U.S. patent application number 11/534950 was filed with the patent office on 2007-02-01 for novel human sodium-dependent phosphate cotransporter.
This patent application is currently assigned to Incyte Pharmaceuticals, Inc. Invention is credited to Olga Bandman, Preeti Lal.
Application Number | 20070026449 11/534950 |
Document ID | / |
Family ID | 25190716 |
Filed Date | 2007-02-01 |
United States Patent
Application |
20070026449 |
Kind Code |
A1 |
Lal; Preeti ; et
al. |
February 1, 2007 |
NOVEL HUMAN SODIUM-DEPENDENT PHOSPHATE COTRANSPORTER
Abstract
The present invention provides a human sodium-dependent
phosphate cotransporter (NAPTR) and polynucleotides which identify
and encode NAPTR. The invention also provides genetically
engineered expression vectors and host cells comprising the nucleic
acid sequences encoding NAPTR and a method for producing NAPTR. The
invention also provides for agonists, antibodies, or antagonists
specifically for NAPTR. Additionally, the invention provides for
the use of antisense molecules to polynucleotides encoding NAPTR
for the treatment of diseases associated with the expression of
NAPTR. The invention also provides diagnostic assays which utilize
the polynucleotide, or fragments or the complement thereof, and
antibodies specifically binding NAPTR. The invention also provides
a method for treating disorders associated with decreased phosphate
levels by administering NAPTR and a method for treating disorders
associated with increased phosphate levels by administering
antagonists to NAPTR.
Inventors: |
Lal; Preeti; (Sunnyvale,
CA) ; Bandman; Olga; (Mountain View, CA) |
Correspondence
Address: |
MERCHANT & GOULD PC
P.O. BOX 2903
MINNEAPOLIS
MN
55402-0903
US
|
Assignee: |
Incyte Pharmaceuticals, Inc
Palo Alto
CA
|
Family ID: |
25190716 |
Appl. No.: |
11/534950 |
Filed: |
September 25, 2006 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10877818 |
Jun 25, 2004 |
|
|
|
11534950 |
Sep 25, 2006 |
|
|
|
09965522 |
Sep 26, 2001 |
|
|
|
10877818 |
Jun 25, 2004 |
|
|
|
09391958 |
Sep 8, 1999 |
6326207 |
|
|
09965522 |
Sep 26, 2001 |
|
|
|
08805118 |
Feb 24, 1997 |
5985604 |
|
|
09391958 |
Sep 8, 1999 |
|
|
|
Current U.S.
Class: |
435/6.16 ;
435/252.3; 435/320.1; 435/325; 435/69.1; 435/7.1; 514/1.2;
514/16.7; 530/350; 530/388.22; 536/23.5 |
Current CPC
Class: |
C07K 14/705 20130101;
G01N 33/6872 20130101; A61K 38/00 20130101; C07K 14/47
20130101 |
Class at
Publication: |
435/006 ;
435/069.1; 435/252.3; 435/320.1; 435/325; 530/350; 536/023.5;
530/388.22; 435/007.1; 514/012 |
International
Class: |
C12Q 1/68 20060101
C12Q001/68; G01N 33/53 20060101 G01N033/53; C07H 21/04 20060101
C07H021/04; C12P 21/06 20060101 C12P021/06; C12N 1/21 20070101
C12N001/21; C07K 14/705 20070101 C07K014/705; C07K 16/28 20070101
C07K016/28 |
Claims
1. An isolated polypeptide selected from the group consisting of:
a) a polypeptide comprising the amino acid sequence of SEQ ID NO:1,
b) a polypeptide comprising a naturally occurring amino acid
sequence at least 90% identical to the amino acid sequence of SEQ
ID NO:1, c) a biologically active fragment of a polypeptide having
the amino acid sequence of SEQ ID NO:1, and d) an immunogenic
fragment of a polypeptide having the amino acid sequence of SEQ ID
NO:1.
2. An isolated polypeptide of claim 1 comprising the amino acid
sequence of SEQ ID NO:1.
3. An isolated polynucleotide encoding a polypeptide of claim
1.
4. An isolated polynucleotide encoding a polypeptide of claim
2.
5. An isolated polynucleotide of claim 4 comprising the
polynucleotide sequence of SEQ ID NO:2.
6. A recombinant polynucleotide comprising a promoter sequence
operably linked to a polynucleotide of claim 3.
7. A cell transformed with a recombinant polynucleotide of claim
6.
8. A transgenic organism comprising a recombinant polynucleotide of
claim 6.
9. A method of producing a polypeptide of claim 1, the method
comprising: a) culturing a cell under conditions suitable for
expression of the polypeptide, wherein said cell is transformed
with a recombinant polynucleotide, and said recombinant
polynucleotide comprises a promoter sequence operably linked to a
polynucleotide encoding the polypeptide of claim 1, and b)
recovering the polypeptide so expressed.
10. A method of claim 9, wherein the polypeptide has the amino acid
sequence of SEQ ID NO:1.
11. An isolated antibody which specifically binds to a polypeptide
selected from the group consisting of: a) a polypeptide comprising
the amino acid sequence of SEQ ID NO:1, b) a polypeptide comprising
a naturally occurring amino acid sequence at least 90% identical to
the amino acid sequence of SEQ ID NO:1, c) a biologically active
fragment of a polypeptide having the amino acid sequence of SEQ ID
NO:1, and d) an immunogenic fragment of a polypeptide having the
amino acid sequence of SEQ ID NO:1.
12. An isolated polynucleotide selected from the group consisting
of: a) a polynucleotide comprising the polynucleotide sequence of
SEQ ID NO:2, b) a polynucleotide comprising a naturally occurring
polynucleotide sequence at least 90% identical to the
polynucleotide sequence of SEQ ID NO:2, c) a polynucleotide
complementary to a polynucleotide of a), d) a polynucleotide
complementary to a polynucleotide of b), and e) an RNA equivalent
of a)-d).
13. An isolated polynucleotide comprising at least 60 contiguous
nucleotides of a polynucleotide of claim 12.
14. A method of detecting a target polynucleotide in a sample, said
target polynucleotide having a sequence of a polynucleotide of
claim 12, the method comprising: a) hybridizing the sample with a
probe comprising at least 20 contiguous nucleotides comprising a
sequence complementary to said target polynucleotide in the sample,
and which probe specifically hybridizes to said target
polynucleotide, under conditions whereby a hybridization complex is
formed between said probe and said target polynucleotide or
fragments thereof, and b) detecting the presence or absence of said
hybridization complex, and, optionally, if present, the amount
thereof.
15. A method of claim 14, wherein the probe comprises at least 60
contiguous nucleotides.
16. A method of detecting a target polynucleotide in a sample, said
target polynucleotide having a sequence of a polynucleotide of
claim 12, the method comprising: a) amplifying said target
polynucleotide or fragment thereof using polymerase chain reaction
amplification, and b) detecting the presence or absence of said
amplified target polynucleotide or fragment thereof, and,
optionally, if present, the amount thereof.
17. A composition comprising a polypeptide of claim 1 and a
pharmaceutically acceptable excipient.
18. A composition of claim 17, wherein the polypeptide has the
amino acid sequence of SEQ ID NO:1.
19. A method for treating a disease or condition associated with
decreased expression of functional NAPTR, comprising administering
to a patient in need of such treatment the composition of claim
17.
20. A method of screening a compound for effectiveness as an
agonist of a polypeptide of claim 1, the method comprising: a)
exposing a sample comprising a polypeptide of claim 1 to a
compound, and b) detecting agonist activity in the sample.
21. A composition comprising an agonist compound identified by a
method of claim 20 and a pharmaceutically acceptable excipient.
22. A method for treating a disease or condition associated with
decreased expression of functional NAPTR, comprising administering
to a patient in need of such treatment a composition of claim
21.
23. A method of screening a compound for effectiveness as an
antagonist of a polypeptide of claim 1, the method comprising: a)
exposing a sample comprising a polypeptide of claim 1 to a
compound, and b) detecting antagonist activity in the sample.
24. A composition comprising an antagonist compound identified by a
method of claim 23 and a pharmaceutically acceptable excipient.
25. A method for treating a disease or condition associated with
overexpression of functional NAPTR, comprising administering to a
patient in need of such treatment a composition of claim 24.
26. A method of screening for a compound that specifically binds to
the polypeptide of claim 1, the method comprising: a) combining the
polypeptide of claim 1 with at least one test compound under
suitable conditions, and b) detecting binding of the polypeptide of
claim 1 to the test compound, thereby identifying a compound that
specifically binds to the polypeptide of claim 1.
27. A method of screening for a compound that modulates the
activity of the polypeptide of claim 1, the method comprising: a)
combining the polypeptide of claim 1 with at least one test
compound under conditions permissive for the activity of the
polypeptide of claim 1, b) assessing the activity of the
polypeptide of claim 1 in the presence of the test compound, and c)
comparing the activity of the polypeptide of claim 1 in the
presence of the test compound with the activity of the polypeptide
of claim 1 in the absence of the test compound, wherein a change in
the activity of the polypeptide of claim 1 in the presence of the
test compound is indicative of a compound that modulates the
activity of the polypeptide of claim 1.
28. A method of screening a compound for effectiveness in altering
expression of a target polynucleotide, wherein said target
polynucleotide comprises a sequence of claim 5, the method
comprising: a) exposing a sample comprising the target
polynucleotide to a compound, under conditions suitable for the
expression of the target polynucleotide, b) detecting altered
expression of the target polynucleotide, and c) comparing the
expression of the target polynucleotide in the presence of varying
amounts of the compound and in the absence of the compound.
29. A method of assessing toxicity of a test compound, the method
comprising: a) treating a biological sample containing nucleic
acids with the test compound, b) hybridizing the nucleic acids of
the treated biological sample with a probe comprising at least 20
contiguous nucleotides of a polynucleotide of claim 12 under
conditions whereby a specific hybridization complex is formed
between said probe and a target polynucleotide in the biological
sample, said target polynucleotide comprising a polynucleotide
sequence of a polynucleotide of claim 12 or fragment thereof, c)
quantifying the amount of hybridization complex, and d) comparing
the amount of hybridization complex in the treated biological
sample with the amount of hybridization complex in an untreated
biological sample, wherein a difference in the amount of
hybridization complex in the treated biological sample is
indicative of toxicity of the test compound.
30. A diagnostic test for a condition or disease associated with
the expression of NAPTR in a biological sample, the method
comprising: a) combining the biological sample with an antibody of
claim 11, under conditions suitable for the antibody to bind the
polypeptide and form an antibody:polypeptide complex, and b)
detecting the complex, wherein the presence of the complex
correlates with the presence of the polypeptide in the biological
sample.
31. The antibody of claim 11, wherein the antibody is: a) a
chimeric antibody, b) a single chain antibody, c) a Fab fragment,
d) a F(ab').sub.2 fragment, or e) a humanized antibody.
32. A composition comprising an antibody of claim 11 and an
acceptable excipient.
33. A method of diagnosing a condition or disease associated with
the expression of NAPTR in a subject, comprising administering to
said subject an effective amount of the composition of claim
32.
34. A composition of claim 32, wherein the antibody is labeled.
35. A method of diagnosing a condition or disease associated with
the expression of NAPTR in a subject, comprising administering to
said subject an effective amount of the composition of claim
34.
36. A method of preparing a polyclonal antibody with the
specificity of the antibody of claim 11, the method comprising: a)
immunizing an animal with a polypeptide having the amino acid
sequence of SEQ ID NO:1, or an immunogenic fragment thereof, under
conditions to elicit an antibody response, b) isolating antibodies
from said animal, and c) screening the isolated antibodies with the
polypeptide, thereby identifying a polyclonal antibody which binds
specifically to a polypeptide having the amino acid sequence of SEQ
ID NO:1.
37. A polyclonal antibody produced by a method of claim 36.
38. A composition comprising the polyclonal antibody of claim 37
and a suitable carrier.
39. A method of making a monoclonal antibody with the specificity
of the antibody of claim 11, the method comprising: a) immunizing
an animal with a polypeptide having the amino acid sequence of SEQ
ID NO:1, or an immunogenic fragment thereof, under conditions to
elicit an antibody response, b) isolating antibody producing cells
from the animal, c) fusing the antibody producing cells with
immortalized cells to form monoclonal antibody-producing hybridoma
cells, d) culturing the hybridoma cells, and e) isolating from the
culture monoclonal antibody which binds specifically to a
polypeptide having the amino acid sequence of SEQ ID NO:1.
40. A monoclonal antibody produced by a method of claim 39.
41. A composition comprising the monoclonal antibody of claim 40
and a suitable carrier.
42. The antibody of claim 11, wherein the antibody is produced by
screening a Fab expression library.
43. The antibody of claim 11, wherein the antibody is produced by
screening a recombinant immunoglobulin library.
44. A method of detecting a polypeptide having the amino acid
sequence of SEQ ID NO:1 in a sample, the method comprising: a)
incubating the antibody of claim 11 with a sample under conditions
to allow specific binding of the antibody and the polypeptide, and
b) detecting specific binding, wherein specific binding indicates
the presence of a polypeptide having the amino acid sequence of SEQ
ID NO:1 in the sample.
45. A method of purifying a polypeptide having the amino acid
sequence of SEQ ID NO:1 from a sample, the method comprising: a)
incubating the antibody of claim 11 with a sample under conditions
to allow specific binding of the antibody and the polypeptide, and
b) separating the antibody from the sample and obtaining the
purified polypeptide having the amino acid sequence of SEQ ID
NO:1.
46. A microarray wherein at least one element of the microarray is
a polynucleotide of claim 13.
47. A method of generating a transcript image of a sample which
contains polynucleotides, the method comprising: a) labeling the
polynucleotides of the sample, b) contacting the elements of the
microarray of claim 46 with the labeled polynucleotides of the
sample under conditions suitable for the formation of a
hybridization complex, and c) quantifying the expression of the
polynucleotides in the sample.
48. An array comprising different nucleotide molecules affixed in
distinct physical locations on a solid substrate, wherein at least
one of said nucleotide molecules comprises a first oligonucleotide
or polynucleotide sequence specifically hybridizable with at least
30 contiguous nucleotides of a target polynucleotide, and wherein
said target polynucleotide is a polynucleotide of claim 12.
49. An array of claim 48, wherein said first oligonucleotide or
polynucleotide sequence is completely complementary to at least 30
contiguous nucleotides of said target polynucleotide.
50. An array of claim 48, wherein said first oligonucleotide or
polynucleotide sequence is completely complementary to at least 60
contiguous nucleotides of said target polynucleotide.
51. An array of claim 48, wherein said first oligonucleotide or
polynucleotide sequence is completely complementary to said target
polynucleotide.
52. An array of claim 48, which is a microarray.
53. An array of claim 48, further comprising said target
polynucleotide hybridized to a nucleotide molecule comprising said
first oligonucleotide or polynucleotide sequence.
54. An array of claim 48, wherein a linker joins at least one of
said nucleotide molecules to said solid substrate.
55. An array of claim 48, wherein each distinct physical location
on the substrate contains multiple nucleotide molecules, and the
multiple nucleotide molecules at any single distinct physical
location have the same sequence, and each distinct physical
location on the substrate contains nucleotide molecules having a
sequence which differs from the sequence of nucleotide molecules at
another distinct physical location on the substrate.
56. A polypeptide of claim 1, comprising the amino acid sequence of
SEQ ID NO:1.
57. A polynucleotide of claim 12, comprising the polynucleotide
sequence of SEQ ID NO:2.
Description
[0001] This application is a divisional application of U.S.
application Ser. No. 09/391,958, filed Sep. 8, 1999, entitled NOVEL
HUMAN SODIUM-DEPENDENT PHOSPHATE COTRANSPORTER, which is a
divisional application of U.S. application Ser. No. 08/805,118,
filed Feb. 24, 1997, which issued on Nov. 16, 1999 as U.S. Pat. No.
5,985,604, entitled HUMAN SODIUM-DEPENDENT PHOSPHATE COTRANSPORTER.
Both of these applications are hereby expressly incorporated by
reference herein.
FIELD OF THE INVENTION
[0002] This invention relates to nucleic acid and amino acid
sequences of a novel human sodium-dependent phosphate cotransporter
and to the use of these sequences in the diagnosis, prevention, and
treatment of diseases associated with increased or decreased
phosphate levels.
BACKGROUND OF THE INVENTION
[0003] Phosphate is present in the plasma, intracellular fluid,
cell membranes, collagen and bone tissue of mammals. It is a
dynamic constituent of energy metabolism, an essential component of
skeletal mineralization, a modulator of tissue concentrations of
calcium, and plays a major role in renal excretion of H.sup.+.
[0004] Phosphate homeostasis in mammals is a balance between
intake, intestinal absorption, bone deposition/resorption, and
renal excretion and resorption. An excess of phosphate reduces the
circulating Ca.sup.2+ levels, and a deficit results in decreases in
erythrocyte ATP and 2,3-diphosphoglycerate and contributes to the
pathology of osteomalacia, hypocalciuria, and rickets. Dietary
phosphate is absorbed from the gastrointestinal tract in an active,
energy-dependent process that is modified by hormones, vitamin D,
Ca.sup.2+, and Al.sup.3+. Regulation of the serum concentration of
phosphate is maintained through resorption by the sodium phosphate
cotransport system, located in the proximal convoluted renal
tubule. Local concentration of phosphate in specific tissue types,
such as liver, bone, and brain, is modulated by sodium phosphate
transport proteins located in these tissues (Hartmann, C. et al.
(1996) Proc. Natl. Acad. Sci. USA 93:7409-7414; Glinn, M. et al.
(1995) J. Neurochem. 65:2358-2365).
[0005] Human NPT1, NPT2, NaP.sub.1-3, and the X-linked
hypophosphatemia (PEX) sodium phosphate transport proteins are
found in the renal brush border membrane where they participate in
renal tubular phosphate uptake. Although similar in function, these
renal proteins differ in affinity, capacity, map to different
chromosomal locations, and are differentially regulated by hormones
and dietary phosphate (Tenenhouse, H. (1989) Biochim. Biophys. Acta
984:207-213; Fulceri, R. (1993) Biochem. J. 289:299-306; Chong, S.
et al. (1993) Genomics 18:355-359; Miyamoto, K. et al. (1995)
Biochem. J. 305:81-85).
[0006] Sodium phosphate transport proteins in rat brain neurons
regulate intracellular phosphate concentrations necessary for
maintaining the phosphorylation potential of the cell.
Physiological concentrations of phosphate enhance the ATP-dependent
binding of Ca.sup.2+ to brain microsomes, resulting in a larger
intracellular pool of Ca.sup.2+ released by inositol triphosphate.
The expression of the brain specific sodium-dependent phosphate
transporter, rBNPI, is developmentally regulated and is specific to
neuron enriched regions of the adult rat brain. Avian osteoclasts
express a sodium-dependent phosphate transporter regulated through
integrin-mediated pathways in the presence of bone. This
transporter is hypothesized to act in the transcellular movement of
phosphate during active bone resorption (Ni, B. (1995) J. Neurosci.
15:5789-5799; Gupta, A. (1996) Kidney Int. 46:968-974).
[0007] By low stringency screening of a human kidney cortex cDNA
library with a rabbit NaP1-1 cDNA, Chong et. al. (1993, supra)
isolated a cDNA encoding a human sodium-dependent phosphate
transport protein (NPT1). Localization of NPT1 to 6p23-p21.3 was
found by Southern hybridization to HindIII-digested DNA from a
human chromosome 6 somatic cell hybrid deletion panel. Fluorescence
in situ hybridization maps NPT1 to 12p11 in the rabbit. This
assignment agrees with the previously reported homology between
rabbit chromosome 12 and human chromosome 6 (Kos, C. et al. (1994)
Genomics 19:176-177).
[0008] The discovery of proteins related to human renal sodium
phosphate transport protein, and the polynucleotides encoding them,
satisfies a need in the art by providing new compositions useful in
diagnosis and treatment of diseases associated with increased or
decreased phosphate levels.
SUMMARY OF THE INVENTION
[0009] The present invention features a novel human
sodium-dependent phosphate cotransporter hereinafter designated
NAPTR and characterized as having similarity to human renal sodium
phosphate transport protein and rat brain-specific sodium-dependent
inorganic phosphate cotransporter.
[0010] Accordingly, the invention features a substantially purified
NAPTR having the amino acid sequence shown in SEQ ID NO:1.
[0011] One aspect of the invention features isolated and
substantially purified polynucleotides that encode NAPTR. In a
particular aspect, the polynucleotide is the nucleotide sequence of
SEQ ID NO:2.
[0012] The invention also relates to a polynucleotide sequence
comprising the complement of SEQ ID NO:2 or variants thereof. In
addition, the invention features polynucleotide sequences which
hybridize under stringent conditions to SEQ ID NO:2.
[0013] The invention additionally features nucleic acid sequences
encoding polypeptides, oligonucleotides, peptide nucleic acids
(PNA), fragments, portions or antisense molecules thereof, and
expression vectors and host cells comprising polynucleotides that
encode NAPTR. The present invention also features antibodies which
bind specifically to NAPTR, and pharmaceutical compositions
comprising substantially purified NAPTR. The invention also
features agonists and antagonists of NAPTR. The invention also
features a method for treating disorders associated with decreased
phosphate levels by administering NAPTR and a method for treating
disorders associated with increased phosphate levels by
administering an antagonist to NAPTR
BRIEF DESCRIPTION OF THE FIGURES
[0014] FIGS. 1A, 1B, and 1C show the amino acid sequence (SEQ ID
NO:1) and nucleic acid sequence (SEQ ID NO:2) of NAPTR. The
alignment was produced using MACDNASIS PRO software (Hitachi
Software Engineering Co., Ltd., San Bruno Calif.).
[0015] FIGS. 2A and 2B show the amino acid sequence alignments
among NAPTR (SEQ ID NO:1), human sodium phosphate transporter
protein (GI 450532; SEQ ID NO:3), and rat brain-specific
sodium-dependent inorganic phosphate cotransporter (GI 507415; SEQ
ID NO:4). The alignment was produced using the multisequence
alignment program of DNASTAR software (DNASTAR Inc, Madison
Wis.).
[0016] FIGS. 3A, 3B, and 3C show the hydrophobicity plots
(MacDNASIS PRO software) for NAPTR, SEQ ID NO:1, human sodium
phosphate transporter protein, SEQ ID NO:3, and rat brain-specific
sodium-dependent inorganic phosphate cotransporter, SEQ ID NO:4,
respectively. The positive X axis reflects amino acid position, and
the negative Y axis, hydrophobicity.
DESCRIPTION OF THE INVENTION
[0017] Before the present proteins, nucleotide sequences, and
methods are described, it is understood that this invention is not
limited to the particular methodology, protocols, cell lines,
vectors, and reagents described as these may vary. It is also to be
understood that the terminology used herein is for the purpose of
describing particular embodiments only, and is not intended to
limit the scope of the present invention which will be limited only
by the appended claims.
[0018] It must be noted that as used herein and in the appended
claims, the singular forms "a", "an", and "the" include plural
reference unless the context clearly dictates otherwise. Thus, for
example, reference to "a host cell" includes a plurality of such
host cells, reference to the "antibody" is a reference to one or
more antibodies and equivalents thereof known to those skilled in
the art, and so forth.
[0019] Unless defined otherwise, all technical and scientific terms
used herein have the same meanings as commonly understood by one of
ordinary skill in the art to which this invention belongs. Although
any methods and materials similar or equivalent to those described
herein can be used in the practice or testing of the present
invention, the preferred methods, devices, and materials are now
described. All publications mentioned herein are incorporated
herein by reference for the purpose of describing and disclosing
the cell lines, vectors, and methodologies which are reported in
the publications which might be used in connection with the
invention. Nothing herein is to be construed as an admission that
the invention is not entitled to antedate such disclosure by virtue
of prior invention.
Definitions
[0020] "Nucleic acid sequence" as used herein refers to an
oligonucleotide, nucleotide, or polynucleotide, and fragments or
portions thereof, and to DNA or RNA of genomic or synthetic origin
which may be single- or double-stranded, and represent the sense or
antisense strand. Similarly, "amino acid sequence" as used herein
refers to an oligopeptide, peptide, polypeptide, or protein
sequence, and fragments or portions thereof, and to naturally
occurring or synthetic molecules.
[0021] Where "amino acid sequence" is recited herein to refer to an
amino acid sequence of a naturally occurring protein molecule,
"amino acid sequence" and like terms, such as "polypeptide" or
"protein" are not meant to limit the amino acid sequence to the
complete, native amino acid sequence associated with the recited
protein molecule.
[0022] "Peptide nucleic acid", as used herein, refers to a molecule
which comprises an oligomer to which an amino acid residue, such as
lysine, and an amino group have been added. These small molecules,
also designated anti-gene agents, stop transcript elongation by
binding to their complementary strand of nucleic acid (Nielsen, P.
E. et al. (1993) Anticancer Drug Des. 8:53-63).
[0023] NAPTR, as used herein, refers to the amino acid sequences of
substantially purified NAPTR obtained from any species,
particularly mammalian, including bovine, ovine, porcine, murine,
equine, and preferably human, from any source whether natural,
synthetic, semi-synthetic, or recombinant.
[0024] "Consensus", as used herein, refers to a nucleic acid
sequence which has been resequenced to resolve uncalled bases, or
which has been extended using XL-PCR (Perkin Elmer, Norwalk, Conn.)
in the 5' and/or the 3' direction and resequenced, or which has
been assembled from the overlapping sequences of more than one
Incyte clone using the GELVIEW Fragment Assembly system (GCG,
Madison, Wis.), or which has been both extended and assembled.
[0025] A "variant" of NAPTR, as used herein, refers to an amino
acid sequence that is altered by one or more amino acids. The
variant may have "conservative" changes, wherein a substituted
amino acid has similar structural or chemical properties, e.g.,
replacement of leucine with isoleucine. More rarely, a variant may
have "nonconservative" changes, e.g., replacement of a glycine with
a tryptophan. Similar minor variations may also include amino acid
deletions or insertions, or both. Guidance in determining which
amino acid residues may be substituted, inserted, or deleted
without abolishing biological or immunological activity may be
found using computer programs well known in the art, for example,
DNASTAR software.
[0026] A "deletion", as used herein, refers to a change in either
amino acid or nucleotide sequence in which one or more amino acid
or nucleotide residues, respectively, are absent.
[0027] An "insertion" or "addition", as used herein, refers to a
change in an amino acid or nucleotide sequence resulting in the
addition of one or more amino acid or nucleotide residues,
respectively, as compared to the naturally occurring molecule.
[0028] A "substitution", as used herein, refers to the replacement
of one or more amino acids or nucleotides by different amino acids
or nucleotides, respectively.
[0029] The term "biologically active", as used herein, refers to a
protein having structural, regulatory, or biochemical functions of
a naturally occurring molecule. Likewise, "immunologically active"
refers to the capability of the natural, recombinant, or synthetic
NAPTR, or any oligopeptide thereof, to induce a specific immune
response in appropriate animals or cells and to bind with specific
antibodies.
[0030] The term "agonist", as used herein, refers to a molecule
which, when bound to NAPTR, causes a change in NAPTR which
modulates the activity of NAPTR. Agonists may include proteins,
nucleic acids, carbohydrates, or any other molecules which bind to
NAPTR.
[0031] The terms "antagonist" or "inhibitor", as used herein, refer
to a molecule which, when bound to NAPTR, blocks or modulates the
biological or immunological activity of NAPTR. Antagonists and
inhibitors may include proteins, nucleic acids, carbohydrates, or
any other molecules which bind to NAPTR.
[0032] The term "modulate", as used herein, refers to a change or
an alteration in the biological activity of NAPTR. Modulation may
be an increase or a decrease in protein activity, a change in
binding characteristics, or any other change in the biological,
functional or immunological properties of NAPTR.
[0033] The term "mimetic", as used herein, refers to a molecule,
the structure of which is developed from knowledge of the structure
of NAPTR or portions thereof and, as such, is able to effect some
or all of the actions of NAPTR-like molecules.
[0034] The term "derivative", as used herein, refers to the
chemical modification of a nucleic acid encoding NAPTR or the
encoded NAPTR. Illustrative of such modifications would be
replacement of hydrogen by an alkyl, acyl, or amino group. A
nucleic acid derivative would encode a polypeptide which retains
essential biological characteristics of the natural molecule.
[0035] The term "substantially purified", as used herein, refers to
nucleic or amino acid sequences that are removed from their natural
environment, isolated or separated, and are at least 60% free,
preferably 75% free, and most preferably 90% free from other
components with which they are naturally associated.
[0036] "Amplification" as used herein refers to the production of
additional copies of a nucleic acid sequence and is generally
carried out using polymerase chain reaction (PCR) technologies well
known in the art (Dieffenbach, C. W. and G. S. Dveksler (1995) PCR
Primer, a Laboratory Manual, Cold Spring Harbor Press, Plainview,
N.Y.).
[0037] The term "hybridization", as used herein, refers to any
process by which a strand of nucleic acid binds with a
complementary strand through base pairing.
[0038] The term "hybridization complex", as used herein, refers to
a complex formed between two nucleic acid sequences by virtue of
the formation of hydrogen binds between complementary G and C bases
and between complementary A and T bases; these hydrogen bonds may
be further stabilized by base stacking interactions. The two
complementary nucleic acid sequences hydrogen bond in an
antiparallel configuration. A hybridization complex may be formed
in solution (e.g., C.sub.0t or R.sub.0t analysis) or between one
nucleic acid sequence present in solution and another nucleic acid
sequence immobilized on a solid support (e.g., membranes, filters,
chips, pins or glass slides to which cells have been fixed for in
situ hybridization).
[0039] The terms "complementary" or "complementarity", as used
herein, refer to the natural binding of polynucleotides by
base-pairing. For example, for the sequence "A-G-T" binds to the
complementary sequence "T-C-A". Complementarity between two
single-stranded molecules may be "partial", in which only some of
the nucleic acids bind, or it may be complete when total
complementarity exists between the single stranded molecules. The
degree of complementarity between nucleic acid strands has
significant effects on the efficiency and strength of hybridization
between nucleic acid strands. This is of particular importance in
amplification reactions, which depend upon binding between nucleic
acids strands.
[0040] The term "homology", as used herein, refers to a degree of
complementarity. There may be partial homology or complete homology
(i.e., identity). A partially complementary sequence is one that at
least partially inhibits an identical sequence from hybridizing to
a target nucleic acid; it is referred to using the functional term
"substantially homologous." The inhibition of hybridization of the
completely complementary sequence to the target sequence may be
examined using a hybridization assay (Southern or northern blot,
solution hybridization and the like) under conditions of low
stringency. A substantially homologous sequence or probe will
compete for and inhibit the binding (i.e., the hybridization) of a
completely homologous sequence or probe to the target sequence
under conditions of low stringency. This is not to say that
conditions of low stringency are such that non-specific binding is
permitted; low stringency conditions require that the binding of
two sequences to one another be a specific (i.e., selective)
interaction. The absence of non-specific binding may be tested by
the use of a second target sequence which lacks even a partial
degree of complementarity (e.g., less than about 30% identity); in
the absence of non-specific binding, the probe will not hybridize
to the second non-complementary target sequence.
[0041] As known in the art, numerous equivalent conditions may be
employed to comprise either low or high stringency conditions.
Factors such as the length and nature (DNA, RNA, base composition)
of the sequence, nature of the target (DNA, RNA, base composition,
presence in solution or immobilization, etc.), and the
concentration of the salts and other components (e.g., the presence
or absence of formamide, dextran sulfate and/or polyethylene
glycol) are considered and the hybridization solution may be varied
to generate conditions of either low or high stringency different
from, but equivalent to, the above listed conditions.
[0042] The term "stringent conditions", as used herein, is the
"stringency" which occurs within a range from about Tm-5.degree. C.
(5.degree. C. below the melting temperature (Tm) of the probe) to
about 20.degree. C. to 25.degree. C. below Tm. As will be
understood by those of skill in the art, the stringency of
hybridization may be altered in order to identify or detect
identical or related polynucleotide sequences.
[0043] The term "antisense", as used herein, refers to nucleotide
sequences which are complementary to a specific DNA or RNA
sequence. The term "antisense strand" is used in reference to a
nucleic acid strand that is complementary to the "sense" strand.
Antisense molecules may be produced by any method, including
synthesis by ligating the gene(s) of interest in a reverse
orientation to a viral promoter which permits the synthesis of a
complementary strand. Once introduced into a cell, this transcribed
strand combines with natural sequences produced by the cell to form
duplexes. These duplexes then block either the further
transcription or translation. In this manner, mutant phenotypes may
be generated. The designation "negative" is sometimes used in
reference to the antisense strand, and "positive" is sometimes used
in reference to the sense strand.
[0044] The term "portion", as used herein, with regard to a protein
(as in "a portion of a given protein") refers to fragments of that
protein. The fragments may range in size from four amino acid
residues to the entire amino acid sequence minus one amino acid.
Thus, a protein "comprising at least a portion of the amino acid
sequence of SEQ ID NO:1" encompasses the full-length human NAPTR
and fragments thereof.
[0045] "Transformation", as defined herein, describes a process by
which exogenous DNA enters and changes a recipient cell. It may
occur under natural or artificial conditions using various methods
well known in the art. Transformation may rely on any known method
for the insertion of foreign nucleic acid sequences into a
prokaryotic or eukaryotic host cell. The method is selected based
on the host cell being transformed and may include, but is not
limited to, viral infection, electroporation, lipofection, and
particle bombardment. Such "transformed" cells include stably
transformed cells in which the inserted DNA is capable of
replication either as an autonomously replicating plasmid or as
part of the host chromosome. They also include cells which
transiently express the inserted DNA or RNA for limited periods of
time.
[0046] The term "antigenic determinant", as used herein, refers to
that portion of a molecule that makes contact with a particular
antibody (i.e., an epitope). When a protein or fragment of a
protein is used to immunize a host animal, numerous regions of the
protein may induce the production of antibodies which bind
specifically to a given region or three-dimensional structure on
the protein; these regions or structures are referred to as
antigenic determinants. An antigenic determinant may compete with
the intact antigen (i.e., the immunogen used to elicit the immune
response) for binding to an antibody.
[0047] The terms "specific binding" or "specifically binding", as
used herein, in reference to the interaction of an antibody and a
protein or peptide, mean that the interaction is dependent upon the
presence of a particular structure (i.e., the antigenic determinant
or epitope) on the protein; in other words, the antibody is
recognizing and binding to a specific protein structure rather than
to proteins in general. For example, if an antibody is specific for
epitope "A", the presence of a protein containing epitope A (or
free, unlabeled A) in a reaction containing labeled "A" and the
antibody will reduce the amount of labeled A bound to the
antibody.
[0048] The term "sample", as used herein, is used in its broadest
sense. A biological sample suspected of containing nucleic acid
encoding NAPTR or fragments thereof may comprise a cell,
chromosomes isolated from a cell (e.g., a spread of metaphase
chromosomes), genomic DNA (in solution or bound to a solid support
such as for Southern analysis), RNA (in solution or bound to a
solid support such as for northern analysis), cDNA (in solution or
bound to a solid support), an extract from cells or a tissue, and
the like.
[0049] The term "correlates with expression of a polynucleotide",
as used herein, indicates that the detection of the presence of
ribonucleic acid that is similar to SEQ ID NO:2 by northern
analysis is indicative of the presence of mRNA encoding NAPTR in a
sample and thereby correlates with expression of the transcript
from the polynucleotide encoding the protein.
[0050] "Alterations" in the polynucleotide of SEQ ID NO:2, as used
herein, comprise any alteration in the sequence of polynucleotides
encoding NAPTR including deletions, insertions, and point mutations
that may be detected using hybridization assays. Included within
this definition is the detection of alterations to the genomic DNA
sequence which encodes NAPTR (e.g., by alterations in the pattern
of restriction fragment length polymorphisms capable of hybridizing
to SEQ ID NO:2), the inability of a selected fragment of SEQ ID
NO:2 to hybridize to a sample of genomic DNA (e.g., using
allele-specific oligonucleotide probes), and improper or unexpected
hybridization, such as hybridization to a locus other than the
normal chromosomal locus for the polynucleotide sequence encoding
NAPTR (e.g., using fluorescent in situ hybridization [FISH] to
metaphase chromosomes spreads).
[0051] As used herein, the term "antibody" refers to intact
molecules as well as fragments thereof, such as Fa, F(ab').sub.2,
and Fv, which are capable of binding the epitopic determinant.
Antibodies that bind NAPTR polypeptides can be prepared using
intact polypeptides or fragments containing small peptides of
interest as the immunizing antigen. The polypeptide or peptide used
to immunize an animal can be derived from the transition of RNA or
synthesized chemically, and can be conjugated to a carrier protein,
if desired. Commonly used carriers that are chemically coupled to
peptides include bovine serum albumin and thyroglobulin. The
coupled peptide is then used to immunize the animal (e.g., a mouse,
a rat, or a rabbit).
[0052] The term "humanized antibody", as used herein, refers to
antibody molecules in which amino acids have been replaced in the
non-antigen binding regions in order to more closely resemble a
human antibody, while still retaining the original binding
ability.
The Invention
[0053] The invention is based on the discovery of a novel human
sodium-dependent phosphate cotransporter, NAPTR, the
polynucleotides encoding NAPTR, and the use of these compositions
for the diagnosis, prevention, or treatment of disorders associated
with increased or decreased phosphate levels.
[0054] Nucleic acids encoding the human NAPTR of the present
invention were first identified in Incyte Clone 754412 from the
brain tumor cDNA library (BRAITUT02) through a computer-generated
search for amino acid sequence alignments. A consensus sequence,
SEQ ID NO:2, was derived from the extension of the nucleic acid
sequence of Incyte Clone 754412.est (BRAITUT02).
[0055] In one embodiment, the invention encompasses a polypeptide
comprising the amino acid sequence of SEQ ID NO:1, as shown in FIG.
1. NAPTR is 402 amino acids in length and has chemical and
structural homology with human renal sodium phosphate transport
protein (GI 450532; SEQ ID NO:3) and rat brain-specific
sodium-dependent inorganic phosphate cotransporter (GI 507415; SEQ
ID NO:4). In particular, NAPTR, human renal sodium phosphate
transport protein, and rat brain-specific sodium-dependent
inorganic phosphate cotransporter share 48% and 29% identity,
respectively and all three have a potential N-glycosylation sites
at N.sub.49, N.sub.49, and N.sub.92, respectively. As illustrated
by FIGS. 3A, 3B, and 3C, NAPTR, human renal sodium phosphate
transport protein, and rat brain-specific sodium-dependent
inorganic phosphate cotransporter have rather similar
hydrophobicity plots.
[0056] The invention also encompasses NAPTR variants. A preferred
NAPTR variant is one having at least 80%, and more preferably 90%,
amino acid sequence identity to the NAPTR amino acid sequence (SEQ
ID NO:1). A most preferred NAPTR variant is one having at least 95%
amino acid sequence identity to SEQ ID NO:1.
[0057] The invention also encompasses polynucleotides which encode
NAPTR. Accordingly, any nucleic acid sequence which encodes the
amino acid sequence of NAPTR can be used to generate recombinant
molecules which express NAPTR. In a particular embodiment, the
invention encompasses the polynucleotide comprising the nucleic
acid sequence of SEQ ID NO:2 as shown in FIG. 1.
[0058] It will be appreciated by those skilled in the art that as a
result of the degeneracy of the genetic code, a multitude of
nucleotide sequences encoding NAPTR, some bearing minimal homology
to the nucleotide sequences of any known and naturally occurring
gene, may be produced. Thus, the invention contemplates each and
every possible variation of nucleotide sequence that could be made
by selecting combinations based on possible codon choices. These
combinations are made in accordance with the standard triplet
genetic code as applied to the nucleotide sequence of naturally
occurring NAPTR, and all such variations are to be considered as
being specifically disclosed.
[0059] Although nucleotide sequences which encode NAPTR and its
variants are preferably capable of hybridizing to the nucleotide
sequence of the naturally occurring NAPTR under appropriately
selected conditions of stringency, it may be advantageous to
produce nucleotide sequences encoding NAPTR or its derivatives
possessing a substantially different codon usage. Codons may be
selected to increase the rate at which expression of the peptide
occurs in a particular prokaryotic or eukaryotic host in accordance
with the frequency with which particular codons are utilized by the
host. Other reasons for substantially altering the nucleotide
sequence encoding NAPTR and its derivatives without altering the
encoded amino acid sequences include the production of RNA
transcripts having more desirable properties, such as a greater
half-life, than transcripts produced from the naturally occurring
sequence.
[0060] The invention also encompasses production of DNA sequences,
or portions thereof, which encode NAPTR and its derivatives,
entirely by synthetic chemistry. After production, the synthetic
sequence may be inserted into any of the many available expression
vectors and cell systems using reagents that are well known in the
art at the time of the filing of this application. Moreover,
synthetic chemistry may be used to introduce mutations into a
sequence encoding NAPTR or any portion thereof.
[0061] Also encompassed by the invention are polynucleotide
sequences that are capable of hybridizing to the claimed nucleotide
sequences, and in particular, those shown in SEQ ID NO:2, under
various conditions of stringency. Hybridization conditions are
based on the melting temperature (Tm) of the nucleic acid binding
complex or probe, as taught in Wahl, G. M. and S. L. Berger (1987;
Methods Enzymol. 152:399-407) and Kimmel, A. R. (1987; Methods
Enzymol. 152:507-511), and may be used at a defined stringency.
[0062] Altered nucleic acid sequences encoding NAPTR which are
encompassed by the invention include deletions, insertions, or
substitutions of different nucleotides resulting in a
polynucleotide that encodes the same or a functionally equivalent
NAPTR. The encoded protein may also contain deletions, insertions,
or substitutions of amino acid residues which produce a silent
change and result in a functionally equivalent NAPTR. Deliberate
amino acid substitutions may be made on the basis of similarity in
polarity, charge, solubility, hydrophobicity, hydrophilicity,
and/or the amphipathic nature of the residues as long as the
biological activity of NAPTR is retained. For example, negatively
charged amino acids may include aspartic acid and glutamic acid;
positively charged amino acids may include lysine and arginine; and
amino acids with uncharged polar head groups having similar
hydrophilicity values may include leucine, isoleucine, and valine;
glycine and alanine; asparagine and glutamine; serine and
threonine; phenylalanine and tyrosine.
[0063] Also included within the scope of the present invention are
alleles of the genes encoding NAPTR. As used herein, an "allele" or
"allelic sequence" is an alternative form of the gene which may
result from at least one mutation in the nucleic acid sequence.
Alleles may result in altered mRNAs or polypeptides whose structure
or function may or may not be altered. Any given gene may have
none, one, or many allelic forms. Common mutational changes which
give rise to alleles are generally ascribed to natural deletions,
additions, or substitutions of nucleotides. Each of these types of
changes may occur alone, or in combination with the others, one or
more times in a given sequence.
[0064] Methods for DNA sequencing which are well known and
generally available in the art may be used to practice any
embodiments of the invention. The methods may employ such enzymes
as the Klenow fragment of DNA polymerase I, SEQUENASE (US
Biochemical Corp, Cleveland, Ohio), Taq polymerase (Perkin Elmer),
thermostable T7 polymerase (Amersham, Chicago, Ill.), or
combinations of recombinant polymerases and proofreading
exonucleases such as the ELONGASE Amplification System marketed by
Gibco BRL (Gaithersburg, Md.). Preferably, the process is automated
with machines such as the Hamilton Micro Lab 2200 (Hamilton, Reno,
Nev.), Peltier Thermal Cycler (PTC200; MJ Research, Watertown,
Mass.) and the ABI 377 DNA sequencers (Perkin Elmer).
[0065] The nucleic acid sequences encoding NAPTR may be extended
utilizing a partial nucleotide sequence and employing various
methods known in the art to detect upstream sequences such as
promoters and regulatory elements. For example, one method which
may be employed, "restriction-site" PCR, uses universal primers to
retrieve unknown sequence adjacent to a known locus (Sarkar, G.
(1993) PCR Methods Applic. 2:318-322). In particular, genomic DNA
is first amplified in the presence of primer to linker sequence and
a primer specific to the known region. The amplified sequences are
then subjected to a second round of PCR with the same linker primer
and another specific primer internal to the first one. Products of
each round of PCR are transcribed with an appropriate RNA
polymerase and sequenced using reverse transcriptase.
[0066] Inverse PCR may also be used to amplify or extend sequences
using divergent primers based on a known region (Triglia, T. et al.
(1988) Nucleic Acids Res. 16:8186). The primers may be designed
using OLIGO 4.06 Primer Analysis software (National Biosciences
Inc., Plymouth, Minn.), or another appropriate program, to be 22-30
nucleotides in length, to have a GC content of 50% or more, and to
anneal to the target sequence at temperatures about
68.degree.-72.degree. C. The method uses several restriction
enzymes to generate a suitable fragment in the known region of a
gene. The fragment is then circularized by intramolecular ligation
and used as a PCR template.
[0067] Another method which may be used is capture PCR which
involves PCR amplification of DNA fragments adjacent to a known
sequence in human and yeast artificial chromosome DNA (Lagerstrom,
M. et al. (1991) PCR Methods Applic. 1:111-119). In this method,
multiple restriction enzyme digestions and ligations may also be
used to place an engineered double-stranded sequence into an
unknown portion of the DNA molecule before performing PCR.
[0068] Another method which may be used to retrieve unknown
sequences is that of Parker, J. D. et al. (1991; Nucleic Acids Res.
19:3055-3060). Additionally, one may use PCR, nested primers, and
PROMOTERFINDER libraries to walk in genomic DNA (Clontech, Palo
Alto, Calif.). This process avoids the need to screen libraries and
is useful in finding intron/exon junctions.
[0069] When screening for full-length cDNAs, it is preferable to
use libraries that have been size-selected to include larger cDNAs.
Also, random-primed libraries are preferable, in that they will
contain more sequences which contain the 5' regions of genes. Use
of a randomly primed library may be especially preferable for
situations in which an oligo d(T) library does not yield a
full-length cDNA. Genomic libraries may be useful for extension of
sequence into the 5' and 3' non-transcribed regulatory regions.
[0070] Capillary electrophoresis systems which are commercially
available may be used to analyze the size or confirm the nucleotide
sequence of sequencing or PCR products. In particular, capillary
sequencing may employ flowable polymers for electrophoretic
separation, four different fluorescent dyes (one for each
nucleotide) which are laser activated, and detection of the emitted
wavelengths by a charge coupled devise camera. Output/light
intensity may be converted to electrical signal using appropriate
software (e.g. GENOTYPER and SEQUENCE NAVIGATOR, Perkin Elmer) and
the entire process from loading of samples to computer analysis and
electronic data display may be computer controlled. Capillary
electrophoresis is especially preferable for the sequencing of
small pieces of DNA which might be present in limited amounts in a
particular sample.
[0071] In another embodiment of the invention, polynucleotide
sequences or fragments thereof which encode NAPTR, or fusion
proteins or functional equivalents thereof, may be used in
recombinant DNA molecules to direct expression of NAPTR in
appropriate host cells. Due to the inherent degeneracy of the
genetic code, other DNA sequences which encode substantially the
same or a functionally equivalent amino acid sequence may be
produced and these sequences may be used to clone and express
NAPTR.
[0072] As will be understood by those of skill in the art, it may
be advantageous to produce NAPTR-encoding nucleotide sequences
possessing non-naturally occurring codons. For example, codons
preferred by a particular prokaryotic or eukaryotic host can be
selected to increase the rate of protein expression or to produce a
recombinant RNA transcript having desirable properties, such as a
half-life which is longer than that of a transcript generated from
the naturally occurring sequence.
[0073] The nucleotide sequences of the present invention can be
engineered using methods generally known in the art in order to
alter NAPTR encoding sequences for a variety of reasons, including
but not limited to, alterations which modify the cloning,
processing, and/or expression of the gene product. DNA shuffling by
random fragmentation and PCR reassembly of gene fragments and
synthetic oligonucleotides may be used to engineer the nucleotide
sequences. For example, site-directed mutagenesis may be used to
insert new restriction sites, alter glycosylation patterns, change
codon preference, produce splice variants, or introduce mutations,
and so forth.
[0074] In another embodiment of the invention, natural, modified,
or recombinant nucleic acid sequences encoding NAPTR may be ligated
to a heterologous sequence to encode a fusion protein. For example,
to screen peptide libraries for inhibitors of NAPTR activity, it
may be useful to encode a chimeric NAPTR protein that can be
recognized by a commercially available antibody. A fusion protein
may also be engineered to contain a cleavage site located between
the NAPTR encoding sequence and the heterologous protein sequence,
so that NAPTR may be cleaved and purified away from the
heterologous moiety.
[0075] In another embodiment, sequences encoding NAPTR may be
synthesized, in whole or in part, using chemical methods well known
in the art (see Caruthers, M. H. et al. (1980) Nucleic Acids Symp.
Ser. 7:215-223, Horn, T. et al. (1980) Nucleic Acids Symp. Ser.
7:225-232). Alternatively, the protein itself may be produced using
chemical methods to synthesize the amino acid sequence of NAPTR, or
a portion thereof. For example, peptide synthesis can be performed
using various solid-phase techniques (Roberge, J. Y. et al. (1995)
Science 269:202-204) and automated synthesis may be achieved, for
example, using the ABI 431A Peptide Synthesizer (Perkin Elmer).
[0076] The newly synthesized peptide may be substantially purified
by preparative high performance liquid chromatography (e.g.,
Creighton, T. (1983) Proteins, Structures and Molecular Principles,
WH Freeman and Co., New York, N.Y.). The composition of the
synthetic peptides may be confirmed by amino acid analysis or
sequencing (e.g., the Edman degradation procedure; Creighton,
supra). Additionally, the amino acid sequence of NAPTR, or any part
thereof, may be altered during direct synthesis and/or combined
using chemical methods with sequences from other proteins, or any
part thereof, to produce a variant polypeptide.
[0077] In order to express a biologically active NAPTR, the
nucleotide sequences encoding NAPTR or functional equivalents, may
be inserted into appropriate expression vector, i.e., a vector
which contains the necessary elements for the transcription and
translation of the inserted coding sequence.
[0078] Methods which are well known to those skilled in the art may
be used to construct expression vectors containing sequences
encoding NAPTR and appropriate transcriptional translational
control elements. These methods include in vitro recombinant DNA
techniques, synthetic techniques, and in vivo genetic
recombination. Such techniques are described in Sambrook, J. et al.
(1989) Molecular Cloning, A Laboratory Manual, Cold Spring Harbor
Press, Plainview, N.Y., and Ausubel, F. M. et al. (1989) Current
Protocols in Molecular Biology, John Wiley & Sons, New York,
N.Y.
[0079] A variety of expression vector/host systems may be utilized
to contain and express sequences encoding NAPTR. These include, but
are not limited to, microorganisms such as bacteria transformed
with recombinant bacteriophage, plasmid, or cosmid DNA expression
vectors; yeast transformed with yeast expression vectors; insect
cell systems infected with virus expression vectors (e.g.,
baculovirus); plant cell systems transformed with virus expression
vectors (e.g., cauliflower mosaic virus, CaMV; tobacco mosaic
virus, TMV) or with bacterial expression vectors (e.g., Ti or
pBR322 plasmids); or animal cell systems.
[0080] The "control elements" or "regulatory sequences" are those
non-translated regions of the vector--enhancers, promoters, 5' and
3' untranslated regions--which interact with host cellular proteins
to carry out transcription and translation. Such elements may vary
in their strength and specificity. Depending on the vector system
and host utilized, any number of suitable transcription and
translation elements, including constitutive and inducible
promoters, may be used. For example, when cloning in bacterial
systems, inducible promoters such as the hybrid lacZ promoter of
the BLUESCRIPT phagemid (Stratagene, LaJolla, Calif.) or PSPORT1
plasmid (Gibco BRL) and the like may be used. The baculovirus
polyhedrin promoter may be used in insect cells. Promoters or
enhancers derived from the genomes of plant cells (e.g., heat
shock, RUBISCO; and storage protein genes) or from plant viruses
(e.g., viral promoters or leader sequences) may be cloned into the
vector. In mammalian cell systems, promoters from mammalian genes
or from mammalian viruses are preferable. If it is necessary to
generate a cell line that contains multiple copies of the sequence
encoding NAPTR, vectors based on SV40 or EBV may be used with an
appropriate selectable marker.
[0081] In bacterial systems, a number of expression vectors may be
selected depending upon the use intended for NAPTR. For example,
when large quantities of NAPTR are needed for the induction of
antibodies, vectors which direct high level expression of fusion
proteins that are readily purified may be used. Such vectors
include, but are not limited to, the multifunctional E. coli
cloning and expression vectors such as BLUESCRIPT (Stratagene), in
which the sequence encoding NAPTR may be ligated into the vector in
frame with sequences for the amino-terminal Met and the subsequent
7 residues of .beta.-galactosidase so that a hybrid protein is
produced; pIN vectors (Van Heeke, G. and S. M. Schuster (1989) J.
Biol. Chem. 264:5503-5509); and the like. pGEX vectors (Promega,
Madison, Wis.) may also be used to express foreign polypeptides as
fusion proteins with glutathione S-transferase (GST). In general,
such fusion proteins are soluble and can easily be purified from
lysed cells by adsorption to glutathione-agarose beads followed by
elution in the presence of free glutathione. Proteins made in such
systems may be designed to include heparin, thrombin, or factor XA
protease cleavage sites so that the cloned polypeptide of interest
can be released from the GST moiety at will.
[0082] In the yeast, Saccharomyces cerevisiae, a number of vectors
containing constitutive or inducible promoters such as alpha
factor, alcohol oxidase, and PGH may be used. For reviews, see
Ausubel et al. (supra) and Bitter, G. A. et al. (1987) Methods
Enzymol. 153:516-544.
[0083] In cases where plant expression vectors are used, the
expression of sequences encoding NAPTR may be driven by any of a
number of promoters. For example, viral promoters such as the 35S
and 19S promoters of CaMV may be used alone or in combination with
the omega leader sequence from TMV (Takamatsu, N. (1987) EMBO J.
6:307-311). Alternatively, plant promoters such as the small
subunit of RUBISCO or heat shock promoters may be used (Coruzzi, G.
et al. (1984) EMBO J. 3:1671-1680; Broglie, R. et al. (1984)
Science 224:838-843; and Winter, J. et al. (1991) Results Probl.
Cell Differ. 17:85-105). These constructs can be introduced into
plant cells by direct DNA transformation or pathogen-mediated
transfection. Such techniques are described in a number of
generally available reviews (see, for example, Hobbs, S. or Murry,
L. E. in McGraw Hill Yearbook of Science and Technology (1992)
McGraw Hill, New York, N.Y.; pp. 191-196.
[0084] An insect system may also be used to express NAPTR. For
example, in one such system, Autographa californica nuclear
polyhedrosis virus (AcNPV) is used as a vector to express foreign
genes in Spodoptera frugiperda cells or in Trichoplusia larvae. The
sequences encoding NAPTR may be cloned into a non-essential region
of the virus, such as the polyhedrin gene, and placed under control
of the polyhedrin promoter. Successful insertion of NAPTR will
render the polyhedrin gene inactive and produce recombinant virus
lacking coat protein. The recombinant viruses may then be used to
infect, for example, S. frugiperda cells or Trichoplusia larvae in
which NAPTR may be expressed (Engelhard, E. K. et al. (1994) Proc.
Natl. Acad. Sci. USA 91:3224-3227).
[0085] In mammalian host cells, a number of viral-based expression
systems may be utilized. In cases where an adenovirus is used as an
expression vector, sequences encoding NAPTR may be ligated into an
adenovirus transcription/translation complex consisting of the late
promoter and tripartite leader sequence. Insertion in a
non-essential E1 or E3 region of the viral genome may be used to
obtain a viable virus which is capable of expressing NAPTR in
infected host cells (Logan, J. and Shenk, T. (1984) Proc. Natl.
Acad. Sci. USA 81:3655-3659). In addition, transcription enhancers,
such as the Rous sarcoma virus (RSV) enhancer, may be used to
increase expression in mammalian host cells.
[0086] Specific initiation signals may also be used to achieve more
efficient translation of sequences encoding NAPTR. Such signals
include the ATG initiation codon and adjacent sequences. In cases
where sequences encoding NAPTR, its initiation codon, and upstream
sequences are inserted into the appropriate expression vector, no
additional transcriptional or translational control signals may be
needed. However, in cases where only coding sequence, or a portion
thereof, is inserted, exogenous translational control signals
including the ATG initiation codon should be provided. Furthermore,
the initiation codon should be in the correct reading frame to
ensure translation of the entire insert. Exogenous translational
elements and initiation codons may be of various origins, both
natural and synthetic. The efficiency of expression may be enhanced
by the inclusion of enhancers which are appropriate for the
particular cell system which is used, such as those described in
the literature (Scharf, D. et al. (1994) Results Probl. Cell
Differ. 20:125-162).
[0087] In addition, a host cell strain may be chosen for its
ability to modulate the expression of the inserted sequences or to
process the expressed protein in the desired fashion. Such
modifications of the polypeptide include, but are not limited to,
acetylation, carboxylation, glycosylation, phosphorylation,
lipidation, and acylation. Post-translational processing which
cleaves a "prepro" form of the protein may also be used to
facilitate correct insertion, folding and/or function. Different
host cells such as CHO, HeLa, MDCK, HEK293, and W138, which have
specific cellular machinery and characteristic mechanisms for such
post-translational activities, may be chosen to ensure the correct
modification and processing of the foreign protein.
[0088] For long-term, high-yield production of recombinant
proteins, stable expression is preferred. For example, cell lines
which stably express NAPTR may be transformed using expression
vectors which may contain viral origins of replication and/or
endogenous expression elements and a selectable marker gene on the
same or on a separate vector. Following the introduction of the
vector, cells may be allowed to grow for 1-2 days in an enriched
media before they are switched to selective media. The purpose of
the selectable marker is to confer resistance to selection, and its
presence allows growth and recovery of cells which successfully
express the introduced sequences. Resistant clones of stably
transformed cells may be proliferated using tissue culture
techniques appropriate to the cell type.
[0089] Any number of selection systems may be used to recover
transformed cell lines. These include, but are not limited to, the
herpes simplex virus thymidine kinase (Wigler, M. et al. (1977)
Cell 11:223-232) and adenine phosphoribosyltransferase (Lowy, I. et
al. (1980) Cell 22:817-823) genes which can be employed in tk.sup.-
and apr.sup.- cells, respectively. Also, antimetabolite, antibiotic
or herbicide resistance can be used as the basis for selection; for
example, dhfr which confers resistance to methotrexate (Wigler, M.
et al. (1980) Proc. Natl. Acad. Sci. USA 77:3567-3570); npt, which
confers resistance to the aminoglycosides neomycin and G-418
(Colbere-Garapin, F. et al (1981) J. Mol. Biol. 150:1-14) and als
and pat, which confer resistance to chlorsulfuron and
phosphinotricin acetyltransferase, respectively (Murry, supra).
Additional selectable genes have been described, for example, trpB,
which allows cells to utilize indole in place of tryptophan, or
hisD, which allows cells to utilize histinol in place of histidine
(Hartman, S. C. and R. C. Mulligan (1988) Proc. Natl. Acad. Sci.
USA 85:8047-8051). Recently, the use of visible markers has gained
popularity with such markers as anthocyanins, .beta. glucuronidase
and its substrate GUS, and luciferase and its substrate luciferin,
being widely used not only to identify transformants, but also to
quantify the amount of transient or stable protein expression
attributable to a specific vector system (Rhodes, C. A. et al.
(1995) Methods Mol. Biol. 55:121-131).
[0090] Although the presence/absence of marker gene expression
suggests that the gene of interest is also present, its presence
and expression may need to be confirmed. For example, if the
sequence encoding NAPTR is inserted within a marker gene sequence,
recombinant cells containing sequences encoding NAPTR can be
identified by the absence of marker gene function. Alternatively, a
marker gene can be placed in tandem with a sequence encoding NAPTR
under the control of a single promoter. Expression of the marker
gene in response to induction or selection usually indicates
expression of the tandem gene as well.
[0091] Alternatively, host cells which contain the nucleic acid
sequence encoding NAPTR and express NAPTR may be identified by a
variety of procedures known to those of skill in the art. These
procedures include, but are not limited to, DNA-DNA or DNA-RNA
hybridizations and protein bioassay or immunoassay techniques which
include membrane, solution, or chip based technologies for the
detection and/or quantification of nucleic acid or protein.
[0092] The presence of polynucleotide sequences encoding NAPTR can
be detected by DNA-DNA or DNA-RNA hybridization or amplification
using probes or portions or fragments of polynucleotides encoding
NAPTR. Nucleic acid amplification based assays involve the use of
oligonucleotides or oligomers based on the sequences encoding NAPTR
to detect transformants containing DNA or RNA encoding NAPTR. As
used herein "oligonucleotides" or "oligomers" refer to a nucleic
acid sequence of at least about 10 nucleotides and as many as about
60 nucleotides, preferably about 15 to 30 nucleotides, and more
preferably about 20-25 nucleotides, which can be used as a probe or
amplimer.
[0093] A variety of protocols for detecting and measuring the
expression of NAPTR, using either polyclonal or monoclonal
antibodies specific for the protein are known in the art. Examples
include enzyme-linked immunosorbent assay (ELISA), radioimmunoassay
(RIA), and fluorescence activated cell sorting (FACS). A two-site,
monoclonal-based immunoassay utilizing monoclonal antibodies
reactive to two non-interfering epitopes on NAPTR is preferred, but
a competitive binding assay may be employed. These and other assays
are described, among other places, in Hampton, R. et al. (1990;
Serological Methods, a Laboratory Manual, APS Press, St. Paul,
Minn.) and Maddox, D. E. et al. (1983; J. Exp. Med.
158:1211-1216).
[0094] A wide variety of labels and conjugation techniques are
known by those skilled in the art and may be used in various
nucleic acid and amino acid assays. Means for producing labeled
hybridization or PCR probes for detecting sequences related to
polynucleotides encoding NAPTR include oligolabeling, nick
translation, end-labeling or PCR amplification using a labeled
nucleotide. Alternatively, the sequences encoding NAPTR, or any
portions thereof may be cloned into a vector for the production of
an mRNA probe. Such vectors are known in the art, are commercially
available, and may be used to synthesize RNA probes in vitro by
addition of an appropriate RNA polymerase such as T7, T3, or SP6
and labeled nucleotides. These procedures may be conducted using a
variety of commercially available kits (Pharmacia & Upjohn,
(Kalamazoo, Mich.); Promega (Madison Wis.); and U.S. Biochemical
Corp., Cleveland, Ohio). Suitable reporter molecules or labels,
which may be used, include radionuclides, enzymes, fluorescent,
chemiluminescent, or chromogenic agents as well as substrates,
cofactors, inhibitors, magnetic particles, and the like.
[0095] Host cells transformed with nucleotide sequences encoding
NAPTR may be cultured under conditions suitable for the expression
and recovery of the protein from cell culture. The protein produced
by a recombinant cell may be secreted or contained intracellularly
depending on the sequence and/or the vector used. As will be
understood by those of skill in the art, expression vectors
containing polynucleotides which encode NAPTR may be designed to
contain signal sequences which direct secretion of NAPTR through a
prokaryotic or eukaryotic cell membrane. Other recombinant
constructions may be used to join sequences encoding NAPTR to
nucleotide sequence encoding a polypeptide domain which will
facilitate purification of soluble proteins. Such purification
facilitating domains include, but are not limited to, metal
chelating peptides such as histidine-tryptophan modules that allow
purification on immobilized metals, protein A domains that allow
purification on immobilized immunoglobulin, and the domain utilized
in the FLAGS extension/affinity purification system (Immunex Corp.,
Seattle, Wash.). The inclusion of cleavable linker sequences such
as those specific for Factor XA or enterokinase (Invitrogen, San
Diego, Calif.) between the purification domain and NAPTR may be
used to facilitate purification. One such expression vector
provides for expression of a fusion protein containing NAPTR and a
nucleic acid encoding 6 histidine residues preceding a thioredoxin
or an enterokinase cleavage site. The histidine residues facilitate
purification on IMIAC (immobilized metal ion affinity
chromatography as described in Porath, J. et al. (1992, Prot. Exp.
Purif. 3: 263-281) while the enterokinase cleavage site provides a
means for purifying NAPTR from the fusion protein. A discussion of
vectors which contain fusion proteins is provided in Kroll, D. J.
et al. (1993; DNA Cell Biol. 12:441-453).
[0096] In addition to recombinant production, fragments of NAPTR
may be produced by direct peptide synthesis using solid-phase
techniques (Merrifield, J. (1963) J. Am. Chem. Soc. 85:2149-2154).
Protein synthesis may be performed using manual techniques or by
automation. Automated synthesis may be achieved, for example, using
Applied Biosystems 431A Peptide Synthesizer (Perkin Elmer). Various
fragments of NAPTR may be chemically synthesized separately and
combined using chemical methods to produce the full length
molecule.
Therapeutics
[0097] Based on the chemical and structural homology between NAPTR
and human NPT1, NAPTR is a sodium-dependent phosphate cotransporter
and appears to play a role in the regulation of phosphate levels.
Increases or decreases of the level of phosphate in a subject that
are above or below normal physiological values are a cause of harm
to the subject.
[0098] Therefore, in one embodiment, NAPTR or a fragment or
derivative thereof may be administered to a subject to treat or
prevent disorders associated with decreased phosphate levels. Such
disorders may include, but are not limited to cancers of the
kidney, disorders of decreased phosphate levels including tumoral
calcinosis, osteomalacia, osteoporosis, familial hypophosphatemia,
rickets, cysteneuria, nephrocalcinosis, glomerulonephritis, renal
calculus, Alzheimers disease, diabetes melitis, hereditary
amyloidosis, myopathies including progressive external
ophthalmoplegia, Kearns-Sayre syndrome, myoclonic epilepsy,
encephalopathy, and cardiomyopathy, hypokalemia, Goodpastures'
Syndrome, and disorders of cell signaling through cAMP, ATP, NADPH,
and glucose-6-phosphate.
[0099] In another embodiment, a vector capable of expressing NAPTR,
or a fragment or a derivative thereof, may also be administered to
a subject to treat the disorders associated with decreased
phosphate levels listed above.
[0100] In another embodiment, antagonists or inhibitors of NAPTR
may be administered to a subject to treat or prevent disorders
associated with increased phosphate levels. Such disorders may
include, but are not limited to, disorders of increased phosphate
levels including, hypocalciuria, hypocalcemia, and abnormal
phosphate regulation in neurons, gastrointestinal tract, and liver.
In one aspect, antibodies which are specific for NAPTR may be used
directly as an antagonist, or indirectly as a targeting or delivery
mechanism for bringing a pharmaceutical agent to cells or tissue
which express NAPTR. Antibodies which are specific for NAPTR may be
used directly as an antagonist, or indirectly as a targeting or
delivery mechanism for bringing a pharmaceutical agent to cells or
tissue which express NAPTR.
[0101] In another embodiment, a vector expressing antisense of the
polynucleotide encoding NAPTR may be administered to a subject to
treat or prevent the disorders associated with increased phosphate
levels listed above.
[0102] In other embodiments, any of the therapeutic proteins,
antagonists, antibodies, agonists, antisense sequences or vectors
described above may be administered in combination with other
appropriate therapeutic agents. Selection of the appropriate agents
for use in combination therapy may be made by one of ordinary skill
in the art, according to conventional pharmaceutical principles.
The combination of therapeutic agents may act synergistically to
effect the treatment or prevention of the various disorders
described above. Using this approach, one may be able to achieve
therapeutic efficacy with lower dosages of each agent, thus
reducing the potential for adverse side effects.
[0103] Antagonists or inhibitors of NAPTR may be produced using
methods which are generally known in the art. In particular,
purified NAPTR may be used to produce antibodies or to screen
libraries of pharmaceutical agents to identify those which
specifically bind NAPTR.
[0104] Antibodies specific to NAPTR may be generated using methods
that are well known in the art. Such antibodies may include, but
are not limited to, polyclonal, monoclonal, chimeric, single chain,
Fab fragments, and fragments produced by a Fab expression library.
Neutralizing antibodies, (i.e., those which inhibit dimer
formation) are especially preferred for therapeutic use.
[0105] For the production of antibodies, various hosts including
goats, rabbits, rats, mice, humans, and others, may be immunized by
injection with NAPTR or any fragment or oligopeptide thereof which
has immunogenic properties. Depending on the host species, various
adjuvants may be used to increase immunological response. Such
adjuvants include, but are not limited to, Freund's, mineral gels
such as aluminum hydroxide, and surface active substances such as
lysolecithin, pluronic polyols, polyanions, peptides, oil
emulsions, keyhole limpet hemocyanin, and dinitrophenol. Among
adjuvants used in humans, BCG (bacilli Calmette-Guerin) and
Corynebacterium parvum are especially preferable.
[0106] It is preferred that the peptides, fragments, or
oligopeptides used to induce antibodies to NAPTR have an amino acid
sequence consisting of at least five amino acids, and more
preferably at least 10 amino acids. It is also preferable that they
are identical to a portion of the amino acid sequence of the
natural protein, and they may contain the entire amino acid
sequence of a small, naturally occurring molecule. Short stretches
of NAPTR amino acids may be fused with those of another protein
such as keyhole limpet hemocyanin and antibody produced against the
chimeric molecule.
[0107] Monoclonal antibodies to NAPTR may be prepared using any
technique which provides for the production of antibody molecules
by continuous cell lines in culture. These include, but are not
limited to, the hybridoma technique, the human B-cell hybridoma
technique, and the EBV-hybridoma technique (Kohler, G. et al.
(1975) Nature 256:495-497; Kozbor, D. et al. (1985) J. Immunol.
Methods 81:31-42; Cote, R. J. et al. (1983) Proc. Natl. Acad. Sci.
USA 80:2026-2030; Cole, S. P. et al. (1984) Mol. Cell Biol.
62:109-120).
[0108] In addition, techniques developed for the production of
"chimeric antibodies", the splicing of mouse antibody genes to
human antibody genes to obtain a molecule with appropriate antigen
specificity and biological activity can be used (Morrison, S. L. et
al. (1984) Proc. Natl. Acad. Sci. USA 81:6851-6855; Neuberger, M.
S. et al. (1984) Nature 312:604-608; Takeda, S. et al. (1985)
Nature 314:452-454). Alternatively, techniques described for the
production of single chain antibodies may be adapted, using methods
known in the art, to produce NAPTR-specific single chain
antibodies. Antibodies with related specificity, but of distinct
idiotypic composition, may be generated by chain shuffling from
random combinatorial immunoglobin libraries (Burton, D. R. (1991)
Proc. Natl. Acad. Sci. USA 88:11120-11123).
[0109] Antibodies may also be produced by inducing in vivo
production in the lymphocyte population or by screening recombinant
immunoglobulin libraries or panels of highly specific binding
reagents as disclosed in the literature (Orlandi, R. et al. (1989)
Proc. Natl. Acad. Sci. USA 86.3833-3837; Winter, G. et al. (1991)
Nature 349:293-299).
[0110] Antibody fragments which contain specific binding sites for
NAPTR may also be generated. For example, such fragments include,
but are not limited to, the F(ab')2 fragments which can be produced
by pepsin digestion of the antibody molecule and the Fab fragments
which can be generated by reducing the disulfide bridges of the
F(ab')2 fragments. Alternatively, Fab expression libraries may be
constructed to allow rapid and easy identification of monoclonal
Fab fragments with the desired specificity (Huse, W. D. et al.
(1989) Science 254:1275-1281).
[0111] Various immunoassays may be used for screening to identify
antibodies having the desired specificity. Numerous protocols for
competitive binding or immunoradiometric assays using either
polyclonal or monoclonal antibodies with established specificities
are well known in the art. Such immunoassays typically involve the
measurement of complex formation between NAPTR and its specific
antibody. A two-site, monoclonal-based immunoassay utilizing
monoclonal antibodies reactive to two non-interfering NAPTR
epitopes is preferred, but a competitive binding assay may also be
employed (Maddox, supra).
[0112] In another embodiment of the invention, the polynucleotides
encoding NAPTR, or any fragment thereof, or antisense molecules,
may be used for therapeutic purposes. In one aspect, antisense to
the polynucleotide encoding NAPTR may be used in situations in
which it would be desirable to block the transcription of the mRNA.
In particular, cells may be transformed with sequences
complementary to polynucleotides encoding NAPTR. Thus, antisense
molecules may be used to modulate NAPTR activity, or to achieve
regulation of gene function. Such technology is now well known in
the art, and sense or antisense oligomers or larger fragments, can
be designed from various locations along the coding or control
regions of sequences encoding NAPTR.
[0113] Expression vectors derived from retro viruses, adenovirus,
herpes or vaccinia viruses, or from various bacterial plasmids may
be used for delivery of nucleotide sequences to the targeted organ,
tissue or cell population. Methods which are well known to those
skilled in the art can be used to construct recombinant vectors
which will express antisense molecules complementary to the
polynucleotides of the gene encoding NAPTR. These techniques are
described both in Sambrook et al. (supra) and in Ausubel et al.
(supra).
[0114] Genes encoding NAPTR can be turned off by transforming a
cell or tissue with expression vectors which express high levels of
a polynucleotide or fragment thereof which encodes NAPTR. Such
constructs may be used to introduce untranslatable sense or
antisense sequences into a cell. Even in the absence of integration
into the DNA, such vectors may continue to transcribe RNA molecules
until they are disabled by endogenous nucleases. Transient
expression may last for a month or more with a non-replicating
vector and even longer if appropriate replication elements are part
of the vector system.
[0115] As mentioned above, modifications of gene expression can be
obtained by designing antisense molecules, DNA, RNA, or PNA, to the
control regions of the gene encoding NAPTR, i.e., the promoters,
enhancers, and introns. Oligonucleotides derived from the
transcription initiation site, e.g., between positions -10 and +10
from the start site, are preferred. Similarly, inhibition can be
achieved using "triple helix" base-pairing methodology. Triple
helix pairing is useful because it causes inhibition of the ability
of the double helix to open sufficiently for the binding of
polymerases, transcription factors, or regulatory molecules. Recent
therapeutic advances using triplex DNA have been described in the
literature (Gee, J. E. et al. (1994) In: Huber, B. E. and B. I.
Carr, Molecular and Immunologic Approaches, Futura Publishing Co.,
Mt. Kisco, N.Y.). The antisense molecules may also be designed to
block translation of mRNA by preventing the transcript from binding
to ribosomes.
[0116] Ribozymes, enzymatic RNA molecules, may also be used to
catalyze the specific cleavage of RNA. The mechanism of ribozyme
action involves sequence-specific hybridization of the ribozyme
molecule to complementary target RNA, followed by endonucleolytic
cleavage. Examples which may be used include engineered hammerhead
motif ribozyme molecules that can specifically and efficiently
catalyze endonucleolytic cleavage of sequences encoding NAPTR.
[0117] Specific ribozyme cleavage sites within any potential RNA
target are initially identified by scanning the target molecule for
ribozyme cleavage sites which include the following sequences: GUA,
GUU, and GUC. Once identified, short RNA sequences of between 15
and 20 ribonucleotides corresponding to the region of the target
gene containing the cleavage site may be evaluated for secondary
structural features which may render the oligonucleotide
inoperable. The suitability of candidate targets may also be
evaluated by testing accessibility to hybridization with
complementary oligonucleotides using ribonuclease protection
assays.
[0118] Antisense molecules and ribozymes of the invention may be
prepared by any method known in the art for the synthesis of
nucleic acid molecules. These include techniques for chemically
synthesizing oligonucleotides such as solid phase phosphoramidite
chemical synthesis. Alternatively, RNA molecules may be generated
by in vitro and in vivo transcription of DNA sequences encoding
NAPTR. Such DNA sequences may be incorporated into a wide variety
of vectors with suitable RNA polymerase promoters such as T7 or
SP6. Alternatively, these cDNA constructs that synthesize antisense
RNA constitutively or inducibly can be introduced into cell lines,
cells, or tissues.
[0119] RNA molecules may be modified to increase intracellular
stability and half-life. Possible modifications include, but are
not limited to, the addition of flanking sequences at the 5' and/or
3' ends of the molecule or the use of phosphorothioate or 2'
O-methyl rather than phosphodiesterase linkages within the backbone
of the molecule. This concept is inherent in the production of PNAs
and can be extended in all of these molecules by the inclusion of
nontraditional bases such as inosine, queosine, and wybutosine, as
well as acetyl-, methyl-, thio-, and similarly modified forms of
adenine, cytidine, guanine, thymine, and uridine which are not as
easily recognized by endogenous endonucleases.
[0120] Many methods for introducing vectors into cells or tissues
are available and equally suitable for use in vivo, in vitro, and
ex vivo. For ex vivo therapy, vectors may be introduced into stem
cells taken from the patient and clonally propagated for autologous
transplant back into that same patient. Delivery by transfection
and by liposome injections may be achieved using methods which are
well known in the art.
[0121] Any of the therapeutic methods described above may be
applied to any subject in need of such therapy, including, for
example, mammals such as dogs, cats, cows, horses, rabbits,
monkeys, and most preferably, humans.
[0122] An additional embodiment of the invention relates to the
administration of a pharmaceutical composition, in conjunction with
a pharmaceutically acceptable carrier, for any of the therapeutic
effects discussed above. Such pharmaceutical compositions may
consist of NAPTR, antibodies to NAPTR, mimetics, agonists,
antagonists, or inhibitors of NAPTR. The compositions may be
administered alone or in combination with at least one other agent,
such as stabilizing compound, which may be administered in any
sterile, biocompatible pharmaceutical carrier, including, but not
limited to, saline, buffered saline, dextrose, and water. The
compositions may be administered to a patient alone, or in
combination with other agents, drugs or hormones.
[0123] The pharmaceutical compositions utilized in this invention
may be administered by any number of routes including, but not
limited to, oral, intravenous, intramuscular, intra-arterial,
intramedullary, intrathecal, intraventricular, transdermal,
subcutaneous, intraperitoneal, intranasal, enteral, topical,
sublingual, or rectal means.
[0124] In addition to the active ingredients, these pharmaceutical
compositions may contain suitable pharmaceutically-acceptable
carriers comprising excipients and auxiliaries which facilitate
processing of the active compounds into preparations which can be
used pharmaceutically. Further details on techniques for
formulation and administration may be found in the latest edition
of Remington's Pharmaceutical Sciences (Maack Publishing Co.,
Easton, Pa.).
[0125] Pharmaceutical compositions for oral administration can be
formulated using pharmaceutically acceptable carriers well known in
the art in dosages suitable for oral administration. Such carriers
enable the pharmaceutical compositions to be formulated as tablets,
pills, dragees, capsules, liquids, gels, syrups, slurries,
suspensions, and the like, for ingestion by the patient.
[0126] Pharmaceutical preparations for oral use can be obtained
through combination of active compounds with solid excipient,
optionally grinding a resulting mixture, and processing the mixture
of granules, after adding suitable auxiliaries, if desired, to
obtain tablets or dragee cores. Suitable excipients are
carbohydrate or protein fillers, such as sugars, including lactose,
sucrose, mannitol, or sorbitol; starch from corn, wheat, rice,
potato, or other plants; cellulose, such as methyl cellulose,
hydroxypropylmethyl-cellulose, or sodium carboxymethylcellulose;
gums including arabic and tragacanth; and proteins such as gelatin
and collagen. If desired, disintegrating or solubilizing agents may
be added, such as the cross-linked polyvinyl pyrrolidone, agar,
alginic acid, or a salt thereof, such as sodium alginate.
[0127] Dragee cores may be used in conjunction with suitable
coatings, such as concentrated sugar solutions, which may also
contain gum arabic, talc, polyvinylpyrrolidone, carbopol gel,
polyethylene glycol, and/or titanium dioxide, lacquer solutions,
and suitable organic solvents or solvent mixtures. Dyestuffs or
pigments may be added to the tablets or dragee coatings for product
identification or to characterize the quantity of active compound,
i.e., dosage.
[0128] Pharmaceutical preparations which can be used orally include
push-fit capsules made of gelatin, as well as soft, sealed capsules
made of gelatin and a coating, such as glycerol or sorbitol.
Push-fit capsules can contain active ingredients mixed with a
filler or binders, such as lactose or starches, lubricants, such as
talc or magnesium stearate, and, optionally, stabilizers. In soft
capsules, the active compounds may be dissolved or suspended in
suitable liquids, such as fatty oils, liquid, or liquid
polyethylene glycol with or without stabilizers.
[0129] Pharmaceutical formulations suitable for parenteral
administration may be formulated in aqueous solutions, preferably
in physiologically compatible buffers such as Hanks's solution,
Ringer's solution, or physiologically buffered saline. Aqueous
injection suspensions may contain substances which increase the
viscosity of the suspension, such as sodium carboxymethyl
cellulose, sorbitol, or dextran. Additionally, suspensions of the
active compounds may be prepared as appropriate oily injection
suspensions. Suitable lipophilic solvents or vehicles include fatty
oils such as sesame oil, or synthetic fatty acid esters, such as
ethyl oleate or triglycerides, or liposomes. Optionally, the
suspension may also contain suitable stabilizers or agents which
increase the solubility of the compounds to allow for the
preparation of highly concentrated solutions.
[0130] For topical or nasal administration, penetrants appropriate
to the particular barrier to be permeated are used in the
formulation. Such penetrants are generally known in the art.
[0131] The pharmaceutical compositions of the present invention may
be manufactured in a manner that is known in the art, e.g., by
means of conventional mixing, dissolving, granulating,
dragee-making, levigating, emulsifying, encapsulating, entrapping,
or lyophilizing processes.
[0132] The pharmaceutical composition may be provided as a salt and
can be formed with many acids, including but not limited to,
hydrochloric, sulfuric, acetic, lactic, tartaric, malic, succinic,
etc. Salts tend to be more soluble in aqueous or other protonic
solvents than are the corresponding free base forms. In other
cases, the preferred preparation may be a lyophilized powder which
may contain any or all of the following: 1-50 mM histidine, 0.1%-2%
sucrose, and 2-7% mannitol, at a pH range of 4.5 to 5.5, that is
combined with buffer prior to use.
[0133] After pharmaceutical compositions have been prepared, they
can be placed in an appropriate container and labeled for treatment
of an indicated condition. For administration of NAPTR, such
labeling would include amount, frequency, and method of
administration.
[0134] Pharmaceutical compositions suitable for use in the
invention include compositions wherein the active ingredients are
contained in an effective amount to achieve the intended purpose.
The determination of an effective dose is well within the
capability of those skilled in the art.
[0135] For any compound, the therapeutically effective dose can be
estimated initially either in cell culture assays, e.g., of
neoplastic cells, or in animal models, usually mice, rabbits, dogs,
or pigs. The animal model may also be used to determine the
appropriate concentration range and route of administration. Such
information can then be used to determine useful doses and routes
for administration in humans.
[0136] A therapeutically effective dose refers to that amount of
active ingredient, for example NAPTR or fragments thereof,
antibodies of NAPTR, agonists, antagonists or inhibitors of NAPTR,
which ameliorates the symptoms or condition. Therapeutic efficacy
and toxicity may be determined by standard pharmaceutical
procedures in cell cultures or experimental animals, e.g., ED50
(the dose therapeutically effective in 50% of the population) and
LD50 (the dose lethal to 50% of the population). The dose ratio
between therapeutic and toxic effects is the therapeutic index, and
it can be expressed as the ratio, LD50/ED50. Pharmaceutical
compositions which exhibit large therapeutic indices are preferred.
The data obtained from cell culture assays and animal studies is
used in formulating a range of dosage for human use. The dosage
contained in such compositions is preferably within a range of
circulating concentrations that include the ED50 with little or no
toxicity. The dosage varies within this range depending upon the
dosage form employed, sensitivity of the patient, and the route of
administration.
[0137] The exact dosage will be determined by the practitioner, in
light of factors related to the subject that requires treatment.
Dosage and administration are adjusted to provide sufficient levels
of the active moiety or to maintain the desired effect. Factors
which may be taken into account include the severity of the disease
state, general health of the subject, age, weight, and gender of
the subject, diet, time and frequency of administration, drug
combination(s), reaction sensitivities, and tolerance/response to
therapy. Long-acting pharmaceutical compositions may be
administered every 3 to 4 days, every week, or once every two weeks
depending on half-life and clearance rate of the particular
formulation.
[0138] Normal dosage amounts may vary from 0.1 to 100,000
micrograms, up to a total dose of about 1 g, depending upon the
route of administration. Guidance as to particular dosages and
methods of delivery is provided in the literature and generally
available to practitioners in the art. Those skilled in the art
will employ different formulations for nucleotides than for
proteins or their inhibitors. Similarly, delivery of
polynucleotides or polypeptides will be specific to particular
cells, conditions, locations, etc.
Diagnostics
[0139] In another embodiment, antibodies which specifically bind
NAPTR may be used for the diagnosis of conditions or diseases
characterized by expression of NAPTR, or in assays to monitor
patients being treated with NAPTR, agonists, antagonists or
inhibitors. The antibodies useful for diagnostic purposes may be
prepared in the same manner as those described above for
therapeutics. Diagnostic assays for NAPTR include methods which
utilize the antibody and a label to detect NAPTR in human body
fluids or extracts of cells or tissues. The antibodies may be used
with or without modification, and may be labeled by joining them,
either covalently or non-covalently, with a reporter molecule. A
wide variety of reporter molecules which are known in the art may
be used, several of which are described above.
[0140] A variety of protocols including ELISA, RIA, and FACS for
measuring NAPTR are known in the art and provide a basis for
diagnosing altered or abnormal levels of NAPTR expression. Normal
or standard values for NAPTR expression are established by
combining body fluids or cell extracts taken from normal mammalian
subjects, preferably human, with antibody to NAPTR under conditions
suitable for complex formation The amount of standard complex
formation may be quantified by various methods, but preferably by
photometric, means. Quantities of NAPTR expressed in subject,
control and disease, samples from biopsied tissues are compared
with the standard values. Deviation between standard and subject
values establishes the parameters for diagnosing disease.
[0141] In another embodiment of the invention, the polynucleotides
encoding NAPTR may be used for diagnostic purposes. The
polynucleotides which may be used include oligonucleotide
sequences, antisense RNA and DNA molecules, and PNAs. The
polynucleotides may be used to detect and quantitate gene
expression in biopsied tissues in which expression of NAPTR may be
correlated with disease. The diagnostic assay may be used to
distinguish between absence, presence, and excess expression of
NAPTR, and to monitor regulation of NAPTR levels during therapeutic
intervention.
[0142] In one aspect, hybridization with PCR probes which are
capable of detecting polynucleotide sequences, including genomic
sequences, encoding NAPTR or closely related molecules, may be used
to identify nucleic acid sequences which encode NAPTR. The
specificity of the probe, whether it is made from a highly specific
region, e.g., 10 unique nucleotides in the 5' regulatory region, or
a less specific region, e.g., especially in the 3' coding region,
and the stringency of the hybridization or amplification (maximal,
high, intermediate, or low) will determine whether the probe
identifies only naturally occurring sequences encoding NAPTR,
alleles, or related sequences.
[0143] Probes may also be used for the detection of related
sequences, and should preferably contain at least 50% of the
nucleotides from any of the NAPTR encoding sequences. The
hybridization probes of the subject invention may be DNA or RNA and
derived from the nucleotide sequence of SEQ ID NO:2 or from genomic
sequence including promoter, enhancer elements, and introns of the
naturally occurring NAPTR.
[0144] Means for producing specific hybridization probes for DNAs
encoding NAPTR include the cloning of nucleic acid sequences
encoding NAPTR or NAPTR derivatives into vectors for the production
of mRNA probes. Such vectors are known in the art, commercially
available, and may be used to synthesize RNA probes in vitro by
means of the addition of the appropriate RNA polymerases and the
appropriate labeled nucleotides. Hybridization probes may be
labeled by a variety of reporter groups, for example, radionuclides
such as 32P or 35S, or enzymatic labels, such as alkaline
phosphatase coupled to the probe via avidin/biotin coupling
systems, and the like.
[0145] Polynucleotide sequences encoding NAPTR may be used for the
diagnosis of disorders which are associated with expression of
NAPTR. Examples of such disorders associated with decreased
expression of NAPTR include cancers of the kidney, disorders of
decreased phosphate levels including tumoral calcinosis,
osteomalacia, osteoporosis, familial hypophosphatemia, rickets,
cysteneuria, nephrocalcinosis, glomerulonephritis, renal calculus,
Alzheimers disease, diabetes mellitus, hereditary amyloidosis,
myopathies including progressive external ophthalmoplegia,
Kearns-Sayre syndrome, myoclonic epilepsy, encephalopathy, and
cardiomyopathy, hypokalemia, Goodpastures' Syndrome, and disorders
of cell signaling through cAMP, ATP, NADPH, and
glucose-6-phosphate. Examples of disorders associated with
increased expression of NAPTR include abnormal phosphate regulation
in neurons, gastrointestinal tract, and liver, hypocalciuria, and
hypocalcemia. The polynucleotide sequences encoding NAPTR may be
used in Southern or northern analysis, dot blot, or other
membrane-based technologies; in PCR technologies; or in dip stick,
pin, ELISA or chip assays utilizing fluids or tissues from patient
biopsies to detect altered NAPTR expression. Such qualitative or
quantitative methods are well known in the art.
[0146] In a particular aspect, the nucleotide sequences encoding
NAPTR may be useful in assays that detect activation or induction
of various cancers, particularly those mentioned above. The
nucleotide sequences encoding NAPTR may be labeled by standard
methods, and added to a fluid or tissue sample from a patient under
conditions suitable for the formation of hybridization complexes.
After a suitable incubation period, the sample is washed and the
signal is quantitated and compared with a standard value. If the
amount of signal in the biopsied or extracted sample is
significantly altered from that of a comparable control sample, the
nucleotide sequences have hybridized with nucleotide sequences in
the sample, and the presence of altered levels of nucleotide
sequences encoding NAPTR in the sample indicates the presence of
the associated disease. Such assays may also be used to evaluate
the efficacy of a particular therapeutic treatment regimen in
animal studies, in clinical trials, or in monitoring the treatment
of an individual patient.
[0147] In order to provide a basis for the diagnosis of disease
associated with expression of NAPTR, a normal or standard profile
for expression is established. This may be accomplished by
combining body fluids or cell extracts taken from normal subjects,
either animal or human, with a sequence, or a fragment thereof,
which encodes NAPTR, under conditions suitable for hybridization or
amplification. Standard hybridization may be quantified by
comparing the values obtained from normal subjects with those from
an experiment where a known amount of a substantially purified
polynucleotide is used. Standard values obtained from normal
samples may be compared with values obtained from samples from
patients who are symptomatic for disease. Deviation between
standard and subject values is used to establish the presence of
disease.
[0148] Once disease is established and a treatment protocol is
initiated, hybridization assays may be repeated on a regular basis
to evaluate whether the level of expression in the patient begins
to approximate that which is observed in the normal patient. The
results obtained from successive assays may be used to show the
efficacy of treatment over a period ranging from several days to
months.
[0149] With respect to cancer, the presence of a relatively high
amount of transcript in biopsied tissue from an individual may
indicate a predisposition for the development of the disease, or
may provide a means for detecting the disease prior to the
appearance of actual clinical symptoms. A more definitive diagnosis
of this type may allow health professionals to employ preventative
measures or aggressive treatment earlier thereby preventing the
development or further progression of the cancer.
[0150] Additional diagnostic uses for oligonucleotides designed
from the sequences encoding NAPTR may involve the use of PCR. Such
oligomers may be chemically synthesized, generated enzymatically,
or produced from a recombinant source. Oligomers will preferably
consist of two nucleotide sequences, one with sense orientation
(5'->3') and another with antisense (3'<-5'), employed under
optimized conditions for identification of a specific gene or
condition. The same two oligomers, nested sets of oligomers, or
even a degenerate pool of oligomers may be employed under less
stringent conditions for detection and/or quantitation of closely
related DNA or RNA sequences.
[0151] Methods which may also be used to quantitate the expression
of NAPTR include radiolabeling or biotinylating nucleotides,
coamplification of a control nucleic acid, and standard curves onto
which the experimental results are interpolated (Melby, P. C. et
al. (1993) J. Immunol. Methods, 159:235-244; Duplaa, C. et al.
(1993) Anal. Biochem. 212:229-236). The speed of quantitation of
multiple samples may be accelerated by running the assay in an
ELISA format where the oligomer of interest is presented in various
dilutions and a spectrophotometric or colorimetric response gives
rapid quantitation.
[0152] In another embodiment of the invention, the nucleic acid
sequences which encode NAPTR may also be used to generate
hybridization probes which are useful for mapping the naturally
occurring genomic sequence. The sequences may be mapped to a
particular chromosome or to a specific region of the chromosome
using well known techniques. Such techniques include FISH, FACS, or
artificial chromosome constructions, such as yeast artificial
chromosomes, bacterial artificial chromosomes, bacterial P1
constructions or single chromosome cDNA libraries as reviewed in
Price, C. M. (1993) Blood Rev. 7:127-134, and Trask, B. J. (1991)
Trends Genet. 7:149-154.
[0153] FISH (as described in Verma et al. (1988) Human Chromosomes:
A Manual of Basic Techniques, Pergamon Press, New York, N.Y.) may
be correlated with other physical chromosome mapping techniques and
genetic map data. Examples of genetic map data can be found in the
1994 Genome Issue of Science (265:1981f). Correlation between the
location of the gene encoding NAPTR on a physical chromosomal map
and a specific disease, or predisposition to a specific disease,
may help delimit the region of DNA associated with that genetic
disease. The nucleotide sequences of the subject invention may be
used to detect differences in gene sequences between normal,
carrier, or affected individuals.
[0154] In situ hybridization of chromosomal preparations and
physical mapping techniques such as linkage analysis using
established chromosomal markers may be used for extending genetic
maps. Often the placement of a gene on the chromosome of another
mammalian species, such as mouse, may reveal associated markers
even if the number or arm of a particular human chromosome is not
known. New sequences can be assigned to chromosomal arms, or parts
thereof, by physical mapping. This provides valuable information to
investigators searching for disease genes using positional cloning
or other gene discovery techniques. Once the disease or syndrome
has been crudely localized by genetic linkage to a particular
genomic region, for example, AT to 11q22-23 (Gatti, R. A. et al.
(1988) Nature 336:577-580), any sequences mapping to that area may
represent associated or regulatory genes for further investigation.
The nucleotide sequence of the subject invention may also be used
to detect differences in the chromosomal location due to
translocation, inversion, etc. among normal, carrier, or affected
individuals.
[0155] In another embodiment of the invention, NAPTR, its catalytic
or immunogenic fragments or oligopeptides thereof, can be used for
screening libraries of compounds in any of a variety of drug
screening techniques. The fragment employed in such screening may
be free in solution, affixed to a solid support, borne on a cell
surface, or located intracellularly. The formation of binding
complexes, between NAPTR and the agent being tested, may be
measured.
[0156] Another technique for drug screening which may be used
provides for high throughput screening of compounds having suitable
binding affinity to the protein of interest as described in
published PCT application WO84/03564. In this method, as applied to
NAPTR large numbers of different small test compounds are
synthesized on a solid substrate, such as plastic pins or some
other surface. The test compounds are reacted with NAPTR, or
fragments thereof, and washed. Bound NAPTR is then detected by
methods well known in the art. Purified NAPTR can also be coated
directly onto plates for use in the aforementioned drug screening
techniques. Alternatively, non-neutralizing antibodies can be used
to capture the peptide and immobilize it on a solid support.
[0157] In another embodiment, one may use competitive drug
screening assays in which neutralizing antibodies capable of
binding NAPTR specifically compete with a test compound for binding
NAPTR. In this manner, the antibodies can be used to detect the
presence of any peptide which shares one or more antigenic
determinants with NAPTR.
[0158] In additional embodiments, the nucleotide sequences which
encode NAPTR may be used in any molecular biology techniques that
have yet to be developed, provided the new techniques rely on
properties of nucleotide sequences that are currently known,
including, but not limited to, such properties as the triplet
genetic code and specific base pair interactions.
[0159] The examples below are provided to illustrate the subject
invention and are not included for the purpose of limiting the
invention.
EXAMPLES
1. BRAITUT02 cDNA Library Construction
[0160] The BRAITUT02 cDNA library was constructed from brain tumor
tissue. The pathology report indicated that a stage 1V grade 2
renal cell carcinoma was the source of the primary tumor which had
metastasized to the brain and formed an ex cerebral meningeal
lesion. The patient was being treated with Decadron (Dexamethasone;
Merck Sharp & Dohme, West Point Pa.) for cerebral
edema/hemorrhage and with Dilantin (Phynetion; Parke-Davis, Morris
Plains, N.J.) for seizures.
[0161] The frozen tissue was homogenized and lysed using a
Brinkmann Homogenizer Polytron PT-3000 (Brinkmann Instruments,
Westbury N.J.). The lysate was centrifuged over a 5.7 M CsCl
cushion using a Beckman SW28 rotor in a Beckman L8-70M
Ultracentrifuge (Beckman Instruments) for 18 hours at 25,000 rpm at
ambient temperature. The RNA was extracted with phenol chloroform
pH 4.0, precipitated using 0.3 M sodium acetate and 2.5 volumes of
ethanol, resuspended in DEPC-treated water and DNase treated at
37.degree. C. The RNA was re-extracted with phenol chloroform pH
4.0 and precipitated using sodium acetate and ethanol as before.
The RNA was then isolated using the Qiagen Oligotex kit (QIAGEN
Inc; Chatsworth Calif.) and used to construct the cDNA library.
[0162] The RNA was handled according to the recommended protocols
in the SuperScript Plasmid System for cDNA Synthesis and Plasmid
Cloning (Cat. #18248-013; Gibco/BRL Gaithersburg Md.). cDNAs were
fractionated on a Sepharose CL4B column (Cat. #275105, Pharmacia),
and those cDNAs exceeding 400 bp were ligated into PSPORT1. The
plasmid PSPORT1 was subsequently transformed into DH5a competent
cells (Cat. #18258-012, Gibco/BRL).
II. Isolation and Sequencing of cDNA Clones
[0163] Plasmid DNA was released from the cells and purified using
the REAL Prep 96 Plasmid Kit (Catalog #26173 QIAGEN, Inc.). The
recommended protocol was employed except for the following changes:
1) the bacteria were cultured in 1 ml of sterile Terrific Broth
(Catalog #22711, Gibco/BRL) with carbenicillin at 25 mg/L and
glycerol at 0.4%; 2) the cultures were incubated for 19 hours after
the wells were inoculated and then lysed with 0.3 ml of lysis
buffer; 3) following isopropanol precipitation, the plasmid DNA
pellet was resuspended in 0.1 ml of distilled water. After the last
step in the protocol, samples were transferred to a Beckman 96-well
block for storage.
[0164] The cDNAs were sequenced by the method of Sanger, F. and A.
R. Coulson (1975; J. Mol. Biol. 94:441f), using a Hamilton Micro
Lab 2200 (Hamilton, Reno Nev.) in combination with Peltier Thermal
Cyclers (PTC200 from MJ Research, Watertown Mass.) and Applied
Biosystems 377 or 373 DNA Sequencing Systems; and the reading frame
was determined.
III. Homology Searching of cDNA Clones and their Deduced
Proteins
[0165] Each cDNA was compared to sequences in GenBank using a
search algorithm developed by Applied Biosystems and incorporated
into the INHERIT 670 sequence analysis system. In this algorithm,
Pattern Specification Language (TRW Inc., Los Angeles, Calif.) was
used to determine regions of homology. The three parameters that
determine how the sequence comparisons run were window size, window
offset, and error tolerance. Using a combination of these three
parameters, the DNA database was searched for sequences containing
regions of homology to the query sequence, and the appropriate
sequences were scored with an initial value. Subsequently, these
homologous regions were examined using dot matrix homology plots to
distinguish regions of homology from chance matches. Smith-Waterman
alignments were used to display the results of the homology
search.
[0166] Peptide and protein sequence homologies were ascertained
using the INHERIT-670 sequence analysis system using the methods
similar to those used in DNA sequence homologies. Pattern
Specification Language and parameter windows were used to search
protein databases for sequences containing regions of homology
which were scored with an initial value. Dot-matrix homology plots
were examined to distinguish regions of significant homology from
chance matches.
[0167] BLAST, which stands for Basic Local Alignment Search Tool
(Altschul, S. F. (1993) J. Mol. Evol. 36:290-300; Altschul et al.
(1990) J. Mol. Biol. 215:403-410), was used to search for local
sequence alignments. BLAST produces alignments of both nucleotide
and amino acid sequences to determine sequence similarity. Because
of the local nature of the alignments, BLAST is especially useful
in determining exact matches or in identifying homologs. BLAST is
useful for matches which do not contain gaps. The fundamental unit
of BLAST algorithm output is the High-scoring Segment Pair
(HSP).
[0168] An HSP consists of two sequence fragments of arbitrary but
equal lengths whose alignment is locally maximal and for which the
alignment score meets or exceeds a threshold or cutoff score set by
the user. The BLAST approach is to look for HSPs between a query
sequence and a database sequence, to evaluate the statistical
significance of any matches found, and to report only those matches
which satisfy the user-selected threshold of significance. The
parameter E establishes the statistically significant threshold for
reporting database sequence matches. E is interpreted as the upper
bound of the expected frequency of chance occurrence of an HSP (or
set of HSPs) within the context of the entire database search. Any
database sequence whose match satisfies E is reported in the
program output.
IV. Northern Analysis
[0169] Northern analysis is a laboratory technique used to detect
the presence of a transcript of a gene and involves the
hybridization of a labeled nucleotide sequence to a membrane on
which RNAs from a particular cell type or tissue have been bound
(Sambrook et al., supra).
[0170] Analogous computer techniques using BLAST (Altschul, S. F.
1993 and 1990, supra) are used to search for identical or related
molecules in nucleotide databases such as GenBank or the LIFESEQ
database (Incyte Pharmaceuticals). This analysis is much faster
than multiple, membrane-based hybridizations. In addition, the
sensitivity of the computer search can be modified to determine
whether any particular match is categorized as exact or
homologous.
[0171] The basis of the search is the product score which is
defined as: % .times. .times. sequence .times. .times. identity
.times. % .times. .times. maximum .times. .times. BLAST .times.
.times. score 100 ##EQU1## The product score takes into account
both the degree of similarity between two sequences and the length
of the sequence match. For example, with a product score of 40, the
match will be exact within a 1-2% error; and at 70, the match will
be exact. Homologous molecules are usually identified by selecting
those which show product scores between 15 and 40, although lower
scores may identify related molecules.
[0172] The results of northern analysis are reported as a list of
libraries in which the transcript encoding NAPTR occurs. Abundance
and percent abundance are also reported. Abundance directly
reflects the number of times a particular transcript is represented
in a cDNA library, and percent abundance is abundance divided by
the total number of sequences examined in the cDNA library.
V. Extension of NAPTR to Full Length
[0173] Incyte Clone 754412.est (SEQ ID NO:5) was used to design
oligonucleotide primers to extend the partial nucleotide sequence
to full length. One primer was synthesized to initiate extension in
the antisense direction (XLR=CTTGATGCTCCCATGAGAAAACTGG, SEQ ID
NO:6), and the other was synthesized to extend sequence in the
sense direction (XLF=AGGATTTTCGAGCATAGCACCTGTC, SEQ ID NO:7). PCR
using these primers allowed the extension of the known partial
sequence "outward" and produced three amplicons which were
subsequently sequenced using the shotgun method (Messing, J. et al.
(1981) Nucleic Acids Res. 9:309-321).
[0174] The initial primers were designed using OLIGO 4.06 primer
analysis software (National Biosciences), or another appropriate
program. Optimum primers are generally 22-30 nucleotides in length,
have a GC content of 50% or more, and anneal to the target sequence
at temperatures about 68.degree.-72.degree. C. Any stretch of
nucleotides which would result in hairpin structures and
primer-primer dimerizations was avoided.
[0175] Extension of Incyte Clone 754412.est (SEQ ID NO:5) to full
length was accomplished in a single PCR experiment. Essential
components of the experiment included a mixture of two commercial
libraries, liver and leukocytes (Gibco/BRL, Gaithersburg Md.), the
XL-PCR kit (Perkin Elmer), 40 pmol each of the XLF and XLR primers,
and the recommended concentrations of all other components of the
kit. PCR was performed using the Peltier Thermal Cycler (PTC200; MJ
Research, Watertown Mass.) and the following parameters:
[0176] Step 1 94.degree. C. for 1 min (initial denaturation)
[0177] Step 2 65.degree. C. for 1 min
[0178] Step 3 68.degree. C. for 6 min
[0179] Step 4 94.degree. C. for 15 sec
[0180] Step 5 65.degree. C. for 1 min
[0181] Step 6 68.degree. C. for 7 min
[0182] Step 7 Repeat step 4-6 for 15 additional cycles
[0183] Step 8 94.degree. C. for 15 sec
[0184] Step 9 65.degree. C. for 1 min
[0185] Step 10 68.degree. C. for 7:15 min
[0186] Step 11 Repeat step 8-10 for 12 cycles
[0187] Step 12 72.degree. C. for 8 min
[0188] Step 13 4.degree. C. (and holding)
[0189] After PCR, 5-10 .mu.l aliquot of the reaction mixture was
analyzed by electrophoresis in a low concentration (about 0.6-0.8%)
agarose mini-gel to determine if the sequence was extended. The
bands thought to contain the largest products were selected and cut
out of the gel. Further purification involved gel extraction using
a method such as QIAQUICK (QIAGEN Inc). After the DNA was
recovered, Klenow enzyme was used to trim single-stranded,
nucleotide overhangs creating blunt ends to facilitate religation
and cloning.
[0190] The reaction products were precipitated in ethanol and
redissolved in 13 .mu.l of ligation buffer. After 1 .mu.l T4-DNA
ligase (15 units) and 1 .mu.l T4 polynucleotide kinase were added,
the mixture was incubated at room temperature for 2-3 hours or
overnight at 16.degree. C. Competent E. coli cells (in 40 .mu.l of
appropriate media) were transformed with 3 .mu.l of ligation
mixture and cultured in 80 .mu.l of SOC medium (Sambrook J et al,
supra). The whole transformation mixture was incubated for one hour
at 37.degree. C. and plated on Luria Bertani (LB)-agar (Sambrook,
J. et al., supra) containing 2.times. carbenicillin (2.times.
Carb). The following day, several colonies were randomly picked
from each plate and cultured in 150 .mu.l of liquid LB/2.times.
Carb medium placed in an individual well of a
commercially-available, sterile 96-well microtiter plate. The next
day, 5 .mu.l of each overnight culture was transferred into a
non-sterile 96-well plate. After being diluted 1:10 with water, 5
.mu.l of each sample was transferred into a PCR array.
[0191] For PCR amplification, 18 .mu.l of concentrated PCR reaction
mix (3.3.times.) containing 4 units of rTth DNA polymerase, a
vector primer and one or both of the gene specific primers used for
the extension reaction were added to each well. Amplification was
performed using the following conditions:
[0192] Step 1 94.degree. C. for 60 sec
[0193] Step 2 94.degree. C. for 20 sec
[0194] Step 3 55.degree. C. for 30 sec
[0195] Step 4 72.degree. C. for 90 sec
[0196] Step 5 Repeat steps 2-4 for an additional 29 cycles
[0197] Step 6 72.degree. C. for 180 sec
[0198] Step 7 4.degree. C. (and holding)
[0199] Aliquots of the PCR reactions were run on agarose gels
together with molecular weight markers. The sizes of the PCR
products were compared to the original partial cDNAs, and
appropriate clones were selected, ligated into plasmid, and
sequenced.
[0200] In like manner, the full length sequence of 745412 (SEQ ID
NO:2) can be used to obtain 5' sequences, promoters or regulatory
elements from appropriate genomic libraries.
VI. Labeling and Use of Hybridization Probes
[0201] Hybridization probes derived from SEQ ID NO:2 are employed
to screen cDNAs, genomic DNAs, or mRNAs. Although the labeling of
oligonucleotides, consisting of about 20 base-pairs, is
specifically described, essentially the same procedure is used with
larger cDNA fragments. Oligonucleotides are designed using
state-of-the-art software such as OLIGO 4.06 (National
Biosciences), labeled by combining 50 pmol of each oligomer and 250
.mu.Ci of [.gamma.-.sup.32P] adenosine triphosphate (Amersham) and
T4 polynucleotide kinase (DuPont NEN, Boston, Mass.). The labeled
oligonucleotides are substantially purified with Sephadex G-25
superfine resin column (Pharmacia & Upjohn). A portion
containing 10.sup.7 counts per minute of each of the sense and
antisense oligonucleotides is used in a typical membrane based
hybridization analysis of human genomic DNA digested with one of
the following endonucleases (Ase I, Bgl II, Eco RI, Pst I, Xba I,
or Pvu II; DuPont NEN).
[0202] The DNA from each digest is fractionated on a 0.7 percent
agarose gel and transferred to nylon membranes (Nytran Plus,
Schleicher & Schuell, Durham, N.H.). Hybridization is carried
out for 16 hours at 40.degree. C. To remove nonspecific signals,
blots are sequentially washed at room temperature under
increasingly stringent conditions up to 0.1.times. saline sodium
citrate and 0.5% sodium dodecyl sulfate. After XOMAT AR film
(Kodak, Rochester, N.Y.) is exposed to the blots in a Phosphoimager
cassette (Molecular Dynamics, Sunnyvale, Calif.) for several hours,
hybridization patterns are compared visually.
VII. Antisense Molecules
[0203] Antisense molecules to the NAPTR-encoding sequence, or any
part thereof, is used to inhibit in vivo or in vitro expression of
naturally occurring NAPTR. Although use of antisense
oligonucleotides, comprising about 20 base-pairs, is specifically
described, essentially the same procedure is used with larger cDNA
fragments. An oligonucleotide based on the coding sequences of
NAPTR, as shown in FIG. 1, is used to inhibit expression of
naturally occurring NAPTR. The complementary oligonucleotide is
designed from the most unique 5' sequence as shown in FIG. 1 and
used either to inhibit transcription by preventing promoter binding
to the upstream nontranslated sequence or translation of an
NAPTR-encoding transcript by preventing the ribosome from binding.
Using an appropriate portion of the signal and 5' sequence of SEQ
ID NO:2, an effective antisense oligonucleotide includes any 15-20
nucleotides spanning the region which translates into the signal or
5' coding sequence of the polypeptide as shown in FIG. 1.
VIII. Expression of NAPTR
[0204] Expression of NAPTR is accomplished by subcloning the cDNAs
into appropriate vectors and transforming the vectors into host
cells. In this case, the cloning vector, PSPORT, previously used
for the generation of the cDNA library is used to express NAPTR in
E. coli. Upstream of the cloning site, this vector contains a
promoter for .beta.-galactosidase, followed by sequence containing
the amino-terminal Met, and the subsequent seven residues of
.beta.-galactosidase. Immediately following these eight residues is
a bacteriophage promoter useful for transcription and a linker
containing a number of unique restriction sites.
[0205] Induction of an isolated, transformed bacterial strain with
IPTG using standard methods produces a fusion protein which
consists of the first eight residues of .beta.-galactosidase, about
5 to 15 residues of linker, and the full length protein. The signal
residues direct the secretion of NAPTR into the bacterial growth
media which can be used directly in the following assay for
activity.
IX. Demonstration of NAPTR Activity
[0206] NAPTR can be assayed by injecting Xenopus laevis oocytes at
stages V and VI with NAPTR mRNA (10 ng per oocyte) and incubating
for 3 days at 18.degree. C. in OR2 medium (82.5 mM NaCl, 2.5 mM
KCL, 1 mM CaCl.sub.2, 1 mM MgCl.sub.2, 1 mM Na.sub.2HPO.sub.4, 5 mM
Hepes, 3.8 mM NaOH, 50 ug/ml gentamycin, pH 7.8) before switching
to standard uptake medium (100 mM NaCl, 2 mM KCL, 1 mM CaCl.sub.2,
1 mM MgCl.sub.2, 10 mM Hepes/Tris pH 7.5). Uptake of phosphate is
initiated by adding 0.1 mM KH.sub.2PO.sub.4 containing 30 uCi of
.sup.32P in uptake medium and incubating for 30 minutes. Uptake is
terminated by washing the oocytes three times in Na.sup.+-free
medium, measuring the incorporated .sup.32P, and comparing with
controls (Ni, B. (1993) supra).
X. Production of NAPTR Specific Antibodies
[0207] NAPTR that is substantially purified using PAGE
electrophoresis (Sambrook, supra), or other purification
techniques, is used to immunize rabbits and to produce antibodies
using standard protocols. The amino acid sequence deduced from SEQ
ID NO:2 is analyzed using DNASTAR software (DNASTAR Inc) to
determine regions of high immunogenicity and a corresponding
oligopolypeptide is synthesized and used to raise antibodies by
means known to those of skill in the art. Selection of appropriate
epitopes, such as those near the C-terminus or in hydrophilic
regions, is described by Ausubel et al. (supra), and others.
[0208] Typically, the oligopeptides are 15 residues in length,
synthesized using an Applied Biosystems Peptide Synthesizer Model
431A using fmoc-chemistry, and coupled to keyhole limpet hemocyanin
(KLH, Sigma, St. Louis, Mo.) by reaction with
N-maleimidobenzoyl-N-hydroxysuccinimide ester (MBS; Ausubel et al.,
supra). Rabbits are immunized with the oligopeptide-KLH complex in
complete Freund's adjuvant. The resulting antisera are tested for
antipeptide activity, for example, by binding the peptide to
plastic, blocking with 1% BSA, reacting with rabbit antisera,
washing, and reacting with radioiodinated, goat anti-rabbit
IgG.
XI. Purification of Naturally Occurring NAPTR Using Specific
Antibodies
[0209] Naturally occurring or recombinant NAPTR is substantially
purified by immunoaffinity chromatography using antibodies specific
for NAPTR. An immunoaffinity column is constructed by covalently
coupling NAPTR antibody to an activated chromatographic resin, such
as CnBr-activated Sepharose (Pharmacia & Upjohn). After the
coupling, the resin is blocked and washed according to the
manufacturer's instructions.
[0210] Media containing NAPTR is passed over the immunoaffinity
column, and the column is washed under conditions that allow the
preferential absorbance of NAPTR (e.g., high ionic strength buffers
in the presence of detergent). The column is eluted under
conditions that disrupt antibody/NAPTR binding (eg, a buffer of pH
2-3 or a high concentration of a chaotrope, such as urea or
thiocyanate ion), and NAPTR is collected.
XII. Identification of Molecules which Interact with NAPTR
[0211] NAPTR or biologically active fragments thereof are labeled
with .sup.125I Bolton-Hunter reagent (Bolton, A. E. and W. M.
Hunter (1973) Biochem. J. 133:529-539). Candidate molecules
previously arrayed in the wells of a multi-well plate are incubated
with the labeled NAPTR, washed and any wells with labeled NAPTR
complex are assayed. Data obtained using different concentrations
of NAPTR are used to calculate values for the number, affinity, and
association of NAPTR with the candidate molecules.
[0212] All publications and patents mentioned in the above
specification are herein incorporated by reference. Various
modifications and variations of the described method and system of
the invention will be apparent to those skilled in the art without
departing from the scope and spirit of the invention. Although the
invention has been described in connection with specific preferred
embodiments, it should be understood that the invention as claimed
should not be unduly limited to such specific embodiments. Indeed,
various modifications of the described modes for carrying out the
invention which are obvious to those skilled in molecular biology
or related fields are intended to be within the scope of the
following claims.
Sequence CWU 1
1
7 1 401 PRT Human 1 Met Gln Val Asp Glu Thr Leu Ile Pro Arg Lys Val
Pro Ser Leu Cys 1 5 10 15 Ser Ala Arg Tyr Gly Ile Ala Leu Val Leu
His Phe Cys Asn Phe Thr 20 25 30 Thr Ile Ala Gln Asn Val Ile Met
Asn Ile Thr Met Val Ala Met Val 35 40 45 Asn Ser Thr Ser Pro Gln
Ser Gln Leu Asn Asp Ser Ser Glu Val Leu 50 55 60 Pro Val Asp Ser
Phe Gly Gly Leu Ser Lys Ala Pro Lys Ser Leu Pro 65 70 75 80 Ala Lys
Ser Ser Ile Leu Gly Gly Gln Phe Ala Ile Trp Glu Arg Trp 85 90 95
Gly Pro Pro Gln Glu Arg Ser Arg Leu Cys Ser Ile Ala Leu Ser Gly 100
105 110 Met Leu Leu Gly Cys Phe Thr Ala Ile Leu Ile Gly Gly Phe Ile
Ser 115 120 125 Glu Thr Leu Gly Trp Pro Phe Val Phe Tyr Ile Phe Gly
Gly Val Gly 130 135 140 Cys Val Cys Cys Leu Leu Trp Phe Val Val Ile
Tyr Asp Asp Pro Val 145 150 155 160 Ser Tyr Pro Trp Ile Ser Thr Ser
Glu Lys Glu Tyr Ile Ile Ser Ser 165 170 175 Leu Lys Gln Gln Val Gly
Ser Ser Lys Gln Pro Leu Pro Ile Lys Ala 180 185 190 Met Leu Arg Ser
Leu Pro Ile Trp Ser Ile Cys Leu Gly Cys Phe Ser 195 200 205 His Gln
Trp Leu Val Ser Thr Met Val Val Tyr Ile Pro Thr Tyr Ile 210 215 220
Ser Ser Val Tyr His Val Asn Ile Arg Asp Asn Gly Leu Leu Ser Ala 225
230 235 240 Leu Pro Phe Ile Val Ala Trp Val Ile Gly Met Val Gly Gly
Tyr Leu 245 250 255 Ala Asp Phe Leu Leu Thr Lys Lys Phe Arg Leu Ile
Thr Val Arg Lys 260 265 270 Ile Ala Thr Ile Leu Gly Ser Leu Pro Ser
Ser Ala Leu Ile Val Ser 275 280 285 Leu Pro Tyr Leu Asn Ser Gly Tyr
Ile Thr Ala Thr Ala Leu Leu Thr 290 295 300 Leu Ser Cys Gly Leu Ser
Thr Leu Cys Gln Ser Gly Ile Tyr Ile Asn 305 310 315 320 Val Leu Asp
Ile Ala Pro Arg Tyr Ser Ser Phe Leu Met Gly Ala Ser 325 330 335 Arg
Gly Phe Ser Ser Ile Ala Pro Val Ile Val Pro Thr Val Ser Gly 340 345
350 Phe Leu Leu Ser Gln Asp Pro Glu Phe Gly Trp Arg Asn Val Phe Phe
355 360 365 Leu Leu Phe Ala Val Asn Leu Leu Gly Leu Leu Phe Tyr Leu
Ile Phe 370 375 380 Gly Glu Ala Asp Val Gln Glu Trp Ala Lys Glu Arg
Lys Leu Thr Arg 385 390 395 400 Leu 2 1643 DNA Human 2 agaacggtga
ggatgaccga cgtataggcg agagcctagg tacgccatgc caggtcaccg 60
gtccggcaat tcccgggtcg acccacgcgt ccgcttggag ggacgctggg ttcaacttga
120 agcccttcca cagacattaa gtcggtgaaa accattcact aggagaggag
aaacacaatg 180 gccaccaaga cagagttgag tcccacagca agggagagca
agaacgcaca agatatgcaa 240 gtggatgaga cactgatccc caggaaagtt
ccaagtttat gttctgctcg ctatggaata 300 gccctcgtct tacatttctg
caatttcaca acgatagcac aaaatgtcat catgaacatc 360 accatggtag
ccatggtcaa cagcacaagc cctcaatccc agctcaatga ttcctctgag 420
gtgctgcctg ttgactcatt tggtggccta agtaaagccc caaagagtct tcctgcaaag
480 tcctcaatac ttgggggtca gtttgcaatt tgggaaaggt ggggccctcc
acaagaacga 540 agcagactct gcagcattgc tttatcagga atgttactgg
gatgctttac tgccatcctc 600 ataggtggct tcattagtga aacccttggg
tggccctttg tcttctatat ctttggaggt 660 gttggctgtg tctgctgcct
tctctggttt gttgtgattt atgatgaccc cgtttcctat 720 ccatggataa
gcacctcaga aaaagaatac atcatatcct ccttgaaaca acaggtcggg 780
tcttctaagc agcctcttcc catcaaagct atgctcagat ctctacccat ttggtccata
840 tgtttaggct gtttcagcca tcaatggtta gttagcacaa tggttgtata
cataccaact 900 tacatcagct ctgtgtacca tgttaacatc agagacaatg
gacttctatc tgcccttcct 960 tttattgttg cctgggtcat aggcatggtg
ggaggctatc tggcagattt ccttctaacc 1020 aaaaagttta gactcatcac
tgtgaggaaa attgccacaa ttttaggaag tctcccctct 1080 tcagcactca
ttgtgtctct gccttacctc aattccggct atatcacagc aactgccttg 1140
ctgacgctct cttgcggatt aagcacattg tgtcagtcag ggatttatat caatgtctta
1200 gatattgctc caaggtattc cagttttctc atgggagcat caagaggatt
ttcgagcata 1260 gcacctgtca ttgtacccac tgtcagcgga tttcttctta
gtcaggaccc tgagtttggg 1320 tggaggaatg tcttcttctt gctgtttgcc
gttaacctgt taggactact cttctacctc 1380 atatttggag aagcagatgt
ccaagaatgg gctaaagaga gaaaactcac tcgtttatga 1440 agttatccca
ccttggatgg aaaagtcatt aggcaccgta ttgcataaaa tagaaggctt 1500
ccgtgatgaa aataccagtg aaaagatttt tttttcctgt ggctcttttc aattatgaga
1560 tcagttcatt attttattca gacttttttt tgagagaaat gtaagatgaa
taaaaattca 1620 aataaaatga taactaagaa tgc 1643 3 467 PRT Human 3
Met Gln Met Asp Asn Arg Leu Pro Pro Lys Lys Val Pro Gly Phe Cys 1 5
10 15 Ser Phe Arg Tyr Gly Leu Ser Phe Leu Val His Cys Cys Asn Val
Ile 20 25 30 Ile Thr Ala Gln Arg Ala Cys Leu Asn Leu Thr Met Val
Val Met Val 35 40 45 Asn Ser Thr Asp Pro His Gly Leu Pro Asn Thr
Ser Thr Lys Lys Leu 50 55 60 Leu Asp Asn Ile Lys Asn Pro Met Tyr
Asn Trp Ser Pro Asp Ile Gln 65 70 75 80 Gly Ile Ile Leu Ser Ser Thr
Ser Tyr Gly Val Ile Ile Ile Gln Val 85 90 95 Pro Val Gly Tyr Phe
Ser Gly Ile Tyr Ser Thr Lys Lys Met Ile Gly 100 105 110 Phe Ala Leu
Cys Leu Ser Ser Val Leu Ser Leu Leu Ile Pro Pro Ala 115 120 125 Ala
Gly Ile Gly Val Ala Trp Val Val Val Cys Arg Ala Val Gln Gly 130 135
140 Ala Ala Gln Gly Ile Val Ala Thr Ala Gln Phe Glu Ile Tyr Val Lys
145 150 155 160 Trp Ala Pro Pro Leu Glu Arg Gly Arg Leu Thr Ser Met
Ser Thr Ser 165 170 175 Gly Phe Leu Leu Gly Pro Phe Ile Val Leu Leu
Val Thr Gly Val Ile 180 185 190 Cys Glu Ser Leu Gly Trp Pro Met Val
Phe Tyr Ile Phe Gly Ala Cys 195 200 205 Gly Cys Ala Val Cys Leu Leu
Trp Phe Val Leu Phe Tyr Asp Asp Pro 210 215 220 Lys Asp His Pro Cys
Ile Ser Ile Ser Glu Lys Glu Tyr Ile Thr Ser 225 230 235 240 Ser Leu
Val Gln Gln Val Ser Ser Ser Arg Gln Ser Leu Pro Ile Lys 245 250 255
Ala Ile Leu Lys Ser Leu Pro Val Trp Ala Ile Ser Ile Gly Ser Phe 260
265 270 Thr Phe Phe Trp Ser His Asn Ile Met Thr Leu Tyr Thr Pro Met
Phe 275 280 285 Ile Asn Ser Met Leu His Val Asn Ile Lys Glu Asn Gly
Phe Leu Ser 290 295 300 Ser Leu Pro Tyr Leu Phe Ala Trp Ile Cys Gly
Asn Leu Ala Gly Gln 305 310 315 320 Leu Ser Asp Phe Phe Leu Thr Arg
Asn Ile Leu Ser Val Ile Ala Val 325 330 335 Arg Lys Leu Phe Thr Ala
Ala Gly Phe Leu Leu Pro Ala Ile Phe Gly 340 345 350 Val Cys Leu Pro
Tyr Leu Ser Ser Thr Phe Tyr Ser Ile Val Ile Phe 355 360 365 Leu Ile
Leu Ala Gly Ala Thr Gly Ser Phe Cys Leu Gly Gly Val Phe 370 375 380
Ile Asn Gly Leu Asp Ile Ala Pro Arg Tyr Phe Gly Phe Ile Lys Ala 385
390 395 400 Cys Ser Thr Leu Thr Gly Met Ile Gly Gly Leu Ile Ala Ser
Thr Leu 405 410 415 Thr Gly Leu Ile Leu Lys Gln Asp Pro Glu Ser Ala
Trp Phe Lys Thr 420 425 430 Phe Ile Leu Met Ala Ala Ile Asn Val Thr
Gly Leu Ile Phe Tyr Leu 435 440 445 Ile Val Ala Thr Ala Glu Ile Gln
Asp Trp Ala Lys Glu Lys Gln His 450 455 460 Thr Arg Leu 465 4 560
PRT Rat 4 Met Glu Phe Arg Gln Glu Glu Phe Arg Lys Leu Ala Gly Arg
Ala Leu 1 5 10 15 Gly Arg Leu His Arg Leu Leu Glu Lys Arg Gln Glu
Gly Ala Glu Thr 20 25 30 Leu Glu Leu Ser Ala Asp Gly Arg Pro Val
Thr Thr His Thr Arg Asp 35 40 45 Pro Pro Val Val Asp Cys Thr Cys
Phe Gly Leu Pro Arg Arg Tyr Ile 50 55 60 Ile Ala Ile Met Ser Gly
Leu Gly Phe Cys Ile Ser Phe Gly Ile Arg 65 70 75 80 Cys Asn Leu Gly
Val Ala Ile Val Ser Met Val Asn Asn Ser Thr Thr 85 90 95 His Arg
Gly Gly His Val Val Val Gln Lys Ala Gln Phe Asn Trp Asp 100 105 110
Pro Glu Thr Val Gly Leu Ile His Gly Ser Phe Phe Trp Gly Tyr Ile 115
120 125 Val Thr Gln Ile Pro Gly Gly Phe Ile Cys Gln Lys Phe Ala Ala
Asn 130 135 140 Arg Val Phe Gly Phe Ala Ile Val Ala Thr Ser Thr Leu
Asn Met Leu 145 150 155 160 Ile Pro Ser Ala Ala Arg Val His Tyr Gly
Cys Val Ile Phe Val Arg 165 170 175 Ile Leu Gln Gly Leu Val Glu Gly
Val Thr Tyr Pro Ala Cys His Gly 180 185 190 Ile Trp Ser Lys Trp Ala
Pro Pro Leu Glu Arg Ser Arg Leu Ala Thr 195 200 205 Thr Ala Phe Cys
Gly Ser Tyr Ala Gly Ala Val Val Ala Met Pro Leu 210 215 220 Ala Gly
Val Leu Val Gln Tyr Ser Gly Trp Ser Ser Val Phe Tyr Val 225 230 235
240 Tyr Gly Ser Phe Gly Ile Phe Trp Tyr Leu Phe Trp Leu Leu Val Ser
245 250 255 Tyr Glu Ser Pro Ala Leu His Pro Ser Ile Ser Glu Glu Glu
Arg Lys 260 265 270 Tyr Ile Glu Asp Ala Ile Gly Glu Ser Ala Lys Leu
Met Asn Pro Val 275 280 285 Thr Lys Phe Asn Thr Pro Trp Arg Arg Phe
Phe Thr Ser Met Pro Val 290 295 300 Tyr Ala Ile Ile Val Ala Asn Phe
Cys Arg Ser Trp Thr Phe Tyr Leu 305 310 315 320 Leu Leu Ile Ser Gln
Pro Ala Tyr Phe Glu Glu Val Phe Gly Phe Glu 325 330 335 Ile Ser Lys
Val Gly Leu Val Ser Ala Leu Pro His Leu Val Met Thr 340 345 350 Ile
Ile Val Pro Ile Gly Gly Gln Ile Ala Asp Phe Leu Arg Ser Arg 355 360
365 His Ile Met Ser Thr Thr Asn Val Arg Lys Leu Met Asn Cys Gly Gly
370 375 380 Phe Gly Met Glu Ala Thr Leu Leu Leu Val Val Gly Tyr Ser
His Ser 385 390 395 400 Lys Gly Val Ala Ile Ser Phe Leu Val Leu Ala
Val Gly Phe Ser Gly 405 410 415 Phe Ala Ile Ser Gly Phe Asn Val Asn
His Leu Asp Ile Ala Pro Arg 420 425 430 Tyr Ala Ser Ile Leu Met Gly
Ile Ser Asn Gly Val Gly Thr Leu Ser 435 440 445 Gly Met Val Cys Pro
Ile Ile Val Gly Ala Met Thr Lys His Lys Thr 450 455 460 Arg Glu Glu
Trp Gln Tyr Val Phe Leu Ile Ala Ser Leu Val His Tyr 465 470 475 480
Gly Gly Val Ile Phe Tyr Gly Val Phe Ala Ser Gly Glu Lys Gln Pro 485
490 495 Trp Ala Glu Pro Glu Glu Met Ser Glu Glu Lys Cys Gly Phe Val
Gly 500 505 510 His Asp Gln Leu Ala Gly Ser Asp Glu Ser Glu Met Glu
Asp Glu Val 515 520 525 Glu Pro Pro Gly Ala Pro Pro Ala Pro Pro Pro
Ser Tyr Gly Ala Thr 530 535 540 His Ser Thr Val Gln Pro Pro Arg Pro
Pro Pro Pro Val Arg Asp Tyr 545 550 555 560 5 272 DNA Artificial
Sequence Oligonucleotide 5 atttatatca atgtcttaga tattgctcca
aggtattcca gttttctcat gggagcatca 60 agaggatttt cgagcatagc
acctgtcatt gtacccactg tcagtggatt tcttcttagt 120 caggaccctg
agtttgggtg gaggaatgtc ttcttcttgc tgtttgccgt taacctgtta 180
ggactactct tctacctcat atttggagaa gcagatgtcc aagaatgggc taaagagaga
240 aaactcactc gtttatgaag ttatcccacc tt 272 6 25 DNA Artificial
Sequence Primer 6 cttgatgctc ccatgagaaa actgg 25 7 25 DNA
Artificial Sequence Primer 7 aggattttcg agcatagcac ctgtc 25
* * * * *