U.S. patent application number 11/595919 was filed with the patent office on 2007-03-08 for oligonucleotide mediated nucleic acid recombination.
This patent application is currently assigned to Maxygen, Inc.. Invention is credited to Steven H. Bass, Andreas Crameri, Claes Gustafsson, Jeremy Minshull, Jon E. Ness, Phillip A. Patten, Willem P.C. Stemmer, Mark Welch.
Application Number | 20070054313 11/595919 |
Document ID | / |
Family ID | 46325329 |
Filed Date | 2007-03-08 |
United States Patent
Application |
20070054313 |
Kind Code |
A1 |
Crameri; Andreas ; et
al. |
March 8, 2007 |
Oligonucleotide mediated nucleic acid recombination
Abstract
Methods of recombining nucleic acids, including homologous
nucleic acids, are provided. Families of gene shuffling
oligonucleotides and their use in recombination procedures, as well
as polymerase and ligase mediated recombination methods are also
provided.
Inventors: |
Crameri; Andreas; (Reinach,
CH) ; Stemmer; Willem P.C.; (Los Gatos, CA) ;
Minshull; Jeremy; (Menlo Park, CA) ; Bass; Steven
H.; (Hillsborough, CA) ; Welch; Mark;
(Fremont, CA) ; Ness; Jon E.; (Sunnyvale, CA)
; Gustafsson; Claes; (Belmont, CA) ; Patten;
Phillip A.; (Mountain View, CA) |
Correspondence
Address: |
BINGHAM, MCCUTCHEN LLP
THREE EMBARCADERO CENTER
18 FLOOR
SAN FRANCISCO
CA
94111-4067
US
|
Assignee: |
Maxygen, Inc.
Redwood City
CA
|
Family ID: |
46325329 |
Appl. No.: |
11/595919 |
Filed: |
November 13, 2006 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
11203602 |
Aug 15, 2005 |
|
|
|
11595919 |
Nov 13, 2006 |
|
|
|
10196473 |
Jul 15, 2002 |
|
|
|
11203602 |
Aug 15, 2005 |
|
|
|
09721601 |
Nov 21, 2000 |
|
|
|
10196473 |
Jul 15, 2002 |
|
|
|
09484850 |
Jan 18, 2000 |
6368861 |
|
|
09721601 |
Nov 21, 2000 |
|
|
|
09494282 |
Jan 18, 2000 |
6917882 |
|
|
09484850 |
Jan 18, 2000 |
|
|
|
09416375 |
Oct 12, 1999 |
|
|
|
09494282 |
Jan 18, 2000 |
|
|
|
09408392 |
Sep 28, 1999 |
6376246 |
|
|
09416375 |
Oct 12, 1999 |
|
|
|
60141049 |
Jun 24, 1999 |
|
|
|
60118813 |
Feb 5, 1999 |
|
|
|
60118854 |
Feb 5, 1999 |
|
|
|
60116447 |
Jan 19, 1999 |
|
|
|
Current U.S.
Class: |
435/6.16 ;
435/325; 435/455; 435/69.1; 435/91.2; 530/350 |
Current CPC
Class: |
C12P 21/06 20130101 |
Class at
Publication: |
435/006 ;
435/069.1; 435/455; 435/325; 435/091.2; 530/350 |
International
Class: |
C12Q 1/68 20060101
C12Q001/68; C12P 21/06 20060101 C12P021/06; C12P 19/34 20060101
C12P019/34 |
Claims
1-104. (canceled)
105. A method of producing a library of chimeric nucleic acid
molecules encoding full-length chimeric proteins, said method
comprising: (a) synthesizing a plurality of ligatable synthetic
oligonucleotides corresponding to parental nucleic acid sequences
encoding full-length proteins; and (b) assembling the
oligonucleotides in order by ligation to produce the library of
chimeric nucleic acid molecules encoding the full-length chimeric
proteins.
Description
CROSS REFERENCE TO RELATED APPLICATIONS
[0001] This application is a continuation-in-part of
"OLIGONUCLEOTIDE MEDIATED NUCLEIC ACID RECOMBINATION" by Crameri et
al., U.S. Ser. No. 09/408,392, filed Sep. 28, 1999, which is a
non-provisional of "OLIGONUCLEOTIDE MEDIATED NUCLEIC ACID
RECOMBINATION" by Crameri et al., U.S. Ser. No. 60/118,813, filed
Feb. 5, 1999 and which is also a non-provisional of
"OLIGONUCLEOTIDE MEDIATED NUCLEIC ACID RECOMBINATION" by Crameri et
al., U.S. Ser. No. 60/141,049, filed Jun. 24, 1999.
[0002] This application is also a continuation-in-part of "METHODS
FOR MAKING CHARACTER STRINGS, POLYNUCLEOTIDES AND POLYPEPTIDES
HAVING DESIRED CHARACTERISTICS" by Selifonov et al., attorney
docket number 02-289-3US, filed herewith, which is a
continuation-in-part of "METHODS FOR MAKING CHARACTER STRINGS,
POLYNUCLEOTIDES AND POLYPEPTIDES HAVING DESIRED CHARACTERISTICS" by
Selifonov et al., U.S. Ser. No. 09/416,375, filed Oct. 12, 1999,
which is a non provisional of "METHODS FOR MAKING CHARACTER
STRINGS, POLYNUCLEOTIDES AND POLYPEPTIDES HAVING DESIRED
CHARACTERISTICS" by Selifonov and Stemmer, U.S. Ser. No.
60/116,447, filed Jan. 19, 1999 and which is also a non-provisional
of "METHODS FOR MAKING CHARACTER STRINGS, POLYNUCLEOTIDES AND
POLYPEPTIDES HAVING DESIRED CHARACTERISTICS" by Selifonov and
Stemmer, U.S. Ser. No. 60/118,854, filed Feb. 5, 1999.
[0003] This application is also a continuation-in-part of co-filed
application "METHODS OF POPULATING DATA STRUCTURES FOR USE IN
EVOLUTIONARY SIMULATIONS" by Selifonov and Stemmer, Attorney Docket
Number 3271.002WO0 (filed by Majestic, Parsons, Siebert & Hsue)
which is a continuation-in-part of "METHODS OF POPULATING DATA
STRUCTURES FOR USE IN EVOLUTIONARY SIMULATIONS" by Selifonov and
Stemmer, U.S. Ser. No. 09/416,837, filed Oct. 12, 1999.
[0004] This application is also related to "USE OF CODON VARIED
OLIGONUCLEOTIDE SYNTHESIS FOR SYNTHETIC SHUFFLING" by Welch et al.,
U.S. Ser. No. 09/408,393, filed Sep. 28, 1999.
[0005] The present application claims priority to and benefit of
each of the applications listed in this section, as provided for
under 35 U.S.C. .sctn.119(e) and/or 35 U.S.C. .sctn.120, as
appropriate.
COPYRIGHT NOTIFICATION
[0006] Pursuant to 37 C.F.R. 1.71(e), Applicants note that a
portion of this disclosure contains material which is subject to
copyright protection. The copyright owner has no objection to the
facsimile reproduction by anyone of the patent document or patent
disclosure, as it appears in the Patent and Trademark Office patent
file or records, but otherwise reserves all copyright rights
whatsoever.
BACKGROUND OF THE INVENTION
[0007] DNA shuffling has provided a paradigm shift in recombinant
nucleic acid generation, manipulation and selection. The inventors
and their co-workers have developed fast artificial evolution
methodologies for generating improved industrial, agricultural, and
therapeutic genes and encoded proteins. These methods, and related
compositions and apparatus for practicing these methods represent a
pioneering body of work by the inventors and their co-workers.
[0008] A number of publications by the inventors and their
co-workers describe DNA shuffling. For example, Stemmer et al.
(1994) "Rapid Evolution of a Protein" Nature 370:389-391; Stemmer
(1994) "DNA Shuffling by Random Fragmentation and Reassembly: in
vitro Recombination for Molecular Evolution," Proc. Natl. Acad. USA
91: 10747-10751; Stemmer U.S. Pat. No. 5,603,793 METHODS FOR IN
VITRO RECOMBINATION; Stemmer et al. U.S. Pat. No. 5,830,721 DNA
MUTAGENESIS BY RANDOM FRAGMENTATION AND REASSEMBLY; Stemmer et al.,
U.S. Pat. No. 5,811,238 METHODS FOR GENERATING POLYNUCLEOTIDES
HAVING DESIRED CHARACTERISTICS BY ITERATIVE SELECTION AND
RECOMBINATION describe, e.g., in vitro and in vivo nucleic acid,
DNA and protein shuffling in a variety of formats, e.g., by
repeated cycles of mutagenesis, shuffling and selection, as well as
methods of generating libraries of displayed peptides and
antibodies.
[0009] Applications of DNA shuffling technology have also been
developed by the inventors and their co-workers. In addition to the
publications noted above, Minshull et al., U.S. Pat. No. 5,837,458
METHODS AND COMPOSITIONS FOR CELLULAR AND METABOLIC ENGINEERING
provides, e.g., for the evolution of metabolic pathways and the
enhancement of bioprocessing through recursive shuffling
techniques. Crameri et al. (1996), "Construction And Evolution Of
Antibody-Phage Libraries By DNA Shuffling" Nature Medicine 2(1):
100-103 describe, e.g., antibody shuffling for antibody phage
libraries. Additional details regarding DNA Shuffling can be found
in WO95/22625, WO97/20078, WO96/33207, WO97/33957, WO98/27230,
WO97/35966, WO98/31837, WO98/13487, WO98/13485 and WO989/42832, as
well as a number of other publications by the inventors and their
co-workers.
[0010] A number of the publications of the inventors and their
co-workers, as well as other investigators in the art also describe
techniques which facilitate DNA shuffling, e.g., by providing for
reassembly of genes from small fragments, or even oligonucleotides.
For example, in addition to the publications noted above, Stemmer
et al. (1998) U.S. Pat. No. 5,834,252 END COMPLEMENTARY POLYMERASE
REACTION describe processes for amplifying and detecting a target
sequence (e.g., in a mixture of nucleic acids), as well as for
assembling large polynucleotides from nucleic acid fragments.
[0011] Review of the foregoing publications reveals that forced
evolution by gene shuffling is an important new technique with many
practical and powerful applications. Thus, new techniques which
facilitate gene shuffling are highly desirable. The present
invention provides significant new gene shuffling protocols, as
well as many other features which will be apparent upon complete
review of this disclosure.
SUMMARY OF THE INVENTION
[0012] The invention provides oligonucleotide assisted shuffling of
nucleic acids. These oligonucleotide assisted approaches
particularly facilitate family shuftling procedures, providing
substantially simplified shuffling protocols which can be used to
produce family shuffled nucleic acids without isolating or cloning
full-length homologous nucleic acids. Furthermore, the
oligonucleotide assisted approaches herein can even be extended to
shuffling non-homologous nucleic acids, thereby accessing greater
sequence space in resulting recombinant molecules and, thus,
greater molecular diversity. The techniques can -also be combined
with classical DNA shuffling protocols, such as DNAse-mediated
methods, or with other diversity generation procedures such as
classical mutagenesis, to increase the versatility and throughput
of these methods.
[0013] Several methods which are applicable to family shuffling
procedures are provided. In one aspect of these methods, sets of
overlapping family gene shuffling oligonucleotides are hybridized
and elongated, providing a population of recombined nucleic acids,
which can be selected for a desired trait or property. Typically,
the set of overlapping family shuffling gene oligonucleotides
include a plurality of oligonucleotide member types which have
consensus region subsequences derived from a plurality of
homologous target nucleic acids. The oligo sets optionally provide
other distinguishing features, including cross-over capability,
codon-variation or selection, and the like.
[0014] The population of recombined nucleic acids can be denatured
and reannealed, providing denatured recombined nucleic acids which
can then be reannealed. The resulting recombinant nucleic acids can
also be selected. Any or all of these steps can be repeated
reiteratively, providing for multiple recombination and selection
events to produce a nucleic acid with a desired trait or
property.
[0015] In a related aspect, methods for introducing nucleic acid
family diversity during nucleic acid recombination are performed by
providing a composition having at least one set of fragmented
nucleic acids which includes a population of family gene shuffling
oligonucleotides and recombining at least one of the fragmented
nucleic acids with at least one of the family gene shuffling
oligonucleotides. A recombinant nucleic acid having a nucleic acid
subsequence corresponding to the at least one family gene shuffling
oligonucleotide is then regenerated, typically to encode a
full-length molecule (e.g., a full-length protein).
[0016] Typically, family gene shuffling oligonucleotides are
provided by aligning homologous nucleic acid sequences to select
conserved regions of sequence identity and regions of sequence
diversity. A plurality of family gene shuffling oligonucleotides
are synthesized (serially or in parallel) which correspond to at
least one region of sequence diversity. In contrast, sets of
fragments are provided by cleaving one or more homologous nucleic
acids (e.g., with a DNase), or by synthesizing a set of
oligonucleotides corresponding to a plurality of regions of at
least one nucleic acid (typically oligonucleotides corresponding to
a fill-length nucleic acid are provided as members of a set of
nucleic acid fragments). In the shuffling procedures herein, these
cleavage fragments can be used in conjunction with family gene
shuffling oligonucleotides, e.g., in one or more recombination
reaction.
[0017] Recursive methods of oligonucleotide shuffling are provided.
As noted herein, recombinant nucleic acids generated synthetically
using oligonucleotides can be cleaved and shuffled by standard
nucleic acid shuffling methodologies, or the nucleic acids can be
sequenced and used to design a second set of family shuffling
oligonucleotides which are used to recombine the recombinant
nucleic acids. Either, or both, of these recursive techniques can
be used for subsequent rounds of recombination and can also be used
in conjunction with rounds of selection of recombinant products.
Selection steps can follow one or several rounds of recombination,
depending on the desired diversity of the recombinant nucleic acids
(the more rounds of recombination which are performed, the more
diverse the resulting population of recombinant nucleic acids).
[0018] The use of family gene shuffling oligonucleotides in
recombination reactions herein provides for domain switching of
domains of sequence identity or diversity between homologous
nucleic acids, e.g., where recombinants resulting from the
recombination reaction provide recombinant nucleic acids with a
sequence domain from a first nucleic acid embedded within a
sequence corresponding to a second nucleic acid, e.g., where the
region most similar to the embedded region from the second nucleic
acid is not present in the recombinant nucleic acid.
[0019] One particular advantage of the present invention is the
ability to recombine homologous nucleic acids with low sequence
similarity, or even to recombine non-homologous nucleic acids. In
these methods, one or more set of fragmented nucleic acids arc
recombined with a with a sct of crossover family diversity
oligonucleotides. Each of these crossover oligonucleotides have a
plurality of sequence diversity domains corresponding to a
plurality of sequence diversity domains from homologous or
non-homologous nucleic acids with low sequence similarity. The
fragmented oligonucleotides, which are derived from one or more
homologous or non-homologous nucleic acids can hybridize to one or
more region of the crossover oligos, facilitating
recombination.
[0020] Methods of family shuffling PCR amplicons using family
diversity oligonucleotide primers are also provided. In these
methods, a plurality of non-homogeneous homologous template nucleic
acids are provided. A plurality of PCR primers which hybridize to a
plurality of the plurality of non-homogeneous homologous template
nucleic acids are also provided. A plurality of PCR amplicons are
produced by PCR amplification of the plurality of template nucleic
acids with the plurality of PCR primers, which are then recombined.
Typically, sequences for the PCR primers are selected by aligning
sequences -for the plurality of non-homogeneous homologous template
nucleic acids and selecting PCR primers which correspond to regions
of sequence similarity.
[0021] A variety of compositions for practicing the above methods
and which result from practicing the above methods are also
provided. Compositions which include a library of oligonucleotides
having a plurality of oligonucleotide member types are one example.
The library can include at least about 2, 3, 5, 10, 20, 30, 40, 50,
100 or more different oligonucleotide members. The oligonucleotide
member types correspond to a plurality of subsequence regions of a
plurality of members of a selected set of a plurality of homologous
target sequences. The plurality of subsequence regions can include,
e.g., a plurality of overlapping or non-overlapping sequence
regions of the selected set of homologous target sequences. The
oligonucleotide member types typically each have a sequence
identical to at least one subsequence from at least one of the
selected set of homologous target sequences. Any of the
oligonucleotide types and sets described above, or elsewhere
herein, can be included in the compositions of the invention (e.g.,
family shuffling oligonucleotides, crossover oligonucleotides,
domain switching oligonucleotides, etc.). The oligonucleotide
member types can include a plurality of homologous oligonucleotides
corresponding to a homologous region from the plurality of
homologous target sequences. In this embodiment, each of the
plurality of homologous oligonucleotides have at least one variant
subsequence. Libraries of nucleic acids and encoded proteins which
result from practicing oligonucleotide-mediated recombination as
noted herein are also a feature of the invention.
[0022] Compositions optionally include components which facilitate
recombination reactions, e.g., a polymerase, such as a thermostable
DNA polymerase (e.g., taq, vent or any of the many other
commercially available polymerases) a recombinase, a nucleic acid
synthesis reagent, buffers, salts, magnesium, one or more nucleic
acid having one or more of the plurality of members of the selected
set of homologous target sequences, and the like.
[0023] Kits comprising the compositions of the invention, e.g., in
containers, or other packaging materials, e.g., with instructional
materials for practicing the methods of the invention are also
provided. Uses for the compositions and kits herein for practicing
the methods are also provided.
BRIEF DESCRIPTION OF THE FIGURES
[0024] FIG. 1 is a schematic showing oligonucleotide-directed in
vivo shuffling using chimeraplasts.
[0025] FIG. 2 is a schematic of a low-homology shuffling procedure
to provide for synthetic gene blending.
[0026] FIG. 3 is a schematic of a modular exon deletion/insertion
library.
DEFINITIONS
[0027] Unless otherwise indicated, the following definitions
supplement those in the art.
[0028] Nucleic acids are "homologous" when they are derived,
naturally or artificially, from a common ancestor sequence. During
natural evolution, this occurs when two or more descendent
sequences diverge from a parent sequence over time, i.e., due to
mutation and natural selection. Under artificial conditions,
divergence occurs, e.g., in one of two basic ways. First, a given
sequence can be artificially recombined with another sequence, as
occurs, e.g., during typical cloning, to produce a descendent
nucleic acid, or a given sequence can be chemically modified, or
otherwise manipulated to modify the resulting molecule.
Alternatively, a nucleic acid can be synthesized de novo, by
synthesizing a nucleic acid which varies in sequence from a
selected parental nucleic acid sequence. When there is no explicit
knowledge about the ancestry of two nucleic acids, homology is
typically inferred by sequence comparison between two sequences.
Where two nucleic acid sequences show sequence similarity over a
significant portion of each of the nucleic acids, it is inferred
that the two nucleic acids share a common ancestor. The precise
level of sequence similarity which establishes homology varies in
the art depending on a variety of factors. For purposes of the
present invention, cladistic intermediates (proposed sequences
which share features of two or more related nucleic acids) are
homologous nucleic acids.
[0029] For purposes of this disclosure, two nucleic acids are
considered homologous where they share sufficient sequence identity
to allow direct recombination to occur between the two nucleic acid
molecules. Typically, nucleic acids utilize regions of close
similarity spaced roughly the same distance apart to permit
recombination to occur. The recombination can be in vitro or in
vivo.
[0030] It should be appreciated, however, that one advantage of
certain features of the invention is the ability to recombine more
distantly related nucleic acids than standard recombination
techniques permit. In particular, sequences from two nucleic acids
which are distantly related, or even not detectably related can be
recombined using cross-over oligonucleotides which have
subsequences from two or more different non-homologous target
nucleic acids, or two or more distantly related nucleic acids.
However, where the two nucleic acids can only be indirectly
recombined using oligonucleotide intermediates as set forth herein,
they are considered to be "non-homologous" for purposes of this
disclosure.
[0031] A "set" as used herein refers to a collection of at least
two molecules types, and typically includes at least about, e.g.,
5, 10, 50, 100, 500, 1,000 or more members, depending on the
precise intended use of the set.
[0032] A set of "family gene shuffling oligonucleotides" is a set
of synthesized oligonucleotides derived from a selected set of
homologous nucleic acids. The oligonucleotides are derived from a
selected set of homologous nucleic acids when they (individually or
collectively) have regions of sequence identity (and, optionally,
regions of sequence diversity) with more than one of the homologous
nucleic acids. Collectively, the oligonucleotides typically
correspond to a substantial portion of the full length of the
homologous nucleic acids of the set of homologous nucleic acids,
e.g., the oligonucleotides correspond over a substantial portion of
the length of the homologous nucleic acids (e.g., the
oligonucleotides of the set collectively correspond to e.g., 25% or
more, often 35% or more, generally 50% or more, typically 60% or
more, more typically 70% or more, and in some applications, 80%,
90% or 100% of the full-length of each of the homologous nucleic
acids). Most commonly, the family gene shuffling oligonucleotides
include multiple member types, each having regions of sequence
identity to at least one member of the selected set of homologous
nucleic acids (e.g., about 2, 3, 5, 10, 50 or more member
types).
[0033] A "cross-over" oligonucleotide has regions of sequence
identity to at least two different members of a selected set of
nucleic acids, which are optionally homologous or
non-homologous.
[0034] Nucleic acids "hybridize" when they associate, typically in
solution. Nucleic acids hybridize due to a variety of well
characterized physico-chemical forces, such as hydrogen bonding,
solvent exclusion, base stacking and the like. An extensive guide
to the hybridization of nucleic acids is found in Tijssen (1993)
Laboratory Techniques in Biochemistry and Molecular
Biology--Hybridization with Nucleic Acid Probes part I chapter 2
"Overview of principles of hybridization and the strategy of
nucleic acid probe assays," Elsevier, N.Y., as well as in Ausubel,
supra.
[0035] Two nucleic acids "correspond" when they have the same or
complementary sequences, or when one nucleic acid is a subsequence
of the other, or when one sequence is derived, by natural or
artificial manipulation, from the other.
[0036] Nucleic acids are "elongated" when additional nucleotides
(or other analogous molecules) are incorporated into the nucleic
acid. Most commonly, this is performed with a polynerase (e.g., a
DNA polymerase), e.g., a polymerase which adds sequences at the 3'
terminus of the nucleic acid.
[0037] Two nucleic acids are "recombined" when sequences from each
of the two nucleic acids are combined in a progeny nucleic acid.
Two sequences are "directly" recombined when both of the nucleic
acids are substrates for recombination. Two sequences are
"indirectly recombined" when the sequences are recombined using an
intermediate such as a cross-over oligonucleotide. For indirect
recombination, no more than one of the sequences is an actual
substrate for recombination, and in some cases, neither sequence is
a substrate for recombination (i.e., when one or more
oligonucleotide(s) corresponding to the nucleic acids are
hybridized and elongated).
[0038] A collection of "fragmented nucleic acids" is a collection
of nucleic acids derived by cleaving one or more parental nucleic
acids (e.g., with a nuclease, or via chemical cleavage), or by
producing subsequences of the parental sequences in any other
manner, such as partial chain elongation of a complementary nucleic
acid.
[0039] A "full-length protein" is a protein having substantially
the same sequence domains as a corresponding protein encoded by a
natural gene. The protein can have modified sequences relative to
the corresponding naturally encoded gene (e.g., due to
recombination and selection), but is at least 95% as long as the
naturally encoded gene.
[0040] A "DNase enzyme" is an enzyme such as DNAse I which
catalyzes cleavage of a DNA, in vitro or in vivo. A wide variety of
DNase enzymes are well known and described, e.g., in Sambrook,
Berger and Ausubel (all supra) and many are commercially
available.
[0041] A "nucleic acid domain" is a nucleic acid region or
subsequence. The domain can be conserved or not conserved between a
plurality of homologous nicleic acids. Typically, a domain is
delineated by comparison between two or more sequences, i.e., a
region of sequence diversity between sequences is a "sequence
diversity domain," while a region of similarity is a "sequence
similarity domain." Domain switching" refers to the ability to
switch one nucleic acid region from one nucleic acid with a second
domain from a second nucleic acid.
[0042] A region of "high sequence similarity" refers to a region
that is 90% or more identical-to a second selected region when
aligned for maximal correspondence (e.g., manually or using the
common program BLAST set to default parameters). A region of "low
sequence similarity" is 60% or less identical, more preferably, 40%
or less identical to a second selected region, when aligned for
maximal correspondence (e.g., manually or using BLAST set with
default parameters).
[0043] A "PCR amplicon" is a nucleic acid made using the polymerasc
chain reaction (PCR). Typically, the nucleic acid is a copy of a
selected nucleic acid. A "PCR primer" is a-nucleic acid which
hybridizes to a template nucleic acid and permits chain elongation
using a thermostable polymerase under appropriate reaction
conditions.
[0044] A "library of oligonucleotides" is a set of
oligonucleotides. The set can be pooled, or can be individually
accessible. Oligonucleotides can be DNA, RNA or combinations of RNA
and DNA (e.g., chimeraplasts).
DETAILED DISCUSSION OF THE INVENTION
[0045] The present invention relates to improved formats for
nucleic acid shuffling. In particular, by using selected
oligonucleotide sets as substrates for recombination and/or gene
synthesis, it is possible to dramatically speed the shuffling
process. Moreover, it is possible to use oligonucleotide
intermediates to indirectly recombine nucleic acids which could not
otherwise be recombined. Direct access to physical nucleic acids
corresponding to sequences to be combined is not necessary, as the
sequences can be recombined indirectly through oligonucleotide
internediates.
[0046] In brief, a family of homologous nucleic acid sequences are
first aligned, e.g. using available computer software to select
regions of identity/similarity and regions of diversity. A
plurality (e.g., 2, 5, 10, 20, 50, 75, or 100 or more) of
oligonucleotides corresponding to at least one region of diversity
(and ordinarily at least one region of similarity) are synthesized.
These oligonucleotides can be shuffled directly, or can be
recombined with one or more of the family of nucleic acids.
[0047] This oligonucleotide-based recombination of related nucleic
acids can be combined with a number of available standard shuffling
methods. For example, there are several procedures now available
for shuffling homologous nucleic acids, such as by digesting the
nucleic acids with a DNase, permitting recombination to occur and
then regenerating full-length templates, e.g., as described in
Stemmer (1998) DNA MUTAGENESIS BY RANDOM FRAGMENTATION AND
REASSEMBLY U.S. Pat. No. 5,830,721. Thus, in one embodiment of the
invention, a full-length nucleic acid which is identical to, or
homologous with, at least one of the homologous nucleic acids is
provided, cleaved with a DNase, and the resulting set of nucleic
acid fragments are recombined with the plurality of family gene
shuffling oligonucleotides. This combination of methods can be
advantageous, because the DNase-cleavage fragments form a
"scaffold" which can be reconstituted into a full length
sequence--an advantage in the event that one or more synthesized
oligo in the synthesized set is defective.
[0048] However, one advantage of the present invention is the
ability to recombine several regions of diversity among homologous
nucleic acids, even without the homologous nucleic acids, or
cleaved fragments thereof, being present in the recombination
mixture. Resulting shuffled nucleic acids can include regions of
diversity from different nucleic acids, providing for the ability
to combine different diversity domains in a single nucleic acid.
This provides a very powerful method of accessing natural sequence
diversity.
[0049] In general, the methods herein provide for "oligonucleotide
mediated shuffling" in which oligonucleotides corresponding to a
family of related homologous nucleic acids which are recombined to
produce selectable nucleic acids. The technique can be used to
recombine homologous or even non-homologous nucleic acid sequences.
When recombining homologous nucleic acids, sets of overlapping
family gene shuffling oligonucleotides (which are derived, e.g., by
comparison of homologous nucleic acids and synthesis of
oligonucleotide fragments) are hybridized and elongated (e.g., by
reassembly PCR), providing a population of recombined nucleic
acids, which can be selected for a desired trait or property.
Typically, the set of overlapping family shuffling gene
oligonucleotides include a plurality of oligonucleotide member
types which have consensus region subsequences derived from a
plurality of homologous target nucleic acids.
[0050] Typically, family gene shuffling oligonucleotide are
provided by aligning homologous nucleic acid sequences to select
conserved regions of sequence identity and regions of sequence
diversity. A plurality of family gene shuffling oligonucleotides
are synthesized (serially or in parallel) which correspond to at
least one region of sequence diversity.
[0051] Sets of fragments, or subsets of fragments used in
oligonucleotide shuffling approaches can be partially provided by
cleaving one or more homologous nucleic acids (e.g., with a DNase),
as well as by synthesizing a set of oligonucleotides corresponding
to a plurality of regions of at least one nucleic acid (typically
oligonucleotides corresponding to a partial or full-length nucleic
acid are provided as members of the set of nucleic acid
"fragments," a term which encompasses both cleavage fragments and
synthesized oligonucleotides). In the shuffling procedures herein,
these cleavage fragments can be used in conjunction with family
gene shuffling oligonucleotides, e.g., in one or more recombination
reaction to produce recombinant nucleic acids.
[0052] The following provides details and examples regarding
sequence alignrnent, oligonucleotide construction and library
generation, shuffling procedures and other aspects of the present
invention.
Aligning Homologous Nucleic Acid Sequences to Select Conserved
Regions of Sequence Identity and Regions of Sequence Diversity
[0053] In one aspect, the invention provides for alignment of
nucleic acid sequences to determine regions of sequence identity or
similarity and regions of diversity. The set of overlapping family
shuffling gene oligonucleotides can comprise a plurality of
oligonucleotide member types which comprise consensus region
subsequences derived from a plurality of homologous target nucleic
acids. These consensus region subsequences are determined by
aligning homologous nucleic acids and identifying regions of
identity or similarity.
[0054] In one embodiment, homologous nucleic acid sequences are
aligned, and at least one conserved region of sequence identity and
a plurality of regions of sequence diversity are selected. The
plurality of regions of sequence diversity provide a plurality of
domains of sequence diversity. Typically, a plurality of family
gene shuffling oligonucleotides corresponding to the plurality of
domains of sequence diversity are synthesized and used in the
various recombination protocols noted herein or which are otherwise
available. Genes synthesized by these recombination methods are
optionally further screened or further diversified by any available
method, including recombination and/or mutagenesis.
Alignment of Homologous Nucleic Acids
[0055] Typically, the invention comprises first aligning identical
nucleic acids, or regions of nucleic acid similarity, e.g., for
sequences available from any of the publicly available or
proprietary nucleic acid databases. Public database/search services
include Genbank.RTM., Entrez.RTM., EMBL, DDBJ and those provided by
the NCBI. Many additional sequence databases are available on the
intemet or on a contract basis from a variety of companies
specializing in genomic information generation and/or storage.
[0056] The terms "identical" or percent "identity," in the context
of two or more nucleic acid or polypeptide sequences, refer to two
or more sequences or subsequences that are the same or have a
specified percentage of amino acid residues or nucleotides that are
the same, when compared and aligned for maximum correspondence, as
measured using one of the sequence comparison algorithms described
below (or other algorithms available to persons of skill) or by
visual inspection.
[0057] The phrase "substantially identical," in the context of two
nucleic acids or polypeptides refers to two or more sequences or
subsequences that have at least about 50%, preferably 80%, most
preferably 90-95% nucleotide or amino acid residue identity, when
compared and aligned for maximum correspondence, as measured using
one of the following sequence comparison algorithms or by visual
inspection. Such "substantially identical" sequences are typically
considered to be homologous.
[0058] For sequence comparison and homology determination,
typically one sequence acts as a reference sequence to which test
sequences are compared. When using a sequence comparison algorithm,
test and reference sequences are input into a computer, subsequence
coordinates are designated, if necessary, and sequence algorithm
program parameters are designated. The sequence comparison
algorithm then calculates the percent sequence identity for the
test sequence(s) relative to the reference sequence, based on the
designated program parameters.
[0059] Optimal alignment of sequences for comparison can be
conducted, e.g., by the local homology algorithm of Smith &
Waterman, Adv. Appl. Math. 2:482 (1981), by the 5 homology
alignment algorithm of Needleman & Wunsch, J. Mol. Biol. 48:443
(1970), by the search for similarity method of Pearson &
Lipman, Proc. Nat'l. Acad. Sci. USA 85:2444 (1988), by computerized
implementations of these algorithms (GAP, BESTFIT, FASTA, and
TFASTA in the Wisconsin Genetics Software Package, Genetics
Computer Group, 575 Science Dr., Madison, Wis.), or by visual
inspection (see generally, Ausubel et al., infra).
[0060] One example algorithm that is suitable for determining
percent sequence identity and sequence similarity is the BLAST
algorithm, which is described in Altschul et al., J Mol. Biol.
215:403-410 (1990). Software for performing BLAST analyses is
publicly available through the National Center for Biotechnology
Information (http://www.ncbi.nlm.nih.gov/). This algorithm involves
first identifying high scoring sequence pairs (HSPs) by identifying
short words of length W in the query sequence, which either match
or satisfy some positive-valued threshold score T when aligned with
a word of the same length in a database sequence. T is referred to
as the neighborhood word score threshold (Altschul et al., supra).
These initial neighborhood word hits act as seeds for initiating
searches to find longer HSPs containing them. The word hits are
then extended in both directions along each sequence for as far as
the cumulative alignment score can be increased. Cumulative scores
are calculated using, for nucleotide sequences, the parameters M
(reward score for a pair of matching residues; always>0) and N
(penalty score for mismatching residues; always<0). For amino
acid sequences, a scoring matrix is used to calculate the
cumulative score. Extension of the word hits in each direction are
halted when: the cumulative alignment score falls off by the
quantity X from its maximum achieved value; the cumulative score
goes to zero or below, due to the accumulation of one or more
negative-scoring residue alignments; or the end of either sequence
is reached. The BLAST algorithm parameters W, T, and X determine
the sensitivity and speed of the alignment. The BLASTN program (for
nucleotide sequences) uses as defaults a wordlength (W) of 11, an
expectation (E) of 10, a cutoff of 100, M=5, N=4, and a comparison
of both strands. For amino acid sequences, the BLASTP program uses
as defaults a wordlength (W) of 3, an expectation (E) of 10, and
the BLOSUM62 scoring matrix (see Henikoff & Henikoff (1989)
Proc. Natl. Acad. Sci. USA 89:10915).
[0061] In addition to calculating percent sequence identity, the
BLAST algorithm also performs a statistical analysis of the
similarity between two sequences (see, e.g., Karlin & Altschul
(1993) Proc. Natl'l . Acad. Sci. USA 90:5873-5787). One measure of
similarity provided by the BLAST algorithm is the smallest sum
probability (P(N)), which provides an indication of the probability
by which a match between two nucleotide or amino acid sequences
would occur by chance. For example, a nucleic acid is considered
similar to a reference sequence (and, therefore, likely homologous)
if the smallest sum probability in a comparison of the test nucleic
acid to the reference nucleic acid is less than about 0.1, more
preferably less than about 0.01, and most preferably less than
about 0.001. Other available sequence alignment programs include,
e.g., PILEUP.
[0062] A number of additional sequence alignment protocols can be
found, e.g., in "METHODS FOR MAKING CHARACTER STRINGS,
POLYNUCLEOTIDES AND POLYPEPTIDES HAVING DESIRED CHARACTERISTICS" by
Selifonov et al., attorney docket number 02-289-3US, filed
herewith.
Oligonucleotide Synthesis
[0063] In one aspect, the invention comprises synthesizing a
plurality of family gene shuffling oligonucleotides, e.g.,
corresponding to at least one region of sequence diversity.
Typically sets of family gene shuffling oligonucleotides are
produced, e.g., by sequential or parallel oligonucleotide synthesis
protocols.
[0064] Oligonucleotides, e.g., whether for use in in vitro
amplification/gene reconstruction/reassembly methods, or to provide
sets of family gene shuffling oligonucleotides, are typically
synthesized chemically according to the solid phase phosphoramidite
triester method described by Beaucage and Caruthers (1981),
Tetrahedron Letts., 22(20):1859-1862, e.g., using an automated
synthesizer, as described in Needham-VanDevanter et al. (1984)
Nucleic Acids Res., 12:6459-6168. A wide variety of equipment is
commercially available for automated oligonucleotide synthesis.
Multi-nucleotide synthesis approaches (e.g., tri-nucleotide
synthesis), as discussed, supra, are also useful.
[0065] Moreover, essentially any nucleic acid can be custom ordered
from any of a variety of commercial sources, such as The Midland
Certified Reagent Company (mcrc@oligos.com), The Great American
Gene Company (http://www.genco.com), ExpressGen Inc.
(www.expressgen.com), Operon Technologies Inc. (Alameda, Calif.)
and many others.
Synthetic Library Assembly
[0066] Libraries of family gene shuffling oligonucleotides are
provided. For example, homologous genes of interest are aligned
using a sequence alignment program such as BLAST, as described
above. Nucleotides corresponding to amino acid variations between
the homologs are noted. Oligos for synthetic gene shuffling are
designed which comprise one (or more) nucleotide difference to any
of the aligned homologous sequences, i.e., oligos are designed that
are identical to a first nucleic acid, but which incorporate a
residue at a position which corresponds to a residue of a nucleic
acids homologous, but not identical to the first nucleic acid.
[0067] Preferably, all of the oligonucleotides of a selected length
(e.g., about 20, 30, 40, 50, 60, 70, 80, 90, or 100 or more
nucleotides) which incorporate all possible nucleic acid variants
are made. This includes X oligonucleotides per X sequence
variations, where X is the number of different sequences at a
locus. The X oligonucleotides are largely identical in sequence,
except for the nucleotide(s) representing the variant
nucleotide(s). Because of this similarity, it can be advantageous
to utilize parallel or pooled synthesis strategies in which a
single synthesis reaction or set of reagents is used to make common
portions of each oligonucleotide. This can be performed e.g., by
well-known solid-phase nucleic acid synthesis techniques, or, e.g.,
utilizing array-based oligonucleotide synthetic methods (see e.g.,
Fodor et al. (1991) Science, 251: 767-777; Fodor (1997) "Genes,
Chips and the Human Genome" FASEB Journal. 11:121-121; Fodor (1997)
"Massively Parallel Genomics" Science. 277:393-395; and Chee et al.
(1996) "Accessing Genetic Information with High-Density DNA Arrays"
Science 274:610-614). Additional oligonucleotide synthetic
strategies are found, e.g., in "METHODS FOR MAKING CHARACTER
STRINGS, POLYNUCLEOTIDES AND POLYPEPTIDES HAVING DESIRED
CHARACTERISTICS" by Selifonov et al., attorney docket number
02-289-3US, filed herewith.
[0068] In one aspect, oligonucleotides are chosen so that only
encoded amino acid alterations are considered in the synthesis
strategy. In this strategy, after aligning a family of homologous
nucleic acids, family shuffling oligos are synthesized to be
degenerate only at those positions where a base change results in
an alteration in an encoded polypeptide sequence. This has the
advantage of requiring fewer degenerate oligonucleotides to achieve
the same degree of diversity in encoded products, thereby
simplifying the synthesis of the set of family gene shuffling
oligonucleotides.
[0069] In synthesis strategies in general, the oligonucleotides
have at least about 10 bases of sequence identity to either side of
a region of variance to ensure reasonably efficient hybridization
and assembly. However, flanking regions with identical bases can
have fewer identical bases (e.g., 5, 6, 7, 8, or 9) and can, of
course, have larger regions of identity (e.g., 11, 12, 13, 14, 15,
16, 17, 18, 19, 20, 25, 30, 50, or more).
[0070] During gene assembly, oligonucleotides can be incubated
together and reassembled using any of a variety of
polyrnerase-mediated reassembly methods, e.g., as described herein
and as known to one of skill. Selected oligonucleotides can
be."spiked" in the recombination mixture at any selected
concentration, thus causing preferential incorporation of desirable
modifications.
[0071] For example, during oligonucleotide elongation, hybridized
oligonucicotides are incubated in the presence of a nucleic acid
polymerase, e.g., Taq, Klenow, or the like, and dNTP's (i.e., dATP,
dCTP, dGTP and dTTP). If regions of sequence identity are large,
Taq or other high-temperature polym erase can be used with a
hybridization temperature of between about room temperature and,
e.g., about 65.degree. C. If the areas of identity are small,
Klenow, Taq or polymerases can be used with a hybridization
temperature of below room temperature. The polymerase can be added
to nucleic acid fragments (oligonucleotides plus any additional
nucleic acids which form a recombination mixture) prior to,
simultaneously with, or after hybridization of the oligonucleotides
and other recombination components. As noted elsewhere in this
disclosure, certain embodiments of the invention can involve
denaturing the resulting elongated double-stranded nucleic acid
sequences and then hybridizing and elongating those sequences
again. This cycle can be repeated for any desired number of times.
The cycle is repeated e.g., from about 2 to about 100 times.
Library Spiking
[0072] Family oligonucleotides can also be used to vary the nucleic
acids present in a typical shuffling mixture; e.g., a mixture of
DNase fragments of one or more gene(s) from a homologous set of
genes. In one aspect, all of the nucleic acid to be shuffled are
aligned as described above. Amino acid variations are noted and/or
marked (e.g., in an integrated system comprising a computer running
appropriate sequence alignment software, or manually, e.g., on a
printout of the sequences or sequence alignments. See also,
"METHODS FOR MAKING CHARACTER STRINGS, POLYNUCLEOTIDES AND
POLYPEPTIDES HAVING DESIRED CHARACTERISTICS" by Selifonov et al.,
attorney docket number 02-289-3US, filed herewith). As above,
family shuffling oligos are designed to incorporate some or all of
the amino acid variations coded by the natural sequence diversity
fot the aligned nucleic acids. One or more nucleic acids
corresponding to the homologous set of aligned nucleic acids are
cleaved (e.g., using a DNase, or by chemical cleavage). Family
shuffling oligos are spiked into the mixture of cleaved nucleic
acids, which are then recombined and reassembled into full-length
sequences using standard techniques.
[0073] To determine the extent of oligonucleotide incorporation,
any approach which distinguishes similar nucleic acids can be used.
For example, the reassembled nucleic acids can be cloned and
sequenced, or amplified (in vitro or by cloning, e.g., into a
standard cloning vector) and cleaved with a restriction enzyme
which specifically recognizes a particular polymorphic sequence
present in the family shuffling oligos, but not present in the same
position in the original cleaved nucleic acid(s).
[0074] In another embodiment, oligonucleotides are selected which
incorporate one or more sequence variation corresponding to an
amino acid polyrnorphism, but which eliminate polymorphic
nucleotide variations between nucleic acid sequences which
correspond to silent substitutions. One advantage of this strategy
is that the elimination of silent substitutions can make a given
sequence more similar to a given substrate for recombination (e.g.,
a selected target nucleic acid). This increased similarity permits
nucleic acid recombination among sequences which might otherwise be
too diverse for efficient recombination.
[0075] For example, a selected nucleic acid can be PCR amplified
using standard methods. The selected nucleic acid is cleaved and
mixed with a library of family gene shuffling oligonucleotides
which are rendered as similar as possible to the corresponding
sequences of the selected nucleic acid by making the
oligonucleotides include the same silent substitution set found in
the selected nucleic acid. The oligonucleotides are spiked at a
selected concentration into the cleavage mixture, which is then
reassembled into full-length sequences. The quality of the
resulting library (e.g., frequency at which the oligos are
incorporated into the reassembled sequences) is checked, as noted
above, by cloning (or otherwise amplifying) and sequencing and/or
restriction digesting the reassembled sequences.
[0076] PCR elongation strategies can also be used to make libraries
using different molar ratios of oligonucleotides in the
recombination mixtures (see also, e.g., WO 97/20078, WO 98/42832
and WO 98/01581).
Iterative Oligonucleotide Formats
[0077] In one aspect, the present invention provides iterative
oligonucleotide-mediated recombination formats. These formats can
be combined with standard recombination methods, also, optionally,
in an iterative format.
[0078] In particular, recombinant nucleic acids produced by
oligonucleotide-mediated recombination can be screened for activity
and sequenced. The sequenced recombinant nucleic acids are aligned
and regions of identity and diversity are identified. Family
shuffling oligonucleotides are then selected for recombination of
the sequenced recombinant nucleic acids. This process of screening,
sequencing active recombinant nucleic acids and recombining the
active recombinant nucleic acids can be iteratively repeated until
a molecule with a desired property is obtained.
[0079] In addition, recombinant nucleic acids made using family
shuffling oligonucleotides can be cleaved and shuffled using
standard recombination methods, which are, optionally, reiterative.
Standard recombination can be used in conjunction with
oligonucleotide shuffling and either or both steps are optionally
reiteratively repeated.
[0080] One useful example of iterative shuffling by oligonucleotide
mediated recombination of family oligonucleotides occurs when
extremely fine grain shuffling is desired. For example, small genes
encoding small protein such as defensins (antifungal proteins of
about 50 amino acids) EF40 (an antifungal protein family of about
28 amino acids), peptide antibiotics, peptide insecticidal
proteins, peptide hormones, many cytokines and many other small
proteins, are difficult to recombine by standard recombination
methods, because the recombination often occurs with a frequency
that is roughly the same as the size of the gene to be recombined,
limiting the diversity resulting from recombination. In contrast,
oligonucleotide-mediated recombination methods can recombine
essentially any region of diversity in any set of sequences, with
recombination events (e.g., crossovers) occurring at any selected
base-pair.
[0081] Thus, libraries of sequences prepared by recursive
oligonucleotide mediated recombination are optionally screened and
selected for a desired property, and improved (or otherwise
desirable) clones are sequenced (or otherwise deconvoluted, e.g.,
by real time PCR analysis such as FRET or TaqMan, or using
restriction enzyme analysis) with the process being iteratively
repeated to generate additional libraries of nucleic acids. Thus,
additional recombination rounds are performed either by standard
fragmentation-based recombination methods, or by sequencing
positive clones, designing appropriate family shuffling
oligonucleotides and performing a second round of
recombinationl/selection. to produce an additional library (which
can be recombined as described). In addition, libraries made from
different recombination rounds can also be recombined, either by
sequencing/oligonucleotide recombination or by standard
recombination methods.
Crossover PCR Shuffling
[0082] In one aspect, the present invention provides for shuffling
of distantly related or even non-homologous sequences. In this
embodiment, PCR crossover oligonucleotides are designed with a
first region derived from a first nucleic acid and a second region
corresponding to a second nucleic acid. Additional oligos are
designed which correspond to either the first or second nucleic
acid, and which have sequences that are complementary (or
identical) to the crossover oligos. By recombining these oligos
(i.e., hybridizing them and then elongating the hybridized
oligonucleotides in successive polyrnerase-mediated elongation
reactions), a substrate is provided which can recombine with either
the first or second nucleic acid, and which will, at the same time,
incorporate sequences from the other nucleic acid.
In Vivo Oligonucleotide Recombination Utilizing Family Shuffling
Chimeraplasts
[0083] Chimeraplasts are synthetic RNA-DNA hybrid molecules which
have been used for "genetic surgery" in which one or a few bases in
a genomic DNA are changed by recombination with the chimeric
molecule. The chimeraplasts are chimeric nucleic acids composed of
contiguous stretches of RNA and DNA residues in a duplex
conformation with double hairpin caps on the ends of the molecules
(Yoon et al. (1996) PNAS 93:2071-2076). The RNA-DNA sequence is
designed to align with the sequence of a locus to be altered by
recombination with the chimeraplast, with the chimeraplast having
the desired change in base sequence for the locus. The host cell
repair machinery converts the host cell sequence to that of the
chimeraplast. For brief reviews of the technique see, Bartlett
(1998) Nature Biotechnology 16:1312; Strauss (1998) Nature Medicine
4:274-275.
[0084] This strategy has been used for targeted correction of a
point mutation in the gene for human liver/kidney/bone alkaline
phosphatase encoded on an episomal DNA in mammalian cells (Yoon,
id.). The strategy was also used for correction of the mutation
responsible for sickle cell anemia in genomic DNA in lymphoblastoid
cells (Cole-Strauss et al. (1996) Science 1386-1389). Alexeev and
Yoon (1998) Nature Biotechnology 1343-1346 describe the use of a
hybrid RNA-DNA oligonucleotide (an "RDO") to make a point
correction in the mouse tyrosinase gene, resulting in correction of
an albino mutation in mouse cells and production of black
pigmentation by the cells. Kren et al. (1998) Nature Medicine
4(3):285-290 describe in vivo site-directed mutagenesis of
thefactor IXg ne by chimeric RNA/DNA oligonucleotides. Xiang et al
(1997) J. Mol. Med. 75:829-835 describe targeted gene conversion in
a mammalian CD34.sup.+-enriched cell population using a chimeric
RNA-DNA oligonucleotide. Kren et al. (1997) Hepatology
25(6):1462-1468 describe targeted nucleotide exchange in the
alkaline phosphatase gene of Hu-H-7 cells mediated by a chimeric
RNA-DNA oligonucleotide.
[0085] In one aspect of the present invention, the family shuffling
oligonucleotides are chimeraplasts. In this embodiment, family
shuffling oligonucleotides are made as set forth herein, to
additionally include structural chimeraplast features. For example,
in the references noted above, DNA-RNA oligos are synthesized
according to standard phosphoramidite coupling chemistries (the
nucleotides utilized optionally include non-standard nucleotides
such as 2-O methylated RNA nucleotidcs). The oligos have a "dual
hairpin" structure (e.g., having a T loop at the ends of the stru
ture) as set forth in the references noted above.
[0086] The set of family shuffling chimeraplasts each include
regions of identity to a target gene of interest, and regions of
diversity corresponding to the diversity (i.e., the sequence
variation for a particular subsequence) found in the target gene of
interest. As set forth in FIG. 1, the set of oligonucleotides is
transduced into cells (e.g., plant cells), where the chimeraplasts
recombine with a sequence of interest in the genome of the cells,
thereby creating a library of cells with at least one region of
diversity at a target gene of interest. The library is then
screened and selected as described herein. Optionally, the selected
library members are subjected to an additional round of
chimeraplast recombination with the same or different set of
chimeraplast oligonucleotides, followed by selection/screening
assays as described.
[0087] For example, chimeraplasts are synthesized with sequences
which correspond to regions of sequence diversity observed
following an alignment of homolgous nucleic acids. That is, the
chimeraplasts each contain one or a few nucleotides which,
following incorporation of the chimeraplasts into one or more
target sequences, results in conversion of a subsequence of a gene
into a subsequence found in an homologous gene. By transducing a
library of homologous chimeraplast sequences into a population of
cells, the target gene of interest within the cells is converted at
one or more positions to a sequence derived from one or more
homologous sequences. Thus, the effect of transducing the cell
population with the chimeraplast library is to create a library of
target genes corresponding to the sequence diversity found in genes
homologous to the target sequence.
[0088] Chimeraplasts can also be similarly used to convert the
target gene at selected positions with non-homologous sequence
choices, e.g., where structural or other information suggests the
desirability of such a conversion. In this embodiment, the
chimeraplasts include sequences corresponding to non-homologous
sequence substitutions.
[0089] Optionally, the chimeraplasts, or a co-transfected DNA, can
incorporate sequence tags, selectable markers, or other structural
features to permit selection or recovery of cells in which the
target gene has recombined with the chimeraplasi. For example, a
co-transfected DNA can include a marker such as drug resistance, or
expression of a delectable marker (e.g., Lac Z, or green
fluorescent protein).
[0090] In addition, sequences in the chimeraplast can be used as
purification or amplification tags. For example, a portion of the
chimeraplast can be complementary to a PCR primer. In this
embodiment, PCR primers are used to synthesize recombinant genes
from the-cells of the library. Similarly, PCR primers can bracket
regions of interest, including regions in which recombination
between a chimeraplast and a standard DNA occurs. Other PCR,
restriction enzyme digestion and/or cloning strategies which result
in the isolation of nucleic acids resulting from recombination
between the chimeraplast can also be used to recover the recombined
nucleic acid, which is optionally recombined with additional
nucleic acids. Reiterative cycles of chimeraplast-mediated
recombination, recovery of recombinant nucleic acids and
recombination of the recovered nucleic acids can be performed using
standard recombination methods. Selection cycles can be performed
after any recombination event to select for desirable nucleic
acids, or, alternatively, several rounds of recombination can be
performed prior to perfonning a selection step.
Libraries of Chimeraplasts and Other Gene Recombination
Vehicles
[0091] As noted above, chimeraplasts are generally useful
structures for modification of nucleotide sequences in target
genes, in vivo. Accordingly, structures which optimize chimeraplast
activity are desirable. Thus, in addition to the use of
chimeraplasts in in vitro and in vivo recombination formats as
noted, the present invention also provides for the optimization of
chimeraplast activity in vitro and in vivo, as well as for a number
of related libraries and other compositions.
[0092] In particular, a marker can be incorporated into a library
of related chimeraplasts. The marker is placed between the ends of
the chimeraplast in the region of the molecule which is
incorporated into a target nucleic acid following recombination
between the chimeraplast and the target nucleic acid. For example,
the marker can cause a detectable phenotypic effect in a cell in
which recombination occurs, or the marker can simply lead to a
change in the target sequence which can be detected by standard
nucleic acid sequence detection techniques (e.g., PCR amplification
of the sequence or of a flanking sequence, LCR, restriction enzyme
digestion of a sequence created by a recombination event, binding
of the recombined nucleic acid to an array (e.g., a gene chip),
and/or sequencing of the recombined nucleic acid, etc.).
Ordinarily, the regions of sequence difference are determined to
provide an indication of which sequences have increased
recombination rates.
[0093] The library of related chimeraplasts includes chimeraplasts
with regions of sequence divergence in the T loop hairpin regions
and in the region between the T loop hairpin region flanking the
marker. This divergence can be produced by synthetic strategies
which provide for production of heterologous sequences as described
herein.
[0094] For example, synthetic strategies utilizing chimeraplasts
which are largely identical in sequence, except for variant
nucleotide(s) are produced to simplify synthetic strategies.
Because of this similarity, parallel or pooled synthesis strategies
can be used in which a single synthesis reaction or set of reagents
is used to make common portions of each oligonucleotide. This can
be performed e.g., by well-known solid-phase nucleic acid synthesis
techniques, e.g., in a commercially available oligonucleotide
synthesizer, or, e.g., by utilizing array-based oligonucleotide
synthetic methods (see e.g., Fodor et al. (1991) Science, 251:
767-777; Fodor (1997) "Genes, Chips and the Human Genome" FASEB
Journal. 11:121-121; Fodor (1997) "Massively Parallel Genomics"
Science. 277:393-395; and Chee et al. (1996) "Accessing Genetic
Information with High-Density DNA Arrays" Science 274:610-614).
Accordingly, one feature of the present invention is a library of
chimeraplasts produced by these methods, i.e., a library of
chimeraplasts which share common sequence elements, including e.g.,
a common marker, as well as regions of difference, e.g., different
sequences in the hairpin regions of the molecule.
[0095] The library which is produced by these methods is screened
for increased recombination rates as noted above. Library members
which are identified as having increased rates of recombination are
optionally themselves recombined to produce libraries of recombined
chimeraplasts. Recombination is ordinarily performed by assessing
the sequences of the members which initially display increased
recombination rates, followed by synthesis of chimeraplasts which
display structural similarity to at least two of these members.
This process can be iteratively repeated to create new
"recombinant" chimeraplasts with increased recombination activity,
as well as libraries of such chimcraplasts.
[0096] Other recombination molecules can similarly be produced by
these methods. For example, Cre-Lox sites, Chi sites and other
recombination facilitating sequences in cell
transduction/transformation vectors are varied and selected in the
same manner as noted above. Where the sequences are simple DNA
sequences, they can be recombined either by the synthetic methods
noted herein, and/or by standard DNA shuffling methods.
Codon-Varied Oligonucleotides
[0097] Codon-varied oligonucleotides are oligonucleotides, similar
in sequence but with one or more base variations, where the
variations correspond to at least one encoded amino acid
difference. They can be synthesized utilizing tri-nucleotide, i.e.,
codon-based phosphoramidite coupling chemistry, in which
tri-nucleotide phosphoramidites representing codons for all 20
amino acids are used to introduce entire codons into
oligonucleotide sequences synthesized by this solid-phase
technique. Preferably, all of the oligonucleotides of a selected
length (e.g., about 20, 30, 40, 50, 60, 70, 80, 90, or 100 or more
nucleotides) which incorporate the chosen nucleic acid sequences
are synthesized. In the present invention, codon-varied
oligonucleotide sequences can be based upon sequences from a
selected set of homologous nucleic acids.
[0098] The synthesis of tri-nucleotide phoshoramidites, their
subsequent use in oligonucleotide synthesis, and related issues are
described in, e.g., Virnekas, B., el al., (1994) Nucleic Acids
Res., 22, 5600-5607, Kayushin, A. L. el al., (1996) Nucleic Acids
Res., 24, 3748-3755, Huse, U.S. Pat. No. 5,264,563 "PROCESS FOR
SYNTHESIZING OLIGONUCLEOTIDES WITH RANDOM CODONS", Lyttle et al.,
U.S. Pat. No. 5,717,085 "PROCESS FOR PREPARING CODON AMIDITES",
Shortle et., al., U.S. Pat. No. 5,869,644 "SYNTHESIS OF DIVERSE AND
USEFUL COLLECTIONS OF OLIGONUCLEOTIDES"; Greyson, U.S. Pat. No.
5,789,577 "METHOD FOR THE CONTROLLED SYNTHESIS OF POLYNUCLEOTIDE
MIXTURES WHICH ENCODE DESIRED MIXTURES OF PEPTIDES"; and Huse, WO
92/06176 "SURFACE EXPRESSION LIBRARIES OF RANDOMIZED PEPTIDES".
[0099] Codon-varied oligonucleotides can be synthesized using
various trinucleotide-related techniques, e.g., the trinucleotide
synthesis format and the split-pool synthesis format. The chemistry
involved in both the trinucleotide and the split-pool codon-varied
oligonucleotide synthetic methods is well known to those of skill.
In general, both methods utilize phosphoramidite solid-phase
chemical synthesis in which the 3' ends of nucleic acid substrate
sequences are covalently attached to a solid support, e.g., control
pore glass. The 5' protecting groups can be, e.g., a
triphenylmethyl group, such as dimethoxyltrityl (DMT) or
monomethyoxytrityl; a carbonyl-containing group, such as
9-fluorenylmethyloxycarbonyl (FMOC) or levulinoyl; an
acid-clearable group, such as pixyl; a fluoride-cleavable
alkylsilyl group, such as tert-butyl dimethylsilyl (T-BDMSi),
triisopropyl silyl, or trimethylsilyl. The 3' protecting groups can
be, e.g., .beta.-cyanoethyl groups
[0100] The trinucleotide synthesis format includes providing a
substrate sequence having a 5' terminus and at least one base, both
of which have protecting groups thereon. The 5' protecting group of
the substrate sequence is then removed to provide a 5' deprotected
substrate sequence, which is then coupled with a selected
trinucleotide phosphoramidite sequence. The trinucleotide has a 3'
terminus, a 5' terminus, and three bases, each of which has
protecting groups thereon. The coupling step yields an extended
oligonucleotide sequence. Thereafter, the removing and coupling
steps are optionally repeated. When these steps are repeated, the
extended oligonucleotide sequence yielded by each repeated coupling
step becomes the substrate sequence of the next repeated removing
step until a desired codon-varied oligonucleotide is obtained. This
basic synthesis format can optionally include coupling together one
or more of: mononucleotides, trinucleotide phosphoramidite
sequences, and oligonucleotides.
[0101] The split-pool synthesis format includes providing substrate
sequences, each having a 5' terminus and at least one base, both of
which have protecting groups thereon. The 5' protecting groups of
the substrate sequences are removed to provide 5' deprotected
substrate sequences, which are then coupled with selected
trinucleotide phosphorarnidite sequences. Each trinucleotide has a
3' terminus, a 5' terminus, and three bases, all of which have
protecting groups thereon. The coupling step yields extended
oligonucleotide sequences. Thereafter, the removing and coupling
steps are optionally repeated. When these steps are repeated, the
extended oligonucleotide sequences yielded by each repeated
coupling step become the substrate sequences of the next repeated
removing step until extended intermediate oligonucleotide sequences
are produced.
[0102] Additional steps of the split-pool format optionally include
splitting the extended intermediate oligonucleotide sequences into
two or more separate pools. After this is done, the 5' protecting
groups of the extended intermediate oligonucleotide sequences are
removed to provide 5' deprotected extended intermediate
oligonucleotide sequences in the two or more separate pools.
Following this, these 5' deprotected intermediates are coupled with
one or more selected mononucleotides, trinucleotide phosphoramidite
sequences, or oligonucleotides in the two or more separate pools to
yield further extended intermediate oligonucleotide sequences. In
turn, these further extended sequences are pooled into a single
pool. Thereafter, the steps beginning with the removal of the 5'
protecting groups of the substrate sequences to provide 5'
deprotected substrate sequences are optionally repeated. When these
steps are repeated, the further extended oligonucleotide sequences,
yielded by each repeated coupling step that generates those
specific sequences, become the substrate sequences of the next
repeated removing step that includes those specific sequences until
desired codon-varied oligonucleotides are obtained.
[0103] Both synthetic protocols described, supra, can optionally be
performed in an automated synthesizer that automatically performs
the steps. This aspect includes inputting character string
information into a computer, the output of which then directs the
automated synthesizer to perform the steps necessary to synthesize
the desired codon-varied oligonucleotides.
[0104] Further details regarding tri-nucleotide synthesis are found
"USE OF CODON VARIED OLIGONUCLEOTIDE SYNTHESIS FOR SYNTHETIC
SHUFFLING" by Welch et al., U.S. Ser. No. 09/408,393, filed Sep.
28, 1999.
Tuning Nucleic Acid Recombination Using Oilgonucleotide-Mediated
Blending
[0105] In one aspect, non-equimolar ratios of family shuffling
oligonucleotides are used to bias recombination during the
procedures noted herein. In this approach, equimolar ratios of
family shuffling oligonucleotides in a set of family shuffling
oligonucleotides are not used to produce a library of recombinant
nucleic acids, as in certain other methods herein. Instead, ratios
of particular oligonucleotides which correspond to the sequences of
a selected member or selected set of members of the family of
nucleic acids from which the family shuffling oligonucleotides are
derived are selected by the practitioner.
[0106] Thus, in one simple illustrative example, oligonucleotide
mediated recombination as described herein is used to recombine,
e.g., a frog gene and a human gene which are 50% identical. Family
oligonucleotides are synthesized which encode both the human and
the frog sequences at all polymorphic positions. However, rather
than using an equimolar ratio of the human and frog derived
oligonucleotides, the ratio is biased in favor of the gene that the
user wishes to emulate most closely. For example, when generating a
human-like gene, the ratio of oligonucleotides which correspond to
the human sequence at polymorphic positions can be biased to
greater than 50% (e.g., about 60%, 70%, 80%, or 90% or more of the
oligos can correspond to the human sequence, with, e.g., about 40%,
30%, 20%, 10%, or less of the oligos corresponding to the frog
sequence). Similarly, if one wants a frog-like gene, the ratio of
oligonucleotides which correspond to the frog sequence at
polymorphic positions can be biased to greater than 50%. In either
case, the resulting "blended" gene (i.e., the resulting recombinant
gene with characteristics of more than one parent gene) can then be
recombined with gene family members which are closely related by
sequence to the blended gene. Thus, in the case above, in the case
where the ratio of oligonucleotides is selected to produce a more
human-like blended gene, the blended gene is optionally further
recombined with genes more closely similar to the original human
gene. Similarly, where the ratio of oligQnucleotides is selected to
produce a more Frog-like blended gene, the blended gene is
optionally further recombined with genes more closely similar to
the original frog gene. This strategy is set out in FIG. 2. The
strategy is generally applicable to the recombination of any two or
more nucleic acids by oligonucleotide mediated recombination.
[0107] Biasing can be accomplished in a variety of ways, including
synthesizing disproportionate amounts of the relevant
oligonucleotides, or simply supplying disproportionate amounts to
the relevant gene synthesis method (e.g., to a PCR synthetic method
as noted, supra).
[0108] As noted, this biasing approach can be applied to the
recombination of any set of two or more related nucleic acids.
Sequences do not have to be closely similar for selection to
proceed. In fact, sequences do not even have to be detectably
homologous for biasing to occur. In this case, "family"
oligonucleotides are substituted for non-sequence homologous sets
of oligonucleotides derived from consideration of structural
similarity of the encoded proteins. For example, the immunoglobulin
superfamily includes structurally similar members which display
little or no detectable sequence homology (especially at the
nucleic acid level). In these cases, non-homologous sequences are
"aligned" by considering structural homology (e.g., by alignment of
functionally similar peptide residues). A recombination space of
interest can be defined which includes all permutations of the
amino acid diversity represented by the alignment. The above
biasing method is optionally used to blend the sequences with
desired ratios of the nucleotides encoding relevant structurally
similar amino acid sequences.
[0109] Any two or more sequences can be aligned by any algorithm or
criteria of interest and the biasing method used to blend the
sequences based upon any desired criteria. These include sequence
homology, structural similarity, predicted structural similarity
(based upon any similarity criteria which are specified), or the
like. It can be applied to situations in which there is a
structural core that is constant, but having many structural
variations built around the core (for example, an Ig domain can be
a structural core having many different loop lengths and
conformations being attached to the core).
[0110] A general advantage to this approach as compared to standard
gene recombination methods is that the overall sequence identity of
two sequences to be blended can be lower than the identity
necessary for recombination to occur by more standard methods. In
addition, sometimes only selected regions are recombined, making it
possible to take any structural or functional data which is
available into account in specifying how the blended gene is
constructed. Thus, sequence space which is not produced by some
other shuffling protocols is accessed by the blended gene approach
and a higher percentage of active clones can sometimes be obtained
if structural information is taken into consideration. Further
details regarding consideration of structural information is found
in "METHODS FOR MAKING CHARACTER STRINGS, POLYNUCLEOTIDES AND
POLYPEPTIDES HAVING DESIRED CHARACTERISTICS" by Selifonov et al.,
attorney docket number 02-289-3US.
[0111] The general strategy above is applicable, e.g., to any set
of genes with low sequence similarity. For example, there is a
large family of TNF homologues whose sequence identity is in the
range of about 30%, making standard shuffling protocols difficult
to achieve. Of course, tuning recombination by selecting
oligonucleotide proportions is also generally applicable to
recombination of any two nucleic acids, including both high
similarity homologues and low similarity homologues. Any alignment
protocol can be selected to align two or more sequences and the
resulting alignment can be used to create appropriate
oligonucleotides to achieve recombination, and any biasing in the
relative frequencies of sequences as compared to parental sequences
can be achieved.
Targets for Oligonucleotide Shuffling
[0112] Essentially any nucleic acid can be shuffled by one
oligonucleotide mediate methods herein. No attempt is made to
identify the hundreds of thousands of known nucleic acids. As noted
above, common sequence repositories for known proteins include
GenBank EMBL, DDBJ and the NCBI. Other repositories can easily be
identified by searching the internet.
[0113] One class of preferred targets for activation includes
nucleic acids encoding therapeutic proteins such as erythropoietin
(EPO), insulin, peptide hormones such as human growth hormone;
growth factors and cytokines such as epithelial Neutrophil
Activating Peptide-78, GRO.alpha./MGSA, GRO.beta., GRO.gamma.,
MIP-1.alpha., MIP-1.beta., MCP-1, epidermal growth factor,
fibroblast growth factor, hepatocyte growth factor, insulin-like
growth factor, the interferons, the interleukins, keratinocyte
growth factor, leukemia inhibitory factor, oncostatin M, PD-ECSF,
PDGF, pleiotropin, SCF, c-kit ligand, VEGEF, G-CSF ctc. Many of
these proteins are commercially available (See, e.g., the Sigma
BioSciences 1997 catalogue and price list), and the corresponding
genes are well-known.
[0114] Another class of preferred targets are transcriptional and
expression activators. Example transcriptional and expression
activators include genes and proteins that modulate cell growth,
differentiation, regulation, or the like. Expression and
transcriptional activators are found in prokaryotes, viruses, and
eukaryotes, including fungi, plants, and animals, including
mammals, providing a wide range of therapeutic targets. It will be
appreciated that expression and transcriptional activators regulate
transcription by many mechanisms, e.g., by binding to receptors,
stimulating a signal transduction cascade, regulating expression of
transcription factors, binding to promoters and enhancers, binding
to proteins that bind to promoters and enhancers, unwinding DNA,
splicing pre-mRNA, polyadenylating RNA, and degrading RNA.
Expression activators include cytokines, inflammatory molecules,
growth factors, their receptors, and oncogene products, e.g.,
interleukins (e.g., IL-1, IL-2, IL-8, etc.), interferons, FGF,
IGF-I, IGF-II, FGF, PDGF, TNF, TGF-.alpha., TGF-.beta., EGF, KGF,
SCF/c-Kit, CD40L/CD40, VLA-4/VCAM-1, ICAM-1/LFA-1, and
hyalurin/CD44; signal transduction molecules and corresponding
oncogene products, e.g., Mos, Ras, Raf, and Met; and
transcriptional activators and suppressors, e.g., p53, Tat, Fos,
Myc, Jun, Myb, Rel, and steroid hormone receptors such as those for
estrogen, progesterone, testosterone, aldosterone, the LDL receptor
ligand and corticosterone.
[0115] Rnases such as Onconase and EDN are preferred targets for
the synthetic methods herein, particularly those methods utilizing
gene blending. One of skill will appreciate that both frog and
human RNAses are known and are known to have a number of important
pharmacological activities. Because of the evolutionary divergence
between these genes, oligonucleotide-mediated recombination methods
are particularly useful in recombining the nucleic acids.
[0116] Similarly, proteins from infectious organisms for possible
vaccine applications, described in more detail below, including
infectious fungi, e.g., Aspergillus, Candida species; bacteria,
particularly E. coli, which serves a model for pathogenic bacteria,
as well as medically important bacteria such as Staphylococci
(e.g., aureus); Streptococci (e.g., pneumoniae), Clostridia (e.g.,
perfrigens), Neisseria (e.g., gonorrhoea), Enterobacteriaceae
(e.g., coli), Helicobacter (e.g., pylori), Vibrio (e.g., cholerae),
Campylobacter (e.g., jejuni), Pseudomonas (e.g., aeruginosa),
Haemophilus (e.g., influenzae), Bordetella (e.g., pertussis),
Mycoplasma (e.g., pneumoniae), Ureaplasma (e.g., urealyticum),
Legionella (e.g., pneumophilia), Spirochetes (e.g., Treponema,
Leptospira, and Borrelia), Mycobacteria (e.g., tuberculosis,
smegmatis), Actinomyces (e.g., israelii), Nocardia (e.g.,
asteroides), Chlamydia (e.g., trachomatis), Rickettsia, Coxiella,
Ehrilichia, Rocholimaea, Brucella, Yersinia, Francisella, and
Pasteurella; protozoa such as sporozoa (e.g., Plasmodia), rhizopods
(e.g., Entamoeba) and flagellates (Trypanosoma, Leishmania,
Trichomonas, Giardia, etc.); viruses such as (+) RNA viruses
(examples include Poxviruses e.g., vaccinia; Picomaviruses, e.g.
polio; Togaviruses, e.g., rubella; Flaviviruses, e.g., HCV; and
Coronaviruses), (-) RNA viruses (examples include Rhabdoviruses,
e.g., VSV; Paramyxovimses, e.g., RSV; Orthomyxovimses, e.g.,
influenza; Bunyaviruses; and Arenaviruses), dsDNA viruses
(Reoviruses, for example), RNA to DNA viruses, i.e., Retroviruses,
e.g., especially HIV and HTLV, and certain DNA to RNA viruses such
as Hepatitis B virus.
[0117] Other proteins relevant to non-medical uses, such as
inhibitors of transcription or toxins of crop pests e.g., insects,
fungi, weed plants, and the like, are also preferred targets for
oligonucleotide shuffling. Industrially important enzymes such as
monooxygenases (e.g., p450s), proteases, nucleases, and lipases are
also preferred targets. As an example, subtilisin can be evolved by
shuffling family oligonucleotides for homologous forms of the gene
for subtilisin. Von der Osten et al., J. Biotechnol. 28:55-68
(1993) provide an example subtilisin coding nucleic acids and
additional nucleic acids are present in GENBANK.RTM.. Proteins
which aid in folding such as the chaperonins are also preferred
targets.
[0118] Preferred known genes suitable for oligonucleotide mediated
shuffling also include the following: Alpha-I antitrypsin,
Angiostatin, Antihemolytic factor, Apolipoprotein, Apoprotein,
Atrial natriuretic factor, Atrial natriuretic polypeptide, Atrial
peptides, C--X--C chemokines (e.g., T39765, NAP-2, ENA-78, Gro-a,
Gro-b, Gro-c, IP-10, GCP-2, NAP-4, SDF-1, PF4, MIG), Calcitonin, CC
chemokines (e.g., Monocyte chemoattractant protein-1, Monocyte
chemoattractant protein-2, Monocyte chemoattractant protein-3,
Monocyte inflammatory protein-1 alpha, Monocyte inflammatory
protein-1 beta, RANTES, 1309, R83915, R91733, HCCl, T58847, D31065,
T64262), CD40 ligand, Collagen, Colony stimulating factor (CSF),
Complement factor 5a, Complement inhibitor, Complement receptor 1,
Factor IX, Factor VII, Factor VIII, Factor X, Fibrinogen,
Fibronectin, Glucocerebrosidase, Gonadotropin, Hedgehog proteins
(e.g., Sonic, Indian, Desert), Hemoglobin (for blood substitute;
for radiosensitization), Hirudin, Human serum albumin, Lactoferrin,
Luciferase, Neurturin, Neutrophil inhibitory factor (NIF),
Osteogenic protein, Parathyroid hormone, Protein A, Protein G,
Relaxin, Renin, Salmon calcitonin, Salmon growth hormone, Soluble
complement receptor I, Soluble I-CAM 1, Soluble interleukin
receptors (IL-1, 2, 3, 4, 5, 6, 7, 9, 10, 11, 12, 13, 14, 15),
Soluble TNF receptor, Somatomedin, Somatostatin, Somatotropin,
Streptokinase, Superantigens, i.e., Staphylococcal enterotoxins
(SEA, SEB, SEC1, SEC2, SEC3, SED, SEE), Toxic shock syndrome toxin
(TSST-1), Exfoliating toxins A and B, Pyrogenic exotoxins A, B, and
C, and M. arthritides mitogen, Superoxide dismutase, Thymosin alpha
1, Tissue plasminogen activator, Tumor necrosis factor beta (TNF
beta), Tumor necrosis factor receptor (TNFR), Tumor necrosis
factor-alpha (TNF alpha) and Urokinase.
[0119] Small proteins such as defensins (antifungal proteins of
about 50 amino acids, EF40 (an anti fungal protein of 28 amino
acids), peptide antibiotics, and peptide insecticidal proteins are
also preferred targets and exist as families of related proteins.
Nucleic acids encoding small proteins are particularly preferred
targets, because conventional recombination methods provide only
limited product sequence diversity. This is because conventional
recombination methodology produces crossovers between homologous
sequences about every 50-100 base pairs. This means that for very
short recombination targets, crossovers occur by standard
techniqucs about once per molecule. In contrast, the
oligonucleotide shuffling formats herein provide for recombination
of small nucleic acids, as the practitioner selects any
"cross-over" desired.
[0120] Addi(ional preferred targets are described in "METHODS FOR
MAKING CHARACTER STRINGS, POLYNUCLEOTIDES AND POLYPEPTIDES HAVING
DESIRED CHARACTERISTICS" by Selifonov et al., attorney docket
number 02-289-3US and other references herein.
Dna Shuffling and Gene Reassembly--Hybrid Synthetic Shuffling
Methods
[0121] One aspect of the present invention is the ability to use
family shuffling oligonucleotides and cross over oligonucleotides
as recombination ternplateslintermediates in various DNA shuffling
methods. In addition, nucleic acids made by the new synthetic
techniques herein can be reshuffled by other available shuffling
methodologies.
[0122] A variety of such methods are known, including those taught
by the inventors and their coworkers. The following publications
describe a variety of recursive recombination procedures and/or
related methods which can be practiced in conjunction with the
processes of the invention: Stemmer, et al., (1999) "Molecular
breeding of viruses for targeting and other clinical properties.
Tumor Targeting" 4:1-4; Nesset al. (1999) "DNA Shuffling of
subgenomic sequences of subtilisin" Nature Biotechnology
17:893-896; Chang et al. (1999) "Evolution of a cytokine using DNA
family shuffling" Nature Biotechnology 17:793-797; Minshull and
Stemmer (1999) "Protein evolution by molecular breeding" Current
Opinion in Chemical Biology 3:284-290; Christians et al. (1999)
"Directed evolution of thyrnidine kinase for AZT phosphorylation
using DNA family shuffling" Nature Biotechnology 17:259-264;
Crameriet al. (1998) "DNA shuffling of a family of genes from
diverse species accelerates directed evolution" Nature 391:288-291;
Crameri et al. (1997) "Molecular evolution of an arsenate
detoxification pathway by DNA shuffling," Nature Biotechnology
15:436-438; Zhang et al. (1997) "Directed evolution of an effective
fucosidase from a galactosidase by DNA shuffling and screening"
Proceedings of the National Academy of Sciences, U.S.A.
94:4504-4509; Patten et al. (1997) "Applications of DNA Shuffling
to Pharmaceuticals and Vaccines" Current Opinion in Biotechnology
8:724-733; Crameri et al. (1996) "Construction and evolution of
antibody-phage libraries by DNA shuffling" Nature Medicine
2:100-103; Crameri et al. (1996) "Improved green fluorescent
protein by molecular evolution using DNA shuffling" Nature
Biotechnology 14:315-319; Gates et al. (1996) "Affinity selective
isolation of ligands from peptide libraries through display on a
lac repressor `headpiece dimer`" Journal of Molecular Biology
255:373-386; Stemmer (1996) "Sexual PCR and Assembly PCR" In: The
Encyclopedia of Molecular Biology. VCH Publishers, New York.
pp.447-457; Crameri and Stemmer (1995) "Combinatorial multiple
cassette mutagenesis creates all the permutations of mutant and
wildtype cassettes" BioTechniques 18:194-195; Stemmer et al.,
(1995) "Single-step assembly of a gene and entire plasmid form
large numbers of oligodeoxyribonucleotides" Gene, 164:49-53;
Stemmer (1995) "The Evolution of Molecular Computation" Science
270: 1510; Stemmer (1995) "Searching Sequence Space" Bio/Technology
13:549-553; Stemmer (1994). "Rapid evolution of a protein in vitro
by DNA shuffling" Nature 370:389-391; and Stemmer (1994) "DNA
shuffling by random fragmentation and reassembly: In vitro
recombination for molecular evolution." Proceedings of the National
Academy of Sciences, U.S.A. 91:10747-10751.
[0123] Additional details regarding DNA shuffling methods are found
in U.S. Patents by the inventors and their co-workers, including:
U.S. Pat. No. 5,605,793 to Stemmer (Feb. 25, 1997), "METHODS FOR IN
VITRO RECOMBINATION;" U.S. Pat. No. 5,811,238 to Stemmer et al.
(Sep 22, 1998) "METHODS FOR GENERATING POLYNUCLEOTIDES HAVING
DESIRED CHARACTERISTICS BY ITERATIVE SELECTION AND RECOMBINATION;"
U.S. Pat. No. 5,830,721 to Stemmer et al. (Nov. 3, 1998), "DNA
MUTAGENESIS BY RANDOM FRAGMENTATION AND REASSEMBLY;" U.S. Pat. No.
5,834,252 to Stemmer, et al. (Nov. 10, 1998) "END-COMPLEMENTARY
POLYMERASE REACTION," and U.S. Pat. No. 5,837,458 to Minshull, et
al. (Nov. 17, 1998), "METHODS AND COMPOSITIONS FOR CELLULAR AND
METABOLIC ENGINEERING."
[0124] In addition, details and formats for nucleic acid shuffling
are found in a variety of PCT and foreign patent application
publications, including: Stemmer and Crameri, "DNA MUTAGENESIS BY
RANDOM FRAGMENTATION AND REASEMBLY" WO 95/22625; Stemmer and
Lipschutz "END COMPLEMENTARY POLYMERASE CHAIN REACTION" WO
96/33207; Stemmer and Crameri "METHODS FOR GENERATING
POLYNUCLEOTIDES HAVING DESIRED CHARACTERISTICS BY ITERATIVE
SELECTION AND RECOMBINATION" WO 97/0078; Minshul and Stemmer,
"METHODS AND COMPOSITIONS FOR CELLULAR AND METABOLIC ENGINEERING"
WO 97/35966; Punnonen et al. "TARGETING OF GENETIC VACCINE VECTORS"
WO 99/41402; Punnonen et al. "ANTIGEN LIBRARY IMMUNIZATION" WO
99/41383; Punnonen et al. "GENETIC VACCINE VECTOR ENGINEERING" WO
99/41369; Purinonen et al. OPTIMIZATION OF IMMUNOMODULATORY
PROPERTIES OF GENETIC VACCINES WO 9941368; Stemmer and Crameri,
"DNA MUTAGENESIS BY RANDOM FRAGMENTATION AND REASSEMBLY" EP
0934999; Stemmer "EVOLVING CELLULAR DNA UPTAKE BY RECURSIVE
SEQUENCE RECOMBINATION" EP 0932670; Stemmer et al., "MODIFICATION
OF VIRUS TROPISM AND HOST RANGE BY VIRAL GENOME SHUFFLING" WO
9923107; Apt et al., "HUMAN PAPILLOMAVIRUS VECTORS" WO 9921979; Del
Cardayre et al. "EVOLUTION OF WHOLE CELLS AND ORGANISMS BY
RECURSIVE SEQUENCE RECOMBINATION" WO 9831837; Patten and Stemmer,
"METHODS AND COMPOSITIONS FOR POLYPEPTIDE ENGINEERING" WO 9827230;
Stemmer et al., and "METHODS FOR OPTIMIZATION OF GENE THERAPY BY
RECURSIVE SEQUENCE SHUFFLING AND SELECTION" WO9813487.
[0125] Certain U.S. Applications provide additional details
regarding DNA shuffling and related techniques, including
"SHUFFLING OF CODON ALTERED GENES" by Patten et al. filed Sep. 29,
1998, (U.S. Ser. No. 60/102,362), Jan. 29, 1999 (U.S. Ser. No.
60/117,729), and Sep. 28, 1999, U.S. Ser. No. PCT/US99/22588;
"EVOLUTION OF WHOLE CELLS AND ORGANISMS BY RECURSIVE SEQUENCE
RECOMBINATION", by del Cardyre et al. filed Jul. 15, 1998 (U.S.
Ser. No. 09/166,188), and Jul. 15, 1999 (U.S. Ser. No. 09/354,922);
"OLIGONUCLEOTIDE MEDIATED NUCLEIC ACID RECOMBINATION" by Crameri et
al., filed Feb. 5, 1999 (U.;S. Ser. No. 60/118,813) and filed Jun.
24, 1999 (U.S. Ser. No. 60/141,049) and filed Sep. 28, 1999 (U.S.
Ser. No. 09/408,392), and "USE OF CODON-BASED OLIGONUCLEOTIDE
SYNTHESIS FOR SYNTHETIC SHUFFLING" by Welch et al., filed Sep. 28,
1999 (U.S. Ser No. 09/408,393). Finally, the applications cited
above in the section entitled "Cross Reference to Related
Applications" provide relevant forrnats.
[0126] The foregoing references also provide additional details on
the process of hybridizing and elongating nucleic acids to achieve
nucleic acid recombination.
[0127] In one aspect, a hybrid method which uses family gene
shuffling in combination with more traditional recombination based
shuffling methods is used. For example, an active nucleic acid can
be reassembled from oligonucleotides to have a few or even no
homologous substitutions relative to a given target gene. The
reassembled "backbone" nucleic acid is treated with DNase as in
standard methods, and the resulting DNased fragments are spiked
with family oligonucleotides comprising sequences corresponding to
regions of sequence identity and diversity in a given nucleic acid.
The nucleic acids are then reassembled into a library of homologous
sequences by the methods below (e.g., PCR reassembly, or other
reassembly methods). This procedure can result in an increase in
the percentage of active clones which are found as compared to
oligonucleotides synthetic methods which do not incorporate the use
of a backbone nucleic acid.
[0128] A number of the publications of the inventors and their
co-workers, as well as other investigators in the art describe
techniques which facilitate DNA shuffling, e.g., by providing for
reassembly of genes from small fragments, including
oligonucleotides, as relevant to the present invention. For
example, Stemmer et al. (1998) U.S. Pat. No. 5,834,252 END
COMPLEMENTARY POLYMERASE REACTION describe processes for amplifying
and detecting a target sequence (e.g., in a mixture of nucleic
acids), as well as for assembling large polynucleotides from
fragments. Crameri et al. (1998) Nature 391: 288-291 provides basic
methodologies for gene reassembly, as does Crameri et al. (1998)
Bio techniques 18(2): 194-196.
[0129] Other diversity generating approaches can also be used to
modify nucleic acids produced by the methods herein, or to be used
as templates for the methods herein. For example, additional
diversity can be introduced by methods which result in the
alteration of individual nucleotides or groups of contiguous or
non-contiguous nucleotides, i.e., mutagenesis methods. Mutagenesis
methods include, for example, recombination (PCT/US98/05223; Pub].
No. WO 87/42727); oligonucleotide-directed mutagenesis (for review
see, Smith, Ann. Rev.Genet. 19: 423-462 (1985); Botstein and
Shortle, Scieice 229: 1193-1201 (1985); Carter, Biochem. J. 237:
1-7 (1986); Kunkel, "The efficiency of oligonucleotide directed
mutagenesis" in Nucleic acids & Molecular Biology, Eckstein and
Lilley, eds., Springer Verlag, Berlin (1987)). Included among these
methods are oligonucleotide-directed mutagenesis (Zoller and Smith,
Nucl. Acids Res. 10: 6487-6500 (1982), Methods in Enzymol. 100:
468-500 (1983), and Methods in Enzymol. 154: 329-350 (1987))
phosphothioate-modified DNA mutagenesis (Taylor et al., Nucl. Acids
Res. 13: 8749-8764 (1985); Taylor et al., Nucl. Acids Res. 13:
8765-8787 (1985); Nakamaye and Eckstein, Nucl. Acids Res. 14:
9679-9698 (1986); Sayers et al., Nucl. Acids Res. 16:791-802
(1988); Sayers et al., Nucl. Acids Res. 16: 803-814 (1988)),
mutagenesis using uracil-containing templates (Kunkel, Proc. Nat'l.
Acad. Sci. USA 82: 488-492 (1985) and Kunkel et al., Methods in
Enzymol. 154:367-382)); mutagenesis using gapped duplex DNA (Kramer
et al., Nucl. Acids Res. 12: 9441-9456 (1984); Kramer and Fritz,
Methods in Enzymol. 154:350-367 (1987); Kramer et al., Nucl. Acids
Res. 16: 7207 (1988)); and Fritz et al., Nucl. Acids Res. 16:
6987-6999 (1988)). Additional methods include point mismatch repair
(Kramer et al., Cell 38: 879-887 (1984)), mutagenesis using
repair-deficient host strains (Carter et al., Nucl. Acids Res. 13:
4431-4443 (1985); Carter, Methods in Enzymol. 154: 382-403 (1987)),
deletion mutagenesis (Eghtedarzadeh and Henikoff, Nucl. Acids Res.
14: 5115 (1986)), restriction-selection and
restriction-purification (Wells et al., Phil. Trans. R. Soc. Lond.
A 317: 415-423 (1986)), mutagenesis by total gene synthesis
(Nambiar et al., Science 223: 1299-1301 (1984); Sakamar and
Khorana, Nucl. Acids Res. 14: 6361-6372 (1988); Wells et al., Gene
34.315-323 (1985); and Grundstrom et al., Nucl. Acids Res. 13:
3305-3316(1985). Kits for mutagenesis are commercially available
(e.g., Bio-Rad, Amersham International, Anglian Biotechnology).
[0130] Other diversity generation procedures are proposed in U.S.
Pat. No. 5,756,316; U.S. Pat. No. 5,965,408; Ostermeier et al.
(1999) "A combinatorial approach to hybrid enzymes independent of
DNA homology" Nature Biotech 17:1205; U.S. Pat. No. 5,783,43 1;
U.S. Pat. No. 5,824,485; U.S. Pat. 5,958,672; Jirholt et al. (1998)
"Exploiting sequence space: shuming in vivo formed complementarity
determining regions into a master framework" Gene 215: 471; U.S.
Pat. No. 5,939,250; WO 99/10539; WO 98/58085; WO 99/10539 and
others. These diversity generating methods can be combined with
each other or with shuffling reactions or oligo shuffling methods,
in any combination selected by the user, to produce nucleic acid
diversity, which may be screened for using any available screening
method.
[0131] Following recombination or other diversification reactions,
any nucleic acids which are produced can be selected for a desired
activity. In the context of the present invention, this can include
testing for and identifying any detectable or assayable activity,
by any relevant assay in the art. A variety of related (or even
unrelated) properties can be assayed for, using any available
assay.
DNA Shuffling Without the use of PCR
[0132] Although one preferred format for gene reassembly uses PCR,
other formats are also useful. For example, site-directed or
oligonucleotide-directed mutagenesis methods can be used to
generate chimeras between 2 or more parental genes (whether
homologous or non-homologous). In this regard, one aspect of the
present invention relates to a new method of performing
recombination between nucleic acids by ligation of libraries of
oligonucleotides corresponding to the nucleic acids to be
recombined.
[0133] In this format, a set of a plurality of oligonucleotides
which includes a plurality of nucleic acid sequences from a
plurality of the parental nucleic acids are ligated to produce one
or more recombinant nucleic acid(s), typically encoding a full
length protein (although ligation can also be used to make
libraries of partial nucleic acid sequences which can then be
recombined, e.g., to produce a partial or full-length recombinant
nucleic acid). The oligonucleotide set typically includes at least
a first oligonucleotide which is complementary to at least a first
of the parental nucleic acids at a first region of sequence
diversity and at least a second oligonucleotide which is
complementary to at least a second of the parental nucleic acids at
a second region of diversity. The parental nucleic acids can be
homologous or non-homologous.
[0134] Often, nucleic acids such as oligos are ligated with a
ligase. In one typical format, oligonucleotides are hybridized to a
first parental nucleic acid which acts as a template, and ligated
with a ligase. The oligos can also be extended with a polymerase
and ligated. The polymerase can.be, e.g., an ordinary DNA
polymerase or a thermostable DNA polymerase. The ligase can also be
an ordinary DNA ligase, or a thermostable DNA ligase. Many such
polymerases and ligases are commercially available.
[0135] In one set of approaches, a common element for non-PCR based
recombination methods is preparation of a single-stranded template
to which primers arc annealed and then elongated by a DNA
polymerase in the presence of dNTP's and appropriate buffer. The
gapped duplex can be sealed with ligase prior to transformation or
electroporation into E. coli. The newly synthesized strand is
replicated and generates a chimeric gene with contributions from
the oligo in the context of the single-stranded (ss) parent.
[0136] For example, the ss template can be prepared by
incorporation of the phage IG region into a plasmid and use of a
helper phage such as M13KO7. (Pharmacia Biotech) or R408 to package
ss plasmids into filamentous phage particles. The ss template can
also be generated by denaturation of a double-stranded template and
annealing in the presence of the primers. The methods vary in the
enrichment methods for isolation of the newly synthesized chimeric
strand over the parental template strand. Isolation and selection
of double stranded templates can be performed using available
methods. See e.g., Ling et al. (1997) "Approaches to DNA
mutagenesis: an overview." Anal Biochem. Dec 15;254(2):157-78; Dale
et al. (1996) "Oligonucleotide-directed random mutagenesis using
the phospborothioate method" Methods Mol Biol. 57:369-74; Smith
(1985) "In vitro mutagenesis" Ann. Rev. Genet. 19:423-462; Botstein
& Shortle (1985) "Strategies and applications of in vitro
mutagenesis" Science 229:1193-1201; and Carter (1986)
"Site-directed mutagenesis" Biochem J. 237:1-7; Kunkel (1987) "The
efficiency of oligonucleotide directed mutagenesis" Nucleic Acids
& Molecular Biology (1987); Eckstein, F. and Lilley, D. M. J.
eds Springer Verlag, Berlin.
[0137] For example, in one aspect, a "Kunkel style" method uses
uracil containing templates. Similarly, the "Eckstein" method uses
phosphorothioate-modified DNA (Taylor et al. (1985) "The use of
phosphorothioate-modified DNA in restriction enzyme reactions to
prepare nicked DNA." Nucleic Acids Res. 13:8749-8764; Taylor et al.
(1985) "The rapid generation of oligonucleotide-directed mutations
at high frequency using phosphorothioate-modified DNA" Nucleic
Acids Res. 13:8765-8787; Nakamaye & Eckstein (1986) "Inhibition
of restriction endonuclease Nci I cleavage by phosphorothioate
groups and its application to oligonucleotide-directed
mutagenesis." Nucleic Acids Res. 14: 9679-9698; Sayers et al.
(1988). "Y-T Exonucleases in phosphorothioate-based
oligonucleotide-directed mutagenesis." Nucleic Acids Res.
16:791-802; Sayers et al. (1988) "5'-3' Strand specific cleavage of
phosphorothioate-containing DNA by reaction with restriction
endonucleases in the presence of ethidium bromide" Nucleic Acids
Res. 16:803-814). The use of restriction selection, or e.g.,
purification can be used in conjunction with mismatch repair
deficient strains (see, e.g., Carter et al. (1985) "Improved
oligonucleotide site directed mutagenesis using M13 vectors"
Nucleic Acids Res. 13, 4431-4443 Carter (1987) "Improved
oligonucleotide-directed mutagenesis using M13 vectors." Methods in
Enzymol. 154:382-403; Wells (1986) "Importance of hydrogen bond
formation in stabilizing the transition state of subtilisin."
Trans. R. Soc. Lond, A317, 415-423).
[0138] The "mutagenic" primer used in these methods can be a
synthetic oligonucleotide encoding any type of randomization,
insertion, deletion, family gene shuffling oligonucleotide based on
sequence diversity of homologous genes, etc. The primer(s) could
also be fragments of homologous genes that are annealed to the ss
parent template. In this way chimeras between 2 or more parental
genes can be generated.
[0139] Multiple primers can anneal to a given template and be
extended to create multiply chimeric genes. The use of a DNA
polymerase such as those from phages T4 or T7 are suitable for this
purpose as they do not degrade or displace a downstream primer from
the template.
[0140] For example, in one aspect, DNA shuffling is performed using
uracil containing templates. In this embodiment, the gene of
interest is cloned into an E. coli plasmid containing the
filamentous phage intergenic (IG, ori) region. Single stranded (ss)
plasmid DNA is packaged into phage particles upon infection with a
helper phage such as M13KO7 (Pharmacia) or R408 and can be easily
purified by methods such as phenol/chloroform extraction and
ethanol precipitation. If this DNA is prepared in a dut-ung-strain
of E. coli, a small number of uracil residues are incorporated into
it in place of the normal thymine residues. One or more primers or
other oligos as described above are annealed to the ss
uracil-containing template by heating to 90.degree. C. and slowly
cooling to room temperature. An appropriate buffer containing all 4
deoxyribonucleotides, T7 DNA polymerase and T4 DNA ligase is added
to the annealed template/primer mix and incubated between room
temperature and e.g., about 37.degree. C. for >1 hour. The T7
DNA polymerase extends from the 3' end of the primer and
synthesizes a complementary strand to the template incorporating
the primer. DNA ligase seals the gap between the 3' end of the
newly synthesized strand and the 5' end of the primer.
[0141] If multiple primers are used, then the polymerase will
extend to the next primer, stop and ligase will seal the gap. This
reaction is then transformed into an ung+strain of E. coli and
antibiotic selection for the plasmid is applied. The uracil
N-glycosylase (ung gene product) enzyme in the host cell recognizes
the uracil in the template strand and removes it, creating
apyrimidinic sites that are either not replicated or the host
repair systems will correct it by using the newly synthesized
strand as a template. The resulting plasmids predominantly contain
the desired change in the gene if interest. If multiple primers are
used then it is possible to simultaneously introduce numerous
changes in a single reaction. If the primers are derived from or
correspond to fragments of homologous genes, then multiply chimeric
genes can be generated.
Codon Modification
[0142] In one aspect, the oligonucleotides utilized in the methods
herein have altered codon use as compared to the parental sequences
from which the oligonucleotides are derived. In particular, it is
useful, e.g., to modify codon preference to optimize expression in
a cell in which a recombinant product of an oligonucleotide
shuffling procedure is to be assessed or otherwise selected.
Conforming a recombinant nucleic acid to the codon bias of a
particular cell in which selection is to take place typically
results in maximization of expression of the recombinant nucleic
acid. Because the oligonucleotides used in the various strategies
herein typically are made synthetically, selecting optimal codon
preference is done simply by reference to well-known codon-bias
tables. Codon-based synthetic methods, as described supra, are
optionally used to modify codons in synthetic protocols.
[0143] In addition to the selection of oligonucleotide sequences to
optimize expression, codon preference can also be used to increase
sequence similarity between distantly related nucleic acids which
are to be recombined. By selecting which codons are used in
particular positions, it is possible to increase the similarity
between the nucleic acids, which, in turn, increases the frequency
of recombination between the nucleic acids.
[0144] Additional details on codon modification procedures and
their application to DNA shuffling are found in Paten and Stemmer,
U.S. Ser. No. 60/102,362 "SHUFFLING OF CODON ALTERED NUCLEIC
ACIDS," filed Sep. 29, 1998 and related application of Paten and
Stemmer, Attorney docket number 018097-028510, entitled "SHUFFLING
OF CODON ALTERED NUCLEIC ACIDS," filed Jan. 29, 1999.
Length Variation by Modular Shuffling
[0145] Many functional sequence domains for genes and gene elements
are composed of functional subsequence domains. For example,
promoter sequences are made up of a number of functional sequence
elements which bind transcription factors, which, in turn regulate
gene expression. Enhancer elements can be combined with promoter
elements to enhance expression of a given gene. Similarly, at least
some exons represent modular domains of an encoded protein, and
exons can be multimerized or deleted relative to a wild-type gene
and the resulting nucleic acids recombined to provide libraries of
altered gene (or encoded protein) modules (i.e., libraries of
module inserted or deleted nucleic acids). The number and
arrangement of modular sequences. as well as their sequence
composition, can affect the overall activity of the promoter, exon,
or other genetic module.
[0146] The concept of exons as modules of genes and encoded
proteins is established, particularly for proteins which have
developed in eukaryotes. See, e.g., Gilbert and Glynias (1993) Gene
137-144; Dolittle and Bork (October 1993) Scientific American
50-56; and Patthy (1991) Current Opinions in Structural Biology
1:351-361. Shuffling of exon modules is optimized by an
understanding of exon shuffling rules. Introns (and consequently
exons) occur in three different phases, depending on the splice
junction of a codon at the exon-intron boundary. See, Stemmer
(1995) Biotechnology 13:549-553; Patthy (1994) Current Opinions in
Structural Biology 4:383-392 and Patthy (1991) Current Opinions in
Structural Biology 1:351-361.
[0147] In nature, splice junctions of shuffled exons have to be
"phase compatible" with those of neighboring exons--if not, then a
shift in reading frame occurs, eliminating the information of the
exon module. The three possible phases of an intron are phases 1,
2, or 0. for the base position within the codon at the intron-exon
boundary in which the intron occurs. Classification of introns
according to their location relative to the reading frame is as
follows: a phase 0 intron is located between two codons of flanking
exons; a phase 1 intron is located between the first and second
nucleotide of a codon and a phase 2 intron is located between the
second and third nucleotide of a codon. Phase 1 introns are the
most common in nature.
[0148] One aspect of the present invention is the shuffling of
modular sequences (including, e.g., promoter elements and exons) to
vary the sequence of such modules, the number of repeats of modules
(from 0 (i.e., a deletion of the element) to a desired number of
copies) and the length of the modules. In particular, standard
shuffling methods, and/or the oligonucleotide-mediated methods
herein, can be combined with element duplication and length
variation approaches simply by spiking appropriately designed
fragments or oligonucleotides into a recombination mixture.
[0149] For example, a PCR-generated fragment containing the element
to be repeated is spiked into a recombination reaction, with ends
designed to be complementary, causing the creation of multimers in
a subsequent recombination reaction. These multimers can be
incorporated into final shuffled products by homologous
recombination at the ends of the multimers, with the overall
lengths of such multimers being dependent on the molar ratios of
the modules to be multimerized. The niultimers can be made
separately, or can be oligos in a gene reassmbly/recombination
reaction as discussed supra.
[0150] In a preferred aspect, oligos are selected to generate
multiniers and/or to delete selected modules such as exons,
promoter elements, enhancers, or the like during oligonucleotide
recombination and gene assembly, thereby avoiding the need to make
multimers or nucleic acids comprising module deletions separately.
Thus, in one aspect, a set of overlapping family gene shuffling
oligonucleotides is constructed to comprise oligos which provide
for deletion or multimerization of sequence module elements. These
"module shuffing" oligonucleotides can be used in conjunction with
any of the other approaches herein to recombine homologous nucleic
acids. Thus, sequence module elements are those subsequences of a
given nucleic acid which provide an activity or distinct component
of an activity of a selected nucleic acid, while module shuffling
oligonucleotides are oligonucleotides which provide for insertion,
deletion or multimerization of sequence modules. Examples of such
oligonucleotides include those having subsequences corresponding to
more than one sequence module (providing for deletion of
intervening sequences andlor insertion of a module in a selected
position), one or more oligonucleotides with ends that have regions
of identity permitting multimerization of the one or more
oligonucleotides (and, optionally, of associated sequences) during
hybridization and elongation of a mixture of oligonucleotides, and
the like.
[0151] Libraries resulting from module deletion/insertion
strategies noted above vary in the number of copies and arrangement
of a given module relative to a corresponding or homologous
parental nucleic acid. When the modules are exons, the
oligonucleotides used in the recombination methods are typically
selected to result in exons being joined in the same phase (i.e.,
having the same reading frame) to increase the liklihood that any
given library member will be functionally active. This is
illustrated schematically in FIG. 3. The differently shaded modules
represent separate exons, with the phase of the exon being
indicated as 1, 2, or 0.
Shuffling of Cladistic Intermediates
[0152] The present invention provides for the shuffling of
"evolutionary intermediates," In the context of the present
invention, evolutionary intermediates are artificial constructs
which are intermediate in character between two or more homologous
sequences, e.g., when the sequences are grouped in an evolutionary
dendogram.
[0153] Nucleic acids are often classified into evolutionary
dendograms (or "trees") showing evolutionary branch points and,
optionally, relatedness. For example, cladistic analysis is a
classification method in which organisms or traits (including
nucleic acid or polypeptide sequences) are ordered and ranked on a
basis that reflects origin from a postulated common ancestor (an
intermediate form of the divergent traits or organisms). Cladistic
analysis is primarily concerned with the branching of relatedness
trees (or "dendograms") which shows relatedness, although the
degree of difference can also be assessed (a distinction is
sometimes made between evolutionary taxomomists who consider
degrees of difference and those who simply determine branch points
in an evolutionary dendogram (classical cladistic analysis); for
purposes of the present invention, however, relatedness trees
produced by either method can produce evolutionary
intermediates).
[0154] Cladistic or other evolutionary intermediates can be
determined by selecting nucleic acids which are intermediate in
sequence between two or more extant nucleic acids. Although the
sequence may not exist in nature, it still represents a sequence
which is similar to a sequence in nature which had been selected
for, i.e., an intermediate of two or more sequences represents a
sequence similar to the common ancestor of the two or more extant
nucleic acids. Thus, evolutionary intermediates are one preferred
shuffling substrate, as they represent "pseudo selected" sequences,
which are more likely than randomly selected sequences to have
activity.
[0155] One benefit of using evolutionary intermediates as
substrates for shuffling (or of using oligonucleotides which
correspond to such sequences) is that considerable sequence
diversity can be represented in fewer starting substrates (i.e., if
starting with parents A and B, a single intermediate "C" has at
least a partial representation of both A and B). This simplifies
the oligonucleotide synthesis for gene reconstruction/recombination
methods, improving the efficiency of the procedure. Further,
searching sequence databases with evolutionary intermediates
increases the chances of identifying related nucleic acids using
standard search programs such as BLAST.
[0156] Intermediate sequences can also be selected between two or
more synthetic sequences which are not represented in nature,
simply by starting from two synthetic sequences. Such synthetic
sequences can include evolutionary intermediates, proposed gene
sequences, or other sequences of interest that are related by
sequence. These "artificial intermediates" are also useful in
reducing the complexity of gene reconstruction methods and for
improving the ability to search evolutionary databases.
[0157] Accordingly, in one significant embodiment of the invention,
character strings representing evolutionary or artificial
intermediates are first determined using alignment and sequence
relationship software (BLAST, PILEUP, etc.) and then synthesized
using oligonucleotide reconstruction methods. Alternately, the
intermediates can form the basis for selection of oligonucleotides
used in the gene reconstruction methods herein.
[0158] Further details regarding advanced procedures for generating
cladistic intermediates, including in silico shuffling using hidden
Markov model threading are set forth in co-filed application
"METHODS FOR MAKING CHARACTER STRINGS, POLYNUCLEOTIDES AND
POLYPEPTIDES HAVING DESIRED CHARACTERISTICS" by Selifonov et al.,
Attorney Docket Number 02-289-30US and in co-filed PCT application
(designating the United States) "METHODS FOR MAKING CHARACTER
STRINGS, POLYNUCLEOTIDES AND POLYPEPTIDES HAVING DESIRED
CHARACTERISTICS" by Selifonov et al., Attorney Docket Number
02-289-30PC.
Protein Domain Shuffling
[0159] Family shuffling of genes is a good way to access functional
diversity of encoded proteins. It can be advantageous, however, to
shuffle only a portion of an encoded protein which provides an
activity of interest, particularly where the protein is
multifunctional and one or more activity can be mapped to a
subsequence (a domain) of the overall protein.
[0160] For example, enzymes such as glycosyl transferases have two
substrates: the acceptor and the activated sugar donor. To change
the sugar to be transferred without altering the acceptor, it can
be preferable to family shuffle only the sugar binding domain,
since family shuffling the sugar acceptor domain can result in
lowered numbers of the desired acceptor. in one example, there are
5 enzymes, eA-eE (each of 500 amino acids) that transfers sugars
a-e to acceptors A-E. To generate a library of enzymes that
transfer sugars a-e to acceptor A it can be preferable to shuffling
the sugar binding domains of eA-eE, combining them with acceptor
binding domains of eA.
[0161] One technical challenge in practicing this strategy is that
there can be insufficient data to identify such functional domains
in a protein of interest. When this is the case, a set of libraries
can be generated by family shuffling random portions of the enzyme.
For example, as applied to the family shuffling of enzymes eA-eE,
above, a first library can be made encoding the first 100 amino
acids of eA-eE, in combination with the last 400 amino acids of any
one of eA-eE by appropriately selecting oligonucleotide sets for
recombination and elongation. A second library can be made which
family shuffles the second 100 amino acids of eA-eE, in combination
with encoding the first 100 amino acids of any one of eA-Ae and the
last 300 amino acids of any one of eA-Ae, and so on. Small subsets
of these libraries are screened for a first desired function.
Libraries that have retained the first desired function (e.g.,
acceptor activity in the example above) have a relatively higher
proportion of variants in additional selectable functions (e.g.,
sugar transfer in the example above).
[0162] This approach can be used for diversification of any
multi-functional protein in which one property is desirably
conserved. This strategy is particularly advantageous when the
property to be conserved is complex (e.g., substrate specificity
for, e.g., polyketides, non-ribosomal peptides or other natural
products).
[0163] In general, selection of oligonucleotides to provide
shuffling of individual domains (whether corresponding to known
functional subsequences or to subsequences of unknown function as
noted above) is performed by providing two general types of
sequence-related oligonucleotides. The first type is provided by
selecting sequence-related overlapping oligonucleotide sets
corresponding to regions where recombination is desired (i.e.,
according to the strategies noted herein), while the second type
provides recombination junctions between the domains to be shuffled
and non-shuffled domains, i.e., similar to a crossover
oligonucleotide as described herein. The non-shuffled domains can
be produced by simple oligonucleotide gene reconstruction methods
(e.g., using ligation or polymerase-mediated extension reactions to
concatenate oligonucleotides), or the non-shuffled domains can be
produced by enzymatic cleavage of larger nucleic acids.
Expanded Family Shuffling Incorporating Molecular Modeling and
Alanine Scaning
[0164] Family based oligo shuffling involves the recombination of
homologous nucleic acids by making sets of family shuffling
oligonucleotides which are recombined in gene synthesis and
recombination protocols as discussed stpra. As noted, the
homologous nucleic acids can be natural or non-natural (i.e.,
artificial) homologues.
[0165] One advantage of recombining non-natural homologues is that
sequence space other than naturally occurring sequence space is
accessed by the resulting recombinant nucleic acids. This
additional diversity allows for the development or acquisition of
functional properties that are not provided by recombination of
nucleic acids representing natural diversity.
[0166] The main disadvantage of creating random homologues for
recombination is that many of the resulting homologues are not
functional with respect to a relevant characteristic. For these
homologues, much of the resulting increase in selectable sequence
space is undesirable "noise" which has to be selected out of the
population. In contrast, natural diversity represents
evolutionarily tested molecules, representing a more targeted
overall potential sequence space in which recombination occurs.
[0167] One way of capturing non-natural diversity without
significantly increasing undesirable sequence space is to define
those positions which can be modified in a given gene without
significantly degrading the desired functional property of an
encoded molecule (protein, RNA, etc.). At least two basic
approaches to can be used.
[0168] First, point mutagenesis (e.g., alanine scanning) can be
performed to define positions that can be mutated without a
significant loss of function. In principle, all 20 amino acids
could be tested at each position to define a large spectrum of
point mutations that are essentially neutral with respect to
function. Sets of shuffling oligos are then made which capture
these non-natural (but still active) homologues. For many
commercially important proteins, alanine scanning information is
already available. For example, Young et al. (1997) Protein Science
6:1228-1236 describe alanine scanning of granulocyte colony
stimulating factor (G-CSF).
[0169] Second, where structural infornation is available for a
protein (and, e.g., how the protein interacts with a ligand),
regions can be defined which are predicted to be mutable with
little or no change in function. Sets of family shuffling oligos
are then made which capture these non-natural (but still predicted
to be active) homologues. A variety of protein crystal structures
are available (including, e.g., the crystal structure of G-CSF:
Hill et al. (1993) PNAS 90:5167).
[0170] Similarly, even where structural information is not
available, molecular modeling can be preformed to provide a
predicted structure, which can also be used to predict which
residues can be changed without altering function. A variety of
protein structure modeling programs are commercially available for
predicting protein structure. Further, the relative tendencies of
amino acids to form regions of superstructure (helixes,
.beta.-sheets, etc.) are well established. For example, O'Neil and
DeGrado Science v.250 provide a discussion of the helix forming
tendencies of the commonly occurring amino acids. Tables of
relative structure forming activity for amino acids can be used as
substitution tables to predict which residues can be functionally
substituted in a given portion. Sets of family shuffling oligos are
then made which capture these non-natural (but still predicted to
be active) homologues.
[0171] For example, Protein Design Automation (PDA) is one
computationally driven system for the design and optimization of
proteins and peptides, as well as for the design of proteins and
peptides. Typically, PDA starts with a protein backbone structure
and designs the amino acid sequence to modify the protein's
properties, while maintaining it's three dimensional folding
properties. Large numbers of sequences can be manipulated using
PDA, allowing for the design of protein structures (sequences,
subsequences, etc.). PDA is described in a number of publications,
including, e.g., Malakauskas and Mayo (1998) "Design, Structure and
Stability of a Hyperthermophilic Protein Variant" Nature Struc.
Biol. 5:470; Dahiyat and Mayo (1997) "De Novo Protein Design: Fully
Automated Sequence Selection" Science, 278, 82-87. DeGrado, (1997)
"Proteins from Scratch" Science, 278:80-81; Dahiyat, Sarisky and
Mayo (1997) "De Novo Protein Design: Towards Fully Automated
Sequence Selection" J. Mol. Biol. 273:789-796; Dahiyat and Mayo
(1997) "Probing the Role of Packing Specificity in Protein Design"
Proc. Nati. Acad. Sci. USA, 94:10172-10177; Hellinga (1997)
"Rational Protein Design--Combining Theory and Experiment" Proc.
Natl. Acad. Sci. USA, 94:10015-10017; Su and Mayo (1997)" Coupling
Backbone Flexibility and Arnino Acid Sequence Selection in Protein
Design" Prot. Sci. 6:1701-1707; Dahiyat, Gordon and Mayo (1997)
"Automated Design of the Surface Positions of Protein Helices"
Prot. Sci., 6:1333-1337; Dahiyat and Mayo (1996) "Protein Design
Automation" Prot. Sci., 5:895-903. Additional details regarding PDA
are available, e.g., at http://www.xencor.com/. PDA can be used to
identify variants of asequence that are likely to retain activity,
providing a set of homologous nucleic acids that can be used as a
basis for oligonucleotide mediated. recombination.
Post-recombination Screening Techniques
[0172] The precise screening method that is used in the various
shuffling procedures herein is not a critical aspect of the
invention. In general, one of skill can practice appropriate
screening (i.e., selection) methods, by reference to the activity
to be selected for.
[0173] In any case, one or more recombination cycle(s) is/are
usually followed by one or more cycle of screening or selection for
molecules or transformed cells or organisms having a desired
property, trait or characteristic. If a recombination cycle is
performed in vitro, the products of recombination, i.e.,
recombinant segments, are sometimes introduced into cells before
the screening step. Recombinant segments can also be linked to an
appropriate vector or other regulatory sequences before screening.
Alternatively, products of recombination generated in vitro are
sometimes packaged in viruses (e.g., bacteriophage) before
screening. If recombination is performed in vivo, recombination
products can sometimes be screened in the cells in which
recombination occurred. In other applications, recombinant segments
are extracted from the cells, and optionally packaged as viruses,
before screening.
[0174] The nature of screening or selection depends on what
property or characteristic is to be acquired or the property or
characteristic for which improvement is sought, and many examples
are discussed below. It is not usually necessary to understand the
molecular basis by which particular products of recombination
(recombinant segments) have acquired new or improved properties or
characteristics relative to the starting substrates. For example, a
gene can have many component sequences, each having a different
intended role (e.g., coding sequence, regulatory sequences,
targeting sequences, stability-conferring sequences, subunit
sequences and sequences affecting integration). Each of these
component sequences can be varied and recombined simultaneously.
Screening/selection can then be performed, for exarnple, for
recombinant segments that have increased ability to confer activity
upon a cell without the need to attribute such improvement to any
of the individual component sequences of the vector.
[0175] Depending on the particular screening protocol used for a
desired property, initial round(s) of screening can sometimes be
performed using bacterial cells due to high transfection
efficiencies and ease of culture. However, bacterial expression is
often not practical or desired, and yeast, fungal or other
eukaryotic systems are also used for library expression and
screening. Similarly, other types of screening which are not
amenable to screening in bacterial or simple eukaryotic library
cells, are performed in cells selected for use in an environment
close to that of their intended use. Final rounds of screening can
be performed in the precise cell type of intended use.
[0176] One approach to screening diverse libraries is to use a
massively parallel solid-phase procedure to screen shuffed nucleic
acid products, e.g., encoded enzymes, for enhanced activity.
Massively parallel solid-phase screening apparatus using
absorption, fluorescence, or FRET are available. See, e.g., U.S.
Pat. 5,914,245 to Bylina, et al. (1999); see also,
http://www.kairos-scientific.com/; Youvan et al. (1999)
"Fluorescence Imaging Micro-Spectrophotometer (FIMS)" Biotechnology
et alia<www.et-al.com>1:1-16; Yang et al. (1998) "High
Resolution Imaging Microscope (HIRIM)" Biotechnology et alia,
<www.et-al.com>4:1-20; and Youvan et al. (1999) "Calibration
of Fluorescence Resonance Energy Transfer in Microscopy Using
Genetically Engineered GFP Derivatives on Nickel Chelating Beads"
posted at www.kairos-scientific.com. Following screening by these
techniques, sequences of interest are typically isolated,
optionally sequenced and the sequences used as set forth herein to
design new oligonucleotide shuffling methods.
[0177] If further improvement in a property is desired, at least
one and usually a collection of recombinant segments surviving a
first round of screening/selection are subject to a further round
of recombination. These recombinant segments can be recombined with
each other or with exogenous segments representing the original
substrates or further variants thereof. Again, recombination can
proceed in vitro or in vivo. If the previous screening step
identifies desired recombinant segments as components of cells, the
components can be subjected to further recombination in vivo, or
can be subjected to further recombination in vitro, or can be
isolated before performing a round of in vitro recombination.
Conversely, if the previous screening step identifies desired
recombinant segments in naked form or as components of viruses,
these segments can be introduced into cells to perform a round of
in vivo recombination. The second round of recombination,
irrespective how performed, generates further recombinant segments
which encompass additional diversity than is present in recombinant
segments resulting from previous rounds.
[0178] The second round of recombination can be followed by a
further round of screening/selection according to the principles
discussed above for the first round. The stringency of
screening/selection can be increased between rounds. Also, the
nature of the screen and the property being screened for can vary
between rounds if improvement in more than one property is desired
or if acquiring more than one new property is desired.
Additional rounds of recombination and screening can then be
performed until the recombinant segments have sufficiently evolved
to acquire the desired new or improved property or function.
Post-Shuffling Procedures
[0179] The nucleic acids produced by the methods of the invention
are optionally cloned into cells for activity screening (or used in
in vitro transcription reactions to make products which are
screened). Furthermore, the nucleic acids can be sequenced,
expressed, amplified in vitro or treated in any other common
recombinant method.
[0180] General texts which describe molecular biological techniques
useful herein, including cloning, mutagenesis, library
construction, screening assays, cell culture and the like include
Berger and Kimmel, Guide to Molecular Cloning Techniques Methods in
Enzymology volume 152 Academic Press, Inc., San Diego, Calif.
(Berger); Sambrook et al., Molecular Cloning--A Laboratory Manual
(2nd Ed.), Vol. 1-3, Cold Spring Harbor Laboratory, Cold Spring
Harbor, N.Y., 1989 ("Sambrook") and Current Protocols in Molecular
Biology, F. M. Ausubel et al., eds., Current Protocols, a joint
venture between Greene Publishing Associates, Inc. and John Wiley
& Sons, Inc., (supplemented through 1998) ("Ausubel")). Methods
of transducing cells, including plant and animal cells, with
nucleic acids are generally available, as are methods of expressing
proteins encoded by such nucleic acids. In addition to Berger,
Ausubel and Sambrook, useful general references for culture of
animal cells include Freshney (Culture of Animal Cells, a Manual of
Basic Technique, third edition Wiley- Liss, New York (1994)) and
the references cited therein, Hurnason (Animal Tissue Techniques,
fourth edition W.H. Freeman and Company (1979)) and Ricciardelli,
et al., In Vitro Cell Dev. Biol. 25:1016-1024 (1989). References
for plant cell cloning, culture and regeneration include Payne et
al. (1992) Plant Cell and Tissue Culture in Liquid Systems John
Wiley & Sons, Inc. New York, NY (Payne); and Gamborg and
Phillips (eds) (1995) Plant Cell, Tissue and Organ Culture;
Fundamental Methods Springer Lab Manual, Springer-Verlag (Berlin
Heidelberg N.Y.) (Gamborg). A variety of Cell culture media are
described in Atlas and Parks (eds) The Handbook of Microbiological
Media (1993) CRC Press, Boca Raton, Fla. (Atlas). Additional
information for plant cell culture is found in available commercial
literature such as the Life Science Research Cell Culture Catalogue
(1998) from Sigma- Aldrich, Inc (St Louis, Mo.) (Sigma-LSRCCC) and,
e.g., the Plant Culture Catalogue and supplement (1997) also from
Sigma-Aldrich, Inc (St Louis, Mo.) (Sigma-PCCS).
[0181] Examples of techniques sufficient to direct persons of skill
through in vitro amplification methods, useful e.g., for amplifying
oligonucleotide shuffled nucleic acids including the polymerase
chain reaction (PCR) the ligase chain reaction (LCR),
Q.beta.-replicase amplification and other RNA polymerase mediated
techniques (e.g. NASBA). These techniques are found in Berger,
Sambrook, and Ausubel, id., as well as in Mullis et al., (1987)
U.S. Pat. No. 4,683,202; PCR Protocols A Guide to Methods and
Applications (Innis el aL eds) Academic Press Inc. San Diego,
Calif. (1990) (Innis); Amheim & Levinson (Oct. 1, 1990) C &
EN 36-47; The Journal Of NIH Research (1991) 3, 81-94; Kwoh et al
(1989) Proc. Natl. Acad. Sci. USA 86, 1173; Guatelli etal. (1990)
Proc. Natl. Acad. Sci. USA 87, 1874; Lomell et al. (1989) J. Clin.
Chem 35, 1826; Landegren et al., (1988) Science 241, 1077-1080; Van
Brunt (1990) Biotechnology 8, 291-294; Wu and Wallace, (1989) Gene
4, 560; Barringer et al (1990) Gene 89, 117, and Sooknanan and
Malek (1995) Biotechnology 13: 563-564. Improved methods of cloning
in vitro amplified nucleic acids are described in Wallace et al,
U.S. Pat. No. 5,426,039. Improved methods of amplifying large
nucleic acids by PCR are summarized in Cheng et al (1994) Nature
369: 684-685 and the references therein, in which PCR amplicons of
up to 40kb are generated. One of skill will appreciate that
essentially any RNA can be converted into a double stranded DNA
suitable for restriction digestion, PCR expansion and sequencing
using reverse transcriptase and a polymerase. See, Ausubel,
Sambrook and Berger, all supra. In one preferred method,
reassembled sequences are checked for incorporation of family gene
shuffling oligonucleotides. This can be done by cloning and
sequencing the nucleic acids, and/or by restriction digestion,
e.g., as essentially taught in Sambrook, Berger and Ausubel, above.
In addition, sequences can be PCR amplified and sequenced directly.
Thus, in addition to, e.g., Sambrook, Berger, Ausubel and Innis
(id. and above), additional PCR sequencing PCR sequencing
methodologies are also particularly useftil. For example, direct
sequencing of PCR generated amplicons by selectively incorporating
boronated nuclease resistant nucleotides into the amplicons during
PCR and digestion of the amplicons with a nuclease to produce sized
template fragments has been performed (Porter et al. (1997) Nucleic
Acids Research 25(8):1611-1617). In the methods, 4 PCR reactions on
a template are performed, in each of which one of the nucleotide
triphosphates in the PCR reaction mixture is partially substituted
with a 2'deoxynucleoside 5'-[P-boranol-triphosphate. The boronated
nucleotide is stochastically incorporated into PCR products at
varying positions along the PCR amplicon in a nested set of PCR
fragments of the template. An exonuclease which is blocked by
incorporated boronated nucleotides is used to cleave the PCR
amplicons. The cleaved amplicons are then separated by size using
polyacrylamide gel electrophoresis, providing the sequence of the
amplicon. An advantage of this method is that it uses fewer
biochemical manipulations than performing standard Sanger-style
sequencing of PCR amplicons.
[0182] In Silico Shuffling "In silico" shuffling utilizes computer
algorithms to perform "virtual" shuffling using genetic operators
in a computer. As applied to the present invention, gene sequence
strings are recombined in a computer system and desirable products
are made, e.g., by reassembly PCR of synthetic oligonucleotides as
described herein. In silico shuffling is described in detail in
"METHODS FOR MAKING CHARACTER STRINGS, POLYNUCLEOTIDES AND
POLYPEPTIDES HAVING DESIRED CHARACTERISTICS" by Selifonov et al.,
attorney docket number 02-289-3US, filed herewith.
[0183] In brief, genetic operators (algorithms which represent
given genetic events such as point mutations, recombination of two
strands of homologous nucleic acids, etc.) are used to model
recombinational or mutational events which can occur in one or more
nucleic acid, e.g., by aligning nucleic acid sequence strings
(using standard alignment software, or by manual inspection and
alignment) such as those representing homologous nucleic acids and
predicting recombinational outcomes. The predicted recombinational
outcomes are used to produce corresponding molecules, e.g., by
oligonucleotide synthesis and reassembly PCR.
Integrated Assays and Integrated System Elements
[0184] As noted throughout, one preferred aspect of the present
invention is the alignment of nucleic acids using a computer and
sequence alignment software. Similarly, computers having
appropriate software can be used to perform "in silico" shuffling
prior to physical oligonucleotide synthesis. In addition, other
important integrated system components can provide for
high-throughput screening assays, as well as the coupling of such
assays to oligonucleotide selection, synthesis and
recombination.
[0185] Of course, the relevant assay will depend on the
application. Many assays for proteins, receptors, ligands and the
like are known. Formats include binding to immobilized components,
cell or organismal viability, production of reporter compositions,
and the like.
[0186] In the high throughput assays of the invention, it is
possible to screen up to several thousand different shuffled
variants in a single day. In particular, each well of a microtiter
plate can be used to run a separate assay, or, if concentration or
incubation time effects are to be observed, every 5-10 wells can
test a single variant. Thus, a single standard microtiter plate can
assay about 100 (e.g., 96) reactions. If 1536 well plates are used,
then a single plate can easily assay from about 100- about 1500
different reactions. It is possible to assay several different
plates per day; assay screens for up to about 6,000-20,000
different assays (i.e., involving different nucleic acids, encoded
proteins, concentrations, etc.) is possible using the integrated
systems of the invention. More recently, microfluidic approaches to
reagent manipulation have been developed, e.g., by Caliper
Technologies (Mountain View, Calif.).
[0187] In one aspect, library members, e.g., cells, viral plaques,
spores or the like, are separated on solid media to produce
individual colonies (or plaques). Using an automated colony picker
(e.g., the Q-bot, Genetix, U.K.), colonies or plaques are
identified, picked, and up to 10,000 different mutants inoculated
into 96 well microtiter dishes containing two 3 mm glass
balls/well. The Q-bot does not pick an entire colony but rather
inserts a pin through the center of the colony and exits with a
small sampling of cells, (or mycelia) and spores (or viruses in
plaque applications). The time the pin is in the colony, the number
of dips to inoculate the culture medium, and the time the pin is in
that mcdium each effect inoculum size, and each can be controlled
and optimized. The uniform process of the Q-bot decreases human
handling error and increases the rate of establishing cultures
(roughly 10,000/4 hours). These cultures are then shaken in a
temperature and humidity controlled incubator. The glass balls in
the microtiter plates act to promote uniform aeration of cells and
the dispersal of mycelial fragments similar to the blades of a
fermenter. Clones from cultures of interest can be cloned by
limiting dilution. As also described supra, plaques or cells
constituting libraries can also be screened directly for production
of proteins, either by detecting hybridization, protein activity,
protein binding to antibodies, or the like.
[0188] A number of well known robotic systems have also been
developed for solution phase chemistries useful in assay systems.
These systems include automated workstations like the automated
synthesis apparatus developed by Takeda Chemical Industries, LTD.
(Osaka, Japan) and many robotic systems utilizing robotic arms
(Zymate II, Zymark Corporation, Hopkinton, Mass.; Orca, Beckman
Coulter, Inc. (Fullerton, Calif.)) which mimic the manual synthetic
operations performed by a scientist. Any of the above devices are
suitable for use with the present invention, e.g., for
high-throughput screening of molecules assembled from the various
oligonucleotide sets described herein. The nature and
implementation of modifications to these devices (if any) so that
they can operate as discussed herein with reference to the
integrated system will be apparent to persons skilled in the
relevant art.
[0189] High throughput screening systems are commercially available
(see, e.g., Zymark Corp., Hopkinton, Mass.; Air Technical
Industries, Mentor, Ohio; Beckman Instruments, Inc. Fullerton,
Calif.; Precision Systems, Inc., Natick, Mass., etc.). These
systems typically automate entire procedures including all sample
and reagent pipetting, liquid dispensing, timed incubations, and
final readings of the microplate in detector(s) appropriate for the
assay. These configurable systems provide high throughput and rapid
start up as well as a high degree of flexibility and customization.
The manufacturers of such systems provide detailed protocols the
various high throughput. Thus, for example, Zymark Corp. provides
technical bulletins describing screening systems for detecting the
modulation of gene to transcription, ligand binding, and the
like.
[0190] Optical images viewed (and, optionally, recorded) by a
camera or other recording device (e.g., a photodiode and data
storage device) are optionally further processed in any of the
embodiments herein, e.g., by digitizing the image and/or storing
and analyzing the image on a computer. A variety of commercially
available peripheral equipment and software is available for
digitizing, storing and analyzing a digitized video or digitized
optical image, e.g., using PC (Intel x86 or Pentium chip-
compatible DOS.TM., OS2.TM. WINDOWS.TM., WINDOWS NT.TM. or
WINDOWS95.TM. based machines), MACINTOSH.TM., or UNIX based (e.g.,
SUN.TM. work station) computers. One conventional system carries
light from the assay device to a cooled charge-coupled device (CCD)
camera, in common use in the art. A CCD camera includes an array of
picture elements (pixels). The light from the specimen is imaged on
the CCD. Particular pixels corresponding to regions of the specimen
(e.g., individual hybridization sites on an array of biological
polymers) are sampled to obtain light intensity readings for each
position. Multiple pixels are processed in parallel to increase
speed. The apparatus and methods of the invention are easily used
for viewing any sample, e.g., by fluorescent or dark field
microscopic techniques.
[0191] Integrated systems for assay analysis in the present
invention typically include a digital computer with sequence
alignment software and one or more of: high-throughput liquid
control software, image analysis software, data interpretation
software, and the like.
[0192] A robotic liquid control armature for transferring solutions
from a source to a destination can be operably linked to the
digital computer and an input device (e.g., a computer keyboard)
can be used for entering data to the digital computer to control
high throughput liquid transfer, oligonucleotide synthesis and the
like, e.g., by the robotic liquid control armature. An image
scanner can be used for digitizing label signals from labeled assay
component. The image scanner interfaces with the image analysis
software to provide a measurement of probe label intensity.
[0193] Of course, these assay systems can also include integrated
systems incorporating oligonucleotide selection elements, such as a
computer, database with nucleic acid sequences of interest,
sequence alignment software, and oligonucleotide selection
software. In addition, this software can include components for
ordering the selected oligonucleotides, and/or directing synthesis
of oligonucleotides by an operably linked oligonucleotide synthesis
machine. Thus, the integrated system elements of the invention
optionally include any of the above components to facilitate high
throughput recombination and selection. It will be appreciated that
these high-throughput recombination elements can be in systems
separate from those for performing selection assays, or the two can
be integrated.
[0194] In one aspect, the present invention comprises a computer or
computer rcadable medium with an instruction set for selecting an
oligonucleotide set such as a set of family shuffling
oligonucleotides using the methods described herein. The
instruction set aligns homologous nucleic acids to identify regions
of similarity and regions of diversity (e.g., as in typical
alignment software such as BLAST) and then selects a set of
overlapping oligonucleotides that encompass the regions of
similarity and diversity, optionally using any of the weighting
factors described herein (e.g., predominant selection of
oligonucleotides corresponding to one or more nucleic acid to be
recombined, as in the gene blending methods herein). The computer
or computer readable medium optionally comprises features
facilitating use by a user, e.g., an input field for inputting
oligonucleotide selections by the user, a display output system for
controlling a user-viewable output (e.g., a GUI), an output file
which directs synthesis of the oligonucleotides, e.g., in an
automated synthesizer, and the like.
EXAMPLE
Betalactamase Shuffling with Three Bridging Oligos
[0195] In this example, two beta lactamase genes (CFAMPC and FOX)
were shuffled using three bridging oligonucleotides. The oligos
were as follows: TABLE-US-00001 1)
CAAATACTGGCCGGAACTGAAAGGTTCTGCTTTCGACGGT 2)
GTCGTGTTCTGCAGCCGCTGGGTCTGCACCACACCTACAT 3)
TCGTTACTGGCGTATCGGTGACATGACCCAGGGTCTGGGT
[0196] The recombination reaction was performed using 2 micrograms
of DNAsed fragments from CFAMPC and FOX. All three oligos were
added to the reaction 1:1 in a total of 60 microliters of 1x
Taq-mix (7070 microliters of H.sub.2O, 100 microliters Taq buffer,
600 microliters MgCl.sub.2 (25 mM), 80 microliters dNTPs (100
mM)).
[0197] Reactions were performed with 150 ng primers
(2.times.molar), 750 ng primers (10.times.molar), and 1500 ng
primers (20.times.molar). 20 microliters of the assembling mix were
added to 60 microliters of the 1x Taq mix and 40 thermal cycles
were performed at 94.degree. C. (30 sec.) 40.degree. C. (30 sec)
and 72.degree. C. (30 sec). 1, 2, 4, and 8 microliters of the
resulting products were then PCR amplified for 40 cycles (same
thermal cycling conditions as before) using primers for the end
regions of the betalactamase genes. The resulting material was then
digested with Sfi overnight at 50.degree. C., gel purified and
ligated into vector Sfi-BLA-Sfi (MG18), transformed into TG1 and
plated on Tet 20. 50 colonies were selected from the Tet 20 plates
and amplified by colony PCR. The PCR amplicon was then digested
overnight at 37.degree. C. with HinF1. Restriciton analysis
revealed that 2 wt sequences for each parental gene, as well as 7
different recombinant products (for the 10.times.molar reaction) or
8 different clones (for the 20 .times.reaction) were produced.
EXAMPLE
Creating Semisinthetic Library by Oligo Spiking
[0198] Genes to be used are cry 2Aa, cry2Ab, and cry2Ac. DNA
aligmcnt was done with DNA star using editseq. and megalig. Oligos
are 50 umol synthesis (BRL, Liftech.) Oligos for the region between
Amino acid 260-630 are designed for cry2Ac in regard to diversity
of this region. Oligos are resuspended in 200 ul H.sub.20. The
oligos are as follows: TABLE-US-00002 CRY2-1
TGGTCGTTATTTAAATATCAAAGCCTTCTAGTATCTTCCGGC GCTAATTTATATGC CRY2-2
CGGCGCTAATTTATATGCGAGTGGTAGTGGTCCAACACAATC ATTTACAGCACA CRY2-3
CTAATTATGTATTAAATGGTTTGAGTGGTGCTAGGACCACCA TTACTTTC CCTAATATT
CRY2-4 CTTTCCCTAATATTGGTGGTCTTCCCGTCTACCACAACTCAA CATTGCATTTTG
CGAGG CRY2-5 AGGATTAATTATAGAGGTGGAGTGTCATCTAGCCGCATAGGT CAAGCTAATCT
CRY2-6 CTAATCTTAATCAAAACTTTAACATTTCCACACTTTTCAATC CTTTACAAA
CACCGTTT CRY2-7 TTTATTAGAAGTTGGCTAGATTCTGGTACAGATCGGGAAGGC
GTTGCCACCTCTAC CRY2-8 TGCCACCTCTACAAACTGGCAATCAGGAGCCTTTGAGACAAC
TTTATTA CRY2-9 0 ACAACTTTATTACGATTTAGCATTTTTTCAGCTCGTGGTA
ATTCGAACTTTTTCCCA CRY2-10
TCCGTAATATTTCTGGTGTTGTTGGGACTATTAGCAACGCAG ATTTAGCAAG ACCTCTAC
CRY2-11 ACTTTAATGAAATAAGAGATATAGGAACGACAGCAGTCGCTA
GCCTTGTAACAGTGCATA CRY2-12
TAATATCTATGACACTCATGAAAATGGTACTATGATTCATTT AGCGCCAAA TGACTATAC
CRY2-13 TATACAGGATTTACCGTATCTCCAATACATGCCACTCAAGTA AATAATC
AAATTCGAAC CRY2-14 CAAATTCGAACGTTTATTTCCGAAAAATATGGTAATCAGGGT
GATTCCTT GAGATTTGA CRY2-15
AGATTTGAGCTAAGCAACCCAACGGCTCGATACACACTTAGA GGGAATGGAAATAGTTAC
CRY2-16 AGAGTATCTTCAATAGGAAGTTCCACAATTCGAGTTACTA CRY2-17
CTGCAAATGTTAATACTACCACAAATAATGATGGAGTACTTG ATAATGG AGCTCGTTTTT
CRY2-18 TATCGGTAATGTAGTGGCAAGTGCTAATACTAATGTACCATT AGATATACA
AGTGACATT CRY2-19 ATACAAGTGACATTTAACGGCAATCCACAATTTGAGCTTATG
AATATTATG TTTGTTCCA
[0199] Family shuffling is done using the assembly conditions
described in Crameri et al. (1995) Nature 391: 288-291, except that
oligos are spiked into the assembling mix as described in Crameri
et al. (1998) Bio techniques 18(2): 194-196. The PCR reactions with
outside primer I for ATGAATAATGTATTGAATA and 1 rev
TTAATAAAGTGGTGGAAGATT are done with Taq/Pfu (9:1) mix (Taq from
Qiagen, Pfu from Stratagene) PCR program 96.degree. C. (30 sec).
50.degree. C. (30sec). 72.degree. C. (1 min) for 25 cycles. The
reaction is diluted 10.times. and an additional cycle is performed.
The gene is !igated into a vector and transformed into TG1
competent Cells, and plated on LB+Amp100 plates. Single colonies
are picked for colony PCR and then analyzed by restriction
digestion.
EXAMPLE
Oligo Shuffling of Libraries
[0200] An advantage of oligonucleotide mediated shuffling methods
is tbe ability to recombine nucleic acids between libraries of
oligos generated for a number of different sites in a gene of
interest. Generating libraries with complex combinations of
randomizations in different regions of a target gene is facilitated
by oligonucleotide mediated shuffling approaches.
[0201] For example, the antigen-binding site of an antibody or
antibody fragment such as a single-chain Fv (ScFv), or Fab is
mainly comprised of 6 complementarity-determining regions (CDR's).
These CDR's are present on one face of the properly folded
molecule, but are separated in the linear gene sequence. Synthetic
oligonucleotides or those generated by PCR of one or more antibody
genes can be used to generate sequence diversity at individual
CDR's. This process can be repeated with a second CDR, then a
third, until a library of diverse antibodies is formed. DNA
shuffling formats have a distinct advantage that allow for
libraries of each CDR to be generated simultaneously and inter-CDR
recombination events will frequently occur to potentially generate
all possible combinations of different CDR's. Recursive DNA
shuffling and screening for an improved trait or property can be
used to optimize protein function.
[0202] Similarly, the 3-dimensional structures of many cytokines
share a common 4-helix bundle structure with long connecting loops.
The receptor binding sites for some of these proteins has been
determined and is localized to 2 or more regions of the protein
that are separate in the linear gene sequence. Modeling of related
proteins could be used to predict functional regions of unknown
proteins for targeting libraries. Libraries in each of these
regions can be generated using synthetic oligos, family-shuffling
oligos, fragments of homologous genes, or combinations thereof as
herein. Oligonucleotide mediated shuffling allows one to generate
libraries in each of these regions simultaneously and to generate
recombinants between each library. In this way, combinations
between members of each library can be screened for improved
function. Those isolates with improved function can then be
submitted to successive rounds of DNA shuffling. In this way,
isolates with the highest activity in each library and potential
synergies between members of different libraries can be selected.
Other methods that optimize each library independently may fail to
isolate such synergistic interactions.
[0203] Another example is the shuffling of enzymes where the active
site and substrate binding site(s) is comprised of residues close
together in the 3-dimensional structure of the folded protein, but
separated in the linear sequence of the gene. DNA shuffling can
simultaneously generate libraries in each region that interact with
substrate. DNA shuffling also allows all possible combinations of
changes between each library to be generated and can be evaluated
for an improved trait or property.
[0204] Modifications can be made to the method and materials as
hereinbefore described without departing from the spirit or scope
of the invention as claimed, and the invention can be put to a
number of different uses, including:
[0205] The use of an integrated system to select family shuffling
oligonucleotides (e.g., by a process which includes sequence
alignment of parental nucleic acids) and to test shuffled nucleic
acids for activity, including in an iterative process.
[0206] An assay, kit or system utilizing a use of any one of the
selection strategies, materials, components, methods or substrates
hereinbefore described. Kits will optionally additionally comprise
instructions for performing methods or assays, packaging materials,
one or more containers which contain assay, device or system
components, or the like.
[0207] In an additional aspect, the present invention provides kits
embodying the methods and apparatus herein. Kits of the invention
optionally comprise one or more of the following: (1) a
recombination component as described herein; (2) instructions for
practicing the methods described herein, and/or for operating the
oligonucleotide synthesis or assembled gene selection procedures
herein; (3) one or more assay component; (4) a container for
holding nucleic acids or enzymes, other nucleic acids, transgenic
plants, animals, cells, or the like (5) packaging materials, and
(6) a computer or computer readable medium having instruction sets
for aligning target nucleic acids and for selecting
oligonucleotides which, upon hybridization and elongation, will
result in shuffled forms of the target nucleic acids.
[0208] In a further aspect, the present invention provides for the
use of any component or kit herein, for the practice of any method
or assay herein, and/or for the use of any apparatus or kit to
practice any assay or method herein.
[0209] While the foregoing invention has been described in some
detail for purposes of clarity and understanding, it will be clear
to one skilled in the art from a reading of this disclosure that
various changes in form and detail can be made without departing
from the true scope of the invention. For example, all the
techniques and materials described above can be used in various
combinations. All publications and patent documents cited in this
application are incorporated by reference In their entirety for all
purposes to the same extent as if each individual publication or
patent document were so individually denoted.
Sequence CWU 1
1
24 1 40 DNA Artificial Sequence bridging oligonucleotides of CFAMPC
and FOX 1 caaatactgg ccggaactga aaggttctgc tttcgacggt 40 2 40 DNA
Artificial Sequence bridging oligonucleotides of CFAMPC and FOX 2
gtcgtgttct gcagccgctg ggtctgcacc acacctacat 40 3 40 DNA Artificial
Sequence bridging oligonucleotides of CFAMPC and FOX 3 tcgttactgg
cgtatcggtg acatgaccca gggtctgggt 40 4 56 DNA Artificial Sequence
oligonucleotides of cry2Aa, cry2Ab, and cry2Ac. 4 tggtcgttat
ttaaatatca aagccttcta gtatcttccg gcgctaattt atatgc 56 5 54 DNA
Artificial Sequence oligonucleotides of cry2Aa, cry2Ab, and cry2Ac.
5 cggcgctaat ttatatgcga gtggtagtgg tccaacacaa tcatttacag caca 54 6
59 DNA Artificial Sequence oligonucleotides of cry2Aa, cry2Ab, and
cry2Ac. 6 ctaattatgt attaaatggt ttgagtggtg ctaggaccac cattactttc
cctaatatt 59 7 59 DNA Artificial Sequence oligonucleotides of
cry2Aa, cry2Ab, and cry2Ac. 7 ctttccctaa tattggtggt cttcccgtct
accacaactc aacattgcat tttgcgagg 59 8 53 DNA Artificial Sequence
oligonucleotides of cry2Aa, cry2Ab, and cry2Ac. 8 aggattaatt
atagaggtgg agtgtcatct agccgcatag gtcaagctaa tct 53 9 59 DNA
Artificial Sequence oligonucleotides of cry2Aa, cry2Ab, and cry2Ac.
9 ctaatcttaa tcaaaacttt aacatttcca cacttttcaa tcctttacaa acaccgttt
59 10 56 DNA Artificial Sequence oligonucleotides of cry2Aa,
cry2Ab, and cry2Ac. 10 tttattagaa gttggctaga ttctggtaca gatcgggaag
gcgttgccac ctctac 56 11 49 DNA Artificial Sequence oligonucleotides
of cry2Aa, cry2Ab, and cry2Ac 11 tgccacctct acaaactggc aatcaggagc
ctttgagaca actttatta 49 12 57 DNA Artificial Sequence
oligonucleotides of cry2Aa, cry2Ab, and cry2Ac. 12 acaactttat
tacgatttag cattttttca gctcgtggta attcgaactt tttccca 57 13 60 DNA
Artificial Sequence oligonucleotides of cry2Aa, cry2Ab, and cry2Ac.
13 tccgtaatat ttctggtgtt gttgggacta ttagcaacgc agatttagca
agacctctac 60 14 60 DNA Artificial Sequence oligonucleotides of
cry2Aa, cry2Ab, and cry2Ac. 14 actttaatga aataagagat ataggaacga
cagcagtcgc tagccttgta acagtgcata 60 15 60 DNA Artificial Sequence
oligonucleotides of cry2Aa, cry2Ab, and cry2Ac. 15 taatatctat
gacactcatg aaaatggtac tatgattcat ttagcgccaa atgactatac 60 16 59 DNA
Artificial Sequence oligonucleotides of cry2Aa, cry2Ab, and cry2Ac.
16 tatacaggat ttaccgtatc tccaatacat gccactcaag taaataatca aattcgaac
59 17 59 DNA Artificial Sequence oligonucleotides of cry2Aa,
cry2Ab, and cry2Ac. 17 caaattcgaa cgtttatttc cgaaaaatat ggtaatcagg
gtgattcctt gagatttga 59 18 60 DNA Artificial Sequence
oligonucleotides of cry2Aa, cry2Ab, and cry2Ac. 18 agatttgagc
taagcaaccc aacggctcga tacacactta gagggaatgg aaatagttac 60 19 40 DNA
Artificial Sequence oligonucleotides of cry2Aa, cry2Ab, and cry2Ac.
19 agagtatctt caataggaag ttccacaatt cgagttacta 40 20 60 DNA
Artificial Sequence oligonucleotides of cry2Aa, cry2Ab, and cry2Ac.
20 ctgcaaatgt taatactacc acaaataatg atggagtact tgataatgga
gctcgttttt 60 21 60 DNA Artificial Sequence oligonucleotides of
cry2Aa, cry2Ab, and cry2Ac. 21 tatcggtaat gtagtggcaa gtgctaatac
taatgtacca ttagatatac aagtgacatt 60 22 60 DNA Artificial Sequence
oligonucleotides of cry2Aa, cry2Ab, and cry2Ac. 22 atacaagtga
catttaacgg caatccacaa tttgagctta tgaatattat gtttgttcca 60 23 19 DNA
Artificial Sequence oligonucleotides of cry2Aa, cry2Ab, and cry2Ac.
23 atgaataatg tattgaata 19 24 21 DNA Artificial Sequence
oligonucleotides of cry2Aa, cry2Ab, and cry2Ac. 24 ttaataaagt
ggtggaagat t 21
* * * * *
References