U.S. patent application number 10/994608 was filed with the patent office on 2007-03-01 for human secreted proteins.
This patent application is currently assigned to Human Genome Sciences, Inc.. Invention is credited to Craig A. Rosen, Steven M. Ruben.
Application Number | 20070048297 10/994608 |
Document ID | / |
Family ID | 39402044 |
Filed Date | 2007-03-01 |
United States Patent
Application |
20070048297 |
Kind Code |
A1 |
Rosen; Craig A. ; et
al. |
March 1, 2007 |
Human secreted proteins
Abstract
The present invention relates to human secreted polypeptides,
and isolated nucleic acid molecules encoding said polypeptides,
useful for diagnosing and treating diseases, disorders, and/or
conditions related to said human secreted proteins. Antibodies that
bind these polypeptides are also encompassed by the present
invention. Also encompassed by the invention are vectors, host
cells, and recombinant and synthetic methods for producing said
polynucleotides, polypeptides, and/or antibodies. The invention
further encompasses screening methods for identifying agonists and
antagonists of polynucleotides and polypeptides of the invention.
The present invention further encompasses methods and compositions
for inhibiting or enhancing the production and function of the
polypeptides of the present invention.
Inventors: |
Rosen; Craig A.;
(Laytonsville, MD) ; Ruben; Steven M.;
(Brookeville, MD) |
Correspondence
Address: |
HUMAN GENOME SCIENCES INC;INTELLECTUAL PROPERTY DEPT.
14200 SHADY GROVE ROAD
ROCKVILLE
MD
20850
US
|
Assignee: |
Human Genome Sciences, Inc.
Rockville
MD
|
Family ID: |
39402044 |
Appl. No.: |
10/994608 |
Filed: |
November 23, 2004 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10105299 |
Mar 26, 2002 |
|
|
|
10994608 |
Nov 23, 2004 |
|
|
|
09950082 |
Sep 12, 2001 |
|
|
|
10994608 |
Nov 23, 2004 |
|
|
|
PCT/US00/06043 |
Mar 9, 2000 |
|
|
|
09950082 |
Sep 12, 2001 |
|
|
|
PCT/US00/06012 |
Mar 9, 2000 |
|
|
|
09950082 |
|
|
|
|
PCT/US00/06058 |
Mar 9, 2000 |
|
|
|
09950082 |
|
|
|
|
PCT/US00/06044 |
Mar 9, 2000 |
|
|
|
09950082 |
|
|
|
|
PCT/US00/06059 |
Mar 9, 2000 |
|
|
|
09950082 |
|
|
|
|
PCT/US00/06042 |
Mar 9, 2000 |
|
|
|
09950082 |
|
|
|
|
PCT/US00/06014 |
Mar 9, 2000 |
|
|
|
09950082 |
|
|
|
|
PCT/US00/06013 |
Mar 9, 2000 |
|
|
|
09950082 |
|
|
|
|
PCT/US00/06049 |
Mar 9, 2000 |
|
|
|
09950082 |
|
|
|
|
PCT/US00/06057 |
Mar 9, 2000 |
|
|
|
09950082 |
|
|
|
|
PCT/US00/06824 |
Mar 16, 2000 |
|
|
|
09950082 |
|
|
|
|
60168664 |
Dec 3, 1999 |
|
|
|
PCT/US00/06824 |
Mar 16, 2000 |
|
|
|
PCT/US00/06765 |
Mar 16, 2000 |
|
|
|
09950082 |
|
|
|
|
PCT/US00/06792 |
Mar 16, 2000 |
|
|
|
09950082 |
|
|
|
|
PCT/US00/06830 |
Mar 16, 2000 |
|
|
|
09950082 |
|
|
|
|
PCT/US00/06782 |
Mar 16, 2000 |
|
|
|
09950082 |
|
|
|
|
PCT/US00/06822 |
Mar 16, 2000 |
|
|
|
09950082 |
|
|
|
|
PCT/US00/06791 |
Mar 16, 2000 |
|
|
|
09950082 |
|
|
|
|
PCT/US00/06828 |
Mar 16, 2000 |
|
|
|
09950082 |
|
|
|
|
PCT/US00/06823 |
Mar 16, 2000 |
|
|
|
09950082 |
|
|
|
|
PCT/US00/06781 |
Mar 16, 2000 |
|
|
|
09950082 |
|
|
|
|
PCT/US00/07505 |
Mar 22, 2000 |
|
|
|
09950082 |
|
|
|
|
PCT/US00/07440 |
Mar 22, 2000 |
|
|
|
09950082 |
|
|
|
|
PCT/US00/07506 |
Mar 22, 2000 |
|
|
|
09950082 |
|
|
|
|
PCT/US00/07507 |
Mar 22, 2000 |
|
|
|
09950082 |
|
|
|
|
PCT/US00/07535 |
Mar 22, 2000 |
|
|
|
09950082 |
|
|
|
|
PCT/US00/07525 |
Mar 22, 2000 |
|
|
|
09950082 |
|
|
|
|
PCT/US00/07534 |
Mar 22, 2000 |
|
|
|
09950082 |
|
|
|
|
PCT/US00/07483 |
Mar 22, 2000 |
|
|
|
09950082 |
|
|
|
|
PCT/US00/07526 |
Mar 22, 2000 |
|
|
|
09950082 |
|
|
|
|
PCT/US00/07527 |
Mar 22, 2000 |
|
|
|
09950082 |
|
|
|
|
PCT/US00/07661 |
Mar 23, 2000 |
|
|
|
09950082 |
|
|
|
|
PCT/US00/07579 |
Mar 23, 2000 |
|
|
|
09950082 |
|
|
|
|
PCT/US00/07723 |
Mar 23, 2000 |
|
|
|
09950082 |
|
|
|
|
PCT/US00/07724 |
Mar 23, 2000 |
|
|
|
09950082 |
|
|
|
|
PCT/US00/14929 |
Jun 1, 2000 |
|
|
|
09950082 |
|
|
|
|
PCT/US00/07722 |
Mar 23, 2000 |
|
|
|
09950082 |
|
|
|
|
PCT/US00/07578 |
Mar 23, 2000 |
|
|
|
09950082 |
|
|
|
|
PCT/US00/07726 |
Mar 23, 2000 |
|
|
|
09950082 |
|
|
|
|
PCT/US00/07677 |
Mar 23, 2000 |
|
|
|
09950082 |
|
|
|
|
PCT/US00/07725 |
Mar 23, 2000 |
|
|
|
09950082 |
|
|
|
|
PCT/US00/09070 |
Apr 6, 2000 |
|
|
|
09950082 |
|
|
|
|
PCT/US00/08982 |
Apr 6, 2000 |
|
|
|
09950082 |
|
|
|
|
PCT/US00/08983 |
Apr 6, 2000 |
|
|
|
09950082 |
|
|
|
|
PCT/US00/09067 |
Apr 6, 2000 |
|
|
|
09950082 |
|
|
|
|
PCT/US00/09066 |
Apr 6, 2000 |
|
|
|
09950082 |
|
|
|
|
PCT/US00/09068 |
Apr 6, 2000 |
|
|
|
09950082 |
|
|
|
|
PCT/US00/08981 |
Apr 6, 2000 |
|
|
|
09950082 |
|
|
|
|
PCT/US00/08980 |
Apr 6, 2000 |
|
|
|
09950082 |
|
|
|
|
PCT/US00/09071 |
Apr 6, 2000 |
|
|
|
09950082 |
|
|
|
|
PCT/US00/09069 |
Apr 6, 2000 |
|
|
|
09950082 |
|
|
|
|
PCT/US00/15136 |
Jun 1, 2000 |
|
|
|
09950082 |
|
|
|
|
PCT/US00/14926 |
Jun 1, 2000 |
|
|
|
09950082 |
|
|
|
|
PCT/US00/14963 |
Jun 1, 2000 |
|
|
|
09950082 |
|
|
|
|
PCT/US00/15135 |
Jun 1, 2000 |
|
|
|
09950082 |
|
|
|
|
PCT/US00/14934 |
Jun 1, 2000 |
|
|
|
09950082 |
|
|
|
|
PCT/US00/14933 |
Jun 1, 2000 |
|
|
|
09950082 |
|
|
|
|
PCT/US00/15137 |
Jun 1, 2000 |
|
|
|
09950082 |
|
|
|
|
PCT/US00/14928 |
Jun 1, 2000 |
|
|
|
09950082 |
|
|
|
|
PCT/US00/14973 |
Jun 1, 2000 |
|
|
|
09950082 |
|
|
|
|
PCT/US00/14964 |
Jun 1, 2000 |
|
|
|
09950082 |
|
|
|
|
PCT/US00/26376 |
Sep 26, 2000 |
|
|
|
09950082 |
|
|
|
|
PCT/US00/26371 |
Sep 26, 2000 |
|
|
|
09950082 |
|
|
|
|
PCT/US00/26324 |
Sep 26, 2000 |
|
|
|
09950082 |
|
|
|
|
PCT/US00/26323 |
Sep 26, 2000 |
|
|
|
09950082 |
|
|
|
|
PCT/US00/26337 |
Sep 26, 2000 |
|
|
|
09950082 |
|
|
|
|
PCT/US01/13318 |
Apr 26, 2001 |
|
|
|
09950082 |
|
|
|
|
09950083 |
Sep 12, 2001 |
|
|
|
10105299 |
|
|
|
|
PCT/US00/06043 |
Mar 9, 2000 |
|
|
|
09950083 |
Sep 12, 2001 |
|
|
|
PCT/US00/06012 |
Mar 9, 2000 |
|
|
|
09950083 |
|
|
|
|
PCT/US00/06058 |
Mar 9, 2000 |
|
|
|
09950083 |
|
|
|
|
PCT/US00/06044 |
Mar 9, 2000 |
|
|
|
09950083 |
|
|
|
|
PCT/US00/06059 |
Mar 9, 2000 |
|
|
|
09950083 |
|
|
|
|
PCT/US00/06042 |
Mar 9, 2000 |
|
|
|
09950083 |
|
|
|
|
PCT/US00/06014 |
Mar 9, 2000 |
|
|
|
09950083 |
|
|
|
|
PCT/US00/06013 |
Mar 9, 2000 |
|
|
|
09950083 |
|
|
|
|
PCT/US00/06049 |
Mar 9, 2000 |
|
|
|
09950083 |
|
|
|
|
PCT/US00/06057 |
Mar 9, 2000 |
|
|
|
09950083 |
|
|
|
|
PCT/US00/06824 |
Mar 16, 2000 |
|
|
|
09950083 |
|
|
|
|
PCT/US00/06765 |
Mar 16, 2000 |
|
|
|
09950083 |
|
|
|
|
PCT/US00/06792 |
Mar 16, 2000 |
|
|
|
09950083 |
|
|
|
|
PCT/US00/06830 |
Mar 16, 2000 |
|
|
|
09950083 |
|
|
|
|
PCT/US00/06782 |
Mar 16, 2000 |
|
|
|
09950083 |
|
|
|
|
PCT/US00/06822 |
Mar 16, 2000 |
|
|
|
09950083 |
|
|
|
|
PCT/US00/06791 |
Mar 16, 2000 |
|
|
|
09950083 |
|
|
|
|
PCT/US00/06828 |
Mar 16, 2000 |
|
|
|
09950083 |
|
|
|
|
PCT/US00/06823 |
Mar 16, 2000 |
|
|
|
09950083 |
|
|
|
|
PCT/US00/06781 |
Mar 16, 2000 |
|
|
|
09950083 |
|
|
|
|
PCT/US00/07505 |
Mar 22, 2000 |
|
|
|
09950083 |
|
|
|
|
PCT/US00/07440 |
Mar 22, 2000 |
|
|
|
09950083 |
|
|
|
|
PCT/US00/07506 |
Mar 22, 2000 |
|
|
|
09950083 |
|
|
|
|
PCT/US00/07507 |
Mar 22, 2000 |
|
|
|
09950083 |
|
|
|
|
PCT/US00/07535 |
Mar 22, 2000 |
|
|
|
09950083 |
|
|
|
|
PCT/US00/07525 |
Mar 22, 2000 |
|
|
|
09950083 |
|
|
|
|
PCT/US00/07534 |
Mar 22, 2000 |
|
|
|
09950083 |
|
|
|
|
PCT/US00/07483 |
Mar 22, 2000 |
|
|
|
09950083 |
|
|
|
|
PCT/US00/07526 |
Mar 22, 2000 |
|
|
|
09950083 |
|
|
|
|
PCT/US00/07527 |
Mar 22, 2000 |
|
|
|
09950083 |
|
|
|
|
PCT/US00/07661 |
Mar 23, 2000 |
|
|
|
09950083 |
|
|
|
|
PCT/US00/07579 |
Mar 23, 2000 |
|
|
|
09950083 |
|
|
|
|
PCT/US00/07723 |
Mar 23, 2000 |
|
|
|
09950083 |
|
|
|
|
PCT/US00/07724 |
Mar 23, 2000 |
|
|
|
09950083 |
|
|
|
|
PCT/US00/14929 |
Jun 1, 2000 |
|
|
|
09950083 |
|
|
|
|
PCT/US00/07722 |
Mar 23, 2000 |
|
|
|
09950083 |
|
|
|
|
PCT/US00/07578 |
Mar 23, 2000 |
|
|
|
09950083 |
|
|
|
|
PCT/US00/07726 |
Mar 23, 2000 |
|
|
|
09950083 |
|
|
|
|
PCT/US00/07677 |
Mar 23, 2000 |
|
|
|
09950083 |
|
|
|
|
PCT/US00/07725 |
Mar 23, 2000 |
|
|
|
09950083 |
|
|
|
|
PCT/US00/09070 |
Apr 6, 2000 |
|
|
|
09950083 |
|
|
|
|
PCT/US00/08982 |
Apr 6, 2000 |
|
|
|
09950083 |
|
|
|
|
PCT/US00/08983 |
Apr 6, 2000 |
|
|
|
09950083 |
|
|
|
|
PCT/US00/09067 |
Apr 6, 2000 |
|
|
|
09950083 |
|
|
|
|
PCT/US00/09066 |
Apr 6, 2000 |
|
|
|
09950083 |
|
|
|
|
PCT/US00/09068 |
Apr 6, 2000 |
|
|
|
09950083 |
|
|
|
|
PCT/US00/08981 |
Apr 6, 2000 |
|
|
|
09950083 |
|
|
|
|
PCT/US00/08980 |
Apr 6, 2000 |
|
|
|
09950083 |
|
|
|
|
PCT/US00/09071 |
Apr 6, 2000 |
|
|
|
09950083 |
|
|
|
|
PCT/US00/09069 |
Apr 6, 2000 |
|
|
|
09950083 |
|
|
|
|
PCT/US00/15136 |
Jun 1, 2000 |
|
|
|
09950083 |
|
|
|
|
PCT/US00/14926 |
Jun 1, 2000 |
|
|
|
09950083 |
|
|
|
|
PCT/US00/14963 |
Jun 1, 2000 |
|
|
|
09950083 |
|
|
|
|
PCT/US00/15135 |
Jun 1, 2000 |
|
|
|
09950083 |
|
|
|
|
PCT/US00/14934 |
Jun 1, 2000 |
|
|
|
09950083 |
|
|
|
|
PCT/US00/14933 |
Jun 1, 2000 |
|
|
|
09950083 |
|
|
|
|
PCT/US00/15137 |
Jun 1, 2000 |
|
|
|
09950083 |
|
|
|
|
PCT/US00/14928 |
Jun 1, 2000 |
|
|
|
09950083 |
|
|
|
|
PCT/US00/14973 |
Jun 1, 2000 |
|
|
|
09950083 |
|
|
|
|
PCT/US00/14964 |
Jun 1, 2000 |
|
|
|
09950083 |
|
|
|
|
PCT/US00/26376 |
Sep 26, 2000 |
|
|
|
09950083 |
|
|
|
|
PCT/US00/26371 |
Sep 26, 2000 |
|
|
|
09950083 |
|
|
|
|
PCT/US00/26324 |
Sep 26, 2000 |
|
|
|
09950083 |
|
|
|
|
PCT/US00/26323 |
Sep 26, 2000 |
|
|
|
09950083 |
|
|
|
|
PCT/US00/26337 |
Sep 26, 2000 |
|
|
|
09950083 |
|
|
|
|
PCT/US01/13318 |
Apr 26, 2001 |
|
|
|
09950083 |
|
|
|
|
60278650 |
Mar 27, 2001 |
|
|
|
60167061 |
Nov 23, 1999 |
|
|
|
60124146 |
Mar 12, 1999 |
|
|
|
60166989 |
Nov 23, 1999 |
|
|
|
60124093 |
Mar 12, 1999 |
|
|
|
60168654 |
Dec 3, 1999 |
|
|
|
60124145 |
Mar 12, 1999 |
|
|
|
60168661 |
Dec 3, 1999 |
|
|
|
60124099 |
Mar 12, 1999 |
|
|
|
60168622 |
Dec 3, 1999 |
|
|
|
60124096 |
Mar 12, 1999 |
|
|
|
60168663 |
Dec 3, 1999 |
|
|
|
60124143 |
Mar 12, 1999 |
|
|
|
60168665 |
Dec 3, 1999 |
|
|
|
60138598 |
Jun 11, 1999 |
|
|
|
60124095 |
Mar 12, 1999 |
|
|
|
60168662 |
Dec 3, 1999 |
|
|
|
60138626 |
Jun 11, 1999 |
|
|
|
60125360 |
Mar 19, 1999 |
|
|
|
60168667 |
Dec 3, 1999 |
|
|
|
60138574 |
Jun 11, 1999 |
|
|
|
60124144 |
Mar 12, 1999 |
|
|
|
60168666 |
Dec 3, 1999 |
|
|
|
60138597 |
Jun 11, 1999 |
|
|
|
60124142 |
Mar 12, 1999 |
|
|
|
60125359 |
Mar 19, 1999 |
|
|
|
60169906 |
Dec 10, 1999 |
|
|
|
60126051 |
Mar 23, 1999 |
|
|
|
60169980 |
Dec 10, 1999 |
|
|
|
60125362 |
Mar 19, 1999 |
|
|
|
60169910 |
Dec 10, 1999 |
|
|
|
60125361 |
Mar 19, 1999 |
|
|
|
60169936 |
Dec 10, 1999 |
|
|
|
60125812 |
Mar 23, 1999 |
|
|
|
60169916 |
Dec 10, 1999 |
|
|
|
60126054 |
Mar 23, 1999 |
|
|
|
60169946 |
Dec 10, 1999 |
|
|
|
60125815 |
Mar 23, 1999 |
|
|
|
60169616 |
Dec 8, 1999 |
|
|
|
60125358 |
Mar 19, 1999 |
|
|
|
60169623 |
Dec 8, 1999 |
|
|
|
60125364 |
Mar 19, 1999 |
|
|
|
60169617 |
Dec 8, 1999 |
|
|
|
60125363 |
Mar 19, 1999 |
|
|
|
60172410 |
Dec 17, 1999 |
|
|
|
60126502 |
Mar 26, 1999 |
|
|
|
60172409 |
Dec 17, 1999 |
|
|
|
60126503 |
Mar 26, 1999 |
|
|
|
60172412 |
Dec 17, 1999 |
|
|
|
60126505 |
Mar 26, 1999 |
|
|
|
60172408 |
Dec 17, 1999 |
|
|
|
60126594 |
Mar 26, 1999 |
|
|
|
60172413 |
Dec 17, 1999 |
|
|
|
60126511 |
Mar 26, 1999 |
|
|
|
60171549 |
Dec 22, 1999 |
|
|
|
60126595 |
Mar 26, 1999 |
|
|
|
60171504 |
Dec 22, 1999 |
|
|
|
60126598 |
Mar 26, 1999 |
|
|
|
60171552 |
Dec 22, 1999 |
|
|
|
60126596 |
Mar 26, 1999 |
|
|
|
60171550 |
Dec 22, 1999 |
|
|
|
60126600 |
Mar 26, 1999 |
|
|
|
60171551 |
Dec 22, 1999 |
|
|
|
60126501 |
Mar 26, 1999 |
|
|
|
60174847 |
Jan 7, 2000 |
|
|
|
60126504 |
Mar 26, 1999 |
|
|
|
60174853 |
Jan 7, 2000 |
|
|
|
60126509 |
Mar 26, 1999 |
|
|
|
60174852 |
Jan 7, 2000 |
|
|
|
60126506 |
Mar 26, 1999 |
|
|
|
60174850 |
Jan 7, 2000 |
|
|
|
60126510 |
Mar 26, 1999 |
|
|
|
60174851 |
Jan 7, 2000 |
|
|
|
60138573 |
Jun 11, 1999 |
|
|
|
60174871 |
Jan 7, 2000 |
|
|
|
60126508 |
Mar 26, 1999 |
|
|
|
60174872 |
Jan 7, 2000 |
|
|
|
60126507 |
Mar 26, 1999 |
|
|
|
60174877 |
Jan 7, 2000 |
|
|
|
60126597 |
Mar 26, 1999 |
|
|
|
60176064 |
Jan 14, 2000 |
|
|
|
60154373 |
Sep 17, 1999 |
|
|
|
60126601 |
Mar 26, 1999 |
|
|
|
60176063 |
Jan 14, 2000 |
|
|
|
60126602 |
Mar 26, 1999 |
|
|
|
60176052 |
Jan 14, 2000 |
|
|
|
60128695 |
Apr 9, 1999 |
|
|
|
60176069 |
Jan 14, 2000 |
|
|
|
60128696 |
Apr 9, 1999 |
|
|
|
60176068 |
Jan 14, 2000 |
|
|
|
60128703 |
Apr 9, 1999 |
|
|
|
60176929 |
Jan 20, 2000 |
|
|
|
60128697 |
Apr 9, 1999 |
|
|
|
60176926 |
Jan 20, 2000 |
|
|
|
60128698 |
Apr 9, 1999 |
|
|
|
60177050 |
Jan 20, 2000 |
|
|
|
60128699 |
Apr 9, 1999 |
|
|
|
60177166 |
Jan 20, 2000 |
|
|
|
60128701 |
Apr 9, 1999 |
|
|
|
60176930 |
Jan 20, 2000 |
|
|
|
60128700 |
Apr 9, 1999 |
|
|
|
60176931 |
Jan 20, 2000 |
|
|
|
60128694 |
Apr 9, 1999 |
|
|
|
60177049 |
Jan 20, 2000 |
|
|
|
60128702 |
Apr 9, 1999 |
|
|
|
60138629 |
Jun 11, 1999 |
|
|
|
60138628 |
Jun 11, 1999 |
|
|
|
60138631 |
Jun 11, 1999 |
|
|
|
60138632 |
Jun 11, 1999 |
|
|
|
60138599 |
Jun 11, 1999 |
|
|
|
60138572 |
Jun 11, 1999 |
|
|
|
60138625 |
Jun 11, 1999 |
|
|
|
60138633 |
Jun 11, 1999 |
|
|
|
60138630 |
Jun 11, 1999 |
|
|
|
60138627 |
Jun 11, 1999 |
|
|
|
60155808 |
Sep 27, 1999 |
|
|
|
60155804 |
Sep 27, 1999 |
|
|
|
60155807 |
Sep 27, 1999 |
|
|
|
60155805 |
Sep 27, 1999 |
|
|
|
60155806 |
Sep 27, 1999 |
|
|
|
60212142 |
Jun 16, 2000 |
|
|
|
60201194 |
May 2, 2000 |
|
|
|
60167061 |
Nov 23, 1999 |
|
|
|
60124146 |
Mar 12, 1999 |
|
|
|
60166989 |
Nov 23, 1999 |
|
|
|
60124093 |
Mar 12, 1999 |
|
|
|
60168654 |
Dec 3, 1999 |
|
|
|
60124145 |
Mar 12, 1999 |
|
|
|
60168661 |
Dec 3, 1999 |
|
|
|
60124099 |
Mar 12, 1999 |
|
|
|
60168622 |
Dec 3, 1999 |
|
|
|
60124096 |
Mar 12, 1999 |
|
|
|
60168663 |
Dec 3, 1999 |
|
|
|
60124143 |
Mar 12, 1999 |
|
|
|
60168665 |
Dec 3, 1999 |
|
|
|
60138598 |
Jun 11, 1999 |
|
|
|
60124095 |
Mar 12, 1999 |
|
|
|
60168662 |
Dec 3, 1999 |
|
|
|
60138626 |
Jun 11, 1999 |
|
|
|
60125360 |
Mar 19, 1999 |
|
|
|
60168667 |
Dec 3, 1999 |
|
|
|
60138574 |
Jun 11, 1999 |
|
|
|
60124144 |
Mar 12, 1999 |
|
|
|
60168666 |
Dec 3, 1999 |
|
|
|
60138597 |
Jun 11, 1999 |
|
|
|
60124142 |
Mar 12, 1999 |
|
|
|
60168664 |
Dec 3, 1999 |
|
|
|
60125359 |
Mar 19, 1999 |
|
|
|
60169906 |
Dec 10, 1999 |
|
|
|
60126051 |
Mar 23, 1999 |
|
|
|
60169980 |
Dec 10, 1999 |
|
|
|
60125362 |
Mar 19, 1999 |
|
|
|
60169910 |
Dec 10, 1999 |
|
|
|
60125361 |
Mar 19, 1999 |
|
|
|
60169936 |
Dec 10, 1999 |
|
|
|
60125812 |
Mar 23, 1999 |
|
|
|
60169916 |
Dec 10, 1999 |
|
|
|
60126054 |
Mar 23, 1999 |
|
|
|
60169946 |
Dec 10, 1999 |
|
|
|
60125815 |
Mar 23, 1999 |
|
|
|
60169616 |
Dec 8, 1999 |
|
|
|
60125358 |
Mar 19, 1999 |
|
|
|
60169623 |
Dec 8, 1999 |
|
|
|
60125364 |
Mar 19, 1999 |
|
|
|
60169617 |
Dec 8, 1999 |
|
|
|
60125363 |
Mar 19, 1999 |
|
|
|
60172410 |
Dec 17, 1999 |
|
|
|
60126502 |
Mar 26, 1999 |
|
|
|
60172409 |
Dec 17, 1999 |
|
|
|
60126503 |
Mar 26, 1999 |
|
|
|
60172412 |
Dec 17, 1999 |
|
|
|
60126505 |
Mar 26, 1999 |
|
|
|
60172408 |
Dec 17, 1999 |
|
|
|
60126594 |
Mar 26, 1999 |
|
|
|
60172413 |
Dec 17, 1999 |
|
|
|
60126511 |
Mar 26, 1999 |
|
|
|
60171549 |
Dec 22, 1999 |
|
|
|
60126595 |
Mar 26, 1999 |
|
|
|
60171504 |
Dec 22, 1999 |
|
|
|
60126598 |
Mar 26, 1999 |
|
|
|
60171552 |
Dec 22, 1999 |
|
|
|
60126596 |
Mar 26, 1999 |
|
|
|
60171550 |
Dec 22, 1999 |
|
|
|
60126600 |
Mar 26, 1999 |
|
|
|
60171551 |
Dec 22, 1999 |
|
|
|
60126501 |
Mar 26, 1999 |
|
|
|
60174847 |
Jan 7, 2000 |
|
|
|
60126504 |
Mar 26, 1999 |
|
|
|
60174853 |
Jan 7, 2000 |
|
|
|
60126509 |
Mar 26, 1999 |
|
|
|
60174852 |
Jan 7, 2000 |
|
|
|
60126506 |
Mar 26, 1999 |
|
|
|
60174850 |
Jan 7, 2000 |
|
|
|
60126510 |
Mar 26, 1999 |
|
|
|
60174851 |
Jan 7, 2000 |
|
|
|
60138573 |
Jun 11, 1999 |
|
|
|
60174871 |
Jan 7, 2000 |
|
|
|
60126508 |
Mar 26, 1999 |
|
|
|
60174872 |
Jan 7, 2000 |
|
|
|
60126507 |
Mar 26, 1999 |
|
|
|
60174877 |
Jan 7, 2000 |
|
|
|
60126597 |
Mar 26, 1999 |
|
|
|
60176064 |
Jan 14, 2000 |
|
|
|
60154373 |
Sep 17, 1999 |
|
|
|
60126601 |
Mar 26, 1999 |
|
|
|
60176063 |
Jan 14, 2000 |
|
|
|
60126602 |
Mar 26, 1999 |
|
|
|
60176052 |
Jan 14, 2000 |
|
|
|
60128695 |
Apr 9, 1999 |
|
|
|
60176069 |
Jan 14, 2000 |
|
|
|
60128696 |
Apr 9, 1999 |
|
|
|
60176068 |
Jan 14, 2000 |
|
|
|
60128703 |
Apr 9, 1999 |
|
|
|
60176929 |
Jan 20, 2000 |
|
|
|
60128697 |
Apr 9, 1999 |
|
|
|
60176926 |
Jan 20, 2000 |
|
|
|
60128698 |
Apr 9, 1999 |
|
|
|
60177050 |
Jan 20, 2000 |
|
|
|
60128699 |
Apr 9, 1999 |
|
|
|
60177166 |
Jan 20, 2000 |
|
|
|
60128701 |
Apr 9, 1999 |
|
|
|
60176930 |
Jan 20, 2000 |
|
|
|
60128700 |
Apr 9, 1999 |
|
|
|
60176931 |
Jan 20, 2000 |
|
|
|
60128694 |
Apr 9, 1999 |
|
|
|
60177049 |
Jan 20, 2000 |
|
|
|
60128702 |
Apr 9, 1999 |
|
|
|
60138629 |
Jun 11, 1999 |
|
|
|
60138628 |
Jun 11, 1999 |
|
|
|
60138631 |
Jun 11, 1999 |
|
|
|
60138632 |
Jun 11, 1999 |
|
|
|
60138599 |
Jun 11, 1999 |
|
|
|
60138572 |
Jun 11, 1999 |
|
|
|
60138625 |
Jun 11, 1999 |
|
|
|
60138633 |
Jun 11, 1999 |
|
|
|
60138630 |
Jun 11, 1999 |
|
|
|
60138627 |
Jun 11, 1999 |
|
|
|
60155808 |
Sep 27, 1999 |
|
|
|
60155804 |
Sep 27, 1999 |
|
|
|
60155807 |
Sep 27, 1999 |
|
|
|
60155805 |
Sep 27, 1999 |
|
|
|
60155806 |
Sep 27, 1999 |
|
|
|
60212142 |
Jun 16, 2000 |
|
|
|
60201194 |
May 2, 2000 |
|
|
|
Current U.S.
Class: |
424/130.1 ;
514/1.9; 514/13.2; 514/13.3; 514/15.4; 514/15.7; 514/16.4;
514/18.2; 514/19.3; 514/19.5; 514/44R; 514/6.9; 514/9.4; 530/350;
530/388.1; 536/23.5 |
Current CPC
Class: |
A61K 38/17 20130101;
C07K 14/47 20130101; Y02A 50/30 20180101; G01N 2500/00 20130101;
Y02A 50/401 20180101; G01N 33/566 20130101 |
Class at
Publication: |
424/130.1 ;
514/012; 530/350; 530/388.1; 514/044; 536/023.5 |
International
Class: |
A61K 39/395 20060101
A61K039/395; A61K 38/17 20060101 A61K038/17; A61K 48/00 20060101
A61K048/00; C07H 21/04 20060101 C07H021/04 |
Claims
1. Use of a polypeptide for the preparation of a diagnostic or
pharmaceutical composition for diagnosing or treating a medical
condition, wherein said polypeptide comprises an amino acid
sequence at least 95% identical to a sequence selected from the
group consisting of: (a) a full length polypeptide of SEQ ID NO:Y
or a full length polypeptide encoded by the cDNA Clone ID in ATCC
Deposit No: Z corresponding to SEQ ID NO:Y as referenced in Table
1A; (b) a predicted secreted form of SEQ ID NO:Y or a secreted form
of the polypeptide encoded by the cDNA Clone ID in ATCC Deposit No:
Z corresponding to SEQ ID NO:Y as referenced in Table 1A; (c) a
polypeptide fragment of SEQ ID NO:Y or a polypeptide fragment
encoded by the cDNA Clone ID in ATCC Deposit No: Z corresponding to
SEQ ID NO:Y as referenced in Table 1A; (d) a polypeptide fragment
of SEQ ID NO:Y or a polypeptide fragment encoded by the cDNA Clone
ID in ATCC Deposit No: Z corresponding to SEQ ID NO:Y as referenced
in Table 1A, wherein said fragment has biological activity; (e) a
polypeptide domain of SEQ ID NO:Y as referenced in Table 1B; (f) a
polypeptide domain of SEQ ID NO:Y as referenced in Table 2; and (g)
a predicted epitope of SEQ ID NO:Y as referenced in Table 1B.
2. Use of the polypeptide of claim 1, wherein said wherein said
polypeptide comprises a heterologous amino acid sequence.
3. Use of a polypeptide for the preparation of a diagnostic or
pharmaceutical composition for diagnosing or treating a medical
condition, wherein said polypeptide comprises an amino acid
sequence selected from the group consisting of: (a) a full length
polypeptide of SEQ ID NO:Y or a full length polypeptide encoded by
the cDNA Clone ID in ATCC Deposit No: Z corresponding to SEQ ID
NO:Y as referenced in Table 1A; (b) a predicted secreted form of
SEQ ID NO:Y or a secreted form of the polypeptide encoded by the
cDNA Clone ID in ATCC Deposit No: Z corresponding to SEQ ID NO:Y as
referenced in Table 1A; (c) a polypeptide fragment of SEQ ID NO:Y
or a polypeptide fragment encoded by the cDNA Clone ID in ATCC
Deposit No: Z corresponding to SEQ ID NO:Y as referenced in Table
1A; (d) a polypeptide fragment of SEQ ID NO:Y or a polypeptide
fragment encoded by the cDNA Clone ID in ATCC Deposit No: Z
corresponding to SEQ ID NO:Y as referenced in Table 1A, wherein
said fragment has biological activity; (e) a polypeptide domain of
SEQ ID NO:Y as referenced in Table 1B; (f) a polypeptide domain of
SEQ ID NO:Y as referenced in Table 2; and (g) a predicted epitope
of SEQ ID NO:Y as referenced in Table 1B.
4. Use of the polypeptide of claim 3, wherein said polypeptide
comprises a heterologous amino acid sequence.
5. Use of an antibody or fragment thereof for the preparation of a
diagnostic or pharmaceutical composition for diagnosing or treating
a medical condition, wherein said antibody or fragment thereof
binds a polypeptide comprising an amino acid sequence at least 95%
identical to a sequence selected from the group consisting of: (a)
a full length polypeptide of SEQ ID NO:Y or a full length
polypeptide encoded by the cDNA Clone ID in ATCC Deposit No: Z
corresponding to SEQ ID NO:Y as referenced in Table 1A; (b) a
predicted secreted form of SEQ ID NO:Y or a secreted form of the
polypeptide encoded by the cDNA Clone ID in ATCC Deposit No: Z
corresponding to SEQ ID NO:Y as referenced in Table 1A; (c) a
polypeptide fragment of SEQ ID NO:Y or a polypeptide fragment
encoded by the cDNA Clone ID in ATCC Deposit No: Z corresponding to
SEQ ID NO:Y as referenced in Table 1A; (d) a polypeptide fragment
of SEQ ID NO:Y or a polypeptide fragment encoded by the cDNA Clone
ID in ATCC Deposit No: Z corresponding to SEQ ID NO:Y as referenced
in Table 1A, wherein said fragment has biological activity; (e) a
polypeptide domain of SEQ ID NO: Y as referenced in Table 1B; (f) a
polypeptide domain of SEQ ID NO:Y as referenced in Table 2; and (g)
a predicted epitope of SEQ ID NO:Y as referenced in Table 1B.
6. Use of an antibody or fragment thereof for the preparation of a
diagnostic or pharmaceutical composition for diagnosing or treating
a medical condition, wherein said antibody or fragment thereof
binds a polypeptide selected from the group consisting of: (a) a
full length polypeptide of SEQ ID NO:Y or a full length polypeptide
encoded by the cDNA Clone ID in ATCC Deposit No: Z corresponding to
SEQ ID NO:Y as referenced in Table 1A; (b) a predicted secreted
form of SEQ ID NO:Y or a secreted form of the polypeptide encoded
by the cDNA Clone ID in ATCC Deposit No: Z corresponding to SEQ ID
NO:Y as referenced in Table 1A; (c) a polypeptide fragment of SEQ
ID NO:Y or a polypeptide fragment encoded by the cDNA Clone ID in
ATCC Deposit No: Z corresponding to SEQ ID NO:Y as referenced in
Table 1A; (d) a polypeptide fragment of SEQ ID NO:Y or a
polypeptide fragment encoded by the cDNA Clone ID in ATCC Deposit
No: Z corresponding to SEQ ID NO:Y as referenced in Table 1A,
wherein said fragment has biological activity; (e) a polypeptide
domain of SEQ ID NO:Y as referenced in Table 1B; (f) a polypeptide
domain of SEQ ID NO:Y as referenced in Table 2; and (g) a predicted
epitope of SEQ ID NO:Y as referenced in Table 1B.
7. Use of a nucleic acid molecule for the preparation of a
diagnostic or pharmaceutical composition for diagnosing or treating
a medical condition, wherein said nucleic acid molecule comprises a
polynucleotide sequence at least 95% identical to a sequence
selected from the group consisting of: (a) a polynucleotide
fragment of SEQ ID NO:X as referenced in Table 1A; (b) a
polynucleotide encoding a full length polypeptide of SEQ ID NO:Y or
a full length polypeptide encoded by the cDNA Clone ID in ATCC
Deposit No: Z corresponding to SEQ ID NO:Y as referenced in Table
1A; (c) a polynucleotide encoding a predicted secreted form of SEQ
ID NO:Y or a secreted form of the polypeptide encoded by the cDNA
Clone ID in ATCC Deposit No: Z corresponding to SEQ ID NO:Y as
referenced in Table 1A; (d) a polynucleotide encoding a polypeptide
fragment of SEQ ID NO:Y or a polypeptide fragment encoded by the
cDNA Clone ID in ATCC Deposit No: Z corresponding to SEQ ID NO:Y as
referenced in Table 1A; (e) a polynucleotide encoding a polypeptide
fragment of SEQ ID NO:Y or a polypeptide fragment encoded by the
cDNA Clone ID in ATCC Deposit No: Z corresponding to SEQ ID NO:Y as
referenced in Table 1A, wherein said fragment has biological
activity; (f) a polynucleotide encoding a polypeptide domain of SEQ
ID NO:Y as referenced in Table 1B; (g) a polynucleotide encoding a
polypeptide domain of SEQ ID NO:Y as referenced in Table 2; and (h)
a polynucleotide encoding a predicted epitope of SEQ ID NO:Y as
referenced in Table 1B.
8. Use of the nucleic acid molecule of claim 7, wherein said
nucleic acid molecule comprises a heterologous polynucleotide
sequence.
9. Use of a nucleic acid molecule for the preparation of a
diagnostic or pharmaceutical composition for diagnosing or treating
a medical condition, wherein said nucleic acid molecule comprises a
polynucleotide sequence selected from the group consisting of: (a)
a polynucleotide fragment of SEQ ID NO:X as referenced in Table 1A;
(b) a polynucleotide encoding a full length polypeptide of SEQ ID
NO:Y or a full length polypeptide encoded by the cDNA Clone ID in
ATCC Deposit No: Z corresponding to SEQ ID NO:Y as referenced in
Table 1A; (c) a polynucleotide encoding a predicted secreted form
of SEQ ID NO:Y or a secreted form of the polypeptide encoded by the
cDNA Clone ID in ATCC Deposit No: Z corresponding to SEQ ID NO:Y as
referenced in Table 1A; (d) a polynucleotide encoding a polypeptide
fragment of SEQ ID NO:Y or a polypeptide fragment encoded by the
cDNA Clone ID in ATCC Deposit No: Z corresponding to SEQ ID NO:Y as
referenced in Table 1A; (e) a polynucleotide encoding a polypeptide
fragment of SEQ ID NO:Y or a polypeptide fragment encoded by the
cDNA Clone ID in ATCC Deposit No: Z corresponding to SEQ ID NO:Y as
referenced in Table 1A, wherein said fragment has biological
activity; (f) a polynucleotide encoding a polypeptide domain of SEQ
ID NO:Y as referenced in Table 1B; (g) a polynucleotide encoding a
polypeptide domain of SEQ ID NO:Y as referenced in Table 2; and (h)
a polynucleotide encoding a predicted epitope of SEQ ID NO:Y as
referenced in Table 1B.
10. Use of the nucleic acid molecule of claim 9, wherein said
nucleic acid molecule comprises a heterologous polynucleotide
sequence.
11. Use of an agonist or antagonist for the preparation of a
pharmaceutical composition for treating a medical condition,
wherein said agonist or antagonist binds a polypeptide comprising
an amino acid sequence at least 95% identical to a sequence
selected from the group consisting of: (a) a full length
polypeptide of SEQ ID NO:Y or a full length polypeptide encoded by
the cDNA Clone ID in ATCC Deposit No: Z corresponding to SEQ ID
NO:Y as referenced in Table 1A; (b) a predicted secreted form of
SEQ ID NO:Y or a secreted form of the polypeptide encoded by the
cDNA Clone ID in ATCC Deposit No: Z corresponding to SEQ ID NO:Y as
referenced in Table 1A; (c) a polypeptide fragment of SEQ ID NO:Y
or a polypeptide fragment encoded by the cDNA Clone ID in ATCC
Deposit No: Z corresponding to SEQ ID NO:Y as referenced in Table
1A; (d) a polypeptide fragment of SEQ ID NO:Y or a polypeptide
fragment encoded by the cDNA Clone ID in ATCC Deposit No: Z
corresponding to SEQ ID NO:Y as referenced in Table 1A, wherein
said fragment has biological activity; (e) a polypeptide domain of
SEQ ID NO:Y as referenced in Table 1B; (f) a polypeptide domain of
SEQ ID NO:Y as referenced in Table 2; and (g) a predicted epitope
of SEQ ID NO:Y as referenced in Table 1B.
12. Use of an agonist or antagonist for the preparation of a
pharmaceutical composition for treating a medical condition,
wherein said agonist or antagonist binds a polypeptide selected
from the group consisting of: (a) a full length polypeptide of SEQ
ID NO:Y or a full length polypeptide encoded by the cDNA Clone ID
in ATCC Deposit No: Z corresponding to SEQ ID NO:Y as referenced in
Table 1A; (b) a predicted secreted form of SEQ ID NO:Y or a
secreted form of the polypeptide encoded by the cDNA Clone ID in
ATCC Deposit No: Z corresponding to SEQ ID NO:Y as referenced in
Table 1A; (c) a polypeptide fragment of SEQ ID NO:Y or a
polypeptide fragment encoded by the cDNA Clone ID in ATCC Deposit
No: Z corresponding to SEQ ID NO:Y as referenced in Table 1A; (d) a
polypeptide fragment of SEQ ID NO:Y or a polypeptide fragment
encoded by the cDNA Clone ID in ATCC Deposit No: Z corresponding to
SEQ ID NO:Y as referenced in Table 1A, wherein said fragment has
biological activity; (e) a polypeptide domain of SEQ ID NO:Y as
referenced in Table 1B; (f) a polypeptide domain of SEQ ID NO:Y as
referenced in Table 2; and (g) a predicted epitope of SEQ ID NO:Y
as referenced in Table 1B.
13. A polypeptide comprising an amino acid sequence at least 95%
identical to a sequence selected from the group consisting of: (a)
a full length polypeptide of SEQ ID NO:Y or a full length
polypeptide encoded by the cDNA Clone ID in ATCC Deposit No: Z
corresponding to SEQ ID NO:Y as referenced in Table 1A; (b) a
predicted secreted form of SEQ ID NO:Y or a secreted form of the
polypeptide encoded by the cDNA Clone ID in ATCC Deposit No: Z
corresponding to SEQ ID NO:Y as referenced in Table 1A; (c) a
polypeptide fragment of SEQ ID NO:Y or a polypeptide fragment
encoded by the cDNA Clone ID in ATCC Deposit No: Z corresponding to
SEQ ID NO:Y as referenced in Table 1A; (d) a polypeptide fragment
of SEQ ID NO:Y or a polypeptide fragment encoded by the cDNA Clone
ID in ATCC Deposit No: Z corresponding to SEQ ID NO:Y as referenced
in Table 1A, wherein said fragment has biological activity; (e) a
polypeptide domain of SEQ ID NO:Y as referenced in Table 1B; (f) a
polypeptide domain of SEQ ID NO:Y as referenced in Table 2; and (g)
a predicted epitope of SEQ ID NO:Y as referenced in Table 1B.
14. The polypeptide of claim 13, wherein said polypeptide comprises
a heterologous amino acid sequence.
15. Use of the polypeptide of claim 13 for identifying a binding
partner comprising: (a) contacting the polypeptide of claim 13 with
a binding partner; and (b) determining whether the binding partner
increases or decreases activity of the polypeptide.
16. A polypeptide comprising an amino acid sequence selected from
the group consisting of: (a) a full length polypeptide of SEQ ID
NO:Y or a full length polypeptide encoded by the cDNA Clone ID in
ATCC Deposit No: Z corresponding to SEQ ID NO:Y as referenced in
Table 1A; (b) a predicted secreted form of SEQ ID NO:Y or a
secreted form of the polypeptide encoded by the cDNA Clone ID in
ATCC Deposit No: Z corresponding to SEQ ID NO:Y as referenced in
Table 1A; (c) a polypeptide fragment of SEQ ID NO:Y or a
polypeptide fragment encoded by the cDNA Clone ID in ATCC Deposit
No: Z corresponding to SEQ ID NO:Y as referenced in Table 1A; (d) a
polypeptide fragment of SEQ ID NO:Y or a polypeptide fragment
encoded by the cDNA Clone ID in ATCC Deposit No: Z corresponding to
SEQ ID NO:Y as referenced in Table 1A, wherein said fragment has
biological activity; (e) a polypeptide domain of SEQ ID NO:Y as
referenced in Table 1B; (f) a polypeptide domain of SEQ ID NO:Y as
referenced in Table 2; and (g) a predicted epitope of SEQ ID NO:Y
as referenced in Table 1B.
17. The polypeptide of claim 16, wherein said polypeptide comprises
a heterologous polypeptide sequence.
18. Use of the polypeptide of claim 16 for identifying a binding
partner comprising: (a) contacting the polypeptide of claim 16 with
a binding partner; and (b) determining whether the binding partner
increases or decreases activity of the polypeptide.
19. An antibody or fragment thereof that binds a polypeptide
comprising an amino acid sequence at least 95% identical to a
sequence selected from the group consisting of: (a) a full length
polypeptide of SEQ ID NO:Y or a full length polypeptide encoded by
the cDNA Clone ID in ATCC Deposit No: Z corresponding to SEQ ID
NO:Y as referenced in Table 1A; (b) a predicted secreted form of
SEQ ID NO:Y or a secreted form of the polypeptide encoded by the
cDNA Clone ID in ATCC Deposit No: Z corresponding to SEQ ID NO:Y as
referenced in Table 1A; (c) a polypeptide fragment of SEQ ID NO:Y
or a polypeptide fragment encoded by the cDNA Clone ID in ATCC
Deposit No: Z corresponding to SEQ ID NO:Y as referenced in Table
1A; (d) a polypeptide fragment of SEQ ID NO:Y or a polypeptide
fragment encoded by the cDNA Clone ID in ATCC Deposit No: Z
corresponding to SEQ ID NO:Y as referenced in Table 1A, wherein
said fragment has biological activity; (e) a polypeptide domain of
SEQ ID NO:Y as referenced in Table 1B; (f) a polypeptide domain of
SEQ ID NO:Y as referenced in Table 2; and (g) a predicted epitope
of SEQ ID NO:Y as referenced in Table 1B.
20. An antibody or fragment thereof that binds a polypeptide
selected from the group consisting of: (a) a full length
polypeptide of SEQ ID NO:Y or a full length polypeptide encoded by
the cDNA Clone ID in ATCC Deposit No: Z corresponding to SEQ ID
NO:Y as referenced in Table 1A; (b) a predicted secreted form of
SEQ ID NO:Y or a secreted form of the polypeptide encoded by the
cDNA Clone ID in ATCC Deposit No: Z corresponding to SEQ ID NO:Y as
referenced in Table 1A; (c) a polypeptide fragment of SEQ ID NO:Y
or a polypeptide fragment encoded by the cDNA Clone ID in ATCC
Deposit No: Z corresponding to SEQ ID NO:Y as referenced in Table
1A; (d) a polypeptide fragment of SEQ ID NO:Y or a polypeptide
fragment encoded by the cDNA Clone ID in ATCC Deposit No: Z
corresponding to SEQ ID NO:Y as referenced in Table 1A, wherein
said fragment has biological activity; (e) a polypeptide domain of
SEQ ID NO:Y as referenced in Table 1B; (f) a polypeptide domain of
SEQ ID NO:Y as referenced in Table 2; and (g) a predicted epitope
of SEQ ID NO:Y as referenced in Table 1B.
21. A nucleic acid molecule comprising a polynucleotide sequence at
least 95% identical to a sequence selected from the group
consisting of: (a) a polynucleotide fragment of SEQ ID NO:X as
referenced in Table 1A; (b) a polynucleotide encoding a full length
polypeptide of SEQ ID NO:Y or a full length polypeptide encoded by
the cDNA Clone ID in ATCC Deposit No: Z corresponding to SEQ ID
NO:Y as referenced in Table 1A; (c) a polynucleotide encoding a
predicted secreted form of SEQ ID NO:Y or a secreted form of the
polypeptide encoded by the cDNA Clone ID in ATCC Deposit No: Z
corresponding to SEQ ID NO:Y as referenced in Table 1A; (d) a
polynucleotide encoding a polypeptide fragment of SEQ ID NO:Y or a
polypeptide fragment encoded by the cDNA Clone ID in ATCC Deposit
No: Z corresponding to SEQ ID NO:Y as referenced in Table 1A; (e) a
polynucleotide encoding a polypeptide fragment of SEQ ID NO:Y or a
polypeptide fragment encoded by the cDNA Clone ID in ATCC Deposit
No: Z corresponding to SEQ ID NO:Y as referenced in Table 1A,
wherein said fragment has biological activity; (f) a polynucleotide
encoding a polypeptide domain of SEQ ID NO:Y as referenced in Table
1B; (g) a polynucleotide encoding a polypeptide domain of SEQ ID
NO:Y as referenced in Table 2; and (h) a polynucleotide encoding a
predicted epitope of SEQ ID NO:Y as referenced in Table 1B.
22. The nucleic acid molecule of claim 21, wherein said nucleic
acid molecule comprises a heterologous polynucleotide sequence.
23. A recombinant vector comprising the nucleic acid molecule of
claim 21.
24. A recombinant vector comprising the nucleic acid molecule of
claim 22.
25. A recombinant host cell comprising the recombinant vector of
claim 23.
26. A recombinant host cell comprising the recombinant vector of
claim 24.
27. A nucleic acid molecule comprising a polynucleotide sequence
selected from the group consisting of: (a) a polynucleotide
fragment of SEQ ID NO:X as referenced in Table 1A; (b) a
polynucleotide encoding a full length polypeptide of SEQ ID NO:Y or
a full length polypeptide encoded by the cDNA Clone ID in ATCC
Deposit No: Z corresponding to SEQ ID NO:Y as referenced in Table
1A; (c) a polynucleotide encoding a predicted secreted form of SEQ
ID NO:Y or a secreted form of the polypeptide encoded by the cDNA
Clone ID in ATCC Deposit No: Z corresponding to SEQ ID NO:Y as
referenced in Table 1A; (d) a polynucleotide encoding a polypeptide
fragment of SEQ ID NO:Y or a polypeptide fragment encoded by the
cDNA Clone ID in ATCC Deposit No: Z corresponding to SEQ ID NO:Y as
referenced in Table 1A; (e) a polynucleotide encoding a polypeptide
fragment of SEQ ID NO:Y or a polypeptide fragment encoded by the
cDNA Clone ID in ATCC Deposit No: Z corresponding to SEQ ID NO:Y as
referenced in Table 1A, wherein said fragment has biological
activity; (f) a polynucleotide encoding a polypeptide domain of SEQ
ID NO:Y as referenced in Table 1B; (g) a polynucleotide encoding a
polypeptide domain of SEQ ID NO:Y as referenced in Table 2; and (h)
a polynucleotide encoding a predicted epitope of SEQ ID NO:Y as
referenced in Table 1B.
28. The nucleic acid molecule of claim 27, wherein said nucleic
acid molecule comprises a heterologous polynucleotide sequence.
29. A recombinant vector comprising the nucleic acid molecule of
claim 27.
30. A recombinant vector comprising the nucleic acid molecule of
claim 28.
31. A recombinant host cell comprising the recombinant vector of
claim 29.
32. A recombinant host cell comprising the recombinant vector of
claim 30.
Description
STATEMENT UNDER 37 C.F.R. .sctn.1.77(b)(4)
[0001] This application refers to a "Sequence Listing" listed
below, which is provided as an electronic document on two identical
compact discs (CD-R), labeled "Copy 1" and "Copy 2." These compact
discs each contain the file "PS950D1_SeqList.txt" (7,281 bytes,
created on Mar. 20, 2002), which is hereby incorporated in its
entirety herein. The Sequence Listing may be viewed on an IBM-PC
machine running the MS-Windows operating system.
FIELD OF THE INVENTION
[0002] The present invention relates to human secreted
proteins/polypeptides, and isolated nucleic acid molecules encoding
said proteins/polypeptides, useful for detecting, preventing,
diagnosing, prognosticating, treating, and/or ameliorating diseases
and disorders related to said proteins/polypeptides (relatedness
may be by direct or indirect association, by cause, by consequence,
or by effect on said diseases and disorders). Antibodies that bind
these polypeptides are also encompassed by the present invention.
Also encompassed by the invention are vectors, host cells, and
recombinant and synthetic methods for producing said
polynucleotides, polypeptides, and/or antibodies. The invention
further encompasses screening methods for identifying agonists and
antagonists of polynucleotides and polypeptides of the invention.
The present invention further encompasses methods and compositions
for inhibiting or enhancing the production and function of the
polypeptides of the present invention.
BACKGROUND OF THE INVENTION
[0003] Unlike bacterium, which exist as a single compartment
surrounded by a membrane, human cells and other eukaryotes are
subdivided by membranes into many functionally distinct
compartments. Each membrane-bounded compartment, or organelle,
contains different proteins essential for the function of the
organelle. The cell uses "sorting signals," which are amino acid
motifs located within the protein, to target proteins to particular
cellular organelles.
[0004] One type of sorting signal, called a signal sequence, a
signal peptide, or a leader sequence, directs a class of proteins
to an organelle called the endoplasmic reticulum (ER). The ER
separates the membrane-bounded proteins from all other types of
proteins. Once localized to the ER, both groups of proteins can be
further directed to another organelle called the Golgi apparatus.
Here, the Golgi distributes the proteins to vesicles, including
secretory vesicles, the cell membrane, lysosomes, and the other
organelles.
[0005] Proteins targeted to the ER by a signal sequence can be
released into the extracellular space as a secreted protein. For
example, vesicles containing secreted proteins can fuse with the
cell membrane and release their contents into the extracellular
space--a process called exocytosis. Exocytosis can occur
constitutively or after receipt of a triggering signal. In the
latter case, the proteins are stored in secretory vesicles (or
secretory granules) until exocytosis is triggered. Similarly,
proteins residing on the cell membrane can also be secreted into
the extracellular space by proteolytic cleavage of a "linker"
holding the protein to the membrane.
[0006] Thus there exists a clear need for identifying and using
novel secreted polynucleotides and polypeptides. Identification and
sequencing of human genes is a major goal of modern scientific
research. For example, by identifying genes and determining their
sequences, scientists have been able to make large quantities of
valuable human "gene products." These include human insulin,
interferon, Factor VIII, tumor necrosis factor, human growth
hormone, tissue plasminogen activator, and numerous other
compounds. Additionally, knowledge of gene sequences can provide
the key to treatment or cure of genetic diseases (such as muscular
dystrophy and cystic fibrosis).
SUMMARY OF THE INVENTION
[0007] The present invention relates to human secreted
proteins/polypeptides, and isolated nucleic acid molecules encoding
said proteins/polypeptides, useful for detecting, preventing,
diagnosing, prognosticating, treating, and/or ameliorating diseases
and disorders related to said proteins/polypeptides (relatedness
may be by direct or indirect association, or by cause, consequence,
or effect on said diseases and disorders). Antibodies that bind
these polypeptides are also encompassed by the present invention.
Also encompassed by the invention are vectors, host cells, and
recombinant and synthetic methods for producing said
polynucleotides, polypeptides, and/or antibodies. The invention
further encompasses screening methods for identifying agonists and
antagonists of polynucleotides and polypeptides of the invention.
The present invention further encompasses methods and compositions
for inhibiting or enhancing the production and function of the
polypeptides of the present invention.
DETAILED DESCRIPTION
Polynucleotides and Polypeptides of the Invention
Description of Table 1A
[0008] Table 1A summarizes information concerning certain
polynucleotides and polypeptides of the invention. The first column
provides the gene number in the application for each clone
identifier. The second column provides a unique clone identifier,
"Clone ID:", for a cDNA clone related to each contig sequence
disclosed in Table 1A. Third column, the cDNA Clones identified in
the second column were deposited as indicated in the third column
(i.e. by ATCC Deposit No: Z and deposit date). Some of the deposits
contain multiple different clones corresponding to the same gene.
In the fourth column, "Vector" refers to the type of vector
contained in the corresponding cDNA Clone identified in the second
column. In the fifth column, the nucleotide sequence identified as
"NT SEQ ID NO:X" was assembled from partially homologous
("overlapping") sequences obtained from the corresponding cDNA
clone identified in the second column and, in some cases, from
additional related cDNA clones. The overlapping sequences were
assembled into a single contiguous sequence of high redundancy
(usually three to five overlapping sequences at each nucleotide
position), resulting in a final sequence identified as SEQ ID NO:X.
In the sixth column, "Total NT Seq." refers to the total number of
nucleotides in the contig sequence identified as SEQ ID NO:X." The
deposited clone may contain all or most of these sequences,
reflected by the nucleotide position indicated as "5' NT of Clone
Seq." (seventh column) and the "3' NT of Clone Seq." (eighth
column) of SEQ ID NO:X. In the ninth column, the nucleotide
position of SEQ ID NO:X of the putative start codon (methionine) is
identified as "5' NT of Start Codon." Similarly, in column ten, the
nucleotide position of SEQ ID NO:X of the predicted signal sequence
is identified as "5' NT of First AA of Signal Pep." In the eleventh
column, the translated amino acid sequence, beginning with the
methionine, is identified as "AA SEQ ID NO:Y," although other
reading frames can also be routinely translated using known
molecular biology techniques. The polypeptides produced by these
alternative open reading frames are specifically contemplated by
the present invention.
[0009] In the twelfth and thirteenth columns of Table 1A, the first
and last amino acid position of SEQ ID NO:Y of the predicted signal
peptide is identified as "First AA of Sig Pep" and "Last AA of Sig
Pep." In the fourteenth column, the predicted first amino acid
position of SEQ ID NO:Y of the secreted portion is identified as
"Predicted First AA of Secreted Portion". The amino acid position
of SEQ ID NO:Y of the last amino acid encoded by the open reading
frame is identified in the fifteenth column as "Last AA of
ORF".
[0010] SEQ ID NO:X (where X may be any of the polynucleotide
sequences disclosed in the sequence listing) and the translated SEQ
ID NO:Y (where Y may be any of the polypeptide sequences disclosed
in the sequence listing) are sufficiently accurate and otherwise
suitable for a variety of uses well known in the art and described
further below. For instance, SEQ ID NO:X is useful for designing
nucleic acid hybridization probes that will detect nucleic acid
sequences contained in SEQ ID NO:X or the cDNA contained in the
deposited clone. These probes will also hybridize to nucleic acid
molecules in biological samples, thereby enabling a variety of
forensic and diagnostic methods of the invention. Similarly,
polypeptides identified from SEQ ID NO:Y may be used, for example,
to generate antibodies which bind specifically to proteins
containing the polypeptides and the secreted proteins encoded by
the cDNA clones identified in Table 1A and/or elsewhere herein
[0011] Nevertheless, DNA sequences generated by sequencing
reactions can contain sequencing errors. The errors exist as
misidentified nucleotides, or as insertions or deletions of
nucleotides in the generated DNA sequence. The erroneously inserted
or deleted nucleotides cause frame shifts in the reading frames of
the predicted amino acid sequence. In these cases, the predicted
amino acid sequence diverges from the actual amino acid sequence,
even though the generated DNA sequence may be greater than 99.9%
identical to the actual DNA sequence (for example, one base
insertion or deletion in an open reading frame of over 1000
bases).
[0012] Accordingly, for those applications requiring precision in
the nucleotide sequence or the amino acid sequence, the present
invention provides not only the generated nucleotide sequence
identified as SEQ ID NO:X, and the predicted translated amino acid
sequence identified as SEQ ID NO:Y, but also a sample of plasmid
DNA containing a human cDNA of the invention deposited with the
ATCC, as set forth in Table 1A. The nucleotide sequence of each
deposited plasmid can readily be determined by sequencing the
deposited plasmid in accordance with known methods
[0013] The predicted amino acid sequence can then be verified from
such deposits. Moreover, the amino acid sequence of the protein
encoded by a particular plasmid can also be directly determined by
peptide sequencing or by expressing the protein in a suitable host
cell containing the deposited human cDNA, collecting the protein,
and determining its sequence.
[0014] Also provided in Table 1A is the name of the vector which
contains the cDNA plasmid. Each vector is routinely used in the
art. The following additional information is provided for
convenience.
[0015] Vectors Lambda Zap (U.S. Pat. Nos. 5,128,256 and 5,286,636),
Uni-Zap XR (U.S. Pat. Nos. 5,128,256 and 5,286,636), Zap Express
(U.S. Pat. Nos. 5,128,256 and 5,286,636), pBluescript (pBS) (Short,
J. M. et al., Nucleic Acids Res. 16:7583-7600 (1988); Alting-Mees,
M. A. and Short, J. M., Nucleic Acids Res. 17:9494 (1989)) and pBK
(Alting-Mees, M. A. et al., Strategies 5:58-61 (1992)) are
commercially available from Stratagene Cloning Systems, Inc., 11011
N. Torrey Pines Road, La Jolla, Calif., 92037. pBS contains an
ampicillin resistance gene and pBK contains a neomycin resistance
gene. Phagemid pBS may be excised from the Lambda Zap and Uni-Zap
XR vectors, and phagemid pBK may be excised from the Zap Express
vector. Both phagemids may be transformed into E. coli strain XL-1
Blue, also available from Stratagene
[0016] Vectors pSport1, pCMVSport 1.0, pCMVSport 2.0 and pCMVSport
3.0, were obtained from Life Technologies, Inc., P.O. Box 6009,
Gaithersburg, Md. 20897. All Sport vectors contain an ampicillin
resistance gene and may be transformed into E. coli strain DH10B,
also available from Life Technologies. See, for instance, Gruber,
C. E., et al., Focus 15:59 (1993). Vector lafmid BA (Bento Soares,
Columbia University, New York, N.Y.) contains an ampicillin
resistance gene and can be transformed into E. coli strain XL-1
Blue. Vector pCR.RTM.2.1, which is available from Invitrogen, 1600
Faraday Avenue, Carlsbad, Calif. 92008, contains an ampicillin
resistance gene and may be transformed into E. coli strain DH10B,
available from Life Technologies. See, for instance, Clark, J. M.,
Nuc. Acids Res. 16:9677-9686 (1988) and Mead, D. et al.,
Bio/Technology 9: (1991).
[0017] The present invention also relates to the genes
corresponding to SEQ ID NO:X, SEQ ID NO:Y, and/or a deposited cDNA
(cDNA Clone ID). The corresponding gene can be isolated in
accordance with known methods using the sequence information
disclosed herein. Such methods include, but are not limited to,
preparing probes or primers from the disclosed sequence and
identifying or amplifying the corresponding gene from appropriate
sources of genomic material.
[0018] Also provided in the present invention are allelic variants,
orthologs, and/or species homologs. Procedures known in the art can
be used to obtain full-length genes, allelic variants, splice
variants, full-length coding portions, orthologs, and/or species
homologs of genes corresponding to SEQ ID NO:X and SEQ ID NO:Y
using information from the sequences disclosed herein or the clones
deposited with the ATCC. For example, allelic variants and/or
species homologs may be isolated and identified by making suitable
probes or primers from the sequences provided herein and screening
a suitable nucleic acid source for allelic variants and/or the
desired homologue.
[0019] The present invention provides a polynucleotide comprising,
or alternatively consisting of, the nucleic acid sequence of SEQ ID
NO:X and/or a cDNA contained in ATCC Deposit No. Z. The present
invention also provides a polypeptide comprising, or alternatively,
consisting of, the polypeptide sequence of SEQ ID NO:Y, a
polypeptide encoded by SEQ ID NO:X, and/or a polypeptide encoded by
a cDNA contained in ATCC deposit No. Z. Polynucleotides encoding a
polypeptide comprising, or alternatively consisting of the
polypeptide sequence of SEQ ID NO:Y, a polypeptide encoded by SEQ
ID NO:X and/or a polypeptide encoded by the cDNA contained in ATCC
Deposit No. Z, are also encompassed by the invention. The present
invention further encompasses a polynucleotide comprising, or
alternatively consisting of the complement of the nucleic acid
sequence of SEQ ID NO:X, and/or the complement of the coding strand
of the cDNA contained in ATCC Deposit No. Z.
Description of Table 1B (Comprised of Tables 1B.1 and 1B.2)
[0020] Table 1B.1 and Table 1B.2 summarize some of the
polynucleotides encompassed by the invention (including cDNA clones
related to the sequences (Clone ID:), contig sequences (contig
identifier (Contig ID:) and contig nucleotide sequence identifiers
(SEQ ID NO:X)) and further summarizes certain characteristics of
these polynucleotides and the polypeptides encoded thereby. The
first column of Tables 1B.1 and 1B.2 provide the gene numbers in
the application for each clone identifier. The second column of
Tables 1B.1 and 1B.2 provide unique clone identifiers, "Clone ID:",
for cDNA clones related to each contig sequence disclosed in Table
1A and/or Table 1B. The third column of Tables 1B.1 and 1B.2
provide unique contig identifiers, "Contig ID:" for each of the
contig sequences disclosed in these tables. The fourth column of
Tables 1B.1 and 1B.2 provide the sequence identifiers, "SEQ ID
NO:X", for each of the contig sequences disclosed in Table 1A
and/or 1B.
[0021] Table 1B.1
[0022] The fifth column of Table 1B.1, "ORF (From-To)", provides
the location (i.e., nucleotide position numbers) within the
polynucleotide sequence of SEQ ID NO:X that delineates the
preferred open reading frame (ORF) that encodes the amino acid
sequence shown in the sequence listing and referenced in Table 1B.1
as SEQ ID NO:Y (column 6). Column 7 of Table 1B.1 lists residues
comprising predicted epitopes contained in the polypeptides encoded
by each of the preferred ORFs (SEQ ID NO:Y). Identification of
potential immunogenic regions was performed according to the method
of Jameson and Wolf (CABIOS, 4; 181-186 (1988)); specifically, the
Genetics Computer Group (GCG) implementation of this algorithm,
embodied in the program PEPTIDESTRUCTURE (Wisconsin Package v10.0,
Genetics Computer Group (GCG), Madison, Wis.). This method returns
a measure of the probability that a given residue is found on the
surface of the protein. Regions where the antigenic index score is
greater than 0.9 over at least 6 amino acids are indicated in Table
1B.1 as "Predicted Epitopes". In particular embodiments,
polypeptides of the invention comprise, or alternatively consist
of, one, two, three, four, five or more of the predicted epitopes
described in Table 1B.1. It will be appreciated that depending on
the analytical criteria used to predict antigenic determinants, the
exact address of the determinant may vary slightly. Column 8 of
Table 1B.1 ("Cytologic Band") provides the chromosomal location of
polynucleotides corresponding to SEQ ID NO:X. Chromosomal location
was determined by finding exact matches to EST and cDNA sequences
contained in the NCBI (National Center for Biotechnology
Information) UniGene database. Given a presumptive chromosomal
location, disease locus association was determined by comparison
with the Morbid Map, derived from Online Mendelian Inheritance in
Man (Online Mendelian Inheritance in Man, OMIM.TM..
McKusick-Nathans Institute for Genetic Medicine, Johns Hopkins
University (Baltimore, Md.) and National Center for Biotechnology
Information, National Library of Medicine (Bethesda, Md.) 2000.
World Wide Web URL: http://www.ncbi.nlm.nih.gov/omim/). If the
putative chromosomal location of the Query overlaps with the
chromosomal location of a Morbid Map entry, an OMIM identification
number is disclosed in Table 1B.1, column 9 labeled "OMIM Disease
Reference(s)". A key to the OMIM reference identification numbers
is provided in Table 5.
[0023] Table 1B.2
[0024] Column 5 of Table 1B.2, "Tissue Distribution" shows the
expression profile of tissue, cells, and/or cell line libraries
which express the polynucleotides of the invention. The first code
number shown in Table 1B.2 column 5 (preceding the colon),
represents the tissue/cell source identifier code corresponding to
the key provided in Table 4. Expression of these polynucleotides
was not observed in the other tissues and/or cell libraries tested.
The second number in column 5 (following the colon), represents the
number of times a sequence corresponding to the reference
polynucleotide sequence (e.g., SEQ ID NO:X) was identified in the
corresponding tissue/cell source. Those tissue/cell source
identifier codes in which the first two letters are "AR" designate
information generated using DNA array technology. Utilizing this
technology, cDNAs were amplified by PCR and then transferred, in
duplicate, onto the array. Gene expression was assayed through
hybridization of first strand cDNA probes to the DNA array. cDNA
probes were generated from total RNA extracted from a variety of
different tissues and cell lines. Probe synthesis was performed in
the presence of .sup.33P dCTP, using oligo(dT) to prime reverse
transcription. After hybridization, high stringency washing
conditions were employed to remove non-specific hybrids from the
array. The remaining signal, emanating from each gene target, was
measured using a Phosphorimager. Gene expression was reported as
Phosphor Stimulating Luminescence (PSL) which reflects the level of
phosphor signal generated from the probe hybridized to each of the
gene targets represented on the array. A local background signal
subtraction was performed before the total signal generated from
each array was used to normalize gene expression between the
different hybridizations. The value presented after "[array code]:"
represents the mean of the duplicate values, following background
subtraction and probe normalization. One of skill in the art could
routinely use this information to identify normal and/or diseased
tissue(s) which show a predominant expression pattern of the
corresponding polynucleotide of the invention or to identify
polynucleotides which show predominant and/or specific tissue
and/or cell expression.
Description of Table 1C
[0025] Table 1C summarizes additional polynucleotides encompassed
by the invention (including cDNA clones related to the sequences
(Clone ID:), contig sequences (contig identifier (Contig ID:)
contig nucleotide sequence identifiers (SEQ ID NO:X)), and genomic
sequences (SEQ ID NO:B). The first column provides a unique clone
identifier, "Clone ID:", for a cDNA clone related to each contig
sequence. The second column provides the sequence identifier, "SEQ
ID NO:X", for each contig sequence. The third column provides a
unique contig identifier, "Contig ID:" for each contig sequence.
The fourth column, provides a BAC identifier "BAC ID NO:A" for the
BAC clone referenced in the corresponding row of the table. The
fifth column provides the nucleotide sequence identifier, "SEQ ID
NO:B" for a fragment of the BAC clone identified in column four of
the corresponding row of the table. The sixth column, "Exon
From-To", provides the location (i.e., nucleotide position numbers)
within the polynucleotide sequence of SEQ ID NO:B which delineate
certain polynucleotides of the invention that are also exemplary
members of polynucleotide sequences that encode polypeptides of the
invention (e.g., polypeptides containing amino acid sequences
encoded by the polynucleotide sequences delineated in column six,
and fragments and variants thereof).
Description of Table 1D
[0026] Table 1D: In preferred embodiments, the present invention
encompasses a method of detecting, preventing, treating, and/or
ameliorating a disease or disorder listed as listed in the
"Preferred Indications" column of Table 1D (below); comprising
administering to a patient (in which such detection, prevention,
treatment, and/or amelioration is desired) a protein, nucleic acid,
or antibody of the invention (or fragment or variant thereof)
represented by Table 1A and Table 1D (in the same row as the
disease or disorder to be treated is listed in the "Preferred
Indications" column of Table 1D) in an amount effective to detect,
prevent, treat, or ameliorate the disease or disorder.
[0027] As indicated in Table 1D, the polynucleotides, polypeptides,
agonists, or antagonists of the present invention (including
antibodies) can be used in assays to test for one or more
biological activities. If these polynucleotides and polypeptides do
exhibit activity in a particular assay, it is likely that these
molecules may be involved in the diseases associated with the
biological activity. Thus, the polynucleotides or polypeptides, or
agonists or antagonists thereof (including antibodies) could be
used to prevent, treat, or ameliorate the associated disease.
[0028] The present invention encompasses methods of detecting,
preventing, diagnosing, prognosticating, treating, and/or
ameliorating a disease or disorder. In preferred embodiments, the
present invention encompasses a method of detecting, diagnosing,
treating, preventing, or ameliorating a disease or disorder listed
in the "Preferred Indications" column of Table 1D; comprising
administering to a patient in which such treatment, prevention, or
amelioration is desired a protein, nucleic acid, or antibody of the
invention (or fragment or variant thereof) in an amount effective
to treat, prevent, or ameliorate the disease or disorder. The first
and seccond columns of Table 1D show the "Gene No." and "cDNA Clone
ID No.", respectively, indicating certain nucleic acids and
proteins (or antibodies against the same) of the invention
(including polynucleotide, polypeptide, and antibody fragments or
variants thereof) that may be used in detecting, preventing,
diagnosing, prognosticating, treating, and/or ameliorating the
disease(s) or disorder(s) indicated in the corresponding row in
Column 3 of Table 1D.
[0029] In another embodiment, the present invention also
encompasses methods of preventing, treating, diagnosing, or
ameliorating a disease or disorder listed in the "Preferred
Indications" column of Table 1D; comprising administering to a
patient combinations of the proteins, nucleic acids, or antibodies
of the invention (or fragments or variants thereof), sharing
similar indications as shown in the corresponding rows in Column 3
of Table 1D.
[0030] The "Preferred Indication" column describes diseases,
disorders, and/or conditions that may be treated, prevented,
diagnosed, or ameliorated by a protein, nucleic acid, or antibody
of the invention (or fragment or variant thereof).
[0031] The recitation of "Cancer" in the "Preferred Indication"
column indicates that the corresponding nucleic acid and protein,
or antibody against the same, of the invention (or fragment or
variant thereof) may be used for example, to diagnose, treat,
prevent, and/or ameliorate diseases and/or disorders relating to
neoplastic diseases (e.g., leukemias, cancers, and/or as described
below under "Hyperproliferative Disorders").
[0032] In specific embodiments, a protein, nucleic acid, or
antibody of the invention (or fragment or variant thereof) having a
"Cancer" recitation in the "Preferred Indication" column of Table
1D may be used for example, to diagnose, treat, prevent, and/or
ameliorate a neoplasm located in a tissue selected from the group
consisting of: colon, abdomen, bone, breast, digestive system,
liver, pancreas, prostate, peritoneum, lung, blood (e.g.,
leukemia), endocrine glands (adrenal, parathyroid, pituitary,
testicles, ovary, thymus, thyroid), uterus, eye, head and neck,
nervous (central and peripheral), lymphatic system, pelvic, skin,
soft tissue, spleen, thoracic, and urogenital.
[0033] In specific embodiments, a protein, nucleic acid, or
antibody of the invention (or fragment or variant thereof) having a
"Cancer" recitation in the "Preferred Indication" column of Table
1D, may be used for example, to diagnose, treat, prevent, and/or
ameliorate a pre-neoplastic condition, selected from the group
consisting of: hyperplasia (e.g., endometrial hyperplasia and/or as
described in the section entitled "Hyperproliferative Disorders"),
metaplasia (e.g., connective tissue metaplasia, atypical
metaplasia, and/or as described in the section entitled
"Hyperproliferative Disorders"), and/or dysplasia (e.g., cervical
dysplasia, and bronchopulmonary dysplasia).
[0034] In another specific embodiment, a protein, nucleic acid, or
antibody of the invention (or fragment or variant thereof) having a
"Cancer" recitation in the "Preferred Indication" column of Table
1D, may be used for example, to diagnose, treat, prevent, and/or
ameliorate a benign dysproliferative disorder selected from the
group consisting of: benign tumors, fibrocystic conditions, tissue
hypertrophy, and/or as described in the section entitled
"Hyperproliferative Disorders".
[0035] The recitation of "Immune/Hematopoietic" in the "Preferred
Indication" column indicates that the corresponding nucleic acid
and protein, or antibody against the same, of the invention (or
fragment or variant thereof), may be used for example, to diagnose,
treat, prevent, and/or ameliorate diseases and/or disorders
relating to neoplastic diseases (e.g., as described below under
"Hyperproliferative Disorders"), blood disorders (e.g., as
described below under "Immune Activity" "Cardiovascular Disorders"
and/or "Blood-Related Disorders"), and infections (e.g., as
described below under "Infectious Disease").
[0036] In specific embodiments, a protein, nucleic acid, or
antibody of the invention (or fragment or variant thereof) having
the "Immune/Hematopoietic" recitation in the "Preferred Indication"
column of Table 1D, may be used for example, to diagnose, treat,
prevent, and/or ameliorate a disease or disorder selected from the
group consisting of: anemia, pancytopenia, leukopenia,
thrombocytopenia, leukemias, Hodgkin's disease, non-Hodgkin's
lymphoma, acute lymphocytic anemia (ALL), plasmacytomas, multiple
myeloma, Burkitt's lymphoma, arthritis, asthma, AIDS, autoimmune
disease, rheumatoid arthritis, granulomatous disease, immune
deficiency, inflammatory bowel disease, sepsis, neutropenia,
neutrophilia, psoriasis, immune reactions to transplanted organs
and tissues, systemic lupus erythematosis, hemophilia,
hypercoagulation, diabetes mellitus, endocarditis, meningitis, Lyme
Disease, and allergies.
[0037] The recitation of "Reproductive" in the "Preferred
Indication" column indicates that the corresponding nucleic acid
and protein, or antibody against the same, of the invention (or
fragment or variant thereof), may be used for example, to diagnose,
treat, prevent, and/or ameliorate diseases and/or disorders
relating to neoplastic diseases (e.g., as described below under
"Hyperproliferative Disorders"), and disorders of the reproductive
system (e.g., as described below under "Reproductive System
Disorders").
[0038] In specific embodiments, a protein, nucleic acid, or
antibody of the invention (or fragment or variant thereof) having a
"Reproductive" recitation in the "Preferred Indication" column of
Table 1D, may be used for example, to diagnose, treat, prevent,
and/or ameliorate a disease or disorder selected from the group
consisting of: cryptorchism, prostatitis, inguinal hernia,
varicocele, leydig cell tumors, verrucous carcinoma, prostatitis,
malacoplakia, Peyronie's disease, penile carcinoma, squamous cell
hyperplasia, dysmenorrhea, ovarian adenocarcinoma, Turner's
syndrome, mucopurulent cervicitis, Sertoli-leydig tumors, ovarian
cancer, uterine cancer, pelvic inflammatory disease, testicular
cancer, prostate cancer, Klinefelter's syndrome, Young's syndrome,
premature ejaculation, diabetes mellitus, cystic fibrosis,
Kartagener's syndrome, testicular atrophy, testicular feminization,
anorchia, ectopic testis, epididymitis, orchitis, gonorrhea,
syphilis, testicular torsion, vasitis nodosa, germ cell tumors,
stromal tumors, dysmenorrhea, retroverted uterus, endometriosis,
fibroids, adenomyosis, anovulatory bleeding, amenorrhea, Cushing's
syndrome, hydatidiform moles, Asherman's syndrome, premature
menopause, precocious puberty, uterine polyps, dysfunctional
uterine bleeding, cervicitis, chronic cervicitis, mucopurulent
cervicitis, cervical dysplasia, cervical polyps, Nabothian cysts,
cervical erosion, cervical incompetence, cervical neoplasms,
pseudohermaphroditism, and premenstrual syndrome.
[0039] The recitation of "Musculoskeletal" in the "Preferred
Indication" column indicates that the corresponding nucleic acid
and protein, or antibody against the same, of the invention (or
fragment or variant thereof), may be used for example, to diagnose,
treat, prevent, and/or ameliorate diseases and/or disorders
relating to neoplastic diseases (e.g., as described below under
"Hyperproliferative Disorders"), and disorders of the immune system
(e.g., as described below under "Immune Activity").
[0040] In specific embodiments, a protein, nucleic acid, or
antibody of the invention (or fragment or variant thereof) having a
"Musculoskeletal" recitation in the "Preferred Indication" column
of Table 1D, may be used for example, to diagnose, treat, prevent,
and/or ameliorate a disease or disorder selected from the group
consisting of: bone cancers (e.g., osteochondromas, benign
chondromas, chondroblastoma, chondromyxoid fibromas, osteoid
osteomas, giant cell tumors, multiple myeloma, osteosarcomas),
Paget's Disease, rheumatoid arthritis, systemic lupus
erythematosus, osteomyelitis, Lyme Disease, gout, bursitis,
tendonitis, osteoporosis, osteoarthritis, muscular dystrophy,
mitochondrial myopathy, cachexia, and multiple sclerosis.
[0041] The recitation of "Cardiovascular" in the "Preferred
Indication" column indicates that the corresponding nucleic acid
and protein, or antibody against the same, of the invention (or
fragment or variant thereof), may be used for example, to diagnose,
treat, prevent, and/or ameliorate diseases and/or disorders
relating to neoplastic diseases (e.g., as described below under
"Hyperproliferative Disorders"), and disorders of the
cardiovascular system (e.g., as described below under
"Cardiovascular Disorders").
[0042] In specific embodiments, a protein, nucleic acid, or
antibody of the invention (or fragment or variant thereof) having a
"Cardiovascular" recitation in the "Preferred Indication" column of
Table 1D, may be used for example, to diagnose, treat, prevent,
and/or ameliorate a disease or disorder selected from the group
consisting of: myxomas, fibromas, rhabdomyomas, cardiovascular
abnormalities (e.g., congenital heart defects, cerebral
arteriovenous malformations, septal defects), heart disease (e.g.,
heart failure, congestive heart disease, arrhythmia, tachycardia,
fibrillation, pericardial Disease, endocarditis), cardiac arrest,
heart valve disease (e.g., stenosis, regurgitation, prolapse),
vascular disease (e.g., hypertension, coronary artery disease,
angina, aneurysm, arteriosclerosis, peripheral vascular disease),
hyponatremia, hypematremia, hypokalemia, and hyperkalemia.
[0043] The recitation of "Mixed Fetal" in the "Preferred
Indication" column indicates that the corresponding nucleic acid
and protein, or antibody against the same, of the invention (or
fragment or variant thereof), may be used for example, to diagnose,
treat, prevent, and/or ameliorate diseases and/or disorders
relating to neoplastic diseases (e.g., as described below under
"Hyperproliferative Disorders").
[0044] In specific embodiments, a protein, nucleic acid, or
antibody of the invention (or fragment or variant thereof) having a
"Mixed Fetal" recitation in the "Preferred Indication" column of
Table 1D, may be used for example, to diagnose, treat, prevent,
and/or ameliorate a disease or disorder selected from the group
consisting of: spina bifida, hydranencephaly, neurofibromatosis,
fetal alcohol syndrome, diabetes mellitus, PKU, Down's syndrome,
Patau syndrome, Edwards syndrome, Turner syndrome, Apert syndrome,
Carpenter syndrome, Conradi syndrome, Crouzon syndrome, cutis laxa,
Cornelia de Lange syndrome, Ellis-van Creveld syndrome, Holt-Oram
syndrome, Kartagener syndrome, Meckel-Gruber syndrome, Noonan
syndrome, Pallister-Hall syndrome, Rubinstein-Taybi syndrome,
Scimitar syndrome, Smith-Lemli-Opitz syndrome,
thromocytopenia-absent radius (TAR) syndrome, Treacher Collins
syndrome, Williams syndrome, Hirschsprung's disease, Meckel's
diverticulum, polycystic kidney disease, Turner's syndrome, and
gonadal dysgenesis, Klippel-Feil syndrome, Ostogenesis imperfecta,
muscular dystrophy, Tay-Sachs disease, Wilm's tumor, neuroblastoma,
and retinoblastoma.
[0045] The recitation of "Excretory" in the "Preferred Indication"
column indicates that the corresponding nucleic acid and protein,
or antibody against the same, of the invention (or fragment or
variant thereof), may be used for example, to diagnose, treat,
prevent, and/or ameliorate diseases and/or disorders relating to
neoplastic diseases (e.g., as described below under
"Hyperproliferative Disorders") and renal disorders (e.g., as
described below under "Renal Disorders").
[0046] In specific embodiments, a protein, nucleic acid, or
antibody of the invention (or fragment or variant thereof) having a
"Excretory" recitation in the "Preferred Indication" column of
Table 1D, may be used for example, to diagnose, treat, prevent,
and/or ameliorate a disease or disorder selected from the group
consisting of: bladder cancer, prostate cancer, benign prostatic
hyperplasia, bladder disorders (e.g., urinary incontinence, urinary
retention, urinary obstruction, urinary tract Infections,
interstitial cystitis, prostatitis, neurogenic bladder, hematuria),
renal disorders (e.g., hydronephrosis, proteinuria, renal failure,
pyelonephritis, urolithiasis, reflux nephropathy, and unilateral
obstructive uropathy).
[0047] The recitation of "Neural/Sensory" in the "Preferred
Indication" column indicates that the corresponding nucleic acid
and protein, or antibody against the same, of the invention (or
fragment or variant thereof), may be used for example, to diagnose,
treat, prevent, and/or ameliorate diseases and/or disorders
relating to neoplastic diseases (e.g., as described below under
"Hyperproliferative Disorders") and diseases or disorders of the
nervous system (e.g., as described below under "Neural Activity and
Neurological Diseases").
[0048] In specific embodiments, a protein, nucleic acid, or
antibody of the invention (or fragment or variant thereof) having a
"Neural/Sensory" recitation in the "Preferred Indication" column of
Table 1D, may be used for example, to diagnose, treat, prevent,
and/or ameliorate a disease or disorder selected from the group
consisting of: brain cancer (e.g., brain stem glioma, brain tumors,
central nervous system (Primary) lymphoma, central nervous system
lymphoma, cerebellar astrocytoma, and cerebral astrocytoma,
neurodegenerative disorders (e.g., Alzheimer's Disease,
Creutzfeldt-Jakob Disease, Parkinson's Disease, and Idiopathic
Presenile Dementia), encephalomyelitis, cerebral malaria,
meningitis, metabolic brain diseases (e.g., phenylketonuria and
pyruvate carboxylase deficiency), cerebellar ataxia, ataxia
telangiectasia, and AIDS Dementia Complex, schizophrenia, attention
deficit disorder, hyperactive attention deficit disorder, autism,
and obsessive compulsive disorders.
[0049] The recitation of "Respiratory" in the "Preferred
Indication" column indicates that the corresponding nucleic acid
and protein, or antibody against the same, of the invention (or
fragment or variant thereof), may be used for example, to diagnose,
treat, prevent, and/or ameliorate diseases and/or disorders
relating to neoplastic diseases (e.g., as described below under
"Hyperproliferative Disorders") and diseases or disorders of the
respiratory system (e.g., as described below under "Respiratory
Disorders").
[0050] In specific embodiments, a protein, nucleic acid, or
antibody of the invention (or fragment or variant thereof) having a
"Respiratory" recitation in the "Preferred Indication" column of
Table 1D, may be used for example, to diagnose, treat, prevent,
and/or ameliorate a disease or disorder selected from the group
consisting of: cancers of the respiratory system such as larynx
cancer, pharynx cancer, trachea cancer, epiglottis cancer, lung
cancer, squamous cell carcinomas, small cell (oat cell) carcinomas,
large cell carcinomas, and adenocarcinomas. Allergic reactions,
cystic fibrosis, sarcoidosis, histiocytosis X, infiltrative lung
diseases (e.g., pulmonary fibrosis and lymphoid interstitial
pneumonia), obstructive airway diseases (e.g., asthma, emphysema,
chronic or acute bronchitis), occupational lung diseases (e.g.,
silicosis and asbestosis), pneumonia, and pleurisy.
[0051] The recitation of "Endocrine" in the "Preferred Indication"
column indicates that the corresponding nucleic acid and protein,
or antibody against the same, of the invention (or fragment or
variant thereof), may be used for example, to diagnose, treat,
prevent, and/or ameliorate diseases and/or disorders relating to
neoplastic diseases (e.g., as described below under
"Hyperproliferative Disorders") and diseases or disorders of the
respiratory system (e.g., as described below under "Respiratory
Disorders"), renal disorders (e.g., as described below under "Renal
Disorders"), and disorders of the endocrine system (e.g., as
described below under "Endocrine Disorders".
[0052] In specific embodiments, a protein, nucleic acid, or
antibody of the invention (or fragment or variant thereof) having
an "Endocrine" recitation in the "Preferred Indication" column of
Table 1D, may be used for example, to diagnose, treat, prevent,
and/or ameliorate a disease or disorder selected from the group
consisting of: cancers of endocrine tissues and organs (e.g.,
cancers of the hypothalamus, pituitary gland, thyroid gland,
parathyroid glands, pancreas, adrenal glands, ovaries, and testes),
diabetes (e.g., diabetes insipidus, type I and type II diabetes
mellitus), obesity, disorders related to pituitary glands (e.g.,
hyperpituitarism, hypopituitarism, and pituitary dwarfism),
hypothyroidism, hyperthyroidism, goiter, reproductive disorders
(e.g. male and female infertility), disorders related to adrenal
glands (e.g., Addison's Disease, corticosteroid deficiency, and
Cushing's Syndrome), kidney cancer (e.g., hypemephroma,
transitional cell cancer, and Wilm's tumor), diabetic nephropathy,
interstitial nephritis, polycystic kidney disease,
glomerulonephritis (e.g., IgM mesangial proliferative
glomerulonephritis and glomerulonephritis caused by autoimmune
disorders; such as Goodpasture's syndrome), and
nephrocalcinosis.
[0053] The recitation of "Digestive" in the "Preferred Indication"
column indicates that the corresponding nucleic acid and protein,
or antibody against the same, of the invention (or fragment or
variant thereof), may be used for example, to diagnose, treat,
prevent, and/or ameliorate diseases and/or disorders relating to
neoplastic diseases (e.g., as described below under
"Hyperproliferative Disorders") and diseases or disorders of the
gastrointestinal system (e.g., as described below under
"Gastrointestinal Disorders".
[0054] In specific embodiments, a protein, nucleic acid, or
antibody of the invention (or fragment or variant thereof) having a
"Digestive" recitation in the "Preferred Indication" column of
Table 1D, may be used for example, to diagnose, treat, prevent,
and/or ameliorate a disease or disorder selected from the group
consisting of: ulcerative colitis, appendicitis, Crohn's disease,
hepatitis, hepatic encephalopathy, portal hypertension,
cholelithiasis, cancer of the digestive system (e.g., biliary tract
cancer, stomach cancer, colon cancer, gastric cancer, pancreatic
cancer, cancer of the bile duct, tumors of the colon (e.g., polyps
or cancers), and cirrhosis), pancreatitis, ulcerative disease,
pyloric stenosis, gastroenteritis, gastritis, gastric atropy,
benign tumors of the duodenum, distension, irritable bowel
syndrome, malabsorption, congenital disorders of the small
intestine, bacterial and parasitic infection, megacolon,
Hirschsprung's disease, aganglionic megacolon, acquired megacolon,
colitis, anorectal disorders (e.g., anal fistulas, hemorrhoids),
congenital disorders of the liver (e.g., Wilson's disease,
hemochromatosis, cystic fibrosis, biliary atresia, and
alpha1-antitrypsin deficiency), portal hypertension,
cholelithiasis, and jaundice.
[0055] The recitation of "Connective/Epithelial" in the "Preferred
Indication" column indicates that the corresponding nucleic acid
and protein, or antibody against the same, of the invention (or
fragment or variant thereof), may be used for example, to diagnose,
treat, prevent, and/or ameliorate diseases and/or disorders
relating to neoplastic diseases (e.g., as described below under
"Hyperproliferative Disorders"), cellular and genetic abnormalities
(e.g., as described below under "Diseases at the Cellular Level"),
angiogenesis (e.g., as described below under "Anti-Angiogenesis
Activity"), and or to promote or inhibit regeneration (e.g., as
described below under "Regeneration"), and wound healing (e.g., as
described below under "Wound Healing and Epithelial Cell
Proliferation").
[0056] In specific embodiments, a protein, nucleic acid, or
antibody of the invention (or fragment or variant thereof) having a
"Connective/Epithelial" recitation in the "Preferred Indication"
column of Table 1D, may be used for example, to diagnose, treat,
prevent, and/or ameliorate a disease or disorder selected from the
group consisting of: connective tissue metaplasia, mixed connective
tissue disease, focal epithelial hyperplasia, epithelial
metaplasia, mucoepithelial dysplasia, graft v. host disease,
polymyositis, cystic hyperplasia, cerebral dysplasia, tissue
hypertrophy, Alzheimer's disease, lymphoproliferative disorder,
Waldenstron's macroglobulinemia, Crohn's disease, pernicious
anemia, idiopathic Addison's disease, glomerulonephritis, bullous
pemphigoid, Sjogren's syndrome, diabetes mellitus, cystic fibrosis,
osteoblastoma, osteoclastoma, osteosarcoma, chondrosarcoma,
osteoporosis, osteocarthritis, periodontal disease, wound healing,
relapsing polychondritis, vasculitis, polyarteritis nodosa,
Wegener's granulomatosis, cellulitis, rheumatoid arthritis,
psoriatic arthritis, discoid lupus erythematosus, systemic lupus
erythematosus, scleroderma, CREST syndrome, Sjogren's syndrome,
polymyositis, dermatomyositis, mixed connective tissue disease,
relapsing polychondritis, vasculitis, Henoch-Schonlein syndrome,
erythema nodosum, polyarteritis nodosa, temporal (giant cell)
arteritis, Takayasu's arteritis, Wegener's granulomatosis, Reiter's
syndrome, Behcet's syndrome, ankylosing spondylitis, cellulitis,
keloids, Ehler Danlos syndrome, Marfan syndrome, pseudoxantoma
elasticum, osteogenese imperfecta, chondrodysplasias, epidermolysis
bullosa, Alport syndrome, and cutis laxa.
Description of Table 1E
[0057] Table 1E provides information related to biological
activities and preferred indications for polynucleotides and
polypeptides of the invention (including antibodies, agonists,
and/or antagonists thereof). Table 1E also provides information
related to assays which may be used to test polynucleotides and
polypeptides of the invention (including antibodies, agonists,
and/or antagonists thereof) for the corresponding biological
activities. The first column ("Gene No.") provides the gene number
in the application for each clone identifier. The second column
("cDNA Clone ID:") provides the unique clone identifier for each
clone as previously described and indicated in Tables 1A, 1B, 1C,
and 1D. The third column ("AA SEQ ID NO:Y") indicates the Sequence
Listing SEQ ID Number for polypeptide sequences encoded by the
corresponding cDNA clones (also as indicated in Tables 1A, 1B, and
2). The fourth column ("Biological Activity") indicates a
biological activity corresponding to the indicated polypeptides (or
polynucleotides encoding said polypeptides). The fifth column
("Exemplary Activity Assay") further describes the corresponding
biological activity and provides information pertaining to the
various types of assays which may be performed to test,
demonstrate, or quantify the corresponding biological activity. The
sixth column ("Preferred Indications") describes particular
embodiments of the invention and indications (e.g. pathologies,
diseases, disorders, abnormalities, etc.) for which polynucleotides
and polypeptides of the invention (including antibodies, agonists,
and/or antagonists thereof) may be used in detecting, preventing,
diagnosing, prognosticating, treating, and/or ameliorating.
[0058] Table 1E describes the use of FMAT technology, inter alia,
for testing or demonstrating various biological activities.
Fluorometric microvolume assay technology (FMAT) is a
fluorescence-based system which provides a means to perform
nonradioactive cell- and bead-based assays to detect activation of
cell signal transduction pathways. This technology was designed
specifically for ligand binding and immunological assays. Using
this technology, fluorescent cells or beads at the bottom of the
well are detected as localized areas of concentrated fluorescence
using a data processing system. Unbound flurophore comprising the
background signal is ignored, allowing for a wide variety of
homogeneous assays. FMAT technology may be used for peptide ligand
binding assays, immunofluorescence, apoptosis, cytotoxicity, and
bead-based immunocapture assays. See, Miraglia S et. al.,
"Homogeneous cell and bead based assays for highthroughput
screening using flourometric microvolume assay technology," Journal
of Biomolecular Screening; 4:193-204 (1999). In particular, FMAT
technology may be used to test, confirm, and/or identify the
ability of polypeptides (including polypeptide fragments and
variants) to activate signal transduction pathways. For example,
FMAT technology may be used to test, confirm, and/or identify the
ability of polypeptides to upregulate production of
immunomodulatory proteins (such as, for example, interleukins,
GM-CSF, Rantes, and Tumor Necrosis factors, as well as other
cellular regulators (e.g. insulin)).
[0059] Table 1E also describes the use of kinase assays for
testing, demonstrating, or quantifying biological activity. In this
regard, the phosphorylation and de-phosphorylation of specific
amino acid residues (e.g. Tyrosine, Serine, Threonine) on
cell-signal transduction proteins provides a fast, reversible means
for activation and de-activation of cellular signal transduction
pathways. Moreover, cell signal transduction via
phosphorylation/de-phosphorylation is crucial to the regulation of
a wide variety of cellular processes (e.g. proliferation,
differentiation, migration, apoptosis, etc.). Accordingly, kinase
assays provide a powerful tool useful for testing, confirming,
and/or identifying polypeptides (including polypeptide fragments
and variants) that mediate cell signal transduction events via
protein phosphorylation. See e.g., Forrer, P., Tamaskovic R., and
Jaussi, R. "Enzyme-Linked Immunosorbent Assay for Measurement of
JNK, ERK, and p38 Kinase Activities" Biol. Chem. 379(8-9):
1101-1110 (1998).
Description of Table 1F
[0060] Polynucleotides encoding polypeptides of the present
invention can be used in assays to test for one or more biological
activities. One such biological activity which may be tested
includes the ability of polynucleotides and polypeptides of the
invention to stimulate up-regulation or down-regulation of
expression of particular genes and proteins. Hence, if
polynucleotides and polypeptides of the present invention exhibit
activity in altering particular gene and protein expression
patterns, it is likely that these polynucleotides and polypeptides
of the present invention may be involved in, or capable of
effecting changes in, diseases associated with the altered gene and
protein expression profiles. Hence, polynucleotides, polypeptides,
or antibodies of the present invention could be used to treat said
associated diseases.
[0061] TaqMan.RTM. assays may be performed to assess the ability of
polynucleotides (and polypeptides they encode) to alter the
expression pattern of particular "target" genes. TaqMan.RTM.
reactions are performed to evaluate the ability of a test agent to
induce or repress expression of specific genes in different cell
types. TaqMan.RTM. gene expression quantification assays
("TaqMan.RTM. assays") are well known to, and routinely performed
by, those of ordinary skill in the art. TaqMan.RTM. assays are
performed in a two step reverse transcription/polymerase chain
reaction (RT-PCR). In the first (RT) step, cDNA is reverse
transcribed from total RNA samples using random hexamer primers. In
the second (PCR) step, PCR products are synthesized from the cDNA
using gene specific primers.
[0062] To quantify gene expression the Taqman.RTM. PCR reaction
exploits the 5' nuclease activity of AmpliTaq Gold.RTM. DNA
Polymerase to cleave a Taqman.RTM. probe (distinct from the
primers) during PCR. The Taqman.RTM. probe contains a reporter dye
at the 5'-end of the probe and a quencher dye at the 3' end of the
probe. When the probe is intact, the proximity of the reporter dye
to the quencher dye results in suppression of the reporter
fluorescence. During PCR, if the target of interest is present, the
probe specifically anneals between the forward and reverse primer
sites. AmpliTaq Fold DNA Polymerase then cleaves the probe between
the reporter and quencher when the probe hybridizes to the target,
resulting in increased fluorescence of the reporter (see FIG. 2).
Accumulation of PCR products is detected directly by monitoring the
increase in fluorescence of the reporter dye.
[0063] After the probe fragments are displaced from the target,
polymerization of the strand continues. The 3'-end of the probe is
blocked to prevent extension of the probe during PCR. This process
occurs in every cycle and does not interfere with the exponential
accumulation of product. The increase in fluorescence signal is
detected only if the target sequence is complementary to the probe
and is amplified during PCR. Because of these requirements, any
nonspecific amplification is not detected.
[0064] For test sample preparation, vector controls or constructs
containing the coding sequence for the gene of interest are
transfected into cells, such as for example 293T cells, and
supernatants collected after 48 hours. For cell treatment and RNA
isolation, multiple primary human cells or human cell lines are
used; such cells may include but are not limited to, Normal Human
Dermal Fibroblasts, Aortic Smooth Muscle, Human Umbilical Vein
Endothelial Cells, HepG2, Daudi, Jurkat, U937, Caco, and THP-1 cell
lines. Cells are plated in growth media and growth is arrested by
culturing without media change for 3 days, or by switching cells to
low serum media and incubating overnight. Cells are treated for 1,
6, or 24 hours with either vector control supernatant or sample
supernatant (or purified/partially purified protein preparations in
buffer). Total RNA is isolated; for example, by using Trizol
extraction or by using the Ambion RNAqueous.TM.-4PCR RNA isolation
system. Expression levels of multiple genes are analyzed using
Taqman.RTM., and expression in the test sample is compared to
control vector samples to identify genes induced or repressed. Each
of the above described techniques are well known to, and routinely
performed by, those of ordinary skill in the art.
[0065] Table 1F indicates particular disease classes and preferred
indications for which polynucleotides, polypeptides, or antibodies
of the present invention may be used in detecting, diagnosing,
preventing, treating and/or ameliorating said diseases and
disorders based on "target" gene expression patterns which may be
up- or down-regulated by polynucleotides (and the encoded
polypeptides) corresponding to each indicated cDNA Clone ID (shown
in Table 1F, Column 2).
[0066] Thus, in preferred embodiments, the present invention
encompasses a method of detecting, diagnosing, preventing,
treating, and/or ameliorating a disease or disorder listed in the
"Disease Class" and/or "Preferred Indication" columns of Table 1F;
comprising administering to a patient in which such detection,
diagnosis, prevention, or treatment is desired a protein, nucleic
acid, or antibody of the invention (or fragment or variant thereof)
in an amount effective to detect, diagnose, prevent, treat, or
ameliorate the disease or disorder. The first and second columns of
Table 1D show the "Gene No." and "cDNA Clone ID No.", respectively,
indicating certain nucleic acids and proteins (or antibodies
against the same) of the invention (including polynucleotide,
polypeptide, and antibody fragments or variants thereof) that may
be used in detecting, diagnosing, preventing, treating, or
ameliorating the disease(s) or disorder(s) indicated in the
corresponding row in the "Disease Class" or "Preferred Indication"
Columns of Table 1F.
[0067] In another embodiment, the present invention also
encompasses methods of detecting, diagnosing, preventing, treating,
or ameliorating a disease or disorder listed in the "Disease Class"
or "Preferred Indication" Columns of Table 1F; comprising
administering to a patient combinations of the proteins, nucleic
acids, or antibodies of the invention (or fragments or variants
thereof), sharing similar indications as shown in the corresponding
rows in the "Disease Class" or "Preferred Indication" Columns of
Table 1F.
[0068] The "Disease Class" Column of Table 1F provides a
categorized descriptive heading for diseases, disorders, and/or
conditions (more fully described below) that may be detected,
diagnosed, prevented, treated, or ameliorated by a protein, nucleic
acid, or antibody of the invention (or fragment or variant
thereof).
[0069] The "Preferred Indication" Column of Table 1F describes
diseases, disorders, and/or conditions that may be detected,
diagnosed, prevented, treated, or ameliorated by a protein, nucleic
acid, or antibody of the invention (or fragment or variant
thereof).
[0070] The "Cell Line" and "Exemplary Targets" Columns of Table 1F
indicate particular cell lines and target genes, respectively,
which may show altered gene expression patterns (i.e., up- or
down-regulation of the indicated target gene) in Taqman.RTM.
assays, performed as described above, utilizing polynucleotides of
the cDNA Clone ID shown in the corresponding row. Alteration of
expression patterns of the indicated "Exemplary Target" genes is
correlated with a particular "Disease Class" and/or "Preferred
Indication" as shown in the corresponding row under the respective
column headings.
[0071] The "Exemplary Accessions" Column indicates GenBank
Accessions (available online through the National Center for
Biotechnology Information (NCBI) at http://www.ncbi.nlm.nih.gov/)
which correspond to the "Exemplary Targets" shown in the adjacent
row.
[0072] The recitation of "Cancer" in the "Disease Class" Column
indicates that the corresponding nucleic acid and protein, or
antibody against the same, of the invention (or fragment or variant
thereof) may be used for example, to detect, diagnose, prevent,
treat, and/or ameliorate neoplastic diseases and/or disorders
(e.g., leukemias, cancers, etc., as described below under
"Hyperproliferative Disorders").
[0073] The recitation of "Immune" in the "Disease Class" column
indicates that the corresponding nucleic acid and protein, or
antibody against the same, of the invention (or fragment or variant
thereof), may be used for example, to detect, diagnose, prevent,
treat, and/or ameliorate diseases and/or disorders relating to
neoplastic diseases (e.g., as described below under
"Hyperproliferative Disorders"), blood disorders (e.g., as
described below under "Immune Activity" "Cardiovascular Disorders"
and/or "Blood-Related Disorders"), and infections (e.g., as
described below under "Infectious Disease").
[0074] The recitation of "Angiogenesis" in the "Disease Class"
column indicates that the corresponding nucleic acid and protein,
or antibody against the same, of the invention (or fragment or
variant thereof), may be used for example, to detect, diagnose,
treat, prevent, and/or ameliorate diseases and/or disorders
relating to neoplastic diseases (e.g., as described below under
"Hyperproliferative Disorders"), diseases and/or disorders of the
cardiovascular system (e.g., as described below under
"Cardiovascular Disorders"), diseases and/or disorders involving
cellular and genetic abnormalities (e.g., as described below under
"Diseases at the Cellular Level"), diseases and/or disorders
involving angiogenesis (e.g., as described below under
"Anti-Angiogenesis Activity"), to promote or inhibit cell or tissue
regeneration (e.g., as described below under "Regeneration"), or to
promote wound healing (e.g., as described below under "Wound
Healing and Epithelial Cell Proliferation").
[0075] The recitation of "Diabetes" in the "Disease Class" column
indicates that the corresponding nucleic acid and protein, or
antibody against the same, of the invention (or fragment or variant
thereof), may be used for example, to detect, diagnose, treat,
prevent, and/or ameliorate diabetes (including diabetes mellitus
types I and II), as well as diseases and/or disorders associated
with, or consequential to, diabetes (e.g. as described below under
"Endocrine Disorders," "Renal Disorders," and "Gastrointestinal
Disorders").
Description of Table 1F
[0076] Polynucleotides encoding polypeptides of the present
invention can be used in assays to test for one or more biological
activities. One such biological activity which may be tested
includes the ability of polynucleotides and polypeptides of the
invention to stimulate up-regulation or down-regulation of
expression of particular genes and proteins. Hence, if
polynucleotides and polypeptides of the present invention exhibit
activity in altering particular gene and protein expression
patterns, it is likely that these polynucleotides and polypeptides
of the present invention may be involved in, or capable of
effecting changes in, diseases associated with the altered gene and
protein expression profiles. Hence, polynucleotides, polypeptides,
or antibodies of the present invention could be used to treat said
associated diseases.
[0077] TaqMan.RTM. assays may be performed to assess the ability of
polynucleotides (and polypeptides they encode) to alter the
expression pattern of particular "target" genes. TaqMan.RTM.
reactions are performed to evaluate the ability of a test agent to
induce or repress expression of specific genes in different cell
types. TaqMan.RTM. gene expression quantification assays
("TaqMan.RTM. assays") are well known to, and routinely performed
by, those of ordinary skill in the art. TaqMan.RTM. assays are
performed in a two step reverse transcription/polymerase chain
reaction (RT-PCR). In the first (RT) step, cDNA is reverse
transcribed from total RNA samples using random hexamer primers. In
the second (PCR) step, PCR products are synthesized from the cDNA
using gene specific primers.
[0078] To quantify gene expression the Taqman.RTM. PCR reaction
exploits the 5' nuclease activity of AmpliTaq Gold.RTM. DNA
Polymerase to cleave a Taqman.RTM. probe (distinct from the
primers) during PCR. The Taqman.RTM. probe contains a reporter dye
at the 5'-end of the probe and a quencher dye at the 3' end of the
probe. When the probe is intact, the proximity of the reporter dye
to the quencher dye results in suppression of the reporter
fluorescence. During PCR, if the target of interest is present, the
probe specifically anneals between the forward and reverse primer
sites. AmpliTaq Fold DNA Polymerase then cleaves the probe between
the reporter and quencher when the probe hybridizes to the target,
resulting in increased fluorescence of the reporter (see FIG. 2).
Accumulation of PCR products is detected directly by monitoring the
increase in fluorescence of the reporter dye.
[0079] After the probe fragments are displaced from the target,
polymerization of the strand continues. The 3'-end of the probe is
blocked to prevent extension of the probe during PCR. This process
occurs in every cycle and does not interfere with the exponential
accumulation of product. The increase in fluorescence signal is
detected only if the target sequence is complementary to the probe
and is amplified during PCR. Because of these requirements, any
nonspecific amplification is not detected.
[0080] For test sample preparation, vector controls or constructs
containing the coding sequence for the gene of interest are
transfected into cells, such as for example 293T cells, and
supernatants collected after 48 hours. For cell treatment and RNA
isolation, multiple primary human cells or human cell lines are
used; such cells may include but are not limited to, Normal Human
Dermal Fibroblasts, Aortic Smooth Muscle, Human Umbilical Vein
Endothelial Cells, HepG2, Daudi, Jurkat, U937, Caco, and THP-1 cell
lines. Cells are plated in growth media and growth is arrested by
culturing without media change for 3 days, or by switching cells to
low serum media and incubating overnight. Cells are treated for 1,
6, or 24 hours with either vector control supernatant or sample
supernatant (or purified/partially purified protein preparations in
buffer). Total RNA is isolated; for example, by using Trizol
extraction or by using the Ambion RNAqueous.TM.-4PCR RNA isolation
system. Expression levels of multiple genes are analyzed using
Taqman.RTM., and expression in the test sample is compared to
control vector samples to identify genes induced or repressed. Each
of the above described techniques are well known to, and routinely
performed by, those of ordinary skill in the art.
[0081] Table 1F indicates particular disease classes and preferred
indications for which polynucleotides, polypeptides, or antibodies
of the present invention may be used in detecting, diagnosing,
preventing, treating and/or ameliorating said diseases and
disorders based on "target" gene expression patterns which may be
up- or down-regulated by polynucleotides (and the encoded
polypeptides) corresponding to each indicated cDNA Clone ID (shown
in Table 1F, Column 2).
[0082] Thus, in preferred embodiments, the present invention
encompasses a method of detecting, diagnosing, preventing,
treating, and/or ameliorating a disease or disorder listed in the
"Disease Class" and/or "Preferred Indication" columns of Table 1F;
comprising administering to a patient in which such detection,
diagnosis, prevention, or treatment is desired a protein, nucleic
acid, or antibody of the invention (or fragment or variant thereof)
in an amount effective to detect, diagnose, prevent, treat, or
ameliorate the disease or disorder. The first and second columns of
Table 1D show the "Gene No." and "cDNA Clone ID No.", respectively,
indicating certain nucleic acids and proteins (or antibodies
against the same) of the invention (including polynucleotide,
polypeptide, and antibody fragments or variants thereof) that may
be used in detecting, diagnosing, preventing, treating, or
ameliorating the disease(s) or disorder(s) indicated in the
corresponding row in the "Disease Class" or "Preferred Indication"
Columns of Table 1F.
[0083] In another embodiment, the present invention also
encompasses methods of detecting, diagnosing, preventing, treating,
or ameliorating a disease or disorder listed in the "Disease Class"
or "Preferred Indication" Columns of Table 1F; comprising
administering to a patient combinations of the proteins, nucleic
acids, or antibodies of the invention (or fragments or variants
thereof), sharing similar indications as shown in the corresponding
rows in the "Disease Class" or "Preferred Indication" Columns of
Table 1F.
[0084] The "Disease Class" Column of Table 1F provides a
categorized descriptive heading for diseases, disorders, and/or
conditions (more fully described below) that may be detected,
diagnosed, prevented, treated, or ameliorated by a protein, nucleic
acid, or antibody of the invention (or fragment or variant
thereof).
[0085] The "Preferred Indication" Column of Table 1F describes
diseases, disorders, and/or conditions that may be detected,
diagnosed, prevented, treated, or ameliorated by a protein, nucleic
acid, or antibody of the invention (or fragment or variant
thereof).
[0086] The "Cell Line" and "Exemplary Targets" Columns of Table 1F
indicate particular cell lines and target genes, respectively,
which may show altered gene expression patterns (i.e., up- or
down-regulation of the indicated target gene) in Taqman.RTM.
assays, performed as described above, utilizing polynucleotides of
the cDNA Clone ID shown in the corresponding row. Alteration of
expression patterns of the indicated "Exemplary Target" genes is
correlated with a particular "Disease Class" and/or "Preferred
Indication" as shown in the corresponding row under the respective
column headings.
[0087] The "Exemplary Accessions" Column indicates GenBank
Accessions (available online through the National Center for
Biotechnology Information (NCBI) at http://www.ncbi.nlm.nih.gov/)
which correspond to the "Exemplary Targets" shown in the adjacent
row.
[0088] The recitation of "Cancer" in the "Disease Class" Column
indicates that the corresponding nucleic acid and protein, or
antibody against the same, of the invention (or fragment or variant
thereof) may be used for example, to detect, diagnose, prevent,
treat, and/or ameliorate neoplastic diseases and/or disorders
(e.g., leukemias, cancers, etc., as described below under
"Hyperproliferative Disorders").
[0089] The recitation of "Immune" in the "Disease Class" column
indicates that the corresponding nucleic acid and protein, or
antibody against the same, of the invention (or fragment or variant
thereof), may be used for example, to detect, diagnose, prevent,
treat, and/or ameliorate diseases and/or disorders relating to
neoplastic diseases (e.g., as described below under
"Hyperproliferative Disorders"), blood disorders (e.g., as
described below under "Immune Activity" "Cardiovascular Disorders"
and/or "Blood-Related Disorders"), and infections (e.g., as
described below under "Infectious Disease").
[0090] The recitation of "Angiogenesis" in the "Disease Class"
column indicates that the corresponding nucleic acid and protein,
or antibody against the same, of the invention (or fragment or
variant thereof), may be used for example, to detect, diagnose,
treat, prevent, and/or ameliorate diseases and/or disorders
relating to neoplastic diseases (e.g., as described below under
"Hyperproliferative Disorders"), diseases and/or disorders of the
cardiovascular system (e.g., as described below under
"Cardiovascular Disorders"), diseases and/or disorders involving
cellular and genetic abnormalities (e.g., as described below under
"Diseases at the Cellular Level"), diseases and/or disorders
involving angiogenesis (e.g., as described below under
"Anti-Angiogenesis Activity"), to promote or inhibit cell or tissue
regeneration (e.g., as described below under "Regeneration"), or to
promote wound healing (e.g., as described below under "Wound
Healing and Epithelial Cell Proliferation").
[0091] The recitation of "Diabetes" in the "Disease Class" column
indicates that the corresponding nucleic acid and protein, or
antibody against the same, of the invention (or fragment or variant
thereof), may be used for example, to detect, diagnose, treat,
prevent, and/or ameliorate diabetes (including diabetes mellitus
types I and II), as well as diseases and/or disorders associated
with, or consequential to, diabetes (e.g. as described below under
"Endocrine Disorders," "Renal Disorders," and "Gastrointestinal
Disorders").
Description of Table 2
[0092] Table 2 summarizes homology and features of some of the
polypeptides of the invention. The first column provides a unique
clone identifier, "Clone ID:", corresponding to a cDNA clone
disclosed in Table 1A or 1B. The second column provides the unique
contig identifier, "Contig ID:" corresponding to contigs in Table
1B and allowing for correlation with the information in Table 1B.
The third column provides the sequence identifier, "SEQ ID NO:X",
for the contig polynucleotide sequence. The fourth column provides
the analysis method by which the homology/identity disclosed in the
Table was determined. Comparisons were made between polypeptides
encoded by the polynucleotides of the invention and either a
non-redundant protein database (herein referred to as "NR"), or a
database of protein families (herein referred to as "PFAM") as
further described below. The fifth column provides a description of
the PFAM/NR hit having a significant match to a polypeptide of the
invention. Column six provides the accession number of the PFAM/NR
hit disclosed in the fifth column. Column seven, "Score/Percent
Identity", provides a quality score or the percent identity, of the
hit disclosed in columns five and six. Columns 8 and 9, "NT From"
and "NT To" respectively, delineate the polynucleotides in "SEQ ID
NO:X" that encode a polypeptide having a significant match to the
PFAM/NR database as disclosed in the fifth and sixth columns. In
specific embodiments polypeptides of the invention comprise, or
alternatively consist of, an amino acid sequence encoded by a
polynucleotide in SEQ ID NO:X as delineated in columns 8 and 9, or
fragments or variants thereof.
Description of Table 3
[0093] Table 3 provides polynucleotide sequences that may be
disclaimed according to certain embodiments of the invention. The
first column provides a unique clone identifier, "Clone ID", for a
cDNA clone related to contig sequences disclosed in Table 1B. The
second column provides the sequence identifier, "SEQ ID NO:X", for
contig sequences disclosed in Table 1A and/or 1B. The third column
provides the unique contig identifier, "Contig ID:", for contigs
disclosed in Table 1B. The fourth column provides a unique integer
`a` where `a` is any integer between 1 and the final nucleotide
minus 15 of SEQ ID NO:X, and the fifth column provides a unique
integer `b` where `b` is any integer between 15 and the final
nucleotide of SEQ ID NO:X, where both a and b correspond to the
positions of nucleotide residues shown in SEQ ID NO:X, and where b
is greater than or equal to a +14. For each of the polynucleotides
shown as SEQ ID NO:X, the uniquely defined integers can be
substituted into the general formula of a-b, and used to describe
polynucleotides which may be preferably excluded from the
invention. In certain embodiments, preferably excluded from the
invention are at least one, two, three, four, five, ten, or more of
the polynucleotide sequence(s) having the accession number(s)
disclosed in the sixth column of this Table (including for example,
published sequence in connection with a particular BAC clone). In
further embodiments, preferably excluded from the invention are the
specific polynucleotide sequence(s) contained in the clones
corresponding to at least one, two, three, four, five, ten, or more
of the available material having the accession numbers identified
in the sixth column of this Table (including for example, the
actual sequence contained in an identified BAC clone).
Description of Table 4
[0094] Table 4 provides a key to the tissue/cell source identifier
code disclosed in Table 1B.2, column 5. Column 1 provides the
tissue/cell source identifier code disclosed in Table 1B.2, Column
5. Columns 2-5 provide a description of the tissue or cell source.
Note that "Description" and "Tissue" sources (i.e. columns 2 and 3)
having the prefix "a_" indicates organs, tissues, or cells derived
from "adult" sources. Codes corresponding to diseased tissues are
indicated in column 6 with the word "disease." The use of the word
"disease" in column 6 is non-limiting. The tissue or cell source
may be specific (e.g. a neoplasm), or may be disease-associated
(e.g., a tissue sample from a normal portion of a diseased organ).
Furthermore, tissues and/or cells lacking the "disease" designation
may still be derived from sources directly or indirectly involved
in a disease state or disorder, and therefore may have a further
utility in that disease state or disorder. In numerous cases where
the tissue/cell source is a library, column 7 identifies the vector
used to generate the library.
Description of Table 5
[0095] Table 5 provides a key to the OMIM reference identification
numbers disclosed in Table 1B.1, column 9. OMIM reference
identification numbers (Table 5, Column 1) were derived from Online
Mendelian Inheritance in Man (Online Mendelian Inheritance in Man,
OMIM. McKusick-Nathans Institute for Genetic Medicine, Johns
Hopkins University (Baltimore, Md.) and National Center for
Biotechnology Information, National Library of Medicine, (Bethesda,
Md.) 2000. World Wide Web URL: http://www.ncbi.nlm.nih.gov/omim/).
Column 2 provides diseases associated with the cytologic band
disclosed in Table 1B.1, column 8, as determined using the Morbid
Map database.
Description of Table 6
[0096] Table 6 summarizes some of the ATCC Deposits, Deposit dates,
and ATCC designation numbers of deposits made with the ATCC in
connection with the present application. These deposits were made
in addition to those described in the Table 1A.
Description of Table 7
[0097] Table 7 shows the cDNA libraries sequenced, and ATCC
designation numbers and vector information relating to these cDNA
libraries.
[0098] The first column shows the first four letters indicating the
Library from which each library clone was derived. The second
column indicates the catalogued tissue description for the
corresponding libraries. The third column indicates the vector
containing the corresponding clones. The fourth column shows the
ATCC deposit designation for each library clone as indicated by the
deposit information in Table 6.
Definitions
[0099] The following definitions are provided to facilitate
understanding of certain terms used throughout this
specification.
[0100] In the present invention, "isolated" refers to material
removed from its original environment (e.g., the natural
environment if it is naturally occurring), and thus is altered "by
the hand of man" from its natural state. For example, an isolated
polynucleotide could be part of a vector or a composition of
matter, or could be contained within a cell, and still be
"isolated" because that vector, composition of matter, or
particular cell is not the original environment of the
polynucleotide. The term "isolated" does not refer to genomic or
cDNA libraries, whole cell total or mRNA preparations, genomic DNA
preparations (including those separated by electrophoresis and
transferred onto blots), sheared whole cell genomic DNA
preparations or other compositions where the art demonstrates no
distinguishing features of the polynucleotide/sequences of the
present invention.
[0101] In the present invention, a "secreted" protein refers to
those proteins capable of being directed to the ER, secretory
vesicles, or the extracellular space as a result of a signal
sequence, as well as those proteins released into the extracellular
space without necessarily containing a signal sequence. If the
secreted protein is released into the extracellular space, the
secreted protein can undergo extracellular processing to produce a
"mature" protein. Release into the extracellular space can occur by
many mechanisms, including exocytosis and proteolytic cleavage.
[0102] As used herein, a "polynucleotide" refers to a molecule
having a nucleic acid sequence encoding SEQ ID NO:Y or a fragment
or variant thereof (e.g., the polypeptide delinated in columns
fourteen and fifteen of Table 1A); a nucleic acid sequence
contained in SEQ ID NO:X (as described in column 5 of Table 1A
and/or column 3 of Table 1B) or the complement thereof; a cDNA
sequence contained in Clone ID: (as described in column 2 of Table
1A and/or 1B and contained within a library deposited with the
ATCC); a nucleotide sequence encoding the polypeptide encoded by a
nucleotide sequence in SEQ ID NO:B as defined in column 6 (EXON
From-To) of Table 1C or a fragment or variant thereof; or a
nucleotide coding sequence in SEQ ID NO:B as defined in column 6 of
Table 1C or the complement thereof. For example, the polynucleotide
can contain the nucleotide sequence of the full length cDNA
sequence, including the 5' and 3' untranslated sequences, the
coding region, as well as fragments, epitopes, domains, and
variants of the nucleic acid sequence. Moreover, as used herein, a
"polypeptide" refers to a molecule having an amino acid sequence
encoded by a polynucleotide of the invention as broadly defined
(obviously excluding poly-Phenylalanine or poly-Lysine peptide
sequences which result from translation of a polyA tail of a
sequence corresponding to a cDNA).
[0103] In the present invention, "SEQ ID NO:X" was often generated
by overlapping sequences contained in multiple clones (contig
analysis). A representative clone containing all or most of the
sequence for SEQ ID NO:X is deposited at Human Genome Sciences,
Inc. (HGS) in a catalogued and archived library. As shown, for
example, in column 2 of Table 1B, each clone is identified by a
cDNA Clone ID (identifier generally referred to herein as Clone
ID:). Each Clone ID is unique to an individual clone and the Clone
ID is all the information needed to retrieve a given clone from the
HGS library. Table 7 provides a list of the deposited cDNA
libraries. One can use the Clone ID: to determine the library
source by reference to Tables 6 and 7. Table 7 lists the deposited
cDNA libraries by name and links each library to an ATCC Deposit.
Library names contain four characters, for example, "HTWE." The
name of a cDNA clone (Clone ID) isolated from that library begins
with the same four characters, for example "HTWEP07". As mentioned
below, Table 1A and/or 1B correlates the Clone ID names with SEQ ID
NO:X. Thus, starting with an SEQ ID NO:X, one can use Tables 1A,
1B, 6, 7, and 9 to determine the corresponding Clone ID, which
library it came from and which ATCC deposit the library is
contained in. Furthermore, it is possible to retrieve a given cDNA
clone from the source library by techniques known in the art and
described elsewhere herein. The ATCC is located at 10801 University
Boulevard, Manassas, Va. 20110-2209, USA. The ATCC deposits were
made pursuant to the terms of the Budapest Treaty on the
international recognition of the deposit of microorganisms for the
purposes of patent procedure.
[0104] In specific embodiments, the polynucleotides of the
invention are at least 15, at least 30, at least 50, at least 100,
at least 125, at least 500, or at least 1000 continuous nucleotides
but are less than or equal to 300 kb, 200 kb, 100 kb, 50 kb, 15 kb,
10 kb, 7.5 kb, 5 kb, 2.5 kb, 2.0 kb, or 1 kb, in length. In a
further embodiment, polynucleotides of the invention comprise a
portion of the coding sequences, as disclosed herein, but do not
comprise all or a portion of any intron. In another embodiment, the
polynucleotides comprising coding sequences do not contain coding
sequences of a genomic flanking gene (i.e., 5' or 3' to the gene of
interest in the genome). In other embodiments, the polynucleotides
of the invention do not contain the coding sequence of more than
1000, 500, 250, 100, 50, 25, 20, 15, 10, 5, 4, 3, 2, or 1 genomic
flanking gene(s).
[0105] A "polynucleotide" of the present invention also includes
those polynucleotides capable of hybridizing, under stringent
hybridization conditions, to sequences contained in SEQ ID NO:X, or
the complement thereof (e.g., the complement of any one, two,
three, four, or more of the polynucleotide fragments described
herein), the polynucleotide sequence delineated in columns 7 and 8
of Table 1A or the complement thereof, the polynucleotide sequence
delineated in columns 8 and 9 of Table 2 or the complement thereof,
and/or cDNA sequences contained in Clone ID: (e.g., the complement
of any one, two, three, four, or more of the polynucleotide
fragments, or the cDNA clone within the pool of cDNA clones
deposited with the ATCC, described herein), and/or the
polynucleotide sequence delineated in column 6 of Table 1C or the
complement thereof. "Stringent hybridization conditions" refers to
an overnight incubation at 42 degree C. in a solution comprising
50% formamide, 5.times.SSC (750 mM NaCl, 75 mM trisodium citrate),
50 mM sodium phosphate (pH 7.6), 5.times. Denhardt's solution, 10%
dextran sulfate, and 20 .mu.g/ml denatured, sheared salmon sperm
DNA, followed by washing the filters in 0.1.times.SSC at about 65
degree C.
[0106] Also contemplated are nucleic acid molecules that hybridize
to the polynucleotides of the present invention at lower stringency
hybridization conditions. Changes in the stringency of
hybridization and signal detection are primarily accomplished
through the manipulation of formamide concentration (lower
percentages of formamide result in lowered stringency); salt
conditions, or temperature. For example, lower stringency
conditions include an overnight incubation at 37 degree C. in a
solution comprising 6.times.SSPE (20.times.SSPE=3M NaCl; 0.2M
NaH.sub.2PO.sub.4; 0.02M EDTA, pH 7.4), 0.5% SDS, 30% formamide,
100 ug/ml salmon sperm blocking DNA; followed by washes at 50
degree C. with 1.times.SSPE, 0.1% SDS. In addition, to achieve even
lower stringency, washes performed following stringent
hybridization can be done at higher salt concentrations (e.g.
5.times.SSC).
[0107] Note that variations in the above conditions may be
accomplished through the inclusion and/or substitution of alternate
blocking reagents used to suppress background in hybridization
experiments. Typical blocking reagents include Denhardt's reagent,
BLOTTO, heparin, denatured salmon sperm DNA, and commercially
available proprietary formulations. The inclusion of specific
blocking reagents may require modification of the hybridization
conditions described above, due to problems with compatibility.
[0108] Of course, a polynucleotide which hybridizes only to polyA+
sequences (such as any 3' terminal polyA+ tract of a cDNA shown in
the sequence listing), or to a complementary stretch of T (or U)
residues, would not be included in the definition of
"polynucleotide," since such a polynucleotide would hybridize to
any nucleic acid molecule containing a poly (A) stretch or the
complement thereof (e.g., practically any double-stranded cDNA
clone generated using oligo dT as a primer).
[0109] The polynucleotide of the present invention can be composed
of any polyribonucleotide or polydeoxribonucleotide, which may be
unmodified RNA or DNA or modified RNA or DNA. For example,
polynucleotides can be composed of single- and double-stranded DNA,
DNA that is a mixture of single- and double-stranded regions,
single- and double-stranded RNA, and RNA that is mixture of single-
and double-stranded regions, hybrid molecules comprising DNA and
RNA that may be single-stranded or, more typically, double-stranded
or a mixture of single- and double-stranded regions. In addition,
the polynucleotide can be composed of triple-stranded regions
comprising RNA or DNA or both RNA and DNA. A polynucleotide may
also contain one or more modified bases or DNA or RNA backbones
modified for stability or for other reasons. "Modified" bases
include, for example, tritylated bases and unusual bases such as
inosine. A variety of modifications can be made to DNA and RNA;
thus, "polynucleotide" embraces chemically, enzymatically, or
metabolically modified forms.
[0110] In specific embodiments, the polynucleotides of the
invention are at least 15, at least 30, at least 50, at least 100,
at least 125, at least 500, or at least 1000 continuous nucleotides
but are less than or equal to 300 kb, 200 kb, 100 kb, 50 kb, 15 kb,
10 kb, 7.5 kb, 5 kb, 2.5 kb, 2.0 kb, or 1 kb, in length. In a
further embodiment, polynucleotides of the invention comprise a
portion of the coding sequences, as disclosed herein, but do not
comprise all or a portion of any intron. In another embodiment, the
polynucleotides comprising coding sequences do not contain coding
sequences of a genomic flanking gene (i.e., 5' or 3' to the gene of
interest in the genome). In other embodiments, the polynucleotides
of the invention do not contain the coding sequence of more than
1000, 500, 250, 100, 50, 25, 20, 15, 10, 5, 4, 3, 2, or 1 genomic
flanking gene(s).
[0111] "SEQ ID NO:X" refers to a polynucleotide sequence described
in column 5 of Table 1A, while "SEQ ID NO:Y" refers to a
polypeptide sequence described in column 10 of Table 1A. SEQ ID
NO:X is identified by an integer specified in column 6 of Table 1A.
The polypeptide sequence SEQ ID NO:Y is a translated open reading
frame (ORF) encoded by polynucleotide SEQ ID NO:X. The
polynucleotide sequences are shown in the sequence listing
immediately followed by all of the polypeptide sequences. Thus, a
polypeptide sequence corresponding to polynucleotide sequence SEQ
ID NO:2 is the first polypeptide sequence shown in the sequence
listing. The second polypeptide sequence corresponds to the
polynucleotide sequence shown as SEQ ID NO:3, and so on.
[0112] The polypeptide of the present invention can be composed of
amino acids joined to each other by peptide bonds or modified
peptide bonds, i.e., peptide isosteres, and may contain amino acids
other than the 20 gene-encoded amino acids. The polypeptides may be
modified by either natural processes, such as posttranslational
processing, or by chemical modification techniques which are well
known in the art. Such modifications are well described in basic
texts and in more detailed monographs, as well as in a voluminous
research literature. Modifications can occur anywhere in a
polypeptide, including the peptide backbone, the amino acid
side-chains and the amino or carboxyl termini. It will be
appreciated that the same type of modification may be present in
the same or varying degrees at several sites in a given
polypeptide. Also, a given polypeptide may contain many types of
modifications. Polypeptides may be branched, for example, as a
result of ubiquitination, and they may be cyclic, with or without
branching. Cyclic, branched, and branched cyclic polypeptides may
result from posttranslation natural processes or may be made by
synthetic methods. Modifications include acetylation, acylation,
ADP-ribosylation, amidation, covalent attachment of flavin,
covalent attachment of a heme moiety, covalent attachment of a
nucleotide or nucleotide derivative, covalent attachment of a lipid
or lipid derivative, covalent attachment of phosphotidylinositol,
cross-linking, cyclization, disulfide bond formation,
demethylation, formation of covalent cross-links, formation of
cysteine, formation of pyroglutamate, formylation,
gamma-carboxylation, glycosylation, GPI anchor formation,
hydroxylation, iodination, methylation, myristoylation, oxidation,
pegylation, proteolytic processing, phosphorylation, prenylation,
racemization, selenoylation, sulfation, transfer-RNA mediated
addition of amino acids to proteins such as arginylation, and
ubiquitination. (See, for instance, PROTEINS--STRUCTURE AND
MOLECULAR PROPERTIES, 2nd Ed., T. E. Creighton, W.H. Freeman and
Company, New York (1993); POSTTRANSLATIONAL COVALENT MODIFICATION
OF PROTEINS, B. C. Johnson, Ed., Academic Press, New York, pgs.
1-12 (1983); Seifter et al., Meth. Enzymol. 182:626-646 (1990);
Rattan et al., Ann. N.Y. Acad. Sci. 663:48-62 (1992)).
[0113] "SEQ ID NO:X" refers to a polynucleotide sequence described,
for example, in Tables 1A, 1B or 2, while "SEQ ID NO:Y" refers to a
polypeptide sequence described in column 11 of Table 1A and or
column 6 of Table 1B.1. SEQ ID NO:X is identified by an integer
specified in column 4 of Table 1B.1. The polypeptide sequence SEQ
ID NO:Y is a translated open reading frame (ORF) encoded by
polynucleotide SEQ ID NO:X. "Clone ID:" refers to a cDNA clone
described in column 2 of Table 1A and/or 1B.
[0114] "A polypeptide having functional activity" refers to a
polypeptide capable of displaying one or more known functional
activities associated with a full-length (complete) protein. Such
functional activities include, but are not limited to, biological
activity, antigenicity [ability to bind (or compete with a
polypeptide for binding) to an anti-polypeptide antibody],
immunogenicity (ability to generate antibody which binds to a
specific polypeptide of the invention), ability to form multimers
with polypeptides of the invention, and ability to bind to a
receptor or ligand for a polypeptide.
[0115] The polypeptides of the invention can be assayed for
functional activity (e.g. biological activity) using or routinely
modifying assays known in the art, as well as assays described
herein. Specifically, one of skill in the art may routinely assay
secreted polypeptides (including fragments and variants) of the
invention for activity using assays as described in the examples
section below.
[0116] "A polypeptide having biological activity" refers to a
polypeptide exhibiting activity similar to, but not necessarily
identical to, an activity of a polypeptide of the present
invention, including mature forms, as measured in a particular
biological assay, with or without dose dependency. In the case
where dose dependency does exist, it need not be identical to that
of the polypeptide, but rather substantially similar to the
dose-dependence in a given activity as compared to the polypeptide
of the present invention (i.e., the candidate polypeptide will
exhibit greater activity or not more than about 25-fold less and,
preferably, not more than about tenfold less activity, and most
preferably, not more than about three-fold less activity relative
to the polypeptide of the present invention).
Tables
Table 1A
[0117] Table 1A summarizes information concerning certain
polynucleotides and polypeptides of the invention. The first column
provides the gene number in the application for each clone
identifier. The second column provides a unique clone identifier,
"Clone ID:", for a cDNA clone related to each contig sequence
disclosed in Table 1A. Third column, the cDNA Clones identified in
the second column were deposited as indicated in the third column
(i.e. by ATCC Deposit No: Z and deposit date). Some of the deposits
contain multiple different clones corresponding to the same gene.
In the fourth column, "Vector" refers to the type of vector
contained in the corresponding cDNA Clone identified in the second
column. In the fifth column, the nucleotide sequence identified as
"NT SEQ ID NO:X" was assembled from partially homologous
("overlapping") sequences obtained from the corresponding cDNA
clone identified in the second column and, in some cases, from
additional related cDNA clones. The overlapping sequences were
assembled into a single contiguous sequence of high redundancy
(usually three to five overlapping sequences at each nucleotide
position), resulting in a final sequence identified as SEQ ID NO:X.
In the sixth column, "Total NT Seq." refers to the total number of
nucleotides in the contig sequence identified as SEQ ID NO:X." The
deposited clone may contain all or most of these sequences,
reflected by the nucleotide position indicated as "5' NT of Clone
Seq." (seventh column) and the "3' NT of Clone Seq." (eighth
column) of SEQ ID NO:X. In the ninth column, the nucleotide
position of SEQ ID NO:X of the putative start codon (methionine) is
identified as "5' NT of Start Codon." Similarly, in column ten, the
nucleotide position of SEQ ID NO:X of the predicted signal sequence
is identified as "5' NT of First AA of Signal Pep." In the eleventh
column, the translated amino acid sequence, beginning with the
methionine, is identified as "AA SEQ ID NO:Y," although other
reading frames can also be routinely translated using known
molecular biology techniques. The polypeptides produced by these
alternative open reading frames are specifically contemplated by
the present invention.
[0118] In the twelfth and thirteenth columns of Table 1A, the first
and last amino acid position of SEQ ID NO:Y of the predicted signal
peptide is identified as "First AA of Sig Pep" and "Last AA of Sig
Pep." In the fourteenth column, the predicted first amino acid
position of SEQ ID NO:Y of the secreted portion is identified as
"Predicted First AA of Secreted Portion". The amino acid position
of SEQ ID NO:Y of the last amino acid encoded by the open reading
frame is identified in the fifteenth column as "Last AA of
ORF".
[0119] SEQ ID NO:X (where X may be any of the polynucleotide
sequences disclosed in the sequence listing) and the translated SEQ
ID NO:Y (where Y may be any of the polypeptide sequences disclosed
in the sequence listing) are sufficiently accurate and otherwise
suitable for a variety of uses well known in the art and described
further below. For instance, SEQ ID NO:X is useful for designing
nucleic acid hybridization probes that will detect nucleic acid
sequences contained in SEQ ID NO:X or the cDNA contained in the
deposited clone. These probes will also hybridize to nucleic acid
molecules in biological samples, thereby enabling a variety of
forensic and diagnostic methods of the invention. Similarly,
polypeptides identified from SEQ ID NO:Y may be used, for example,
to generate antibodies which bind specifically to proteins
containing the polypeptides and the secreted proteins encoded by
the cDNA clones identified in Table 1A and/or elsewhere herein
[0120] Nevertheless, DNA sequences generated by sequencing
reactions can contain sequencing errors. The errors exist as
misidentified nucleotides, or as insertions or deletions of
nucleotides in the generated DNA sequence. The erroneously inserted
or deleted nucleotides cause frame shifts in the reading frames of
the predicted amino acid sequence. In these cases, the predicted
amino acid sequence diverges from the actual amino acid sequence,
even though the generated DNA sequence may be greater than 99.9%
identical to the actual DNA sequence (for example, one base
insertion or deletion in an open reading frame of over 1000
bases).
[0121] Accordingly, for those applications requiring precision in
the nucleotide sequence or the amino acid sequence, the present
invention provides not only the generated nucleotide sequence
identified as SEQ ID NO:X, and the predicted translated amino acid
sequence identified as SEQ ID NO:Y, but also a sample of plasmid
DNA containing a human cDNA of the invention deposited with the
ATCC, as set forth in Table 1A. The nucleotide sequence of each
deposited plasmid can readily be determined by sequencing the
deposited plasmid in accordance with known methods
[0122] The predicted amino acid sequence can then be verified from
such deposits. Moreover, the amino acid sequence of the protein
encoded by a particular plasmid can also be directly determined by
peptide sequencing or by expressing the protein in a suitable host
cell containing the deposited human cDNA, collecting the protein,
and determining its sequence.
[0123] Also provided in Table 1A is the name of the vector which
contains the cDNA plasmid. Each vector is routinely used in the
art. The following additional information is provided for
convenience.
[0124] Vectors Lambda Zap (U.S. Pat. Nos. 5,128,256 and 5,286,636),
Uni-Zap XR (U.S. Pat. Nos. 5,128,256 and 5,286,636), Zap Express
(U.S. Pat. Nos. 5,128,256 and 5,286,636), pBluescript (pBS) (Short,
J. M. et al., Nucleic Acids Res. 16:7583-7600 (1988); Alting-Mees,
M. A. and Short, J. M., Nucleic Acids Res. 17:9494 (1989)) and pBK
(Alting-Mees, M. A. et al., Strategies 5:58-61 (1992)) are
commercially available from Stratagene Cloning Systems, Inc., 11011
N. Torrey Pines Road, La Jolla, Calif., 92037. pBS contains an
ampicillin resistance gene and pBK contains a neomycin resistance
gene. Phagemid pBS may be excised from the Lambda Zap and Uni-Zap
XR vectors, and phagemid pBK may be excised from the Zap Express
vector. Both phagemids may be transformed into E. coli strain XL-1
Blue, also available from Stratagene
[0125] Vectors pSport1, pCMVSport 1.0, pCMVSport 2.0 and pCMVSport
3.0, were obtained from Life Technologies, Inc., P.O. Box 6009,
Gaithersburg, Md. 20897. All Sport vectors contain an ampicillin
resistance gene and may be transformed into E. coli strain DH10B,
also available from Life Technologies. See, for instance, Gruber,
C. E., et al., Focus 15:59 (1993). Vector lafmid BA (Bento Soares,
Columbia University, New York, N.Y.) contains an ampicillin
resistance gene and can be transformed into E. coli strain XL-1
Blue. Vector pCR.RTM.2.1, which is available from Invitrogen, 1600
Faraday Avenue, Carlsbad, Calif. 92008, contains an ampicillin
resistance gene and may be transformed into E. coli strain DH10B,
available from Life Technologies. See, for instance, Clark, J. M.,
Nuc. Acids Res. 16:9677-9686 (1988) and Mead, D. et al.,
Bio/Technology 9: (1991).
[0126] The present invention also relates to the genes
corresponding to SEQ ID NO:X, SEQ ID NO:Y, and/or a deposited cDNA
(cDNA Clone ID). The corresponding gene can be isolated in
accordance with known methods using the sequence information
disclosed herein. Such methods include, but are not limited to,
preparing probes or primers from the disclosed sequence and
identifying or amplifying the corresponding gene from appropriate
sources of genomic material.
[0127] Also provided in the present invention are allelic variants,
orthologs, and/or species homologs. Procedures known in the art can
be used to obtain full-length genes, allelic variants, splice
variants, full-length coding portions, orthologs, and/or species
homologs of genes corresponding to SEQ ID NO:X and SEQ ID NO:Y
using information from the sequences disclosed herein or the clones
deposited with the ATCC. For example, allelic variants and/or
species homologs may be isolated and identified by making suitable
probes or primers from the sequences provided herein and screening
a suitable nucleic acid source for allelic variants and/or the
desired homologue.
[0128] The present invention provides a polynucleotide comprising,
or alternatively consisting of, the nucleic acid sequence of SEQ ID
NO:X and/or a cDNA contained in ATCC Deposit No. Z. The present
invention also provides a polypeptide comprising, or alternatively,
consisting of, the polypeptide sequence of SEQ ID NO:Y, a
polypeptide encoded by SEQ ID NO:X, and/or a polypeptide encoded by
a cDNA contained in ATCC deposit No. Z. Polynucleotides encoding a
polypeptide comprising, or alternatively consisting of the
polypeptide sequence of SEQ ID NO:Y, a polypeptide encoded by SEQ
ID NO:X and/or a polypeptide encoded by the cDNA contained in ATCC
Deposit No. Z, are also encompassed by the invention. The present
invention further encompasses a polynucleotide comprising, or
alternatively consisting of the complement of the nucleic acid
sequence of SEQ ID NO:X, and/or the complement of the coding strand
of the cDNA contained in ATCC Deposit No. Z. TABLE-US-00001 LENGTHY
TABLE REFERENCED HERE US20070048297A1-20070301-T00001 Please refer
to the end of the specification for access instructions.
Table 1B (Comprised of Tables 1B.1 and 1B.2)
[0129] The first column in Table 1B.1 and Table 1B.2 provides the
gene number in the application corresponding to the clone
identifier. The second column in Table 1B.1 and Table 1B.2 provides
a unique "Clone ID:" for the cDNA clone related to each contig
sequence disclosed in Table 1B.1 and Table 1B.2. This clone ID
references the cDNA clone which contains at least the 5' most
sequence of the assembled contig and at least a portion of SEQ ID
NO:X as determined by directly sequencing the referenced clone. The
referenced clone may have more sequence than described in the
sequence listing or the clone may have less. In the vast majority
of cases, however, the clone is believed to encode a full-length
polypeptide. In the case where a clone is not full-length, a
full-length cDNA can be obtained by methods described elsewhere
herein. The third column in Table 1B.1 and Table 1B.2 provides a
unique "Contig ID" identification for each contig sequence. The
fourth column in Table 1B.1 and Table 1B.2 provides the "SEQ ID
NO:" identifier for each of the contig polynucleotide sequences
disclosed in Table 1B.
[0130] Table 1B.1
[0131] The fifth column in Table 1B.1, "ORF (From-To)", provides
the location (i.e., nucleotide position numbers) within the
polynucleotide sequence "SEQ ID NO:X" that delineate the preferred
open reading frame (ORF) shown in the sequence listing and
referenced in Table 1B.1, column 6, as SEQ ID NO:Y. Where the
nucleotide position number "To" is lower than the nucleotide
position number "From", the preferred ORF is the reverse complement
of the referenced polynucleotide sequence. The sixth column in
Table 1B.1 provides the corresponding SEQ ID NO:Y for the
polypeptide sequence encoded by the preferred ORF delineated in
column 5. In one embodiment, the invention provides an amino acid
sequence comprising, or alternatively consisting of, a polypeptide
encoded by the portion of SEQ ID NO:X delineated by "ORF
(From-To)". Also provided are polynucleotides encoding such amino
acid sequences and the complementary strand thereto. Column 7 in
Table 1B.1 lists residues comprising epitopes contained in the
polypeptides encoded by the preferred ORF (SEQ ID NO:Y), as
predicted using the algorithm of Jameson and Wolf, (1988) Comp.
Appl. Biosci. 4:181-186. The Jameson-Wolf antigenic analysis was
performed using the computer program PROTEAN (Version 3.11 for the
Power MacIntosh, DNASTAR, Inc., 1228 South Park Street Madison,
Wis.). In specific embodiments, polypeptides of the invention
comprise, or alternatively consist of, at least one, two, three,
four, five or more of the predicted epitopes as described in Table
1B. It will be appreciated that depending on the analytical
criteria used to predict antigenic determinants, the exact address
of the determinant may vary slightly.
[0132] Column 8 in Table 1B.1 provides a chromosomal map location
for certain polynucleotides of the invention. Chromosomal location
was determined by finding exact matches to EST and cDNA sequences
contained in the NCBI (National Center for Biotechnology
Information) UniGene database. Each sequence in the UniGene
database is assigned to a "cluster"; all of the ESTs, cDNAs, and
STSs in a cluster are believed to be derived from a single gene.
Chromosomal mapping data is often available for one or more
sequence(s) in a UniGene cluster; this data (if consistent) is then
applied to the cluster as a whole. Thus, it is possible to infer
the chromosomal location of a new polynucleotide sequence by
determining its identity with a mapped UniGene cluster.
[0133] A modified version of the computer program BLASTN (Altshul,
et al., J. Mol. Biol. 215:403-410 (1990), and Gish, and States,
Nat. Genet. 3:266-272) (1993) was used to search the UniGene
database for EST or cDNA sequences that contain exact or near-exact
matches to a polynucleotide sequence of the invention (the
`Query`). A sequence from the UniGene database (the `Subject`) was
said to be an exact match if it contained a segment of 50
nucleotides in length such that 48 of those nucleotides were in the
same order as found in the Query sequence. If all of the matches
that met this criteria were in the same UniGene cluster, and
mapping data was available for this cluster, it is indicated in
Table 1B under the heading "Cytologic Band". Where a cluster had
been further localized to a distinct cytologic band, that band is
disclosed; where no banding information was available, but the gene
had been localized to a single chromosome, the chromosome is
disclosed.
[0134] Once a presumptive chromosomal location was determined for a
polynucleotide of the invention, an associated disease locus was
identified by comparison with a database of diseases which have
been experimentally associated with genetic loci. The database used
was the Morbid Map, derived from OMIM.TM. and National Center for
Biotechnology Information, National Library of Medicine (Bethesda,
Md.) 2000. If the putative chromosomal location of a polynucleotide
of the invention (Query sequence) was associated with a disease in
the Morbid Map database, an OMIM reference identification number
was noted in column 9, Table 1B.1, labelled "OMIM Disease
Reference(s). Table 5 is a key to the OMIM reference identification
numbers (column 1), and provides a description of the associated
disease in Column 2.
[0135] Table 1B.2
[0136] Column 5, in Table 1B.2, provides an expression profile and
library Code:Count for each of the contig sequences (SEQ ID NO:X)
disclosed in Table 1B, which can routinely be combined with the
information provided in Table 4 and used to determine the tissues,
cells, and/or cell line libraries which predominantly express the
polynucleotides of the invention. The first number in Table 1B.2,
column 5 (preceding the colon), represents the tissue/cell source
identifier code corresponding to the code and description provided
in Table 4. The second number in column 5 (following the colon)
represents the number of times a sequence corresponding to the
reference polynucleotide sequence was identified in the
corresponding tissue/cell source. Those tissue/cell source
identifier codes in which the first two letters are "AR" designate
information generated using DNA array technology. Utilizing this
technology, cDNAs were amplified by PCR and then transferred, in
duplicate, onto the array. Gene expression was assayed through
hybridization of first strand cDNA probes to the DNA array. cDNA
probes were generated from total RNA extracted from a variety of
different tissues and cell lines. Probe synthesis was performed in
the presence of .sup.33P dCTP, using oligo (dT) to prime reverse
transcription. After hybridization, high stringency washing
conditions were employed to remove non-specific hybrids from the
array. The remaining signal, emanating from each gene target, was
measured using a Phosphorimager. Gene expression was reported as
Phosphor Stimulating Luminescence (PSL) which reflects the level of
phosphor signal generated from the probe hybridized to each of the
gene targets represented on the array. A local background signal
subtraction was performed before the total signal generated from
each array was used to normalize gene expression between the
different hybridizations. The value presented after "[array code]:"
represents the mean of the duplicate values, following background
subtraction and probe normalization. One of skill in the art could
routinely use this information to identify normal and/or diseased
tissue(s) which show a predominant expression pattern of the
corresponding polynucleotide of the invention or to identify
polynucleotides which show predominant and/or specific tissue
and/or cell expression. TABLE-US-00002 LENGTHY TABLE REFERENCED
HERE US20070048297A1-20070301-T00002 Please refer to the end of the
specification for access instructions.
TABLE-US-00003 LENGTHY TABLE REFERENCED HERE
US20070048297A1-20070301-T00003 Please refer to the end of the
specification for access instructions.
[0137] Table 1C summarizes additional polynucleotides encompassed
by the invention (including cDNA clones related to the sequences
(Clone ID:), contig sequences (contig identifier (Contig ID:)
contig nucleotide sequence identifiers (SEQ ID NO:X)), and genomic
sequences (SEQ ID NO:B). The first column provides a unique clone
identifier, "Clone ID:", for a cDNA clone related to each contig
sequence. The second column provides the sequence identifier, "SEQ
ID NO:X", for each contig sequence. The third column provides a
unique contig identifier, "Contig ID:" for each contig sequence.
The fourth column, provides a BAC identifier "BAC ID NO:A" for the
BAC clone referenced in the corresponding row of the table. The
fifth column provides the nucleotide sequence identifier, "SEQ ID
NO:B" for a fragment of the BAC clone identified in column four of
the corresponding row of the table. The sixth column, "Exon
From-To", provides the location (i.e., nucleotide position numbers)
within the polynucleotide sequence of SEQ ID NO:B which delineate
certain polynucleotides of the invention that are also exemplary
members of polynucleotide sequences that encode polypeptides of the
invention (e.g., polypeptides containing amino acid sequences
encoded by the polynucleotide sequences delineated in column six,
and fragments and variants thereof). TABLE-US-00004 LENGTHY TABLE
REFERENCED HERE US20070048297A1-20070301-T00004 Please refer to the
end of the specification for access instructions.
[0138] Tables 1D and 1E: The polynucleotides or polypeptides, or
agonists or antagonists of the present invention can be used in
assays to test for one or more biological activities. If these
polynucleotides and polypeptides do exhibit activity in a
particular assay, it is likely that these molecules may be involved
in the diseases associated with the biological activity. Thus, the
polynucleotides or polypeptides, or agonists or antagonists could
be used to treat the associated disease.
[0139] The present invention encompasses methods of detecting,
preventing, diagnosing, prognosticating, treating, and/or
ameliorating a disease or disorder. In preferred embodiments, the
present invention encompasses a method of treating a disease or
disorder listed in the "Preferred Indications" columns of Table 1D
and Table 1E; comprising administering to a patient (in which such
treatment, prevention, or amelioration is desired) a protein,
nucleic acid, or antibody of the invention (or fragment or variant
thereof) in an amount effective to treat, prevent, diagnose, or
ameliorate the disease or disorder. The first and seccond columns
of Table 1D show the "Gene No." and "cDNA Clone ID No.",
respectively, indicating certain nucleic acids and proteins (or
antibodies against the same) of the invention (including
polynucleotide, polypeptide, and antibody fragments or variants
thereof) that may be used in preventing, treating, diagnosing, or
ameliorating the disease(s) or disorder(s) indicated in the
corresponding row in Column 3 of Table 1D.
[0140] In another embodiment, the present invention also
encompasses methods of preventing, treating, diagnosing, or
ameliorating a disease or disorder listed in the "Preferred
Indications" column of Table 1D and Table 1E; comprising
administering to a patient combinations of the proteins, nucleic
acids, or antibodies of the invention (or fragments or variants
thereof), sharing similar indications as shown in the corresponding
rows in Colum 3 of Table 1D.
[0141] The "Preferred Indications" columns of Table 1D and Table 1E
describe diseases, disorders, and/or conditions that may be
treated, prevented, diagnosed, or ameliorated by a protein, nucleic
acid, or antibody of the invention (or fragment or variant
thereof).
[0142] The recitation of "Cancer" in the "Preferred Indications"
columns indicates that the corresponding nucleic acid and protein,
or antibody against the same, of the invention (or fragment or
variant thereof) may be used for example, to diagnose, treat,
prevent, and/or ameliorate diseases and/or disorders relating to
neoplastic diseases (e.g., leukemias, cancers, and/or as described
below under "Hyperproliferative Disorders").
[0143] In specific embodiments, a protein, nucleic acid, or
antibody of the invention (or fragment or variant thereof) having a
"Cancer" recitation in the "Preferred Indication" column of Table
1D may be used for example, to diagnose, treat, prevent, and/or
ameliorate a neoplasm located in a tissue selected from the group
consisting of: colon, abdomen, bone, breast, digestive system,
liver, pancreas, prostate, peritoneum, lung, blood (e.g.,
leukemia), endocrine glands (adrenal, parathyroid, pituitary,
testicles, ovary, thymus, thyroid), uterus, eye, head and neck,
nervous (central and peripheral), lymphatic system, pelvic, skin,
soft tissue, spleen, thoracic, and urogenital.
[0144] In specific embodiments, a protein, nucleic acid, or
antibody of the invention (or fragment or variant thereof) having a
"Cancer" recitation in the "Preferred Indication" column of Table
1D, may be used for example, to diagnose, treat, prevent, and/or
ameliorate a pre-neoplastic condition, selected from the group
consisting of: hyperplasia (e.g., endometrial hyperplasia and/or as
described in the section entitled "Hyperproliferative Disorders"),
metaplasia (e.g., connective tissue metaplasia, atypical
metaplasia, and/or as described in the section entitled
"Hyperproliferative Disorders"), and/or dysplasia (e.g., cervical
dysplasia, and bronchopulmonary dysplasia).
[0145] In another specific embodiment, a protein, nucleic acid, or
antibody of the invention (or fragment or variant thereof) having a
"Cancer" recitation in the "Preferred Indication" column of Table
1D, may be used for example, to diagnose, treat, prevent, and/or
ameliorate a benign dysproliferative disorder selected from the
group consisting of: benign tumors, fibrocystic conditions, tissue
hypertrophy, and/or as described in the section entitled
"Hyperproliferative Disorders".
[0146] The recitation of "Immune/Hematopoietic" in the "Preferred
Indication" column indicates that the corresponding nucleic acid
and protein, or antibody against the same, of the invention (or
fragment or variant thereof), may be used for example, to diagnose,
treat, prevent, and/or ameliorate diseases and/or disorders
relating to neoplastic diseases (e.g., as described below under
"Hyperproliferative Disorders"), blood disorders (e.g., as
described below under "Immune Activity" "Cardiovascular Disorders"
and/or "Blood-Related Disorders"), and infections (e.g., as
described below under "Infectious Disease").
[0147] In specific embodiments, a protein, nucleic acid, or
antibody of the invention (or fragment or variant thereof) having
the "Immune/Hematopoietic" recitation in the "Preferred Indication"
column of Table 1D, may be used for example, to diagnose, treat,
prevent, and/or ameliorate a disease or disorder selected from the
group consisting of: anemia, pancytopenia, leukopenia,
thrombocytopenia, leukemias, Hodgkin's disease, non-Hodgkin's
lymphoma, acute lymphocytic anemia (ALL), plasmacytomas, multiple
myeloma, Burkitt's lymphoma, arthritis, asthma, AIDS, autoimmune
disease, rheumatoid arthritis, granulomatous disease, immune
deficiency, inflammatory bowel disease, sepsis, neutropenia,
neutrophilia, psoriasis, immune reactions to transplanted organs
and tissues, systemic lupus erythematosis, hemophilia,
hypercoagulation, diabetes mellitus, endocarditis, meningitis, Lyme
Disease, and allergies.
[0148] The recitation of "Reproductive" in the "Preferred
Indication" column indicates that the corresponding nucleic acid
and protein, or antibody against the same, of the invention (or
fragment or variant thereof), may be used for example, to diagnose,
treat, prevent, and/or ameliorate diseases and/or disorders
relating to neoplastic diseases (e.g., as described below under
"Hyperproliferative Disorders"), and disorders of the reproductive
system (e.g., as described below under "Reproductive System
Disorders").
[0149] In specific embodiments, a protein, nucleic acid, or
antibody of the invention (or fragment or variant thereof) having a
"Reproductive" recitation in the "Preferred Indication" column of
Table 1D, may be used for example, to diagnose, treat, prevent,
and/or ameliorate a disease or disorder selected from the group
consisting of: cryptorchism, prostatitis, inguinal hernia,
varicocele, leydig cell tumors, verrucous carcinoma, prostatitis,
malacoplakia, Peyronie's disease, penile carcinoma, squamous cell
hyperplasia, dysmenorrhea, ovarian adenocarcinoma, Turner's
syndrome, mucopurulent cervicitis, Sertoli-leydig tumors, ovarian
cancer, uterine cancer, pelvic inflammatory disease, testicular
cancer, prostate cancer, Klinefelter's syndrome, Young's syndrome,
premature ejaculation, diabetes mellitus, cystic fibrosis,
Kartagener's syndrome, testicular atrophy, testicular feminization,
anorchia, ectopic testis, epididymitis, orchitis, gonorrhea,
syphilis, testicular torsion, vasitis nodosa, germ cell tumors,
stromal tumors, dysmenorrhea, retroverted uterus, endometriosis,
fibroids, adenomyosis, anovulatory bleeding, amenorrhea, Cushing's
syndrome, hydatidiform moles, Asherman's syndrome, premature
menopause, precocious puberty, uterine polyps, dysfunctional
uterine bleeding, cervicitis, chronic cervicitis, mucopurulent
cervicitis, cervical dysplasia, cervical polyps, Nabothian cysts,
cervical erosion, cervical incompetence, cervical neoplasms,
pseudohermaphroditism, and premenstrual syndrome.
[0150] The recitation of "Musculoskeletal" in the "Preferred
Indication" column indicates that the corresponding nucleic acid
and protein, or antibody against the same, of the invention (or
fragment or variant thereof), may be used for example, to diagnose,
treat, prevent, and/or ameliorate diseases and/or disorders
relating to neoplastic diseases (e.g., as described below under
"Hyperproliferative Disorders"), and disorders of the immune system
(e.g., as described below under "Immune Activity").
[0151] In specific embodiments, a protein, nucleic acid, or
antibody of the invention (or fragment or variant thereof) having a
"Musculoskeletal" recitation in the "Preferred Indication" column
of Table 1D, may be used for example, to diagnose, treat, prevent,
and/or ameliorate a disease or disorder selected from the group
consisting of: bone cancers (e.g., osteochondromas, benign
chondromas, chondroblastoma, chondromyxoid fibromas, osteoid
osteomas, giant cell tumors, multiple myeloma, osteosarcomas),
Paget's Disease, rheumatoid arthritis, systemic lupus
erythematosus, osteomyelitis, Lyme Disease, gout, bursitis,
tendonitis, osteoporosis, osteoarthritis, muscular dystrophy,
mitochondrial myopathy, cachexia, and multiple sclerosis.
[0152] The recitation of "Cardiovascular" in the "Preferred
Indication" column indicates that the corresponding nucleic acid
and protein, or antibody against the same, of the invention (or
fragment or variant thereof), may be used for example, to diagnose,
treat, prevent, and/or ameliorate diseases and/or disorders
relating to neoplastic diseases (e.g., as described below under
"Hyperproliferative Disorders"), and disorders of the
cardiovascular system (e.g., as described below under
"Cardiovascular Disorders").
[0153] In specific embodiments, a protein, nucleic acid, or
antibody of the invention (or fragment or variant thereof) having a
"Cardiovascular" recitation in the "Preferred Indication" column of
Table 1D, may be used for example, to diagnose, treat, prevent,
and/or ameliorate a disease or disorder selected from the group
consisting of: myxomas, fibromas, rhabdomyomas, cardiovascular
abnormalities (e.g., congenital heart defects, cerebral
arteriovenous malformations, septal defects), heart disease (e.g.,
heart failure, congestive heart disease, arrhythmia, tachycardia,
fibrillation, pericardial Disease, endocarditis), cardiac arrest,
heart valve disease (e.g., stenosis, regurgitation, prolapse),
vascular disease (e.g., hypertension, coronary artery disease,
angina, aneurysm, arteriosclerosis, peripheral vascular disease),
hyponatremia, hypernatremia, hypokalemia, and hyperkalemia.
[0154] The recitation of "Mixed Fetal" in the "Preferred
Indication" column indicates that the corresponding nucleic acid
and protein, or antibody against the same, of the invention (or
fragment or variant thereof), may be used for example, to diagnose,
treat, prevent, and/or ameliorate diseases and/or disorders
relating to neoplastic diseases (e.g., as described below under
"Hyperproliferative Disorders").
[0155] In specific embodiments, a protein, nucleic acid, or
antibody of the invention (or fragment or variant thereof) having a
"Mixed Fetal" recitation in the "Preferred Indication" column of
Table 1D, may be used for example, to diagnose, treat, prevent,
and/or ameliorate a disease or disorder selected from the group
consisting of: spina bifida, hydranencephaly, neurofibromatosis,
fetal alcohol syndrome, diabetes mellitus, PKU, Down's syndrome,
Patau syndrome, Edwards syndrome, Turner syndrome, Apert syndrome,
Carpenter syndrome, Conradi syndrome, Crouzon syndrome, cutis laxa,
Cornelia de Lange syndrome, Ellis-van Creveld syndrome, Holt-Oram
syndrome, Kartagener syndrome, Meckel-Gruber syndrome, Noonan
syndrome, Pallister-Hall syndrome, Rubinstein-Taybi syndrome,
Scimitar syndrome, Smith-Lemli-Opitz syndrome,
thromocytopenia-absent radius (TAR) syndrome, Treacher Collins
syndrome, Williams syndrome, Hirschsprung's disease, Meckel's
diverticulum, polycystic kidney disease, Turner's syndrome, and
gonadal dysgenesis, Klippel-Feil syndrome, Ostogenesis imperfecta,
muscular dystrophy, Tay-Sachs disease, Wilm's tumor, neuroblastoma,
and retinoblastoma.
[0156] The recitation of "Excretory" in the "Preferred Indication"
column indicates that the corresponding nucleic acid and protein,
or antibody against the same, of the invention (or fragment or
variant thereof), may be used for example, to diagnose, treat,
prevent, and/or ameliorate diseases and/or disorders relating to
neoplastic diseases (e.g., as described below under
"Hyperproliferative Disorders") and renal disorders (e.g., as
described below under "Renal Disorders").
[0157] In specific embodiments, a protein, nucleic acid, or
antibody of the invention (or fragment or variant thereof) having a
"Excretory" recitation in the "Preferred Indication" column of
Table 1D, may be used for example, to diagnose, treat, prevent,
and/or ameliorate a disease or disorder selected from the group
consisting of: bladder cancer, prostate cancer, benign prostatic
hyperplasia, bladder disorders (e.g., urinary incontinence, urinary
retention, urinary obstruction, urinary tract Infections,
interstitial cystitis, prostatitis, neurogenic bladder, hematuria),
renal disorders (e.g., hydronephrosis, proteinuria, renal failure,
pyelonephritis, urolithiasis, reflux nephropathy, and unilateral
obstructive uropathy).
[0158] The recitation of "Neural/Sensory" in the "Preferred
Indication" column indicates that the corresponding nucleic acid
and protein, or antibody against the same, of the invention (or
fragment or variant thereof), may be used for example, to diagnose,
treat, prevent, and/or ameliorate diseases and/or disorders
relating to neoplastic diseases (e.g., as described below under
"Hyperproliferative Disorders") and diseases or disorders of the
nervous system (e.g., as described below under "Neural Activity and
Neurological Diseases").
[0159] In specific embodiments, a protein, nucleic acid, or
antibody of the invention (or fragment or variant thereof) having a
"Neural/Sensory" recitation in the "Preferred Indication" column of
Table 1D, may be used for example, to diagnose, treat, prevent,
and/or ameliorate a disease or disorder selected from the group
consisting of: brain cancer (e.g., brain stem glioma, brain tumors,
central nervous system (Primary) lymphoma, central nervous system
lymphoma, cerebellar astrocytoma, and cerebral astrocytoma,
neurodegenerative disorders (e.g., Alzheimer's Disease,
Creutzfeldt-Jakob Disease, Parkinson's Disease, and Idiopathic
Presenile Dementia), encephalomyelitis, cerebral malaria,
meningitis, metabolic brain diseases (e.g., phenylketonuria and
pyruvate carboxylase deficiency), cerebellar ataxia, ataxia
telangiectasia, and AIDS Dementia Complex, schizophrenia, attention
deficit disorder, hyperactive attention deficit disorder, autism,
and obsessive compulsive disorders.
[0160] The recitation of "Respiratory" in the "Preferred
Indication" column indicates that the corresponding nucleic acid
and protein, or antibody against the same, of the invention (or
fragment or variant thereof), may be used for example, to diagnose,
treat, prevent, and/or ameliorate diseases and/or disorders
relating to neoplastic diseases (e.g., as described below under
"Hyperproliferative Disorders") and diseases or disorders of the
respiratory system (e.g., as described below under "Respiratory
Disorders").
[0161] In specific embodiments, a protein, nucleic acid, or
antibody of the invention (or fragment or variant thereof) having a
"Respiratory" recitation in the "Preferred Indication" column of
Table 1D, may be used for example, to diagnose, treat, prevent,
and/or ameliorate a disease or disorder selected from the group
consisting of: cancers of the respiratory system such as larynx
cancer, pharynx cancer, trachea cancer, epiglottis cancer, lung
cancer, squamous cell carcinomas, small cell (oat cell) carcinomas,
large cell carcinomas, and adenocarcinomas. Allergic reactions,
cystic fibrosis, sarcoidosis, histiocytosis X, infiltrative lung
diseases (e.g., pulmonary fibrosis and lymphoid interstitial
pneumonia), obstructive airway diseases (e.g., asthma, emphysema,
chronic or acute bronchitis), occupational lung diseases (e.g.,
silicosis and asbestosis), pneumonia, and pleurisy.
[0162] The recitation of "Endocrine" in the "Preferred Indication"
column indicates that the corresponding nucleic acid and protein,
or antibody against the same, of the invention (or fragment or
variant thereof), may be used for example, to diagnose, treat,
prevent, and/or ameliorate diseases and/or disorders relating to
neoplastic diseases (e.g., as described below under
"Hyperproliferative Disorders") and diseases or disorders of the
respiratory system (e.g., as described below under "Respiratory
Disorders"), renal disorders (e.g., as described below under "Renal
Disorders"), and disorders of the endocrine system (e.g., as
described below under "Endocrine Disorders".
[0163] In specific embodiments, a protein, nucleic acid, or
antibody of the invention (or fragment or variant thereof) having
an "Endocrine" recitation in the "Preferred Indication" column of
Table 1D, may be used for example, to diagnose, treat, prevent,
and/or ameliorate a disease or disorder selected from the group
consisting of: cancers of endocrine tissues and organs (e.g.,
cancers of the hypothalamus, pituitary gland, thyroid gland,
parathyroid glands, pancreas, adrenal glands, ovaries, and testes),
diabetes (e.g., diabetes insipidus, type I and type II diabetes
mellitus), obesity, disorders related to pituitary glands (e.g.,
hyperpituitarism, hypopituitarism, and pituitary dwarfism),
hypothyroidism, hyperthyroidism, goiter, reproductive disorders
(e.g. male and female infertility), disorders related to adrenal
glands (e.g., Addison's Disease, corticosteroid deficiency, and
Cushing's Syndrome), kidney cancer (e.g., hypemephroma,
transitional cell cancer, and Wilm's tumor), diabetic nephropathy,
interstitial nephritis, polycystic kidney disease,
glomerulonephritis (e.g., IgM mesangial proliferative
glomerulonephritis and glomerulonephritis caused by autoimmune
disorders; such as Goodpasture's syndrome), and
nephrocalcinosis.
[0164] The recitation of "Digestive" in the "Preferred Indication"
column indicates that the corresponding nucleic acid and protein,
or antibody against the same, of the invention (or fragment or
variant thereof), may be used for example, to diagnose, treat,
prevent, and/or ameliorate diseases and/or disorders relating to
neoplastic diseases (e.g., as described below under
"Hyperproliferative Disorders") and diseases or disorders of the
gastrointestinal system (e.g., as described below under
"Gastrointestinal Disorders".
[0165] In specific embodiments, a protein, nucleic acid, or
antibody of the invention (or fragment or variant thereof) having a
"Digestive" recitation in the "Preferred Indication" column of
Table 1D, may be used for example, to diagnose, treat, prevent,
and/or ameliorate a disease or disorder selected from the group
consisting of: ulcerative colitis, appendicitis, Crohn's disease,
hepatitis, hepatic encephalopathy, portal hypertension,
cholelithiasis, cancer of the digestive system (e.g., biliary tract
cancer, stomach cancer, colon cancer, gastric cancer, pancreatic
cancer, cancer of the bile duct, tumors of the colon (e.g., polyps
or cancers), and cirrhosis), pancreatitis, ulcerative disease,
pyloric stenosis, gastroenteritis, gastritis, gastric atropy,
benign tumors of the duodenum, distension, irritable bowel
syndrome, malabsorption, congenital disorders of the small
intestine, bacterial and parasitic infection, megacolon,
Hirschsprung's disease, aganglionic megacolon, acquired megacolon,
colitis, anorectal disorders (e.g., anal fistulas, hemorrhoids),
congenital disorders of the liver (e.g., Wilson's disease,
hemochromatosis, cystic fibrosis, biliary atresia, and
alpha1-antitrypsin deficiency), portal hypertension,
cholelithiasis, and jaundice.
[0166] The recitation of "Connective/Epithelial" in the "Preferred
Indication" column indicates that the corresponding nucleic acid
and protein, or antibody against the same, of the invention (or
fragment or variant thereof), may be used for example, to diagnose,
treat, prevent, and/or ameliorate diseases and/or disorders
relating to neoplastic diseases (e.g., as described below under
"Hyperproliferative Disorders"), cellular and genetic abnormalities
(e.g., as described below under "Diseases at the Cellular Level"),
angiogenesis (e.g., as described below under "Anti-Angiogenesis
Activity"), and or to promote or inhibit regeneration (e.g., as
described below under "Regeneration"), and wound healing (e.g., as
described below under "Wound Healing and Epithelial Cell
Proliferation").
[0167] In specific embodiments, a protein, nucleic acid, or
antibody of the invention (or fragment or variant thereof) having a
"Connective/Epithelial" recitation in the "Preferred Indication"
column of Table 1D, may be used for example, to diagnose, treat,
prevent, and/or ameliorate a disease or disorder selected from the
group consisting of: connective tissue metaplasia, mixed connective
tissue disease, focal epithelial hyperplasia, epithelial
metaplasia, mucoepithelial dysplasia, graft v. host disease,
polymyositis, cystic hyperplasia, cerebral dysplasia, tissue
hypertrophy, Alzheimer's disease, lymphoproliferative disorder,
Waldenstron's macroglobulinemia, Crohn's disease, pernicious
anemia, idiopathic Addison's disease, glomerulonephritis, bullous
pemphigoid, Sjogren's syndrome, diabetes mellitus, cystic fibrosis,
osteoblastoma, osteoclastoma, osteosarcoma, chondrosarcoma,
osteoporosis, osteocarthritis, periodontal disease, wound healing,
relapsing polychondritis, vasculitis, polyarteritis nodosa,
Wegener's granulomatosis, cellulitis, rheumatoid arthritis,
psoriatic arthritis, discoid lupus erythematosus, systemic lupus
erythematosus, scleroderma, CREST syndrome, Sjogren's syndrome,
polymyositis, dermatomyositis, mixed connective tissue disease,
relapsing polychondritis, vasculitis, Henoch-Schonlein syndrome,
erythema nodosum, polyarteritis nodosa, temporal (giant cell)
arteritis, Takayasu's arteritis, Wegener's granulomatosis, Reiter's
syndrome, Behcet's syndrome, ankylosing spondylitis, cellulitis,
keloids, Ehler Danlos syndrome, Marfan syndrome, pseudoxantoma
elasticum, osteogenese imperfecta, chondysplasias, epidermolysis
bullosa, Alport syndrome, and cutis laxa. TABLE-US-00005 TABLE 1D
Gene No. cDNA Clone ID Preferred Indication Identifiers 1 H6BSF56
Cancer 2 H6EDM64 Cancer 3 H6EEC72 Cancer 4 HACAB68
Connective/Epithelial, Immune/Hematopoietic 5 HACBJ56 Cancer 6
HACBS22 Cancer 7 HADDE71 Cancer 8 HADDJ13 Connective/Epithelial 9
HADMB15 Cancer 10 HAGBQ12 Excretory, Neural/Sensory 11 HAGDW20
Neural/Sensory, Reproductive 12 HAGEG10 Cancer 13 HAGEQ79
Digestive, Neural/Sensory 14 HAGFS57 Cancer 15 HAGHN57 Cancer 16
HAHEA15 Cardiovascular 17 HAJAA47 Immune/Hematopoietic 18 HAJAY92
Cancer 19 HAJBV67 Cancer 20 HAJCH70 Cancer 21 HAOAG15 Cancer 22
HAQAI92 Digestive, Mixed Fetal, Reproductive 23 HAQCE11
Reproductive 24 HATBI94 Cancer 25 HATCB45 Cancer 26 HATCD80
Endocrine, Reproductive 27 HATCI03 Endocrine, Immune/Hematopoietic,
Neural/Sensory 28 HATEH20 Cancer 29 HBAGD86 Cancer 30 HBCJL35
Cancer 31 HBDAB91 Immune/Hematopoietic 32 HBDAB91
Immune/Hematopoietic 33 HBGBC29 Cancer 34 HBGNC72 Cancer 35 HBHAA05
Neural/Sensory 36 HBHAA81 Cancer 37 HBIAA59 Cancer 38 HBIAC29
Cancer 39 HBICW51 Digestive, Immune/Hematopoietic, Neural/Sensory
40 HBJAB02 Cancer 41 HBJAC65 Cancer 42 HBJBM12 Immune/Hematopoietic
43 HBJCR46 Cancer 44 HBJDS79 Cancer 45 HBJDW56 Immune/Hematopoietic
46 HBJEL16 Cancer 47 HBJFK45 Immune/Hematopoietic 48 HBJIG20 Cancer
49 HBJKD16 Cancer 50 HBMBM96 Digestive, Immune/Hematopoietic,
Neural/Sensory 51 HBMBX01 Cancer 52 HBMTM11 Cancer 53 HBMTX26
Immune/Hematopoietic 54 HBMTY48 Immune/Hematopoietic, Reproductive
55 HBMUH74 Cardiovascular, Immune/Hematopoietic, Reproductive 56
HBMWE61 Immune/Hematopoietic 57 HBNAX40 Cancer 58 HBNBJ76 Cancer 59
HBQAB79 Neural/Sensory 60 HBQAC57 Neural/Sensory 61 HBSAK32 Mixed
Fetal, Musculoskeletal, Neural/Sensory 62 HBXCM66 Cardiovascular,
Neural/Sensory, Reproductive 63 HBXCX15 Immune/Hematopoietic,
Neural/Sensory 64 HCDCY76 Cancer 65 HCDDL48 Musculoskeletal 66
HCE1G78 Cancer 67 HCE2H52 Cancer 68 HCE3B04 Digestive,
Neural/Sensory 69 HCE5F78 Immune/Hematopoietic, Neural/Sensory 70
HCEDR26 Digestive, Immune/Hematopoietic, Neural/Sensory 71 HCEEE79
Neural/Sensory 72 HCEEQ25 Mixed Fetal, Neural/Sensory 73 HCEEU18
Neural/Sensory 74 HCEFZ82 Cancer 75 HCEGX05 Cancer 76 HCFLN88
Cancer 77 HCFLT90 Cancer 78 HCHAB84 Cancer 79 HCMSX51 Cancer 80
HCNCO11 Digestive 81 HCNSD29 Cardiovascular, Digestive,
Immune/Hematopoietic 82 HCQBH72 Digestive, Excretory,
Immune/Hematopoietic 83 HCQCC96 Cancer 84 HCQCJ56 Cardiovascular,
Digestive, Reproductive 85 HCQCM24 Cancer 86 HCRAY10 Cancer 87
HCRBF72 Cancer 88 HCRNF78 Cancer 89 HCUAF85 Immune/Hematopoietic 90
HCUCF89 Immune/Hematopoietic 91 HCUCK44 Cancer 92 HCUDD64 Cancer 93
HCWAE64 Immune/Hematopoietic 94 HCWFU39 Immune/Hematopoietic,
Neural/Sensory 95 HCWUL09 Immune/Hematopoietic, Neural/Sensory 96
HDHAA42 Cancer 97 HDHEB76 Mixed Fetal, Neural/Sensory 98 HDPCW16
Cancer 99 HDPDI72 Immune/Hematopoietic 100 HDPDJ58 Cancer 101
HDPFF10 Cancer 102 HDPFU43 Cancer 103 HDPFY18 Cancer 104 HDPGE24
Cancer 105 HDPIU94 Cancer 106 HDPOC24 Cancer 107 HDPOL37
Immune/Hematopoietic, Reproductive 108 HDPOO76 Cancer 109 HDPPD93
Cancer 110 HDPPQ30 Connective/Epithelial, Immune/Hematopoietic,
Musculoskeletal 111 HDPPW82 Immune/Hematopoietic 112 HDPXN20
Immune/Hematopoietic 113 HDQHM36 Immune/Hematopoietic 114 HDTAU35
Immune/Hematopoietic 115 HDTAV54 Cancer 116 HDTFX18
Immune/Hematopoietic, Reproductive 117 HDTGW48
Immune/Hematopoietic, Reproductive 118 HDTLM18 Immune/Hematopoietic
119 HE2CA60 Cancer 120 HE2CA60 Cancer 121 HE2CH58 Digestive, Mixed
Fetal 122 HE2CM39 Cancer 123 HE2HC60 Cancer 124 HE2PO93 Cancer 125
HE6AU52 Mixed Fetal 126 HE6CS65 Cancer 127 HE6DO92
Immune/Hematopoietic, Mixed Fetal 128 HE6EY13 Cancer 129 HE6FU11
Mixed Fetal, Neural/Sensory, Respiratory 130 HE6FV29 Cancer 131
HE8FC45 Cancer 132 HE8FC45 Cancer 133 HE8FD92 Cancer 134 HE8FD92
Cancer 135 HE8FD92 Cancer 136 HE8FD92 Cancer 137 HE8FD92 Cancer 138
HE8SG96 Mixed Fetal, Neural/Sensory 139 HE8TY46 Cancer 140 HE9CY05
Mixed Fetal 141 HE9EA10 Cancer 142 HE9GG20 Cancer 143 HEBCI18
Cancer 144 HEBCY54 Cancer 145 HEBDF77 Neural/Sensory 146 HEBDQ91
Neural/Sensory 147 HEBFR46 Cancer 148 HEBGE07 Neural/Sensory 149
HEGAU15 Excretory, Immune/Hematopoietic, Reproductive 150 HELAT35
Cardiovascular, Mixed Fetal 151 HELBU54 Cardiovascular, Digestive
152 HELGG84 Cancer 153 HELGG84 Cancer 154 HEMEY47 Cancer 155
HEOMC46 Immune/Hematopoietic 156 HEPBA14 Reproductive 157 HEQAH80
Cancer 158 HEQBF89 Reproductive 159 HETCI16 Cancer 160 HETDW58
Cancer 161 HETEY67 Connective/Epithelial, Immune/Hematopoietic,
Reproductive 162 HFCDW95 Cancer 163 HFCEI04 Neural/Sensory 164
HFCFD04 Neural/Sensory 165 HFCFE20 Cancer 166 HFEAY59
Connective/Epithelial 167 HFGAJ16 Cancer 168 HFIHZ75 Cancer
169 HFIJA29 Cancer 170 HFIJA68 Musculoskeletal 171 HFKES05 Cancer
172 HFKEU12 Excretory 173 HFPCZ55 Cancer 174 HFPDR62
Immune/Hematopoietic, Neural/Sensory 175 HFPDS07 Cancer 176 HFRAB10
Excretory, Immune/Hematopoietic, Neural/Sensory 177 HFTBM38 Cancer
178 HFTDH56 Cancer 179 HFVGK35 Cancer 180 HFVHW43 Digestive 181
HFXAV37 Immune/Hematopoietic, Neural/Sensory 182 HFXBN86
Neural/Sensory 183 HFXBT66 Neural/Sensory 184 HFXFZ46
Neural/Sensory 185 HGBER72 Cancer 186 HGBEY14 Cancer 187 HGBGN34
Cancer 188 HGBHP91 Digestive 189 HGCAC19 Cancer 190 HGCAC19 Cancer
191 HGCAC19 Cancer 192 HHEAK45 Cancer 193 HHEGS55
Immune/Hematopoietic 194 HHEOW19 Cancer 195 HHFFF87 Cancer 196
HHFFL34 Cancer 197 HHFFS40 Cancer 198 HHGCS78 Immune/Hematopoietic
199 HHGDT26 Immune/Hematopoietic, Reproductive 200 HHPFU28 Cancer
201 HHPSA85 Cancer 202 HHSBI06 Cancer 203 HHSBI65 Cancer 204
HHSDI53 Cancer 205 HHSFC09 Cancer 206 HHSGL28 Cancer 207 HILCA24
Digestive, Immune/Hematopoietic, Reproductive 208 HILCA24
Digestive, Immune/Hematopoietic, Reproductive 209 HISAT67 Cancer
210 HJBCU75 Cancer 211 HJMAA03 Cancer 212 HJMAV41 Cancer 213
HJMAY90 Cancer 214 HJPBE39 Cancer 215 HJPBK28 Cancer 216 HJPCH08
Cancer 217 HKABU43 Cancer 218 HKACI79 Cancer 219 HKAFF50 Cancer 220
HKGBF25 Cancer 221 HKIXC44 Cancer 222 HKMLK03 Digestive, Excretory,
Immune/Hematopoietic 223 HKMLM95 Cancer 224 HKTAB41 Digestive,
Excretory 225 HLDBG17 Cancer 226 HLDCA54 Cancer 227 HLDQU79 Cancer
228 HLDRT09 Cancer 229 HLHAP05 Immune/Hematopoietic,
Neural/Sensory, Respiratory 230 HLHCS23 Respiratory 231 HLIBO72
Cancer 232 HLICE88 Cancer 233 HLICO10 Cancer 234 HLJBS28 Cancer 235
HLMBW89 Cancer 236 HLMGP50 Digestive, Immune/Hematopoietic 237
HLMJB64 Cancer 238 HLMMX62 Cancer 239 HLQAS12 Cancer 240 HLQCL64
Digestive, Immune/Hematopoietic, Reproductive 241 HLQCX36 Digestive
242 HLWAF06 Immune/Hematopoietic, Reproductive 243 HLWAU42 Cancer
244 HLWAU42 Cancer 245 HLWAV47 Cancer 246 HLWBB73 Cancer 247
HLWCN37 Cancer 248 HLWDB73 Cancer 249 HLYDF73 Immune/Hematopoietic
250 HLYEU59 Immune/Hematopoietic 251 HLYGB19 Cancer 252 HLYGE16
Cancer 253 HLYGY91 Cancer 254 HMCAZ04 Cancer 255 HMCAZ04 Cancer 256
HMCAZ04 Cancer 257 HMCAZ04 Cancer 258 HMCAZ04 Cancer 259 HMCFH60
Cancer 260 HMDAB29 Digestive, Neural/Sensory 261 HMDAD44
Connective/Epithelial, Immune/Hematopoietic, Neural/Sensory 262
HMEBB82 Cancer 263 HMEDE24 Cardiovascular 264 HMEDI90
Cardiovascular, Musculoskeletal, Neural/Sensory 265 HMELM75 Cancer
266 HMIAK10 Neural/Sensory 267 HMIBF07 Neural/Sensory 268 HMICI80
Cardiovascular, Endocrine, Neural/Sensory 269 HMICP65 Cancer 270
HMJAK70 Neural/Sensory 271 HMSBE04 Immune/Hematopoietic 272 HMSCL38
Immune/Hematopoietic, Neural/Sensory 273 HMSCR69 Cancer 274 HMSHC86
Immune/Hematopoietic 275 HMSHU20 Immune/Hematopoietic, Reproductive
276 HMSHY25 Immune/Hematopoietic 277 HMTAB77 Cancer 278 HMUAE26
Cancer 279 HMUAN45 Cancer 280 HMVBC31 Cancer 281 HMVDU15 Cancer 282
HMWBL03 Cancer 283 HMWJF53 Cancer 284 HNEAK81 Immune/Hematopoietic
285 HNECL22 Cancer 286 HNECW49 Immune/Hematopoietic 287 HNEDH88
Immune/Hematopoietic 288 HNFAC50 Cancer 289 HNFGR08
Immune/Hematopoietic 290 HNFHF34 Cancer 291 HNGAK51
Immune/Hematopoietic 292 HNGAM58 Immune/Hematopoietic 293 HNGBH53
Immune/Hematopoietic 294 HNGDQ38 Immune/Hematopoietic 295 HNGDX18
Cancer 296 HNGDY34 Immune/Hematopoietic 297 HNGEA34 Digestive,
Immune/Hematopoietic 298 HNGEQ75 Immune/Hematopoietic,
Neural/Sensory 299 HNGGA68 Immune/Hematopoietic, Musculoskeletal
300 HNGGP65 Immune/Hematopoietic 301 HNGHZ69 Immune/Hematopoietic
302 HNGIV64 Immune/Hematopoietic 303 HNGJB41 Immune/Hematopoietic
304 HNGKT41 Immune/Hematopoietic 305 HNGMW45 Immune/Hematopoietic
306 HNGNK44 Immune/Hematopoietic 307 HNGNO53 Immune/Hematopoietic
308 HNGPJ25 Immune/Hematopoietic, Mixed Fetal, Musculoskeletal 309
HNHEN82 Cancer 310 HNHFE71 Immune/Hematopoietic 311 HNHGK22
Immune/Hematopoietic 312 HNHHB10 Immune/Hematopoietic, Reproductive
313 HNHKS19 Immune/Hematopoietic, Reproductive 314 HNTBT17 Cancer
315 HNTMH79 Cancer 316 HOABP31 Cancer 317 HOABP31 Cancer 318
HOACG07 Cancer 319 HODAG07 Reproductive 320 HODBB70 Reproductive
321 HODBV05 Cancer 322 HODCZ32 Reproductive 323 HOEBK60 Cancer 324
HOFAA78 Cancer 325 HOFNB74 Reproductive 326 HOFNU55 Reproductive
327 HOGBF01 Reproductive 328 HORBS82 Cancer 329 HORBV76
Immune/Hematopoietic, Reproductive 330 HOSDO75 Cancer 331 HOSEC25
Musculoskeletal 332 HOSEI81 Digestive, Musculoskeletal 333 HOSEJ94
Cancer 334 HOUCA21 Connective/Epithelial, Immune/Hematopoietic,
Musculoskeletal 335 HOUDE92 Cancer 336 HOUDR07 Cancer 337 HOUED72
Connective/Epithelial 338 HOUFS04 Cancer 339 HOUHI25 Cancer 340
HOVBD85 Musculoskeletal, Reproductive 341 HPCAB41
Immune/Hematopoietic, Reproductive 342 HPCAL26 Cancer 343 HPEAD23
Cancer 344 HPFBA54 Reproductive 345 HPFCI36 Cancer 346 HPFDI37
Cancer 347 HPIAA80 Cancer 348 HPJBJ51 Immune/Hematopoietic,
Reproductive 349 HPJBJ51 Immune/Hematopoietic, Reproductive 350
HPJBU43 Reproductive 351 HPJCW58 Reproductive 352 HPMBX22 Cancer
353 HPMCJ84 Reproductive 354 HPMCV30 Cancer 355 HPMFH77 Cancer 356
HPQAX38 Cardiovascular 357 HPQAX38 Cardiovascular 358 HPQCB83
Cancer 359 HPQCC53 Cancer 360 HPRBH85 Cancer 361 HPRCA64 Cancer 362
HPRCD35 Cancer 363 HPTRM02 Cancer 364 HPWBA29 Reproductive 365
HPWDK06 Cancer 366 HRAAD30 Cancer 367 HRADA42 Cancer 368 HRADF49
Cancer 369 HRADN25 Cancer 370 HRADT25 Digestive, Excretory 371
HRDAI17 Cancer 372 HRDDQ39 Cancer 373 HRDER22 Cancer 374 HRDEX93
Cancer 375 HRDFK37 Cancer 376 HRGBD54 Cancer
377 HROEA08 Cancer 378 HSAVA08 Immune/Hematopoietic 379 HSAVW42
Cancer 380 HSAWN53 Immune/Hematopoietic 381 HSAWZ40
Immune/Hematopoietic 382 HSAYC41 Excretory, Immune/Hematopoietic,
Reproductive 383 HSDZM54 Neural/Sensory 384 HSHBF76 Cancer 385
HSIFG47 Digestive 386 HSJBY32 Immune/Hematopoietic,
Musculoskeletal, Neural/Sensory 387 HSKDR27 Cancer 388 HSLHG78
Cancer 389 HSLHX15 Musculoskeletal 390 HSNAP85 Cancer 391 HSNAZ09
Cancer 392 HSNBM34 Cancer 393 HSOAH16 Digestive 394 HSQBF66 Cancer
395 HSQDO85 Cancer 396 HSQES57 Cancer 397 HSRBE06 Cancer 398
HSSDI26 Musculoskeletal 399 HSSEA64 Cancer 400 HSSEF77 Cancer 401
HSSFE38 Cancer 402 HSSGJ58 Musculoskeletal 403 HSWBE76 Cancer 404
HSXCP38 Cardiovascular, Neural/Sensory 405 HSYBI06 Cancer 406
HT1SC27 Digestive, Immune/Hematopoietic, Reproductive 407 HT3BF49
Immune/Hematopoietic 408 HT4FV41 Cancer 409 HT5FX79 Cancer 410
HT5GR59 Cancer 411 HTAEI78 Immune/Hematopoietic 412 HTDAA78
Immune/Hematopoietic 413 HTEAG62 Digestive, Immune/Hematopoietic,
Reproductive 414 HTECB02 Cancer 415 HTECC15 Cancer 416 HTEDF18
Reproductive 417 HTEDJ28 Cancer 418 HTEDS12 Cardiovascular,
Immune/Hematopoietic, Reproductive 419 HTEED26 Reproductive 420
HTEED26 Reproductive 421 HTEEF26 Cancer 422 HTEEF26 Cancer 423
HTEEW69 Reproductive 424 HTEGS07 Reproductive 425 HTEGS11 Cancer
426 HTEHA56 Cancer 427 HTEHU59 Cancer 428 HTEJD29 Reproductive 429
HTEKM46 Cancer 430 HTEMQ17 Cancer 431 HTENR63 Cancer 432 HTGGM44
Cancer 433 HTHBZ06 Cancer 434 HTLAP64 Cancer 435 HTLBT80 Cancer 436
HTLDA84 Reproductive 437 HTLDN29 Cancer 438 HTLDU78 Reproductive
439 HTLEC82 Cancer 440 HTLEM16 Cancer 441 HTLEV48 Reproductive 442
HTLFA13 Musculoskeletal, Reproductive 443 HTLFI73 Digestive,
Immune/Hematopoietic, Reproductive 444 HTLGI89 Cancer 445 HTLIF11
Cancer 446 HTLIF12 Excretory, Reproductive 447 HTLIF12 Excretory,
Reproductive 448 HTLIF12 Excretory, Reproductive 449 HTLIF12
Excretory, Reproductive 450 HTLIF12 Excretory, Reproductive 451
HTLIF12 Excretory, Reproductive 452 HTNAM63 Endocrine 453 HTNBK13
Cancer 454 HTOAI50 Digestive, Immune/Hematopoietic 455 HTOAM11
Immune/Hematopoietic, Neural/Sensory 456 HTODH57
Immune/Hematopoietic 457 HTODH83 Immune/Hematopoietic 458 HTOEV16
Cancer 459 HTOGR38 Immune/Hematopoietic 460 HTOHO21
Immune/Hematopoietic 461 HTOHQ05 Immune/Hematopoietic 462 HTOJL95
Cancer 463 HTOJL95 Cancer 464 HTPDU17 Cancer 465 HTSFJ32
Immune/Hematopoietic 466 HTTCB60 Cancer 467 HTTEE41 Cancer 468
HTTEZ02 Cancer 469 HTWEH94 Immune/Hematopoietic 470 HTXBD09 Cancer
471 HTXDB22 Cancer 472 HTXDC38 Cancer 473 HTXDC77 Cancer 474
HTXDD61 Cancer 475 HTXDG92 Cancer 476 HTXET11 Digestive,
Immune/Hematopoietic 477 HTXFA72 Immune/Hematopoietic 478 HTXJY08
Cancer 479 HTXKF95 Cancer 480 HTXMZ07 Cancer 481 HUFCL31 Digestive,
Immune/Hematopoietic 482 HUKBT67 Cancer 483 HUKDF20 Cardiovascular,
Neural/Sensory, Reproductive 484 HUKDY82 Cancer 485 HUSCJ14 Cancer
486 HUSGL67 Cancer 487 HUSGU40 Cancer 488 HUSIR18 Cancer 489
HUVDJ48 Digestive, Reproductive 490 HWAAI12 Cancer 491 HWBBQ70
Immune/Hematopoietic, Neural/Sensory 492 HWBCN36
Immune/Hematopoietic 493 HWBDJ08 Cancer 494 HWBFX16
Immune/Hematopoietic 495 HWDAC26 Connective/Epithelial,
Immune/Hematopoietic, Neural/Sensory 496 HWDAG96 Cancer 497 HWDAJ01
Connective/Epithelial 498 HWHPB78 Cancer 499 HYABC84 Cancer 500
HYABC84 Cancer 501 H2CBD20 Digestive 502 H2CBH91 Cancer 503 H2LBA54
Cancer 504 H2LBB09 Cancer 505 H2LBB09 Cancer 506 H2MAC63 Digestive,
Reproductive 507 H2MBA76 Cancer 508 H2MBF60 Cancer 509 H6BSM88
Cancer 510 H6EEA48 Cancer 511 H6EEN71 Cancer 512 H6EEO05 Cancer 513
H6EEU40 Cancer 514 H7TDB54 Cancer 515 H7TMB95 Cancer 516 HAAAT06
Cancer 517 HACAD42 Connective/Epithelial, Mixed Fetal,
Neural/Sensory 518 HACBJ11 Cancer 519 HACBS86 Cancer 520 HACBT91
Cancer 521 HACBZ73 Cancer 522 HACCK29 Connective/Epithelial 523
HADAB60 Cancer 524 HADAM31 Connective/Epithelial 525 HADCL19
Connective/Epithelial 526 HADCZ65 Connective/Epithelial,
Immune/Hematopoietic 527 HADDC04 Connective/Epithelial,
Reproductive 528 HADDP23 Cancer 529 HADDP51 Cancer 530 HADDR24
Cancer 531 HADET62 Connective/Epithelial 532 HADEY08 Cancer 533
HADEY22 Connective/Epithelial 534 HADEY22 Connective/Epithelial 535
HADFB84 Cancer 536 HADFD01 Cancer 537 HADFD10 Cancer 538 HADFK11
Connective/Epithelial 539 HADFT44 Connective/Epithelial, Mixed
Fetal, Neural/Sensory 540 HADFW20 Connective/Epithelial 541 HADFX10
Connective/Epithelial, Neural/Sensory 542 HADFY80
Connective/Epithelial, Digestive 543 HADGD93 Cardiovascular,
Connective/Epithelial 544 HADMA77 Cancer 545 HADXA10 Cancer 546
HADXA10 Cancer 547 HAFBB15 Cancer 548 HAFBL14 Cancer 549 HAGAB62
Cancer 550 HAGAB83 Neural/Sensory 551 HAGAE84 Neural/Sensory 552
HAGAF75 Digestive, Neural/Sensory 553 HAGAK40 Cancer 554 HAGAU43
Neural/Sensory 555 HAGAZ36 Neural/Sensory 556 HAGBC57 Cancer 557
HAGBL31 Neural/Sensory 558 HAGBO09 Mixed Fetal, Neural/Sensory 559
HAGBO12 Neural/Sensory 560 HAGBO51 Neural/Sensory 561 HAGBS89
Immune/Hematopoietic, Musculoskeletal, Neural/Sensory 562 HAGBV06
Cancer 563 HAGBV25 Cancer 564 HAGBV29 Immune/Hematopoietic,
Neural/Sensory 565 HAGCC87 Digestive, Immune/Hematopoietic,
Neural/Sensory 566 HAGCH67 Neural/Sensory 567 HAGCI69
Neural/Sensory, Reproductive 568 HAGCT33 Immune/Hematopoietic,
Mixed Fetal, Neural/Sensory 569 HAGCZ70 Neural/Sensory 570 HAGDC73
Cancer 571 HAGDG84 Immune/Hematopoietic, Neural/Sensory 572 HAGDH85
Neural/Sensory 573 HAGDI69 Neural/Sensory 574 HAGDJ53
Immune/Hematopoietic, Neural/Sensory 575 HAGDJ56
Cardiovascular,
Endocrine, Neural/Sensory 576 HAGDL51 Immune/Hematopoietic,
Musculoskeletal, Neural/Sensory 577 HAGDO70 Cancer 578 HAGDT30
Cancer 579 HAGDW68 Endocrine, Neural/Sensory 580 HAGDX84 Cancer 581
HAGEK37 Cancer 582 HAGEK86 Cancer 583 HAGEP30 Neural/Sensory 584
HAGEQ58 Neural/Sensory 585 HAGEQ67 Cancer 586 HAGEU26
Neural/Sensory 587 HAGEW83 Neural/Sensory 588 HAGEX49 Cancer 589
HAGEX49 Cancer 590 HAGFD75 Cancer 591 HAGFF43 Cancer 592 HAGFJ67
Digestive, Immune/Hematopoietic, Neural/Sensory 593 HAGFM58
Cardiovascular, Neural/Sensory 594 HAGFT48 Cancer 595 HAGFU31
Neural/Sensory 596 HAGFW13 Neural/Sensory 597 HAGHE85
Cardiovascular, Neural/Sensory 598 HAGHR18 Neural/Sensory 599
HAGIB90 Cancer 600 HAHEM51 Cardiovascular 601 HAHSA76
Cardiovascular 602 HAHSD51 Cancer 603 HAIBR76 Cancer 604 HAIBT20
Cancer 605 HAIBV91 Cancer 606 HAICE62 Cancer 607 HAICL90 Digestive,
Immune/Hematopoietic, Reproductive 608 HAICV44 Cancer 609 HAIDP45
Cancer 610 HAJAB88 Cancer 611 HAJAZ56 Cancer 612 HAMFC67 Cancer 613
HAMFQ38 Cancer 614 HAMGG01 Cancer 615 HANGB24 Cancer 616 HANKC93
Musculoskeletal 617 HAPAD35 Cancer 618 HAPBR13 Cancer 619 HAPBU09
Cancer 620 HAPBU86 Cancer 621 HAPBU86 Cancer 622 HAPNJ33 Cancer 623
HAPNL62 Cancer 624 HAPNO50 Cancer 625 HAPNY10 Cancer 626 HAPPW83
Cancer 627 HAPQJ73 Cancer 628 HAPQK26 Reproductive 629 HAPQU71
Cancer 630 HAPQU71 Cancer 631 HAPQW18 Cancer 632 HAPQX44 Cancer 633
HAPRK55 Cancer 634 HAPSH37 Cancer 635 HAQBG57 Cancer 636 HAQBY85
Cancer 637 HAQBZ15 Cancer 638 HAQCE18 Immune/Hematopoietic,
Reproductive 639 HAQCF94 Cancer 640 HARAE26 Neural/Sensory 641
HARAT69 Cancer 642 HARAZ81 Cancer 643 HASAU26 Cancer 644 HASAX57
Cancer 645 HASAY07 Cancer 646 HATAE01 Cancer 647 HATAG52 Endocrine,
Neural/Sensory, Reproductive 648 HATAL05 Cancer 649 HATBA90
Endocrine 650 HATBM71 Endocrine 651 HATCF80 Cancer 652 HATCI67
Cancer 653 HATCJ27 Cancer 654 HATCS79 Endocrine,
Immune/Hematopoietic 655 HATCX03 Cancer 656 HATDE03 Cancer 657
HATDF41 Cancer 658 HATDH23 Cancer 659 HATDH55 Cancer 660 HATDO84
Endocrine 661 HATDU01 Cancer 662 HATDW05 Endocrine 663 HATEF13
Digestive, Endocrine 664 HATEF64 Cancer 665 HATEH40 Cancer 666
HATEI22 Cancer 667 HAUCC84 Cancer 668 HAWAS41
Connective/Epithelial, Excretory, Immune/Hematopoietic 669 HAWBA65
Cancer 670 HBAGH64 Cancer 671 HBAGV01 Connective/Epithelial,
Excretory 672 HBAMC50 Excretory 673 HBAMC57 Excretory 674 HBBBA42
Cancer 675 HBBBB08 Neural/Sensory 676 HBBBE83 Cancer 677 HBBMA11
Neural/Sensory 678 HBCAK10 Digestive, Immune/Hematopoietic,
Reproductive 679 HBCAK80 Cancer 680 HBCAQ48 Cancer 681 HBCAY17
Cancer 682 HBCGE46 Musculoskeletal 683 HBGBA14 Cancer 684 HBGBE75
Cancer 685 HBGBP22 Cancer 686 HBGFQ34 Reproductive 687 HBGML95
Reproductive 688 HBGMT60 Cancer 689 HBHAA53 Neural/Sensory 690
HBIAU43 Cancer 691 HBIAW58 Neural/Sensory 692 HBIBB20 Cancer 693
HBIBF26 Cancer 694 HBIBM33 Neural/Sensory 695 HBIBN67 Cancer 696
HBIBQ69 Immune/Hematopoietic, Neural/Sensory 697 HBIBR38
Neural/Sensory 698 HBIBR61 Cancer 699 HBIBS33 Neural/Sensory 700
HBIBT13 Digestive, Immune/Hematopoietic, Neural/Sensory 701 HBIBZ20
Neural/Sensory 702 HBICB80 Cancer 703 HBJAC40 Cancer 704 HBJAV56
Immune/Hematopoietic, Musculoskeletal 705 HBJAY14
Immune/Hematopoietic 706 HBJBQ69 Immune/Hematopoietic 707 HBJBR40
Immune/Hematopoietic 708 HBJCH46 Immune/Hematopoietic,
Musculoskeletal 709 HBJCR17 Cancer 710 HBJCS26 Cancer 711 HBJCW24
Cancer 712 HBJDC57 Immune/Hematopoietic, Reproductive 713 HBJDR18
Immune/Hematopoietic 714 HBJDR83 Immune/Hematopoietic 715 HBJEE51
Immune/Hematopoietic 716 HBJEL21 Cancer 717 HBJFH84 Cancer 718
HBJFJ14 Cancer 719 HBJFJ26 Cancer 720 HBJFJ83 Immune/Hematopoietic,
Mixed Fetal 721 HBJFJ83 Immune/Hematopoietic, Mixed Fetal 722
HBJFP47 Immune/Hematopoietic, Reproductive 723 HBJFR77 Cancer 724
HBJFU30 Cancer 725 HBJFX41 Immune/Hematopoietic 726 HBJHO83
Immune/Hematopoietic, Reproductive 727 HBJHS92
Immune/Hematopoietic, Neural/Sensory 728 HBJHT01
Immune/Hematopoietic, Reproductive 729 HBJHT01
Immune/Hematopoietic, Reproductive 730 HBJHW06
Immune/Hematopoietic, Reproductive 731 HBJIR14 Cancer 732 HBJJA26
Immune/Hematopoietic 733 HBJJX02 Immune/Hematopoietic 734 HBJLH78
Immune/Hematopoietic 735 HBJND04 Cancer 736 HBJND57
Immune/Hematopoietic 737 HBKDF66 Cancer 738 HBKEA94 Cancer 739
HBKEE60 Digestive 740 HBKEI41 Endocrine, Mixed Fetal, Reproductive
741 HBMBD51 Digestive, Immune/Hematopoietic 742 HBMBD73 Cancer 743
HBMBE33 Immune/Hematopoietic 744 HBMBM17 Immune/Hematopoietic,
Reproductive 745 HBMCL59 Immune/Hematopoietic 746 HBMCM96
Immune/Hematopoietic, Neural/Sensory 747 HBMCQ74 Cancer 748 HBMCQ74
Cancer 749 HBMCT40 Cancer 750 HBMDM08 Immune/Hematopoietic 751
HBMSN62 Cancer 752 HBMSO30 Immune/Hematopoietic 753 HBMTM50 Cancer
754 HBMUD59 Cancer 755 HBMUI10 Cancer 756 HBMUJ48 Cancer 757
HBMUR39 Immune/Hematopoietic 758 HBMVF65 Endocrine,
Immune/Hematopoietic, Neural/Sensory 759 HBMVF65 Endocrine,
Immune/Hematopoietic, Neural/Sensory 760 HBMWC39 Cancer 761 HBMWJ92
Cancer 762 HBMWS52 Immune/Hematopoietic 763 HBMXE34 Cancer 764
HBMXG01 Immune/Hematopoietic 765 HBMXG76 Immune/Hematopoietic 766
HBMXM05 Excretory, Immune/Hematopoietic, Neural/Sensory 767 HBMXW83
Cancer 768 HBNAE74 Excretory, Musculoskeletal, Reproductive 769
HBNAX16 Cancer 770 HBNAZ35 Endocrine, Reproductive 771 HBODK40
Cancer 772 HBODV76 Cancer 773 HBPAD89 Cancer 774 HBPAF39
Immune/Hematopoietic, Neural/Sensory 775 HBQAC45 Neural/Sensory 776
HBQAC72 Neural/Sensory
777 HBQAE37 Neural/Sensory 778 HBSAJ63 Cancer 779 HBSAJ63 Cancer
780 HBSDD24 Cancer 781 HBWBD25 Immune/Hematopoietic, Neural/Sensory
782 HBXAS93 Neural/Sensory 783 HBXAT27 Cancer 784 HBXAW57
Neural/Sensory 785 HBXBI29 Neural/Sensory 786 HBXBM24
Neural/Sensory 787 HBXBM78 Cancer 788 HBXCD59 Immune/Hematopoietic,
Neural/Sensory 789 HBXCE43 Neural/Sensory 790 HBXCG08 Cancer 791
HBXCM52 Cancer 792 HBXCQ03 Cancer 793 HBXCR15 Cancer 794 HBXDL52
Cancer 795 HBXDL52 Cancer 796 HBXDN08 Cancer 797 HBXDN65
Neural/Sensory 798 HBXFA04 Neural/Sensory 799 HBXFE64
Neural/Sensory 800 HBXFI33 Immune/Hematopoietic, Neural/Sensory 801
HBXFP72 Cancer 802 HBXFS31 Neural/Sensory 803 HBXFW01
Neural/Sensory 804 HBXGE12 Cancer 805 HBXGL91 Neural/Sensory,
Reproductive 806 HBXGM24 Cancer 807 HBZAI75 Digestive, Reproductive
808 HCABP33 Cancer 809 HCABW10 Cancer 810 HCACZ65 Cancer 811
HCBAB34 Cancer 812 HCDAA24 Cancer 813 HCDAA24 Cancer 814 HCDAF17
Cancer 815 HCDAH02 Immune/Hematopoietic, Musculoskeletal 816
HCDAP33 Cancer 817 HCDAR40 Cardiovascular, Immune/Hematopoietic,
Musculoskeletal 818 HCDAS02 Cancer 819 HCDBE76 Cancer 820 HCDBO32
Cancer 821 HCDBW67 Cancer 822 HCDBZ31 Musculoskeletal 823 HCDCB03
Cancer 824 HCDCE51 Cancer 825 HCDCI42 Immune/Hematopoietic,
Musculoskeletal 826 HCDDB15 Cancer 827 HCDDX81 Musculoskeletal 828
HCDDY28 Cardiovascular, Musculoskeletal 829 HCDEB19 Cancer 830
HCDEN46 Cancer 831 HCDES69 Immune/Hematopoietic, Musculoskeletal,
Reproductive 832 HCE1D45 Cancer 833 HCE1N56 Cancer 834 HCE1T53
Neural/Sensory 835 HCE1Y27 Digestive, Neural/Sensory, Reproductive
836 HCE1Y34 Immune/Hematopoietic, Neural/Sensory 837 HCE2B57
Musculoskeletal, Neural/Sensory 838 HCE2E47 Immune/Hematopoietic,
Mixed Fetal, Neural/Sensory 839 HCE2I23 Neural/Sensory 840 HCE2P90
Neural/Sensory 841 HCE3A54 Neural/Sensory 842 HCE3C46
Immune/Hematopoietic, Neural/Sensory 843 HCE3D58 Cancer 844 HCE3D89
Endocrine, Neural/Sensory 845 HCE3J43 Cancer 846 HCE3L04
Neural/Sensory 847 HCE3N23 Cancer 848 HCE3R01 Cancer 849 HCE3R01
Cancer 850 HCE3R01 Cancer 851 HCE3R46 Cancer 852 HCE4H32 Cancer 853
HCE4H32 Cancer 854 HCE4T64 Cancer 855 HCE4W88 Cancer 856 HCE5B62
Neural/Sensory 857 HCE5H86 Cancer 858 HCE5J64 Digestive,
Neural/Sensory 859 HCEBF54 Cancer 860 HCECO77 Cancer 861 HCEDH42
Neural/Sensory 862 HCEDJ05 Neural/Sensory 863 HCEDJ26 Cancer 864
HCEDN07 Digestive, Mixed Fetal, Neural/Sensory 865 HCEDO17 Cancer
866 HCEEG48 Neural/Sensory 867 HCEEM33 Cancer 868 HCEEP16
Immune/Hematopoietic, Neural/Sensory, Reproductive 869 HCEER60
Cardiovascular, Digestive, Neural/Sensory 870 HCEFA10
Immune/Hematopoietic, Neural/Sensory, Reproductive 871 HCEFA50
Neural/Sensory 872 HCEFA94 Neural/Sensory 873 HCEFC27 Cancer 874
HCEFG93 Neural/Sensory 875 HCEFH31 Cancer 876 HCEFK56 Cancer 877
HCEFN51 Cancer 878 HCEGG08 Cancer 879 HCEGH74 Cancer 880 HCEGK81
Cancer 881 HCEGS49 Connective/Epithelial, Neural/Sensory,
Reproductive 882 HCEGU75 Cancer 883 HCEGY33 Cancer 884 HCEHW24
Neural/Sensory 885 HCEJL08 Cancer 886 HCEJP93 Cancer 887 HCELB04
Cancer 888 HCEMA08 Cancer 889 HCENN67 Digestive, Endocrine,
Neural/Sensory 890 HCENQ22 Digestive, Immune/Hematopoietic,
Neural/Sensory 891 HCEOF01 Neural/Sensory, Reproductive 892 HCEOF01
Neural/Sensory, Reproductive 893 HCEON94 Immune/Hematopoietic,
Neural/Sensory, Reproductive 894 HCEOQ67 Cancer 895 HCEOV48 Cancer
896 HCEPC90 Neural/Sensory 897 HCEPO08 Cancer 898 HCESB03
Immune/Hematopoietic, Neural/Sensory 899 HCESK44 Cancer 900 HCETE08
Mixed Fetal, Neural/Sensory, Reproductive 901 HCETL19
Immune/Hematopoietic, Neural/Sensory, Reproductive 902 HCEWD90
Cancer 903 HCEWE62 Neural/Sensory 904 HCEZW14 Cancer 905 HCFAT42
Immune/Hematopoietic 906 HCFAT66 Immune/Hematopoietic 907 HCFBA30
Cardiovascular, Immune/Hematopoietic, Reproductive 908 HCFBM77
Immune/Hematopoietic 909 HCFBV39 Cancer 910 HCFCB72
Immune/Hematopoietic 911 HCFCG91 Cancer 912 HCFCM81 Digestive,
Immune/Hematopoietic, Reproductive 913 HCFCW39 Cancer 914 HCFCY49
Cancer 915 HCFDD18 Digestive, Immune/Hematopoietic, Mixed Fetal 916
HCFLB10 Cardiovascular, Immune/Hematopoietic 917 HCFLC03 Cancer 918
HCFLJ52 Cancer 919 HCFLL33 Immune/Hematopoietic, Reproductive 920
HCFLP48 Immune/Hematopoietic 921 HCFLQ12 Cancer 922 HCFLY20 Cancer
923 HCFLY20 Cancer 924 HCFMA39 Immune/Hematopoietic 925 HCFMJ40
Immune/Hematopoietic 926 HCFML07 Cancer 927 HCFMR75 Digestive,
Immune/Hematopoietic 928 HCFMX16 Immune/Hematopoietic 929 HCFMX88
Immune/Hematopoietic, Neural/Sensory 930 HCFNM40 Digestive,
Immune/Hematopoietic, Reproductive 931 HCFNM50 Immune/Hematopoietic
932 HCFNN16 Cancer 933 HCFNN75 Cancer 934 HCFOG17
Immune/Hematopoietic 935 HCFOH93 Immune/Hematopoietic, Reproductive
936 HCGBA15 Cancer 937 HCHAC68 Cancer 938 HCHBP49 Cancer 939
HCHCA79 Digestive, Neural/Sensory, Reproductive 940 HCHCG33 Cancer
941 HCHMY57 Cancer 942 HCHOC06 Reproductive 943 HCHOY52 Cancer 944
HCHQB93 Cancer 945 HCHQB93 Cancer 946 HCLBK61 Cancer 947 HCLCU75
Respiratory 948 HCMSA37 Cardiovascular 949 HCMSR07 Cardiovascular
950 HCNAI74 Digestive 951 HCNCT01 Digestive 952 HCNDR39 Cancer 953
HCNSD91 Cancer 954 HCNSF01 Cancer 955 HCNSG06 Digestive,
Reproductive 956 HCNSG32 Digestive, Reproductive 957 HCPAE41 Cancer
958 HCQAK36 Cancer 959 HCQAQ47 Cancer 960 HCQAS72 Cancer 961
HCQBM95 Digestive, Immune/Hematopoietic 962 HCQCM95 Cancer 963
HCQCM95 Cancer 964 HCQCV23 Cancer 965 HCQCV23 Cancer
966 HCQDD32 Digestive, Immune/Hematopoietic, Reproductive 967
HCQDD61 Digestive, Immune/Hematopoietic 968 HCQDT67 Digestive,
Immune/Hematopoietic 969 HCRAI29 Neural/Sensory 970 HCRBI79 Cancer
971 HCRBL20 Cancer 972 HCRBX84 Cancer 973 HCRMA24 Digestive,
Musculoskeletal 974 HCRMR35 Cancer 975 HCRMR35 Cancer 976 HCRMR35
Cancer 977 HCROC18 Cancer 978 HCUAE53 Immune/Hematopoietic 979
HCUAO46 Immune/Hematopoietic 980 HCUAT74 Cancer 981 HCUBA28 Cancer
982 HCUBC45 Cancer 983 HCUBM41 Immune/Hematopoietic 984 HCUBN69
Immune/Hematopoietic 985 HCUBY47 Digestive, Immune/Hematopoietic
986 HCUCV66 Cancer 987 HCUDJ41 Immune/Hematopoietic 988 HCUEC55
Immune/Hematopoietic 989 HCUEG85 Immune/Hematopoietic 990 HCUES35
Immune/Hematopoietic, Neural/Sensory 991 HCUFC77 Cancer 992 HCUFD17
Cancer 993 HCUFD46 Immune/Hematopoietic 994 HCUFE33
Immune/Hematopoietic 995 HCUFJ09 Cancer 996 HCUFQ58 Cardiovascular,
Immune/Hematopoietic 997 HCUFQ58 Cardiovascular,
Immune/Hematopoietic 998 HCUFX08 Immune/Hematopoietic 999 HCUGB76
Immune/Hematopoietic, Reproductive 1000 HCUGK79
Immune/Hematopoietic 1001 HCUGQ19 Immune/Hematopoietic 1002 HCUGR26
Immune/Hematopoietic 1003 HCUGR86 Immune/Hematopoietic 1004 HCUHE27
Immune/Hematopoietic 1005 HCUHL82 Cardiovascular,
Immune/Hematopoietic, Reproductive 1006 HCUHM71
Immune/Hematopoietic, Musculoskeletal 1007 HCWAK88
Immune/Hematopoietic 1008 HCWAL10 Cardiovascular,
Immune/Hematopoietic 1009 HCWAT71 Immune/Hematopoietic 1010 HCWBQ52
Immune/Hematopoietic 1011 HCWCH16 Immune/Hematopoietic 1012 HCWDM69
Digestive, Immune/Hematopoietic 1013 HCWEB38 Immune/Hematopoietic
1014 HCWEB72 Immune/Hematopoietic 1015 HCWEF04 Cancer 1016 HCWEI82
Immune/Hematopoietic 1017 HCWEM96 Cancer 1018 HCWFJ16
Immune/Hematopoietic 1019 HCWFJ16 Immune/Hematopoietic 1020 HCWFK03
Cancer 1021 HCWHD30 Immune/Hematopoietic 1022 HCWHT34
Immune/Hematopoietic, Mixed Fetal 1023 HCWHT52 Immune/Hematopoietic
1024 HCWKO32 Immune/Hematopoietic 1025 HCWLE50 Immune/Hematopoietic
1026 HCWUF93 Cancer 1027 HCWUW24 Immune/Hematopoietic 1028 HCYBA32
Cancer 1029 HDAAV67 Musculoskeletal, Neural/Sensory 1030 HDABR74
Cancer 1031 HDABW45 Immune/Hematopoietic, Musculoskeletal 1032
HDACJ52 Cancer 1033 HDCBM09 Immune/Hematopoietic 1034 HDFAB86 Mixed
Fetal, Neural/Sensory 1035 HDFIB37 Connective/Epithelial,
Neural/Sensory 1036 HDFMB91 Neural/Sensory 1037 HDHAA55
Immune/Hematopoietic, Neural/Sensory 1038 HDHEA33 Cancer 1039
HDHEB12 Immune/Hematopoietic, Neural/Sensory 1040 HDHEB80
Neural/Sensory 1041 HDHIA16 Cancer 1042 HDHIA26 Neural/Sensory 1043
HDHMA71 Cancer 1044 HDLAL94 Cancer 1045 HDPAB86 Cancer 1046 HDPAE80
Cancer 1047 HDPAQ86 Digestive, Immune/Hematopoietic, Neural/Sensory
1048 HDPBD56 Cancer 1049 HDPBN48 Digestive, Immune/Hematopoietic
1050 HDPCG79 Digestive, Immune/Hematopoietic, Reproductive 1051
HDPCV29 Immune/Hematopoietic 1052 HDPDA36 Immune/Hematopoietic 1053
HDPDC59 Immune/Hematopoietic, Musculoskeletal 1054 HDPFG13 Cancer
1055 HDPFK27 Immune/Hematopoietic, Neural/Sensory 1056 HDPFZ05
Immune/Hematopoietic, Neural/Sensory 1057 HDPGA84 Cancer 1058
HDPGR80 Cancer 1059 HDPGU14 Cancer 1060 HDPGX09 Cancer 1061 HDPIE44
Cancer 1062 HDPIE73 Immune/Hematopoietic 1063 HDPIF35
Immune/Hematopoietic 1064 HDPIF65 Immune/Hematopoietic 1065 HDPIH25
Cancer 1066 HDPIY31 Cancer 1067 HDPJH72 Cancer 1068 HDPJV53
Immune/Hematopoietic 1069 HDPJV75 Cancer 1070 HDPKC55
Cardiovascular, Immune/Hematopoietic, Reproductive 1071 HDPKD16
Cancer 1072 HDPMC52 Digestive, Immune/Hematopoietic,
Musculoskeletal 1073 HDPML04 Connective/Epithelial,
Immune/Hematopoietic 1074 HDPMM22 Immune/Hematopoietic 1075 HDPNC21
Cancer 1076 HDPNJ26 Cancer 1077 HDPOD73 Immune/Hematopoietic 1078
HDPOT33 Cancer 1079 HDPPB70 Cancer 1080 HDPPC19
Immune/Hematopoietic 1081 HDPPE05 Cancer 1082 HDPSA70 Cancer 1083
HDPSS56 Cancer 1084 HDPSZ07 Immune/Hematopoietic 1085 HDPSZ07
Immune/Hematopoietic 1086 HDPSZ07 Immune/Hematopoietic 1087 HDPTI49
Immune/Hematopoietic, Neural/Sensory 1088 HDPTP22
Immune/Hematopoietic, Neural/Sensory, Reproductive 1089 HDPYE25
Immune/Hematopoietic, Neural/Sensory 1090 HDQGD06 Cancer 1091
HDQGD06 Cancer 1092 HDQGD06 Cancer 1093 HDQGN08
Immune/Hematopoietic 1094 HDQGO62 Cancer 1095 HDQPM16 Cancer 1096
HDRAA17 Cancer 1097 HDRAC68 Cancer 1098 HDSAC78 Cancer 1099 HDSAH37
Connective/Epithelial 1100 HDSAM57 Immune/Hematopoietic 1101
HDSAO14 Cancer 1102 HDSAO64 Cancer 1103 HDSAP15 Cancer 1104 HDTAR39
Cancer 1105 HDTAS57 Cancer 1106 HDTBP62 Cancer 1107 HDTBQ77 Cancer
1108 HDTDA48 Immune/Hematopoietic, Neural/Sensory 1109 HDTDE66
Cancer 1110 HDTDG75 Immune/Hematopoietic 1111 HDTDS09 Cancer 1112
HDTFF53 Cancer 1113 HDTGW76 Cancer 1114 HDTGZ56
Immune/Hematopoietic 1115 HDTHZ85 Cancer 1116 HDTIM39 Cancer 1117
HDTKJ29 Cancer 1118 HDUAB12 Cancer 1119 HDUAD68 Cancer 1120 HE2AC74
Cancer 1121 HE2AC74 Cancer 1122 HE2AC75 Mixed Fetal 1123 HE2AI94
Cancer 1124 HE2AT61 Cancer 1125 HE2AX36 Cancer 1126 HE2AY96 Cancer
1127 HE2BD72 Cancer 1128 HE2BH50 Cancer 1129 HE2CB53 Cancer 1130
HE2CC17 Excretory, Mixed Fetal 1131 HE2CJ53 Cancer 1132 HE2CK47
Cancer 1133 HE2CM34 Cancer 1134 HE2DG46 Mixed Fetal 1135 HE2DI16
Mixed Fetal 1136 HE2DJ84 Cancer 1137 HE2DY23 Cancer 1138 HE2DY25
Cancer 1139 HE2EE80 Cancer 1140 HE2EH45 Mixed Fetal 1141 HE2FE89
Cardiovascular, Digestive, Mixed Fetal 1142 HE2FR49 Cancer 1143
HE2GB19 Cancer 1144 HE2GO81 Cancer 1145 HE2HB61 Mixed Fetal 1146
HE2HB64 Cancer 1147 HE2HF76 Cancer 1148 HE2ID09 Mixed Fetal 1149
HE2IE66 Cancer 1150 HE2NW57 Mixed Fetal 1151 HE2OA95 Cancer 1152
HE2OC39 Mixed Fetal, Musculoskeletal 1153 HE2PB61 Cancer 1154
HE2PI43 Cancer 1155 HE2PJ56 Cancer 1156 HE6CJ41
Immune/Hematopoietic, Mixed Fetal 1157 HE6DC37 Digestive, Mixed
Fetal, Reproductive 1158 HE6DN83 Cancer 1159 HE6EI30
Immune/Hematopoietic, Mixed Fetal 1160 HE6ET70 Mixed Fetal,
Reproductive 1161 HE6GO65 Mixed Fetal, Neural/Sensory 1162 HE8AN83
Mixed Fetal, Musculoskeletal 1163 HE8AU68 Cancer 1164 HE8BE20
Cancer 1165 HE8BP05 Mixed Fetal
1166 HE8BP64 Cancer 1167 HE8BQ49 Mixed Fetal 1168 HE8BR18 Cancer
1169 HE8BR30 Mixed Fetal 1170 HE8BT58 Cancer 1171 HE8BU60 Cancer
1172 HE8CA13 Cancer 1173 HE8CC34 Cardiovascular, Digestive, Mixed
Fetal 1174 HE8CH08 Cancer 1175 HE8DG02 Mixed Fetal 1176 HE8DK52
Cancer 1177 HE8DZ94 Cancer 1178 HE8EN79 Cancer 1179 HE8EX86 Cancer
1180 HE8FC10 Immune/Hematopoietic, Mixed Fetal, Reproductive 1181
HE8FG15 Cancer 1182 HE8FG24 Cancer 1183 HE8FK78 Cancer 1184 HE8FL24
Mixed Fetal 1185 HE8FL68 Mixed Fetal 1186 HE8FR53 Cancer 1187
HE8MA27 Cancer 1188 HE8MG56 Mixed Fetal 1189 HE8MQ01 Cancer 1190
HE8MS43 Cancer 1191 HE8MY77 Cancer 1192 HE8NC81 Cancer 1193 HE8NO09
Cancer 1194 HE8QU21 Immune/Hematopoietic, Mixed Fetal 1195 HE8SH74
Immune/Hematopoietic, Mixed Fetal, Musculoskeletal 1196 HE8UX34
Mixed Fetal 1197 HE9AE05 Cancer 1198 HE9BJ14 Mixed Fetal,
Musculoskeletal 1199 HE9CI81 Cancer 1200 HE9CJ38 Mixed Fetal 1201
HE9CM11 Mixed Fetal 1202 HE9CN58 Cancer 1203 HE9CV59 Cancer 1204
HE9DG54 Cancer 1205 HE9DH59 Cancer 1206 HE9DZ47 Endocrine,
Immune/Hematopoietic, Mixed Fetal 1207 HE9EC36 Cancer 1208 HE9EM54
Immune/Hematopoietic, Mixed Fetal 1209 HE9FH28 Mixed Fetal 1210
HE9HE13 Cancer 1211 HE9HE13 Cancer 1212 HE9HF59 Mixed Fetal 1213
HE9HV71 Cancer 1214 HE9NB82 Cancer 1215 HE9NE43 Mixed Fetal 1216
HE9RN58 Cancer 1217 HE9TA42 Cancer 1218 HEAAC21 Cancer 1219 HEAAC39
Neural/Sensory, Reproductive 1220 HEAAC48 Reproductive 1221 HEAAD63
Neural/Sensory, Reproductive 1222 HEAAE19 Immune/Hematopoietic,
Reproductive 1223 HEAAM54 Reproductive 1224 HEAAM96 Reproductive
1225 HEAAN52 Cancer 1226 HEAAU28 Reproductive 1227 HEAAW54
Reproductive 1228 HEAAW94 Cancer 1229 HEBAP51 Cancer 1230 HEBAT05
Cancer 1231 HEBBF78 Cancer 1232 HEBBK04 Cancer 1233 HEBCN80
Neural/Sensory 1234 HEBCW57 Mixed Fetal, Neural/Sensory 1235
HEBDF90 Cancer 1236 HEBDW31 Cancer 1237 HEBFL36 Neural/Sensory 1238
HEBGC01 Neural/Sensory 1239 HEBGE23 Cancer 1240 HEBGE85 Digestive,
Neural/Sensory, Reproductive 1241 HEBGJ94 Cancer 1242 HEBGM06
Cancer 1243 HEEAB58 Cancer 1244 HEEAF49 Cancer 1245 HEEAJ46 Mixed
Fetal, Reproductive 1246 HEGAI20 Reproductive 1247 HEIAC52 Cancer
1248 HELAC55 Cardiovascular, Immune/Hematopoietic, Musculoskeletal
1249 HELAT58 Cardiovascular 1250 HELAW94 Cancer 1251 HELDF80 Cancer
1252 HELDH39 Cancer 1253 HELDK79 Cardiovascular 1254 HELDQ42 Cancer
1255 HELEE85 Cancer 1256 HELEL76 Cancer 1257 HELEL76 Cancer 1258
HELEO45 Cancer 1259 HELFA57 Cancer 1260 HELFO30 Cancer 1261 HELGF28
Cancer 1262 HELGP60 Cardiovascular, Excretory, Immune/Hematopoietic
1263 HELHN47 Cancer 1264 HELHP11 Cardiovascular,
Immune/Hematopoietic 1265 HELHP11 Cardiovascular,
Immune/Hematopoietic 1266 HEMAE30 Cancer 1267 HEMBV40 Cancer 1268
HEMCJ80 Cancer 1269 HEMCL55 Cardiovascular 1270 HEMDB07
Cardiovascular 1271 HEMDR05 Cardiovascular, Digestive,
Immune/Hematopoietic 1272 HEMGK71 Cardiovascular,
Immune/Hematopoietic, Musculoskeletal 1273 HEOMF59
Immune/Hematopoietic 1274 HEOMJ73 Cancer 1275 HEOMR67 Cancer 1276
HEOMU25 Connective/Epithelial, Immune/Hematopoietic 1277 HEOMU44
Cancer 1278 HEONI85 Digestive, Immune/Hematopoietic, Reproductive
1279 HEONK04 Cancer 1280 HEONP08 Immune/Hematopoietic 1281 HEPAD15
Endocrine, Reproductive 1282 HEPBC23 Cancer 1283 HEPBV09
Reproductive 1284 HEPCF35 Neural/Sensory, Reproductive 1285 HEPCU48
Cancer 1286 HEQAH47 Cancer 1287 HEQAP92 Cancer 1288 HEQAV53 Cancer
1289 HEQBJ01 Cancer 1290 HEQBJ01 Cancer 1291 HEQBJ01 Cancer 1292
HEQBM94 Cancer 1293 HEQCB93 Cancer 1294 HERAI63
Connective/Epithelial 1295 HERAQ22 Connective/Epithelial 1296
HERAS61 Connective/Epithelial 1297 HESAG57 Cancer 1298 HETAA62
Cancer 1299 HETBB70 Immune/Hematopoietic, Reproductive 1300 HETBJ88
Cancer 1301 HETCM67 Cancer 1302 HETDD61 Reproductive 1303 HETDD61
Reproductive 1304 HETDJ34 Cancer 1305 HETDM73 Cancer 1306 HETDP76
Cancer 1307 HETFO57 Cancer 1308 HETGZ31 Cancer 1309 HETHD26 Cancer
1310 HETHM27 Cancer 1311 HETIN36 Cancer 1312 HFAAI17 Neural/Sensory
1313 HFAAJ45 Immune/Hematopoietic, Neural/Sensory 1314 HFADF41
Neural/Sensory 1315 HFADM09 Cancer 1316 HFAUA23 Cancer 1317 HFCAG75
Cancer 1318 HFCAI40 Cancer 1319 HFCAQ17 Cancer 1320 HFCBC16
Neural/Sensory 1321 HFCBL53 Cancer 1322 HFCBL53 Cancer 1323 HFCBL53
Cancer 1324 HFCBT29 Cancer 1325 HFCCZ31 Cancer 1326 HFCDN13 Cancer
1327 HFCDT67 Cancer 1328 HFCDY36 Neural/Sensory 1329 HFCEC45 Cancer
1330 HFCET43 Cancer 1331 HFEAG55 Cancer 1332 HFEAU63
Connective/Epithelial 1333 HFEBA88 Cancer 1334 HFEBK75
Connective/Epithelial 1335 HFEBO15 Cancer 1336 HFEBO17 Cancer 1337
HFFAE46 Neural/Sensory 1338 HFFAH01 Digestive,
Immune/Hematopoietic, Neural/Sensory 1339 HFFAL70 Cancer 1340
HFFAV61 Neural/Sensory 1341 HFGAB50 Cancer 1342 HFGAE28 Cancer 1343
HFGAN63 Cancer 1344 HFHDN80 Cardiovascular, Digestive,
Immune/Hematopoietic 1345 HFIAB78 Cancer 1346 HFIAD23 Cancer 1347
HFIAK06 Musculoskeletal, Reproductive 1348 HFICH70 Musculoskeletal
1349 HFIHQ57 Musculoskeletal, Reproductive 1350 HFIIK29 Cancer 1351
HFIIK29 Cancer 1352 HFIIK29 Cancer 1353 HFIIK29 Cancer 1354 HFIIQ27
Cancer 1355 HFIIQ64 Cancer 1356 HFIIZ61 Cancer 1357 HFIJD81 Cancer
1358 HFIJF44 Cancer 1359 HFITA02 Immune/Hematopoietic,
Musculoskeletal 1360 HFITF80 Cancer 1361 HFIUK66 Cancer 1362
HFIUT21 Cancer 1363 HFIVB04 Cancer 1364 HFIXC39 Cancer 1365 HFIXC69
Cancer 1366 HFIXE39 Cancer 1367 HFIYP15 Immune/Hematopoietic,
Musculoskeletal 1368 HFIZE10 Cancer 1369 HFIZF51 Musculoskeletal
1370 HFIZK42 Immune/Hematopoietic, Musculoskeletal 1371 HFIZM89
Musculoskeletal 1372 HFKBA62 Digestive,
Excretory, Neural/Sensory 1373 HFKBC47 Cancer 1374 HFKDX53 Cancer
1375 HFKEB14 Cancer 1376 HFKEG63 Excretory 1377 HFKES35 Cancer 1378
HFKES35 Cancer 1379 HFKEU17 Cancer 1380 HFKEV77 Cancer 1381 HFKFI15
Cancer 1382 HFKFI35 Excretory 1383 HFKFK49 Cancer 1384 HFKFV88
Cancer 1385 HFKFV88 Cancer 1386 HFKFV88 Cancer 1387 HFKFX64
Excretory 1388 HFOXD49 Cancer 1389 HFOXE28 Cancer 1390 HFOYH74
Musculoskeletal 1391 HFOYP02 Musculoskeletal 1392 HFOYR24
Musculoskeletal 1393 HFOYR54 Cancer 1394 HFOZB26 Cancer 1395
HFPBF54 Cancer 1396 HFPBF54 Cancer 1397 HFPBI93 Cancer 1398 HFPBJ64
Musculoskeletal, Neural/Sensory 1399 HFPBQ55 Musculoskeletal,
Neural/Sensory, Reproductive 1400 HFPCK22 Cancer 1401 HFPCM32
Neural/Sensory 1402 HFPCM36 Cancer 1403 HFPCS84 Neural/Sensory 1404
HFPCU47 Neural/Sensory 1405 HFPCY66 Digestive, Neural/Sensory 1406
HFPDC65 Cancer 1407 HFPDE42 Musculoskeletal, Neural/Sensory 1408
HFPDE88 Neural/Sensory 1409 HFPDO25 Neural/Sensory 1410 HFPDP70
Neural/Sensory 1411 HFPDR39 Cancer 1412 HFPDX08 Cancer 1413 HFPEP69
Neural/Sensory 1414 HFRAU40 Cancer 1415 HFRAY90 Cancer 1416 HFSAY91
Cancer 1417 HFSBC10 Immune/Hematopoietic, Mixed Fetal 1418 HFSBE94
Immune/Hematopoietic 1419 HFTAN11 Cancer 1420 HFTAR27 Cancer 1421
HFTAR30 Cancer 1422 HFTAS49 Cancer 1423 HFTBB50 Cancer 1424 HFTBL17
Cancer 1425 HFTBL17 Cancer 1426 HFTCF02 Digestive, Musculoskeletal,
Neural/Sensory 1427 HFTCI85 Neural/Sensory 1428 HFTCJ32
Neural/Sensory 1429 HFTCO17 Cancer 1430 HFTCW07 Neural/Sensory 1431
HFTDF32 Cancer 1432 HFTDF79 Immune/Hematopoietic, Neural/Sensory,
Reproductive 1433 HFTDK11 Cancer 1434 HFTDU08 Immune/Hematopoietic,
Musculoskeletal, Neural/Sensory 1435 HFVGK67 Digestive,
Immune/Hematopoietic 1436 HFVHD38 Cancer 1437 HFVHY57 Cancer 1438
HFVIC33 Cancer 1439 HFXAK32 Cancer 1440 HFXAK59 Cancer 1441 HFXBI64
Neural/Sensory 1442 HFXBL05 Mixed Fetal, Neural/Sensory 1443
HFXBM52 Neural/Sensory 1444 HFXBR58 Neural/Sensory 1445 HFXBV67
Digestive, Neural/Sensory 1446 HFXBY20 Neural/Sensory 1447 HFXCB70
Neural/Sensory 1448 HFXCI42 Neural/Sensory 1449 HFXCL59
Immune/Hematopoietic, Musculoskeletal, Neural/Sensory 1450 HFXCM22
Neural/Sensory, Reproductive 1451 HFXCN18 Neural/Sensory 1452
HFXCS53 Cancer 1453 HFXDB37 Neural/Sensory 1454 HFXDI32
Neural/Sensory 1455 HFXDJ43 Neural/Sensory 1456 HFXDL76
Immune/Hematopoietic, Musculoskeletal, Neural/Sensory 1457 HFXDM75
Neural/Sensory 1458 HFXDO18 Neural/Sensory 1459 HFXDP44
Neural/Sensory 1460 HFXDR08 Immune/Hematopoietic, Neural/Sensory,
Reproductive 1461 HFXDR28 Neural/Sensory 1462 HFXDR28
Neural/Sensory 1463 HFXDR47 Cancer 1464 HFXDZ03
Immune/Hematopoietic, Neural/Sensory 1465 HFXED33 Neural/Sensory
1466 HFXEE88 Neural/Sensory 1467 HFXGR32 Neural/Sensory 1468
HFXGT51 Neural/Sensory 1469 HFXGW16 Neural/Sensory 1470 HFXHC15
Neural/Sensory 1471 HFXHI33 Immune/Hematopoietic, Neural/Sensory
1472 HFXHL21 Neural/Sensory 1473 HFXHL83 Neural/Sensory 1474
HFXHM49 Neural/Sensory 1475 HFXHM93 Neural/Sensory 1476 HFXHN89
Immune/Hematopoietic, Neural/Sensory 1477 HFXJB21 Neural/Sensory
1478 HFXJN93 Neural/Sensory 1479 HFXJS15 Cancer 1480 HFXJT53 Cancer
1481 HFXKG56 Neural/Sensory 1482 HFXKL60 Cancer 1483 HFXLG08
Neural/Sensory 1484 HFXLK91 Cancer 1485 HFXLM32 Neural/Sensory,
Reproductive 1486 HGBAX83 Digestive 1487 HGBBR29 Cancer 1488
HGBDL51 Cancer 1489 HGBDV35 Cancer 1490 HGBDX28 Cancer 1491 HGBGX31
Cancer 1492 HGBHE23 Cancer 1493 HGBHI15 Digestive 1494 HGCMW39
Cancer 1495 HGLAG32 Cancer 1496 HGLAH08 Cancer 1497 HGLAH86
Immune/Hematopoietic 1498 HGLBC33 Cancer 1499 HGLBG15 Cancer 1500
HGLBM55 Cancer 1501 HGLDA95 Cancer 1502 HGLDB06 Cancer 1503 HGLDE15
Digestive, Immune/Hematopoietic 1504 HHBEI14 Cancer 1505 HHBGL33
Cardiovascular, Digestive 1506 HHEAW44 Immune/Hematopoietic 1507
HHEBP28 Cancer 1508 HHECK41 Cancer 1509 HHECR10
Immune/Hematopoietic 1510 HHEMC55 Immune/Hematopoietic 1511 HHEMM20
Immune/Hematopoietic 1512 HHEMM80 Immune/Hematopoietic 1513 HHEMP35
Cancer 1514 HHEMZ08 Cancer 1515 HHENC17 Cancer 1516 HHENF95
Immune/Hematopoietic 1517 HHENR74 Immune/Hematopoietic 1518 HHENU33
Immune/Hematopoietic 1519 HHENY07 Cancer 1520 HHEOK77 Cancer 1521
HHEPE72 Immune/Hematopoietic 1522 HHEPE81 Cancer 1523 HHEPM64
Cancer 1524 HHEQI04 Connective/Epithelial, Excretory,
Immune/Hematopoietic 1525 HHEQY60 Immune/Hematopoietic 1526 HHFBA31
Cancer 1527 HHFCI81 Cancer 1528 HHFCN78 Cardiovascular,
Immune/Hematopoietic 1529 HHFCT95 Cancer 1530 HHFDN16
Cardiovascular 1531 HHFEB79 Connective/Epithelial 1532 HHFEC39
Cancer 1533 HHFEN34 Cardiovascular 1534 HHFFZ01 Cancer 1535 HHFGI71
Cardiovascular 1536 HHFGJ54 Cancer 1537 HHFGL38 Cardiovascular,
Immune/Hematopoietic 1538 HHFGR75 Cardiovascular,
Immune/Hematopoietic, Neural/Sensory 1539 HHFGZ23 Cardiovascular,
Digestive, Endocrine 1540 HHFHG26 Cardiovascular, Neural/Sensory
1541 HHFHM47 Cardiovascular, Immune/Hematopoietic 1542 HHGAA76
Immune/Hematopoietic, Reproductive 1543 HHGAD46 Cancer 1544 HHGAT09
Cancer 1545 HHGBC21 Cancer 1546 HHGBF91 Cancer 1547 HHGBG63 Cancer
1548 HHGBV02 Immune/Hematopoietic, Reproductive 1549 HHGBW55
Immune/Hematopoietic, Reproductive 1550 HHGBX88 Cancer 1551 HHGCA26
Reproductive 1552 HHGDA81 Cancer 1553 HHGDI12 Neural/Sensory 1554
HHGDR05 Neural/Sensory 1555 HHGDR92 Cancer 1556 HHGDS56 Cancer 1557
HHGDW65 Cancer 1558 HHLBA86 Digestive 1559 HHNAC56 Digestive 1560
HHPBG90 Cancer 1561 HHPDE28 Cancer 1562 HHPDJ11 Cancer 1563 HHPDX86
Neural/Sensory 1564 HHPEA17 Neural/Sensory 1565 HHPEB61
Immune/Hematopoietic, Neural/Sensory, Respiratory 1566 HHPFP26
Cancer 1567 HHPFS11 Cardiovascular, Neural/Sensory 1568 HHPFS15
Cancer 1569 HHPFS18 Cancer 1570 HHPGH34 Neural/Sensory,
Reproductive 1571 HHPGU74 Neural/Sensory 1572 HHPGU87 Cancer 1573
HHPSD42 Immune/Hematopoietic, Neural/Sensory 1574 HHPSE03
Neural/Sensory 1575 HHPSE55 Cancer
1576 HHPSF70 Cancer 1577 HHPSH74 Cancer 1578 HHPSL14 Cancer 1579
HHPSM40 Neural/Sensory 1580 HHPTF26 Mixed Fetal, Musculoskeletal,
Neural/Sensory 1581 HHSAD31 Immune/Hematopoietic, Neural/Sensory,
Reproductive 1582 HHSAE74 Neural/Sensory 1583 HHSAG62 Cancer 1584
HHSAK17 Neural/Sensory 1585 HHSBJ92 Cancer 1586 HHSBN84 Cancer 1587
HHSCL24 Cancer 1588 HHSCQ67 Cancer 1589 HHSCU12 Cancer 1590 HHSDB43
Cancer 1591 HHSDL07 Neural/Sensory 1592 HHSDX07 Cancer 1593 HHSFF54
Cancer 1594 HHSGB85 Cancer 1595 HHSGL84 Neural/Sensory 1596 HHTLH79
Immune/Hematopoietic, Musculoskeletal, Neural/Sensory 1597 HIABC70
Cancer 1598 HIATG10 Endocrine 1599 HIBCO70 Cancer 1600 HIBCR82
Mixed Fetal, Neural/Sensory 1601 HIBDA41 Cancer 1602 HIBEC45 Cancer
1603 HILBW03 Cancer 1604 HISAE16 Digestive 1605 HISAG53 Cancer 1606
HISAN63 Digestive 1607 HISAT78 Cancer 1608 HISBA38 Digestive,
Immune/Hematopoietic 1609 HISBB66 Cancer 1610 HISCJ20 Cancer 1611
HISCK41 Digestive 1612 HISCO45 Cancer 1613 HISEJ52 Cancer 1614
HJABC58 Cancer 1615 HJABG59 Immune/Hematopoietic 1616 HJABR75
Immune/Hematopoietic 1617 HJABS31 Cancer 1618 HJABT12 Digestive,
Immune/Hematopoietic, Neural/Sensory 1619 HJACE25 Cancer 1620
HJACK21 Cancer 1621 HJBCG74 Cancer 1622 HJBCO21 Cancer 1623 HJBCQ40
Immune/Hematopoietic 1624 HJBDM36 Cancer 1625 HJMAF30 Cancer 1626
HJMAM72 Cancer 1627 HJMAZ60 Cancer 1628 HJMBB20 Cancer 1629 HJMBB20
Cancer 1630 HJMBB20 Cancer 1631 HJMBK59 Cancer 1632 HJMBP01 Cancer
1633 HJMBQ17 Cancer 1634 HJMBW62 Reproductive 1635 HJMBX54
Musculoskeletal, Reproductive 1636 HJPAF69 Immune/Hematopoietic
1637 HJPAQ19 Cancer 1638 HJPAZ35 Cancer 1639 HJPBI77
Immune/Hematopoietic, Musculoskeletal, Neural/Sensory 1640 HJPBN96
Cancer 1641 HJPBU47 Cancer 1642 HJPCQ19 Cancer 1643 HJPDJ08
Immune/Hematopoietic 1644 HJPDK61 Cancer 1645 HKABI53 Cancer 1646
HKABN63 Cancer 1647 HKACA25 Cancer 1648 HKACO64 Cancer 1649 HKACP50
Cancer 1650 HKACX90 Cancer 1651 HKADI27 Cancer 1652 HKADN26 Cancer
1653 HKADP79 Cancer 1654 HKADT55 Cancer 1655 HKAEK58 Cancer 1656
HKAEK72 Connective/Epithelial 1657 HKAFJ47 Cancer 1658 HKAFQ41
Cancer 1659 HKAHH71 Cancer 1660 HKAJA95 Cancer 1661 HKAKU90 Cancer
1662 HKCSZ54 Digestive 1663 HKFAA15 Cancer 1664 HKFBB08
Immune/Hematopoietic 1665 HKGAG59 Cancer 1666 HKGAJ81 Cancer 1667
HKGAK45 Musculoskeletal, Reproductive 1668 HKGAP04 Cancer 1669
HKGAP57 Immune/Hematopoietic 1670 HKGAW41 Cancer 1671 HKGBA21
Connective/Epithelial, Mixed Fetal, Musculoskeletal 1672 HKGBC33
Immune/Hematopoietic 1673 HKGBC73 Cancer 1674 HKGBF61 Cancer 1675
HKGBH54 Cancer 1676 HKGBP52 Cancer 1677 HKGCE23 Cancer 1678 HKGCE62
Immune/Hematopoietic 1679 HKGCK41 Cancer 1680 HKGCK41 Cancer 1681
HKGCN96 Cancer 1682 HKGCX05 Cancer 1683 HKGDA95 Cancer 1684 HKGDO12
Cancer 1685 HKIME53 Cancer 1686 HKIMG23 Cancer 1687 HKIXB73
Excretory 1688 HKIXD68 Cancer 1689 HKIXR91 Cancer 1690 HKIXS19
Cancer 1691 HKIXW45 Cancer 1692 HKIYU90 Excretory, Neural/Sensory
1693 HKIMLB81 Excretory 1694 HKMLF77 Excretory 1695 HKMLM32
Excretory, Neural/Sensory 1696 HKMLR17 Cancer 1697 HKMLT89
Excretory, Immune/Hematopoietic, Reproductive 1698 HKMLV05
Excretory, Immune/Hematopoietic 1699 HKMLV25 Cancer 1700 HKMMB79
Cancer 1701 HKMMC69 Excretory, Immune/Hematopoietic 1702 HKMMD91
Cancer 1703 HKMMP90 Excretory, Immune/Hematopoietic, Neural/Sensory
1704 HKMMU76 Cancer 1705 HKPAC10 Excretory 1706 HKPAC50 Cancer 1707
HKPMA08 Cancer 1708 HKTAC18 Cancer 1709 HL1SA89 Cancer 1710 HL2AB60
Cancer 1711 HL3AE69 Cancer 1712 HL3AF32 Cancer 1713 HLDAV70
Digestive, Immune/Hematopoietic 1714 HLDBL62 Cancer 1715 HLDBV18
Cancer 1716 HLDBV54 Cancer 1717 HLDCR26 Cancer 1718 HLDDM27 Cancer
1719 HLDDM27 Cancer 1720 HLDNF18 Cancer 1721 HLDNN84 Digestive,
Mixed Fetal 1722 HLDOD77 Digestive 1723 HLDOL74 Cancer 1724 HLDPB24
Cardiovascular, Digestive 1725 HLDRU08 Cancer 1726 HLDXF43 Cancer
1727 HLEAA10 Immune/Hematopoietic 1728 HLEAA24 Immune/Hematopoietic
1729 HLHAE14 Neural/Sensory, Respiratory 1730 HLHAE14
Neural/Sensory, Respiratory 1731 HLHBS54 Cancer 1732 HLHCB33
Digestive, Reproductive, Respiratory 1733 HLHCF14
Connective/Epithelial, Respiratory 1734 HLHCG24 Cancer 1735 HLHCH20
Cancer 1736 HLHCN51 Digestive, Immune/Hematopoietic, Respiratory
1737 HLHCT96 Cancer 1738 HLHDC33 Immune/Hematopoietic,
Reproductive, Respiratory 1739 HLHDF92 Cancer 1740 HLHDJ05
Respiratory 1741 HLHDL37 Respiratory 1742 HLHDL69 Cancer 1743
HLHDL69 Cancer 1744 HLHDL69 Cancer 1745 HLHDL69 Cancer 1746 HLHDM38
Cancer 1747 HLHDR92 Neural/Sensory, Respiratory 1748 HLHDY94 Cancer
1749 HLHEE27 Cancer 1750 HLHEE38 Connective/Epithelial,
Neural/Sensory, Respiratory 1751 HLHEI72 Musculoskeletal,
Respiratory 1752 HLHEX62 Excretory, Immune/Hematopoietic,
Respiratory 1753 HLHFK59 Digestive, Respiratory 1754 HLHFP09 Cancer
1755 HLHGG78 Cancer 1756 HLHSG15 Cancer 1757 HLHSQ35 Respiratory
1758 HLHTB92 Immune/Hematopoietic, Respiratory 1759 HLHTP55 Cancer
1760 HLIBD74 Digestive 1761 HLIBE41 Digestive,
Immune/Hematopoietic, Reproductive 1762 HLIBO16 Digestive,
Immune/Hematopoietic 1763 HLJBI22 Cancer 1764 HLJEE16 Cancer 1765
HLLAX64 Cancer 1766 HLLAX95 Immune/Hematopoietic 1767 HLLCD67
Immune/Hematopoietic 1768 HLMBX89 Cancer 1769 HLMBZ14
Immune/Hematopoietic 1770 HLMCT51 Immune/Hematopoietic,
Reproductive 1771 HLMCT95 Cancer 1772 HLMDD65 Cancer 1773 HLMDH01
Immune/Hematopoietic 1774 HLMDU23 Immune/Hematopoietic 1775 HLMFB62
Immune/Hematopoietic 1776 HLMFG52 Immune/Hematopoietic 1777 HLMFU53
Cancer 1778 HLMHG68 Cancer
1779 HLMHN06 Immune/Hematopoietic, Neural/Sensory 1780 HLMHS15
Immune/Hematopoietic 1781 HLMIM84 Cancer 1782 HLMIN52 Cancer 1783
HLMIQ83 Immune/Hematopoietic 1784 HLMIW76 Immune/Hematopoietic 1785
HLMMA65 Immune/Hematopoietic 1786 HLMMT12 Digestive,
Immune/Hematopoietic 1787 HLMNA19 Cardiovascular,
Immune/Hematopoietic 1788 HLQAD72 Cancer 1789 HLQAM30 Cancer 1790
HLQAM59 Digestive 1791 HLQBB23 Cancer 1792 HLQBF05 Digestive,
Reproductive 1793 HLQBX64 Cancer 1794 HLQCY09 Digestive 1795
HLQCZ43 Cancer 1796 HLQCZ80 Digestive 1797 HLQDK45 Digestive 1798
HLQDM47 Digestive 1799 HLQDU77 Cancer 1800 HLSAD72
Connective/Epithelial 1801 HLTCJ67 Immune/Hematopoietic 1802
HLTCM28 Immune/Hematopoietic, Respiratory 1803 HLTCO22 Cancer 1804
HLTDA14 Immune/Hematopoietic 1805 HLTDC26 Cancer 1806 HLTDC26
Cancer 1807 HLTDI20 Cancer 1808 HLTDI65 Immune/Hematopoietic 1809
HLTDK30 Cancer 1810 HLTDL37 Cancer 1811 HLTDU35 Cancer 1812 HLTDX04
Cancer 1813 HLTEH84 Cancer 1814 HLTEL39 Cardiovascular,
Immune/Hematopoietic 1815 HLTEN11 Cancer 1816 HLTEW52
Immune/Hematopoietic 1817 HLTEZ36 Cancer 1818 HLTGG14 Cancer 1819
HLUAF94 Immune/Hematopoietic 1820 HLWAH33 Mixed Fetal, Reproductive
1821 HLWAO11 Cancer 1822 HLWAW73 Cancer 1823 HLWAX50 Cancer 1824
HLWBJ93 Cancer 1825 HLWBK16 Cardiovascular, Connective/Epithelial,
Reproductive 1826 HLWCC11 Reproductive 1827 HLYAH81
Immune/Hematopoietic 1828 HLYAH92 Immune/Hematopoietic 1829 HLYAJ79
Cancer 1830 HLYAL28 Immune/Hematopoietic 1831 HLYAR30 Cancer 1832
HLYAT54 Immune/Hematopoietic 1833 HLYBC81 Connective/Epithelial,
Immune/Hematopoietic, Reproductive 1834 HLYBD09
Immune/Hematopoietic 1835 HLYBL67 Immune/Hematopoietic 1836 HLYBM38
Digestive, Immune/Hematopoietic 1837 HLYBN23 Immune/Hematopoietic
1838 HLYBN71 Immune/Hematopoietic 1839 HLYBS25 Digestive,
Immune/Hematopoietic, Reproductive 1840 HLYBT28
Immune/Hematopoietic 1841 HLYBU15 Immune/Hematopoietic 1842 HLYBY04
Immune/Hematopoietic 1843 HLYCE15 Digestive, Immune/Hematopoietic
1844 HLYCH04 Immune/Hematopoietic 1845 HLYCY48 Immune/Hematopoietic
1846 HLYDE38 Immune/Hematopoietic 1847 HLYDG55 Immune/Hematopoietic
1848 HLYDO73 Immune/Hematopoietic 1849 HLYEA60 Cancer 1850 HLYEJ14
Cancer 1851 HLYEJ44 Cancer 1852 HLYEU51 Immune/Hematopoietic 1853
HLYGV19 Cancer 1854 HMABK52 Immune/Hematopoietic 1855 HMACF34
Immune/Hematopoietic 1856 HMACL77 Cancer 1857 HMACT74
Immune/Hematopoietic 1858 HMADJ14 Connective/Epithelial,
Immune/Hematopoietic, Musculoskeletal 1859 HMADJ74
Connective/Epithelial, Immune/Hematopoietic, Musculoskeletal 1860
HMAEA58 Cancer 1861 HMAGF01 Cancer 1862 HMAJS26 Cancer 1863 HMCED78
Cancer 1864 HMCFN86 Cancer 1865 HMCGJ47 Cancer 1866 HMCGK88 Cancer
1867 HMCIH27 Cancer 1868 HMCIQ20 Cardiovascular,
Immune/Hematopoietic, Neural/Sensory 1869 HMCJC19
Immune/Hematopoietic 1870 HMDAB44 Neural/Sensory 1871 HMDAE88
Neural/Sensory 1872 HMDAG62 Cancer 1873 HMDAK20 Neural/Sensory 1874
HMDAM08 Neural/Sensory 1875 HMDAM39 Neural/Sensory 1876 HMEAA41
Cancer 1877 HMECM77 Cardiovascular 1878 HMEEH21 Cardiovascular 1879
HMEET36 Cancer 1880 HMEEZ07 Cardiovascular, Reproductive 1881
HMEFB15 Cardiovascular 1882 HMEIH57 Cardiovascular,
Immune/Hematopoietic 1883 HMEIJ21 Cancer 1884 HMEIX79 Cancer 1885
HMEJC96 Cancer 1886 HMEJD36 Cardiovascular, Endocrine,
Immune/Hematopoietic 1887 HMEJK28 Cancer 1888 HMEKH55 Cancer 1889
HMEKW44 Cardiovascular, Immune/Hematopoietic, Neural/Sensory 1890
HMEKW71 Cancer 1891 HMELW26 Cancer 1892 HMGBT32 Cancer 1893 HMHBI09
Cancer 1894 HMHBI93 Cancer 1895 HMHBP74 Cancer 1896 HMIAC52 Cancer
1897 HMIAD75 Neural/Sensory 1898 HMIAG42 Cancer 1899 HMIAG55 Cancer
1900 HMIAG72 Cancer 1901 HMIAL39 Cancer 1902 HMIAO82 Cancer 1903
HMIAR42 Cancer 1904 HMLAV33 Immune/Hematopoietic, Mixed Fetal,
Neural/Sensory 1905 HMIAZ24 Cancer 1906 HMIBD93 Cancer 1907 HMIBE95
Neural/Sensory 1908 HMIBG57 Immune/Hematopoietic, Neural/Sensory,
Reproductive 1909 HMJAC12 Neural/Sensory 1910 HMKAN71 Cancer 1911
HMKBA33 Neural/Sensory 1912 HMKCI22 Cancer 1913 HMKCK32
Neural/Sensory 1914 HMKCP81 Cancer 1915 HMKCY49
Immune/Hematopoietic, Neural/Sensory 1916 HMKDD51 Neural/Sensory
1917 HMKDG69 Cardiovascular, Neural/Sensory 1918 HMKDM80
Neural/Sensory 1919 HMKEG88 Neural/Sensory 1920 HMMAA09
Immune/Hematopoietic 1921 HMMAK92 Immune/Hematopoietic 1922 HMMAL32
Immune/Hematopoietic 1923 HMMBD19 Immune/Hematopoietic,
Reproductive 1924 HMMBF22 Immune/Hematopoietic, Reproductive 1925
HMMBH91 Immune/Hematopoietic 1926 HMMBH94 Immune/Hematopoietic 1927
HMMBK55 Immune/Hematopoietic 1928 HMMBQ31 Cardiovascular,
Immune/Hematopoietic 1929 HMMBR63 Cancer 1930 HMMBS55
Immune/Hematopoietic, Reproductive 1931 HMMBT47
Immune/Hematopoietic 1932 HMMCD35 Immune/Hematopoietic 1933 HMMCD95
Immune/Hematopoietic, Neural/Sensory 1934 HMPAB26 Cancer 1935
HMPAP48 Immune/Hematopoietic 1936 HMQAI38 Immune/Hematopoietic,
Reproductive 1937 HMQAT69 Cancer 1938 HMQBL90 Digestive,
Immune/Hematopoietic 1939 HMQBV82 Immune/Hematopoietic,
Musculoskeletal, Reproductive 1940 HMQCA75 Cancer 1941 HMQCB37
Cancer 1942 HMQCL80 Immune/Hematopoietic 1943 HMQCX41
Immune/Hematopoietic 1944 HMQDM09 Cancer 1945 HMQDU07 Digestive,
Immune/Hematopoietic, Musculoskeletal 1946 HMSAP33
Immune/Hematopoietic 1947 HMSAZ48 Immune/Hematopoietic 1948 HMSBN18
Cancer 1949 HMSBS25 Immune/Hematopoietic 1950 HMSBU14
Immune/Hematopoietic 1951 HMSBZ10 Immune/Hematopoietic 1952 HMSCB94
Immune/Hematopoietic, Reproductive 1953 HMSCK12
Immune/Hematopoietic 1954 HMSCP63 Immune/Hematopoietic 1955 HMSCV75
Immune/Hematopoietic 1956 HMSCV85 Immune/Hematopoietic,
Reproductive 1957 HMSCW44 Immune/Hematopoietic, Mixed Fetal,
Neural/Sensory 1958 HMSCZ19 Cancer 1959 HMSDI67 Digestive,
Immune/Hematopoietic 1960 HMSDI79 Cancer 1961 HMSDR28 Cancer 1962
HMSFT25 Immune/Hematopoietic 1963 HMSFW52 Immune/Hematopoietic 1964
HMSGT73 Immune/Hematopoietic 1965 HMSGU30 Cancer 1966 HMSHB42
Cancer 1967 HMSHB42 Cancer 1968 HMSHN72 Immune/Hematopoietic,
Reproductive 1969 HMSHT29 Immune/Hematopoietic 1970 HMSHW73
Immune/Hematopoietic 1971 HMSIC48 Cardiovascular,
Immune/Hematopoietic 1972 HMSII36 Immune/Hematopoietic 1973 HMSIT42
Digestive, Immune/Hematopoietic, Neural/Sensory 1974 HMSJB08 Cancer
1975 HMSJI69 Immune/Hematopoietic 1976 HMSJM20
Immune/Hematopoietic
1977 HMSJR44 Immune/Hematopoietic 1978 HMSKQ91 Immune/Hematopoietic
1979 HMSKY45 Immune/Hematopoietic 1980 HMTAF92 Cancer 1981 HMTAT36
Cancer 1982 HMUAB93 Cancer 1983 HMUAD65 Immune/Hematopoietic,
Musculoskeletal 1984 HMUAT23 Cancer 1985 HMUBA47 Cancer 1986
HMUBJ22 Cancer 1987 HMUBK53 Cancer 1988 HMUBN24 Musculoskeletal
1989 HMUBO15 Cancer 1990 HMUBX48 Musculoskeletal, Reproductive 1991
HMUBY57 Cancer 1992 HMUBZ15 Cancer 1993 HMVAL15 Cancer 1994 HMVBC84
Digestive, Immune/Hematopoietic, Neural/Sensory 1995 HMVBD68 Cancer
1996 HMVCG17 Immune/Hematopoietic 1997 HMVCS92 Cancer 1998 HMVCS92
Cancer 1999 HMVDB45 Immune/Hematopoietic 2000 HMVDJ71 Cancer 2001
HMVDT89 Cancer 2002 HMVDT89 Cancer 2003 HMWAO65 Cancer 2004 HMWAO82
Immune/Hematopoietic 2005 HMWBD74 Cancer 2006 HMWBK35 Cancer 2007
HMWBK86 Immune/Hematopoietic, Mixed Fetal 2008 HMWBL38
Connective/Epithelial, Immune/Hematopoietic 2009 HMWBM48 Cancer
2010 HMWCG28 Cancer 2011 HMWCP85 Digestive, Immune/Hematopoietic
2012 HMWDG30 Cancer 2013 HMWDU20 Cancer 2014 HMWDX57 Digestive,
Immune/Hematopoietic, Respiratory 2015 HMWDZ63 Immune/Hematopoietic
2016 HMWEA77 Immune/Hematopoietic 2017 HMWEC03 Cancer 2018 HMWEF46
Immune/Hematopoietic 2019 HMWEK43 Immune/Hematopoietic 2020 HMWEM23
Cancer 2021 HMWEM23 Cancer 2022 HMWER46 Cancer 2023 HMWEU96 Cancer
2024 HMWEX02 Cancer 2025 HMWFB65 Cancer 2026 HMWFD77
Immune/Hematopoietic 2027 HMWFO25 Immune/Hematopoietic 2028 HMWFO89
Cancer 2029 HMWGM41 Cancer 2030 HMWGO95 Immune/Hematopoietic 2031
HMWGV85 Cancer 2032 HMWGZ42 Immune/Hematopoietic 2033 HMWHR36
Immune/Hematopoietic 2034 HMWIM55 Immune/Hematopoietic 2035 HMWIQ26
Cancer 2036 HMWIU49 Cancer 2037 HMWJJ62 Cancer 2038 HMWJJ64 Cancer
2039 HNAAD76 Digestive, Immune/Hematopoietic 2040 HNAAE24 Digestive
2041 HNALD94 Cancer 2042 HNALE44 Cancer 2043 HNDAC35 Cancer 2044
HNEAA04 Immune/Hematopoietic 2045 HNEAH26 Immune/Hematopoietic,
Neural/Sensory 2046 HNEAK38 Immune/Hematopoietic 2047 HNEAK65
Cancer 2048 HNEBX72 Immune/Hematopoietic, Neural/Sensory 2049
HNEBY79 Immune/Hematopoietic 2050 HNECD52 Immune/Hematopoietic,
Neural/Sensory 2051 HNECL75 Cancer 2052 HNECX90 Cancer 2053 HNECX90
Cancer 2054 HNEDA05 Immune/Hematopoietic 2055 HNEDP75
Immune/Hematopoietic 2056 HNEDQ02 Cancer 2057 HNEDU46 Cancer 2058
HNFAD50 Cancer 2059 HNFAD50 Cancer 2060 HNFAG67 Cancer 2061 HNFCJ77
Immune/Hematopoietic, Reproductive 2062 HNFCO56 Cancer 2063 HNFCY57
Connective/Epithelial, Immune/Hematopoietic, Respiratory 2064
HNFDL89 Digestive, Immune/Hematopoietic 2065 HNFDT73 Excretory,
Immune/Hematopoietic, Reproductive 2066 HNFDU92
Immune/Hematopoietic 2067 HNFDY09 Digestive, Immune/Hematopoietic,
Neural/Sensory 2068 HNFDY31 Cancer 2069 HNFEA17 Cancer 2070 HNFEP55
Cancer 2071 HNFET12 Immune/Hematopoietic 2072 HNFFR59
Immune/Hematopoietic 2073 HNFGC51 Cancer 2074 HNFGR15
Immune/Hematopoietic 2075 HNFGW37 Immune/Hematopoietic 2076 HNFGW53
Cancer 2077 HNFHA34 Cancer 2078 HNFHD58 Cancer 2079 HNFHV68
Immune/Hematopoietic 2080 HNFIE15 Cancer 2081 HNFIE29
Immune/Hematopoietic 2082 HNFIG49 Immune/Hematopoietic 2083 HNFJE27
Immune/Hematopoietic 2084 HNFJG16 Immune/Hematopoietic 2085 HNGAC71
Digestive, Immune/Hematopoietic 2086 HNGAK42 Immune/Hematopoietic
2087 HNGAL25 Immune/Hematopoietic 2088 HNGAT83 Immune/Hematopoietic
2089 HNGAX06 Cancer 2090 HNGBB09 Immune/Hematopoietic 2091 HNGBC53
Immune/Hematopoietic 2092 HNGBD94 Immune/Hematopoietic 2093 HNGBE44
Digestive, Immune/Hematopoietic 2094 HNGBE63 Immune/Hematopoietic
2095 HNGBI83 Immune/Hematopoietic 2096 HNGBJ74 Immune/Hematopoietic
2097 HNGBP30 Immune/Hematopoietic 2098 HNGBQ61 Immune/Hematopoietic
2099 HNGBS35 Immune/Hematopoietic 2100 HNGBW25 Immune/Hematopoietic
2101 HNGCF29 Immune/Hematopoietic 2102 HNGCF64 Immune/Hematopoietic
2103 HNGDF54 Cancer 2104 HNGDH22 Immune/Hematopoietic 2105 HNGDH27
Immune/Hematopoietic 2106 HNGDN07 Immune/Hematopoietic,
Reproductive 2107 HNGDO65 Cancer 2108 HNGDR39 Immune/Hematopoietic
2109 HNGDW78 Immune/Hematopoietic 2110 HNGEA90 Immune/Hematopoietic
2111 HNGEC17 Immune/Hematopoietic 2112 HNGEE06 Immune/Hematopoietic
2113 HNGEF70 Immune/Hematopoietic 2114 HNGEF72 Immune/Hematopoietic
2115 HNGEI64 Immune/Hematopoietic 2116 HNGEJ33 Cancer 2117 HNGEK64
Immune/Hematopoietic 2118 HNGEN32 Immune/Hematopoietic 2119 HNGER85
Immune/Hematopoietic 2120 HNGES90 Immune/Hematopoietic 2121 HNGET33
Immune/Hematopoietic 2122 HNGEX18 Immune/Hematopoietic 2123 HNGEY45
Immune/Hematopoietic 2124 HNGEZ02 Immune/Hematopoietic,
Reproductive 2125 HNGEZ90 Immune/Hematopoietic 2126 HNGFA25
Immune/Hematopoietic 2127 HNGFB05 Immune/Hematopoietic 2128 HNGFD30
Immune/Hematopoietic, Mixed Fetal 2129 HNGFD31 Immune/Hematopoietic
2130 HNGFD61 Excretory, Immune/Hematopoietic 2131 HNGFG04
Immune/Hematopoietic 2132 HNGFG74 Immune/Hematopoietic 2133 HNGFH32
Immune/Hematopoietic 2134 HNGFH83 Immune/Hematopoietic 2135 HNGFI21
Cancer 2136 HNGFM31 Immune/Hematopoietic 2137 HNGFN77
Immune/Hematopoietic 2138 HNGFQ18 Immune/Hematopoietic 2139 HNGFR54
Immune/Hematopoietic 2140 HNGFT70 Immune/Hematopoietic 2141 HNGFU70
Immune/Hematopoietic 2142 HNGFV39 Immune/Hematopoietic 2143 HNGGF13
Immune/Hematopoietic 2144 HNGGK63 Immune/Hematopoietic 2145 HNGGK65
Immune/Hematopoietic, Neural/Sensory, Reproductive 2146 HNGGL11
Immune/Hematopoietic 2147 HNGGO05 Immune/Hematopoietic 2148 HNGGS92
Immune/Hematopoietic 2149 HNGGT10 Cancer 2150 HNGGT74
Immune/Hematopoietic 2151 HNGHB89 Digestive, Immune/Hematopoietic,
Reproductive 2152 HNGHD07 Immune/Hematopoietic 2153 HNGHK37
Immune/Hematopoietic 2154 HNGHM47 Immune/Hematopoietic 2155 HNGHT01
Immune/Hematopoietic, Neural/Sensory 2156 HNGHT86
Immune/Hematopoietic 2157 HNGIH40 Immune/Hematopoietic 2158 HNGIK07
Connective/Epithelial, Immune/Hematopoietic, Musculoskeletal 2159
HNGIM40 Immune/Hematopoietic 2160 HNGIM83 Immune/Hematopoietic 2161
HNGIO93 Cancer 2162 HNGIS27 Immune/Hematopoietic 2163 HNGIU16
Immune/Hematopoietic, Reproductive 2164 HNGIX91
Immune/Hematopoietic 2165 HNGJA68 Immune/Hematopoietic 2166 HNGJB57
Immune/Hematopoietic 2167 HNGJE86 Immune/Hematopoietic 2168 HNGJH26
Immune/Hematopoietic 2169 HNGJJ61 Immune/Hematopoietic 2170 HNGJL07
Immune/Hematopoietic, Neural/Sensory 2171 HNGJS66
Immune/Hematopoietic, Reproductive 2172 HNGJU60
Immune/Hematopoietic 2173 HNGKB09 Immune/Hematopoietic,
Reproductive 2174 HNGKW35 Immune/Hematopoietic 2175 HNGKY94
Immune/Hematopoietic 2176 HNGLD28 Immune/Hematopoietic 2177 HNGOY36
Immune/Hematopoietic 2178 HNHAB38 Immune/Hematopoietic,
Musculoskeletal 2179 HNHAC43 Cancer 2180 HNHAD34
Immune/Hematopoietic 2181 HNHAG83 Immune/Hematopoietic, Mixed
Fetal, Musculoskeletal 2182 HNHAH06 Immune/Hematopoietic 2183
HNHAJ65 Immune/Hematopoietic 2184 HNHAL61 Immune/Hematopoietic 2185
HNHAP58 Cancer 2186 HNHAW34 Immune/Hematopoietic
2187 HNHAW35 Immune/Hematopoietic 2188 HNHAY26 Immune/Hematopoietic
2189 HNHAY86 Immune/Hematopoietic, Neural/Sensory 2190 HNHAZ20
Immune/Hematopoietic 2191 HNHBE21 Immune/Hematopoietic 2192 HNHBE38
Cancer 2193 HNHBG18 Immune/Hematopoietic 2194 HNHBI65
Immune/Hematopoietic 2195 HNHBM16 Immune/Hematopoietic,
Neural/Sensory 2196 HNHCH78 Immune/Hematopoietic 2197 HNHCP14
Immune/Hematopoietic 2198 HNHCQ44 Immune/Hematopoietic 2199 HNHCT22
Cardiovascular, Immune/Hematopoietic 2200 HNHCT47 Cardiovascular,
Immune/Hematopoietic 2201 HNHCV48 Immune/Hematopoietic 2202 HNHCZ54
Cancer 2203 HNHDC52 Immune/Hematopoietic, Neural/Sensory 2204
HNHDD95 Immune/Hematopoietic 2205 HNHDE58 Cancer 2206 HNHDI17
Immune/Hematopoietic 2207 HNHDL37 Immune/Hematopoietic 2208 HNHDM21
Immune/Hematopoietic 2209 HNHDR57 Immune/Hematopoietic 2210 HNHDR96
Immune/Hematopoietic 2211 HNHDU62 Immune/Hematopoietic 2212 HNHDW34
Immune/Hematopoietic 2213 HNHDX28 Immune/Hematopoietic 2214 HNHDZ06
Immune/Hematopoietic 2215 HNHDZ42 Immune/Hematopoietic 2216 HNHEF37
Immune/Hematopoietic 2217 HNHEF49 Immune/Hematopoietic 2218 HNHEF70
Immune/Hematopoietic 2219 HNHEG30 Immune/Hematopoietic 2220 HNHEH38
Immune/Hematopoietic 2221 HNHEL22 Immune/Hematopoietic 2222 HNHEN70
Cancer 2223 HNHEP21 Immune/Hematopoietic 2224 HNHEP41
Immune/Hematopoietic 2225 HNHES33 Immune/Hematopoietic,
Reproductive 2226 HNHET16 Immune/Hematopoietic 2227 HNHEY29
Immune/Hematopoietic 2228 HNHEZ76 Immune/Hematopoietic 2229 HNHFF60
Immune/Hematopoietic 2230 HNHFF81 Immune/Hematopoietic,
Neural/Sensory 2231 HNHFJ49 Immune/Hematopoietic 2232 HNHFR42
Immune/Hematopoietic 2233 HNHFX25 Immune/Hematopoietic,
Musculoskeletal 2234 HNHGD95 Cardiovascular, Immune/Hematopoietic
2235 HNHGR82 Immune/Hematopoietic 2236 HNHGS62 Immune/Hematopoietic
2237 HNHGY77 Cancer 2238 HNHHA47 Digestive, Immune/Hematopoietic,
Respiratory 2239 HNHHN22 Immune/Hematopoietic 2240 HNHHW53
Immune/Hematopoietic 2241 HNHIB40 Immune/Hematopoietic 2242 HNHKI74
Immune/Hematopoietic 2243 HNHKV56 Immune/Hematopoietic 2244 HNHLD80
Immune/Hematopoietic 2245 HNHLS76 Immune/Hematopoietic 2246 HNHLZ47
Immune/Hematopoietic 2247 HNHMP15 Immune/Hematopoietic 2248 HNHMP62
Immune/Hematopoietic 2249 HNHMY76 Immune/Hematopoietic,
Reproductive 2250 HNHMZ01 Immune/Hematopoietic 2251 HNHND14
Immune/Hematopoietic 2252 HNHND94 Immune/Hematopoietic 2253 HNHOF09
Immune/Hematopoietic 2254 HNKAA76 Cancer 2255 HNTAF42 Cancer 2256
HNTCG32 Cancer 2257 HNTNY89 Cancer 2258 HNTRB25 Cancer 2259 HNTRQ40
Cancer 2260 HNTSQ23 Cancer 2261 HOAAH51 Cancer 2262 HOAAI76 Cancer
2263 HOAAJ09 Cancer 2264 HOAAL10 Musculoskeletal 2265 HOAAU13 Mixed
Fetal, Musculoskeletal 2266 HOABC12 Cancer 2267 HOABH36 Cancer 2268
HOBNA89 Musculoskeletal 2269 HOBNF51 Cancer 2270 HODAH24
Reproductive 2271 HODAH46 Cancer 2272 HODAV25 Cancer 2273 HODAW64
Cardiovascular, Neural/Sensory, Reproductive 2274 HODAY17 Cancer
2275 HODBA45 Reproductive 2276 HODBC79 Cancer 2277 HODBD79
Immune/Hematopoietic, Reproductive 2278 HODBF12 Cancer 2279 HODBF86
Digestive, Reproductive 2280 HODBF91 Cancer 2281 HODBW34 Digestive,
Immune/Hematopoietic, Reproductive 2282 HODBX93 Reproductive 2283
HODBZ06 Cancer 2284 HODCA73 Cancer 2285 HODCV86
Immune/Hematopoietic, Reproductive 2286 HODCY44 Reproductive 2287
HODDB58 Neural/Sensory, Reproductive 2288 HODDG72 Cancer 2289
HODDJ25 Cancer 2290 HODDN21 Reproductive 2291 HODDO31 Reproductive
2292 HODDQ06 Cancer 2293 HODEA20 Cancer 2294 HODEM38 Digestive,
Immune/Hematopoietic, Reproductive 2295 HODET37 Reproductive 2296
HOEBI94 Cancer 2297 HOEBJ70 Cancer 2298 HOECB33 Cancer 2299 HOECX21
Cancer 2300 HOEDE27 Musculoskeletal 2301 HOEEK81 Cancer 2302
HOEEZ62 Musculoskeletal 2303 HOEFJ26 Cancer 2304 HOEFL74
Cardiovascular, Digestive, Musculoskeletal 2305 HOFMF63 Cancer 2306
HOFMJ65 Cancer 2307 HOFMK02 Immune/Hematopoietic, Reproductive 2308
HOFMO16 Reproductive 2309 HOFMP62 Reproductive 2310 HOFMT59
Reproductive 2311 HOFMV22 Reproductive 2312 HOFND06 Digestive,
Reproductive 2313 HOFNY15 Reproductive 2314 HOFNY28 Reproductive
2315 HOFOC41 Reproductive 2316 HOGAA41 Cancer 2317 HOGAB51
Immune/Hematopoietic, Reproductive 2318 HOGAH40 Cancer 2319 HOGAP06
Immune/Hematopoietic, Reproductive 2320 HOGAR36 Reproductive 2321
HOGAR71 Cancer 2322 HOGCC26 Cancer 2323 HOGCD78 Reproductive 2324
HOGCK03 Cancer 2325 HOGCL01 Cancer 2326 HOHBB36 Cancer 2327 HOHBC57
Cancer 2328 HOHBO66 Cancer 2329 HOHBZ10 Cancer 2330 HOHCH71 Cancer
2331 HOHEB48 Musculoskeletal 2332 HONAH67 Digestive, Excretory,
Reproductive 2333 HOOAC84 Immune/Hematopoietic, Neural/Sensory,
Reproductive 2334 HOPBP13 Cancer 2335 HOQBG21 Cancer 2336 HORBI80
Cancer 2337 HORBL77 Cancer 2338 HOSBX14 Immune/Hematopoietic,
Musculoskeletal, Reproductive 2339 HOSCZ41 Cancer 2340 HOSEM81
Cancer 2341 HOSEO83 Cancer 2342 HOSFR35 Cancer 2343 HOUAZ32 Cancer
2344 HOUBC29 Connective/Epithelial, Immune/Hematopoietic,
Reproductive 2345 HOUBG39 Connective/Epithelial,
Immune/Hematopoietic, Musculoskeletal 2346 HOUCD12
Connective/Epithelial 2347 HOUDB17 Connective/Epithelial 2348
HOUDX40 Connective/Epithelial 2349 HOUEF84 Cancer 2350 HOUEJ43
Connective/Epithelial 2351 HOUGS36 Connective/Epithelial 2352
HOUHQ36 Connective/Epithelial 2353 HOUIG68 Cancer 2354 HOUIG92
Cancer 2355 HOVAD93 Reproductive 2356 HOVAE10 Cancer 2357 HOVAE36
Reproductive 2358 HOVAE82 Immune/Hematopoietic, Reproductive 2359
HOVAJ68 Reproductive 2360 HOVAW46 Musculoskeletal, Reproductive
2361 HOVBB19 Musculoskeletal, Reproductive 2362 HOVBD31 Cancer 2363
HOVBE81 Reproductive 2364 HOVBI16 Cancer 2365 HOVBS68 Cancer 2366
HOVCC73 Immune/Hematopoietic, Reproductive 2367 HOVCF30
Immune/Hematopoietic, Reproductive 2368 HOVCJ71 Reproductive 2369
HOVCN53 Reproductive 2370 HOVCO53 Reproductive 2371 HPASF94 Cancer
2372 HPBCG26 Cancer 2373 HPBCT11 Reproductive 2374 HPBDE33 Cancer
2375 HPBDE33 Cancer 2376 HPBDF31 Cancer 2377 HPCAG17
Immune/Hematopoietic, Reproductive 2378 HPCAG17
Immune/Hematopoietic, Reproductive 2379 HPCAM02
Immune/Hematopoietic, Musculoskeletal, Reproductive 2380 HPDDQ17
Endocrine 2381 HPDDQ28 Endocrine, Musculoskeletal 2382 HPDDT14
Cancer 2383 HPEAA65 Digestive, Immune/Hematopoietic, Reproductive
2384 HPEAG24 Cancer 2385 HPEBA84 Immune/Hematopoietic,
Reproductive
2386 HPEBF91 Cancer 2387 HPEBI09 Digestive, Reproductive 2388
HPFCJ75 Cancer 2389 HPFCP75 Immune/Hematopoietic, Neural/Sensory,
Reproductive 2390 HPFDB66 Cancer 2391 HPFDD28 Reproductive 2392
HPFDI47 Digestive, Reproductive 2393 HPIAF35 Reproductive 2394
HPIAK27 Cancer 2395 HPIAL55 Cancer 2396 HPIAT18 Cancer 2397 HPIAZ52
Reproductive 2398 HPIBA07 Cancer 2399 HPIBA24 Cancer 2400 HPIBI40
Cancer 2401 HPIBT19 Reproductive 2402 HPJAA82 Reproductive 2403
HPJAB75 Cancer 2404 HPJAN76 Cancer 2405 HPJAN76 Cancer 2406 HPJAU94
Immune/Hematopoietic, Reproductive 2407 HPJAW78
Immune/Hematopoietic, Musculoskeletal, Reproductive 2408 HPJBS16
Connective/Epithelial, Reproductive 2409 HPJBU04
Immune/Hematopoietic, Reproductive 2410 HPJCN83 Reproductive 2411
HPJCP75 Reproductive 2412 HPJCV35 Reproductive 2413 HPJCX13 Cancer
2414 HPLAW13 Cancer 2415 HPMAI31 Cancer 2416 HPMBI91 Reproductive
2417 HPMBT05 Reproductive 2418 HPMBW95 Cancer 2419 HPMCW10 Cancer
2420 HPMCZ18 Cancer 2421 HPMDA80 Cancer 2422 HPMDD27 Cancer 2423
HPMDF45 Excretory, Immune/Hematopoietic, Reproductive 2424 HPMDP57
Immune/Hematopoietic, Musculoskeletal, Reproductive 2425 HPMEG72
Cancer 2426 HPMFM70 Immune/Hematopoietic, Neural/Sensory,
Reproductive 2427 HPMFP48 Cancer 2428 HPMFW01 Cancer 2429 HPMGM06
Digestive, Neural/Sensory, Reproductive 2430 HPMGW43 Cancer 2431
HPMGY89 Cancer 2432 HPMKB09 Cancer 2433 HPMSH26 Cancer 2434 HPMSH96
Mixed Fetal, Reproductive 2435 HPQAJ25 Cardiovascular, Digestive,
Mixed Fetal 2436 HPQAJ27 Cancer 2437 HPQAN50 Reproductive 2438
HPQAO80 Cancer 2439 HPQAW27 Cancer 2440 HPQBC90 Cancer 2441 HPQBJ48
Cancer 2442 HPQBJ48 Cancer 2443 HPQBL67 Cancer 2444 HPQBT17 Cancer
2445 HPQCF94 Cancer 2446 HPQCI62 Cancer 2447 HPQRS74 Cancer 2448
HPRAD30 Cancer 2449 HPRCC91 Cancer 2450 HPRCF40 Cancer 2451 HPRCF50
Cancer 2452 HPRCL58 Reproductive 2453 HPRCM72 Cancer 2454 HPRCS59
Reproductive 2455 HPRCT73 Cancer 2456 HPRTH56 Cancer 2457 HPTRE80
Cancer 2458 HPTRI42 Cancer 2459 HPTRL95 Cancer 2460 HPTRQ52 Cancer
2461 HPTTH35 Cancer 2462 HPTTI65 Endocrine, Reproductive 2463
HPTTT62 Cancer 2464 HPTVH24 Cancer 2465 HPTVH59 Endocrine,
Neural/Sensory 2466 HPTVI04 Cancer 2467 HPTVI96 Cancer 2468 HPVAA15
Cancer 2469 HPVAB20 Cancer 2470 HPVAB63 Cancer 2471 HPVAF86
Reproductive 2472 HPWAH55 Digestive 2473 HPWAO89
Immune/Hematopoietic, Reproductive 2474 HPWAS27 Cancer 2475 HPWAT86
Immune/Hematopoietic, Neural/Sensory, Reproductive 2476 HPWAV82
Reproductive 2477 HPWBA36 Reproductive 2478 HPWTF23 Cancer 2479
HPWTF23 Cancer 2480 HPWTF53 Cancer 2481 HPXAB56
Immune/Hematopoietic 2482 HPZAB75 Digestive, Reproductive 2483
HRAAB26 Excretory 2484 HRAAC36 Excretory, Immune/Hematopoietic 2485
HRAAF59 Excretory 2486 HRAAG89 Cancer 2487 HRAAO40 Excretory 2488
HRAAZ12 Cancer 2489 HRABA19 Excretory, Reproductive 2490 HRABP28
Excretory, Immune/Hematopoietic 2491 HRABU56 Cardiovascular,
Excretory, Musculoskeletal 2492 HRABZ80 Excretory,
Immune/Hematopoietic, Musculoskeletal 2493 HRACB01 Excretory 2494
HRACI39 Excretory 2495 HRADU15 Excretory 2496 HRDAH04
Immune/Hematopoietic, Mixed Fetal, Musculoskeletal 2497 HRDBA20
Musculoskeletal 2498 HRDBD32 Musculoskeletal 2499 HRDBL01 Mixed
Fetal, Musculoskeletal, Neural/Sensory 2500 HRDDM85 Musculoskeletal
2501 HRDDS22 Cancer 2502 HRDEJ86 Cancer 2503 HRDEQ34
Musculoskeletal 2504 HRDFE30 Cancer 2505 HRDFT83 Musculoskeletal
2506 HRGCA01 Musculoskeletal 2507 HRGCA06 Cancer 2508 HRGSE38
Cancer 2509 HRLAT43 Cancer 2510 HRLME03 Cancer 2511 HROAN20
Cardiovascular, Digestive 2512 HROAP64 Digestive 2513 HROAS35
Digestive 2514 HROAY16 Digestive 2515 HROBJ10 Cancer 2516 HROBW46
Digestive, Immune/Hematopoietic 2517 HRODG86 Cancer 2518 HRSAL26
Cancer 2519 HRTAE88 Digestive 2520 HRTAP63 Cancer 2521 HRTAR24
Digestive, Immune/Hematopoietic 2522 HSAAN03 Cancer 2523 HSAAS05
Immune/Hematopoietic, Neural/Sensory 2524 HSAAW13 Cancer 2525
HSABA15 Cancer 2526 HSABG81 Cancer 2527 HSATA50 Cardiovascular,
Immune/Hematopoietic, Musculoskeletal 2528 HSATA61 Cancer 2529
HSATG66 Cancer 2530 HSATI91 Immune/Hematopoietic 2531 HSATR50
Digestive, Immune/Hematopoietic, Reproductive 2532 HSATT82
Immune/Hematopoietic 2533 HSATW19 Immune/Hematopoietic,
Musculoskeletal 2534 HSATW67 Excretory, Immune/Hematopoietic,
Reproductive 2535 HSATZ02 Immune/Hematopoietic, Musculoskeletal
2536 HSAUA95 Immune/Hematopoietic 2537 HSAUB89 Cancer 2538 HSAUI53
Immune/Hematopoietic 2539 HSAUV74 Cancer 2540 HSAUX39
Immune/Hematopoietic 2541 HSAVA58 Immune/Hematopoietic, Mixed Fetal
2542 HSAVE52 Immune/Hematopoietic 2543 HSAVH32 Immune/Hematopoietic
2544 HSAVM49 Immune/Hematopoietic 2545 HSAVO11
Immune/Hematopoietic, Neural/Sensory 2546 HSAVO17
Immune/Hematopoietic, Musculoskeletal 2547 HSAVQ13
Immune/Hematopoietic 2548 HSAVR85 Cancer 2549 HSAVY92
Immune/Hematopoietic, Neural/Sensory 2550 HSAVZ05 Digestive,
Immune/Hematopoictic 2551 HSAWB58 Immune/Hematopoietic 2552 HSAWH36
Immune/Hematopoietic 2553 HSAWM20 Immune/Hematopoietic 2554 HSAWM74
Cancer 2555 HSAWX70 Cancer 2556 HSAXC22 Immune/Hematopoietic 2557
HSAXI10 Digestive, Immune/Hematopoietic 2558 HSAXL49
Immune/Hematopoietic 2559 HSAXL82 Immune/Hematopoietic 2560 HSAXN57
Immune/Hematopoietic 2561 HSAXO45 Immune/Hematopoictic 2562 HSAXS06
Immune/Hematopoietic, Reproductive 2563 HSAXS22
Immune/Hematopoietic 2564 HSAYL24 Immune/Hematopoietic 2565 HSAYO82
Endocrine, Immune/Hematopoietic 2566 HSAYR62 Cancer 2567 HSAZP90
Immune/Hematopoietic 2568 HSBAJ47 Cancer 2569 HSDBI90 Digestive,
Endocrine, Neural/Sensory 2570 HSDDC55 Neural/Sensory 2571 HSDEA26
Neural/Sensory 2572 HSDEY39 Neural/Sensory 2573 HSDFF72 Cancer 2574
HSDFO08 Neural/Sensory 2575 HSDFR10 Digestive, Neural/Sensory,
Reproductive
2576 HSDGB20 Neural/Sensory 2577 HSDGH56 Cancer 2578 HSDGM01
Neural/Sensory 2579 HSDGM42 Cancer 2580 HSDGM42 Cancer 2581 HSDGM42
Cancer 2582 HSDGM42 Cancer 2583 HSDGM42 Cancer 2584 HSDGM42 Cancer
2585 HSDHD05 Neural/Sensory 2586 HSDIE51 Cancer 2587 HSDIK31 Cancer
2588 HSDIV37 Cancer 2589 HSDJC96 Cancer 2590 HSDJE77
Cardiovascular, Immune/Hematopoietic, Neural/Sensory 2591 HSDJF04
Cancer 2592 HSDJG47 Cancer 2593 HSDJH72 Connective/Epithelial,
Excretory, Neural/Sensory 2594 HSDJL07 Neural/Sensory, Reproductive
2595 HSDJR49 Neural/Sensory 2596 HSDJV24 Cancer 2597 HSDJV40
Immune/Hematopoietic, Neural/Sensory 2598 HSDKA64
Immune/Hematopoietic, Neural/Sensory 2599 HSDKE82 Neural/Sensory
2600 HSDKF96 Neural/Sensory 2601 HSDZO08 Cancer 2602 HSDZQ96
Neural/Sensory 2603 HSEBB18 Cancer 2604 HSFAM19 Cancer 2605 HSHAG54
Cancer 2606 HSHAS72 Cancer 2607 HSHAX04 Cancer 2608 HSHBT15 Cancer
2609 HSHCE85 Cancer 2610 HSIAC81 Digestive 2611 HSIAF66 Digestive
2612 HSIAP01 Digestive, Reproductive 2613 HSIDA33 Cancer 2614
HSIDA39 Digestive 2615 HSIDZ25 Cancer 2616 HSIEB64 Digestive 2617
HSIEM18 Cancer 2618 HSIFO61 Cancer 2619 HSIFO61 Cancer 2620 HSIGC63
Digestive, Immune/Hematopoietic, Reproductive 2621 HSIGM95
Digestive, Immune/Hematopoietic 2622 HSJAE76 Cancer 2623 HSJAN83
Digestive, Musculoskeletal 2624 HSJAQ10 Cancer 2625 HSJAR59
Musculoskeletal 2626 HSJAU93 Cancer 2627 HSJAY14 Cancer 2628
HSJAY14 Cancer 2629 HSJAY14 Cancer 2630 HSJAY14 Cancer 2631 HSJBB27
Musculoskeletal 2632 HSKBU03 Musculoskeletal, Neural/Sensory 2633
HSKCQ51 Cancer 2634 HSKDE13 Cancer 2635 HSKDS47 Cancer 2636 HSKHV81
Musculoskeletal 2637 HSKXB14 Cancer 2638 HSKYR49 Cancer 2639
HSKYU81 Cancer 2640 HSKYY92 Musculoskeletal 2641 HSLAB11 Cancer
2642 HSLAS96 Immune/Hematopoietic, Musculoskeletal 2643 HSLAW59
Immune/Hematopoietic, Musculoskeletal 2644 HSLCH54 Cancer 2645
HSLCH57 Cancer 2646 HSLCI86 Endocrine, Mixed Fetal, Musculoskeletal
2647 HSLCS31 Cancer 2648 HSLCS34 Cancer 2649 HSLCV16 Cancer 2650
HSLDW54 Cancer 2651 HSLEC18 Cancer 2652 HSLEG59 Musculoskeletal
2653 HSLFR59 Cancer 2654 HSLGD91 Cancer 2655 HSLGF66 Cancer 2656
HSLGF70 Musculoskeletal, Neural/Sensory 2657 HSLGP68
Musculoskeletal, Neural/Sensory 2658 HSNAB88 Cancer 2659 HSNAH56
Cancer 2660 HSNAN38 Cancer 2661 HSNAO19 Cancer 2662 HSNAQ52 Cancer
2663 HSNAT08 Cancer 2664 HSNAW06 Immune/Hematopoietic 2665 HSNAW37
Cancer 2666 HSNBJ05 Cancer 2667 HSNBO90 Cancer 2668 HSNBQ36 Cancer
2669 HSNBS39 Cancer 2670 HSOAE34 Digestive, Immune/Hematopoietic
2671 HSOAT44 Cancer 2672 HSOBB94 Cancer 2673 HSOBH11 Digestive 2674
HSOBP75 Cancer 2675 HSOBW65 Digestive 2676 HSPAA89 Digestive 2677
HSPAC13 Cancer 2678 HSPAG75 Digestive 2679 HSPAI20 Digestive,
Neural/Sensory 2680 HSPAL59 Digestive, Immune/Hematopoietic 2681
HSPAY90 Cancer 2682 HSPMF63 Cancer 2683 HSQAC69 Cancer 2684 HSQAH14
Cancer 2685 HSQAX94 Cancer 2686 HSQBL20 Cancer 2687 HSQCQ45 Cancer
2688 HSQCY74 Cancer 2689 HSQDM74 Cancer 2690 HSQEG23 Cancer 2691
HSQEG47 Cancer 2692 HSQFE72 Cancer 2693 HSQFE76 Cancer 2694 HSQFV12
Cancer 2695 HSRAA81 Cancer 2696 HSRAO56 Cancer 2697 HSRAV28
Digestive, Musculoskeletal 2698 HSRDM56 Cancer 2699 HSRDW57 Cancer
2700 HSREC72 Immune/Hematopoietic, Musculoskeletal 2701 HSREG42
Cancer 2702 HSRFD18 Cancer 2703 HSRGZ11 Cancer 2704 HSRHB59 Cancer
2705 HSSAN03 Cancer 2706 HSSCC66 Musculoskeletal 2707 HSSDI13
Musculoskeletal 2708 HSSDQ20 Musculoskeletal, Neural/Sensory 2709
HSSDX38 Musculoskeletal 2710 HSSED57 Cancer 2711 HSSEL28 Cancer
2712 HSSFP88 Cancer 2713 HSSGS62 Musculoskeletal, Reproductive 2714
HSSJA23 Cancer 2715 HSSJF26 Musculoskeletal 2716 HSSJF96
Musculoskeletal 2717 HSSJM47 Cancer 2718 HSSJW30 Cancer 2719
HSSJW30 Cancer 2720 HSSJW30 Cancer 2721 HSSMY35 Cancer 2722 HSTAL93
Connective/Epithelial 2723 HSTBG23 Connective/Epithelial 2724
HSUAF06 Immune/Hematopoietic 2725 HSUBX67 Immune/Hematopoietic 2726
HSUSB73 Immune/Hematopoietic, Reproductive 2727 HSVAC05 Cancer 2728
HSVAE42 Connective/Epithelial, Neural/Sensory 2729 HSVAL83 Cancer
2730 HSVAT36 Immune/Hematopoietic 2731 HSVAV02 Cancer 2732 HSVBA83
Endocrine, Mixed Fetal 2733 HSVBD37 Cancer 2734 HSVBN46 Cancer 2735
HSVBY62 Cancer 2736 HSVBZ53 Cancer 2737 HSVCF53 Cardiovascular,
Neural/Sensory, Reproductive 2738 HSWAZ17 Connective/Epithelial,
Reproductive, Respiratory 2739 HSWBI16 Cancer 2740 HSXAI44
Neural/Sensory 2741 HSXAJ07 Neural/Sensory 2742 HSXAS59
Neural/Sensory 2743 HSXAX20 Digestive, Mixed Fetal, Neural/Sensory
2744 HSXAY60 Cancer 2745 HSXBB78 Neural/Sensory 2746 HSXCA83 Cancer
2747 HSXCX20 Cancer 2748 HSXFG21 Cancer 2749 HSXFH82 Cancer 2750
HSYBD33 Immune/Hematopoietic 2751 HSYBR79 Cancer 2752 HSYBV44
Immune/Hematopoietic 2753 HSYBZ94 Cancer 2754 HT3AB13 Cancer 2755
HT4SB02 Immune/Hematopoietic 2756 HT4SB37 Cardiovascular,
Immune/Hematopoietic, Reproductive 2757 HT4SB81 Cancer 2758 HT4SB81
Cancer 2759 HT4SB81 Cancer 2760 HT5FX76 Cancer 2761 HTABF81 Cancer
2762 HTACX63 Immune/Hematopoietic 2763 HTADC63 Cancer 2764 HTADO61
Cancer 2765 HTADQ22 Cancer 2766 HTAEC59 Cancer 2767 HTAED89
Immune/Hematopoietic 2768 HTAEF02 Immune/Hematopoietic 2769 HTAEH58
Immune/Hematopoietic 2770 HTAEO35 Immune/Hematopoietic 2771 HTDAF68
Immune/Hematopoietic 2772 HTDAI38 Cancer 2773 HTEAJ87 Mixed Fetal,
Neural/Sensory, Reproductive 2774 HTEAN76 Cancer 2775 HTEBL56
Cancer 2776 HTECE87 Cancer 2777 HTEDF78 Reproductive 2778 HTEDT87
Cancer 2779 HTEDX05 Cancer 2780 HTEEC19 Cancer 2781 HTEGH03 Cancer
2782 HTEGH03 Cancer 2783 HTEGS48 Reproductive 2784 HTEGY81 Cancer
2785 HTEHB11 Reproductive 2786 HTEHB49 Immune/Hematopoietic,
Reproductive
2787 HTEHS91 Cancer 2788 HTEHV60 Reproductive 2789 HTEHW80
Reproductive 2790 HTEID25 Reproductive 2791 HTEIJ23 Cancer 2792
HTEIM62 Digestive, Immune/Hematopoietic, Reproductive 2793 HTEIV33
Reproductive 2794 HTEIV65 Reproductive 2795 HTEJC50 Reproductive
2796 HTEJD20 Cancer 2797 HTEJD61 Reproductive 2798 HTEJF31
Reproductive 2799 HTEJI29 Reproductive 2800 HTEJL16 Reproductive
2801 HTEJP65 Cancer 2802 HTEJY20 Cancer 2803 HTEKD35 Reproductive
2804 HTEKP82 Cardiovascular, Mixed Fetal, Reproductive 2805 HTEKV69
Reproductive 2806 HTEKZ52 Reproductive 2807 HTEQG28
Immune/Hematopoietic, Reproductive 2808 HTFOB75 Cancer 2809 HTGAA35
Immune/Hematopoietic 2810 HTGAD74 Immune/Hematopoietic,
Reproductive 2811 HTGAP05 Immune/Hematopoietic, Neural/Sensory 2812
HTGAQ29 Immune/Hematopoietic 2813 HTGAR21 Immune/Hematopoietic 2814
HTGAS70 Cancer 2815 HTGAT65 Immune/Hematopoietic, Neural/Sensory,
Reproductive 2816 HTGAU17 Immune/Hematopoietic 2817 HTGBF47
Immune/Hematopoietic 2818 HTGBK95 Cancer 2819 HTGCC01
Immune/Hematopoietic 2820 HTGCK43 Cancer 2821 HTGDS43
Immune/Hematopoietic, Neural/Sensory 2822 HTGDS92 Cancer 2823
HTGEX34 Digestive, Immune/Hematopoietic 2824 HTGFM31
Immune/Hematopoietic 2825 HTGGM37 Digestive, Immune/Hematopoietic
2826 HTGGN22 Immune/Hematopoietic 2827 HTHAA41 Cancer 2828 HTHBC58
Digestive, Immune/Hematopoietic 2829 HTHBO72 Cancer 2830 HTHBQ29
Immune/Hematopoietic 2831 HTHBT76 Cancer 2832 HTHBZ91
Immune/Hematopoietic 2833 HTHCA30 Cancer 2834 HTHCM60
Immune/Hematopoietic 2835 HTHDB20 Immune/Hematopoietic 2836 HTHDF45
Immune/Hematopoietic 2837 HTHDF86 Immune/Hematopoietic 2838 HTHDH18
Immune/Hematopoietic 2839 HTHDP65 Cancer 2840 HTHDT25
Immune/Hematopoietic 2841 HTHDV50 Immune/Hematopoietic 2842 HTJMA64
Cancer 2843 HTJMJ72 Connective/Epithelial, Immune/Hematopoietic
2844 HTLAD74 Reproductive 2845 HTLAF81 Cancer 2846 HTLBF46 Cancer
2847 HTLBF63 Cancer 2848 HTLCX82 Cancer 2849 HTLDD89 Reproductive
2850 HTLDN34 Reproductive 2851 HTLDP19 Cancer 2852 HTLDY30 Cancer
2853 HTLEJ24 Cancer 2854 HTLEJ75 Cancer 2855 HTLEJ75 Cancer 2856
HTLEP55 Cancer 2857 HTLEV80 Cancer 2858 HTLEZ57 Cancer 2859 HTLFA90
Cancer 2860 HTLGL33 Reproductive 2861 HTLGQ25 Reproductive 2862
HTLGS72 Reproductive 2863 HTLGY50 Cancer 2864 HTLHN86 Cancer 2865
HTLHN86 Cancer 2866 HTLHN86 Cancer 2867 HTLHN86 Cancer 2868 HTLIW29
Cancer 2869 HTLJC15 Cancer 2870 HTNAL14 Cancer 2871 HTNAL34
Endocrine, Reproductive 2872 HTNBJ15 Cancer 2873 HTNBJ15 Cancer
2874 HTNBJ15 Cancer 2875 HTNBJ15 Cancer 2876 HTOAC65
Immune/Hematopoietic 2877 HTOAE47 Immune/Hematopoietic 2878 HTOAK03
Cancer 2879 HTOAO58 Immune/Hematopoietic 2880 HTOAT56 Cancer 2881
HTOBG07 Immune/Hematopoietic, Musculoskeletal 2882 HTOBG62
Immune/Hematopoietic 2883 HTODA92 Cancer 2884 HTODN35
Immune/Hematopoietic 2885 HTODO45 Immune/Hematopoietic 2886 HTOEA53
Digestive, Excretory, Immune/Hematopoietic 2887 HTOEB55 Cancer 2888
HTOEB76 Immune/Hematopoietic 2889 HTOET03 Cancer 2890 HTOET03
Cancer 2891 HTOEV01 Immune/Hematopoietic, Reproductive 2892 HTOFA11
Cancer 2893 HTOFC33 Immune/Hematopoietic 2894 HTOGB79 Cancer 2895
HTOHE22 Immune/Hematopoietic 2896 HTOHG63 Cancer 2897 HTOHJ93
Immune/Hematopoietic 2898 HTOHM12 Immune/Hematopoietic,
Neural/Sensory 2899 HTOHM82 Cancer 2900 HTOHN40
Immune/Hematopoietic, Neural/Sensory 2901 HTOHR59 Digestive,
Immune/Hematopoietic, Neural/Sensory 2902 HTOHS29 Cancer 2903
HTOID65 Cancer 2904 HTOIE17 Excretory, Immune/Hematopoietic 2905
HTOIG16 Immune/Hematopoietic, Reproductive 2906 HTOIH39
Immune/Hematopoietic 2907 HTOIH51 Immune/Hematopoietic 2908 HTOJB02
Immune/Hematopoietic 2909 HTOJJ26 Connective/Epithelial, Digestive,
Immune/Hematopoietic 2910 HTOJP25 Immune/Hematopoietic 2911 HTOJS23
Immune/Hematopoietic 2912 HTOJY56 Cancer 2913 HTOJZ18
Immune/Hematopoietic 2914 HTPCG10 Cancer 2915 HTPCO75 Cancer 2916
HTPCW21 Digestive, Neural/Sensory 2917 HTPDD68 Cancer 2918 HTPDV75
Digestive, Reproductive 2919 HTSER28 Cancer 2920 HTSET62 Cancer
2921 HTSFV18 Cancer 2922 HTSGO13 Cancer 2923 HTSGO88
Immune/Hematopoietic 2924 HTTAH05 Reproductive 2925 HTTAP37
Immune/Hematopoietic, Reproductive 2926 HTTBJ38 Cancer 2927 HTTDB11
Cancer 2928 HTTDG27 Reproductive 2929 HTTDN24 Cancer 2930 HTTDO33
Cancer 2931 HTTDT67 Cancer 2932 HTTEO25 Cancer 2933 HTTEP11
Neural/Sensory, Reproductive 2934 HTTES77 Cancer 2935 HTTFD29
Reproductive 2936 HTTFG15 Cancer 2937 HTWAM19 Immune/Hematopoietic
2938 HTWBF58 Immune/Hematopoietic 2939 HTWBO30 Cancer 2940 HTWBZ57
Cancer 2941 HTWCC10 Immune/Hematopoietic 2942 HTWCE14 Cancer 2943
HTWCT76 Digestive, Immune/Hematopoietic 2944 HTWDJ17 Cancer 2945
HTWDM89 Immune/Hematopoietic 2946 HTWEA05 Immune/Hematopoietic 2947
HTWEG06 Immune/Hematopoietic 2948 HTWEQ36 Cancer 2949 HTWFA21
Immune/Hematopoietic 2950 HTWFA88 Digestive, Immune/Hematopoietic
2951 HTWFM85 Cancer 2952 HTWFO43 Cancer 2953 HTWLG39 Cancer 2954
HTXAA20 Cancer 2955 HTXAD75 Cancer 2956 HTXAR92
Immune/Hematopoietic 2957 HTXBS38 Cancer 2958 HTXBU88
Immune/Hematopoietic 2959 HTXCP27 Cancer 2960 HTXCU30 Excretory,
Immune/Hematopoietic 2961 HTXCV44 Immune/Hematopoietic,
Neural/Sensory 2962 HTXDJ21 Immune/Hematopoietic 2963 HTXDJ75
Digestive, Immune/Hematopoietic, Mixed Fetal 2964 HTXDJ85
Immune/Hematopoietic 2965 HTXDK09 Cancer 2966 HTXDO17
Immune/Hematopoietic, Neural/Sensory, Respiratory 2967 HTXDT72
Cancer 2968 HTXDU08 Cancer 2969 HTXDZ68 Immune/Hematopoietic,
Musculoskeletal 2970 HTXEN33 Immune/Hematopoietic, Reproductive
2971 HTXES13 Cancer 2972 HTXFD86 Cancer 2973 HTXGK12 Cancer 2974
HTXGL32 Immune/Hematopoietic 2975 HTXJD08 Digestive,
Immune/Hematopoietic 2976 HTXJD85 Immune/Hematopoietic 2977 HTXJE12
Cancer 2978 HTXJI59 Cancer 2979 HTXJJ92 Cancer 2980 HTXJM94 Cancer
2981 HTXJV54 Digestive, Immune/Hematopoietic, Reproductive 2982
HTXJW06 Cancer 2983 HTXKB57 Cancer 2984 HTXKH22
Immune/Hematopoietic 2985 HTXKH40 Cancer 2986 HTXKK76
Immune/Hematopoietic 2987 HTXKL53 Cancer 2988 HTXKS11
Immune/Hematopoietic 2989 HTXKS27 Cancer 2990 HTXLC05 Digestive,
Immune/Hematopoietic, Respiratory 2991 HTXLC45
Immune/Hematopoietic
2992 HTXLT36 Cancer 2993 HTXLY94 Cancer 2994 HTXNV66 Cancer 2995
HTXOL30 Immune/Hematopoietic 2996 HTXOW27 Cancer 2997 HTXPD86
Cancer 2998 HTXPT57 Digestive, Immune/Hematopoietic 2999 HTYSJ88
Endocrine, Immune/Hematopoietic 3000 HUDBE20 Reproductive 3001
HUDBK47 Immune/Hematopoietic, Reproductive 3002 HUFAB57 Cancer 3003
HUFAL17 Digestive 3004 HUFAO92 Digestive, Reproductive 3005 HUFAO94
Cancer 3006 HUFAP33 Cancer 3007 HUFAU71 Cancer 3008 HUFBK95
Digestive, Reproductive 3009 HUFBP77 Cancer 3010 HUFBV62 Cancer
3011 HUFBY96 Cancer 3012 HUFCN72 Digestive 3013 HUFEF79 Cancer 3014
HUKAD46 Endocrine, Immune/Hematopoietic, Reproductive 3015 HUKAI28
Cardiovascular, Reproductive 3016 HUKAO50 Cancer 3017 HUKCS86
Cancer 3018 HUKCS86 Cancer 3019 HUKEA22 Cancer 3020 HUKEL79 Cancer
3021 HUKEX37 Reproductive 3022 HUKFC71 Cancer 3023 HUKFV37 Cancer
3024 HUKFY09 Cancer 3025 HUNAL39 Reproductive 3026 HUSAO04 Cancer
3027 HUSAO04 Cancer 3028 HUSCA09 Cancer 3029 HUSCJ01 Cancer 3030
HUSGB23 Cancer 3031 HUSGJ09 Cardiovascular, Neural/Sensory 3032
HUSGQ57 Cancer 3033 HUSGY15 Cancer 3034 HUSHD41 Cancer 3035 HUSHK65
Cancer 3036 HUSIK45 Cancer 3037 HUSIO57 Cancer 3038 HUSIP17
Cardiovascular 3039 HUSIR70 Cancer 3040 HUSXP50 Cardiovascular,
Reproductive 3041 HUSXY93 Cancer 3042 HUSYG26 Cancer 3043 HUVCQ68
Cancer 3044 HUVDG58 Digestive, Immune/Hematopoietic, Reproductive
3045 HUVEG53 Cancer 3046 HWAAH11 Cancer 3047 HWAAQ28 Cancer 3048
HWAAY60 Cancer 3049 HWABR43 Digestive, Immune/Hematopoietic 3050
HWACH06 Cancer 3051 HWACZ33 Digestive, Immune/Hematopoietic,
Reproductive 3052 HWADV90 Immune/Hematopoietic 3053 HWAEB52 Cancer
3054 HWBAK71 Immune/Hematopoietic 3055 HWBBU75 Cancer 3056 HWBCN81
Immune/Hematopoietic, Reproductive 3057 HWBCP16
Immune/Hematopoietic 3058 HWBCX93 Cancer 3059 HWBEF34
Immune/Hematopoietic, Neural/Sensory 3060 HWFBB23 Cancer 3061
HWFBI40 Connective/Epithelial, Digestive, Immune/Hematopoietic 3062
HWHGV77 Connective/Epithelial 3063 HWHGW09 Cancer 3064 HWHHA21
Connective/Epithelial 3065 HWHPU44 Connective/Epithelial 3066
HWHRC51 Cancer 3067 HWLAT50 Cancer 3068 HWLBO67 Digestive 3069
HWLGP26 Cancer 3070 HWLHO31 Cardiovascular, Digestive 3071 HWLIL31
Cancer 3072 HWLJN08 Cancer 3073 HWLRE03 Cancer 3074 HWTAM38
Digestive, Immune/Hematopoietic, Reproductive 3075 HWTAW58 Cancer
3076 HWTBB42 Cancer 3077 HWTBC75 Cancer 3078 HWTBI25 Cancer 3079
HWTBL86 Cancer 3080 HWTBX66 Cancer 3081 HYAAC74
Immune/Hematopoietic, Musculoskeletal, Reproductive 3082 HYAAD61
Immune/Hematopoietic 3083 HYACC21 Immune/Hematopoietic 3084 HYBAP75
Cancer 3085 HYBAQ24 Cancer 3086 HYBAW56 Musculoskeletal 3087
HYBBD81 Musculoskeletal
[0168] Table 1E provides information related to biological
activities and preferred indications for polynucleotides and
polypeptides of the invention (including antibodies, agonists,
and/or antagonists thereof). Table 1E also provides information
related to assays which may be used to test polynucleotides and
polypeptides of the invention (including antibodies, agonists,
and/or antagonists thereof) for the corresponding biological
activities. The first column ("Gene No.") provides the gene number
in the application for each clone identifier. The second column
("cDNA Clone ID:") provides the unique clone identifier for each
clone as previously described and indicated in Tables 1A, 1B, 1C,
and 1D. The third column ("AA SEQ ID NO:Y") indicates the Sequence
Listing SEQ ID Number for polypeptide sequences encoded by the
corresponding cDNA clones (also as indicated in Tables 1A, 1B, and
2). The fourth column ("Biological Activity") indicates a
biological activity corresponding to the indicated polypeptides (or
polynucleotides encoding said polypeptides). The fifth column
("Exemplary Activity Assay") further describes the corresponding
biological activity and also provides information pertaining to the
various types of assays which may be performed to test,
demonstrate, or quantify the corresponding biological activity. The
sixth column ("Preferred Indictions") describes particular
embodiments of the invention as well as indications (e.g.
pathologies, diseases, disorders, abnormalities, etc.) for which
polynucleotides and polypeptides of the invention (including
antibodies, agonists, and/or antagonists thereof) may be used in
detecting, diagnosing, preventing, and/or treating.
[0169] Table 1E describes the use of, inter alia, FMAT technology
for testing or demonstrating various biological activities.
Fluorometric microvolume assay technology (FMAT) is a
fluorescence-based system which provides a means to perform
nonradioactive cell- and bead-based assays to detect activation of
cell signal transduction pathways. This technology was designed
specifically for ligand binding and immunological assays. Using
this technology, fluorescent cells or beads at the bottom of the
well are detected as localized areas of concentrated fluorescence
using a data processing system. Unbound flurophore comprising the
background signal is ignored, allowing for a wide variety of
homogeneous assays. FMAT technology may be used for peptide ligand
binding assays, immunofluorescence, apoptosis, cytotoxicity, and
bead-based immunocapture assays. See, Miraglia S et. al.,
"Homogeneous cell and bead based assays for highthroughput
screening using flourometric microvolume assay technology," Journal
of Biomolecular Screening; 4:193-204 (1999). In particular, FMAT
technology may be used to test, confirm, and/or identify the
ability of polypeptides (including polypeptide fragments and
variants) to activate signal transduction pathways. For example,
FMAT technology may be used to test, confirm, and/or identify the
ability of polypeptides to upregulate production of
immunomodulatory proteins (such as, for example, interleukins,
GM-CSF, Rantes, and Tumor Necrosis factors, as well as other
cellular regulators (e.g. insulin)).
[0170] Table 1E also describes the use of kinase assays for
testing, demonstrating, or quantifying biological activity. In this
regard, the phosphorylation and de-phosphorylation of specific
amino acid residues (e.g. Tyrosine, Serine, Threonine) on
cell-signal transduction proteins provides a fast, reversible means
for activation and de-activation of cellular signal transduction
pathways. Moreover, cell signal transduction via
phosphorylation/de-phosphorylation is crucial to the regulation of
a wide variety of cellular processes (e.g. proliferation,
differentiation, migration, apoptosis, etc.). Accordingly, kinase
assays provide a powerful tool useful for testing, confirming,
and/or identifying polypeptides (including polypeptide fragments
and variants) that mediate cell signal transduction events via
protein phosphorylation. See e.g., Forrer, P., Tamaskovic R., and
Jaussi, R. "Enzyme-Linked Immunosorbent Assay for Measurement of
JNK, ERK, and p38 Kinase Activities" Biol. Chem. 379(8-9):
1101-1110 (1998). TABLE-US-00006 LENGTHY TABLE REFERENCED HERE
US20070048297A1-20070301-T00005 Please refer to the end of the
specification for access instructions.
Table 1F:
[0171] Polynucleotides encoding polypeptides of the present
invention can be used in assays to test for one or more biological
activities. One such biological activity which may be tested
includes the ability of polynucleotides and polypeptides of the
invention to stimulate up-regulation or down-regulation of
expression of particular genes and proteins. Hence, if
polynucleotides and polypeptides of the present invention exhibit
activity in altering particular gene and protein expression
patterns, it is likely that these polynucleotides and polypeptides
of the present invention may be involved in, or capable of
effecting changes in, diseases associated with the altered gene and
protein expression profiles. Hence, polynucleotides, polypeptides,
or antibodies of the present invention could be used to treat said
associated diseases.
[0172] TaqMan.RTM. assays may be performed to assess the ability of
polynucleotides (and polypeptides they encode) to alter the
expression pattern of particular "target" genes. TaqMan.RTM.
reactions are performed to evaluate the ability of a test agent to
induce or repress expression of specific genes in different cell
types. TaqMan.RTM. gene expression quantification assays
("TaqMan.RTM. assays") are well known to, and routinely performed
by, those of ordinary skill in the art. TaqMan.RTM. assays are
performed in a two step reverse transcription/polymerase chain
reaction (RT-PCR). In the first (RT) step, cDNA is reverse
transcribed from total RNA samples using random hexamer primers. In
the second (PCR) step, PCR products are synthesized from the cDNA
using gene specific primers.
[0173] To quantify gene expression the Taqman.RTM. PCR reaction
exploits the 5' nuclease activity of AmpliTaq Gold.RTM. DNA
Polymerase to cleave a Taqman.RTM. probe (distinct from the
primers) during PCR. The Taqman.RTM. probe contains a reporter dye
at the 5'-end of the probe and a quencher dye at the 3' end of the
probe. When the probe is intact, the proximity of the reporter dye
to the quencher dye results in suppression of the reporter
fluorescence. During PCR, if the target of interest is present, the
probe specifically anneals between the forward and reverse primer
sites. AmpliTaq Fold DNA Polymerase then cleaves the probe between
the reporter and quencher when the probe hybridizes to the target,
resulting in increased fluorescence of the reporter (see FIG. 2).
Accumulation of PCR products is detected directly by monitoring the
increase in fluorescence of the reporter dye.
[0174] After the probe fragments are displaced from the target,
polymerization of the strand continues. The 3'-end of the probe is
blocked to prevent extension of the probe during PCR. This process
occurs in every cycle and does not interfere with the exponential
accumulation of product. The increase in fluorescence signal is
detected only if the target sequence is complementary to the probe
and is amplified during PCR. Because of these requirements, any
nonspecific amplification is not detected.
[0175] For test sample preparation, vector controls or constructs
containing the coding sequence for the gene of interest are
transfected into cells, such as for example 293T cells, and
supernatants collected after 48 hours. For cell treatment and RNA
isolation, multiple primary human cells or human cell lines are
used; such cells may include but are not limited to, Normal Human
Dermal Fibroblasts, Aortic Smooth Muscle, Human Umbilical Vein
Endothelial Cells, HepG2, Daudi, Jurkat, U937, Caco, and THP-1 cell
lines. Cells are plated in growth media and growth is arrested by
culturing without media change for 3 days, or by switching cells to
low serum media and incubating overnight. Cells are treated for 1,
6, or 24 hours with either vector control supernatant or sample
supernatant (or purified/partially purified protein preparations in
buffer). Total RNA is isolated; for example, by using Trizol
extraction or by using the Ambion RNAqueous.TM.-4PCR RNA isolation
system. Expression levels of multiple genes are analyzed using
Taqman.RTM., and expression in the test sample is compared to
control vector samples to identify genes induced or repressed. Each
of the above described techniques are well known to, and routinely
performed by, those of ordinary skill in the art.
[0176] Table 1F indicates particular disease classes and preferred
indications for which polynucleotides, polypeptides, or antibodies
of the present invention may be used in detecting, diagnosing,
preventing, treating and/or ameliorating said diseases and
disorders based on "target" gene expression patterns which may be
up- or down-regulated by polynucleotides (and the encoded
polypeptides) corresponding to each indicated cDNA Clone ID (shown
in Table 1F, Column 2).
[0177] Thus, in preferred embodiments, the present invention
encompasses a method of detecting, diagnosing, preventing,
treating, and/or ameliorating a disease or disorder listed in the
"Disease Class" and/or "Preferred Indication" columns of Table 1F;
comprising administering to a patient in which such detection,
diagnosis, prevention, or treatment is desired a protein, nucleic
acid, or antibody of the invention (or fragment or variant thereof)
in an amount effective to detect, diagnose, prevent, treat, or
ameliorate the disease or disorder. The first and second columns of
Table 1D show the "Gene No." and "cDNA Clone ID No.", respectively,
indicating certain nucleic acids and proteins (or antibodies
against the same) of the invention (including polynucleotide,
polypeptide, and antibody fragments or variants thereof) that may
be used in detecting, diagnosing, preventing, treating, or
ameliorating the disease(s) or disorder(s) indicated in the
corresponding row in the "Disease Class" or "Preferred Indication"
Columns of Table 1F.
[0178] In another embodiment, the present invention also
encompasses methods of detecting, diagnosing, preventing, treating,
or ameliorating a disease or disorder listed in the "Disease Class"
or "Preferred Indication" Columns of Table 1F; comprising
administering to a patient combinations of the proteins, nucleic
acids, or antibodies of the invention (or fragments or variants
thereof), sharing similar indications as shown in the corresponding
rows in the "Disease Class" or "Preferred Indication" Columns of
Table 1F.
[0179] The "Disease Class" Column of Table 1F provides a
categorized descriptive heading for diseases, disorders, and/or
conditions (more fully described below) that may be detected,
diagnosed, prevented, treated, or ameliorated by a protein, nucleic
acid, or antibody of the invention (or fragment or variant
thereof).
[0180] The "Preferred Indication" Column of Table 1F describes
diseases, disorders, and/or conditions that may be detected,
diagnosed, prevented, treated, or ameliorated by a protein, nucleic
acid, or antibody of the invention (or fragment or variant
thereof).
[0181] The "Cell Line" and "Exemplary Targets" Columns of Table 1F
indicate particular cell lines and target genes, respectively,
which may show altered gene expression patterns (i.e., up- or
down-regulation of the indicated target gene) in Taqman.RTM.
assays, performed as described above, utilizing polynucleotides of
the cDNA Clone ID shown in the corresponding row. Alteration of
expression patterns of the indicated "Exemplary Target" genes is
correlated with a particular "Disease Class" and/or "Preferred
Indication" as shown in the corresponding row under the respective
column headings.
[0182] The "Exemplary Accessions" Column indicates GenBank
Accessions (available online through the National Center for
Biotechnology Information (NCBI) at http://www.ncbi.nlm.nih.gov/)
which correspond to the "Exemplary Targets" shown in the adjacent
row.
[0183] The recitation of "Cancer" in the "Disease Class" Column
indicates that the corresponding nucleic acid and protein, or
antibody against the same, of the invention (or fragment or variant
thereof) may be used for example, to detect, diagnose, prevent,
treat, and/or ameliorate neoplastic diseases and/or disorders
(e.g., leukemias, cancers, etc., as described below under
"Hyperproliferative Disorders").
[0184] The recitation of "Immune" in the "Disease Class" column
indicates that the corresponding nucleic acid and protein, or
antibody against the same, of the invention (or fragment or variant
thereof), may be used for example, to detect, diagnose, prevent,
treat, and/or ameliorate diseases and/or disorders relating to
neoplastic diseases (e.g., as described below under
"Hyperproliferative Disorders"), blood disorders (e.g., as
described below under "Immune Activity" "Cardiovascular Disorders"
and/or "Blood-Related Disorders"), and infections (e.g., as
described below under "Infectious Disease").
[0185] The recitation of "Angiogenesis" in the "Disease Class"
column indicates that the corresponding nucleic acid and protein,
or antibody against the same, of the invention (or fragment or
variant thereof), may be used for example, to detect, diagnose,
treat, prevent, and/or ameliorate diseases and/or disorders
relating to neoplastic diseases (e.g., as described below under
"Hyperproliferative Disorders"), diseases and/or disorders of the
cardiovascular system (e.g., as described below under
"Cardiovascular Disorders"), diseases and/or disorders involving
cellular and genetic abnormalities (e.g., as described below under
"Diseases at the Cellular Level"), diseases and/or disorders
involving angiogenesis (e.g., as described below under
"Anti-Angiogenesis Activity"), to promote or inhibit cell or tissue
regeneration (e.g., as described below under "Regeneration"), or to
promote wound healing (e.g., as described below under "Wound
Healing and Epithelial Cell Proliferation").
[0186] The recitation of "Diabetes" in the "Disease Class" column
indicates that the corresponding nucleic acid and protein, or
antibody against the same, of the invention (or fragment or variant
thereof), may be used for example, to detect, diagnose, treat,
prevent, and/or ameliorate diabetes (including diabetes mellitus
types I and II), as well as diseases and/or disorders associated
with, or consequential to, diabetes (e.g. as described below under
"Endocrine Disorders," "Renal Disorders," and "Gastrointestinal
Disorders"). TABLE-US-00007 TABLE 1F Gene cDNA Disease Exemplary
No. Clone ID Class Preferred Indications Cell Line Targets
Exemplary Accessions 423 HTEEW69 Immune Highly preferred
indications include AOSMC CCR7 gb|X84702|HSDNABLR2 immunological
disorders such as described herein CXCR3 gb|Z79783|HSCKRL2 under
the heading "Immune Activity" and/or Rag2 gb|AY011962|AY011962
"Blood-Related Disorders" (particularly VLA4 gb|X16983|HSINTAL4
including, but not limited to, immune disorders involving muscle
tissues and the cardiovascular system (e.g. heart, lungs,
circulatory system)). Highly preferred embodiments of the invention
include methods of preventing, detecting, diagnosing, treating
and/or ameliorating disorders of the immune system (particularly
including, but not limited to, immune disorders involving muscle
tissue or the cardiovascular system). (AOSMC cells are human aortic
smooth muscle cells). 423 HTEEW69 Immune Highly preferred
indications include Caco-2 TNF gb|AJ270944|HSA27094 immunological
disorders such as described herein under the heading "Immune
Activity" and/or "Blood-Related Disorders" (particularly including,
but not limited to, immune disorders involving the cells of the
gastrointestinal tract). Highly preferred embodiments of the
invention include methods of preventing, detecting, diagnosing,
treating and/or ameliorating disorders of the immune system
(particularly including, but not limited to, immune disorders
involving cells of the gastrointestinal tract). (The Caco-2 cell
line is a human colorectal adenocarcinoma cell line available
through the ATCC as cell line number HTB-37). 423 HTEEW69 Immune
Highly preferred indications include Daudi GATA3 gb|X55037|HSGATA3
immunological disorders such as described herein ICAM
gb|X06990|HSICAM1 under the heading "Immune Activity" and/or TNF
gb|AJ270944|HSA27094 "Blood-Related Disorders" (particularly
including, but not limited to, immune disorders involving the
B-cells). Highly preferred embodiments of the invention include
methods of preventing, detecting, diagnosing, treating and/or
ameliorating disorders of the immune system (particularly
including, but not limited to, immune disorders involving B-cells).
(The Daudi cell line is a human B lymphoblast cell line available
through the ATCC as cell line number CCL-213). 423 HTEEW69 Immune
Highly preferred indications include HEK293 TNF
gb|AJ270944|HSA27094 immunological disorders such as described
herein under the heading "Immune Activity" and/or "Blood-Related
Disorders" (particularly including, but not limited to, immune
disorders involving epithelial cells or the renal system). Highly
preferred embodiments of the invention include methods of
preventing, detecting, diagnosing, treating and/or ameliorating
disorders of the immune system (particularly including, but not
limited to, immune disorders involving epithelial cells or the
renal system). (The 293 cell line is a human embryonal kidney
epithelial cell line available through the ATCC as cell line number
CRL-1573). 423 HTEEW69 Immune Highly preferred indications include
Liver ICAM gb|X06990|HSICAM1 immunological disorders such as
described herein under the heading "Immune Activity" and/or
"Blood-Related Disorders" (particularly including, but not limited
to, immune disorders involving cells of the hepatic system). Highly
preferred embodiments of the invention include methods of
preventing, detecting, diagnosing, treating and/or ameliorating
disorders of the immune system (particularly including, but not
limited to, immune disorders involving cells of the hepatic
system). 423 HTEEW69 Immune Highly preferred indications include
NHDF CIS3 gb|AB006967|AB006967 immunological disorders such as
described herein TNF gb|AJ270944|HSA27094 under the heading "Immune
Activity" and/or "Blood-Related Disorders" (particularly including,
but not limited to, immune disorders involving the skin). Highly
preferred embodiments of the invention include methods of
preventing, detecting, diagnosing, treating and/or ameliorating
disorders of the immune system (particularly including, but not
limited to, immune disorders involving the skin). (NHDF cells are
normal human dermal fibroblasts). 423 HTEEW69 Immune Highly
preferred indications include SK-N-MC TNF gb|AJ270944|HSA27094
immunological disorders such as described herein neuroblastoma VCAM
gb|A30922|A30922 under the heading "Immune Activity" and/or
"Blood-Related Disorders" (particularly including, but not limited
to, immune disorders involving the central nervous system). Highly
preferred embodiments of the invention include methods of
preventing, detecting, diagnosing, treating and/or ameliorating
disorders of the immune system (particularly including, but not
limited to, immune disorders involving the central nervous sytem).
(The SK-N-MC neuroblastoma cell line is a cell line derived from
human brain tissue and is available through the ATCC as cell line
number HTB-10). 423 HTEEW69 Immune Highly preferred indications
include THP1 CD25 gb|X03137|HSIL2RG7 immunological disorders such
as described herein CD40 gb|AJ300189|HSA30018 under the heading
"Immune Activity" and/or GATA3 gb|X55037|HSGATA3 "Blood-Related
Disorders" (particularly LTBR gb|AK027080|AK027080 including, but
not limited to, immune disorders Rag1 gb|M29474|HUMRAG1 involving
monocytes). Highly preferred embodiments of the invention include
methods of preventing, detecting, diagnosing, treating and/or
ameliorating disorders of the immune system (particularly
including, but not limited to, immune disorders involving
monocytes). (The THP1 cell line is a human monocyte cell line
available through the ATCC as cell line number TIB-202). 423
HTEEW69 Immune Highly preferred indications include U937 IL1B
gb|X02532|HSIL1BR immunological disorders such as described herein
TNF gb|AJ270944|HSA27094 under the heading "Immune Activity" and/or
"Blood-Related Disorders" (particularly including, but not limited
to, immune disorders involving monocytes). Highly preferred
embodiments of the invention include methods of preventing,
detecting, diagnosing, treating and/or ameliorating disorders of
the immune system (particularly including, but not limited to,
immune disorders involving monocytes). (The U937 cell line is a
human monocyte cell line available through the ATCC; cell
#CRL-1593.2). 878 HCEGG08 Immune Highly preferred indications
include AOSMC CIS3 gb|AB006967|AB006967 immunological disorders
such as described herein Granzyme gb|J04071|HUMCSE under the
heading "Immune Activity" and/or B "Blood-Related Disorders"
(particularly IL1B gb|X02532|HSIL1BR including, but not limited to,
immune disorders IL5 gb|X12705|HSBCDFIA involving muscle tissues
and the cardiovascular system (e.g. heart, lungs, circulatory
system)). Highly preferred embodiments of the invention include
methods of preventing, detecting, diagnosing, treating and/or
ameliorating disorders of the immune system (particularly
including, but not limited to, immune disorders involving muscle
tissue or the cardiovascular system). (AOSMC cells are human aortic
smooth muscle cells). 878 HCEGG08 Immune Highly preferred
indications include HEK293 ICAM gb|X06990|HSICAM1 immunological
disorders such as described herein under the heading "Immune
Activity" and/or "Blood-Related Disorders" (particularly including,
but not limited to, immune disorders involving epithelial cells or
the renal system). Highly preferred embodiments of the invention
include methods of preventing, detecting, diagnosing, treating
and/or ameliorating disorders of the immune system (particularly
including, but not limited to, immune disorders involving
epithelial cells or the renal system). (The 293 cell line is a
human embryonal kidney epithelial cell line available through the
ATCC as cell line number CRL-1573). 878 HCEGG08 Immune Highly
preferred indications include HUVEC CCR7 gb|X84702|HSDNABLR2
immunological disorders such as described herein TNF
gb|AJ270944|HSA27094 under the heading "Immune Activity" and/or
"Blood-Related Disorders" (particularly including, but not limited
to, immune disorders involving endothelial cells). Highly preferred
embodiments of the invention include methods of preventing,
detecting, diagnosing, treating and/or ameliorating disorders of
the immune system (particularly including, but not limited to,
immune disorders involving endothelial cells). (HUVEC cells are
human umbilical vein endothelial cells). 878 HCEGG08 Immune Highly
preferred indications include Jurkat GATA1 gb|X17254|HSERYF1
immunological disorders such as described herein Rag1
gb|M29474|HUMRAG1 under the heading "Immune Activity" and/or Rag2
gb|AY011962|AY011962 "Blood-Related Disorders" (particularly
including, but not limited to, immune disorders involving T-cells).
Highly preferred embodiments of the invention include methods of
preventing, detecting, diagnosing, treating and/or ameliorating
disorders of the immune system (particularly including, but not
limited to, immune disorders involving T-cells). (The Jurkat cell
line is a human T lymphocyte cell line available through the ATCC;
cell line #TIB-152). 878 HCEGG08 Immune Highly preferred
indications include Liver ICAM gb|X06990|HSICAM1 immunological
disorders such as described herein under the heading "Immune
Activity" and/or "Blood-Related Disorders" (particularly including,
but not limited to, immune disorders involving cells of the hepatic
system). Highly preferred embodiments of the invention include
methods of preventing, detecting, diagnosing, treating and/or
ameliorating disorders of the immune system (particularly
including, but not limited to, immune disorders involving cells of
the hepatic system). 878 HCEGG08 Immune Highly preferred
indications include NHDF HLA-c immunological disorders such as
described herein under the heading "Immune Activity" and/or
"Blood-Related Disorders" (particularly including, but not limited
to, immune disorders involving the skin). Highly preferred
embodiments of the invention include methods of preventing,
detecting, diagnosing, treating and/or ameliorating disorders of
the immune system (particularly including, but not limited to,
immune disorders involving the skin). (NHDF cells are normal human
dermal fibroblasts). 878 HCEGG08 Immune Highly preferred
indications include SK-N-MC HLA-c immunological disorders such as
described herein neuroblastoma VCAM gb|A30922|A30922 under the
heading "Immune Activity" and/or "Blood-Related Disorders"
(particularly including, but not limited to, immune disorders
involving the central nervous system). Highly preferred embodiments
of the invention include methods of preventing, detecting,
diagnosing, treating and/or ameliorating disorders of the immune
system (particularly including, but not limited to, immune
disorders involving the central nervous sytem). (The SK-N-MC
neuroblastoma cell line is a cell line derived from human brain
tissue and is available through the ATCC as cell line number
HTB-10). 878 HCEGG08 Immune Highly preferred indications include
THP1 CCR3 gb|AB023887|AB023887 immunological disorders such as
described herein CCR4 gb|AB023888|AB023888 under the heading
"Immune Activity" and/or CTLA4 gb|AF316875|AF316875 "Blood-Related
Disorders" (particularly Granzyme gb|J04071|HUMCSE including, but
not limited to, immune disorders B involving monocytes). Highly
preferred Rag2 gb|AY011962|AY011962 embodiments of the invention
include methods of VCAM gb|A30922|A30922 preventing, detecting,
diagnosing, treating and/or ameliorating disorders of the immune
system (particularly including, but not limited to, immune
disorders involving monocytes). (The THP1 cell line is a human
monocyte cell line available through the ATCC as cell line number
TIB-202). 878 HCEGG08 Immune Highly preferred indications include
U937 CCR5 gb|AF161918|AF161918 immunological disorders such as
described herein CCR7 gb|X84702|HSDNABLR2 under the heading "Immune
Activity" and/or CD25 gb|X03137|HSIL2RG7 "Blood-Related Disorders"
(particularly CD30 including, but not limited to, immune disorders
CXCR3 gb|Z79783|HSCKRL2 involving monocytes). Highly preferred Rag1
gb|M29474|HUMRAG1 embodiments of the invention include methods of
Rag2 gb|AY011962|AY011962 preventing, detecting, diagnosing,
treating and/or ameliorating disorders of the immune system
(particularly including, but not limited to, immune disorders
involving monocytes). (The U937 cell line is a human monocyte cell
line available through the ATCC as cell line number
CRL-1593.2).
[0187] Table 2 further characterizes certain encoded polypeptides
of the invention, by providing the results of comparisons to
protein and protein family databases. The first column provides a
unique clone identifier, "Clone ID NO:", corresponding to a cDNA
clone disclosed in Table 1A and/or Table 1B. The second column
provides the unique contig identifier, "Contig ID:" which allows
correlation with the information in Table 1B. The third column
provides the sequence identifier, "SEQ ID NO:", for the contig
polynucleotide sequences. The fourth column provides the analysis
method by which the homology/identity disclosed in the Table was
determined. The fifth column provides a description of the PFAM/NR
hit identified by each analysis. Column six provides the accession
number of the PFAM/NR hit disclosed in the fifth column. Column
seven, score/percent identity, provides a quality score or the
percent identity, of the hit disclosed in column five. Comparisons
were made between polypeptides encoded by polynucleotides of the
invention and a non-redundant protein database (herein referred to
as "NR"), or a database of protein families (herein referred to as
"PFAM"), as described below.
[0188] The NR database, which comprises the NBRF PIR database, the
NCBI GenPept database, and the SIB SwissProt and TrEMBL databases,
was made non-redundant using the computer program nrdb2 (Warren
Gish, Washington University in Saint Louis). Each of the
polynucleotides shown in Table 1B, column 3 (e.g., SEQ ID NO:X or
the `Query` sequence) was used to search against the NR database.
The computer program BLASTX was used to compare a 6-frame
translation of the Query sequence to the NR database (for
information about the BLASTX algorithm please see Altshul et al.,
J. Mol. Biol. 215:403-410 (1990), and Gish and States, Nat. Genet.
3:266-272 (1993). A description of the sequence that is most
similar to the Query sequence (the highest scoring `Subject`) is
shown in column five of Table 2 and the database accession number
for that sequence is provided in column six. The highest scoring
`Subject` is reported in Table 2 if (a) the estimated probability
that the match occurred by chance alone is less than 1.0 e-07, and
(b) the match was not to a known repetitive element. BLASTX returns
alignments of short polypeptide segments of the Query and Subject
sequences which share a high degree of similarity; these segments
are known as High-Scoring Segment Pairs or HSPs. Table 2 reports
the degree of similarity between the Query and the Subject for each
HSP as a percent identity in Column 7. The percent identity is
determined by dividing the number of exact matches between the two
aligned sequences in the HSP, dividing by the number of Query amino
acids in the HSP and multiplying by 100. The polynucleotides of SEQ
ID NO:X which encode the polypeptide sequence that generates an HSP
are delineated by columns 8 and 9 of Table 2.
[0189] The PFAM database, PFAM version 2.1, (Sonnhammer, Nucl.
Acids Res., 26:320-322, 1998)) consists of a series of multiple
sequence alignments; one alignment for each protein family. Each
multiple sequence alignment is converted into a probability model
called a Hidden Markov Model, or HMM, that represents the
position-specific variation among the sequences that make up the
multiple sequence alignment (see, e.g., Durbin, et al., Biological
sequence analysis: probabilistic models of proteins and nucleic
acids, Cambridge University Press, 1998 for the theory of HMMs).
The program HMMER version 1.8 (Sean Eddy, Washington University in
Saint Louis) was used to compare the predicted protein sequence for
each Query sequence (SEQ ID NO:Y in Table 1B.1) to each of the HMMs
derived from PFAM version 2.1. A HMM derived from PFAM version 2.1
was said to be a significant match to a polypeptide of the
invention if the score returned by HMMER 1.8 was greater than 0.8
times the HMMER 1.8 score obtained with the most distantly related
known member of that protein family. The description of the PFAM
family which shares a significant match with a polypeptide of the
invention is listed in column 5 of Table 2, and the database
accession number of the PFAM hit is provided in column 6. Column 7
provides the score returned by HMMER version 1.8 for the alignment.
Columns 8 and 9 delineate the polynucleotides of SEQ ID NO:X which
encode the polypeptide sequence which show a significant match to a
PFAM protein family.
[0190] As mentioned, columns 8 and 9 in Table 2, "NT From" and "NT
To", delineate the polynucleotides of "SEQ ID NO:X" that encode a
polypeptide having a significant match to the PFAM/NR database as
disclosed in the fifth column. In one embodiment, the invention
provides a protein comprising, or alternatively consisting of, a
polypeptide encoded by the polynucleotides of SEQ ID NO:X
delineated in columns 8 and 9 of Table 2. Also provided are
polynucleotides encoding such proteins, and the complementary
strand thereto.
[0191] The nucleotide sequence SEQ ID NO:X and the translated SEQ
ID NO:Y are sufficiently accurate and otherwise suitable for a
variety of uses well known in the art and described further below.
For instance, the nucleotide sequences of SEQ ID NO:X are useful
for designing nucleic acid hybridization probes that will detect
nucleic acid sequences contained in SEQ ID NO:X or the cDNA
contained in ATCC Deposit No: Z. These probes will also hybridize
to nucleic acid molecules in biological samples, thereby enabling
immediate applications in chromosome mapping, linkage analysis,
tissue identification and/or typing, and a variety of forensic and
diagnostic methods of the invention. Similarly, polypeptides
identified from SEQ ID NO:Y may be used to generate antibodies
which bind specifically to these polypeptides, or fragments
thereof, and/or to the polypeptides encoded by the cDNA clones
identified in, for example, Table 1A and/or 1B.
[0192] Nevertheless, DNA sequences generated by sequencing
reactions can contain sequencing errors. The errors exist as
misidentified nucleotides, or as insertions or deletions of
nucleotides in the generated DNA sequence. The erroneously inserted
or deleted nucleotides cause frame shifts in the reading frames of
the predicted amino acid sequence. In these cases, the predicted
amino acid sequence diverges from the actual amino acid sequence,
even though the generated DNA sequence may be greater than 99.9%
identical to the actual DNA sequence (for example, one base
insertion or deletion in an open reading frame of over 1000
bases).
[0193] Accordingly, for those applications requiring precision in
the nucleotide sequence or the amino acid sequence, the present
invention provides not only the generated nucleotide sequence
identified as SEQ ID NO:X, and a predicted translated amino acid
sequence identified as SEQ ID NO:Y, but also a sample of plasmid
DNA containing cDNA ATCC Deposit No: Z (e.g., as set forth in
columns 2 and 3 of Table 1A and/or as set forth, for example, in
Table 1B, 6, and 7). The nucleotide sequence of each deposited
clone can readily be determined by sequencing the deposited clone
in accordance with known methods. Further, techniques known in the
art can be used to verify the nucleotide sequences of SEQ ID
NO:X.
[0194] The predicted amino acid sequence can then be verified from
such deposits. Moreover, the amino acid sequence of the protein
encoded by a particular clone can also be directly determined by
peptide sequencing or by expressing the protein in a suitable host
cell containing the deposited human cDNA, collecting the protein,
and determining its sequence. TABLE-US-00008 TABLE 2 SEQ PFam/NR
Score/ cDNA ID Analysis Accession Percent NT Clone ID Contig ID:
NO: X Method PFam/NR Description Number Identity From NT To H6BSF56
762968 11 HMMER PFAM: Zinc-binding dehydrogenases PF00107 35.6 176
415 2.1.1 WUblastx.64 (Q9BV79) SIMILAR TO CGI-63 Q9BV79 100% 25 42
PROTEIN. 92% 53 427 H6EDM64 841331 12 WUblastx.64 (Q9UID3) ANG2.
Q9UID3 90% 928 2451 36% 203 310 36% 931 1038 95% 191 871 H6EEC72
889401 13 WUblastx.64 hypothetical protein DKFZp434L061.1 -
pir|T43456|T43456 80% 1484 1203 human 41% 1277 1080 35% 973 845 34%
659 549 57% 991 365 HACBJ56 847112 15 WUblastx.64 (Q9D2Q2)
2310079F23RIK Q9D2Q2 65% 98 286 PROTEIN. HACBS22 847113 16
WUblastx.64 (O60266) ADENYLATE CYCLASE CYA3_HUMAN 89% 6 416 TYPE
III (EC 4.6.1.1) (ADENYLATE 25% 1547 2299 18% 917 1111 93% 416 2449
HADMB15 847116 19 WUblastx.64 (Q9BVH1) SIMILAR TO DLXIN-1. Q9BVH1
100% 8 109 HAGEG10 823543 22 WUblastx.64 (Q9NWT5) CDNA FLJ20618
FIS, Q9NWT5 100% 1237 1377 CLONE KAT05049. 96% 1 156 HAGFS57 847120
24 WUblastx.64 (Q9Y485) X-LIKE 1 PROTEIN. Q9Y485 58% 9 872 HAGHN57
773286 25 WUblastx.64 (O60416) WUGSC: H_RG276O03.2 O60416 98% 65
1444 PROTEIN. HAHEA15 847013 26 WUblastx.64 (Q9NWD5) HYPOTHETICAL
31.4 KDA Q9NWD5 76% 455 832 PROTEIN. 99% 30 560 HAJAA47 534670 27
WUblastx.64 (Q9NZA3) CDA14. Q9NZA3 100% 17 157 HAJAY92 845601 28
WUblastx.64 (O00549) ORF2-LIKE PROTEIN O00549 53% 2226 2318
(FRAGMENT). 26% 769 915 38% 1653 1769 31% 1721 2242 HAJBV67 866415
29 WUblastx.64 (Q9HD45) TRANSMEMBRANE 9 T9S3_HUMAN 100% 13 126
SUPERFAMILY PROTEIN 93% 116 1681 MEMBER 3 PRECU HAOAG15 852204 31
HMMER PFAM: von Willebrand factor type A PF00092 180.1 506 1057
2.1.1 domain WUblastx.64 (O75578) INTEGRIN ALPHA-10 ITAG_HUMAN 90%
8 3463 PRECURSOR. HAQCE11 633730 33 WUblastx.64 (Q24333) ELASTIN
LIKE PROTEIN Q24333 95% 61 132 (FRAGMENT). HATCB45 631172 35
WUblastx.64 (Q9D0I6) 2610014F08RIK PROTEIN. Q9D0I6 88% 490 645
HATCI03 580805 37 WUblastx.64 (Q9H743) CDNA: FLJ21394 FIS, Q9H743
71% 906 688 CLONE COL03536. HBAGD86 838799 39 WUblastx.64 (Q14287)
HYPOTHETICAL Q14287 37% 801 559 PROTEIN (FRAGMENT). HBDAB91 789532
41 WUblastx.64 (O00370) PUTATIVE P150. O00370 40% 587 513 34% 529 5
HBDAB91 864374 42 WUblastx.64 (O00370) PUTATIVE P150. O00370 40%
907 833 35% 849 307 HBGBC29 691473 43 WUblastx.64 (O60513)
BETA-1,4- B4G4_HUMAN 61% 1 78 GALACTOSYLTRANSFERASE 4 98% 65 1021
(EC 2.4.1.--) (BET HBHAA05 603174 45 WUblastx.64 (Q9H387) PRO2550.
Q9H387 71% 676 386 HBHAA81 846465 46 WUblastx.64 (Q9D1G3)
1110011D13RIK Q9D1G3 89% 1329 1502 PROTEIN. 79% 28 1329 HBIAC29
831751 48 WUblastx.64 (Q9D7J5) 2310005N01RIK Q9D7J5 78% 25 492
PROTEIN. 93% 883 927 HBJAB02 837309 50 WUblastx.64 (Q9NXT6) CDNA
FLJ20062 FIS, Q9NXT6 70% 2 1210 CLONE COL01508. HBJCR46 815649 53
HMMER PFAM: WD domain, G-beta repeat PF00400 36.6 790 867 2.1.1
WUblastx.64 (Q9DC22) 1200006M05RIK Q9DC22 96% 207 611 PROTEIN. 73%
568 2763 HBJDS79 813588 54 WUblastx.64 (Q9CY11) 2510039O18RIK
Q9CY11 92% 1119 1325 PROTEIN. 89% 1322 1519 93% 1032 1127 100% 1509
1532 66% 2 1075 HBJEL16 847030 56 WUblastx.64 (O95297) PROTEIN ZERO
O95297 98% 285 491 RELATED PROTEIN. HBJIG20 866159 58 HMMER PFAM:
Cytochrome c oxidase subunit PF00510 162.6 321 551 2.1.1 III
WUblastx.64 (BAA77671) Cytochrome c oxidase BAA77671 81% 9 617
subunit 3 (Fragment HBJKD16 853358 59 WUblastx.64 (Q9NXS4) CDNA
FLJ20080 FIS, Q9NXS4 91% 8 1528 CLONE COL03184. HBMBM96 561935 60
WUblastx.64 (Q9H387) PRO2550. Q9H387 69% 661 494 67% 794 639
HBMTX26 695704 63 WUblastx.64 (Q14288) HYPOTHETICAL Q14288 46% 964
608 PROTEIN (FRAGMENT). 61% 272 156 66% 136 101 54% 611 507 58% 546
292 HBMTY48 637521 64 WUblastx.64 (Q9H5N9) CDNA: FLJ23235 FIS,
Q9H5N9 94% 54 941 CLONE CAS04980. HBMUH74 866160 65 WUblastx.64
(Q9NVW8) CDNA FLJ10462 FIS, Q9NVW8 100% 11 427 CLONE NT2RP1001494,
WEAKLY SIMILAR TO MAL HBMWE61 778066 66 WUblastx.64 (Q9BX88)
MAGPHININ DELTA. Q9BX88 100% 302 520 95% 869 1009 HBNAX40 834801 67
WUblastx.64 (Q9H2K2) TANKYRASE-LIKE Q9H2K2 100% 1 201 PROTEIN
(TANKYRASE 2). 100% 221 481 HBQAB79 810542 69 WUblastx.64 (Q9UQ32)
AD 3 (FRAGMENT). Q9UQ32 82% 323 204 HBSAK32 856387 71 WUblastx.64
(Q9H1Q7) BA12M19.1.3 (NOVEL Q9H1Q7 100% 239 412 PROTEIN). 100% 95
172 HBXCM66 639039 72 WUblastx.64 (Q9H728) CDNA: FLJ21463 FIS,
Q9H728 65% 988 809 CLONE COL04765. 77% 836 690 HBXCX15 637542 73
WUblastx.64 (Q9GMX5) HYPOTHETICAL 12.9 KDA Q9GMX5 41% 726 827
PROTEIN. 52% 578 730 HCDCY76 837972 74 WUblastx.64 frizzled protein
4 - human pir|JC7127|JC7127 100% 1039 527 30% 994 785 79% 567 37
HCE1G78 761204 76 HMMER PFAM: Inositol polyphosphate PF00783 277.3
77 775 2.1.1 phosphatase family, catalytic domain WUblastx.64
(Q9UDT9) WUGSC: H_DJ412A9.2 Q9UDT9 72% 8 1549 PROTEIN (FRAGMENT).
95% 8 67 HCE2H52 847007 77 WUblastx.64 probable transposase - human
pir|S72481|S72481 60% 564 758 transposon MER37 77% 430 537 75% 754
1251 HCE3B04 831151 78 WUblastx.64 (O43466) HYPOTHETICAL 31.3 KDA
O43466 98% 836 1003 PROTEIN (FRAGMENT). 45% 217 972 HCEDR26 771144
80 WUblastx.64 (Q9H919) CDNA FLJ13078 FIS, Q9H919 66% 1157 1095
CLONE NT2RP3002002. 66% 1345 1184 HCEEQ25 531784 82 WUblastx.64
(P78349) SODIUM CHANNEL 2. P78349 95% 311 433 93% 433 480 100% 658
714 HCEEU18 688041 83 WUblastx.64 (Q9N083) UNNAMED PORTEIN Q9N083
49% 186 10 PRODUCT. 56% 1223 933 HCEFZ82 831745 84 WUblastx.64
(Q9BV23) SIMILAR TO LIPASE Q9BV23 95% 594 782 PROTEIN. 100% 17 604
HCFLN88 610000 86 WUblastx.64 (Q9BQE9) SIMILAR TO B-CELL Q9BQE9 87%
278 475 CLL/LYMPHOMA 7B (UNKNOWN) (PROTEIN FOR MGC HCFLT90 788578
87 WUblastx.64 (Q9CVC2) 2210013O21RIK Q9CVC2 53% 612 445 PROTEIN
(FRAGMENT). 70% 850 671 HCHAB84 834326 88 WUblastx.64 (Q9BRV3)
STROMAL CELL Q9BRV3 89% 82 744 PROTEIN. HCNSD29 862314 91
WUblastx.64 (O75400) HUNTINGTIN- O75400 82% 628 1605 INTERACTING
PROTEIN 78% 337 489 HYPA/FBP11 (FRAGMENT). HCRAY10 695709 96
WUblastx.64 (AAH08671) Similar to RIKEN cDNA AAH08671 77% 72 440
5530601I19 gene. HCRBF72 828945 97 WUblastx.64 (Q9UI95) MITOTIC
SPINDLE MD22_HUMAN 94% 191 823 ASSEMBLY CHECKPOINT PROTEIN MAD2B
HCUCF89 637986 100 WUblastx.64 (Q9P147) PRO2822. Q9P147 100% 421
398 82% 494 426 HCUCK44 790277 101 WUblastx.64 hypothetical protein
DKFZp564J157.1 - pir|T34520|T34520 100% 29 157 human (fragment)
100% 377 403 HDPDI72 897277 109 WUblastx.64 adult-specific brush
border protein - pir|C45665|C45665 64% 180 230 rabbit 83% 11 100
HDPDJ58 587265 110 WUblastx.64 hypothetical protein
pir|T42691|T42691 100% 307 609 DKFZp434D2328.1 - human 87% 621 785
(fragment) 36% 101 313 36% 307 606 36% 188 316 42% 89 172 27% 23
307 85% 14 307 37% 134 307 35% 101 307 35% 89 274 32% 137 307 36%
325 594 34% 543 671 38% 307 606 37% 322 585 28% 307 606 29% 358 606
33% 337 594 41% 487 594 37% 92 307 36% 352 606 32% 89 316 32% 340
594 30% 83 316 35% 454 606 31% 654 785 41% 624 779 31% 624 794 40%
630 785 34% 624 776 33% 630 785 34% 83 307 35% 92 286 34% 1229 1402
36% 1265 1411 36% 660 785 32% 624 779 39% 645 773 35% 645 785 35%
645 785 32% 785 1393 34% 280 606 36% 259 594 32% 259 591 32% 319
591 100% 1405 1464 33% 322 510 33% 633 881 29% 656 1327 25% 902
1402 30% 848 1402 30% 1040 1420 36% 89 307 39% 827 1042 41% 962
1117 27% 803 1402 33% 131 307
25% 848 1144 27% 89 307 37% 125 307 30% 854 1447 76% 746 1450
HDPFF10 853513 111 HMMER PFAM: Leucine Rich Repeat PF00560 65.1 729
800 2.1.1 WUblastx.64 garp precursor - human pir|S42799|S42799 38%
285 965 42% 1153 1593 32% 1306 1641 29% 1147 1446 31% 1614 1898 26%
1159 1512 30% 1174 1536 33% 1306 1632 30% 1174 1494 31% 1162 1539
33% 1183 1500 28% 468 893 27% 246 965 37% 1629 2111 HDPFU43 790189
112 WUblastx.64 (AAH01057) Tyrosylprotein AAH01057 100% 360 1349
sulfotransferase 2. 58% 220 348 HDPGE24 801947 114 WUblastx.64
(Q9P195) PRO1722. Q9P195 65% 1413 1291 43% 1388 1278 77% 2528 2394
47% 2182 2078 75% 1774 1751 62% 2604 2557 68% 1301 1167 HDPIU94
813352 115 WUblastx.64 (Q9BVF7) SIMILAR TO Q9BVF7 99% 63 1703
HYPOTHETICAL PROTEIN FLJ10422. HDPOC24 777493 116 WUblastx.64
(Q9H8K1) CDNA FLJ13518 FIS, Q9H8K1 100% 62 208 CLONE PLACE1005799.
HDPOL37 745377 117 WUblastx.64 (AAK40301) TRH4. AAK40301 70% 502
323 60% 1325 483 HDPPQ30 684292 120 WUblastx.64 (Q9H387) PRO2550.
Q9H387 51% 807 727 79% 1042 815 HDPPW82 778405 121 WUblastx.64
hypothetical protein UL126 - human pir|S09875|S09875 94% 6 116
cytomegalovirus (strain AD169) HDQHM36 852328 123 WUblastx.64
(Q9N083) UNNAMED PORTEIN Q9N083 69% 1129 1257 PRODUCT. 50% 965 1153
HDTAU35 838139 124 WUblastx.64 (Q9T9V8) NADH Q9T9V8 87% 56 175
DEHYDROGENASE SUBUNIT 3. 83% 305 340 HDTAV54 801898 125 WUblastx.64
(AAH01231) Glutathione S-transferase AAH01231 100% 13 303 subunit
13 hom HDTGW48 827285 127 WUblastx.64 (Q9P1W8) SIRP-B2. Q9P1W8 100%
783 1100 79% 1359 1757 HE2CA60 888705 130 WUblastx.64 (O95232)
OKADAIC ACID- OA48_HUMAN 98% 1098 1265 INDUCIBLE PHOSPHOPROTEIN
OA48-18. HE2HC60 753265 133 WUblastx.64 (Q9NVC4) CDNA FLJ10814 FIS,
Q9NVC4 88% 125 1300 CLONE NT2RP4000984. HE6CS65 762960 136
WUblastx.64 (Q9H7C6) CDNA: FLJ21047 FIS, Q9H7C6 98% 938 1378 CLONE
CAS00253. HE6DO92 562767 137 WUblastx.64 gag polyprotein - human
endogenous pir|A46312|A46312 63% 623 895 virus S71 80% 19 633
HE6EY13 847058 138 WUblastx.64 (O95476) HYPOTHETICAL 28.3 KDA
O95476 92% 5 472 PROTEIN. HE6FU11 827236 139 HMMER PFAM: von
Willebrand factor type A PF00092 184.7 244 771 2.1.1 domain
WUblastx.64 (O95460) MATRILIN-4 MTN4_HUMAN 77% 145 789 PRECURSOR.
45% 782 907 41% 791 925 50% 794 907 38% 863 1498 33% 190 741 98%
782 1642 HE8FC45 843781 141 WUblastx.64 (Q9NX85) CDNA FLJ20378 FIS,
Q9NX85 50% 1285 1172 CLONE KAIA0536. 57% 1824 1663 75% 1672 1553
HE8FC45 845672 142 WUblastx.64 (Q9NX85) CDNA FLJ20378 FIS, Q9NX85
50% 1285 1172 CLONE KAIA0536. 57% 1824 1663 75% 1672 1553 HE8FD92
856544 145 WUblastx.64 (Q9UJI9) HYPOTHETICAL 105.9 KDA Q9UJI9 84%
419 1414 PROTEIN. 71% 2 1060 76% 419 1345 61% 2 613 45% 203 1060
40% 449 1345 52% 2 328 33% 605 1345 46% 47 328 HE8FD92 869847 146
WUblastx.64 (Q9UJI9) HYPOTHETICAL 105.9 KDA Q9UJI9 74% 4 609
PROTEIN. 59% 4 540 50% 1 255 63% 346 540 63% 346 540 60% 346 540
49% 1 255 48% 1 255 53% 346 540 41% 4 255 33% 40 255 HE8FD92 901142
147 WUblastx.64 (Q9UJI9) HYPOTHETICAL 105.9 KDA Q9UJI9 76% 31 480
PROTEIN. 56% 31 411 67% 217 408 67% 217 408 63% 217 411 63% 217 411
60% 217 411 53% 217 411 59% 31 126 56% 31 126 56% 31 126 56% 31 126
39% 58 126 HE8SG96 862016 148 WUblastx.64 (Q9P195) PRO1722. Q9P195
58% 1997 1845 63% 1854 1687 HE8TY46 899528 149 WUblastx.64
(BAB55144) CDNA FLJ14576 fis, BAB55144 95% 318 938 clone
NT2RM4001092, w HE9CY05 834826 150 WUblastx.64 (Q9CX63)
6030468B19RIK Q9CX63 48% 434 742 PROTEIN. 57% 55 426 HE9EA10 827796
151 WUblastx.64 laminin alpha-1 chain precursor - pir|S14458|S14458
99% 761 1891 human 27% 878 1840 25% 1142 1876 HEBFR46 847064 157
WUblastx.64 (Q9NX85) CDNA FLJ20378 FIS, Q9NX85 80% 1111 1022 CLONE
KAIA0536. 84% 1265 1110 HEBGE07 798096 158 WUblastx.64 (Q9NX85)
CDNA FLJ20378 FIS, Q9NX85 79% 1851 1720 CLONE KAIA0536. HELAT35
693175 160 WUblastx.64 (Q9H728) CDNA: FLJ21463 FIS, Q9H728 72% 2092
1802 CLONE COL04765. HELBU54 637624 161 WUblastx.64 (Q9H728) CDNA:
FLJ21463 FIS, Q9H728 59% 1255 1031 CLONE COL04765. HEMEY47 834491
164 WUblastx.64 (Q9H387) PRO2550. Q9H387 68% 513 587 74% 578 838
HEPBA14 855935 166 WUblastx.64 (Q9BTY9) UNKNOWN (PROTEIN Q9BTY9 87%
423 515 FOR IMAGE: 2823490) 71% 15 77 (FRAGMENT). 92% 85 426
HEQAH80 701984 167 WUblastx.64 (Q9GMX5) HYPOTHETICAL 12.9 KDA
Q9GMX5 60% 818 1045 PROTEIN. HEQBF89 786205 168 WUblastx.64
(Q9H728) CDNA: FLJ21463 FIS, Q9H728 64% 793 638 CLONE COL04765. 64%
647 489 HETCI16 844543 169 WUblastx.64 (Q9P0V3) BOG25. Q9P0V3 99% 3
356 HETDW58 790557 170 WUblastx.64 unidentified 27.6K protein,
spliced pir|JC7586|JC7586 95% 324 1058 form A - human HFCFE20
701985 175 WUblastx.64 (Q9CSE5) EUKARYOTIC Q9CSE5 89% 438 581
TRANSLATION INITIATION 54% 1083 1187 FACTOR 3 (FRAGMENT). HFEAY59
658685 176 WUblastx.64 (Q9Z320) C29. Q9Z320 67% 50 1153 HFGAJ16
580824 177 WUblastx.64 CDM protein - human pir|S44279|S44279 97%
263 403 HFIJA29 839206 179 WUblastx.64 (Q9UHT1) PRO1902 PROTEIN.
Q9UHT1 46% 889 806 59% 1026 880 HFIJA68 847074 180 WUblastx.64
(Q9UHE8) SIX TRANSMEMBRANE STEA_HUMAN 89% 13 399 EPITHELIAL ANTIGEN
OF PROSTATE. HFKES05 827572 181 WUblastx.64 (BAB55088) CDNA
FLJ14496 fis, BAB55088 85% 84 314 clone NT2RM1000035. 94% 367 1722
HFKEU12 634006 182 WUblastx.64 hypothetical protein 3 - rat
pir|S21347|S21347 52% 695 745 50% 757 933 40% 774 1007 54% 387 692
HFPDS07 821646 185 WUblastx.64 (O94925) GLUTAMINASE, KIDNEY
GLSK_HUMAN 78% 343 513 ISOFORM, MITOCHONDRIAL 74% 2 436 PRECURS
HFVGK35 731868 189 WUblastx.64 (Q9GMX5) HYPOTHETICAL 12.9 KDA
Q9GMX5 65% 832 608 PROTEIN. HFVHW43 570948 190 WUblastx.64 (Q9BGX4)
HYPOTHETICAL 13.8 KDA Q9BGX4 69% 1209 1093 PROTEIN. HFXAV37 626595
191 WUblastx.64 (O60448) NEURONAL THREAD O60448 33% 583 461 PROTEIN
AD7C-NTP. 68% 473 333 60% 1240 1166 47% 607 539 45% 1454 1275 56%
1295 1173 59% 1287 1222 64% 607 407 69% 607 461 57% 1285 1169 40%
1467 1402 48% 1321 1232 37% 558 346 78% 402 361 68% 591 406 31% 549
355 60% 398 354 36% 1321 1232 41% 1364 1275 46% 1187 1110 47% 1453
1187 HFXBT66 580831 193 WUblastx.64 (Q9H387) PRO2550. Q9H387 73%
739 807 58% 809 907 62% 564 764 HGBER72 826710 195 WUblastx.64
(Q9H387) PRO2550. Q9H387 71% 1061 969 78% 1104 1063 77% 1237 1103
HGBHP91 693011 198 WUblastx.64 hypothetical protein (L1H 3' region)
- pir|B34087|B34087 52% 541 491 human 44% 537 34 HGCAC19 851527 199
WUblastx.64 (Q9UIE9) WUGSC: H_DJ0687K01.2 Q9UIE9 34% 984 1124
PROTEIN. 31% 1546 1863 96% 361 1047 24% 993 1124 22% 984 1124 40%
1002 1124 27% 984 1124 27% 981 1124 25% 984 1088 31% 984 1124 23%
984 1124 29% 984 1124 29% 984 1124 32% 1023 1124 26% 586 801 95%
2017 2712 HGCAC19 801999 200 WUblastx.64 (Q9H6A1) CDNA: FLJ22454
FIS, Q9H6A1 34% 984 1124 CLONE HRC09703 (FRAGMENT). 100% 184 210
31% 984 1124 29% 984 1124 40% 1002 1124 27% 984 1124 29% 984 1124
27% 981 1124
21% 984 1121 24% 993 1124 23% 984 1124 96% 316 1056 HGCAC19 842540
201 WUblastx.64 (Q9H6A1) CDNA: FLJ22454 FIS, Q9H6A1 34% 982 1122
CLONE HRC09703 (FRAGMENT). 100% 182 208 31% 982 1122 29% 982 1122
40% 1000 1122 27% 982 1122 29% 982 1122 27% 979 1122 21% 982 1119
24% 991 1122 23% 982 1122 96% 314 1045 HHEAK45 765278 202
WUblastx.64 (Q9NPB0) DJ202I21.1 (NOVEL Q9NPB0 68% 1949 1458
PROTEIN) (CDNA FLJ11101 FIS, CLONE PLACE10 HHEOW19 886174 204
WUblastx.64 (O18973) RAB5 GDP/GTP O18973 77% 417 623 EXCHANGE
FACTOR, RABEX5. 91% 611 715 56% 166 378 92% 129 167 HHFFF87 778071
205 WUblastx.64 coatomer zeta chain - bovine pir|A49465|A49465 100%
50 145 HHFFL34 753230 206 WUblastx.64 (BAB55306) CDNA FLJ14793 fis,
BAB55306 100% 9 710 clone NT2RP4001174, w HHFFS40 824059 207
WUblastx.64 (Q9H4A6) GOLGI PROTEIN. Q9H4A6 100% 3 251 HHGDT26
658692 209 WUblastx.64 (Q9H728) CDNA: FLJ21463 FIS, Q9H728 69% 1580
1290 CLONE COL04765. HHSBI65 801910 213 WUblastx.64 (Q9H5W9) CDNA:
FLJ22888 FIS, Q9H5W9 100% 270 407 CLONE KAT03934. 94% 479 1300
HHSDI53 862028 214 WUblastx.64 (Q9H387) PRO2550. Q9H387 70% 1108
935 71% 1241 1107 75% 1276 1241 HILCA24 782450 217 WUblastx.64
(Q9NUU6) CDNA FLJ11127 FIS, Q9NUU6 73% 103 159 CLONE PLACE1006225.
100% 168 1169 HILCA24 869856 218 WUblastx.64 (Q9NUU6) CDNA FLJ11127
FIS, Q9NUU6 95% 104 1171 CLONE PLACE1006225. HISAT67 843549 219
WUblastx.64 (Q9UH94) PROLACTIN Q9UH94 88% 219 797 REGULATORY
ELEMENT- 91% 788 1447 BINDING PROTEIN (PROLACTIN REGU HJBCU75
638329 220 WUblastx.64 (O45030) STRABISMUS. O45030 44% 199 426 52%
464 964 HJMAA03 824062 221 WUblastx.64 (Q9N032) UNNAMED PROTEIN
Q9N032 71% 415 528 PRODUCT. HJMAV41 862029 222 WUblastx.64
brain-specific membrane anchor pir|JC7110|JC7110 100% 14 475
protein - human HJMAY90 793678 223 WUblastx.64 (Q9DC16)
1200007D18RIK Q9DC16 77% 100 312 PROTEIN (RIKEN CDNA 98% 315 968
1200007D18 GENE). HJPBE39 801960 224 WUblastx.64 (Q9CUS4)
4833420K19RIK Q9CUS4 33% 1 621 PROTEIN (FRAGMENT). 74% 213 1007
HJPCH08 840365 226 WUblastx.64 (O95235) RABKINESIN-6 (RAB6-
RB6K_HUMAN 93% 9 596 INTERACTING KINESIN-LIKE PROTEI HKABU43 838573
227 WUblastx.64 (AAH03633) Translocase of outer AAH03633 100% 33 62
mitochondrial membr 92% 26 1597 HKACI79 853361 228 WUblastx.64
(Q9BGV8) HYPOTHETICAL 10.0 KDA Q9BGV8 72% 886 1104 PROTEIN. HKAFF50
790192 229 WUblastx.64 (Q9P1G7) PRO1777. Q9P1G7 99% 1753 1424
HKGBF25 738797 230 WUblastx.64 (Q9HBS7) HYPOTHETICAL 14.2 KDA
Q9HBS7 71% 1708 1688 PROTEIN. 56% 1956 1708 HKMLK03 734213 232
WUblastx.64 (Q9N083) UNNAMED PORTEIN Q9N083 50% 981 832 PRODUCT.
73% 856 731 HLDQU79 740755 237 WUblastx.64 (O75477) KE04P. O75477
100% 105 1142 HLDQU79 837599 3099 blastx.2 KE04P. sp|O75477|O75477
99% 81 1118 HLDRT09 830544 238 WUblastx.64 (Q9HAQ7) ATP-BINDING
Q9HAQ7 86% 2 469 CASSETTE HALF-TRANSPORTER. HLHAP05 638476 239
WUblastx.64 (Q9HA67) CDNA FLJ12155 FIS, Q9HA67 55% 1553 1500 CLONE
MAMMA1000472. 72% 1650 1585 77% 1807 1646 HLIBO72 883431 241
WUblastx.64 (AAH07829) Similar to hypothetical AAH07829 100% 65 547
protein AF140225 HLICE88 840321 242 WUblastx.64 fibrinogen gamma-A
chain precursor pir|A90470|FGHUG 89% 3 584 [validated] - human
HLMBW89 701996 245 WUblastx.64 (AAH07983) Unknown (protein for
AAH07983 85% 390 247 MGC: 16279). HLMGP50 647603 246 WUblastx.64
(Q9GMI7) HYPOTHETICAL 9.0 KDA Q9GMI7 61% 765 709 PROTEIN. 72% 935
807 HLQAS12 886180 249 WUblastx.64 (Q9XTA8) LECTIN-LIKE Q9XTA8 71%
690 842 OXIDIZED LDL RECEPTOR. 52% 364 711 HLQCL64 864966 250 HMMER
PFAM: Major intrinsic protein PF00230 87.3 87 449 2.1.1 WUblastx.64
aquaporin 9 - human pir|JC5973|JC5973 98% 18 548 HLQCX36 584786 251
WUblastx.64 (Q9UI59) PRO0478 PROTEIN. Q9UI59 87% 1100 1216 HLWDB73
838453 258 WUblastx.64 (Q9H7D7) CDNA: FLJ21016 FIS, Q9H7D7 100% 660
872 CLONE CAE05735. 98% 1 657 HLYGB19 838083 261 WUblastx.64
(Q9H0Q1) HYPOTHETICAL 12.3 KDA Q9H0Q1 97% 204 518 PROTEIN. HLYGY91
658703 263 WUblastx.64 (Q9H8N0) CDNA FLJ13386 FIS, Q9H8N0 94% 221
391 CLONE PLACE1001104, WEAKLY SIMILAR TO MYO HMCAZ04 839783 264
WUblastx.64 (Q9Y6N5) HYPOTHETICAL 50.0 KDA Q9Y6N5 100% 106 1455
PROTEIN. HMCAZ04 858210 265 WUblastx.64 (Q9Y6N5) HYPOTHETICAL 50.0
KDA Q9Y6N5 100% 106 1455 PROTEIN. HMCAZ04 867910 266 WUblastx.64
(Q9Y6N5) HYPOTHETICAL 50.0 KDA Q9Y6N5 100% 106 1455 PROTEIN.
HMCAZ04 887445 267 WUblastx.64 (Q9Y6N5) HYPOTHETICAL 50.0 KDA
Q9Y6N5 100% 107 1456 PROTEIN. HMCAZ04 668249 268 WUblastx.64
(Q9UQM8) CGI-44 PROTEIN. Q9UQM8 100% 9 1055 HMDAB29 584789 270
WUblastx.64 (Q9NX17) CDNA FLJ20489 FIS, Q9NX17 72% 1186 890 CLONE
KAT08285. HMEBB82 783077 272 WUblastx.64 (Q9NSE4) MITOCHONDRIAL
Q9NSE4 99% 2 2206 ISOLEUCINE TRNA SYNTHETASE (FRAGMENT). HMEDE24
837027 273 WUblastx.64 (Q9BVH9) SIMILAR TO GLUCOSE Q9BVH9 94% 188
1159 REGULATED PROTEIN, 58 KDA. 42% 101 742 HMEDI90 840077 274
WUblastx.64 (Q9HBA3) RAB3 INTERACTING Q9HBA3 100% 81 794 PROTEIN
VARIANT 4 (FRAGMENT). HMELM75 587307 275 WUblastx.64 (Q9NVW5)
HYPOTHETICAL 31.3 KDA Q9NVW5 100% 137 391 PROTEIN. HMICP65 847403
279 WUblastx.64 (Q9HAU9) GUANINE Q9HAU9 99% 8 892 NUCLEOTIDE
BINDING PROTEIN 22% 269 943 BETA SUBUNIT 5L. HMSBE04 709672 281
WUblastx.64 (Q9H5V8) CDNA: FLJ22969 FIS, Q9H5V8 85% 182 3 CLONE
KAT10759. HMSCL38 801919 282 WUblastx.64 (Q9P195) PRO1722. Q9P195
64% 1272 1460 72% 2918 2844 64% 2851 2759 76% 2769 2653 HMSCR69
843059 283 HMMER PFAM: Zinc finger present in PF00569 48.2 113 250
2.1.1 dystrophin, CBP/p300 WUblastx.64 (Q9BWK2) POTASSIUM CHANNEL
Q9BWK2 78% 107 1231 MODULATORY FACTOR. HMSHC86 840402 284
WUblastx.64 (Q9N083) UNNAMED PORTEIN Q9N083 70% 1724 1674 PRODUCT.
67% 1674 1420 HMSHU20 847410 285 WUblastx.64 (Q9H728) CDNA:
FLJ21463 FIS, Q9H728 47% 1722 1453 CLONE COL04765. HMTAB77 847411
287 WUblastx.64 (P43243) MATRIN 3. MAT3_HUMAN 95% 630 1385 64% 287
628 22% 2002 2175 98% 3255 3428 31% 2041 2190 22% 2047 2181 23%
2584 2763 75% 2440 2760 27% 2596 2709 35% 1705 1797 35% 3312 3404
91% 1384 2328 HMUAE26 747403 288 WUblastx.64 (Q9P2R4) SEVEN Q9P2R4
89% 153 575 TRANSMEMBRANE DOMAIN 86% 577 1272 ORPHAN RECEPTOR.
HMUAN45 833072 289 WUblastx.64 (BAB55441) CDNA FLJ14993 fis,
BAB55441 70% 684 1238 clone Y79AA1001874, w 65% 239 955 100% 1247
1516 HMVBC31 825598 290 WUblastx.64 (O60725) PROTEIN-S ICMT_HUMAN
80% 747 938 ISOPRENYLCYSTEINE O- 87% 121 789 METHYLTRANSFERASE (E
HMVDU15 801969 291 WUblastx.64 (Q9BTJ2) SIMILAR TO CGI-30 Q9BTJ2
100% 75 917 PROTEIN. HMWBL03 822861 292 WUblastx.64 (Q9BWT1) C-MYC
TARGET JP1. Q9BWT1 85% 137 1240 HMWJF53 758158 293 WUblastx.64
(Q9GZU7) NUCLEAR LIM Q9GZU7 91% 3 170 INTERACTOR-INTERACTING 100%
154 720 FACTOR. HNEAK81 722235 294 WUblastx.64 (Q9N083) UNNAMED
PORTEIN Q9N083 56% 770 1087 PRODUCT. HNECL22 799541 295 WUblastx.64
(Q9P0J2) MITOCHONDRIAL Q9P0J2 94% 1771 2331 SOLUTE CARRIER. HNEDH88
815675 297 WUblastx.64 (Q9GML5) HYPOTHETICAL 8.0 KDA Q9GML5 56%
1706 1849 PROTEIN. HNFAC50 815676 298 WUblastx.64 (Q9H286)
SEROLOGICALLY Q9H286 100% 425 282 DEFINED BREAST CANCER ANTIGEN
NY-BR-20 (FRAGME HNFHF34 722237 300 WUblastx.64 (Q9NZX0) HSPC068.
Q9NZX0 100% 9 431 34% 9 404 35% 3 407 33% 9 407 32% 129 422 HNGAK51
603910 301 WUblastx.64 (O60448) NEURONAL THREAD O60448 61% 563 601
PROTEIN AD7C-NTP. 67% 733 915 65% 702 878 74% 714 914 HNGAM58
688114 302 WUblastx.64 (Q9H728) CDNA: FLJ21463 FIS, Q9H728 71% 1020
1061 CLONE COL04765. 85% 1081 1143 53% 818 1003 HNGGP65 597449 310
WUblastx.64 (Q9GMU5) HYPOTHETICAL 14.1 KDA Q9GMU5 31% 69 302
PROTEIN. 47% 398 541 HNGJB41 852178 313 WUblastx.64 probable
oxysterol-binding protein pir|T02435|T02435 100% 128 9 DJ430N08.1 -
human (fragment) HNHFE71 834487 320 WUblastx.64 hypothetical
protein pir|T47135|T47135 67% 822 583 DKFZp761L0812.1 - human
(fragment) HNHGK22 597451 321 WUblastx.64 hypothetical protein (L1H
3' region) - pir|B34087|B34087 41% 483 37 human 41% 333 10 50% 733
485 HNHHB10 634589 322 WUblastx.64 (Q9BVD9) UNKNOWN (PROTEIN Q9BVD9
70% 658 608 FOR MGC: 5149). 73% 845 711 73% 717 661 HNTBT17 855957
324 WUblastx.64 (Q9NZF3) BM-001. Q9NZF3 45% 818 1342 61% 729 947
84% 556 774 HOACG07 792928 328 WUblastx.64 (Q9GZN8) DJ1009E24.3 (A
NOVEL Q9GZN8 99% 183 704 PROTEIN) (CDNA FLJ14158 FIS, CLONE NT2R
HODBV05 825283 331 WUblastx.64 (Q13878) 94 KDA B-RAF PROTEIN Q13878
100%
566 661 (FRAGMENT). HODCZ32 836069 332 WUblastx.64 (Q9NSI6)
WD-REPEAT PROTEIN 9 WDR9_HUMAN 86% 8 331 (FRAGMENT). HOEBK60 789396
333 WUblastx.64 (Q9H916) CDNA FLJ13081 FIS, Q9H916 98% 132 1916
CLONE NT2RP3002033. 100% 14 109 88% 106 159 HOFAA78 836646 334
WUblastx.64 (Q9NXS2) CDNA FLJ20084 FIS, Q9NXS2 90% 529 792 CLONE
COL03526. 50% 9 80 88% 29 529 HOFNB74 762821 335 WUblastx.64
(Q99JH1) HYPOTHETICAL 17.7 KDA Q99JH1 72% 44 187 PROTEIN. 97% 199
471 HORBV76 839270 339 WUblastx.64 (Q9Y2B2) Q9Y2B2 91% 30 761
PHOSPHATIDYLINOSITOL GLYCAN, CLASS L (EC 3.5.--.--) (PIG-L PRO
HOSDO75 862049 340 WUblastx.64 (Q9D099) 1110057L18RIK Q9D099 89% 11
202 PROTEIN. 88% 259 630 HOSEC25 688055 341 WUblastx.64 (Q9BGW3)
HYPOTHETICAL 13.5 KDA Q9BGW3 73% 530 631 PROTEIN. 65% 627 809 64%
1501 1451 56% 1440 1222 HOSEJ94 795132 343 WUblastx.64 (Q9GZY3)
HT032 (PRK1- Q9GZY3 92% 363 986 ASSOCIATED PROTEIN AWP1) (PROTEIN
ASSOCIATED WIT HOUCA21 655359 344 WUblastx.64 (Q9HBS7) HYPOTHETICAL
14.2 KDA Q9HBS7 78% 988 1110 PROTEIN. HOUDE92 580866 345
WUblastx.64 (Q9HBT2) HYPOTHETICAL 17.2 KDA Q9HBT2 96% 21 245
PROTEIN. HOUDR07 745404 346 WUblastx.64 (Q9HBV4) ANGIOPOIETIN-LIKE
Q9HBV4 87% 170 1384 PROTEIN PP1158. HOUED72 858547 347 WUblastx.64
(Q9CRP8) RIBOSOMAL PROTEIN Q9CRP8 84% 676 774 L15 (FRAGMENT). 85%
110 682 HOUFS04 771564 348 WUblastx.64 (Q9VN45) CG12001 PROTEIN.
Q9VN45 32% 1362 1982 39% 915 1106 26% 141 380 HOUHI25 888279 349
WUblastx.64 (O95003) WUGSC: H_DJ0593H12.2 O95003 94% 73 783
PROTEIN. HPCAL26 762822 352 WUblastx.64 (O95084) SERINE PROTEASE
O95084 98% 398 640 (HYPOTHETICAL 43.0 KDA 76% 135 497 PROTEIN)
(PROTEASE, S HPFBA54 635539 354 WUblastx.64 (Q9HBW6) NAG13. Q9HBW6
76% 795 733 73% 766 602 84% 602 393 86% 135 91 79% 394 128 HPFCI36
855966 355 WUblastx.64 (Q9NX47) CDNA FLJ20445 FIS, Q9NX47 100% 9
320 CLONE KAT05170. HPJBU43 862058 360 WUblastx.64 (Q9P1E1)
PRO2221. Q9P1E1 54% 187 44 HPMCJ84 562779 363 WUblastx.64 (Q9NX85)
CDNA FLJ20378 FIS, Q9NX85 74% 619 479 CLONE KAIA0536. 69% 759 613
HPMCV30 612870 364 WUblastx.64 (Q9BVD9) UNKNOWN (PROTEIN Q9BVD9 76%
384 334 FOR MGC: 5149). 68% 590 399 HPQAX38 843592 366 WUblastx.64
(Q9BGV8) HYPOTHETICAL 10.0 KDA Q9BGV8 74% 664 768 PROTEIN. 68% 543
674 HPQAX38 845752 367 WUblastx.64 (Q9BGV8) HYPOTHETICAL 10.0 KDA
Q9BGV8 74% 664 768 PROTEIN. 68% 543 674 HPRBH85 695752 370
WUblastx.64 (BAB55300) CDNA FLJ14784 fis, BAB55300 62% 2 616 clone
NT2RP4000713. 86% 534 1085 HPRCA64 824074 371 WUblastx.64 (P55161)
NCK-ASSOCIATED NCP1_RAT 100% 1021 1926 PROTEIN 1 (NAP 1) (P125NAP1)
85% 387 1019 (MEMBR 93% 11 481 HPRCD35 853551 372 WUblastx.64
hypothetical protein pir|T50629|T50629 100% 320 613 DKFZp762L1710.1
- human 57% 2 499 (fragment) HPTRM02 812879 373 WUblastx.64
(Q9UJU6) SRC HOMOLOGY 3 Q9UJU6 92% 332 940 DOMAIN-CONTAINING
PROTEIN 97% 2 106 HIP-55 (DREBRIN F). 96% 98 190 HRAAD30 866187 376
WUblastx.64 (Q9H6V0) CDNA: FLJ21839 FIS, Q9H6V0 89% 23 1393 CLONE
HEP01794. HRADA42 827302 377 WUblastx.64 hypothetical protein
C11D2.4 - pir|T32961|T32961 48% 387 668 Caenorhabditis elegans 74%
668 931 HRADF49 866481 378 WUblastx.64 (Q9H6L1) CDNA: FLJ22169 FIS,
Q9H6L1 90% 13 825 CLONE HRC00632. 84% 813 1379 75% 1291 1593 34%
1590 1685 HRADN25 800628 379 WUblastx.64 (Q9HB07) MYG1 PROTEIN.
MYG1_HUMAN 96% 47 1174 HRDAI17 560720 381 WUblastx.64 (Q9NUM6) CDNA
FLJ11267 FIS, Q9NUM6 59% 1305 1475 CLONE PLACE1009174. HRDDQ39
840405 382 WUblastx.64 (Q9NX85) CDNA FLJ20378 FIS, Q9NX85 53% 582
436 CLONE KAIA0536. 65% 775 578 HRDER22 688056 383 WUblastx.64
(Q9NW07) CDNA FLJ10390 FIS, Q9NW07 80% 9 248 CLONE NT2RM4000104,
100% 357 431 MODERATELY SIMILAR TO 39% 120 227 28% 15 203 38% 254
316 HRDEX93 816046 384 WUblastx.64 (Q9UBV8) PEFLIN. Q9UBV8 100% 313
864 HRDFK37 840381 385 WUblastx.64 (Q9P195) PRO1722. Q9P195 69% 536
652 40% 50 115 HRGBD54 828436 386 WUblastx.64 (O95819) HPK/GCK-LIKE
KINASE O95819 51% 32 253 HGK. 74% 253 645 27% 6 149 92% 781 2019
HSAVA08 580870 388 WUblastx.64 (Q9BGW3) HYPOTHETICAL 13.5 KDA
Q9BGW3 57% 949 896 PROTEIN. 42% 926 792 63% 796 764 66% 1059 934
HSAWZ40 634000 391 WUblastx.64 (O00549) ORF2-LIKE PROTEIN O00549
64% 951 610 (FRAGMENT). 60% 613 8 HSDZM54 637870 393 WUblastx.64
NADH dehydrogenase (ubiquinone) pir|A00422|DNHUN3 88% 226 360 (EC
1.6.5.3) chain 3 - human mitochondrion HSHBF76 715838 394
WUblastx.64 (AAH08335) Unknown (protein for AAH08335 86% 762 457
IMAGE: 3506202) (Fra 73% 882 748 100% 1267 836 HSJBY32 702020 396
WUblastx.64 (Q9GZZ6) NEURONAL NICOTINIC Q9GZZ6 81% 466 639
ACETYLCHOLINE ALPHA10 57% 215 514 SUBUNIT PRECURSOR ( HSLHX15
777861 399 WUblastx.64 catalase (EC 1.11.1.6) - pir|I40767|I40767
86% 162 76 Campylobacter jejuni HSNBM34 635131 402 WUblastx.64
acyl-CoA dehydrogenase (EC 1.3.99.--) pir|S54183|S54183 84% 1548
1979 very-long-chain specific - human 100% 251 1546 HSOAH16 827058
403 WUblastx.64 (Q9NX85) CDNA FLJ20378 FIS, Q9NX85 57% 682 623
CLONE KAIA0536. 81% 624 544 68% 524 384 HSQDO85 853393 405
WUblastx.64 (Q9VCK0) CG10161 PROTEIN. Q9VCK0 67% 485 988 60% 60 521
56% 10 57 HSQES57 831222 406 WUblastx.64 (Q96EW4) Unknown (protein
for Q96EW4 94% 195 980 MGC: 19936). HSRBE06 871264 407 WUblastx.64
(Q9H387) PRO2550. Q9H387 70% 1608 1327 HSSDI26 560722 408
WUblastx.64 (Q9BVD9) UNKNOWN (PROTEIN Q9BVD9 68% 1398 1264 FOR MGC:
5149). HSSEA64 853395 409 WUblastx.64 (Q9HBT2) HYPOTHETICAL 17.2
KDA Q9HBT2 98% 7 243 PROTEIN. HSSEF77 658725 410 WUblastx.64
(O95637) WW DOMAIN BINDING O95637 42% 10 246 PROTEIN-1. 83% 296 829
HSSFE38 742512 411 HMMER PFAM: Ribonuclease HII PF01351 76.3 184
-142 2.1.1 WUblastx.64 (O75792) RIBONUCLEASE HI RNHL_HUMAN 91% 156
635 LARGE SUBUNIT (EC 3.1.26.--) 99% 587 1051 (RNASE HSWBE76 751308
413 WUblastx.64 (Q9NW15) CDNA FLJ10375 FIS, Q9NW15 100% 126 266
CLONE NT2RM2001950. HSXCP38 895392 414 WUblastx.64
hydroxymethylglutaryl-CoA lyase (EC pir|B45470|B45470 70% 17 895
4.1.3.4) - chicken HSYBI06 740766 415 WUblastx.64 (Q9BGV8)
HYPOTHETICAL 10.0 KDA Q9BGV8 69% 916 954 PROTEIN. 78% 821 913
HT5GR59 801930 420 WUblastx.64 (O60496) DOCKING PROTEIN. O60496 72%
70 1284 HTAEI78 637684 421 WUblastx.64 (Q9UKQ2) ADAM 28 PRECURSOR
AD28_HUMAN 90% 85 174 (EC 3.4.24.--) (A DISINTEGRIN AND HTDAA78
566861 422 WUblastx.64 (Q9D8E7) 5830443F10RIK Q9D8E7 58% 84 302
PROTEIN. HTEAG62 812332 423 WUblastx.64 (Q9Y5Z7) HOST CELL FACTOR
2. Q9Y5Z7 60% 1 57 93% 14 2011 30% 107 631 HTECB02 806305 424
WUblastx.64 (AAK39520) BTB domain protein AAK39520 95% 33 1211
(Fragment). HTECC15 866488 425 WUblastx.64 (Q92558) WISKOTT-ALDRICH
WAS1_HUMAN 95% 321 1100 SYNDROME PROTEIN FAMILY 70% 1525 1998
MEMBER 1 ( 89% 1105 1281 HTEDS12 838621 428 WUblastx.64 (Q9H0K0)
HYPOTHETICAL 81.8 KDA Q9H0K0 97% 1029 1391 PROTEIN. 42% 1269 1490
100% 16 1011 HTEEF26 789606 431 WUblastx.64 (Q9H7X7) CDNA FLJ14117
FIS, Q9H7X7 81% 80 634 CLONE MAMMA1001785. HTEEF26 879704 432
WUblastx.64 (Q9H7X7) CDNA FLJ14117 FIS, Q9H7X7 81% 80 634 CLONE
MAMMA1001785. HTEEW69 764835 433 WUblastx.64 (Q9Z1H7) GSG1. Q9Z1H7
65% 850 927 85% 707 769 50% 519 662 66% 908 943 65% 182 544 HTEGS07
827700 434 WUblastx.64 (Q9D143) 1110030K22RIK Q9D143 96% 183 593
PROTEIN. HTEHA56 806461 436 WUblastx.64 (Q9H9A0) CDNA FLJ12895 FIS,
Q9H9A0 94% 2 217 CLONE NT2RP2004187, WEAKLY 65% 70 468 SIMILAR TO
ZIN HTEJD29 695798 438 WUblastx.64 (Q60713) REVERSE Q60713 42% 1115
1285 TRANSCRIPTASE. 47% 874 1089 HTEMQ17 840387 440 WUblastx.64
(Q9D4P8) 4930579G24RIK Q9D4P8 90% 120 359 PROTEIN. HTENR63 877952
441 WUblastx.64 (Q9HD71) HYPOTHETICAL Q9HD71 33% 1278 1358 NUCLEAR
FACTOR SBBI22. 78% 26 1168 HTGGM44 842856 442 WUblastx.64 probable
phosphodiesterase I (EC pir|T43461|T43461 100% 1400 1924 3.1.4.1) -
human (fragment) 83% 1925 2488 HTLBT80 840045 445 WUblastx.64
(Q9NQQ7) BA394O2.1 (CGI-15 Q9NQQ7 76% 1214 1405 PROTEIN). 74% 804
1223 47% 780 845 78% 313 825 HTLDA84 686397 446 WUblastx.64
(Q9H387) PRO2550. Q9H387 79% 1265 1134 60% 1442 1398 65% 1398 1243
HTLDN29 790195 447 WUblastx.64 (Q9CWL8) 5730471K09RIK Q9CWL8 96% 15
1226 PROTEIN. HTLEC82 811992 449 WUblastx.64 (Q99MI0) CELL GROWTH
Q99MI0 98% 111 455 REGULATOR FALKOR. HTLEM16 779133 450 WUblastx.64
(O95638) WW DOMAIN BINDING O95638 92% 50 541 PROTEIN-2. 28% 987
1142 48% 617 841 HTLEV48 723799 451 WUblastx.64 (BAB55550)
Bk125H2.1 protein. BAB55550 94% 10 825 HTLFA13 535937 452
WUblastx.64 (Q9UHT1) PRO1902 PROTEIN. Q9UHT1 57% 1118 873 HTLGI89
835069 454 WUblastx.64 (Q9BXS5) CLATHRIN- Q9BXS5 98% 104 682
ASSOCIATED PROTEIN AP47. 99% 675 1370 HTLIF11 843506 455
WUblastx.64 (Q9I8S4) ORNITHINE Q9I8S4 68% 309 356 DECARBOXYLASE-2.
59% 353 1687 HTLIF12 834946 456 WUblastx.64 (Q9DAR1) 1700001K04RIK
Q9DAR1 47% 291 752 PROTEIN. HTLIF12 842691 457 WUblastx.64 (Q9DAR1)
1700001K04RIK Q9DAR1 47% 293 754 PROTEIN. HTLIF12 870167 458
WUblastx.64 (Q9DAR1) 1700001K04RIK Q9DAR1 47% 293 754 PROTEIN.
HTLIF12 886780 459 WUblastx.64 (Q9DAR1) 1700001K04RIK Q9DAR1 47%
293 754 PROTEIN. HTLIF12 891533 460 WUblastx.64 (Q9DAR1)
1700001K04RIK Q9DAR1 47% 293 754 PROTEIN. HTLIF12 901225 461
WUblastx.64 (Q9DAR1) 1700001K04RIK Q9DAR1 47% 293 754 PROTEIN.
HTNBK13 831967 463 WUblastx.64 (Q9Y3M2) HYPOTHETICAL 14.5 KDA
Q9Y3M2 81% 123 500 PROTEIN. HTOAM11 664508 465 WUblastx.64 (Q9H5R3)
CDNA: FLJ23147 FIS, Q9H5R3 77% 428 363 CLONE LNG09295. 75% 586 425
HTOEV16 853616 468 WUblastx.64 (Q9NRZ5) 1-ACYL-SN- PLCD_HUMAN 98%
201 383 GLYCEROL-3-PHOSPHATE 95% 379 1164 ACYLTRANSFERASE DEL
HTOHO21 732808 470 WUblastx.64 P47 LBC oncogene - human
pir|I38434|I38434 97% 581 438 HTOHQ05 853621 471 WUblastx.64
(Q9UII4) CYCLIN-E BINDING Q9UII4 100% 669 791 PROTEIN 1. HTOJL95
806212 472 WUblastx.64 (Q15605) ORF1 CODES FOR A 40 KDA Q15605 86%
192 61 PRODUCT. 57% 876 730 57% 751 161 HTOJL95 762851 473
WUblastx.64 (Q15401) LINE-1 REPEAT MRNA Q15401 36% 683 609 WITH 2
OPEN READING FRAMES. 59% 966 820 71% 607 248 HTPDU17 840596 474
WUblastx.64 (Q9NW00) CDNA FLJ10404 FIS, Q9NW00 80% 553 1308 CLONE
NT2RM4000486. 64% 1143 1664 HTSFJ32 637720 475 WUblastx.64 (Q9WUW2)
VESICLE Q9WUW2 64% 747 788 ASSOCIATED MEMBRANE 94% 448 609 PROTEIN
2B. HTTCB60 853401 476 WUblastx.64 (Q9HAW0) RNA POLYMERASE III
Q9HAW0 90% 6 881 TRANSCRIPTION INITIATION FACTOR BRFU. HTTEE41
840950 477 WUblastx.64 (P78371) T-COMPLEX PROTEIN 1, TCPB_HUMAN 98%
92 1696 BETA SUBUNIT (TCP-1-BETA) (CC HTTEZ02 702027 478
WUblastx.64 (Q9UEZ7) MAKORIN 1. Q9UEZ7 56% 278 346 98% 6 272
HTWEH94 561680 479 WUblastx.64 (Q9GMX5) HYPOTHETICAL 12.9 KDA
Q9GMX5 60% 1150 929 PROTEIN. HTXDC38 801935 482 WUblastx.64
(Q9BTX3) SIMILAR TO HSPC171 Q9BTX3 99% 100 573 PROTEIN. HTXDC77
844258 483 HMMER PFAM: Class I Histocompatibility PF00129 103.3 137
259 2.1.1 antigen, domains alpha 1 and 2 WUblastx.64 (P03989) HLA
CLASS I 1B14_HUMAN 63% 880 945 HISTOCOMPATIBILITY ANTIGEN, 71% 65
256 B-27 ALPHA 80% 282 863 HTXFA72 853410 487 WUblastx.64 (Q9N083)
UNNAMED PORTEIN Q9N083 59% 1688 1557 PRODUCT. 66% 1839 1681 HTXKF95
834438 489 WUblastx.64 (AAH08360) Similar to hypothetical AAH08360
85% 233 553 protein FLJ22376 100% 2 112 HTXMZ07 834881 490
WUblastx.64 (Q9BRF3) SIMILAR TO RIKEN Q9BRF3 90% 3 1469 CDNA
2810468K17 GENE. HUFCL31 801938 491 WUblastx.64 (Q9D311)
9030623N16RIK Q9D311 60% 280 1224 PROTEIN. HUKBT67 844446 492
WUblastx.64 (BAB55428) CDNA FLJ14975 fis, BAB55428 100% 1040 1216
clone THYRO1001405, w 100% 8 61 30% 80 241 HUKDY82 570896 494
WUblastx.64 (Q9HA67) CDNA FLJ12155 FIS, Q9HA67 59% 1405 1145 CLONE
MAMMA1000472. HUSCJ14 894699 495 WUblastx.64 tex261 protein - mouse
pir|S47481|S47481 99% 74 661 HUSGL67 792637 496 WUblastx.64
(Q9Y2G2) CARD DOMAIN CRD8_HUMAN 100% 347 421 PROTEIN 8 (APOPTOTIC
PROTEIN 65% 947 1006 NDPP1) (D 97% 469 954 HUSGU40 684975 497
WUblastx.64 (Q9BX98) UBIQUITIN A-52 Q9BX98 75% 840 433 RESIDUE
RIBOSOMAL PROTEIN FUSION PRODUCT 1 (F HUVDJ48 564853 499
WUblastx.64 SHORT ISOFORM OF Q9P2N4 sp_vs|Q9P2N4- 92% 1510 1668
01|Q9P2N4 HWAAI12 830432 500 WUblastx.64 (Q9BWW4) SINGLE STRANDED
Q9BWW4 82% 512 829 DNA BINDING PROTEIN-1. 87% 92 394 69% 941 1252
36% 521 685 37% 752 826 HWBCN36 722259 502 WUblastx.64 (Q9BGW3)
HYPOTHETICAL 13.5 KDA Q9BGW3 69% 1007 900 PROTEIN. 57% 887 846
HWBDJ08 762860 503 WUblastx.64 probable pol polyprotein-related
pir|S21348|S21348 47% 901 833 protein 4 - rat 43% 1262 1131 53%
1134 904 HWDAC26 821335 505 WUblastx.64 (Q14287) HYPOTHETICAL
Q14287 51% 1316 1471 PROTEIN (FRAGMENT). 57% 1093 1323 HWDAG96
796743 506 WUblastx.64 (AAH01119) Integrin beta 4 binding AAH01119
100% 108 842 protein. HWHPB78 740778 508 WUblastx.64 (Q9BUK4)
SIMILAR TO Q9BUK4 61% 360 614 HYPOTHETICAL PROTEIN 100% 677 817
FLJ10709. HYABC84 789854 509 WUblastx.64 (Q99L03) SIMILAR TO TRP4-
Q99L03 89% 209 553 ASSOCIATED PROTEIN TAP1 (FRAGMENT). HYABC84
865064 510 WUblastx.64 (Q9H429) DJ756N5.2 (A NOVEL Q9H429 92% 163
618 PROTEIN (DKFZP727M231) SIMILAR TO TRP4-AS H2CBD20 570796 511
WUblastx.64 (Q14288) HYPOTHETICAL Q14288 42% 758 988 PROTEIN
(FRAGMENT). 51% 987 1223 H2CBH91 826669 512 WUblastx.64 (Q9NXA3)
CDNA FLJ20357 FIS, Q9NXA3 63% 133 222 CLONE HEP16545. 53% 3 125 75%
603 737 68% 263 643 H2LBA54 684290 513 WUblastx.64 (O60875)
APOPTOSIS SPECIFIC O60875 97% 172 996 PROTEIN (DJ134E15.2)
(APOPTOSIS SPECIFIC H2LBB09 658667 514 WUblastx.64 (Q9P0R6)
HSPC210. Q9P0R6 95% 465 536 97% 73 477 H2LBB09 830636 515
WUblastx.64 (Q9P0R6) HSPC210. Q9P0R6 100% 504 575 97% 112 516
H2MBF60 695714 518 WUblastx.64 transcription factor TFIID 32K chain
pir|I39141|I39141 100% 163 909 TAFII32 - human H6EEA48 847111 520
WUblastx.64 (AAH07644) Similar to RIKEN cDNA AAH07644 90% 478 933
9430029K10 gene (F 96% 27 482 H6EEN71 829201 521 WUblastx.64
(Q9BW90) SIMILAR TO Q9BW90 100% 1943 1779 PEROXISOME BIOGENESIS
FACTOR 10. H6EEO05 865424 522 HMMER PFAM: EF hand PF00036 25 328
414 2.1.1 WUblastx.64 hypothetical protein pir|T17225|T17225 97%
265 522 DKFZp564C246.1 - human HACBJ11 797625 528 WUblastx.64
band-6-protein - human pir|S60712|S60712 100% 8 139 HACBS86 603946
529 WUblastx.64 (Q9BQB1) HYPOTHETICAL 22.5 KDA Q9BQB1 66% 89 682
PROTEIN. HADCL19 599065 535 WUblastx.64 (Q9H728) CDNA: FLJ21463
FIS, Q9H728 57% 1070 780 CLONE COL04765. HADDC04 601695 537
WUblastx.64 (Q9GML5) HYPOTHETICAL 8.0 KDA Q9GML5 57% 2522 2379
PROTEIN. HADDP51 853356 539 HMMER PFAM: TBC domain PF00566 52.3 357
509 2.1.1 WUblastx.64 (Q9H695) CDNA: FLJ22474 FIS, Q9H695 99% 12
701 CLONE HRC10568. HADET62 607615 541 WUblastx.64
retrovirus-related hypothetical protein pir|S23650|S23650 33% 506
330 II - human 1 27% 325 77 50% 657 592 44% 808 668 HADEY08 799507
542 WUblastx.64 (Q9NX94) CDNA FLJ20367 FIS, Q9NX94 98% 663 1076
CLONE HEP18101. HADEY22 861628 544 WUblastx.64 (Q9H728) CDNA:
FLJ21463 FIS, Q9H728 77% 590 459 CLONE COL04765. HADFB84 668229 545
WUblastx.64 (Q9H387) PRO2550. Q9H387 67% 758 1009 HADFD10 843934
547 WUblastx.64 (Q9P1C6) PRO2738. Q9P1C6 52% 1254 1054 HADFW20
599066 550 WUblastx.64 (Q9H9H0) CDNA FLJ12759 FIS, Q9H9H0 83% 1065
823 CLONE NT2RP2001347. HADFX10 741054 551 WUblastx.64 (O60448)
NEURONAL THREAD O60448 45% 1225 1040 PROTEIN AD7C-NTP. 62% 726 646
35% 1221 808 39% 1194 850 56% 917 729 33% 965 729 57% 1022 939 45%
726 628 51% 972 772 59% 972 715 57% 1225 1169 34% 1188 940 HADFY80
654831 552 WUblastx.64 (Q9H8X9) CDNA FLJ13153 FIS, Q9H8X9 94% 2 169
CLONE NT2RP3003409, WEAKLY SIMILAR TO HUM HADXA10 772423 555
WUblastx.64 (Q9NZ51) NEUROENDOCRINE Q9NZ51 78% 132 311
DIFFERENTIATION FACTOR. 79% 295 798 HADXA10 859777 556 WUblastx.64
(Q9D792) 9130011K15RIK Q9D792 49% 173 472 PROTEIN. HAFBB15 608180
557 HMMER PFAM: RNA 3'-terminal phosphate PF01137 159.5 186 440
2.1.1 cyclase WUblastx.64 RNA-3'-phosphate cyclase (EC
pir|T48844|T48844 93% 6 446 6.5.1.4) 1 [validated] - human HAGAB62
588471 559 WUblastx.64 (Q9H2I4) DC42. Q9H2I4 77% 8 232 HAGAB83
823044 560 WUblastx.64 (Q9NX17) CDNA FLJ20489 FIS, Q9NX17 47% 1597
1472 CLONE KAT08285. 76% 1817 1599 HAGAF75 561933 562 WUblastx.64
(Q9UI59) PRO0478 PROTEIN. Q9UI59 77% 1203 1310 HAGAK40 731929 563
WUblastx.64 (Q9H387) PRO2550. Q9H387 80% 506 658 70% 707 838
HAGAZ36 564230 565 WUblastx.64 pro-pol-dUTPase polyprotein - murine
pir|T29097|T29097 66% 613 578 endogenous retrovirus ERV-L 38% 897
655 (fragment) 34% 572 27 HAGBL31 679582 567 WUblastx.64 (Q13416)
ORIGIN RECOGNITION ORC2_HUMAN 97% 509 610 COMPLEX SUBUNIT 2.
HAGBO09 853357 568 WUblastx.64 (Q9NX17) CDNA FLJ20489 FIS, Q9NX17
78% 1533 1249 CLONE KAT08285. HAGBO12 601431 569 WUblastx.64
(Q9BGW3) HYPOTHETICAL 13.5 KDA Q9BGW3 63% 348 241 PROTEIN. 76% 532
353 HAGBS89 846292 571 WUblastx.64 (Q9P195) PRO1722. Q9P195 56%
1125 841 HAGBV06 701966 572 WUblastx.64 (Q9UHC7) MAKORIN 1. Q9UHC7
66% 28 195 HAGBV25 838174 573 WUblastx.64 (Q9H7C8) CDNA: FLJ21040
FIS, Q9H7C8 99% 1 1644 CLONE CAE10642. HAGBV29 837203 574
WUblastx.64 (Q9H387) PRO2550. Q9H387 70% 2054 1761 71% 439 585 60%
309 455 56% 749 955 48% 732 836 73% 687 731 HAGCC87 638587 575
WUblastx.64 (Q9BGW3) HYPOTHETICAL 13.5 KDA Q9BGW3 65% 992 1105
PROTEIN. 36% 54 116 57% 801 980 HAGCI69 560596 577 WUblastx.64
(Q9UI59) PRO0478 PROTEIN. Q9UI59 51% 1015 1185 HAGCZ70 747697 579
WUblastx.64 (Q9H397) PRO2852. Q9H397 41% 1672 1544 75% 1490 1359
77% 1366 1235 HAGDC73 724860 580 WUblastx.64 (Q9V662) CG12367
PROTEIN. Q9V662 37% 536 1006
HAGDJ53 821315 584 WUblastx.64 (Q9BGW3) HYPOTHETICAL 13.5 KDA
Q9BGW3 70% 1873 1781 PROTEIN. 46% 1796 1713 41% 1782 1582 HAGDL51
637488 586 WUblastx.64 (O60448) NEURONAL THREAD O60448 61% 1639
1532 PROTEIN AD7C-NTP. 70% 110 3 HAGDO70 812393 587 WUblastx.64
platelet-activating factor pir|JC4246|JC4246 94% 185 877
acetylhydrolase (EC 3.1.1.--) gamma chain - human HAGDT30 589514
588 WUblastx.64 (O75592) PROTEIN ASSOCIATED O75592 100% 11 280 WITH
MYC. 24% 11 208 100% 1125 1946 25% 295 933 90% 511 1131 45% 1445
1504 HAGDW68 835631 589 WUblastx.64 (AAC14670) AAC14670 100% 390
470 WUGSC: H_DJ0651K02.1 protein 99% 2 385 (Fragment). HAGEK86
748222 592 WUblastx.64 (O43237) DYNEIN LIGHT DYJ2_HUMAN 88% 1066
1617 INTERMEDIATE CHAIN 2, CYTOSOLIC (LIC5 HAGEP30 604478 593
WUblastx.64 (Q9H387) PRO2550. Q9H387 84% 594 517 67% 788 606
HAGEQ67 838445 595 WUblastx.64 (Q94532) PUTATIVE TYPE III Q94532
55% 22 123 ALCOHOL DEHYDROGENASE. 59% 108 722 HAGEU26 608183 596
WUblastx.64 (Q9GMX5) HYPOTHETICAL 12.9 KDA Q9GMX5 59% 356 481
PROTEIN. HAGFM58 604536 603 WUblastx.64 (Q9H3C0) PRO0898. Q9H3C0
62% 10 144 HAGFT48 780112 604 WUblastx.64 (Q9Y2Y7) FOOCEN-M (NOGO-B
Q9Y2Y7 80% 761 1090 PROTEIN) (RTN-XS) (RETICULON 100% 1156 1281
4B). 48% 233 559 HAGFU31 751713 605 WUblastx.64 (O60448) NEURONAL
THREAD O60448 65% 1214 1083 PROTEIN AD7C-NTP. 68% 1245 1084 45%
1093 1028 52% 1015 953 68% 1094 1029 71% 1230 967 HAGFW13 634611
606 WUblastx.64 (O00549) ORF2-LIKE PROTEIN O00549 65% 398 321
(FRAGMENT). 65% 453 385 70% 307 164 HAGHE85 838059 607 WUblastx.64
(Q9P195) PRO1722. Q9P195 58% 1665 1498 69% 1511 1365 HAHSD51 847014
612 WUblastx.64 (Q9D8B4) 2010012C24RIK Q9D8B4 50% 99 176 PROTEIN.
61% 182 505 HAIBV91 852223 615 WUblastx.64 (Q9N083) UNNAMED PORTEIN
Q9N083 59% 672 899 PRODUCT. 40% 1911 1955 HAICE62 834523 616
WUblastx.64 (Q9H3T5) MOB1 PROTEIN Q9H3T5 100% 203 850 (HYPOTHETICAL
25.1 KDA PROTEIN). HAICL90 637491 617 WUblastx.64 (Q9N083) UNNAMED
PORTEIN Q9N083 63% 716 438 PRODUCT. HAIDP45 847015 619 WUblastx.64
(AAH08590) Hypothetical 47.9 kDa AAH08590 100% 986 1096 protein.
HAJAB88 780114 620 HMMER PFAM: Ribosomal protein L34 PF00468 32.3
276 401 2.1.1 WUblastx.64 (Q9BQ48) MITOCHONDRIAL Q9BQ48 98% 126 374
RIBOSOMAL PROTEIN L34 (L34MT) (UNKNOWN) (PROTE HAMGG01 783864 624
WUblastx.64 (Q9BY78) RING FINGER PROTEIN Q9BY78 86% 7 342 WITH
LEUCINE ZIPPER RNF26. HANKC93 847018 626 WUblastx.64 (Q9H387)
PRO2550. Q9H387 67% 648 565 52% 876 820 61% 748 656 HAPAD35 840584
627 WUblastx.64 (Q9NX85) CDNA FLJ20378 FIS, Q9NX85 76% 1346 1245
CLONE KAIA0536. 63% 1237 1064 HAPBR13 609976 628 WUblastx.64
(Q9H6T0) CDNA: FLJ21918 FIS, Q9H6T0 26% 273 452 CLONE HEP04006. 51%
95 274 40% 424 762 HAPBU09 762803 629 WUblastx.64 (O60859)
NEUROPATHY TARGET O60859 100% 3 545 ESTERASE. HAPNJ33 835554 632
WUblastx.64 (BAA85159) Sec61. BAA85159 100% 1200 1403 98% 163 1230
HAPNL62 790340 633 WUblastx.64 (BAB55063) CDNA FLJ14456 fis,
BAB55063 93% 1 1977 clone HEMBB1001915, m HAPNO50 834384 634
WUblastx.64 hypothetical protein pir|T08701|T08701 98% 27 332
DKFZp564N123.1 - human (fragment) 88% 3 29 86% 323 883 HAPPW83
847020 636 WUblastx.64 (Q9H387) PRO2550. Q9H387 77% 626 757 84% 475
627 HAPRK55 735887 643 WUblastx.64 (Q9NX17) CDNA FLJ20489 FIS,
Q9NX17 63% 1379 1068 CLONE KAT08285. HAPSH37 847021 644 WUblastx.64
(Q9H387) PRO2550. Q9H387 75% 63 28 84% 199 68 HAQBY85 832384 646
WUblastx.64 (Q9D4H9) 4932409F11RIK Q9D4H9 100% 17 358 PROTEIN. 55%
1663 1716 28% 1066 1212 34% 1459 1728 93% 361 1539 HAQBZ15 801966
647 WUblastx.64 (AAH07201) Unknown (protein for AAH07201 100% 6 86
IMAGE: 2961284) (Fra 30% 1717 1824 93% 175 711 37% 1019 1564 29%
1277 1510 35% 1711 1836 97% 1705 1956 35% 843 953 31% 205 357 27%
187 408 67% 641 1708 52% 1711 1836 31% 849 962 31% 1078 1296 26%
1241 1696 36% 1123 1266 30% 1292 1564 27% 1081 1146 37% 882 953 30%
205 498 29% 1684 1938 29% 196 357 27% 1054 1317 90% 83 181 HARAE26
560598 650 WUblastx.64 (Q9H743) CDNA: FLJ21394 FIS, Q9H743 65% 1204
1076 CLONE COL03536. 75% 1068 925 HARAT69 769389 651 WUblastx.64
(Q9VZ55) CG1582 PROTEIN. Q9VZ55 48% 2 1360 HARAZ81 832380 652
WUblastx.64 (Q9BQ36) MITOCHONDRIAL Q9BQ36 97% 7 327 RIBOSOMAL
PROTEIN BMRP64 (HYPOTHETICAL 15.1 KD HASAU26 845848 653 WUblastx.64
(Q9H964) CDNA FLJ12984 FIS, Q9H964 94% 3 107 CLONE NT2RP3000047,
WEAKLY 95% 132 194 SIMILAR TO NPL 98% 820 1425 40% 2405 2479 98%
188 829 100% 98 133 HASAY07 834511 655 WUblastx.64 catalase (EC
1.11.1.6) - pir|I40767|I40767 96% 263 177 Campylobacter jejuni
HATAE01 654834 656 WUblastx.64 (Q9NX17) CDNA FLJ20489 FIS, Q9NX17
71% 569 507 CLONE KAT08285. 95% 636 574 72% 790 647 HATAL05 847023
658 WUblastx.64 (Q9ER61) MDM2 BINDING Q9ER61 68% 10 876 PROTEIN.
HATCF80 780460 661 WUblastx.64 (Q99LV8) UNKNOWN (PROTEIN Q99LV8 78%
9 479 FOR IMAGE: 3489486) (FRAGMENT). HATCI67 847024 662
WUblastx.64 (Q9UHU3) PRO1659. Q9UHU3 85% 214 528 HATDH23 603959 668
WUblastx.64 (O43439) MTG8-LIKE PROTEIN O43439 98% 1 348 (MTG8
RELATED PROTEIN) (EHT) (EHT PROTEIN) HATDO84 609850 670 WUblastx.64
(Q9NX85) CDNA FLJ20378 FIS, Q9NX85 58% 798 646 CLONE KAIA0536. 77%
919 812 HATDU01 847028 671 WUblastx.64 (Q9H387) PRO2550. Q9H387 81%
1257 1225 58% 1198 974 HAUCC84 830672 677 WUblastx.64 (O75353)
ANTI-DEATH PROTEIN. O75353 72% 44 259 98% 250 498 HAWAS41 877621
678 WUblastx.64 (Q9BGV8) HYPOTHETICAL 10.0 KDA Q9BGV8 66% 754 930
PROTEIN. HAWBA65 542056 679 WUblastx.64 (Q24333) ELASTIN LIKE
PROTEIN Q24333 100% 41 112 (FRAGMENT). HBAGH64 801884 680
WUblastx.64 (Q14287) HYPOTHETICAL Q14287 37% 810 568 PROTEIN
(FRAGMENT). HBBBA42 841010 684 WUblastx.64 (Q9UIL1) HRIHFB2072
PROTEIN Q9UIL1 58% 3 263 (FRAGMENT). 57% 6 269 HBCAQ48 525002 690
WUblastx.64 (O75528) ADA3-LIKE PROTEIN. O75528 84% 73 345 HBGBE75
897455 694 WUblastx.64 (O60830) MITOCHONDRIAL I17B_HUMAN 97% 98 307
IMPORT INNER MEMBRANE TRANSLOCASE SU HBHAA53 603183 699 WUblastx.64
(Q9N083) UNNAMED PORTEIN Q9N083 65% 439 326 PRODUCT. 68% 594 415
HBIAU43 840354 700 WUblastx.64 (Q9UI59) PRO0478 PROTEIN. Q9UI59 76%
1109 1225 HBIAW58 596805 701 WUblastx.64 (Q9H728) CDNA: FLJ21463
FIS, Q9H728 66% 1268 1188 CLONE COL04765. 77% 1335 1270 68% 1486
1337 HBIBF26 845743 703 WUblastx.64 (Q9NQQ7) BA394O2.1 (CGI-15
Q9NQQ7 76% 1214 1405 PROTEIN). 74% 804 1223 47% 780 845 78% 313 825
HBIBQ69 580807 706 WUblastx.64 (BAB55217) CDNA FLJ14686 fis,
BAB55217 94% 671 724 clone NT2RP2004961, m 100% 721 810 HBIBR38
612783 707 WUblastx.64 (Q9NX17) CDNA FLJ20489 FIS, Q9NX17 73% 802
503 CLONE KAT08285. HBIBS33 590280 709 WUblastx.64 (Q9H960) CDNA
FLJ12988 FIS, Q9H960 62% 595 452 CLONE NT2RP3000080. HBIBZ20 688861
711 WUblastx.64 (O75717) ACIDIC O75717 99% 229 603 NUCLEOPLASMIC
DNA-BINDING PROTEIN 1 (AND-1). HBICB80 637516 712 WUblastx.64
(Q9BV17) SIMILAR TO CG9172 Q9BV17 90% 545 637 GENE PRODUCT. 91% 18
557 HBJAC40 841235 713 WUblastx.64 (Q9P112) CHROMOSOME 16 OPEN
Q9P112 100% 8 73 READING FRAME 5. 36% 5 70 57% 11 52 53% 85 180
100% 192 632 HBJAV56 603529 714 WUblastx.64 (Q9H387) PRO2550.
Q9H387 58% 642 478 67% 715 623 75% 780 745 HBJBR40 581104 717
WUblastx.64 (Q9GMX5) HYPOTHETICAL 12.9 KDA Q9GMX5 54% 931 860
PROTEIN. 66% 861 745 HBJCH46 609859 718 WUblastx.64 conserved
hypothetical protein pir|D83014|D83014 53% 1070 900 PA5065
[imported] - Pseudomonas 78% 900 1 aeruginosa (strain PAO1) HBJCS26
821682 720 WUblastx.64 (Q9H0D4) HYPOTHETICAL 54.1 KDA Q9H0D4 92%
227 1576 PROTEIN. HBJDR18 604907 723 WUblastx.64 (Q9H6G8) CDNA:
FLJ22294 FIS, Q9H6G8 81% 940 875 CLONE HRC04426. 77% 1092 934
HBJDR83 600395 724 WUblastx.64 (Q14273) POL/ENV ORF. Q14273 71% 559
621 60% 813 902 68% 614 718 41% 1223 1291 62% 14 556 HBJEL21 866158
726 WUblastx.64 (Q9UQR1) ZINC FINGER PROTEIN Z148_HUMAN 97% 807
2063 148 (ZINC FINGER DNA BINDING P HBJFH84 836997 727 WUblastx.64
(Q9LM25) T10O22.22. Q9LM25 30% 118 921 HBJFJ26 873844 3102
WUblastx.64 (Q9BWK5) UNKNOWN (PROTEIN Q9BWK5 94% 657 758 FOR MGC:
5242). 100% 336 389
100% 427 657 HBJHO83 610259 736 HMMER PFAM: ENV polyprotein (coat
PF00429 40.5 207 389 2.1.1 polyprotein) WUblastx.64 (Q85641) 3' END
OF THE GENOME Q85641 85% 2 61 OF MOLONEY MURINE 28% 177 365
LEUKEMIA VIRUS (CODES 46% 64 180 HBJIR14 793391 741 WUblastx.64
(Q9H832) CDNA FLJ13968 FIS, Q9H832 91% 134 871 CLONE Y79AA1001493,
WEAKLY SIMILAR TO UBI HBJJA26 743181 742 WUblastx.64 (Q9BRM8)
UNKNOWN (PROTEIN Q9BRM8 47% 647 423 FOR MGC: 13219). HBJND04 837242
745 HMMER PFAM: Bacterial mutT protein PF00293 26.2 -360 -479 2.1.1
WUblastx.64 (Q9BW91) UNKNOWN (PROTEIN Q9BW91 91% 309 1352 FOR MGC:
3037). HBJND57 612785 746 WUblastx.64 (Q9VCB4) CG17741 PROTEIN.
Q9VCB4 52% 1 318 HBKEE60 793788 749 WUblastx.64 pro-pol-dUTPase
polyprotein - murine pir|T29097|T29097 64% 97 204 endogenous
retrovirus ERV-L 39% 3 128 (fragment) 62% 273 620 HBKEI41 827278
750 WUblastx.64 (BAB47402) CG10671-like. BAB47402 100% 436 465 90%
596 757 59% 498 623 77% 5 436 HBMBD51 842176 751 WUblastx.64
hypothetical protein pir|T50632|T50632 98% 2197 2709
DKFZp762E1511.1 - human (fragment) HBMBD73 839564 752 WUblastx.64
MAP kinase 1 (EC 2.7.1.--) - human pir|JQ1400|JQ1400 91% 93 161 92%
127 1137 HBMBM17 637518 754 WUblastx.64 (Q9NX85) CDNA FLJ20378 FIS,
Q9NX85 75% 950 840 CLONE KAIA0536. 75% 1083 949 HBMCL59 608668 755
WUblastx.64 (Q9H728) CDNA: FLJ21463 FIS, Q9H728 45% 630 472 CLONE
COL04765. 60% 796 608 HBMCM96 821318 756 WUblastx.64 (Q9H728) CDNA:
FLJ21463 FIS, Q9H728 57% 2253 2155 CLONE COL04765. 63% 2177 1971
HBMCQ74 856461 757 WUblastx.64 (Q9JKP5) MUSCLEBLIND. Q9JKP5 100%
561 590 52% 13 213 83% 1 465 HBMCQ74 864382 758 WUblastx.64
(Q9JKP5) MUSCLEBLIND. Q9JKP5 100% 561 590 52% 13 213 83% 1 465
HBMDM08 837927 760 WUblastx.64 (Q9P0I2) 30 KDA PROTEIN. Q9P0I2 94%
190 972 HBMSO30 843389 762 WUblastx.64 (Q9D4B1) 4933405A16RIK
Q9D4B1 78% 52 174 PROTEIN. HBMTM50 609988 763 WUblastx.64 (Q9NX85)
CDNA FLJ20378 FIS, Q9NX85 76% 763 689 CLONE KAIA0536. 55% 962 765
HBMUD59 701970 764 WUblastx.64 (Q9BR03) C367G8.2 (NOVEL Q9BR03 91%
9 647 PROTEIN) (FRAGMENT). HBMUR39 647594 767 WUblastx.64 (Q9N083)
UNNAMED PORTEIN Q9N083 55% 883 803 PRODUCT. 39% 810 577 HBMWC39
523713 770 WUblastx.64 (Q9H728) CDNA: FLJ21463 FIS, Q9H728 71% 1055
1117 CLONE COL04765. 67% 820 1053 HBMWS52 872553 772 WUblastx.64
(Q9H728) CDNA: FLJ21463 FIS, Q9H728 62% 1341 997 CLONE COL04765.
HBMXG01 689522 774 WUblastx.64 (Q9BGX7) HYPOTHETICAL 13.0 KDA
Q9BGX7 58% 838 885 PROTEIN. 71% 900 1055 HBMXG76 580812 775
WUblastx.64 probable phosphodiesterase I (EC pir|T43461|T43461 98%
37 222 3.1.4.1) - human (fragment) HBMXW83 725335 777 WUblastx.64
glutamate-cysteine ligase (EC 6.3.2.2) pir|JH0611|JH0611 100% 492
584 heavy chain - human 90% 373 498 HBNAE74 637524 778 WUblastx.64
(Q9NU78) DJ622L5.7.1 (NOVEL Q9NU78 100% 6 146 PROTEIN (ISOFORM 1)).
HBNAX16 843727 779 WUblastx.64 (Q9BT21) SIMILAR TO RIKEN Q9BT21 92%
360 2639 CDNA 2610005L19 GENE (FRAGMENT). HBODK40 852382 781
WUblastx.64 (Q9Y6B7) ADAPTER-RELATED A4B1_HUMAN 89% 55 696 PROTEIN
COMPLEX 4 BETA 1 99% 674 1741 SUBUNIT ( HBODV76 866420 782
WUblastx.64 (O60662) KELCH-RELATED KRP1_HUMAN 83% 474 902 PROTEIN 1
(KEL-LIKE PROTEIN 100% 71 475 23) (SAR 96% 808 1905 HBPAF39 850786
784 WUblastx.64 (Q9NX85) CDNA FLJ20378 FIS, Q9NX85 51% 1217 849
CLONE KAIA0536. HBQAC72 799512 786 WUblastx.64 transcription factor
znf6 - human pir|S25409|S25409 90% 2072 1110 33% 1844 1227 30% 2024
1215 30% 1757 1194 31% 1844 1401 HBSAJ63 848683 788 WUblastx.64
(BAB55144) CDNA FLJ14576 fis, BAB55144 92% 11 406 clone
NT2RM4001092, w HBSDD24 839802 790 WUblastx.64 (Q9UJ70) N- Q9UJ70
100% 886 1251 ACETYLGLUCOSAMINE KINASE PROTEIN (EC 2.7.1.59).
HBWBD25 800765 791 WUblastx.64 (O08872) PUTATIVE RNA O08872 49% 850
698 BINDING PROTEIN 1 30% 1473 853 (FRAGMENT). HBXAS93 836513 792
WUblastx.64 (Q14940) SODIUM/HYDROGEN NAH5_HUMAN 85% 532 1023
EXCHANGER 5 (NA(+)/H(+) 78% 2 238 EXCHANGER 90% 256 321 HBXAW57
815650 794 WUblastx.64 (Q9N083) UNNAMED PORTEIN Q9N083 56% 1223
1071 PRODUCT. HBXBM78 812527 797 WUblastx.64 (Q9Y613) FH1/FH2
DOMAINS- FHOS_HUMAN 84% 846 259 CONTAINING PROTEIN (FORMIN 28% 2503
2138 HOMOLOG 100% 1004 852 97% 1903 1046 100% 2311 2042 42% 2184
2122 28% 1777 1334 55% 2520 2248 HBXCD59 860439 798 WUblastx.64
(Q9C026) TRIPARTITE MOTIF Q9C026 99% 59 823 PROTEIN TRIM9 ISOFORM
BETA. HBXCG08 628501 800 WUblastx.64 (Q9BSG3) UNKNOWN (PROTEIN
Q9BSG3 98% 758 1024 FOR MGC: 12974). HBXCM52 799513 801 WUblastx.64
(Q9BH03) HYPOTHETICAL 12.0 KDA Q9BH03 53% 683 850 PROTEIN. 73% 784
942 80% 903 1028 HBXCQ03 589516 802 WUblastx.64 (Q9Y296) PTD009
(HSPC172). Q9Y296 100% 382 672 100% 17 382 HBXDN08 566765 806
WUblastx.64 (O43597) SPROUTY HOMOLOG 2 SPY2_HUMAN 100% 8 256
(SPRY-2). HBXDN65 840021 807 WUblastx.64 (Q9H387) PRO2550. Q9H387
75% 1925 1641 HBXFA04 842901 808 WUblastx.64 (AAH08467) Similar to
RIKEN cDNA AAH08467 95% 287 499 1110001J03 gene. HBXFE64 838824 809
WUblastx.64 (Q9H728) CDNA: FLJ21463 FIS, Q9H728 57% 1646 1320 CLONE
COL04765. HBXFP72 688040 811 WUblastx.64 (Q9H754) CDNA: FLJ21308
FIS, Q9H754 93% 7 1155 CLONE COL02131. HBXFS31 815651 812
WUblastx.64 (Q9NX17) CDNA FLJ20489 FIS, Q9NX17 65% 469 678 CLONE
KAT08285. 70% 1551 1261 HBXFW01 847001 813 HMMER PFAM: Stathmin
family PF00836 185.7 266 523 2.1.1 WUblastx.64 (Q9H169) RB3 PROTEIN
Q9H169 100% 523 690 (HYPOTHETICAL 22.1 KDA 100% 125 523 PROTEIN).
HBXGE12 1310891 814 WUblastx.64 (O95902) UNKNOWN O95902 100% 31 411
(FRAGMENT). HBXGE12 745398 3103 WUblastx.64 (AF131851) Unknown
[Homo sapiens] gb|AAD20061.1| 100% 10 390 HBXGL91 901845 815
WUblastx.64 (Q9H2J7) ORPHAN Q9H2J7 100% 949 1470 NEUROTRANSMITTER
100% 10 99 TRANSPORTER V7-3. 95% 389 979 HBXGM24 821320 816
WUblastx.64 hypothetical protein (L1H 3' region) -
pir|B34087|B34087 77% 712 647 human 46% 740 660 48% 639 475 57% 85
23 64% 530 84 HCBAB34 847002 821 WUblastx.64 (Q9BWF8) UNKNOWN
(PROTEIN Q9BWF8 95% 1009 1308 FOR IMAGE: 3355813) 98% 814 963
(FRAGMENT). 95% 680 823 60% 29 583 HCDAH02 653066 825 WUblastx.64
(BAB55208) CDNA FLJ14668 fis, BAB55208 81% 655 491 clone
NT2RP2003194. 83% 492 241 HCDAP33 566794 826 WUblastx.64 (O75964)
ATP SYNTHASE G ATPN_HUMAN 73% 407 664 CHAIN, MITOCHONDRIAL (EC
3.6.1.34) HCDAR40 654821 827 WUblastx.64 (Q9P195) PRO1722. Q9P195
63% 837 514 HCDAS02 896667 828 WUblastx.64 (O75153) PUTATIVE
EUKARYOTIC IF3X_HUMAN 89% 79 867 TRANSLATION INITIATION FACTOR
HCDBO32 831942 830 WUblastx.64 (AAH17472) Hypothetical 21.3 kDa
AAH17472 69% 643 801 protein. 100% 239 583 HCDBW67 733860 831
WUblastx.64 (Q9H410) DJ469A13.2 (NOVEL Q9H410 97% 43 255 PROTEIN)
(FRAGMENT). HCDCB03 571037 833 HMMER PFAM: Zinc carboxypeptidase
PF00246 103.3 35 337 2.1.1 WUblastx.64 carboxypeptidase H (EC
3.4.17.10) pir|S09489|S09489 91% 657 728 precursor - human 66% 11
664 HCDCE51 813504 834 WUblastx.64 (Q9N083) UNNAMED PORTEIN Q9N083
55% 1016 837 PRODUCT. HCDCI42 847004 835 WUblastx.64 (Q9UHD2) TANK
BINDING Q9UHD2 100% 678 875 KINASE TBK1 (NF-KB- ACTIVATING KINASE
NAK). HCDDB15 841041 836 WUblastx.64 (Q9BW53) UNKNOWN (PROTEIN
Q9BW53 100% 98 703 FOR IMAGE: 3343149) (FRAGMENT). HCDDY28 892137
838 WUblastx.64 (Q14287) HYPOTHETICAL Q14287 55% 1458 1312 PROTEIN
(FRAGMENT). 60% 1312 1013 HCDEB19 587264 839 WUblastx.64 nuclear
matrix protein NMP 238 - pir|JE0334|JE0334 100% 1218 1436 human 93%
426 470 99% 473 829 98% 76 438 31% 605 700 31% 1335 1430 91% 838
1218 HCDES69 609997 841 WUblastx.64 (Q9H8N2) CDNA FLJ13381 FIS,
Q9H8N2 61% 524 423 CLONE PLACE1001010. 62% 687 553 HCE1D45 664481
842 WUblastx.64 (Q9UDU0) WUGSC: H_DJ400N23.1 Q9UDU0 84% 10 279
PROTEIN (ZINC FINGER SARCOMA GENE LONG A HCE1T53 843680 844
WUblastx.64 (Q9NX17) CDNA FLJ20489 FIS, Q9NX17 71% 725 663 CLONE
KAT08285. 65% 843 739 92% 1450 1412 67% 1409 1140 HCE1Y27 637529
845 WUblastx.64 (O95741) COPINE VI (NEURONAL- CNE6_HUMAN 80% 887
946 COPINE) (N-COPINE). 98% 519 896 95% 901 1353 93% 16 561 HCE1Y34
809084 846 WUblastx.64 (Q9NX85) CDNA FLJ20378 FIS, Q9NX85 61% 1718
1680 CLONE KAIA0536. 51% 1680 1411 HCE2E47 886155 848 WUblastx.64
(Q9H387) PRO2550. Q9H387 72% 1254 1448 67% 1450 1533 HCE2P90 737935
850 WUblastx.64 (AAH07558) Unknown (protein for AAH07558 47% 792
896 MGC: 15483). 42% 640 795 HCE3C46 737889 852 WUblastx.64
(Q9NX17) CDNA FLJ20489 FIS, Q9NX17 41% 186 260 CLONE KAT08285. 62%
751 1032 HCE3D58 873227 853 WUblastx.64 (Q9H026) HYPOTHETICAL 16.0
KDA Q9H026 70% 421 879
PROTEIN (FRAGMENT). HCE3N23 810211 857 WUblastx.64 (Q9D2L0)
4833417L20RIK Q9D2L0 42% 1150 1539 PROTEIN. 38% 1147 1536 71% 423
590 70% 913 1044 55% 584 925 54% 916 1047 44% 370 423 58% 863 913
72% 77 358 HCE3R01 834836 858 WUblastx.64 (O95251) HISTONE O95251
76% 6 320 ACETYLTRANSFERASE. 84% 68 1111 HCE3R01 841472 859
WUblastx.64 (O95251) HISTONE O95251 76% 6 320 ACETYLTRANSFERASE.
84% 68 1111 HCE3R01 844574 860 WUblastx.64 (O95251) HISTONE O95251
76% 6 320 ACETYLTRANSFERASE. 84% 68 1111 HCE3R46 844450 861
WUblastx.64 (O95894) UNKNOWN (DERP2). O95894 91% 131 1165 HCE4H32
843941 862 WUblastx.64 (Q9NVF5) CDNA FLJ10769 FIS, Q9NVF5 92% 926
964 CLONE NT2RP4000151. 65% 964 1104 64% 73 402 94% 333 893 HCE4H32
874256 863 WUblastx.64 (Q9P0P1) HSPC237. Q9P0P1 100% 1260 1322 100%
1325 1765 HCE4W88 792953 865 WUblastx.64 (Q9Y5W4) MLL SEPTIN-LIKE
Q9Y5W4 100% 3676 2003 FUSION PROTEIN (CELL DIVISION CONTROL PROTEI
HCE5B62 566864 866 WUblastx.64 (O60448) NEURONAL THREAD O60448 70%
1011 850 PROTEIN AD7C-NTP. 47% 1056 757 64% 1653 1486 58% 1563 1441
47% 953 810 70% 1470 1420 34% 820 725 40% 1023 943 62% 956 855 58%
778 728 58% 1553 1425 63% 1653 1546 61% 1632 1579 38% 1631 1500 36%
981 748 55% 1696 1637 56% 1505 1410 50% 1496 1431 45% 823 725 59%
846 781 61% 995 834 43% 1557 1420 84% 1683 1645 62% 1673 1425
HCE5H86 847032 867 WUblastx.64 (O95637) WW DOMAIN BINDING O95637
83% 1574 2107 PROTEIN-1. 66% 847 1248 66% 1300 1539 HCE5J64 688883
868 WUblastx.64 (Q9GMX5) HYPOTHETICAL 12.9 KDA Q9GMX5 64% 2021 2122
PROTEIN. 56% 1903 2031 HCEBF54 847033 869 WUblastx.64 (Q9NQ43)
HYPOTHETICAL 18.4 KDA Q9NQ43 100% 338 583 PROTEIN (FRAGMENT).
HCEDN07 847034 874 WUblastx.64 (Q9H387) PRO2550. Q9H387 93% 1256
1212 86% 1186 1121 71% 1410 1255 HCEEG48 896688 876 WUblastx.64
(AAK55521) PRO0764. AAK55521 70% 919 680 HCEEM33 821322 877
WUblastx.64 hypothetical protein pir|T46310|T46310 100% 3 746
DKFZp434G0511.1 - human HCEFA94 822850 882 WUblastx.64 (Q9BGW3)
HYPOTHETICAL 13.5 KDA Q9BGW3 56% 1066 1224 PROTEIN. HCEFG93 745400
884 WUblastx.64 (Q9H387) PRO2550. Q9H387 66% 1178 1134 80% 1114
1052 76% 1323 1186 HCEFH31 801890 885 WUblastx.64 (Q9ULW1) SPONDIN
2. Q9ULW1 100% 1503 1685 HCEFK56 872554 886 WUblastx.64 (Q9UIU2)
DYNACTIN 1 P150 Q9UIU2 92% 7 2088 ISOFORM. HCEGK81 844452 890
WUblastx.64 (Q9H387) PRO2550. Q9H387 88% 524 649 68% 390 455 76%
487 525 HCEGS49 846298 891 WUblastx.64 (O60448) NEURONAL THREAD
O60448 42% 711 529 PROTEIN AD7C-NTP. 92% 651 610 61% 856 710 72%
870 838 66% 721 659 61% 872 711 68% 857 579 HCEGY33 753258 893
WUblastx.64 (O75843) ADAPTER-RELATED A1G2_HUMAN 97% 1131 988
PROTEIN COMPLEX 1 GAMMA 2 89% 873 760 SUBUNIT 100% 1396 1274 68%
393 256 96% 603 523 98% 2024 1818 HCEHW24 560610 894 WUblastx.64
(Q9BGX7) HYPOTHETICAL 13.0 KDA Q9BGX7 55% 1001 1297 PROTEIN.
HCEJL08 722208 895 WUblastx.64 (AAH08203) Chromosome X open
AAH08203 59% 36 170 reading frame 12. 96% 581 775 58% 2 103 79% 130
570 HCELB04 847375 897 WUblastx.64 (Q9P290) POTENT BRAIN TYPE
Q9P290 96% 994 1083 ORGANIC ION TRANSPORTER. 94% 156 263 71% 677
1024 100% 317 544 62% 1106 1177 73% 500 544 75% 1064 1579 HCEMA08
846468 898 WUblastx.64 ATPase inhibitor precursor,
pir|JC7175|JC7175 65% 1599 1739 mitochondrial - human 100% 67 216
HCENQ22 740746 900 WUblastx.64 (Q9H926) CDNA FLJ13059 FIS, Q9H926
80% 1086 934 CLONE NT2RP3001589. HCEOF01 564906 901 WUblastx.64
(Q9H728) CDNA: FLJ21463 FIS, Q9H728 50% 1669 1586 CLONE COL04765.
75% 1551 1366 HCEOF01 850521 902 WUblastx.64 (Q9H728) CDNA:
FLJ21463 FIS, Q9H728 50% 1668 1585 CLONE COL04765. 75% 1550 1365
HCEOV48 850681 905 WUblastx.64 (Q9DA75) 1700018O18RIK Q9DA75 83%
1344 1739 PROTEIN. 76% 193 1311 HCEPO08 637543 907 WUblastx.64
ribosomal protein L29, cytosolic - pir|S65784|S65784 100% 614 504
human 64% 516 145 HCESB03 812940 908 WUblastx.64 (Q9HD86) NAG18.
Q9HD86 76% 729 857 HCETL19 702090 911 WUblastx.64
retrovirus-related env polyprotein pir|E24483|VCHUER 79% 580 464
pseudogene - human HCFAT42 815652 915 WUblastx.64 (Q9G6T1)
CYTOCHROME Q9G6T1 79% 699 884 OXIDASE SUBUNIT 3. 47% 369 431
HCFAT66 821337 916 WUblastx.64 (Q9HAD8) CDNA FLJ11786 FIS, Q9HAD8
64% 1754 1662 CLONE HEMBA1006036. 69% 1641 1453 HCFBA30 608166 917
WUblastx.64 (Q9BU56) UNKNOWN (PROTEIN Q9BU56 75% 357 692 FOR IMAGE:
3940029) 45% 192 245 (FRAGMENT). HCFBM77 604576 918 WUblastx.64
(O60448) NEURONAL THREAD O60448 59% 729 664 PROTEIN AD7C-NTP. 75%
880 719 77% 865 605 HCFCB72 824165 920 WUblastx.64 (Q9NX85) CDNA
FLJ20378 FIS, Q9NX85 63% 1537 1370 CLONE KAIA0536. 59% 1707 1555
HCFCG91 897509 921 WUblastx.64 (Q9V677) CG8858 PROTEIN. Q9V677 47%
53 511 32% 786 2780 43% 492 785 24% 480 950 23% 1269 1565 21% 1275
1643 26% 1800 1922 HCFCM81 847378 922 WUblastx.64 (O00398) PUTATIVE
PURINERGIC O00398 96% 281 1297 RECEPTOR P2Y10. HCFLJ52 1307037 928
WUblastx.64 (O00466) K12 PROTEIN O00466 95% 362 418 PRECURSOR. 100%
415 561 100% 121 372 HCFLJ52 753260 3104 WUblastx.64 (AX055560)
unnamed protein product emb|CAC22100.1| 100% 91 126 [Homo sapiens]
56% 14 94 98% 123 287 HCFLY20 786452 932 WUblastx.64 hypothetical
protein pir|T46299|T46299 85% 57 380 DKFZp434J0310.1 - human 93%
437 784 65% 936 1022 40% 167 226 76% 757 936 HCFLY20 858875 933
WUblastx.64 hypothetical protein pir|T46299|T46299 85% 68 391
DKFZp434J0310.1 - human 72% 959 1033 40% 178 237 89% 448 951
HCFMX16 581042 938 WUblastx.64 (Q9BGW3) HYPOTHETICAL 13.5 KDA
Q9BGW3 54% 304 29 PROTEIN. HCFMX88 825989 939 WUblastx.64 (Q9HAD8)
CDNA FLJ11786 FIS, Q9HAD8 71% 1068 1130 CLONE HEMBA1006036. 77% 853
945 69% 959 1066 HCFNM40 746864 940 WUblastx.64 catalase (EC
1.11.1.6) - pir|I40767|I40767 84% 246 130 Campylobacter jejuni
HCFNM50 732010 941 WUblastx.64 (Q9NX17) CDNA FLJ20489 FIS, Q9NX17
75% 1258 1103 CLONE KAT08285. HCFNN75 762959 943 WUblastx.64
(Q9BGZ4) HYPOTHETICAL 11.6 KDA Q9BGZ4 56% 821 696 PROTEIN. HCGBA15
604603 946 WUblastx.64 (AAK55521) PRO0764. AAK55521 81% 791 726 80%
925 881 80% 724 662 65% 903 790 HCHAC68 610370 947 HMMER PFAM: Ank
repeat PF00023 58.1 462 560 2.1.1 WUblastx.64 (Q9Y290) RELA
ASSOCIATED Q9Y290 90% 201 770 INHIBITOR. 93% 52 96 100% 770 871 70%
6 50 HCHBP49 892141 948 WUblastx.64 hypothetical protein
pir|T47147|T47147 91% 8 457 DKFZp761H229.1 - human (fragment)
HCHCG33 862534 950 WUblastx.64 (Q9H728) CDNA: FLJ21463 FIS, Q9H728
66% 2068 1988 CLONE COL04765. 75% 2285 2073 HCHMY57 833049 951
WUblastx.64 (Q9BV10) UNKNOWN (PROTEIN Q9BV10 84% 12 1202 FOR MGC:
3136). HCHOC06 688042 952 WUblastx.64 (Q9BZH7) GASTRIC CANCER-
Q9BZH7 75% 131 424 RELATED PROTEIN VRG107. HCHOY52 837297 953
WUblastx.64 (Q9BT25) UNKNOWN (PROTEIN Q9BT25 89% 27 1223 FOR IMAGE:
3636299) (FRAGMENT). HCHQB93 793648 954 WUblastx.64 GTP-binding
protein 2 - human pir|PC7084|PC7084 89% 767 985 (fragment) 92% 258
788 86% 2 46 37% 36 143 100% 61 258 HCHQB93 875853 955 WUblastx.64
GTP-binding protein 2 - human pir|PC7084|PC7084 89% 767 985
(fragment) 92% 258 788 86% 2 46 37% 36 143 100% 61 258 HCLCU75
862406 957 WUblastx.64 (Q24333) ELASTIN LIKE PROTEIN Q24333 95% 51
122 (FRAGMENT). HCMSA37 598712 958 WUblastx.64 (Q9UHS7) PRO1992.
Q9UHS7 63% 902 795 HCMSR07 821338 959 WUblastx.64 (Q9UI59) PRO0478
PROTEIN. Q9UI59 91% 1388 1489 HCNSF01 901060 964 WUblastx.64
(Q9Y6N5) HYPOTHETICAL 50.0 KDA Q9Y6N5 100% 107 1456 PROTEIN.
HCPAE41 799546 967 WUblastx.64 (Q9P0P0) HSPC238 Q9P0P0 81% 490 443
(HYPOTHETICAL 17.9 KDA 73% 444 31 PROTEIN). HCQAS72 828082 970
WUblastx.64 (AAK58423) PC2-glutamine-rich- AAK58423 91% 22 57
associated protein. 93% 1010 1054 100% 57 119
71% 122 463 HCQBM95 841011 971 WUblastx.64 ribosomal protein L39,
cytosolic pir|JC4229|R6RT39 84% 409 447 [validated] - rat 88% 282
389 HCRAI29 844084 979 WUblastx.64 hypothetical protein (L1H 3'
region) - pir|B34087|B34087 34% 329 132 human 56% 48 1 39% 493 305
61% 89 12 HCRBL20 709660 981 WUblastx.64 (Q9NWM9) CDNA FLJ20730
FIS, Q9NWM9 94% 1 678 CLONE HEP10359. HCRBX84 1007105 982
WUblastx.64 (Q9H1F6) DJ453C12.6.1 Q9H1F6 91% 37 177
(UNCHARACTERIZED 63% 51 617 HYPOTHALAMUS PROTEIN (ISOFORM HCRMA24
897005 983 WUblastx.64 hypothetical protein pir|T08683|T08683 100%
388 591 DKFZp564J2123.1 - human (fragment) HCRMR35 849071 984
WUblastx.64 (Q9H175) HYPOTHETICAL 59.6 KDA Q9H175 48% 43 858
PROTEIN. HCRMR35 874743 985 WUblastx.64 (Q9H175) HYPOTHETICAL 59.6
KDA Q9H175 48% 43 858 PROTEIN. HCRMR35 897434 986 WUblastx.64
(Q9H175) HYPOTHETICAL 59.6 KDA Q9H175 49% 43 858 PROTEIN. HCROC18
884144 987 WUblastx.64 (Q9H8A5) CDNA FLJ13824 FIS, Q9H8A5 95% 7
1695 CLONE THYRO1000505. HCUAE53 665716 988 WUblastx.64
hypothetical protein [imported] - pir|E86188|E86188 58% 504 304
Arabidopsis thaliana 80% 225 76 56% 895 653 28% 542 459 62% 1299
1156 HCUAT74 834611 990 WUblastx.64 hypothetical protein UL126 -
human pir|S09875|S09875 68% 3 191 cytomegalovirus (strain AD169)
HCUBN69 826610 994 WUblastx.64 (Q9BVD9) UNKNOWN (PROTEIN Q9BVD9 78%
831 763 FOR MGC: 5149). 72% 626 573 80% 760 626 HCUBY47 842787 995
WUblastx.64 (Q9EPL2) CALSYNTENIN-1 Q9EPL2 97% 444 313 PROTEIN
PRECURSOR. 97% 1003 869 HCUCV66 806577 996 WUblastx.64 (BAB22833)
18 days embryo cDNA, BAB22833 100% 36 362 RIKEN full-length e
HCUFC77 745374 1001 WUblastx.64 (Q9NX85) CDNA FLJ20378 FIS, Q9NX85
77% 1526 1461 CLONE KAIA0536. 61% 1449 1234 HCUFD17 847039 1002
WUblastx.64 (Q9HBZ6) HT005 PROTEIN. Q9HBZ6 100% 10 195 HCUFD46
757481 1003 WUblastx.64 (Q9H728) CDNA: FLJ21463 FIS, Q9H728 43% 580
386 CLONE COL04765. HCUFX08 612843 1008 WUblastx.64 (Q9BGW3)
HYPOTHETICAL 13.5 KDA Q9BGW3 55% 1214 1128 PROTEIN. 65% 1329 1216
HCUHE27 562766 1014 WUblastx.64 (Q9N083) UNNAMED PORTEIN Q9N083 61%
764 639 PRODUCT. HCWAK88 839083 1017 WUblastx.64 probable
excinuclease ABC chain A - pir|T33732|T33732 86% 435 370 Zymomonas
mobilis 31% 815 321 32% 1969 1814 64% 956 501 67% 362 42 57% 1237
1181 69% 1306 998 85% 1993 1538 HCWAL10 639023 1018 WUblastx.64
(Q9Y2N3) NUCLEAR ENVELOPE N121_HUMAN 100% 754 680 PORE MEMBRANE
PROTEIN POM 100% 240 118 121 (PO HCWDM69 684527 1022 WUblastx.64
(Q9P195) PRO1722. Q9P195 66% 819 748 78% 886 818 70% 1001 900
HCWEB72 639041 1024 WUblastx.64 (Q9NX85) CDNA FLJ20378 FIS, Q9NX85
56% 872 798 CLONE KAIA0536. 48% 588 508 65% 757 617 HCWEI82 799516
1026 WUblastx.64 (Q9P1N7) PRO0974. Q9P1N7 47% 384 656 HCWEM96
812735 1027 WUblastx.64 probable ATP-binding component of
pir|G83165|G83165 74% 1901 1146 ABC transporter PA3838 [imported] -
Pseudomonas aeruginosa (strain PAO1) HCWHD30 834724 1031
WUblastx.64 (AAH07609) Similar to hypothetical AAH07609 86% 634 590
protein PRO1722. 80% 782 633 HCWHT34 692400 1032 WUblastx.64
(Q9UI50) PRO0657 (FRAGMENT). Q9UI50 68% 556 777 HCWHT52 834618 1033
WUblastx.64 hypothetical protein UL126 - human pir|S09875|S09875
75% 20 274 cytomegalovirus (strain AD169) HCWKO32 610619 1034
WUblastx.64 (Q9GMU5) HYPOTHETICAL 14.1 KDA Q9GMU5 82% 496 600
PROTEIN. HCWUW24 799517 1037 WUblastx.64 (Q9H387) PRO2550. Q9H387
45% 541 696 33% 60 245 77% 686 817 HCYBA32 847042 1038 WUblastx.64
(Q9H3F8) MSTP016. Q9H3F8 100% 329 718 79% 925 1800 HDABR74 861789
1040 WUblastx.64 (O60717) 7- O60717 81% 5 37 DEHYDROCHOLESTEROL 95%
69 908 REDUCTASE (EC 1.3.1.21) (FRAGMENT). HDFIB37 821339 1045
WUblastx.64 (Q9D8F2) 2010004A03RIK Q9D8F2 74% 792 884 PROTEIN. 64%
357 431 65% 388 816 HDHEA33 847044 1048 WUblastx.64 (Q9BU66)
UNKNOWN (PROTEIN Q9BU66 40% 482 619 FOR MGC: 10433). 45% 159 638
82% 1054 1494 HDHEB12 610260 1049 WUblastx.64 (Q9NZ96) NEUROLIGIN 3
Q9NZ96 94% 2 697 ISOFORM HNL3S (FRAGMENT). HDLAL94 843583 1054
HMMER PFAM: ADP-ribosylation factor PF00025 309.2 195 728 2.1.1
family WUblastx.64 (Q9D4P0) 4930587A11RIK Q9D4P0 100% 192 728
PROTEIN. HDPAB86 901851 1055 WUblastx.64 (Q9NYH9) HEPATOCELLULAR
Q9NYH9 56% 74 538 CARCINOMA-ASSOCIATED 97% 310 1863 ANTIGEN 66.
HDPAE80 778068 1056 WUblastx.64 (Q9BR63) PHENYLALANYL-TRNA Q9BR63
93% 1435 1662 SYNTHETASE BETA-SUBUNIT 78% 1604 1744 (FRAGMENT). 54%
383 661 32% 417 761 98% 905 1438 HDPAQ86 612855 1057 WUblastx.64
(Q9H743) CDNA: FLJ21394 FIS, Q9H743 48% 1419 1246 CLONE COL03536.
76% 1250 1122 HDPBN48 838593 1059 WUblastx.64 (Q9H013)
MELTRIN-BETA/ADAM Q9H013 84% 525 773 19 HOMOLOGUE. HDPCG79 691350
1060 WUblastx.64 (Q9H9H4) CDNA FLJ12750 FIS, Q9H9H4 98% 415 588
CLONE NT2RP2001168, WEAKLY SIMILAR TO VER HDPCV29 567228 1061
WUblastx.64 hypothetical protein (L1H 3' region) -
pir|B34087|B34087 40% 546 1196 human HDPDA36 827283 1062
WUblastx.64 (Q9CZU3) 2610528A15RIK Q9CZU3 96% 3443 3604 PROTEIN.
HDPDC59 872451 1063 WUblastx.64 (Q9H251) CADHERIN RELATED Q9H251
99% 142 1737 23. 32% 145 1761 33% 130 1737 32% 130 1734 32% 112
1740 34% 145 1743 31% 124 1731 30% 145 1743 31% 256 1725 31% 145
1755 31% 145 1698 31% 139 1491 30% 658 1737 29% 154 1731 HDPFG13
637580 1064 WUblastx.64 (Q9H8S0) CDNA FLJ13287 FIS, Q9H8S0 100% 55
441 CLONE OVARC1001161. HDPFZ05 824390 1066 WUblastx.64 (Q9CZC8)
2810019K23RIK Q9CZC8 84% 500 658 PROTEIN. HDPGR80 844812 1068
WUblastx.64 (Q9BRR6) SIMILAR TO RIKEN Q9BRR6 87% 2434 1067 CDNA
2610017G09 GENE. 83% 2556 2377 HDPGU14 832543 1069 WUblastx.64
mda-9 protein - human pir|JC6537|JC6537 100% 292 1185 HDPGX09
580818 1070 WUblastx.64 (Q9D0M0) 2610002K22RIK Q9D0M0 94% 832 999
PROTEIN. 33% 995 1093 91% 1020 1220 HDPIE44 899328 1071 WUblastx.64
(Q9D666) 4632417G13RIK Q9D666 62% 102 2453 PROTEIN. HDPIE73 886158
1072 WUblastx.64 (Q9H728) CDNA: FLJ21463 FIS, Q9H728 58% 1852 2145
CLONE COL04765. HDPIF35 826781 1073 WUblastx.64 (BAB55422) CDNA
FLJ14966 fis, BAB55422 100% 1000 887 clone THYRO1000034, w HDPIF65
847047 1074 WUblastx.64 (Q9H7Z0) CDNA FLJ14058 FIS, Q9H7Z0 60% 236
12 CLONE HEMBB1000554. HDPIH25 740749 1075 WUblastx.64 (Q9H7Q7)
FLJ00010 PROTEIN Q9H7Q7 78% 99 539 (FRAGMENT). 100% 876 968 76% 971
2266 98% 536 796 50% 2190 2300 75% 796 876 HDPIY31 886159 1076
WUblastx.64 hypothetical protein pir|T46448|T46448 72% 1714 1899
DKFZp434N1429.1 - human (fragment) HDPJH72 847048 1077 WUblastx.64
(O15427) MONOCARBOXYLATE MOT4_HUMAN 96% 294 392 TRANSPORTER 4 (MCT
4) (MCT 3). 81% 1204 1473 100% 77 295 89% 854 1192 37% 1427 1498
71% 394 855 HDPKC55 822869 1080 HMMER PFAM: Tubulin/FtsZ family
PF00091 177.8 108 797 2.1.1 WUblastx.64 (Q9UJT1) TUBULIN DELTA
CHAIN TBD_HUMAN 100% 102 1460 (DELTA TUBULIN). HDPKD16 897304 1081
WUblastx.64 (AAG10506) 2P domain K+ channel AAG10506 100% 246 857
TWIK-2. HDPMC52 847049 1082 WUblastx.64 (Q9Y275) TUMOR NECROSIS
T13B_HUMAN 98% 67 447 FACTOR LIGAND SUPERFAMILY 100% 7 72 MEMBER 13
HDPML04 822851 1083 WUblastx.64 X-linked retinopathy protein (C-
pir|A46010|A46010 73% 1403 1326 terminal, clone XEH.8c) - human 68%
1327 1223 (fragment) HDPNC21 839263 1085 WUblastx.64 (AAK55521)
PRO0764. AAK55521 81% 1290 964 HDPNJ26 852338 1086 WUblastx.64
(Q9CQ35) 4921508O11RIK Q9CQ35 67% 115 651 PROTEIN. HDPOD73 876202
1087 WUblastx.64 (Q9P195) PRO1722. Q9P195 84% 173 211 60% 16 90 61%
78 185 HDPOT33 892319 1088 WUblastx.64 (Q92482) AQUAPORIN 3.
AQP3_HUMAN 100% 53 928 HDPPB70 874027 1089 WUblastx.64 (Q96DV8)
Unknown (protein for Q96DV8 68% 257 1186 MGC: 3551). HDPPE05 809109
1091 WUblastx.64 (Q9P0G1) HSPC075 (FRAGMENT). Q9P0G1 100% 355 459
100% 64 153 HDPSA70 722216 1092 WUblastx.64 (Q9UL01) SQUAMOUS CELL
Q9UL01 100% 13 261 CARCINOMA ANTIGEN RECOGNIZED BY T CELL. HDPTI49
847052 1097 WUblastx.64 (Q14185) DOCK180 PROTEIN. Q14185 79% 927
1190 HDPYE25 636058 1099 WUblastx.64 (O42346) NEURULA-SPECIFIC
O42346 73% 3 722 FERRODOXIN REDUCTASE-LIKE PROTEIN. HDQGD06 838076
1100 WUblastx.64 (Q9H1C4) UNC-93 RELATED Q9H1C4 80% 969 1535
PROTEIN. 90% 59 463 87% 454 996 HDQGD06 852673 1101 WUblastx.64
(Q9H1C4) UNC-93 RELATED Q9H1C4 81% 969 1559
PROTEIN. 90% 59 463 87% 454 996 HDQGD06 881280 1102 WUblastx.64
(Q9H1C4) UNC-93 RELATED Q9H1C4 86% 59 1537 PROTEIN. HDQGN08 840588
1103 WUblastx.64 (Q9HAD8) CDNA FLJ11786 FIS, Q9HAD8 56% 782 510
CLONE HEMBA1006036. HDQGO62 837353 1104 WUblastx.64 (Q9D6E9)
2900070E19RIK Q9D6E9 96% 222 515 PROTEIN. HDQPM16 886161 1105
WUblastx.64 (Q9DCP9) PROLINE RICH Q9DCP9 76% 145 648 PROTEIN
EXPRESSED IN BRAIN. HDSAH37 603518 1109 WUblastx.64 (Q9H9U3) CDNA
FLJ12547 FIS, Q9H9U3 41% 341 156 CLONE NT2RM4000634. 36% 449 147
35% 344 105 HDSAM57 834822 1110 WUblastx.64 (Q9P195) PRO1722.
Q9P195 76% 752 690 80% 685 623 61% 897 742 HDSAO14 847054 1111
WUblastx.64 (Q9H0I1) HYPOTHETICAL 83.8 KDA Q9H0I1 100% 241 348
PROTEIN. HDSAP15 772712 1113 WUblastx.64 (Q9H059) HYPOTHETICAL 99.0
KDA Q9H059 46% 160 378 PROTEIN. HDTAR39 847055 1114 WUblastx.64
(Q9NVH2) HYPOTHETICAL 106.8 KDA Q9NVH2 100% 13 273 PROTEIN. 85% 242
772 HDTDA48 809110 1118 WUblastx.64 (O15254) PRISTANOYL-COA O15254
98% 149 601 OXIDASE. HDTDE66 610074 1119 WUblastx.64 (Q9Y609) LR8.
Q9Y609 88% 1 447 HDTDG75 799892 1120 WUblastx.64 (Q9H2I8) CDA017.
Q9H2I8 100% 434 514 HDTGW76 862012 1123 WUblastx.64 (Q9NY74) ETAA16
PROTEIN. Q9NY74 73% 1290 1835 27% 1422 1616 23% 296 829 82% 20 1234
HDTGZ56 800756 1124 WUblastx.64 (Q9BGW3) HYPOTHETICAL 13.5 KDA
Q9BGW3 54% 27 257 PROTEIN. HDTIM39 886164 1126 WUblastx.64 (Q9P0Q9)
HSPC217. Q9P0Q9 80% 254 523 35% 302 403 90% 504 788 HDTKJ29 840023
1127 HMMER PFAM: Uncharacterized protein family PF01027 137.6 184
726 2.1.1 WUblastx.64 (Q9Y3C2) CGI-119 PROTEIN. Q9Y3C2 71% 19 732
HE2AC74 901343 1131 WUblastx.64 (AAK53385) G protein gamma 12
AAK53385 100% 207 422 subunit. HE2AX36 812337 1135 WUblastx.64
(Q9Y5B5) UBIQUITIN-SPECIFIC Q9Y5B5 85% 1292 300 PROTEASE HOMOLOG.
HE2AY96 796800 1136 WUblastx.64 (BAB22850) 18 days embryo cDNA,
BAB22850 87% 56 751 RIKEN full-length e HE2BD72 600349 1137
WUblastx.64 (Q9NX85) CDNA FLJ20378 FIS, Q9NX85 66% 496 371 CLONE
KAIA0536. 77% 650 522 HE2BH50 847056 1138 WUblastx.64 (Q9GZW0)
DJ604K5.1 (15 KDA Q9GZW0 100% 226 405 SELENOPROTEIN). HE2CC17
566806 1140 WUblastx.64 (Q9HBW6) NAG13. Q9HBW6 69% 996 694 59% 731
516 75% 347 180 42% 1037 933 70% 540 352 HE2CJ53 637592 1141
WUblastx.64 (Q9NUM3) CDNA FLJ11274 FIS, Q9NUM3 100% 123 266 CLONE
PLACE1009368, WEAKLY 100% 266 412 SIMILAR TO MET HE2DI16 604029
1145 WUblastx.64 (Q9NX85) CDNA FLJ20378 FIS, Q9NX85 66% 1350 1201
CLONE KAIA0536. 76% 1483 1331 HE2DJ84 746643 1146 WUblastx.64
(P82673) MITOCHONDRIAL 28S P82673 100% 2 313 RIBOSOMAL PROTEIN S28
(MRP- S28). HE2DY23 877491 1147 WUblastx.64 (Q9VW97) CG17149
PROTEIN. Q9VW97 48% 1018 1284 HE2EH45 581520 1150 WUblastx.64
(Q9H3F4) MSTP030. Q9H3F4 73% 690 815 63% 8 250 75% 97 735 HE2FE89
780314 1151 WUblastx.64 (Q9QYN1) ENH3. Q9QYN1 95% 254 541 HE2FR49
714456 1152 WUblastx.64 (Q9NUP7) CDNA FLJ11219 FIS, Q9NUP7 64% 63
104 CLONE PLACE1008122. 100% 92 400 HE2GB19 566808 1153 WUblastx.64
(O95245) ENVELOPE PROTEIN O95245 41% 397 519 (FRAGMENT). 39% 246
362 63% 140 247 HE2HB61 798113 1155 WUblastx.64 (Q9BS71) UNKNOWN
(PROTEIN Q9BS71 100% 261 365 FOR MGC: 12301). HE2HF76 637594 1157
WUblastx.64 (Q9HAZ1) PROTEIN SERINE Q9HAZ1 100% 11 859 THREONINE
KINASE CLK4. HE21E66 830436 1159 WUblastx.64 (AAH22050)
Hypothetical 61.5 kDa AAH22050 98% 98 523 protein (Fragment)
HE2NW57 638615 1160 WUblastx.64 (Q9UI58) PRO0483 PROTEIN. Q9UI58
57% 191 15 HE2OA95 637595 1161 WUblastx.64 (Q9UIK5) TMEFF2 PROTEIN
Q9UIK5 99% 1647 1231 PRECURSOR (TRANSMEMBRANE PROTEIN TENB2) (TPEF
HE2PB61 847379 1163 WUblastx.64 (Q9BWY7) DJ639P13.1 (NOVEL Q9BWY7
92% 3 719 PROTEIN SIMILAR TO RAT TRANSPORTER-LIKE PR HE2PI43 847380
1164 WUblastx.64 (Q9H8E8) CDNA FLJ13697 FIS, Q9H8E8 100% 234 407
CLONE PLACE2000172. HE6CJ41 604908 1166 WUblastx.64 (Q9GMX5)
HYPOTHETICAL 12.9 KDA Q9GMX5 54% 898 1050 PROTEIN. HE6EI30 847381
1169 WUblastx.64 (Q9BRG1) SIMILAR TO RIKEN Q9BRG1 100% 603 523 CDNA
1110020N13 GENE. HE8BP64 847059 1176 WUblastx.64 (Q9DBS0)
HIPPOCAMPUS Q9DBS0 71% 10 1299 ABUNDANT GENE TRANSCRIPT 1. HE8BQ49
589443 1177 WUblastx.64 hypothetical protein - human
pir|S72482|S72482 75% 343 474 transposon MER37 64% 105 248 HE8BR18
731933 1178 WUblastx.64 (Q9NW38) CDNA FLJ10335 FIS, Q9NW38 100% 654
1091 CLONE NT2RM2000669. HE8BT58 806144 1180 WUblastx.64 (Q9BX67)
JUNCTIONAL Q9BX67 91% 80 937 ADHESION MOLECULE 3 PRECURSOR. HE8CC34
753266 1183 WUblastx.64 (Q9H728) CDNA: FLJ21463 FIS, Q9H728 72%
2116 1829 CLONE COL04765. HE8DK52 658676 1186 WUblastx.64 (Q9D1U5)
D730039F16RIK Q9D1U5 66% 778 813 PROTEIN. 64% 843 935 HE8DZ94
877630 1187 WUblastx.64 (Q9Y3C2) CGI-119 PROTEIN. Q9Y3C2 91% 1295
1657 HE8EX86 823176 1189 WUblastx.64 (AAK53401) Elongation factor
G2. AAK53401 100% 1410 457 96% 2790 2593 88% 2579 1362 HE8FC10
693908 1190 HMMER PFAM: Zinc finger, C2H2 type PF00096 72.8 606 674
2.1.1 WUblastx.64 (Q9H8L4) CDNA FLJ13479 FIS, Q9H8L4 84% 300 731
CLONE PLACE1003738, WEAKLY 98% 6 173 SIMILAR TO ZIN 45% 438 731 45%
438 674 44% 438 674 39% 438 674 36% 438 674 40% 444 674 37% 438 674
37% 444 674 51% 6 134 48% 6 161 46% 6 134 46% 6 134 47% 9 134 48% 6
134 47% 9 134 40% 9 134 44% 48 134 HE8FG15 799520 1191 WUblastx.64
(O43491) PROTEIN 4.1-G. O43491 84% 226 1197 HE8FG24 733560 1192
WUblastx.64 (Q9HAQ1) GLYCEROL 3- Q9HAQ1 90% 11 76 PHOSPHATE
PERMEASE. 86% 94 522 HE8FK78 852180 1193 WUblastx.64 (Q9H8A3) CDNA
FLJ13837 FIS, Q9H8A3 100% 1 75 CLONE THYRO1000748, 80% 72 266
MODERATELY SIMILAR TO 88% 269 1372 HE8FR53 843807 1196 WUblastx.64
(Q9H373) PRO1107. Q9H373 98% 3411 3181 HE8MQ01 886800 1199
WUblastx.64 (Q9UHT1) PRO1902 PROTEIN. Q9UHT1 71% 2692 2483 HE8MS43
799521 1200 WUblastx.64 (Q9D7J4) 2310005N03RIK Q9D7J4 88% 1023 946
PROTEIN. 83% 1247 1155 77% 175 44 HE8NC81 862015 1202 WUblastx.64
(Q9H6B2) CDNA: FLJ22418 FIS, Q9H6B2 100% 74 106 CLONE HRC08590. 88%
168 923 HE8NC81 1096692 3106 HMMER PFAM: Immunoglobulin domain
PF00047 28.3 563 814 2.1.1 WUblastx.64 (Q9H6B2) CDNA: FLJ22418 FIS,
Q9H6B2 99% 419 1264 CLONE HRC08590. HE8QU21 838391 1204 WUblastx.64
(Q9BGZ4) HYPOTHETICAL 11.6 KDA Q9BGZ4 44% 1391 1125 PROTEIN.
HE8SH74 833053 1205 WUblastx.64 (Q9H387) PRO2550. Q9H387 69% 2476
2441 50% 3129 3034 76% 3017 2868 HE8UX34 838170 1206 WUblastx.64
(Q9H8Q9) CDNA FLJ13310 FIS, Q9H8Q9 67% 7 162 CLONE OVARC1001453.
HE9CI81 734918 1209 WUblastx.64 (Q9DB52) 2900009I07RIK Q9DB52 82%
2273 2016 PROTEIN. HE9CJ38 565082 1210 WUblastx.64 (Q9BGW3)
HYPOTHETICAL 13.5 KDA Q9BGW3 64% 1180 1079 PROTEIN. 54% 1380 1243
HE9CN58 562768 1212 WUblastx.64 (Q99710) YY1-ASSOCIATED Q99710 44%
6 353 FACTOR 2. HE9CV59 847061 1213 WUblastx.64 (Q9CYF7)
5730494N06RIK Q9CYF7 76% 73 408 PROTEIN. HE9DG54 821326 1214
WUblastx.64 (Q9N083) UNNAMED PORTEIN Q9N083 53% 1508 1197 PRODUCT.
HE9DH59 886059 1215 WUblastx.64 (AAK49519) Putative mitochondrial
AAK49519 100% 54 419 solute carrier sp 94% 1534 2085 HE9EM54 560627
1218 WUblastx.64 (Q9H743) CDNA: FLJ21394 FIS, Q9H743 57% 611 688
CLONE COL03536. 67% 756 902 HE9FH28 633737 1219 WUblastx.64
(Q9H728) CDNA: FLJ21463 FIS, Q9H728 58% 965 591 CLONE COL04765.
HE9HE13 868829 1220 WUblastx.64 (Q9P183) PRO2160. Q9P183 100% 434
183 HE9HE13 824328 1221 WUblastx.64 (Q9UI56) PROTEIN PRO0518.
P518_HUMAN 100% 665 462 HE9HF59 664485 1222 WUblastx.64 (Q9BGW3)
HYPOTHETICAL 13.5 KDA Q9BGW3 45% 1593 1276 PROTEIN. HE9TA42 834972
1227 WUblastx.64 (P53992) PROTEIN TRANSPORT S24C_HUMAN 100% 1423
1674 PROTEIN SEC24C (SEC24- 98% 2099 2359 RELATED PR 85% 1674 2105
29% 1833 1943 38% 58 135 98% 8 1435 HEAAC21 581048 1228 WUblastx.64
(Q9NV24) CDNA FLJ10980 FIS, Q9NV24 100% 100 246 CLONE PLACE1001570.
HEAAD63 603321 1231 WUblastx.64 (Q9H965) CDNA FLJ12983 FIS, Q9H965
84% 613 575 CLONE NT2RP3000002. 68% 789 613 HEAAM96 562769 1234
WUblastx.64 (Q9H4S5) DJ336K20B.1 (NOVEL Q9H4S5 83% 541 1044 PROTEIN
BASED ON FGENESH) (FRAGMENT). HEAAN52 862020 1235 WUblastx.64
(Q9BGW3) HYPOTHETICAL 13.5 KDA Q9BGW3 54% 796 1104 PROTEIN. HEAAW94
847340 1238 WUblastx.64 (Q9UEV9) ACTIN-BINDING Q9UEV9 94% 285 890
PROTEIN HOMOLOG ABP-278. 41% 285 884 38% 285 884 36% 285 872 35%
285 884 34% 285 884
34% 285 878 32% 303 887 33% 285 881 33% 285 878 31% 285 869 29% 288
887 30% 279 884 31% 285 863 36% 414 848 30% 288 884 32% 429 857 31%
309 824 26% 321 824 38% 285 539 37% 552 824 HEBAT05 637602 1240
WUblastx.64 (Q9NWW0) CDNA FLJ20568 FIS, Q9NWW0 96% 111 380 CLONE
REC00775. 87% 84 131 HEBCN80 596808 1243 WUblastx.64 (Q9BGX7)
HYPOTHETICAL 13.0 KDA Q9BGX7 57% 782 865 PROTEIN. 53% 666 788
HEEAF49 880521 1254 WUblastx.64 (Q9P147) PRO2822. Q9P147 79% 2117
1896 HEEAJ46 637623 1255 WUblastx.64 (AAK55521) PRO0764. AAK55521
86% 2358 2314 66% 1626 1582 55% 2336 2163 73% 1601 1368 HEGAI20
825818 1256 WUblastx.64 (Q9N083) UNNAMED PORTEIN Q9N083 63% 893 759
PRODUCT. HEIAC52 826611 1257 WUblastx.64 (Q9H6A7) CDNA: FLJ22429
FIS, Q9H6A7 75% 40 915 CLONE HRC09084. HELAT58 732199 1259
WUblastx.64 (Q9H743) CDNA: FLJ21394 FIS, Q9H743 56% 1807 1881 CLONE
COL03536. 60% 1731 1805 59% 1880 2035 HELAW94 834796 1260
WUblastx.64 (AAH02585) RAB7, member RAS AAH02585 100% 159 551
oncogene family-like 1. HELDF80 799522 1261 WUblastx.64 N-ras
upstream protein NRU - human pir|S29815|S29815 99% 3 1289 28% 6
1061 28% 435 1118 HELDK79 532597 1263 WUblastx.64 L6 surface
protein - human pir|A42926|A42926 78% 71 676 HELDQ42 695716 1264
WUblastx.64 (O60629) BLADDER CANCER- BC10_HUMAN 100% 289 549
ASSOCIATED PROTEIN (BLADDER CANCER HELEL76 862490 1266 WUblastx.64
(Q9BRX8) SIMILAR TO RIKEN Q9BRX8 93% 171 818 CDNA 5730469M10 GENE.
HELEL76 839470 1267 WUblastx.64 (Q9BRX8) SIMILAR TO RIKEN Q9BRX8
98% 545 694 CDNA 5730469M10 GENE. 90% 48 506 HELEO45 847067 1268
WUblastx.64 (Q9H6Q6) CDNA: FLJ21982 FIS, Q9H6Q6 92% 1385 1423 CLONE
HEP06188. 88% 7 1392 HELFA57 845981 1269 WUblastx.64 (O95761)
WUGSC: H_DJ0771P04.2 O95761 95% 340 1362 PROTEIN (FRAGMENT). 95% 9
137 78% 62 409 HELHN47 872795 1273 WUblastx.64 (Q9NWC8)
HYPOTHETICAL 17.6 KDA Q9NWC8 91% 1233 772 PROTEIN. HELHP11 638064
1274 WUblastx.64 (Q9H743) CDNA: FLJ21394 FIS, Q9H743 76% 1429 1313
CLONE COL03536. HELHP11 851116 1275 WUblastx.64 (Q9H743) CDNA:
FLJ21394 FIS, Q9H743 79% 1441 1313 CLONE COL03536. HEMBV40 847069
1277 WUblastx.64 NADH dehydrogenase (ubiquinone) pir|JC5822|JC5822
77% 798 1055 (EC 1.6.5.3) CI-B12 chain - human HEMCJ80 765041 1278
WUblastx.64 (Q9NXF8) CDNA FLJ20279 FIS, Q9NXF8 98% 489 710 CLONE
HEP03229. 73% 3 206 79% 155 487 HEMDB07 617137 1280 WUblastx.64
(Q9H387) PRO2550. Q9H387 82% 400 660 HEMGK71 847374 1282
WUblastx.64 (Q9NX85) CDNA FLJ20378 FIS, Q9NX85 80% 1383 1258 CLONE
KAIA0536. 64% 1576 1352 HEOMU44 778085 1287 WUblastx.64 (Q9N307)
HYPOTHETICAL Q9N307 52% 823 1392 PROTEIN Y61A9LA.B. HEONI85 566833
1288 WUblastx.64 hypothetical 43.5K protein - mouse
pir|JU0319|JU0319 77% 236 421 90% 382 672 HEONK04 658682 1289
WUblastx.64 (Q9UKN4) BRIDGING Q9UKN4 72% 267 1070 INTEGRATOR-2.
HEONP08 601691 1290 WUblastx.64 (Q9Y349) HYPOTHETICAL 15.7 KDA
Q9Y349 100% 924 523 PROTEIN. HEPBC23 799985 1292 WUblastx.64
(Q9H1V4) DJ1182A14.3 (SIMILAR Q9H1V4 92% 4 303 TO MST1 (MACROPHAGE
STIMULATING 1 (HEPA HEPCU48 805585 1295 WUblastx.64 (Q9UNT2)
PROTEIN O- Q9UNT2 79% 315 1490 MANNOSYL-TRANSFERASE 1. 95% 79 324
100% 15 32 HEQAH47 877634 1296 WUblastx.64 hypothetical protein
pir|T08772|T08772 100% 630 1085 DKFZp586M121.1 - human 87% 12 476
(fragment) 30% 90 308 30% 189 305 29% 1104 1355 28% 30 245 63% 257
289 HEQBJ01 861786 1300 WUblastx.64 (Q9LVQ7) ZINC FINGER PROTEIN.
Q9LVQ7 34% 424 849 HEQBJ01 876546 1301 WUblastx.64 (Q9LVQ7) ZINC
FINGER PROTEIN. Q9LVQ7 34% 424 849 HEQBM94 580823 1302 WUblastx.64
(Q9BT25) UNKNOWN (PROTEIN Q9BT25 100% 470 559 FOR IMAGE: 3636299)
72% 583 843 (FRAGMENT). 77% 7 471 HESAG57 855936 1307 WUblastx.64
(O43432) EIF4GII. O43432 82% 936 7 100% 1221 1030 100% 1365 1336
27% 1382 1254 28% 1545 1327 HETBJ88 855937 1310 WUblastx.64
(Q9H1Y3) DJ317G22.2 Q9H1Y3 83% 10 864 (ENCEPHALOPSIN) (PANOPSIN).
HETCM67 861909 1311 HMMER PFAM: Disintegrin PF00200 112.2 239 466
2.1.1 WUblastx.64 (Q9UKQ2) ADAM 28 PRECURSOR AD28_HUMAN 96% 11 1318
(EC 3.4.24.--) (A DISINTEGRIN AND HETDD61 800668 1312 WUblastx.64
(Q9Y6B7) ADAPTER-RELATED A4B1_HUMAN 96% 789 1085 PROTEIN COMPLEX 4
BETA 1 85% 363 569 SUBUNIT ( 96% 1315 1761 HETDD61 852381 1313
WUblastx.64 (Q9Y6B7) ADAPTER-RELATED A4B1_HUMAN 96% 1314 1760
PROTEIN COMPLEX 4 BETA 1 96% 789 1085 SUBUNIT ( 85% 363 569 HETDP76
782836 1316 WUblastx.64 (Q9BUK6) HYPOTHETICAL 61.8 KDA Q9BUK6 100%
29 394 PROTEIN. 92% 700 1620 80% 1895 2116 53% 1428 1466 100% 465
653 HETFO57 844190 1317 WUblastx.64 (Q9H229) RAD50-INTERACTING
Q9H229 96% 2 1363 PROTEIN 1. HFAAI17 607563 1322 WUblastx.64
(Q9H387) PRO2550. Q9H387 61% 426 518 73% 281 403 HFADF41 607557
1324 WUblastx.64 B-cell growth factor precursor - human
pir|A47582|A47582 56% 600 737 HFADM09 899435 1325 WUblastx.64
ISOFORM 8 OF Q9Y4J8 sp_vs|Q9Y4J8- 100% 382 480 02|Q9Y4J8 HFAUA23
636071 1326 WUblastx.64 (Q9HAL3) CDNA FLJ11393 FIS, Q9HAL3 25% 243
91 CLONE HEMBA1000591, WEAKLY 45% 466 263 SIMILAR TO PTB HFCAG75
834834 1327 WUblastx.64 (AAK55521) PRO0764. AAK55521 80% 745 701
78% 720 484 HFCAI40 866441 1328 HMMER PFAM: TPR Domain PF00515 52.6
167 253 2.1.1 WUblastx.64 (Q9V532) CG8777 PROTEIN. Q9V532 36% 20
1021 HFCAQ17 695720 1329 WUblastx.64 NADH dehydrogenase
(ubiquinone) pir|JE0379|JE0379 78% 20 238 (EC 1.6.5.3) chain NDUFA3
- human HFCBC16 559312 1330 WUblastx.64 (Q9H743) CDNA: FLJ21394
FIS, Q9H743 55% 998 792 CLONE COL03536. HFCBT29 654842 1334
WUblastx.64 (Q9H9H1) CDNA FLJ12756 FIS, Q9H9H1 73% 80 280 CLONE
NT2RP2001295, WEAKLY SIMILAR TO ZIN HFCDN13 722221 1336 WUblastx.64
(Q9P0T7) HSPC186 Q9P0T7 90% 2 187 (HYPOTHETICAL 20.6 KDA PROTEIN).
HFCDT67 598900 1337 WUblastx.64 (Q9H0N3) HYPOTHETICAL 107.1 KDA
Q9H0N3 82% 9 455 PROTEIN. 77% 845 910 45% 373 438 67% 498 902
HFCDY36 834512 1338 WUblastx.64 catalase (EC 1.11.1.6) -
pir|I40767|I40767 93% 279 190 Campylobacter jejuni HFCEC45 847384
1339 WUblastx.64 (Q9D3Q4) 5033428A16RIK Q9D3Q4 98% 68 349 PROTEIN.
HFCET43 596813 1340 WUblastx.64 (Q9Z1M7) Q9Z1M7 100% 7 144
ACETYLGLUCOSAMINYLTRANSFERASE- LIKE PROTEIN. HFEAG55 838142 1341
WUblastx.64 (Q9EP97) SENTRIN/SUMO- Q9EP97 100% 12 200 SPECIFIC
PROTEASE (SMT3 ISOPEPTIDASE 1). HFEAU63 790190 1342 WUblastx.64
ISOFORM EYA1B OF Q99502 sp_vs|Q99502- 90% 2180 2028 01|Q99502
HFEBA88 684297 1343 WUblastx.64 (BAB55210) CDNA FLJ14675 fis,
BAB55210 100% 205 297 clone NT2RP2003952, w 44% 70 327 HFEBO15
831772 1345 WUblastx.64 (Q9HC46) HYPOTHETICAL 42.8 KDA Q9HC46 85%
226 477 PROTEIN. 53% 150 332 51% 2 298 HFEBO17 852218 1346
WUblastx.64 (BAB55130) CDNA FLJ14559 fis, BAB55130 100% 523 624
clone NT2RM2001998. 91% 606 809 HFFAE46 654843 1347 WUblastx.64
(O14597) NON-FUNCTIONAL O14597 100% 608 658 FOLATE BINDING PROTEIN.
96% 703 801 78% 386 442 58% 602 649 57% 402 632 HFFAH01 843438 1348
WUblastx.64 hypothetical protein pir|T43460|T43460 91% 510 241
DKFZp434P1721.1 - human 98% 259 11 (fragment) 95% 818 513 HFFAL70
827570 1349 WUblastx.64 (AAH07384) Unknown (protein for AAH07384
84% 921 466 IMAGE: 3677194) (Fra HFFAV61 664486 1350 WUblastx.64
(BAA92711) Adaptor protein BAA92711 100% 1555 1184 p130Cas. 50% 577
536 HFGAN63 708053 1353 WUblastx.64 (Q9D4E9) 4932701A20RIK Q9D4E9
34% 159 542 PROTEIN. 52% 561 617 HFIAB78 581054 1355 WUblastx.64
(Q9UKA1) F-BOX PROTEIN FBL5 Q9UKA1 100% 672 872 (FRAGMENT). 100% 14
667 58% 608 658 32% 461 661 36% 690 836 HFIIK29 843587 1360
WUblastx.64 (Q9H705) CDNA: FLJ21611 FIS, Q9H705 94% 48 218 CLONE
COL07344. HFIIK29 852308 1361 WUblastx.64 (Q9H705) CDNA: FLJ21611
FIS, Q9H705 94% 48 218 CLONE COL07344. HFIIK29 873681 1362
WUblastx.64 (Q9H705) CDNA: FLJ21611 FIS, Q9H705 94% 48 218 CLONE
COL07344. HFIIK29 885007 1363 WUblastx.64 (Q9H705) CDNA: FLJ21611
FIS, Q9H705 94% 48 218 CLONE COL07344. HFIIZ61 855939 1366
WUblastx.64 (Q62786) PROSTAGLANDIN F2- FPRP_RAT 92% 35 229 ALPHA
RECEPTOR REGULATORY PROTEIN HFIUT21 794323 1372 WUblastx.64
(AAH07934) DKFZP434A043 AAH07934 100% 6 320 protein. HFIXC39 683053
1374 WUblastx.64 hypothetical protein 1 - rat (fragment)
pir|S33477|S33477 36% 1816 1541 HFIXC69 704080 1375 WUblastx.64
(Q9NRX3) NADH: UBIQUINONE Q9NRX3 87% 32 292 OXIDOREDUCTASE MLRQ
SUBUNIT HOMOLOG.
HFIXE39 844408 1376 WUblastx.64 (CAC18649) Lipoyl-containing
CAC18649 100% 1394 1651 component X precursor. HFIYP15 688044 1377
WUblastx.64 (Q9H324) ZINC Q9H324 49% 430 1074 METALLOENDOPEPTIDASE
35% 406 915 (FRAGMENT). 31% 553 1110 36% 712 966 33% 577 738 34%
481 558 HFKBC47 847076 1383 WUblastx.64 (O95302) FK506-BINDING
O95302 99% 1177 323 PROTEIN (FRAGMENT). 54% 1174 404 47% 997 323
HFKDX53 731867 1384 WUblastx.64 (Q9BTV6) UNKNOWN (PROTEIN Q9BTV6
100% 407 763 FOR IMAGE: 3502107) 65% 204 371 (FRAGMENT). 100% 766
1296 HFKEB14 709663 1385 WUblastx.64 (Q9NVY4) CDNA FLJ10436 FIS,
Q9NVY4 97% 8 127 CLONE NT2RP1000574, HIGHLY SIMILAR TO HOM HFKEU17
815554 1389 WUblastx.64 (AAH00465) Growth arrest and DNA- AAH00465
97% 226 330 damage-inducible, 86% 473 784 HFKEV77 850678 1390
WUblastx.64 hypothetical protein pir|T14797|T14797 89% 238 567
DKFZp564B167.1 - human HFKFI15 775846 1391 WUblastx.64 (Q12948)
FORKHEAD BOX FXC1_HUMAN 100% 2 166 PROTEIN C1 (FORKHEAD- RELATED
PROTEIN HFKFK49 847077 1393 WUblastx.64 (Q9UHR0) MAP KINASE- Q9UHR0
100% 277 366 INTERACTING KINASE. HFOXD49 844524 1398 WUblastx.64
(O15194) YA22 PROTEIN (HYA22). O15194 99% 7 435 HFOXE28 847385 1399
WUblastx.64 (Q9H0E0) HYPOTHETICAL 13.4 KDA Q9H0E0 47% 1011 1286
PROTEIN. 39% 135 476 34% 360 671 60% 837 881 HFOYR54 743196 1403
WUblastx.64 (O00566) U3 SMALL NUCLEOLAR MP10_HUMAN 78% 118 1365
RIBONUCLEOPROTEIN PROTEIN 63% 136 168 MPP10 HFPBQ55 608171 1409
WUblastx.64 (Q24333) ELASTIN LIKE PROTEIN Q24333 100% 45 116
(FRAGMENT). HFPCM32 608215 1411 WUblastx.64 (Q9H743) CDNA: FLJ21394
FIS, Q9H743 48% 719 441 CLONE COL03536. HFPCU47 741049 1414
WUblastx.64 (Q9H728) CDNA: FLJ21463 FIS, Q9H728 59% 1645 1580 CLONE
COL04765. 58% 1598 1356 HFPCY66 825718 1415 WUblastx.64 (Q9H387)
PRO2550. Q9H387 72% 1371 1252 72% 1555 1424 HFPDC65 839208 1416
WUblastx.64 (Q9H5G8) CDNA: FLJ23451 FIS, Q9H5G8 100% 72 605 CLONE
HSI06456. HFPDE42 844402 1417 WUblastx.64 (Q99PQ3) TRIPARTITE MOTIF
Q99PQ3 97% 3 218 PROTEIN TRIM9 (FRAGMENT). HFPDP70 745433 1420
WUblastx.64 (Q9H919) CDNA FLJ13078 FIS, Q9H919 83% 937 990 CLONE
NT2RP3002002. 88% 879 905 58% 980 1096 HFPDX08 746379 1422
WUblastx.64 (Q9H9Y3) CDNA FLJ12474 FIS, Q9H9Y3 100% 3 311 CLONE
NT2RM1000927. HFPEP69 835459 1423 WUblastx.64 (Q9P0X1)
LIPOPOLYSACCHARIDE Q9P0X1 96% 654 749 SPECIFIC RESPONSE-5 PROTEIN
(FRAGMENT). HFRAU40 701986 1424 WUblastx.64 hypothetical protein 3
- human pir|E41925|E41925 34% 228 109 57% 511 428 45% 428 252
HFSAY91 828067 1426 WUblastx.64 hypothetical protein
pir|T46933|T46933 100% 1280 1197 DKFZp434M035.1 - human 92% 1096
437 HFSBC10 638315 1427 WUblastx.64 (O95025) SEMAPHORIN 3D
SM3D_HUMAN 82% 1437 532 PRECURSOR. 82% 626 231 54% 742 443 100% 234
67 HFSBE94 600398 1428 WUblastx.64 (Q9P195) PRO1722. Q9P195 75% 705
610 73% 853 695 HFTAN11 638316 1429 WUblastx.64 (Q9H387) PRO2550.
Q9H387 54% 676 614 82% 771 667 68% 537 490 83% 617 489 HFTBL17
844488 1434 WUblastx.64 (Q14288) HYPOTHETICAL Q14288 95% 967 710
PROTEIN (FRAGMENT). HFTBL17 863152 1435 WUblastx.64 (Q14288)
HYPOTHETICAL Q14288 95% 969 712 PROTEIN (FRAGMENT). HFTCI85 664487
1437 WUblastx.64 (O60448) NEURONAL THREAD O60448 63% 1140 1075
PROTEIN AD7C-NTP. 92% 1070 1032 38% 1139 1032 67% 1285 1130 59%
1067 1002 33% 877 707 65% 1275 1129 77% 1283 1257 72% 1276 1019
HFTCJ32 604911 1438 WUblastx.64 (Q9H387) PRO2550. Q9H387 59% 669
586 71% 889 689 HFTCO17 844354 1439 WUblastx.64 (Q9QY01)
SERINE/THREONINE Q9QY01 83% 1 231 KINASE UNC51.2. 95% 216 611
HFTCW07 604987 1440 WUblastx.64 (Q9H5R3) CDNA: FLJ23147 FIS, Q9H5R3
75% 798 589 CLONE LNG09295. HFTDF32 600360 1441 WUblastx.64
(Q9H728) CDNA: FLJ21463 FIS, Q9H728 73% 1017 1310 CLONE COL04765.
HFTDF79 827459 1442 WUblastx.64 hypothetical protein XF0051
pir|G82853|G82853 40% 873 691 [imported]- Xylella fastidiosa
(strain 32% 872 627 9a5c) 51% 1202 1113 42% 813 589 32% 961 716 28%
792 424 62% 1184 1113 62% 1184 1113 42% 873 619 HFTDK11 837382 1443
WUblastx.64 (Q9Y6D7) ES18 (FRAGMENT). Q9Y6D7 100% 2 67 100% 558 650
63% 97 618 HFTDU08 825715 1444 WUblastx.64 (Q9NX85) CDNA FLJ20378
FIS, Q9NX85 70% 885 775 CLONE KAIA0536. HFVGK67 569778 1445
WUblastx.64 (Q9H387) PRO2550. Q9H387 83% 1269 985 HFVHD38 826709
1446 WUblastx.64 SHORT ISOFORM OF O00339 sp_vs|O00339- 98% 2163 550
01|O00339 56% 2163 1387 50% 2163 1387 49% 2163 1387 48% 2142 1387
40% 1386 820 HFVIC33 799524 1448 HMMER PFAM: Enoyl-CoA PF00378 34.7
462 680 2.1.1 hydratase/isomerase family WUblastx.64 (Q9NTX5)
DJ351K20.2.1 (NOVEL Q9NTX5 96% 694 975 ENOYL COA/ACYL COA 99% 72
716 HYDRATASE/DEHYDROGENA HFXAK32 638319 1449 WUblastx.64 (Q9BGW3)
HYPOTHETICAL 13.5 KDA Q9BGW3 40% 1403 1104 PROTEIN. HFXAK59 831141
1450 WUblastx.64 (Q9BTC8) SIMILAR TO Q9BTC8 95% 1537 431 METASTASIS
ASSOCIATED 1. HFXBM52 737672 1453 WUblastx.64 (Q9HA67) CDNA
FLJ12155 FIS, Q9HA67 80% 708 631 CLONE MAMMA1000472. 50% 123 64 68%
569 465 HFXBV67 748230 1455 WUblastx.64 hypothetical protein (L1H
3' region) - pir|B34087|B34087 52% 1618 1319 human HFXCI42 606806
1458 WUblastx.64 (Q9GMI7) HYPOTHETICAL 9.0 KDA Q9GMI7 43% 542 297
PROTEIN. 72% 534 406 HFXCL59 825713 1459 WUblastx.64 (Q9NSI6)
WD-REPEAT PROTEIN 9 WDR9_HUMAN 90% 1008 397 (FRAGMENT). 76% 53 3
35% 1002 385 28% 993 604 24% 960 556 29% 349 182 100% 367 182 88%
180 154 HFXCS53 828903 1462 WUblastx.64 (Q9H8H0) CDNA FLJ13640 FIS,
Q9H8H0 99% 1107 442 CLONE PLACE1011221. HFXDB37 569805 1463
WUblastx.64 (Q9GMX5) HYPOTHETICAL 12.9 KDA Q9GMX5 58% 1116 1208
PROTEIN. 57% 991 1131 HFXDL76 821571 1466 WUblastx.64 probable pol
polyprotein-related pir|S21348|S21348 63% 1811 1746 protein 4 - rat
48% 1520 1446 64% 1740 1519 HFXDP44 590269 1469 WUblastx.64
(Q9NX17) CDNA FLJ20489 FIS, Q9NX17 64% 531 761 CLONE KAT08285. 50%
918 1115 88% 745 825 36% 1005 1103 30% 660 779 HFXDR08 621342 1470
WUblastx.64 (Q9BGV8) HYPOTHETICAL 10.0 KDA Q9BGV8 64% 506 700
PROTEIN. HFXDR28 621300 1471 WUblastx.64 (Q9H5R3) CDNA: FLJ23147
FIS, Q9H5R3 68% 652 717 CLONE LNG09295. 70% 501 653 HFXDR28 873859
1472 WUblastx.64 (Q9H5X2) CDNA: FLJ22865 FIS, Q9H5X2 98% 853 314
CLONE KAT02171. HFXDR47 846477 1473 WUblastx.64 (Q9H387) PRO2550.
Q9H387 100% 977 957 92% 1051 1010 65% 957 733 HFXDZ03 846323 1474
WUblastx.64 (Q9UN78) HYPOTHETICAL 40.1 KDA Q9UN78 32% 1065 739
PROTEIN. 52% 528 385 24% 1161 877 39% 757 521 HFXEE88 838822 1476
WUblastx.64 (Q9NX17) CDNA FLJ20489 FIS, Q9NX17 56% 1310 1116 CLONE
KAT08285. HFXGR32 534607 1477 WUblastx.64 (Q9HA67) CDNA FLJ12155
FIS, Q9HA67 57% 24 272 CLONE MAMMA1000472. HFXGT51 638174 1478
WUblastx.64 (Q9NX85) CDNA FLJ20378 FIS, Q9NX85 74% 1126 989 CLONE
KAIA0536. 78% 1232 1107 HFXHI33 874255 1481 WUblastx.64 (Q9HBS7)
HYPOTHETICAL 14.2 KDA Q9HBS7 66% 1535 1278 PROTEIN. HFXHL21 581363
1482 WUblastx.64 (Q9BGW3) HYPOTHETICAL 13.5 KDA Q9BGW3 56% 1441
1373 PROTEIN. 64% 1601 1443 HFXHM93 858720 1485 WUblastx.64
(AAK55521) PRO0764. AAK55521 66% 803 1027 HFXHN89 786196 1486
WUblastx.64 (O60448) NEURONAL THREAD O60448 61% 1063 1218 PROTEIN
AD7C-NTP. 59% 1208 1273 65% 1072 1332 HFXJB21 743165 1487
WUblastx.64 (Q9H728) CDNA: FLJ21463 FIS, Q9H728 73% 1269 1003 CLONE
COL04765. HFXJN93 596815 1488 WUblastx.64 (Q9D4B1) 4933405A16RIK
Q9D4B1 97% 501 298 PROTEIN. HFXJS15 800866 1489 WUblastx.64
(Q9ESN6) NEURAL ACTIVITY- Q9ESN6 97% 1 447 RELATED RING FINGER
PROTEIN 32% 37 438 (TRIPARTITE MOTI 33% 10 435 31% 10 516 HFXJT53
823591 1490 WUblastx.64 (AAL50053) Viperin. AAL50053 94% 111 1193
HFXKL60 895307 1492 WUblastx.64 (Q9H3C0) PRO0898. Q9H3C0 37% 1749
1889 67% 1865 2029 HFXLG08 885514 1493 WUblastx.64 (Q9GMX5)
HYPOTHETICAL 12.9 KDA Q9GMX5 60% 1303 1067 PROTEIN. HFXLK91 827288
1494 WUblastx.64 (Q9NWT2) CDNA FLJ20623 FIS, Q9NWT2 87% 3 827 CLONE
KAT04793. HGBBR29 823106 1497 WUblastx.64 (O43592) EXPORTIN T.
O43592 100% 183 1118 HGBDV35 581058 1499 WUblastx.64 (AAK53702)
ADMP. AAK53702 42% 91 252 HGBHE23 832303 1502 WUblastx.64
hypothetical protein pir|T12479|T12479 86% 24 455 DKFZp564N1362.1 -
human (fragment) HGBHI15 608170 1503 WUblastx.64 (Q9BGW3)
HYPOTHETICAL 13.5 KDA Q9BGW3 63% 663 565 PROTEIN. 65% 559 380
HGLAG32 668271 1505 WUblastx.64 (Q9BRZ3) UNKNOWN (PROTEIN Q9BRZ3
66% 2 154
FOR MGC: 2724). HGLAH86 603525 1507 WUblastx.64 (Q9NX17) CDNA
FLJ20489 FIS, Q9NX17 55% 824 618 CLONE KAT08285. HHEBP28 775744
1517 WUblastx.64 (Q9BRL7) SIMILAR TO VESICLE Q9BRL7 100% 3 233
TRAFFICKING PROTEIN. HHECR10 621371 1519 WUblastx.64 (Q9H7S6) CDNA
FLJ14310 FIS, Q9H7S6 64% 972 766 CLONE PLACE3000271. HHEMC55 566796
1520 WUblastx.64 (O60448) NEURONAL THREAD O60448 64% 605 417
PROTEIN AD7C-NTP. 42% 659 417 63% 1063 896 48% 912 808 41% 575 405
47% 1063 965 40% 1017 781 42% 976 878 61% 1060 827 32% 1063 812 50%
896 771 80% 349 320 65% 656 597 40% 606 325 43% 516 343 45% 941 885
65% 606 445 HHEMP35 821328 1523 WUblastx.64 (Q9Y6X2) PROTEIN
INHIBITOR OF Q9Y6X2 93% 302 931 ACTIVATIED STAT3 (PROTEIN 60% 75
308 INHIBITOR OF HHEMZ08 840026 1524 WUblastx.64 (Q9NZ80)
UNCHARACTERIZED Q9NZ80 77% 845 1351 BONE MARROW PROTEIN BM042.
HHENR74 825671 1527 WUblastx.64 (Q9H728) CDNA: FLJ21463 FIS, Q9H728
70% 1005 1085 CLONE COL04765. 77% 811 876 76% 878 1003 HHENY07
638321 1529 WUblastx.64 (O00311) CELL DIVISION CYCLE CDC7_HUMAN 88%
8 136 7-RELATED PROTEIN KINASE (EC 2 98% 121 744 HHEOK77 841099
1530 WUblastx.64 (Q9Z1W6) P80 (FRAGMENT). Q9Z1W6 76% 238 276 87%
942 1127 23% 510 764 80% 315 977 HHEPE72 621254 1531 WUblastx.64
(Q9H728) CDNA: FLJ21463 FIS, Q9H728 53% 1015 749 CLONE COL04765.
HHEPE81 840614 1532 WUblastx.64 (O95373) RANBP7/IMPORTIN 7. O95373
86% 3 389 HHEQY60 799535 1535 WUblastx.64 (O60448) NEURONAL THREAD
O60448 68% 703 566 PROTEIN AD7C-NTP. 62% 731 555 68% 568 503 47%
570 502 58% 489 439 65% 731 429 HHFEB79 1300768 1541 WUblastx.64
(Q92545) RW1 PROTEIN RW1_HUMAN 74% 708 2387 (FRAGMENT). 80% 6 590
32% 1984 2148 HHFEB79 863749 3107 WUblastx.64 Similar to a C.
elegans protein encoded dbj|BAA13387.1| 69% 1303 2400 in cosmid
C27F2 (U40419) [Homo 80% 601 1185 sapiens] HHFEN34 701992 1543
WUblastx.64 (Q9HAD8) CDNA FLJ11786 FIS, Q9HAD8 63% 709 644 CLONE
HEMBA1006036. 57% 942 691 HHFFZ01 847388 1544 WUblastx.64 (Q9H6Y7)
CDNA: FLJ21676 FIS, Q9H6Y7 89% 835 1080 CLONE COL09164. 91% 1077
1763 HHFGI71 663531 1545 WUblastx.64 (Q9BGW3) HYPOTHETICAL 13.5 KDA
Q9BGW3 75% 1174 1272 PROTEIN. 67% 1424 1269 HHFGJ54 731870 1546
WUblastx.64 (Q9H906) CDNA FLJ13099 FIS, Q9H906 99% 1232 1645 CLONE
NT2RP3002248. 96% 510 1259 HHFGL38 833063 1547 WUblastx.64 (Q9H387)
PRO2550. Q9H387 53% 2764 2465 HHFGZ23 721653 1549 WUblastx.64
hypothetical protein 3 - human pir|E41925|E41925 64% 978 1136
HHFHM47 638181 1551 WUblastx.64 (O60448) NEURONAL THREAD O60448 76%
680 618 PROTEIN AD7C-NTP. 40% 804 670 65% 802 671 84% 611 573 72%
681 616 60% 77 3 62% 838 557 HHGAA76 767745 1552 WUblastx.64
(Q14288) HYPOTHETICAL Q14288 49% 1301 870 PROTEIN (FRAGMENT). 69%
499 431 68% 59 3 74% 1455 1294 66% 888 505 HHGAD46 812646 1553
WUblastx.64 (Q9UGT4) BK65A6.2 (NOVEL Q9UGT4 85% 148 783 SUSHI
DOMAIN (SCR REPEAT) 67% 3 203 CONTAINING PROTEIN HHGBC21 840455
1555 WUblastx.64 (Q9H743) CDNA: FLJ21394 FIS, Q9H743 54% 1118 858
CLONE COL03536. HHGBW55 638183 1559 WUblastx.64 hypothetical
protein [imported] - pir|T50835|T50835 97% 3 143 human HHGDR05
610266 1564 WUblastx.64 (Q9HAD8) CDNA FLJ11786 FIS, Q9HAD8 63% 821
690 CLONE HEMBA1006036. HHGDR92 840454 1565 WUblastx.64 (Q9Y512)
PROTEIN CGI-51. CG51_HUMAN 99% 10 1104 HHGDS56 663379 1566
WUblastx.64 (Q9NX85) CDNA FLJ20378 FIS, Q9NX85 57% 1318 1187 CLONE
KAIA0536. 62% 1476 1309 HHGDW65 825652 1567 WUblastx.64 (Q9GMX5)
HYPOTHETICAL 12.9 KDA Q9GMX5 56% 463 726 PROTEIN. HHPDE28 877640
1571 WUblastx.64 (Q9H620) CDNA: FLJ22673 FIS, Q9H620 98% 393 596
CLONE HSI10503. HHPEB61 658693 1575 WUblastx.64 (Q9H743) CDNA:
FLJ21394 FIS, Q9H743 50% 777 935 CLONE COL03536. 54% 622 804
HHPFP26 753269 1576 WUblastx.64 (Q9BQG8) HYPOTHETICAL 32.5 KDA
Q9BQG8 100% 906 1742 PROTEIN. HHPFS11 570807 1577 WUblastx.64
(Q9H728) CDNA: FLJ21463 FIS, Q9H728 50% 402 587 CLONE COL04765.
HHPFS18 829347 1579 WUblastx.64 (Q9H728) CDNA: FLJ21463 FIS, Q9H728
75% 2558 2427 CLONE COL04765. HHPGH34 535780 1580 WUblastx.64
(Q9BVD9) UNKNOWN (PROTEIN Q9BVD9 68% 1019 972 FOR MGC: 5149). 64%
835 794 68% 963 850 HHPGU87 658694 1582 WUblastx.64 SHORT ISOFORM
OF O60658 sp_vs|O60658- 100% 1050 1274 01|O60658 HHPSE55 735562
1585 WUblastx.64 (Q9CQ15) 0610011N22RIK Q9CQ15 79% 67 846 PROTEIN
(RIKEN CDNA 0610011N22 GENE). HHPSF70 709665 1586 WUblastx.64
(AAH18471) Similar to nitrogen AAH18471 81% 1 96 fixation gene 1
(S. HHPSH74 638185 1587 WUblastx.64 hypothetical protein
DKFZp566E044.1 - pir|T46284|T46284 72% 323 1339 human 99% 10 321
54% 10 321 53% 323 571 20% 752 1030 87% 1272 1730 HHPTF26 857654
1590 WUblastx.64 (Q9BGW3) HYPOTHETICAL 13.5 KDA Q9BGW3 66% 1006 752
PROTEIN. HHSAE74 839473 1592 WUblastx.64 (Q9P1J1) PRO1546. Q9P1J1
89% 451 365 87% 588 442 HHSAG62 847392 1593 WUblastx.64 (Q9H876)
CDNA FLJ13898 FIS, Q9H876 99% 2 460 CLONE THYRO1001738, WEAKLY 99%
600 1052 SIMILAR TO TUB 100% 533 604 HHSBJ92 838604 1595
WUblastx.64 (Q9BTM2) SIMILAR TO RIKEN Q9BTM2 100% 509 718 CDNA
1300006O23 GENE (FRAGMENT). HHSDB43 812510 1600 HMMER PFAM: Zinc
finger, C2H2 type PF00096 117.4 877 945 2.1.1 WUblastx.64
hypothetical protein pir|T42688|T42688 92% 25 1344 DKFZp434H0127.1
- human (fragment) HHSDL07 899430 1601 WUblastx.64 (Q9UJH9)
C380A1.2.1 (NOVEL Q9UJH9 85% 9 317 PROTEIN (ISOFORM 1)) (UNKNOWN)
(PROTEIN FO HHSDX07 847393 1602 WUblastx.64 (Q9H9W2) CDNA FLJ12510
FIS, Q9H9W2 86% 3 512 CLONE NT2RM2001723. 79% 434 1066 HHSFF54
836149 1603 WUblastx.64 (Q9BS18) UNKNOWN (PROTEIN Q9BS18 100% 129
350 FOR MGC: 12537). HIABC70 838605 1607 WUblastx.64 (Q9NPJ9)
APOLIPOPROTEIN B48 Q9NPJ9 77% 15 851 RECEPTOR. 100% 1047 1160 34%
522 821 25% 303 842 24% 306 818 24% 312 839 HIBCO70 853360 1609
HMMER PFAM: Myelin proteolipid protein PF01275 32.3 127 192 2.1.1
(PLP or lipophilin) WUblastx.64 (Q99NH0) GENE TRAP ANKYRIN Q99NH0
95% 176 1564 REPEAT CONTAINING PROTEIN. 38% 410 1414 39% 413 1408
37% 419 1411 39% 413 1408 38% 410 1360 37% 443 1441 38% 425 1420
37% 608 1411 38% 407 1141 33% 887 1411 HIBDA41 603909 1611
WUblastx.64 (Q9H387) PRO2550. Q9H387 80% 404 697 HIBEC45 822854
1612 WUblastx.64 (Q9BGW3) HYPOTHETICAL 13.5 KDA Q9BGW3 63% 1023
1283 PROTEIN. HILBW03 841377 1613 WUblastx.64 (Q9NVS4) CDNA
FLJ10546 FIS, Q9NVS4 97% 705 1163 CLONE NT2RP2001721. HISAE16
845233 1614 WUblastx.64 (Q9H728) CDNA: FLJ21463 FIS, Q9H728 85% 7
90 CLONE COL04765. HISAG53 843902 1615 WUblastx.64 (BAB55426) CDNA
FLJ14972 fis, BAB55426 100% 84 122 clone THYRO1000715. 83% 952 1614
78% 127 993 HISAN63 797658 1616 WUblastx.64 (O00363) PUTATIVE P150.
O00363 33% 1609 1427 29% 1299 1045 59% 1454 1392 35% 716 384
HISAT78 840961 1617 WUblastx.64 (Q9NUD5) DJ1103G7.7 (PUTATIVE
Q9NUD5 66% 155 280 NOVEL PROTEIN). 96% 13 108 29% 594 767 100% 114
194 32% 591 785 50% 538 567 100% 576 743 98% 280 567 HISBA38 561711
1618 WUblastx.64 (Q9H387) PRO2550. Q9H387 53% 919 836 53% 996 907
51% 842 687 HISBB66 839808 1619 WUblastx.64 (O95627) POTENTIAL
O95627 88% 2 451 TRANSCRIPTIONAL REPRESSOR NOT4HP. HISEJ52 886777
1623 WUblastx.64 (Q9Y6J0) CALCINEURIN-BINDING CABI_HUMAN 94% 480
1697 PROTEIN CABIN 1 (CALCINEURIN I HJABC58 753272 1624 WUblastx.64
(Q9H743) CDNA: FLJ21394 FIS, Q9H743 68% 993 928 CLONE COL03536. 73%
1186 998 HJABS31 825607 1627 WUblastx.64 (AAG49400) Ring-H2
protein. AAG49400 90% 1 1221 HJACE25 835517 1629 WUblastx.64
(O75921) RNA POLYMERASE II O75921 95% 381 662 TERMINATION FACTOR.
91% 64 390 HJACK21 664506 1630 WUblastx.64 (Q9CYB5) 5730552M22RIK
Q9CYB5 98% 530 1123 PROTEIN. HJBCG74 839361 1631 WUblastx.64
(Q9UNW1) MULTIPLE INOSITOL Q9UNW1 88% 33
560 POLYPHOSPHATE 99% 560 1492 PHOSPHATASE. HJBCO21 695727 1632
WUblastx.64 (Q9Y6E5) HSPC024-ISO. Q9Y6E5 84% 9 482 HJBCQ40 831119
1633 WUblastx.64 (BAB55245) CDNA FLJ14722 fis, BAB55245 84% 58 1068
clone NT2RP3001621. HJBDM36 773168 1634 WUblastx.64 (O15498) SNARE
PROTEIN YKT6. O15498 92% 127 720 HJMAZ60 844796 1637 WUblastx.64
(Q9D9R1) ADULT MALE TESTIS Q9D9R1 87% 482 1054 CDNA, RIKEN
FULL-LENGTH 88% 14 484 ENRICHED LIBRARY, HJMBB20 824264 1638
WUblastx.64 ISOFORM GAC OF O94925 sp_vs|O94925- 99% 3 527 02|O94925
HJMBB20 842673 1639 WUblastx.64 ISOFORM GAC OF O94925 sp_vs|O94925-
100% 4 1461 02|O94925 HJMBB20 844890 1640 WUblastx.64 ISOFORM GAC
OF O94925 sp_vs|O94925- 100% 4 1461 02|O94925 HJMBK59 664490 1641
WUblastx.64 (O75935) DYNACTIN SUBUNIT. O75935 100% 2 286 HJMBP01
638190 1642 WUblastx.64 (AAH00573) HSPC163 protein. AAH00573 100%
13 174 HJPAF69 589794 1646 WUblastx.64 (Q9H387) PRO2550. Q9H387 77%
439 531 73% 278 424 HJPAQ19 566832 1647 WUblastx.64 hypothetical
protein pir|T08694|T08694 78% 9 869 DKFZp564O092.1 - human
(fragment) HJPAZ35 845379 1648 WUblastx.64 (Q9Y262) HSPC025. Q9Y262
95% 126 1745 HJPBI77 602875 1649 WUblastx.64 (Q9V756) CG10155
PROTEIN. Q9V756 42% 16 249 HJPBN96 610087 1650 WUblastx.64 (Q9NX09)
CDNA FLJ20500 FIS, Q9NX09 100% 106 288 CLONE KAT09159. 100% 70 108
HJPBU47 824063 1651 WUblastx.64 (Q9NPM0) 8D6 ANTIGEN Q9NPM0 100%
240 377 (FRAGMENT). 77% 315 380 73% 261 329 80% 329 844 HJPDK61
844034 1654 WUblastx.64 (Q9V7R7) CG8311 PROTEIN. Q9V7R7 41% 466
1194 HKABI53 805966 1655 WUblastx.64 (Q9BUP3) TAT-INTERACTING
Q9BUP3 93% 126 212 PROTEIN (30 KD). 99% 212 778 HKABN63 566840 1656
WUblastx.64 (Q9BRZ8) SIMILAR TO RIKEN Q9BRZ8 85% 40 306 CDNA
1810009K13 GENE. 98% 263 700 HKACA25 824087 1657 WUblastx.64
(Q9BGW3) HYPOTHETICAL 13.5 KDA Q9BGW3 64% 1493 1543 PROTEIN. 66%
1276 1488 HKACO64 897591 1658 WUblastx.64 (Q9P195) PRO1722. Q9P195
61% 694 593 58% 930 748 HKACX90 604042 1660 WUblastx.64 (Q9CZH5)
2700094L05RIK Q9CZH5 69% 13 510 PROTEIN. HKADI27 1028177 1661
WUblastx.64 (O35390) ENDO-ALPHA-D- O35390 65% 302 562 MANNOSIDASE.
51% 531 602 87% 574 1512 HKADN26 802131 1662 WUblastx.64 (Q24333)
ELASTIN LIKE PROTEIN Q24333 48% 57 263 (FRAGMENT). HKADT55 668243
1664 WUblastx.64 (Q9CS80) 5730420G12RIK PROTEIN Q9CS80 97% 454 708
(FRAGMENT). 93% 13 57 HKAEK58 695729 1665 HMMER PFAM: Acyl-CoA
dehydrogenase PF00441 449.8 160 1269 2.1.1 WUblastx.64 (Q9UKU7)
ACYL-COENZYME A Q9UKU7 100% 39 113 DEHYDROGENASE-8. 99% 112 1284
HKAEK72 840457 1666 HMMER PFAM: Sugar (and other) transporter
PF00083 70.8 270 575 2.1.1 WUblastx.64 (Q9UGQ3) SUGAR TRANSPORTER
Q9UGQ3 99% 9 602 (GLUCOSE TRANSPORTER 9). HKAFQ41 847281 1668
WUblastx.64 (O94771) TRANSCRIPTION O94771 84% 36 896 FACTOR-LIKE 5.
HKAHH71 846826 1669 WUblastx.64 (Q9VAA6) CG7950 PROTEIN. Q9VAA6 57%
31 348 HKAKU90 838608 1671 WUblastx.64 (Q9H2T6) ANTIGEN ART1/P17.
Q9H2T6 85% 19 1230 HKFAA15 753275 1673 WUblastx.64 (Q9P195)
PRO1722. Q9P195 67% 1748 1593 76% 1605 1465 HKGAJ81 581063 1676
WUblastx.64 (Q9H387) PRO2550. Q9H387 81% 445 335 48% 1240 1166 70%
620 429 HKGAK45 809093 1677 WUblastx.64 (Q9H387) PRO2550. Q9H387
63% 1946 1815 68% 2088 1945 HKGAP57 841627 1679 WUblastx.64
(Q9NX85) CDNA FLJ20378 FIS, Q9NX85 54% 770 639 CLONE KAIA0536. 72%
907 767 HKGAW41 858745 1680 WUblastx.64 (Q9H728) CDNA: FLJ21463
FIS, Q9H728 68% 1458 1327 CLONE COL04765. 71% 1622 1431 HKGBA21
822870 1681 WUblastx.64 (O00367) L1 ELEMENT L1.19 P40 O00367 55%
1697 1783 PROTEIN. 30% 810 1064 50% 1279 1731 HKGBC33 823368 1682
WUblastx.64 (Q9UI50) PRO0657 (FRAGMENT). Q9UI50 76% 783 1001
HKGBC73 608169 1683 WUblastx.64 (Q9BGV8) HYPOTHETICAL 10.0 KDA
Q9BGV8 54% 74 9 PROTEIN. 78% 133 77 HKGBF61 658697 1684 WUblastx.64
(AAK55521) PRO0764. AAK55521 70% 978 919 39% 1700 1587 59% 138 73
70% 1171 980 HKGBH54 588482 1685 WUblastx.64 (Q9UHT1) PRO1902
PROTEIN. Q9UHT1 61% 2206 2114 43% 1994 1884 54% 2135 1959 HKGBP52
899282 1686 WUblastx.64 (Q9NX85) CDNA FLJ20378 FIS, Q9NX85 68% 1562
1440 CLONE KAIA0536. 76% 1726 1556 HKGCE23 564825 1687 WUblastx.64
(Q9D445) 4933414E04RIK Q9D445 60% 1456 1749 PROTEIN. HKGCE62 638200
1688 WUblastx.64 (Q9UHT1) PRO1902 PROTEIN. Q9UHT1 63% 995 897 61%
1131 985 HKGCK41 559327 1689 WUblastx.64 (Q9NQ89) MIB001 PROTEIN.
Q9NQ89 93% 20 583 HKGCK41 795256 1690 WUblastx.64 (Q9NQ89) MIB001
PROTEIN. Q9NQ89 93% 31 591 HKGDA95 581064 1693 WUblastx.64 (Q9BYC7)
MITOCHONDRIAL Q9BYC7 98% 77 313 RIBOSOMAL PROTEIN BMRP36A. 98% 618
782 82% 428 625 HKGDO12 857225 1694 WUblastx.64 (O60448) NEURONAL
THREAD O60448 55% 1223 1170 PROTEIN AD7C-NTP. 72% 1429 1277 57%
1437 1222 48% 1218 1129 56% 1289 1146 79% 1441 1223 HKIME53 636982
1695 WUblastx.64 (Q9H3S2) HCCA2 PROTEIN. Q9H3S2 100% 4 30 100% 29
70 89% 63 446 HKIMG23 738671 1696 WUblastx.64 (O75896) FUS1
PROTEIN. FUS1_HUMAN 76% 217 255 100% 131 172 100% 246 458 HKMLF77
604743 1704 WUblastx.64 (Q9NX85) CDNA FLJ20378 FIS, Q9NX85 91% 673
638 CLONE KAIA0536. 88% 737 684 52% 627 457 HKMLM32 826523 1705
WUblastx.64 (Q9P0E3) HSPC093 (FRAGMENT). Q9P0E3 57% 861 1001
HKMLR17 847432 1706 HMMER PFAM: CUB domain PF00431 145 425 760
2.1.1 WUblastx.64 (Q9UKZ9) PROCOLLAGEN C- Q9UKZ9 94% 8 1210
TERMINAL PROTEINASE ENHANCER PROTEIN 2. HKMLT89 826167 1707
WUblastx.64 (Q9HD86) NAG18. Q9HD86 87% 1141 1233 HKMLV05 663924
1708 WUblastx.64 (Q9H387) PRO2550. Q9H387 81% 1559 1290 HKMLV25
695731 1709 WUblastx.64 (Q9BT42) SIMILAR TO LR8 Q9BT42 97% 328 474
PROTEIN. 40% 266 340 99% 2 334 HKMMD91 847394 1712 WUblastx.64
(AAH07729) Similar to RIKEN cDNA AAH07729 100% 1150 752 2810021O14
gene. HKMMP90 746876 1713 WUblastx.64 (O40947) ORF 73. O40947 30%
237 398 28% 240 443 30% 210 317 24% 1054 1569 25% 1054 1659 24%
1054 1659 25% 1054 1659 25% 1060 1662 23% 1054 1677 HKPAC10 527238
1715 WUblastx.64 (Q9HAD8) CDNA FLJ11786 FIS, Q9HAD8 47% 970 677
CLONE HEMBA1006036. HKPAC50 830367 1716 WUblastx.64 (O95139)
NADH-UBIQUINONE NB7M_HUMAN 61% 106 324 OXIDOREDUCTASE B17 SUBUNIT
(EC 1.6 HKTAC18 831292 1718 WUblastx.64 (Q9Y5W8) SORTING NEXIN 13
SNXD_HUMAN 88% 3 53 (FRAGMENT). 96% 38 400 HL1SA89 839594 1719
WUblastx.64 (Q9Y399) MITOCHONDRIAL 28S Q9Y399 99% 63 641 RIBOSOMAL
PROTEIN S2 (MRP- S2). HL2AB60 722226 1720 WUblastx.64 SHORT ISOFORM
OF Q9Y679 sp_vs|Q9Y679- 91% 64 1293 01|Q9Y679 HL3AF32 753468 1722
WUblastx.64 (Q9CZ73) 2810049G06RIK Q9CZ73 76% 6 527 PROTEIN.
HLDAV70 623603 1723 WUblastx.64 (Q9UJW0) DYNACTIN P62 Q9UJW0 100%
175 285 SUBUNIT (CDNA FLJ20292 FIS, CLONE HEP05374). HLDBL62 899498
1724 WUblastx.64 (Q9NYC7) HEPATOCELLULAR Q9NYC7 78% 36 740
CARCINOMA-ASSOCIATED ANTIGEN 112. HLDBV18 805684 1725 WUblastx.64
(Q9H7D5) CDNA: FLJ21022 FIS, Q9H7D5 94% 284 1198 CLONE CAE06383.
HLDBV54 570813 1726 HMMER PFAM: Sec1 family PF00995 18.7 180 332
2.1.1 HLDNF18 821599 1730 WUblastx.64 (Q9NWI8) CDNA FLJ20823 FIS,
Q9NWI8 78% 17 583 CLONE ADSE00282 (SIMILAR TO TRANSLOCASE O HLDNN84
612801 1731 WUblastx.64 (Q9UHT1) PRO1902 PROTEIN. Q9UHT1 51% 751
849 59% 600 755 HLDOD77 610208 1732 WUblastx.64 (Q9GMX5)
HYPOTHETICAL 12.9 KDA Q9GMX5 71% 513 617 PROTEIN. 62% 395 523
HLDOL74 812765 1733 WUblastx.64 (Q9P0A2) HSPC279 (FRAGMENT). Q9P0A2
94% 57 671 HLDRU08 701995 1735 WUblastx.64 (Q9NVD7) CDNA FLJ10793
FIS, Q9NVD7 99% 13 729 CLONE NT2RP4000588 (ALPHA- PARVIN). HLDXF43
514022 1736 WUblastx.64 cytochrome-c oxidase (EC 1.9.3.1)
pir|A00472|OBHU2 52% 164 559 chain II - human mitochondrion HLEAA10
824265 1737 WUblastx.64 (Q13579) MARINER Q13579 85% 842 741
TRANSPOSASE. 77% 738 13 HLHAE14 865625 1739 WUblastx.64 (Q9H7S6)
CDNA FLJ14310 FIS, Q9H7S6 66% 1412 1528 CLONE PLACE3000271. 44% 935
1060 HLHAE14 886763 1740 WUblastx.64 (Q9H7S6) CDNA FLJ14310 FIS,
Q9H7S6 66% 1412 1528 CLONE PLACE3000271. 44% 935 1060 HLHBS54
837503 1741 WUblastx.64 (Q9NZV5) SELENOPROTEIN N SELN_HUMAN 92% 1
1455 PRECURSOR. HLHCG24 847398 1744 WUblastx.64 (Q9BZE5) PGC-1
RELATED CO- Q9BZE5 82% 10 615 ACTIVATOR. HLHCN51 836150 1746
WUblastx.64 (Q9D1H8) 1110007K17RIK Q9D1H8 72% 1588 1514 PROTEIN.
48% 1514 1275 HLHCT96 886178 1747 WUblastx.64 (Q9H6G8) CDNA:
FLJ22294 FIS, Q9H6G8 90% 1976 1917 CLONE HRC04426. 68% 2152 1955
HLHDJ05 841732 1750 WUblastx.64 (Q9BGW3) HYPOTHETICAL 13.5 KDA
Q9BGW3 68% 812 708 PROTEIN. 66% 708 547 HLHDL37 847399 1751
WUblastx.64 (Q9NX17) CDNA FLJ20489 FIS, Q9NX17 78% 690 571 CLONE
KAT08285. HLHDL69 883335 1752 WUblastx.64 (O09014)
PEPTIDE/HISTIDINE O09014 88% 305 592 TRANSPORTER. 72% 598 1314
HLHDL69 850691 1753 WUblastx.64 (O09014) PEPTIDE/HISTIDINE O09014
75% 305 340
TRANSPORTER. 78% 330 1484 HLHDL69 843836 1754 WUblastx.64 (O09014)
PEPTIDE/HISTIDINE O09014 75% 305 340 TRANSPORTER. 78% 330 1484
HLHDL69 855906 1755 WUblastx.64 (O09014) PEPTIDE/HISTIDINE O09014
75% 305 340 TRANSPORTER. 78% 330 1484 HLHDM38 566843 1756
WUblastx.64 hypothetical protein pir|T46471|T46471 45% 6 326
DKFZp434L0130.1 - human 39% 181 339 61% 476 886 HLHDR92 692150 1757
WUblastx.64 (Q9NX85) CDNA FLJ20378 FIS, Q9NX85 77% 1252 1172 CLONE
KAIA0536. 58% 1181 1095 HLHDY94 847121 1758 WUblastx.64 (O00572)
HYPOTHETICAL 43.0 KDA O00572 56% 637 876 PROTEIN. 61% 18 752
HLHEI72 874180 1761 HMMER PFAM: Eukaryotic protein kinase PF00069
106.7 101 403 2.1.1 domain WUblastx.64 (Q9Y6S4) SIMILARITY IS TO
Q9Y6S4 81% 589 621 SERINE/THREONINE-PROTEIN 97% 89 526 KINASE
(FRAGMENT). HLHEX62 608285 1762 WUblastx.64 (Q9H387) PRO2550.
Q9H387 70% 1102 833 HLHFP09 805967 1764 WUblastx.64 ISOFORM 2 OF
O95460 sp_vs|O95460- 98% 3 881 01|O95460 38% 102 740 HLHGG78 638210
1765 WUblastx.64 (O95989) DIPHOSPHOINOSITOL O95989 100% 10 291
POLYPHOSPHATE PHOSPHOHYDROLASE. HLHSQ35 570814 1767 WUblastx.64
(Q9JIX6) RNA BINDING PROTEIN Q9JIX6 100% 671 712 NAPOR-3
(FRAGMENT). 87% 711 827 HLHTP55 847322 1769 WUblastx.64 (Q9H728)
CDNA: FLJ21463 FIS, Q9H728 50% 320 433 CLONE COL04765. 56% 462 635
HLIBD74 604914 1770 WUblastx.64 (Q9H797) CDNA: FLJ21128 FIS, Q9H797
98% 12 290 CLONE CAS06258. HLIBE41 772762 1771 WUblastx.64 (Q9D0Q3)
1300007B24RIK Q9D0Q3 58% 71 409 PROTEIN. HLLAX64 827292 1775
WUblastx.64 (BAB55004) CDNA FLJ14357 fis, BAB55004 96% 1020 1502
clone HEMBA1000005, h 91% 27 416 77% 364 417 25% 996 1196 97% 395
1057 32% 761 862 28% 752 973 28% 1257 1478 45% 611 676 45% 1428
1499 17% 1002 1229 HLLAX95 588405 1776 WUblastx.64 (Q9GMX5)
HYPOTHETICAL 12.9 KDA Q9GMX5 52% 541 603 PROTEIN. 65% 381 521
HLMCT51 772579 1780 WUblastx.64 (Q9DAD1) 1700013E09RIK Q9DAD1 55%
443 883 PROTEIN. HLMCT95 570815 1781 WUblastx.64 (Q9N083) UNNAMED
PORTEIN Q9N083 53% 1414 1121 PRODUCT. HLMDD65 566891 1782
WUblastx.64 (P20591) INTERFERON- MX1_HUMAN 100% 489 575 REGULATED
RESISTANCE GTP- 70% 580 720 BINDING PROTEI HLMFB62 604915 1785
WUblastx.64 (Q9H700) CDNA: FLJ21617 FIS, Q9H700 68% 154 2 CLONE
COL07481. HLMFG52 602166 1786 WUblastx.64 (Q9UHT5) PRO1848. Q9UHT5
71% 837 941 HLMFU53 801936 1787 WUblastx.64 (Q9ESD6) LNV. Q9ESD6
67% 1141 620 HLMHG68 580850 1788 WUblastx.64 (Q9HAI5) CDNA FLJ11583
FIS, Q9HAI5 92% 305 775 CLONE HEMBA1003680, WEAKLY SIMILAR TO PUT
HLMHN06 853606 1789 WUblastx.64 probable transposase - human
pir|S72481|S72481 59% 456 286 transposon MER37 80% 262 107 HLMIM84
588487 1791 WUblastx.64 (Q9Y3B0) CGI-105 PROTEIN. Q9Y3B0 84% 296
334 98% 645 806 HLMIW76 570816 1794 WUblastx.64 (O60448) NEURONAL
THREAD O60448 85% 531 490 PROTEIN AD7C-NTP. 57% 528 472 59% 600 535
57% 528 472 77% 744 718 63% 601 536 66% 752 591 69% 736 590 70% 737
474 HLQAD72 853613 1798 HMMER PFAM: Pancreatic ribonucleases
PF00074 213.4 208 564 2.1.1 WUblastx.64 ribonuclease 4 (EC
3.1.--.--) precursor - pir|I52489|I52489 90% 124 564 human HLQAM30
609880 1799 WUblastx.64 (Q9UHT1) PRO1902 PROTEIN. Q9UHT1 76% 648
610 57% 490 398 73% 617 480 HLQAM59 560662 1800 WUblastx.64
(AAH08373) Similar to hypothetical AAH08373 82% 879 829 protein
PRO1722. 54% 754 722 63% 1018 881 HLQBB23 745364 1801 WUblastx.64
(Q9CYS6) 2810459M11RIK Q9CYS6 44% 38 286 PROTEIN. HLQCY09 745384
1804 WUblastx.64 (Q9NX17) CDNA FLJ20489 FIS, Q9NX17 57% 884 843
CLONE KAT08285. 58% 759 505 HLQDK45 621414 1807 WUblastx.64
(Q9CPU5) 2700019M19RIK Q9CPU5 100% 615 737 PROTEIN. HLQDM47 743237
1808 WUblastx.64 giant protein p619 - human pir|S71752|S71752 92%
377 616 HLTDI20 610269 1817 WUblastx.64 (Q9H6C9) CDNA: FLJ22385
FIS, Q9H6C9 70% 5 76 CLONE HRC07610. 95% 58 186 HLTDI65 740756 1818
WUblastx.64 (O60448) NEURONAL THREAD O60448 41% 1290 1382 PROTEIN
AD7C-NTP. 50% 1456 1623 46% 1881 2027 47% 1881 2018 54% 1958 2029
54% 1878 1949 41% 1513 1605 57% 2095 2157 55% 1955 2038 60% 1275
1484 54% 1372 1464 47% 2095 2163 42% 2008 2157 64% 1472 1513 61%
1263 1463 36% 1939 2079 32% 1296 1460 50% 1363 1470 61% 2015 2149
46% 1315 1608 HLTDK30 834810 1819 WUblastx.64 (Q9HA72) CDNA
FLJ12133 FIS, Q9HA72 100% 511 747 CLONE MAMMA1000278 97% 231 506
(SIMILAR TO HYPOTHETIC 97% 740 1180 HLTDL37 638213 1820 WUblastx.64
(Q9Y383) CGI-74 PROTEIN. Q9Y383 82% 2 754 66% 1084 1155 37% 974
1078 HLTDU35 827293 1821 WUblastx.64 (Q9N083) UNNAMED PORTEIN
Q9N083 44% 1118 954 PRODUCT. 62% 954 820 HLTEH84 782094 1823
WUblastx.64 (Q9H5P9) CDNA: FLJ23188 FIS, Q9H5P9 97% 15 491 CLONE
LNG12038. HLTEL39 853615 1824 WUblastx.64 (Q9H743) CDNA: FLJ21394
FIS, Q9H743 39% 1391 1218 CLONE COL03536. 70% 1536 1387 HLTEW52
663148 1826 WUblastx.64 (Q9NX85) CDNA FLJ20378 FIS, Q9NX85 70% 1498
1244 CLONE KAIA0536. HLTEZ36 821676 1827 WUblastx.64 (Q9H387)
PRO2550. Q9H387 76% 7 171 HLTGG14 824068 1828 WUblastx.64 (Q9N032)
UNNAMED PROTEIN Q9N032 70% 1142 1020 PRODUCT. HLUAF94 794116 1829
WUblastx.64 (Q9UI50) PRO0657 (FRAGMENT). Q9UI50 75% 1438 1473 72%
1256 1444 HLWAH33 855954 1830 WUblastx.64 (Q9NSI3) PRED43 PROTEIN
Q9NSI3 100% 1660 1761 (FRAGMENT). 96% 25 102 HLWAO11 885339 1831
WUblastx.64 (Q9ES77) POLYDOM PROTEIN Q9ES77 76% 14 2656 PRECURSOR.
32% 14 2371 32% 2 2383 29% 152 2635 28% 14 2371 27% 14 1699 28% 506
1408 30% 2 628 29% 38 640 27% 161 787 28% 1469 2020 31% 2084 2617
34% 2267 2659 33% 14 373 32% 80 448 32% 2021 2635 35% 1019 1297 29%
1472 1969 22% 494 1990 33% 1745 2074 25% 14 478 27% 1067 1597 28%
1886 2179 26% 170 895 24% 1310 1771 26% 2249 2638 30% 1430 1654 22%
1142 1609 35% 1145 1288 36% 2003 2110 18% 1382 2194 35% 95 187 24%
455 709 27% 2354 2560 25% 440 673 33% 173 271 HLWAX50 809094 1833
WUblastx.64 (AAC08702) Meltrin-L precursor. AAC08702 92% 628 1629
93% 1587 2273 64% 178 255 39% 1553 1669 97% 257 661 HLWBK16 638217
1835 WUblastx.64 (Q9UEV9) ACTIN-BINDING Q9UEV9 94% 679 1191 PROTEIN
HOMOLOG ABP-278. 28% 572 700 52% 590 658 57% 605 658 58% 593 658
34% 673 750 29% 682 1185 50% 593 652 37% 593 721 33% 727 1164 37%
853 1125 30% 664 1179 53% 590 775 31% 593 775 34% 730 1188 34% 691
1185 32% 745 1125 32% 590 775 37% 706 1185 32% 691 1170 32% 688
1179 37% 688 1173 37% 703 1185 31% 703 1182 28% 703 1176 36% 715
1149 30% 703 1188 32% 949 1173 32% 691 1158 28% 691 1185 41% 706
1185 36% 593 775 32% 593 775 26% 551 775 31% 691 1179 34% 593 775
30% 748 1125 HLYAJ79 608289 1839 WUblastx.64 (Q9B2U5) ATP SYNTHASE
6. Q9B2U5 63% 301 807
HLYAT54 581067 1842 WUblastx.64 (Q9H9F0) CDNA FLJ12802 FIS, Q9H9F0
93% 35 220 CLONE NT2RP2002124, WEAKLY SIMILAR TO UBI HLYBC81 588490
1843 WUblastx.64 (Q9HBW6) NAG13. Q9HBW6 43% 1373 1711 HLYBD09
610019 1844 WUblastx.64 (Q9NX85) CDNA FLJ20378 FIS, Q9NX85 69% 1546
1644 CLONE KAIA0536. 65% 1391 1513 HLYBL67 834538 1845 WUblastx.64
(Q9NRE8) PADI-H PROTEIN. Q9NRE8 64% 335 294 61% 304 158 HLYBN23
667995 1847 WUblastx.64 (Q9UI59) PRO0478 PROTEIN. Q9UI59 83% 1397
1450 80% 1333 1395 HLYBT28 608152 1850 WUblastx.64 (Q9N083) UNNAMED
PORTEIN Q9N083 54% 1082 774 PRODUCT. HLYBY04 596819 1852
WUblastx.64 (Q9H387) PRO2550. Q9H387 83% 1565 1530 71% 1533 1270
HLYCE15 621407 1853 WUblastx.64 (Q9P147) PRO2822. Q9P147 75% 518
420 HLYCH04 608295 1854 WUblastx.64 (O62658) LINE-1 ELEMENT ORF2.
O62658 47% 106 273 45% 7 39 HLYDE38 735987 1856 WUblastx.64
(Q9N083) UNNAMED PORTEIN Q9N083 47% 987 835 PRODUCT. 68% 1091 1005
HLYDG55 835625 1857 WUblastx.64 (Q9H5R3) CDNA: FLJ23147 FIS, Q9H5R3
73% 638 423 CLONE LNG09295. HLYEA60 685469 1859 WUblastx.64
(Q9UI50) PRO0657 (FRAGMENT). Q9UI50 50% 104 181 70% 27 116 HLYEJ14
853362 1860 WUblastx.64 (O95498) VASCULAR NON- VNN2_HUMAN 97% 94
1653 INFLAMMATORY MOLECULE 2 PRECURSOR (VA HLYEJ44 838149 1861
WUblastx.64 (Q9H400) DJ583P15.4.1 (NOVEL Q9H400 100% 124 153
PROTEIN (TRANSLATION OF 80% 273 1007 CDNA FLJ20406 (E HLYEU51
607815 1862 WUblastx.64 (Q9NX85) CDNA FLJ20378 FIS, Q9NX85 67% 691
563 CLONE KAIA0536. 78% 857 708 HLYGV19 826334 1863 WUblastx.64
(Q9H0W4) HYPOTHETICAL 19.2 KDA Q9H0W4 72% 195 644 PROTEIN. HMABK52
853363 1864 WUblastx.64 (Q9N032) UNNAMED PROTEIN Q9N032 62% 1136
1002 PRODUCT. HMACL77 853365 1866 WUblastx.64 (O95564) HYPOTHETICAL
30.9 KDA O95564 100% 8 256 PROTEIN. HMACT74 843744 1867 WUblastx.64
gamma-interferon-inducible protein pir|A43708|A43708 94% 403 639
IP-30 precursor - human HMADJ14 843725 1868 WUblastx.64 (Q9H295)
DC-SPECIFIC Q9H295 96% 871 945 TRANSMEMBRANE PROTEIN. 90% 47 880
HMADJ74 795479 1869 WUblastx.64 (Q9H295) DC-SPECIFIC Q9H295 100%
1010 1393 TRANSMEMBRANE PROTEIN. 93% 186 1067 HMAEA58 872563 1870
WUblastx.64 (Q9NX85) CDNA FLJ20378 FIS, Q9NX85 36% 584 519 CLONE
KAIA0536. 59% 1339 1172 HMAGF01 837235 1871 WUblastx.64 (Q9UJ41)
RAB5 GDP/GTP Q9UJ41 89% 71 1543 EXCHANGE FACTOR HOMOLOGUE. HMCED78
829071 1873 WUblastx.64 (Q9NWY5) CDNA FLJ20533 FIS, Q9NWY5 98% 380
862 CLONE KAT10931. HMCFN86 886182 1874 WUblastx.64 (Q9BVB2)
UNKNOWN (PROTEIN Q9BVB2 100% 22 294 FOR IMAGE: 3459631) (FRAGMENT).
HMCGJ47 699850 1875 WUblastx.64 (AAK29328) Serine AAK29328 91% 11
511 palmitoyltransferase. 91% 495 1430 HMCGK88 654854 1876
WUblastx.64 (Q9BT48) SIMILAR TO Q9BT48 100% 506 330 HYPOTHETICAL
PROTEIN 92% 982 506 FLJ20116. HMCIH27 862038 1877 WUblastx.64
(Q9H728) CDNA: FLJ21463 FIS, Q9H728 70% 1293 1063 CLONE COL04765.
HMDAE88 638222 1881 WUblastx.64 (Q9H3C0) PRO0898. Q9H3C0 57% 1001
843 81% 844 734 HMDAM39 602907 1885 WUblastx.64 (Q9P195) PRO1722.
Q9P195 66% 648 388 HMEAA41 587304 1886 WUblastx.64 (Q9H6H3) CDNA:
FLJ22282 FIS, Q9H6H3 100% 9 419 CLONE HRC03861. HMEEH21 603187 1888
WUblastx.64 (Q9N083) UNNAMED PORTEIN Q9N083 65% 280 504 PRODUCT.
HMEEZ07 638225 1890 WUblastx.64 (Q9UK97) F-BOX ONLY PROTEIN
FBX9_HUMAN 100% 795 917 9. HMEIH57 840370 1892 WUblastx.64 (Q14288)
HYPOTHETICAL Q14288 74% 238 11 PROTEIN (FRAGMENT). 58% 1348 1190
50% 1236 256 HMEIJ21 767276 1893 WUblastx.64 (Q9H067) HYPOTHETICAL
66.5 KDA Q9H067 61% 2388 1777 PROTEIN. 50% 828 709 56% 1676 840
HMEJC96 761218 1895 WUblastx.64 (O60836) MEMBRANE O60836 86% 193
669 GLYCOPROTEIN GP36 PRECURSOR. HMEJK28 825591 1897 WUblastx.64
(O00479) NON-HISTONE O00479 54% 273 485 CHROMOSOMAL PROTEIN (HIGH-
MOBILITY GROUP (NONHIS HMEKW44 825499 1899 WUblastx.64 (O18975)
HYPOTHETICAL 16.6 KDA O18975 71% 7 198 PROTEIN (FRAGMENT). HMEKW71
855955 1900 WUblastx.64 (Q9UHF1) NOTCH4-LIKE PROTEIN Q9UHF1 96% 579
758 (HYPOTHETICAL 29.6 KDA PROTEIN). HMHBI09 847402 1903
WUblastx.64 (AAH07644) Similar to RIKEN cDNA AAH07644 93% 39 683
9430029K10 gene (F HMHBI93 844729 1904 WUblastx.64 (Q9Z1S4)
TGFB1-INDUCED ANTI- TIAF_MOUSE 90% 1391 1735 APOPTOTIC FACTOR 1 (12
KDA TGF- HMIAC52 825484 1906 WUblastx.64 (AAH00713) Neighbor of
A-kinase AAH00713 30% 941 1201 anchoring protein 9 52% 988 1056 75%
112 927 HMIAG42 846339 1908 WUblastx.64 (AAK54122) RGS20 ret splice
variant AAK54122 78% 1071 1730 1. HMIAG55 736020 1909 WUblastx.64
(AAD20460) Ribosomal protein L11. AAD20460 67% 424 609 HMIAG72
824091 1910 WUblastx.64 (O60519) CRE BINDING PROTEIN- O60519 85%
318 677 LIKE 2. HMIAO82 833070 1912 WUblastx.64 hypothetical
protein pir|T46340|T46340 58% 32 358 DKFZp434B0814.1 - human 50%
443 742 (fragment) HMIAR42 809096 1913 WUblastx.64 (Q9BVE4) SIMILAR
TO Q9BVE4 87% 1046 1165 INTERFERON-RELATED 91% 831 1052
DEVELOPMENTAL REGULATOR 99% 7 849 1. HMIAV33 668252 1914
WUblastx.64 (Q9UN80) HYPOTHETICAL 149.0 KDA Q9UN80 34% 1051 1182
PROTEIN. 48% 1167 1337 40% 603 430 41% 138 10 28% 1015 611 38% 431
162 HMIBE95 804597 1917 WUblastx.64 probable transposase - human
pir|S72481|S72481 60% 1932 2075 transposon MER37 64% 1221 1355 42%
1355 1948 HMKAN71 884161 1920 WUblastx.64 (Q96G03) Unknown (protein
for Q96G03 100% 12 1385 MGC: 19508). HMKBA33 596949 1921
WUblastx.64 (Q9N083) UNNAMED PORTEIN Q9N083 47% 1147 1010 PRODUCT.
44% 1248 1162 75% 1441 1382 57% 1314 1147 33% 383 261 65% 1691 1482
HMKCK32 561576 1923 WUblastx.64 (Q9N083) UNNAMED PORTEIN Q9N083 53%
619 335 PRODUCT. HMKDG69 588407 1927 WUblastx.64 pro-pol-dUTPase
polyprotein - murine pir|T29097|T29097 59% 104 24 endogenous
retrovirus ERV-L 34% 700 116 (fragment) HMKDM80 608168 1928
WUblastx.64 (Q9H6G8) CDNA: FLJ22294 FIS, Q9H6G8 74% 178 11 CLONE
HRC04426. HMKEG88 634245 1929 WUblastx.64 (O00378) PUTATIVE P150.
O00378 47% 294 4 HMMAA09 822859 1930 WUblastx.64 (AAK55521)
PRO0764. AAK55521 68% 1305 1249 67% 1271 1014 HMMAK92 610100 1931
WUblastx.64 (Q9CZ33) 2810408E11RIK Q9CZ33 86% 15 152 PROTEIN.
HMMBF22 780406 1934 WUblastx.64 (Q9H6V7) CDNA: FLJ21825 FIS, Q9H6V7
56% 1228 1341 CLONE HEP01348. 93% 407 499 58% 824 1159 HMMBH94
607463 1936 WUblastx.64 (AAK55521) PRO0764. AAK55521 80% 857 813
71% 835 593 HMMBK55 608179 1937 WUblastx.64 (Q9H397) PRO2852.
Q9H397 72% 521 468 36% 480 361 70% 691 527 HMMBT47 804594 1941
WUblastx.64 (Q9NX85) CDNA FLJ20378 FIS, Q9NX85 66% 1238 1203 CLONE
KAIA0536. 54% 1206 874 HMMCD35 607840 1942 WUblastx.64 (Q9H728)
CDNA: FLJ21463 FIS, Q9H728 59% 813 676 CLONE COL04765. 58% 661 512
HMMCD95 603202 1943 WUblastx.64 (Q9N083) UNNAMED PORTEIN Q9N083 58%
1498 1397 PRODUCT. 63% 1643 1494 HMPAB26 580854 1944 WUblastx.64
(P78560) DEATH DOMAIN CRAD_HUMAN 100% 66 365 CONTAINING PROTEIN
CRADD (CASPASE AND HMQAI38 589964 1946 WUblastx.64
immune-responsive gene 1 - mouse pir|I54546|I54546 71% 11 1363
(fragment) HMQAT69 799551 1947 WUblastx.64 (Q9Y5X1) SORTING NEXIN 9
(SH3 SNX9_HUMAN 94% 739 1842 AND PX DOMAIN-CONTAINING 82% 660 809
PROT 93% 56 748 HMQBL90 600363 1948 WUblastx.64 pre-B cell Ig
lambda-like omega light pir|A33911|A33911 52% 879 1091 chain
(non-rearranging) 14.1 - human 76% 974 1309 HMQBV82 826522 1949
WUblastx.64 (Q9BGW3) HYPOTHETICAL 13.5 KDA Q9BGW3 61% 739 876
PROTEIN. 72% 969 868 40% 651 592 HMQCA75 767086 1950 WUblastx.64
(AAK55521) PRO0764. AAK55521 62% 1235 1071 72% 1072 944 HMQCB37
732168 1951 WUblastx.64 (AAK55521) PRO0764. AAK55521 85% 426 446
71% 1087 1149 50% 872 1042 79% 503 904 HMQCX41 603388 1953
WUblastx.64 (O60448) NEURONAL THREAD O60448 43% 192 260 PROTEIN
AD7C-NTP. 55% 16 204 HMQDM09 664494 1954 WUblastx.64 (Q9NZV6)
SELENOPROTEIN X 1 SELX_HUMAN 98% 38 385 (PROTEIN HSPC270). HMSAP33
731969 1956 WUblastx.64 (Q9P147) PRO2822. Q9P147 83% 1526 1398
HMSAZ48 877650 1957 WUblastx.64 probable pol polyprotein-related
pir|S21348|S21348 46% 793 1218 protein 4 - rat 66% 722 784 HMSBN18
847405 1958 WUblastx.64 (O95789) ZNF258. O95789 65% 165 329 HMSBS25
826487 1959 WUblastx.64 (Q9Y642) K: CL COTRANSPORTER Q9Y642 77%
1019 1189 3. 81% 337 384 100% 257 346 HMSBU14 844443 1960
WUblastx.64 hypothetical protein pir|T47135|T47135 41% 954 1184
DKFZp761L0812.1 - human 63% 1192 1488 (fragment) HMSCB94 847406
1962 WUblastx.64 (Q9NX17) CDNA FLJ20489 FIS, Q9NX17 45% 1690 1589
CLONE KAT08285. 80% 1931 1683 HMSCK12 825475 1963 WUblastx.64
(Q9P195) PRO1722. Q9P195 62% 771 613 81% 622 491 HMSCV75 838530
1965 WUblastx.64 (Q9NRE8) PADI-H PROTEIN. Q9NRE8 40% 1565 1461 67%
1438 1301 HMSCW44 716249 1967 WUblastx.64 (Q9P195) PRO1722. Q9P195
47% 1251 1102 66% 1112 942 HMSCZ19 847408 1968 WUblastx.64 (O60427)
BC269730_2 O60427 84% 621 1124 (HYPOTHETICAL 52.0 KDA 94% 1 675
PROTEIN) (FATTY ACID DESAT HMSDI67 827298 1969 WUblastx.64 probable
pol polyprotein-related pir|S21348|S21348 55% 1255 1121 protein
4-rat 38% 1748 1284 HMSDR28 801948 1971 WUblastx.64 (Q9H728) CDNA:
FLJ21463 FIS, Q9H728 76% 1097 1035 CLONE COL04765. 72% 1317 1102
HMSFT25 581069 1972 WUblastx.64 (AAK55521) PRO0764. AAK55521 43%
1088 1198 61% 918 1025 HMSFW52 603177 1973 WUblastx.64 (Q9NX85)
CDNA FLJ20378 FIS, Q9NX85 67% 1380 1631 CLONE KAIA0536. HMSGU30
847409 1975 WUblastx.64 (Q9GMX5) HYPOTHETICAL 12.9 KDA Q9GMX5 55%
1718 1494 PROTEIN. HMSHB42 792385 1976 WUblastx.64 (Q9NR81) RHOGEF
Q9NR81 97% 4 867 (HYPOTHETICAL 59.8 KDA PROTEIN). HMSHB42 600401
1977 WUblastx.64 (Q9NR81) RHOGEF Q9NR81 99% 4 1203 (HYPOTHETICAL
59.8 KDA PROTEIN). HMSHN72 855917 1978 WUblastx.64 (Q98SS5)
DOUBLECORTIN. Q98SS5 91% 650 754 HMSHW73 704099 1980 WUblastx.64
(Q9P195) PRO1722. Q9P195 62% 2214 2134 65% 2131 2063 71% 2072 1935
HMSII36 825453 1982 WUblastx.64 (AAK55521) PRO0764. AAK55521 61% 23
61 72% 51 161 HMSIT42 581070 1983 WUblastx.64 (Q9P147) PRO2822.
Q9P147 80% 1160 936 HMSJB08 877651 1984 WUblastx.64 (Q9D2Y4)
9130019I15RIK Q9D2Y4 56% 1037 612 PROTEIN. 58% 1987 1028 HMSJR44
638098 1987 WUblastx.64 (Q9P195) PRO1722. Q9P195 73% 798 721 43%
1168 1037 82% 853 803 36% 1633 1511 64% 995 843 HMSKQ91 825450 1988
WUblastx.64 (Q9HBN2) HYPOTHETICAL 15.8 KDA Q9HBN2 68% 864 742
PROTEIN. HMTAF92 740784 1990 WUblastx.64 (Q9Y6I4) UBIQUITIN
CARBOXYL- UBP3_HUMAN 93% 2211 2167 TERMINAL HYDROLASE 3 (EC 84%
2053 644 3.1.2. HMTAT36 811885 1991 WUblastx.64 (Q9H6Z9) CDNA:
FLJ21620 FIS, Q9H6Z9 100% 1 117 CLONE COL07838. HMUAD65 809097 1993
WUblastx.64 (Q9H743) CDNA: FLJ21394 FIS, Q9H743 67% 1524 1213 CLONE
COL03536. HMUBK53 553624 1997 WUblastx.64 (Q9H8X7) CDNA FLJ13156
FIS, Q9H8X7 86% 18 398 CLONE NT2RP3003490, WEAKLY SIMILAR TO HOM
HMUBY57 844800 2001 WUblastx.64 (Q9H5R3) CDNA: FLJ23147 FIS, Q9H5R3
78% 1827 1609 CLONE LNG09295. HMUBZ15 609837 2002 WUblastx.64
(Q9BU61) SIMILAR TO NUCLEAR Q9BU61 60% 968 1012 PROTEIN E3-3 ORF1.
100% 412 963 HMVAL15 822860 2003 WUblastx.64 A-kinase anchor
protein 95 - human pir|T13161|T13161 83% 1 348 HMVBC84 743191 2004
WUblastx.64 (Q9H728) CDNA: FLJ21463 FIS, Q9H728 47% 1019 957 CLONE
COL04765. 76% 1135 1019 HMVBD68 831130 2005 WUblastx.64 catalase
(EC 1.11.1.6) - pir|I40767|I40767 85% 207 103 Campylobacter jejuni
HMVCG17 846161 2006 WUblastx.64 (Q9NZS9) APOPTOSIS Q9NZS9 96% 282
458 REGULATOR. 33% 89 151 100% 204 290 HMVDT89 831127 2011
WUblastx.64 (Q9HAT2) SIALIC ACID-SPECIFIC Q9HAT2 90% 2 385
ACETYLESTERASE II. 98% 384 809 HMVDT89 875313 2012 WUblastx.64
(Q9HAT2) SIALIC ACID-SPECIFIC Q9HAT2 90% 2 385 ACETYLESTERASE II.
98% 384 809 HMWAO65 839268 2013 WUblastx.64 (Q9P0A1) HSPC280
(FRAGMENT). Q9P0A1 100% 30 371 HMWAO82 825427 2014 WUblastx.64
(Q9NX17) CDNA FLJ20489 FIS, Q9NX17 84% 461 366 CLONE KAT08285.
HMWBK35 566888 2016 WUblastx.64 (Q9NX17) CDNA FLJ20489 FIS, Q9NX17
76% 956 918 CLONE KAT08285. 64% 919 650 HMWBL38 602940 2018
WUblastx.64 (Q9NX17) CDNA FLJ20489 FIS, Q9NX17 76% 743 615 CLONE
KAT08285. 65% 916 719 HMWBM48 566828 2019 WUblastx.64 ribosomal
protein L3 precursor, pir|A27294|R5HUL3 80% 609 379 mitochondrial -
human 100% 794 609 HMWCG28 847413 2020 WUblastx.64 (Q9P1S9) KINASE
DEFICIENT Q9P1S9 84% 35 892 PROTEIN KDP (FRAGMENT). HMWCP85 757974
2021 WUblastx.64 Na+-dependent vitamin C (L-ascorbic
pir|JC7182|JC7182 64% 37 297 acid) transporter SVCT1 - human 79%
1181 1507 61% 698 1264 86% 369 737 HMWDG30 623758 2022 WUblastx.64
(Q9VQ76) CG4263 PROTEIN. Q9VQ76 43% 1364 1411 37% 30 668 HMWDU20
695743 2023 WUblastx.64 (Q9NXB8) CDNA FLJ20335 FIS, Q9NXB8 89% 918
1034 CLONE HEP11429 (FRAGMENT). 75% 347 454 93% 1004 1819 HMWDZ63
608146 2025 WUblastx.64 (P41565) ISOCITRATE IDHG_RAT 33% 399 301
DEHYDROGENASE [NAD] 100% 169 74 SUBUNIT GAMMA, MITO HMWEA77 839221
2026 WUblastx.64 (Q9BGX7) HYPOTHETICAL 13.0 KDA Q9BGX7 60% 1066
1110 PROTEIN. 70% 1100 1282 HMWEC03 598902 2027 WUblastx.64
(Q9P0X2) HEAT SHOCK PROTEIN Q9P0X2 100% 1066 1365 HSP60. 91% 573
1064 99% 105 572 HMWEF46 825433 2028 WUblastx.64 (Q9H0G8)
HYPOTHETICAL 14.0 KDA Q9H0G8 100% 1113 1226 PROTEIN. HMWEK43 847414
2029 WUblastx.64 (Q9H8K0) CDNA FLJ13520 FIS, Q9H8K0 46% 940 1167
CLONE PLACE1005828. HMWEM23 863105 2030 WUblastx.64 (Q96QF0) SSX2
interacting protein Q96QF0 96% 1086 1532 hRabin3A, isoform alpha2.
96% 128 1114 HMWEM23 859387 2031 WUblastx.64 (Q9H673) CDNA:
FLJ22548 FIS, Q9H673 95% 1086 1532 CLONE HSI00519. 96% 152 1114
HMWEU96 1310888 2033 WUblastx.64 (Q9UH62) HYPOTHETICAL 42.5 KDA
Q9UH62 88% 91 1227 PROTEIN (ALEX3) (ALEX3 PROTEIN). HMWEU96 601698
3110 WUblastx.64 (AB039669) ALEX3 [Homo sapiens] dbj|BAA94602.1|
88% 86 1222 HMWEX02 596821 2034 WUblastx.64 (Q9H7H4) FLJ00116
PROTEIN Q9H7H4 67% 509 1000 (FRAGMENT). HMWFB65 638102 2035
WUblastx.64 (O95427) MCD4P HOMOLOG. O95427 74% 37 591 95% 894 959
100% 611 898 68% 9 59 HMWFD77 610105 2036 WUblastx.64 (Q9P1N7)
PRO0974. Q9P1N7 83% 459 494 55% 293 433 HMWFO25 566855 2037
WUblastx.64 (Q9HA89) CDNA FLJ12060 FIS, Q9HA89 100% 742 816 CLONE
HEMBB1002142. HMWGM41 847415 2039 WUblastx.64 (Q9H8P0) CDNA
FLJ13352 FIS, Q9H8P0 84% 33 986 CLONE OVARC1002165, WEAKLY SIMILAR
TO 3-O HMWGO95 582078 2040 WUblastx.64 (Q9H728) CDNA: FLJ21463 FIS,
Q9H728 82% 1446 1396 CLONE COL04765. 68% 1390 1145 HMWGV85 847416
2041 WUblastx.64 (Q9H8H3) CDNA FLJ13631 FIS, Q9H8H3 100% 41 298
CLONE PLACE1011090, HIGHLY SIMILAR TO HOM HMWGZ42 824259 2042
WUblastx.64 (Q9BVD9) UNKNOWN (PROTEIN Q9BVD9 50% 262 309 FOR MGC:
5149). 42% 1316 1534 HMWIQ26 722234 2045 WUblastx.64 (Q9NGC3)
CENTAURIN GAMMA Q9NGC3 48% 844 395 1A PROTEIN. 47% 298 5 43% 221
162 21% 388 218 HMWIU49 800894 2046 WUblastx.64 (O95831) PROGRAMED
CELL PCD8_HUMAN 98% 3 407 DEATH PROTEIN 8, 38% 1384 1500
MITOCHONDRIAL PREC 94% 379 1362 HMWJJ62 838612 2047 WUblastx.64
(Q9BGV8) HYPOTHETICAL 10.0 KDA Q9BGV8 71% 657 875 PROTEIN. HMWJJ64
581071 2048 WUblastx.64 (Q9D0Q7) 2600005P05RIK Q9D0Q7 78% 12 878
PROTEIN. HNAAD76 596801 2049 WUblastx.64 (Q9N083) UNNAMED PORTEIN
Q9N083 65% 1650 1528 PRODUCT. 59% 1807 1646 HNALD94 844722 2051
WUblastx.64 (Q9NX85) CDNA FLJ20378 FIS, Q9NX85 70% 764 817 CLONE
KAIA0536. 72% 816 926 HNALE44 785045 2052 WUblastx.64 (Q9Y503)
FILAMIN, MUSCLE Q9Y503 100% 12 86 ISOFORM. 30% 916 1170 72% 12 86
62% 12 83 52% 12 62 31% 783 896 60% 18 86 51% 12 95 45% 12 77 36%
18 92 36% 9 95 95% 79 1170 31% 916 1170 28% 49 795 36% 1096 1170
33% 1127 1207 35% 901 1170 31% 112 801 30% 1823 1927 29% 925 1170
39% 916 1170 30% 916 1170 27% 217 504 29% 18 98 46% 15 86 29% 910
1170 30% 901 1170 34% 79 792 42% 79 798 25% 940 1170 30% 79 792 32%
916 1170 38% 340 864 29% 88 855 30% 88 792 32% 109 795 33% 16 798
26% 103 855 29% 916 1170 25% 925 1170 33% 85 792 30% 262 795 29%
109 816 34% 916 1164 32% 520 792 26% 751 1170 29% 430 792 33% 940
1170 36% 12 77 31% 82 792 34% 79 783 HNEAK38 631279 2056
WUblastx.64 (Q26195) PVA1 GENE. Q26195 71% 1204 1100 47% 1383 1333
59% 1358 1197 HNEAK65 604991 2057 WUblastx.64 (Q9P195) PRO1722.
Q9P195 72% 570 427 82% 715 560 HNEBY79 841769 2059 WUblastx.64
(Q9UI50) PRO0657 (FRAGMENT). Q9UI50 58% 944 1153 72% 1270 1488
HNECL75 782493 2061 WUblastx.64 (Q9HCX0) PELLINO. Q9HCX0 96% 215
649 100% 627 1268 HNECX90 834776 2062 WUblastx.64 (Q9UJL8)
HYPOTHETICAL 43.5 KDA Q9UJL8 84% 81 1265 PROTEIN. HNECX90 881133
2063 WUblastx.64 (Q9UJL8) HYPOTHETICAL 43.5 KDA Q9UJL8 84% 81 1265
PROTEIN. HNEDP75 581072 2065 WUblastx.64 (Q9NX85) CDNA FLJ20378
FIS, Q9NX85 63% 910 722 CLONE KAIA0536.
HNEDQ02 846061 2066 WUblastx.64 (Q9HA25) CDNA FLJ12374 FIS, Q9HA25
76% 941 1063 CLONE MAMMA1002470, 93% 1018 2013 WEAKLY SIMILAR TO
PRO HNEDU46 695745 2067 WUblastx.64 (Q9H3P1) 6-PHOSPHOFRUCTO-2-
Q9H3P1 100% 343 420 KINASE HEART ISOFORM. 95% 137 208 95% 766 825
HNFAD50 839369 2068 WUblastx.64 (Q9H175) HYPOTHETICAL 59.6 KDA
Q9H175 47% 128 859 PROTEIN. HNFAD50 843242 2069 WUblastx.64
(Q9H175) HYPOTHETICAL 59.6 KDA Q9H175 54% 50 379 PROTEIN. HNFAG67
804546 2070 WUblastx.64 (O60759) CYTOHESIN BINDING O60759 73% 327
857 PROTEIN HE. HNFCJ77 886185 2071 WUblastx.64 (Q9BVD9) UNKNOWN
(PROTEIN Q9BVD9 74% 2342 2250 FOR MGC: 5149). 63% 1819 1763 73%
1763 1719 61% 2034 1792 HNFCY57 877653 2073 WUblastx.64 (AAL12497)
Cryopyrin. AAL12497 91% 8 2203 HNFDL89 823362 2074 WUblastx.64
(Q9BT07) UNKNOWN (PROTEIN Q9BT07 46% 2098 2193 FOR MGC: 4033). 100%
1964 2101 HNFDU92 602933 2076 WUblastx.64 (O60448) NEURONAL THREAD
O60448 60% 703 407 PROTEIN AD7C-NTP. 48% 721 425 88% 435 409 74%
570 388 56% 764 627 56% 522 388 43% 571 503 43% 495 388 57% 745 683
48% 757 677 HNFDY09 843300 2077 WUblastx.64 (Q9BZ41) BA476I15.3
(NOVEL Q9BZ41 92% 1243 1281 PROTEIN SIMILAR TO SEPTIN) 75% 1280
1363 (FRAGMENT). 53% 1104 1238 HNFDY31 724955 2078 WUblastx.64
(O00571) DEAD-BOX PROTEIN 3 DDX3_HUMAN 64% 169 621 (HELICASE-LIKE
PROTEIN 2) 98% 693 1028 (HLP2 HNFEA17 753242 2079 WUblastx.64
(Q9BRG9) UNKNOWN (PROTEIN Q9BRG9 94% 965 1318 FOR MGC: 11314).
HNFEP55 722236 2080 WUblastx.64 (Q9NW80) HYPOTHETICAL 73.6 KDA
Q9NW80 41% 877 966 PROTEIN. 65% 158 862 HNFET12 824170 2081
WUblastx.64 (Q9H743) CDNA: FLJ21394 FIS, Q9H743 75% 1217 1182 CLONE
COL03536. 75% 1182 952 HNFFR59 634649 2082 WUblastx.64 (Q9HA67)
CDNA FLJ12155 FIS, Q9HA67 65% 1613 1485 CLONE MAMMA1000472. HNFGR15
844044 2084 WUblastx.64 (Q99770) HYPOTHETICAL 15.4 KDA Q99770 53%
1128 1172 PROTEIN. 90% 824 886 HNFGW53 589525 2086 WUblastx.64
(Q9NUM6) CDNA FLJ11267 FIS, Q9NUM6 53% 777 938 CLONE PLACE1009174.
HNFHV68 567445 2089 WUblastx.64 pro-pol-dUTPase polyprotein -
murine pir|T29097|T29097 44% 380 24 endogenous retrovirus ERV-L
(fragment) HNFIE15 898153 2090 WUblastx.64 (Q9H387) PRO2550. Q9H387
72% 2374 2300 62% 2576 2370 HNFIE29 852233 2091 WUblastx.64
(Q9HBS7) HYPOTHETICAL 14.2 KDA Q9HBS7 42% 1484 1407 PROTEIN. 54%
1419 1168 HNFJE27 825400 2093 WUblastx.64 (Q9NUQ9) CDNA FLJ11197
FIS, Q9NUQ9 93% 986 1123 CLONE PLACE1007690 (HYPOTHETICAL 36.7 KDA
HNGAC71 695746 2095 WUblastx.64 (Q9GKW4) HYPOTHETICAL 12.6 KDA
Q9GKW4 77% 64 11 PROTEIN. 85% 138 79 HNGAX06 841890 2099
WUblastx.64 (Q14288) HYPOTHETICAL Q14288 100% 22 108 PROTEIN
(FRAGMENT). HNGBE44 825391 2103 WUblastx.64 (O00437) AXONEMAL
DYNEIN O00437 71% 323 502 HEAVY CHAIN (FRAGMENT). HNGBI83 566815
2105 WUblastx.64 (O60448) NEURONAL THREAD O60448 69% 322 420
PROTEIN AD7C-NTP. 53% 122 160 73% 331 420 74% 13 87 59% 10 87 51%
12 104 55% 22 102 61% 42 80 55% 28 81 HNGCF29 580201 2111
WUblastx.64 (Q9H387) PRO2550. Q9H387 71% 1112 1074 60% 1069 842
HNGCF64 823147 2112 WUblastx.64 (AAH07558) Unknown (protein for
AAH07558 48% 1893 1765 MGC: 15483). 55% 1763 1629 HNGDF54 702002
2113 WUblastx.64 (Q9N8T2) POSSIBLE SRPA. Q9N8T2 29% 13 654 27% 14
679 27% 14 679 29% 13 654 HNGDH27 581074 2115 WUblastx.64 (Q92722)
RETINOBLASTOMA 1. Q92722 45% 290 99 HNGDN07 847081 2116 WUblastx.64
(Q9UI50) PRO0657 (FRAGMENT). Q9UI50 80% 1091 966 HNGEE06 689506
2122 WUblastx.64 (Q9H960) CDNA FLJ12988 FIS, Q9H960 43% 66 1 CLONE
NT2RP3000080. 60% 1040 909 HNGEN32 621308 2128 WUblastx.64 (Q9H5R3)
CDNA: FLJ23147 FIS, Q9H5R3 76% 361 399 CLONE LNG09295. 80% 408 557
HNGET33 825378 2131 WUblastx.64 (Q9H387) PRO2550. Q9H387 78% 459
755 HNGEZ02 825376 2134 WUblastx.64 (Q9NX85) CDNA FLJ20378 FIS,
Q9NX85 81% 840 938 CLONE KAIA0536. HNGEZ90 634858 2135 WUblastx.64
(Q9H728) CDNA: FLJ21463 FIS, Q9H728 72% 1119 1045 CLONE COL04765.
71% 956 810 HNGFD30 612782 2138 WUblastx.64 (O75423) O75423 72% 264
100 ORF3, SPLICEVARIANT_A. HNGFD31 663532 2139 WUblastx.64 (Q9HA67)
CDNA FLJ12155 FIS, Q9HA67 76% 574 624 CLONE MAMMA1000472. 78% 491
574 HNGFG04 772548 2141 WUblastx.64 (Q9Y485) X-LIKE 1 PROTEIN.
Q9Y485 100% 423 533 HNGFI21 581075 2145 WUblastx.64 (Q9EQC8)
PAPILLARY RENAL Q9EQC8 58% 117 296 CELL CARCINOMA-ASSOCIATED
PROTEIN. HNGFT70 581079 2150 WUblastx.64 (Q9H5R3) CDNA: FLJ23147
FIS, Q9H5R3 76% 1073 855 CLONE LNG09295. HNGGF13 638117 2153
WUblastx.64 hypothetical protein hc1 - mouse pir|S26689|S26689 38%
13 183 (fragment) 37% 13 186 HNGGK63 822862 2154 WUblastx.64
(Q9QZ22) OLFACTORY Q9QZ22 59% 1224 1003 RECEPTOR. 88% 985 278
HNGGT10 866179 2159 HMMER PFAM: 3-beta hydroxysteroid PF01073 263.9
19 468 2.1.1 dehydrogenase/isomerase family WUblastx.64 (Q9BSN9) 3
BETA-HYDROXY- Q9BSN9 75% 10 480 DELTA 5-C27-STEROID OXIDOREDUCTASE.
HNGHB89 722238 2161 WUblastx.64 (O88748) E-STOP PROTEIN. O88748
100% 153 37 HNGHD07 608149 2162 WUblastx.64 (Q9BRA2) UNKNOWN
(PROTEIN Q9BRA2 51% 588 755 FOR MGC: 14353). 70% 746 943 HNGIK07
825360 2168 WUblastx.64 (Q9H3I6) BRAIN MY040 PROTEIN. Q9H3I6 76%
1139 912 HNGIM40 747699 2169 WUblastx.64 (Q9H5W7) CDNA: FLJ22921
FIS, Q9H5W7 87% 2354 2208 CLONE KAT06711. HNGIM83 751714 2170 HMMER
PFAM: HCO3-transporter family PF00955 117.9 72 290 2.1.1
WUblastx.64 (Q9UIB9) BICARBONATE Q9UIB9 74% 9 290 TRANSPORTER.
HNGIO93 897527 2171 HMMER PFAM: Ribosomal L27 protein PF01016 71.7
-21 -233 2.1.1 WUblastx.64 (Q9P0M9) HSPC250 Q9P0M9 88% 151 594
(MITOCHONDRIAL RIBOSOMAL PROTEIN L27) (L27MT) (HYPOT HNGIU16 826717
2173 WUblastx.64 (Q9H387) PRO2550. Q9H387 78% 2322 2215 76% 2505
2467 78% 2467 2315 HNGIX91 564574 2174 WUblastx.64 (AAH07609)
Similar to hypothetical AAH07609 100% 956 982 protein PRO1722. 77%
885 950 76% 739 891 HNGJU60 825336 2182 WUblastx.64 (Q9GW02)
EXTREMELY Q9GW02 51% 166 258 CYSTEINE/VALINE RICH 50% 166 261
PROTEIN (FRAGMENT). 46% 166 261 56% 169 258 48% 169 261 45% 169 261
48% 169 261 40% 290 487 44% 287 487 41% 290 487 41% 169 261 44% 287
490 46% 169 258 55% 231 257 44% 290 487 45% 287 487 42% 287 487 44%
290 487 44% 290 490 48% 163 261 46% 166 261 48% 169 261 48% 163 261
44% 287 487 40% 172 261 45% 169 261 43% 287 487 48% 169 261 HNGKW35
899408 2184 WUblastx.64 (O00627) HYPOTHETICAL 11.0 KDA O00627 53%
292 477 PROTEIN (ORF2). HNGKY94 835021 2185 WUblastx.64 (Q9H728)
CDNA: FLJ21463 FIS, Q9H728 66% 581 501 CLONE COL04765. 69% 777 583
HNHAB38 609892 2188 WUblastx.64 (Q9H387) PRO2550. Q9H387 68% 635
339 HNHAD34 612845 2190 WUblastx.64 (Q9N032) UNNAMED PROTEIN Q9N032
64% 1056 922 PRODUCT. HNHAY26 704789 2198 WUblastx.64 (Q9H397)
PRO2852. Q9H397 85% 2098 1919 HNHAZ20 839696 2200 WUblastx.64
(Q9C074) HYPOTHETICAL 73.9 KDA Q9C074 81% 1213 11 PROTEIN
(FRAGMENT). HNHBE38 562730 2202 WUblastx.64 (AAK55521) PRO0764.
AAK55521 65% 1131 1072 72% 1097 855 HNHBG18 604924 2203 WUblastx.64
(O00365) L1 ELEMENT L1.15 P40 O00365 29% 717 271 PROTEIN. HNHBM16
566866 2205 WUblastx.64 (Q9H743) CDNA: FLJ21394 FIS, Q9H743 87% 80
33 CLONE COL03536. 71% 310 80 HNHCH78 694657 2206 WUblastx.64
(AAH07609) Similar to hypothetical AAH07609 100% 270 290 protein
PRO1722. 88% 194 271 75% 49 195 HNHCT47 634691 2210 WUblastx.64
(Q9H728) CDNA: FLJ21463 FIS, Q9H728 46% 434 396 CLONE COL04765. 56%
621 448 HNHDC52 812424 2213 WUblastx.64 (O00365) L1 ELEMENT L1.15
P40 O00365 32% 1038 910 PROTEIN. 68% 904 269 HNHDI17 738043 2216
WUblastx.64 (O95662) POT. ORF VI O95662 80% 265 327 (FRAGMENT). 56%
5 295 HNHDR57 638121 2219 WUblastx.64 (O60448) NEURONAL THREAD
O60448 58% 1193 1095 PROTEIN AD7C-NTP. 63% 496 440 56% 485 393 50%
503 426 64% 1195 1124 33% 658 440 41% 1186 1043 40% 402 322 61%
1065 874 51% 1177 923 36% 486 331 31% 1090 455 53% 437 393 60% 1168
863
HNHDW34 607867 2222 WUblastx.64 (Q9H728) CDNA: FLJ21463 FIS, Q9H728
62% 1175 1017 CLONE COL04765. 56% 961 671 HNHEF70 610115 2228
WUblastx.64 (Q9H728) CDNA: FLJ21463 FIS, Q9H728 80% 481 437 CLONE
COL04765. 77% 417 352 50% 650 462 HNHEL22 607421 2231 WUblastx.64
(Q9NUL2) CDNA FLJ11292 FIS, Q9NUL2 71% 280 342 CLONE PLACE1009665.
72% 363 656 HNHEN70 854712 2232 WUblastx.64 olfactory receptor OR18
- rat pir|S29710|S29710 67% 34 567 HNHEP41 638124 2234 WUblastx.64
(Q9NX85) CDNA FLJ20378 FIS, Q9NX85 41% 915 730 CLONE KAIA0536. 73%
736 635 HNHEZ76 618544 2238 WUblastx.64 (Q9HA67) CDNA FLJ12155 FIS,
Q9HA67 72% 359 466 CLONE MAMMA1000472. HNHFF81 732075 2240
WUblastx.64 (Q9GMP5) HYPOTHETICAL 6.6 KDA Q9GMP5 71% 1208 1333
PROTEIN. HNHFR42 638127 2242 WUblastx.64 (Q9UI50) PRO0657
(FRAGMENT). Q9UI50 75% 522 427 HNHGD95 609905 2244 WUblastx.64
(Q9H728) CDNA: FLJ21463 FIS, Q9H728 46% 430 392 CLONE COL04765. 56%
608 444 HNHGR82 617117 2245 WUblastx.64 (Q9BGV8) HYPOTHETICAL 10.0
KDA Q9BGV8 48% 125 39 PROTEIN. 56% 262 110 HNHGY77 638128 2247
WUblastx.64 (Q9BZV1) UBX DOMAIN- Q9BZV1 53% 292 248 CONTAINING
PROTEIN 1. 100% 212 90 HNHHA47 658743 2248 WUblastx.64 (Q9NX85)
CDNA FLJ20378 FIS, Q9NX85 65% 983 864 CLONE KAIA0536. 66% 1138 1001
HNHKI74 777856 2252 WUblastx.64 (Q9BGX7) HYPOTHETICAL 13.0 KDA
Q9BGX7 64% 350 541 PROTEIN. HNHLD80 839255 2254 WUblastx.64
(Q9HA67) CDNA FLJ12155 FIS, Q9HA67 44% 563 414 CLONE MAMMA1000472.
72% 700 572 HNHLS76 853372 2255 WUblastx.64 (O15410) CAGH45. O15410
74% 146 316 HNHMY76 838256 2259 WUblastx.64 (Q9NX85) CDNA FLJ20378
FIS, Q9NX85 75% 576 647 CLONE KAIA0536. 83% 520 555 75% 659 778
HNKAA76 802009 2264 WUblastx.64 (Q9BTI4) SIMILAR TO RIKEN Q9BTI4
84% 323 1492 CDNA 8430408O15 GENE. 60% 353 421 HNTAF42 824082 2265
WUblastx.64 (Q9NX17) CDNA FLJ20489 FIS, Q9NX17 63% 380 673 CLONE
KAT08285. HNTCG32 897776 2266 HMMER PFAM: Sodium/hydrogen exchanger
PF00999 244.7 178 789 2.1.1 family WUblastx.64 (AAK54508)
Nonselective sodium AAK54508 60% 13 837 potassium/proton exc 52%
772 1089 HNTNY89 886188 2267 WUblastx.64 (Q9H400) DJ583P15.4.1
(NOVEL Q9H400 90% 338 1006 PROTEIN (TRANSLATION OF 100% 158 187
CDNA FLJ20406 (E 68% 307 354 HNTRQ40 809100 2269 WUblastx.64
(Q9UBC2) EPIDERMAL GROWTH Q9UBC2 64% 1498 1857 FACTOR RECEPTOR
SUBSTRATE 76% 11 451 EPS15R. 92% 492 1604 66% 1810 1845 57% 1567
1608 36% 32 178 40% 202 486 40% 1540 1623 48% 1567 1686 41% 1398
1544 33% 1395 1589 50% 1452 1544 34% 1377 1547 36% 495 695 35% 20
196 40% 519 623 23% 750 1610 HOAAJ09 654862 2273 WUblastx.64
(Q9BVD9) UNKNOWN (PROTEIN Q9BVD9 82% 560 510 FOR MGC: 5149). 77%
769 572 HOAAL10 566867 2274 WUblastx.64 (Q9P1N7) PRO0974. Q9P1N7
42% 1113 1217 58% 929 1129 HOABC12 801922 2276 WUblastx.64 (Q13391)
HYPOTHETICAL Q13391 100% 208 405 PROTEIN 384D8_6. 97% 5 208 HOABH36
740758 2277 WUblastx.64 (Q9BSY5) UNKNOWN (PROTEIN Q9BSY5 94% 147
1073 FOR IMAGE: 3831362) 86% 1078 1353 (FRAGMENT). 83% 10 177
HOBNA89 604999 2278 WUblastx.64 microtubule-associated
pir|A54602|A54602 51% 369 7 serine/threonine protein kinase MAST205
- mouse HOBNF51 580861 2279 WUblastx.64 (O00410) IMPORTIN BETA-3
IMB3_HUMAN 95% 10 414 SUBUNIT (KARYOPHERIN BETA-3 20% 271 375
SUBUNI 99% 395 1051 HODAH24 656887 2280 WUblastx.64 (Q9BVD9)
UNKNOWN (PROTEIN Q9BVD9 68% 1326 1189 FOR MGC: 5149). HODAH46
862551 2281 WUblastx.64 (Q9H6Y7) CDNA: FLJ21676 FIS, Q9H6Y7 82% 264
608 CLONE COL09164. HODAV25 787471 2282 WUblastx.64 (Q9UHS9)
PRO1914 PROTEIN. Q9UHS9 100% 72 1 HODAW64 840069 2283 WUblastx.64
(Q9H7T2) CDNA FLJ14295 FIS, Q9H7T2 93% 634 1263 CLONE PLACE1008426,
WEAKLY SIMILAR TO RES HODAY17 806341 2284 WUblastx.64 (Q9H7L0)
FLJ00062 PROTEIN Q9H7L0 90% 492 1478 (FRAGMENT). 100% 77 487
HODBF86 605001 2289 WUblastx.64 (Q9BRM8) UNKNOWN (PROTEIN Q9BRM8
43% 189 410 FOR MGC: 13219). HODDJ25 824592 2299 WUblastx.64
(Q9C0K7) AMYOTROPHIC Q9C0K7 100% 266 1519 LATERAL SCLEROSIS 2.
HODDQ06 834824 2302 WUblastx.64 (Q9NZK6) PDZ-BINDING KINASE. Q9NZK6
94% 200 1165 HODEA20 840376 2303 WUblastx.64 (Q9BXY9) RALBP1.
Q9BXY9 84% 141 1229 68% 6 179 HOEBI94 795312 2306 WUblastx.64
(Q9Y4J5) RIBONUCLEOPROTEIN Q9Y4J5 74% 823 999 (HNRNP 2H9). 100% 695
820 33% 710 820 100% 167 469 HOEBJ70 836143 2307 WUblastx.64
(AAH09229) Unknown (protein for AAH09229 100% 560 646 MGC: 16480).
HOECB33 840378 2308 WUblastx.64 (Q9H6D8) CDNA: FLJ22362 FIS, Q9H6D8
100% 10 525 CLONE HRC06544. HOECX21 842866 2309 WUblastx.64
(Q9HC05) CD003 PROTEIN. Q9HC05 100% 368 225 HOEDE27 825262 2310
WUblastx.64 (Q9P195) PRO1722. Q9P195 55% 914 759 67% 780 649
HOEEK81 844390 2311 WUblastx.64 (BAB22091) Adult male kidney
BAB22091 60% 51 596 cDNA, RIKEN full-lengt HOEEZ62 638833 2312
WUblastx.64 (Q9T9V8) NADH Q9T9V8 88% 66 173 DEHYDROGENASE SUBUNIT
3. 83% 303 338 HOEFJ26 847422 2313 WUblastx.64 (Q9H5R3) CDNA:
FLJ23147 FIS, Q9H5R3 77% 1198 995 CLONE LNG09295. HOFMF63 847423
2315 WUblastx.64 L6 surface protein - human pir|A42926|A42926 82%
409 690 77% 86 409 HOFMJ65 664498 2316 WUblastx.64 (P70560)
COLLAGEN ALPHA 1(XII) CA1C_RAT 74% 987 1160 CHAIN (FRAGMENT).
HOFMO16 596835 2318 HMMER PFAM: 3-beta hydroxysteroid PF01073 68.3
149 346 2.1.1 dehydrogenase/isomerase family WUblastx.64 (Q9BSN9) 3
BETA-HYDROXY- Q9BSN9 75% 11 184 DELTA 5-C27-STEROID 83% 349 438
OXIDOREDUCTASE. 94% 290 346 HOFMV22 812864 2321 WUblastx.64
(Q9P039) HSPC113. Q9P039 60% 180 293 50% 4 198 HOFNY15 668259 2323
WUblastx.64 (Q9H9J2) CDNA FLJ12701 FIS, Q9H9J2 73% 69 326 CLONE
NT2RP1000730. 83% 331 999 HOFNY28 603911 2324 WUblastx.64
interferon gamma receptor accessory pir|I38500|I38500 59% 13 654
factor-1 precursor - human HOGAA41 843499 2326 WUblastx.64 (Q9D3B1)
6330408J20RIK Q9D3B1 96% 580 1257 PROTEIN. HOGAB51 825278 2327
WUblastx.64 (Q9H5R3) CDNA: FLJ23147 FIS, Q9H5R3 74% 919 1119 CLONE
LNG09295. HOGAH40 790978 2328 WUblastx.64 (Q9NX63) CDNA FLJ20420
FIS, Q9NX63 93% 185 844 CLONE KAT02462. HOGAP06 823364 2329
WUblastx.64 (Q9BGV8) HYPOTHETICAL 10.0 KDA Q9BGV8 70% 1445 1669
PROTEIN. HOGAR71 722242 2331 HMMER PFAM: PMP-22/EMP/MP20/Claudin
PF00822 336 96 632 2.1.1 family WUblastx.64 (O95471) CLAUDIN-7.
CLD7_HUMAN 100% 87 719 HOGCC26 834792 2332 WUblastx.64 (Q9HCN4) XPA
BINDING PROTEIN Q9HCN4 87% 19 1140 1. HOGCD78 610217 2333
WUblastx.64 (Q9H6Q7) CDNA: FLJ21979 FIS, Q9H6Q7 95% 428 487 CLONE
HEP06065 (FRAGMENT). 100% 217 321 HOGCK03 847427 2334 WUblastx.64
(Q99LE1) UNKNOWN (PROTEIN Q99LE1 53% 310 405 FOR MGC: 7036). 78%
369 860 HOGCL01 846353 2335 HMMER PFAM: KOW motif PF00467 40.2 332
442 2.1.1 WUblastx.64 (Q96A35) Similar to mitochondrial Q96A35 100%
167 814 ribosomal protein L24. HOHBB36 847428 2336 WUblastx.64
myosin I alpha chain - mouse pir|A45438|A45438 90% 2093 3 93% 2237
2103 HOHBC57 813392 2337 WUblastx.64 (Q9VEL9) CG4090 PROTEIN.
Q9VEL9 21% 2162 1767 22% 4081 3632 31% 1961 1836 18% 2582 1737 17%
4772 4509 20% 1793 1374 20% 2582 2376 26% 1897 1652 21% 3583 2564
22% 3550 2534 21% 2087 1809 24% 1970 1704 22% 4084 2534 38% 575 498
20% 2021 1773 21% 3556 2534 HOHBO66 853375 2338 WUblastx.64
(Q9NY61) DED PROTEIN Q9NY61 94% 1322 828 (APOPTOSIS ANTAGONIZING
88% 844 212 TRANSCRIPTION FACTOR). HONAH67 821419 2342 WUblastx.64
(Q9H7T6) CDNA FLJ14272 FIS, Q9H7T6 97% 1192 1338 CLONE
PLACE1004793, WEAKLY 96% 513 1172 SIMILAR TO RET HOOAC84 604043
2343 WUblastx.64 (Q9UPN3) ACTIN CROSS-LINKING ACF7_HUMAN 84% 1324
1482 FAMILY PROTEIN 7 100% 325 444 (MACROPHIN) ( 100% 592 690 29%
1381 1461 36% 1387 1461 HOPBP13 825243 2344 WUblastx.64 (Q9P195)
PRO1722. Q9P195 63% 2105 1851 HORBI80 877660 2346 WUblastx.64
(Q9NY33) DIPEPTIDYL- DPP3_HUMAN 100% 30 92 PEPTIDASE III (EC
3.4.14.4) (DPP 99% 92 2239 III) ( HORBL77 852099 2347 WUblastx.64
(Q9CWX4) 2410001E19RIK Q9CWX4 27% 852 1034 PROTEIN. 31% 212 784
HOSEM81 846354 2350 WUblastx.64 (O75872) RAB3-GAP O75872 100% 1012
803 REGULATORY DOMAIN. HOSEO83 847083 2351 WUblastx.64 (Q9NX85)
CDNA FLJ20378 FIS, Q9NX85 68% 356 412 CLONE KAIA0536. 73% 310 354
53% 551 769 HOSFR35 845994 2352 WUblastx.64 (Q9NXV7) CDNA FLJ20035
FIS, Q9NXV7 63% 9 320 CLONE COL00213. 67% 316 780 HOUBC29 872565
2354 WUblastx.64 GTP-binding protein rab2 - rat pir|B39963|B39963
94% 763 876 HOUBG39 601696 2355 WUblastx.64 (Q9H6G8) CDNA: FLJ22294
FIS, Q9H6G8 79% 1603 1403 CLONE HRC04426. HOUCD12 605006 2356
WUblastx.64 (Q9H728) CDNA: FLJ21463 FIS, Q9H728 69% 250 555 CLONE
COL04765.
HOUDB17 603417 2357 WUblastx.64 (Q9N083) UNNAMED PORTEIN Q9N083 66%
672 367 PRODUCT. HOUIG68 793749 2363 WUblastx.64 (Q9NVC9) CDNA
FLJ10808 FIS, Q9NVC9 100% 2 355 CLONE NT2RP4000879, WEAKLY SIMILAR
TO UBI HOVAJ68 741098 2369 WUblastx.64 (Q9HA67) CDNA FLJ12155 FIS,
Q9HA67 55% 1588 1421 CLONE MAMMA1000472. HOVAW46 892162 2370
WUblastx.64 (O00363) PUTATIVE P150. O00363 41% 395 345 39% 1030 773
37% 1359 1009 71% 759 697 45% 697 359 HOVBB19 843768 2371
WUblastx.64 catalase (EC 1.11.1.6) - pir|I40767|I40767 97% 307 197
Campylobacter jejuni HOVBI16 581097 2374 WUblastx.64 (AAG50170)
Tripartite motif protein AAG50170 63% 83 115 TRIM28 alpha. 83% 202
702 HOVCO53 564632 2380 WUblastx.64 (Q9H8N2) CDNA FLJ13381 FIS,
Q9H8N2 52% 1321 1127 CLONE PLACE1001010. HPBDE33 853660 2384
WUblastx.64 hypothetical protein pir|T12458|T12458 64% 257 985
DKFZp564O0823.1 - human HPBDE33 897372 2385 WUblastx.64
hypothetical protein pir|T12458|T12458 65% 257 985 DKFZp564O0823.1
- human HPCAG17 757836 2387 WUblastx.64 (Q9H743) CDNA: FLJ21394
FIS, Q9H743 64% 1306 1013 CLONE COL03536. HPCAG17 863943 2388
WUblastx.64 (Q9H387) PRO2550. Q9H387 71% 1141 1007 71% 1008 850
HPDDQ28 566793 2391 WUblastx.64 (O95357) PUTATIVE G PROTEIN- O95357
98% 231 440 COUPLED RECEPTOR (CDNA 100% 10 231 FLJ10899 FIS, CLON
HPDDT14 580867 2392 WUblastx.64 (Q9BGV8) HYPOTHETICAL 10.0 KDA
Q9BGV8 71% 193 5 PROTEIN. HPFCP75 581083 2399 WUblastx.64 (Q9NX17)
CDNA FLJ20489 FIS, Q9NX17 53% 656 949 CLONE KAT08285. HPFDB66
829318 2400 WUblastx.64 (Q9NTM9) BA483F11.3 (CGI-32 Q9NTM9 100% 102
920 PROTEIN). HPFDD28 824856 2401 WUblastx.64 (Q9P195) PRO1722.
Q9P195 66% 672 628 70% 622 551 69% 815 660 HPIAK27 852658 2404
WUblastx.64 (AAH06621) RIKEN cDNA AAH06621 83% 16 1050 2810403A07
gene. 70% 1286 1864 95% 1162 1293 40% 1162 1290 34% 1201 1269 44%
1174 1245 HPIAL55 847429 2405 WUblastx.64 (Q9D0W4) 1110060O18RIK
Q9D0W4 96% 506 592 PROTEIN. 90% 1088 1150 72% 694 1002 100% 82 231
90% 1778 1807 HPIAT18 877663 2406 WUblastx.64 (Q9H397) PRO2852.
Q9H397 84% 3823 3728 74% 3735 3571 HPIAZ52 801924 2407 WUblastx.64
(Q9H387) PRO2550. Q9H387 68% 2082 1987 67% 1988 1833 HPIBA07 886191
2408 WUblastx.64 (Q99ML9) ARKADIA. Q99ML9 73% 61 1482 HPIBA24
840379 2409 WUblastx.64 (Q9ULZ5) GONADOTROPIN Q9ULZ5 50% 27 1865
INDUCIBLE TRANSCRIPTION 56% 378 1793 REPRESSOR-4. 57% 420 1805 53%
549 1868 53% 330 1544 HPIBI40 588944 2410 WUblastx.64 (O43264)
ZW10_HUMAN 99% 1 339 CENTROMERE/KINETOCHORE 98% 336 860 PROTEIN
ZW10 HOMOLOG. HPJAB75 841653 2413 WUblastx.64 (Q9BZ63) FKSG60.
Q9BZ63 80% 1581 1273 HPJAN76 826185 2414 WUblastx.64 (O43194)
PUTATIVE G PROTEIN- GP39_HUMAN 89% 328 828 COUPLED RECEPTOR GPR39.
HPJAN76 854893 2415 WUblastx.64 (O43194) PUTATIVE G PROTEIN-
GP39_HUMAN 89% 328 828 COUPLED RECEPTOR GPR39. HPJAU94 826719 2416
WUblastx.64 (O00371) L1 ELEMENT L1.21 P40 O00371 83% 3944 4159
PROTEIN. 56% 3529 3921 HPJAW78 812766 2417 WUblastx.64 (Q9D1W2)
C030013D06RIK Q9D1W2 44% 87 254 PROTEIN. 38% 96 266 40% 77 262 45%
87 260 47% 86 256 43% 243 85 40% 259 86 39% 249 67 41% 261 88
HPJBS16 608307 2418 WUblastx.64 (CAC39435) Epigen protein
precursor. CAC39435 64% 31 357 HPJBU04 798101 2419 WUblastx.64
(Q9H743) CDNA: FLJ21394 FIS, Q9H743 72% 830 567 CLONE COL03536. 47%
2315 2265 HPJCP75 886192 2421 WUblastx.64 (Q9GMX5) HYPOTHETICAL
12.9 KDA Q9GMX5 61% 1459 1704 PROTEIN. HPJCV35 827317 2422
WUblastx.64 (Q9Y5S2) CDC42-BINDING Q9Y5S2 92% 2685 2951 PROTEIN
KINASE BETA. 100% 533 610 HPJCX13 852869 2423 HMMER PFAM: Reverse
transcriptase (RNA- PF00078 307.8 3321 4148 2.1.1 dependent DNA
polymerase) WUblastx.64 hypothetical protein (L1H 3' region) -
pir|B34087|B34087 96% 4105 266 human HPMBT05 658715 2427
WUblastx.64 (Q14287) HYPOTHETICAL Q14287 73% 491 592 PROTEIN
(FRAGMENT). 85% 403 483 HPMDD27 830748 2432 WUblastx.64 (Q9NZX0)
HSPC068. Q9NZX0 96% 2 1417 HPMDF45 638148 2433 WUblastx.64 (Q9NX85)
CDNA FLJ20378 FIS, Q9NX85 67% 1678 1857 CLONE KAIA0536. 72% 1856
1987 HPMDP57 567303 2434 WUblastx.64 (Q9H387) PRO2550. Q9H387 64%
1286 1074 77% 1447 1211 HPMEG72 795709 2435 WUblastx.64 (O00549)
ORF2-LIKE PROTEIN O00549 55% 1844 2056 (FRAGMENT). HPMFM70 756931
2436 WUblastx.64 (Q9H387) PRO2550. Q9H387 81% 2108 1998 61% 2286
2248 68% 2248 2105 HPMFP48 597457 2437 WUblastx.64 (Q9P195)
PRO1722. Q9P195 66% 987 853 69% 1130 975 HPMFW01 844865 2438
WUblastx.64 (Q9NP48) PUTATIVE LIPID Q9NP48 97% 973 1113 KINASE
(CDNA FLJ10842 FIS, CLONE NT2RP4001343 HPMGW43 830452 2440
WUblastx.64 vesicle-associated membrane protein- pir|JG0186|JG0186
100% 31 72 associated protein B - human 95% 59 427 HPMKB09 900362
2442 WUblastx.64 (Q9UJU6) SRC HOMOLOGY 3 Q9UJU6 92% 798 1406
DOMAIN-CONTAINING PROTEIN 92% 117 656 HIP-55 (DREBRIN F). HPMSH26
780109 2443 WUblastx.64 (Q9NQC3) NOGO-A PROTEIN. Q9NQC3 69% 1592
1014 70% 1748 1578 HPMSH96 610023 2444 WUblastx.64 (AAH00127)
Glutathione-S- AAH00127 88% 1203 1505 transferase like, glutathi
HPQAJ27 782957 2446 WUblastx.64 peptidyl-prolyl cis-trans isomerase
pir|B81216|B81216 54% 1370 987 NMB0281 [imported] - Neisseria 77%
973 707 meningitidis (strain MC58 serogroup B) HPQAN50 788813 2447
WUblastx.64 (O00549) ORF2-LIKE PROTEIN O00549 35% 381 10
(FRAGMENT). 32% 1151 222 38% 1285 590 HPRAD30 805969 2458
WUblastx.64 (Q9P1C6) PRO2738. Q9P1C6 52% 2465 2265 HPRCC91 638151
2459 WUblastx.64 (Q9H1R7) BA534G20.4 Q9H1R7 100% 2 97 (SUPERVILLIN)
(FRAGMENT). HPRCF40 834808 2460 WUblastx.64 (AAH07482) Similar to
conserved AAH07482 97% 3 221 membrane protein at HPRCF50 638153
2461 WUblastx.64 (Q9H387) PRO2550. Q9H387 66% 1787 1912 58% 1614
1790 HPRCM72 813512 2463 WUblastx.64 (Q9D3K9) 2810468K05RIK Q9D3K9
45% 296 526 PROTEIN. HPRCS59 601523 2464 WUblastx.64 (Q61787) ORF
2. Q61787 30% 746 189 HPRCT73 610024 2465 WUblastx.64 (Q9NPZ5)
B3G2_HUMAN 96% 1231 1145 GALACTOSYLGALACTOSYLXYL 89% 1476 1300
OSYLPROTEIN 3-BETA- GLUCURON HPTRE80 884167 2467 WUblastx.64
(O43819) SCO2 PROTEIN SCO2_HUMAN 85% 779 39 HOMOLOG PRECURSOR.
HPTRI42 655362 2468 WUblastx.64 (Q9BVA7) UNKNOWN (PROTEIN Q9BVA7
85% 3 611 FOR MGC: 5621). HPTTT62 561954 2473 WUblastx.64 (Q9H3X5)
HYPOTHETICAL 85.5 KDA Q9H3X5 100% 8 169 PROTEIN (FRAGMENT). HPTVH24
831983 2474 WUblastx.64 (Q9H7Z7) CDNA FLJ14038 FIS, Q9H7Z7 90% 3
974 CLONE HEMBA1005206. HPTVI96 636064 2477 WUblastx.64 (Q9H5X3)
HYPOTHETICAL 13.8 KDA Q9H5X3 77% 42 416 PROTEIN. HPVAA15 783074
2478 WUblastx.64 (AAK54355) ATP-binding cassette AAK54355 40% 4 483
transporter family 33% 7 477 31% 487 870 30% 487 828 HPWAS27 536008
2484 WUblastx.64 (Q9P0E3) HSPC093 (FRAGMENT). Q9P0E3 40% 1042 1146
65% 512 625 HPWAV82 830084 2486 WUblastx.64 (Q9H387) PRO2550.
Q9H387 79% 3 89 69% 104 229 HPWBA36 840380 2487 WUblastx.64
(Q9H387) PRO2550. Q9H387 54% 1183 1073 51% 1238 1152 62% 1380 1219
HPWTF23 843700 2488 HMMER PFAM: TSC-22/dip/bun family PF01166 146.4
442 621 2.1.1 WUblastx.64 (Q99576) GLUCOCORTICOID- GILZ_HUMAN 94%
271 672 INDUCED LEUCINE ZIPPER PROTEIN (DEL HPWTF23 844775 2489
HMMER PFAM: TSC-22/dip/bun family PF01166 146.4 442 621 2.1.1
WUblastx.64 (Q99576) GLUCOCORTICOID- GILZ_HUMAN 94% 271 672 INDUCED
LEUCINE ZIPPER PROTEIN (DEL HPWTF53 844737 2490 WUblastx.64
(Q9BGV8) HYPOTHETICAL 10.0 KDA Q9BGV8 48% 1855 2082 PROTEIN.
HRAAC36 798104 2494 WUblastx.64 (Q26195) PVA1 GENE. Q26195 65% 835
758 62% 750 565 41% 2229 2119 HRAAF59 847086 2495 WUblastx.64
(Q9H728) CDNA: FLJ21463 FIS, Q9H728 56% 1519 1247 CLONE COL04765.
HRAAG89 621271 2496 WUblastx.64 (Q9GMW5) HYPOTHETICAL 45.1 KDA
Q9GMW5 93% 2 187 PROTEIN. HRAAZ12 834637 2498 WUblastx.64
(AAG41897) Neuropilin-2a(17). AAG41897 100% 1361 1435 92% 863 901
56% 385 579 96% 579 878 79% 901 1356 HRABP28 823344 2500
WUblastx.64 (AAK55521) PRO0764. AAK55521 44% 1136 975 44% 1245 1111
HRABU56 621381 2501 WUblastx.64 (O75876) RNA-BINDING PROTEIN.
O75876 90% 105 320 HRABZ80 562230 2502 WUblastx.64 (Q9H743) CDNA:
FLJ21394 FIS, Q9H743 64% 1166 1116 CLONE COL03536. 54% 1104 1000
HRACB01 637647 2503 WUblastx.64 (Q9BGW3) HYPOTHETICAL 13.5 KDA
Q9BGW3 52% 1423 1349 PROTEIN. 52% 1344 1135 HRACI39 840461 2504
WUblastx.64 (Q9N083) UNNAMED PORTEIN Q9N083 59% 1346 1146 PRODUCT.
HRADU15 801926 2505 WUblastx.64 (Q9H7S6) CDNA FLJ14310 FIS, Q9H7S6
75% 645 586 CLONE PLACE3000271. 74% 787 638 HRDAH04 651356 2506
WUblastx.64 (Q9H728) CDNA: FLJ21463 FIS, Q9H728 38% 1336 1229 CLONE
COL04765. 60% 1478 1329 HRDBA20 637709 2507 WUblastx.64 (Q9HA67)
CDNA FLJ12155 FIS, Q9HA67 80% 1113 1069 CLONE MAMMA1000472. 71%
1049 1008 79% 1267 1106
HRDBD32 637710 2508 WUblastx.64 (Q9HA67) CDNA FLJ12155 FIS, Q9HA67
80% 1113 1069 CLONE MAMMA1000472. 71% 1049 1008 79% 1267 1106
HRDBL01 631169 2509 WUblastx.64 (Q9P195) PRO1722. Q9P195 65% 934
755 HRDDM85 799542 2510 WUblastx.64 (O95662) POT. ORF VI O95662 60%
1034 1096 (FRAGMENT). 56% 538 1077 HRDEJ86 695755 2512 WUblastx.64
(Q9NX85) CDNA FLJ20378 FIS, Q9NX85 74% 827 627 CLONE KAIA0536.
HRDFE30 750872 2514 WUblastx.64 (Q9NWU2) BA305P22.1. Q9NWU2 89% 533
823 95% 141 548 HRDFT83 606799 2515 WUblastx.64 (O60448) NEURONAL
THREAD O60448 60% 442 377 PROTEIN AD7C-NTP. 84% 584 528 60% 439 380
53% 578 459 61% 932 768 30% 778 641 68% 779 714 70% 942 769 58% 387
337 47% 948 892 42% 584 294 100% 691 668 62% 948 664 HRGCA01 589970
2516 WUblastx.64 (Q9H387) PRO2550. Q9H387 57% 1318 1016 HRGCA06
866189 2517 HMMER PFAM: Ribosomal protein S16 PF00886 69.1 143 325
2.1.1 WUblastx.64 (Q9Y3D3) 28S RIBOSOMAL RT16_HUMAN 99% 74 445
PROTEIN S16, MITOCHONDRIAL PRECURSOR HRGSE38 898233 2518
WUblastx.64 ATPase inhibitor precursor, pir|JC7175|JC7175 83% 77
367 mitochondrial - human HRLME03 610614 2520 WUblastx.64 (Q9H3B9)
PRO0956. Q9H3B9 39% 220 122 68% 111 46 HROAP64 835467 2522
WUblastx.64 (Q24333) ELASTIN LIKE PROTEIN Q24333 100% 46 117
(FRAGMENT). HROAS35 827304 2523 WUblastx.64 cytochrome-c oxidase
(EC 1.9.3.1) pir|A00482|OTHU3 77% 483 881 chain III - human 1
HROBJ10 836368 2525 WUblastx.64 (Q9Y5P3) RETINOIC ACID- RAI2_HUMAN
36% 1719 1441 INDUCED PROTEIN 2. 96% 1817 1719 96% 1054 671 100%
1445 1044 HRTAE88 822964 2529 WUblastx.64 (Q13579) MARINER Q13579
76% 2579 2845 TRANSPOSASE. HRTAP63 780698 2530 WUblastx.64 (Q9Y3C9)
CGI-127 PROTEIN. Q9Y3C9 100% 498 860 HSAAN03 599334 2532
WUblastx.64 (Q9H387) PRO2550. Q9H387 70% 924 832 72% 676 602 77%
1094 921 HSAAS05 703244 2533 WUblastx.64 (Q9N083) UNNAMED PORTEIN
Q9N083 55% 1475 1416 PRODUCT. 55% 1419 1216 HSAAW13 821334 2534
WUblastx.64 (AAK57641) CAMP-specific cyclic AAK57641 99% 1 1101
nucleotide phosphod HSATA61 801927 2538 WUblastx.64 (Q9CR30)
1110007C05RIK Q9CR30 73% 6 224 PROTEIN. HSATG66 824903 2539
WUblastx.64 (Q9JKP5) MUSCLEBLIND. Q9JKP5 100% 561 590 52% 13 213
83% 1 465 HSATI91 838829 2540 WUblastx.64 hypothetical protein (L1H
3' region) - pir|B34087|B34087 43% 345 127 human 35% 808 515 30%
828 580 50% 527 375 32% 128 45 HSATR50 826398 2541 WUblastx.64
(AAH02742) U6 snRNA-associated AAH02742 100% 397 483 Sm-like
protein LSm8 HSATT82 566784 2542 WUblastx.64 (Q9HAD8) CDNA FLJ11786
FIS, Q9HAD8 57% 1004 891 CLONE HEMBA1006036. 68% 915 766 HSATW19
637658 2543 WUblastx.64 (Q9UI50) PRO0657 (FRAGMENT). Q9UI50 75% 448
669 HSATW67 604938 2544 WUblastx.64 pro-pol-dUTPase polyprotein -
murine pir|T29097|T29097 63% 653 441 endogenous retrovirus ERV-L
82% 436 119 (fragment) HSATZ02 490895 2545 WUblastx.64 (Q9H387)
PRO2550. Q9H387 75% 964 857 76% 858 742 HSAUB89 600369 2547
WUblastx.64 (Q9BGW3) HYPOTHETICAL 13.5 KDA Q9BGW3 62% 359 631
PROTEIN. HSAUI53 866191 2548 WUblastx.64 retrovirus-related reverse
transcriptase pir|B25313|GNLRL1 42% 362 9 pseudogene - slow loris
32% 562 365 44% 942 868 44% 1037 957 38% 570 436 37% 827 723
HSAUV74 866193 2549 WUblastx.64 (Q9UHT1) PRO1902 PROTEIN. Q9UHT1
62% 827 693 HSAUX39 823161 2550 WUblastx.64 (Q62510) ZINC FINGER
PROTEIN Q62510 33% 960 1040 62 (FRAGMENT). 41% 1319 1645 43% 1244
1975 50% 1343 1975 52% 1349 1894 59% 1412 1975 45% 1235 1975 63%
1385 1972 52% 1349 1966 63% 1388 1966 48% 1130 1810 49% 1244 1975
64% 1367 1972 56% 1223 1975 HSAVE52 600370 2552 WUblastx.64
(Q9H728) CDNA: FLJ21463 FIS, Q9H728 55% 1425 1366 CLONE COL04765.
56% 1384 1127 HSAVH32 603367 2553 WUblastx.64 (AAK55521) PRO0764.
AAK55521 73% 811 767 56% 789 547 HSAVO11 566467 2555 WUblastx.64
(O60448) NEURONAL THREAD O60448 41% 1599 1207 PROTEIN AD7C-NTP. 66%
1597 1439 54% 1257 1192 64% 1582 1301 HSAVO17 738007 2556
WUblastx.64 (Q9H743) CDNA: FLJ21394 FIS, Q9H743 72% 1407 1129 CLONE
COL03536. HSAVQ13 606818 2557 WUblastx.64 (Q9GMX5) HYPOTHETICAL
12.9 KDA Q9GMX5 66% 494 538 PROTEIN. 72% 406 471 HSAVR85 786185
2558 WUblastx.64 (Q9H396) PRO2870. Q9H396 100% 3791 3546 HSAVY92
606808 2559 WUblastx.64 (Q9H5T7) CDNA: FLJ23054 FIS, Q9H5T7 100% 19
123 CLONE LNG03193. HSAVZ05 690151 2560 WUblastx.64 (Q9H743) CDNA:
FLJ21394 FIS, Q9H743 65% 57 257 CLONE COL03536. 56% 256 303 67%
1529 1212 HSAWB58 738018 2561 WUblastx.64 (Q9BGV8) HYPOTHETICAL
10.0 KDA Q9BGV8 75% 1386 1607 PROTEIN. HSAWH36 581087 2562
WUblastx.64 (Q9NX17) CDNA FLJ20489 FIS, Q9NX17 71% 1109 867 CLONE
KAT08285. HSAWM20 606840 2563 WUblastx.64 (Q9P147) PRO2822. Q9P147
67% 488 387 57% 363 322 73% 591 490 HSAWM74 866195 2564 WUblastx.64
(O95166) MM46 (HT004 PROTEIN) O95166 100% 8 85 (MAP1 LIGHT CHAIN 3
RELATED PROTEIN). HSAWX70 872498 2565 WUblastx.64 (O00369) L1
ELEMENT L1.20 P40 O00369 43% 1309 1088 PROTEIN. 73% 1028 300
HSAXI10 598726 2567 WUblastx.64 (Q9H387) PRO2550. Q9H387 79% 643
512 75% 811 776 71% 776 621 HSAXL49 606826 2568 WUblastx.64
(Q9H387) PRO2550. Q9H387 63% 742 572 83% 863 717 HSAXL82 566801
2569 WUblastx.64 (Q9CXK1) 5730406I15RIK Q9CXK1 96% 533 613 PROTEIN.
HSAXS06 668260 2572 WUblastx.64 (Q9H743) CDNA: FLJ21394 FIS, Q9H743
50% 955 824 CLONE COL03536. 62% 1121 954 HSAYL24 608642 2574
WUblastx.64 (Q9UI59) PRO0478 PROTEIN. Q9UI59 73% 132 7 HSBAJ47
842694 2578 WUblastx.64 (Q9H189) SPHINGOSINE-1- Q9H189 100% 1 237
PHOSPHATASE. HSDDC55 663277 2580 WUblastx.64 (Q9NX85) CDNA FLJ20378
FIS, Q9NX85 82% 743 793 CLONE KAIA0536. 57% 490 741 HSDEA26 822812
2581 WUblastx.64 (Q9UHT1) PRO1902 PROTEIN. Q9UHT1 76% 1325 1387 75%
1140 1322 HSDGH56 853379 2587 WUblastx.64 (Q9H728) CDNA: FLJ21463
FIS, Q9H728 94% 865 815 CLONE COL04765. 61% 1096 1058 70% 1058 879
HSDGM01 608310 2588 WUblastx.64 (Q9GMX5) HYPOTHETICAL 12.9 KDA
Q9GMX5 85% 722 781 PROTEIN. 53% 529 726 HSDGM42 870143 2589
WUblastx.64 (Q9BT21) SIMILAR TO RIKEN Q9BT21 92% 360 2639 CDNA
2610005L19 GENE (FRAGMENT). HSDGM42 824916 2590 WUblastx.64
(Q9BT21) SIMILAR TO RIKEN Q9BT21 91% 359 2638 CDNA 2610005L19 GENE
(FRAGMENT). HSDGM42 852473 2591 WUblastx.64 (Q9BT21) SIMILAR TO
RIKEN Q9BT21 95% 1544 606 CDNA 2610005L19 GENE (FRAGMENT). HSDGM42
861925 2592 WUblastx.64 (Q9BT21) SIMILAR TO RIKEN Q9BT21 92% 420
2699 CDNA 2610005L19 GENE (FRAGMENT). HSDGM42 865828 2593
WUblastx.64 (Q9BT21) SIMILAR TO RIKEN Q9BT21 92% 420 2699 CDNA
2610005L19 GENE (FRAGMENT). HSDGM42 886748 2594 WUblastx.64
(Q9BT21) SIMILAR TO RIKEN Q9BT21 92% 420 2699 CDNA 2610005L19 GENE
(FRAGMENT). HSDIK31 847087 2597 WUblastx.64 (O15121) PUTATIVE FATTY
ACID O15121 100% 19 369 DESATURASE MLD 97% 354 881 (DEGENERATIVE
SPERMATOCYT HSDJC96 753284 2599 WUblastx.64 (Q9Y6A3) HYPOTHETICAL
5.6 KDA Q9Y6A3 100% 1946 1800 PROTEIN (FRAGMENT). HSDJF04 695756
2601 WUblastx.64 (O95890) UNKNOWN. O95890 94% 2 382 HSDJG47 847325
2602 WUblastx.64 (Q9H6U6) CDNA: FLJ21857 FIS, Q9H6U6 84% 59 1180
CLONE HEP02294. HSDJH72 805971 2603 WUblastx.64 (Q9BVD9) UNKNOWN
(PROTEIN Q9BVD9 66% 1500 1447 FOR MGC: 5149). 71% 1709 1485 HSDJL07
895387 2604 WUblastx.64 (Q9H5R3) CDNA: FLJ23147 FIS, Q9H5R3 64% 764
898 CLONE LNG09295. 82% 1481 1290 HSDJR49 741079 2605 WUblastx.64
(Q9H728) CDNA: FLJ21463 FIS, Q9H728 63% 1000 1122 CLONE COL04765.
70% 893 1015 68% 786 872 62% 1124 1210 73% 1000 1044 67% 569 733
HSDJV24 806246 2606 WUblastx.64 (Q9CWT1) 2410004N11RIK Q9CWT1 72%
539 1429 PROTEIN. HSDJV40 623716 2607 WUblastx.64 (Q9NX85) CDNA
FLJ20378 FIS, Q9NX85 69% 1105 977 CLONE KAIA0536. 59% 1360 1295 38%
1583 1401 60% 1277 1104 HSDKA64 600372 2608 WUblastx.64 (Q9H387)
PRO2550. Q9H387 80% 1340 1278 72% 1548 1342 HSDKF96 839730 2610
WUblastx.64 (Q9N083) UNNAMED PORTEIN Q9N083 63% 1672 1412 PRODUCT.
HSDZO08 827460 2611 WUblastx.64 (Q9UES6) I-1 RECEPTOR Q9UES6 74% 1
393 CANDIDATE PROTEIN. 30% 1 156 92% 449 1648 HSEBB18 877813 2613
WUblastx.64 (Q9NXX4) CDNA FLJ20005 FIS, Q9NXX4 89% 476 898 CLONE
ADKA02526. HSFAM19 691371 2614 WUblastx.64 (O18966) EAG CHANNEL.
O18966 83% 76 510 HSHAG54 834781 2615 WUblastx.64 (Q9H5R3) CDNA:
FLJ23147 FIS, Q9H5R3 51% 1028 738
CLONE LNG09295. HSHAS72 835991 2616 HMMER PFAM: G-protein gamma
subunit. PF00631 139.1 225 422 2.1.1 WUblastx.64 (AAK53385) G
protein gamma 12 AAK53385 100% 207 422 subunit. HSHAX04 812178 2617
WUblastx.64 peptidylprolyl isomerase (EC 5.2.1.8) pir|S66681|S66681
96% 14 916 A - human HSHBT15 581088 2618 WUblastx.64 (O95863) ZINC
FINGER PROTEIN SNAI_HUMAN 100% 570 680 SNAI1 (SNAIL PROTEIN 79% 10
570 HOMOLOG) HSHCE85 855969 2619 WUblastx.64 (Q9Y546) DJ167A19.4
(NOVEL Q9Y546 100% 202 1224 PROTEIN). HSIAC81 783076 2620
WUblastx.64 (Q9H3T4) KLOTHO-RELATED Q9H3T4 99% 8 1261 PROTEIN 1.
HSIAP01 897538 2622 WUblastx.64 (Q9NXP8) CDNA FLJ20124 FIS, Q9NXP8
92% 590 673 CLONE COL06056. 28% 218 535 100% 685 732 89% 71 613
HSIDZ25 658721 2625 WUblastx.64 (Q9HBN2) HYPOTHETICAL 15.8 KDA
Q9HBN2 37% 1366 1280 PROTEIN. 80% 1689 1597 HSIEB64 651359 2626
WUblastx.64 (Q9P1J1) PRO1546. Q9P1J1 70% 1718 1747 60% 1860 1949
53% 1741 1875 HSIFO61 845026 2628 WUblastx.64 (O95831) PROGRAMED
CELL PCD8_HUMAN 96% 95 1933 DEATH PROTEIN 8, MITOCHONDRIAL PREC
HSIFO61 852715 2629 WUblastx.64 (O95831) PROGRAMED CELL PCD8_HUMAN
96% 183 2021 DEATH PROTEIN 8, MITOCHONDRIAL PREC HSIGC63 877486
2630 WUblastx.64 (Q9NX85) CDNA FLJ20378 FIS, Q9NX85 58% 1734 1354
CLONE KAIA0536. HSIGM95 840382 2631 WUblastx.64 (Q9H397) PRO2852.
Q9H397 80% 818 759 75% 754 707 77% 942 823 HSJAN83 825132 2633
WUblastx.64 (Q9HAD8) CDNA FLJ11786 FIS, Q9HAD8 86% 1063 977 CLONE
HEMBA1006036. 63% 963 898 57% 827 771 87% 839 768 77% 960 841
HSJAQ10 853383 2634 WUblastx.64 (AAH05957) Solute carrier family 25
AAH05957 100% 11 187 (mitochondrial HSJAR59 846364 2635 WUblastx.64
(Q9NZS6) GLUCOCORTICOID Q9NZS6 100% 16 138 RECEPTOR AF-1 SPECIFIC
ELONGATION FACTOR (FRA HSJAU93 702019 2636 WUblastx.64 (Q9BUK4)
SIMILAR TO Q9BUK4 74% 123 728 HYPOTHETICAL PROTEIN FLJ10709.
HSKHV81 841590 2646 WUblastx.64 (Q9HA67) CDNA FLJ12155 FIS, Q9HA67
60% 935 801 CLONE MAMMA1000472. 26% 308 219 HSKYR49 806548 2648
WUblastx.64 (Q9BTV7) UNKNOWN (PROTEIN Q9BTV7 100% 10 456 FOR IMAGE:
3357127) (FRAGMENT). HSKYU81 899335 2649 WUblastx.64 (Q9Y2W2) SH3
DOMAIN-BINDING Q9Y2W2 84% 950 1276 PROTEIN SNP70 (NPW38-BINDING
100% 536 565 PROTEIN NPWB 31% 240 365 72% 6 533 HSKYY92 853384 2650
WUblastx.64 (Q9P0E3) HSPC093 (FRAGMENT). Q9P0E3 57% 1455 1351 50%
1348 1193 HSLAB11 823825 2651 WUblastx.64 (Q9CVT0) 1700040C17RIK
Q9CVT0 99% 915 1427 PROTEIN (FRAGMENT). 34% 313 453 89% 187 915
HSLAS96 740764 2652 WUblastx.64 (Q9H387) PRO2550. Q9H387 62% 1173
1075 73% 1378 1175 HSLAW59 637669 2653 WUblastx.64 (Q9HAD8) CDNA
FLJ11786 FIS, Q9HAD8 52% 578 423 CLONE HEMBA1006036. 70% 427 287
HSLCH54 562018 2654 WUblastx.64 (P51805) PLEXIN A3 PRECURSOR
PLX4_HUMAN 97% 445 570 (PLEXIN 4) (TRANSMEMBRANE 81% 9 446 PROT
HSLCH57 899415 2655 WUblastx.64 SREBP cleavage activating protein -
pir|T18526|T18526 92% 1408 2205 Chinese hamster 39% 658 774 47% 352
459 HSLCI86 737626 2656 WUblastx.64 estrogen sulfotransferase (EC
2.8.2.--) - pir|JC2229|JC2229 33% 493 555 human 100% 704 1090
HSLCS31 604046 2657 HMMER PFAM: PPR repeat PF01535 22.6 493 597
2.1.1 WUblastx.64 (Q9H9R0) CDNA FLJ12598 FIS, Q9H9R0 98% 454 828
CLONE NT2RM4001384. 100% 826 1047 HSLCS34 751324 2658 WUblastx.64
(Q9NVE5) CDNA FLJ10785 FIS, Q9NVE5 70% 40 576 CLONE NT2RP4000457,
WEAKLY 86% 375 1007 SIMILAR TO UBI HSLCV16 772948 2659 WUblastx.64
(Q9H0J7) HYPOTHETICAL 53.4 KDA Q9H0J7 99% 1 552 PROTEIN. 87% 1537
1698 HSLDW54 853386 2660 WUblastx.64 probable pol
polyprotein-related pir|S21348|S21348 52% 732 631 protein 4 - rat
44% 625 452 34% 1115 738 HSLEC18 722249 2661 WUblastx.64 (Q96RP7)
Galbetal-3GalNAc 3'- Q96RP7 97% 60 1319 sulfotransferase. HSLEG59
637671 2662 WUblastx.64 (Q14287) HYPOTHETICAL Q14287 44% 968 807
PROTEIN (FRAGMENT). 20% 745 614 50% 1150 941 HSLFR59 853388 2663
WUblastx.64 hypothetical protein pir|T46471|T46471 86% 877 987
DKFZp434L0130.1 - human 93% 987 1481 HSLGD91 883491 2664
WUblastx.64 (Q9NX85) CDNA FLJ20378 FIS, Q9NX85 70% 764 817 CLONE
KAIA0536. 72% 816 926 HSNAQ52 600402 2672 WUblastx.64 (Q9BGZ4)
HYPOTHETICAL 11.6 KDA Q9BGZ4 85% 197 156 PROTEIN. 81% 142 95
HSNAW06 580248 2674 WUblastx.64 (Q9GMI2) HYPOTHETICAL 9.4 KDA
Q9GMI2 61% 219 413 PROTEIN. HSNBQ36 784994 2678 WUblastx.64
(Q9NUU5) CDNA FLJ11128 FIS, Q9NUU5 98% 358 732 CLONE PLACE1006236.
HSNBS39 617125 2679 WUblastx.64 retrovirus-related hypothetical
protein pir|S23650|S23650 76% 313 263 II - human 1 47% 82 26 38%
275 93 HSOAT44 847357 2681 WUblastx.64 (Q9GZY9) CDNA: FLJ20877 FIS,
Q9GZY9 100% 10 195 CLONE ADKA02965 (CDNA: FLJ20871 FIS, CLO HSOBH11
794000 2683 WUblastx.64 (Q9GMX5) HYPOTHETICAL 12.9 KDA Q9GMX5 58%
657 743 PROTEIN. 59% 508 603 HSOBW65 778388 2685 WUblastx.64
(Q14288) HYPOTHETICAL Q14288 64% 160 110 PROTEIN (FRAGMENT). 67%
636 142 HSPAA89 825099 2686 WUblastx.64 (P05142) PROLINE-RICH
PROTEIN PRP2_MOUSE 42% 210 148 MP-2 PRECURSOR. 37% 1144 641 HSQBL20
780518 2696 WUblastx.64 (Q9UBQ5) MRNA OF MUSCLE Q9UBQ5 100% 183 836
SPECIFIC GENE M9, COMPLETE CDS (ARG134 PROTEI HSQCY74 886110 2698
WUblastx.64 (Q9H455) DJ383J4.4 (A NOVEL Q9H455 99% 10 1455 PROTEIN
SIMILAR TO ASPARTYL-TRNA SYNTHETA HSRAA81 695759 2705 WUblastx.64
(CAC38441) DJ1033B10.5.1 (SAC2 CAC38441 90% 9 749 (suppressor of
actin 33% 596 694 100% 727 1086 HSRAO56 719816 2706 WUblastx.64
(Q9HBS7) HYPOTHETICAL 14.2 KDA Q9HBS7 68% 1419 1324 PROTEIN. 72%
1592 1416 HSRAV28 581102 2707 WUblastx.64 (Q9H387) PRO2550. Q9H387
61% 655 524 61% 823 785 75% 788 654 HSRDW57 562019 2709 WUblastx.64
(BAB55068) CDNA FLJ14466 fis, BAB55068 100% 8 259 clone
MAMMA1000416. 91% 262 495 83% 485 520 HSREC72 601368 2710
WUblastx.64 (Q9H387) PRO2550. Q9H387 88% 838 812 69% 783 625
HSREG42 839481 2711 WUblastx.64 (Q9VZZ4) PXN PROTEIN. Q9VZZ4 47% 6
1484 HSRFD18 840771 2712 WUblastx.64 (Q9H941) CDNA FLJ13033 FIS,
Q9H941 100% 437 559 CLONE NT2RP3001126. HSRGZ11 801929 2713
WUblastx.64 (Q9BYN8) DJ534B8.3 (NOVEL Q9BYN8 100% 253 384 PROTEIN).
HSRHB59 840384 2714 WUblastx.64 (Q9NWT0) HYPOTHETICAL 17.7 KDA
Q9NWT0 100% 8 121 PROTEIN. 100% 123 308 HSSCC66 559402 2716
WUblastx.64 (Q9N083) UNNAMED PORTEIN Q9N083 65% 548 667 PRODUCT.
HSSEL28 838618 2721 WUblastx.64 (Q9P195) PRO1722. Q9P195 68% 755
1042 HSSFP88 658726 2722 HMMER PFAM: Zinc finger, C3HC4 type
PF00097 36.1 828 953 2.1.1 (RING finger) WUblastx.64 (Q9H6Y7) CDNA:
FLJ21676 FIS, Q9H6Y7 90% 204 1133 CLONE COL09164. HSSGS62 741162
2723 WUblastx.64 (Q9GMX5) HYPOTHETICAL 12.9 KDA Q9GMX5 60% 899 762
PROTEIN. 60% 200 141 HSSJA23 847089 2724 WUblastx.64 (Q9BTH7)
UNKNOWN (PROTEIN Q9BTH7 94% 272 685 FOR MGC: 5601). 96% 1379 1561
HSSJF26 567431 2725 WUblastx.64 (Q9HBS7) HYPOTHETICAL 14.2 KDA
Q9HBS7 76% 600 689 PROTEIN. 46% 401 580 HSSJM47 796096 2727
WUblastx.64 (Q9UJ98) STROMAL ANTIGEN 3, Q9UJ98 77% 129 194 (STAG3).
75% 527 637 96% 899 994 HSSJW30 779822 2728 WUblastx.64 (BAB55147)
CDNA FLJ14580 fis, BAB55147 86% 2 46 clone NT2RM4001204. 92% 45 488
HSSJW30 850566 2729 WUblastx.64 (BAB55147) CDNA FLJ14580 fis,
BAB55147 67% 14 703 clone NT2RM4001204. HSSJW30 867721 2730
WUblastx.64 (BAB55147) CDNA FLJ14580 fis, BAB55147 82% 672 842
clone NT2RM4001204. 100% 625 675 89% 76 186 46% 131 220 60% 24 83
HSSMY35 740765 2731 WUblastx.64 (Q9H7J9) FLJ00075 PROTEIN Q9H7J9
96% 20 217 (FRAGMENT). HSTAL93 841863 2732 WUblastx.64 (AAK52433)
Low density lipoprotein AAK52433 98% 287 799 receptor-related 35%
284 787 35% 299 787 35% 287 637 HSUAF06 863206 2734 WUblastx.64 pol
polyprotein - Cas-Br-E murine pir|A26103|A26103 47% 630 944
leukemia virus (fragment) 50% 1194 1307 HSUBX67 751266 2735
WUblastx.64 (Q9N083) UNNAMED PORTEIN Q9N083 61% 624 499 PRODUCT.
64% 766 608 HSUSB73 603912 2736 WUblastx.64 (Q9GMU5) HYPOTHETICAL
14.1 KDA Q9GMU5 57% 1158 1117 PROTEIN. 80% 130 56 HSVAC05 836051
2737 WUblastx.64 (Q9H6G8) CDNA: FLJ22294 FIS, Q9H6G8 64% 688 539
CLONE HRC04426. HSVBA83 812059 2742 WUblastx.64 (O60593)
ARG/ABL-INTERACTING O60593 98% 313 516 PROTEIN ARGBP2B (FRAGMENT).
HSVBY62 637113 2745 WUblastx.64 (Q9Y2Q7) HSPC005 PROTEIN Q9Y2Q7
100% 35 217 (C11ORF10) (CHROMOSOME 11 OPEN READING FRAME HSXAI44
590743 2750 WUblastx.64 (Q9H728) CDNA: FLJ21463 FIS, Q9H728 90%
1024 992 CLONE COL04765. 73% 1007 828 HSXAS59 838072 2752
WUblastx.64 (Q9H728) CDNA: FLJ21463 FIS, Q9H728 85% 1515 1474 CLONE
COL04765. 81% 1303 1256 62% 1478 1305 HSXAY60 737753 2754
WUblastx.64 (Q9N032) UNNAMED PROTEIN Q9N032 59% 1742 1602
PRODUCT.
HSXCA83 830046 2756 WUblastx.64 (Q9UHD2) TANK BINDING Q9UHD2 39%
1121 1219 KINASE TBK1 (NF-KB- 98% 1215 1382 ACTIVATING KINASE NAK).
93% 109 1197 HSXCX20 658728 2757 WUblastx.64 (Q9BXA5) G-PROTEIN
COUPLED Q9BXA5 100% 891 1049 RECEPTOR 91. 86% 61 942 HSXFG21 805972
2758 WUblastx.64 (Q9CQQ2) 1700066F09RIK Q9CQQ2 47% 499 933 PROTEIN
(FRAGMENT). HSXFH82 699863 2759 WUblastx.64 (Q9MZZ7) HYPOTHETICAL
16.3 KDA Q9MZZ7 69% 1447 1611 PROTEIN. 92% 1124 1162 65% 1146 1598
HSYBR79 873848 2761 WUblastx.64 vesicle-associated membrane
protein- pir|JG0186|JG0186 100% 193 861 associated protein B -
human HSYBV44 753253 2762 WUblastx.64 (Q9B2U5) ATP SYNTHASE 6.
Q9B2U5 66% 84 761 HSYBZ94 799543 2763 WUblastx.64 (Q9BZ73) NIR2.
Q9BZ73 98% 2168 2392 99% 2388 2924 33% 1313 1399 33% 1895 1999 79%
21 2174 HT3AB13 841680 2764 WUblastx.64 (Q9UP93) SHORT FORM Q9UP93
53% 663 980 TRANSCRIPTION FACTOR C-MAF. 74% 271 612 HT4SB02 837688
2765 HMMER PFAM: emp24/gp25L/p24 family PF01105 231.4 78 521 2.1.1
WUblastx.64 protein trafficking protein tmp21-I - pir|G01159|G01159
100% 84 524 human 100% 21 74 HT4SB81 756723 2767 WUblastx.64
(O95621) TIC. O95621 95% 3 194 77% 580 789 62% 185 631 41% 19 54
HT4SB81 844512 2768 WUblastx.64 (O95621) TIC. O95621 72% 185 790
95% 3 194 41% 19 54 57% 872 913 HT4SB81 858154 2769 WUblastx.64
(O95621) TIC. O95621 71% 185 790 41% 19 54 95% 3 194 57% 872 913
HTABF81 610040 2771 WUblastx.64 (Q9NRR3) NON-KINASE CDC42 Q9NRR3
100% 48 299 EFFECTOR PROTEIN SPEC2. HTACX63 602694 2772 WUblastx.64
(Q9H728) CDNA: FLJ21463 FIS, Q9H728 65% 919 860 CLONE COL04765. 78%
825 784 53% 1067 921 HTADC63 842131 2773 WUblastx.64 (Q9D7U1)
2210407P13RIK Q9D7U1 40% 557 793 PROTEIN. 46% 162 557 HTADO61
695760 2774 WUblastx.64 hypothetical protein pir|T42648|T42648 100%
9 95 DKFZp434C1415.1 - human HTAEC59 846728 2776 WUblastx.64
ubiquitin-conjugating enzyme pir|S53358|S53358 100% 409 591 E2.17
kB - rat 100% 156 383 HTAED89 801931 2777 HMMER PFAM: 7
transmembrane receptor PF00003 78.6 1240 1578 2.1.1 (metabotropic
glutamate family) WUblastx.64 (O35363) CALCIUM SENSING O35363 51%
1590 1718 RECEPTOR, RELATED SEQUENCE 38% 858 920 2 (CALCIUM-SENSIN
38% 908 1171 53% 1216 1611 HTAEO35 732379 2780 WUblastx.64 (Q9H387)
PRO2550. Q9H387 73% 1476 1195 HTDAF68 637685 2781 WUblastx.64
(Q9H728) CDNA: FLJ21463 FIS, Q9H728 72% 892 1041 CLONE COL04765.
50% 2 91 70% 711 890 HTDAI38 878930 2782 WUblastx.64 (Q9NX73) CDNA
FLJ20400 FIS, Q9NX73 88% 954 1268 CLONE KAT00587 (FRAGMENT). 30%
361 669 34% 1146 1874 37% 1314 1898 100% 343 678 32% 930 1628
HTECE87 702025 2786 WUblastx.64 (Q9NVC3) CDNA FLJ10815 FIS, Q9NVC3
100% 53 133 CLONE NT2RP4000989, WEAKLY 100% 133 279 SIMILAR TO UNC
HTEDF78 564215 2787 WUblastx.64 (Q9BGW3) HYPOTHETICAL 13.5 KDA
Q9BGW3 75% 1545 1423 PROTEIN. HTEDX05 862064 2789 WUblastx.64
(Q9D4H6) 4932415A06RIK Q9D4H6 79% 16 441 PROTEIN. 86% 429 1649
HTEEC19 862065 2790 WUblastx.64 translation initiation factor IF-2
pir|T43483|T43483 100% 11 1321 homolog [similarity] - 1 HTEGH03
815562 2791 WUblastx.64 (Q9UHB5) EPITHELIAL PROTEIN Q9UHB5 93% 32
928 LOST IN NEOPLASM ALPHA. HTEGH03 839477 2792 WUblastx.64
(Q9UHB5) EPITHELIAL PROTEIN Q9UHB5 82% 678 845 LOST IN NEOPLASM
ALPHA. 88% 1 732 HTEGY81 637689 2794 WUblastx.64 (Q9CYN5)
5730405I09RIK Q9CYN5 74% 11 544 PROTEIN. HTEHB49 823145 2796
WUblastx.64 (Q9H2T7) RANBP17. Q9H2T7 65% 126 254 99% 203 1537
HTEHV60 637690 2798 WUblastx.64 (Q9D2H5) 4930486B16RIK Q9D2H5 88%
72 1028 PROTEIN. 33% 153 281 89% 1027 1113 HTEHW80 862068 2799
WUblastx.64 (Q9HAD8) CDNA FLJ11786 FIS, Q9HAD8 71% 297 578 CLONE
HEMBA1006036. HTEID25 737852 2800 WUblastx.64 (Q9Y4V7) DJ1178H5.3
(NOVEL Q9Y4V7 100% 259 384 PROTEIN) (FRAGMENT). HTEIJ23 784268 2801
WUblastx.64 (Q9NX98) CDNA FLJ20363 FIS, Q9NX98 93% 107 1303 CLONE
HEP17001. HTEIM62 806472 2802 WUblastx.64 (Q9H3C1) PRO0872. Q9H3C1
81% 62 15 76% 123 61 HTEIV33 603393 2803 WUblastx.64 hypothetical
protein pir|T47135|T47135 53% 259 11 DKFZp761L0812.1 - human
(fragment) HTEJD61 828178 2807 WUblastx.64 (BAB49394) Ml12208
protein. BAB49394 37% 437 682 27% 21 380 30% 437 682 27% 9 383 24%
18 392 29% 21 386 32% 401 682 30% 138 395 24% 452 682 27% 90 380
30% 395 679 28% 437 682 26% 392 592 30% 12 386 HTEJL16 603409 2810
WUblastx.64 (Q9CPU8) 4921511D23RIK Q9CPU8 71% 453 412 PROTEIN. 34%
1042 722 34% 1027 698 80% 412 257 32% 952 728 64% 1030 596 HTEKD35
604979 2813 WUblastx.64 (Q9D6N1) CARBONIC Q9D6N1 89% 40 594
ANHYDRASE (EC 4.2.1.1) (CARBONATE DEHYDRATASE). HTEKP82 694648 2814
WUblastx.64 (Q9D9W1) 1700027A23RIK Q9D9W1 68% 147 689 PROTEIN.
HTEKV69 877673 2815 WUblastx.64 (Q9D400) 4933425K02RIK Q9D400 61%
157 1005 PROTEIN. 66% 1052 1096 35% 52 210 HTFOB75 900824 2818
WUblastx.64 (Q9BX86) HP95. Q9BX86 96% 162 2366 50% 2469 2675 21%
1857 2354 HTGAA35 737945 2819 WUblastx.64 (Q9NX85) CDNA FLJ20378
FIS, Q9NX85 64% 1474 1349 CLONE KAIA0536. 78% 1632 1465 HTGAD74
834464 2820 WUblastx.64 (Q9UHT1) PRO1902 PROTEIN. Q9UHT1 66% 665
621 67% 868 668 HTGAP05 637715 2821 WUblastx.64 (Q9NX85) CDNA
FLJ20378 FIS, Q9NX85 65% 871 749 CLONE KAIA0536. 73% 990 868
HTGAR21 838159 2823 WUblastx.64 (Q9BVD9) UNKNOWN (PROTEIN Q9BVD9
80% 864 820 FOR MGC: 5149). 67% 1081 878 HTGAS70 827320 2824
WUblastx.64 (AAH00037) DNA fragmentation AAH00037 95% 290 1216
factor, 45 kD, alpha p HTGAT65 688864 2825 WUblastx.64 (Q9P0D8)
HSPC098 (FRAGMENT). Q9P0D8 42% 1074 1130 60% 1469 1573 HTGAU17
605125 2826 WUblastx.64 (Q9BGW3) HYPOTHETICAL 13.5 KDA Q9BGW3 58%
621 692 PROTEIN. 44% 703 876 HTGBK95 834490 2828 WUblastx.64
(Q9GMX5) HYPOTHETICAL 12.9 KDA Q9GMX5 66% 126 55 PROTEIN. 70% 235
116 HTGCC01 598903 2829 WUblastx.64 (Q9H387) PRO2550. Q9H387 73%
1099 962 68% 963 784 HTGCK43 828867 2830 WUblastx.64 (P82914) 28S
RIBOSOMAL RT15_HUMAN 91% 862 92 PROTEIN S15, MITOCHONDRIAL
PRECURSOR HTGDS43 605094 2831 WUblastx.64 (O60921) HUS1+-LIKE
PROTEIN. O60921 97% 706 831 HTGDS92 839478 2832 WUblastx.64
(Q9H728) CDNA: FLJ21463 FIS, Q9H728 69% 1300 1001 CLONE COL04765.
HTGEX34 877490 2833 WUblastx.64 (Q9H387) PRO2550. Q9H387 77% 2277
1966 HTGGM37 827310 2835 WUblastx.64 (Q9NUM6) CDNA FLJ11267 FIS,
Q9NUM6 76% 1781 1909 CLONE PLACE1009174. HTGGN22 782853 2836
WUblastx.64 (Q9H5R3) CDNA: FLJ23147 FIS, Q9H5R3 57% 741 664 CLONE
LNG09295. 66% 682 524 HTHBC58 839916 2838 WUblastx.64 (Q9H387)
PRO2550. Q9H387 80% 1267 1208 71% 1452 1294 HTHBQ29 561547 2840
WUblastx.64 (Q9BGV8) HYPOTHETICAL 10.0 KDA Q9BGV8 78% 786 1010
PROTEIN. HTHBZ91 637697 2842 WUblastx.64 (O60448) NEURONAL THREAD
O60448 53% 823 668 PROTEIN AD7C-NTP. 61% 948 802 69% 743 705 44%
458 273 52% 947 747 59% 594 466 61% 963 748 50% 360 313 36% 891 802
39% 948 880 57% 569 324 50% 493 425 25% 848 561 48% 408 289 26% 425
249 34% 454 272 30% 513 301 52% 588 367 HTHCA30 637124 2843
WUblastx.64 (Q9BVD9) UNKNOWN (PROTEIN Q9BVD9 67% 627 466 FOR MGC:
5149). HTHDB20 669032 2845 WUblastx.64 (Q9H728) CDNA: FLJ21463 FIS,
Q9H728 79% 426 355 CLONE COL04765. 60% 629 429 HTHDF45 621313 2846
WUblastx.64 (Q9H387) PRO2550. Q9H387 42% 987 691 HTHDF86 815686
2847 WUblastx.64 (Q9NX85) CDNA FLJ20378 FIS, Q9NX85 63% 1184 1249
CLONE KAIA0536. 83% 1029 1193 50% 1495 1247 HTHDP65 637699 2849
WUblastx.64 (Q9H387) PRO2550. Q9H387 100% 42 16 66% 205 35 HTHDV50
789402 2851 WUblastx.64 (Q9GMI7) HYPOTHETICAL 9.0 KDA Q9GMI7 47%
299 78 PROTEIN. HTJMA64 775181 2852 WUblastx.64 (Q9H728) CDNA:
FLJ21463 FIS, Q9H728 75% 1065 1211 CLONE COL04765. 75% 1369 1500
52% 1209 1391 44% 1187 1267 64% 893 1087 HTLAD74 638978 2854
WUblastx.64 (P78525) MYB PROTO-ONCOGENE P78525 48% 929 633 PROTEIN
(C-MYB). HTLAF81 855970 2855 WUblastx.64 (Q9BUS3) UNKNOWN (PROTEIN
Q9BUS3 72% 306 1073 FOR IMAGE: 3461487) (FRAGMENT). HTLBF46 839774
2856 HMMER PFAM: Papain family cysteine PF00112 255 176 751 2.1.1
protease WUblastx.64 (Q9UBX1) CATHEPSIN F CATF_HUMAN 99% 56 757
PRECURSOR (EC 3.4.22.41) (CATSF).
HTLBF63 762847 2857 HMMER PFAM: MYND finger PF01753 53.8 652 762
2.1.1 WUblastx.64 (O75800) BLU PROTEIN. O75800 94% 10 792 HTLCX82
847091 2858 WUblastx.64 (Q9BTZ4) SIMILAR TO Q9BTZ4 100% 127 258
EXPRESSED SEQUENCE 2 72% 237 629 EMBRYONIC LETHAL (FRAGMENT).
HTLDN34 866199 2860 WUblastx.64 (O94993) SOX30 PROTEIN. O94993 82%
242 751 89% 726 842 69% 9 137 HTLDP19 885353 2861 WUblastx.64
(Q9D5P4) 4930403J07RIK PROTEIN. Q9D5P4 62% 530 751 84% 8 121 61%
159 581 HTLEJ24 608317 2863 WUblastx.64 (Q9D7G6) 2310009N05RIK
Q9D7G6 84% 2 619 PROTEIN. HTLEJ75 815631 2864 WUblastx.64
(AAK52668) MMS19. AAK52668 92% 31 2133 HTLEJ75 762849 2865
WUblastx.64 (BAB55315) CDNA FLJ14804 fis, BAB55315 85% 7 798 clone
NT2RP4001638, w HTLEP55 637704 2866 WUblastx.64 (AAL37611)
Carboxypeptidase A5. AAL37611 97% 1242 1352 92% 1171 1251 53% 561
656 100% 178 561 87% 608 1168 HTLEV80 866200 2867 WUblastx.64
(O15020) BETA-SPECTRIN III O15020 100% 9 452 (FNTA III SPECTRIN).
HTLEZ57 634874 2868 WUblastx.64 (Q9P195) PRO1722. Q9P195 57% 662
531 59% 121 26 62% 481 401 HTLFA90 740770 2869 WUblastx.64 (Q9BRY0)
UNKNOWN (PROTEIN Q9BRY0 100% 2 1072 FOR IMAGE: 2966557) (FRAGMENT).
HTLGL33 835020 2870 WUblastx.64 N-type calcium channel alpha-1
chain, 1 pir|T45115|T45115 22% 364 1092 HTLGQ25 898114 2871 HMMER
PFAM: Immunoglobulin domain PF00047 26.6 153 377 2.1.1 WUblastx.64
(Q9H106) DJ576H24.4 (NOVEL Q9H106 100% 114 443 PROTEIN MEMBER OF
THE PTPNS (PROTEIN TYROS HTLGS72 897278 2872 WUblastx.64 (Q9JJC0)
BRAIN CDNA, CLONE Q9JJC0 34% 6 563 MNCB-2717. HTLGY50 839479 2873
WUblastx.64 (O73884) PUTATIVE O73884 39% 987 1100 PHOSPHATASE. 65%
589 1002 HTLHN86 896930 2874 WUblastx.64 (BAB55144) CDNA FLJ14576
fis, BAB55144 95% 318 938 clone NT2RM4001092, w HTLHN86 838287 2875
WUblastx.64 (BAB55144) CDNA FLJ14576 fis, BAB55144 95% 318 938
clone NT2RM4001092, w HTLHN86 843766 2876 WUblastx.64 (BAB55144)
CDNA FLJ14576 fis, BAB55144 95% 318 938 clone NT2RM4001092, w
HTLHN86 883351 2877 WUblastx.64 (BAB55144) CDNA FLJ14576 fis,
BAB55144 95% 318 938 clone NT2RM4001092, w HTLIW29 899417 2878
HMMER PFAM: Trypsin PF00089 226.4 133 852 2.1.1 WUblastx.64
(Q9Y6M0) TESTISIN PRECURSOR TEST_HUMAN 100% 67 885 (EC 3.4.21.--)
(EOSINOPHIL SERIN HTLJC15 898235 2879 WUblastx.64 (Q9D123)
1110032O16RIK Q9D123 71% 996 1715 PROTEIN. HTNAL14 886203 2880
WUblastx.64 (Q9NXU2) CDNA FLJ20054 FIS, Q9NXU2 100% 580 687 CLONE
COL00849. HTNBJ15 834872 2882 WUblastx.64 (Q9H055) HYPOTHETICAL
13.8 KDA Q9H055 99% 1536 1889 PROTEIN. HTNBJ15 845783 2883
WUblastx.64 (Q9H055) HYPOTHETICAL 13.8 KDA Q9H055 99% 1536 1889
PROTEIN. HTNBJ15 853916 2884 WUblastx.64 (Q9H055) HYPOTHETICAL 13.8
KDA Q9H055 99% 1536 1889 PROTEIN. HTNBJ15 884024 2885 WUblastx.64
(Q9H055) HYPOTHETICAL 13.8 KDA Q9H055 99% 1536 1889 PROTEIN.
HTOAO58 855972 2889 WUblastx.64 (Q9GZW5) SCAN DOMAIN- Q9GZW5 49%
974 1321 CONTAINING PROTEIN 2 (SCAND2). HTOAT56 702026 2890
WUblastx.64 (AAH00407) Synaptogyrin 2. AAH00407 82% 425 673 83% 10
495 HTOBG07 566862 2891 WUblastx.64 (Q9H288) SEROLOGICALLY Q9H288
100% 225 1343 DEFINED BREAST CANCER 41% 498 1343 ANTIGEN NY-BR-16.
37% 438 1343 37% 276 1187 33% 258 1319 34% 462 1304 30% 462 1286
50% 798 953 44% 1182 1343 66% 941 967 25% 261 839 39% 1098 1247
100% 42 71 HTOBG62 566830 2892 WUblastx.64 (Q9H728) CDNA: FLJ21463
FIS, Q9H728 66% 1378 1112 CLONE COL04765. HTODO45 823125 2895
WUblastx.64 (AAH08373) Similar to hypothetical AAH08373 67% 1408
1226 protein PRO1722. HTOET03 845230 2899 WUblastx.64 (Q9BQC3)
SIMILAR TO Q9BQC3 83% 4 1041 DIPTHERIA TOXIN RESISTANCE PROTEIN
REQUIRED FOR D HTOET03 837213 2900 WUblastx.64 (Q9BQC3) SIMILAR TO
Q9BQC3 83% 4 1041 DIPTHERIA TOXIN RESISTANCE PROTEIN REQUIRED FOR D
HTOFA11 637719 2902 WUblastx.64 (Q30086) MHC CLASS II HLA-DQ-
Q30086 96% 1348 1635 ALPHA (DR2-DQW1/DR4 DQW3) 80% 1962 2069
(FRAGMENT). 97% 694 942 68% 1882 1968 HTOFC33 824604 2903
WUblastx.64 (Q9H387) PRO2550. Q9H387 65% 900 754 73% 1069 878
HTOGB79 762835 2904 WUblastx.64 (O60448) NEURONAL THREAD O60448 52%
1639 1917 PROTEIN AD7C-NTP. 60% 1642 1806 50% 1661 1825 31% 1465
1530 26% 1238 1528 27% 69 227 60% 1854 1928 43% 1797 1865 32% 1420
1542 75% 2727 2596 52% 2606 2472 42% 1214 1137 77% 2727 2551 49%
2661 2500 42% 2663 2553 56% 1213 1166 45% 2715 2596 68% 1284 1219
41% 1302 1141 55% 1332 1273 48% 1332 1264 52% 2730 2674 55% 1333
1274 55% 1208 1155 60% 1339 1157 62% 2756 2478 HTOHE22 821698 2905
WUblastx.64 (Q9NX85) CDNA FLJ20378 FIS, Q9NX85 75% 1008 1217 CLONE
KAIA0536. HTOHG63 834832 2906 WUblastx.64 (Q9H8L6) CDNA FLJ13465
FIS, Q9H8L6 98% 2 670 CLONE PLACE1003493, WEAKLY SIMILAR TO END
HTOHJ93 762836 2907 WUblastx.64 (Q9H743) CDNA: FLJ21394 FIS, Q9H743
70% 1323 1048 CLONE COL03536. HTOHN40 843372 2910 WUblastx.64
(Q9NX85) CDNA FLJ20378 FIS, Q9NX85 64% 1889 1839 CLONE KAIA0536.
50% 1845 1654 HTOHR59 762850 2911 WUblastx.64 (AAH07609) Similar to
hypothetical AAH07609 92% 1249 1127 protein PRO1722. HTOHS29 722256
2912 WUblastx.64 (AAH08373) Similar to hypothetical AAH08373 80%
129 10 protein PRO1722. HTOID65 636069 2913 WUblastx.64 (Q9H387)
PRO2550. Q9H387 56% 630 761 50% 467 658 77% 1420 1316 78% 1314 1165
HTOIE17 688061 2914 WUblastx.64 (Q9NWI4) CDNA FLJ20837 FIS, Q9NWI4
66% 942 889 CLONE ADKA02602. 61% 1078 938 HTOIG16 845999 2915
WUblastx.64 (Q9H728) CDNA: FLJ21463 FIS, Q9H728 93% 1558 1511 CLONE
COL04765. 63% 1793 1563 HTOIH39 839245 2916 WUblastx.64 (O60448)
NEURONAL THREAD O60448 53% 750 1106 PROTEIN AD7C-NTP. 46% 53 130
50% 1095 1184 51% 840 1049 57% 64 126 56% 14 121 54% 987 1151 54%
29 133 40% 1039 1167 68% 19 93 HTOJB02 600376 2918 WUblastx.64
(O60448) NEURONAL THREAD O60448 54% 780 652 PROTEIN AD7C-NTP. 33%
1322 1143 50% 1275 1108 66% 919 770 47% 682 626 52% 1235 1161 40%
889 770 50% 787 632 58% 816 727 41% 1424 1338 62% 708 661 37% 784
614 56% 918 658 58% 1411 1265 56% 1274 1134 30% 1275 1093 57% 1403
1251 59% 1424 1098 60% 949 713 HTOJJ26 821702 2919 WUblastx.64
(Q9UHT1) PRO1902 PROTEIN. Q9UHT1 71% 2969 2844 HTOJP25 853623 2920
WUblastx.64 hypothetical L1 protein (third intron of
pir|JU0033|JU0033 60% 1388 1519 gene TS) - human HTOJS23 737735
2921 WUblastx.64 (Q9H728) CDNA: FLJ21463 FIS, Q9H728 57% 1564 1523
CLONE COL04765. 46% 1670 1575 59% 1833 1657 HTOJY56 664504 2922
WUblastx.64 (Q9P1F2) PRO2032. Q9P1F2 100% 88 240 HTPCO75 853645
2925 WUblastx.64 (O00549) ORF2-LIKE PROTEIN O00549 43% 325 26
(FRAGMENT). 36% 1318 1253 HTPDD68 590530 2927 WUblastx.64 (Q9H0G2)
HYPOTHETICAL 136.4 KDA Q9H0G2 88% 10 2004 PROTEIN. HTSET62 833692
2930 WUblastx.64 (Q9HCS4) HMG-BOX Q9HCS4 95% 59 124 TRANSCRIPTION
FACTOR TCF-3. 66% 124 327 HTSFV18 609939 2931 HMMER PFAM:
Low-density lipoprotein PF00057 49.4 170 280 2.1.1 receptor domain
class A WUblastx.64 LDL receptor related protein 105 -
pir|T00204|T00204 82% 10 984 human HTSGO13 789723 2932 WUblastx.64
(Q9NWJ5) CDNA FLJ20807 FIS, Q9NWJ5 99% 195 548 CLONE ADSE01784. 97%
489 845 HTSGO88 634834 2933 WUblastx.64 (O60448) NEURONAL THREAD
O60448 76% 797 612 PROTEIN AD7C-NTP. 52% 640 521 66% 636 574 45%
560 492 69% 791 627 61% 137 75 HTTAH05 772560 2934 WUblastx.64
(Q9H397) PRO2852. Q9H397 60% 548 676 39% 684 926 HTTBJ38 863131
2936 WUblastx.64 (Q9VST7) CG4911 PROTEIN. Q9VST7 25% 497 1177
HTTDB11 638132 2937 WUblastx.64 (Q99LX8) UNKNOWN (PROTEIN Q99LX8
100% 130 240 FOR MGC: 7346).
HTTDG27 608318 2938 WUblastx.64 (O62658) LINE-1 ELEMENT ORF2.
O62658 44% 454 380 35% 392 3 HTTDN24 766485 2939 WUblastx.64
(Q9BVN5) HYPOTHETICAL 120.6 KDA Q9BVN5 95% 628 1725 PROTEIN. 32%
937 1593 95% 3 629 32% 1114 1596 HTTDO33 899418 2940 WUblastx.64
(Q96GQ9) Unknown (protein for Q96GQ9 95% 22 753 MGC: 16648).
HTTEO25 853403 2942 WUblastx.64 (Q9BWK9) UNKNOWN (PROTEIN Q9BWK9
97% 1314 1424 FOR IMAGE: 2900813) (FRAGMENT). HTTEP11 562023 2943
WUblastx.64 hypothetical protein pir|T46441|T46441 70% 753 830
DKFZp434C0927.1 - human 74% 1006 1110 51% 812 928 100% 625 753
HTTES77 844417 2944 WUblastx.64 (AAK40083) Inhibin binding protein
AAK40083 82% 697 2085 long isoform. 37% 3 725 31% 6 713 30% 93 704
36% 659 733 39% 697 1818 34% 697 1815 33% 982 1818 88% 3 719 33%
697 1827 31% 1096 1821 31% 736 1833 35% 45 719 28% 901 1761 35% 6
737 34% 9 680 32% 45 716 36% 1240 1818 HTTFG15 600377 2946
WUblastx.64 (Q9GMK2) HYPOTHETICAL 10.0 KDA Q9GMK2 66% 327 482
PROTEIN. HTWAM19 618318 2947 WUblastx.64 (Q9H728) CDNA: FLJ21463
FIS, Q9H728 76% 1852 1763 CLONE COL04765. 64% 1764 1525 HTWBO30
655371 2949 WUblastx.64 (Q9N083) UNNAMED PORTEIN Q9N083 47% 560 453
PRODUCT. 55% 751 578 HTWBZ57 828030 2950 WUblastx.64 (O95273)
D-TYPE CYCLIN- O95273 87% 218 1276 INTERACTING PROTEIN 1. HTWCC10
747687 2951 WUblastx.64 (Q9NX85) CDNA FLJ20378 FIS, Q9NX85 60% 1051
947 CLONE KAIA0536. 63% 1241 1095 HTWCE14 762839 2952 WUblastx.64
(Q9BSZ7) UNKNOWN (PROTEIN Q9BSZ7 100% 121 231 FOR MGC: 4322).
HTWCT76 767758 2953 WUblastx.64 (Q9BGW3) HYPOTHETICAL 13.5 KDA
Q9BGW3 68% 1550 1368 PROTEIN. 58% 1361 1311 HTWDJ17 784037 2954
WUblastx.64 (Q9CYV6) 2810439F02RIK Q9CYV6 93% 17 1255 PROTEIN.
HTWDM89 569787 2955 WUblastx.64 (Q9P195) PRO1722. Q9P195 63% 1413
1267 61% 1277 1098 HTWEQ36 823369 2958 WUblastx.64 (Q9NXK9) CDNA
FLJ20187 FIS, Q9NXK9 68% 748 891 CLONE COLF0433. HTWFA88 596942
2960 WUblastx.64 probable transposase - human pir|S72481|S72481 58%
1286 1357 transposon MER37 70% 1350 1559 51% 709 1272 HTWFO43
858741 2962 WUblastx.64 (O60448) NEURONAL THREAD O60448 67% 890 627
PROTEIN AD7C-NTP. 62% 1241 1056 63% 754 689 62% 1108 980 65% 1242
1102 61% 905 744 53% 684 601 40% 790 665 58% 675 625 34% 1184 975
35% 863 744 61% 1257 1039 45% 1063 992 64% 657 607 40% 1215 1087
34% 778 659 100% 1016 996 HTXAD75 745410 2965 WUblastx.64 (Q9GLG1)
CALPAIN 2. Q9GLG1 92% 345 917 HTXAR92 656935 2966 WUblastx.64
(Q9H728) CDNA: FLJ21463 FIS, Q9H728 77% 1578 1297 CLONE COL04765.
HTXBU88 604985 2968 WUblastx.64 (Q9NX85) CDNA FLJ20378 FIS, Q9NX85
75% 771 736 CLONE KAIA0536. 65% 739 680 60% 701 453 HTXCP27 892364
2969 WUblastx.64 (AAH00057) Protein phosphatase 1G AAH00057 97% 521
628 (formerly 2C), ma 100% 946 1149 98% 285 524 HTXCU30 839846 2970
WUblastx.64 (Q9H728) CDNA: FLJ21463 FIS, Q9H728 81% 706 641 CLONE
COL04765. 80% 639 577 59% 875 684 HTXCV44 740773 2971 WUblastx.64
(Q9HA67) CDNA FLJ12155 FIS, Q9HA67 52% 883 945 CLONE MAMMA1000472.
70% 809 898 63% 630 803 63% 1521 1366 68% 1370 1323 HTXDJ75 562780
2973 WUblastx.64 (Q26195) PVA1 GENE. Q26195 51% 1598 1335 HTXDT72
778083 2977 WUblastx.64 (Q9BSV9) SIMILAR TO 95 KDA Q9BSV9 100% 8
400 RETINOBLASTOMA PROTEIN BINDING PROTEIN, KI HTXDZ68 824545 2979
WUblastx.64 (Q9P0D0) HSPC106 (FRAGMENT). Q9P0D0 72% 80 277 54% 136
498 HTXEN33 589556 2980 WUblastx.64 (Q99419) ICSAT TRANSCRIPTION
Q99419 78% 843 968 FACTOR (FRAGMENT). HTXJD08 566885 2985
WUblastx.64 (Q14288) HYPOTHETICAL Q14288 59% 743 1111 PROTEIN
(FRAGMENT). 47% 604 756 45% 395 583 HTXJD85 840391 2986 WUblastx.64
(Q9HAD8) CDNA FLJ11786 FIS, Q9HAD8 52% 1093 818 CLONE HEMBA1006036.
HTXJI59 869905 2988 WUblastx.64 (O15290) P66SHC. O15290 93% 1708
1571 HTXJJ92 688062 2989 WUblastx.64 (Q9N044) UNNAMED PROTEIN
Q9N044 59% 709 614 PRODUCT. 66% 611 531 HTXJM94 853413 2990
WUblastx.64 (Q9Y2S9) HSPC019. Q9Y2S9 83% 44 262 HTXJW06 789201 2992
WUblastx.64 (Q9UI28) ADRENAL GLAND Q9UI28 100% 868 623 PROTEIN
AD-003. HTXKB57 844329 2993 WUblastx.64 (Q9P073) HSPC309
(FRAGMENT). Q9P073 94% 1072 1128 65% 1125 1523 HTXKH40 600378 2995
WUblastx.64 (Q9Y380) CGI-71 PROTEIN. Q9Y380 94% 9 290 HTXKK76
858755 2996 WUblastx.64 pro-pol-dUTPase polyprotein - murine
pir|T29097|T29097 44% 466 2 endogenous retrovirus ERV-L (fragment)
HTXKL53 783141 2997 WUblastx.64 (Q9Y3F0) CGI-05 PROTEIN. Q9Y3F0
100% 1315 1359 90% 3 89 HTXLC05 843523 3000 WUblastx.64 (Q9H189)
SPHINGOSINE-1- Q9H189 25% 4 531 PHOSPHATASE. HTXLY94 844165 3003
WUblastx.64 hypothetical protein pir|T14744|T14744 64% 77 643
DKFZp586F0424.1 - human (fragment) HTXNV66 840597 3004 WUblastx.64
(Q9UJY4) ADP-RIBOSYLATION GGA2_HUMAN 99% 18 431 FACTOR BINDING
PROTEIN GGA2 (GOLG HTXOW27 839280 3006 WUblastx.64 (Q9P2V7) PROTEIN
CONTAINING Q9P2V7 100% 1652 2086 CXXC DOMAIN 1 92% 1309 1656
(HYPOTHETICAL 75.7 KDA PROT 78% 229 1188 HTXPD86 834772 3007
WUblastx.64 (Q9UGP9) WD-REPEAT PROTEIN 5 WDR5_HUMAN 95% 74 1132
(FRAGMENT). HTXPT57 897834 3008 WUblastx.64 (O60448) NEURONAL
THREAD O60448 60% 939 838 PROTEIN AD7C-NTP. 52% 693 544 42% 564 451
53% 471 427 26% 722 543 35% 725 474 37% 1123 938 45% 974 849 53%
705 526 40% 1054 911 53% 911 834 75% 1104 1069 64% 891 841 51% 551
432 57% 425 384 52% 1084 926 HTYSJ88 598718 3009 WUblastx.64
(Q9NX85) CDNA FLJ20378 FIS, Q9NX85 64% 729 457 CLONE KAIA0536.
HUFAB57 587275 3012 WUblastx.64 ISOFORM B OF Q9UNP9 sp_vs|Q9UNP9-
94% 1266 1316 01|Q9UNP9 53% 826 1035 HUFAO92 608175 3014
WUblastx.64 (Q9D922) 1810010G06RIK Q9D922 69% 232 522 PROTEIN.
HUFAO94 668267 3015 WUblastx.64 (Q9UI14) PRENYLATED RAB Q9UI14 100%
3 551 ACCEPTOR 1. HUFAP33 600379 3016 HMMER PFAM: Zona
pellucida-like domain PF00100 223.2 282 1016 2.1.1 WUblastx.64
(Q9Y211) DMBT1 PROTEIN. Q9Y211 93% 228 1016 100% 26 226 43% 29 217
41% 445 546 38% 445 546 38% 445 522 100% 1013 1117 HUFBV62 742892
3020 WUblastx.64 (Q9CWU4) 2410004B18RIK Q9CWU4 76% 76 264 PROTEIN.
HUKAD46 604986 3024 WUblastx.64 (Q9NX85) CDNA FLJ20378 FIS, Q9NX85
46% 589 747 CLONE KAIA0536. 63% 377 598 HUKCS86 826468 3027
WUblastx.64 (Q9NX09) CDNA FLJ20500 FIS, Q9NX09 82% 201 896 CLONE
KAT09159. HUKCS86 844245 3028 WUblastx.64 (Q9NX09) CDNA FLJ20500
FIS, Q9NX09 82% 201 896 CLONE KAT09159. HUKEA22 702029 3029
WUblastx.64 (Q9PTD7) CINGULIN. Q9PTD7 68% 575 12 HUKFC71 1300740
3032 WUblastx.64 (P82914) 28S RIBOSOMAL RT15_HUMAN 97% 292 414
PROTEIN S15, MITOCHONDRIAL 65% 408 929 PRECURSOR HUKFC71 845161
3111 blastx.2 MITOCHONDRIAL 28S sp|P82914|P82914 100% 293 931
RIBOSOMAL PROTEIN S15 (MRP- S15). HUKFV37 844644 3033 WUblastx.64
(AAH00407) Synaptogyrin 2. AAH00407 91% 49 720 HUNAL39 559448 3035
WUblastx.64 (Q14288) HYPOTHETICAL Q14288 81% 1009 629 PROTEIN
(FRAGMENT). HUSAO04 877889 3036 HMMER PFAM: tRNA synthetases class
I (W PF00579 260.4 255 965 2.1.1 and Y) WUblastx.64 (Q9H817) CDNA
FLJ13995 FIS, Q9H817 92% 30 1451 CLONE Y79AA1002209, WEAKLY SIMILAR
TO TYR HUSAO04 870791 3037 HMMER PFAM: tRNA synthetases class I (W
PF00579 212.2 297 965 2.1.1 and Y) WUblastx.64 (Q9H817) CDNA
FLJ13995 FIS, Q9H817 92% 30 1451 CLONE Y79AA1002209, WEAKLY SIMILAR
TO TYR HUSCA09 853417 3038 HMMER PFAM: Leucine Rich Repeat PF00560
69.9 1259 1327 2.1.1 WUblastx.64 (Q9H075) HYPOTHETICAL 81.8 KDA
Q9H075 52% 44 1615 PROTEIN. HUSCJ01 740775 3039 WUblastx.64
(Q9CWP6) 2410013I23RIK Q9CWP6 70% 1 252 PROTEIN. HUSGB23 704094
3040 WUblastx.64 (Q9H0F5) HYPOTHETICAL 43.9 KDA Q9H0F5 97% 143 247
PROTEIN. HUSGY15 759888 3043 WUblastx.64 (Q9JKN1) ZINC TRANSPORTER
Q9JKN1 76% 162 1289 LIKE 2 (1810059J10RIK PROTEIN). HUSHD41 866498
3044 WUblastx.64 (BAB55441) CDNA FLJ14993 fis, BAB55441 86%
2575 1541 clone Y79AA1001874, w 50% 2569 2483 HUSHK65 847188 3045
HMMER PFAM: CUB domain PF00431 292.1 887 1222 2.1.1 WUblastx.64
(AAG41897) Neuropilin-2a(17). AAG41897 97% 806 2122 95% 2727 3023
82% 3046 3579 92% 2089 2721 32% 2086 2619 31% 1547 2086 92% 3008
3046 HUSIK45 853932 3046 WUblastx.64 (Q96CN8) Hypothetical 30.9 kDa
Q96CN8 91% 23 454 protein (Fragment). HUSIO57 886206 3047
WUblastx.64 (Q9Y3E2) HYPOTHETICAL YCE3_HUMAN 100% 170 565 PROTEIN
CGI-143. HUSIR70 838163 3049 WUblastx.64 (Q9HDC9) BSCV PROTEIN
Q9HDC9 97% 1 345 (FRAGMENT). HUSXP50 561962 3050 WUblastx.64
(Q63777) HYPOTHETICAL 32.0 KDA Q63777 26% 178 291 PROTEIN. 57% 27
68 55% 113 172 HUVCQ68 561963 3053 WUblastx.64 (Q9BV40) SIMILAR TO
VESICLE- Q9BV40 82% 40 339 ASSOCIATED MEMBRANE PROTEIN 8
(ENDOBREVIN HUVEG53 797556 3055 WUblastx.64 (O62658) LINE-1 ELEMENT
ORF2. O62658 35% 1843 1676 39% 2148 1939 60% 1391 1263 HWAAH11
815548 3056 WUblastx.64 (Q9HAB3) CDNA FLJ11856 FIS, Q9HAB3 74% 362
754 CLONE HEMBA1006789 (SIMILAR TO HYPOTHETIC HWAAQ28 806588 3057
WUblastx.64 (Q9NZZ8) HSPC169 Q9NZZ8 96% 62 676 (HYPOTHETICAL 33.9
KDA 23% 649 801 PROTEIN). 100% 651 980 HWAAY60 745917 3058
WUblastx.64 (Q9BQA1) BA552M11.2.2 (NOVEL Q9BQA1 76% 504 722 PROTEIN
(ISOFORM 2)) (UNKNOWN) (PROTEIN HWABR43 823367 3059 WUblastx.64
(Q9BVD9) UNKNOWN (PROTEIN Q9BVD9 75% 2081 2034 FOR MGC: 5149). 79%
2266 2093 HWACZ33 827311 3061 WUblastx.64 (Q9CTA6) 1110035E02RIK
Q9CTA6 62% 389 436 PROTEIN (FRAGMENT). 73% 234 392 HWADV90 897732
3062 WUblastx.64 (Q9NX17) CDNA FLJ20489 FIS, Q9NX17 78% 2375 2163
CLONE KAT08285. HWAEB52 873207 3063 WUblastx.64 (Q9H8U5) CDNA
FLJ13219 FIS, Q9H8U5 68% 878 1426 CLONE NT2RP4001849, WEAKLY 60%
389 685 SIMILAR TO SH3 23% 356 667 28% 874 1113 31% 1191 1286 40%
344 442 35% 299 466 HWBAK71 853581 3064 WUblastx.64 (Q9T9V8) NADH
Q9T9V8 87% 77 175 DEHYDROGENASE SUBUNIT 3. 83% 305 340 HWBBU75
780360 3065 WUblastx.64 (Q9R189) MUNC13-4 PROTEIN. Q9R189 82% 1454
2362 73% 913 1434 80% 194 952 62% 2229 2729 31% 1586 1711 34% 401
532 HWBCN81 853580 3066 WUblastx.64 (Q9H101) DJ776F14.2 (A NOVEL
Q9H101 94% 195 560 PROTEIN MEMBER OF THE PTPNS 33% 222 560 (PROTEIN
TYR 100% 150 221 HWBCX93 853418 3068 WUblastx.64 (Q9NX85) CDNA
FLJ20378 FIS, Q9NX85 80% 642 553 CLONE KAIA0536. 84% 796 641
HWHGV77 788555 3072 WUblastx.64 (Q9D6W1) 2310050C09RIK Q9D6W1 70%
136 621 PROTEIN. 51% 127 552 37% 127 588 47% 124 318 100% 721 756
HWHGW09 702032 3073 HMMER PFAM: Uncharacterized protein family
PF01027 68.3 271 444 2.1.1 WUblastx.64 (Q9Y3C2) CGI-119 PROTEIN.
Q9Y3C2 84% 256 450 HWHPU44 778090 3075 WUblastx.64 (Q9H1C8)
PUTATIVE Q9H1C8 97% 311 547 CYTOPLASMATIC PROTEIN. HWLAT50 840753
3077 WUblastx.64 (Q99JR4) UNKNOWN (PROTEIN Q99JR4 48% 1864 2106 FOR
IMAGE: 3599558) (FRAGMENT). HWLGP26 834770 3079 WUblastx.64
(Q9NP87) DNA POLYMERASE MU. Q9NP87 93% 674 760 100% 269 298 94% 295
465 87% 432 623 100% 3 254 HWLHO31 837480 3080 WUblastx.64 (Q9NQT8)
KINESIN-LIKE PROTEIN Q9NQT8 100% 41 205 GAKIN. 96% 190 1674 HWLJN08
800626 3082 WUblastx.64 (Q9BX68) HIT-17 KDA. Q9BX68 99% 434 844
HWLRE03 831198 3083 WUblastx.64 (O60646) HYPOTHETICAL 53.8 KDA
O60646 100% 1008 1232 PROTEIN (FRAGMENT). 99% 1238 2431 HWTBL86
791720 3089 WUblastx.64 hypothetical protein pir|T17285|T17285 91%
1 1080 DKFZp434N0535.1 - human (fragment) HWTBX66 732187 3090
WUblastx.64 (Q9BRI8) UNKNOWN (PROTEIN Q9BRI8 71% 63 1073 FOR MGC:
11332). HYAAD61 897736 3092 WUblastx.64 (O21101) ATPASE 6/8 O21101
56% 2009 2179 (FRAGMENT). HYBAP75 853561 3094 WUblastx.64 (Q9N032)
UNNAMED PROTEIN Q9N032 64% 909 1025 PRODUCT.
RACE Protocol for Recovery of Full-Length Genes
[0195] Partial cDNA clones can be made full-length by utilizing the
rapid amplification of cDNA ends (RACE) procedure described in
Frohman, M. A., et al., Proc. Nat'l. Acad. Sci. USA, 85:8998-9002
(1988). A cDNA clone missing either the 5' or 3' end can be
reconstructed to include the absent base pairs extending to the
translational start or stop codon, respectively. In some cases,
cDNAs are missing the start codon of translation, therefor. The
following briefly describes a modification of this original 5' RACE
procedure. Poly A+ or total RNA is reverse transcribed with
Superscript II (Gibco/BRL) and an antisense or complementary primer
specific to the cDNA sequence. The primer is removed from the
reaction with a Microcon Concentrator (Amicon). The first-strand
cDNA is then tailed with dATP and terminal deoxynucleotide
transferase (Gibco/BRL). Thus, an anchor sequence is produced which
is needed for PCR amplification. The second strand is synthesized
from the dA-tail in PCR buffer, Taq DNA polymerase (Perkin-Elmer
Cetus), an oligo-dT primer containing three adjacent restriction
sites (XhoI, SalI and ClaI) at the 5' end and a primer containing
just these restriction sites. This double-stranded cDNA is PCR
amplified for 40 cycles with the same primers as well as a nested
cDNA-specific antisense primer. The PCR products are size-separated
on an ethidium bromide-agarose gel and the region of gel containing
cDNA products the predicted size of missing protein-coding DNA is
removed. cDNA is purified from the agarose with the Magic PCR Prep
kit (Promega), restriction digested with XhoI or SalI, and ligated
to a plasmid such as pBluescript SKII (Stratagene) at XhoI and
EcoRV sites. This DNA is transformed into bacteria and the plasmid
clones sequenced to identify the correct protein-coding inserts.
Correct 5' ends are confirmed by comparing this sequence with the
putatively identified homologue and overlap with the partial cDNA
clone. Similar methods known in the art and/or commercial kits are
used to amplify and recover 3' ends.
[0196] Several quality-controlled kits are commercially available
for purchase. Similar reagents and methods to those above are
supplied in kit form from Gibco/BRL for both 5' and 3' RACE for
recovery of full length genes. A second kit is available from
Clontech which is a modification of a related technique, SLIC
(single-stranded ligation to single-stranded cDNA), developed by
Dumas et al., Nucleic Acids Res., 19:5227-32 (1991). The major
differences in procedure are that the RNA is alkaline hydrolyzed
after reverse transcription and RNA ligase is used to join a
restriction site-containing anchor primer to the first-strand cDNA.
This obviates the necessity for the dA-tailing reaction which
results in a polyT stretch that is difficult to sequence past.
[0197] An alternative to generating 5' or 3' cDNA from RNA is to
use cDNA library double-stranded DNA. An asymmetric PCR-amplified
antisense cDNA strand is synthesized with an antisense
cDNA-specific primer and a plasmid-anchored primer. These primers
are removed and a symmetric PCR reaction is performed with a nested
cDNA-specific antisense primer and the plasmid-anchored primer.
RNA Ligase Protocol for Generating the 5' or 3' End Sequences to
Obtain Full Length Genes
[0198] Once a gene of interest is identified, several methods are
available for the identification of the 5' or 3' portions of the
gene which may not be present in the original cDNA plasmid. These
methods include, but are not limited to, filter probing, clone
enrichment using specific probes and protocols similar and
identical to 5' and 3' RACE. While the full length gene may be
present in the library and can be identified by probing, a useful
method for generating the 5' or 3' end is to use the existing
sequence information from the original cDNA to generate the missing
information. A method similar to 5' RACE is available for
generating the missing 5' end of a desired full-length gene. (This
method was published by Fromont-Racine et al., Nucleic Acids Res.,
21(7):1683-1684 (1993)). Briefly, a specific RNA oligonucleotide is
ligated to the 5' ends of a population of RNA presumably containing
full-length gene RNA transcript and a primer set containing a
primer specific to the ligated RNA oligonucleotide and a primer
specific to a known sequence of the gene of interest, is used to
PCR amplify the 5' portion of the desired full length gene which
may then be sequenced and used to generate the full length gene.
This method starts with total RNA isolated from the desired source,
poly A RNA may be used but is not a prerequisite for this
procedure. The RNA preparation may then be treated with phosphatase
if necessary to eliminate 5' phosphate groups on degraded or
damaged RNA which may interfere with the later RNA ligase step. The
phosphatase if used is then inactivated and the RNA is treated with
tobacco acid pyrophosphatase in order to remove the cap structure
present at the 5' ends of messenger RNAs. This reaction leaves a 5'
phosphate group at the 5' end of the cap cleaved RNA which can then
be ligated to an RNA oligonucleotide using T4 RNA ligase. This
modified RNA preparation can then be used as a template for first
strand cDNA synthesis using a gene specific oligonucleotide. The
first strand synthesis reaction can then be used as a template for
PCR amplification of the desired 5' end using a primer specific to
the ligated RNA oligonucleotide and a primer specific to the known
sequence of the gene of interest. The resultant product is then
sequenced and analyzed to confirm that the 5' end sequence belongs
to the relevant gene.
[0199] The present invention also relates to vectors or plasmids
which include such DNA sequences, as well as the use of the DNA
sequences. The material deposited with the ATCC (e.g., as described
in columns 2 and 3 of Table 1A, and/or as set forth in Table 1B,
Table 6, or Table 7) is a mixture of cDNA clones derived from a
variety of human tissue and cloned in either a plasmid vector or a
phage vector, as described, for example, in Table 1A and Table 7.
These deposits are referred to as "the deposits" herein. The
tissues from which some of the clones were derived are listed in
Table 7, and the vector in which the corresponding cDNA is
contained is also indicated in Table 7. The deposited material
includes cDNA clones corresponding to SEQ ID NO:X described, for
example, in Table 1A and/or 1B (ATCC Deposit No: Z). A clone which
is isolatable from the ATCC Deposits by use of a sequence listed as
SEQ ID NO:X, may include the entire coding region of a human gene
or in other cases such clone may include a substantial portion of
the coding region of a human gene. Furthermore, although the
sequence listing may in some instances list only a portion of the
DNA sequence in a clone included in the ATCC Deposits, it is well
within the ability of one skilled in the art to sequence the DNA
included in a clone contained in the ATCC Deposits by use of a
sequence (or portion thereof) described in, for example Tables 1A
and/or 1B or 2, by procedures hereinafter further described, and
others apparent to those skilled in the art.
[0200] Also provided in Table 1A and 7 is the name of the vector
which contains the cDNA clone. Each vector is routinely used in the
art. The following additional information is provided for
convenience.
[0201] Vectors Lambda Zap (U.S. Pat. Nos. 5,128,256 and 5,286,636),
Uni-Zap XR (U.S. Pat. Nos. 5,128,256 and 5,286,636), Zap Express
(U.S. Pat. Nos. 5,128,256 and 5,286,636), pBluescript (pBS) (Short,
J. M. et al., Nucleic Acids Res. 16:7583-7600 (1988); Alting-Mees,
M. A. and Short, J. M., Nucleic Acids Res. 17:9494 (1989)) and pBK
(Alting-Mees, M. A. et al., Strategies 5:58-61 (1992)) are
commercially available from Stratagene Cloning Systems, Inc., 11011
N. Torrey Pines Road, La Jolla, Calif., 92037. pBS contains an
ampicillin resistance gene and pBK contains a neomycin resistance
gene. Phagemid pBS may be excised from the Lambda Zap and Uni-Zap
XR vectors, and phagemid pBK may be excised from the Zap Express
vector. Both phagemids may be transformed into E. coli strain XL-1
Blue, also available from Stratagene.
[0202] Vectors pSport1, pCMVSport 1.0, pCMVSport 2.0 and pCMVSport
3.0, were obtained from Life Technologies, Inc., P.O. Box 6009,
Gaithersburg, Md. 20897. All Sport vectors contain an ampicillin
resistance gene and may be transformed into E. coli strain DH10B,
also available from Life Technologies. See, for instance, Gruber,
C. E., et al., Focus 15:59-(1993). Vector lafinid BA (Bento Soares,
Columbia University, New York, N.Y.) contains an ampicillin
resistance gene and can be transformed into E. coli strain XL-1
Blue. Vector pCR.RTM.2.1, which is available from Invitrogen, 1600
Faraday Avenue, Carlsbad, Calif. 92008, contains an ampicillin
resistance gene and may be transformed into E. coli strain DH10B,
available from Life Technologies. See, for instance, Clark, J. M.,
Nuc. Acids Res. 16:9677-9686 (1988) and Mead, D. et al.,
Bio/Technology 9: (1991).
[0203] The present invention also relates to the genes
corresponding to SEQ ID NO:X, SEQ ID NO:Y, and/or the deposited
clone (ATCC Deposit No: Z). The corresponding gene can be isolated
in accordance with known methods using the sequence information
disclosed herein. Such methods include preparing probes or primers
from the disclosed sequence and identifying or amplifying the
corresponding gene from appropriate sources of genomic
material.
[0204] Also provided in the present invention are allelic variants,
orthologs, and/or species homologs. Procedures known in the art can
be used to obtain full-length genes, allelic variants, splice
variants, full-length coding portions, orthologs, and/or species
homologs of genes corresponding to SEQ ID NO:X or the complement
thereof, polypeptides encoded by genes corresponding to SEQ ID NO:X
or the complement thereof, and/or the cDNA contained in ATCC
Deposit No: Z, using information from the sequences disclosed
herein or the clones deposited with the ATCC. For example, allelic
variants and/or species homologs may be isolated and identified by
making suitable probes or primers from the sequences provided
herein and screening a suitable nucleic acid source for allelic
variants and/or the desired homologue.
[0205] The polypeptides of the invention can be prepared in any
suitable manner. Such polypeptides include isolated naturally
occurring polypeptides, recombinantly produced polypeptides,
synthetically produced polypeptides, or polypeptides produced by a
combination of these methods. Means for preparing such polypeptides
are well understood in the art.
[0206] The polypeptides may be in the form of the secreted protein,
including the mature form, or may be a part of a larger protein,
such as a fusion protein (see below). It is often advantageous to
include an additional amino acid sequence which contains secretory
or leader sequences, pro-sequences, sequences which aid in
purification, such as multiple histidine residues, or an additional
sequence for stability during recombinant production.
[0207] The polypeptides of the present invention are preferably
provided in an isolated form, and preferably are substantially
purified. A recombinantly produced version of a polypeptide,
including the secreted polypeptide, can be substantially purified
using techniques described herein or otherwise known in the art,
such as, for example, by the one-step method described in Smith and
Johnson, Gene 67:31-40 (1988). Polypeptides of the invention also
can be purified from natural, synthetic or recombinant sources
using techniques described herein or otherwise known in the art,
such as, for example, antibodies of the invention raised against
the polypeptides of the present invention in methods which are well
known in the art.
[0208] The present invention provides a polynucleotide comprising,
or alternatively consisting of, the nucleic acid sequence of SEQ ID
NO:X, and/or the cDNA sequence contained in ATCC Deposit No: Z. The
present invention also provides a polypeptide comprising, or
alternatively, consisting of, the polypeptide sequence of SEQ ID
NO:Y, a polypeptide encoded by SEQ ID NO:X or a complement thereof,
a polypeptide encoded by the cDNA contained in ATCC Deposit No: Z,
and/or the polypeptide sequence encoded by a nucleotide sequence in
SEQ ID NO:B as defined in column 6 of Table 1C. Polynucleotides
encoding a polypeptide comprising, or alternatively consisting of
the polypeptide sequence of SEQ ID NO:Y, a polypeptide encoded by
SEQ ID NO:X, a polypeptide encoded by the cDNA contained in ATCC
Deposit No: Z, and/or a polypeptide sequence encoded by a
nucleotide sequence in SEQ ID NO:B as defined in column 6 of Table
1C are also encompassed by the invention. The present invention
further encompasses a polynucleotide comprising, or alternatively
consisting of, the complement of the nucleic acid sequence of SEQ
ID NO:X, a nucleic acid sequence encoding a polypeptide encoded by
the complement of the nucleic acid sequence of SEQ ID NO:X, and/or
the cDNA contained in ATCC Deposit No: Z.
[0209] Moreover, representative examples of polynucleotides of the
invention comprise, or alternatively consist of, one, two, three,
four, five, six, seven, eight, nine, ten, or more of the sequences
delineated in Table 1C column 6, or any combination thereof.
Additional, representative examples of polynucleotides of the
invention comprise, or alternatively consist of, one, two, three,
four, five, six, seven, eight, nine, ten, or more of the
complementary strand(s) of the sequences delineated in Table 1C
column 6, or any combination thereof. In further embodiments, the
above-described polynucleotides of the invention comprise, or
alternatively consist of, sequences delineated in Table 1C, column
6, and have a nucleic acid sequence which is different from that of
the BAC fragment having the sequence disclosed in SEQ ID NO:B (see
Table 1C, column 5). In additional embodiments, the above-described
polynucleotides of the invention comprise, or alternatively consist
of, sequences delineated in Table 1C, column 6, and have a nucleic
acid sequence which is different from that published for the BAC
clone identified as BAC ID NO:A (see Table 1C, column 4). In
additional embodiments, the above-described polynucleotides of the
invention comprise, or alternatively consist of, sequences
delineated in Table 1C, column 6, and have a nucleic acid sequence
which is different from that contained in the BAC clone identified
as BAC ID NO:A (see Table 1C, column 4). Polypeptides encoded by
these polynucleotides, other polynucleotides that encode these
polypeptides, and antibodies that bind these polypeptides are also
encompassed by the invention. Additionally, fragments and variants
of the above-described polynucleotides and polypeptides are also
encompassed by the invention.
[0210] Further, representative examples of polynucleotides of the
invention comprise, or alternatively consist of, one, two, three,
four, five, six, seven, eight, nine, ten, or more of the sequences
delineated in column 6 of Table 1C which correspond to the same
Clone ID (see Table 1C, column 1), or any combination thereof.
Additional, representative examples of polynucleotides of the
invention comprise, or alternatively consist of, one, two, three,
four, five, six, seven, eight, nine, ten, or more of the
complementary strand(s) of the sequences delineated in column 6 of
Table 1C which correspond to the same Clone ID (see Table 1C,
column 1), or any combination thereof. In further embodiments, the
above-described polynucleotides of the invention comprise, or
alternatively consist of, sequences delineated in column 6 of Table
1C which correspond to the same Clone ID (see Table 1C, column 1)
and have a nucleic acid sequence which is different from that of
the BAC fragment having the sequence disclosed in SEQ ID NO:B (see
Table 1C, column 5). In additional embodiments, the above-described
polynucleotides of the invention comprise, or alternatively consist
of, sequences delineated in column 6 of Table 1C which correspond
to the same Clone ID (see Table 1C, column 1) and have a nucleic
acid sequence which is different from that published for the BAC
clone identified as BAC ID NO:A (see Table 1C, column 4). In
additional embodiments, the above-described polynucleotides of the
invention comprise, or alternatively consist of, sequences
delineated in column 6 of Table 1C which correspond to the same
Clone ID (see Table 1C, column 1) and have a nucleic acid sequence
which is different from that contained in the BAC clone identified
as BAC ID NO:A (see Table 1C, column 4). Polypeptides encoded by
these polynucleotides, other polynucleotides that encode these
polypeptides, and antibodies that bind these polypeptides are also
encompassed by the invention. Additionally, fragments and variants
of the above-described polynucleotides and polypeptides are also
encompassed by the invention.
[0211] Further, representative examples of polynucleotides of the
invention comprise, or alternatively consist of, one, two, three,
four, five, six, seven, eight, nine, ten, or more of the sequences
delineated in column 6 of Table 1C which correspond to the same
contig sequence identifier SEQ ID NO:X (see Table 1C, column 2), or
any combination thereof. Additional, representative examples of
polynucleotides of the invention comprise, or alternatively consist
of, one, two, three, four, five, six, seven, eight, nine, ten, or
more of the complementary strand(s) of the sequences delineated in
column 6 of Table 1C which correspond to the same contig sequence
identifier SEQ ID NO:X (see Table 1C, column 2), or any combination
thereof. In further embodiments, the above-described
polynucleotides of the invention comprise, or alternatively consist
of, sequences delineated in column 6 of Table 1C which correspond
to the same contig sequence identifier SEQ ID NO:X (see Table 1C,
column 2) and have a nucleic acid sequence which is different from
that of the BAC fragment having the sequence disclosed in SEQ ID
NO:B (see Table 1C, column 5). In additional embodiments, the
above-described polynucleotides of the invention comprise, or
alternatively consist of, sequences delineated in column 6 of Table
1C which correspond to the same contig sequence identifier SEQ ID
NO:X (see Table 1C, column 2) and have a nucleic acid sequence
which is different from that published for the BAC clone identified
as BAC ID NO:A (see Table 1C, column 4). In additional embodiments,
the above-described polynucleotides of the invention comprise, or
alternatively consist of, sequences delineated in column 6 of Table
1C which correspond to the same contig sequence identifier SEQ ID
NO:X (see Table 1C, column 2) and have a nucleic acid sequence
which is different from that contained in the BAC clone identified
as BAC ID NO:A (See Table 1C, column 4). Polypeptides encoded by
these polynucleotides, other polynucleotides that encode these
polypeptides, and antibodies that bind these polypeptides are also
encompassed by the invention. Additionally, fragments and variants
of the above-described polynucleotides and polypeptides are also
encompassed by the invention.
[0212] Moreover, representative examples of polynucleotides of the
invention comprise, or alternatively consist of, one, two, three,
four, five, six, seven, eight, nine, ten, or more of the sequences
delineated in the same row of Table 1C column 6, or any combination
thereof. Additional, representative examples of polynucleotides of
the invention comprise, or alternatively consist of, one, two,
three, four, five, six, seven, eight, nine, ten, or more of the
complementary strand(s) of the sequences delineated in the same row
of Table 1C column 6, or any combination thereof. In preferred
embodiments, the polynucleotides of the invention comprise, or
alternatively consist of, one, two, three, four, five, six, seven,
eight, nine, ten, or more of the complementary strand(s) of the
sequences delineated in the same row of Table 1C column 6, wherein
sequentially delineated sequences in the table (i.e. corresponding
to those exons located closest to each other) are directly
contiguous in a 5' to 3' orientation. In further embodiments,
above-described polynucleotides of the invention comprise, or
alternatively consist of, sequences delineated in the same row of
Table 1C, column 6, and have a nucleic acid sequence which is
different from that of the BAC fragment having the sequence
disclosed in SEQ ID NO:B (see Table 1C, column 5). In additional
embodiments, the above-described polynucleotides of the invention
comprise, or alternatively consist of, sequences delineated in the
same row of Table 1C, column 6, and have a nucleic acid sequence
which is different from that published for the BAC clone identified
as BAC ID NO:A (see Table 1C, column 4). In additional embodiments,
the above-described polynucleotides of the invention comprise, or
alternatively consist of, sequences delineated in the same row of
Table 1C, column 6, and have a nucleic acid sequence which is
different from that contained in the BAC clone identified as BAC ID
NO:A (see Table 1C, column 4). Polypeptides encoded by these
polynucleotides, other polynucleotides that encode these
polypeptides, and antibodies that bind these polypeptides are also
encompassed by the invention.
[0213] In additional specific embodiments, polynucleotides of the
invention comprise, or alternatively consist of, one, two, three,
four, five, six, seven, eight, nine, ten, or more of the sequences
delineated in column 6 of Table 1C, and the polynucleotide sequence
of SEQ ID NO:X (e.g., as defined in Table 1C, column 2) or
fragments or variants thereof. Polypeptides encoded by these
polynucleotides, other polynucleotides that encode these
polypeptides, and antibodies that bind these polypeptides are also
encompassed by the invention.
[0214] In additional specific embodiments, polynucleotides of the
invention comprise, or alternatively consist of, one, two, three,
four, five, six, seven, eight, nine, ten, or more of the sequences
delineated in column 6 of Table 1C which correspond to the same
Clone ID (see Table 1C, column 1), and the polynucleotide sequence
of SEQ ID NO:X (e.g., as defined in Table 1A, 1B, or 1C) or
fragments or variants thereof. In preferred embodiments, the
delineated sequence(s) and polynucleotide sequence of SEQ ID NO:X
correspond to the same Clone ID. Polypeptides encoded by these
polynucleotides, other polynucleotides that encode these
polypeptides, and antibodies that bind these polypeptides are also
encompassed by the invention.
[0215] In further specific embodiments, polynucleotides of the
invention comprise, or alternatively consist of, one, two, three,
four, five, six, seven, eight, nine, ten, or more of the sequences
delineated in the same row of column 6 of Table 1C, and the
polynucleotide sequence of SEQ ID NO:X (e.g., as defined in Table
1A, 1B, or 1C) or fragments or variants thereof. In preferred
embodiments, the delineated sequence(s) and polynucleotide sequence
of SEQ ID NO:X correspond to the same row of column 6 of Table 1C.
Polypeptides encoded by these polynucleotides, other
polynucleotides that encode these polypeptides, and antibodies that
bind these polypeptides are also encompassed by the invention.
[0216] In additional specific embodiments, polynucleotides of the
invention comprise, or alternatively consist of a polynucleotide
sequence in which the 3' 10 polynucleotides of one of the sequences
delineated in column 6 of Table 1C and the 5' 10 polynucleotides of
the sequence of SEQ ID NO:X are directly contiguous. Nucleic acids
which hybridize to the complement of these 20 contiguous
polynucleotides under stringent hybridization conditions or
alternatively, under lower stringency conditions, are also
encompassed by the invention. Polypeptides encoded by these
polynucleotides and/or nucleic acids, other polynucleotides and/or
nucleic acids that encode these polypeptides, and antibodies that
bind these polypeptides are also encompassed by the invention.
Additionally, fragments and variants of the above-described
polynucleotides, nucleic acids, and polypeptides are also
encompassed by the invention.
[0217] In additional specific embodiments, polynucleotides of the
invention comprise, or alternatively consist of, a polynucleotide
sequence in which the 3' 10 polynucleotides of one of the sequences
delineated in column 6 of Table 1C and the 5' 10 polynucleotides of
a fragment or variant of the sequence of SEQ ID NO:X are directly
contiguous Nucleic acids which hybridize to the complement of these
20 contiguous polynucleotides under stringent hybridization
conditions or alternatively, under lower stringency conditions, are
also encompassed by the invention. Polypeptides encoded by these
polynucleotides and/or nucleic acids, other polynucleotides and/or
nucleic acids encoding these polypeptides, and antibodies that bind
these polypeptides are also encompassed by the invention.
Additionally, fragments and variants of the above-described
polynucleotides, nucleic acids, and polypeptides are also
encompassed by the invention.
[0218] In specific embodiments, polynucleotides of the invention
comprise, or alternatively consist of, a polynucleotide sequence in
which the 3' 10 polynucleotides of the sequence of SEQ ID NO:X and
the 5' 10 polynucleotides of the sequence of one of the sequences
delineated in column 6 of Table 1C are directly contiguous. Nucleic
acids which hybridize to the complement of these 20 contiguous
polynucleotides under stringent hybridization conditions or
alternatively, under lower stringency conditions, are also
encompassed by the invention. Polypeptides encoded by these
polynucleotides and/or nucleic acids, other polynucleotides and/or
nucleic acids encoding these polypeptides, and antibodies that bind
these polypeptides are also encompassed by the invention.
Additionally, fragments and variants of the above-described
polynucleotides, nucleic acids, and polypeptides are also
encompassed by the invention.
[0219] In specific embodiments, polynucleotides of the invention
comprise, or alternatively consist of, a polynucleotide sequence in
which the 3' 10 polynucleotides of a fragment or variant of the
sequence of SEQ ID NO:X and the 5' 10 polynucleotides of the
sequence of one of the sequences delineated in column 6 of Table 1C
are directly contiguous. Nucleic acids which hybridize to the
complement of these 20 contiguous polynucleotides under stringent
hybridization conditions or alternatively, under lower stringency
conditions, are also encompassed by the invention. Polypeptides
encoded by these polynucleotides and/or nucleic acids, other
polynucleotides and/or nucleic acids encoding these polypeptides,
and antibodies that bind these polypeptides are also encompassed by
the invention. Additionally, fragments and variants of the
above-described polynucleotides, nucleic acids, and polypeptides,
are also encompassed by the invention.
[0220] In further specific embodiments, polynucleotides of the
invention comprise, or alternatively consist of, a polynucleotide
sequence in which the 3' 10 polynucleotides of one of the sequences
delineated in column 6 of Table 1C and the 5' 10 polynucleotides of
another sequence in column 6 are directly contiguous. Nucleic acids
which hybridize to the complement of these 20 contiguous
polynucleotides under stringent hybridization conditions or
alternatively, under lower stringency conditions, are also
encompassed by the invention. Polypeptides encoded by these
polynucleotides and/or nucleic acids, other polynucleotides and/or
nucleic acids encoding these polypeptides, and antibodies that bind
these polypeptides are also encompassed by the invention.
Additionally, fragments and variants of the above-described
polynucleotides, nucleic acids, and polypeptides are also
encompassed by the invention.
[0221] In specific embodiments, polynucleotides of the invention
comprise, or alternatively consist of, a polynucleotide sequence in
which the 3' 10 polynucleotides of one of the sequences delineated
in column 6 of Table 1C and the 5' 10 polynucleotides of another
sequence in column 6 corresponding to the same Clone ID (see Table
1C, column 1) are directly contiguous. Nucleic acids which
hybridize to the complement of these 20 lower stringency
conditions, are also encompassed by the invention. Polypeptides
encoded by these polynucleotides and/or nucleic acids, other
polynucleotides and/or nucleic acids encoding these polypeptides,
and antibodies that bind these polypeptides are also encompassed by
the invention. Additionally, fragments and variants of the
above-described polynucleotides, nucleic acids, and polypeptides
are also encompassed by the invention.
[0222] In specific embodiments, polynucleotides of the invention
comprise, or alternatively consist of, a polynucleotide sequence in
which the 3' 10 polynucleotides of one sequence in column 6
corresponding to the same contig sequence identifier SEQ ID NO:X
(see Table 1C, column 2) are directly contiguous. Nucleic acids
which hybridize to the complement of these 20 contiguous
polynucleotides under stringent hybridization conditions or
alternatively, under lower stringency conditions, are also
encompassed by the invention. Polypeptides encoded by these
polynucleotides and/or nucleic acids, other polynucleotides and/or
nucleic acids encoding these polypeptides, and antibodies that bind
these polypeptides are also encompassed by the invention.
Additionally, fragments and variants of the above-described
polynucleotides, nucleic acids, and polypeptides are also
encompassed by the invention.
[0223] In specific embodiments, polynucleotides of the invention
comprise, or alternatively consist of a polynucleotide sequence in
which the 3' 10 polynucleotides of one of the sequences delineated
in column 6 of Table 1C and the 5' 10 polynucleotides of another
sequence in column 6 corresponding to the same row are directly
contiguous. In preferred embodiments, the 3' 10 polynucleotides of
one of the sequences delineated in column 6 of Table 1C is directly
contiguous with the 5' 10 polynucleotides of the next sequential
exon delineated in Table 1C, column 6. Nucleic acids which
hybridize to the complement of these 20 contiguous polynucleotides
under stringent hybridization conditions or alternatively, under
lower stringency conditions, are also encompassed by the invention.
Polypeptides encoded by these polynucleotides and/or nucleic acids,
other polynucleotides and/or nucleic acids encoding these
polypeptides, and antibodies that bind these polypeptides are also
encompassed by the invention. Additionally, fragments and variants
of the above-described polynucleotides, nucleic acids, and
polypeptides are also encompassed by the invention.
Table 3
[0224] Many polynucleotide sequences, such as EST sequences, are
publicly available and accessible through sequence databases and
may have been publicly available prior to conception of the present
invention. Preferably, such related polynucleotides are
specifically excluded from the scope of the present invention.
Accordingly, for each contig sequence (SEQ ID NO:X) listed in the
fifth column of Table 1A and/or the fourth column of Table 1B.1,
preferably excluded are one or more polynucleotides comprising a
nucleotide sequence described by the general formula of a-b, where
a is any integer between 1 and the final nucleotide minus 15 of SEQ
ID NO:X, b is an integer of 15 to the final nucleotide of SEQ ID
NO:X, where both a and b correspond to the positions of nucleotide
residues shown in SEQ ID NO:X, and where b is greater than or equal
to a +14. More specifically, preferably excluded are one or more
polynucleotides comprising a nucleotide sequence described by the
general formula of a-b, where a and b are integers as defined in
columns 4 and 5, respectively, of Table 3. In specific embodiments,
the polynucleotides of the invention do not consist of at least
one, two, three, four, five, ten, or more of the specific
polynucleotide sequences referenced by the Genbank Accession No. as
disclosed in column 6 of Table 3 (including for example, published
sequence in connection with a particular BAC clone). In further
embodiments, preferably excluded from the invention are the
specific polynucleotide sequence(s) contained in the clones
corresponding to at least one, two, three, four, five, ten, or more
of the available material having the accession numbers identified
in the sixth column of this Table (including for example, the
actual sequence contained in an identified BAC clone). In no way is
this listing meant to encompass all of the sequences which may be
excluded by the general formula, it is just a representative
example. All references available through these accessions are
hereby incorporated by reference in their entirety. TABLE-US-00009
LENGTHY TABLE REFERENCED HERE US20070048297A1-20070301-T00006
Please refer to the end of the specification for access
instructions.
Description of Table 4
[0225] Table 4 provides a key to the tissue/cell source identifier
code disclosed in Table 1B.2, column 5. Column 1 of Table 4
provides the tissue/cell source identifier code disclosed in Table
1B.2, Column 5. Columns 2-5 provide a description of the tissue or
cell source. Note that "Description" and "Tissue" sources (i.e.
columns 2 and 3) having the prefix "a_" indicates organs, tissues,
or cells derived from "adult" sources. Codes corresponding to
diseased tissues are indicated in column 6 with the word "disease."
The use of the word "disease" in column 6 is non-limiting. The
tissue or cell source may be specific (e.g. a neoplasm), or may be
disease-associated (e.g., a tissue sample from a normal portion of
a diseased organ). Furthermore, tissues and/or cells lacking the
"disease" designation may still be derived from sources directly or
indirectly involved in a disease state or disorder, and therefore
may have a further utility in that disease state or disorder. In
numerous cases where the tissue/cell source is a library, column 7
identifies the vector used to generate the library. TABLE-US-00010
TABLE 4 Code Description Tissue Organ Cell Line Disease Vector
AR022 a_Heart a_Heart AR023 a_Liver a_Liver AR024 a_mammary gland
a_mammary gland AR025 a_Prostate a_Prostate AR026 a_small intestine
a_small intestine AR027 a_Stomach a_Stomach AR028 Blood B cells
Blood B cells AR029 Blood B cells activated Blood B cells activated
AR030 Blood B cells resting Blood B cells resting AR031 Blood T
cells activated Blood T cells activated AR032 Blood T cells resting
Blood T cells resting AR033 brain brain AR034 breast breast AR035
breast cancer breast cancer AR036 Cell Line CAOV3 Cell Line CAOV3
AR037 cell line PA-1 cell line PA-1 AR038 cell line transformed
cell line transformed AR039 colon colon AR040 colon (9808co65R)
colon (9808co65R) AR041 colon (9809co15) colon (9809co15) AR042
colon cancer colon cancer AR043 colon cancer (9808co64R) colon
cancer (9808co64R) AR044 colon cancer 9809co14 colon cancer
9809co14 AR050 Donor II B Cells 24 hrs Donor II B Cells 24 hrs
AR051 Donor II B Cells 72 hrs Donor II B Cells 72 hrs AR052 Donor
II B-Cells 24 hrs. Donor II B-Cells 24 hrs. AR053 Donor II B-Cells
72 hrs Donor II B-Cells 72 hrs AR054 Donor II Resting B Cells Donor
II Resting B Cells AR055 Heart Heart AR056 Human Lung (clonetech)
Human Lung (clonetech) AR057 Human Mammary (clontech) Human Mammary
(clontech) AR058 Human Thymus (clonetech) Human Thymus (clonetech)
AR059 Jurkat (unstimulated) Jurkat (unstimulated) AR060 Kidney
Kidney AR061 Liver Liver AR062 Liver (Clontech) Liver (Clontech)
AR063 Lymphocytes chronic lymphocytic leukaemia Lymphocytes chronic
lymphocytic leukaemia AR064 Lymphocytes diffuse large B cell
lymphoma Lymphocytes diffuse large B cell lymphoma AR065
Lymphocytes follicular lymphoma Lymphocytes follicular lymphoma
AR066 normal breast normal breast AR067 Normal Ovarian (4004901)
Normal Ovarian (4004901) AR068 Normal Ovary 9508G045 Normal Ovary
9508G045 AR069 Normal Ovary 9701G208 Normal Ovary 9701G208 AR070
Normal Ovary 9806G005 Normal Ovary 9806G005 AR071 Ovarian Cancer
Ovarian Cancer AR072 Ovarian Cancer (9702G001) Ovarian Cancer
(9702G001) AR073 Ovarian Cancer (9707G029) Ovarian Cancer
(9707G029) AR074 Ovarian Cancer (9804G011) Ovarian Cancer
(9804G011) AR075 Ovarian Cancer (9806G019) Ovarian Cancer
(9806G019) AR076 Ovarian Cancer (9807G017) Ovarian Cancer
(9807G017) AR077 Ovarian Cancer (9809G001) Ovarian Cancer
(9809G001) AR078 ovarian cancer 15799 ovarian cancer 15799 AR079
Ovarian Cancer 17717AID Ovarian Cancer 17717AID AR080 Ovarian
Cancer 4004664B1 Ovarian Cancer 4004664B1 AR081 Ovarian Cancer
4005315A1 Ovarian Cancer 4005315A1 AR082 ovarian cancer 94127303
ovarian cancer 94127303 AR083 Ovarian Cancer 96069304 Ovarian
Cancer 96069304 AR084 Ovarian Cancer 9707G029 Ovarian Cancer
9707G029 AR085 Ovarian Cancer 9807G045 Ovarian Cancer 9807G045
AR086 ovarian cancer 9809G001 ovarian cancer 9809G001 AR087 Ovarian
Cancer 9905C032RC Ovarian Cancer 9905C032RC AR088 Ovarian cancer
9907 C00 3rd Ovarian cancer 9907 C00 3rd AR089 Prostate Prostate
AR090 Prostate (clonetech) Prostate (clonetech) AR091 prostate
cancer prostate cancer AR092 prostate cancer #15176 prostate cancer
#15176 AR093 prostate cancer #15509 prostate cancer #15509 AR094
prostate cancer #15673 prostate cancer #15673 AR095 Small Intestine
(Clontech) Small Intestine (Clontech) AR096 Spleen Spleen AR097
Thymus T cells activated Thymus T cells activated AR098 Thymus T
cells resting Thymus T cells resting AR099 Tonsil Tonsil AR100
Tonsil geminal center centroblast Tonsil geminal center centroblast
AR101 Tonsil germinal center B cell Tonsil germinal center B cell
AR102 Tonsil lymph node Tonsil lymph node AR103 Tonsil memory B
cell Tonsil memory B cell AR104 Whole Brain Whole Brain AR105
Xenograft ES-2 Xenograft ES-2 AR106 Xenograft SW626 Xenograft SW626
AR119 001: IL-2 001: IL-2 AR120 001: IL-2.1 001: IL-2.1 AR121 001:
IL-2_b 001: IL-2_b AR124 002: Monocytes untreated (1 hr) 002:
Monocytes untreated (1 hr) AR125 002: Monocytes untreated (5 hrs)
002: Monocytes untreated (5 hrs) AR126 002: Control.1C 002:
Control.1C AR127 002: IL2.1C 002: IL2.1C AR130 003: Placebo-treated
Rat Lacrimal Gland 003: Placebo-treated Rat Lacrimal Gland AR131
003: Placebo-treated Rat Submandibular 003: Placebo-treated Rat
Gland Submandibular Gland AR135 004: Monocytes untreated (5 hrs)
004: Monocytes untreated (5 hrs) AR136 004: Monocytes untreated 1
hr 004: Monocytes untreated 1 hr AR139 005: Placebo (48 hrs) 005:
Placebo (48 hrs) AR140 006: pC4 (24 hrs) 006: pC4 (24 hrs) AR141
006: pC4 (48 hrs) 006: pC4 (48 hrs) AR152 007: PHA(1 hr) 007: PHA(1
hr) AR153 007: PHA(6 HRS) 007: PHA(6 HRS) AR154 007: PMA(6 hrs)
007: PMA(6 hrs) AR155 008: 1449_#2 008: 1449_#2 AR161 01: A - max
24 01: A - max 24 AR162 01: A - max 26 01: A - max 26 AR163 01: A -
max 30 01: A - max 30 AR164 01: B - max 24 01: B - max 24 AR165 01:
B - max 26 01: B - max 26 AR166 01: B - max 30 01: B - max 30 AR167
1449 Sample 1449 Sample AR168 3T3P10 1.0 uM insulin 3T3P10 1.0 uM
insulin AR169 3T3P10 10 nM Insulin 3T3P10 10 nM Insulin AR170
3T3P10 10 uM insulin 3T3P10 10 uM insulin AR171 3T3P10 No Insulin
3T3P10 No Insulin AR172 3T3P4 3T3P4 AR173 Adipose (41892) Adipose
(41892) AR174 Adipose Diabetic (41611) Adipose Diabetic (41611)
AR175 Adipose Diabetic (41661) Adipose Diabetic (41661) AR176
Adipose Diabetic (41689) Adipose Diabetic (41689) AR177 Adipose
Diabetic (41706) Adipose Diabetic (41706) AR178 Adipose Diabetic
(42352) Adipose Diabetic (42352) AR179 Adipose Diabetic (42366)
Adipose Diabetic (42366) AR180 Adipose Diabetic (42452) Adipose
Diabetic (42452) AR181 Adipose Diabetic (42491) Adipose Diabetic
(42491) AR182 Adipose Normal (41843) Adipose Normal (41843) AR183
Adipose Normal (41893) Adipose Normal (41893) AR184 Adipose Normal
(42452) Adipose Normal (42452) AR185 Adrenal Gland Adrenal Gland
AR186 Adrenal Gland + Whole Brain Adrenal Gland + Whole Brain AR187
B7(1 hr) + (inverted) B7(1 hr) + (inverted) AR188 Breast (18275A2B)
Breast (18275A2B) AR189 Breast (4004199) Breast (4004199) AR190
Breast (4004399) Breast (4004399) AR191 Breast (4004943B7) Breast
(4004943B7) AR192 Breast (4005570B1) Breast (4005570B1) AR193
Breast Cancer (4004127A30) Breast Cancer (4004127A30) AR194 Breast
Cancer (400443A21) Breast Cancer (400443A21) AR195 Breast Cancer
(4004643A2) Breast Cancer (4004643A2) AR196 Breast Cancer
(4004710A7) Breast Cancer (4004710A7) AR197 Breast Cancer
(4004943A21) Breast Cancer (4004943A21) AR198 Breast Cancer
(400553A2) Breast Cancer (400553A2) AR199 Breast Cancer (9805C046R)
Breast Cancer (9805C046R) AR200 Breast Cancer (9806C012R) Breast
Cancer (9806C012R) AR201 Breast Cancer (ODQ 45913) Breast Cancer
(ODQ 45913) AR202 Breast Cancer (ODQ45913) Breast Cancer (ODQ45913)
AR203 Breast Cancer (ODQ4591B) Breast Cancer (ODQ4591B) AR204 Colon
Cancer (15663) Colon Cancer (15663) AR205 Colon Cancer (4005144A4)
Colon Cancer (4005144A4) AR206 Colon Cancer (4005413A4) Colon
Cancer (4005413A4) AR207 Colon Cancer (4005570B1) Colon Cancer
(4005570B1) AR208 Control RNA #1 Control RNA #1 AR209 Control RNA
#2 Control RNA #2 AR210 Cultured Preadipocyte (blue) Cultured
Preadipocyte (blue) AR211 Cultured Preadipocyte (Red) Cultured
Preadipocyte (Red) AR212 Donor II B-Cells 24 hrs Donor II B-Cells
24 hrs AR213 Donor II Resting B-Cells Donor II Resting B-Cells
AR214 H114EP12 10 nM Insulin H114EP12 10 nM Insulin AR215 H114EP12
(10 nM insulin) H114EP12 (10 nM insulin) AR216 H114EP12 (2.6 ug/ul)
H114EP12 (2.6 ug/ul) AR217 H114EP12 (3.6 ug/ul) H114EP12 (3.6
ug/ul) AR218 HUVEC #1 HUVEC #1 AR219 HUVEC #2 HUVEC #2 AR221 L6
undiff. L6 undiff. AR222 L6 Undifferentiated L6 Undifferentiated
AR223 L6P8 + 10 nM Insulin L6P8 + 10 nM Insulin AR224 L6P8 + HS
L6P8 + HS AR225 L6P8 10 nM Insulin L6P8 10 nM Insulin AR226 Liver
(00-06-A007B) Liver (00-06-A007B) AR227 Liver (96-02-A075) Liver
(96-02-A075) AR228 Liver (96-03-A144) Liver (96-03-A144) AR229
Liver (96-04-A138) Liver (96-04-A138) AR230 Liver (97-10-A074B)
Liver (97-10-A074B) AR231 Liver (98-09-A242A) Liver (98-09-A242A)
AR232 Liver Diabetic (1042) Liver Diabetic (1042) AR233 Liver
Diabetic (41616) Liver Diabetic (41616) AR234 Liver Diabetic
(41955) Liver Diabetic (41955) AR235 Liver Diabetic (42352R) Liver
Diabetic (42352R) AR236 Liver Diabetic (42366) Liver Diabetic
(42366) AR237 Liver Diabetic (42483) Liver Diabetic (42483) AR238
Liver Diabetic (42491) Liver Diabetic (42491) AR239 Liver Diabetic
(99-09-A281A) Liver Diabetic (99-09- A281A) AR240 Lung Lung AR241
Lung (27270) Lung (27270) AR242 Lung (2727Q) Lung (2727Q) AR243
Lung Cancer (4005116A1) Lung Cancer (4005116A1) AR244 Lung Cancer
(4005121A5) Lung Cancer (4005121A5) AR245 Lung Cancer (4005121A5))
Lung Cancer (4005121A5)) AR246 Lung Cancer (4005340A4) Lung Cancer
(4005340A4) AR247 Mammary Gland Mammary Gland AR248 Monocyte (CT)
Monocyte (CT) AR249 Monocyte (OCT) Monocyte (OCT) AR250 Monocytes
(CT) Monocytes (CT) AR251 Monocytes (INFG 18 hr) Monocytes (INFG 18
hr) AR252 Monocytes (INFG 18 hr) Monocytes (INFG 18 hr) AR253
Monocytes (INFG 8-11) Monocytes (INFG 8-11) AR254 Monocytes (OCT)
Monocytes (OCT) AR255 Muscle (91-01-A105) Muscle (91-01-A105) AR256
Muscle (92-04-A059) Muscle (92-04-A059) AR257 Muscle (97-11-A056d)
Muscle (97-11-A056d) AR258 Muscle (99-06-A210A) Muscle
(99-06-A210A) AR259 Muscle (99-07-A203B) Muscle (99-07-A203B) AR260
Muscle (99-7-A203B) Muscle (99-7-A203B) AR261 Muscle Diabetic
(42352R) Muscle Diabetic (42352R) AR262 Muscle Diabetic (42366)
Muscle Diabetic (42366) AR263 NK-19 Control NK-19 Control AR264
NK-19 IL Treated 72 hrs NK-19 IL Treated 72 hrs AR265 NK-19 UK
Treated 72 hrs. NK-19 UK Treated 72 hrs. AR266 Omentum Normal
(94-08-B009) Omentum Normal (94-08- B009) AR267 Omentum Normal
(97-01-A039A) Omentum Normal (97-01- A039A) AR268 Omentum Normal
(97-04-A114C) Omentum Normal (97-04- A114C) AR269 Omentum Normal
(97-06-A117C) Omentum Normal (97-06- A117C) AR270 Omentum Normal
(97-09-B004C) Omentum Normal (97-09- B004C) AR271 Ovarian Cancer
(17717AID) Ovarian Cancer (17717AID) AR272 Ovarian Cancer
(9905C023RC) Ovarian Cancer (9905C023RC) AR273 Ovarian Cancer
(9905C032RC) Ovarian Cancer
(9905C032RC) AR274 Ovary (9508G045) Ovary (9508G045) AR275 Ovary
(9701G208) Ovary (9701G208) AR276 Ovary 9806G005 Ovary 9806G005
AR277 Pancreas Pancreas AR278 Placebo Placebo AR279 rIL2 Control
rIL2 Control AR280 RSS288L RSS288L AR281 RSS288LC RSS288LC AR282
Salivary Gland Salivary Gland AR283 Skeletal Muscle Skeletal Muscle
AR284 Skeletal Muscle (91-01-A105) Skeletal Muscle (91-01- A105)
AR285 Skeletal Muscle (42180) Skeletal Muscle (42180) AR286
Skeletal Muscle (42386) Skeletal Muscle (42386) AR287 Skeletal
Muscle (42461) Skeletal Muscle (42461) AR288 Skeletal Muscle
(91-01-A105) Skeletal Muscle (91-01- A105) AR289 Skeletal Muscle
(92-04-A059) Skeletal Muscle (92-04- A059) AR290 Skeletal Muscle
(96-08-A171) Skeletal Muscle (96-08- A171) AR291 Skeletal Muscle
(97-07-A190A) Skeletal Muscle (97-07- A190A) AR292 Skeletal Muscle
Diabetic (42352) Skeletal Muscle Diabetic (42352) AR293 Skeletal
Muscle Diabetic (42366) Skeletal Muscle Diabetic (42366) AR294
Skeletal Muscle Diabetic (42395) Skeletal Muscle Diabetic (42395)
AR295 Skeletal Muscle Diabetic (42483) Skeletal Muscle Diabetic
(42483) AR296 Skeletal Muscle Diabetic (42491) Skeletal Muscle
Diabetic (42491) AR297 Skeletal Muscle Diabetic 42352 Skeletal
Muscle Diabetic 42352 AR298 Skeletal Musle (42461) Skeletal Musle
(42461) AR299 Small Intestine Small Intestine AR300 Stomach Stomach
AR301 T-Cell + HDPBQ71.fc 1449 16 hrs T-Cell + HDPBQ71.fc 1449 16
hrs AR302 T-Cell + HDPBQ71.fc 1449 6 hrs T-Cell + HDPBQ71.fc 1449 6
hrs AR303 T-Cell + IL2 16 hrs T-Cell + IL2 16 hrs AR304 T-Cell +
IL2 6 hrs T-Cell + IL2 6 hrs AR306 T-Cell Untreated 16 hrs T-Cell
Untreated 16 hrs AR307 T-Cell Untreated 6 hrs T-Cell Untreated 6
hrs AR308 T-Cells 24 hours T-Cells 24 hours AR309 T-Cells 24 hrs
T-Cells 24 hrs AR310 T-Cells 24 hrs. T-Cells 24 hrs. AR311 T-Cells
24 hrs T-Cells 24 hrs AR312 T-Cells 4 days T-Cells 4 days AR313
Thymus Thymus AR314 TRE TRE AR315 TREC TREC AR316 Virtual Mixture
Virtual Mixture AR317 B lymphocyte, B lymphocyte, AR318 (non-T;
non-B) (non-T; non-B) AR326 001-293 RNA (Vector Control) 001-293
RNA (Vector Control) AR327 001: Control 001: Control AR328 001:
Control.1 001: Control.1 AR355 Acute Lymphocyte Leukemia Acute
Lymphocyte Leukemia AR356 AML Patient #11 AML Patient #11 AR357 AML
Patient #2 AML Patient #2 AR358 AML Patient #2 SGAH AML Patient #2
SGAH AR359 AML Patient#2 AML Patient#2 AR360 Aorta Aorta AR361 B
Cell B Cell AR362 B lymphoblast B lymphoblast AR363 B lymphocyte B
lymphocyte AR364 B lymphocytes B lymphocytes AR365 B-cell B-cell
AR366 B-Cells B-Cells AR367 B-Lymphoblast B-Lymphoblast AR368
B-Lymphocytes B-Lymphocytes AR369 Bladder Bladder AR370 Bone Marrow
Bone Marrow AR371 Bronchial Epithelial Cell Bronchial Epithelial
Cell AR372 Bronchial Epithelial Cells Bronchial Epithelial Cells
AR373 Caco-2A Caco-2A AR374 Caco-2B Caco-2B AR375 Caco-2C Caco-2C
AR376 Cardiac #1 Cardiac #1 AR377 Cardiac #2 Cardiac #2 AR378 Chest
Muscle Chest Muscle AR381 Dendritic Cell Dendritic Cell AR382
Dendritic cells Dendritic cells AR383 E. coli E. coli AR384
Epithelial Cells Epithelial Cells AR385 Esophagus Esophagus AR386
FPPS FPPS AR387 FPPSC FPPSC AR388 HepG2 Cell Line HepG2 Cell Line
AR389 HepG2 Cell line Buffer 1 hr. HepG2 Cell line Buffer 1 hr.
AR390 HepG2 Cell line Buffer 06 hr HepG2 Cell line Buffer 06 hr
AR391 HepG2 Cell line Buffer 24 hr. HepG2 Cell line Buffer 24 hr.
AR392 HepG2 Cell line Insulin 01 hr. HepG2 Cell line Insulin 01 hr.
AR393 HepG2 Cell line Insulin 06 hr. HepG2 Cell line Insulin 06 hr.
AR394 HepG2 Cell line Insulin 24 hr. HepG2 Cell line insulin 24 hr.
AR398 HMC-1 HMC-1 AR399 HMCS HMCS AR400 HMSC HMSC AR401 HUVEC #3
HUVEC #3 AR402 HUVEC #4 HUVEC #4 AR404 KIDNEY NORMAL KIDNEY NORMAL
AR405 KIDNEY TUMOR KIDNEY TUMOR AR406 KIDNEY TUMOR AR407 Lymph Node
Lymph Node AR408 Macrophage Macrophage AR409 Megakarioblast
Megakarioblast AR410 Monocyte Monocyte AR411 Monocytes Monocytes
AR412 Myocardium Myocardium AR413 Myocardium #3 Myocardium #3 AR414
Myocardium #4 Myocardium #4 AR415 Myocardium #5 Myocardium #5 AR416
NK NK AR417 NK cell NK cell AR418 NK cells NK cells AR419 NKYa NKYa
AR420 NKYa019 NKYa019 AR421 Ovary Ovary AR422 Patient #11 Patient
#11 AR423 Peripheral blood Peripheral blood AR424 Primary
Adipocytes Primary Adipocytes AR425 Promyeloblast Promyeloblast
AR427 RSSWT RSSWT AR428 RSSWTC RSSWTC AR429 SW 480(G1) SW 480(G1)
AR430 SW 480(G2) SW 480(G2) AR431 SW 480(G3) SW 480(G3) AR432 SW
480(G4) SW 480(G4) AR433 SW 480(G5) SW 480(G5) AR434 T Lymphoblast
T Lymphoblast AR435 T Lymphocyte T Lymphocyte AR436 T-Cell T-Cell
AR438 T-Cell, T-Cell, AR439 T-Cells T-Cells AR440 T-lymphoblast
T-lymphoblast AR441 Th 1 Th 1 AR442 Th 2 Th 2 AR443 Th1 Th1 AR444
Th2 Th2 H0002 Human Adult Heart Human Adult Heart Heart Uni-ZAP XR
H0003 Human Adult Liver Human Adult Liver Liver Uni-ZAP XR H0004
Human Adult Spleen Human Adult Spleen Spleen Uni-ZAP XR H0007 Human
Cerebellum Human Cerebellum Brain Uni-ZAP XR H0008 Whole 6 Week Old
Embryo Uni-ZAP XR H0009 Human Fetal Brain Uni-ZAP XR H0010 Human
Fetal Hepatic Human Fetal Liver Liver Uni-ZAP XR H0011 Human Fetal
Kidney Human Fetal Kidney Kidney Uni-ZAP XR H0012 Human Fetal
Kidney Human Fetal Kidney Kidney Uni-ZAP XR H0013 Human 8 Week
Whole Embryo Human 8 Week Old Embryo Embryo Uni-ZAP XR H0014 Human
Gall Bladder Human Gall Bladder Gall Bladder Uni-ZAP XR H0015 Human
Gall Bladder, fraction II Human Gall Bladder Gall Bladder Uni-ZAP
XR H0018 Human Greater Omentum, fII remake Human Greater Omentum
peritoneum Uni-ZAP XR H0019 Human Fetal Heart Human Fetal Heart
Heart pBluescript H0020 Human Hippocampus Human Hippocampus Brain
Uni-ZAP XR H0021 Human Infant Adrenal Gland Human Infant Adrenal
Gland Adrenal gland Uni-ZAP XR H0022 Jurkat Cells Jurkat T-Cell
Line Lambda ZAP II H0023 Human Fetal Lung Uni-ZAP XR H0024 Human
Fetal Lung III Human Fetal Lung Lung Uni-ZAP XR H0025 Human Adult
Lymph Node Human Adult Lymph Node Lymph Node Lambda ZAP II H0026
Namalwa Cells Namalwa B-Cell Line, EBV Lambda ZAP II immortalized
H0028 Human Old Ovary Human Old Ovary Ovary pBluescript H0029 Human
Pancreas Human Pancreas Pancreas Uni-ZAP XR H0030 Human Placenta
Uni-ZAP XR H0031 Human Placenta Human Placenta Placenta Uni-ZAP XR
H0032 Human Prostate Human Prostate Prostate Uni-ZAP XR H0033 Human
Pituitary Human Pituitary Uni-ZAP XR H0035 Human Salivary Gland
Human Salivary Gland Salivary gland Uni-ZAP XR H0036 Human Adult
Small Intestine Human Adult Small Intestine Small Int. Uni-ZAP XR
H0037 Human Adult Small Intestine Human Adult Small Intestine Small
Int. pBluescript H0038 Human Testes Human Testes Testis Uni-ZAP XR
H0039 Human Pancreas Tumor Human Pancreas Tumor Pancreas disease
Uni-ZAP XR H0040 Human Testes Tumor Human Testes Tumor Testis
disease Uni-ZAP XR H0041 Human Fetal Bone Human Fetal Bone Bone
Uni-ZAP XR H0042 Human Adult Pulmonary Human Adult Pulmonary Lung
Uni-ZAP XR H0044 Human Cornea Human Cornea eye Uni-ZAP XR H0045
Human Esophagus, Cancer Human Esophagus, cancer Esophagus disease
Uni-ZAP XR H0046 Human Endometrial Tumor Human Endometrial Tumor
Uterus disease Uni-ZAP XR H0047 Human Fetal Liver Human Fetal Liver
Liver Uni-ZAP XR H0048 Human Pineal Gland Human Pineal Gland
Uni-ZAP XR H0049 Human Fetal Kidney Human Fetal Kidney Kidney
Uni-ZAP XR H0050 Human Fetal Heart Human Fetal Heart Heart Uni-ZAP
XR H0051 Human Hippocampus Human Hippocampus Brain Uni-ZAP XR H0052
Human Cerebellum Human Cerebellum Brain Uni-ZAP XR H0053 Human
Adult Kidney Human Adult Kidney Kidney Uni-ZAP XR H0056 Human
Umbilical Vein, Endo. remake Human Umbilical Vein Umbilical vein
Uni-ZAP XR Endothelial Cells H0057 Human Fetal Spleen Uni-ZAP XR
H0058 Human Thymus Tumor Human Thymus Tumor Thymus disease Lambda
ZAP II H0059 Human Uterine Cancer Human Uterine Cancer Uterus
disease Lambda ZAP II H0060 Human Macrophage Human Macrophage Blood
Cell Line pBluescript H0061 Human Macrophage Human Macrophage Blood
Cell Line pBluescript H0062 Human Thymus Human Thymus Thymus
Uni-ZAP XR H0063 Human Thymus Human Thymus Thymus Uni-ZAP XR H0064
Human Right Hemisphere of Brain Human Brain, right Brain Uni-ZAP XR
hemisphere H0067 Human left hemisphere, adult Human Left
Hemisphere, Brain Lambda ZAP II Adult H0068 Human Skin Tumor Human
Skin Tumor Skin disease Uni-ZAP XR H0069 Human Activated T-Cells
Activated T-Cells Blood Cell Line Uni-ZAP XR H0070 Human Pancreas
Human Pancreas Pancreas Uni-ZAP XR H0071 Human Infant Adrenal Gland
Human Infant Adrenal Gland Adrenal gland Uni-ZAP XR H0073 Human
Leiomyeloid Carcinoma Human Leiomyeloid Muscle disease Uni-ZAP XR
Carcinoma H0074 Human Platelets Human Platelets Blood Cell Line
Uni-ZAP XR H0075 Human Activated T-Cells (II) Activated T-Cells
Blood Cell Line Uni-ZAP XR H0077 Human Thymus Tumor Human Thymus
Tumor Thymus disease Lambda ZAP II H0078 Human Lung Cancer Human
Lung Cancer Lung disease Lambda ZAP II H0079 Human Whole 7 Week Old
Embryo (II) Human Whole 7 Week Old Embryo Uni-ZAP XR Embryo H0080
Human Whole 6 Week Old Embryo (II) Human Whole Six Week Old Embryo
Lambda ZAP II Embryo H0081 Human Fetal Epithelium (Skin) Human
Fetal Skin Skin Uni-ZAP XR H0082 Human Fetal Muscle Human Fetal
Muscle Sk Muscle Uni-ZAP XR H0083 HUMAN JURKAT MEMBRANE BOUND
Jurkat Cells Uni-ZAP XR POLYSOMES H0085 Human Colon Human Colon
Lambda ZAP II H0086 Human epithelioid sarcoma Epithelioid Sarcoma,
muscle Sk Muscle disease Uni-ZAP XR H0087 Human Thymus Human Thymus
pBluescript H0090 Human T-Cell Lymphoma T-Cell Lymphoma T-Cell
disease Uni-ZAP XR H0092 Human Pancreas Tumor Human Pancreas Tumor
Pancreas disease Uni-ZAP XR H0093 Human Greater Omentum Tumor Human
Greater Omentum peritoneum
disease Uni-ZAP XR H0095 Human Greater Omentum, RNA Remake Human
Greater Omentum peritoneum Uni-ZAP XR H0097 Human Adult Heart,
subtracted Human Adult Heart Heart pBluescript H0098 Human Adult
Liver, subtracted Human Adult Liver Liver Uni-ZAP XR H0099 Human
Lung Cancer, subtracted Human Lung Cancer Lung pBluescript H0100
Human Whole Six Week Old Embryo Human Whole Six Week Old Embryo
Uni-ZAP XR Embryo H0101 Human 7 Weeks Old Embryo, subtracted Human
Whole 7 Week Old Embryo Lambda ZAP II Embryo H0102 Human Whole 6
Week Old Embryo (II), subt Human Whole Six Week Old Embryo
pBluescript Embryo H0103 Human Fetal Brain, subtracted Human Fetal
Brain Brain Uni-ZAP XR H0105 Human Fetal Heart, subtracted Human
Fetal Heart Heart pBluescript H0107 Human Infant Adrenal Gland,
subtracted Human Infant Adrenal Gland Adrenal gland pBluescript
H0108 Human Adult Lymph Node, subtracted Human Adult Lymph Node
Lymph Node Uni-ZAP XR H0109 Human Macrophage, subtracted Macrophage
Blood Cell Line pBluescript H0110 Human Old Ovary, subtracted Human
Old Ovary Ovary pBluescript H0111 Human Placenta, subtracted Human
Placenta Placenta pBluescript H0113 Human skin Tumor, subtracted
Human Skin Tumor Skin Uni-ZAP XR H0116 Human Thymus Tumor,
subtracted Human Thymus Tumor Thymus pBluescript H0117 Human
Uterine Cancer, subtracted Human Uterine Cancer Uterus pBluescript
H0119 Human Pediatric Kidney Human Pediatric Kidney Kidney Uni-ZAP
XR H0120 Human Adult Spleen, subtracted Human Adult Spleen Spleen
Uni-ZAP XR H0121 Human Cornea, subtracted Human Cornea eye Uni-ZAP
XR H0122 Human Adult Skeletal Muscle Human Skeletal Muscle Sk
Muscle Uni-ZAP XR H0123 Human Fetal Dura Mater Human Fetal Dura
Mater Brain Uni-ZAP XR H0124 Human Rhabdomyosarcoma Human
Rhabdomyosarcoma Sk Muscle disease Uni-ZAP XR H0125 Cem cells
cyclohexamide treated Cyclohexamide Treated Blood Cell Line Uni-ZAP
XR Cem, Jurkat, Raji, and Supt H0128 Jurkat cells, thiouridine
activated Jurkat Cells Uni-ZAP XR H0129 Jurkat cells, thiouridine
activated, fract II Jurkat Cells Uni-ZAP XR H0130 LNCAP untreated
LNCAP Cell Line Prostate Cell Line Uni-ZAP XR H0131 LNCAP + o.3 nM
R1881 LNCAP Cell Line Prostate Cell Line Uni-ZAP XR H0132 LNCAP +
30 nM R1881 LNCAP Cell Line Prostate Cell Line Uni-ZAP XR H0134
Raji Cells, cyclohexamide treated Cyclohexamide Treated Blood Cell
Line Uni-ZAP XR Cem, Jurkat, Raji, and Supt H0135 Human Synovial
Sarcoma Human Synovial Sarcoma Synovium Uni-ZAP XR H0136 Supt
Cells, cyclohexamide treated Cyclohexamide Treated Blood Cell Line
Uni-ZAP XR Cem, Jurkat, Raji, and Supt H0140 Activated T-Cells, 8
hrs. Activated T-Cells Blood Cell Line Uni-ZAP XR H0141 Activated
T-Cells, 12 hrs. Activated T-Cells Blood Cell Line Uni-ZAP XR H0142
MCF7 Cell Line MCF7 Cell line Breast Cell Line Uni-ZAP XR H0144
Nine Week Old Early Stage Human 9 Wk Old Early Stage Embryo Uni-ZAP
XR Human H0147 Human Adult Liver Human Adult Liver Liver Uni-ZAP XR
H0149 7 Week Old Early Stage Human, subtracted Human Whole 7 Week
Old Embryo Uni-ZAP XR Embryo H0150 Human Epididymus Epididymis
Testis Uni-ZAP XR H0151 Early Stage Human Liver Human Fetal Liver
Liver Uni-ZAP XR H0152 Early Stage Human Liver, fract (II) Human
Fetal Liver Liver Uni-ZAP XR H0154 Human Fibrosarcoma Human Skin
Fibrosarcoma Skin disease Uni-ZAP XR H0155 Human Thymus, subtracted
Human Thymus Tumor Thymus pBluescript H0156 Human Adrenal Gland
Tumor Human Adrenal Gland Adrenal Gland disease Uni-ZAP XR Tumor
H0157 Activated T-Cells, 0 hrs, ligation 2 Activated T-Cells Blood
Cell Line Uni-ZAP XR H0158 Activated T-Cells, 4 hrs., ligation 2
Activated T-Cells Blood Cell Line Uni-ZAP XR H0159 Activated
T-Cells, 8 hrs., ligation 2 Activated T-Cells Blood Cell Line
Uni-ZAP XR H0163 Human Synovium Human Synovium Synovium Uni-ZAP XR
H0164 Human Trachea Tumor Human Trachea Tumor Trachea disease
Uni-ZAP XR H0165 Human Prostate Cancer, Stage B2 Human Prostate
Cancer, Prostate disease Uni-ZAP XR stage B2 H0166 Human Prostate
Cancer, Stage B2 fraction Human Prostate Cancer, Prostate disease
Uni-ZAP XR stage B2 H0167 Activated T-Cells, 24 hrs. Activated
T-Cells Blood Cell Line Uni-ZAP XR H0168 Human Prostate Cancer,
Stage C Human Prostate Cancer, Prostate disease Uni-ZAP XR stage C
H0169 Human Prostate Cancer, Stage C fraction Human Prostate
Cancer, Prostate disease Uni-ZAP XR stage C H0170 12 Week Old Early
Stage Human Twelve Week Old Early Embryo Uni-ZAP XR Stage Human
H0171 12 Week Old Early Stage Human, II Twelve Week Old Early
Embryo Uni-ZAP XR Stage Human H0172 Human Fetal Brain, random
primed Human Fetal Brain Brain Lambda ZAP II H0173 Human
Cardiomyopathy, RNA remake Human Cardiomyopathy Heart disease
Uni-ZAP XR H0175 H. Adult Spleen, ziplox pSport1 H0176 CAMA1Ee Cell
Line CAMA1Ee Cell Line Breast Cell Line Uni-ZAP XR H0177 CAMA1Ee
Cell Line CAMA1Ee Cell Line Breast Cell Line Uni-ZAP XR H0178 Human
Fetal Brain Human Fetal Brain Brain Uni-ZAP XR H0179 Human
Neutrophil Human Neutrophil Blood Cell Line Uni-ZAP XR H0181 Human
Primary Breast Cancer Human Primary Breast Breast disease Uni-ZAP
XR Cancer H0182 Human Primary Breast Cancer Human Primary Breast
Breast disease Uni-ZAP XR Cancer H0183 Human Colon Cancer Human
Colon Cancer Colon disease Uni-ZAP XR H0184 Human Colon Cancer,
metasticized to live Human Colon Cancer, Liver disease Lambda ZAP
II metasticized to liver H0185 Activated T-Cell labeled with
4-thioluri T-Cells Blood Cell Line Lambda ZAP II H0186 Activated
T-Cell T-Cells Blood Cell Line Lambda ZAP II H0187 Resting T-Cell
T-Cells Blood Cell Line Lambda ZAP II H0188 Human Normal Breast
Human Normal Breast Breast Uni-ZAP XR H0189 Human Resting
Macrophage Human Blood Cell Line Uni-ZAP XR Macrophage/Monocytes
H0190 Human Activated Macrophage (LPS) Human Blood Cell Line
Uni-ZAP XR Macrophage/Monocytes H0191 Human Activated Macrophage
(LPS), thiour Human Blood Cell Line Uni-ZAP XR Macrophage/Monocytes
H0192 Cem Cells, cyclohexamide treated, subtra Cyclohexamide
Treated Blood Cell Line Uni-ZAP XR Cem, Jurkat, Raji, and Supt
H0193 Cem Cells, cyclohexamide treated, differ Cyclohexamide
Treated Blood Cell Line Uni-ZAP XR Cem, Jurkat, Raji, and Supt
H0194 Human Cerebellum, subtracted Human Cerebellum Brain
pBluescript H0196 Human Cardiomyopathy, subtracted Human
Cardiomyopathy Heart Uni-ZAP XR H0197 Human Fetal Liver, subtracted
Human Fetal Liver Liver Uni-ZAP XR H0198 Human Fetal Liver,
subtracted, pos. clon Human Fetal Liver Liver Uni-ZAP XR H0199
Human Fetal Liver, subtracted, neg clone Human Fetal Liver Liver
Uni-ZAP XR H0200 Human Greater Omentum, fract II remake, Human
Greater Omentum peritoneum Uni-ZAP XR H0201 Human Hippocampus,
subtracted Human Hippocampus Brain pBluescript H0202 Jurkat Cells,
cyclohexamide treated, Cyclohexamide Treated Blood Cell Line
Uni-ZAP XR subtraction Cem, Jurkat, Raji, and Supt H0203 Jurkat
Cells, cyclohexamide treated, dif Cyclohexamide Treated Blood Cell
Line Uni-ZAP XR Cem, Jurkat, Raji, and Supt H0204 Human Colon
Cancer, subtracted Human Colon Cancer Colon pBluescript H0205 Human
Colon Cancer, differential Human Colon Cancer Colon pBluescript
H0207 LNCAP, differential expression LNCAP Cell Line Prostate Cell
Line pBluescript H0208 Early Stage Human Lung, subtracted Human
Fetal Lung Lung pBluescript H0209 Human Cerebellum, differentially
expressed Human Cerebellum Brain Uni-ZAP XR H0211 Human Prostate,
differential expression Human Prostate Prostate pBluescript H0212
Human Prostate, subtracted Human Prostate Prostate pBluescript
H0213 Human Pituitary, subtracted Human Pituitary Uni-ZAP XR H0214
Raji cells, cyclohexamide treated, subtracted Cyclohexamide Treated
Blood Cell Line pBluescript Cem, Jurkat, Raji, and Supt H0215 Raji
cells, cyclohexamide treated, Cyclohexamide Treated Blood Cell Line
pBluescript differentially expressed Cem, Jurkat, Raji, and Supt
H0216 Supt cells, cyclohexamide treated, subtracted Cyclohexamide
Treated Blood Cell Line pBluescript Cem, Jurkat, Raji, and Supt
H0217 Supt cells, cyclohexamide treated, Cyclohexamide Treated
Blood Cell Line pBluescript differentially expressed Cem, Jurkat,
Raji, and Supt H0218 Activated T-Cells, 0 hrs, subtracted Activated
T-Cells Blood Cell Line Uni-ZAP XR H0219 Activated T-Cells, 0 hrs,
differentially Activated T-Cells Blood Cell Line Uni-ZAP XR
expressed H0220 Activated T-Cells, 4 hrs, subtracted Activated
T-Cells Blood Cell Line Uni-ZAP XR H0222 Activated T-Cells, 8 hrs,
subtracted Activated T-Cells Blood Cell Line Uni-ZAP XR H0224
Activated T-Cells, 12 hrs, subtracted Activated T-Cells Blood Cell
Line Uni-ZAP XR H0225 Activated T-Cells, 12 hrs, differentially
Activated T-Cells Blood Cell Line Uni-ZAP XR expressed H0228 C7MCF7
cell line, estrogen treated C7MCF7 Cell Line, estrogen Breast Cell
Line Uni-ZAP XR treated H0229 Early Stage Human Brain, random
primed Early Stage Human Brain Brain Lambda ZAP II H0230 Human
Cardiomyopathy, diff exp Human Cardiomyopathy Heart disease Uni-ZAP
XR H0231 Human Colon, subtraction Human Colon pBluescript H0232
Human Colon, differential expression Human Colon pBluescript H0233
Human Fetal Heart, Differential (Adult- Human Fetal Heart Heart
pBluescript Specific) H0234 human colon cancer, metastatic to
liver, Human Colon Cancer, Liver pBluescript differentially
expressed metasticized to liver H0235 Human colon cancer,
metaticized to liver, Human Colon Cancer, Liver pBluescript
subtraction metasticized to liver H0239 Human Kidney Tumor Human
Kidney Tumor Kidney disease Uni-ZAP XR H0241 C7MCF7 cell line,
estrogen treated, C7MCF7 Cell Line, estrogen Breast Cell Line
Uni-ZAP XR subtraction treated H0242 Human Fetal Heart,
Differential (Fetal- Human Fetal Heart Heart pBluescript Specific)
H0244 Human 8 Week Whole Embryo, subtracted Human 8 Week Old Embryo
Embryo Uni-ZAP XR H0246 Human Fetal Liver- Enzyme subtraction Human
Fetal Liver Liver Uni-ZAP XR H0247 Human Membrane Bound Polysomes-
Human Membrane Bound Blood Cell Line Uni-ZAP XR Enzyme Subtraction
Polysomes H0249 HE7, subtracted by hybridization with E7 Human
Whole 7 Week Old Embryo Uni-ZAP XR cDNA Embryo H0250 Human
Activated Monocytes Human Monocytes Uni-ZAP XR H0251 Human
Chondrosarcoma Human Chondrosarcoma Cartilage disease Uni-ZAP XR
H0252 Human Osteosarcoma Human Osteosarcoma Bone disease Uni-ZAP XR
H0253 Human adult testis, large inserts Human Adult Testis Testis
Uni-ZAP XR H0254 Breast Lymph node cDNA library Breast Lymph Node
Lymph Node Uni-ZAP XR H0255 breast lymph node CDNA library Breast
Lymph Node Lymph Node Lambda ZAP II H0256 HL-60, unstimulated Human
HL-60 Cells, Blood Cell Line Uni-ZAP XR unstimulated H0257 HL-60,
PMA 4 H HL-60 Cells, PMA Blood Cell Line Uni-ZAP XR stimulated 4 H
H0261 H. cerebellum, Enzyme subtracted Human Cerebellum Brain
Uni-ZAP XR H0263 human colon cancer Human Colon Cancer Colon
disease Lambda ZAP II H0264 human tonsils Human Tonsil Tonsil
Uni-ZAP XR
H0265 Activated T-Cell (12 hs)/Thiouridine T-Cells Blood Cell Line
Uni-ZAP XR labelledEco H0266 Human Microvascular Endothelial Cells,
HMEC Vein Cell Line Lambda ZAP II fract. A H0267 Human
Microvascular Endothelial Cells, HMEC Vein Cell Line Lambda ZAP II
fract. B H0268 Human Umbilical Vein Endothelial Cells, HUVE Cells
Umbilical vein Cell Line Lambda ZAP II fract. A H0269 Human
Umbilical Vein Endothelial Cells, HUVE Cells Umbilical vein Cell
Line Lambda ZAP II fract. B H0270 HPAS (human pancreas, subtracted)
Human Pancreas Pancreas Uni-ZAP XR H0271 Human Neutrophil,
Activated Human Neutrophil - Blood Cell Line Uni-ZAP XR Activated
H0272 HUMAN TONSILS, FRACTION 2 Human Tonsil Tonsil Uni-ZAP XR
H0274 Human Adult Spleen, fractionII Human Adult Spleen Spleen
Uni-ZAP XR H0275 Human Infant Adrenal Gland, Subtracted Human
Infant Adrenal Gland Adrenal gland pBluescript H0279 K562 cells
K562 Cell line cell line Cell Line ZAP Express H0280 K562 + PMA (36
hrs) K562 Cell line cell line Cell Line ZAP Express H0281 Lymph
node, abnorm. cell line (ATCC Lymph Node, abnormal cell Lymph Node
Cell Line ZAP Express #7225) line H0282 HBGB''s differential
consolidation Human Primary Breast Breast Uni-ZAP XR Cancer H0284
Human OB MG63 control fraction I Human Osteoblastoma Bone Cell Line
Uni-ZAP XR MG63 cell line H0286 Human OB MG63 treated (10 nM E2)
Human Osteoblastoma Bone Cell Line Uni-ZAP XR fraction I MG63 cell
line H0288 Human OB HOS control fraction I Human Osteoblastoma HOS
Bone Cell Line Uni-ZAP XR cell line H0290 Human OB HOS treated (1
nM E2) fraction I Human Osteoblastoma HOS Bone Cell Line Uni-ZAP XR
cell line H0292 Human OB HOS treated (10 nM E2) Human Osteoblastoma
HOS Bone Cell Line Uni-ZAP XR fraction I cell line H0293 WI 38
cells Uni-ZAP XR H0294 Amniotic Cells - TNF induced Amniotic Cells
- TNF Placenta Cell Line Uni-ZAP XR induced H0295 Amniotic Cells -
Primary Culture Amniotic Cells - Primary Placenta Cell Line Uni-ZAP
XR Culture H0298 HCBB''s differential consolidation CAMA1Ee Cell
Line Breast Cell Line Uni-ZAP XR H0299 HCBA''s differential
consolidation CAMA1Ee Cell Line Breast Cell Line Uni-ZAP XR H0300
CD34 positive cells (Cord Blood) CD34 Positive Cells Cord Blood ZAP
Express H0305 CD34 positive cells (Cord Blood) CD34 Positive Cells
Cord Blood ZAP Express H0306 CD34 depleted Buffy Coat (Cord Blood)
CD34 Depleted Buffy Coat Cord Blood ZAP Express (Cord Blood) H0309
Human Chronic Synovitis Synovium, Chronic Synovium disease Uni-ZAP
XR Synovitis/Osteoarthritis H0310 human caudate nucleus Brain Brain
Uni-ZAP XR H0313 human pleural cancer pleural cancer disease
pBluescript H0316 HUMAN STOMACH Human Stomach Stomach Uni-ZAP XR
H0318 HUMAN B CELL LYMPHOMA Human B Cell Lymphoma Lymph Node
disease Uni-ZAP XR H0320 Human frontal cortex Human Frontal Cortex
Brain Uni-ZAP XR H0321 HUMAN SCHWANOMA Schwanoma Nerve disease
Uni-ZAP XR H0327 human corpus colosum Human Corpus Callosum Brain
Uni-ZAP XR H0328 human ovarian cancer Ovarian Cancer Ovary disease
Uni-ZAP XR H0329 Dermatofibrosarcoma Protuberance
Dermatofibrosarcoma Skin disease Uni-ZAP XR Protuberans H0330
HCBB''s Subtractive (-mito genes) CAMA1Ee Cell Line Breast Cell
Line Uni-ZAP XR H0331 Hepatocellular Tumor Hepatocellular Tumor
Liver disease Lambda ZAP II H0333 Hemangiopericytoma
Hemangiopericytoma Blood vessel disease Lambda ZAP II H0334 Kidney
cancer Kidney Cancer Kidney disease Uni-ZAP XR H0339 Duodenum
Duodenum Uni-ZAP XR H0340 Corpus Callosum Corpus Collosum-93052
Uni-ZAP XR H0341 Bone Marrow Cell Line (RS4; 11) Bone Marrow Cell
Line Bone Marrow Cell Line Uni-ZAP XR RS4; 11 H0342 Lingual Gyrus
Lingual Gyrus Brain Uni-Zap XR H0343 stomach cancer (human) Stomach
Cancer - 5383A disease Uni-ZAP XR (human) H0344 Adipose tissue
(human) Adipose - 6825A (human) Uni-ZAP XR H0345 SKIN Skin -
4000868H Skin Uni-ZAP XR H0346 Brain-medulloblastoma Brain
(Medulloblastoma)- Brain disease Uni-ZAP XR 9405C006R H0349 human
adult liver cDNA library Human Adult Liver Liver pCMVSport 1 H0350
Human Fetal Liver, mixed 10 & 14 week Human Fetal Liver, mixed
Liver Uni-ZAP XR 10&14 Week H0351 Glioblastoma Glioblastoma
Brain disease Uni-ZAP XR H0352 wilm''s tumor Wilm''s Tumor disease
Uni-ZAP XR H0354 Human Leukocytes Human Leukocytes Blood Cell Line
pCMVSport 1 H0355 Human Liver Human Liver, normal Adult pCMVSport 1
H0356 Human Kidney Human Kidney Kidney pCMVSport 1 H0357 H.
Normalized Fetal Liver, II Human Fetal Liver Liver Uni-ZAP XR H0359
KMH2 cell line KMH2 ZAP Express H0360 Hemangiopericytoma
Hemangiopericytoma disease H0361 Human rejected kidney Human
Rejected Kidney disease pBluescript H0362 HeLa cell line HELA CELL
LINE pSport1 H0363 Human Brain Medulla, subtracted Human Brain
Medulla pBluescript H0364 Human Osteoclastoma, excised Human
Osteoclastoma disease pBluescript H0365 Osteoclastoma-normalized B
Human Osteoclastoma disease Uni-ZAP XR H0366 L428 cell line L428
ZAP Express H0369 H. Atrophic Endometrium Atrophic Endometrium and
Uni-ZAP XR myometrium H0370 H. Lymph node breast Cancer Lymph node
with Met. disease Uni-ZAP XR Breast Cancer H0371
Eosinophils-Hypereosinophilia patient Eosinophils- disease Uni-ZAP
XR Hypereosinophilia patient H0372 Human Testes Human Testes Testis
pCMVSport 1 H0373 Human Heart Human Adult Heart Heart pCMVSport 1
H0374 Human Brain Human Brain pCMVSport 1 H0375 Human Lung Human
Lung pCMVSport 1 H0376 Human Spleen Human Adult Spleen Spleen
pCMVSport 1 H0379 Human Tongue, frac 1 Human Tongue pSport1 H0380
Human Tongue, frac 2 Human Tongue pSport1 H0381 Bone Cancer Bone
Cancer disease Uni-ZAP XR H0383 Human Prostate BPH, re-excision
Human Prostate BPH Uni-ZAP XR H0384 Brain, Kozak Human Brain
pCMVSport 1 H0385 H. Leukocytes, Kozak Human Leukocytes Blood Cell
Line pCMVSport 1 H0386 Leukocyte and Lung; 4 screens Human
Leukocytes Blood Cell Line pCMVSport 1 H0388 Human Rejected Kidney,
704 re-excision Human Rejected Kidney disease pBluescript H0389 H.
Brain, X-Chromosome hybridization Human Brain pCMVSport 1 H0390
Human Amygdala Depression, re-excision Human Amygdala disease
pBluescript Depression H0391 H. Meniingima, M6 Human Meningima
brain pSport1 H0392 H. Meningima, M1 Human Meningima brain pSport1
H0393 Fetal Liver, subtraction II Human Fetal Liver Liver
pBluescript H0394 A-14 cell line Redd-Sternberg cell ZAP Express
H0395 A1-CELL LINE Redd-Sternberg cell ZAP Express H0396 L1 Cell
line Redd-Sternberg cell ZAP Express H0398 Human Newborn Bladder
Human Newborn Bladder pBluescript H0399 Human Kidney Cortex,
re-rescue Human Kidney Cortex Lambda ZAP II H0400 Human Striatum
Depression, re-rescue Human Brain, Striatum Brain Lambda ZAP II
Depression H0401 Human Pituitary, subtracted V Human Pituitary
pBluescript H0402 CD34 depleted Buffy Coat (Cord Blood), re- CD34
Depleted Buffy Coat Cord Blood ZAP Express excision (Cord Blood)
H0403 H. Umbilical Vein Endothelial Cells, IL4 HUVE Cells Umbilical
vein Cell Line Uni-ZAP XR induced H0404 H. Umbilical Vein
endothelial cells, HUVE Cells Umbilical vein Cell Line Uni-ZAP XR
uninduced H0405 Human Pituitary, subtracted VI Human Pituitary
pBluescript H0406 H Amygdala Depression, subtracted Human Amygdala
Uni-ZAP XR Depression H0408 Human kidney Cortex, subtracted Human
Kidney Cortex pBluescript H0409 H. Striatum Depression, subtracted
Human Brain, Striatum Brain pBluescript Depression H0410 H. Male
bladder, adult H Male Bladder, Adult Bladder pSport1 H0411 H Female
Bladder, Adult Human Female Adult Bladder pSport1 Bladder H0412
Human umbilical vein endothelial cells, IL-4 HUVE Cells Umbilical
vein Cell Line pSport1 induced H0413 Human Umbilical Vein
Endothelial Cells, HUVE Cells Umbilical vein Cell Line pSport1
uninduced H0414 Ovarian Tumor I, OV5232 Ovarian Tumor, OV5232 Ovary
disease pSport1 H0415 H. Ovarian Tumor, II, OV5232 Ovarian Tumor,
OV5232 Ovary disease pCMVSport 2.0 H0416 Human Neutrophils,
Activated, re-excision Human Neutrophil - Blood Cell Line
pBluescript Activated H0417 Human Pituitary, subtracted VIII Human
Pituitary pBluescript H0418 Human Pituitary, subtracted VII Human
Pituitary pBluescript H0419 Bone Cancer, re-excision Bone Cancer
Uni-ZAP XR H0421 Human Bone Marrow, re-excision Bone Marrow
pBluescript H0422 T-Cell PHA 16 hrs T-Cells Blood Cell Line pSport1
H0423 T-Cell PHA 24 hrs T-Cells Blood Cell Line pSport1 H0424 Human
Pituitary, subt IX Human Pituitary pBluescript H0427 Human Adipose
Human Adipose, left pSport1 hiplipoma H0428 Human Ovary Human Ovary
Tumor Ovary pSport1 H0429 K562 + PMA (36 hrs), re-excision K562
Cell line cell line Cell Line ZAP Express H0431 H. Kidney Medulla,
re-excision Kidney medulla Kidney pBluescript H0432 H. Kidney
Pyramid Kidney pyramids Kidney pBluescript H0433 Human Umbilical
Vein HUVE Cells Umbilical vein Cell Line pBluescript Endothelial
cells, frac B, re-excision H0434 Human Brain, striatum, re-excision
Human Brain, Striatum pBluescript H0435 Ovarian Tumor 10-3-95
Ovarian Tumor, OV350721 Ovary pCMVSport 2.0 H0436 Resting T-Cell
Library, II T-Cells Blood Cell Line pSport1 H0437 H Umbilical Vein
Endothelial Cells, frac A, HUVE Cells Umbilical vein Cell Line
Lambda ZAP II re-excision H0438 H. Whole Brain #2, re-excision
Human Whole Brain #2 ZAP Express H0439 Human Eosinophils
Eosinophils pBluescript H0440 FGF enriched mixed library Mixed
libraries pCMVSport 1 H0441 H. Kidney Cortex, subtracted Kidney
cortex Kidney pBluescript H0442 H. Striatum Depression, subt II
Human Brain, Striatum Brain pBluescript Depression H0443 H.
Adipose, subtracted Human Adipose, left pSport1 hiplipoma H0444
Spleen metastic melanoma Spleen, Metastic malignant Spleen disease
pSport1 melanoma H0445 Spleen, Chronic lymphocytic leukemia Human
Spleen, CLL Spleen disease pSport1 H0447 Salivary gland,
re-excision Human Salivary Gland Salivary gland Uni-ZAP XR H0448
Salivary gland, subtracted Human Salivary Gland Salivary gland
Lambda ZAP II H0449 CD34 + cell, I CD34 positive cells pSport1
H0450 CD34 +cells, II CD34 positive cells pCMVSport 2.0 H0453 H.
Kidney Pyramid, subtracted Kidney pyramids Kidney pBluescript H0455
H. Striatum Depression, subt Human Brain, Striatum Brain
pBluescript Depression H0456 H Kidney Cortex, subtracted III Human
Kidney Cortex pBluescript H0457 Human Eosinophils Human Eosinophils
pSport1 H0458 CD34 + cell, I, frac II CD34 positive cells pSport1
H0459 CD34+cells, II, FRACTION 2 CD34 positive cells pCMVSport 2.0
H0461 H. Kidney Medulla, subtracted Kidney medulla Kidney
pBluescript H0462 H. Amygdala Depression, subtracted Brain
pBluescript H0477 Human Tonsil, Lib 3 Human Tonsil Tonsil pSport1
H0478 Salivary Gland, Lib 2 Human Salivary Gland Salivary gland
pSport1 H0479 Salivary Gland, Lib 3 Human Salivary Gland Salivary
gland pSport1 H0480 L8 cell line L8 cell line ZAP Express H0483
Breast Cancer cell line, MDA 36 Breast Cancer Cell line,
pSport1
MDA 36 H0484 Breast Cancer Cell line, angiogenic Breast Cancer Cell
line, pSport1 Angiogenic, 36T3 H0485 Hodgkin''s Lymphoma I
Hodgkin''s Lymphoma I disease pCMVSport 2.0 H0486 Hodgkin''s
Lymphoma II Hodgkin''s Lymphoma II disease pCMVSport 2.0 H0487
Human Tonsils, lib I Human Tonsils pCMVSport 2.0 H0488 Human
Tonsils, Lib 2 Human Tonsils pCMVSport 2.0 H0489 Crohn''s Disease
Ileum Intestine disease pSport1 H0490 HI-60, untreated, subtracted
Human HL-60 Cells, Blood Cell Line Uni-ZAP XR unstimulated H0491
HL-60, PMA 4 H, subtracted HL-60 Cells, PMA Blood Cell Line Uni-ZAP
XR stimulated 4 H H0492 HL-60, RA 4 h, Subtracted HL-60 Cells, RA
stimulated Blood Cell Line Uni-ZAP XR for 4 H H0493 HL-60, PMA 1 d,
subtracted HL-60 Cells, PMA Blood Cell Line Uni-ZAP XR stimulated
for 1 day H0494 Keratinocyte Keratinocyte pCMVSport 2.0 H0497 HEL
cell line HEL cell line HEL 92.1.7 pSport1 H0505 Human Astrocyte
Human Astrocyte pSport1 H0506 Ulcerative Colitis Colon Colon
pSport1 H0509 Liver, Hepatoma Human Liver, Hepatoma, Liver disease
pCMVSport 3.0 patient 8 H0510 Human Liver, normal Human Liver,
normal, Liver pCMVSport 3.0 Patient # 8 H0512 Keratinocyte, lib 3
Keratinocyte pCMVSport 2.0 H0517 Nasal polyps Nasal polyps
pCMVSport 2.0 H0518 pBMC stimulated w/ poly I/C pBMC stimulated
with poly pCMVSport 3.0 I/C H0519 NTERA2, control NTERA2,
Teratocarcinoma pCMVSport 3.0 cell line H0520 NTERA2 + retinoic
acid, 14 days NTERA2, Teratocarcinoma pSport1 cell line H0521
Primary Dendritic Cells, lib 1 Primary Dendritic cells pCMVSport
3.0 H0522 Primary Dendritic cells, frac 2 Primary Dendritic cells
pCMVSport 3.0 H0523 Primary Dendritic cells, CapFinder2, frac 1
Primary Dendritic cells pSport1 H0524 Primary Dendritic Cells,
CapFinder, frac 2 Primary Dendritic cells pSport1 H0525 PCR, pBMC
I/C treated pBMC stimulated with poly PCRII I/C H0528
Poly[I]/Poly[C] Normal Lung Fibroblasts Poly[I]/Poly[C] Normal
pCMVSport 3.0 Lung Fibroblasts H0529 Myoloid Progenitor Cell Line
TF-1 Cell Line; Myoloid pCMVSport 3.0 progenitor cell line H0530
Human Dermal Endothelial Cells, untreated Human Dermal Endothelial
pSport1 Cells; untreated H0535 Human ovary tumor cell OV350721
Ovarian Tumor, OV350721 Ovary disease pSport1 H0537 H. Primary
Dendritic Cells, lib 3 Primary Dendritic cells pCMVSport 2.0 H0538
Merkel Cells Merkel cells Lymph node pSport1 H0539 Pancreas Islet
Cell Tumor Pancreas Islet Cell Tumour Pancreas disease pSport1
H0540 Skin, burned Skin, leg burned Skin pSport1 H0542 T Cell
helper I Helper T cell pCMVSport 3.0 H0543 T cell helper II Helper
T cell pCMVSport 3.0 H0544 Human endometrial stromal cells Human
endometrial stromal pCMVSport 3.0 cells H0545 Human endometrial
stromal Human endometrial stromal pCMVSport 3.0 cells-treated with
progesterone cells-treated with proge H0546 Human endometrial
stromal Human endometrial stromal pCMVSport 3.0 cells-treated with
estradiol cells-treated with estra H0547 NTERA2 teratocarcinoma
cell line + retinoic NTERA2, Teratocarcinoma pSport1 acid (14 days)
cell line H0549 H. Epididiymus, caput & corpus Human
Epididiymus, caput Uni-ZAP XR and corpus H0550 H. Epididiymus,
cauda Human Epididiymus, cauda Uni-ZAP XR H0551 Human Thymus
Stromal Cells Human Thymus Stromal pCMVSport 3.0 Cells H0552 Signal
trap, Femur Bone Marrow, pooled Femur Bone marrow, pooled Other
from 8 male/female H0553 Human Placenta Human Placenta pCMVSport
3.0 H0555 Rejected Kidney, lib 4 Human Rejected Kidney Kidney
disease pCMVSport 3.0 H0556 Activated T-cell(12 h)/Thiouridine-re-
T-Cells Blood Cell Line Uni-ZAP XR excision H0559 HL-60, PMA 4 H,
re-excision HL-60 Cells, PMA Blood Cell Line Uni-ZAP XR stimulated
4 H H0560 KMH2 KMH2 pCMVSport 3.0 H0561 L428 L428 pCMVSport 3.0
H0562 Human Fetal Brain, normalized c5-11-26 Human Fetal Brain
pCMVSport 2.0 H0563 Human Fetal Brain, normalized 50021F Human
Fetal Brain pCMVSport 2.0 H0564 Human Fetal Brain, normalized
C5001F Human Fetal Brain pCMVSport 2.0 H0565 HUman Fetal Brain,
normalized 100024F Human Fetal Brain pCMVSport 2.0 H0566 Human
Fetal Brain, normalized c50F Human Fetal Brain pCMVSport 2.0 H0567
Human Fetal Brain, normalized A5002F Human Fetal Brain pCMVSport
2.0 H0569 Human Fetal Brain, normalized CO Human Fetal Brain
pCMVSport 2.0 H0570 Human Fetal Brain, normalized C500H Human Fetal
Brain pCMVSport 2.0 H0571 Human Fetal Brain, normalized C500HE
Human Fetal Brain pCMVSport 2.0 H0572 Human Fetal Brain, normalized
AC5002 Human Fetal Brain pCMVSport 2.0 H0574 Hepatocellular Tumor;
re-excision Hepatocellular Tumor Liver disease Lambda ZAP II H0575
Human Adult Pulmonary; re-excision Human Adult Pulmonary Lung
Uni-ZAP XR H0576 Resting T-Cell; re-excision T-Cells Blood Cell
Line Lambda ZAP II H0578 Human Fetal Thymus Fetal Thymus Thymus
pSport1 H0579 Pericardium Pericardium Heart pSport1 H0580 Dendritic
cells, pooled Pooled dendritic cells pCMVSport 3.0 H0581 Human Bone
Marrow, treated Human Bone Marrow Bone Marrow pCMVSport 3.0 H0583 B
Cell lymphoma B Cell Lymphoma B Cell disease pCMVSport 3.0 H0584
Activated T-cells, 24 hrs, re-excision Activated T-Cells Blood Cell
Line Uni-ZAP XR H0585 Activated T-Cells, 12 hrs, re-excision
Activated T-Cells Blood Cell Line Uni-ZAP XR H0586 Healing groin
wound, 6.5 hours post incision healing groin wound, 6.5 groin
disease pCMVSport 3.0 hours post incision - 2/ H0587 Healing groin
wound; 7.5 hours post incision Groin-2/19/97 groin disease
pCMVSport 3.0 H0589 CD34 positive cells (cord blood), re-ex CD34
Positive Cells Cord Blood ZAP Express H0590 Human adult small
intestine, re-excision Human Adult Small Intestine Small Int.
Uni-ZAP XR H0591 Human T-cell lymphoma; re-excision T-Cell Lymphoma
T-Cell disease Uni-ZAP XR H0592 Healing groin wound - zero hr
post-incision HGS wound healing project; disease pCMVSport 3.0
(control) abdomen H0593 Olfactory epithelium; nasalcavity Olfactory
epithelium from pCMVSport 3.0 roof of left nasal cacit H0594 Human
Lung Cancer; re-excision Human Lung Cancer Lung disease Lambda ZAP
II H0595 Stomach cancer (human); re-excision Stomach Cancer - 5383A
disease Uni-ZAP XR (human) H0596 Human Colon Cancer; re-excision
Human Colon Cancer Colon Lambda ZAP II H0597 Human Colon;
re-excision Human Colon Lambda ZAP II H0598 Human Stomach;
re-excision Human Stomach Stomach Uni-ZAP XR H0599 Human Adult
Heart; re-excision Human Adult Heart Heart Uni-ZAP XR H0600 Healing
Abdomen wound; 70&90 min post Abdomen disease pCMVSport 3.0
incision H0601 Healing Abdomen Wound; 15 days post Abdomen disease
pCMVSport 3.0 incision H0602 Healing Abdomen Wound; 21&29 days
post Abdomen disease pCMVSport 3.0 incision H0604 Human Pituitary,
re-excision Human Pituitary pBluescript H0606 Human Primary Breast
Cancer; re-excision Human Primary Breast Breast disease Uni-ZAP XR
Cancer H0607 H. Leukocytes, normalized cot 50A3 H. Leukocytes
pCMVSport 1 H0608 H. Leukocytes, control H. Leukocytes pCMVSport 1
H0609 H. Leukocytes, normalized cot >500A H. Leukocytes
pCMVSport 1 H0610 H. Leukocytes, normalized cot 5A H. Leukocytes
pCMVSport 1 H0611 H. Leukocytes, normalized cot 500 B H. Leukocytes
pCMVSport 1 H0612 H. Leukocytes, normalized cot 50 B H. Leukocytes
pCMVSport 1 H0613 H. Leukocytes, normalized cot 5B H. Leukocytes
pCMVSport 1 H0614 H. Leukocytes, normalized cot 500 A H. Leukocytes
pCMVSport 1 H0615 Human Ovarian Cancer Reexcision Ovarian Cancer
Ovary disease Uni-ZAP XR H0616 Human Testes, Reexcision Human
Testes Testis Uni-ZAP XR H0617 Human Primary Breast Cancer
Reexcision Human Primary Breast Breast disease Uni-ZAP XR Cancer
H0618 Human Adult Testes, Large Inserts, Human Adult Testis Testis
Uni-ZAP XR Reexcision H0619 Fetal Heart Human Fetal Heart Heart
Uni-ZAP XR H0620 Human Fetal Kidney; Reexcision Human Fetal Kidney
Kidney Uni-ZAP XR H0622 Human Pancreas Tumor; Reexcision Human
Pancreas Tumor Pancreas disease Uni-ZAP XR H0623 Human Umbilical
Vein; Reexcision Human Umbilical Vein Umbilical vein Uni-ZAP XR
Endothelial Cells H0624 12 Week Early Stage Human II; Reexcision
Twelve Week Old Early Embryo Uni-ZAP XR Stage Human H0625 Ku 812F
Basophils Line Ku812F Basophils pSport1 H0626 Saos2 Cells;
Untreated Saos2 Cell Line; Untreated pSport1 H0627 Saos2 Cells;
Vitamin D3 Treated Saos2 Cell Line; Vitamin D3 pSport1 Treated
H0628 Human Pre-Differentiated Adipocytes Human Pre-Differentiated
Uni-ZAP XR Adipocytes H0629 Human Leukocyte, control #2 Human
Normalized pCMVSport 1 leukocyte H0630 Human Leukocytes, normalized
control #4 Human Normalized pCMVSport 1 leukocyte H0631 Saos2,
Dexamethosome Treated Saos2 Cell Line; pSport1 Dexamethosome
Treated H0632 Hepatocellular Tumor; re-excision Hepatocellular
Tumor Liver Lambda ZAP II H0633 Lung Carcinoma A549 TNFalpha
activated TNFalpha activated A549- disease pSport1 Lung Carcinoma
H0634 Human Testes Tumor, re-excision Human Testes Tumor Testis
disease Uni-ZAP XR H0635 Human Activated T-Cells, re-excision
Activated T-Cells Blood Cell Line Uni-ZAP XR H0637 Dendritic Cells
From CD34 Cells Dentritic cells from CD34 pSport1 cells H0638 CD40
activated monocyte dendridic cells CD40 activated monocyte pSport1
dendridic cells H0639 Ficolled Human Stromal Cells, 5Fu treated
Ficolled Human Stromal Other Cells, 5Fu treated H0640 Ficolled
Human Stromal Cells, Untreated Ficolled Human Stromal Other Cells,
Untreated H0641 LPS activated derived dendritic cells LPS activated
monocyte pSport1 derived dendritic cells H0642 Hep G2 Cells, lambda
library Hep G2 Cells Other H0643 Hep G2 Cells, PCR library Hep G2
Cells Other H0644 Human Placenta (re-excision) Human Placenta
Placenta Uni-ZAP XR H0645 Fetal Heart, re-excision Human Fetal
Heart Heart Uni-ZAP XR H0646 Lung, Cancer (4005313 A3): Invasive
Metastatic squamous cell pSport1 Poorly Differentiated Lung
Adenocarcinoma, lung carcinoma, poorly di H0647 Lung, Cancer
(4005163 B7): Invasive, Invasive poorly disease pSport1 Poorly
Diff. Adenocarcinoma, Metastatic differentiated lung
adenocarcinoma H0648 Ovary, Cancer: (4004562 B6) Papillary
Papillary Cstic neoplasm of disease pSport1 Serous Cystic Neoplasm,
Low Malignant Pot low malignant potentia H0649 Lung, Normal:
(4005313 B1) Normal Lung pSport1 H0650 B-Cells B-Cells pCMVSport
3.0 H0651 Ovary, Normal: (9805C040R) Normal Ovary pSport1 H0652
Lung, Normal: (4005313 B1) Normal Lung pSport1 H0653 Stromal Cells
Stromal Cells pSport1 H0654 Lung, Cancer: (4005313 A3) Invasive
Metastatic Squamous cell Other Poorly-differentiated Metastatic
lung adenoc lung Carcinoma poorly dif H0656 B-cells (unstimulated)
B-cells (unstimulated) pSport1 H0657 B-cells (stimulated) B-cells
(stimulated) pSport1 H0658 Ovary, Cancer (9809C332): Poorly
9809C332- Poorly Ovary & disease pSport1 differentiated
adenocarcinoma differentiate Fallopian Tubes H0659 Ovary, Cancer
(15395A1F): Grade II Grade II Papillary Ovary disease pSport1
Papillary Carcinoma Carcinoma, Ovary H0660 Ovary, Cancer:
(15799A1F) Poorly Poorly differentiated disease pSport1
differentiated carcinoma carcinoma, ovary H0661 Breast, Cancer:
(4004943 A5) Breast cancer disease pSport1 H0662 Breast, Normal:
(4005522B2) Normal Breast - Breast pSport1 #4005522(B2) H0663
Breast, Cancer: (4005522 A2) Breast Cancer - Breast disease pSport1
#4005522(A2) H0664 Breast, Cancer: (9806C012R) Breast Cancer Breast
disease pSport1 H0665 Stromal cells 3.88 Stromal cells 3.88 pSport1
H0666 Ovary, Cancer: (4004332 A2) Ovarian Cancer, Sample disease
pSport1 #4004332A2 H0667 Stromal cells(HBM3.18) Stromal cell(HBM
3.18) pSport1 H0668 stromal cell clone 2.5 stromal cell clone 2.5
pSport1 H0669 Breast, Cancer: (4005385 A2) Breast Cancer
(4005385A2) Breast pSport1 H0670 Ovary, Cancer(4004650 A3): Well-
Ovarian Cancer - pSport1 Differentiated Micropapillary Serous
4004650A3 Carcinoma H0671 Breast, Cancer: (9802C02OE) Breast
Cancer- Sample # pSport1 9802C02OE H0672 Ovary, Cancer: (4004576
A8) Ovarian Cancer(4004576A8) Ovary pSport1 H0673 Human Prostate
Cancer, Stage B2; re- Human Prostate Cancer, Prostate Uni-ZAP XR
excision stage B2 H0674 Human Prostate Cancer, Stage C; re- Human
Prostate Cancer, Prostate Uni-ZAP XR excission stage C H0675 Colon,
Cancer: (9808C064R) Colon Cancer 9808C064R pCMVSport 3.0 H0676
Colon, Cancer: (9808C064R)-total RNA Colon Cancer 9808C064R
pCMVSport 3.0 H0677 TNFR degenerate oligo B-Cells PCRII H0678
screened clones from placental library Placenta Placenta Other
H0679 screened clones from Tonsil library Human Tonsils Other H0682
Serous Papillary Adenocarcinoma serous papillary pCMVSport 3.0
adenocarcinoma (9606G304SPA3B) H0683 Ovarian Serous Papillary
Adenocarcinoma Serous papillary pCMVSport 3.0 adenocarcinoma, stage
3C (9804G01 H0684 Serous Papillary Adenocarcinoma Ovarian
Cancer-9810G606 Ovaries pCMVSport 3.0 H0685 Adenocarcinoma of
Ovary, Human Cell Line Adenocarcinoma of Ovary, pCMVSport 3.0 #
OVCAR-3 Human Cell Line, # OVCAR- H0686 Adenocarcinoma of Ovary,
Human Cell Line Adenocarcinoma of Ovary, pCMVSport 3.0 Human Cell
Line, # SW-626 H0687 Human normal ovary(#9610G215) Human normal
Ovary pCMVSport 3.0 ovary(#9610G215) H0688 Human Ovarian
Cancer(#9807G017) Human Ovarian pCMVSport 3.0 cancer(#9807G017),
mRNA from Maura Ru H0689 Ovarian Cancer Ovarian Cancer, #9806G019
pCMVSport 3.0 H0690 Ovarian Cancer, # 9702G001 Ovarian Cancer,
#9702G001 pCMVSport 3.0 H0691 Normal Ovary, #9710G208 normal ovary,
#9710G208 pCMVSport 3.0 H0692 BLyS Receptor from Expression Cloning
B Cell Lymphoma B Cell pCMVSport 3.0 H0693 Normal Prostate
#ODQ3958EN Normal Prostate Tissue # pCMVSport 3.0 ODQ3958EN H0694
Prostate gland adenocarcinoma Prostate gland, prostate gland
pCMVSport 3.0 adenocarcinoma, mod/diff, gleason H0695
mononucleocytes from patient mononucleocytes from pCMVSport 3.0
patient at Shady Grove Hospit N0006 Human Fetal Brain Human Fetal
Brain N0007 Human Hippocampus Human Hippocampus N0009 Human
Hippocampus, prescreened Human Hippocampus N0011 Human Brain Human
Brain S0001 Brain frontal cortex Brain frontal cortex Brain Lambda
ZAP II S0002 Monocyte activated Monocyte-activated blood Cell Line
Uni-ZAP XR S0003 Human Osteoclastoma Osteoclastoma bone disease
Uni-ZAP XR S0004 Prostate Prostate BPH Prostate Lambda ZAP II S0005
Heart Heart-left ventricle Heart pCDNA S0006 Neuroblastoma Human
Neural Blastoma disease pCDNA S0007 Early Stage Human Brain Human
Fetal Brain Uni-ZAP XR S0010 Human Amygdala Amygdala Uni-ZAP XR
S0011 STROMAL - OSTEOCLASTOMA Osteoclastoma bone disease Uni-ZAP XR
S0013 Prostate Prostate prostate Uni-ZAP XR S0014 Kidney Cortex
Kidney cortex Kidney Uni-ZAP XR S0015 Kidney medulla Kidney medulla
Kidney Uni-ZAP XR S0016 Kidney Pyramids Kidney pyramids Kidney
Uni-ZAP XR S0021 Whole brain Whole brain Brain ZAP Express S0022
Human Osteoclastoma Stromal Cells - Osteoclastoma Stromal Cells
Uni-ZAP XR unamplified S0024 Human Kidney Medulla - unamplified
Human Kidney Medulla S0025 Human Kidney Pyramids - unamplified
Human Kidney Pyramids S0026 Stromal cell TF274 stromal cell Bone
marrow Cell Line Uni-ZAP XR S0027 Smooth muscle, serum treated
Smooth muscle Pulmanary Cell Line Uni-ZAP XR artery S0028 Smooth
muscle, control Smooth muscle Pulmanary Cell Line Uni-ZAP XR artery
S0029 brain stem Brain stem brain Uni-ZAP XR S0030 Brain pons Brain
Pons Brain Uni-ZAP XR S0031 Spinal cord Spinal cord spinal cord
Uni-ZAP XR S0032 Smooth muscle-ILb induced Smooth muscle Pulmanary
Cell Line Uni-ZAP XR artery S0035 Brain medulla oblongata Brain
medulla oblongata Brain Uni-ZAP XR S0036 Human Substantia Nigra
Human Substantia Nigra Uni-ZAP XR S0037 Smooth muscle, IL1b induced
Smooth muscle Pulmanary Cell Line Uni-ZAP XR artery S0038 Human
Whole Brain #2 - Oligo dT >1.5 Kb Human Whole Brain #2 ZAP
Express S0039 Hypothalamus Hypothalamus Brain Uni-ZAP XR S0040
Adipocytes Human Adipocytes from Uni-ZAP XR Osteoclastoma S0041
Thalamus Human Thalamus Uni-ZAP XR S0042 Testes Human Testes ZAP
Express S0044 Prostate BPH prostate BPH Prostate disease Uni-ZAP XR
S0045 Endothelial cells-control Endothelial cell endothelial cell-
Cell Line Uni-ZAP XR lung S0046 Endothelial-induced Endothelial
cell endothelial cell- Cell Line Uni-ZAP XR lung S0048 Human
Hypothalamus, Alzheimer''s Human Hypothalamus, disease Uni-ZAP XR
Alzheimer''s S0049 Human Brain, Striatum Human Brain, Striatum
Uni-ZAP XR S0050 Human Frontal Cortex, Schizophrenia Human Frontal
Cortex, disease Uni-ZAP XR Schizophrenia S0051 Human Hypothalmus,
Schizophrenia Human Hypothalamus, disease Uni-ZAP XR Schizophrenia
S0052 neutrophils control human neutrophils blood Cell Line Uni-ZAP
XR S0053 Neutrophils IL-1 and LPS induced human neutrophil induced
blood Cell Line Uni-ZAP XR S0106 STRIATUM DEPRESSION BRAIN disease
Uni-ZAP XR S0110 Brain Amygdala Depression Brain disease Uni-ZAP XR
S0112 Hypothalamus Brain Uni-ZAP XR S0114 Anergic T-cell Anergic
T-cell Cell Line Uni-ZAP XR S0116 Bone marrow Bone marrow Bone
marrow Uni-ZAP XR S0118 Smooth muscle control 2 Smooth muscle
Pulmanary Cell Line Uni-ZAP XR artery S0122
Osteoclastoma-normalized A Osteoclastoma bone disease pBluescript
S0124 Smooth muscle-edited A Smooth muscle Pulmanary Cell Line
Uni-ZAP XR artery S0126 Osteoblasts Osteoblasts Knee Cell Line
Uni-ZAP XR S0132 Epithelial-TNFa and INF induced Airway Epithelial
Uni-ZAP XR S0134 Apoptotic T-cell apoptotic cells Cell Line Uni-ZAP
XR S0136 PERM TF274 stromal cell Bone marrow Cell Line Lambda ZAP
II S0140 eosinophil-IL5 induced eosinophil lung Cell Line Uni-ZAP
XR S0142 Macrophage-oxLDL macrophage-oxidized LDL blood Cell Line
Uni-ZAP XR treated S0144 Macrophage (GM-CSF treated) Macrophage
(GM-CSF Uni-ZAP XR treated) S0146 prostate-edited prostate BPH
Prostate Uni-ZAP XR S0148 Normal Prostate Prostate prostate Uni-ZAP
XR S0150 LNCAP prostate cell line LNCAP Cell Line Prostate Cell
Line Uni-ZAP XR S0152 PC3 Prostate cell line PC3 prostate cell line
Uni-ZAP XR S0168 Prostate/LNCAP, subtraction I PC3 prostate cell
line pBluescript S0174 Prostate-BPH subtracted II Human Prostate
BPH pBluescript S0176 Prostate, normal, subtraction I Prostate
prostate Uni-ZAP XR S0180 Bone Marrow Stroma, TNF&LPS ind Bone
Marrow Stroma, TNF disease Uni-ZAP XR & LPS induced S0182 Human
B Cell 8866 Human B-Cell 8866 Uni-ZAP XR S0184 7TM Receptor
enriched, lib II PBLS, 7TM receptor Other enriched S0188 Prostate,
BPH, Lib 2 Human Prostate BPH disease pSport1 S0190 Prostate BPH,
Lib 2, subtracted Human Prostate BPH pSport1 S0192 Synovial
Fibroblasts (control) Synovial Fibroblasts pSport1 S0194 Synovial
hypoxia Synovial Fibroblasts pSport1 S0196 Synovial IL-1/TNF
stimulated Synovial Fibroblasts pSport1 S0202 7TM-pbdd PBLS, 7TM
receptor PCRII enriched S0206 Smooth Muscle- HASTE normalized
Smooth muscle Pulmanary Cell Line pBluescript artery S0208
Messangial cell, frac 1 Messangial cell pSport1 S0210 Messangial
cell, frac 2 Messangial cell pSport1 S0212 Bone Marrow Stromal
Cell, untreated Bone Marrow Stromal pSport1 Cell, untreated S0214
Human Osteoclastoma, re-excision Osteoclastoma bone disease Uni-ZAP
XR S0216 Neutrophils IL-1 and LPS induced human neutrophil induced
blood Cell Line Uni-ZAP XR S0218 Apoptotic T-cell, re-excision
apoptotic cells Cell Line Uni-ZAP XR S0220 H. hypothalamus, frac A;
re-excision Hypothalamus Brain ZAP Express S0222 H. Frontal cortex,
epileptic; re-excision H. Brain, Frontal Cortex, Brain disease
Uni-ZAP XR Epileptic S0242 Synovial Fibroblasts (Il1/TNF), subt
Synovial Fibroblasts pSport1 S0250 Human Osteoblasts II Human
Osteoblasts Femur disease pCMVSport 2.0 S0252 7TM-PIMIX PBLS, 7TM
receptor PCRII enriched S0256 7TM-PHMIX PBLS, 7TM receptor PCRII
enriched S0260 Spinal Cord, re-excision Spinal cord spinal cord
Uni-ZAP XR S0264 PPMIX PPMIX (Human Pituitary) Pituitary PCRII
S0266 PLMIX PLMIX (Human Lung) Lung PCRII S0268 PRMIX PRMIX (Human
Prostate) prostate PCRII S0270 PTMIX PTMIX (Human Thymus) Thymus
PCRII S0276 Synovial hypoxia-RSF subtracted Synovial fobroblasts
Synovial tissue pSport1 (rheumatoid) S0278 H Macrophage (GM-CSF
treated), re- Macrophage (GM-CSF Uni-ZAP XR excision treated) S0280
Human Adipose Tissue, re-excision Human Adipose Tissue Uni-ZAP XR
S0282 Brain Frontal Cortex, re-excision Brain frontal cortex Brain
Lambda ZAP II S0292 Osteoarthritis (OA-4) Human Osteoarthritic Bone
disease pSport1 Cartilage S0294 Larynx tumor Larynx tumor Larynx,
vocal disease pSport1 cord S0296 Normal lung Normal lung Lung
pSport1 S0298 Bone marrow stroma, treated Bone marrow Bone marrow
pSport1 stroma, treatedSB
S0300 Frontal lobe, dementia; re-excision Frontal Lobe Brain
Uni-ZAP XR dementia/Alzheimer''s S0306 Larynx normal #10 261-273
Larynx normal pSport1 S0308 Spleen/normal Spleen normal pSport1
S0310 Normal trachea Normal trachea pSport1 S0312 Human
osteoarthritic; fraction II Human osteoarthritic disease pSport1
cartilage S0314 Human osteoarthritis; fraction I Human
osteoarthritic disease pSport1 cartilage S0316 Human Normal
Cartilage, Fraction I Human Normal Cartilage pSport1 S0318 Human
Normal Cartilage Fraction II Human Normal Cartilage pSport1 S0320
Human Larynx Larynx Epiglottis pSport1 S0322 Siebben Polyposis
Siebben Polyposis pSport1 S0324 Human Brain Brain Cerebellum
pSport1 S0328 Palate carcinoma Palate carcinoma Uvula disease
pSport1 S0330 Palate normal Palate normal Uvula pSport1 S0332
Pharynx carcinoma Pharynx carcinoma Hypopharynx pSport1 S0334 Human
Normal Cartilage Fraction III Human Normal Cartilage pSport1 S0336
Human Normal Cartilage Fraction IV Human Normal Cartilage pSport1
S0338 Human Osteoarthritic Cartilage Fraction III Human
osteoarthritic disease pSport1 cartilage S0340 Human Osteoarthritic
Cartilage Fraction IV Human osteoarthritic disease pSport1
cartilage S0342 Adipocytees; re-excision Human Adipocytes from
Uni-ZAP XR Osteoclastoma S0344 Macrophage-oxLDL; re-excision
macrophage-oxidized LDL blood Cell Line Uni-ZAP XR treated S0346
Human Amygdala; re-excision Amygdala Uni-ZAP XR S0348 Cheek
Carcinoma Cheek Carcinoma disease pSport1 S0350 Pharynx Carcinoma
Pharynx carcinoma Hypopharynx disease pSport1 S0352 Larynx
Carcinoma Larynx carcinoma disease pSport1 S0354 Colon Normal II
Colon Normal Colon pSport1 S0356 Colon Carcinoma Colon Carcinoma
Colon disease pSport1 S0358 Colon Normal III Colon Normal Colon
pSport1 S0360 Colon Tumor II Colon Tumor Colon disease pSport1
S0362 Human Gastrocnemius Gastrocnemius muscle pSport1 S0364 Human
Quadriceps Quadriceps muscle pSport1 S0366 Human Soleus Soleus
Muscle pSport1 S0368 Human Pancreatic Langerhans Islets of
Langerhans pSport1 S0370 Larynx carcinoma II Larynx carcinoma
disease pSport1 S0372 Larynx carcinoma III Larynx carcinoma disease
pSport1 S0374 Normal colon Normal colon pSport1 S0376 Colon Tumor
Colon Tumor disease pSport1 S0378 Pancreas normal PCA4 No Pancreas
Normal PCA4 No pSport1 S0380 Pancreas Tumor PCA4 Tu Pancreas Tumor
PCA4 Tu disease pSport1 S0382 Larynx carcinoma IV Larynx carcinoma
disease pSport1 S0384 Tongue carcinoma Tongue carcinoma disease
pSport1 S0386 Human Whole Brain, re-excision Whole brain Brain ZAP
Express S0388 Human Hypothalamus, schizophrenia, re- Human
Hypothalamus, disease Uni-ZAP XR excision Schizophrenia S0390
Smooth muscle, control; re-excision Smooth muscle Pulmanary Cell
Line Uni-ZAP XR artery S0392 Salivary Gland Salivary gland; normal
pSport1 S0394 Stomach; normal Stomach; normal pSport1 S0396 Uterus;
normal Uterus; normal pSport1 S0398 Testis; normal Testis; normal
pSport1 S0400 Brain; normal Brain; normal pSport1 S0402 Adrenal
Gland, normal Adrenal gland; normal pSport1 S0404 Rectum normal
Rectum, normal pSport1 S0406 Rectum tumour Rectum tumour pSport1
S0408 Colon, normal Colon, normal pSport1 S0410 Colon, tumour
Colon, tumour pSport1 S0412 Temporal cortex-Alzheizmer; subtracted
Temporal cortex, alzheimer disease Other S0414 Hippocampus,
Alzheimer Subtracted Hippocampus, Alzheimer Other Subtracted S0418
CHME Cell Line; treated 5 hrs CHME Cell Line; treated pCMVSport 3.0
S0420 CHME Cell Line, untreated CHME Cell line, untreatetd pSport1
S0422 Mo7e Cell Line GM-CSF treated (1 ng/ml) Mo7e Cell Line GM-CSF
pCMVSport 3.0 treated (1 ng/ml) S0424 TF-1 Cell Line GM-CSF Treated
TF-1 Cell Line GM-CSF pSport1 Treated S0426 Monocyte activated;
re-excision Monocyte-activated blood Cell Line Uni-ZAP XR S0428
Neutrophils control; re-excision human neutrophils blood Cell Line
Uni-ZAP XR S0430 Aryepiglottis Normal Aryepiglottis Normal pSport1
S0432 Sinus piniformis Tumour Sinus piniformis Tumour pSport1 S0434
Stomach Normal Stomach Normal disease pSport1 S0436 Stomach Tumour
Stomach Tumour disease pSport1 S0438 Liver Normal Met5No Liver
Normal Met5No pSport1 S0440 Liver Tumour Met 5 Tu Liver Tumour
pSport1 S0442 Colon Normal Colon Normal pSport1 S0444 Colon Tumor
Colon Tumour disease pSport1 S0446 Tongue Tumour Tongue Tumour
pSport1 S0448 Larynx Normal Larynx Normal pSport1 S0450 Larynx
Tumour Larynx Tumour pSport1 S0452 Thymus Thymus pSport1 S0454
Placenta Placenta Placenta pSport1 S0456 Tongue Normal Tongue
Normal pSport1 S0458 Thyroid Normal (SDCA2 No) Thyroid normal
pSport1 S0460 Thyroid Tumour Thyroid Tumour pSport1 S0462 Thyroid
Thyroiditis Thyroid Thyroiditis pSport1 S0464 Larynx Normal Larynx
Normal pSport1 S0466 Larynx Tumor Larynx Tumor disease pSport1
S0468 Ea.hy.926 cell line Ea.hy.926 cell line pSport1 S0470
Adenocarcinoma PYFD disease pSport1 S0472 Lung Mesothelium PYBT
pSport1 S0474 Human blood platelets Platelets Blood platelets Other
S0665 Human Amygdala; re-excission Amygdala Uni-ZAP XR S3012 Smooth
Muscle Serum Treated, Norm Smooth muscle Pulmanary Cell Line
pBluescript artery S3014 Smooth muscle, serum induced, re-exc
Smooth muscle Pulmanary Cell Line pBluescript artery S6014 H.
hypothalamus, frac A Hypothalamus Brain ZAP Express S6016 H.
Frontal Cortex, Epileptic H. Brain, Frontal Cortex, Brain disease
Uni-ZAP XR Epileptic S6022 H. Adipose Tissue Human Adipose Tissue
Uni-ZAP XR S6024 Alzheimers, spongy change Alzheimer''s/Spongy
change Brain disease Uni-ZAP XR S6026 Frontal Lobe, Dementia
Frontal Lobe Brain Uni-ZAP XR dementia/Alzheimer''s S6028 Human
Manic Depression Tissue Human Manic depression Brain disease
Uni-ZAP XR tissue T0001 Human Brown Fat Brown Fat pBluescript SK-
T0002 Activated T-cells Activated T-Cell, PBL Blood Cell Line
pBluescript SK- fraction T0003 Human Fetal Lung Human Fetal Lung
pBluescript SK- T0004 Human White Fat Human White Fat pBluescript
SK- T0006 Human Pineal Gland Human Pinneal Gland pBluescript SK-
T0007 Colon Epithelium Colon Epithelium pBluescriptISK- T0008
Colorectal Tumor Colorectal Tumor disease pBluescript SK- T0010
Human Infant Brain Human Infant Brain Other T0023 Human Pancreatic
Carcinoma Human Pancreatic disease pBluescript SK- Carcinoma T0039
HSA 172 Cells Human HSA 172 cell line pBluescript SK- T0040 HSC172
cells SA172 Cells pBluescript SK- T0041 Jurkat T-cell G1 phase
Jurkat T-cell pBluescript SK- T0042 Jurkat T-Cell, S phase Jurkat
T-Cell Line pBluescript SK- T0047 T lymphocytes >70 T
lymphocytes >70 pBluescript SK- T0048 Human Aortic Endothelium
Human Aortic Endothilium pBluescript SK- T0049 Aorta endothelial
cells + TNF-a Aorta endothelial cells pBluescript SK- T0060 Human
White Adipose Human White Fat pBluescript SK- T0067 Human Thyroid
Human Thyroid pBluescript SK- T0068 Normal Ovary, Premenopausal
Normal Ovary, pBluescript SK- Premenopausal T0069 Human Uterus,
normal Human Uterus, normal pBluescript SK- T0070 Human Adrenal
Gland Human Adrenal Gland pBluescript SK- T0071 Human Bone Marrow
Human Bone Marrow pBluescript SK- T0078 Human Liver, normal adult
Human Liver, normal Adult pBluescript SK- T0079 Human Kidney,
normal Adult Human Kidney, normal pBluescript SK- Adult T0082 Human
Adult Retina Human Adult Retina pBluescript SK- T0090 Liver, normal
pBluescript SK- T0091 Liver, hepatocellular carcinoma pBluescript
SK- T0104 HCC cell line metastisis to liver pBluescript SK- T0109
Human (HCC) cell line liver (mouse) pBluescript SK- metastasis,
remake T0110 Human colon carcinoma (HCC) cell line, pBluescript SK-
remake T0112 Human (Caco-2) cell line, adenocarcinoma, pBluescript
SK- colon T0114 Human (Caco-2) cell line, adenocarcinoma,
pBluescript SK- colon, remake T0115 Human Colon Carcinoma (HCC)
cell line pBluescript SK- L0002 Atrium cDNA library Human heart
L0004 ClonTech HL 1065a L0005 Clontech human aorta polyA+ mRNA
(#6572) L0009 EST from 8p21.3-p22 L0012 HDMEC cDNA library L0015
Human L0021 Human adult (K. Okubo) L0022 Human adult lung 3''
directed MboI cDNA L0024 Human brain ARSanders L0032 Human
chromosome 12p cDNAs L0034 Human chromosome 14 L0038 Human
chromosome 6 L0040 Human colon mucosa L0041 Human epidermal
keratinocyte L0045 Human keratinocyte differential display (B. Lin)
L0051 Human mRNA (Tripodis and Ragoussis) L0052 Human normalized
K562-cDNA L0055 Human promyclocyte L0060 Human thymus NSTH II L0065
Liver HepG2 cell line. L0070 Selected chromosome 21 cDNA library
L0096 Subtracted human retina L0097 Subtracted human retinal
pigment epithelium (RPE) L0103 DKFZphamy1 amygdala L0105 Human
aorta polyA+ (TFujiwara) aorta L0109 Human brain cDNA brain L0118
Human fetal brain S. Meier-Ewert brain L0126 Human fibroblast cDNA
fibroblast L0138 Human normal gingiva normal gingiva L0141 Human
pancreatic islet cell pancreatic islet L0142 Human placenta cDNA
(TFujiwara) placenta L0143 Human placenta polyA+ (TFujiwara)
placenta L0146 Human fovea cDNA retinal fovea L0149 DKFZphsnu1
subthalamic nucleus L0151 Human testis (C. De Smet) testis L0157
Human fetal brain (TFujiwara) brain L0158 Human fetal brain QBoqin
brain L0162 Human brain frontal cortex frontal cortex brain L0163
Human heart cDNA (YNakamura) heart L0171 Human lung adenocarcinoma
A549 lung adenocarcinoma A549 L0175 Human retina cell line ARPE-19
retina ARPE-19 L0177 Human newborn melanocytes (T. Vogt) Clonetics
Corp. (San Diego, CA) strain #68 and 2486 L0182 Human HeLa (Y.
Wang) HeLa L0186 Human salivary gland cell line HSG salivary gland
HSG L0194 Human pancreatic cancer cell line Patu 8988t pancreatic
cancer Patu 8988t L0351 Infant brain, Bento Soares BA, M13-derived
L0352 Normalized infant brain, Bento Soares BA, M13-derived L0353
21q Placenta, F. Tassone and K. Gardiner Bluescript L0355 P, Human
foetal Brain Whole tissue Bluescript L0356 S, Human foetal Adrenals
tissue Bluescript L0361 Stratagene ovary (#937217) ovary Bluescript
SK L0362 Stratagene ovarian cancer (#937219) Bluescript SK- L0363
NCI_CGAP_GC2 germ cell tumor Bluescript SK- L0364 NCI_CGAP_GC5 germ
cell tumor Bluescript SK- L0365 NCI_CGAP_Phe1 pheochromocytoma
Bluescript SK- L0366 Stratagene schizo brain S11 schizophrenic
brain S-11 Bluescript SK- frontal lobe L0367 NCI_CGAP_Sch1
Schwannoma tumor Bluescript SK- L0368 NCI_CGAP_SS1 synovial sarcoma
Bluescript SK- L0369 NCI_CGAP_AA1 adrenal adenoma adrenal gland
Bluescript SK- L0370 Johnston frontal cortex pooled frontal lobe
brain Bluescript SK- L0371 NCI_CGAP_Br3 breast tumor breast
Bluescript SK- L0372 NCI_CGAP_Co12 colon tumor colon Bluescript SK-
L0373 NCI_CGAP_Co11 tumor colon Bluescript SK- L0374 NCI_CGAP_Co2
tumor colon Bluescript SK-
L0375 NCI_CGAP_Kid6 kidney tumor kidney Bluescript SK- L0376
NCI_CGAP_Lar1 larynx larynx Bluescript SK- L0377 NCI_CGAP_HN2
squamous cell carcinoma larynx Bluescript SK- from vocal cord L0378
NCI_CGAP_Lu1 lung tumor lung Bluescript SK- L0379 NCI_CGAP_Lym3
lymphoma lymph node Bluescript SK- L0380 NCI_CGAP_HN1 squamous cell
carcinoma lymph node Bluescript SK- L0381 NCI_CGAP_HN4 squamous
cell carcinoma pharynx Bluescript SK- L0382 NCI_CGAP_Pr25
epithelium (cell line) prostate Bluescript SK- L0383 NCI_CGAP_Pr24
invasive tumor (cell line) prostate Bluescript SK- L0384
NCI_CGAP_Pr23 prostate tumor prostate Bluescript SK- L0385
NCI_CGAP_Gas1 gastric tumor stomach Bluescript SK- L0386
NCI_CGAP_HN3 squamous cell carcinoma tongue Bluescript SK- from
base of tongue L0387 NCI_CGAP_GCB0 germinal center B-cells tonsil
Bluescript SK- L0388 NCI_CGAP_HN6 normal gingiva (cell line
Bluescript SK- from immortalized kerati L0389 NCI_CGAP_HN5 normal
gingiva (cell line Bluescript SK- from primary keratinocyt L0393 B,
Human Liver tissue gt11 L0394 H, Human adult Brain Cortex tissue
gt11 L0404 b4HB3MA Cot109 + 103 + 85-Bio Lafmid A L0405 b4HB3MA
Cot109 + 103-Bio Lafmid A L0411 1-NIB Lafmid BA L0414 b4HB3MA
Lafmid BA L0415 b4HB3MA Cot8-HAP-Ft Lafmid BA L0416
b4HB3MA-Cot0.38-HAP-B Lafmid BA L0417 b4HB3MA-Cot0.38-HAP-Ft-6
Lafmid BA L0422 b4HB3MA-Cot12-HAP-B Lafmid BA L0424 b4HB3MA-Cot14.5
Lafmid BA L0425 b4HB3MA-Cot18-Bio Lafmid BA L0426
b4HB3MA-Cot51.5-HAP-Ft Lafmid BA L0427 b4HB3MA-FT20%-Biotin Lafmid
BA L0428 Cot1374Ft-4HB3MA Lafmid BA L0430 Cot250Ft-b4HB3MA Lafmid
BA L0434 Infant brain library of Dr. M. Soares lafmid BA L0435
Infant brain, LLNL array of Dr. M. Soares lafmid BA 1NIB L0437
N-b4HB3MA-Cot109 Lafmid BA L0438 normalized infant brain cDNA total
brain brain lafmid BA L0439 Soares infant brain 1NIB whole brain
Lafmid BA L0441 2HB3MK Lafmid BK L0442 4HB3MK Lafmid BK L0443
b4HB3MK Lafmid BK L0446 N4HB3MK Lafmid BK L0447 NHB3MK Lafmid BK
L0448 3HFLSK20 Lafmid K L0451 N3HFLSK20 Lafmid K L0453 BATM1 lambda
gt10 L0454 Clontech adult human fat cell library lambda gt10
HL1108A L0455 Human retina cDNA randomly primed retina eye lambda
gt10 sublibrary L0456 Human retina cDNA Tsp509I-cleaved retina eye
lambda gt10 sublibrary L0457 multi-tissue normalized short-fragment
multi-tissue pooled lambda gt10 L0459 Adult heart, Clontech Lambda
gt11 L0460 Adult heart, Lambda gt11 Lambda gt11 L0462 WATM1 lambda
gt11 L0463 fetal brain cDNA brain brain lambda gt11 L0465 TEST1,
Human adult Testis tissue lambda nm1149 L0468 HE6W lambda zap L0469
T, Human adult Rhabdomyosarcoma Lambda Zap cell-line L0470 BL29
Burkitt''s lymphoma, Pascalis Sideras lambda ZAP 2 L0471 Human
fetal heart, Lambda ZAP Express Lambda ZAP Express L0475 KG1-a
Lambda Zap Express cDNA library KG1-a Lambda Zap Express
(Stratagene) L0476 Fetal brain, Stratagene Lambda ZAP II L0477 HPLA
CCLee placenta Lambda ZAP II L0480 Stratagene cat#937212 (1992)
Lambda ZAP, pBluescript SK(-) L0481 CD34+DIRECTIONAL Lambda ZAPII
L0483 Human pancreatic islet Lambda ZAPII L0485 STRATAGENE Human
skeletal muscle skeletal muscle leg muscle Lambda ZAPII cDNA
library, cat. #936215. L0487 Human peripheral blood (Steve Elledge)
whole peripheral blood Lambda-Yes L0492 Human Genomic pAMP L0493
NCI_CGAP_Ov26 papillary serous carcinoma ovary pAMP1 L0497
NCI_CGAP_HSC4 CD34+, CD38- from normal bone marrow pAMP1 bone
marrow donor L0498 NCI_CGAP_HSC3 CD34+, T negative, patient bone
marrow pAMP1 with chronic myelogenou L0499 NCI_CGAP_HSC2 stem cell
34+/38+ bone marrow pAMP1 L0500 NCI_CGAP_Brn20 oligodendroglioma
brain pAMP1 L0501 NCI_CGAP_Brn21 oligodendroglioma brain pAMP1
L0502 NCI_CGAP_Br15 adenocarcinoma breast pAMP1 L0503 NCI_CGAP_Br17
adenocarcinoma breast pAMP1 L0504 NCI_CGAP_Br13 breast carcinoma in
situ breast pAMP1 L0505 NCI_CGAP_Br12 invasive carcinoma breast
pAMP1 L0506 NCI_CGAP_Br16 lobullar carcinoma in situ breast pAMP1
L0507 NCI_CGAP_Br14 normal epithelium breast pAMP1 L0508
NCI_CGAP_Lu25 bronchioalveolar carcinoma lung pAMP1 L0509
NCI_CGAP_Lu26 invasive adenocarcinoma lung pAMP1 L0510
NCI_CGAP_Ov33 borderline ovarian carcinoma ovary pAMP1 L0511
NCI_CGAP_Ov34 borderline ovarian carcinoma ovary pAMP1 L0512
NCI_CGAP_Ov36 borderline ovarian carcinoma ovary pAMP1 L0513
NCI_CGAP_Ov37 early stage papillary serous ovary pAMP1 carcinoma
L0514 NCI_CGAP_Ov31 papillary serous carcinoma ovary pAMP1 L0515
NCI_CGAP_Ov32 papillary serous carcinoma ovary pAMP1 L0516
Chromosome 19p12-p13.1 exon pAMP10 L0517 NCI_CGAP_Pr1 pAMP10 L0518
NCI_CGAP_Pr2 pAMP10 L0519 NCI_CGAP_Pr3 pAMP10 L0520 NCI_CGAP_Alv1
alveolar rhabdomyosarcoma pAMP10 L0521 NCI_CGAP_Ew1 Ewing''s
sarcoma pAMP10 L0522 NCI_CGAP_Kid1 kidney pAMP10 L0523
NCI_CGAP_Lip2 liposarcoma pAMP10 L0524 NCI_CGAP_Li1 liver pAMP10
L0525 NCI_CGAP_Li2 liver pAMP10 L0526 NCI_CGAP_Pr12 metastatic
prostate bone pAMP10 lesion L0527 NCI_CGAP_Ov2 ovary pAMP10 L0528
NCI_CGAP_Pr5 prostate pAMP10 L0529 NCI_CGAP_Pr6 prostate pAMP10
L0530 NCI_CGAP_Pr8 prostate pAMP10 L0531 NCI_CGAP_Pr20 prostate
metastasis, liver pAMP10 L0532 NCI_CGAP_Thy1 thyroid pAMP10 L0533
NCI_CGAP_HSC1 stem cells bone marrow pAMP10 L0534 Chromosome 7
Fetal Brain cDNA Library brain brain pAMP10 L0535 NCI_CGAP_Br5
infiltrating ductal carcinoma breast pAMP10 L0536 NCI_CGAP_Br4
normal ductal tissue breast pAMP10 L0537 NCI_CGAP_Ov6 normal
cortical stroma ovary pAMP10 L0539 Chromosome 7 Placental cDNA
Library placenta pAMP10 L0540 NCI_CGAP_Pr10 invasive prostate tumor
prostate pAMP10 L0541 NCI_CGAP_Pr7 low-grade prostatic neoplasia
prostate pAMP10 L0542 NCI_CGAP_Pr11 normal prostatic epithelial
prostate pAMP10 cells L0543 NCI_CGAP_Pr9 normal prostatic
epithelial prostate pAMP10 cells L0544 NCI_CGAP_Pr4 prostatic
intraepithelial prostate pAMP10 neoplasia --high grade L0545
NCI_CGAP_Pr4.1 prostatic intraepithelial prostate pAMP10 neoplasia
--high grade L0546 NCI_CGAP_Pr18 stroma prostate pAMP10 L0547
NCI_CGAP_Pr16 tumor prostate pAMP10 L0548 Chromosome 7 Thymus cDNA
Library thymus thymus pAMP10 L0549 NCI_CGAP_HN10 carcinoma in situ
from pAMP10 retromolar trigone L0550 NCI_CGAP_HN9 normal squamous
epithelium pAMP10 from retromolar trigone L0551 NCI_CGAP_HN7 normal
squamous pAMP10 epithelium, floor of mouth L0552 NCI_CGAP_HN8
well-differentiated invasive pAMP10 carcinoma, floor of m L0553
NCI_CGAP_Co22 colonic adenocarcinoma colon pAMP10 L0554
NCI_CGAP_Li8 liver pAMP10 L0555 NCI_CGAP_Lu34 large cell carcinoma
lung pAMP10 L0556 NCI_CGAP_Lu34.1 large cell carcinoma lung pAMP10
L0558 NCI_CGAP_Ov40 endometrioid ovarian ovary pAMP10 metastasis
L0559 NCI_CGAP_Ov39 papillary serous ovarian ovary pAMP10
metastasis L0560 NCI_CGAP_HN12 moderate to poorly tongue pAMP10
differentiated invasive carcino L0561 NCI_CGAP_HN11 normal squamous
epithelium tongue pAMP10 L0562 Chromosome 7 HeLa cDNA Library HeLa
cell pAMP10 line; ATCC L0563 Human Bone Marrow Stromal Fibroblast
bone marrow pBluescript L0564 Jia bone marrow stroma bone marrow
stroma pBluescript L0565 Normal Human Trabecular Bone Cells Bone
Hip pBluescript L0579 Human fetal brain QBoqin2 cerebrum and
cerebellum pBluescript SK L0581 Stratagene liver (#937224) liver
pBluescript SK L0583 Stratagene cDNA library Human fibroblast,
pBluescript SK(+) cat#937212 L0584 Stratagene cDNA library Human
heart, pBluescript SK(+) cat#936208 L0586 HTCDLI pBluescript SK(-)
L0587 Stratagene colon HT29 (#937221) pBluescript SK- L0588
Stratagene endothelial cell 937223 pBluescript SK- L0589 Stratagene
fetal retina 937202 pBluescript SK- L0590 Stratagene fibroblast
(#937212) pBluescript SK- L0591 Stratagene HeLa cell s3 937216
pBluescript SK- L0592 Stratagene hNT neuron (#937233) pBluescript
SK- L0593 Stratagene neuroepithelium (#937231) pBluescript SK-
L0594 Stratagene neuroepithelium NT2RAMI pBluescript SK- 937234
L0595 Stratagene NT2 neuronal precursor 937230 neuroepithelial
cells brain pBluescript SK- L0596 Stratagene colon (#937204) colon
pBluescript SK- L0597 Stratagene corneal stroma (#937222) cornea
pBluescript SK- L0598 Morton Fetal Cochlea cochlea ear pBluescript
SK- L0599 Stratagene lung (#937210) lung pBluescript SK- L0600
Weizmann Olfactory Epithelium olfactory epithelium nose pBluescript
SK- L0601 Stratagene pancreas (#937208) pancreas pBluescript SK-
L0602 Pancreatic Islet pancreatic islet pancreas pBluescript SK-
L0603 Stratagene placenta (#937225) placenta pBluescript SK- L0604
Stratagene muscle 937209 muscle skeletal muscle pBluescript SK-
L0605 Stratagene fetal spleen (#937205) fetal spleen spleen
pBluescript SK- L0606 NCI_CGAP_Lym5 follicular lymphoma lymph node
pBluescript SK- L0607 NCI_CGAP_Lym6 mantle cell lymphoma lymph node
pBluescript SK- L0608 Stratagene lung carcinoma 937218 lung
carcinoma lung NCI-H69 pBluescript SK- L0609 Schiller astrocytoma
astrocytoma brain pBluescript SK- (Stratagene) L0611 Schiller
meningioma meningioma brain pBluescript SK- (Stratagene) L0612
Schiller oligodendroglioma oligodendroglioma brain pBluescript SK-
(Stratagene) L0615 22 week old human fetal liver cDNA library
pBluescriptII SK(-) L0617 Chromosome 22 exon pBluescriptIIKS+ L0619
Chromosome 9 exon II pBluescriptIIKS+ L0622 HM1 pcDNAII
(Invitrogen) L0623 HM3 pectoral muscle (after pcDNAII mastectomy)
(Invitrogen) L0625 NCI_CGAP_AR1 bulk alveolar tumor pCMV-SPORT2
L0626 NCI_CGAP_GC1 bulk germ cell seminoma pCMV-SPORT2 L0627
NCI_CGAP_Col bulk tumor colon pCMV-SPORT2 L0628 NCI_CGAP_Ov1 ovary
bulk tumor ovary pCMV-SPORT2 L0629 NCI_CGAP_Mel3 metastatic
melanoma to bowel (skin pCMV-SPORT4 bowel primary) L0630
NCI_CGAP_CNS1 substantia nigra brain pCMV-SPORT4 L0631 NCI_CGAP_Br7
breast pCMV-SPORT4 L0632 NCI_CGAP_Li5 hepatic adenoma liver
pCMV-SPORT4 L0633 NCI_CGAP_Lu6 small cell carcinoma lung
pCMV-SPORT4 L0634 NCI_CGAP_Ov8 serous adenocarcinoma ovary
pCMV-SPORT4 L0635 NCI_CGAP_PNS1 dorsal root ganglion peripheral
pCMV-SPORT4 nervous system L0636 NCI_CGAP_Pit1 four pooled
pituitary brain pCMV-SPORT6 adenomas L0637 NCI_CGAP_Brn53 three
pooled meningiomas brain pCMV-SPORT6 L0638 NCI_CGAP_Brn35 tumor, 5
pooled (see brain pCMV-SPORT6 description) L0639 NCI_CGAP_Brn52
tumor, 5 pooled (see brain pCMV-SPORT6 description) L0640
NCI_CGAP_Br18 four pooled high-grade breast pCMV-SPORT6 tumors,
including two prima L0641 NCI_CGAP_Co17 juvenile granulosa tumor
colon pCMV-SPORT6 L0642 NCI_CGAP_Co18 moderately differentiated
colon pCMV-SPORT6 adenocarcinoma L0643 NCI_CGAP_Co19 moderately
differentiated colon pCMV-SPORT6 adenocarcinoma L0644 NCI_CGAP_Co20
moderately differentiated colon pCMV-SPORT6 adenocarcinoma L0645
NCI_CGAP_Co21 moderately differentiated colon pCMV-SPORT6
adenocarcinoma L0646 NCI_CGAP_Co14 moderately-differentiated colon
pCMV-SPORT6 adenocarcinoma L0647 NCI_CGAP_Sar4 five pooled
sarcomas, connective tissue pCMV-SPORT6 including myxoid
liposarcoma L0648 NCI_CGAP_Eso2 squamous cell carcinoma esophagus
pCMV-SPORT6 L0649 NCI_CGAP_GU1 2 pooled high-grade genitourinary
pCMV-SPORT6 transitional cell tumors tract L0650 NCI_CGAP_Kid13 2
pooled Wilms" tumors, one kidney pCMV-SPORT6 primary and one metast
L0651 NCI_CGAP_Kid8 renal cell tumor kidney pCMV-SPORT6 L0652
NCI_CGAP_Lu27 four pooled poorly- lung pCMV-SPORT6 differentiated
adenocarcinomas L0653 NCI_CGAP_Lu28 two pooled squamous cell lung
pCMV-SPORT6 carcinomas L0654 NCI_CGAP_Lu31 lung, cell line
pCMV-SPORT6 L0655 NCI_CGAP_Lym12 lymphoma, follicular mixed lymph
node pCMV-SPORT6 small and large cell L0656 NCI_CGAP_Ov38 normal
epithelium ovary pCMV-SPORT6 L0657 NCI_CGAP_Ov23 tumor, 5 pooled
(see ovary pCMV-SPORT6 description) L0658 NCI_CGAP_Ov35 tumor, 5
pooled (see ovary pCMV-SPORT6 description) L0659 NCI_CGAP_Pan1
adenocarcinoma pancreas pCMV-SPORT6 L0661 NCI_CGAP_Mel15 malignant
melanoma, skin pCMV-SPORT6 metastatic to lymph node L0662
NCI_CGAP_Gas4 poorly differentiated stomach pCMV-SPORT6
adenocarcinoma with signet r L0663 NCI_CGAP_Ut2
moderately-differentiated uterus pCMV-SPORT6 endometrial
adenocarcino L0664 NCI_CGAP_Ut3 poorly-differentiated uterus
pCMV-SPORT6 endometrial adenocarcinoma, L0665 NCI_CGAP_Ut4 serous
papillary carcinoma, uterus pCMV-SPORT6 high grade, 2 pooled t
L0666 NCI_CGAP_Ut1 well-differentiated uterus pCMV-SPORT6
endometrial adenocarcinoma, 7 L0667 NCI_CGAP_CML1 myeloid cells, 18
pooled whole blood pCMV-SPORT6 CML cases, BCR/ABL rearra L0669
Human MCF7 cDNA subtracted with MDA- breast adenocarcinoma breast
MCF7 pCR II [Invitrogen] MB-231 cDNA L0681 Stanley Frontal SN
individual frontal lobe (see description) brain pCR2.1 (Invitrogen)
L0682 Stanley Frontal NB pool 2 frontal lobe (see description)
brain pCR2.1-TOPO (Invitrogen) L0683 Stanley Frontal NS pool 2
frontal lobe (see description) brain pCR2.1-TOPO (Invitrogen) L0684
Stanley Frontal SB pool 1 frontal lobe (see description) brain
pCR2.1-TOPO (Invitrogen) L0685 Stanley Frontal SN pool 1 frontal
lobe (see description) brain pCR2.1-TOPO (Invitrogen) L0686 Stanley
Frontal SN pool 2 frontal lobe (see description) brain pCR2.1-TOPO
(Invitrogen) L0687 Stanley Hippocampus NB pool 1 hippocampus (see
brain pCR2.1-TOPO description) (Invitrogen) L0688 Stanley
Hippocampus SB pool 1 hippocampus (see brain pCR2.1-TOPO
description) (Invitrogen) L0689 Stanley Hippocampus SN pool 1
hippocampus (see brain pCR2.1-TOPO description) (Invitrogen) L0695
Human Glialblastoma Cell Brain BT-325 PCRII, Invitrogen L0697
Testis 1 PGEM 5zf(+) L0698 Testis 2 PGEM 5zf(+) L0700 Outward
Alu-primed hncDNA library pGEM-3Z L0709 NIH_MGC_21 choriocarcinoma
placenta pOTB7 L0710 NIH_MGC_7 small cell carcinoma lung MGC3 pOTB7
L0716 PMA-induced HL60 cell subtraction library PMA- pSPORT 1
induced HL60 human leukemic cell line L0717 Gessler Wilms tumor
pSPORT1 L0718 Testis 5 pSPORT1 L0719 human embryo cDNA library
Whole embryo pSPORT1 L0731 Soares_pregnant_uterus_NbHPU uterus
pT7T3-Pac L0738 Human colorectal cancer pT7T3D L0740 Soares
melanocyte 2NbHM melanocyte pT7T3D (Pharmacia) with a modified
polylinker L0741 Soares adult brain N2b4HB55Y brain pT7T3D
(Pharmacia) with a modified polylinker L0742 Soares adult brain
N2b5HB55Y brain pT7T3D (Pharmacia) with a modified polylinker L0743
Soares breast 2NbHBst breast pT7T3D (Pharmacia) with a modified
polylinker L0744 Soares breast 3NbHBst breast pT7T3D (Pharmacia)
with a modified polylinker L0745 Soares retina N2b4HR retina eye
pT7T3D (Pharmacia) with a modified polylinker L0746 Soares retina
N2b5HR retina eye pT7T3D (Pharmacia) with a modified polylinker
L0747 Soares_fetal_heart_NbHH19W heart pT7T3D (Pharmacia) with a
modified polylinker L0748 Soares fetal liver spleen 1NFLS Liver and
Spleen pT7T3D (Pharmacia) with a modified polylinker L0749
Soares_fetal_liver_spleen_1NFLS_S1 Liver and Spleen pT7T3D
(Pharmacia) with a modified polylinker L0750
Soares_fetal_lung_NbHL19W lung pT7T3D (Pharmacia) with a modified
polylinker L0751 Soares ovary tumor NbHOT ovarian tumor ovary
pT7T3D (Pharmacia) with a modified polylinker L0752
Soares_parathyroid_tumor_NbHPA parathyroid tumor parathyroid pT7T3D
gland (Pharmacia) with a modified polylinker L0753
Soares_pineal_gland_N3HPG pineal gland pT7T3D (Pharmacia) with a
modified polylinker L0754 Soares placenta Nb2HP placenta pT7T3D
(Pharmacia) with a modified polylinker L0755
Soares_placenta_8to9weeks_2NbHP8to9W placenta pT7T3D (Pharmacia)
with a modified polylinker L0756 Soares_multiple_sclerosis_2NbHMSP
multiple sclerosis lesions pT7T3D (Pharmacia) with a modified
polylinker V_TYPE L0757 Soares_senescent_fibroblasts_NbHSF
senescent fibroblast pT7T3D (Pharmacia) with a modified polylinker
V_TYPE L0758 Soares_testis_NHT pT7T3D-Pac (Pharmacia) with a
modified polylinker L0759 Soares_total_fetus_Nb2HF8_9w pT7T3D-Pac
(Pharmacia) with a modified polylinker L0760 Barstead aorta HPLRB3
aorta pT7T3D-Pac (Pharmacia) with a modified polylinker L0761
NCI_CGAP_CLL1 B-cell, chronic lymphotic pT7T3D-Pac leukemia
(Pharmacia) with a modified polylinker L0762 NCI_CGAP_Br1.1 breast
pT7T3D-Pac (Pharmacia) with a modified polylinker L0763
NCI_CGAP_Br2 breast pT7T3D-Pac (Pharmacia) with a modified
polylinker L0764 NCI_CGAP_Co3 colon pT7T3D-Pac (Pharmacia) with a
modified polylinker L0765 NCI_CGAP_Co4 colon pT7T3D-Pac (Pharmacia)
with a modified polylinker L0766 NCI_CGAP_GCB1 germinal center B
cell pT7T3D-Pac (Pharmacia) with a modified polylinker L0767
NCI_CGAP_GC3 pooled germ cell tumors pT7T3D-Pac (Pharmacia) with a
modified polylinker L0768 NCI_CGAP_GC4 pooled germ cell tumors
pT7T3D-Pac (Pharmacia) with a modified polylinker L0769
NCI_CGAP_Brn25 anaplastic brain pT7T3D-Pac oligodendroglioma
(Pharmacia) with a modified polylinker L0770 NCI_CGAP_Brn23
glioblastoma (pooled) brain pT7T3D-Pac (Pharmacia) with a modified
polylinker L0771 NCI_CGAP_Co8 adenocarcinoma colon pT7T3D-Pac
(Pharmacia) with a modified polylinker L0772 NCI_CGAP_Co10 colon
tumor RER+ colon pT7T3D-Pac (Pharmacia) with a modified polylinker
L0773 NCI_CGAP_Co9 colon tumor RER+ colon pT7T3D-Pac (Pharmacia)
with a modified polylinker L0774 NCI_CGAP_Kid3 kidney pT7T3D-Pac
(Pharmacia) with a modified polylinker L0775 NCI_CGAP_Kid5 2 pooled
tumors (clear cell kidney pT7T3D-Pac type) (Pharmacia) with a
modified polylinker L0776 NCI_CGAP_Lu5 carcinoid lung pT7T3D-Pac
(Pharmacia) with a modified polylinker L0777 Soares_NhHMPu_S1
Pooled human melanocyte, mixed (see pT7T3D-Pac fetal heart, and
pregnant below) (Pharmacia) with a modified polylinker L0778
Barstead pancreas HPLRB1 pancreas pT7T3D-Pac (Pharmacia) with a
modified polylinker L0779 Soares_NFL_T_GBC_S1 pooled pT7T3D-Pac
(Pharmacia) with a modified polylinker L0780
Soares_NSF_F8_9W_OT_PA_P_S1 pooled pT7T3D-Pac (Pharmacia) with a
modified polylinker L0782 NCI_CGAP_Pr21 normal prostate prostate
pT7T3D-Pac (Pharmacia) with a modified polylinker L0783
NCI_CGAP_Pr22 normal prostate prostate pT7T3D-Pac (Pharmacia) with
a modified polylinker L0784 NCI_CGAP_Lei2 leiomyosarcoma soft
tissue pT7T3D-Pac (Pharmacia) with a modified polylinker L0785
Barstead spleen HPLRB2 spleen pT7T3D-Pac (Pharmacia) with a
modified polylinker L0786 Soares_NbHFB whole brain pT7T3D-Pac
(Pharmacia) with a modified polylinker L0787 NCI_CGAP_Sub1
pT7T3D-Pac (Pharmacia) with a modified polylinker L0788
NCI_CGAP_Sub2 pT7T3D-Pac (Pharmacia) with a modified polylinker
L0789 NCI_CGAP_Sub3 pT7T3D-Pac (Pharmacia) with a modified
polylinker L0790 NCI_CGAP_Sub4 pT7T3D-Pac (Pharmacia) with a
modified polylinker L0791 NCI_CGAP_Sub5 pT7T3D-Pac (Pharmacia) with
a modified polylinker L0792 NCI_CGAP_Sub6 pT7T3D-Pac (Pharmacia)
with a modified polylinker L0793 NCI_CGAP_Sub7 pT7T3D-Pac
(Pharmacia) with a modified polylinker L0794 NCI_CGAP_GC6 pooled
germ cell tumors pT7T3D-Pac (Pharmacia) with a modified polylinker
L0796 NCI_CGAP_Brn50 medulloblastoma brain pT7T3D-Pac (Pharmacia)
with a modified polylinker L0800 NCI_CGAP_Co16 colon tumor, RER+
colon pT7T3D-Pac
(Pharmacia) with a modified polylinker L0803 NCI_CGAP_Kid11 kidney
pT7T3D-Pac (Pharmacia) with a modified polylinker L0804
NCI_CGAP_Kid12 2 pooled tumors (clear cell kidney pT7T3D-Pac type)
(Pharmacia) with a modified polylinker L0805 NCI_CGAP_Lu24
carcinoid lung pT7T3D-Pac (Pharmacia) with a modified polylinker
L0806 NCI_CGAP_Lu19 squamous cell carcinoma, lung pT7T3D-Pac poorly
differentiated (4 (Pharmacia) with a modified polylinker L0807
NCI_CGAP_Ov18 fibrotheoma ovary pT7T3D-Pac (Pharmacia) with a
modified polylinker L0808 Barstead prostate BPH HPLRB4 1 prostate
pT7T3D-Pac (Pharmacia) with a modified polylinker L0809
NCI_CGAP_Pr28 prostate pT7T3D-Pac (Pharmacia) with a modified
polylinker L0811 BATM2 PTZ18 L0988 BT0387 breast puc18 L1430 CT0225
colon puc18 L1562 CN0027 colon_normal puc18 L1819 HT0268 head_neck
puc18 L2138 ST0186 stomach puc18 L2245 NEM subtracted human fetal
kidney cDNA pUEX1 L2250 Human cerebral cortex cerebral cortex L2251
Human fetal lung Fetal lung L2252 Human placenta placenta L2255 GLC
corresponding non cancerous pBluescript sk(-) liver tissue L2257
NIH_MGC_65 adenocarcinoma colon pCMV-SPORT6 L2258 NIH_MGC_67
retinoblastoma eye pCMV-SPORT6 L2259 NIH_MGC_68 large cell
carcinoma lung pCMV-SPORT6 L2260 NIH_MGC_69 large cell carcinoma,
lung pCMV-SPORT6 undifferentiated L2261 NIH_MGC_70 epithelioid
carcinoma pancreas pCMV-SPORT6 L2262 NIH_MGC_72 melanotic melanoma
skin pCMV-SPORT6 L2263 NIH_MGC_66 adenocarcinoma ovary pCMV-SPORT6
L2264 NIH_MGC_71 leiomyosarcoma uterus pCMV-SPORT6 L2265 NIH_MGC_39
adenocarcinoma pancreas pOTB7 L2269 NCI_CGAP_Thy11 follicular
carcinoma thyroid pAMP10 L2270 Lupski_dorsal_root_ganglion dorsal
root ganglia pCMV-SPORT6 (Life Technologies) L2285 BT0723 breast
puc18 L2289 BT0757 breast puc18 L2293 BT0762 breast puc18 L2300
BT0789 breast puc18 L2323 CT0406 colon puc18 L2336 CT0428 colon
puc18 L2352 UT0001 uterus_tumor puc18 L2357 UT0021 uterus_tumor
puc18 L2359 UT0023 uterus_tumor puc18 L2368 UT0041 uterus_tumor
puc18 L2380 NN0068 nervous_normal puc18 L2381 NN0070 nervous_normal
puc18 L2402 NN0118 nervous_normal puc18 L2412 NN0136 nervous_normal
puc18 L2439 NN1022 nervous_normal puc18 L2482 HT0497 head_neck
puc18 L2486 HT0527 head_neck puc18 L2487 HT0542 head_neck puc18
L2491 HT0559 head_neck puc18 L2497 HT0618 head_neck puc18 L2499
HT0622 head_neck puc18 L2504 HT0636 head_neck puc18 L2519 HT0698
head_neck puc18 L2528 HT0713 head_neck puc18 L2543 HT0734 head_neck
puc18 L2551 HT0744 head_neck puc18 L2630 HT0865 head_neck puc18
L2635 HT0875 head_neck puc18 L2647 HT0894 head_neck puc18 L2652
NIH_MGC_57 glioblastoma brain pDNR-LIB (Clontech) L2653 NIH_MGC_58
hypernephroma kidney pDNR-LIB (Clontech) L2654 NIH_MGC_9
adenocarcinoma cell line ovary pOTB7 L2655 NIH_MGC_55 from acute
myelogenous bone marrow pDNR-LIB leukemia (Clontech) L2657
NIH_MGC_54 from chronic myelogenous bone marrow pDNR-LIB leukemia
(Clontech) L2669 NT0022 nervous_tumor puc18 L2670 NT0023
nervous_tumor puc18 L2673 NT0028 nervous_tumor puc18 L2675 NT0033
nervous_tumor puc18 L2706 NT0102 nervous_tumor puc18 L2744 FT0004
prostate_tumor puc18 L2758 FT0027 prostate_tumor puc18 L2759 FT0028
prostate_tumor puc18 L2767 FT0044 prostate_tumor puc18 L2771 FT0050
prostate_tumor puc18 L2777 FT0056 prostate_tumor puc18 L2791 FT0077
prostate_tumor puc18 L2800 FT0097 prostate_tumor puc18 L2842 UM0009
uterus puc18 L2877 AN0027 amnion_normal puc18 L2879 AN0032
amnion_normal puc18 L2903 BN0039 breast_normal puc18 L2904 BN0042
breast_normal puc18 L2906 BN0047 breast_normal puc18 L2909 BN0067
breast_normal puc18 L2910 BN0070 breast_normal puc18 L2915 BN0098
breast_normal puc18 L2985 BN0257 breast_normal puc18 L2991 BN0264
breast_normal puc18 L2999 BN0273 breast_normal puc18 L3001 BN0275
breast_normal puc18 L3012 BN0296 breast_normal puc18 L3019 BN0303
breast_normal puc18 L3092 ET0023 lung_tumor puc18 L3109 ET0046
lung_tumor puc18 L3117 ET0068 lung_tumor puc18 L3119 ET0072
lung_tumor puc18 L3180 MT0101 marrow puc18 L3181 MT0107 marrow
puc18 L3210 OT0067 ovary puc18 L3215 OT0083 ovary puc18 L3271
FN0094 prostate_normal puc18 L3278 FN0104 prostate_normal puc18
L3280 FN0106 prostate_normal puc18 L3311 FN0180 prostate_normal
puc18 L3327 SN0024 stomach_normal puc18 L3357 TN0034 testis_normal
puc18 L3372 TN0068 testis_normal puc18 L3378 TN0080 testis_normal
puc18 L3385 Homo sapiens HeLa HeLa L3387 GKB hepatocellular
carcinoma pBluescript sk(-) L3388 GKC hepatocellular carcinoma
pBluescript sk(-) L3391 NIH_MGC_53 carcinoma, cell line bladder
pDNR-LIB (Clontech) L3450 CT0508 colon puc18 L3485 GN0070
placenta_normal puc18 L3499 HT0617 head_neck puc18 L3503 HT0870
head_neck puc18 L3516 HT0913 head_neck puc18 L3560 TN0023
testis_normal puc18 L3563 TN0037 testis_normal puc18 L3566 TN0046
testis_normal puc18 L3576 TN0086 testis_normal puc18 L3585 TN0119
testis_normal puc18 L3592 TN0129 testis_normal puc18 L3630 UT0071
uterus_tumor puc18 L3632 UT0074 uterus_tumor puc18 L3642 ADA
Adrenal gland pBluescript sk(-) L3643 ADB Adrenal gland pBluescript
sk(-) L3644 ADC Adrenal gland pBluescript sk(-) L3645 Cu adrenal
cortico adenoma for pBluescript sk(-) Cushing''s syndrome L3646 DCA
pTriplEx2 L3647 Human HO-1 melanoma cells L3649 DCB pTriplEx2 L3651
FHTA hypothalamus pTriplEx2 L3652 FHTB hypothalamus pTriplEx2 L3653
HTB Hypothalamus pBluescript sk(-) L3655 HTC Hypothalamus
pBluescript sk(-) L3657 HTF Hypothalamus pBluescript sk(-) L3658
cdA pheochromocytoma pTriplEx2 L3659 CB cord blood pBluescript
L3660 NP1 pituitary pBluescript sk(-) L3661 NPA pituitary
pBluescript sk(-) L3663 NIH_MGC_60 adenocarcinoma prostate pDNR-LIB
(Clontech) L3665 NIH_MGC_75 kidney pDNR-LIB (Clontech) L3709 CT0515
colon puc18 L3726 GN0038 placenta_normal puc18 L3729 GN0079
placenta_normal puc18 L3750 HT0945 head_neck puc18 L3783 TN0136
testis_normal puc18 L3796 UT0042 uterus_tumor puc18 L3807 UT0077
uterus_tumor puc18 L3811 NPC pituitary pBluescript sk(-) L3812 NPD
pituitary pBluescript sk(-) L3813 TP pituitary tumor pTriplEx2
L3814 BM Bone marrow pTriplEx2 L3815 MDS Bone marrow pTriplEx2
L3816 HEMBA1 whole embryo, mainly head pME18SFL3 L3817 HEMBB1 whole
embryo, mainly body pME18SFL3 L3818 MAMMA1 mammary gland pME18SFL3
L3820 NIH_MGC_46 leiomyosarcoma cell line uterus pOTB7 L3821
NIH_MGC_48 primary B-cells from tonsils B-cells pOTB7 (cell line)
L3822 NIH_MGC_59 mucoepidermoid carcinoma lung pDNR-LIB (Clontech)
L3823 NT2RM1 NT2 pUC19FL3 L3824 NT2RM2 NT2 pME18SFL3 L3825 NT2RM4
NT2 pME18SFL3 L3826 NT2RP1 NT2 pUC19FL3 L3827 NT2RP2 NT2 pME18SFL3
L3828 NT2RP3 NT2 pME18SFL3 L3829 NT2RP4 NT2 pME18SFL3 L3831 OVARC1
ovary, tumor tissue pME18SFL3 L3832 PLACE1 placenta pME18SFL3 L3833
PLACE2 placenta pME18SFL3 L3834 PLACE3 placenta pME18SFL3 L3837
THYRO1 thyroid gland pME18SFL3 L3872 NCI_CGAP_Skn1 skin, normal, 4
pCMV-SPORT6 pooled sa L3904 NCI_CGAP_Brn64 glioblastoma with EGFR
brain pCMV-SPORT6 amplification L3905 NCI_CGAP_Brn67 anaplastic
brain pCMV-SPORT6 oligodendroglioma with 1p/19q loss L4497
NCI_CGAP_Br22 invasive ductal carcinoma, 3 breast pCMV-SPORT6
pooled samples L4500 NCI_CGAP_HN16 moderate to poorly mouth pAMP10
differentiated invasive carcino L4501 NCI_CGAP_Sub8 pT7T3D-Pac
(Pharmacia) with a modified polylinker L4507 NCI_CGAP_Thy6 normal
epithelium thyroid pAMP10 L4508 NCI_CGAP_Thy8 normal epithelium
thyroid pAMP10 L4537 NCI_CGAP_Thy7 follicular adenoma (benign
thyroid pAMP10 lesion) L4556 NCI_CGAP_HN13 squamous cell carcinoma
tongue pCMV-SPORT6 L4557 NCI_CGAP_Adr1 neuroblastoma adrenal gland
pCMV-SPORT6 L4558 NCI_CGAP_Pan3 pancreas pCMV-SPORT6 L4559
NCI_CGAP_Thy3 follicular carcinoma thyroid pCMV-SPORT6 L4560
NCI_CGAP_Ut7 tumor uterus pCMV-SPORT6 L4669 NCI_CGAP_Ov41 serous
papillary tumor ovary pCMV-SPORT6 L4747 NCI_CGAP_Brn41
oligodendroglioma brain pT7T3D-Pac (Pharmacia) with a modified
polylinker L4753 NCI_CGAP_HN15 leukoplakia of the buccal mouth
pAMP10 mucosa L4775 NCI_CGAP_Thy12 papillary carcinoma thyroid
pAMP10 L5286 NCI_CGAP_Thy10 medullary carcinoma thyroid pAMP10
L5564 NCI_CGAP_HN20 normal pAMP1 head/neck tissue L5565
NCI_CGAP_Brn66 glioblastoma with probably brain pCMV-SPORT6 TP53
mutation and witho L5566 NCI_CGAP_Brn70 anaplastic brain pCMV-
oligodendroglioma SPORT6.ccdb L5568 NCI_CGAP_HN21 nasopharyngeal
carcinoma head/neck pAMP1 L5569 NCI_CGAP_HN17 normal epithetlium
nasopharynx pAMP10 L5572 NCI_CGAP_Co27 adenocarcinoma (mucinous
colon pAMP1 component) L5574 NCI_CGAP_HN19 normal epithetlium
nasopharynx pAMP10 L5575 NCI_CGAP_Brn65 glioblastoma without EGFR
brain pCMV-SPORT6 amplification L5622 NCI_CGAP_Skn3 skin
pCMV-SPORT6 L5623 NCI_CGAP_Skn4 squamous cell carcinoma skin
pCMV-SPORT6
Description of Table 5
[0226] Table 5 provides a key to the OMIM reference identification
numbers disclosed in Table 1B. 1, column 9. OMIM reference
identification numbers (Column 1) were derived from Online
Mendelian Inheritance in Man (Online Mendelian Inheritance in Man,
OMIM. McKusick-Nathans Institute for Genetic Medicine, Johns
Hopkins University (Baltimore, Md.) and National Center for
Biotechnology Information, National Library of Medicine, (Bethesda,
Md.) 2000. World Wide Web URL: http://www.ncbi.nlm.nih.gov/omim/).
Column 2 provides diseases associated with the cytologic band
disclosed in Table 1B.1, column 8, as determined using the Morbid
Map database. TABLE-US-00011 TABLE 5 OMIM Reference Description
100678 ACAT2 deficiency 100690 Myasthenic syndrome, slow-channel
congenital, 601462 100710 Myasthenic syndrome, slow-channel
congenital, 601462 100730 Myasthenia gravis, neonatal transient
101000 Meningioma, NF2-related, sporadic Schwannoma, sporadic
101000 Neurofibromatosis, type 2 101000 Neurolemmomatosis 101000
Malignant mesothelioma, sporadic 102200 Somatotrophinoma 102540
Cardiomyopathy, idiopathic dilated 102578 Leukemia, acute
promyelocytic, PML/RARA type 102700 Severe combined
immunodeficiency due to ADA deficiency 102700 Hemolytic anemia due
to ADA excess 102770 Myoadenylate deaminase deficiency 102772 [AMP
deaminase deficiency, erythrocytic] 103000 Hemolytic anemia due to
adenylate kinase deficiency 103050 Autism, succinylpurinemic 103050
Adenylosuccinase deficiency 103581 Albright hereditary
osteodystrophy-2 103600 [Dysalbuminemic hyperthyroxinemia] 103600
[Dysalbuminemic hyperzincemia], 194470 103600 Analbuminemia 103720
Alcoholism, susceptibility to 103850 Aldolase A deficiency 103950
Emphysema due to alpha-2-macroglobulin deficiency 104150 [AFP
deficiency, congenital] 104150 [Hereditary persistence of
alpha-fetoprotein] 104311 Alzheimer disease-3 104500 Amelogenesis
imperfecta-2, hypoplastic local type 104770 Amyloidosis, secondary,
susceptibility to 105580 Anal canal carcinoma 105600
Dyserythropoietic anemia, congenital, type III 106100 Angioedema,
hereditary 106150 Hypertension, essential, susceptibility to 106150
Preeclampsia, susceptibility to 106165 Hypertension, essential,
145500 106180 Myocardial infarction, susceptibility to 106210
Peters anomaly 106210 Cataract, congenital, with late-onset corneal
dystrophy 106210 Foveal hypoplasia, isolated, 136520 106210
Aniridia 106300 Ankylosing spondylitis 107250 Anterior segment
mesenchymal dysgenesis 107271 CD59 deficiency 107300 Antithrombin
III deficiency 107470 Atypical mycobacterial infection, familial
disseminated, 209950 107470 BCG infection, generalized familial
107470 Tuberculosis, susceptibility to 107670 Apolipoprotein A-II
deficiency 107680 ApoA-I and apoC-III deficiency, combined 107680
Corneal clouding, autosomal recessive 107680 Amyloidosis, 3 or more
types 107680 Hypertriglyceridemia, one form 107680
Hypoalphalipoproteinemia 107720 Hypertriglyceridemia 107741
Hyperlipoproteinemia, type III 107777 Diabetes insipidus,
nephrogenic, autosomal recessive, 222000 107970 Arrhythmogenic
right ventricular dysplasia-1 108120 Distal arthrogryposis-1 108725
Atherosclerosis, susceptibility to 108730 Brody myopathy, 601003
108800 Atrial septal defect, secundum type 108962 Hypertension,
salt-resistant 108985 Atrophia areata 109150 Machado-Joseph disease
109270 Renal tubular acidosis, distal, 179800 109270 Spherocytosis,
hereditary 109270 [Acanthocytosis, one form] 109270
[Elliptocytosis, Malaysian-Melanesian type] 109270 Hemolytic anemia
due to band 3 defect 109565 Lymphoma, B-cell 109565 Lymphoma,
diffuse large cell 109690 Asthma, nocturnal, susceptibility to
109690 Obesity, susceptibility to 109700 Hemodialysis-related
amyloidosis 110100 Blepharophimosis, epicanthus inversus, and
ptosis, type 1 110700 Vivax malaria, susceptibility to 112250 Bone
dysplasia with medullary fibrosarcoma 112262 Fibrodysplasia
ossificans progressiva, 135100 112410 Hypertension with
brachydactyly 113721 Breast cancer 113811 Epidermolysis bullosa,
generalized atrophic benign, 226650 113900 Heart block, progressive
familial, type I 114130 Osteoporosis 114208 Malignant hyperthermia
susceptibility 5, 601887 114208 Hypokalemic periodic paralysis,
170400 114240 Muscular dystrophy, limb-girdle, type 2A, 253600
114290 Campomelic dysplasia with autosomal sex reversal 114350
Leukemia, acute myeloid 114400 Lynch cancer family syndrome II
114550 Hepatocellular carcinoma 114835 Monocyte carboxyesterase
deficiency 115200 Cardiomyopathy, dilated, 1A 115500 Acatalasemia
115650 Cataract, anterior polar-1 115660 Cataract, cerulean, type 1
115665 Cataract, congenital, Volkmann type 116800 Cataract, Marner
type 116806 Colorectal cancer 116860 Cavernous angiomatous
malformations 117700 [Hypoceruloplasminemia, hereditary] 117700
Hemosiderosis, systemic, due to aceruloplasminemia 118210
Charcot-Marie-Tooth neuropathy-2A 118425 Myotonia congenita,
dominant, 160800 118425 Myotonia congenita, recessive, 255700
118425 Myotonia levior, recessive 118485 Polycystic ovary syndrome
with hyperandrogenemia 118504 Epilepsy, benign neonatal, type 1,
121200 118504 Epilepsy, nocturnal frontal lobe, 600513 118511
Schizophrenia, neurophysiologic defect in 118800 Choreoathetosis,
familial paroxysmal 119300 van der Woude syndrome 120070 Alport
syndrome, autosomal recessive, 203780 120110 Metaphyseal
chondrodysplasia, Schmid type 120120 Epidermolysis bullosa
dystrophica, dominant, 131750 120120 Epidermolysis bullosa
dystrophica, recessive, 226600 120120 Epidermolysis bullosa,
pretibial, 131850 120131 Alport syndrome, autosomal recessive,
203780 120131 Hematuria, familial benign 120140 Osteoarthrosis,
precocious 120140 SED congenita 120140 SMED Strudwick type 120140
Stickler syndrome, type I 120140 Wagner syndrome, type II 120140
Achondrogenesis-hypochondrogenesis, type II 120140 Kniest dysplasia
120150 Osteogenesis imperfecta, 4 clinical forms, 166200, 166210,
259420, 166220 120150 Osteoporosis, idiopathic, 166710 120150
Ehlers-Danlos syndrome, type VIIA1, 130060 120160 Osteogenesis
imperfecta, 4 clinical forms, 166200, 166210, 259420, 166220 120160
Osteoporosis, idiopathic, 166710 120160 Ehlers-Danlos syndrome,
type VIIA2, 130060 120160 Marfan syndrome, atypical 120180
Ehlers-Danlos syndrome, type III 120180 Ehlers-Danlos syndrome,
type IV, 130050 120180 Fibromuscular dysplasia of arteries, 135580
120180 Aneurysm, familial, 100070 120190 Ehlers-Danlos syndrome,
type I, 130000 120215 Ehlers-Danlos syndrome, type I, 130000 120215
Ehlers-Danlos syndrome, type II, 130010 120220 Bethlem myopathy,
158810 120240 Bethlem myopathy, 158810 120260 Epiphyseal dysplasia,
multiple, type 2, 600204 120280 Stickler syndrome, type III 120280
Marshall syndrome, 154780 120290 OSMED syndrome, 215150 120290
Stickler syndrome, type II, 184840 120435 Muir-Torre syndrome,
158320 120435 Colorectal cancer, hereditary, nonpolyposis, type 1
Ovarian cancer 120436 Muir-Torre family cancer syndrome, 158320
120436 Turcot syndrome with glioblastoma, 276300 120436 Colorectal
cancer, hereditary nonpolyposis, type 2 120550 C1q deficiency, type
A 120570 C1q deficiency, type B 120575 C1q deficiency, type C
120580 C1r/C1s is deficiency, combined 120620 SLE susceptibility
120620 CR1 deficiency 120700 C3 deficiency 120810 C4 deficiency
120820 C4 deficiency 120900 C5 deficiency 120920 Measles,
susceptibility to 120940 C9 deficiency 120950 C8 deficiency, type I
120960 C8 deficiency, type II 121014 Heterotaxia, visceroatrial,
autosomal recessive 121050 Contractural arachnodactyly, congenital
121360 Myeloid leukemia, acute, M4Eo subtype 121800 Corneal
dystrophy, crystalline, Schnyder 122720 Nicotine addiction,
protection from 122720 Coumarin resistance, 122700 123000
Craniometaphyseal dysplasia 123100 Craniosynostosis, type 1 123101
Craniosynostosis, type 2 123270 [Creatine kinase, brain type,
ectopic expression of] 123580 Cataract, congenital, autosomal
dominant 123620 Cataract, cerulean, type 2, 601547 123660 Cataract,
Coppock-like 123829 Melanoma 123940 White sponge nevus, 193900
124020 Mephenytoin poor metabolizer 124030 Parkinsonism,
susceptibility to 124030 Debrisoquine sensitivity 124200 Darier
disease (keratosis follicularis) 125264 Leukemia, acute
nonlymphocytic 125270 Porphyria, acute hepatic 125270 Lead
poisoning, susceptibility to 125370 Dentatorubro-pallidoluysian
atrophy 125490 Dentinogenesis imperfecta-1 125660 Myopathy,
desminopathic 125660 Cardiomyopathy 125852 Insulin-dependent
diabetes mellitus-2 126060 Anemia, megaloblastic, due to DHFR
deficiency 126337 Myxoid liposarcoma 126340 Xeroderma pigmentosum,
group D, 278730 126391 DNA ligase I deficiency 126451
Schizophrenia, susceptibility to 126452 Autonomic nervous system
dysfunction 126452 [Novelty seeking personality] 126600 Drusen,
radial, autosomal dominant 126650 Chloride diarrhea, congenital,
Finnish type, 214700 126650 Colon cancer 128100 Dystonia-1, torsion
129010 Neuropathy, congenital hypomyelinating, 1 129490 Ectodermal
dysplasia-3, anhidrotic 129900 EEC syndrome-1 130410
Glutaricaciduria, type IIB 130500 Elliptocytosis-1 130650
Beckwith-Wiedemann syndrome 131100 Multiple endocrine neoplasia I
131100 Prolactinoma, hyperparathyroidism, carcinoid syndrome 131100
Carcinoid tumor of lung 131195 Hereditary hemorrhagic
telangiectasia-1, 187300 131210 Atherosclerosis, susceptibility to
131242 Shah-Waardenburg syndrome, 277580 131400 Eosinophilia,
familial 131440 Eosinophilic myeloproliferative disorder 132700
Cylindromatosis 132810 Diphenylhydantoin toxicity 132810 Fetal
hydantoin syndrome 133170 Erythremia 133171 [Erythrocytosis,
familial], 133100 133200 Erythrokeratodermia variabilis 133430
Breast cancer 133430 Estrogen resistance 133450 Neuroepithelioma
133450 Ewing sarcoma 133510 Trichothiodystrophy 133510 Xeroderma
pigmentosum, group B 133550 Dicarboxylicaminoaciduria, 222730
133700 Chondrosarcoma, 215300 133700 Exostoses, multiple, type
1
133701 Exostoses, multiple, type 2 133780 Vitreoretinopathy,
exudative, familial 134370 Membroproliferative glomerulonephritis
134370 Factor H deficiency 134370 Hemolytic-uremic syndrome, 235400
134570 Factor XIIIA deficiency 134580 Factor XIIIB deficiency
134637 Autoimmune lymphoproliferative syndrome 134790
Hyperferritinemia-cataract syndrome, 600886 134820
Dysfibrinogenemia, alpha type, causing bleeding diathesis 134820
Dysfibrinogenemia, alpha type, causing recurrent thrombosis 134820
Amyloidosis, hereditary renal, 105200 134830 Dysfibrinogenemia,
beta type 134850 Dysfibrinogenemia, gamma type 134850
Hypofibrinogenemia, gamma type 134934 Thanatophoric dysplasia,
types I and II, 187600 134934 Achondroplasia, 100800 134934
Craniosynostosis, nonsyndromic 134934 Crouzon syndrome with
acanthosis nigricans 134934 Hypochondroplasia, 146000 135300
Fibromatosis, gingival 135600 Ehlers-Danlos syndrome, type X 135700
Fibrosis of extraocular muscles, congenital, 1 135940 Ichthyosis
vulgaris, 146700 136132 [Fish-odor syndrome], 602079 136350
Pfeiffer syndrome, 101600 136435 Ovarian dysgenesis,
hypergonadotropic, with normal karyotype, 233300 136530 Male
infertility, familial 136836 Fucosyltransferase-6 deficiency 137350
Amyloidosis, Finnish type, 105120 138030 [Hyperproglucagonemia]
138033 Diabetes mellitus, type II 138040 Cortisol resistance 138079
Hyperinsulinism, familial, 602485 138079 MODY, type 2, 125851
138130 Hyperinsulinism-hyperammonemia syndrome 138140 Glucose
transport defect, blood-brain barrier 138160 Diabetes mellitus,
noninsulin-dependent 138160 Fanconi-Bickel syndrome, 227810 138190
Diabetes mellitus, noninsulin-dependent 138250 P5CS deficiency
138300 Hemolytic anemia due to glutathione reductase deficiency
138320 Hemolytic anemia due to glutathione peroxidase deficiency
138491 Startle disease, autosomal recessive 138491 Startle
disease/hyperekplexia, autosomal dominant, 149400 138491
Hyperekplexia and spastic paraparesis 138570 Non-insulin dependent
diabetes mellitus, susceptibility to 138571 Glycogen synthase,
liver, deficiency of, 240600 138700 [Apolipoprotein H deficiency]
138720 Bernard-Soulier syndrome, type B 138971 Kostmann
neutropenia, 202700 138981 Pulmonary alveolar proteinosis, 265120
139130 Hypertension, essential, susceptibility to, 145500 139150
Basal cell carcinoma 139190 Gigantism due to GHRF hypersecretion
139190 Isolated growth hormone deficiency due to defect in GHRF
139191 Growth hormone deficient dwarfism 139250 Isolated growth
hormone deficiency, Illig type with absent GH and Kowarski type
with bioinactive GH 139320 Pituitary ACTH secreting adenoma 139320
Pseudohypoparathyroidism, type Ia, 103580 139320 Somatotrophinoma
139320 McCune-Albright polyostotic fibrous dysplasia, 174800 139330
Night blindness, congenital stationary 139350 Epidermolytic
hyperkeratosis, 113800 139350 Keratoderma, palmoplantar,
nonepidermolytic 139360 Pituitary ACTH-secreting adenoma 140100
[Anhaptoglobinemia] 140100 [Hypohaptogloginemia] 141750
Alpha-thalassemia/mental retardation syndrome, type 1 141800
Methemoglobinemias, alpha- 141800 Thalassemias, alpha- 141800
Erythremias, alpha- 141800 Heinz body anemias, alpha- 141850
Thalassemia, alpha- 141850 Erythrocytosis 141850 Heinz body anemia
141850 Hemoglobin H disease 141850 Hypochromic microcytic anemia
141900 Methemoglobinemias, beta- 141900 Sickle cell anemia 141900
Thalassemias, beta- 141900 Erythremias, beta- 141900 HPFH, deletion
type 141900 Heinz body anemias, beta- 142000 Thalassemia due to Hb
Lepore 142000 Thalassemia, delta- 142200 HPFH, nondeletion type A
142250 HPFH, nondeletion type G 142270 Hereditary persistence of
fetal hemoglobin 142335 Hereditary persistence of fetal hemoglobin,
heterocellular, Indian type 142470 [Hereditary persistence of fetal
hemoglobin, heterocellular] 142640 Thrombophilia due to elevated
HRG 142680 Periodic fever, familial 142857 Pemphigoid,
susceptibility to 142858 Beryllium disease, chronic, susceptibility
to 142946 Holoprosencephaly-4 142959 Hand-foot-uterus syndrome,
140000 142989 Synpolydactyly, type II, 186000 143100 Huntington
disease 143200 Wagner syndrome 143200 Erosive vitreoretinopathy
143890 Hypercholesterolemia, familial 144200 Epidermolytic
palmoplantar keratoderma 145001 Hyperparathyroidism-jaw tumor
syndrome 145260 Pseudohypoaldosteronism, type II 145410 Opitz G
syndrome, type II 145505 Hypertension, essential 145981
Hypocalciuric hypercalcemia, type II 146150 Hypomelanosis of Ito
146150 Hypomelanosis of Ito 146760 [IgG receptor I, phagocytic,
familial deficiency of] 146790 Lupus nephritis, susceptibility to
147050 Atopy 147141 Leukemia, acute lymphoblastic 147200 [Kappa
light chain deficiency] 147280 Hepatocellular carcinoma 147440
Growth retardation with deafness and mental retardation 147450
Amytrophic lateral sclerosis, due to SOD1 deficiency, 105400 147545
Diabetes mellitus, noninsulin-dependent 147570 Interferon, immune,
deficiency 147660 Interferon, alpha, deficiency 147670
Rabson-Mendenhall syndrome 147670 Diabetes mellitus,
insulin-resistant, with acanthosis nigricans 147670 Leprechaunism
147730 Interleukin-2 receptor, alpha chain, deficiency of 147781
Atopy, susceptibility to 147790 Leukemia, acute lymphocytic, with
4/11 translocation 147791 Jacobsen syndrome 148040 Epidermolysis
bullosa simplex, Koebner, Dowling-Meara, and Weber- Cockayne types,
131900, 131760, 131800 148041 Pachyonychia congenita,
Jadassohn-Lewandowsky type, 167200 148043 Meesmann corneal
dystrophy, 122100 148065 White sponge nevus, 193900 148066
Epidermolysis bullosa simplex, Koebner, Dowling-Meara, and Weber-
Cockayne types, 131900, 131760, 131800 148066 Epidermolysis bullosa
simplex, recessive, 601001 148067 Nonepidermolytic palmoplantar
keratoderma, 600962 148067 Pachyonychia congenita,
Jadassohn-Lewandowsky type, 167200 148069 Pachyonychia congenita,
Jackson-Lawler type, 167210 148070 Liver disease, susceptibility
to, from hepatotoxins or viruses 148080 Epidermolytic
hyperkeratosis, 113800 148370 Keratolytic winter erythema 148500
Tylosis with esophageal cancer 150000 Exertional myoglobinuria due
to deficiency of LDH-A 150100 Lactate dehydrogenase-B deficiency
150200 [Placental lactogen deficiency] 150210 Lactoferrin-deficient
neutrophils, 245480 150230 Langer-Giedion syndrome 150240 Cutis
laxa, marfanoid neonatal type 150250 Larsen syndrome, autosomal
dominant 150270 Laryngeal adductor paralysis 150292 Epidermolysis
bullosa, Herlitz junctional type, 226700 150310 Epidermolysis
bullosa, Herlitz junctional type, 226700 150310 Epidermolysis
bullosa, generalized atrophic benign, 226650 151385 Leukemia, acute
myeloid 151390 Leukemia, acute T-cell 151400 Leukemia/lymphoma,
B-cell, 1 151410 Leukemia, chronic myeloid 151440 Leukemia, T-cell
acute lymphoblastoid 151670 Hepatic lipase deficiency 152200
Coronary artery disease, susceptibility to 152427 Long QT
syndrome-2 152445 Vohwinkel syndrome, 124500 152445
Erythrokeratoderma, progressive symmetric, 602036 152760
Hypogonadotropic hypogonadism due to GNRH deficiency, 227200 152790
Precocious puberty, male, 176410 152790 Leydig cell hypoplasia
153454 Ehlers-Danlos syndrome, type VI, 225400 153455 Cutis laxa,
recessive, type I, 219100 153700 Macular dystrophy, vitelliform
type 153880 Macular dystrophy, dominant cystoid 153900 Stargardt
disease-2 154275 Malignant hyperthermia susceptibility 2 154276
Malignant hyperthermia susceptibility 3 154400 Acrofacial
dysostosis, Nager type 154500 Treacher Collins mandibulofacial
dysostosis 154550 Carbohydrate-deficient glycoprotein syndrome,
type Ib, 602579 154705 Marfan syndrome, type II 155555 [Red
hair/fair skin] 155555 UV-induced skin damage, vulnerability to
155600 Malignant melanoma, cutaneous 156225 Muscular dystrophy,
congenital merosin-deficient 156232 Mesomelic dysplasia, Kantaputra
type 156570 Methylcobalamin deficiency, cbl G type 156600
Microcoria, congenital 156845 Tietz syndrome, 103500 156845
Waardenburg syndrome, type IIA, 193510 156845 Waardenburg
syndrome/ocular albinism, digenic, 103470 156850 Cataract,
congenital, with microphthalmia 157147 Abetalipoproteinemia, 200100
157170 Holoprosencephaly-2 157640 PEO with mitochondrial DNA
deletions, type 1 157655 Lactic acidosis due to defect in
iron-sulfur cluster of complex I 157900 Moebius syndrome 159000
Muscular dystrophy, limb-girdle, type 1A 159001 Muscular dystrophy,
limb-girdle, type 1B 159440 Charcot-Marie-Tooth neuropathy-1B,
118200 159440 Dejerine-Sottas disease, myelin P-related, 145900
159440 Hypomyelination, congenital 159555 Leukemia,
myeloid/lymphoid or mixed-lineage 160777 Griscelli disease, 214450
160781 Cardiomyopathy, hypertrophic, mid-left ventricular chamber
type 160900 Myotonic dystrophy 161015 Mitochondrial complex I
deficiency, 252010 162100 Neuralgic amyotrophy with predilection
for brachial plexus 162200 Neurofibromatosis, type 1 162200 Watson
syndrome, 193520 162400 Neuropathy, hereditary sensory and
autonomic, type 1 163729 Hypertension, pregnancy-induced 163890
Parkinson disease, type 1, 601508 164009 Leukemia, acute
promyelocytic, NUMA/RARA type 164040 Leukemia, acute promyelocytic,
NPM/RARA type 164160 Obesity, severe, due to leptin deficiency
164200 Oculodentodigital dysplasia 164200 Syndactyly, type III,
186100 164500 Spinocerebellar ataxia-7 164731 Ovarian carcinoma,
167000 164759 Ovarian carcinoma 164790 Colorectal cancer 164860
Renal cell carcinoma, papillary, familial and sporadic 164920
Piebaldism 164920 Mast cell leukemia 164920 Mastocytosis with
associated hematologic disorder 164953 Liposarcoma 165240
Pallister-Hall syndrome, 146510 165240 Postaxial polydactyly type
A1, 174200 165240 Greig cephalopolysyndactyly syndrome, 175700
165320 Hepatocellular carcinoma 165500 Optic atrophy 1 166600
Osteopetrosis, AD, type II 167000 Ovarian cancer, serous 167250
Paget disease of bone 167409 Optic nerve coloboma with renal
disease, 120330 167410 Rhabdomyosarcoma, alveolar, 268220 167415
Hypothyroidism, congenital, due to thyroid dysgenesis or hypoplasia
168000 Paraganglioma, familial nonchromaffin, 1 168360
Paraneoplastic sensory neuropathy 168450 Hypoparathyroidism,
autosomal dominant 168450 Hypoparathyroidism, autosomal recessive
168461 Multiple myeloma, 254250 168461 Parathyroid adenomatosis 1
168461 Centrocytic lymphoma 168468 Metaphyseal chondrodysplasia,
Murk Jansen type, 156400 168470 Humoral hypercalcemia of malignancy
168500 Parietal foramina 169600 Hailey-Hailey disease 170261 Bare
lymphocyte syndrome, type I, due to TAP2 deficiency
170500 Myotonia congenita, atypical acetazolamide-responsive 170500
Paramyotonia congenita, 168300 170500 Hyperkalemic periodic
paralysis 170650 Periodontitis, juvenile 170995 Zellweger
syndrome-2 171050 Colchicine resistance 171060 Cholestasis,
progressive familial intrahepatic, type III, 602347 171190
Hypertension, essential, 145500 171650 Lysosomal acid phosphatase
deficiency 171760 Hypophosphatasia, adult, 146300 171760
Hypophosphatasia, infantile, 241500 171860 Hemolytic anemia due to
phosphofructokinase deficiency 172400 Hemolytic anemia due to
glucosephosphate isomerase deficiency 172400 Hydrops fetalis, one
form 172411 Colorectal cancer, resistance to 172430 Enolase
deficiency 172471 Glycogenosis, hepatic, autosomal 172490
Phosphorylase kinase deficiency of liver and muscle, 261750 173350
Plasminogen Tochigi disease 173350 Plasminogen deficiency, types I
and II 173350 Thrombophilia, dysplasminogenemic 173360
Thrombophilia due to excessive plasminogen activator inhibitor
173360 Hemorrhagic diathesis due to PAI1 deficiency 173370
Plasminogen activator deficiency 173470 Glanzmann thrombasthenia,
type B 173610 Platelet alpha/delta storage pool deficiency 173850
Polio, susceptibility to 173870 Xeroderma pigmentosum 173870
Fanconi anemia 173910 Polycystic kidney disease, adult, type II
174000 Medullary cystic kidney disease, AD 174810 Osteolysis,
familial expansile 174900 Polyposis, juvenile intestinal 175100
Turcot syndrome, 276300 175100 Adenomatous polyposis coli 175100
Adenomatous polyposis coli, attenuated 175100 Colorectal cancer
175100 Desmoid disease, hereditary, 135290 175100 Gardner syndrome
176000 Porphyria, acute intermittent 176100 Porphyria cutanea tarda
176100 Porphyria, hepatoerythropoietic 176260 Episodic
ataxia/myokymia syndrome, 160120 176261 Jervell and Lange-Nielsen
syndrome, 220400 176270 Prader-Willi syndrome 176300
[Dystransthyretinemic hyperthyroxinemia] 176300 Carpal tunnel
syndrome, familial 176300 Amyloid neuropathy, familial, several
allelic types 176300 Amyloidosis, senile systemic 176450 Sacral
agenesis-1 176730 Diabetes mellitus, rare form 176730
Hyperproinsulinemia, familial 176730 MODY, one form 176801
Metachromatic leukodystrophy due to deficiency of SAP-1 176801
Gaucher disease, variant form 176830 Obesity, adrenal
insufficiency, and red hair 176830 ACTH deficiency 176860 Purpura
fulminans, neonatal 176860 Thrombophilia due to protein C
deficiency 176880 Protein S deficiency 176930 Dysprothrombinemia
176930 Hypoprothrombinemia 176943 Apert syndrome, 101200 176943
Pfeiffer syndrome, 101600 176943 Beare-Stevenson cutis gyrata
syndrome, 123790 176943 Crouzon craniofacial dysostosis, 123500
176943 Jackson-Weiss syndrome, 123150 176947 Selective T-cell
defect 176960 Pituitary tumor, invasive 177070 Spherocytosis,
hereditary, Japanese type 177070 Hermansky-Pudlak syndrome, 203300
177400 Apnea, postanesthetic 177900 Psoriasis susceptibility-1
178300 Ptosis, hereditary congenital, 1 178600 Pulmonary
hypertension, familial primary 178640 Pulmonary alveolar
proteinosis, congenital, 265120 179095 Male infertility 179450
Ragweed sensitivity 179605 Retinitis pigmentosa, digenic 179605
Retinitis pigmentosa-7, peripherin-related 179605 Retinitis
punctata albescens 179605 Butterfly dystrophy, retinal 179605
Macular dystrophy 179615 Reticulosis, familial histiocytic, 267700
179615 Severe combined immunodeficiency, B cell-negative, 601457
179616 Severe combined immunodeficiency, B cell-negative, 601457
179755 Renal cell carcinoma, papillary, 1 179820
[Hyperproreninemia] 180020 Retinal cone dystrophy-1 180069 Retinal
dystrophy, autosomal recessive, childhood-onset 180069 Retinitis
pigmentosa-20 180069 Leber congenital amaurosis-2, 204100 180071
Retinitis pigmentosa, autosomal recessive 180072 Night blindness,
congenital stationary, type 3, 163500 180072 Retinitis pigmentosa,
autosomal recessive 180100 Retinitis pigmentosa-1 180104 Retinitis
pigmentosa-9 180105 Retinitis pigmentosa-10 180200 Osteosarcoma,
259500 180200 Pinealoma with bilateral retinoblastoma 180200
Retinoblastoma 180200 Bladder cancer, 109800 180240 Leukemia, acute
promyelocytic 180250 Retinol binding protein, deficiency of 180297
Anemia, hemolytic, Rh-null, suppressor type, 268150 180380 Night
blindness, congenital stationery, rhodopsin-related 180380
Retinitis pigmentosa, autosomal recessive 180380 Retinitis
pigmentosa-4, autosomal dominant 180381 Oguchi disease-2, 258100
180385 Leukemia, acute T-cell 180721 Retinitis pigmentosa, digenic
180840 Susceptibility to IDDM 180860 Russell-Silver syndrome 180901
Malignant hyperthermia susceptibility 1, 145600 180901 Central core
disease, 117000 181030 Salivary gland pleomorphic adenoma 181031
Oguchi disease-1, 258100 181405 Scapuloperoneal spinal muscular
atrophy, New England type 181430 Scapuloperoneal syndrome,
myopathic type 181460 Schistosoma mansoni,
susceptibility/resistance to 181510 Schizophrenia 181600
Sclerotylosis 182138 Anxiety-related personality traits 182279
Prader-Willi syndrome 182280 Small-cell cancer of lung 182380
Glucose/galactose malabsorption 182381 Renal glucosuria, 253100
182452 Lung cancer, small cell 182500 Cataract, congenital 182600
Spastic paraplegia-3A 182601 Spastic paraplegia-4 182860
Pyropoikilocytosis 182860 Spherocytosis, recessive 182860
Elliptocytosis-2 182870 Spherocytosis-1 182870 Elliptocytosis-3
182870 Anemia, neonatal hemolytic, fatal and near-fatal 182900
Spherocytosis-2 183600 Split hand/foot malformation, type 1 185000
Stomatocytosis I 185430 Atherosclerosis, susceptibility to 185470
Myopathy due to succinate dehydrogenase deficiency 185800
Symphalangism, proximal 186580 Arthrocutaneouveal granulomatosis
186740 Immunodeficiency due to defect in CD3-gamma 186770 Leukemia,
T-cell acute lymphocytic 186780 CD3, zeta chain, deficiency 186830
Immunodeficiency, T-cell receptor/CD3 complex 186860
Leukemia/lymphoma, T-cell 186880 Leukemia/lymphoma, T-cell 186921
Leukemia, T-cell acute lymphoblastic 187040 Leukemia-1, T-cell
acute lymphoblastic 187680 6-mercaptopurine sensitivity 188025
Thrombocytopenia, Paris-Trousseau type 188070 Bleeding disorder due
to defective thromboxane A2 receptor 188450 Goiter, adolescent
multinodular 188450 Goiter, nonendemic, simple 188450
Hypothyroidism, hereditary congenital 188540 Hypothyroidism,
nongoitrous 188826 Sorsby fundus dystrophy, 136900 189800
Preeclampsia/eclampsia 189980 Leukemia, chronic myeloid 190000
Atransferrinemia 190020 Bladder cancer, 109800 190040 Meningioma,
SIS-related 190040 Dermatofibrosarcoma protuberans 190040
Giant-cell fibroblastoma 190100 Geniospasm 190160 Thyroid hormone
resistance, 274300, 188570 190182 Colon cancer 190182 Colorectal
cancer, familial nonpolyposis, type 6 190195 Ichthyosiform
erythroderma, congenital, 242100 190195 Ichthyosis, lamellar,
autosomal recessive, 242300 190198 Leukemia, T-cell acute
lymphoblastic 190450 Hemolytic anemia due to triosephosphate
isomerase deficiency 190605 Triphalangeal thumb-polysyndactyly
syndrome 190685 Down syndrome 190900 Colorblindness, tritan 191010
Cardiomyopathy, familial hypertrophic, 3, 115196 191030 Nemaline
myopathy-1, 161800 191044 Cardiomyopathy, familial hypertrophic
191045 Cardiomyopathy, familial hypertrophic, 2, 115195 191092
Tuberous sclerosis-2 191100 Tuberous sclerosis-1 191170 Colorectal
cancer, 114500 191170 Li-Fraumeni syndrome 191181 Cervical
carcinoma 191290 Segawa syndrome, recessive 191315 Insensitivity to
pain, congenital, with anhidrosis, 256800 191540 [Urate oxidase
deficiency] 192090 Ovarian carcinoma 192090 Breast cancer, lobular
192090 Endometrial carcinoma 192090 Gastric cancer, familial,
137215 192340 Diabetes insipidus, neurohypophyseal, 125700 192500
Jervell and Lange-Nielsen syndrome, 220400 192500 Long QT
syndrome-1 192974 Neonatal alloimmune thrombocytopenia 192974
Glycoprotein Ia deficiency 193100 Hypophosphatemic rickets,
autosomal dominant 193235 Vitreoretinopathy, neovascular
inflammatory 193300 Renal cell carcinoma 193300 von Hippel-Lindau
syndrome 193400 von Willebrand disease 193500 Rhabdomyosarcoma,
alveolar, 268220 193500 Waardenburg syndrome, type I 193500
Waardenburg syndrome, type III, 148820 193500
Craniofacial-deafness-hand syndrome, 122880 194070 Wilms tumor,
type 1 194070 Denys-Drash syndrome 194070 Frasier syndrome, 136680
194071 Wilms tumor, type 2 194071 Adrenocortical carcinoma,
hereditary, 202300 194190 Wolf-Hirschhorn syndrome 200150
Choreoacanthocytosis 200990 Acrocallosal syndrome 201450 Acyl-CoA
dehydrogenase, medium chain, deficiency of 201460 Acyl-CoA
dehydrogenase, long chain, deficiency of 201470 Acyl-CoA
dehydrogenase, short-chain, deficiency of 201910 Adrenal
hyperplasia, congenital, due to 21-hydroxylase deficiency 202110
Adrenal hyperplasia, congenital, due to 17-alpha-hydroxylase
deficiency 203100 Waardenburg syndrome/ocular albinism, digenic,
103470 203100 Albinism, oculocutaneous, type IA 203200 Albinism,
ocular, autosomal recessive 203200 Albinism, oculocutaneous, type
II 203300 Hermansky-Pudlak syndrome 203310 Ocular albinism,
autosomal recessive 203500 Alkaptonuria 203740 Alpha-ketoglutarate
dehydrogenase deficiency 203750 3-ketothiolase deficiency 203800
Alstrom syndrome 204500 Ceroid-lipofuscinosis, neuronal 2, classic
late infantile 205100 Amyotrophic lateral sclerosis, juvenile
207750 Hyperlipoproteinemia, type Ib 207800 Argininemia 208100
Arthrogryposis multiplex congenita, neurogenic 208250 Jacobs
syndrome 208400 Aspartylglucosaminuria 209901 Bardet-Biedl syndrome
1 211420 Breast cancer, ductal 212138 Carnitine-acylcarnitine
translocase deficiency 214300 Klippel-Feil syndrome 214400
Charcot-Marie-Tooth neuropathy-4A 214500 Chediak-Higashi syndrome
215700 Citrullinemia 216550 Cohen syndrome 216900 Achromatopsia
216950 C1r/C1s deficiency, combined 217000 C2 deficiency 217050 C6
deficiency
217050 Combined C6/C7 deficiency 217070 C7 deficiency 217800
Macular corneal dystrophy 218000 Andermann syndrome 218030 Apparent
mineralocorticoid excess, hypertension due to 219800 Cystinosis,
nephropathic 221770 Polycystic lipomembranous osteodysplasia with
sclerosing leukencephalopathy 221820 Gliosis, familial progressive
subcortical 222100 Diabetes mellitus, insulin-dependent-1 222600
Atelosteogenesis II, 256050 222600 Achondrogenesis Ib, 600972
222600 Diastrophic dysplasia 222700 Lysinuric protein intolerance
222800 Hemolytic anemia due to bisphosphoglycerate mutase
deficiency 222900 Sucrose intolerance 223000 Lactase deficiency,
adult, 223100 223000 Lactase deficiency, congenital 223360
Dopamine-beta-hydroxylase deficiency 223900 Dysautonomia, familial
224100 Congenital dyserythropoietic anemia II 224120
Dyserythropoietic anemia, contenital, type I 225500 Ellis-van
Creveld syndrome 227220 [Eye color, brown] 227500 Factor VII
deficiency 227600 Factor X deficiency 227646 Fanconi anemia, type D
227650 Fanconi anemia, type A 228960 [Kininogen deficiency] 229300
Friedreich ataxia 229300 Friedreich ataxia with retained reflexes
229600 Fructose intolerance 229700 Fructose-bisphosphatase
deficiency 229800 [Fructosuria] 230000 Fucosidosis 230200
Galactokinase deficiency with cataracts 230350 Galactose epimerase
deficiency 230400 Galactosemia 230450 Hemolytic anemia due to
gamma-glutamylcysteine synthetase deficiency 230800 Gaucher disease
230800 Gaucher disease with cardiovascular calcification 231550
Achalasia-addisonianism-alacrimia syndrome 231670 Glutaricaciduria,
type I 231680 Glutaricaciduria, type IIA 231950 Glutathioninuria
232000 Propionicacidemia, type I or pccA type 232050
Propionicacidemia, type II or pccB type 232300 Glycogen storage
disease II 232400 Glycogen storage disease IIIa 232400 Glycogen
storage disease IIIb 232500 Glycogen storage disease IV 232600
McArdle disease 232700 Glycogen storage disease VI 232800 Glycogen
storage disease VII 233100 [Renal glucosuria] 233700 Chronic
granulomatous disease due to deficiency of NCF-1 233710 Chronic
granulomatous disease due to deficiency of NCF-2 234000 Factor XII
deficiency 234200 Neurodegeneration with brain iron accumulation
235200 Hemochromatosis 235800 [Histidinemia] 236100
Holoprosencephaly-1 236200 Homocystinuria, B6-responsive and
nonresponsive types 236730 Urofacial syndrome 237300
Carbamoylphosphate synthetase I deficiency 238300 Hyperglycinemia,
nonketotic, type I 238310 Hyperglycinemia, nonketotic, type II
238600 Chylomicronemia syndrome, familial 238600 Combined
hyperlipemia, familial 238600 Hyperlipoproteinemia I 238600
Lipoprotein lipase deficiency 238970 HHH syndrome 239100 Van Buchem
disease 239500 Hyperprolinemia, type I 240300 Autoimmune
polyglandular disease, type I 240400 Scurvy 243500
Isovalericacidemia 245000 Papillon-Lefevre syndrome 245050
Ketoacidosis due to SCOT deficiency 245200 Krabbe disease 245349
Lacticacidemia due to PDX1 deficiency 245900 Norum disease 245900
Fish-eye disease 246450 HMG-CoA lyase deficiency 246530 Leukotriene
C4 synthase deficiency 246600 Pancreatic lipase deficiency 246900
Lipoamide dehydrogenase deficiency 247200 Miller-Dieker
lissencephaly syndrome 247640 Leukemia, acute lymphoblastic 248510
Mannosidosis, beta- 248600 Maple syrup urine disease, type Ia
248610 Maple syrup urine disease, type II 248611 Maple syrup urine
disease, type Ib 249000 Meckel syndrome 249270 Thiamine-responsive
megaloblastic anemia 250100 Metachromatic leukodystrophy 250250
Cartilage-hair hypoplasia 250790 Methemoglobinemia due to
cytochrome b5 deficiency 250800 Methemoglobinemia, type I 250800
Methemoglobinemia, type II 251000 Methylmalonicaciduria, mutase
deficiency type 251600 Microphthalmia, autosomal recessive 252500
Mucolipidosis II 252500 Mucolipidosis III 252800
Mucopolysaccharidosis Ih 252800 Mucopolysaccharidosis Ih/s 252800
Mucopolysaccharidosis Is 252900 Sanfilippo syndrome, type A 252940
Sanfilippo syndrome, type D 253000 Mucopolysaccharidosis IVA 253200
Maroteaux-Lamy syndrome, several forms 253250 Mulibrey nanism
253270 Multiple carboxylase deficiency, biotin-responsive 253601
Miyoshi myopathy, 254130 253601 Muscular dystrophy, limb-girdle,
type 2B 253800 Walker-Warburg syndrome, 236670 253800 Fukuyama type
congenital muscular dystrophy 254210 Myasthenia gravis, familial
infantile 254770 Epilepsy, juvenile myoclonic 254780 Myoclonus
epilepsy, Lafora type 255800 Schwartz-Jampel syndrome 256030
Nemaline myopathy-2 256100 Nephronophthisis, juvenile 256540
Galactosialidosis 256550 Sialidosis, type I 256550 Sialidosis, type
II 256700 Neuroblastoma 256731 Ceroid-lipofuscinosis, neuronal-5,
variant late infantile 256850 Giant axonal neuropathy-1 257200
Niemann-Pick disease, type A 257200 Niemann-Pick disease, type B
257220 Niemann-Pick disease, type C 257220 Niemann-Pick disease,
type D, 257250 258501 3-methylglutaconicaciduria, type III 258870
Gyrate atrophy of choroid and retina with ornithinemia, B6
responsive or unresponsive 259700 Osteopetrosis, recessive 259730
Renal tubular acidosis-osteopetrosis syndrome 259770
Osteoporosis-pseudoglioma syndrome 259900 Hyperoxaluria, primary,
type 1 261510 Pseudo-Zellweger syndrome 261515 Peroxisomal
bifunctional enzyme deficiency 261600 Phenylketonuria 261600
[Hyperphenylalaninemia, mild] 261640 Phenylketonuria due to PTS
deficiency 261670 Myopathy due to phosphoglycerate mutase
deficiency 262000 Bjornstad syndrome 263200 Polycystic kidney
disease, autosomal recessive 263700 Porphyria, congenital
erythropoietic 264300 Pseudohermaphroditism, male, with
gynecomastia 264470 Adrenoleukodystrophy, pseudoneonatal 264700
Pseudo-vitamin D dependency rickets 1 266100 Pyridoxine dependency
with seizures 266150 Pyruvate carboxylase deficiency 266200 Anemia,
hemolytic, due to PK deficiency 266300 [Hair color, red] 266600
Inflammatory bowel disease-1 267750 Knobloch syndrome 268900
[Sarcosinemia] 270100 Situs inversus viscerum 270800 Spastic
paraplegia-5A 271245 Spinocerebellar ataxia-8, infantile, with
sensory neuropathy 271900 Canavan disease 272750
GM2-gangliosidosis, AB variant 272800 Tay-Sachs disease 272800 [Hex
A pseudodeficiency] 272800 GM2-gangliosidosis, juvenile, adult
273300 Male germ cell tumor 273800 Thrombocytopenia, neonatal
alloimmune 273800 Glanzmann thrombasthenia, type A 274180
Thromboxane synthase deficiency 274270 Thymine-uraciluria 274270
Fluorouracil toxicity, sensitivity to 274600 Pendred syndrome
274600 Deafness, autosomal recessive 4 275350 Transcobalamin II
deficiency 276000 Pancreatitis, hereditary, 167800 276000
Trypsinogen deficiency 276600 Tyrosinemia, type II 276700
Tyrosinemia, type I 276900 Usher syndrome, type 1A 276901 Usher
syndrome, type 2 276902 Usher syndrome, type 3 276903 Usher
syndrome, type 1B 276903 Deafness, autosomal dominant 11,
neurosensory, 601317 276903 Deafness, autosomal recessive 2,
neurosensory, 600060 276904 Usher syndrome, type 1C 277700 Werner
syndrome 277730 Wernicke-Korsakoff syndrome, susceptibility to
278000 Wolman disease 278000 Cholesteryl ester storage disease
278250 Wrinkly skin syndrome 278300 Xanthinuria, type I 278700
Xeroderma pigmentosum, group A 278760 Xeroderma pigmentosum, group
F 300008 Nephrolithiasis, type I, 310468 300008 Proteinuria, low
molecular weight, with hypercalciuric nephrocalcinosis 300008 Dent
disease, 300009 300008 Hypophosphatemia, type III 300011 Menkes
disease, 309400 300011 Occipital horn syndrome, 304150 300011 Cutis
laxa, neonatal 300031 Mental retardation, X-linked, FRAXF type
300032 Alpha-thalassemia/mental retardation syndrome, type 2,
301040 300032 Juberg-Marsidi syndrome, 309590 300037 Simpson
dysmorphia syndrome, 312870 300039 Deafness, X-linked 3,
conductive, with stapes fixation, 304400 300044 Wernicke-Korsakoff
syndrome, susceptibility to 300046 Mental retardation, X-linked 23,
nonspecific 300047 Mental retardation, X-linked 20 300048
Intestinal pseudoobstruction, neuronal, X-linked 300049 Nodular
heterotopia, bilateral periventricular 300049 BPNH/MR syndrome
300055 Mental retardation with psychosis, pyramidal signs, and
macroorchidism 300062 Mental retardation, X-linked 14 300071 Night
blindness, congenital stationary, type 2 300076 Wood
neuroimmunologic syndrome 300077 Mental retardation, X-linked 29
300088 Epilepsy, female restricted, with mental retardation 300100
Adrenoleukodystrophy 300100 Adrenomyeloneuropathy 300104 Mental
retardation, X-linked nonspecific, 309541 300110 Night blindness,
congenital stationary, X-linked incomplete, 300071 300123 Mental
retardation with isolated growth hormone deficiency 300126
Dyskeratosis congenita-1, 305000 300136 Diabetes mellitus,
insulin-dependent, X-linked, susceptibility to 300300 XLA and
isolated growth hormone deficiency, 307200 300300
Agammaglobulinemia, type 1, X-linked 300600 Ocular albinism,
Forsius-Eriksson type 301000 Thrombocytopenia, X-linked, 313900
301000 Wiskott-Aldrich syndrome 301200 Amelogenesis imperfecta
301201 Amelogenesis imperfecta-3, hypoplastic type 301300 Anemia,
sideroblastic/hypochromic 301310 Anemia, sideroblastic, with
spinocerebellar ataxia 301500 Fabry disease 301590 Anophthalmos-1
301830 Arthrogryposis, X-linked (spinal muscular atrophy,
infantile, X-linked) 301835 Arts syndrome 301845 Bazex syndrome
301900 Borjeson-Forssman-Lehmann syndrome 302060 Noncompaction of
left ventricular myocardium, isolated 302060 Barth syndrome 302060
Cardiomyopathy, X-linked dilated, 300069 302060 Endocardial
fibroelastosis-2
302350 Nance-Horan syndrome 302960 Chondrodysplasia punctata,
X-linked dominant 303400 Cleft palate, X-linked 303630 Alport
syndrome, 301050 303630 Leiomyomatosis-nephropathy syndrome, 308940
303631 Leiomyomatosis, diffuse, with Alport syndrome 303700
Colorblindness, blue monochromatic 303800 Colorblindness, deutan
303900 Colorblindness, protan 304020 Cone dystrophy, progressive
X-linked, 1 304040 Charcot-Marie-Tooth neuropathy, X-linked-1,
dominant, 302800 304340 Mental retardation, X-linked, syndromic-5,
with Dandy-Walker malformation, basal ganglia disease, and seizures
304500 Deafness, X-linked 2, perceptive congenital 304700
Mohr-Tranebjaerg syndrome 304700 Deafness, X-linked 1, progressive
304700 Jensen syndrome, 311150 304800 Diabetes insipidus,
nephrogenic 305100 Anhidrotic ectodermal dysplasia 305400
Aarskog-Scott syndrome 305450 FG syndrome 305900 Favism 305900 G6PD
deficiency 305900 Hemolytic anemia due to G6PD deficiency 306700
Hemophilia A 306900 Hemophilia B 306995 [Homosexuality, male]
307150 Hypertrichosis, congenital generalized 307700
Hypoparathyroidism, X-linked 308000 HPRT-related gout 308000
Lesch-Nyhan syndrome 308230 Immunodeficiency, X-linked, with
hyper-IgM 308240 Lymphoproliferative syndrome, X-linked 308300
Incontinentia pigmenti, sporadic type 308310 Incontinentia
pigmenti, familial 308380 Severe combined immunodeficiency,
X-linked, 300400 308380 Combined immunodeficiency, X-linked,
moderate, 312863 308840 Spastic paraplegia, 312900 308840
Hydrocephalus due to aqueductal stenosis, 307000 308840 MASA
syndrome, 303350 309000 Lowe syndrome 309200 Manic-depressive
illness, X-linked 309300 Megalocornea, X-linked 309470 Mental
retardation, X-linked, syndromic-3, with spastic diplegia 309500
Renpenning syndrome-1 309545 Mental retardation, X-linked
nonspecific, with aphasia 309548 Mental retardation, X-linked,
FRAXE type 309555 Gustavson syndrome 309605 Mental retardation,
X-linked, syndromic-4, with congenital contractures and low
fingertip arches 309610 Mental retardation, X-linked, syndromic-2,
with dysmorphism and cerebral atrophy 309620 Mental
retardation-skeletal dysplasia 309850 Brunner syndrome 309900
Mucopolysaccharidosis II 310300 Emery-Dreifuss muscular dystrophy
310400 Myotubular myopathy, X-linked 310460 Myopia-1 310460
Bornholm eye disease 310490 Cowchock syndrome 310500 Night
blindness, congenital stationary, type 1 311050 Optic atrophy,
X-linked 311200 Oral-facial-digital syndrome 1 311300
Otopalatodigital syndrome, type I 311510 Waisman
parkinsonism-mental retardation syndrome 311800
Myoglobinuria/hemolysis due to PGK deficiency 311800 Hemolytic
anemia due to PGK deficiency 311850 Phosphoribosyl pyrophosphate
synthetase-related gout 311870 Muscle glycogenosis 312000
Panhypopituitarism, X-linked 312040 N syndrome, 310465 312060
Properdin deficiency, X-linked 312080 Pelizaeus-Merzbacher disease
312080 Spastic paraplegia-2, 312920 312600 Retinitis pigmentosa-2
312760 Turner syndrome 313350 Split hand/foot malformation, type 2
313850 Thoracoabdominal syndrome 314200 [Euthyroidal hyper- and
hypothyroxinemia] 314250 Dystonia-3, torsion, with parkinsonism,
Filipino type 314300 Goeminne TKCR syndrome 314400 Cardiac valvular
dysplasia-1 314580 Wieacker-Wolff syndrome 600020 Prostate cancer,
176807 600035 Schizencephaly 600040 Colorectal cancer 600044
Thrombocythemia, essential, 187950 600045 Xeroderma pigmentosum,
group E, subtype 2 600048 Breast cancer-3 600059 Retinitis
pigmentosa-13 600065 Leukocyte adhesion deficiency, 116920 600079
Colon cancer 600095 Split hand/foot malformation, type 3 600101
Deafness, autosomal dominant 2 600105 Retinitis pigmentosa-12,
autosomal recessive 600119 Muscular dystrophy, Duchenne-like, type
2 600119 Adhalinopathy, primary 600138 Retinitis pigmentosa-11
600140 Rubenstein-Taybi syndrome, 180849 600143 Epilepsy,
progressive, with mental retardation 600151 Bardet-Biedl syndrome 3
600160 Melanoma, 155601 600163 Long QT syndrome-3 600173 SCID,
autosomal recessive, T-negative/B-positive type 600175 Spinal
muscular atrophy, congenital nonprogressive, of lower limbs 600179
Leber congenital amaurosis, type I, 204000 600184 Carnitine
acetyltransferase deficiency 600185 Pancreatic cancer 600185 Breast
cancer 2, early onset 600194 Ichthyosis bullosa of Siemens, 146800
600202 Dyslexia, specific, 2 600211 Cleidocranial dysplasia, 119600
600221 Venous malformations, multiple cutaneous and mucosal, 600195
600223 Spinocerebellar ataxia-4 600225 Phenylketonuria, atypical,
due to GCH1 deficiency, 233910 600225 Dystonia, DOPA-responsive,
128230 600228 Pseudohypoaldosteronism, type I, 264350 600231
Palmoplantar keratoderma, Bothnia type 600234 HMG-CoA synthease-2
deficiency 600243 Temperature-sensitive apoptosis 600258 Colorectal
cancer, hereditary nonpolyposis, type 3 600259 Turcot syndrome with
glioblastoma, 276300 600259 Colorectal cancer, hereditary
nonpolyposis, type 4 600261 Ehlers-Danlos-like syndrome 600266
Resistance/susceptibility to TB, etc. 600273 Polycystic kidney
disease, infantile severe, with tuberous sclerosis 600276 Cerebral
arteriopathy with subcortical infarcts and leukoencephalopathy,
125310 600281 Non-insulin-dependent diabetes mellitus, 125853
600281 MODY, type 1, 125850 600309 Atrioventricular canal defect-1
600310 Pseudoachondroplasia, 177170 600310 Epiphyseal dysplasia,
multiple 1, 132400 600319 Diabetes mellitus, insulin-dependent, 4
600320 Insulin-dependent diabetes mellitus-5 600321 Diabetes
mellitus, insulin-dependent, 7 600332 Rippling muscle disease-1
600354 Spinal muscular atrophy-1, 253300 600354 Spinal muscular
atrophy-2, 253550 600354 Spinal muscular atrophy-3, 253400 600364
Cone dystrophy-3, 602093 600374 Bardet-Biedl syndrome 4 600414
Adrenoleukodystrophy, neonatal, 202370 600415 Ataxia with isolated
vitamin E deficiency, 277460 600429 [Ii blood group, 110800] 600509
Persistent hyperinsulinemic hypoglycemia of infancy, 256450 600510
Pigment dispersion syndrome 600511 Schizophrenia-3 600512 Epilepsy,
partial 600525 Trichodontoosseous syndrome, 190320 600528 CPT
deficiency, hepatic, type I, 255120 600536 Myopathy, congenital
600542 Chondrosarcoma, extraskeletal myxoid 600584 Atrial septal
defect with atrioventricular conduction defects, 108900 600593
Craniosynostosis, Adelaide type 600617 Lipoid adrenal hyperplasia,
201710 600618 Leukemia, acute lymphoblastic 600623 Prostate cancer,
176807 600624 Cone-rod retinal dystrophy-1 600631 Enuresis,
nocturnal, 1 600650 Myopathy due to CPT II deficiency, 255110
600650 CPT deficiency, hepatic, type II, 600649 600698 Salivary
adenoma 600698 Uterine leiomyoma 600698 Lipoma 600698 Lipomatosis,
mutiple, 151900 600700 Lipoma 600701 Lipoma 600722 Ceroid
lipofuscinosis, neuronal, variant juvenile type, with granular
osmiophilic deposits 600722 Ceroid lipofuscinosis, neuronal-1,
infantile, 256730 600725 Holoprosencephaly-3, 142945 600759
Alzheimer disease-4 600760 Pseudohypoaldosteronism, type I, 264350
600760 Liddle syndrome, 177200 600761 Pseudohypoaldosteronism, type
I, 264350 600761 Liddle syndrome, 177200 600795 Dementia, familial,
nonspecific 600807 Bronchial asthma 600808 Enuresis, nocturnal, 2
600811 Xeroderma pigmentosum, group E, DDB-negative subtype, 278740
600837 Hirschsprung disease, 142623 600839 Bartter syndrome, 241200
600850 Schizophrenia disorder-4 600852 Retinitis pigmentosa-17
600856 Beckwith-Wiedemann syndrome, 130650 600881 Cataract,
congenital, zonular, with sutural opacities 600882
Charcot-Marie-Tooth neuropathy-2B 600883 Diabetes mellitus,
insulin-dependent, 8 600887 Endometrial carcinoma 600897 Cataract,
zonular pulverulent-1, 116200 600900 Muscular dystrophy,
limb-girdle, type 2E 600918 Cystinuria, type III 600923 Porphyria
variegata, 176200 600937 Persistent hyperinsulinemic hypoglycemia
of infancy, 256450 600946 Short stature, autosomal dominant, with
normal serum growth hormone binding protein 600946 Short stature,
idiopathic 600946 Laron dwarfism, 262500 600956 Persistent
Mullerian duct syndrome, type II, 261550 600957 Persistent
Mullerian duct syndrome, type I, 261550 600958 Cardiomyopathy,
familial hypertrophic, 4, 115197 600965 Deafness, autosomal
dominant 6 600968 Gitelman syndrome, 263800 600971 Deafness,
autosomal recessive 6 600974 Deafness, autosomal recessive 7 600975
Glaucoma 3, primary infantile, B 600977 Cone dystrophy, progressive
600983 Pseudohypoaldosteronism type I, autosomal dominant, 177735
600993 Pancreatic cancer 600995 Nephrotic syndrome, idiopathic,
steroid-resistant 600996 Arrhythmogenic right ventricular
dysplasia-2 600998 Bleeding diathesis due to GNAQ deficiency 601002
5-oxoprolinuria, 266130 601002 Hemolytic anemia due to glutathione
synthetase deficiency, 231900 601011 Spinocerebellar ataxia-6,
183086 601011 Cerebellar ataxia, pure 601011 Episodic ataxia, type
2, 108500 601011 Hemiplegic migraine, familial, 141500 601071
Deafness, autosomal recessive 9 601072 Deafness, autosomal
recessive 8 601090 Iridogoniodysgenesis, 601631 601105
Pycnodysostosis, 265800 601107 Dubin-Johnson syndrome, 237500
601130 Tolbutamide poor metabolizer 601145 Epilepsy, progressive
myoclonic 1, 254800 601146 Brachydactyly, type C, 113100 601146
Acromesomelic dysplasia, Hunter-Thompson type, 201250 601146
Chondrodysplasia, Grebe type, 200700 601154 Cardiomyopathy,
dilated, 1E 601199 Neonatal hyperparathyroidism, 239200 601199
Hypocalcemia, autosomal dominant, 601198 601199 Hypocalciuric
hypercalcemia, type I, 145980 601202 Cataract, anterior polar-2
601208 Insulin-dependent diabetes mellitus-11 601226 Progressive
external ophthalmoplegia, type 2 601238 Cerebellar ataxia, Cayman
type 601267 HIV infection, susceptibility/resistence to 601277
Ichthyosis, lamellar, type 2 601284 Hereditary hemorrhagic
telangiectasia-2, 600376 601313 Polycystic kidney disease, adult
type I, 173900 601316 Deafness, autosomal dominant 10 601318
Diabetes mellitus, insulin-dependent, 13 601362 DiGeorge
syndrome/velocardiofacial syndrome complex-2 601363 Wilms tumor,
type 4 601373 HIV infection, susceptibility/resistance to 601382
Charcot-Marie-Tooth neuropathy-4B
601385 Prostate cancer 601387 Breast cancer 601399 Platelet
disorder, familial, with associated myeloid malignancy 601402
Leukemia, myeloid, acute 601406 B-cell non-Hodgkin lymphoma,
high-grade 601410 Diabetes mellitus, transient neonatal 601411
Muscular dystrophy, limb-girdle, type 2F, 601287 601412 Deafness,
autosomal dominant 7 601414 Retinitis pigmentosa-18 601458
Inflammatory bowel disease-2 601471 Moebius syndrome-2 601493
Cardiomyopathy, dilated 1C 601494 Cardiomyopathy, familial,
dilated-2 601498 Peroxisomal biogenesis disorder, complementation
group 4 601518 Prostate cancer, hereditary, 1, 176807 601545
Lissencephaly-1 601556 Spinocerebellar ataxia-1, 164400 601567
Combined factor V and VIII deficiency, 227300 601596
Charcot-Marie-Tooth neuropathy, demyelinating 601604 Mycobacterial
and salmonella infections, susceptibility to 601606
Trichoepithelioma, multiple familial 601620 Holt-Oram syndrome,
142900 601621 Ulnar-mammary syndrome, 181450 601622 Saethre-Chotzen
syndrome, 101400 601623 Angelman syndrome 601649 Blepharophimosis,
epicanthus inversus, and ptosis, type 2 601650 Paraganglioma,
familial nonchromaffin, 2 601652 Glaucoma 1A, primary open angle,
juvenile-onset, 137750 601653 Branchiootic syndrome 601653
Branchiootorenal syndrome, 113650 601666 Insulin-dependent diabetes
mellitus-15 601669 Hirschsprung disease, one form 601676 Acute
insulin response 601680 Distal arthrogryposis, type 2B 601682
Glaucoma 1C, primary open angle 601687 Meesmann corneal dystrophy,
122100 601690 Platelet-activating factor acetylhydrolase deficiency
601691 Retinitis pigmentosa-19, 601718 601691 Stargardt disease-1,
248200 601691 Cone-rod dystrophy 3 601691 Fundus flavimaculatus
with macular dystrophy, 248200 601692 Reis-Bucklers corneal
dystrophy 601692 Corneal dystrophy, Avellino type 601692 Corneal
dystrophy, Groenouw type I, 121900 601692 Corneal dystrophy,
lattice type I, 122200 601718 Retinitis pigmentosa-19 601728
Bannayan-Zonana syndrome, 153480 601728 Cowden disease, 158350
601728 Endometrial carcinoma 601728 Lhermitte-Duclos syndrome
601744 Systemic lupus erythematosus, susceptibility to, 1 601757
Rhizomelic chondrodysplasia punctata, type 1, 215100 601768
Leukemia, acute myeloid 601769 Osteoporosis, involutional 601769
Rickets, vitamin D-resistant, 277440 601771 Glaucoma 3A, primary
infantile, 231300 601777 Cone dystrophy, progressive 601780
Ceroid-lipofuscinosis, neuronal-6, variant late infantile 601785
Carbohydrate-deficient glycoprotein syndrome, type I, 212065 601800
[Hair color, brown] 601843 Hypothyroidism, congenital, 274400
601844 Pseudohypoaldosteronism type II 601846 Muscular dystrophy
with rimmed vacuoles 601847 Progressive intrahepatic cholestasis-2
601850 Retinitis pigmentosa-deafness syndrome 601863 Bare
lymphocyte syndrome, complementation group C 601868 Deafness,
autosomal dominant 13 601884 [High bone mass] 601889 Lymphoma,
diffuse large cell 601916 Pancreatic cancer 601928 Monilethrix,
158000 601941 Insulin-dependent diabetes mellitus-6 601954 Muscular
dystrophy, limb-girdle, type 2G 601969 Medulloblastoma, 155255
601969 Glioblastoma multiforme, 137800 601975 Ectodermal
dysplasia/skin fragility syndrome 601990 Neuroblastoma 602014
Hypomagnesemia with secondary hypocalcemia 602023 Bartter syndrome,
type 3 602025 Obesity/hyperinsulinism, susceptibility to 602028
Multiple myeloma 602066 Convulsions, infantile and paroxysmal
choreoathetosis 602067 Cardiomyopathy, dilated, 1F 602078 Fibrosis
of extraocular muscles, congenital, 2 602080 Paget disease of
bone-2 602081 Speech-language disorder-1 602082 Corneal dystrophy,
Thiel-Behnke type 602084 Endometrial carcinoma 602085 Postaxial
polydactyly, type A2 602086 Arrhythmogenic right ventricular
dysplasia-3 602087 Arrhythmogenic right ventricular dysplasia-4
602088 Nephronophthisis, infantile 602089 Hemangioma, capillary,
hereditary 602091 Marfan syndrome, atypical 602092 Deafness,
autosomal recessive 18 602094 Lipodystrophy, familial partial
602096 Alzheimer disease-5 602099 Amytrophic lateral sclerosis-5
602116 Glioma 602117 Prader-Willi syndrome 602121 Deafness,
autosomal dominant nonsyndromic sensorineural, 1, 124900 602134
Tremor, familial essential, 2 602136 Refsum disease, infantile,
266510 602136 Zellweger syndrome-1, 214100 602136
Adrenoleukodystrophy, neonatal, 202370 602153 Monilethrix, 158000
602216 Peutz-Jeghers syndrome, 175200 602225 Cone-rod retinal
dystrophy-2, 120970 602225 Leber congenital amaurosis, type III
602235 Epilepsy, benign, neonatal, type 1, 121200 602279
Oculopharyngeal muscular dystorphy, 164300 602279 Oculopharyngeal
muscular dystrophy, autosomal recessive, 257950 602280 Retinitis
pigmentosa-14, 600132 602363 Ellis-van Creveld-like syndrome 602397
Cholestasis, benign recurrent intrahepatic, 243300 602397
Cholestasis, progressive familial intrahepatic-1, 211600 602403
Alzheimer disease, susceptibility to 602404 Parkinson disease, type
3 602447 Coronary artery disease, susceptibility to 602460
Deafness, autosomal dominant 15, 602459 602475 Ossification of
posterior longitudinal ligament of spine 602476 Febrile
convulsions, familial, 1 602477 Febrile convulsions, familial, 2
602491 Hyperlipidemia, familial combined, 1 602522 Bartter
syndrome, infantile, with sensorineural deafness 602544 Parkinson
disease, juvenile, type 2, 600116 602568
Homocystinuria-megaloblastic anemia, cbl E type, 236270 602574
Deafness, autosomal dominant 12, 601842 602574 Deafness, autosomal
dominant 8, 601543 602575 Nail-patella syndrome with open-angle
glaucoma, 137750 602575 Nail-patella syndrome, 161200 602616
Carbohydrate-deficient glycoprotein syndrome, type II, 212066
602629 Dystonia-6, torsion 602631 Rhabdomyosarcoma, 268210 602631
Breast Cancer 602669 Anterior segment mesenchymal dysgenesis and
cataract, 107250 602669 Cataract, congenital 602685 Mental
retardation, severe, with spasticity and tapetoretinal degeneration
602716 Nephrosis-1, congenital, Finnish type, 256300 602759
Prostate cancer, hereditary, 2, 176807 602771 Muscular dystrophy,
congenital, with early spine rigidity 602772 Retinitis
pitmentosa-24 602782 Faisalabad histiocytosis 602783 Spastic
paraplegia-7
Mature Polypeptides
[0227] The present invention also encompasses mature forms of a
polypeptide having the amino acid sequence of SEQ ID NO:Y and/or
the amino acid sequence encoded by the cDNA in a deposited clone.
Polynucleotides encoding the mature forms (such as, for example,
the polynucleotide sequence in SEQ ID NO:X and/or the
polynucleotide sequence contained in the cDNA of a deposited clone)
are also encompassed by the invention. Moreover, fragments or
variants of these polypeptides (such as, fragments as described
herein, polypeptides at least 80%, 85%, 90%, 95%, 96%, 97%, 98%,
99%, or 100% identical to these polypeptides, or polypeptides
encoded by a polynucleotide that hybridizes under stringent
conditions to the complementary strand of the polynucleotide
encoding these polypeptides) are also encompassed by the invention.
In preferred embodiments, these fragments or variants retain one or
more functional activities of the full-length or mature form of the
polypeptide (e.g., biological activity (such as, for example,
activity in detecting, preventing, treating and/or indicated
disorders), antigenicity (ability to bind, or compete with a
polypeptide of the invention for binding, to an anti-polypeptide of
the invention antibody), immunogenicity (ability to generate
antibody which binds to a specific polypeptide of the invention),
ability to form multimers with polypeptides of the invention, and
ability to bind to a receptor or ligand for a polypeptide of the
invention). Antibodies that bind the polypeptides of the invention,
and polynucleotides encoding these polypeptides are also
encompassed by the invention.
[0228] According to the signal hypothesis, proteins secreted by
mammalian cells have a signal or secretary leader sequence which is
cleaved from the mature protein once export of the growing protein
chain across the rough endoplasmic reticulum has been initiated.
Most mammalian cells and even insect cells cleave secreted proteins
with the same specificity. However, in some cases, cleavage of a
secreted protein is not entirely uniform, which results in two or
more mature species of the protein. Further, it has long been known
that cleavage specificity of a secreted protein is ultimately
determined by the primary structure of the complete protein, that
is, it is inherent in the amino acid sequence of the
polypeptide.
[0229] Methods for predicting whether a protein has a signal
sequence, as well as the cleavage point for that sequence, are
available. For instance, the method of McGeoch, Virus Res.
3:271-286 (1985), uses the information from a short N-terminal
charged region and a subsequent uncharged region of the complete
(uncleaved) protein. The method of von Heinje, Nucleic Acids Res.
14:4683-4690 (1986) uses the information from the residues
surrounding the cleavage site, typically residues -13 to +2, where
+1 indicates the amino terminus of the secreted protein. The
accuracy of predicting the cleavage points of known mammalian
secretory proteins for each of these methods is in the range of
75-80%. (von Heinje, supra.) However, the two methods do not always
produce the same predicted cleavage point(s) for a given
protein.
[0230] In the present case, the deduced amino acid sequence of the
secreted polypeptide was analyzed by a computer program called
SignalP (Henrik Nielsen et al., Protein Engineering 10:1-6 (1997)),
which predicts the cellular location of a protein based on the
amino acid sequence. As part of this computational prediction of
localization, the methods of McGeoch and von Heinje are
incorporated. The analysis of the amino acid sequences of the
secreted proteins described herein by this program provided the
results shown in Table 1A.
[0231] In specific embodiments, polypeptides of the invention
comprise, or alternatively consist of, the predicted mature form of
the polypeptide as delineated in columns 14 and 15 of Table 1A.
Moreover, fragments or variants of these polypeptides (such as,
fragments as described herein, polypeptides at least 80%, 85%, 90%,
95%, 96%, 97%, 98%, 99%, or 100% identical to these polypeptides,
or polypeptides encoded by a polynucleotide that hybridizes under
stringent conditions to the complementary strand of the
polynucleotide encoding these polypeptides) are also encompassed by
the invention. In preferred embodiments, these fragments or
variants retain one or more functional activities of the
full-length or mature form of the polypeptide (e.g., biological
activity, antigenicity [ability to bind (or compete with a
polypeptide of the invention for binding) to an anti-polypeptide of
the invention antibody], immunogenicity (ability to generate
antibody which binds to a specific polypeptide of the invention),
ability to form multimers with polypeptides of the invention, and
ability to bind to a receptor or ligand for a polypeptide of the
invention). Antibodies that bind the polypeptides of the invention,
and polynucleotides encoding these polypeptides are also
encompassed by the invention.
[0232] Polynucleotides encoding proteins comprising, or consisting
of, the predicted mature form of polypeptides of the invention
(e.g., polynucleotides having the sequence of SEQ ID NO: X (Table
1A, column 4), the sequence delineated in columns 7 and 8 of Table
1A, and a sequence encoding the mature polypeptide delineated in
columns 14 and 15 of Table 1A (e.g., the sequence of SEQ ID NO:X
encoding the mature polypeptide delineated in columns 14 and 15 of
Table 1)) are also encompassed by the invention, as are fragments
or variants of these polynucleotides (such as, fragments as
described herein, polynucleotides at least 80%, 85%, 90%, 95%, 96%,
97%, 98%, 99%, or 100% identical to these polynucleotides, and
nucleic acids which hybridizes under stringent conditions to the
complementary strand of the polynucleotide).
[0233] As one of ordinary skill would appreciate, however, cleavage
sites sometimes vary from organism to organism and cannot be
predicted with absolute certainty. Accordingly, the present
invention provides secreted polypeptides having a sequence shown in
SEQ ID NO:Y which have an N-terminus beginning within 15 residues
of the predicted cleavage point (i.e., having 1, 2, 3, 4, 5, 6, 7,
8, 9, 10, 11, 12, 13, 14, or 15 more or less contiguous residues of
SEQ ID NO:Y at the N-terminus when compared to the predicted mature
form of the polypeptide (e.g., the mature polypeptide delineated in
columns 14 and 15 of Table 1). Similarly, it is also recognized
that in some cases, cleavage of the signal sequence from a secreted
protein is not entirely uniform, resulting in more than one
secreted species. These polypeptides, and the polynucleotides
encoding such polypeptides, are contemplated by the present
invention.
[0234] Moreover, the signal sequence identified by the above
analysis may not necessarily predict the naturally occurring signal
sequence. For example, the naturally occurring signal sequence may
be further upstream from the predicted signal sequence. However, it
is likely that the predicted signal sequence will be capable of
directing the secreted protein to the ER. Nonetheless, the present
invention provides the mature protein produced by expression of the
polynucleotide sequence of SEQ ID NO:X and/or the polynucleotide
sequence contained in the cDNA of a deposited clone, in a mammalian
cell (e.g., COS cells, as described below). These polypeptides, and
the polynucleotides encoding such polypeptides, are contemplated by
the present invention.
Polynucleotide and Polypeptide Variants
[0235] The present invention is also directed to variants of the
polynucleotide sequence disclosed in SEQ ID NO:X or the
complementary strand thereto, nucleotide sequences encoding the
polypeptide of SEQ ID NO:Y, the nucleotide sequence of SEQ ID NO:X
that encodes the polypeptide sequence as defined in columns 13 and
14 of Table 1A, nucleotide sequences encoding the polypeptide
sequence as defined in columns 13 and 14 of Table 1A, the
nucleotide sequence of SEQ ID NO:X encoding the polypeptide
sequence as defined in column 5 of Table 1B.1, nucleotide sequences
encoding the polypeptide as defined in column 6 and column 7 of
Table 1B.1, the nucleotide sequence as defined in columns 8 and 9
of Table 2, nucleotide sequences encoding the polypeptide encoded
by the nucleotide sequence as defined in columns 8 and 9 of Table
2, the nucleotide sequence as defined in column 6 of Table 1C,
nucleotide sequences encoding the polypeptide encoded by the
nucleotide sequence as defined in column 6 of Table 1C, the cDNA
sequence contained in ATCC Deposit NO: Z, nucleotide sequences
encoding the polypeptide encoded by the cDNA sequence contained in
ATCC Deposit NO: Z, and/or nucleotide sequences encoding a mature
(secreted) polypeptide encoded by the cDNA sequence contained in
ATCC Deposit NO: Z.
[0236] The present invention also encompasses variants of the
polypeptide sequence disclosed in SEQ ID NO:Y, the polypeptide as
defined in columns 13 and 14 of Table 1A, the polypeptide sequence
as defined in columns 6 and 7 of Table 1B.1, a polypeptide sequence
encoded by the nucleotide sequence as defined in columns 8 and 9 of
Table 2, a polypeptide sequence encoded by the nucleotide sequence
as defined in column 6 of Table 1C, a polypeptide sequence encoded
by the complement of the polynucleotide sequence in SEQ ID NO:X,
the polypeptide sequence encoded by the cDNA sequence contained in
ATCC Deposit NO: Z and/or a mature (secreted) polypeptide encoded
by the cDNA sequence contained in ATCC Deposit NO: Z.
[0237] "Variant" refers to a polynucleotide or polypeptide
differing from the polynucleotide or polypeptide of the present
invention, but retaining essential properties thereof. Generally,
variants are overall closely similar, and, in many regions,
identical to the polynucleotide or polypeptide of the present
invention.
[0238] Thus, one aspect of the invention provides an isolated
nucleic acid molecule comprising, or alternatively consisting of, a
polynucleotide having a nucleotide sequence selected from the group
consisting of: (a) a nucleotide sequence described in SEQ ID NO:X
or contained in the cDNA sequence of ATCC Deposit No: Z; (b) a
nucleotide sequence in SEQ ID NO:X or the cDNA in ATCC Deposit No:
Z which encodes the complete amino acid sequence of SEQ ID NO:Y or
the complete amino acid sequence encoded by the cDNA in ATCC
Deposit No: Z; (c) a nucleotide sequence in SEQ ID NO:X or the cDNA
in ATCC Deposit No: Z which encodes a mature polypeptide (i.e., a
secreted polypeptide (e.g., as delineated in columns 14 and 15 of
Table 1A)); (d) a nucleotide sequence in SEQ ID NO:X or the cDNA
sequence of ATCC Deposit No: Z, which encodes a biologically active
fragment of a polypeptide; (e) a nucleotide sequence in SEQ ID NO:X
or the cDNA sequence of ATCC Deposit No: Z, which encodes an
antigenic fragment of a polypeptide; (f) a nucleotide sequence
encoding a polypeptide comprising the complete amino acid sequence
of SEQ ID NO:Y or the complete amino acid sequence encoded by the
cDNA in ATCC Deposit No: Z; (g) a nucleotide sequence encoding a
mature polypeptide of the amino acid sequence of SEQ ID NO:Y (i.e.,
a secreted polypeptide (e.g., as delineated in columns 14 and 15 of
Table 1A)) or a mature polypeptide of the amino acid sequence
encoded by the cDNA in ATCC Deposit No: Z; (h) a nucleotide
sequence encoding a biologically active fragment of a polypeptide
having the complete amino acid sequence of SEQ ID NO:Y or the
complete amino acid sequence encoded by the cDNA in ATCC Deposit
No: Z; (i) a nucleotide sequence encoding an antigenic fragment of
a polypeptide having the complete amino acid sequence of SEQ ID
NO:Y or the complete amino acid sequence encoded by the cDNA in
ATCC Deposit No: Z; and (j) a nucleotide sequence complementary to
any of the nucleotide sequences in (a), (b), (c), (d), (e), (f),
(g), (h), or (i) above.
[0239] The present invention is also directed to nucleic acid
molecules which comprise, or alternatively consist of, a nucleotide
sequence which is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%
or 100%, identical to, for example, any of the nucleotide sequences
in (a), (b), (c), (d), (e), (f), (g), (h), (i), or (j) above, the
nucleotide coding sequence in SEQ ID NO:X or the complementary
strand thereto, the nucleotide coding sequence of the cDNA
contained in ATCC Deposit No: Z or the complementary strand
thereto, a nucleotide sequence encoding the polypeptide of SEQ ID
NO:Y, a nucleotide sequence encoding a polypeptide sequence encoded
by the nucleotide sequence in SEQ ID NO:X, a polypeptide sequence
encoded by the complement of the polynucleotide sequence in SEQ ID
NO:X, a nucleotide sequence encoding the polypeptide encoded by the
cDNA contained in ATCC Deposit No: Z, the nucleotide coding
sequence in SEQ ID NO:X as defined in columns 8 and 9 of Table 2 or
the complementary strand thereto, a nucleotide sequence encoding
the polypeptide encoded by the nucleotide sequence in SEQ ID NO:X
as defined in columns 8 and 9 of Table 2 or the complementary
strand thereto, the nucleotide coding sequence in SEQ ID NO:B as
defined in column 6 of Table 1C or the complementary strand
thereto, a nucleotide sequence encoding the polypeptide encoded by
the nucleotide sequence in SEQ ID NO:B as defined in column 6 of
Table 1C or the complementary strand thereto, the nucleotide
sequence in SEQ ID NO:X encoding the polypeptide sequence as
defined in columns 6 and 7 of Table 1B.1 or the complementary
strand thereto, nucleotide sequences encoding the polypeptide as
defined in column 6 and 7 of Table 1B.1 or the complementary strand
thereto, and/or polynucleotide fragments of any of these nucleic
acid molecules (e.g., those fragments described herein).
Polynucleotides which hybridize to the complement of these nucleic
acid molecules under stringent hybridization conditions or
alternatively, under lower stringency conditions, are also
encompassed by the invention, as are polypeptides encoded by these
polynucleotides and nucleic acids.
[0240] In a preferred embodiment, the invention encompasses nucleic
acid molecules which comprise, or alternatively, consist of a
polynucleotide which hybridizes under stringent hybridization
conditions, or alternatively, under lower stringency conditions, to
a polynucleotide in (a), (b), (c), (d), (e), (f), (g), (h), or (i),
above, as are polypeptides encoded by these polynucleotides. In
another preferred embodiment, polynucleotides which hybridize to
the complement of these nucleic acid molecules under stringent
hybridization conditions, or alternatively, under lower stringency
conditions, are also encompassed by the invention, as are
polypeptides encoded by these polynucleotides.
[0241] In another embodiment, the invention provides a purified
protein comprising, or alternatively consisting of, a polypeptide
having an amino acid sequence selected from the group consisting
of: (a) the complete amino acid sequence of SEQ ID NO:Y or the
complete amino acid sequence encoded by the cDNA in ATCC Deposit
No: Z; (b) the amino acid sequence of a mature (secreted) form of a
polypeptide having the amino acid sequence of SEQ ID NO:Y (e.g., as
delineated in columns 14 and 15 of Table 1A) or a mature form of
the amino acid sequence encoded by the cDNA in ATCC Deposit No: Z
mature; (c) the amino acid sequence of a biologically active
fragment of a polypeptide having the complete amino acid sequence
of SEQ ID NO:Y or the complete amino acid sequence encoded by the
cDNA in ATCC Deposit No: Z; and (d) the amino acid sequence of an
antigenic fragment of a polypeptide having the complete amino acid
sequence of SEQ ID NO:Y or the complete amino acid sequence encoded
by the cDNA in ATCC Deposit No: Z.
[0242] The present invention is also directed to proteins which
comprise, or alternatively consist of, an amino acid sequence which
is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100%,
identical to, for example, any of the amino acid sequences in (a),
(b), (c), or (d), above, the amino acid sequence shown in SEQ ID
NO:Y, the amino acid sequence encoded by the cDNA contained in ATCC
Deposit No: Z, the amino acid sequence of the polypeptide encoded
by the nucleotide sequence in SEQ ID NO:X as defined in columns 8
and 9 of Table 2, the amino acid sequence of the polypeptide
encoded by the nucleotide sequence in SEQ ID NO:B as defined in
column 6 of Table 1C, the amino acid sequence as defined in column
6 and 7 of Table 1B. 1, an amino acid sequence encoded by the
nucleotide sequence in SEQ ID NO:X, and an amino acid sequence
encoded by the complement of the polynucleotide sequence in SEQ ID
NO:X. Fragments of these polypeptides are also provided (e.g.,
those fragments described herein). Further proteins encoded by
polynucleotides which hybridize to the complement of the nucleic
acid molecules encoding these amino acid sequences under stringent
hybridization conditions or alternatively, under lower stringency
conditions, are also encompassed by the invention, as are the
polynucleotides encoding these proteins.
[0243] By a nucleic acid having a nucleotide sequence at least, for
example, 95% "identical" to a reference nucleotide sequence of the
present invention, it is intended that the nucleotide sequence of
the nucleic acid is identical to the reference sequence except that
the nucleotide sequence may include up to five point mutations per
each 100 nucleotides of the reference nucleotide sequence encoding
the polypeptide. In other words, to obtain a nucleic acid having a
nucleotide sequence at least 95% identical to a reference
nucleotide sequence, up to 5% of the nucleotides in the reference
sequence may be deleted or substituted with another nucleotide, or
a number of nucleotides up to 5% of the total nucleotides in the
reference sequence may be inserted into the reference sequence. The
query sequence may be an entire sequence referred to in Table 1B or
2 as the ORF (open reading frame), or any fragment specified as
described herein.
[0244] As a practical matter, whether any particular nucleic acid
molecule or polypeptide is at least 80%, 85%, 90%, 95%, 96%, 97%,
98% or 99% identical to a nucleotide sequence of the present
invention can be determined conventionally using known computer
programs. A preferred method for determining the best overall match
between a query sequence (a sequence of the present invention) and
a subject sequence, also referred to as a global sequence
alignment, can be determined using the FASTDB computer program
based on the algorithm of Brutlag et al. (Comp. App. Biosci.
6:237-245 (1990)). In a sequence alignment the query and subject
sequences are both DNA sequences. An RNA sequence can be compared
by converting U's to T's. The result of said global sequence
alignment is expressed as percent identity. Preferred parameters
used in a FASTDB alignment of DNA sequences to calculate percent
identity are: Matrix=Unitary, k-tuple=4, Mismatch Penalty=1,
Joining Penalty=30, Randomization Group Length=0, Cutoff Score=1,
Gap Penalty=5, Gap Size Penalty 0.05, Window Size=500 or the length
of the subject nucleotide sequence, whichever is shorter.
[0245] If the subject sequence is shorter than the query sequence
because of 5' or 3' deletions, not because of internal deletions, a
manual correction must be made to the results. This is because the
FASTDB program does not account for 5' and 3' truncations of the
subject sequence when calculating percent identity. For subject
sequences truncated at the 5' or 3' ends, relative to the query
sequence, the percent identity is corrected by calculating the
number of bases of the query sequence that are 5' and 3' of the
subject sequence, which are not matched/aligned, as a percent of
the total bases of the query sequence. Whether a nucleotide is
matched/aligned is determined by results of the FASTDB sequence
alignment. This percentage is then subtracted from the percent
identity, calculated by the above FASTDB program using the
specified parameters, to arrive at a final percent identity score.
This corrected score is what is used for the purposes of the
present invention. Only bases outside the 5' and 3' bases of the
subject sequence, as displayed by the FASTDB alignment, which are
not matched/aligned with the query sequence, are calculated for the
purposes of manually adjusting the percent identity score.
[0246] For example, a 90 base subject sequence is aligned to a 100
base query sequence to determine percent identity. The deletions
occur at the 5' end of the subject sequence and therefore, the
FASTDB alignment does not show a matched/alignment of the first 10
bases at 5' end. The 10 unpaired bases represent 10% of the
sequence (number of bases at the 5' and 3' ends not matched/total
number of bases in the query sequence) so 10% is subtracted from
the percent identity score calculated by the FASTDB program. If the
remaining 90 bases were perfectly matched the final percent
identity would be 90%. In another example, a 90 base subject
sequence is compared with a 100 base query sequence. This time the
deletions are internal deletions so that there are no bases on the
5' or 3' of the subject sequence which are not matched/aligned with
the query. In this case the percent identity calculated by FASTDB
is not manually corrected. Once again, only bases 5' and 3' of the
subject sequence which are not matched/aligned with the query
sequence are manually corrected for. No other manual corrections
are to be made for the purposes of the present invention.
[0247] By a polypeptide having an amino acid sequence at least, for
example, 95% "identical" to a query amino acid sequence of the
present invention, it is intended that the amino acid sequence of
the subject polypeptide is identical to the query sequence except
that the subject polypeptide sequence may include up to five amino
acid alterations per each 100 amino acids of the query amino acid
sequence. In other words, to obtain a polypeptide having an amino
acid sequence at least 95% identical to a query amino acid
sequence, up to 5% of the amino acid residues in the subject
sequence may be inserted, deleted, (indels) or substituted with
another amino acid. These alterations of the reference sequence may
occur at the amino or carboxy terminal positions of the reference
amino acid sequence or anywhere between those terminal positions,
interspersed either individually among residues in the reference
sequence or in one or more contiguous groups within the reference
sequence.
[0248] As a practical matter, whether any particular polypeptide is
at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to, for
instance, the amino acid sequence of a polypeptide referred to in
Table 1A (e.g., the amino acid sequence delineated in columns 14
and 15) or a fragment thereof, Table 1B.1 (e.g., the amino acid
sequence identified in column 6) or a fragment thereof, Table 2
(e.g., the amino acid sequence of the polypeptide encoded by the
polynucleotide sequence defined in columns 8 and 9 of Table 2) or a
fragment thereof, the amino acid sequence of the polypeptide
encoded by the polynucleotide sequence in SEQ ID NO:B as defined in
column 6 of Table 1C or a fragment thereof, the amino acid sequence
of the polypeptide encoded by the nucleotide sequence in SEQ ID
NO:X or a fragment thereof, or the amino acid sequence of the
polypeptide encoded by cDNA contained in ATCC Deposit No: Z, or a
fragment thereof, the amino acid sequence of a mature (secreted)
polypeptide encoded by cDNA contained in ATCC Deposit No: Z, or a
fragment thereof, can be determined conventionally using known
computer programs. A preferred method for determining the best
overall match between a query sequence (a sequence of the present
invention) and a subject sequence, also referred to as a global
sequence alignment, can be determined using the FASTDB computer
program based on the algorithm of Brutlag et al. (Comp. App.
Biosci. 6:237-245 (1990)). In a sequence alignment the query and
subject sequences are either both nucleotide sequences or both
amino acid sequences. The result of said global sequence alignment
is expressed as percent identity. Preferred parameters used in a
FASTDB amino acid alignment are: Matrix=PAM 0, k-tuple=2, Mismatch
Penalty=1, Joining Penalty=20, Randomization Group Length=0, Cutoff
Score=1, Window Size=sequence length, Gap Penalty=5, Gap Size
Penalty=0.05, Window Size=500 or the length of the subject amino
acid sequence, whichever is shorter.
[0249] If the subject sequence is shorter than the query sequence
due to N- or C-terminal deletions, not because of internal
deletions, a manual correction must be made to the results. This is
because the FASTDB program does not account for N- and C-terminal
truncations of the subject sequence when calculating global percent
identity. For subject sequences truncated at the N- and C-termini,
relative to the query sequence, the percent identity is corrected
by calculating the number of residues of the query sequence that
are N- and C-terminal of the subject sequence, which are not
matched/aligned with a corresponding subject residue, as a percent
of the total bases of the query sequence. Whether a residue is
matched/aligned is determined by results of the FASTDB sequence
alignment. This percentage is then subtracted from the percent
identity, calculated by the above FASTDB program using the
specified parameters, to arrive at a final percent identity score.
This final percent identity score is what is used for the purposes
of the present invention. Only residues to the N- and C-termini of
the subject sequence, which are not matched/aligned with the query
sequence, are considered for the purposes of manually adjusting the
percent identity score. That is, only query residue positions
outside the farthest N- and C-terminal residues of the subject
sequence.
[0250] For example, a 90 amino acid residue subject sequence is
aligned with a 100 residue query sequence to determine percent
identity. The deletion occurs at the N-terminus of the subject
sequence and therefore, the FASTDB alignment does not show a
matching/alignment of the first 10 residues at the N-terminus. The
10 unpaired residues represent 10% of the sequence (number of
residues at the N- and C-termini not matched/total number of
residues in the query sequence) so 10% is subtracted from the
percent identity score calculated by the FASTDB program. If the
remaining 90 residues were perfectly matched the final percent
identity would be 90%. In another example, a 90 residue subject
sequence is compared with a 100 residue query sequence. This time
the deletions are internal deletions so there are no residues at
the N- or C-termini of the subject sequence which are not
matched/aligned with the query. In this case the percent identity
calculated by FASTDB is not manually corrected. Once again, only
residue positions outside the N- and C-terminal ends of the subject
sequence, as displayed in the FASTDB alignment, which are not
matched/aligned with the query sequnce are manually corrected for.
No other manual corrections are to made for the purposes of the
present invention.
[0251] The polynucleotide variants of the invention may contain
alterations in the coding regions, non-coding regions, or both.
Especially preferred are polynucleotide variants containing
alterations which produce silent substitutions, additions, or
deletions, but do not alter the properties or activities of the
encoded polypeptide. Nucleotide variants produced by silent
substitutions due to the degeneracy of the genetic code are
preferred. Moreover, polypeptide variants in which less than 50,
less than 40, less than 30, less than 20, less than 10, or 5-50,
5-25, 5-10, 1-5, or 1-2 amino acids are substituted, deleted, or
added in any combination are also preferred. Polynucleotide
variants can be produced for a variety of reasons, e.g., to
optimize codon expression for a particular host (change codons in
the human mRNA to those preferred by a bacterial host such as E.
coli).
[0252] Naturally occurring variants are called "allelic variants,"
and refer to one of several alternate forms of a gene occupying a
given locus on a chromosome of an organism. (Genes II, Lewin, B.,
ed., John Wiley & Sons, New York (1985)). These allelic
variants can vary at either the polynucleotide and/or polypeptide
level and are included in the present invention. Alternatively,
non-naturally occurring variants may be produced by mutagenesis
techniques or by direct synthesis.
[0253] Using known methods of protein engineering and recombinant
DNA technology, variants may be generated to improve or alter the
characteristics of the polypeptides of the present invention. For
instance, one or more amino acids can be deleted from the
N-terminus or C-terminus of the polypeptide of the present
invention without substantial loss of biological function. As an
example, Ron et al. (J. Biol. Chem. 268: 2984-2988 (1993)) reported
variant KGF proteins having heparin binding activity even after
deleting 3, 8, or 27 amino-terminal amino acid residues. Similarly,
Interferon gamma exhibited up to ten times higher activity after
deleting 8-10 amino acid residues from the carboxy terminus of this
protein. (Dobeli et al., J. Biotechnology 7:199-216 (1988).)
[0254] Moreover, ample evidence demonstrates that variants often
retain a biological activity similar to that of the naturally
occurring protein. For example, Gayle and coworkers (J. Biol. Chem.
268:22105-22111 (1993)) conducted extensive mutational analysis of
human cytokine IL-1a. They used random mutagenesis to generate over
3,500 individual IL-1a mutants that averaged 2.5 amino acid changes
per variant over the entire length of the molecule. Multiple
mutations were examined at every possible amino acid position. The
investigators found that "[m]ost of the molecule could be altered
with little effect on either [binding or biological activity]." In
fact, only 23 unique amino acid sequences, out of more than 3,500
nucleotide sequences examined, produced a protein that
significantly differed in activity from wild-type.
[0255] Furthermore, even if deleting one or more amino acids from
the N-terminus or C-terminus of a polypeptide results in
modification or loss of one or more biological functions, other
biological activities may still be retained. For example, the
ability of a deletion variant to induce and/or to bind antibodies
which recognize the secreted form will likely be retained when less
than the majority of the residues of the secreted form are removed
from the N-terminus or C-terminus. Whether a particular polypeptide
lacking N- or C-terminal residues of a protein retains such
immunogenic activities can readily be determined by routine methods
described herein and otherwise known in the art.
[0256] Thus, the invention further includes polypeptide variants
which show a functional activity (e.g., biological activity) of the
polypeptides of the invention. Such variants include deletions,
insertions, inversions, repeats, and substitutions selected
according to general rules known in the art so as have little
effect on activity.
[0257] The present application is directed to nucleic acid
molecules at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100%
identical to the nucleic acid sequences disclosed herein, (e.g.,
encoding a polypeptide having the amino acid sequence of an N
and/or C terminal deletion), irrespective of whether they encode a
polypeptide having functional activity. This is because even where
a particular nucleic acid molecule does not encode a polypeptide
having functional activity, one of skill in the art would still
know how to use the nucleic acid molecule, for instance, as a
hybridization probe or a polymerase chain reaction (PCR) primer.
Uses of the nucleic acid molecules of the present invention that do
not encode a polypeptide having functional activity include, inter
alia, (1) isolating a gene or allelic or splice variants thereof in
a cDNA library; (2) in situ hybridization (e.g., "FISH") to
metaphase chromosomal spreads to provide precise chromosomal
location of the gene, as described in Verma et al., Human
Chromosomes: A Manual of Basic Techniques, Pergamon Press, New York
(1988); (3) Northern Blot analysis for detecting mRNA expression in
specific tissues (e.g., normal or diseased tissues); and (4) in
situ hybridization (e.g., histochemistry) for detecting mRNA
expression in specific tissues (e.g., normal or diseased
tissues).
[0258] Preferred, however, are nucleic acid molecules having
sequences at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100%
identical to the nucleic acid sequences disclosed herein, which do,
in fact, encode a polypeptide having functional activity. By a
polypeptide having "functional activity" is meant, a polypeptide
capable of displaying one or more known functional activities
associated with a full-length (complete) protein and/or a mature
(secreted) protein of the invention. Such functional activities
include, but are not limited to, biological activity, antigenicity
[ability to bind (or compete with a polypeptide of the invention
for binding) to an anti-polypeptide of the invention antibody],
immunogenicity (ability to generate antibody which binds to a
specific polypeptide of the invention), ability to form multimers
with polypeptides of the invention, and ability to bind to a
receptor or ligand for a polypeptide of the invention.
[0259] The functional activity of the polypeptides, and fragments,
variants and derivatives of the invention, can be assayed by
various methods.
[0260] For example, in one embodiment where one is assaying for the
ability to bind or compete with a full-length polypeptide of the
present invention for binding to an anti-polypeptide antibody,
various immunoassays known in the art can be used, including but
not limited to, competitive and non-competitive assay systems using
techniques such as radioimmunoassays, ELISA (enzyme linked
immunosorbent assay), "sandwich" immunoassays, immunoradiometric
assays, gel diffusion precipitation reactions, immunodiffusion
assays, in situ immunoassays (using colloidal gold, enzyme or
radioisotope labels, for example), western blots, precipitation
reactions, agglutination assays (e.g., gel agglutination assays,
hemagglutination assays), complement fixation assays,
immunofluorescence assays, protein A assays, and
immunoelectrophoresis assays, etc. In one embodiment, antibody
binding is detected by detecting a label on the primary antibody.
In another embodiment, the primary antibody is detected by
detecting binding of a secondary antibody or reagent to the primary
antibody. In a further embodiment, the secondary antibody is
labeled. Many means are known in the art for detecting binding in
an immunoassay and are within the scope of the present
invention.
[0261] In another embodiment, where a ligand is identified, or the
ability of a polypeptide fragment, variant or derivative of the
invention to multimerize is being evaluated, binding can be
assayed, e.g., by means well-known in the art, such as, for
example, reducing and non-reducing gel chromatography, protein
affinity chromatography, and affinity blotting. See generally,
Phizicky et al., Microbiol. Rev. 59:94-123 (1995). In another
embodiment, the ability of physiological correlates of a
polypeptide of the present invention to bind to a substrate(s) of
the polypeptide of the invention can be routinely assayed using
techniques known in the art.
[0262] In addition, assays described herein (see Examples) and
otherwise known in the art may routinely be applied to measure the
ability of the polypeptides of the present invention and fragments,
variants and derivatives thereof to elicit polypeptide related
biological activity (either in vitro or in vivo). Other methods
will be known to the skilled artisan and are within the scope of
the invention.
[0263] Of course, due to the degeneracy of the genetic code, one of
ordinary skill in the art will immediately recognize that a large
number of the nucleic acid molecules having a sequence at least
80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to, for
example, the nucleic acid sequence of the cDNA contained in ATCC
Deposit No: Z, the nucleic acid sequence referred to in Table 1B
(SEQ ID NO:X), the nucleic acid sequence disclosed in Table 1A
(e.g., the nucleic acid sequence delineated in columns 7 and 8),
the nucleic acid sequence disclosed in Table 2 (e.g., the nucleic
acid sequence delineated in columns 8 and 9) or fragments thereof,
will encode polypeptides "having functional activity." In fact,
since degenerate variants of any of these nucleotide sequences all
encode the same polypeptide, in many instances, this will be clear
to the skilled artisan even without performing the above described
comparison assay. It will be further recognized in the art that,
for such nucleic acid molecules that are not degenerate variants, a
reasonable number will also encode a polypeptide having functional
activity. This is because the skilled artisan is fully aware of
amino acid substitutions that are either less likely or not likely
to significantly effect protein function (e.g., replacing one
aliphatic amino acid with a second aliphatic amino acid), as
further described below.
[0264] For example, guidance concerning how to make phenotypically
silent amino acid substitutions is provided in Bowie et al.,
"Deciphering the Message in Protein Sequences: Tolerance to Amino
Acid Substitutions," Science 247:1306-1310 (1990), wherein the
authors indicate that there are two main strategies for studying
the tolerance of an amino acid sequence to change.
[0265] The first strategy exploits the tolerance of amino acid
substitutions by natural selection during the process of evolution.
By comparing amino acid sequences in different species, conserved
amino acids can be identified. These conserved amino acids are
likely important for protein function. In contrast, the amino acid
positions where substitutions have been tolerated by natural
selection indicates that these positions are not critical for
protein function. Thus, positions tolerating amino acid
substitution could be modified while still maintaining biological
activity of the protein.
[0266] The second strategy uses genetic engineering to introduce
amino acid changes at specific positions of a cloned gene to
identify regions critical for protein function. For example, site
directed mutagenesis or alanine-scanning mutagenesis (introduction
of single alanine mutations at every residue in the molecule) can
be used. See Cunningham and Wells, Science 244:1081-1085 (1989).
The resulting mutant molecules can then be tested for biological
activity.
[0267] As the authors state, these two strategies have revealed
that proteins are surprisingly tolerant of amino acid
substitutions. The authors further indicate which amino acid
changes are likely to be permissive at certain amino acid positions
in the protein. For example, most buried (within the tertiary
structure of the protein) amino acid residues require nonpolar side
chains, whereas few features of surface side chains are generally
conserved. Moreover, tolerated conservative amino acid
substitutions involve replacement of the aliphatic or hydrophobic
amino acids Ala, Val, Leu and Ile; replacement of the hydroxyl
residues Ser and Thr; replacement of the acidic residues Asp and
Glu; replacement of the amide residues Asn and Gln, replacement of
the basic residues Lys, Arg, and His; replacement of the aromatic
residues Phe, Tyr, and Trp, and replacement of the small-sized
amino acids Ala, Ser, Thr, Met, and Gly.
[0268] Besides conservative amino acid substitution, variants of
the present invention include (i) substitutions with one or more of
the non-conserved amino acid residues, where the substituted amino
acid residues may or may not be one encoded by the genetic code, or
(ii) substitutions with one or more of the amino acid residues
having a substituent group, or (iii) fusion of the mature
polypeptide with another compound, such as a compound to increase
the stability and/or solubility of the polypeptide (for example,
polyethylene glycol), (iv) fusion of the polypeptide with
additional amino acids, such as, for example, an IgG Fc fusion
region peptide, serum albumin (preferably human serum albumin) or a
fragment thereof, or leader or secretory sequence, or a sequence
facilitating purification, or (v) fusion of the polypeptide with
another compound, such as albumin (including but not limited to
recombinant albumin (see, e.g., U.S. Pat. No. 5,876,969, issued
Mar. 2, 1999, EP Patent 0 413 622, and U.S. Pat. No. 5,766,883,
issued Jun. 16, 1998, herein incorporated by reference in their
entirety)). Such variant polypeptides are deemed to be within the
scope of those skilled in the art from the teachings herein.
[0269] For example, polypeptide variants containing amino acid
substitutions of charged amino acids with other charged or neutral
amino acids may produce proteins with improved characteristics,
such as less aggregation. Aggregation of pharmaceutical
formulations both reduces activity and increases clearance due to
the aggregate's immunogenic activity. See Pinckard et al., Clin.
Exp. Immunol. 2:331-340 (1967); Robbins et al., Diabetes 36:
838-845 (1987); Cleland et al., Crit. Rev. Therapeutic Drug Carrier
Systems 10:307-377 (1993).
[0270] A further embodiment of the invention relates to
polypeptides which comprise the amino acid sequence of a
polypeptide having an amino acid sequence which contains at least
one amino acid substitution, but not more than 50 amino acid
substitutions, even more preferably, not more than 40 amino acid
substitutions, still more preferably, not more than 30 amino acid
substitutions, and still even more preferably, not more than 20
amino acid substitutions from a polypeptide sequence disclosed
herein. Of course it is highly preferable for a polypeptide to have
an amino acid sequence which, for example, comprises the amino acid
sequence of a polypeptide of SEQ ID NO:Y, the amino acid sequence
of the mature (e.g., secreted) polypeptide of SEQ ID NO:Y, an amino
acid sequence encoded by SEQ ID NO:X, an amino acid sequence
encoded by the portion of SEQ ID NO:X as defined in columns 8 and 9
of Table 2, an amino acid sequence encoded by the complement of SEQ
ID NO:X, an amino acid sequence encoded by cDNA contained in ATCC
Deposit No: Z, and/or the amino acid sequence of a mature
(secreted) polypeptide encoded by cDNA contained in ATCC Deposit
No: Z, or a fragment thereof, which contains, in order of
ever-increasing preference, at least one, but not more than 10, 9,
8, 7, 6, 5, 4, 3, 2 or 1 amino acid substitutions.
[0271] In specific embodiments, the polypeptides of the invention
comprise, or alternatively, consist of, fragments or variants of a
reference amino acid sequence selected from: (a) the amino acid
sequence of SEQ ID NO:Y or fragments thereof (e.g., the mature
formand/or other fragments described herein); (b) the amino acid
sequence encoded by SEQ ID NO:X or fragments thereof; (c) the amino
acid sequence encoded by the complement of SEQ ID NO:X or fragments
thereof; (d) the amino acid sequence encoded by the portion of SEQ
ID NO:X as defined in columns 8 and 9 of Table 2 or fragments
thereof; and (e) the amino acid sequence encoded by cDNA contained
in ATCC Deposit No: Z or fragments thereof; wherein the fragments
or variants have 1-5, 5-10, 5-25, 5-50, 10-50 or 50-150, amino acid
residue additions, substitutions, and/or deletions when compared to
the reference amino acid sequence. In preferred embodiments, the
amino acid substitutions are conservative. Polynucleotides encoding
these polypeptides are also encompassed by the invention.
Polynucleotide and Polypeptide Fragments
[0272] The present invention is also directed to polynucleotide
fragments of the polynucleotides (nucleic acids) of the invention.
In the present invention, a "polynucleotide fragment" refers to a
polynucleotide having a nucleic acid sequence which, for example:
is a portion of the cDNA contained in ATCC Deposit No: Z or the
complementary strand thereto; is a portion of the polynucleotide
sequence encoding the polypeptide encoded by the cDNA contained in
ATCC Deposit No: Z or the complementary strand thereto; is a
portion of the polynucleotide sequence encoding the mature
(secreted) polypeptide encoded by the cDNA contained in ATCC
Deposit No: Z or the complementary strand thereto; is a portion of
a polynucleotide sequence encoding the mature amino acid sequence
as defined in columns 14 and 15 of Table 1A or the complementary
strand thereto; is a portion of a polynucleotide sequence encoding
the amino acid sequence encoded by the region of SEQ ID NO:X as
defined in columns 8 and 9 of Table 2 or the complementary strand
thereto; is a portion of the polynucleotide sequence of SEQ ID NO:X
as defined in columns 8 and 9 of Table 2 or the complementary
strand thereto; is a portion of the polynucleotide sequence in SEQ
ID NO:X or the complementary strand thereto; is a polynucleotide
sequence encoding a portion of the polypeptide of SEQ ID NO:Y; is a
polynucleotide sequence encoding a portion of a polypeptide encoded
by SEQ ID NO:X; is a polynucleotide sequence encoding a portion of
a polypeptide encoded by the complement of the polynucleotide
sequence in SEQ ID NO:X; is a portion of a polynucleotide sequence
encoding the amino acid sequence encoded by the region of SEQ ID
NO:B as defined in column 6 of Table 1C or the complementary strand
thereto; or is a portion of the polynucleotide sequence of SEQ ID
NO:B as defined in column 6 of Table 1C or the complementary strand
thereto.
[0273] The polynucleotide fragments of the invention are preferably
at least about 15 nt, and more preferably at least about 20 nt,
still more preferably at least about 30 nt, and even more
preferably, at least about 40 nt, at least about 50 nt, at least
about 75 nt, or at least about 150 nt in length. A fragment "at
least 20 nt in length," for example, is intended to include 20 or
more contiguous bases from the cDNA sequence contained in ATCC
Deposit No: Z, or the nucleotide sequence shown in SEQ ID NO:X or
the complementary stand thereto. In this context "about" includes
the particularly recited value or a value larger or smaller by
several (5, 4, 3, 2, or 1) nucleotides, at either terminus or at
both termini. These nucleotide fragments have uses that include,
but are not limited to, as diagnostic probes and primers as
discussed herein. Of course, larger fragments (e.g., at least 160,
170, 180, 190, 200, 250, 500, 600, 1000, or 2000 nucleotides in
length) are also encompassed by the invention.
[0274] Moreover, representative examples of polynucleotide
fragments of the invention comprise, or alternatively consist of, a
sequence from about nucleotide number 1-50, 51-100, 101-150,
151-200, 201-250, 251-300, 301-350, 351-400, 401-450, 451-500,
501-550, 551-600, 601-650, 651-700, 701-750, 751-800, 801-850,
851-900, 901-950, 951-1000, 1001-1050, 1051-1100, 1101-1150,
1151-1200, 1201-1250, 1251-1300, 1301-1350, 1351-1400, 1401-1450,
1451-1500, 1501-1550, 1551-1600, 1601-1650, 1651-1700, 1701-1750,
1751-1800, 1801-1850, 1851-1900, 1901-1950, 1951-2000, 2001-2050,
2051-2100, 2101-2150, 2151-2200, 2201-2250, 2251-2300, 2301-2350,
2351-2400, 2401-2450, 2451-2500, 2501-2550, 2551-2600, 2601-2650,
2651-2700, 2701-2750, 2751-2800, 2801-2850, 2851-2900, 2901-2950,
2951-3000, 3001-3050, 3051-3100, 3101-3150, 3151-3200, 3201-3250,
3251-3300, 3301-3350, 3351-3400, 3401-3450, 3451-3500, 3501-3550,
3551-3600, 3601-3650, 3651-3700, 3701-3750, 3751-3800, 3801-3850,
3851-3900, 3901-3950, 3951-4000, 4001-4050, 4051-4100, 4101-4150,
4151-4200, 4201-4250, 4251-4300, 4301-4350, 4351-4400, 4401-4450,
4451-4500, 4501-4550, 4551-4600, 4601-4650, 4651-4700, 4701-4750,
4751-4800, 4801-4850, 4851-4900, 4901-4950, 4951-5000, 5001-5050,
5051-5100, 5101-5150, 5151-5200, 5201-5250, 5251-5300, 5301-5350,
5351-5400, 5401-5450, 5451-5500, 5501-5550, 5551-5600, 5601-5650,
5651-5700, 5701-5750, 5751-5800, 5801-5850, 5851-5900, 5901-5950,
5951-6000, 6001-6050, 6051-6100, 6101-6150, 6151-6200, 6201-6250,
6251-6300, 6301-6350, 6351-6400, 6401-6450, 6451-6500, 6501-6550,
6551-6600, 6601-6650, 6651-6700, 6701-6750, 6751-6800, 6801-6850,
6851-6900, 6901-6950, 6951-7000, 7001-7050, 7051-7100, 7101-7150,
7151-7200, 7201-7250, 7251-7300 or 7301 to the end of SEQ ID NO:X,
or the complementary strand thereto. In this context "about"
includes the particularly recited range or a range larger or
smaller by several (5, 4, 3, 2, or 1) nucleotides, at either
terminus or at both termini. Preferably, these fragments encode a
polypeptide which has a functional activity (e.g., biological
activity). More preferably, these polynucleotides can be used as
probes or primers as discussed herein. Polynucleotides which
hybridize to one or more of these polynucleotides under stringent
hybridization conditions or alternatively, under lower stringency
conditions are also encompassed by the invention, as are
polypeptides encoded by these polynucleotides.
[0275] Further representative examples of polynucleotide fragments
of the invention comprise, or alternatively consist of, a sequence
from about nucleotide number 1-50, 51-100, 101-150, 151-200,
201-250, 251-300, 301-350, 351-400, 401-450, 451-500, 501-550,
551-600, 601-650, 651-700, 701-750, 751-800, 801-850, 851-900,
901-950, 951-1000, 1001-1050, 1051-1100, 1101-1150, 1151-1200,
1201-1250, 1251-1300, 1301-1350, 1351-1400, 1401-1450, 1451-1500,
1501-1550, 1551-1600, 1601-1650, 1651-1700, 1701-1750, 1751-1800,
1801-1850, 1851-1900, 1901-1950, 1951-2000, 2001-2050, 2051-2100,
2101-2150, 2151-2200, 2201-2250, 2251-2300, 2301-2350, 2351-2400,
2401-2450, 2451-2500, 2501-2550, 2551-2600, 2601-2650, 2651-2700,
2701-2750, 2751-2800, 2801-2850, 2851-2900, 2901-2950, 2951-3000,
3001-3050, 3051-3100, 3101-3150, 3151-3200, 3201-3250, 3251-3300,
3301-3350, 3351-3400, 3401-3450, 3451-3500, 3501-3550, 3551-3600,
3601-3650, 3651-3700, 3701-3750, 3751-3800, 3801-3850, 3851-3900,
3901-3950, 3951-4000, 4001-4050, 4051-4100, 4101-4150, 4151-4200,
4201-4250, 4251-4300, 4301-4350, 4351-4400, 4401-4450, 4451-4500,
4501-4550, 4551-4600, 4601-4650, 4651-4700, 4701-4750, 4751-4800,
4801-4850, 4851-4900, 4901-4950, 4951-5000, 5001-5050, 5051-5100,
5101-5150, 5151-5200, 5201-5250, 5251-5300, 5301-5350, 5351-5400,
5401-5450, 5451-5500, 5501-5550, 5551-5600, 5601-5650, 5651-5700,
5701-5750, 5751-5800, 5801-5850, 5851-5900, 5901-5950, 5951-6000,
6001-6050, 6051-6100, 6101-6150, 6151-6200, 6201-6250, 6251-6300,
6301-6350, 6351-6400, 6401-6450, 6451-6500, 6501-6550, 6551-6600,
6601-6650, 6651-6700, 6701-6750, 6751-6800, 6801-6850, 6851-6900,
6901-6950, 6951-7000, 7001-7050, 7051-7100, 7101-7150, 7151-7200,
7201-7250, 7251-7300 or 7301 to the end of the cDNA sequence
contained in ATCC Deposit No: Z, or the complementary strand
thereto. In this context "about" includes the particularly recited
range or a range larger or smaller by several (5, 4, 3, 2, or 1)
nucleotides, at either terminus or at both termini. Preferably,
these fragments encode a polypeptide which has a functional
activity (e.g., biological activity). More preferably, these
polynucleotides can be used as probes or primers as discussed
herein. Polynucleotides which hybridize to one or more of these
polynucleotides under stringent hybridization conditions or
alternatively, under lower stringency conditions are also
encompassed by the invention, as are polypeptides encoded by these
polynucleotides.
[0276] Moreover, representative examples of polynucleotide
fragments of the invention comprise, or alternatively consist of, a
nucleic acid sequence comprising one, two, three, four, five, six,
seven, eight, nine, ten, or more of the above described
polynucleotide fragments of the invention in combination with a
polynucleotide sequence delineated in Table 1C column 6.
Additional, representative examples of polynucleotide fragments of
the invention comprise, or alternatively consist of, a nucleic acid
sequence comprising one, two, three, four, five, six, seven, eight,
nine, ten, or more of the above described polynucleotide fragments
of the invention in combination with a polynucleotide sequence that
is the complementary strand of a sequence delineated in column 6 of
Table 1C. In further embodiments, the above-described
polynucleotide fragments of the invention comprise, or
alternatively consist of, sequences delineated in Table 1C, column
6, and have a nucleic acid sequence which is different from that of
the BAC fragment having the sequence disclosed in SEQ ID NO:B (see
Table 1C, column 5). In additional embodiments, the above-described
polynucleotide fragments of the invention comprise, or
alternatively consist of, sequences delineated in Table 1C, column
6, and have a nucleic acid sequence which is different from that
published for the BAC clone identified as BAC ID NO:A (see Table
1C, column 4). In additional embodiments, the above-described
polynucleotides of the invention comprise, or alternatively consist
of, sequences delineated Table 1C, column 6, and have a nucleic
acid sequence which is different from that contained in the BAC
clone identified as BAC ID NO:A (see Table 1C, column 4).
Polypeptides encoded by these polynucleotides, other
polynucleotides that encode these polypeptides, and antibodies that
bind these polypeptides are also encompassed by the invention.
Additionally, fragments and variants of the above-described
polynucleotides and polypeptides are also encompassed by the
invention.
[0277] In additional specific embodiments, polynucleotides of the
invention comprise, or alternatively consist of, one, two, three,
four, five, six, seven, eight, nine, ten, or more fragments of the
sequences delineated in column 6 of Table 1C, and the
polynucleotide sequence of SEQ ID NO:X (e.g., as defined in Table
1C, column 2) or fragments or variants thereof. Polypeptides
encoded by these polynucleotides, other polynucleotides that encode
these polypeptides, and antibodies that bind these polypeptides are
also encompassed by the invention.
[0278] In additional specific embodiments, polynucleotides of the
invention comprise, or alternatively consist of, one, two, three,
four, five, six, seven, eight, nine, ten, or more fragments of the
sequences delineated in column 6 of Table 1C which correspond to
the same ATCC Deposit No: Z (see Table 1C, column 1), and the
polynucleotide sequence of SEQ ID NO:X (e.g., as defined in Table
1A, 1B, or 1C) or fragments or variants thereof. Polypeptides
encoded by these polynucleotides, other polynucleotides that encode
these polypeptides, and antibodies that bind these polypeptides are
also encompassed by the invention.
[0279] In further specific embodiments, polynucleotides of the
invention comprise, or alternatively consist of, one, two, three,
four, five, six, seven, eight, nine, ten, or more fragments of the
sequences delineated in the same row of column 6 of Table 1C, and
the polynucleotide sequence of SEQ ID NO:X (e.g., as defined in
Table 1A, 1B, or 1C) or fragments or variants thereof. Polypeptides
encoded by these polynucleotides, other polynucleotides that encode
these polypeptides, and antibodies that bind these polypeptides are
also encompassed by the invention.
[0280] In additional specific embodiments, polynucleotides of the
invention comprise, or alternatively consist of a polynucleotide
sequence in which the 3' 10 polynucleotides of one of the sequences
delineated in column 6 of Table 1C and the 5' 10 polynucleotides of
the sequence of SEQ ID NO:X are directly contiguous. Nucleic acids
which hybridize to the complement of these 20 contiguous
polynucleotides under stringent hybridization conditions or
alternatively, under lower stringency conditions, are also
encompassed by the invention. Polypeptides encoded by these
polynucleotides and/or nucleic acids, other polynucleotides and/or
nucleic acids that encode these polypeptides, and antibodies that
bind these polypeptides are also encompassed by the invention.
Additionally, fragments and variants of the above-described
polynucleotides, nucleic acids, and polypeptides are also
encompassed by the invention.
[0281] In additional specific embodiments, polynucleotides of the
invention comprise, or alternatively consist of a polynucleotide
sequence in which the 3' 10 polynucleotides of one of the sequences
delineated in column 6 of Table 1C and the 5' 10 polynucleotides of
a fragment or variant of the sequence of SEQ ID NO:X (e.g., as
described herein) are directly contiguous Nucleic acids which
hybridize to the complement of these 20 contiguous polynucleotides
under stringent hybridization conditions or alternatively, under
lower stringency conditions, are also encompassed by the invention.
Polypeptides encoded by these polynucleotides and/or nucleic acids,
other polynucleotides and/or nucleic acids encoding these
polypeptides, and antibodies that bind these polypeptides are also
encompassed by the invention. Additionally, fragments and variants
of the above-described polynucleotides, nucleic acids, and
polypeptides are also encompassed by the invention.
[0282] In further specific embodiments, polynucleotides of the
invention comprise, or alternatively consist of a polynucleotide
sequence in which the 3' 10 polynucleotides of a fragment or
variant of the sequence of SEQ ID NO:X and the 5' 10
polynucleotides of the sequence of one of the sequences delineated
in column 6 of Table 1C are directly contiguous. Nucleic acids
which hybridize to the complement of these 20 contiguous
polynucleotides under stringent hybridization conditions or
alternatively, under lower stringency conditions, are also
encompassed by the invention. Polypeptides encoded by these
polynucleotides and/or nucleic acids, other polynucleotides and/or
nucleic acids encoding these polypeptides, and antibodies that bind
these polypeptides are also encompassed by the invention.
Additionally, fragments and variants of the above-described
polynucleotides, nucleic acids, and polypeptides are also
encompassed by the invention.
[0283] In specific embodiments, polynucleotides of the invention
comprise, or alternatively consist of a polynucleotide sequence in
which the 3' 10 polynucleotides of one of the sequences delineated
in column 6 of Table 1C and the 5' 10 polynucleotides of another
sequence in column 6 are directly contiguous. In preferred
embodiments, the 3' 10 polynucleotides of one of the sequences
delineated in column 6 of Table 1C is directly contiguous with the
5' 10 polynucleotides of the next sequential exon delineated in
Table 1C, column 6. Nucleic acids which hybridize to the complement
of these 20 contiguous polynucleotides under stringent
hybridization conditions or alternatively, under lower stringency
conditions, are also encompassed by the invention. Polypeptides
encoded by these polynucleotides and/or nucleic acids, other
polynucleotides and/or nucleic acids encoding these polypeptides,
and antibodies that bind these polypeptides are also encompassed by
the invention. Additionally, fragments and variants of the
above-described polynucleotides, nucleic acids, and polypeptides
are also encompassed by the invention.
[0284] In the present invention, a "polypeptide fragment" refers to
an amino acid sequence which is a portion of the amino acid
sequence contained in SEQ ID NO:Y, is a portion of the mature form
of SEQ ID NO:Y as defined in columns 14 and 15 of Table 1A, a
portion of an amino acid sequence encoded by the portion of SEQ ID
NO:X as defined in columns 8 and 9 of Table 2, is a portion of an
amino acid sequence encoded by the polynucleotide sequence of SEQ
ID NO:X, is a portion of an amino acid sequence encoded by the
complement of the polynucleotide sequence in SEQ ID NO:X, is a
portion of the amino acid sequence of a mature (secreted)
polypeptide encoded by the cDNA contained in ATCC Deposit No: Z,
and/or is a portion of an amino acid sequence encoded by the cDNA
contained in ATCC Deposit No: Z. Protein (polypeptide) fragments
may be "free-standing," or comprised within a larger polypeptide of
which the fragment forms a part or region, most preferably as a
single continuous region. Representative examples of polypeptide
fragments of the invention, include, for example, fragments
comprising, or alternatively consisting of, from about amino acid
number 1-20, 21-40, 41-60, 61-80, 81-100, 101-120, 121-140,
141-160, 161-180, 181-200, 201-220, 221-240, 241-260, 261-280,
281-300, 301-320, 321-340, 341-360, 361-380, 381-400, 401-420,
421-440, 441-460, 461-480, 481-500, 501-520, 521-540, 541-560,
561-580, 581-600, 601-620, 621-640, 641-660, 661-680, 681-700,
701-720, 721-740, 741-760, 761-780, 781-800, 801-820, 821-840,
841-860, 861-880, 881-900, 901-920, 921-940, 941-960, 961-980,
981-1000, 1001-1020, 1021-1040, 1041-1060, 1061-1080, 1081-1100,
1101-1120, 1121-1140, 1141-1160, 1161-1180, 1181-1200, 1201-1220,
1221-1240, 1241-1260, 1261-1280, 1281-1300, 1301-1320, 1321-1340,
1341-1360, 1361-1380, 1381-1400, 1401-1420, 1421-1440, or 1441 to
the end of the coding region of cDNA and SEQ ID NO: Y. In a
preferred embodiment, polypeptide fragments of the invention
include, for example, fragments comprising, or alternatively
consisting of, from about amino acid number 1-20, 21-40, 41-60,
61-80, 81-100, 101-120, 121-140, 141-160, 161-180, 181-200,
201-220, 221-240, 241-260, 261-280, 281-300, 301-320, 321-340,
341-360, 361-380, 381-400, 401-420, 421-440, 441-460, 461-480,
481-500, 501-520, 521-540, 541-560, 561-580, 581-600, 601-620,
621-640, 641-660, 661-680, 681-700, 701-720, 721-740, 741-760,
761-780, 781-800, 801-820, 821-840, 841-860, 861-880, 881-900,
901-920, 921-940, 941-960, 961-980, 981-1000, 1001-1020, 1021-1040,
1041-1060, 1061-1080, 1081-1100, 1101-1120, 1121-1140, 1141-1160,
1161-1180, 1181-1200, 1201-1220, 1221-1240, 1241-1260, 1261-1280,
1281-1300, 1301-1320, 1321-1340, 1341-1360, 1361-1380, 1381-1400,
1401-1420, 1421-1440, or 1441 to the end of the coding region of
SEQ ID NO:Y. Moreover, polypeptide fragments of the invention may
be at least about 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65,
70, 75, 80, 85, 90, 100, 110, 120, 130, 140, or 150 amino acids in
length. In this context "about" includes the particularly recited
ranges or values, or ranges or values larger or smaller by several
(5, 4, 3, 2, or 1) amino acids, at either extreme or at both
extremes. Polynucleotides encoding these polypeptide fragments are
also encompassed by the invention.
[0285] Even if deletion of one or more amino acids from the
N-terminus of a protein results in modification of loss of one or
more biological functions of the protein, other functional
activities (e.g., biological activities, ability to multimerize,
ability to bind a ligand) may still be retained. For example, the
ability of shortened muteins to induce and/or bind to antibodies
which recognize the complete or mature forms of the polypeptides
generally will be retained when less than the majority of the
residues of the complete or mature polypeptide are removed from the
N-terminus. Whether a particular polypeptide lacking N-terminal
residues of a complete polypeptide retains such immunologic
activities can readily be determined by routine methods described
herein and otherwise known in the art. It is not unlikely that a
mutein with a large number of deleted N-terminal amino acid
residues may retain some biological or immunogenic activities. In
fact, peptides composed of as few as six amino acid residues may
often evoke an immune response.
[0286] Accordingly, polypeptide fragments include the secreted
protein as well as the mature form. Further preferred polypeptide
fragments include the secreted protein or the mature form having a
continuous series of deleted residues from the amino or the carboxy
terminus, or both. For example, any number of amino acids, ranging
from 1-60, can be deleted from the amino terminus of either the
secreted polypeptide or the mature form. Similarly, any number of
amino acids, ranging from 1-30, can be deleted from the carboxy
terminus of the secreted protein or mature form. Furthermore, any
combination of the above amino and carboxy terminus deletions are
preferred. Similarly, polynucleotides encoding these polypeptide
fragments are also preferred.
[0287] The present invention further provides polypeptides having
one or more residues deleted from the amino terminus of the amino
acid sequence of a polypeptide disclosed herein (e.g., a
polypeptide of SEQ ID NO:Y, a polypeptide as defined in columns 14
and 15 of Table 1A, a polypeptide encoded by the polynucleotide
sequence contained in SEQ ID NO:X or the complement thereof, a
polypeptide encoded by the portion of SEQ ID NO:X as defined in
columns 8 and 9 of Table 2, a polypeptide encoded by the portion of
SEQ ID NO:B as defined in column 6 of Table 1C, a polypeptide
encoded by the cDNA contained in ATCC Deposit No: Z, and/or a
mature polypeptide encoded by the cDNA contained in ATCC Deposit
No: Z). In particular, N-terminal deletions may be described by the
general formula m-q, where q is a whole integer representing the
total number of amino acid residues in a polypeptide of the
invention (e.g., the polypeptide disclosed in SEQ ID NO:Y, the
mature (secreted) portion of SEQ ID NO:Y as defined in columns 14
and 15 of Table 1A, or the polypeptide encoded by the portion of
SEQ ID NO:X as defined in columns 8 and 9 of Table 2), and m is
defined as any integer ranging from 2 to q-6. Polynucleotides
encoding these polypeptides are also encompassed by the
invention.
[0288] The present invention further provides polypeptides having
one or more residues from the carboxy terminus of the amino acid
sequence of a polypeptide disclosed herein (e.g., a polypeptide of
SEQ ID NO:Y, the mature (secreted) portion of SEQ ID NO:Y as
defined in columns 14 and 15 of Table 1A, a polypeptide encoded by
the polynucleotide sequence contained in SEQ ID NO:X, a polypeptide
encoded by the portion of SEQ ID NO:X as defined in columns 8 and 9
of Table 2, a polypeptide encoded by the portion of SEQ ID NO:B as
defined in column 6 of Table 1C, a polypeptide encoded by the cDNA
contained in ATCC Deposit No: Z, and/or a mature polypeptide
encoded by the cDNA contained in ATCC Deposit No: Z). In
particular, C-terminal deletions may be described by the general
formula 1-n, where n is any whole integer ranging from 6 to q-1,
and where n corresponds to the position of amino acid residue in a
polypeptide of the invention. Polynucleotides encoding these
polypeptides are also encompassed by the invention.
[0289] In addition, any of the above described N- or C-terminal
deletions can be combined to produce a N- and C-terminal deleted
polypeptide. The invention also provides polypeptides having one or
more amino acids deleted from both the amino and the carboxyl
termini, which may be described generally as having residues m-n of
a polypeptide encoded by SEQ ID NO:X (e.g., including, but not
limited to, the preferred polypeptide disclosed as SEQ ID NO:Y, the
mature (secreted) portion of SEQ ID NO:Y as defined in columns 14
and 15 of Table 1A, and the polypeptide encoded by the portion of
SEQ ID NO:X as defined in columns 8 and 9 of Table 2), the cDNA
contained in ATCC Deposit No: Z, and/or the complement thereof,
where n and m are integers as described above. Polynucleotides
encoding these polypeptides are also encompassed by the
invention.
[0290] Also as mentioned above, even if deletion of one or more
amino acids from the C-terminus of a protein results in
modification of loss of one or more biological functions of the
protein, other functional activities (e.g., biological activities,
ability to multimerize, ability to bind a ligand) may still be
retained. For example the ability of the shortened mutein to induce
and/or bind to antibodies which recognize the complete or mature
forms of the polypeptide generally will be retained when less than
the majority of the residues of the complete or mature polypeptide
are removed from the C-terminus. Whether a particular polypeptide
lacking C-terminal residues of a complete polypeptide retains such
immunologic activities can readily be determined by routine methods
described herein and otherwise known in the art. It is not unlikely
that a mutein with a large number of deleted C-terminal amino acid
residues may retain some biological or immunogenic activities. In
fact, peptides composed of as few as six amino acid residues may
often evoke an immune response.
[0291] The present application is also directed to proteins
containing polypeptides at least 80%, 85%, 90%, 95%, 96%, 97%, 98%
or 99% identical to a polypeptide sequence set forth herein. In
preferred embodiments, the application is directed to proteins
containing polypeptides at least 80%, 85%, 90%, 95%, 96%, 97%, 98%
or 99% identical to polypeptides having the amino acid sequence of
the specific N- and C-terminal deletions. Polynucleotides encoding
these polypeptides are also encompassed by the invention.
[0292] Any polypeptide sequence encoded by, for example, the
polynucleotide sequences set forth as SEQ ID NO:X or the complement
thereof, (presented, for example, in Tables 1A and 2), the cDNA
contained in ATCC Deposit No: Z, or the polynucleotide sequence as
defined in column 6 of Table 1C, may be analyzed to determine
certain preferred regions of the polypeptide. For example, the
amino acid sequence of a polypeptide encoded by a polynucleotide
sequence of SEQ ID NO:X (e.g., the polypeptide of SEQ ID NO:Y and
the polypeptide encoded by the portion of SEQ ID NO:X as defined in
columns 8 and 9 of Table 2) or the cDNA contained in ATCC Deposit
No: Z may be analyzed using the default parameters of the DNASTAR
computer algorithm (DNASTAR, Inc., 1228 S. Park St., Madison, Wis.
53715 USA; http://www.dnastar.com/).
[0293] Polypeptide regions that may be routinely obtained using the
DNASTAR computer algorithm include, but are not limited to,
Garnier-Robson alpha-regions, beta-regions, turn-regions, and
coil-regions; Chou-Fasman alpha-regions, beta-regions, and
turn-regions; Kyte-Doolittle hydrophilic regions and hydrophobic
regions; Eisenberg alpha- and beta-amphipathic regions;
Karplus-Schulz flexible regions; Emini surface-forming regions; and
Jameson-Wolf regions of high antigenic index. Among highly
preferred polynucleotides of the invention in this regard are those
that encode polypeptides comprising regions that combine several
structural features, such as several (e.g., 1, 2, 3 or 4) of the
features set out above.
[0294] Additionally, Kyte-Doolittle hydrophilic regions and
hydrophobic regions, Emini surface-forming regions, and
Jameson-Wolf regions of high antigenic index (i.e., containing four
or more contiguous amino acids having an antigenic index of greater
than or equal to 1.5, as identified using the default parameters of
the Jameson-Wolf program) can routinely be used to determine
polypeptide regions that exhibit a high degree of potential for
antigenicity. Regions of high antigenicity are determined from data
by DNASTAR analysis by choosing values which represent regions of
the polypeptide which are likely to be exposed on the surface of
the polypeptide in an environment in which antigen recognition may
occur in the process of initiation of an immune response.
[0295] Preferred polypeptide fragments of the invention are
fragments comprising, or alternatively, consisting of, an amino
acid sequence that displays a functional activity (e.g. biological
activity) of the polypeptide sequence of which the amino acid
sequence is a fragment. By a polypeptide displaying a "functional
activity" is meant a polypeptide capable of one or more known
functional activities associated with a full-length protein, such
as, for example, biological activity, antigenicity, immunogenicity,
and/or multimerization, as described herein.
[0296] Other preferred polypeptide fragments are biologically
active fragments. Biologically active fragments are those
exhibiting activity similar, but not necessarily identical, to an
activity of the polypeptide of the present invention. The
biological activity of the fragments may include an improved
desired activity, or a decreased undesirable activity.
[0297] In preferred embodiments, polypeptides of the invention
comprise, or alternatively consist of, one, two, three, four, five
or more of the antigenic fragments of the polypeptide of SEQ ID
NO:Y, or portions thereof. Polynucleotides encoding these
polypeptides are also encompassed by the invention.
Epitopes and Antibodies
[0298] The present invention encompasses polypeptides comprising,
or alternatively consisting of, an epitope of: the polypeptide
sequence shown in SEQ ID NO:Y; a polypeptide sequence encoded by
SEQ ID NO:X or the complementary strand thereto; the polypeptide
sequence encoded by the portion of SEQ ID NO:X as defined in
columns 8 and 9 of Table 2; the polypeptide sequence encoded by the
portion of SEQ ID NO:B as defined in column 6 of Table 1C or the
complement thereto; the polypeptide sequence encoded by the cDNA
contained in ATCC Deposit No: Z; or the polypeptide sequence
encoded by a polynucleotide that hybridizes to the sequence of SEQ
ID NO:X, the complement of the sequence of SEQ ID NO:X, the
complement of a portion of SEQ ID NO:X as defined in columns 8 and
9 of Table 2, or the cDNA sequence contained in ATCC Deposit No: Z
under stringent hybridization conditions or alternatively, under
lower stringency hybridization as defined supra. The present
invention further encompasses polynucleotide sequences encoding an
epitope of a polypeptide sequence of the invention (such as, for
example, the sequence disclosed in SEQ ID NO:X, or a fragment
thereof), polynucleotide sequences of the complementary strand of a
polynucleotide sequence encoding an epitope of the invention, and
polynucleotide sequences which hybridize to the complementary
strand under stringent hybridization conditions or alternatively,
under lower stringency hybridization conditions defined supra.
[0299] The term "epitopes," as used herein, refers to portions of a
polypeptide having antigenic or immunogenic activity in an animal,
preferably a mammal, and most preferably in a human. In a preferred
embodiment, the present invention encompasses a polypeptide
comprising an epitope, as well as the polynucleotide encoding this
polypeptide. An "immunogenic epitope," as used herein, is defined
as a portion of a protein that elicits an antibody response in an
animal, as determined by any method known in the art, for example,
by the methods for generating antibodies described infra. (See, for
example, Geysen et al., Proc. Natl. Acad. Sci. USA 81:3998-4002
(1983)). The term "antigenic epitope," as used herein, is defined
as a portion of a protein to which an antibody can
immunospecifically bind its antigen as determined by any method
well known in the art, for example, by the immunoassays described
herein. Immunospecific binding excludes non-specific binding but
does not necessarily exclude cross-reactivity with other antigens.
Antigenic epitopes need not necessarily be immunogenic.
[0300] Fragments which function as epitopes may be produced by any
conventional means. (See, e.g., Houghten, R. A., Proc. Natl. Acad.
Sci. USA 82:5131-5135 (1985) further described in U.S. Pat. No.
4,631,211.)
[0301] In the present invention, antigenic epitopes preferably
contain a sequence of at least 4, at least 5, at least 6, at least
7, more preferably at least 8, at least 9, at least 10, at least
11, at least 12, at least 13, at least 14, at least 15, at least
20, at least 25, at least 30, at least 40, at least 50, and, most
preferably, between about 15 to about 30 amino acids. Preferred
polypeptides comprising immunogenic or antigenic epitopes are at
least 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80,
85, 90, 95, or 100 amino acid residues in length. Additional
non-exclusive preferred antigenic epitopes include the antigenic
epitopes disclosed herein, as well as portions thereof. Antigenic
epitopes are useful, for example, to raise antibodies, including
monoclonal antibodies, that specifically bind the epitope.
Preferred antigenic epitopes include the antigenic epitopes
disclosed herein, as well as any combination of two, three, four,
five or more of these antigenic epitopes. Antigenic epitopes can be
used as the target molecules in immunoassays. (See, for instance,
Wilson et al., Cell 37:767-778 (1984); Sutcliffe et al., Science
219:660-666 (1983)).
[0302] Non-limiting examples of epitopes of polypeptides that can
be used to generate antibodies of the invention include a
polypeptide comprising, or alternatively consisting of, at least
one, two, three, four, five, six or more of the portion(s) of SEQ
ID NO:Y specified in column 6 of Table 1B.1. These polypeptide
fragments have been determined to bear antigenic epitopes of the
proteins of the invention by the analysis of the Jameson-Wolf
antigenic index which is included in the DNAStar suite of computer
programs. By "comprise" it is intended that a polypeptide contains
at least one, two, three, four, five, six or more of the portion(s)
of SEQ ID NO:Y shown in column 6 of Table 1B.1, but it may contain
additional flanking residues on either the amino or carboxyl
termini of the recited portion. Such additional flanking sequences
are preferably sequences naturally found adjacent to the portion;
i.e., contiguous sequence shown in SEQ ID NO:Y. The flanking
sequence may, however, be sequences from a heterolgous polypeptide,
such as from another protein described herein or from a
heterologous polypeptide not described herein. In particular
embodiments, epitope portions of a polypeptide of the invention
comprise one, two, three, or more of the portions of SEQ ID NO:Y
shown in column 6 of Table 1B.1.
[0303] Similarly, immunogenic epitopes can be used, for example, to
induce antibodies according to methods well known in the art. See,
for instance, Sutcliffe et al., supra; Wilson et al., supra; Chow
et al., Proc. Natl. Acad. Sci. USA 82:910-914; and Bittle et al.,
J. Gen. Virol. 66:2347-2354 (1985). Preferred immunogenic epitopes
include the immunogenic epitopes disclosed herein, as well as any
combination of two, three, four, five or more of these immunogenic
epitopes. The polypeptides comprising one or more immunogenic
epitopes may be presented for eliciting an antibody response
together with a carrier protein, such as an albumin, to an animal
system (such as rabbit or mouse), or, if the polypeptide is of
sufficient length (at least about 25 amino acids), the polypeptide
may be presented without a carrier. However, immunogenic epitopes
comprising as few as 8 to 10 amino acids have been shown to be
sufficient to raise antibodies capable of binding to, at the very
least, linear epitopes in a denatured polypeptide (e.g., in Western
blotting).
[0304] Epitope-bearing polypeptides of the present invention may be
used to induce antibodies according to methods well known in the
art including, but not limited to, in vivo immunization, in vitro
immunization, and phage display methods. See, e.g., Sutcliffe et
al., supra; Wilson et al., supra, and Bittle et al., J. Gen.
Virol., 66:2347-2354 (1985). If in vivo immunization is used,
animals may be immunized with free peptide; however, anti-peptide
antibody titer may be boosted by coupling the peptide to a
macromolecular carrier, such as keyhole limpet hemacyanin (KLH) or
tetanus toxoid. For instance, peptides containing cysteine residues
may be coupled to a carrier using a linker such as
maleimidobenzoyl-N-hydroxysuccinimide ester (MBS), while other
peptides may be coupled to carriers using a more general linking
agent such as glutaraldehyde. Animals such as rabbits, rats and
mice are immunized with either free or carrier-coupled peptides,
for instance, by intraperitoneal and/or intradermal injection of
emulsions containing about 100 .mu.g of peptide or carrier protein
and Freund's adjuvant or any other adjuvant known for stimulating
an immune response. Several booster injections may be needed, for
instance, at intervals of about two weeks, to provide a useful
titer of anti-peptide antibody which can be detected, for example,
by ELISA assay using free peptide adsorbed to a solid surface. The
titer of anti-peptide antibodies in serum from an immunized animal
may be increased by selection of anti-peptide antibodies, for
instance, by adsorption to the peptide on a solid support and
elution of the selected antibodies according to methods well known
in the art.
[0305] As one of skill in the art will appreciate, and as discussed
above, the polypeptides of the present invention (e.g., those
comprising an immunogenic or antigenic epitope) can be fused to
heterologous polypeptide sequences. For example, polypeptides of
the present invention (including fragments or variants thereof),
may be fused with the constant domain of immunoglobulins (IgA, IgE,
IgG, IgM), or portions thereof (CH1, CH2, CH3, or any combination
thereof and portions thereof, resulting in chimeric polypeptides.
By way of another non-limiting example, polypeptides and/or
antibodies of the present invention (including fragments or
variants thereof) may be fused with albumin (including but not
limited to recombinant human serum albumin or fragments or variants
thereof (see, e.g., U.S. Pat. No. 5,876,969, issued Mar. 2, 1999,
EP Patent 0 413 622, and U.S. Pat. No. 5,766,883, issued Jun. 16,
1998, herein incorporated by reference in their entirety)). In a
preferred embodiment, polypeptides and/or antibodies of the present
invention (including fragments or variants thereof) are fused with
the mature form of human serum albumin (i.e., amino acids 1-585 of
human serum albumin as shown in FIGS. 1 and 2 of EP Patent 0 322
094) which is herein incorporated by reference in its entirety. In
another preferred embodiment, polypeptides and/or antibodies of the
present invention (including fragments or variants thereof) are
fused with polypeptide fragments comprising, or alternatively
consisting of, amino acid residues 1-z of human serum albumin,
where z is an integer from 369 to 419, as described in U.S. Pat.
No. 5,766,883 herein incorporated by reference in its entirety.
Polypeptides and/or antibodies of the present invention (including
fragments or variants thereof) may be fused to either the N- or
C-terminal end of the heterologous protein (e.g., immunoglobulin Fc
polypeptide or human serum albumin polypeptide). Polynucleotides
encoding fusion proteins of the invention are also encompassed by
the invention.
[0306] Such fusion proteins as those described above may facilitate
purification and may increase half-life in vivo. This has been
shown for chimeric proteins consisting of the first two domains of
the human CD4-polypeptide and various domains of the constant
regions of the heavy or light chains of mammalian immunoglobulins.
See, e.g., EP 394,827; Traunecker et al., Nature, 331:84-86 (1988).
Enhanced delivery of an antigen across the epithelial barrier to
the immune system has been demonstrated for antigens (e.g.,
insulin) conjugated to an FcRn binding partner such as IgG or Fc
fragments (see, e.g., PCT Publications WO 96/22024 and WO
99/04813). IgG fusion proteins that have a disulfide-linked dimeric
structure due to the IgG portion desulfide bonds have also been
found to be more efficient in binding and neutralizing other
molecules than monomeric polypeptides or fragments thereof alone.
See, e.g., Fountoulakis et al., J. Biochem., 270:3958-3964 (1995).
Nucleic acids encoding the above epitopes can also be recombined
with a gene of interest as an epitope tag (e.g., the hemagglutinin
(HA) tag or flag tag) to aid in detection and purification of the
expressed polypeptide. For example, a system described by Janknecht
et al. allows for the ready purification of non-denatured fusion
proteins expressed in human cell lines (Janknecht et al., 1991,
Proc. Natl. Acad. Sci. USA 88:8972-897). In this system, the gene
of interest is subcloned into a vaccinia recombination plasmid such
that the open reading frame of the gene is translationally fused to
an amino-terminal tag consisting of six histidine residues. The tag
serves as a matrix binding domain for the fusion protein. Extracts
from cells infected with the recombinant vaccinia virus are loaded
onto Ni2+ nitriloacetic acid-agarose column and histidine-tagged
proteins can be selectively eluted with imidazole-containing
buffers.
Fusion Proteins
[0307] Any polypeptide of the present invention can be used to
generate fusion proteins. For example, the polypeptide of the
present invention, when fused to a second protein, can be used as
an antigenic tag. Antibodies raised against the polypeptide of the
present invention can be used to indirectly detect the second
protein by binding to the polypeptide. Moreover, because secreted
proteins target cellular locations based on trafficking signals,
polypeptides of the present invention which are shown to be
secreted can be used as targeting molecules once fused to other
proteins.
[0308] Examples of domains that can be fused to polypeptides of the
present invention include not only heterologous signal sequences,
but also other heterologous functional regions. The fusion does not
necessarily need to be direct, but may occur through linker
sequences.
[0309] In certain preferred embodiments, proteins of the invention
are fusion proteins comprising an amino acid sequence that is an N
and/or C-terminal deletion of a polypeptide of the invention. In
preferred embodiments, the invention is directed to a fusion
protein comprising an amino acid sequence that is at least 90%,
95%, 96%, 97%, 98% or 99% identical to a polypeptide sequence of
the invention. Polynucleotides encoding these proteins are also
encompassed by the invention.
[0310] Moreover, fusion proteins may also be engineered to improve
characteristics of the polypeptide of the present invention. For
instance, a region of additional amino acids, particularly charged
amino acids, may be added to the N-terminus of the polypeptide to
improve stability and persistence during purification from the host
cell or subsequent handling and storage. Also, peptide moieties may
be added to the polypeptide to facilitate purification. Such
regions may be removed prior to final preparation of the
polypeptide. The addition of peptide moieties to facilitate
handling of polypeptides are familiar and routine techniques in the
art.
[0311] As one of skill in the art will appreciate that, as
discussed above, polypeptides of the present invention, and
epitope-bearing fragments thereof, can be combined with
heterologous polypeptide sequences. For example, the polypeptides
of the present invention may be fused with heterologous polypeptide
sequences, for example, the polypeptides of the present invention
may be fused with the constant domain of immunoglobulins (IgA, IgE,
IgG, IgM) or portions thereof (CH1, CH2, CH3, and any combination
thereof, including both entire domains and portions thereof), or
albumin (including, but not limited to, native or recombinant human
albumin or fragments or variants thereof (see, e.g., U.S. Pat. No.
5,876,969, issued Mar. 2, 1999, EP Patent 0 413 622, and U.S. Pat.
No. 5,766,883, issued Jun. 16, 1998, herein incorporated by
reference in their entirety)), resulting in chimeric polypeptides.
For example, EP-A-O 464 533 (Canadian counterpart 2045869)
discloses fusion proteins comprising various portions of constant
region of immunoglobulin molecules together with another human
protein or part thereof. In many cases, the Fc part in a fusion
protein is beneficial in therapy and diagnosis, and thus can result
in, for example, improved pharmacokinetic properties (EP-A 0232
262). Alternatively, deleting the Fc part after the fusion protein
has been expressed, detected, and purified, would be desired. For
example, the Fc portion may hinder therapy and diagnosis if the
fusion protein is used as an antigen for immunizations. In drug
discovery, for example, human proteins, such as hIL-5, have been
fused with Fc portions for the purpose of high-throughput screening
assays to identify antagonists of hIL-5. See, D. Bennett et al., J.
Molecular Recognition 8:52-58 (1995); K. Johanson et al., J. Biol.
Chem. 270:9459-9471 (1995).
[0312] Moreover, the polypeptides of the present invention can be
fused to marker sequences, such as a polypeptide which facilitates
purification of the fused polypeptide. In preferred embodiments,
the marker amino acid sequence is a hexa-histidine peptide, such as
the tag provided in a pQE vector (QIAGEN, Inc., 9259 Eton Avenue,
Chatsworth, Calif., 91311), among others, many of which are
commercially available. As described in Gentz et al., Proc. Natl.
Acad. Sci. USA 86:821-824 (1989), for instance, hexa-histidine
provides for convenient purification of the fusion protein. Another
peptide tag useful for purification, the "HA" tag, corresponds to
an epitope derived from the influenza hemagglutinin protein (Wilson
et al., Cell 37:767 (1984)).
[0313] Additional fusion proteins of the invention may be generated
through the techniques of gene-shuffling, motif-shuffling,
exon-shuffling, and/or codon-shuffling (collectively referred to as
"DNA shuffling"). DNA shuffling may be employed to modulate the
activities of polypeptides of the invention, such methods can be
used to generate polypeptides with altered activity, as well as
agonists and antagonists of the polypeptides. See, generally, U.S.
Pat. Nos. 5,605,793; 5,811,238; 5,830,721; 5,834,252; and
5,837,458, and Patten et al., Curr. Opinion Biotechnol. 8:724-33
(1997); Harayama, Trends Biotechnol. 16(2):76-82 (1998); Hansson,
et al., J. Mol. Biol. 287:265-76 (1999); and Lorenzo and Blasco,
Biotechniques 24(2):308-13 (1998) (each of these patents and
publications are hereby incorporated by reference in its entirety).
In one embodiment, alteration of polynucleotides corresponding to
SEQ ID NO:X and the polypeptides encoded by these polynucleotides
may be achieved by DNA shuffling. DNA shuffling involves the
assembly of two or more DNA segments by homologous or site-specific
recombination to generate variation in the polynucleotide sequence.
In another embodiment, polynucleotides of the invention, or the
encoded polypeptides, may be altered by being subjected to random
mutagenesis by error-prone PCR, random nucleotide insertion or
other methods prior to recombination. In another embodiment, one or
more components, motifs, sections, parts, domains, fragments, etc.,
of a polynucleotide encoding a polypeptide of the invention may be
recombined with one or more components, motifs, sections, parts,
domains, fragments, etc. of one or more heterologous molecules.
[0314] Thus, any of these above fusions can be engineered using the
polynucleotides or the polypeptides of the present invention.
Recombinant and Synthetic Production of Polypeptides of the
Invention
[0315] The present invention also relates to vectors containing the
polynucleotide of the present invention, host cells, and the
production of polypeptides by synthetic and recombinant techniques.
The vector may be, for example, a phage, plasmid, viral, or
retroviral vector. Retroviral vectors may be replication competent
or replication defective. In the latter case, viral propagation
generally will occur only in complementing host cells.
[0316] The polynucleotides of the invention may be joined to a
vector containing a selectable marker for propagation in a host.
Generally, a plasmid vector is introduced in a precipitate, such as
a calcium phosphate precipitate, or in a complex with a charged
lipid. If the vector is a virus, it may be packaged in vitro using
an appropriate packaging cell line and then transduced into host
cells.
[0317] The polynucleotide insert should be operatively linked to an
appropriate promoter, such as the phage lambda PL promoter, the E.
coli lac, trp, phoA and tac promoters, the SV40 early and late
promoters and promoters of retroviral LTRs, to name a few. Other
suitable promoters will be known to the skilled artisan. The
expression constructs will further contain sites for transcription
initiation, termination, and, in the transcribed region, a ribosome
binding site for translation. The coding portion of the transcripts
expressed by the constructs will preferably include a translation
initiating codon at the beginning and a termination codon (UAA, UGA
or UAG) appropriately positioned at the end of the polypeptide to
be translated.
[0318] As indicated, the expression vectors will preferably include
at least one selectable marker. Such markers include dihydrofolate
reductase, G418, glutamine synthase, or neomycin resistance for
eukaryotic cell culture, and tetracycline, kanamycin or ampicillin
resistance genes for culturing in E. coli and other bacteria.
Representative examples of appropriate hosts include, but are not
limited to, bacterial cells, such as E. coli, Streptomyces and
Salmonella typhimurium cells; fungal cells, such as yeast cells
(e.g., Saccharomyces cerevisiae or Pichia pastoris (ATCC Accession
No. 201178)); insect cells such as Drosophila S2 and Spodoptera Sf9
cells; animal cells such as CHO, COS, 293, and Bowes melanoma
cells; and plant cells. Appropriate culture mediums and conditions
for the above-described host cells are known in the art.
[0319] Among vectors preferred for use in bacteria include pQE70,
pQE60 and pQE-9, available from QIAGEN, Inc.; pBluescript vectors,
Phagescript vectors, pNH8A, pNH16a, pNH18A, pNH46A, available from
Stratagene Cloning Systems, Inc.; and ptrc99a, pKK223-3, pKK233-3,
pDR540, pRIT5 available from Pharmacia Biotech, Inc. Among
preferred eukaryotic vectors are pWLNEO, pSV2CAT, pOG44, pXT1 and
pSG available from Stratagene; and pSVK3, pBPV, pMSG and pSVL
available from Pharmacia. Preferred expression vectors for use in
yeast systems include, but are not limited to pYES2, pYD1,
pTEF1/Zeo, pYES2/GS, pPICZ, pGAPZ, pGAPZalph, pPIC9, pPIC3.5,
pHIL-D2, pHIL-S1, pPIC3.5K, pPIC9K, and PA0815 (all available from
Invitrogen, Carlbad, Calif.). Other suitable vectors will be
readily apparent to the skilled artisan.
[0320] Vectors which use glutamine synthase (GS) or DHFR as the
selectable markers can be amplified in the presence of the drugs
methionine sulphoximine or methotrexate, respectively. An advantage
of glutamine synthase based vectors are the availability of cell
lines (e.g., the murine myeloma cell line, NS0) which are glutamine
synthase negative. Glutamine synthase expression systems can also
function in glutamine synthase expressing cells (e.g., Chinese
Hamster Ovary (CHO) cells) by providing additional inhibitor to
prevent the functioning of the endogenous gene. A glutamine
synthase expression system and components thereof are detailed in
PCT publications: WO87/04462; WO86/05807; WO89/01036; WO89/10404;
and WO91/06657, which are hereby incorporated in their entireties
by reference herein. Additionally, glutamine synthase expression
vectors can be obtained from Lonza Biologics, Inc. (Portsmouth,
N.H.). Expression and production of monoclonal antibodies using a
GS expression system in murine myeloma cells is described in
Bebbington et al., Bio/technology 10:169(1992) and in Biblia and
Robinson Biotechnol. Prog. 11:1 (1995) which are herein
incorporated by reference.
[0321] The present invention also relates to host cells containing
the above-described vector constructs described herein, and
additionally encompasses host cells containing nucleotide sequences
of the invention that are operably associated with one or more
heterologous control regions (e.g., promoter and/or enhancer) using
techniques known of in the art. The host cell can be a higher
eukaryotic cell, such as a mammalian cell (e.g., a human derived
cell), or a lower eukaryotic cell, such as a yeast cell, or the
host cell can be a prokaryotic cell, such as a bacterial cell. A
host strain may be chosen which modulates the expression of the
inserted gene sequences, or modifies and processes the gene product
in the specific fashion desired. Expression from certain promoters
can be elevated in the presence of certain inducers; thus
expression of the genetically engineered polypeptide may be
controlled. Furthermore, different host cells have characteristics
and specific mechanisms for the translational and
post-translational processing and modification (e.g.,
phosphorylation, cleavage) of proteins. Appropriate cell lines can
be chosen to ensure the desired modifications and processing of the
foreign protein expressed.
[0322] Introduction of the nucleic acids and nucleic acid
constructs of the invention into the host cell can be effected by
calcium phosphate transfection, DEAE-dextran mediated transfection,
cationic lipid-mediated transfection, electroporation,
transduction, infection, or other methods. Such methods are
described in many standard laboratory manuals, such as Davis et
al., Basic Methods In Molecular Biology (1986). It is specifically
contemplated that the polypeptides of the present invention may in
fact be expressed by a host cell lacking a recombinant vector.
[0323] In addition to encompassing host cells containing the vector
constructs discussed herein, the invention also encompasses
primary, secondary, and immortalized host cells of vertebrate
origin, particularly mammalian origin, that have been engineered to
delete or replace endogenous genetic material (e.g., the coding
sequence), and/or to include genetic material (e.g., heterologous
polynucleotide sequences) that is operably associated with
polynucleotides of the invention, and which activates, alters,
and/or amplifies endogenous polynucleotides. For example,
techniques known in the art may be used to operably associate
heterologous control regions (e.g., promoter and/or enhancer) and
endogenous polynucleotide sequences via homologous recombination
(see, e.g., U.S. Pat. No. 5,641,670, issued Jun. 24, 1997;
International Publication Number WO 96/29411; International
Publication Number WO 94/12650; Koller et al., Proc. Natl. Acad.
Sci. USA 86:8932-8935 (1989); and Zijlstra et al., Nature
342:435-438 (1989), the disclosures of each of which are
incorporated by reference in their entireties).
[0324] Polypeptides of the invention can be recovered and purified
from recombinant cell cultures by well-known methods including
ammonium sulfate or ethanol precipitation, acid extraction, anion
or cation exchange chromatography, phosphocellulos chromatography,
hydrophobic interaction chromatography, affinity chromatography,
hydroxylapatite chromatography and lectin chromatography. Most
preferably, high performance liquid charomatography ("HPLC") is
employed for purification.
[0325] Polypeptides of the present invention can also be recovered
from: products purified from natural sources, including bodily
fluids, tissues and cells, whether directly isolated or cultured;
products of chemical synthetic procedures; and products produced by
recombinant techniques from a prokaryotic or eukaryotic host,
including, for example, bacterial, yeast, higher plant, insect, and
mammalian cells. Depending upon the host employed in a recombinant
production procedure, the polypeptides of the present invention may
be glycosylated or may be non-glycosylated. In addition,
polypeptides of the invention may also include an initial modified
methionine residue, in some cases as a result of host-mediated
processes. Thus, it is well known in the art that the N-terminal
methionine encoded by the translation initiation codon generally is
removed with high efficiency from any protein after translation in
all eukaryotic cells. While the N-terminal methionine on most
proteins also is efficiently removed in most prokaryotes, for some
proteins, this prokaryotic removal process is inefficient,
depending on the nature of the amino acid to which the N-terminal
methionine is covalently linked.
[0326] In one embodiment, the yeast Pichia pastoris is used to
express polypeptides of the invention in a eukaryotic system.
Pichia pastoris is a methylotrophic yeast which can metabolize
methanol as its sole carbon source. A main step in the methanol
metabolization pathway is the oxidation of methanol to formaldehyde
using O.sub.2. This reaction is catalyzed by the enzyme alcohol
oxidase. In order to metabolize methanol as its sole carbon source,
Pichia pastoris must generate high levels of alcohol oxidase due,
in part, to the relatively low affinity of alcohol oxidase for
O.sub.2. Consequently, in a growth medium depending on methanol as
a main carbon source, the promoter region of one of the two alcohol
oxidase genes (AOX1) is highly active. In the presence of methanol,
alcohol oxidase produced from the AOX1 gene comprises up to
approximately 30% of the total soluble protein in Pichia pastoris.
See Ellis, S. B., et al., Mol. Cell. Biol. 5:1111-21 (1985); Koutz,
P. J, et al., Yeast 5:167-77 (1989); Tschopp, J. F., et al., Nucl.
Acids Res. 15:3859-76 (1987). Thus, a heterologous coding sequence,
such as, for example, a polynucleotide of the present invention,
under the transcriptional regulation of all or part of the AOX1
regulatory sequence is expressed at exceptionally high levels in
Pichia yeast grown in the presence of methanol.
[0327] In one example, the plasmid vector pPIC9K is used to express
DNA encoding a polypeptide of the invention, as set forth herein,
in a Pichea yeast system essentially as described in "Pichia
Protocols: Methods in Molecular Biology," D. R. Higgins and J.
Cregg, eds. The Humana Press, Totowa, N.J., 1998. This expression
vector allows expression and secretion of a polypeptide of the
invention by virtue of the strong AOX1 promoter linked to the
Pichia pastoris alkaline phosphatase (PHO) secretory signal peptide
(i.e., leader) located upstream of a multiple cloning site.
[0328] Many other yeast vectors could be used in place of pPIC9K,
such as, pYES2, pYD1, pTEF1/Zeo, pYES2/GS, pPICZ, pGAPZ,
pGAPZalpha, pPIC9, pPIC3.5, pHIL-D2, pHIL-S1, pPIC3.5K, and PAO815,
as one skilled in the art would readily appreciate, as long as the
proposed expression construct provides appropriately located
signals for transcription, translation, secretion (if desired), and
the like, including an in-frame AUG as required.
[0329] In another embodiment, high-level expression of a
heterologous coding sequence, such as, for example, a
polynucleotide of the present invention, may be achieved by cloning
the heterologous polynucleotide of the invention into an expression
vector such as, for example, pGAPZ or pGAPZalpha, and growing the
yeast culture in the absence of methanol.
[0330] In addition to encompassing host cells containing the vector
constructs discussed herein, the invention also encompasses
primary, secondary, and immortalized host cells of vertebrate
origin, particularly mammalian origin, that have been engineered to
delete or replace endogenous genetic material (e.g., coding
sequence), and/or to include genetic material (e.g., heterologous
polynucleotide sequences) that is operably associated with
polynucleotides of the invention, and which activates, alters,
and/or amplifies endogenous polynucleotides. For example,
techniques known in the art may be used to operably associate
heterologous control regions (e.g., promoter and/or enhancer) and
endogenous polynucleotide sequences via homologous recombination
(see, e.g., U.S. Pat. No. 5,641,670, issued Jun. 24, 1997;
International Publication No. WO 96/29411, published Sep. 26, 1996;
International Publication No. WO 94/12650, published Aug. 4, 1994;
Koller et al., Proc. Natl. Acad. Sci. USA 86:8932-8935 (1989); and
Zijlstra et al., Nature 342:435-438 (1989), the disclosures of each
of which are incorporated by reference in their entireties).
[0331] In addition, polypeptides of the invention can be chemically
synthesized using techniques known in the art (e.g., see Creighton,
1983, Proteins: Structures and Molecular Principles, W.H. Freeman
& Co., N.Y., and Hunkapiller et al., Nature, 310:105-111
(1984)). For example, a polypeptide corresponding to a fragment of
a polypeptide can be synthesized by use of a peptide synthesizer.
Furthermore, if desired, nonclassical amino acids or chemical amino
acid analogs can be introduced as a substitution or addition into
the polypeptide sequence. Non-classical amino acids include, but
are not limited to, to the D-isomers of the common amino acids,
2,4-diaminobutyric acid, a-amino isobutyric acid, 4-aminobutyric
acid, Abu, 2-amino butyric acid, g-Abu, e-Ahx, 6-amino hexanoic
acid, Aib, 2-amino isobutyric acid, 3-amino propionic acid,
ornithine, norleucine, norvaline, hydroxyproline, sarcosine,
citrulline, homocitrulline, cysteic acid, t-butylglycine,
t-butylalanine, phenylglycine, cyclohexylalanine, b-alanine,
fluoro-amino acids, designer amino acids such as b-methyl amino
acids, Ca-methyl amino acids, Na-methyl amino acids, and amino acid
analogs in general. Furthermore, the amino acid can be D
(dextrorotary) or L (levorotary).
[0332] The invention encompasses polypeptides of the present
invention which are differentially modified during or after
translation, e.g., by glycosylation, acetylation, phosphorylation,
amidation, derivatization by known protecting/blocking groups,
proteolytic cleavage, linkage to an antibody molecule or other
cellular ligand, etc. Any of numerous chemical modifications may be
carried out by known techniques, including but not limited, to
specific chemical cleavage by cyanogen bromide, trypsin,
chymotrypsin, papain, V8 protease, NaBH.sub.4; acetylation,
formylation, oxidation, reduction; metabolic synthesis in the
presence of tunicamycin; etc.
[0333] Additional post-translational modifications encompassed by
the invention include, for example, e.g., N-linked or O-linked
carbohydrate chains, processing of N-terminal or C-terminal ends),
attachment of chemical moieties to the amino acid backbone,
chemical modifications of N-linked or O-linked carbohydrate chains,
and addition or deletion of an N-terminal methionine residue as a
result of procaryotic host cell expression. The polypeptides may
also be modified with a detectable label, such as an enzymatic,
fluorescent, isotopic or affinity label to allow for detection and
isolation of the protein.
[0334] Examples of suitable enzymes include horseradish peroxidase,
alkaline phosphatase, beta-galactosidase, or acetylcholinesterase;
examples of suitable prosthetic group complexes include
streptavidin/biotin and avidin/biotin; examples of suitable
fluorescent materials include umbelliferone, fluorescein,
fluorescein isothiocyanate, rhodamine, dichlorotriazinylamine
fluorescein, dansyl chloride or phycoerythrin; an example of a
luminescent material includes luminol; examples of bioluminescent
materials include luciferase, luciferin, and aequorin; and examples
of suitable radioactive material include iodine (.sup.121I,
.sup.123I, .sup.125I, .sup.131I), carbon (.sup.14C), sulfur
(.sup.35S), tritium (.sup.3H), indium (.sup.111In, .sup.112In,
.sup.113mIn, .sup.115mIn), technetium (.sup.99Tc, .sup.99mTc),
thallium (.sup.201Ti), gallium (.sup.68Ga, .sup.67Ga), palladium
(.sup.103Pd), molybdenum (.sup.99Mo), xenon (.sup.133Xe), fluorine
(.sup.18F), .sup.153Sm, .sup.177Lu, .sup.159Gd, .sup.149Pm,
.sup.140La, .sup.175Yb, .sup.166Ho, .sup.90Y, .sup.47Sc,
.sup.186Re, .sup.188Re, .sup.142Pr, .sup.105Rh, and .sup.97Ru.
[0335] In specific embodiments, a polypeptide of the present
invention or fragment or variant thereof is attached to macrocyclic
chelators that associate with radiometal ions, including but not
limited to, .sup.177Lu, .sup.90Y, .sup.166Ho, and .sup.153Sm, to
polypeptides. In a preferred embodiment, the radiometal ion
associated with the macrocyclic chelators is .sup.111In. In another
preferred embodiment, the radiometal ion associated with the
macrocyclic chelator is .sup.90Y. In specific embodiments, the
macrocyclic chelator is
1,4,7,10-tetraazacyclododecane-N,N',N'',N'''-tetraacetic acid
(DOTA). In other specific embodiments, DOTA is attached to an
antibody of the invention or fragment thereof via a linker
molecule. Examples of linker molecules useful for conjugating DOTA
to a polypeptide are commonly known in the art--see, for example,
DeNardo et al., Clin Cancer Res. 4(10):2483-90 (1998); Peterson et
al., Bioconjug. Chem. 10(4):553-7 (1999); and Zimmerman et al,
Nucl. Med. Biol. 26(8):943-50 (1999); which are hereby incorporated
by reference in their entirety.
[0336] As mentioned, the proteins of the invention may be modified
by either natural processes, such as posttranslational processing,
or by chemical modification techniques which are well known in the
art. It will be appreciated that the same type of modification may
be present in the same or varying degrees at several sites in a
given polypeptide. Polypeptides of the invention may be branched,
for example, as a result of ubiquitination, and they may be cyclic,
with or without branching. Cyclic, branched, and branched cyclic
polypeptides may result from posttranslation natural processes or
may be made by synthetic methods. Modifications include
acetylation, acylation, ADP-ribosylation, amidation, covalent
attachment of flavin, covalent attachment of a heme moiety,
covalent attachment of a nucleotide or nucleotide derivative,
covalent attachment of a lipid or lipid derivative, covalent
attachment of phosphotidylinositol, cross-linking, cyclization,
disulfide bond formation, demethylation, formation of covalent
cross-links, formation of cysteine, formation of pyroglutamate,
formylation, gamma-carboxylation, glycosylation, GPI anchor
formation, hydroxylation, iodination, methylation, myristoylation,
oxidation, pegylation, proteolytic processing, phosphorylation,
prenylation, racemization, selenoylation, sulfation, transfer-RNA
mediated addition of amino acids to proteins such as arginylation,
and ubiquitination. (See, for instance, PROTEINS--STRUCTURE AND
MOLECULAR PROPERTIES, 2nd Ed., T. E. Creighton, W.H. Freeman and
Company, New York (1993); POSTTRANSLATIONAL COVALENT MODIFICATION
OF PROTEINS, B. C. Johnson, Ed., Academic Press, New York, pgs.
1-12 (1983); Seifter et al., Meth. Enzymol. 182:626-646 (1990);
Rattan et al., Ann. N.Y. Acad. Sci. 663:48-62 (1992)).
[0337] Also provided by the invention are chemically modified
derivatives of the polypeptides of the invention which may provide
additional advantages such as increased solubility, stability and
circulating time of the polypeptide, or decreased immunogenicity
(see U.S. Pat. No. 4,179,337). The chemical moieties for
derivitization may be selected from water soluble polymers such as
polyethylene glycol, ethylene glycol/propylene glycol copolymers,
carboxymethylcellulose, dextran, polyvinyl alcohol and the like.
The polypeptides may be modified at random positions within the
molecule, or at predetermined positions within the molecule and may
include one, two, three or more attached chemical moieties.
[0338] The polymer may be of any molecular weight, and may be
branched or unbranched. For polyethylene glycol, the preferred
molecular weight is between about 1 kDa and about 100 kDa (the term
"about" indicating that in preparations of polyethylene glycol,
some molecules will weigh more, some less, than the stated
molecular weight) for ease in handling and manufacturing. Other
sizes may be used, depending on the desired therapeutic profile
(e.g., the duration of sustained release desired, the effects, if
any on biological activity, the ease in handling, the degree or
lack of antigenicity and other known effects of the polyethylene
glycol to a therapeutic protein or analog). For example, the
polyethylene glycol may have an average molecular weight of about
200, 500, 1000, 1500, 2000, 2500, 3000, 3500, 4000, 4500, 5000,
5500, 6000, 6500, 7000, 7500, 8000, 8500, 9000, 9500, 10,000,
10,500, 11,000, 11,500, 12,000, 12,500, 13,000, 13,500, 14,000,
14,500, 15,000, 15,500, 16,000, 16,500, 17,000, 17,500, 18,000,
18,500, 19,000, 19,500, 20,000, 25,000, 30,000, 35,000, 40,000,
45,000, 50,000, 55,000, 60,000, 65,000, 70,000, 75,000, 80,000,
85,000, 90,000, 95,000, or 100,000 kDa.
[0339] As noted above, the polyethylene glycol may have a branched
structure. Branched polyethylene glycols are described, for
example, in U.S. Pat. No. 5,643,575; Morpurgo et al., Appl.
Biochem. Biotechnol. 56:59-72 (1996); Vorobjev et al, Nucleosides
Nucleotides 18:2745-2750 (1999); and Caliceti et al., Bioconjug.
Chem. 10:638-646 (1999), the disclosures of each of which are
incorporated herein by reference.
[0340] The polyethylene glycol molecules (or other chemical
moieties) should be attached to the protein with consideration of
effects on functional or antigenic domains of the protein. There
are a number of attachment methods available to those skilled in
the art, such as, for example, the method disclosed in EP 0 401 384
(coupling PEG to G-CSF), herein incorporated by reference; see also
Malik et al., Exp. Hematol. 20:1028-1035 (1992), reporting
pegylation of GM-CSF using tresyl chloride. For example,
polyethylene glycol may be covalently bound through amino acid
residues via a reactive group, such as a free amino or carboxyl
group. Reactive groups are those to which an activated polyethylene
glycol molecule may be bound. The amino acid residues having a free
amino group may include lysine residues and the N-terminal amino
acid residues; those having a free carboxyl group may include
aspartic acid residues glutamic acid residues and the C-terminal
amino acid residue. Sulfhydryl groups may also be used as a
reactive group for attaching the polyethylene glycol molecules.
Preferred for therapeutic purposes is attachment at an amino group,
such as attachment at the N-terminus or lysine group.
[0341] As suggested above, polyethylene glycol may be attached to
proteins via linkage to any of a number of amino acid residues. For
example, polyethylene glycol can be linked to proteins via covalent
bonds to lysine, histidine, aspartic acid, glutamic acid, or
cysteine residues. One or more reaction chemistries may be employed
to attach polyethylene glycol to specific amino acid residues
(e.g., lysine, histidine, aspartic acid, glutamic acid, or
cysteine) of the protein or to more than one type of amino acid
residue (e.g., lysine, histidine, aspartic acid, glutamic acid,
cysteine and combinations thereof) of the protein.
[0342] One may specifically desire proteins chemically modified at
the N-terminus. Using polyethylene glycol as an illustration of the
present composition, one may select from a variety of polyethylene
glycol molecules (by molecular weight, branching, etc.), the
proportion of polyethylene glycol molecules to protein
(polypeptide) molecules in the reaction mix, the type of pegylation
reaction to be performed, and the method of obtaining the selected
N-terminally pegylated protein. The method of obtaining the
N-terminally pegylated preparation (i.e., separating this moiety
from other monopegylated moieties if necessary) may be by
purification of the N-terminally pegylated material from a
population of pegylated protein molecules. Selective proteins
chemically modified at the N-terminus modification may be
accomplished by reductive alkylation which exploits differential
reactivity of different types of primary amino groups (lysine
versus the N-terminal) available for derivatization in a particular
protein. Under the appropriate reaction conditions, substantially
selective derivatization of the protein at the N-terminus with a
carbonyl group containing polymer is achieved.
[0343] As indicated above, pegylation of the proteins of the
invention may be accomplished by any number of means. For example,
polyethylene glycol may be attached to the protein either directly
or by an intervening linker. Linkerless systems for attaching
polyethylene glycol to proteins are described in Delgado et al.,
Crit. Rev. Thera. Drug Carrier Sys. 9:249-304 (1992); Francis et
al., Intern. J. of Hematol. 68:1-18 (1998); U.S. Pat. No.
4,002,531; U.S. Pat. No. 5,349,052; WO 95/06058; and WO 98/32466,
the disclosures of each of which are incorporated herein by
reference.
[0344] One system for attaching polyethylene glycol directly to
amino acid residues of proteins without an intervening linker
employs tresylated MPEG, which is produced by the modification of
monmethoxy polyethylene glycol (MPEG) using tresylchloride
(ClSO.sub.2CH.sub.2CF.sub.3). Upon reaction of protein with
tresylated MPEG, polyethylene glycol is directly attached to amine
groups of the protein. Thus, the invention includes
protein-polyethylene glycol conjugates produced by reacting
proteins of the invention with a polyethylene glycol molecule
having a 2,2,2-trifluoreothane sulphonyl group.
[0345] Polyethylene glycol can also be attached to proteins using a
number of different intervening linkers. For example, U.S. Pat. No.
5,612,460, the entire disclosure of which is incorporated herein by
reference, discloses urethane linkers for connecting polyethylene
glycol to proteins. Protein-polyethylene glycol conjugates wherein
the polyethylene glycol is attached to the protein by a linker can
also be produced by reaction of proteins with compounds such as
MPEG-succinimidylsuccinate, MPEG activated with
1,1'-carbonyldiimidazole, MPEG-2,4,5-trichloropenylcarbonate,
MPEG-p-nitrophenolcarbonate, and various MPEG-succinate
derivatives. A number of additional polyethylene glycol derivatives
and reaction chemistries for attaching polyethylene glycol to
proteins are described in International Publication No. WO
98/32466, the entire disclosure of which is incorporated herein by
reference. Pegylated protein products produced using the reaction
chemistries set out herein are included within the scope of the
invention.
[0346] The number of polyethylene glycol moieties attached to each
protein of the invention (i.e., the degree of substitution) may
also vary. For example, the pegylated proteins of the invention may
be linked, on average, to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 15,
17, 20, or more polyethylene glycol molecules. Similarly, the
average degree of substitution within ranges such as 1-3, 2-4, 3-5,
4-6, 5-7, 6-8, 7-9, 8-10, 9-11, 10-12, 11-13, 12-14, 13-15, 14-16,
15-17, 16-18, 17-19, or 18-20 polyethylene glycol moieties per
protein molecule. Methods for determining the degree of
substitution are discussed, for example, in Delgado et al., Crit.
Rev. Thera. Drug Carrier Sys. 9:249-304 (1992).
[0347] The polypeptides of the invention can be recovered and
purified from chemical synthesis and recombinant cell cultures by
standard methods which include, but are not limited to, ammonium
sulfate or ethanol precipitation, acid extraction, anion or cation
exchange chromatography, phosphocellulose chromatography,
hydrophobic interaction chromatography, affinity chromatography,
hydroxylapatite chromatography and lectin chromatography. Most
preferably, high performance liquid chromatography ("HPLC") is
employed for purification. Well known techniques for refolding
protein may be employed to regenerate active conformation when the
polypeptide is denatured during isolation and/or purification.
[0348] The polypeptides of the invention may be in monomers or
multimers (i.e., dimers, trimers, tetramers and higher multimers).
Accordingly, the present invention relates to monomers and
multimers of the polypeptides of the invention, their preparation,
and compositions (preferably, Therapeutics) containing them. In
specific embodiments, the polypeptides of the invention are
monomers, dimers, trimers or tetramers. In additional embodiments,
the multimers of the invention are at least dimers, at least
trimers, or at least tetramers.
[0349] Multimers encompassed by the invention may be homomers or
heteromers. As used herein, the term homomer refers to a multimer
containing only polypeptides corresponding to a protein of the
invention (e.g., the amino acid sequence of SEQ ID NO:Y, an amino
acid sequence encoded by SEQ ID NO:X or the complement of SEQ ID
NO:X, the amino acid sequence encoded by the portion of SEQ ID NO:X
as defined in columns 8 and 9 of Table 2, and/or an amino acid
sequence encoded by cDNA contained in ATCC Deposit No: Z (including
fragments, variants, splice variants, and fusion proteins,
corresponding to these as described herein)). These homomers may
contain polypeptides having identical or different amino acid
sequences. In a specific embodiment, a homomer of the invention is
a multimer containing only polypeptides having an identical amino
acid sequence. In another specific embodiment, a homomer of the
invention is a multimer containing polypeptides having different
amino acid sequences. In specific embodiments, the multimer of the
invention is a homodimer (e.g., containing two polypeptides having
identical or different amino acid sequences) or a homotrimer (e.g.,
containing three polypeptides having identical and/or different
amino acid sequences). In additional embodiments, the homomeric
multimer of the invention is at least a homodimer, at least a
homotrimer, or at least a homotetramer.
[0350] As used herein, the term heteromer refers to a multimer
containing one or more heterologous polypeptides (i.e.,
polypeptides of different proteins) in addition to the polypeptides
of the invention. In a specific embodiment, the multimer of the
invention is a heterodimer, a heterotrimer, or a heterotetramer. In
additional embodiments, the heteromeric multimer of the invention
is at least a heterodimer, at least a heterotrimer, or at least a
heterotetramer.
[0351] Multimers of the invention may be the result of hydrophobic,
hydrophilic, ionic and/or covalent associations and/or may be
indirectly linked by, for example, liposome formation. Thus, in one
embodiment, multimers of the invention, such as, for example,
homodimers or homotrimers, are formed when polypeptides of the
invention contact one another in solution. In another embodiment,
heteromultimers of the invention, such as, for example,
heterotrimers or heterotetramers, are formed when polypeptides of
the invention contact antibodies to the polypeptides of the
invention (including antibodies to the heterologous polypeptide
sequence in a fusion protein of the invention) in solution. In
other embodiments, multimers of the invention are formed by
covalent associations with and/or between the polypeptides of the
invention. Such covalent associations may involve one or more amino
acid residues contained in the polypeptide sequence (e.g., that
recited in SEQ ID NO:Y, encoded by the portion of SEQ ID NO:X as
defined in columns 8 and 9 of Table 2, and/or encoded by the cDNA
contained in ATCC Deposit No: Z). In one instance, the covalent
associations are cross-linking between cysteine residues located
within the polypeptide sequences which interact in the native
(i.e., naturally occurring) polypeptide. In another instance, the
covalent associations are the consequence of chemical or
recombinant manipulation. Alternatively, such covalent associations
may involve one or more amino acid residues contained in the
heterologous polypeptide sequence in a fusion protein. In one
example, covalent associations are between the heterologous
sequence contained in a fusion protein of the invention (see, e.g.,
U.S. Pat. No. 5,478,925). In a specific example, the covalent
associations are between the heterologous sequence contained in a
Fc fusion protein of the invention (as described herein). In
another specific example, covalent associations of fusion proteins
of the invention are between heterologous polypeptide sequence from
another protein that is capable of forming covalently associated
multimers, such as for example, osteoprotegerin (see, e.g.,
International Publication NO: WO 98/49305, the contents of which
are herein incorporated by reference in its entirety). In another
embodiment, two or more polypeptides of the invention are joined
through peptide linkers. Examples include those peptide linkers
described in U.S. Pat. No. 5,073,627 (hereby incorporated by
reference). Proteins comprising multiple polypeptides of the
invention separated by peptide linkers may be produced using
conventional recombinant DNA technology.
[0352] Another method for preparing multimer polypeptides of the
invention involves use of polypeptides of the invention fused to a
leucine zipper or isoleucine zipper polypeptide sequence. Leucine
zipper and isoleucine zipper domains are polypeptides that promote
multimerization of the proteins in which they are found. Leucine
zippers were originally identified in several DNA-binding proteins
(Landschulz et al., Science 240:1759, (1988)), and have since been
found in a variety of different proteins. Among the known leucine
zippers are naturally occurring peptides and derivatives thereof
that dimerize or trimerize. Examples of leucine zipper domains
suitable for producing soluble multimeric proteins of the invention
are those described in PCT application WO 94/10308, hereby
incorporated by reference. Recombinant fusion proteins comprising a
polypeptide of the invention fused to a polypeptide sequence that
dimerizes or trimerizes in solution are expressed in suitable host
cells, and the resulting soluble multimeric fusion protein is
recovered from the culture supernatant using techniques known in
the art.
[0353] Trimeric polypeptides of the invention may offer the
advantage of enhanced biological activity. Preferred leucine zipper
moieties and isoleucine moieties are those that preferentially form
trimers. One example is a leucine zipper derived from lung
surfactant protein D (SPD), as described in Hoppe et al. (FEBS
Letters 344:191, (1994)) and in U.S. patent application Ser. No.
08/446,922, hereby incorporated by reference. Other peptides
derived from naturally occurring trimeric proteins may be employed
in preparing trimeric polypeptides of the invention.
[0354] In another example, proteins of the invention are associated
by interactions between Flag.RTM. polypeptide sequence contained in
fusion proteins of the invention containing Flag.RTM. polypeptide
sequence. In a further embodiment, proteins of the invention are
associated by interactions between heterologous polypeptide
sequence contained in Flag.RTM. fusion proteins of the invention
and anti-Flag.RTM. antibody.
[0355] The multimers of the invention may be generated using
chemical techniques known in the art. For example, polypeptides
desired to be contained in the multimers of the invention may be
chemically cross-linked using linker molecules and linker molecule
length optimization techniques known in the art (see, e.g., U.S.
Pat. No. 5,478,925, which is herein incorporated by reference in
its entirety). Additionally, multimers of the invention may be
generated using techniques known in the art to form one or more
inter-molecule cross-links between the cysteine residues located
within the sequence of the polypeptides desired to be contained in
the multimer (see, e.g., U.S. Pat. No. 5,478,925, which is herein
incorporated by reference in its entirety). Further, polypeptides
of the invention may be routinely modified by the addition of
cysteine or biotin to the C-terminus or N-terminus of the
polypeptide and techniques known in the art may be applied to
generate multimers containing one or more of these modified
polypeptides (see, e.g., U.S. Pat. No. 5,478,925, which is herein
incorporated by reference in its entirety). Additionally,
techniques known in the art may be applied to generate liposomes
containing the polypeptide components desired to be contained in
the multimer of the invention (see, e.g., U.S. Pat. No. 5,478,925,
which is herein incorporated by reference in its entirety).
[0356] Alternatively, multimers of the invention may be generated
using genetic engineering techniques known in the art. In one
embodiment, polypeptides contained in multimers of the invention
are produced recombinantly using fusion protein technology
described herein or otherwise known in the art (see, e.g., U.S.
Pat. No. 5,478,925, which is herein incorporated by reference in
its entirety). In a specific embodiment, polynucleotides coding for
a homodimer of the invention are generated by ligating a
polynucleotide sequence encoding a polypeptide of the invention to
a sequence encoding a linker polypeptide and then further to a
synthetic polynucleotide encoding the translated product of the
polypeptide in the reverse orientation from the original C-terminus
to the N-terminus (lacking the leader sequence) (see, e.g., U.S.
Pat. No. 5,478,925, which is herein incorporated by reference in
its entirety). In another embodiment, recombinant techniques
described herein or otherwise known in the art are applied to
generate recombinant polypeptides of the invention which contain a
transmembrane domain (or hydrophobic or signal peptide) and which
can be incorporated by membrane reconstitution techniques into
liposomes (see, e.g., U.S. Pat. No. 5,478,925, which is herein
incorporated by reference in its entirety).
Antibodies
[0357] Further polypeptides of the invention relate to antibodies
and T-cell antigen receptors (TCR) which immunospecifically bind a
polypeptide, polypeptide fragment, or variant of the invention
(e.g., a polypeptide or fragment or variant of the amino acid
sequence of SEQ ID NO:Y or a polypeptide encoded by the cDNA
contained in ATCC Deposit No: Z, and/or an epitope, of the present
invention) as determined by immunoassays well known in the art for
assaying specific antibody-antigen binding. Antibodies of the
invention include, but are not limited to, polyclonal, monoclonal,
multispecific, human, humanized or chimeric antibodies, single
chain antibodies, Fab fragments, F(ab') fragments, fragments
produced by a Fab expression library, anti-idiotypic (anti-Id)
antibodies (including, e.g., anti-Id antibodies to antibodies of
the invention), intracellularly-made antibodies (i.e.,
intrabodies), and epitope-binding fragments of any of the above.
The term "antibody," as used herein, refers to immunoglobulin
molecules and immunologically active portions of immunoglobulin
molecules, i.e., molecules that contain an antigen binding site
that immunospecifically binds an antigen. The immunoglobulin
molecules of the invention can be of any type (e.g., IgG, IgE, IgM,
IgD, IgA and IgY), class (e.g., IgG1, IgG2, IgG3, IgG4, IgA1 and
IgA2) or subclass of immunoglobulin molecule. In preferred
embodiments, the immunoglobulin molecules of the invention are
IgG1. In other preferred embodiments, the immunoglobulin molecules
of the invention are IgG4.
[0358] Most preferably the antibodies are human antigen-binding
antibody fragments of the present invention and include, but are
not limited to, Fab, Fab' and F(ab')2, Fd, single-chain Fvs (scFv),
single-chain antibodies, disulfide-linked Fvs (sdFv) and fragments
comprising either a VL or VH domain. Antigen-binding antibody
fragments, including single-chain antibodies, may comprise the
variable region(s) alone or in combination with the entirety or a
portion of the following: hinge region, CH1, CH2, and CH3 domains.
Also included in the invention are antigen-binding fragments also
comprising any combination of variable region(s) with a hinge
region, CH1, CH2, and CH3 domains. The antibodies of the invention
may be from any animal origin including birds and mammals.
Preferably, the antibodies are human, murine (e.g., mouse and rat),
donkey, ship rabbit, goat, guinea pig, camel, horse, or chicken. As
used herein, "human" antibodies include antibodies having the amino
acid sequence of a human immunoglobulin and include antibodies
isolated from human immunoglobulin libraries or from animals
transgenic for one or more human immunoglobulin and that do not
express endogenous immunoglobulins, as described infra and, for
example in, U.S. Pat. No. 5,939,598 by Kucherlapati et al. The
antibodies of the present invention may be monospecific,
bispecific, trispecific or of greater multispecificity.
Multispecific antibodies may be specific for different epitopes of
a polypeptide of the present invention or may be specific for both
a polypeptide of the present invention as well as for a
heterologous epitope, such as a heterologous polypeptide or solid
support material. See, e.g., PCT publications WO 93/17715; WO
92/08802; WO 91/00360; WO 92/05793; Tutt, et al., J. Immunol.
147:60-69 (1991); U.S. Pat. Nos. 4,474,893; 4,714,681; 4,925,648;
5,573,920; 5,601,819; Kostelny et al., J. Immunol. 148:1547-1553
(1992).
[0359] Antibodies of the present invention may be described or
specified in terms of the epitope(s) or portion(s) of a polypeptide
of the present invention which they recognize or specifically bind.
The epitope(s) or polypeptide portion(s) may be specified as
described herein, e.g., by N-terminal and C-terminal positions, or
by size in contiguous amino acid residues, or listed in the Tables
and Figures. Preferred epitopes of the invention include the
predicted epitopes shown in column 6 of Table 1B.1, as well as
polynucleotides that encode these epitopes. Antibodies which
specifically bind any epitope or polypeptide of the present
invention may also be excluded. Therefore, the present invention
includes antibodies that specifically bind polypeptides of the
present invention, and allows for the exclusion of the same.
[0360] Antibodies of the present invention may also be described or
specified in terms of their cross-reactivity. Antibodies that do
not bind any other analog, ortholog, or homolog of a polypeptide of
the present invention are included. Antibodies that bind
polypeptides with at least 95%, at least 90%, at least 85%, at
least 80%, at least 75%, at least 70%, at least 65%, at least 60%,
at least 55%, and at least 50% identity (as calculated using
methods known in the art and described herein) to a polypeptide of
the present invention are also included in the present invention.
In specific embodiments, antibodies of the present invention
cross-react with murine, rat and/or rabbit homologs of human
proteins and the corresponding epitopes thereof. Antibodies that do
not bind polypeptides with less than 95%, less than 90%, less than
85%, less than 80%, less than 75%, less than 70%, less than 65%,
less than 60%, less than 55%, and less than 50% identity (as
calculated using methods known in the art and described herein) to
a polypeptide of the present invention are also included in the
present invention. In a specific embodiment, the above-described
cross-reactivity is with respect to any single specific antigenic
or immunogenic polypeptide, or combination(s) of 2, 3, 4, 5, or
more of the specific antigenic and/or immunogenic polypeptides
disclosed herein. Further included in the present invention are
antibodies which bind polypeptides encoded by polynucleotides which
hybridize to a polynucleotide of the present invention under
stringent hybridization conditions (as described herein).
Antibodies of the present invention may also be described or
specified in terms of their binding affinity to a polypeptide of
the invention. Preferred binding affinities include those with a
dissociation constant or Kd less than 5.times.10.sup.-2 M,
10.sup.-2 M, 5.times.10.sup.-3 M, 10.sup.-3 M, 5.times.10.sup.-4 M,
10.sup.-4 M, 5.times.10.sup.-5 M, 10.sup.-5 M, 5.times.10.sup.-6 M,
10.sup.-6M, 5.times.10.sup.-7 M, 10.sup.7 M, 5.times.10.sup.-8 M,
10.sup.-8 M, 5.times.10.sup.-9 M, 10.sup.-9 M, 5.times.10.sup.-10
M, 10.sup.-10 M, 5.times.10.sup.-11 M, 10.sup.-11 M,
5.times.10.sup.-12 M, 10.sup.-12 M, 5.times.10.sup.-13 M,
10.sup.-13 M, 5.times.10.sup.-14 M, 10.sup.-14 M,
5.times.10.sup.-15 M, or 10.sup.-15 M.
[0361] The invention also provides antibodies that competitively
inhibit binding of an antibody to an epitope of the invention as
determined by any method known in the art for determining
competitive binding, for example, the immunoassays described
herein. In preferred embodiments, the antibody competitively
inhibits binding to the epitope by at least 95%, at least 90%, at
least 85%, at least 80%, at least 75%, at least 70%, at least 60%,
or at least 50%.
[0362] Antibodies of the present invention may act as agonists or
antagonists of the polypeptides of the present invention. For
example, the present invention includes antibodies which disrupt
the receptor/ligand interactions with the polypeptides of the
invention either partially or fully. Preferably, antibodies of the
present invention bind an antigenic epitope disclosed herein, or a
portion thereof. The invention features both receptor-specific
antibodies and ligand-specific antibodies. The invention also
features receptor-specific antibodies which do not prevent ligand
binding but prevent receptor activation. Receptor activation (i.e.,
signaling) may be determined by techniques described herein or
otherwise known in the art. For example, receptor activation can be
determined by detecting the phosphorylation (e.g., tyrosine or
serine/threonine) of the receptor or its substrate by
immunoprecipitation followed by western blot analysis (for example,
as described supra). In specific embodiments, antibodies are
provided that inhibit ligand activity or receptor activity by at
least 95%, at least 90%, at least 85%, at least 80%, at least 75%,
at least 70%, at least 60%, or at least 50% of the activity in
absence of the antibody.
[0363] The invention also features receptor-specific antibodies
which both prevent ligand binding and receptor activation as well
as antibodies that recognize the receptor-ligand complex, and,
preferably, do not specifically recognize the unbound receptor or
the unbound ligand. Likewise, included in the invention are
neutralizing antibodies which bind the ligand and prevent binding
of the ligand to the receptor, as well as antibodies which bind the
ligand, thereby preventing receptor activation, but do not prevent
the ligand from binding the receptor. Further included in the
invention are antibodies which activate the receptor. These
antibodies may act as receptor agonists, i.e., potentiate or
activate either all or a subset of the biological activities of the
ligand-mediated receptor activation, for example, by inducing
dimerization of the receptor. The antibodies may be specified as
agonists, antagonists or inverse agonists for biological activities
comprising the specific biological activities of the peptides of
the invention disclosed herein. The above antibody agonists can be
made using methods known in the art. See, e.g., PCT publication WO
96/40281; U.S. Pat. No. 5,811,097; Deng et al., Blood
92(6):1981-1988 (1998); Chen et al., Cancer Res. 58(16):3668-3678
(1998); Harrop et al., J. Immunol. 161(4):1786-1794 (1998); Zhu et
al., Cancer Res. 58(15):3209-3214 (1998); Yoon et al., J. Immunol.
160(7):3170-3179 (1998); Prat et al., J. Cell. Sci.
111(Pt2):237-247 (1998); Pitard et al., J. Immunol. Methods
205(2):177-190 (1997); Liautard et al., Cytokine 9(4):233-241
(1997); Carlson et al., J. Biol. Chem. 272(17):11295-11301 (1997);
Taryman et al., Neuron 14(4):755-762 (1995); Muller et al.,
Structure 6(9):1153-1167 (1998); Bartunek et al., Cytokine
8(1):14-20 (1996) (which are all incorporated by reference herein
in their entireties).
[0364] Antibodies of the present invention may be used, for
example, to purify, detect, and target the polypeptides of the
present invention, including both in vitro and in vivo diagnostic
and therapeutic methods. For example, the antibodies have utility
in immunoassays for qualitatively and quantitatively measuring
levels of the polypeptides of the present invention in biological
samples. See, e.g., Harlow et al., Antibodies: A Laboratory Manual,
(Cold Spring Harbor Laboratory Press, 2nd ed. 1988); incorporated
by reference herein in its entirety.
[0365] As discussed in more detail below, the antibodies of the
present invention may be used either alone or in combination with
other compositions. The antibodies may further be recombinantly
fused to a heterologous polypeptide at the N- or C-terminus or
chemically conjugated (including covalent and non-covalent
conjugations) to polypeptides or other compositions. For example,
antibodies of the present invention may be recombinantly fused or
conjugated to molecules useful as labels in detection assays and
effector molecules such as heterologous polypeptides, drugs,
radionuclides, or toxins. See, e.g., PCT publications WO 92/08495;
WO 91/14438; WO 89/12624; U.S. Pat. No. 5,314,995; and EP 396,387;
the disclosures of which are incorporated herein by reference in
their entireties.
[0366] The antibodies of the invention include derivatives that are
modified, i.e, by the covalent attachment of any type of molecule
to the antibody such that covalent attachment does not prevent the
antibody from generating an anti-idiotypic response. For example,
but not by way of limitation, the antibody derivatives include
antibodies that have been modified, e.g., by glycosylation,
acetylation, pegylation, phosphylation, amidation, derivatization
by known protecting/blocking groups, proteolytic cleavage, linkage
to a cellular ligand or other protein, etc. Any of numerous
chemical modifications may be carried out by known techniques,
including, but not limited to specific chemical cleavage,
acetylation, formylation, metabolic synthesis of tunicamycin, etc.
Additionally, the derivative may contain one or more non-classical
amino acids.
[0367] The antibodies of the present invention may be generated by
any suitable method known in the art. Polyclonal antibodies to an
antigen-of-interest can be produced by various procedures well
known in the art. For example, a polypeptide of the invention can
be administered to various host animals including, but not limited
to, rabbits, mice, rats, etc. to induce the production of sera
containing polyclonal antibodies specific for the antigen. Various
adjuvants may be used to increase the immunological response,
depending on the host species, and include but are not limited to,
Freund's (complete and incomplete), mineral gels such as aluminum
hydroxide, surface active substances such as lysolecithin, pluronic
polyols, polyanions, peptides, oil emulsions, keyhole limpet
hemocyanins, dinitrophenol, and potentially useful human adjuvants
such as BCG (bacille Calmette-Guerin) and corynebacterium parvum.
Such adjuvants are also well known in the art.
[0368] Monoclonal antibodies can be prepared using a wide variety
of techniques known in the art including the use of hybridoma,
recombinant, and phage display technologies, or a combination
thereof. For example, monoclonal antibodies can be produced using
hybridoma techniques including those known in the art and taught,
for example, in Harlow et al., Antibodies: A Laboratory Manual,
(Cold Spring Harbor Laboratory Press; 2nd ed. 1988); Hammerling, et
al., in: Monoclonal Antibodies and T-Cell Hybridomas 563-681
(Elsevier, N.Y., 1981) (said references incorporated by reference
in their entireties). The term "monoclonal antibody" as used herein
is not limited to antibodies produced through hybridoma technology.
The term "monoclonal antibody" refers to an antibody that is
derived from a single clone, including any eukaryotic, prokaryotic,
or phage clone, and not the method by which it is produced.
[0369] Methods for producing and screening for specific antibodies
using hybridoma technology are routine and well known in the art
and are discussed in detail in the Examples. In a non-limiting
example, mice can be immunized with a polypeptide of the invention
or a cell expressing such peptide. Once an immune response is
detected, e.g., antibodies specific for the antigen are detected in
the mouse serum, the mouse spleen is harvested and splenocytes
isolated. The splenocytes are then fused by well known techniques
to any suitable myeloma cells, for example cells from cell line
SP20 available from the ATCC. Hybridomas are selected and cloned by
limited dilution. The hybridoma clones are then assayed by methods
known in the art for cells that secrete antibodies capable of
binding a polypeptide of the invention. Ascites fluid, which
generally contains high levels of antibodies, can be generated by
immunizing mice with positive hybridoma clones.
[0370] Accordingly, the present invention provides methods of
generating monoclonal antibodies as well as antibodies produced by
the method comprising culturing a hybridoma cell secreting an
antibody of the invention wherein, preferably, the hybridoma is
generated by fusing splenocytes isolated from a mouse immunized
with an antigen of the invention with myeloma cells and then
screening the hybridomas resulting from the fusion for hybridoma
clones that secrete an antibody able to bind a polypeptide of the
invention.
[0371] Another well known method for producing both polyclonal and
monoclonal human B cell lines is transformation using Epstein Barr
Virus (EBV). Protocols for generating EBV-transformed B cell lines
are commonly known in the art, such as, for example, the protocol
outlined in Chapter 7.22 of Current Protocols in Immunology,
Coligan et al., Eds., 1994, John Wiley & Sons, NY, which is
hereby incorporated in its entirety by reference. The source of B
cells for transformation is commonly human peripheral blood, but B
cells for transformation may also be derived from other sources
including, but not limited to, lymph nodes, tonsil, spleen, tumor
tissue, and infected tissues. Tissues are generally made into
single cell suspensions prior to EBV transformation. Additionally,
steps may be taken to either physically remove or inactivate T
cells (e.g., by treatment with cyclosporin A) in B cell-containing
samples, because T cells from individuals seropositive for anti-EBV
antibodies can suppress B cell immortalization by EBV.
[0372] In general, the sample containing human B cells is
innoculated with EBV, and cultured for 3-4 weeks. A typical source
of EBV is the culture supernatant of the B95-8 cell line (ATCC
#VR-1492). Physical signs of EBV transformation can generally be
seen towards the end of the 3-4 week culture period. By
phase-contrast microscopy, transformed cells may appear large,
clear, hairy and tend to aggregate in tight clusters of cells.
Initially, EBV lines are generally polyclonal. However, over
prolonged periods of cell cultures, EBV lines may become monoclonal
or polyclonal as a result of the selective outgrowth of particular
B cell clones. Alternatively, polyclonal EBV transformed lines may
be subcloned (e.g., by limiting dilution culture) or fused with a
suitable fusion partner and plated at limiting dilution to obtain
monoclonal B cell lines. Suitable fusion partners for EBV
transformed cell lines include mouse myeloma cell lines (e.g.,
SP2/0, X63-Ag8.653), heteromyeloma cell lines (human.times.mouse;
e.g, SPAM-8, SBC-H20, and CB-F7), and human cell lines (e.g., GM
1500, SKO-007, RPMI 8226, and KR-4). Thus, the present invention
also provides a method of generating polyclonal or monoclonal human
antibodies against polypeptides of the invention or fragments
thereof, comprising EBV-transformation of human B cells.
[0373] Antibody fragments which recognize specific epitopes may be
generated by known techniques. For example, Fab and F(ab')2
fragments of the invention may be produced by proteolytic cleavage
of immunoglobulin molecules, using enzymes such as papain (to
produce Fab fragments) or pepsin (to produce F(ab')2 fragments).
F(ab')2 fragments contain the variable region, the light chain
constant region and the CH1 domain of the heavy chain.
[0374] For example, the antibodies of the present invention can
also be generated using various phage display methods known in the
art. In phage display methods, functional antibody domains are
displayed on the surface of phage particles which carry the
polynucleotide sequences encoding them. In a particular embodiment,
such phage can be utilized to display antigen binding domains
expressed from a repertoire or combinatorial antibody library
(e.g., human or murine). Phage expressing an antigen binding domain
that binds the antigen of interest can be selected or identified
with antigen, e.g., using labeled antigen or antigen bound or
captured to a solid surface or bead. Phage used in these methods
are typically filamentous phage including fd and M13 binding
domains expressed from phage with Fab, Fv or disulfide stabilized
Fv antibody domains recombinantly fused to either the phage gene
III or gene VIII protein. Examples of phage display methods that
can be used to make the antibodies of the present invention include
those disclosed in Brinkman et al., J. Immunol. Methods 182:41-50
(1995); Ames et al., J. Immunol. Methods 184:177-186 (1995);
Kettleborough et al., Eur. J. Immunol. 24:952-958 (1994); Persic et
al., Gene 187 9-18 (1997); Burton et al., Advances in Immunology
57:191-280 (1994); PCT application No. PCT/GB91/01134; PCT
publications WO 90/02809; WO 91/10737; WO 92/01047; WO 92/18619; WO
93/11236; WO 95/15982; WO 95/20401; and U.S. Pat. Nos. 5,698,426;
5,223,409; 5,403,484; 5,580,717; 5,427,908; 5,750,753; 5,821,047;
5,571,698; 5,427,908; 5,516,637; 5,780,225; 5,658,727; 5,733,743
and 5,969,108; each of which is incorporated herein by reference in
its entirety.
[0375] As described in the above references, after phage selection,
the antibody coding regions from the phage can be isolated and used
to generate whole antibodies, including human antibodies, or any
other desired antigen binding fragment, and expressed in any
desired host, including mammalian cells, insect cells, plant cells,
yeast, and bacteria, e.g., as described in detail below. For
example, techniques to recombinantly produce Fab, Fab' and F(ab')2
fragments can also be employed using methods known in the art such
as those disclosed in PCT publication WO 92/22324; Mullinax et al.,
BioTechniques 12(6):864-869 (1992); and Sawai et al., AJRI 34:26-34
(1995); and Better et al., Science 240:1041-1043 (1988) (said
references incorporated by reference in their entireties).
[0376] Examples of techniques which can be used to produce
single-chain Fvs and antibodies include those described in U.S.
Pat. Nos. 4,946,778 and 5,258,498; Huston et al., Methods in
Enzymology 203:46-88 (1991); Shu et al., PNAS 90:7995-7999 (1993);
and Skerra et al., Science 240:1038-1040 (1988). For some uses,
including in vivo use of antibodies in humans and in vitro
detection assays, it may be preferable to use chimeric, humanized,
or human antibodies. A chimeric antibody is a molecule in which
different portions of the antibody are derived from different
animal species, such as antibodies having a variable region derived
from a murine monoclonal antibody and a human immunoglobulin
constant region. Methods for producing chimeric antibodies are
known in the art. See e.g., Morrison, Science 229:1202 (1985); Oi
et al., BioTechniques 4:214 (1986); Gillies et al., (1989) J.
Immunol. Methods 125:191-202; U.S. Pat. Nos. 5,807,715; 4,816,567;
and 4,816,397, which are incorporated herein by reference in their
entirety. Humanized antibodies are antibody molecules from
non-human species antibody that binds the desired antigen having
one or more complementarity determining regions (CDRs) from the
non-human species and a framework regions from a human
immunoglobulin molecule. Often, framework residues in the human
framework regions will be substituted with the corresponding
residue from the CDR donor antibody to alter, preferably improve,
antigen binding. These framework substitutions are identified by
methods well known in the art, e.g., by modeling of the
interactions of the CDR and framework residues to identify
framework residues important for antigen binding and sequence
comparison to identify unusual framework residues at particular
positions. (See, e.g., Queen et al., U.S. Pat. No. 5,585,089;
Riechmann et al., Nature 332:323 (1988), which are incorporated
herein by reference in their entireties.) Antibodies can be
humanized using a variety of techniques known in the art including,
for example, CDR-grafting (EP 239,400; PCT publication WO 91/09967;
U.S. Pat. Nos. 5,225,539; 5,530,101; and 5,585,089), veneering or
resurfacing (EP 592,106; EP 519,596; Padlan, Molecular Immunology
28(4/5):489-498 (1991); Studnicka et al., Protein Engineering
7(6):805-814 (1994); Roguska. et al., PNAS 91:969-973 (1994)), and
chain shuffling (U.S. Pat. No. 5,565,332).
[0377] Completely human antibodies are particularly desirable for
therapeutic treatment of human patients. Human antibodies can be
made by a variety of methods known in the art including phage
display methods described above using antibody libraries derived
from human immunoglobulin sequences. See also, U.S. Pat. Nos.
4,444,887 and 4,716,111; and PCT publications WO 98/46645, WO
98/50433, WO 98/24893, WO 98/16654, WO 96/34096, WO 96/33735, and
WO 91/10741; each of which is incorporated herein by reference in
its entirety.
[0378] Human antibodies can also be produced using transgenic mice
which are incapable of expressing functional endogenous
immunoglobulins, but which can express human immunoglobulin genes.
For example, the human heavy and light chain immunoglobulin gene
complexes may be introduced randomly or by homologous recombination
into mouse embryonic stem cells. Alternatively, the human variable
region, constant region, and diversity region may be introduced
into mouse embryonic stem cells in addition to the human heavy and
light chain genes. The mouse heavy and light chain immunoglobulin
genes may be rendered non-functional separately or simultaneously
with the introduction of human immunoglobulin loci by homologous
recombination. In particular, homozygous deletion of the JH region
prevents endogenous antibody production. The modified embryonic
stem cells are expanded and microinjected into blastocysts to
produce chimeric mice. The chimeric mice are then bred to produce
homozygous offspring which express human antibodies. The transgenic
mice are immunized in the normal fashion with a selected antigen,
e.g., all or a portion of a polypeptide of the invention.
Monoclonal antibodies directed against the antigen can be obtained
from the immunized, transgenic mice using conventional hybridoma
technology. The human immunoglobulin transgenes harbored by the
transgenic mice rearrange during B cell differentiation, and
subsequently undergo class switching and somatic mutation. Thus,
using such a technique, it is possible to produce therapeutically
useful IgG, IgA, IgM and IgE antibodies. For an overview of this
technology for producing human antibodies, see Lonberg and Huszar,
Int. Rev. Immunol. 13:65-93 (1995). For a detailed discussion of
this technology for producing human antibodies and human monoclonal
antibodies and protocols for producing such antibodies, see, e.g.,
PCT publications WO 98/24893; WO 92/01047; WO 96/34096; WO
96/33735; European Patent No. 0 598 877; U.S. Pat. Nos. 5,413,923;
5,625,126; 5,633,425; 5,569,825; 5,661,016; 5,545,806; 5,814,318;
5,885,793; 5,916,771; 5,939,598; 6,075,181; and 6,114,598, which
are incorporated by reference herein in their entirety. In
addition, companies such as Abgenix, Inc. (Freemont, Calif.) and
Genpharm (San Jose, Calif.) can be engaged to provide human
antibodies directed against a selected antigen using technology
similar to that described above.
[0379] Completely human antibodies which recognize a selected
epitope can be generated using a technique referred to as "guided
selection." In this approach a selected non-human monoclonal
antibody, e.g., a mouse antibody, is used to guide the selection of
a completely human antibody recognizing the same epitope. (Jespers
et al., Bio/technology 12:899-903 (1988)).
[0380] Further, antibodies to the polypeptides of the invention
can, in turn, be utilized to generate anti-idiotype antibodies that
"mimic" polypeptides of the invention using techniques well known
to those skilled in the art. (See, e.g., Greenspan & Bona,
FASEB J. 7(5):437-444; (1989) and Nissinoff, J. Immunol.
147(8):2429-2438 (1991)). For example, antibodies which bind to and
competitively inhibit polypeptide multimerization and/or binding of
a polypeptide of the invention to a ligand can be used to generate
anti-idiotypes that "mimic" the polypeptide multimerization and/or
binding domain and, as a consequence, bind to and neutralize
polypeptide and/or its ligand. Such neutralizing anti-idiotypes or
Fab fragments of such anti-idiotypes can be used in therapeutic
regimens to neutralize polypeptide ligand(s)/receptor(s). For
example, such anti-idiotypic antibodies can be used to bind a
polypeptide of the invention and/or to bind its
ligand(s)/receptor(s), and thereby block its biological activity.
Alternatively, antibodies which bind to and enhance polypeptide
multimerization and/or binding, and/or receptor/ligand
multimerization, binding and/or signaling can be used to generate
anti-idiotypes that function as agonists of a polypeptide of the
invention and/or its ligand/receptor. Such agonistic anti-idiotypes
or Fab fragments of such anti-idiotypes can be used in therapeutic
regimens as agonists of the polypeptides of the invention or its
ligand(s)/receptor(s). For example, such anti-idiotypic antibodies
can be used to bind a polypeptide of the invention and/or to bind
its ligand(s)/receptor(s), and thereby promote or enhance its
biological activity.
[0381] Intrabodies of the invention can be produced using methods
known in the art, such as those disclosed and reviewed in Chen et
al., Hum. Gene Ther. 5:595-601 (1994); Marasco, W. A., Gene Ther.
4:11-15 (1997); Rondon and Marasco, Annu. Rev. Microbiol.
51:257-283 (1997); Proba et al., J. Mol. Biol. 275:245-253 (1998);
Cohen et al., Oncogene 17:2445-2456 (1998); Ohage and Steipe, J.
Mol. Biol. 291:1119-1128 (1999); Ohage et al., J. Mol. Biol.
291:1129-1134 (1999); Wirtz and Steipe, Protein Sci. 8:2245-2250
(1999); Zhu et al., J. Immunol. Methods 231:207-222 (1999); and
references cited therein.
Polynucleotides Encoding Antibodies
[0382] The invention further provides polynucleotides comprising a
nucleotide sequence encoding an antibody of the invention and
fragments thereof. The invention also encompasses polynucleotides
that hybridize under stringent or alternatively, under lower
stringency hybridization conditions, e.g., as defined supra, to
polynucleotides that encode an antibody, preferably, that
specifically binds to a polypeptide of the invention, preferably,
an antibody that binds to a polypeptide having the amino acid
sequence of SEQ ID NO:Y, to a polypeptide encoded by a portion of
SEQ ID NO:X as defined in columns 8 and 9 of Table 2, and/or to a
polypeptide encoded by the cDNA contained in ATCC Deposit No:
Z.
[0383] The polynucleotides may be obtained, and the nucleotide
sequence of the polynucleotides determined, by any method known in
the art. For example, if the nucleotide sequence of the antibody is
known, a polynucleotide encoding the antibody may be assembled from
chemically synthesized oligonucleotides (e.g., as described in
Kutmeier et al., BioTechniques 17:242 (1994)), which, briefly,
involves the synthesis of overlapping oligonucleotides containing
portions of the sequence encoding the antibody, annealing and
ligating of those oligonucleotides, and then amplification of the
ligated oligonucleotides by PCR.
[0384] Alternatively, a polynucleotide encoding an antibody may be
generated from nucleic acid from a suitable source. If a clone
containing a nucleic acid encoding a particular antibody is not
available, but the sequence of the antibody molecule is known, a
nucleic acid encoding the immunoglobulin may be chemically
synthesized or obtained from a suitable source (e.g., an antibody
cDNA library, or a cDNA library generated from, or nucleic acid,
preferably poly A+ RNA, isolated from, any tissue or cells
expressing the antibody, such as hybridoma cells selected to
express an antibody of the invention) by PCR amplification using
synthetic primers hybridizable to the 3' and 5' ends of the
sequence or by cloning using an oligonucleotide probe specific for
the particular gene sequence to identify, e.g., a cDNA clone from a
cDNA library that encodes the antibody. Amplified nucleic acids
generated by PCR may then be cloned into replicable cloning vectors
using any method well known in the art.
[0385] Once the nucleotide sequence and corresponding amino acid
sequence of the antibody is determined, the nucleotide sequence of
the antibody may be manipulated using methods well known in the art
for the manipulation of nucleotide sequences, e.g., recombinant DNA
techniques, site directed mutagenesis, PCR, etc. (see, for example,
the techniques described in Sambrook et al., 1990, Molecular
Cloning, A Laboratory Manual, 2d Ed., Cold Spring Harbor
Laboratory, Cold Spring Harbor, N.Y. and Ausubel et al., eds.,
1998, Current Protocols in Molecular Biology, John Wiley &
Sons, NY, which are both incorporated by reference herein in their
entireties), to generate antibodies having a different amino acid
sequence, for example to create amino acid substitutions,
deletions, and/or insertions.
[0386] In a specific embodiment, the amino acid sequence of the
heavy and/or light chain variable domains may be inspected to
identify the sequences of the complementarity determining regions
(CDRs) by methods that are well know in the art, e.g., by
comparison to known amino acid sequences of other heavy and light
chain variable regions to determine the regions of sequence
hypervariability. Using routine recombinant DNA techniques, one or
more of the CDRs may be inserted within framework regions, e.g.,
into human framework regions to humanize a non-human antibody, as
described supra. The framework regions may be naturally occurring
or consensus framework regions, and preferably human framework
regions (see, e.g., Chothia et al., J. Mol. Biol. 278: 457-479
(1998) for a listing of human framework regions). Preferably, the
polynucleotide generated by the combination of the framework
regions and CDRs encodes an antibody that specifically binds a
polypeptide of the invention. Preferably, as discussed supra, one
or more amino acid substitutions may be made within the framework
regions, and, preferably, the amino acid substitutions improve
binding of the antibody to its antigen. Additionally, such methods
may be used to make amino acid substitutions or deletions of one or
more variable region cysteine residues participating in an
intrachain disulfide bond to generate antibody molecules lacking
one or more intrachain disulfide bonds. Other alterations to the
polynucleotide are encompassed by the present invention and within
the skill of the art.
[0387] In addition, techniques developed for the production of
"chimeric antibodies" (Morrison et al., Proc. Natl. Acad. Sci.
81:851-855 (1984); Neuberger et al., Nature 312:604-608 (1984);
Takeda et al., Nature 314:452-454 (1985)) by splicing genes from a
mouse antibody molecule of appropriate antigen specificity together
with genes from a human antibody molecule of appropriate biological
activity can be used. As described supra, a chimeric antibody is a
molecule in which different portions are derived from different
animal species, such as those having a variable region derived from
a murine mAb and a human immunoglobulin constant region, e.g.,
humanized antibodies.
[0388] Alternatively, techniques described for the production of
single chain antibodies (U.S. Pat. No. 4,946,778; Bird, Science
242:423-42 (1988); Huston et al., Proc. Natl. Acad. Sci. USA
85:5879-5883 (1988); and Ward et al., Nature 334:544-54 (1989)) can
be adapted to produce single chain antibodies. Single chain
antibodies are formed by linking the heavy and light chain
fragments of the Fv region via an amino acid bridge, resulting in a
single chain polypeptide. Techniques for the assembly of functional
Fv fragments in E. coli may also be used (Skerra et al., Science
242:1038-1041 (1988)).
Methods of Producing Antibodies
[0389] The antibodies of the invention can be produced by any
method known in the art for the synthesis of antibodies, in
particular, by chemical synthesis or preferably, by recombinant
expression techniques. Methods of producing antibodies include, but
are not limited to, hybridoma technology, EBV transformation, and
other methods discussed herein as well as through the use
recombinant DNA technology, as discussed below.
[0390] Recombinant expression of an antibody of the invention, or
fragment, derivative or analog thereof, (e.g., a heavy or light
chain of an antibody of the invention or a single chain antibody of
the invention), requires construction of an expression vector
containing a polynucleotide that encodes the antibody. Once a
polynucleotide encoding an antibody molecule or a heavy or light
chain of an antibody, or portion thereof (preferably containing the
heavy or light chain variable domain), of the invention has been
obtained, the vector for the production of the antibody molecule
may be produced by recombinant DNA technology using techniques well
known in the art. Thus, methods for preparing a protein by
expressing a polynucleotide containing an antibody encoding
nucleotide sequence are described herein. Methods which are well
known to those skilled in the art can be used to construct
expression vectors containing antibody coding sequences and
appropriate transcriptional and translational control signals.
These methods include, for example, in vitro recombinant DNA
techniques, synthetic techniques, and in vivo genetic
recombination. The invention, thus, provides replicable vectors
comprising a nucleotide sequence encoding an antibody molecule of
the invention, or a heavy or light chain thereof, or a heavy or
light chain variable domain, operably linked to a promoter. Such
vectors may include the nucleotide sequence encoding the constant
region of the antibody molecule (see, e.g., PCT Publication WO
86/05807; PCT Publication WO 89/01036; and U.S. Pat. No. 5,122,464)
and the variable domain of the antibody may be cloned into such a
vector for expression of the entire heavy or light chain.
[0391] The expression vector is transferred to a host cell by
conventional techniques and the transfected cells are then cultured
by conventional techniques to produce an antibody of the invention.
Thus, the invention includes host cells containing a polynucleotide
encoding an antibody of the invention, or a heavy or light chain
thereof, or a single chain antibody of the invention, operably
linked to a heterologous promoter. In preferred embodiments for the
expression of double-chained antibodies, vectors encoding both the
heavy and light chains may be co-expressed in the host cell for
expression of the entire immunoglobulin molecule, as detailed
below.
[0392] A variety of host-expression vector systems may be utilized
to express the antibody molecules of the invention. Such
host-expression systems represent vehicles by which the coding
sequences of interest may be produced and subsequently purified,
but also represent cells which may, when transformed or transfected
with the appropriate nucleotide coding sequences, express an
antibody molecule of the invention in situ. These include but are
not limited to microorganisms such as bacteria (e.g., E. coli, B.
subtilis) transformed with recombinant bacteriophage DNA, plasmid
DNA or cosmid DNA expression vectors containing antibody coding
sequences; yeast (e.g., Saccharomyces, Pichia) transformed with
recombinant yeast expression vectors containing antibody coding
sequences; insect cell systems infected with recombinant virus
expression vectors (e.g., baculovirus) containing antibody coding
sequences; plant cell systems infected with recombinant virus
expression vectors (e.g., cauliflower mosaic virus, CaMV; tobacco
mosaic virus, TMV) or transformed with recombinant plasmid
expression vectors (e.g., Ti plasmid) containing antibody coding
sequences; or mammalian cell systems (e.g., COS, CHO, BHK, 293, 3T3
cells) harboring recombinant expression constructs containing
promoters derived from the genome of mammalian cells (e.g.,
metallothionein promoter) or from mammalian viruses (e.g., the
adenovirus late promoter; the vaccinia virus 7.5K promoter).
Preferably, bacterial cells such as Escherichia coli, and more
preferably, eukaryotic cells, especially for the expression of
whole recombinant antibody molecule, are used for the expression of
a recombinant antibody molecule. For example, mammalian cells such
as Chinese hamster ovary cells (CHO), in conjunction with a vector
such as the major intermediate early gene promoter element from
human cytomegalovirus is an effective expression system for
antibodies (Foecking et al., Gene 45:101 (1986); Cockett et al.,
Bio/Technology 8:2 (1990)).
[0393] In bacterial systems, a number of expression vectors may be
advantageously selected depending upon the use intended for the
antibody molecule being expressed. For example, when a large
quantity of such a protein is to be produced, for the generation of
pharmaceutical compositions of an antibody molecule, vectors which
direct the expression of high levels of fusion protein products
that are readily purified may be desirable. Such vectors include,
but are not limited, to the E. coli expression vector pUR278
(Ruther et al., EMBO J. 2:1791 (1983)), in which the antibody
coding sequence may be ligated individually into the vector in
frame with the lac Z coding region so that a fusion protein is
produced; pIN vectors (Inouye & Inouye, Nucleic Acids Res.
13:3101-3109 (1985); Van Heeke & Schuster, J. Biol. Chem.
24:5503-5509 (1989)); and the like. pGEX vectors may also be used
to express foreign polypeptides as fusion proteins with glutathione
S-transferase (GST). In general, such fusion proteins are soluble
and can easily be purified from lysed cells by adsorption and
binding to matrix glutathione-agarose beads followed by elution in
the presence of free glutathione. The pGEX vectors are designed to
include thrombin or factor Xa protease cleavage sites so that the
cloned target gene product can be released from the GST moiety.
[0394] In an insect system, Autographa californica nuclear
polyhedrosis virus (AcNPV) is used as a vector to express foreign
genes. The virus grows in Spodoptera frugiperda cells. The antibody
coding sequence may be cloned individually into non-essential
regions (for example the polyhedrin gene) of the virus and placed
under control of an AcNPV promoter (for example the polyhedrin
promoter).
[0395] In mammalian host cells, a number of viral-based expression
systems may be utilized. In cases where an adenovirus is used as an
expression vector, the antibody coding sequence of interest may be
ligated to an adenovirus transcription/translation control complex,
e.g., the late promoter and tripartite leader sequence. This
chimeric gene may then be inserted in the adenovirus genome by in
vitro or in vivo recombination. Insertion in a non-essential region
of the viral genome (e.g., region E1 or E3) will result in a
recombinant virus that is viable and capable of expressing the
antibody molecule in infected hosts. (e.g., see Logan & Shenk,
Proc. Natl. Acad. Sci. USA 81:355-359 (1984)). Specific initiation
signals may also be required for efficient translation of inserted
antibody coding sequences. These signals include the ATG initiation
codon and adjacent sequences. Furthermore, the initiation codon
must be in phase with the reading frame of the desired coding
sequence to ensure translation of the entire insert. These
exogenous translational control signals and initiation codons can
be of a variety of origins, both natural and synthetic. The
efficiency of expression may be enhanced by the inclusion of
appropriate transcription enhancer elements, transcription
terminators, etc. (see Bittner et al., Methods in Enzymol.
153:51-544 (1987)).
[0396] In addition, a host cell strain may be chosen which
modulates the expression of the inserted sequences, or modifies and
processes the gene product in the specific fashion desired. Such
modifications (e.g., glycosylation) and processing (e.g., cleavage)
of protein products may be important for the function of the
protein. Different host cells have characteristic and specific
mechanisms for the post-translational processing and modification
of proteins and gene products. Appropriate cell lines or host
systems can be chosen to ensure the correct modification and
processing of the foreign protein expressed. To this end,
eukaryotic host cells which possess the cellular machinery for
proper processing of the primary transcript, glycosylation, and
phosphorylation of the gene product may be used. Such mammalian
host cells include but are not limited to CHO, VERY, BHK, Hela,
COS, MDCK, 293, 3T3, WI38, and in particular, breast cancer cell
lines such as, for example, BT483, Hs578T, HTB2, BT20 and T47D, and
normal mammary gland cell line such as, for example, CRL7030 and
Hs578Bst.
[0397] For long-term, high-yield production of recombinant
proteins, stable expression is preferred. For example, cell lines
which stably express the antibody molecule may be engineered.
Rather than using expression vectors which contain viral origins of
replication, host cells can be transformed with DNA controlled by
appropriate expression control elements (e.g., promoter, enhancer,
sequences, transcription terminators, polyadenylation sites, etc.),
and a selectable marker. Following the introduction of the foreign
DNA, engineered cells may be allowed to grow for 1-2 days in an
enriched media, and then are switched to a selective media. The
selectable marker in the recombinant plasmid confers resistance to
the selection and allows cells to stably integrate the plasmid into
their chromosomes and grow to form foci which in turn can be cloned
and expanded into cell lines. This method may advantageously be
used to engineer cell lines which express the antibody molecule.
Such engineered cell lines may be particularly useful in screening
and evaluation of compounds that interact directly or indirectly
with the antibody molecule.
[0398] A number of selection systems may be used, including but not
limited to the herpes simplex virus thymidine kinase (Wigler et
al., Cell 11:223 (1977)), hypoxanthine-guanine
phosphoribosyltransferase (Szybalska & Szybalski, Proc. Natl.
Acad. Sci. USA 48:202 (1992)), and adenine
phosphoribosyltransferase (Lowy et al., Cell 22:817 (1980)) genes
can be employed in tk-, hgprt- or aprt-cells, respectively. Also,
antimetabolite resistance can be used as the basis of selection for
the following genes: dhfr, which confers resistance to methotrexate
(Wigler et al., Natl. Acad. Sci. USA 77:357 (1980); O'Hare et al.,
Proc. Natl. Acad. Sci. USA 78:1527 (1981)); gpt, which confers
resistance to mycophenolic acid (Mulligan & Berg, Proc. Natl.
Acad. Sci. USA 78:2072 (1981)); neo, which confers resistance to
the aminoglycoside G-418 Clinical Pharmacy 12:488-505; Wu and Wu,
Biotherapy 3:87-95 (1991); Tolstoshev, Ann. Rev. Pharmacol.
Toxicol. 32:573-596 (1993); Mulligan, Science 260:926-932 (1993);
and Morgan and Anderson, Ann. Rev. Biochem. 62:191-217 (1993); May,
1993, TIB TECH 11(5):155-215 (1993)); and hygro, which confers
resistance to hygromycin (Santerre et al., Gene 30:147 (1984)).
Methods commonly known in the art of recombinant DNA technology may
be routinely applied to select the desired recombinant clone, and
such methods are described, for example, in Ausubel et al. (eds.),
Current Protocols in Molecular Biology, John Wiley & Sons, NY
(1993); Kriegler, Gene Transfer and Expression, A Laboratory
Manual, Stockton Press, NY (1990); and in Chapters 12 and 13,
Dracopoli et al. (eds), Current Protocols in Human Genetics, John
Wiley & Sons, NY (1994); Colberre-Garapin et al., J. Mol. Biol.
150:1 (1981), which are incorporated by reference herein in their
entireties.
[0399] The expression levels of an antibody molecule can be
increased by vector amplification (for a review, see Bebbington and
Hentschel, The use of vectors based on gene amplification for the
expression of cloned genes in mammalian cells in DNA cloning, Vol.
3. (Academic Press, New York, 1987)). When a marker in the vector
system expressing antibody is amplifiable, increase in the level of
inhibitor present in culture of host cell will increase the number
of copies of the marker gene. Since the amplified region is
associated with the antibody gene, production of the antibody will
also increase (Crouse et al., Mol. Cell. Biol. 3:257 (1983)).
[0400] Vectors which use glutamine synthase (GS) or DHFR as the
selectable markers can be amplified in the presence of the drugs
methionine sulphoximine or methotrexate, respectively. An advantage
of glutamine synthase based vectors are the availability of cell
lines (e.g., the murine myeloma cell line, NS0) which are glutamine
synthase negative. Glutamine synthase expression systems can also
function in glutamine synthase expressing cells (e.g. Chinese
Hamster Ovary (CHO) cells) by providing additional inhibitor to
prevent the functioning of the endogenous gene. A glutamine
synthase expression system and components thereof are detailed in
PCT publications: WO87/04462; WO86/05807; WO89/01036; WO89/10404;
and WO91/06657 which are incorporated in their entireties by
reference herein. Additionally, glutamine synthase expression
vectors that may be used according to the present invention are
commercially available from suplliers, including, for example Lonza
Biologics, Inc. (Portsmouth, N.H.). Expression and production of
monoclonal antibodies using a GS expression system in murine
myeloma cells is described in Bebbington et al., Bio/technology
10:169(1992) and in Biblia and Robinson Biotechnol. Prog. 11:1
(1995) which are incorporated in their entirities by reference
herein.
[0401] The host cell may be co-transfected with two expression
vectors of the invention, the first vector encoding a heavy chain
derived polypeptide and the second vector encoding a light chain
derived polypeptide. The two vectors may contain identical
selectable markers which enable equal expression of heavy and light
chain polypeptides. Alternatively, a single vector may be used
which encodes, and is capable of expressing, both heavy and light
chain polypeptides. In such situations, the light chain should be
placed before the heavy chain to avoid an excess of toxic free
heavy chain (Proudfoot, Nature 322:52 (1986); Kohler, Proc. Natl.
Acad. Sci. USA 77:2197 (1980)). The coding sequences for the heavy
and light chains may comprise cDNA or genomic DNA.
[0402] Once an antibody molecule of the invention has been produced
by an animal, chemically synthesized, or recombinantly expressed,
it may be purified by any method known in the art for purification
of an immunoglobulin molecule, for example, by chromatography
(e.g., ion exchange, affinity, particularly by affinity for the
specific antigen after Protein A, and sizing column
chromatography), centrifugation, differential solubility, or by any
other standard technique for the purification of proteins. In
addition, the antibodies of the present invention or fragments
thereof can be fused to heterologous polypeptide sequences
described herein or otherwise known in the art, to facilitate
purification.
[0403] The present invention encompasses antibodies recombinantly
fused or chemically conjugated (including both covalently and
non-covalently conjugations) to a polypeptide (or portion thereof,
preferably at least 10, 20, 30, 40, 50, 60, 70, 80, 90 or 100 amino
acids of the polypeptide) of the present invention to generate
fusion proteins. The fusion does not necessarily need to be direct,
but may occur through linker sequences. The antibodies may be
specific for antigens other than polypeptides (or portion thereof,
preferably at least 10, 20, 30, 40, 50, 60, 70, 80, 90 or 100 amino
acids of the polypeptide) of the present invention. For example,
antibodies may be used to target the polypeptides of the present
invention to particular cell types, either in vitro or in vivo, by
fusing or conjugating the polypeptides of the present invention to
antibodies specific for particular cell surface receptors.
Antibodies fused or conjugated to the polypeptides of the present
invention may also be used in in vitro immunoassays and
purification methods using methods known in the art. See e.g.,
Harbor et al., supra, and PCT publication WO 93/21232; EP 439,095;
Naramura et al., Immunol. Lett. 39:91-99 (1994); U.S. Pat. No.
5,474,981; Gillies et al., PNAS 89:1428-1432 (1992); Fell et al.,
J. Immunol. 146:2446-2452 (1991), which are incorporated by
reference in their entireties.
[0404] The present invention further includes compositions
comprising the polypeptides of the present invention fused or
conjugated to antibody domains other than the variable regions. For
example, the polypeptides of the present invention may be fused or
conjugated to an antibody Fc region, or portion thereof. The
antibody portion fused to a polypeptide of the present invention
may comprise the constant region, hinge region, CH1 domain, CH2
domain, and CH3 domain or any combination of whole domains or
portions thereof. The polypeptides may also be fused or conjugated
to the above antibody portions to form multimers. For example, Fc
portions fused to the polypeptides of the present invention can
form dimers through disulfide bonding between the Fc portions.
Higher multimeric forms can be made by fusing the polypeptides to
portions of IgA and IgM. Methods for fusing or conjugating the
polypeptides of the present invention to antibody portions are
known in the art. See, e.g., U.S. Pat. Nos. 5,336,603; 5,622,929;
5,359,046; 5,349,053; 5,447,851; 5,112,946; EP 307,434; EP 367,166;
PCT publications WO 96/04388; WO 91/06570; Ashkenazi et al., Proc.
Natl. Acad. Sci. USA 88:10535-10539 (1991); Zheng et al., J.
Immunol. 154:5590-5600 (1995); and Vil et al., Proc. Natl. Acad.
Sci. USA 89:11337-11341 (1992) (said references incorporated by
reference in their entireties).
[0405] As discussed, supra, the polypeptides corresponding to a
polypeptide, polypeptide fragment, or a variant of SEQ ID NO:Y may
be fused or conjugated to the above antibody portions to increase
the in vivo half life of the polypeptides or for use in
immunoassays using methods known in the art. Further, the
polypeptides corresponding to SEQ ID NO:Y may be fused or
conjugated to the above antibody portions to facilitate
purification. One reported example describes chimeric proteins
consisting of the first two domains of the human CD4-polypeptide
and various domains of the constant regions of the heavy or light
chains of mammalian immunoglobulins. See EP 394,827; and Traunecker
et al., Nature 331:84-86 (1988). The polypeptides of the present
invention fused or conjugated to an antibody having
disulfide-linked dimeric structures (due to the IgG) may also be
more efficient in binding and neutralizing other molecules, than
the monomeric secreted protein or protein fragment alone. See, for
example, Fountoulakis et al., J. Biochem. 270:3958-3964 (1995). In
many cases, the Fc part in a fusion protein is beneficial in
therapy and diagnosis, and thus can result in, for example,
improved pharmacokinetic properties. See, for example, EP A
232,262. Alternatively, deleting the Fc part after the fusion
protein has been expressed, detected, and purified, would be
desired. For example, the Fc portion may hinder therapy and
diagnosis if the fusion protein is used as an antigen for
immunizations. In drug discovery, for example, human proteins, such
as hIL-5, have been fused with Fc portions for the purpose of
high-throughput screening assays to identify antagonists of hIL-5.
(See, Bennett et al., J. Molecular Recognition 8:52-58 (1995);
Johanson et al., J. Biol. Chem. 270:9459-9471 (1995)).
[0406] Moreover, the antibodies or fragments thereof of the present
invention can be fused to marker sequences, such as a peptide to
facilitate purification. In preferred embodiments, the marker amino
acid sequence is a hexa-histidine peptide, such as the tag provided
in a pQE vector (QIAGEN, Inc., 9259 Eton Avenue, Chatsworth,
Calif., 91311), among others, many of which are commercially
available. As described in Gentz et al., Proc. Natl. Acad. Sci. USA
86:821-824 (1989), for instance, hexa-histidine provides for
convenient purification of the fusion protein. Other peptide tags
useful for purification include, but are not limited to, the "HA"
tag, which corresponds to an epitope derived from the influenza
hemagglutinin protein (Wilson et al., Cell 37:767 (1984)) and the
"flag" tag.
[0407] The present invention further encompasses antibodies or
fragments thereof conjugated to a diagnostic or therapeutic agent.
The antibodies can be used diagnostically to, for example, monitor
the development or progression of a tumor as part of a clinical
testing procedure to, e.g., determine the efficacy of a given
treatment regimen. Detection can be facilitated by coupling the
antibody to a detectable substance. Examples of detectable
substances include various enzymes, prosthetic groups, fluorescent
materials, luminescent materials, bioluminescent materials,
radioactive materials, positron emitting metals using various
positron emission tomographies, and nonradioactive paramagnetic
metal ions. The detectable substance may be coupled or conjugated
either directly to the antibody (or fragment thereof) or
indirectly, through an intermediate (such as, for example, a linker
known in the art) using techniques known in the art. See, for
example, U.S. Pat. No. 4,741,900 for metal ions which can be
conjugated to antibodies for use as diagnostics according to the
present invention. Examples of suitable enzymes include horseradish
peroxidase, alkaline phosphatase, beta-galactosidase, or
acetylcholinesterase; examples of suitable prosthetic group
complexes include streptavidin/biotin and avidin/biotin; examples
of suitable fluorescent materials include umbelliferone,
fluorescein, fluorescein isothiocyanate, rhodamine,
dichlorotriazinylamine fluorescein, dansyl chloride or
phycoerythrin; an example of a luminescent material includes
luminol; examples of bioluminescent materials include luciferase,
luciferin, and aequorin; and examples of suitable radioactive
material include 125I, 131I, 111In or 99Tc.
[0408] Further, an antibody or fragment thereof may be conjugated
to a therapeutic moiety such as a cytotoxin, e.g., a cytostatic or
cytocidal agent, a therapeutic agent or a radioactive metal ion,
e.g., alpha-emitters such as, for example, 213Bi. A cytotoxin or
cytotoxic agent includes any agent that is detrimental to cells.
Examples include paclitaxol, cytochalasin B, gramicidin D, ethidium
bromide, emetine, mitomycin, etoposide, tenoposide, vincristine,
vinblastine, colchicin, doxorubicin, daunorubicin, dihydroxy
anthracin dione, mitoxantrone, mithramycin, actinomycin D,
1-dehydrotestosterone, glucocorticoids, procaine, tetracaine,
lidocaine, propranolol, and puromycin and analogs or homologs
thereof. Therapeutic agents include, but are not limited to,
antimetabolites (e.g., methotrexate, 6-mercaptopurine,
6-thioguanine, cytarabine, 5-fluorouracil decarbazine), alkylating
agents (e.g., mechlorethamine, thioepa chlorambucil, melphalan,
carmustine (BSNU) and lomustine (CCNU), cyclothosphamide, busulfan,
dibromomannitol, streptozotocin, mitomycin C, and
cis-dichlorodiamine platinum (II) (DDP) cisplatin), anthracyclines
(e.g., daunorubicin (formerly daunomycin) and doxorubicin),
antibiotics (e.g., dactinomycin (formerly actinomycin), bleomycin,
mithramycin, and anthramycin (AMC)), and anti-mitotic agents (e.g.,
vincristine and vinblastine).
[0409] The conjugates of the invention can be used for modifying a
given biological response, the therapeutic agent or drug moiety is
not to be construed as limited to classical chemical therapeutic
agents. For example, the drug moiety may be a protein or
polypeptide possessing a desired biological activity. Such proteins
may include, for example, a toxin such as abrin, ricin A,
pseudomonas exotoxin, or diphtheria toxin; a protein such as tumor
necrosis factor, a-interferon, .beta.-interferon, nerve growth
factor, platelet derived growth factor, tissue plasminogen
activator, an apoptotic agent, e.g., TNF-alpha, TNF-beta, AIM I
(See, International Publication No. WO 97/33899), AIM II (See,
International Publication No. WO 97/34911), Fas Ligand (Takahashi
et al., Int. Immunol., 6:1567-1574 (1994)), VEGI (See,
International Publication No. WO 99/23105), a thrombotic agent or
an anti-angiogenic agent, e.g., angiostatin or endostatin; or,
biological response modifiers such as, for example, lymphokines,
interleukin-1 ("IL-1"), interleukin-2 ("IL-2"), interleukin-6
("IL-6"), granulocyte macrophage colony stimulating factor
("GM-CSF"), granulocyte colony stimulating factor ("G-CSF"), or
other growth factors.
[0410] Antibodies may also be attached to solid supports, which are
particularly useful for immunoassays or purification of the target
antigen. Such solid supports include, but are not limited to,
glass, cellulose, polyacrylamide, nylon, polystyrene, polyvinyl
chloride or polypropylene.
[0411] Techniques for conjugating such therapeutic moiety to
antibodies are well known. See, for example, Arnon et al.,
"Monoclonal Antibodies For Immunotargeting Of Drugs In Cancer
Therapy", in Monoclonal Antibodies And Cancer Therapy, Reisfeld et
al. (eds.), pp. 243-56 (Alan R. Liss, Inc. 1985); Hellstrom et al.,
"Antibodies For Drug Delivery", in Controlled Drug Delivery (2nd
Ed.), Robinson et al. (eds.), pp. 623-53 (Marcel Dekker, Inc.
1987); Thorpe, "Antibody Carriers Of Cytotoxic Agents In Cancer
Therapy: A Review", in Monoclonal Antibodies '84: Biological And
Clinical Applications, Pinchera et al. (eds.), pp. 475-506 (1985);
"Analysis, Results, And Future Prospective Of The Therapeutic Use
Of Radiolabeled Antibody In Cancer Therapy", in Monoclonal
Antibodies For Cancer Detection And Therapy, Baldwin et al. (eds.),
pp. 303-16 (Academic Press 1985), and Thorpe et al., "The
Preparation And Cytotoxic Properties Of Antibody-Toxin Conjugates",
Immunol. Rev. 62:119-58 (1982).
[0412] Alternatively, an antibody can be conjugated to a second
antibody to form an antibody heteroconjugate as described by Segal
in U.S. Pat. No. 4,676,980, which is incorporated herein by
reference in its entirety.
[0413] An antibody, with or without a therapeutic moiety conjugated
to it, administered alone or in combination with cytotoxic
factor(s) and/or cytokine(s) can be used as a therapeutic.
Immunophenotyping
[0414] The antibodies of the invention may be utilized for
immunophenotyping of cell lines and biological samples. Translation
products of the gene of the present invention may be useful as
cell-specific markers, or more specifically as cellular markers
that are differentially expressed at various stages of
differentiation and/or maturation of particular cell types.
Monoclonal antibodies directed against a specific epitope, or
combination of epitopes, will allow for the screening of cellular
populations expressing the marker. Various techniques can be
utilized using monoclonal antibodies to screen for cellular
populations expressing the marker(s), and include magnetic
separation using antibody-coated magnetic beads, "panning" with
antibody attached to a solid matrix (i.e., plate), and flow
cytometry (See, e.g., U.S. Pat. No. 5,985,660; and Morrison et al.,
Cell, 96:737-49 (1999)).
[0415] These techniques allow for the screening of particular
populations of cells, such as might be found with hematological
malignancies (i.e. minimal residual disease (MRD) in acute leukemic
patients) and "non-self" cells in transplantations to prevent
Graft-versus-Host Disease (GVHD). Alternatively, these techniques
allow for the screening of hematopoietic stem and progenitor cells
capable of undergoing proliferation and/or differentiation, as
might be found in human umbilical cord blood.
Assays for Antibody Binding
[0416] The antibodies of the invention may be assayed for
immunospecific binding by any method known in the art. The
immunoassays which can be used include but are not limited to
competitive and non-competitive assay systems using techniques such
as western blots, radioimmunoassays, ELISA (enzyme linked
immunosorbent assay), "sandwich" immunoassays, immunoprecipitation
assays, precipitin reactions, gel diffusion precipitin reactions,
immunodiffusion assays, agglutination assays, complement-fixation
assays, immunoradiometric assays, fluorescent immunoassays, and
protein A immunoassays, to name but a few. Such assays are routine
and well known in the art (see, e.g., Ausubel et al, eds, 1994,
Current Protocols in Molecular Biology, Vol. 1, John Wiley &
Sons, Inc., New York, which is incorporated by reference herein in
its entirety). Exemplary immunoassays are described briefly below
(but are not intended by way of limitation).
[0417] Immunoprecipitation protocols generally comprise lysing a
population of cells in a lysis buffer such as RIPA buffer (1% NP-40
or Triton X-100, 1% sodium deoxycholate, 0.1% SDS, 0.15 M NaCl,
0.01 M sodium phosphate at pH 7.2, 1% Trasylol) supplemented with
protein phosphatase and/or protease inhibitors (e.g., EDTA, PMSF,
aprotinin, sodium vanadate), adding the antibody of interest to the
cell lysate, incubating for a period of time (e.g., 1-4 hours) at
4.degree. C., adding protein A and/or protein G sepharose beads to
the cell lysate, incubating for about an hour or more at 4.degree.
C., washing the beads in lysis buffer and resuspending the beads in
SDS/sample buffer. The ability of the antibody of interest to
immunoprecipitate a particular antigen can be assessed by, e.g.,
western blot analysis. One of skill in the art would be
knowledgeable as to the parameters that can be modified to increase
the binding of the antibody to an antigen and decrease the
background (e.g., pre-clearing the cell lysate with sepharose
beads). For further discussion regarding immunoprecipitation
protocols see, e.g., Ausubel et al., eds., (1994), Current
Protocols in Molecular Biology, Vol. 1, John Wiley & Sons,
Inc., New York, section 10.16.1.
[0418] Western blot analysis generally comprises preparing protein
samples, electrophoresis of the protein samples in a polyacrylamide
gel (e.g., 8%-20% SDS-PAGE depending on the molecular weight of the
antigen), transferring the protein sample from the polyacrylamide
gel to a membrane such as nitrocellulose, PVDF or nylon, blocking
the membrane in blocking solution (e.g., PBS with 3% BSA or non-fat
milk), washing the membrane in washing buffer (e.g., PBS-Tween 20),
blocking the membrane with primary antibody (the antibody of
interest) diluted in blocking buffer, washing the membrane in
washing buffer, blocking the membrane with a secondary antibody
(which recognizes the primary antibody, e.g., an anti-human
antibody) conjugated to an enzymatic substrate (e.g., horseradish
peroxidase or alkaline phosphatase) or radioactive molecule (e.g.,
32P or 125I) diluted in blocking buffer, washing the membrane in
wash buffer, and detecting the presence of the antigen. One of
skill in the art would be knowledgeable as to the parameters that
can be modified to increase the signal detected and to reduce the
background noise. For further discussion regarding western blot
protocols see, e.g., Ausubel et al, eds, (1994), Current Protocols
in Molecular Biology, Vol. 1, John Wiley & Sons, Inc., New
York, section 10.8.1.
[0419] ELISAs comprise preparing antigen, coating the well of a 96
well microtiter plate with the antigen, adding the antibody of
interest conjugated to a detectable compound such as an enzymatic
substrate (e.g., horseradish peroxidase or alkaline phosphatase) to
the well and incubating for a period of time, and detecting the
presence of the antigen. In ELISAs the antibody of interest does
not have to be conjugated to a detectable compound; instead, a
second antibody (which recognizes the antibody of interest)
conjugated to a detectable compound may be added to the well.
Further, instead of coating the well with the antigen, the antibody
may be coated to the well. In this case, a second antibody
conjugated to a detectable compound may be added following the
addition of the antigen of interest to the coated well. One of
skill in the art would be knowledgeable as to the parameters that
can be modified to increase the signal detected as well as other
variations of ELISAs known in the art. For further discussion
regarding ELISAs see, e.g., Ausubel et al, eds, (1994), Current
Protocols in Molecular Biology, Vol. 1, John Wiley & Sons,
Inc., New York, section 11.2.1.
[0420] The binding affinity of an antibody to an antigen and the
off-rate of an antibody-antigen interaction can be determined by
competitive binding assays. One example of a competitive binding
assay is a radioimmunoassay comprising the incubation of labeled
antigen (e.g., 3H or 125I) with the antibody of interest in the
presence of increasing amounts of unlabeled antigen, and the
detection of the antibody bound to the labeled antigen. The
affinity of the antibody of interest for a particular antigen and
the binding off-rates can be determined from the data by scatchard
plot analysis. Competition with a second antibody can also be
determined using radioimmunoassays. In this case, the antigen is
incubated with antibody of interest conjugated to a labeled
compound (e.g., 3H or 125I) in the presence of increasing amounts
of an unlabeled second antibody.
[0421] Antibodies of the invention may be characterized using
immunocytochemisty methods on cells (e.g., mammalian cells, such as
CHO cells) transfected with a vector enabling the expression of an
antigen or with vector alone using techniques commonly known in the
art. Antibodies that bind antigen transfected cells, but not
vector-only transfected cells, are antigen specific.
Therapeutic Uses
[0422] Table 1D: In preferred embodiments, the present invention
encompasses a method of treating a disease or disorder listed in
the "Preferred Indications" column of Table 1D; comprising
administering to a patient in which such treatment, prevention, or
amelioration is desired a protein, nucleic acid, or antibody of the
invention (or fragment or variant thereof) represented by Table 1A
and Table 1D (in the same row as the disease or disorder to be
treated is listed in the "Preferred Indications" column of Table
1D) in an amount effective to treat, prevent, or ameliorate the
disease or disorder.
[0423] As indicated in Table 1D, the polynucleotides, polypeptides,
agonists, or antagonists of the present invention (including
antibodies) can be used in assays to test for one or more
biological activities. If these polynucleotides and polypeptides do
exhibit activity in a particular assay, it is likely that these
molecules may be involved in the diseases associated with the
biological activity. Thus, the polynucleotides or polypeptides, or
agonists or antagonists thereof (including antibodies) could be
used to treat the associated disease.
[0424] The present invention encompasses methods of preventing,
treating, diagnosing, or ameliorating a disease or disorder. In
preferred embodiments, the present invention encompasses a method
of treating a disease or disorder listed in the "Preferred
Indications" column of Table 1D; comprising administering to a
patient in which such treatment, prevention, or amelioration is
desired a protein, nucleic acid, or antibody of the invention (or
fragment or variant thereof) in an amount effective to treat,
prevent, diagnose, or ameliorate the disease or disorder. The first
and seccond columns of Table 1D show the "Gene No." and "cDNA Clone
ID No.", respectively, indicating certain nucleic acids and
proteins (or antibodies against the same) of the invention
(including polynucleotide, polypeptide, and antibody fragments or
variants thereof) that may be used in preventing, treating,
diagnosing, or ameliorating the disease(s) or disorder(s) indicated
in the corresponding row in Column 3 of Table 1D.
[0425] In another embodiment, the present invention also
encompasses methods of preventing, treating, diagnosing, or
ameliorating a disease or disorder listed in the "Preferred
Indications" column of Table 1D; comprising administering to a
patient combinations of the proteins, nucleic acids, or antibodies
of the invention (or fragments or variants thereof), sharing
similar indications as shown in the corresponding rows in Column 3
of Table 1D.
[0426] The "Preferred Indication" column describes diseases,
disorders, and/or conditions that may be treated, prevented,
diagnosed, or ameliorated by a protein, nucleic acid, or antibody
of the invention (or fragment or variant thereof).
[0427] The recitation of "Cancer" in the "Preferred Indication"
column indicates that the corresponding nucleic acid and protein,
or antibody against the same, of the invention (or fragment or
variant thereof) may be used for example, to diagnose, treat,
prevent, and/or ameliorate diseases and/or disorders relating to
neoplastic diseases (e.g., leukemias, cancers, and/or as described
below under "Hyperproliferative Disorders").
[0428] In specific embodiments, a protein, nucleic acid, or
antibody of the invention (or fragment or variant thereof) having a
"Cancer" recitation in the "Preferred Indication" column of Table 1
D may be used for example, to diagnose, treat, prevent, and/or
ameliorate a neoplasm located in a tissue selected from the group
consisting of: colon, abdomen, bone, breast, digestive system,
liver, pancreas, prostate, peritoneum, lung, blood (e.g.,
leukemia), endocrine glands (adrenal, parathyroid, pituitary,
testicles, ovary, thymus, thyroid), uterus, eye, head and neck,
nervous (central and peripheral), lymphatic system, pelvic, skin,
soft tissue, spleen, thoracic, and urogenital.
[0429] In specific embodiments, a protein, nucleic acid, or
antibody of the invention (or fragment or variant thereof) having a
"Cancer" recitation in the "Preferred Indication" column of Table
1D, may be used for example, to diagnose, treat, prevent, and/or
ameliorate a pre-neoplastic condition, selected from the group
consisting of: hyperplasia (e.g., endometrial hyperplasia and/or as
described in the section entitled "Hyperproliferative Disorders"),
metaplasia (e.g., connective tissue metaplasia, atypical
metaplasia, and/or as described in the section entitled
"Hyperproliferative Disorders"), and/or dysplasia (e.g., cervical
dysplasia, and bronchopulmonary dysplasia).
[0430] In another specific embodiment, a protein, nucleic acid, or
antibody of the invention (or fragment or variant thereof) having a
"Cancer" recitation in the "Preferred Indication" column of Table
1D, may be used for example, to diagnose, treat, prevent, and/or
ameliorate a benign dysproliferative disorder selected from the
group consisting of: benign tumors, fibrocystic conditions, tissue
hypertrophy, and/or as described in the section entitled
"Hyperproliferative Disorders".
[0431] The recitation of "Immune/Hematopoietic" in the "Preferred
Indication" column indicates that the corresponding nucleic acid
and protein, or antibody against the same, of the invention (or
fragment or variant thereof), may be used for example, to diagnose,
treat, prevent, and/or ameliorate diseases and/or disorders
relating to neoplastic diseases (e.g., as described below under
"Hyperproliferative Disorders"), blood disorders (e.g., as
described below under "Immune Activity" "Cardiovascular Disorders"
and/or "Blood-Related Disorders"), and infections (e.g., as
described below under "Infectious Disease").
[0432] In specific embodiments, a protein, nucleic acid, or
antibody of the invention (or fragment or variant thereof) having
the "Immune/Hematopoietic" recitation in the "Preferred Indication"
column of Table 1D, may be used for example, to diagnose, treat,
prevent, and/or ameliorate a disease or disorder selected from the
group consisting of: anemia, pancytopenia, leukopenia,
thrombocytopenia, leukemias, Hodgkin's disease, non-Hodgkin's
lymphoma, acute lymphocytic anemia (ALL), plasmacytomas, multiple
myeloma, Burkitt's lymphoma, arthritis, asthma, AIDS, autoimmune
disease, rheumatoid arthritis, granulomatous disease, immune
deficiency, inflammatory bowel disease, sepsis, neutropenia,
neutrophilia, psoriasis, immune reactions to transplanted organs
and tissues, systemic lupus erythematosis, hemophilia,
hypercoagulation, diabetes mellitus, endocarditis, meningitis, Lyme
Disease, and allergies.
[0433] The recitation of "Reproductive" in the "Preferred
Indication" column indicates that the corresponding nucleic acid
and protein, or antibody against the same, of the invention (or
fragment or variant thereof), may be used for example, to diagnose,
treat, prevent, and/or ameliorate diseases and/or disorders
relating to neoplastic diseases (e.g., as described below under
"Hyperproliferative Disorders"), and disorders of the reproductive
system (e.g., as described below under "Reproductive System
Disorders").
[0434] In specific embodiments, a protein, nucleic acid, or
antibody of the invention (or fragment or variant thereof) having a
"Reproductive" recitation in the "Preferred Indication" column of
Table 1D, may be used for example, to diagnose, treat, prevent,
and/or ameliorate a disease or disorder selected from the group
consisting of: cryptorchism, prostatitis, inguinal hernia,
varicocele, leydig cell tumors, verrucous carcinoma, prostatitis,
malacoplakia, Peyronie's disease, penile carcinoma, squamous cell
hyperplasia, dysmenorrhea, ovarian adenocarcinoma, Turner's
syndrome, mucopurulent cervicitis, Sertoli-leydig tumors, ovarian
cancer, uterine cancer, pelvic inflammatory disease, testicular
cancer, prostate cancer, Klinefelter's syndrome, Young's syndrome,
premature ejaculation, diabetes mellitus, cystic fibrosis,
Kartagener's syndrome, testicular atrophy, testicular feminization,
anorchia, ectopic testis, epididymitis, orchitis, gonorrhea,
syphilis, testicular torsion, vasitis nodosa, germ cell tumors,
stromal tumors, dysmenorrhea, retroverted uterus, endometriosis,
fibroids, adenomyosis, anovulatory bleeding, amenorrhea, Cushing's
syndrome, hydatidiform moles, Asherman's syndrome, premature
menopause, precocious puberty, uterine polyps, dysfunctional
uterine bleeding, cervicitis, chronic cervicitis, mucopurulent
cervicitis, cervical dysplasia, cervical polyps, Nabothian cysts,
cervical erosion, cervical incompetence, cervical neoplasms,
pseudohermaphroditism, and premenstrual syndrome.
[0435] The recitation of "Musculoskeletal" in the "Preferred
Indication" column indicates that the corresponding nucleic acid
and protein, or antibody against the same, of the invention (or
fragment or variant thereof), may be used for example, to diagnose,
treat, prevent, and/or ameliorate diseases and/or disorders
relating to neoplastic diseases (e.g., as described below under
"Hyperproliferative Disorders"), and disorders of the immune system
(e.g., as described below under "Immune Activity").
[0436] In specific embodiments, a protein, nucleic acid, or
antibody of the invention (or fragment or variant thereof) having a
"Musculoskeletal" recitation in the "Preferred Indication" column
of Table 1D, may be used for example, to diagnose, treat, prevent,
and/or ameliorate a disease or disorder selected from the group
consisting of: bone cancers (e.g., osteochondromas, benign
chondromas, chondroblastoma, chondromyxoid fibromas, osteoid
osteomas, giant cell tumors, multiple myeloma, osteosarcomas),
Paget's Disease, rheumatoid arthritis, systemic lupus
erythematosus, osteomyelitis, Lyme Disease, gout, bursitis,
tendonitis, osteoporosis, osteoarthritis, muscular dystrophy,
mitochondrial myopathy, cachexia, and multiple sclerosis.
[0437] The recitation of "Cardiovascular" in the "Preferred
Indication" column indicates that the corresponding nucleic acid
and protein, or antibody against the same, of the invention (or
fragment or variant thereof), may be used for example, to diagnose,
treat, prevent, and/or ameliorate diseases and/or disorders
relating to neoplastic diseases (e.g., as described below under
"Hyperproliferative Disorders"), and disorders of the
cardiovascular system (e.g., as described below under
"Cardiovascular Disorders").
[0438] In specific embodiments, a protein, nucleic acid, or
antibody of the invention (or fragment or variant thereof) having a
"Cardiovascular" recitation in the "Preferred Indication" column of
Table 1D, may be used for example, to diagnose, treat, prevent,
and/or ameliorate a disease or disorder selected from the group
consisting of: myxomas, fibromas, rhabdomyomas, cardiovascular
abnormalities (e.g., congenital heart defects, cerebral
arteriovenous malformations, septal defects), heart disease (e.g.,
heart failure, congestive heart disease, arrhythmia, tachycardia,
fibrillation, pericardial Disease, endocarditis), cardiac arrest,
heart valve disease (e.g., stenosis, regurgitation, prolapse),
vascular disease (e.g., hypertension, coronary artery disease,
angina, aneurysm, arteriosclerosis, peripheral vascular disease),
hyponatremia, hypernatremia, hypokalemia, and hyperkalemia.
[0439] The recitation of "Mixed Fetal" in the "Preferred
Indication" column indicates that the corresponding nucleic acid
and protein, or antibody against the same, of the invention (or
fragment or variant thereof), may be used for example, to diagnose,
treat, prevent, and/or ameliorate diseases and/or disorders
relating to neoplastic diseases (e.g., as described below under
"Hyperproliferative Disorders").
[0440] In specific embodiments, a protein, nucleic acid, or
antibody of the invention (or fragment or variant thereof) having a
"Mixed Fetal" recitation in the "Preferred Indication" column of
Table 1D, may be used for example, to diagnose, treat, prevent,
and/or ameliorate a disease or disorder selected from the group
consisting of: spina bifida, hydranencephaly, neurofibromatosis,
fetal alcohol syndrome, diabetes mellitus, PKU, Down's syndrome,
Patau syndrome, Edwards syndrome, Turner syndrome, Apert syndrome,
Carpenter syndrome, Conradi syndrome, Crouzon syndrome, cutis laxa,
Cornelia de Lange syndrome, Ellis-van Creveld syndrome, Holt-Oram
syndrome, Kartagener syndrome, Meckel-Gruber syndrome, Noonan
syndrome, Pallister-Hall syndrome, Rubinstein-Taybi syndrome,
Scimitar syndrome, Smith-Lemli-Opitz syndrome,
thromocytopenia-absent radius (TAR) syndrome, Treacher Collins
syndrome, Williams syndrome, Hirschsprung's disease, Meckel's
diverticulum, polycystic kidney disease, Turner's syndrome, and
gonadal dysgenesis, Klippel-Feil syndrome, Ostogenesis imperfecta,
muscular dystrophy, Tay-Sachs disease, Wilm's tumor, neuroblastoma,
and retinoblastoma.
[0441] The recitation of "Excretory" in the "Preferred Indication"
column indicates that the corresponding nucleic acid and protein,
or antibody against the same, of the invention (or fragment or
variant thereof), may be used for example, to diagnose, treat,
prevent, and/or ameliorate diseases and/or disorders relating to
neoplastic diseases (e.g., as described below under
"Hyperproliferative Disorders") and renal disorders (e.g., as
described below under "Renal Disorders").
[0442] In specific embodiments, a protein, nucleic acid, or
antibody of the invention (or fragment or variant thereof) having a
"Excretory" recitation in the "Preferred Indication" column of
Table 1D, may be used for example, to diagnose, treat, prevent,
and/or ameliorate a disease or disorder selected from the group
consisting of: bladder cancer, prostate cancer, benign prostatic
hyperplasia, bladder disorders (e.g., urinary incontinence, urinary
retention, urinary obstruction, urinary tract Infections,
interstitial cystitis, prostatitis, neurogenic bladder, hematuria),
renal disorders (e.g., hydronephrosis, proteinuria, renal failure,
pyelonephritis, urolithiasis, reflux nephropathy, and unilateral
obstructive uropathy).
[0443] The recitation of "Neural/Sensory" in the "Preferred
Indication" column indicates that the corresponding nucleic acid
and protein, or antibody against the same, of the invention (or
fragment or variant thereof), may be used for example, to diagnose,
treat, prevent, and/or ameliorate diseases and/or disorders
relating to neoplastic diseases (e.g., as described below under
"Hyperproliferative Disorders") and diseases or disorders of the
nervous system (e.g., as described below under "Neural Activity and
Neurological Diseases").
[0444] In specific embodiments, a protein, nucleic acid, or
antibody of the invention (or fragment or variant thereof) having a
"Neural/Sensory" recitation in the "Preferred Indication" column of
Table 1D, may be used for example, to diagnose, treat, prevent,
and/or ameliorate a disease or disorder selected from the group
consisting of: brain cancer (e.g., brain stem glioma, brain tumors,
central nervous system (Primary) lymphoma, central nervous system
lymphoma, cerebellar astrocytoma, and cerebral astrocytoma,
neurodegenerative disorders (e.g., Alzheimer's Disease,
Creutzfeldt-Jakob Disease, Parkinson's Disease, and Idiopathic
Presenile Dementia), encephalomyelitis, cerebral malaria,
meningitis, metabolic brain diseases (e.g., phenylketonuria and
pyruvate carboxylase deficiency), cerebellar ataxia, ataxia
telangiectasia, and AIDS Dementia Complex, schizophrenia, attention
deficit disorder, hyperactive attention deficit disorder, autism,
and obsessive compulsive disorders.
[0445] The recitation of "Respiratory" in the "Preferred
Indication" column indicates that the corresponding nucleic acid
and protein, or antibody against the same, of the invention (or
fragment or variant thereof), may be used for example, to diagnose,
treat, prevent, and/or ameliorate diseases and/or disorders
relating to neoplastic diseases (e.g., as described below under
"Hyperproliferative Disorders") and diseases or disorders of the
respiratory system (e.g., as described below under "Respiratory
Disorders").
[0446] In specific embodiments, a protein, nucleic acid, or
antibody of the invention (or fragment or variant thereof) having a
"Respiratory" recitation in the "Preferred Indication" column of
Table 1D, may be used for example, to diagnose, treat, prevent,
and/or ameliorate a disease or disorder selected from the group
consisting of: cancers of the respiratory system such as larynx
cancer, pharynx cancer, trachea cancer, epiglottis cancer, lung
cancer, squamous cell carcinomas, small cell (oat cell) carcinomas,
large cell carcinomas, and adenocarcinomas. Allergic reactions,
cystic fibrosis, sarcoidosis, histiocytosis X, infiltrative lung
diseases (e.g., pulmonary fibrosis and lymphoid interstitial
pneumonia), obstructive airway diseases (e.g., asthma, emphysema,
chronic or acute bronchitis), occupational lung diseases (e.g.,
silicosis and asbestosis), pneumonia, and pleurisy.
[0447] The recitation of "Endocrine" in the "Preferred Indication"
column indicates that the corresponding nucleic acid and protein,
or antibody against the same, of the invention (or fragment or
variant thereof), may be used for example, to diagnose, treat,
prevent, and/or ameliorate diseases and/or disorders relating to
neoplastic diseases (e.g., as described below under
"Hyperproliferative Disorders") and diseases or disorders of the
respiratory system (e.g., as described below under "Respiratory
Disorders"), renal disorders (e.g., as described below under "Renal
Disorders"), and disorders of the endocrine system (e.g., as
described below under "Endocrine Disorders".
[0448] In specific embodiments, a protein, nucleic acid, or
antibody of the invention (or fragment or variant thereof) having
an "Endocrine" recitation in the "Preferred Indication" column of
Table 1D, may be used for example, to diagnose, treat, prevent,
and/or ameliorate a disease or disorder selected from the group
consisting of: cancers of endocrine tissues and organs (e.g.,
cancers of the hypothalamus, pituitary gland, thyroid gland,
parathyroid glands, pancreas, adrenal glands, ovaries, and testes),
diabetes (e.g., diabetes insipidus, type I and type II diabetes
mellitus), obesity, disorders related to pituitary glands (e.g.,
hyperpituitarism, hypopituitarism, and pituitary dwarfism),
hypothyroidism, hyperthyroidism, goiter, reproductive disorders
(e.g. male and female infertility), disorders related to adrenal
glands (e.g., Addison's Disease, corticosteroid deficiency, and
Cushing's Syndrome), kidney cancer (e.g., hypemephroma,
transitional cell cancer, and Wilm's tumor), diabetic nephropathy,
interstitial nephritis, polycystic kidney disease,
glomerulonephritis (e.g., IgM mesangial proliferative
glomerulonephritis and glomerulonephritis caused by autoimmune
disorders; such as Goodpasture's syndrome), and
nephrocalcinosis.
[0449] The recitation of "Digestive" in the "Preferred Indication"
column indicates that the corresponding nucleic acid and protein,
or antibody against the same, of the invention (or fragment or
variant thereof), may be used for example, to diagnose, treat,
prevent, and/or ameliorate diseases and/or disorders relating to
neoplastic diseases (e.g., as described below under
"Hyperproliferative Disorders") and diseases or disorders of the
gastrointestinal system (e.g., as described below under
"Gastrointestinal Disorders".
[0450] In specific embodiments, a protein, nucleic acid, or
antibody of the invention (or fragment or variant thereof) having a
"Digestive" recitation in the "Preferred Indication" column of
Table 1D, may be used for example, to diagnose, treat, prevent,
and/or ameliorate a disease or disorder selected from the group
consisting of: ulcerative colitis, appendicitis, Crohn's disease,
hepatitis, hepatic encephalopathy, portal hypertension,
cholelithiasis, cancer of the digestive system (e.g., biliary tract
cancer, stomach cancer, colon cancer, gastric cancer, pancreatic
cancer, cancer of the bile duct, tumors of the colon (e.g., polyps
or cancers), and cirrhosis), pancreatitis, ulcerative disease,
pyloric stenosis, gastroenteritis, gastritis, gastric atropy,
benign tumors of the duodenum, distension, irritable bowel
syndrome, malabsorption, congenital disorders of the small
intestine, bacterial and parasitic infection, megacolon,
Hirschsprung's disease, aganglionic megacolon, acquired megacolon,
colitis, anorectal disorders (e.g., anal fistulas, hemorrhoids),
congenital disorders of the liver (e.g., Wilson's disease,
hemochromatosis, cystic fibrosis, biliary atresia, and
alpha1-antitrypsin deficiency), portal hypertension,
cholelithiasis, and jaundice.
[0451] The recitation of "Connective/Epithelial" in the "Preferred
Indication" column indicates that the corresponding nucleic acid
and protein, or antibody against the same, of the invention (or
fragment or variant thereof), may be used for example, to diagnose,
treat, prevent, and/or ameliorate diseases and/or disorders
relating to neoplastic diseases (e.g., as described below under
"Hyperproliferative Disorders"), cellular and genetic abnormalities
(e.g., as described below under "Diseases at the Cellular Level"),
angiogenesis (e.g., as described below under "Anti-Angiogenesis
Activity"), and or to promote or inhibit regeneration (e.g., as
described below under "Regeneration"), and wound healing (e.g., as
described below under "Wound Healing and Epithelial Cell
Proliferation").
[0452] In specific embodiments, a protein, nucleic acid, or
antibody of the invention (or fragment or variant thereof) having a
"Connective/Epithelial" recitation in the "Preferred Indication"
column of Table 1D, may be used for example, to diagnose, treat,
prevent, and/or ameliorate a disease or disorder selected from the
group consisting of: connective tissue metaplasia, mixed connective
tissue disease, focal epithelial hyperplasia, epithelial
metaplasia, mucoepithelial dysplasia, graft v. host disease,
polymyositis, cystic hyperplasia, cerebral dysplasia, tissue
hypertrophy, Alzheimer's disease, lymphoproliferative disorder,
Waldenstron's macroglobulinemia, Crohn's disease, pernicious
anemia, idiopathic Addison's disease, glomerulonephritis, bullous
pemphigoid, Sjogren's syndrome, diabetes mellitus, cystic fibrosis,
osteoblastoma, osteoclastoma, osteosarcoma, chondrosarcoma,
osteoporosis, osteocarthritis, periodontal disease, wound healing,
relapsing polychondritis, vasculitis, polyarteritis nodosa,
Wegener's granulomatosis, cellulitis, rheumatoid arthritis,
psoriatic arthritis, discoid lupus erythematosus, systemic lupus
erythematosus, scleroderma, CREST syndrome, Sjogren's syndrome,
polymyositis, dermatomyositis, mixed connective tissue disease,
relapsing polychondritis, vasculitis, Henoch-Schonlein syndrome,
erythema nodosum, polyarteritis nodosa, temporal (giant cell)
arteritis, Takayasu's arteritis, Wegener's granulomatosis, Reiter's
syndrome, Behcet's syndrome, ankylosing spondylitis, cellulitis,
keloids, Ehler Danlos syndrome, Marfan syndrome, pseudoxantoma
elasticum, osteogenese imperfecta, chondrodysplasias, epidermolysis
bullosa, Alport syndrome, and cutis laxa.
[0453] Table 1E also provides information regarding biological
activities and preferred therapeutic uses (i.e. see, "Preferred
Indications" column) for polynucleotides and polypeptides of the
invention (including antibodies, agonists, and/or antagonists
thereof). Table 1E also provides information regarding assays which
may be used to test polynucleotides and polypeptides of the
invention (including antibodies, agonists, and/or antagonists
thereof) for the corresponding biological activities. The first
column ("Gene No.") provides the gene number in the application for
each clone identifier. The second column ("cDNA ATCC Deposit No:
Z") provides the unique clone identifier for each clone as
previously described and indicated in Tables 1A, 1B, 1C, and 1D.
The third column ("AA SEQ ID NO:Y") indicates the Sequence Listing
SEQ ID Number for polypeptide sequences encoded by the
corresponding cDNA clones (also as indicated in Tables 1A, 1B, and
2). The fourth column ("Biological Activity") indicates a
biological activity corresponding to the indicated polypeptides (or
polynucleotides encoding said polypeptides). The fifth column
("Exemplary Activity Assay") further describes the corresponding
biological activity and also provides information pertaining to the
various types of assays which may be performed to test,
demonstrate, or quantify the corresponding biological activity. The
sixth column ("Preferred Indications") describes particular
embodiments of the invention as well as indications (e.g.
pathologies, diseases, disorders, abnormalities, etc.) for which
polynucleotides and polypeptides of the invention (including
antibodies, agonists, and/or antagonists thereof) may be used in
detecting, diagnosing, preventing, and/or treating.
[0454] The present invention is further directed to antibody-based
therapies which involve administering antibodies of the invention
to an animal, preferably a mammal, and most preferably a human,
patient for treating one or more of the disclosed diseases,
disorders, or conditions. Therapeutic compounds of the invention
include, but are not limited to, antibodies of the invention
(including fragments, analogs and derivatives thereof as described
herein) and nucleic acids encoding antibodies of the invention
(including fragments, analogs and derivatives thereof and
anti-idiotypic antibodies as described herein). The antibodies of
the invention can be used to treat, inhibit or prevent diseases,
disorders or conditions associated with aberrant expression and/or
activity of a polypeptide of the invention, including, but not
limited to, any one or more of the diseases, disorders, or
conditions described herein. The treatment and/or prevention of
diseases, disorders, or conditions associated with aberrant
expression and/or activity of a polypeptide of the invention
includes, but is not limited to, alleviating symptoms associated
with those diseases, disorders or conditions. Antibodies of the
invention may be provided in pharmaceutically acceptable
compositions as known in the art or as described herein.
[0455] In a specific and preferred embodiment, the present
invention is directed to antibody-based therapies which involve
administering antibodies of the invention to an animal, preferably
a mammal, and most preferably a human, patient for treating one or
more diseases, disorders, or conditions, including but not limited
to: neural disorders, immune system disorders, muscular disorders,
reproductive disorders, gastrointestinal disorders, pulmonary
disorders, cardiovascular disorders, renal disorders, proliferative
disorders, and/or cancerous diseases and conditions., and/or as
described elsewhere herein. Therapeutic compounds of the invention
include, but are not limited to, antibodies of the invention (e.g.,
antibodies directed to the full length protein expressed on the
cell surface of a mammalian cell; antibodies directed to an epitope
of a polypeptide of the invention (such as, for example, a
predicted linear epitope shown in column 7 of Table 1B.1; or a
conformational epitope, including fragments, analogs and
derivatives thereof as described herein) and nucleic acids encoding
antibodies of the invention (including fragments, analogs and
derivatives thereof and anti-idiotypic antibodies as described
herein). The antibodies of the invention can be used to treat,
inhibit or prevent diseases, disorders or conditions associated
with aberrant expression and/or activity of a polypeptide of the
invention, including, but not limited to, any one or more of the
diseases, disorders, or conditions described herein. The treatment
and/or prevention of diseases, disorders, or conditions associated
with aberrant expression and/or activity of a polypeptide of the
invention includes, but is not limited to, alleviating symptoms
associated with those diseases, disorders or conditions. Antibodies
of the invention may be provided in pharmaceutically acceptable
compositions as known in the art or as described herein.
[0456] A summary of the ways in which the antibodies of the present
invention may be used therapeutically includes binding
polynucleotides or polypeptides of the present invention locally or
systemically in the body or by direct cytotoxicity of the antibody,
e.g. as mediated by complement (CDC) or by effector cells (ADCC).
Some of these approaches are described in more detail below. Armed
with the teachings provided herein, one of ordinary skill in the
art will know how to use the antibodies of the present invention
for diagnostic, monitoring or therapeutic purposes without undue
experimentation.
[0457] The antibodies of this invention may be advantageously
utilized in combination with other monoclonal or chimeric
antibodies, or with lymphokines or hematopoietic growth factors
(such as, e.g., IL-2, IL-3 and IL-7), for example, which serve to
increase the number or activity of effector cells which interact
with the antibodies.
[0458] The antibodies of the invention may be administered alone or
in combination with other types of treatments (e.g., radiation
therapy, chemotherapy, hormonal therapy, immunotherapy and
anti-tumor agents). Generally, administration of products of a
species origin or species reactivity (in the case of antibodies)
that is the same species as that of the patient is preferred. Thus,
in a preferred embodiment, human antibodies, fragments derivatives,
analogs, or nucleic acids, are administered to a human patient for
therapy or prophylaxis.
[0459] It is preferred to use high affinity and/or potent in vivo
inhibiting and/or neutralizing antibodies against polypeptides or
polynucleotides of the present invention, fragments or regions
thereof, for both immunoassays directed to and therapy of disorders
related to polynucleotides or polypeptides, including fragments
thereof, of the present invention. Such antibodies, fragments, or
regions, will preferably have an affinity for polynucleotides or
polypeptides of the invention, including fragments thereof.
Preferred binding affinities include those with a dissociation
constant or Kd less than 5.times.10.sup.-2 M, 10.sup.-2 M,
5.times.10.sup.-3 M, 10.sup.-3M, 5.times.10.sup.-4 M, 10.sup.-4 M,
5.times.10.sup.-5 M, 10.sup.-5 M, 5.times.10.sup.-6 M, 10.sup.-6 M,
5.times.10.sup.-7 M, 10.sup.-7 M, 5.times.10.sup.-8 M, 10.sup.-8 M,
5.times.10.sup.-9 M, 10.sup.-9 M, 5.times.10.sup.-10 M, 10.sup.-10
M, 5.times.10.sup.-11 M, 10.sup.-11 M, 5.times.10.sup.-12 M,
10.sup.-12 M, 5.times.10.sup.-13 M, 10.sup.-13 M,
5.times.10.sup.-14 M, 10.sup.-14 M, 5.times.10.sup.-15 M, and
10.sup.-15 M.
Gene Therapy
[0460] In a specific embodiment, nucleic acids comprising sequences
encoding antibodies or functional derivatives thereof, are
administered to treat, inhibit or prevent a disease or disorder
associated with aberrant expression and/or activity of a
polypeptide of the invention, by way of gene therapy. Gene therapy
refers to therapy performed by the administration to a subject of
an expressed or expressible nucleic acid. In this embodiment of the
invention, the nucleic acids produce their encoded protein that
mediates a therapeutic effect.
[0461] Any of the methods for gene therapy available in the art can
be used according to the present invention. Exemplary methods are
described below.
[0462] For general reviews of the methods of gene therapy, see
Goldspiel et al., Clinical Pharmacy 12:488-505 (1993); Wu and Wu,
Biotherapy 3:87-95 (1991); Tolstoshev, Ann. Rev. Pharmacol.
Toxicol. 32:573-596 (1993); Mulligan, Science 260:926-932 (1993);
and Morgan and Anderson, Ann. Rev. Biochem. 62:191-217 (1993); May,
TIBTECH 11(5):155-215 (1993). Methods commonly known in the art of
recombinant DNA technology which can be used are described in
Ausubel et al. (eds.), Current Protocols in Molecular Biology, John
Wiley & Sons, NY (1993); and Kriegler, Gene Transfer and
Expression, A Laboratory Manual, Stockton Press, NY (1990).
[0463] In a preferred embodiment, the compound comprises nucleic
acid sequences encoding an antibody, said nucleic acid sequences
being part of expression vectors that express the antibody or
fragments or chimeric proteins or heavy or light chains thereof in
a suitable host. In particular, such nucleic acid sequences have
promoters operably linked to the antibody coding region, said
promoter being inducible or constitutive, and, optionally,
tissue-specific. In another particular embodiment, nucleic acid
molecules are used in which the antibody coding sequences and any
other desired sequences are flanked by regions that promote
homologous recombination at a desired site in the genome, thus
providing for intrachromosomal expression of the antibody encoding
nucleic acids (Koller and Smithies, Proc. Natl. Acad. Sci. USA
86:8932-8935 (1989); Zijlstra et al., Nature 342:435-438 (1989). In
specific embodiments, the expressed antibody molecule is a single
chain antibody; alternatively, the nucleic acid sequences include
sequences encoding both the heavy and light chains, or fragments
thereof, of the antibody.
[0464] Delivery of the nucleic acids into a patient may be either
direct, in which case the patient is directly exposed to the
nucleic acid or nucleic acid-carrying vectors, or indirect, in
which case, cells are first transformed with the nucleic acids in
vitro, then transplanted into the patient. These two approaches are
known, respectively, as in vivo or ex vivo gene therapy.
[0465] In a specific embodiment, the nucleic acid sequences are
directly administered in vivo, where it is expressed to produce the
encoded product. This can be accomplished by any of numerous
methods known in the art, e.g., by constructing them as part of an
appropriate nucleic acid expression vector and administering it so
that they become intracellular, e.g., by infection using defective
or attenuated retrovirals or other viral vectors (see U.S. Pat. No.
4,980,286), or by direct injection of naked DNA, or by use of
microparticle bombardment (e.g., a gene gun; Biolistic, Dupont), or
coating with lipids or cell-surface receptors or transfecting
agents, encapsulation in liposomes, microparticles, or
microcapsules, or by administering them in linkage to a peptide
which is known to enter the nucleus, by administering it in linkage
to a ligand subject to receptor-mediated endocytosis (see, e.g., Wu
and Wu, J. Biol. Chem. 262:4429-4432 (1987)) (which can be used to
target cell types specifically expressing the receptors), etc. In
another embodiment, nucleic acid-ligand complexes can be formed in
which the ligand comprises a fusogenic viral peptide to disrupt
endosomes, allowing the nucleic acid to avoid lysosomal
degradation. In yet another embodiment, the nucleic acid can be
targeted in vivo for cell specific uptake and expression, by
targeting a specific receptor (see, e.g., PCT Publications WO
92/06180; WO 92/22635; WO92/20316; WO93/14188, WO 93/20221).
Alternatively, the nucleic acid can be introduced intracellularly
and incorporated within host cell DNA for expression, by homologous
recombination (Koller and Smithies, Proc. Natl. Acad. Sci. USA
86:8932-8935 (1989); Zijlstra et al., Nature 342:435-438
(1989)).
[0466] In a specific embodiment, viral vectors that contains
nucleic acid sequences encoding an antibody of the invention are
used. For example, a retroviral vector can be used (see Miller et
al., Meth. Enzymol. 217:581-599 (1993)). These retroviral vectors
contain the components necessary for the correct packaging of the
viral genome and integration into the host cell DNA. The nucleic
acid sequences encoding the antibody to be used in gene therapy are
cloned into one or more vectors, which facilitates delivery of the
gene into a patient. More detail about retroviral vectors can be
found in Boesen et al., Biotherapy 6:291-302 (1994), which
describes the use of a retroviral vector to deliver the mdr1 gene
to hematopoietic stem cells in order to make the stem cells more
resistant to chemotherapy. Other references illustrating the use of
retroviral vectors in gene therapy are: Clowes et al., J. Clin.
Invest. 93:644-651 (1994); Kiem et al., Blood 83:1467-1473 (1994);
Salmons and Gunzberg, Human Gene Therapy 4:129-141 (1993); and
Grossman and Wilson, Curr. Opin. in Genetics and Devel. 3:110-114
(1993).
[0467] Adenoviruses are other viral vectors that can be used in
gene therapy. Adenoviruses are especially attractive vehicles for
delivering genes to respiratory epithelia. Adenoviruses naturally
infect respiratory epithelia where they cause a mild disease. Other
targets for adenovirus-based delivery systems are liver, the
central nervous system, endothelial cells, and muscle. Adenoviruses
have the advantage of being capable of infecting non-dividing
cells. Kozarsky and Wilson, Current Opinion in Genetics and
Development 3:499-503 (1993) present a review of adenovirus-based
gene therapy. Bout et al., Human Gene Therapy 5:3-10 (1994)
demonstrated the use of adenovirus vectors to transfer genes to the
respiratory epithelia of rhesus monkeys. Other instances of the use
of adenoviruses in gene therapy can be found in Rosenfeld et al.,
Science 252:431-434 (1991); Rosenfeld et al., Cell 68:143-155
(1992); Mastrangeli et al., J. Clin. Invest. 91:225-234 (1993); PCT
Publication WO94/12649; and Wang, et al., Gene Therapy 2:775-783
(1995). In a preferred embodiment, adenovirus vectors are used.
[0468] Adeno-associated virus (AAV) has also been proposed for use
in gene therapy (Walsh et al., Proc. Soc. Exp. Biol. Med.
204:289-300 (1993); U.S. Pat. No. 5,436,146).
[0469] Another approach to gene therapy involves transferring a
gene to cells in tissue culture by such methods as electroporation,
lipofection, calcium phosphate mediated transfection, or viral
infection. Usually, the method of transfer includes the transfer of
a selectable marker to the cells. The cells are then placed under
selection to isolate those cells that have taken up and are
expressing the transferred gene. Those cells are then delivered to
a patient.
[0470] In this embodiment, the nucleic acid is introduced into a
cell prior to administration in vivo of the resulting recombinant
cell. Such introduction can be carried out by any method known in
the art, including but not limited to transfection,
electroporation, microinjection, infection with a viral or
bacteriophage vector containing the nucleic acid sequences, cell
fusion, chromosome-mediated gene transfer, microcell-mediated gene
transfer, spheroplast fusion, etc. Numerous techniques are known in
the art for the introduction of foreign genes into cells (see,
e.g., Loeffler and Behr, Meth. Enzymol. 217:599-618 (1993); Cohen
et al., Meth. Enzymol. 217:618-644 (1993); Cline, Pharmac. Ther.
29:69-92m (1985) and may be used in accordance with the present
invention, provided that the necessary developmental and
physiological functions of the recipient cells are not disrupted.
The technique should provide for the stable transfer of the nucleic
acid to the cell, so that the nucleic acid is expressible by the
cell and preferably heritable and expressible by its cell
progeny.
[0471] The resulting recombinant cells can be delivered to a
patient by various methods known in the art. Recombinant blood
cells (e.g., hematopoietic stem or progenitor cells) are preferably
administered intravenously. The amount of cells envisioned for use
depends on the desired effect, patient state, etc., and can be
determined by one skilled in the art.
[0472] Cells into which a nucleic acid can be introduced for
purposes of gene therapy encompass any desired, available cell
type, and include but are not limited to epithelial cells,
endothelial cells, keratinocytes, fibroblasts, muscle cells,
hepatocytes; blood cells such as T lymphocytes, B lymphocytes,
monocytes, macrophages, neutrophils, eosinophils, megakaryocytes,
granulocytes; various stem or progenitor cells, in particular
hematopoietic stem or progenitor cells, e.g., as obtained from bone
marrow, umbilical cord blood, peripheral blood, fetal liver,
etc.
[0473] In a preferred embodiment, the cell used for gene therapy is
autologous to the patient.
[0474] In an embodiment in which recombinant cells are used in gene
therapy, nucleic acid sequences encoding an antibody are introduced
into the cells such that they are expressible by the cells or their
progeny, and the recombinant cells are then administered in vivo
for therapeutic effect. In a specific embodiment, stem or
progenitor cells are used. Any stem and/or progenitor cells which
can be isolated and maintained in vitro can potentially be used in
accordance with this embodiment of the present invention (see e.g.
PCT Publication WO 94/08598; Stemple and Anderson, Cell 71:973-985
(1992); Rheinwald, Meth. Cell Bio. 21A:229 (1980); and Pittelkow
and Scott, Mayo Clinic Proc. 61:771 (1986)).
[0475] In a specific embodiment, the nucleic acid to be introduced
for purposes of gene therapy comprises an inducible promoter
operably linked to the coding region, such that expression of the
nucleic acid is controllable by the presence or absence of an
appropriate inducer of transcription.
Demonstration of Therapeutic or Prophylactic Activity
[0476] The compounds or pharmaceutical compositions of the
invention are preferably tested in vitro, and then in vivo for the
desired therapeutic or prophylactic activity, prior to use in
humans. For example, in vitro assays to demonstrate the therapeutic
or prophylactic utility of a compound or pharmaceutical composition
include, the effect of a compound on a cell line or a patient
tissue sample. The effect of the compound or composition on the
cell line and/or tissue sample can be determined utilizing
techniques known to those of skill in the art including, but not
limited to, rosette formation assays and cell lysis assays. In
accordance with the invention, in vitro assays which can be used to
determine whether administration of a specific compound is
indicated, include in vitro cell culture assays in which a patient
tissue sample is grown in culture, and exposed to or otherwise
administered a compound, and the effect of such compound upon the
tissue sample is observed.
Therapeutic/Prophylactic Administration and Composition
[0477] The invention provides methods of treatment, inhibition and
prophylaxis by administration to a subject of an effective amount
of a compound or pharmaceutical composition of the invention,
preferably a polypeptide or antibody of the invention. In a
preferred embodiment, the compound is substantially purified (e.g.,
substantially free from substances that limit its effect or produce
undesired side-effects). The subject is preferably an animal,
including but not limited to animals such as cows, pigs, horses,
chickens, cats, dogs, etc., and is preferably a mammal, and most
preferably human.
[0478] Formulations and methods of administration that can be
employed when the compound comprises a nucleic acid or an
immunoglobulin are described above; additional appropriate
formulations and routes of administration can be selected from
among those described herein below.
[0479] Various delivery systems are known and can be used to
administer a compound of the invention, e.g., encapsulation in
liposomes, microparticles, microcapsules, recombinant cells capable
of expressing the compound, receptor-mediated endocytosis (see,
e.g., Wu and Wu, J. Biol. Chem. 262:4429-4432 (1987)), construction
of a nucleic acid as part of a retroviral or other vector, etc.
Methods of introduction include but are not limited to intradermal,
intramuscular, intraperitoneal, intravenous, subcutaneous,
intranasal, epidural, and oral routes. The compounds or
compositions may be administered by any convenient route, for
example by infusion or bolus injection, by absorption through
epithelial or mucocutaneous linings (e.g., oral mucosa, rectal and
intestinal mucosa, etc.) and may be administered together with
other biologically active agents. Administration can be systemic or
local. In addition, it may be desirable to introduce the
pharmaceutical compounds or compositions of the invention into the
central nervous system by any suitable route, including
intraventricular and intrathecal injection; intraventricular
injection may be facilitated by an intraventricular catheter, for
example, attached to a reservoir, such as an Ommaya reservoir.
Pulmonary administration can also be employed, e.g., by use of an
inhaler or nebulizer, and formulation with an aerosolizing
agent.
[0480] In a specific embodiment, it may be desirable to administer
the pharmaceutical compounds or compositions of the invention
locally to the area in need of treatment; this may be achieved by,
for example, and not by way of limitation, local infusion during
surgery, topical application, e.g., in conjunction with a wound
dressing after surgery, by injection, by means of a catheter, by
means of a suppository, or by means of an implant, said implant
being of a porous, non-porous, or gelatinous material, including
membranes, such as sialastic membranes, or fibers. Preferably, when
administering a protein, including an antibody, of the invention,
care must be taken to use materials to which the protein does not
absorb.
[0481] In another embodiment, the compound or composition can be
delivered in a vesicle, in particular a liposome (see Langer,
Science 249:1527-1533 (1990); Treat et al., in Liposomes in the
Therapy of Infectious Disease and Cancer, Lopez-Berestein and
Fidler (eds.), Liss, New York, pp. 353-365 (1989); Lopez-Berestein,
ibid., pp. 317-327; see generally ibid.)
[0482] In yet another embodiment, the compound or composition can
be delivered in a controlled release system. In one embodiment, a
pump may be used (see Langer, supra; Sefton, CRC Crit. Ref. Biomed.
Eng. 14:201 (1987); Buchwald et al., Surgery 88:507 (1980); Saudek
et al., N. Engl. J. Med. 321:574 (1989)). In another embodiment,
polymeric materials can be used (see Medical Applications of
Controlled Release, Langer and Wise (eds.), CRC Pres., Boca Raton,
Fla. (1974); Controlled Drug Bioavailability, Drug Product Design
and Performance, Smolen and Ball (eds.), Wiley, New York (1984);
Ranger and Peppas, J., Macromol. Sci. Rev. Macromol. Chem. 23:61
(1983); see also Levy et al., Science 228:190 (1985); During et
al., Ann. Neurol. 25:351 (1989); Howard et al., J. Neurosurg.
71:105 (1989)). In yet another embodiment, a controlled release
system can be placed in proximity of the therapeutic target, e.g.,
the brain, thus requiring only a fraction of the systemic dose
(see, e.g., Goodson, in Medical Applications of Controlled Release,
supra, vol. 2, pp. 115-138 (1984)).
[0483] Other controlled release systems are discussed in the review
by Langer (Science 249:1527-1533 (1990)).
[0484] In a specific embodiment where the compound of the invention
is a nucleic acid encoding a protein, the nucleic acid can be
administered in vivo to promote expression of its encoded protein,
by constructing it as part of an appropriate nucleic acid
expression vector and administering it so that it becomes
intracellular, e.g., by use of a retroviral vector (see U.S. Pat.
No. 4,980,286), or by direct injection, or by use of microparticle
bombardment (e.g., a gene gun; Biolistic, Dupont), or coating with
lipids or cell-surface receptors or transfecting agents, or by
administering it in linkage to a homeobox-like peptide which is
known to enter the nucleus (see e.g., Joliot et al., Proc. Natl.
Acad. Sci. USA 88:1864-1868 (1991)), etc. Alternatively, a nucleic
acid can be introduced intracellularly and incorporated within host
cell DNA for expression, by homologous recombination.
[0485] The present invention also provides pharmaceutical
compositions. Such compositions comprise a therapeutically
effective amount of a compound, and a pharmaceutically acceptable
carrier. In a specific embodiment, the term "pharmaceutically
acceptable" means approved by a regulatory agency of the Federal or
a state government or listed in the U.S. Pharmacopeia or other
generally recognized pharmacopeia for use in animals, and more
particularly in humans. The term "carrier" refers to a diluent,
adjuvant, excipient, or vehicle with which the therapeutic is
administered. Such pharmaceutical carriers can be sterile liquids,
such as water and oils, including those of petroleum, animal,
vegetable or synthetic origin, such as peanut oil, soybean oil,
mineral oil, sesame oil and the like. Water is a preferred carrier
when the pharmaceutical composition is administered intravenously.
Saline solutions and aqueous dextrose and glycerol solutions can
also be employed as liquid carriers, particularly for injectable
solutions. Suitable pharmaceutical excipients include starch,
glucose, lactose, sucrose, gelatin, malt, rice, flour, chalk,
silica gel, sodium stearate, glycerol monostearate, talc, sodium
chloride, dried skim milk, glycerol, propylene, glycol, water,
ethanol and the like. The composition, if desired, can also contain
minor amounts of wetting or emulsifying agents, or pH buffering
agents. These compositions can take the form of solutions,
suspensions, emulsion, tablets, pills, capsules, powders,
sustained-release formulations and the like. The composition can be
formulated as a suppository, with traditional binders and carriers
such as triglycerides. Oral formulation can include standard
carriers such as pharmaceutical grades of mannitol, lactose,
starch, magnesium stearate, sodium saccharine, cellulose, magnesium
carbonate, etc. Examples of suitable pharmaceutical carriers are
described in "Remington's Pharmaceutical Sciences" by E. W. Martin.
Such compositions will contain a therapeutically effective amount
of the compound, preferably in purified form, together with a
suitable amount of carrier so as to provide the form for proper
administration to the patient. The formulation should suit the mode
of administration.
[0486] In a preferred embodiment, the composition is formulated in
accordance with routine procedures as a pharmaceutical composition
adapted for intravenous administration to human beings. Typically,
compositions for intravenous administration are solutions in
sterile isotonic aqueous buffer. Where necessary, the composition
may also include a solubilizing agent and a local anesthetic such
as lignocaine to ease pain at the site of the injection. Generally,
the ingredients are supplied either separately or mixed together in
unit dosage form, for example, as a dry lyophilized powder or water
free concentrate in a hermetically sealed container such as an
ampoule or sachette indicating the quantity of active agent. Where
the composition is to be administered by infusion, it can be
dispensed with an infusion bottle containing sterile pharmaceutical
grade water or saline. Where the composition is administered by
injection, an ampoule of sterile water for injection or saline can
be provided so that the ingredients may be mixed prior to
administration.
[0487] The compounds of the invention can be formulated as neutral
or salt forms. Pharmaceutically acceptable salts include those
formed with anions such as those derived from hydrochloric,
phosphoric, acetic, oxalic, tartaric acids, etc., and those formed
with cations such as those derived from sodium, potassium,
ammonium, calcium, ferric hydroxides, isopropylamine,
triethylamine, 2-ethylamino ethanol, histidine, procaine, etc.
[0488] The amount of the compound of the invention which will be
effective in the treatment, inhibition and prevention of a disease
or disorder associated with aberrant expression and/or activity of
a polypeptide of the invention can be determined by standard
clinical techniques. In addition, in vitro assays may optionally be
employed to help identify optimal dosage ranges. The precise dose
to be employed in the formulation will also depend on the route of
administration, and the seriousness of the disease or disorder, and
should be decided according to the judgment of the practitioner and
each patient's circumstances. Effective doses may be extrapolated
from dose-response curves derived from in vitro or animal model
test systems.
[0489] For antibodies, the dosage administered to a patient is
typically 0.1 mg/kg to 100 mg/kg of the patient's body weight.
Preferably, the dosage administered to a patient is between 0.1
mg/kg and 20 mg/kg of the patient's body weight, more preferably 1
mg/kg to 10 mg/kg of the patient's body weight. Generally, human
antibodies have a longer half-life within the human body than
antibodies from other species due to the immune response to the
foreign polypeptides. Thus, lower dosages of human antibodies and
less frequent administration is often possible. Further, the dosage
and frequency of administration of antibodies of the invention may
be reduced by enhancing uptake and tissue penetration (e.g., into
the brain) of the antibodies by modifications such as, for example,
lipidation.
[0490] The invention also provides a pharmaceutical pack or kit
comprising one or more containers filled with one or more of the
ingredients of the pharmaceutical compositions of the invention.
Optionally associated with such container(s) can be a notice in the
form prescribed by a governmental agency regulating the
manufacture, use or sale of pharmaceuticals or biological products,
which notice reflects approval by the agency of manufacture, use or
sale for human administration.
Diagnosis and Imaging
[0491] Labeled antibodies, and derivatives and analogs thereof,
which specifically bind to a polypeptide of interest can be used
for diagnostic purposes to detect, diagnose, or monitor diseases,
disorders, and/or conditions associated with the aberrant
expression and/or activity of a polypeptide of the invention. The
invention provides for the detection of aberrant expression of a
polypeptide of interest, comprising (a) assaying the expression of
the polypeptide of interest in cells or body fluid of an individual
using one or more antibodies specific to the polypeptide interest
and (b) comparing the level of gene expression with a standard gene
expression level, whereby an increase or decrease in the assayed
polypeptide gene expression level compared to the standard
expression level is indicative of aberrant expression.
[0492] The invention provides a diagnostic assay for diagnosing a
disorder, comprising (a) assaying the expression of the polypeptide
of interest in cells or body fluid of an individual using one or
more antibodies specific to the polypeptide interest and (b)
comparing the level of gene expression with a standard gene
expression level, whereby an increase or decrease in the assayed
polypeptide gene expression level compared to the standard
expression level is indicative of a particular disorder. With
respect to cancer, the presence of a relatively high amount of
transcript in biopsied tissue from an individual may indicate a
predisposition for the development of the disease, or may provide a
means for detecting the disease prior to the appearance of actual
clinical symptoms. A more definitive diagnosis of this type may
allow health professionals to employ preventative measures or
aggressive treatment earlier thereby preventing the development or
further progression of the cancer.
[0493] Antibodies of the invention can be used to assay protein
levels in a biological sample using classical immunohistological
methods known to those of skill in the art (e.g., see Jalkanen et
al., J. Cell. Biol. 101:976-985 (1985); Jalkanen et al., J. Cell.
Biol. 105:3087-3096 (1987)). Other antibody-based methods useful
for detecting protein gene expression include immunoassays, such as
the enzyme linked immunosorbent assay (ELISA) and the
radioimmunoassay (RIA). Suitable antibody assay labels are known in
the art and include enzyme labels, such as, glucose oxidase;
radioisotopes, such as iodine (125I, 121I), carbon (14C), sulfur
(35S), tritium (3H), indium (112In), and technetium (99Tc);
luminescent labels, such as luminol; and fluorescent labels, such
as fluorescein and rhodamine, and biotin.
[0494] One facet of the invention is the detection and diagnosis of
a disease or disorder associated with aberrant expression of a
polypeptide of interest in an animal, preferably a mammal and most
preferably a human. In one embodiment, diagnosis comprises: a)
administering (for example, parenterally, subcutaneously, or
intraperitoneally) to a subject an effective amount of a labeled
molecule which specifically binds to the polypeptide of interest;
b) waiting for a time interval following the administering for
permitting the labeled molecule to preferentially concentrate at
sites in the subject where the polypeptide is expressed (and for
unbound labeled molecule to be cleared to background level); c)
determining background level; and d) detecting the labeled molecule
in the subject, such that detection of labeled molecule above the
background level indicates that the subject has a particular
disease or disorder associated with aberrant expression of the
polypeptide of interest. Background level can be determined by
various methods including, comparing the amount of labeled molecule
detected to a standard value previously determined for a particular
system.
[0495] It will be understood in the art that the size of the
subject and the imaging system used will determine the quantity of
imaging moiety needed to produce diagnostic images. In the case of
a radioisotope moiety, for a human subject, the quantity of
radioactivity injected will normally range from about 5 to 20
millicuries of 99 mTc. The labeled antibody or antibody fragment
will then preferentially accumulate at the location of cells which
contain the specific protein. In vivo tumor imaging is described in
S. W. Burchiel et al., "Immunopharmacokinetics of Radiolabeled
Antibodies and Their Fragments." (Chapter 13 in Tumor Imaging: The
Radiochemical Detection of Cancer, S. W. Burchiel and B. A. Rhodes,
eds., Masson Publishing Inc. (1982)).
[0496] Depending on several variables, including the type of label
used and the mode of administration, the time interval following
the administration for permitting the labeled molecule to
preferentially concentrate at sites in the subject and for unbound
labeled molecule to be cleared to background level is 6 to 48 hours
or 6 to 24 hours or 6 to 12 hours. In another embodiment the time
interval following administration is 5 to 20 days or 5 to 10
days.
[0497] In an embodiment, monitoring of the disease or disorder is
carried out by repeating the method for diagnosing the disease or
disease, for example, one month after initial diagnosis, six months
after initial diagnosis, one year after initial diagnosis, etc.
[0498] Presence of the labeled molecule can be detected in the
patient using methods known in the art for in vivo scanning. These
methods depend upon the type of label used. Skilled artisans will
be able to determine the appropriate method for detecting a
particular label. Methods and devices that may be used in the
diagnostic methods of the invention include, but are not limited
to, computed tomography (CT), whole body scan such as position
emission tomography (PET), magnetic resonance imaging (MRI), and
sonography.
[0499] In a specific embodiment, the molecule is labeled with a
radioisotope and is detected in the patient using a radiation
responsive surgical instrument (Thurston et al., U.S. Pat. No.
5,441,050). In another embodiment, the molecule is labeled with a
fluorescent compound and is detected in the patient using a
fluorescence responsive scanning instrument. In another embodiment,
the molecule is labeled with a positron emitting metal and is
detected in the patent using positron emission-tomography. In yet
another embodiment, the molecule is labeled with a paramagnetic
label and is detected in a patient using magnetic resonance imaging
(MRI).
Kits
[0500] The present invention provides kits that can be used in the
above methods. In one embodiment, a kit comprises an antibody of
the invention, preferably a purified antibody, in one or more
containers. In a specific embodiment, the kits of the present
invention contain a substantially isolated polypeptide comprising
an epitope which is specifically immunoreactive with an antibody
included in the kit. Preferably, the kits of the present invention
further comprise a control antibody which does not react with the
polypeptide of interest. In another specific embodiment, the kits
of the present invention contain a means for detecting the binding
of an antibody to a polypeptide of interest (e.g., the antibody may
be conjugated to a detectable substrate such as a fluorescent
compound, an enzymatic substrate, a radioactive compound or a
luminescent compound, or a second antibody which recognizes the
first antibody may be conjugated to a detectable substrate).
[0501] In another specific embodiment of the present invention, the
kit is a diagnostic kit for use in screening serum containing
antibodies specific against proliferative and/or cancerous
polynucleotides and polypeptides. Such a kit may include a control
antibody that does not react with the polypeptide of interest. Such
a kit may include a substantially isolated polypeptide antigen
comprising an epitope which is specifically immunoreactive with at
least one anti-polypeptide antigen antibody. Further, such a kit
includes means for detecting the binding of said antibody to the
antigen (e.g., the antibody may be conjugated to a fluorescent
compound such as fluorescein or rhodamine which can be detected by
flow cytometry). In specific embodiments, the kit may include a
recombinantly produced or chemically synthesized polypeptide
antigen. The polypeptide antigen of the kit may also be attached to
a solid support.
[0502] In a more specific embodiment the detecting means of the
above-described kit includes a solid support to which said
polypeptide antigen is attached. Such a kit may also include a
non-attached reporter-labeled anti-human antibody. In this
embodiment, binding of the antibody to the polypeptide antigen can
be detected by binding of the said reporter-labeled antibody.
[0503] In an additional embodiment, the invention includes a
diagnostic kit for use in screening serum containing antigens of
the polypeptide of the invention. The diagnostic kit includes a
substantially isolated antibody specifically immunoreactive with
polypeptide or polynucleotide antigens, and means for detecting the
binding of the polynucleotide or polypeptide antigen to the
antibody. In one embodiment, the antibody is attached to a solid
support. In a specific embodiment, the antibody may be a monoclonal
antibody. The detecting means of the kit may include a second,
labeled monoclonal antibody. Alternatively, or in addition, the
detecting means may include a labeled, competing antigen.
[0504] In one diagnostic configuration, test serum is reacted with
a solid phase reagent having a surface-bound antigen obtained by
the methods of the present invention. After binding with specific
antigen antibody to the reagent and removing unbound serum
components by washing, the reagent is reacted with reporter-labeled
anti-human antibody to bind reporter to the reagent in proportion
to the amount of bound anti-antigen antibody on the solid support.
The reagent is again washed to remove unbound labeled antibody, and
the amount of reporter associated with the reagent is determined.
Typically, the reporter is an enzyme which is detected by
incubating the solid phase in the presence of a suitable
fluorometric, luminescent or calorimetric substrate (Sigma, St.
Louis, Mo.).
[0505] The solid surface reagent in the above assay is prepared by
known techniques for attaching protein material to solid support
material, such as polymeric beads, dip sticks, 96-well plate or
filter material. These attachment methods generally include
non-specific adsorption of the protein to the support or covalent
attachment of the protein, typically through a free amine group, to
a chemically reactive group on the solid support, such as an
activated carboxyl, hydroxyl, or aldehyde group. Alternatively,
streptavidin coated plates can be used in conjunction with
biotinylated antigen(s).
[0506] Thus, the invention provides an assay system or kit for
carrying out this diagnostic method. The kit generally includes a
support with surface-bound recombinant antigens, and a
reporter-labeled anti-human antibody for detecting surface-bound
anti-antigen antibody.
Uses of the Polynucleotides
[0507] Each of the polynucleotides identified herein can be used in
numerous ways as reagents. The following description should be
considered exemplary and utilizes known techniques.
[0508] The polynucleotides of the present invention are useful for
chromosome identification. There exists an ongoing need to identify
new chromosome markers, since few chromosome marking reagents,
based on actual sequence data (repeat polymorphisms), are presently
available. Each sequence is specifically targeted to and can
hybridize with a particular location on an individual human
chromosome, thus each polynucleotide of the present invention can
routinely be used as a chromosome marker using techniques known in
the art. Table 1B.1, column 8 provides the chromosome location of
some of the polynucleotides of the invention.
[0509] Briefly, sequences can be mapped to chromosomes by preparing
PCR primers (preferably at least 15 bp (e.g., 15-25 bp) from the
sequences shown in SEQ ID NO:X. Primers can optionally be selected
using computer analysis so that primers do not span more than one
predicted exon in the genomic DNA. These primers are then used for
PCR screening of somatic cell hybrids containing individual human
chromosomes. Only those hybrids containing the human gene
corresponding to SEQ ID NO:X will yield an amplified fragment.
[0510] Similarly, somatic hybrids provide a rapid method of PCR
mapping the polynucleotides to particular chromosomes. Three or
more clones can be assigned per day using a single thermal cycler.
Moreover, sublocalization of the polynucleotides can be achieved
with panels of specific chromosome fragments. Other gene mapping
strategies that can be used include in situ hybridization,
prescreening with labeled flow-sorted chromosomes, preselection by
hybridization to construct chromosome specific-cDNA libraries, and
computer mapping techniques (See, e.g., Shuler, Trends Biotechnol
16:456-459 (1998) which is hereby incorporated by reference in its
entirety).
[0511] Precise chromosomal location of the polynucleotides can also
be achieved using fluorescence in situ hybridization (FISH) of a
metaphase chromosomal spread. This technique uses polynucleotides
as short as 500 or 600 bases; however, polynucleotides 2,000 bp are
preferred. For a review of this technique, see Verma et al., "Human
Chromosomes: a Manual of Basic Techniques," Pergamon Press, New
York (1988).
[0512] For chromosome mapping, the polynucleotides can be used
individually (to mark a single chromosome or a single site on that
chromosome) or in panels (for marking multiple sites and/or
multiple chromosomes).
[0513] Thus, the present invention also provides a method for
chromosomal localization which involves (a) preparing PCR primers
from the polynucleotide sequences in Table 1B and/or Table 2 and
SEQ ID NO:X and (b) screening somatic cell hybrids containing
individual chromosomes.
[0514] The polynucleotides of the present invention would likewise
be useful for radiation hybrid mapping, HAPPY mapping, and long
range restriction mapping. For a review of these techniques and
others known in the art, see, e.g. Dear, "Genome Mapping: A
Practical Approach," IRL Press at Oxford University Press, London
(1997); Aydin, J. Mol. Med. 77:691-694 (1999); Hacia et al., Mol.
Psychiatry 3:483-492 (1998); Herrick et al., Chromosome Res.
7:409-423 (1999); Hamilton et al., Methods Cell Biol. 62:265-280
(2000); and/or Ott, J. Hered. 90:68-70 (1999) each of which is
hereby incorporated by reference in its entirety.
[0515] Once a polynucleotide has been mapped to a precise
chromosomal location, the physical position of the polynucleotide
can be used in linkage analysis. Linkage analysis establishes
coinheritance between a chromosomal location and presentation of a
particular disease. (Disease mapping data are found, for example,
in V. McKusick, Mendelian Inheritance in Man (available on line
through Johns Hopkins University Welch Medical Library)). Column 9
of Table 1B.1 provides an OMIM reference identification number of
diseases associated with the cytologic band disclosed in column 8
of Table 1B.1, as determined using techniques described herein and
by reference to Table 5. Assuming 1 megabase mapping resolution and
one gene per 20 kb, a cDNA precisely localized to a chromosomal
region associated with the disease could be one of 50-500 potential
causative genes.
[0516] Thus, once coinheritance is established, differences in a
polynucleotide of the invention and the corresponding gene between
affected and unaffected individuals can be examined. First, visible
structural alterations in the chromosomes, such as deletions or
translocations, are examined in chromosome spreads or by PCR. If no
structural alterations exist, the presence of point mutations are
ascertained. Mutations observed in some or all affected
individuals, but not in normal individuals, indicates that the
mutation may cause the disease. However, complete sequencing of the
polypeptide and the corresponding gene from several normal
individuals is required to distinguish the mutation from a
polymorphism. If a new polymorphism is identified, this polymorphic
polypeptide can be used for further linkage analysis.
[0517] Furthermore, increased or decreased expression of the gene
in affected individuals as compared to unaffected individuals can
be assessed using the polynucleotides of the invention. Any of
these alterations (altered expression, chromosomal rearrangement,
or mutation) can be used as a diagnostic or prognostic marker.
Diagnostic and prognostic methods, kits and reagents encompassed by
the present invention are briefly described below and more
thoroughly elsewhere herein (see e.g., the sections labeled
"Antibodies", "Diagnostic Assays", and "Methods for Detecting
Diseases").
[0518] Thus, the invention also provides a diagnostic method useful
during diagnosis of a disorder, involving measuring the expression
level of polynucleotides of the present invention in cells or body
fluid from an individual and comparing the measured gene expression
level with a standard level of polynucleotide expression level,
whereby an increase or decrease in the gene expression level
compared to the standard is indicative of a disorder. Additional
non-limiting examples of diagnostic methods encompassed by the
present invention are more thoroughly described elsewhere herein
(see, e.g., Example 12).
[0519] In still another embodiment, the invention includes a kit
for analyzing samples for the presence of proliferative and/or
cancerous polynucleotides derived from a test subject. In a general
embodiment, the kit includes at least one polynucleotide probe
containing a nucleotide sequence that will specifically hybridize
with a polynucleotide of the invention and a suitable container. In
a specific embodiment, the kit includes two polynucleotide probes
defining an internal region of the polynucleotide of the invention,
where each probe has one strand containing a 31'mer-end internal to
the region. In a further embodiment, the probes may be useful as
primers for polymerase chain reaction amplification.
[0520] Where a diagnosis of a related disorder, including, for
example, diagnosis of a tumor, has already been made according to
conventional methods, the present invention is useful as a
prognostic indicator, whereby patients exhibiting enhanced or
depressed polynucleotide of the invention expression will
experience a worse clinical outcome relative to patients expressing
the gene at a level nearer the standard level.
[0521] By "measuring the expression level of polynucleotides of the
invention" is intended qualitatively or quantitatively measuring or
estimating the level of the polypeptide of the invention or the
level of the mRNA encoding the polypeptide of the invention in a
first biological sample either directly (e.g., by determining or
estimating absolute protein level or mRNA level) or relatively
(e.g., by comparing to the polypeptide level or mRNA level in a
second biological sample). Preferably, the polypeptide level or
mRNA level in the first biological sample is measured or estimated
and compared to a standard polypeptide level or mRNA level, the
standard being taken from a second biological sample obtained from
an individual not having the related disorder or being determined
by averaging levels from a population of individuals not having a
related disorder. As will be appreciated in the art, once a
standard polypeptide level or mRNA level is known, it can be used
repeatedly as a standard for comparison.
[0522] By "biological sample" is intended any biological sample
obtained from an individual, body fluid, cell line, tissue culture,
or other source which contains polypeptide of the present invention
or the corresponding mRNA. As indicated, biological samples include
body fluids (such as semen, lymph, vaginal pool, sera, plasma,
urine, synovial fluid and spinal fluid) which contain the
polypeptide of the present invention, and tissue sources found to
express the polypeptide of the present invention. Methods for
obtaining tissue biopsies and body fluids from mammals are well
known in the art. Where the biological sample is to include mRNA, a
tissue biopsy is the preferred source.
[0523] The method(s) provided above may preferably be applied in a
diagnostic method and/or kits in which polynucleotides and/or
polypeptides of the invention are attached to a solid support. In
one exemplary method, the support may be a "gene chip" or a
"biological chip" as described in U.S. Pat. Nos. 5,837,832,
5,874,219, and 5,856,174. Further, such a gene chip with
polynucleotides of the invention attached may be used to identify
polymorphisms between the isolated polynucleotide sequences of the
invention, with polynucleotides isolated from a test subject. The
knowledge of such polymorphisms (i.e. their location, as well as,
their existence) would be beneficial in identifying disease loci
for many disorders, such as for example, in neural disorders,
immune system disorders, muscular disorders, reproductive
disorders, gastrointestinal disorders, pulmonary disorders,
digestive disorders, metabolic disorders, cardiovascular disorders,
renal disorders, proliferative disorders, and/or cancerous diseases
and conditions. Such a method is described in U.S. Pat. Nos.
5,858,659 and 5,856,104. The US Patents referenced supra are hereby
incorporated by reference in their entirety herein.
[0524] The present invention encompasses polynucleotides of the
present invention that are chemically synthesized, or reproduced as
peptide nucleic acids (PNA), or according to other methods known in
the art. The use of PNAs would serve as the preferred form if the
polynucleotides of the invention are incorporated onto a solid
support, or gene chip. For the purposes of the present invention, a
peptide nucleic acid (PNA) is a polyamide type of DNA analog and
the monomeric units for adenine, guanine, thymine and cytosine are
available commercially (Perceptive Biosystems). Certain components
of DNA, such as phosphorus, phosphorus oxides, or deoxyribose
derivatives, are not present in PNAs. As disclosed by Nielsen et
al., Science 254, 1497 (1991); and Egholm et al., Nature 365, 666
(1993), PNAs bind specifically and tightly to complementary DNA
strands and are not degraded by nucleases. In fact, PNA binds more
strongly to DNA than DNA itself does. This is probably because
there is no electrostatic repulsion between the two strands, and
also the polyamide backbone is more flexible. Because of this,
PNA/DNA duplexes bind under a wider range of stringency conditions
than DNA/DNA duplexes, making it easier to perform multiplex
hybridization. Smaller probes can be used than with DNA due to the
strong binding. In addition, it is more likely that single base
mismatches can be determined with PNA/DNA hybridization because a
single mismatch in a PNA/DNA 15-mer lowers the melting point
(T.sub.m) by 8.degree.-20.degree. C., vs. 4.degree.-16.degree. C.
for the DNA/DNA 15-mer duplex. Also, the absence of charge groups
in PNA means that hybridization can be done at low ionic strengths
and reduce possible interference by salt during the analysis.
[0525] The compounds of the present invention have uses which
include, but are not limited to, detecting cancer in mammals. In
particular the invention is useful during diagnosis of pathological
cell proliferative neoplasias which include, but are not limited
to: acute myelogenous leukemias including acute monocytic leukemia,
acute myeloblastic leukemia, acute promyelocytic leukemia, acute
myelomonocytic leukemia, acute erythroleukemia, acute
megakaryocytic leukemia, and acute undifferentiated leukemia, etc.;
and chronic myelogenous leukemias including chronic myelomonocytic
leukemia, chronic granulocytic leukemia, etc. Preferred mammals
include monkeys, apes, cats, dogs, cows, pigs, horses, rabbits and
humans. Particularly preferred are humans.
[0526] Pathological cell proliferative disorders are often
associated with inappropriate activation of proto-oncogenes.
(Gelmann, E. P. et al., "The Etiology of Acute Leukemia: Molecular
Genetics and Viral Oncology," in Neoplastic Diseases of the Blood,
Vol 1., Wiernik, P. H. et al. eds., 161-182 (1985)). Neoplasias are
now believed to result from the qualitative alteration of a normal
cellular gene product, or from the quantitative modification of
gene expression by insertion into the chromosome of a viral
sequence, by chromosomal translocation of a gene to a more actively
transcribed region, or by some other mechanism. (Gelmann et al.,
supra) It is likely that mutated or altered expression of specific
genes is involved in the pathogenesis of some leukemias, among
other tissues and cell types. (Gelmann et al., supra) Indeed, the
human counterparts of the oncogenes involved in some animal
neoplasias have been amplified or translocated in some cases of
human leukemia and carcinoma. (Gelmann et al., supra)
[0527] For example, c-myc expression is highly amplified in the
non-lymphocytic leukemia cell line HL-60. When HL-60 cells are
chemically induced to stop proliferation, the level of c-myc is
found to be downregulated. (International Publication Number WO
91/15580). However, it has been shown that exposure of HL-60 cells
to a DNA construct that is complementary to the 5' end of c-myc or
c-myb blocks translation of the corresponding mRNAs which
downregulates expression of the c-myc or c-myb proteins and causes
arrest of cell proliferation and differentiation of the treated
cells. (International Publication Number WO 91/15580; Wickstrom et
al., Proc. Natl. Acad. Sci. 85:1028 (1988); Anfossi et al., Proc.
Natl. Acad. Sci. 86:3379 (1989)). However, the skilled artisan
would appreciate the present invention's usefulness is not be
limited to treatment, prevention, and/or prognosis of proliferative
disorders of cells and tissues of hematopoietic origin, in light of
the numerous cells and cell types of varying origins which are
known to exhibit proliferative phenotypes.
[0528] In addition to the foregoing, a polynucleotide of the
present invention can be used to control gene expression through
triple helix formation or through antisense DNA or RNA. Antisense
techniques are discussed, for example, in Okano, J. Neurochem. 56:
560 (1991); "Oligodeoxynucleotides as Antisense Inhibitors of Gene
Expression, CRC Press, Boca Raton, Fla. (1988). Triple helix
formation is discussed in, for instance Lee et al., Nucleic Acids
Research 6: 3073 (1979); Cooney et al., Science 241: 456 (1988);
and Dervan et al., Science 251: 1360 (1991). Both methods rely on
binding of the polynucleotide to a complementary DNA or RNA. For
these techniques, preferred polynucleotides are usually
oligonucleotides 20 to 40 bases in length and complementary to
either the region of the gene involved in transcription (triple
helix--see Lee et al., Nucl. Acids Res. 6:3073 (1979); Cooney et
al., Science 241:456 (1988); and Dervan et al., Science 251:1360
(1991)) or to the mRNA itself (antisense--Okano, J. Neurochem.
56:560 (1991); Oligodeoxy-nucleotides as Antisense Inhibitors of
Gene Expression, CRC Press, Boca Raton, Fla. (1988)). Triple helix
formation optimally results in a shut-off of RNA transcription from
DNA, while antisense RNA hybridization blocks translation of an
mRNA molecule into polypeptide. The oligonucleotide described above
can also be delivered to cells such that the antisense RNA or DNA
may be expressed in vivo to inhibit production of polypeptide of
the present invention antigens. Both techniques are effective in
model systems, and the information disclosed herein can be used to
design antisense or triple helix polynucleotides in an effort to
treat disease, and in particular, for the treatment of
proliferative diseases and/or conditions. Non-limiting antisense
and triple helix methods encompassed by the present invention are
more thoroughly described elsewhere herein (see, e.g., the section
labeled "Antisense and Ribozyme (Antagonists)").
[0529] Polynucleotides of the present invention are also useful in
gene therapy. One goal of gene therapy is to insert a normal gene
into an organism having a defective gene, in an effort to correct
the genetic defect. The polynucleotides disclosed in the present
invention offer a means of targeting such genetic defects in a
highly accurate manner. Another goal is to insert a new gene that
was not present in the host genome, thereby producing a new trait
in the host cell. Additional non-limiting examples of gene therapy
methods encompassed by the present invention are more thoroughly
described elsewhere herein (see, e.g., the sections labeled "Gene
Therapy Methods", and Examples 16, 17 and 18).
[0530] The polynucleotides are also useful for identifying
indivisuals from minute biological samples. The United States
military, for example, is considering the use of restriction
fragment length polymorphism (RFLP) for identification of its
personnel. In this technique, an individual's genomic DNA is
digested with one or more restriction enzymes, and probed on a
Southern blot to yield unique bands for identifying personnel. This
method does not suffer from the current limitations of "Dog Tags"
which can be lost, switched, or stolen, making positive
identification difficult. The polynucleotides of the present
invention can be used as additional DNA markers for RFLP.
[0531] The polynucleotides of the present invention can also be
used as an alternative to RFLP, by determining the actual
base-by-base DNA sequence of selected portions of an individual's
genome. These sequences can be used to prepare PCR primers for
amplifying and isolating such selected DNA, which can then be
sequenced. Using this technique, individuals can be identified
because each individual will have a unique set of DNA sequences.
Once an unique ID database is established for an individual,
positive identification of that individual, living or dead, can be
made from extremely small tissue samples.
[0532] Forensic biology also benefits from using DNA-based
identification techniques as disclosed herein. DNA sequences taken
from very small biological samples such as tissues, e.g., hair or
skin, or body fluids, e.g., blood, saliva, semen, synovial fluid,
amniotic fluid, breast milk, lymph, pulmonary sputum or surfactant,
urine, fecal matter, etc., can be amplified using PCR. In one prior
art technique, gene sequences amplified from polymorphic loci, such
as DQa class II HLA gene, are used in forensic biology to identify
individuals. (Erlich, H., PCR Technology, Freeman and Co. (1992)).
Once these specific polymorphic loci are amplified, they are
digested with one or more restriction enzymes, yielding an
identifying set of bands on a Southern blot probed with DNA
corresponding to the DQa class II HLA gene. Similarly,
polynucleotides of the present invention can be used as polymorphic
markers for forensic purposes.
[0533] There is also a need for reagents capable of identifying the
source of a particular tissue. Such need arises, for example, in
forensics when presented with tissue of unknown origin. Appropriate
reagents can comprise, for example, DNA probes or primers prepared
from the sequences of the present invention, specific to tissues,
including but not limited to those shown in Table 1B. Panels of
such reagents can identify tissue by species and/or by organ type.
In a similar fashion, these reagents can be used to screen tissue
cultures for contamination. Additional non-limiting examples of
such uses are further described herein.
[0534] The polynucleotides of the present invention are also useful
as hybridization probes for differential identification of the
tissue(s) or cell type(s) present in a biological sample.
Similarly, polypeptides and antibodies directed to polypeptides of
the present invention are useful to provide immunological probes
for differential identification of the tissue(s) (e.g.,
immunohistochemistry assays) or cell type(s) (e.g.,
immunocytochemistry assays). In addition, for a number of disorders
of the above tissues or cells, significantly higher or lower levels
of gene expression of the polynucleotides/polypeptides of the
present invention may be detected in certain tissues (e.g., tissues
expressing polypeptides and/or polynucleotides of the present
invention, for example, those disclosed in column 5 of Table 1B.2,
and/or cancerous and/or wounded tissues) or bodily fluids (e.g.,
semen, lymph, vaginal pool, serum, plasma, urine, synovial fluid or
spinal fluid) taken from an individual having such a disorder,
relative to a "standard" gene expression level, i.e., the
expression level in healthy tissue from an individual not having
the disorder.
[0535] Thus, the invention provides a diagnostic method of a
disorder, which involves: (a) assaying gene expression level in
cells or body fluid of an individual; (b) comparing the gene
expression level with a standard gene expression level, whereby an
increase or decrease in the assayed gene expression level compared
to the standard expression level is indicative of a disorder.
[0536] In the very least, the polynucleotides of the present
invention can be used as molecular weight markers on Southern gels,
as diagnostic probes for the presence of a specific mRNA in a
particular cell type, as a probe to "subtract-out" known sequences
in the process of discovering novel polynucleotides, for selecting
and making oligomers for attachment to a "gene chip" or other
support, to raise anti-DNA antibodies using DNA immunization
techniques, and as an antigen to elicit an immune response.
Uses of the Polypeptides
[0537] Each of the polypeptides identified herein can be used in
numerous ways. The following description should be considered
exemplary and utilizes known techniques.
[0538] Polypeptides and antibodies directed to polypeptides of the
present invention are useful to provide immunological probes for
differential identification of the tissue(s) (e.g.,
immunohistochemistry assays such as, for example, ABC
immunoperoxidase (Hsu et al., J. Histochem. Cytochem. 29:577-580
(1981)) or cell type(s) (e.g., immunocytochemistry assays).
[0539] Antibodies can be used to assay levels of polypeptides
encoded by polynucleotides of the invention in a biological sample
using classical immunohistological methods known to those of skill
in the art (e.g., see Jalkanen, et al., J. Cell. Biol. 101:976-985
(1985); Jalkanen, et al., J. Cell. Biol. 105:3087-3096 (1987)).
Other antibody-based methods useful for detecting protein gene
expression include immunoassays, such as the enzyme linked
immunosorbent assay (ELISA) and the radioimmunoassay (RIA).
Suitable antibody assay labels are known in the art and include
enzyme labels, such as, glucose oxidase; radioisotopes, such as
iodine (.sup.131I, .sup.125I, .sup.123I, .sup.121I), carbon
(.sup.14C), sulfur (.sup.35S), tritium (.sup.3H), indium
(.sup.115mIn, .sup.113mIn, .sup.112In, .sup.111In), and technetium
(.sup.99Tc, .sup.99mTc), thallium (.sup.201Ti), gallium (.sup.68Ga,
.sup.67Ga), palladium (.sup.103Pd), molybdenum (.sup.99Mo), xenon
(.sup.133Xe), fluorine (.sup.18F), .sup.153Sm, .sup.177Lu,
.sup.159Gd, .sup.149 Pm, .sup.140La, .sup.175Yb, .sup.166Ho,
.sup.90Y, .sup.47Sc, .sup.186Re, .sup.188Re, .sup.142Pr,
.sup.105Rh, .sup.97Ru; luminescent labels, such as luminol; and
fluorescent labels, such as fluorescein and rhodamine, and
biotin.
[0540] In addition to assaying levels of polypeptide of the present
invention in a biological sample, proteins can also be detected in
vivo by imaging. Antibody labels or markers for in vivo imaging of
protein include those detectable by X-radiography, NMR or ESR. For
X-radiography, suitable labels include radioisotopes such as barium
or cesium, which emit detectable radiation but are not overtly
harmful to the subject. Suitable markers for NMR and ESR include
those with a detectable characteristic spin, such as deuterium,
which may be incorporated into the antibody by labeling of
nutrients for the relevant hybridoma.
[0541] A protein-specific antibody or antibody fragment which has
been labeled with an appropriate detectable imaging moiety, such as
a radioisotope (for example, .sup.131I, .sup.112In, .sup.99mTc,
(.sup.131I, .sup.125I, .sup.123I, .sup.121I), carbon (.sup.14C),
sulfur (.sup.35S), tritium (.sup.3H), indium (.sup.115mIn,
.sup.113mIn, .sup.112In, .sup.111In), and technetium (.sup.99Tc,
.sup.99mTc), thallium (.sup.201Ti), gallium (.sup.68Ga, .sup.67Ga),
palladium (.sup.103Pd), molybdenum (.sup.99Mo), xenon (.sup.133Xe),
fluorine (.sup.18F, .sup.153Sm, .sup.177Lu, .sup.159Gd, .sup.149
Pm, .sup.140La, .sup.175Yb, .sup.166Ho, .sup.90Y, .sup.47Sc,
.sup.186Re, .sup.188Re, .sup.142Pr, .sup.105Rh, .sup.97Ru), a
radio-opaque substance, or a material detectable by nuclear
magnetic resonance, is introduced (for example, parenterally,
subcutaneously or intraperitoneally) into the mammal to be examined
for immune system disorder. It will be understood in the art that
the size of the subject and the imaging system used will determine
the quantity of imaging moiety needed to produce diagnostic images.
In the case of a radioisotope moiety, for a human subject, the
quantity of radioactivity injected will normally range from about 5
to 20 millicuries of .sup.99mTc. The labeled antibody or antibody
fragment will then preferentially accumulate at the location of
cells which express the polypeptide encoded by a polynucleotide of
the invention. In vivo tumor imaging is described in S. W. Burchiel
et al., "Immunopharmacokinetics of Radiolabeled Antibodies and
Their Fragments" (Chapter 13 in Tumor Imaging: The Radiochemical
Detection of Cancer, S. W. Burchiel and B. A. Rhodes, eds., Masson
Publishing Inc. (1982)).
[0542] In one embodiment, the invention provides a method for the
specific delivery of compositions of the invention to cells by
administering polypeptides of the invention (e.g., polypeptides
encoded by polynucleotides of the invention and/or antibodies) that
are associated with heterologous polypeptides or nucleic acids. In
one example, the invention provides a method for delivering a
therapeutic protein into the targeted cell. In another example, the
invention provides a method for delivering a single stranded
nucleic acid (e.g., antisense or ribozymes) or double stranded
nucleic acid (e.g., DNA that can integrate into the cell's genome
or replicate episomally and that can be transcribed) into the
targeted cell.
[0543] In another embodiment, the invention provides a method for
the specific destruction of cells (e.g., the destruction of tumor
cells) by administering polypeptides of the invention in
association with toxins or cytotoxic prodrugs.
[0544] By "toxin" is meant one or more compounds that bind and
activate endogenous cytotoxic effector systems, radioisotopes,
holotoxins, modified toxins, catalytic subunits of toxins, or any
molecules or enzymes not normally present in or on the surface of a
cell that under defined conditions cause the cell's death. Toxins
that may be used according to the methods of the invention include,
but are not limited to, radioisotopes known in the art, compounds
such as, for example, antibodies (or complement fixing containing
portions thereof) that bind an inherent or induced endogenous
cytotoxic effector system, thymidine kinase, endonuclease, RNAse,
alpha toxin, ricin, abrin, Pseudomonas exotoxin A, diphtheria
toxin, saporin, momordin, gelonin, pokeweed antiviral protein,
alpha-sarcin and cholera toxin. "Toxin" also includes a cytostatic
or cytocidal agent, a therapeutic agent or a radioactive metal ion,
e.g., alpha-emitters such as, for example, .sup.213Bi, or other
radioisotopes such as, for example, .sup.103Pd, .sup.133Xe,
.sup.131I, .sup.68Ge, .sup.57Co, .sup.65Zn, .sup.85Sr, .sup.32P,
.sup.35S, .sup.90Y, .sup.153Sm, .sup.153Gd, .sup.169Yb, .sup.51Cr,
.sup.54Mn, .sup.75Se, .sup.113Sn, .sup.90Yttrium, .sup.117Tin,
.sup.186Rhenium, .sup.166Holmium, and .sup.188Rhenium; luminescent
labels, such as luminol; and fluorescent labels, such as
fluorescein and rhodamine, and biotin. In a specific embodiment,
the invention provides a method for the specific destruction of
cells (e.g., the destruction of tumor cells) by administering
polypeptides of the invention or antibodies of the invention in
association with the radioisotope .sup.90Y. In another specific
embodiment, the invention provides a method for the specific
destruction of cells (e.g., the destruction of tumor cells) by
administering polypeptides of the invention or antibodies of the
invention in association with the radioisotope .sup.111In. In a
further specific embodiment, the invention provides a method for
the specific destruction of cells (e.g., the destruction of tumor
cells) by administering polypeptides of the invention or antibodies
of the invention in association with the radioisotope
.sup.131I.
[0545] Techniques known in the art may be applied to label
polypeptides of the invention (including antibodies). Such
techniques include, but are not limited to, the use of bifunctional
conjugating agents (see e.g., U.S. Pat. Nos. 5,756,065; 5,714,631;
5,696,239; 5,652,361; 5,505,931; 5,489,425; 5,435,990; 5,428,139;
5,342,604; 5,274,119; 4,994,560; and 5,808,003; the contents of
each of which are hereby incorporated by reference in its
entirety).
[0546] Thus, the invention provides a diagnostic method of a
disorder, which involves (a) assaying the expression level of a
polypeptide of the present invention in cells or body fluid of an
individual; and (b) comparing the assayed polypeptide expression
level with a standard polypeptide expression level, whereby an
increase or decrease in the assayed polypeptide expression level
compared to the standard expression level is indicative of a
disorder. With respect to cancer, the presence of a relatively high
amount of transcript in biopsied tissue from an individual may
indicate a predisposition for the development of the disease, or
may provide a means for detecting the disease prior to the
appearance of actual clinical symptoms. A more definitive diagnosis
of this type may allow health professionals to employ preventative
measures or aggressive treatment earlier thereby preventing the
development or further progression of the cancer.
[0547] Moreover, polypeptides of the present invention can be used
to treat or prevent diseases or conditions such as, for example,
neural disorders, immune system disorders, muscular disorders,
reproductive disorders, gastrointestinal disorders, pulmonary
disorders, cardiovascular disorders, renal disorders, proliferative
disorders, and/or cancerous diseases and conditions. For example,
patients can be administered a polypeptide of the present invention
in an effort to replace absent or decreased levels of the
polypeptide (e.g., insulin), to supplement absent or decreased
levels of a different polypeptide (e.g., hemoglobin S for
hemoglobin B, SOD, catalase, DNA repair proteins), to inhibit the
activity of a polypeptide (e.g., an oncogene or tumor supressor),
to activate the activity of a polypeptide (e.g., by binding to a
receptor), to reduce the activity of a membrane bound receptor by
competing with it for free ligand (e.g., soluble TNF receptors used
in reducing inflammation), or to bring about a desired response
(e.g., blood vessel growth inhibition, enhancement of the immune
response to proliferative cells or tissues).
[0548] Similarly, antibodies directed to a polypeptide of the
present invention can also be used to treat disease (as described
supra, and elsewhere herein). For example, administration of an
antibody directed to a polypeptide of the present invention can
bind, and/or neutralize the polypeptide, and/or reduce
overproduction of the polypeptide. Similarly, administration of an
antibody can activate the polypeptide, such as by binding to a
polypeptide bound to a membrane (receptor).
[0549] At the very least, the polypeptides of the present invention
can be used as molecular weight markers on SDS-PAGE gels or on
molecular sieve gel filtration columns using methods well known to
those of skill in the art. Polypeptides can also be used to raise
antibodies, which in turn are used to measure protein expression
from a recombinant cell, as a way of assessing transformation of
the host cell. Moreover, the polypeptides of the present invention
can be used to test the biological activities described herein.
Diagnostic Assays
[0550] The compounds of the present invention are useful for
diagnosis, treatment, prevention and/or prognosis of various
disorders in mammals, preferably humans. Such disorders include,
but are not limited to, those described in the legends for Tables
1D and 1E and as indicated in the "Preferred Indications" columns
in Table 1D and Table 1E; and, also as described herein under the
section heading "Biological Activities".
[0551] For a number of disorders, substantially altered (increased
or decreased) levels of gene expression can be detected in tissues,
cells or bodily fluids (e.g., sera, plasma, urine, semen, synovial
fluid or spinal fluid) taken from an individual having such a
disorder, relative to a "standard" gene expression level, that is,
the expression level in tissues or bodily fluids from an individual
not having the disorder. Thus, the invention provides a diagnostic
method useful during diagnosis of a disorder, which involves
measuring the expression level of the gene encoding the polypeptide
in tissues, cells or body fluid from an individual and comparing
the measured gene expression level with a standard gene expression
level, whereby an increase or decrease in the gene expression
level(s) compared to the standard is indicative of a disorder.
These diagnostic assays may be performed in vivo or in vitro, such
as, for example, on blood samples, biopsy tissue or autopsy
tissue.
[0552] The present invention is also useful as a prognostic
indicator, whereby patients exhibiting enhanced or depressed gene
expression will experience a worse clinical outcome relative to
patients expressing the gene at a level nearer the standard
level.
[0553] In certain embodiments, a polypeptide of the invention, or
polynucleotides, antibodies, agonists, or antagonists corresponding
to that polypeptide, may be used to diagnose and/or prognose
diseases and/or disorders associated with the tissue(s) in which
the polypeptide of the invention is expressed, including one, two,
three, four, five, or more tissues disclosed in Table 1B.2, column
5 (Tissue Distribution Library Code).
[0554] By "assaying the expression level of the gene encoding the
polypeptide" is intended qualitatively or quantitatively measuring
or estimating the level of the polypeptide of the invention or the
level of the mRNA encoding the polypeptide of the invention in a
first biological sample either directly (e.g., by determining or
estimating absolute protein level or mRNA level) or relatively
(e.g., by comparing to the polypeptide level or mRNA level in a
second biological sample). Preferably, the polypeptide expression
level or mRNA level in the first biological sample is measured or
estimated and compared to a standard polypeptide level or mRNA
level, the standard being taken from a second biological sample
obtained from an individual not having the disorder or being
determined by averaging levels from a population of individuals not
having the disorder. As will be appreciated in the art, once a
standard polypeptide level or mRNA level is known, it can be used
repeatedly as a standard for comparison.
[0555] By "biological sample" is intended any biological sample
obtained from an individual, cell line, tissue culture, or other
source containing polypeptides of the invention (including portions
thereof) or mRNA. As indicated, biological samples include body
fluids (such as sera, plasma, urine, synovial fluid and spinal
fluid) and tissue sources found to express the full length or
fragments thereof of a polypeptide or mRNA. Methods for obtaining
tissue biopsies and body fluids from mammals are well known in the
art. Where the biological sample is to include mRNA, a tissue
biopsy is the preferred source.
[0556] Total cellular RNA can be isolated from a biological sample
using any suitable technique such as the single-step
guanidinium-thiocyanate-phenol-chloroform method described in
Chomczynski and Sacchi, Anal. Biochem. 162:156-159 (1987). Levels
of mRNA encoding the polypeptides of the invention are then assayed
using any appropriate method. These include Northern blot analysis,
S1 nuclease mapping, the polymerase chain reaction (PCR), reverse
transcription in combination with the polymerase chain reaction
(RT-PCR), and reverse transcription in combination with the ligase
chain reaction (RT-LCR).
[0557] The present invention also relates to diagnostic assays such
as quantitative and diagnostic assays for detecting levels of
polypeptides of the invention, in a biological sample (e.g., cells
and tissues), including determination of normal and abnormal levels
of polypeptides. Thus, for instance, a diagnostic assay in
accordance with the invention for detecting over-expression of
polypeptides of the invention compared to normal control tissue
samples may be used to detect the presence of tumors. Assay
techniques that can be used to determine levels of a polypeptide,
such as a polypeptide of the present invention in a sample derived
from a host are well-known to those of skill in the art. Such assay
methods include radioimmunoassays, competitive-binding assays,
Western Blot analysis and ELISA assays. Assaying polypeptide levels
in a biological sample can occur using any art-known method.
[0558] Assaying polypeptide levels in a biological sample can occur
using antibody-based techniques. For example, polypeptide
expression in tissues can be studied with classical
immunohistological methods (Jalkanen et al., J. Cell. Biol.
101:976-985 (1985); Jalkanen, M., et al., J. Cell. Biol.
105:3087-3096 (1987)). Other antibody-based methods useful for
detecting polypeptide gene expression include immunoassays, such as
the enzyme linked immunosorbent assay (ELISA) and the
radioimmunoassay (RIA). Suitable antibody assay labels are known in
the art and include enzyme labels, such as, glucose oxidase, and
radioisotopes, such as iodine (.sup.125I, .sup.121I), carbon
(.sup.14C), sulfur (.sup.35S), tritium (.sup.3H), indium
(.sup.112In), and technetium (.sup.99mTc), and fluorescent labels,
such as fluorescein and rhodamine, and biotin.
[0559] The tissue or cell type to be analyzed will generally
include those which are known, or suspected, to express the gene of
inteest (such as, for example, cancer). The protein isolation
methods employed herein may, for example, be such as those
described in Harlow and Lane (Harlow, E. and Lane, D., 1988,
"Antibodies: A Laboratory Manual", Cold Spring Harbor Laboratory
Press, Cold Spring Harbor, N.Y.), which is incorporated herein by
reference in its entirety. The isolated cells can be derived from
cell culture or from a patient. The analysis of cells taken from
culture may be a necessary step in the assessment of cells that
could be used as part of a cell-based gene therapy technique or,
alternatively, to test the effect of compounds on the expression of
the gene.
[0560] For example, antibodies, or fragments of antibodies, such as
those described herein, may be used to quantitatively or
qualitatively detect the presence of gene products or conserved
variants or peptide fragments thereof. This can be accomplished,
for example, by immunofluorescence techniques employing a
fluorescently labeled antibody coupled with light microscopic, flow
cytometric, or fluorimetric detection.
[0561] In a preferred embodiment, antibodies, or fragments of
antibodies directed to any one or all of the predicted epitope
domains of the polypeptides of the invention (shown in column 7 of
Table 1B.1) may be used to quantitatively or qualitatively detect
the presence of gene products or conserved variants or peptide
fragments thereof. This can be accomplished, for example, by
immunofluorescence techniques employing a fluorescently labeled
antibody coupled with light microscopic, flow cytometric, or
fluorimetric detection.
[0562] In an additional preferred embodiment, antibodies, or
fragments of antibodies directed to a conformational epitope of a
polypeptide of the invention may be used to quantitatively or
qualitatively detect the presence of gene products or conserved
variants or peptide fragments thereof. This can be accomplished,
for example, by immunofluorescence techniques employing a
fluorescently labeled antibody coupled with light microscopic, flow
cytometric, or fluorimetric detection.
[0563] The antibodies (or fragments thereof), and/or polypeptides
of the present invention may, additionally, be employed
histologically, as in immunofluorescence, immunoelectron microscopy
or non-immunological assays, for in situ detection of gene products
or conserved variants or peptide fragments thereof. In situ
detection may be accomplished by removing a histological specimen
from a patient, and applying thereto a labeled antibody or
polypeptide of the present invention. The antibody (or fragment
thereof) or polypeptide is preferably applied by overlaying the
labeled antibody (or fragment) onto a biological sample. Through
the use of such a procedure, it is possible to determine not only
the presence of the gene product, or conserved variants or peptide
fragments, or polypeptide binding, but also its distribution in the
examined tissue. Using the present invention, those of ordinary
skill will readily perceive that any of a wide variety of
histological methods (such as staining procedures) can be modified
in order to achieve such in situ detection.
[0564] Immunoassays and non-immunoassays for gene products or
conserved variants or peptide fragments thereof will typically
comprise incubating a sample, such as a biological fluid, a tissue
extract, freshly harvested cells, or lysates of cells which have
been incubated in cell culture, in the presence of a detectably
labeled antibody capable of binding gene products or conserved
variants or peptide fragments thereof, and detecting the bound
antibody by any of a number of techniques well-known in the
art.
[0565] The biological sample may be brought in contact with and
immobilized onto a solid phase support or carrier such as
nitrocellulose, or other solid support which is capable of
immobilizing cells, cell particles or soluble proteins. The support
may then be washed with suitable buffers followed by treatment with
the detectably labeled antibody or detectable polypeptide of the
invention. The solid phase support may then be washed with the
buffer a second time to remove unbound antibody or polypeptide.
Optionally the antibody is subsequently labeled. The amount of
bound label on solid support may then be detected by conventional
means.
[0566] By "solid phase support or carrier" is intended any support
capable of binding an antigen or an antibody. Well-known supports
or carriers include glass, polystyrene, polypropylene,
polyethylene, dextran, nylon, amylases, natural and modified
celluloses, polyacrylamides, gabbros, and magnetite. The nature of
the carrier can be either soluble to some extent or insoluble for
the purposes of the present invention. The support material may
have virtually any possible structural configuration so long as the
coupled molecule is capable of binding to an antigen or antibody.
Thus, the support configuration may be spherical, as in a bead, or
cylindrical, as in the inside surface of a test tube, or the
external surface of a rod. Alternatively, the surface may be flat
such as a sheet, test strip, etc. Preferred supports include
polystyrene beads. Those skilled in the art will know many other
suitable carriers for binding antibody or antigen, or will be able
to ascertain the same by use of routine experimentation.
[0567] The binding activity of a given lot of antibody or antigen
polypeptide may be determined according to well known methods.
Those skilled in the art will be able to determine operative and
optimal assay conditions for each determination by employing
routine experimentation.
[0568] In addition to assaying polypeptide levels or polynucleotide
levels in a biological sample obtained from an individual,
polypeptide or polynucleotide can also be detected in vivo by
imaging. For example, in one embodiment of the invention,
polypeptides and/or antibodies of the invention are used to image
diseased cells, such as neoplasms. In another embodiment,
polynucleotides of the invention (e.g., polynucleotides
complementary to all or a portion of an mRNA) and/or antibodies
(e.g., antibodies directed to any one or a combination of the
epitopes of a polypeptide of the invention, antibodies directed to
a conformational epitope of a polypeptide of the invention, or
antibodies directed to the full length polypeptide expressed on the
cell surface of a mammalian cell) are used to image diseased or
neoplastic cells.
[0569] Antibody labels or markers for in vivo imaging of
polypeptides of the invention include those detectable by
X-radiography, NMR, MRI, CAT-scans or ESR. For X-radiography,
suitable labels include radioisotopes such as barium or cesium,
which emit detectable radiation but are not overtly harmful to the
subject. Suitable markers for NMR and ESR include those with a
detectable characteristic spin, such as deuterium, which may be
incorporated into the antibody by labeling of nutrients for the
relevant hybridoma. Where in vivo imaging is used to detect
enhanced levels of polypeptides for diagnosis in humans, it may be
preferable to use human antibodies or "humanized" chimeric
monoclonal antibodies. Such antibodies can be produced using
techniques described herein or otherwise known in the art. For
example methods for producing chimeric antibodies are known in the
art. See, for review, Morrison, Science 229:1202 (1985); Oi et al.,
BioTechniques 4:214 (1986); Cabilly et al., U.S. Pat. No.
4,816,567; Taniguchi et al., EP 171496; Morrison et al., EP 173494;
Neuberger et al., WO 8601533; Robinson et al., WO 8702671;
Boulianne et al., Nature 312:643 (1984); Neuberger et al., Nature
314:268 (1985).
[0570] Additionally, any polypeptides of the invention whose
presence can be detected, can be administered. For example,
polypeptides of the invention labeled with a radio-opaque or other
appropriate compound can be administered and visualized in vivo, as
discussed, above for labeled antibodies. Further, such polypeptides
can be utilized for in vitro diagnostic procedures.
[0571] A polypeptide-specific antibody or antibody fragment which
has been labeled with an appropriate detectable imaging moiety,
such as a radioisotope (for example, .sup.131I, .sup.112In,
.sup.99mTc), a radio-opaque substance, or a material detectable by
nuclear magnetic resonance, is introduced (for example,
parenterally, subcutaneously or intraperitoneally) into the mammal
to be examined for a disorder. It will be understood in the art
that the size of the subject and the imaging system used will
determine the quantity of imaging moiety needed to produce
diagnostic images. In the case of a radioisotope moiety, for a
human subject, the quantity of radioactivity injected will normally
range from about 5 to 20 millicuries of .sup.99mTc. The labeled
antibody or antibody fragment will then preferentially accumulate
at the location of cells which contain the antigenic protein. In
vivo tumor imaging is described in S. W. Burchiel et al.,
"Immunopharmacokinetics of Radiolabeled Antibodies and Their
Fragments" (Chapter 13 in Tumor Imaging: The Radiochemical
Detection of Cancer, S. W. Burchiel and B. A. Rhodes, eds., Masson
Publishing Inc. (1982)).
[0572] With respect to antibodies, one of the ways in which an
antibody of the present invention can be detectably labeled is by
linking the same to a reporter enzyme and using the linked product
in an enzyme immunoassay (EIA) (Voller, A., "The Enzyme Linked
Immunosorbent Assay (ELISA)", 1978, Diagnostic Horizons 2:1-7,
Microbiological Associates Quarterly Publication, Walkersville,
Md.); Voller et al., J. Clin. Pathol. 31:507-520 (1978); Butler, J.
E., Meth. Enzymol. 73:482-523 (1981); Maggio, E. (ed.), 1980,
Enzyme Immunoassay, CRC Press, Boca Raton, Fla.,; Ishikawa, E. et
al., (eds.), 1981, Enzyme Immunoassay, Kgaku Shoin, Tokyo). The
reporter enzyme which is bound to the antibody will react with an
appropriate substrate, preferably a chromogenic substrate, in such
a manner as to produce a chemical moiety which can be detected, for
example, by spectrophotometric, fluorimetric or by visual means.
Reporter enzymes which can be used to detectably label the antibody
include, but are not limited to, malate dehydrogenase,
staphylococcal nuclease, delta-5-steroid isomerase, yeast alcohol
dehydrogenase, alpha-glycerophosphate, dehydrogenase, triose
phosphate isomerase, horseradish peroxidase, alkaline phosphatase,
asparaginase, glucose oxidase, beta-galactosidase, ribonuclease,
urease, catalase, glucose-6-phosphate dehydrogenase, glucoamylase
and acetylcholinesterase. Additionally, the detection can be
accomplished by colorimetric methods which employ a chromogenic
substrate for the reporter enzyme. Detection may also be
accomplished by visual comparison of the extent of enzymatic
reaction of a substrate in comparison with similarly prepared
standards.
[0573] Detection may also be accomplished using any of a variety of
other immunoassays. For example, by radioactively labeling the
antibodies or antibody fragments, it is possible to detect
polypeptides through the use of a radioimmunoassay (RIA) (see, for
example, Weintraub, B., Principles of Radioimmunoassays, Seventh
Training Course on Radioligand Assay Techniques, The Endocrine
Society, March, 1986, which is incorporated by reference herein).
The radioactive isotope can be detected by means including, but not
limited to, a gamma counter, a scintillation counter, or
autoradiography.
[0574] It is also possible to label the antibody with a fluorescent
compound. When the fluorescently labeled antibody is exposed to
light of the proper wave length, its presence can then be detected
due to fluorescence. Among the most commonly used fluorescent
labeling compounds are fluorescein isothiocyanate, rhodamine,
phycoerythrin, phycocyanin, allophycocyanin, ophthaldehyde and
fluorescamine.
[0575] The antibody can also be detectably labeled using
fluorescence emitting metals such as .sup.152Eu, or others of the
lanthanide series. These metals can be attached to the antibody
using such metal chelating groups as diethylenetriaminepentacetic
acid (DTPA) or ethylenediaminetetraacetic acid (EDTA).
[0576] The antibody also can be detectably labeled by coupling it
to a chemiluminescent compound. The presence of the
chemiluminescent-tagged antibody is then determined by detecting
the presence of luminescence that arises during the course of a
chemical reaction. Examples of particularly useful chemiluminescent
labeling compounds are luminol, isoluminol, theromatic acridinium
ester, imidazole, acridinium salt and oxalate ester.
[0577] Likewise, a bioluminescent compound may be used to label the
antibody of the present invention. Bioluminescence is a type of
chemiluminescence found in biological systems in, which a catalytic
protein increases the efficiency of the chemiluminescent reaction.
The presence of a bioluminescent protein is determined by detecting
the presence of luminescence. Important bioluminescent compounds
for purposes of labeling are luciferin, luciferase and
aequorin.
Methods for Detecting Diseases
[0578] In general, a disease may be detected in a patient based on
the presence of one or more proteins of the invention and/or
polynucleotides encoding such proteins in a biological sample (for
example, blood, sera, urine, and/or tumor biopsies) obtained from
the patient. In other words, such proteins may be used as markers
to indicate the presence or absence of a disease or disorder,
including cancer and/or as described elsewhere herein. In addition,
such proteins may be useful for the detection of other diseases and
cancers. The binding agents provided herein generally permit
detection of the level of antigen that binds to the agent in the
biological sample. Polynucleotide primers and probes may be used to
detect the level of mRNA encoding polypeptides of the invention,
which is also indicative of the presence or absence of a disease or
disorder, including cancer. In general, polypeptides of the
invention should be present at a level that is at least three fold
higher in diseased tissue than in normal tissue.
[0579] There are a variety of assay formats known to those of
ordinary skill in the art for using a binding agent to detect
polypeptide markers in a sample. See, e.g., Harlow and Lane, supra.
In general, the presence or absence of a disease in a patient may
be determined by (a) contacting a biological sample obtained from a
patient with a binding agent; (b) detecting in the sample a level
of polypeptide that binds to the binding agent; and (c) comparing
the level of polypeptide with a predetermined cut-off value.
[0580] In a preferred embodiment, the assay involves the use of a
binding agent(s) immobilized on a solid support to bind to and
remove the polypeptide of the invention from the remainder of the
sample. The bound polypeptide may then be detected using a
detection reagent that contains a reporter group and specifically
binds to the binding agent/polypeptide complex. Such detection
reagents may comprise, for example, a binding agent that
specifically binds to the polypeptide or an antibody or other agent
that specifically binds to the binding agent, such as an
anti-immunoglobulin, protein G, protein A or a lectin.
Alternatively, a competitive assay may be utilized, in which a
polypeptide is labeled with a reporter group and allowed to bind to
the immobilized binding agent after incubation of the binding agent
with the sample. The extent to which components of the sample
inhibit the binding of the labeled polypeptide to the binding agent
is indicative of the reactivity of the sample with the immobilized
binding agent. Suitable polypeptides for use within such assays
include polypeptides of the invention and portions thereof, or
antibodies, to which the binding agent binds, as described
above.
[0581] The solid support may be any material known to those of
skill in the art to which polypeptides of the invention may be
attached. For example, the solid support may be a test well in a
microtiter plate or a nitrocellulose or other suitable membrane.
Alternatively, the support may be a bead or disc, such as glass
fiberglass, latex or a plastic material such as polystyrene or
polyvinylchloride. The support may also be a magnetic particle or a
fiber optic sensor, such as those disclosed, for example, in U.S.
Pat. No. 5,359,681. The binding agent may be immobilized on the
solid support using a variety of techniques known to those of skill
in the art, which are amply described in the patent and scientific
literature. In the context of the present invention, the term
"immobilization" refers to both noncovalent association, such as
adsorption, and covalent attachment (which may be a direct linkage
between the agent and functional groups on the support or may be a
linkage by way of a cross-linking agent). Immobilization by
adsorption to a well in a microtiter plate or to a membrane is
preferred. In such cases, adsorption may be achieved by contacting
the binding agent, in a suitable buffer, with the solid support for
the suitable amount of time. The contact time varies with
temperature, but is typically between about 1 hour and about 1 day.
In general, contacting a well of plastic microtiter plate (such as
polystyrene or polyvinylchloride) with an amount of binding agent
ranging from about 10 ng to about 10 ug, and preferably about 100
ng to about 1 ug, is sufficient to immobilize an adequate amount of
binding agent.
[0582] Covalent attachment of binding agent to a solid support may
generally be achieved by first reacting the support with a
bifunctional reagent that will react with both the support and a
functional group, such as a hydroxyl or amino group, on the binding
agent. For example, the binding agent may be covalently attached to
supports having an appropriate polymer coating using benzoquinone
or by condensation of an aldehyde group on the support with an
amine and an active hydrogen on the binding partner (see, e.g.,
Pierce Immunotechnology Catalog and Handbook, 1991, at
A12-A13).
Gene Therapy Methods
[0583] Also encompassed by the invention are gene therapy methods
for treating or preventing disorders, diseases and conditions. The
gene therapy methods relate to the introduction of nucleic acid
(DNA, RNA and antisense DNA or RNA) sequences into an animal to
achieve expression of the polypeptide of the present invention.
This method requires a polynucleotide which codes for a polypeptide
of the present invention operatively linked to a promoter and any
other genetic elements necessary for the expression of the
polypeptide by the target tissue. Such gene therapy and delivery
techniques are known in the art, see, for example, WO90/11092,
which is herein incorporated by reference.
[0584] Thus, for example, cells from a patient may be engineered
with a polynucleotide (DNA or RNA) comprising a promoter operably
linked to a polynucleotide of the present invention ex vivo, with
the engineered cells then being provided to a patient to be treated
with the polypeptide of the present invention. Such methods are
well-known in the art. For example, see Belldegrun, A., et al., J.
Natl. Cancer Inst. 85: 207-216 (1993); Ferrantini, M. et al.,
Cancer Research 53: 1107-1112 (1993); Ferrantini, M. et al., J.
Immunology 153: 4604-4615 (1994); Kaido, T., et al., Int. J. Cancer
60: 221-229 (1995); Ogura, H., et al., Cancer Research 50:
5102-5106 (1990); Santodonato, L., et al., Human Gene Therapy
7:1-10 (1996); Santodonato, L., et al., Gene Therapy 4:1246-1255
(1997); and Zhang, J.-F. et al., Cancer Gene Therapy 3: 31-38
(1996)), which are herein incorporated by reference. In one
embodiment, the cells which are engineered are arterial cells. The
arterial cells may be reintroduced into the patient through direct
injection to the artery, the tissues surrounding the artery, or
through catheter injection.
[0585] As discussed in more detail below, the polynucleotide
constructs can be delivered by any method that delivers injectable
materials to the cells of an animal, such as, injection into the
interstitial space of tissues (heart, muscle, skin, lung, liver,
and the like). The polynucleotide constructs may be delivered in a
pharmaceutically acceptable liquid or aqueous carrier.
[0586] In one embodiment, the polynucleotide of the present
invention is delivered as a naked polynucleotide. The term "naked"
polynucleotide, DNA or RNA refers to sequences that are free from
any delivery vehicle that acts to assist, promote or facilitate
entry into the cell, including viral sequences, viral particles,
liposome formulations, lipofectin or precipitating agents and the
like. However, the polynucleotide of the present invention can also
be delivered in liposome formulations and lipofectin formulations
and the like can be prepared by methods well known to those skilled
in the art. Such methods are described, for example, in U.S. Pat.
Nos. 5,593,972, 5,589,466, and 5,580,859, which are herein
incorporated by reference.
[0587] The polynucleotide vector constructs used in the gene
therapy method are preferably constructs that will not integrate
into the host genome nor will they contain sequences that allow for
replication. Appropriate vectors include pWLNEO, pSV2CAT, pOG44,
pXT1 and pSG available from Stratagene; pSVK3, pBPV, pMSG and pSVL
available from Pharmacia; and pEF1/V5, pcDNA3.1, and pRc/CMV2
available from Invitrogen. Other suitable vectors will be readily
apparent to the skilled artisan.
[0588] Any strong promoter known to those skilled in the art can be
used for driving the expression of the polynucleotide sequence.
Suitable promoters include adenoviral promoters, such as the
adenoviral major late promoter; or heterologous promoters, such as
the cytomegalovirus (CMV) promoter; the respiratory syncytial virus
(RSV) promoter; inducible promoters, such as the MMT promoter, the
metallothionein promoter; heat shock promoters; the albumin
promoter; the ApoAI promoter; human globin promoters; viral
thymidine kinase promoters, such as the Herpes Simplex thymidine
kinase promoter; retroviral LTRs; the b-actin promoter; and human
growth hormone promoters. The promoter also may be the native
promoter for the polynucleotide of the present invention.
[0589] Unlike other gene therapy techniques, one major advantage of
introducing naked nucleic acid sequences into target cells is the
transitory nature of the polynucleotide synthesis in the cells.
Studies have shown that non-replicating DNA sequences can be
introduced into cells to provide production of the desired
polypeptide for periods of up to six months.
[0590] The polynucleotide construct can be delivered to the
interstitial space of tissues within the an animal, including of
muscle, skin, brain, lung, liver, spleen, bone marrow, thymus,
heart, lymph, blood, bone, cartilage, pancreas, kidney, gall
bladder, stomach, intestine, testis, ovary, uterus, rectum, nervous
system, eye, gland, and connective tissue. Interstitial space of
the tissues comprises the intercellular, fluid, mucopolysaccharide
matrix among the reticular fibers of organ tissues, elastic fibers
in the walls of vessels or chambers, collagen fibers of fibrous
tissues, or that same matrix within connective tissue ensheathing
muscle cells or in the lacunae of bone. It is similarly the space
occupied by the plasma of the circulation and the lymph fluid of
the lymphatic channels. Delivery to the interstitial space of
muscle tissue is preferred for the reasons discussed below. They
may be conveniently delivered by injection into the tissues
comprising these cells. They are preferably delivered to and
expressed in persistent, non-dividing cells which are
differentiated, although delivery and expression may be achieved in
non-differentiated or less completely differentiated cells, such
as, for example, stem cells of blood or skin fibroblasts. In vivo
muscle cells are particularly competent in their ability to take up
and express polynucleotides.
[0591] For the naked nucleic acid sequence injection, an effective
dosage amount of DNA or RNA will be in the range of from about 0.05
mg/kg body weight to about 50 mg/kg body weight. Preferably the
dosage will be from about 0.005 mg/kg to about 20 mg/kg and more
preferably from about 0.05 mg/kg to about 5 mg/kg. Of course, as
the artisan of ordinary skill will appreciate, this dosage will
vary according to the tissue site of injection. The appropriate and
effective dosage of nucleic acid sequence can readily be determined
by those of ordinary skill in the art and may depend on the
condition being treated and the route of administration.
[0592] The preferred route of administration is by the parenteral
route of injection into the interstitial space of tissues. However,
other parenteral routes may also be used, such as, inhalation of an
aerosol formulation particularly for delivery to lungs or bronchial
tissues, throat or mucous membranes of the nose. In addition, naked
DNA constructs can be delivered to arteries during angioplasty by
the catheter used in the procedure.
[0593] The naked polynucleotides are delivered by any method known
in the art, including, but not limited to, direct needle injection
at the delivery site, intravenous injection, topical
administration, catheter infusion, and so-called "gene guns". These
delivery methods are known in the art.
[0594] The constructs may also be delivered with delivery vehicles
such as viral sequences, viral particles, liposome formulations,
lipofectin, precipitating agents, etc. Such methods of delivery are
known in the art.
[0595] In certain embodiments, the polynucleotide constructs are
complexed in a liposome preparation. Liposomal preparations for use
in the instant invention include cationic (positively charged),
anionic (negatively charged) and neutral preparations. However,
cationic liposomes are particularly preferred because a tight
charge complex can be formed between the cationic liposome and the
polyanionic nucleic acid. Cationic liposomes have been shown to
mediate intracellular delivery of plasmid DNA (Felgner et al.,
Proc. Natl. Acad. Sci. USA (1987) 84:7413-7416, which is herein
incorporated by reference); mRNA (Malone et al., Proc. Natl. Acad.
Sci. USA (1989) 86:6077-6081, which is herein incorporated by
reference); and purified transcription factors (Debs et al., J.
Biol. Chem. (1990) 265:10189-10192, which is herein incorporated by
reference), in functional form.
[0596] Cationic liposomes are readily available. For example,
N[1-2,3-dioleyloxy)propyl]-N,N,N-triethylammonium (DOTMA) liposomes
are particularly useful and are available under the trademark
Lipofectin, from GIBCO BRL, Grand Island, N.Y. (See, also, Felgner
et al., Proc. Natl. Acad. Sci. USA (1987) 84:7413-7416, which is
herein incorporated by reference). Other commercially available
liposomes include transfectace (DDAB/DOPE) and DOTAP/DOPE
(Boehringer).
[0597] Other cationic liposomes can be prepared from readily
available materials using techniques well known in the art. See,
e.g. PCT Publication No. WO 90/11092 (which is herein incorporated
by reference) for a description of the synthesis of DOTAP
(1,2-bis(oleoyloxy)-3-(trimethylammonio)propane) liposomes.
Preparation of DOTMA liposomes is explained in the literature, see,
e.g., P. Felgner et al., Proc. Natl. Acad. Sci. USA 84:7413-7417,
which is herein incorporated by reference. Similar methods can be
used to prepare liposomes from other cationic lipid materials.
[0598] Similarly, anionic and neutral liposomes are readily
available, such as from Avanti Polar Lipids (Birmingham, Ala.), or
can be easily prepared using readily available materials. Such
materials include phosphatidyl, choline, cholesterol, phosphatidyl
ethanolamine, dioleoylphosphatidyl choline (DOPC),
dioleoylphosphatidyl glycerol (DOPG), dioleoylphoshatidyl
ethanolamine (DOPE), among others. These materials can also be
mixed with the DOTMA and DOTAP starting materials in appropriate
ratios. Methods for making liposomes using these materials are well
known in the art.
[0599] For example, commercially dioleoylphosphatidyl choline
(DOPC), dioleoylphosphatidyl glycerol (DOPG), and
dioleoylphosphatidyl ethanolamine (DOPE) can be used in various
combinations to make conventional liposomes, with or without the
addition of cholesterol. Thus, for example, DOPG/DOPC vesicles can
be prepared by drying 50 mg each of DOPG and DOPC under a stream of
nitrogen gas into a sonication vial. The sample is placed under a
vacuum pump overnight and is hydrated the following day with
deionized water. The sample is then sonicated for 2 hours in a
capped vial, using a Heat Systems model 350 sonicator equipped with
an inverted cup (bath type) probe at the maximum setting while the
bath is circulated at 15EC. Alternatively, negatively charged
vesicles can be prepared without sonication to produce
multilamellar vesicles or by extrusion through nucleopore membranes
to produce unilamellar vesicles of discrete size. Other methods are
known and available to those of skill in the art.
[0600] The liposomes can comprise multilamellar vesicles (MLVs),
small unilamellar vesicles (SUVs), or large unilamellar vesicles
(LUVs), with SUVs being preferred. The various liposome-nucleic
acid complexes are prepared using methods well known in the art.
See, e.g., Straubinger et al., Methods of Immunology (1983),
101:512-527, which is herein incorporated by reference. For
example, MLVs containing nucleic acid can be prepared by depositing
a thin film of phospholipid on the walls of a glass tube and
subsequently hydrating with a solution of the material to be
encapsulated. SUVs are prepared by extended sonication of MLVs to
produce a homogeneous population of unilamellar liposomes. The
material to be entrapped is added to a suspension of preformed MLVs
and then sonicated. When using liposomes containing cationic
lipids, the dried lipid film is resuspended in an appropriate
solution such as sterile water or an isotonic buffer solution such
as 10 mM Tris/NaCl, sonicated, and then the preformed liposomes are
mixed directly with the DNA. The liposome and DNA form a very
stable complex due to binding of the positively charged liposomes
to the cationic DNA. SUVs find use with small nucleic acid
fragments. LUVs are prepared by a number of methods, well known in
the art. Commonly used methods include Ca.sup.2+-EDTA chelation
(Papahadjopoulos et al., Biochim. Biophys. Acta (1975) 394:483;
Wilson et al., Cell 17:77 (1979)); ether injection (Deamer, D. and
Bangham, A., Biochim. Biophys. Acta 443:629 (1976); Ostro et al.,
Biochem. Biophys. Res. Commun. 76:836 (1977); Fraley et al., Proc.
Natl. Acad. Sci. USA 76:3348 (1979)); detergent dialysis (Enoch, H.
and Strittmatter, P., Proc. Natl. Acad. Sci. USA 76:145 (1979));
and reverse-phase evaporation (REV) (Fraley et al., J. Biol. Chem.
255:10431 (1980); Szoka, F. and Papahadjopoulos, D., Proc. Natl.
Acad. Sci. USA 75:145 (1978); Schaefer-Ridder et al., Science
215:166 (1982)), which are herein incorporated by reference.
[0601] Generally, the ratio of DNA to liposomes will be from about
10:1 to about 1:10. Preferably, the ration will be from about 5:1
to about 1:5. More preferably, the ration will be about 3:1 to
about 1:3. Still more preferably, the ratio will be about 1:1.
[0602] U.S. Pat. No. 5,676,954 (which is herein incorporated by
reference) reports on the injection of genetic material, complexed
with cationic liposomes carriers, into mice. U.S. Pat. Nos.
4,897,355, 4,946,787, 5,049,386, 5,459,127, 5,589,466, 5,693,622,
5,580,859, 5,703,055, and international publication no. WO 94/9469
(which are herein incorporated by reference) provide cationic
lipids for use in transfecting DNA into cells and mammals. U.S.
Pat. Nos. 5,589,466, 5,693,622, 5,580,859, 5,703,055, and
international publication no. WO 94/9469 provide methods for
delivering DNA-cationic lipid complexes to mammals.
[0603] In certain embodiments, cells are engineered, ex vivo or in
vivo, using a retroviral particle containing RNA which comprises a
sequence encoding a polypeptide of the present invention.
Retroviruses from which the retroviral plasmid vectors may be
derived include, but are not limited to, Moloney Murine Leukemia
Virus, spleen necrosis virus, Rous sarcoma Virus, Harvey Sarcoma
Virus, avian leukosis virus, gibbon ape leukemia virus, human
immunodeficiency virus, Myeloproliferative Sarcoma Virus, and
mammary tumor virus.
[0604] The retroviral plasmid vector is employed to transduce
packaging cell lines to form producer cell lines. Examples of
packaging cells which may be transfected include, but are not
limited to, the PE501, PA317, R-2, R-AM, PA12, T19-14X,
VT-19-17-H2, RCRE, RCRIP, GP+E-86, GP+envAm12, and DAN cell lines
as described in Miller, Human Gene Therapy 1:5-14 (1990), which is
incorporated herein by reference in its entirety. The vector may
transduce the packaging cells through any means known in the art.
Such means include, but are not limited to, electroporation, the
use of liposomes, and CaPO.sub.4 precipitation. In one alternative,
the retroviral plasmid vector may be encapsulated into a liposome,
or coupled to a lipid, and then administered to a host.
[0605] The producer cell line generates infectious retroviral
vector particles which include polynucleotide encoding a
polypeptide of the present invention. Such retroviral vector
particles then may be employed, to transduce eukaryotic cells,
either in vitro or in vivo. The transduced eukaryotic cells will
express a polypeptide of the present invention.
[0606] In certain other embodiments, cells are engineered, ex vivo
or in vivo, with polynucleotide contained in an adenovirus vector.
Adenovirus can be manipulated such that it encodes and expresses a
polypeptide of the present invention, and at the same time is
inactivated in terms of its ability to replicate in a normal lytic
viral life cycle. Adenovirus expression is achieved without
integration of the viral DNA into the host cell chromosome, thereby
alleviating concerns about insertional mutagenesis. Furthermore,
adenoviruses have been used as live enteric vaccines for many years
with an excellent safety profile (Schwartz et al. Am. Rev. Respir.
Dis. 109:233-238 (1974)). Finally, adenovirus mediated gene
transfer has been demonstrated in a number of instances including
transfer of alpha-1-antitrypsin and CFTR to the lungs of cotton
rats (Rosenfeld, M. A. et al. (1991) Science 252:431-434; Rosenfeld
et al., (1992) Cell 68:143-155). Furthermore, extensive studies to
attempt to establish adenovirus as a causative agent in human
cancer were uniformly negative (Green, M. et al. (1979) Proc. Natl.
Acad. Sci. USA 76:6606).
[0607] Suitable adenoviral vectors useful in the present invention
are described, for example, in Kozarsky and Wilson, Curr. Opin.
Genet. Devel. 3:499-503 (1993); Rosenfeld et al., Cell 68:143-155
(1992); Engelhardt et al., Human Genet. Ther. 4:759-769 (1993);
Yang et al., Nature Genet. 7:362-369 (1994); Wilson et al., Nature
365:691-692 (1993); and U.S. Pat. No. 5,652,224, which are herein
incorporated by reference. For example, the adenovirus vector Ad2
is useful and can be grown in human 293 cells. These cells contain
the E1 region of adenovirus and constitutively express E1a and E1b,
which complement the defective adenoviruses by providing the
products of the genes deleted from the vector. In addition to Ad2,
other varieties of adenovirus (e.g., Ad3, Ad5, and Ad7) are also
useful in the present invention.
[0608] Preferably, the adenoviruses used in the present invention
are replication deficient. Replication deficient adenoviruses
require the aid of a helper virus and/or packaging cell line to
form infectious particles. The resulting virus is capable of
infecting cells and can express a polynucleotide of interest which
is operably linked to a promoter, but cannot replicate in most
cells. Replication deficient adenoviruses may be deleted in one or
more of all or a portion of the following genes: E1a, E1b, E3, E4,
E2a, or L1 through L5.
[0609] In certain other embodiments, the cells are engineered, ex
vivo or in vivo, using an adeno-associated virus (AAV). AAVs are
naturally occurring defective viruses that require helper viruses
to produce infectious particles (Muzyczka, N., Curr. Topics in
Microbiol. Immunol. 158:97 (1992)). It is also one of the few
viruses that may integrate its DNA into non-dividing cells. Vectors
containing as little as 300 base pairs of AAV can be packaged and
can integrate, but space for exogenous DNA is limited to about 4.5
kb. Methods for producing and using such AAVs are known in the art.
See, for example, U.S. Pat. Nos. 5,139,941, 5,173,414, 5,354,678,
5,436,146, 5,474,935, 5,478,745, and 5,589,377.
[0610] For example, an appropriate AAV vector for use in the
present invention will include all the sequences necessary for DNA
replication, encapsidation, and host-cell integration. The
polynucleotide construct is inserted into the AAV vector using
standard cloning methods, such as those found in Sambrook et al.,
Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Press
(1989). The recombinant AAV vector is then transfected into
packaging cells which are infected with a helper virus, using any
standard technique, including lipofection, electroporation, calcium
phosphate precipitation, etc. Appropriate helper viruses include
adenoviruses, cytomegaloviruses, vaccinia viruses, or herpes
viruses. Once the packaging cells are transfected and infected,
they will produce infectious AAV viral particles which contain the
polynucleotide construct. These viral particles are then used to
transduce eukaryotic cells, either ex vivo or in vivo. The
transduced cells will contain the polynucleotide construct
integrated into its genome, and will express a polypeptide of the
invention.
[0611] Another method of gene therapy involves operably associating
heterologous control regions and endogenous polynucleotide
sequences (e.g. encoding a polypeptide of the present invention)
via homologous recombination (see, e.g., U.S. Pat. No. 5,641,670,
issued Jun. 24, 1997; International Publication No. WO 96/29411,
published Sep. 26, 1996; International Publication No. WO 94/12650,
published Aug. 4, 1994; Koller et al., Proc. Natl. Acad. Sci. USA
86:8932-8935 (1989); and Zijlstra et al., Nature 342:435-438
(1989), which are herein encorporated by reference. This method
involves the activation of a gene which is present in the target
cells, but which is not normally expressed in the cells, or is
expressed at a lower level than desired.
[0612] Polynucleotide constructs are made, using standard
techniques known in the art, which contain the promoter with
targeting sequences flanking the promoter. Suitable promoters are
described herein. The targeting sequence is sufficiently
complementary to an endogenous sequence to permit homologous
recombination of the promoter-targeting sequence with the
endogenous sequence. The targeting sequence will be sufficiently
near the 5' end of the desired endogenous polynucleotide sequence
so the promoter will be operably linked to the endogenous sequence
upon homologous recombination.
[0613] The promoter and the targeting sequences can be amplified
using PCR. Preferably, the amplified promoter contains distinct
restriction enzyme sites on the 5' and 3' ends. Preferably, the 3'
end of the first targeting sequence contains the same restriction
enzyme site as the 5' end of the amplified promoter and the 5' end
of the second targeting sequence contains the same restriction site
as the 3' end of the amplified promoter. The amplified promoter and
targeting sequences are digested and ligated together.
[0614] The promoter-targeting sequence construct is delivered to
the cells, either as naked polynucleotide, or in conjunction with
transfection-facilitating agents, such as liposomes, viral
sequences, viral particles, whole viruses, lipofection,
precipitating agents, etc., described in more detail above. The P
promoter-targeting sequence can be delivered by any method,
included direct needle injection, intravenous injection, topical
administration, catheter infusion, particle accelerators, etc. The
methods are described in more detail below.
[0615] The promoter-targeting sequence construct is taken up by
cells. Homologous recombination between the construct and the
endogenous sequence takes place, such that an endogenous sequence
is placed under the control of the promoter. The promoter then
drives the expression of the endogenous sequence.
[0616] The polynucleotide encoding a polypeptide of the present
invention may contain a secretory signal sequence that facilitates
secretion of the protein. Typically, the signal sequence is
positioned in the coding region of the polynucleotide to be
expressed towards or at the 5' end of the coding region. The signal
sequence may be homologous or heterologous to the polynucleotide of
interest and may be homologous or heterologous to the cells to be
transfected. Additionally, the signal sequence may be chemically
synthesized using methods known in the art.
[0617] Any mode of administration of any of the above-described
polynucleotides constructs can be used so long as the mode results
in the expression of one or more molecules in an amount sufficient
to provide a therapeutic effect. This includes direct needle
injection, systemic injection, catheter infusion, biolistic
injectors, particle accelerators (i.e., "gene guns"), gelfoam
sponge depots, other commercially available depot materials,
osmotic pumps (e.g., Alza minipumps), oral or suppositorial solid
(tablet or pill) pharmaceutical formulations, and decanting or
topical applications during surgery. For example, direct injection
of naked calcium phosphate-precipitated plasmid into rat liver and
rat spleen or a protein-coated plasmid into the portal vein has
resulted in gene expression of the foreign gene in the rat livers
(Kaneda et al., Science 243:375 (1989)).
[0618] A preferred method of local administration is by direct
injection. Preferably, a recombinant molecule of the present
invention complexed with a delivery vehicle is administered by
direct injection into or locally within the area of arteries.
Administration of a composition locally within the area of arteries
refers to injecting the composition centimeters and preferably,
millimeters within arteries.
[0619] Another method of local administration is to contact a
polynucleotide construct of the present invention in or around a
surgical wound. For example, a patient can undergo surgery and the
polynucleotide construct can be coated on the surface of tissue
inside the wound or the construct can be injected into areas of
tissue inside the wound.
[0620] Therapeutic compositions useful in systemic administration,
include recombinant molecules of the present invention complexed to
a targeted delivery vehicle of the present invention. Suitable
delivery vehicles for use with systemic administration comprise
liposomes comprising ligands for targeting the vehicle to a
particular site. In specific embodiments, suitable delivery
vehicles for use with systemic administration comprise liposomes
comprising polypeptides of the invention for targeting the vehicle
to a particular site.
[0621] Preferred methods of systemic administration, include
intravenous injection, aerosol, oral and percutaneous (topical)
delivery. Intravenous injections can be performed using methods
standard in the art. Aerosol delivery can also be performed using
methods standard in the art (see, for example, Stribling et al.,
Proc. Natl. Acad. Sci. USA 189:11277-11281, 1992, which is
incorporated herein by reference). Oral delivery can be performed
by complexing a polynucleotide construct of the present invention
to a carrier capable of withstanding degradation by digestive
enzymes in the gut of an animal. Examples of such carriers, include
plastic capsules or tablets, such as those known in the art.
Topical delivery can be performed by mixing a polynucleotide
construct of the present invention with a lipophilic reagent (e.g.,
DMSO) that is capable of passing into the skin.
[0622] Determining an effective amount of substance to be delivered
can depend upon a number of factors including, for example, the
chemical structure and biological activity of the substance, the
age and weight of the animal, the precise condition requiring
treatment and its severity, and the route of administration. The
frequency of treatments depends upon a number of factors, such as
the amount of polynucleotide constructs administered per dose, as
well as the health and history of the subject. The precise amount,
number of doses, and timing of doses will be determined by the
attending physician or veterinarian.
[0623] Therapeutic compositions of the present invention can be
administered to any animal, preferably to mammals and birds.
Preferred mammals include humans, dogs, cats, mice, rats, rabbits
sheep, cattle, horses and pigs, with humans being particularly
preferred.
Biological Activities
[0624] Polynucleotides or polypeptides, or agonists or antagonists
of the present invention, can be used in assays to test for one or
more biological activities. If these polynucleotides or
polypeptides, or agonists or antagonists of the present invention,
do exhibit activity in a particular assay, it is likely that these
molecules may be involved in the diseases associated with the
biological activity. Thus, the polynucleotides and polypeptides,
and agonists or antagonists could be used to treat the associated
disease.
[0625] Members of the secreted family of proteins are believed to
be involved in biological activities associated with, for example,
cellular signaling. Accordingly, compositions of the invention
(including polynucleotides, polypeptides and antibodies of the
invention, and fragments and variants thereof) may be used in
diagnosis, prognosis, prevention and/or treatment of diseases
and/or disorders associated with aberrant activity of secreted
polypeptides.
[0626] In preferred embodiments, compositions of the invention
(including polynucleotides, polypeptides and antibodies of the
invention, and fragments and variants thereof) may be used in the
diagnosis, prognosis, prevention and/or treatment of diseases
and/or disorders relating to diseases and disorders of the
endocrine system, the nervous system (See, for example,
"Neurological Disorders" section below), and the immune system
(See, for example, "Immune Activity" section below).
[0627] In certain embodiments, a polypeptide of the invention, or
polynucleotides, antibodies, agonists, or antagonists corresponding
to that polypeptide, may be used to diagnose and/or prognose
diseases and/or disorders associated with the tissue(s) in which
the polypeptide of the invention is expressed including one, two,
three, four, five, or more tissues disclosed in Table 1B.2, column
5 (Tissue Distribution Library Code).
[0628] Thus, polynucleotides, translation products and antibodies
of the invention are useful in the diagnosis, detection and/or
treatment of diseases and/or disorders associated with activities
that include, but are not limited to, prohormone activation,
neurotransmitter activity, cellular signaling, cellular
proliferation, cellular differentiation, and cell migration.
[0629] More generally, polynucleotides, translation products and
antibodies corresponding to this gene may be useful for the
diagnosis, prognosis, prevention and/or treatment of diseases
and/or disorders associated with the following systems.
Immune Activity
[0630] Polynucleotides, polypeptides, antibodies, and/or agonists
or antagonists of the present invention may be useful in treating,
preventing, diagnosing and/or prognosing diseases, disorders,
and/or conditions of the immune system, by, for example, activating
or inhibiting the proliferation, differentiation, or mobilization
(chemotaxis) of immune cells. Immune cells develop through a
process called hematopoiesis, producing myeloid (platelets, red
blood cells, neutrophils, and macrophages) and lymphoid (B and T
lymphocytes) cells from pluripotent stem cells. The etiology of
these immune diseases, disorders, and/or conditions may be genetic,
somatic, such as cancer and some autoimmune diseases, acquired
(e.g., by chemotherapy or toxins), or infectious. Moreover,
polynucleotides, polypeptides, antibodies, and/or agonists or
antagonists of the present invention can be used as a marker or
detector of a particular immune system disease or disorder.
[0631] In another embodiment, a polypeptide of the invention, or
polynucleotides, antibodies, agonists, or antagonists corresponding
to that polypeptide, may be used to treat diseases and disorders of
the immune system and/or to inhibit or enhance an immune response
generated by cells associated with the tissue(s) in which the
polypeptide of the invention is expressed, including one, two,
three, four, five, or more tissues disclosed in Table 1B.2, column
5 (Tissue Distribution Library Code).
[0632] Polynucleotides, polypeptides, antibodies, and/or agonists
or antagonists of the present invention may be useful in treating,
preventing, diagnosing, and/or prognosing immunodeficiencies,
including both congenital and acquired immunodeficiencies. Examples
of B cell immunodeficiencies in which immunoglobulin levels B cell
function and/or B cell numbers are decreased include: X-linked
agammaglobulinemia (Bruton's disease), X-linked infantile
agammaglobulinemia, X-linked immunodeficiency with hyper IgM, non
X-linked immunodeficiency with hyper IgM, X-linked
lymphoproliferative syndrome (XLP), agammaglobulinemia including
congenital and acquired agammaglobulinemia, adult onset
agammaglobulinemia, late-onset agammaglobulinemia,
dysgammaglobulinemia, hypogammaglobulinemia, unspecified
hypogammaglobulinemia, recessive agammaglobulinemia (Swiss type),
Selective IgM deficiency, selective IgA deficiency, selective IgG
subclass deficiencies, IgG subclass deficiency (with or without IgA
deficiency), Ig deficiency with increased IgM, IgG and IgA
deficiency with increased IgM, antibody deficiency with normal or
elevated Igs, Ig heavy chain deletions, kappa chain deficiency, B
cell lymphoproliferative disorder (BLPD), common variable
immunodeficiency (CVID), common variable immunodeficiency (CVI)
(acquired), and transient hypogammaglobulinemia of infancy.
[0633] In specific embodiments, ataxia-telangiectasia or conditions
associated with ataxia-telangiectasia are treated, prevented,
diagnosed, and/or prognosing using the polypeptides or
polynucleotides of the invention, and/or agonists or antagonists
thereof.
[0634] Examples of congenital immunodeficiencies in which T cell
and/or B cell function and/or number is decreased include, but are
not limited to: DiGeorge anomaly, severe combined
immunodeficiencies (SCID) (including, but not limited to, X-linked
SCID, autosomal recessive SCID, adenosine deaminase deficiency,
purine nucleoside phosphorylase (PNP) deficiency, Class II MHC
deficiency (Bare lymphocyte syndrome), Wiskott-Aldrich syndrome,
and ataxia telangiectasia), thymic hypoplasia, third and fourth
pharyngeal pouch syndrome, 22q11.2 deletion, chronic mucocutaneous
candidiasis, natural killer cell deficiency (NK), idiopathic CD4+
T-lymphocytopenia, immunodeficiency with predominant T cell defect
(unspecified), and unspecified immunodeficiency of cell mediated
immunity.
[0635] In specific embodiments, DiGeorge anomaly or conditions
associated with DiGeorge anomaly are treated, prevented, diagnosed,
and/or prognosed using polypeptides or polynucleotides of the
invention, or antagonists or agonists thereof.
[0636] Other immunodeficiencies that may be treated, prevented,
diagnosed, and/or prognosed using polypeptides or polynucleotides
of the invention, and/or agonists or antagonists thereof, include,
but are not limited to, chronic granulomatous disease,
Chediak-Higashi syndrome, myeloperoxidase deficiency, leukocyte
glucose-6-phosphate dehydrogenase deficiency, X-linked
lymphoproliferative syndrome (XLP), leukocyte adhesion deficiency,
complement component deficiencies (including C1, C2, C3, C4, C5,
C6, C7, C8 and/or C9 deficiencies), reticular dysgenesis, thymic
alymphoplasia-aplasia, immunodeficiency with thymoma, severe
congenital leukopenia, dysplasia with immunodeficiency, neonatal
neutropenia, short limbed dwarfism, and Nezelof syndrome-combined
immunodeficiency with Igs.
[0637] In a preferred embodiment, the immunodeficiencies and/or
conditions associated with the immunodeficiencies recited above are
treated, prevented, diagnosed and/or prognosed using
polynucleotides, polypeptides, antibodies, and/or agonists or
antagonists of the present invention.
[0638] In a preferred embodiment polynucleotides, polypeptides,
antibodies, and/or agonists or antagonists of the present invention
could be used as an agent to boost immunoresponsiveness among
immunodeficient individuals. In specific embodiments,
polynucleotides, polypeptides, antibodies, and/or agonists or
antagonists of the present invention could be used as an agent to
boost immunoresponsiveness among B cell and/or T cell
immunodeficient individuals.
[0639] The polynucleotides, polypeptides, antibodies, and/or
agonists or antagonists of the present invention may be useful in
treating, preventing, diagnosing and/or prognosing autoimmune
disorders. Many autoimmune disorders result from inappropriate
recognition of self as foreign material by immune cells. This
inappropriate recognition results in an immune response leading to
the destruction of the host tissue. Therefore, the administration
of polynucleotides and polypeptides of the invention that can
inhibit an immune response, particularly the proliferation,
differentiation, or chemotaxis of T-cells, may be an effective
therapy in preventing autoimmune disorders.
[0640] Autoimmune diseases or disorders that may be treated,
prevented, diagnosed and/or prognosed by polynucleotides,
polypeptides, antibodies, and/or agonists or antagonists of the
present invention include, but are not limited to, one or more of
the following: systemic lupus erythematosus, rheumatoid arthritis,
ankylosing spondylitis, multiple sclerosis, autoimmune thyroiditis,
Hashimoto's thyroiditis, autoimmune hemolytic anemia, hemolytic
anemia, thrombocytopenia, autoimmune thrombocytopenia purpura,
autoimmune neonatal thrombocytopenia, idiopathic thrombocytopenia
purpura, purpura (e.g., Henloch-Scoenlein purpura),
autoimmunocytopenia, Goodpasture's syndrome, Pemphigus vulgaris,
myasthenia gravis, Grave's disease (hyperthyroidism), and
insulin-resistant diabetes mellitus.
[0641] Additional disorders that are likely to have an autoimmune
component that may be treated, prevented, and/or diagnosed with the
compositions of the invention include, but are not limited to, type
II collagen-induced arthritis, antiphospholipid syndrome,
dermatitis, allergic encephalomyelitis, myocarditis, relapsing
polychondritis, rheumatic heart disease, neuritis, uveitis
ophthalmia, polyendocrinopathies, Reiter's Disease, Stiff-Man
Syndrome, autoimmune pulmonary inflammation, autism, Guillain-Barre
Syndrome, insulin dependent diabetes mellitus, and autoimmune
inflammatory eye disorders.
[0642] Additional disorders that are likely to have an autoimmune
component that may be treated, prevented, diagnosed and/or
prognosed with the compositions of the invention include, but are
not limited to, scleroderma with anti-collagen antibodies (often
characterized, e.g., by nucleolar and other nuclear antibodies),
mixed connective tissue disease (often characterized, e.g., by
antibodies to extractable nuclear antigens (e.g.,
ribonucleoprotein)), polymyositis (often characterized, e.g., by
nonhistone ANA), pernicious anemia (often characterized, e.g., by
antiparietal cell, microsomes, and intrinsic factor antibodies),
idiopathic Addison's disease (often characterized, e.g., by humoral
and cell-mediated adrenal cytotoxicity, infertility (often
characterized, e.g., by antispermatozoal antibodies),
glomerulonephritis (often characterized, e.g., by glomerular
basement membrane antibodies or immune complexes), bullous
pemphigoid (often characterized, e.g., by IgG and complement in
basement membrane), Sjogren's syndrome (often characterized, e.g.,
by multiple tissue antibodies, and/or a specific nonhistone ANA
(SS-B)), diabetes mellitus (often characterized, e.g., by
cell-mediated and humoral islet cell antibodies), and adrenergic
drug resistance (including adrenergic drug resistance with asthma
or cystic fibrosis) (often characterized, e.g., by beta-adrenergic
receptor antibodies).
[0643] Additional disorders that may have an autoimmune component
that may be treated, prevented, diagnosed and/or prognosed with the
compositions of the invention include, but are not limited to,
chronic active hepatitis (often characterized, e.g., by smooth
muscle antibodies), primary biliary cirrhosis (often characterized,
e.g., by mitochondria antibodies), other endocrine gland failure
(often characterized, e.g., by specific tissue antibodies in some
cases), vitiligo (often characterized, e.g., by melanocyte
antibodies), vasculitis (often characterized, e.g., by Ig and
complement in vessel walls and/or low serum complement), post-MI
(often characterized, e.g., by myocardial antibodies), cardiotomy
syndrome (often characterized, e.g., by myocardial antibodies),
urticaria (often characterized, e.g., by IgG and IgM antibodies to
IgE), atopic dermatitis (often characterized, e.g., by IgG and IgM
antibodies to IgE), asthma (often characterized, e.g., by IgG and
IgM antibodies to IgE), and many other inflammatory, granulomatous,
degenerative, and atrophic disorders.
[0644] In a preferred embodiment, the autoimmune diseases and
disorders and/or conditions associated with the diseases and
disorders recited above are treated, prevented, diagnosed and/or
prognosed using for example, antagonists or agonists, polypeptides
or polynucleotides, or antibodies of the present invention. In a
specific preferred embodiment, rheumatoid arthritis is treated,
prevented, and/or diagnosed using polynucleotides, polypeptides,
antibodies, and/or agonists or antagonists of the present
invention.
[0645] In another specific preferred embodiment, systemic lupus
erythematosus is treated, prevented, and/or diagnosed using
polynucleotides, polypeptides, antibodies, and/or agonists or
antagonists of the present invention. In another specific preferred
embodiment, idiopathic thrombocytopenia purpura is treated,
prevented, and/or diagnosed using polynucleotides, polypeptides,
antibodies, and/or agonists or antagonists of the present
invention.
[0646] In another specific preferred embodiment IgA nephropathy is
treated, prevented, and/or diagnosed using polynucleotides,
polypeptides, antibodies, and/or agonists or antagonists of the
present invention.
[0647] In a preferred embodiment, the autoimmune diseases and
disorders and/or conditions associated with the diseases and
disorders recited above are treated, prevented, diagnosed and/or
prognosed using polynucleotides, polypeptides, antibodies, and/or
agonists or antagonists of the present invention
[0648] In preferred embodiments, polypeptides, antibodies,
polynucleotides and/or agonists or antagonists of the present
invention are used as a immunosuppressive agent(s).
[0649] Polynucleotides, polypeptides, antibodies, and/or agonists
or antagonists of the present invention may be useful in treating,
preventing, prognosing, and/or diagnosing diseases, disorders,
and/or conditions of hematopoietic cells. Polynucleotides,
polypeptides, antibodies, and/or agonists or antagonists of the
present invention could be used to increase differentiation and
proliferation of hematopoietic cells, including the pluripotent
stem cells, in an effort to treat or prevent those diseases,
disorders, and/or conditions associated with a decrease in certain
(or many) types hematopoietic cells, including but not limited to,
leukopenia, neutropenia, anemia, and thrombocytopenia.
Alternatively, Polynucleotides, polypeptides, antibodies, and/or
agonists or antagonists of the present invention could be used to
increase differentiation and proliferation of hematopoietic cells,
including the pluripotent stem cells, in an effort to treat or
prevent those diseases, disorders, and/or conditions associated
with an increase in certain (or many) types of hematopoietic cells,
including but not limited to, histiocytosis.
[0650] Allergic reactions and conditions, such as asthma
(particularly allergic asthma) or other respiratory problems, may
also be treated, prevented, diagnosed and/or prognosed using
polypeptides, antibodies, or polynucleotides of the invention,
and/or agonists or antagonists thereof. Moreover, these molecules
can be used to treat, prevent, prognose, and/or diagnose
anaphylaxis, hypersensitivity to an antigenic molecule, or blood
group incompatibility.
[0651] Additionally, polypeptides or polynucleotides of the
invention, and/or agonists or antagonists thereof, may be used to
treat, prevent, diagnose and/or prognose IgE-mediated allergic
reactions. Such allergic reactions include, but are not limited to,
asthma, rhinitis, and eczema. In specific embodiments,
polynucleotides, polypeptides, antibodies, and/or agonists or
antagonists of the present invention may be used to modulate IgE
concentrations in vitro or in vivo.
[0652] Moreover, polynucleotides, polypeptides, antibodies, and/or
agonists or antagonists of the present invention have uses in the
diagnosis, prognosis, prevention, and/or treatment of inflammatory
conditions. For example, since polypeptides, antibodies, or
polynucleotides of the invention, and/or agonists or antagonists of
the invention may inhibit the activation, proliferation and/or
differentiation of cells involved in an inflammatory response,
these molecules can be used to prevent and/or treat chronic and
acute inflammatory conditions. Such inflammatory conditions
include, but are not limited to, for example, inflammation
associated with infection (e.g., septic shock, sepsis, or systemic
inflammatory response syndrome), ischemia-reperfusion injury,
endotoxin lethality, complement-mediated hyperacute rejection,
nephritis, cytokine or chemokine induced lung injury, inflammatory
bowel disease, Crohn's disease, over production of cytokines (e.g.,
TNF or IL-1.), respiratory disorders (e.g., asthma and allergy);
gastrointestinal disorders (e.g., inflammatory bowel disease);
cancers (e.g., gastric, ovarian, lung, bladder, liver, and breast);
CNS disorders (e.g., multiple sclerosis; ischemic brain injury
and/or stroke, traumatic brain injury, neurodegenerative disorders
(e.g., Parkinson's disease and Alzheimer's disease); AIDS-related
dementia; and prion disease); cardiovascular disorders (e.g.,
atherosclerosis, myocarditis, cardiovascular disease, and
cardiopulmonary bypass complications); as well as many additional
diseases, conditions, and disorders that are characterized by
inflammation (e.g., hepatitis, rheumatoid arthritis, gout, trauma,
pancreatitis, sarcoidosis, dermatitis, renal ischemia-reperfusion
injury, Grave's disease, systemic lupus erythematosus, diabetes
mellitus, and allogenic transplant rejection).
[0653] Because inflammation is a fundamental defense mechanism,
inflammatory disorders can effect virtually any tissue of the body.
Accordingly, polynucleotides, polypeptides, and antibodies of the
invention, as well as agonists or antagonists thereof, have uses in
the treatment of tissue-specific inflammatory disorders, including,
but not limited to, adrenalitis, alveolitis, angiocholecystitis,
appendicitis, balanitis, blepharitis, bronchitis, bursitis,
carditis, cellulitis, cervicitis, cholecystitis, chorditis,
cochlitis, colitis, conjunctivitis, cystitis, dermatitis,
diverticulitis, encephalitis, endocarditis, esophagitis,
eustachitis, fibrositis, folliculitis, gastritis, gastroenteritis,
gingivitis, glossitis, hepatosplenitis, keratitis, labyrinthitis,
laryngitis, lymphangitis, mastitis, media otitis, meningitis,
metritis, mucitis, myocarditis, myosititis, myringitis, nephritis,
neuritis, orchitis, osteochondritis, otitis, pericarditis,
peritendonitis, peritonitis, pharyngitis, phlebitis, poliomyelitis,
prostatitis, pulpitis, retinitis, rhinitis, salpingitis, scleritis,
sclerochoroiditis, scrotitis, sinusitis, spondylitis, steatitis,
stomatitis, synovitis, syringitis, tendonitis, tonsillitis,
urethritis, and vaginitis.
[0654] In specific embodiments, polypeptides, antibodies, or
polynucleotides of the invention, and/or agonists or antagonists
thereof, are useful to diagnose, prognose, prevent, and/or treat
organ transplant rejections and graft-versus-host disease. Organ
rejection occurs by host immune cell destruction of the
transplanted tissue through an immune response. Similarly, an
immune response is also involved in GVHD, but, in this case, the
foreign transplanted immune cells destroy the host tissues.
Polypeptides, antibodies, or polynucleotides of the invention,
and/or agonists or antagonists thereof, that inhibit an immune
response, particularly the activation, proliferation,
differentiation, or chemotaxis of T-cells, may be an effective
therapy in preventing organ rejection or GVHD. In specific
embodiments, polypeptides, antibodies, or polynucleotides of the
invention, and/or agonists or antagonists thereof, that inhibit an
immune response, particularly the activation, proliferation,
differentiation, or chemotaxis of T-cells, may be an effective
therapy in preventing experimental allergic and hyperacute
xenograft rejection.
[0655] In other embodiments, polypeptides, antibodies, or
polynucleotides of the invention, and/or agonists or antagonists
thereof, are useful to diagnose, prognose, prevent, and/or treat
immune complex diseases, including, but not limited to, serum
sickness, post streptococcal glomerulonephritis, polyarteritis
nodosa, and immune complex-induced vasculitis.
[0656] Polypeptides, antibodies, polynucleotides and/or agonists or
antagonists of the invention can be used to treat, detect, and/or
prevent infectious agents. For example, by increasing the immune
response, particularly increasing the proliferation activation
and/or differentiation of B and/or T cells, infectious diseases may
be treated, detected, and/or prevented. The immune response may be
increased by either enhancing an existing immune response, or by
initiating a new immune response. Alternatively, polynucleotides,
polypeptides, antibodies, and/or agonists or antagonists of the
present invention may also directly inhibit the infectious agent
(refer to section of application listing infectious agents, etc),
without necessarily eliciting an immune response.
[0657] In another embodiment, polypeptides, antibodies,
polynucleotides and/or agonists or antagonists of the present
invention are used as a vaccine adjuvant that enhances immune
responsiveness to an antigen. In a specific embodiment,
polypeptides, antibodies, polynucleotides and/or agonists or
antagonists of the present invention are used as an adjuvant to
enhance tumor-specific immune responses.
[0658] In another specific embodiment, polypeptides, antibodies,
polynucleotides and/or agonists or antagonists of the present
invention are used as an adjuvant to enhance anti-viral immune
responses. Anti-viral immune responses that may be enhanced using
the compositions of the invention as an adjuvant, include virus and
virus associated diseases or symptoms described herein or otherwise
known in the art. In specific embodiments, the compositions of the
invention are used as an adjuvant to enhance an immune response to
a virus, disease, or symptom selected from the group consisting of:
AIDS, meningitis, Dengue, EBV, and hepatitis (e.g., hepatitis B).
In another specific embodiment, the compositions of the invention
are used as an adjuvant to enhance an immune response to a virus,
disease, or symptom selected from the group consisting of:
HIV/AIDS, respiratory syncytial virus, Dengue, rotavirus, Japanese
B encephalitis, influenza A and B, parainfluenza, measles,
cytomegalovirus, rabies, Junin, Chikungunya, Rift Valley Fever,
herpes simplex, and yellow fever.
[0659] In another specific embodiment, polypeptides, antibodies,
polynucleotides and/or agonists or antagonists of the present
invention are used as an adjuvant to enhance anti-bacterial or
anti-fungal immune responses. Anti-bacterial or anti-fungal immune
responses that may be enhanced using the compositions of the
invention as an adjuvant, include bacteria or fungus and bacteria
or fungus associated diseases or symptoms described herein or
otherwise known in the art. In specific embodiments, the
compositions of the invention are used as an adjuvant to enhance an
immune response to a bacteria or fungus, disease, or symptom
selected from the group consisting of: tetanus, Diphtheria,
botulism, and meningitis type B.
[0660] In another specific embodiment, the compositions of the
invention are used as an adjuvant to enhance an immune response to
a bacteria or fungus, disease, or symptom selected from the group
consisting of: Vibrio cholerae, Mycobacterium leprae, Salmonella
typhi, Salmonella paratyphi, Meisseria meningitidis, Streptococcus
pneumoniae, Group B streptococcus, Shigella spp., Enterotoxigenic
Escherichia colt, Enterohemorrhagic E. coli, and Borrelia
burgdorferi.
[0661] In another specific embodiment, polypeptides, antibodies,
polynucleotides and/or agonists or antagonists of the present
invention are used as an adjuvant to enhance anti-parasitic immune
responses. Anti-parasitic immune responses that may be enhanced
using the compositions of the invention as an adjuvant, include
parasite and parasite associated diseases or symptoms described
herein or otherwise known in the art. In specific embodiments, the
compositions of the invention are used as an adjuvant to enhance an
immune response to a parasite. In another specific embodiment, the
compositions of the invention are used as an adjuvant to enhance an
immune response to Plasmodium (malaria) or Leishmania.
[0662] In another specific embodiment, polypeptides, antibodies,
polynucleotides and/or agonists or antagonists of the present
invention may also be employed to treat infectious diseases
including silicosis, sarcoidosis, and idiopathic pulmonary
fibrosis; for example, by preventing the recruitment and activation
of mononuclear phagocytes.
[0663] In another specific embodiment, polypeptides, antibodies,
polynucleotides and/or agonists or antagonists of the present
invention are used as an antigen for the generation of antibodies
to inhibit or enhance immune mediated responses against
polypeptides of the invention.
[0664] In one embodiment, polypeptides, antibodies, polynucleotides
and/or agonists or antagonists of the present invention are
administered to an animal (e.g., mouse, rat, rabbit, hamster,
guinea pig, pigs, micro-pig, chicken, camel, goat, horse, cow,
sheep, dog, cat, non-human primate, and human, most preferably
human) to boost the immune system to produce increased quantities
of one or more antibodies (e.g., IgG, IgA, IgM, and IgE), to induce
higher affinity antibody production and immunoglobulin class
switching (e.g., IgG, IgA, IgM, and IgE), and/or to increase an
immune response.
[0665] In another specific embodiment, polypeptides, antibodies,
polynucleotides and/or agonists or antagonists of the present
invention are used as a stimulator of B cell responsiveness to
pathogens.
[0666] In another specific embodiment, polypeptides, antibodies,
polynucleotides and/or agonists or antagonists of the present
invention are used as an activator of T cells.
[0667] In another specific embodiment, polypeptides, antibodies,
polynucleotides and/or agonists or antagonists of the present
invention are used as an agent that elevates the immune status of
an individual prior to their receipt of immunosuppressive
therapies.
[0668] In another specific embodiment, polypeptides, antibodies,
polynucleotides and/or agonists or antagonists of the present
invention are used as an agent to induce higher affinity
antibodies.
[0669] In another specific embodiment, polypeptides, antibodies,
polynucleotides and/or agonists or antagonists of the present
invention are used as an agent to increase serum immunoglobulin
concentrations.
[0670] In another specific embodiment, polypeptides, antibodies,
polynucleotides and/or agonists or antagonists of the present
invention are used as an agent to accelerate recovery of
immunocompromised individuals.
[0671] In another specific embodiment, polypeptides, antibodies,
polynucleotides and/or agonists or antagonists of the present
invention are used as an agent to boost immunoresponsiveness among
aged populations and/or neonates.
[0672] In another specific embodiment, polypeptides, antibodies,
polynucleotides and/or agonists or antagonists of the present
invention are used as an immune system enhancer prior to, during,
or after bone marrow transplant and/or other transplants (e.g.,
allogeneic or xenogeneic organ transplantation). With respect to
transplantation, compositions of the invention may be administered
prior to, concomitant with, and/or after transplantation. In a
specific embodiment, compositions of the invention are administered
after transplantation, prior to the beginning of recovery of T-cell
populations. In another specific embodiment, compositions of the
invention are first administered after transplantation after the
beginning of recovery of T cell populations, but prior to full
recovery of B cell populations.
[0673] In another specific embodiment, polypeptides, antibodies,
polynucleotides and/or agonists or antagonists of the present
invention are used as an agent to boost immunoresponsiveness among
individuals having an acquired loss of B cell function. Conditions
resulting in an acquired loss of B cell function that may be
ameliorated or treated by administering the polypeptides,
antibodies, polynucleotides and/or agonists or antagonists thereof,
include, but are not limited to, HIV Infection, AIDS, bone marrow
transplant, and B cell chronic lymphocytic leukemia (CLL).
[0674] In another specific embodiment, polypeptides, antibodies,
polynucleotides and/or agonists or antagonists of the present
invention are used as an agent to boost immunoresponsiveness among
individuals having a temporary immune deficiency. Conditions
resulting in a temporary immune deficiency that may be ameliorated
or treated by administering the polypeptides, antibodies,
polynucleotides and/or agonists or antagonists thereof, include,
but are not limited to, recovery from viral infections (e.g.,
influenza), conditions associated with malnutrition, recovery from
infectious mononucleosis, or conditions associated with stress,
recovery from measles, recovery from blood transfusion, and
recovery from surgery.
[0675] In another specific embodiment, polypeptides, antibodies,
polynucleotides and/or agonists or antagonists of the present
invention are used as a regulator of antigen presentation by
monocytes, dendritic cells, and/or B-cells. In one embodiment,
polynucleotides, polypeptides, antibodies, and/or agonists or
antagonists of the present invention enhance antigen presentation
or antagonizes antigen presentation in vitro or in vivo. Moreover,
in related embodiments, said enhancement or antagonism of antigen
presentation may be useful as an anti-tumor treatment or to
modulate the immune system.
[0676] In another specific embodiment, polypeptides, antibodies,
polynucleotides and/or agonists or antagonists of the present
invention are used as an agent to direct an individual's immune
system towards development of a humoral response (i.e. TH2) as
opposed to a TH1 cellular response.
[0677] In another specific embodiment, polypeptides, antibodies,
polynucleotides and/or agonists or antagonists of the present
invention are used as a means to induce tumor proliferation and
thus make it more susceptible to anti-neoplastic agents. For
example, multiple myeloma is a slowly dividing disease and is thus
refractory to virtually all anti-neoplastic regimens. If these
cells were forced to proliferate more rapidly their susceptibility
profile would likely change.
[0678] In another specific embodiment, polypeptides, antibodies,
polynucleotides and/or agonists or antagonists of the present
invention are used as a stimulator of B cell production in
pathologies such as AIDS, chronic lymphocyte disorder and/or Common
Variable Immunodificiency.
[0679] In another specific embodiment, polypeptides, antibodies,
polynucleotides and/or agonists or antagonists of the present
invention are used as a therapy for generation and/or regeneration
of lymphoid tissues following surgery, trauma or genetic defect. In
another specific embodiment, polypeptides, antibodies,
polynucleotides and/or agonists or antagonists of the present
invention are used in the pretreatment of bone marrow samples prior
to transplant.
[0680] In another specific embodiment, polypeptides, antibodies,
polynucleotides and/or agonists or antagonists of the present
invention are used as a gene-based therapy for genetically
inherited disorders resulting in
immuno-incompetence/immunodeficiency such as observed among SCID
patients.
[0681] In another specific embodiment, polypeptides, antibodies,
polynucleotides and/or agonists or antagonists of the present
invention are used as a means of activating monocytes/macrophages
to defend against parasitic diseases that effect monocytes such as
Leishmania.
[0682] In another specific embodiment, polypeptides, antibodies,
polynucleotides and/or agonists or antagonists of the present
invention are used as a means of regulating secreted cytokines that
are elicited by polypeptides of the invention.
[0683] In another embodiment, polypeptides, antibodies,
polynucleotides and/or agonists or antagonists of the present
invention are used in one or more of the applications decribed
herein, as they may apply to veterinary medicine.
[0684] In another specific embodiment, polypeptides, antibodies,
polynucleotides and/or agonists or antagonists of the present
invention are used as a means of blocking various aspects of immune
responses to foreign agents or self. Examples of diseases or
conditions in which blocking of certain aspects of immune responses
may be desired include autoimmune disorders such as lupus, and
arthritis, as well as immunoresponsiveness to skin allergies,
inflammation, bowel disease, injury and diseases/disorders
associated with pathogens.
[0685] In another specific embodiment, polypeptides, antibodies,
polynucleotides and/or agonists or antagonists of the present
invention are used as a therapy for preventing the B cell
proliferation and Ig secretion associated with autoimmune diseases
such as idiopathic thrombocytopenic purpura, systemic lupus
erythematosus and multiple sclerosis.
[0686] In another specific embodiment, polypeptides, antibodies,
polynucleotides and/or agonists or antagonists of the present
invention are used as a inhibitor of B and/or T cell migration in
endothelial cells. This activity disrupts tissue architecture or
cognate responses and is useful, for example in disrupting immune
responses, and blocking sepsis.
[0687] In another specific embodiment, polypeptides, antibodies,
polynucleotides and/or agonists or antagonists of the present
invention are used as a therapy for chronic hypergammaglobulinemia
evident in such diseases as monoclonal gammopathy of undetermined
significance (MGUS), Waldenstrom's disease, related idiopathic
monoclonal gammopathies, and plasmacytomas.
[0688] In another specific embodiment, polypeptides, antibodies,
polynucleotides and/or agonists or antagonists of the present
invention may be employed for instance to inhibit polypeptide
chemotaxis and activation of macrophages and their precursors, and
of neutrophils, basophils, B lymphocytes and some T-cell subsets,
e.g., activated and CD8 cytotoxic T cells and natural killer cells,
in certain autoimmune and chronic inflammatory and infective
diseases. Examples of autoimmune diseases are described herein and
include multiple sclerosis, and insulin-dependent diabetes.
[0689] The polypeptides, antibodies, polynucleotides and/or
agonists or antagonists of the present invention may also be
employed to treat idiopathic hyper-eosinophilic syndrome by, for
example, preventing eosinophil production and migration.
[0690] In another specific embodiment, polypeptides, antibodies,
polynucleotides and/or agonists or antagonists of the present
invention are used to enhance or inhibit complement mediated cell
lysis.
[0691] In another specific embodiment, polypeptides, antibodies,
polynucleotides and/or agonists or antagonists of the present
invention are used to enhance or inhibit antibody dependent
cellular cytotoxicity.
[0692] In another specific embodiment, polypeptides, antibodies,
polynucleotides and/or agonists or antagonists of the present
invention may also be employed for treating atherosclerosis, for
example, by preventing monocyte infiltration in the artery
wall.
[0693] In another specific embodiment, polypeptides, antibodies,
polynucleotides and/or agonists or antagonists of the present
invention may be employed to treat adult respiratory distress
syndrome (ARDS).
[0694] In another specific embodiment, polypeptides, antibodies,
polynucleotides and/or agonists or antagonists of the present
invention may be useful for stimulating wound and tissue repair,
stimulating angiogenesis, and/or stimulating the repair of vascular
or lymphatic diseases or disorders. Additionally, agonists and
antagonists of the invention may be used to stimulate the
regeneration of mucosal surfaces.
[0695] In a specific embodiment, polynucleotides or polypeptides,
and/or agonists thereof are used to diagnose, prognose, treat,
and/or prevent a disorder characterized by primary or acquired
immunodeficiency, deficient serum immunoglobulin production,
recurrent infections, and/or immune system dysfunction. Moreover,
polynucleotides or polypeptides, and/or agonists thereof may be
used to treat or prevent infections of the joints, bones, skin,
and/or parotid glands, blood-borne infections (e.g., sepsis,
meningitis, septic arthritis, and/or osteomyelitis), autoimmune
diseases (e.g., those disclosed herein), inflammatory disorders,
and malignancies, and/or any disease or disorder or condition
associated with these infections, diseases, disorders and/or
malignancies) including, but not limited to, CVID, other primary
immune deficiencies, HIV disease, CLL, recurrent bronchitis,
sinusitis, otitis media, conjunctivitis, pneumonia, hepatitis,
meningitis, herpes zoster (e.g., severe herpes zoster), and/or
pneumocystis carnii. Other diseases and disorders that may be
prevented, diagnosed, prognosed, and/or treated with
polynucleotides or polypeptides, and/or agonists of the present
invention include, but are not limited to, HIV infection, HTLV-BLV
infection, lymphopenia, phagocyte bactericidal dysfunction anemia,
thrombocytopenia, and hemoglobinuria.
[0696] In another embodiment, polynucleotides, polypeptides,
antibodies, and/or agonists or antagonists of the present invention
are used to treat, and/or diagnose an individual having common
variable immunodeficiency disease ("CVID"; also known as "acquired
agammaglobulinemia" and "acquired hypogammaglobulinemia") or a
subset of this disease.
[0697] In a specific embodiment, polynucleotides, polypeptides,
antibodies, and/or agonists or antagonists of the present invention
may be used to diagnose, prognose, prevent, and/or treat cancers or
neoplasms including immune cell or immune tissue-related cancers or
neoplasms. Examples of cancers or neoplasms that may be prevented,
diagnosed, or treated by polynucleotides, polypeptides, antibodies,
and/or agonists or antagonists of the present invention include,
but are not limited to, acute myelogenous leukemia, chronic
myelogenous leukemia, Hodgkin's disease, non-Hodgkin's lymphoma,
acute lymphocytic anemia (ALL) Chronic lymphocyte leukemia,
plasmacytomas, multiple myeloma, Burkitt's lymphoma,
EBV-transformed diseases, and/or diseases and disorders described
in the section entitled "Hyperproliferative Disorders" elsewhere
herein.
[0698] In another specific embodiment, polypeptides, antibodies,
polynucleotides and/or agonists or antagonists of the present
invention are used as a therapy for decreasing cellular
proliferation of Large B-cell Lymphomas.
[0699] In another specific embodiment, polypeptides, antibodies,
polynucleotides and/or agonists or antagonists of the present
invention are used as a means of decreasing the involvement of B
cells and Ig associated with Chronic Myelogenous Leukemia.
[0700] In specific embodiments, the compositions of the invention
are used as an agent to boost immunoresponsiveness among B cell
immunodeficient individuals, such as, for example, an individual
who has undergone a partial or complete splenectomy.
[0701] Antagonists of the invention include, for example, binding
and/or inhibitory antibodies, antisense nucleic acids, ribozymes or
soluble forms of the polypeptides of the present invention (e.g.,
Fc fusion protein; see, e.g., Example 9). Agonists of the invention
include, for example, binding or stimulatory antibodies, and
soluble forms of the polypeptides (e.g., Fc fusion proteins; see,
e.g., Example 9). polypeptides, antibodies, polynucleotides and/or
agonists or antagonists of the present invention may be employed in
a composition with a pharmaceutically acceptable carrier, e.g., as
described herein.
[0702] In another embodiment, polypeptides, antibodies,
polynucleotides and/or agonists or antagonists of the present
invention are administered to an animal (including, but not limited
to, those listed above, and also including transgenic animals)
incapable of producing functional endogenous antibody molecules or
having an otherwise compromised endogenous immune system, but which
is capable of producing human immunoglobulin molecules by means of
a reconstituted or partially reconstituted immune system from
another animal (see, e.g., published PCT Application Nos.
WO98/24893, WO/9634096, WO/9633735, and WO/9110741). Administration
of polypeptides, antibodies, polynucleotides and/or agonists or
antagonists of the present invention to such animals is useful for
the generation of monoclonal antibodies against the polypeptides,
antibodies, polynucleotides and/or agonists or antagonists of the
present invention.
Blood-Related Disorders
[0703] The polynucleotides, polypeptides, antibodies, and/or
agonists or antagonists of the present invention may be used to
modulate hemostatic (the stopping of bleeding) or thrombolytic
(clot dissolving) activity. For example, by increasing hemostatic
or thrombolytic activity, polynucleotides or polypeptides, and/or
agonists or antagonists of the present invention could be used to
treat or prevent blood coagulation diseases, disorders, and/or
conditions (e.g., afibrinogenemia, factor deficiencies,
hemophilia), blood platelet diseases, disorders, and/or conditions
(e.g., thrombocytopenia), or wounds resulting from trauma, surgery,
or other causes. Alternatively, polynucleotides, polypeptides,
antibodies, and/or agonists or antagonists of the present invention
that can decrease hemostatic or thrombolytic activity could be used
to inhibit or dissolve clotting. These molecules could be important
in the treatment or prevention of heart attacks (infarction),
strokes, or scarring.
[0704] In specific embodiments, the polynucleotides, polypeptides,
antibodies, and/or agonists or antagonists of the present invention
may be used to prevent, diagnose, prognose, and/or treat
thrombosis, arterial thrombosis, venous thrombosis,
thromboembolism, pulmonary embolism, atherosclerosis, myocardial
infarction, transient ischemic attack, unstable angina. In specific
embodiments, the polynucleotides, polypeptides, antibodies, and/or
agonists or antagonists of the present invention may be used for
the prevention of occulsion of saphenous grafts, for reducing the
risk of periprocedural thrombosis as might accompany angioplasty
procedures, for reducing the risk of stroke in patients with atrial
fibrillation including nonrheumatic atrial fibrillation, for
reducing the risk of embolism associated with mechanical heart
valves and or mitral valves disease. Other uses for the
polynucleotides, polypeptides, antibodies, and/or agonists or
antagonists of the present invention, include, but are not limited
to, the prevention of occlusions in extrcorporeal devices (e.g.,
intravascular canulas, vascular access shunts in hemodialysis
patients, hemodialysis machines, and cardiopulmonary bypass
machines).
[0705] In another embodiment, a polypeptide of the invention, or
polynucleotides, antibodies, agonists, or antagonists corresponding
to that polypeptide, may be used to prevent, diagnose, prognose,
and/or treat diseases and disorders of the blood and/or blood
forming organs associated with the tissue(s) in which the
polypeptide of the invention is expressed, including one, two,
three, four, five, or more tissues disclosed in Table 1B.2, column
5 (Tissue Distribution Library Code).
[0706] The polynucleotides, polypeptides, antibodies, and/or
agonists or antagonists of the present invention may be used to
modulate hematopoietic activity (the formation of blood cells). For
example, the polynucleotides, polypeptides, antibodies, and/or
agonists or antagonists of the present invention may be used to
increase the quantity of all or subsets of blood cells, such as,
for example, erythrocytes, lymphocytes (B or T cells), myeloid
cells (e.g., basophils, eosinophils, neutrophils, mast cells,
macrophages) and platelets. The ability to decrease the quantity of
blood cells or subsets of blood cells may be useful in the
prevention, detection, diagnosis and/or treatment of anemias and
leukopenias described below. Alternatively, the polynucleotides,
polypeptides, antibodies, and/or agonists or antagonists of the
present invention may be used to decrease the quantity of all or
subsets of blood cells, such as, for example, erythrocytes,
lymphocytes (B or T cells), myeloid cells (e.g., basophils,
eosinophils, neutrophils, mast cells, macrophages) and platelets.
The ability to decrease the quantity of blood cells or subsets of
blood cells may be useful in the prevention, detection, diagnosis
and/or treatment of leukocytoses, such as, for example
eosinophilia.
[0707] The polynucleotides, polypeptides, antibodies, and/or
agonists or antagonists of the present invention may be used to
prevent, treat, or diagnose blood dyscrasia.
[0708] Anemias are conditions in which the number of red blood
cells or amount of hemoglobin (the protein that carries oxygen) in
them is below normal. Anemia may be caused by excessive bleeding,
decreased red blood cell production, or increased red blood cell
destruction (hemolysis). The polynucleotides, polypeptides,
antibodies, and/or agonists or antagonists of the present invention
may be useful in treating, preventing, and/or diagnosing anemias.
Anemias that may be treated prevented or diagnosed by the
polynucleotides, polypeptides, antibodies, and/or agonists or
antagonists of the present invention include iron deficiency
anemia, hypochromic anemia, microcytic anemia, chlorosis,
hereditary siderob; astic anemia, idiopathic acquired sideroblastic
anemia, red cell aplasia, megaloblastic anemia (e.g., pernicious
anemia, (vitamin B12 deficiency) and folic acid deficiency anemia),
aplastic anemia, hemolytic anemias (e.g., autoimmune helolytic
anemia, microangiopathic hemolytic anemia, and paroxysmal nocturnal
hemoglobinuria). The polynucleotides, polypeptides, antibodies,
and/or agonists or antagonists of the present invention may be
useful in treating, preventing, and/or diagnosing anemias
associated with diseases including but not limited to, anemias
associated with systemic lupus erythematosus, cancers, lymphomas,
chronic renal disease, and enlarged spleens. The polynucleotides,
polypeptides, antibodies, and/or agonists or antagonists of the
present invention may be useful in treating, preventing, and/or
diagnosing anemias arising from drug treatments such as anemias
associated with methyldopa, dapsone, and/or sulfadrugs.
Additionally, rhe polynucleotides, polypeptides, antibodies, and/or
agonists or antagonists of the present invention may be useful in
treating, preventing, and/or diagnosing anemias associated with
abnormal red blood cell architecture including but not limited to,
hereditary spherocytosis, hereditary elliptocytosis,
glucose-6-phosphate dehydrogenase deficiency, and sickle cell
anemia.
[0709] The polynucleotides, polypeptides, antibodies, and/or
agonists or antagonists of the present invention may be useful in
treating, preventing, and/or diagnosing hemoglobin abnormalities,
(e.g., those associated with sickle cell anemia, hemoglobin C
disease, hemoglobin S-C disease, and hemoglobin E disease).
Additionally, the polynucleotides, polypeptides, antibodies, and/or
agonists or antagonists of the present invention may be useful in
diagnosing, prognosing, preventing, and/or treating thalassemias,
including, but not limited to major and minor forms of
alpha-thalassemia and beta-thalassemia.
[0710] In another embodiment, the polynucleotides, polypeptides,
antibodies, and/or agonists or antagonists of the present invention
may be useful in diagnosing, prognosing, preventing, and/or
treating bleeding disorders including, but not limited to,
thrombocytopenia (e.g., idiopathic thrombocytopenic purpura, and
thrombotic thrombocytopenic purpura), Von Willebrand's disease,
hereditary platelet disorders (e.g., storage pool disease such as
Chediak-Higashi and Hermansky-Pudlak syndromes, thromboxane A2
dysfunction, thromboasthenia, and Bemard-Soulier syndrome),
hemolytic-uremic syndrome, hemophelias such as hemophelia A or
Factor VII deficiency and Christmas disease or Factor IX
deficiency, Hereditary Hemorhhagic Telangiectsia, also known as
Rendu-Osler-Weber syndrome, allergic purpura (Henoch Schonlein
purpura) and disseminated intravascular coagulation.
[0711] The effect of the polynucleotides, polypeptides, antibodies,
and/or agonists or antagonists of the present invention on the
clotting time of blood may be monitored using any of the clotting
tests known in the art including, but not limited to, whole blood
partial thromboplastin time (PTT), the activated partial
thromboplastin time (aPTT), the activated clotting time (ACT), the
recalcified activated clotting time, or the Lee-White Clotting
time.
[0712] Several diseases and a variety of drugs can cause platelet
dysfunction. Thus, in a specific embodiment, the polynucleotides,
polypeptides, antibodies, and/or agonists or antagonists of the
present invention may be useful in diagnosing, prognosing,
preventing, and/or treating acquired platelet dysfunction such as
platelet dysfunction accompanying kidney failure, leukemia,
multiple myeloma, cirrhosis of the liver, and systemic lupus
erythematosus as well as platelet dysfunction associated with drug
treatments, including treatment with aspirin, ticlopidine,
nonsteroidal anti-inflammatory drugs (used for arthritis, pain, and
sprains), and penicillin in high doses.
[0713] In another embodiment, the polynucleotides, polypeptides,
antibodies, and/or agonists or antagonists of the present invention
may be useful in diagnosing, prognosing, preventing, and/or
treating diseases and disorders characterized by or associated with
increased or decreased numbers of white blood cells. Leukopenia
occurs when the number of white blood cells decreases below normal.
Leukopenias include, but are not limited to, neutropenia and
lymphocytopenia. An increase in the number of white blood cells
compared to normal is known as leukocytosis. The body generates
increased numbers of white blood cells during infection. Thus,
leukocytosis may simply be a normal physiological parameter that
reflects infection. Alternatively, leukocytosis may be an indicator
of injury or other disease such as cancer. Leokocytoses, include
but are not limited to, eosinophilia, and accumulations of
macrophages. In specific embodiments, the polynucleotides,
polypeptides, antibodies, and/or agonists or antagonists of the
present invention may be useful in diagnosing, prognosing,
preventing, and/or treating leukopenia. In other specific
embodiments, the polynucleotides, polypeptides, antibodies, and/or
agonists or antagonists of the present invention may be useful in
diagnosing, prognosing, preventing, and/or treating
leukocytosis.
[0714] Leukopenia may be a generalized decreased in all types of
white blood cells, or may be a specific depletion of particular
types of white blood cells. Thus, in specific embodiments, the
polynucleotides, polypeptides, antibodies, and/or agonists or
antagonists of the present invention may be useful in diagnosing,
prognosing, preventing, and/or treating decreases in neutrophil
numbers, known as neutropenia. Neutropenias that may be diagnosed,
prognosed, prevented, and/or treated by the polynucleotides,
polypeptides, antibodies, and/or agonists or antagonists of the
present invention include, but are not limited to, infantile
genetic agranulocytosis, familial neutropenia, cyclic neutropenia,
neutropenias resulting from or associated with dietary deficiencies
(e.g., vitamin B 12 deficiency or folic acid deficiency),
neutropenias resulting from or associated with drug treatments
(e.g., antibiotic regimens such as penicillin treatment,
sulfonamide treatment, anticoagulant treatment, anticonvulsant
drugs, anti-thyroid drugs, and cancer chemotherapy), and
neutropenias resulting from increased neutrophil destruction that
may occur in association with some bacterial or viral infections,
allergic disorders, autoimmune diseases, conditions in which an
individual has an enlarged spleen (e.g., Felty syndrome, malaria
and sarcoidosis), and some drug treatment regimens.
[0715] The polynucleotides, polypeptides, antibodies, and/or
agonists or antagonists of the present invention may be useful in
diagnosing, prognosing, preventing, and/or treating
lymphocytopenias (decreased numbers of B and/or T lymphocytes),
including, but not limited lymphocytopenias resulting from or
associated with stress, drug treatments (e.g., drug treatment with
corticosteroids, cancer chemotherapies, and/or radiation
therapies), AIDS infection and/or other diseases such as, for
example, cancer, rheumatoid arthritis, systemic lupus
erythematosus, chronic infections, some viral infections and/or
hereditary disorders (e.g., DiGeorge syndrome, Wiskott-Aldrich
Syndome, severe combined immunodeficiency, ataxia
telangiectsia).
[0716] The polynucleotides, polypeptides, antibodies, and/or
agonists or antagonists of the present invention may be useful in
diagnosing, prognosing, preventing, and/or treating diseases and
disorders associated with macrophage numbers and/or macrophage
function including, but not limited to, Gaucher's disease,
Niemann-Pick disease, Letterer-Siwe disease and
Hand-Schuller-Christian disease.
[0717] In another embodiment, the polynucleotides, polypeptides,
antibodies, and/or agonists or antagonists of the present invention
may be useful in diagnosing, prognosing, preventing, and/or
treating diseases and disorders associated with eosinophil numbers
and/or eosinophil function including, but not limited to,
idiopathic hypereosinophilic syndrome, eosinophilia-myalgia
syndrome, and Hand-Schuller-Christian disease.
[0718] In yet another embodiment, the polynucleotides,
polypeptides, antibodies, and/or agonists or antagonists of the
present invention may be useful in diagnosing, prognosing,
preventing, and/or treating leukemias and lymphomas including, but
not limited to, acute lymphocytic (lymphpblastic) leukemia (ALL),
acute myeloid (myelocytic, myelogenous, myeloblastic, or
myelomonocytic) leukemia, chronic lymphocytic leukemia (e.g., B
cell leukemias, T cell leukemias, Sezary syndrome, and Hairy cell
leukenia), chronic myelocytic (myeloid, myelogenous, or
granulocytic) leukemia, Hodgkin's lymphoma, non-hodgkin's lymphoma,
Burkitt's lymphoma, and mycosis fungoides.
[0719] In other embodiments, the polynucleotides, polypeptides,
antibodies, and/or agonists or antagonists of the present invention
may be useful in diagnosing, prognosing, preventing, and/or
treating diseases and disorders of plasma cells including, but not
limited to, plasma cell dyscrasias, monoclonal gammaopathies,
monoclonal gammopathies of undetermined significance, multiple
myeloma, macroglobulinemia, Waldenstrom's macroglobulinemia,
cryoglobulinemia, and Raynaud's phenomenon.
[0720] In other embodiments, the polynucleotides, polypeptides,
antibodies, and/or agonists or antagonists of the present invention
may be useful in treating, preventing, and/or diagnosing
myeloproliferative disorders, including but not limited to,
polycythemia vera, relative polycythemia, secondary polycythemia,
myelofibrosis, acute myelofibrosis, agnogenic myelod metaplasia,
thrombocythemia, (including both primary and seconday
thrombocythemia) and chronic myelocytic leukemia.
[0721] In other embodiments, the polynucleotides, polypeptides,
antibodies, and/or agonists or antagonists of the present invention
may be useful as a treatment prior to surgery, to increase blood
cell production.
[0722] In other embodiments, the polynucleotides, polypeptides,
antibodies, and/or agonists or antagonists of the present invention
may be useful as an agent to enhance the migration, phagocytosis,
superoxide production, antibody dependent cellular cytotoxicity of
neutrophils, eosionophils and macrophages.
[0723] In other embodiments, the polynucleotides, polypeptides,
antibodies, and/or agonists or antagonists of the present invention
may be useful as an agent to increase the number of stem cells in
circulation prior to stem cells pheresis. In another specific
embodiment, the polynucleotides, polypeptides, antibodies, and/or
agonists or antagonists of the present invention may be useful as
an agent to increase the number of stem cells in circulation prior
to platelet pheresis.
[0724] In other embodiments, the polynucleotides, polypeptides,
antibodies, and/or agonists or antagonists of the present invention
may be useful as an agent to increase cytokine production.
[0725] In other embodiments, the polynucleotides, polypeptides,
antibodies, and/or agonists or antagonists of the present invention
may be useful in preventing, diagnosing, and/or treating primary
hematopoietic disorders.
Hyperproliferative Disorders
[0726] In certain embodiments, polynucleotides or polypeptides, or
agonists or antagonists of the present invention can be used to
treat or detect hyperproliferative disorders, including neoplasms.
Polynucleotides or polypeptides, or agonists or antagonists of the
present invention may inhibit the proliferation of the disorder
through direct or indirect interactions. Alternatively,
Polynucleotides or polypeptides, or agonists or antagonists of the
present invention may proliferate other cells which can inhibit the
hyperproliferative disorder.
[0727] For example, by increasing an immune response, particularly
increasing antigenic qualities of the hyperproliferative disorder
or by proliferating, differentiating, or mobilizing T-cells,
hyperproliferative disorders can be treated. This immune response
may be increased by either enhancing an existing immune response,
or by initiating a new immune response. Alternatively, decreasing
an immune response may also be a method of treating
hyperproliferative disorders, such as a chemotherapeutic agent.
[0728] Examples of hyperproliferative disorders that can be treated
or detected by polynucleotides or polypeptides, or agonists or
antagonists of the present invention include, but are not limited
to neoplasms located in the: colon, abdomen, bone, breast,
digestive system, liver, pancreas, peritoneum, endocrine glands
(adrenal, parathyroid, pituitary, testicles, ovary, thymus,
thyroid), eye, head and neck, nervous (central and peripheral),
lymphatic system, pelvis, skin, soft tissue, spleen, thorax, and
urogenital tract.
[0729] Similarly, other hyperproliferative disorders can also be
treated or detected by polynucleotides or polypeptides, or agonists
or antagonists of the present invention. Examples of such
hyperproliferative disorders include, but are not limited to: Acute
Childhood Lymphoblastic Leukemia, Acute Lymphoblastic Leukemia,
Acute Lymphocytic Leukemia, Acute Myeloid Leukemia, Adrenocortical
Carcinoma, Adult (Primary) Hepatocellular Cancer, Adult (Primary)
Liver Cancer, Adult Acute Lymphocytic Leukemia, Adult Acute Myeloid
Leukemia, Adult Hodgkin's Disease, Adult Hodgkin's Lymphoma, Adult
Lymphocytic Leukemia, Adult Non-Hodgkin's Lymphoma, Adult Primary
Liver Cancer, Adult Soft Tissue Sarcoma, AIDS-Related Lymphoma,
AIDS-Related Malignancies, Anal Cancer, Astrocytoma, Bile Duct
Cancer, Bladder Cancer, Bone Cancer, Brain Stem Glioma, Brain
Tumors, Breast Cancer, Cancer of the Renal Pelvis and Ureter,
Central Nervous System (Primary) Lymphoma, Central Nervous System
Lymphoma, Cerebellar Astrocytoma, Cerebral Astrocytoma, Cervical
Cancer, Childhood (Primary) Hepatocellular Cancer, Childhood
(Primary) Liver Cancer, Childhood Acute Lymphoblastic Leukemia,
Childhood Acute Myeloid Leukemia, Childhood Brain Stem Glioma,
Childhood Cerebellar Astrocytoma, Childhood Cerebral Astrocytoma,
Childhood Extracranial Germ Cell Tumors, Childhood Hodgkin's
Disease, Childhood Hodgkin's Lymphoma, Childhood Hypothalamic and
Visual Pathway Glioma, Childhood Lymphoblastic Leukemia, Childhood
Medulloblastoma, Childhood Non-Hodgkin's Lymphoma, Childhood Pineal
and Supratentorial Primitive Neuroectodermal Tumors, Childhood
Primary Liver Cancer, Childhood Rhabdomyosarcoma, Childhood Soft
Tissue Sarcoma, Childhood Visual Pathway and Hypothalamic Glioma,
Chronic Lymphocytic Leukemia, Chronic Myelogenous Leukemia, Colon
Cancer, Cutaneous T-Cell Lymphoma, Endocrine Pancreas Islet Cell
Carcinoma, Endometrial Cancer, Ependymoma, Epithelial Cancer,
Esophageal Cancer, Ewing's Sarcoma and Related Tumors, Exocrine
Pancreatic Cancer, Extracranial Germ Cell Tumor, Extragonadal Germ
Cell Tumor, Extrahepatic Bile Duct Cancer, Eye Cancer, Female
Breast Cancer, Gaucher's Disease, Gallbladder Cancer, Gastric
Cancer, Gastrointestinal Carcinoid Tumor, Gastrointestinal Tumors,
Germ Cell Tumors, Gestational Trophoblastic Tumor, Hairy Cell
Leukemia, Head and Neck Cancer, Hepatocellular Cancer, Hodgkin's
Disease, Hodgkin's Lymphoma, Hypergammaglobulinemia, Hypopharyngeal
Cancer, Intestinal Cancers, Intraocular Melanoma, Islet Cell
Carcinoma, Islet Cell Pancreatic Cancer, Kaposi's Sarcoma, Kidney
Cancer, Laryngeal Cancer, Lip and Oral Cavity Cancer, Liver Cancer,
Lung Cancer, Lymphoproliferative Disorders, Macroglobulinemia, Male
Breast Cancer, Malignant Mesothelioma, Malignant Thymoma,
Medulloblastoma, Melanoma, Mesothelioma, Metastatic Occult Primary
Squamous Neck Cancer, Metastatic Primary Squamous Neck Cancer,
Metastatic Squamous Neck Cancer, Multiple Myeloma, Multiple
Myeloma/Plasma Cell Neoplasm, Myelodysplastic Syndrome, Myelogenous
Leukemia, Myeloid Leukemia, Myeloproliferative Disorders, Nasal
Cavity and Paranasal Sinus Cancer, Nasopharyngeal Cancer,
Neuroblastoma, Non-Hodgkin's Lymphoma During Pregnancy, Nonmelanoma
Skin Cancer, Non-Small Cell Lung Cancer, Occult Primary Metastatic
Squamous Neck Cancer, Oropharyngeal Cancer, Osteo-/Malignant
Fibrous Sarcoma, Osteosarcoma/Malignant Fibrous Histiocytoma,
Osteosarcoma/Malignant Fibrous Histiocytoma of Bone, Ovarian
Epithelial Cancer, Ovarian Germ Cell Tumor, Ovarian Low Malignant
Potential Tumor, Pancreatic Cancer, Paraproteinemias, Purpura,
Parathyroid Cancer, Penile Cancer, Pheochromocytoma, Pituitary
Tumor, Plasma Cell Neoplasm/Multiple Myeloma, Primary Central
Nervous System Lymphoma, Primary Liver Cancer, Prostate Cancer,
Rectal Cancer, Renal Cell Cancer, Renal Pelvis and Ureter Cancer,
Retinoblastoma, Rhabdomyosarcoma, Salivary Gland Cancer,
Sarcoidosis Sarcomas, Sezary Syndrome, Skin Cancer, Small Cell Lung
Cancer, Small Intestine Cancer, Soft Tissue Sarcoma, Squamous Neck
Cancer, Stomach Cancer, Supratentorial Primitive Neuroectodermal
and Pineal Tumors, T-Cell Lymphoma, Testicular Cancer, Thymoma,
Thyroid Cancer, Transitional Cell Cancer of the Renal Pelvis and
Ureter, Transitional Renal Pelvis and Ureter Cancer, Trophoblastic
Tumors, Ureter and Renal Pelvis Cell Cancer, Urethral Cancer,
Uterine Cancer, Uterine Sarcoma, Vaginal Cancer, Visual Pathway and
Hypothalamic Glioma, Vulvar Cancer, Waldenstrom's
Macroglobulinemia, Wilms' Tumor, and any other hyperproliferative
disease, besides neoplasia, located in an organ system listed
above.
[0730] In another preferred embodiment, polynucleotides or
polypeptides, or agonists or antagonists of the present invention
are used to diagnose, prognose, prevent, and/or treat premalignant
conditions and to prevent progression to a neoplastic or malignant
state, including but not limited to those disorders described
above. Such uses are indicated in conditions known or suspected of
preceding progression to neoplasia or cancer, in particular, where
non-neoplastic cell growth consisting of hyperplasia, metaplasia,
or most particularly, dysplasia has occurred (for review of such
abnormal growth conditions, see Robbins and Angell, 1976, Basic
Pathology, 2d Ed., W.B. Saunders Co., Philadelphia, pp. 68-79.)
[0731] Hyperplasia is a form of controlled cell proliferation,
involving an increase in cell number in a tissue or organ, without
significant alteration in structure or function. Hyperplastic
disorders which can be diagnosed, prognosed, prevented, and/or
treated with compositions of the invention (including
polynucleotides, polypeptides, agonists or antagonists) include,
but are not limited to, angiofollicular mediastinal lymph node
hyperplasia, angiolymphoid hyperplasia with eosinophilia, atypical
melanocytic hyperplasia, basal cell hyperplasia, benign giant lymph
node hyperplasia, cementum hyperplasia, congenital adrenal
hyperplasia, congenital sebaceous hyperplasia, cystic hyperplasia,
cystic hyperplasia of the breast, denture hyperplasia, ductal
hyperplasia, endometrial hyperplasia, fibromuscular hyperplasia,
focal epithelial hyperplasia, gingival hyperplasia, inflammatory
fibrous hyperplasia, inflammatory papillary hyperplasia,
intravascular papillary endothelial hyperplasia, nodular
hyperplasia of prostate, nodular regenerative hyperplasia,
pseudoepitheliomatous hyperplasia, senile sebaceous hyperplasia,
and verrucous hyperplasia.
[0732] Metaplasia is a form of controlled cell growth in which one
type of adult or fully differentiated cell substitutes for another
type of adult cell. Metaplastic disorders which can be diagnosed,
prognosed, prevented, and/or treated with compositions of the
invention (including polynucleotides, polypeptides, agonists or
antagonists) include, but are not limited to, agnogenic myeloid
metaplasia, apocrine metaplasia, atypical metaplasia,
autoparenchymatous metaplasia, connective tissue metaplasia,
epithelial metaplasia, intestinal metaplasia, metaplastic anemia,
metaplastic ossification, metaplastic polyps, myeloid metaplasia,
primary myeloid metaplasia, secondary myeloid metaplasia, squamous
metaplasia, squamous metaplasia of amnion, and symptomatic myeloid
metaplasia.
[0733] Dysplasia is frequently a forerunner of cancer, and is found
mainly in the epithelia; it is the most disorderly form of
non-neoplastic cell growth, involving a loss in individual cell
uniformity and in the architectural orientation of cells.
Dysplastic cells often have abnormally large, deeply stained
nuclei, and exhibit pleomorphism. Dysplasia characteristically
occurs where there exists chronic irritation or inflammation.
Dysplastic disorders which can be diagnosed, prognosed, prevented,
and/or treated with compositions of the invention (including
polynucleotides, polypeptides, agonists or antagonists) include,
but are not limited to, anhidrotic ectodermal dysplasia,
anterofacial dysplasia, asphyxiating thoracic dysplasia,
atriodigital dysplasia, bronchopulmonary dysplasia, cerebral
dysplasia, cervical dysplasia, chondroectodermal dysplasia,
cleidocranial dysplasia, congenital ectodermal dysplasia,
craniodiaphysial dysplasia, craniocarpotarsal dysplasia,
craniometaphysial dysplasia, dentin dysplasia, diaphysial
dysplasia, ectodermal dysplasia, enamel dysplasia,
encephalo-ophthalmic dysplasia, dysplasia epiphysialis hemimelia,
dysplasia epiphysialis multiplex, dysplasia epiphysialis punctata,
epithelial dysplasia, faciodigitogenital dysplasia, familial
fibrous dysplasia of jaws, familial white folded dysplasia,
fibromuscular dysplasia, fibrous dysplasia of bone, florid osseous
dysplasia, hereditary renal-retinal dysplasia, hidrotic ectodermal
dysplasia, hypohidrotic ectodermal dysplasia, lymphopenic thymic
dysplasia, mammary dysplasia, mandibulofacial dysplasia,
metaphysial dysplasia, Mondini dysplasia, monostotic fibrous
dysplasia, mucoepithelial dysplasia, multiple epiphysial dysplasia,
oculoauriculovertebral dysplasia, oculodentodigital dysplasia,
oculovertebral dysplasia, odontogenic dysplasia,
ophthalmomandibulomelic dysplasia, periapical cemental dysplasia,
polyostotic fibrous dysplasia, pseudoachondroplastic
spondyloepiphysial dysplasia, retinal dysplasia, septo-optic
dysplasia, spondyloepiphysial dysplasia, and ventriculoradial
dysplasia.
[0734] Additional pre-neoplastic disorders which can be diagnosed,
prognosed, prevented, and/or treated with compositions of the
invention (including polynucleotides, polypeptides, agonists or
antagonists) include, but are not limited to, benign
dysproliferative disorders (e.g., benign tumors, fibrocystic
conditions, tissue hypertrophy, intestinal polyps, colon polyps,
and esophageal dysplasia), leukoplakia, keratoses, Bowen's disease,
Farmer's Skin, solar cheilitis, and solar keratosis.
[0735] In another embodiment, a polypeptide of the invention, or
polynucleotides, antibodies, agonists, or antagonists corresponding
to that polypeptide, may be used to diagnose and/or prognose
disorders associated with the tissue(s) in which the polypeptide of
the invention is expressed, including one, two, three, four, five,
or more tissues disclosed in Table 1B.2, column 5 (Tissue
Distribution Library Code).
[0736] In another embodiment, polynucleotides, polypeptides,
antibodies, and/or agonists or antagonists of the present invention
conjugated to a toxin or a radioactive isotope, as described
herein, may be used to treat cancers and neoplasms, including, but
not limited to those described herein. In a further preferred
embodiment, polynucleotides, polypeptides, antibodies, and/or
agonists or antagonists of the present invention conjugated to a
toxin or a radioactive isotope, as described herein, may be used to
treat acute myelogenous leukemia.
[0737] Additionally, polynucleotides, polypeptides, and/or agonists
or antagonists of the invention may affect apoptosis, and
therefore, would be useful in treating a number of diseases
associated with increased cell survival or the inhibition of
apoptosis. For example, diseases associated with increased cell
survival or the inhibition of apoptosis that could be diagnosed,
prognosed, prevented, and/or treated by polynucleotides,
polypeptides, and/or agonists or antagonists of the invention,
include cancers (such as follicular lymphomas, carcinomas with p53
mutations, and hormone-dependent tumors, including, but not limited
to colon cancer, cardiac tumors, pancreatic cancer, melanoma,
retinoblastoma, glioblastoma, lung cancer, intestinal cancer,
testicular cancer, stomach cancer, neuroblastoma, myxoma, myoma,
lymphoma, endothelioma, osteoblastoma, osteoclastoma, osteosarcoma,
chondrosarcoma, adenoma, breast cancer, prostate cancer, Kaposi's
sarcoma and ovarian cancer); autoimmune disorders such as, multiple
sclerosis, Sjogren's syndrome, Hashimoto's thyroiditis, biliary
cirrhosis, Behcet's disease, Crohn's disease, polymyositis,
systemic lupus erythematosus and immune-related glomerulonephritis
and rheumatoid arthritis) and viral infections (such as herpes
viruses, pox viruses and adenoviruses), inflammation, graft v. host
disease, acute graft rejection, and chronic graft rejection.
[0738] In preferred embodiments, polynucleotides, polypeptides,
and/or agonists or antagonists of the invention are used to inhibit
growth, progression, and/or metastasis of cancers, in particular
those listed above.
[0739] Additional diseases or conditions associated with increased
cell survival that could be diagnosed, prognosed, prevented, and/or
treated by polynucleotides, polypeptides, and/or agonists or
antagonists of the invention, include, but are not limited to,
progression, and/or metastases of malignancies and related
disorders such as leukemia (including acute leukemias (e.g., acute
lymphocytic leukemia, acute myelocytic leukemia (including
myeloblastic, promyelocytic, myelomonocytic, monocytic, and
erythroleukemia)) and chronic leukemias (e.g., chronic myelocytic
(granulocytic) leukemia and chronic lymphocytic leukemia)),
polycythemia vera, lymphomas (e.g., Hodgkin's disease and
non-Hodgkin's disease), multiple myeloma, Waldenstrom's
macroglobulinemia, heavy chain disease, and solid tumors including,
but not limited to, sarcomas and carcinomas such as fibrosarcoma,
myxosarcoma, liposarcoma, chondrosarcoma, osteogenic sarcoma,
chordoma, angiosarcoma, endotheliosarcoma, lymphangiosarcoma,
lymphangioendotheliosarcoma, synovioma, mesothelioma, Ewing's
tumor, leiomyosarcoma, rhabdomyosarcoma, colon carcinoma,
pancreatic cancer, breast cancer, ovarian cancer, prostate cancer,
squamous cell carcinoma, basal cell carcinoma, adenocarcinoma,
sweat gland carcinoma, sebaceous gland carcinoma, papillary
carcinoma, papillary adenocarcinomas, cystadenocarcinoma, medullary
carcinoma, bronchogenic carcinoma, renal cell carcinoma, hepatoma,
bile duct carcinoma, choriocarcinoma, seminoma, embryonal
carcinoma, Wilm's tumor, cervical cancer, testicular tumor, lung
carcinoma, small cell lung carcinoma, bladder carcinoma, epithelial
carcinoma, glioma, astrocytoma, medulloblastoma, craniopharyngioma,
ependymoma, pinealoma, emangioblastoma, acoustic neuroma,
oligodendroglioma, menangioma, melanoma, neuroblastoma, and
retinoblastoma.
[0740] Diseases associated with increased apoptosis that could be
diagnosed, prognosed, prevented, and/or treated by polynucleotides,
polypeptides, and/or agonists or antagonists of the invention,
include AIDS; neurodegenerative disorders (such as Alzheimer's
disease, Parkinson's disease, amyotrophic lateral sclerosis,
retinitis pigmentosa, cerebellar degeneration and brain tumor or
prior associated disease); autoimmune disorders (such as, multiple
sclerosis, Sjogren's syndrome, Hashimoto's thyroiditis, biliary
cirrhosis, Behcet's disease, Crohn's disease, polymyositis,
systemic lupus erythematosus and immune-related glomerulonephritis
and rheumatoid arthritis) myelodysplastic syndromes (such as
aplastic anemia), graft v. host disease, ischemic injury (such as
that caused by myocardial infarction, stroke and reperfusion
injury), liver injury (e.g., hepatitis related liver injury,
ischemia/reperfusion injury, cholestosis (bile duct injury) and
liver cancer); toxin-induced liver disease (such as that caused by
alcohol), septic shock, cachexia and anorexia.
[0741] Hyperproliferative diseases and/or disorders that could be
diagnosed, prognosed, prevented, and/or treated by polynucleotides,
polypeptides, and/or agonists or antagonists of the invention,
include, but are not limited to, neoplasms located in the liver,
abdomen, bone, breast, digestive system, pancreas, peritoneum,
endocrine glands (adrenal, parathyroid, pituitary, testicles,
ovary, thymus, thyroid), eye, head and neck, nervous system
(central and peripheral), lymphatic system, pelvis, skin, soft
tissue, spleen, thorax, and urogenital tract.
[0742] Similarly, other hyperproliferative disorders can also be
diagnosed, prognosed, prevented, and/or treated by polynucleotides,
polypeptides, and/or agonists or antagonists of the invention.
Examples of such hyperproliferative disorders include, but are not
limited to: hypergammaglobulinemia, lymphoproliferative disorders,
paraproteinemias, purpura, sarcoidosis, Sezary Syndrome,
Waldenstron's macroglobulinemia, Gaucher's Disease, histiocytosis,
and any other hyperproliferative disease, besides neoplasia,
located in an organ system listed above.
[0743] Another preferred embodiment utilizes polynucleotides of the
present invention to inhibit aberrant cellular division, by gene
therapy using the present invention, and/or protein fusions or
fragments thereof.
[0744] Thus, the present invention provides a method for treating
cell proliferative disorders by inserting into an abnormally
proliferating cell a polynucleotide of the present invention,
wherein said polynucleotide represses said expression.
[0745] Another embodiment of the present invention provides a
method of treating cell-proliferative disorders in individuals
comprising administration of one or more active gene copies of the
present invention to an abnormally proliferating cell or cells. In
a preferred embodiment, polynucleotides of the present invention is
a DNA construct comprising a recombinant expression vector
effective in expressing a DNA sequence encoding said
polynucleotides. In another preferred embodiment of the present
invention, the DNA construct encoding the polynucleotides of the
present invention is inserted into cells to be treated utilizing a
retrovirus, or more preferably an adenoviral vector (See G J.
Nabel, et. al., PNAS 1999 96: 324-326, which is hereby incorporated
by reference). In a most preferred embodiment, the viral vector is
defective and will not transform non-proliferating cells, only
proliferating cells. Moreover, in a preferred embodiment, the
polynucleotides of the present invention inserted into
proliferating cells either alone, or in combination with or fused
to other polynucleotides, can then be modulated via an external
stimulus (i.e. magnetic, specific small molecule, chemical, or drug
administration, etc.), which acts upon the promoter upstream of
said polynucleotides to induce expression of the encoded protein
product. As such the beneficial therapeutic affect of the present
invention may be expressly modulated (i.e. to increase, decrease,
or inhibit expression of the present invention) based upon said
external stimulus.
[0746] Polynucleotides of the present invention may be useful in
repressing expression of oncogenic genes or antigens. By
"repressing expression of the oncogenic genes" is intended the
suppression of the transcription of the gene, the degradation of
the gene transcript (pre-message RNA), the inhibition of splicing,
the destruction of the messenger RNA, the prevention of the
post-translational modifications of the protein, the destruction of
the protein, or the inhibition of the normal function of the
protein.
[0747] For local administration to abnormally proliferating cells,
polynucleotides of the present invention may be administered by any
method known to those of skill in the art including, but not
limited to transfection, electroporation, microinjection of cells,
or in vehicles such as liposomes, lipofectin, or as naked
polynucleotides, or any other method described throughout the
specification. The polynucleotide of the present invention may be
delivered by known gene delivery systems such as, but not limited
to, retroviral vectors (Gilboa, J. Virology 44:845 (1982); Hocke,
Nature 320:275 (1986); Wilson, et al., Proc. Natl. Acad. Sci.
U.S.A. 85:3014), vaccinia virus system (Chakrabarty et al., Mol.
Cell Biol. 5:3403 (1985) or other efficient DNA delivery systems
(Yates et al., Nature 313:812 (1985)) known to those skilled in the
art. These references are exemplary only and are hereby
incorporated by reference. In order to specifically deliver or
transfect cells which are abnormally proliferating and spare
non-dividing cells, it is preferable to utilize a retrovirus, or
adenoviral (as described in the art and elsewhere herein) delivery
system known to those of skill in the art. Since host DNA
replication is required for retroviral DNA to integrate and the
retrovirus will be unable to self replicate due to the lack of the
retrovirus genes needed for its life cycle. Utilizing such a
retroviral delivery system for polynucleotides of the present
invention will target said gene and constructs to abnormally
proliferating cells and will spare the non-dividing normal
cells.
[0748] The polynucleotides of the present invention may be
delivered directly to cell proliferative disorder/disease sites in
internal organs, body cavities and the like by use of imaging
devices used to guide an injecting needle directly to the disease
site. The polynucleotides of the present invention may also be
administered to disease sites at the time of surgical
intervention.
[0749] By "cell proliferative disease" is meant any human or animal
disease or disorder, affecting any one or any combination of
organs, cavities, or body parts, which is characterized by single
or multiple local abnormal proliferations of cells, groups of
cells, or tissues, whether benign or malignant.
[0750] Any amount of the polynucleotides of the present invention
may be administered as long as it has a biologically inhibiting
effect on the proliferation of the treated cells. Moreover, it is
possible to administer more than one of the polynucleotide of the
present invention simultaneously to the same site. By "biologically
inhibiting" is meant partial or total growth inhibition as well as
decreases in the rate of proliferation or growth of the cells. The
biologically inhibitory dose may be determined by assessing the
effects of the polynucleotides of the present invention on target
malignant or abnormally proliferating cell growth in tissue
culture, tumor growth in animals and cell cultures, or any other
method known to one of ordinary skill in the art.
[0751] The present invention is further directed to antibody-based
therapies which involve administering of anti-polypeptides and
anti-polynucleotide antibodies to a mammalian, preferably human,
patient for treating one or more of the described disorders.
Methods for producing anti-polypeptides and anti-polynucleotide
antibodies polyclonal and monoclonal antibodies are described in
detail elsewhere herein. Such antibodies may be provided in
pharmaceutically acceptable compositions as known in the art or as
described herein.
[0752] A summary of the ways in which the antibodies of the present
invention may be used therapeutically includes binding
polynucleotides or polypeptides of the present invention locally or
systemically in the body or by direct cytotoxicity of the antibody,
e.g. as mediated by complement (CDC) or by effector cells (ADCC).
Some of these approaches are described in more detail below. Armed
with the teachings provided herein, one of ordinary skill in the
art will know how to use the antibodies of the present invention
for diagnostic, monitoring or therapeutic purposes without undue
experimentation.
[0753] In particular, the antibodies, fragments and derivatives of
the present invention are useful for treating a subject having or
developing cell proliferative and/or differentiation disorders as
described herein. Such treatment comprises administering a single
or multiple doses of the antibody, or a fragment, derivative, or a
conjugate thereof.
[0754] The antibodies of this invention may be advantageously
utilized in combination with other monoclonal or chimeric
antibodies, or with lymphokines or hematopoietic growth factors,
for example., which serve to increase the number or activity of
effector cells which interact with the antibodies.
[0755] It is preferred to use high affinity and/or potent in vivo
inhibiting and/or neutralizing antibodies against polypeptides or
polynucleotides of the present invention, fragments or regions
thereof, for both immunoassays directed to and therapy of disorders
related to polynucleotides or polypeptides, including fragements
thereof, of the present invention. Such antibodies, fragments, or
regions, will preferably have an affinity for polynucleotides or
polypeptides, including fragements thereof. Preferred binding
affinities include those with a dissociation constant or Kd less
than 5.times.10.sup.-6 M, 10.sup.-6M, 5.times.10.sup.-7M,
10.sup.-7M, 5.times.10.sup.-8M, 10.sup.-8M, 5.times.10.sup.-9M,
10.sup.-9M, 5.times.10.sup.-10 M, 10.sup.-10 M, 5.times.10.sup.-11
M, 10.sup.-11 M, 5.times.10.sup.-12M, 10.sup.-12M,
5.times.10.sup.-13M, 10.sup.-13M, 5.times.10.sup.-14M, 10.sup.-14M,
5.times.10.sup.-15M, and 10.sup.-15M.
[0756] Moreover, polypeptides of the present invention are useful
in inhibiting the angiogenesis of proliferative cells or tissues,
either alone, as a protein fusion, or in combination with other
polypeptides directly or indirectly, as described elsewhere herein.
In a most preferred embodiment, said anti-angiogenesis effect may
be achieved indirectly, for example, through the inhibition of
hematopoietic, tumor-specific cells, such as tumor-associated
macrophages (See Joseph I B, et al. J Natl Cancer Inst,
90(21):1648-53 (1998), which is hereby incorporated by reference).
Antibodies directed to polypeptides or polynucleotides of the
present invention may also result in inhibition of angiogenesis
directly, or indirectly (See Witte L, et al., Cancer Metastasis
Rev. 17(2):155-61 (1998), which is hereby incorporated by
reference)).
[0757] Polypeptides, including protein fusions, of the present
invention, or fragments thereof may be useful in inhibiting
proliferative cells or tissues through the induction of apoptosis.
Said polypeptides may act either directly, or indirectly to induce
apoptosis of proliferative cells and tissues, for example in the
activation of a death-domain receptor, such as tumor necrosis
factor (TNF) receptor-1, CD95 (Fas/APO-1), TNF-receptor-related
apoptosis-mediated protein (TRAMP) and TNF-related
apoptosis-inducing ligand (TRAIL) receptor-1 and -2 (See
Schulze-Osthoff K, et. al., Eur J Biochem 254(3):439-59 (1998),
which is hereby incorporated by reference). Moreover, in another
preferred embodiment of the present invention, said polypeptides
may induce apoptosis through other mechanisms, such as in the
activation of other proteins which will activate apoptosis, or
through stimulating the expression of said proteins, either alone
or in combination with small molecule drugs or adjuvants, such as
apoptonin, galectins, thioredoxins, anti-inflammatory proteins (See
for example, Mutat Res 400(1-2):447-55 (1998), Med
Hypotheses.50(5):423-33 (1998), Chem Biol Interact. April 24;
111-112:23-34 (1998), J Mol Med.76(6):402-12 (1998), Int J Tissue
React; 20(1):3-15 (1998), which are all hereby incorporated by
reference).
[0758] Polypeptides, including protein fusions to, or fragments
thereof, of the present invention are useful in inhibiting the
metastasis of proliferative cells or tissues. Inhibition may occur
as a direct result of administering polypeptides, or antibodies
directed to said polypeptides as described elsewere herein, or
indirectly, such as activating the expression of proteins known to
inhibit metastasis, for example alpha 4 integrins, (See, e.g., Curr
Top Microbiol Immunol 1998;231:125-41, which is hereby incorporated
by reference). Such therapeutic affects of the present invention
may be achieved either alone, or in combination with small molecule
drugs or adjuvants.
[0759] In another embodiment, the invention provides a method of
delivering compositions containing the polypeptides of the
invention (e.g., compositions containing polypeptides or
polypeptide antibodes associated with heterologous polypeptides,
heterologous nucleic acids, toxins, or prodrugs) to targeted cells
expressing the polypeptide of the present invention. Polypeptides
or polypeptide antibodes of the invention may be associated with
with heterologous polypeptides, heterologous nucleic acids, toxins,
or prodrugs via hydrophobic, hydrophilic, ionic and/or covalent
interactions.
[0760] Polypeptides, protein fusions to, or fragments thereof, of
the present invention are useful in enhancing the immunogenicity
and/or antigenicity of proliferating cells or tissues, either
directly, such as would occur if the polypeptides of the present
invention `vaccinated` the immune response to respond to
proliferative antigens and immunogens, or indirectly, such as in
activating the expression of proteins known to enhance the immune
response (e.g. chemokines), to said antigens and immunogens.
Renal Disorders
[0761] Polynucleotides, polypeptides, antibodies, and/or agonists
or antagonists of the present invention, may be used to treat,
prevent, diagnose, and/or prognose disorders of the renal system.
Renal disorders which can be diagnosed, prognosed, prevented,
and/or treated with compositions of the invention include, but are
not limited to, kidney failure, nephritis, blood vessel disorders
of kidney, metabolic and congenital kidney disorders, urinary
disorders of the kidney, autoimmune disorders, sclerosis and
necrosis, electrolyte imbalance, and kidney cancers.
[0762] Kidney diseases which can be diagnosed, prognosed,
prevented, and/or treated with compositions of the invention
include, but are not limited to, acute kidney failure, chronic
kidney failure, atheroembolic renal failure, end-stage renal
disease, inflammatory diseases of the kidney (e.g., acute
glomerulonephritis, postinfectious glomerulonephritis, rapidly
progressive glomerulonephritis, nephrotic syndrome, membranous
glomerulonephritis, familial nephrotic syndrome,
membranoproliferative glomerulonephritis I and II, mesangial
proliferative glomerulonephritis, chronic glomerulonephritis, acute
tubulointerstitial nephritis, chronic tubulointerstitial nephritis,
acute post-streptococcal glomerulonephritis (PSGN), pyelonephritis,
lupus nephritis, chronic nephritis, interstitial nephritis, and
post-streptococcal glomerulonephritis), blood vessel disorders of
the kidneys (e.g., kidney infarction, atheroembolic kidney disease,
cortical necrosis, malignant nephrosclerosis, renal vein
thrombosis, renal underperfusion, renal retinopathy, renal
ischemia-reperfusion, renal artery embolism, and renal artery
stenosis), and kidney disorders resulting form urinary tract
disease (e.g., pyelonephritis, hydronephrosis, urolithiasis (renal
lithiasis, nephrolithiasis), reflux nephropathy, urinary tract
infections, urinary retention, and acute or chronic unilateral
obstructive uropathy.)
[0763] In addition, compositions of the invention can be used to
diagnose, prognose, prevent, and/or treat metabolic and congenital
disorders of the kidney (e.g., uremia, renal amyloidosis, renal
osteodystrophy, renal tubular acidosis, renal glycosuria,
nephrogenic diabetes insipidus, cystinuria, Fanconi's syndrome,
renal fibrocystic osteosis (renal rickets), Hartnup disease,
Bartter's syndrome, Liddle's syndrome, polycystic kidney disease,
medullary cystic disease, medullary sponge kidney, Alport's
syndrome, nail-patella syndrome, congenital nephrotic syndrome,
CRUSH syndrome, horseshoe kidney, diabetic nephropathy, nephrogenic
diabetes insipidus, analgesic nephropathy, kidney stones, and
membranous nephropathy), and autoimmune disorders of the kidney
(e.g., systemic lupus erythematosus (SLE), Goodpasture syndrome,
IgA nephropathy, and IgM mesangial proliferative
glomerulonephritis).
[0764] Compositions of the invention can also be used to diagnose,
prognose, prevent, and/or treat sclerotic or necrotic disorders of
the kidney (e.g., glomerulosclerosis, diabetic nephropathy, focal
segmental glomerulosclerosis (FSGS), necrotizing
glomerulonephritis, and renal papillary necrosis), cancers of the
kidney (e.g., nephroma, hypemephroma, nephroblastoma, renal cell
cancer, transitional cell cancer, renal adenocarcinoma, squamous
cell cancer, and Wilm's tumor), and electrolyte imbalances (e.g.,
nephrocalcinosis, pyuria, edema, hydronephritis, proteinuria,
hyponatremia, hypernatremia, hypokalemia, hyperkalemia,
hypocalcemia, hypercalcemia, hypophosphatemia, and
hyperphosphatemia).
[0765] Polypeptides may be administered using any method known in
the art, including, but not limited to, direct needle injection at
the delivery site, intravenous injection, topical administration,
catheter infusion, biolistic injectors, particle accelerators,
gelfoam sponge depots, other commercially available depot
materials, osmotic pumps, oral or suppositorial solid
pharmaceutical formulations, decanting or topical applications
during surgery, aerosol delivery. Such methods are known in the
art. Polypeptides may be administered as part of a Therapeutic,
described in more detail below. Methods of delivering
polynucleotides are described in more detail herein.
Cardiovascular Disorders
[0766] Polynucleotides or polypeptides, or agonists or antagonists
of the present invention, may be used to treat, prevent, diagnose,
and/or prognose cardiovascular disorders, including, but not
limited to, peripheral artery disease, such as limb ischemia.
[0767] Cardiovascular disorders include, but are not limited to,
cardiovascular abnormalities, such as arterio-arterial fistula,
arteriovenous fistula, cerebral arteriovenous malformations,
congenital heart defects, pulmonary atresia, and Scimitar Syndrome.
Congenital heart defects include, but are not limited to, aortic
coarctation, cor triatriatum, coronary vessel anomalies, crisscross
heart, dextrocardia, patent ductus arteriosus, Ebstein's anomaly,
Eisenmenger complex, hypoplastic left heart syndrome, levocardia,
tetralogy of fallot, transposition of great vessels, double outlet
right ventricle, tricuspid atresia, persistent truncus arteriosus,
and heart septal defects, such as aortopulmonary septal defect,
endocardial cushion defects, Lutembacher's Syndrome, trilogy of
Fallot, ventricular heart septal defects.
[0768] Cardiovascular disorders also include, but are not limited
to, heart disease, such as arrhythmias, carcinoid heart disease,
high cardiac output, low cardiac output, cardiac tamponade,
endocarditis (including bacterial), heart aneurysm, cardiac arrest,
congestive heart failure, congestive cardiomyopathy, paroxysmal
dyspnea, cardiac edema, heart hypertrophy, congestive
cardiomyopathy, left ventricular hypertrophy, right ventricular
hypertrophy, post-infarction heart rupture, ventricular septal
rupture, heart valve diseases, myocardial diseases, myocardial
ischemia, pericardial effusion, pericarditis (including
constrictive and tuberculous), pneumopericardium,
postpericardiotomy syndrome, pulmonary heart disease, rheumatic
heart disease, ventricular dysfunction, hyperemia, cardiovascular
pregnancy complications, Scimitar Syndrome, cardiovascular
syphilis, and cardiovascular tuberculosis.
[0769] Arrhythmias include, but are not limited to, sinus
arrhythmia, atrial fibrillation, atrial flutter, bradycardia,
extrasystole, Adams-Stokes Syndrome, bundle-branch block,
sinoatrial block, long QT syndrome, parasystole, Lown-Ganong-Levine
Syndrome, Mahaim-type pre-excitation syndrome,
Wolff-Parkinson-White syndrome, sick sinus syndrome, tachycardias,
and ventricular fibrillation. Tachycardias include paroxysmal
tachycardia, supraventricular tachycardia, accelerated
idioventricular rhythm, atrioventricular nodal reentry tachycardia,
ectopic atrial tachycardia, ectopic junctional tachycardia,
sinoatrial nodal reentry tachycardia, sinus tachycardia, Torsades
de Pointes, and ventricular tachycardia.
[0770] Heart valve diseases include, but are not limited to, aortic
valve insufficiency, aortic valve stenosis, hear murmurs, aortic
valve prolapse, mitral valve prolapse, tricuspid valve prolapse,
mitral valve insufficiency, mitral valve stenosis, pulmonary
atresia, pulmonary valve insufficiency, pulmonary valve stenosis,
tricuspid atresia, tricuspid valve insufficiency, and tricuspid
valve stenosis.
[0771] Myocardial diseases include, but are not limited to,
alcoholic cardiomyopathy, congestive cardiomyopathy, hypertrophic
cardiomyopathy, aortic subvalvular stenosis, pulmonary subvalvular
stenosis, restrictive cardiomyopathy, Chagas cardiomyopathy,
endocardial fibroelastosis, endomyocardial fibrosis, Kearns
Syndrome, myocardial reperfusion injury, and myocarditis.
[0772] Myocardial ischemias include, but are not limited to,
coronary disease, such as angina pectoris, coronary aneurysm,
coronary arteriosclerosis, coronary thrombosis, coronary vasospasm,
myocardial infarction and myocardial stunning.
[0773] Cardiovascular diseases also include vascular diseases such
as aneurysms, angiodysplasia, angiomatosis, bacillary angiomatosis,
Hippel-Lindau Disease, Klippel-Trenaunay-Weber Syndrome,
Sturge-Weber Syndrome, angioneurotic edema, aortic diseases,
Takayasu's Arteritis, aortitis, Leriche's Syndrome, arterial
occlusive diseases, arteritis, enarteritis, polyarteritis nodosa,
cerebrovascular disorders, diabetic angiopathies, diabetic
retinopathy, embolisms, thrombosis, erythromelalgia, hemorrhoids,
hepatic veno-occlusive disease, hypertension, hypotension,
ischemia, peripheral vascular diseases, phlebitis, pulmonary
veno-occlusive disease, Raynaud's disease, CREST syndrome, retinal
vein occlusion, Scimitar syndrome, superior vena cava syndrome,
telangiectasia, atacia telangiectasia, hereditary hemorrhagic
telangiectasia, varicocele, varicose veins, varicose ulcer,
vasculitis, and venous insufficiency.
[0774] Aneurysms include, but are not limited to, dissecting
aneurysms, false aneurysms, infected aneurysms, ruptured aneurysms,
aortic aneurysms, cerebral aneurysms, coronary aneurysms, heart
aneurysms, and iliac aneurysms.
[0775] Arterial occlusive diseases include, but are not limited to,
arteriosclerosis, intermittent claudication, carotid stenosis,
fibromuscular dysplasias, mesenteric vascular occlusion, Moyamoya
disease, renal artery obstruction, retinal artery occlusion, and
thromboangiitis obliterans.
[0776] Cerebrovascular disorders include, but are not limited to,
carotid artery diseases, cerebral amyloid angiopathy, cerebral
aneurysm, cerebral anoxia, cerebral arteriosclerosis, cerebral
arteriovenous malformation, cerebral artery diseases, cerebral
embolism and thrombosis, carotid artery thrombosis, sinus
thrombosis, Wallenberg's syndrome, cerebral hemorrhage, epidural
hematoma, subdural hematoma, subaraxhnoid hemorrhage, cerebral
infarction, cerebral ischemia (including transient), subclavian
steal syndrome, periventricular leukomalacia, vascular headache,
cluster headache, migraine, and vertebrobasilar insufficiency.
[0777] Embolisms include, but are not limited to, air embolisms,
amniotic fluid embolisms, cholesterol embolisms, blue toe syndrome,
fat embolisms, pulmonary embolisms, and thromoboembolisms.
Thrombosis include, but are not limited to, coronary thrombosis,
hepatic vein thrombosis, retinal vein occlusion, carotid artery
thrombosis, sinus thrombosis, Wallenberg's syndrome, and
thrombophlebitis.
[0778] Ischemic disorders include, but are not limited to, cerebral
ischemia, ischemic colitis, compartment syndromes, anterior
compartment syndrome, myocardial ischemia, reperfusion injuries,
and peripheral limb ischemia. Vasculitis includes, but is not
limited to, aortitis, arteritis, Behcet's Syndrome, Churg-Strauss
Syndrome, mucocutaneous lymph node syndrome, thromboangiitis
obliterans, hypersensitivity vasculitis, Schoenlein-Henoch purpura,
allergic cutaneous vasculitis, and Wegener's granulomatosis.
[0779] Polypeptides may be administered using any method known in
the art, including, but not limited to, direct needle injection at
the delivery site, intravenous injection, topical administration,
catheter infusion, biolistic injectors, particle accelerators,
gelfoam sponge depots, other commercially available depot
materials, osmotic pumps, oral or suppositorial solid
pharmaceutical formulations, decanting or topical applications
during surgery, aerosol delivery. Such methods are known in the
art. Polypeptides may be administered as part of a Therapeutic,
described in more detail below. Methods of delivering
polynucleotides are described in more detail herein.
Respiratory Disorders
[0780] Polynucleotides or polypeptides, or agonists or antagonists
of the present invention may be used to treat, prevent, diagnose,
and/or prognose diseases and/or disorders of the respiratory
system.
[0781] Diseases and disorders of the respiratory system include,
but are not limited to, nasal vestibulitis, nonallergic rhinitis
(e.g., acute rhinitis, chronic rhinitis, atrophic rhinitis,
vasomotor rhinitis), nasal polyps, and sinusitis, juvenile
angiofibromas, cancer of the nose and juvenile papillomas, vocal
cord polyps, nodules (singer's nodules), contact ulcers, vocal cord
paralysis, laryngoceles, pharyngitis (e.g., viral and bacterial),
tonsillitis, tonsillar cellulitis, parapharyngeal abscess,
laryngitis, laryngoceles, and throat cancers (e.g., cancer of the
nasopharynx, tonsil cancer, larynx cancer), lung cancer (e.g.,
squamous cell carcinoma, small cell (oat cell) carcinoma, large
cell carcinoma, and adenocarcinoma), allergic disorders
(eosinophilic pneumonia, hypersensitivity pneumonitis (e.g.,
extrinsic allergic alveolitis, allergic interstitial pneumonitis,
organic dust pneumoconiosis, allergic bronchopulmonary
aspergillosis, asthma, Wegener's granulomatosis (granulomatous
vasculitis), Goodpasture's syndrome)), pneumonia (e.g., bacterial
pneumonia (e.g., Streptococcus pneumoniae (pneumoncoccal
pneumonia), Staphylococcus aureus(staphylococcal pneumonia),
Gram-negative bacterial pneumonia (caused by, e.g., Klebsiella and
Pseudomas spp.), Mycoplasma pneumoniae pneumonia, Hemophilus
influenzae pneumonia, Legionella pneumophila (Legionnaires'
disease), and Chlamydia psittaci (Psittacosis)), and viral
pneumonia (e.g., influenza, chickenpox (varicella).
[0782] Additional diseases and disorders of the respiratory system
include, but are not limited to bronchiolitis, polio
(poliomyelitis), croup, respiratory syncytial viral infection,
mumps, erythema infectiosum (fifth disease), roseola infantum,
progressive rubella panencephalitis, german measles, and subacute
sclerosing panencephalitis), fungal pneumonia (e.g.,
Histoplasmosis, Coccidioidomycosis, Blastomycosis, ftungal
infections in people with severely suppressed immune systems (e.g.,
cryptococcosis, caused by Cryptococcus neoformans; aspergillosis,
caused by Aspergillus spp.; candidiasis, caused by Candida; and
mucormycosis)), Pneumocystis carinii (pneumocystis pneumonia),
atypical pneumonias (e.g., Mycoplasma and Chlamydia spp.),
opportunistic infection pneumonia, nosocomial pneumonia, chemical
pneumonitis, and aspiration pneumonia, pleural disorders (e.g.,
pleurisy, pleural effusion, and pneumothorax (e.g., simple
spontaneous pneumothorax, complicated spontaneous pneumothorax,
tension pneumothorax)), obstructive airway diseases (e.g., asthma,
chronic obstructive pulmonary disease (COPD), emphysema, chronic or
acute bronchitis), occupational lung diseases (e.g., silicosis,
black lung (coal workers' pneumoconiosis), asbestosis, berylliosis,
occupational asthsma, byssinosis, and benign pneumoconioses),
Infiltrative Lung Disease (e.g., pulmonary fibrosis (e.g.,
fibrosing alveolitis, usual interstitial pneumonia), idiopathic
pulmonary fibrosis, desquamative interstitial pneumonia, lymphoid
interstitial pneumonia, histiocytosis X (e.g., Letterer-Siwe
disease, Hand-Schuller-Christian disease, eosinophilic granuloma),
idiopathic pulmonary hemosiderosis, sarcoidosis and pulmonary
alveolar proteinosis), Acute respiratory distress syndrome (also
called, e.g., adult respiratory distress syndrome), edema,
pulmonary embolism, bronchitis (e.g., viral, bacterial),
bronchiectasis, atelectasis, lung abscess (caused by, e.g.,
Staphylococcus aureus or Legionella pneumophila), and cystic
fibrosis.
Anti-Angiogenesis Activity
[0783] The naturally occurring balance between endogenous
stimulators and inhibitors of angiogenesis is one in which
inhibitory influences predominate. Rastinejad et al., Cell
56:345-355 (1989). In those rare instances in which
neovascularization occurs under normal physiological conditions,
such as wound healing, organ regeneration, embryonic development,
and female reproductive processes, angiogenesis is stringently
regulated and spatially and temporally delimited. Under conditions
of pathological angiogenesis such as that characterizing solid
tumor growth, these regulatory controls fail. Unregulated
angiogenesis becomes pathologic and sustains progression of many
neoplastic and non-neoplastic diseases. A number of serious
diseases are dominated by abnormal neovascularization including
solid tumor growth and metastases, arthritis, some types of eye
disorders, and psoriasis. See, e.g., reviews by Moses et al.,
Biotech. 9:630-634 (1991); Folkman et al., N. Engl. J. Med.,
333:1757-1763 (1995); Auerbach et al., J Microvasc. Res. 29:401-411
(1985); Folkman, Advances in Cancer Research, eds. Klein and
Weinhouse, Academic Press, New York, pp. 175-203 (1985); Patz, Am.
J. Opthalmol. 94:715-743 (1982); and Folkman et al., Science
221:719-725 (1983). In a number of pathological conditions, the
process of angiogenesis contributes to the disease state. For
example, significant data have accumulated which suggest that the
growth of solid tumors is dependent on angiogenesis. Folkman and
Klagsbrun, Science 235:442-447 (1987).
[0784] The present invention provides for treatment of diseases or
disorders associated with neovascularization by administration of
the polynucleotides and/or polypeptides of the invention, as well
as agonists or antagonists of the present invention. Malignant and
metastatic conditions which can be treated with the polynucleotides
and polypeptides, or agonists or antagonists of the invention
include, but are not limited to, malignancies, solid tumors, and
cancers described herein and otherwise known in the art (for a
review of such disorders, see Fishman et al., Medicine, 2d Ed., J.
B. Lippincott Co., Philadelphia (1985)). Thus, the present
invention provides a method of treating an angiogenesis-related
disease and/or disorder, comprising administering to an individual
in need thereof a therapeutically effective amount of a
polynucleotide, polypeptide, antagonist and/or agonist of the
invention. For example, polynucleotides, polypeptides, antagonists
and/or agonists may be utilized in a variety of additional methods
in order to therapeutically treat a cancer or tumor. Cancers which
may be treated with polynucleotides, polypeptides, antagonists
and/or agonists include, but are not limited to solid tumors,
including prostate, lung, breast, ovarian, stomach, pancreas,
larynx, esophagus, testes, liver, parotid, biliary tract, colon,
rectum, cervix, uterus, endometrium, kidney, bladder, thyroid
cancer; primary tumors and metastases; melanomas; glioblastoma;
Kaposi's sarcoma; leiomyosarcoma; non-small cell lung cancer;
colorectal cancer; advanced malignancies; and blood born tumors
such as leukemias. For example, polynucleotides, polypeptides,
antagonists and/or agonists may be delivered topically, in order to
treat cancers such as skin cancer, head and neck tumors, breast
tumors, and Kaposi's sarcoma.
[0785] Within yet other aspects, polynucleotides, polypeptides,
antagonists and/or agonists may be utilized to treat superficial
forms of bladder cancer by, for example, intravesical
administration. Polynucleotides, polypeptides, antagonists and/or
agonists may be delivered directly into the tumor, or near, the
tumor site, via injection or a catheter. Of course, as the artisan
of ordinary skill will appreciate, the appropriate mode of
administration will vary according to the cancer to be treated.
Other modes of delivery are discussed herein.
[0786] Polynucleotides, polypeptides, antagonists and/or agonists
may be useful in treating other disorders, besides cancers, which
involve angiogenesis. These disorders include, but are not limited
to: benign tumors, for example hemangiomas, acoustic neuromas,
neurofibromas, trachomas, and pyogenic granulomas; artheroscleric
plaques; ocular angiogenic diseases, for example, diabetic
retinopathy, retinopathy of prematurity, macular degeneration,
corneal graft rejection, neovascular glaucoma, retrolental
fibroplasia, rubeosis, retinoblastoma, uvietis and Pterygia
(abnormal blood vessel growth) of the eye; rheumatoid arthritis;
psoriasis; delayed wound healing; endometriosis; vasculogenesis;
granulations; hypertrophic scars (keloids); nonunion fractures;
scleroderma; trachoma; vascular adhesions; myocardial angiogenesis;
coronary collaterals; cerebral collaterals; arteriovenous
malformations; ischemic limb angiogenesis; Osler-Webber Syndrome;
plaque neovascularization; telangiectasia; hemophiliac joints;
angiofibroma; fibromuscular dysplasia; wound granulation; Crohn's
disease; and atherosclerosis.
[0787] For example, within one aspect of the present invention
methods are provided for treating hypertrophic scars and keloids,
comprising the step of administering a polynucleotide, polypeptide,
antagonist and/or agonist of the invention to a hypertrophic scar
or keloid.
[0788] Within one embodiment of the present invention
polynucleotides, polypeptides, antagonists and/or agonists of the
invention are directly injected into a hypertrophic scar or keloid,
in order to prevent the progression of these lesions. This therapy
is of particular value in the prophylactic treatment of conditions
which are known to result in the development of hypertrophic scars
and keloids (e.g., burns), and is preferably initiated after the
proliferative phase has had time to progress (approximately 14 days
after the initial injury), but before hypertrophic scar or keloid
development. As noted above, the present invention also provides
methods for treating neovascular diseases of the eye, including for
example, corneal neovascularization, neovascular glaucoma,
proliferative diabetic retinopathy, retrolental fibroplasia and
macular degeneration.
[0789] Moreover, Ocular disorders associated with
neovascularization which can be treated with the polynucleotides
and polypeptides of the present invention (including agonists
and/or antagonists) include, but are not limited to: neovascular
glaucoma, diabetic retinopathy, retinoblastoma, retrolental
fibroplasia, uveitis, retinopathy of prematurity macular
degeneration, corneal graft neovascularization, as well as other
eye inflammatory diseases, ocular tumors and diseases associated
with choroidal or iris neovascularization. See, e.g., reviews by
Waltman et al., Am. J Ophthal. 85:704-710 (1978) and Gartner et
al., Surv. Ophthal. 22:291-312 (1978).
[0790] Thus, within one aspect of the present invention methods are
provided for treating neovascular diseases of the eye such as
corneal neovascularization (including corneal graft
neovascularization), comprising the step of administering to a
patient a therapeutically effective amount of a compound (as
described above) to the cornea, such that the formation of blood
vessels is inhibited. Briefly, the cornea is a tissue which
normally lacks blood vessels. In certain pathological conditions
however, capillaries may extend into the cornea from the
pericorneal vascular plexus of the limbus. When the cornea becomes
vascularized, it also becomes clouded, resulting in a decline in
the patient's visual acuity. Visual loss may become complete if the
cornea completely opacitates. A wide variety of disorders can
result in corneal neovascularization, including for example,
corneal infections (e.g., trachoma, herpes simplex keratitis,
leishmaniasis and onchocerciasis), immunological processes (e.g.,
graft rejection and Stevens-Johnson's syndrome), alkali burns,
trauma, inflammation (of any cause), toxic and nutritional
deficiency states, and as a complication of wearing contact
lenses.
[0791] Within particularly preferred embodiments of the invention,
may be prepared for topical administration in saline (combined with
any of the preservatives and antimicrobial agents commonly used in
ocular preparations), and administered in eyedrop form. The
solution or suspension may be prepared in its pure form and
administered several times daily. Alternatively, anti-angiogenic
compositions, prepared as described above, may also be administered
directly to the cornea. Within preferred embodiments, the
anti-angiogenic composition is prepared with a muco-adhesive
polymer which binds to cornea. Within further embodiments, the
anti-angiogenic factors or anti-angiogenic compositions may be
utilized as an adjunct to conventional steroid therapy. Topical
therapy may also be useful prophylactically in corneal lesions
which are known to have a high probability of inducing an
angiogenic response (such as chemical burns). In these instances
the treatment, likely in combination with steroids, may be
instituted immediately to help prevent subsequent
complications.
[0792] Within other embodiments, the compounds described above may
be injected directly into the corneal stroma by an ophthalmologist
under microscopic guidance. The preferred site of injection may
vary with the morphology of the individual lesion, but the goal of
the administration would be to place the composition at the
advancing front of the vasculature (i.e., interspersed between the
blood vessels and the normal cornea). In most cases this would
involve perilimbic corneal injection to "protect" the cornea from
the advancing blood vessels. This method may also be utilized
shortly after a corneal insult in order to prophylactically prevent
corneal neovascularization. In this situation the material could be
injected in the perilimbic cornea interspersed between the corneal
lesion and its undesired potential limbic blood supply. Such
methods may also be utilized in a similar fashion to prevent
capillary invasion of transplanted corneas. In a sustained-release
form injections might only be required 2-3 times per year. A
steroid could also be added to the injection solution to reduce
inflammation resulting from the injection itself.
[0793] Within another aspect of the present invention, methods are
provided for treating neovascular glaucoma, comprising the step of
administering to a patient a therapeutically effective amount of a
polynucleotide, polypeptide, antagonist and/or agonist to the eye,
such that the formation of blood vessels is inhibited. In one
embodiment, the compound may be administered topically to the eye
in order to treat early forms of neovascular glaucoma. Within other
embodiments, the compound may be implanted by injection into the
region of the anterior chamber angle. Within other embodiments, the
compound may also be placed in any location such that the compound
is continuously released into the aqueous humor. Within another
aspect of the present invention, methods are provided for treating
proliferative diabetic retinopathy, comprising the step of
administering to a patient a therapeutically effective amount of a
polynucleotide, polypeptide, antagonist and/or agonist to the eyes,
such that the formation of blood vessels is inhibited.
[0794] Within particularly preferred embodiments of the invention,
proliferative diabetic retinopathy may be treated by injection into
the aqueous humor or the vitreous, in order to increase the local
concentration of the polynucleotide, polypeptide, antagonist and/or
agonist in the retina. Preferably, this treatment should be
initiated prior to the acquisition of severe disease requiring
photocoagulation.
[0795] Within another aspect of the present invention, methods are
provided for treating retrolental fibroplasia, comprising the step
of administering to a patient a therapeutically effective amount of
a polynucleotide, polypeptide, antagonist and/or agonist to the
eye, such that the formation of blood vessels is inhibited. The
compound may be administered topically, via intravitreous injection
and/or via intraocular implants.
[0796] Additionally, disorders which can be treated with the
polynucleotides, polypeptides, agonists and/or agonists include,
but are not limited to, hemangioma, arthritis, psoriasis,
angiofibroma, atherosclerotic plaques, delayed wound healing,
granulations, hemophilic joints, hypertrophic scars, nonunion
fractures, Osler-Weber syndrome, pyogenic granuloma, scleroderma,
trachoma, and vascular adhesions.
[0797] Moreover, disorders and/or states, which can be treated,
prevented, diagnosed, and/or prognosed with the the
polynucleotides, polypeptides, agonists and/or agonists of the
invention include, but are not limited to, solid tumors, blood born
tumors such as leukemias, tumor metastasis, Kaposi's sarcoma,
benign tumors, for example hemangiomas, acoustic neuromas,
neurofibromas, trachomas, and pyogenic granulomas, rheumatoid
arthritis, psoriasis, ocular angiogenic diseases, for example,
diabetic retinopathy, retinopathy of prematurity, macular
degeneration, corneal graft rejection, neovascular glaucoma,
retrolental fibroplasia, rubeosis, retinoblastoma, and uvietis,
delayed wound healing, endometriosis, vascluogenesis, granulations,
hypertrophic scars (keloids), nonunion fractures, scleroderma,
trachoma, vascular adhesions, myocardial angiogenesis, coronary
collaterals, cerebral collaterals, arteriovenous malformations,
ischemic limb angiogenesis, Osler-Webber Syndrome, plaque
neovascularization, telangiectasia, hemophiliac joints,
angiofibroma fibromuscular dysplasia, wound granulation, Crohn's
disease, atherosclerosis, birth control agent by preventing
vascularization required for embryo implantation controlling
menstruation, diseases that have angiogenesis as a pathologic
consequence such as cat scratch disease (Rochele minalia quintosa),
ulcers (Helicobacter pylori), Bartonellosis and bacillary
angiomatosis.
[0798] In one aspect of the birth control method, an amount of the
compound sufficient to block embryo implantation is administered
before or after intercourse and fertilization have occurred, thus
providing an effective method of birth control, possibly a "morning
after" method. Polynucleotides, polypeptides, agonists and/or
agonists may also be used in controlling menstruation or
administered as either a peritoneal lavage fluid or for peritoneal
implantation in the treatment of endometriosis.
[0799] Polynucleotides, polypeptides, agonists and/or agonists of
the present invention may be incorporated into surgical sutures in
order to prevent stitch granulomas.
[0800] Polynucleotides, polypeptides, agonists and/or agonists may
be utilized in a wide variety of surgical procedures. For example,
within one aspect of the present invention a compositions (in the
form of, for example, a spray or film) may be utilized to coat or
spray an area prior to removal of a tumor, in order to isolate
normal surrounding tissues from malignant tissue, and/or to prevent
the spread of disease to surrounding tissues. Within other aspects
of the present invention, compositions (e.g., in the form of a
spray) may be delivered via endoscopic procedures in order to coat
tumors, or inhibit angiogenesis in a desired locale. Within yet
other aspects of the present invention, surgical meshes which have
been coated with anti-angiogenic compositions of the present
invention may be utilized in any procedure wherein a surgical mesh
might be utilized. For example, within one embodiment of the
invention a surgical mesh laden with an anti-angiogenic composition
may be utilized during abdominal cancer resection surgery (e.g.,
subsequent to colon resection) in order to provide support to the
structure, and to release an amount of the anti-angiogenic
factor.
[0801] Within further aspects of the present invention, methods are
provided for treating tumor excision sites, comprising
administering a polynucleotide, polypeptide, agonist and/or agonist
to the resection margins of a tumor subsequent to excision, such
that the local recurrence of cancer and the formation of new blood
vessels at the site is inhibited. Within one embodiment of the
invention, the anti-angiogenic compound is administered directly to
the tumor excision site (e.g., applied by swabbing, brushing or
otherwise coating the resection margins of the tumor with the
anti-angiogenic compound). Alternatively, the anti-angiogenic
compounds may be incorporated into known surgical pastes prior to
administration. Within particularly preferred embodiments of the
invention, the anti-angiogenic compounds are applied after hepatic
resections for malignancy, and after neurosurgical operations.
[0802] Within one aspect of the present invention, polynucleotides,
polypeptides, agonists and/or agonists may be administered to the
resection margin of a wide variety of tumors, including for
example, breast, colon, brain and hepatic tumors. For example,
within one embodiment of the invention, anti-angiogenic compounds
may be administered to the site of a neurological tumor subsequent
to excision, such that the formation of new blood vessels at the
site are inhibited.
[0803] The polynucleotides, polypeptides, agonists and/or agonists
of the present invention may also be administered along with other
anti-angiogenic factors. Representative examples of other
anti-angiogenic factors include: Anti-Invasive Factor, retinoic
acid and derivatives thereof, paclitaxel, Suramin, Tissue Inhibitor
of Metalloproteinase-1, Tissue Inhibitor of Metalloproteinase-2,
Plasminogen Activator Inhibitor-1, Plasminogen Activator
Inhibitor-2, and various forms of the lighter "d group" transition
metals.
[0804] Lighter "d group" transition metals include, for example,
vanadium, molybdenum, tungsten, titanium, niobium, and tantalum
species. Such transition metal species may form transition metal
complexes. Suitable complexes of the above-mentioned transition
metal species include oxo transition metal complexes.
[0805] Representative examples of vanadium complexes include oxo
vanadium complexes such as vanadate and vanadyl complexes. Suitable
vanadate complexes include metavanadate and orthovanadate complexes
such as, for example, ammonium metavanadate, sodium metavanadate,
and sodium orthovanadate. Suitable vanadyl complexes include, for
example, vanadyl acetylacetonate and vanadyl sulfate including
vanadyl sulfate hydrates such as vanadyl sulfate mono- and
trihydrates.
[0806] Representative examples of tungsten and molybdenum complexes
also include oxo complexes. Suitable oxo tungsten complexes include
tungstate and tungsten oxide complexes. Suitable tungstate
complexes include ammonium tungstate, calcium tungstate, sodium
tungstate dihydrate, and tungstic acid. Suitable tungsten oxides
include tungsten (IV) oxide and tungsten (VI) oxide. Suitable oxo
molybdenum complexes include molybdate, molybdenum oxide, and
molybdenyl complexes. Suitable molybdate complexes include ammonium
molybdate and its hydrates, sodium molybdate and its hydrates, and
potassium molybdate and its hydrates. Suitable molybdenum oxides
include molybdenum (VI) oxide, molybdenum (VI) oxide, and molybdic
acid. Suitable molybdenyl complexes include, for example,
molybdenyl acetylacetonate. Other suitable tungsten and molybdenum
complexes include hydroxo derivatives derived from, for example,
glycerol, tartaric acid, and sugars.
[0807] A wide variety of other anti-angiogenic factors may also be
utilized within the context of the present invention.
Representative examples include platelet factor 4; protamine
sulphate; sulphated chitin derivatives (prepared from queen crab
shells), (Murata et al., Cancer Res. 51:22-26, 1991); Sulphated
Polysaccharide Peptidoglycan Complex (SP-PG) (the function of this
compound may be enhanced by the presence of steroids such as
estrogen, and tamoxifen citrate); Staurosporine; modulators of
matrix metabolism, including for example, proline analogs,
cishydroxyproline, d,L-3,4-dehydroproline, Thiaproline,
alpha,alpha-dipyridyl, aminopropionitrile fumarate;
4-propyl-5-(4-pyridinyl)-2(3H)-oxazolone; Methotrexate;
Mitoxantrone; Heparin; Interferons; 2 Macroglobulin-serum; ChIMP-3
(Pavloff et al., J. Bio. Chem. 267:17321-17326, 1992); Chymostatin
(Tomkinson et al., Biochem J. 286:475-480, 1992); Cyclodextrin
Tetradecasulfate; Eponemycin; Camptothecin; Fumagillin (Ingber et
al., Nature 348:555-557, 1990); Gold Sodium Thiomalate ("GST";
Matsubara and Ziff, J. Clin. Invest. 79:1440-1446, 1987);
anticollagenase-serum; alpha2-antiplasmin (Holmes et al., J. Biol.
Chem. 262(4):1659-1664, 1987); Bisantrene (National Cancer
Institute); Lobenzarit disodium
(N-(2)-carboxyphenyl-4-chloroanthronilic acid disodium or "CCA";
Takeuchi et al., Agents Actions 36:312-316, 1992); Thalidomide;
Angostatic steroid; AGM-1470; carboxynaminolmidazole; and
metalloproteinase inhibitors such as BB94.
Diseases at the Cellular Level
[0808] Diseases associated with increased cell survival or the
inhibition of apoptosis that could be treated, prevented,
diagnosed, and/or prognosed using polynucleotides or polypeptides,
as well as antagonists or agonists of the present invention,
include cancers (such as follicular lymphomas, carcinomas with p53
mutations, and hormone-dependent tumors, including, but not limited
to colon cancer, cardiac tumors, pancreatic cancer, melanoma,
retinoblastoma, glioblastoma, lung cancer, intestinal cancer,
testicular cancer, stomach cancer, neuroblastoma, myxoma, myoma,
lymphoma, endothelioma, osteoblastoma, osteoclastoma, osteosarcoma,
chondrosarcoma, adenoma, breast cancer, prostate cancer, Kaposi's
sarcoma and ovarian cancer); autoimmune disorders (such as,
multiple sclerosis, Sjogren's syndrome, Hashimoto's thyroiditis,
biliary cirrhosis, Behcet's disease, Crohn's disease, polymyositis,
systemic lupus erythematosus and immune-related glomerulonephritis
and rheumatoid arthritis) and viral infections (such as herpes
viruses, pox viruses and adenoviruses), inflammation, graft v. host
disease, acute graft rejection, and chronic graft rejection.
[0809] In preferred embodiments, polynucleotides, polypeptides,
and/or antagonists of the invention are used to inhibit growth,
progression, and/or metasis of cancers, in particular those listed
above.
[0810] Additional diseases or conditions associated with increased
cell survival that could be treated or detected by polynucleotides
or polypeptides, or agonists or antagonists of the present
invention include, but are not limited to, progression, and/or
metastases of malignancies and related disorders such as leukemia
(including acute leukemias (e.g., acute lymphocytic leukemia, acute
myelocytic leukemia (including myeloblastic, promyelocytic,
myelomonocytic, monocytic, and erythroleukemia)) and chronic
leukemias (e.g., chronic myelocytic (granulocytic) leukemia and
chronic lymphocytic leukemia)), polycythemia vera, lymphomas (e.g.,
Hodgkin's disease and non-Hodgkin's disease), multiple myeloma,
Waldenstrom's macroglobulinemia, heavy chain disease, and solid
tumors including, but not limited to, sarcomas and carcinomas such
as fibrosarcoma, myxosarcoma, liposarcoma, chondrosarcoma,
osteogenic sarcoma, chordoma, angiosarcoma, endotheliosarcoma,
lymphangiosarcoma, lymphangioendotheliosarcoma, synovioma,
mesothelioma, Ewing's tumor, leiomyosarcoma, rhabdomyosarcoma,
colon carcinoma, pancreatic cancer, breast cancer, ovarian cancer,
prostate cancer, squamous cell carcinoma, basal cell carcinoma,
adenocarcinoma, sweat gland carcinoma, sebaceous gland carcinoma,
papillary carcinoma, papillary adenocarcinomas, cystadenocarcinoma,
medullary carcinoma, bronchogenic carcinoma, renal cell carcinoma,
hepatoma, bile duct carcinoma, choriocarcinoma, seminoma, embryonal
carcinoma, Wilm's tumor, cervical cancer, testicular tumor, lung
carcinoma, small cell lung carcinoma, bladder carcinoma, epithelial
carcinoma, glioma, astrocytoma, medulloblastoma, craniopharyngioma,
ependymoma, pinealoma, hemangioblastoma, acoustic neuroma,
oligodendroglioma, menangioma, melanoma, neuroblastoma, and
retinoblastoma.
[0811] Diseases associated with increased apoptosis that could be
treated, prevented, diagnosed, and/or prognesed using
polynucleotides or polypeptides, as well as agonists or antagonists
of the present invention, include, but are not limited to, AIDS;
neurodegenerative disorders (such as Alzheimer's disease,
Parkinson's disease, Amyotrophic lateral sclerosis, Retinitis
pigmentosa, Cerebellar degeneration and brain tumor or prior
associated disease); autoimmune disorders (such as, multiple
sclerosis, Sjogren's syndrome, Hashimoto's thyroiditis, biliary
cirrhosis, Behcet's disease, Crohn's disease, polymyositis,
systemic lupus erythematosus and immune-related glomerulonephritis
and rheumatoid arthritis) myelodysplastic syndromes (such as
aplastic anemia), graft v. host disease, ischemic injury (such as
that caused by myocardial infarction, stroke and reperfusion
injury), liver injury (e.g., hepatitis related liver injury,
ischemia/reperfusion injury, cholestosis (bile duct injury) and
liver cancer); toxin-induced liver disease (such as that caused by
alcohol), septic shock, cachexia and anorexia.
Wound Healing and Epithelial Cell Proliferation
[0812] In accordance with yet a further aspect of the present
invention, there is provided a process for utilizing
polynucleotides or polypeptides, as well as agonists or antagonists
of the present invention, for therapeutic purposes, for example, to
stimulate epithelial cell proliferation and basal keratinocytes for
the purpose of wound healing, and to stimulate hair follicle
production and healing of dermal wounds. Polynucleotides or
polypeptides, as well as agonists or antagonists of the present
invention, may be clinically useful in stimulating wound healing
including surgical wounds, excisional wounds, deep wounds involving
damage of the dermis and epidermis, eye tissue wounds, dental
tissue wounds, oral cavity wounds, diabetic ulcers, dermal ulcers,
cubitus ulcers, arterial ulcers, venous stasis ulcers, burns
resulting from heat exposure or chemicals, and other abnormal wound
healing conditions such as uremia, malnutrition, vitamin
deficiencies and complications associated with systemic treatment
with steroids, radiation therapy and antineoplastic drugs and
antimetabolites. Polynucleotides or polypeptides, as well as
agonists or antagonists of the present invention, could be used to
promote dermal reestablishment subsequent to dermal loss
[0813] Polynucleotides or polypeptides, as well as agonists or
antagonists of the present invention, could be used to increase the
adherence of skin grafts to a wound bed and to stimulate
re-epithelialization from the wound bed. The following are types of
grafts that polynucleotides or polypeptides, agonists or
antagonists of the present invention, could be used to increase
adherence to a wound bed: autografts, artificial skin, allografts,
autodermic graft, autoepdermic grafts, avacular grafts, Blair-Brown
grafts, bone graft, brephoplastic grafts, cutis graft, delayed
graft, dermic graft, epidermic graft, fascia graft, full thickness
graft, heterologous graft, xenograft, homologous graft,
hyperplastic graft, lamellar graft, mesh graft, mucosal graft,
Ollier-Thiersch graft, omenpal graft, patch graft, pedicle graft,
penetrating graft, split skin graft, thick split graft.
Polynucleotides or polypeptides, as well as agonists or antagonists
of the present invention, can be used to promote skin strength and
to improve the appearance of aged skin.
[0814] It is believed that polynucleotides or polypeptides, as well
as agonists or antagonists of the present invention, will also
produce changes in hepatocyte proliferation, and epithelial cell
proliferation in the lung, breast, pancreas, stomach, small
intestine, and large intestine. Polynucleotides or polypeptides, as
well as agonists or antagonists of the present invention, could
promote proliferation of epithelial cells such as sebocytes, hair
follicles, hepatocytes, type II pneumocytes, mucin-producing goblet
cells, and other epithelial cells and their progenitors contained
within the skin, lung, liver, and gastrointestinal tract.
Polynucleotides or polypeptides, agonists or antagonists of the
present invention, may promote proliferation of endothelial cells,
keratinocytes, and basal keratinocytes.
[0815] Polynucleotides or polypeptides, as well as agonists or
antagonists of the present invention, could also be used to reduce
the side effects of gut toxicity that result from radiation,
chemotherapy treatments or viral infections. Polynucleotides or
polypeptides, as well as agonists or antagonists of the present
invention, may have a cytoprotective effect on the small intestine
mucosa. Polynucleotides or polypeptides, as well as agonists or
antagonists of the present invention, may also stimulate healing of
mucositis (mouth ulcers) that result from chemotherapy and viral
infections.
[0816] Polynucleotides or polypeptides, as well as agonists or
antagonists of the present invention, could further be used in full
regeneration of skin in full and partial thickness skin defects,
including burns, (i.e., repopulation of hair follicles, sweat
glands, and sebaceous glands), treatment of other skin defects such
as psoriasis. Polynucleotides or polypeptides, as well as agonists
or antagonists of the present invention, could be used to treat
epidermolysis bullosa, a defect in adherence of the epidermis to
the underlying dermis which results in frequent, open and painful
blisters by accelerating reepithelialization of these lesions.
Polynucleotides or polypeptides, as well as agonists or antagonists
of the present invention, could also be used to treat gastric and
doudenal ulcers and help heal by scar formation of the mucosal
lining and regeneration of glandular mucosa and duodenal mucosal
lining more rapidly. Inflammatory bowel diseases, such as Crohn's
disease and ulcerative colitis, are diseases which result in
destruction of the mucosal surface of the small or large intestine,
respectively. Thus, polynucleotides or polypeptides, as well as
agonists or antagonists of the present invention, could be used to
promote the resurfacing of the mucosal surface to aid more rapid
healing and to prevent progression of inflammatory bowel disease.
Treatment with polynucleotides or polypeptides, agonists or
antagonists of the present invention, is expected to have a
significant effect on the production of mucus throughout the
gastrointestinal tract and could be used to protect the intestinal
mucosa from injurious substances that are ingested or following
surgery. Polynucleotides or polypeptides, as well as agonists or
antagonists of the present invention, could be used to treat
diseases associate with the under expression.
[0817] Moreover, polynucleotides or polypeptides, as well as
agonists or antagonists of the present invention, could be used to
prevent and heal damage to the lungs due to various pathological
states. Polynucleotides or polypeptides, as well as agonists or
antagonists of the present invention, which could stimulate
proliferation and differentiation and promote the repair of alveoli
and brochiolar epithelium to prevent or treat acute or chronic lung
damage. For example, emphysema, which results in the progressive
loss of aveoli, and inhalation injuries, i.e., resulting from smoke
inhalation and burns, that cause necrosis of the bronchiolar
epithelium and alveoli could be effectively treated using
polynucleotides or polypeptides, agonists or antagonists of the
present invention. Also, polynucleotides or polypeptides, as well
as agonists or antagonists of the present invention, could be used
to stimulate the proliferation of and differentiation of type II
pneumocytes, which may help treat or prevent disease such as
hyaline membrane diseases, such as infant respiratory distress
syndrome and bronchopulmonary displasia, in premature infants.
[0818] Polynucleotides or polypeptides, as well as agonists or
antagonists of the present invention, could stimulate the
proliferation and differentiation of hepatocytes and, thus, could
be used to alleviate or treat liver diseases and pathologies such
as fulminant liver failure caused by cirrhosis, liver damage caused
by viral hepatitis and toxic substances (i.e., acetaminophen,
carbon tetraholoride and other hepatotoxins known in the art).
[0819] In addition, polynucleotides or polypeptides, as well as
agonists or antagonists of the present invention, could be used
treat or prevent the onset of diabetes mellitus. In patients with
newly diagnosed Types I and II diabetes, where some islet cell
function remains, polynucleotides or polypeptides, as well as
agonists or antagonists of the present invention, could be used to
maintain the islet function so as to alleviate, delay or prevent
permanent manifestation of the disease. Also, polynucleotides or
polypeptides, as well as agonists or antagonists of the present
invention, could be used as an auxiliary in islet cell
transplantation to improve or promote islet cell function.
Neural Activity and Neurological Diseases
[0820] The polynucleotides, polypeptides and agonists or
antagonists of the invention may be used for the diagnosis and/or
treatment of diseases, disorders, damage or injury of the brain
and/or nervous system. Nervous system disorders that can be treated
with the compositions of the invention (e.g., polypeptides,
polynucleotides, and/or agonists or antagonists), include, but are
not limited to, nervous system injuries, and diseases or disorders
which result in either a disconnection of axons, a diminution or
degeneration of neurons, or demyelination. Nervous system lesions
which may be treated in a patient (including human and non-human
mammalian patients) according to the methods of the invention,
include but are not limited to, the following lesions of either the
central (including spinal cord, brain) or peripheral nervous
systems: (1) ischemic lesions, in which a lack of oxygen in a
portion of the nervous system results in neuronal injury or death,
including cerebral infarction or ischemia, or spinal cord
infarction or ischemia; (2) traumatic lesions, including lesions
caused by physical injury or associated with surgery, for example,
lesions which sever a portion of the nervous system, or compression
injuries; (3) malignant lesions, in which a portion of the nervous
system is destroyed or injured by malignant tissue which is either
a nervous system associated malignancy or a malignancy derived from
non-nervous system tissue; (4) infectious lesions, in which a
portion of the nervous system is destroyed or injured as a result
of infection, for example, by an abscess or associated with
infection by human immunodeficiency virus, herpes zoster, or herpes
simplex virus or with Lyme disease, tuberculosis, or syphilis; (5)
degenerative lesions, in which a portion of the nervous system is
destroyed or injured as a result of a degenerative process
including but not limited to, degeneration associated with
Parkinson's disease, Alzheimer's disease, Huntington's chorea, or
amyotrophic lateral sclerosis (ALS); (6) lesions associated with
nutritional diseases or disorders, in which a portion of the
nervous system is destroyed or injured by a nutritional disorder or
disorder of metabolism including, but not limited to, vitamin B12
deficiency, folic acid deficiency, Wernicke disease,
tobacco-alcohol amblyopia, Marchiafava-Bignami disease (primary
degeneration of the corpus callosum), and alcoholic cerebellar
degeneration; (7) neurological lesions associated with systemic
diseases including, but not limited to, diabetes (diabetic
neuropathy, Bell's palsy), systemic lupus erythematosus, carcinoma,
or sarcoidosis; (8) lesions caused by toxic substances including
alcohol, lead, or particular neurotoxins; and (9) demyelinated
lesions in which a portion of the nervous system is destroyed or
injured by a demyelinating disease including, but not limited to,
multiple sclerosis, human immunodeficiency virus-associated
myelopathy, transverse myelopathy or various etiologies,
progressive multifocal leukoencephalopathy, and central pontine
myelinolysis.
[0821] In one embodiment, the polypeptides, polynucleotides, or
agonists or antagonists of the invention are used to protect neural
cells from the damaging effects of hypoxia. In a further preferred
embodiment, the polypeptides, polynucleotides, or agonists or
antagonists of the invention are used to protect neural cells from
the damaging effects of cerebral hypoxia. According to this
embodiment, the compositions of the invention are used to treat or
prevent neural cell injury associated with cerebral hypoxia. In one
non-exclusive aspect of this embodiment, the polypeptides,
polynucleotides, or agonists or antagonists of the invention, are
used to treat or prevent neural cell injury associated with
cerebral ischemia. In another non-exclusive aspect of this
embodiment, the polypeptides, polynucleotides, or agonists or
antagonists of the invention are used to treat or prevent neural
cell injury associated with cerebral infarction.
[0822] In another preferred embodiment, the polypeptides,
polynucleotides, or agonists or antagonists of the invention are
used to treat or prevent neural cell injury associated with a
stroke. In a specific embodiment, the polypeptides,
polynucleotides, or agonists or antagonists of the invention are
used to treat or prevent cerebral neural cell injury associated
with a stroke.
[0823] In another preferred embodiment, the polypeptides,
polynucleotides, or agonists or antagonists of the invention are
used to treat or prevent neural cell injury associated with a heart
attack. In a specific embodiment, the polypeptides,
polynucleotides, or agonists or antagonists of the invention are
used to treat or prevent cerebral neural cell injury associated
with a heart attack.
[0824] The compositions of the invention which are useful for
treating or preventing a nervous system disorder may be selected by
testing for biological activity in promoting the survival or
differentiation of neurons. For example, and not by way of
limitation, compositions of the invention which elicit any of the
following effects may be useful according to the invention: (1)
increased survival time of neurons in culture either in the
presence or absence of hypoxia or hypoxic conditions; (2) increased
sprouting of neurons in culture or in vivo; (3) increased
production of a neuron-associated molecule in culture or in vivo,
e.g., choline acetyltransferase or acetylcholinesterase with
respect to motor neurons; or (4) decreased symptoms of neuron
dysfunction in vivo. Such effects may be measured by any method
known in the art. In preferred, non-limiting embodiments, increased
survival of neurons may routinely be measured using a method set
forth herein or otherwise known in the art, such as, for example,
in Zhang et al., Proc Natl Acad Sci USA 97:3637-42 (2000) or in
Arakawa et al., J. Neurosci., 10:3507-15 (1990); increased
sprouting of neurons may be detected by methods known in the art,
such as, for example, the methods set forth in Pestronk et al.,
Exp. Neurol., 70:65-82 (1980), or Brown et al., Ann. Rev.
Neurosci., 4:17-42 (1981); increased production of
neuron-associated molecules may be measured by bioassay, enzymatic
assay, antibody binding, Northern blot assay, etc., using
techniques known in the art and depending on the molecule to be
measured; and motor neuron dysfunction may be measured by assessing
the physical manifestation of motor neuron disorder, e.g.,
weakness, motor neuron conduction velocity, or functional
disability.
[0825] In specific embodiments, motor neuron disorders that may be
treated according to the invention include, but are not limited to,
disorders such as infarction, infection, exposure to toxin, trauma,
surgical damage, degenerative disease or malignancy that may affect
motor neurons as well as other components of the nervous system, as
well as disorders that selectively affect neurons such as
amyotrophic lateral sclerosis, and including, but not limited to,
progressive spinal muscular atrophy, progressive bulbar palsy,
primary lateral sclerosis, infantile and juvenile muscular atrophy,
progressive bulbar paralysis of childhood (Fazio-Londe syndrome),
poliomyelitis and the post polio syndrome, and Hereditary
Motorsensory Neuropathy (Charcot-Marie-Tooth Disease).
[0826] Further, polypeptides or polynucleotides of the invention
may play a role in neuronal survival; synapse formation;
conductance; neural differentiation, etc. Thus, compositions of the
invention (including polynucleotides, polypeptides, and agonists or
antagonists) may be used to diagnose and/or treat or prevent
diseases or disorders associated with these roles, including, but
not limited to, learning and/or cognition disorders. The
compositions of the invention may also be useful in the treatment
or prevention of neurodegenerative disease states and/or
behavioural disorders. Such neurodegenerative disease states and/or
behavioral disorders include, but are not limited to, Alzheimer's
Disease, Parkinson's Disease, Huntington's Disease, Tourette
Syndrome, schizophrenia, mania, dementia, paranoia, obsessive
compulsive disorder, panic disorder, learning disabilities, ALS,
psychoses, autism, and altered behaviors, including disorders in
feeding, sleep patterns, balance, and perception. In addition,
compositions of the invention may also play a role in the
treatment, prevention and/or detection of developmental disorders
associated with the developing embryo, or sexually-linked
disorders.
[0827] Additionally, polypeptides, polynucleotides and/or agonists
or antagonists of the invention, may be useful in protecting neural
cells from diseases, damage, disorders, or injury, associated with
cerebrovascular disorders including, but not limited to, carotid
artery diseases (e.g., carotid artery thrombosis, carotid stenosis,
or Moyamoya Disease), cerebral amyloid angiopathy, cerebral
aneurysm, cerebral anoxia, cerebral arteriosclerosis, cerebral
arteriovenous malformations, cerebral artery diseases, cerebral
embolism and thrombosis (e.g., carotid artery thrombosis, sinus
thrombosis, or Wallenberg's Syndrome), cerebral hemorrhage (e.g.,
epidural or subdural hematoma, or subarachnoid hemorrhage),
cerebral infarction, cerebral ischemia (e.g., transient cerebral
ischemia, Subclavian Steal Syndrome, or vertebrobasilar
insufficiency), vascular dementia (e.g., multi-infarct),
leukomalacia, periventricular, and vascular headache (e.g., cluster
headache or migraines).
[0828] In accordance with yet a further aspect of the present
invention, there is provided a process for utilizing
polynucleotides or polypeptides, as well as agonists or antagonists
of the present invention, for therapeutic purposes, for example, to
stimulate neurological cell proliferation and/or differentiation.
Therefore, polynucleotides, polypeptides, agonists and/or
antagonists of the invention may be used to treat and/or detect
neurologic diseases. Moreover, polynucleotides or polypeptides, or
agonists or antagonists of the invention, can be used as a marker
or detector of a particular nervous system disease or disorder.
[0829] Examples of neurologic diseases which can be treated or
detected with polynucleotides, polypeptides, agonists, and/or
antagonists of the present invention include brain diseases, such
as metabolic brain diseases which includes phenylketonuria such as
maternal phenylketonuria, pyruvate carboxylase deficiency, pyruvate
dehydrogenase complex deficiency, Wernicke's Encephalopathy, brain
edema, brain neoplasms such as cerebellar neoplasms which include
infratentorial neoplasms, cerebral ventricle neoplasms such as
choroid plexus neoplasms, hypothalamic neoplasms, supratentorial
neoplasms, canavan disease, cerebellar diseases such as cerebellar
ataxia which include spinocerebellar degeneration such as ataxia
telangiectasia, cerebellar dyssynergia, Friederich's Ataxia,
Machado-Joseph Disease, olivopontocerebellar atrophy, cerebellar
neoplasms such as infratentorial neoplasms, diffuse cerebral
sclerosis such as encephalitis periaxialis, globoid cell
leukodystrophy, metachromatic leukodystrophy and subacute
sclerosing panencephalitis.
[0830] Additional neurologic diseases which can be treated or
detected with polynucleotides, polypeptides, agonists, and/or
antagonists of the present invention include cerebrovascular
disorders (such as carotid artery diseases which include carotid
artery thrombosis, carotid stenosis and Moyamoya Disease), cerebral
amyloid angiopathy, cerebral aneurysm, cerebral anoxia, cerebral
arteriosclerosis, cerebral arteriovenous malformations, cerebral
artery diseases, cerebral embolism and thrombosis such as carotid
artery thrombosis, sinus thrombosis and Wallenberg's Syndrome,
cerebral hemorrhage such as epidural hematoma, subdural hematoma
and subarachnoid hemorrhage, cerebral infarction, cerebral ischemia
such as transient cerebral ischemia, Subclavian Steal Syndrome and
vertebrobasilar insufficiency, vascular dementia such as
multi-infarct dementia, periventricular leukomalacia, vascular
headache such as cluster headache and migraine.
[0831] Additional neurologic diseases which can be treated or
detected with polynucleotides, polypeptides, agonists, and/or
antagonists of the present invention include dementia such as AIDS
Dementia Complex, presenile dementia such as Alzheimer's Disease
and Creutzfeldt-Jakob Syndrome, senile dementia such as Alzheimer's
Disease and progressive supranuclear palsy, vascular dementia such
as multi-infarct dementia, encephalitis which include encephalitis
periaxialis, viral encephalitis such as epidemic encephalitis,
Japanese Encephalitis, St. Louis Encephalitis, tick-borne
encephalitis and West Nile Fever, acute disseminated
encephalomyelitis, meningoencephalitis such as
uveomeningoencephalitic syndrome, Postencephalitic Parkinson
Disease and subacute sclerosing panencephalitis, encephalomalacia
such as periventricular leukomalacia, epilepsy such as generalized
epilepsy which includes infantile spasms, absence epilepsy,
myoclonic epilepsy which includes MERRF Syndrome, tonic-clonic
epilepsy, partial epilepsy such as complex partial epilepsy,
frontal lobe epilepsy and temporal lobe epilepsy, post-traumatic
epilepsy, status epilepticus such as Epilepsia Partialis Continua,
and Hallervorden-Spatz Syndrome.
[0832] Additional neurologic diseases which can be treated or
detected with polynucleotides, polypeptides, agonists, and/or
antagonists of the present invention include hydrocephalus such as
Dandy-Walker Syndrome and normal pressure hydrocephalus,
hypothalamic diseases such as hypothalamic neoplasms, cerebral
malaria, narcolepsy which includes cataplexy, bulbar poliomyelitis,
cerebri pseudotumor, Rett Syndrome, Reye's Syndrome, thalamic
diseases, cerebral toxoplasmosis, intracranial tuberculoma and
Zellweger Syndrome, central nervous system infections such as AIDS
Dementia Complex, Brain Abscess, subdural empyema,
encephalomyelitis such as Equine Encephalomyelitis, Venezuelan
Equine Encephalomyelitis, Necrotizing Hemorrhagic
Encephalomyelitis, Visna, and cerebral malaria.
[0833] Additional neurologic diseases which can be treated or
detected with polynucleotides, polypeptides, agonists, and/or
antagonists of the present invention include meningitis such as
arachnoiditis, aseptic meningtitis such as viral meningtitis which
includes lymphocytic choriomeningitis, Bacterial meningtitis which
includes Haemophilus Meningtitis, Listeria Meningtitis,
Meningococcal Meningtitis such as Waterhouse-Friderichsen Syndrome,
Pneumococcal Meningtitis and meningeal tuberculosis, fungal
meningitis such as Cryptococcal Meningtitis, subdural effusion,
meningoencephalitis such as uvemeningoencephalitic syndrome,
myelitis such as transverse myelitis, neurosyphilis such as tabes
dorsalis, poliomyelitis which includes bulbar poliomyelitis and
postpoliomyelitis syndrome, prion diseases (such as
Creutzfeldt-Jakob Syndrome, Bovine Spongiform Encephalopathy,
Gerstmann-Straussler Syndrome, Kuru, Scrapie), and cerebral
toxoplasmosis.
[0834] Additional neurologic diseases which can be treated or
detected with polynucleotides, polypeptides, agonists, and/or
antagonists of the present invention include central nervous system
neoplasms such as brain neoplasms that include cerebellar neoplasms
such as infratentorial neoplasms, cerebral ventricle neoplasms such
as choroid plexus neoplasms, hypothalamic neoplasms and
supratentorial neoplasms, meningeal neoplasms, spinal cord
neoplasms which include epidural neoplasms, demyelinating diseases
such as Canavan Diseases, diffuse cerebral sceloris which includes
adrenoleukodystrophy, encephalitis periaxialis, globoid cell
leukodystrophy, diffuse cerebral sclerosis such as metachromatic
leukodystrophy, allergic encephalomyelitis, necrotizing hemorrhagic
encephalomyelitis, progressive multifocal leukoencephalopathy,
multiple sclerosis, central pontine myelinolysis, transverse
myelitis, neuromyelitis optica, Scrapie, Swayback, Chronic Fatigue
Syndrome, Visna, High Pressure Nervous Syndrome, Meningism, spinal
cord diseases such as amyotonia congenita, amyotrophic lateral
sclerosis, spinal muscular atrophy such as Werdnig-Hoffmann
Disease, spinal cord compression, spinal cord neoplasms such as
epidural neoplasms, syringomyelia, Tabes Dorsalis, Stiff-Man
Syndrome, mental retardation such as Angelman Syndrome, Cri-du-Chat
Syndrome, De Lange's Syndrome, Down Syndrome, Gangliosidoses such
as gangliosidoses G(M1), Sandhoff Disease, Tay-Sachs Disease,
Hartnup Disease, homocystinuria, Laurence-Moon-Biedl Syndrome,
Lesch-Nyhan Syndrome, Maple Syrup Urine Disease, mucolipidosis such
as fucosidosis, neuronal ceroid-lipofuscinosis, oculocerebrorenal
syndrome, phenylketonuria such as maternal phenylketonuria,
Prader-Willi Syndrome, Rett Syndrome, Rubinstein-Taybi Syndrome,
Tuberous Sclerosis, WAGR Syndrome, nervous system abnormalities
such as holoprosencephaly, neural tube defects such as anencephaly
which includes hydrangencephaly, Arnold-Chairi Deformity,
encephalocele, meningocele, meningomyelocele, spinal dysraphism
such as spina bifida cystica and spina bifida occulta.
[0835] Additional neurologic diseases which can be treated or
detected with polynucleotides, polypeptides, agonists, and/or
antagonists of the present invention include hereditary motor and
sensory neuropathies which include Charcot-Marie Disease,
Hereditary optic atrophy, Refsum's Disease, hereditary spastic
paraplegia, Werdnig-Hoffmann Disease, Hereditary Sensory and
Autonomic Neuropathies such as Congenital Analgesia and Familial
Dysautonomia, Neurologic manifestations (such as agnosia that
include Gerstmann's Syndrome, Amnesia such as retrograde amnesia,
apraxia, neurogenic bladder, cataplexy, communicative disorders
such as hearing disorders that includes deafness, partial hearing
loss, loudness recruitment and tinnitus, language disorders such as
aphasia which include agraphia, anomia, broca aphasia, and Wernicke
Aphasia, Dyslexia such as Acquired Dyslexia, language development
disorders, speech disorders such as aphasia which includes anomia,
broca aphasia and Wemicke Aphasia, articulation disorders,
communicative disorders such as speech disorders which include
dysarthria, echolalia, mutism and stuttering, voice disorders such
as aphonia and hoarseness, decerebrate state, delirium,
fasciculation, hallucinations, meningism, movement disorders such
as angelman syndrome, ataxia, athetosis, chorea, dystonia,
hypokinesia, muscle hypotonia, myoclonus, tic, torticollis and
tremor, muscle hypertonia such as muscle rigidity such as stiff-man
syndrome, muscle spasticity, paralysis such as facial paralysis
which includes Herpes Zoster Oticus, Gastroparesis, Hemiplegia,
ophthalmoplegia such as diplopia, Duane's Syndrome, Horner's
Syndrome, Chronic progressive external ophthalmoplegia such as
Kearns Syndrome, Bulbar Paralysis, Tropical Spastic Paraparesis,
Paraplegia such as Brown-Sequard Syndrome, quadriplegia,
respiratory paralysis and vocal cord paralysis, paresis, phantom
limb, taste disorders such as ageusia and dysgeusia, vision
disorders such as amblyopia, blindness, color vision defects,
diplopia, hemianopsia, scotoma and subnormal vision, sleep
disorders such as hypersomnia which includes Kleine-Levin Syndrome,
insomnia, and somnambulism, spasm such as trismus, unconsciousness
such as coma, persistent vegetative state and syncope and vertigo,
neuromuscular diseases such as amyotonia congenita, amyotrophic
lateral sclerosis, Lambert-Eaton Myasthenic Syndrome, motor neuron
disease, muscular atrophy such as spinal muscular atrophy,
Charcot-Marie Disease and Werdnig-Hoffmann Disease,
Postpoliomyelitis Syndrome, Muscular Dystrophy, Myasthenia Gravis,
Myotonia Atrophica, Myotonia Confenita, Nemaline Myopathy, Familial
Periodic Paralysis, Multiplex Paramyloclonus, Tropical Spastic
Paraparesis and Stiff-Man Syndrome, peripheral nervous system
diseases such as acrodynia, amyloid neuropathies, autonomic nervous
system diseases such as Adie's Syndrome, Barre-Lieou Syndrome,
Familial Dysautonomia, Horner's Syndrome, Reflex Sympathetic
Dystrophy and Shy-Drager Syndrome, Cranial Nerve Diseases such as
Acoustic Nerve Diseases such as Acoustic Neuroma which includes
Neurofibromatosis 2, Facial Nerve Diseases such as Facial
Neuralgia, Melkersson-Rosenthal Syndrome, ocular motility disorders
which includes amblyopia, nystagmus, oculomotor nerve paralysis,
ophthalmoplegia such as Duane's Syndrome, Horner's Syndrome,
Chronic Progressive External Ophthalmoplegia which includes Kearns
Syndrome, Strabismus such as Esotropia and Exotropia, Oculomotor
Nerve Paralysis, Optic Nerve Diseases such as Optic Atrophy which
includes Hereditary Optic Atrophy, Optic Disk Drusen, Optic
Neuritis such as Neuromyelitis Optica, Papilledema, Trigeminal
Neuralgia, Vocal Cord Paralysis, Demyelinating Diseases such as
Neuromyelitis Optica and Swayback, and Diabetic neuropathies such
as diabetic foot.
[0836] Additional neurologic diseases which can be treated or
detected with polynucleotides, polypeptides, agonists, and/or
antagonists of the present invention include nerve compression
syndromes such as carpal tunnel syndrome, tarsal tunnel syndrome,
thoracic outlet syndrome such as cervical rib syndrome, ulnar nerve
compression syndrome, neuralgia such as causalgia, cervico-brachial
neuralgia, facial neuralgia and trigeminal neuralgia, neuritis such
as experimental allergic neuritis, optic neuritis, polyneuritis,
polyradiculoneuritis and radiculities such as polyradiculitis,
hereditary motor and sensory neuropathies such as Charcot-Marie
Disease, Hereditary Optic Atrophy, Refsum's Disease, Hereditary
Spastic Paraplegia and Werdnig-Hoffmann Disease, Hereditary Sensory
and Autonomic Neuropathies which include Congenital Analgesia and
Familial Dysautonomia, POEMS Syndrome, Sciatica, Gustatory Sweating
and Tetany).
Endocrine Disorders
[0837] Polynucleotides or polypeptides, or agonists or antagonists
of the present invention, may be used to treat, prevent, diagnose,
and/or prognose disorders and/or diseases related to hormone
imbalance, and/or disorders or diseases of the endocrine
system.
[0838] Hormones secreted by the glands of the endocrine system
control physical growth, sexual function, metabolism, and other
functions. Disorders may be classified in two ways: disturbances in
the production of hormones, and the inability of tissues to respond
to hormones. The etiology of these hormone imbalance or endocrine
system diseases, disorders or conditions may be genetic, somatic,
such as cancer and some autoimmune diseases, acquired (e.g., by
chemotherapy, injury or toxins), or infectious. Moreover,
polynucleotides, polypeptides, antibodies, and/or agonists or
antagonists of the present invention can be used as a marker or
detector of a particular disease or disorder related to the
endocrine system and/or hormone imbalance.
[0839] Endocrine system and/or hormone imbalance and/or diseases
encompass disorders of uterine motility including, but not limited
to: complications with pregnancy and labor (e.g., pre-term labor,
post-term pregnancy, spontaneous abortion, and slow or stopped
labor); and disorders and/or diseases of the menstrual cycle (e.g.,
dysmenorrhea and endometriosis).
[0840] Endocrine system and/or hormone imbalance disorders and/or
diseases include disorders and/or diseases of the pancreas, such
as, for example, diabetes mellitus, diabetes insipidus, congenital
pancreatic agenesis, pheochromocytoma--islet cell tumor syndrome;
disorders and/or diseases of the adrenal glands such as, for
example, Addison's Disease, corticosteroid deficiency, virilizing
disease, hirsutism, Cushing's Syndrome, hyperaldosteronism,
pheochromocytoma; disorders and/or diseases of the pituitary gland,
such as, for example, hyperpituitarism, hypopituitarism, pituitary
dwarfism, pituitary adenoma, panhypopituitarism, acromegaly,
gigantism; disorders and/or diseases of the thyroid, including but
not limited to, hyperthyroidism, hypothyroidism, Plummer's disease,
Graves' disease (toxic diffuse goiter), toxic nodular goiter,
thyroiditis (Hashimoto's thyroiditis, subacute granulomatous
thyroiditis, and silent lymphocytic thyroiditis), Pendred's
syndrome, myxedema, cretinism, thyrotoxicosis, thyroid hormone
coupling defect, thymic aplasia, Hurthle cell tumours of the
thyroid, thyroid cancer, thyroid carcinoma, Medullary thyroid
carcinoma; disorders and/or diseases of the parathyroid, such as,
for example, hyperparathyroidism, hypoparathyroidism; disorders
and/or diseases of the hypothalamus.
[0841] In addition, endocrine system and/or hormone imbalance
disorders and/or diseases may also include disorders and/or
diseases of the testes or ovaries, including cancer. Other
disorders and/or diseases of the testes or ovaries further include,
for example, ovarian cancer, polycystic ovary syndrome,
Klinefelter's syndrome, vanishing testes syndrome (bilateral
anorchia), congenital absence of Leydig's cells, cryptorchidism,
Noonan's syndrome, myotonic dystrophy, capillary haemangioma of the
testis (benign), neoplasias of the testis and neo-testis.
[0842] Moreover, endocrine system and/or hormone imbalance
disorders and/or diseases may also include disorders and/or
diseases such as, for example, polyglandular deficiency syndromes,
pheochromocytoma, neuroblastoma, multiple Endocrine neoplasia, and
disorders and/or cancers of endocrine tissues.
[0843] In another embodiment, a polypeptide of the invention, or
polynucleotides, antibodies, agonists, or antagonists corresponding
to that polypeptide, may be used to diagnose, prognose, prevent,
and/or treat endocrine diseases and/or disorders associated with
the tissue(s) in which the polypeptide of the invention is
expressed, including one, two, three, four, five, or more tissues
disclosed in Table 1B.2, column 5 (Tissue Distribution Library
Code).
Reproductive System Disorders
[0844] The polynucleotides or polypeptides, or agonists or
antagonists of the invention may be used for the diagnosis,
treatment, or prevention of diseases and/or disorders of the
reproductive system. Reproductive system disorders that can be
treated by the compositions of the invention, include, but are not
limited to, reproductive system injuries, infections, neoplastic
disorders, congenital defects, and diseases or disorders which
result in infertility, complications with pregnancy, labor, or
parturition, and postpartum difficulties.
[0845] Reproductive system disorders and/or diseases include
diseases and/or disorders of the testes, including testicular
atrophy, testicular feminization, cryptorchism (unilateral and
bilateral), anorchia, ectopic testis, epididymitis and orchitis
(typically resulting from infections such as, for example,
gonorrhea, mumps, tuberculosis, and syphilis), testicular torsion,
vasitis nodosa, germ cell tumors (e.g., seminomas, embryonal cell
carcinomas, teratocarcinomas, choriocarcinomas, yolk sac tumors,
and teratomas), stromal tumors (e.g., Leydig cell tumors),
hydrocele, hematocele, varicocele, spermatocele, inguinal hernia,
and disorders of sperm production (e.g., immotile cilia syndrome,
aspermia, asthenozoospermia, azoospermia, oligospermia, and
teratozoospermia).
[0846] Reproductive system disorders also include disorders of the
prostate gland, such as acute non-bacterial prostatitis, chronic
non-bacterial prostatitis, acute bacterial prostatitis, chronic
bacterial prostatitis, prostatodystonia, prostatosis, granulomatous
prostatitis, malacoplakia, benign prostatic hypertrophy or
hyperplasia, and prostate neoplastic disorders, including
adenocarcinomas, transitional cell carcinomas, ductal carcinomas,
and squamous cell carcinomas.
[0847] Additionally, the compositions of the invention may be
useful in the diagnosis, treatment, and/or prevention of disorders
or diseases of the penis and urethra, including inflammatory
disorders, such as balanoposthitis, balanitis xerotica obliterans,
phimosis, paraphimosis, syphilis, herpes simplex virus, gonorrhea,
non-gonococcal urethritis, chlamydia, mycoplasma, trichomonas, HIV,
AIDS, Reiter's syndrome, condyloma acuminatum, condyloma latum, and
pearly penile papules; urethral abnormalities, such as hypospadias,
epispadias, and phimosis; premalignant lesions, including
Erythroplasia of Queyrat, Bowen's disease, Bowenoid paplosis, giant
condyloma of Buscke-Lowenstein, and varrucous carcinoma; penile
cancers, including squamous cell carcinomas, carcinoma in situ,
verrucous carcinoma, and disseminated penile carcinoma; urethral
neoplastic disorders, including penile urethral carcinoma,
bulbomembranous urethral carcinoma, and prostatic urethral
carcinoma; and erectile disorders, such as priapism, Peyronie's
disease, erectile dysfunction, and impotence.
[0848] Moreover, diseases and/or disorders of the vas deferens
include vasculititis and CBAVD (congenital bilateral absence of the
vas deferens); additionally, the polynucleotides, polypeptides, and
agonists or antagonists of the present invention may be used in the
diagnosis, treatment, and/or prevention of diseases and/or
disorders of the seminal vesicles, including hydatid disease,
congenital chloride diarrhea, and polycystic kidney disease.
[0849] Other disorders and/or diseases of the male reproductive
system include, for example, Klinefelter's syndrome, Young's
syndrome, premature ejaculation, diabetes mellitus, cystic
fibrosis, Kartagener's syndrome, high fever, multiple sclerosis,
and gynecomastia.
[0850] Further, the polynucleotides, polypeptides, and agonists or
antagonists of the present invention may be used in the diagnosis,
treatment, and/or prevention of diseases and/or disorders of the
vagina and vulva, including bacterial vaginosis, candida vaginitis,
herpes simplex virus, chancroid, granuloma inguinale,
lymphogranuloma venereum, scabies, human papillomavirus, vaginal
trauma, vulvar trauma, adenosis, chlamydia vaginitis, gonorrhea,
trichomonas vaginitis, condyloma acuminatum, syphilis, molluscum
contagiosum, atrophic vaginitis, Paget's disease, lichen sclerosus,
lichen planus, vulvodynia, toxic shock syndrome, vaginismus,
vulvovaginitis, vulvar vestibulitis, and neoplastic disorders, such
as squamous cell hyperplasia, clear cell carcinoma, basal cell
carcinoma, melanomas, cancer of Bartholin's gland, and vulvar
intraepithelial neoplasia.
[0851] Disorders and/or diseases of the uterus include
dysmenorrhea, retroverted uterus, endometriosis, fibroids,
adenomyosis, anovulatory bleeding, amenorrhea, Cushing's syndrome,
hydatidiform moles, Asherman's syndrome, premature menopause,
precocious puberty, uterine polyps, dysfunctional uterine bleeding
(e.g., due to aberrant hormonal signals), and neoplastic disorders,
such as adenocarcinomas, keiomyosarcomas, and sarcomas.
Additionally, the polypeptides, polynucleotides, or agonists or
antagonists of the invention may be useful as a marker or detector
of, as well as in the diagnosis, treatment, and/or prevention of
congenital uterine abnormalities, such as bicornuate uterus,
septate uterus, simple unicornuate uterus, unicornuate uterus with
a noncavitary rudimentary horn, unicornuate uterus with a
non-communicating cavitary rudimentary horn, unicornuate uterus
with a communicating cavitary horn, arcuate uterus, uterine
didelfus, and T-shaped uterus.
[0852] Ovarian diseases and/or disorders include anovulation,
polycystic ovary syndrome (Stein-Leventhal syndrome), ovarian
cysts, ovarian hypofunction, ovarian insensitivity to
gonadotropins, ovarian overproduction of androgens, right ovarian
vein syndrome, amenorrhea, hirutism, and ovarian cancer (including,
but not limited to, primary and secondary cancerous growth,
Sertoli-Leydig tumors, endometriod carcinoma of the ovary, ovarian
papillary serous adenocarcinoma, ovarian mucinous adenocarcinoma,
and Ovarian Krukenberg tumors).
[0853] Cervical diseases and/or disorders include cervicitis,
chronic cervicitis, mucopurulent cervicitis, cervical dysplasia,
cervical polyps, Nabothian cysts, cervical erosion, cervical
incompetence, and cervical neoplasms (including, for example,
cervical carcinoma, squamous metaplasia, squamous cell carcinoma,
adenosquamous cell neoplasia, and columnar cell neoplasia).
[0854] Additionally, diseases and/or disorders of the reproductive
system include disorders and/or diseases of pregnancy, including
miscarriage and stillbirth, such as early abortion, late abortion,
spontaneous abortion, induced abortion, therapeutic abortion,
threatened abortion, missed abortion, incomplete abortion, complete
abortion, habitual abortion, missed abortion, and septic abortion;
ectopic pregnancy, anemia, Rh incompatibility, vaginal bleeding
during pregnancy, gestational diabetes, intrauterine growth
retardation, polyhydramnios, HELLP syndrome, abruptio placentae,
placenta previa, hyperemesis, preeclampsia, eclampsia, herpes
gestationis, and urticaria of pregnancy. Additionally, the
polynucleotides, polypeptides, and agonists or antagonists of the
present invention may be used in the diagnosis, treatment, and/or
prevention of diseases that can complicate pregnancy, including
heart disease, heart failure, rheumatic heart disease, congenital
heart disease, mitral valve prolapse, high blood pressure, anemia,
kidney disease, infectious disease (e.g., rubella, cytomegalovirus,
toxoplasmosis, infectious hepatitis, chlamydia, HIV, AIDS, and
genital herpes), diabetes mellitus, Graves' disease, thyroiditis,
hypothyroidism, Hashimoto's thyroiditis, chronic active hepatitis,
cirrhosis of the liver, primary biliary cirrhosis, asthma, systemic
lupus eryematosis, rheumatoid arthritis, myasthenia gravis,
idiopathic thrombocytopenic purpura, appendicitis, ovarian cysts,
gallbladder disorders, and obstruction of the intestine.
[0855] Complications associated with labor and parturition include
premature rupture of the membranes, pre-term labor, post-term
pregnancy, postmaturity, labor that progresses too slowly, fetal
distress (e.g., abnormal heart rate (fetal or maternal), breathing
problems, and abnormal fetal position), shoulder dystocia,
prolapsed umbilical cord, amniotic fluid embolism, and aberrant
uterine bleeding.
[0856] Further, diseases and/or disorders of the postdelivery
period, including endometritis, myometritis, parametritis,
peritonitis, pelvic thrombophlebitis, pulmonary embolism,
endotoxemia, pyelonephritis, saphenous thrombophlebitis, mastitis,
cystitis, postpartum hemorrhage, and inverted uterus.
[0857] Other disorders and/or diseases of the female reproductive
system that may be diagnosed, treated, and/or prevented by the
polynucleotides, polypeptides, and agonists or antagonists of the
present invention include, for example, Turner's syndrome,
pseudohermaphroditism, premenstrual syndrome, pelvic inflammatory
disease, pelvic congestion (vascular engorgement), frigidity,
anorgasmia, dyspareunia, ruptured fallopian tube, and
Mittelschmerz.
Infectious Disease
[0858] Polynucleotides or polypeptides, as well as agonists or
antagonists of the present invention can be used to treat or detect
infectious agents. For example, by increasing the immune response,
particularly increasing the proliferation and differentiation of B
and/or T cells, infectious diseases may be treated. The immune
response may be increased by either enhancing an existing immune
response, or by initiating a new immune response. Alternatively,
polynucleotides or polypeptides, as well as agonists or antagonists
of the present invention may also directly inhibit the infectious
agent, without necessarily eliciting an immune response.
[0859] Viruses are one example of an infectious agent that can
cause disease or symptoms that can be treated or detected by a
polynucleotide or polypeptide and/or agonist or antagonist of the
present invention. Examples of viruses, include, but are not
limited to Examples of viruses, include, but are not limited to the
following DNA and RNA viruses and viral families: Arbovirus,
Adenoviridae, Arenaviridae, Arterivirus, Birnaviridae,
Bunyaviridae, Caliciviridae, Circoviridae, Coronaviridae, Dengue,
EBV, HIV, Flaviviridae, Hepadnaviridae (Hepatitis), Herpesviridae
(such as, Cytomegalovirus, Herpes Simplex, Herpes Zoster),
Mononegavirus (e.g., Paramyxoviridae, Morbillivirus,
Rhabdoviridae), Orthomyxoviridae (e.g., Influenza A, Influenza B,
and parainfluenza), Papiloma virus, Papovaviridae, Parvoviridae,
Picornaviridae, Poxyiridae (such as Smallpox or Vaccinia),
Reoviridae (e.g., Rotavirus), Retroviridae (HTLV-I, HTLV-II,
Lentivirus), and Togaviridae (e.g., Rubivirus). Viruses falling
within these families can cause a variety of diseases or symptoms,
including, but not limited to: arthritis, bronchiollitis,
respiratory syncytial virus, encephalitis, eye infections (e.g.,
conjunctivitis, keratitis), chronic fatigue syndrome, hepatitis (A,
B, C, E, Chronic Active, Delta), Japanese B encephalitis, Junin,
Chikungunya, Rift Valley fever, yellow fever, meningitis,
opportunistic infections (e.g., AIDS), pneumonia, Burkitt's
Lymphoma, chickenpox, hemorrhagic fever, Measles, Mumps,
Parainfluenza, Rabies, the common cold, Polio, leukemia, Rubella,
sexually transmitted diseases, skin diseases (e.g., Kaposi's,
warts), and viremia. polynucleotides or polypeptides, or agonists
or antagonists of the invention, can be used to treat or detect any
of these symptoms or diseases. In specific embodiments,
polynucleotides, polypeptides, or agonists or antagonists of the
invention are used to treat: meningitis, Dengue, EBV, and/or
hepatitis (e.g., hepatitis B). In an additional specific embodiment
polynucleotides, polypeptides, or agonists or antagonists of the
invention are used to treat patients nonresponsive to one or more
other commercially available hepatitis vaccines. In a further
specific embodiment polynucleotides, polypeptides, or agonists or
antagonists of the invention are used to treat AIDS.
[0860] Similarly, bacterial and fungal agents that can cause
disease or symptoms and that can be treated or detected by a
polynucleotide or polypeptide and/or agonist or antagonist of the
present invention include, but not limited to, the following
Gram-Negative and Gram-positive bacteria, bacterial families, and
fungi: Actinomyces (e.g., Norcardia), Acinetobacter, Cryptococcus
neoformans, Aspergillus, Bacillaceae (e.g., Bacillus anthrasis),
Bacteroides (e.g., Bacteroides fragilis), Blastomycosis,
Bordetella, Borrelia (e.g., Borrelia burgdorferi), Brucella,
Candidia, Campylobacter, Chlamydia, Clostridium (e.g., Clostridium
botulinum, Clostridium dificile, Clostridium perfringens,
Clostridium tetani), Coccidioides, Corynebacterium (e.g.,
Corynebacterium diptheriae), Cryptococcus, Dermatocycoses, E. coli
(e.g., Enterotoxigenic E. coli and Enterohemorrhagic E. coli),
Enterobacter (e.g. Enterobacter aerogenes), Enterobacteriaceae
(Klebsiella, Salmonella (e.g., Salmonella typhi, Salmonella
enteritidis, Salmonella typhi), Serratia, Yersinia, Shigella),
Erysipelothrix, Haemophilus (e.g., Haemophilus influenza type B),
Helicobacter, Legionella (e.g., Legionella pneumophila),
Leptospira, Listeria (e.g., Listeria monocytogenes), Mycoplasma,
Mycobacterium (e.g., Mycobacterium leprae and Mycobacterium
tuberculosis), Vibrio (e.g., Vibrio cholerae), Neisseriaceae (e.g.,
Neisseria gonorrhea, Neisseria meningitidis), Pasteurellacea,
Proteus, Pseudomonas (e.g., Pseudomonas aeruginosa),
Rickettsiaceae, Spirochetes (e.g., Treponema spp., Leptospira spp.,
Borrelia spp.), Shigella spp., Staphylococcus (e.g., Staphylococcus
aureus), Meningiococcus, Pneumococcus and Streptococcus (e.g.,
Streptococcus pneumoniae and Groups A, B, and C Streptococci), and
Ureaplasmas. These bacterial, parasitic, and fungal families can
cause diseases or symptoms, including, but not limited to:
antibiotic-resistant infections, bacteremia, endocarditis,
septicemia, eye infections (e.g., conjunctivitis), uveitis,
tuberculosis, gingivitis, bacterial diarrhea, opportunistic
infections (e.g., AIDS related infections), paronychia,
prosthesis-related infections, dental caries, Reiter's Disease,
respiratory tract infections, such as Whooping Cough or Empyema,
sepsis, Lyme Disease, Cat-Scratch Disease, dysentery, paratyphoid
fever, food poisoning, Legionella disease, chronic and acute
inflammation, erythema, yeast infections, typhoid, pneumonia,
gonorrhea, meningitis (e.g., mengitis types A and B), chlamydia,
syphillis, diphtheria, leprosy, brucellosis, peptic ulcers,
anthrax, spontaneous abortions, birth defects, pneumonia, lung
infections, ear infections, deafness, blindness, lethargy, malaise,
vomiting, chronic diarrhea, Crohn's disease, colitis, vaginosis,
sterility, pelvic inflammatory diseases, candidiasis,
paratuberculosis, tuberculosis, lupus, botulism, gangrene, tetanus,
impetigo, Rheumatic Fever, Scarlet Fever, sexually transmitted
diseases, skin diseases (e.g., cellulitis, dermatocycoses),
toxemia, urinary tract infections, wound infections, noscomial
infections. Polynucleotides or polypeptides, agonists or
antagonists of the invention, can be used to treat or detect any of
these symptoms or diseases. In specific embodiments,
polynucleotides, polypeptides, agonists or antagonists of the
invention are used to treat: tetanus, diptheria, botulism, and/or
meningitis type B.
[0861] Moreover, parasitic agents causing disease or symptoms that
can be treated, prevented, and/or diagnosed by a polynucleotide or
polypeptide and/or agonist or antagonist of the present invention
include, but not limited to, the following families or class:
Amebiasis, Babesiosis, Coccidiosis, Cryptosporidiosis,
Dientamoebiasis, Dourine, Ectoparasitic, Giardias, Helminthiasis,
Leishmaniasis, Schistisoma, Theileriasis, Toxoplasmosis,
Trypanosomiasis, and Trichomonas and Sporozoans (e.g., Plasmodium
virax, Plasmodium falciparium, Plasmodium malariae and Plasmodium
ovale). These parasites can cause a variety of diseases or
symptoms, including, but not limited to: Scabies, Trombiculiasis,
eye infections, intestinal disease (e.g., dysentery, giardiasis),
liver disease, lung disease, opportunistic infections (e.g., AIDS
related), malaria, pregnancy complications, and toxoplasmosis.
polynucleotides or polypeptides, or agonists or antagonists of the
invention, can be used to treat, prevent, and/or diagnose any of
these symptoms or diseases. In specific embodiments,
polynucleotides, polypeptides, or agonists or antagonists of the
invention are used to treat, prevent, and/or diagnose malaria.
[0862] Polynucleotides or polypeptides, as well as agonists or
antagonists of the present invention of the present invention could
either be by administering an effective amount of a polypeptide to
the patient, or by removing cells from the patient, supplying the
cells with a polynucleotide of the present invention, and returning
the engineered cells to the patient (ex vivo therapy). Moreover,
the polypeptide or polynucleotide of the present invention can be
used as an antigen in a vaccine to raise an immune response against
infectious disease.
Regeneration
[0863] Polynucleotides or polypeptides, as well as agonists or
antagonists of the present invention can be used to differentiate,
proliferate, and attract cells, leading to the regeneration of
tissues. (See, Science 276:59-87 (1997)). The regeneration of
tissues could be used to repair, replace, or protect tissue damaged
by congenital defects, trauma (wounds, burns, incisions, or
ulcers), age, disease (e.g. osteoporosis, osteocarthritis,
periodontal disease, liver failure), surgery, including cosmetic
plastic surgery, fibrosis, reperfusion injury, or systemic cytokine
damage.
[0864] Tissues that could be regenerated using the present
invention include organs (e.g., pancreas, liver, intestine, kidney,
skin, endothelium), muscle (smooth, skeletal or cardiac),
vasculature (including vascular and lymphatics), nervous,
hematopoietic, and skeletal (bone, cartilage, tendon, and ligament)
tissue. Preferably, regeneration occurs without or decreased
scarring. Regeneration also may include angiogenesis.
[0865] Moreover, polynucleotides or polypeptides, as well as
agonists or antagonists of the present invention, may increase
regeneration of tissues difficult to heal. For example, increased
tendon/ligament regeneration would quicken recovery time after
damage. Polynucleotides or polypeptides, as well as agonists or
antagonists of the present invention could also be used
prophylactically in an effort to avoid damage. Specific diseases
that could be treated include of tendinitis, carpal tunnel
syndrome, and other tendon or ligament defects. A further example
of tissue regeneration of non-healing wounds includes pressure
ulcers, ulcers associated with vascular insufficiency, surgical,
and traumatic wounds.
[0866] Similarly, nerve and brain tissue could also be regenerated
by using polynucleotides or polypeptides, as well as agonists or
antagonists of the present invention, to proliferate and
differentiate nerve cells. Diseases that could be treated using
this method include central and peripheral nervous system diseases,
neuropathies, or mechanical and traumatic disorders (e.g., spinal
cord disorders, head trauma, cerebrovascular disease, and stoke).
Specifically, diseases associated with peripheral nerve injuries,
peripheral neuropathy (e.g., resulting from chemotherapy or other
medical therapies), localized neuropathies, and central nervous
system diseases (e.g., Alzheimer's disease, Parkinson's disease,
Huntington's disease, amyotrophic lateral sclerosis, and Shy-Drager
syndrome), could all be treated using the polynucleotides or
polypeptides, as well as agonists or antagonists of the present
invention.
Gastrointestinal Disorders
[0867] Polynucleotides or polypeptides, or agonists or antagonists
of the present invention, may be used to treat, prevent, diagnose,
and/or prognose gastrointestinal disorders, including inflammatory
diseases and/or conditions, infections, cancers (e.g., intestinal
neoplasms (carcinoid tumor of the small intestine, non-Hodgkin's
lymphoma of the small intestine, small bowl lymphoma)), and ulcers,
such as peptic ulcers.
[0868] Gastrointestinal disorders include dysphagia, odynophagia,
inflammation of the esophagus, peptic esophagitis, gastric reflux,
submucosal fibrosis and stricturing, Mallory-Weiss lesions,
leiomyomas, lipomas, epidermal cancers, adeoncarcinomas, gastric
retention disorders, gastroenteritis, gastric atrophy,
gastric/stomach cancers, polyps of the stomach, autoimmune
disorders such as pernicious anemia, pyloric stenosis, gastritis
(bacterial, viral, eosinophilic, stress-induced, chronic erosive,
atrophic, plasma cell, and Menetrier's), and peritoneal diseases
(e.g., chyloperioneum, hemoperitoneum, mesenteric cyst, mesenteric
lymphadenitis, mesenteric vascular occlusion, panniculitis,
neoplasms, peritonitis, pneumoperitoneum, bubphrenic abscess,).
[0869] Gastrointestinal disorders also include disorders associated
with the small intestine, such as malabsorption syndromes,
distension, irritable bowel syndrome, sugar intolerance, celiac
disease, duodenal ulcers, duodenitis, tropical sprue, Whipple's
disease, intestinal lymphangiectasia, Crohn's disease,
appendicitis, obstructions of the ileum, Meckel's diverticulum,
multiple diverticula, failure of complete rotation of the small and
large intestine, lymphoma, and bacterial and parasitic diseases
(such as Traveler's diarrhea, typhoid and paratyphoid, cholera,
infection by Roundworms (Ascariasis lumbricoides), Hookworms
(Ancylostoma duodenale), Threadworms (Enterobius vermicularis),
Tapeworms (Taenia saginata, Echinococcus granulosus,
Diphyllobothrium spp., and T. solium).
[0870] Liver diseases and/or disorders include intrahepatic
cholestasis (alagille syndrome, biliary liver cirrhosis), fatty
liver (alcoholic fatty liver, reye syndrome), hepatic vein
thrombosis, hepatolentricular degeneration, hepatomegaly,
hepatopulmonary syndrome, hepatorenal syndrome, portal hypertension
(esophageal and gastric varices), liver abscess (amebic liver
abscess), liver cirrhosis (alcoholic, biliary and experimental),
alcoholic liver diseases (fatty liver, hepatitis, cirrhosis),
parasitic (hepatic echinococcosis, fascioliasis, amebic liver
abscess), jaundice (hemolytic, hepatocellular, and cholestatic),
cholestasis, portal hypertension, liver enlargement, ascites,
hepatitis (alcoholic hepatitis, animal hepatitis, chronic hepatitis
(autoimmune, hepatitis B, hepatitis C, hepatitis D, drug induced),
toxic hepatitis, viral human hepatitis (hepatitis A, hepatitis B,
hepatitis C, hepatitis D, hepatitis E), Wilson's disease,
granulomatous hepatitis, secondary biliary cirrhosis, hepatic
encephalopathy, portal hypertension, varices, hepatic
encephalopathy, primary biliary cirrhosis, primary sclerosing
cholangitis, hepatocellular adenoma, hemangiomas, bile stones,
liver failure (hepatic encephalopathy, acute liver failure), and
liver neoplasms (angiomyolipoma, calcified liver metastases, cystic
liver metastases, epithelial tumors, fibrolamellar hepatocarcinoma,
focal nodular hyperplasia, hepatic adenoma, hepatobiliary
cystadenoma, hepatoblastoma, hepatocellular carcinoma, hepatoma,
liver cancer, liver hemangioendothelioma, mesenchymal hamartoma,
mesenchymal tumors of liver, nodular regenerative hyperplasia,
benign liver tumors (Hepatic cysts [Simple cysts, Polycystic liver
disease, Hepatobiliary cystadenoma, Choledochal cyst], Mesenchymal
tumors [Mesenchymal hamartoma, Infantile hemangioendothelioma,
Hemangioma, Peliosis hepatis, Lipomas, Inflammatory pseudotumor,
Miscellaneous], Epithelial tumors [Bile duct epithelium (Bile duct
hamartoma, Bile duct adenoma), Hepatocyte (Adenoma, Focal nodular
hyperplasia, Nodular regenerative hyperplasia)], malignant liver
tumors [hepatocellular, hepatoblastoma, hepatocellular carcinoma,
cholangiocellular, cholangiocarcinoma, cystadenocarcinoma, tumors
of blood vessels, angiosarcoma, Karposi's sarcoma,
hemangioendothelioma, other tumors, embryonal sarcoma,
fibrosarcoma, leiomyosarcoma, rhabdomyosarcoma, carcinosarcoma,
teratoma, carcinoid, squamous carcinoma, primary lymphoma]),
peliosis hepatis, erythrohepatic porphyria, hepatic porphyria
(acute intermittent porphyria, porphyria cutanea tarda), Zellweger
syndrome).
[0871] Pancreatic diseases and/or disorders include acute
pancreatitis, chronic pancreatitis (acute necrotizing pancreatitis,
alcoholic pancreatitis), neoplasms (adenocarcinoma of the pancreas,
cystadenocarcinoma, insulinoma, gastrinoma, and glucagonoma, cystic
neoplasms, islet-cell tumors, pancreoblastoma), and other
pancreatic diseases (e.g., cystic fibrosis, cyst (pancreatic
pseudocyst, pancreatic fistula, insufficiency)).
[0872] Gallbladder diseases include gallstones (cholelithiasis and
choledocholithiasis), postcholecystectomy syndrome, diverticulosis
of the gallbladder, acute cholecystitis, chronic cholecystitis,
bile duct tumors, and mucocele.
[0873] Diseases and/or disorders of the large intestine include
antibiotic-associated colitis, diverticulitis, ulcerative colitis,
acquired megacolon, abscesses, fungal and bacterial infections,
anorectal disorders (e.g., fissures, hemorrhoids), colonic diseases
(colitis, colonic neoplasms [colon cancer, adenomatous colon polyps
(e.g., villous adenoma), colon carcinoma, colorectal cancer],
colonic diverticulitis, colonic diverticulosis, megacolon
[Hirschsprung disease, toxic megacolon]; sigmoid diseases
[proctocolitis, sigmoin neoplasms]), constipation, Crohn's disease,
diarrhea (infantile diarrhea, dysentery), duodenal diseases
(duodenal neoplasms, duodenal obstruction, duodenal ulcer,
duodenitis), enteritis (enterocolitis), HIV enteropathy, ileal
diseases (ileal neoplasms, ileitis), immunoproliferative small
intestinal disease, inflammatory bowel disease (ulcerative colitis,
Crohn's disease), intestinal atresia, parasitic diseases
(anisakiasis, balantidiasis, blastocystis infections,
cryptosporidiosis, dientamoebiasis, amebic dysentery, giardiasis),
intestinal fistula (rectal fistula), intestinal neoplasms (cecal
neoplasms, colonic neoplasms, duodenal neoplasms, ileal neoplasms,
intestinal polyps, jejunal neoplasms, rectal neoplasms), intestinal
obstruction (afferent loop syndrome, duodenal obstruction, impacted
feces, intestinal pseudo-obstruction [cecal volvulus],
intussusception), intestinal perforation, intestinal polyps
(colonic polyps, gardner syndrome, peutz-jeghers syndrome), jejunal
diseases (jejunal neoplasms), malabsorption syndromes (blind loop
syndrome, celiac disease, lactose intolerance, short bowl syndrome,
tropical sprue, whipple's disease), mesenteric vascular occlusion,
pneumatosis cystoides intestinalis, protein-losing enteropathies
(intestinal lymphagiectasis), rectal diseases (anus diseases, fecal
incontinence, hemorrhoids, proctitis, rectal fistula, rectal
prolapse, rectocele), peptic ulcer (duodenal ulcer, peptic
esophagitis, hemorrhage, perforation, stomach ulcer,
Zollinger-Ellison syndrome), postgastrectomy syndromes (dumping
syndrome), stomach diseases (e.g., achlorhydria, duodenogastric
reflux (bile reflux), gastric antral vascular ectasia, gastric
fistula, gastric outlet obstruction, gastritis (atrophic or
hypertrophic), gastroparesis, stomach dilatation, stomach
diverticulum, stomach neoplasms (gastric cancer, gastric polyps,
gastric adenocarcinoma, hyperplastic gastric polyp), stomach
rupture, stomach ulcer, stomach volvulus), tuberculosis,
visceroptosis, vomiting (e.g., hematemesis, hyperemesis gravidarum,
postoperative nausea and vomiting) and hemorrhagic colitis.
[0874] Further diseases and/or disorders of the gastrointestinal
system include biliary tract diseases, such as, gastroschisis,
fistula (e.g., biliary fistula, esophageal fistula, gastric
fistula, intestinal fistula, pancreatic fistula), neoplasms (e.g.,
biliary tract neoplasms, esophageal neoplasms, such as
adenocarcinoma of the esophagus, esophageal squamous cell
carcinoma, gastrointestinal neoplasms, pancreatic neoplasms, such
as adenocarcinoma of the pancreas, mucinous cystic neoplasm of the
pancreas, pancreatic cystic neoplasms, pancreatoblastoma, and
peritoneal neoplasms), esophageal disease (e.g., bullous diseases,
candidiasis, glycogenic acanthosis, ulceration, barrett esophagus
varices, atresia, cyst, diverticulum (e.g., Zenker's diverticulum),
fistula (e.g., tracheoesophageal fistula), motility disorders
(e.g., CREST syndrome, deglutition disorders, achalasia, spasm,
gastroesophageal reflux), neoplasms, perforation (e.g., Boerhaave
syndrome, Mallory-Weiss syndrome), stenosis, esophagitis,
diaphragmatic hernia (e.g., hiatal hernia); gastrointestinal
diseases, such as, gastroenteritis (e.g., cholera morbus, norwalk
virus infection), hemorrhage (e.g., hematemesis, melena, peptic
ulcer hemorrhage), stomach neoplasms (gastric cancer, gastric
polyps, gastric adenocarcinoma, stomach cancer)), hernia (e.g.,
congenital diaphragmatic hernia, femoral hernia, inguinal hernia,
obturator hernia, umbilical hernia, ventral hernia), and intestinal
diseases (e.g., cecal diseases (appendicitis, cecal
neoplasms)).
Chemotaxis
[0875] Polynucleotides or polypeptides, as well as agonists or
antagonists of the present invention may have chemotaxis activity.
A chemotaxic molecule attracts or mobilizes cells (e.g., monocytes,
fibroblasts, neutrophils, T-cells, mast cells, eosinophils,
epithelial and/or endothelial cells) to a particular site in the
body, such as inflammation, infection, or site of
hyperproliferation. The mobilized cells can then fight off and/or
heal the particular trauma or abnormality.
[0876] Polynucleotides or polypeptides, as well as agonists or
antagonists of the present invention may increase chemotaxic
activity of particular cells. These chemotactic molecules can then
be used to treat inflammation, infection, hyperproliferative
disorders, or any immune system disorder by increasing the number
of cells targeted to a particular location in the body. For
example, chemotaxic molecules can be used to treat wounds and other
trauma to tissues by attracting immune cells to the injured
location. Chemotactic molecules of the present invention can also
attract fibroblasts, which can be used to treat wounds.
[0877] It is also contemplated that polynucleotides or
polypeptides, as well as agonists or antagonists of the present
invention may inhibit chemotactic activity. These molecules could
also be used to treat disorders. Thus, polynucleotides or
polypeptides, as well as agonists or antagonists of the present
invention could be used as an inhibitor of chemotaxis.
Binding Activity
[0878] A polypeptide of the present invention may be used to screen
for molecules that bind to the polypeptide or for molecules to
which the polypeptide binds. The binding of the polypeptide and the
molecule may activate (agonist), increase, inhibit (antagonist), or
decrease activity of the polypeptide or the molecule bound.
Examples of such molecules include antibodies, oligonucleotides,
proteins (e.g., receptors), or small molecules.
[0879] Preferably, the molecule is closely related to the natural
ligand of the polypeptide, e.g., a fragment of the ligand, or a
natural substrate, a ligand, a structural or functional mimetic.
(See, Coligan et al., Current Protocols in Immunology 1(2):Chapter
5 (1991)). Similarly, the molecule can be closely related to the
natural receptor to which the polypeptide binds, or at least, a
fragment of the receptor capable of being bound by the polypeptide
(e.g., active site). In either case, the molecule can be rationally
designed using known techniques.
[0880] Preferably, the screening for these molecules involves
producing appropriate cells which express the polypeptide.
Preferred cells include cells from mammals, yeast, Drosophila, or
E. coli. Cells expressing the polypeptide (or cell membrane
containing the expressed polypeptide) are then preferably contacted
with a test compound potentially containing the molecule to observe
binding, stimulation, or inhibition of activity of either the
polypeptide or the molecule.
[0881] The assay may simply test binding of a candidate compound to
the polypeptide, wherein binding is detected by a label, or in an
assay involving competition with a labeled competitor. Further, the
assay may test whether the candidate compound results in a signal
generated by binding to the polypeptide.
[0882] Alternatively, the assay can be carried out using cell-free
preparations, polypeptide/molecule affixed to a solid support,
chemical libraries, or natural product mixtures. The assay may also
simply comprise the steps of mixing a candidate compound with a
solution containing a polypeptide, measuring polypeptide/molecule
activity or binding, and comparing the polypeptide/molecule
activity or binding to a standard.
[0883] Preferably, an ELISA assay can measure polypeptide level or
activity in a sample (e.g., biological sample) using a monoclonal
or polyclonal antibody. The antibody can measure polypeptide level
or activity by either binding, directly or indirectly, to the
polypeptide or by competing with the polypeptide for a
substrate.
[0884] Additionally, the receptor to which the polypeptide of the
present invention binds can be identified by numerous methods known
to those of skill in the art, for example, ligand panning and FACS
sorting (Coligan, et al., Current Protocols in Immun., 1(2),
Chapter 5, (1991)). For example, expression cloning is employed
wherein polyadenylated RNA is prepared from a cell responsive to
the polypeptides, for example, NIH3T3 cells which are known to
contain multiple receptors for the FGF family proteins, and SC-3
cells, and a cDNA library created from this RNA is divided into
pools and used to transfect COS cells or other cells that are not
responsive to the polypeptides. Transfected cells which are grown
on glass slides are exposed to the polypeptide of the present
invention, after they have been labeled. The polypeptides can be
labeled by a variety of means including iodination or inclusion of
a recognition site for a site-specific protein kinase.
[0885] Following fixation and incubation, the slides are subjected
to auto-radiographic analysis. Positive pools are identified and
sub-pools are prepared and re-transfected using an iterative
sub-pooling and re-screening process, eventually yielding a single
clones that encodes the putative receptor.
[0886] As an alternative approach for receptor identification, the
labeled polypeptides can be photoaffinity linked with cell membrane
or extract preparations that express the receptor molecule.
Cross-linked material is resolved by PAGE analysis and exposed to
X-ray film. The labeled complex containing the receptors of the
polypeptides can be excised, resolved into peptide fragments, and
subjected to protein microsequencing. The amino acid sequence
obtained from microsequencing would be used to design a set of
degenerate oligonucleotide probes to screen a cDNA library to
identify the genes encoding the putative receptors.
[0887] Moreover, the techniques of gene-shuffling, motif-shuffling,
exon-shuffling, and/or codon-shuffling (collectively referred to as
"DNA shuffling") may be employed to modulate the activities of the
polypeptide of the present invention thereby effectively generating
agonists and antagonists of the polypeptide of the present
invention. See generally, U.S. Pat. Nos. 5,605,793, 5,811,238,
5,830,721, 5,834,252, and 5,837,458, and Patten, P. A., et al.,
Curr. Opinion Biotechnol. 8:724-33 (1997); Harayama, S. Trends
Biotechnol. 16(2):76-82 (1998); Hansson, L. O., et al., J. Mol.
Biol. 287:265-76 (1999); and Lorenzo, M. M. and Blasco, R.
Biotechniques 24(2):308-13 (1998); each of these patents and
publications are hereby incorporated by reference). In one
embodiment, alteration of polynucleotides and corresponding
polypeptides may be achieved by DNA shuffling. DNA shuffling
involves the assembly of two or more DNA segments into a desired
molecule by homologous, or site-specific, recombination. In another
embodiment, polynucleotides and corresponding polypeptides may be
altered by being subjected to random mutagenesis by error-prone
PCR, random nucleotide insertion or other methods prior to
recombination. In another embodiment, one or more components,
motifs, sections, parts, domains, fragments, etc., of the
polypeptide of the present invention may be recombined with one or
more components, motifs, sections, parts, domains, fragments, etc.
of one or more heterologous molecules. In preferred embodiments,
the heterologous molecules are family members. In further preferred
embodiments, the heterologous molecule is a growth factor such as,
for example, platelet-derived growth factor (PDGF), insulin-like
growth factor (IGF-I), transforming growth factor (TGF)-alpha,
epidermal growth factor (EGF), fibroblast growth factor (FGF),
TGF-beta, bone morphogenetic protein (BMP)-2, BMP-4, BMP-5, BMP-6,
BMP-7, activins A and B, decapentaplegic (dpp), 60A, OP-2,
dorsalin, growth differentiation factors (GDFs), nodal, MIS,
inhibin-alpha, TGF-beta1, TGF-beta2, TGF-beta3, TGF-beta5, and
glial-derived neurotrophic factor (GDNF).
[0888] Other preferred fragments are biologically active fragments
of the polypeptide of the present invention. Biologically active
fragments are those exhibiting activity similar, but not
necessarily identical, to an activity of the polypeptide of the
present invention. The biological activity of the fragments may
include an improved desired activity, or a decreased undesirable
activity.
[0889] Additionally, this invention provides a method of screening
compounds to identify those which modulate the action of the
polypeptide of the present invention. An example of such an assay
comprises combining a mammalian fibroblast cell, a the polypeptide
of the present invention, the compound to be screened and .sup.3[H]
thymidine under cell culture conditions where the fibroblast cell
would normally proliferate. A control assay may be performed in the
absence of the compound to be screened and compared to the amount
of fibroblast proliferation in the presence of the compound to
determine if the compound stimulates proliferation by determining
the uptake of .sup.3[H] thymidine in each case. The amount of
fibroblast cell proliferation is measured by liquid scintillation
chromatography which measures the incorporation of .sup.3[H]
thymidine. Both agonist and antagonist compounds may be identified
by this procedure.
[0890] In another method, a mammalian cell or membrane preparation
expressing a receptor for a polypeptide of the present invention is
incubated with a labeled polypeptide of the present invention in
the presence of the compound. The ability of the compound to
enhance or block this interaction could then be measured.
Alternatively, the response of a known second messenger system
following interaction of a compound to be screened and the receptor
is measured and the ability of the compound to bind to the receptor
and elicit a second messenger response is measured to determine if
the compound is a potential agonist or antagonist. Such second
messenger systems include but are not limited to, cAMP guanylate
cyclase, ion channels or phosphoinositide hydrolysis.
[0891] All of these above assays can be used as diagnostic or
prognostic markers. The molecules discovered using these assays can
be used to treat disease or to bring about a particular result in a
patient (e.g., blood vessel growth) by activating or inhibiting the
polypeptide/molecule. Moreover, the assays can discover agents
which may inhibit or enhance the production of the polypeptides of
the invention from suitably manipulated cells or tissues.
[0892] Therefore, the invention includes a method of identifying
compounds which bind to a polypeptide of the invention comprising
the steps of: (a) incubating a candidate binding compound with a
polypeptide of the present invention; and (b) determining if
binding has occurred. Moreover, the invention includes a method of
identifying agonists/antagonists comprising the steps of: (a)
incubating a candidate compound with a polypeptide of the present
invention, (b) assaying a biological activity, and (b) determining
if a biological activity of the polypeptide has been altered.
Targeted Delivery
[0893] In another embodiment, the invention provides a method of
delivering compositions to targeted cells expressing a receptor for
a polypeptide of the invention, or cells expressing a cell bound
form of a polypeptide of the invention.
[0894] As discussed herein, polypeptides or antibodies of the
invention may be associated with heterologous polypeptides,
heterologous nucleic acids, toxins, or prodrugs via hydrophobic,
hydrophilic, ionic and/or covalent interactions. In one embodiment,
the invention provides a method for the specific delivery of
compositions of the invention to cells by administering
polypeptides of the invention (including antibodies) that are
associated with heterologous polypeptides or nucleic acids. In one
example, the invention provides a method for delivering a
therapeutic protein into the targeted cell. In another example, the
invention provides a method for delivering a single stranded
nucleic acid (e.g., antisense or ribozymes) or double stranded
nucleic acid (e.g., DNA that can integrate into the cell's genome
or replicate episomally and that can be transcribed) into the
targeted cell.
[0895] In another embodiment, the invention provides a method for
the specific destruction of cells (e.g., the destruction of tumor
cells) by administering polypeptides of the invention (e.g.,
polypeptides of the invention or antibodies of the invention) in
association with toxins or cytotoxic prodrugs.
[0896] By "toxin" is meant compounds that bind and activate
endogenous cytotoxic effector systems, radioisotopes, holotoxins,
modified toxins, catalytic subunits of toxins, or any molecules or
enzymes not normally present in or on the surface of a cell that
under defined conditions cause the cell's death. Toxins that may be
used according to the methods of the invention include, but are not
limited to, radioisotopes known in the art, compounds such as, for
example, antibodies (or complement fixing containing portions
thereof) that bind an inherent or induced endogenous cytotoxic
effector system, thymidine kinase, endonuclease, RNAse, alpha
toxin, ricin, abrin, Pseudomonas exotoxin A, diphtheria toxin,
saporin, momordin, gelonin, pokeweed antiviral protein,
alpha-sarcin and cholera toxin. By "cytotoxic prodrug" is meant a
non-toxic compound that is converted by an enzyme, normally present
in the cell, into a cytotoxic compound. Cytotoxic prodrugs that may
be used according to the methods of the invention include, but are
not limited to, glutamyl derivatives of benzoic acid mustard
alkylating agent, phosphate derivatives of etoposide or mitomycin
C, cytosine arabinoside, daunorubisin, and phenoxyacetamide
derivatives of doxorubicin.
Drug Screening
[0897] Further contemplated is the use of the polypeptides of the
present invention, or the polynucleotides encoding these
polypeptides, to screen for molecules which modify the activities
of the polypeptides of the present invention. Such a method would
include contacting the polypeptide of the present invention with a
selected compound(s) suspected of having antagonist or agonist
activity, and assaying the activity of these polypeptides following
binding.
[0898] This invention is particularly useful for screening
therapeutic compounds by using the polypeptides of the present
invention, or binding fragments thereof, in any of a variety of
drug screening techniques. The polypeptide or fragment employed in
such a test may be affixed to a solid support, expressed on a cell
surface, free in solution, or located intracellularly. One method
of drug screening utilizes eukaryotic or prokaryotic host cells
which are stably transformed with recombinant nucleic acids
expressing the polypeptide or fragment. Drugs are screened against
such transformed cells in competitive binding assays. One may
measure, for example, the formulation of complexes between the
agent being tested and a polypeptide of the present invention.
[0899] Thus, the present invention provides methods of screening
for drugs or any other agents which affect activities mediated by
the polypeptides of the present invention. These methods comprise
contacting such an agent with a polypeptide of the present
invention or a fragment thereof and assaying for the presence of a
complex between the agent and the polypeptide or a fragment
thereof, by methods well known in the art. In such a competitive
binding assay, the agents to screen are typically labeled.
Following incubation, free agent is separated from that present in
bound form, and the amount of free or uncomplexed label is a
measure of the ability of a particular agent to bind to the
polypeptides of the present invention.
[0900] Another technique for drug screening provides high
throughput screening for compounds having suitable binding affinity
to the polypeptides of the present invention, and is described in
great detail in European Patent Application 84/03564, published on
Sep. 13, 1984, which is incorporated herein by reference herein.
Briefly stated, large numbers of different small peptide test
compounds are synthesized on a solid substrate, such as plastic
pins or some other surface. The peptide test compounds are reacted
with polypeptides of the present invention and washed. Bound
polypeptides are then detected by methods well known in the art.
Purified polypeptides are coated directly onto plates for use in
the aforementioned drug screening techniques. In addition,
non-neutralizing antibodies may be used to capture the peptide and
immobilize it on the solid support.
[0901] This invention also contemplates the use of competitive drug
screening assays in which neutralizing antibodies capable of
binding polypeptides of the present invention specifically compete
with a test compound for binding to the polypeptides or fragments
thereof. In this manner, the antibodies are used to detect the
presence of any peptide which shares one or more antigenic epitopes
with a polypeptide of the invention.
Antisense And Ribozyme (Antagonists)
[0902] In specific embodiments, antagonists according to the
present invention are nucleic acids corresponding to the sequences
contained in SEQ ID NO:X, or the complementary strand thereof,
and/or to cDNA sequences contained in cDNA ATCC Deposit No: Z
identified for example, in Table 1A and/or 1B. In one embodiment,
antisense sequence is generated internally, by the organism, in
another embodiment, the antisense sequence is separately
administered (see, for example, O'Connor, J., Neurochem. 56:560
(1991). Oligodeoxynucleotides as Antisense Inhibitors of Gene
Expression, CRC Press, Boca Raton, Fla. (1988). Antisense
technology can be used to control gene expression through antisense
DNA or RNA, or through triple-helix formation. Antisense techniques
are discussed for example, in Okano, J., Neurochem. 56:560 (1991);
Oligodeoxynucleotides as Antisense Inhibitors of Gene Expression,
CRC Press, Boca Raton, Fla. (1988). Triple helix formation is
discussed in, for instance, Lee et al., Nucleic Acids Research
6:3073 (1979); Cooney et al., Science 241:456 (1988); and Dervan et
al., Science 251:1300 (1991). The methods are based on binding of a
polynucleotide to a complementary DNA or RNA.
[0903] For example, the use of c-myc and c-myb antisense RNA
constructs to inhibit the growth of the non-lymphocytic leukemia
cell line HL-60 and other cell lines was previously described.
(Wickstrom et al. (1988); Anfossi et al. (1989)). These experiments
were performed in vitro by incubating cells with the
oligoribonucleotide. A similar procedure for in vivo use is
described in WO 91/15580. Briefly, a pair of oligonucleotides for a
given antisense RNA is produced as follows: A sequence
complimentary to the first 15 bases of the open reading frame is
flanked by an EcoRI site on the 5 end and a HindIII site on the 3
end. Next, the pair of oligonucleotides is heated at 90.degree. C.
for one minute and then annealed in 2.times. ligation buffer (20 mM
TRIS HCl pH 7.5, 10 mM MgCl2, 10MM dithiothreitol (DTT) and 0.2 mM
ATP) and then ligated to the EcoRI/Hind III site of the retroviral
vector PMV7 (WO 91/15580).
[0904] For example, the 5' coding portion of a polynucleotide that
encodes the polypeptide of the present invention may be used to
design an antisense RNA oligonucleotide of from about 10 to 40 base
pairs in length. A DNA oligonucleotide is designed to be
complementary to a region of the gene involved in transcription
thereby preventing transcription and the production of the
receptor. The antisense RNA oligonucleotide hybridizes to the mRNA
in vivo and blocks translation of the mRNA molecule into receptor
polypeptide.
[0905] In one embodiment, the antisense nucleic acid of the
invention is produced intracellularly by transcription from an
exogenous sequence. For example, a vector or a portion thereof, is
transcribed, producing an antisense nucleic acid (RNA) of the
invention. Such a vector would contain a sequence encoding the
antisense nucleic acid. Such a vector can remain episomal or become
chromosomally integrated, as long as it can be transcribed to
produce the desired antisense RNA. Such vectors can be constructed
by recombinant DNA technology methods standard in the art. Vectors
can be plasmid, viral, or others known in the art, used for
replication and expression in vertebrate cells. Expression of the
sequence encoding the polypeptide of the present invention or
fragments thereof, can be by any promoter known in the art to act
in vertebrate, preferably human cells. Such promoters can be
inducible or constitutive. Such promoters include, but are not
limited to, the SV40 early promoter region (Bernoist and Chambon,
Nature 29:304-310 (1981), the promoter contained in the 3' long
terminal repeat of Rous sarcoma virus (Yamamoto et al., Cell
22:787-797 (1980), the herpes thymidine promoter (Wagner et al.,
Proc. Natl. Acad. Sci. U.S.A. 78:1441-1445 (1981), the regulatory
sequences of the metallothionein gene (Brinster, et al., Nature
296:39-42 (1982)), etc.
[0906] The antisense nucleic acids of the invention comprise a
sequence complementary to at least a portion of an RNA transcript
of a gene of the present invention. However, absolute
complementarity, although preferred, is not required. A sequence
"complementary to at least a portion of an RNA," referred to
herein, means a sequence having sufficient complementarity to be
able to hybridize with the RNA, forming a stable duplex; in the
case of double stranded antisense nucleic acids, a single strand of
the duplex DNA may thus be tested, or triplex formation may be
assayed. The ability to hybridize will depend on both the degree of
complementarity and the length of the antisense nucleic acid.
Generally, the larger the hybridizing nucleic acid, the more base
mismatches with a RNA it may contain and still form a stable duplex
(or triplex as the case may be). One skilled in the art can
ascertain a tolerable degree of mismatch by use of standard
procedures to determine the melting point of the hybridized
complex.
[0907] Oligonucleotides that are complementary to the 5' end of the
message, e.g., the 5' untranslated sequence up to and including the
AUG initiation codon, should work most efficiently at inhibiting
translation. However, sequences complementary to the 3'
untranslated sequences of mRNAs have been shown to be effective at
inhibiting translation of mRNAs as well. See generally, Wagner, R.,
1994, Nature 372:333-335. Thus, oligonucleotides complementary to
either the 5'- or 3'-non-translated, non-coding regions of
polynucleotide sequences described herein could be used in an
antisense approach to inhibit translation of endogenous mRNA.
Oligonucleotides complementary to the 5' untranslated region of the
mRNA should include the complement of the AUG start codon.
Antisense oligonucleotides complementary to mRNA coding regions are
less efficient inhibitors of translation but could be used in
accordance with the invention. Whether designed to hybridize to the
5'-, 3'- or coding region of mRNA of the present invention,
antisense nucleic acids should be at least six nucleotides in
length, and are preferably oligonucleotides ranging from 6 to about
50 nucleotides in length. In specific aspects the oligonucleotide
is at least 10 nucleotides, at least 17 nucleotides, at least 25
nucleotides or at least 50 nucleotides.
[0908] The polynucleotides of the invention can be DNA or RNA or
chimeric mixtures or derivatives or modified versions thereof,
single-stranded or double-stranded. The oligonucleotide can be
modified at the base moiety, sugar moiety, or phosphate backbone,
for example, to improve stability of the molecule, hybridization,
etc. The oligonucleotide may include other appended groups such as
peptides (e.g., for targeting host cell receptors in vivo), or
agents facilitating transport across the cell membrane (see, e.g.,
Letsinger et al., 1989, Proc. Natl. Acad. Sci. U.S.A. 86:6553-6556;
Lemaitre et al., 1987, Proc. Natl. Acad. Sci. 84:648-652; PCT
Publication No. WO88/09810, published Dec. 15, 1988) or the
blood-brain barrier (see, e.g., PCT Publication No. WO89/10134,
published Apr. 25, 1988), hybridization-triggered cleavage agents.
(See, e.g., Krol et al., 1988, BioTechniques 6:958-976) or
intercalating agents. (See, e.g., Zon, 1988, Pharm. Res.
5:539-549). To this end, the oligonucleotide may be conjugated to
another molecule, e.g., a peptide, hybridization triggered
cross-linking agent, transport agent, hybridization-triggered
cleavage agent, etc.
[0909] The antisense oligonucleotide may comprise at least one
modified base moiety which is selected from the group including,
but not limited to, 5-fluorouracil, 5-bromouracil, 5-chlorouracil,
5-iodouracil, hypoxanthine, xantine, 4-acetylcytosine,
5-(carboxyhydroxylmethyl) uracil,
5-carboxymethylaminomethyl-2-thiouridine,
5-carboxymethylaminomethyluracil, dihydrouracil,
beta-D-galactosylqueosine, inosine, N6-isopentenyladenine,
1-methylguanine, 1-methylinosine, 2,2-dimethylguanine,
2-methyladenine, 2-methylguanine, 3-methylcytosine,
5-methylcytosine, N6-adenine, 7-methylguanine,
5-methylaminomethyluracil, 5-methoxyaminomethyl-2-thiouracil,
beta-D-mannosylqueosine, 5'-methoxycarboxymethyluracil,
5-methoxyuracil, 2-methylthio-N-6-isopentenyladenine,
uracil-5-oxyacetic acid (v), wybutoxosine, pseudouracil, queosine,
2-thiocytosine, 5-methyl-2-thiouracil, 2-thiouracil, 4-thiouracil,
5-methyluracil, uracil-5-oxyacetic acid methylester,
uracil-5-oxyacetic acid (v), 5-methyl-2-thiouracil,
3-(3-amino-3-N-2-carboxypropyl) uracil, (acp3)w, and
2,6-diaminopurine.
[0910] The antisense oligonucleotide may also comprise at least one
modified sugar moiety selected from the group including, but not
limited to, arabinose, 2-fluoroarabinose, xylulose, and hexose.
[0911] In yet another embodiment, the antisense oligonucleotide
comprises at least one modified phosphate backbone selected from
the group including, but not limited to, a phosphorothioate, a
phosphorodithioate, a phosphoramidothioate, a phosphoramidate, a
phosphordiamidate, a methylphosphonate, an alkyl phosphotriester,
and a formacetal or analog thereof.
[0912] In yet another embodiment, the antisense oligonucleotide is
an a-anomeric oligonucleotide. An a-anomeric oligonucleotide forms
specific double-stranded hybrids with complementary RNA in which,
contrary to the usual b-units, the strands run parallel to each
other (Gautier et al., 1987, Nucl. Acids Res. 15:6625-6641). The
oligonucleotide is a 2'-O-methylribonucleotide (Inoue et al., 1987,
Nucl. Acids Res. 15:6131-6148), or a chimeric RNA-DNA analogue
(Inoue et al., 1987, FEBS Lett. 215:327-330).
[0913] Polynucleotides of the invention may be synthesized by
standard methods known in the art, e.g. by use of an automated DNA
synthesizer (such as are commercially available from Biosearch,
Applied Biosystems, etc.). As examples, phosphorothioate
oligonucleotides may be synthesized by the method of Stein et al.
(1988, Nucl. Acids Res. 16:3209), methylphosphonate
oligonucleotides can be prepared by use of controlled pore glass
polymer supports (Sarin et al., 1988, Proc. Natl. Acad. Sci. U.S.A.
85:7448-7451), etc.
[0914] While antisense nucleotides complementary to the coding
region sequence could be used, those complementary to the
transcribed untranslated region are most preferred.
[0915] Potential antagonists according to the invention also
include catalytic RNA, or a ribozyme (See, e.g., PCT International
Publication WO 90/11364, published Oct. 4, 1990; Sarver et al,
Science 247:1222-1225 (1990). While ribozymes that cleave mRNA at
site specific recognition sequences can be used to destroy mRNAs,
the use of hammerhead ribozymes is preferred. Hammerhead ribozymes
cleave mRNAs at locations dictated by flanking regions that form
complementary base pairs with the target mRNA. The sole requirement
is that the target mRNA have the following sequence of two bases:
5'-UG-3'. The construction and production of hammerhead ribozymes
is well known in the art and is described more fully in Haseloff
and Gerlach, Nature 334:585-591 (1988). There are numerous
potential hammerhead ribozyme cleavage sites within the nucleotide
sequence of SEQ ID NO:X. Preferably, the ribozyme is engineered so
that the cleavage recognition site is located near the 5' end of
the mRNA; i.e., to increase efficiency and minimize the
intracellular accumulation of non-functional mRNA transcripts.
[0916] As in the antisense approach, the ribozymes of the invention
can be composed of modified oligonucleotides (e.g., for improved
stability, targeting, etc.) and should be delivered to cells which
express in vivo. DNA constructs encoding the ribozyme may be
introduced into the cell in the same manner as described above for
the introduction of antisense encoding DNA. A preferred method of
delivery involves using a DNA construct "encoding" the ribozyme
under the control of a strong constitutive promoter, such as, for
example, pol III or pol II promoter, so that transfected cells will
produce sufficient quantities of the ribozyme to destroy endogenous
messages and inhibit translation. Since ribozymes unlike antisense
molecules, are catalytic, a lower intracellular concentration is
required for efficiency.
[0917] Antagonist/agonist compounds may be employed to inhibit the
cell growth and proliferation effects of the polypeptides of the
present invention on neoplastic cells and tissues, i.e. stimulation
of angiogenesis of tumors, and, therefore, retard or prevent
abnormal cellular growth and proliferation, for example, in tumor
formation or growth.
[0918] The antagonist/agonist may also be employed to prevent
hyper-vascular diseases, and prevent the proliferation of
epithelial lens cells after extracapsular cataract surgery.
Prevention of the mitogenic activity of the polypeptides of the
present invention may also be desirous in cases such as restenosis
after balloon angioplasty.
[0919] The antagonist/agonist may also be employed to prevent the
growth of scar tissue during wound healing.
[0920] The antagonist/agonist may also be employed to treat the
diseases described herein.
[0921] Thus, the invention provides a method of treating disorders
or diseases, including but not limited to the disorders or diseases
listed throughout this application, associated with overexpression
of a polynucleotide of the present invention by administering to a
patient (a) an antisense molecule directed to the polynucleotide of
the present invention, and/or (b) a ribozyme directed to the
polynucleotide of the present invention.
Binding Peptides and Other Molecules
[0922] The invention also encompasses screening methods for
identifying polypeptides and nonpolypeptides that bind polypeptides
of the invention, and the binding molecules identified thereby.
These binding molecules are useful, for example, as agonists and
antagonists of the polypeptides of the invention. Such agonists and
antagonists can be used, in accordance with the invention, in the
therapeutic embodiments described in detail, below.
[0923] This method comprises the steps of: [0924] a. contacting
polypeptides of the invention with a plurality of molecules; and
[0925] b. identifying a molecule that binds the polypeptides of the
invention.
[0926] The step of contacting the polypeptides of the invention
with the plurality of molecules may be effected in a number of
ways. For example, one may contemplate immobilizing the
polypeptides on a solid support and bringing a solution of the
plurality of molecules in contact with the immobilized
polypeptides. Such a procedure would be akin to an affinity
chromatographic process, with the affinity matrix being comprised
of the immobilized polypeptides of the invention. The molecules
having a selective affinity for the polypeptides can then be
purified by affinity selection. The nature of the solid support,
process for attachment of the polypeptides to the solid support,
solvent, and conditions of the affinity isolation or selection are
largely conventional and well known to those of ordinary skill in
the art.
[0927] Alternatively, one may also separate a plurality of
polypeptides into substantially separate fractions comprising a
subset of or individual polypeptides. For instance, one can
separate the plurality of polypeptides by gel electrophoresis,
column chromatography, or like method known to those of ordinary
skill for the separation of polypeptides. The individual
polypeptides can also be produced by a transformed host cell in
such a way as to be expressed on or about its outer surface (e.g.,
a recombinant phage). Individual isolates can then be "probed" by
the polypeptides of the invention, optionally in the presence of an
inducer should one be required for expression, to determine if any
selective affinity interaction takes place between the polypeptides
and the individual clone. Prior to contacting the polypeptides with
each fraction comprising individual polypeptides, the polypeptides
could first be transferred to a solid support for additional
convenience. Such a solid support may simply be a piece of filter
membrane, such as one made of nitrocellulose or nylon. In this
manner, positive clones could be identified from a collection of
transformed host cells of an expression library, which harbor a DNA
construct encoding a polypeptide having a selective affinity for
polypeptides of the invention. Furthermore, the amino acid sequence
of the polypeptide having a selective affinity for the polypeptides
of the invention can be determined directly by conventional means
or the coding sequence of the DNA encoding the polypeptide can
frequently be determined more conveniently. The primary sequence
can then be deduced from the corresponding DNA sequence. If the
amino acid sequence is to be determined from the polypeptide
itself, one may use microsequencing techniques. The sequencing
technique may include mass spectroscopy.
[0928] In certain situations, it may be desirable to wash away any
unbound polypeptides from a mixture of the polypeptides of the
invention and the plurality of polypeptides prior to attempting to
determine or to detect the presence of a selective affinity
interaction. Such a wash step may be particularly desirable when
the polypeptides of the invention or the plurality of polypeptides
are bound to a solid support.
[0929] The plurality of molecules provided according to this method
may be provided by way of diversity libraries, such as random or
combinatorial peptide or nonpeptide libraries which can be screened
for molecules that specifically bind polypeptides of the invention.
Many libraries are known in the art that can be used, e.g.,
chemically synthesized libraries, recombinant (e.g., phage display
libraries), and in vitro translation-based libraries. Examples of
chemically synthesized libraries are described in Fodor et al.,
1991, Science 251:767-773; Houghten et al., 1991, Nature 354:84-86;
Lam et al., 1991, Nature 354:82-84; Medynski, 1994, Bio/Technology
12:709-710; Gallop et al., 1994, J. Medicinal Chemistry
37(9):1233-1251; Ohlmeyer et al., 1993, Proc. Natl. Acad. Sci. USA
90:10922-10926; Erb et al., 1994, Proc. Natl. Acad. Sci. USA
91:11422-11426; Houghten et al., 1992, Biotechniques 13:412;
Jayawickreme et al., 1994, Proc. Natl. Acad. Sci. USA 91:1614-1618;
Salmon et al., 1993, Proc. Natl. Acad. Sci. USA 90:11708-11712; PCT
Publication No. WO 93/20242; and Brenner and Lerner, 1992, Proc.
Natl. Acad. Sci. USA 89:5381-5383.
[0930] Examples of phage display libraries are described in Scott
and Smith, 1990, Science 249:386-390; Devlin et al., 1990, Science,
249:404-406; Christian, R. B., et al., 1992, J. Mol. Biol.
227:711-718); Lenstra, 1992, J. Immunol. Meth. 152:149-157; Kay et
al., 1993, Gene 128:59-65; and PCT Publication No. WO 94/18318
dated Aug. 18, 1994.
[0931] In vitro translation-based libraries include but are not
limited to those described in PCT Publication No. WO 91/05058 dated
Apr. 18, 1991; and Mattheakis et al., 1994, Proc. Natl. Acad. Sci.
USA 91:9022-9026.
[0932] By way of examples of nonpeptide libraries, a benzodiazepine
library (see e.g., Bunin et al., 1994, Proc. Natl. Acad. Sci. USA
91:4708-4712) can be adapted for use. Peptoid libraries (Simon et
al., 1992, Proc. Natl. Acad. Sci. USA 89:9367-9371) can also be
used. Another example of a library that can be used, in which the
amide functionalities in peptides have been permethylated to
generate a chemically transformed combinatorial library, is
described by Ostresh et al. (1994, Proc. Natl. Acad. Sci. USA
91:11138-11142).
[0933] The variety of non-peptide libraries that are useful in the
present invention is great. For example, Ecker and Crooke, 1995,
Bio/Technology 13:351-360 list benzodiazepines, hydantoins,
piperazinediones, biphenyls, sugar analogs, beta-mercaptoketones,
arylacetic acids, acylpiperidines, benzopyrans, cubanes, xanthines,
aminimides, and oxazolones as among the chemical species that form
the basis of various libraries.
[0934] Non-peptide libraries can be classified broadly into two
types: decorated monomers and oligomers. Decorated monomer
libraries employ a relatively simple scaffold structure upon which
a variety functional groups is added. Often the scaffold will be a
molecule with a known useful pharmacological activity. For example,
the scaffold might be the benzodiazepine structure.
[0935] Non-peptide oligomer libraries utilize a large number of
monomers that are assembled together in ways that create new shapes
that depend on the order of the monomers. Among the monomer units
that have been used are carbamates, pyrrolinones, and morpholinos.
Peptoids, peptide-like oligomers in which the side chain is
attached to the alpha amino group rather than the alpha carbon,
form the basis of another version of non-peptide oligomer
libraries. The first non-peptide oligomer libraries utilized a
single type of monomer and thus contained a repeating backbone.
Recent libraries have utilized more than one monomer, giving the
libraries added flexibility.
[0936] Screening the libraries can be accomplished by any of a
variety of commonly known methods. See, e.g., the following
references, which disclose screening of peptide libraries: Parmley
and Smith, 1989, Adv. Exp. Med. Biol. 251:215-218; Scott and Smith,
1990, Science 249:386-390; Fowlkes et al., 1992; BioTechniques
13:422-427; Oldenburg et al., 1992, Proc. Natl. Acad. Sci. USA
89:5393-5397; Yu et al., 1994, Cell 76:933-945; Staudt et al.,
1988, Science 241:577-580; Bock et al., 1992, Nature 355:564-566;
Tuerk et al., 1992, Proc. Natl. Acad. Sci. USA 89:6988-6992;
Ellington et al., 1992, Nature 355:850-852; U.S. Pat. No.
5,096,815, U.S. Pat. No. 5,223,409, and U.S. Pat. No. 5,198,346,
all to Ladner et al.; Rebar and Pabo, 1993, Science 263:671-673;
and CT Publication No. WO 94/18318.
[0937] In a specific embodiment, screening to identify a molecule
that binds polypeptides of the invention can be carried out by
contacting the library members with polypeptides of the invention
immobilized on a solid phase and harvesting those library members
that bind to the polypeptides of the invention. Examples of such
screening methods, termed "panning" techniques are described by way
of example in Parmley and Smith, 1988, Gene 73:305-318; Fowlkes et
al., 1992, BioTechniques 13:422-427; PCT Publication No. WO
94/18318; and in references cited herein.
[0938] In another embodiment, the two-hybrid system for selecting
interacting proteins in yeast (Fields and Song, 1989, Nature
340:245-246; Chien et al., 1991, Proc. Natl. Acad. Sci. USA
88:9578-9582) can be used to identify molecules that specifically
bind to polypeptides of the invention.
[0939] Where the binding molecule is a polypeptide, the polypeptide
can be conveniently selected from any peptide library, including
random peptide libraries, combinatorial peptide libraries, or
biased peptide libraries. The term "biased" is used herein to mean
that the method of generating the library is manipulated so as to
restrict one or more parameters that govern the diversity of the
resulting collection of molecules, in this case peptides.
[0940] Thus, a truly random peptide library would generate a
collection of peptides in which the probability of finding a
particular amino acid at a given position of the peptide is the
same for all 20 amino acids. A bias can be introduced into the
library, however, by specifying, for example, that a lysine occur
every fifth amino acid or that positions 4, 8, and 9 of a
decapeptide library be fixed to include only arginine. Clearly,
many types of biases can be contemplated, and the present invention
is not restricted to any particular bias. Furthermore, the present
invention contemplates specific types of peptide libraries, such as
phage displayed peptide libraries and those that utilize a DNA
construct comprising a lambda phage vector with a DNA insert.
[0941] As mentioned above, in the case of a binding molecule that
is a polypeptide, the polypeptide may have about 6 to less than
about 60 amino acid residues, preferably about 6 to about 10 amino
acid residues, and most preferably, about 6 to about 22 amino
acids. In another embodiment, a binding polypeptide has in the
range of 15-100 amino acids, or 20-50 amino acids.
[0942] The selected binding polypeptide can be obtained by chemical
synthesis or recombinant expression.
Other Activities
[0943] A polypeptide, polynucleotide, agonist, or antagonist of the
present invention, as a result of the ability to stimulate vascular
endothelial cell growth, may be employed in treatment for
stimulating re-vascularization of ischemic tissues due to various
disease conditions such as thrombosis, arteriosclerosis, and other
cardiovascular conditions. The polypeptide, polynucleotide,
agonist, or antagonist of the present invention may also be
employed to stimulate angiogenesis and limb regeneration, as
discussed above.
[0944] A polypeptide, polynucleotide, agonist, or antagonist of the
present invention may also be employed for treating wounds due to
injuries, burns, post-operative tissue repair, and ulcers since
they are mitogenic to various cells of different origins, such as
fibroblast cells and skeletal muscle cells, and therefore,
facilitate the repair or replacement of damaged or diseased
tissue.
[0945] A polypeptide, polynucleotide, agonist, or antagonist of the
present invention may also be employed stimulate neuronal growth
and to treat and prevent neuronal damage which occurs in certain
neuronal disorders or neuro-degenerative conditions such as
Alzheimer's disease, Parkinson's disease, and AIDS-related complex.
A polypeptide, polynucleotide, agonist, or antagonist of the
present invention may have the ability to stimulate chondrocyte
growth, therefore, they may be employed to enhance bone and
periodontal regeneration and aid in tissue transplants or bone
grafts.
[0946] A polypeptide, polynucleotide, agonist, or antagonist of the
present invention may be also be employed to prevent skin aging due
to sunburn by stimulating keratinocyte growth.
[0947] A polypeptide, polynucleotide, agonist, or antagonist of the
present invention may also be employed for preventing hair loss,
since FGF family members activate hair-forming cells and promotes
melanocyte growth. Along the same lines, a polypeptide,
polynucleotide, agonist, or antagonist of the present invention may
be employed to stimulate growth and differentiation of
hematopoietic cells and bone marrow cells when used in combination
with other cytokines.
[0948] A polypeptide, polynucleotide, agonist, or antagonist of the
present invention may also be employed to maintain organs before
transplantation or for supporting cell culture of primary tissues.
A polypeptide, polynucleotide, agonist, or antagonist of the
present invention may also be employed for inducing tissue of
mesodermal origin to differentiate in early embryos.
[0949] A polypeptide, polynucleotide, agonist, or antagonist of the
present invention may also increase or decrease the differentiation
or proliferation of embryonic stem cells, besides, as discussed
above, hematopoietic lineage.
[0950] A polypeptide, polynucleotide, agonist, or antagonist of the
present invention may also be used to modulate mammalian
characteristics, such as body height, weight, hair color, eye
color, skin, percentage of adipose tissue, pigmentation, size, and
shape (e.g., cosmetic surgery). Similarly, a polypeptide,
polynucleotide, agonist, or antagonist of the present invention may
be used to modulate mammalian metabolism affecting catabolism,
anabolism, processing, utilization, and storage of energy.
[0951] A polypeptide, polynucleotide, agonist, or antagonist of the
present invention may be used to change a mammal's mental state or
physical state by influencing biorhythms, caricadic rhythms,
depression (including depressive disorders), tendency for violence,
tolerance for pain, reproductive capabilities (preferably by
Activin or Inhibin-like activity), hormonal or endocrine levels,
appetite, libido, memory, stress, or other cognitive qualities.
[0952] A polypeptide, polynucleotide, agonist, or antagonist of the
present invention may also be used as a food additive or
preservative, such as to increase or decrease storage capabilities,
fat content, lipid, protein, carbohydrate, vitamins, minerals,
cofactors or other nutritional components.
[0953] The above-recited applications have uses in a wide variety
of hosts. Such hosts include, but are not limited to, human,
murine, rabbit, goat, guinea pig, camel, horse, mouse, rat,
hamster, pig, micro-pig, chicken, goat, cow, sheep, dog, cat,
non-human primate, and human. In specific embodiments, the host is
a mouse, rabbit, goat, guinea pig, chicken, rat, hamster, pig,
sheep, dog or cat. In preferred embodiments, the host is a mammal.
In most preferred embodiments, the host is a human.
Other Preferred Embodiments
[0954] Other preferred embodiments of the claimed invention include
an isolated nucleic acid molecule comprising a nucleotide sequence
which is at least 95% identical to a sequence of at least about 50
contiguous nucleotides in the nucleotide sequence of SEQ ID NO:X or
the complementary strand thereto, the nucleotide sequence as
defined in column 5 of Table 1B.1 or columns 8 and 9 of Table 2 or
the complementary strand thereto, and/or cDNA contained in ATCC
Deposit No: Z.
[0955] Also preferred is a nucleic acid molecule wherein said
sequence of contiguous nucleotides is included in the nucleotide
sequence of the portion of SEQ ID NO:X as defined in column 5, "ORF
(From-To)", in Table 1B.1.
[0956] Also preferred is a nucleic acid molecule wherein said
sequence of contiguous nucleotides is included in the nucleotide
sequence of the portion of SEQ ID NO:X as defined in columns 8 and
9, "NT From" and "NT To" respectively, in Table 2.
[0957] Also preferred is an isolated nucleic acid molecule
comprising a nucleotide sequence which is at least 95% identical to
a sequence of at least about 150 contiguous nucleotides in the
nucleotide sequence of SEQ ID NO:X or the complementary strand
thereto, the nucleotide sequence as defined in column 5 of Table
1B.1 or columns 8 and 9 of Table 2 or the complementary strand
thereto, and/or cDNA contained in ATCC Deposit No: Z.
[0958] Further preferred is an isolated nucleic acid molecule
comprising a nucleotide sequence which is at least 95% identical to
a sequence of at least about 500 contiguous nucleotides in the
nucleotide sequence of SEQ ID NO:X or the complementary strand
thereto, the nucleotide sequence as defined in column 5 of Table
1B.1 or columns 8 and 9 of Table 2 or the complementary strand
thereto, and/or cDNA contained in ATCC Deposit No: Z.
[0959] A further preferred embodiment is a nucleic acid molecule
comprising a nucleotide sequence which is at least 95% identical to
the nucleotide sequence of the portion of SEQ ID NO:X defined in
column 5, "ORF (From-To)", in Table 1B.1.
[0960] A further preferred embodiment is a nucleic acid molecule
comprising a nucleotide sequence which is at least 95% identical to
the nucleotide sequence of the portion of SEQ ID NO:X defined in
columns 8 and 9, "NT From" and "NT To", respectively, in Table
2.
[0961] A further preferred embodiment is an isolated nucleic acid
molecule comprising a nucleotide sequence which is at least 95%
identical to the complete nucleotide sequence of SEQ ID NO:X or the
complementary strand thereto, the nucleotide sequence as defined in
column 5 of Table 1B.1 or columns 8 and 9 of Table 2 or the
complementary strand thereto, and/or cDNA contained in ATCC Deposit
No: Z.
[0962] Also preferred is an isolated nucleic acid molecule which
hybridizes under stringent hybridization conditions to a nucleic
acid molecule comprising a nucleotide sequence of SEQ ID NO:X or
the complementary strand thereto, the nucleotide sequence as
defined in column 5 of Table 1B.1 or columns 8 and 9 of Table 2 or
the complementary strand thereto, and/or cDNA contained in ATCC
Deposit No: Z, wherein said nucleic acid molecule which hybridizes
does not hybridize under stringent hybridization conditions to a
nucleic acid molecule having a nucleotide sequence consisting of
only A residues or of only T residues.
[0963] Also preferred is a composition of matter comprising a DNA
molecule which comprises the cDNA contained in ATCC Deposit No:
Z.
[0964] Also preferred is an isolated nucleic acid molecule
comprising a nucleotide sequence which is at least 95% identical to
a sequence of at least 50 contiguous nucleotides of the cDNA
sequence contained in ATCC Deposit No: Z.
[0965] Also preferred is an isolated nucleic acid molecule, wherein
said sequence of at least 50 contiguous nucleotides is included in
the nucleotide sequence of an open reading frame sequence encoded
by cDNA contained in ATCC Deposit No: Z.
[0966] Also preferred is an isolated nucleic acid molecule
comprising a nucleotide sequence which is at least 95% identical to
sequence of at least 150 contiguous nucleotides in the nucleotide
sequence encoded by cDNA contained in ATCC Deposit No: Z.
[0967] A further preferred embodiment is an isolated nucleic acid
molecule comprising a nucleotide sequence which is at least 95%
identical to sequence of at least 500 contiguous nucleotides in the
nucleotide sequence encoded by cDNA contained in ATCC Deposit No:
Z.
[0968] A further preferred embodiment is an isolated nucleic acid
molecule comprising a nucleotide sequence which is at least 95%
identical to the complete nucleotide sequence encoded by cDNA
contained in ATCC Deposit No: Z.
[0969] A further preferred embodiment is a method for detecting in
a biological sample a nucleic acid molecule comprising a nucleotide
sequence which is at least 95% identical to a sequence of at least
50 contiguous nucleotides in a sequence selected from the group
consisting of: a nucleotide sequence of SEQ ID NO:X or the
complementary strand thereto; the nucleotide sequence as defined in
column 5 of Table 1B. 1 or columns 8 and 9 of Table 2 or the
complementary strand thereto; and a nucleotide sequence encoded by
cDNA contained in ATCC Deposit No: Z; which method comprises a step
of comparing a nucleotide sequence of at least one nucleic acid
molecule in said sample with a sequence selected from said group
and determining whether the sequence of said nucleic acid molecule
in said sample is at least 95% identical to said selected
sequence.
[0970] Also preferred is the above method wherein said step of
comparing sequences comprises determining the extent of nucleic
acid hybridization between nucleic acid molecules in said sample
and a nucleic acid molecule comprising said sequence selected from
said group. Similarly, also preferred is the above method wherein
said step of comparing sequences is performed by comparing the
nucleotide sequence determined from a nucleic acid molecule in said
sample with said sequence selected from said group. The nucleic
acid molecules can comprise DNA molecules or RNA molecules.
[0971] A further preferred embodiment is a method for identifying
the species, tissue or cell type of a biological sample which
method comprises a step of detecting nucleic acid molecules in said
sample, if any, comprising a nucleotide sequence that is at least
95% identical to a sequence of at least 50 contiguous nucleotides
in a sequence selected from the group consisting of: a nucleotide
sequence of SEQ ID NO:X or the complementary strand thereto; the
nucleotide sequence as defined in column 5 of Table 1B.1 or columns
8 and 9 of Table 2 or the complementary strand thereto; and a
nucleotide sequence of the cDNA contained in ATCC Deposit No:
Z.
[0972] The method for identifying the species, tissue or cell type
of a biological sample can comprise a step of detecting nucleic
acid molecules comprising a nucleotide sequence in a panel of at
least two nucleotide sequences, wherein at least one sequence in
said panel is at least 95% identical to a sequence of at least 50
contiguous nucleotides in a sequence selected from said group.
[0973] Also preferred is a method for diagnosing in a subject a
pathological condition associated with abnormal structure or
expression of a nucleotide sequence of SEQ ID NO:X or the
complementary strand thereto; the nucleotide sequence as defined in
column 5 of Table 1B.1 or columns 8 and 9 of Table 2 or the
complementary strand thereto; or the cDNA contained in ATCC Deposit
No: Z which encodes a protein, wherein the method comprises a step
of detecting in a biological sample obtained from said subject
nucleic acid molecules, if any, comprising a nucleotide sequence
that is at least 95% identical to a sequence of at least 50
contiguous nucleotides in a sequence selected from the group
consisting of: a nucleotide sequence of SEQ ID NO:X or the
complementary strand thereto; the nucleotide sequence as defined in
column 5 of Table 1B. 1 or columns 8 and 9 of Table 2 or the
complementary strand thereto; and a nucleotide sequence of cDNA
contained in ATCC Deposit No: Z.
[0974] The method for diagnosing a pathological condition can
comprise a step of detecting nucleic acid molecules comprising a
nucleotide sequence in a panel of at least two nucleotide
sequences, wherein at least one sequence in said panel is at least
95% identical to a sequence of at least 50 contiguous nucleotides
in a sequence selected from said group.
[0975] Also preferred is a composition of matter comprising
isolated nucleic acid molecules wherein the nucleotide sequences of
said nucleic acid molecules comprise a panel of at least two
nucleotide sequences, wherein at least one sequence in said panel
is at least 95% identical to a sequence of at least 50 contiguous
nucleotides in a sequence selected from the group consisting of: a
nucleotide sequence of SEQ ID NO:X or the complementary strand
thereto; the nucleotide sequence as defined in column 5 of Table
1B.1 or columns 8 and 9 of Table 2 or the complementary strand
thereto; and a nucleotide sequence encoded by cDNA contained in
ATCC Deposit No: Z. The nucleic acid molecules can comprise DNA
molecules or RNA molecules.
[0976] Also preferred is a composition of matter comprising
isolated nucleic acid molecules wherein the nucleotide sequences of
said nucleic acid molecules comprise a DNA microarray or "chip" of
at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 40, 50,
100, 150, 200, 250, 300, 500, 1000, 2000, 3000, or 4000 nucleotide
sequences, wherein at least one sequence in said DNA microarray or
"chip" is at least 95% identical to a sequence of at least 50
contiguous nucleotides in a sequence selected from the group
consisting of: a nucleotide sequence of SEQ ID NO:X wherein X is
any integer as defined in Table 1A and/or 1B; and a nucleotide
sequence encoded by a human cDNA clone identified by a cDNA "Clone
ID" in Table 1A and/or 1B.
[0977] Also preferred is an isolated polypeptide comprising an
amino acid sequence at least 90% identical to a sequence of at
least about 10 contiguous amino acids in the polypeptide sequence
of SEQ ID NO:Y; a polypeptide encoded by SEQ ID NO:X or the
complementary strand thereto; the polypeptide encoded by the
nucleotide sequence as defined in columns 8 and 9 of Table 2;
and/or a polypeptide encoded by cDNA contained in ATCC Deposit No:
Z.
[0978] Also preferred is an isolated polypeptide comprising an
amino acid sequence at least 95% identical to a sequence of at
least about 30 contiguous amino acids in the amino acid sequence of
SEQ ID NO:Y; a polypeptide encoded by SEQ ID NO:X or the
complementary strand thereto; the polypeptide encoded by the
nucleotide sequence as defined in columns 8 and 9 of Table 2;
and/or a polypeptide encoded by cDNA contained in ATCC Deposit No:
Z.
[0979] Further preferred is an isolated polypeptide comprising an
amino acid sequence at least 95% identical to a sequence of at
least about 100 contiguous amino acids in the amino acid sequence
of SEQ ID NO:Y; a polypeptide encoded by SEQ ID NO:X or the
complementary strand thereto; the polypeptide encoded by the
nucleotide sequence as defined in columns 8 and 9 of Table 2;
and/or a polypeptide encoded by cDNA contained in ATCC Deposit No:
Z.
[0980] Further preferred is an isolated polypeptide comprising an
amino acid sequence at least 95% identical to the complete amino
acid sequence of SEQ ID NO:Y; a polypeptide encoded by SEQ ID NO:X
or the complementary strand thereto; the polypeptide encoded by the
nucleotide sequence as defined in columns 8 and 9 of Table 2;
and/or a polypeptide encoded by cDNA contained in ATCC Deposit No:
Z.
[0981] Further preferred is an isolated polypeptide comprising an
amino acid sequence at least 90% identical to a sequence of at
least about 10 contiguous amino acids in the complete amino acid
sequence of a polypeptide encoded by contained in ATCC Deposit No:
Z
[0982] Also preferred is a polypeptide wherein said sequence of
contiguous amino acids is included in the amino acid sequence of a
portion of said polypeptide encoded by cDNA contained in ATCC
Deposit No: Z; a polypeptide encoded by SEQ ID NO:X or the
complementary strand thereto; the polypeptide encoded by the
nucleotide sequence as defined in columns 8 and 9 of Table 2;
and/or the polypeptide sequence of SEQ ID NO:Y.
[0983] Also preferred is an isolated polypeptide comprising an
amino acid sequence at least 95% identical to a sequence of at
least about 30 contiguous amino acids in the amino acid sequence of
a polypeptide encoded by the cDNA contained in ATCC Deposit No:
Z.
[0984] Also preferred is an isolated polypeptide comprising an
amino acid sequence at least 95% identical to a sequence of at
least about 100 contiguous amino acids in the amino acid sequence
of a polypeptide encoded by cDNA contained in ATCC Deposit No:
Z.
[0985] Also preferred is an isolated polypeptide comprising an
amino acid sequence at least 95% identical to the amino acid
sequence of a polypeptide encoded by the cDNA contained in ATCC
Deposit No: Z.
[0986] Further preferred is an isolated antibody which binds
specifically to a polypeptide comprising an amino acid sequence
that is at least 90% identical to a sequence of at least 10
contiguous amino acids in a sequence selected from the group
consisting of: a polypeptide sequence of SEQ ID NO:Y; a polypeptide
encoded by SEQ ID NO:X or the complementary strand thereto; the
polypeptide encoded by the nucleotide sequence as defined in
columns 8 and 9 of Table 2; and a polypeptide encoded by the cDNA
contained in ATCC Deposit No: Z.
[0987] Further preferred is a method for detecting in a biological
sample a polypeptide comprising an amino acid sequence which is at
least 90% identical to a sequence of at least 10 contiguous amino
acids in a sequence selected from the group consisting of: a
polypeptide sequence of SEQ ID NO:Y; a polypeptide encoded by SEQ
ID NO:X or the complementary strand thereto; the polypeptide
encoded by the nucleotide sequence as defined in columns 8 and 9 of
Table 2; and a polypeptide encoded by the cDNA contained in ATCC
Deposit No: Z; which method comprises a step of comparing an amino
acid sequence of at least one polypeptide molecule in said sample
with a sequence selected from said group and determining whether
the sequence of said polypeptide molecule in said sample is at
least 90% identical to said sequence of at least 10 contiguous
amino acids.
[0988] Also preferred is the above method wherein said step of
comparing an amino acid sequence of at least one polypeptide
molecule in said sample with a sequence selected from said group
comprises determining the extent of specific binding of
polypeptides in said sample to an antibody which binds specifically
to a polypeptide comprising an amino acid sequence that is at least
90% identical to a sequence of at least 10 contiguous amino acids
in a sequence selected from the group consisting of: a polypeptide
sequence of SEQ ID NO:Y; a polypeptide encoded by SEQ ID NO:X or
the complementary strand thereto; the polypeptide encoded by the
nucleotide sequence as defined in columns 8 and 9 of Table 2; and a
polypeptide encoded by the cDNA contained in ATCC Deposit No:
Z.
[0989] Also preferred is the above method wherein said step of
comparing sequences is performed by comparing the amino acid
sequence determined from a polypeptide molecule in said sample with
said sequence selected from said group.
[0990] Also preferred is a method for identifying the species,
tissue or cell type of a biological sample which method comprises a
step of detecting polypeptide molecules in said sample, if any,
comprising an amino acid sequence that is at least 90% identical to
a sequence of at least 10 contiguous amino acids in a sequence
selected from the group consisting of: polypeptide sequence of SEQ
ID NO:Y; a polypeptide encoded by SEQ ID NO:X or the complementary
strand thereto; the polypeptide encoded by the nucleotide sequence
as defined in columns 8 and 9 of Table 2; and a polypeptide encoded
by the cDNA contained in ATCC Deposit No: Z.
[0991] Also preferred is the above method for identifying the
species, tissue or cell type of a biological sample, which method
comprises a step of detecting polypeptide molecules comprising an
amino acid sequence in a panel of at least two amino acid
sequences, wherein at least one sequence in said panel is at least
90% identical to a sequence of at least 10 contiguous amino acids
in a sequence selected from the above group.
[0992] Also preferred is a method for diagnosing in a subject a
pathological condition associated with abnormal structure or
expression of a nucleic acid sequence identified in Table 1A, 1B or
Table 2 encoding a polypeptide, which method comprises a step of
detecting in a biological sample obtained from said subject
polypeptide molecules comprising an amino acid sequence in a panel
of at least two amino acid sequences, wherein at least one sequence
in said panel is at least 90% identical to a sequence of at least
10 contiguous amino acids in a sequence selected from the group
consisting of: polypeptide sequence of SEQ ID NO:Y; a polypeptide
encoded by SEQ ID NO:X or the complementary strand thereto; the
polypeptide encoded by the nucleotide sequence as defined in
columns 8 and 9 of Table 2; and a polypeptide encoded by the cDNA
contained in ATCC Deposit No: Z.
[0993] In any of these methods, the step of detecting said
polypeptide molecules includes using an antibody.
[0994] Also preferred is an isolated nucleic acid molecule
comprising a nucleotide sequence which is at least 95% identical to
a nucleotide sequence encoding a polypeptide wherein said
polypeptide comprises an amino acid sequence that is at least 90%
identical to a sequence of at least 10 contiguous amino acids in a
sequence selected from the group consisting of: polypeptide
sequence of SEQ ID NO:Y; a polypeptide encoded by SEQ ID NO:X or
the complementary strand thereto; the polypeptide encoded by the
nucleotide sequence as defined in columns 8 and 9 of Table 2; and a
polypeptide encoded by the cDNA contained in ATCC Deposit No:
Z.
[0995] Also preferred is an isolated nucleic acid molecule, wherein
said nucleotide sequence encoding a polypeptide has been optimized
for expression of said polypeptide in a prokaryotic host.
[0996] Also preferred is a polypeptide molecule, wherein said
polypeptide comprises an amino acid sequence selected from the
group consisting of: polypeptide sequence of SEQ ID NO:Y; a
polypeptide encoded by SEQ ID NO:X or the complementary strand
thereto; the polypeptide encoded by the nucleotide sequence as
defined in columns 8 and 9 of Table 2; and a polypeptide encoded by
the cDNA contained in ATCC Deposit No: Z.
[0997] Further preferred is a method of making a recombinant vector
comprising inserting any of the above isolated nucleic acid
molecule into a vector. Also preferred is the recombinant vector
produced by this method. Also preferred is a method of making a
recombinant host cell comprising introducing the vector into a host
cell, as well as the recombinant host cell produced by this
method.
[0998] Also preferred is a method of making an isolated polypeptide
comprising culturing this recombinant host cell under conditions
such that said polypeptide is expressed and recovering said
polypeptide. Also preferred is this method of making an isolated
polypeptide, wherein said recombinant host cell is a eukaryotic
cell and said polypeptide is a human protein comprising an amino
acid sequence selected from the group consisting of: polypeptide
sequence of SEQ ID NO:Y; a polypeptide encoded by SEQ ID NO:X or
the complementary strand thereto; the polypeptide encoded by the
nucleotide sequence as defined in columns 8 and 9 of Table 2; and a
polypeptide encoded by the cDNA contained in ATCC Deposit No: Z.
The isolated polypeptide produced by this method is also
preferred.
[0999] Also preferred is a method of treatment of an individual in
need of an increased level of a protein activity, which method
comprises administering to such an individual a Therapeutic
comprising an amount of an isolated polypeptide, polynucleotide,
immunogenic fragment or analogue thereof, binding agent, antibody,
or antigen binding fragment of the claimed invention effective to
increase the level of said protein activity in said individual.
[1000] Also preferred is a method of treatment of an individual in
need of a decreased level of a protein activity, which method
comprised administering to such an individual a Therapeutic
comprising an amount of an isolated polypeptide, polynucleotide,
immunogenic fragment or analogue thereof, binding agent, antibody,
or antigen binding fragment of the claimed invention effective to
decrease the level of said protein activity in said individual.
[1001] Also preferred is a method of treatment of an individual in
need of a specific delivery of toxic compositions to diseased cells
(e.g., tumors, leukemias or lymphomas), which method comprises
administering to such an individual a Therapeutic comprising an
amount of an isolated polypeptide of the invention, including, but
not limited to a binding agent, or antibody of the claimed
invention that are associated with toxin or cytotoxic prodrugs.
[1002] Having generally described the invention, the same will be
more readily understood by reference to the following examples,
which are provided by way of illustration and are not intended as
limiting.
Description of Table 6
[1003] Table 6 summarizes some of the ATCC Deposits, Deposit dates,
and ATCC designation numbers of deposits made with the ATCC in
connection with the present application. These deposits were made
in addition to those described in the Table 1A. TABLE-US-00012
TABLE 6 ATCC Deposits Deposit Date ATCC Designation Number LP01,
LP02, LP03, LP04, May-20-97 209059, 209060, 209061, LP05, LP06,
LP07, LP08, 209062, 209063, 209064, LP09, LP10, LP11, 209065,
209066, 209067, 209068, 209069 LP12 Jan-12-98 209579 LP13 Jan-12-98
209578 LP14 Jul-16-98 203067 LP15 Jul-16-98 203068 LP16 Feb-1-99
203609 LP17 Feb-1-99 203610 LP20 Nov-17-98 203485 LP21 Jun-18-99
PTA-252 LP22 Jun-18-99 PTA-253 LP23 Dec-22-99 PTA-1081
EXAMPLES
Example 1
Isolation of a Selected cDNA Clone from the Deposited Sample
[1004] Each ATCC Deposit No: Z is contained in a plasmid vector.
Table 7 identifies the vectors used to construct the cDNA library
from which each clone was isolated. In many cases, the vector used
to construct the library is a phage vector from which a plasmid has
been excised. The following correlates the related plasmid for each
phage vector used in constructing the cDNA library. For example,
where a particular clone is identified in Table 7 as being isolated
in the vector "Lambda Zap," the corresponding deposited clone is in
"pBluescript." TABLE-US-00013 Vector Used to Construct Library
Corresponding Deposited Plasmid Lambda Zap pBluescript (pBS)
Uni-Zap XR pBluescript (pBS) Zap Express pBK lafmid BA plafmid BA
pSport1 pSport1 pCMVSport 2.0 pCMVSport 2.0 pCMVSport 3.0 pCMVSport
3.0 pCR .RTM. 2.1 pCR .RTM. 2.1
[1005] Vectors Lambda Zap (U.S. Pat. Nos. 5,128,256 and 5,286,636),
Uni-Zap XR (U.S. Pat. Nos. 5,128,256 and 5,286,636), Zap Express
(U.S. Pat. Nos. 5,128,256 and 5,286,636), pBluescript (pBS) (Short,
J. M. et al., Nucleic Acids Res. 16:7583-7600 (1988); Alting-Mees,
M. A. and Short, J. M., Nucleic Acids Res. 17:9494 (1989)) and pBK
(Alting-Mees, M. A. et al., Strategies 5:58-61 (1992)) are
commercially available from Stratagene Cloning Systems, Inc., 11011
N. Torrey Pines Road, La Jolla, Calif., 92037. pBS contains an
ampicillin resistance gene and pBK contains a neomycin resistance
gene. Both can be transformed into E. coli strain XL-1 Blue, also
available from Stratagene. pBS comes in 4 forms SK+, SK-, KS+ and
KS. The S and K refers to the orientation of the polylinker to the
T7 and T3 primer sequences which flank the polylinker region ("S"
is for SacI and "K" is for KpnI which are the first sites on each
respective end of the linker). "+" or "-" refer to the orientation
of the f1 origin of replication ("ori"), such that in one
orientation, single stranded rescue initiated from the f1 ori
generates sense strand DNA and in the other, antisense.
[1006] Vectors pSport1, pCMVSport 2.0 and pCMVSport 3.0, were
obtained from Life Technologies, Inc., P.O. Box 6009, Gaithersburg,
Md. 20897. All Sport vectors contain an ampicillin resistance gene
and may be transformed into E. coli strain DH10B, also available
from Life Technologies. (See, for instance, Gruber, C. E., et al.,
Focus 15:59 (1993)). Vector lafmid BA (Bento Soares, Columbia
University, NY) contains an ampicillin resistance gene and can be
transformed into E. coli strain XL-1 Blue. Vector pCR.RTM.2.1,
which is available from Invitrogen, 1600 Faraday Avenue, Carlsbad,
Calif. 92008, contains an ampicillin resistance gene and may be
transformed into E. coli strain DH10B, available from Life
Technologies. (See, for instance, Clark, J. M., Nuc. Acids Res.
16:9677-9686 (1988) and Mead, D. et al., Bio/Technology 9: (1991)).
Preferably, a polynucleotide of the present invention does not
comprise the phage vector sequences identified for the particular
clone in Table 7, as well as the corresponding plasmid vector
sequences designated above.
[1007] The deposited material in the sample assigned the ATCC
Deposit Number cited by reference to Tables 1, 2, 6 and 7 for any
given cDNA clone also may contain one or more additional plasmids,
each comprising a cDNA clone different from that given clone. Thus,
deposits sharing the same ATCC Deposit Number contain at least a
plasmid for each ATCC Deposit No: Z. TABLE-US-00014 TABLE 7 ATCC
Libraries owned by Catalog Catalog Description Vector Deposit HUKA
HUKB HUKC HUKD Human Uterine Cancer Lambda ZAP II LP01 HUKE HUKF
HUKG HCNA HCNB Human Colon Lambda Zap II LP01 HFFA Human Fetal
Brain, random Lambda Zap II LP01 primed HTWA Resting T-Cell Lambda
ZAP II LP01 HBQA Early Stage Human Brain, Lambda ZAP II LP01 random
primed HLMB HLMF HLMG HLMH breast lymph node CDNA Lambda ZAP II
LP01 HLMI HLMJ HLMM HLMN library HCQA HCQB human colon cancer Lamda
ZAP II LP01 HMEA HMEC HMED Human Microvascular Lambda ZAP II LP01
HMEE HMEF HMEG HMEI Endothelial Cells, fract. A HMEJ HMEK HMEL HUSA
HUSC Human Umbilical Vein Lambda ZAP II LP01 Endothelial Cells,
fract. A HLQA HLQB Hepatocellular Tumor Lambda ZAP II LP01 HHGA
HHGB HHGC HHGD Hemangiopericytoma Lambda ZAP II LP01 HSDM Human
Striatum Depression, Lambda ZAP II LP01 re-rescue HUSH H Umbilical
Vein Endothelial Lambda ZAP II LP01 Cells, frac A, re-excision HSGS
Salivary gland, subtracted Lambda ZAP II LP01 HFXA HFXB HFXC HFXD
Brain frontal cortex Lambda ZAP II LP01 HFXE HFXF HFXG HFXH HPQA
HPQB HPQC PERM TF274 Lambda ZAP II LP01 HFXJ HFXK Brain Frontal
Cortex, re- Lambda ZAP II LP01 excision HCWA HCWB HCWC CD34
positive cells (Cord ZAP Express LP02 HCWD HCWE HCWF Blood) HCWG
HCWH HCWI HCWJ HCWK HCUA HCUB HCUC CD34 depleted Buffy Coat ZAP
Express LP02 (Cord Blood) HRSM A-14 cell line ZAP Express LP02 HRSA
A1-CELL LINE ZAP Express LP02 HCUD HCUE HCUF HCUG CD34 depleted
Buffy Coat ZAP Express LP02 HCUH HCUI (Cord Blood), re-excision
HBXE HBXF HBXG H. Whole Brain #2, re- ZAP Express LP02 excision
HRLM L8 cell line ZAP Express LP02 HBXA HBXB HBXC HBXD Human Whole
Brain #2 - ZAP Express LP02 Oligo dT >1.5 Kb HUDA HUDB HUDC
Testes ZAP Express LP02 HHTM HHTN HHTO H. hypothalamus, frac A; re-
ZAP Express LP02 excision HHTL H. hypothalamus, frac A ZAP Express
LP02 HASA HASD Human Adult Spleen Uni-ZAP XR LP03 HFKC HFKD HFKE
HFKF Human Fetal Kidney Uni-ZAP XR LP03 HFKG HE8A HE8B HE8C HE8D
Human 8 Week Whole Uni-ZAP XR LP03 HE8E HE8F HE8M HE8N Embryo HGBA
HGBD HGBE HGBF Human Gall Bladder Uni-ZAP XR LP03 HGBG HGBH HGBI
HLHA HLHB HLHC HLHD Human Fetal Lung III Uni-ZAP XR LP03 HLHE HLHF
HLHG HLHH HLHQ HPMA HPMB HPMC HPMD Human Placenta Uni-ZAP XR LP03
HPME HPMF HPMG HPMH HPRA HPRB HPRC HPRD Human Prostate Uni-ZAP XR
LP03 HSIA HSIC HSID HSIE Human Adult Small Intestine Uni-ZAP XR
LP03 HTEA HTEB HTEC HTED Human Testes Uni-ZAP XR LP03 HTEE HTEF
HTEG HTEH HTEI HTEJ HTEK HTPA HTPB HTPC HTPD Human Pancreas Tumor
Uni-ZAP XR LP03 HTPE HTTA HTTB HTTC HTTD Human Testes Tumor Uni-ZAP
XR LP03 HTTE HTTF HAPA HAPB HAPC HAPM Human Adult Pulmonary Uni-ZAP
XR LP03 HETA HETB HETC HETD Human Endometrial Tumor Uni-ZAP XR LP03
HETE HETF HETG HETH HETI HHFB HHFC HHFD HHFE Human Fetal Heart
Uni-ZAP XR LP03 HHFF HHFG HHFH HHFI HHPB HHPC HHPD HHPE Human
Hippocampus Uni-ZAP XR LP03 HHPF HHPG HHPH HCE1 HCE2 HCE3 HCE4
Human Cerebellum Uni-ZAP XR LP03 HCE5 HCEB HCEC HCED HCEE HCEF HCEG
HUVB HUVC HUVD HUVE Human Umbilical Vein, Uni-ZAP XR LP03 Endo.
remake HSTA HSTB HSTC HSTD Human Skin Tumor Uni-ZAP XR LP03 HTAA
HTAB HTAC HTAD Human Activated T-Cells Uni-ZAP XR LP03 HTAE HFEA
HFEB HFEC Human Fetal Epithelium Uni-ZAP XR LP03 (Skin) HJPA HJPB
HJPC HJPD HUMAN JURKAT Uni-ZAP XR LP03 MEMBRANE BOUND POLYSOMES
HESA Human epithelioid sarcoma Uni-Zap XR LP03 HLTA HLTB HLTC HLTD
Human T-Cell Lymphoma Uni-ZAP XR LP03 HLTE HLTF HFTA HFTB HFTC HFTD
Human Fetal Dura Mater Uni-ZAP XR LP03 HRDA HRDB HRDC HRDD Human
Rhabdomyosarcoma Uni-ZAP XR LP03 HRDE HRDF HCAA HCAB HCAC Cem cells
cyclohexamide Uni-ZAP XR LP03 treated HRGA HRGB HRGC HRGD Raji
Cells, cyclohexamide Uni-ZAP XR LP03 treated HSUA HSUB HSUC HSUM
Supt Cells, cyclohexamide Uni-ZAP XR LP03 treated HT4A HT4C HT4D
Activated T-Cells, 12 hrs. Uni-ZAP XR LP03 HE9A HE9B HE9C HE9D Nine
Week Old Early Stage Uni-ZAP XR LP03 HE9E HE9F HE9G HE9H Human HE9M
HE9N HATA HATB HATC HATD Human Adrenal Gland Tumor Uni-ZAP XR LP03
HATE HT5A Activated T-Cells, 24 hrs. Uni-ZAP XR LP03 HFGA HFGM
Human Fetal Brain Uni-ZAP XR LP03 HNEA HNEB HNEC HNED Human
Neutrophil Uni-ZAP XR LP03 HNEE HBGB HBGD Human Primary Breast
Uni-ZAP XR LP03 Cancer HBNA HBNB Human Normal Breast Uni-ZAP XR
LP03 HCAS Cem Cells, cyclohexamide Uni-ZAP XR LP03 treated, subtra
HHPS Human Hippocampus, pBS LP03 subtracted HKCS HKCU Human Colon
Cancer, pBS LP03 subtracted HRGS Raji cells, cyclohexamide pBS LP03
treated, subtracted HSUT Supt cells, cyclohexamide pBS LP03
treated, differentially expressed HT4S Activated T-Cells, 12 hrs,
Uni-ZAP XR LP03 subtracted HCDA HCDB HCDC HCDD Human Chondrosarcoma
Uni-ZAP XR LP03 HCDE HOAA HOAB HOAC Human Osteosarcoma Uni-ZAP XR
LP03 HTLA HTLB HTLC HTLD Human adult testis, large Uni-ZAP XR LP03
HTLE HTLF inserts HLMA HLMC HLMD Breast Lymph node cDNA Uni-ZAP XR
LP03 library H6EA H6EB H6EC HL-60, PMA 4 H Uni-ZAP XR LP03 HTXA
HTXB HTXC HTXD Activated T-Cell Uni-ZAP XR LP03 HTXE HTXF HTXG HTXH
(12 hs)/Thiouridine labelledEco HNFA HNFB HNFC HNFD Human
Neutrophil, Activated Uni-ZAP XR LP03 HNFE HNFF HNFG HNFH HNFJ HTOB
HTOC HUMAN TONSILS, Uni-ZAP XR LP03 FRACTION 2 HMGB Human OB MG63
control Uni-ZAP XR LP03 fraction I HOPB Human OB HOS control
Uni-ZAP XR LP03 fraction I HORB Human OB HOS treated (10 nM Uni-ZAP
XR LP03 E2) fraction I HSVA HSVB HSVC Human Chronic Synovitis
Uni-ZAP XR LP03 HROA HUMAN STOMACH Uni-ZAP XR LP03 HBJA HBJB HBJC
HBJD HUMAN B CELL Uni-ZAP XR LP03 HBJE HBJF HBJG HBJH LYMPHOMA HBJI
HBJJ HBJK HCRA HCRB HCRC human corpus colosum Uni-ZAP XR LP03 HODA
HODB HODC HODD human ovarian cancer Uni-ZAP XR LP03 HDSA
Dermatofibrosarcoma Uni-ZAP XR LP03 Protuberance HMWA HMWB HMWC
Bone Marrow Cell Line Uni-ZAP XR LP03 HMWD HMWE HMWF (RS4; 11) HMWG
HMWH HMWI HMWJ HSOA stomach cancer (human) Uni-ZAP XR LP03 HERA
SKIN Uni-ZAP XR LP03 HMDA Brain-medulloblastoma Uni-ZAP XR LP03
HGLA HGLB HGLD Glioblastoma Uni-ZAP XR LP03 HEAA H. Atrophic
Endometrium Uni-ZAP XR LP03 HBCA HBCB H. Lymph node breast Cancer
Uni-ZAP XR LP03 HPWT Human Prostate BPH, re- Uni-ZAP XR LP03
excision HFVG HFVH HFVI Fetal Liver, subtraction II pBS LP03 HNFI
Human Neutrophils, pBS LP03 Activated, re-excision HBMB HBMC HBMD
Human Bone Marrow, re- pBS LP03 excision HKML HKMM HKMN H. Kidney
Medulla, re- pBS LP03 excision HKIX HKIY H. Kidney Cortex,
subtracted pBS LP03 HADT H. Amygdala Depression, pBS LP03
subtracted H6AS Hl-60, untreated, subtracted Uni-ZAP XR LP03 H6ES
HL-60, PMA 4 H, subtracted Uni-ZAP XR LP03 H6BS HL-60, RA 4 h,
Subtracted Uni-ZAP XR LP03 H6CS HL-60, PMA 1 d, subtracted Uni-ZAP
XR LP03 HTXJ HTXK Activated T- Uni-ZAP XR LP03 cell(12
h)/Thiouridine-re- excision HMSA HMSB HMSC HMSD Monocyte activated
Uni-ZAP XR LP03 HMSE HMSF HMSG HMSH HMSI HMSJ HMSK HAGA HAGB HAGC
HAGD Human Amygdala Uni-ZAP XR LP03 HAGE HAGF HSRA HSRB HSRE
STROMAL - Uni-ZAP XR LP03 OSTEOCLASTOMA HSRD HSRF HSRG HSRH Human
Osteoclastoma Uni-ZAP XR LP03 Stromal Cells - unamplified HSQA HSQB
HSQC HSQD Stromal cell TF274 Uni-ZAP XR LP03 HSQE HSQF HSQG HSKA
HSKB HSKC HSKD Smooth muscle, serum treated Uni-ZAP XR LP03 HSKE
HSKF HSKZ HSLA HSLB HSLC HSLD Smooth muscle, control Uni-ZAP XR
LP03 HSLE HSLF HSLG HSDA HSDD HSDE HSDF Spinal cord Uni-ZAP XR LP03
HSDG HSDH HPWS Prostate-BPH subtracted II pBS LP03 HSKW HSKX HSKY
Smooth Muscle- HASTE pBS LP03 normalized HFPB HFPC HFPD H. Frontal
cortex, epileptic; re- Uni-ZAP XR LP03 excision HSDI HSDJ HSDK
Spinal Cord, re-excision Uni-ZAP XR LP03 HSKN HSKO Smooth Muscle
Serum pBS LP03 Treated, Norm HSKG HSKH HSKI Smooth muscle, serum
pBS LP03 induced, re-exc HFCA HFCB HFCC HFCD Human Fetal Brain
Uni-ZAP XR LP04 HFCE HFCF HPTA HPTB HPTD Human Pituitary Uni-ZAP XR
LP04 HTHB HTHC HTHD Human Thymus Uni-ZAP XR LP04 HE6B HE6C HE6D
HE6E Human Whole Six Week Old Uni-ZAP XR LP04 HE6F HE6G HE6S Embryo
HSSA HSSB HSSC HSSD Human Synovial Sarcoma Uni-ZAP XR LP04 HSSE
HSSF HSSG HSSH HSSI HSSJ HSSK HE7T 7 Week Old Early Stage Uni-ZAP
XR LP04 Human, subtracted HEPA HEPB HEPC Human Epididymus Uni-ZAP
XR LP04 HSNA HSNB HSNC HSNM Human Synovium Uni-ZAP XR LP04 HSNN
HPFB HPFC HPFD HPFE Human Prostate Cancer, Uni-ZAP XR LP04 Stage C
fraction HE2A HE2D HE2E HE2H 12 Week Old Early Stage Uni-ZAP XR
LP04 HE2I HE2M HE2N HE2O Human HE2B HE2C HE2F HE2G 12 Week Old
Early Stage Uni-ZAP XR LP04 HE2P HE2Q Human, II HPTS HPTT HPTU
Human Pituitary, subtracted Uni-ZAP XR LP04 HAUA HAUB HAUC Amniotic
Cells - TNF Uni-ZAP XR LP04 induced HAQA HAQB HAQC HAQD Amniotic
Cells - Primary Uni-ZAP XR LP04 Culture
HWTA HWTB HWTC wilm's tumor Uni-ZAP XR LP04 HBSD Bone Cancer,
re-excision Uni-ZAP XR LP04 HSGB Salivary gland, re-excision
Uni-ZAP XR LP04 HSJA HSJB HSJC Smooth muscle-ILb induced Uni-ZAP XR
LP04 HSXA HSXB HSXC HSXD Human Substantia Nigra Uni-ZAP XR LP04
HSHA HSHB HSHC Smooth muscle, IL1b induced Uni-ZAP XR LP04 HOUA
HOUB HOUC HOUD Adipocytes Uni-ZAP XR LP04 HOUE HPWA HPWB HPWC
Prostate BPH Uni-ZAP XR LP04 HPWD HPWE HELA HELB HELC HELD
Endothelial cells-control Uni-ZAP XR LP04 HELE HELF HELG HELH HEMA
HEMB HEMC Endothelial-induced Uni-ZAP XR LP04 HEMD HEME HEMF HEMG
HEMH HBIA HBIB HBIC Human Brain, Striatum Uni-ZAP XR LP04 HHSA HHSB
HHSC HHSD Human Uni-ZAP XR LP04 HHSE Hypothalmus, Schizophrenia
HNGA HNGB HNGC HNGD neutrophils control Uni-ZAP XR LP04 HNGE HNGF
HNGG HNGH HNGI HNGJ HNHA HNHB HNHC HNHD Neutrophils IL-1 and LPS
Uni-ZAP XR LP04 HNHE HNHF HNHG HNHH induced HNHI HNHJ HSDB HSDC
STRIATUM DEPRESSION Uni-ZAP XR LP04 HHPT Hypothalamus Uni-ZAP XR
LP04 HSAT HSAU HSAV HSAW Anergic T-cell Uni-ZAP XR LP04 HSAX HSAY
HSAZ HBMS HBMT HBMU Bone marrow Uni-ZAP XR LP04 HBMV HBMW HBMX HOEA
HOEB HOEC HOED Osteoblasts Uni-ZAP XR LP04 HOEE HOEF HOEJ HAIA HAIB
HAIC HAID Epithelial-TNFa and INF Uni-ZAP XR LP04 HAIE HAIF induced
HTGA HTGB HTGC HTGD Apoptotic T-cell Uni-ZAP XR LP04 HMCA HMCB HMCC
Macrophage-oxLDL Uni-ZAP XR LP04 HMCD HMCE HMAA HMAB HMAC
Macrophage (GM-CSF Uni-ZAP XR LP04 HMAD HMAE HMAF treated) HMAG
HPHA Normal Prostate Uni-ZAP XR LP04 HPIA HPIB HPIC LNCAP prostate
cell line Uni-ZAP XR LP04 HPJA HPJB HPJC PC3 Prostate cell line
Uni-ZAP XR LP04 HOSE HOSF HOSG Human Osteoclastoma, re- Uni-ZAP XR
LP04 excision HTGE HTGF Apoptotic T-cell, re-excision Uni-ZAP XR
LP04 HMAJ HMAK H Macrophage (GM-CSF Uni-ZAP XR LP04 treated),
re-excision HACB HACC HACD Human Adipose Tissue, re- Uni-ZAP XR
LP04 excision HFPA H. Frontal Cortex, Epileptic Uni-ZAP XR LP04
HFAA HFAB HFAC HFAD Alzheimer's, spongy change Uni-ZAP XR LP04 HFAE
HFAM Frontal Lobe, Dementia Uni-ZAP XR LP04 HMIA HMIB HMIC Human
Manic Depression Uni-ZAP XR LP04 Tissue HTSA HTSE HTSF HTSG Human
Thymus pBS LP05 HTSH HPBA HPBB HPBC HPBD Human Pineal Gland pBS
LP05 HPBE HSAA HSAB HSAC HSA 172 Cells pBS LP05 HSBA HSBB HSBC HSBM
HSC172 cells pBS LP05 HJAA HJAB HJAC HJAD Jurkat T-cell G1 phase
pBS LP05 HJBA HJBB HJBC HJBD Jurkat T-Cell, S phase pBS LP05 HAFA
HAFB Aorta endothelial cells + TNF-a pBS LP05 HAWA HAWB HAWC Human
White Adipose pBS LP05 HTNA HTNB Human Thyroid pBS LP05 HONA Normal
Ovary, pBS LP05 Premenopausal HARA HARB Human Adult Retina pBS LP05
HLJA HLJB Human Lung pCMVSport 1 LP06 HOFM HOFN HOFO H. Ovarian
Tumor, II, pCMVSport 2.0 LP07 OV5232 HOGA HOGB HOGC OV 10-3-95
pCMVSport 2.0 LP07 HCGL CD34+cells, II pCMVSport 2.0 LP07 HDLA
Hodgkin's Lymphoma I pCMVSport 2.0 LP07 HDTA HDTB HDTC HDTD
Hodgkin's Lymphoma II pCMVSport 2.0 LP07 HDTE HKAA HKAB HKAC HKAD
Keratinocyte pCMVSport 2.0 LP07 HKAE HKAF HKAG HKAH HCIM CAPFINDER,
Crohn's pCMVSport 2.0 LP07 Disease, lib 2 HKAL Keratinocyte, lib 2
pCMVSport 2.0 LP07 HKAT Keratinocyte, lib 3 pCMVSport 2.0 LP07 HNDA
Nasal polyps pCMVSport 2.0 LP07 HDRA H. Primary Dendritic Cells,
lib 3 pCMVSport 2.0 LP07 HOHA HOHB HOHC Human Osteoblasts II
pCMVSport 2.0 LP07 HLDA HLDB HLDC Liver, Hepatoma pCMVSport 3.0
LP08 HLDN HLDO HLDP Human Liver, normal pCMVSport 3.0 LP08 HMTA
pBMC stimulated w/ poly I/C pCMVSport 3.0 LP08 HNTA NTERA2, control
pCMVSport 3.0 LP08 HDPA HDPB HDPC HDPD Primary Dendritic Cells, lib
1 pCMVSport 3.0 LP08 HDPF HDPG HDPH HDPI HDPJ HDPK HDPM HDPN HDPO
HDPP Primary Dendritic cells, frac 2 pCMVSport 3.0 LP08 HMUA HMUB
HMUC Myoloid Progenitor Cell Line pCMVSport 3.0 LP08 HHEA HHEB HHEC
HHED T Cell helper I pCMVSport 3.0 LP08 HHEM HHEN HHEO HHEP T cell
helper II pCMVSport 3.0 LP08 HEQA HEQB HEQC Human endometrial
stromal pCMVSport 3.0 LP08 cells HJMA HJMB Human endometrial
stromal pCMVSport 3.0 LP08 cells-treated with progesterone HSWA
HSWB HSWC Human endometrial stromal pCMVSport 3.0 LP08
cells-treated with estradiol HSYA HSYB HSYC Human Thymus Stromal
Cells pCMVSport 3.0 LP08 HLWA HLWB HLWC Human Placenta pCMVSport
3.0 LP08 HRAA HRAB HRAC Rejected Kidney, lib 4 pCMVSport 3.0 LP08
HMTM PCR, pBMC I/C treated PCRII LP09 HMJA H. Meniingima, M6 pSport
1 LP10 HMKA HMKB HMKC H. Meningima, M1 pSport 1 LP10 HMKD HMKE HUSG
HUSI Human umbilical vein pSport 1 LP10 endothelial cells, IL-4
induced HUSX HUSY Human Umbilical Vein pSport 1 LP10 Endothelial
Cells, uninduced HOFA Ovarian Tumor I, OV5232 pSport 1 LP10 HCFA
HCFB HCFC HCFD T-Cell PHA 16 hrs pSport 1 LP10 HCFL HCFM HCFN HCFO
T-Cell PHA 24 hrs pSport 1 LP10 HADA HADC HADD HADE Human Adipose
pSport 1 LP10 HADF HADG HOVA HOVB HOVC Human Ovary pSport 1 LP10
HTWB HTWC HTWD Resting T-Cell Library, II pSport 1 LP10 HTWE HTWF
HMMA Spleen metastic melanoma pSport 1 LP10 HLYA HLYB HLYC HLYD
Spleen, Chronic lymphocytic pSport 1 LP10 HLYE leukemia HCGA CD34+
cell, I pSport 1 LP10 HEOM HEON Human Eosinophils pSport 1 LP10
HTDA Human Tonsil, Lib 3 pSport 1 LP10 HSPA Salivary Gland, Lib 2
pSport 1 LP10 HCHA HCHB HCHC Breast Cancer cell line, MDA pSport 1
LP10 36 HCHM HCHN Breast Cancer Cell line, pSport 1 LP10 angiogenic
HCIA Crohn's Disease pSport 1 LP10 HDAA HDAB HDAC HEL cell line
pSport 1 LP10 HABA Human Astrocyte pSport 1 LP10 HUFA HUFB HUFC
Ulcerative Colitis pSport 1 LP10 HNTM NTERA2 + retinoic acid, 14
pSport 1 LP10 days HDQA Primary Dendritic pSport 1 LP10 cells,
CapFinder2, frac 1 HDQM Primary Dendritic Cells, pSport 1 LP10
CapFinder, frac 2 HLDX Human Liver, pSport 1 LP10 normal, CapFinder
HULA HULB HULC Human Dermal Endothelial pSport 1 LP10 Cells,
untreated HUMA Human Dermal Endothelial pSport 1 LP10 cells,
treated HCJA Human Stromal Endometrial pSport 1 LP10 fibroblasts,
untreated HCJM Human Stromal endometrial pSport 1 LP10 fibroblasts,
treated w/ estradiol HEDA Human Stromal endometrial pSport 1 LP10
fibroblasts, treated with progesterone HFNA Human ovary tumor cell
pSport 1 LP10 OV350721 HKGA HKGB HKGC HKGD Merkel Cells pSport 1
LP10 HISA HISB HISC Pancreas Islet Cell Tumor pSport 1 LP10 HLSA
Skin, burned pSport 1 LP10 HBZA Prostate, BPH, Lib 2 pSport 1 LP10
HBZS Prostate BPH, Lib 2, pSport 1 LP10 subtracted HFIA HFIB HFIC
Synovial Fibroblasts (control) pSport 1 LP10 HFIH HFII HFIJ
Synovial hypoxia pSport 1 LP10 HFIT HFIU HFIV Synovial IL-1/TNF
stimulated pSport 1 LP10 HGCA Messangial cell, frac 1 pSport 1 LP10
HMVA HMVB HMVC Bone Marrow Stromal Cell, pSport 1 LP10 untreated
HFIX HFIY HFIZ Synovial Fibroblasts pSport 1 LP10 (Il1/TNF), subt
HFOX HFOY HFOZ Synovial hypoxia-RSF pSport 1 LP10 subtracted HMQA
HMQB HMQC Human Activated Monocytes Uni-ZAP XR LP11 HMQD HLIA HLIB
HLIC Human Liver pCMVSport 1 LP012 HHBA HHBB HHBC HHBD Human Heart
pCMVSport 1 LP012 HHBE HBBA HBBB Human Brain pCMVSport 1 LP012 HLJA
HLJB HLJC HLJD Human Lung pCMVSport 1 LP012 HLJE HOGA HOGB HOGC
Ovarian Tumor pCMVSport 2.0 LP012 HTJM Human Tonsils, Lib 2
pCMVSport 2.0 LP012 HAMF HAMG KMH2 pCMVSport 3.0 LP012 HAJA HAJB
HAJC L428 pCMVSport 3.0 LP012 HWBA HWBB HWBC Dendritic cells,
pooled pCMVSport 3.0 LP012 HWBD HWBE HWAA HWAB HWAC Human Bone
Marrow, pCMVSport 3.0 LP012 HWAD HWAE treated HYAA HYAB HYAC B Cell
lymphoma pCMVSport 3.0 LP012 HWHG HWHH HWHI Healing groin wound,
6.5 pCMVSport 3.0 LP012 hours post incision HWHP HWHQ HWHR Healing
groin wound; 7.5 pCMVSport 3.0 LP012 hours post incision HARM
Healing groin wound - zero hr pCMVSport 3.0 LP012 post-incision
(control) HBIM Olfactory epithelium; pCMVSport 3.0 LP012
nasalcavity HWDA Healing Abdomen wound; pCMVSport 3.0 LP012
70&90 min post incision HWEA Healing Abdomen Wound; 15
pCMVSport 3.0 LP012 days post incision HWJA Healing Abdomen
pCMVSport 3.0 LP012 Wound; 21&29 days HNAL Human Tongue, frac 2
pSport 1 LP012 HMJA H. Meniingima, M6 pSport 1 LP012 HMKA HMKB HMKC
H. Meningima, M1 pSport 1 LP012 HMKD HMKE HOFA Ovarian Tumor I,
OV5232 pSport 1 LP012 HCFA HCFB HCFC HCFD T-Cell PHA 16 hrs pSport
1 LP012 HCFL HCFM HCFN HCFO T-Cell PHA 24 hrs pSport 1 LP012 HMMA
HMMB HMMC Spleen metastic melanoma pSport 1 LP012 HTDA Human
Tonsil, Lib 3 pSport 1 LP012 HDBA Human Fetal Thymus pSport 1 LP012
HDUA Pericardium pSport 1 LP012 HBZA Prostate, BPH, Lib 2 pSport 1
LP012 HWCA Larynx tumor pSport 1 LP012 HWKA Normal lung pSport 1
LP012 HSMB Bone marrow stroma, treated pSport 1 LP012 HBHM Normal
trachea pSport 1 LP012 HLFC Human Larynx pSport 1 LP012 HLRB
Siebben Polyposis pSport 1 LP012 HNIA Mammary Gland pSport 1 LP012
HNJB Palate carcinoma pSport 1 LP012 HNKA Palate normal pSport 1
LP012 HMZA Pharynx carcinoma pSport 1 LP012 HABG Cheek Carcinoma
pSport 1 LP012 HMZM Pharynx Carcinoma pSport 1 LP012 HDRM Larynx
Carcinoma pSport 1 LP012 HVAA Pancreas normal PCA4 No pSport 1
LP012 HICA Tongue carcinoma pSport 1 LP012 HUKA HUKB HUKC HUKD
Human Uterine Cancer Lambda ZAP II LP013 HUKE HFFA Human Fetal
Brain, random Lambda ZAP II LP013 primed HTUA Activated T-cell
labeled with Lambda ZAP II LP013 4-thioluri HBQA Early Stage Human
Brain, Lambda ZAP II LP013 random primed HMEB Human microvascular
Lambda ZAP II LP013 Endothelial cells, fract. B HUSH Human
Umbilical Vein Lambda ZAP II LP013 Endothelial cells, fract. A, re-
excision HLQC HLQD Hepatocellular tumor, re- Lambda ZAP II LP013
excision
HTWJ HTWK HTWL Resting T-cell, re-excision Lambda ZAP II LP013 HF6S
Human Whole 6 week Old pBluescript LP013 Embryo (II), subt HHPS
Human Hippocampus, pBluescript LP013 subtracted HL1S LNCAP,
differential pBluescript LP013 expression HLHS HLHT Early Stage
Human Lung, pBluescript LP013 Subtracted HSUS Supt cells,
cyclohexamide pBluescript LP013 treated, subtracted HSUT Supt
cells, cyclohexamide pBluescript LP013 treated, differentially
expressed HSDS H. Striatum Depression, pBluescript LP013 subtracted
HPTZ Human Pituitary, Subtracted pBluescript LP013 VII HSDX H.
Striatum Depression, subt pBluescript LP013 II HSDZ H. Striatum
Depression, subt pBluescript LP013 HPBA HPBB HPBC HPBD Human Pineal
Gland pBluescript SK- LP013 HPBE HRTA Colorectal Tumor pBluescript
SK- LP013 HSBA HSBB HSBC HSBM HSC172 cells pBluescript SK- LP013
HJAA HJAB HJAC HJAD Jurkat T-cell G1 phase pBluescript SK- LP013
HJBA HJBB HJBC HJBD Jurkat T-cell, S1 phase pBluescript SK- LP013
HTNA HTNB Human Thyroid pBluescript SK- LP013 HAHA HAHB Human Adult
Heart Uni-ZAP XR LP013 HE6A Whole 6 week Old Embryo Uni-ZAP XR
LP013 HFCA HFCB HFCC HFCD Human Fetal Brain Uni-ZAP XR LP013 HFCE
HFKC HFKD HFKE HFKF Human Fetal Kidney Uni-ZAP XR LP013 HFKG HGBA
HGBD HGBE HGBF Human Gall Bladder Uni-ZAP XR LP013 HGBG HPRA HPRB
HPRC HPRD Human Prostate Uni-ZAP XR LP013 HTEA HTEB HTEC HTED Human
Testes Uni-ZAP XR LP013 HTEE HTTA HTTB HTTC HTTD Human Testes Tumor
Uni-ZAP XR LP013 HTTE HYBA HYBB Human Fetal Bone Uni-ZAP XR LP013
HFLA Human Fetal Liver Uni-ZAP XR LP013 HHFB HHFC HHFD HHFE Human
Fetal Heart Uni-ZAP XR LP013 HHFF HUVB HUVC HUVD HUVE Human
Umbilical Vein, End. Uni-ZAP XR LP013 remake HTHB HTHC HTHD Human
Thymus Uni-ZAP XR LP013 HSTA HSTB HSTC HSTD Human Skin Tumor
Uni-ZAP XR LP013 HTAA HTAB HTAC HTAD Human Activated T-cells
Uni-ZAP XR LP013 HTAE HFEA HFEB HFEC Human Fetal Epithelium Uni-ZAP
XR LP013 (skin) HJPA HJPB HJPC HJPD Human Jurkat Membrane Uni-ZAP
XR LP013 Bound Polysomes HESA Human Epithelioid Sarcoma Uni-ZAP XR
LP013 HALS Human Adult Liver, Uni-ZAP XR LP013 Subtracted HFTA HFTB
HFTC HFTD Human Fetal Dura Mater Uni-ZAP XR LP013 HCAA HCAB HCAC
Cem cells, cyclohexamide Uni-ZAP XR LP013 treated HRGA HRGB HRGC
HRGD Raji Cells, cyclohexamide Uni-ZAP XR LP013 treated HE9A HE9B
HE9C HE9D Nine Week Old Early Stage Uni-ZAP XR LP013 HE9E Human
HSFA Human Fibrosarcoma Uni-ZAP XR LP013 HATA HATB HATC HATD Human
Adrenal Gland Tumor Uni-ZAP XR LP013 HATE HTRA Human Trachea Tumor
Uni-ZAP XR LP013 HE2A HE2D HE2E HE2H 12 Week Old Early Stage
Uni-ZAP XR LP013 HE2I Human HE2B HE2C HE2F HE2G 12 Week Old Early
Stage Uni-ZAP XR LP013 HE2P Human, II HNEA HNEB HNEC HNED Human
Neutrophil Uni-ZAP XR LP013 HNEE HBGA Human Primary Breast Uni-ZAP
XR LP013 Cancer HPTS HPTT HPTU Human Pituitary, subtracted Uni-ZAP
XR LP013 HMQA HMQB HMQC Human Activated Monocytes Uni-ZAP XR LP013
HMQD HOAA HOAB HOAC Human Osteosarcoma Uni-ZAP XR LP013 HTOA HTOD
HTOE HTOF human tonsils Uni-ZAP XR LP013 HTOG HMGB Human OB MG63
control Uni-ZAP XR LP013 fraction I HOPB Human OB HOS control
Uni-ZAP XR LP013 fraction I HOQB Human OB HOS treated (1 nM Uni-ZAP
XR LP013 E2) fraction I HAUA HAUB HAUC Amniotic Cells - TNF Uni-ZAP
XR LP013 induced HAQA HAQB HAQC HAQD Amniotic Cells - Primary
Uni-ZAP XR LP013 Culture HROA HROC HUMAN STOMACH Uni-ZAP XR LP013
HBJA HBJB HBJC HBJD HUMAN B CELL Uni-ZAP XR LP013 HBJE LYMPHOMA
HODA HODB HODC HODD human ovarian cancer Uni-ZAP XR LP013 HCPA
Corpus Callosum Uni-ZAP XR LP013 HSOA stomach cancer (human)
Uni-ZAP XR LP013 HERA SKIN Uni-ZAP XR LP013 HMDA
Brain-medulloblastoma Uni-ZAP XR LP013 HGLA HGLB HGLD Glioblastoma
Uni-ZAP XR LP013 HWTA HWTB HWTC wilm's tumor Uni-ZAP XR LP013 HEAA
H. Atrophic Endometrium Uni-ZAP XR LP013 HAPN HAPO HAPP HAPQ Human
Adult Pulmonary; re- Uni-ZAP XR LP013 HAPR excision HLTG HLTH Human
T-cell lymphoma; re- Uni-ZAP XR LP013 excision HAHC HAHD HAHE Human
Adult Heart; re- Uni-ZAP XR LP013 excision HAGA HAGB HAGC HAGD
Human Amygdala Uni-ZAP XR LP013 HAGE HSJA HSJB HSJC Smooth
muscle-ILb induced Uni-ZAP XR LP013 HSHA HSHB HSHC Smooth muscle,
IL1b induced Uni-ZAP XR LP013 HPWA HPWB HPWC Prostate BPH Uni-ZAP
XR LP013 HPWD HPWE HPIA HPIB HPIC LNCAP prostate cell line Uni-ZAP
XR LP013 HPJA HPJB HPJC PC3 Prostate cell line Uni-ZAP XR LP013
HBTA Bone Marrow Stroma, Uni-ZAP XR LP013 TNF&LPS ind HMCF HMCG
HMCH HMCI Macrophage-oxLDL; re- Uni-ZAP XR LP013 HMCJ excision HAGG
HAGH HAGI Human Amygdala; re-excision Uni-ZAP XR LP013 HACA H.
Adipose Tissue Uni-ZAP XR LP013 HKFB K562 + PMA (36 hrs), re- ZAP
Express LP013 excision HCWT HCWU HCWV CD34 positive cells (cord ZAP
Express LP013 blood), re-ex HBWA Whole brain ZAP Express LP013 HBXA
HBXB HBXC HBXD Human Whole Brain #2 - ZAP Express LP013 Oligo dT
>1.5 Kb HAVM Temporal cortex-Alzheizmer pT-Adv LP014 HAVT
Hippocampus, Alzheimer pT-Adv LP014 Subtracted HHAS CHME Cell Line
Uni-ZAP XR LP014 HAJR Larynx normal pSport 1 LP014 HWLE HWLF HWLG
Colon Normal pSport 1 LP014 HWLH HCRM HCRN HCRO Colon Carcinoma
pSport 1 LP014 HWLI HWLJ HWLK Colon Normal pSport 1 LP014 HWLQ HWLR
HWLS Colon Tumor pSport 1 LP014 HWLT HBFM Gastrocnemius Muscle
pSport 1 LP014 HBOD HBOE Quadriceps Muscle pSport 1 LP014 HBKD HBKE
Soleus Muscle pSport 1 LP014 HCCM Pancreatic Langerhans pSport 1
LP014 HWGA Larynx carcinoma pSport 1 LP014 HWGM HWGN Larynx
carcinoma pSport 1 LP014 HWLA HWLB HWLC Normal colon pSport 1 LP014
HWLM HWLN Colon Tumor pSport 1 LP014 HVAM HVAN HVAO Pancreas Tumor
pSport 1 LP014 HWGQ Larynx carcinoma pSport 1 LP014 HAQM HAQN
Salivary Gland pSport 1 LP014 HASM Stomach; normal pSport 1 LP014
HBCM Uterus; normal pSport 1 LP014 HCDM Testis; normal pSport 1
LP014 HDJM Brain; normal pSport 1 LP014 HEFM Adrenal Gland, normal
pSport 1 LP014 HBAA Rectum normal pSport 1 LP014 HFDM Rectum tumour
pSport 1 LP014 HGAM Colon, normal pSport 1 LP014 HHMM Colon, tumour
pSport 1 LP014 HCLB HCLC Human Lung Cancer Lambda Zap II LP015 HRLA
L1 Cell line ZAP Express LP015 HHAM Hypothalamus, Alzheimer's
pCMVSport 3.0 LP015 HKBA Ku 812F Basophils Line pSport 1 LP015 HS2S
Saos2, Dexamethosome pSport 1 LP016 Treated HA5A Lung Carcinoma
A549 pSport 1 LP016 TNFalpha activated HTFM TF-1 Cell Line GM-CSF
pSport 1 LP016 Treated HYAS Thyroid Tumour pSport 1 LP016 HUTS
Larynx Normal pSport 1 LP016 HXOA Larynx Tumor pSport 1 LP016 HEAH
Ea.hy.926 cell line pSport 1 LP016 HINA Adenocarcinoma Human pSport
1 LP016 HRMA Lung Mesothelium pSport 1 LP016 HLCL Human
Pre-Differentiated Uni-Zap XR LP017 Adipocytes HS2A Saos2 Cells
pSport 1 LP020 HS2I Saos2 Cells; Vitamin D3 pSport 1 LP020 Treated
HUCM CHME Cell Line, untreated pSport 1 LP020 HEPN Aryepiglottis
Normal pSport 1 LP020 HPSN Sinus Piniformis Tumour pSport 1 LP020
HNSA Stomach Normal pSport 1 LP020 HNSM Stomach Tumour pSport 1
LP020 HNLA Liver Normal Met5No pSport 1 LP020 HUTA Liver Tumour Met
5 Tu pSport 1 LP020 HOCN Colon Normal pSport 1 LP020 HOCT Colon
Tumor pSport 1 LP020 HTNT Tongue Tumour pSport 1 LP020 HLXN Larynx
Normal pSport 1 LP020 HLXT Larynx Tumour pSport 1 LP020 HTYN Thymus
pSport 1 LP020 HPLN Placenta pSport 1 LP020 HTNG Tongue Normal
pSport 1 LP020 HZAA Thyroid Normal (SDCA2 No) pSport 1 LP020 HWES
Thyroid Thyroiditis pSport 1 LP020 HFHD Ficolled Human Stromal
pTrip1Ex2 LP021 Cells, 5Fu treated HFHM, HFHN Ficolled Human
Stromal pTrip1Ex2 LP021 Cells, Untreated HPCI Hep G2 Cells, lambda
library lambda Zap-CMV LP021 XR HBCA, HBCB, HBCC H. Lymph node
breast Cancer Uni-ZAP XR LP021 HCOK Chondrocytes pSPORT1 LP022
HDCA, HDCB, HDCC Dendritic Cells From CD34 pSPORT1 LP022 Cells
HDMA, HDMB CD40 activated monocyte pSPORT1 LP022 dendritic cells
HDDM, HDDN, HDDO LPS activated derived pSPORT1 LP022 dendritic
cells HPCR Hep G2 Cells, PCR library lambda Zap-CMV LP022 XR HAAA,
HAAB, HAAC Lung, Cancer (4005313A3): pSPORT1 LP022 Invasive Poorly
Differentiated Lung Adenocarcinoma HIPA, HIPB, HIPC Lung, Cancer
(4005163 B7): pSPORT1 LP022 Invasive, Poorly Diff. Adenocarcinoma,
Metastatic HOOH, HOOI Ovary, Cancer: (4004562 B6) pSPORT1 LP022
Papillary Serous Cystic Neoplasm, Low Malignant Pot HIDA Lung,
Normal: (4005313 B1) pSPORT1 LP022 HUJA, HUJB, HUJC, HUJD, HUJE
B-Cells pCMVSport 3.0 LP022 HNOA, HNOB, HNOC, HNOD Ovary, Normal:
(9805C040R) pSPORT1 LP022 HNLM Lung, Normal: (4005313 B1) pSPORT1
LP022 HSCL Stromal Cells pSPORT1 LP022 HAAX Lung, Cancer: (4005313
A3) pSPORT1 LP022 Invasive Poorly-differentiated Metastatic lung
adenocarcinoma HUUA, HUUB, HUUC, HUUD B-cells (unstimulated)
pTrip1Ex2 LP022 HWWA, HWWB, HWWC, HWWD, B-cells (stimulated)
pSPORT1 LP022 HWWE, HWWF, HWWG HCCC Colon, Cancer: (9808C064R)
pCMVSport 3.0 LP023 HPDO HPDP HPDQ HPDR Ovary, Cancer (9809C332):
pSport 1 LP023 HPD Poorly differentiated adenocarcinoma HPCO HPCP
HPCQ HPCT Ovary, Cancer (15395A1F): pSport 1 LP023 Grade II
Papillary Carcinoma HOCM HOCO HOCP HOCQ Ovary, Cancer: (15799A1F)
pSport 1 LP023 Poorly differentiated carcinoma HCBM HCBN HCBO
Breast, Cancer: (4004943 A5) pSport 1 LP023 HNBT HNBU HNBV Breast,
Normal: (4005522B2) pSport 1 LP023 HBCP HBCQ Breast, Cancer:
(4005522 A2) pSport 1 LP023 HBCJ Breast, Cancer: (9806C012R) pSport
1 LP023
HSAM HSAN Stromal cells 3.88 pSport 1 LP023 HVCA HVCB HVCC HVCD
Ovary, Cancer: (4004332 A2) pSport 1 LP023 HSCK HSEN HSEO Stromal
cells (HBM3.18) pSport 1 LP023 HSCP HSCQ stromal cell clone 2.5
pSport 1 LP023 HUXA Breast Cancer: (4005385 A2) pSport 1 LP023 HCOM
HCON HCOO HCOP Ovary, Cancer (4004650 A3): pSport 1 LP023 HCOQ
Well-Differentiated Micropapillary Serous Carcinoma HBNM Breast,
Cancer: (9802C020E) pSport 1 LP023 HVVA HVVB HVVC HVVD Human Bone
Marrow, treated pSport 1 LP023 HVVE
[1008] Two nonlimiting examples are provided below for isolating a
particular clone from the deposited sample of plasmid cDNAs cited
for that clone in Table 7. First, a plasmid is directly isolated by
screening the clones using a polynucleotide probe corresponding to
the nucleotide sequence of SEQ ID NO:X.
[1009] Particularly, a specific polynucleotide with 30-40
nucleotides is synthesized using an Applied Biosystems DNA
synthesizer according to the sequence reported. The oligonucleotide
is labeled, for instance, with .sup.32P-.gamma.-ATP using T4
polynucleotide kinase and purified according to routine methods.
(E.g., Maniatis et al., Molecular Cloning: A Laboratory Manual,
Cold Spring Harbor Press, Cold Spring, N.Y. (1982)). The plasmid
mixture is transformed into a suitable host, as indicated above
(such as XL-1 Blue (Stratagene)) using techniques known to those of
skill in the art, such as those provided by the vector supplier or
in related publications or patents cited above. The transformants
are plated on 1.5% agar plates (containing the appropriate
selection agent, e.g., ampicillin) to a density of about 150
transformants (colonies) per plate. These plates are screened using
Nylon membranes according to routine methods for bacterial colony
screening (e.g., Sambrook et al., Molecular Cloning: A Laboratory
Manual, 2nd Edit., (1989), Cold Spring Harbor Laboratory Press,
pages 1.93 to 1.104), or other techniques known to those of skill
in the art.
[1010] Alternatively, two primers of 17-20 nucleotides derived from
both ends of the nucleotide sequence of SEQ ID NO:X are synthesized
and used to amplify the desired cDNA using the deposited cDNA
plasmid as a template. The polymerase chain reaction is carried out
under routine conditions, for instance, in 25 .mu.l of reaction
mixture with 0.5 ug of the above cDNA template. A convenient
reaction mixture is 1.5-5 mM MgCl.sub.2, 0.01% (w/v) gelatin, 20
.mu.M each of dATP, dCTP, dGTP, dTTP, 25 pmol of each primer and
0.25 Unit of Taq polymerase. Thirty five cycles of PCR
(denaturation at 94.degree. C. for 1 min; annealing at 55.degree.
C. for 1 min; elongation at 72.degree. C. for 1 min) are performed
with a Perkin-Elmer Cetus automated thermal cycler. The amplified
product is analyzed by agarose gel electrophoresis and the DNA band
with expected molecular weight is excised and purified. The PCR
product is verified to be the selected sequence by subcloning and
sequencing the DNA product.
[1011] Several methods are available for the identification of the
5' or 3' non-coding portions of a gene which may not be present in
the deposited clone. These methods include but are not limited to,
filter probing, clone enrichment using specific probes, and
protocols similar or identical to 5' and 3' "RACE" protocols which
are well known in the art. For instance, a method similar to 5'
RACE is available for generating the missing 5' end of a desired
full-length transcript. (Fromont-Racine et al., Nucleic Acids Res.
21(7):1683-1684 (1993)).
[1012] Briefly, a specific RNA oligonucleotide is ligated to the 5'
ends of a population of RNA presumably containing full-length gene
RNA transcripts. A primer set containing a primer specific to the
ligated RNA oligonucleotide and a primer specific to a known
sequence of the gene of interest is used to PCR amplify the 5'
portion of the desired full-length gene. This amplified product may
then be sequenced and used to generate the full length gene.
[1013] This above method starts with total RNA isolated from the
desired source, although poly-A+ RNA can be used. The RNA
preparation can then be treated with phosphatase if necessary to
eliminate 5' phosphate groups on degraded or damaged RNA which may
interfere with the later RNA ligase step. The phosphatase should
then be inactivated and the RNA treated with tobacco acid
pyrophosphatase in order to remove the cap structure present at the
5' ends of messenger RNAs. This reaction leaves a 5' phosphate
group at the 5' end of the cap cleaved RNA which can then be
ligated to an RNA oligonucleotide using T4 RNA ligase.
[1014] This modified RNA preparation is used as a template for
first strand cDNA synthesis using a gene specific oligonucleotide.
The first strand synthesis reaction is used as a template for PCR
amplification of the desired 5' end using a primer specific to the
ligated RNA oligonucleotide and a primer specific to the known
sequence of the gene of interest. The resultant product is then
sequenced and analyzed to confirm that the 5' end sequence belongs
to the desired gene.
Example 2
Isolation of Genomic Clones Corresponding to a Polynucleotide
[1015] A human genomic P1 library (Genomic Systems, Inc.) is
screened by PCR using primers selected for the sequence
corresponding to SEQ ID NO:X according to the method described in
Example 1. (See also, Sambrook.)
Example 3
Tissue Specific Expression Analysis
[1016] The Human Genome Sciences, Inc. (HGS) database is derived
from sequencing tissue and/or disease specific cDNA libraries.
Libraries generated from a particular tissue are selected and the
specific tissue expression pattern of EST groups or assembled
contigs within these libraries is determined by comparison of the
expression patterns of those groups or contigs within the entire
database. ESTs and assembled contigs which show tissue specific
expression are selected.
[1017] The original clone from which the specific EST sequence was
generated, or in the case of an assembled contig, the clone from
which the 5' most EST sequence was generated, is obtained from the
catalogued library of clones and the insert amplified by PCR using
methods known in the art. The PCR product is denatured and then
transferred in 96 or 384 well format to a nylon membrane
(Schleicher and Scheull) generating an array filter of tissue
specific clones. Housekeeping genes, maize genes, and known tissue
specific genes are included on the filters. These targets can be
used in signal normalization and to validate assay sensitivity.
Additional targets are included to monitor probe length and
specificity of hybridization.
[1018] Radioactively labeled hybridization probes are generated by
first strand cDNA synthesis per the manufacturer's instructions
(Life Technologies) from mRNA/RNA samples prepared from the
specific tissue being analyzed (e.g., prostate, prostate cancer,
ovarian, ovarian cancer, etc.). The hybridization probes are
purified by gel exclusion chromatography, quantitated, and
hybridized with the array filters in hybridization bottles at
65.degree. C. overnight. The filters are washed under stringent
conditions and signals are captured using a Fuji
phosphorimager.
[1019] Data is extracted using AIS software and following
background subtraction, signal normalization is performed. This
includes a normalization of filter-wide expression levels between
different experimental runs. Genes that are differentially
expressed in the tissue of interest are identified.
Example 4
Chromosomal Mapping of the Polynucleotides
[1020] An oligonucleotide primer set is designed according to the
sequence at the 5' end of SEQ ID NO:X. This primer preferably spans
about 100 nucleotides. This primer set is then used in a polymerase
chain reaction under the following set of conditions: 30 seconds,
95.degree. C.; 1 minute, 56.degree. C.; 1 minute, 70.degree. C.
This cycle is repeated 32 times followed by one 5 minute cycle at
70.degree. C. Human, mouse, and hamster DNA is used as template in
addition to a somatic cell hybrid panel containing individual
chromosomes or chromosome fragments (Bios, Inc). The reactions are
analyzed on either 8% polyacrylamide gels or 3.5% agarose gels.
Chromosome mapping is determined by the presence of an
approximately 100 bp PCR fragment in the particular somatic cell
hybrid.
Example 5
Bacterial Expression of a Polypeptide
[1021] A polynucleotide encoding a polypeptide of the present
invention is amplified using PCR oligonucleotide primers
corresponding to the 5' and 3' ends of the DNA sequence, as
outlined in Example 1, to synthesize insertion fragments. The
primers used to amplify the cDNA insert should preferably contain
restriction sites, such as BamHI and XbaI, at the 5' end of the
primers in order to clone the amplified product into the expression
vector. For example, BamHI and XbaI correspond to the restriction
enzyme sites on the bacterial expression vector pQE-9. (Qiagen,
Inc., Chatsworth, Calif.). This plasmid vector encodes antibiotic
resistance (Amp.sup.r), a bacterial origin of replication (ori), an
IPTG-regulatable promoter/operator (P/O), a ribosome binding site
(RBS), a 6-histidine tag (6-His), and restriction enzyme cloning
sites.
[1022] The pQE-9 vector is digested with BamHI and XbaI and the
amplified fragment is ligated into the pQE-9 vector maintaining the
reading frame initiated at the bacterial RBS. The ligation mixture
is then used to transform the E. coli strain M15/rep4 (Qiagen,
Inc.) which contains multiple copies of the plasmid pREP4, which
expresses the lacI repressor and also confers kanamycin resistance
(Kan.sup.r). Transformants are identified by their ability to grow
on LB plates and ampicillin/kanamycin resistant colonies are
selected. Plasmid DNA is isolated and confirmed by restriction
analysis.
[1023] Clones containing the desired constructs are grown overnight
(O/N) in liquid culture in LB media supplemented with both Amp (100
ug/ml) and Kan (25 ug/ml). The O/N culture is used to inoculate a
large culture at a ratio of 1:100 to 1:250. The cells are grown to
an optical density 600 (O.D..sup.600) of between 0.4 and 0.6. IPTG
(Isopropyl-B-D-thiogalacto pyranoside) is then added to a final
concentration of 1 mM. IPTG induces by inactivating the lacI
repressor, clearing the P/O leading to increased gene
expression.
[1024] Cells are grown for an extra 3 to 4 hours. Cells are then
harvested by centrifugation (20 mins at 6000.times.g). The cell
pellet is solubilized in the chaotropic agent 6 Molar Guanidine HCl
by stirring for 3-4 hours at 4.degree. C. The cell debris is
removed by centrifugation, and the supernatant containing the
polypeptide is loaded onto a nickel-nitrilo-tri-acetic acid
("Ni-NTA") affinity resin column (available from QIAGEN, Inc.,
supra). Proteins with a 6.times.His tag bind to the Ni-NTA resin
with high affinity and can be purified in a simple one-step
procedure (for details see: The QIAexpressionist (1995) QIAGEN,
Inc., supra).
[1025] Briefly, the supernatant is loaded onto the column in 6 M
guanidine-HCl, pH 8. The column is first washed with 10 volumes of
6 M guanidine-HCl, pH 8, then washed with 10 volumes of 6 M
guanidine-HCl pH 6, and finally the polypeptide is eluted with 6 M
guanidine-HCl, pH 5.
[1026] The purified protein is then renatured by dialyzing it
against phosphate-buffered saline (PBS) or 50 mM Na-acetate, pH 6
buffer plus 200 mM NaCl. Alternatively, the protein can be
successfully refolded while immobilized on the Ni-NTA column. The
recommended conditions are as follows: renature using a linear
6M-1M urea gradient in 500 mM NaCl, 20% glycerol, 20 mM Tris/HCl pH
7.4, containing protease inhibitors. The renaturation should be
performed over a period of 1.5 hours or more. After renaturation
the proteins are eluted by the addition of 250 mM immidazole.
Immidazole is removed by a final dialyzing step against PBS or 50
mM sodium acetate pH 6 buffer plus 200 mM NaCl. The purified
protein is stored at 4.degree. C. or frozen at -80.degree. C.
[1027] In addition to the above expression vector, the present
invention further includes an expression vector, called pHE4a (ATCC
Accession Number 209645, deposited on Feb. 25, 1998) which contains
phage operator and promoter elements operatively linked to a
polynucleotide of the present invention, called pHE4a. (ATCC
Accession Number 209645, deposited on Feb. 25, 1998.) This vector
contains: 1) a neomycinphosphotransferase gene as a selection
marker, 2) an E. coli origin of replication, 3) a T5 phage promoter
sequence, 4) two lac operator sequences, 5) a Shine-Delgamo
sequence, and 6) the lactose operon repressor gene (lacIq). The
origin of replication (oriC) is derived from pUC19 (LTI,
Gaithersburg, Md.). The promoter and operator sequences are made
synthetically.
[1028] DNA can be inserted into the pHE4a by restricting the vector
with NdeI and XbaI, BamHI, XhoI, or Asp718, running the restricted
product on a gel, and isolating the larger fragment (the stuffer
fragment should be about 310 base pairs). The DNA insert is
generated according to the PCR protocol described in Example 1,
using PCR primers having restriction sites for NdeI (5' primer) and
XbaI, BamHI, XhoI, or Asp718 (3' primer). The PCR insert is gel
purified and restricted with compatible enzymes. The insert and
vector are ligated according to standard protocols.
[1029] The engineered vector could easily be substituted in the
above protocol to express protein in a bacterial system.
Example 6
Purification of a Polypeptide from an Inclusion Body
[1030] The following alternative method can be used to purify a
polypeptide expressed in E coli when it is present in the form of
inclusion bodies. Unless otherwise specified, all of the following
steps are conducted at 4-10.degree. C.
[1031] Upon completion of the production phase of the E. coli
fermentation, the cell culture is cooled to 4-10.degree. C. and the
cells harvested by continuous centrifugation at 15,000 rpm (Heraeus
Sepatech). On the basis of the expected yield of protein per unit
weight of cell paste and the amount of purified protein required,
an appropriate amount of cell paste, by weight, is suspended in a
buffer solution containing 100 mM Tris, 50 mM EDTA, pH 7.4. The
cells are dispersed to a homogeneous suspension using a high shear
mixer.
[1032] The cells are then lysed by passing the solution through a
microfluidizer (Microfuidics, Corp. or APV Gaulin, Inc.) twice at
4000-6000 psi. The homogenate is then mixed with NaCl solution to a
final concentration of 0.5 M NaCl, followed by centrifugation at
7000.times.g for 15 min. The resultant pellet is washed again using
0.5M NaCl, 100 mM Tris, 50 mM EDTA, pH 7.4.
[1033] The resulting washed inclusion bodies are solubilized with
1.5 M guanidine hydrochloride (GuHCl) for 2-4 hours. After
7000.times.g centrifugation for 15 min., the pellet is discarded
and the polypeptide containing supernatant is incubated at
4.degree. C. overnight to allow further GuHCl extraction.
[1034] Following high speed centrifugation (30,000.times.g) to
remove insoluble particles, the GuHCl solubilized protein is
refolded by quickly mixing the GuHCl extract with 20 volumes of
buffer containing 50 mM sodium, pH 4.5, 150 mM NaCl, 2 mM EDTA by
vigorous stirring. The refolded diluted protein solution is kept at
4.degree. C. without mixing for 12 hours prior to further
purification steps.
[1035] To clarify the refolded polypeptide solution, a previously
prepared tangential filtration unit equipped with 0.16 .mu.m
membrane filter with appropriate surface area (e.g., Filtron),
equilibrated with 40 mM sodium acetate, pH 6.0 is employed. The
filtered sample is loaded onto a cation exchange resin (e.g., Poros
HS-50, Perseptive Biosystems). The column is washed with 40 mM
sodium acetate, pH 6.0 and eluted with 250 mM, 500 mM, 1000 mM, and
1500 mM NaCl in the same buffer, in a stepwise manner. The
absorbance at 280 nm of the effluent is continuously monitored.
Fractions are collected and further analyzed by SDS-PAGE.
[1036] Fractions containing the polypeptide are then pooled and
mixed with 4 volumes of water. The diluted sample is then loaded
onto a previously prepared set of tandem columns of strong anion
(Poros HQ-50, Perseptive Biosystems) and weak anion (Poros CM-20,
Perseptive Biosystems) exchange resins. The columns are
equilibrated with 40 mM sodium acetate, pH 6.0. Both columns are
washed with 40 mM sodium acetate, pH 6.0, 200 mM NaCl. The CM-20
column is then eluted using a 10 column volume linear gradient
ranging from 0.2 M NaCl, 50 mM sodium acetate, pH 6.0 to 1.0 M
NaCl, 50 mM sodium acetate, pH 6.5. Fractions are collected under
constant A.sub.280 monitoring of the effluent. Fractions containing
the polypeptide (determined, for instance, by 16% SDS-PAGE) are
then pooled.
[1037] The resultant polypeptide should exhibit greater than 95%
purity after the above refolding and purification steps. No major
contaminant bands should be observed from Commassie blue stained
16% SDS-PAGE gel when 5 .mu.g of purified protein is loaded. The
purified protein can also be tested for endotoxin/LPS
contamination, and typically the LPS content is less than 0.1 ng/ml
according to LAL assays.
Example 7
Cloning and Expression of a Polypeptide in a Baculovirus Expression
System
[1038] In this example, the plasmid shuttle vector pA2 is used to
insert a polynucleotide into a baculovirus to express a
polypeptide. This expression vector contains the strong polyhedrin
promoter of the Autographa californica nuclear polyhedrosis virus
(AcMNPV) followed by convenient restriction sites such as BamHI,
Xba I and Asp718. The polyadenylation site of the simian virus 40
("SV40") is used for efficient polyadenylation. For easy selection
of recombinant virus, the plasmid contains the beta-galactosidase
gene from E. coli under control of a weak Drosophila promoter in
the same orientation, followed by the polyadenylation signal of the
polyhedrin gene. The inserted genes are flanked on both sides by
viral sequences for cell-mediated homologous recombination with
wild-type viral DNA to generate a viable virus that express the
cloned polynucleotide.
[1039] Many other baculovirus vectors can be used in place of the
vector above, such as pAc373, pVL941, and pAcIM1, as one skilled in
the art would readily appreciate, as long as the construct provides
appropriately located signals for transcription, translation,
secretion and the like, including a signal peptide and an in-frame
AUG as required. Such vectors are described, for instance, in
Luckow et al., Virology 170:31-39 (1989).
[1040] Specifically, the cDNA sequence contained in the deposited
clone, including the AUG initiation codon, is amplified using the
PCR protocol described in Example 1. If a naturally occurring
signal sequence is used to produce the polypeptide of the present
invention, the pA2 vector does not need a second signal peptide.
Alternatively, the vector can be modified (pA2 GP) to include a
baculovirus leader sequence, using the standard methods described
in Summers et al., "A Manual of Methods for Baculovirus Vectors and
Insect Cell Culture Procedures," Texas Agricultural Experimental
Station Bulletin No. 1555 (1987).
[1041] The amplified fragment is isolated from a 1% agarose gel
using a commercially available kit ("Geneclean," BIO 101 Inc., La
Jolla, Calif.). The fragment then is digested with appropriate
restriction enzymes and again purified on a 1% agarose gel.
[1042] The plasmid is digested with the corresponding restriction
enzymes and optionally, can be dephosphorylated using calf
intestinal phosphatase, using routine procedures known in the art.
The DNA is then isolated from a 1% agarose gel using a commercially
available kit ("Geneclean" BIO 101 Inc., La Jolla, Calif.).
[1043] The fragment and the dephosphorylated plasmid are ligated
together with T4 DNA ligase. E. coli HB101 or other suitable E.
coli hosts such as XL-1 Blue (Stratagene Cloning Systems, La Jolla,
Calif.) cells are transformed with the ligation mixture and spread
on culture plates. Bacteria containing the plasmid are identified
by digesting DNA from individual colonies and analyzing the
digestion product by gel electrophoresis. The sequence of the
cloned fragment is confirmed by DNA sequencing.
[1044] Five .mu.g of a plasmid containing the polynucleotide is
co-transfected with 1.0 .mu.g of a commercially available
linearized baculovirus DNA ("BaculoGold.TM. baculovirus DNA,
Pharmingen, San Diego, Calif.), using the lipofection method
described by Felgner et al., Proc. Natl. Acad. Sci. USA
84:7413-7417 (1987). One .mu.g of BaculoGold.TM. virus DNA and 5
.mu.g of the plasmid are mixed in a sterile well of a microtiter
plate containing 50 .mu.l of serum-free Grace's medium (Life
Technologies Inc., Gaithersburg, Md.). Afterwards, 10 .mu.l
Lipofectin plus 90 .mu.l Grace's medium are added, mixed and
incubated for 15 minutes at room temperature. Then the transfection
mixture is added drop-wise to Sf9 insect cells (ATCC CRL 1711)
seeded in a 35 mm tissue culture plate with 1 ml Grace's medium
without serum. The plate is then incubated for 5 hours at
27.degree. C. The transfection solution is then removed from the
plate and 1 ml of Grace's insect medium supplemented with 10% fetal
calf serum is added. Cultivation is then continued at 27.degree. C.
for four days.
[1045] After four days the supernatant is collected and a plaque
assay is performed, as described by Summers and Smith, supra. An
agarose gel with "Blue Gal" (Life Technologies Inc., Gaithersburg)
is used to allow easy identification and isolation of
gal-expressing clones, which produce blue-stained plaques. (A
detailed description of a "plaque assay" of this type can also be
found in the user's guide for insect cell culture and
baculovirology distributed by Life Technologies Inc., Gaithersburg,
page 9-10.) After appropriate incubation, blue stained plaques are
picked with the tip of a micropipettor (e.g., Eppendorf). The agar
containing the recombinant viruses is then resuspended in a
microcentrifuge tube containing 200 .mu.l of Grace's medium and the
suspension containing the recombinant baculovirus is used to infect
Sf9 cells seeded in 35 mm dishes. Four days later the supernatants
of these culture dishes are harvested and then they are stored at
4.degree. C.
[1046] To verify the expression of the polypeptide, Sf9 cells are
grown in Grace's medium supplemented with 10% heat-inactivated FBS.
The cells are infected with the recombinant baculovirus containing
the polynucleotide at a multiplicity of infection ("MOI") of about
2. If radiolabeled proteins are desired, 6 hours later the medium
is removed and is replaced with SF900 II medium minus methionine
and cysteine (available from Life Technologies Inc., Rockville,
Md.). After 42 hours, 5 .mu.Ci of .sup.35S-methionine and 5 .mu.Ci
.sup.35S-cysteine (available from Amersham) are added. The cells
are further incubated for 16 hours and then are harvested by
centrifugation. The proteins in the supernatant as well as the
intracellular proteins are analyzed by SDS-PAGE followed by
autoradiography (if radiolabeled).
[1047] Microsequencing of the amino acid sequence of the amino
terminus of purified protein may be used to determine the amino
terminal sequence of the produced protein.
Example 8
Expression of a Polypeptide in Mammalian Cells
[1048] The polypeptide of the present invention can be expressed in
a mammalian cell. A typical mammalian expression vector contains a
promoter element, which mediates the initiation of transcription of
mRNA, a protein coding sequence, and signals required for the
termination of transcription and polyadenylation of the transcript.
Additional elements include enhancers, Kozak sequences and
intervening sequences flanked by donor and acceptor sites for RNA
splicing. Highly efficient transcription is achieved with the early
and late promoters from SV40, the long terminal repeats (LTRs) from
Retroviruses, e.g., RSV, HTLVI, HIVI and the early promoter of the
cytomegalovirus (CMV). However, cellular elements can also be used
(e.g., the human actin promoter).
[1049] Suitable expression vectors for use in practicing the
present invention include, for example, vectors such as pSVL and
pMSG (Pharmacia, Uppsala, Sweden), pRSVcat (ATCC 37152), pSV2dhfr
(ATCC 37146), pBC12MI (ATCC 67109), pCMVSport 2.0, and pCMVSport
3.0. Mammalian host cells that could be used include, human Hela,
293, H9 and Jurkat cells, mouse NIH3T3 and C127 cells, Cos 1, Cos 7
and CVI, quail QC1-3 cells, mouse L cells and Chinese hamster ovary
(CHO) cells.
[1050] Alternatively, the polypeptide can be expressed in stable
cell lines containing the polynucleotide integrated into a
chromosome. The co-transfection with a selectable marker such as
DHFR, gpt, neomycin, or hygromycin allows the identification and
isolation of the transfected cells.
[1051] The transfected gene can also be amplified to express large
amounts of the encoded protein. The DHFR (dihydrofolate reductase)
marker is useful in developing cell lines that carry several
hundred or even several thousand copies of the gene of interest.
(See, e.g., Alt, F. W., et al., J. Biol. Chem. 253:1357-1370
(1978); Hamlin, J. L. and Ma, C., Biochem. et Biophys. Acta,
1097:107-143 (1990); Page, M. J. and Sydenham, M. A., Biotechnology
9:64-68 (1991)). Another useful selection marker is the enzyme
glutamine synthase (GS) (Murphy et al., Biochem J. 227:277-279
(1991); Bebbington et al., Bio/Technology 10:169-175 (1992). Using
these markers, the mammalian cells are grown in selective medium
and the cells with the highest resistance are selected. These cell
lines contain the amplified gene(s) integrated into a chromosome.
Chinese hamster ovary (CHO) and NSO cells are often used for the
production of proteins.
[1052] Derivatives of the plasmid pSV2-dhfr (ATCC Accession No.
37146), the expression vectors pC4 (ATCC Accession No. 209646) and
pC6 (ATCC Accession No. 209647) contain the strong promoter (LTR)
of the Rous Sarcoma Virus (Cullen et al., Molecular and Cellular
Biology, 438-447 (March, 1985)) plus a fragment of the CMV-enhancer
(Boshart et al., Cell 41:521-530 (1985)). Multiple cloning sites,
e.g., with the restriction enzyme cleavage sites BamHI, XbaI and
Asp718, facilitate the cloning of the gene of interest. The vectors
also contain the 3' intron, the polyadenylation and termination
signal of the rat preproinsulin gene, and the mouse DHFR gene under
control of the SV40 early promoter.
[1053] Specifically, the plasmid pC6, for example, is digested with
appropriate restriction enzymes and then dephosphorylated using
calf intestinal phosphates by procedures known in the art. The
vector is then isolated from a 1% agarose gel.
[1054] A polynucleotide of the present invention is amplified
according to the protocol outlined in Example 1. If a naturally
occurring signal sequence is used to produce the polypeptide of the
present invention, the vector does not need a second signal
peptide. Alternatively, if a naturally occurring signal sequence is
not used, the vector can be modified to include a heterologous
signal sequence. (See, e.g., International Publication No. WO
96/34891.)
[1055] The amplified fragment is isolated from a 1% agarose gel
using a commercially available kit ("Geneclean," BIO 101 Inc., La
Jolla, Calif.). The fragment then is digested with appropriate
restriction enzymes and again purified on a 1% agarose gel.
[1056] The amplified fragment is then digested with the same
restriction enzyme and purified on a 1% agarose gel. The isolated
fragment and the dephosphorylated vector are then ligated with T4
DNA ligase. E. coli HB101 or XL-1 Blue cells are then transformed
and bacteria are identified that contain the fragment inserted into
plasmid pC6 using, for instance, restriction enzyme analysis.
[1057] Chinese hamster ovary cells lacking an active DHFR gene is
used for transfection. Five .mu.g of the expression plasmid pC6 or
pC4 is cotransfected with 0.5 .mu.g of the plasmid pSVneo using
lipofectin (Felgner et al., supra). The plasmid pSV2-neo contains a
dominant selectable marker, the neo gene from Tn5 encoding an
enzyme that confers resistance to a group of antibiotics including
G418. The cells are seeded in alpha minus MEM supplemented with 1
mg/ml G418. After 2 days, the cells are trypsinized and seeded in
hybridoma cloning plates (Greiner, Germany) in alpha minus MEM
supplemented with 10, 25, or 50 ng/ml of methotrexate plus 1 mg/ml
G418. After about 10-14 days single clones are trypsinized and then
seeded in 6-well petri dishes or 10 ml flasks using different
concentrations of methotrexate (50 n.TM., 100 nM, 200 nM, 400 nM,
800 nM). Clones growing at the highest concentrations of
methotrexate are then transferred to new 6-well plates containing
even higher concentrations of methotrexate (1 .mu.M, 2 .mu.M, 5
.mu.M, 10 mM, 20 mM). The same procedure is repeated until clones
are obtained which grow at a concentration of 100-200 .mu.M.
Expression of the desired gene product is analyzed, for instance,
by SDS-PAGE and Western blot or by reversed phase HPLC
analysis.
Example 9
Protein Fusions
[1058] The polypeptides of the present invention are preferably
fused to other proteins. These fusion proteins can be used for a
variety of applications. For example, fusion of the present
polypeptides to His-tag, HA-tag, protein A, IgG domains, and
maltose binding protein facilitates purification. (See Example 5;
see also EP A 394,827; Traunecker, et al., Nature 331:84-86
(1988)). Similarly, fusion to IgG-1, IgG-3, and albumin increases
the halflife time in vivo. Nuclear localization signals fused to
the polypeptides of the present invention can target the protein to
a specific subcellular localization, while covalent heterodimer or
homodimers can increase or decrease the activity of a fusion
protein. Fusion proteins can also create chimeric molecules having
more than one function. Finally, fusion proteins can increase
solubility and/or stability of the fused protein compared to the
non-fused protein. All of the types of fusion proteins described
above can be made by modifying the following protocol, which
outlines the fusion of a polypeptide to an IgG molecule, or the
protocol described in Example 5.
[1059] Briefly, the human Fc portion of the IgG molecule can be PCR
amplified, using primers that span the 5' and 3' ends of the
sequence described below. These primers also should have convenient
restriction enzyme sites that will facilitate cloning into an
expression vector, preferably a mammalian expression vector.
[1060] For example, if pC4 (ATCC Accession No. 209646) is used, the
human Fc portion can be ligated into the BamHI cloning site. Note
that the 3' BamHI site should be destroyed. Next, the vector
containing the human Fc portion is re-restricted with BamHI,
linearizing the vector, and a polynucleotide of the present
invention, isolated by the PCR protocol described in Example 1, is
ligated into this BamHI site. Note that the polynucleotide is
cloned without a stop codon, otherwise a fusion protein will not be
produced.
[1061] If the naturally occurring signal sequence is used to
produce the polypeptide of the present invention, pC4 does not need
a second signal peptide. Alternatively, if the naturally occurring
signal sequence is not used, the vector can be modified to include
a heterologous signal sequence. (See, e.g., International
Publication No. WO 96/34891.) TABLE-US-00015 Human IgG Fc region:
GGGATCCGGAGCCCAAATCTTCTGACAAAACTCACAC (SEQ ID NO:1)
ATGCCCACCGTGCCCAGCACCTGAATTCGAGGGTGCA
CCGTCAGTCTTCCTCTTCCCCCCAAAACCCAAGGACA
CCCTCATGATCTCCCGGACTCCTGAGGTCACATGCGT
GGTGGTGGACGTAAGCCACGAAGACCCTGAGGTCAAG
TTCAACTGGTACGTGGACGGCGTGGAGGTGCATAATG
CCAAGACAAAGCCGCGGGAGGAGCAGTACAACAGCAC
GTACCGTGTGGTCAGCGTCCTCACCGTCCTGCACCAG
GACTGGCTGAATGGCAAGGAGTACAAGTGCAAGGTCT
CCAACAAAGCCCTCCCAACCCCCATCGAGAAAACCAT
CTCCAAAGCCAAAGGGCAGCCCCGAGAACCACAGGTG
TACACCCTGCCCCCATCCCGGGATGAGCTGACCAAGA
ACCAGGTCAGCCTGACCTGCCTGGTCAAAGGCTTCTA
TCCAAGCGACATCGCCGTGGAGTGGGAGAGCAATGGG
CAGCCGGAGAACAACTACAAGACCACGCCTCCCGTGC
TGGACTCCGACGGCTCCTTCTTCCTCTACAGCAAGCT
CACCGTGGACAAGAGCAGGTGGCAGCAGGGGAACGTC
TTCTCATGCTCCGTGATGCATGAGGCTCTGCACAACC
ACTACACGCAGAAGAGCCTCTCCCTGTCTCCGGGTAA
ATGAGTGCGACGGCCGCGACTCTAGAGGAT
Example 10
Production of an Antibody from a Polypeptide
a) Hybridoma Technology
[1062] The antibodies of the present invention can be prepared by a
variety of methods. (See, Current Protocols, Chapter 2.) As one
example of such methods, cells expressing a polypeptide of the
present invention are administered to an animal to induce the
production of sera containing polyclonal antibodies. In a preferred
method, a preparation of a polypeptide of the present invention is
prepared and purified to render it substantially free of natural
contaminants. Such a preparation is then introduced into an animal
in order to produce polyclonal antisera of greater specific
activity.
[1063] Monoclonal antibodies specific for a polypeptide of the
present invention are prepared using hybridoma technology (Kohler
et al., Nature 256:495 (1975); Kohler et al., Eur. J. Immunol.
6:511 (1976); Kohler et al., Eur. J. Immunol. 6:292 (1976);
Hammerling et al., in: Monoclonal Antibodies and T-Cell Hybridomas,
Elsevier, N.Y., pp. 563-681 (1981)). In general, an animal
(preferably a mouse) is immunized with a polypeptide of the present
invention or, more preferably, with a secreted
polypeptide-expressing cell. Such polypeptide-expressing cells are
cultured in any suitable tissue culture medium, preferably in
Earle's modified Eagle's medium supplemented with 10% fetal bovine
serum (inactivated at about 56.degree. C.), and supplemented with
about 10 g/l of nonessential amino acids, about 1,000 U/ml of
penicillin, and about 100 .mu.g/ml of streptomycin.
[1064] The splenocytes of such mice are extracted and fused with a
suitable myeloma cell line. Any suitable myeloma cell line may be
employed in accordance with the present invention; however, it is
preferable to employ the parent myeloma cell line (SP20), available
from the ATCC. After fusion, the resulting hybridoma cells are
selectively maintained in HAT medium, and then cloned by limiting
dilution as described by Wands et al. (Gastroenterology 80:225-232
(1981)). The hybridoma cells obtained through such a selection are
then assayed to identify clones which secrete antibodies capable of
binding the polypeptide of the present invention.
[1065] Alternatively, additional antibodies capable of binding to a
polypeptide of the present invention can be produced in a two-step
procedure using anti-idiotypic antibodies. Such a method makes use
of the fact that antibodies are themselves antigens, and therefore,
it is possible to obtain an antibody which binds to a second
antibody. In accordance with this method, protein specific
antibodies are used to immunize an animal, preferably a mouse. The
splenocytes of such an animal are then used to produce hybridoma
cells, and the hybridoma cells are screened to identify clones
which produce an antibody whose ability to bind to the
polypeptide-specific antibody can be blocked by said polypeptide.
Such antibodies comprise anti-idiotypic antibodies to the
polypeptide-specific antibody and are used to immunize an animal to
induce formation of further polypeptide-specific antibodies.
[1066] For in vivo use of antibodies in humans, an antibody is
"humanized". Such antibodies can be produced using genetic
constructs derived from hybridoma cells producing the monoclonal
antibodies described above. Methods for producing chimeric and
humanized antibodies are known in the art and are discussed herein.
(See, for review, Morrison, Science 229:1202 (1985); Oi et al.,
BioTechniques 4:214 (1986); Cabilly et al., U.S. Pat. No.
4,816,567; Taniguchi et al., EP 171496; Morrison et al., EP 173494;
Neuberger et al., WO 8601533; Robinson et al., International
Publication No. WO 8702671; Boulianne et al., Nature 312:643
(1984); Neuberger et al., Nature 314:268 (1985)).
B) Isolation of Antibody Fragments Directed Against a Polypeptide
of the Present Invention from a Library of scFvs
[1067] Naturally occurring V-genes isolated from human PBLs are
constructed into a library of antibody fragments which contain
reactivities against a polypeptide of the present invention to
which the donor may or may not have been exposed (see e.g., U.S.
Pat. No. 5,885,793 incorporated herein by reference in its
entirety).
[1068] Rescue of the Library. A library of scFvs is constructed
from the RNA of human PBLs as described in International
Publication No. WO 92/01047. To rescue phage displaying antibody
fragments, approximately 10.sup.9 E. coli harboring the phagemid
are used to inoculate 50 ml of 2.times.TY containing 1% glucose and
100 .mu.g/ml of ampicillin (2.times.TY-AMP-GLU) and grown to an
O.D. of 0.8 with shaking. Five ml of this culture is used to
inoculate 50 ml of 2.times.TY-AMP-GLU, 2.times.108 TU of delta gene
3 helper (M13 delta gene III, see International Publication No. WO
92/01047) are added and the culture incubated at 37.degree. C. for
45 minutes without shaking and then at 37.degree. C. for 45 minutes
with shaking. The culture is centrifuged at 4000 r.p.m. for 10 min.
and the pellet resuspended in 2 liters of 2.times.TY containing 100
.mu.g/ml ampicillin and 50 ug/ml kanamycin and grown overnight.
Phage are prepared as described in International Publication No. WO
92/01047.
[1069] M13 delta gene III is prepared as follows: M13 delta gene
III helper phage does not encode gene III protein, hence the phage
(mid) displaying antibody fragments have a greater avidity of
binding to antigen. Infectious M13 delta gene III particles are
made by growing the helper phage in cells harboring a pUC19
derivative supplying the wild type gene III protein during phage
morphogenesis. The culture is incubated for 1 hour at 37.degree. C.
without shaking and then for a further hour at 37.degree. C. with
shaking. Cells are spun down (IEC-Centra 8,400 r.p.m. for 10 min),
resuspended in 300 ml 2.times.TY broth containing 100 .mu.g
ampicillin/ml and 25 .mu.g kanarnycin/ml (2.times.TY-AMP-KAN) and
grown overnight, shaking at 37.degree. C. Phage particles are
purified and concentrated from the culture medium by two
PEG-precipitations (Sambrook et al., 1990), resuspended in 2 ml PBS
and passed through a 0.45 .mu.m filter (Minisart NML; Sartorius) to
give a final concentration of approximately 10.sup.13 transducing
units/ml (ampicillin-resistant clones).
[1070] Panning of the Library. Immunotubes (Nunc) are coated
overnight in PBS with 4 ml of either 100 .mu.g/ml or 10 .mu.g/ml of
a polypeptide of the present invention. Tubes are blocked with 2%
Marvel-PBS for 2 hours at 37.degree. C. and then washed 3 times in
PBS. Approximately 10.sup.13 TU of phage is applied to the tube and
incubated for 30 minutes at room temperature tumbling on an over
and under turntable and then left to stand for another 1.5 hours.
Tubes are washed 10 times with PBS 0.1% Tween-20 and 10 times with
PBS. Phage are eluted by adding 1 ml of 100 mM triethylamine and
rotating 15 minutes on an under and over turntable after which the
solution is immediately neutralized with 0.5 ml of 11.0M Tris-HCl,
pH 7.4. Phage are then used to infect 10 ml of mid-log E. coli TG1
by incubating eluted phage with bacteria for 30 minutes at
37.degree. C. The E. coli are then plated on TYE plates containing
1% glucose and 100 .mu.g/ml ampicillin. The resulting bacterial
library is then rescued with delta gene 3 helper phage as described
above to prepare phage for a subsequent round of selection. This
process is then repeated for a total of 4 rounds of affinity
purification with tube-washing increased to 20 times with PBS, 0.1%
Tween-20 and 20 times with PBS for rounds 3 and 4.
[1071] Characterization of Binders. Eluted phage from the 3rd and
4th rounds of selection are used to infect E. coli HB 2151 and
soluble scFv is produced (Marks, et al., 1991) from single colonies
for assay. ELISAs are performed with microtitre plates coated with
either 10 pg/ml of the polypeptide of the present invention in 50
mM bicarbonate pH 9.6. Clones positive in ELISA are further
characterized by PCR fingerprinting (see, e.g., International
Publication No. WO 92/01047) and then by sequencing. These ELISA
positive clones may also be further characterized by techniques
known in the art, such as, for example, epitope mapping, binding
affinity, receptor signal transduction, ability to block or
competitively inhibit antibody/antigen binding, and competitive
agonistic or antagonistic activity.
Example 11
Method of Determining Alterations in a Gene Corresponding to a
Polynucleotide
[1072] RNA isolated from entire families or individual patients
presenting with a phenotype of interest (such as a disease) is
isolated. cDNA is then generated from these RNA samples using
protocols known in the art. (See, Sambrook.) The cDNA is then used
as a template for PCR, employing primers surrounding regions of
interest in SEQ ID NO:X; and/or the nucleotide sequence of the cDNA
contained in ATCC Deposit No: Z. Suggested PCR conditions consist
of 35 cycles at 95 degrees C. for 30 seconds; 60-120 seconds at
52-58 degrees C.; and 60-120 seconds at 70 degrees C., using buffer
solutions described in Sidransky et al., Science 252:706
(1991).
[1073] PCR products are then sequenced using primers labeled at
their 5' end with T4 polynucleotide kinase, employing SequiTherm
Polymerase (Epicentre Technologies). The intron-exon boundaries of
selected exons is also determined and genomic PCR products analyzed
to confirm the results. PCR products harboring suspected mutations
are then cloned and sequenced to validate the results of the direct
sequencing.
[1074] PCR products are cloned into T-tailed vectors as described
in Holton et al., Nucleic Acids Research, 19:1156 (1991) and
sequenced with T7 polymerase (United States Biochemical). Affected
individuals are identified by mutations not present in unaffected
individuals.
[1075] Genomic rearrangements are also observed as a method of
determining alterations in a gene corresponding to a
polynucleotide. Genomic clones isolated according to Example 2 are
nick-translated with digoxigenindeoxy-uridine 5'-triphosphate
(Boehringer Manheim), and FISH performed as described in Johnson et
al., Methods Cell Biol. 35:73-99 (1991). Hybridization with the
labeled probe is carried out using a vast excess of human cot-1 DNA
for specific hybridization to the corresponding genomic locus.
[1076] Chromosomes are counterstained with
4,6-diamino-2-phenylidole and propidium iodide, producing a
combination of C- and R-bands. Aligned images for precise mapping
are obtained using a triple-band filter set (Chroma Technology,
Brattleboro, Vt.) in combination with a cooled charge-coupled
device camera (Photometrics, Tucson, Ariz.) and variable excitation
wavelength filters. (Johnson et al., Genet. Anal. Tech. Appl., 8:75
(1991)). Image collection, analysis and chromosomal fractional
length measurements are performed using the ISee Graphical Program
System. (Inovision Corporation, Durham, N.C.) Chromosome
alterations of the genomic region hybridized by the probe are
identified as insertions, deletions, and translocations. These
alterations are used as a diagnostic marker for an associated
disease.
Example 12
Method of Detecting Abnormal Levels of a Polypeptide in a
Biological Sample
[1077] A polypeptide of the present invention can be detected in a
biological sample, and if an increased or decreased level of the
polypeptide is detected, this polypeptide is a marker for a
particular phenotype. Methods of detection are numerous, and thus,
it is understood that one skilled in the art can modify the
following assay to fit their particular needs.
[1078] For example, antibody-sandwich ELISAs are used to detect
polypeptides in a sample, preferably a biological sample. Wells of
a microtiter plate are coated with specific antibodies, at a final
concentration of 0.2 to 10 ug/ml. The antibodies are either
monoclonal or polyclonal and are produced by the method described
in Example 10. The wells are blocked so that non-specific binding
of the polypeptide to the well is reduced.
[1079] The coated wells are then incubated for >2 hours at RT
with a sample containing the polypeptide. Preferably, serial
dilutions of the sample should be used to validate results. The
plates are then washed three times with deionized or distilled
water to remove unbound polypeptide.
[1080] Next, 50 ul of specific antibody-alkaline phosphatase
conjugate, at a concentration of 25-400 ng, is added and incubated
for 2 hours at room temperature. The plates are again washed three
times with deionized or distilled water to remove unbound
conjugate.
[1081] Add 75 ul of 4-methylumbelliferyl phosphate (MUP) or
p-nitrophenyl phosphate (NPP) substrate solution to each well and
incubate 1 hour at room temperature. Measure the reaction by a
microtiter plate reader. Prepare a standard curve, using serial
dilutions of a control sample, and plot polypeptide concentration
on the X-axis (log scale) and fluorescence or absorbance of the
Y-axis (linear scale). Interpolate the concentration of the
polypeptide in the sample using the standard curve.
Example 13
Formulation
[1082] The invention also provides methods of treatment and/or
prevention of diseases or disorders (such as, for example, any one
or more of the diseases or disorders disclosed herein) by
administration to a subject of an effective amount of a
Therapeutic. By therapeutic is meant polynucleotides or
polypeptides of the invention (including fragments and variants),
agonists or antagonists thereof, and/or antibodies thereto, in
combination with a pharmaceutically acceptable carrier type (e.g.,
a sterile carrier).
[1083] The Therapeutic will be formulated and dosed in a fashion
consistent with good medical practice, taking into account the
clinical condition of the individual patient (especially the side
effects of treatment with the Therapeutic alone), the site of
delivery, the method of administration, the scheduling of
administration, and other factors known to practitioners. The
"effective amount" for purposes herein is thus determined by such
considerations.
[1084] As a general proposition, the total pharmaceutically
effective amount of the Therapeutic administered parenterally per
dose will be in the range of about 1 ug/kg/day to 10 mg/kg/day of
patient body weight, although, as noted above, this will be subject
to therapeutic discretion. More preferably, this dose is at least
0.01 mg/kg/day, and most preferably for humans between about 0.01
and 1 mg/kg/day for the hormone. If given continuously, the
Therapeutic is typically administered at a dose rate of about 1
ug/kg/hour to about 50 ug/kg/hour, either by 1-4 injections per day
or by continuous subcutaneous infusions, for example, using a
mini-pump. An intravenous bag solution may also be employed. The
length of treatment needed to observe changes and the interval
following treatment for responses to occur appears to vary
depending on the desired effect.
[1085] Therapeutics can be are administered orally, rectally,
parenterally, intracistemally, intravaginally, intraperitoneally,
topically (as by powders, ointments, gels, drops or transdermal
patch), bucally, or as an oral or nasal spray. "Pharmaceutically
acceptable carrier" refers to a non-toxic solid, semisolid or
liquid filler, diluent, encapsulating material or formulation
auxiliary of any. The term "parenteral" as used herein refers to
modes of administration which include intravenous, intramuscular,
intraperitoneal, intrasternal, subcutaneous and intraarticular
injection and infusion.
[1086] Therapeutics of the invention are also suitably administered
by sustained-release systems. Suitable examples of
sustained-release Therapeutics are administered orally, rectally,
parenterally, intracistemally, intravaginally, intraperitoneally,
topically (as by powders, ointments, gels, drops or transdermal
patch), bucally, or as an oral or nasal spray. "Pharmaceutically
acceptable carrier" refers to a non-toxic solid, semisolid or
liquid filler, diluent, encapsulating material or formulation
auxiliary of any type. The term "parenteral" as used herein refers
to modes of administration which include intravenous,
intramuscular, intraperitoneal, intrasternal, subcutaneous and
intraarticular injection and infusion.
[1087] Therapeutics of the invention are also suitably administered
by sustained-release systems. Suitable examples of
sustained-release Therapeutics include suitable polymeric materials
(such as, for example, semi-permeable polymer matrices in the form
of shaped articles, e.g., films, or mirocapsules), suitable
hydrophobic materials (for example as an emulsion in an acceptable
oil) or ion exchange resins, and sparingly soluble derivatives
(such as, for example, a sparingly soluble salt).
[1088] Sustained-release matrices include polylactides (U.S. Pat.
No. 3,773,919, EP 58,481), copolymers of L-glutamic acid and
gamma-ethyl-L-glutamate (Sidman et al., Biopolymers 22:547-556
(1983)), poly (2-hydroxyethyl methacrylate) (Langer et al., J.
Biomed. Mater. Res. 15:167-277 (1981), and Langer, Chem. Tech.
12:98-105 (1982)), ethylene vinyl acetate (Langer et al., Id.) or
poly-D-(-)-3-hydroxybutyric acid (EP 133,988).
[1089] In a preferred embodiment, polypeptide, polynucleotide, and
antibody compositions of the invention are formulated in a
biodegradable, polymeric drug delivery system, for example as
described in U.S. Pat. Nos. 4,938,763; 5,278,201; 5,278,202;
5,324,519; 5,340,849; and 5,487,897 and in International
Publication Numbers WO01/35929, WO00/24374, and WO00/06117 which
are hereby incorporated by reference in their entirety. In specific
preferred embodiments the polypeptide, polynucleotide, and antibody
compositions of the invention are formulated using the ATRIGEL.RTM.
Biodegradable System of Atrix Laboratories, Inc. (Fort Collins,
Colo.).
[1090] Examples of biodegradable polymers which can be used in the
formulation of polypeptide, polynucleotide, and antibody
compositions, include but are not limited to, polylactides,
polyglycolides, polycaprolactones, polyanhydrides, polyamides,
polyurethanes, polyesteramides, polyorthoesters, polydioxanones,
polyacetals, polyketals, polycarbonates, polyorthocarbonates,
polyphosphazenes, polyhydroxybutyrates, polyhydroxyvalerates,
polyalkylene oxalates, polyalkylene succinates, poly(malic acid),
poly(amino acids), poly(methyl vinyl ether), poly(maleic
anhydride), polyvinylpyrrolidone, polyethylene glycol,
polyhydroxycellulose, chitin, chitosan, and copolymers,
terpolymers, or combinations or mixtures of the above materials.
The preferred polymers are those that have a lower degree of
crystallization and are more hydrophobic. These polymers and
copolymers are more soluble in the biocompatible solvents than the
highly crystalline polymers such as polyglycolide and chitin which
also have a high degree of hydrogen-bonding. Preferred materials
with the desired solubility parameters are the polylactides,
polycaprolactones, and copolymers of these with glycolide in which
there are more amorphous regions to enhance solubility. In specific
preferred embodiments, the biodegradable polymers which can be used
in the formulation of polypeptide, polynucleotide, and antibody
compositions are poly(lactide-co-glycolides). Polymer properties
such as molecular weight, hydrophobicity, and lactide/glycolide
ratio may be modified to obtain the desired polypeptide,
polynucleotide, or antibody release profile (See, e.g., Ravivarapu
et al., Journal of Pharmaceutical Sciences 89:732-741 (2000), which
is hereby incorporated by reference in its entirety).
[1091] It is also preferred that the solvent for the biodegradable
polymer be non-toxic, water miscible, and otherwise biocompatible.
Examples of such solvents include, but are not limited to,
N-methyl-2-pyrrolidone, 2-pyrrolidone, C2 to C6 alkanols, C1 to C15
alchohols, dils, triols, and tetraols such as ethanol, glycerine
propylene glycol, butanol; C3 to C15 alkyl ketones such as acetone,
diethyl ketone and methyl ethyl ketone; C3 to C15 esters such as
methyl acetate, ethyl acetate, ethyl lactate; alkyl ketones such as
methyl ethyl ketone, C1 to C15 amides such as dimethylformamide,
dimethylacetamide and caprolactam; C3 to C20 ethers such as
tetrahydrofuran, or solketal; tweens, triacetin, propylene
carbonate, decylmethylsulfoxide, dimethyl sulfoxide, oleic acid,
1-dodecylazacycloheptan-2-one, Other preferred solvents are benzyl
alchohol, benzyl benzoate, dipropylene glycol, tributyrin, ethyl
oleate, glycerin, glycofural, isopropyl myristate, isopropyl
palmitate, oleic acid, polyethylene glycol, propylene carbonate,
and triethyl citrate. The most preferred solvents are
N-methyl-2-pyrrolidone, 2-pyrrolidone, dimethyl sulfoxide,
triacetin, and propylene carbonate because of the solvating ability
and their compatibility.
[1092] Additionally, formulations comprising polypeptide,
polynucleotide, and antibody compositions and a biodegradable
polymer may also include release-rate modification agents and/or
pore-forming agents. Examples of release-rate modification agents
include, but are not limited to, fatty acids, triglycerides, other
like hydrophobic compounds, organic solvents, plasticizing
compounds and hydrophilic compounds. Suitable release rate
modification agents include, for example, esters of mono-, di-, and
tricarboxylic acids, such as 2-ethoxyethyl acetate, methyl acetate,
ethyl acetate, diethyl phthalate, dimethyl phthalate, dibutyl
phthalate, dimethyl adipate, dimethyl succinate, dimethyl oxalate,
dimethyl citrate, triethyl citrate, acetyl tributyl citrate, acetyl
triethyl citrate, glycerol triacetate, di(n-butyl) sebecate, and
the like; polyhydroxy alcohols, such as propylene glycol,
polyethylene glycol, glycerin, sorbitol, and the like; fatty acids;
triesters of glycerol, such as triglycerides, epoxidized soybean
oil, and other epoxidized vegetable oils; sterols, such as
cholesterol; alcohols, such as C.sub.6-C.sub.12 alkanols,
2-ethoxyethanol. The release rate modification agent may be used
singly or in combination with other such agents. Suitable
combinations of release rate modification agents include, but are
not limited to, glycerin/propylene glycol, sorbitol/glycerine,
ethylene oxide/propylene oxide, butylene glycol/adipic acid, and
the like. Preferred release rate modification agents include, but
are not limited to, dimethyl citrate, triethyl citrate, ethyl
heptanoate, glycerin, and hexanediol. Suitable pore-forming agents
that may be used in the polymer composition include, but are not
limited to, sugars such as sucrose and dextrose, salts such as
sodium chloride and sodium carbonate, polymers such as
hydroxylpropylcellulose, carboxymethylcellulose, polyethylene
glycol, and polyvinylpyrrolidone. Solid crystals that will provide
a defined pore size, such as salt or sugar, are preferred.
[1093] In specific preferred embodiments the polypeptide,
polynucleotide, and antibody compositions of the invention are
formulated using the BEMA.TM. BioErodible Mucoadhesive System,
MCA.TM. MucoCutaneous Absorption System, SMP.TM. Solvent
MicroParticle System, or BCP.TM. BioCompatible Polymer System of
Atrix Laboratories, Inc. (Fort Collins, Colo.).
[1094] Sustained-release Therapeutics also include liposomally
entrapped Therapeutics of the invention (see generally, Langer,
Science 249:1527-1533 (1990); Treat et al., in Liposomes in the
Therapy of Infectious Disease and Cancer, Lopez-Berestein and
Fidler (eds.), Liss, New York, pp. 317-327 and 353-365 (1989)).
Liposomes containing the Therapeutic are prepared by methods known
per se: DE 3,218,121; Epstein et al., Proc. Natl. Acad. Sci. (USA)
82:3688-3692 (1985); Hwang et al., Proc. Natl. Acad. Sci. (USA)
77:4030-4034 (1980); EP 52,322; EP 36,676; EP 88,046; EP 143,949;
EP 142,641; Japanese Pat. Appl. 83-118008; U.S. Pat. Nos. 4,485,045
and 4,544,545; and EP 102,324. Ordinarily, the liposomes are of the
small (about 200-800 Angstroms) unilamellar type in which the lipid
content is greater than about 30 mol. percent cholesterol, the
selected proportion being adjusted for the optimal Therapeutic.
[1095] In yet an additional embodiment, the Therapeutics of the
invention are delivered by way of a pump (see Langer, supra;
Sefton, CRC Crit. Ref. Biomed. Eng. 14:201 (1987); Buchwald et al.,
Surgery 88:507 (1980); Saudek et al., N. Engl. J. Med. 321:574
(1989)).
[1096] Other controlled release systems are discussed in the review
by Langer (Science 249:1527-1533 (1990)).
[1097] For parenteral administration, in one embodiment, the
Therapeutic is formulated generally by mixing it at the desired
degree of purity, in a unit dosage injectable form (solution,
suspension, or emulsion), with a pharmaceutically acceptable
carrier, i.e., one that is non-toxic to recipients at the dosages
and concentrations employed and is compatible with other
ingredients of the formulation. For example, the formulation
preferably does not include oxidizing agents and other compounds
that are known to be deleterious to the Therapeutic.
[1098] Generally, the formulations are prepared by contacting the
Therapeutic uniformly and intimately with liquid carriers or finely
divided solid carriers or both. Then, if necessary, the product is
shaped into the desired formulation. Preferably the carrier is a
parenteral carrier, more preferably a solution that is isotonic
with the blood of the recipient. Examples of such carrier vehicles
include water, saline, Ringer's solution, and dextrose solution.
Non-aqueous vehicles such as fixed oils and ethyl oleate are also
useful herein, as well as liposomes.
[1099] The carrier suitably contains minor amounts of additives
such as substances that enhance isotonicity and chemical stability.
Such materials are non-toxic to recipients at the dosages and
concentrations employed, and include buffers such as phosphate,
citrate, succinate, acetic acid, and other organic acids or their
salts; antioxidants such as ascorbic acid; low molecular weight
(less than about ten residues) polypeptides, e.g., polyarginine or
tripeptides; proteins, such as serum albumin, gelatin, or
immunoglobulins; hydrophilic polymers such as polyvinylpyrrolidone;
amino acids, such as glycine, glutamic acid, aspartic acid, or
arginine; monosaccharides, disaccharides, and other carbohydrates
including cellulose or its derivatives, glucose, manose, or
dextrins; chelating agents such as EDTA; sugar alcohols such as
mannitol or sorbitol; counterions such as sodium; and/or nonionic
surfactants such as polysorbates, poloxamers, or PEG.
[1100] The Therapeutic is typically formulated in such vehicles at
a concentration of about 0.1 mg/ml to 100 mg/ml, preferably 1-10
mg/ml, at a pH of about 3 to 8. It will be understood that the use
of certain of the foregoing excipients, carriers, or stabilizers
will result in the formation of polypeptide salts.
[1101] Any pharmaceutical used for therapeutic administration can
be sterile. Sterility is readily accomplished by filtration through
sterile filtration membranes (e.g., 0.2 micron membranes).
Therapeutics generally are placed into a container having a sterile
access port, for example, an intravenous solution bag or vial
having a stopper pierceable by a hypodermic injection needle.
[1102] Therapeutics ordinarily will be stored in unit or multi-dose
containers, for example, sealed ampoules or vials, as an aqueous
solution or as a lyophilized formulation for reconstitution. As an
example of a lyophilized formulation, 10-ml vials are filled with 5
ml of sterile-filtered 1% (w/v) aqueous Therapeutic solution, and
the resulting mixture is lyophilized. The infusion solution is
prepared by reconstituting the lyophilized Therapeutic using
bacteriostatic Water-for-Injection.
[1103] The invention also provides a pharmaceutical pack or kit
comprising one or more containers filled with one or more of the
ingredients of the Therapeutics of the invention. Associated with
such container(s) can be a notice in the form prescribed by a
governmental agency regulating the manufacture, use or sale of
pharmaceuticals or biological products, which notice reflects
approval by the agency of manufacture, use or sale for human
administration. In addition, the Therapeutics may be employed in
conjunction with other therapeutic compounds.
[1104] The Therapeutics of the invention may be administered alone
or in combination with adjuvants. Adjuvants that may be
administered with the Therapeutics of the invention include, but
are not limited to, alum, alum plus deoxycholate (ImmunoAg), MTP-PE
(Biocine Corp.), QS21 (Genentech, Inc.), BCG (e.g., THERACYS.RTM.),
MPL and nonviable prepartions of Corynebacterium parvum. In a
specific embodiment, Therapeutics of the invention are administered
in combination with alum. In another specific embodiment,
Therapeutics of the invention are administered in combination with
QS-21. Further adjuvants that may be administered with the
Therapeutics of the invention include, but are not limited to,
Monophosphoryl lipid immunomodulator, AdjuVax 100a, QS-21, QS-18,
CRL1005, Aluminum salts, MF-59, and Virosomal adjuvant technology.
Vaccines that may be administered with the Therapeutics of the
invention include, but are not limited to, vaccines directed toward
protection against MMR (measles, mumps, rubella), polio, varicella,
tetanus/diptheria, hepatitis A, hepatitis B, haemophilus influenzae
B, whooping cough, pneumonia, influenza, Lyme's Disease, rotavirus,
cholera, yellow fever, Japanese encephalitis, poliomyelitis,
rabies, typhoid fever, and pertussis. Combinations may be
administered either concomitantly, e.g., as an admixture,
separately but simultaneously or concurrently; or sequentially.
This includes presentations in which the combined agents are
administered together as a therapeutic mixture, and also procedures
in which the combined agents are administered separately but
simultaneously, e.g., as through separate intravenous lines into
the same individual. Administration "in combination" further
includes the separate administration of one of the compounds or
agents given first, followed by the second.
[1105] The Therapeutics of the invention may be administered alone
or in combination with other therapeutic agents. Therapeutic agents
that may be administered in combination with the Therapeutics of
the invention, include but not limited to, chemotherapeutic agents,
antibiotics, steroidal and non-steroidal anti-inflammatories,
conventional immunotherapeutic agents, and/or therapeutic
treatments described below. Combinations may be administered either
concomitantly, e.g., as an admixture, separately but simultaneously
or concurrently; or sequentially. This includes presentations in
which the combined agents are administered together as a
therapeutic mixture, and also procedures in which the combined
agents are administered separately but simultaneously, e.g., as
through separate intravenous lines into the same individual.
Administration "in combination" further includes the separate
administration of one of the compounds or agents given first,
followed by the second.
[1106] In one embodiment, the Therapeutics of the invention are
administered in combination with an anticoagulant. Anticoagulants
that may be administered with the compositions of the invention
include, but are not limited to, heparin, low molecular weight
heparin, warfarin sodium (e.g., COUMADIN.RTM.), dicumarol,
4-hydroxycoumarin, anisindione (e.g., MIRADON.TM.), acenocoumarol
(e.g., nicoumalone, SINTHROME.TM.), indan-1,3-dione, phenprocoumon
(e.g., MARCUMAR.TM.), ethyl biscoumacetate (e.g., TROMEXAN.TM.),
and aspirin. In a specific embodiment, compositions of the
invention are administered in combination with heparin and/or
warfarin. In another specific embodiment, compositions of the
invention are administered in combination with warfarin. In another
specific embodiment, compositions of the invention are administered
in combination with warfarin and aspirin. In another specific
embodiment, compositions of the invention are administered in
combination with heparin. In another specific embodiment,
compositions of the invention are administered in combination with
heparin and aspirin.
[1107] In another embodiment, the Therapeutics of the invention are
administered in combination with thrombolytic drugs. Thrombolytic
drugs that may be administered with the compositions of the
invention include, but are not limited to, plasminogen,
lys-plasminogen, alpha2-antiplasmin, streptokinae (e.g.,
KABIKINASE.TM.), antiresplace (e.g., EMINASE.TM.), tissue
plasminogen activator (t-PA, altevase, ACTIVASE.TM.), urokinase
(e.g., ABBOKINASE.TM.), sauruplase, (Prourokinase, single chain
urokinase), and aminocaproic acid (e.g., AMICAR.TM.). In a specific
embodiment, compositions of the invention are administered in
combination with tissue plasminogen activator and aspirin.
[1108] In another embodiment, the Therapeutics of the invention are
administered in combination with antiplatelet drugs. Antiplatelet
drugs that may be administered with the compositions of the
invention include, but are not limited to, aspirin, dipyridamole
(e.g., PERSANTINE.TM.), and ticlopidine (e.g., TICLID.TM.).
[1109] In specific embodiments, the use of anti-coagulants,
thrombolytic and/or antiplatelet drugs in combination with
Therapeutics of the invention is contemplated for the prevention,
diagnosis, and/or treatment of thrombosis, arterial thrombosis,
venous thrombosis, thromboembolism, pulmonary embolism,
atherosclerosis, myocardial infarction, transient ischemic attack,
unstable angina. In specific embodiments, the use of
anticoagulants, thrombolytic drugs and/or antiplatelet drugs in
combination with Therapeutics of the invention is contemplated for
the prevention of occulsion of saphenous grafts, for reducing the
risk of periprocedural thrombosis as might accompany angioplasty
procedures, for reducing the risk of stroke in patients with atrial
fibrillation including nonrheumatic atrial fibrillation, for
reducing the risk of embolism associated with mechanical heart
valves and or mitral valves disease. Other uses for the
therapeutics of the invention, alone or in combination with
antiplatelet, anticoagulant, and/or thrombolytic drugs, include,
but are not limited to, the prevention of occlusions in
extracorporeal devices (e.g., intravascular canulas, vascular
access shunts in hemodialysis patients, hemodialysis machines, and
cardiopulmonary bypass machines).
[1110] In certain embodiments, Therapeutics of the invention are
administered in combination with antiretroviral agents,
nucleoside/nucleotide reverse transcriptase inhibitors (NRTIs),
non-nucleoside reverse transcriptase inhibitors (NNRTIs), and/or
protease inhibitors (PIs). NRTIs that may be administered in
combination with the Therapeutics of the invention, include, but
are not limited to, RETROVIR.TM. (zidovudine/AZT), VIDEX.TM.
(didanosine/ddI), HIVID.TM. (zalcitabine/ddC), ZERIT.TM.
(stavudine/d4T), EPIVIR.TM. (larnivudine/3TC), and COMBIVIR.TM.
(zidovudine/lamivudine). NNRTIs that may be administered in
combination with the Therapeutics of the invention, include, but
are not limited to, VIRAMUNE.TM. (nevirapine), RESCRIPTOR.TM.
(delavirdine), and SUSTIVA.TM. (efavirenz). Protease inhibitors
that may be administered in combination with the Therapeutics of
the invention, include, but are not limited to, CRIXIVAN.TM.
(indinavir), NORVIR.TM. (ritonavir), INVIRASE.TM. (saquinavir), and
VICEPT.TM. (nelfinavir). In a specific embodiment, antiretroviral
agents, nucleoside reverse transcriptase inhibitors, non-nucleoside
reverse transcriptase inhibitors, and/or protease inhibitors may be
used in any combination with Therapeutics of the invention to treat
AIDS and/or to prevent or treat HIV infection.
[1111] Additional NRTIs include LODENOSINE.TM. (F-ddA; an
acid-stable adenosine NRTI; Triangle/Abbott; COVIRACIL.TM.
(emtricitabine/FTC; structurally related to lamivudine (3TC) but
with 3- to 10-fold greater activity in vitro; Triangle/Abbott);
dOTC (BCH-10652, also structurally related to lamivudine but
retains activity against a substantial proportion of
lamivudine-resistant isolates; Biochem Pharma); Adefovir (refused
approval for anti-HIV therapy by FDA; Gilead Sciences);
PREVEON.RTM. (Adefovir Dipivoxil, the active prodrug of adefovir;
its active form is PMEA-pp); TENOFOVIR.TM. (bis-POC PMPA, a PMPA
prodrug; Gilead); DAPD/DXG (active metabolite of DAPD;
Triangle/Abbott); D-D4FC (related to 3TC, with activity against
AZT/3TC-resistant virus); GW420867X (Glaxo Wellcome); ZIAGEN.TM.
(abacavir/159 U89; Glaxo Wellcome Inc.); CS-87
(3'azido-2',3'-dideoxyuridine; WO 99/66936); and S-acyl-2-thioethyl
(SATE)-bearing prodrug forms of .beta.-L-FD4C and .beta.-L-FddC (WO
98/17281).
[1112] Additional NNRTIs include COACTINON.TM. (Emivirine/MKC-442,
potent NNRTI of the HEPT class; Triangle/Abbott); CAPRAVIRINE.TM.
(AG-1549/S-1153, a next generation NNRTI with activity against
viruses containing the K103N mutation, Agouron); PNU-142721 (has
20- to 50-fold greater activity than its predecessor delavirdine
and is active against K103N mutants; Pharmacia & Upjohn);
DPC-961 and DPC-963 (second-generation derivatives of efavirenz,
designed to be active against viruses with the K103N mutation;
DuPont); GW-420867.times. (has 25-fold greater activity than HBY097
and is active against K103N mutants; Glaxo Wellcome); CALANOLIDE A
(naturally occurring agent from the latex tree; active against
viruses containing either or both the Y181C and K103N mutations);
and Propolis (WO 99/49830).
[1113] Additional protease inhibitors include LOPINAVIR.TM.
(ABT378/r; Abbott Laboratories); BMS-232632 (an azapeptide;
Bristol-Myres Squibb); TIPRANAVIR.TM. (PNU-140690, a non-peptic
dihydropyrone; Pharmacia & Upjohn); PD-178390 (a nonpeptidic
dihydropyrone; Parke-Davis); BMS 232632 (an azapeptide;
Bristol-Myers Squibb); L-756,423 (an indinavir analog; Merck);
DMP-450 (a cyclic urea compound; Avid & DuPont); AG-1776 (a
peptidomimetic with in vitro activity against protease
inhibitor-resistant viruses; Agouron); VX-175/GW-433908 (phosphate
prodrug of amprenavir; Vertex & Glaxo Welcome); CGP61755
(Ciba); and AGENERASE.TM. (amprenavir; Glaxo Wellcome Inc.).
[1114] Additional antiretroviral agents include fusion
inhibitors/gp41 binders. Fusion inhibitors/gp41 binders include
T-20 (a peptide from residues 643-678 of the HIV gp41 transmembrane
protein ectodomain which binds to gp41 in its resting state and
prevents transformation to the fusogenic state; Trimeris) and
T-1249 (a second-generation fusion inhibitor; Trimeris).
[1115] Additional antiretroviral agents include fusion
inhibitors/chemokine receptor antagonists. Fusion
inhibitors/chemokine receptor antagonists include CXCR4 antagonists
such as AMD 3100 (a bicyclam), SDF-1 and its analogs, and ALX40-4C
(a cationic peptide), T22 (an 18 amino acid peptide; Trimeris) and
the T22 analogs T134 and T140; CCR5 antagonists such as RANTES
(9-68), AOP-RANTES, NNY-RANTES, and TAK-779; and CCR5/CXCR4
antagonists such as NSC 651016 (a distamycin analog). Also included
are CCR2B, CCR3, and CCR6 antagonists. Chemokine recpetor agonists
such as RANTES, SDF-1, MIP-1.alpha., MIP-1.beta., etc., may also
inhibit fusion.
[1116] Additional antiretroviral agents include integrase
inhibitors. Integrase inhibitors include dicaffeoylquinic (DFQA)
acids; L-chicoric acid (a dicaffeoyltartaric (DCTA) acid);
quinalizarin (QLC) and related anthraquinones; ZINTEVIR.TM. (AR
177, an oligonucleotide that probably acts at cell surface rather
than being a true integrase inhibitor; Arondex); and naphthols such
as those disclosed in WO 98/50347.
[1117] Additional antiretroviral agents include hydroxyurea-like
compounds such as BCX-34 (a purine nucleoside phosphorylase
inhibitor; Biocryst); ribonucleotide reductase inhibitors such as
DIDOX.TM. (Molecules for Health); inosine monophosphate
dehydrogenase (IMPDH) inhibitors sucha as VX-497 (Vertex); and
mycopholic acids such as CellCept (mycophenolate mofetil;
Roche).
[1118] Additional antiretroviral agents include inhibitors of viral
integrase, inhibitors of viral genome nuclear translocation such as
arylene bis(methylketone) compounds; inhibitors of HIV entry such
as AOP-RANTES, NNY-RANTES, RANTES-IgG fusion protein, soluble
complexes of RANTES and glycosaminoglycans (GAG), and AMD-3100;
nucleocapsid zinc finger inhibitors such as dithiane compounds;
targets of HIV Tat and Rev; and pharmacoenhancers such as
ABT-378.
[1119] Other antiretroviral therapies and adjunct therapies include
cytokines and lymphokines such as MIP-1.alpha., MIP-1.beta.,
SDF-1.alpha., IL-2, PROLEUKIN.TM. (aldesleukin/L2-7001; Chiron),
IL-4, IL-10, IL-12, and IL-13; interferons such as IFN-.alpha.2a;
antagonists of TNFs, NF.kappa.B, GM-CSF, M-CSF, and IL-10; agents
that modulate immune activation such as cyclosporin and prednisone;
vaccines such as Remune.TM. (HIV Immunogen), APL 400-003 (Apollon),
recombinant gp120 and fragments, bivalent (B/E) recombinant
envelope glycoprotein, rgp120CM235, MN rgp120, SF-2 rgp120,
gp120/soluble CD4 complex, Delta JR-FL protein, branched synthetic
peptide derived from discontinuous gp120 C3/C4 domain,
fusion-competent immunogens, and Gag, Pol, Nef, and Tat vaccines;
gene-based therapies such as genetic suppressor elements (GSEs; WO
98/54366), and intrakines (genetically modified CC chemokines
targetted to the ER to block surface expression of newly
synthesized CCR5 (Yang et al., PNAS 94:11567-72 (1997); Chen et
al., Nat. Med. 3:1110-16 (1997)); antibodies such as the anti-CXCR4
antibody 12G5, the anti-CCR5 antibodies 2D7, 5C7, PA8, PA9, PA10,
PA11, PA12, and PA14, the anti-CD4 antibodies Q4120 and RPA-T4, the
anti-CCR3 antibody 7B11, the anti-gp120 antibodies 17b, 48d,
447-52D, 257-D, 268-D and 50.1, anti-Tat antibodies,
anti-TNF-.alpha. antibodies, and monoclonal antibody 33A; aryl
hydrocarbon (AH) receptor agonists and antagonists such as TCDD,
3,3',4,4',5-pentachlorobiphenyl, 3,3',4,4'-tetrachlorobiphenyl, and
.alpha.-naphthoflavone (WO 98/30213); and antioxidants such as
.gamma.-L-glutamyl-L-cysteine ethyl ester (.gamma.-GCE; WO
99/56764).
[1120] In a further embodiment, the Therapeutics of the invention
are administered in combination with an antiviral agent. Antiviral
agents that may be administered with the Therapeutics of the
invention include, but are not limited to, acyclovir, ribavirin,
amantadine, and remantidine.
[1121] In other embodiments, Therapeutics of the invention may be
administered in combination with anti-opportunistic infection
agents. Anti-opportunistic agents that may be administered in
combination with the Therapeutics of the invention, include, but
are not limited to, TRIMETHOPRIM-SULFAMETHOXAZOLE.TM., DAPSONE.TM.,
PENTAMIDINE.TM., ATOVAQUONE.TM., ISONIAZID.TM., RIFAMPIN.TM.,
PYRAZINAMIDE.TM., ETHAMBUTOL.TM., RIFABUTIN.TM.,
CLARITHROMYCIN.TM., AZITHROMYCIN.TM., GANCICLOVIR.TM.,
FOSCARNET.TM., CIDOFOVIR.TM., FLUCONAZOLE.TM., ITRACONAZOLE.TM.,
KETOCONAZOLE.TM., ACYCLOVIR.TM., FAMCICOLVIR.TM.,
PYRIMETHAMINE.TM., LEUCOVORIN.TM., NEUPOGEN.TM. (filgrastim/G-CSF),
and LEUKINE.TM. (sargramostim/GM-CSF). In a specific embodiment,
Therapeutics of the invention are used in any combination with
TRIMETHOPRIM-SULFAMETHOXAZOLE.TM., DAPSONE.TM., PENTAMIDINE.TM.,
and/or ATOVAQUONE.TM. to prophylactically treat or prevent an
opportunistic Pneumocystis carinii pneumonia infection. In another
specific embodiment, Therapeutics of the invention are used in any
combination with ISONIAZID.TM., RIFAMPIN.TM., PYRAZINAMIDE.TM.,
and/or ETHAMBUTOL.TM. to prophylactically treat or prevent an
opportunistic Mycobacterium avium complex infection. In another
specific embodiment, Therapeutics of the invention are used in any
combination with RIFABUTIN.TM., CLARITHROMYCIN.TM., and/or
AZITHROMYCIN.TM. to prophylactically treat or prevent an
opportunistic Mycobacterium tuberculosis infection. In another
specific embodiment, Therapeutics of the invention are used in any
combination with GANCICLOVIR.TM., FOSCARNET.TM., and/or
CIDOFOVIR.TM. to prophylactically treat or prevent an opportunistic
cytomegalovirus infection. In another specific embodiment,
Therapeutics of the invention are used in any combination with
FLUCONAZOLE.TM., ITRACONAZOLE.TM., and/or KETOCONAZOLE.TM. to
prophylactically treat or prevent an opportunistic fungal
infection. In another specific embodiment, Therapeutics of the
invention are used in any combination with ACYCLOVIR.TM. and/or
FAMCICOLVIR.TM. to prophylactically treat or prevent an
opportunistic herpes simplex virus type I and/or type II infection.
In another specific embodiment, Therapeutics of the invention are
used in any combination with PYRIMETHAMINE.TM. and/or
LEUCOVORIN.TM. to prophylactically treat or prevent an
opportunistic Toxoplasma gondii infection. In another specific
embodiment, Therapeutics of the invention are used in any
combination with LEUCOVORIN.TM. and/or NEUPOGEN.TM. to
prophylactically treat or prevent an opportunistic bacterial
infection.
[1122] In a further embodiment, the Therapeutics of the invention
are administered in combination with an antibiotic agent.
Antibiotic agents that may be administered with the Therapeutics of
the invention include, but are not limited to, amoxicillin,
beta-lactamases, aminoglycosides, beta-lactam (glycopeptide),
beta-lactamases, Clindamycin, chloramphenicol, cephalosporins,
ciprofloxacin, erythromycin, fluoroquinolones, macrolides,
metronidazole, penicillins, quinolones, rapamycin, rifampin,
streptomycin, sulfonamide, tetracyclines, trimethoprim,
trimethoprim-sulfamethoxazole, and vancomycin.
[1123] In other embodiments, the Therapeutics of the invention are
administered in combination with immunestimulants. Immunostimulants
that may be administered in combination with the Therapeutics of
the invention include, but are not limited to, levamisole (e.g.,
ERGAMISOL.TM.), isoprinosine (e.g. INOSIPLEX.TM.), interferons
(e.g. interferon alpha), and interleukins (e.g., IL-2).
[1124] In other embodiments, Therapeutics of the invention are
administered in combination with immunosuppressive agents.
Immunosuppressive agents that may be administered in combination
with the Therapeutics of the invention include, but are not limited
to, steroids, cyclosporine, cyclosporine analogs, cyclophosphamide
methylprednisone, prednisone, azathioprine, FK-506,
15-deoxyspergualin, and other immunosuppressive agents that act by
suppressing the function of responding T cells. Other
immunosuppressive agents that may be administered in combination
with the Therapeutics of the invention include, but are not limited
to, prednisolone, methotrexate, thalidomide, methoxsalen,
rapamycin, leflunomide, mizoribine (BREDININ.TM.), brequinar,
deoxyspergualin, and azaspirane (SKF 105685), ORTHOCLONE OKT.RTM. 3
(muromonab-CD3), SANDIMMUNE.TM., NEORAL.TM., SANGDYA.TM.
(cyclosporine), PROGRAF.RTM. (FK506, tacrolimus), CELLCEPT.RTM.
(mycophenolate motefil, of which the active metabolite is
mycophenolic acid), IMURAN.TM. (azathioprine),
glucocorticosteroids, adrenocortical steroids such as DELTASONE.TM.
(prednisone) and HYDELTRASOL.TM. (prednisolone), FOLEX.TM. and
MEXATE.TM. (methotrxate), OXSORALEN-ULTRA.TM. (methoxsalen) and
RAPAMUNE.TM. (sirolimus). In a specific embodiment,
immunosuppressants may be used to prevent rejection of organ or
bone marrow transplantation.
[1125] In an additional embodiment, Therapeutics of the invention
are administered alone or in combination with one or more
intravenous immune globulin preparations. Intravenous immune
globulin preparations that may be administered with the
Therapeutics of the invention include, but not limited to,
GAMMAR.TM., IVEEGAM.TM., SANDOGLOBULIN.TM., GAMMAGARD S/D.TM.,
ATGAM.TM. (antithymocyte glubulin), and GAMIMUNE.TM.. In a specific
embodiment, Therapeutics of the invention are administered in
combination with intravenous immune globulin preparations in
transplantation therapy (e.g., bone marrow transplant).
[1126] In certain embodiments, the Therapeutics of the invention
are administered alone or in combination with an anti-inflammatory
agent. Anti-inflammatory agents that may be administered with the
Therapeutics of the invention include, but are not limited to,
corticosteroids (e.g. betamethasone, budesonide, cortisone,
dexamethasone, hydrocortisone, methylprednisolone, prednisolone,
prednisone, and triamcinolone), nonsteroidal anti-inflammatory
drugs (e.g., diclofenac, diflunisal, etodolac, fenoprofen,
floctafenine, flurbiprofen, ibuprofen, indomethacin, ketoprofen,
meclofenamate, mefenamic acid, meloxicam, nabumetone, naproxen,
oxaprozin, phenylbutazone, piroxicam, sulindac, tenoxicam,
tiaprofenic acid, and tolmetin.), as well as antihistamines,
aminoarylcarboxylic acid derivatives, arylacetic acid derivatives,
arylbutyric acid derivatives, arylcarboxylic acids, arylpropionic
acid derivatives, pyrazoles, pyrazolones, salicylic acid
derivatives, thiazinecarboxamides, e-acetamidocaproic acid,
S-adenosylmethionine, 3-amino-4-hydroxybutyric acid, amixetrine,
bendazac, benzydamine, bucolome, difenpiramide, ditazol,
emorfazone, guaiazulene, nabumetone, nimesulide, orgotein,
oxaceprol, paranyline, perisoxal, pifoxime, proquazone, proxazole,
and tenidap.
[1127] In an additional embodiment, the compositions of the
invention are administered alone or in combination with an
anti-angiogenic agent. Anti-angiogenic agents that may be
administered with the compositions of the invention include, but
are not limited to, Angiostatin (Entremed, Rockville, Md.),
Troponin-1 (Boston Life Sciences, Boston, Mass.), anti-Invasive
Factor, retinoic acid and derivatives thereof, paclitaxel (Taxol),
Suramin, Tissue Inhibitor of Metalloproteinase-1, Tissue Inhibitor
of Metalloproteinase-2, VEGI, Plasminogen Activator Inhibitor-1,
Plasminogen Activator Inhibitor-2, and various forms of the lighter
"d group" transition metals.
[1128] Lighter "d group" transition metals include, for example,
vanadium, molybdenum, tungsten, titanium, niobium, and tantalum
species. Such transition metal species may form transition metal
complexes. Suitable complexes of the above-mentioned transition
metal species include oxo transition metal complexes.
[1129] Representative examples of vanadium complexes include oxo
vanadium complexes such as vanadate and vanadyl complexes. Suitable
vanadate complexes include metavanadate and orthovanadate complexes
such as, for example, ammonium metavanadate, sodium metavanadate,
and sodium orthovanadate. Suitable vanadyl complexes include, for
example, vanadyl acetylacetonate and vanadyl sulfate including
vanadyl sulfate hydrates such as vanadyl sulfate mono- and
trihydrates.
[1130] Representative examples of tungsten and molybdenum complexes
also include oxo complexes. Suitable oxo tungsten complexes include
tungstate and tungsten oxide complexes. Suitable tungstate
complexes include ammonium tungstate, calcium tungstate, sodium
tungstate dihydrate, and tungstic acid. Suitable tungsten oxides
include tungsten (IV) oxide and tungsten (VI) oxide. Suitable oxo
molybdenum complexes include molybdate, molybdenum oxide, and
molybdenyl complexes. Suitable molybdate complexes include ammonium
molybdate and its hydrates, sodium molybdate and its hydrates, and
potassium molybdate and its hydrates. Suitable molybdenum oxides
include molybdenum (VI) oxide, molybdenum (VI) oxide, and molybdic
acid. Suitable molybdenyl complexes include, for example,
molybdenyl acetylacetonate. Other suitable tungsten and molybdenum
complexes include hydroxo derivatives derived from, for example,
glycerol, tartaric acid, and sugars.
[1131] A wide variety of other anti-angiogenic factors may also be
utilized within the context of the present invention.
Representative examples include, but are not limited to, platelet
factor 4; protamine sulphate; sulphated chitin derivatives
(prepared from queen crab shells), (Murata et al., Cancer Res.
51:22-26, (1991)); Sulphated Polysaccharide Peptidoglycan Complex
(SP-PG) (the function of this compound may be enhanced by the
presence of steroids such as estrogen, and tamoxifen citrate);
Staurosporine; modulators of matrix metabolism, including for
example, proline analogs, cishydroxyproline,
d,L-3,4-dehydroproline, Thiaproline, alpha,alpha-dipyridyl,
aminopropionitrile fumarate;
4-propyl-5-(4-pyridinyl)-2(3H)-oxazolone; Methotrexate;
Mitoxantrone; Heparin; Interferons; 2 Macroglobulin-serum; ChIMP-3
(Pavloff et al., J. Bio. Chem. 267:17321-17326, (1992));
Chymostatin (Tomkinson et al., Biochem J. 286:475-480, (1992));
Cyclodextrin Tetradecasulfate; Eponemycin; Camptothecin; Fumagillin
(Ingber et al., Nature 348:555-557, (1990)); Gold Sodium Thiomalate
("GST"; Matsubara and Ziff, J. Clin. Invest. 79:1440-1446, (1987));
anticollagenase-serum; alpha2-antiplasmin (Holmes et al., J. Biol.
Chem. 262(4):1659-1664, (1987)); Bisantrene (National Cancer
Institute); Lobenzarit disodium
(N-(2)-carboxyphenyl-4-chloroanthronilic acid disodium or "CCA";
(Takeuchi et al., Agents Actions 36:312-316, (1992)); and
metalloproteinase inhibitors such as BB94.
[1132] Additional anti-angiogenic factors that may also be utilized
within the context of the present invention include Thalidomide,
(Celgene, Warren, N.J.); Angiostatic steroid; AGM-1470 (H. Brem and
J. Folkman J Pediatr. Surg. 28:445-51 (1993)); an integrin alpha v
beta 3 antagonist (C. Storgard et al., J. Clin. Invest. 103:47-54
(1999)); carboxynaminolmidazole; Carboxyamidotriazole (CAI)
(National Cancer Institute, Bethesda, Md.); Conbretastatin A-4
(CA4P) (OXiGENE, Boston, Mass.); Squalamine (Magainin
Pharmaceuticals, Plymouth Meeting, Pa.); TNP-470, (Tap
Pharmaceuticals, Deerfield, Ill.); ZD-0101 AstraZeneca (London,
UK); APRA (CT2584); Benefin, Byrostatin-1 (SC339555); CGP-41251
(PKC 412); CM11; Dexrazoxane (ICRF187); DMXAA; Endostatin;
Flavopridiol; Genestein; GTE; ImmTher; Iressa (ZD1839); Octreotide
(Somatostatin); Panretin; Penacillamine; Photopoint; PI-88;
Prinomastat (AG-3340) Purlytin; Suradista (FCE26644); Tamoxifen
(Nolvadex); Tazarotene; Tetrathiomolybdate; Xeloda (Capecitabine);
and 5-Fluorouracil.
[1133] Anti-angiogenic agents that may be administed in combination
with the compounds of the invention may work through a variety of
mechanisms including, but not limited to, inhibiting proteolysis of
the extracellular matrix, blocking the function of endothelial
cell-extracellular matrix adhesion molecules, by antagonizing the
function of angiogenesis inducers such as growth factors, and
inhibiting integrin receptors expressed on proliferating
endothelial cells. Examples of anti-angiogenic inhibitors that
interfere with extracellular matrix proteolysis and which may be
administered in combination with the compositons of the invention
include, but are not lmited to, AG-3340 (Agouron, La Jolla,
Calif.), BAY-12-9566 (Bayer, West Haven, Conn.), BMS-275291
(Bristol Myers Squibb, Princeton, N.J.), CGS-27032A (Novartis, East
Hanover, N.J.), Marimastat (British Biotech, Oxford, UK), and
Metastat (Aetema, St-Foy, Quebec). Examples of anti-angiogenic
inhibitors that act by blocking the function of endothelial
cell-extracellular matrix adhesion molecules and which may be
administered in combination with the compositons of the invention
include, but are not limited to, EMD-121974 (Merck KcgaA Darmstadt,
Germany) and Vitaxin (Ixsys, La Jolla, Calif./Medimmune,
Gaithersburg, Md.). Examples of anti-angiogenic agents that act by
directly antagonizing or inhibiting angiogenesis inducers and which
may be administered in combination with the compositons of the
invention include, but are not lmited to, Angiozyme (Ribozyme,
Boulder, Colo.), Anti-VEGF antibody (Genentech, S. San Francisco,
Calif.), PTK-787/ZK-225846 (Novartis, Basel, Switzerland), SU-101
(Sugen, S. San Francisco, Calif.), SU-5416 (Sugen/Pharmacia Upjohn,
Bridgewater, N.J.), and SU-6668 (Sugen). Other anti-angiogenic
agents act to indirectly inhibit angiogenesis. Examples of indirect
inhibitors of angiogenesis which may be administered in combination
with the compositons of the invention include, but are not limited
to, IM-862 (Cytran, Kirkland, Wash.), Interferon-alpha, IL-12
(Roche, Nutley, N.J.), and Pentosan polysulfate (Georgetown
University, Washington, D.C.).
[1134] In particular embodiments, the use of compositions of the
invention in combination with anti-angiogenic agents is
contemplated for the treatment, prevention, and/or amelioration of
an autoimmune disease, such as for example, an autoimmune disease
described herein.
[1135] In a particular embodiment, the use of compositions of the
invention in combination with anti-angiogenic agents is
contemplated for the treatment, prevention, and/or amelioration of
arthritis. In a more particular embodiment, the use of compositions
of the invention in combination with anti-angiogenic agents is
contemplated for the treatment, prevention, and/or amelioration of
rheumatoid arthritis.
[1136] In another embodiment, the polynucleotides encoding a
polypeptide of the present invention are administered in
combination with an angiogenic protein, or polynucleotides encoding
an angiogenic protein. Examples of angiogenic proteins that may be
administered with the compositions of the invention include, but
are not limited to, acidic and basic fibroblast growth factors,
VEGF-1, VEGF-2, VEGF-3, epidermal growth factor alpha and beta,
platelet-derived endothelial cell growth factor, platelet-derived
growth factor, tumor necrosis factor alpha, hepatocyte growth
factor, insulin-like growth factor, colony stimulating factor,
macrophage colony stimulating factor, granulocyte/macrophage colony
stimulating factor, and nitric oxide synthase.
[1137] In additional embodiments, compositions of the invention are
administered in combination with a chemotherapeutic agent.
Chemotherapeutic agents that may be administered with the
Therapeutics of the invention include, but are not limited to
alkylating agents such as nitrogen mustards (for example,
Mechlorethamine, cyclophosphamide, Cyclophosphamide Ifosfamide,
Melphalan (L-sarcolysin), and Chlorambucil), ethylenimines and
methylmelamines (for example, Hexamethylmelamine and Thiotepa),
alkyl sulfonates (for example, Busulfan), nitrosoureas (for
example, Carmustine (BCNU), Lomustine (CCNU), Semustine
(methyl-CCNU), and Streptozocin (streptozotocin)), triazenes (for
example, Dacarbazine (DTIC; dimethyltriazenoimidazolecarboxamide)),
folic acid analogs (for example, Methotrexate (amethopterin)),
pyrimidine analogs (for example, Fluorouacil (5-fluorouracil;
5-FU), Floxuridine (fluorodeoxyuridine; FudR), and Cytarabine
(cytosine arabinoside)), purine analogs and related inhibitors (for
example, Mercaptopurine (6-mercaptopurine; 6-MP), Thioguanine
(6-thioguanine; TG), and Pentostatin (2'-deoxycoformycin)), vinca
alkaloids (for example, Vinblastine (VLB, vinblastine sulfate)) and
Vincristine (vincristine sulfate)), epipodophyllotoxins (for
example, Etoposide and Teniposide), antibiotics (for example,
Dactinomycin (actinomycin D), Daunorubicin (daunomycin;
rubidomycin), Doxorubicin, Bleomycin, Plicamycin (mithramycin), and
Mitomycin (mitomycin C), enzymes (for example, L-Asparaginase),
biological response modifiers (for example, Interferon-alpha and
interferon-alpha-2b), platinum coordination compounds (for example,
Cisplatin (cis-DDP) and Carboplatin), anthracenedione
(Mitoxantrone), substituted ureas (for example, Hydroxyurea),
methylhydrazine derivatives (for example, Procarbazine
(N-methylhydrazine; MIH), adrenocorticosteroids (for example,
Prednisone), progestins (for example, Hydroxyprogesterone caproate,
Medroxyprogesterone, Medroxyprogesterone acetate, and Megestrol
acetate), estrogens (for example, Diethylstilbestrol (DES),
Diethylstilbestrol diphosphate, Estradiol, and Ethinyl estradiol),
antiestrogens (for example, Tamoxifen), androgens (Testosterone
proprionate, and Fluoxymesterone), antiandrogens (for example,
Flutamide), gonadotropin-releasing horomone analogs (for example,
Leuprolide), other hormones and hormone analogs (for example,
methyltestosterone, estramustine, estramustine phosphate sodium,
chlorotrianisene, and testolactone), and others (for example,
dicarbazine, glutamic acid, and mitotane).
[1138] In one embodiment, the compositions of the invention are
administered in combination with one or more of the following
drugs: infliximab (also known as Remicade.TM. Centocor, Inc.),
Trocade (Roche, RO-32-3555), Leflunomide (also known as Arava.TM.
from Hoechst Marion Roussel), Kineret.TM. (an IL-1 Receptor
antagonist also known as Anakinra from Amgen, Inc.)
[1139] In a specific embodiment, compositions of the invention are
administered in combination with CHOP (cyclophosphamide,
doxorubicin, vincristine, and prednisone) or combination of one or
more of the components of CHOP. In one embodiment, the compositions
of the invention are administered in combination with anti-CD20
antibodies, human monoclonal anti-CD20 antibodies. In another
embodiment, the compositions of the invention are administered in
combination with anti-CD20 antibodies and CHOP, or anti-CD20
antibodies and any combination of one or more of the components of
CHOP, particularly cyclophosphamide and/or prednisone. In a
specific embodiment, compositions of the invention are administered
in combination with Rituximab. In a further embodiment,
compositions of the invention are administered with Rituximab and
CHOP, or Rituximab and any combination of one or more of the
components of CHOP, particularly cyclophosphamide and/or
prednisone. In a specific embodiment, compositions of the invention
are administered in combination with tositumomab. In a further
embodiment, compositions of the invention are administered with
tositumomab and CHOP, or tositumomab and any combination of one or
more of the components of CHOP, particularly cyclophosphamide
and/or prednisone. The anti-CD20 antibodies may optionally be
associated with radioisotopes, toxins or cytotoxic prodrugs.
[1140] In another specific embodiment, the compositions of the
invention are administered in combination Zevalin.TM.. In a further
embodiment, compositions of the invention are administered with
Zevalin.TM. and CHOP, or Zevalin.TM. and any combination of one or
more of the components of CHOP, particularly cyclophosphamide
and/or prednisone. Zevalin.TM. may be associated with one or more
radisotopes. Particularly preferred isotopes are .sup.90Y and
.sup.111In.
[1141] In an additional embodiment, the Therapeutics of the
invention are administered in combination with cytokines. Cytokines
that may be administered with the Therapeutics of the invention
include, but are not limited to, IL2, IL3, IL4, IL5, IL6, IL7,
IL10, IL12, IL13, IL15, anti-CD40, CD40L, IFN-gamma and TNF-alpha.
In another embodiment, Therapeutics of the invention may be
administered with any interleukin, including, but not limited to,
IL-1alpha, IL-1beta, IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8,
IL-9, IL-10, IL-1, IL-12, IL-13, IL-14, IL-15, IL-16, IL-17, IL-18,
IL-19, IL-20, and IL-21.
[1142] In one embodiment, the Therapeutics of the invention are
administered in combination with members of the TNF family. TNF,
TNF-related or TNF-like molecules that may be administered with the
Therapeutics of the invention include, but are not limited to,
soluble forms of TNF-alpha, lymphotoxin-alpha (LT-alpha, also known
as TNF-beta), LT-beta (found in complex heterotrimer
LT-alpha2-beta), OPGL, FasL, CD27L, CD30L, CD40L, 4-1BBL, DcR3,
OX40L, TNF-gamma (International Publication No. WO 96/14328), AIM-I
(International Publication No. WO 97/33899), endokine-alpha
(International Publication No. WO 98/07880), OPG, and
neutrokine-alpha (International Publication No. WO 98/18921, OX40,
and nerve growth factor (NGF), and soluble forms of Fas, CD30,
CD27, CD40 and 4-IBB, TR2 (International Publication No. WO
96/34095), DR3 (International Publication No. WO 97/33904), DR4
(International Publication No. WO 98/32856), TR5 (International
Publication No. WO 98/30693), TRANK, TR9 (International Publication
No. WO 98/56892), TR10 (International Publication No. WO 98/54202),
312C2 (International Publication No. WO 98/06842), and TR12, and
soluble forms CD154, CD70, and CD153.
[1143] In an additional embodiment, the Therapeutics of the
invention are administered in combination with angiogenic proteins.
Angiogenic proteins that may be administered with the Therapeutics
of the invention include, but are not limited to, Glioma Derived
Growth Factor (GDGF), as disclosed in European Patent Number
EP-399816; Platelet Derived Growth Factor-A (PDGF-A), as disclosed
in European Patent Number EP-682110; Platelet Derived Growth
Factor-B (PDGF-B), as disclosed in European Patent Number
EP-282317; Placental Growth Factor (PlGF), as disclosed in
International Publication Number WO 92/06194; Placental Growth
Factor-2 (PlGF-2), as disclosed in Hauser et al., Growth Factors,
4:259-268 (1993); Vascular Endothelial Growth Factor (VEGF), as
disclosed in International Publication Number WO 90/13649; Vascular
Endothelial Growth Factor-A (VEGF-A), as disclosed in European
Patent Number EP-506477; Vascular Endothelial Growth Factor-2
(VEGF-2), as disclosed in International Publication Number WO
96/39515; Vascular Endothelial Growth Factor B (VEGF-3); Vascular
Endothelial Growth Factor B-186 (VEGF-B186), as disclosed in
International Publication Number WO 96/26736; Vascular Endothelial
Growth Factor-D (VEGF-D), as disclosed in International Publication
Number WO 98/02543; Vascular Endothelial Growth Factor-D (VEGF-D),
as disclosed in International Publication Number WO 98/07832; and
Vascular Endothelial Growth Factor-E (VEGF-E), as disclosed in
German Patent Number DE19639601. The above mentioned references are
herein incorporated by reference in their entireties.
[1144] In an additional embodiment, the Therapeutics of the
invention are administered in combination with Fibroblast Growth
Factors. Fibroblast Growth Factors that may be administered with
the Therapeutics of the invention include, but are not limited to,
FGF-1, FGF-2, FGF-3, FGF-4, FGF-5, FGF-6, FGF-7, FGF-8, FGF-9,
FGF-10, FGF-11, FGF-12, FGF-13, FGF-14, and FGF-15.
[1145] In an additional embodiment, the Therapeutics of the
invention are administered in combination with hematopoietic growth
factors. Hematopoietic growth factors that may be administered with
the Therapeutics of the invention include, but are not limited to,
granulocyte macrophage colony stimulating factor (GM-CSF)
(sargramostim, LEUKINE.TM., PROKINE.TM.), granulocyte colony
stimulating factor (G-CSF) (filgrastim, NEUPOGEN.TM.), macrophage
colony stimulating factor (M-CSF, CSF-1) erythropoietin (epoetin
alfa, EPOGEN.TM., PROCRIT.TM.), stem cell factor (SCF, c-kit
ligand, steel factor), megakaryocyte colony stimulating factor,
PIXY321 (a GMCSF/IL-3 fusion protein), interleukins, especially any
one or more of IL-1 through IL-12, interferon-gamma, or
thrombopoietin.
[1146] In certain embodiments, Therapeutics of the present
invention are administered in combination with adrenergic blockers,
such as, for example, acebutolol, atenolol, betaxolol, bisoprolol,
carteolol, labetalol, metoprolol, nadolol, oxprenolol, penbutolol,
pindolol, propranolol, sotalol, and timolol.
[1147] In another embodiment, the Therapeutics of the invention are
administered in combination with an antiarrhythmic drug (e.g.,
adenosine, amidoarone, bretylium, digitalis, digoxin, digitoxin,
diliazem, disopyramide, esmolol, flecainide, lidocaine, mexiletine,
moricizine, phenyloin, procainamide, N-acetyl procainamide,
propafenone, propranolol, quinidine, sotalol, tocainide, and
verapamil).
[1148] In another embodiment, the Therapeutics of the invention are
administered in combination with diuretic agents, such as carbonic
anhydrase-inhibiting agents (e.g., acetazolamide, dichlorphenamide,
and methazolamide), osmotic diuretics (e.g., glycerin, isosorbide,
mannitol, and urea), diuretics that inhibit
Na.sup.+--K.sup.+-2Cl.sup.- symport (e.g., furosemide, bumetanide,
azosemide, piretanide, tripamide, ethacrynic acid, muzolimine, and
torsemide), thiazide and thiazide-like diuretics (e.g.,
bendroflumethiazide, benzthiazide, chlorothiazide,
hydrochlorothiazide, hydroflumethiazide, methyclothiazide,
polythiazide, trichormethiazide, chlorthalidone, indapamide,
metolazone, and quinethazone), potassium sparing diuretics (e.g.,
amiloride and triamterene), and mineralcorticoid receptor
antagonists (e.g., spironolactone, canrenone, and potassium
canrenoate).
[1149] In one embodiment, the Therapeutics of the invention are
administered in combination with treatments for endocrine and/or
hormone imbalance disorders. Treatments for endocrine and/or
hormone imbalance disorders include, but are not limited to,
.sup.127I, radioactive isotopes of iodine such as .sup.131I and
.sup.1231I; recombinant growth hormone, such as HUMATROPE.TM.
(recombinant somatropin); growth hormone analogs such as
PROTROPIN.TM. (somatrem); dopamine agonists such as PARLODEL.TM.
(bromocriptine); somatostatin analogs such as SANDOSTATIN.TM.
(octreotide); gonadotropin preparations such as PREGNYL.TM.,
A.P.L..TM. and PROFASI.TM. (chorionic gonadotropin (CG)),
PERGONAL.TM. (menotropins), and METRODIN.TM. (urofollitropin
(uFSH)); synthetic human gonadotropin releasing hormone
preparations such as FACTREL.TM. and LUTREPULSE.TM. (gonadorelin
hydrochloride); synthetic gonadotropin agonists such as LUPRON.TM.
(leuprolide acetate), SUPPRELIN.TM. (histrelin acetate),
SYNAREL.TM. (nafarelin acetate), and ZOLADEX.TM. (goserelin
acetate); synthetic preparations of thyrotropin-releasing hormone
such as RELEFACT TRH.TM. and THYPINONE.TM. (protirelin);
recombinant human TSH such as THYROGEN.TM.; synthetic preparations
of the sodium salts of the natural isomers of thyroid hormones such
as L-T.sub.4.TM., SYNTHROID.TM. and LEVOTHROID.TM. (levothyroxine
sodium), L-T.sub.3.TM., CYTOMEL.TM. and TRIOSTAT.TM. (liothyroine
sodium), and THYROLAR.TM. (liotrix); antithyroid compounds such as
6-n-propylthiouracil (propylthiouracil),
1-methyl-2-mercaptoimidazole and TAPAZOLE.TM. (methimazole),
NEO-MERCAZOLE.TM. (carbimazole); beta-adrenergic receptor
antagonists such as propranolol and esmolol; Ca.sup.2+ channel
blockers; dexamethasone and iodinated radiological contrast agents
such as TELEPAQUE.TM. (iopanoic acid) and ORAGRAFIN.TM. (sodium
ipodate).
[1150] Additional treatments for endocrine and/or hormone imbalance
disorders include, but are not limited to, estrogens or congugated
estrogens such as ESTRACE.TM. (estradiol), ESTINYL.TM. (ethinyl
estradiol), PREMARIN.TM., ESTRATAB.TM., ORTHO-EST.TM., OGEN.TM. and
estropipate (estrone), ESTROVIS.TM. (quinestrol), ESTRADERM.TM.
(estradiol), DELESTROGEN.TM. and VALERGEN.TM. (estradiol valerate),
DEPO-ESTRADIOL CYPIONATE.TM. and ESTROJECT LA.TM. (estradiol
cypionate); antiestrogens such as NOLVADEX.TM. (tamoxifen),
SEROPHENE.TM. and CLOMID.TM. (clomiphene); progestins such as
DURALUTIN.TM. (hydroxyprogesterone caproate), MPA.TM. and
DEPO-PROVERA.TM. (medroxyprogesterone acetate), PROVERA.TM. and
CYCRIN.TM. (MPA), MEGACE.TM. (megestrol acetate), NORLUTIN.TM.
(norethindrone), and NORLUTATE.TM. and AYGESTIN.TM. (norethindrone
acetate); progesterone implants such as NORPLANT SYSTEM.TM.
(subdermal implants of norgestrel); antiprogestins such as RU
486.TM. (mifepristone); hormonal contraceptives such as ENOVID.TM.
(norethynodrel plus mestranol), PROGESTASERT.TM. (intrauterine
device that releases progesterone), LOESTRIN.TM., BREVICON.TM.,
MODICON.TM., GENORA.TM., NELONA.TM., NORINYL.TM., OVACON-35.TM. and
OVACON-50.TM. (ethinyl estradiol/norethindrone), LEVLEN.TM.,
NORDETTE.TM., TRI-LEVLEN.TM. and TRIPHASIL-21.TM. (ethinyl
estradiol/levonorgestrel) LO/OVRAL.TM. and OVRAL.TM. (ethinyl
estradiol/norgestrel), DEMULEN.TM. (ethinyl estradiol/ethynodiol
diacetate), NORINYL.TM., ORTHO-NOVUM.TM., NORETHIN.TM., GENORA.TM.,
and NELOVA.TM. (norethindrone/mestranol), DESOGEN.TM. and
ORTHO-CEPT.TM. (ethinyl estradiol/desogestrel), ORTHO-CYCLEN.TM.
and ORTHO-TRICYCLEN.TM. (ethinyl estradiol/norgestimate),
MICRONOR.TM. and NOR-QD.TM. (norethindrone), and OVRETTE.TM.
(norgestrel).
[1151] Additional treatments for endocrine and/or hormone imbalance
disorders include, but are not limited to, testosterone esters such
as methenolone acetate and testosterone undecanoate; parenteral and
oral androgens such as TESTOJECT-50.TM. (testosterone), TESTEX.TM.
(testosterone propionate), DELATESTRYL.TM. (testosterone
enanthate), DEPO-TESTOSTERONE.TM. (testosterone cypionate),
DANOCRINE.TM. (danazol), HALOTESTIN.TM. (fluoxymesterone), ORETON
METHYL.TM., TESTRED.TM. and VIRILON.TM. (methyltestosterone), and
OXANDRIN.TM. (oxandrolone); testosterone transdermal systems such
as TESTODERM.TM.; androgen receptor antagonist and
5-alpha-reductase inhibitors such as ANDROCUR.TM. (cyproterone
acetate), EULEXIN.TM. (flutamide), and PROSCAR.TM. (finasteride);
adrenocorticotropic hormone preparations such as CORTROSYN.TM.
(cosyntropin); adrenocortical steroids and their synthetic analogs
such as ACLOVATE.TM. (alclometasone dipropionate), CYCLOCORT.TM.
(amcinonide), BECLOVENT.TM. and VANCERIL.TM. (beclomethasone
dipropionate), CELESTONE.TM. (betamethasone), BENISONE.TM. and
UTICORT.TM. (betamethasone benzoate), DIPROSONE.TM. (betamethasone
dipropionate), CELESTONE PHOSPHATE.TM. (betamethasone sodium
phosphate), CELESTONE SOLUSPAN.TM. (betamethasone sodium phosphate
and acetate), BETA-VAL.TM. and VALISONE.TM. (betamethasone
valerate), TEMOVATE.TM. (clobetasol propionate), CLODERM.TM.
(clocortolone pivalate), CORTEF.TM. and HYDROCORTONE.TM. (cortisol
(hydrocortisone)), HYDROCORTONE ACETATE.TM. (cortisol
(hydrocortisone) acetate), LOCOID.TM. (cortisol (hydrocortisone)
butyrate), HYDROCORTONE PHOSPHATE.TM. (cortisol (hydrocortisone)
sodium phosphate), A-HYDROCORT.TM. and SOLU CORTEF.TM. (cortisol
(hydrocortisone) sodium succinate), WESTCORT.TM. (cortisol
(hydrocortisone) valerate), CORTISONE ACETATE.TM. (cortisone
acetate), DESOWEN.TM. and TRIDESILON.TM. (desonide), TOPICORT.TM.
(desoximetasone), DECADRON.TM. (dexamethasone), DECADRON LA.TM.
(dexamethasone acetate), DECADRON PHOSPHATE.TM. and HEXADROL
PHOSPHATE.TM. (dexamethasone sodium phosphate), FLORONE.TM. and
MAXIFLOR.TM. (diflorasone diacetate), FLORINEF ACETATE.TM.
(fludrocortisone acetate), AEROBID.TM. and NASALIDE.TM.
(flunisolide), FLUONID.TM. and SYNALAR.TM. (fluocinolone
acetonide), LIDEX.TM. (fluocinonide), FLUOR-OP.TM. and FML.TM.
(fluorometholone), CORDRAN.TM. (flurandrenolide), HALOG.TM.
(halcinonide), HMS LIZUIFILM.TM. (medrysone), MEDROL.TM.
(methylprednisolone), DEPO-MEDROL.TM. and MEDROL ACETATE.TM.
(methylprednisone acetate), A-METHAPRED.TM. and SOLUMEDROL.TM.
(methylprednisolone sodium succinate), ELOCON.TM. (mometasone
furoate), HALDRONE.TM. (paramethasone acetate), DELTA-CORTEF.TM.
(prednisolone), ECONOPRED.TM. (prednisolone acetate),
HYDELTRASOL.TM. (prednisolone sodium phosphate), HYDELTRA-T.B.A.TM.
(prednisolone tebutate), DELTASONE.TM. (prednisone), ARISTOCORT.TM.
and KENACORT.TM. (triamcinolone), KENALOG.TM. (triamcinolone
acetonide), ARISTOCORT.TM. and KENACORT DIACETATE.TM.
(triamcinolone diacetate), and ARISTOSPAN.TM. (triamcinolone
hexacetonide); inhibitors of biosynthesis and action of
adrenocortical steroids such as CYTADREN.TM. (aminoglutethimide),
NIZORAL.TM. (ketoconazole), MODRASTANE.TM. (trilostane), and
METOPIRONE.TM. (metyrapone); bovine, porcine or human insulin or
mixtures thereof; insulin analogs; recombinant human insulin such
as HUMULIN.TM. and NOVOLIN.TM.; oral hypoglycemic agents such as
ORAMIDE.TM. and ORINASE.TM. (tolbutamide), DIABINESE.TM.
(chlorpropamide), TOLAMIDE.TM. and TOLINASE.TM. (tolazamide),
DYMELOR.TM. (acetohexamide), glibenclamide, MICRONASE.TM.,
DIBETA.TM. and GLYNASE.TM. (glyburide), GLUCOTROL.TM. (glipizide),
and DIAMICRON.TM. (gliclazide), GLUCOPHAGE.TM. (metformin),
ciglitazone, pioglitazone, and alpha-glucosidase inhibitors; bovine
or porcine glucagon; somatostatins such as SANDOSTATIN.TM.
(octreotide); and diazoxides such as PROGLYCEM.TM. (diazoxide).
[1152] In one embodiment, the Therapeutics of the invention are
administered in combination with treatments for uterine motility
disorders. Treatments for uterine motility disorders include, but
are not limited to, estrogen drugs such as conjugated estrogens
(e.g., PREMARIN.RTM. and ESTRATAB.RTM.), estradiols (e.g.,
CLIMARA.RTM. and ALORA.RTM.), estropipate, and chlorotrianisene;
progestin drugs (e.g., AMEN.RTM. (medroxyprogesterone),
MICRONOR.RTM. (norethidrone acetate), PROMETRIUM.RTM. progesterone,
and megestrol acetate); and estrogen/progesterone combination
therapies such as, for example, conjugated
estrogens/medroxyprogesterone (e.g., PREMPRO.TM. and
PREMPHASE.RTM.) and norethindrone acetate/ethinyl estsradiol (e.g.,
FEMHRT.TM.).
[1153] In an additional embodiment, the Therapeutics of the
invention are administered in combination with drugs effective in
treating iron deficiency and hypochromic anemias, including but not
limited to, ferrous sulfate (iron sulfate, FEOSOL.TM.), ferrous
fumarate (e.g., FEOSTAT.TM.), ferrous gluconate (e.g., FERGON.TM.),
polysaccharide-iron complex (e.g., NIFEREX.TM.), iron dextran
injection (e.g., INFED.TM.), cupric sulfate, pyroxidine,
riboflavin, Vitamin B.sub.12, cyancobalamin injection (e.g.,
REDISOL.TM., RUBRAMIN PC.TM.), hydroxocobalamin, folic acid (e.g.,
FOLVITE.TM.), leucovorin (folinic acid, 5-CHOH4PteGlu, citrovorum
factor) or WELLCOVORIN (Calcium salt of leucovorin), transferrin or
ferritin.
[1154] In certain embodiments, the Therapeutics of the invention
are administered in combination with agents used to treat
psychiatric disorders. Psychiatric drugs that may be administered
with the Therapeutics of the invention include, but are not limited
to, antipsychotic agents (e.g., chlorpromazine, chlorprothixene,
clozapine, fluphenazine, haloperidol, loxapine, mesoridazine,
molindone, olanzapine, perphenazine, pimozide, quetiapine,
risperidone, thioridazine, thiothixene, trifluoperazine, and
triflupromazine), antimanic agents (e.g., carbamazepine, divalproex
sodium, lithium carbonate, and lithium citrate), antidepressants
(e.g., amitriptyline, amoxapine, bupropion, citalopram,
clomipramine, desipramine, doxepin, fluvoxamine, fluoxetine,
imipramine, isocarboxazid, maprotiline, mirtazapine, nefazodone,
nortriptyline, paroxetine, phenelzine, protriptyline, sertraline,
tranylcypromine, trazodone, trimipramine, and venlafaxine),
antianxiety agents (e.g., alprazolam, buspirone, chlordiazepoxide,
clorazepate, diazepam, halazepam, lorazepam, oxazepam, and
prazepam), and stimulants (e.g., d-amphetamine, methylphenidate,
and pemoline).
[1155] In other embodiments, the Therapeutics of the invention are
administered in combination with agents used to treat neurological
disorders. Neurological agents that may be administered with the
Therapeutics of the invention include, but are not limited to,
antiepileptic agents (e.g., carbarnazepine, clonazepam,
ethosuximide, phenobarbital, phenyloin, primidone, valproic acid,
divalproex sodium, felbamate, gabapentin, lamotrigine,
levetiracetam, oxcarbazepine, tiagabine, topiramate, zonisamide,
diazepam, lorazepam, and clonazepam), antiparkinsonian agents
(e.g., levodopa/carbidopa, selegiline, amantidine, bromocriptine,
pergolide, ropinirole, pramipexole, benztropine; biperiden;
ethopropazine; procyclidine; trihexyphenidyl, tolcapone), and ALS
therapeutics (e.g. riluzole).
[1156] In another embodiment, Therapeutics of the invention are
administered in combination with vasodilating agents and/or calcium
channel blocking agents. Vasodilating agents that may be
administered with the Therapeutics of the invention include, but
are not limited to, Angiotensin Converting Enzyme (ACE) inhibitors
(e.g., papaverine, isoxsuprine, benazepril, captopril, cilazapril,
enalapril, enalaprilat, fosinopril, lisinopril, moexipril,
perindopril, quinapril, ramipril, spirapril, trandolapril, and
nylidrin), and nitrates (e.g., isosorbide dinitrate, isosorbide
mononitrate, and nitroglycerin). Examples of calcium channel
blocking agents that may be administered in combination with the
Therapeutics of the invention include, but are not limited to
amlodipine, bepridil, diltiazem, felodipine, flunarizine,
isradipine, nicardipine, nifedipine, nimodipine, and verapamil.
[1157] In certain embodiments, the Therapeutics of the invention
are administered in combination with treatments for
gastrointestinal disorders. Treatments for gastrointestinal
disorders that may be administered with the Therapeutic of the
invention include, but are not limited to, H.sub.2 histamine
receptor antagonists (e.g., TAGAMET.TM. (cimetidine), ZANTAC.TM.
(ranitidine), PEPCID.TM. (famotidine), and AXID.TM. (nizatidine));
inhibitors of H.sup.+, K.sup.+ ATPase (e.g., PREVACID.TM.
(lansoprazole) and PRILOSEC.TM. (omeprazole)); Bismuth compounds
(e.g., PEPTO-BISMOL.TM. (bismuth subsalicylate) and DE-NOL.TM.
(bismuth subcitrate)); various antacids; sucralfate; prostaglandin
analogs (e.g. CYTOTEC.TM. (misoprostol)); muscarinic cholinergic
antagonists; laxatives (e.g., surfactant laxatives, stimulant
laxatives, saline and osmotic laxatives); antidiarrheal agents
(e.g., LOMOTIL.TM. (diphenoxylate), MOTOFEN.TM. (diphenoxin), and
IMODIUM.TM. (loperamide hydrochloride)), synthetic analogs of
somatostatin such as SANDOSTATIN.TM. (octreotide), antiemetic
agents (e.g., ZOFRAN.TM. (ondansetron), KYTRIL.TM. (granisetron
hydrochloride), tropisetron, dolasetron, metoclopramide,
chlorpromazine, perphenazine, prochlorperazine, promethazine,
thiethylperazine, triflupromazine, domperidone, haloperidol,
droperidol, trimethobenzamide, dexamethasone, methylprednisolone,
dronabinol, and nabilone); D2 antagonists (e.g., metoclopramide,
trimethobenzamide and chlorpromazine); bile salts; chenodeoxycholic
acid; ursodeoxycholic acid; and pancreatic enzyme preparations such
as pancreatin and pancrelipase.
[1158] In additional embodiments, the Therapeutics of the invention
are administered in combination with other therapeutic or
prophylactic regimens, such as, for example, radiation therapy.
Example 14
Method of Treating Decreased Levels of the Polypeptide
[1159] The present invention relates to a method for treating an
individual in need of an increased level of a polypeptide of the
invention in the body comprising administering to such an
individual a composition comprising a therapeutically effective
amount of an agonist of the invention (including polypeptides of
the invention). Moreover, it will be appreciated that conditions
caused by a decrease in the standard or normal expression level of
a polypeptide of the present invention in an individual can be
treated by administering the agonist or antagonist of the present
invention. Thus, the invention also provides a method of treatment
of an individual in need of an increased level of the polypeptide
comprising administering to such an individual a Therapeutic
comprising an amount of the agonist or antagonist to increase the
activity level of the polypeptide in such an individual.
[1160] For example, a patient with decreased levels of a
polypeptide receives a daily dose 0.1-100 ug/kg of the agonist or
antagonist for six consecutive days. The exact details of the
dosing scheme, based on administration and formulation, are
provided in Example 13.
Example 15
Method of Treating Increased Levels of the Polypeptide
[1161] The present invention also relates to a method of treating
an individual in need of a decreased level of a polypeptide of the
invention in the body comprising administering to such an
individual a composition comprising a therapeutically effective
amount of an antagonist of the invention (including polypeptides
and antibodies of the invention).
[1162] In one example, antisense technology is used to inhibit
production of a polypeptide of the present invention. This
technology is one example of a method of decreasing levels of a
polypeptide, due to a variety of etiologies, such as cancer.
[1163] For example, a patient diagnosed with abnormally increased
levels of a polypeptide is administered intravenously antisense
polynucleotides at 0.5, 1.0, 1.5, 2.0 and 3.0 mg/kg day for 21
days. This treatment is repeated after a 7-day rest period if the
treatment was well tolerated. The antisense polynucleotides of the
present invention can be formulated using techniques and
formulations described herein (e.g. see Example 13), or otherwise
known in the art.
Example 16
Method of Treatment Using Gene Therapy-Ex Vivo
[1164] One method of gene therapy transplants fibroblasts, which
are capable of expressing a polypeptide, onto a patient. Generally,
fibroblasts are obtained from a subject by skin biopsy. The
resulting tissue is placed in tissue-culture medium and separated
into small pieces. Small chunks of the tissue are placed on a wet
surface of a tissue culture flask, approximately ten pieces are
placed in each flask. The flask is turned upside down, closed tight
and left at room temperature over night. After 24 hours at room
temperature, the flask is inverted and the chunks of tissue remain
fixed to the bottom of the flask and fresh media (e.g., Ham's F12
media, with 10% FBS, penicillin and streptomycin) is added. The
flasks are then incubated at 37 degree C. for approximately one
week.
[1165] At this time, fresh media is added and subsequently changed
every several days. After an additional two weeks in culture, a
monolayer of fibroblasts emerge. The monolayer is trypsinized and
scaled into larger flasks.
[1166] pMV-7 (Kirschmeier, P. T. et al., DNA, 7:219-25 (1988)),
flanked by the long terminal repeats of the Moloney murine sarcoma
virus, is digested with EcoRI and HindIII and subsequently treated
with calf intestinal phosphatase. The linear vector is fractionated
on agarose gel and purified, using glass beads.
[1167] The cDNA encoding a polypeptide of the present invention can
be amplified using PCR primers which correspond to the 5' and 3'
end sequences respectively as set forth in Example 1 using primers
and having appropriate restriction sites and initiation/stop
codons, if necessary. Preferably, the 5' primer contains an EcoRI
site and the 3' primer includes a HindIII site. Equal quantities of
the Moloney murine sarcoma virus linear backbone and the amplified
EcoRI and HindIII fragment are added together, in the presence of
T4 DNA ligase. The resulting mixture is maintained under conditions
appropriate for ligation of the two fragments. The ligation mixture
is then used to transform bacteria HB101, which are then plated
onto agar containing kanamycin for the purpose of confirming that
the vector has the gene of interest properly inserted.
[1168] The amphotropic pA317 or GP+am12 packaging cells are grown
in tissue culture to confluent density in Dulbecco's Modified
Eagles Medium (DMEM) with 10% calf serum (CS), penicillin and
streptomycin. The MSV vector containing the gene is then added to
the media and the packaging cells transduced with the vector. The
packaging cells now produce infectious viral particles containing
the gene (the packaging cells are now referred to as producer
cells).
[1169] Fresh media is added to the transduced producer cells, and
subsequently, the media is harvested from a 10 cm plate of
confluent producer cells. The spent media, containing the
infectious viral particles, is filtered through a millipore filter
to remove detached producer cells and this media is then used to
infect fibroblast cells. Media is removed from a sub-confluent
plate of fibroblasts and quickly replaced with the media from the
producer cells. This media is removed and replaced with fresh
media. If the titer of virus is high, then virtually all
fibroblasts will be infected and no selection is required. If the
titer is very low, then it is necessary to use a retroviral vector
that has a selectable marker, such as neo or his. Once the
fibroblasts have been efficiently infected, the fibroblasts are
analyzed to determine whether protein is produced.
[1170] The engineered fibroblasts are then transplanted onto the
host, either alone or after having been grown to confluence on
cytodex 3 microcarrier beads.
Example 17
Gene Therapy Using Endogenous Genes Corresponding To
Polynucleotides of the Invention
[1171] Another method of gene therapy according to the present
invention involves operably associating the endogenous
polynucleotide sequence of the invention with a promoter via
homologous recombination as described, for example, in U.S. Pat.
No. 5,641,670, issued Jun. 24, 1997; International Publication NO:
WO 96/29411, published Sep. 26, 1996; International Publication NO:
WO 94/12650, published Aug. 4, 1994; Koller et al., Proc. Natl.
Acad. Sci. USA, 86:8932-8935 (1989); and Zijlstra et al., Nature,
342:435-438 (1989). This method involves the activation of a gene
which is present in the target cells, but which is not expressed in
the cells, or is expressed at a lower level than desired.
[1172] Polynucleotide constructs are made which contain a promoter
and targeting sequences, which are homologous to the 5' non-coding
sequence of endogenous polynucleotide sequence, flanking the
promoter. The targeting sequence will be sufficiently near the 5'
end of the polynucleotide sequence so the promoter will be operably
linked to the endogenous sequence upon homologous recombination.
The promoter and the targeting sequences can be amplified using
PCR. Preferably, the amplified promoter contains distinct
restriction enzyme sites on the 5' and 3' ends. Preferably, the 3'
end of the first targeting sequence contains the same restriction
enzyme site as the 5' end of the amplified promoter and the 5' end
of the second targeting sequence contains the same restriction site
as the 3' end of the amplified promoter.
[1173] The amplified promoter and the amplified targeting sequences
are digested with the appropriate restriction enzymes and
subsequently treated with calf intestinal phosphatase. The digested
promoter and digested targeting sequences are added together in the
presence of T4 DNA ligase. The resulting mixture is maintained
under conditions appropriate for ligation of the two fragments. The
construct is size fractionated on an agarose gel, then purified by
phenol extraction and ethanol precipitation.
[1174] In this Example, the polynucleotide constructs are
administered as naked polynucleotides via electroporation. However,
the polynucleotide constructs may also be administered with
transfection-facilitating agents, such as liposomes, viral
sequences, viral particles, precipitating agents, etc. Such methods
of delivery are known in the art.
[1175] Once the cells are transfected, homologous recombination
will take place which results in the promoter being operably linked
to the endogenous polynucleotide sequence. This results in the
expression of polynucleotide corresponding to the polynucleotide in
the cell. Expression may be detected by immunological staining, or
any other method known in the art.
[1176] Fibroblasts are obtained from a subject by skin biopsy. The
resulting tissue is placed in DMEM+10% fetal calf serum.
Exponentially growing or early stationary phase fibroblasts are
trypsinized and rinsed from the plastic surface with nutrient
medium. An aliquot of the cell suspension is removed for counting,
and the remaining cells are subjected to centrifugation. The
supernatant is aspirated and the pellet is resuspended in 5 ml of
electroporation buffer (20 mM HEPES pH 7.3, 137 mM NaCl, 5 mM KCl,
0.7 mM Na.sub.2 HPO.sub.4, 6 mM dextrose). The cells are
recentrifuged, the supernatant aspirated, and the cells resuspended
in electroporation buffer containing 1 mg/ml acetylated bovine
serum albumin. The final cell suspension contains approximately
3.times.10.sup.6 cells/ml. Electroporation should be performed
immediately following resuspension.
[1177] Plasmid DNA is prepared according to standard techniques.
For example, to construct a plasmid for targeting to the locus
corresponding to the polynucleotide of the invention, plasmid pUC18
(MBI Fermentas, Amherst, N.Y.) is digested with HindIII. The CMV
promoter is amplified by PCR with an XbaI site on the 5' end and a
BamHI site on the 3' end. Two non-coding sequences are amplified
via PCR: one non-coding sequence (fragment 1) is amplified with a
HindIII site at the 5' end and an Xba site at the 3' end; the other
non-coding sequence (fragment 2) is amplified with a BamHI site at
the 5'end and a HindIII site at the 3' end. The CMV promoter and
the fragments (1 and 2) are digested with the appropriate enzymes
(CMV promoter--XbaI and BamHI; fragment 1--XbaI; fragment 2--BamHI)
and ligated together. The resulting ligation product is digested
with HindIII, and ligated with the HindIII-digested pUC18
plasmid.
[1178] Plasmid DNA is added to a sterile cuvette with a 0.4 cm
electrode gap (Bio-Rad). The final DNA concentration is generally
at least 120 .mu.g/ml. 0.5 ml of the cell suspension (containing
approximately 1.5.times.10.sup.6 cells) is then added to the
cuvette, and the cell suspension and DNA solutions are gently
mixed. Electroporation is performed with a Gene-Pulser apparatus
(Bio-Rad). Capacitance and voltage are set at 960 .mu.F and 250-300
V, respectively. As voltage increases, cell survival decreases, but
the percentage of surviving cells that stably incorporate the
introduced DNA into their genome increases dramatically. Given
these parameters, a pulse time of approximately 14-20 mSec should
be observed.
[1179] Electroporated cells are maintained at room temperature for
approximately 5 min, and the contents of the cuvette are then
gently removed with a sterile transfer pipette. The cells are added
directly to 10 ml of prewarmed nutrient media (DMEM with 15% calf
serum) in a 10 cm dish and incubated at 37 degree C. The following
day, the media is aspirated and replaced with 10 ml of fresh media
and incubated for a further 16-24 hours.
[1180] The engineered fibroblasts are then injected into the host,
either alone or after having been grown to confluence on cytodex 3
microcarrier beads. The fibroblasts now produce the protein
product. The fibroblasts can then be introduced into a patient as
described above.
Example 18
Method of Treatment Using Gene Therapy--In Vivo
[1181] Another aspect of the present invention is using in vivo
gene therapy methods to treat disorders, diseases and conditions.
The gene therapy method relates to the introduction of naked
nucleic acid (DNA, RNA, and antisense DNA or RNA) sequences into an
animal to increase or decrease the expression of the polypeptide.
The polynucleotide of the present invention may be operatively
linked to (i.e., associated with) a promoter or any other genetic
elements necessary for the expression of the polypeptide by the
target tissue. Such gene therapy and delivery techniques and
methods are known in the art, see, for example, WO90/11092,
WO98/11779; U.S. Pat. Nos. 5,693,622, 5,705,151, 5,580,859; Tabata
et al., Cardiovasc. Res. 35(3):470-479 (1997); Chao et al.,
Pharmacol. Res. 35(6):517-522 (1997); Wolff, Neuromuscul. Disord.
7(5):314-318 (1997); Schwartz et al., Gene Ther. 3(5):405-411
(1996); Tsurumi et al., Circulation 94(12):3281-3290 (1996)
(incorporated herein by reference).
[1182] The polynucleotide constructs may be delivered by any method
that delivers injectable materials to the cells of an animal, such
as, injection into the interstitial space of tissues (heart,
muscle, skin, lung, liver, intestine and the like). The
polynucleotide constructs can be delivered in a pharmaceutically
acceptable liquid or aqueous carrier.
[1183] The term "naked" polynucleotide, DNA or RNA, refers to
sequences that are free from any delivery vehicle that acts to
assist, promote, or facilitate entry into the cell, including viral
sequences, viral particles, liposome formulations, lipofectin or
precipitating agents and the like. However, the polynucleotides of
the present invention may also be delivered in liposome
formulations (such as those taught in Felgner P. L. et al. (1995)
Ann. NY Acad. Sci. 772:126-139 and Abdallah B. et al. (1995) Biol.
Cell 85(1):1-7) which can be prepared by methods well known to
those skilled in the art.
[1184] The polynucleotide vector constructs used in the gene
therapy method are preferably constructs that will not integrate
into the host genome nor will they contain sequences that allow for
replication. Any strong promoter known to those skilled in the art
can be used for driving the expression of DNA. Unlike other gene
therapy techniques, one major advantage of introducing naked
nucleic acid sequences into target cells is the transitory nature
of the polynucleotide synthesis in the cells. Studies have shown
that non-replicating DNA sequences can be introduced into cells to
provide production of the desired polypeptide for periods of up to
six months.
[1185] The polynucleotide construct can be delivered to the
interstitial space of tissues within an animal, including muscle,
skin, brain, lung, liver, spleen, bone marrow, thymus, heart,
lymph, blood, bone, cartilage, pancreas, kidney, gall bladder,
stomach, intestine, testis, ovary, uterus, rectum, nervous system,
eye, gland, and connective tissue. Interstitial space of the
tissues comprises the intercellular fluid, mucopolysaccharide
matrix among the reticular fibers of organ tissues, elastic fibers
in the walls of vessels or chambers, collagen fibers of fibrous
tissues, or that same matrix within connective tissue ensheathing
muscle cells or in the lacunae of bone. It is similarly the space
occupied by the plasma of the circulation and the lymph fluid of
the lymphatic channels. Delivery to the interstitial space of
muscle tissue is preferred for the reasons discussed below. They
may be conveniently delivered by injection into the tissues
comprising these cells. They are preferably delivered to and
expressed in persistent, non-dividing cells which are
differentiated, although delivery and expression may be achieved in
non-differentiated or less completely differentiated cells, such
as, for example, stem cells of blood or skin fibroblasts. In vivo
muscle cells are particularly competent in their ability to take up
and express polynucleotides.
[1186] For the naked polynucleotide injection, an effective dosage
amount of DNA or RNA will be in the range of from about 0.05 g/kg
body weight to about 50 mg/kg body weight. Preferably the dosage
will be from about 0.005 mg/kg to about 20 mg/kg and more
preferably from about 0.05 mg/kg to about 5 mg/kg. Of course, as
the artisan of ordinary skill will appreciate, this dosage will
vary according to the tissue site of injection. The appropriate and
effective dosage of nucleic acid sequence can readily be determined
by those of ordinary skill in the art and may depend on the
condition being treated and the route of administration. The
preferred route of administration is by the parenteral route of
injection into the interstitial space of tissues. However, other
parenteral routes may also be used, such as, inhalation of an
aerosol formulation particularly for delivery to lungs or bronchial
tissues, throat or mucous membranes of the nose. In addition, naked
polynucleotide constructs can be delivered to arteries during
angioplasty by the catheter used in the procedure.
[1187] The dose response effects of injected polynucleotide in
muscle in vivo is determined as follows. Suitable template DNA for
production of mRNA coding for polypeptide of the present invention
is prepared in accordance with a standard recombinant DNA
methodology. The template DNA, which may be either circular or
linear, is either used as naked DNA or complexed with liposomes.
The quadriceps muscles of mice are then injected with various
amounts of the template DNA.
[1188] Five to six week old female and male Balb/C mice are
anesthetized by intraperitoneal injection with 0.3 ml of 2.5%
Avertin. A 1.5 cm incision is made on the anterior thigh, and the
quadriceps muscle is directly visualized. The template DNA is
injected in 0.1 ml of carrier in a 1 cc syringe through a 27 gauge
needle over one minute, approximately 0.5 cm from the distal
insertion site of the muscle into the knee and about 0.2 cm deep. A
suture is placed over the injection site for future localization,
and the skin is closed with stainless steel clips.
[1189] After an appropriate incubation time (e.g., 7 days) muscle
extracts are prepared by excising the entire quadriceps. Every
fifth 15 um cross-section of the individual quadriceps muscles is
histochemically stained for protein expression. A time course for
protein expression may be done in a similar fashion except that
quadriceps from different mice are harvested at different times.
Persistence of DNA in muscle following injection may be determined
by Southern blot analysis after preparing total cellular DNA and
HIRT supernatants from injected and control mice. The results of
the above experimentation in mice can be used to extrapolate proper
dosages and other treatment parameters in humans and other animals
using naked DNA.
Example 19
Transgenic Animals
[1190] The polypeptides of the invention can also be expressed in
transgenic animals. Animals of any species, including, but not
limited to, mice, rats, rabbits, hamsters, guinea pigs, pigs,
micro-pigs, goats, sheep, cows and non-human primates, e.g.,
baboons, monkeys, and chimpanzees may be used to generate
transgenic animals. In a specific embodiment, techniques described
herein or otherwise known in the art, are used to express
polypeptides of the invention in humans, as part of a gene therapy
protocol.
[1191] Any technique known in the art may be used to introduce the
transgene (i.e., polynucleotides of the invention) into animals to
produce the founder lines of transgenic animals. Such techniques
include, but are not limited to, pronuclear microinjection
(Paterson et al., Appl. Microbiol. Biotechnol. 40:691-698 (1994);
Carver et al., Biotechnology (NY) 11:1263-1270 (1993); Wright et
al., Biotechnology (NY) 9:830-834 (1991); and Hoppe et al., U.S.
Pat. No. 4,873,191 (1989)); retrovirus mediated gene transfer into
germ lines (Van der Putten et al., Proc. Natl. Acad. Sci., USA
82:6148-6152 (1985)), blastocysts or embryos; gene targeting in
embryonic stem cells (Thompson et al., Cell 56:313-321 (1989));
electroporation of cells or embryos (Lo, 1983, Mol Cell. Biol.
3:1803-1814 (1983)); introduction of the polynucleotides of the
invention using a gene gun (see, e.g., Ulmer et al., Science
259:1745 (1993); introducing nucleic acid constructs into embryonic
pleuripotent stem cells and transferring the stem cells back into
the blastocyst; and sperm-mediated gene transfer (Lavitrano et al.,
Cell 57:717-723 (1989); etc. For a review of such techniques, see
Gordon, "Transgenic Animals," Intl. Rev. Cytol. 115:171-229 (1989),
which is incorporated by reference herein in its entirety.
[1192] Any technique known in the art may be used to produce
transgenic clones containing polynucleotides of the invention, for
example, nuclear transfer into enucleated oocytes of nuclei from
cultured embryonic, fetal, or adult cells induced to quiescence
(Campell et al., Nature 380:64-66 (1996); Wilmut et al., Nature
385:810-813 (1997)).
[1193] The present invention provides for transgenic animals that
carry the transgene in all their cells, as well as animals which
carry the transgene in some, but not all their cells, i.e., mosaic
animals or chimeric. The transgene may be integrated as a single
transgene or as multiple copies such as in concatamers, e.g.,
head-to-head tandems or head-to-tail tandems. The transgene may
also be selectively introduced into and activated in a particular
cell type by following, for example, the teaching of Lasko et al.
(Lasko et al., Proc. Natl. Acad. Sci. USA 89:6232-6236 (1992)). The
regulatory sequences required for such a cell-type specific
activation will depend upon the particular cell type of interest,
and will be apparent to those of skill in the art. When it is
desired that the polynucleotide transgene be integrated into the
chromosomal site of the endogenous gene, gene targeting is
preferred. Briefly, when such a technique is to be utilized,
vectors containing some nucleotide sequences homologous to the
endogenous gene are designed for the purpose of integrating, via
homologous recombination with chromosomal sequences, into and
disrupting the function of the nucleotide sequence of the
endogenous gene. The transgene may also be selectively introduced
into a particular cell type, thus inactivating the endogenous gene
in only that cell type, by following, for example, the teaching of
Gu et al. (Gu et al., Science 265:103-106 (1994)). The regulatory
sequences required for such a cell-type specific inactivation will
depend upon the particular cell type of interest, and will be
apparent to those of skill in the art.
[1194] Once transgenic animals have been generated, the expression
of the recombinant gene may be assayed utilizing standard
techniques. Initial screening may be accomplished by Southern blot
analysis or PCR techniques to analyze animal tissues to verify that
integration of the transgene has taken place. The level of mRNA
expression of the transgene in the tissues of the transgenic
animals may also be assessed using techniques which include, but
are not limited to, Northern blot analysis of tissue samples
obtained from the animal, in situ hybridization analysis, and
reverse transcriptase-PCR (rt-PCR). Samples of transgenic
gene-expressing tissue may also be evaluated immunocytochemically
or immunohistochemically using antibodies specific for the
transgene product.
[1195] Once the founder animals are produced, they may be bred,
inbred, outbred, or crossbred to produce colonies of the particular
animal. Examples of such breeding strategies include, but are not
limited to: outbreeding of founder animals with more than one
integration site in order to establish separate lines; inbreeding
of separate lines in order to produce compound transgenics that
express the transgene at higher levels because of the effects of
additive expression of each transgene; crossing of heterozygous
transgenic animals to produce animals homozygous for a given
integration site in order to both augment expression and eliminate
the need for screening of animals by DNA analysis; crossing of
separate homozygous lines to produce compound heterozygous or
homozygous lines; and breeding to place the transgene on a distinct
background that is appropriate for an experimental model of
interest.
[1196] Transgenic animals of the invention have uses which include,
but are not limited to, animal model systems useful in elaborating
the biological function of polypeptides of the present invention,
studying conditions and/or disorders associated with aberrant
expression, and in screening for compounds effective in
ameliorating such conditions and/or disorders.
Example 20
Knock-Out Animals
[1197] Endogenous gene expression can also be reduced by
inactivating or "knocking out" the gene and/or its promoter using
targeted homologous recombination. (e.g., see Smithies et al.,
Nature 317:230-234 (1985); Thomas & Capecchi, Cell 51:503-512
(1987); Thompson et al., Cell 5:313-321 (1989); each of which is
incorporated by reference herein in its entirety). For example, a
mutant, non-functional polynucleotide of the invention (or a
completely unrelated DNA sequence) flanked by DNA homologous to the
endogenous polynucleotide sequence (either the coding regions or
regulatory regions of the gene) can be used, with or without a
selectable marker and/or a negative selectable marker, to transfect
cells that express polypeptides of the invention in vivo. In
another embodiment, techniques known in the art are used to
generate knockouts in cells that contain, but do not express the
gene of interest. Insertion of the DNA construct, via targeted
homologous recombination, results in inactivation of the targeted
gene. Such approaches are particularly suited in research and
agricultural fields where modifications to embryonic stem cells can
be used to generate animal offspring with an inactive targeted gene
(e.g., see Thomas & Capecchi 1987 and Thompson 1989, supra).
However this approach can be routinely adapted for use in humans
provided the recombinant DNA constructs are directly administered
or targeted to the required site in vivo using appropriate viral
vectors that will be apparent to those of skill in the art.
[1198] In further embodiments of the invention, cells that are
genetically engineered to express the polypeptides of the
invention, or alternatively, that are genetically engineered not to
express the polypeptides of the invention (e.g., knockouts) are
administered to a patient in vivo. Such cells may be obtained from
the patient (i.e., animal, including human) or an MHC compatible
donor and can include, but are not limited to fibroblasts, bone
marrow cells, blood cells (e.g., lymphocytes), adipocytes, muscle
cells, endothelial cells etc. The cells are genetically engineered
in vitro using recombinant DNA techniques to introduce the coding
sequence of polypeptides of the invention into the cells, or
alternatively, to disrupt the coding sequence and/or endogenous
regulatory sequence associated with the polypeptides of the
invention, e.g., by transduction (using viral vectors, and
preferably vectors that integrate the transgene into the cell
genome) or transfection procedures, including, but not limited to,
the use of plasmids, cosmids, YACs, naked DNA, electroporation,
liposomes, etc. The coding sequence of the polypeptides of the
invention can be placed under the control of a strong constitutive
or inducible promoter or promoter/enhancer to achieve expression,
and preferably secretion, of the polypeptides of the invention. The
engineered cells which express and preferably secrete the
polypeptides of the invention can be introduced into the patient
systemically, e.g., in the circulation, or intraperitoneally.
[1199] Alternatively, the cells can be incorporated into a matrix
and implanted in the body, e.g., genetically engineered fibroblasts
can be implanted as part of a skin graft; genetically engineered
endothelial cells can be implanted as part of a lymphatic or
vascular graft. (See, for example, Anderson et al. U.S. Pat. No.
5,399,349; and Mulligan & Wilson, U.S. Pat. No. 5,460,959 each
of which is incorporated by reference herein in its entirety).
[1200] When the cells to be administered are non-autologous or
non-MHC compatible cells, they can be administered using well known
techniques which prevent the development of a host immune response
against the introduced cells. For example, the cells may be
introduced in an encapsulated form which, while allowing for an
exchange of components with the immediate extracellular
environment, does not allow the introduced cells to be recognized
by the host immune system.
[1201] Transgenic and "knock-out" animals of the invention have
uses which include, but are not limited to, animal model systems
useful in elaborating the biological function of polypeptides of
the present invention, studying conditions and/or disorders
associated with aberrant expression, and in screening for compounds
effective in ameliorating such conditions and/or disorders.
Example 21
Assays Detecting Stimulation or Inhibition of B cell Proliferation
and Differentiation
[1202] Generation of functional humoral immune responses requires
both soluble and cognate signaling between B-lineage cells and
their microenvironment. Signals may impart a positive stimulus that
allows a B-lineage cell to continue its programmed development, or
a negative stimulus that instructs the cell to arrest its current
developmental pathway. To date, numerous stimulatory and inhibitory
signals have been found to influence B cell responsiveness
including IL-2, IL-4, IL-5, IL-6, IL-7, IL10, IL-13, IL-14 and
IL-15. Interestingly, these signals are by themselves weak
effectors but can, in combination with various co-stimulatory
proteins, induce activation, proliferation, differentiation,
homing, tolerance and death among B cell populations.
[1203] One of the best studied classes of B-cell co-stimulatory
proteins is the TNF-superfamily. Within this family CD40, CD27, and
CD30 along with their respective ligands CD154, CD70, and CD153
have been found to regulate a variety of immune responses. Assays
which allow for the detection and/or observation of the
proliferation and differentiation of these B-cell populations and
their precursors are valuable tools in determining the effects
various proteins may have on these B-cell populations in terms of
proliferation and differentiation. Listed below are two assays
designed to allow for the detection of the differentiation,
proliferation, or inhibition of B-cell populations and their
precursors.
[1204] In Vitro Assay--Agonists or antagonists of the invention can
be assessed for its ability to induce activation, proliferation,
differentiation or inhibition and/or death in B-cell populations
and their precursors. The activity of the agonists or antagonists
of the invention on purified human tonsillar B cells, measured
qualitatively over the dose range from 0.1 to 10,000 ng/mL, is
assessed in a standard B-lymphocyte co-stimulation assay in which
purified tonsillar B cells are cultured in the presence of either
formalin-fixed Staphylococcus aureus Cowan I (SAC) or immobilized
anti-human IgM antibody as the priming agent. Second signals such
as IL-2 and IL-15 synergize with SAC and IgM crosslinking to elicit
B cell proliferation as measured by tritiated-thymidine
incorporation. Novel synergizing agents can be readily identified
using this assay. The assay involves isolating human tonsillar B
cells by magnetic bead (MACS) depletion of CD3-positive cells. The
resulting cell population is greater than 95% B cells as assessed
by expression of CD45R(B220).
[1205] Various dilutions of each sample are placed into individual
wells of a 96-well plate to which are added 10.sup.5 B-cells
suspended in culture medium (RPMI 1640 containing 10% FBS,
5.times.10.sup.-5M 2ME, 100 U/ml penicillin, 10 ug/ml streptomycin,
and 10.sup.-5 dilution of SAC) in a total volume of 150 ul.
Proliferation or inhibition is quantitated by a 20 h pulse (1
uCi/well) with 3H-thymidine (6.7 Ci/mM) beginning 72 h post factor
addition. The positive and negative controls are IL2 and medium
respectively.
[1206] In vivo Assay--BALB/c mice are injected (i.p.) twice per day
with buffer only, or 2 mg/Kg of agonists or antagonists of the
invention, or truncated forms thereof. Mice receive this treatment
for 4 consecutive days, at which time they are sacrificed and
various tissues and serum collected for analyses. Comparison of
H&E sections from normal spleens and spleens treated with
agonists or antagonists of the invention identify the results of
the activity of the agonists or antagonists on spleen cells, such
as the diffusion of peri-arterial lymphatic sheaths, and/or
significant increases in the nucleated cellularity of the red pulp
regions, which may indicate the activation of the differentiation
and proliferation of B-cell populations. Immunohistochemical
studies using a B cell marker, anti-CD45R(B220), are used to
determine whether any physiological changes to splenic cells, such
as splenic disorganization, are due to increased B-cell
representation within loosely defined B-cell zones that infiltrate
established T-cell regions.
[1207] Flow cytometric analyses of the spleens from mice treated
with agonist or antagonist is used to indicate whether the agonists
or antagonists specifically increases the proportion of ThB+,
CD45R(B220) dull B cells over that which is observed in control
mice.
[1208] Likewise, a predicted consequence of increased mature B-cell
representation in vivo is a relative increase in serum Ig titers.
Accordingly, serum IgM and IgA levels are compared between buffer
and agonists or antagonists-treated mice.
[1209] The studies described in this example tested activity of
agonists or antagonists of the invention. However, one skilled in
the art could easily modify the exemplified studies to test the
activity of polynucleotides or polypeptides of the invention (e.g.,
gene therapy).
Example 22
T Cell Proliferation Assay
[1210] A CD3-induced proliferation assay is performed on PBMCs and
is measured by the uptake of .sup.3H-thymidine. The assay is
performed as follows. Ninety-six well plates are coated with 100
.mu.l/well of mAb to CD3 (HIT3a, Pharmingen) or isotype-matched
control mAb (B33.1) overnight at 4 degrees C. (1 .mu.g/ml in 0.05M
bicarbonate buffer, pH 9.5), then washed three times with PBS. PBMC
are isolated by F/H gradient centrifugation from human peripheral
blood and added to quadruplicate wells (5.times.10.sup.4/well) of
mAb coated plates in RPMI containing 10% FCS and P/S in the
presence of varying concentrations of agonists or antagonists of
the invention (total volume 200 ul). Relevant protein buffer and
medium alone are controls. After 48 hr. culture at 37 degrees C.,
plates are spun for 2 min. at 1000 rpm and 100 .mu.l of supernatant
is removed and stored -20 degrees C. for measurement of IL-2 (or
other cytokines) if effect on proliferation is observed. Wells are
supplemented with 100 ul of medium containing 0.5 uCi of
.sup.3H-thymidine and cultured at 37 degrees C. for 18-24 hr. Wells
are harvested and incorporation of .sup.3H-thymidine used as a
measure of proliferation. Anti-CD3 alone is the positive control
for proliferation. IL-2 (100 U/ml) is also used as a control which
enhances proliferation. Control antibody which does not induce
proliferation of T cells is used as the negative control for the
effects of agonists or antagonists of the invention.
[1211] The studies described in this example tested activity of
agonists or antagonists of the invention. However, one skilled in
the art could easily modify the exemplified studies to test the
activity of polynucleotides or polypeptides of the invention (e.g.,
gene therapy).
Example 23
Effect of Agonists or Antagonists of the Invention on the
Expression of MHC Class II, Costimulatory and Adhesion Molecules
and Cell Differentiation of Monocytes and Monocyte-Derived Human
Dendritic Cells
[1212] Dendritic cells are generated by the expansion of
proliferating precursors found in the peripheral blood: adherent
PBMC or elutriated monocytic fractions are cultured for 7-10 days
with GM-CSF (50 ng/ml) and IL-4 (20 ng/ml). These dendritic cells
have the characteristic phenotype of immature cells (expression of
CD1, CD80, CD86, CD40 and MHC class II antigens). Treatment with
activating factors, such as TNF-.alpha., causes a rapid change in
surface phenotype (increased expression of MHC class I and II,
costimulatory and adhesion molecules, downregulation of FC.gamma.
RII, upregulation of CD83). These changes correlate with increased
antigen-presenting capacity and with functional maturation of the
dendritic cells.
[1213] FACS analysis of surface antigens is performed as follows.
Cells are treated 1-3 days with increasing concentrations of
agonist or antagonist of the invention or LPS (positive control),
washed with PBS containing 1% BSA and 0.02 mM sodium azide, and
then incubated with 1:20 dilution of appropriate FITC- or
PE-labeled monoclonal antibodies for 30 minutes at 4 degrees C.
After an additional wash, the labeled cells are analyzed by flow
cytometry on a FACScan (Becton Dickinson).
[1214] Effect on the production of cytokines. Cytokines generated
by dendritic cells, in particular IL-12, are important in the
initiation of T-cell dependent immune responses. IL-12 strongly
influences the development of Thl helper T-cell immune response,
and induces cytotoxic T and NK cell function. An ELISA is used to
measure the IL-12 release as follows. Dendritic cells (10.sup.6/ml)
are treated with increasing concentrations of agonists or
antagonists of the invention for 24 hours. LPS (100 ng/ml) is added
to the cell culture as positive control. Supernatants from the cell
cultures are then collected and analyzed for IL-12 content using
commercial ELISA kit (e.g., R & D Systems (Minneapolis,
Minn.)). The standard protocols provided with the kits are
used.
[1215] Effect on the expression of MHC Class II, costimulatory and
adhesion molecules. Three major families of cell surface antigens
can be identified on monocytes: adhesion molecules, molecules
involved in antigen presentation, and Fc receptor. Modulation of
the expression of MHC class II antigens and other costimulatory
molecules, such as B7 and ICAM-1, may result in changes in the
antigen presenting capacity of monocytes and ability to induce T
cell activation. Increased expression of Fc receptors may correlate
with improved monocyte cytotoxic activity, cytokine release and
phagocytosis.
[1216] FACS analysis is used to examine the surface antigens as
follows. Monocytes are treated 1-5 days with increasing
concentrations of agonists or antagonists of the invention or LPS
(positive control), washed with PBS containing 1% BSA and 0.02 mM
sodium azide, and then incubated with 1:20 dilution of appropriate
FITC- or PE-labeled monoclonal antibodies for 30 minutes at 4
degrees C. After an additional wash, the labeled cells are analyzed
by flow cytometry on a FACScan (Becton Dickinson).
[1217] Monocyte activation and/or increased survival. Assays for
molecules that activate (or alternatively, inactivate) monocytes
and/or increase monocyte survival (or alternatively, decrease
monocyte survival) are known in the art and may routinely be
applied to determine whether a molecule of the invention functions
as an inhibitor or activator of monocytes. Agonists or antagonists
of the invention can be screened using the three assays described
below. For each of these assays, Peripheral blood mononuclear cells
(PBMC) are purified from single donor leukopacks (American Red
Cross, Baltimore, Md.) by centrifugation through a Histopaque
gradient (Sigma). Monocytes are isolated from PBMC by counterflow
centrifugal elutriation.
[1218] Monocyte Survival Assay. Human peripheral blood monocytes
progressively lose viability when cultured in absence of serum or
other stimuli. Their death results from internally regulated
processes (apoptosis). Addition to the culture of activating
factors, such as TNF-alpha dramatically improves cell survival and
prevents DNA fragmentation. Propidium iodide (PI) staining is used
to measure apoptosis as follows. Monocytes are cultured for 48
hours in polypropylene tubes in serum-free medium (positive
control), in the presence of 100 ng/ml TNF-alpha (negative
control), and in the presence of varying concentrations of the
compound to be tested. Cells are suspended at a concentration of
2.times.10.sup.6/ml in PBS containing PI at a final concentration
of 5 .mu.g/ml, and then incubated at room temperature for 5 minutes
before FACScan analysis. PI uptake has been demonstrated to
correlate with DNA fragmentation in this experimental paradigm.
[1219] Effect on cytokine release. An important function of
monocytes/macrophages is their regulatory activity on other
cellular populations of the immune system through the release of
cytokines after stimulation. An ELISA to measure cytokine release
is performed as follows. Human monocytes are incubated at a density
of 5.times.10.sup.5 cells/ml with increasing concentrations of
agonists or antagonists of the invention and under the same
conditions, but in the absence of agonists or antagonists. For
IL-12 production, the cells are primed overnight with IFN (100
U/ml) in the presence of agonist or antagonist of the invention.
LPS (10 ng/ml) is then added. Conditioned media are collected after
24 h and kept frozen until use. Measurement of TNF-alpha, IL-10,
MCP-1 and IL-8 is then performed using a commercially available
ELISA kit (e.g., R & D Systems (Minneapolis, Minn.)) and
applying the standard protocols provided with the kit.
[1220] Oxidative burst. Purified monocytes are plated in 96-w plate
at 2-1.times.10.sup.5 cell/well. Increasing concentrations of
agonists or antagonists of the invention are added to the wells in
a total volume of 0.2 ml culture medium (RPMI 1640+10% FCS,
glutamine and antibiotics). After 3 days incubation, the plates are
centrifuged and the medium is removed from the wells. To the
macrophage monolayers, 0.2 ml per well of phenol red solution (140
mM NaCl, 10 mM potassium phosphate buffer pH 7.0, 5.5 mM dextrose,
0.56 mM phenol red and 19 U/ml of HRPO) is added, together with the
stimulant (200 nM PMA). The plates are incubated at 37.degree. C.
for 2 hours and the reaction is stopped by adding 20 .mu.l 1N NaOH
per well. The absorbance is read at 610 nm. To calculate the amount
of H.sub.2O.sub.2 produced by the macrophages, a standard curve of
a H.sub.2O.sub.2 solution of known molarity is performed for each
experiment.
[1221] The studies described in this example tested activity of
agonists or antagonists of the invention. However, one skilled in
the art could easily modify the exemplified studies to test the
activity of polynucleotides or polypeptides of the invention (e.g.,
gene therapy).
Example 24
Biological Effects of Agonists or Antagonists of the Invention
Astrocyte and Neuronal Assays
[1222] Agonists or antagonists of the invention, expressed in
Escherichia coli and purified as described above, can be tested for
activity in promoting the survival, neurite outgrowth, or
phenotypic differentiation of cortical neuronal cells and for
inducing the proliferation of glial fibrillary acidic protein
immunopositive cells, astrocytes. The selection of cortical cells
for the bioassay is based on the prevalent expression of FGF-1 and
FGF-2 in cortical structures and on the previously reported
enhancement of cortical neuronal survival resulting from FGF-2
treatment. A thymidine incorporation assay, for example, can be
used to elucidate an agonist or antagonist of the invention's
activity on these cells.
[1223] Moreover, previous reports describing the biological effects
of FGF-2 (basic FGF) on cortical or hippocampal neurons in vitro
have demonstrated increases in both neuron survival and neurite
outgrowth (Walicke et al., "Fibroblast growth factor promotes
survival of dissociated hippocampal neurons and enhances neurite
extension." Proc. Natl. Acad. Sci. USA 83:3012-3016. (1986), assay
herein incorporated by reference in its entirety). However, reports
from experiments done on PC-12 cells suggest that these two
responses are not necessarily synonymous and may depend on not only
which FGF is being tested but also on which receptor(s) are
expressed on the target cells. Using the primary cortical neuronal
culture paradigm, the ability of an agonist or antagonist of the
invention to induce neurite outgrowth can be compared to the
response achieved with FGF-2 using, for example, a thymidine
incorporation assay.
Fibroblast and Endothelial Cell Assays
[1224] Human lung fibroblasts are obtained from Clonetics (San
Diego, Calif.) and maintained in growth media from Clonetics.
Dermal microvascular endothelial cells are obtained from Cell
Applications (San Diego, Calif.). For proliferation assays, the
human lung fibroblasts and dermal microvascular endothelial cells
can be cultured at 5,000 cells/well in a 96-well plate for one day
in growth medium. The cells are then incubated for one day in 0.1%
BSA basal medium. After replacing the medium with fresh 0.1% BSA
medium, the cells are incubated with the test proteins for 3 days.
Alamar Blue (Alamar Biosciences, Sacramento, Calif.) is added to
each well to a final concentration of 10%. The cells are incubated
for 4 hr. Cell viability is measured by reading in a CytoFluor
fluorescence reader. For the PGE.sub.2 assays, the human lung
fibroblasts are cultured at 5,000 cells/well in a 96-well plate for
one day. After a medium change to 0.1% BSA basal medium, the cells
are incubated with FGF-2 or agonists or antagonists of the
invention with or without IL-1.alpha. for 24 hours. The
supernatants are collected and assayed for PGE.sub.2 by EIA kit
(Cayman, Ann Arbor, Mich.). For the IL-6 assays, the human lung
fibroblasts are cultured at 5,000 cells/well in a 96-well plate for
one day. After a medium change to 0.1% BSA basal medium, the cells
are incubated with FGF-2 or with or without agonists or antagonists
of the invention IL-1a for 24 hours. The supernatants are collected
and assayed for IL-6 by ELISA kit (Endogen, Cambridge, Mass.).
[1225] Human lung fibroblasts are cultured with FGF-2 or agonists
or antagonists of the invention for 3 days in basal medium before
the addition of Alamar Blue to assess effects on growth of the
fibroblasts. FGF-2 should show a stimulation at 10-2500 ng/ml which
can be used to compare stimulation with agonists or antagonists of
the invention.
Parkinson Models.
[1226] The loss of motor function in Parkinson's disease is
attributed to a deficiency of striatal dopamine resulting from the
degeneration of the nigrostriatal dopaminergic projection neurons.
An animal model for Parkinson's that has been extensively
characterized involves the systemic administration of 1-methyl-4
phenyl 1,2,3,6-tetrahydropyridine (MPTP). In the CNS, MPTP is
taken-up by astrocytes and catabolized by monoamine oxidase B to
1-methyl-4-phenyl pyridine (MPP.sup.+) and released. Subsequently,
MPP.sup.+ is actively accumulated in dopaminergic neurons by the
high-affinity reuptake transporter for dopamine. MPP.sup.+ is then
concentrated in mitochondria by the electrochemical gradient and
selectively inhibits nicotidamide adenine disphosphate: ubiquinone
oxidoreductionase (complex I), thereby interfering with electron
transport and eventually generating oxygen radicals.
[1227] It has been demonstrated in tissue culture paradigms that
FGF-2 (basic FGF) has trophic activity towards nigral dopaminergic
neurons (Ferrari et al., Dev. Biol. 1989). Recently, Dr. Unsicker's
group has demonstrated that administering FGF-2 in gel foam
implants in the striatum results in the near complete protection of
nigral dopaminergic neurons from the toxicity associated with MPTP
exposure (Otto and Unsicker, J. Neuroscience, 1990).
[1228] Based on the data with FGF-2, agonists or antagonists of the
invention can be evaluated to determine whether it has an action
similar to that of FGF-2 in enhancing dopaminergic neuronal
survival in vitro and it can also be tested in vivo for protection
of dopaminergic neurons in the striatum from the damage associated
with MPTP treatment. The potential effect of an agonist or
antagonist of the invention is first examined in vitro in a
dopaminergic neuronal cell culture paradigm. The cultures are
prepared by dissecting the midbrain floor plate from gestation day
14 Wistar rat embryos. The tissue is dissociated with trypsin and
seeded at a density of 200,000 cells/cm.sup.2 on
polyorthinine-laminin coated glass coverslips. The cells are
maintained in Dulbecco's Modified Eagle's medium and F12 medium
containing hormonal supplements (N1). The cultures are fixed with
paraformaldehyde after 8 days in vitro and are processed for
tyrosine hydroxylase, a specific marker for dopaminergic neurons,
immunohistochemical staining. Dissociated cell cultures are
prepared from embryonic rats. The culture medium is changed every
third day and the factors are also added at that time.
[1229] Since the dopaminergic neurons are isolated from animals at
gestation day 14, a developmental time which is past the stage when
the dopaminergic precursor cells are proliferating, an increase in
the number of tyrosine hydroxylase immunopositive neurons would
represent an increase in the number of dopaminergic neurons
surviving in vitro. Therefore, if an agonist or antagonist of the
invention acts to prolong the survival of dopaminergic neurons, it
would suggest that the agonist or antagonist may be involved in
Parkinson's Disease.
[1230] The studies described in this example tested activity of
agonists or antagonists of the invention. However, one skilled in
the art could easily modify the exemplified studies to test the
activity of polynucleotides or polypeptides of the invention (e.g.,
gene therapy).
Example 25
The Effect of Agonists or Antagonists of the Invention on the
Growth of Vascular Endothelial Cells
[1231] On day 1, human umbilical vein endothelial cells (HUVEC) are
seeded at 2-5.times.10.sup.4 cells/35 mm dish density in M199
medium containing 4% fetal bovine serum (FBS), 16 units/ml heparin,
and 50 units/ml endothelial cell growth supplements (ECGS,
Biotechnique, Inc.). On day 2, the medium is replaced with M199
containing 10% FBS, 8 units/ml heparin. An agonist or antagonist of
the invention, and positive controls, such as VEGF and basic FGF
(bFGF) are added, at varying concentrations. On days 4 and 6, the
medium is replaced. On day 8, cell number is determined with a
Coulter Counter.
[1232] An increase in the number of HUVEC cells indicates that the
compound of the invention may proliferate vascular endothelial
cells, while a decrease in the number of HUVEC cells indicates that
the compound of the invention inhibits vascular endothelial
cells.
[1233] The studies described in this example tested activity of a
polypeptide of the invention. However, one skilled in the art could
easily modify the exemplified studies to test the activity of
polynucleotides (e.g., gene therapy), agonists, and/or antagonists
of the invention.
Example 26
Rat Corneal Wound Healing Model
[1234] This animal model shows the effect of an agonist or
antagonist of the invention on neovascularization. The experimental
protocol includes:
a) Making a 1-1.5 mm long incision from the center of cornea into
the stromal layer.
b) Inserting a spatula below the lip of the incision facing the
outer corner of the eye.
c) Making a pocket (its base is 1-1.5 mm form the edge of the
eye).
d) Positioning a pellet, containing 50 ng-5 ug of an agonist or
antagonist of the invention, within the pocket.
e) Treatment with an agonist or antagonist of the invention can
also be applied topically to the corneal wounds in a dosage range
of 20 mg-500 mg (daily treatment for five days).
[1235] The studies described in this example tested activity of
agonists or antagonists of the invention. However, one skilled in
the art could easily modify the exemplified studies to test the
activity of polynucleotides or polypeptides of the invention (e.g.,
gene therapy).
Example 27
Diabetic Mouse and Glucocorticoid-Impaired Wound Healing Models
Diabetic db+/db+Mouse Model.
[1236] To demonstrate that an agonist or antagonist of the
invention accelerates the healing process, the genetically diabetic
mouse model of wound healing is used. The full thickness wound
healing model in the db+/db+mouse is a well characterized,
clinically relevant and reproducible model of impaired wound
healing. Healing of the diabetic wound is dependent on formation of
granulation tissue and re-epithelialization rather than contraction
(Gartner, M. H. et al., J. Surg. Res. 52:389 (1992); Greenhalgh, D.
G. et al., Am. J. Pathol. 136:1235 (1990)).
[1237] The diabetic animals have many of the characteristic
features observed in Type II diabetes mellitus. Homozygous
(db+/db+) mice are obese in comparison to their normal heterozygous
(db+/+m) littermates. Mutant diabetic (db+/db+) mice have a single
autosomal recessive mutation on chromosome 4 (db+) (Coleman et al.
Proc. Natl. Acad. Sci. USA 77:283-293 (1982)). Animals show
polyphagia, polydipsia and polyuria. Mutant diabetic mice (db+/db+)
have elevated blood glucose, increased or normal insulin levels,
and suppressed cell-mediated immunity (Mandel et al., J. Immunol.
120:1375 (1978); Debray-Sachs, M. et al., Clin. Exp. Immunol.
51(1):1-7 (1983); Leiter et al., Am. J. of Pathol. 114:46-55
(1985)). Peripheral neuropathy, myocardial complications, and
microvascular lesions, basement membrane thickening and glomerular
filtration abnormalities have been described in these animals
(Norido, F. et al., Exp. Neurol. 83(2):221-232 (1984); Robertson et
al., Diabetes 29(1):60-67 (1980); Giacomelli et al., Lab Invest.
40(4):460-473 (1979); Coleman, D. L., Diabetes 31 (Suppl):1-6
(1982)). These homozygous diabetic mice develop hyperglycemia that
is resistant to insulin analogous to human type II diabetes (Mandel
et al., J. Immunol. 120:1375-1377 (1978)).
[1238] The characteristics observed in these animals suggests that
healing in this model may be similar to the healing observed in
human diabetes (Greenhalgh, et al., Am. J. of Pathol. 136:1235-1246
(1990)).
[1239] Genetically diabetic female C57BL/KsJ (db+/db+) mice and
their non-diabetic (db+/+m) heterozygous littermates are used in
this study (Jackson Laboratories). The animals are purchased at 6
weeks of age and are 8 weeks old at the beginning of the study.
Animals are individually housed and received food and water ad
libitum. All manipulations are performed using aseptic techniques.
The experiments are conducted according to the rules and guidelines
of Human Genome Sciences, Inc. Institutional Animal Care and Use
Committee and the Guidelines for the Care and Use of Laboratory
Animals.
[1240] Wounding protocol is performed according to previously
reported methods (Tsuboi, R. and Rifkin, D. B., J. Exp. Med.
172:245-251 (1990)). Briefly, on the day of wounding, animals are
anesthetized with an intraperitoneal injection of Avertin (0.01
mg/mL), 2,2,2-tribromoethanol and 2-methyl-2-butanol dissolved in
deionized water. The dorsal region of the animal is shaved and the
skin washed with 70% ethanol solution and iodine. The surgical area
is dried with sterile gauze prior to wounding. An 8 mm
full-thickness wound is then created using a Keyes tissue punch.
Immediately following wounding, the surrounding skin is gently
stretched to eliminate wound expansion. The wounds are left open
for the duration of the experiment. Application of the treatment is
given topically for 5 consecutive days commencing on the day of
wounding. Prior to treatment, wounds are gently cleansed with
sterile saline and gauze sponges.
[1241] Wounds are visually examined and photographed at a fixed
distance at the day of surgery and at two day intervals thereafter.
Wound closure is determined by daily measurement on days 1-5 and on
day 8. Wounds are measured horizontally and vertically using a
calibrated Jameson caliper. Wounds are considered healed if
granulation tissue is no longer visible and the wound is covered by
a continuous epithelium.
[1242] An agonist or antagonist of the invention is administered
using at a range different doses, from 4 mg to 500 mg per wound per
day for 8 days in vehicle. Vehicle control groups received 50 mL of
vehicle solution.
[1243] Animals are euthanized on day 8 with an intraperitoneal
injection of sodium pentobarbital (300 mg/kg). The wounds and
surrounding skin are then harvested for histology and
immunohistochemistry. Tissue specimens are placed in 10% neutral
buffered formalin in tissue cassettes between biopsy sponges for
further processing.
[1244] Three groups of 10 animals each (5 diabetic and 5
non-diabetic controls) are evaluated: 1) Vehicle placebo control,
2) untreated group, and 3) treated group.
[1245] Wound closure is analyzed by measuring the area in the
vertical and horizontal axis and obtaining the total square area of
the wound. Contraction is then estimated by establishing the
differences between the initial wound area (day 0) and that of post
treatment (day 8). The wound area on day 1 is 64 mm.sup.2, the
corresponding size of the dermal punch. Calculations are made using
the following formula: [Open area on day 8]-[Open area on day
1]/[Open area on day 1]
[1246] Specimens are fixed in 10% buffered formalin and paraffin
embedded blocks are sectioned perpendicular to the wound surface (5
mm) and cut using a Reichert-Jung microtome. Routine
hematoxylin-eosin (H&E) staining is performed on cross-sections
of bisected wounds. Histologic examination of the wounds are used
to assess whether the healing process and the morphologic
appearance of the repaired skin is altered by treatment with an
agonist or antagonist of the invention. This assessment included
verification of the presence of cell accumulation, inflammatory
cells, capillaries, fibroblasts, re-epithelialization and epidermal
maturity (Greenhalgh, D. G. et al., Am. J. Pathol. 136:1235
(1990)). A calibrated lens micrometer is used by a blinded
observer.
[1247] Tissue sections are also stained immunohistochemically with
a polyclonal rabbit anti-human keratin antibody using ABC Elite
detection system. Human skin is used as a positive tissue control
while non-immune IgG is used as a negative control. Keratinocyte
growth is determined by evaluating the extent of
reepithelialization of the wound using a calibrated lens
micrometer.
[1248] Proliferating cell nuclear antigen/cyclin (PCNA) in skin
specimens is demonstrated by using anti-PCNA antibody (1:50) with
an ABC Elite detection system. Human colon cancer served as a
positive tissue control and human brain tissue is used as a
negative tissue control. Each specimen included a section with
omission of the primary antibody and substitution with non-immune
mouse IgG. Ranking of these sections is based on the extent of
proliferation on a scale of 0-8, the lower side of the scale
reflecting slight proliferation to the higher side reflecting
intense proliferation.
[1249] Experimental data are analyzed using an unpaired t test. A p
value of <0.05 is considered significant.
Steroid Impaired Rat Model
[1250] The inhibition of wound healing by steroids has been well
documented in various in vitro and in vivo systems (Wahl,
Glucocorticoids and Wound healing. In: Anti-Inflammatory Steroid
Action: Basic and Clinical Aspects. 280-302 (1989); Wahl et al., J.
Immunol. 115: 476-481 (1975); Werb et al., J. Exp. Med.
147:1684-1694 (1978)). Glucocorticoids retard wound healing by
inhibiting angiogenesis, decreasing vascular permeability (Ebert et
al., An. Intern. Med. 37:701-705 (1952)), fibroblast proliferation,
and collagen synthesis (Beck et al., Growth Factors. 5: 295-304
(1991); Haynes et al., J. Clin. Invest. 61: 703-797 (1978)) and
producing a transient reduction of circulating monocytes (Haynes et
al., J. Clin. Invest. 61: 703-797 (1978); Wahl, "Glucocorticoids
and wound healing", In: Antiinflammatory Steroid Action: Basic and
Clinical Aspects, Academic Press, New York, pp. 280-302 (1989)).
The systemic administration of steroids to impaired wound healing
is a well establish phenomenon in rats (Beck et al., Growth
Factors. 5: 295-304 (1991); Haynes et al., J. Clin. Invest. 61:
703-797 (1978); Wahl, "Glucocorticoids and wound healing", In:
Antiinflammatory Steroid Action: Basic and Clinical Aspects,
Academic Press, New York, pp. 280-302 (1989); Pierce et al., Proc.
Natl. Acad. Sci. USA 86: 2229-2233 (1989)).
[1251] To demonstrate that an agonist or antagonist of the
invention can accelerate the healing process, the effects of
multiple topical applications of the agonist or antagonist on full
thickness excisional skin wounds in rats in which healing has been
impaired by the systemic administration of methylprednisolone is
assessed.
[1252] Young adult male Sprague Dawley rats weighing 250-300 g
(Charles River Laboratories) are used in this example. The animals
are purchased at 8 weeks of age and are 9 weeks old at the
beginning of the study. The healing response of rats is impaired by
the systemic administration of methylprednisolone (17 mg/kg/rat
intramuscularly) at the time of wounding. Animals are individually
housed and received food and water ad libitum. All manipulations
are performed using aseptic techniques. This study is conducted
according to the rules and guidelines of Human Genome Sciences,
Inc. Institutional Animal Care and Use Committee and the Guidelines
for the Care and Use of Laboratory Animals.
[1253] The wounding protocol is followed according to section A,
above. On the day of wounding, animals are anesthetized with an
intramuscular injection of ketamine (50 mg/kg) and xylazine (5
mg/kg). The dorsal region of the animal is shaved and the skin
washed with 70% ethanol and iodine solutions. The surgical area is
dried with sterile gauze prior to wounding. An 8 mm full-thickness
wound is created using a Keyes tissue punch. The wounds are left
open for the duration of the experiment. Applications of the
testing materials are given topically once a day for 7 consecutive
days commencing on the day of wounding and subsequent to
methylprednisolone administration. Prior to treatment, wounds are
gently cleansed with sterile saline and gauze sponges.
[1254] Wounds are visually examined and photographed at a fixed
distance at the day of wounding and at the end of treatment. Wound
closure is determined by daily measurement on days 1-5 and on day
8. Wounds are measured horizontally and vertically using a
calibrated Jameson caliper. Wounds are considered healed if
granulation tissue is no longer visible and the wound is covered by
a continuous epithelium.
[1255] The agonist or antagonist of the invention is administered
using at a range different doses, from 4 mg to 500 mg per wound per
day for 8 days in vehicle. Vehicle control groups received 50 mL of
vehicle solution.
[1256] Animals are euthanized on day 8 with an intraperitoneal
injection of sodium pentobarbital (300 mg/kg). The wounds and
surrounding skin are then harvested for histology. Tissue specimens
are placed in 10% neutral buffered formalin in tissue cassettes
between biopsy sponges for further processing.
[1257] Three groups of 10 animals each (5 with methylprednisolone
and 5 without glucocorticoid) are evaluated: 1) Untreated group 2)
Vehicle placebo control 3) treated groups.
[1258] Wound closure is analyzed by measuring the area in the
vertical and horizontal axis and obtaining the total area of the
wound. Closure is then estimated by establishing the differences
between the initial wound area (day 0) and that of post treatment
(day 8). The wound area on day 1 is 64 mm.sup.2, the corresponding
size of the dermal punch. Calculations are made using the following
formula: [Open area on day 8]-[Open area on day 1]/[Open area on
day 1]
[1259] Specimens are fixed in 10% buffered formalin and paraffin
embedded blocks are sectioned perpendicular to the wound surface (5
mm) and cut using an Olympus microtome. Routine hematoxylin-eosin
(H&E) staining is performed on cross-sections of bisected
wounds. Histologic examination of the wounds allows assessment of
whether the healing process and the morphologic appearance of the
repaired skin is improved by treatment with an agonist or
antagonist of the invention. A calibrated lens micrometer is used
by a blinded observer to determine the distance of the wound
gap.
[1260] Experimental data are analyzed using an unpaired t test. A p
value of <0.05 is considered significant.
[1261] The studies described in this example tested activity of
agonists or antagonists of the invention. However, one skilled in
the art could easily modify the exemplified studies to test the
activity of polynucleotides or polypeptides of the invention (e.g.,
gene therapy).
Example 28
Lymphadema Animal Model
[1262] The purpose of this experimental approach is to create an
appropriate and consistent lymphedema model for testing the
therapeutic effects of an agonist or antagonist of the invention in
lymphangiogenesis and re-establishment of the lymphatic circulatory
system in the rat hind limb. Effectiveness is measured by swelling
volume of the affected limb, quantification of the amount of
lymphatic vasculature, total blood plasma protein, and
histopathology. Acute lymphedema is observed for 7-10 days. Perhaps
more importantly, the chronic progress of the edema is followed for
up to 3-4 weeks.
[1263] Prior to beginning surgery, blood sample is drawn for
protein concentration analysis. Male rats weighing approximately
.about.350 g are dosed with Pentobarbital. Subsequently, the right
legs are shaved from knee to hip. The shaved area is swabbed with
gauze soaked in 70% EtOH. Blood is drawn for serum total protein
testing. Circumference and volumetric measurements are made prior
to injecting dye into paws after marking 2 measurement levels (0.5
cm above heel, at mid-pt of dorsal paw). The intradermal dorsum of
both right and left paws are injected with 0.05 ml of 1% Evan's
Blue. Circumference and volumetric measurements are then made
following injection of dye into paws.
[1264] Using the knee joint as a landmark, a mid-leg inguinal
incision is made circumferentially allowing the femoral vessels to
be located. Forceps and hemostats are used to dissect and separate
the skin flaps. After locating the femoral vessels, the lymphatic
vessel that runs along side and underneath the vessel(s) is
located. The main lymphatic vessels in this area are then
electrically coagulated or suture ligated.
[1265] Using a microscope, muscles in back of the leg (near the
semitendinosis and adductors) are bluntly dissected. The popliteal
lymph node is then located. The 2 proximal and 2 distal lymphatic
vessels and distal blood supply of the popliteal node are then
ligated by suturing. The popliteal lymph node, and any accompanying
adipose tissue, is then removed by cutting connective tissues.
[1266] Care is taken to control any mild bleeding resulting from
this procedure. After lymphatics are occluded, the skin flaps are
sealed by using liquid skin (Vetbond) (AJ Buck). The separated skin
edges are sealed to the underlying muscle tissue while leaving a
gap of 0.5 cm around the leg. Skin also may be anchored by suturing
to underlying muscle when necessary.
[1267] To avoid infection, animals are housed individually with
mesh (no bedding). Recovering animals are checked daily through the
optimal edematous peak, which typically occurred by day 5-7. The
plateau edematous peak are then observed. To evaluate the intensity
of the lymphedema, the circumference and volumes of 2 designated
places on each paw before operation and daily for 7 days are
measured. The effect of plasma proteins on lymphedema is determined
and whether protein analysis is a useful testing perimeter is also
investigated. The weights of both control and edematous limbs are
evaluated at 2 places. Analysis is performed in a blind manner.
[1268] Circumference Measurements: Under brief gas anesthetic to
prevent limb movement, a cloth tape is used to measure limb
circumference. Measurements are done at the ankle bone and dorsal
paw by 2 different people and those 2 readings are averaged.
Readings are taken from both control and edematous limbs.
[1269] Volumetric Measurements: On the day of surgery, animals are
anesthetized with Pentobarbital and are tested prior to surgery.
For daily volumetrics animals are under brief halothane anesthetic
(rapid immobilization and quick recovery), and both legs are shaved
and equally marked using waterproof marker on legs. Legs are first
dipped in water, then dipped into instrument to each marked level
then measured by Buxco edema software (Chen/Victor). Data is
recorded by one person, while the other is dipping the limb to
marked area.
[1270] Blood-plasma protein measurements: Blood is drawn, spun, and
serum separated prior to surgery and then at conclusion for total
protein and Ca.sup.2+ comparison.
[1271] Limb Weight Comparison: After drawing blood, the animal is
prepared for tissue collection. The limbs are amputated using a
quillitine, then both experimental and control legs are cut at the
ligature and weighed. A second weighing is done as the
tibio-cacaneal joint is disarticulated and the foot is weighed.
[1272] Histological Preparations: The transverse muscle located
behind the knee (popliteal) area is dissected and arranged in a
metal mold, filled with freezeGel, dipped into cold methylbutane,
placed into labeled sample bags at -80 EC until sectioning. Upon
sectioning, the muscle is observed under fluorescent microscopy for
lymphatics.
[1273] The studies described in this example tested activity of
agonists or antagonists of the invention. However, one skilled in
the art could easily modify the exemplified studies to test the
activity of polynucleotides or polypeptides of the invention (e.g.,
gene therapy).
Example 29
Suppression of TNF Alpha-Induced Adhesion Molecule Expression by an
Agonist or Antagonist of the Invention
[1274] The recruitment of lymphocytes to areas of inflammation and
angiogenesis involves specific receptor-ligand interactions between
cell surface adhesion molecules (CAMs) on lymphocytes and the
vascular endothelium. The adhesion process, in both normal and
pathological settings, follows a multi-step cascade that involves
intercellular adhesion molecule-1 (ICAM-1), vascular cell adhesion
molecule-1 (VCAM-1), and endothelial leukocyte adhesion molecule-1
(E-selectin) expression on endothelial cells (EC). The expression
of these molecules and others on the vascular endothelium
determines the efficiency with which leukocytes may adhere to the
local vasculature and extravasate into the local tissue during the
development of an inflammatory response. The local concentration of
cytokines and growth factor participate in the modulation of the
expression of these CAMs.
[1275] Tumor necrosis factor alpha (TNF-a), a potent
proinflammatory cytokine, is a stimulator of all three CAMs on
endothelial cells and may be involved in a wide variety of
inflammatory responses, often resulting in a pathological
outcome.
[1276] The potential of an agonist or antagonist of the invention
to mediate a suppression of TNF-a induced CAM expression can be
examined. A modified ELISA assay which uses ECs as a solid phase
absorbent is employed to measure the amount of CAM expression on
TNF-a treated ECs when co-stimulated with a member of the FGF
family of proteins.
[1277] To perform the experiment, human umbilical vein endothelial
cell (HUVEC) cultures are obtained from pooled cord harvests and
maintained in growth medium (EGM-2; Clonetics, San Diego, Calif.)
supplemented with 10% FCS and 1% penicillin/streptomycin in a 37
degree C. humidified incubator containing 5% CO.sub.2. HUVECs are
seeded in 96-well plates at concentrations of 1.times.10.sup.4
cells/well in EGM medium at 37 degree C. for 18-24 hrs or until
confluent. The monolayers are subsequently washed 3 times with a
serum-free solution of RPMI-1640 supplemented with 100 U/ml
penicillin and 100 mg/ml streptomycin, and treated with a given
cytokine and/or growth factor(s) for 24 h at 37 degree C. Following
incubation, the cells are then evaluated for CAM expression.
[1278] Human Umbilical Vein Endothelial cells (HUVECs) are grown in
a standard 96 well plate to confluence. Growth medium is removed
from the cells and replaced with 90 ul of 199 Medium (10% FBS).
Samples for testing and positive or negative controls are added to
the plate in triplicate (in 10 ul volumes). Plates are incubated at
37 degree C. for either 5 h (selectin and integrin expression) or
24 h (integrin expression only). Plates are aspirated to remove
medium and 100 .mu.l of 0.1% paraformaldehyde-PBS (with Ca++ and
Mg++) is added to each well. Plates are held at 4.degree. C. for 30
min.
[1279] Fixative is then removed from the wells and wells are washed
1.times. with PBS (+Ca,Mg)+0.5% BSA and drained. Do not allow the
wells to dry. Add 10 .mu.l of diluted primary antibody to the test
and control wells. Anti-ICAM-1-Biotin, Anti-VCAM-1-Biotin and
Anti-E-selectin-Biotin are used at a concentration of 10 .mu.g/ml
(1:10 dilution of 0.1 mg/ml stock antibody). Cells are incubated at
37.degree. C. for 30 min. in a humidified environment. Wells are
washed X3 with PBS (+Ca,Mg)+0.5% BSA.
[1280] Then add 20 .mu.l of diluted ExtrAvidin-Alkaline Phosphotase
(1:5,000 dilution) to each well and incubated at 37.degree. C. for
30 min. Wells are washed X3 with PBS (+Ca,Mg)+0.5% BSA. 1 tablet of
p-Nitrophenol Phosphate pNPP is dissolved in 5 ml of glycine buffer
(pH 10.4). 100 .mu.l of pNPP substrate in glycine buffer is added
to each test well. Standard wells in triplicate are prepared from
the working dilution of the ExtrAvidin-Alkaline Phosphotase in
glycine buffer: 1:5,000
(10.sup.0)>10.sup.-0.5>10.sup.-1>10.sup.-1.50.5 .mu.l of
each dilution is added to triplicate wells and the resulting AP
content in each well is 5.50 ng, 1.74 ng, 0.55 ng, 0.18 ng. 100
.mu.l of pNNP reagent must then be added to each of the standard
wells. The plate must be incubated at 37.degree. C. for 4 h. A
volume of 50 .mu.l of 3M NaOH is added to all wells. The results
are quantified on a plate reader at 405 nm. The background
subtraction option is used on blank wells filled with glycine
buffer only. The template is set up to indicate the concentration
of AP-conjugate in each standard well [5.50 ng; 1.74 ng; 0.55 ng;
0.18 ng]. Results are indicated as amount of bound AP-conjugate in
each sample.
[1281] The studies described in this example tested activity of
agonists or antagonists of the invention. However, one skilled in
the art could easily modify the exemplified studies to test the
activity of polynucleotides or polypeptides of the invention (e.g.,
gene therapy).
Example 30
Production Of Polypeptide of the Invention For High-Throughput
Screening Assays
[1282] The following protocol produces a supernatant containing
polypeptide of the present invention to be tested. This supernatant
can then be used in the Screening Assays described in Examples
32-41.
[1283] First, dilute Poly-D-Lysine (644 587 Boehringer-Mannheim)
stock solution (1 mg/ml in PBS) 1:20 in PBS (w/o calcium or
magnesium 17-516F Biowhittaker) for a working solution of 50 ug/ml.
Add 200 ul of this solution to each well (24 well plates) and
incubate at RT for 20 minutes. Be sure to distribute the solution
over each well (note: a 12-channel pipetter may be used with tips
on every other channel). Aspirate off the Poly-D-Lysine solution
and rinse with 1 ml PBS (Phosphate Buffered Saline). The PBS should
remain in the well until just prior to plating the cells and plates
may be poly-lysine coated in advance for up to two weeks.
[1284] Plate 293T cells (do not carry cells past P+20) at
2.times.10.sup.5 cells/well in 0.5 ml DMEM (Dulbecco's Modified
Eagle Medium)(with 4.5 G/L glucose and L-glutamine (12-604F
Biowhittaker))/10% heat inactivated FBS (14-503F
Biowhittaker)/1.times. Penstrep (17-602E Biowhittaker). Let the
cells grow overnight.
[1285] The next day, mix together in a sterile solution basin: 300
ul Lipofectamine (18324-012 Gibco/BRL) and 5 ml Optimem I (31985070
Gibco/BRL)/96-well plate. With a small volume multi-channel
pipetter, aliquot approximately 2 ug of an expression vector
containing a polynucleotide insert, produced by the methods
described in Examples 8-10, into an appropriately labeled 96-well
round bottom plate. With a multi-channel pipetter, add 50 ul of the
Lipofectamine/Optimem I mixture to each well. Pipette up and down
gently to mix. Incubate at RT 15-45 minutes. After about 20
minutes, use a multi-channel pipetter to add 150 ul Optimem I to
each well. As a control, one plate of vector DNA lacking an insert
should be transfected with each set of transfections.
[1286] Preferably, the transfection should be performed by
tag-teaming the following tasks. By tag-teaming, hands on time is
cut in half, and the cells do not spend too much time on PBS.
First, person A aspirates off the media from four 24-well plates of
cells, and then person B rinses each well with 0.5-1 ml PBS. Person
A then aspirates off PBS rinse, and person B, using a12-channel
pipetter with tips on every other channel, adds the 200 ul of
DNA/Lipofectamine/Optimem I complex to the odd wells first, then to
the even wells, to each row on the 24-well plates. Incubate at 37
degree C. for 6 hours.
[1287] While cells are incubating, prepare appropriate media,
either 1% BSA in DMEM with 1.times. penstrep, or HGS CHO-5 media
(116.6 mg/L of CaCl.sub.2 (anhyd); 0.00130 mg/L
CuSO.sub.4-5H.sub.2O; 0.050 mg/L of Fe(NO.sub.3).sub.3-9H.sub.2O;
0.417 mg/L of FeSO.sub.4.7H.sub.2O; 311.80 mg/L of Kcl; 28.64 mg/L
of MgCl.sub.2; 48.84 mg/L of MgSO.sub.4; 6995.50 mg/L of NaCl;
2400.0 mg/L of NaHCO.sub.3; 62.50 mg/L of
NaH.sub.2PO.sub.4--H.sub.2O; 71.02 mg/L of Na.sub.2HPO4; 0.4320
mg/L of ZnSO.sub.4-7H.sub.2O; 0.002 mg/L of Arachidonic Acid; 1.022
mg/L of Cholesterol; 0.070 mg/L of DL-alpha-Tocopherol-Acetate;
0.0520 mg/L of Linoleic Acid; 0.010 mg/L of Linolenic Acid; 0.010
mg/L of Myristic Acid; 0.010 mg/L of Oleic Acid; 0.010 mg/L of
Palmitric Acid; 0.010 mg/L of Palmitic Acid; 100 mg/L of Pluronic
F-68; 0.010 mg/L of Stearic Acid; 2.20 mg/L of Tween 80; 4551 mg/L
of D-Glucose; 130.85 mg/ml of L-Alanine; 147.50 mg/ml of
L-Arginine-HCL; 7.50 mg/ml of L-Asparagine-H.sub.20; 6.65 mg/ml of
L-Aspartic Acid; 29.56 mg/ml of L-Cystine-2HCL-H.sub.20; 31.29
mg/ml of L-Cystine-2HCL; 7.35 mg/ml of L-Glutamic Acid; 365.0 mg/ml
of L-Glutamine; 18.75 mg/ml of Glycine; 52.48 mg/ml of
L-Histidine-HCL-H.sub.20; 106.97 mg/ml of L-Isoleucine; 111.45
mg/ml of L-Leucine; 163.75 mg/ml of L-Lysine HCL; 32.34 mg/ml of
L-Methionine; 68.48 mg/ml of L-Phenylalainine; 40.0 mg/ml of
L-Proline; 26.25 mg/ml of L-Serine; 101.05 mg/ml of L-Threonine;
19.22 mg/ml of L-Tryptophan; 91.79 mg/ml of
L-Tryrosine-2Na-2H.sub.20; and 99.65 mg/ml of L-Valine; 0.0035 mg/L
of Biotin; 3.24 mg/L of D-Ca Pantothenate; 11.78 mg/L of Choline
Chloride; 4.65 mg/L of Folic Acid; 15.60 mg/L of i-Inositol; 3.02
mg/L of Niacinamide; 3.00 mg/L of Pyridoxal HCL; 0.031 mg/L of
Pyridoxine HCL; 0.319 mg/L of Riboflavin; 3.17 mg/L of Thiamine
HCL; 0.365 mg/L of Thymidine; 0.680 mg/L of Vitamin B.sub.12; 25 mM
of HEPES Buffer; 2.39 mg/L of Na Hypoxanthine; 0.105 mg/L of Lipoic
Acid; 0.081 mg/L of Sodium Putrescine-2HCL; 55.0 mg/L of Sodium
Pyruvate; 0.0067 mg/L of Sodium Selenite; 20 uM of Ethanolamine;
0.122 mg/L of Ferric Citrate; 41.70 mg/L of Methyl-B-Cyclodextrin
complexed with Linoleic Acid; 33.33 mg/L of Methyl-B-Cyclodextrin
complexed with Oleic Acid; 10 mg/L of Methyl-B-Cyclodextrin
complexed with Retinal Acetate. Adjust osmolarity to 327 mOsm) with
2 mm glutamine and 1.times. penstrep. (BSA (81-068-3 Bayer) 100 gm
dissolved in IL DMEM for a 10% BSA stock solution). Filter the
media and collect 50 ul for endotoxin assay in 15 ml polystyrene
conical.
[1288] The transfection reaction is terminated, preferably by
tag-teaming, at the end of the incubation period. Person A
aspirates off the transfection media, while person B adds 1.5 ml
appropriate media to each well. Incubate at 37 degree C. for 45 or
72 hours depending on the media used: 1% BSA for 45 hours or CHO-5
for 72 hours.
[1289] On day four, using a 300 ul multichannel pipetter, aliquot
600 ul in one 1 ml deep well plate and the remaining supernatant
into a 2 ml deep well. The supernatants from each well can then be
used in the assays described in Examples 32-39.
[1290] It is specifically understood that when activity is obtained
in any of the assays described below using a supernatant, the
activity originates from either the polypeptide of the present
invention directly (e.g., as a secreted protein) or by polypeptide
of the present invention inducing expression of other proteins,
which are then secreted into the supernatant. Thus, the invention
further provides a method of identifying the protein in the
supernatant characterized by an activity in a particular assay.
Example 31
Construction of GAS Reporter Construct
[1291] One signal transduction pathway involved in the
differentiation and proliferation of cells is called the Jaks-STATs
pathway. Activated proteins in the Jaks-STATs pathway bind to gamma
activation site "GAS" elements or interferon-sensitive responsive
element ("ISRE"), located in the promoter of many genes. The
binding of a protein to these elements alter the expression of the
associated gene.
[1292] GAS and ISRE elements are recognized by a class of
transcription factors called Signal Transducers and Activators of
Transcription, or "STATs." There are six members of the STATs
family. Stat1 and Stat3 are present in many cell types, as is Stat2
(as response to IFN-alpha is widespread). Stat4 is more restricted
and is not in many cell types though it has been found in T helper
class I, cells after treatment with IL-12. Stat5 was originally
called mammary growth factor, but has been found at higher
concentrations in other cells including myeloid cells. It can be
activated in tissue culture cells by many cytokines.
[1293] The STATs are activated to translocate from the cytoplasm to
the nucleus upon tyrosine phosphorylation by a set of kinases known
as the Janus Kinase ("Jaks") family. Jaks represent a distinct
family of soluble tyrosine kinases and include Tyk2, Jak1, Jak2,
and Jak3. These kinases display significant sequence similarity and
are generally catalytically inactive in resting cells.
[1294] The Jaks are activated by a wide range of receptors
summarized in the Table below. (Adapted from review by Schidler and
Darnell, Ann. Rev. Biochem. 64:621-51 (1995)). A cytokine receptor
family, capable of activating Jaks, is divided into two groups: (a)
Class 1 includes receptors for IL-2, IL-3, IL-4, IL-6, IL-7, IL-9,
IL-11, IL-12, IL-15, Epo, PRL, GH, G-CSF, GM-CSF, LIF, CNTF, and
thrombopoietin; and (b) Class 2 includes IFN-a, IFN-g, and IL-10.
The Class 1 receptors share a conserved cysteine motif (a set of
four conserved cysteines and one tryptophan) and a WSXWS motif (a
membrane proximal region encoding Trp-Ser-Xaa-Trp-Ser (SEQ ID NO:
2)).
[1295] Thus, on binding of a ligand to a receptor, Jaks are
activated, which in turn activate STATs, which then translocate and
bind to GAS elements. This entire process is encompassed in the
Jaks-STATs signal transduction pathway. Therefore, activation of
the Jaks-STATs pathway, reflected by the binding of the GAS or the
ISRE element, can be used to indicate proteins involved in the
proliferation and differentiation of cells. For example, growth
factors and cytokines are known to activate the Jaks-STATs pathway
(See Table below). Thus, by using GAS elements linked to reporter
molecules, activators of the Jaks-STATs pathway can be identified.
TABLE-US-00016 JAKs Ligand tyk2 Jak1 Jak2 Jak3 STATS GAS(elements)
or ISRE IFN family IFN-a/B + + - - 1, 2, 3 ISRE IFN-g + + - 1 GAS
(IRF1 > Lys6 > IFP) Il-10 + ? ? - 1, 3 gp130 family IL-6
(Pleiotropic) + + + ? 1, 3 GAS (IRF1 > Lys6 > IFP) Il-11
(Pleiotropic) ? + ? ? 1, 3 OnM (Pleiotropic) ? + + ? 1, 3 LIF
(Pleiotropic) ? + + ? 1, 3 CNTF (Pleiotropic) -/+ + + ? 1, 3 G-CSF
(Pleiotropic) ? + ? ? 1, 3 IL-12 (Pleiotropic) + - + + 1, 3 g-C
family IL-2 (lymphocytes) - + - + 1, 3, 5 GAS IL-4 (lymph/myeloid)
- + - + 6 GAS (IRF1 = IFP >> Ly6)(IgH) IL-7 (lymphocytes) - +
- + 5 GAS IL-9 (lymphocytes) - + - + 5 GAS IL-13 (lymphocyte) - + ?
? 6 GAS IL-15 ? + ? + 5 GAS gp140 family IL-3 (myeloid) - - + - 5
GAS (IRF1 > IFP >> Ly6) IL-5 (myeloid) - - + - 5 GAS
GM-CSF (myeloid) - - + - 5 GAS Growth hormone family GH ? - + - 5
PRL ? +/- + - 1, 3, 5 EPO ? - + - 5 GAS(B-CAS > IRF1 = IFP
>> Ly6) Receptor Tyrosine Kinases EGF ? + + - 1, 3 GAS (IRF1)
PDGF ? + + - 1, 3 CSF-1 ? + + - 1, 3 GAS (not IRF1)
[1296] To construct a synthetic GAS containing promoter element,
which is used in the Biological Assays described in Examples 32-33,
a PCR based strategy is employed to generate a GAS-SV40 promoter
sequence. The 5' primer contains four tandem copies of the GAS
binding site found in the IRF1 promoter and previously demonstrated
to bind STATs upon induction with a range of cytokines (Rothman et
al., Immunity 1:457-468 (1994).), although other GAS or ISRE
elements can be used instead. The 5' primer also contains 18 bp of
sequence complementary to the SV40 early promoter sequence and is
flanked with an XhoI site. The sequence of the 5' primer is:
TABLE-US-00017 5':GCGCCTCGAGATTTCCCCGAAATCTAGATTTCCC (SEQ ID NO:3)
CGAAATGATTTCCCCGAAATGATTTCCCCGAAATATC TGCCATCTCAATTAG:3'
[1297] The downstream primer is complementary to the SV40 promoter
and is flanked with a Hind III site:
5':GCGGCAAGCTTTTTGCAAAGCCTAGGC:3' (SEQ ID NO: 4)
[1298] PCR amplification is performed using the SV40 promoter
template present in the B-gal:promoter plasmid obtained from
Clontech. The resulting PCR fragment is digested with XhoI/Hind III
and subcloned into BLSK2-. (Stratagene.) Sequencing with forward
and reverse primers confirms that the insert contains the following
sequence: TABLE-US-00018 5':CTCGAGATTTCCCCGAAATCTAGATTTCCCCGAA (SEQ
ID NO:5) ATGATTTCCCCGAAATGATTTCCCCGAAATATCTGCC
ATCTCAATTAGTCAGCAACCATAGTCCCGCCCCTAAC
TCCGCCCATCCCGCCCCTAACTCCGCCCAGTTCCGCC
CATTCTCCGCCCCATGGCTGACTAATTTTTTTTATTT
ATGCAGAGGCCGAGGCCGCCTCGGCCTCTGAGCTATT
CCAGAAGTAGTGAGGAGGCTTTTTTGGAGGCCTAGGC TTTTGCAAAAAGCTT:3'
[1299] With this GAS promoter element linked to the SV40 promoter,
a GAS:SEAP2 reporter construct is next engineered. Here, the
reporter molecule is a secreted alkaline phosphatase, or "SEAP."
Clearly, however, any reporter molecule can be instead of SEAP, in
this or in any of the other Examples. Well known reporter molecules
that can be used instead of SEAP include chloramphenicol
acetyltransferase (CAT), luciferase, alkaline phosphatase,
B-galactosidase, green fluorescent protein (GFP), or any protein
detectable by an antibody.
[1300] The above sequence confirmed synthetic GAS-SV40 promoter
element is subcloned into the pSEAP-Promoter vector obtained from
Clontech using HindIII and XhoI, effectively replacing the SV40
promoter with the amplified GAS:SV40 promoter element, to create
the GAS-SEAP vector. However, this vector does not contain a
neomycin resistance gene, and therefore, is not preferred for
mammalian expression systems.
[1301] Thus, in order to generate mammalian stable cell lines
expressing the GAS-SEAP reporter, the GAS-SEAP cassette is removed
from the GAS-SEAP vector using SalI and NotI, and inserted into a
backbone vector containing the neomycin resistance gene, such as
pGFP-1 (Clontech), using these restriction sites in the multiple
cloning site, to create the GAS-SEAP/Neo vector. Once this vector
is transfected into mammalian cells, this vector can then be used
as a reporter molecule for GAS binding as described in Examples
32-33.
[1302] Other constructs can be made using the above description and
replacing GAS with a different promoter sequence. For example,
construction of reporter molecules containing EGR and NF-KB
promoter sequences are described in Examples 34 and 35. However,
many other promoters can be substituted using the protocols
described in these Examples. For instance, SRE, IL-2, NFAT, or
Osteocalcin promoters can be substituted, alone or in combination
(e.g., GAS/NF-KB/EGR, GAS/NF-KB, 11-2/NFAT, or NF-KB/GAS).
Similarly, other cell lines can be used to test reporter construct
activity, such as HELA (epithelial), HUVEC (endothelial), Reh
(B-cell), Saos-2 (osteoblast), HUVAC (aortic), or
Cardiomyocyte.
Example 32
High-Throughput Screening Assay for T-Cell Activity
[1303] The following protocol is used to assess T-cell activity by
identifying factors, and determining whether supernate containing a
polypeptide of the invention proliferates and/or differentiates
T-cells. T-cell activity is assessed using the GAS/SEAP/Neo
construct produced in Example 31. Thus, factors that increase SEAP
activity indicate the ability to activate the Jaks-STATS signal
transduction pathway. The T-cell used in this assay is Jurkat
T-cells (ATCC Accession No. TIB-152), although Molt-3 cells (ATCC
Accession No. CRL-1552) and Molt-4 cells (ATCC Accession No.
CRL-1582) cells can also be used.
[1304] Jurkat T-cells are lymphoblastic CD4+ Th1 helper cells. In
order to generate stable cell lines, approximately 2 million Jurkat
cells are transfected with the GAS-SEAP/neo vector using DMRIE-C
(Life Technologies)(transfection procedure described below). The
transfected cells are seeded to a density of approximately 20,000
cells per well and transfectants resistant to 1 mg/ml genticin
selected. Resistant colonies are expanded and then tested for their
response to increasing concentrations of interferon gamma. The dose
response of a selected clone is demonstrated.
[1305] Specifically, the following protocol will yield sufficient
cells for 75 wells containing 200 ul of cells. Thus, it is either
scaled up, or performed in multiple to generate sufficient cells
for multiple 96 well plates. Jurkat cells are maintained in
RPMI+10% serum with 1% Pen-Strep. Combine 2.5 mls of OPTI-MEM (Life
Technologies) with 10 ug of plasmid DNA in a T25 flask. Add 2.5 ml
OPTI-MEM containing 50 ul of DMRIE-C and incubate at room
temperature for 15-45 mins.
[1306] During the incubation period, count cell concentration, spin
down the required number of cells (10.sup.7 per transfection), and
resuspend in OPTI-MEM to a final concentration of 10.sup.7
cells/ml. Then add 1 ml of 1.times.10.sup.7 cells in OPTI-MEM to
T25 flask and incubate at 37 degree C. for 6 hrs. After the
incubation, add 10 ml of RPMI+15% serum.
[1307] The Jurkat:GAS-SEAP stable reporter lines are maintained in
RPMI+10% serum, 1 mg/ml Genticin, and 1% Pen-Strep. These cells are
treated with supernatants containing polypeptide of the present
invention or polypeptide of the present invention induced
polypeptides as produced by the protocol described in Example
30.
[1308] On the day of treatment with the supernatant, the cells
should be washed and resuspended in fresh RPMI+10% serum to a
density of 500,000 cells per ml. The exact number of cells required
will depend on the number of supernatants being screened. For one
96 well plate, approximately 10 million cells (for 10 plates, 100
million cells) are required.
[1309] Transfer the cells to a triangular reservoir boat, in order
to dispense the cells into a 96 well dish, using a 12 channel
pipette. Using a 12 channel pipette, transfer 200 ul of cells into
each well (therefore adding 100,000 cells per well).
[1310] After all the plates have been seeded, 50 ul of the
supernatants are transferred directly from the 96 well plate
containing the supernatants into each well using a 12 channel
pipette. In addition, a dose of exogenous interferon gamma (0.1,
1.0, 10 ng) is added to wells H9, H10, and H11 to serve as
additional positive controls for the assay.
[1311] The 96 well dishes containing Jurkat cells treated with
supernatants are placed in an incubator for 48 hrs (note: this time
is variable between 48-72 hrs). 35 ul samples from each well are
then transferred to an opaque 96 well plate using a 12 channel
pipette. The opaque plates should be covered (using sellophene
covers) and stored at -20 degree C. until SEAP assays are performed
according to Example 36. The plates containing the remaining
treated cells are placed at 4 degree C. and serve as a source of
material for repeating the assay on a specific well if desired.
[1312] As a positive control, 100 Unit/ml interferon gamma can be
used which is known to activate Jurkat T cells. Over 30 fold
induction is typically observed in the positive control wells.
[1313] The above protocol may be used in the generation of both
transient, as well as, stable transfected cells, which would be
apparent to those of skill in the art.
Example 33
High-Throughput Screening Assay Identifying Myeloid Activity
[1314] The following protocol is used to assess myeloid activity of
polypeptide of the present invention by determining whether
polypeptide of the present invention proliferates and/or
differentiates myeloid cells. Myeloid cell activity is assessed
using the GAS/SEAP/Neo construct produced in Example 31. Thus,
factors that increase SEAP activity indicate the ability to
activate the Jaks-STATS signal transduction pathway. The myeloid
cell used in this assay is U937, a pre-monocyte cell line, although
TF-1, HL60, or KG1 can be used.
[1315] To transiently transfect U937 cells with the GAS/SEAP/Neo
construct produced in Example 31, a DEAE-Dextran method (Kharbanda
et. al., 1994, Cell Growth & Differentiation, 5:259-265) is
used. First, harvest 2.times.10.sup.7 U937 cells and wash with PBS.
The U937 cells are usually grown in RPMI 1640 medium containing 10%
heat-inactivated fetal bovine serum (FBS) supplemented with 100
units/ml penicillin and 100 mg/ml streptomycin.
[1316] Next, suspend the cells in 1 ml of 20 mM Tris-HCl (pH 7.4)
buffer containing 0.5 mg/ml DEAE-Dextran, 8 ug GAS-SEAP2 plasmid
DNA, 140 mM NaCl, 5 mM KCl, 375 uM Na.sub.2HPO.sub.4.7H.sub.2O, 1
mM MgCl.sub.2, and 675 uM CaCl.sub.2. Incubate at 37 degrees C. for
45 min.
[1317] Wash the cells with RPMI 1640 medium containing 10% FBS and
then resuspend in 10 ml complete medium and incubate at 37 degree
C. for 36 hr.
[1318] The GAS-SEAP/U937 stable cells are obtained by growing the
cells in 400 ug/ml G418. The G418-free medium is used for routine
growth but every one to two months, the cells should be re-grown in
400 ug/ml G418 for couple of passages.
[1319] These cells are tested by harvesting 1.times.10.sup.8 cells
(this is enough for ten 96-well plates assay) and wash with PBS.
Suspend the cells in 200 ml above described growth medium, with a
final density of 5.times.10.sup.5 cells/ml. Plate 200 ul cells per
well in the 96-well plate (or 1.times.10.sup.5 cells/well).
[1320] Add 50 ul of the supernatant prepared by the protocol
described in Example 30. Incubate at 37 degree C for 48 to 72 hr.
As a positive control, 100 Unit/ml interferon gamma can be used
which is known to activate U937 cells. Over 30 fold induction is
typically observed in the positive control wells. SEAP assay the
supernatant according to the protocol described in Example 36.
Example 34
High-Throughput Screening Assay Identifying Neuronal Activity
[1321] When cells undergo differentiation and proliferation, a
group of genes are activated through many different signal
transduction pathways. One of these genes, EGRL (early growth
response gene 1), is induced in various tissues and cell types upon
activation. The promoter of EGR1 is responsible for such induction.
Using the EGR1 promoter linked to reporter molecules, activation of
cells can be assessed by polypeptide of the present invention.
[1322] Particularly, the following protocol is used to assess
neuronal activity in PC12 cell lines. PC12 cells (rat
phenochromocytoma cells) are known to proliferate and/or
differentiate by activation with a number of mitogens, such as TPA
(tetradecanoyl phorbol acetate), NGF (nerve growth factor), and EGF
(epidermal growth factor). The EGR1 gene expression is activated
during this treatment. Thus, by stably transfecting PC12 cells with
a construct containing an EGR promoter linked to SEAP reporter,
activation of PC12 cells by polypeptide of the present invention
can be assessed.
[1323] The EGR/SEAP reporter construct can be assembled by the
following protocol. The EGR-1 promoter sequence (-633 to
+1)(Sakamoto K et al., Oncogene 6:867-871 (1991)) can be PCR
amplified from human genomic DNA using the following primers:
TABLE-US-00019 5' GCGCTCGAGGGATGACAGCGATAGAACCCCGG- (SEQ ID NO:6)
3' 5' GCGAAGCTTCGCGACTCCCCGGATCCGCCTC-3' (SEQ ID NO:7)
[1324] Using the GAS:SEAP/Neo vector produced in Example 31, EGR1
amplified product can then be inserted into this vector. Linearize
the GAS:SEAP/Neo vector using restriction enzymes XhoI/HindIII,
removing the GAS/SV40 stuffer. Restrict the EGR1 amplified product
with these same enzymes. Ligate the vector and the EGR1
promoter.
[1325] To prepare 96 well-plates for cell culture, two mls of a
coating solution (1:30 dilution of collagen type I (Upstate Biotech
Inc. Cat#08-115) in 30% ethanol (filter sterilized)) is added per
one 10 cm plate or 50 ml per well of the 96-well plate, and allowed
to air dry for 2 hr.
[1326] PC12 cells are routinely grown in RPMI-1640 medium (Bio
Whittaker) containing 10% horse serum (JRH BIOSCIENCES, Cat. #
12449-78P), 5% heat-inactivated fetal bovine serum (FBS)
supplemented with 100 units/ml penicillin and 100 ug/ml
streptomycin on a precoated 10 cm tissue culture dish. One to four
split is done every three to four days. Cells are removed from the
plates by scraping and resuspended with pipetting up and down for
more than 15 times.
[1327] Transfect the EGR/SEAP/Neo construct into PC12 using the
Lipofectamine protocol described in Example 30. EGR-SEAP/PC12
stable cells are obtained by growing the cells in 300 ug/ml G418.
The G418-free medium is used for routine growth but every one to
two months, the cells should be re-grown in 300 ug/ml G418 for
couple of passages.
[1328] To assay for neuronal activity, a 10 cm plate with cells
around 70 to 80% confluent is screened by removing the old medium.
Wash the cells once with PBS (Phosphate buffered saline). Then
starve the cells in low serum medium (RPMI-1640 containing 1% horse
serum and 0.5% FBS with antibiotics) overnight.
[1329] The next morning, remove the medium and wash the cells with
PBS. Scrape off the cells from the plate, suspend the cells well in
2 ml low serum medium. Count the cell number and add more low serum
medium to reach final cell density as 5.times.10.sup.5
cells/ml.
[1330] Add 200 ul of the cell suspension to each well of 96-well
plate (equivalent to 1.times.10.sup.5 cells/well). Add 50 ul
supernatant produced by Example 30, 37 degree C. for 48 to 72 hr.
As a positive control, a growth factor known to activate PC12 cells
through EGR can be used, such as 50 ng/ul of Neuronal Growth Factor
(NGF). Over fifty-fold induction of SEAP is typically seen in the
positive control wells. SEAP assay the supernatant according to
Example 36.
Example 35
High-Throughput Screening Assay for T-Cell Activity
[1331] NF-KB (Nuclear Factor KB) is a transcription factor
activated by a wide variety of agents including the inflammatory
cytokines IL-1 and TNF, CD30 and CD40, lymphotoxin-alpha and
lymphotoxin-beta, by exposure to LPS or thrombin, and by expression
of certain viral gene products. As a transcription factor, NF-KB
regulates the expression of genes involved in immune cell
activation, control of apoptosis (NF-KB appears to shield cells
from apoptosis), B and T-cell development, anti-viral and
antimicrobial responses, and multiple stress responses.
[1332] In non-stimulated conditions, NF-KB is retained in the
cytoplasm with I-KB (Inhibitor KB). However, upon stimulation, I-KB
is phosphorylated and degraded, causing NF-KB to shuttle to the
nucleus, thereby activating transcription of target genes. Target
genes activated by NF-KB include IL-2, IL-6, GM-CSF, ICAM-1 and
class 1 MHC.
[1333] Due to its central role and ability to respond to a range of
stimuli, reporter constructs utilizing the NF-KB promoter element
are used to screen the supernatants produced in Example 30.
Activators or inhibitors of NF-KB would be useful in treating,
preventing, and/or diagnosing diseases. For example, inhibitors of
NF-KB could be used to treat those diseases related to the acute or
chronic activation of NF-KB, such as rheumatoid arthritis.
[1334] To construct a vector containing the NF-KB promoter element,
a PCR based strategy is employed. The upstream primer contains four
tandem copies of the NF-KB binding site (GGGGACTTTCCC) (SEQ ID NO:
8), 18 bp of sequence complementary to the 5' end of the SV40 early
promoter sequence, and is flanked with an XhoI site: TABLE-US-00020
5':GCGGCCTCGAGGGGACTTTCCCGGGGACTTTCCG (SEQ ID NO:9)
GGGACTTTCCGGGACTTTCCATCCTGCCATCTCAATT AG:3'
[1335] The downstream primer is complementary to the 3' end of the
SV40 promoter and is flanked with a Hind III site: TABLE-US-00021
5':GCGGCAAGCTTTTTGCAAAGCCTAGGC:3' (SEQ ID NO:4)
[1336] PCR amplification is performed using the SV40 promoter
template present in the pB-gal:promoter plasmid obtained from
Clontech. The resulting PCR fragment is digested with XhoI and Hind
III and subcloned into BLSK2-. (Stratagene) Sequencing with the T7
and T3 primers confirms the insert contains the following sequence:
TABLE-US-00022 5':CTCGAGGGGACTTTCCCGGGGACTTTCCGGGGA (SEQ ID NO:10)
CTTTCCGGGACTTTCCATCTGCCATCTCAATTAGTC
AGCAACCATAGTCCCGCCCCTAACTCCGCCCATCCC
GCCCCTAACTCCGCCCAGTTCCGCCCATTCTCCGCC
CCATGGCTGACTAATTTTTTTTATTTATGCAGAGGC
CGAGGCCGCCTCGGCCTCTGAGCTATTCCAGAAGTA
GTGAGGAGGCTTTTTTGGAGGCCTAGGCTTTTGCAA AAAGCTT:3'
[1337] Next, replace the SV40 minimal promoter element present in
the pSEAP2-promoter plasmid (Clontech) with this NF-KB/SV40
fragment using XhoI and HindIII. However, this vector does not
contain a neomycin resistance gene, and therefore, is not preferred
for mammalian expression systems.
[1338] In order to generate stable mammalian cell lines, the
NF-KB/SV46/SEAP cassette is removed from the above NF-KB/SEAP
vector using restriction enzymes SalI and NotI, and inserted into a
vector containing neomycin resistance. Particularly, the
NF-KB/SV40/SEAP cassette was inserted into pGFP-1 (Clontech),
replacing the GFP gene, after restricting pGFP-1 with SalI and
NotI.
[1339] Once NF-KB/SV40/SEAP/Neo vector is created, stable Jurkat
T-cells are created and maintained according to the protocol
described in Example 32. Similarly, the method for assaying
supernatants with these stable Jurkat T-cells is also described in
Example 32. As a positive control, exogenous TNF alpha (0.1, 1, 10
ng) is added to wells H9, H10, and H11, with a 5-10 fold activation
typically observed.
Example 36
Assay for SEAP Activity
[1340] As a reporter molecule for the assays described in Examples
32-35, SEAP activity is assayed using the Tropix Phospho-light Kit
(Cat. BP-400) according to the following general procedure. The
Tropix Phospho-light Kit supplies the Dilution, Assay, and Reaction
Buffers used below.
[1341] Prime a dispenser with the 2.5.times. Dilution Buffer and
dispense 15 ul of 2.5.times. dilution buffer into Optiplates
containing 35 ul of a supernatant. Seal the plates with a plastic
sealer and incubate at 65 degree C. for 30 min. Separate the
Optiplates to avoid uneven heating.
[1342] Cool the samples to room temperature for 15 minutes. Empty
the dispenser and prime with the Assay Buffer. Add 50 ml Assay
Buffer and incubate at room temperature 5 min. Empty the dispenser
and prime with the Reaction Buffer (see the Table below). Add 50 ul
Reaction Buffer and incubate at room temperature for 20 minutes.
Since the intensity of the chemiluminescent signal is time
dependent, and it takes about 10 minutes to read 5 plates on a
luminometer, thus one should treat 5 plates at each time and start
the second set 10 minutes later.
[1343] Read the relative light unit in the luminometer. Set H12 as
blank, and print the results. An increase in chemiluminescence
indicates reporter activity. TABLE-US-00023 Reaction Buffer
Formulation: # of plates Rxn buffer diluent (ml) CSPD (ml) 10 60 3
11 65 3.25 12 70 3.5 13 75 3.75 14 80 4 15 85 4.25 16 90 4.5 17 95
4.75 18 100 5 19 105 5.25 20 110 5.5 21 115 5.75 22 120 6 23 125
6.25 24 130 6.5 25 135 6.75 26 140 7 27 145 7.25 28 150 7.5 29 155
7.75 30 160 8 31 165 8.25 32 170 8.5 33 175 8.75 34 180 9 35 185
9.25 36 190 9.5 37 195 9.75 38 200 10 39 205 10.25 40 210 10.5 41
215 10.75 42 220 11 43 225 11.25 44 230 11.5 45 235 11.75 46 240 12
47 245 12.25 48 250 12.5 49 255 12.75 50 260 13
Example 37
High-Throughput Screening Assay Identifying Changes in Small
Molecule Concentration and Membrane Permeability
[1344] Binding of a ligand to a receptor is known to alter
intracellular levels of small molecules, such as calcium,
potassium, sodium, and pH, as well as alter membrane potential.
These alterations can be measured in an assay to identify
supernatants which bind to receptors of a particular cell. Although
the following protocol describes an assay for calcium, this
protocol can easily be modified to detect changes in potassium,
sodium, pH, membrane potential, or any other small molecule which
is detectable by a fluorescent probe.
[1345] The following assay uses Fluorometric Imaging Plate Reader
("FLIPR") to measure changes in fluorescent molecules (Molecular
Probes) that bind small molecules. Clearly, any fluorescent
molecule detecting a small molecule can be used instead of the
calcium fluorescent molecule, fluo-4 (Molecular Probes, Inc.;
catalog no. F-14202), used here.
[1346] For adherent cells, seed the cells at 10,000 cells/well in a
Co-star black 96-well plate with clear bottom. The plate is
incubated in a CO.sub.2 incubator for 20 hours. The adherent cells
are washed two times in Biotek washer with 200 ul of HBSS (Hank's
Balanced Salt Solution) leaving 100 ul of buffer after the final
wash.
[1347] A stock solution of 1 mg/ml fluo-4 is made in 10% pluronic
acid DMSO. To load the cells with fluo-4, 50 ul of 12 ug/ml fluo-4
is added to each well. The plate is incubated at 37 degrees C. in a
CO.sub.2 incubator for 60 min. The plate is washed four times in
the Biotek washer with HBSS leaving 100 ul of buffer.
[1348] For non-adherent cells, the cells are spun down from culture
media. Cells are re-suspended to 2-5.times.10.sup.6 cells/ml with
HBSS in a 50-ml conical tube. 4 ul of 1 mg/ml fluo-4 solution in
10% pluronic acid DMSO is added to each ml of cell suspension. The
tube is then placed in a 37 degrees C. water bath for 30-60 min.
The cells are washed twice with HBSS, resuspended to
1.times.10.sup.6 cells/ml, and dispensed into a microplate, 100
ul/well. The plate is centrifuged at 1000 rpm for 5 min. The plate
is then washed once in Denley Cell Wash with 200 ul, followed by an
aspiration step to 100 ul final volume.
[1349] For a non-cell based assay, each well contains a fluorescent
molecule, such as fluo-4. The supernatant is added to the well, and
a change in fluorescence is detected.
[1350] To measure the fluorescence of intracellular calcium, the
FLIPR is set for the following parameters: (1) System gain is
300-800 mW; (2) Exposure time is 0.4 second; (3) Camera F/stop is
F/2; (4) Excitation is 488 nm; (5) Emission is 530 nm; and (6)
Sample addition is 50 ul. Increased emission at 530 nm indicates an
extracellular signaling event caused by the a molecule, either
polypeptide of the present invention or a molecule induced by
polypeptide of the present invention, which has resulted in an
increase in the intracellular Ca.sup.++ concentration.
Example 38
High-Throughput Screening Assay Identifying Tyrosine Kinase
Activity
[1351] The Protein Tyrosine Kinases (PTK) represent a diverse group
of transmembrane and cytoplasmic kinases. Within the Receptor
Protein Tyrosine Kinase RPTK) group are receptors for a range of
mitogenic and metabolic growth factors including the PDGF, FGF,
EGF, NGF, HGF and Insulin receptor subfamilies. In addition there
are a large family of RPTKs for which the corresponding ligand is
unknown. Ligands for RPTKs include mainly secreted small proteins,
but also membrane-bound and extracellular matrix proteins.
[1352] Activation of RPTK by ligands involves ligand-mediated
receptor dimerization, resulting in transphosphorylation of the
receptor subunits and activation of the cytoplasmic tyrosine
kinases. The cytoplasmic tyrosine kinases include receptor
associated tyrosine kinases of the src-family (e.g., src, yes, lck,
lyn, fyn) and non-receptor linked and cytosolic protein tyrosine
kinases, such as the Jak family, members of which mediate signal
transduction triggered by the cytokine superfamily of receptors
(e.g., the Interleukins, Interferons, GM-CSF, and Leptin).
[1353] Because of the wide range of known factors capable of
stimulating tyrosine kinase activity, identifying whether
polypeptide of the present invention or a molecule induced by
polypeptide of the present invention is capable of activating
tyrosine kinase signal transduction pathways is of interest.
Therefore, the following protocol is designed to identify such
molecules capable of activating the tyrosine kinase signal
transduction pathways.
[1354] Seed target cells (e.g., primary keratinocytes) at a density
of approximately 25,000 cells per well in a 96 well Loprodyne
Silent Screen Plates purchased from Nalge Nunc (Naperville, Ill.).
The plates are sterilized with two 30 minute rinses with 100%
ethanol, rinsed with water and dried overnight. Some plates are
coated for 2 hr with 100 ml of cell culture grade type I collagen
(50 mg/ml), gelatin (2%) or polylysine (50 mg/ml), all of which can
be purchased from Sigma Chemicals (St. Louis, Mo.) or 10% Matrigel
purchased from Becton Dickinson (Bedford, Mass.), or calf serum,
rinsed with PBS and stored at 4 degree C. Cell growth on these
plates is assayed by seeding 5,000 cells/well in growth medium and
indirect quantitation of cell number through use of alamarBlue as
described by the manufacturer Alamar Biosciences, Inc. (Sacramento,
Calif.) after 48 hr. Falcon plate covers #3071 from Becton
Dickinson (Bedford, Mass.) are used to cover the Loprodyne Silent
Screen Plates. Falcon Microtest III cell culture plates can also be
used in some proliferation experiments.
[1355] To prepare extracts, A431 cells are seeded onto the nylon
membranes of Loprodyne plates (20,000/200 ml/well) and cultured
overnight in complete medium. Cells are quiesced by incubation in
serum-free basal medium for 24 hr. After 5-20 minutes treatment
with EGF (60 ng/ml) or 50 ul of the supernatant produced in Example
30, the medium was removed and 100 ml of extraction buffer ((20 mM
HEPES pH 7.5, 0.15 M NaCl, 1% Triton X-100, 0.1% SDS, 2 mM Na3VO4,
2 mM Na4P207 and a cocktail of protease inhibitors (# 1836170)
obtained from Boeheringer Mannheim (Indianapolis, Ind.)) is added
to each well and the plate is shaken on a rotating shaker for 5
minutes at 4.degree. C. The plate is then placed in a vacuum
transfer manifold and the extract filtered through the 0.45 mm
membrane bottoms of each well using house vacuum. Extracts are
collected in a 96-well catch/assay plate in the bottom of the
vacuum manifold and immediately placed on ice. To obtain extracts
clarified by centrifugation, the content of each well, after
detergent solubilization for 5 minutes, is removed and centrifuged
for 15 minutes at 4 degree C. at 16,000.times.g.
[1356] Test the filtered extracts for levels of tyrosine kinase
activity. Although many methods of detecting tyrosine kinase
activity are known, one method is described here.
[1357] Generally, the tyrosine kinase activity of a supernatant is
evaluated by determining its ability to phosphorylate a tyrosine
residue on a specific substrate (a biotinylated peptide).
Biotinylated peptides that can be used for this purpose include
PSK1 (corresponding to amino acids 6-20 of the cell division kinase
cdc2-p34) and PSK2 (corresponding to amino acids 1-17 of gastrin).
Both peptides are substrates for a range of tyrosine kinases and
are available from Boehringer Mannheim.
[1358] The tyrosine kinase reaction is set up by adding the
following components in order. First, add 10 ul of 5 uM
Biotinylated Peptide, then 10 ul ATP/IMg.sub.2+(5 mM ATP/50 mM
MgCl.sub.2), then 10 ul of 5.times. Assay Buffer (40 mM imidazole
hydrochloride, pH7.3, 40 mM beta-glycerophosphate, 1 mM EGTA, 100
mM MgCl.sub.2, 5 mM MnCl.sub.2, 0.5 mg/ml BSA), then 5 ul of Sodium
Vanadate (1 mM), and then 5 ul of water. Mix the components gently
and preincubate the reaction mix at 30 degree C. for 2 min. Initial
the reaction by adding 10 ul of the control enzyme or the filtered
supernatant.
[1359] The tyrosine kinase assay reaction is then terminated by
adding 10 ul of 120 mm EDTA and place the reactions on ice.
[1360] Tyrosine kinase activity is determined by transferring 50 ul
aliquot of reaction mixture to a microtiter plate (MTP) module and
incubating at 37 degree C. for 20 min. This allows the streptavidin
coated 96 well plate to associate with the biotinylated peptide.
Wash the MTP module with 300 ul/well of PBS four times. Next add 75
ul of anti-phospotyrosine antibody conjugated to horse radish
peroxidase (anti-P-Tyr-POD (0.5u/ml)) to each well and incubate at
37 degree C. for one hour. Wash the well as above.
[1361] Next add 100 ul of peroxidase substrate solution (Boehringer
Mannheim) and incubate at room temperature for at least 5 mins (up
to 30 min). Measure the absorbance of the sample at 405 nm by using
ELISA reader. The level of bound peroxidase activity is quantitated
using an ELISA reader and reflects the level of tyrosine kinase
activity.
Example 39
High-Throughput Screening Assay Identifying Phosphorylation
Activity
[1362] As a potential alternative and/or complement to the assay of
protein tyrosine kinase activity described in Example 38, an assay
which detects activation (phosphorylation) of major intracellular
signal transduction intermediates can also be used. For example, as
described below one particular assay can detect tyrosine
phosphorylation of the Erk-1 and Erk-2 kinases. However,
phosphorylation of other molecules, such as Raf, JNK, p38. MAP, Map
kinase kinase (MEK), MEK kinase, Src, Muscle specific kinase
(MuSK), IRAK, Tec, and Janus, as well as any other phosphoserine,
phosphotyrosine, or phosphothreonine molecule, can be detected by
substituting these molecules for Erk-1 or Erk-2 in the following
assay.
[1363] Specifically, assay plates are made by coating the wells of
a 96-well ELISA plate with 0.1 ml of protein G (1 ug/ml) for 2 hr
at room temp, (RT). The plates are then rinsed with PBS and blocked
with 3% BSA/PBS for 1 hr at RT. The protein G plates are then
treated with 2 commercial monoclonal antibodies (10 ng/well)
against Erk-1 and Erk-2 (1 hr at RT) (Santa Cruz Biotechnology).
(To detect other molecules, this step can easily be modified by
substituting a monoclonal antibody detecting any of the above
described molecules.) After 3-5 rinses with PBS, the plates are
stored at 4 degree C. until use.
[1364] A431 cells are seeded at 20,000/well in a 96-well Loprodyne
filterplate and cultured overnight in growth medium. The cells are
then starved for 48 hr in basal medium (DMEM) and then treated with
EGF (6 ng/well) or 50 ul of the supernatants obtained in Example 30
for 5-20 minutes. The cells are then solubilized and extracts
filtered directly into the assay plate.
[1365] After incubation with the extract for 1 hr at RT, the wells
are again rinsed. As a positive control, a commercial preparation
of MAP kinase (10 ng/well) is used in place of A431 extract. Plates
are then treated with a commercial polyclonal (rabbit) antibody (1
ug/ml) which specifically recognizes the phosphorylated epitope of
the Erk-1 and Erk-2 kinases (1 hr at RT). This antibody is
biotinylated by standard procedures. The bound polyclonal antibody
is then quantitated by successive incubations with
Europium-streptavidin and Europium fluorescence enhancing reagent
in the Wallac DELFIA instrument (time-resolved fluorescence). An
increased fluorescent signal over background indicates a
phosphorylation by polypeptide of the present invention or a
molecule induced by polypeptide of the present invention.
Example 40
Assay for the Stimulation of Bone Marrow CD34+Cell
Proliferation
[1366] This assay is based on the ability of human CD34+ to
proliferate in the presence of hematopoietic growth factors and
evaluates the ability of isolated polypeptides expressed in
mammalian cells to stimulate proliferation of CD34+cells.
[1367] It has been previously shown that most mature precursors
will respond to only a single signal. More immature precursors
require at least two signals to respond. Therefore, to test the
effect of polypeptides on hematopoietic activity of a wide range of
progenitor cells, the assay contains a given polypeptide in the
presence or absence of other hematopoietic growth factors. Isolated
cells are cultured for 5 days in the presence of Stem Cell Factor
(SCF) in combination with tested sample. SCF alone has a very
limited effect on the proliferation of bone marrow (BM) cells,
acting in such conditions only as a "survival" factor. However,
combined with any factor exhibiting stimulatory effect on these
cells (e.g., IL-3), SCF will cause a synergistic effect. Therefore,
if the tested polypeptide has a stimulatory effect on hematopoietic
progenitors, such activity can be easily detected. Since normal BM
cells have a low level of cycling cells, it is likely that any
inhibitory effect of a given polypeptide, or agonists or
antagonists thereof, might not be detected. Accordingly, assays for
an inhibitory effect on progenitors is preferably tested in cells
that are first subjected to in vitro stimulation with SCF+IL+3, and
then contacted with the compound that is being evaluated for
inhibition of such induced proliferation.
[1368] Briefly, CD34+cells are isolated using methods known in the
art. The cells are thawed and resuspended in medium (QBSF 60
serum-free medium with 1% L-glutamine (500 ml) Quality Biological,
Inc., Gaithersburg, Md. Cat# 160-204-101). After several gentle
centrifugation steps at 200.times.g, cells are allowed to rest for
one hour. The cell count is adjusted to 2.5.times.10.sup.5
cells/ml. During this time, 100 .mu.l of sterile water is added to
the peripheral wells of a 96-well plate. The cytokines that can be
tested with a given polypeptide in this assay is rhSCF (R&D
Systems, Minneapolis, Minn., Cat# 255-SC) at 50 ng/ml alone and in
combination with rhSCF and rhIL-3 (R&D Systems, Minneapolis,
Minn., Cat# 203-ML) at 30 ng/ml. After one hour, 10 .mu.l of
prepared cytokines, 50 .mu.l of the supernatants prepared in
Example 30 (supernatants at 1:2 dilution=50 .mu.l) and 20 .mu.l of
diluted cells are added to the media which is already present in
the wells to allow for a final total volume of 100 .mu.l. The
plates are then placed in a 37.degree. C./5% CO.sub.2 incubator for
five days.
[1369] Eighteen hours before the assay is harvested, 0.5
.mu.Ci/well of [3H] Thymidine is added in a 10 .mu.l volume to each
well to determine the proliferation rate. The experiment is
terminated by harvesting the cells from each 96-well plate to a
filtermat using the Tomtec Harvester 96. After harvesting, the
filtermats are dried, trimmed and placed into OmniFilter assemblies
consisting of one OmniFilter plate and one OmniFilter Tray. 60
.mu.L Microscint is added to each well and the plate sealed with
TopSeal-A press-on sealing film A bar code 15 sticker is affixed to
the first plate for counting. The sealed plates are then loaded and
the level of radioactivity determined via the Packard Top Count and
the printed data collected for analysis. The level of radioactivity
reflects the amount of cell proliferation.
[1370] The studies described in this example test the activity of a
given polypeptide to stimulate bone marrow CD34+cell proliferation.
One skilled in the art could easily modify the exemplified studies
to test the activity of polynucleotides (e.g., gene therapy),
antibodies, agonists, and/or antagonists and fragments and variants
thereof. As a nonlimiting example, potential antagonists tested in
this assay would be expected to inhibit cell proliferation in the
presence of cytokines and/or to increase the inhibition of cell
proliferation in the presence of cytokines and a given polypeptide.
In contrast, potential agonists tested in this assay would be
expected to enhance cell proliferation and/or to decrease the
inhibition of cell proliferation in the presence of cytokines and a
given polypeptide.
[1371] The ability of a gene to stimulate the proliferation of bone
marrow CD34+cells indicates that polynucleotides and polypeptides
corresponding to the gene are useful for the diagnosis and
treatment of disorders affecting the immune system and
hematopoiesis. Representative uses are described in the "Immune
Activity" and "Infectious Disease" sections above, and elsewhere
herein.
Example 41
Assay for Extracellular Matrix Enhanced Cell Response (EMECR)
[1372] The objective of the Extracellular Matrix Enhanced Cell
Response (EMECR) assay is to identify gene products (e.g., isolated
polypeptides) that act on the hematopoietic stem cells in the
context of the extracellular matrix (ECM) induced signal.
[1373] Cells respond to the regulatory factors in the context of
signal(s) received from the surrounding microenvironment. For
example, fibroblasts, and endothelial and epithelial stem cells
fail to replicate in the absence of signals from the ECM.
Hematopoietic stem cells can undergo self-renewal in the bone
marrow, but not in in vitro suspension culture. The ability of stem
cells to undergo self-renewal in vitro is dependent upon their
interaction with the stromal cells and the ECM protein fibronectin
(fn). Adhesion of cells to fn is mediated by the
.alpha..sub.5..beta..sub.1 and .alpha..sub.4..beta..sub.1 integrin
receptors, which are expressed by human and mouse hematopoietic
stem cells. The factor(s) which integrate with the ECM environment
and are responsible for stimulating stem cell self-renewal have a
not yet been identified. Discovery of such factors should be of
great interest in gene therapy and bone marrow transplant
applications
[1374] Briefly, polystyrene, non tissue culture treated, 96-well
plates are coated with fn fragment at a coating concentration of
0.2 .mu.g/cm.sup.2. Mouse bone marrow cells are plated (1,000
cells/well) in 0.2 ml of serum-free medium. Cells cultured in the
presence of IL-3 (5 ng/ml)+SCF (50 ng/ml) would serve as the
positive control, conditions under which little self-renewal but
pronounced differentiation of the stem cells is to be expected.
Gene products of the invention (e.g., including, but not limited
to, polynucleotides and polypeptides of the present invention, and
supernatants produced in Example 30), are tested with appropriate
negative controls in the presence and absence of SCF (5.0 ng/ml),
where test factor supernatants represent 10% of the total assay
volume. The plated cells are then allowed to grow by incubating in
a low oxygen environment (5% CO.sub.2, 7% O.sub.2, and 88% N.sub.2)
tissue culture incubator for 7 days. The number of proliferating
cells within the wells is then quantitated by measuring thymidine
incorporation into cellular DNA. Verification of the positive hits
in the assay will require phenotypic characterization of the cells,
which can be accomplished by scaling up of the culture system and
using appropriate antibody reagents against cell surface antigens
and FACScan.
[1375] One skilled in the art could easily modify the exemplified
studies to test the activity of polynucleotides (e.g., gene
therapy), antibodies, agonists, and/or antagonists and fragments
and variants thereof.
[1376] If a particular polypeptide of the present invention is
found to be a stimulator of hematopoietic progenitors,
polynucleotides and polypeptides corresponding to the gene encoding
said polypeptide may be useful for the diagnosis and treatment of
disorders affecting the immune system and hematopoiesis.
Representative uses are described in the "Immune Activity" and
"Infectious Disease" sections above, and elsewhere herein. The gene
product may also be useful in the expansion of stem cells and
committed progenitors of various blood lineages, and in the
differentiation and/or proliferation of various cell types.
[1377] Additionally, the polynucleotides and/or polypeptides of the
gene of interest and/or agonists and/or antagonists thereof, may
also be employed to inhibit the proliferation and differentiation
of hematopoietic cells and therefore may be employed to protect
bone marrow stem cells from chemotherapeutic agents during
chemotherapy. This antiproliferative effect may allow
administration of higher doses of chemotherapeutic agents and,
therefore, more effective chemotherapeutic treatment.
[1378] Moreover, polynucleotides and polypeptides corresponding to
the gene of interest may also be useful for the treatment and
diagnosis of hematopoietic related disorders such as, for example,
anemia, pancytopenia, leukopenia, thrombocytopenia or leukemia
since stromal cells are important in the production of cells of
hematopoietic lineages. The uses include bone marrow cell ex-vivo
culture, bone marrow transplantation, bone marrow reconstitution,
radiotherapy or chemotherapy of neoplasia.
Example 42
Human Dermal Fibroblast and Aortic Smooth Muscle Cell
Proliferation
[1379] The polypeptide of interest is added to cultures of normal
human dermal fibroblasts (NHDF) and human aortic smooth muscle
cells (AoSMC) and two co-assays are performed with each sample. The
first assay examines the effect of the polypeptide of interest on
the proliferation of normal human dermal fibroblasts (NHDF) or
aortic smooth muscle cells (AoSMC). Aberrant growth of fibroblasts
or smooth muscle cells is a part of several pathological processes,
including fibrosis, and restenosis. The second assay examines IL6
production by both NHDF and SMC. IL6 production is an indication of
functional activation. Activated cells will have increased
production of a number of cytokines and other factors, which can
result in a proinflammatory or immunomodulatory outcome. Assays are
run with and without co-TNFa stimulation, in order to check for
costimulatory or inhibitory activity.
[1380] Briefly, on day 1,96-well black plates are set up with 1000
cells/well (NHDF) or 2000 cells/well (AOSMC) in 100 .mu.l culture
media. NHDF culture media contains: Clonetics FB basal media, 1
mg/ml hFGF, 5 mg/ml insulin, 50 mg/ml gentamycin, 2% FBS, while
AoSMC culture media contains Clonetics SM basal media, 0.5 .mu.g/ml
hEGF, 5 mg/ml insulin, 1 .mu.g/ml hFGF, 50 mg/ml gentamycin, 50
.mu.g/ml Amphotericin B, 5% FBS. After incubation at 37.degree. C.
for at least 4-5 hours culture media is aspirated and replaced with
growth arrest media. Growth arrest media for NHDF contains
fibroblast basal media, 50 mg/ml gentamycin, 2% FBS, while growth
arrest media for AoSMC contains SM basal media, 50 mg/ml
gentamycin, 50 .mu.g/ml Amphotericin B, 0.4% FBS. Incubate at
37.degree. C. until day 2.
[1381] On day 2, serial dilutions and templates of the polypeptide
of interest are designed such that they always include media
controls and known-protein controls. For both stimulation and
inhibition experiments, proteins are diluted in growth arrest
media. For inhibition experiments, TNFa is added to a final
concentration of 2 ng/ml (NHDF) or 5 ng/ml (AoSMC). Add 1/3 vol
media containing controls or polypeptides of the present invention
and incubate at 37 degrees C./5% CO.sub.2 until day 5.
[1382] Transfer 60 .mu.l from each well to another labeled 96-well
plate, cover with a plate-sealer, and store at 4 degrees C. until
Day 6 (for IL6 ELISA). To the remaining 100 .mu.l in the cell
culture plate, aseptically add Alamar Blue in an amount equal to
10% of the culture volume (10 .mu.l). Return plates to incubator
for 3 to 4 hours. Then measure fluorescence with excitation at 530
nm and emission at 590 nm using the CytoFluor. This yields the
growth stimulation/inhibition data.
[1383] On day 5, the IL6 ELISA is performed by coating a 96 well
plate with 50-100 ul/well of Anti-Human IL6 Monoclonal antibody
diluted in PBS, pH 7.4, incubate ON at room temperature.
[1384] On day 6, empty the plates into the sink and blot on paper
towels. Prepare Assay Buffer containing PBS with 4% BSA. Block the
plates with 200 .mu.l/well of Pierce Super Block blocking buffer in
PBS for 1-2 hr and then wash plates with wash buffer (PBS, 0.05%
Tween-20). Blot plates on paper towels. Then add 50 .mu.l/well of
diluted Anti-Human IL-6 Monoclonal, Biotin-labeled antibody at 0.50
mg/ml. Make dilutions of IL-6 stock in media (30, 10, 3, 1, 0.3, 0
ng/ml). Add duplicate samples to top row of plate. Cover the plates
and incubate for 2 hours at RT on shaker.
[1385] Plates are washed with wash buffer and blotted on paper
towels. Dilute EU-labeled Streptavidin 1:1000 in Assay buffer, and
add 100 .mu.l/well. Cover the plate and incubate 1 h at RT. Plates
are again washed with wash buffer and blotted on paper towels.
[1386] Add 100 .mu.l/well of Enhancement Solution. Shake for 5
minutes. Read the plate on the Wallac DELFIA Fluorometer. Readings
from triplicate samples in each assay were tabulated and
averaged.
[1387] A positive result in this assay suggests AoSMC cell
proliferation and that the polypeptide of the present invention may
be involved in dermal fibroblast proliferation and/or smooth muscle
cell proliferation. A positive result also suggests many potential
uses of polypeptides, polynucleotides, agonists and/or antagonists
of the polynucleotide/polypeptide of the present invention which
gives a positive result. For example, inflammation and immune
responses, wound healing, and angiogenesis, as detailed throughout
this specification. Particularly, polypeptides of the present
invention and polynucleotides of the present invention may be used
in wound healing and dermal regeneration, as well as the promotion
of vasculogenesis, both of the blood vessels and lymphatics. The
growth of vessels can be used in the treatment of, for example,
cardiovascular diseases. Additionally, antagonists of polypeptides
and polynucleotides of the invention may be useful in treating
diseases, disorders, and/or conditions which involve angiogenesis
by acting as an anti-vascular agent (e.g., anti-angiogenesis).
These diseases, disorders, and/or conditions are known in the art
and/or are described herein, such as, for example, malignancies,
solid tumors, benign tumors, for example hemangiomas, acoustic
neuromas, neurofibromas, trachomas, and pyogenic granulomas;
artheroscleric plaques; ocular angiogenic diseases, for example,
diabetic retinopathy, retinopathy of prematurity, macular
degeneration, corneal graft rejection, neovascular glaucoma,
retrolental fibroplasia, rubeosis, retinoblastoma, uvietis and
Pterygia (abnormal blood vessel growth) of the eye; rheumatoid
arthritis; psoriasis; delayed wound healing; endometriosis;
vasculogenesis; granulations; hypertrophic scars (keloids);
nonunion fractures; scleroderma; trachoma; vascular adhesions;
myocardial angiogenesis; coronary collaterals; cerebral
collaterals; arteriovenous malformations; ischemic limb
angiogenesis; Osler-Webber Syndrome; plaque neovascularization;
telangiectasia; hemophiliac joints; angiofibroma; fibromuscular
dysplasia; wound granulation; Crohn's disease; and atherosclerosis.
Moreover, antagonists of polypeptides and polynucleotides of the
invention may be useful in treating anti-hyperproliferative
diseases and/or anti-inflammatory known in the art and/or described
herein.
[1388] One skilled in the art could easily modify the exemplified
studies to test the activity of polynucleotides (e.g., gene
therapy), antibodies, agonists, and/or antagonists and fragments
and variants thereof.
Example 43
Cellular Adhesion Molecule (CAM) Expression on Endothelial
Cells
[1389] The recruitment of lymphocytes to areas of inflammation and
angiogenesis involves specific receptor-ligand interactions between
cell surface adhesion molecules (CAMs) on lymphocytes and the
vascular endothelium. The adhesion process, in both normal and
pathological settings, follows a multi-step cascade that involves
intercellular adhesion molecule-1 (ICAM-1), vascular cell adhesion
molecule-1 (VCAM-1), and endothelial leukocyte adhesion molecule-1
(E-selectin) expression on endothelial cells (EC). The expression
of these molecules and others on the vascular endothelium
determines the efficiency with which leukocytes may adhere to the
local vasculature and extravasate into the local tissue during the
development of an inflammatory response. The local concentration of
cytokines and growth factor participate in the modulation of the
expression of these CAMs.
[1390] Briefly, endothelial cells (e.g., Human Umbilical Vein
Endothelial cells (HUVECs)) are grown in a standard 96 well plate
to confluence, growth medium is removed from the cells and replaced
with 100 .mu.l of 199 Medium (10% fetal bovine serum (FBS)).
Samples for testing and positive or negative controls are added to
the plate in triplicate (in 10 .mu.l volumes). Plates are then
incubated at 37.degree. C. for either 5 h (selectin and integrin
expression) or 24 h (integrin expression only). Plates are
aspirated to remove medium and 100 .mu.l of 0.1%
paraformaldehyde-PBS (with Ca++ and Mg++) is added to each well.
Plates are held at 4.degree. C. for 30 min. Fixative is removed
from the wells and wells are washed 1.times. with PBS (+Ca,Mg)+0.5%
BSA and drained. 10 .mu.l of diluted primary antibody is added to
the test and control wells. Anti-ICAM-1-Biotin, Anti-VCAM-1-Biotin
and Anti-E-selectin-Biotin are used at a concentration of 10
.mu.g/ml (1:10 dilution of 0.1 mg/ml stock antibody). Cells are
incubated at 37.degree. C. for 30 min. in a humidified environment.
Wells are washed three times with PBS (+Ca,Mg)+0.5% BSA. 20 .mu.l
of diluted ExtrAvidin-Alkaline Phosphatase (1:5,000 dilution,
referred to herein as the working dilution) are added to each well
and incubated at 37.degree. C. for 30 min. Wells are washed three
times with PBS (+Ca,Mg)+0.5% BSA. Dissolve 1 tablet of
p-Nitrophenol Phosphate pNPP per 5 ml of glycine buffer (pH 10.4).
100 .mu.l of pNPP substrate in glycine buffer is added to each test
well. Standard wells in triplicate are prepared from the working
dilution of the ExtrAvidin-Alkaline Phosphotase in glycine buffer:
1:5,000 (10.sup.0)>10.sup.-0.5>10.sup.-1>10.sup.1.50.5
.mu.l of each dilution is added to triplicate wells and the
resulting AP content in each well is 5.50 ng, 1.74 ng, 0.55 ng,
0.18 ng. 100 .mu.l of pNNP reagent is then added to each of the
standard wells. The plate is incubated at 37.degree. C. for 4 h. A
volume of 50 .mu.l of 3M NaOH is added to all wells. The plate is
read on a plate reader at 405 nm using the background subtraction
option on blank wells filled with glycine buffer only.
Additionally, the template is set up to indicate the concentration
of AP-conjugate in each standard well [5.50 ng; 1.74 ng; 0.55 ng;
0.18 ng]. Results are indicated as amount of bound AP-conjugate in
each sample.
Example 44
Alamar Blue Endothelial Cells Proliferation Assay
[1391] This assay may be used to quantitatively determine protein
mediated inhibition of bFGF-induced proliferation of Bovine
Lymphatic Endothelial Cells (LECs), Bovine Aortic Endothelial Cells
(BAECs) or Human Microvascular Uterine Myometrial Cells (UTMECs).
This assay incorporates a fluorometric growth indicator based on
detection of metabolic activity. A standard Alamar Blue
Proliferation Assay is prepared in EGM-2MV with 10 ng/ml of bFGF
added as a source of endothelial cell stimulation. This assay may
be used with a variety of endothelial cells with slight changes in
growth medium and cell concentration. Dilutions of the protein
batches to be tested are diluted as appropriate. Serum-free medium
(GIBCO SFM) without bFGF is used as a non-stimulated control and
Angiostatin or TSP-1 are included as a known inhibitory
controls.
[1392] Briefly, LEC, BAECs or UTMECs are seeded in growth media at
a density of 5000 to 2000 cells/well in a 96 well plate and placed
at 37 degreesC overnight. After the overnight incubation of the
cells, the growth media is removed and replaced with GIBCO EC-SFM.
The cells are treated with the appropriate dilutions of the protein
of interest or control protein sample(s) (prepared in SFM) in
triplicate wells with additional bFGF to a concentration of 10
ng/ml. Once the cells have been treated with the samples, the
plate(s) is/are placed back in the 37.degree. C. incubator for
three days. After three days 10 ml of stock alamar blue (Biosource
Cat# DAL100) is added to each well and the plate(s) is/are placed
back in the 37.degree. C. incubator for four hours. The plate(s)
are then read at 530 nm excitation and 590 nm emission using the
CytoFluor fluorescence reader. Direct output is recorded in
relative fluorescence units.
[1393] Alamar blue is an oxidation-reduction indicator that both
fluoresces and changes color in response to chemical reduction of
growth medium resulting from cell growth. As cells grow in culture,
innate metabolic activity results in a chemical reduction of the
immediate surrounding environment. Reduction related to growth
causes the indicator to change from oxidized (non-fluorescent blue)
form to reduced (fluorescent red) form (i.e., stimulated
proliferation will produce a stronger signal and inhibited
proliferation will produce a weaker signal and the total signal is
proportional to the total number of cells as well as their
metabolic activity). The background level of activity is observed
with the starvation medium alone. This is compared to the output
observed from the positive control samples (bFGF in growth medium)
and protein dilutions.
Example 45
Detection of Inhibition of a Mixed Lymphocyte Reaction
[1394] This assay can be used to detect and evaluate inhibition of
a Mixed Lymphocyte Reaction (MLR) by gene products (e.g., isolated
polypeptides). Inhibition of a MLR may be due to a direct effect on
cell proliferation and viability, modulation of costimulatory
molecules on interacting cells, modulation of adhesiveness between
lymphocytes and accessory cells, or modulation of cytokine
production by accessory cells. Multiple cells may be targeted by
these polypeptides since the peripheral blood mononuclear fraction
used in this assay includes T, B and natural killer lymphocytes, as
well as monocytes and dendritic cells.
[1395] Polypeptides of interest found to inhibit the MLR may find
application in diseases associated with lymphocyte and monocyte
activation or proliferation. These include, but are not limited to,
diseases such as asthma, arthritis, diabetes, inflammatory skin
conditions, psoriasis, eczema, systemic lupus erythematosus,
multiple sclerosis, glomerulonephritis, inflammatory bowel disease,
crohn's disease, ulcerative colitis, arteriosclerosis, cirrhosis,
graft vs. host disease, host vs. graft disease, hepatitis, leukemia
and lymphoma.
[1396] Briefly, PBMCs from human donors are purified by density
gradient centrifugation using Lymphocyte Separation Medium
(LSM.RTM., density 1.0770 g/ml, Organon Teknika Corporation, West
Chester, Pa.). PBMCs from two donors are adjusted to
2.times.10.sup.6 cells/ml in RPMI-1640 (Life Technologies, Grand
Island, N.Y.) supplemented with 10% FCS and 2 mM glutamine. PBMCs
from a third donor is adjusted to 2.times.10.sup.5 cells/ml. Fifty
microliters of PBMCs from each donor is added to wells of a 96-well
round bottom microtiter plate. Dilutions of test materials (50
.mu.l) is added in triplicate to microtiter wells. Test samples (of
the protein of interest) are added for final dilution of 1:4;
rhuIL-2 (R&D Systems, Minneapolis, Minn., catalog number
202-IL) is added to a final concentration of 1 .mu.g/ml; anti-CD4
mAb (R&D Systems, clone 34930.11, catalog number MAB379) is
added to a final concentration of 10 .mu.g/ml. Cells are cultured
for 7-8 days at 37.degree. C. in 5% CO.sub.2, and 1 .mu.C of
[.sup.3H] thymidine is added to wells for the last 16 hrs of
culture. Cells are harvested and thymidine incorporation determined
using a Packard TopCount. Data is expressed as the mean and
standard deviation of triplicate determinations.
[1397] Samples of the protein of interest are screened in separate
experiments and compared to the negative control treatment,
anti-CD4 mAb, which inhibits proliferation of lymphocytes and the
positive control treatment, IL-2 (either as recombinant material or
supernatant), which enhances proliferation of lymphocytes.
[1398] One skilled in the art could easily modify the exemplified
studies to test the activity of polynucleotides (e.g., gene
therapy), antibodies, agonists, and/or antagonists and fragments
and variants thereof.
Example 46
Assays for Protease Activity
[1399] The following assay may be used to assess protease activity
of the polypeptides of the invention.
[1400] Gelatin and casein zymography are performed essentially as
described (Heusen et al., Anal. Biochem., 102:196-202 (1980);
Wilson et al., Journal of Urology, 149:653-658 (1993)). Samples are
run on 10% polyacryamide/0.1% SDS gels containing 1% gelain
orcasein, soaked in 2.5% triton at room temperature for 1 hour, and
in 0.1M glycine, pH 8.3 at 37.degree. C. 5 to 16 hours. After
staining in amido black areas of proteolysis apear as clear areas
agains the blue-black background. Trypsin (Sigma T8642) is used as
a positive control.
[1401] Protease activity is also determined by monitoring the
cleavage of n-a-benzoyl-L-arginine ethyl ester (BAEE) (Sigma
B-4500. Reactions are set up in (25 mMNaPO.sub.4, 1 mM EDTA, and 1
mM BAEE), pH 7.5. Samples are added and the change in adsorbance at
260 nm is monitored on the Beckman DU-6 spectrophotometer in the
time-drive mode. Trypsin is used as a positive control.
[1402] Additional assays based upon the release of acid-soluble
peptides from casein or hemoglobin measured as adsorbance at 280 nm
or colorimetrically using the Folin method are performed as
described in Bergmeyer, et al., Methods of Enzymatic Analysis, 5
(1984). Other assays involve the solubilization of chromogenic
substrates (Ward, Applied Science, 251-317 (1983)).
Example 47
Identifying Serine Protease Substrate Specificity
[1403] Methods known in the art or described herein may be used to
determine the substrate specificity of the polypeptides of the
present invention having serine protease activity. A preferred
method of determining substrate specificity is by the use of
positional scanning synthetic combinatorial libraries as described
in GB 2 324 529 (incorporated herein in its entirety).
Example 48
Ligand Binding Assays
[1404] The following assay may be used to assess ligand binding
activity of the polypeptides of the invention.
[1405] Ligand binding assays provide a direct method for
ascertaining receptor pharmacology and are adaptable to a high
throughput format. The purified ligand for a polypeptide is
radiolabeled to high specific activity (50-2000 Ci/mmol) for
binding studies. A determination is then made that the process of
radiolabeling does not diminish the activity of the ligand towards
its polypeptide. Assay conditions for buffers, ions, pH and other
modulators such as nucleotides are optimized to establish a
workable signal to noise ratio for both membrane and whole cell
polypeptide sources. For these assays, specific polypeptide binding
is defined as total associated radioactivity minus the
radioactivity measured in the presence of an excess of unlabeled
competing ligand. Where possible, more than one competing ligand is
used to define residual nonspecific binding.
Example 49
Functional Assay in Xenopus Oocytes
[1406] Capped RNA transcripts from linearized plasmid templates
encoding the polypeptides of the invention are synthesized in vitro
with RNA polymerases in accordance with standard procedures. In
vitro transcripts are suspended in water at a final concentration
of 0.2 mg/ml. Ovarian lobes are removed from adult female toads,
Stage V defolliculated oocytes are obtained, and RNA transcripts
(10 ng/oocytc) are injected in a 50 nl bolus using a microinjection
apparatus. Two electrode voltage clamps are used to measure the
currents from individual Xenopus oocytes in response polypeptides
and polypeptide agonist exposure. Recordings are made in Ca2+ free
Barth's medium at room temperature. The Xenopus system can be used
to screen known ligands and tissue/cell extracts for activating
ligands.
Example 50
Microphysiometric Assays
[1407] Activation of a wide variety of secondary messenger systems
results in extrusion of small amounts of acid from a cell. The acid
formed is largely as a result of the increased metabolic activity
required to fuel the intracellular signaling process. The pH
changes in the media surrounding the cell are very small but are
detectable by the CYTOSENSOR microphysiometer (Molecular Devices
Ltd., Menlo Park, Calif.). The CYTOSENSOR is thus capable of
detecting the activation of polypeptide which is coupled to an
energy utilizing intracellular signaling pathway.
Example 51
Extract/Cell Supernatant Screening
[1408] A large number of mammalian receptors exist for which there
remains, as yet, no cognate activating ligand (agonist). Thus,
active ligands for these receptors may not be included within the
ligands banks as identified to date. Accordingly, the polypeptides
of the invention can also be functionally screened (using calcium,
cAMP, microphysiometer, oocyte electrophysiology, etc., functional
screens) against tissue extracts to identify its natural ligands.
Extracts that produce positive functional responses can be
sequentially subfractionated until an activating ligand is isolated
and identified.
Example 52
Calcium and cAMP Functional Assays
[1409] Seven transmembrane receptors which are expressed in HEK 293
cells have been shown to be coupled functionally to activation of
PLC and calcium mobilization and/or cAMP stimulation or inhibition.
Basal calcium levels in the HEK 293 cells in receptor-transfected
or vector control cells were observed to be in the normal, 100 nM
to 200 nM, range. HEK 293 cells expressing recombinant receptors
are loaded with fura 2 and in a single day >150 selected ligands
or tissue/cell extracts are evaluated for agonist induced calcium
mobilization. Similarly, HEK 293 cells expressing recombinant
receptors are evaluated for the stimulation or inhibition of cAMP
production using standard cAMP quantitation assays. Agonists
presenting a calcium transient or cAMP fluctuation are tested in
vector control cells to determine if the response is unique to the
transfected cells expressing receptor.
Example 53
ATP-Binding Assay
[1410] The following assay may be used to assess ATP-binding
activity of polypeptides of the invention.
[1411] ATP-binding activity of the polypeptides of the invention
may be detected using the ATP-binding assay described in U.S. Pat.
No. 5,858,719, which is herein incorporated by reference in its
entirety. Briefly, ATP-binding to polypeptides of the invention is
measured via photoaffinity labeling with 8-azido-ATP in a
competition assay. Reaction mixtures containing 1 mg/ml of the ABC
transport protein of the present invention are incubated with
varying concentrations of ATP, or the non-hydrolyzable ATP analog
adenyl-5'-imidodiphosphate for 10 minutes at 4.degree. C. A mixture
of 8-azido-ATP (Sigma Chem. Corp., St. Louis, Mo.) plus 8-azido-ATP
(.sup.32P-ATP) (5 mCi/.mu.mol, ICN, Irvine Calif.) is added to a
final concentration of 100 .mu.M and 0.5 ml aliquots are placed in
the wells of a porcelain spot plate on ice. The plate is irradiated
using a short wave 254 nm UV lamp at a distance of 2.5 cm from the
plate for two one-minute intervals with a one-minute cooling
interval in between. The reaction is stopped by addition of
dithiothreitol to a final concentration of 2 mM. The incubations
are subjected to SDS-PAGE electrophoresis, dried, and
autoradiographed. Protein bands corresponding to the particular
polypeptides of the invention are excised, and the radioactivity
quantified. A decrease in radioactivity with increasing ATP or
adenly-5'-imidodiphosphate provides a measure of ATP affinity to
the polypeptides.
Example 54
Small Molecule Screening
[1412] This invention is particularly useful for screening
therapeutic compounds by using the polypeptides of the invention,
or binding fragments thereof, in any of a variety of drug screening
techniques. The polypeptide or fragment employed in such a test may
be affixed to a solid support, expressed on a cell surface, free in
solution, or located intracellularly. One method of drug screening
utilizes eukaryotic or prokaryotic host cells which are stably
transformed with recombinant nucleic acids expressing the
polypeptide or fragment. Drugs are screened against such
transformed cells in competitive binding assays. One may measure,
for example, the formulation of complexes between the agent being
tested and polypeptide of the invention.
[1413] Thus, the present invention provides methods of screening
for drugs or any other agents which affect activities mediated by
the polypeptides of the invention. These methods comprise
contacting such an agent with a polypeptide of the invention or
fragment thereof and assaying for the presence of a complex between
the agent and the polypeptide or fragment thereof, by methods well
known in the art. In such a competitive binding assay, the agents
to screen are typically labeled. Following incubation, free agent
is separated from that present in bound form, and the amount of
free or uncomplexed label is a measure of the ability of a
particular agent to bind to the polypeptides of the invention.
[1414] Another technique for drug screening provides high
throughput screening for compounds having suitable binding affinity
to the polypeptides of the invention, and is described in great
detail in European Patent Application 84/03564, published on Sep.
13, 1984, which is herein incorporated by reference in its
entirety. Briefly stated, large numbers of different small molecule
test compounds are synthesized on a solid substrate, such as
plastic pins or some other surface. The test compounds are reacted
with polypeptides of the invention and washed. Bound polypeptides
are then detected by methods well known in the art. Purified
polypeptides are coated directly onto plates for use in the
aforementioned drug screening techniques. In addition,
non-neutralizing antibodies may be used to capture the peptide and
immobilize it on the solid support.
[1415] This invention also contemplates the use of competitive drug
screening assays in which neutralizing antibodies capable of
binding polypeptides of the invention specifically compete with a
test compound for binding to the polypeptides or fragments thereof.
In this manner, the antibodies are used to detect the presence of
any peptide which shares one or more antigenic epitopes with a
polypeptide of the invention.
Example 55
Phosphorylation Assay
[1416] In order to assay for phosphorylation activity of the
polypeptides of the invention, a phosphorylation assay as described
in U.S. Pat. No. 5,958,405 (which is herein incorporated by
reference) is utilized. Briefly, phosphorylation activity may be
measured by phosphorylation of a protein substrate using
gamma-labeled .sup.32P-ATP and quantitation of the incorporated
radioactivity using a gamma radioisotope counter. The polypeptides
of the invention are incubated with the protein substrate,
.sup.32P-ATP, and a kinase buffer. The .sup.32P incorporated into
the substrate is then separated from free .sup.32P-ATP by
electrophoresis, and the incorporated .sup.32P is counted and
compared to a negative control. Radioactivity counts above the
negative control are indicative of phosphorylation activity of the
polypeptides of the invention.
Example 56
Detection of Phosphorylation Activity (Activation) of the
Polypeptides of the Invention in the Presence of Polypeptide
Ligands
[1417] Methods known in the art or described herein may be used to
determine the phosphorylation activity of the polypeptides of the
invention. A preferred method of determining phosphorylation
activity is by the use of the tyrosine phosphorylation assay as
described in U.S. Pat. No. 5,817,471 (incorporated herein by
reference).
Example 57
Identification of Signal Transduction Proteins that Interact with
Polypeptides of the Present Invention
[1418] The purified polypeptides of the invention are research
tools for the identification, characterization and purification of
additional signal transduction pathway proteins or receptor
proteins. Briefly, labeled polypeptides of the invention are useful
as reagents for the purification of molecules with which it
interacts. In one embodiment of affinity purification, polypeptides
of the invention are covalently coupled to a chromatography column.
Cell-free extract derived from putative target cells, such as
carcinoma tissues, is passed over the column, and molecules with
appropriate affinity bind to the polypeptides of the invention. The
protein complex is recovered from the column, dissociated, and the
recovered molecule subjected to N-terminal protein sequencing. This
amino acid sequence is then used to identify the captured molecule
or to design degenerate oligonucleotide probes for cloning the
relevant gene from an appropriate cDNA library.
Example 58
IL-6 Bioassay
[1419] To test the proliferative effects of the polypeptides of the
invention, the IL-6 Bioassay as described by Marz et al. is
utilized (Proc. Natl. Acad. Sci., U.S.A., 95:3251-56 (1998), which
is herein incorporated by reference). Briefly, IL-6 dependent B9
murine cells are washed three times in IL-6 free medium and plated
at a concentration of 5,000 cells per well in 50 .mu.l, and 50
.mu.l of the IL-6-like polypeptide is added. After 68 hrs. at
37.degree. C., the number of viable cells is measured by adding the
tetrazolium salt thiazolyl blue (MTT) and incubating for a further
4 hrs. at 37.degree. C. B9 cells are lysed by SDS and optical
density is measured at 570 nm. Controls containing IL-6 (positive)
and no cytokine (negative) are utilized. Enhanced proliferation in
the test sample(s) relative to the negative control is indicative
of proliferative effects mediated by polypeptides of the
invention.
Example 59
Support of Chicken Embryo Neuron Survival
[1420] To test whether sympathetic neuronal cell viability is
supported by polypeptides of the invention, the chicken embryo
neuronal survival assay of Senaldi et al is utilized (Proc. Natl.
Acad. Sci., U.S.A., 96:11458-63 (1998), which is herein
incorporated by reference). Briefly, motor and sympathetic neurons
are isolated from chicken embryos, resuspended in L15 medium (with
10% FCS, glucose, sodium selenite, progesterone, conalbumin,
putrescine, and insulin; Life Technologies, Rockville, Md.) and
Dulbecco's modified Eagles medium [with 10% FCS, glutamine,
penicillin, and 25 mM Hepes buffer (pH 7.2); Life Technologies,
Rockville, Md.], respectively, and incubated at 37.degree. C. in 5%
CO.sub.2 in the presence of different concentrations of the
purified IL-6-like polypeptide, as well as a negative control
lacking any cytokine. After 3 days, neuron survival is determined
by evaluation of cellular morphology, and through the use of the
calorimetric assay of Mosmann (Mosmann, T., J. Immunol. Methods,
65:55-63 (1983)). Enhanced neuronal cell viability as compared to
the controls lacking cytokine is indicative of the ability of the
inventive purified IL-6-like polypeptide(s) to enhance the survival
of neuronal cells.
Example 60
Assay for Phosphatase Activity
[1421] The following assay may be used to assess serine/threonine
phosphatase (PTPase) activity of the polypeptides of the
invention.
[1422] In order to assay for serine/threonine phosphatase (PTPase)
activity, assays can be utilized which are widely known to those
skilled in the art. For example, the serine/threonine phosphatase
(PSPase) activity is measured using a PSPase assay kit from New
England Biolabs, Inc. Myelin basic protein (MyBP), a substrate for
PSPase, is phosphorylated on serine and threonine residues with
cAMP-dependent Protein Kinase in the presence of [.sup.32P]ATP.
Protein serine/threonine phosphatase activity is then determined by
measuring the release of inorganic phosphate from .sup.32P-labeled
MyBP.
Example 61
Interaction of Serine/Threonine Phosphatases with other
Proteins
[1423] The polypeptides of the invention with serine/threonine
phosphatase activity as determined in Example 60 are research tools
for the identification, characterization and purification of
additional interacting proteins or receptor proteins, or other
signal transduction pathway proteins. Briefly, labeled
polypeptide(s) of the invention is useful as a reagent for the
purification of molecules with which it interacts. In one
embodiment of affinity purification, polypeptide of the invention
is covalently coupled to a chromatography column. Cell-free extract
derived from putative target cells, such as neural or liver cells,
is passed over the column, and molecules with appropriate affinity
bind to the polypeptides of the invention. The polypeptides of the
invention-complex is recovered from the column, dissociated, and
the recovered molecule subjected to N-terminal protein sequencing.
This amino acid sequence is then used to identify the captured
molecule or to design degenerate oligonucleotide probes for cloning
the relevant gene from an appropriate cDNA library.
Example 62
Assaying for Heparanase Activity
[1424] In order to assay for heparanase activity of the
polypeptides of the invention, the heparanase assay described by
Vlodavsky et al is utilized (Vlodavsky, I., et al., Nat. Med.,
5:793-802 (1999)). Briefly, cell lysates, conditioned media or
intact cells (1.times.10.sup.6 cells per 35-mm dish) are incubated
for 18 hrs at 37.degree. C., pH 6.2-6.6, with .sup.35S-labeled ECM
or soluble ECM derived peak I proteoglycans. The incubation medium
is centrifuged and the supernatant is analyzed by gel filtration on
a Sepharose CL-6B column (0.9.times.30 cm). Fractions are eluted
with PBS and their radioactivity is measured. Degradation fragments
of heparan sulfate side chains are eluted from Sepharose 6B at
0.5<K.sub.av<0.8 (peak II). Each experiment is done at least
three times. Degradation fragments corresponding to "peak II," as
described by Vlodavsky et al., is indicative of the activity of the
polypeptides of the invention in cleaving heparan sulfate.
Example 63
Immobilization of Biomolecules
[1425] This example provides a method for the stabilization of
polypeptides of the invention in non-host cell lipid bilayer
constucts (see, e.g., Bieri et al., Nature Biotech 17:1105-1108
(1999), hereby incorporated by reference in its entirety herein)
which can be adapted for the study of polypeptides of the invention
in the various functional assays described above. Briefly,
carbohydrate-specific chemistry for biotinylation is used to
confine a biotin tag to the extracellular domain of the
polypeptides of the invention, thus allowing uniform orientation
upon immobilization. A 50 uM solution of polypeptides of the
invention in washed membranes is incubated with 20 mM NaIO4 and 1.5
mg/ml (4 mM) BACH or 2 mg/ml (7.5 mM) biotin-hydrazide for 1 hr at
room temperature (reaction volume, 150 ul). Then the sample is
dialyzed (Pierce Slidealizer Cassett, 10 kDa cutoff; Pierce
Chemical Co., Rockford Ill.) at 4C first for 5 h, exchanging the
buffer after each hour, and finally for 12 h against 500 ml buffer
R (0.15 M NaCl, 1 mM MgCl2, 10 mM sodium phosphate, pH7). Just
before addition into a cuvette, the sample is diluted 1:5 in buffer
ROG50 (Buffer R supplemented with 50 mM octylglucoside).
Example 64
TAQMAN
[1426] Quantitative PCR (QPCR). Total RNA from cells in culture are
extracted by Trizol separation as recommended by the supplier
(LifeTechnologies). (Total RNA is treated with DNase I (Life
Technologies) to remove any contaminating genomic DNA before
reverse transcription.) Total RNA (50 ng) is used in a one-step, 50
ul, RT-QPCR, consisting of Taqman Buffer A (Perkin-Elmer; 50 mM
KCl/10 mM Tris, pH 8.3), 5.5 mM MgCl.sub.2, 240 .mu.M each dNTP,
0.4 units RNase inhibitor (Promega), 8% glycerol, 0.012% Tween-20,
0.05% gelatin, 0.3 uM primers, 0.1 uM probe, 0.025 units Amplitaq
Gold (Perkin-Elmer) and 2.5 units Superscript II reverse
transcriptase (Life Technologies). As a control for genomic
contamination, parallel reactions are setup without reverse
transcriptase. The relative abundance of (unknown) and 18S RNAs are
assessed by using the Applied Biosystems Prism 7700 Sequence
Detection System (Livak, K. J., Flood, S. J., Marmaro, J., Giusti,
W. & Deetz, K. (1995) PCR Methods Appl. 4, 357-362). Reactions
are carried out at 48.degree. C. for 30 min, 95.degree. C. for 10
min, followed by 40 cycles of 95.degree. C. for 15 s, 60.degree. C.
for 1 min. Reactions are performed in triplicate.
[1427] Primers (f & r) and FRET probes sets are designed using
Primer Express Software (Perkin-Elmer). Probes are labeled at the
5'-end with the reporter dye 6-FAM and on the 3'-end with the
quencher dye TAMRA (Biosource International, Camarillo, Calif. or
Perkin-Elmer).
Example 65
Assays for Metalloproteinase Activity
[1428] Metalloproteinases (EC 3.4.24.-) are peptide hydrolases
which use metal ions, such as Zn.sup.2+, as the catalytic
mechanism. Metalloproteinase activity of polypeptides of the
present invention can be assayed according to the following
methods.
Proteolysis of Alpha-2-Macroglobulin
[1429] To confirm protease activity, purified polypeptides of the
invention are mixed with the substrate alpha-2-macroglobulin (0.2
unit/ml; Boehringer Mannheim, Germany) in 1.times. assay buffer (50
mM HEPES, pH 7.5, 0.2 M NaCl, 10 mM CaCl.sub.2, 25 .mu.M ZnCl.sub.2
and 0.05% Brij-35) and incubated at 37.degree. C. for 1-5 days.
Trypsin is used as positive control. Negative controls contain only
alpha-2-macroglobulin in assay buffer. The samples are collected
and boiled in SDS-PAGE sample buffer containing 5%
2-mercaptoethanol for 5-min, then loaded onto 8% SDS-polyacrylamide
gel. After electrophoresis the proteins are visualized by silver
staining. Proteolysis is evident by the appearance of lower
molecular weight bands as compared to the negative control.
Inhibition of Alpha-2-Macroglobulin Proteolysis by Inhibitors of
Metalloproteinases
[1430] Known metalloproteinase inhibitors (metal chelators (EDTA,
EGTA, AND HgCl.sub.2), peptide metalloproteinase inhibitors (TIMP-1
and TIMP-2), and commercial small molecule MMP inhibitors) are used
to characterize the proteolytic activity of polypeptides of the
invention. The three synthetic MMP inhibitors used are: MMP
inhibitor I, [IC.sub.50=1.0 .mu.M against MMP-1 and MMP-8;
IC.sub.50=30 .mu.M against MMP-9; IC.sub.50=150 .mu.M against
MMP-3]; MMP-3 (stromelysin-1) inhibitor I [IC.sub.50=5 .mu.M
against MMP-3], and MMP-3 inhibitor II [K.sub.i=130 nM against
MMP-3]; inhibitors available through Calbiochem, catalog # 444250,
444218, and 444225, respectively). Briefly, different
concentrations of the small molecule MMP inhibitors are mixed with
purified polypeptides of the invention (50 .mu.g/ml) in 22.9 .mu.l
of 1.times. HEPES buffer (50 mM HEPES, pH 7.5, 0.2 M NaCl, 10 mM
CaCl.sub.2, 25 .mu.M ZnCl.sub.2 and 0.05% Brij-35) and incubated at
room temperature (24.degree. C.) for 2-hr, then 7.1 .mu.l of
substrate alpha-2-macroglobulin (0.2 unit/ml) is added and
incubated at 37.degree. C. for 20-hr. The reactions are stopped by
adding 4.times. sample buffer and boiled immediately for 5 minutes.
After SDS-PAGE, the protein bands are visualized by silver
stain.
Synthetic Fluorogenic Peptide Substrates Cleavage Assay
[1431] The substrate specificity for polypeptides of the invention
with demonstrated metalloproteinase activity can be determined
using synthetic fluorogenic peptide substrates (purchased from
BACHEM Bioscience Inc). Test substrates include, M-1985, M-2225,
M-2105, M-2110, and M-2255. The first four are MMP substrates and
the last one is a substrate of tumor necrosis factor-.alpha.
(TNF-.alpha.) converting enzyme (TACE). All the substrates are
prepared in 1:1 dimethyl sulfoxide (DMSO) and water. The stock
solutions are 50-500 .mu.M. Fluorescent assays are performed by
using a Perkin Elmer LS 50B luminescence spectrometer equipped with
a constant temperature water bath. The excitation .lamda. is 328 nm
and the emission .lamda. is 393 nm. Briefly, the assay is carried
out by incubating 176 .mu.l 1.times. HEPES buffer (0.2 M NaCl, 10
mM CaCl.sub.2, 0.05% Brij-35 and 50 mM HEPES, pH 7.5) with 4 .mu.l
of substrate solution (50 .mu.M) at 25.degree. C. for 15 minutes,
and then adding 20 .mu.l of a purified polypeptide of the invention
into the assay cuvett. The final concentration of substrate is 1
.mu.M. Initial hydrolysis rates are monitored for 30-min.
Example 66
Characterization of the cDNA Contained in a Deposited Plasmid
[1432] The size of the cDNA insert contained in a deposited plasmid
may be routinely determined using techniques known in the art, such
as PCR amplification using synthetic primers hybridizable to the 3'
and 5' ends of the cDNA sequence. For example, two primers of 17-30
nucleotides derived from each end of the cDNA (i.e., hybridizable
to the absolute 5' nucleotide or the 3' nucleotide end of the
sequence of SEQ ID NO:X, respectively) are synthesized and used to
amplify the cDNA using the deposited cDNA plasmid as a template.
The polymerase chain reaction is carried out under routine
conditions, for instance, in 25 ul of reaction mixture with 0.5 ug
of the above cDNA template. A convenient reaction mixture is 1.5-5
mM MgCl.sub.2, 0.01% (w/v) gelatin, 20 uM each of dATP, dCTP, dGTP,
dTTP, 25 pmol of each primer and 0.25 Unit of Taq polymerase.
Thirty five cycles of PCR (denaturation at 94 degree C. for 1 min;
annealing at 55 degree C. for 1 min; elongation at 72 degree C. for
1 min) are performed with a Perkin-Elmer Cetus automated thermal
cycler. The amplified product is analyzed by agarose gel
electrophoresis. The PCR product is verified to be the selected
sequence by subcloning and sequencing the DNA product. It will be
clear that the invention may be practiced otherwise than as
particularly described in the foregoing description and examples.
Numerous modifications and variations of the present invention are
possible in light of the above teachings and, therefore, are within
the scope of the appended claims.
INCORPORATION BY REFERENCE
[1433] The entire disclosure of each document cited (including
patents, patent applications, journal articles, abstracts,
laboratory manuals, books, or other disclosures) in the Background
of the Invention, Detailed Description, and Examples is hereby
incorporated herein by reference. In addition, the sequence listing
submitted herewith is incorporated herein by reference in its
entirety. The specification and sequence listing of each of the
following U.S. and PCT applications are herein incorporated by
reference in their entirety (filing dates shown in format
"year-month-day" (yyyy-mm-dd)): Application No. 60/278,650 filed on
2001-03-27, application Ser. No. 09/950,082 filed on 2001-09-12,
application Ser. No. 09/950,083 filed on 2001-09-12, Application
No. 60/306,171 filed on 19 Jul. 2001, application Ser. No.
09/833,245 filed on 2001-04-12, Application No. PCT/US01/11988
filed on 2001-04-12, Application No. 60/331,287 filed on
2001-11-13, Application No. 60/277,340 filed on 2001-03-21,
Application No. PCT/US00/06043 filed on 2000-03-09, Application No.
PCT/US00/06012 filed on 2000-03-09, Application No. PCT/US00/06058
filed on 2000-03-09, Application No. PCT/US00/06044 filed on
2000-03-09, Application No. PCT/US00/06059 filed on 2000-03-09,
Application No. PCT/US00/06042 filed on 2000-03-09, Application No.
PCT/US00/06014 filed on 2000-03-09, Application No. PCT/US00/06013
filed on 2000-03-09, Application No. PCT/US00/06049 filed on
2000-03-09, Application No. PCT/US00/06057 filed on 2000-03-09,
Application No. PCT/US00/06824 filed on 2000-03-16, Application No.
PCT/US00/06765 filed on 2000-03-16, Application No. PCT/US00/06792
filed on 2000-03-16, Application No. PCT/US00/06830 filed on
2000-03-16, Application No. PCT/US00/06782 filed on 2000-03-16,
Application No. PCT/US00/06822 filed on 2000-03-16, Application No.
PCT/US00/06791 filed on 2000-03-16, Application No. PCT/US00/06828
filed on 2000-03-16, Application No. PCT/US00/06823 filed on
2000-03-16, Application No. PCT/US00/06781 filed on 2000-03-16,
Application No. PCT/US00/07505 filed on 2000-03-22, Application No.
PCT/US00/07440 filed on 2000-03-22, Application No. PCT/US00/07506
filed on 2000-03-22, Application No. PCT/US00/07507 filed on
2000-03-22, Application No. PCT/US00/07535 filed on 2000-03-22,
Application No. PCT/US00/07525 filed on 2000-03-22, Application No.
PCT/US00/07534 filed on 2000-03-22, Application No. PCT/US00/07483
filed on 2000-03-22, Application No. PCT/IUS00/07526 filed on
2000-03-22, Application No. PCT/US00/07527 filed on 2000-03-22,
Application No. PCT/US00/07661 filed on 2000-03-23, Application No.
PCT/US00/07579 filed on 2000-03-23, Application No. PCT/US00/07723
filed on 2000-03-23, Application No. PCT/US00/07724 filed on
2000-03-23, Application No. PCT/US00/14929 filed on 2000-06-01,
Application No. PCT/US00/07722 filed on 2000-03-23, Application No.
PCT/US00/07578 filed on 2000-03-23, Application No. PCT/US00/07726
filed on 2000-03-23, Application No. PCT/US00/07677 filed on
2000-03-23, Application No. PCT/US00/07725 filed on 2000-03-23,
Application No. PCT/US00/09070 filed on 2000-04-06, Application No.
PCT/US00/08982 filed on 2000-04-06, Application No. PCT/US00/08983
filed on 2000-04-06, Application No. PCT/US00/09067 filed on
2000-04-06, Application No. PCT/US00/09066 filed on 2000-04-06,
Application No. PCT/US00/09068 filed on 2000-04-06, Application No.
PCT/US00/08981 filed on 2000-04-06, Application No. PCT/US00/08980
filed on 2000-04-06, Application No. PCT/US00/09071 filed on
2000-04-06, Application No. PCT/US00/09069 filed on 2000-04-06,
Application No. PCT/US00/15136 filed on 2000-06-01, Application No.
PCT/US00/14926 filed on 2000-06-01, Application No. PCT/US00/14963
filed on 2000-06-01, Application No. PCT/US00/15135 filed on
2000-06-01, Application No. PCT/US00/14934 filed on 2000-06-01,
Application No. PCT/US00/14933 filed on 2000-06-01, Application No.
PCT/US00/15137 filed on 2000-06-01, Application No. PCT/US00/14928
filed on 2000-06-01, Application No. PCT/US00/14973 filed on
2000-06-01, Application No. PCT/US00/14964 filed on 2000-06-01,
Application No. PCT/US00/26376 filed on 2000-09-26, Application No.
PCT/US00/26371 filed on 2000-09-26, Application No. PCT/US00/26324
filed on 2000-09-26, Application No. PCT/US00/26323 filed on
2000-09-26, Application No. PCT/US00/26337 filed on 2000-09-26,
Application No. PCT/US01/13318 filed on 2001-04-27, Application No.
U.S. 60/124,146 filed on 1999-03-12, Application No. U.S.
60/167,061 filed on 1999-11-23, Application No. U.S. 60/124,093
filed on 1999-03-12, Application No. U.S. 60/166,989 filed on
1999-11-23, Application No. U.S. 60/124,145 filed on 1999-03-12,
Application No. U.S. 60/168,654 filed on 1999-12-03, Application
No. U.S. 60/124,099 filed on 1999-03-12, Application No. U.S.
60/168,661 filed on 1999-12-03, Application No. U.S. 60/124,096
filed on 1999-03-12, Application No. U.S. 60/168,622 filed on
1999-12-03, Application No. U.S. 60/124,143 filed on 1999-03-12,
Application No. U.S. 60/168,663 filed on 1999-12-03, Application
No. U.S. 60/124,095 filed on 1999-03-12, Application No. U.S.
60/138,598 filed on 1999-06-11, Application No. U.S. 60/168,665
filed on 1999-12-03, Application No. U.S. 60/125,360 filed on
1999-03-19, Application No. U.S. 60/138,626 filed on 1999-06-11,
Application No. U.S. 60/168,662 filed on 1999-12-03, Application
No. U.S. 60/124,144 filed on 1999-03-12, Application No. U.S.
60/138,574 filed on 1999-06-11, Application No. U.S. 60/168,667
filed on 1999-12-03, Application No. U.S. 60/124,142 filed on
1999-03-12, Application No. U.S. 60/138,597 filed on 1999-06-11,
Application No. U.S. 60/168,666 filed on 1999-12-03, Application
No. U.S. 60/125,359 filed on 1999-03-19, Application No. U.S.
60/168,664 filed on 1999-12-03, Application No. U.S. 60/126,051
filed on 1999-03-23, Application No. U.S. 60/169,906 filed on
1999-12-10, Application No. U.S. 60/125,362 filed on 1999-03-19,
Application No. U.S. 60/169,980 filed on 1999-12-10, Application
No. U.S. 60/125,361 filed on 1999-03-19, Application No. U.S.
60/169,910 filed on 1999-12-10, Application No. U.S. 60/125,812
filed on 1999-03-23, Application No. U.S. 60/169,936 filed on
1999-12-10, Application No. U.S. 60/126,054 filed on 1999-03-23,
Application No. U.S. 60/169,916 filed on 1999-12-10, Application
No. U.S. 60/125,815 filed on 1999-03-23, Application No. U.S.
60/169,946 filed on 1999-12-10, Application No. U.S. 60/125,358
filed on 1999-03-19, Application No. U.S. 60/169,616 filed on
1999-12-08, Application No. U.S. 60/125,364 filed on 1999-03-19,
Application No. U.S. 60/169,623 filed on 1999-12-08, Application
No. U.S. 60/125,363 filed on 1999-03-19, Application No. U.S.
60/169,617 filed on 1999-12-08, Application No. U.S. 60/126,502
filed on 1999-03-26, Application No. U.S. 60/172,410 filed on
1999-12-17, Application No. U.S. 60/126,503 filed on 1999-03-26,
Application No. U.S. 60/172,409 filed on 1999-12-17, Application
No. U.S. 60/126,505 filed on 1999-03-26, Application No. U.S.
60/172,412 filed on 1999-12-17, Application No. U.S. 60/126,594
filed on 1999-03-26, Application No. U.S. 60/172,408 filed on
1999-12-17, Application No. U.S. 60/126,511 filed on 1999-03-26,
Application No. U.S. 60/172,413 filed on 1999-12-17, Application
No. U.S. 60/126,595 filed on 1999-03-26, Application No. U.S.
60/171,549 filed on 1999-12-22, Application No. U.S. 60/126,598
filed on 1999-03-26, Application No. U.S. 60/171,504 filed on
1999-12-22, Application No. U.S. 60/126,596 filed on 1999-03-26,
Application No. U.S. 60/171,552 filed on 1999-12-22, Application
No. U.S. 60/126,600 filed on 1999-03-26, Application No. U.S.
60/171,550 filed on 1999-12-22, Application No. U.S. 60/126,501
filed on 1999-03-26, Application No. U.S. 60/171,551 filed on
1999-12-22, Application No. U.S. 60/126,504 filed on 1999-03-26,
Application No. U.S. 60/174,847 filed on 2000-01-07, Application
No. U.S. 60/126,509 filed on 1999-03-26, Application No. U.S.
60/174,853 filed on 2000-01-07, Application No. U.S. 60/126,506
filed on 1999-03-26, Application No. U.S. 60/174,852 filed on
2000-01-07, Application No. U.S. 60/242,710 filed on 2000-10-25,
Application No. U.S. 60/126,510 filed on 1999-03-26, Application
No. U.S. 60/174,850 filed on 2000-01-07, Application No. U.S.
60/138,573 filed on 1999-06-11, Application No. U.S. 60/174,851
filed on 2000-01-07, Application No. U.S. 60/126,508 filed on
1999-03-26, Application No. U.S. 60/174,871 filed on 2000-01-07,
Application No. U.S. 60/126,507 filed on 1999-03-26, Application
No. U.S. 60/174,872 filed on 2000-01-07, Application No. U.S.
60/126,597 filed on 1999-03-26, Application No. U.S. 60/174,877
filed on 2000-01-07, Application No. U.S. 60/126,601 filed on
1999-03-26, Application No. U.S. 60/154,373 filed on 1999-09-17,
Application No. U.S. 60/176,064 filed on 2000-01-14, Application
No. U.S. 60/126,602 filed on 1999-03-26, Application No. U.S.
60/176,063 filed on 2000-01-14, Application No. U.S. 60/128,695
filed on 1999-04-09, Application No. U.S. 60/176,052 filed on
2000-01-14, Application No. U.S. 60/128,696 filed on 1999-04-09,
Application No. U.S. 60/176,069 filed on 2000-01-14, Application
No. U.S. 60/128,703 filed on 1999-04-09, Application No. U.S.
60/176,068 filed on 2000-01-14, Application No. U.S. 60/128,697
filed on 1999-04-09, Application No. U.S. 60/176,929 filed on
2000-01-20, Application No. U.S. 60/128,698 filed on 1999-04-09,
Application No. U.S. 60/176,926 filed on 2000-01-20, Application
No. U.S. 60/128,699 filed on 1999-04-09, Application No. U.S.
60/177,050 filed on 2000-01-20, Application No. U.S. 60/128,701
filed on 1999-04-09, Application No. U.S. 60/177,166 filed on
2000-01-20, Application No. U.S. 60/128,700 filed on 1999-04-09,
Application No. U.S. 60/176,930 filed on 2000-01-20, Application
No. U.S. 60/128,694 filed on 1999-04-09, Application No. U.S.
60/176,931 filed on 2000-01-20, Application No. U.S. 60/128,702
filed on 1999-04-09, Application No. U.S. 60/177,049 filed on
2000-01-20, Application No. U.S. 60/138,629 filed on 1999-06-11,
Application No. U.S. 60/138,628 filed on 1999-06-11, Application
No. U.S. 60/138,631 filed on 1999-06-11, Application No. U.S.
60/138,632 filed on 1999-06-11, Application No. U.S. 60/138,599
filed on 1999-06-11, Application No. U.S. 60/138,572 filed on
1999-06-11, Application No. U.S. 60/138,625 filed on 1999-06-11,
Application No. U.S. 60/138,633 filed on 1999-06-11, Application
No. U.S. 60/138,630 filed on 1999-06-11, Application No. U.S.
60/138,627 filed on 1999-06-11, Application No. U.S. 60/155,808
filed on 1999-09-27, Application No. U.S. 60/155,804 filed on
1999-09-27, Application No. U.S. 60/155,807 filed on 1999-09-27,
Application No. U.S. 60/155,805 filed on 1999-09-27, Application
No. U.S. 60/155,806 filed on 1999-09-27, Application No. U.S.
60/201,194 filed on 2000-05-O.sub.2, and Application No. U.S.
60/212,142 filed on 2000-06-16. TABLE-US-00024 LENGTHY TABLE The
patent application contains a lengthy table section. A copy of the
table is available in electronic form from the USPTO web site
(http://seqdata.uspto.gov/?pageRequest=docDetail&DocID=US20070048297A1).
An electronic copy of the table will also be available from the
USPTO upon request and payment of the fee set forth in 37 CFR
1.19(b)(3).
* * * * *
References