U.S. patent application number 11/433257 was filed with the patent office on 2007-02-15 for method and antisense composition for selective inhibition of hiv infection in hematopoietic cells.
Invention is credited to Richard K. Bestwick, Patrick L. Iversen, Dan V. Mourich, Dwight D. Weller.
Application Number | 20070037764 11/433257 |
Document ID | / |
Family ID | 34555922 |
Filed Date | 2007-02-15 |
United States Patent
Application |
20070037764 |
Kind Code |
A1 |
Mourich; Dan V. ; et
al. |
February 15, 2007 |
Method and antisense composition for selective inhibition of HIV
infection in hematopoietic cells
Abstract
The invention provides antisense antiviral compounds and methods
of their use in inhibition of growth of human immunodeficiency
virus-1 (HOV-1), as in treatment of a viral infection. The
antisense antiviral compounds have morpholino subunits linked by
uncharged phosphorodiamidate linkages interspersed with cationic
phosphorodiamidate linkages. An exemplary embodiment of the
invention provides an antisense compound directed to the HIV Vif
gene, causing the production of defective HIV- 1 virions in an
infected individual.
Inventors: |
Mourich; Dan V.; (Albany,
OR) ; Iversen; Patrick L.; (Corvallis, OR) ;
Bestwick; Richard K.; (Corvallis, OR) ; Weller;
Dwight D.; (Corvallis, OR) |
Correspondence
Address: |
PERKINS COIE LLP
P.O. BOX 2168
MENLO PARK
CA
94026
US
|
Family ID: |
34555922 |
Appl. No.: |
11/433257 |
Filed: |
May 11, 2006 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10971959 |
Oct 21, 2004 |
|
|
|
11433257 |
May 11, 2006 |
|
|
|
60514064 |
Oct 23, 2003 |
|
|
|
Current U.S.
Class: |
514/44A ; 514/81;
544/81 |
Current CPC
Class: |
A61K 31/675 20130101;
C12N 15/1132 20130101; A61P 37/06 20180101; A61P 31/18 20180101;
C07K 2319/10 20130101; C12N 2310/11 20130101; C12N 2810/6054
20130101 |
Class at
Publication: |
514/044 ;
514/081; 544/081 |
International
Class: |
A61K 48/00 20060101
A61K048/00; C07F 9/6533 20060101 C07F009/6533 |
Claims
1. An antiviral compound directed against an human immunodeficiency
virus (HIV-1), comprising a morpholino oligonucleotide compound
composed of 12 to 40 morpholino subunits (a) with a targeting base
sequence that is substantially complementary to a viral target
sequence composed of at least 12 contiguous bases in a region of
HIV-1 positive strand RNA identified by one of the sequences
selected from the group consisting of SEQ ID NOS:17-19, and (b)
that are linked by uncharged phosphorodiamidate linkages
interspersed with at least two and up to half positively charged
phosphorodiamidate linkages.
2. The compound of claim 1, wherein said morpholino subunits are
joined by phosphorodiamidate linkages, in accordance with the
structure: ##STR2## where Y.sub.1.dbd.O, Z=O, Pj is a purine or
pyrimidine base-pairing moiety effective to bind, by base-specific
hydrogen bonding, to a base in a polynucleotide (where base-pairing
moieties on different subunits may be the same or different), and X
is alkyl, alkoxy, thioalkoxy, or alkyl amino of the form NR.sub.2,
where each R is independently hydrogen or methyl, for the uncharged
linkages, and the positively charged linkages are represented by
the same structure, but where X is 1-piperazino.
3. The compound of claim 1, which has a T.sub.m, with respect to
binding to said viral target sequence, of greater than about
45.degree. C., and said compound is actively taken up by mammalian
cells.
4. The compound of claim 1, wherein the antisense compound is
capable of hybridizing with a sequence consisting of SEQ ID NO:17
(i) to form a heteroduplex structure having a Tm of dissociation of
at least 45 degrees C., and (ii) to inhibit the synthesis of the
HIV Vif protein in the infected cells.
5. The compound of claim 4, having a targeting sequence with at
least 90% homology to a sequence selected from SEQ ID NOS.5-13
6. The compound of claim 1, wherein said compound is a covalent
conjugate of the oligonucloeotide and an arginine-rich polypeptide
effective to enhance the uptake of the compound into host
cells.
7. The compound of claim 1, wherein the arginine-rich polypeptide
has a sequence selected from the group consisting of SEQ ID NOS:
1-4.
8. The compound of claim 1, wherein the antisense compound is
capable of hybridizing with a sequence selected from the group
consisting of SEQ ID NOS: 18 and 19 to form a heteroduplex
structure having a Tm of dissociation of at least 45 degrees C.
9. The compound of claim 1, wherein the antisense compound has at
least 12 contiguous bases from one of the sequences selected from
the group consisting of SEQ ID NOS: 14-16.
10. A method of inhibiting infection by an HIV-1 virus in a
subject, comprising: administering to the subject, a
therapeutically effective amount of a morpholino oligonucleotide
compound composed of 12 to 40 morpholino subunits (a) with a
targeting base sequence that is substantially complementary to a
viral target sequence composed of at least 12 contiguous bases in
in a region of HIV-1 positive strand RNA identified by one of the
sequences selected from the group consisting of SEQ ID NOS:17-19,
and (b) that are linked by uncharged phosphorodiamidate linkages
interspersed with at least two and up to half positively charged
phosphorodiamidate linkages.
11. The method of claim 10, wherein said morpholino subunits are
joined by phosphorodiamidate linkages, in accordance with the
structure: ##STR3## where Y.sub.1.dbd.O, Z=O, Pj is a purine or
pyrimidine base-pairing moiety effective to bind, by base-specific
hydrogen bonding , to a base in a polynucleotide (where
base-pairing moieties on different subunits may be the same or
different), and X is alkyl, alkoxy, thioalkoxy, or alkyl amino of
the form NR.sub.2, where each R is independently hydrogen or
methyl, for the uncharged linkages, and the positively charged
linkages are represented by the same structure, but where X is
1-piperazino.
12. The method of claim 10, wherein the compound has a T.sub.m,
with respect to binding to said viral target sequence, of greater
than about 50.degree. C., and said compound is actively taken up by
mammalian cells.
13. The method of claim 10, wherein the antisense compound is
capable of hybridizing with a sequence consisting of SEQ ID NO:17
(i) to form a heteroduplex structure having a Tm of dissociation of
at least 45 degrees C., and (ii) to inhibit the synthesis of the
HIV Vif protein in the infected cells.
14. The method of claim 10, wherein the compound has a targeting
sequence having at least 90% homology to a sequence selected from
the group consisting of SEQ ID NOS.5-13.
15. The method of claim 10, wherein said compound is a covalent
conjugate of the oligonucloeotide and an arginine-rich polypeptide
effective to enhance the uptake of the compound into host
cells.
16. The method of claim 10, wherein the arginine-rich polypeptide
has a sequence selected from the group consisting of SEQ ID NOS:
1-4.
17. The method of claim 10, wherein the antisense compound is
capable of hybridizing with a sequence selected from the group
consisting of SEQ ID NOS:18 and 19 to form a heteroduplex structure
having a Tm of dissociation of at least 45 degrees C.
18. The method of claim 10, wherein the antisense compound has at
least 12 contiguous bases from one of the sequences selected from
the group consisting of SEQ ID NOS:14-16.
Description
[0001] This is a continuation-in-part of U.S. patent application
Ser. No. 10/971,959, filed Oct. 21, 2004, now pending, which claims
the benefit of priority to U.S. Provisional Application No.
60/514,064, filed Oct. 23, 2003. Both applications are incorporated
herein by reference.
FIELD OF THE INVENTION
[0002] The present invention is drawn to novel antiviral antisense
oligomers and their use in inhibiting HIV- 1 infection and
replication in hematopoietic cells, in particular, macrophage and T
lymphocyte cells.
REFERENCES
[0003] Agrawal, S., S. H. Mayrand, et al. (1990). "Site-specific
excision from RNA by RNase H and mixed-phosphate-backbone
oligodeoxynucleotides." Proc Natl Acad Sci USA 87(4): 1401-5.
[0004] Akhtar, S., S. Basu, et al. (1991). "Interactions of
antisense DNA oligonucleotide analogs with phospholipid membranes
(liposomes)." Nucleic Acids Res 19(20): 5551-9.
[0005] Aldrovandi, G. M. and J. A. Zack (1996). "Replication and
pathogenicity of human immunodeficiency virus type 1 accessory gene
mutants in SCID-hu mice." J Virol 70(3): 1505-11.
[0006] Anderson, C. M., W. Xiong, et al. (1999). "Distribution of
equilibrative, nitrobenzylthioinosine-sensitive nucleoside
transporters (ENT1) in brain." J Neurochem 73(2): 867-73.
[0007] Anderson, K. P., M. C. Fox, et al. (1996). "Inhibition of
human cytomegalovirus immediate-early gene expression by an
antisense oligonucleotide complementary to immediate-early RNA."
Antimicrob Agents Chemother 40(9): 2004-11.
[0008] Berrey, M. M., T. Schacker, et al. (2001). "Treatment of
primary human immunodeficiency virus type 1 infection with potent
antiretroviral therapy reduces frequency of rapid progression to
AIDS." J Infect Dis 183(10): 1466-75.
[0009] Bonham, M. A., S. Brown, et al. (1995). "An assessment of
the antisense properties of RNase H-competent and steric-blocking
oligomers." Nucleic Acids Res 23(7): 1197-203.
[0010] Boudvillain, M., M. Guerin, et al. (1997).
"Transplatin-modified oligo(2'-O-methyl ribonucleotide)s: a new
tool for selective modulation of gene expression." Biochemistry
36(10): 2925-31.
[0011] Courcoul, M., C. Patience, et al. (1995). "Peripheral blood
mononuclear cells produce normal amounts of defective Vif- human
immunodeficiency virus type 1 particles which are restricted for
the preretrotranscription steps." J Virol 69(4): 2068-74.
[0012] Desrosiers, R. C., J. D. Lifson, et al. (1998).
"Identification of highly attenuated mutants of simian
immunodeficiency virus." J Virol 72(2): 1431-7.
[0013] Dettenhofer, M., S. Cen, et al. (2000). "Association of
human immunodeficiency virus type 1 Vif with RNA and its role in
reverse transcription." J Virol 74(19): 8938-45.
[0014] Ding, D., S. M. Grayaznov, et al. (1996). "An
oligodeoxyribonucleotide N3'->P5' phosphoramidate duplex forms
an A-type helix in solution." Nucleic Acids Res 24(2): 354-60.
[0015] Gee, J. E., I. Robbins, et al. (1998). "Assessment of
high-affinity hybridization, RNase H cleavage, and covalent linkage
in translation arrest by antisense oligonucleotides." Antisense
Nucleic Acid Drug Dev 8(2): 103-11.
[0016] Goncalves, J., Y. Korin, et al. (1996). "Role of Vif in
human immunodeficiency virus type 1 reverse transcription." J Virol
70(12): 8701-9.
[0017] Harris, R. S., K. N. Bishop, et al. (2003). "DNA deamination
mediates innate immunity to retroviral infection." Cell 113(6):
803-9.
[0018] Hudziak, R. M., E. Barofsky, et al. (1996). "Resistance of
morpholino phosphorodiamidate oligomers to enzymatic degradation."
Antisense Nucleic Acid Drug Dev 6(4): 267-72.
[0019] Kinter, A. L., C. A. Umscheid, et al. (2003). "HIV envelope
induces virus expression from resting CD4+T cells isolated from
HIV-infected individuals in the absence of markers of cellular
activation or apoptosis." J Immunol 170(5): 2449-55.
[0020] Loke, S. L., C. A. Stein, et al. (1989). "Characterization
of oligonucleotide transport into living cells." Proc Natl Acad Sci
USA 86(10): 3474-8.
[0021] Mariani, R., D. Chen, et al. (2003). "Species-specific
exclusion of APOBEC3G from HIV-1 virions by Vif." Cell 114(1):
21-31.
[0022] Marin, M., K. M. Rose, et al. (2003). "HIV-1 Vif protein
binds the editing enzyme APOBEC3G and induces its degradation." Nat
Med.
[0023] Moulton, H. M., M. C. Hase, et al. (2003). "HIV Tat peptide
enhances cellular delivery of antisense morpholino oligomers."
Antisense Nucleic Acid Drug Dev 13(1): 31-43.
[0024] Moulton, H. M. and J. D. Moulton (2003). "Peptide-assisted
delivery of steric-blocking antisense oligomers." Curr Opin Mol
Ther 5(2): 123-32.
[0025] Moulton, H. M., M. H. Nelson, et al. (2004). "Cellular
uptake of antisense morpholino oligomers conjugated to
arginine-rich peptides." Bioconjug Chem 15(2): 290-9.
[0026] Murphy, K. M., A. B. Heimberger, et al. (1990). "Induction
by antigen of intrathymic apoptosis of CD4+CD8+TCR1o thymocytes in
vivo." Science 250(4988): 1720-3.
[0027] Pari, G. S., A. K. Field, et aL (1995). "Potent antiviral
activity of an antisense oligonucleotide complementary to the
intron-exon boundary of human cytomegalovirus genes UL36 and UL37."
Antimicrob Agents Chemother 39(5): 1157-61.
[0028] Sheehy, A. M., N. C. Gaddis, et al. (2002). "Isolation of a
human gene that inhibits HIV-1 infection and is suppressed by the
viral Vif protein." Nature 418(6898): 646-50.
[0029] Simon, J. H. and M. H. Malim (1996). "The human
immunodeficiency virus type 1 Vif protein modulates the
postpenetration stability of viral nucleoprotein complexes." J
Virol 70(8): 5297-305.
[0030] Stein, D., E. Foster, et al. (1997). "A specificity
comparison of four antisense types: morpholino, 2'-O-methyl RNA,
DNA, and phosphorothioate DNA." Antisense Nucleic Acid Drug Dev
7(3): 151-7.
[0031] Summerton, J. and D. Weller (1997). "Morpholino antisense
oligomers: design, preparation, and properties." Antisense Nucleic
Acid Drug Dev 7(3): 187-95.
[0032] Toulme, J. J., R. L. Tinevez, et al. (1996). "Targeting RNA
structures by antisense oligonucleotides." Biochimie 78(7):
663-73.
[0033] Wender, P. A., D. J. Mitchell, et al. (2000). "The design,
synthesis, and evaluation of molecules that enable or enhance
cellular uptake: peptoid molecular transporters." Proc Natl Acad
Sci USA 97(24): 13003-8.
[0034] Yakubov, L. A., E. A. Deeva, et al. (1989). "Mechanism of
oligonucleotide uptake by cells: involvement of specific
receptors?" Proc Natl Acad Sci USA 86(17): 6454-8.
[0035] Zhu, T., D. Muthui, et al. (2002). "Evidence for human
immunodeficiency virus type 1 replication in vivo in CD 14(+)
monocytes and its potential role as a source of virus in patients
on highly active antiretroviral therapy." J Virol 76(2): 707-16
BACKGROUND OF THE INVENTION
[0036] Human immunodeficiency virus (HIV) has been identified as
the etiological agent responsible for acquired immune deficiency
syndrome (AIDS), a fatal disease characterized by destruction of
the immune system and the inability to fight off life threatening
opportunistic infections. Recent statistics (UNAIDS: AIDS Epidemic
Update, December 2002), indicate that as many as 42 million people
worldwide are infected with the virus. In addition to the large
number of individuals already infected, the virus continues to
spread. Estimates from 2002 indicate 5 million new infections in
that year alone. In the same year there were approximately 3.1
million deaths associated with HIV and AIDS.
[0037] The global health crisis caused by the human
immunodeficiency virus (HIV) is unquestioned, and while recent
advances in drug therapies have been successful in slowing the
progression of AIDS, there is still a need to find a safer, more
efficient way to control the virus. Although considerable effort is
being put into the successful design of effective therapeutics,
currently no curative anti-retroviral drugs against AIDS exist.
[0038] Presently available antiviral drugs to combat HIV infection
can be divided into three classes based on the viral protein they
target and their mode of action. Saquinavir, indinavir, ritonavir,
nelfinavir and amprenavir are competitive inhibitors of the
aspartyl protease expressed by HIV. Zidovudine, didanosine,
stavudine, lamivudine, zalcitabine and abacavir are nucleoside
reverse transcriptase inhibitors that block viral cDNA synthesis.
The non-nucleoside reverse transcriptase inhibitors, nevaripine,
delavamidine and efavirenz inhibit the synthesis of viral cDNA via
a non-competitive mechanism. Used alone these drugs are effective
in reducing viral replication. The antiviral effect is only
temporary as HIV rapidly develops resistance to all known agents.
To circumvent this problem, combination therapy (also called highly
active antiretroviral therapy, or HAART) has proven very effective
at both reducing virus load and suppressing the emergence of
resistance in a number of patients. In the US, where HAART is
widely available, the number of HIV-related deaths has declined
(Berrey, Schacker et al. 2001).
[0039] Despite the success obtained with HAART, approximately
30-50% of patients ultimately fail resulting in the emergence of
viral resistance. Viral resistance in turn is caused by the rapid
turnover of HIV- 1 during the course of infection combined with a
high viral mutation rate. Incomplete viral suppression is thought
to provide an environment for drug resistant variants to emerge.
Even when viral plasma levels have dropped below detectable levels
(<50 copies/ml) as a consequence of HAART, low-level HIV
replication continues (Zhu, Muthui et al. 2002; Kinter, Umscheid et
al. 2003). Clearly there is a need for new antiviral agents,
preferably targeting other viral enzymes to reduce the rate of
resistance and suppress viral replication even further.
SUMMARY OF THE INVENTION
[0040] In one aspect, the invention provides an antiviral compound
directed against a human immunodeficiency virus (HIV-1). The
antiviral compound comprises an oligomer or oligonucleotide
compound having a sequence of 12 to 40 morpholino subunits (a) with
a targeting base sequence that is substantially complementary to a
viral target sequence composed of at least 12 contiguous bases in a
region of HIV-1 positive strand RNA identified by one of the
sequences selected from the group consisting of SEQ ID NOS:17-19 of
and (b) that are linked by uncharged phosphorodiamidate linkages
interspersed with at least two and up to half positively charged
phosphorodiamidate linkages. In a preferred embodiment, the
uncharged, phosphorus-containing intersubunit linkages are
represented by the structure: ##STR1##
[0041] where Y.sub.1.dbd.O, Z=O, Pj is a purine or pyrimidine
base-pairing moiety effective to bind, by base-specific hydrogen
bonding , to a base in a polynucleotide (where base-pairing
moieties on different subunits may be the same or different), X is
alkyl, alkoxy, thioalkoxy, or alkyl amino of the form NR.sub.2,
where each R is independently hydrogen or methyl, and the
positively charged linkages are represented by the same structure,
but where X is 1-piperazino.
[0042] In one embodiment, the antisense compound is capable of
hybridizing with a sequence selected from the group consisting of
SEQ ID NO:17 (i) to form a heteroduplex structure having a Tm of
dissociation of at least 45.degree. C., and (ii) to inhibit the
synthesis of the HIV Vif protein in the infected cells. The
compound in this embodiment may have at least 12 contiguous bases
from one of the sequences selected from the group consisting of SEQ
ID NOS:5-13.
[0043] In another embodiment, the antisense compound is capable of
hybridizing with SEQ ID NO:18 (i) to form a heteroduplex structure
having a Tm of dissociation of at least 45.degree. C., and (ii) to
inhibit the transcription of HIV mRNA transcripts. The compound in
this embodiment may have at least 12 contiguous bases from the
sequences identified as SEQ ID NOS:14 and 15.
[0044] In another embodiment, the antisense compound is capable of
hybridizing with SEQ ID NOS: 19, (i) to form a heteroduplex
structure having a Tm of dissociation of at least 45.degree. C.,
and (ii) to inhibit reverse transcription of viral RNA by blocking
the minus-strand transfer step. The compound in this embodiment may
have at least 12 contiguous bases from the sequence identified as
SEQ ID NO:16.
[0045] In a related aspect, the invention includes a method of
selectively inhibiting HIV-1 replication in HIV-1-infected human
hematopoietic cells, e.g., macrophage or T lymphocyte cells. In
practicing the method, HIV-infected cells are exposed to an
antisense oligomer of the type described above, including exemplary
embodiments noted above.
[0046] These and other objects and features of the invention will
become more fully apparent when the following detailed description
of the invention is read in conjunction with the accompanying
drawings.
BRIEF DESCRIPTION OF THE FIGURES
[0047] FIGS. 1A-1D show several preferred morpholino-type subunits
having 5-atom (A), six-atom (B) and seven-atom (C-D) linking groups
suitable for forming polymers.
[0048] FIGS. 2A-2D show the repeating subunit segment of exemplary
morpholino oligonucleotides, designated A through D, constructed
using subunits A-D, respectively, of FIG. 1.
[0049] FIGS. 3A-3G show examples of uncharged linkage types in
oligonucleotide analogs. FIG. 3H shows a preferred positively
charged linkage.
[0050] FIGS. 4A-4C show fluorescence activated cell sorting (FACS)
analysis of uptake of rTAT-PMO conjugates into cultured splenocytes
incubated with fluorescent conjugates and subjected to various
lymphocyte activating substance in culture, as indicated. Separate
lymphocytes populations were stained with antibodies to determine
the extent of uptake by FACS analysis in CD8 positive T cells (FIG.
4A), CD4 positive T cells (FIG. 4B), and B cells (B220 positive
cells) (FIG. 4C).
[0051] FIGS. 5A-5B shows FACS analysis of conjugated PMO uptake
into naive and activated CD8 (FIG. 5A), and CD4 T-cells (FIG. 5B)
using PMO-0003 (arginine-rich peptide-PMO) and PMO-0002
(rTAT-PMO).
[0052] FIG. 6 shows the synthetic steps to produce subunits used to
produce +PMO containing the (1-piperazino) phosphinylideneoxy
cationic linkage as shown in FIG. 3H.
[0053] FIG. 7 shows the inhibition of HIV-1 replication in human H9
cells in the presence of a peptide-conjugated PMO that targets the
Vif AUG start codon (SEQ ID NO:
DETAILED DESCRIPTION OF THE INVENTION
[0054] I. Definitions
[0055] The terms below, as used herein, have the following
meanings, unless indicated otherwise.
[0056] The term "hematopoietic cells " refers specifically to T
cells (T lymphocyte cells), B cells (B lymphocyte cells),
monocytes, macrophages, dendritic cells and microglial cells among
the other cell lineages derived from these hematopoietic
precursors. All of these cells support HIV infection.
[0057] The term "activated, HIV-infected T-lymphocyte cells" refers
to T cells that become activated, either as a result of HIV
infection of the cells and/or after the T cell receptor (TCR)
complex and a co-stimulatory receptor (e.g. CD28 on naive CD4 and
CD8 T cells) are engaged to the extent that a signal transduction
cascade is initiated, following HIV infection. Upon activation, T
cells will proliferate and then secrete cytokines or carry out
cytolysis on cells expressing a specific foreign peptide with self
MHC. Cytokines are growth factors for other T cells, signals for B
cells to produce antibody and signals for the transcriptional
activation of HIV. The majority of HIV production in T cells is
linked to T cell activation as determined by classical activation
markers.
[0058] The term "macrophages" refer to mononuclear phagocytes which
are key components of innate immunity because they recognize,
ingest, and destroy many pathogens without the aid of an adaptive
immune response. They are also an important reservoir of HIV
infection and are able to harbor replicating virus without being
killed by it.
[0059] "Activated, HIV-infected macrophage cells" refers to
HIV-infected macrophage cells that have become activated either as
a result of HIV infection of the cells and/or effector T cells
activate macrophages by direct interaction (e.g. CD40 ligand on T
cells binds to CD40 on macrophages) and by secretion of
gamma-interferon, a potent macrophage activating cytokine.
Macrophage activation results in increased HIV replication as is
the case with T cells.
[0060] The term "antigen-activated B cells" refer to either of two
different types of B cell activation, T cell dependent and T cell
independent. T cell independent antigens contain repetitive
identical epitopes and are capable of clustering membrane bound
antibody on the surface of the B cell which can result in
delivering activation signals. T cell dependent activation is in
response to protein antigens where the B cell acts as a
professional antigen presenting cell. In either case of B cell
activation the cell will proliferate and differentiate into plasma
B cells capable of secreting antibodies against the antigen.
[0061] The term "mature dendritic cells" (DCs) refer to
professional antigen-presenting cells (APCs) that express both MHC
class I and II and co-stimulatory molecules and are capable of
initiating activation of naive T cells. Two different DC phenotypes
are exhibited depending on maturation state and location in the
body. Immature DCs reside in all tissues and organs as active
phagocytic cells. Mature DCs traffic to secondary lymphoid organs
(e.g. lymph node and spleen) and present peptides derived from
processed protein antigens to T cells in the context of MHC
molecules. Mature DCs also provide the necessary co-stimulatory
signals to T cells by expressing the appropriate surface ligand
(e.g. CD80 and CD86 on DCs bind to CD28 on T cells).
[0062] The terms "antisense oligonucleotides," "antisense
oligomer," "antisense compound" and "targeting antisense oligomer"
are used interchangeably and refer to a compound having sequence of
nucleotide bases and a subunit-to-subunit backbone that allows the
antisense oligomer to hybridize to a target sequence in an RNA by
Watson-Crick base pairing, to form an RNA:oligomer heterduplex
within the target sequence. The antisense oligonucleotide includes
a sequence of purine and pyrimidine heterocyclic bases, supported
by a backbone, which are effective to hydrogen-bond to
corresponding, contiguous bases in a target nucleic acid sequence.
The backbone is composed of subunit backbone moieties supporting
the purine and pyrimidine heterocyclic bases at positions that
allow such hydrogen bonding. These backbone moieties may be cyclic
moieties of 5 to 7 atoms in length, linked together by, for
example, phosphorous-containing linkages one to three atoms long.
Alternatively, the backbone may comprise a peptide structure, such
as the backbone of a peptide nucleic acid (PNA)
[0063] A "morpholino" oligonucleotide refers to a polymeric
molecule having a backbone which supports bases capable of hydrogen
bonding to typical polynucleotides, wherein the polymer lacks a
pentose sugar backbone moiety, and more specifically a ribose
backbone linked by phosphodiester bonds which is typical of
nucleotides and nucleosides, but instead contains a ring nitrogen
with coupling through the ring nitrogen.
[0064] A substantially uncharged, phosphorus containing backbone in
an oligonucleotide analog is one in which a majority of the subunit
linkages, e.g., between 50-100%, are uncharged at physiological pH,
and contain a single phosphorous atom. The analog contains between
12 and 40 subunits, typically about 15-25 subunits, and preferably
about 18 to 25 subunits. The analog may have exact sequence
complementarity to the target sequence or near complementarity, as
defined below. The morpholino subunits in the oliogmer compound of
the present invention that are linked by uncharged
phosphorodiamidate linkages interspersed with at least two and up
to half positively charged phosphorodiamidate linkages. Such
oligomers are composed of morpholino subunit structures such as
shown in FIG. 2B, where X.dbd.NH.sub.2, NHR, or NR.sub.2 (where R
is lower alkyl, preferably methyl), Y.dbd.O, and Z=O, and P.sub.i
and P.sub.j are purine or pyrimidine base-pairing moieties
effective to bind, by base-specific hydrogen bonding, to a base in
a polynucleotide, where the phosphordiamidate linkages may be a
mixture of uncharged linkages as shown in FIG. 3G and cationic
linkages as shown in FIG. 3H where, in FIG. 2B, X=1-piperazino.
Also preferred are structures having an alternate uncharged
phosphorodiamidate linkage, where, in FIG. 1B, X=lower alkoxy, such
as methoxy or ethoxy, Y.dbd.NH or NR, where R is lower alkyl, and
Z=O.
[0065] A preferred "morpholino" oligonucleotide is composed of
morpholino subunit structures of the form shown in FIGS. 1A-1D,
where (i) the structures are linked together by
phosphorous-containing linkages, one to three atoms long, joining
the morpholino nitrogen of one subunit to the 5' exocyclic carbon
of an adjacent subunit, and (ii) P.sub.i and P.sub.j are purine or
pyrimidine base-pairing moieties effective to bind, by
base-specific hydrogen bonding, to a base in a polynucleotide.
Exemplary structures for antisense oligonucleotides for use in the
invention include the morpholino subunit types shown in FIGS.
1A-1D, with the uncharged, phosphorous-containing linkages shown in
FIGS. 2A-2D, and more generally, the uncharged linkages 3A-3G, and
the charged,cationic linkage is shown in FIG. 3H.
[0066] As used herein, an oligonucleotide or antisense oligomer
"specifically hybridizes" to a target polynucleotide if the
oligomer hybridizes to the target under physiological conditions,
with a thermal melting point (Tm) substantially greater than
37.degree. C., preferably at least 45.degree. C., and typically
50.degree. C.-80.degree. C. or higher. Such hybridization
preferably corresponds to stringent hybridization conditions,
selected to be about 10.degree. C., and preferably about 50.degree.
C. lower than the T.sub.m for the specific sequence at a defined
ionic strength and pH. At a given ionic strength and pH, the
T.sub.m is the temperature at which 50% of a target sequence
hybridizes to a complementary polynucleotide.
[0067] Polynucleotides are described as "complementary" to one
another when hybridization occurs in an antiparallel configuration
between two single-stranded polynucleotides. A double-stranded
polynucleotide can be "complementary" to another polynucleotide, if
hybridization can occur between one of the strands of the first
polynucleotide and the second. Complementarity (the degree that one
polynucleotide is complementary with another) is quantifiable in
terms of the proportion of bases in opposing strands that are
expected to form hydrogen bonds with each other, according to
generally accepted base-pairing rules.
[0068] As used herein the term "analog" with reference to an
oligomer means a substance possessing both structural and chemical
properties similar to those of the reference oligomer.
[0069] As used herein, a first sequence is an "antisense sequence"
with respect to a second sequence if a polynucleotide whose
sequence is the first sequence specifically binds to, or
specifically hybridizes with, the second polynucleotide sequence
under physiological conditions.
[0070] As used herein, "effective amount" relative to an antisense
oligomer refers to the amount of antisense oligomer administered to
a subject, either as a single dose or as part of a series of doses,
that is effective to inhibit expression of a selected target
nucleic acid sequence.
[0071] Unless otherwise indicated, "HIV" is intended to include
Human Immunodeficiency Virus-1 (HIV-1).
[0072] "Inhibition HIV-1 replication in HIV-1-infected cells" means
inhibiting viral replication within the cell, either by inhibiting
or blocking the synthesis of a critical structural protein,
inhibiting or blocking the synthesis of a viral protein necessary
for viral-protein synthesis, replication, or assembly, or blocking
a cis-acting element on the HIV genome or portion thereof.
[0073] "Selectively inhibiting HIV-1 in activated, HIV-1-infected
hematopoietic cells, e.g., macrophage or T-lymphocyte cells, cells"
means inhibiting HIV infection selectively with respect to the
extent of viral inhibition that would be observed in non-activated
or non-HIV infected hematopoietic cells under the same inhibition
conditions.
[0074] The terms "percent identity" and "% identity," as applied to
polynucleotide sequences, refer to the percentage of residue
matches between at least two polynucleotide sequences aligned using
a standardized algorithm.
[0075] The term "similarity" refers to a degree of complementarity.
There may be partial similarity or complete similarity. The word
"identity" may substitute for the word "similarity."
[0076] Percent identity can be determined electronically, e.g., by
using the MEGALIGN program (DNASTAR, Madison Wis.) and protocols
well known in the art.
[0077] Abbreviations:
[0078] PMO=morpholino oligomer
[0079] PMO+=morpholino oligomer with interspersed cationic
linkages
[0080] ARP=arginine-rich polypeptide
[0081] ARP-PMO=arginine-rich polypeptide conjugated to a PMO
[0082] HIV=HIV-1=human immunodeficiency virus-1
[0083] Vif=viral infectivity factor
[0084] HAART=highly active antiretroviral therapy
[0085] II. HIV Replication in Hematopoietic Cells
[0086] HIV infection of a cell is initiated by the interaction of
viral envelope glycoproteins with specific cellular receptors.
Following adsorption and uncoating, the viral RNA enters the target
cell and is converted into cDNA by the action of reverse
transcriptase (RT), an enzyme brought within the virion. The cDNA
adopts a circular form, is converted to double-stranded cDNA and
then becomes integrated into the host cell's genomic DNA by the
action of integrase, a component of RT. Once integrated, HIV
proviral cDNA is transcribed from the promoter within the 5' LTR.
The transcribed RNA is spliced into one of several subgenomic mRNAs
which act as mRNA and are translated to produce the viral proteins
or is left as nascent, full-length viral RNA which is also
translated or targeted for packaging into budding virions. Full
length genomic viral RNA contains a psi packaging sequence and a
dimerization sequence near its 5' end which are essential for
packaging of two dimerized, full-length viral RNA molecules into
virions. Once the virion is produced, it is released from the cell
by budding from the plasma membrane. The proviral cDNA remains
stably integrated in the host genome and is replicated with the
host DNA so that progeny cells also inherit the provirus.
[0087] The entry of HIV into cells, including T lymphocytes,
monocytes and macrophages, is, in general, effected by the
interaction of the gp120 envelope protein of HIV with a CD4
receptor on the target cell surface. The amino acid sequence of
gp120 can be highly variable in different patients (or even the
same patient). This variability plays an important role in disease
progression. The major peculiarities for HIV are that it has a
latent phase in which the provirus may lie dormant following
integration into the host cell's genome and it is cytopathic for T
lymphocyte target cells. HIV commences the bulk of viral
replication in activated and proliferating cells due to the binding
of nuclear transcription and cellular enhancer factors to the HIV
LTR which results in increased levels of viral transcription. As
for all retroviruses, gag, pol and env gene products are translated
into structural and enzymatic proteins. In addition, HIV encodes
several additional regulatory genes. Specifically, Tat and Rev are
regulatory proteins and act to modulate transcriptional and
posttranscriptional steps, respectively, and are essential for
virus propagation. Nef is another regulatory gene which increases
viral infectivity and is essential for efficient viral spread and
disease progression in vivo.
[0088] Another important regulatory protein is Vif or the viral
infectivity factor (see below). Vif promotes the infectivity but
not the production of viral particles. Viral particles produced in
the absence of Vif (e.g. Vif deletion mutants) are defective while
the cell to cell transmission of virus is not altered.
[0089] HIV infects primarily T cells and macrophages and HIV
isolates that preferentially infect these cells are called T-tropic
and M-tropic, respectively. Virus isolates from early stages of an
infection are consistently M-tropic while over the course of
disease progression T-tropic viruses emerge and are associated with
advanced disease stages. HIV replication in both T cells and
macrophages is highest in activated and proliferating cells due to
the binding of nuclear transcription and cellular enhancer factors
to the HIV long terminal repeat (LTR) resulting in increased
transcription of HIV genes. This narrow tissue tropism provides an
opportunity to deliver antiviral drugs to a discrete population of
hematopoietic cells provided an appropriate delivery mechanism is
available.
[0090] As described above, anti-HIV drugs currently in use directly
interfere with the machinery by which HIV-1 replicates itself
within human cells. Lentiviruses such as HIV-1 encode a number of
accessory genes in addition to the structural gag, pol, and env
genes common to all retroviruses. One of these accessory genes, Vif
(viral infectivity factor), is expressed by many lentiviruses. The
HIV-1 Vif protein is a 23-kDa protein composed of 192 highly basic
amino acids. Deletion of the Vif gene dramatically decreases the
replication of simian immunodeficiency virus (SIV) in macaques and
HIV-1 replication in SCID-hu mice (Aldrovandi and Zack 1996;
Desrosiers, Lifson et al. 1998), supporting an essential role for
Vif in the pathogenic replication of lentiviruses in vivo.
[0091] A. Targeting Vif mRNA
[0092] Recently, a mechanism for Vif function has been proposed
(Sheehy, Gaddis et al. 2002; Mariani, Chen et al. 2003; Marin, Rose
et al. 2003). In this model Vif acts to neutralize a cellular
protein, APOBEC3G, that is part of a conserved antiretroviral
pathway in mammalian cells. In the absence of Vif, APOBEC3G is
incorporated into virions and in newly infected cells disables
reverse transcription. Vif specifically inactivates APOBEC3G and
prevents its incorporation into progeny virions allowing productive
infection of newly infected cells.
[0093] HIV-1 mutants with defective Vif genes have normal viral
transcription, translation and virion production. These HIV-1
variants are able to bind and penetrate target cells but are not
able to complete reverse transcription during the subsequent cycle
of infection (Courcoul, Patience et al. 1995; Goncalves, Korin et
al. 1996; Simon and Malim 1996; Dettenhofer, Cen et al. 2000). Vif
is incorporated into HIV-1 virions and binds to RNA.
[0094] Vif functions to inactivate a newly discovered innate
antiretroviral pathway in human T lymphocytes. The APOBEC3G protein
is a member of the cytidine deaminase family of nucleic acid
editing enzymes and provides innate immunity to retroviral
infection by effecting massive deamination of cytidine residues in
nascent, first strand cDNA produced by reverse transcriptase
(Harris, Bishop et al. 2003). HIV-1 utilizes the Vif protein to
defeat the antiretroviral activity of APOBEC3G by Vif binding to
APOBEC3G and targeting it for degradation by cellular
proteasome-dependent pathways (Marin, Rose et al. 2003). APOBEC3G
is absent from HIV-1 virions produced in the presence of Vif and
present in virions produced in the absence of Vif. Current models
suggest that virion incorporated APOBEC3G is responsible for the
cytidine deamination of nascent cDNA in cells infected by virions
containing APOBEC3G (Marin, Rose et al. 2003). Therefore, Vif acts
to eliminate APOBEC3G from progeny virions and allows infection of
otherwise nonpermisive cells.
[0095] Antisense oligomers directed to Vif MRNA reduce Vif protein
levels and allow incorporation of APOBEC3G into nascent virions.
This substantially reduces or eliminates the replicative potential
of these virions and cause infected cells to produce a virus
population with an increased defective to non-defective virion
ratio. The overall effect on an in vivo infection is to block the
productive infection of lymphoid and myeloid cells and reduce the
viral load in the individual. A preferred target sequence is the
region adjacent or including the AUG start site of the Vif gene,
including the sequence identified by SEQ ID NO: 17 in Table 2
below. Exemplary targeting sequences for the Vif start codon
include SEQ ID NOS:5-16 given below.
[0096] B. Other HIV Targets
[0097] Other HIV target sites include the translational start sites
of essential HIV structural and accessory genes, the tRNA primer
binding site (PBS) and primer activation sequences (PAS), the
Tat-Rev subgenomic mRNA splice donor and splice acceptor sites, the
major 5' splice donor (SD) site, the psi viral RNA packaging site,
sequences required for dimerization of viral RNA prior to
packaging, the TAR stemloop and the boundary between the U3 and R
region of the viral long terminal repeat (LTR) which serves as the
point of minus strand transfer during reverse transcription. In
these general embodiments designed to target translational start
sites, RNA splice sites or cis-acting elements, the antisense
compound has a base sequence that is complementary to a target
region containing at least 12 contiguous bases in a HIV RNA
transcript, and which includes at least 6 contiguous bases of one
of the sequences identified by SEQ ID NOS:18 and 19 in Table 2
below. Exemplary antisense oligomer sequences include those
identified as SEQ ID NOS:14-16 in Table 1 below. The target
nucleotide sequence regions in Table 2 are referenced to NCBI
GenBank Accession Number AF324493.
[0098] Inhibition of viral replication or infectivity may also be
inhibited by blocking cis-acting elements of HIV RNA transcripts.
Among the preferred target sequences for this approach are the
tRNA-PBS (primer binding site), the TAR stemloop, primer activation
sequences (PAS) and the Psi-packaging site and dimerization
sequences (DIS) in full length HIV RNA transcripts. Exemplary
target sequences for the TAR stemloop include SEQ ID NO:18 given
below.
[0099] Viral replication can also be inhibitied by interfering with
the minus-strand transfer step during reverse transcription. The
preferred target region for this approach is found at the junction
of the U3 and R regions of the viral long terminal repeat (LTR). An
exemplary target sequence is SEQ ID NO:19 given below.
[0100] III. ARP-Antisense Conjugate For Targeting Activated
HIV-Infected Hematopoietic Cells
[0101] The present invention is based, in part, on the discovery
that the uptake of uncharged of substantially uncharged antisense
compounds into activated human hematopoietic cells, such as
activated, HIV-infected macrophages and T-lymphocyte cells, can be
selectively enhanced, with respect to non-infected and/or
non-activated cells, by conjugating the antisense compound with an
rTAT polypeptide. This section describes various exemplary
antisense compounds, the rTAT polypeptide, alternative ARPs and
methods of producing the ARP-antisense conjugate.
[0102] A. Antisense Compound
[0103] Antisense oligomers for use in practicing the invention,
preferably have the properties: (1) a backbone that is
substantially uncharged, (2) the ability to hybridize with the
complementary sequence of a target RNA with high affinity, that is
a Tm substantially greater than 37.degree. C., preferably at least
45.degree. C., and typically greater than 50.degree. C., e.g.,
60.degree. C.-80.degree. C. or higher, (3) a subunit length of at
least 8 bases, generally about 8-40 bases, preferably 12-25 bases,
and (4) nuclease resistance (Hudziak, Barofsky et al. 1996).
[0104] In addition, the antisense compound may have the capability
for active or facilitated transport as evidenced by (i) competitive
binding with a phosphorothioate antisense oligomer, and/or (ii) the
ability to transport a detectable reporter into target cells. In
particular, for purposes of transport, the antisense compound
displays selective uptake into activated immune cells when
conjugated with rTAT polypeptide, according to cell-uptake criteria
set out below.
[0105] Candidate antisense oligomers may be evaluated, according to
well known methods, for acute and chronic cellular toxicity, such
as the effect on protein and DNA synthesis as measured via
incorporation of 3H-leucine and 3H-thymidine, respectively. In
addition, various control oligonucleotides, e.g., control
oligonucleotides such as sense, nonsense or scrambled antisense
sequences, or sequences containing mismatched bases, in order to
confirm the specificity of binding of candidate antisense
oligomers. The outcome of such tests is important in discerning
specific effects of antisense inhibition of gene expression from
indiscriminate suppression. Accordingly, sequences may be modified
as needed to limit non-specific binding of antisense oligomers to
non-target nucleic acid sequences.
[0106] Heteroduplex formation. The effectiveness of a given
antisense oligomer molecule in forming a heteroduplex with the
target mRNA may be determined by screening methods known in the
art. For example, the oligomer is incubated in a cell culture
containing an MRNA preferentially expressed in activated
lymphocytes, and the effect on the target mRNA is evaluated by
monitoring the presence or absence of (1) heteroduplex formation
with the target sequence and non-target sequences using procedures
known to those of skill in the art, (2) the amount of the target
MRNA expressed by activated lymphocytes, as determined by standard
techniques such as RT-PCR or Northern blot, (3) the amount of
protein transcribed from the target MRNA, as determined by standard
techniques such as ELISA or Western blotting. (See, for
example,(Pari, Field et al. 1995; Anderson, Fox et al. 1996).
[0107] Uptake into cells. A second test measures cell transport, by
examining the ability of the test compound to transport a labeled
reporter, e.g., a fluorescence reporter, into cells. The cells are
incubated in the presence of labeled test compound, added at a
final concentration between about 10-300 nM. After incubation for
30-120 minutes, the cells are examined, e.g., by microscopy or FACS
analysis, for intracellular label. The presence of significant
intracellular label is evidence that the test compound is
transported by facilitated or active transport. It will be
recognized that conjugation of the oligomer with the rTAT peptide
selectively enhances uptake into activated immune cells, including
activated, HIV-infected hematopoietic cells, in particular,
activated, HIV-infected macrophage and T-lymphocyte cells.
[0108] RNAse resistance. Two general mechanisms have been proposed
to account for inhibition of expression by antisense
oligonucleotides (Agrawal, Mayrand et al. 1990; Bonham, Brown et
al. 1995; Boudvillain, Guerin et al. 1997). In the first, a
heteroduplex formed between the oligonucleotide and the viral RNA
acts as a substrate for RNaseH, leading to cleavage of the viral
RNA. Oligonucleotides belonging, or proposed to belong, to this
class include phosphorothioates, phosphotriesters, and
phosphodiesters (unmodified "natural" oligonucleotides). Such
compounds expose the viral RNA in an oligomer:RNA duplex structure
to hydrolysis by RNaseH, and therefore loss of function.
[0109] A second class of oligonucleotide analogs, termed "steric
blockers" or, alternatively, "RNaseH inactive" or "RNaseH
resistant" , have not been observed to act as a substrate for
RNaseH, and are believed to act by sterically blocking target RNA
nucleocytoplasmic transport, splicing, translation, or replication.
This class includes methylphosphonates (Toulme, Tinevez et al.
1996), morpholino oligonucleotides, peptide nucleic acids (PNA's),
certain 2'-O-allyl or 2'-O-alkyl modified oligonucleotides (Bonham,
Brown et al. 1995), and N3'.fwdarw.P5' phosphoramidates (Ding,
Grayaznov et al. 1996; Gee, Robbins et al. 1998).
[0110] A test oligomer can be assayed for its RNaseH resistance by
forming an RNA:oligomer duplex with the test compound, then
incubating the duplex with RNaseH under a standard assay
conditions, as described (Stein, Foster et al. 1997). After
exposure to RNaseH, the presence or absence of intact duplex can be
monitored by gel electrophoresis or mass spectrometry.
[0111] In vivo uptake. In accordance with another aspect of the
invention, there is provided a simple, rapid test for confirming
that a given antisense oligomer type provides the required
characteristics noted above, namely, high Tm, ability to be
actively taken up by the host cells, and substantial resistance to
RNaseH. This method is based on the discovery that a properly
designed antisense compound will form a stable heteroduplex with
the complementary portion of the viral RNA target when administered
to a mammalian subject, and the heteroduplex subsequently appears
in the urine (or other body fluid). Details of this method are also
given in co-owned U.S. Pat. No. 6,365,351 for "Non-Invasive Method
for Detecting Target RNA," the disclosure of which is incorporated
herein by reference.
[0112] Briefly, a test oligomer containing a backbone to be
evaluated, having a base sequence targeted against a known RNA, is
administered to a mammalian subject. The antisense oligomer may be
directed against any intracellular RNA, including RNA encoded by a
host gene. Several hours (typically 8-72) after administration, the
urine is assayed for the presence of the antisense-RNA
heteroduplex. If heteroduplex is detected, the backbone is suitable
for use in the antisense oligomers of the present invention.
[0113] The test oligomer may be labeled, e.g. by a fluorescent or a
radioactive tag, to facilitate subsequent analyses, if it is
appropriate for the mammalian subject. The assay can be in any
suitable solid-phase or fluid format. Generally, a solid-phase
assay involves first binding the heteroduplex analyte to a
solid-phase support, e.g., particles or a polymer or test-strip
substrate, and detecting the presence/amount of heteroduplex bound.
In a fluid-phase assay, the analyte sample is typically pretreated
to remove interfering sample components. If the oligomer is
labeled, the presence of the heteroduplex is confirmed by detecting
the label tags. For non-labeled compounds, the heteroduplex may be
detected by immunoassay if in solid phase format or by mass
spectroscopy or other known methods if in solution or suspension
format.
[0114] Structural features. As detailed above, the antisense
oligomer has a base sequence directed to a targeted portion of the
HIV genome, as discussed in Section II above. In addition, the
oligomer is able to effectively inhibit expression or action of the
targeted genome region when administered to a host cell, e.g. in a
mammalian subject. This requirement is met when the oligomer
compound (a) has the ability to be selectively taken up by
activated, HIV-infected macrophage or T lymphocyte cells, (or other
activated immune cells) and (b) once taken up, form a duplex with
the target RNA with a Tm greater than about 45.degree. C.
[0115] The ability to be taken up selectively by activated immune
cells requires, in part, that the oligomer backbone be
substantially uncharged. The ability of the oligomer to form a
stable duplex with the target RNA will depend on the oligomer
backbone, the length and degree of complementarity of the antisense
oligomer with respect to the target, the ratio of G:C to A:T base
matches, and the positions of any mismatched bases. The ability of
the antisense oligomer to resist cellular nucleases promotes
survival and ultimate delivery of the agent to the cell
cytoplasm.
[0116] Antisense oligonucleotides of 15-20 bases are generally long
enough to have one complementary sequence in the mammalian genome.
In addition, antisense compounds having a length of at least 17
nucleotides in length hybridize well with their target mRNA(Akhtar,
Basu et al. 1991). Due to their hydrophobicity, antisense
oligonucleotides interact well with phospholipid membranes (Akhtar,
Basu et al. 1991), and it has been suggested that following the
interaction with the cellular plasma membrane, oligonucleotides are
actively transported into living cells (Loke, Stein et al. 1989;
Yakubov, Deeva et al. 1989; Anderson, Xiong et al. 1999).
[0117] Morpholino oligonucleotides, particularly phosphoramidate-
or phosphorodiamidate-linked morpholino oligonucleotides have been
shown to have high binding affinities for complementary or
near-complementary nucleic acids. Morpholino oligomers also exhibit
little or no non-specific antisense activity, afford good water
solubility, are immune to nucleases, and are designed to have low
production costs (Summerton and Weller 1997).
[0118] Morpholino oligonucleotides (including antisense oligomers)
are detailed, for example, in co-owned U.S. Patent Nos. 5,698,685,
5,217,866, 5,142,047, 5,034,506, 5,166,315, 5,185, 444, 5,521,063,
and 5,506,337, all of which are expressly incorporated by reference
herein
[0119] In one preferred approach, antisense oligomers for use in
practicing the invention are composed of morpholino subunits of the
form shown in the above cited patents, where (i) the morpholino
groups are linked together by phosphorodiamidate linkages, one to
three atoms long, joining the morpholino nitrogen of one subunit to
the 5' exocyclic carbon of an adjacent subunit, and (ii) the base
attached to the morpholino group is a purine or pyrimidine
base-pairing moiety effective to bind, by base-specific hydrogen
bonding, to a base in a polynucleotide. The purine or pyrimidine
base-pairing moiety is typically adenine, cytosine, guanine,
uracil, inosine or thymine. Preparation of such oligomers is
described in detail in U.S. Pat. No. 5,185,444 (Summerton et al.,
1993), which is hereby incorporated by reference in its entirety.
As shown in this reference, several types of nonionic linkages may
be used to construct a morpholino backbone.
[0120] Exemplary subunit structures for antisense oligonucleotides
of the invention include the morpholino subunit types shown in
FIGS. 1A-D, each linked by an uncharged, phosphorous-containing
subunit linkage, as shown in FIGS. 2A-2D, respectively. In these
figures, the X moiety pendant from the phosphorous may be any of
the following: fluorine; an alkyl or substituted alkyl; an alkoxy
or substituted alkoxy; a thioalkoxy or substituted thioalkoxy; or,
an unsubstituted, monosubstituted, or disubstituted nitrogen,
including cyclic structures. Alkyl, alkoxy and thioalkoxy
preferably include 1-6 carbon atoms, and more preferably 1-4 carbon
atoms. Monosubstituted or disubstituted nitrogen preferably refers
to lower alkyl substitution, and the cyclic structures are
preferably 5- to 7-membered nitrogen heterocycles optionally
containing 1-2 additional heteroatoms selected from oxygen,
nitrogen, and sulfur. Z is sulfur or oxygen, and is preferably
oxygen.
[0121] FIG. 1A shows a phosphorous-containing linkage which forms
the five atom repeating-unit backbone shown in FIG. 2A, where the
morpholino rings are linked by a 1-atom phosphoamide linkage.
Subunit B in FIG. 1B is designed for 6-atom repeating-unit
backbones, as shown in FIG. 2B. In FIG. 1B, the atom Y linking the
5' morpholino carbon to the phosphorous group may be sulfur,
nitrogen, carbon or, preferably, oxygen. The X moiety pendant from
the phosphorous may be any of the following: fluorine; an alkyl or
substituted alkyl; an alkoxy or substituted alkoxy; a thioalkoxy or
substituted thioalkoxy; or, an unsubstituted, monosubstituted, or
disubstituted nitrogen, including cyclic structures. Z is sulfur or
oxygen, and is preferably oxygen. Particularly preferred morpholino
oligonucleotides include those composed of morpholino subunit
structures of the form shown in FIG. 2B, where X is an amine or
alkyl amine of the form X.dbd.NR.sub.2, where R is independently H
or CH.sub.3, that is where X.dbd.NH.sub.2, X.dbd.NHCH.sub.3 or
X.dbd.N(CH.sub.3).sub.2, Y.dbd.O, and Z=O.
[0122] Subunits C-D in FIGS. 1C-D are designed for 7-atom
unit-length backbones as shown for structures in FIGS. 2C and D. In
Structure C, the X moiety is as in Structure B, and the moiety Y
may be methylene, sulfur, or preferably oxygen. In Structure D, the
X and Y moieties are as in Structure B. In all subunits depicted in
FIGS. 1 and 2, each Pi and Pj is a purine or pyrimidine
base-pairing moiety effective to bind, by base-specific hydrogen
bonding, to a base in a polynucleotide, and is preferably selected
from adenine, cytosine, guanine and uracil.
[0123] As noted above, the morpholino oligomer backbone of the
present invention includes substantially phosphordiamidate linkages
interspersed with a limited number of charged linkages, e.g. up to
about one for every one uncharged linkages. In the case of the
morpholino oligomers, such a charged linkage may be a linkage as
represented by FIG. 3H where, in FIG. 2B, X=1-piperazino
[0124] More generally, the morpholino oligomers with substantially
uncharged backbones are shown in FIGS. 3A-3G, with interspersed
cationic linkages such as shown in FIG. 3H. By including between
two to eight such cationic linkages, and more generally, at least
two and no more than about half the total number of linkages,
interspersed along the backbone of the otherwise uncharged
oligomer, antisense activity can be enhanced without a significant
loss of specificity. The charged linkages are preferably separated
in the backbone by at least 1 and preferably 2 or more uncharged
linkages.
[0125] B. Antisense Sequences
[0126] In the methods of the invention, the antisense oligomer is
designed to hybridize to a region of the target nucleic acid
sequence, under physiological conditions with a Tm substantially
greater than 37.degree. C., e.g., at least 45.degree. C. and
preferably 60.degree. C.-80.degree. C., wherein the target nucleic
acid sequence is preferentially expressed in activated lymphocytes.
The oligomer is designed to have high-binding affinity to the
target nucleic acid sequence and may be 100% complementary thereto,
or may include mismatches, e.g., to accommodate allelic variants,
as long as the heteroduplex formed between the oligomer and the
target nucleic acid sequence is sufficiently stable to withstand
the action of cellular nucleases and other modes of degradation
during its transit from cell to body fluid. Mismatches, if present,
are less destabilizing toward the end regions of the hybrid duplex
than in the middle. The number of mismatches allowed will depend on
the length of the oligomer, the percentage of G:C base pair in the
duplex and the position of the mismatch(es) in the duplex,
according to well understood principles of duplex stability. In
this sense, the invention also encompasses PMO alternatives or
variants. A preferred PMO alternative or variant is one having at
least about 90% nucleic acid sequence identity to the target
nucleic acid sequence.
[0127] Although such an antisense oligomer is not necessarily 100%
complementary to a nucleic acid sequence that is preferentially
expressed in activated lymphocytes, it is effective to stably and
specifically bind to the target sequence such that expression of
the target sequence is modulated. The appropriate length of the
oligomer to allow stable, effective binding combined with good
specificity is about 8-40 nucleotide base units, and preferably
about 12-25 nucleotides. Oligomer bases that allow degenerate base
pairing with target bases are also contemplated, assuming base-pair
specificity with the target is maintained.
[0128] mRNA transcribed from the relevant region of HIV is
generally targeted by the antisense oligonucleotides for use in
practicing the invention, however, in some cases double-stranded
DNA may be targeted using a non-ionic probe designed for
sequence-specific binding to major-groove sites in duplex DNA. Such
probe types are described in U.S. Pat. No. 5,166,315 (Summerton et
al., 1992), which is hereby incorporated by reference, and are
generally referred to herein as antisense oligomers, referring to
their ability to block expression of target genes.
[0129] When the antisense compound is complementary to a specific
region of a target gene (such as the region surrounding the AUG
start codon of the Vif gene) the method can be used to monitor the
binding of the oligomer to the Vif RNA.
[0130] The antisense activity of the oligomer may be enhanced by
using a mixture of uncharged and cationic phosphorodiamidate
linkages as shown in FIGS. 3G and 3H. The total number of cationic
linkages in the oligomer can vary from 1 to 10, and be interspersed
throughout the oligomer. Preferably the number of charged linkages
is at least 2 and no more than half the total backbone linkages,
e.g., between 2-8 positively charged linkages, and preferably each
charged linkages is separated along the backbone by at least one,
preferably at least two uncharged linkages. The antisense activity
of various oligomers can be measured in vitro by fusing the
oligomer target region to the 5' end a reporter gene (e.g. firefly
luciferase) and then measuring the inhibition of translation of the
fusion gene mRNA transcripts in cell free translation assays. The
inhibitory properties of oligomers containing a mixture of
uncharged and cationic linkages can be enhanced between,
approximately, five to 100 fold in cell free translation assays.
Examples of oligomers that target the Vif AUG start codon and that
contain cationic linkages of the type shown in FIG. 3H are listed
below as SEQ ID NOS:11-13. In these examples four positive charges
are introduced per oligomer.
[0131] The antisense compounds for use in practicing the invention
can be synthesized by stepwise solid-phase synthesis, employing
methods detailed in the references cited above. The sequence of
subunit additions will be determined by the selected base sequence.
In some cases, it may be desirable to add additional chemical
moieties to the oligomer compounds, e.g. to enhance the
pharmacokinetics of the compound or to facilitate capture or
detection of the compound. Such a moiety may be covalently
attached, typically to the 5'- or 3'-end of the oligomer, according
to standard synthesis methods. For example, addition of a
polyethyleneglycol moiety or other hydrophilic polymer, e.g., one
having 10-100 polymer subunits, may be useful in enhancing
solubility. One or more charged groups, e.g., anionic charged
groups such as an organic acid, may enhance cell uptake. A reporter
moiety, such as fluorescein or a radiolabeled group, may be
attached for purposes of detection. Alternatively, the reporter
label attached to the oligomer may be a ligand, such as an antigen
or biotin, capable of binding a labeled antibody or streptavidin.
In selecting a moiety for attachment or modification of an oligomer
antisense, it is generally of course desirable to select chemical
compounds of groups that are biocompatible and likely to be
tolerated by cells in vitro or in vivo without undesirable side
effects. TABLE-US-00001 TABLE 1 Exemplary Antisense Oligomer
Sequences (Based on GenBank Acc. No. AF324493) Target Targeting
Antisense Oligo- SE PMO Nucleo mer (5' to 3') NO. Vif-AUG4
CCTGCCATCTGTTTTCCATAATC 5 Vif-AUG5 CTGCCATCTGTTTTCCATA 6 Vif-AUG6
CACCTGCCATCTGTTTTCC 7 Vif-AUG4 CTGCCATCTGTTTTCCATAGTC 8 Vif-AUG4
CTGCCATCTGTTTTCCATAITC 9 Vif-AUG5 CACCTGCCATCTGTTTTCCATA 10
Vif-AUG4 CTGCCATCTGT.sup.+T.sup.+TTCCAT.sup.+AG.sup.+TC 11 Vif-AUG4
CTGCCATCTGT.sup.+T.sup.+TTCCAT.sup.+A.sup.+ 12 I Vif-AUG5
CACCTGCCATCTGT.sup.+T.sup.+TTCC.sup.+ 13 A.sup.+ Tar1
GCTCCCAGGCTCAGATCTGGTC 14 Tar2 GTTAGCCAGAGAGCTCCCAGGC 15 U3R
CCAGAGAGACCCAGTACAGG 16
[0132] TABLE-US-00002 TABLE 2 Exemplary Target Sequences (Based on
GenBank Acc. No. AF324493) SE Name Target Target Sequence (5' to
3') NO. Vif-A 5037-50 GACTATGGAAAACAGATGGCAGGT GATTGT TARc 469-502
GACCAGATCTGAGCCTGGGAGCTCT GGCTAAC U3Rc 446-465
CCTGTACTGGGTCTCTCTGG
[0133] C. rTAT Peptide
[0134] The use of arginine-rich peptide sequences conjugated to PMO
has been shown to enhance cellular uptake in a variety of cells
(Wender, Mitchell et al. 2000; Moulton, Hase et al. 2003; Moulton
and Moulton 2003; Moulton, Nelson et al. 2004; and U.S. patent
application Ser. No. 10/836,804).
[0135] In studies conducted in support of the present invention,
several different "arginine-rich" peptide sequences were conjugated
to fluorescent tagged PMO (PMO-fl) and examined to determine the
effect of peptide sequence on uptake into lymphocytes. Enhanced
uptake was observed for all arginine-rich peptide-PMO conjugates
tested compared to unconjugated PMO. The P003 arginine-rich peptide
[NH2-RRRRRRRRFFC--COOH] (SEQ ID NO:2) provides enhanced uptake into
lymphocytes regardless of the cell activation state as does the ARP
listed as SEQ ID NOS: 3 and 4. However, among the arginine-rich
peptides examined, only the rTAT (P002) peptide
[NH.sub.2--RRRQRRKKRC--COOH] (SEQ ID NO:1) PMO conjugates exhibited
differential uptake into lymphocytes dependent on cell activation
status. PMO uptake was greatly increased in mature dendritic cells
as well as activated B cells and CD4 and CD8 T cells when compared
to immature or naive lymphocytes, as discussed below.
[0136] The rTAT peptide can be synthesized by a variety of known
methods, including solid-phase synthesis. The amino acid subunits
used in construction of the polypeptide may be either l- or d-amino
acids, preferably all l-amino acids or all d-amino acids. Minor (or
neutral) amino acid substitutions are allowed, as long as these do
not substantially degrade the ability of the polypeptide to enhance
uptake of antisense compounds selectively into activated T cells.
One skilled in the art can readily determine the effect of amino
acid substitutions by construction a series of substituted rTAT
polypeptides, e.g., with a given amino acid substitution separately
at each of the positions along the rTAT chain (see Example 1).
Using the above test for uptake of fluoresceinated PMO-polypeptide
conjugate, (see Example 2) one can then determine which
substitutions are neutral and which significantly degrade the
transporter activity of the peptide. Rules for neutral amino acid
substitutions, based on common charge and hydrophobicity
similarities among distinct classes of amino acids are well known
and applicable here. In addition, it will be recognized that the
N-terminal cysteine of SEQ ID NO: 1 is added for purposes of
coupling to the antisense compound, and may be replaced/deleted
when another terminal amino acid or linker is used for
coupling.
[0137] The rTAT polypeptide can be linked to the antisense to be
delivered by a variety of methods available to one of skill in the
art. The linkage point can be at various locations along the
transporter. In selected embodiments, it is at a terminus of the
transporter, e.g., the C-terminal or N-terminal amino acid. In one
exemplary approach, the polypeptide has, as its N terminal residue,
a single cysteine residue whose side chain thiol is used for
linking. Multiple transporters can be attached to a single compound
if desired.
[0138] When the compound is a PMO, the transporter can be attached
at the 5' end of the PMO, e.g. via the 5'-hydroxyl group, or via an
amine capping moiety, as described in Example 1C. Alternatively,
the transporter may be attached at the 3' end, e.g. via a
morpholino ring nitrogen, as described in Example ID, either at a
terminus or an internal linkage. The linker may also comprise a
direct bond between the carboxy terminus of a transporter peptide
and an amine or hydroxy group of the PMO, formed by condensation
promoted by e.g. carbodiimide.
[0139] Linkers can be selected from those which are non-cleavable
under normal conditions of use, e.g., containing a thioether or
carbamate bond. In some embodiments, it may be desirable to include
a linkage between the transporter moiety and compound which is
cleavable in vivo. Bonds which are cleavable in vivo are known in
the art and include, for example, carboxylic acid esters, which are
hydrolyzed enzymatically, and disulfides, which are cleaved in the
presence of glutathione. It may also be feasible to cleave a
photolytically cleavable linkage, such as an ortho-nitrophenyl
ether, in vivo by application of radiation of the appropriate
wavelength.
[0140] For example, the preparation of a conjugate having a
disulfide linker, using the reagent N-succinimidyl
3-(2-pyridyldithio) propionate (SPDP) or succinimidyloxycarbonyl
.alpha.-methyl-.alpha.-(2-pyridyldithio) toluene (SMPT), is
described in Example 1E. Exemplary heterobifunctional linking
agents which further contain a cleavable disulfide group include
N-hydroxysuccinimidyl 3-[(4-azidophenyl)dithio]propionate and
others described in (Vanin).
[0141] IV. Targeted Delivery of rTat-Conjugated Anti-HIV Antisense
Oligomers
[0142] The present invention provides a method and composition for
delivering therapeutic compounds, e.g., uncharged antisense
compounds to hematopoietic cells, and, specifically, to activated T
cells, macrophages, monocytes, and mature dendritic cells. The
primary cellular reservoir for HIV production is from activated T
cells, macrophages and dendritic cells. The antiviral therapeutic
effect of HIV antisense oligomers is augmented by precisely
targeting the cells producing the majority of infectious virions.
This is especially powerful when coupled to an antisense oligomer
(e.g. antisense Vif oligomers) designed to create defective virions
as the mechanism of its therapeutic effect, in part, because the
crippled virus can serve as a vaccine in the infected host.
[0143] The ability of the rTAT peptide to enhance uptake of a
fluoresceinated PMO antisense compound selectively into activated
mouse lymphocytes is demonstrated in the study described in Example
1, and with the results shown in FIGS. 4A-4C. In this study,
cultured mouse splenocytes were incubated with fluorescent rTAT-PMO
conjugate and subjected to various lymphocyte activating
substances, as indicated in the drawings. Separate lymphocyte
populations (CD8 positive T cells, CD4 positive T cells, and B
cells (B220 positive cells) were stained with antibody to determine
the extent of uptake by FACS analysis of the cells. The results
show relatively low uptake of the antisense PMO into non-activated
cells (dark heavy line) in all three cell types. Activation by
gamma-interferon (gamma-IFN), phytohemaglutinin (PHA) or phorbol
myristic acid+calcium ionophore (PMA+ION) caused significantly
increased uptake of the antisense into CD8 and CD 4 T cells.
Likewise, activation of B cells with lipopolysaccharide (LPS) or
gamma-IFN resulted in a significant enhancement of the rTAT-PMO
into B cells.
[0144] The property of activation-dependent uptake of
peptide-antisense conjugate is not observed with other
arginine-rich peptides, which are known to enhance drug transport
into cells. This is demonstrated by a second study described in
Example 2, and with the results shown in FIGS. 5A and 5B. As seen
in these figures, P003-PMO conjugate (corresponding to the
arginine-rich peptide of SEQ ID NO:2) is readily taken up by naive
CD4 and naive CD8 T cells, PMO alone (e.g. no peptide conjugate) is
relatively poorly taken up naive cells, and rTAT-PMO shows enhanced
uptake into PHA treated cells.
[0145] In one aspect of the invention, therefore, the rTAT peptide
may be conjugated to a substantially uncharged antisense compound,
to enhance its selective uptake into activated T cells, B cells,
macrophages, monocytes or dendritic cells, including HIV-infected
cells of these lineages.
[0146] Where the method is used for treating an HIV infection in a
human subject, the exposing step involves administering the
antisense conjugate to the subject, in an amount effective to
reduce the severity of the HIV infection.
[0147] In one exemplary embodiment, the rTAT polypeptide is
covalently coupled at its N-terminal cysteine residue to the 3' or
5' end of the antisense compound. Also in an exemplary embodiment,
the antisense compound is composed of morpholino subunits and
phosphorus-containing intersubunit linkages joining a morpholino
nitrogen of one subunit to a 5' exocyclic carbon of an adjacent
subunit.
[0148] The invention further includes an antisense conjugate for
use in selectively targeting activated, HIV-activated myeloid- or
lymphoid-derived human cells, e.g., macrophage or T-lymphocyte
cells, with an antisense conjugate. The conjugate is composed of
(i) a substantially uncharged antisense compound containing 12-40
subunits and a base sequence effective to hybridize to a region of
HIV positive-strand RNA, e.g., the HIV Vif transcript identified by
SEQ ID NOS:26-31, thereby to block expression or otherwise inhibit
replication of the virus in the infected cells, and (ii) a reverse
TAT (rTAT) polypeptide having the sequence identified as SEQ ID NO:
1 and covalently coupled to the antisense compound. The compound
may have various exemplary structural features, as described
above.
[0149] Also disclosed is a method for treating a HIV infection in a
subject. The method includes administering to the subject, a
substantially uncharged antisense conjugate of the type just
described, thereby to block expression of an HIV protein or
proteins or block a cis-acting genomic elements that plays a role
in viral replication.
[0150] All patent and literature references cited in the present
specification are hereby incorporated by reference in their
entirety.
[0151] The following examples illustrate but are not intended in
any way to limit the invention.
EXAMPLE 1
Preparation Antisense PMO And Peptide Conjugates
[0152] A. Production of PMO and Peptide Conjugated PMOs.
[0153] The PMOs were synthesized at AVI BioPharma (Corvallis, OR)
as previously described (Summerton and Weller, 1997). Purity of
full length oligomers was >95% as determined by reverse-phase
high-pressure liquid chromatography (HPLC) and MALDI TOF mass
spectroscopy. Peptide conjugated forms of the PMO where produced by
attaching the carboxy terminal cysteine of the peptide to the 5'
end of the PMO through a cross-linker
N-[.quadrature.-maleimidobutyryloxy] succinimide ester (GMBS)
(Moulton and Moulton, 2003), as detailed below in section C. The
peptides used in this study designated as P002 (RRRQRRKKRC, SEQ ID
NO:1) (Moulton and Moulton, 2003) and P003 (RRRRRRRRRFFC, SEQ ID
NO:2). The lyophilized PMO or peptide-conjugated PMO were dissolved
in sterile H.sub.2O prior to use in cell cultures or dilution in
PBS prior to injection in to mice.
[0154] A schematic of a synthetic pathway that can be used to make
morpholino subunits containing a (1-piperazino) phosphinylideneoxy
linkage is shown in FIG. 6; further experimental detail for a
representative synthesis is provided in Materials and Methods,
below. As shown in the Figure, reaction of piperazine and trityl
chloride gave trityl piperazine (1a), which was isolated as the
succinate salt. Reaction with ethyl trifluoroacetate (1b) in the
presence of a weak base (such as diisopropylethylamine or DIEA)
provided 1-trifluoroacetyl-4-trityl piperazine (2), which was
immediately reacted with HCI to provide the salt (3) in good yield.
Introduction of the dichlorophosphoryl moiety was performed with
phosphorus oxychloride in toluene.
[0155] The acid chloride (4) is reacted with morpholino subunits
(moN), which may be prepared as described in U.S. Pat. No.
5,185,444 or in Summerton and Weller, 1997 (cited above), to
provide the activated subunits (5,6,7). Suitable protecting groups
are used for the nucleoside bases, where necessary; for example,
benzoyl for adenine and cytosine, isobutyryl for guanine, and
pivaloylmethyl for inosine. The subunits containing the
(1-piperazino) phosphinylideneoxy linkage can be incorporated into
the existing PMO synthesis protocol, as described, for example in
Summerton and Weller (1997), without modification.
[0156] B. 3'- Fluoresceination of a PMO (Phosphorodiamidate-Linked
Morpholino Oligomer).
[0157] A protected and activated carboxyfluorescein, e.g.
6-carboxyfluorescein dipivalate N-hydroxysuccinimide ester,
commercially available from Berry & Associates, Inc. (Dexter,
Mich.), was dissolved in NMP (0.05M), and the solution was added to
a PMO synthesis column in sufficient volume to cover the resin. The
mixture was incubated at 45.degree. C. for 20 minutes, then the
column was drained and a second similar portion of protected and
activated carboxyfluorescein was added to the column and incubated
at 45.degree. C. for 60 minutes. The column was drained and washed
with NMP, and the oligomer was cleaved from the resin using 1 ml of
cleavage solution (0.1M dithiothreitol in NMP containing 10%
triethylamine). The resin was washed with 300 .mu.l of cleavage
solution three times, immediately followed by addition of 4 ml of
concentrated ammonia hydroxide and 16 hours incubation at
45.degree. C. to remove base protecting groups. The morpholino
oligomer was precipitated by adding 8 volumes of acetone, the
mixture was centrifuged, and the pellet was washed with 15 ml of
CH.sub.3CN. The washed pellet was re-dissolved in 4 ml of H.sub.2O
and lyophilized. The product was analyzed by time-of-flight MALDI
mass spectrometry (MALDI-TOF) and high pressure liquid
chromatography (HPLC).
[0158] C. 2. 3'-Acetylation of PMO and 5' Attachment of Transport
Peptide.
[0159] Acetic anhydride (0.1 M), dissolved in
N-methyl-2-pyrrolidinone (NMP) containing 1% N-ethyl morpholine
(v/v) was added while the oligomer was still attached to the
synthesis resin. After 90 minutes at room temperature, the oligomer
was washed with NMP, cleaved from the synthesis resin and worked up
as described above. The product was analyzed by time-of-flight
MALDI mass spectrometry (MALDI-TOF) and high pressure liquid
chromatography (HPLC). The desired product included a 3'-acetyl
group and was capped at the 5'-end with piperazine, which was used
for conjugation, as described below.
[0160] The cross linker, N-(.gamma.-maleimidobutyryloxy)succinimide
ester (GMBS), was dissolved in 50 .mu.l of DMSO, and the solution
was added to the oligomer (2-5 mM) in sodium phosphate buffer (50
mM, pH 7.2) at a 1:2 PMO/GMBS molar ratio. The mixture was stirred
at room temperature in the dark for 30 minutes, and the product was
precipitated using a 30-fold excess of acetone, then redissolved in
water. The PMO-GMBS adduct was lyophilized and analyzed by
MALDI-TOF and HPLC. The adduct was then dissolved in phosphate
buffer (5OmM, pH 6.5, 5 mM EDTA) containing 20% CH.sub.3CN, and the
transport peptide was added, at a 2:1 peptide to PMO molar ratio
(based on a PMO concentration as determined by its absorbance at
260 nm). The reaction was stirred at room temperature in the dark
for 2 hours. The conjugate was purified first through a
CM-Sepharose (Sigma, St. Louis, Mo.) cationic exchange column, to
remove unconjugated PMO, then through a reverse phase column (HLB
column, Waters, Milford, Mass.). The conjugate was lyophilized and
analyzed by MALDI-TOF and capillary electrophoresis (CE). The final
product contained about 70% material corresponding to the full
length PMO conjugated to the transport peptide, with the balance
composed of shorter sequence conjugates, a small amount of
unconjugated PMO, both full length and fragments, and a very small
amount (about 2%) of unconjugated peptide. The concentration
determination used for all experiments was based on the total
absorbance at 260 nm, including all shorter PMO sequences in the
sample.
[0161] D. 3'-Attachment of Transport Peptide.
[0162] A PMO having a free secondary amine (ring nitrogen of
morpholine) at the 5'-end was dissolved in 100 MM sodium phosphate
buffer, pH 7.2, to make a 2-5 mM solution. The linking reagent,
GMBS, was dissolved in 100 .mu.l of DMSO and added to the PMO
solution at a PMO/GMBS ratio of 1:2. The mixture was stirred at
room temperature in the dark for 30 min, then passed through a P2
(Biorad) gel filtration column to remove the excess GMBS and
reaction by-products.
[0163] The GMBS-PMO adduct was lyophilized and re-dissolved in 50mM
phosphate buffer, pH 6.5, to make a 2-5 mM solution. A transport
peptide having a terminal cysteine was added to the GMBS-PMO
solution at a molar ratio of 2:1 peptide to PMO. The reaction
mixture was stirred at room temperature for 2 hours or at 4.degree.
C. overnight. The conjugate was purified by passing through
Excellulose gel filtration column (Pierce Chemical) to remove
excess peptide, then through a cation exchange CM-Sepharose column
(Sigma) to remove unconjugated PMO, and finally through an
Amberchrom reverse phase column (Rohm and Haas) to remove salt. The
conjugate was lyophilized and characterized by MS and HPLC.
[0164] E. Preparation of a PMO-Peptide Conjugate Having a Cleavable
Linker
[0165] The procedure of sections C or D is repeated, employing
N-succinimidyl 3-(2-pyridyldithio) propionate (SPDP) or
succinimidyloxycarbonyl .alpha.-methyl-.alpha.-(2-pyridyldithio)
toluene (SMPT) as linking reagent place of GMBS.
EXAMPLE 2
Uptake of rTAT-Antisense Conjugates Selectively into Activated T
Cells
[0166] The DO11.10 transgenic mouse system (Murphy, Heimberger et
al. 1990) was used as a source of splenocytes and T cells. This
transgenic mouse contains the gene for the T cell receptor (TCR)
from the T cell hybridoma, DO11. 10, that recognizes chicken
ovalbumin (OVA). Virtually all thymocytes and peripheral T cells in
these mice express the OVA-TCR which is detected by the KJ26
monoclonal antibody.
[0167] A. Uptake in Naive and Activated Murine Lymphocytes
[0168] Freshly isolated splenocytes from B6 mice were plated (1.5
million/well) into 96 well V-bottom plates and incubated with
PMO-fl, P002-PMO-fl or P003-PMO-fl [10 .mu.M, 10 .mu.M and 5 .mu.M
in culture media, respectively]. Lymphocyte activating substances
derived from bacterial (LPS), murine cytokine (Gamma IFN),
mitogenic plant lectin (PHA), chemical activator (PMA+ION) or
culture media control (naive cell treatment) were added to
individual cultures as follows; LPS [1.mu.g/ml]
(lipopolysaccharide), murine gamma interferon [10 ng/ml], PHA
(phytohemaglutanin) [2.5 .mu.g/ml], PMA (phorbol myristic
acid)+calcium ionophore [10 ng/ml+5 ng/ml] or RPMI+10% fetal calf
serum. All activating substances were added to cells with the PMO
treatment overnight save the PMA+calcium ionophore which was added
4 hours prior to staining the cells for flow cytometric analysis.
Immediately following treatment the cultures were washed twice with
cold FACS buffer (phosphate buffered saline+1% fetal calf
serum+0.02% w/v sodium azide). All cultures were suspended in 100
.mu.ls of Fc blocking antibody (eBioscience) [0.5 .mu.g/well] for
15 min on ice. Staining of lymphocyte populations was performed
using anti-CD4 or anti CD8 PE-Texas Red [0.3 .mu.g/million cells]
(CalTag) or anti-CD45R (clone B220) APC (eBioscience) [0.4
mg/million cells] for 30 min on ice. The cells were washed twice
with cold FACS buffer and suspended in 50 .mu.l of cold
cyofix/cytoperm reagent (Pharmingen) for 30 min to lyse remaining
red blood cells. The cells were washed once with FACS buffer and
suspended in 200 .mu.l FACS buffer prior to analysis. Cell staining
and PMO-fl uptake was measured using a FACSCalibur flow cytometer
(Becton Dickinson). Flow data was analyzed using FCS Express 2 Pro
software (Denovo software).
[0169] FIG. 4 demonstrates that separate lymphocytes populations
all have enhanced uptake of P002-PMO conjugate when activated by a
variety of lymphocyte activators. Different lymphocyte populations
were stained with antibodies to determine the extent of uptake by
FACS analysis in T cells A) CD8 positive T cells, B) CD4 positive T
cells and C) B cells (B220 positive cells).
[0170] FIG. 5 is similar to FIG. 4 except that P003-PMO-fl was
compared to P002-PMO-fl and unconjugated PMO-fl in A) CD8 positive
T cells and B) CD4 positive T cells. The P002-PMO-fl treated cells
were activated with PHA as described above. The figure indicates
that the P003 peptide greatly enhances uptake in naive T-cells of
both CD4 and CD8 lineages compared to PHA-activated T-cells treated
with P002-PMO-fl. Uptake of the PMO-fl without a peptide conjugate
is undetectable.
EXAMPLE 3
Inhibition of HIV-1 Replication in Human H9 Cells by a
Peptide-Conjugated Antisense PMO Targeted to the HIV-1 Vif AUG
Start Codon
[0171] The human T-cell line H9 was grown and harvested using
standard protocols. Cells were pelleted and resuspended in
RPMI-1640 supplemented with 0.1% fetal bovine serum (FBS). From
this cell suspension, 5.times.10 6 cells were infected in bulk with
HIV-1 (strain NL4-3) at a multiplicity of infection (MOI) equal to
0.001 in a T25 flask The cells were incubated in the presence of
HIV-1 for 2 hours at 37 degrees C. The cells were pelleted by
centrifugation and resuspended in 20 ml of RPMI-1640+10% FBS. The
infected cell suspension was used to seed a 24 well plate at
1.times.10 5 cells per well. The final volume per well was adjusted
to one ml. Peptide conjugated Vif-AUG4 PMO (Vif4-P007; SEQ ID NO:5
conjugated to SEQ ID NO:3) was added to each well at concentrations
ranging from 10 to 5000 nanomolar and incubated for 5-7 days at 37
degrees C. A P007 conjugated scrambled control PMO was used as a
negative control with a concentration range from 500 to 10000
nanomolar. On day five, 200 microliters was removed from each well
and used in a HIV-1 P24 antigen capture ELISA. The results are
shown in FIG. 7 as a plot of the P24 ELISA readout (Absorbance at
450 nM) versus the PMO concentration. The Vif4-P007 PMO reduced the
replication of HIV-1 significantly compared to the scramble control
(Scr-P007). The Scr-P007 compound does inhibit HIV-1 replication
due to a known ability of arginine-rich polypeptides to block HIV-1
cell entry. The specific inhibition of the Vif4-P007 compound is
reflected in the greater than 20-fold lower EC50 as shown in FIG. 7
(approx. 100 nanomolar for Vif4-P007 vs. approx. 2 micromolar for
the Scr-P007 compound). TABLE-US-00003 Sequence ID Listing SEQ ID
Peptide Sequences (NH.sub.2 to COOH)* NO. Name RRRQRRKKRC 1 P002,
rTat RRRRRRRRRFFC 2 P003, R.sub.9F.sub.2 RAhxRRAhxRRAhxRRAhxRAhxB 3
P007, (RXR).sub.4XB RBRBRBRBRBRBRBRAhxB 4 (RB).sub.7RXB Oligomer
Targeting Sequences (5'-3') CCTGCCATCTGTTTTCCATAATC 5 Vif-AUG4
CTGCCATCTGTTTTCCATA 6 Vif-AUG5 CACCTGCCATCTGTTTTCC 7 Vif-AUG6
CTGCCATCTGTTTTCCATAGTC 8 Vif-AUG4 CTGCCATCTGTTTTCCATAITC 9
Vif-AUG4I CACCTGCCATCTGTTTTCCATA 10 Vif-AUG5
CTGCCATCTGT.sup.+T.sup.+TTCCAT.sup.+AG.sup.+TC 11 Vif-AUG4
CTGCCATCTGT.sup.+T.sup.+TTCCAT.sup.+A.sup.+ITC 12 Vif-AUG4I
RRRQRRKKRC 1 P002, rTat RRRRRRRRRFFC 2 P003, R.sub.9F.sub.2
RAhxRRAhxRRAhxRRAhxRAhxB 3 P007, (RXR).sub.4XB RBRBRBRBRBRBRBRAhxB
4 (RB).sub.7RXB Oligomer Targeting Sequences (5'-3')
CCTGCCATCTGTTTTCCATAATC 5 Vif-AUG4 CTGCCATCTGTTTTCCATA 6 Vif-AUG5
CACCTGCCATCTGTTTTCC 7 Vif-AUG6 CTGCCATCTGTTTTCCATAGTC 8 Vif-AUG4
CTGCCATCTGTTTTCCATAITC 9 Vif-AUG4I CACCTGCCATCTGTTTTCCATA 10
Vif-AUG56 CTGCCATCTGT.sup.+T.sup.+TTCCAT.sup.+AG.sup.+TC 11
Vif-AUG4 CTGCCATCTGT.sup.+T.sup.+TTCCAT.sup.+A.sup.+ITC 12
Vif-AUG4I CACCTGCCATCTGT.sup.+T.sup.+TTCC.sup.+A.sup.+TA 13
Vif-AUG56 RRRQRRKKRC 1 P002, rTat RRRRRRRRRFFC 2 P003,
R.sub.9F.sub.2 RAhxRRAhxRRAhxRRAhxRAhxB 3 P007, (RXR).sub.4XB
RBRBRBRBRBRBRBRAhxB 4 (RB).sub.7RXB Oligomer Targeting Sequences
(5'-3') CCTGCCATCTGTTTTCCATAATC 5 Vif-AUG4 CTGCCATCTGTTTTCCATA 6
Vif-AUG5 CACCTGCCATCTGTTTTCC 7 Vif-AUG6 CTGCCATCTGTTTTCCATAGTC 8
Vif-AUG4 CTGCCATCTGTTTTCCATAITC 9 Vif-AUG4I CACCTGCCATCTGTTTTCCATA
10 Vif-AUG56 CTGCCATCTGT.sup.+T.sup.+TTCCAT.sup.+AG.sup.+TC 11
Vif-AUG4 CTGCCATCTGT.sup.+T.sup.+TTCCAT.sup.+A.sup.+ITC 12
Vif-AUG4I GCTCCCAGGCTCAGATCTGGTC 14 Tar1 RRRQRRKKRC 1 P002, rTat
RRRRRRRRRFFC 2 P003, R.sub.9F.sub.2 RAhxRRAhxRRAhxRRAhxRAhxB 3
P007, (RXR).sub.4XB RBRBRBRBRBRBRBRAhxB 4 (RB).sub.7RXB Oligomer
Targeting Sequences (5'-3') CCTGCCATCTGTTTTCCATAATC 5 Vif-AUG4
CTGCCATCTGTTTTCCATA 6 Vif-AUG5 CACCTGCCATCTGTTTTCC 7 Vif-AUG6
CTGCCATCTGTTTTCCATAGTC 8 Vif-AUG4 CTGCCATCTGTTTTCCATAITC 9
Vif-AUG4I CACCTGCCATCTGTTTTCCATA 10 Vif-AUG56
CTGCCATCTGT.sup.+T.sup.+TTCCAT.sup.+AG.sup.+TC 11 Vif-AUG4
CTGCCATCTGT.sup.+T.sup.+TTCCAT.sup.+A.sup.+ITC 12 Vif-AUG4I
GTTAGCCAGAGAGCTCCCAGGC 15 Tar2 RRRQRRKKRC 1 P002, rTat RRRRRRRRRFFC
2 P003, R.sub.9F.sub.2 RAhxRRAhxRRAhxRRAhxRAhxB 3 P007,
(RXR).sub.4XB RBRBRBRBRBRBRBRAhxB 4 (RB).sub.7RXB Oligomer
Targeting Sequences (5'-3') CCTGCCATCTGTTTTCCATAATC 5 Vif-AUG4
CTGCCATCTGTTTTCCATA 6 Vif-AUG5 CACCTGCCATCTGTTTTCC 7 Vif-AUG6
CTGCCATCTGTTTTCCATAGTC 8 Vif-AUG4 CTGCCATCTGTTTTCCATAITC 9
Vif-AUG4I CACCTGCCATCTGTTTTCCATA 10 Vif-AUG56
CTGCCATCTGT.sup.+T.sup.+TTCCAT.sup.+AG.sup.+TC 11 Vif-AUG4
CTGCCATCTGT.sup.+T.sup.+TTCCAT.sup.+A.sup.+ITC 12 Vif-AUG4I
CCAGAGAGACCCAGTACAGG 16 U3R RRRQRRKKRC 1 P002, rTat RRRRRRRRRFFC 2
P003, R.sub.9F.sub.2 RAhxRRAhxRRAhxRRAhxRAhxB 3 P007, (RXR).sub.4XB
RBRBRBRBRBRBRBRAhxB 4 (RB).sub.7RXB Oligomer Targeting Sequences
(5'-3') CCTGCCATCTGTTTTCCATAATC 5 Vif-AUG4 CTGCCATCTGTTTTCCATA 6
Vif-AUG5 CACCTGCCATCTGTTTTCC 7 Vif-AUG6 CTGCCATCTGTTTTCCATAGTC 8
Vif-AUG4 CTGCCATCTGTTTTCCATAITC 9 Vif-AUG4I CACCTGCCATCTGTTTTCCATA
10 Vif-AUG56 CTGCCATCTGT.sup.+T.sup.+TTCCAT.sup.+AG.sup.+TC 11
Vif-AUG4 CTGCCATCTGT.sup.+T.sup.+TTCCAT.sup.+A.sup.+ITC 12
Vif-AUG4I Target Sequences (5'-3') RRRQRRKKRC 1 P002, rTat
RRRRRRRRRFFC 2 P003, R.sub.9F.sub.2 RAhxRRAhxRRAhxRRAhxRAhxB 3
P007, (RXR).sub.4XB RBRBRBRBRBRBRBRAhxB 4 (RB).sub.7RXB Oligomer
Targeting Sequences (5'-3') CCTGCCATCTGTTTTCCATAATC 5 Vif-AUG4
CTGCCATCTGTTTTCCATA 6 Vif-AUG5 CACCTGCCATCTGTTTTCC 7 Vif-AUG6
CTGCCATCTGTTTTCCATAGTC 8 Vif-AUG4 CTGCCATCTGTTTTCCATAITC 9
Vif-AUG4I CACCTGCCATCTGTTTTCCATA 10 Vif-AUG56
CTGCCATCTGT.sup.+T.sup.+TTCCAT.sup.+AG.sup.+TC 11 Vif-AUG4
CTGCCATCTGT.sup.+T.sup.+TTCCAT.sup.+A.sup.+ITC 12 Vif-AUG4I
GACTATGGAAAACAGATGGCAGGTGATGAT 17 Vif-AUGc
GACCAGATCTGAGCCTGGGAGCTCTCTGGC 18 TARc RRRQRRKKRC 1 P002, rTat
RRRRRRRRRFFC 2 P003, R.sub.9F.sub.2 RAhxRRAhxRRAhxRRAhxRAhxB 3
P007, (RXR).sub.4XB RBRBRBRBRBRBRBRAhxB 4 (RB).sub.7RXB Oligomer
Targeting Sequences (5'-3') CCTGCCATCTGTTTTCCATAATC 5 Vif-AUG4
CTGCCATCTGTTTTCCATA 6 Vif-AUG5 CACCTGCCATCTGTTTTCC 7 Vif-AUG6
CTGCCATCTGTTTTCCATAGTC 8 Vif-AUG4
CTGCCATCTGTTTTCCATAITC 9 Vif-AUG4I CACCTGCCATCTGTTTTCCATA 10
Vif-AUG56 CTGCCATCTGT.sup.+T.sup.+TTCCAT.sup.+AG.sup.+TC 11
Vif-AUG4 CTGCCATCTGT.sup.+T.sup.+TTCCAT.sup.+A.sup.+ITC 12
Vif-AUG4I CCTGTACTGGGTCTCTCTGG 19 U3Rc *R = Arginine, F =
phenylalanine, B = beta-alanine, Ahx = 6-aminohexanoic acid
[0172]
Sequence CWU 1
1
19 1 10 PRT Artificial Sequence synthetic Arginine-rich peptide 1
Arg Arg Arg Gln Arg Arg Lys Lys Arg Cys 1 5 10 2 12 PRT Artificial
Sequence synthetic Arginine-rich peptide 2 Arg Arg Arg Arg Arg Arg
Arg Arg Arg Phe Phe Cys 1 5 10 3 14 PRT Artificial Sequence
synthetic Arginine-rich peptide misc_feature (2)..(13) Xaa is
6-aminohexanoic acid misc_feature (14)..(14) Xaa is beta-Alanine 3
Arg Xaa Arg Arg Xaa Arg Arg Xaa Arg Arg Xaa Arg Xaa Xaa 1 5 10 4 17
PRT Artificial Sequence Synthetic Arginine-rich peptide VARIANT
(2)..(16) Xaa is 6-aminohexanoic acid VARIANT (17)..(17) Xaa is
beta-Alanine 4 Arg Xaa Arg Xaa Arg Xaa Arg Xaa Arg Xaa Arg Xaa Arg
Xaa Arg Xaa 1 5 10 15 Xaa 5 23 DNA Artificial Sequence synthetic
antisense oligomer 5 cctgccatct gttttccata atc 23 6 19 DNA
Artificial Sequence synthetic antisense oligomer 6 ctgccatctg
ttttccata 19 7 19 DNA Artificial Sequence synthetic antisense
oligomer 7 cacctgccat ctgttttcc 19 8 22 DNA Artificial Sequence
synthetic antisense oligomer 8 ctgccatctg ttttccatag tc 22 9 22 DNA
Artificial Sequence synthetic antisense oligomer misc_feature
(20)..(20) n is inosine 9 ctgccatctg ttttccatan tc 22 10 22 DNA
Artificial Sequence synthetic antisense oligomer 10 cacctgccat
ctgttttcca ta 22 11 22 DNA Artificial Sequence synthetic antisense
oligomer 11 ctgccatctg ttttccatag tc 22 12 22 DNA Artificial
Sequence synthetic antisense oligomer misc_feature (20)..(20) n is
inosine 12 ctgccatctg ttttccatan tc 22 13 22 DNA Artificial
Sequence synthetic antisense oligomer 13 cacctgccat ctgttttcca ta
22 14 22 DNA Artificial Sequence synthetic antisense oligomer 14
gctcccaggc tcagatctgg tc 22 15 22 DNA Artificial Sequence synthetic
antisense oligomer 15 gttagccaga gagctcccag gc 22 16 20 DNA
Artificial Sequence synthetic antisense oligomer 16 ccagagagac
ccagtacagg 20 17 33 DNA Human immunodeficiency virus 1 17
gactatggaa aacagatggc aggtgatgat tgt 33 18 34 DNA Artificial
Sequence synthetic sequence based on Human immunodeficiency virus 1
18 gaccagatct gagcctggga gctctctggc taac 34 19 20 DNA Human
immunodeficiency virus 1 19 cctgtactgg gtctctctgg 20
* * * * *