RNAi modulation of the Rho-A gene in research models

Abstract

The invention relates to compositions and methods for modulating the expression of the RhoA gene, and more particularly to the downregulation of RhoA by chemically modified oligonucleotides.

Description

RELATED APPLICATIONS

[0001] This application claims the benefit of U.S. Provisional Application No. 60/701,470, filed Jul. 21, 2005, U.S. Provisional Application No. 60/726,838, filed Oct. 14, 2005, and U.S. Provisional Application No. 60/748,316, filed Dec. 7, 2005. The contents of each of these priority applications are incorporated herein by reference in their entirety.

TECHNICAL FIELD

[0002] The invention relates to compositions and methods for modulating the expression of RhoA, and more particularly to the downregulation of RhoA mRNA and RhoA protein levels by oligonucleotides via RNA interference, e.g., chemically modified oligonucleotides.

BACKGROUND

[0003] RNA interference or "RNAi" is a term initially coined by Fire and co-workers to describe the observation that double-stranded RNA (dsRNA) can block gene expression when it is introduced into worms (Fire et al., Nature 391:806-811, 1998). Short dsRNA directs gene-specific, post-transcriptional silencing in many organisms, including vertebrates, and has provided a new tool for studying gene function.

[0004] Numerous myelin-derived axon growth inhibitors have been characterized (see, for review, David et al., WO995394547, 1999; Bandman et al. U.S. Pat. No. 5,858,708, 1999; Schwab, Neurochem. Res. 21:755-761, 1996). Several components of CNS white matter, NI35, NI250 (Nogo) and Myelin-associated glycoprotein (MAG), which have inhibitory activity for axonal extension, have been described as well (Schwab et al., WO9005191, 1990; Schwab et al., U.S. Pat. No. 5,684,133, 1997). In particular, RhoA is a member of the large family of Rho (Ras homologue) GTPases, itself belonging to the superfamily of Ras GTPases. All eukaryotes contain at least one Rho GTPase. During the process of evolution the number of Rho GTPases increased from 5 to 6 per organism (yeast) to over 20 (mammals) (Karnoub, A. E., et al., Breast Cancer Res. Treat. 2004, 84:61). Like other GTPases, RhoA has intrinsic GTPase activity and shuttles between an inactive GDP-bound state and an active GTP-bound state. In vitro, the exchange of GDP to GTP occurs very slowly, and is catalyzed by guanine nucleotide exchange factors (GEFs), which exchange GDP for GTP. GTPase activating proteins (GAPs) catalyze hydrolysis of the .gamma.-phosphate of GTP. (Wheeler, A. P., Ridley, A. J., Exp. Cell Res. 2004, 301:43). A third set of regulatory proteins, the guanine nucleotide-dissociation inhibitors (GDIs), sequester GTPAses in the cytosol in the inactive, GDP-bound state.

[0005] The N-terminal half of Rho GTPases contains the majority of the amino acids involved in GTP binding and hydrolysis, together with the Switch 1 and 2 regions that change conformation between the GTP-bound and GDP-bound states (Bishop, A. L., Hall, A., Biochem. J. 2000, 348 (Pt. 2):241). The C-terminus of Rho family GTPases is essential for correct localization of the proteins. It is post-translationally modified by prenylation of a conserved C-terminal cysteine followed by methylation and proteolytic removal of the last three amino acids (Shao, F., Dixon, J. E., Adv. Exp. Med. Biol. 2003, 529:79). The prenyl group anchors the GTPases into membranes and this modification is essential for cell growth, transformation, and cytoskeleton organization (Allal, C., et al., J. Biol. Chem. 2000, 275:31001). Prenylation of Rho proteins appears to be important for their stability, inhibitors of enzymes that synthesize prenyl groups induce a decrease in Rho protein levels and their function (Stamatakis, K., et al., J. Biol. Chem 2002, 277:49389). In the case of RhoA, prenylation adds a geranylgeranyl group. RhoA is mainly found in the cytoplasm or at the plasma membrane (Adamson, P., et al., J. Cell Biol. 1992, 119:617).

[0006] RhoA may bind to the intracellular portion of p75NTR and is activated by Nogo-R in a p75NTR-dependent manner (Wang, K. C., et al., Nature 2002, 420:74), which is how MAG, Nogo-66, and oligodendrocyte-myelin glycoprotein achieve RhoA activation. The central inhibitory domain of Nogo-A, NiG, distinct from Nogo-66, and Versican V2, a chondroitin-sulfate proteoglycan and another component of myelin, are able to activate RhoA in the absence of p75NTR, by an alternative pathway of RhoA activation remaining to be elucidated (Schweigreiter, R., et al., Mol. Cell Neurosci. 2004, 27:163). Further pathways of activation may exist.

[0007] RhoA is part of the growth inhibitory machinery present in the central nervous system (CNS), but not in peripheral nerves, which prevents the regeneration of CNS tissue after injury. Both the expression and the activation of RhoA is induced in brain and spinal cord injury (Mueller, K., et al., Nature Reviews 2005, 4:387). Activation of RhoA leads to neuronal growth cone collapse, retraction bulb formation and neurite withdrawal. Inactivation of RhoA leads to neurite outgrowth in primary neurons on otherwise inhibitory substrates in vitro, and promotes axon regeneration and functional recovery after spinal cord injury in rats and mice in vivo (Lehmann, M. A., et al., J. Neurosci. 1999, 19:7537; Hara, M, et al., J. Neurosurg. 2000, 93:94; Dergham, P., et al., J. Neurosci. 2002, 22:6570). Furthermore, inactivation of Rho has been shown to protect endogenous cells of the spinal cord from apoptosis induced by spinal cord injury (Dubreuil, C. I., et al, J. Cell Biol. 2003, 162:233). These findings have clinical relevance because neuroprotective treatments after spinal cord injury lead to improved functional recovery (Liu, X. Z., et al., J. Neurosci. 1997, 17:5395).

[0008] Evidently, RhoA is a potential target for therapeutic intervention strategies aimed at diseases and conditions involving, e.g., the destruction and/or impaired regeneration of cells of the CNS. The present invention advances the art by providing methods and medicaments encompassing short dsRNAs leading to the downregulation of RhoA mRNA and protein levels in cells expressing the RhoA gene. These methods and medicaments may be used in the treatment of disorders or pathological processes mediated, at least in part, by RhoA, e.g., by preventing the RhoA inhibition of axonal elongation and regeneration, and consequently stimulating nerve growth and proliferation.

SUMMARY

[0009] The present invention is based, at least in part, on an investigation of the RhoA gene using iRNA agents and further testing of the iRNA agents that target the RhoA site. The present invention provides compositions and methods that are useful in reducing RhoA mRNA levels, RhoA protein levels and the treatment of pathological process mediated, at least in part, by RhoA, e.g. preventing RhoA inhibition of axonal elongation and regeneration, in a subject, e.g., a mammal, such as a human.

[0010] In one aspect, the invention provides iRNA agents comprising a sense strand, wherein the sense strand comprises at least 15 contiguous nucleotides that differ by no more than 1, 2, or 3 nucleotides from the sense strand sequences of any one agent selected from the group consisting of: agents number 6477 to 6836 as given in Table 1 below, and an antisense strand, wherein the antisense strand comprises at least 15 contiguous nucleotides that differ by no more than 1, 2, or 3 nucleotides from the antisense sequences of any one agent selected from the group consisting of: agents number 6477 to 6836.

[0011] In a further aspect, the invention provides iRNA agents for inhibiting the expression of a rhoA gene in a cell comprising a sense strand, wherein the sense strand comprises at least 15 contiguous nucleotides that differ by no more than 1, 2, or 3 nucleotides from the sense strand sequences of any one agent selected from the group consisting of: agents number 6477 to 6836, and an antisense strand wherein the antisense strand comprises at least 15 contiguous nucleotides of the antisense sequences of any one agent selected from the group consisting of: agents number 6477 to 6836, and wherein the iRNA agent reduces the amount of RhoA MRNA present in cultured human cells after incubation with these agents by 40% or more compared to cells which have not been incubated with the agent.

[0012] In a further aspect, the invention provides iRNA agents for inhibiting the expression of a rhoA gene in a cell comprising a sense strand and an antisense strand each comprising a sequence of at least 16, 17 or 18 nucleotides which is essentially identical to one of the sequences of any one agent selected from the group consisting of: agents number 6477 to 6836, except that not more than 1, 2 or 3 nucleotides per strand, respectively, have been substituted by other nucleotides (e.g. adenosine replaced by uracil), while essentially retaining the ability to inhibit RhoA expression. Preferably, for such agents the sense and/or antisense strand sequence is chosen from the group consisting of: the sense and antisense strand sequences of agent numbers 6523, 6524, 6530, 6614, 6650, 6656, 6657, 6661, 6662, 6703, 6712, 6713, 6732, 6751, 6756, 6767, 6769, 6787, 6789, 6790, 6832.

[0013] Evidently, in the above embodiments, the sense strands and/or antisense strands of the iRNA agents of the invention can also be identical to the sense strands and antisense strands of the agents, agent numbers 6477 to 6836.

[0014] The iRNA agents of the invention may comprise a modification, e.g a modification that causes the iRNA agent to have increased stability in a biological sample. For example, they may comprise a phosphorothioate, a 2'-modified nucleotide, a locked nucleotide, an abasic nucleotide, morpholino nucleotide, a phosphoramidate, or a non-natural base comprising nucleotide. For purposes of the above embodiments, an iRNA agent is considered to comprise one of the sequences of the agents, agent numbers 6477 to 6836, irrespective of the potential presence of nucleotide modifications, i.e. a 2'-O-methyl guanosine would be considered a guanosine for such comparison. However, certain patterns of modifications are particularly preferred embodiments of the present invention. Consequently, in another embodiment, the invention provides iRNA agents for inhibiting the expression of a rhoA gene in a cell wherein the sense and/or antisense strand sequence is chosen from the group consisting of: the sense and antisense strand sequences of agent numbers AL-DP-5972, AL-DP-5973, AL-DP-5974, AL-DP-5975, AL-DP-5976, AL-DP-5978, AL-DP-5979, AL-DP-5981, AL-DP-5982, AL-DP-5983, AL-DP-5984, AL-DP-5986, AL-DP-5987, AL-DP-5988, AL-DP-5989, AL-DP-5990, AL-DP-5991, AL-DP-5992, AL-DP-5993, AL-DP-5994, AL-DP-5995, AL-DP-6176, AL-DP-6 177.

[0015] In the iRNA agents of the present invention, the antisense RNA strand may be 30 or fewer nucleotides in length, and the duplex region of the iRNA agent may be 15-30 nucleotide pairs in length.

[0016] A 2'-modified nucleotide according to the instant invention may comprise at least one 5'-uridine-adenine-3' (5'-ua-3') dinucleotide wherein the uridine is a 2'-modified nucleotide; at least one 5'-uridine-guanine-3' (5'-ug-3') dinucleotide, wherein the 5'-uridine is a 2'-modified nucleotide; at least one 5'-cytidine-adenine-3' (5'-ca-3') dinucleotide, wherein the 5'-cytidine is a 2'-modified nucleotide; or at least one 5'-uridine-uridine-3' (5'-uu-3') dinucleotide, wherein the 5'-uridine is a 2'-modified nucleotide.

[0017] The iRNA agents of the invention may be designed such that

[0018] every 5'-nucleotide in 5'-ua-3', 5'-uu-3', 5'-ca-3', and 5'-ug-3' motifs is a 2'-modified in sense strand, and every 5'-nucleotide in 5'-ua-3' and 5'-ca-3' motifs is 2'-modified in antisense strand, or

[0019] every 5'-nucleotide in 5'-ua-3', 5'-uu-3', 5'-ca-3', and 5'-ug-3' motifs is 2'-modified in the sense and antisense strand, or

[0020] every pyrimidine nucleotide is 2'-modified in the sense strand, and every 5'-nucleotide in 5'-ua-3' and 5'-ca-3' motifs is 2'-modified in the antisense strand, or

[0021] every pyrimidine nucleotide is 2'-modified in sense strand, and every 5'-nucleotide in 5'-ua-3', 5'-uu-3', 5'-ca-3', and 5'-ug-3' motifs is 2'-modified in the antisense strand, or

[0022] every pyrimidine nucleotide in the sense strand is 2'-modified, and no nucleotide is 2'-modified in the antisense strand.

[0023] The 2'-modification in the iRNA agents of the invention may be selected from the group consisting of: 2'-deoxy, 2'-deoxy-2'-fluoro, 2'-O-methyl, 2'-O-methoxyethyl (2'-O-MOE), 2'-O-aminopropyl (2'-O-AP), 2'-O-dimethylaminoethyl (2'-O-DMAOE), 2'-O-dimethylaminopropyl (2'-O-DMAP), 2'-O-dimethylaminoethyloxyethyl (2'-O-DMAEOE), and 2'-O-N-methylacetamido (2'-O-NMA).

[0024] The iRNA agents of the invention may comprise a nucleotide overhang having 1 to 4 unpaired nucleotides, preferably 2 or 3 unpaired nucleotides. The nucleotide overhang may be at the 3'-end of the antisense strand of the iRNA agent. The iRNA agents may comprise a cholesterol moiety, which is preferably conjugated to the 3'-end of the sense strand of the iRNA agent. In a preferred embodiment, the iRNA agent is targeted for uptake by nerve cells or nerve sheath cells.

[0025] The present invention further provides methods for reducing the level of RhoA mRNA in a cell. The present methods utilize the cellular mechanisms involved in RNA interference to selectively degrade RhoA mRNA in a cell and are comprised of the step of contacting a cell with one of the iRNA agents of the present invention. Such methods can be performed directly on a cell or can be performed on a mammalian subject by administering to a subject one of the iRNA agents of the present invention. Reduction of RhoA mRNA in a cell results in a reduction in the amount of RhoA protein produced, and in an organism, may result in a decrease in RhoA specific pathological/disease effects, e.g. preventing RhoA inhibition of axonal elongation and regeneration.

[0026] In another aspect of the invention, a method of treating a human subject having a pathological process mediated in part by RhoA is provided, comprising administering an iRNA agent of the invention, e.g. wherein the iRNA agent comprises a sense strand wherein the sense strand comprises at least 15 contiguous nucleotides that differ by no more than 1, 2, or 3 nucleotides from the sense strand sequences any one of the agents, agent numbers 6477 to 6836, and an antisense strand, wherein the antisense strand comprises at least 15 contiguous nucleotides that differ by no more than 1, 2, or 3 nucleotides from the antisense strand sequences of any one of the agents, agent numbers 6477 to 6836.

[0027] In one embodiment of the above methods of the invention, the pathological process is the inhibition of nerve growth or elongation, preferably as a result of nerve injury or damage. In another preferred embodiment, the iRNA agent is administered in an amount sufficient to reduce the expression of RhoA in a cell or tissue of the subject. Preferably, the subject is a human.

[0028] In another aspect, the instant invention provides pharmaceutical compositions, comprising:

[0029] a.) an iRNA agent of the invention; and

[0030] b.) a pharmaceutically acceptable carrier

[0031] In another embodiment, the invention provides a cell comprising an iRNA agent of the invention.

[0032] In another embodiment, the invention provides a method for inhibiting the expression of a RhoA gene in a cell, the method comprising: [0033] (a) introducing into the cell an iRNA agent of the invention; and [0034] (b) maintaining the cell produced in step (a) for a time sufficient to obtain degradation of the mRNA transcript of the RhoA gene, thereby inhibiting expression of the RhoA gene in the cell.

[0035] In another embodiment, the invention provides a vector for inhibiting the expression of a RhoA gene in a cell, said vector comprising a regulatory sequence operably linked to a nucleotide sequence that encodes at least one strand of an an iRNA agent of the invention.

[0036] In another embodiment, the invention provides a cell comprising the above vector.

[0037] The methods and compositions of the invention, e.g., the methods and iRNA compositions can be used with any dosage and/or formulation described herein, as well as with any route of administration described herein.

[0038] The details of one or more embodiments of the invention are set forth in the description below. Other features, objects, and advantages of the invention will be apparent from this description and from the claims. This application incorporates all cited references, patents, and patent applications by references in their entirety for all purposes.

BRIEF DESCRIPTION OF DRAWINGS

[0039] FIG. 1 is a schematic illustrating the synthesis and structure of cholesterol conjugated RNA strands. The sphere represents the solid phase (controlled pore glass, CPG).

[0040] FIG. 2 shows the effect of administration of iRNA agents of the invention, and of a control agent, respectively, to the site of injury in rats that have undergone partial dissection of the spinal cord; shown is the improvement in BBB locomotor score from day 10 after spinal cord injury, taking the BBB locomotor score of individual rats on day 10 as 0.

DETAILED DESCRIPTION

[0041] For ease of exposition the term "nucleotide" or "ribonucleotide" is sometimes used herein in reference to one or more monomeric subunits of an RNA agent. It will be understood that the usage of the term "ribonucleotide" or "nucleotide" herein can, in the case of a modified RNA or nucleotide surrogate, also refer to a modified nucleotide, or surrogate replacement moiety, as further described below, at one or more positions.

[0042] An "RNA agent" as used herein, is an unmodified RNA, modified RNA, or nucleoside surrogate, each of which is described herein or is well known in the RNA synthetic art. While numerous modified RNAs and nucleoside surrogates are described, preferred examples include those which have greater resistance to nuclease degradation than do unmodified RNAs. Preferred examples include those that have a 2' sugar modification, a modification in a single strand overhang, preferably a 3' single strand overhang, or, particularly if single stranded, a 5'-modification which includes one or more phosphate groups or one or more analogs of a phosphate group.

[0043] An "iRNA agent" (abbreviation for "interfering RNA agent") as used herein, is an RNA agent, which can downregulate the expression of a target gene, e.g., RhoA. While not wishing to be bound by theory, an iRNA agent may act by one or more of a number of mechanisms, including post-transcriptional cleavage of a target mRNA sometimes referred to in the art as RNAi, or pre-transcriptional or pre-translational mechanisms. An iRNA agent can be a double stranded iRNA agent.

[0044] A "ds iRNA agent" (abbreviation for "double stranded iRNA agent"), as used herein, is an iRNA agent which includes more than one, and preferably two, strands in which interstrand hybridization can form a region of duplex structure. A "strand" herein refers to a contigouous sequence of nucleotides (including non-naturally occurring or modified nucleotides). The two or more strands may be, or each form a part of, separate molecules, or they may be covalently interconnected, e.g., by a linker, e.g., a polyethyleneglycol linker, to form one molecule. At least one strand can include a region which is sufficiently complementary to a target RNA. Such strand is termed the "antisense strand." A second strand of the dsRNA agent, which comprises a region complementary to the antisense strand, is termed the "sense strand." However, a ds iRNA agent can also be formed from a single RNA molecule which is at least partly self-complementary, forming, e.g., a hairpin or panhandle structure, including a duplex region. In such case, the term "strand" refers to one of the regions of the RNA molecule that is complementary to another region of the same RNA molecule.

[0045] Although, in mammalian cells, long ds iRNA agents can induce the interferon response which is frequently deleterious, short ds iRNA agents do not trigger the interferon response, at least not to an extent that is deleterious to the cell and/or host (Manche et al., Mol. Cell. Biol. 12:5238, 1992; Lee et al., Virology 199:491, 1994; Castelli et al., J. Exp. Med. 186:967, 1997; Zheng et al., RNA 10:1934, 2004; Heidel et al., "Lack of interferon response in animals to naked siRNAs" Nature Biotechn. advance online publication doi: 10.1038/nbt1038, Nov. 21, 2004). The iRNA agents of the present invention include molecules which are sufficiently short that they do not trigger a deleterious non-specific interferon response in normal mammalian cells. Thus, the administration of a composition including an iRNA agent (e.g., formulated as described herein) to a subject can be used to decreased expression of the RhoA genes in RhoA expressing cells in the subject, while circumventing an interferon response. Molecules that are short enough that they do not trigger a deleterious interferon response are termed siRNA agents or siRNAs herein. "siRNA agent" or "siRNA" as used herein, refers to an iRNA agent, e.g., a ds iRNA agent, that is sufficiently short that it does not induce a deleterious interferon response in a human cell, e.g., it has a duplexed region of less than 60 but preferably less than 50, 40, or 30 nucleotide pairs.

[0046] The isolated iRNA agents described herein, including ds iRNA agents and siRNA agents, can mediate the decreased expression of a RhoA nucleic acid, e.g., by RNA degradation. For convenience, such RNA is also referred to herein as the RNA to be silenced. Such a nucleic acid is also referred to as a target gene. Preferably, the RNA to be silenced is a gene product of an endogenous RhoA gene.

[0047] As used herein, the phrase "mediates RNAi" refers to the ability of an agent to silence, in a sequence specific manner, a target gene. "Silencing a target gene" means the process whereby a cell containing and/or expressing a certain product of the target gene when not in contact with the agent, will contain and/or express at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, or 90% less of such gene product when contacted with the agent, as compared to a similar cell which has not been contacted with the agent. Such product of the target gene can, for example, be a messenger RNA (mRNA), a protein, or a regulatory element.

[0048] As used herein, the term "complementary" is used to indicate a sufficient degree of complementarity such that stable and specific binding occurs between a compound of the invention and a target RNA molecule, e.g., a RhoA mRNA. Specific binding requires a sufficient degree of complementarity to avoid non-specific binding of the oligomeric compound to non-target sequences under conditions in which specific binding is desired, i.e., under physiological conditions in the case of in vivo assays or therapeutic treatment, or in the case of in vitro assays, under conditions in which the assays are performed. The non-target sequences typically differ from the target sequences by at least 4 nucleotides.

[0049] As used herein, an iRNA agent is "sufficiently complementary" to a target RNA, e.g., a target mRNA (e.g., a target RhoA mRNA) if the iRNA agent reduces the production of a protein encoded by the target RNA in a cell. The iRNA agent may also be "exactly complementary" to the target RNA, e.g., the target RNA and the iRNA agent anneal, preferably to form a hybrid made exclusively of Watson-Crick basepairs in the region of exact complementarity. A "sufficiently complementary" iRNA agent can include an internal region (e.g., of at least 10 nucleotides) that is exactly complementary to a target RhoA RNA. Moreover, in some embodiments, the iRNA agent specifically discriminates a single-nucleotide difference. In this case, the iRNA agent only mediates RNAi if exact complementarity is found in the region (e.g., within 7 nucleotides of) the single-nucleotide difference. Preferred iRNA agents will be based on or consist of or comprise the sense and antisense sequences provided in Table 1.

[0050] As used herein, "essentially identical" when used referring to a first nucleotide sequence in comparison to a second nucleotide sequence means that the first nucleotide sequence is identical to the second nucleotide sequence except for up to one, two or three nucleotide substitutions (e.g., adenosine replaced by uracil). "Essentially retaining the ability to inhibit RhoA expression in cultured human RhoA expressing cells," as used herein referring to an iRNA agent not identical to but derived from one of the iRNA agents of Table 1 by deletion, addition or substitution of nucleotides, means that the derived iRNA agent possesses an inhibitory activity not more than 20% (in terms of remaining target mRNA) different from the inhibitory activity of the iRNA agent of Table 1 from which it was derived. For example, an iRNA agent derived from an iRNA agent of Table 1 which lowers the amount of RhoA mRNA present in cultured human Rho-A expressing cells by 70% may itself lower the amount of RhoA mRNA present in cultured human RhoA expressing cells by at least 50% in order to be considered as essentially retaining the ability to inhibit RhoA expression in cultured human RhoA expressing cells. Optionally, an iRNA agent of the invention may lower the amount of RhoA mRNA present in cultured human RhoA expressing cells by at least 50%, or at least 40%.

[0051] As used herein, a "subject" refers to a mammalian organism undergoing treatment for a disorder mediated by RhoA protein expression. The subject can be any mammal, such as a cow, horse, mouse, rat, dog, pig, goat, or a primate. In the preferred embodiment, the subject is a human.

[0052] Design and Selection of iRNA Agents

[0053] As used herein, "disorders associated with RhoA expression" refers to any biological or pathological state that (1) is mediated in part by the presence of RhoA mRNA and/or protein and (2) whose outcome can be affected by reducing the level of RhoA mRNA and/or protein present. Specific disorders associated with RhoA expression are noted below and are primarily based on the responsibility of RhoA action in inhibiting axonal elongation and regeneration.

[0054] The present invention is based on the design, synthesis and generation of iRNA agents that target RhoA and the demonstration of silencing of a RhoA gene in vitro in cultured cells after incubation with an iRNA agent, and the resulting RhoA-specific effect.

[0055] An iRNA agent can be rationally designed based on sequence information and desired characteristics. For example, an iRNA agent can be designed according to the relative melting temperature of the candidate duplex. Generally, the duplex should have a lower melting temperature at the 5' end of the antisense strand than at the 3' end of the antisense strand.

[0056] Candidate iRNA agents can also be designed by performing, for example, a gene walk analysis of the genes that will serve as the target gene. Overlapping, adjacent, or closely spaced candidate agents corresponding to all or some of the transcribed region can be generated and tested. Each of the iRNA agents can be tested and evaluated for the ability to down regulate the target gene expression (see below, "Evaluation of Candidate iRNA agents").

[0057] Herein, potential iRNA agents targeting RhoA were designed using the known sequences of RhoA for human, rat and mouse and other known RhoA sequences. The target sequences shown in Table 1 hereinabove were selected from those regions of the human RhoA mRNA sequences that show complete homology with the corresponding sequences in rat and mouse. Therefore, the siRNA agents, agent numbers 6477-6836 should show cross reactivity between these three species. Based on the results provided, the present invention provides iRNA agents that silence RhoA in cultured human RhoA expressing cells and in a subject.

[0058] Table 1 provides exemplary iRNA agents targeting RhoA TABLE-US-00001 TABLE 1 Exemplary iRNA agents for targeting RhoA mRNA Start duplex sense strand antisense strand pos. SEQ design SEQ SEQ Agent in ID (over- ID ID number RNA.sup.b NO. target sequence (5'-3') hang).sup.a NO. sequence (5'-3') NO. sequence (5'-3') 6477 288 1 ccggaagaaacuggugauuguug double 2 ggaagaaacuggugauuguTT 3 acaaucaccaguuucuuccTT 6478 289 4 cggaagaaacuggugauuguugg double 5 gaagaaacuggugauuguuTT 6 aacaaucaccaguuucuucTT 6479 290 7 ggaagaaacuggugauuguuggu double 8 aagaaacuggugauuguugTT 9 caacaaucaccaguuucuuTT 6480 291 10 gaagaaacuggugauuguuggug double 11 agaaacuggugauuguuggTT 12 ccaacaaucaccaguuucuTT 6481 292 13 aagaaacuggugauuguugguga double 14 gaaacuggugauuguugguTT 15 accaacaaucaccaguuucTT 6482 293 16 agaaacuggugauuguuggugau double 17 aaacuggugauuguuggugTT 18 caccaacaaucaccaguuuTT 6483 294 19 gaaacuggugauuguuggugaug double 20 aacuggugauuguuggugaTT 21 ucaccaacaaucaccaguuTT 6484 295 22 aaacuggugauuguuggugaugg double 23 acuggugauuguuggugauTT 24 aucaccaacaaucaccaguTT 6485 296 25 aacuggugauuguuggugaugga double 26 cuggugauuguuggugaugTT 27 caucaccaacaaucaccagTT 6486 297 28 acuggugauuguuggugauggag double 29 uggugauuguuggugauggTT 30 ccaucaccaacaaucaccaTT 6487 298 31 cuggugauuguuggugauggagc double 32 ggugauuguuggugauggaTT 33 uccaucaccaacaaucaccTT 6488 299 34 uggugauuguuggugauggagcc double 35 gugauuguuggugauggagTT 36 cuccaucaccaacaaucacTT 6489 300 37 ggugauuguuggugauggagccu double 38 ugauuguuggugauggagcTT 39 gcuccaucaccaacaaucaTT 6490 326 40 gaaagacaugcuugcucauaguc double 41 aagacaugcuugcucauagTT 42 cuaugagcaagcaugucuuTT 6491 327 43 aaagacaugcuugcucauagucu double 44 agacaugcuugcucauaguTT 45 acuaugagcaagcaugucuTT 6492 328 46 aagacaugcuugcucauagucuu double 47 gacaugcuugcucauagucTT 48 gacuaugagcaagcaugucTT 6493 329 49 agacaugcuugcucauagucuuc double 50 acaugcuugcucauagucuTT SI agacuaugagcaagcauguTT 6494 330 52 gacaugcuugcucauagucuuca double 53 caugcuugcucauagucuuTT 54 aagacuaugagcaagcaugTT 6495 331 55 acaugcuugcucauagucuucag double 56 augcuugcucauagucuucTT 57 gaagacuaugagcaagcauTT 6496 332 58 caugcuugcucauagucuucagc double 59 ugcuugcucauagucuucaTT 60 ugaagacuaugagcaagcaTT 6497 333 61 augcuugcucauagucuucagca double 62 gcuugcucauagucuucagTT 63 cugaagacuaugagcaagcTT 6498 334 64 ugcuugcucauagucuucagcaa double 65 cuugcucauagucuucagcTT 66 gcugaagacuaugagcaagTT 6499 335 67 gcuugcucauagucuucagcaag double 68 uugcucauagucuucagcaTT 69 ugcugaagacuaugagcaaTT 6500 336 70 cuugcucauagucuucagcaagg double 71 ugcucauagucuucagcaaTT 72 uugcugaagacuaugagcaTT 6501 337 73 uugcucauagucuucagcaagga double 74 gcucauagucuucagcaagTT 75 cuugcugaagacuaugagcTT 6502 338 76 ugcucauagucuucagcaaggac double 77 cucauagucuucagcaaggTT 78 ccuugcugaagacuaugagTT 6503 339 79 gcucauagucuucagcaaggacc double 80 ucauagucuucagcaaggaTT 81 uccuugcugaagacuaugaTT 6504 340 82 cucauagucuucagcaaggacca double 83 cauagucuucagcaaggacTT 84 guccuugcugaagacuaugTT 6505 341 85 ucauagucuucagcaaggaccag double 86 auagucuucagcaaggaccTT 87 gguccuugcugaagacuauTT 6506 342 88 cauagucuucagcaaggaccagu double 89 uagucuucagcaaggaccaTT 90 ugguccuugcugaagacuaTT 6507 343 91 auagucuucagcaaggaccaguu double 92 agucuucagcaaggaccagTT 93 cugguccuugcugaagacuTT 6508 344 94 uagucuucagcaaggaccaguuc double 95 gucuucagcaaggaccaguTT 96 acugguccuugcugaagacTT 6509 345 97 agucuucagcaaggaccaguucc double 98 ucuucagcaaggaccaguuTT 99 aacugguccuugcugaagaTT 6510 346 100 gucuucagcaaggaccaguuccc double 101 cuucagcaaggaccaguucTT 102 gaacugguccuugcugaagTT 6511 347 103 ucuucagcaaggaccaguuccca double 104 uucagcaaggaccaguuccTT 105 ggaacugguccuugcugaaTT 6512 348 106 cuucagcaaggaccaguucccag double 107 ucagcaaggaccaguucccTT 108 gggaacugguccuugcugaTT 6513 349 109 uucagcaaggaccaguucccaga double 110 cagcaaggaccaguucccaTT 111 ugggaacugguccuugcugTT 6514 350 112 ucagcaaggaccaguucccagag double 113 agcaaggaccaguucccagTT 114 cugggaacugguccuugcuTT 6515 351 115 cagcaaggaccaguucccagagg double 116 gcaaggaccaguucccagaTT 117 ucugggaacugguccuugcTT 6516 352 118 agcaaggaccaguucccagaggu double 119 caaggaccaguucccagagTT 120 cucugggaacugguccuugTT 6517 353 121 gcaaggaccaguucccagaggug double 122 aaggaccaguucccagaggTT 123 ccucugggaacugguccuuTT 6518 354 124 caaggaccaguucccagaggugu double 125 aggaccaguucccagagguTT 126 accucugggaacugguccuTT 6519 425 127 gaaagcagguagaguuggcuuug double 128 aagcagguagaguuggcuuTT 129 aagccaacucuaccugcuuTT 6520 426 130 aaagcagguagaguuggcuuugu double 131 agcagguagaguuggcuuuTT 132 aaagccaacucuaccugcuTT 6521 535 133 gacagcccugauaguuuagaaaa double 134 cagcccugauaguuuagaaTT 135 uucuaaacuaucagggcugTT 6522 536 136 acagcccugauaguuuagaaaac double 137 agcccugauaguuuagaaaTT 138 uuucuaaacuaucagggcuTT 6523 537 139 cagcccugauaguuuagaaaaca double 140 gcccugauaguuuagaaaaTT 141 uuuucuaaacuaucagggcTT 6524 538 142 agcccugauaguuuagaaaacau double 143 cccugauaguuuagaaaacTT 144 guuuucuaaacuaucagggTT 6525 539 145 gcccugauaguuuagaaaacauc double 146 ccugauaguuuagaaaacaTT 147 uguuuucuaaacuaucaggTT 6526 540 148 cccugauaguuuagaaaacaucc double 149 cugauaguuuagaaaacauTT 150 auguuuucuaaacuaucagTT 6527 541 151 ccugauaguuuagaaaacauccc double 152 ugauaguuuagaaaacaucTT 153 gauguuuucuaaacuaucaTT 6528 542 154 cugauaguuuagaaaacauccca double 155 gauaguuuagaaaacauccTT 156 ggauguuuucuaaacuaucTT 6529 543 157 ugauaguuuagaaaacaucccag double 158 auaguuuagaaaacaucccTT 159 gggauguuuucuaaacuauTT 6530 544 160 gauaguuuagaaaacaucccaga double 161 uaguuuagaaaacaucccaTT 162 ugggauguuuucuaaacuaTT 6531 545 163 auaguuuagaaaacaucccagaa double 164 aguuuagaaaacaucccagTT 165 cugggauguuuucuaaacuTT 6532 546 166 uaguuuagaaaacaucccagaaa double 167 guuuagaaaacaucccagaTT 168 ucugggauguuuucuaaacTT 6533 547 169 aguuuagaaaacaucccagaaaa double 170 uuuagaaaacaucccagaaTT 171 uucugggauguuuucuaaaTT 6534 548 172 guuuagaaaacaucccagaaaag double 173 uuagaaaacaucccagaaaTT 174 uuucugggauguuuucuaaTT 6535 549 175 uuuagaaaacaucccagaaaagu double 176 uagaaaacaucccagaaaaTT 177 uuuucugggauguuuucuaTT 6536 575 178 ccccagaagucaagcauuucugu double 179 ccagaagucaagcauuucuTT 180 agaaaugcuugacuucuggTT 6537 576 181 cccagaagucaagcauuucuguc double 182 cagaagucaagcauuucugTT 183 cagaaaugcuugacuucugTT 6538 577 184 ccagaagucaagcauuucugucc double 185 agaagucaagcauuucuguTT 186 acagaaaugcuugacuucuTT 6539 578 187 cagaagucaagcauuucuguccc double 188 gaagucaagcauuucugucTT 189 gacagaaaugcuugacuucTT 6540 579 190 agaagucaagcauuucuguccca double 191 aagucaagcauuucuguccTT 192 ggacagaaaugcuugacuuTT 6541 692 193 ugaaaccugaagaaggcagagau double 194 aaaccugaagaaggcagagTT 195 cucugccuucuucagguuuTT 6542 693 196 gaaaccugaagaaggcagagaua double 197 aaccugaagaaggcagagaTT 198 ucucugccuucuucagguuTT 6543 694 199 aaaccugaagaaggcagagauau double 200 accugaagaaggcagagauTT 201 aucucugccuucuucagguTT 6544 695 202 aaccugaagaaggcagagauaug double 203 ccugaagaaggcagagauaTT 204 uaucucugccuucuucaggTT 6545 696 205 accugaagaaggcagagauaugg double 206 cugaagaaggcagagauauTT 207 auaucucugccuucuucagTT 6546 697 208 ccugaagaaggcagagauauggc double 209 ugaagaaggcagagauaugTT 210 cauaucucugccuucuucaTT 6547 698 211 cugaagaaggcagagauauggca double 212 gaagaaggcagagauauggTT 213 ccauaucucugccuucuucTT 6548 699 214 ugaagaaggcagagauauggcaa double 215 aagaaggcagagauauggcTT 216 gccauaucucugccuucuuTT 6549 700 217 gaagaaggcagagauaugycaaa double 218 agaaggcagagauaug9caTT 219 ugccauaucucugccuucuTT 6550 701 220 aagaaggcagagauauggcaaac double 221 gaaggcagagauauggcaaTT 222 uugccauaucucugccuucTT 6551 702 223 agaaggcagagauauggcaaaca double 224 aaggcagagauauggcaaaTT 225 uuugccauaucucugccuuTT 6552 703 226 gaaggcagagauauggcaaacag double 227 aggcagagauauggcaaacTT 228 guuugccauaucucugccuTT 6553 704 229 aaggcagagauauggcaaacagg double 230 ggcagagauauggcaaacaTT 231 uguuugccauaucucugccTT 6554 705 232 aggcagagauauggcaaacagga double 233 gcagagauauggcaaacagTT 234 cuguuugccauaucucugcTT 6555 706 235 ggcagagauauggcaaacaggau double 236 cagagauauggcaaacaggTT 237 ccuguuugccauaucucugTT 6556 707 238 gcagagauauggcaaacaggauu double 239 agagauauggcaaacaggaTT 240 uccuguuugccauaucucuTT

6557 708 241 cagagauauggcaaacaggauug double 242 gagauauggcaaacaggauTT 243 auccuguuugccauaucucTT 6558 709 244 agagauauggcaaacaggauugg double 245 agauauggcaaacaggauuTT 246 aauccuguuugccauaucuTT 6559 710 247 gagauauggcaaacaggauuggc double 248 gauauggcaaacaggauugTT 249 caauccuguuugccauaucTT 6560 711 250 agauauggcaaacaggauuggcg double 251 auauggcaaacaggauuggTT 252 ccaauccuguuugccauauTT 6561 712 253 gauauggcaaacaggauuggcgc double 254 uauggcaaacaggauuggcTT 255 gccaauccuguuugccauaTT 6562 713 256 auauggcaaacaggauuggcgcu double 257 auggcaaacaggauuggcgTT 258 cgccaauccuguuugccauTT 6563 714 259 uauggcaaacaggauuggcgcuu double 260 uggcaaacaggauuggcgcTT 261 gcgccaauccuguuugccaTT 6564 715 262 auggcaaacaggauuggcgcuuu double 263 ggcaaacaggauuggcgcuTT 264 agcgccaauccuguuugccTT 6565 716 265 uggcaaacaggauuggcgcuuuu double 266 gcaaacaggauuggcgcuuTT 267 aagcgccaauccuguuugcTT 6566 717 268 ggcaaacaggauuggcgcuuuug double 269 caaacaggauuggcgcuuuTT 270 aaagcgccaauccuguuugTT 6567 718 271 gcaaacaggauuggcgcuuuugg double 272 aaacaggauuggcgcuuuuTT 273 aaaagcgccaauccuguuuTT 6568 719 274 caaacaggauuggcgcuuuuggg double 275 aacaggauuggcgcuuuugTT 276 caaaagcgccaauccuguuTT 6569 720 277 aaacaggauuggcgcuuuugggu double 278 acaggauuggcgcuuuuggTT 279 ccaaaagcgccaauccuguTT 6570 721 280 aacaggauuggcgcuuuugggua double 281 caggauuggcgcuuuugggTT 282 cccaaaagcgccaauccugTT 6571 722 283 acaggauuggcgcuuuuggguac double 284 aggauuggcgcuuuuggguTT 285 acccaaaagcgccaauccuTT 6572 723 286 caggauuggcgcuuuuggguaca double 287 ggauuggcgcuuuuggguaTT 288 uacccaaaagcgccaauccTT 6573 724 289 aggauuggcgcuuuuggguacau double 290 gauuggcgcuuuuggguacTT 291 guacccaaaagcgccaaucTT 6574 725 292 ggauuggcgcuuuuggguacaug double 293 auuggcgcuuuuggguacaTT 294 uguacccaaaagcgccaauTT 6575 726 295 gauuggcgcuuuuggguacaugg double 296 uuggcgcuuuuggguacauTT 297 auguacccaaaagcgccaaTT 6576 727 298 auuggcgcuuuuggguacaugga double 299 uggcgcuuuuggguacaugTT 300 cauguacccaaaagcgccaTT 6577 728 301 uuggcgcuuuuggguacauggag double 302 ggcgcuuuuggguacauggTT 303 ccauguacccaaaagcgccTT 6578 729 304 uggcgcuuuuggguacauggagu double 305 gcgcuuuuggguacauggaTT 306 uccauguacccaaaagcgcTT 6579 730 307 ggcgcuuuuggguacauggagug double 308 cgcuuuuggguacauggagTT 309 cuccauguacccaaaagcgTT 6580 731 310 gcgcuuuuggguacauggagugu double 311 gcuuuuggguacauggaguTT 312 acuccauguacccaaaagcTT 6581 732 313 cgcuuuuggguacauggaguguu double 314 cuuuuggguacauggagugTT 315 cacuccauguacccaaaagTT 6582 733 316 gcuuuuggguacauggaguguuc double 317 uuuuggguacauggaguguTT 318 acacuccauguacccaaaaTT 6583 734 319 cuuuuggguacauggaguguuca double 320 uuuggguacauggaguguuTT 321 aacacuccauguacccaaaTT 6584 735 322 uuuuggguacauggaguguucag double 323 uuggguacauggaguguucTT 324 gaacacuccauguacccaaTT 6585 736 325 uuuggguacauggaguguucagc double 326 uggguacauggaguguucaTT 327 ugaacacuccauguacccaTT 6586 737 328 uuggguacauggaguguucagca double 329 ggguacauggaguguucagTT 330 cugaacacuccauguacccTT 6587 738 331 uggguacauggaguguucagcaa double 332 gguacauggaguguucagcTT 333 gcugaacacuccauguaccTT 6588 739 334 ggguacauggaguguucagcaaa double 335 guacauggaguguucagcaTT 336 ugcugaacacuccauguacTT 6589 740 337 gguacauggaguguucagcaaag double 338 uacauggaguguucagcaaTT 339 uugcugaacacuccauguaTT 6590 741 340 guacauggaguguucagcaaaga double 341 acauggaguguucagcaaaTT 342 uuugcugaacacuccauguTT 6591 742 343 uacauggaguguucagcaaagac double 344 cauggaguguucagcaaagTT 345 cuuugcugaacacuccaugTT 6592 743 346 acauggaguguucagcaaagacc double 347 auggaguguucagcaaagaTT 348 ucuuugcugaacacuccauTT 6593 744 349 cauggaguguucagcaaagacca double 350 uggaguguucagcaaagacTT 351 gucuuugcugaacacuccaTT 6594 745 352 auggaguguucagcaaagaccaa double 353 ggaguguucagcaaagaccTT 354 ggucuuugcugaacacuccTT 6595 746 355 uggaguguucagcaaagaccaaa double 356 gaguguucagcaaagaccaTT 357 uggucuuugcugaacacucTT 6596 747 358 ggaguguucagcaaagaccaaag double 359 aguguucagcaaagaccaaTT 360 uuggucuuugcugaacacuTT 6597 748 361 gaguguucagcaaagaccaaaga double 362 guguucagcaaagaccaaaTT 363 uuuggucuuugcugaacacTT 6598 749 364 aguguucagcaaagaccaaagau double 365 uguucagcaaagaccaaagTT 366 cuuuggucuuugcugaacaTT 6599 750 367 guguucagcaaagaccaaagaug double 368 guucagcaaagaccaaagaTT 369 ucuuuggucuuugcugaacTT 6600 770 370 auggagugagagagguuuuugaa double 371 ggagugagagagguuuuugTT 372 caaaaaccucucucacuccTT 6601 771 373 uggagugagagagguuuuugaaa double 374 gagugagagagguuuuugaTT 375 ucaaaaaccucucucacucTT 6602 797 376 cuacgagagcugcucugcaagcu double 377 acgagagcugcucugcaagTT 378 cuugcagagcagcucucguTT 6603 798 379 uacgagagcugcucugcaagcua double 380 cgagagcugcucugcaagcTT 381 gcuugcagagcagcucucgTT 6604 799 382 acgagagcugcucugcaagcuag double 383 gagagcugcucugcaagcuTT 384 agcuugcagagcagcucucTT 6605 800 385 cgagagcugcucugcaagcuaga double 386 agagcugcucugcaagcuaTT 387 uagcuugcagagcagcucuTT 6606 801 388 gagagcugcucugcaagcuagac double 389 gagcugcucugcaagcuagTT 390 cuagcuugcagagcagcucTT 6607 802 391 agagcugcucugcaagcuagacg double 392 agcugcucugcaagcuagaTT 393 ucuagcuugcagagcagcuTT 6608 803 394 gagcugcucugcaagcuagacgu double 395 gcugcucugcaagcuagacTT 396 gucuagcuugcagagcagcTT 6609 804 397 agcugcucugcaagcuagacgug double 398 cuyoucugcaagcuagacgTT 399 cgucuagcuugcagagcagTT 6610 895 400 uugaagugcuguuuauuaaucuu double 401 gaagugcuguuuauuaaucTT 402 gauuaauaaacagcacuucTT 6611 896 403 ugaagugcuguuuauuaaucuua double 404 aagugcuguuuauuaaucuTT 405 agauuaauaaacagcacuuTT 6612 897 406 gaagugcuguuuauuaaucuuag double 407 agugcuguuuauuaaucuuTT 408 aagauuaauaaacagcacuTT 6613 898 409 aagugcuguuuauuaaucuuagu double 410 gugcuguuuauuaaucuuaTT 411 uaagauuaauaaacagcacTT 6614 899 412 agugcuguuuauuaaucuuagug double 413 ugcuguuuauuaaucuuagTT 414 cuaagauuaauaaacagcaTT 6615 900 415 gugcuguuuauuaaucuuagugu double 416 gcuguuuauuaaucuuaguTT 417 acuaagauuaauaaacagcTT 6616 901 418 ugcuguuuauuaaucuuagugua double 419 cuguuuauuaaucuuagugTT 420 cacuaagauuaauaaacagTT 6617 902 421 gcuguuuauuaaucuuaguguau double 422 uguuuauuaaucuuaguguTT 423 acacuaagauuaauaaacaTT 6618 903 424 cuguuuauuaaucuuaguguaug double 425 guuuauuaaucuuaguguaTT 426 uacacuaagauuaauaaacTT 6619 904 427 uguuuauuaaucuuaguguauga double 428 uuuauuaaucuuaguguauTT 429 auacacuaagauuaauaaaTT 6620 905 430 guuuauuaaucuuaguguaugau double 431 uuauuaaucuuaguguaugTT 432 cauacacuaagauuaauaaTT 6621 906 433 uuuauuaaucuuaguguaugauu double 434 uauuaaucuuaguguaugaTT 435 ucauacacuaagauuaauaTT 6622 907 436 uuauuaaucuuaguguaugauua double 437 auuaaucuuaguguaugauTT 438 aucauacacuaagauuaauTT 6623 908 439 uauuaaucuuaguguaugauuac double 440 uuaaucuuaguguaugauuTT 441 aaucauacacuaagauuaaTT 6624 909 442 auuaaucuuaguguaugauuacu double 443 uaaucuuaguguaugauuaTT 444 uaaucauacacuaagauuaTT 6625 910 445 uuaaucuuaguguaugauuacug double 446 aaucuuaguguaugauuacTT 447 guaaucauacacuaagauuTT 6626 911 448 uaaucuuaguguauyauuacugg double 449 aucuuaguguaugauuacuTT 450 aguaaucauacacuaagauTT 6627 912 451 aaucuuaguguaugauuacuggc double 452 ucuuaguguaugauuacugTT 453 caguaaucauacacuaagaTT 6628 913 454 aucuuaguguaugauuacuggcc double 455 cuuaguguaugauuacuggTT 456 ccaguaaucauacacuaagTT 6629 914 457 ucuuaguguaugauuacuggccu double 458 uuaguguaugauuacuggcTT 459 gccaguaaucauacacuaaTT 6630 915 460 cuuaguguaugauuacuggccuu double 461 uaguguaugauuacuggccTT 462 ggccaguaaucauacacuaTT 6631 916 463 uuaguguaugauuacuggccuuu double 464 aguguaugauuacuggccuTT 465 aggccaguaaucauacacuTT 6632 917 466 uaguguaugauuacuggccuuuu double 467 guguaugauuacuggccuuTT 468 aaggccaguaaucauacacTT 6633 918 469 aguguaugauuacugyccuuuuu double 470 uguaugauuacuggccuuuTT 471 aaaggccaguaaucauacaTT 6634 919 472 guguaugauuacuggccuuuuuc double 473 guaugauuacuggccuuuuTT 474 aaaaggccaguaaucauacTT 6635 939 475 uucauuuaucuauaauuuaccua double 476 cauuuaucuauaauuuaccTT 477 gguaaauuauagauaaaugTT 6636 940 478 ucauuuaucuauaauuuaccuaa double 479 auuuaucuauaauuuaccuTT 480 agguaaauuauagauaaauTT 6637 941 481 cauuuaucuauaauuuaccuaag double 482 uuuaucuauaauuuaccuaTT 483 uagguaaauuauagauaaaTT 6638 942 484 auuuaucuauaauuuaccuaaga double 485 uuaucuauaauuuaccuaaTT 486 uuagguaaauuauagauaaTT 6639 943 487 uuuaucuauaauuuaccuaagau double 488 uaucuauaauuuaccuaagTT 489 cuuagguaaauuauagauaTT 6640 944 490 uuaucuauaauuuaccuaagauu double 491 aucuauaauuuaccuaagaTT 492

ucuuagguaaauuauagauTT 6641 945 493 uaucuauaauuuaccuaagauua double 494 ucuauaauuuaccuaagauTT 495 aucuuagguaaauuauagaTT 6642 946 496 aucuauaauuuaccuaagauuac double 497 cuauaauuuaccuaagauuTT 498 aaucuuagguaaauuauagTT 6643 947 499 ucuauaauuuaccuaagauuaca double 500 uauaauuuaccuaagauuaTT 501 uaaucuuagguaaauuauaTT 6644 948 502 cuauaauuuaccuaagauuacaa double 503 auaauuuaccuaagauuacTT 504 guaaucuuagguaaauuauTT 6645 949 505 uauaauuuaccuaagauuacaaa double 506 uaauuuaccuaagauuacaTT 507 uguaaucuuagguaaauuaTT 6646 950 508 auaauuuaccuaagauuacaaau double 509 aauuuaccuaagauuacaaTT 510 uuguaaucuuagguaaauuTT 6647 951 511 uaauuuacauaagauuacaaauc double 512 auuuaccuaagauuacaaaTT 513 uuuguaaucuuagguaaauTT 6648 952 514 aauuuaccuaagauuacaaauca double 515 uuuaccuaagauuacaaauTT 516 auuuguaaucuuagguaaaTT 6649 953 517 auuuaccuaagauuacaaaucag double 518 uuaccuaagauuacaaaucTT 519 gauuuguaaucuuagguaaTT 6650 954 520 uuuaccuaagauuacaaaucaga double 521 uaccuaagauuacaaaucaTT 522 ugauuuguaaucuuagguaTT 6651 974 523 agaagucaucuugcuaccaguau double 524 aagucaucuugcuaccaguTT 525 acugguagcaagaugacuuTT 6652 975 526 gaagucaucuugcuaccaguauu double 527 agucaucuugcuaccaguaTT 528 uacugguagcaagaugacuTT 6653 976 529 aagucaucuugcuaccaguauuu double 530 gucaucuugcuaccaguauTT 531 auacugguagcaagaugacTT 6654 977 532 agucaucuugcuaccaguauuua double 533 ucaucuugcuaccaguauuTT 534 aauacugguagcaagaugaTT 6655 978 535 gucaucuugcuaccaguauuuag double 536 caucuugcuaccaguauuuTT 537 aaauacugguagcaagaugTT 6656 979 538 ucaucuugcuaccaguauuuaga double 539 aucuugcuaccaguauuuaTT 540 uaaauacugguagcaagauTT 6657 980 541 caucuugcuaccaguauuuagaa double 542 ucuugcuaccaguauuuagTT 543 cuaaauacugguagcaagaTT 6658 981 544 aucuugcuaccaguauuuagaag double 545 cuugcuaccaguauuuagaTT 546 ucuaaauacugguagcaagTT 6659 982 547 ucuugcuaccaguauuuagaagc double 548 uugcuaccaguauuuagaaTT 549 uucuaaauacugguagcaaTT 6660 983 550 cuugcuaccaguauuuagaagcc double 551 ugcuaccaguauuuagaagTT 552 cuucuaaauacugguagcaTT 6661 984 553 uugcuaccaguauuuagaagcca double 554 gcuaccaguauuuagaagcTT 555 gcuucuaaauacugguagcTT 6662 985 556 ugcuaccaguauuuagaagccaa double 557 cuaccaguauuuagaagccTT 558 ggcuucuaaauacugguagTT 6663 986 559 gcuaccaguauuuagaagccaac double 560 uaccaguauuuagaagccaTT 561 uggcuucuaaauacugguaTT 6664 987 562 cuaccaguauuuagaagccaacu double 563 accaguauuuagaagccaaTT 564 uuggcuucuaaauacugguTT 6665 988 565 uaccaguauuuagaagccaacua double 566 ccaguauuuagaagccaacTT 567 guuggcuucuaaauacuggTT 6666 1131 568 cuugcuucuuucuagaaagagaa double 569 ugcuucuuucuagaaagagTT 570 cucuuucuagaaagaagcaTT 6667 1132 571 uugcuucuuucuagaaagagaaa double 572 gcuucuuucuagaaagagaTT 573 ucucuuucuagaaagaagcTT 6668 1133 574 ugcuucuuucuagaaagagaaac double 575 cuucuuucuagaaagagaaTT 576 uucucuuucuagaaagaagTT 6669 1134 577 gcuucuuucuagaaagagaaaca double 578 uucuuucuagaaagagaaaTT 579 uuucucuuucuagaaagaaTT 6670 1135 580 cuucuuucuagaaagagaaacag double 581 ucuuucuagaaagagaaacTT 582 guuucucuuucuagaaagaTT 6671 1136 583 uucuuucuagaaagagaaacagu double 584 cuuucuagaaagagaaacaTT 585 uguuucucuuucuagaaagTT 6672 1137 586 ucuuucuagaaagagaaacaguu double 587 uuucuagaaagagaaacagTT 588 cuguuucucuuucuagaaaTT 6673 1138 589 cuuucuagaaagagaaacaguug double 590 uucuagaaagagaaacaguTT 591 acuguuucucuuucuagaaTT 6674 1139 592 uuucuagaaagagaaacaguugg double 593 ucuagaaagagaaacaguuTT 594 aacuguuucucuuucuagaTT 6675 1140 595 uucuagaaagagaaacaguuggu double 596 cuagaaagagaaacaguugTT 597 caacuguuucucuuucuagTT 6676 1141 598 ucuagaaagagaaacaguuggua double 599 uagaaagagaaacaguuggTT 600 ccaacuguuucucuuucuaTT 6677 1142 601 cuagaaagagaaacaguugguaa double 602 agaaagagaaacaguugguTT 603 accaacuguuucucuuucuTT 6678 1143 604 uagaaagagaaacaguugguaac double 605 gaaagagaaacaguugguaTT 606 uaccaacuguuucucuuucTT 6679 1144 607 agaaagagaaacaguugguaacu double 608 aaagagaaacaguugguaaTT 609 uuaccaacuguuucucuuuTT 6680 1145 610 gaaagagaaacaguugguaacuu double 611 aagagaaacaguugguaacTT 612 guuaccaacuguuucucuuTT 6681 1146 613 aaagagaaacaguugguaacuuu double 614 agagaaacaguugguaacuTT 615 aguuaccaacuguuucucuTT 6682 1147 616 aagagaaacaguugguaacuuuu double 617 gagaaacaguugguaacuuTT 618 aaguuaccaacuguuucucTT 6683 1148 619 agagaaacaguugguaacuuuug double 620 agaaacaguugguaacuuuTT 621 aaaguuaccaacuguuucuTT 6684 1149 622 gagaaacaguugguaacuuuugu double 623 gaaacaguugguaacuuuuTT 624 aaaaguuaccaacuguuucTT 6685 1150 625 agaaacaguugguaacuuuugug double 626 aaacaguugguaacuuuugTT 627 caaaaguuaccaacuguuuTT 6686 1151 628 gaaacaguugguaacuuuuguga double 629 aacaguugguaacuuuuguTT 630 acaaaaguuaccaacuguuTT 6687 1152 631 aaacaguugguaacuuuugugaa double 632 acaguugguaacuuuugugTT 633 cacaaaaguuaccaacuguTT 6688 1153 634 aacaguugguaacuuuugugaau double 635 caguugguaacuuuugugaTT 636 ucacaaaaguuaccaacugTT 6689 1154 637 acaguugguaacuuuugugaauu double 638 aguugguaacuuuugugaaTT 639 uucacaaaaguuaccaacuTT 6690 1155 640 caguugguaacuuuugugaauua double 641 guugguaacuuuugugaauTT 642 auucacaaaaguuaccaacTT 6691 1156 643 aguugguaacuuuugugaauuag double 644 uugguaacuuuugugaauuTT 645 aauucacaaaaguuaccaaTT 6692 1157 646 guugguaacuuuugugaauuagg double 647 ugguaacuuuugugaauuaTT 648 uaauucacaaaaguuaccaTT 6693 1158 649 uugguaacuuuugugaauuaggc double 650 gguaacuuuugugaauuagTT 651 cuaauucacaaaaguuaccTT 6694 1159 652 ugguaacuuuugugaauuaggcu double 653 guaacuuuugugaauuaggTT 654 ccuaauucacaaaaguuacTT 6695 1160 655 gguaacuuuugugaauuaggcug double 656 uaacuuuugugaauuaggcTT 657 gccuaauucacaaaaguuaTT 6696 1161 658 guaacuuuugugaauuaggcugu double 659 aacuuuugugaauuaggcuTT 660 agccuaauucacaaaaguuTT 6697 1162 661 uaacuuuugugaauuaggcugua double 662 acuuuugugaauuaggcugTT 663 cagccuaauucacaaaaguTT 6698 1163 664 aacuuuugugaauuaggcuguaa double 665 cuuuugugaauuaggcuguTT 666 acagccuaauucacaaaagTT 6699 1164 667 acuuuugugaauuaggcuguaac double 668 uuuugugaauuaggcuguaTT 669 uacagccuaauucacaaaaTT 6700 1165 670 cuuuugugaauuaggcuguaacu double 671 uuugugaauuaggcuguaaTT 672 uuacagccuaauucacaaaTT 6701 1166 673 uuuugugaauuaggcuguaacua double 674 uugugaauuaggcuguaacTT 675 guuacagccuaauucacaaTT 6702 1167 676 uuugugaauuaggcuguaacuac double 677 ugugaauuaggcuguaacuTT 678 aguuacagccuaauucacaTT 6703 1168 679 uugugaauuaggcuguaacuacu double 680 gugaauuaggcuguaacuaTT 681 uaguuacagccuaauucacTT 6704 1169 682 ugugaauuaggcuguaacuacuu double 683 ugaauuaggcuguaacuacTT 684 guaguuacagccuaauucaTT 6705 1170 685 gugaauuaggcuguaacuacuuu double 686 gaauuaggcuguaacuacuTT 687 aguaguuacagccuaauucTT 6706 1171 688 ugaauuaggcuguaacuacuuua double 689 aauuaggcuguaacuacuuTT 690 aaguaguuacagccuaauuTT 6707 1172 691 gaauuaggcuguaacuacuuuau double 692 auuaggcuguaacuacuuuTT 693 aaaguaguuacagccuaauTT 6708 1173 694 aauuaggcuguaacuacuuuaua double 695 uuaggcuguaacuacuuuaTT 696 uaaaguaguuacagccuaaTT 6709 1174 697 auuaggcuguaacuacuuuauaa double 698 uaggcuguaacuacuuuauTT 699 auaaaguaguuacagccuaTT 6710 1175 700 uuaggcuguaacuacuuuauaac double 701 aggcuguaacuacuuuauaTT 702 uauaaaguaguuacagccuTT 6711 1176 703 uaggcuguaacuacuuuauaacu double 704 ggcuguaacuacuuuauaaTT 705 uuauaaaguaguuacagccTT 6712 1177 706 aggcuguaacuacuuuauaacua double 707 gcuguaacuacuuuauaacTT 708 guuauaaaguaguuacagcTT 6713 1178 709 ggcuguaacuacuuuauaacuaa double 710 cuguaacuacuuuauaacuTT 711 aguuauaaaguaguuacagTT 6714 1179 712 gcuguaacuacuuuauaacuaac double 713 uguaacuacuuuauaacuaTT 714 uaguuauaaaguaguuacaTT 6715 1180 715 cuguaacuacuuuauaacuaaca double 716 guaacuacuuuauaacuaaTT 717 uuaguuauaaaguaguuacTT 6716 1181 718 uguaacuacuuuauaacuaacau double 719 uaacuacuuuauaacuaacTT 720 guuaguuauaaaguaguuaTT 6717 1182 721 guaacuacuuuauaacuaacaug double 722 aacuacuuuauaacuaacaTT 723 uguuaguuauaaaguaguuIT 6718 1183 724 uaacuacuuuauaacuaacaugu double 725 acuacuuuauaacuaacauTT 726 auguuaguuauaaaguaguTT 6719 1184 727 aacuacuuuauaacuaacauguc double 728 cuacuuuauaacuaacaugTT 729 cauguuaguuauaaaguagTT 6720 1185 730 acuacuuuauaacuaacaugucc double 731 uacuuuauaacuaacauguTT 732 acauguuaguuauaaaguaTT 6721 1186 733 cuacuuuauaacuaacauguccu double 734 acuuuauaacuaacaugucTT 735 gacauguuaguuauaaaguTT 6722 1187 736 uacuuuauaacuaacauguccug double 737 cuuuauaacuaacauguccTT 738 ggacauguuaguuauaaagTT 6723 1188 739 acuuuauaacuaacauguccugc double 740 uuuauaacuaacauguccuTT 741 aggacauguuaguuauaaaTT

6724 1189 742 cuuuauaacuaacauguccugcc double 743 uuauaacuaacauguccugTT 744 caggacauguuaguuauaaTT 6725 1190 745 uuuauaacuaacauguccugccu double 746 uauaacuaacauguccugcTT 747 gcaggacauguuaguuauaTT 6726 1191 748 uuauaacuaacauguccugccua double 749 auaacuaacauguccugccTT 750 ggcaggacauguuaguuauTT 6727 1192 751 uauaacuaacauguccugccuau double 752 uaacuaacauguccugccuTT 753 aggcaggacauguuaguuaTT 6728 1193 754 auaacuaacauguccugccuauu double 755 aacuaacauguccugccuaTT 756 uaggcaggacauguuaguuTT 6729 1352 757 uggcagaguuacaguucuguggu double 758 gcagaguuacaguucugugTT 759 cacagaacuguaacucugcTT 6730 1353 760 ggcagaguuacaguucugugguu double 761 cagaguuacaguucuguggTT 762 ccacagaacuguaacucugTT 6731 1354 763 gcagaguuacaguucugugguuu double 764 agaguuacaguucugugguTT 765 accacagaacuguaacucuTT 6732 1374 766 uuucauguuaguuaccuuauagu double 767 ucauguuaguuaccuuauaTT 768 uauaagguaacuaacaugaTT 6733 1375 769 uucauguuaguuaccuuauaguu double 770 cauguuaguuaccuuauagTT 771 cuauaagguaacuaacaugTT 6734 1376 772 ucauguuaguuaccuuauaguua double 773 auguuaguuaccuuauaguTT 774 acuauaagguaacuaacauTT 6735 1377 775 cauguuaguuaccuuauaguuac double 776 uguuaguuaccuuauaguuTT 777 aacuauaagguaacuaacaTT 6736 1378 778 auguuaguuaccuuauaguuacu double 779 guuaguuaccuuauaguuaTT 780 uaacuauaagguaacuaacTT 6737 1379 781 uguuaguuaccuuauaguuacug double 782 uuaguuaccuuauaguuacTT 783 guaacuauaagguaacuaaTT 6738 1380 784 guuaguuaccuuauaguuacugu double 785 uaguuaccuuauaguuacuTT 786 aguaacuauaagguaacuaTT 6739 1381 787 uuaguuaccuuauaguuacugug double 788 aguuaccuuauaguuacugTT 789 caguaacuauaagguaacuTT 6740 1382 790 uaguuaccuuauaguuacugugu double 791 guuaccuuauaguuacuguTT 792 acaguaacuauaagguaacTT 6741 1383 793 aguuaccuuauaguuacugugua double 794 uuaccuuauaguuacugugTT 795 cacaguaacuauaagguaaTT 6742 1384 796 guuaccuuauaguuacuguguaa double 797 uaccuuauaguuacuguguTT 798 acacaguaacuauaagguaTT 6743 1385 799 uuaccuuauaguuacuguguaau double 800 accuuauaguuacuguguaTT 801 uacacaguaacuauaagguTT 6744 1386 802 uaccuuauaguuacuguguaauu double 803 ccuuauaguuacuguguaaTT 804 uuacacaguaacuauaaggTT 6745 1387 805 accuuauaguuacuguguaauua double 806 cuuauaguuacuguguaauTT 807 auuacacaguaacuauaagTT 6746 1388 808 ccuuauaguuacuguguaauuag double 809 uuauaguuacuguguaauuTT 810 aauuacacaguaacuauaaTT 6747 1389 811 cuuauaguuacuguguaauuagu double 812 uauaguuacuguguaauuaTT 813 uaauuacacaguaacuauaTT 6748 1390 814 uuauaguuacuguguaauuagug double 815 auaguuacuguguaauuagTT 816 cuaauuacacaguaacuauTT 6749 1391 817 uauaguuacuguguaauuagugc double 818 uaguuacuguguaauuaguTT 819 acuaauuacacaguaacuaTT 6750 1392 820 auaguuacuguguaauuagugcc double 821 aguuacuguguaauuagugTT 822 cacuaauuacacaguaacuTT 6751 1393 823 uaguuacuguguaauuagugcca double 824 guuacuguguaauuagugcTT 825 gcacuaauuacacaguaacTT 6752 1394 826 aguuacuguguaauuagugccac double 827 uuacuguguaauuagugccTT 828 ggcacuaauuacacaguaaTT 6753 1395 829 guuacuguguaauuagugccacu double 830 uacuguguaauuagugccaTT 831 uggcacuaauuacacaguaTT 6754 1396 832 uuacuguguaauuagugccacuu double 833 acuguguaauuagugccacTT 834 guggcacuaauuacacaguTT 6755 1397 835 uacuguguaauuagugccacuua double 836 cuguguaauuagugccacuTT 837 aguggcacuaauuacacagTT 6756 1398 838 acuguguaauuagugccacuuaa double 839 uguguaauuagugccacuuTT 840 aaguggcacuaauuacacaTT 6757 1399 841 cuguguaauuagugccacuuaau double 842 guguaauuagugccacuuaTT 843 uaaguggcacuaauuacacTT 6758 1400 844 uguguaauuagugccacuuaaug double 845 uguaauuagugccacuuaaTT 846 uuaaguggcacuaauuacaTT 6759 1401 847 guguaauuagugccacuuaaugu double 848 guaauuagugccacuuaauTT 849 auuaaguggcacuaauuacTT 6760 1402 850 uguaauuagugccacuuaaugua double 851 uaauuagugccacuuaaugTT 852 cauuaaguggcacuaauuaTT 6761 1403 853 guaauuagugccacuuaauguau double 854 aauuagugccacuuaauguTT 855 acauuaaguggcacuaauuTT 6762 1404 856 uaauuagugccacuuaauguaug double 857 auuagugccacuuaauguaTT 858 uacauuaaguggcacuaauTT 6763 1405 859 aauuagugccacuuaauguaugu double 860 uuagugccacuuaauguauTT 861 auacauuaaguggcacuaaTT 6764 1406 862 auuagugccacuuaauguauguu double 863 uagugccacuuaauguaugTT 864 cauacauuaaguggcacuaTT 6765 1407 865 uuagugccacuuaauguauguua double 866 agugccacuuaauguauguTT 867 acauacauuaaguggcacuTT 6766 1408 868 uagugccacuuaauguauguuac double 869 gugccacuuaauguauguuTT 870 aacauacauuaaguggcacTT 6767 1409 871 agugccacuuaauguauguuacc double 872 ugccacuuaauguauguuaTT 873 uaacauacauuaaguggcaTT 6768 1410 874 gugccacuuaauguauguuacca double 875 gccacuuaauguauguuacTT 876 guaacauacauuaaguggcTT 6769 1411 877 ugccacuuaauguauguuaccaa double 878 ccacuuaauguauguuaccTT 879 gguaacauacauuaaguggTT 6770 1412 880 gccacuuaauguauguuaccaaa double 881 cacuuaauguauguuaccaTT 882 ugguaacauacauuaagugTT 6771 1413 883 ccacuuaauguauguuaccaaaa double 884 acuuaauguauguuaccaaTT 885 uugguaacauacauuaaguTT 6772 1414 886 cacuuaauguauguuaccaaaaa double 887 cuuaauguauguuaccaaaTT 888 uuugguaacauacauuaagTT 6773 1415 889 acuuaauguauguuaccaaaaau double 890 uuaauguauguuaccaaaaTT 891 uuuugguaacauacauuaaTT 6774 1416 892 cuuaauguauguuaccaaaaaua double 893 uaauguauguuaccaaaaaTT 894 uuuuugguaacauacauuaTT 6775 1435 895 aauaaauauaucuaccccagacu double 896 uaaauauaucuaccccagaTT 897 ucugggguagauauauuuaTT 6776 1436 898 auaaauauaucuaccccagacua double 899 aaauauaucuaccccagacTT 900 gucugggguagauauauuuTT 6777 1437 901 uaaauauaucuaccccagacuag double 902 aauauaucuaccccagacuTT 903 agucugggguagauauauuTT 6778 1438 904 aaauauaucuaccccagacuaga double 905 auauaucuaccccagacuaTT 906 uagucugggguagauauauTT 6779 1439 907 aauauaucuaccccagacuagau double 908 uauaucuaccccagacuagTT 909 cuagucugggguagauauaTT 6780 1440 910 auauaucuaccccagacuagaug double 911 auaucuaccccagacuagaTT 912 ucuagucugggguagauauTT 6781 1441 913 uauaucuaccccagacuagaugu double 914 uaucuaccccagacuagauTT 915 aucuagucugggguagauaTT 6782 1442 916 auaucuaccccagacuagaugua double 917 aucuaccccagacuagaugTT 918 caucuagucugggguagauTT 6783 1443 919 uaucuaccccagacuagauguag double 920 ucuaccccagacuagauguTT 921 acaucuagucugggguagaTT 6784 1444 922 aucuaccccagacuagauguagu double 923 cuaccccagacuagauguaTT 924 uacaucuagucugggguagTT 6785 1445 925 ucuaccccagacuagauguagua double 926 uaccccagacuagauguagTT 927 cuacaucuagucugggguaTT 6786 1446 928 cuaccccagacuagauguaguau double 929 accccagacuagauguaguTT 930 acuacaucuagucugggguTT 6787 1447 931 uaccccagacuagauguaguauu double 932 ccccagacuagauguaguaTT 933 uacuacaucuagucuggggTT 6788 1448 934 accccagacuagauguaguauuu double 935 cccagacuagauguaguauTT 936 auacuacaucuagucugggTT 6789 1449 937 ccccagacuagauguaguauuuu double 938 ccagacuagauguaguauuTT 939 aauacuacaucuagucuggTT 6790 1450 940 cccagacuagauguaguauuuuu double 941 cagacuagauguaguauuuTT 942 aaauacuacaucuagucugTT 6791 1451 943 ccagacuagauguaguauuuuuu double 944 agacuagauguaguauuuuTT 945 aaaauacuacaucuagucuTT 6792 1452 946 cagacuagauguaguauuuuuug double 947 gacuagauguaguauuuuuTT 948 aaaaauacuacaucuagucTT 6793 1453 949 agacuagauguaguauuuuuugu double 950 acuagauguaguauuuuuuTT 951 aaaaaauacuacaucuaguTT 6794 1454 952 gacuagauguaguauuuuuugua double 953 cuagauguaguauuuuuugTT 954 caaaaaauacuacaucuagTT 6795 1455 955 acuagauguaguauuuuuuguau double 956 uagauguaguauuuuuuguTT 957 acaaaaaauacuacaucuaTT 6796 1456 958 cuagauguaguauuuuuuguaua double 959 agauguaguauuuuuuguaTT 960 uacaaaaaauacuacaucuTT 6797 1457 961 uagauguaguauuuuuuguauaa double 962 gauguaguauuuuuuguauTT 963 auacaaaaaauacuacaucTT 6798 1458 964 agauguaguauuuuuuguauaau double 965 auguaguauuuuuuguauaTT 966 uauacaaaaaauacuacauTT 6799 1459 967 gauguagauuuuuuuguauaauu double 968 uguaguauuuuuuguauaaTT 969 uuauacaaaaaauacuacaTT 6800 1460 970 auguaguauuuuuuguauaauug double 971 guaguauuuuuuguauaauTT 972 auuauacaaaaaauacuacTT 6801 1461 973 uguaguauuuuuuguauaauugg double 974 uaguauuuuuuguauaauuTT 975 aauuauacaaaaaauacuaTT 6802 1462 976 guaguauuuuuuguauaauugga double 977 aguauuuuuuguauaauugTT 978 caauuauacaaaaaauacuTT 6803 1463 979 uaguauuuuuuguauaauuggau double 980 guauuuuuuguauaauuggTT 981 ccaauuauacaaaaaauacTT 6804 1464 982 aguauuuuuuguauaauuggauu double 983 uauuuuuuguauaauuggaTT 984 uccaauuauacaaaaaauaTT 6805 1465 985 guauuuuuuguauaauuggauuu double 986 auuuuuuguauaauuggauTT 987 auccaauuauacaaaaaauTT 6806 1466 988 uauuuuuuguauaauuggauuuc double 989 uuuuuuguauaauuggauuTT 990 aauccaauuauacaaaaaaTl 6807 1467 991 auuuuuuguauaauuggauuucc double 992 uuuuuguauaauuggauuuTT 993 aaauccaauuauacaaaaaTT

6808 1468 994 uuuuuuguauaauuggauuuccu double 995 uuuuguauaauuggauuucTT 996 gaaauccaauuauacaaaaTT 6809 1469 997 uuuuuguauaauuggauuuccua double 998 uuuguauaauuggauuuccTT 999 ggaaauccaauuauacaaaTT 6810 1470 1000 uuuuguauaauuggauuuccuaa double 1001 uuguauaauuggauuuccuTT 1602 aggaaauccaauuauacaaTT 6811 1471 1003 uuuguauaauuggauuuccuaau double 1004 uguauaauuggauuuccuaTT 1005 uaggaaauccaauuauacaTT 6812 1472 1006 uuguauaauuggauuuccuaaua double 1007 guauaauuggauuuccuaaTT 1008 uuaggaaauccaauuauacTT 6813 1473 1009 uguauaauuggauuuccuaauac double 1010 uauaauuggauuuccuaauTT 1011 auuaggaaauccaauuauaTT 6814 1540 1012 guauuuggaaauaaagucagaug double 1013 auuuggaaauaaagucagaTT 1014 ucugacuuuauuuccaaauTT 6815 1541 lOIS uauuuggaaauaaagucagaugg double 1016 uuuggaaauaaagucagauTT 1017 aucugacuuuauuuccaaaTT 6816 1542 1018 auuuggaaauaaagucagaugga double 1019 uuggaaauaaagucagaugTT 1020 aaucugacuuuauuuccaaTT 6817 1543 1021 uuuggaaauaaagucagauggaa double 1022 uggaaauaaagucagauggTT 1023 ccaucugacuuuauuuccaTT 6818 1544 1024 uuggaaauaaagucagauggaaa double 1025 ggaaauaaagucagauggaTT 1026 uccaucugacuuuauuuccTT 6819 1545 1027 uggaaauaaagucagauggaaaa double 1028 gaaauaaagucagauggaaTT 1029 uuccaucugacuuuauuucTT 6820 1796 1030 ucccucccagaggagccaccagu double 1031 ccucccagaggagccaccaTT 1032 ugguggcuccucugggaggTT 6821 1797 1033 cccucccagaggagccaccaguu double 1034 cucccagaggagccaccagTT 1035 cugguggcuccucugggagTT 6822 1798 1036 ccucccagaggagccaccaguuc double 1037 ucccagaggagccaccaguTT 1038 acugguggcuccucugggaTT 6823 1799 1039 cucccagaggagccaccaguucu double 1040 cccagaggagccaccaguuTT 1041 aacugguggcuccucugggTT 6824 1800 1042 ucccagaggagccaccaguucuc double 1043 ccagaggagccaccaguucTT 1044 gaacugguggcuccucuggTT 6825 1801 1045 cccagaggagccaccaguucuca double 1046 cagaggagccaccaguucuTT 1047 agaacugguggcuccucugTT 6826 1843 1048 cuucucuccagcugacuaaacuu double 1049 ucucuccagcugacuaaacTT 1050 guuuagucagcuggagagaTT 6827 1869 1051 uucuguaccaguuaauuuuucca double 1052 cuguaccaguuaauuuuucTT 1053 gaaaaauuaacugguacagTT 6828 1870 1054 ucuguaccaguuaauuuuuccaa double 1055 uguaccaguuaauuuuuccTT 1056 ggaaaaauuaacugguacaTT 6829 1871 1057 cuguaccaguuaauuuuuccaac double 1058 guaccaguuaauuuuuccaTT 1059 uggaaaaauuaacugguacTT 6830 1872 1060 uguaacaguuaauuuuuccaacu double 1061 uaccaguuaauuuuuccaaTT 1062 uuggaaaaauuaacugguaTT 6831 1873 1063 guaccaguuaauuuuuccaacua double 1064 accaguuaauuuuuccaacTT 1065 guuggaaaaauuaacugguTT 6832 1874 1066 uaccaguuaauuuuuccaacuac double 1067 ccaguuaauuuuuccaacuTT 1068 aguuggaaaaauuaacuggTT 6833 1875 1069 accaguuaauuuuuccaacuacu double 1070 caguuaauuuuuccaacuaTT 1071 uaguuggaaaaauuaacugTT 6834 1897 1072 uaauagaauaaaggcaguuuucu double 1073 auagaauaaaggcaguuuuTT 1074 aaaacugccuuuauucuauTT 6835 1898 1075 aauagaauaaaggcaguuuucua double 1076 uagaauaaaggcaguuuucTT 1077 gaaaacugccuuuauucuaTT 6836 1899 1078 auagaauaaaggcaguuuucuaa double 1079 agaauaaaggcaguuuucuTT 1080 agaaaacugccuuuauucuTT .sup.aSingle: Single overhang design 21 mer sense, corresponding 23 mer antisense with 2 nucleotides overhang at 3' end; Double: double overhang design corresponding 19 mer sense and antisense strand each with 2 dT nucleotide overhang at 3' end .sup.b"Start position" corresponds to the position within the sequence of human RhoA (Genbank accession no. NM_001664) mRNA to which the 5'-most nucleotide of the sense strand corresponds for single overhang designs; for double overhang designs, the 5'-most ribonucleotide of the sense strand corresponds to (Start position + 2)

[0059] Based on these results, the invention specifically provides an iRNA agent that includes a sense strand having at least 15 contiguous nucleotides of the sense strand sequences of the agents provided in Table 1 under agent numbers 6477-6836, and an antisense strand having at least 15 contiguous nucleotides of the antisense sequences of the agents provided in Table 1 under agent numbers 6477 to 6836.

[0060] The iRNA agents shown in Table 1 are composed of two strands of 19 nucleotides in length which are complementary or identical to the target sequence, plus a 3'-TT overhang. The present invention provides agents that comprise 15 contiguous nucleotides from these agents. However, while these lengths may potentially be optimal, the iRNA agents are not meant to be limited to these lengths. The skilled person is well aware that shorter or longer iRNA agents may be similarly effective, since, within certain length ranges, the efficacy is rather a finction of the nucleotide sequence than strand length. For example, Yang, et al., PNAS 99:9942-9947 (2002), demonstrated similar efficacies for iRNA agents of lengths between 21 and 30 base pairs. Others have shown effective silencing of genes by iRNA agents down to a length of approx. 15 base pairs (Byrom, et al., "Inducing RNAi with siRNA Cocktails Generated by RNase III" Tech Notes 10(1), Ambion, Inc., Austin, Tex.).

[0061] Therefore, it is possible and contemplated by the instant invention to select from the sequences provided in Table 1 under agent numbers 6477 to 6836 a partial sequence of between 15 to 22 nucleotides for the generation of an iRNA agent derived from one of the sequences provided in Table 1 under agent numbers 6477 to 6836. Alternatively, one may add one or several nucleotides to one of the sequences provided in Table 1 under agent numbers 6477 to 6836, or an agent comprising 15 contiguous nucleotides from one of these agents, preferably, but not necessarily, in such a fashion that the added nucleotides are complementary to the respective sequence of the target gene, e.g., RhoA. For example, the first 15 nucleotides from one of the agents can be combined with the 8 nucleotides found 5' to these sequence in the RhoA mRNA to obtain an agent with 23 nucleotides in the sense and antisense strands. All such derived iRNA agents are included in the iRNA agents of the present invention, provided they essentially retain the ability to inhibit RhoA expression in cultured human RhoA expressing cells.

[0062] The antisense strand of an iRNA agent should be equal to or at least, 14, 15, 16 17, 18, 19, 25, 29, 40, or 50 nucleotides in length. It should be equal to or less than 60, 50, 40, or 30, nucleotides in length. Preferred ranges are 15-30, 17 to 25, 19 to 23, and 19 to 21 nucleotides in length.

[0063] The sense strand of an iRNA agent should be equal to or at least 14, 15, 16 17, 18, 19, 25, 29, 40, or 50 nucleotides in length. It should be equal to or less than 60, 50, 40, or 30 nucleotides in length. Preferred ranges are 15-30, 17 to 25, 19 to 23, and 19 to 21 nucleotides in length.

[0064] The double stranded portion of an iRNA agent should be equal to or at least, 15, 16 17, 18, 19, 20, 21, 22, 23, 24, 25, 29, 40, or 50 nucleotide pairs in length. It should be equal to or less than 60, 50, 40, or 30 nucleotides pairs in length. Preferred ranges are 15-30, 17 to 25, 19 to 23, and 19 to 21 nucleotides pairs in length.

[0065] Generally, the iRNA agents of the instant invention include a region of sufficient complementarity to the respective RhoA gene, and are of sufficient length in terms of nucleotides, that the iRNA agent, or a fragment thereof, can mediate down regulation of the RhoA gene. The ribonucleotide portions of the antisense strands of the iRNA agents of Table 1 under agent numbers 6477 to 6836 are fully complementary to the mRNA sequences of the RhoA gene, respectively, and ribonucleotide portion of their sense strands are fully complementary to the ribonucleotide portions of the respective antisense strands, except for the two 3'-terminal nucleotides on the antisense strand in single overhang design iRNA agents. However, it is not necessary that there be perfect complementarity between the iRNA agent and the target, but the correspondence must be sufficient to enable the iRNA agent, or a cleavage product thereof, to direct sequence specific silencing, e.g., by RNAi cleavage of a RhoA mRNA.

[0066] Therefore, the iRNA agents of the instant invention include agents comprising a sense strand and antisense strand each comprising a sequence of at least 16, 17 or 18 nucleotides which is essentially identical, as defined below, to one of the sequences of Table 1 under agent numbers 6477 to 6836, except that not more than 1, 2 or 3 nucleotides per strand, respectively, have been substituted by other nucleotides (e.g. adenosine replaced by uracil), while essentially retaining the ability to inhibit RhoA expression in cultured human RhoA expressing cells, respectively. These agents will therefore possess at least 15 nucleotides identical to one of the sequences of Table 1 under agent numbers 6477 to 6836, but 1, 2 or 3 base mismatches with respect to either the target RhoA mRNA sequence or between the sense and antisense strand are introduced. Mismatches to the target RhoA mRNA sequence, particularly in the antisense strand, are most tolerated in the terminal regions and if present are preferably in a terminal region or regions, e.g., within 6, 5, 4, or 3 nucleotides of a 5' and/or 3' terminus, most preferably within 6, 5, 4, or 3 nucleotides of the 5'-terminus of the sense strand or the 3'-terminus of the antisense strand. The sense strand need only be sufficiently complementary with the antisense strand to maintain the overall double stranded character of the molecule.

[0067] It is preferred that the sense and antisense strands be chosen such that the iRNA agent includes a single strand or unpaired region at one or both ends of the molecule. Thus, an iRNA agent contains sense and antisense strands, preferably paired to contain an overhang, e.g., one or two 5' or 3' overhangs but preferably a 3' overhang of 2-3 nucleotides. Most embodiments will have a 3' overhang. Preferred siRNA agents will have single-stranded overhangs, preferably 3' overhangs, of 1 to 4, or preferably 2 or 3 nucleotides, in length, at one or both ends of the iRNA agent. The overhangs can be the result of one strand being longer than the other, or the result of two strands of the same length being staggered. The unpaired nucleotides forming the overhang can be ribonucleotides, or they can be deoxyribonucleotides, preferably thymidine. 5'-ends are preferably phosphorylated.

[0068] Preferred lengths for the duplexed region are between 15 and 30, most preferably 18, 19, 20, 21, 22, and 23 nucleotides in length, e.g., in the siRNA agent range discussed above. siRNA agents can resemble in length and structure the natural Dicer processed products from long dsRNAs. Embodiments in which the two strands of the siRNA agent are linked, e.g., covalently linked, are also included. Hairpin, or other single strand structures which provide the required double stranded region, and preferably a 3' overhang are also within the invention.

[0069] Evaluation of Candidate iRNA Agents

[0070] A candidate iRNA agent can be evaluated for its ability to downregulate target gene expression. For example, a candidate iRNA agent can be provided, and contacted with a cell, that expresses the target gene, e.g., the RhoA gene, either endogenously or because it has been transfected with a construct from which a RhoA protein can be expressed. The level of target gene expression prior to and following contact with the candidate iRNA agent can be compared, e.g., on an MRNA or protein level. If it is determined that the amount of RNA or protein expressed from the target gene is lower following contact with the iRNA agent, then it can be concluded that the iRNA agent downregulates target gene expression. The level of target RhoA RNA or RhoA protein in the cell can be determined by any method desired. For example, the level of target RNA can be determined by Northern blot analysis, reverse transcription coupled with polymerase chain reaction (RT-PCR), or RNAse protection assay. The level of protein can be determined, for example, by Western blot analysis or immuno-fluorescence. Preferably, the assay also tests the ability of the iRNA agent to inhibit RhoA expression on a functional level, e.g. by assessing the ability of the iRNA agent to facilitate neuronal growth, e.g. the restoration of neurite outgrowth on an otherwise inhibitory substrate, e.g a substrate comprising myelin.

Stability Testing, Modification, and Retesting of iRNA Agents

[0071] A candidate iRNA agent can be evaluated with respect to stability, e.g., its susceptibility to cleavage by an endonuclease or exonuclease, such as when the iRNA agent is introduced into the body of a subject. Methods can be employed to identify sites that are susceptible to modification, particularly cleavage, e.g., cleavage by a component found in the body of a subject.

[0072] When sites susceptible to cleavage are identified, a further iRNA agent can be designed and/or synthesized wherein the potential cleavage site is made resistant to cleavage, e.g. by introduction of a 2'-modification on the site of cleavage, e.g. a 2'-O-methyl group. This further iRNA agent can be retested for stability, and this process may be iterated until an iRNA agent is found exhibiting the desired stability.

In Vivo Testing

[0073] An iRNA agent identified as being capable of inhibiting RhoA gene expression can be tested for functionality in vivo in an animal model (e.g., in a mammal, such as in mouse or rat). For example, the iRNA agent can be administered to an animal, and the iRNA agent evaluated with respect to its biodistribution, stability, and its ability to inhibit RhoA gene expression or reduce a biological or pathological process mediated at least in part by RhoA.

[0074] The iRNA agent can be administered directly to the target tissue, e.g. the spinal cord, and, in the case of a spinal cord injury model, to the site of spinal cord injury, such as by injection. Preferably, the iRNA agent is administered to the animal model in the same manner that it would be administered to a human.

[0075] The iRNA agent can also be evaluated for its intracellular distribution. The evaluation can include determining whether the iRNA agent was taken up into the cell. The evaluation can also include determining the stability (e.g., the half-life) of the iRNA agent. Evaluation of an iRNA agent in vivo can be facilitated by use of an iRNA agent conjugated to a traceable marker (e.g., a fluorescent marker such as fluorescein; a radioactive label, such as .sup.35S, .sup.32P, .sup.33P, or .sup.3H; gold particles; or antigen particles for immunohistochemistry).

[0076] The iRNA agent can be evaluated with respect to its ability to down regulate RhoA gene expression. Levels of RhoA gene expression in vivo can be measured, for example, by in situ hybridization, or by the isolation of RNA from tissue prior to and following exposure to the iRNA agent. Where the animal needs to be sacrificed in order to harvest the tissue, an untreated control animal will serve for comparison. RhoA mRNA can be detected by any desired method, including but not limited to RT-PCR, Northern blot, branched-DNA assay, or RNAase protection assay. Alternatively, or additionally, RhoA gene expression can be monitored by performing Western blot analysis on tissue extracts treated with the iRNA agent.

[0077] Animal models may be used to establish the concentration necessary to achieve a certain desired effect (e.g., EC.sub.50 or ED.sub.50). Such animal models may include transgenic animals that express a human gene, e.g., a gene that produces a target human RhoA RNA. In another embodiment, the composition for testing includes an iRNA agent that is complementary, at least in an internal region, to a sequence that is conserved between the target RhoA RNA in the animal model and the target RhoA RNA in a human.

[0078] iRNA Chemistry

[0079] Described herein are isolated iRNA agents, e.g., ds RNA agents that mediate RNAi to inhibit expression of a RhoA gene.

[0080] RNA agents discussed herein include otherwise unmodified RNA as well as RNA which has been modified, e.g., to improve efficacy, and polymers of nucleoside surrogates. Unmodified RNA refers to a molecule in which the components of the nucleic acid, namely sugars, bases, and phosphate moieties, are the same or essentially the same as that which occur in nature, preferably as occur naturally in the human body. The art has referred to rare or unusual, but naturally occurring, RNAs as modified RNAs, see, e.g., Limbach et al. Nucleic Acids Res. 22: 2183-2196, 1994. Such rare or unusual RNAs, often termed modified RNAs (apparently because they are typically the result of a post-transcriptional modification) are within the term unmodified RNA, as used herein. Modified RNA as used herein refers to a molecule in which one or more of the components of the nucleic acid, namely sugars, bases, and phosphate moieties, are different from that which occurs in nature, preferably different from that which occurs in the human body. While they are referred to as modified "RNAs," they will of course, because of the modification, include molecules which are not RNAs. Nucleoside surrogates are molecules in which the ribophosphate backbone is replaced with a non-ribophosphate construct that allows the bases to the presented in the correct spatial relationship such that hybridization is substantially similar to what is seen with a ribophosphate backbone, e.g., non-charged mimics of the ribophosphate backbone. Examples of the above are discussed herein.

[0081] Modifications described herein can be incorporated into any double-stranded RNA and RNA-like molecule described herein, e.g., an iRNA agent. It may be desirable to modify one or both of the antisense and sense strands of an iRNA agent. As nucleic acids are polymers of subunits or monomers, many of the modifications described below occur at a position which is repeated within a nucleic acid, e.g., a modification of a base, or a phosphate moiety, or the non-linking O of a phosphate moiety. In some cases the modification will occur at all of the subject positions in the nucleic acid but in many, and in fact in most, cases it will not. By way of example, a modification may only occur at a 3' or 5' terminal position, may only occur in a terminal region, e.g. at a position on a terminal nucleotide or in the last 2, 3, 4, 5, or 10 nucleotides of a strand. A modification may occur in a double strand region, a single strand region, or in both. E.g., a phosphorothioate modification at a non-linking O position may only occur at one or both termini, may only occur in a terminal regions, e.g., at a position on a terminal nucleotide or in the last 2, 3, 4, 5, or 10 nucleotides of a strand, or may occur in double strand and single strand regions, particularly at termini. Similarly, a modification may occur on the sense strand, antisense strand, or both. In some cases, the sense and antisense strand will have the same modifications or the same class of modifications, but in other cases the sense and antisense strand will have different modifications, e.g., in some cases it may be desirable to modify only one strand, e.g. the sense strand.

[0082] Two prime objectives for the introduction of modifications into iRNA agents is their stabilization towards degradation in biological environments and the improvement of pharmacological properties, e.g. pharmacodynamic properties, which are further discussed below. Other suitable modifications to a sugar, base, or backbone of an iRNA agent are described in co-owned PCT Application No. PCT/US2004/01193, filed Jan. 16, 2004. An iRNA agent can include a non-naturally occurring base, such as the bases described in co-owned PCT Application No. PCT/US2004/011822, filed Apr. 16, 2004. An iRNA agent can include a non-naturally occurring sugar, such as a non-carbohydrate cyclic carrier molecule. Exemplary features of non-naturally occurring sugars for use in iRNA agents are described in co-owned PCT Application No. PCT/US2004/11829, filed Apr. 16, 2003.

[0083] An iRNA agent can include an internucleotide linkage (e.g., the chiral phosphorothioate linkage) useful for increasing nuclease resistance. In addition, or in the alternative, an iRNA agent can include a ribose mimic for increased nuclease resistance. Exemplary intemucleotide linkages and ribose mimics for increased nuclease resistance are described in co-owned PCT Application No. PCT/US2004/07070, filed on Mar. 8, 2004.

[0084] An iRNA agent can include ligand-conjugated monomer subunits and monomers for oligonucleotide synthesis. Exemplary monomers are described in co-owned U.S. application Ser. No. 10/916,185, filed on Aug. 10, 2004.

[0085] An iRNA agent can have a ZXY structure, such as is described in co-owned PCT Application No. PCT/US2004/07070, filed on Mar. 8, 2004.

[0086] An iRNA agent can be complexed with an amphipathic moiety. Exemplary amphipathic moieties for use with iRNA agents are described in co-owned PCT Application No. PCT/US2004/07070, filed on Mar. 8, 2004.

[0087] In another embodiment, the iRNA agent can be complexed to a delivery agent that features a modular complex. The complex can include a carrier agent linked to one or more of (preferably two or more, more preferably all three of): (a) a condensing agent (e.g., an agent capable of attracting, e.g., binding, a nucleic acid, e.g., through ionic or electrostatic interactions); (b) a fusogenic agent (e.g., an agent capable of fusing and/or being transported through a cell membrane); and (c) a targeting group, e.g., a cell or tissue targeting agent, e.g., a lectin, glycoprotein, lipid or protein, e.g., an antibody, that binds to a specified cell type. iRNA agents complexed to a delivery agent are described in co-owned PCT Application No. PCT/US2004/07070, filed on Mar. 8, 2004.

[0088] An iRNA agent can have non-canonical pairings, such as between the sense and antisense sequences of the iRNA duplex. Exemplary features of non-canonical iRNA agents are described in co-owned PCT Application No. PCT/US2004/07070, filed on Mar. 8, 2004.

Enhanced Nuclease Resistance

[0089] An iRNA agent, e.g., an iRNA agent that targets RhoA, can have enhanced resistance to nucleases. Naked RNA is often an easy prey for nucleolytic enzymes, such as exonucleases and endonucleases, which are omnipresent in biological media, such as the cellular cytoplasm, blood, or cerebrospinal fluid (CSF). Quick degradation can severly hamper the ability of an siRNA to inhibit the expression of a target gene. The vulnerability towards nucleolytic degradation can be greatly reduced by chemically modifying certain nucleotides of an siRNA. However, adding modifications in order to stabilize an siRNA sometimes represents a trade-off with its activity, and stabilizing modifications may even introduce toxic effects. It is therefore desirable to introduce the minimum number of modifications that still imparts the desired level of stability. Modifications in the sense strand usually have less impact on the activity of an siRNA.

[0090] In order to increase the stability of an siRNA towards nucleolytic degradation by endonucleases, it is therefore advantageous to modify only a limited number of nucleotides in particularly degradation prone positions, as described in co-owned U.S. Application No. 60/559,917, filed on May 4, 2004, co-owned U.S. Application No. 60/574,744, filed on May 27, 2004, and co-owned international application PCT/US2005/018931, filed May 27, 2005. We have determined that pyrimidine nucleotides, and specifically the 5' nucleotide in a 5'-ua-3' sequence context, a 5'-ug-3' sequence context, a 5'-ca-3' sequence context, a 5'-uu-3' sequence context, or a 5'-cc-3' sequence context are particularly prone to degradative attack, in that approximate order. Sufficiently stable and highly active siRNAs have been obtained by our laboratory when the 5'-most pyrimidines in all occurrences of the sequence contexts 5'-ua-3' and 5'-ca-3', or in all occurrences of 5'-ua-3', 5'-ca-3', and 5'-uu-3', or in all occurrences of 5'-ua-3', 5'-ca-3', 5'-uu-3', and 5'-ug-3' were replaced by 2'-modified nucleotides, such as 2'-O-methyl nucleotides, in both strands. Alternatively, 2'-modifying all pyrimidine nucleotides in the sense strand and the 5'-most pyrimidines in all occurrences of the sequence contexts 5'-ua-3' and 5'-ca-3' in the antisense strand has given good results in terms of activity and stability. Sometimes, it has been necessary to 2'-modify all pyrimidine nucleotides in the sense strand and the 5'-most pyrimidines in all occurrences of the sequence contexts 5'-ua-3', 5'-ca-3', 5'-uu-3', and 5'-ug-3' in the antisense strand. The iRNA agent can include at least 2, at least 3, at least 4 or at least 5 of such dinucleotides.

[0091] Preferably, the 2'-modified nucleotides include, for example, a 2'-modified ribose unit, e.g., the 2'-hydroxyl group (OH) can be modified or replaced with a number of different "oxy" or "deoxy" substituents.

[0092] Examples of "oxy"-2' hydroxyl group modifications include alkoxy or aryloxy (OR, e.g., R=H, alkyl, cycloalkyl, aryl, aralkyl, heteroaryl or sugar); polyethyleneglycols (PEG), O(CH.sub.2CH.sub.2O).sub.nCH.sub.2CH.sub.2OR; "locked" nucleic acids (LNA) in which the 2' hydroxyl is connected, e.g., by a methylene bridge, to the 4' carbon of the same ribose sugar; O-AMINE and aminoalkoxy, O(CH.sub.2).sub.nAMINE, (e.g., AMINE=NH.sub.2; alkylamino, dialkylamino, heterocyclyl amino, arylamino, diaryl amino, heteroaryl amino, or diheteroaryl amino, ethylene diamine, polyamino). It is noteworthy that oligonucleotides containing only the methoxyethyl group (MOE), (OCH.sub.2CH.sub.2OCH.sub.3, a PEG derivative), exhibit nuclease stabilities comparable to those modified with the robust phosphorothioate modification.

[0093] "Deoxy" modifications include hydrogen (i.e. deoxyribose sugars, which are of particular relevance to the overhang portions of partially ds RNA); halo (e.g., fluoro); amino (e.g. NH.sub.2; alkylamino, dialkylamino, heterocyclyl, arylamino, diaryl amino, heteroaryl amino, diheteroaryl amino, or amino acid); NH(CH.sub.2CH.sub.2NH).sub.nCH.sub.2CH.sub.2-AMINE (AMINE=NH.sub.2; alkylamino, dialkylamino, heterocyclyl amino, arylamino, diaryl amino, heteroaryl amino,or diheteroaryl amino), --NHC(O)R (R=alkyl, cycloalkyl, aryl, aralkyl, heteroaryl or sugar), cyano; mercapto; alkyl-thio-alkyl; thioalkoxy; and alkyl, cycloalkyl, aryl, alkenyl and alkynyl, which may be optionally substituted with e.g., an amino functionality.

[0094] Preferred substitutents are 2'-methoxyethyl, 2'-OCH.sub.3, 2'-O-allyl, 2'-C-allyl, and 2'-fluoro.

[0095] The inclusion of furanose sugars in the oligonucleotide backbone can also decrease endonucleolytic cleavage. An iRNA agent can be further modified by including a 3' cationic group, or by inverting the nucleoside at the 3'-terminus with a 3'-3' linkage. In another alternative, the 3'-terminus can be blocked with an aminoalkyl group, e.g., a 3' C5-aminoalkyl dT. Other 3' conjugates can inhibit 3'-5' exonucleolytic cleavage. While not being bound by theory, a 3' conjugate, such as naproxen or ibuprofen, may inhibit exonucleolytic cleavage by sterically blocking the exonuclease from binding to the 3'-end of oligonucleotide. Even small alkyl chains, aryl groups, or heterocyclic conjugates or modified sugars (D-ribose, deoxyribose, glucose etc.) can block 3'-5'-exonucleases.

[0096] Nucleolytic cleavage can also be inhibited by the introduction of phosphate linker modifications, e.g., phosphorothioate linkages. Thus, preferred iRNA agents include nucleotide dimers enriched or pure for a particular chiral form of a modified phosphate group containing a heteroatom at a nonbridging position normally occupied by oxygen. The heteroatom can be S, Se, Nr.sub.2, or Br.sub.3. When the heteroatom is S, enriched or chirally pure Sp linkage is preferred. Enriched means at least 70, 80, 90, 95, or 99% of the preferred form. Modified phosphate linkages are particularly efficient in inhibiting exonucleolytic cleavage when introduced near the 5'- or 3'-terminal positions, and preferably the 5'-terminal positions, of an iRNA agent.

[0097] 5' conjugates can also inhibit 5'-3' exonucleolytic cleavage. While not being bound by theory, a 5' conjugate, such as naproxen or ibuprofen, may inhibit exonucleolytic cleavage by sterically blocking the exonuclease from binding to the 5'-end of oligonucleotide. Even small alkyl chains, aryl groups, or heterocyclic conjugates or modified sugars (D-ribose, deoxyribose, glucose etc.) can block 3'-5'-exonucleases.

[0098] An iRNA agent can have increased resistance to nucleases when a duplexed iRNA agent includes a single-stranded nucleotide overhang on at least one end. In preferred embodiments, the nucleotide overhang includes 1 to 4, preferably 2 to 3, unpaired nucleotides. In a preferred embodiment, the unpaired nucleotide of the single-stranded overhang that is directly adjacent to the terminal nucleotide pair contains a purine base, and the terminal nucleotide pair is a G-C pair, or at least two of the last four complementary nucleotide pairs are G-C pairs. In further embodiments, the nucleotide overhang may have 1 or 2 unpaired nucleotides, and in an exemplary embodiment the nucleotide overhang is 5'-GC-3'. In preferred embodiments, the nucleotide overhang is on the 3'-end of the antisense strand. In one embodiment, the iRNA agent includes the motif 5'-CGC-3' on the 3'-end of the antisense strand, such that a 2-nt overhang 5'-GC-3' is formed.

[0099] Thus, an iRNA agent can include modifications so as to inhibit degradation, e.g., by nucleases, e.g., endonucleases or exonucleases, found in the body of a subject. These monomers are referred to herein as NRMs, or Nuclease Resistance promoting Monomers, the corresponding modifications as NRM modifications. In many cases these modifications will modulate other properties of the iRNA agent as well, e.g., the ability to interact with a protein, e.g., a transport protein, e.g., serum albumin, or a member of the RISC, or the ability of the first and second sequences to form a duplex with one another or to form a duplex with another sequence, e.g., a target molecule.

[0100] One or more different NRM modifications can be introduced into an iRNA agent or into a sequence of an iRNA agent. An NRM modification can be used more than once in a sequence or in an iRNA agent.

[0101] NRM modifications include some which can be placed only at the terminus and others which can go at any position. Some NRM modifications can inhibit hybridization so it is preferable to use them only in terminal regions, and preferable to not use them at the cleavage site or in the cleavage region of a sequence which targets a subject sequence or gene, particularly on the antisense strand. They can be used anywhere in a sense strand, provided that sufficient hybridization between the two strands of the ds iRNA agent is maintained. In some embodiments it is desirable to put the NRM at the cleavage site or in the cleavage region of a sense strand, as it can minimize off-target silencing.

[0102] In most cases, NRM modifications will be distributed differently depending on whether they are comprised on a sense or antisense strand. If on an antisense strand, modifications which interfere with or inhibit endonuclease cleavage should not be inserted in the region which is subject to RISC mediated cleavage, e.g., the cleavage site or the cleavage region (As described in Elbashir et al., 2001, Genes and Dev. 15: 188, hereby incorporated by reference). Cleavage of the target occurs about in the middle of a 20 or 21 nt antisense strand, or about 10 or 11 nucleotides upstream of the first nucleotide on the target mRNA which is complementary to the antisense strand. As used herein cleavage site refers to the nucleotides on either side of the cleavage site, on the target or on the iRNA agent strand which hybridizes to it. Cleavage region means the nucleotides within 1, 2, or 3 nucleotides of the cleavagee site, in either direction.

[0103] Such modifications can be introduced into the terminal regions, e.g., at the terminal position or with 2, 3, 4, or 5 positions of the terminus, of a sense or antisense strand.

Tethered Ligands

[0104] The properties of an iRNA agent, including its pharmacological properties, can be influenced and tailored, for example, by the introduction of ligands, e.g. tethered ligands.

[0105] A wide variety of entities, e.g., ligands, can be tethered to an iRNA agent, e.g., to the carrier of a ligand-conjugated monomer subunit. Examples are described below in the context of a ligand-conjugated monomer subunit but that is only preferred, entities can be coupled at other points to an iRNA agent.

[0106] Preferred moieties are ligands, which are coupled, preferably covalently, either directly or indirectly via an intervening tether, to the carrier. In preferred embodiments, the ligand is attached to the carrier via an intervening tether. The ligand or tethered ligand may be present on the ligand-conjugated monomer when the ligand-conjugated monomer is incorporated into the growing strand. In some embodiments, the ligand may be incorporated into a "precursor" ligand-conjugated monomer subunit after a "precursor" ligand-conjugated monomer subunit has been incorporated into the growing strand. For example, a monomer having, e.g., an amino-terminated tether, e.g., TAP-(CH.sub.2).sub.nNH.sub.2 may be incorporated into a growing sense or antisense strand. In a subsequent operation, i.e., after incorporation of the precursor monomer subunit into the strand, a ligand having an electrophilic group, e.g., a pentafluorophenyl ester or aldehyde group, can subsequently be attached to the precursor ligand-conjugated monomer by coupling the electrophilic group of the ligand with the terminal nucleophilic group of the precursor ligand-conjugated monomer subunit tether.

[0107] In preferred embodiments, a ligand alters the distribution, targeting or lifetime of an iRNA agent into which it is incorporated. In preferred embodiments a ligand provides an enhanced affinity for a selected target, e.g., molecule, cell or cell type, compartment, e.g., a cellular or organ compartment, tissue, organ or region of the body, as, e.g., compared to a species absent such a ligand.

[0108] Preferred ligands can improve transport, hybridization, and specificity properties and may also improve nuclease resistance of the resultant natural or modified oligoribonucleotide, or a polymeric molecule comprising any combination of monomers described herein and/or natural or modified ribonucleotides.

[0109] Ligands in general can include therapeutic modifiers, e.g., for enhancing uptake; diagnostic compounds or reporter groups e.g., for monitoring distribution; cross-linking agents; nuclease-resistance conferring moieties; and natural or unusual nucleobases. General examples include lipophilic molecules, lipids, lectins, steroids (e.g.,uvaol, hecigenin, diosgenin), terpenes (e.g., triterpenes, e.g., sarsasapogenin, Friedelin, epifriedelanol derivatized lithocholic acid), vitamins, carbohydrates (e.g., a dextran, pullulan, chitin, chitosan, inulin, cyclodextrin or hyaluronic acid), proteins, protein binding agents, integrin targeting molecules, polycationics, peptides, polyamines, and peptide mimics.

[0110] The ligand may be a naturally occurring or recombinant or synthetic molecule, such as a synthetic polymer, e.g., a synthetic polyamino acid. Examples of polyamino acids include polylysine (PLL), poly L-aspartic acid, poly L-glutamic acid, styrene-maleic acid anhydride copolymer, poly(L-lactide-co-glycolied) copolymer, divinyl ether-maleic anhydride copolymer, N-(2-hydroxypropyl)methacrylamide copolymer (HMPA), polyethylene glycol (PEG), polyvinyl alcohol (PVA), polyurethane, poly(2-ethylacrylic acid), N-isopropylacrylamide polymers, or polyphosphazine. Example of polyamines include: polyethylenimine, polylysine (PLL), spermine, spermidine, polyamine, pseudopeptide-polyamine, peptidomimetic polyamine, dendrimer polyamine, arginine, amidine, protamine, cationic moieties, e.g., cationic lipid, cationic porphyrin, quaternary salt of a polyamine, or an alpha helical peptide.

[0111] Ligands can also include targeting groups, e.g., a cell or tissue targeting agent, e.g., a thyrotropin, melanotropin, surfactant protein A, Mucin carbohydrate, a glycosylated polyaminoacid, transferrin, bisphosphonate, polyglutamate, polyaspartate, or an RGD peptide or RGD peptide mimetic.

[0112] Ligands can be proteins, e.g., glycoproteins, lipoproteins, e.g. low density lipoprotein (LDL), or albumins, e.g. human serum albumin (HSA), or peptides, e.g., molecules having a specific affinity for a co-ligand, or antibodies e.g., an antibody, that binds to a specified cell type such as a cancer cell, endothelial cell, or bone cell. Ligands may also include hormones and hormone receptors. They can also include non-peptidic species, such as cofactors, multivalent lactose, multivalent galactose, N-acetyl-galactosamine, N-acetyl-glucosamine, multivalent mannose, or multivalent fucose. The ligand can be, for example, a lipopolysaccharide, an activator of p38 MAP kinase, or an activator of NF-.kappa.B.

[0113] The ligand can be a substance, e.g, a drug, which can increase the uptake of the iRNA agent into the cell, for example, by disrupting the cell's cytoskeleton, e.g., by disrupting the cell's microtubules, microfilaments, and/or intermediate filaments. The drug can be, for example, taxon, vincristine, vinblastine, cytochalasin, nocodazole, japlakinolide, latrunculin A, phalloidin, swinholide A, indanocine, or myoservin.

[0114] In one aspect, the ligand is a lipid or lipid-based molecule. Such a lipid or lipid-based molecule preferably binds a serum protein, e.g., human serum albumin (HSA). An HSA binding ligand allows for distribution of the conjugate to a target tissue, e.g., liver tissue, including parenchymal cells of the liver. Other molecules that can bind HSA can also be used as ligands. For example, neproxin or aspirin can be used. A lipid or lipid-based ligand can (a) increase resistance to degradation of the conjugate, (b) increase targeting or transport into a target cell or cell membrane, and/or (c) can be used to adjust binding to a serum protein, e.g., HSA.

[0115] A lipid based ligand can be used to modulate, e.g., control the binding of the conjugate to a target tissue. For example, a lipid or lipid-based ligand that binds to HSA more strongly will be less likely to be targeted to the kidney and therefore less likely to be cleared from the body. A lipid or lipid-based ligand that binds to HSA less strongly can be used to target the conjugate to the kidney.

[0116] In a preferred embodiment, the lipid based ligand binds HSA. Preferably, it binds HSA with a sufficient affinity such that the conjugate will be preferably distributed to a non-kidney tissue. However, it is preferred that the affinity not be so strong that the HSA-ligand binding cannot be reversed.

[0117] In another aspect, the ligand is a moiety, e.g., a vitamin or nutrient, which is taken up by a target cell, e.g., a proliferating cell. These are particularly useful for treating disorders characterized by unwanted cell proliferation, e.g., of the malignant or non-malignant type, e.g., cancer cells. Exemplary vitamins include vitamin A, E, and K. Other exemplary vitamins include the B vitamins, e.g., folic acid, B12, riboflavin, biotin, pyridoxal or other vitamins or nutrients taken up by cancer cells.

[0118] In another aspect, the ligand is a cell-permeation agent, preferably a helical cell-permeation agent. Preferably, the agent is amphipathic. An exemplary agent is a peptide such as tat or antennapedia. If the agent is a peptide, it can be modified, including a peptidylmimetic, invertomers, non-peptide or pseudo-peptide linkages, and use of D-amino acids. The helical agent is preferably an alpha-helical agent, which preferably has a lipophilic and a lipophobic phase.

5'-Phosphate Modifications

[0119] In preferred embodiments, iRNA agents are 5' phosphorylated or include a phosphoryl analog at the 5' prime terminus. 5'-phosphate modifications of the antisense strand include those which are compatible with RISC mediated gene silencing. Suitable modifications include: 5'-monophosphate ((HO)2(O)P--O-5'); 5'-diphosphate ((HO)2(O)P--O--P(HO)(O)--O-5'); 5'-triphosphate ((HO)2(O)P--O--(HO)(O)P--O--P(HO)(O)--O-5'); 5'-guanosine cap (7-methylated or non-methylated) (7m-G-O-5'-(HO)(O)P--O--(HO)(O)P--O--P(HO)(O)--O-5'); 5'-adenosine cap (Appp), and any modified or unmodified nucleotide cap structure (N--O-5'-(HO)(O)P--O--(HO)(O)P--O--P(HO)(O)--O-5'); 5'-monothiophosphate (phosphorothioate; (HO)2(S)P--O-5'); 5'-monodithiophosphate (phosphorodithioate; (HO)(HS)(S)P--O-5'), 5'-phosphorothiolate ((HO)2(O)P--S-5'); any additional combination of oxygen/sulfur replaced monophosphate, diphosphate and triphosphates (e.g. 5'-alpha-thiotriphosphate, 5'-gamma-thiotriphosphate, etc.), 5'-phosphoramidates ((HO)2(O)P--NH-5', (HO)(NH2)(O)P--O-5'), 5'-alkylphosphonates (R=alkyl=methyl, ethyl, isopropyl, propyl, etc., e.g. RP(OH)(O)--O-5'-, (OH)2(O)P-5'-CH2-), 5'-alkyletherphosphonates (R=alkylether=methoxymethyl (MeOCH2-), ethoxymethyl, etc., e.g. RP(OH)(O)--O-5'-).

[0120] The sense strand can be modified in order to inactivate the sense strand and prevent formation of an active RISC, thereby potentially reducing off-target effects. This can be accomplished by a modification which prevents 5'-phosphorylation of the sense strand, e.g., by modification with a 5'-O-methyl ribonucleotide (see Nykanen et al., (2001) ATP requirements and small interfering RNA structure in the RNA interference pathway. Cell 107, 309-321.) Other modifications which prevent phosphorylation can also be used, e.g., simply substituting the 5'-OH by H rather than O-Me. Alternatively, a large bulky group may be added to the 5'-phosphate turning it into a phosphodiester linkage.

Transport of iRNA Agents into Cells

[0121] Not wishing to be bound by any theory, the chemical similarity between cholesterol-conjugated iRNA agents and certain constituents of lipoproteins (e.g. cholesterol, cholesteryl esters, phospholipids) may lead to the association of iRNA agents with lipoproteins (e.g. LDL, HDL) in blood and/or the interaction of the iRNA agent with cellular components having an affinity for cholesterol, e.g. components of the cholesterol transport pathway. Lipoproteins as well as their constituents are taken up and processed by cells by various active and passive transport mechanisms, for example, without limitation, endocytosis of LDL-receptor bound LDL, endocytosis of oxidized or otherwise modified LDLs through interaction with Scavenger receptor A, Scavenger receptor B1-mediated uptake of HDL cholesterol in the liver, pinocytosis, or transport of cholesterol across membranes by ABC (ATP-binding cassette) transporter proteins, e.g. ABC-A1, ABC-G1 or ABC-G4. Hence, cholesterol-conjugated iRNA agents could enjoy facilitated uptake by cells possessing such transport mechanisms, e.g. cells of the liver. As such, the present invention provides evidence and general methods for targeting iRNA agents to cells expressing certain cell surface components, e.g. receptors, by conjugating a natural ligand for such component (e.g. cholesterol) to the iRNA agent, or by conjugating a chemical moiety (e.g. cholesterol) to the iRNA agent which associates with or binds to a natural ligand for the component (e.g. LDL, HDL).

[0122] Other Embodiments

[0123] An RNA, e.g., an iRNA agent, can be produced in a cell in vivo, e.g., from exogenous DNA templates that are delivered into the cell. For example, the DNA templates can be inserted into vectors and used as gene therapy vectors. Gene therapy vectors can be delivered to a subject by, for example, intravenous injection, local administration (U.S. Pat. No. 5,328,470), or by stereotactic injection (see, e.g., Chen et al. Proc. Natl. Acad. Sci. USA 91:3054-3057, 1994). The pharmaceutical preparation of the gene therapy vector can include the gene therapy vector in an acceptable diluent, or can comprise a slow release matrix in which the gene delivery vehicle is imbedded. The DNA templates, for example, can include two transcription units, one that produces a transcript that includes the top strand of an iRNA agent and one that produces a transcript that includes the bottom strand of an iRNA agent. When the templates are transcribed, the iRNA agent is produced, and processed into siRNA agent fragments that mediate gene silencing.

[0124] Formulation

[0125] The iRNA agents described herein can be formulated for administration to a subject.

[0126] For ease of exposition, the formulations, compositions, and methods in this section are discussed largely with regard to unmodified iRNA agents. It should be understood, however, that these formulations, compositions, and methods can be practiced with other iRNA agents, e.g., modified iRNA agents, and such practice is within the invention.

[0127] A formulated iRNA agent composition can assume a variety of states. In some examples, the composition is at least partially crystalline, uniformly crystalline, and/or anhydrous (e.g., less than 80, 50, 30, 20, or 10% water). In another example, the iRNA agent is in an aqueous phase, e.g., in a solution that includes water.

[0128] The aqueous phase or the crystalline compositions can, e.g., be incorporated into a delivery vehicle, e.g., a liposome (particularly for the aqueous phase) or a particle (e.g., a microparticle as can be appropriate for a crystalline composition). Generally, the iRNA agent composition is formulated in a manner that is compatible with the intended method of administration.

[0129] An iRNA agent preparation can be formulated in combination with another agent, e.g., another therapeutic agent or an agent that stabilizes an iRNA agent, e.g., a protein that complexes with the iRNA agent to form an iRNP. Still other agents include chelators, e.g., EDTA (e.g., to remove divalent cations such as Mg.sup.2+), salts, RNAse inhibitors (e.g., a broad specificity RNAse inhibitor such as RNAsin) and so forth.

[0130] In one embodiment, the iRNA agent preparation includes two or more iRNA agent(s), e.g., two or more iRNA agents that can mediate RNAi with respect to the same gene, or different alleles of the gene, or with respect to different genes. Such preparations can include at least three, five, ten, twenty, fifty, or a hundred or more different iRNA agent species. Such iRNA agents can mediate RNAi with respect to a similar number of different genes.

[0131] Where the two or more iRNA agents in such preparation target the same gene, they can have target sequences that are non-overlapping and non-adjacent, or the target sequences may be overlapping or adjacent.

[0132] Disorders Associated with RhoA Expression

[0133] An iRNA agent that targets RhoA, e.g., an iRNA agent described herein, can be used to treat a subject, e.g., a human having or at risk for developing a disease or disorder associated with RhoA gene expression or treating a subject where a biological process mediated by RhoA is unwanted. Since Nogo-L, RhoA, and Nogo-R participate in inhibiting axonal growth and elongations, the iRNA agents of the present invention are used to reverse this inhibition leading to nerve/axonal growth and elongation. Such a treatment is useful in treating injuries to the nervous system such as spinal cord injury or peripheral nerve death (caused by, e.g., Metastatic cancers of the CNS, e.g., gliomas (such as glioblastomas, astrocytomas, oligodendrogliomas, ependymomas), meningiomas, medulloblastomas, neuroblastomas, choroid plexus papillomas, sarcomas can also be treated by the iRNA agents described herein. Other indications include diseases of the central nervous system, including but not limited to encephalomyelitis, ischemic stroke, Alzheimer's Disease, spongiform encephalopathy, Amyotrophic lateral sclerosis (ALS), spinal muscular atrophy (SMA), multiple sclerosis, transverse myelitis, motor neuron disease, Guillan Barre, Anterior Spinal Artery Syndrome, and schizophrenia.

[0134] For example, an iRNA agent that targets RhoA mRNA can be used to treat a subject with a spinal cord injury or a subject having another pathological state which can be ameliorated, at least in part, by nerve growth and elongation. In such a use, an iRNA agent of the present invention is administered preferably locally at the site of nerve damage or the site at which the inhibitory effects of RhoA is desired to be reversed. Administration of the iRNA agent leads to decrease in RhoA protein resulting in reversing Nogo mediated inhibition of axonal elongation and growth.

[0135] Treatment Methods and Routes of Delivery

[0136] A composition that includes an iRNA agent, e.g., an iRNA agent that targets RhoA, can be delivered to a subject by a variety of routes to achieve either local delivery to the site of action of systemic delivery to the subject. Exemplary routes include direct injection to the site of treatment, intrathecal, parenchymal, intravenous, nasal, oral, and ocular delivery. The preferred means of administering the iRNA agents of the present invention is through direct injection or infusion to the site of treatment.

[0137] An iRNA agent can be incorporated into pharmaceutical compositions suitable for administration. For example, compositions can include one or more species of an iRNA agent and a pharmaceutically acceptable carrier. As used herein the language "pharmaceutically acceptable carrier" is intended to include any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like, compatible with pharmaceutical administration. The use of such media and agents for pharmaceutically active substances is well known in the art. Except insofar as any conventional media or agent is incompatible with the active compound, use thereof in the compositions is contemplated. Supplementary active compounds can also be incorporated into the compositions.

[0138] The pharmaceutical compositions of the present invention may be administered in a number of ways depending upon whether local or systemic treatment is desired and upon the area to be treated. Administration may be topical (including ophthalmic, intranasal, transdermal), oral or parenteral. Parenteral administration includes intravenous drip, subcutaneous, intraperitoneal or intramuscular injection, or intrathecal or intraventricular administration.

[0139] The route of delivery can be dependent on the disorder of the patient. In general, the delivery of the iRNA agents of the present invention is done to achieve systemic delivery into the subject. One preferred means of achieving this is through parenteral administration. In a particularly preferred embodiment, the application is achieved by direct application of the pharmaceutical composition to the site of nerve injury, such as the the site of spinal cord injury. Formulations for parenteral administration may include sterile aqueous solutions which may also contain buffers, diluents and other suitable additives. For intravenous use, the total concentration of solutes should be controlled to render the preparation isotonic.

[0140] Using the small interfering RNA vectors previously described, the invention also provides devices, systems, and methods for delivery of small interfering RNA to target locations in the nervous system and or/the brain. The envisioned route of delivery is through the use of implanted, indwelling, intrathecal or intraparenchymal catheters that provide a means for injecting small volumes of fluid containing the dsRNA of the invention directly into local nerves or local brain tissue. The proximal end of these catheters may be connected to an implanted, intrathecal or intracerebral access port surgically affixed to the patient's body or cranium, or to an implanted drug pump located in the patient's torso.

[0141] Alternatively, implantable delivery devices, such as an implantable pump may be employed. Examples of the delivery devices within the scope of the invention include the Model 8506 investigational device (by Medtronic, Inc. of Minneapolis, Minn.), which can be implanted subcutaneously in the body or on the cranium, and provides an access port through which therapeutic agents may be delivered to the nerves or brain. Delivery occurs through a stereotactically implanted polyurethane catheter. Two models of catheters that can finction with the Model 8506 access port include the Model 8770 ventricular catheter by Medtronic, Inc., for delivery to the intracerebral ventricles, which is disclosed in U.S. Pat. No. 6,093,180, incorporated herein by reference, and the IPA1 catheter by Medtronic, Inc., for delivery to the brain tissue itself (i.e., intraparenchymal delivery), disclosed in U.S. Ser. Nos. 09/540,444 and 09/625,751, which are incorporated herein by reference. The latter catheter has multiple outlets on its distal end to deliver the therapeutic agent to multiple sites along the catheter path. In addition to the aforementioned device, the delivery of the small interfering RNA vectors in accordance with the invention can be accomplished with a wide variety of devices, including but not limited to U.S. Pat. Nos. 5,735,814, 5,814,014, and 6,042,579, all of which are incorporated herein by reference. Using the teachings of the invention and those of skill in the art will recognize that these and other devices and systems may be suitable for delivery of small interfering RNA vectors for the treatment of pain in accordance with the invention.

[0142] In one such embodiment, the method further comprises the steps of implanting a pump outside the body or brain, the pump coupled to a proximal end of the catheter, and operating the pump to deliver the predetermined dosage of the at least one small interfering RNA or small interfering RNA vector through the discharge portion of the catheter. A further embodiment comprises the further step of periodically refreshing a supply of the at least one small interfering RNA or small interfering RNA vector to the pump outside said body or brain.

[0143] Thus, the invention includes the delivery of small interfering RNA vectors using an implantable pump and catheter, like that taught in U.S. Pat. Nos. 5,735,814 and 6,042,579, and further using a sensor as part of the infusion system to regulate the amount of small interfering RNA vectors delivered to the nerves or brain, like that taught in U.S. Pat. No. 5,814,014. Other devices and systems can be used in accordance with the method of the invention, for example, the devices and systems disclosed in U.S. Ser. No. 09/872,698 (filed Jun. 1, 2001) and Ser. No. 09/864,646 (filed May 23, 2001), which are incorporated herein by reference.

[0144] Preferably, the outlet of the pump or catheter is placed in close proximity of the desired site of action of the pharmaceutical composition, such as near the site of spinal cord, or other nerve, injury.

[0145] Administration can be provided by the subject or by another person, e.g., a caregiver. A caregiver can be any entity involved with providing care to the human: for example, a hospital, hospice, doctor's office, outpatient clinic; a healthcare worker such as a doctor, nurse, or other practitioner; or a spouse or guardian, such as a parent. The medication can be provided in measured doses or in a dispenser which delivers a metered dose.

[0146] The term "therapeutically effective amount" is the amount present in the composition that is needed to provide the desired level of drug in the subject to be treated to give the anticipated physiological response.

[0147] The term "physiologically effective amount" is that amount delivered to a subject to give the desired palliative or curative effect.

[0148] The term "pharmaceutically acceptable carrier" means that the carrier can be taken into the lungs with no significant adverse toxicological effects on the lungs.

[0149] The term "co-administration" refers to administering to a subject two or more agents, and in particular two or more iRNA agents. The agents can be contained in a single pharmaceutical composition and be administered at the same time, or the agents can be contained in separate formulation and administered serially to a subject. So long as the two agents can be detected in the subject at the same time, the two agents are said to be co-administered. In one embodiment, both Nogo-L, RhoA, and Nogo-R iRNA agents are co-administered.

[0150] The types of pharmaceutical excipients that are useful as carrier include stabilizers such as human serum albumin (HSA), bulking agents such as carbohydrates, amino acids and polypeptides; pH adjusters or buffers; salts such as sodium chloride; and the like. These carriers may be in a crystalline or amorphous form or may be a mixture of the two.

[0151] Bulking agents that are particularly valuable include compatible carbohydrates, polypeptides, amino acids or combinations thereof. Suitable carbohydrates include monosaccharides such as galactose, D-mannose, sorbose, and the like; disaccharides, such as lactose, trehalose, and the like; cyclodextrins, such as 2-hydroxypropyl-.beta.-cyclodextrin; and polysaccharides, such as raffmose, maltodextrins, dextrans, and the like; alditols, such as mannitol, xylitol, and the like. A preferred group of carbohydrates includes lactose, threhalose, raffinose maltodextrins, and mannitol. Suitable polypeptides include aspartame. Amino acids include alanine and glycine, with glycine being preferred.

[0152] Suitable pH adjusters or buffers include organic salts prepared from organic acids and bases, such as sodium citrate, sodium ascorbate, and the like; sodium citrate is preferred.

[0153] Dosage. An iRNA agent can be administered at a unit dose less than about 75 mg per kg of bodyweight, or less than about 70, 60, 50, 40, 30, 20, 10, 5, 2, 1, 0.5, 0.1, 0.05, 0.01, 0.005, 0.001, or 0.0005 mg per kg of bodyweight, and less than 200 nmol of iRNA agent (e.g., about 4.4.times.1016 copies) per kg of bodyweight, or less than 1500, 750, 300, 150, 75, 15, 7.5, 1.5, 0.75, 0.15, 0.075, 0.015, 0.0075, 0.0015, 0.00075, 0.00015 nmol of iRNA agent per kg of bodyweight. The unit dose, for example, can be administered by injection (e.g., intravenous or intramuscular, intrathecally, or directly into an organ), an inhaled dose, or a topical application.

[0154] Delivery of an iRNA agent directly to an organ (e.g., directly to the liver) can be at a dosage on the order of about 0.00001 mg to about 3 mg per organ, or preferably about 0.0001-0.001 mg per organ, about 0.03-3.0 mg per organ, about 0.1-3.0 mg per eye or about 0.3-3.0 mg per organ.

[0155] The dosage can be an amount effective to treat or prevent a disease or disorder.

[0156] In one embodiment, the unit dose is administered less frequently than once a day, e.g., less than every 2, 4, 8 or 30 days. In another embodiment, the unit dose is not administered with a frequency (e.g., not a regular frequency). For example, the unit dose may be administered a single time. Because iRNA agent mediated silencing can persist for several days after administering the iRNA agent composition, in many instances, it is possible to administer the composition with a frequency of less than once per day, or, for some instances, only once for the entire therapeutic regimen.

[0157] In one embodiment, a subject is administered an initial dose, and one or more maintenance doses of an iRNA agent, e.g., a double-stranded iRNA agent, or siRNA agent, (e.g., a precursor, e.g., a larger iRNA agent which can be processed into an siRNA agent, or a DNA which encodes an iRNA agent, e.g., a double-stranded iRNA agent, or siRNA agent, or precursor thereof). The maintenance dose or doses are generally lower than the initial dose, e.g., one-half less of the initial dose. A maintenance regimen can include treating the subject with a dose or doses ranging from 0.01 to 75 mg/kg of body weight per day, e.g., 70, 60, 50, 40, 30, 20, 10, 5, 2, 1, 0.5, 0.1, 0.05, 0.01, 0.005, 0.001, or 0.0005 mg per kg of body weight per day. The maintenance doses are preferably administered no more than once every 5, 10, or 30 days. Further, the treatment regimen may last for a period of time which will vary depending upon the nature of the particular disease, its severity and the overall condition of the patient. In preferred embodiments the dosage may be delivered no more than once per day, e.g., no more than once per 24, 36, 48, or more hours, e.g., no more than once every 5 or 8 days. Following treatment, the patient can be monitored for changes in his condition and for alleviation of the symptoms of the disease state. The dosage of the compound may either be increased in the event the patient does not respond significantly to current dosage levels, or the dose may be decreased if an alleviation of the symptoms of the disease state is observed, if the disease state has been ablated, or if undesired side-effects are observed.

[0158] The effective dose can be administered in a single dose or in two or more doses, as desired or considered appropriate under the specific circumstances. If desired to facilitate repeated or frequent infusions, implantation of a delivery device, e.g., a pump, semi-permanent stent (e.g., intravenous, intraperitoneal, intracisternal or intracapsular), or reservoir may be advisable.

[0159] Following successful treatment, it may be desirable to have the patient undergo maintenance therapy to prevent the recurrence of the disease state, wherein the compound of the invention is administered in maintenance doses, ranging from 0.001 g to 100 g per kg of body weight (see U.S. Pat. No. 6,107,094).

[0160] The concentration of the iRNA agent composition is an amount sufficient to be effective in treating or preventing a disorder or to regulate a physiological condition in humans. The concentration or amount of iRNA agent administered will depend on the parameters determined for the agent and the method of administration, e.g. nasal, buccal, pulmonary, or topical, such as intrathecal or at the site of nerve injury. For example, topical formulations tend to require much lower concentrations of some ingredients in order to avoid irritation or burning.

[0161] Certain factors may influence the dosage required to effectively treat a subject, including but not limited to the severity of the disease or disorder, previous treatments, the general health and/or age of the subject, and other diseases present. It will also be appreciated that the effective dosage of an iRNA agent such as an siRNA used for treatment may increase or decrease over the course of a particular treatment. Changes in dosage may result and become apparent from the results of diagnostic assays. For example, the subject can be monitored after administering an iRNA agent composition. Based on information from the monitoring, an additional amount of the iRNA agent composition can be administered.

[0162] Dosing is dependent on severity and responsiveness of the disease condition to be treated, with the course of treatment lasting from several days to several months, or until a cure is effected or a diminution of disease state is achieved. Optimal dosing schedules can be calculated from measurements of drug accumulation in the body of the patient, or of drug accumulation at the site of application when delivering locally, e.g. at the site of nerve injusry, e.g. at the site of spinal cord injury. Persons of ordinary skill can easily determine optimum dosages, dosing methodologies and repetition rates.

[0163] Optimum dosages may vary depending on the relative potency of individual compounds, and can generally be estimated based on EC50s found to be effective in in vitro and in vivo animal models as described above.

[0164] The invention is further illustrated by the following examples, which should not be construed as further limiting.

EXAMPLES

[0165] Nucleic acid sequences are represented below using standard nomenclature, and specifically the abbreviations of Table 2. TABLE-US-00002 TABLE 2 Abbreviations of nucleotide monomers used in nucleic acid sequence representation. It will be understood that these monomers, when present in an oligonucleotide, are mutually linked by 5'-3'-phosphodiester bonds. Abbreviation.sup.a Nucleotide(s) A, a 2'-deoxy-adenosine-5'-phosphate, adenosine-5'-phosphate C, c 2'-deoxy-cytidine-5'-phosphate, cytidine-5'-phosphate G, g 2'-deoxy-guanosine-5'-phosphate, guanosine-5'-phosphate T, t 2'-deoxy-thymidine-5'-phosphate, thymidine-5'-phosphate U, u 2'-deoxy-uridine-5'-phosphate, uridine-5'-phosphate N, n any 2'-deoxy-nucleotide/nucleotide (G, A, C, or T, g, a, c or u) am 2'-O-methyladenosine-5'-phosphate cm 2'-O-methylcytidine-5'-phosphate gm 2'-O-methylguanosine-5'-phosphate tm 2'-O-methyl-thymidine-5'-phosphate um 2'-O-methyluridine-5'-phosphate A, C, G, T, U, a, underlined: nucleoside-5'-phosphorothioate c, g, t, u -Chol 1-{6-[cholester-3-yloxycarbonylamino]- hexanoyl}-4-hydroxy-pyrrolidin-3- phosphorothioate diester .sup.acapital letters represent 2'-deoxyribonucleotides (DNA), lower case letters represent ribonucleotides (RNA)

Source of Reagents

[0166] Where the source of a reagent is not specifically given herein, such reagent may be obtained from any supplier of reagents for molecular biology at a quality/purity standard for application in molecular biology.

Example 1

Selection of Sequences

[0167] Sequence alignment was performed to identify regions within the sequence of human RhoA mRNA with full homology to the respective sequences in both mouse and rat RhoA mRNA (human RhoA mRNA: Genbank accession no. NM.sub.--001664; mouse RhoA MRNA: Genbank accession no. NM.sub.--016802; rat RhoA mRNA: Genbank accession no. NM.sub.--057132). Within the regions of homology thus identified, all possible contiguous sequences of 19 nucleotides were examined by further BLAST comparison for potential cross-reactivity of an siRNA comprising such sequence to other mRNA sequences present in humans. Only sequences with 3 or more mismatches to any other human mRNA or genomic sequence were chosen. The resulting set of 19 nt sequences is represented in the sense strand ribonucleotide sequences of the double-overhang iRNA agents given in Table 1.

[0168] In order to maximise the stability of the siRNAs for testing in biological media, particularly towards nucleolytic attack by endo- and exonucleases, the siRNAs were synthesized such that in the sense strands, all cytidine and uridine nucleotides comprise a 2'-O-methyl group, and in the antisense strand, all cytidines and uridines appearing in a sequence context of 5'-ca-3' or 5'-ua-3' comprise a 2'-O-methyl group.

[0169] To the same end, phosphorothioate linkages were introduced between 3'-terminal 5'-TT-3'-group thymidines. It has been our experience that the most active exonucleases in serum and other biological media relevant for the in vivo activity of siRNAs act by degrading siRNA strands 3'-5'. It has proven advantageous, and often sufficient, to replace the 2 penultimate nucleotides in the antisense strand by 2'-O-methyl-5'-phosphorothioate-modified nucleotides (e.g. the nucleotides in positions 21 and 22, counting 5' to 3', of a 23-nucleotide antisense strand); sometimes it is sufficient to modify only the penultimate nucleotide, or to use only 5'-phosphorothioate-modified nucleotides, or both. The sense strand may be protected in a similar fashion, and/or it may be 3'-conjugated to a tethered ligand via a phosphodiester or a phosphorothioate diester.

[0170] In addition to the sequences selected as described above, four siRNAs were synthesized which corresponded to four of those utilized by the authors of Ahmed, Z.,et al, Mol Cell Neurosci. 2005, 28:509-23. AL-DP-5850 corresponds to RHO-A1 of Ahmed et al., supra, AL-DP-5851 to RHO-A2, AL-DP-5852 to RHO-A5 and AL-DP-5853 to RHO-A4 of Ahmed et al., supra.

Example 2

siRNA Synthesis

[0171] Single-stranded RNAs were produced by solid phase synthesis on a scale of 1 .mu.mole using an Expedite 8909 synthesizer (Applied Biosystems, Applera Deutschland GmbH, Darmstadt, Germany) and controlled pore glass (CPG, 500 .ANG., Glen Research, Sterling Va.) as solid support. RNA and RNA containing 2'-O-methyl nucleotides were 30 generated by solid phase synthesis employing the corresponding phosphoramidites and 2'-O-methyl phosphoramidites, respectively (Proligo Biochemie GmbH, Hamburg, Germany). These building blocks were incorporated at selected sites within the sequence of the oligoribonucleotide chain using standard nucleoside phosphoramidite chemistry such as described in Current protocols in nucleic acid chemistry, Beaucage, S. L. et al. (Edrs.), John Wiley & Sons, Inc., New York, N.Y., USA. Phosphorothioate linkages were introduced by replacement of the iodine oxidizer solution with a solution of the Beaucage reagent (Chruachem Ltd, Glasgow, UK) in acetonitrile (1%). Further ancillary reagents were obtained from Mallinckrodt Baker (Griesheim, Germany).

[0172] Deprotection and purification by anion exchange HPLC of the crude oligoribonucleotides were carried out according to established procedures. Yields and concentrations were determined by UV absorption of a solution of the respective RNA at a wavelength of 260 nm using a spectral photometer (DU 640B, Beckman Coulter GmbH, Unterschlei.beta.heim, Germany). Double stranded RNA was generated by mixing an equimolar solution of complementary strands in annealing buffer (20 mM sodium phosphate, pH 6.8; 100 mM sodium chloride), heated in a water bath at 85-90.degree. C. for 3 minutes and cooled to room temperature over a period of 3-4 hours. The purified RNA solution was stored at -20.degree. C. until use.

[0173] As a result of the synthesis strategy described above, all oligonucleotides synthesized as described above do not comprise a phosphate group on their 5'-most nucleotide.

[0174] Cholesterol was 3'-conjugated to siRNA as illustrated in FIG. 1. For the synthesis of these 3'-cholesterol-conjugated siRNAs, an appropriately modified solid support was used for RNA synthesis. The modified solid support was prepared as follows: Diethyl-2-azabutane-1,4-dicarboxylate AA ##STR1##

[0175] A 4.7 M aqueous solution of sodium hydroxide (50 mL) was added into a stirred, ice-cooled solution of ethyl glycinate hydrochloride (32.19 g, 0.23 mole) in water (50 mL). Then, ethyl acrylate (23.1 g, 0.23 mole) was added and the mixture was stirred at room temperature until the completion of reaction was ascertained by TLC (19 h). After 19 h which it was partitioned with dichloromethane (3.times.100 mL). The organic layer was dried with anhydrous sodium sulfate, filtered and evaporated. The residue was distilled to afford AA (28.8 g, 61%). 3-{Ethoxycarbonylmethyl-[6-(9H-fluoren-9-ylmethoxycarbonyl-amino)-hexanoy- l]-amino}-propionic acid ethyl ester AB ##STR2##

[0176] Fmoc-6-amino-hexanoic acid (9.12 g, 25.83 mmol) was dissolved in dichloromethane (50 mL) and cooled with ice. Diisopropylcarbodiimde (3.25 g, 3.99 mL, 25.83 mmol) was added to the solution at 0.degree. C. It was then followed by the addition of Diethyl-azabutane-1,4-dicarboxylate (5 g, 24.6 mmol) and dimethylamino pyridine (0.305 g, 2.5 mmol). The solution was brought to room temperature and stirred further for 6 h. the completion of the reaction was ascertained by TLC. The reaction mixture 1 5 was concentrated in vacuum and to the ethylacetate was added to precipitate diisopropyl urea. The suspension was filtered. The filtrate was washed with 5% aqueous hydrochloric acid, 5% sodium bicarbonate and water. The combined organic layer was dried over sodium sulfate and concentrated to give the crude product which was purified by column chromatography (50% EtOAC/Hexanes) to yield 11.87 g (88%) of AB. 3-[(6-Amino-hexanoyl)-ethoxycarbonylmethyl-amino]-propionic acid ethyl ester AC ##STR3##

[0177] 3-{Ethoxycarbonylmethyl-[6-(9H-fluoren-9-ylmethoxycarbonylamino)-h- exanoyl]-amino}-propionic acid ethyl ester AB (11.5 g, 21.3 mmol) was dissolved in 20% piperidine in dimethylformamide at 0.degree. C. The solution was continued stirring for 1 h. The reaction mixture was concentrated in vacuum and the residue water was added and the product was extracted with ethyl acetate. The crude. product was purified by converting into hydrochloride salt. 3-({6-[17-(1,5-Dimethyl-hexyl)-10,13-dimethyl-2,3,4,7,8,9,10,11,12,13,14,- 15,16,17-tetradecahydro-1H-cyclopenta[a]phenanthren-3-yloxycarbonylamino]-- hexanoyl}ethoxycarbonylmethyl-amino)-propionic acid ethyl ester AD ##STR4##

[0178] The hydrochloride salt of 3-[(6-Amino-hexanoyl)-ethoxycarbonylmethyl-amino]-propionic acid ethyl ester AC (4.7 g, 14.8 mmol) was taken up in dichloromethane. The suspension was cooled to 0.degree. C. on ice. To the suspension diisopropylethylamine (3.87 g, 5.2 mL, 30 mmol) was added. To the resulting solution cholesteryl chloroformate (6.675 g, 14.8 mmol) was added. The reaction mixture was stirred overnight. The reaction mixture was diluted with dichloromethane and washed with 10% hydrochloric acid. The product was purified by flash chromatography (10.3 g, 92%). 1-{6-[17-(1,5-Dimethyl-hexyl)-10,13-dimethyl-2,3,4,7,8,9,10,11,12,13,14,1- 5,16,17-tetradecahydro-1H-cyclopenta[a]phenanthren-3-yloxycarbonylamino]-h- exanoyl}-4-oxo-pyrrolidine-3-carboxylic acid ethyl ester AE ##STR5##

[0179] Potassium t-butoxide (1.1 g, 9.8 mmol) was slurried in 30 mL of dry toluene. The mixture was cooled to 0.degree. C. on ice and 5 g (6.6 mmol) of diester AD was added slowly with stirring within 20 mins. The temperature was kept below 5.degree. C. during the addition. The stirring was continued for 30 mins at 0.degree. C. and 1 mL of glacial acetic acid was added, immediately followed by 4 g of NaH.sub.2PO.sub.4.H.sub.2O in 40 mL of water The resultant mixture was extracted twice with 100 mL of dichloromethane each and the combined organic extracts were washed twice with 10 mL of phosphate buffer each, dried, and evaporated to dryness. The residue was dissolved in 60 mL of toluene, cooled to 0.degree. C. and extracted with three 50 mL portions of cold pH 9.5 carbonate buffer. The aqueous extracts were adjusted to pH 3 with phosphoric acid, and extracted with five 40 mL portions of chloroform which were combined, dried and evaporated to a residue. The residue was purified by column chromatography using 25% ethylacetate/hexane to afford 1.9 g of b-ketoester (39%). [6-(3-Hydroxy-4-hydroxymethyl-pyrrolidin-1-yl)-6-oxo-hexyl]-carbamic acid 17-(1,5-dimethyl-hexyl)-10,13-dimethyl-2,3,4,7,8,9,10,11,12,13,14,15,16,1- 7-tetradecahydro-1H-cyclopenta[a]phenanthren-3-yl ester AF ##STR6##

[0180] Methanol (2 mL) was added dropwise over a period of 1 h to a refluxing mixture of b-ketoester AE (1.5 g, 2.2 mmol) and sodium borohydride (0.226 g, 6 mmol) in tetrahydrofuran (10 mL). Stirring was continued at reflux temperature for 1 h. After cooling to room temperature, 1 N HCl (12.5 mL) was added, the mixture was extracted with ethylacetate (3.times.40 mL). The combined ethylacetate layer was dried over anhydrous sodium sulfate and concentrated in vacuum to yield the product which was purified by column chromatography (10% MeOH/CHCl.sub.3) (89%). (6-{3-[Bis-(4-methoxy-phenyl)-phenyl-methoxymethyl]-4-hydroxy-py- rrolidin-1-yl}-6-oxo-hexyl)-carbamic acid 17-(1,5-dimethyl-hexyl)-10,13-dimethyl-2,3,4,7,8,9,10,11,12,13,14,15,16,1- 7-tetradecahydro-1H-cyclopenta[a]phenanthren-3-yl ester AG ##STR7##

[0181] Diol AF (1.25 gm 1.994 mmol) was dried by evaporating with pyridine (2.times.5 mL) in vacuo. Anhydrous pyridine (10 mL) and 4,4'-dimethoxytritylchloride (0.724 g, 2.13 mmol) were added with stirring. The reaction was carried out at room temperature overnight. The reaction was quenched by the addition of methanol. The reaction mixture was concentrated in vacuum and to the residue dichloromethane (50 mL) was added. The organic layer was washed with IM aqueous sodium bicarbonate. The organic layer was dried over anhydrous sodium sulfate, filtered and concentrated. The residual pyridine was removed by evaporating with toluene. The crude product was purified by column chromatography (2% MeOH/Chloroform, Rf=0.5 in 5% MeOH/CHCl.sub.3) (1.75 g, 95%). Succinic acid mono-(4-[bis-(4-methoxy-phenyl)-phenyl-methoxymethyl]-1-{6-[17-(1,5-- dimethyl-hexyl)-10,13-dimethyl 2,3,4,7,8,9,10,11,12,13,14,15,16,17-tetradecahydro-1H cyclopenta[a]phenanthren-3-yloxycarbonylamino]-hexanoyl}-pyrrolidin-3-yl) ester AH ##STR8##

[0182] Compound AG (1.0 g, 1.05 mmol) was mixed with succinic anhydride (0.150 g, 1.5 mmol) and DMAP (0.073 g, 0.6 mmol) and dried in a vacuum at 40.degree. C. overnight. The mixture was dissolved in anhydrous dichloroethane (3 mL), triethylamine (0.318 g, 0.440 mL, 3.15 mmol) was added and the solution was stirred at room temperature under argon atmosphere for 16 h. It was then diluted with dichloromethane (40 mL) and washed with ice cold aqueous citric acid (5 wt %, 30 mL) and water (2.times.20 mL). The organic phase was dried over anhydrous sodium sulfate and concentrated to dryness. The residue was used as such for the next step. Cholesterol Derivatised CPG AI ##STR9##

[0183] Succinate AH (0.254 g, 0.242 mmol) was dissolved in a mixture of dichloromethane/acetonitrile (3:2, 3 mL). To that solution DMAP (0.0296 g, 0.242 mmol) in acetonitrile (1.25 mL), 2,2'-Dithio-bis(5-nitropyridine) (0.075 g, 0.242 mmol) in acetonitrile/dichloroethane (3:1, 1.25 mL) were added successively To the resulting solution triphenylphosphine (0.064 g, 0.242 mmol) in acetonitrile (0.6 ml) was added. The reaction mixture turned bright orange in color. The solution was agitated briefly using wrist-action shaker (5 mins). Long chain alkyl amine-CPG (LCAA-CPG) (1.5 g, 61 mm/g) was added. The suspension was agitated for 2 h. The CPG was filtered through a sintered finnel and washed with acetonitrile, dichloromethane and ether successively. Unreacted amino groups were masked using acetic anhydride/pyridine. The loading capacity of the CPG was measured by taking UV measurement (37 mM/g).

[0184] The synthesis and structure of cholesterol conjugated RNA strands is illustrated in FIG. 1.

[0185] The siRNAs listed Table 3 were synthesized for activity screening. TABLE-US-00003 TABLE 3 siRNAs specific for RhoA SEQ SEQ Agent ID ID C. a. number Sense strand NO. Antisense strand NO. #.sup.1 AL-DP-5850 gauuaugaccgucugaggcTT 1081 gccucagucggucauaaucTT 1082 n.a. AL-DP-5851 ggaucuucggaaugaugagTT 1083 cucaucauuccgaagauccTT 1084 n.a. AL-DP-5852 agaccaaagacggagugagTT 1085 cucacuccgucuuuggucuTT 1086 na. AL-DP-5853 ugaagcaggagccgguaaaTT 1087 uuuaccggcuccugcuucaTT 1088 na. AL-DP-5972 gcmumacmcmagumaumumumagaagcmTT 1089 gcuucumaaaumacuggumagcTT 1090 6661 AL-DP-5973 cmumacmcmagumaumumumagaagcmcmTT 1091 ggcuucumaaaumacuggumagTT 1092 6662 AL-DP-5974 gcmumgumaacmumacmumumumaumaacmTT 1093 guumaumaaagumaguumacmagcTT 1094 6712 AL-DP-5975 gumumacmumgumgumaaumumagumgcmTT 1095 gcmacumaauumacmacmagumaacTT 1096 6751 AL-DP-5976 cmcmacmumumaaumgumaumgumumacmcmTT 1097 ggumaacmaumacmauumaaguggTT 1098 6769 AL-DP-5977 cmagcmcmcmumgaumagumumumagaaTT 1099 uucumaaacumaucmagggcugTT 1100 6521 AL-DP-5978 gcmcmcmumgaumagumumumagaaaaTT 1101 uuuucumaaacumaucmagggcTT 1102 6523 AL-DP-5979 cmcmcmumgaumagumumumagaaaacmTT 1103 guuuucumaaacumaucmagggTT 1104 6524 AL-DP-5980 gaumagumumumagaaaacmaumcmcmTT 1105 ggauguuuucumaaacumaucTT 1106 6528 AL-DP-5981 umagumumumagaaaacmaumcmcmcmaTT 1107 ugggauguuuucumaaacumaTT 1108 6530 AL-DP-5982 cmagacmumagaumgumagumaumumumTT 1109 aaaumacumacmaucumagucugTT 1110 6790 AL-DP-5983 cmcmcmcmagacmumagaumgumagumaTT 1111 umacumacmaucumagucuggggTT 1112 6787 AL-DP-5984 cmcmagacmumagaumgumagumaumumTT 1113 aaumacumacmaucumagucuggTT 1114 6789 AL-DP-5985 cmcmcmagacmumagaumgumagumaumTT 1115 aumacumacmaucumagucugggTT 1116 6788 AL-DP-5986 umgcmacmumumaaumgumaumgumumaTT 1117 umaacmaumacmauumaaguggcmaTT 1118 6767 AL-DP-5987 umgcmumgumumumaumumaaumcmumumagTT 1119 cumaagauumaaumaaacmagcmaTT 1120 6614 AL-DP-5988 umcmaumgumumagumumacmcmumumaumaTT 1121 umaumaaggumaacumaacmaugaTT 1122 6732 AL-DP-5989 cmcmagumumaaumumumumumcmcmaacmumTT 1123 aguuggaaaaauumaacuggTT 1124 6832 AL-DP-5990 umacmcmumaagaumumacmaaaumcmaTT 1125 ugauuugumaaucuumaggumaTT 1126 6650 AL-DP-5991 umcmumumgcmumacmcmagumaumumumagTT 1127 cumaaaumacuggumagcmaagaTT 1128 6657 AL-DP-5992 umgumgumaaumumagumgcmcmacmumumTT 1129 aaguggcmacumaauumacmacmaTT 1130 6756 AL-DP-5993 aumcmumumgcmumacmcmagumaumumumaTT 1131 umaaaumacuggumagcmaagauTT 1132 6656 AL-DP-5994 cmumgumaacmumacmumumumaumaacmumTT 1133 aguumaumaaagumaguumacmagTT 1134 6713 AL-DP-5995 gumgaaumumaggcmumgumaacmumaTT 1135 umaguumacmagccumaauucmacTT 1136 6703 AL-DP-6176 cmumacmcmagumaumumumagaagcmcmTT-Chol 1137 ggcuucumaaaumacuggumagTT 1138 6662 AL-DP-6177 umgcmumgumumumaumumaaumcmumumagTT-Chol 1139 cumaagauumaaumaaacmagcmaTT 1140 6614 .sup.1C. a. # = corresponding agent # in Table 2. The agent given under this agent number in Table 3 possesses the same core nucleotide sequence when nucleotide modifications, e.g. 2'-O-methyl modifications and phosphorothioate linkages, are disregarded

Example 3

siRNA Activity Testing

[0186] The ability of the iRNA agents represented in Table 3 to inhibit the expression of human RhoA was tested in human cell lines expressing the respective gene product from an expression construct, or in cell lines constitutively expressing the respective gene product. The iRNA agent is transfected into the cells, e.g., by transfection or electroporation, allowed to act on the cells for a certain time, e.g., 24 hours, and levels of RhoA expression were determined by measurement of RhoA mRNA concentrations in cell lysates. These expression levels were then compared to RhoA expression levels in cells treated equivalently but without addition of the iRNA agent, or to expression levels of housekeeping genes (e.g. GAPDH), and the ability of the iRNA agents representend in Table 3 to inhibit the expression of human RhoA thereby assessed.

Screening for Inhibition of RhoA Expression

[0187] One day before transfection, Neuroscreen-1 cells (Cellomics Inc., Pittsburgh, USA) were seeded at 1.5.times.10.sup.4 cells/well on 96-well collagen-coated plates (Greiner Bio-One GmbH, Frickenhausen, Germany) in 100 .mu.l of growth medium (RPMI 1640, 10% horse serum, 5% fetal calf serum, 100 u penicillin/100 .mu.g/ml streptomycin, 2 mM L-glutamine, Biochrom AG, Berlin, Germany). Transfections were performed in triplicates. For each well 0.5 .mu.l Lipofectamine2000 (Invitrogen GmbH, Karlsruhe, Germany) were mixed with 12 .mu.l Opti-MEM (Invitrogen) and incubated for 15 min at room temperature. 2 .mu.l of a 5 .mu.M solution of siRNA in annealing buffer (20 mM sodium phosphate, pH 6.8; 100 mM sodium chloride) were mixed with 10.5 .mu.l Opti-MEM per well, combined with the Lipofectamine2000-Opti-MEM mixture and again incubated for 15 minutes at room temperature. During this incubation, growth medium was removed from cells and replaced by 75 .mu.l/well of fresh medium. The 25 .mu.l solution of siRNA-Lipofectamine2000-complex were added, resulting in an overall 100 nM siRNA concentration in the 100 .mu.l incubation volume, and the cells were incubated for 24 h at 37.degree. C. and 5% CO.sub.2 in a humidified incubator (Heraeus GmbH, Hanau).

[0188] mRNA levels in cell lysates were quantitated by a commercially available branched DNA hybridization assay (QuantiGene bDNA-kit, Genospectra, Fremont, USA). Cells were harvested by applying 50 .mu.l additional growth medium and 75 .mu.l of Lysis Mixture (from QuantiGene bDNA-kit) to each well and were lysed at 53.degree. C. for 30 min. 50 .mu.l of the lysates were incubated with probes specific to rat RhoA and rGAPDH (sequence of probes given in Table 4 and Table 5) according to the manufacturer's protocol for the QuantiGene bDNA kit assay. Finally, chemoluminescence was measured in a Victor2-Light (Perkin Elmer, Wiesbaden, Germany) as RLUs (relative light units) and values obtained with RhoA probes were normalized to the respective GAPDH values for each well. Mock transfected cells (following the same protocol except that no siRNA was added) served as controls and forcomparison of mRNA levels.

[0189] Effective siRNAs from the screen were further characterized by establishment of dose response curves and calculation of IC.sub.50 concentrations (the concentration at which 50% inhibition of gene expression would be observed). For dose response assessment, transfections were performed at the following concentrations: 100 nM, 33.3 nM, 11.1 nM, 3.7 nM, 1.2 nM, 0.4 nM, 137 pM, 46 pM, 15 pM, 5 pM and mock (no siRNA) by serially diluting the 5 .mu.M siRNA stock solution with annealing buffer and using 2 .mu.l of the diluted stock according to the above protocol. The IC.sub.50 was determined by curve fitting using the computer software Xlfit using the following parameters: Dose Response One Site, 4 Parameter Logistic Model, fit=(A+((B-A)/(1+(((10 AC)/x) D)))), inv=((10 C)/((((B-A)/(y-A))-1) (1/D))), res=(y-fit). TABLE-US-00004 TABLE 4 Rat RhoA probes SEQ Probe ID type.sup.1 Nucleotide sequence NO. CE CCATTTTTCTGGGATGTTTTCTAAATTTTTCTCTTGGAA 1141 AGAAAGT CE ACAGAAATGCTTGACTTCTGGAGTTTTTTCTCTTGGAAA 1142 GAAAGT CE CTTCAGGTTTTACCGGCTCCTTTTTCTCTTGGAAAGAAA 1143 GT CE CTGTTTGCCATATCTCTGCCTTTTTTTCTCTTGGAAAGA 1144 AAGT CE TTGGTCTTTGCTGAACACTCCATTTTTCTCTTGGAAAGA 1145 AAGT CE CCCGCGTCTAGCTTGCAGATTTTTCTCTTGGAAAGAAAG 1146 T LE AGGATGATGGGCACATTTGGTTTTTAGGCATAGGACCCG 1147 TGTCT LE GCCTTGTGTGCTCATCATTCCTTTTTAGGCATAGGACCC 1148 GTGTCT LE TGCTTCATTTTGGCTAACTCCCTTTTTAGGCATAGGACC 1149 CGTGTCT LE TGTACCCAAAAGCGCCAATCTTTTTAGGCATAGGACCCG 1150 TGTCT LE GCAGCTCTCGTGGCCATCTTTTTTAGGCATAGGACCCGT 1151 GTCT LE AGGCACCCCGACTTTTTCTTTTTTTAGGCATAGGACCCG 1152 TGTCT BL CTATCAGGGCTGTCGATGGAA 1153 BL GAAGATCCTTCTTGTTCCCAACT 1154 BL CAAAAACCTCTCTCACTCCGTCT 1155 .sup.1CE = Capture Extender probe; LE = Label Extender probe; BL = blocking probe

[0190] TABLE-US-00005 TABLE 5 Rat GAPDH probes SEQ Probe ID type.sup.1 Nucleotide sequence NO. CE CCAGCTTCCCATTCTCAGCCTTTTTCTCTTGGAAAGAAA 1156 GT CE TCTCGCTCCTGGAAGATGGTTTTTTCTCTTGGAAAGAAA 1157 GT CE CCCATTTGATGTTAGCGGGATTTTTCTCTTGGAAAGAAA 1158 GT CE CGGAGATGATGACCCTTTTGGTTTTTCTCTTGGAAAGAA 1159 AGT LE GATGGGTTTCCCGTTGATGATTTTTAGGCATAGGACCCG 1160 TGTCT LE GACATACTCAGCACCAGCATCACTTTTTAGGCATAGGAC 1161 CCGTGTCT LE CCCAGCCTTCTCCATGGTGGTTTTTAGGCATAGGACCCG 1162 TGTCT BL TTGACTGTGCCGTTGAACTTG 1163 BL CCCCACCCTTCAGGTGAGC 1164 BL GGCATCAGCGGAAGGGG 1165 .sup.1CE = Capture Extender probe; LE = Label Extender probe; BL = blocking probe

[0191] Table 6 lists the agent number, the position of the nucleotide within the human RhoA mRNA sequence (Genbank accession number NM.sub.--001664) corresponding to the 5'-most nucleotide of the sense strand of the agent, the amount of total RhoA mRNA remaining in cells treated with the agent at 100 nM concentration in % of controls, and the IC.sub.50 value for selected agents. TABLE-US-00006 TABLE 6 Ability of siRNAs specific for RhoA to reduce RhoA mRNA levels in cultured cells Rem. RhoA mRNA at Rem. RhoA 100 nM mRNA at 100 nM Agent Pos. in agent, agent, second IC.sub.50 RhoA number mRNA.sup.1 first screen screen [nM] AL-DP-5850 73 .+-. 8% 142 AL-DP-5852 17 .+-. 4% 3.1 AL-DP-5853 18 .+-. 3% 2.8 AL-DP-5854 17 .+-. 1% 4.2 AL-DP-5972 986 30 .+-. 9% 17 .+-. 2% AL-DP-5973 987 21 .+-. 2% 15 .+-. 1% 0.003 AL-DP-5974 1179 44 .+-. 12% 48 .+-. 2% AL-DP-5975 1395 33 .+-. 4% 27 .+-. 10% AL-DP-5976 1413 26 .+-. 3% 17 .+-. 2% AL-DP-5977 537 n.d. 30 .+-. 1% AL-DP-5978 539 58 .+-. 4% 51 .+-. 1% AL-DP-5979 540 12 .+-. 2% 15 .+-. 2% 0.06 AL-DP-5980 544 75 .+-. 3% 95 .+-. 3% AL-DP-5981 546 17 .+-. 2% 16 .+-. 1% 0.13 AL-DP-5982 1452 18 .+-. 2% 22 .+-. 2% 0.13 AL-DP-5983 1449 37 .+-. 4% 29 .+-. 3% AL-DP-5984 1451 26 .+-. 1% 33 .+-. 4% AL-DP-5985 1450 n.d. 33 .+-. 1% 0.37 AL-DP-5986 1411 18 .+-. 1% 22 .+-. 1% 0.4 AL-DP-5987 901 22 .+-. 5% 10 .+-. 0% 0.01 AL-DP-5988 1376 17 .+-. 1% 16 .+-. 1% 0.34 AL-DP-5989 1876 20 .+-. 1% 25 .+-. 3% 3.1 AL-DP-5990 956 16 .+-. 2% 17 .+-. 1% 0.36 AL-DP-5991 982 55 .+-. 5% 33 .+-. 5% AL-DP-5992 1400 55 .+-. 6% 55 .+-. 6% AL-DP-5993 981 32 .+-. 2% 33 .+-. 3% AL-DP-5994 1180 23 .+-. 2% 20 .+-. 1% 0.24 AL-DP-5995 1170 25 .+-. 2% 26 .+-. 2% 6.0 AL-DP-6176 987 14 .+-. 2% 1.17 AL-DP-6177 901 19 .+-. 5% 0.005 .sup.1Position of nucleotide within human Nogo-R mRNA corresponding to the 5'-most nucleotide of the sense strand of the agent

[0192] In summary, agents AL-DP-5979, AL-DP-5990, AL-DP-5988, AL-DP-5981, AL-DP-5982, AL-DP-5986, AL-DP-5989 AL-DP-6176, and AL-DP-6177 were able to reduce the expression of RhoA mRNA by 80% or more, AL-DP-5973, AL-DP-5987, AL-DP-5994, AL-DP-5995, AL-DP-5976, AL-DP-5984, and AL-DP-5972 were able to reduce the expression of RhoA mRNA by 70% or more, AL-DP-5993, AL-DP-5975, and AL-DP-5983 were able to reduce the expression of RhoA mRNA by 60% or more, AL-DP-5974 was able to reduce the expression of RhoA mRNA by 50% or more, and AL-DP-5991, AL-DP-5992, and AL-DP-5978 were able to reduce the expression of RhoA mRNA by 40% or more. The high activity of AL-DP-6176 and AL-DP-6177 shwos that a cholesteryl moiety may be conjugated to the 3'-end of the sense strand of an siRNA without significant loss of activity. AL-DP-6176 and AL-DP-6177 are identical to AL-DP-5973 and AL-DP-5987, respectively, except for the 3'-conjugated cholesteryl moiety on the sense strand.

Example 4

Stability Testing

[0193] In order to verify the stability of siRNAs in the biological matrix most relevant to their intended physiological application, cerebrospinal fluid (CSF), we established a method for determining the degradation half life of siRNAs in this medium. This method comprises the incubation of siRNAs with CSF followed by Proteinase K treatment of the CSF sample and the separation of CSF sample constituents on an HPLC.

[0194] The example below shows the analyses of CSF samples which were contacted with siRNAs in vitro. However, this method can equally be applied to biological samples ex vivo, i.e. obtained from a subject which was contacted with an siRNA in vivo.

[0195] Bovine CSF was obtained from a calf (Bos bovis), age 6 months (Prof. Dr. J. Rehage, University of Veterinary Medicine Hannover, Foundation, Hannover, Germany). Porcine CSF was pooled from 3 healthy weaner pigs (Sus scrofa domesticus), age 3-4 months (Prof. Dr. M. Wendt, University of Veterinary Medicine Hannover, Foundation, Hannover, Germany). Rat CSF was pooled from 20 male Sprague Dawley rats (Rattus norvegicus), 175-200 g in weight (Charles River Laboratories, L'Arbresle Cedex, France). Proteinase K (20 mg/ml) was obtained from peQLab (Erlangen, Germany; Cat.-No. 04-1075) and diluted 1:1 with deionized water (18.2 m.OMEGA.) to a final concentration of 10 mg/ml Proteinase K. Proteinase K Buffer (4.0 ml TRIS-HCl 1M pH 7.5, 1.0 ml EDTA 0.5M, 1.2 ml NaCl 5M, 4.0 ml SDS 10%) was prepared fresh and kept at 50.degree. C. until use to avoid precipitation.

[0196] A 40 mer of poly(L-dT), (L-dT).sub.40 was obtained from Noxxon Pharma AG (Berlin, Germany) and used as an internal standard. Polymers of the L-enantiomers of nucleic acids show an extraordinary stability towards nucleolytic degradation (Klussman S, et al., Nature Biotechn. 1996, 14:1112) but otherwise very similar properties when compared to naturally occuring nucleic acids consisting of R-enantiomers.

Proteinase K Treatment of siRNA Incubation Samples

[0197] 6 .mu.l of a 50 .mu.M solution of the respective siRNA in phosphate buffered saline (PBS, Sigma-Aldrich Chemie GmbH, Taufkirchen, Germany) was incubated with 54 .mu.l CSF at 37.degree. C. for 30 min, 1, 2, 4, 8, 16, 24 or 48 hours. To terminate the siRNA-degradation, 25 .mu.l of Proteinase K buffer were added to incubation samples immediately after expiry of the respective incubation period, the mixture vortexed at highest speed for 5 s (Vortex Genie 2, Scientific Industries, Inc., Bohemia, N.Y., USA, cat. no. SI 0256), 8 .mu.l Proteinase K (10 mg/ml) were added followed by vortexing for 5 s, and finally the mixture was incubated for 20 min in a thermomixer at 42.degree. C. and 1050 rpm.

[0198] 5 .mu.l of a 50 .mu.M solution (250 pmole) of (L-dT).sub.40 were added as an internal standard to each well, the solution was vortexed for 5 s, and the tube centrifuged for 1 min in a tabletop centrifuge to collect all droplets clinging to the inner surfaces of the wells at the bottom. The solution was transferred to a 96 well Captiva 0.2 .mu.m filter plate (Varian, Germany, Cat. No. A5960002) and filtered by centrifugation at 21900 rcf for 45 min.

[0199] The incubation wells were washed with 47.5 .mu.l deionized water (18.2 m.OMEGA.), the wash filtered through the Captiva Filter Unit at 21900 rcf for 15 min, and the wash step repeated. Approximately 180 .mu.l of the theoretical total volume of 200 .mu.l are on average recovered after the second washing step.

Ion exchange chromatographic separation of siRNA single strands from each other and from degradation products:

[0200] A Dionex BioLC HPLC-system equipped with inline-degasser, autosampler, column oven and fixed wavelength UV-detector (Dionex GmbH, Idstein, Germany) was used under denaturing conditions. Standard run parameters were: TABLE-US-00007 Column: Dionex DNA-Pac100; 4 .times. 250 mm Temperature: 75.degree. C. Eluent A: 10 mM NaClO.sub.4, 20 mM TRIS-HCl, 1 mM EDTA; 10% acetonitrile, pH = 8.0 Eluent B: 800 mM NaClO.sub.4, 20 mM TRIS-HCl, 1 mM EDTA; 10% acetonitrile, pH = 8.0 Detection: @ 260 nm Gradient: 0-1 min: 10% B 1-11 min: 10% -> 35% B 11-12 min: 35% B -> 100% B 12-14 min: 100% B -> 10% B 14-16 min: 10% B for column reequilibration Injection volume: 20 .mu.l

[0201] Where separation between the two strands of an siRNA was not satisfactory or a degradation fragment co-eluted with one strand, the chromatographic parameters were adjusted by changing temperature, pH, replacement of NaClO.sub.4 by NaBr, the concentration of acetonitrile, and/or adjusting the slope of the eluent gradient until separation was achieved which allowed separate quantitation of the peaks from sense and antisense strand.

[0202] Peak areas for full length strands were obtained by integration of the UV detector signal using software supplied by the manufacturer of the instrument (Chromeleon 6.6; Dionex GmbH, Idstein, Germany).

Data Analysis:

[0203] Integrated sense strand, antisense strand, and internal standard peak areas were obtained for all samples and the normalization control.

[0204] A correction factor CF, accounting for liquid losses in the filtration and washing steps, was determined for every sample by calculating the ratio of experimental to theoretical internal standard peak area. The theoretical internal standard peak area is obtained, e.g. from a calibration curve of the internal standard obtained by injecting 50 .mu.l each of a serial dilution of the 50 .mu.M solution of (L-dT).sub.40 onto the HPLC column, and calculation of the theoretical peak area corresponding to 25 pmole (L-dT).sub.40 with the equation obtained by linear least square fit to the peak areas from the dilution series. The correction factor CF to be applied to the peak areas of the sense and antisense strand is the obtained as: CF=PeakArea.sub.intStd(theoretical)/PeakArea.sub.intStd(Sample)

[0205] This treatment assumes that, by virtue of washing the filter twice, virtually complete recovery is achieved in the combined filtrates, and corrects for the variable volume of wash water retained in the filter, such that peak areas from different samples can be compared.

[0206] The peak areas obtained for the sense and antisense strand peaks for each time point are then multiplied with the correction factor CF to obtain Normalized Peak Areas (NPA.sub.sense,t, NPA.sub.antisense,t): NPA.sub.sense or antisense,t=(Peak Area.sub.sense or antisense,t).times.CF

[0207] To obtain the relative amount of remaining Full Length Product (% FLP) for the sense and antisense strands at time t, the Normalized Peak Area for each strand at time t=0 min (NPA.sub.sense,t=0, NPA.sub.antisense,t=0) is set as 100%, and the NPAs from other time points are divided by these values. % FLP.sub.t=1, 2, 3 . . . n=(NPA.sub.t=1, 2, 3 . . . n/NPA.sub.t=0)*100

[0208] The value obtained from the control sample, where the siRNA was incubated with annealing buffer only, may serve as a control of the accuracy of the method. The % FLP for both strands should lie near 100%, within error margins, regardless of time of incubation.

[0209] The degradation half life t.sub.1/2 may then be calculated for each strand, assuming first order kinetics, from the slope of a linear least square fit to a plot of ln(% FLP) versus time as: t.sub.1/2=ln(0,5)/slope Stability of siRNAs Specific for NogoL and RhoA in Rat, Bovine and Porcine CSF

[0210] Table 7 shows the results for select siRNAs of the determination of the relative amount of full length dsRNA present in porcine, rat, and bovine CSF, and PBS, after 48 h of incubation in the respective medium. In addition, the degradation half life was determined for the sense and antisense strands separately for some siRNAs. TABLE-US-00008 TABLE 7 Stability of various siRNAs specific for NogoL and RhoA in rat, bovine and porcine CSF % full length duplex present after 48 h in Agent Porcine Rat Bovine Specific Modifi- C.a. number CSF CSF CSF PBS for cation.sup.1 #.sup.2 AL-DP-5973 95 3 95 100 RhoA 3/TTs 6662 AL-DP-5979 99 108 RhoA 3/TTs 6524 AL-DP-5981 96 103 RhoA 3/TTs 6530 AL-DP-5982 56 98 RhoA 3/TTs 6790 AL-DP-5986 100 105 RhoA 3/TTs 6767 AL-DP-5987 87 97 RhoA 3/TTs 6614 AL-DP-5988 41 99 RhoA 3/TTs 6732 AL-DP-5989 87 101 RhoA 3/TTs 6832 AL-DP-5990 76 92 RhoA 3/TTs 6650 .sup.10 = no 2'-modifications; 1 = 5'-nucleotide in 5'-ua-3', 5'-uu-3', 5'-ca-3', and 5'-ug-3' motifs is 2'-modified in sense strand, 5'-nucleotide in 5'-ua-3' and 5'-ca-3' motifs is 2'-modified in antisense strand; 2 = 5'-nucleotide in 5'-ua-3', 5'-uu-3', 5'-ca-3', and 5'-ug-3' motifs is # 2'-modified in sense and antisense strand, 3 = all pyrmidine nucleotides are 2'-modified in sense strand, 5'-nucleotide in 5'-ua-3' and 5'-ca-3' motifs is 2'-modified in antisense strand; 4 = all pyrimidine nucleotides are 2'-modified in sense strand, # 5'-nucleotide in 5'-ua-3', 5'-uu-3', 5'-ca-3', and 5'-ug-3' motifs is 2'-modified in antisense strand; 5 = all pyrimidine nucleotides are 2'-modified in sense strand, no 2'-modifications in antisense strand; TT = 21 nucleotides and 3'-terminal TT single strand overhangs in sense and antisense strands; TTs = 21 nucleotides and 3'-terminal # TT single strand overhangs in sense and antisense strands; 23 = 21 nucleotide sense, 23 nucleotide antisense strand, 2 nucleotide single strand overhang on 3'-end of antisense strand; 23s = 21 nucleotide sense, 23 nucleotide antisense strand, 2 nucleotide single strand overhang on 3'-end of antisense strand, nucleotides comprise 5'-phosphorothioate groups in positions 21 and 22 of antisense strand .sup.2C.a. # = corresponding agent # in Table 2. The agent given under this agent number in Table 2 possesses the same core nucleotide sequence when nucleotide modifications, e.g. 2'-O-methyl modifications and phosphorothioate linkages, are disregarded

[0211] As is evident from Table 7, the modification of siRNAs in select sites vulnerable to degradation can lead to agents with excellent properties in terms of activity and stability. For example, AL-DP-5871, AL-DP-5938, AL-DP-5963, AL-DP-5973, AL-DP-5979, AL-DP-5981, AL-DP-5986, AL-DP-5987, AL-DP-5989, and AL-DP-5990 all inhibit their respective target gene by more than 70% in the in vitro assays described above, and more than 70% full length duplex remain after incubation with porcine CSF for 48 h. However, there is some indication that rat CSF is more aggressive towards siRNAs than porcine or bovine CSF.

Example 5

Inhibition of RhoA Expression in Rat Primary Dorsal Root Ganglia (DRG) Cells in Culture

[0212] The inhibition of RhoA expression was assessed in rat primary dorsal root ganglia (DRG) cells in culture in order to validate results obtained using Neuroscreen 1 cells as described above.

[0213] DRG cells were isolated from Sprague-Dawley rats at postnatal day 3 to 6. Rats were dissected and cells dissociated into single cells by addition of 1.3 ml (0.28 Wunsch units/ml) Liberase Blendzyme (Roche) in S-MEM (Invitrogen Gibco, Carlsbad Calif., USA) and incubated for 35 min at 37.degree. C. The cell suspension was pre-plated on tissue-culture plates to remove non-neuronal cells. Neurons were then plated onto tissue-culture Biocoat.TM. PDL Poly-D-Lysine/Laminin 96 well plates (BD Biosciences, Bedford Mass., USA) in F12-HAM's Medium containing glutamine (Invitrogen Gibco, Carlsbad Calif., USA) with 5% fetal bovine serum (FBS, heat inactivated) and 5% horse serum (heat inactivated) (both Invitrogen Gibco, Carlsbad Calif., USA) supplemented with 50 ng/ml mouse nerve growth factor 2.5S (NGF; Promega Corp., Madison Wis., USA) and kept at 37.degree. C., 5% CO.sub.2 in a humidified incubator until transfection.

[0214] A rhoA-specific siRNA, agent number AL-DP-5987, was tested in DRG cultures at 200 nM concentration using TransMessenger.TM. Transfection reagent (Qiagen GmbH, Hilden, Germany, cat. no. 301525) which is based on a lipid formulation, specific RNA-condensing reagent (Enhancer R.TM.) and an RNA-condensing buffer (Buffer EC-R.TM.) keeping siRNA:Enhancer R.TM. ratio (.mu.g:.mu.l) constant at 1:2, and siRNA:TransMessenger.TM. ratio (.mu.g:.mu.l) constant at 1:12.

[0215] DRG neurons were transfected 24 h post-plating. For each well 0.52 .mu.l Enhancer R.TM. were first mixed with 13.68 .mu.l Buffer EC-R.TM.. 0.8 .mu.l of a 25 .mu.M solution of AL-DP-5987 (0.26 .mu.g) in annealing buffer (20 mM sodium phosphate, pH 6.8; 100 mM sodium chloride), or 0.8 .mu.l of annealing buffer (siRNA-free control) were added and the mixture incubated for 5 min at RT. 3.12 .mu.l TransMesssenger.TM. Transfection Reagent were diluted with 6.88 .mu.l Buffer EC-R.TM., added to the mixture, and the mixture incubated for another 10 min at room temperature to allow transfection-complex formation. 75 .mu.l serum free F12-HAM's Medium containing glutamine (Invitrogen Gibco, Carlsbad Calif., USA) supplemented with 50 ng/ml NGF 2.5S (Promega Corp., Madison Wis., USA) and 1:50 B27 supplement (Invitrogen Gibco, Carlsbad Calif., USA) were added to the transfection complexes and complete mixing achieved by gently pipetting up and down. The growth medium was removed from the DRG cells, and 90 .mu.l of the above transfection complex mixture were added onto the cells. After 8 h of incubation at 37.degree. C., 5% CO.sub.2 in a humidified incubator supernatant was removed from the cells, fresh F12-HAM's medium containing glutamine supplemented with 5% FBS, 5% horse serum (both Invitrogen Gibco, Carlsbad Calif., USA), 50 ng/ml mouse NGF 2.5S (Promega Corp., Madison Wis., USA) and 1:100 Penicillin/Streptomycin (Invitrogen Gibco, Carlsbad Calif., USA) was added, the cells were incubated for another 16 h at 37.degree. C., 5% CO.sub.2 in a humidified incubator, and rhoA mRNA was quantified.

[0216] RhoA mRNA levels were measured using the QuantiGene.TM. bDNA kit (Genospectra, Fremont, USA) according to manufacturer's protocol. Briefly, the supernatant was removed from the DRG cells, and the cells were lysed by addition of 150 .mu.l of Lysis Working Reagent (1 volume of Lysis Mixture plus 2 volumes of medium) and incubation at 52.degree. C. for 30min. 40 .mu.l of the lysates were incubated at 52.degree. C. for 40 min with the probe sets specific to rat RhoA and rat GAPDH given above in Table 4 and Table 5. Chemoluminescence was read on a Victor.sup.2-Light.TM. (PerkinElmer Life And Analytical Sciences, Inc., Boston Mass., USA) as Relative Light Units (RLU). RLU for RhoA were normalized to GAPDH RLU for each well. Normalized RhoA/GAPDH ratios were then compared to the siRNA-free control, which was set as 100%.

[0217] In several independent experiments, rhoA mRNA was reduced in primary DRG cells treated with AL-DP-5987 in culture consistently to 20-25% of rhoA mRNA levels found in the siRNA free controls.

Example 6

Neurite Outgrowth Assessment in Primary DRG Transfected with Selected iRNA Agents of the Invention

Neuron Dissection

[0218] Dorsal root ganglia (DRG) were isolated from Sprague-Dawley rats at postnatal day 7-12. DRG were dissected into the culture medium (Neurobasal-A supplemented with 1:50 B27, Glutamine, and Pen/Strep; Invitrogen Gibco, Carlsbad Calif., USA), blood was rinsed off with PBS and neurons were dissociated by incubation with 1 mL DMEM/collagenase (0.5%) for 90 minutes at 37.degree. C., inverting the tube every 30 minutes. The collagenase was washed off by serial dilution and the isolated DRG were resuspended in 500 .mu.l of culture medium. The suspension was then triturated 15-20 times with a fire-polished pipette until a homogeneous cell suspension was achieved. Cells were spun down three times for 3 minutes at 1500 RPM, and the cell debris aspirated off. Cells were then resuspended in 500 .mu.l of culture media and passed through a 70 .mu.m strainer (Falcon, 352350). The cell suspension was pre-plated on a 24 well tissue-culture plate in 300 .mu.l of culture media for 24 hours at 37.degree. C., 5% CO2 in a humidified incubator. Neurons were then transfected with appropriate siRNA as follows:

Transfection of siRNA

[0219] For each well, Lipofectamine.TM. 2000 was used and transfections were performed according to the manufacturer's protocol. The appropriate amount of siRNA was diluted into Opti-MEM I Reduced Serum Medium and mixed gently. The Lipofectamine.TM. 2000 was vortexed before use. For each well of a 24 well plate, 1.5 .mu.l was diluted in 25 .mu.l of Opti-MEM I Reduced Serum Medium, mixed gently and incubated for 5 minutes at room temperature. After the 5 minute incubation, 3 .mu.l of the diluted siRNA was combined with the diluted Lipofectamine.TM. 2000 (total volume is 29.5 .mu.l). The complex was mixed gently and incubated for 20 minutes at room temperature to allow the siRNA: Lipofectamine.TM. 2000 complexes to form. 300 .mu.l of Media were added to the transfection complexes and complete mixing was achieved by gently pipetting up and down (total volume: 600 .mu.l). The cells were incubated for another 20-24 h at 37.degree. C., 5% CO2 in a humidified incubator

Outgrowth Assay Plate Preparation

[0220] Chondroitin sulfate proteoglycan (CSPG) or myelin was dried down overnight in 50 .mu.l in individual wells of a biocoat Poly-D-Lysine plate (BD Biosciences, Bedford Mass., USA). The plate was rinsed once with water to remove salt deposits. laminin (Invitrogen, CA; 1 .mu.g/ml) was then coated for 1 h at room temperature.

Replating of the Neurons

[0221] Neurons were resuspended from the 24 well plate by gently pipetting up and down, spun down at 1500 RPM for 3 minutes and resuspended in the appropriate volume. Neurons were replated at a concentration of 3000 neurons/well onto the prepared Poly-D-Lysine/Laminin 96-well plates in culture medium. The neurons were allowed to grow for 16-24 hours at 37.degree. C., 5% CO2 in a humidified incubator and subjected to neurite quantification as follows.

Neurite Quantification

[0222] The cells were fixed in 4% formaldehyde, 20% sucrose in PBS for 15 minutes. The cells were rinsed once with PBS, permeabilized and blocked for an hour at room temperature using 0.1% Triton, 10% Goat serum in PBS. The cells were stained with a beta-III tubulin, polyclonal rabbit antibody (Covance, 1:500) diluted in PBS and incubated overnight at 4.degree. C. After three 5 minutes rinses in PBS, the secondary Alexa-Fluor 488 goat anti-rabbit IgG antibody (Molecular Probes, 1:500 filtered through 0.22 um) was incubated overnight at 4.degree. C. Following 3 rinses in PBS, neurite outgrowth was quantified using an automated cellular imaging and analysis system (Axon Instrument, Union City, Calif.).

Results

[0223] Two iRNA agents specific for the green fluorescent protein gene (AL-DP 5549, AL-DP 5266; nucleic acid sequences in Table 8) were used as controls. TABLE-US-00009 TABLE 8 Nucleic acid sequences of control iRNA agents specific for the green fluorescent protein gene SEQ SEQ Agent ID ID number Sense strand NO. Antisense strand NO. AL-DP-5549 ccacaugaagcagcacgacuu-Chol 1166 aagucgugcugcuucauguggmumc 1167 AL-DP-5266 ccacaugaagcagcacgacuu 1168 aagucgugcugcuucauguggmumc 1169

[0224] The iRNA agent of the invention AL-DP-6176 was tested at a concentration of 250 nM at transfection for its effect on neurite outgrowth on growth substrate supplemented with 0, 40, or 200 ng myelin, and compared to the effect of AL-DP-5266. In Table 9, neurite outgrowth is expressed as percent of neurite outgrowth seen without myelin. Evidently, the green fluorescent protein-specific iRNA agent has no effect on neunte outgrowth of DRG on the inhibitory substrate, while the RhoA-specific iRNA agent strongly counters the growth inhibitory effect of myelin. TABLE-US-00010 TABLE 9 Inhibition of neurite outgrowth by myelin in DRG in the absence or presence of iRNA agents specific for green fluorescent protein (GFP) or RhoA Myelin (ng) no siRNA AL-DP 5266 (GFP) AL-DP 6176 (RhoA) 0 100% 100% 100% 40 82% 75% 183% 200 3% 6% 19%

[0225] Furthermore, the iRNA agents of the invention AL-DP 5973, AL-DP 5987, AL-DP 6176, and AL-DP 6177 were tested at a concentration of 250 nM at transfection for its effect on neurite outgrowth on growth substrate supplemented with 30 ng CSPG, and compared to the effect of AL-DP-5549 and AL-DP-5266. In Table 10, neurite outgrowth is expressed as percent of neurite outgrowth seen without CSPG. Evidently, the green fluorescent protein-specific iRNA agent has no effect on neurite outgrowth of DRG on the inhibitory substrate, while the RhoA-specific iRNA agents counter the growth inhibitory effect of CSPG. TABLE-US-00011 TABLE 10 Inhibition of neurite outgrowth by CSPG in DRG in the absence or presence of iRNA agents specific for green fluorescent protein (GFP) or RhoA Relative outgrowth AL-DP-5549 3 .+-. 2% AL-DP-5266 2 .+-. 1% AL-DP 5266 6 .+-. 2% AL-DP 5973 5 .+-. 2% AL-DP 6176 8 .+-. 4% AL-DP 5987 10 .+-. 5%

Example 7

Assessing Behavioural Improvement by Intrathecal Administration of iRNA Agents of the Invention Following Hemisection Injury

Animals and iRNA Agent Adminstration

[0226] Thirty adult female Sprague-Dawley rats (Charles River Laboratories, Wilmington, Mass., USA; weight 200-230 grams) were randomly divided into 3 groups. One day before the spinal cord lesion surgery, all the animals were trained for locomotor BBB score in an open field. 3 iRNA agents were administered in blinded fashion to the three different groups. Group A being administered a first rhoA-specific iRNA agent (AL-DP-6177), group B receiving a second rhoA-specific iRNA agent (AL-DP-6176), group C as a control group getting the unrelated control iRNA agent, directed against Luciferase (AL-DP-1956, for nucleic acid sequence see Table 11). The iRNA agents were delivered through an osmotic minipump (Alzet 2004, 0.25 .mu.l/hr, 28 day delivery), which was filled with appropriate drug for the groups A, B, C, and pre-incubated overnight at 37.degree. C. before implantation to the animals (described below). The siRNA was released at a dose of 0.4 mg per day for 28 days. TABLE-US-00012 TABLE 11 Nucleic acid sequences of control iRNA agent specific for luciferase SEQ SEQ Agent ID ID number Sense strand NO. Antisense strand NO. AL-DP-5549 cmumumacmgcmumgagumacmumumcmgaTT-Chol 1170 ucgaagumacucmagcgumaagTT 1171

Microsurgery

[0227] For the microsurgery procedure generating the hemisection injury the rats were deeply anesthetized with ketamine (60 mg/kg) and xylazine (10 mg/kg). A complete laminectomy was conducted at spinal level T6-7 under a surgical microscope. The dorsal part of spinal cord was transected with the sharp tip of a 30 gauge needle and a pair of microscissors. The depth of transection (1.85 mm) was confirmed by passing the sharp part of number 11 blade across the dorsal spinal cord for several times with the aid of a stereotaxic (David Kopf Instruments, Tujunga, Calif.). Routinely, the spinal cord was severed past the central canal area (GrandPre, T., et al., Nature 2002, 417:547-551; Li, S., et al., J Neurosci 2004, 24:10511-10520). Rats with an incomplete lesion documented by uninjured dorsal or dorsolateral corticospinal fibers in caudal spinal cord or a less degree of disability (BBB score .gtoreq.5) at two days after injury were excluded.

[0228] For intrathecal administration of the siRNA solutions with the osmotic pumps the dura over the dorsal spinal cord was gently lifted with a pair of microforceps and a small hole was made in the midline with a pair of microscissors at T7 level. The minipump was sutured to the muscles under the skin on the back of the animals. The outlet of the minipump was connected to one end of an intrathecal catheter (PE-60, MS-0040, Marsil Scientific). The other end of the catheter with a small diameter of PE-5 was inserted into the subdura space of spinal cord at T7 level through the small opening made for drug infusion. After pump and catheter implantation, muscle and connective tissue layers were sutured with 4.0 silk. The skin incision was closed with sterile animal clips. The animals received a subcutaneous injection of lactated Ringer's solutions (5% of body weight) immediately after surgery and two times per day for the first two days after injury. Postoperative antibiotics and analgesics were given during the first two days post injury. Bladder expression was performed manually three times per day during the survival period of the animal.

Behavioral Tests

[0229] To monitor the recovery of locomotor functions during and after siRNA treatment after spinal cord hemisection, we used a standard behavioral test, the Basso, Beattie, and Bresnahan (BBB) locomotor rating scale (GrandPre, T., et al., Nature 2002, 417:547-551; Li, S., et al., J Neurosci 2004, 24:10511-10520; Basso, D. M., et al., J Neurotrauma 1995, 12:1-21) to analyze individual components of limp movements, weight support, plantar and dorsal stepping, forelimb-hindlimp coordination, paw rotation, toe clearance, trunk stability, and tail placement. Scores from 0-21 were given based on these observations. The BBB score was evaluated by two individuals unaware of experimental treatments at several time points (Li, S., et al., J Neurosci 2004, 24:10511-10520). In particular, the locomotion was analyzed on day 3, 10, 17, 24, 31 and 45 post hemisection of the spinal cord.

Results

[0230] The obtained BBB score data were plotted by normalizing all the single day score data of the animals to the score at day 10. The group averages of those normalized scores were charted including the error representing the calculated standard error. By this procedure improvements in locomotion from day 10 onwards are shown in FIG. 2. As evident, a significant improvement was obtained by virtue of the treatment with the inventive RhoA-specific iRNA agents over the unrelatred control iRNA agent.

Sequence CWU 1

1

1171 1 23 RNA Artificial Sequence Exemplary iRNA agents 1 ccggaagaaa cuggugauug uug 23 2 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 2 ggaagaaacu ggugauugun n 21 3 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 3 acaaucacca guuucuuccn n 21 4 23 RNA Artificial Sequence Exemplary iRNA agents 4 cggaagaaac uggugauugu ugg 23 5 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 5 gaagaaacug gugauuguun n 21 6 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 6 aacaaucacc aguuucuucn n 21 7 23 RNA Artificial Sequence Exemplary iRNA agents 7 ggaagaaacu ggugauuguu ggu 23 8 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 8 aagaaacugg ugauuguugn n 21 9 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 9 caacaaucac caguuucuun n 21 10 23 RNA Artificial Sequence Exemplary iRNA agents 10 gaagaaacug gugauuguug gug 23 11 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 11 agaaacuggu gauuguuggn n 21 12 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 12 ccaacaauca ccaguuucun n 21 13 23 RNA Artificial Sequence Exemplary iRNA agents 13 aagaaacugg ugauuguugg uga 23 14 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 14 gaaacuggug auuguuggun n 21 15 21 DNA Artificial Sequence misc_feature 20, 21 n = 2'-deoxy-thymidine Exemplary iRNA agents 15 accaacaauc accaguuucn n 21 16 23 RNA Artificial Sequence Exemplary iRNA agents 16 agaaacuggu gauuguuggu gau 23 17 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 17 aaacugguga uuguuggugn n 21 18 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 18 caccaacaau caccaguuun n 21 19 23 RNA Artificial Sequence Exemplary iRNA agents 19 gaaacuggug auuguuggug aug 23 20 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 20 aacuggugau uguuggugan n 21 21 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 21 ucaccaacaa ucaccaguun n 21 22 23 RNA Artificial Sequence Exemplary iRNA agents 22 aaacugguga uuguugguga ugg 23 23 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 23 acuggugauu guuggugaun n 21 24 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 24 aucaccaaca aucaccagun n 21 25 23 RNA Artificial Sequence Exemplary iRNA agents 25 aacuggugau uguuggugau gga 23 26 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 26 cuggugauug uuggugaugn n 21 27 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 27 caucaccaac aaucaccagn n 21 28 23 RNA Artificial Sequence Exemplary iRNA agents 28 acuggugauu guuggugaug gag 23 29 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 29 uggugauugu uggugauggn n 21 30 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 30 ccaucaccaa caaucaccan n 21 31 23 RNA Artificial Sequence Exemplary iRNA agents 31 cuggugauug uuggugaugg agc 23 32 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 32 ggugauuguu ggugauggan n 21 33 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 33 uccaucacca acaaucaccn n 21 34 23 RNA Artificial Sequence Exemplary iRNA agents 34 uggugauugu uggugaugga gcc 23 35 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 35 gugauuguug gugauggagn n 21 36 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 36 cuccaucacc aacaaucacn n 21 37 23 RNA Artificial Sequence Exemplary iRNA agents 37 ggugauuguu ggugauggag ccu 23 38 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 38 ugauuguugg ugauggagcn n 21 39 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 39 gcuccaucac caacaaucan n 21 40 23 RNA Artificial Sequence Exemplary iRNA agents 40 gaaagacaug cuugcucaua guc 23 41 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 41 aagacaugcu ugcucauagn n 21 42 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 42 cuaugagcaa gcaugucuun n 21 43 23 RNA Artificial Sequence Exemplary iRNA agents 43 aaagacaugc uugcucauag ucu 23 44 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 44 agacaugcuu gcucauagun n 21 45 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 45 acuaugagca agcaugucun n 21 46 23 RNA Artificial Sequence Exemplary iRNA agents 46 aagacaugcu ugcucauagu cuu 23 47 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 47 gacaugcuug cucauagucn n 21 48 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 48 gacuaugagc aagcaugucn n 21 49 23 RNA Artificial Sequence Exemplary iRNA agents 49 agacaugcuu gcucauaguc uuc 23 50 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 50 acaugcuugc ucauagucun n 21 51 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 51 agacuaugag caagcaugun n 21 52 23 RNA Artificial Sequence Exemplary iRNA agents 52 gacaugcuug cucauagucu uca 23 53 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine misc_feature 20, 21 n = 2'-deoxy-thymidine 53 caugcuugcu cauagucuun n 21 54 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 54 aagacuauga gcaagcaugn n 21 55 23 RNA Artificial Sequence Exemplary iRNA agents 55 acaugcuugc ucauagucuu cag 23 56 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 56 augcuugcuc auagucuucn n 21 57 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 57 gaagacuaug agcaagcaun n 21 58 23 RNA Artificial Sequence Exemplary iRNA agents 58 caugcuugcu cauagucuuc agc 23 59 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 59 ugcuugcuca uagucuucan n 21 60 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 60 ugaagacuau gagcaagcan n 21 61 23 RNA Artificial Sequence Exemplary iRNA agents 61 augcuugcuc auagucuuca gca 23 62 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 62 gcuugcucau agucuucagn n 21 63 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 63 cugaagacua ugagcaagcn n 21 64 23 RNA Artificial Sequence Exemplary iRNA agents 64 ugcuugcuca uagucuucag caa 23 65 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 65 cuugcucaua gucuucagcn n 21 66 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 66 gcugaagacu augagcaagn n 21 67 23 RNA Artificial Sequence Exemplary iRNA agents 67 gcuugcucau agucuucagc aag 23 68 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 68 uugcucauag ucuucagcan n 21 69 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 69 ugcugaagac uaugagcaan n 21 70 23 RNA Artificial Sequence Exemplary iRNA agents 70 cuugcucaua gucuucagca agg 23 71 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 71 ugcucauagu cuucagcaan n 21 72 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 72 uugcugaaga cuaugagcan n 21 73 23 RNA Artificial Sequence Exemplary iRNA agents 73 uugcucauag ucuucagcaa gga 23 74 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 74 gcucauaguc uucagcaagn n 21 75 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 75 cuugcugaag acuaugagcn n 21 76 23 RNA Artificial Sequence Exemplary iRNA agents 76 ugcucauagu cuucagcaag gac 23 77 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 77 cucauagucu ucagcaaggn n 21 78 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 78 ccuugcugaa gacuaugagn n 21 79 23 RNA Artificial Sequence Exemplary iRNA agents 79 gcucauaguc uucagcaagg acc 23 80 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 80 ucauagucuu cagcaaggan n 21 81 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 81 uccuugcuga agacuaugan n 21 82 23 RNA Artificial Sequence Exemplary iRNA agents 82 cucauagucu ucagcaagga cca 23 83 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 83 cauagucuuc agcaaggacn n 21 84 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 84 guccuugcug aagacuaugn n 21 85 23 RNA Artificial Sequence Exemplary iRNA agents 85 ucauagucuu cagcaaggac cag 23 86 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 86 auagucuuca gcaaggaccn n 21 87 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 87 gguccuugcu gaagacuaun n 21 88 23 RNA Artificial Sequence Exemplary iRNA agents 88 cauagucuuc agcaaggacc agu 23 89 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 89 uagucuucag caaggaccan n 21 90 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 90 ugguccuugc ugaagacuan n 21 91 23 RNA Artificial Sequence Exemplary iRNA agents 91 auagucuuca gcaaggacca guu 23 92 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 92 agucuucagc aaggaccagn n 21 93 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 93 cugguccuug cugaagacun n 21 94 23 RNA Artificial Sequence Exemplary iRNA agents 94 uagucuucag caaggaccag uuc 23 95 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 95 gucuucagca aggaccagun n 21 96 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 96 acugguccuu gcugaagacn n 21 97 23 RNA Artificial Sequence Exemplary iRNA agents 97 agucuucagc aaggaccagu ucc 23 98 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 98 ucuucagcaa ggaccaguun n 21 99 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 99 aacugguccu ugcugaagan n 21 100 23 RNA Artificial Sequence Exemplary iRNA agents 100 gucuucagca aggaccaguu ccc 23 101 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 101 cuucagcaag gaccaguucn n 21 102 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 102 gaacuggucc uugcugaagn n 21 103 23 RNA Artificial Sequence Exemplary iRNA agents 103 ucuucagcaa ggaccaguuc cca 23 104 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 104 uucagcaagg accaguuccn n 21 105 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 105 ggaacugguc cuugcugaan n 21 106 23 RNA Artificial Sequence Exemplary iRNA agents 106 cuucagcaag gaccaguucc cag 23 107 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 107 ucagcaagga ccaguucccn n 21 108 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 108 gggaacuggu ccuugcugan n 21 109 23 RNA Artificial Sequence Exemplary iRNA agents 109 uucagcaagg accaguuccc aga 23 110 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 110 cagcaaggac caguucccan n 21 111 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 111 ugggaacugg uccuugcugn n 21 112 23 RNA Artificial Sequence Exemplary iRNA agents 112 ucagcaagga ccaguuccca gag 23 113 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 113 agcaaggacc aguucccagn n 21 114 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 114 cugggaacug

guccuugcun n 21 115 23 RNA Artificial Sequence Exemplary iRNA agents 115 cagcaaggac caguucccag agg 23 116 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 116 gcaaggacca guucccagan n 21 117 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 117 ucugggaacu gguccuugcn n 21 118 23 RNA Artificial Sequence Exemplary iRNA agents 118 agcaaggacc aguucccaga ggu 23 119 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 119 caaggaccag uucccagagn n 21 120 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 120 cucugggaac ugguccuugn n 21 121 23 RNA Artificial Sequence Exemplary iRNA agents 121 gcaaggacca guucccagag gug 23 122 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 122 aaggaccagu ucccagaggn n 21 123 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 123 ccucugggaa cugguccuun n 21 124 23 RNA Artificial Sequence Exemplary iRNA agents 124 caaggaccag uucccagagg ugu 23 125 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 125 aggaccaguu cccagaggun n 21 126 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 126 accucuggga acugguccun n 21 127 23 RNA Artificial Sequence Exemplary iRNA agents 127 gaaagcaggu agaguuggcu uug 23 128 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 128 aagcagguag aguuggcuun n 21 129 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 129 aagccaacuc uaccugcuun n 21 130 23 RNA Artificial Sequence Exemplary iRNA agents 130 aaagcaggua gaguuggcuu ugu 23 131 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 131 agcagguaga guuggcuuun n 21 132 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 132 aaagccaacu cuaccugcun n 21 133 23 RNA Artificial Sequence Exemplary iRNA agents 133 gacagcccug auaguuuaga aaa 23 134 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 134 cagcccugau aguuuagaan n 21 135 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 135 uucuaaacua ucagggcugn n 21 136 23 RNA Artificial Sequence Exemplary iRNA agents 136 acagcccuga uaguuuagaa aac 23 137 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 137 agcccugaua guuuagaaan n 21 138 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 138 uuucuaaacu aucagggcun n 21 139 23 RNA Artificial Sequence Exemplary iRNA agents 139 cagcccugau aguuuagaaa aca 23 140 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 140 gcccugauag uuuagaaaan n 21 141 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 141 uuuucuaaac uaucagggcn n 21 142 23 RNA Artificial Sequence Exemplary iRNA agents 142 agcccugaua guuuagaaaa cau 23 143 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 143 cccugauagu uuagaaaacn n 21 144 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 144 guuuucuaaa cuaucagggn n 21 145 23 RNA Artificial Sequence Exemplary iRNA agents 145 gcccugauag uuuagaaaac auc 23 146 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 146 ccugauaguu uagaaaacan n 21 147 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 147 uguuuucuaa acuaucaggn n 21 148 23 RNA Artificial Sequence Exemplary iRNA agents 148 cccugauagu uuagaaaaca ucc 23 149 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 149 cugauaguuu agaaaacaun n 21 150 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 150 auguuuucua aacuaucagn n 21 151 23 RNA Artificial Sequence Exemplary iRNA agents 151 ccugauaguu uagaaaacau ccc 23 152 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 152 ugauaguuua gaaaacaucn n 21 153 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 153 gauguuuucu aaacuaucan n 21 154 23 RNA Artificial Sequence Exemplary iRNA agents 154 cugauaguuu agaaaacauc cca 23 155 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 155 gauaguuuag aaaacauccn n 21 156 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 156 ggauguuuuc uaaacuaucn n 21 157 23 RNA Artificial Sequence Exemplary iRNA agents 157 ugauaguuua gaaaacaucc cag 23 158 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 158 auaguuuaga aaacaucccn n 21 159 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 159 gggauguuuu cuaaacuaun n 21 160 23 RNA Artificial Sequence Exemplary iRNA agents 160 gauaguuuag aaaacauccc aga 23 161 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 161 uaguuuagaa aacaucccan n 21 162 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 162 ugggauguuu ucuaaacuan n 21 163 23 RNA Artificial Sequence Exemplary iRNA agents 163 auaguuuaga aaacauccca gaa 23 164 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 164 aguuuagaaa acaucccagn n 21 165 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 165 cugggauguu uucuaaacun n 21 166 23 RNA Artificial Sequence Exemplary iRNA agents 166 uaguuuagaa aacaucccag aaa 23 167 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 167 guuuagaaaa caucccagan n 21 168 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 168 ucugggaugu uuucuaaacn n 21 169 23 RNA Artificial Sequence Exemplary iRNA agents 169 aguuuagaaa acaucccaga aaa 23 170 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 170 uuuagaaaac aucccagaan n 21 171 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 171 uucugggaug uuuucuaaan n 21 172 23 RNA Artificial Sequence Exemplary iRNA agents 172 guuuagaaaa caucccagaa aag 23 173 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 173 uuagaaaaca ucccagaaan n 21 174 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 174 uuucugggau guuuucuaan n 21 175 23 RNA Artificial Sequence Exemplary iRNA agents 175 uuuagaaaac aucccagaaa agu 23 176 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 176 uagaaaacau cccagaaaan n 21 177 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 177 uuuucuggga uguuuucuan n 21 178 23 RNA Artificial Sequence Exemplary iRNA agents 178 ccccagaagu caagcauuuc ugu 23 179 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 179 ccagaaguca agcauuucun n 21 180 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 180 agaaaugcuu gacuucuggn n 21 181 23 RNA Artificial Sequence Exemplary iRNA agents 181 cccagaaguc aagcauuucu guc 23 182 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 182 cagaagucaa gcauuucugn n 21 183 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 183 cagaaaugcu ugacuucugn n 21 184 23 RNA Artificial Sequence Exemplary iRNA agents 184 ccagaaguca agcauuucug ucc 23 185 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 185 agaagucaag cauuucugun n 21 186 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 186 acagaaaugc uugacuucun n 21 187 23 RNA Artificial Sequence Exemplary iRNA agents 187 cagaagucaa gcauuucugu ccc 23 188 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 188 gaagucaagc auuucugucn n 21 189 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 189 gacagaaaug cuugacuucn n 21 190 23 RNA Artificial Sequence Exemplary iRNA agents 190 agaagucaag cauuucuguc cca 23 191 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 191 aagucaagca uuucuguccn n 21 192 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 192 ggacagaaau gcuugacuun n 21 193 23 RNA Artificial Sequence Exemplary iRNA agents 193 ugaaaccuga agaaggcaga gau 23 194 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 194 aaaccugaag aaggcagagn n 21 195 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 195 cucugccuuc uucagguuun n 21 196 23 RNA Artificial Sequence Exemplary iRNA agents 196 gaaaccugaa gaaggcagag aua 23 197 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 197 aaccugaaga aggcagagan n 21 198 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 198 ucucugccuu cuucagguun n 21 199 23 RNA Artificial Sequence Exemplary iRNA agents 199 aaaccugaag aaggcagaga uau 23 200 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 200 accugaagaa ggcagagaun n 21 201 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 201 aucucugccu ucuucaggun n 21 202 23 RNA Artificial Sequence Exemplary iRNA agents 202 aaccugaaga aggcagagau aug 23 203 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 203 ccugaagaag gcagagauan n 21 204 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 204 uaucucugcc uucuucaggn n 21 205 23 RNA Artificial Sequence Exemplary iRNA agents 205 accugaagaa ggcagagaua ugg 23 206 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 206 cugaagaagg cagagauaun n 21 207 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 207 auaucucugc cuucuucagn n 21 208 23 RNA Artificial Sequence Exemplary iRNA agents 208 ccugaagaag gcagagauau ggc 23 209 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 209 ugaagaaggc agagauaugn n 21 210 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 210 cauaucucug ccuucuucan n 21 211 23 RNA Artificial Sequence Exemplary iRNA agents 211 cugaagaagg cagagauaug gca 23 212 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 212 gaagaaggca gagauauggn n 21 213 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 213 ccauaucucu gccuucuucn n 21 214 23 RNA Artificial Sequence Exemplary iRNA agents 214 ugaagaaggc agagauaugg caa 23 215 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 215 aagaaggcag agauauggcn n 21 216 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 216 gccauaucuc ugccuucuun n 21 217 23 RNA Artificial Sequence Exemplary iRNA agents 217 gaagaaggca gagauauggc aaa 23 218 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 218 agaaggcaga gauauggcan n 21 219 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 219 ugccauaucu cugccuucun n 21 220 23 RNA Artificial Sequence Exemplary iRNA agents 220 aagaaggcag agauauggca aac 23 221 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 221 gaaggcagag auauggcaan n 21 222 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 222 uugccauauc ucugccuucn n 21 223 23 RNA Artificial Sequence Exemplary iRNA agents 223 agaaggcaga gauauggcaa aca 23 224 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 224 aaggcagaga uauggcaaan n 21 225 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 225 uuugccauau cucugccuun n 21 226 23 RNA Artificial Sequence Exemplary iRNA agents 226 gaaggcagag auauggcaaa cag 23 227 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 227 aggcagagau auggcaaacn n

21 228 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 228 guuugccaua ucucugccun n 21 229 23 RNA Artificial Sequence Exemplary iRNA agents 229 aaggcagaga uauggcaaac agg 23 230 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 230 ggcagagaua uggcaaacan n 21 231 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 231 uguuugccau aucucugccn n 21 232 23 RNA Artificial Sequence Exemplary iRNA agents 232 aggcagagau auggcaaaca gga 23 233 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 233 gcagagauau ggcaaacagn n 21 234 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 234 cuguuugcca uaucucugcn n 21 235 23 RNA Artificial Sequence Exemplary iRNA agents 235 ggcagagaua uggcaaacag gau 23 236 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 236 cagagauaug gcaaacaggn n 21 237 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 237 ccuguuugcc auaucucugn n 21 238 23 RNA Artificial Sequence Exemplary iRNA agents 238 gcagagauau ggcaaacagg auu 23 239 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 239 agagauaugg caaacaggan n 21 240 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 240 uccuguuugc cauaucucun n 21 241 23 RNA Artificial Sequence Exemplary iRNA agents 241 cagagauaug gcaaacagga uug 23 242 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 242 gagauauggc aaacaggaun n 21 243 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 243 auccuguuug ccauaucucn n 21 244 23 RNA Artificial Sequence Exemplary iRNA agents 244 agagauaugg caaacaggau ugg 23 245 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 245 agauauggca aacaggauun n 21 246 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 246 aauccuguuu gccauaucun n 21 247 23 RNA Artificial Sequence Exemplary iRNA agents 247 gagauauggc aaacaggauu ggc 23 248 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 248 gauauggcaa acaggauugn n 21 249 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 249 caauccuguu ugccauaucn n 21 250 23 RNA Artificial Sequence Exemplary iRNA agents 250 agauauggca aacaggauug gcg 23 251 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 251 auauggcaaa caggauuggn n 21 252 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 252 ccaauccugu uugccauaun n 21 253 23 RNA Artificial Sequence Exemplary iRNA agents 253 gauauggcaa acaggauugg cgc 23 254 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 254 uauggcaaac aggauuggcn n 21 255 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 255 gccaauccug uuugccauan n 21 256 23 RNA Artificial Sequence Exemplary iRNA agents 256 auauggcaaa caggauuggc gcu 23 257 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 257 auggcaaaca ggauuggcgn n 21 258 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 258 cgccaauccu guuugccaun n 21 259 23 RNA Artificial Sequence Exemplary iRNA agents 259 uauggcaaac aggauuggcg cuu 23 260 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 260 uggcaaacag gauuggcgcn n 21 261 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 261 gcgccaaucc uguuugccan n 21 262 23 RNA Artificial Sequence Exemplary iRNA agents 262 auggcaaaca ggauuggcgc uuu 23 263 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 263 ggcaaacagg auuggcgcun n 21 264 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 264 agcgccaauc cuguuugccn n 21 265 23 RNA Artificial Sequence Exemplary iRNA agents 265 uggcaaacag gauuggcgcu uuu 23 266 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 266 gcaaacagga uuggcgcuun n 21 267 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 267 aagcgccaau ccuguuugcn n 21 268 23 RNA Artificial Sequence Exemplary iRNA agents 268 ggcaaacagg auuggcgcuu uug 23 269 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 269 caaacaggau uggcgcuuun n 21 270 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 270 aaagcgccaa uccuguuugn n 21 271 23 RNA Artificial Sequence Exemplary iRNA agents 271 gcaaacagga uuggcgcuuu ugg 23 272 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 272 aaacaggauu ggcgcuuuun n 21 273 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 273 aaaagcgcca auccuguuun n 21 274 23 RNA Artificial Sequence Exemplary iRNA agents 274 caaacaggau uggcgcuuuu ggg 23 275 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 275 aacaggauug gcgcuuuugn n 21 276 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 276 caaaagcgcc aauccuguun n 21 277 23 RNA Artificial Sequence Exemplary iRNA agents 277 aaacaggauu ggcgcuuuug ggu 23 278 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 278 acaggauugg cgcuuuuggn n 21 279 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 279 ccaaaagcgc caauccugun n 21 280 23 RNA Artificial Sequence Exemplary iRNA agents 280 aacaggauug gcgcuuuugg gua 23 281 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 281 caggauuggc gcuuuugggn n 21 282 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 282 cccaaaagcg ccaauccugn n 21 283 23 RNA Artificial Sequence Exemplary iRNA agents 283 acaggauugg cgcuuuuggg uac 23 284 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 284 aggauuggcg cuuuugggun n 21 285 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 285 acccaaaagc gccaauccun n 21 286 23 RNA Artificial Sequence Exemplary iRNA agents 286 caggauuggc gcuuuugggu aca 23 287 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 287 ggauuggcgc uuuuggguan n 21 288 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 288 uacccaaaag cgccaauccn n 21 289 23 RNA Artificial Sequence Exemplary iRNA agents 289 aggauuggcg cuuuugggua cau 23 290 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 290 gauuggcgcu uuuggguacn n 21 291 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 291 guacccaaaa gcgccaaucn n 21 292 23 RNA Artificial Sequence Exemplary iRNA agents 292 ggauuggcgc uuuuggguac aug 23 293 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 293 auuggcgcuu uuggguacan n 21 294 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 294 uguacccaaa agcgccaaun n 21 295 23 RNA Artificial Sequence Exemplary iRNA agents 295 gauuggcgcu uuuggguaca ugg 23 296 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 296 uuggcgcuuu uggguacaun n 21 297 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 297 auguacccaa aagcgccaan n 21 298 23 RNA Artificial Sequence Exemplary iRNA agents 298 auuggcgcuu uuggguacau gga 23 299 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 299 uggcgcuuuu ggguacaugn n 21 300 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 300 cauguaccca aaagcgccan n 21 301 23 RNA Artificial Sequence Exemplary iRNA agents 301 uuggcgcuuu uggguacaug gag 23 302 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 302 ggcgcuuuug gguacauggn n 21 303 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 303 ccauguaccc aaaagcgccn n 21 304 23 RNA Artificial Sequence Exemplary iRNA agents 304 uggcgcuuuu ggguacaugg agu 23 305 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 305 gcgcuuuugg guacauggan n 21 306 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 306 uccauguacc caaaagcgcn n 21 307 23 RNA Artificial Sequence Exemplary iRNA agents 307 ggcgcuuuug gguacaugga gug 23 308 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 308 cgcuuuuggg uacauggagn n 21 309 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 309 cuccauguac ccaaaagcgn n 21 310 23 RNA Artificial Sequence Exemplary iRNA agents 310 gcgcuuuugg guacauggag ugu 23 311 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 311 gcuuuugggu acauggagun n 21 312 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 312 acuccaugua cccaaaagcn n 21 313 23 RNA Artificial Sequence Exemplary iRNA agents 313 cgcuuuuggg uacauggagu guu 23 314 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 314 cuuuugggua cauggagugn n 21 315 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 315 cacuccaugu acccaaaagn n 21 316 23 RNA Artificial Sequence Exemplary iRNA agents 316 gcuuuugggu acauggagug uuc 23 317 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 317 uuuuggguac auggagugun n 21 318 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 318 acacuccaug uacccaaaan n 21 319 23 RNA Artificial Sequence Exemplary iRNA agents 319 cuuuugggua cauggagugu uca 23 320 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 320 uuuggguaca uggaguguun n 21 321 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 321 aacacuccau guacccaaan n 21 322 23 RNA Artificial Sequence Exemplary iRNA agents 322 uuuuggguac auggaguguu cag 23 323 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 323 uuggguacau ggaguguucn n 21 324 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 324 gaacacucca uguacccaan n 21 325 23 RNA Artificial Sequence Exemplary iRNA agents 325 uuuggguaca uggaguguuc agc 23 326 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 326 uggguacaug gaguguucan n 21 327 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 327 ugaacacucc auguacccan n 21 328 23 RNA Artificial Sequence Exemplary iRNA agents 328 uuggguacau ggaguguuca gca 23 329 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 329 ggguacaugg aguguucagn n 21 330 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 330 cugaacacuc cauguacccn n 21 331 23 RNA Artificial Sequence Exemplary iRNA agents 331 uggguacaug gaguguucag caa 23 332 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 332 gguacaugga guguucagcn n 21 333 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 333 gcugaacacu ccauguaccn n 21 334 23 RNA Artificial Sequence Exemplary iRNA agents 334 ggguacaugg aguguucagc aaa 23 335 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 335 guacauggag uguucagcan n 21 336 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 336 ugcugaacac uccauguacn n 21 337 23 RNA Artificial Sequence Exemplary iRNA agents 337 gguacaugga guguucagca aag 23 338 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 338 uacauggagu guucagcaan n 21 339 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 339 uugcugaaca cuccauguan n 21 340 23 RNA Artificial Sequence Exemplary iRNA agents 340 guacauggag uguucagcaa aga

23 341 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 341 acauggagug uucagcaaan n 21 342 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 342 uuugcugaac acuccaugun n 21 343 23 RNA Artificial Sequence Exemplary iRNA agents 343 uacauggagu guucagcaaa gac 23 344 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 344 cauggagugu ucagcaaagn n 21 345 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 345 cuuugcugaa cacuccaugn n 21 346 23 RNA Artificial Sequence Exemplary iRNA agents 346 acauggagug uucagcaaag acc 23 347 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 347 auggaguguu cagcaaagan n 21 348 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 348 ucuuugcuga acacuccaun n 21 349 23 RNA Artificial Sequence Exemplary iRNA agents 349 cauggagugu ucagcaaaga cca 23 350 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 350 uggaguguuc agcaaagacn n 21 351 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 351 gucuuugcug aacacuccan n 21 352 23 RNA Artificial Sequence Exemplary iRNA agents 352 auggaguguu cagcaaagac caa 23 353 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 353 ggaguguuca gcaaagaccn n 21 354 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 354 ggucuuugcu gaacacuccn n 21 355 23 RNA Artificial Sequence Exemplary iRNA agents 355 uggaguguuc agcaaagacc aaa 23 356 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 356 gaguguucag caaagaccan n 21 357 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 357 uggucuuugc ugaacacucn n 21 358 23 RNA Artificial Sequence Exemplary iRNA agents 358 ggaguguuca gcaaagacca aag 23 359 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 359 aguguucagc aaagaccaan n 21 360 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 360 uuggucuuug cugaacacun n 21 361 23 RNA Artificial Sequence Exemplary iRNA agents 361 gaguguucag caaagaccaa aga 23 362 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 362 guguucagca aagaccaaan n 21 363 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 363 uuuggucuuu gcugaacacn n 21 364 23 RNA Artificial Sequence Exemplary iRNA agents 364 aguguucagc aaagaccaaa gau 23 365 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 365 uguucagcaa agaccaaagn n 21 366 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 366 cuuuggucuu ugcugaacan n 21 367 23 RNA Artificial Sequence Exemplary iRNA agents 367 guguucagca aagaccaaag aug 23 368 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 368 guucagcaaa gaccaaagan n 21 369 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 369 ucuuuggucu uugcugaacn n 21 370 23 RNA Artificial Sequence Exemplary iRNA agents 370 auggagugag agagguuuuu gaa 23 371 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 371 ggagugagag agguuuuugn n 21 372 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 372 caaaaaccuc ucucacuccn n 21 373 23 RNA Artificial Sequence Exemplary iRNA agents 373 uggagugaga gagguuuuug aaa 23 374 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 374 gagugagaga gguuuuugan n 21 375 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 375 ucaaaaaccu cucucacucn n 21 376 23 RNA Artificial Sequence Exemplary iRNA agents 376 cuacgagagc ugcucugcaa gcu 23 377 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 377 acgagagcug cucugcaagn n 21 378 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 378 cuugcagagc agcucucgun n 21 379 23 RNA Artificial Sequence Exemplary iRNA agents 379 uacgagagcu gcucugcaag cua 23 380 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 380 cgagagcugc ucugcaagcn n 21 381 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 381 gcuugcagag cagcucucgn n 21 382 23 RNA Artificial Sequence Exemplary iRNA agents 382 acgagagcug cucugcaagc uag 23 383 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 383 gagagcugcu cugcaagcun n 21 384 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 384 agcuugcaga gcagcucucn n 21 385 23 RNA Artificial Sequence Exemplary iRNA agents 385 cgagagcugc ucugcaagcu aga 23 386 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 386 agagcugcuc ugcaagcuan n 21 387 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 387 uagcuugcag agcagcucun n 21 388 23 RNA Artificial Sequence Exemplary iRNA agents 388 gagagcugcu cugcaagcua gac 23 389 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 389 gagcugcucu gcaagcuagn n 21 390 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 390 cuagcuugca gagcagcucn n 21 391 23 RNA Artificial Sequence Exemplary iRNA agents 391 agagcugcuc ugcaagcuag acg 23 392 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 392 agcugcucug caagcuagan n 21 393 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 393 ucuagcuugc agagcagcun n 21 394 23 RNA Artificial Sequence Exemplary iRNA agents 394 gagcugcucu gcaagcuaga cgu 23 395 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 395 gcugcucugc aagcuagacn n 21 396 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 396 gucuagcuug cagagcagcn n 21 397 23 RNA Artificial Sequence Exemplary iRNA agents 397 agcugcucug caagcuagac gug 23 398 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 398 cugcucugca agcuagacgn n 21 399 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 399 cgucuagcuu gcagagcagn n 21 400 23 RNA Artificial Sequence Exemplary iRNA agents 400 uugaagugcu guuuauuaau cuu 23 401 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 401 gaagugcugu uuauuaaucn n 21 402 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 402 gauuaauaaa cagcacuucn n 21 403 23 RNA Artificial Sequence Exemplary iRNA agents 403 ugaagugcug uuuauuaauc uua 23 404 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 404 aagugcuguu uauuaaucun n 21 405 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 405 agauuaauaa acagcacuun n 21 406 23 RNA Artificial Sequence Exemplary iRNA agents 406 gaagugcugu uuauuaaucu uag 23 407 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 407 agugcuguuu auuaaucuun n 21 408 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 408 aagauuaaua aacagcacun n 21 409 23 RNA Artificial Sequence Exemplary iRNA agents 409 aagugcuguu uauuaaucuu agu 23 410 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 410 gugcuguuua uuaaucuuan n 21 411 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 411 uaagauuaau aaacagcacn n 21 412 23 RNA Artificial Sequence Exemplary iRNA agents 412 agugcuguuu auuaaucuua gug 23 413 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 413 ugcuguuuau uaaucuuagn n 21 414 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 414 cuaagauuaa uaaacagcan n 21 415 23 RNA Artificial Sequence Exemplary iRNA agents 415 gugcuguuua uuaaucuuag ugu 23 416 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 416 gcuguuuauu aaucuuagun n 21 417 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 417 acuaagauua auaaacagcn n 21 418 23 RNA Artificial Sequence Exemplary iRNA agents 418 ugcuguuuau uaaucuuagu gua 23 419 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 419 cuguuuauua aucuuagugn n 21 420 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 420 cacuaagauu aauaaacagn n 21 421 23 RNA Artificial Sequence Exemplary iRNA agents 421 gcuguuuauu aaucuuagug uau 23 422 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 422 uguuuauuaa ucuuagugun n 21 423 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 423 acacuaagau uaauaaacan n 21 424 23 RNA Artificial Sequence Exemplary iRNA agents 424 cuguuuauua aucuuagugu aug 23 425 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 425 guuuauuaau cuuaguguan n 21 426 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 426 uacacuaaga uuaauaaacn n 21 427 23 RNA Artificial Sequence Exemplary iRNA agents 427 uguuuauuaa ucuuagugua uga 23 428 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 428 uuuauuaauc uuaguguaun n 21 429 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 429 auacacuaag auuaauaaan n 21 430 23 RNA Artificial Sequence Exemplary iRNA agents 430 guuuauuaau cuuaguguau gau 23 431 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 431 uuauuaaucu uaguguaugn n 21 432 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 432 cauacacuaa gauuaauaan n 21 433 23 RNA Artificial Sequence Exemplary iRNA agents 433 uuuauuaauc uuaguguaug auu 23 434 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 434 uauuaaucuu aguguaugan n 21 435 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 435 ucauacacua agauuaauan n 21 436 23 RNA Artificial Sequence Exemplary iRNA agents 436 uuauuaaucu uaguguauga uua 23 437 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 437 auuaaucuua guguaugaun n 21 438 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 438 aucauacacu aagauuaaun n 21 439 23 RNA Artificial Sequence Exemplary iRNA agents 439 uauuaaucuu aguguaugau uac 23 440 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 440 uuaaucuuag uguaugauun n 21 441 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 441 aaucauacac uaagauuaan n 21 442 23 RNA Artificial Sequence Exemplary iRNA agents 442 auuaaucuua guguaugauu acu 23 443 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 443 uaaucuuagu guaugauuan n 21 444 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 444 uaaucauaca cuaagauuan n 21 445 23 RNA Artificial Sequence Exemplary iRNA agents 445 uuaaucuuag uguaugauua cug 23 446 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 446 aaucuuagug uaugauuacn n 21 447 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 447 guaaucauac acuaagauun n 21 448 23 RNA Artificial Sequence Exemplary iRNA agents 448 uaaucuuagu guaugauuac ugg 23 449 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 449 aucuuagugu augauuacun n 21 450 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 450 aguaaucaua cacuaagaun n 21 451 23 RNA Artificial Sequence Exemplary iRNA agents 451 aaucuuagug uaugauuacu ggc 23 452 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 452 ucuuagugua ugauuacugn n 21 453 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine

453 caguaaucau acacuaagan n 21 454 23 RNA Artificial Sequence Exemplary iRNA agents 454 aucuuagugu augauuacug gcc 23 455 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 455 cuuaguguau gauuacuggn n 21 456 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 456 ccaguaauca uacacuaagn n 21 457 23 RNA Artificial Sequence Exemplary iRNA agents 457 ucuuagugua ugauuacugg ccu 23 458 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 458 uuaguguaug auuacuggcn n 21 459 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 459 gccaguaauc auacacuaan n 21 460 23 RNA Artificial Sequence Exemplary iRNA agents 460 cuuaguguau gauuacuggc cuu 23 461 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 461 uaguguauga uuacuggccn n 21 462 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 462 ggccaguaau cauacacuan n 21 463 23 RNA Artificial Sequence Exemplary iRNA agents 463 uuaguguaug auuacuggcc uuu 23 464 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 464 aguguaugau uacuggccun n 21 465 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 465 aggccaguaa ucauacacun n 21 466 23 RNA Artificial Sequence Exemplary iRNA agents 466 uaguguauga uuacuggccu uuu 23 467 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 467 guguaugauu acuggccuun n 21 468 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 468 aaggccagua aucauacacn n 21 469 23 RNA Artificial Sequence Exemplary iRNA agents 469 aguguaugau uacuggccuu uuu 23 470 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 470 uguaugauua cuggccuuun n 21 471 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 471 aaaggccagu aaucauacan n 21 472 23 RNA Artificial Sequence Exemplary iRNA agents 472 guguaugauu acuggccuuu uuc 23 473 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 473 guaugauuac uggccuuuun n 21 474 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 474 aaaaggccag uaaucauacn n 21 475 23 RNA Artificial Sequence Exemplary iRNA agents 475 uucauuuauc uauaauuuac cua 23 476 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 476 cauuuaucua uaauuuaccn n 21 477 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 477 gguaaauuau agauaaaugn n 21 478 23 RNA Artificial Sequence Exemplary iRNA agents 478 ucauuuaucu auaauuuacc uaa 23 479 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 479 auuuaucuau aauuuaccun n 21 480 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 480 agguaaauua uagauaaaun n 21 481 23 RNA Artificial Sequence Exemplary iRNA agents 481 cauuuaucua uaauuuaccu aag 23 482 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 482 uuuaucuaua auuuaccuan n 21 483 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 483 uagguaaauu auagauaaan n 21 484 23 RNA Artificial Sequence Exemplary iRNA agents 484 auuuaucuau aauuuaccua aga 23 485 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 485 uuaucuauaa uuuaccuaan n 21 486 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 486 uuagguaaau uauagauaan n 21 487 23 RNA Artificial Sequence Exemplary iRNA agents 487 uuuaucuaua auuuaccuaa gau 23 488 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 488 uaucuauaau uuaccuaagn n 21 489 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 489 cuuagguaaa uuauagauan n 21 490 23 RNA Artificial Sequence Exemplary iRNA agents 490 uuaucuauaa uuuaccuaag auu 23 491 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 491 aucuauaauu uaccuaagan n 21 492 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 492 ucuuagguaa auuauagaun n 21 493 23 RNA Artificial Sequence Exemplary iRNA agents 493 uaucuauaau uuaccuaaga uua 23 494 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 494 ucuauaauuu accuaagaun n 21 495 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 495 aucuuaggua aauuauagan n 21 496 23 RNA Artificial Sequence Exemplary iRNA agents 496 aucuauaauu uaccuaagau uac 23 497 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 497 cuauaauuua ccuaagauun n 21 498 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 498 aaucuuaggu aaauuauagn n 21 499 23 RNA Artificial Sequence Exemplary iRNA agents 499 ucuauaauuu accuaagauu aca 23 500 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 500 uauaauuuac cuaagauuan n 21 501 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 501 uaaucuuagg uaaauuauan n 21 502 23 RNA Artificial Sequence Exemplary iRNA agents 502 cuauaauuua ccuaagauua caa 23 503 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 503 auaauuuacc uaagauuacn n 21 504 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 504 guaaucuuag guaaauuaun n 21 505 23 RNA Artificial Sequence Exemplary iRNA agents 505 uauaauuuac cuaagauuac aaa 23 506 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 506 uaauuuaccu aagauuacan n 21 507 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 507 uguaaucuua gguaaauuan n 21 508 23 RNA Artificial Sequence Exemplary iRNA agents 508 auaauuuacc uaagauuaca aau 23 509 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 509 aauuuaccua agauuacaan n 21 510 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 510 uuguaaucuu agguaaauun n 21 511 23 RNA Artificial Sequence Exemplary iRNA agents 511 uaauuuaccu aagauuacaa auc 23 512 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 512 auuuaccuaa gauuacaaan n 21 513 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 513 uuuguaaucu uagguaaaun n 21 514 23 RNA Artificial Sequence Exemplary iRNA agents 514 aauuuaccua agauuacaaa uca 23 515 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 515 uuuaccuaag auuacaaaun n 21 516 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 516 auuuguaauc uuagguaaan n 21 517 23 RNA Artificial Sequence Exemplary iRNA agents 517 auuuaccuaa gauuacaaau cag 23 518 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 518 uuaccuaaga uuacaaaucn n 21 519 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 519 gauuuguaau cuuagguaan n 21 520 23 RNA Artificial Sequence Exemplary iRNA agents 520 uuuaccuaag auuacaaauc aga 23 521 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 521 uaccuaagau uacaaaucan n 21 522 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 522 ugauuuguaa ucuuagguan n 21 523 23 RNA Artificial Sequence Exemplary iRNA agents 523 agaagucauc uugcuaccag uau 23 524 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 524 aagucaucuu gcuaccagun n 21 525 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 525 acugguagca agaugacuun n 21 526 23 RNA Artificial Sequence Exemplary iRNA agents 526 gaagucaucu ugcuaccagu auu 23 527 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 527 agucaucuug cuaccaguan n 21 528 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 528 uacugguagc aagaugacun n 21 529 23 RNA Artificial Sequence Exemplary iRNA agents 529 aagucaucuu gcuaccagua uuu 23 530 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 530 gucaucuugc uaccaguaun n 21 531 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 531 auacugguag caagaugacn n 21 532 23 RNA Artificial Sequence Exemplary iRNA agents 532 agucaucuug cuaccaguau uua 23 533 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 533 ucaucuugcu accaguauun n 21 534 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 534 aauacuggua gcaagaugan n 21 535 23 RNA Artificial Sequence Exemplary iRNA agents 535 gucaucuugc uaccaguauu uag 23 536 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 536 caucuugcua ccaguauuun n 21 537 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 537 aaauacuggu agcaagaugn n 21 538 23 RNA Artificial Sequence Exemplary iRNA agents 538 ucaucuugcu accaguauuu aga 23 539 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 539 aucuugcuac caguauuuan n 21 540 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 540 uaaauacugg uagcaagaun n 21 541 23 RNA Artificial Sequence Exemplary iRNA agents 541 caucuugcua ccaguauuua gaa 23 542 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 542 ucuugcuacc aguauuuagn n 21 543 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 543 cuaaauacug guagcaagan n 21 544 23 RNA Artificial Sequence Exemplary iRNA agents 544 aucuugcuac caguauuuag aag 23 545 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 545 cuugcuacca guauuuagan n 21 546 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 546 ucuaaauacu gguagcaagn n 21 547 23 RNA Artificial Sequence Exemplary iRNA agents 547 ucuugcuacc aguauuuaga agc 23 548 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 548 uugcuaccag uauuuagaan n 21 549 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 549 uucuaaauac ugguagcaan n 21 550 23 RNA Artificial Sequence Exemplary iRNA agents 550 cuugcuacca guauuuagaa gcc 23 551 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 551 ugcuaccagu auuuagaagn n 21 552 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 552 cuucuaaaua cugguagcan n 21 553 23 RNA Artificial Sequence Exemplary iRNA agents 553 uugcuaccag uauuuagaag cca 23 554 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 554 gcuaccagua uuuagaagcn n 21 555 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 555 gcuucuaaau acugguagcn n 21 556 23 RNA Artificial Sequence Exemplary iRNA agents 556 ugcuaccagu auuuagaagc caa 23 557 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 557 cuaccaguau uuagaagccn n 21 558 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 558 ggcuucuaaa uacugguagn n 21 559 23 RNA Artificial Sequence Exemplary iRNA agents 559 gcuaccagua uuuagaagcc aac 23 560 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 560 uaccaguauu uagaagccan n 21 561 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 561 uggcuucuaa auacugguan n 21 562 23 RNA Artificial Sequence Exemplary iRNA agents 562 cuaccaguau uuagaagcca acu 23 563 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 563 accaguauuu agaagccaan n 21 564 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 564 uuggcuucua aauacuggun n 21 565 23 RNA Artificial Sequence Exemplary iRNA agents 565 uaccaguauu uagaagccaa cua 23 566 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine

566 ccaguauuua gaagccaacn n 21 567 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 567 guuggcuucu aaauacuggn n 21 568 23 RNA Artificial Sequence Exemplary iRNA agents 568 cuugcuucuu ucuagaaaga gaa 23 569 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 569 ugcuucuuuc uagaaagagn n 21 570 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 570 cucuuucuag aaagaagcan n 21 571 23 RNA Artificial Sequence Exemplary iRNA agents 571 uugcuucuuu cuagaaagag aaa 23 572 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 572 gcuucuuucu agaaagagan n 21 573 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 573 ucucuuucua gaaagaagcn n 21 574 23 RNA Artificial Sequence Exemplary iRNA agents 574 ugcuucuuuc uagaaagaga aac 23 575 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 575 cuucuuucua gaaagagaan n 21 576 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 576 uucucuuucu agaaagaagn n 21 577 23 RNA Artificial Sequence Exemplary iRNA agents 577 gcuucuuucu agaaagagaa aca 23 578 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 578 uucuuucuag aaagagaaan n 21 579 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 579 uuucucuuuc uagaaagaan n 21 580 23 RNA Artificial Sequence Exemplary iRNA agents 580 cuucuuucua gaaagagaaa cag 23 581 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 581 ucuuucuaga aagagaaacn n 21 582 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 582 guuucucuuu cuagaaagan n 21 583 23 RNA Artificial Sequence Exemplary iRNA agents 583 uucuuucuag aaagagaaac agu 23 584 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 584 cuuucuagaa agagaaacan n 21 585 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 585 uguuucucuu ucuagaaagn n 21 586 23 RNA Artificial Sequence Exemplary iRNA agents 586 ucuuucuaga aagagaaaca guu 23 587 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 587 uuucuagaaa gagaaacagn n 21 588 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 588 cuguuucucu uucuagaaan n 21 589 23 RNA Artificial Sequence Exemplary iRNA agents 589 cuuucuagaa agagaaacag uug 23 590 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 590 uucuagaaag agaaacagun n 21 591 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 591 acuguuucuc uuucuagaan n 21 592 23 RNA Artificial Sequence Exemplary iRNA agents 592 uuucuagaaa gagaaacagu ugg 23 593 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 593 ucuagaaaga gaaacaguun n 21 594 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 594 aacuguuucu cuuucuagan n 21 595 23 RNA Artificial Sequence Exemplary iRNA agents 595 uucuagaaag agaaacaguu ggu 23 596 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 596 cuagaaagag aaacaguugn n 21 597 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 597 caacuguuuc ucuuucuagn n 21 598 23 RNA Artificial Sequence Exemplary iRNA agents 598 ucuagaaaga gaaacaguug gua 23 599 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 599 uagaaagaga aacaguuggn n 21 600 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 600 ccaacuguuu cucuuucuan n 21 601 23 RNA Artificial Sequence Exemplary iRNA agents 601 cuagaaagag aaacaguugg uaa 23 602 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 602 agaaagagaa acaguuggun n 21 603 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 603 accaacuguu ucucuuucun n 21 604 23 RNA Artificial Sequence Exemplary iRNA agents 604 uagaaagaga aacaguuggu aac 23 605 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 605 gaaagagaaa caguugguan n 21 606 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 606 uaccaacugu uucucuuucn n 21 607 23 RNA Artificial Sequence Exemplary iRNA agents 607 agaaagagaa acaguuggua acu 23 608 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 608 aaagagaaac aguugguaan n 21 609 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 609 uuaccaacug uuucucuuun n 21 610 23 RNA Artificial Sequence Exemplary iRNA agents 610 gaaagagaaa caguugguaa cuu 23 611 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 611 aagagaaaca guugguaacn n 21 612 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 612 guuaccaacu guuucucuun n 21 613 23 RNA Artificial Sequence Exemplary iRNA agents 613 aaagagaaac aguugguaac uuu 23 614 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 614 agagaaacag uugguaacun n 21 615 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 615 aguuaccaac uguuucucun n 21 616 23 RNA Artificial Sequence Exemplary iRNA agents 616 aagagaaaca guugguaacu uuu 23 617 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 617 gagaaacagu ugguaacuun n 21 618 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 618 aaguuaccaa cuguuucucn n 21 619 23 RNA Artificial Sequence Exemplary iRNA agents 619 agagaaacag uugguaacuu uug 23 620 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 620 agaaacaguu gguaacuuun n 21 621 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 621 aaaguuacca acuguuucun n 21 622 23 RNA Artificial Sequence Exemplary iRNA agents 622 gagaaacagu ugguaacuuu ugu 23 623 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 623 gaaacaguug guaacuuuun n 21 624 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 624 aaaaguuacc aacuguuucn n 21 625 23 RNA Artificial Sequence Exemplary iRNA agents 625 agaaacaguu gguaacuuuu gug 23 626 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 626 aaacaguugg uaacuuuugn n 21 627 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 627 caaaaguuac caacuguuun n 21 628 23 RNA Artificial Sequence Exemplary iRNA agents 628 gaaacaguug guaacuuuug uga 23 629 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 629 aacaguuggu aacuuuugun n 21 630 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 630 acaaaaguua ccaacuguun n 21 631 23 RNA Artificial Sequence Exemplary iRNA agents 631 aaacaguugg uaacuuuugu gaa 23 632 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 632 acaguuggua acuuuugugn n 21 633 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 633 cacaaaaguu accaacugun n 21 634 23 RNA Artificial Sequence Exemplary iRNA agents 634 aacaguuggu aacuuuugug aau 23 635 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 635 caguugguaa cuuuugugan n 21 636 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 636 ucacaaaagu uaccaacugn n 21 637 23 RNA Artificial Sequence Exemplary iRNA agents 637 acaguuggua acuuuuguga auu 23 638 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 638 aguugguaac uuuugugaan n 21 639 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 639 uucacaaaag uuaccaacun n 21 640 23 RNA Artificial Sequence Exemplary iRNA agents 640 caguugguaa cuuuugugaa uua 23 641 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 641 guugguaacu uuugugaaun n 21 642 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 642 auucacaaaa guuaccaacn n 21 643 23 RNA Artificial Sequence Exemplary iRNA agents 643 aguugguaac uuuugugaau uag 23 644 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 644 uugguaacuu uugugaauun n 21 645 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 645 aauucacaaa aguuaccaan n 21 646 23 RNA Artificial Sequence Exemplary iRNA agents 646 guugguaacu uuugugaauu agg 23 647 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 647 ugguaacuuu ugugaauuan n 21 648 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 648 uaauucacaa aaguuaccan n 21 649 23 RNA Artificial Sequence Exemplary iRNA agents 649 uugguaacuu uugugaauua ggc 23 650 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 650 gguaacuuuu gugaauuagn n 21 651 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 651 cuaauucaca aaaguuaccn n 21 652 23 RNA Artificial Sequence Exemplary iRNA agents 652 ugguaacuuu ugugaauuag gcu 23 653 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 653 guaacuuuug ugaauuaggn n 21 654 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 654 ccuaauucac aaaaguuacn n 21 655 23 RNA Artificial Sequence Exemplary iRNA agents 655 gguaacuuuu gugaauuagg cug 23 656 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 656 uaacuuuugu gaauuaggcn n 21 657 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 657 gccuaauuca caaaaguuan n 21 658 23 RNA Artificial Sequence Exemplary iRNA agents 658 guaacuuuug ugaauuaggc ugu 23 659 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 659 aacuuuugug aauuaggcun n 21 660 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 660 agccuaauuc acaaaaguun n 21 661 23 RNA Artificial Sequence Exemplary iRNA agents 661 uaacuuuugu gaauuaggcu gua 23 662 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 662 acuuuuguga auuaggcugn n 21 663 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 663 cagccuaauu cacaaaagun n 21 664 23 RNA Artificial Sequence Exemplary iRNA agents 664 aacuuuugug aauuaggcug uaa 23 665 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 665 cuuuugugaa uuaggcugun n 21 666 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 666 acagccuaau ucacaaaagn n 21 667 23 RNA Artificial Sequence Exemplary iRNA agents 667 acuuuuguga auuaggcugu aac 23 668 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 668 uuuugugaau uaggcuguan n 21 669 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 669 uacagccuaa uucacaaaan n 21 670 23 RNA Artificial Sequence Exemplary iRNA agents 670 cuuuugugaa uuaggcugua acu 23 671 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 671 uuugugaauu aggcuguaan n 21 672 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 672 uuacagccua auucacaaan n 21 673 23 RNA Artificial Sequence Exemplary iRNA agents 673 uuuugugaau uaggcuguaa cua 23 674 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 674 uugugaauua ggcuguaacn n 21 675 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 675 guuacagccu aauucacaan n 21 676 23 RNA Artificial Sequence Exemplary iRNA agents 676 uuugugaauu aggcuguaac uac 23 677 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 677 ugugaauuag gcuguaacun n 21 678 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 678 aguuacagcc uaauucacan n 21 679 23 RNA Artificial Sequence Exemplary iRNA agents 679 uugugaauua

ggcuguaacu acu 23 680 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 680 gugaauuagg cuguaacuan n 21 681 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 681 uaguuacagc cuaauucacn n 21 682 23 RNA Artificial Sequence Exemplary iRNA agents 682 ugugaauuag gcuguaacua cuu 23 683 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 683 ugaauuaggc uguaacuacn n 21 684 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 684 guaguuacag ccuaauucan n 21 685 23 RNA Artificial Sequence Exemplary iRNA agents 685 gugaauuagg cuguaacuac uuu 23 686 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 686 gaauuaggcu guaacuacun n 21 687 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 687 aguaguuaca gccuaauucn n 21 688 23 RNA Artificial Sequence Exemplary iRNA agents 688 ugaauuaggc uguaacuacu uua 23 689 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 689 aauuaggcug uaacuacuun n 21 690 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 690 aaguaguuac agccuaauun n 21 691 23 RNA Artificial Sequence Exemplary iRNA agents 691 gaauuaggcu guaacuacuu uau 23 692 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 692 auuaggcugu aacuacuuun n 21 693 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 693 aaaguaguua cagccuaaun n 21 694 23 RNA Artificial Sequence Exemplary iRNA agents 694 aauuaggcug uaacuacuuu aua 23 695 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 695 uuaggcugua acuacuuuan n 21 696 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 696 uaaaguaguu acagccuaan n 21 697 23 RNA Artificial Sequence Exemplary iRNA agents 697 auuaggcugu aacuacuuua uaa 23 698 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 698 uaggcuguaa cuacuuuaun n 21 699 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 699 auaaaguagu uacagccuan n 21 700 23 RNA Artificial Sequence Exemplary iRNA agents 700 uuaggcugua acuacuuuau aac 23 701 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 701 aggcuguaac uacuuuauan n 21 702 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 702 uauaaaguag uuacagccun n 21 703 23 RNA Artificial Sequence Exemplary iRNA agents 703 uaggcuguaa cuacuuuaua acu 23 704 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 704 ggcuguaacu acuuuauaan n 21 705 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 705 uuauaaagua guuacagccn n 21 706 23 RNA Artificial Sequence Exemplary iRNA agents 706 aggcuguaac uacuuuauaa cua 23 707 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 707 gcuguaacua cuuuauaacn n 21 708 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 708 guuauaaagu aguuacagcn n 21 709 23 RNA Artificial Sequence Exemplary iRNA agents 709 ggcuguaacu acuuuauaac uaa 23 710 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 710 cuguaacuac uuuauaacun n 21 711 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 711 aguuauaaag uaguuacagn n 21 712 23 RNA Artificial Sequence Exemplary iRNA agents 712 gcuguaacua cuuuauaacu aac 23 713 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 713 uguaacuacu uuauaacuan n 21 714 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 714 uaguuauaaa guaguuacan n 21 715 23 RNA Artificial Sequence Exemplary iRNA agents 715 cuguaacuac uuuauaacua aca 23 716 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 716 guaacuacuu uauaacuaan n 21 717 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 717 uuaguuauaa aguaguuacn n 21 718 23 RNA Artificial Sequence Exemplary iRNA agents 718 uguaacuacu uuauaacuaa cau 23 719 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 719 uaacuacuuu auaacuaacn n 21 720 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 720 guuaguuaua aaguaguuan n 21 721 23 RNA Artificial Sequence Exemplary iRNA agents 721 guaacuacuu uauaacuaac aug 23 722 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 722 aacuacuuua uaacuaacan n 21 723 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 723 uguuaguuau aaaguaguun n 21 724 23 RNA Artificial Sequence Exemplary iRNA agents 724 uaacuacuuu auaacuaaca ugu 23 725 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 725 acuacuuuau aacuaacaun n 21 726 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 726 auguuaguua uaaaguagun n 21 727 23 RNA Artificial Sequence Exemplary iRNA agents 727 aacuacuuua uaacuaacau guc 23 728 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 728 cuacuuuaua acuaacaugn n 21 729 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 729 cauguuaguu auaaaguagn n 21 730 23 RNA Artificial Sequence Exemplary iRNA agents 730 acuacuuuau aacuaacaug ucc 23 731 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 731 uacuuuauaa cuaacaugun n 21 732 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 732 acauguuagu uauaaaguan n 21 733 23 RNA Artificial Sequence Exemplary iRNA agents 733 cuacuuuaua acuaacaugu ccu 23 734 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 734 acuuuauaac uaacaugucn n 21 735 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 735 gacauguuag uuauaaagun n 21 736 23 RNA Artificial Sequence Exemplary iRNA agents 736 uacuuuauaa cuaacauguc cug 23 737 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 737 cuuuauaacu aacauguccn n 21 738 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 738 ggacauguua guuauaaagn n 21 739 23 RNA Artificial Sequence Exemplary iRNA agents 739 acuuuauaac uaacaugucc ugc 23 740 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 740 uuuauaacua acauguccun n 21 741 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 741 aggacauguu aguuauaaan n 21 742 23 RNA Artificial Sequence Exemplary iRNA agents 742 cuuuauaacu aacauguccu gcc 23 743 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 743 uuauaacuaa cauguccugn n 21 744 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 744 caggacaugu uaguuauaan n 21 745 23 RNA Artificial Sequence Exemplary iRNA agents 745 uuuauaacua acauguccug ccu 23 746 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 746 uauaacuaac auguccugcn n 21 747 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 747 gcaggacaug uuaguuauan n 21 748 23 RNA Artificial Sequence Exemplary iRNA agents 748 uuauaacuaa cauguccugc cua 23 749 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 749 auaacuaaca uguccugccn n 21 750 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 750 ggcaggacau guuaguuaun n 21 751 23 RNA Artificial Sequence Exemplary iRNA agents 751 uauaacuaac auguccugcc uau 23 752 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 752 uaacuaacau guccugccun n 21 753 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 753 aggcaggaca uguuaguuan n 21 754 23 RNA Artificial Sequence Exemplary iRNA agents 754 auaacuaaca uguccugccu auu 23 755 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 755 aacuaacaug uccugccuan n 21 756 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 756 uaggcaggac auguuaguun n 21 757 23 RNA Artificial Sequence Exemplary iRNA agents 757 uggcagaguu acaguucugu ggu 23 758 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 758 gcagaguuac aguucugugn n 21 759 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 759 cacagaacug uaacucugcn n 21 760 23 RNA Artificial Sequence Exemplary iRNA agents 760 ggcagaguua caguucugug guu 23 761 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 761 cagaguuaca guucuguggn n 21 762 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 762 ccacagaacu guaacucugn n 21 763 23 RNA Artificial Sequence Exemplary iRNA agents 763 gcagaguuac aguucugugg uuu 23 764 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 764 agaguuacag uucuguggun n 21 765 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 765 accacagaac uguaacucun n 21 766 23 RNA Artificial Sequence Exemplary iRNA agents 766 uuucauguua guuaccuuau agu 23 767 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 767 ucauguuagu uaccuuauan n 21 768 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 768 uauaagguaa cuaacaugan n 21 769 23 RNA Artificial Sequence Exemplary iRNA agents 769 uucauguuag uuaccuuaua guu 23 770 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 770 cauguuaguu accuuauagn n 21 771 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 771 cuauaaggua acuaacaugn n 21 772 23 RNA Artificial Sequence Exemplary iRNA agents 772 ucauguuagu uaccuuauag uua 23 773 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 773 auguuaguua ccuuauagun n 21 774 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 774 acuauaaggu aacuaacaun n 21 775 23 RNA Artificial Sequence Exemplary iRNA agents 775 cauguuaguu accuuauagu uac 23 776 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 776 uguuaguuac cuuauaguun n 21 777 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 777 aacuauaagg uaacuaacan n 21 778 23 RNA Artificial Sequence Exemplary iRNA agents 778 auguuaguua ccuuauaguu acu 23 779 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 779 guuaguuacc uuauaguuan n 21 780 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 780 uaacuauaag guaacuaacn n 21 781 23 RNA Artificial Sequence Exemplary iRNA agents 781 uguuaguuac cuuauaguua cug 23 782 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 782 uuaguuaccu uauaguuacn n 21 783 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 783 guaacuauaa gguaacuaan n 21 784 23 RNA Artificial Sequence Exemplary iRNA agents 784 guuaguuacc uuauaguuac ugu 23 785 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 785 uaguuaccuu auaguuacun n 21 786 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 786 aguaacuaua agguaacuan n 21 787 23 RNA Artificial Sequence Exemplary iRNA agents 787 uuaguuaccu uauaguuacu gug 23 788 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 788 aguuaccuua uaguuacugn n 21 789 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 789 caguaacuau aagguaacun n 21 790 23 RNA Artificial Sequence Exemplary iRNA agents 790 uaguuaccuu auaguuacug ugu 23 791 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 791 guuaccuuau aguuacugun n 21 792 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20,

21 n = 2'-deoxy-thymidine 792 acaguaacua uaagguaacn n 21 793 23 RNA Artificial Sequence Exemplary iRNA agents 793 aguuaccuua uaguuacugu gua 23 794 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 794 uuaccuuaua guuacugugn n 21 795 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 795 cacaguaacu auaagguaan n 21 796 23 RNA Artificial Sequence Exemplary iRNA agents 796 guuaccuuau aguuacugug uaa 23 797 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 797 uaccuuauag uuacugugun n 21 798 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 798 acacaguaac uauaagguan n 21 799 23 RNA Artificial Sequence Exemplary iRNA agents 799 uuaccuuaua guuacugugu aau 23 800 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 800 accuuauagu uacuguguan n 21 801 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 801 uacacaguaa cuauaaggun n 21 802 23 RNA Artificial Sequence Exemplary iRNA agents 802 uaccuuauag uuacugugua auu 23 803 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 803 ccuuauaguu acuguguaan n 21 804 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 804 uuacacagua acuauaaggn n 21 805 23 RNA Artificial Sequence Exemplary iRNA agents 805 accuuauagu uacuguguaa uua 23 806 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 806 cuuauaguua cuguguaaun n 21 807 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 807 auuacacagu aacuauaagn n 21 808 23 RNA Artificial Sequence Exemplary iRNA agents 808 ccuuauaguu acuguguaau uag 23 809 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 809 uuauaguuac uguguaauun n 21 810 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 810 aauuacacag uaacuauaan n 21 811 23 RNA Artificial Sequence Exemplary iRNA agents 811 cuuauaguua cuguguaauu agu 23 812 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 812 uauaguuacu guguaauuan n 21 813 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 813 uaauuacaca guaacuauan n 21 814 23 RNA Artificial Sequence Exemplary iRNA agents 814 uuauaguuac uguguaauua gug 23 815 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 815 auaguuacug uguaauuagn n 21 816 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 816 cuaauuacac aguaacuaun n 21 817 23 RNA Artificial Sequence Exemplary iRNA agents 817 uauaguuacu guguaauuag ugc 23 818 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 818 uaguuacugu guaauuagun n 21 819 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 819 acuaauuaca caguaacuan n 21 820 23 RNA Artificial Sequence Exemplary iRNA agents 820 auaguuacug uguaauuagu gcc 23 821 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 821 aguuacugug uaauuagugn n 21 822 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 822 cacuaauuac acaguaacun n 21 823 23 RNA Artificial Sequence Exemplary iRNA agents 823 uaguuacugu guaauuagug cca 23 824 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 824 guuacugugu aauuagugcn n 21 825 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 825 gcacuaauua cacaguaacn n 21 826 23 RNA Artificial Sequence Exemplary iRNA agents 826 aguuacugug uaauuagugc cac 23 827 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 827 uuacugugua auuagugccn n 21 828 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 828 ggcacuaauu acacaguaan n 21 829 23 RNA Artificial Sequence Exemplary iRNA agents 829 guuacugugu aauuagugcc acu 23 830 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 830 uacuguguaa uuagugccan n 21 831 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 831 uggcacuaau uacacaguan n 21 832 23 RNA Artificial Sequence Exemplary iRNA agents 832 uuacugugua auuagugcca cuu 23 833 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 833 acuguguaau uagugccacn n 21 834 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 834 guggcacuaa uuacacagun n 21 835 23 RNA Artificial Sequence Exemplary iRNA agents 835 uacuguguaa uuagugccac uua 23 836 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 836 cuguguaauu agugccacun n 21 837 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 837 aguggcacua auuacacagn n 21 838 23 RNA Artificial Sequence Exemplary iRNA agents 838 acuguguaau uagugccacu uaa 23 839 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 839 uguguaauua gugccacuun n 21 840 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 840 aaguggcacu aauuacacan n 21 841 23 RNA Artificial Sequence Exemplary iRNA agents 841 cuguguaauu agugccacuu aau 23 842 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 842 guguaauuag ugccacuuan n 21 843 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 843 uaaguggcac uaauuacacn n 21 844 23 RNA Artificial Sequence Exemplary iRNA agents 844 uguguaauua gugccacuua aug 23 845 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 845 uguaauuagu gccacuuaan n 21 846 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 846 uuaaguggca cuaauuacan n 21 847 23 RNA Artificial Sequence Exemplary iRNA agents 847 guguaauuag ugccacuuaa ugu 23 848 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 848 guaauuagug ccacuuaaun n 21 849 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 849 auuaaguggc acuaauuacn n 21 850 23 RNA Artificial Sequence Exemplary iRNA agents 850 uguaauuagu gccacuuaau gua 23 851 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 851 uaauuagugc cacuuaaugn n 21 852 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 852 cauuaagugg cacuaauuan n 21 853 23 RNA Artificial Sequence Exemplary iRNA agents 853 guaauuagug ccacuuaaug uau 23 854 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 854 aauuagugcc acuuaaugun n 21 855 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 855 acauuaagug gcacuaauun n 21 856 23 RNA Artificial Sequence Exemplary iRNA agents 856 uaauuagugc cacuuaaugu aug 23 857 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 857 auuagugcca cuuaauguan n 21 858 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 858 uacauuaagu ggcacuaaun n 21 859 23 RNA Artificial Sequence Exemplary iRNA agents 859 aauuagugcc acuuaaugua ugu 23 860 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 860 uuagugccac uuaauguaun n 21 861 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 861 auacauuaag uggcacuaan n 21 862 23 RNA Artificial Sequence Exemplary iRNA agents 862 auuagugcca cuuaauguau guu 23 863 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 863 uagugccacu uaauguaugn n 21 864 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 864 cauacauuaa guggcacuan n 21 865 23 RNA Artificial Sequence Exemplary iRNA agents 865 uuagugccac uuaauguaug uua 23 866 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 866 agugccacuu aauguaugun n 21 867 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 867 acauacauua aguggcacun n 21 868 23 RNA Artificial Sequence Exemplary iRNA agents 868 uagugccacu uaauguaugu uac 23 869 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 869 gugccacuua auguauguun n 21 870 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 870 aacauacauu aaguggcacn n 21 871 23 RNA Artificial Sequence Exemplary iRNA agents 871 agugccacuu aauguauguu acc 23 872 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 872 ugccacuuaa uguauguuan n 21 873 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 873 uaacauacau uaaguggcan n 21 874 23 RNA Artificial Sequence Exemplary iRNA agents 874 gugccacuua auguauguua cca 23 875 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 875 gccacuuaau guauguuacn n 21 876 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 876 guaacauaca uuaaguggcn n 21 877 23 RNA Artificial Sequence Exemplary iRNA agents 877 ugccacuuaa uguauguuac caa 23 878 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 878 ccacuuaaug uauguuaccn n 21 879 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 879 gguaacauac auuaaguggn n 21 880 23 RNA Artificial Sequence Exemplary iRNA agents 880 gccacuuaau guauguuacc aaa 23 881 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 881 cacuuaaugu auguuaccan n 21 882 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 882 ugguaacaua cauuaagugn n 21 883 23 RNA Artificial Sequence Exemplary iRNA agents 883 ccacuuaaug uauguuacca aaa 23 884 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 884 acuuaaugua uguuaccaan n 21 885 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 885 uugguaacau acauuaagun n 21 886 23 RNA Artificial Sequence Exemplary iRNA agents 886 cacuuaaugu auguuaccaa aaa 23 887 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 887 cuuaauguau guuaccaaan n 21 888 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 888 uuugguaaca uacauuaagn n 21 889 23 RNA Artificial Sequence Exemplary iRNA agents 889 acuuaaugua uguuaccaaa aau 23 890 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 890 uuaauguaug uuaccaaaan n 21 891 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 891 uuuugguaac auacauuaan n 21 892 23 RNA Artificial Sequence Exemplary iRNA agents 892 cuuaauguau guuaccaaaa aua 23 893 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 893 uaauguaugu uaccaaaaan n 21 894 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 894 uuuuugguaa cauacauuan n 21 895 23 RNA Artificial Sequence Exemplary iRNA agents 895 aauaaauaua ucuaccccag acu 23 896 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 896 uaaauauauc uaccccagan n 21 897 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 897 ucugggguag auauauuuan n 21 898 23 RNA Artificial Sequence Exemplary iRNA agents 898 auaaauauau cuaccccaga cua 23 899 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 899 aaauauaucu accccagacn n 21 900 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 900 gucuggggua gauauauuun n 21 901 23 RNA Artificial Sequence Exemplary iRNA agents 901 uaaauauauc uaccccagac uag 23 902 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 902 aauauaucua ccccagacun n 21 903 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 903 agucuggggu agauauauun n 21 904 23 RNA Artificial Sequence Exemplary iRNA agents 904 aaauauaucu accccagacu aga 23 905 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n =

2'-deoxy-thymidine 905 auauaucuac cccagacuan n 21 906 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 906 uagucugggg uagauauaun n 21 907 23 RNA Artificial Sequence Exemplary iRNA agents 907 aauauaucua ccccagacua gau 23 908 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 908 uauaucuacc ccagacuagn n 21 909 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 909 cuagucuggg guagauauan n 21 910 23 RNA Artificial Sequence Exemplary iRNA agents 910 auauaucuac cccagacuag aug 23 911 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 911 auaucuaccc cagacuagan n 21 912 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 912 ucuagucugg gguagauaun n 21 913 23 RNA Artificial Sequence Exemplary iRNA agents 913 uauaucuacc ccagacuaga ugu 23 914 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 914 uaucuacccc agacuagaun n 21 915 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 915 aucuagucug ggguagauan n 21 916 23 RNA Artificial Sequence Exemplary iRNA agents 916 auaucuaccc cagacuagau gua 23 917 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 917 aucuacccca gacuagaugn n 21 918 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 918 caucuagucu gggguagaun n 21 919 23 RNA Artificial Sequence Exemplary iRNA agents 919 uaucuacccc agacuagaug uag 23 920 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 920 ucuaccccag acuagaugun n 21 921 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 921 acaucuaguc ugggguagan n 21 922 23 RNA Artificial Sequence Exemplary iRNA agents 922 aucuacccca gacuagaugu agu 23 923 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 923 cuaccccaga cuagauguan n 21 924 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 924 uacaucuagu cugggguagn n 21 925 23 RNA Artificial Sequence Exemplary iRNA agents 925 ucuaccccag acuagaugua gua 23 926 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 926 uaccccagac uagauguagn n 21 927 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 927 cuacaucuag ucugggguan n 21 928 23 RNA Artificial Sequence Exemplary iRNA agents 928 cuaccccaga cuagauguag uau 23 929 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 929 accccagacu agauguagun n 21 930 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 930 acuacaucua gucuggggun n 21 931 23 RNA Artificial Sequence Exemplary iRNA agents 931 uaccccagac uagauguagu auu 23 932 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 932 ccccagacua gauguaguan n 21 933 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 933 uacuacaucu agucuggggn n 21 934 23 RNA Artificial Sequence Exemplary iRNA agents 934 accccagacu agauguagua uuu 23 935 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 935 cccagacuag auguaguaun n 21 936 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 936 auacuacauc uagucugggn n 21 937 23 RNA Artificial Sequence Exemplary iRNA agents 937 ccccagacua gauguaguau uuu 23 938 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 938 ccagacuaga uguaguauun n 21 939 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 939 aauacuacau cuagucuggn n 21 940 23 RNA Artificial Sequence Exemplary iRNA agents 940 cccagacuag auguaguauu uuu 23 941 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 941 cagacuagau guaguauuun n 21 942 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 942 aaauacuaca ucuagucugn n 21 943 23 RNA Artificial Sequence Exemplary iRNA agents 943 ccagacuaga uguaguauuu uuu 23 944 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 944 agacuagaug uaguauuuun n 21 945 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 945 aaaauacuac aucuagucun n 21 946 23 RNA Artificial Sequence Exemplary iRNA agents 946 cagacuagau guaguauuuu uug 23 947 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 947 gacuagaugu aguauuuuun n 21 948 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 948 aaaaauacua caucuagucn n 21 949 23 RNA Artificial Sequence Exemplary iRNA agents 949 agacuagaug uaguauuuuu ugu 23 950 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 950 acuagaugua guauuuuuun n 21 951 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 951 aaaaaauacu acaucuagun n 21 952 23 RNA Artificial Sequence Exemplary iRNA agents 952 gacuagaugu aguauuuuuu gua 23 953 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 953 cuagauguag uauuuuuugn n 21 954 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 954 caaaaaauac uacaucuagn n 21 955 23 RNA Artificial Sequence Exemplary iRNA agents 955 acuagaugua guauuuuuug uau 23 956 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 956 uagauguagu auuuuuugun n 21 957 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 957 acaaaaaaua cuacaucuan n 21 958 23 RNA Artificial Sequence Exemplary iRNA agents 958 cuagauguag uauuuuuugu aua 23 959 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 959 agauguagua uuuuuuguan n 21 960 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 960 uacaaaaaau acuacaucun n 21 961 23 RNA Artificial Sequence Exemplary iRNA agents 961 uagauguagu auuuuuugua uaa 23 962 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 962 gauguaguau uuuuuguaun n 21 963 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 963 auacaaaaaa uacuacaucn n 21 964 23 RNA Artificial Sequence Exemplary iRNA agents 964 agauguagua uuuuuuguau aau 23 965 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 965 auguaguauu uuuuguauan n 21 966 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 966 uauacaaaaa auacuacaun n 21 967 23 RNA Artificial Sequence Exemplary iRNA agents 967 gauguaguau uuuuuguaua auu 23 968 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 968 uguaguauuu uuuguauaan n 21 969 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 969 uuauacaaaa aauacuacan n 21 970 23 RNA Artificial Sequence Exemplary iRNA agents 970 auguaguauu uuuuguauaa uug 23 971 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 971 guaguauuuu uuguauaaun n 21 972 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 972 auuauacaaa aaauacuacn n 21 973 23 RNA Artificial Sequence Exemplary iRNA agents 973 uguaguauuu uuuguauaau ugg 23 974 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 974 uaguauuuuu uguauaauun n 21 975 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 975 aauuauacaa aaaauacuan n 21 976 23 RNA Artificial Sequence Exemplary iRNA agents 976 guaguauuuu uuguauaauu gga 23 977 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 977 aguauuuuuu guauaauugn n 21 978 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 978 caauuauaca aaaaauacun n 21 979 23 RNA Artificial Sequence Exemplary iRNA agents 979 uaguauuuuu uguauaauug gau 23 980 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 980 guauuuuuug uauaauuggn n 21 981 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 981 ccaauuauac aaaaaauacn n 21 982 23 RNA Artificial Sequence Exemplary iRNA agents 982 aguauuuuuu guauaauugg auu 23 983 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 983 uauuuuuugu auaauuggan n 21 984 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 984 uccaauuaua caaaaaauan n 21 985 23 RNA Artificial Sequence Exemplary iRNA agents 985 guauuuuuug uauaauugga uuu 23 986 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 986 auuuuuugua uaauuggaun n 21 987 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 987 auccaauuau acaaaaaaun n 21 988 23 RNA Artificial Sequence Exemplary iRNA agents 988 uauuuuuugu auaauuggau uuc 23 989 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 989 uuuuuuguau aauuggauun n 21 990 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 990 aauccaauua uacaaaaaan n 21 991 23 RNA Artificial Sequence Exemplary iRNA agents 991 auuuuuugua uaauuggauu ucc 23 992 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 992 uuuuuguaua auuggauuun n 21 993 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 993 aaauccaauu auacaaaaan n 21 994 23 RNA Artificial Sequence Exemplary iRNA agents 994 uuuuuuguau aauuggauuu ccu 23 995 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 995 uuuuguauaa uuggauuucn n 21 996 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 996 gaaauccaau uauacaaaan n 21 997 23 RNA Artificial Sequence Exemplary iRNA agents 997 uuuuuguaua auuggauuuc cua 23 998 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 998 uuuguauaau uggauuuccn n 21 999 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 999 ggaaauccaa uuauacaaan n 21 1000 23 RNA Artificial Sequence Exemplary iRNA agents 1000 uuuuguauaa uuggauuucc uaa 23 1001 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 1001 uuguauaauu ggauuuccun n 21 1002 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 1002 aggaaaucca auuauacaan n 21 1003 23 RNA Artificial Sequence Exemplary iRNA agents 1003 uuuguauaau uggauuuccu aau 23 1004 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 1004 uguauaauug gauuuccuan n 21 1005 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 1005 uaggaaaucc aauuauacan n 21 1006 23 RNA Artificial Sequence Exemplary iRNA agents 1006 uuguauaauu ggauuuccua aua 23 1007 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 1007 guauaauugg auuuccuaan n 21 1008 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 1008 uuaggaaauc caauuauacn n 21 1009 23 RNA Artificial Sequence Exemplary iRNA agents 1009 uguauaauug gauuuccuaa uac 23 1010 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 1010 uauaauugga uuuccuaaun n 21 1011 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 1011 auuaggaaau ccaauuauan n 21 1012 23 RNA Artificial Sequence Exemplary iRNA agents 1012 guauuuggaa auaaagucag aug 23 1013 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 1013 auuuggaaau aaagucagan n 21 1014 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 1014 ucugacuuua uuuccaaaun n 21 1015 23 RNA Artificial Sequence Exemplary iRNA agents 1015 uauuuggaaa uaaagucaga ugg 23 1016 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 1016 uuuggaaaua aagucagaun n 21 1017 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 1017 aucugacuuu auuuccaaan n 21 1018 23 RNA

Artificial Sequence Exemplary iRNA agents 1018 auuuggaaau aaagucagau gga 23 1019 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 1019 uuggaaauaa agucagaugn n 21 1020 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 1020 caucugacuu uauuuccaan n 21 1021 23 RNA Artificial Sequence Exemplary iRNA agents 1021 uuuggaaaua aagucagaug gaa 23 1022 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 1022 uggaaauaaa gucagauggn n 21 1023 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 1023 ccaucugacu uuauuuccan n 21 1024 23 RNA Artificial Sequence Exemplary iRNA agents 1024 uuggaaauaa agucagaugg aaa 23 1025 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 1025 ggaaauaaag ucagauggan n 21 1026 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 1026 uccaucugac uuuauuuccn n 21 1027 23 RNA Artificial Sequence Exemplary iRNA agents 1027 uggaaauaaa gucagaugga aaa 23 1028 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 1028 gaaauaaagu cagauggaan n 21 1029 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 1029 uuccaucuga cuuuauuucn n 21 1030 23 RNA Artificial Sequence Exemplary iRNA agents 1030 ucccucccag aggagccacc agu 23 1031 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 1031 ccucccagag gagccaccan n 21 1032 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 1032 ugguggcucc ucugggaggn n 21 1033 23 RNA Artificial Sequence Exemplary iRNA agents 1033 cccucccaga ggagccacca guu 23 1034 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 1034 cucccagagg agccaccagn n 21 1035 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 1035 cugguggcuc cucugggagn n 21 1036 23 RNA Artificial Sequence Exemplary iRNA agents 1036 ccucccagag gagccaccag uuc 23 1037 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 1037 ucccagagga gccaccagun n 21 1038 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 1038 acugguggcu ccucugggan n 21 1039 23 RNA Artificial Sequence Exemplary iRNA agents 1039 cucccagagg agccaccagu ucu 23 1040 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 1040 cccagaggag ccaccaguun n 21 1041 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 1041 aacugguggc uccucugggn n 21 1042 23 RNA Artificial Sequence Exemplary iRNA agents 1042 ucccagagga gccaccaguu cuc 23 1043 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 1043 ccagaggagc caccaguucn n 21 1044 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 1044 gaacuggugg cuccucuggn n 21 1045 23 RNA Artificial Sequence Exemplary iRNA agents 1045 cccagaggag ccaccaguuc uca 23 1046 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 1046 cagaggagcc accaguucun n 21 1047 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 1047 agaacuggug gcuccucugn n 21 1048 23 RNA Artificial Sequence Exemplary iRNA agents 1048 cuucucucca gcugacuaaa cuu 23 1049 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 1049 ucucuccagc ugacuaaacn n 21 1050 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 1050 guuuagucag cuggagagan n 21 1051 23 RNA Artificial Sequence Exemplary iRNA agents 1051 uucuguacca guuaauuuuu cca 23 1052 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 1052 cuguaccagu uaauuuuucn n 21 1053 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 1053 gaaaaauuaa cugguacagn n 21 1054 23 RNA Artificial Sequence Exemplary iRNA agents 1054 ucuguaccag uuaauuuuuc caa 23 1055 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 1055 uguaccaguu aauuuuuccn n 21 1056 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 1056 ggaaaaauua acugguacan n 21 1057 23 RNA Artificial Sequence Exemplary iRNA agents 1057 cuguaccagu uaauuuuucc aac 23 1058 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 1058 guaccaguua auuuuuccan n 21 1059 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 1059 uggaaaaauu aacugguacn n 21 1060 23 RNA Artificial Sequence Exemplary iRNA agents 1060 uguaccaguu aauuuuucca acu 23 1061 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 1061 uaccaguuaa uuuuuccaan n 21 1062 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 1062 uuggaaaaau uaacugguan n 21 1063 23 RNA Artificial Sequence Exemplary iRNA agents 1063 guaccaguua auuuuuccaa cua 23 1064 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 1064 accaguuaau uuuuccaacn n 21 1065 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 1065 guuggaaaaa uuaacuggun n 21 1066 23 RNA Artificial Sequence Exemplary iRNA agents 1066 uaccaguuaa uuuuuccaac uac 23 1067 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 1067 ccaguuaauu uuuccaacun n 21 1068 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 1068 aguuggaaaa auuaacuggn n 21 1069 23 RNA Artificial Sequence Exemplary iRNA agents 1069 accaguuaau uuuuccaacu acu 23 1070 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 1070 caguuaauuu uuccaacuan n 21 1071 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 1071 uaguuggaaa aauuaacugn n 21 1072 23 RNA Artificial Sequence Exemplary iRNA agents 1072 uaauagaaua aaggcaguuu ucu 23 1073 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 1073 auagaauaaa ggcaguuuun n 21 1074 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 1074 aaaacugccu uuauucuaun n 21 1075 23 RNA Artificial Sequence Exemplary iRNA agents 1075 aauagaauaa aggcaguuuu cua 23 1076 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 1076 uagaauaaag gcaguuuucn n 21 1077 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 1077 gaaaacugcc uuuauucuan n 21 1078 23 RNA Artificial Sequence Exemplary iRNA agents 1078 auagaauaaa ggcaguuuuc uaa 23 1079 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 1079 agaauaaagg caguuuucun n 21 1080 21 DNA Artificial Sequence Exemplary iRNA agents misc_feature 20, 21 n = 2'-deoxy-thymidine 1080 agaaaacugc cuuuauucun n 21 1081 21 DNA Artificial Sequence Synthetically generated oligonucleotide misc_feature 20, 21 n = 2'-deoxy-thymidine 1081 gauuaugacc gucugaggcn n 21 1082 21 DNA Artificial Sequence Synthetically generated oligonucleotide misc_feature 20, 21 n = 2'-deoxy-thymidine 1082 gccucagucg gucauaaucn n 21 1083 21 DNA Artificial Sequence Synthetically generated oligonucleotide misc_feature 20 n = 2'-deoxy-thymidine misc_feature 21 n = 2'-deoxy-thymidine phosphorothioate linkages 1083 ggaucuucgg aaugaugagn n 21 1084 21 DNA Artificial Sequence Synthetically generated oligonucleotide misc_feature 20 n = 2'-deoxy-thymidine misc_feature 21 n = 2'-deoxy-thymidine phosphorothioate linkages 1084 cucaucauuc cgaagauccn n 21 1085 21 DNA Artificial Sequence Synthetically generated oligonucleotide misc_feature 20, 21 n = 2'-deoxy-thymidine 1085 agaccaaaga cggagugagn n 21 1086 21 DNA Artificial Sequence Synthetically generated oligonucleotide misc_feature 20 n = 2'-deoxy-thymidine misc_feature 21 n = 2'-deoxy-thymidine phosphorothioate linkages 1086 cucacuccgu cuuuggucun n 21 1087 21 DNA Artificial Sequence Synthetically generated oligonucleotide misc_feature 20, 21 n = 2'-deoxy-thymidine 1087 ugaagcagga gccgguaaan n 21 1088 21 DNA Artificial Sequence Synthetically generated oligonucleotide misc_feature 20 n = 2'-deoxy-thymidine misc_feature 21 n = 2'-deoxy-thymidine phosphorothioate linkages 1088 uuuaccggcu ccugcuucan n 21 1089 21 DNA Artificial Sequence Synthetically generated oligonucleotide modified_base 2, 3, 5, 6, 9, 11, 12, 13,19 2'- O-methyl modification corresponding base misc_feature 20, n = 2'-deoxy-thymidine misc_feature 21 n = 2'-deoxy-thymidine phosphorothioate linkages 1089 gcuaccagua uuuagaagcn n 21 1090 21 DNA Artificial Sequence Synthetically generated oligonucleotide modified_base 6, 10, 16 2'- O-methyl modification corresponding base misc_feature 20 n = 2'-deoxy-thymidine misc_feature 21 n = 2'-deoxy-thymidine phosphorothioate linkages 1090 gcuucuaaau acugguagcn n 21 1091 21 DNA Artificial Sequence Synthetically generated oligonucleotide modified_base 1, 2, 4, 5, 8, 10, 11, 12, 18, 19 2'- O-methyl modification corresponding base misc_feature 20 n = 2'-deoxy-thymidine misc_feature 21 n = 2'-deoxy-thymidine phosphorothioate linkages 1091 cuaccaguau uuagaagccn n 21 1092 21 DNA Artificial Sequence Synthetically generated oligonucleotide modified_base 7, 11, 17 2'- O-methyl modification corresponding base misc_feature 20 n = 2'-deoxy-thymidine misc_feature 21 n = 2'-deoxy-thymidine phosphorothioate linkages 1092 ggcuucuaaa uacugguagn n 21 1093 21 DNA Artificial Sequence Synthetically generated oligonucleotide modified_base 2, 3, 5, 8, 9, 11, 12, 13, 14, 16, 19 2'- O-methyl modification corresponding base misc_feature 20 n = 2'-deoxy-thymidine misc_feature 21 n = 2'-deoxy-thymidine phosphorothioate linkages 1093 gcuguaacua cuuuauaacn n 21 1094 21 DNA Artificial Sequence Synthetically generated oligonucleotide modified_base 3, 5, 10, 14, 16 2'- O-methyl modification corresponding base misc_feature 20 n = 2'-deoxy-thymidine misc_feature 21 n = 2'-deoxy-thymidine phosphorothioate linkages 1094 guuauaaagu aguuacagcn n 21 1095 21 DNA Artificial Sequence Synthetically generated oligonucleotide modified_base 2, 3, 5, 6, 8, 10, 13, 14, 17, 19 2'- O-methyl modification corresponding base misc_feature 20 n = 2'-deoxy-thymidine misc_feature 21 n = 2'-deoxy-thymidine phosphorothioate linkages 1095 guuacugugu aauuagugcn n 21 1096 21 DNA Artificial Sequence Synthetically generated oligonucleotide modified_base 1, 5, 9, 11, 13, 16 2'- O-methyl modification corresponding base misc_feature 20 n = 2'-deoxy-thymidine misc_feature 21 n = 2'-deoxy-thymidine phosphorothioate linkages 1096 gcacuaauua cacaguaacn n 21 1097 21 DNA Artificial Sequence Synthetically generated oligonucleotide modified_base 1, 2, 4, 5, 6, 9, 11, 13, 15, 16, 18, 19 2'- O-methyl modification corresponding base misc_feature 20 n = 2'-deoxy-thymidine misc_feature 21 n = 2'-deoxy-thymidine phosphorothioate linkages 1097 ccacuuaaug uauguuaccn n 21 1098 21 DNA Artificial Sequence Synthetically generated oligonucleotide modified_base 3, 6, 8, 10, 13 2'- O-methyl modification corresponding base misc_feature 20 n = 2'-deoxy-thymidine misc_feature 21 n = 2'-deoxy-thymidine phosphorothioate linkages 1098 gguaacauac auuaaguggn n 21 1099 21 DNA Artificial Sequence Synthetically generated oligonucleotide modified_base 1, 4, 5, 6, 7, 10, 13, 14, 15 2'- O-methyl modification corresponding base misc_feature 20 n = 2'-deoxy-thymidine misc_feature 21 n = 2'-deoxy-thymidine phosphorothioate linkages 1099 cagcccugau aguuuagaan n 21 1100 21 DNA Artificial Sequence Synthetically generated oligonucleotide modified_base 4, 9, 12 2'- O-methyl modification corresponding base misc_feature 20 n = 2'-deoxy-thymidine misc_feature 21 n = 2'-deoxy-thymidine phosphorothioate linkages 1100 uucuaaacua ucagggcugn n 21 1101 21 DNA Artificial Sequence Synthetically generated oligonucleotide modified_base 2, 3, 4, 5, 8, 11, 12, 13 2'- O-methyl modification corresponding base misc_feature 20 n = 2'-deoxy-thymidine misc_feature 21 n = 2'-deoxy-thymidine phosphorothioate linkages 1101 gcccugauag uuuagaaaan n 21 1102 21 DNA Artificial Sequence Synthetically generated oligonucleotide modified_base 6, 11, 14 2'- O-methyl modification corresponding base misc_feature 20 n = 2'-deoxy-thymidine misc_feature 21 n = 2'-deoxy-thymidine phosphorothioate linkages 1102 uuuucuaaac uaucagggcn n 21 1103 21 DNA Artificial Sequence Synthetically generated oligonucleotide modified_base 1, 2, 3, 4, 7, 10, 11, 12, 19 2'- O-methyl modification corresponding base misc_feature 20 n = 2'-deoxy-thymidine misc_feature 21 n = 2'-deoxy-thymidine phosphorothioate linkages 1103 cccugauagu uuagaaaacn n 21 1104 21 DNA Artificial Sequence Synthetically generated oligonucleotide modified_base 7, 12, 15 2'- O-methyl modification corresponding base misc_feature 20 n = 2'-deoxy-thymidine misc_feature 20 n = 2'-deoxy-thymidine 1104 guuuucuaaa cuaucagggn n 21 1105 21 DNA Artificial Sequence Synthetically generated oligonucleotide modified_base 3, 6, 7, 8, 15, 17, 18, 19 2'- O-methyl modification corresponding base misc_feature 20 n = 2'-deoxy-thymidine misc_feature 21 n = 2'-deoxy-thymidine phosphorothioate linkages 1105 gauaguuuag

aaaacauccn n 21 1106 21 DNA Artificial Sequence Synthetically generated oligonucleotide modified_base 11, 16 2'- O-methyl modification corresponding base misc_feature 20 n = 2'-deoxy-thymidine misc_feature 21 n = 2'-deoxy-thymidine phosphorothioate linkages 1106 ggauguuuuc uaaacuaucn n 21 1107 21 DNA Artificial Sequence Synthetically generated oligonucleotide modified_base 1, 4, 5, 6, 13, 15, 16, 17, 18 2'- O-methyl modification corresponding base misc_feature 20 n = 2'-deoxy-thymidine misc_feature 21 n = 2'-deoxy-thymidine phosphorothioate linkages 1107 uaguuuagaa aacaucccan n 21 1108 21 DNA Artificial Sequence Synthetically generated oligonucleotide modified_base 13, 18 2'- O-methyl modification corresponding base misc_feature 20 n = 2'-deoxy-thymidine misc_feature 21 n = 2'-deoxy-thymidine phosphorothioate linkages 1108 ugggauguuu ucuaaacuan n 21 1109 21 DNA Artificial Sequence Synthetically generated oligonucleotide modified_base 1, 5, 6, 10, 12, 15, 17, 18, 19 2'- O-methyl modification corresponding base misc_feature 20 n = 2'-deoxy-thymidine misc_feature 21 n = 2'-deoxy-thymidine phosphorothioate linkages 1109 cagacuagau guaguauuun n 21 1110 21 DNA Artificial Sequence Synthetically generated oligonucleotide modified_base 4, 7, 9, 13 2'- O-methyl modification corresponding base misc_feature 20 n = 2'-deoxy-thymidine misc_feature 21 n = 2'-deoxy-thymidine phosphorothioate linkages 1110 aaauacuaca ucuagucugn n 21 1111 21 DNA Artificial Sequence Synthetically generated oligonucleotide modified_base 1, 2, 3, 4, 8, 9, 13, 15, 18 2'- O-methyl modification corresponding base misc_feature 20 n = 2'-deoxy-thymidine misc_feature 21 n = 2'-deoxy-thymidine phosphorothioate linkages 1111 ccccagacua gauguaguan n 21 1112 21 DNA Artificial Sequence Synthetically generated oligonucleotide modified_base 1, 4, 6, 10 2'- O-methyl modification corresponding base misc_feature 20 n = 2'-deoxy-thymidine misc_feature 21 n = 2'-deoxy-thymidine phosphorothioate linkages 1112 uacuacaucu agucuggggn n 21 1113 21 DNA Artificial Sequence Synthetically generated oligonucleotide modified_base 1, 2, 6, 7, 11, 13, 16, 18, 19 2'- O-methyl modification corresponding base misc_feature 20 n = 2'-deoxy-thymidine misc_feature 21 n = 2'-deoxy-thymidine phosphorothioate linkages 1113 ccagacuaga uguaguauun n 21 1114 21 DNA Artificial Sequence Synthetically generated oligonucleotide modified_base 3, 6, 8, 12 2'- O-methyl modification corresponding base misc_feature 20 n = 2'-deoxy-thymidine misc_feature 21 n = 2'-deoxy-thymidine phosphorothioate linkages 1114 aauacuacau cuagucuggn n 21 1115 21 DNA Artificial Sequence Synthetically generated oligonucleotide modified_base 1, 2, 3, 7, 8, 12, 14, 17, 19 2'- O-methyl modification corresponding base misc_feature 20 n = 2'-deoxy-thymidine misc_feature 21 n = 2'-deoxy-thymidine phosphorothioate linkages 1115 cccagacuag auguaguaun n 21 1116 21 DNA Artificial Sequence Synthetically generated oligonucleotide modified_base 2, 5, 7, 11 2'- O-methyl modification corresponding base misc_feature 20 n = 2'-deoxy-thymidine misc_feature 21 n = 2'-deoxy-thymidine phosphorothioate linkages 1116 auacuacauc uagucugggn n 21 1117 21 DNA Artificial Sequence Synthetically generated oligonucleotide modified_base 1, 3, 4, 6, 7, 8, 11, 13, 15, 17, 18 2'- O-methyl modification corresponding base misc_feature 20 n = 2'-deoxy-thymidine misc_feature 21 n = 2'-deoxy-thymidine phosphorothioate linkages 1117 ugccacuuaa uguauguuan n 21 1118 21 DNA Artificial Sequence Synthetically generated oligonucleotide modified_base 1, 4, 6, 8, 11, 18 2'- O-methyl modification corresponding base misc_feature 20 n = 2'-deoxy-thymidine misc_feature 21 n = 2'-deoxy-thymidine phosphorothioate linkages 1118 uaacauacau uaaguggcan n 21 1119 21 DNA Artificial Sequence Synthetically generated oligonucleotide modified_base 1, 3, 4, 6, 7, 8, 10, 11, 14, 15, 16, 17 2'- O-methyl modification corresponding base misc_feature 20 n = 2'-deoxy-thymidine misc_feature 21 n = 2'-deoxy-thymidine phosphorothioate linkages 1119 ugcuguuuau uaaucuuagn n 21 1120 21 DNA Artificial Sequence Synthetically generated oligonucleotide modified_base 2, 8, 11, 15, 18 2'- O-methyl modification corresponding base misc_feature 20 n = 2'-deoxy-thymidine misc_feature 21 n = 2'-deoxy-thymidine phosphorothioate linkages 1120 cuaagauuaa uaaacagcan n 21 1121 21 DNA Artificial Sequence Synthetically generated oligonucleotide modified_base 1, 2, 4, 6, 7, 10, 11, 13, 14, 15, 16, 18 2'- O-methyl modification corresponding base misc_feature 20 n = 2'-deoxy-thymidine misc_feature 21 n = 2'-deoxy-thymidine phosphorothioate linkages 1121 ucauguuagu uaccuuauan n 21 1122 21 DNA Artificial Sequence Synthetically generated oligonucleotide modified_base 1, 3, 8, 12, 15 2'- O-methyl modification corresponding base misc_feature 20 n = 2'-deoxy-thymidine misc_feature 21 n = 2'-deoxy-thymidine phosphorothioate linkages 1122 uauaagguaa cuaacaugan n 21 1123 21 DNA Artificial Sequence Synthetically generated oligonucleotide modified_base 1, 2, 5, 6, 9, 10, 11, 12, 13,, 14, 15, 18, 19 2'- O-methyl modification corresponding base misc_feature 20 n = 2'-deoxy-thymidine misc_feature 21 n = 2'-deoxy-thymidine phosphorothioate linkages 1123 ccaguuaauu uuuccaacun n 21 1124 21 DNA Artificial Sequence Synthetically generated oligonucleotide modified_base 13 2'- O-methyl modification corresponding base misc_feature 20 n = 2'-deoxy-thymidine misc_feature 21 n = 2'-deoxy-thymidine phosphorothioate linkages 1124 aguuggaaaa auuaacuggn n 21 1125 21 DNA Artificial Sequence Synthetically generated oligonucleotide modified_base 1, 3, 4, 5, 10, 11, 13, 17, 18 2'- O-methyl modification corresponding base misc_feature 20 n = 2'-deoxy-thymidine misc_feature 21 n = 2'-deoxy-thymidine phosphorothioate linkages 1125 uaccuaagau uacaaaucan n 21 1126 21 DNA Artificial Sequence Synthetically generated oligonucleotide modified_base 8, 14, 18 2'- O-methyl modification corresponding base misc_feature 20 n = 2'-deoxy-thymidine misc_feature 21 n = 2'-deoxy-thymidine phosphorothioate linkages 1126 ugauuuguaa ucuuagguan n 21 1127 21 DNA Artificial Sequence Synthetically generated oligonucleotide modified_base 1, 2, 3, 4, 6, 7, 9, 10, 13, 15, 16, 17 2'- O-methyl modification corresponding base misc_feature 20 n = 2'-deoxy-thymidine misc_feature 21 n = 2'-deoxy-thymidine phosphorothioate linkages 1127 ucuugcuacc aguauuuagn n 21 1128 21 DNA Artificial Sequence Synthetically generated oligonucleotide modified_base 2, 6, 12, 15 2'- O-methyl modification corresponding base misc_feature 20 n = 2'-deoxy-thymidine misc_feature 21 n = 2'-deoxy-thymidine phosphorothioate linkages 1128 cuaaauacug guagcaagan n 21 1129 21 DNA Artificial Sequence Synthetically generated oligonucleotide modified_base 1, 3, 5, 8, 9, 12, 14, 15, 17, 18, 19 2'- O-methyl modification corresponding base misc_feature 20 n = 2'-deoxy-thymidine misc_feature 21 n = 2'-deoxy-thymidine phosphorothioate linkages 1129 uguguaauua gugccacuun n 21 1130 21 DNA Artificial Sequence Synthetically generated oligonucleotide modified_base 7, 10, 14, 16, 18 2'- O-methyl modification corresponding base misc_feature 20 n = 2'-deoxy-thymidine misc_feature 21 n = 2'-deoxy-thymidine phosphorothioate linkages 1130 aaguggcacu aauuacacan n 21 1131 21 DNA Artificial Sequence Synthetically generated oligonucleotide modified_base 2, 3, 4, 5, 7, 8, 10, 11, 14, 16, 17, 18 2'- O-methyl modification corresponding base misc_feature 20 n = 2'-deoxy-thymidine misc_feature 21 n = 2'-deoxy-thymidine phosphorothioate linkages 1131 aucuugcuac caguauuuan n 21 1132 21 DNA Artificial Sequence Synthetically generated oligonucleotide modified_base 1, 5, 11, 14 2'- O-methyl modification corresponding base misc_feature 20 n = 2'-deoxy-thymidine misc_feature 21 n = 2'-deoxy-thymidine phosphorothioate linkages 1132 uaaauacugg uagcaagaun n 21 1133 21 DNA Artificial Sequence Synthetically generated oligonucleotide modified_base 1, 2, 4, 7, 8, 10, 11, 12, 13, 15, 18, 19 2'- O-methyl modification corresponding base misc_feature 20 n = 2'-deoxy-thymidine misc_feature 21 n = 2'-deoxy-thymidine phosphorothioate linkages 1133 cuguaacuac uuuauaacun n 21 1134 21 DNA Artificial Sequence Synthetically generated oligonucleotide modified_base 4, 6, 11, 15, 17 2'- O-methyl modification corresponding base misc_feature 20 n = 2'-deoxy-thymidine misc_feature 21 n = 2'-deoxy-thymidine phosphorothioate linkages 1134 aguuauaaag uaguuacagn n 21 1135 21 DNA Artificial Sequence Synthetically generated oligonucleotide modified_base 2, 6, 7, 11, 12, 14, 17, 18 2'- O-methyl modification corresponding base misc_feature 20 n = 2'-deoxy-thymidine misc_feature 21 n = 2'-deoxy-thymidine phosphorothioate linkages 1135 gugaauuagg cuguaacuan n 21 1136 21 DNA Artificial Sequence Synthetically generated oligonucleotide modified_base 1, 5, 7, 12, 17, 2'- O-methyl modification corresponding base misc_feature 20 n = 2'-deoxy-thymidine misc_feature 21 n = 2'-deoxy-thymidine phosphorothioate linkages 1136 uaguuacagc cuaauucacn n 21 1137 21 DNA Artificial Sequence Synthetically generated oligonucleotide modified_base 1, 2, 4, 5, 8, 10, 11, 12, 18, 19 2'- O-methyl modification corresponding base misc_feature 20 n = 2'-deoxy-thymidine misc_feature 21 n = 2'-deoxy-thymidine phosphorothioate linkages, conjugated 1-{6-[cholester-3-yloxycarbonylamino]- hexanoyl}-4-hydroxy-pyrrolidin-3-phosphorothioate diester 1137 cuaccaguau uuagaagccn n 21 1138 21 DNA Artificial Sequence Synthetically generated oligonucleotide modified_base 7, 11, 17 2'- O-methyl modification corresponding base misc_feature 20 n = 2'-deoxy-thymidine misc_feature 21 n = 2'-deoxy-thymidine phosphorothioate linkages 1138 ggcuucuaaa uacugguagn n 21 1139 21 DNA Artificial Sequence Synthetically generated oligonucleotide modified_base 1, 3, 4, 6, 7, 8, 10, 11, 14, 15, 16, 17 2'- O-methyl modification corresponding base misc_feature 20 n = 2'-deoxy-thymidine misc_feature 21 n = 2'-deoxy-thymidine phosphorothioate linkages, conjugated 1-{6-[cholester-3-yloxycarbonylamino]- hexanoyl}-4-hydroxy-pyrrolidin-3-phosphorothioate diester 1139 ugcuguuuau uaaucuuagn n 21 1140 21 DNA Artificial Sequence Synthetically generated oligonucleotide modified_base 2, 8, 11, 15, 18 2'- O-methyl modification corresponding base misc_feature 20 n = 2'-deoxy-thymidine misc_feature 21 n = 2'-deoxy-thymidine phosphorothioate linkages 1140 cuaagauuaa uaaacagcan n 21 1141 46 DNA Rattus norvegicus 1141 ccatttttct gggatgtttt ctaaattttt ctcttggaaa gaaagt 46 1142 45 DNA Rattus norvegicus 1142 acagaaatgc ttgacttctg gagttttttc tcttggaaag aaagt 45 1143 41 DNA Rattus norvegicus 1143 cttcaggttt taccggctcc tttttctctt ggaaagaaag t 41 1144 43 DNA Rattus norvegicus 1144 ctgtttgcca tatctctgcc tttttttctc ttggaaagaa agt 43 1145 43 DNA Rattus norvegicus 1145 ttggtctttg ctgaacactc catttttctc ttggaaagaa agt 43 1146 40 DNA Rattus norvegicus 1146 cccgcgtcta gcttgcagat ttttctcttg gaaagaaagt 40 1147 44 DNA Rattus norvegicus 1147 aggatgatgg gcacatttgg tttttaggca taggacccgt gtct 44 1148 45 DNA Rattus norvegicus 1148 gccttgtgtg ctcatcattc ctttttaggc ataggacccg tgtct 45 1149 46 DNA Rattus norvegicus 1149 tgcttcattt tggctaactc cctttttagg cataggaccc gtgtct 46 1150 44 DNA Rattus norvegicus 1150 tgtacccaaa agcgccaatc tttttaggca taggacccgt gtct 44 1151 43 DNA Rattus norvegicus 1151 gcagctctcg tggccatctt ttttaggcat aggacccgtg tct 43 1152 44 DNA Rattus norvegicus 1152 aggcaccccg actttttctt tttttaggca taggacccgt gtct 44 1153 21 DNA Rattus norvegicus 1153 ctatcagggc tgtcgatgga a 21 1154 23 DNA Rattus norvegicus 1154 gaagatcctt cttgttccca act 23 1155 23 DNA Rattus norvegicus 1155 caaaaacctc tctcactccg tct 23 1156 41 DNA Rattus norvegicus 1156 ccagcttccc attctcagcc tttttctctt ggaaagaaag t 41 1157 41 DNA Rattus norvegicus 1157 tctcgctcct ggaagatggt tttttctctt ggaaagaaag t 41 1158 41 DNA Rattus norvegicus 1158 cccatttgat gttagcggga tttttctctt ggaaagaaag t 41 1159 42 DNA Rattus norvegicus 1159 cggagatgat gacccttttg gtttttctct tggaaagaaa gt 42 1160 44 DNA Rattus norvegicus 1160 gatgggtttc ccgttgatga tttttaggca taggacccgt gtct 44 1161 47 DNA Rattus norvegicus 1161 gacatactca gcaccagcat cactttttag gcataggacc cgtgtct 47 1162 44 DNA Rattus norvegicus 1162 cccagccttc tccatggtgg tttttaggca taggacccgt gtct 44 1163 21 DNA Rattus norvegicus 1163 ttgactgtgc cgttgaactt g 21 1164 19 DNA Rattus norvegicus 1164 ccccaccctt caggtgagc 19 1165 17 DNA Rattus norvegicus 1165 ggcatcagcg gaagggg 17 1166 21 RNA Artificial Sequence Synthetically generated oligonucleotide 21 conjugated 1-{6-[cholester-3- yloxycarbonylamino]-hexanoyl}-4-hydroxy-pyrrolidin-3- phosphorothioate diester 1166 ccacaugaag cagcacgacu u 21 1167 23 RNA Artificial Sequence Synthetically generated oligonucleotide modified_base 21 2'- O-methyl modification corresponding base modified_base 22 2'- O-methyl modification corresponding base phosphorothioate linkages modified_base 23 phosphorothioate linkages corresponding base 1167 aagucgugcu gcuucaugug guc 23 1168 21 RNA Artificial Sequence Synthetically generated oligonucleotide modified_base 20, 21, phosphorothioate linkages corresponding base 1168 ccacaugaag cagcacgacu u 21 1169 23 RNA Artificial Sequence Synthetically generated oligonucleotide modified_base 21 2'- O-methyl modification corresponding base modified_base 22 2'- O-methyl modification corresponding base phosphorothioate linkages modified_base 23 phosphorothioate linkages corresponding base 1169 aagucgugcu gcuucaugug guc 23 1170 21 DNA Artificial Sequence Synthetically generated oligonucleotide modified_base 1, 2, 3, 5, 7, 8, 12, 14, 15, 16, 17 2'- O-methyl modification corresponding base misc_feature 20 n = 2'-deoxy-thymidine misc_feature 21 n = 2'-deoxy-thymidine phosphorothioate linkages, conjugated 1-{6-[cholester-3-yloxycarbonylamino]- hexanoyl}-4-hydroxy-pyrrolidin-3-phosphorothioate diester 1170 cuuacgcuga guacuucgan n 21 1171 21 DNA Artificial Sequence Synthetically generated oligonucleotide modified_base 7, 11, 16 2'- O-methyl modification corresponding base misc_feature 20 n = 2'-deoxy-thymidine misc_feature 21 n = 2'-deoxy-thymidine phosphorothioate linkages, conjugated 1-{6-[cholester-3-yloxycarbonylamino]- hexanoyl}-4-hydroxy-pyrrolidin-3-phosphorothioate diester 1171 ucgaaguacu cagcguaagn n 21

Claims

1. A method of stimulating neuronal cell outgrowth in a neural cell culture comprising contacting the neural cell culture with an iRNA agent, wherein the iRNA agent comprises (i) a sense strand, wherein the sense strand comprises at least 15 contiguous nucleotides that differ by no more than 1, 2, or 3 nucleotides from the sense strand sequences of any one agent selected from the group consisting of agents number 5850 to 6177, and (ii) an antisense strand, wherein the antisense strand comprises at least 15 contiguous nucleotides that differ by no more than 1, 2, or 3 nucleotides from the antisense sequences of any one agent selected from the group consisting of agents number 5850 to 6177.

2. A method of performing an animal study comprising: (a) providing an animal having a neural disfunction; (b) administering an iRNA agent wherein the iRNA agent comprises (i) a sense strand, wherein the sense strand comprises at least 15 contiguous nucleotides that differ by no more than 1, 2, or 3 nucleotides from the sense strand sequences of any one agent selected from the group consisting of agents number 5850 to 6177, and (ii) an antisense strand, wherein the antisense strand comprises at least 15 contiguous nucleotides that differ by no more than 1, 2, or 3 nucleotides from the antisense sequences of any one agent selected from the group consisting of agents number 5850 to 6177; and (c) monitoring the animal for an improvement in neural function.