTL4 antagonists of the invention are molecules that
inhibit or reduce the activity of ANGPTL4. An ANGPTL4 inhibitor can
include a small molecular weight substance, an polynucleotide,
antisense molecules, RNA aptamers, ribozymes against ANGPTL4 or its
receptor polypeptides, an polypeptide, antagonist variants of
ANGPTL4, an isolated protein, a recombinant protein, an antibody,
or conjugates or fusion proteins thereof, that inhibits an ANGPTL4
activity, directly or indirectly. In certain embodiments of the
invention, an antagonist ANGPTL4 antibody is an antibody that
inhibits or reduces the activity of ANGPTL4 by binding to a
specific subsequence or region of the ANGPTL4 protein, e.g.,
N-terminal, N-terminal coiled-coil domain, C-terminal, C-terminal
fibrinogen-like domain, or ANGPTL4 (1-183), ANGPTL4 (23-183),
ANGPTL4 (1 to about 162), ANGPTL4 (about 162-406), ANGPTL4
(23-406), or ANGPTL4 (184-406) amino acid subsequence of human
ANGPTL4, and/or mANGPTL4 (1-183), mANGPTL4 (23-183), mANGPTL4 (1 to
about 165), mANGPTL4 (23 to about 165), mANGPTL4 (23-410) or
mANGPTL4 (184-410) amino acid subsequence of the murine ANGPTL4.
Other subsequences also include, but are not limited to, e.g.,
40-183, 60-183, 80-183, 100-183, 120-183, 140-183, 40-406, 60-406,
80-406, 100-406, 120-406, 140-406, and 160-406 of mANGPTL4 and,
e.g., 40-183, 60-183, 80-183, 100-183, 120-183, 140-183, 40-410,
60-410, 80-410, 100-410, 120-410, 140-410 and 160-410 of mANGPTL4.
In certain embodiments of the invention, an antagonist of ANGPTL4
includes an anti-.alpha..sub.v.beta..sub.5 antibody, e.g., an
antagonist anti-.alpha..sub.v.beta..sub.5 antibody. In certain
embodiments, the antibodies of the invention are humanized
antibodies. In certain embodiments of the invention, an ANGPTL4
antagonist is a SiRNA molecule. In one embodiment, the SiRNA
molecule is an ANGPTL4-SiRNA molecule, where the molecule targets a
DNA sequence (e.g., GTGGCCAAGCCTGCCCGAAGA (SEQ ID NO: 3)) of a
nucleic acid encoding ANGPTL4. An immunoadhesin of ANGPTL4
comprises at least the receptor-binding region of ANGPTL4 fused to
an immunoglobulin sequence. In certain embodiments, ANGPTL4,
agonist or antagonist is with a carrier, e.g., a pharmaceutically
acceptable carrier.
[0017] ANGPTL4 transgenic and knockout animals are described and
uses of these transgenic animals are also provided. The invention
also provides an isolated cell derived from a non human transgenic
animal whose genome comprises a disruption of a gene which encodes
for an ANGPTL4. In certain embodiments, the isolated cell comprises
a murine cell (e.g., an embryonic stem cell).
[0018] Mutated gene disruptions of ANGPTL4 have resulted in
phenotypic observations related to various disease conditions or
dysfunctions including: cardiovascular, endothelial or angiogenic
disorders including atherosclerosis; abnormal metabolic disorders
including lipid homeostasis disorders; or immunological and
inflammatory disorders. Methods of the invention include treating a
cardiovascular, endothelial or angiogenic disorder; abnormal
metabolic disorder, immunological disorder; a lipid homeostasis
disorder, or oncological disorder associated with the disruption of
a gene which encodes for an ANGPTL4 or associated with an ANGPTL4
activity by administering to a subject an effective amount of an
ANGPTL4, an agonist or antagonist of an ANGPTL4, thereby
effectively treating said disorder or disease.
[0019] Methods of identifying a phenotype associated with a
disruption of a gene which encodes for an ANGPTL4 are also
provided. For example, the method includes (a) measuring a
physiological characteristic of a non human transgenic animal whose
genome comprises a disruption of a gene which encodes for an
ANGPTL4; and (b) comparing the measured physiological
characteristic with that of a gender matched wild type animal. A
phenotype resulting from the gene disruption is identified as the
physiological characteristic of the non human transgenic animal
that differs from the physiological characteristic of the wild type
animal. The non-human transgenic animal can be homozygous or
heterozygous for the disruption of a gene which encodes for an
ANGPTL4.
[0020] Methods for identifying an agent that modulates a phenotype
associated with a disruption of a gene that encodes for an ANGPTL4
are also provided. For example, a method includes (a) measuring a
physiological characteristic of a non human transgenic animal whose
genome comprises a disruption of the gene which encodes for the
ANGPTL4; and (b) comparing the measured physiological
characteristic of (a) with that of a gender matched wild type
animal. A phenotype resulting from the gene disruption in the non
human transgenic animal is a physiological characteristic of the
non human transgenic animal that differs from the physiological
characteristic of the wild type animal. A test agent is
administered to the non human transgenic animal of (a); and, it is
determined whether the test agent modulates the identified
phenotype associated with gene disruption. A test agent that
modulates the phenotype is an agent that modulates that
phenotype.
[0021] In certain embodiments, a phenotype associated with the
ANGPTL4 gene disruption or phenotype exhibited by the non human
transgenic animal as compared with gender matched wild type
littermates is at least one of the following, but is not limited
to, e.g., a cardiovascular, endothelial or angiogenic disorder; an
immunological disorder; a lipid homeostasis disorder; or an
abnormal metabolic disorder.
[0022] Methods of identifying an agent that modulates a
physiological characteristic associated with a disruption of the
gene which encodes for an ANGPTL4 are also provided. In certain
embodiments, the method includes (a) measuring a physiological
characteristic exhibited by a non human transgenic animal whose
genome comprises a disruption of the gene which encodes for an
ANGPTL4; and (b) comparing the measured physiological
characteristic of (a) with that of a gender matched wild type
animal. A physiological characteristic exhibited by the non human
transgenic animal that differs from the physiological
characteristic exhibited by the wild type animal is identified as a
physiological characteristic associated with gene disruption. A
test agent is administered to the non human transgenic animal of
(a); and, it is determined whether the physiological characteristic
associated with gene disruption is modulated. A test agent that
modulates the physiological characteristics is an agent that
modulates that characteristic.
[0023] In certain embodiments, the non human transgenic animal
exhibits at least one of the following physiological
characteristics compared with gender matched wildtype littermates,
e.g., a modulation in mean serum cholesterol levels, a modulation
in mean serum triglyceride levels, a modulation in a glucose
tolerance test, a modulation in glucose homeostasis, a decreased
mean serum glucose level; an increased mean serum insulin level; a
decreased mean serum insulin level; an increased mean serum IgM
level and increased mean absolute neutrophil count, an increased
mean percent body fat; a decreased body weight and length,
decreased total tissue mass and lean body mass, decreased total fat
mass, growth retardation with decreased body weight and length,
and/or decreased mean percent of total body fat, total tissue mass.
In one embodiment, the modulation in the mean serum cholesterol
levels is a decreased mean serum cholesterol level. In one
embodiment, the modulation in the mean serum triglyceride level is
a decrease mean serum triglyceride level. In another embodiment,
the modulation in the glucose tolerance test is an enhanced glucose
tolerance.
[0024] Methods of identifying an agent that ameliorates a
cardiovascular, endothelial or angiogenic disorder; an
immunological disorder; an oncological disorder; a lipid metabolic
disorder; or an abnormal metabolic disorder associated with a
disruption in the gene which encodes for an ANGPTL4 are provided.
For example, a method includes (a) administering a test agent to a
non human transgenic animal comprising a disruption in an ANGPTL4
gene; and (b) determining whether the test agent ameliorates the
cardiovascular, endothelial or angiogenic disorder; immunological
disorder; oncological disorder; lipid metabolic disorder; or
metabolic disorder associated with the gene disruption in the non
human transgenic animal.
[0025] The invention provides methods of evaluating a therapeutic
agent capable of affecting a condition associated with a disruption
of a gene that encodes for an ANGPTL4. For example, a method
includes (a) measuring a physiological characteristic of a non
human transgenic animal whose genome comprises a disruption of the
gene which encodes for the ANGPTL4; (b) comparing the measured
physiological characteristic of (a) with that of a gender matched
wild type animal; (c) administering a test agent to the non human
transgenic animal of (a); and, (d) evaluating the effects of the
test agent on the identified condition associated with gene
disruption in the non human transgenic animal. The physiological
characteristic of the non human transgenic animal that differs from
the physiological characteristic of the wild type animal is
identified as a condition resulting from the gene disruption in the
non human transgenic animal. For example, the condition is a
cardiovascular, endothelial or angiogenic disorder; an
immunological disorder; an oncological disorder; a lipid
homeostasis disorder; or a metabolic disorder.
[0026] Methods of identifying an agent that modulates the
expression of an ANGPTL4 are also provided. For example, a method
includes (a) contacting a test agent with a host cell expressing an
ANGPTL4; and (b) determining whether the test agent modulates the
expression of the ANGPTL4 by the host cell.
[0027] An agent identified by any of above methods is also included
in the invention. In one embodiment, the agent comprises an
agonist. In another embodiment, the agent comprises an antagonist
of an ANGPTL4. Agents that are therapeutic agents are also included
in the invention along with a pharmaceutical composition including
the therapeutic agent.
[0028] In various methods of the invention, a molecule of the
invention, e.g., ANGPTL4, an agonist or antagonist of ANGPTL4, an
agent, etc., can be administered to the subject through a systemic
delivery system. In one aspect, the systemic delivery system
includes a cell preparation comprising mammalian cells (e.g., CHO
cells) expressing a recombinant form of the subject agent. In
another aspect, the systemic delivery system can comprise a slow
release preparation comprising purified agent and a polymer matrix.
In certain embodiments, the molecule is administered to a subject
with a pharmaceutically acceptable carrier. Alternatively, the
molecule of the invention can be administered via a tissue-targeted
(e.g., adipocytes, liver, etc.) gene delivery vector comprising a
nucleic acid encoding the molecule. Well established viral or
nonviral vectors for gene therapy can be used as the
tissue-targeted gene delivery vector in the invention.
BRIEF DESCRIPTION OF THE FIGURES
[0029] FIG. 1 illustrate a nucleic acid sequence of human ANGPTL4
(SEQ ID NO: 1).
[0030] FIG. 2 illustrates an amino acid sequence of human ANGPTL4
(SEQ ID NO:2) derived from the coding sequence of SEQ ID NO: 1
shown in FIG. 1.
[0031] FIG. 3, Panel A illustrates purified recombinant murine
ANGPTL4 (23-410) separated on SDS polyacrylamide gel
electrophoresis (SDS-PAGE) (4-20%) in the presence (10 mM) or
absence of dithiothreitol (DTT). FIG. 3, Panel B illustrates wild
type (lane 1) and variant hANGPTL4 (lane 2) separated on a SDS gel
and detected by western blotting, where the variant hANGPTL4 has a
R162G and R164E substitution.
[0032] FIG. 4 schematically illustrates ANGPTL4 induces
cell-adhesion of human hepatocytes.
[0033] FIG. 5 schematically illustrates ANGPTL4 induces hepatocyte
proliferation.
[0034] FIG. 6, Panels A and B schematically illustrate
extracellular ANGPTL4 induces primary human pre-adipocyte visceral
proliferation (Panel A) and pre-adipocyte subcutaneous
proliferation (Panel B).
[0035] FIG. 7 schematically illustrates ANGPTL4 (23-406) and
IgG-chimera human ANGPTL4 forms bind to subcutaneous primary human
adipocytes by FACS analysis.
[0036] FIG. 8, Panels A, B and C illustrate that ANGPTL4 induces
cell migration of primary human pre-adipocytes, subcutaneous.
Panels A and B illustrate ANGPTL4 induces cell migration of primary
pre-adipocytes overnight (Panel A) and 7 hours (Panel B). Panel C
schematically illustrates migration of primary pre-adipocytes with
ANGPTL4 at 7 hours, where (1) is no serum added, (2) is 10% fetal
calf serum (FCS), (3) is PDGF-BB, and (4) mANGPTL4.
[0037] FIG. 9, Panels A, B, C, D and E illustrate binding of
ANGPTL4 to integrin .alpha..sub.V.beta..sub.5. Panel A illustrates
the adhesion of 293-1953 (.alpha..sub.V.beta..sub.5) cells to a
plate coated with either mANGPTL4 or vitronectin at the
concentration indicated at the bottom in (.mu.g/ml), where BSA is
used as a control. Panel B illustrates that
anti-.alpha..sub.V.beta..sub.5 and anti-hANGPTL4 antibodies
abolishes ANGPTL4 cell adhesion activity, where (1) is BSA, (2) is
vitronectin and (3) is mANGPTL4. Panel C illustrates binding of
protein (mANGPTL4, hANGPTL4-N.sub.terminal, or
hANGPTL4-C.sub.terminal) using the amount indicated to
.alpha..sub.V.beta..sub.5 coated plates. Panel D illustrates
inhibition of binding of protein (mANGPTL4,
hANGPTL4-N.sub.terminal, or hANGPTL4-C.sub.terminal) to
.alpha..sub.V.beta..sub.5 coated plates with anti-hANGPTL4, where
anti-down syndrome critical region 1 protein (Dscr) antibody
control, 5G7 or medium are used as controls. Panel E illustrates
binding of ANGPTL4 and .alpha..sub.V.beta..sub.5, where (1) is
hANGPTL4-Cterminal coated on the plate, (2) is hANGPTL4-Cterminal
coated on plate and incubated with anti-hANGPTL4, (3) is
hANGPTL4-Cterminal coated on the plate and incubated anti-Dscr, (4)
is Vitronectin coated on the plate and (5) is BSA coated on the
plate, before adding .alpha..sub.V.beta..sub.5.
[0038] FIG. 10 illustrates triglyceride levels of mice with
intravenous tail injection of ANGPTL4 and variants of ANGPTL4,
where (1) is Ad-GFP, (2) is Ad-Gd, (3) is ANGPTL4 (1-406), (4)
ANGPTL4 (1-183), (5) is ANGPTL4 (184-406), (6) is ANGPTL4 variant
R1162G and R164E, (7) is ANGPTL4 (1-408) and (8) is a control.
DETAILED DESCRIPTION
Definitions
[0039] Before describing the invention in detail, it is to be
understood that this invention is not limited to particular
compositions or biological systems, which can, of course, vary. It
is also to be understood that the terminology used herein is for
the purpose of describing particular embodiments only, and is not
intended to be limiting. As used in this specification and the
appended claims, the singular forms "a", "an" and "the" include
plural referents unless the content clearly dictates otherwise.
Thus, for example, reference to "a molecule" optionally includes a
combination of two or more such molecules, and the like. Unless
defined otherwise, all scientific and technical terms are
understood to have the same meaning as commonly used in the art to
which they pertain. For the purpose of the invention, the following
terms are defined below.
[0040] The term "ANGPTL4 or "Angpt14" refers to angiopoietin-like 4
polypeptide or protein, along with naturally occurring allelic,
secreted, and processed forms thereof. For example, ANGPTL4 from
human is a 406 amino acid protein, while the mouse ANGPTL4 is a 410
amino acid protein. The term "ANGPTL4" is also used to refer to
fragments (e.g., subsequences, truncated forms, etc.) of the
polypeptide comprising, e.g., N-terminal fragment, Coiled-coil
domain, C-terminal fragment, fibrinogen-like domain, amino acids
1-183, 23-183, 1 to about 162, 23 to about 162, 23-406, 184-406,
about 162-406, or 23-184 of the human angiopoietin-like 4 protein,
and amino acids 1-183, 23-183, 1 to about 165, 23 to about 165,
23-410, or 184-410 of the murine angiopoietin-like 4 protein. Other
fragments include but are not limited to, e.g., 40-183, 60-183,
80-183, 100-183, 120-183, 140-183, 40-406, 60-406, 80-406, 100-406,
120-406, 140-406, and 160-406 of hANGPTL4 and, e.g., 40-183,
60-183, 80-183, 100-183, 120-183, 140-183, 40-410, 60-410, 80-410,
100-410, 120-410, 140-410 and 160-410 of mANGPTL4. Reference to any
such forms of ANGPTL4 can also be identified in the application,
e.g., by "ANGPTL4 (23-406)," "ANGPTL4 (184-406)," "ANGPTL4
(23-183)," "mANGPTL4 (23-410)," "mANGPTL4 (184-410)," etc., where m
indicates murine sequence. The amino acid position for a fragment
native ANGPTL4 are numbered as indicated in the native ANGPTL4
sequence. For example, amino acid position 22(Ser) in a fragment
ANGPTL4 is also position 22(Ser) in native human ANGPTL4, e.g., see
FIG. 2. Generally, the fragment native ANGPTL4 has biological
activity.
[0041] A "native sequence" polypeptide comprises a polypeptide
having the same amino acid sequence as a polypeptide derived from
nature. Thus, a native sequence polypeptide can have the amino acid
sequence of naturally occurring polypeptide from any mammal. Such
native sequence polypeptide can be isolated from nature or can be
produced by recombinant or synthetic means. The term "native
sequence" polypeptide specifically encompasses naturally occurring
truncated or secreted forms of the polypeptide (e.g., an
extracellular domain sequence), naturally occurring variant forms
(e.g., alternatively spliced forms) and naturally occurring allelic
variants of the polypeptide.
[0042] A polypeptide "variant" means a biologically active
polypeptide having at least about 80% amino acid sequence identity
with the corresponding native sequence polypeptide, or fragment
thereof. Such variants include, for instance, polypeptides wherein
one or more amino acid residues are added, or deleted, at the N-
and/or C-terminus of the polypeptide. Ordinarily, a variant will
have at least about 80% amino acid sequence identity, or at least
about 90% amino acid sequence identity, or at least about 95% or
more amino acid sequence identity with the native sequence
polypeptide, or fragment thereof.
[0043] The term "ANGPTL4 variant" as used herein refers to a
variant as described above and/or an ANGPTL4 which includes one or
more amino acid mutations in the native ANGPTL4 sequence.
Optionally, the one or more amino acid mutations include amino acid
substitution(s). ANGPTL4 and variants thereof for use in the
invention can be prepared by a variety of methods well known in the
art. Amino acid sequence variants of ANGPTL4 can be prepared by
mutations in the ANGPTL4 DNA. Such variants include, for example,
deletions from, insertions into or substitutions of residues within
the amino acid sequence of ANGPTL4, e.g., a human amino acid
sequence encoded by the nucleic acid deposited under ATCC deposit
number 209284, or as shown in FIG. 2. Any combination of deletion,
insertion, and substitution may be made to arrive at the final
construct having the desired activity. The mutations that will be
made in the DNA encoding the variant must not place the sequence
out of reading frame and preferably will not create complementary
regions that could produce secondary mRNA structure. EP
75,444A.
[0044] The ANGPTL4 variants optionally are prepared by
site-directed mutagenesis of nucleotides in the DNA encoding the
native ANGPTL4 or phage display techniques, thereby producing DNA
encoding the variant, and thereafter expressing the DNA in
recombinant cell culture.
[0045] While the site for introducing an amino acid sequence
variation is predetermined, the mutation per se need not be
predetermined. For example, to optimize the performance of a
mutation at a given site, random mutagenesis may be conducted at
the target codon or region and the expressed ANGPTL4 variants
screened for the optimal combination of desired activity.
Techniques for making substitution mutations at predetermined sites
in DNA having a known sequence are well-known, such as, for
example, site-specific mutagenesis. Preparation of the ANGPTL4
variants described herein can be achieved by phage display
techniques, such as those described in the PCT publication WO
00/63380.
[0046] After such a clone is selected, the mutated protein region
may be removed and placed in an appropriate vector for protein
production, generally an expression vector of the type that may be
employed for transformation of an appropriate host.
[0047] Amino acid sequence deletions generally range from about 1
to 30 residues, optionally 1 to 10 residues, optionally 1 to 5 or
less, and typically are contiguous. Amino acid sequence insertions
include amino- and/or carboxyl-terminal fusions of from one residue
to polypeptides of essentially unrestricted length as well as
intrasequence insertions of single or multiple amino acid residues.
Intrasequence insertions (i.e., insertions within the native
ANGPTL4 sequence) may range generally from about 1 to 10 residues,
optionally 1 to 5, or optionally 1 to 3. An example of a terminal
insertion includes a fusion of a signal sequence, whether
heterologous or homologous to the host cell, to the N-terminus to
facilitate the secretion from recombinant hosts.
[0048] Additional ANGPTL4 variants are those in which at least one
amino acid residue in the native ANGPTL4 has been removed and a
different residue inserted in its place. In one embodiment of the
invention, ANGPTL4 variant includes a substitution at 162 and/or
164 of ANGPTL4 or a substitution at 169 of mANGPTL4. Such
substitutions may be made in accordance with those shown in Table
1. ANGPTL4 variants can also comprise unnatural amino acids as
described herein.
[0049] Amino acids may be grouped according to similarities in the
properties of their side chains (in A. L. Lehninger, in
Biochemistry, second ed., pp. 73-75, Worth Publishers, New York
(1975)):
(1) non-polar: Ala (A), Val (V), Leu (L), Ile (I), Pro (P), Phe
(F), Trp (W), Met (M)
(2) uncharged polar: Gly (G), Ser (S), Thr (T), Cys (C), Tyr (Y),
Asn (N), Gln (O)
(3) acidic: Asp (D), Glu (E)
(4) basic: Lys (K), Arg (R), His(H)
[0050] Alternatively, naturally occurring residues may be divided
into groups based on common side-chain properties:
[0051] (1) hydrophobic: Norleucine, Met, Ala, Val, Leu, Ile;
[0052] (2) neutral hydrophilic: Cys, Ser, Thr, Asn, Gln;
[0053] (3) acidic: Asp, Glu;
[0054] (4) basic: His, Lys, Arg;
[0055] (5) residues that influence chain orientation: Gly, Pro;
[0056] (6) aromatic: Trp, Tyr, Phe. TABLE-US-00001 TABLE 1 Original
Exemplary Preferred Residue Substitutions Substitutions Ala (A)
Val; Leu; Ile Val Arg (R) Lys; Gln; Asn Lys Asn (N) Gln; His; Asp,
Lys; Arg Gln Asp (D) Glu; Asn Glu Cys (C) Ser; Ala Ser Gln (Q) Asn;
Glu Asn Glu (E) Asp; Gln Asp Gly (G) Ala Ala His (H) Asn; Gln; Lys;
Arg Arg Ile (I) Leu; Val; Met; Ala; Phe; Norleucine Leu Leu (L)
Norleucine; Ile; Val; Met; Ala; Phe Ile Lys (K) Arg; Gln; Asn Arg
Met (M) Leu; Phe; Ile Leu Phe (F) Trp; Leu; Val; Ile; Ala; Tyr Tyr
Pro (P) Ala Ala Ser (S) Thr Thr Thr (T) Val; Ser Ser Trp (W) Tyr;
Phe Tyr Tyr (Y) Trp; Phe; Thr; Ser Phe Val (V) Ile; Leu; Met; Phe;
Leu Ala; Norleucine
[0057] "Naturally occurring amino acid residues" (i.e. amino acid
residues encoded by the genetic code) may be selected from the
group consisting of: alanine (Ala); arginine (Arg); asparagine
(Asn); aspartic acid (Asp); cysteine (Cys); glutamine (Gln);
glutamic acid (Glu); glycine (Gly); histidine (His); isoleucine
(Ile): leucine (Leu); lysine (Lys); methionine (Met); phenylalanine
(Phe); proline (Pro); serine (Ser); threonine (Thr); tryptophan
(Trp); tyrosine (Tyr); and valine (Val). A "non-naturally occurring
amino acid residue" refers to a residue, other than those naturally
occurring amino acid residues listed above, which is able to
covalently bind adjacent amino acid residues(s) in a polypeptide
chain. Examples of non-naturally occurring amino acid residues
include, e.g., norleucine, ornithine, norvaline, homoserine and
other amino acid residue analogues such as those described in
Ellman et al. Meth. Enzym. 202:301-336 (1991) & US Patent
application publications 20030108885 and 20030082575. Briefly,
these procedures involve activating a suppressor tRNA with a
non-naturally occurring amino acid residue followed by in vitro or
in vivo transcription and translation of the RNA. See, e.g., US
Patent application publications 20030108885 and 20030082575; Noren
et al. Science 244:182 (1989); and, Ellman et al., supra.
[0058] "Percent (%) amino acid sequence identity" herein is defined
as the percentage of amino acid residues in a candidate sequence
that are identical with the amino acid residues in a selected
sequence, after aligning the sequences and introducing gaps, if
necessary, to achieve the maximum percent sequence identity, and
not considering any conservative substitutions as part of the
sequence identity. Alignment for purposes of determining percent
amino acid sequence identity can be achieved in various ways that
are within the skill in the art, for instance, using publicly
available computer software such as BLAST, BLAST-2, ALIGN, ALIGN-2
or Megalign (DNASTAR) software. Those skilled in the art can
determine appropriate parameters for measuring alignment, including
any algorithms needed to achieve maximal alignment over the
full-length of the sequences being compared. For purposes herein,
however, % amino acid sequence identity values are obtained as
described below by using the sequence comparison computer program
ALIGN-2. The ALIGN-2 sequence comparison computer program was
authored by Genentech, Inc. has been filed with user documentation
in the U.S. Copyright Office, Washington D.C., 20559, where it is
registered under U.S. Copyright Registration No. TXU510087, and is
publicly available through Genentech, Inc., South San Francisco,
Calif. The ALIGN-2 program should be compiled for use on a UNIX
operating system, e.g., digital UNIX V4.0D. All sequence comparison
parameters are set by the ALIGN-2 program and do not vary.
[0059] For purposes herein, the % amino acid sequence identity of a
given amino acid sequence A to, with, or against a given amino acid
sequence B (which can alternatively be phrased as a given amino
acid sequence A that has or comprises a certain % amino acid
sequence identity to, with, or against a given amino acid sequence
B) is calculated as follows:
[0060] 100 times the fraction X/Y
[0061] where X is the number of amino acid residues scored as
identical matches by the sequence alignment program ALIGN-2 in that
program's alignment of A and B, and where Y is the total number of
amino acid residues in B. It will be appreciated that where the
length of amino acid sequence A is not equal to the length of amino
acid sequence B, the % amino acid sequence identity of A to B will
not equal the % amino acid sequence identity of B to A.
[0062] An "isolated" polypeptide is one that has been identified
and separated and/or recovered from a component of its natural
environment. Contaminant components of its natural environment are
materials that would interfere with diagnostic or therapeutic uses
for the polypeptide, and may include enzymes, hormones, and other
proteinaceous or nonproteinaceous solutes. In certain embodiments,
the polypeptide will be purified (1) to greater than 95% by weight
of polypeptide as determined by the Lowry method, or more than 99%
by weight, (2) to a degree sufficient to obtain at least 15
residues of N-terminal or internal amino acid sequence by use of a
spinning cup sequenator, or (3) to homogeneity by SDS-PAGE under
reducing or nonreducing conditions using Coomassie blue, or silver
stain. Isolated polypeptide includes the polypeptide in situ within
recombinant cells since at least one component of the polypeptide's
natural environment will not be present. Ordinarily, however,
isolated polypeptide will be prepared by at least one purification
step.
[0063] The term "ANGPTL4 modulator" refers to a molecule that can
activate, e.g., an agonist, ANGPTL4 or its expression, or that can
inhibit, e.g., an antagonist (or inhibitor), the activity of
ANGPTL4 or its expression. ANGPTL4 agonists include antibodies and
active fragments. An ANGPTL4 antagonist refers to a molecule
capable of neutralizing, blocking, inhibiting, abrogating, reducing
or interfering with ANGPTL4 activities, e.g., cell proliferation or
growth, migration, adhesion or metabolic, e.g., lipid, modulation,
or its expression including its binding to an ANGPTL4 receptor,
e.g., .alpha..sub.V.beta..sub.5. ANGPTL4 antagonists include, e.g.,
anti-ANGPTL4 antibodies and antigen-binding fragments thereof,
receptor molecules and derivatives which bind specifically to
ANGPTL4 thereby sequestering its binding to one or more receptors,
anti-ANGPTL4 receptor antibodies and ANGPTL4 receptor antagonists
such as small molecule inhibitors of the receptor. Other ANGPTL4
antagonists also include antagonist variants of ANGPTL4, antisense
molecules (e.g., ANGPTL4-SiRNA), RNA aptamers, and ribozymes
against ANGPTL4 or its receptor. In certain embodiments, antagonist
ANGPTL4 antibodies are antibodies that inhibit or reduce the
activity of ANGPTL4 by binding to a specific subsequence or region
of ANGPTL4, e.g., N-terminal fragment, Coiled-coil domain,
C-terminal fragment, fibrinogen-like domain, amino acids 1-183,
23-183, 1 to about 162, 23 to about 162, 23-406, 184-406, about
162-406 or 23-184 of the human angiopoietin-like 4 protein, and
amino acids 1-183, 23-183, 1 to about 165, 23 to about 165, 23-410,
or 184-410 of the murine angiopoietin-like 4 protein. Other
subsequences also include, but not limited to, e.g., 40-183,
60-183, 80-183, 100-183, 120-183, 140-183, 40-406, 60-406, 80-406,
100-406, 120-406, 140-406, and 160-406 of hANGPTL4 and, e.g.,
40-183, 60-183, 80-183, 100-183, 120-183, 140-183, 40-410, 60-410,
80-410, 100-410, 120-410, 140-410 and 160-410 of mANGPTL4.
[0064] Modulators of ANGPTL4 are molecules that modulate the
activity of ANGPTL4, e.g., agonists and antagonists. The term
"agonist" is used to refer to peptide and non-peptide analogs of
ANGPTL4, and to antibodies specifically binding such ANGPTL4
molecules, provided they have the ability to signal through a
native ANGPTL4 receptor (e.g., .alpha..sub.V.beta..sub.5 integrin).
The term "agonist" is defined in the context of the biological role
of an ANGPTL4 receptor (e.g., .alpha..sub.V.beta..sub.5). In
certain embodiments, agonists possess the biological activities of
a native ANGPTL4, as defined above, such as the promotion of
proliferation, migration, and/or adhesion of cells, and/or
modulation of lipid homestasis.
[0065] The term "antagonist" is used to refer to molecules that
have the ability to inhibit the biological activity of ANGPTL4
regardless of whether they have the ability to bind ANGPTL4 or its
receptor, e.g., .alpha..sub.V.beta..sub.5. For example, antagonists
that have the ability to bind ANGPTL4 or its receptor include
anti-ANGPTL4 and anti-.alpha..sub.V.beta..sub.5 antibodies.
Antagonist that inhibit expression of ANGPTL4 are included, e.g.,
ANGPTL4-SiRNA. Antagonist ANGPTL4 can be assessed by, e.g., by
inhibiting the activity of ANGPTL4, e.g., adhesion, migration,
proliferation, and/or modulation of lipid homestasis activity of
ANGPTL4. With regard to .alpha..sub.V.beta..sub.5 integrin receptor
activity, a modulator of an .alpha..sub.V.beta..sub.5 integrin
receptor can be determined by methods known in the art. For
example, the method described by J. W. Smith et al. in J. Biol.
Chem. 265:12267-12271 (1990) can be used.
[0066] The term "Anti-ANGPTL4 antibody" is an antibody that binds
to ANGPTL4 with sufficient affinity and specificity. In certain
embodiments of the invention, the anti-ANGPTL4 antibody of the
invention can be used as a therapeutic agent in targeting and
interfering with diseases or conditions wherein ANGPTL4 activity is
involved. Generally, an anti-ANGPTL4 antibody will usually not bind
to other ANGPTL4 homologues, e.g., ANGPTL3.
[0067] The term "antibody" is used in the broadest sense and
includes monoclonal antibodies (including full length or intact
monoclonal antibodies), polyclonal antibodies, multivalent
antibodies, multispecific antibodies (e.g., bispecific antibodies),
and antibody fragments (see below) so long as they exhibit the
desired biological activity.
[0068] Unless indicated otherwise, the expression "multivalent
antibody" is used throughout this specification to denote an
antibody comprising three or more antigen binding sites. The
multivalent antibody is typically engineered to have the three or
more antigen binding sites and is generally not a native sequence
IgM or IgA antibody.
[0069] "Antibody fragments" comprise only a portion of an intact
antibody, generally including an antigen binding site of the intact
antibody and thus retaining the ability to bind antigen. Examples
of antibody fragments encompassed by the present definition
include: (i) the Fab fragment, having VL, CL, VH and CH1 domains;
(ii) the Fab' fragment, which is a Fab fragment having one or more
cysteine residues at the C-terminus of the CH1 domain; (iii) the Fd
fragment having VH and CH1 domains; (iv) the Fd' fragment having VH
and CH1 domains and one or more cysteine residues at the C-terminus
of the CH1 domain; (v) the Fv fragment having the VL and VH domains
of a single arm of an antibody; (vi) the dAb fragment (Ward et al.,
Nature 341, 544-546 (1989)) which consists of a VH domain; (vii)
isolated CDR regions; (viii) F(ab')2 fragments, a bivalent fragment
including two Fab' fragments linked by a disulphide bridge at the
hinge region; (ix) single chain antibody molecules (e.g. single
chain Fv; scFv) (Bird et al., Science 242:423-426 (1988); and
Huston et al., PNAS (USA) 85:5879-5883 (1988)); (x) "diabodies"
with two antigen binding sites, comprising a heavy chain variable
domain (VH) connected to a light chain variable domain (VL) in the
same polypeptide chain (see, e.g., EP 404,097; WO 93/11161; and
Hollinger et al., Proc. Natl. Acad. Sci. USA, 90:6444-6448 (1993));
(xi) "linear antibodies" comprising a pair of tandem Fd segments
(VH-CH1-VH-CH1) which, together with complementary light chain
polypeptides, form a pair of antigen binding regions (Zapata et al.
Protein Eng. 8(10): 1057 1062 (1995); and U.S. Pat. No.
5,641,870).
[0070] The term "monoclonal antibody" as used herein refers to an
antibody obtained from a population of substantially homogeneous
antibodies, i.e., the individual antibodies comprising the
population are identical except for possible naturally occurring
mutations that may be present in minor amounts. Monoclonal
antibodies are highly specific, being directed against a single
antigen. Furthermore, in contrast to polyclonal antibody
preparations that typically include different antibodies directed
against different determinants (epitopes), each monoclonal antibody
is directed against a single determinant on the antigen. The
modifier "monoclonal" is not to be construed as requiring
production of the antibody by any particular method. For example,
the monoclonal antibodies to be used in accordance with the
invention may be made by the hybridoma method first described by
Kohler et al., Nature 256:495 (1975), or may be made by recombinant
DNA methods (see, e.g., U.S. Pat. No. 4,816,567). The "monoclonal
antibodies" may also be isolated from phage antibody libraries
using the techniques described in Clackson et al., Nature
352:624-628 (1991) or Marks et al., J. Mol. Biol. 222:581-597
(1991), for example.
[0071] The monoclonal antibodies herein specifically include
"chimeric" antibodies in which a portion of the heavy and/or light
chain is identical with or homologous to corresponding sequences in
antibodies derived from a particular species or belonging to a
particular antibody class or subclass, while the remainder of the
chain(s) is identical with or homologous to corresponding sequences
in antibodies derived from another species or belonging to another
antibody class or subclass, as well as fragments of such
antibodies, so long as they exhibit the desired biological activity
(U.S. Pat. No. 4,816,567; and Morrison et al., Proc. Natl. Acad.
Sci. USA 81:6851-6855 (1984)).
[0072] "Humanized" forms of non-human (e.g., murine) antibodies are
chimeric antibodies that contain minimal sequence derived from
non-human immunoglobulin. For the most part, humanized antibodies
are human immunoglobulins (recipient antibody) in which residues
from a hypervariable region of the recipient are replaced by
residues from a hypervariable region of a non-human species (donor
antibody) such as mouse, rat, rabbit or nonhuman primate having the
desired specificity, affinity, and capacity. In some instances,
framework region (FR) residues of the human immunoglobulin are
replaced by corresponding non-human residues. Furthermore,
humanized antibodies may comprise residues that are not found in
the recipient antibody or in the donor antibody. These
modifications are made to further refine antibody performance. In
general, the humanized antibody will comprise substantially all of
at least one, and typically two, variable domains, in which all or
substantially all of the hypervariable loops correspond to those of
a non-human immunoglobulin and all or substantially all of the FRs
are those of a human immunoglobulin sequence. The humanized
antibody optionally will also comprise at least a portion of an
immunoglobulin constant region (Fc), typically that of a human
immunoglobulin. For further details, see Jones et al., Nature
321:522-525 (1986); Riechmann et al., Nature 332:323-329 (1988);
and Presta, Curr. Op. Struct. Biol. 2:593-596 (1992).
[0073] A "human antibody" is one which possesses an amino acid
sequence which corresponds to that of an antibody produced by a
human and/or has been made using any of the techniques for making
human antibodies as disclosed herein. This definition of a human
antibody specifically excludes a humanized antibody comprising
non-human antigen-binding residues. Human antibodies can be
produced using various techniques known in the art. In one
embodiment, the human antibody is selected from a phage library,
where that phage library expresses human antibodies (Vaughan et al.
Nature Biotechnology 14:309-314 (1996): Sheets et al. PNAS (USA)
95:6157-6162 (1998)); Hoogenboom and Winter, J. Mol. Biol., 227:381
(1991); Marks et al., J. Mol. Biol., 222:581 (1991)). Human
antibodies can also be made by introducing human immunoglobulin
loci into transgenic animals, e.g., mice in which the endogenous
immunoglobulin genes have been partially or completely inactivated.
Upon challenge, human antibody production is observed, which
closely resembles that seen in humans in all respects, including
gene rearrangement, assembly, and antibody repertoire. This
approach is described, for example, in U.S. Pat. Nos. 5,545,807;
5,545,806; 5,569,825; 5,625,126; 5,633,425; 5,661,016, and in the
following scientific publications: Marks et al., Bio/Technology 10:
779-783 (1992); Lonberg et al., Nature 368: 856-859 (1994);
Morrison, Nature 368:812-13 (1994); Fishwild et al., Nature
Biotechnology 14: 845-51 (1996); Neuberger, Nature Biotechnology
14: 826 (1996); Lonberg and Huszar, Intern. Rev. Immunol. 13:65-93
(1995). Alternatively, the human antibody may be prepared via
immortalization of human B lymphocytes producing an antibody
directed against a target antigen (such B lymphocytes may be
recovered from an individual or may have been immunized in vitro).
See, e.g., Cole et al., Monoclonal Antibodies and Cancer Therapy,
Alan R. Liss, p. 77 (1985); Boerner et al., J. Immunol., 147
(1):86-95 (1991); and U.S. Pat. No. 5,750,373.
[0074] The term "variable" refers to the fact that certain portions
of the variable domains differ extensively in sequence among
antibodies and are used in the binding and specificity of each
particular antibody for its particular antigen. However, the
variability is not evenly distributed throughout the variable
domains of antibodies. It is concentrated in three segments called
hypervariable regions both in the light chain and the heavy chain
variable domains. The more highly conserved portions of variable
domains are called the framework regions (FRs). The variable
domains of native heavy and light chains each comprise four FRs,
largely adopting a beta-sheet configuration, connected by three
hypervariable regions, which form loops connecting, and in some
cases forming part of, the beta-sheet structure. The hypervariable
regions in each chain are held together in close proximity by the
FRs and, with the hypervariable regions from the other chain,
contribute to the formation of the antigen-binding site of
antibodies (see Kabat et al., Sequences of Proteins of
Immunological Interest, 5th Ed. Public Health Service, National
Institutes of Health, Bethesda, Md. (1991)). The constant domains
are not involved directly in binding an antibody to an antigen, but
exhibit various effector functions, such as participation of the
antibody in antibody-dependent cell-mediated cytotoxicity
(ADCC).
[0075] The term "hypervariable region" when used herein refers to
the amino acid residues of an antibody which are responsible for
antigen-binding. The hypervariable region generally comprises amino
acid residues from a "complementarity determining region" or "CDR"
(e.g. residues 24-34 (L1), 50-56 (L2) and 89-97 (L3) in the light
chain variable domain and 31-35 (H1), 50-65 (H2) and 95-102 (H3) in
the heavy chain variable domain; Kabat et al., Sequences of
Proteins of Immunological Interest, 5th Ed. Public Health Service,
National Institutes of Health, Bethesda, Md. (1991)) and/or those
residues from a "hypervariable loop" (e.g. residues 26-32 (L1),
50-52 (L2) and 91-96 (L3) in the light chain variable domain and
26-32 (H1), 53-55 (H2) and 96-101 (H3) in the heavy chain variable
domain; Chothia and Lesk J. Mol. Biol. 196:901-917 (1987)).
"Framework Region" or "FR" residues are those variable domain
residues other than the hypervariable region residues as herein
defined.
[0076] Depending on the amino acid sequence of the constant domain
of their heavy chains, intact antibodies can be assigned to
different "classes". There are five major classes of intact
antibodies: IgA, IgD, IgE, IgG, and IgM, and several of these may
be further divided into "subclasses" (isotypes), e.g., IgG.sub.1
(including non-A and A allotypes), IgG.sub.2, IgG.sub.3, IgG.sub.4,
IgA, and IgA.sub.2. The heavy-chain constant domains that
correspond to the different classes of antibodies are called
.alpha., .delta., .epsilon., .gamma. and .mu., respectively. The
subunit structures and three-dimensional configurations of
different classes of immunoglobulins are well known.
[0077] The light chains of antibodies from any vertebrate species
can be assigned to one of two clearly distinct types, called kappa
(6) and lambda (8), based on the amino acid sequences of their
constant domains.
[0078] The term "Fc region" is used to define the C-terminal region
of an immunoglobulin heavy chain which may be generated by papain
digestion of an intact antibody. The Fc region may be a native
sequence Fc region or a variant Fc region. Although the boundaries
of the Fc region of an immunoglobulin heavy chain might vary, the
human IgG heavy chain Fc region is usually defined to stretch from
an amino acid residue at about position Cys226, or from about
position Pro230, to the carboxyl-terminus of the Fc region. The Fc
region of an immunoglobulin generally comprises two constant
domains, a CH2 domain and a CH3 domain, and optionally comprises a
CH4 domain. By "Fc region chain" herein is meant one of the two
polypeptide chains of an Fc region.
[0079] The "CH2 domain" of a human IgG Fc region (also referred to
as "Cg2" domain) usually extends from an amino acid residue at
about position 231 to an amino acid residue at about position 340.
The CH2 domain is unique in that it is not closely paired with
another domain. Rather, two N-linked branched carbohydrate chains
are interposed between the two CH2 domains of an intact native IgG
molecule. It has been speculated that the carbohydrate may provide
a substitute for the domain-domain pairing and help stabilize the
CH2 domain. Burton, Molec. Immunol. 22:161-206 (1985). The CH2
domain herein may be a native sequence CH2 domain or variant CH2
domain.
[0080] The "CH3 domain" comprises the stretch of residues
C-terminal to a CH2 domain in an Fc region (i.e. from an amino acid
residue at about position 341 to an amino acid residue at about
position 447 of an IgG). The CH3 region herein may be a native
sequence CH3 domain or a variant CH3 domain (e.g. a CH3 domain with
an introduced "protroberance" in one chain thereof and a
corresponding introduced "cavity" in the other chain thereof; see
U.S. Pat. No. 5,821,333, expressly incorporated herein by
reference). Such variant CH3 domains may be used to make
multispecific (e.g. bispecific) antibodies as herein described.
[0081] "Hinge region" is generally defined as stretching from about
Glu216, or about Cys226, to about Pro230 of human IgG1 (Burton,
Molec. Immunol. 22:161-206 (1985)). Hinge regions of other IgG
isotypes may be aligned with the IgG1 sequence by placing the first
and last cysteine residues forming inter-heavy chain S--S bonds in
the same positions. The hinge region herein may be a native
sequence hinge region or a variant hinge region. The two
polypeptide chains of a variant hinge region generally retain at
least one cysteine residue per polypeptide chain, so that the two
polypeptide chains of the variant hinge region can form a disulfide
bond between the two chains. The preferred hinge region herein is a
native sequence human hinge region, e.g. a native sequence human
IgG1 hinge region.
[0082] A "functional Fc region" possesses at least one "effector
function" of a native sequence Fc region. Exemplary "effector
functions" include C1q binding; complement dependent cytotoxicity
(CDC); Fc receptor binding; antibody-dependent cell-mediated
cytotoxicity (ADCC); phagocytosis; down regulation of cell surface
receptors (e.g. B cell receptor; BCR), etc. Such effector functions
generally require the Fc region to be combined with a binding
domain (e.g. an antibody variable domain) and can be assessed using
various assays known in the art for evaluating such antibody
effector functions.
[0083] A "native sequence Fc region" comprises an amino acid
sequence identical to the amino acid sequence of an Fc region found
in nature.
[0084] A "variant Fc region" comprises an amino acid sequence which
differs from that of a native sequence Fc region by virtue of at
least one amino acid modification. Preferably, the variant Fc
region has at least one amino acid substitution compared to a
native sequence Fc region or to the Fc region of a parent
polypeptide, e.g. from about one to about ten amino acid
substitutions, and preferably from about one to about five amino
acid substitutions in a native sequence Fc region or in the Fc
region of the parent polypeptide. The variant Fc region herein will
typically possess, e.g., at least about 80% sequence identity with
a native sequence Fc region and/or with an Fc region of a parent
polypeptide, or at least about 90% sequence identity therewith, or
at least about 95% sequence or more identity therewith.
[0085] "Antibody-dependent cell-mediated cytotoxicity" and "ADCC"
refer to a cell-mediated reaction in which nonspecific cytotoxic
cells that express Fc receptors (FcRs) (e.g. Natural Killer (NK)
cells, neutrophils, and macrophages) recognize bound antibody on a
target cell and subsequently cause lysis of the target cell. The
primary cells for mediating ADCC, NK cells, express Fc.gamma.RIII
only, whereas monocytes express Fc.gamma.RI, Fc.gamma.RII and
Fc.gamma.RIII. FcR expression on hematopoietic cells is summarized
in Table 3 on page 464 of Ravetch and Kinet, Annu. Rev. Immunol
9:457-92 (1991). To assess ADCC activity of a molecule of interest,
an in vitro ADCC assay, such as that described in U.S. Pat. No.
5,500,362 or 5,821,337 may be performed. Useful effector cells for
such assays include peripheral blood mononuclear cells (PBMC) and
Natural Killer (NK) cells. Alternatively, or additionally, ADCC
activity of the molecule of interest may be assessed in vivo, e.g.,
in a animal model such as that disclosed in Clynes et al. PNAS
(USA) 95:652-656 (1998).
[0086] "Human effector cells" are leukocytes which express one or
more FcRs and perform effector functions. Typically, the cells
express at least Fc.gamma.RIII and perform ADCC effector function.
Examples of human leukocytes which mediate ADCC include peripheral
blood mononuclear cells (PBMC), natural killer (NK) cells,
monocytes, cytotoxic T cells and neutrophils; with PBMCs and NK
cells being generally preferred. The effector cells may be isolated
from a native source thereof, e.g. from blood or PBMCs as described
herein.
[0087] The terms "Fc receptor" and "FcR" are used to describe a
receptor that binds to the Fc region of an antibody. The preferred
FcR is a native sequence human FcR. Moreover, a preferred FcR is
one which binds an IgG antibody (a gamma receptor) and includes
receptors of the Fc.gamma.RI, Fc.gamma.RII, and Fc.gamma.RIII
subclasses, including allelic variants and alternatively spliced
forms of these receptors. Fc.gamma.RII receptors include
Fc.gamma.RIIA (an "activating receptor") and Fc.gamma.RIIB (an
"inhibiting receptor"), which have similar amino acid sequences
that differ primarily in the cytoplasmic domains thereof.
Activating receptor Fc.gamma.RIIA contains an immunoreceptor
tyrosine-based activation motif (ITAM) in its cytoplasmic domain.
Inhibiting receptor Fc.gamma.RIIB contains an immunoreceptor
tyrosine-based inhibition motif (ITIM) in its cytoplasmic domain
(reviewed in Daeron, Annu. Rev. Immunol. 15:203-234 (1997)). FcRs
are reviewed in Ravetch and Kinet, Annu. Rev. Immunol 9:457-92
(1991); Capel et al., Immunomethods 4:25-34 (1994); and de Haas et
al., J. Lab. Clin. Med. 126:330-41 (1995). Other FcRs, including
those to be identified in the future, are encompassed by the term
"FcR" herein. The term also includes the neonatal receptor, FcRn,
which is responsible for the transfer of maternal IgGs to the fetus
(Guyer et al., J. Immunol. 117:587 (1976); and Kim et al., J.
Immunol. 24:249 (1994)).
[0088] "Complement dependent cytotoxicity" and "CDC" refer to the
lysing of a target in the presence of complement. The complement
activation pathway is initiated by the binding of the first
component of the complement system (C1q) to a molecule (e.g. an
antibody) complexed with a cognate antigen. To assess complement
activation, a CDC assay, e.g. as described in Gazzano-Santoro et
al., J. Immunol. Methods 202:163 (1996), may be performed.
[0089] The term "immunoadhesin" refers to antibody-like molecules
which combine the binding specificity of a heterologous protein (an
"adhesin") with the effector functions of immunoglobulin constant
domains.
[0090] Structurally, the immunoadhesins comprise a fusion of an
amino acid sequence with the desired binding specificity which is
other than the antigen recognition and binding site of an antibody
(i.e., is "heterologous"), and an immunoglobulin constant domain
sequence. The adhesin part of an immunoadhesin molecule typically
is a contiguous amino acid sequence comprising at least the binding
site of a receptor or a ligand. The immunoglobulin constant domain
sequence in the immunoadhesin may be obtained from any
immunoglobulin, such as IgG.sub.1, IgG.sub.2, IgG.sub.3, or
IgG.sub.4 subtypes, IgA (including IgA.sub.1 and IgA.sub.2), IgE,
IgD or IgM.
[0091] "Active" or "activity" for the purposes herein refers to
form(s) of ANGPTL4 which retain a biological and/or an
immunological activity of native or naturally-occurring ANGPTL4,
wherein "biological" activity refers to a biological function
(either inhibitory or stimulatory) caused by a native or
naturally-occurring ANGPTL4 other than the ability to induce the
production of an antibody against an antigenic epitope possessed by
a native or naturally-occurring ANGPTL4 and an "immunological"
activity refers to the ability to induce the production of an
antibody against an antigenic epitope possessed by a native or
naturally-occurring ANGPTL4.
[0092] An "affinity matured" antibody is one with one or more
alterations in one or more CDRs thereof which result an improvement
in the affinity of the antibody for antigen, compared to a parent
antibody which does not possess those alteration(s). Preferred
affinity matured antibodies will have nanomolar or even picomolar
affinities for the target antigen. Affinity matured antibodies are
produced by procedures known in the art. Marks et al.
Bio/Technology 10:779-783 (1992) describes affinity maturation by
VH and VL domain shuffling. Random mutagenesis of CDR and/or
framework residues is described by: Barbas et al. Proc Nat. Acad.
Sci, USA 91:3809-3813 (1994); Schier et al. Gene 169:147-155
(1995); Yelton et al. J. Immunol. 155:1994-2004 (1995); Jackson et
al., J. Immunol. 154(7):3310-9 (1995); and Hawkins et al, J. Mol.
Biol. 226:889-896 (1992).
[0093] A "functional antigen binding site" of an antibody is one
which is capable of binding a target antigen. The antigen binding
affinity of the antigen binding site is not necessarily as strong
as the parent antibody from which the antigen binding site is
derived, but the ability to bind antigen must be measurable using
any one of a variety of methods known for evaluating antibody
binding to an antigen. Moreover, the antigen binding affinity of
each of the antigen binding sites of a multivalent antibody herein
need not be quantitatively the same. For the multimeric antibodies
herein, the number of functional antigen binding sites can be
evaluated using ultracentrifugation analysis. According to this
method of analysis, different ratios of target antigen to
multimeric antibody are combined and the average molecular weight
of the complexes is calculated assuming differing numbers of
functional binding sites. These theoretical values are compared to
the actual experimental values obtained in order to evaluate the
number of functional binding sites.
[0094] An antibody having a "biological characteristic" of a
designated antibody is one which possesses one or more of the
biological characteristics of that antibody which distinguish it
from other antibodies that bind to the same antigen. In order to
screen for antibodies which bind to an epitope on an antigen bound
by an antibody of interest, a routine cross-blocking assay such as
that described in Antibodies, A Laboratory Manual, Cold Spring
Harbor Laboratory, Ed Harlow and David Lane (1988), can be
performed.
[0095] A "polypeptide chain" is a polypeptide wherein each of the
domains thereof is joined to other domain(s) by peptide bond(s), as
opposed to non-covalent interactions or disulfide bonds.
[0096] A "flexible linker" herein refers to a peptide comprising
two or more amino acid residues joined by peptide bond(s), and
provides more rotational freedom for two polypeptides (such as two
Fd regions) linked thereby. Such rotational freedom allows two or
more antigen binding sites joined by the flexible linker to each
access target antigen(s) more efficiently. Examples of suitable
flexible linker peptide sequences include gly-ser, gly-ser-gly-ser,
ala-ser, and gly-gly-gly-ser.
[0097] A "dimerization domain" is formed by the association of at
least two amino acid residues (generally cysteine residues) or of
at least two peptides or polypeptides (which may have the same, or
different, amino acid sequences). The peptides or polypeptides may
interact with each other through covalent and/or non-covalent
association(s). Examples of dimerization domains herein include an
Fc region; a hinge region; a CH3 domain; a CH4 domain; a CH1-CL
pair; an "interface" with an engineered "knob" and/or
"protruberance" as described in U.S. Pat. No. 5,821,333, expressly
incorporated herein by reference; a leucine zipper (e.g. a jun/fos
leucine zipper, see Kostelney et al., J. Immunol., 148: 1547-1553
(1992); or a yeast GCN4 leucine zipper); an isoleucine zipper; a
receptor dimer pair (e.g., interleukin-8 receptor (IL-8R); and
integrin heterodimers such as LFA-1 and GPIIIb/IIIa), or the
dimerization region(s) thereof; dimeric ligand polypeptides (e.g.
nerve growth factor (NGF), neurotrophin-3 (NT-3), interleukin-8
(IL-8), vascular endothelial growth factor (VEGF), VEGF-C, VEGF-D,
PDGF members, and brain-derived neurotrophic factor (BDNF); see
Arakawa et al. J. Biol. Chem. 269(45): 27833-27839 (1994) and
Radziejewski et al. Biochem. 32(48): 1350 (1993)), or the
dimerization region(s) thereof; a pair of cysteine residues able to
form a disulfide bond; a pair of peptides or polypeptides, each
comprising at least one cysteine residue (e.g. from about one, two
or three to about ten cysteine residues) such that disulfide
bond(s) can form between the peptides or polypeptides (hereinafter
"a synthetic hinge"); and antibody variable domains. The most
preferred dimerization domain herein is an Fc region or a hinge
region.
[0098] The phrase "stimulating proliferation of a cell" encompasses
the step of increasing the extent of growth and/or reproduction of
the cell relative to an untreated cell or a reduced treated cell
either in vitro or in vivo. An increase in cell proliferation in
cell culture can be detected by counting the number of cells before
and after exposure to a molecule of interest. The extent of
proliferation can be quantified via microscopic examination of the
degree of confluence. Cell proliferation can also be quantified
using assays known in the art, e.g., thymidine incorporation assay,
and commercially available assays. The phrase "inhibiting
proliferation of a cell" encompasses the step of decreasing the
extent of growth and/or reproduction of the cell relative to an
untreated cel or a reduced treated cell either in vitro or in vivo.
It can be quantified as described above.
[0099] Administration "in combination with" one or more further
therapeutic agents includes simultaneous (concurrent) and/or
consecutive administration in any order.
[0100] "Subject" for purposes of treatment refers to any animal.
Generally, the animal is a mammal. "Mammal" for purposes of
treatment refers to any animal classified as a mammal, including
humans, domestic and farm animals, and zoo, sports, or pet animals,
such as dogs, horses, cats, cows, sheep, pigs, etc. Typically, the
mammal is a human.
[0101] The term "ameliorates" or "amelioration" as used herein
refers to a decrease, reduction or elimination of a condition,
disease, disorder, or phenotype, including an abnormality or
symptom.
[0102] A "disorder" is any condition that would benefit from
treatment with a molecule of the invention. This includes chronic
and acute disorders or diseases including those pathological
conditions which predispose the subject to the disorder in
question.
[0103] The term "effective amount" or "therapeutically effective
amount" refers to an amount of a drug effective to treat a disease
or disorder in a subject.
[0104] "Treatment" refers to both therapeutic treatment and
prophylactic or preventative measures. Those in need of treatment
include those already with the disorder as well as those in which
the disorder is to be prevented.
[0105] "Hypertrophy," as used herein, is defined as an increase in
mass of an organ or structure independent of natural growth that
does not involve tumor formation. Hypertrophy of an organ or tissue
is due either to an increase in the mass of the individual cells
(true hypertrophy), or to an increase in the number of cells making
up the tissue (hyperplasia), or both. For example, hypertrophic
growth of adipocytes is an increase in size of the adipocyte
stimulated by lipid accumulation. Hyperplastic growth of adipocytes
is an increase in number of adipocytes in adipose tissue.
[0106] The phrases "cardiovascular and endothelial disorder,"
"cardiovascular and endothelial dysfunction" and "cardiovascular,
endothelial or angiogenic disorder" are used interchangeably and
refer to disorders, typically systemic, that stimulate angiogenesis
and/or cardiovascularization. This includes diseases that affect
vessels, as well as diseases of the vessels themselves, such as of
the arteries, capillaries, veins, and/or lymphatics. Such disorders
include, but are not limited to, e.g., arterial disease, such as
atherosclerosis, diabetes mellitus, hypertension, inflammatory
vasculitides, Reynaud's disease and Reynaud's phenomenon,
aneurysms, and arterial restenosis; venous and lymphatic disorders
such as thrombophlebitis, lymphangitis, and lymphedema; cancer such
as vascular tumors, e.g., hemangioma (capillary and cavernous),
glomus tumors, telangiectasia, bacillary angiomatosis,
hemangioendothelioma, angiosarcoma, haemangiopericytoma, Kaposi's
sarcoma, lymphangioma, and lymphangiosarcoma; tumor angiogenesis;
and other vascular disorders such as peripheral vascular disease,
trauma such as wounds, burns, and other injured tissue, implant
fixation, scarring, ischemia reperfusion injury, rheumatoid
arthritis, cerebrovascular disease, renal diseases such as acute
renal failure; stroke, coronary artery disease,
hypercholesterolemia, hypertriglyceridemia, and/or osteoporosis.
This would also include angina, myocardial infarctions such as
acute myocardial infarctions, cardiac hypertrophy, and heart
failure such as congestive heart failure (CHF). Cardiovascular
diseases associated with dyslipidemia are also included, e.g., but
not limited to, hypertension, atherosclerosis, heart failure,
stroke, various coronary artery diseases, obesity, diabetes,
etc.
[0107] The term a "lipid homeostasis disorder" includes a disorder,
disease, or condition associated with, caused by, and/or linked to
abnormal regulation (e.g., upregulation or downregulation) of lipid
metabolism. Lipid homeostasis disorders may be caused by or
associated with aberrant lipolysis, aberrant lipid uptake, aberrant
lipid synthesis and/or secretion, aberrant intracellular lipid
release and/or turnover, aberrant intracellular triglyceride
release and/or turnover, aberrant intracellular lipid and/or
triglyceride mass, and/or aberrant secreted lipid and/or
triglyceride mass within or from a cell, e.g., a liver cell. Lipid
homeostasis disorders include, but are not limited to,
atherosclerosis, obesity, conditions related to obesity, diabetes,
insulin resistance, hyperlipidemia, hypolipidemia, dyslipidemia,
hypercholesterolemia, hypocholesterolemia, triglyceride storage
disease, cardiovascular disease, coronary artery disease,
hypertension, stroke, overweight, anorexia, cachexia,
hyperlipoproteinemia, hypolipoproteinemia, Niemann Pick disease,
hypertriglyceridemia, hypotriglyceridemia, pancreatitis, diffuse
idiopathic skeletal hyperostosis (DISH), atherogenic lipoprotein
phenotype (ALP), epilepsy, liver disease, fatty liver,
steatohepatitis, polycystic ovarian syndrome, cancer, etc. The term
"lipid metabolic disorder" refers to abnormal clinical chemistry
levels of cholesterol and triglycerides. The term "Hyperlipidemia"
or "Hyperlipemia" refers to a condition where there are higher
levels than normal of serum lipid levels. Serum lipids include
cholesterol (ester and free), lipoproteins, triglycerides, free
fatty acids, and other sterols. In one aspect, elevated levels of
these lipids are an indication for atherosclerosis.
[0108] The term "Obesity" refers to a condition whereby a mammal
has a Body Mass Index (BMI), which is calculated as weight (kg) per
height.sup.2 (meters.sup.2), of at least 25.9. Conventionally,
those persons with normal weight have a BMI of 19.9 to less than
25.9. The obesity herein may be due to any cause, whether genetic
or environmental. Examples of disorders that may result in obesity
or be the cause of obesity include, e.g., but are not limited to,
overeating and bulimia, polycystic ovarian disease,
craniopharyngioma, the Prader-Willi Syndrome, Frohlich's syndrome,
Type II diabetes, GH-deficient subjects, normal variant short
stature, Turner's syndrome, and other pathological conditions
showing reduced metabolic activity or a decrease in resting energy
expenditure as a percentage of total fat-free mass, e.g., children
with acute lymphoblastic leukemia. An "obesity-determining
property" includes fat cells and tissue, such as fat pads, total
body weight, triglyceride levels in muscle, liver and fat and
fasting and non-fasting levels of leptin, free fatty acids and
triglycerides in the blood.
[0109] The term "Conditions related to obesity" refer to conditions
which are the result of or which are exasperated by obesity, such
as, but not limited to dermatological disorders such as infections,
varicose veins, Acanthosis nigricans, and eczema, exercise
intolerance, diabetes mellitus, insulin resistance, hypertension,
hypercholesterolemia, cholelithiasis, osteoarthritis, orthopedic
injury, thromboembolic disease, cancer (e.g., breast cancer, colon
cancer, prostate cancer, etc.), and coronary (or cardiovascular)
heart disease, particular those cardiovascular conditions
associated with high triglycerides and free fatty acids in a
subject.
[0110] Obesity represents the most prevalent of body weight
disorders, affecting an estimated 30 to 50% of the middle-aged
population in the western world. Other body weight disorders, such
as anorexia nervosa and bulimia nervosa, which together affect
approximately 0.2% of the female population of the western world,
also pose serious health threats. Further, such disorders as
anorexia and cachexia (wasting) are also prominent features of
other diseases such as cancer, cystic fibrosis, and AIDS.
[0111] The term "wasting" disorders (e.g., wasting syndrome,
cachexia, sarcopenia) refers to a disorder caused by undesirable
and/or unhealthy loss of weight or loss of body cell mass. In the
elderly as well as in AIDS and cancer patients, wasting disease can
result in undesired loss of body weight, including both the fat and
the fat-free compartments. Wasting diseases can be the result of
inadequate intake of food and/or metabolic changes related to
illness and/or the aging process. Cancer patients and AIDS
patients, as well as patients following extensive surgery or having
chronic infections, immunologic diseases, hyperthyroidism,
extraintestinal Crohn's disease, psychogenic disease, chronic heart
failure or other severe trauma, frequently suffer from wasting
disease which is sometimes also referred to as cachexia, a
metabolic and, sometimes, an eating disorder. Cachexia is
additionally characterized by hypermetabolism and hypercatabolism.
Although cachexia and wasting disease are frequently used
interchangeably to refer to wasting conditions, there is at least
one body of research which differentiates cachexia from wasting
syndrome as a loss of fat-free mass, and particularly, body cell
mass (Mayer, 1999, J. Nutr. 129(1S Suppl.):256S-259S). Sarcopenia,
yet another such disorder which can affect the aging individual, is
typically characterized by loss of muscle mass. End stage wasting
disease as described above can develop in individuals suffering
from either cachexia or sarcopenia.
[0112] Diabetes is a chronic disorder affecting carbohydrate, fat
and protein metabolism in animals. Diabetes is the leading cause of
blindness, renal failure, and lower limb amputations in adults and
is a major risk factor for cardiovascular disease and stroke.
[0113] Type I diabetes mellitus (or insulin-dependent diabetes
mellitus ("IDDM") or juvenile-onset diabetes) comprises
approximately 10% of all diabetes cases. The disease is
characterized by a progressive loss of insulin secretory function
by beta cells of the pancreas. This characteristic is also shared
by non-idiopathic, or "secondary", diabetes having its origins in
pancreatic disease. Type I diabetes mellitus is associated with the
following clinical signs or symptoms, e.g., persistently elevated
plasma glucose concentration or hyperglycemia; polyuria; polydipsia
and/or hyperphagia; chronic microvascular complications such as
retinopathy, nephropathy and neuropathy; and macrovascular
complications such as hyperlipidemia and hypertension which can
lead to blindness, end-stage renal disease, limb amputation and
myocardial infarction.
[0114] Type II diabetes mellitus (non-insulin-dependent diabetes
mellitus or NIDDM) is a metabolic disorder involving the
dysregulation of glucose metabolism and impaired insulin
sensitivity. Type II diabetes mellitus usually develops in
adulthood and is associated with the body's inability to utilize or
make sufficient insulin. In addition to the insulin resistance
observed in the target tissues, patients suffering from type II
diabetes mellitus have a relative insulin deficiency--that is,
patients have lower than predicted insulin levels for a given
plasma glucose concentration. Type II diabetes mellitus is
characterized by the following clinical signs or symptoms, e.g.,
persistently elevated plasma glucose concentration or
hyperglycemia; polyuria; polydipsia and/or hyperphagia; chronic
microvascular complications such as retinopathy, nephropathy and
neuropathy; and macrovascular complications such as hyperlipidemia
and hypertension which can lead to blindness, end-stage renal
disease, limb amputation and myocardial infarction.
[0115] Syndrome X, also termed Insulin Resistance Syndrome (IRS),
Metabolic Syndrome, or Metabolic Syndrome X, is recognized in some
2% of diagnostic coronary catheterizations. Often disabling, it
presents symptoms or risk factors for the development of Type II
diabetes mellitus and cardiovascular disease, including, e.g.,
impaired glucose tolerance (IGT), impaired fasting glucose (IFG),
hyperinsulinemia, insulin resistance, dyslipidemia (e.g., high
triglycerides, low HDL), hypertension and obesity.
[0116] An immunological disorders include, but is not limited to,
e.g., systemic lupus erythematosis; rheumatoid arthritis; juvenile
chronic arthritis; spondyloarthropathies; systemic sclerosis
(scleroderma); idiopathic inflammatory myopathies (dermatomyositis,
polymyositis); Sjogren's syndrome; systemic vasculitis;
sarcoidosis; autoimmune hemolytic anemia (immune pancytopenia,
paroxysmal nocturnal hemoglobinuria); autoimmune thrombocytopenia
(idiopathic thrombocytopenic purpura, immune-mediated
thrombocytopenia); thyroiditis (Grave's disease, Hashimoto's
thyroiditis, juvenile lymphocytic thyroiditis, atrophic
thyroiditis); diabetes mellitus; immune-mediated renal disease
(glomerulonephritis, tubulointerstitial nephritis); demyelinating
diseases of the central and peripheral nervous systems such as
multiple sclerosis, idiopathic demyelinating polyneuropathy or
Guillain-Barre syndrome, and chronic inflammatory demyelinating
polyneuropathy; hepatobiliary diseases such as infectious hepatitis
(hepatitis A, B, C, D, E and other non-hepatotropic viruses),
autoimmune chronic active hepatitis, primary biliary cirrhosis,
granulomatous hepatitis, and sclerosing cholangitis; inflammatory
bowel disease (ulcerative colitis: Crohn's disease);
gluten-sensitive enteropathy, and Whipple's disease; autoimmune or
immune-mediated skin diseases including bullous skin diseases,
erythema multiforme and contact dermatitis, psoriasis; allergic
diseases such as asthma, allergic rhinitis, atopic dermatitis, food
hypersensitivity and urticaria; immunologic diseases of the lung
such as eosinophilic pneumonias, idiopathic pulmonary fibrosis and
hypersensitivity pneumonitis; and/or transplantation associated
diseases including graft rejection and graft-versus-host disease.
Other disorders can be present, such as a developmental disorder
(e.g., embryonic lethality), a neurological disorder (e.g., a
decreased anxiety like response during open field activity testing,
an abnormal circadian rhythm during home cage activity testing,
etc.) an eye abnormality (e.g., a retinal abnormality); and/or a
bone metabolic abnormality or disorder (e.g., arthritis,
osteoporosis, and/or osteopetrosis).
[0117] The word "label" when used herein refers to a detectable
compound or composition which is conjugated directly or indirectly
to the polypeptide. The label may be itself be detectable (e.g.,
radioisotope labels or fluorescent labels) or, in the case of an
enzymatic label, may catalyze chemical alteration of a substrate
compound or composition which is detectable.
[0118] An "isolated" nucleic acid molecule is a nucleic acid
molecule that is identified and separated from at least one
contaminant nucleic acid molecule with which it is ordinarily
associated in the natural source of the polypeptide nucleic acid.
An isolated nucleic acid molecule is other than in the form or
setting in which it is found in nature. Isolated nucleic acid
molecules therefore are distinguished from the nucleic acid
molecule as it exists in natural cells. However, an isolated
nucleic acid molecule includes a nucleic acid molecule contained in
cells that ordinarily express the polypeptide where, for example,
the nucleic acid molecule is in a chromosomal location different
from that of natural cells.
[0119] The expression "control sequences" refers to DNA sequences
necessary for the expression of an operably linked coding sequence
in a particular host organism. The control sequences that are
suitable for prokaryotes, for example, include a promoter,
optionally an operator sequence, and a ribosome binding site.
Eukaryotic cells are known to utilize promoters, polyadenylation
signals, and enhancers.
[0120] Nucleic acid is "operably linked" when it is placed into a
functional relationship with another nucleic acid sequence. For
example, DNA for a presequence or secretory leader is operably
linked to DNA for a polypeptide if it is expressed as a preprotein
that participates in the secretion of the polypeptide; a promoter
or enhancer is operably linked to a coding sequence if it affects
the transcription of the sequence; or a ribosome binding site is
operably linked to a coding sequence if it is positioned so as to
facilitate translation. Generally, "operably linked" means that the
DNA sequences being linked are contiguous, and, in the case of a
secretory leader, contiguous and in reading phase. However,
enhancers do not have to be contiguous. Linking is accomplished by
ligation at convenient restriction sites. If such sites do not
exist, the synthetic oligonucleotide adaptors or linkers are used
in accordance with conventional practice.
[0121] As used herein, the expressions "cell," "cell line," and
"cell culture" are used interchangeably and all such designations
include progeny. Thus, the words "transformants" and "transformed
cells" include the primary subject cell and cultures derived
therefrom without regard for the number of transfers. It is also
understood that all progeny may not be precisely identical in DNA
content, due to deliberate or inadvertent mutations. Mutant progeny
that have the same function or biological activity as screened for
in the originally transformed cell are included. Where distinct
designations are intended, it will be clear from the context.
[0122] The term "gene" refers to (a) a gene containing a DNA
sequence encoding ANGPTL4, e.g., ATCC deposit number 209284, or see
FIG. 1; (b) any DNA sequence that encodes an ANGPTL4 amino acid
sequence (see, e.g., FIG. 2), and/or; (c) any DNA sequence that
hybridizes to the complement of the coding sequences disclosed
herein. In certain embodiments, the term includes coding as well as
noncoding regions, and preferably includes all sequences necessary
for normal gene expression.
[0123] The term "gene targeting" refers to a type of homologous
recombination that occurs when a fragment of genomic DNA is
introduced into a mammalian cell and that fragment locates and
recombines with endogenous homologous sequences. Gene targeting by
homologous recombination employs recombinant DNA technologies to
replace specific genomic sequences with exogenous DNA of particular
design.
[0124] The term "homologous recombination" refers to the exchange
of DNA fragments between two DNA molecules or chromatids at the
site of homologous nucleotide sequences.
[0125] The term "target gene" (alternatively referred to as "target
gene sequence" or "target DNA sequence") refers to any nucleic acid
molecule, polynucleotide, or gene to be modified by homologous
recombination. The target sequence includes an intact gene, an exon
or intron, a regulatory sequence or any region between genes. The
target gene may comprise a portion of a particular gene or genetic
locus in the individual's genomic DNA.
[0126] "Disruption" of an ANGPTL4 gene occurs when a fragment of
genomic DNA locates and recombines with an endogenous homologous
sequence wherein the disruption is a deletion of the native gene or
a portion thereof, or a mutation in the native gene or wherein the
disruption is the functional inactivation of the native gene.
Alternatively, sequence disruptions may be generated by nonspecific
insertional inactivation using a gene trap vector (i.e. non-human
transgenic animals containing and expressing a randomly inserted
transgene; see for example U.S. Pat. No. 6,436,707 issued Aug. 20,
2002). These sequence disruptions or modifications may include
insertions, missense, frameshift, deletion, or substitutions, or
replacements of DNA sequence, or any combination thereof.
Insertions include the insertion of entire genes, which may be of
animal, plant, fungal, insect, prokaryotic, or viral origin.
Disruption, for example, can alter the normal gene product by
inhibiting its production partially or completely or by enhancing
the normal gene product's activity. In one embodiment, the
disruption is a null disruption, wherein there is no significant
expression of the ANGPTL4 gene.
[0127] The term "native expression" refers to the expression of the
full-length polypeptide encoded by the ANGPTL4 gene, at expression
levels present in the wild-type mouse. Thus, a disruption in which
there is "no native expression" of the endogenous ANGPTL4 gene
refers to a partial or complete reduction of the expression of at
least a portion of a polypeptide encoded by an endogenous ANGPTL4
gene of a single cell, selected cells, or all of the cells of a
mammal.
[0128] The term "knockout" refers to the disruption of an ANGPTL4
gene wherein the disruption results in: the functional inactivation
of the native gene; the deletion of the native gene or a portion
thereof; or a mutation in the native gene.
[0129] The term "knock-in" refers to the replacement of the mouse
ortholog (or other mouse gene) with a human cDNA encoding
ANGPTL4-encoding genes or variants thereof (ie. the disruption
results in a replacement of a native mouse gene with a native human
gene).
[0130] The term "construct" refers to an artificially assembled DNA
segment to be transferred into a target tissue, cell line or
animal. Typically, the construct will include a gene or a nucleic
acid sequence of particular interest, a marker gene and appropriate
control sequences. As provided herein, a targeting ANGPTL4
construct includes a DNA sequence homologous to at least one
portion of an ANGPTL4 gene and is capable of producing a disruption
in an ANGPTL4 gene in a host cell.
[0131] The term "transgenic cell" refers to a cell containing
within its genome an ANGPTL4 gene that has been disrupted,
modified, altered, or replaced completely or partially by the
method of gene targeting.
[0132] The term "transgenic animal" refers to an animal that
contains within its genome a specific gene that has been disrupted
or otherwise modified or mutated by the methods described herein or
methods otherwise well known in the art. In certain embodiments,
the non-human transgenic animal is a mammal. In one embodiment, the
mammal is a rodent such as a rat or mouse. In addition, a
"transgenic animal" may be a heterozygous animal (i.e., one
defective allele and one wild-type allele) or a homozygous animal
(i.e., two defective alleles). An embryo is considered to fall
within the definition of an animal. The provision of an animal
includes the provision of an embryo or foetus in utero, whether by
mating or otherwise, and whether or not the embryo goes to
term.
[0133] As used herein, the terms "selective marker" and "position
selection marker" refer to a gene encoding a product that enables
only the cells that carry the gene to survive and/or grow under
certain conditions. For example, plant and animal cells that
express the introduced neomycin resistance (Neo.sup.r) gene are
resistant to the compound G418. Cells that do not carry the
Neo.sup.r gene marker are killed by G418. Other positive selection
markers are known to, or are within the purview of, those of
ordinary skill in the art.
[0134] The term "modulates" or "modulation" as used herein refers
to the decrease, inhibition, reduction, amelioration, increase or
enhancement of an ANGPTL4 gene function, expression, activity, or
alternatively a phenotype associated with ANGPTL4 gene.
[0135] The term "abnormality" refers to any disease, disorder,
condition, or phenotype in which ANGPTL4 is implicated, including
pathological conditions and behavioral observations.
ANGPTL4
[0136] The invention results from the desire to further elucidate
the biological function of ANGPTL4 and its role in disease states.
ANGPTL4 expression is found primarily in the placenta, adipose,
liver and kidney tissues. This invention provides additional uses
of ANGPTL4 and modulators of ANGPTL4 in the areas of hepatocytes,
adipocytes and lipid homestasis. The invention also describes
transgenic or knockout mice containing a disruption in the ANGPTL4
gene, and uses thereof.
[0137] Angiopoietin-like 4 protein (ANGPTL4) is a secreted protein
and is a member of the angiopoietin family. It is also known as
hepatic fibrinogen/angiopoietin-related protein (HFARP) (Kim et
al., Biochem. J. 346:603-610 (2000)), PGAR (PPAR.gamma.
angiopoietin related protein) (Yoon, et al., Mol. Cell Biol.,
20:5343-5349 (2000)), fasting induced adipose factor (FIAF) (Kerten
et al., J. Biol. Chem., 275:28488-28493 (2000));
angiopoietin-related protein (ARP-4); NL2 (see U.S. Pat. Nos.
6,348,350; 6,372,491; and 6,455,496); and Ang6.
[0138] The ANGPTL4 protein from human is a 406 amino acid protein
(e.g., U.S. Pat. Nos. 6,348,350, 6,372,491 & 6,455,496), while
the mouse ANGPTL4 is a 410 amino acid protein (Kim et al., Biochem.
J. 346:603-610(2000)). The mouse and human share about 75% identity
at the amino acid level. Kim et al., Biochem. J. 346:603-610(2000).
ANGPTL4 has a signal peptide, three potential N-glycosylation
sites, and four cysteines that can be involved in intramolecular
disulfide bonding. ANGPTL4 forms higher molecular structures, e.g.,
as indicated in FIG. 3, Panel A. See also, e.g., Ge et al., J.
Biol. Chem., 279(3):2038-2045 (2004); Ge et al., J. Lipid Res.
45:2071-2079 (2004); and, Mandard et al., J. of Biol. Chem.,
279(33):34411-34420 (2004). ANGPTL4 can also be proteolytically
processed, e.g., the substitution of R162G and R164E of ANGPTL4
results in the variant ANGPTL4 running at a higher molecular weight
on an SDS-Gel than the wild type protein (see FIG. 3, Panel B). See
also, e.g., Ge et al., J. Biol. Chem., 279(3):2038-2045 (2004);
and, Mandard et al., J. of Biol. Chem., 279(33):34411-34420
(2004).
[0139] Conserved regions of the angiopoietin family include a
coiled-coil domain and a C-terminal fibrinogen (FBN)-like domain.
See, e.g., Kim et al., Biochem. J. 346:603-610 (2000). It is
suggested that ANGPTL4 is proteolytically processed in a regulated
way to release the C-terminal fibrinogen-like domain. See, e.g., Ge
et al., J. Biol. Chem., 279(3):2038-2045 (2004).
[0140] ANGPTL4 binds to integrin .alpha..sub.v.beta..sub.5. See,
e.g., FIG. 9, Panels A-E. Another member of the family,
angiopoietin-like 3 protein (ANGPTL3) is an angiogeneic factor that
binds to integrin .alpha..sub.v.beta..sub.3. See, e.g., US patent
application 20030215451, published on Nov. 20, 2003, and Camenisch
et al., J. Biol. Chem., 277(19): 17281-17290 (2002). ANGPTL3 does
not appear to bind to receptor Tie2. Camenish et al., Journal of
Biol. Chem. 277(19):17281-17290 (2002). ANGPTL3 is also a regulator
of plasma lipid levels. See, e.g., Koishi et al., Nat. Genetics
30:151-157 (2002).
[0141] Integrin .alpha..sub.V.beta.5 is a receptor for
extracellular matrix proteins including vitronectin, and Del-1
(see, e.g., Stupack and Cheresh, Journal of Cell Science
115:3729-3738 (2002)). Alpha v-integrins have been implicated in
tumour progression and metastasis. See, e.g., Marshall, J F and
Hart, I R Semin. Cancer Biol. 7(3): 129-38 (1996). In addition, a
role of alpha v-integrins during angiogenesis has also been shown.
See, e.g., Eliceiri, B P and Cheresh, D A Molecular Medicine 4:
741-750 (1998). For example, a monoclonal antibody for
.alpha..sub.V.beta..sub.5 was shown to inhibit VEGF-induced
angiogenesis in rabbit cornea and the chick chorioallantoic
membrane model. See, e.g., M. C. Friedlander, et al., Science
270:1500-1502 (1995). Antagonists of .alpha..sub.V.beta.3 and
.alpha..sub.V.beta.5 were also shown to inhibit growth-factor and
tumor-induced angiogenesis. See, e.g., Eliceiri and Cheresh,
Current Opinion in Cell Biology, 13:563-568 (2001).
Use of ANGPTL4 and Modulators of ANGPTL4
[0142] The invention provides uses of ANGPTL4 or, an agonist or
antagonist thereof, to modulate a variety of cell activities and
processes, e.g., hepatocyte proliferation and/or cell adhesion, and
pre-adipocyte proliferation and/or pre-adipocyte cell migration.
ANGPTL4 is involved in modulating serum levels of triglyceride and
cholesterol. In addition, ANGPTL4 can also be a negative regulator
of inflammatory responses. Modulators of ANGPTL4 can be used to
treat disorders and diseases related to these activities.
[0143] Liver
[0144] ANGPTL4 stimulates the proliferation of hepatocytes and the
adhesion of hepatocytes. The liver is the major organ for
cholesterol homeostasis. See also the section "Lipid Homeostasis"
herein. Liver is responsible for cholesterol biosynthesis and
catabolism of cholesterol. The liver synthesis and secretes very
low density lipoproteins (VLDL). In the circulation, VLDL is
metabolized to become low density lipoproteins (LDL), which are the
major cholesterol carrying lipoproteins in the plasma.
[0145] The liver acts as a guardian interposed between the
digestive tract and the rest of the body. A major hepatic function
involves effective uptake, storage, metabolism and distribution to
blood and bile large amounts of substances such as carbohydrates,
lipids, amino acids, vitamins and trace elements. Another function
of the liver is the detoxification of xenobiotic pollutants, drugs
and endogenous metabolites, through both phase I
(oxidation/reduction) and phase II (conjugation) mechanisms.
[0146] The liver is the major metabolic control organ of the human
body that comprises thousands of minute lobules (lobuli hepatis),
the functional units of the organ. Liver tissue contains two major
differentiated cell types: parenchymal cells (i.e., hepatocytes)
and non-parenchymal cells. The complex functions of liver are
exerted to a large extent by hepatocytes, whereas non-parenchymal
cells such as Kupffer cells, Ito cells and liver sinusoidal
endothelial cells (LSEC) play important roles in supporting and
providing supplies to hepatocytes. Mochida et al. Biochem. Biophy.
Res. Comm. 226:176-179 (1996).
[0147] In addition to normal growth during early development, liver
tissue has a unique ability to regenerate at adult stage. Liver
regeneration after the loss of hepatic tissue is a fundamental
component of the recovery process in response to various forms of
liver injury such as hepatotoxicity, viral infection, vascular
injury and partial hepatectomy. Following partial hepatectomy, for
example, the liver size is usually restored to its original mass
within about six days. Liver growth and regeneration involves
proliferation of both hepatocytes and non-parenchymal cells such as
sinusoidal endothelial cells. Typically, hepatocytes are the first
to proliferate, and other cells of the liver enter into DNA
synthesis about 24 hours after the hepatocytes. Michalopoulos and
DeFrances Science 276:60-66 (1997).
[0148] The invention provides methods for promoting liver growth
and/or hepatocyte cell proliferation by administering an effective
amount of ANGPTL4 or agonist thereof. The promoting effects of the
invention can be assessed either in vitro or in vivo, using methods
known in the art. See, e.g., Drakes et al. J. Immunol.
159:4268-4278 (1997); Omori et al. Hepatology 26:720-727 (1997);
and, U.S. Pat. No. 5,227,158. For example, cell proliferation is
assessed during culture using methods known in the art, including
but not limited to, measuring the rate of DNA synthesis (see, e.g.,
Nakamura et al. Biochem. Biophy. Res. Comm. 122:1450 (1984), trypan
blue dye exclusion/hemacytometer counting (see, e.g., Omiri et al.
(1997) supra), or flow cytometry (see, e.g., Drakes (1997)
supra).
[0149] In certain embodiments of the invention, ANGPTL4 or an
agonist thereof is administered to induce cell adhesion of
hepatocytes. Adhesion of hepatocytes can be assayed by methods
known in the art, including, e.g., crystal violet assay. See also,
Landegren, U. J. Immunological Methods, 67:379-388 (1984). In one
embodiment of the invention, hepatocytes and other nonparenchymal
liver cells are isolated from the target livers and resuspended in
appropriate tissue culture medium with ANGPTL4 or an agonist
thereof to induce cell adherence. If necessary, different cell
fractions can be further separated (e.g., parenchymal cells from
nonparenchymal cells) by centrifugation at different speeds for
different length of time.
[0150] In another embodiment, the proliferative effect of an
ANGPTL4 or ANGPTL4 agonist on hepatic cells and liver organ as a
whole is measured in vivo using, for example, histochemistry assays
of the liver tissue samples. In one aspect, in vivo proliferation
of hepatic cells is assessed by reactivity to an antibody directed
against a protein known to be present in higher concentrations in
proliferating cells than in non-proliferating cells, such as
proliferating cell nuclear antigen (PCNA or cyclin). Rodgers et al.
J. Burn Care Rehabil. 18:381-388 (1997). In another aspect, a BrdU
immunohistochemistry assay can be used as described by Gerber et
al. Development 126:1149-1159 (1999).
[0151] Because of its essential role to life, liver dysfunction and
diseases are often debilitating and life threatening. A number of
acute or chronic pathological conditions are associated with
structural and/or functional abnormalities of the liver. These
include, but are not limited to, liver failure, hepatitis (acute,
chronic or alcohol), liver cirrhosis, toxic liver damage,
medicamentary liver damage, hepatic encephalopathy, hepatic coma or
hepatic necrosis. Cellular growth enhancement of hepatocytes can be
useful in treating liver disease. The compounds and methods of the
invention can provide for the repair of liver damage. Not to be
bound by theory, it is believed that this can be accomplished,
either directly or indirectly, by stimulating liver cells to grow
and divide. According to one embodiment, the invention provides
methods for treating a pathological liver condition in a subject by
administering an effective amount of an ANGPTL4 or ANGPTL4 agonist
of the invention.
[0152] The phrase "pathological liver condition" is used
interchangeably with "liver disorder" or "liver disease" to
indicate any structural and/or functional liver abnormalities.
Non-limiting examples of pathological liver condition include those
conditions associated with liver failure, hepatitis (acute, chronic
or alcohol), liver cirrhosis, toxic liver damage, medicamentary
liver damage, hepatic encephalopathy, hepatic coma or hepatic
necrosis.
[0153] In one aspect, the invention provides methods for protecting
liver from damage in a subject susceptible to conditions or factors
causative of liver damage. The phrase "liver damage" is used herein
in the broadest sense, and indicates any structural or functional
liver injury resulting, directly or indirectly, from internal or
external factors or their combinations. Liver damage can be induced
by a number of factors including, but not limited to, exposure to
hepatotoxic compounds, radiation exposure, mechanical liver
injuries, genetic predisposition, viral infections, autoimmune
disease, such as, autoimmune chronic hepatitis and as a result of
elevated in vivo levels of proteins, such as activin and
TGF-.beta.. Liver damage induced by hepatotoxic compounds includes
direct cytotoxicity including drug hypersensitivity reactions,
cholestasis, and injury to the vascular endothelium.
[0154] Many chemical and biological agents, either therapeutic or
purely harmful, can induce liver damages and thus are hepatotoxic.
Hepatotoxic compounds are also an important cause of chronic liver
disease including fatty liver, hepatitis, cirrhosis and vascular
and neoplastic lesions of the liver. (Sinclair et al., Textbook of
Internal Medicine, 569-575 (1992) (editor, Kelley; Publisher, J. B.
Lippincott Co.). Provided in the invention are methods for
protecting liver in a subject from damage due to exposure to a
hepatotoxic agent, comprising administering to the subject an
ANGPTL4 or agonist, where said ANGPTL4 or ANGPTL4 agonist
effectively protects liver from damage. In one aspect, the ANGPTL4
or ANGPTL4 agonist is administered prior to or concurrent with the
exposure of said subject to the hepatotoxic agent, said hepatotoxic
agent being a therapeutic agent such as a chemotherapeutic or
radiation agent for treating cancers. As such, the methods serve to
enhance the efficacy of the treatment by permitting the subject
tolerance to high doses of the therapeutic agents. In another
aspect, the ANGPTL4 or ANGPTL4 agonist is administered after the
exposure of the subject to a hepatotoxic agent but prior to any
detectable liver damage in the subject. Such methods can be useful
for treating liver damages due to accidental exposure of the
subject to a hepatotoxic agent.
[0155] Hepatotoxic agents may induce liver damage by cytotoxicity
to the liver directly or through the production of toxic
metabolites (this category includes the hypersensitivity reaction
which mimics a drug allergy); cholestasis, an arrest in the flow of
bile due to obstruction of the bile ducts; and vascular lesions,
such as in veno occlusive disease (VOD), where injury to the
vascular endothelium results in hepatic vein thrombosis. Individual
susceptibility to liver damage induced by hepatotoxic agents is
influenced by genetic factors, age, sex, nutritional status,
exposure to other drugs, and systemic diseases (Sinclair et al.,
Textbook of Internal Medicine, supra).
[0156] Many hepatotoxic compounds unpredictably produce liver
damage in a small proportion of recipients. In some patients, the
liver damage is referred to as a hypersensitivity reaction and is
like that of a drug reaction, where the patient presents with
fever, rash and eosinophilia and has a recurrence of symptoms upon
rechallenge of the drug. In other situations, the mechanism for
injury is unknown and may represent aberrant metabolism in
susceptible patients that permits the production or accumulation of
hepatotoxic metabolites.
[0157] Those drugs inducing cytotoxicity by direct chemical attack
include the following: Anesthetics, such as Enflurane, Fluroxene,
Halothane, and Methoxyflurane; Neuropsychotropics, such as,
Cocaine, Hydrazides, Methylphenidate, and Tricyclics;
Anticonvulsants, such as, Phenyloin and Valproic acid; Analgesics,
such as, Acetaminophen, Chlorzoxazone, Dantrolene, Diclofenac,
Ibuprofen, Indomethacin, Salicylates, Tolmetin, and Zoxazolamine;
Hormones, such as, Acetohexamide, Carbutamide, Glipizide,
Metahexamide, Propylthiouracil, Tamoxifen, Diethylstilbestrol;
Antimicrobials, such as, Amphotericin B, Clindamycin, Ketoconazole,
Mebendazole, Metronidazole, Oxacillin, Paraminosalicylic acid,
Penicillin, Rifampicin, Sulfonamides, Tetracycline, and Zidovudine;
Cardiovascular drugs, such as, Amiodarone, Dilitiazem,
a-Methyldopa, Mexiletine, Hydrazaline, Nicotinic acid, Papaverine,
Perhexiline, Procainamide, Quinidine, and Tocainamide; and
Immunosuppressives and Antineoplastics, such as, Asparaginase,
Cisplatin, Cyclophosphamide, Dacarbazine, Doxorubicin,
Fluorouracil, Methotrexate, Mithramycin, 6-MP, Nitrosoureas,
Tamoxifen, Thioguanine, and Vincristine; and Miscellaneous drugs,
such as, Disulfiram, Iodide ion, Oxyphenisatin, Vitamin A and
Paraminobenzoic acid.
[0158] Those hepatotoxic compounds producing hypersensitivity
reaction in the liver include the following: Phenyloin, Paramino
salicylic acid, Chlorpromazine, Sulfonamides, Erythromycin
estolate, Isoniazid, Halothane, Methyldopa, and Valproic acid.
[0159] Hepatotoxic compounds including cholestasis, an arrest in
the flow of bile, may take several forms. Centribular cholestasis
is accompanied by portal inflammatory changes. Bile duct changes
have been reported with some drugs such as erythromycin, while pure
canalicular cholestasis is characteristic of other drugs such as
the anabolic steroids. Chronic cholestasis has been linked to such
drugs as methyltestosterone and estradiol.
[0160] Those hepatotoxic compounds inducing cholestatic disease
include the following: Contraceptive steroids, androgenic steroids,
anabolic steroids, Acetylsalicylic acid, Azathioprine,
Benzodiazepine, Chenodeoxycholic acid, Chlordiazepoxide,
Erythromycin estolate, Fluphenazine, Furosemide, Griseoftilvin,
Haloperidol, Imipramine, 6-Mercaptopurine, Methimazole,
Methotrexate, Methyldopa, Methylenediamine, Methyltestosterone,
Naproxen, Nitrofurantoin, Penicillamine, Perphenazine,
Prochlorperazine, Promazine, Thiobendazole, Thioridazine,
Tolbutamide, Trimethoprimsulfamethoxazole, Arsenic, Copper, and
Paraquat.
[0161] Some drugs, although primarily cholestatic, can also produce
hepatoxicity, and therefore the liver injury they cause is mixed.
The drugs causing mixed liver injury include, for example, the
following: Chlorpromazine, Phenylbutazone, Halothane,
Chlordiazepoxide, Diazepam, Allopurinol, Phenobarbital, Naproxen,
Propylthiouracil, Chloramphenicol, Trimethoprimsulfamethoxazxole,
Amrinone, Disopyramide, Azathioprine, Cimetidine, and
Ranitidine.
[0162] Vascular lesions of the liver, including thrombosis of the
hepatic veins, occlusion of the hepatic venules or veno occlusive
disease (VOD), and peliosis hepatitis, can be produced by drugs. In
addition, lesions including sinusoidal dilation, perisinusoidal
fibrosis, and hepatoportal selerosis can occur. Midzonal and
pericentral sinusoidal dilatation was first reported as a
complication of oral contraceptive therapy. Peliosis hepatitis is a
condition consisting of large blood-filled cavities that results
from leakage of red blood cells through the endothelial barrier,
followed by perisinusoidal fibrosis. It has been described in
patients taking oral contraceptives, anabolic steroids,
azathioprine and danazol. Injury and occlusion of the central
hepatic venules is also known to be related to the ingestion of
pyrrolizidine alkaloids, such as bush teas. The initial lesion is
central necrosis accompanied by a progressive decrease in venule
caliber. All of these lesions may be only partially reversible when
the drug is stopped and cirrhosis can develop.
[0163] Several types of benign and malignant hepatic neoplasm can
result from the administration of hepatotoxic compounds. Adenomas,
a lesion restricted to women in the childbearing years, is related
to the use of contraceptive steroids and the risk increases with
duration of use. Hepatocellular carcinoma may also be seen in
patients taking androgenic hormones for aplastic anemia or
hypopituitarism.
[0164] Hepatotoxic compounds known to cause hepatic lesions include
the following: Contraceptive steroids, Pyrriolizidine alkaloids,
Urethane, Azathioprine, 6-Mercaptopurine, 6-Thioguanine, Mitomycin,
BCNU, Vincristine, Adriamycin, Intravenous Vitamin E,
Anabolic-androgenic steroids, Azathioprine, Medroxyprogesterone
acetate, Estrone sulfate, Tamoxifen, inorganic arsenicals, Thorium
dioxide, Vitamin A, methotrexate, Methylamphetamine hydrochloride,
Vitamin A, Corticosteroids, Thorium dioxide, and Radium
therapy.
[0165] Liver damage caused by other factors usually takes similar
forms. Liver damage, whether caused by the hepatotoxicity of a
compound, radiation therapy, genetic predisposition, mechanical
injury or any combination of such and other factors, can be
detected by several means. Biochemical tests have been used
clinically for many years as the standard measure of
hepatotoxicity. Most biochemical tests generally fall into two
categories: tests which measure specific liver markers, for
example, prothrombin clotting time, and/or hepatic blood flow, or
tests which analyze serum markers, for detection of necrosis,
cholestasis, progressive fibrogenesis, or hepatoma (Cornelius, C.
in Hepatotoxicology, Meeks et al. eds., pgs. 181-185 (1991)). The
importance of such tests lies in their simplicity and the fact that
they are non-invasive. The rationale for the use of serum enzymes
in assessing liver damage is that these enzymes, normally contained
in the liver cells, gain entry into the general circulation when
liver cells are injured.
[0166] Elevated serum enzyme activity suggests nercrosis and/or
cholestasis. Elevated levels of serum bilirubin conjugates suggest
intra or extra hepatic cholestasis. However, there are certain
limitations for the use of serum enzyme levels as single means of
diagnosing liver injury. Serum enzyme levels may increase as a
result of leakage from cells with altered permeability due to
systemic effects of an agent rather than specific liver injury
caused by a chemical. Histopathological examination of the liver is
the next logical step in identifying and quantifying the nature and
extent of liver injury.
[0167] The serum enzymes as markers of liver injury can be divided
into four groups based on specificity and sensitivity to liver
damage (Kodavanti et al., Toxicologic Pathology 20(4):556-69
(1992); Kodavanti et al., Archives of Toxicology 63(5):367-75
(1989).
[0168] Group I: these enzymes indicate more selectively hepatic
cholestasis when elevated, e.g. alkaline phosphatase (AP),
5'-nucleotidase (5'-ND), and a-glutamyl transpeptidase (G-GT) and
leucine aminopeptidase (LAP). Group II: These enzymes indicate
parenchymal injury when elevated, e.g., aspartate transaminase
(AST), alanine transaminase (ALT), fructose-1,6-diphosphate
aldolase (ALD), lactate dehydrogenase (LDH), isocitrate
dehydrogenase (ICDH), ornithine-carbamoyl-transferase (OCT), and
sorbitol dehydrogenase (SDH) arginase and guanase. Group III: These
enzymes represent injury of other tissue when elevated e.g.,
creatine phosphokinase (CPK). Group IV: These enzymes are depressed
in hepatic injury, e.g., cholinesterase (ChE).
[0169] Other serum markers include, procollagen type III peptide
levels (PIIIP) to assess if hepatic fibrogenesis is active; ammonia
blood levels in hepatoencephalopathies; ligand in levels in
necrosis and hepatoma; hyaluronate levels due to hepatic
endothelial cell damage; a-1-fetoprotein (AFP) levels to detect
hepatoma; carcinoembryonic antigen (CEA) levels to detect cancer
metastasis to the liver; elevations of antibodies against a variety
of cellular components, such as, mitochondrial, and nuclear and
specific liver membrane protein; and detection of proteins, such
as, albumin, globin, amino acids, cholesterol, and other lipids.
Also, biochemical analysis of a variety of minerals, metabolites,
and enzymes obtained from liver biopsies can be useful in studying
specific biochemical defects in inherited, acquired, and
experimentally induced liver disorders.
[0170] Liver function tests can be performed to assess liver
injury. Liver function tests include the following: Group I
assessment of hepatic clearance of organic anions, such as,
bilirubin, indocyanine green (ICG), sulfobromophthalein (BSP) and
bile acids; Group II assessment of hepatic blood flow by
measurements of galactose and ICG clearance; and, Group III
assessment of hepatic microsomal function, through the use of the
aminopyrine breath test and caffeine clearance test. For example,
serum bilirubin can be measured to confirm the presence and
severity of jaundice and to determine the extent of
hyperbilirubinemia, as seen in parenchymal liver disease.
Aminotransferase (transaminase) elevations reflect the severity of
active hepatocellular damage, while alkaline phosphatase elevations
are found with cholestasis and hepatic infiltrates (Isselbacher, K.
and Podolsky, D. in Harrisson's Principles of Internal Medicine,
12th edition, Wilson et al. eds., 2:1301-1308 (1991)). Methods for
performing serum enzyme analysis are known in the art and are, for
example, described in Kodavanti et al. supra.
[0171] Because extensive liver injury may lead to decreased blood
levels of albumin, prothrombin, fibrinogen, and other proteins
synthesized exclusively by hepatocytes, these protein levels may be
measured as indicators of liver injury. In contrast to measurements
of serum enzymes, serum protein levels reflect liver synthetic
function rather than just cell injury (Podolsky, D. Harrison's
Principles of Internal Medicine, 12th edition, Wilson et al. eds.,
2: 1308-1311 (1991)).
[0172] In many patients, computed tomography (CT), ultrasound,
scintiscans, or liver biopsy may be needed to determine the nature
of the liver disease (Isselbacher, K, and Friedman, L. and
Needleman, L. in Harrison's Principles of Internal Medicine, 12th
edition, Wilson et al. eds., 2: 1303-1307 (1991)).
[0173] The invention provides methods for enhancing the effect of
therapy in a subject, said methods comprising administering to the
subject an ANGPTL4 or ANGPTL4 agonist in a manner effective to
protect the liver of the subject from damage caused by a hepatoxic
compound prior to, or simultaneous with, the therapy, thereby
increasing the subject's tolerance to the therapy. For example, the
chemotherapeutic agents used during the course of chemotherapy can
have cytotoxic effects upon hepatic cells, therefore limiting the
dosage and/or duration of the chemotherapeutic agent being
administered to the patient. By exposing the liver to a composition
comprising an ANGPTL4 or ANGPTL4 agonist, such toxic effects can be
prevented or reduced. As such, the dosage of the chemotherapeutic
agents can be increased, thereby enhancing the efficacy of the
cancer therapy.
[0174] An ANGPTL4 or ANGPTL4 agonist can be combined with other
agents in the methods described herein. For example, several growth
factors and cytokines have been implicated as being able to induce
liver regeneration, most notably hepatocyte growth factor (HGF),
epidermal growth factor (EGF), transforming growth factor- (TGF-),
interleukin-6 (IL-6), tumor necrosis factor- (TNF-.alpha.), basic
and acidic fibroblast growth factors, CTGF, HB-EGF, and
norepinephrine. Fujiwara et al. Hepatol. 18:1443-9 (1993); Baruch
et al. J. Hepatol. 23:328-32 (1995); Ito et al. Biochem. Biophys.
Res. Commun. 198:25-31 (1994); Suzuma et al. J. Biol. Chem.
275:40725-31 (2000); and, Michalopoulos and DeFrances (1997) supra.
These can be combined with ANGPTL4 or ANGPTL4 agonist.
[0175] Around HGF, one of the most potent liver mitogens, was first
identified as a factor capable of stimulating DNA synthesis in
cultured hepatocytes but is now known to have multiple distinct
functions on a variety of epithelial cells. Nakamura et al.
Biochem. Biophys. Res. Comm. 122:1450 (1984); and, Russell et al.
J. Cell. Physiol. 119:183-192 (1984). HGF is also known as Scatter
factor (SF), leading to the designation HGF/SF. Stoker and Perryman
J. Cell Sci. 77:209-223 (1985); and, Gherardi and Stoker Nature
346:228 (1990). The biological effects of HGF are transduced via a
single tyrosine kinase receptor, Met, the product of the Met
protooncogene. In the liver, HGF is expressed in non-hepatocyte
cells such as Ito cells and LSECs, whereas met transcripts are
strongly expressed in hepatocytes. Hu et al. Am. J. Pathol.
142:1823-1830 (1993). After chemical or mechanical liver injury,
HGF levels sharply increase, leading to a strong hepatocyte
proliferation. Horimoto et al. J. Hepatol. 23:174-183 (1995).
Livers from transgenic mice with liver-specific overexpression of
HGF are twice the size of livers of control animals and they
regenerate much faster after partial hepatectomy. Sakata et al.
(1996) Cell Growth Differ. 7:1513-1523; Shiota et al. (1994)
Hepatol. 19:962-972.
[0176] Angiogenesis is an important cellular event in which
vascular endothelial cells proliferate, prune and reorganize to
form new vessels from preexisting vascular network. There are
compelling evidences that the development of a vascular supply is
essential for normal and pathological proliferative processes
(Folkman and Klagsbrun (1987) Science 235:442-447). Regenerating
liver, in analogy to rapidly growing tumors, must synthesize new
stroma and blood vessels. See, e.g., WO03/103581; Yamane et al.
Oncogene 9:2683-2690 (1994); Mochida et al. Biochem. Biophy. Res.
Comm. 226:176-179 (1996); Ajioka et al. Hepatology 29:396-402
(1999); and, Assy et al. J Hepatol. 30:911-915 (1999).
Michalopoulos and DeFrances (1997) supra; Mochida et al. (1996). In
one embodiment of the invention, ANGPTL4 or ANGPTL4 agonist is
administered in combination with an angiogenic agent, e.g., VEGF or
activators of VEGFRs. An "angiogenic factor or agent" is a growth
factor which stimulates the development of blood vessels, e.g.,
promotes angiogenesis, endothelial cell growth, stability of blood
vessels, and/or vasculogenesis, etc. For example, angiogenic
factors, include, but are not limited to, e.g., VEGF and members of
the VEGF family (A, B, C, D, and E), PIGF, PDGF family, fibroblast
growth factor family (FGFs), TIE ligands (Angiopoietins), ANGPTL3,
ephrins, etc. It would also include factors that accelerate wound
healing, such as growth hormone, insulin-like growth factor-I
(IGF-I), VIGF, epidermal growth factor (EGF), CTGF and members of
its family, and TGF-.alpha. and TGF-.beta.. See, e.g., Klagsbrun
and D'Amore, Annu. Rev. Physiol., 53:217-39 (1991); Streit and
Detmar, Oncogene, 22:3172-3179 (2003); Ferrara & Alitalo,
Nature Medicine 5(12):1359-1364 (1999); Tonini et al., Oncogene,
22:6549-6556 (2003) (e.g., Table 1 listing known angiogenic
factors); and, Sato Int. J. Clin. Oncol., 8:200-206 (2003).
[0177] Lipid Homeostasis
[0178] ANGPTL4 is implicated in modulating other aspects of energy
homeostasis, besides the liver. ANGPTL4 is associated with adipose
differentiation, systemic lipid metabolism, and angiogenesis. See,
e.g., Yoon et al., Molecular and Cellular Biology, 20(14):5343-5349
(2000); Le Jan et al., American Journal of Pathology, 162(5):
1521-1528 (2003); and, EP 1403367. ANGPTL4 expression is also
induced by PPAR gamma and alpha in adipose tissue, and is induced
by starvation. See, e.g., Yoon et al., Mol. Cell. Biol.,
20:5343-5349 (2000); and, Kersten et al., J. Biol. Chem., 275:
28488-28493 (20000). Expression of ANGPTL4 is upregulated during
fasting, and abundance of the protein in plasma decreases with high
fat feeding.
[0179] In addition, ANGPTL4 inhibits lipoprotein lipase (LPL)
activity. See, e.g., EP1403367. Lipoprotein lipase (LPL) is a
secreted glycoprotein that mediates lipoprotein metabolism by
hydrolyzing triglycerides present in chylomicrons and very low
density lipoproteins (VLDLs), to produce free fatty acids and
phospholipids.
[0180] As provided herein, ANGPTL4 knockout mice have decreased
levels of cholesterol and serum triglycerides compared to their
gender-matched wild-type littermates. See sections entitled
Transgenic Knockout Animals and Example 4, herein. In addition,
intravenous injection of ANGPTL4 increases circulating plasma lipid
levels in mice and increases levels of very low-density
lipoprotein. See, e.g., Yoshida et al., Journal of Lipid Research,
43: 1770-1772 (2002), and see FIG. 10.
[0181] Methods of modulating serum levels of triglycerides or
cholesterol in a subject are provided in the invention. For
example, methods include administering an effective amount of a
composition comprising an ANGPTL4 or ANGPTL4 agonist or an ANGPTL4
antagonist to a subject, thereby modulation the serum levels of
triglycerides or cholesterol in a subject. In one embodiment, an
ANGPTL4 or ANGPTL4 agonist is administered, which results in an
accumulation of triglycerides or cholesterol in the serum. In
another embodiment, an effective amount of an ANGPTL4 antagonist is
administered to a subject, thereby reducing the level of at least
one triglyceride, free fatty acids and/or cholesterol in the serum
of the subject compared to the subject before treatment, or a
subject with no treatment or reduced treatment. Mean serum
cholesterol and triglyceride levels can be assayed as known in the
art.
[0182] ANGPTL4 can also modulate adipocytes. For example, ANGPTL4
can stimulate pre-adipocyte proliferation or induce cell migration
of pre-adipocytes. Adipose tissue consists primarily of adipocytes,
which also play a critical role in energy homeostasis. Adipocytes
synthesize and store lipids when nutrients are plentiful, and
release fatty acids into the circulation when nutrients are
required. White adipose tissue (WAT) and brown adipose tissue (BAT)
are found in vertebrates. WAT stores and releases fat dependent on
nutritional needs of the animal. WAT stored fat is used for (1)
heat insulation (e.g., subcutaneous fat), (2) mechanical cushion
(e.g., surrounding internal organs), and (3) as a source of energy.
BAT burns fat, releasing the energy as heat through thermogenesis
for maintaining homeothenmy by increasing thermogenesis in response
to lower temperatures and for maintaining energy balance by
increasing energy expenditure in response to increases in caloric
intake. See, e.g., Sears, I. B. et al. (1996) Mol. Cell. Biol.
16(7):3410-3419 (1996). Generally, BAT diminishes with age, but can
be re-activated under certain conditions, e.g., prolonged exposure
to cold, maintenance on a high fat diet and in the presence of
noradrenaline producing tumors.
[0183] Adipogenesis involves morphological changes, growth arrest,
expression of lipogenic enzymes, lipid accumulation and acquire
sensitivity to various hormones, e.g., insulin. Methods are
provided that include stimulating adipocyte proliferation by
administering an effective amount of ANGPTL4 or an ANGPTL4 agonist.
Cell proliferation can be assessed during culture using methods
known in the art, including but not limited to, measuring the rate
of DNA synthesis (see, e.g., Nakamura et al. Biochem. Biophy. Res.
Comm. 122:1450 (1984), trypan blue dye exclusion/hemacytometer
counting (see, e.g., Omiri et al. (1997) supra), or flow cytometry
(see, e.g., Drakes (1997) supra). ANGPTL4 or ANGPTL4 agonists can
be useful in inducing the proliferation of adipocytes in disorders
where additional adipocytes would be beneficial, e.g., including,
but not limited to, e.g., wasting diseases (e.g., such as in types
of cancer, immunocompromised patients (e.g., AIDS sufferers, etc.),
aging individual), etc. Methods are also provided that include
inducing preadipocyte cell migration by administering an effective
amount of ANGPTL4 or an ANGPTL4 agonist.
[0184] ANGPTL4 or ANGPTL4 agonists can also be combined with other
factors that promote differentiation of adipocytes. These factors
include, but are not limited to, e.g., IGF-1, insulin,
glucocorticoids, 3,3',5-Triiodothyronine, retinoic acid,
PGF2.alpha., PGI.sub.2, etc. Additional factors can also be
combined with ANGPTL4 or ANGPTL4 agonist. For example, adipogenesis
is subject to hormonal and transcriptional control. For example,
adipogenesis can be mediated by a cascade of transcription factors
including, e.g., members of the peroxisome proliferators-activated
receptor (PPAR), e.g., (PPAR.alpha., .gamma.) family,
CCAAT/enhancer binding protein (C/EBP) family, and basic
helix-loop-helix leucine zipper (bHLH) family, e.g., ADD1/SREBP1.
See, e.g., Wu et al. Current Opin. Cell Biol 11:689-694 (1999);
Rosen and Spiegelman Annu Rev Cell Dev Biol 16:145-171 (2000);
Gregoire et al., Physiological Reviews 78(3) (1998); and, Kim and
Spiegelman Genes Devel 10: 1096-1107 (1996)). PPAR.gamma. acts in
adipose tissue and promotes adipogenesis and lipid storage. See,
e.g., Rosen et al., Annu. Rev. Cell Dev. Biol., 16:145-171 (2000);
Rosen et al., Mol. Cell. 4:611-617 (1999); Ren et al., Genes Dev.
16:27-32 (2002); Rosen et al., Genes Dev., 16:22-26 (2002); and,
Fukumura et al., Circ. Res. 93:e88-e97 (2003). PPAR also mediates
lipoprotein lipase mRNA and protein levels in adipocytes and other
cells (see, e.g., Gbaguidi et al., FEBS Letters 512:85-90 (2002)),
and PPARs have also been implicated in cancer (see, e.g., Yoshimura
et al., Int. J. Cancer 104:597-602 (2003); and, Kubota et al.,
Cancer Research 58:3344-52 (1998)).
[0185] However, growth and/or formation of adipose tissue are often
not desired. For example, obesity typically results when energy
intake exceeds energy expenditure, resulting in the growth and/or
formation of adipose tissue via hypertrophic and hyperplastic
growth. Hypertrophic growth is an increase in size of adipocytes
stimulated by lipid accumulation. Hyperplastic growth is defined as
an increase in the number of adipocytes in adipose tissue.
[0186] Obesity is a chronic disease that is highly prevalent in
modern society and is associated not only with a social stigma, but
also with decreased life span and numerous medical problems,
including adverse psychological development, reproductive disorders
such as polycystic ovarian disease, dermatological disorders such
as infections, varicose veins, Acanthosis nigricans, and eczema,
exercise intolerance, insulin resistance, hypertension,
hypercholesterolemia, cholelithiasis, osteoarthritis, orthopedic
injury, thromboembolic disease, cancer, and coronary heart disease.
Rissanen et al., British Medical Journal, 301: 835-837 (1990).
Treatment of obesity involves using appetite suppressors and other
weight-loss inducers, dietary modifications, and the like, but,
similar to the patients with insulin resistance, the majority of
obese patients undergo primary dietary failure over time, thereby
failing to achieve ideal body weight. ANGPTL4 antagonists can be
used to treat obesity and/or reducing total body mass in a subject,
using an effective amount of an ANGPTL4 antagonist. Obesity can be
determined by BMI and/or an obesity-determining property, which are
known in the art and described herein. For example, treatment of
obesity generally refers to reducing the BMI of the mammal to less
than about 25.9, and maintaining that weight for at least 6 months.
The treatment suitably results in a reduction in food or caloric
intake by the mammal. In addition, treatment in this context refers
to preventing obesity from occurring if the treatment is
administered prior to the onset of the obese condition. Treatment
includes the inhibition and/or complete suppression of lipogenesis
in obese mammals, i.e., the excessive accumulation of lipids in fat
cells or accumulation of fat cells, which is one of the major
features of human and animal obesity, as well as loss of total body
weight. A reduction in total body mass can be measured using
standard techniques (e.g., scales). In one embodiment, adiposity
(fat) of a subject is reduced. In this manner, conditions related
to obesity can also be treated, e.g., cardiovascular disease,
diabetes, etc.
[0187] ANGPTL4 is also implicated in the modulation of leptin,
which is an adipocyte-derived hormone. Leptin, which is
structurally related to cytokines, acts on receptors that belong to
the cytokine-receptor superfamily. See, e.g., Zhang F, et al.,
Nature 387:206-209 (1997); Tartaglia L A, et al., Cell 83:1263-1271
(1995); and, Lee G-H, et al., Nature 379:632-635 (1996). Leptin is
encoded by the gene affected in the obese (ob) mutation (Zhang F,
et al., Nature 387:206-209 (1997)). The long form of the leptin
receptor is encoded by the gene affected in the diabetic (db)
mutation (Tartaglia L A, et al., Cell 83:1263-1271 (1995)). The
leptin receptor, which there are several isoforms, is most closely
related to the gp130 and LIFR signal transducing subunits that are
activated by cytokines such as IL-6, LIF and CNTF and hormone
receptors for growth hormone such as erythropoietin. See, e.g.,
Tartaglia L A, et al., supra. Lack of functional leptin or its
receptor causes severe obesity. See, e.g., Zhang et al., supra; Lee
et al., supra; and, Chen H et al, Cell 84:491-495 (1996). Leptin is
known to act in certain regions of the brain (e.g., hypothalamus)
to regulate food intake, energy expenditure and neuroendocrine
function, e.g., it has been shown to be a key regulator of fat
stores, where leptin levels increase with increasing fat stores.
See, e.g., Zhang Y, et al., Nature 372:425-432 (1994); Halaas J L
et al., Science 269:543-546 (1995); Campfield L A, et al., Science
269:546-549 (1995); and, Pellymounter M A, et al., Science
269:540-543 (1995).
[0188] Leptin was also found to be an angiogenic factor. See, e.g.,
Sierra-Honigmann et al., "Biological Action of Leptin as an
Angiogenic Factor" Science 281:1683-1686 (1998); and, Bouloumie et
al., Circ. Res. 83:1059-1066 (1998). Adipose tissue growth depends
on neovascularization. See, e.g., Rupnick et al., PNAS USA 99(16):
10730-10735 (2002). Leptin also plays a role in immunity. See,
e.g., La Cava and Matarese, "The Weight of Leptin in Immunity"
Nature Reviews Immunology 5:371-379 (2004). Other leptin activities
include modulating reproduction, modulating hematopoeisis,
modulating glucose metabolism, and modulating proinflammatory
immune responses. See, e.g., Chelab et al., Nature Genetics
12:318-320 (1996); Stroebel et al., Nature Genetics 18:213-215
(1998); Clement et al., Nature 392:398-401 (1998); Cioffi et al.,
Nature Medicine 2: 585-589 (1996); Gainsford et al., PNAS USA,
93:14564-14568 (1996); Kamohara et al., Nature 389:374-377 (1997);
Loffreda et al., FASEB J. 12:57-65 (1998); and, Lord et al., Nature
394:897-901 (1998).
[0189] ANGPTL4 is up regulated in ob/ob (leptin knockout) and db/db
(leptin receptor knockout) mice. The invention provides methods for
modulating leptin and/or leptin activities by administering an
effective amount of an ANGPTL4, ANGPTL4 agonist or ANGPTL4
antagonist. Leptin levels can be assayed used standard techniques,
e.g., SDS-PAGE, immunoblots, etc.
[0190] ANGPTL4, ANGPTL4 agonists and/or ANGPTL4 antagonists can be
used in the treatment of diseases and disorders related to
disruptions of lipid homeostasis and metabolism of fat which
include, but are not limited to, e.g., metabolic diseases such as
cardiac disorders, cardiovascular, endothelial or angiogenic
disorders, dyslipidemia, hypertension, atherosclerosis,
arteriosclerosis, coronary artery disease (CAD), coronary heart
disease, hypercholesterolemia, heart failure, stroke, diabetes,
pancreatic dysfunctions, osteoarthritis, gallstones, cancer,
glaucoma, obesity, as well as related disorders such as adipositas,
eating disorders, wasting syndromes (cachexia), sleep apnea, and
others. For example, several human conditions are characterized by
distinctive lipid compositions of tissues, cells, membranes, and
extracellular regions or structures. For example, in
atherosclerosis, cholesterol (unesterified, esterified, and
oxidized forms) and other lipids accumulate in cells and in
extracellular areas of the arterial wall and elsewhere. These
lipids have potentially harmful biologic effects, for example, by
changing cellular functions, including gene expression, and by
narrowing the vessel lumen, obstructing the flow of blood.
Regulation of lipid levels would provide numerous substantial
benefits. The effects of administration of ANGPTL4, agonist or
antagonist can be measured likewise by a variety of assays known in
the art, including analysis of fat cells and tissue, such as fat
pads, total body weight, triglyceride levels in muscle, liver, and
fat, fasting and non-fasting levels of leptin, and the levels of
free fatty acids and triglycerides in the blood. ANGPTL4 antagonist
can also be use to inhibit migration of pre-adipocytes by
administering an effective amount of an ANGPTL4 antagonist.
[0191] In certain aspects of the invention, it is desirable to
combine the ANGPTL4, ANGPTL4 agonist or ANGPTL4 antagonist
therapeutic agents with other therapeutic regimens. ANGPTL4 or
ANGPTL4 agonists can be combined with the administrations of other
factors, e.g., such as thoses described herein. As for antagonists,
ANGPTL4 antagonists can be combined with the administration of,
e.g., therapeutic agents to treat hyperlipidemia (and diseases
associated with hyperlipidemia, e.g., obesity,
hypercholesterolemia, atherosclerosis, cardiovascular disease,
diabetes mellitus, hypothyroidism, Cushing's syndrome), e.g.,
including but not limited to, e.g., niacin, cholestyramine,
colestipol, gemfibrozil, clofibrate, statins, fluvastatin (Lescol),
pravastatin, simvastatin, rosuvastin calcium (ZD-4522),
pitavastatin (NK 104), premarin/pravachol (estrogen/pravastatin),
ezetimbe/simvastatin, superstatin, Lipitor, CETi-1 vaccine,
antibodies against CETP (cholesterol ester transfer protein),
BMS-201038 (a microsomal triglyceride transport protein), FM-VP4
(cholesterol transport inhibitor), phyostanol, hypoglycemic agents,
insulin, pramlintide, amylin, AC2993 synthetic exendin-4, Xenical
(orlistat), ciliary neutrophic factor, Axokine, Metformin XT,
Merformin, Glucovance (metformin/glyburide), dexlipotam
(R+/-alpha-lipoic acid), PPAR agonists, beta-3-adenergic receptor
agonists, lipase inhibitors, ATL-962, leptin, anorectics or
appetite suppressant, phentermine, Meridia (silbutramine),
Wellbutrin (buproion), Procyglem (diazoxide), Tenuate
(diethylpropion), Revia (naltrexon), Bontril (phendimetrazine),
Zoloft (sertraline), ciliary neurotrophic factor (CNTF), Axokine,
CB1-cannabinoid receptor antagonists, SR 141716, phytopharm,
AOD9604, hGH 177-191, weight-loss agent, and derivatives thereof
(e.g., salts, peglyated versions, etc.). See also, WO96/04260
(compounds for the treatment of Type II diabetes), WO94/01420,
WO95/17394, WO97/36579, WO97/25042, WO99/08501, WO99/19313, and
WO99/16758. Lifestyle changes can also be combined with the
therapeutic agents of the invention. They include, but are not
limited to, e.g., diet, exercise, limited cholesterol intake,
smoking cessation, etc. See also, WO91/19702 (hypoglycemic and
hypocholesterolemic agents). In certain aspects, ANGPTL4
antagonists can be combined with, e.g., cytokines and other
proinflammatory molecules and several growth factors which inhibit
adipogenesis. These include, but are not limited to, e.g., tumor
necrosis factor (TNF)-.alpha., IL-1, PDGF, FGF, EGF, transforming
growth factor (TGF)-.alpha., -.beta., preadipocyte factor-1
(pref-1), etc. See, e.g., Gregoire et al., Physiological Reviews
78(3):783-809 (1998).
[0192] A "weight-loss agent" refers to a molecule useful in
treatment or prevention of obesity. Such molecules include, e.g.,
hormones (catecholamines, glucagon, ACTH, and growth hormone
combined with IGF-1; the Ob protein; clofibrate; halogenate;
cinchocaine; chlorpromazine; appetite-suppressing drugs acting on
noradrenergic neurotransmitters such as mazindol and derivatives of
phenethylamine, e.g., phenylpropanolamine, diethylpropion,
phentermine, phendimetrazine, benzphetamine, amphetamine,
methamphetamine, and phenmetrazine; drugs acting on serotonin
neurotransmitters such as fenfluramine, tryptophan,
5-hydroxytryptophan, fluoxetine, and sertraline; centrally active
drugs such as naloxone, neuropeptide-Y, galanin,
corticotropin-releasing hormone, and cholecystokinin; a cholinergic
agonist such as pyridostigmine; a sphingolipid such as a
lysosphingolipid or derivative thereof; thermogenic drugs such as
thyroid hormone; ephedrine; beta-adrenergic agonists; drugs
affecting the gastrointestinal tract such as enzyme inhibitors,
e.g. tetrahydrolipostatin, indigestible food such as sucrose
polyester, and inhibitors of gastric emptying such as
threo-chlorocitric acid or its derivatives; .beta.-adrenergic
agonists such as isoproterenol and yohimbine; aminophylline to
increase the .beta.-adrenergic-like effects of yohimbine, an
.alpha..sub.2-adrenergic blocking drug such as clonidine alone or
in combination with a growth-hormone releasing peptide; drugs that
interfere with intestinal absorption such as biguanides such as
metformin and phenformin; bulk fillers such as methylcellulose;
metabolic blocking drugs such as hydroxycitrate; progesterone;
cholecystokinin agonists; small molecules that mimic ketoacids;
agonists to corticotropin-releasing hormone; an ergot-related
prolactin-inhibiting compound for reducing body fat stores (U.S.
Pat. No. 4,783,469 issued Nov. 8, 1988); beta-3-agonists;
bromocriptine; antagonists to opioid peptides; antagonists to
neuropeptide Y; glucocorticoid receptor antagonists; growth hormone
agonists; combinations thereof; etc.
[0193] Other Uses
[0194] ANGPTL4 also appears to be a negative regulator of
inflammatory responses. In certain embodiments of the invention,
ANGPTL4s or ANGPTL4 agonists can be used to inhibit the immune
response, e.g., in the case of undesired or harmful immune
response, e.g., in graft rejection or graft-versus-host diseases.
ANGPTL4 antagonists can be useful in stimulating the immune system.
For example, stimulating the immune system would be desired in
leukemia, other types of cancer, immunocompromised patients (e.g.,
AIDS sufferers, etc.), etc.
[0195] ANGPTL4 is also implicated in cancer. ANGPTL4, when
expressed in tumor cells, causes tumor cell proliferation, in vitro
and in vivo (See, provisional application 60/589,782 and Attorney
Docket number P2144R1 filed concurrently with the present
application, which is incorporated by reference for all purposes).
When ANGPTL4 is expressed in tumors being treated with an
anti-angiogenesis factor, e.g., anti-VEGF antibody, the tumor still
maintains the ability to grow. It has also been shown to be
upregulated in renal cancers. See, e.g., attorney docket number
P5032R1; WO 02/07941; and, Le Jan et al., American Journal of
Pathology, 162(5):1521-1528 (2003). In addition, ANGPTL4 is a
proangiogenic factor (see, e.g., S. Le Jan et al., Am. J. Pathol.,
162(5): 1521-1528 (2003)), which are targets for cancer therapy,
and is an apoptosis survival factor for endothelial cells (see,
e.g., Kim et al., Biochem J. 346:603-610 (2000). Like VEGF (Shweiki
et al., Proc. Natl. Acad. Sci, USA 92:768-772 (1995), ANGPTL4
expression is increased in response to hypoxia. See, e.g., Le Jan
et al., American Journal of Pathology, 162(5):1521-1528 (2003).
Researchers have reported connections between angiogenesis and
adipogenesis or adipose tissue growth. See, e.g., Sierra-Honigmann
et al., "Biological Action of Leptin as an Angiogenic Factor"
Science 281:1683-1686 (1998); Rupnick et al., "Adipose tissue mass
can be regulated through the vasculature" Proc. Nat. Acad. Sci.
USA, 99(16): 10730-10735 (2002); Kolonin et al., "Reversal of
obesity by targeted ablation of adipose tissue" Nature Medicine
Advance Online publication May 9, 2004: 1-8; and, Fukumura et al.,
"Paracrine Regulation of Angiogenesis and Adipocyte Differentiation
During In Vivo Adipogenesis." Circ. Res. 93:e88-e97 (2003).
[0196] ANGPTL4 can also be used in diagnostic assays. Many
different assays and assay formats can be used to detect the amount
of ANGPTL4 in a sample relative to a control sample. These formats,
in turn are useful in the diagnostic assays of the invention, which
are used to detect the presence or onset of disorders described
herein in a subject.
[0197] Any procedure known in the art for the measurement of
soluble analytes can be used in the practice of the instant
invention. Such procedures include but are not limited to
competitive and non-competitive assay systems using techniques such
as radioimmunoassay, enzyme immunoassays (EIA), e.g., ELISA,
"sandwich" immunoassays, precipitin reactions, gel diffusion
reactions, immunodiffusion assays, agglutination assays,
complement-fixation assays, immunoradiometric assays, fluorescent
immunoassays, protein A immunoassays, and immunoelectrophoresis
assays. See, e.g., U.S. Pat. Nos. 4,845,026 and 5,006,459.
Transgenic Knockout Animals of ANGPTL4
[0198] Nucleic acids which encode ANGPTL4 or its modified forms can
also be used to generate either transgenic animals or "knock out"
animals which, in turn, are useful in the development and screening
of therapeutically useful reagents. A transgenic animal (e.g., a
mouse or rat) is an animal having cells that contain a transgene,
which transgene was introduced into the animal or an ancestor of
the animal at a prenatal, e.g., an embryonic stage. A transgene is
a DNA which is integrated into the genome of a cell from which a
transgenic animal develops. The invention provides cDNA encoding an
ANGPTL4 which can be used to clone genomic DNA encoding an ANGPTL4
in accordance with established techniques and the genomic sequences
used to generate transgenic animals that contain cells which
express DNA encoding ANGPTL4.
[0199] Any technique known in the art may be used to introduce a
target gene transgene into animals to produce the founder lines of
transgenic animals. Such techniques include, but are not limited to
pronuclear microinjection (U.S. Pat. Nos. 4,873,191, 4,736,866 and
4,870,009); retrovirus mediated gene transfer into germ lines (Van
der Putten, et al., Proc. Natl. Acad. Sci., USA, 82:6148-6152
(1985)); gene targeting in embryonic stem cells (Thompson, et al.,
Cell, 56:313-321 (1989)); nonspecific insertional inactivation
using a gene trap vector (U.S. Pat. No. 6,436,707); electroporation
of embryos (Lo, Mol. Cell. Biol., 3:1803-1814 (1983)); and
sperm-mediated gene transfer (Lavitrano, et al., Cell, 57:717-723
(1989)); etc.
[0200] Typically, particular cells would be targeted for ANGPTL4
transgene incorporation with tissue-specific enhancers. Transgenic
animals that include a copy of a transgene encoding an ANGPTL4
introduced into the germ line of the animal at an embryonic stage
can be used to examine the effect of increased expression of DNA
encoding ANGPTL4 polypeptides. Such animals can be used as tester
animals for reagents thought to confer protection from, for
example, pathological conditions associated with its
overexpression. In accordance with this facet of the invention, an
animal is treated with the reagent and a reduced incidence of the
pathological condition, compared to untreated animals bearing the
transgene, would indicate a potential therapeutic intervention for
the pathological condition.
[0201] Alternatively, non-human homologues of ANGPTL4 can be used
to construct an ANGPTL4 "knock out" animal which has a defective or
altered gene encoding an ANGPTL4 protein as a result of homologous
recombination between the endogenous gene encoding ANGPTL4 and
altered genomic DNA encoding ANGPTL4 introduced into an embryonic
stem cell of the animal. In certain embodiments, the knock out
animal is a mammal, e.g., a rodent such as a rat or mouse. For
example, cDNA encoding an ANGPTL4 can be used to clone genomic DNA
encoding an ANGPTL4 in accordance with established techniques. A
portion of the genomic DNA encoding the ANGPTL4 can be deleted or
replaced with another gene, such as a gene encoding a selectable
marker which can be used to monitor integration. Typically, several
kilobases of unaltered flanking DNA (both at the 5' and 3' ends)
are included in the vector (see e.g., Thomas and Capecchi, Cell,
51:503 (1987) for a description of homologous recombination
vectors).
[0202] The vector is introduced into an embryonic stem cell line
(e.g., by electroporation) and cells in which the introduced DNA
has homologously recombined with the endogenous DNA are selected
(see e.g., L1 et al., Cell, 69:915 (1992)). The selected cells are
then injected into a blastocyst of an animal (e.g., a mouse or rat)
to form aggregation chimeras (see e.g., Bradley, in
Teratocarcinomas and Embryonic Stem Cells: A Practical Approach, E.
J. Robertson, ed. (IRL, Oxford, 1987), pp. 113-152). A chimeric
embryo can then be implanted into a suitable pseudopregnant female
foster animal and the embryo brought to term to create a "knock
out" animal. Progeny harboring the homologously recombined DNA in
their germ cells can be identified by standard techniques and used
to breed animals in which all cells of the animal contain the
homologously recombined DNA. Knockout animals can be characterized
for instance, for their ability to defend against certain
pathological conditions and for their development of pathological
conditions due to absence of the gene encoding the ANGPTL4.
[0203] In addition, knockout mice can be highly informative in the
discovery of gene function and pharmaceutical utility for a drug
target, as well as in the determination of the potential on-target
side effects associated with a given target. Gene function and
physiology are so well conserved between mice and humans, since
they are both mammals and contain similar numbers of genes, which
are highly conserved between the species. It has recently been well
documented, for example, that 98% of genes on mouse chromosome 16
have a human ortholog (Mural et al., Science 296:1661-71
(2002)).
[0204] Although gene targeting in embryonic stem (ES) cells has
enabled the construction of mice with null mutations in many genes
associated with human disease, not all genetic diseases are
attributable to null mutations. One can design valuable mouse
models of human diseases by establishing a method for gene
replacement (knock-in) which will disrupt the mouse locus and
introduce a human counterpart with mutation, Subsequently one can
conduct in vivo drug studies targeting the human protein (Kitamoto
et. Al., Biochemical and Biophysical Res. Commun., 222:742-47
(1996)).
Uses of Transgenic Animals
[0205] In certain embodiments, the invention encompasses methods of
screening compounds to identify those that mimic the ANGPTL4
(agonists) or prevent the effect of the ANGPTL4 (antagonists).
Agonists that mimic an ANGPTL4 would be especially valuable
therapeutically in the inducing activities of ANGPTL4, e.g., as
described herein, and in those instances where a negative phenotype
is observed based on findings with the non-human transgenic animal
whose genome comprises a disruption of the gene which encodes for
the ANGPTL4. Antagonists that prevent the effects of an ANGPTL4
would be especially valuable therapeutically in preventing ANGPTL4
activities, e.g., described herein, and in those instances where a
positive phenotype is observed based upon observations with the
non-human transgenic knockout animal. Screening assays for
antagonist drug candidates are designed to identify compounds that
bind or complex with the ANGPTL4 encoded by the genes identified
herein, or otherwise interfere with the interaction of the encoded
polypeptide with other cellular proteins, e.g., an ANGPTL4 receptor
(e.g., .alpha..sub.V.gamma..sub.5), lipolipase protein, etc.
[0206] For example, the effect of an antagonist to an ANGPTL4 can
be assessed by administering an ANGPTL4 antagonist to a wild-type
mouse in order to mimic a known knockout phenotype. Thus, one would
initially knockout the ANGPTL4 gene of interest and observe the
resultant phenotype as a consequence of knocking out or disrupting
the ANGPTL4 gene. Subsequently, one could then assess the
effectiveness of an antagonist to the ANGPTL4 by administering an
antagonist to the ANGPTL4 to a wild-type mouse. An effective
antagonist would be expected to mimic the phenotypic effect that
was initially observed in the knockout animal.
[0207] Likewise, one could assess the effect of an agonist to an
ANGPTL4, by administering an ANGPTL4 agonist to a non-human
transgenic mouse in order to ameliorate a known negative knockout
phenotype. Thus, one would initially knockout the ANGPTL4 gene of
interest and observe the resultant phenotype as a consequence of
knocking out or disrupting the ANGPTL4 gene. Subsequently, one
could then assess the effectiveness of an agonist to the ANGPTL4 by
administering an agonist to the ANGPTL4 to a non-human transgenic
mouse. An effective agonist would be expected to ameliorate the
negative phenotypic effect that was initially observed in the
knockout animal.
[0208] In another assay for antagonists, mammalian cells or a
membrane preparation expressing the receptor would be incubated
with a labeled ANGPTL4 in the presence of the candidate compound.
The ability of the compound to enhance or block this interaction
could then be measured.
Antibodies
[0209] Antibodies of the invention include anti-ANGPTL4 antibodies
or antigen-binding fragments of ANGPTL4,
anti-.alpha..sub.V.beta..sub.5 antibodies or other antibodies
described herein. Exemplary antibodies include, e.g., polyclonal,
monoclonal, humanized, fragment, multispecific, heteroconjugated,
multivalent, effecto function, etc., antibodies. Antibodies can be
agonists or antagonists.
[0210] Polyclonal Antibodies
[0211] The antibodies of the invention can comprise polyclonal
antibodies. Methods of preparing polyclonal antibodies are known to
the skilled artisan. For example, polyclonal antibodies against
ANGPTL4 are raised in animals by one or multiple subcutaneous (sc)
or intraperitoneal (ip) injections of the relevant antigen and an
adjuvant. It may be useful to conjugate the relevant antigen to a
protein that is immunogenic in the species to be immunized, e.g.,
keyhole limpet hemocyanin, serum albumin, bovine thyroglobulin, or
soybean trypsin inhibitor using a bifunctional or derivatizing
agent, for example, maleimidobenzoyl sulfosuccinimide ester
(conjugation through cysteine residues), N-hydroxysuccinimide
(through lysine residues), glutaraldehyde, succinic anhydride,
SOC.sub.2, or R.sup.1N.dbd.C.dbd.NR, where R and R.sup.1 are
different alkyl groups.
[0212] Animals are immunized against ANGPTL4, immunogenic
conjugates, or derivatives by combining, e.g., 100 .mu.g or 5 .mu.g
of the protein or conjugate (for rabbits or mice, respectively)
with 3 volumes of Freund's complete adjuvant and injecting the
solution intradermally at multiple sites. One month later the
animals are boosted with 1/5 to 1/10 the original amount of peptide
or conjugate in Freund's complete adjuvant by subcutaneous
injection at multiple sites. Seven to 14 days later the animals are
bled and the serum is assayed for antibody titer. Animals are
boosted until the titer plateaus. Typically, the animal is boosted
with the conjugate of the same antigen, but conjugated to a
different protein and/or through a different cross-linking reagent.
Conjugates also can be made in recombinant cell culture as protein
fusions. Also, aggregating agents such as alum are suitably used to
enhance the immune response.
[0213] Monoclonal Antibodies
[0214] Monoclonal antibodies can be made using the hybridoma method
first described by Kohler et al., Nature, 256:495 (1975), or may be
made by recombinant DNA methods (U.S. Pat. No. 4,816,567).
[0215] In the hybridoma method, a mouse or other appropriate host
animal, such as a hamster or macaque monkey, is immunized as
hereinabove described to elicit lymphocytes that produce or are
capable of producing antibodies that will specifically bind to the
protein used for immunization. Alternatively, lymphocytes may be
immunized in vitro. Lymphocytes then are fused with myeloma cells
using a suitable fusing agent, such as polyethylene glycol, to form
a hybridoma cell (Goding, Monoclonal Antibodies: Principles and
Practice, pp. 59-103 (Academic Press, 1986)).
[0216] The hybridoma cells thus prepared are seeded and grown in a
suitable culture medium that typically contains one or more
substances that inhibit the growth or survival of the unfused,
parental myeloma cells. For example, if the parental myeloma cells
lack the enzyme hypoxanthine guanine phosphoribosyl transferase
(HGPRT or HPRT), the culture medium for the hybridomas typically
will include hypoxanthine, aminopterin, and thymidine (HAT medium),
which substances prevent the growth of HGPRT-deficient cells.
[0217] Typical myeloma cells are those that fuse efficiently,
support stable high-level production of antibody by the selected
antibody-producing cells, and are sensitive to a medium such as HAT
medium. Among these, preferred myeloma cell lines are murine
myeloma lines, such as those derived from MOPC-21 and MPC-11 mouse
tumors available from the Salk Institute Cell Distribution Center,
San Diego, Calif. USA, and SP-2 or X63-Ag8-653 cells available from
the American Type Culture Collection, Rockville, Md. USA. Human
myeloma and mouse-human heteromyeloma cell lines also have been
described for the production of human monoclonal antibodies
(Kozbor, J. Immunol., 133:3001 (1984); Brodeur et al., Monoclonal
Antibody Production Techniques and Applications, pp. 51-63 (Marcel
Dekker, Inc., New York, 1987)).
[0218] Culture medium in which hybridoma cells are growing is
assayed for production of monoclonal antibodies directed against
ANGPTL4. The binding specificity of monoclonal antibodies produced
by hybridoma cells can be determined by immunoprecipitation or by
an in vitro binding assay, such as radioimmunoassay (RIA) or
enzyme-linked immunoabsorbent assay (ELISA). Such techniques and
assays are known in the art. The binding affinity of the monoclonal
antibody can, for example, be determined by the Scatchard analysis
of Munson and Pollard, Anal. Biochem., 107:220 (1980).
[0219] After hybridoma cells are identified that produce antibodies
of the desired specificity, affinity, and/or activity, the clones
may be subcloned by limiting dilution procedures and grown by
standard methods (Goding, Monoclonal Antibodies: Principles and
Practice, pp. 59-103 (Academic Press, 1986)). Suitable culture
media for this purpose include, for example, D-MEM or RPMI-1640
medium. In addition, the hybridoma cells may be grown in vivo as
ascites tumors in an animal.
[0220] The monoclonal antibodies secreted by the subclones are
suitably separated from the culture medium, ascites fluid, or serum
by conventional immunoglobulin purification procedures such as, for
example, protein A-Sepharose, hydroxylapatite chromatography, gel
electrophoresis, dialysis, or affinity chromatography.
[0221] The monoclonal antibodies may also be made by recombinant
DNA methods, such as those described in U.S. Pat. No. 4,816,567.
DNA encoding the monoclonal antibodies is readily isolated and
sequenced using conventional procedures (e.g., by using
oligonucleotide probes that are capable of binding specifically to
genes encoding the heavy and light chains of the monoclonal
antibodies). The hybridoma cells serve as a source of such DNA.
Once isolated, the DNA may be placed into expression vectors, which
are then transfected into host cells such as E. coli cells, simian
COS cells, Chinese hamster ovary (CHO) cells, or myeloma cells that
do not otherwise produce immunoglobulin protein, to obtain the
synthesis of monoclonal antibodies in the recombinant host cells.
Recombinant production of antibodies will be described in more
detail below.
[0222] In another embodiment, antibodies or antibody fragments can
be isolated from antibody phage libraries generated using the
techniques described in McCafferty et al., Nature, 348:552-554
(1990). Clackson et al., Nature, 352:624-628 (1991) and Marks et
al., J. Mol. Biol., 222:581-597 (1991) describe the isolation of
murine and human antibodies, respectively, using phage libraries.
Subsequent publications describe the production of high affinity
(nM range) human antibodies by chain shuffling (Marks et al.,
Bio/Technology, 10:779-783 (1992)), as well as combinatorial
infection and in vivo recombination as a strategy for constructing
very large phage libraries (Waterhouse et al., Nuc. Acids. Res.,
21:2265-2266 (1993)). Thus, these techniques are viable
alternatives to traditional monoclonal antibody hybridoma
techniques for isolation of monoclonal antibodies.
[0223] The DNA also may be modified, for example, by substituting
the coding sequence for human heavy- and light-chain constant
domains in place of the homologous murine sequences (U.S. Pat. No.
4,816,567; Morrison, et al., Proc. Natl Acad. Sci. USA, 81:6851
(1984)), or by covalently joining to the immunoglobulin coding
sequence all or part of the coding sequence for a
non-immunoglobulin polypeptide.
[0224] Typically such non-immunoglobulin polypeptides are
substituted for the constant domains of an antibody, or they are
substituted for the variable domains of one antigen-combining site
of an antibody to create a chimeric bivalent antibody comprising
one antigen-combining site having specificity for an antigen and
another antigen-combining site having specificity for a different
antigen.
[0225] Humanized and Human Antibodies
[0226] Antibodies of the invention can comprise humanized
antibodies or human antibodies. A humanized antibody has one or
more amino acid residues introduced into it from a source which is
non-human. These non-human amino acid residues are often referred
to as "import" residues, which are typically taken from an "import"
variable domain. Humanization can be essentially performed
following the method of Winter and co-workers (Jones et al.,
Nature, 321:522-525 (1986); Riechmann et al., Nature, 332:323-327
(1988); Verhoeyen et al., Science, 239:1534-1536 (1988)), by
substituting rodent CDRs or CDR sequences for the corresponding
sequences of a human antibody. Accordingly, such "humanized"
antibodies are chimeric antibodies (U.S. Pat. No. 4,816,567)
wherein substantially less than an intact human variable domain has
been substituted by the corresponding sequence from a non-human
species. In practice, humanized antibodies are typically human
antibodies in which some CDR residues and possibly some FR residues
are substituted by residues from analogous sites in rodent
antibodies.
[0227] The choice of human variable domains, both light and heavy,
to be used in making the humanized antibodies is very important to
reduce antigenicity. According to the so-called "best-fit" method,
the sequence of the variable domain of a rodent antibody is
screened against the entire library of known human variable-domain
sequences. The human sequence which is closest to that of the
rodent is then accepted as the human framework (FR) for the
humanized antibody (Sims et al., J. Immunol., 151:2296 (1993);
Chothia et al., J. Mol. Biol., 196:901 (1987)). Another method uses
a particular framework derived from the consensus sequence of all
human antibodies of a particular subgroup of light or heavy chains.
The same framework may be used for several different humanized
antibodies (Carter et al., Proc. Natl. Acad. Sci. USA, 89:4285
(1992); Presta et al., J. Immunol., 151:2623 (1993)).
[0228] It is further important that antibodies be humanized with
retention of high affinity for the antigen and other favorable
biological properties. To achieve this goal, according to a typical
method, humanized antibodies are prepared by a process of analysis
of the parental sequences and various conceptual humanized products
using three-dimensional models of the parental and humanized
sequences. Three-dimensional immunoglobulin models are commonly
available and are familiar to those skilled in the art. Computer
programs are available which illustrate and display probable
three-dimensional conformational structures of selected candidate
immunoglobulin sequences. Inspection of these displays permits
analysis of the likely role of the residues in the functioning of
the candidate immunoglobulin sequence, i.e., the analysis of
residues that influence the ability of the candidate immunoglobulin
to bind its antigen. In this way, FR residues can be selected and
combined from the recipient and import sequences so that the
desired antibody characteristic, such as increased affinity for the
target antigen(s), is achieved. In general, the CDR residues are
directly and most substantially involved in influencing antigen
binding.
[0229] Alternatively, it is now possible to produce transgenic
animals (e.g., mice) that are capable, upon immunization, of
producing a full repertoire of human antibodies in the absence of
endogenous immunoglobulin production. For example, it has been
described that the homozygous deletion of the antibody heavy-chain
joining region (J.sub.H) gene in chimeric and germ-line mutant mice
results in complete inhibition of endogenous antibody production.
Transfer of the human germ-line immunoglobulin gene array in such
germ-line mutant mice will result in the production of human
antibodies upon antigen challenge. See, e.g., Jakobovits et al.,
Proc. Natl. Acad. Sci. USA, 90:2551 (1993); Jakobovits et al.,
Nature, 362:255-258 (1993); Bruggermann et al., Year in Immuno.,
7:33 (1993); and Duchosal et al. Nature 355:258 (1992). Human
antibodies can also be derived from phage-display libraries
(Hoogenboom et al., J. Mol. Biol., 227:381 (1991); Marks et al., J.
Mol. Biol., 222:581-597 (1991); Vaughan et al. Nature Biotech
14:309 (1996)).
[0230] Human antibodies can also be produced using various
techniques known in the art, including phage display libraries
(Hoogenboom and Winter, J. Mol. Biol., 227:381 (1991); Marks et
al., J. Mol. Biol., 222:581 (1991)). According to this technique,
antibody V domain genes are cloned in-frame into either a major or
minor coat protein gene of a filamentous bacteriophage, such as M13
or fd, and displayed as functional antibody fragments on the
surface of the phage particle. Because the filamentous particle
contains a single-stranded DNA copy of the phage genome, selections
based on the functional properties of the antibody also result in
selection of the gene encoding the antibody exhibiting those
properties. Thus, the phage mimics some of the properties of the
B-cell. Phage display can be performed in a variety of formats,
reviewed in, e.g., Johnson, K S. and Chiswell, D J., Cur Opin in
Struct Biol 3:564-571 (1993). Several sources of V-gene segments
can be used for phage display. For example, Clackson et al.,
Nature, 352:624-628 (1991) isolated a diverse array of
anti-oxazolone antibodies from a small random combinatorial library
of V genes derived from the spleens of immunized mice. A repertoire
of V genes from unimmunized human donors can be constructed and
antibodies to a diverse array of antigens (including self-antigens)
can be isolated, e.g., by essentially following the techniques
described by Marks et al., J. Mol. Biol. 222:581-597 (1991), or
Griffith et al., EMBO J. 12:725-734 (1993). See, also, U.S. Pat.
Nos. 5,565,332 and 5,573,905. The techniques of Cole et al. and
Boerner et al. are also available for the preparation of human
monoclonal antibodies (Cole et al., Monoclonal Antibodies and
Cancer Therapy, Alan R. Liss, p. 77 (1985) and Boerner et al., J.
Immunol., 147(1):86-95 (1991)). Human antibodies may also be
generated by in vitro activated B cells (see U.S. Pat. Nos.
5,567,610 and 5,229,275).
[0231] Antibody Fragments
[0232] Antibody fragments are also included in the invention.
Various techniques have been developed for the production of
antibody fragments. Traditionally, these fragments were derived via
proteolytic digestion of intact antibodies (see, e.g., Morimoto et
al., Journal of Biochemical and Biophysical Methods 24:107-117
(1992) and Brennan et al., Science, 229:81 (1985)). However, these
fragments can now be produced directly by recombinant host cells.
For example, the antibody fragments can be isolated from the
antibody phage libraries discussed above. Alternatively, Fab'-SH
fragments can be directly recovered from E. coli and chemically
coupled to form F(ab').sub.2 fragments (Carter et al.,
Bio/Technology 10:163-167 (1992)). According to another approach,
F(ab').sub.2 fragments can be isolated directly from recombinant
host cell culture. Other techniques for the production of antibody
fragments will be apparent to the skilled practitioner. In other
embodiments, the antibody of choice is a single chain Fv fragment
(scFv). See WO 93/16185; U.S. Pat. No. 5,571,894; and U.S. Pat. No.
5,587,458. Fv and sFv are the only species with intact combining
sites that are devoid of constant regions; thus, they are suitable
for reduced nonspecific binding during in vivo use. SFv fusion
proteins may be constructed to yield fusion of an effector protein
at either the amino or the carboxy terminus of an sFv. See Antibody
Engineering, ed. Borrebaeck, supra. The antibody fragment may also
be a "linear antibody", e.g., as described in U.S. Pat. No.
5,641,870 for example. Such linear antibody fragments may be
monospecific or bispecific.
[0233] Multispecific Antibodies (e.g., Bispecific)
[0234] Antibodies of the invention also include, e.g.,
multispecific antibodies, which have binding specificities for at
least two different antigens. While such molecules normally will
only bind two antigens (i.e. bispecific antibodies, BsAbs),
antibodies with additional specificities such as trispecific
antibodies are encompassed by this expression when used herein.
Examples of BsAbs include those with one arm directed against a
cell antigen and the other arm directed against a cytotoxic trigger
molecule such as anti-Fc.gamma.RI/anti-CD15,
anti-p185.sup.HER2/Fc.gamma.RIII (CD16), anti-CD3/anti-malignant
B-cell (1D10), anti-CD3/anti-p185.sup.HER2, anti-CD3/anti-p97,
anti-CD3/anti-renal cell carcinoma, anti-CD3/anti-OVCAR-3,
anti-CD3/L-D1 (anti-colon carcinoma), anti-CD3/anti-melanocyte
stimulating hormone analog, anti-EGF receptor/anti-CD3,
anti-CD3/anti-CAMA1, anti-CD3/anti-CD19, anti-CD3/MoV18,
anti-neural cell adhesion molecule (NCAM)/anti-CD3, anti-folate
binding protein (FBP)/anti-CD3, anti-pan carcinoma associated
antigen (AMOC-31)/anti-CD3; BsAbs with one arm which binds
specifically to an antigen on a cell and one arm which binds to a
toxin such as anti-saporin/anti-Id-1, anti-CD22/anti-saporin,
anti-CD7/anti-saporin, anti-CD38/anti-saporin, anti-CEA/anti-ricin
A chain, anti-interferon-.alpha.(IFN-.alpha.)/anti-hybridoma
idiotype, anti-CEA/anti-vinca alkaloid; BsAbs for converting enzyme
activated prodrugs such as anti-CD30/anti-alkaline phosphatase
(which catalyzes conversion of mitomycin phosphate prodrug to
mitomycin alcohol); BsAbs which can be used as fibrinolytic agents
such as anti-fibrin/anti-tissue plasminogen activator (tPA),
anti-fibrin/anti-urokinase-type plasminogen activator (uPA); BsAbs
for targeting immune complexes to cell surface receptors such as
anti-low density lipoprotein (LDL)/anti-Fc receptor (e.g.
Fc.gamma.RI, Fc.gamma.RII or Fc.gamma.RIII); BsAbs for use in
therapy of infectious diseases such as anti-CD3/anti-herpes simplex
virus (HSV), anti-T-cell receptor:CD3 complex/anti-influenza,
anti-Fc.gamma.R-anti-HIV; BsAbs for tumor detection in vitro or in
vivo such as anti-CEA/anti-EOTUBE, anti-CEA/anti-DPTA,
anti-p185.sup.HER2/anti-hapten; BsAbs as vaccine adjuvants; and
BsAbs as diagnostic tools such as anti-rabbit IgG/anti-ferritin,
anti-horse radish peroxidase (HRP)/anti-hormone,
anti-somatostatin/anti-substance P, anti-HRP/anti-FITC,
anti-CEA/anti-.beta.-galactosidase. Examples of trispecific
antibodies include anti-CD3/anti-CD4/anti-CD37,
anti-CD3/anti-CD5/anti-CD37 and anti-CD3/anti-CD8/anti-CD37.
Bispecific antibodies can be prepared as full length antibodies or
antibody fragments (e.g. F(ab').sub.2 bispecific antibodies).
[0235] Methods for making bispecific antibodies are known in the
art. Traditional production of full length bispecific antibodies is
based on the coexpression of two immunoglobulin heavy chain-light
chain pairs, where the two chains have different specificities
(Millstein et al., Nature, 305:537-539 (1983)). Because of the
random assortment of immunoglobulin heavy and light chains, these
hybridomas (quadromas) produce a potential mixture of 10 different
antibody molecules, of which only one has the correct bispecific
structure. Purification of the correct molecule, which is usually
done by affinity chromatography steps, is rather cumbersome, and
the product yields are low. Similar procedures are disclosed in WO
93/08829, and in Traunecker et al., EMBO J, 10:3655-3659
(1991).
[0236] According to a different approach, antibody variable domains
with the desired binding specificities (antibody-antigen combining
sites) are fused to immunoglobulin constant domain sequences. The
fusion preferably is with an immunoglobulin heavy chain constant
domain, comprising at least part of the hinge, CH2, and CH3
regions. It is preferred to have the first heavy-chain constant
region (CH1) containing the site necessary for light chain binding,
present in at least one of the fusions. DNAs encoding the
immunoglobulin heavy chain fusions and, if desired, the
immunoglobulin light chain, are inserted into separate expression
vectors, and are co-transfected into a suitable host organism. This
provides for great flexibility in adjusting the mutual proportions
of the three polypeptide fragments in embodiments when unequal
ratios of the three polypeptide chains used in the construction
provide the optimum yields. It is, however, possible to insert the
coding sequences for two or all three polypeptide chains in one
expression vector when the expression of at least two polypeptide
chains in equal ratios results in high yields or when the ratios
are of no particular significance.
[0237] In one embodiment of this approach, the bispecific
antibodies are composed of a hybrid immunoglobulin heavy chain with
a first binding specificity in one arm, and a hybrid immunoglobulin
heavy chain-light chain pair (providing a second binding
specificity) in the other arm. It was found that this asymmetric
structure facilitates the separation of the desired bispecific
compound from unwanted immunoglobulin chain combinations, as the
presence of an immunoglobulin light chain in only one half of the
bispecific molecule provides for a facile way of separation. This
approach is disclosed in WO 94/04690. For further details of
generating bispecific antibodies see, for example, Suresh et al.,
Methods in Enzymology, 121:210 (1986).
[0238] According to another approach described in WO96/27011, the
interface between a pair of antibody molecules can be engineered to
maximize the percentage of heterodimers which are recovered from
recombinant cell culture. The preferred interface comprises at
least a part of the C.sub.H3 domain of an antibody constant domain.
In this method, one or more small amino acid side chains from the
interface of the first antibody molecule are replaced with larger
side chains (e.g. tyrosine or tryptophan). Compensatory "cavities"
of identical or similar size to the large side chain(s) are created
on the interface of the second antibody molecule by replacing large
amino acid side chains with smaller ones (e.g. alanine or
threonine). This provides a mechanism for increasing the yield of
the heterodimer over other unwanted end-products such as
homodimers.
[0239] Techniques for generating bispecific antibodies from
antibody fragments have also been described in the literature. For
example, bispecific antibodies can be prepared using chemical
linkage. Brennan et al., Science, 229: 81 (1985) describe a
procedure wherein intact antibodies are proteolytically cleaved to
generate F(ab').sub.2 fragments. These fragments are reduced in the
presence of the dithiol complexing agent sodium arsenite to
stabilize vicinal dithiols and prevent intermolecular disulfide
formation. The Fab' fragments generated are then converted to
thionitrobenzoate (TNB) derivatives. One of the Fab'-TNB
derivatives is then reconverted to the Fab'-thiol by reduction with
mercaptoethylamine and is mixed with an equimolar amount of the
other Fab'-TNB derivative to form the bispecific antibody. The
bispecific antibodies produced can be used as agents for the
selective immobilization of enzymes.
[0240] Recent progress has facilitated the direct recovery of
Fab'-SH fragments from E. coli, which can be chemically coupled to
form bispecific antibodies. Shalaby et al., J. Exp. Med., 175:
217-225 (1992) describe the production of a fully humanized
bispecific antibody F(ab').sub.2 molecule. Each Fab' fragment was
separately secreted from E. coli and subjected to directed chemical
coupling in vitro to form the bispecific antibody. The bispecific
antibody thus formed was able to bind to cells overexpressing the
VEGF receptor and normal human T cells, as well as trigger the
lytic activity of human cytotoxic lymphocytes against human breast
tumor targets.
[0241] Various techniques for making and isolating bispecific
antibody fragments directly from recombinant cell culture have also
been described. For example, bispecific antibodies have been
produced using leucine zippers. Kostelny et al., J. Immunol.,
148(5):1547-1553 (1992). The leucine zipper peptides from the Fos
and Jun proteins were linked to the Fab' portions of two different
antibodies by gene fusion. The antibody homodimers were reduced at
the hinge region to form monomers and then re-oxidized to form the
antibody heterodimers. This method can also be utilized for the
production of antibody homodimers. The "diabody" technology
described by Hollinger et al., Proc. Natl. Acad. Sci. USA,
90:6444-6448 (1993) has provided an alternative mechanism for
making bispecific antibody fragments. The fragments comprise a
heavy-chain variable domain (V.sub.H) connected to a light-chain
variable domain (V.sub.L) by a linker which is too short to allow
pairing between the two domains on the same chain. Accordingly, the
V.sub.H and V.sub.L domains of one fragment are forced to pair with
the complementary V.sub.L and V.sub.H domains of another fragment,
thereby forming two antigen-binding sites. Another strategy for
making bispecific antibody fragments by the use of single-chain Fv
(sFv) dimers has also been reported. See Gruber et al., J.
Immunol., 152:5368 (1994).
[0242] Antibodies with more than two valencies are contemplated.
For example, trispecific antibodies can be prepared. Tutt et al. J.
Immunol. 147: 60 (1991).
[0243] Heteroconjugate Antibodies
[0244] Bispecific antibodies include cross-linked or
"heteroconjugate" antibodies, which are antibodies of the
invention. For example, one of the antibodies in the
heteroconjugate can be coupled to avidin, the other to biotin. Such
antibodies have, for example, been proposed to target immune system
cells to unwanted cells (U.S. Pat. No. 4,676,980), and for
treatment of HIV infection (WO 91/00360, WO 92/200373, and EP
03089). Heteroconjugate antibodies may be made using any convenient
cross-linking methods. Suitable cross-linking agents are well known
in the art, and are disclosed in U.S. Pat. No. 4,676,980, along
with a number of cross-linking techniques.
[0245] Multivalent Antibodies
[0246] Antibodies of the invention include a multivalent antibody.
A multivalent antibody may be internalized (and/or catabolized)
faster than a bivalent antibody by a cell expressing an antigen to
which the antibodies bind. The antibodies of the invention can be
multivalent antibodies (which are other than of the IgM class) with
three or more antigen binding sites (e.g. tetravalent antibodies),
which can be readily produced by recombinant expression of nucleic
acid encoding the polypeptide chains of the antibody. The
multivalent antibody can comprise a dimerization domain and three
or more antigen binding sites. The preferred dimerization domain
comprises (or consists of) an Fc region or a hinge region. In this
scenario, the antibody will comprise an Fc region and three or more
antigen binding sites amino-terminal to the Fc region. The
preferred multivalent antibody herein comprises (or consists of)
three to about eight, but preferably four, antigen binding sites.
The multivalent antibody comprises at least one polypeptide chain
(and preferably two polypeptide chains), wherein the polypeptide
chain(s) comprise two or more variable domains. For instance, the
polypeptide chain(s) may comprise
VD1-(X1).sub.n-VD2-(X.sup.2).sub.n-Fc, wherein VD1 is a first
variable domain, VD2 is a second variable domain, Fc is one
polypeptide chain of an Fc region, X1 and X2 represent an amino
acid or polypeptide, and n is 0 or 1. For instance, the polypeptide
chain(s) may comprise: VH-CH1-flexible linker-VH-CH1-Fc region
chain; or VH-CH1-VH-CH1-Fc region chain. The multivalent antibody
herein preferably further comprises at least two (and preferably
four) light chain variable domain polypeptides. The multivalent
antibody herein may, for instance, comprise from about two to about
eight light chain variable domain polypeptides. The light chain
variable domain polypeptides contemplated here comprise a light
chain variable domain and, optionally, further comprise a CL
domain.
[0247] Effector Function Engineering
[0248] It may be desirable to modify the antibody of the invention
with respect to effector function, so as to enhance the
effectiveness of the antibody in treating cancer, for example. For
example, a cysteine residue(s) may be introduced in the Fc region,
thereby allowing interchain disulfide bond formation in this
region. The homodimeric antibody thus generated may have improved
internalization capability and/or increased complement-mediated
cell killing and antibody-dependent cellular cytotoxicity (ADCC).
See Caron et al., J. Exp Med. 176:1191-1195 (1992) and Shopes, B.
J. Immunol. 148:2918-2922 (1992). Homodimeric antibodies with
enhanced targeting activity may also be prepared using
heterobifunctional cross-linkers as described in Wolff et al.
Cancer Research 53:2560-2565 (1993). Alternatively, an antibody can
be engineered which has dual Fc regions and may thereby have
enhanced complement lysis and ADCC capabilities. See Stevenson et
al. Anti-Cancer Drug Design 3:219-230 (1989). To increase the serum
half life of the antibody, one may incorporate a salvage receptor
binding epitope into the antibody (especially an antibody fragment)
as described in U.S. Pat. No. 5,739,277, for example. As used
herein, the term "salvage receptor binding epitope" refers to an
epitope of the Fc region of an IgG molecule (e.g., IgG.sub.1,
IgG.sub.2, IgG.sub.3, or IgG.sub.4) that is responsible for
increasing the in vivo serum half-life of the IgG molecule.
[0249] Immunoconjugates
[0250] The invention also pertains to immunoconjugates comprising
the antibody described herein conjugated to a cytotoxic agent such
as a chemotherapeutic agent, toxin (e.g. an enzymatically active
toxin of bacterial, fungal, plant or animal origin, or fragments
thereof), or a radioactive isotope (i.e., a radioconjugate). A
variety of radionuclides are available for the production of
radioconjugate antibodies. Examples include, but are not limited
to, e.g., .sup.212Bi .sup.131I, .sup.131In, .sup.90Y and
.sup.186Re.
[0251] Chemotherapeutic agents useful in the generation of such
immunoconjugates have been described above. For example, BCNU,
streptozoicin, vincristine, 5-fluorouracil, the family of agents
known collectively LL-E33288 complex described in U.S. Pat. Nos.
5,053,394, 5,770,710, esperamicins (U.S. Pat. No. 5,877,296), etc.
(see also the definition of chemotherapeutic agents herein) can be
conjugated to the anti-ANGPTL4 or anti-angiogenesis antibodies or
fragments thereof.
[0252] For selective destruction of a cell, the antibody may
comprise a highly radioactive atom. A variety of radioactive
isotopes are available for the production of radioconjugated
anti-ANGPTL4 or fragments thereof. Examples include, but are not
limited to, e.g., .sup.211At, .sup.131I, .sup.125I, .sup.90Y,
.sup.186Re, .sup.188Re, .sup.153Sm, .sup.212Bi, .sup.32P,
.sup.212Pb, .sup.111In, radioactive isotopes of Lu, etc. When the
conjugate is used for diagnosis, it may comprise a radioactive atom
for scintigraphic studies, for example .sup.99mtc or .sup.123I, or
a spin label for nuclear magnetic resonance (NMR) imaging (also
known as magnetic resonance imaging, MRI), such as iodine-123,
iodine-131, indium-111, fluorine-19, carbon-13, nitrogen-15,
oxygen-17, gadolinium, manganese or iron.
[0253] The radio- or other labels may be incorporated in the
conjugate in known ways. For example, the peptide may be
biosynthesized or may be synthesized by chemical amino acid
synthesis using suitable amino acid precursors involving, for
example, fluorine-19 in place of hydrogen. Labels such as
.sup.99mtc or .sup.123I, .sup.186Re, .sup.188Re and .sup.111In can
be attached via a cysteine residue in the peptide. Yttrium-90 can
be attached via a lysine residue. The IODOGEN method (Fraker et al
Biochem. Biophys. Res. Commun. 80: 49-57 (1978) can be used to
incorporate iodine-123. See, e.g., Monoclonal Antibodies in
Immunoscintigraphy (Chatal, CRC Press 1989) which describes other
methods in detail.
[0254] Enzymatically active toxins and fragments thereof which can
be used include diphtheria A chain, nonbinding active fragments of
diphtheria toxin, exotoxin A chain (from Pseudomonas aeruginosa),
ricin A chain, abrin A chain, modeccin A chain, alpha-sarcin,
Aleurites fordii proteins, dianthin proteins, Phytolacca americana
proteins (PAPI, PAPII, and PAP-S), momordica charantia inhibitor,
curcin, crotin, sapaonaria officinalis inhibitor, gelonin,
mitogellin, restrictocin, phenomycin, neomycin, and the
tricothecenes. See, e.g., WO 93/21232 published Oct. 28, 1993.
[0255] Conjugates of the antibody and cytotoxic agent are made
using a variety of bifunctional protein coupling agents such as
N-succinimidyl-3-(2-pyridyldithiol) propionate (SPDP),
succinimidyl-4-(N-maleimidomethyl) cyclohexane-1-carboxylate,
iminothiolane (IT), bifunctional derivatives of imidoesters (such
as dimethyl adipimidate HCL), active esters (such as disuccinimidyl
suberate), aldehydes (such as glutareldehyde), bis-azido compounds
(such as his (p-azidobenzoyl) hexanediamine), bis-diazonium
derivatives (such as bis-(p-diazoniumbenzoyl)-ethylenediamine),
diisocyanates (such as tolyene 2,6-diisocyanate), and bis-active
fluorine compounds (such as 1,5-difluoro-2,4-dinitrobenzene). For
example, a ricin immunotoxin can be prepared as described in
Vitetta et al. Science 238: 1098 (1987). Carbon-14-labeled
1-isothiocyanatobenzyl-3-methyldiethylene triaminepentaacetic acid
(MX-DTPA) is an exemplary chelating agent for conjugation of
radionucleotide to the antibody. See WO94/11026. The linker may be
a "cleavable linker" facilitating release of the cytotoxic drug in
the cell. For example, an acid-labile linker, peptidase-sensitive
linker, photolabile linker, dimethyl linker or disulfide-containing
linker (Chari et al., Cancer Research 52:127-131 (1992); U.S. Pat.
No. 5,208,020) may be used.
[0256] Alternatively, a fusion protein comprising the anti-ANGPTL4
and cytotoxic agent may be made, e.g., by recombinant techniques or
peptide synthesis. The length of DNA may comprise respective
regions encoding the two portions of the conjugate either adjacent
one another or separated by a region encoding a linker peptide
which does not destroy the desired properties of the conjugate.
[0257] In certain embodiments, the antibody is conjugated to a
"receptor" (such streptavidin) for utilization in cell pretargeting
wherein the antibody-receptor conjugate is administered to the
patient, followed by removal of unbound conjugate from the
circulation using a clearing agent and then administration of a
"ligand" (e.g. avidin) which is conjugated to a cytotoxic agent
(e.g. a radionucleotide). In certain embodiments, an
immunoconjugate is formed between an antibody and a compound with
nucleolytic activity (e.g., a ribonuclease or a DNA endonuclease
such as a deoxyribonuclease; Dnase).
[0258] Maytansine and Maytansinoids
[0259] The invention provides an antibody of the invention which is
conjugated to one or more maytansinoid molecules. Maytansinoids are
mitototic inhibitors which act by inhibiting tubulin
polymerization. Maytansine was first isolated from the east African
shrub Maytenus serrata (U.S. Pat. No. 3,896,111). Subsequently, it
was discovered that certain microbes also produce maytansinoids,
such as maytansinol and C-3 maytansinol esters (U.S. Pat. No.
4,151,042). Synthetic maytansinol and derivatives and analogues
thereof are disclosed, for example, in U.S. Pat. Nos. 4,137,230;
4,248,870; 4,256,746; 4,260,608; 4,265,814; 4,294,757; 4,307,016;
4,308,268; 4,308,269; 4,309,428; 4,313,946; 4,315,929; 4,317,821;
4,322,348; 4,331,598; 4,361,650; 4,364,866; 4,424,219; 4,450,254;
4,362,663; and 4,371,533.
[0260] For example, an anti-ANGPTL4 antibody or
anti-.alpha..sub.V.beta..sub.5 antibody is conjugated to a
maytansinoid molecule without significantly diminishing the
biological activity of either the antibody or the maytansinoid
molecule. An average of 3-4 maytansinoid molecules conjugated per
antibody molecule has shown efficacy in enhancing cytotoxicity of
target cells without negatively affecting the function or
solubility of the antibody, although even one molecule of
toxin/antibody would be expected to enhance cytotoxicity over the
use of naked antibody. Maytansinoids are well known in the art and
can be synthesized by known techniques or isolated from natural
sources. Suitable maytansinoids are disclosed, for example, in U.S.
Pat. No. 5,208,020 and in the other patents and nonpatent
publications referred to hereinabove. In one embodiment,
maytansinoids are maytansinol and maytansinol analogues modified in
the aromatic ring or at other positions of the maytansinol
molecule, such as various maytansinol esters.
[0261] There are many linking groups known in the art for making
antibody-maytansinoid conjugates, including, for example, those
disclosed in U.S. Pat. No. 5,208,020 or EP Patent 0 425 235 B1, and
Chari et al., Cancer Research 52:127-131 (1992). The linking groups
include disulfide groups, thioether groups, acid labile groups,
photolabile groups, peptidase labile groups, or esterase labile
groups, as disclosed in the above-identified patents, disulfide and
thioether groups being preferred.
[0262] Conjugates of the antibody and maytansinoid may be made
using a variety of bifunctional protein coupling agents such as
N-succinimidyl-3-(2-pyridyldithio)propionate (SPDP),
succinimidyl-4-(N-maleimidomethyl) cyclohexane-1-carboxylate,
iminothiolane (IT), bifunctional derivatives of imidoesters (such
as dimethyl adipimidate HCL), active esters (such as disuccinimidyl
suberate), aldehydes (such as glutareldehyde), bis-azido compounds
(such as bis(p-azidobenzoyl) hexanediamine), bis-diazonium
derivatives (such as bis-(p-diazoniumbenzoyl)-ethylenediamine),
diisocyanates (such as toluene 2,6-diisocyanate), and bis-active
fluorine compounds (such as 1,5-difluoro-2,4-dinitrobenzene).
Typical coupling agents include
N-succinimidyl-3-(2-pyridyldithio)propionate (SPDP) (Carlsson et
al., Biochem. J. 173:723-737 [1978]) and
N-succinimidyl-4-(2-pyridylthio)pentanoate (SPP) to provide for a
disulfide linkage.
[0263] The linker may be attached to the maytansinoid molecule at
various positions, depending on the type of the link. For example,
an ester linkage may be formed by reaction with a hydroxyl group
using conventional coupling techniques. The reaction may occur at
the C-3 position having a hydroxyl group, the C-14 position
modified with hyrdoxymethyl, the C-15 position modified with a
hydroxyl group, and the C-20 position having a hydroxyl group. The
linkage is formed at the C-3 position of maytansinol or a
maytansinol analogue.
[0264] Calicheamicin
[0265] Another immunoconjugate of interest comprises an
anti-ANGPTL4 antibody or anti-.alpha..sub.V.beta..sub.5 antibody
conjugated to one or more calicheamicin molecules. The
calicheamicin family of antibiotics is capable of producing
double-stranded DNA breaks at sub-picomolar concentrations. For the
preparation of conjugates of the calicheamicin family, see U.S.
Pat. Nos. 5,712,374, 5,714,586, 5,739,116, 5,767,285, 5,770,701,
5,770,710, 5,773,001, 5,877,296 (all to American Cyanamid Company).
Structural analogues of calicheamicin which may be used include,
but are not limited to, .gamma..sub.1.sup.I, .alpha..sub.2.sup.I,
.alpha..sub.3.sup.I, N-acetyl-.gamma..sub.1.sup.I, PSAG and
.theta..sup.I.sub.1 (Hinman et al., Cancer Research 53:3336-3342
(1993), Lode et al., Cancer Research 58:2925-2928 (1998) and the
aforementioned U.S. patents to American Cyanamid). Another
anti-tumor drug that the antibody can be conjugated is QFA which is
an antifolate. Both calicheamicin and QFA have intracellular sites
of action and do not readily cross the plasma membrane. Therefore,
cellular uptake of these agents through antibody mediated
internalization greatly enhances their cytotoxic effects.
[0266] Other Antibody Modifications
[0267] Other modifications of the antibody are contemplated herein.
For example, the antibody may be linked to one of a variety of
nonproteinaceous polymers, e.g., polyethylene glycol, polypropylene
glycol, polyoxyalkylenes, or copolymers of polyethylene glycol and
polypropylene glycol. The antibody also may be entrapped in
microcapsules prepared, for example, by coacervation techniques or
by interfacial polymerization (for example, hydroxymethylcellulose
or gelatin-microcapsules and poly-(methylmethacylate)
microcapsules, respectively), in colloidal drug delivery systems
(for example, liposomes, albumin microspheres, microemulsions,
nano-particles and nanocapsules), or in macroemulsions. Such
techniques are disclosed in Remington's Pharmaceutical Sciences,
16th edition, Oslo, A., Ed., (1980).
[0268] Liposomes and Nanoparticles
[0269] Polypeptides of the invention cane me formulated in
liposomes. For example, antibodies of the invention may also be
formulated as immunoliposomes. Liposomes containing the antibody
are prepared by methods known in the art, such as described in
Epstein et al., Proc. Natl. Acad. Sci. USA, 82:3688 (1985); Hwang
et al., Proc. Natl. Acad. Sci. USA, 77:4030 (1980); and U.S. Pat.
Nos. 4,485,045 and 4,544,545. Liposomes with enhanced circulation
time are disclosed in U.S. Pat. No. 5,013,556. Generally, the
formulation and use of liposomes is known to those of skill in the
art.
[0270] Particularly useful liposomes can be generated by the
reverse phase evaporation method with a lipid composition
comprising phosphatidylcholine, cholesterol and PEG-derivatized
phosphatidylethanolamine (PEG-PE). Liposomes are extruded through
filters of defined pore size to yield liposomes with the desired
diameter. Fab' fragments of the antibody of the invention can be
conjugated to the liposomes as described in Martin et al. J. Biol.
Chem. 257: 286-288 (1982) via a disulfide interchange reaction.
Nanoparticles or nanocapsules can also be used to entrap the
polypeptides of the invention. In one embodiment, a biodegradable
polyalky-cyanoacrylate nanoparticles can be used with the
polypeptides of the invention.
[0271] Other Uses
[0272] The anti-ANGPTL4 antibodies have various utilities. For
example, anti-ANGPTL4 antibodies may be used in diagnostic assays
for ANGPTL4 or fragments of ANGPTL4, e.g., detecting its expression
in specific cells, tissues, or serum, for disease detection, e.g.,
of the disorders described herein, etc. In one embodiment, ANGPTL4
antibodies are used for selecting the patient population for
treatment with the methods provided herein. Various diagnostic
assay techniques known in the art may be used, such as competitive
binding assays, direct or indirect sandwich assays and
immunoprecipitation assays conducted in either heterogeneous or
homogeneous phases (Zola, Monoclonal Antibodies: A Manual of
Techniques, CRC Press, Inc. (1987) pp. 147-158). The antibodies
used in the diagnostic assays can be labeled with a detectable
moiety. The detectable moiety should be capable of producing,
either directly or indirectly, a detectable signal. For example,
the detectable moiety may be a radioisotope, such as .sup.3H,
.sup.14C, .sup.32P, .sup.35S, or .sup.125I, a fluorescent or
chemiluminescent compound, such as fluorescein isothiocyanate,
rhodamine, or luciferin, or an enzyme, such as alkaline
phosphatase, beta-galactosidase or horseradish peroxidase. Any
method known in the art for conjugating the antibody to the
detectable moiety may be employed, including those methods
described by Hunter et al., Nature, 144:945 (1962); David et al.,
Biochemistry, 13:1014 (1974); Pain et al., J. Immunol. Meth.,
40:219 (1981); and Nygren, J. Histochem. And Cytochem., 30:407
(1982).
[0273] Anti-ANGPTL4 antibodies also are useful for the affinity
purification of ANGPTL4 from recombinant cell culture or natural
sources. In this process, the antibodies against ANGPTL4 are
immobilized on a suitable support, such a Sephadex resin or filter
paper, using methods well known in the art. The immobilized
antibody then is contacted with a sample containing the ANGPTL4 to
be purified, and thereafter the support is washed with a suitable
solvent that will remove substantially all the material in the
sample except the ANGPTL4, which is bound to the immobilized
antibody. Finally, the support is washed with another suitable
solvent that will release the ANGPTL4 from the antibody.
Vectors, Host Cells and Recombinant Methods
[0274] The polypeptides of the invention can be produced
recombinantly, using techniques and materials readily
obtainable.
[0275] For recombinant production of a polypeptide of the
invention, e.g., an ANGPTL4, an anti-ANGPTL4 antibody, or an
anti-.alpha..sub.V.beta..sub.5 antibody, the nucleic acid encoding
it is isolated and inserted into a replicable vector for further
cloning (amplification of the DNA) or for expression. DNA encoding
the polypeptide of the invention is readily isolated and sequenced
using conventional procedures. For example, a DNA encoding a
monoclonal antibody is isolated and sequenced, e.g., by using
oligonucleotide probes that are capable of binding specifically to
genes encoding the heavy and light chains of the antibody. Many
vectors are available. The vector components generally include, but
are not limited to, one or more of the following: a signal
sequence, an origin of replication, one or more marker genes, an
enhancer element, a promoter, and a transcription termination
sequence.
[0276] Signal Sequence Component
[0277] Polypeptides of the invention may be produced recombinantly
not only directly, but also as a fusion polypeptide with a
heterologous polypeptide, which is typically a signal sequence or
other polypeptide having a specific cleavage site at the N-terminus
of the mature protein or polypeptide. The heterologous signal
sequence selected typically is one that is recognized and processed
(i.e., cleaved by a signal peptidase) by the host cell. For
prokaryotic host cells that do not recognize and process the native
polypeptide signal sequence, the signal sequence is substituted by
a prokaryotic signal sequence selected, for example, from the group
of the alkaline phosphatase, penicillinase, lpp, or heat-stable
enterotoxin II leaders. For yeast secretion the native signal
sequence may be substituted by, e.g., the yeast invertase leader,
.alpha. factor leader (including Saccharomyces and Kluyveromyces
.alpha.-factor leaders), or acid phosphatase leader, the C.
albicans glucoamylase leader, or the signal described in WO
90/13646. In mammalian cell expression, mammalian signal sequences
as well as viral secretory leaders, for example, the herpes simplex
gD signal, are available.
[0278] The DNA for such precursor region is ligated in reading
frame to DNA encoding the polypeptide of the invention.
[0279] Origin of Replication Component
[0280] Both expression and cloning vectors contain a nucleic acid
sequence that enables the vector to replicate in one or more
selected host cells. Generally, in cloning vectors this sequence is
one that enables the vector to replicate independently of the host
chromosomal DNA, and includes origins of replication or
autonomously replicating sequences. Such sequences are well known
for a variety of bacteria, yeast, and viruses. The origin of
replication from the plasmid pBR322 is suitable for most
Gram-negative bacteria, the 2.mu. plasmid origin is suitable for
yeast, and various viral origins (SV40, polyoma, adenovirus, VSV or
BPV) are useful for cloning vectors in mammalian cells. Generally,
the origin of replication component is not needed for mammalian
expression vectors (the SV40 origin may typically be used only
because it contains the early promoter).
[0281] Selection Gene Component
[0282] Expression and cloning vectors may contain a selection gene,
also termed a selectable marker. Typical selection genes encode
proteins that (a) confer resistance to antibiotics or other toxins,
e.g., ampicillin, neomycin, methotrexate, or tetracycline, (b)
complement auxotrophic deficiencies, or (c) supply critical
nutrients not available from complex media, e.g., the gene encoding
D-alanine racemase for Bacilli.
[0283] One example of a selection scheme utilizes a drug to arrest
growth of a host cell. Those cells that are successfully
transformed with a heterologous gene produce a protein conferring
drug resistance and thus survive the selection regimen. Examples of
such dominant selection use the drugs neomycin, mycophenolic acid
and hygromycin.
[0284] Another example of suitable selectable markers for mammalian
cells are those that enable the identification of cells competent
to take up the antibody nucleic acid, such as DHFR, thymidine
kinase, metallothionein-I and -II, typically primate
metallothionein genes, adenosine deaminase, ornithine
decarboxylase, etc.
[0285] For example, cells transformed with the DHFR selection gene
are first identified by culturing all of the transformants in a
culture medium that contains methotrexate (Mtx), a competitive
antagonist of DHFR. An appropriate host cell when wild-type DHFR is
employed is the Chinese hamster ovary (CHO) cell line deficient in
DHFR activity.
[0286] Alternatively, host cells (particularly wild-type hosts that
contain endogenous DHFR) transformed or co-transformed with DNA
sequences encoding a polypeptide of the invention, wild-type DHFR
protein, and another selectable marker such as aminoglycoside
3'-phosphotransferase (APH) can be selected by cell growth in
medium containing a selection agent for the selectable marker such
as an aminoglycosidic antibiotic, e.g., kanamycin, neomycin, or
G418. See U.S. Pat. No. 4,965,199.
[0287] A suitable selection gene for use in yeast is the trp 1 gene
present in the yeast plasmid Yrp7 (Stinchcomb et al., Nature,
282:39 (1979)). The trp1 gene provides a selection marker for a
mutant strain of yeast lacking the ability to grow in tryptophan,
for example, ATCC No. 44076 or PEP4-1. Jones, Genetics, 85:12
(1977). The presence of the trp1 lesion in the yeast host cell
genome then provides an effective environment for detecting
transformation by growth in the absence of tryptophan. Similarly,
Leu2-deficient yeast strains (ATCC 20,622 or 38,626) are
complemented by known plasmids bearing the Leu2 gene.
[0288] In addition, vectors derived from the 1.6 .mu.m circular
plasmid pKD1 can be used for transformation of Kluyveromyces
yeasts. Alternatively, an expression system for large-scale
production of recombinant calf chymosin was reported for K. lactis.
Van den Berg, Bio/Technology, 8:135 (1990). Stable multi-copy
expression vectors for secretion of mature recombinant human serum
albumin by industrial strains of Kluyveromyces have also been
disclosed. Fleer et al., Bio/Technology, 9:968-975 (1991).
[0289] Promotor Component
[0290] Expression and cloning vectors usually contain a promoter
that is recognized by the host organism and is operably linked to a
nucleic acid encoding a polypeptide of the invention. Promoters
suitable for use with prokaryotic hosts include the phoA promoter,
.beta.-lactamase and lactose promoter systems, alkaline
phosphatase, a tryptophan (trp) promoter system, and hybrid
promoters such as the tac promoter. However, other known bacterial
promoters are suitable. Promoters for use in bacterial systems also
will contain a Shine-Dalgamo (S.D.) sequence operably linked to the
DNA encoding the polypeptide of the invention.
[0291] Promoter sequences are known for eukaryotes. Virtually all
eukaryotic genes have an AT-rich region located approximately 25 to
30 bases upstream from the site where transcription is initiated.
Another sequence found 70 to 80 bases upstream from the start of
transcription of many genes is a CNCAAT region where N may be any
nucleotide. At the 3' end of most eukaryotic genes is an AATAAA
sequence that may be the signal for addition of the poly A tail to
the 3' end of the coding sequence. All of these sequences are
suitably inserted into eukaryotic expression vectors.
[0292] Examples of suitable promoting sequences for use with yeast
hosts include the promoters for 3-phosphoglycerate kinase or other
glycolytic enzymes, such as enolase, glyceraldyhyde-3-phosphate
dehydrogenase, hexokinase, pyruvate decarboxylase,
phosphofructokinase, glucose-6-phosphate isomerase,
3-phosphoglycerate mutase, pyruvate kinase, triosephosphate
isomerase, phosphoglucose isomerase, and glucokinase.
[0293] Other yeast promoters, which are inducible promoters having
the additional advantage of transcription controlled by growth
conditions, are the promoter regions for alcohol dehydrogenase 2,
isocytochrome C, acid phosphatase, degradative enzymes associated
with nitrogen metabolism, metallothionein,
glyceraldyhyde-3-phosphate dehydrogenase, and enzymes responsible
for maltose and galactose utilization. Suitable vectors and
promoters for use in yeast expression are further described in EP
73,657. Yeast enhancers also are advantageously used with yeast
promoters.
[0294] Transcription of polypeptides of the invention from vectors
in mammalian host cells is controlled, for example, by promoters
obtained from the genomes of viruses such as polyoma virus, fowlpox
virus, adenovirus (such as Adenovirus 2), bovine papilloma virus,
avian sarcoma virus, cytomegalovirus, a retrovirus, hepatitis-B
virus and typically Simian Virus 40 (SV40), from heterologous
mammalian promoters, e.g., the actin promoter or an immunoglobulin
promoter, from heat-shock promoters, provided such promoters are
compatible with the host cell systems.
[0295] The early and late promoters of the SV40 virus are
conveniently obtained as an SV40 restriction fragment that also
contains the SV40 viral origin of replication. The immediate early
promoter of the human cytomegalovirus is conveniently obtained as a
HindIII E restriction fragment. A system for expressing DNA in
mammalian hosts using the bovine papilloma virus as a vector is
disclosed in U.S. Pat. No. 4,419,446. A modification of this system
is described in U.S. Pat. No. 4,601,978. See also Reyes et al.,
Nature 297:598-601 (1982) on expression of human .beta.-interferon
cDNA in mouse cells under the control of a thymidine kinase
promoter from herpes simplex virus. Alternatively, the rous sarcoma
virus long terminal repeat can be used as the promoter.
[0296] Enhancer Element Component
[0297] Transcription of a DNA encoding a polypeptide of this
invention by higher eukaryotes is often increased by inserting an
enhancer sequence into the vector. Many enhancer sequences are now
known from mammalian genes (globin, elastase, albumin,
.alpha.-fetoprotein, and insulin). Typically, one will use an
enhancer from a eukaryotic cell virus. Examples include the SV40
enhancer on the late side of the replication origin (bp 100-270),
the cytomegalovirus early promoter enhancer, the polyoma enhancer
on the late side of the replication origin, and adenovirus
enhancers. See also Yaniv, Nature 297:17-18 (1982) on enhancing
elements for activation of eukaryotic promoters. The enhancer may
be spliced into the vector at a position 5' or 3' to the
polypeptide-encoding sequence, but is typically located at a site
5' from the promoter.
[0298] Transcription Termination Component
[0299] Expression vectors used in eukaryotic host cells (yeast,
fungi, insect, plant, animal, human, or nucleated cells from other
multicellular organisms) will also contain sequences necessary for
the termination of transcription and for stabilizing the mRNA. Such
sequences are commonly available from the 5' and, occasionally 3',
untranslated regions of eukaryotic or viral DNAs or cDNAs. These
regions contain nucleotide segments transcribed as polyadenylated
fragments in the untranslated portion of the mRNA encoding the
polypeptide of the invention. One useful transcription termination
component is the bovine growth hormone polyadenylation region. See
WO94/11026 and the expression vector disclosed therein.
[0300] Selection and Transformation of Host Cells
[0301] Suitable host cells for cloning or expressing DNA encoding
the polypeptides of the invention in the vectors herein are the
prokaryote, yeast, or higher eukaryote cells described above.
Suitable prokaryotes for this purpose include eubacteria, such as
Gram-negative or Gram-positive organisms, for example,
Enterobacteriaceae such as Escherichia, e.g., E. coli,
Enterobacter, Erwinia, Klebsiella, Proteus, Salmonella, e.g.,
Salmonella typhimurium, Serratia, e.g., Serratia marcescans, and
Shigella, as well as Bacilli such as B. subtilis and B.
licheniformis (e.g., B. licheniformis 41P disclosed in DD 266,710
published 12 Apr. 1989), Pseudomonas such as P. aeruginosa, and
Streptomyces. Typically, the E. coli cloning host is E. coli 294
(ATCC 31,446), although other strains such as E. coli B, E. coli
X1776 (ATCC 31,537), and E. coli W3110 (ATCC 27,325) are suitable.
These examples are illustrative rather than limiting.
[0302] In addition to prokaryotes, eukaryotic microbes such as
filamentous fungi or yeast are suitable cloning or expression hosts
for polypeptide of the invention-encoding vectors. Saccharomyces
cerevisiae, or common baker's yeast, is the most commonly used
among lower eukaryotic host microorganisms. However, a number of
other genera, species, and strains are commonly available and
useful herein, such as Schizosaccharomyces pombe; Kluyveromyces
hosts such as, e.g., K. lactis, K. fragilis (ATCC 12,424), K.
bulgaricus (ATCC 16,045), K. wickeramii (ATCC 24,178), K. waltii
(ATCC 56,500), K. drosophilarum (ATCC 36,906), K. thermotolerans,
and K. marxianus; yarrowia (EP 402,226); Pichia pastoris (EP
183,070); Candida; Trichoderma reesia (EP 244,234); Neurospora
crassa; Schwanniomyces such as Schwanniomyces occidentalis; and
filamentous fungi such as, e.g., Neurospora, Penicillium,
Tolypocladium, and Aspergillus hosts such as A. nidulans and A.
niger.
[0303] Suitable host cells for the expression of glycosylated
polypeptides of the invention are derived from multicellular
organisms. Examples of invertebrate cells include plant and insect
cells. Numerous baculoviral strains and variants and corresponding
permissive insect host cells from hosts such as Spodoptera
frugiperda(caterpillar), Aedes aegypti (mosquito), Aedes albopictus
(mosquito), Drosophila melanogaster (fruitfly), and Bombyx mori
have been identified. A variety of viral strains for transfection
are publicly available, e.g., the L-1 variant of Autographa
californica NPV and the Bm-5 strain of Bombyx mori NPV, and such
viruses may be used as the virus herein according to the invention,
particularly for transfection of Spodoptera frugiperda cells. Plant
cell cultures of cotton, corn, potato, soybean, petunia, tomato,
and tobacco can also be utilized as hosts.
[0304] However, interest has been greatest in vertebrate cells, and
propagation of vertebrate cells in culture (tissue culture) has
become a routine procedure. Examples of useful mammalian host cell
lines are monkey kidney CV1 line transformed by SV40 (COS-7, ATCC
CRL 1651); human embryonic kidney line (293 or 293 cells subcloned
for growth in suspension culture, Graham et al., J. Gen Virol.
36:59 (1977)); baby hamster kidney cells (BHK, ATCC CCL 10);
Chinese hamster ovary cells/-DHFR (CHO, Urlaub et al., Proc. Natl.
Acad. Sci. USA 77:4216 (1980)); mouse sertoli cells (TM4, Mather,
Biol. Reprod. 23:243-251 (1980)); monkey kidney cells (CV1 ATCC CCL
70); African green monkey kidney cells (VERO-76, ATCC CRL-1587);
human cervical carcinoma cells (HELA, ATCC CCL 2); canine kidney
cells (MDCK, ATCC CCL 34); buffalo rat liver cells (BRL 3A, ATCC
CRL 1442); human lung cells (W138, ATCC CCL 75); human liver cells
(Hep G2, HB 8065); mouse mammary tumor (MMT 060562, ATCC CCL51);
TR1 cells (Mather et al., Annals N.Y. Acad. Sci. 383:44-68 (1982));
MRC 5 cells; FS4 cells; and a human hepatoma line (Hep G2).
[0305] Host cells are transformed with the above-described
expression or cloning vectors for polypeptide of the invention
production and cultured in conventional nutrient media modified as
appropriate for inducing promoters, selecting transformants, or
amplifying the genes encoding the desired sequences.
[0306] Culturing the Host Cells
[0307] The host cells used to produce polypeptides of the invention
may be cultured in a variety of media.
[0308] Commercially available media such as Ham's F10 (Sigma),
Minimal Essential Medium ((MEM), (Sigma), RPMI-1640 (Sigma),
Dulbecco's Modified Eagle's Medium ((DMEM), Sigma), normal growth
media for hepatocytes (Cambrex), growth media for pre-adipocytes
(Cambrex), etc. are suitable for culturing the host cells. In
addition, any of the media described in Ham et al., Meth. Enz.
58:44 (1979), Barnes et al., Anal. Biochem. 102:255 (1980), U.S.
Pat. Nos. 4,767,704; 4,657,866; 4,927,762; 4,560,655; or 5,122,469;
WO 90/03430; WO 87/00195; or U.S. Patent Re. 30,985 may be used as
culture media for the host cells. Any of these media may be
supplemented as necessary with hormones and/or other growth factors
(such as insulin, transferrin, or epidermal growth factor), salts
(such as sodium chloride, calcium, magnesium, and phosphate),
buffers (such as HEPES), nucleotides (such as adenosine and
thymidine), antibiotics (such as GENTAMYCIN.TM.drug), trace
elements (defined as inorganic compounds usually present at final
concentrations in the micromolar range), and glucose or an
equivalent energy source. Any other necessary supplements may also
be included at appropriate concentrations that would be known to
those skilled in the art. The culture conditions, such as
temperature, pH, and the like, are those previously used with the
host cell selected for expression, and will be apparent to the
ordinarily skilled artisan.
[0309] Polypeptide Purification
[0310] When using recombinant techniques, a polypeptide of the
invention, e.g., ANGPTL4, anti-ANGPTL4 antibody, or an
anti-.alpha..sub.V.beta..sub.5 antibody can be produced
intracellularly, in the periplasmic space, or directly secreted
into the medium. Polypeptides of the invention may be recovered
from culture medium or from host cell lysates. If membrane-bound,
it can be released from the membrane using a suitable detergent
solution (e.g. Triton-X 100) or by enzymatic cleavage. Cells
employed in expression of a polypeptide of the invention can be
disrupted by various physical or chemical means, such as
freeze-thaw cycling, sonication, mechanical disruption, or cell
lysing agents.
[0311] It may be desired to purify a polypeptide of the invention
from recombinant cell proteins or polypeptides. The following
procedures are exemplary of suitable purification procedures: by
fractionation on an ion-exchange column; ethanol precipitation;
reverse phase HPLC; chromatography on silica, chromatography on
heparin SEPHAROSE.TM. chromatography on an anion or cation exchange
resin (such as a polyaspartic acid column, DEAE, etc.);
chromatofocusing; SDS-PAGE; ammonium sulfate precipitation; gel
filtration using, for example, Sephadex G-75; protein A Sepharose
columns to remove contaminants such as IgG; and metal chelating
columns to bind epitope-tagged forms of polypeptides of the
invention. Various methods of protein purification may be employed
and such methods are known in the art and described for example in
Deutscher, Methods in Enzymology, 182 (1990); Scopes, Protein
Purification: Principles and Practice, Springer-Verlag, New York
(1982). The purification step(s) selected will depend, for example,
on the nature of the production process used and the particular
polypeptide of the invention produced.
[0312] For example, an antibody composition prepared from the cells
can be purified using, for example, hydroxylapatite chromatography,
gel electrophoresis, dialysis, and affinity chromatography, with
affinity chromatography being the typical purification technique.
The suitability of protein A as an affinity ligand depends on the
species and isotype of any immunoglobulin Fc domain that is present
in the antibody. Protein A can be used to purify antibodies that
are based on human .gamma.1, .gamma.2, or .gamma.4 heavy chains
(Lindmark et al., J. Immunol. Meth. 62:1-13 (1983)). Protein G is
recommended for all mouse isotypes and for human .gamma.3 (Guss et
al., EMBO J. 5:15671575 (1986)). The matrix to which the affinity
ligand is attached is most often agarose, but other matrices are
available. Mechanically stable matrices such as controlled pore
glass or poly(styrenedivinyl)benzene allow for faster flow rates
and shorter processing times than can be achieved with agarose.
Where the antibody comprises a C.sub.H3 domain, the Bakerbond
ABX.TM.resin (J. T. Baker, Phillipsburg, N.J.) is useful for
purification. Other techniques for protein purification, e.g.,
those indicated above, are also available depending on the antibody
to be recovered. See also, Carter et al., Bio/Technology 10:163-167
(1992) which describes a procedure for isolating antibodies which
are secreted to the periplasmic space of E. coli.
Covalent Modifications to Polypeptides of the Invention
[0313] Covalent modifications of a polypeptide of the invention,
e.g., ANGPTL4, or polypeptide agonist or polypeptide antagonist,
are included within the scope of this invention. They may be made
by chemical synthesis or by enzymatic or chemical cleavage of the
polypeptide, if applicable. Other types of covalent modifications
of the polypeptide are introduced into the molecule by reacting
targeted amino acid residues of the polypeptide with an organic
derivatizing agent that is capable of reacting with selected side
chains or the N- or C-terminal residues, or by incorporating a
modified amino acid or unnatural amino acid into the growing
polypeptide chain, e.g., Ellman et al. Meth. Enzym. 202:301-336
(1991); Noren et al. Science 244:182 (1989); and, & US Patent
applications 20030108885 and 20030082575.
[0314] Cysteinyl residues most commonly are reacted with
.alpha.-haloacetates (and corresponding amines), such as
chloroacetic acid or chloroacetamide, to give carboxymethyl or
carboxyamidomethyl derivatives. Cysteinyl residues also are
derivatized by reaction with bromotrifluoroacetone,
.alpha.-bromo-.beta.-(5-imidozoyl)propionic acid, chloroacetyl
phosphate, N-alkylmaleimides, 3-nitro-2-pyridyl disulfide, methyl
2-pyridyl disulfide, p-chloromercuribenzoate,
2-chloromercuri-4-nitrophenol, or
chloro-7-nitrobenzo-2-oxa-1,3-diazole.
[0315] Histidyl residues are derivatized by reaction with
diethylpyrocarbonate at pH 5.5-7.0 because this agent is relatively
specific for the histidyl side chain. Para-bromophenacyl bromide
also is useful; the reaction is typically performed in 0.1 M sodium
cacodylate at pH 6.0.
[0316] Lysinyl and amino-terminal residues are reacted with
succinic or other carboxylic acid anhydrides. Derivatization with
these agents has the effect of reversing the charge of the lysinyl
residues. Other suitable reagents for derivatizing
.alpha.-amino-containing residues include imidoesters such as
methyl picolinimidate, pyridoxal phosphate, pyridoxal,
chloroborohydride, trinitrobenzenesulfonic acid, O-methylisourea,
2,4-pentanedione, and transaminase-catalyzed reaction with
glyoxylate.
[0317] Arginyl residues are modified by reaction with one or
several conventional reagents, among them phenylglyoxal,
2,3-butanedione, 1,2-cyclohexanedione, and ninhydrin.
Derivatization of arginine residues requires that the reaction be
performed in alkaline conditions because of the high pK.sub.a of
the guanidine functional group. Furthermore, these reagents may
react with the groups of lysine as well as the arginine
epsilon-amino group.
[0318] The specific modification of tyrosyl residues may be made,
with particular interest in introducing spectral labels into
tyrosyl residues by reaction with aromatic diazonium compounds or
tetranitromethane. Most commonly, N-acetylimidizole and
tetranitromethane are used to form O-acetyl tyrosyl species and
3-nitro derivatives, respectively. Tyrosyl residues are iodinated
using .sup.125I or .sup.131I to prepare labeled proteins for use in
radioimmunoassay.
[0319] Carboxyl side groups (aspartyl or glutamyl) are selectively
modified by reaction with carbodiimides (R--N.dbd.C.dbd.N--R'),
where R and R' are different alkyl groups, such as
1-cyclohexyl-3-(2-morpholinyl-4-ethyl) carbodiimide or
1-ethyl-3-(4-azonia-4,4-dimethylpentyl) carbodiimide. Furthermore,
aspartyl and glutamyl residues are converted to asparaginyl and
glutaminyl residues by reaction with ammonium ions.
[0320] Glutaminyl and asparaginyl residues are frequently
deamidated to the corresponding glutamyl and aspartyl residues,
respectively. These residues are deamidated under neutral or basic
conditions. The deamidated form of these residues falls within the
scope of this invention.
[0321] Other modifications include hydroxylation of proline and
lysine, phosphorylation of hydroxyl groups of seryl or threonyl
residues, methylation of the .alpha.-amino groups of lysine,
arginine, and histidine side chains (T. E. Creighton, Proteins:
Structure and Molecular Properties, W.H. Freeman & Co., San
Francisco, pp. 79-86 (1983)), acetylation of the N-terminal amine,
and amidation of any C-terminal carboxyl group.
[0322] Another type of covalent modification involves chemically or
enzymatically coupling glycosides to a polypeptide of the
invention. These procedures are advantageous in that they do not
require production of the polypeptide in a host cell that has
glycosylation capabilities for N- or O-linked glycosylation.
Depending on the coupling mode used, the sugar(s) may be attached
to (a) arginine and histidine, (b) free carboxyl groups, (c) free
sulfhydryl groups such as those of cysteine, (d) free hydroxyl
groups such as those of serine, threonine, or hydroxyproline, (e)
aromatic residues such as those of phenylalanine, tyrosine, or
tryptophan, or (f) the amide group of glutamine. These methods are
described in WO 87/05330 published 11 Sep. 1987, and in Aplin and
Wriston, CRC Crit. Rev. Biochem., pp. 259-306 (1981).
[0323] Removal of any carbohydrate moieties present on a
polypeptide of the invention may be accomplished chemically or
enzymatically. Chemical deglycosylation requires exposure of the
polypeptide to the compound trifluoromethanesulfonic acid, or an
equivalent compound. This treatment results in the cleavage of most
or all sugars except the linking sugar (N-acetylglucosamine or
N-acetylgalactosamine), while leaving the polypeptide intact.
Chemical deglycosylation is described by Hakimuddin, et al. Arch.
Biochem. Biophys. 259:52 (1987) and by Edge et al. Anal. Biochem.,
118:131 (1981). Enzymatic cleavage of carbohydrate moieties, e.g.,
on antibodies, can be achieved by the use of a variety of endo- and
exo-glycosidases as described by Thotakura et al. Meth. Enzymol.
138:350 (1987).
[0324] Another type of covalent modification of a polypeptide of
the invention comprises linking the polypeptide to one of a variety
of nonproteinaceous polymers, e.g., polyethylene glycol,
polypropylene glycol, or polyoxyalkylenes, in the manner set forth
in U.S. Pat. Nos. 4,640,835; 4,496,689; 4,301,144; 4,670,417;
4,791,192 or 4,179,337.
Pharmaceutical Compositions
[0325] Therapeutic formulations of molecules of the invention,
ANGPTL4, ANGPTL4 agonist or ANGPTL4 antagonist, used in accordance
with the invention are prepared for storage by mixing a molecule,
e.g., a polypeptide, having the desired degree of purity with
optional pharmaceutically acceptable carriers, excipients or
stabilizers (Remington's Pharmaceutical Sciences 16th edition,
Osol, A. Ed. (1980)), in the form of lyophilized formulations or
aqueous solutions. Acceptable carriers, excipients, or stabilizers
are nontoxic to recipients at the dosages and concentrations
employed, and include buffers such as phosphate, citrate, and other
organic acids; antioxidants including ascorbic acid and methionine;
preservatives (such as octadecyldimethylbenzyl ammonium chloride;
hexamethonium chloride; benzalkonium chloride, benzethonium
chloride; phenol, butyl or benzyl alcohol; alkyl parabens such as
methyl or propyl paraben; catechol; resorcinol; cyclohexanol;
3-pentanol; and m-cresol); low molecular weight (less than about 10
residues) polypeptides; proteins, such as serum albumin, gelatin,
or immunoglobulins; hydrophilic polymers such as
polyvinylpyrrolidone; amino acids such as glycine, glutamine,
asparagine, histidine, arginine, or lysine; monosaccharides,
disaccharides, and other carbohydrates including glucose, mannose,
or dextrins; chelating agents such as EDTA; sugars such as sucrose,
mannitol, trehalose or sorbitol; salt-forming counter-ions such as
sodium; metal complexes (e.g. Zn-protein complexes); and/or
non-ionic surfactants such as TWEEN.TM., PLURONICS.TM. or
polyethylene glycol (PEG).
[0326] The active ingredients may also be entrapped in
microcapsules prepared, for example, by coacervation techniques or
by interfacial polymerization, for example, hydroxymethylcellulose
or gelatin-microcapsules and poly-(methylmethacylate)
microcapsules, respectively, in colloidal drug delivery systems
(for example, liposomes, albumin microspheres, microemulsions,
nano-particles and nanocapsules) or in macroemulsions. Such
techniques are disclosed in Remington's Pharmaceutical Sciences
16th edition, Osol, A. Ed. (1980). See also Johnson et al., Nat.
Med., 2:795-799 (1996); Yasuda, Biomed. Ther., 27:1221-1223 (1993);
Hora et al., Bio/Technology, 8:755-758 (1990); Cleland, "Design and
Production of Single Immunization Vaccines Using Polylactide
Polyglycolide Microsphere Systems," in Vaccine Design: The Subunit
and Adjuvant Approach, Powell and Newman, eds, (Plenum Press: New
York, 1995), pp. 439-462; WO 97/03692, WO 96/40072, WO 96/07399;
and U.S. Pat. No. 5,654,010.
[0327] In certain embodiments, the formulations to be used for in
vivo administration are sterile. This is readily accomplished by
filtration through sterile filtration membranes.
[0328] Sustained-release preparations may be prepared. Suitable
examples of sustained-release preparations include semipermeable
matrices of solid hydrophobic polymers containing a polypeptide of
the invention, which matrices are in the form of shaped articles,
e.g. films, or microcapsules. Examples of sustained-release
matrices include polyesters, hydrogels (for example,
poly(2-hydroxyethyl-methacrylate), or poly(vinylalcohol)),
polylactides (U.S. Pat. No. 3,773,919), copolymers of L-glutamic
acid and .gamma. ethyl-L-glutamate, non-degradable ethylene-vinyl
acetate, degradable lactic acid-glycolic acid copolymers such as
the LUPRON DEPOT.TM. (injectable microspheres composed of lactic
acid-glycolic acid copolymer and leuprolide acetate),
poly-lactic-coglycolic acid (PLGA) polymer, and
poly-D-(-)-3-hydroxybutyric acid. While polymers such as
ethylene-vinyl acetate and lactic acid-glycolic acid enable release
of molecules for over 100 days, certain hydrogels release proteins
for shorter time periods. When encapsulated antibodies remain in
the body for a long time, they may denature or aggregate as a
result of exposure to moisture at 37EC, resulting in a loss of
biological activity and possible changes in immunogenicity.
Rational strategies can be devised for stabilization depending on
the mechanism involved. For example, if the aggregation mechanism
is discovered to be intermolecular S--S bond formation through
thio-disulfide interchange, stabilization may be achieved by
modifying sulfhydryl residues, lyophilizing from acidic solutions,
controlling moisture content, using appropriate additives, and
developing specific polymer matrix compositions. See also, e.g.,
U.S. Pat. No. 6,699,501, describing capsules with polyelectrolyte
covering.
[0329] It is further contemplated that a therapeutic protein agent
of the invention (ANGPTL4, ANGPTL4 agonist or ANGPTL4 antagonist)
can be introduced to a subject by gene therapy. Gene therapy refers
to therapy performed by the administration of a nucleic acid to a
subject. In gene therapy applications, genes are introduced into
cells in order to achieve in vivo synthesis of a therapeutically
effective genetic product, for example for replacement of a
defective gene. "Gene therapy" includes both conventional gene
therapy where a lasting effect is achieved by a single treatment,
and the administration of gene therapeutic agents, which involves
the one time or repeated administration of a therapeutically
effective DNA or mRNA. Antisense RNAs and DNAs can be used as
therapeutic agents for blocking the expression of certain genes in
vivo. See, e.g., Ad-ANGPTL4-SiRNA described herein. It has already
been shown that short antisense oligonucleotides can be imported
into cells where they act as inhibitors, despite their low
intracellular concentrations caused by their restricted uptake by
the cell membrane. (Zamecnik et al., Proc. Natl. Acad. Sci. USA
83:4143-4146 (1986)). The oligonucleotides can be modified to
enhance their uptake, e.g. by substituting their negatively charged
phosphodiester groups by uncharged groups. For general reviews of
the methods of gene therapy, see, for example, Goldspiel et al.
Clinical Pharmacy 12:488-505 (1993); Wu and Wu Biotherapy 3:87-95
(1991); Tolstoshev Ann. Rev. Pharmacol. Toxicol. 32:573-596 (1993);
Mulligan Science 260:926-932 (1993); Morgan and Anderson Ann. Rev.
Biochem. 62:191-217 (1993); and May TIBTECH 11:155-215 (1993).
Methods commonly known in the art of recombinant DNA technology
which can be used are described in Ausubel et al. eds. (1993)
Current Protocols in Molecular Biology, John Wiley & Sons, NY;
and Kriegler (1990) Gene Transfer and Expression, A Laboratory
Manual, Stockton Press, NY.
[0330] There are a variety of techniques available for introducing
nucleic acids into viable cells. The techniques vary depending upon
whether the nucleic acid is transferred into cultured cells in
vitro, or in vivo in the cells of the intended host. Techniques
suitable for the transfer of nucleic acid into mammalian cells in
vitro include the use of liposomes, electroporation,
microinjection, cell fusion, DEAE-dextran, the calcium phosphate
precipitation method, etc. For example, in vivo gene transfer
techniques include but are not limited to, e.g., transfection with
viral (typically retroviral) vectors and viral coat
protein-liposome mediated transfection (Dzau et al., Trends in
Biotechnology 11, 205-210 (1993)). For example, in vivo nucleic
acid transfer techniques include transfection with viral vectors
(such as adenovirus, Herpes simplex I virus, lentivirus,
retrovirus, or adeno-associated virus) and lipid-based systems
(useful lipids for lipid-mediated transfer of the gene are DOTMA,
DOPE and DC-Chol, for example). Examples of using viral vectors in
gene therapy can be found in Clowes et al. J. Clin. Invest.
93:644-651 (1994); Kiem et al. Blood 83:1467-1473 (1994); Salmons
and Gunzberg Human Gene Therapy 4:129-141 (1993); Grossman and
Wilson Curr. Opin. in Genetics and Devel. 3:110-114 (1993); Bout et
al. Human Gene Therapy 5:3-10 (1994); Rosenfeld et al. Science
252:431-434 (1991); Rosenfeld et al. Cell 68:143-155 (1992);
Mastrangeli et al. J. Clin. Invest. 91:225-234 (1993); and Walsh et
al. Proc. Soc. Exp. Biol. Med. 204:289-300 (1993).
[0331] In some situations it is desirable to provide the nucleic
acid source with an agent that targets the target cells, such as an
antibody specific for a cell surface membrane protein or the target
cell, a ligand for a receptor on the target cell, etc. Where
liposomes are employed, proteins which bind to a cell surface
membrane protein associated with endocytosis may be used for
targeting and/or to facilitate uptake, e.g. capsid proteins or
fragments thereof tropic for a particular cell type, antibodies for
proteins which undergo internalization in cycling, proteins that
target intracellular localization and enhance intracellular
half-life. The technique of receptor-mediated endocytosis is
described, for example, by Wu et al., J. Biol. Chem. 262, 4429-4432
(1987); and Wagner et al., Proc. Natl. Acad. Sci. USA 87, 3410-3414
(1990). For review of gene marking and gene therapy protocols see
Anderson et al., Science 256, 808-813 (1992).
[0332] Dosage and Administration
[0333] Dosages and desired drug concentrations of pharmaceutical
compositions of the invention may vary depending on the particular
use envisioned. The determination of the appropriate dosage or
route of administration is well within the skill of an ordinary
physician. Animal experiments provide reliable guidance for the
determination of effective doses for human therapy. Interspecies
scaling of effective doses can be performed following the
principles laid down by Mordenti, J. and Chappell, W. "The use of
interspecies scaling in toxicokinetics" In Toxicokinetics and New
Drug Development, Yacobi et al., Eds., Pergamon Press, New York
1989, pp. 42-96.
[0334] Depending on the type and severity of the disease, about 1
.mu.g/kg to 50 mg/kg (e.g. 0.1-20 mg/kg) of ANGPTL4, ANGPTL4
agonist or ANGPTL4 antagonist, is an initial candidate dosage for
administration to the patient, whether, for example, by one or more
separate administrations, or by continuous infusion. When in vivo
administration of an ANGPTL4 or, agonist or antagonist thereof, is
employed, normal dosage amounts may vary from about 10 ng/kg to up
to 100 mg/kg of mammal body weight or more per day, preferably
about 1 .mu.g/kg/day to 10 mg/kg/day, depending upon the route of
administration. Guidance as to particular dosages and methods of
delivery is provided in the literature; see, for example, U.S. Pat.
Nos. 4,657,760; 5,206,344; or 5,225,212. It is anticipated that
different formulations will be effective for different treatment
compounds and different disorders, that administration targeting
one organ or tissue, for example, may necessitate delivery in a
manner different from that to another organ or tissue. For repeated
administrations over several days or longer, depending on the
condition, the treatment is sustained until a desired suppression
of disease symptoms occurs. However, other dosage regimens may be
useful. Typically, the clinician will administered a molecule(s) of
the invention until a dosage(s) is reached that provides the
required biological effect. The progress of the therapy of the
invention is easily monitored by conventional techniques and
assays.
[0335] The therapeutic composition of the invention can be
administered by any suitable means, including but not limited to,
parenteral, subcutaneous, intraperitoneal, intrapulmonary,
intracerobrospinal, subcutaneous, intra-articular, intrasynovial,
intrathecal, oral, topical, and intranasal administration.
Parenteral infusions include intramuscular, intravenous,
intraarterial, intraperitoneal, or subcutaneous administration. In
addition, the therapeutic composition is suitably administered by
pulse infusion, particularly with declining doses of the antibody.
In certain embodiments, the therapeutic composition is given by
injections, e.g., intravenous or subcutaneous injections, depending
in part on whether the administration is brief or chronic.
[0336] As described herein, ANGPTL4, ANGPTL4 agonist or ANGPTL4
antagonist, can be combined with one or more therapeutic agents.
The combined administration includes coadministration, using
separate formulations or a single pharmaceutical formulation, and
consecutive administration in either order. Use of multiple agents
are also included in the invention. For example, an ANGPTL4 or
ANGPTL4 agonist may precede, follow, alternate with administration
of the additional therapeutic agent, or may be given simultaneously
therewith. In one embodiment, there is a time period while both (or
all) active agents simultaneously exert their biological
activities.
[0337] In certain embodiments, the treatment of the invention
involves the combined administration of an ANGPTL4 antagonist and
one or more therapeutic agent. The invention also contemplates
administration of multiple inhibitors. The combined administration
includes coadministration, using separate formulations or a single
pharmaceutical formulation, and consecutive administration in
either order. For example, an ANGPTL4 antagonist may precede,
follow, alternate with administration of the additional therapeutic
agent, or may be given simultaneously therewith. In one embodiment,
there is a time period while both (or all) active agents
simultaneously exert their biological activities.
[0338] For the prevention or treatment of disease, the appropriate
dosage of ANGPTL4, ANGPTL4 agonist or ANGPTL4 antagonist, will
depend on the type of disease to be treated, as defined above, the
severity and course of the disease, whether the agent is
administered for preventive or therapeutic purposes, previous
therapy, the patient's clinical history and response to the agent,
and the discretion of the attending physician. The agent is
suitably administered to the patient at one time or over a series
of treatments. In a combination therapy regimen, the compositions
of the invention are administered in a therapeutically effective
amount or a therapeutically synergistic amount. As used herein, a
therapeutically effective amount is such that co-administration of
ANGPTL4, ANGPTL4 agonist or ANGPTL4 antagonist, and one or more
other therapeutic agents, or administration of a composition of the
invention, results in reduction or inhibition of the targeting
disease or condition. A therapeutically synergistic amount is that
amount of ANGPTL4, ANGPTL4 agonist or ANGPTL4 antagonist, and one
or more other therapeutic agents, e.g., described herein, necessary
to synergistically or significantly reduce or eliminate conditions
or symptoms associated with a particular disease.
Articles of Manufacture
[0339] In another embodiment of the invention, an article of
manufacture containing materials useful for the methods and
treatment of the disorders described above is provided. The article
of manufacture comprises a container, a label and a package insert.
Suitable containers include, for example, bottles, vials, syringes,
etc. The containers may be formed from a variety of materials such
as glass or plastic. The container holds a composition which is
effective for treating the condition and may have a sterile access
port (for example the container may be an intravenous solution bag
or a vial having a stopper pierceable by a hypodermic injection
needle). At least one active agent in the composition is an
ANGPTL4, ANGPTL4 agonist or ANGPTL4 antagonist. The label on, or
associated with, the container indicates that the composition is
used for treating the condition of choice. The article of
manufacture may further comprise a second container comprising a
pharmaceutically-acceptable buffer, such as phosphate-buffered
saline, Ringer's solution and dextrose solution. It may further
include other materials desirable from a commercial and user
standpoint, including other buffers, diluents, filters, needles,
and syringes. Optionally, a set of instructions, generally written
instructions, is included, which relates to the use and dosage of
ANGPTL4, agonist or antagonist for a disorder described herein. The
instructions included with the kit generally include information as
to dosage, dosing schedule, and route of administration for the
treatment the disorder. The containers of ANGPTL4, ANGPTL4 agonist
or ANGPTL4 antagonist may be unit doses, bulk packages (e.g.,
multi-dose packages), or sub-unit doses.
Deposit of Materials
[0340] The following material has been deposited with the American
Type Culture Collection, 10801 University Boulevard, Manassas, Va.
20110-2209, USA (ATCC): TABLE-US-00002 Material ATCC Deposit No.
Deposit Date ANGPTL4 (NL2-DNA 22780- 209284 Sep. 18, 1997 1078)
[0341] The deposit was made under the provisions of the Budapest
Treaty on the International Recognition of the Deposit of
Microorganisms for the Purpose of Patent Procedure and the
Regulations thereunder (Budapest Treaty). This assures maintenance
of a viable culture of the deposit for 30 years from the date of
deposit. The deposits will be made available by ATCC under the
terms of the Budapest Treaty, and subject to an agreement between
Genentech, Inc. and ATCC, which assures permanent and unrestricted
availability of the progeny of the culture of the deposit to the
public upon issuance of the pertinent U.S. patent or upon laying
open to the public of any U.S. or foreign patent application,
whichever comes first, and assures availability of the progeny to
one determined by the U.S. Commissioner of Patents and Trademarks
to be entitled thereto according to 35 USC .sctn. 122 and the
Commissioner's rules pursuant thereto (including 37 CFR .sctn. 1.14
with particular reference to 886 OG 638).
[0342] The assignee of the present application has agreed that if a
culture of the materials on deposit should die or be lost or
destroyed when cultivated under suitable conditions, the materials
will be promptly replaced on notification with another of the same.
Availability of the deposited material is not to be construed as a
license to practice the invention in contravention of the rights
granted under the authority of any government in accordance with
its patent laws.
EXAMPLES
Example 1
ANGPTL4 Induces Cell-Adhesion and Proliferation of Human
Hepatocytes
[0343] Generation of adenoviral vectors and transduction:
Adenoviral constructs have been constructed by cloning the
Not1-Not1 cDNA insert into the polylinker site of the Ad-easy
vector construction kits from Stratagene (LaJolla, Calif.),
essentially as described by the manufacturer. See, e.g., Hesser et
al., Blood, 104(1):149-158 (2004).
[0344] Generation of hAngptl4(23-406) (PUR9384),
mAngptl4(184-410)-IgG (PUR9388) and mAngptl4(23-410) (PUR9452)
single flag tagged protein. Harvested cell culture fluid was passed
overnight onto anti-flag M2 resin (Sigma#A-2220). The column was
washed to base-line with PBS then eluted with 50 mM Na Citrate
pH3.0. This volume was concentrated on Amicon-15 10,000MWCO
(Millipore #UFC901024). The final step was dialysis into 1 mM
HCl/Super Q H.sub.2O and 0.2 um filtration. A 4-20% tris/glycine
(Invitrogen#EC6028box) SDS page gel +/-10 mM DTT was used to
determine purity. Correct proteins were identified by either Mass
Spec or Edman's n-terminal sequencing.
[0345] Generation of hAngptl4(184-406)-IgG (PUR 9441) n-terminal
flag tag followed in series by an n-terminal hu Fc tag: Harvested
cell culture fluid was passed overnight onto ProSep A (Amersham
#113111835). The column was washed to base-line with PBS. Then a
four column volume 0.5M TMAC/PBS pH 7.5 wash step was followed by a
PBS wash to base line. The elution step was a 50 mM Na Citrate pH
3.0 bump. This volume was concentrated on Amicon-15 10,000MWCO
(Millipore #UFC901024). The final step was dialysis into 1 mM
HCl/Super Q H2O and 0.2 um filtration. A 4-20% tris/glycine
(Invitrogen#EC6028box) SDS page gel +/-10 mM DTT is used to
determine purity. Correct proteins were identified by either Mass
Spec or Edman's n-terminal sequencing. Recombinant proteins can
also be made using standard techniques known in the art.
[0346] Generation of Ad-ANGPTL4-SiRNA: 4 potential ANGPTL4-SiRNA
molecules (Qiagen) were generated based on the fill length hANGPTL4
sequence. One ANGPTL4-SiRNA was selected based on the ability of
the SiRNA to inhibit hANGPTL4 expression. It targeted the following
DNA target sequence GTGGCCAAGCCTGCCCGAAGA (SEQ ID NO:3) of ANGPTL4,
e.g. r(GGCCAAGCCUGCCCGAAGAUU) (SEQ ID NO:4) and/or
r(UCUUCGGGCAGGCUUGGCCAC) (SEQ ID NO:5). The SiRNA was cloned into
CMVpShuttle-H1.1 transfer vector with an RNA promoter, e.g., H1
promoter (GenScript). The SiRNA expression cassette was then cloned
to generate an adenoviral AdhANGPTL4-SiRNA construct. Adenoviral
constructs have been constructed by cloning the Not1-Not1 cDNA
insert into the polylinker site of the Ad-easy vector construction
kits from Stratagene (LaJolla, Calif.), essentially as described by
the manufacturer. See e.g., Hesser et al., Blood, 104(1):149-158
(2004).
[0347] Expression of ANGPTL4 was verified by Western blotting
analysis using an anti-FLAG antibody. One strongly expressing clone
was selected and titers were amplified according to the
manufactures instruction. Viral preparations were purified by CsC1
centrifugation and tested for revertants by PCR. Viral titers were
determined by 96 well cell lysis experiments according to the
manufacturers instructions. These vectors, along with the supplied
pShuttleCMV-lacZ, were recombined, in BJ5183 electro competent
bacteria with the AdEasy vector containing the Ad5 genome deleted
for E1 and E3 regions. Primary viral stocks were prepared by
transiently transfecting the recombined AdEasy plasmids into host
HEK293 cells. Adenovirus stocks were further amplified in HEK293
cells and purified using CsC1 gradient purification method as
described by the manufacturer. Adenovirus working titers were
obtained by Elisa assay.
[0348] Generation of mANGPTL4: 293 cells were transiently
transfected with a construct which contained a nucleic acid
encoding the full length mANGPTL4 (1-410). mANGPTL4 was purified
from the supernatant and used for experiments.
[0349] Cell Adhesion of hepatocytes: The ability of ANGPTL4 to
induce cell adhesion of primary hepatocytes was evaluated in
96-well plates. Plates were coated with murine Angptl4 subsequence
23-410, fibronectin or a control protein NL4 at various
concentrations, e.g., no coating, 0.3 .mu.g/ml, 3.0 .mu.g/ml or 30
.mu.g/ml in 60 .mu.l at 4.degree. C. overnight. Excess protein was
removed and coated wells were blocked with 200 .mu.l of 3% BSA in
PBS for 37.degree. C. for 11/2 hours. After incubation, the
supernatant was aspirated and washed once with PBS.
[0350] The primary human hepatocytes were prepared and grown in
normal growth medium (Cambrex). The cells were washed 3 times with
PBS. The cells were trypsinized followed by a trypsin
neutralization solution (Clonetics). The cells were then
resuspended in normal growth medium (Cambrex). Cells were seeded at
1.5.times.10.sup.4 cells/well in 200 .mu.l total volume. The cells
were split in 5% serum 24 hours before dosing. Cells were incubated
in wells for 37.degree. C. for 2 hours. The supernatant was
removed. Cell attachment was measured using a crystal violet assay.
50 .mu.l of 10% formalin solution was added to well and fixed for
10 minutes. The cells were washed carefully once with PBS. 50 .mu.l
of 0.5% Crystal violet solution was added that was filtered before
use. Solution was incubated in the wells for 30 minutes or more at
room temperature. Wells were washed 3 to 5 times with PBS. PBS was
removed from the wells and dried. The 96 well plate was read at an
OD.sub.550. See FIG. 4. The PNAG method of Landegren can also be
used. See, Landegren, U. (1984) J. Immunol. Methods 67:379-388. As
seen in FIG. 4, recombinant mAngptl4 (23-410) induces cell-adhesion
of primary hepatocytes in vitro.
[0351] Proliferation of Hepatocytes: The proliferation effect of
Angptl4 on primary human hepatocytes was examined. Adenoviral
constructs of Ad-human (h)Angptl4, Ad-LacZ and Ad-Angptl3 were
prepared. See, e.g., Hesser et al, Blood 104(1):149-158 (2004).
Primary human hepatocytes were transduced with either a
construction comprising the adenovirus-Angptl4 construct
(Ad-Angptl4), the adenovirus-LacZ construct (Ad-LacZ) as a control
or the adenovirus-Angptl3 construct (Ad-Angptl3) at the
multiplicity of infection (MOI) of 10, 100 and 1000. After 5 days
of growing the hepatocytes in normal hepatocyte growth medium
(Cambrex), the cells were counted. As indicated in FIG. 5, the
Ad-Angptl4 induces hepatocyte proliferation in vitro at MOI of
10.
Example 2
ANGPTL4 Induces Proliferation of Pre-Adipocytes
[0352] Pre-adipocyte proliferation: The ability of ANGPTL4 to
induce pre-adipocyte proliferation was evaluated. Human
pre-adipocytes (visceral or subcutaneous) were grown on 6 well
dishes (Falcon, Primaria) by splitting cells at a density of 30,000
cells/well in a volume of 3 ml of growth medium containing serum
(preadipocyte growth medium (Cambrex)). 500 .mu.l of COS cell
condition medium from COS cells that were transduced with
adenoviral constructs, e.g., Ad-LacZ (4), Ad-human (h) Angptl4
(23-406) (5) or Ad-human (h)Angptl3 (full length protein) (6), or
recombinant proteins (recombinant murine Angptl4 (23-410) (2);
IgG-mAngptl4 (184-410) (3) or nothing added (1) at the following
concentrations (rmAngptl4 (23-410) (5 .mu.g/ml); IgG-mAngptl4 (5
.mu.g/ml)) were added directly after seeding the cells. The cells
were grown for 5 days at 37.degree. C. in 5% CO.sub.2 incubator.
The cells were trypsinized with 500 .mu.l of 1.times. trypsin for 3
to 5 minutes. The cell mixture (0.5 ml) was pipetted into 9.5 ml of
isotonic buffer solution and counted in a cell counter vial
(considering the dilution factor of 20). As indicated in FIG. 6,
Panel A, both recombinant murine Angptl4 (23-410) (2) and
conditioned COS cell media containing hAngptl14 (23-406)(5) induces
primary human visceral pre-adipocyte proliferation. FIG. 6, Panel B
illustrates that both recombinant murine Angptl4 (23-410) (2) and
conditioned COS cell media containing hAngptl4(23-406) (5) induces
primary human subcutaneous pre-adipocyte proliferation.
[0353] FA CS analysis of Angptl4 binding to human primary
adipocytes: Binding of ANGPTL4 to human primary adipoctyes was
examined by FACS analysis. Primary human subcutaneous adipocytes
were plated in 10 cm cultured dishes at 500,000 to 1.times.10.sup.6
cells/sample well. The cells were split the day before the FACS.
The cells were washed once with PBS and then 10 ml of 20 mM EDTA in
PBS was added and incubated for 10 to 20 minutes. After 20 minutes,
cells were scraped from plate. 10 ml of 5% FCS in PBS was added and
cells were transferred to a 50 ml Falcon tube. The cells were spun
down at 1.8 K rpm for 5 minutes at 4.degree. C. The supernatant was
removed and the cells were resuspended in 1 ml of 5% FCS in PBS.
100 .mu.l of cell suspension was distributed into a 5 ml FACS tubes
containing 1 .mu.g of protein and incubated for 30 minutes or
greater on ice. The following proteins were used: mAngptl4
(23-410), PUR 9452, 0.428 mg/ml (2 .mu.l/sample); hAngptl4
(23-406), PUR 9384, +/-90 .mu.g/ml (10 .mu.l/sample); mAngptl4
(184-410)-IgG, PUR 9388, 8.5 mg/ml (0.211/sample); hAngptl4
(184-406)-IgG, PUR 9441, 1.5 mg/ml (1 .mu.l/sample); and control
FLAG-BAP (Sigma) 0.1 mg/ml (2 .mu.l/sample). After incubation,
tubes were filled with 5 ml of 5% FCS in PBS on ice. The cells were
spun down for 5 minutes at 2K rpm. The supernatant was removed.
Anti-FLAG-FITC antibody (Sigma) was added (2 .mu.l of antibody (100
.mu.g/ml stock) and incubated on ice for 5 minutes or greater. The
final antibody concentration was 1 .mu.g/ml. 5 ml of 5% FCS in PBS
was added and cells were spun down 5 minutes at 1.8 K rpm at
4.degree. C. The supernatant was removed and cells were resuspended
in 0.25 ml PBS with 5% FCS on ice. 0.05% sodium azide may be also
present to prevent receptor internalization. 1 .mu.l of 1:50
diluted stock of propidium iodide (PI) was added per sample. The
cells were then subject to FACS. As indicated in FIG. 7, under
these conditions, both human Angptl4 forms, rhAngptl4 (23-406), and
rhIgG-hAngptl4 (184-406) bind more efficiently to subcutaneous
adipocytes compared to the murine ortholog.
Example 3
Angptl4 Induces Migration of Primary Human Subcutaneous
Pre-Adipocytes
[0354] Angptl4 induces cell migration: We examined Angptl4 ability
to induce cell migration of primary human subcutaneous
pre-adipocytes. Cell motility was measured as described (see, e.g.,
Camenish et al., J. Biol. Chem., 277(19):17281-17290 (2002)) using
HTS Multiwell tissue culture inserts with 3 .mu.m pore size (Becton
Dickinson, N.J.). hANGPTL4 (1-406) was diluted in 50/50/0.1% BSA to
5, 1 and 0.2 .mu.g/ml. As a positive control, membranes were
incubated with either 10% fetal calf serum (FCS) containing medium
or 0.1 .mu.g/ml of recombinant human PDGF-BB (R&D Systems).
PBM/0.1% BSA was used as a negative control. Primary human
adipocytes were washed three times with PBS, harvested and
suspended at about 2-5.times.10.sup.5 cells/ml in PBM/0.1% BSA. The
following cell preparations were tested, where ANGPTL4 is indicated
as NL2. TABLE-US-00003 Adipocyte FIG. 8, Panel NL2 5 .mu.g PBM/0.1%
BSA A NL2 0.5 .mu.g +10% FBS NL2 0.2 .mu.g +10% FBS PDGF-BB 0.1
.mu.g PBM/0.1% BSA FIG. 8, Panel NL2 6.0 .mu.g PBM/0.1% BSA B and C
NL2 1.5 .mu.g PBM/0.1% BSA NL2 0.375 .mu.g PBM/0.1% BSA PDGF-BB 0.1
.mu.g PBM/0.1% BSA
The preparations were added to the bottom chamber and the
preparations were incubated at 37.degree. C. for 19 hours.
[0355] The cell suspension (250 .mu.l) was added to the upper
chamber and the cells were allowed to migrate overnight at
37.degree. C. in a 5% CO.sub.2 humidified incubator. After
incubation, medium was aspirated from the both top and bottom
chambers, and cells that had migrated to the lower surface of the
membrane were fixed with methanol (400 .mu.l of MeOH for 30 minutes
at 4.degree. C., remove MeOH and air dry for 40 minutes) and
stained with YO-PRO-1 iodide (Molecular Probes, Oreg.) (400 .mu.l
YO-PRO-1 iodide at 10 .mu.m (1:100 from 1 mM stock)). Migration
results are quantitated in terms of the average number of
cells/microscopic field at a 20-fold magnification using the
Openlab software (Improvision, MA). As seen in FIG. 8, Panel A,
hAngptl4 added to primary human subcutaneous pre-adipocytes induces
them to migrate. FIG. 8, Panel B illustrates migration at 7 hours.
FIG. 8, Panel C graphically illustrates the migration of adipocytes
after 7 hours of treatment with either no serum (1), 10% fetal calf
serum (FCS) (2), PDGF-BB (3), mANGPTL4 (4).
Example 4
Variant of Angptl4
[0356] A variant ANGPTL4 was made using a standard mutagenesis kit
(e.g., QuikChange XL Site-Directed Mutagenesis Kit (Invitrogen,
Carlsbad, Calif.)) following the manufacturer's protocol. Two amino
acid substitutions were made in the human ANGPTL4 sequence (see,
e.g., FIG. 2). The substitutions were at position 162 and 164
(R162G and R164E), resulting in a RKR to GKE change. ANGPTL4
protein (L280 plasmid, aa 1-406) or variant ANGPTL4 was isolated
from the supernatant of transiently transfected COS-7 cells. For
purification, the supernatant was loaded on a nickel column.
Protein was detected by Western blot with an anti-FLAG-HRP
antibody. See, FIG. 3, Panel B. When the substitutions were made
and the variant ANGPTL4 was compared to native or wild type ANGPTL4
protein, the variant ANGPTL4 was found to have a higher molecular
weight than native ANGPTL4 by Western blotting. The substitution
from RKR to GKE at position 162 and 164 of the native protein
prevented proteolytic degradation of ANGPTL4.
Example 5
Angptl4 binds to integrin .alpha.V.beta.5
[0357] Angiopoietins are secreted factors that regulate
angiogenesis by binding to the endothelial cell specific tyrosine
kinase receptor Tie2 via their fibrinogen (FBN)-like domain. The
coiled-coil domain present in the family of secreted ligands was
found to be necessary for ligant oligomerization (see, e.g.,
Procopio et al., J. Biol. Chem., 274:30196-201(1999)).
[0358] Similar to the angiopoietins, ANGPTL3 and ANGPTL4 are
secreted glycoproteins, each consisting of an N-terminal signal
peptide, followed by a coiled-coil domain and a C-terminal FBN-like
domain. It was determined that ANGPTL3 binds to
.alpha..sub.V.beta..sub.3 through the FBN-like domain. We
determined that ANGPTL4 binds to .alpha..sub.V.beta..sub.5.
293-1953 cell line that is stably transfected with
.alpha..sub.V.beta..sub.5 integrin was tested for the ability to
bind or adhere to ANGPTL4 coated plates. Cells were harvested and
diluted to 10 cells/ml in serum-free medium containing, PBS, 1%
BSA, 1 mM CaCl.sub.2 and 1 mM MgCl.sub.2. Cells were preincubated
with or without anti-integrin .alpha..sub.V.beta..sub.5 antibodies
(MAB1961 (Chemicon, Temecula, Calif.)) or peptides for 15 minutes
at 37.degree. C. Recombinant mANGPTL4, BSA or vitronectin (1 .mu.g,
3 .mu.g, 10 .mu.g, or 30 .mu.g/ml) were coated on to Nunc Maxisorp
96-well flat-bottomed microtiter plates overnight at 4.degree. C.
and blocked with 200 .mu.l of 3% BSA in phosphate buffer saline
(PBS), pH 7.4, for 1.5 hours at 37.degree. C. Cell suspensions
(5.times.10.sup.4 cells/100 .mu.l/well (5.times.10.sup.5/ml)) were
added to the coated wells and the plates were incubated at
37.degree. C. for 5.5 hours. Non-adherent cells were removed by PBS
washes and cell attachment was measured by adding 200 .mu.l of
CyQuant GD Dye (Molecular Probes (Invitrogen detection Technologies
(Carlsbad, Calif.)) (1:400)/cell lysis buffer and incubated for 2-5
minutes. The sample fluorescence was measured using 480 nm
excitation and 520 nm emission maxima. The PNAG method of
Lanndegren can be used (see, e.g., Landegren, J. Immunol. Methods,
67:379-388 (1984)). Cells expressing .alpha..sub.V.beta..sub.5
displayed adherence to ANGPTL4 and vitronectin (USBiological,
Swampscott, Mass.), a positive control, compared to BSA, a negative
control. See FIG. 9, Panel A.
[0359] To determine whether the .alpha..sub.V.beta..sub.5 integrin
was sufficient to mediate ANGPTL4 cell adhesion, blocking
antibodies were tested for their ability to inhibit the adhesion in
the cell adhesion assay. Functional blocking antibodies
(anti-.alpha..sub.V.beta..sub.5 antibody (MAB1961 (Chemicon,
Temecula, Calif.)) or anti-hANGPTL4 antibodies) were added to
293-1953 cells prior to incubation with the protein coated (BSA
(1), vitronectrin (2) or ANGPTL4(3)) wells. See See FIG. 9, Panel
B. Anti-.alpha..sub.V.beta..sub.5 and anti-ANGPTL4 antibodies
abolished ANGPTL4 cell adhesion activity.
[0360] Additional experiments were performed to confirm that
ANGPTL4 binds .alpha..sub.V.beta..sub.5. ELISA experiments were
performed to detect if mANGPTL4, IgG-hANGPTL4-Nterminal (1-183)
and/or IgG-hANGPTL4-Cterminal (184-406) binds to
.beta..sub.V.beta..sub.5 (USBiological, 37K, Swampscott, Mass.)
coated plates. 100 .mu.l/well of integrin .alpha..sub.V.beta..sub.5
diluent (1 .mu.g/ml coating buffer (50 mM carbonate/bicarbonate, pH
9.6)) with coating buffer was incubated overnight at 4.degree. C.
The plates were washed three times with wash buffer (PBS, pH 7.4,
0.05% Tween-20), and 100 .mu.l/well of blocking buffer (PBS, pH
7.4, 0.5% BSA) was added for 1 hour at room temperature with gentle
agitation. Various amounts (0, 0.070 .mu.g, 0.22 .mu.g, 0.66 .mu.g,
2 .mu.g, or 6 .mu.g) of samples, mANGPTL4, IgG-hANGPTL4-Nterminal
(1-183) and/or IgG-hANGPTL4-Cterminal (184406), were prepared in
sample buffer (0.5% BSA, 50 mM Tris, pH 7.4, 0.05% Tween 20, 1 mM
MnCl.sub.2, 50 mMCaCl.sub.2, 50 mMMgCl.sub.2, 100 mM NaCl) and
incubated for 30 minutes. Samples were added to plates (100
.mu.l/well in the amounts incubated above) and incubated for 2
hours at room temperature with gentle agitation. Plates were washed
with buffer and 100 .mu.l/well anti-Flag-horseradish peroxidase
(HRP) (100 ng/ml) (Jackson, #109-036-098) in assay buffer (PBS,
pH7.4, 0.5% BSA, 0.05% Tween 20) was added and incubated for 1 hour
at room temperature with gentle agitation. The plates were washed.
100 .mu.l/well of tetramethylbenzidine (TMB) (Moss, Inc.) was added
and incubated in the plates until good color was developed at room
temperature. 100 .mu.l/well Stop solution (1 M H.sub.3PO.sub.4) was
added to stop the reaction. The plates were read at 630 nm.
mANGPTL4, IgG-hANGPTL4-Nterminal and IgG-hANGPTL4-C-terminal bound
to .alpha..sub.V.beta..sub.5 coated plates, although slightly more
of IgG-hANGPTL4-Cterminal bound to the plates. See, FIG. 9, Panel
C.
[0361] Anti-ANGPTL4 antibodies inhibit binding of ANGPTL4 to
.alpha..sub.V.beta..sub.5 coated plates. ELISA experiments were
performed. 100 .mu.l/well of integrin .alpha..sub.V.beta..sub.5
diluent (1 g/ml coating buffer (50 mM carbonate/bicarbonate, pH
9.6)) with coating buffer was incubated overnight at 4.degree. C.
The plates were washed three times with wash buffer (PBS, pH 7.4,
0.05% Tween-20), and 100 .mu.l/well of blocking buffer (PBS, pH
7.4, 0.5% BSA) was added for 1 hour at room temperature with gentle
agitation. 0.6 .mu.g to 6.0 .mu.g of samples, mANGPTL4,
IgG-hANGPTL4-Nterminal (1-183) and/or IgG-hANGPTL4-Cterminal
(183-406), in sample buffer (0.5% BSA, 50 mM Tris, pH 7.4, 0.05%
Tween 20, 1 mM MnCl.sub.2, 50 .mu.MCaCl.sub.2, 50 .mu.MMgCl.sub.2,
100 mM NaCl) were incubated with anti-ANGPTL4 antibodies (1.5
.mu.g) or anti-Dscr (1.5 .mu.g) for 30 minutes. After incubation,
100 .mu.l/well of sample +/- antibody was incubated with the plates
for 2 hours at room temperature with gentle agitation. Plates were
washed with buffer and 100 .mu.l/well anti-Flag-HRP (100 ng/ml) in
assay buffer (PBS, pH7.4, 0.5% BSA, 0.05% Tween 20) was added and
incubated for 1 hour at room temperature with gentle agitation. The
plates were washed and 100 .mu.l/well of TMB was added and
incubated in the plates until good color was developed at room
temperature. 100 .mu.l/well Stop solution (1 M H.sub.3PO.sub.4) was
added to stop the reaction. The plates were read at 630 nm.
Anti-ANGPTL4 antibodies reduced the amount of mANGPTL4,
IgG-hANGPTL4-Nterminal and IgG-hANGPTL4-Cterminal binding to the
.alpha..sub.V.beta..sub.5 coated plates compared to anti-Dscr
antibody, 5G7 monoclonal antibody or medium. See, FIG. 9, Panel
D.
[0362] In another experiment, binding of ANGPTL4 and integrin
.alpha..sub.V.beta..sub.5 was shown by ELISA. In this experiment,
80 .mu.l/well of hANGPTL4-C terminal, vitronectin or BSA (5
.mu.g/ml) was added to plates in coating buffer (50 mM
carbonate/bicarbonate, pH 9.6) and incubated overnight at 4.degree.
C. The plates were washed (wash buffer: PBS, pH 7.4, 0.05%
Tween-20) and 100 .mu.l/well of blocking buffer (PBS, pH 7.4, 0.5%
BSA) with either media, anti-hANGPTL4 antibodies (15 .mu.g/100
.mu.l), or anti-Dscr antibodies (15 .mu.g/100 .mu.l) was added and
incubated for 1 hour at room temperature with gentle agitation. The
plates were washed and .alpha..sub.V.beta..sub.5 100 .mu.l (3-9
.mu.g/ml) was added and incubated for 2 hours at room temperature
with gentle agitation. The plates were washed and 1 .mu.g/ml
(1:1000) of anti-.alpha..sub.V.beta..sub.5 antibody (Chemicon) (5
.mu.g/100 .mu.l) was added in assay buffer (PBS, pH7.4, 0.5% BSA,
0.05% Tween 20) and incubated for 1 hour at room temperature with
gentle agitation. After incubation, the plates were washed and 100
.mu.l/well horseradish peroxidase (HRP) anti-mouse (1:5000) was
added in assay buffer. The plates were washed and 100 .mu.l/well
tetramethylbenzidine (TMB) was added and incubated at room
temperature until there was good color development. The reaction
was stopped with 100 .mu.l/well 1 M H.sub.3PO.sub.4 and plates were
read at 630 nm. .alpha..sub.V.beta..sub.5 binds to ANGPTL4 (lane 1)
and vitronectrin (lane 4) coated plates. The binding is blocked
with an anti-ANGPTL4 antibodies (lane 2) but not when a control
antibody anti-Dscr is used (lane 3) or a control protein is coated
on the plates (lane 5). See, FIG. 9, Panel E.
[0363] Hence, these findings demonstrate that recombinant ANGPTL4
binds specifically to the .alpha..sub.V.beta..sub.5 integrin.
Example 6
Angptl4 Increases Triglycerides in a Mouse when Injected
Intravenously
[0364] Triglycerides levels were determined in C57B1-6 mice
injected with various adenovirus constructs that include ANGPTL4.
C57B1-6 mice were injected intravenously in the tail with either
(1) adenovirus GFP construct, (2) adenovirus Gd construct, (3)
adenovirus ANGPTL4 (1-406) construct, (4) adenovirus ANGPTL4
(1-183) construct, (5) adenovirus ANGPTL4 (184-406) construct, (6)
adenovirus ANGPTL4 variant construct; (7) adenovirus ANGPTL4
(1-408) construct and (8) adenovirus control construct.
Triglycerides levels in (mg/dl) were measured from blood samples
from the mice, seven days after injection. As seen in FIG. 10, the
ANGPTL4 N-terminal construct (1-183) has the most pronounced affect
on triglyceride levels along with full length ANGPTL4 construct and
the ANGPTL4 variant construct.
Example 7
Generation and Analysis of Mice Comprising an ANGPTL4 Gene
Disruption
[0365] To investigate the role of an ANGPTL4, disruptions in an
ANGPTL4 gene were produced by homologous recombination.
Specifically, transgenic mice comprising disruptions in ANGPTL4
gene (i.e., knockout mice) were created by either gene targeting or
gene trapping. Mutations were confirmed by southern blot analysis
to confirm correct targeting on both the 5' and 3' ends.
Gene-specific genotyping was also performed by genomic PCR to
confirm the loss of the endogenous native transcript as
demonstrated by RT-PCR using primers that anneal to exons flanking
the site of insertion. Targeting vectors were electroporated into
129 strain ES cells and targeted clones were identified. Targeted
clones were microinjected into host blastocysts to produce
chimeras. Chimeras were bred with C57 animals to produce F1
heterozygotes. Heterozygotes were intercrossed to produce F2
wildtype, heterozygote and homozygote cohorts which were used for
phenotypic analysis. Rarely, if not enough F1 heterozygotes were
produced, the F1 hets were bred to wildtype C57 mice to produce
sufficient heterozygotes to breed for cohorts to be analyzed for a
phenotype. All phenotypic analysis was performed from 12-16 weeks
after birth.
[0366] Results
[0367] Generation and Analysis of Mice Comprising ANGPTL4 Gene
Disruptions: In these knockout experiments, the gene encoding
ANGPTL4 (PRO197 polypeptide designated as DNA 22780-1078; UNQ171)
was disrupted. The gene specific information for these studies is
as follows: the mutated mouse gene corresponds to nucleotide
reference: NM.sub.--020581. ACCESSION:NM.sub.--020581 NID:10181163;
or Mus musculus angiopoietin-like 4 (Angptl4); protein reference:
Q9Z1P8. ACCESSION:Q9SZ1P9 NID; or Mus musculus (Mouse). NG27
(HEPATIC ANGIOPOEITIN-RELATED PROTEIN) (HYPOTHETICAL PROTEIN
425018-1) (FIBRINOGEN/ANGIOPOIETIN-RELATED PROTEIN)
(ANGIOPOIETIN-LIKE PROTEIN) (ANGIOPOIETIN-LIKE 4). MOUSESTRNRDB;
the human gene sequence reference: NM.sub.--139314. ACCESSION:
NM.sub.--139314 NID:21536397 Homo sapiens angiopoietin-like 4
(ANGPTL4); the human protein sequence corresponds to reference:
Q9BY76. ACCESSION:Q9BY78 NID: or Homo sapiens (Human).
Angiopoietin-related protein 3 precursor (Angiopoitein-like 4)
(Hepatic fibrinogen/angiopoietin-related protein) (HFARP)
(Angiopoietin-like protein PP1158). HUMANSTRNRDB.
[0368] The disrupted mouse gene is Angptl4 (angiopoietin-like 4),
which is the ortholog of human ANGPTL4. Aliases include those
described herein and BK89, Bk89, FIAF, NG27, Ng27, HFARP,
Farp-pending, fibrinogen/angiopoietin-related protein, major
histocompatibility complex region NG27, ARP4, PGAR, PPARG, PP1158,
ANGPTL2, fasting-induced adipose factor, PPARG angiopoietin related
protein, hepatic angiopoietin-related protein, and hepatic
fibrinogen/angiopoietin-related protein.
[0369] Targeted or gene trap mutations were generated in strain
129SvEVBrd-derived embroyonic stem cells (ES) cells. The chimeric
mice were bred to C57BL/6J albino mice to generate F1 heterozygous
animals. These progeny were intercrossed to generate F2 wild type,
heterozygous, and homozygous mutant progeny. On rare occasions, for
example, when very few F1 mice were obtained from the chimera, F1
heterozygous mice were crossed to 129SvEVBrd/C57 hybrid mice to
yield additional heterozygous animals for the intercross to
generate the F2 mice. Phenotypic analysis was performed on mice
from this generation as described below. TABLE-US-00004 wt het hom
Total Observed 18 38 11 67 Expected 16.75 33.5 16.75 67 Chi-Sq. =
2.76 Significance = 0.26294 (hom/n) = 0.16 Avg. Litter Size = 7
[0370] Retroviral insertion (OST) occurred disrupting the gene
between coding exons 2 and 3 (NCBI accession NM.sub.--020581.1)
[0371] Wild-type expression of target gene was detected in
embryonic stem (ES) cells and in all adult tissue samples tested by
RT-PCT, except tail. RT-PCR analysis revealed that the transcript
was absent in the (-/-) mouse analyzed.
1. Phenotypic Analysis
[0372] Overall Phenotypic Summary: Mutation of the gene encoding
the ortholog of human angiopoietin-like 4 (ANGPTL4) resulted in
decreased cholesterol and triglyceride levels in (-/-) mice. In
addition, the male (-/-) mice exhibited an enhanced glucose
tolerance in Glucose Tolerance Test. The mutant (-/-) mice also
exhibited immunological abnormalities including elevated mean serum
IgM levels and mean absolute neutrophil counts when compared with
their (+/+) littermates. Transcript was absent by RT-PCR.
[0373] Cardiovascular Phenotypic Analysis/Metabolism-Blood
Chemistry: In the area of cardiovascular biology, phenotypic
testing was performed to identify potential targets for the
treatment of cardiovascular, endothelial or angiogenic disorders
such as hypertension, atherosclerosis, heart failure, stroke,
various coronary artery diseases, dyslipidemias such as high
cholesterol (hypercholesterolemia) and elevated serum triglycerides
(hypertriglyceridemia), cancer and/or obesity. The phenotypic tests
include the measurement of serum cholesterol and triglycerides. In
addition, blood chemistry phenotypic analysis also included glucose
tolerance tests to measure insulin sensitivity and changes in
glucose metabolism. Abnormal glucose tolerance test results are
indicative of but may not be limited to the following disorders or
conditions: Diabetes Type 1 and Type 2, Syndrome X.
The phenotypic tests in this instance included the measurement of
serum cholesterol and triglycerides.
[0374] Blood Lipids
[0375] Procedure: A cohort of 4 wild type and 8 homozygote males
were used in these assays. Mean serum cholesterol and triglyceride
levels were measured and compared with gender matched (+/+)
littermates. Concurrent testing of glucose tolerance was performed
since this test is the standard for defining impaired glucose
homeostasis in mammals. The glucose tolerance test was performed
using a Lifescan glucomter. Animals were injected IP at 2 g/kg with
D-glucose delivered as a 20% solution and blood glucose levels were
measured at 0, 30, 60 and 90 minutes after injection. The COBAS
Integra 400 (Roche) was used for running blood chemistry tests on
mice.
[0376] Results: The male and female homozygous mutant mice
exhibited a notably decreased mean triglyceride level when compared
with their gender-matched wild-type littermates and the historical
means. These mutants also showed decreased mean serum cholesterol
levels when compared with their wild-type littermates.
Concurrently, male (-/-) mice exhibited an enhanced glucose
tolerance in the presence of normal fasting glucose at all 3
intervals tested when compared with their gender-matched (+/+)
littermates and the historical means, whereas, female (-/-) mice
showed a decreased mean serum glucose level. In summary, these
knockout mice exhibited a positive phenotype with regards to lipid
and/or glucose metabolism. Thus, mutant mice deficient in the
ANGPTL4 gene can serve as a model for treatment of cardiovascular
disease. Antagonists of ANGPTL4 or its encoding gene would play an
important role in regulating blood lipids and in particular in
maintaining normal cholesterol and triglyceride metabolism. Such
inhibitors or antagonists of ANGPTL4 would be useful in the
treatment of such cardiovascular diseases associated with
dyslipidemia as: hypertension, atherosclerosis, heart failure,
stroke, various coronary artery diseases, obesity, and/or
diabetes.
[0377] Immunology Phenotypic Analysis: Immune related and
inflammatory diseases are the manifestations or consequences of
fairly complex, often multiple interconnected biological pathways
which in normal physiology are critical to respond to insult or
injury, initiate repair from insult or injury, and mount innate and
acquired defense against foreign organisms. Disease or pathology
occurs when these normal physiological pathways cause additional
insult or injury either as directly related to the intensity of the
response, as a consequence of abnormal regulation or excessive
stimulation, as a reaction to self, or a combination of these.
[0378] Though the genesis of these diseases often involved
multistep pathways and often multiple different biological
systems/pathways, intervention at critical points in one or more of
these pathways can have an ameliorative or therapeutic effect.
Therapeutic intervention can occur by either antagonism of a
detrimental process/pathway or stimulation of a beneficial
process/pathway.
[0379] T lymphocytes (T cells) are an important component of a
mammalian immune response. T cells recognize antigens which are
associated with a self-molecule encoded by genes within the major
histocompatibility complex (MHC). The antigen may be displayed
together with MHC molecules on the surface of antigen presenting
cells, virus infected cells, cancer cells, grafts, etc. The T cell
system eliminates these altered cells which pose a health threat to
the host animal. T cells include helper T cells and cytotoxic T
cells. Helper T cells proliferate extensively following recognition
of an antigen-MHC complex on an antigen presenting cell. Helper T
cells also secrete a variety of cytokines, e.g., lymphokines, which
play a central role in the activation of B cells, cytotoxic T cells
and a variety of other cells which participate in the immune
response.
[0380] In many immune responses, inflammatory cells infiltrate the
site of injury or infection. The migrating cells may be
neutrophilic, eosinophilic, monocytic or lymphocytic as can be
determined by histologic examination of the affected tissues. See,
e.g., Current Protocols in Immunology, ed. John E. Coligan, 1994,
John Wiley & Sons, Inc.
[0381] Many immune related diseases are known and have been
extensively studied. Such diseases include immune-mediated
inflammatory diseases (e.g., rheumatoid arthritis, immune mediated
renal disease, hepatobiliary diseases, inflammatory bowel disease
(IBD), psoriasis, and asthma), non-immune-mediated inflammatory
diseases, infectious diseases, immunodeficiency diseases,
neoplasia, and graft rejection, etc. In the area of immunology,
targets were identified for the treatment of inflammation and
inflammatory disorders.
[0382] In the area of immunology, targets have been identified
herein for the treatment of inflammation and inflammatory
disorders. Immune related diseases, in one instance, could be
treated by suppressing the immune response. Using neutralizing
antibodies that inhibit molecules having immune stimulatory
activity would be beneficial in the treatment of immune-mediated
and inflammatory diseases. Molecules which inhibit the immune
response can be utilized (proteins directly or via the use of
antibody agonists) to inhibit the immune response and thus
ameliorate immune related disease.
The following test was performed:
[0383] Serum Immunoglobulin Isotyping Assay: The Serum
Immunoglobulin Isotyping Assay was performed using a Cytometric
Bead Array (CBA) kit. This assay was used to rapidly identify the
heavy and light chains isotypes of a mouse monoclonal antibody in a
single sample. The values expressed are "relative fluorescence
units" and are based on the detection of kappa light chains. Any
value <6 is not significant.
[0384] Results: The serum immunoglobulin isotyping assay revealed
that mutant (-/-) mice exhibited an elevation of IgM serum
immunoglobulins compared to their gender-matched (+/+) littermates.
IgM immunoglobulins are the first to be produced in a humoral
immune response for neutralization of bacterial toxins and are
particularly important in activating the complement system.
Likewise, IgG immunoglobulins have neutralization effects and to a
lesser extent are important for activation for the complement
system. In addition, the (-/-) mice exhibited an increased mean
absolute neutrophil count when compared with their (+/+)
littermates and the historical mean. The observed phenotype
suggests that ANGPTL4 is a negative regulator of inflammatory
responses. These immunological abnormalities suggest that
inhibitors (antagonists) of ANGPTL4 may be important agents which
could stimulate the immune system (such as T cell proliferation)
and would find utility in the cases where this effect would be
beneficial to the individual such as in the case of leukemia, and
other types of cancer, and in immunocompromised patients, such as
AIDS sufferers. Accordingly, ANGPTL4 or agonists thereof may play a
role in inhibiting the immune response and would be useful
candidates for suppressing harmful immune responses, e.g., in the
case of graft rejection or graft-versus-host diseases.
Example 8
Preparation of Antibodies that Bind to Angptl4
[0385] Techniques for producing the polyclonal antibodies and
monoclonal antibodies are known in the art and are described
herein. Antigens (or immunogens) that may be employed include
purified protein of the invention, protein fragments, fusion
proteins containing such protein, and cells expressing recombinant
protein and/or protein fragments on the cell surface. Selection of
the antigen can be made by the skilled artisan without undue
experimentation.
[0386] Mice, such as Balb/c, are immunized with the antigen
emulsified in complete Freund's adjuvant and injected
subcutaneously or intraperitoneally in an amount from 1-100
micrograms. Alternatively, the antigen is emulsified in MPL-TDM
adjuvant (Ribi Immunochemical Research, Hamilton, Mont.) and
injected into the animal's hind food pads. The immunized mice are
then boosted 10 to 12 days later with additional antigen emulsified
in the selected adjuvant. Thereafter, for several weeks, the mice
might also be boosted with additional immunization injections.
Serum samples may be periodically obtained from the mice by
retro-orbital bleeding for testing ELISA assays to detect the
antibodies.
[0387] After a suitable antibody titer has been detected, the
animals "positive" for antibodies can be injected with a final
intravenous injection of the given ligand. Three to four days
later, the mice are sacrificed and the spleen cells are harvested.
The spleen cells are then fused (using 35% polyethylene glycol) to
a selected murine myeloma cell line such as P3X63AgU.1, available
from ATCC, No. CRL 1597. The fusions generate hybridoma cells which
can then be plated in 96 well tissue culture plates containing HAT
(hypoxanthine, aminopterin, and thymidine) medium to inhibit
proliferation of non-fused cells, myeloma hybrids, and spleen cell
hybrids.
[0388] The hybridoma cells will be screened in an ELISA for
reactivity against the antigen. Determination of "positive"
hybridoma cells secreting the desired monoclonal antibodies against
ANGPTL4 herein is well within the skill in the art.
[0389] The positive hybridoma cells can be injected intraperitoneal
into syngeneic Balb/c mice to produce ascites containing the
anti-ANGPTL4 monoclonal antibodies. Alternatively, the hybridoma
cells can be grown in tissue culture flasks or roller bottles.
Purification of the monoclonal antibodies produced in the ascites
can be accomplished using ammonium sulfate precipitation, followed
by gel exclusion chromatography. Alternatively, affinity
chromatography based upon binding of antibody to protein A or
protein G can be employed.
[0390] For example, polyclonal rabbit antibodies were generated by
immunization of rabbit with 500 .mu.g of recombinant human ANGPTL4
protein (23-406) generated in E. Coli on days 1, 40 and 70. Serum
was harvested in day 80 and 120 post immunization and antibodies
were purifed by protein-A sephadex columns.
Example 9
Blocking or Neutralizing Antibodies
[0391] Antibodies against the antigens described herein, e.g.,
ANGPTL4, can be identified by a variety of techniques known in the
art, e.g., an ELISA. For example, plates can be coated with the
polypeptide of interest, e.g., ANGPTL4 or a fragment thereof, and
incubated with antibodies generated against that polypeptide, e.g.,
ANGPTL4 (see, e.g., description in U.S. Pat. Nos. 6,348,350,
6,372,491 and 6,455,496). Bound antibody can be detected by various
methods.
[0392] Antagonist (e.g., blocking or neutralizing) antibodies can
be identified by competition assays and/or activity assays. For
example, expression of ANGPTL4 stimulates cell hepatocyte or
pre-adipocyte proliferation, adipocyte migration, regulates
triglyceride amounts, or binds to .alpha..sub.V.beta..sub.5
integrin. Determination of a blocking or neutralizing antibody to
ANGPTL4 can be shown by the ability of the antibody to block these
activities, e.g., (see, e.g., FIG. 9, Panel B, D and E). For
example, hepatocytes or pre-adipocytes cells can be plated and
incubated with supernatant from COS7 cells transduced with
Ad-hAngptl4 along with an anti-ANGPTL4 antibody, or a control
antibody or PBS. After several days, the cells can be trypsinized
and counted. Antibodies that reduce the numbers of cells are
identified as blocking or neutralizing antibodies. ANGPTL4 was also
shown to induce hepatocyte adhesion and pre-adipocyte migration,
thus determination of a blocking or neutralizing antibody to
ANGPTL4 can be shown by the ability of the antibody to block the
hepatocyte adhesion and/or pre-adipocyte cell migration. ANGPTL4
was also shown to be a proangiogenic factor. See, e.g., Le Jan et
al., American Journal of Pathology, 164(5): 1521-1528 (2003). Thus,
blocking or neutralizing antibodies to ANGPTL4 can be identified by
using the antibodies in combination with ANGPTL4 in angiogenesis
assays, e.g., CAM assay.
[0393] The specification is considered to be sufficient to enable
one skilled in the art to practice the invention. It is understood
that the examples and embodiments described herein are for
illustrative purposes only. The invention is not to be limited in
scope by the construct deposited, since the deposited embodiment is
intended as a single illustration of certain aspects of the
invention and any constructs that are functionally equivalent are
within the scope of the invention. The deposit of material herein
does not constitute an admission that the written description is
inadequate to enable the practice of any aspect of the invention,
including the best more thereof, nor is it to be construed as
limiting the scope of the claims to the specific illustrations that
it represents. Indeed, various modifications of the invention in
addition to those shown and described herein will become apparent
to those skilled in the art from the foregoing description and fall
within the scope of the appended claims. All publications, patents,
and patent applications cited herein are hereby incorporated by
reference in their entirety for all purposes.
Sequence CWU 1
1
5 1 1869 DNA Homo sapiens 1 gccgagctga gcggatcctc acatgactgt
gatccgattc tttccagcgg 50 cttctgcaac caagcgggtc ttacccccgg
tcctccgcgt ctccagtcct 100 cgcacctgga accccaacgt ccccgagagt
ccccgaatcc ccgctcccag 150 gctacctaag aggatgagcg gtgctccgac
ggccggggca gccctgatgc 200 tctgcgccgc caccgccgtg ctactgagcg
ctcagggcgg acccgtgcag 250 tccaagtcgc cgcgctttgc gtcctgggac
gagatgaatg tcctggcgca 300 cggactcctg cagctcggcc aggggctgcg
cgaacacgcg gagcgcaccc 350 gcagtcagct gagcgcgctg gagcggcgcc
tgagcgcgtg cgggtccgcc 400 tgtcagggaa ccgaggggtc caccgacctc
ccgttagccc ctgagagccg 450 ggtggaccct gaggtccttc acagcctgca
gacacaactc aaggctcaga 500 acagcaggat ccagcaactc ttccacaagg
tggcccagca gcagcggcac 550 ctggagaagc agcacctgcg aattcagcat
ctgcaaagcc agtttggcct 600 cctggaccac aagcacctag accatgaggt
ggccaagcct gcccgaagaa 650 agaggctgcc cgagatggcc cagccagttg
acccggctca caatgtcagc 700 cgcctgcacc ggctgcccag ggattgccag
gagctgttcc aggttgggga 750 gaggcagagt ggactatttg aaatccagcc
tcaggggtct ccgccatttt 800 tggtgaactg caagatgacc tcagatggag
gctggacagt aattcagagg 850 cgccacgatg gctcagtgga cttcaaccgg
ccctgggaag cctacaaggc 900 ggggtttggg gatccccacg gcgagttctg
gctgggtctg gagaaggtgc 950 atagcatcac gggggaccgc aacagccgcc
tggccgtgca gctgcgggac 1000 tgggatggca acgccgagtt gctgcagttc
tccgtgcacc tgggtggcga 1050 ggacacggcc tatagcctgc agctcactgc
acccgtggcc ggccagctgg 1100 gcgccaccac cgtcccaccc agcggcctct
ccgtaccctt ctccacttgg 1150 gaccaggatc acgacctccg cagggacaag
aactgcgcca agagcctctc 1200 tggaggctgg tggtttggca cctgcagcca
ttccaacctc aacggccagt 1250 acttccgctc catcccacag cagcggcaga
agcttaagaa gggaatcttc 1300 tggaagacct ggcggggccg ctactacccg
ctgcaggcca ccaccatgtt 1350 gatccagccc atggcagcag aggcagcctc
ctagcgtcct ggctgggcct 1400 ggtcccaggc ccacgaaaga cggtgactct
tggctctgcc cgaggatgtg 1450 gccgttccct gcctgggcag gggctccaag
gaggggccat ctggaaactt 1500 gtggacagag aagaagacca cgactggaga
agcccccttt ctgagtgcag 1550 gggggctgca tgcgttgcct cctgagatcg
aggctgcagg atatgctcag 1600 actctagagg cgtggaccaa ggggcatgga
gcttcactcc ttgctggcca 1650 gggagttggg gactcagagg gaccacttgg
ggccagccag actggcctca 1700 atggcggact cagtcacatt gactgacggg
gaccagggct tgtgtgggtc 1750 gagagcgccc tcatggtgct ggtgctgttg
tgtgtaggtc ccctggggac 1800 acaagcaggc gccaatggta tctgggcgga
gctcacagag ttcttggaat 1850 aaaagcaacc tcagaacac 1869 2 406 PRT Homo
sapiens Unsure 221 Unknown amino acid 2 Met Ser Gly Ala Pro Thr Ala
Gly Ala Ala Leu Met Leu Cys Ala 1 5 10 15 Ala Thr Ala Val Leu Leu
Ser Ala Gln Gly Gly Pro Val Gln Ser 20 25 30 Lys Ser Pro Arg Phe
Ala Ser Trp Asp Glu Met Asn Val Leu Ala 35 40 45 His Gly Leu Leu
Gln Leu Gly Gln Gly Leu Arg Glu His Ala Glu 50 55 60 Arg Thr Arg
Ser Gln Leu Ser Ala Leu Glu Arg Arg Leu Ser Ala 65 70 75 Cys Gly
Ser Ala Cys Gln Gly Thr Glu Gly Ser Thr Asp Leu Pro 80 85 90 Leu
Ala Pro Glu Ser Arg Val Asp Pro Glu Val Leu His Ser Leu 95 100 105
Gln Thr Gln Leu Lys Ala Gln Asn Ser Arg Ile Gln Gln Leu Phe 110 115
120 His Lys Val Ala Gln Gln Gln Arg His Leu Glu Lys Gln His Leu 125
130 135 Arg Ile Gln His Leu Gln Ser Gln Phe Gly Leu Leu Asp His Lys
140 145 150 His Leu Asp His Glu Val Ala Lys Pro Ala Arg Arg Lys Arg
Leu 155 160 165 Pro Glu Met Ala Gln Pro Val Asp Pro Ala His Asn Val
Ser Arg 170 175 180 Leu His Arg Leu Pro Arg Asp Cys Gln Glu Leu Phe
Gln Val Gly 185 190 195 Glu Arg Gln Ser Gly Leu Phe Glu Ile Gln Pro
Gln Gly Ser Pro 200 205 210 Pro Phe Leu Val Asn Cys Lys Met Thr Ser
Xaa Gly Gly Trp Thr 215 220 225 Val Ile Gln Arg Arg His Asp Gly Ser
Val Asp Phe Asn Arg Pro 230 235 240 Trp Glu Ala Tyr Lys Ala Gly Phe
Gly Asp Pro His Gly Glu Phe 245 250 255 Trp Leu Gly Leu Glu Lys Val
His Ser Ile Thr Gly Asp Arg Asn 260 265 270 Ser Arg Leu Ala Val Gln
Leu Arg Asp Trp Asp Gly Asn Ala Glu 275 280 285 Leu Leu Gln Phe Ser
Val His Leu Gly Gly Glu Asp Thr Ala Tyr 290 295 300 Ser Leu Gln Leu
Thr Ala Pro Val Ala Gly Gln Leu Gly Ala Thr 305 310 315 Thr Val Pro
Pro Ser Gly Leu Ser Val Pro Phe Ser Thr Trp Asp 320 325 330 Gln Asp
His Asp Leu Arg Arg Asp Lys Asn Cys Ala Lys Ser Leu 335 340 345 Ser
Gly Gly Trp Trp Phe Gly Thr Cys Ser His Ser Asn Leu Asn 350 355 360
Gly Gln Tyr Phe Arg Ser Ile Pro Gln Gln Arg Gln Lys Leu Lys 365 370
375 Lys Gly Ile Phe Trp Lys Thr Trp Arg Gly Arg Tyr Tyr Pro Leu 380
385 390 Gln Ala Thr Thr Met Leu Ile Gln Pro Met Ala Ala Glu Ala Ala
395 400 405 Ser 3 21 DNA Homo sapiens 3 gtggccaagc ctgcccgaag a 21
4 21 RNA Artificial sequence Sequence is synthesized 4 ggccaagccu
gcccgaagau u 21 5 21 RNA Artificial sequence Sequence is
synthesized 5 ucuucgggca ggcuuggcca c 21
* * * * *