DNA vaccines encoding antigen linked to a domain that binds CD40

Abstract

Vaccines that target one or more antigens to a cell surface receptor improve the antigen-specific humoral and cellular immune response. Antigen(s) linked to a domain that binds to a cell surface receptor are internalized, carrying antigen(s) into an intracellular compartment where the antigen(s) are digested into peptides and loaded onto MHC molecules. T cells specific for the peptide antigens are activated, leading to an enhanced immune response. The vaccine may comprise antigen(s) linked to a domain that binds at least one receptor or a DNA plasmid encoding antigen(s) linked to a domain that binds at least one receptor. A preferred embodiment of the invention targets HIV-1 env antigen to the CD40 receptor, resulting in delivery of antigen to CD40 positive cells, and selective activation of the CD40 receptor on cells presenting HIV-1 env antigens to T cells.

Description

CROSS REFERENCE TO RELATED APPLICATIONS

[0001] This application is entitled to the benefit of Provisional Patent Application Ser. No. 60/159,690, filed 1999 Oct. 14.

BACKGROUND

[0002] 1. Field of Invention

[0003] This invention relates to DNA vaccines, specifically to improved DNA vaccines that induce strong antigen-specific humoral and cellular immune responses.

[0004] 2. Description of Prior Art

[0005] DNA immunization, the inoculation of plasmid DNA encoding a microbial or tumor antigen, is a recent addition to vaccine technology (Donnelly J. J. et al, Ann. Rev. Immunol. 15: 617-648, 1997; Letvin N. L., Science 280: 1875-1879, 1998). Both cellular and humoral immune responses occur after DNA vaccination, and protective immunity against microbial challenge is sometimes induced in experimental animals (Ulmer J. B. et al, Vaccine 12: 1541-1544, 1994; Yokoyama M. et al, J. Virol. 69: 2684-2688, 1995; Xiang Z. Q. et al, Virology 199: 132-140, 1994; Sedegah M. et al, Proc. Natl. Acad. Sci. USA 91: 9866-9870, 1994; Montgomery D. L. et al, DNA Cell Biol. 12: 777-783, 1993). T cell responses, including CD8+ cytotoxic T lymphocyte (CTL) and CD4+ T helper cells, can be stimulated by DNA vaccination in response to antigenic peptides presented by class I and class II MHC molecules (Whitton J. L. et al, Vaccine 17: 1612-1619, 1999). Endogenous protein synthesis allows presentation of foreign antigenic peptides by MHC class I, whereas uptake of soluble protein by APC is required for presentation of peptides by MHC class II. Both arms of the immune response can therefore be induced after DNA vaccination, but the pathways for antigen processing and presentation are distinct for peptides presented by MHC class I or MHC class II. This conclusion is derived from experiments using DNA encoding ubiquitinated protein that is rapidly targeted to intracellular degradation by proteosomes. Ubiquitinated antigen that was degraded so rapidly that intact protein could not leave the cell led to enhanced production of CTL in vivo, but completely eliminated antibody production (Rodriguez F. et al, J. Virol. 71: 8497-8503, 1997; Wu Y. and Kipps T. J., J. Immunol. 159: 6037-6043, 1997). Thus a major limitation of DNA vaccines is their inability to induce strong and sustained humoral immune responses. Strategies for optimization of the cellular immune response to DNA vaccines that do not reduce humoral immune responses are needed.

[0006] DNA vaccines for HIV-1 have been tested in animal models and found to induce an immune response that provides protection against challenge only when the virulence of the viral isolate is low. In benign challenge models, chimpanzees were protected from live virus exposure by vaccination with plasmid DNA or by subunit antigens or peptides (Boyer J. D. et al, Nat. Med. 3:526-532, 1997; Kennedy R. C., Nat. Med. 3: 501-502, 1997). However, when highly virulent SIV was tested in rhesus macaques, DNA vaccination was not protective and could only achieve a reduction in virus load even when multiple doses of DNA were inoculated through multiple routes (Lu S. et al, J. Virol. 70: 3978-3991, 1996). Therefore, enhancing the immune response to DNA immunization is an important goal of current AIDS vaccine research. Enhancing the immune response to other DNA vaccines is also desirable in order to provide protection when infected with highly virulent organisms or with a high infectious dose, and to provide long lasting protection. Enhancing the immune response to DNA vaccines encoding tumor antigens is also important for maximizing the anti-tumor response.

[0007] One strategy that has been tested is to prime with a DNA vaccine followed by boosting with protein antigen. However, this approach requires construction of multiple vaccines for the same infection or disease, and depends upon multiple injections given in a precise order. It would be desirable to induce protective immunity without needing multiple forms of a vaccine, and without requiring alternating injections of DNA and protein.

[0008] Chemical and genetic approaches to enhance the immune response to DNA vaccines have been studied. Chemical adjuvants with some activity include monophosphoryl lipid A (Sasaki S. et al, Infect. Immun. 65: 3520-3528, 1997), saponin QS-21 (Sasaki S et al, J. Virol. 72: 4931-4939, 1998), mannan-coated liposomes (Toda S et al, Immunology 92: 111-117, 1997), and the aminopeptidase inhibitor ubenimex (Sasaki S et al, Clin. Exp. Immunol. 11: 30-36, 1998). Each of these adjuvants modestly enhanced both antibody titers and CTL activity after DNA vaccination in mice. Although the mechanism of action of chemical adjuvants is not fully elucidated, they seem to work by induction of cytokines that amplify responses, by recruitment of macrophages and other lymphoid cells at sites of DNA administration, or by facilitating entry of DNA into host cells (Sasaki S. et al, Anticancer Research 18: 3907-3916, 1998). Several genetic approaches to enhancing responses to DNA vaccines have been tested, including administration of a gene encoding a cytokine (IL2, IL12, GM-CSF, TCA3, MIP-1.alpha.) (Chow Y.-H. et al, J. Virol. 71: 169-178,1997; Hwee Lee A. et al, Vaccine 17: 473-479, 1998; Tsuji T. et al, Immunol.158: 4008-4014, 1997; Rodriguez D. et al, Gen.Virol.80: 217-223, 1999; Tsuji T. et al, Immunology 90: 1-6, 1997; Lu Y. et al, Clin. Exp. Immunol. 115: 335-341,1999) or a costimulatory adhesion receptor (CD86, CD58, CD54) (Tsuji T. et al, Eur. J. Immunol. 27: 782-787, 1997; Kim J. J. et al, J. Clin. Invest. 103: 869-877, 1999; Iwasaki A. et al, J. Immunol. 158: 4591-4601, 1997). Each of these cytokine and adhesion receptor genes increased immune responses to DNA vaccination, with some treatments enhancing CTL generation only, and some enhancing both CTL and antibody production. However, the levels of enhancement of the immune response to DNA vaccination obtained from these approaches are modest and not sustained, so it is important to find additional ways to enhance the immune response to DNA vaccines.

[0009] The CD40 receptor must be activated for an effective cellular or humoral immune response after exposure to antigen (Grewal I. S., and Flavell R. A., Annu. Rev. Immunol 16: 111-135, 1998). This conclusion is derived from multiple findings, including the phenotype of patients with hyper IgM (HIGM) syndrome that results from CD154 genetic defects (Aruffo A. et al, Cell 72: 291-300,1993; Fuleihan R. et al, Proc. Natl. Acad. Sci. USA 90: 2170-2173,1993; Korthauer U. et al, Nature 361: 539-541,1993), the phenotype of mice with CD40 or CD154 gene disruption (Grewal I. S. et al, Science 273: 1864-1867,1996; Kawabe T. et al, Immunity 1: 167-178,1994; Renshaw B. et al, J. Exp. Med. 180: 1889-1900,1994; Xu J. et al, Immunity 1: 423-431, 1994), and the effects of actively blocking CD40 in vivo using inhibitory antibodies to CD154 (Durie F. H. et al, Science 261: 1328-1330,1993; Foy T. M. et al, J. Exp. Med. 178: 1567-1575, 1993; Foy T. M. et al, J. Exp. Med. 180: 157-163,1994; Durie F. H. et al, J. Clin. Invest. 94: 1333-1338, 1994; Gerritsse K. et al, Proc. Nat. Acad. Sci. USA 93: 2499-2504, 1996). CD40 is expressed in several cell lineages, including B cells, dendritic cells, monocytes, epithelial cells, and endothelial cells. CD40 transmits signals for each of these cell types that regulates activation and differentiation (Hollenbaugh D. et al, EMBO J. 11: 4313-4321,1992; Kiener P. A. et al, J. Immunol. 155: 4917-4925,1995; Cella M. et al, J. Exp. Med. 184: 747-752,1996; Galy A. H., and Spits H., J. Immunol. 152: 775-782,1992; Clark E. A., and Ledbetter J. A., Proc. Natl. Acad. Sci. USA 83: 4494-4498, 1986). CD40 is activated by crosslinking during cell to cell contact with cells expressing CD40 ligand (CD154), primarily T cells. While soluble forms of CD154 can stimulate CD40, no attempts have been made to use or modify soluble CD154 to promote immune responses to antigens.

[0010] CD40 signals to B cells are required for isotype switching and affinity maturation through somatic mutation Rousset F. et al, J. Exp. Med. 173: 705-710, 1991). In the absence of CD40 signals, germinal centers, the specialized sites of B cell maturation, are not formed, and B cells are unable to differentiate into IgG producing plasma cells (Foy T. M. et al, J. Exp. Med. 180: 157-163, 1994). Patients with HIGM syndrome are not able to form germinal centers or produce IgG antibodies after antigen challenge, and the same phenotype is seen in knockout mice where CD40 or CD154 is not expressed. The CD40 signal has been shown in vitro to promote survival of surface Ig-activated B cells, and to interact with signals from cytokines to induce immunoglobulin isotype switching to IgG, IgA, and IgE production (Holder M. J. et al, Eur. J. Immunol 23: 2368-2371,1993; Jabara H. H. et al, J. Exp. Med. 177: 925-935,1990; Grabstein K. H. et al, J. Immunol. 150: 3141-3147, 1993). In addition, HIGM syndrome patients and CD154 knockout mice have impaired lymphocyte proliferation in response to diphtheria toxoid, tetanus, and Candida, showing that the CD40 signal is required for T cell priming to protein antigens (Grewal I. S., and Flavell R. A., Annu. Rev. Immunol 16: 111-135, 1998; Toes R. E. M. et al, Sem. Immun. 10: 443-448,1998; Grewal I. S. et al, Nature 378: 617-620,1995; Ameratunga R. et al, J. Pediatr. 131: 147-150,1997; Subauste C. S. et al, J. Immunol. 162: 6690-6700, 1999). Expression of CD154 in vivo to enhance immune responses utilized only the cell surface form of the molecule and resulted in significant toxicity in experimental animals, including induction of lethal autoimmune disease and T cell malignancies (Roskrow M. A et al, Leukemia Research 23: 549-557, 1999; Brown M. P. et al, Nature Medicine 4: 1253-1260, 1998).

[0011] In neonates, insufficient stimulation of CD40 due to low levels of expression of CD154 by activated T cells has been identified as a factor in the inability of infants to produce IgG antibodies towards bacterial antigens (Nonoyama S. et al, J. Clin. Invest. 95: 66-75, 1995; Fuleihan R. et al, Eur. J. Immunol. 24: 1925-1928, 1994; Brugnoni D. et al, Eur. J. Immunol. 24: 1919-1924, 1994). This suggests that CD40 signals are not ubiquitous and that highly restricted expression of CD154 may limit the extent of CD40 signaling and thus the magnitude and quality of an immune response. Direct evidence in support of this idea comes from a recent study where a modest increase (1.1-2 fold) in expression of cell surface CD154 in the thymus of mice resulted in a>10 fold increase in the antigen-specific antibody response (Prez-Melgosa M. et al, J. Immunol. 163: 1123-1127, 1999). Some evidence suggests that CD40 stimulation may be deficient in HIV-1 infected individuals, since HIV gp120 suppressed the expression of CD154 by activated T cells in vitro, and production of IL12 is defective in HIV-1 positive individuals (Chirmule N. et al, J. Immunol. 155: 917-924, 1995; Taoufik Y. et al, Blood 89: 2842-2848, 1997; Yoo J. et al, J. Immunol. 157: 1313-1320, 1996; Ito M. et al, AIDS Res. Hum. Retroviruses 14: 845-849, 1998; Benyoucef S. et al, J. Med. Virol. 55: 209-214, 1998). In addition, CD40 stimulation of dendritic cells infected with HIV-1 was found to suppress virus replication, suggesting that transmission of HIV-1 from infected dendritic cells during antigen presentation could be blocked by CD40 signals (McDyer J. F. et al, J. Immunol. 162: 3711-3717, 1999). However, a method for stimulation of CD40 on cells actively presenting antigen to T cells while avoiding toxicity from unregulated CD40 stimulation is needed.

[0012] CD40 signals to dendritic cells or B cells causes their differentiation from an antigen uptake function to an antigen processing and presentation function (Sallusto D. et al, J. Exp. Med. 182: 389-400, 1995; Cella M. et al, J. Exp. Med. 184: 747-752, 1996; Faassen A. E. et al, Eur. J. Immunol. 25: 3249-3255, 1995). This shift is accompanied by reduction of the MHC class II intracellular compartment, increased expression of MHC class II on the cell surface, secretion of the Th1 regulatory cytokine IL12 and increased expression of CD86 and CD80. After CD40 activation, dendritic cells and B cells are able to more efficiently present antigen and give a critical costimulatory signal through CD28. The production of IL12 leads to enhanced secretion of IFN.gamma. by T cells and suppression of Th2 cytokine production. The CD40 signal is therefore an important mediator of Th1 cellular immunity and CTL induction. However, selective stimulation of CD40 during antigen presentation is needed to enhance immune responses to vaccination.

[0013] In addition to B cells and dendritic cells, CD40 is functionally active on other APC's such as monocytes, where CD40 signals prevent cell death from apoptosis and induce expression of adhesion molecules and production of inflammatory cytokines TNF.alpha. and IL8 (Kiener P. A. et al, J. Immunol. 155: 4917-4925, 1995). CD40 has also been reported to be expressed and functionally active on thymic epithelial cells (Galy A. H., and Spits H., J. Immunol. 152: 775-782, 1992) and on many kinds of tumor cells, including carcinomas, melanomas, and lymphomas (Ledbetter J. A. et al, In Leucocyte Typing III: White Cell Differentiation Antigens p.432-435, 1987; Oxford University Press, Oxford, U. K.; Paulie S. et al, Cancer Immunol. Immunother. 20: 23-28, 1985). In contrast to most normal cells where the CD40 signal enhances survival, in many malignant cells CD40 actively promotes death by apoptosis. Therefore CD40 is functionally active in all cell types that express the receptor, and CD40 signals are central to fundamental processes of survival and differentiation. Because of the widespread expression of functional CD40, localized stimulation of CD40 positive cells that present specific antigen to T cells is desirable so that only APC involved in the specific immune response are activated.

[0014] Studies in CD154 knockout mice have confirmed the importance of CD40 activation for the antigen specific priming of T cells. CD154 deficient mice have an enhanced susceptibility to Leishmania major and Toxoplasma gondii infection, consistent with a central role for CD40 in cellular immunity (Subauste C. S. et al, J. Immunol. 162: 6690-6700, 1999; Campbell K. A. et al, Immunity 4: 283-289, 1996). CTL generation after viral infection in CD154 deficient mice is markedly blunted, and induction of experimental allergic encephalomyelitis (EAE) in response to myelin basic protein does not occur (Grewal I. S. et al, Science 273: 1864-1867, 1996; Grewal I. S. et al, 378: 617-620, 1995). The defect in T cell priming in these models appears to be due to an inability of APC to provide costimulatory signals to T cells (Grewal I. S. et al, Science 273: 1864-1867, 1996; Yang Y. and Wilson J. M., Science 273: 1862-1867, 1996).

[0015] Inhibition of CD40 in vivo has been studied in mice using a mAb, MR1, that binds and blocks the CD40 ligand, CD154 (Durie F. H. et al, Science 261: 1328-1330, 1993; Foy T. M. et al, J. Exp. Med. 178: 1567-1575, 1993; Foy T. M. et al, J. Exp. Med. 180: 157-163, 1994; Durie F. H. et al, J. Clin. Invest. 94: 1333-1338, 1994; Gerritsse K. et al, Proc. Nat. Acad. Sci. USA 93: 2499-2504, 1996). These experiments demonstrated that anti-CD154 prevents the induction of autoimmune diseases, including EAE after immunization with myelin basic protein, oophritis after immunization with zona pelucida antigen (ZP3), and spontaneous disease in lupus prone mice (Griggs N. D. et al, J. Exp. Med. 183: 801-807, 1996; Daikh D. I. et al, J. Immunol. 159: 3104-3108, 1997). Anti-CD154 was also effective in preventing both chronic and acute graft versus host (GVH) disease and in preventing rejection of heart allografts after transplantation (Larsen C. P. et al, Nature 381: 434-438, 1996). Thus, CD40 signals are required for T cell responses to antigen, and restriction of the CD40 signal with specific inhibitors is an effective method of limiting T cell priming during an immune response.

[0016] The CD40 receptor is therefore a proven target for regulation of antigen specific immunity. While biological inhibitors of CD40 have been studied extensively in mice and in nonhuman primates, there is a need for localized stimulation of CD40 on cells that present antigens to T cells in order to improve the effectiveness of vaccines.

[0017] Gp160, the product of the HIV-1 env gene, is cleaved in the Golgi complex into gp120 and gp41 proteins that remain associated through noncovalent interactions. Most neutralizing epitopes of the virus are located on gp120 and gp41, and are expressed by the intact env complex that has been shown to be a trimer (Kwong P. D. et al, Nature 393: 648-659, 1998). Monomeric gp120 can be released from the complex and expose immunodominant epitopes that are non-neutralizing and are located on the internal face of gp120 in the intact trimeric complex (Wyatt R. et al, Nature 393: 705-711, 1998; Broder C. C. et al, PNAS USA 91: 11699-11703, 1994). Thus, stabilization of the env complex is needed for an HIV-1 vaccine in order to preserve conformational epitopes important for neutralization and to mask immunodominant epitopes that are not relevant for neutralization of the env complex.

[0018] One attempt to produce a stable, properly folded gp120-gp41complex was made by altering the cleavage site in gp160 between the gp120 and gp41 domains (Earl P. L. et al, J. Virol. 68: 3015-3026, 1994). By introducing a stop codon before the transmembrane domain of gp41, a soluble molecule composed of gp120 and the extracellular domain of gp41 was produced as a complex that folds properly to bind the CD4 receptor and to express some conformational epitopes. However, this molecule formed dimers and multimers rather than the stable trimers that comprise the native structure of the envelope glycoprotein as revealed in the crystal structure of the gp120 complex.

[0019] Three major sites of gp120 have been identified that are involved in cross-neutralization of diverse viral strains (Wyatt R. et al, Nature 393: 705-711, 1998). The V3 domain was found to express linear and conformational epitopes that can be recognized by antibodies that neutralize HIV-1. Although the V3 domain is a variable region, it contains a central portion shared by many HIV-1 isolates, particularly those found in the United States and Europe. The central portion has been called the principle neutralization epitope and is formed from a linear epitope of the amino acid sequence GPGRAF (Broliden P. A. et al, Proc. Natl. Acad. Sci. USA 89: 461-465, 1992; Broliden P. A. et al, Immunol. 73: 371-376, 1991; Javaherian K. et al, Science 250: 1590-1593, 1990; Javaherian K. et al, Proc. Natl. Acad. Sci. USA 86: 6768-6772, 1989). Conformational epitopes of the V3 loop have also been identified that can be recognized by antibodies that are more broadly neutralizing.

[0020] The CD4 binding domain of gp120 is another neutralization site for antibodies directed to HIV-1 env. This domain is a nonlinear, conformational site that depends upon proper folding of gp120 (Kang C.-Y. et al, Proc. Natl. Acad. Sci. USA: 6171-6175, 1991; Lasky L. A. et al, Cell 50: 975-985, 1987). Antibodies can recognize distinct portions of the CD4 binding domain, and may have either type-specific or cross-neutralization properties (Pinter A. et al, AIDS Res. Hum. Retro. 9: 985-996, 1993). Although monomeric gp120 can retain CD4 binding function, a stable trimeric structure of gp120 is thought to be important for masking immunodominant epitopes that are expressed on the internal face of the intact complex (Wyatt R. et al, Nature 393: 705-711, 1998). A third domain of gp120 involved in virus neutralization is exposed upon binding to CD4, and functions to bind the chemokine coreceptor to allow virus entry into the cell (Rizzuto C. D. et al, Science 280: 1949-1953, 1998). Thus a stable trimer of HIV-1 env is needed to present the major cross-neutralization epitopes and to prevent exposure of internal, immunodominant epitopes that do not induce neutralizing antibodies.

[0021] CD154 is a TNF-related, type II membrane protein that forms stable trimers (Mazzei G. J. et al, J. Biol. Chem. 270: 7025-7028, 1995). Soluble fusion proteins of human CD154 have been expressed using murine CD8 at the amino terminal side of the CD154 molecule (Hollenbaugh D. et al, EMBO J. 11: 4313-4321, 1992). Single chain Fv (scFv) molecules have also been constructed using heavy and light chain variable regions cloned from the G28-5 hybridoma that produces antibody specific for human CD40 (Ledbetter J. A. et al, Crit. Rev. Immunol.17: 427-435, 1997). Both CD154 and G28-5 scFv fusion proteins retain functional activity as soluble molecules in vitro. However, no use of these molecules to improve the effectiveness of vaccines has been found.

SUMMARY

[0022] For vaccines to be effective, they must induce both humoral and cellular immune responses. This invention describes improved vaccines that target antigens to cell surface receptors. DNA vaccines are a recent addition to immunization technology. However, further optimization of DNA vaccines is needed to induce long-lasting protection against tumor antigens, virulent HIV-1 isolates, and other pathogenic microorganisms. Receptor activation and targeting improves the ability of DNA vaccines to generate strong cellular immunity and high titers of neutralizing antibodies. CD40 is a preferred receptor for targeting and activation. DNA vaccines encoding CD40 ligand (CD154) or a single chain Fv (scFv) specific for CD40, fused with DNA encoding portions of the HIV-1 env protein are preferred embodiments of the invention. A molecule comprising the extracellular domain of HIV-1 env gp160 or env gp120 linked to the extracellular domain of CD154 is a stable trimer that improves immune recognition of HIV-1 env cross-neutralization epitopes. After DNA vaccination, the expression of the fusion protein in vivo results in both activation of the CD40 receptor and direction of HIV-1 env antigens into the endocytic pathway of CD40 positive antigen presenting cells (APC). Internalization of env antigens after binding the CD40 receptor enhances presentation of peptides by MHC molecules. Activation of the CD40 receptor promotes B cell and APC maturation leading to effective antibody production and generation of CD4+ helper T cell and CD8+ CTL activity. The combination of CD40 activation, stabilization of the HIV-1 gp160 or gp120 env trimer, and enhanced presentation of antigenic peptides by MHC molecules thus improves immune responses to HIV-1 antigens. Protein molecules of the invention can be injected directly into mammals or encoded by DNA vaccines.

DRAWINGS

[0023] FIG. 1.

[0024] Schematic representation of fusion proteins that target antigen to cell surface receptors expressed by antigen presenting cells. [0025] A. A fusion protein expressed from a cDNA construct that encodes an antigen domain attached with a linker to a receptor targeting domain. The antigen domain may be attached to the amino terminus of the receptor targeting domain as shown, or may be attached to the carboxy terminus of the receptor targeting domain. [0026] B. A fusion protein expressed from a cDNA construct that encodes the HIV env antigen or a subdomain, is attached to the amino terminus of the CD154 extracellular domain. [0027] C. A fusion protein expressed from a cDNA construct that encodes the HIV env antigen or a subdomain, is attached to the amino terminus of a single chain Fv specific for CD40. [0028] D. A fusion protein expressed from a cDNA construct as in C, except that the scFv that binds CD40 is oriented with the light chain variable region (V.sub.L) attached to the carboxy-terminus of the heavy chain variable region (V.sub.H). [0029] E. A fusion protein expressed from a cDNA construct that encodes the HIV env antigen or a subdomain, is attached to a camelid variable region (V.sub.HH) that binds CD40. [0030] F. A fusion protein expressed from a cDNA construct that encodes the HIV env antigen or a subdomain, is attached to a peptide that binds CD40.

[0031] FIG. 2.

[0032] A. Sequence of two cDNAs encoding HIV gp120-V3 loop/CD154 long form extracellular domain fusion proteins. [0033] The sequence of a cDNA construct and corresponding fusion protein encoding the HIV V3 loop from gp120 with a (ProAspPro) linker (SEQUENCE ID NO.: 17 [DNA] OR SEQUENCE ID NO.: 25 [FUSION PROTEIN]) or a (Gly.sub.4Ser).sub.3 linker (SEQ. ID NO.: 16 [DNA] OR SEQ. ID NO.:24 [FUSION PROTEIN]) fused to the CD154 extracellular domain encoded between amino acids 48 (Arg)-261(Leu), with an additional (Glu) residue at the carboxyl end oft he protein, not present in wild type CD154. The sequence of the fusion protein is indicated using the three-letter amino acid code convention, above each codon of the open reading frame. Relevant restriction sites are indicated on the drawing and the nucleotides encoding sites at domain fusion junctions are displayed in boldface type, while the first codon of each fused domain is indicated in underlined, italicized type. The protein domains are labeled above the relevant position in the sequence. The nucleotide number is indicated in the left margin with a designation for the PDP linker form or the G4S linker form.

[0034] B. Sequence of two cDNAs encoding HIV V3 loop-CD154 short form extracellular domain fusion proteins. [0035] The two HIV V3 loop constructs with alternate linkers, either (ProAspPro) (SEQUENCE ID NO.:19 [DNA] OR SEQUENCE ID NO.: 27 [FUSION PROTEIN]) or (Gly.sub.4Ser).sub.3 (SEQUENCE ID NO.: 18 [DNA] OR SEQUENCE ID NO.: 26 [FUSION PROTEIN]) were also fused to the short form of the CD154 extracellular domain encoded from amino acids 108 (Glu)-261 (Leu) plus an extra glutamic acid residue at the carboxy terminus, not encoded by wild type CD154. All sequences are labeled as described for FIG. 2A.

[0036] FIG. 3. [0037] A. Sequence of two HIV gp120env-CD154 long form extracellular domain cDNA and the predicted fusion proteins. [0038] The sequence of a cDNA construct and corresponding fusion protein encoding the HIV gp120 with a (ProAspPro) linker (SEQ. ID NO.: 13 [DNA] OR SEQ. ID NO.: 21 [FUSION PROTEIN]) or a (Gly.sub.4Ser).sub.3 linker (SEQ. ID NO.: 12 [DNA] OR SEQ. ID NO.: 20 [FUSION PROTEIN]) fused to the CD154 extracellular domain (Long Form) encoded between amino acids 48 (Arg)-261(Leu)+(Glu). All sequences are labeled as described for FIG. 2A. [0039] B. Sequence of two HIV gp120env-CD154 short form extracellular domain cDNAs and the predicted fusion proteins. [0040] The sequence of a cDNA construct and corresponding fusion protein encoding the HIV gp120 with a (ProAspPro) linker (SEQ. ID NO.: 15 [DNA] or SEQ. ID NO.: 23 [fusion protein]) or a (Gly4Ser)3 linker (SEQ. ID NO.: 14 [DNA] or SEQ. ID NO.: 22 [fusion protein]) fused to the short form of the CD154 extracellular domain encoded between amino acids 108 (Glu)-261 (Leu)+(Glu). All sequences are labeled as described for FIG. 2A.

DESCRIPTION

[0041] This invention relates to improved vaccines comprising one or more antigens attached to a domain that targets at least one cell surface receptor. The vaccine may be delivered either as a protein, as a DNA plasmid, or by a viral vector. The expression of the DNA after injection of the plasmid or viral vector in vivo results in the secretion of the antigen(s) attached to a targeting domain, directing the antigen(s) to a cell surface receptor. Receptor-mediated internalization of the antigen into the endocytic compartment of cells that express the receptor enhances the presentation of antigenic peptides by MHC class II molecules that circulate through this compartment. [0042] Presentation of antigenic peptides by MHC class I molecules is mediated by the cells expressing the DNA vaccine, and is enhanced in cells that internalize the antigen-targeting domain fusion protein by movement of the fusion protein from the endocytic compartment into the cytoplasm. The activation of antigen-specific CD4+ T cells and CD8+ T cells is increased, resulting in better humoral and cellular immune responses.

[0043] The preferred receptor(s) chosen for antigen targeting are those expressed by antigen presenting cells (APC), such as dendritic cells. Desirable receptors for targeting include but are not limited to CD80, CD86, CD83, CD40, CD32, CD64, Flt3, Dec 205, and ICOS ligand. The CD40 receptor is a preferred receptor for antigen targeting, since signals from CD40 regulate activation and differentiation of APC. Fusion proteins of antigen and CD154 (CD40 ligand) combine the functions of antigen targeting and activation of APC by simultaneous delivery of CD40 signals.

[0044] The preferred antigen(s) for receptor targeting are HIV-1 and HIV-2 viral antigens, since vaccines have not been effective in protecting against virulent viral isolates. Attachment of HIV-1 gp160 or gp120 extracellular domain to CD154 extracellular domain stabilizes the trimeric structure of HIV-1 env. However, the invention is not limited to HIV env antigens, since improved immune responses to vaccines are needed to provide long-lasting protection against infection with high doses of pathogenic microorganisms or against tumors.

[0045] Thus the structure of the invention's main embodiment is a DNA plasmid encoding the extracellular domain of HIV-1 env gp160 attached to the CD154 extracellular domain.

[0046] The fusion protein expressed from this DNA plasmid a) stabilizes the trimeric structure of HIV-1 env, b) directs the HIV-1 antigen into the MHC class II compartment of CD40 positive cells, and c) selectively activates the CD40 receptor to increase APC functional activity.

[0047] The main embodiment of the invention encodes a stable trimer that expresses the major cross-neutralization epitopes of HIV-1 env while masking the internal env epitopes that are not involved in virus neutralization. Antigenic peptides of HIV env are presented by MHC class I molecules by cells that express the DNA, while antigenic peptides of HIV env are presented by MHC class II molecules in CD40 positive cells that internalize the trimeric antigen-CD154 fusion protein. Activation of the CD40 receptor on cells bound by the antigen-CD154 fusion protein increases the specific immune response due to increased production of IL12 and increased expression of costimulatory molecules CD80 and CD86.

Operation

[0048] An improved DNA vaccine for AIDS comprising the extracellular domain of HIV-1 gp160, HIV-1 gp120, or a subdomain of these antigens fused to the extracellular domain of CD154 is described. Alternative embodiments of the invention use a smaller portion oft he CD154 molecule composed of an 18 kDa subunit from Glu-108 to Leu-261 (Mazzei G. J. et al, J. Biol. Chem. 270: 7025-7028, 1995). The extracellular domain of gp160 can also be shortened by removing the gp41 domain, removing the V2 and V2 domains, or mutating the glycosylation sites without damaging the conformational structure of the HIV-1 envelope (Kwong P. D. et al, Nature 393: 648-659, 1998). These changes could further improve the activity of the vaccine, since the V1 and V2 loops, and the carbohydrate structures are thought to be exposed, clade specific epitopes that prevent or dilute the immune response to important cross-neutralization epitopes for diverse clades of HIV-1. Linkers between gp160 and CD154 can also be used. Thus, alternative embodiments of the invention minimize the CD154 domain, remove gp41, V1, V2, or glycosylation sites of gp160. This invention also envisions DNA vaccines comprising other HIV-1 antigens and antigens from alternative isolates of HIV-1, fused to the extracellular domain of CD154.

[0049] Delivery of antigen(s) to the CD40 receptor may use anti-CD40 scFv instead of CD154. Single antibody variable regions (V.sub.HH) or peptides that bind CD40 are also included in the scope of the invention.

[0050] Antigen targeting to receptors is not limited to the CD40 receptor. Alternative receptors preferred for targeting include CD80, CD86, Dec205, ICOS ligand, Flt 3, Fc receptors, and CD83. All cell surface receptors are envisioned by this invention. Receptors may be targeted by ligands, scFv molecules, single variable regions or peptides. Additional methods of attachment of antigen(s) to receptor targeting domains are envisioned, including chemical linkages of subunits, disulfide bonds, or noncovalent attachments such as leucine zipper motifs and the like. The invention contemplates injection of protein, injection of DNA plasmids, or viral vectors encoding the molecules comprising one or more antigens linked to a receptor-binding domain.

[0051] Antigens targeted to cell surface receptors are not limited to HIV gp160 antigens. Other antigens, including tumor antigens, parasite antigens, bacterial antigens, and viral antigens are included in the scope of the invention.

[0052] The invention also envisions delivery of antigens to cell surface receptors in order to induce antigen-specific tolerance or nonresponsiveness. For this application, an autoantigen would be chosen and the vaccine would be used to treat autoimmune disease.

[0053] The invention also envisions antigen(s) that are natural components of the body, such as tumor-associated antigens, where an immune response to the antigen(s) breaks tolerance to the antigen, resulting in a change in immune homeostasis.

[0054] The following examples describe particular embodiments of the invention but are not meant to limit its scope.

EXAMPLE 1

[0055] A preferred embodiment of the DNA vaccine includes an amino-terminal secretory signal peptide sequence upstream and adjacent to a cDNA sequence cassette encoding the desired antigen. This molecule is then fused to the extracellular domain of CD154 or to a portion of the extracellular domain of CD154 which retains the ability to bind CD40, or to an scFv targeted to CD40, to create a fusion protein expression cassette that targets the antigen to the antigen presenting cell through the CD40 receptor as diagrammed in FIG. 1. The expression cassette is inserted into an appropriate mammalian expression vector or virus to achieve high level expression of the fusion protein either in vitro or in vivo.

[0056] The leader peptide is encoded on complementary oligonucleotides with a single-stranded HindIII cohesive end at the 5' terminus, and a BglII cohesive end at the 3' terminus. The sense oligonucleotide is designated SEQUENCE ID NO: 1 or HBLPS and the sequence is as follows: [0057] 5'agcttgccgccatgctgtatacctctcagctgttaggactacttctgttttggatctcggctt- cga-3'.

[0058] The antisense oligonucleotide is designated SEQUENCE ID NO: 2 or HBLPAS and the sequence is as follows: [0059] 5'gatctcgaagcccgagatccaaaacagaagtagtcctaacagctgagaggtatacagcatggcggca-3'. The two molecules anneal to one another except at the overhanging nucleotides indicated in boldface type. Alternative embodiments could include other secretory signal peptides or localization sequences.

[0060] The extracellular domain of human CD154 was PCR amplified using cDNA generated with random primers and RNA from human T lymphocytes activated with PHA (phytohemagglutinin). Two different fusion junctions were designed which resulted in a short or truncated form (form S4) including amino acids 108 (Glu)-261 (Leu)+(Glu), and a long or complete form (form L2) including amino acids 48 (Arg)-261 (Leu)+(Glu), of the extracellular domain of CD154. The sense primer which fuses the extracellular domain to the targeted antigen includes a BamHI site for cloning that introduces the peptide sequence PDP or (ProAspPro) at the fusion junction and can also encode a linker peptide such as (Gly.sub.4Ser).sub.3 to separate the antigen from the extracellular domain. The oligonucleotide primers used in amplifying the short form (S4) of the CD154 extracellular domain encoding amino acids 108 (Glu)-261 (Leu)+(Glu) are as follows:

[0061] The sense primer is designated SEQUENCE ID NO: 3 or CD154BAM108 and encodes a 34 mer with the following sequence: 5'-gtt gtc gga tcc aga aaa cag ctt tga aat gca a-3', while the antisense primer is designated SEQUENCE ID NO: 4 or CD154XBA and encodes a 44 mer with the following sequence: 5'-gtt gtt tct aga tta tca ctc gag ttt gag taa gcc aaa gga cg-3'.

[0062] The oligonucleotide primers used in amplifying the long form (L2) of the CD154 extracellular domain encoding amino acids 48 (Arg)-261 (Leu)+(Glu), are as follows: [0063] The sense primer is identified as SEQUENCE ID NO: 5 or CD154 BAM48 and encodes a 35 mer with the following sequence: 5'-gtt gtc gga tcc aag aag gtt gga caa gat aga ag-3', while the antisense primer is also SEQUENCE ID NO: 4 or CD154XBA encoding the 44 mer: 5'-gtt gtt tct aga tta tca ctc gag ttt gag taa gcc aaa gga cg-3'.

[0064] A variety of different antigens can be encoded on cDNA cassettes to be inserted between the leader peptide cassette and the CD40 targeted domain (such as a truncated or complete CD154 extracellular domain or a CD40 specific scFv). In a preferred embodiment of the invention, the cDNA antigen encoded by the vaccine is the HIV-1 gp 120 or a fragment of this antigen, such as the V3 loop. The primer sets used to amplify the complete gp120 domain include the sense primer SEQUENCE ID NO: 6 or GP120Bg12f 5'-gga tat tga tga gat cta gtg cta cag-3' and one of two antisense primers encoding different linkers. Either the antisense primer encoding the ProAspPro linker, identified as SEQUENCE ID NO: 7 or GP120PDPr 5'-gaa cac agc tcc tat tgg atc cgg tct ttt ttc tct ttg cac-3' or the antisense primer encoding the (Gly.sub.4Ser).sub.3 linker, identified as SEQUENCE ID NO: 8 or GP120G4Sr 5'-cct gca tgg atc cga tcc gcc acc tcc aga acc tcc acc tcc tga acc gcc tcc ccc tct ttt ttc tct ttg cac tgt tct tct ctt tgc-3' were used to amplify the gp120 domain with the desired linker attached. PV75Kgp160(89.6) DNA was used as template in PCR reactions. Alternatively, other isolates or sequence variants of gp120 or gp160 are available and can be substituted to create novel fusion cassettes. PCR amplification reactions were performed using cloned plasmid DNA as template (approximately 45 ng), 3 mM MgCl.sub.2, 0,3 MM dNTPs, 1/10 volume 10.times. reaction buffer supplied by the manufacturer, 10 pmol sense primer, 10 pmol antisense primer, and 2.5 units TAQ polymerase (Takara Pharmaceuticals) in a total reaction volume of 50 .mu.. The amplification profile included an initial 4 minute 94.degree. C. denaturation, followed by a 30 cycle program of 50.degree. C. annealing for 30 seconds, 72.degree. C. extension for 30 seconds, and 94.degree. C. denaturation for 30 seconds. PCR fragments were purified by ethanol precipitation, resuspended in 30 .mu.l ddH.sub.2O and 10 .mu.l was digested with BglII (Roche) restriction endonuclease in a 20 .mu.l reaction volume at 37.degree. C. for 3 hours. Fragments were gel purified, purified using QIAEX kits according to the manufacturer's instructions (QIAGEN, San Diego, Calif.), and ligated along with the annealed leader peptide oligonucleotides to HindIII-BamHI digested expression vector already containing the CD154 extracellular domain as a BamHI-XbaI fragment. Recombinant clones were screened for the correct orientation and presence of inserts, and the resulting positive clones were verified by DNA sequencing using an ABI 310 sequence analyzer and the ABI Prism Dye Terminator Reaction Chemistry. The final fusion cassette encodes the synthetic leader peptide fused to the HIV gp120 domain with either a (ProAspPro) linker or a (Gly.sub.4Ser).sub.3 linker, and then to the CD154 extracellular domain long (FIG. 3A) or short (FIG. 3B) form to create the embodiments of example 1.

EXAMPLE 2

[0065] In an alternative preferred embodiment, the V1 and V2 domains of gp120 are removed and only the V3 loop domain from HIV gp120 is encoded on a BglII-BamHI fragment and fused to the signal peptide and the CD154 extracellular domain to create the vaccine, as illustrated in FIG. 2A and B. This antigen domain is separated from the CD154 short (FIG. 2B) or long extracellular domain (FIG. 2A) by a peptide linker encoding the amino acids (ProAspPro), or a longer peptide linker encoding the amino acids (Gly.sub.4Ser).sub.3.

[0066] The V3 loop was PCR amplified from pV75 (gp89.6), a plasmid containing HIV gp120 from isolate LAV, using the following primer set: [0067] The antisense primer encoding a ProAspPro linker is SEQUENCE ID NO: 9 or V3PDPr 5'-gtt att cca tgg atc cgg act aat ctt aca atg tgc ttg-3' [0068] The sense primer fusing the antigen to the signal peptide is SEQUENCE ID NO: 10 or V3Bg12f [0069] 5'-gta cag cta aat aga tct gta gta att aat tg-3' [0070] The antisense primer encoding a (Gly.sub.4Ser).sub.3 linker is SEQUENCE ID NO: 11 or V3G4Sr 5'-ggt gca tgg atc cga acc tcc acc gcc aga tcc acc gcc tcc tga ggc acc gcc acc act aat gtt aca atg tgc ttg ttg tct tat atc tcc-3'. [0071] Amplification, digestion, purification, and ligation conditions were identical to those described above for the full-length gp120 domain. The final fusion cassettes encode the HIV gp120-V3 loop with either a (ProAspPro) linker or a (Gly.sub.4Ser).sub.3 linker fused to either the CD154 extracellular domain as diagrammed in FIG. 2A for the long form, and FIG. 2B for the short form of the CD40 binding domain.

[0072] Other antigens and linkers can be substituted to create alternative vaccines by construction of the appropriate cDNA cassettes encoding the desired domains and attaching them to the CD154 extracellular domain. Because of the high degree of sequence variation among HIV isolates, alternative sequences might be incorporated as needed to target particular clades. Other viral antigens such as HIV tat or their subdomains can be substituted for the HIV domains described here. Similarly, an alternate APC targeted domain can be substituted for the CD40 binding domain, such as a domain which binds to CD80 or CD86, or to ICOS ligand, or to one of several other cell surface receptors expressed on antigen presenting cells. Surface receptors that internalize readily are preferred over receptors that contain multiple transmembrane domains and do not internalize readily such as G-protein coupled chemokine receptors.

Sequence CWU 1

1

29 1 66 DNA Artificial Sequence Description of Artificial Sequence Synthetic oligonucleotide 1 agcttgccgc catgctgtat acctctcagc tgttaggact acttctgttt tggatctcgg 60 cttcga 66 2 67 DNA Artificial Sequence Description of Artificial Sequence Synthetic oligonucleotide 2 gatctcgaag cccgagatcc aaaacagaag tagtcctaac agctgagagg tatacagcat 60 ggcggca 67 3 34 DNA Artificial Sequence Description of Artificial Sequence Primer 3 gttgtcggat ccagaaaaca gctttgaaat gcaa 34 4 44 DNA Artificial Sequence Description of Artificial Sequence Primer 4 gttgtttcta gattatcact cgagtttgag taagccaaag gacg 44 5 35 DNA Artificial Sequence Description of Artificial Sequence Primer 5 gttgtcggat ccaagaaggt tggacaagat agaag 35 6 27 DNA Artificial Sequence Description of Artificial Sequence Primer 6 ggatattgat gagatctagt gctacag 27 7 42 DNA Artificial Sequence Description of Artificial Sequence Primer 7 gaacacagct cctattggat ccggtctttt ttctctttgc ac 42 8 90 DNA Artificial Sequence Description of Artificial Sequence Primer 8 cctgcatgga tccgatccgc cacctccaga acctccacct cctgaaccgc ctccccctct 60 tttttctctt tgcactgttc ttctctttgc 90 9 39 DNA Artificial Sequence Description of Artificial Sequence Primer 9 gttattccat ggatccggac taatcttaca atgtgcttg 39 10 32 DNA Artificial Sequence Description of Artificial Sequence Primer 10 gtacagctaa atagatctgt agtaattaat tg 32 11 93 DNA Artificial Sequence Description of Artificial Sequence Primer 11 ggtgcatgga tccgaacctc caccgccaga tccaccgcct cctgaggcac cgccaccact 60 aatgttacaa tgtgcttgtt gtcttatatc tcc 93 12 2252 DNA Artificial Sequence Description of Artificial Sequence Synthetic HIV-human fusion construct CDS (13)..(2238) sig_peptide (13)..(72) mat_peptide (73)..(2238) misc_feature (73)..(1587) HIV gp120 allele + (Gly4Ser)3 linker misc_feature (1594)..(2238) CD154 extracellular domain from amino acids 48-261+Glu binds to CD40 12 aagcttgccg cc atg ctg tat acc tct cag ctg tta gga cta ctt ctg ttt 51 Met Leu Tyr Thr Ser Gln Leu Leu Gly Leu Leu Leu Phe -20 -15 -10 tgg atc tcg gct tcg aga tct atg ctc ctt ggg ata ttg atg atc tgt 99 Trp Ile Ser Ala Ser Arg Ser Met Leu Leu Gly Ile Leu Met Ile Cys -5 -1 1 5 agt gct aca gaa aaa ttg tgg gtc aca gtc tat tat ggg gta cct gtg 147 Ser Ala Thr Glu Lys Leu Trp Val Thr Val Tyr Tyr Gly Val Pro Val 10 15 20 25 tgg aga gaa gca acc acc act cta ttt tgt gca tca gat gct aaa gcc 195 Trp Arg Glu Ala Thr Thr Thr Leu Phe Cys Ala Ser Asp Ala Lys Ala 30 35 40 tat gat aca gag gta cat aat gtt tgg gcc aca cat gcc tgt gta ccc 243 Tyr Asp Thr Glu Val His Asn Val Trp Ala Thr His Ala Cys Val Pro 45 50 55 aca gac ccc aac cca caa gaa gta gta ttg gga aat gtg aca gaa aat 291 Thr Asp Pro Asn Pro Gln Glu Val Val Leu Gly Asn Val Thr Glu Asn 60 65 70 ttt aac atg tgg aaa aat aac atg gta gat cag atg cat gag gat ata 339 Phe Asn Met Trp Lys Asn Asn Met Val Asp Gln Met His Glu Asp Ile 75 80 85 atc agt tta tgg gat gaa agc cta aag cca tgt gta aaa tta acc cca 387 Ile Ser Leu Trp Asp Glu Ser Leu Lys Pro Cys Val Lys Leu Thr Pro 90 95 100 105 ctc tgt gtt act tta aat tgc act aat ttg aat atc act aag aat act 435 Leu Cys Val Thr Leu Asn Cys Thr Asn Leu Asn Ile Thr Lys Asn Thr 110 115 120 act aat ccc act agt agc agc tgg gga atg atg gag aaa gga gaa ata 483 Thr Asn Pro Thr Ser Ser Ser Trp Gly Met Met Glu Lys Gly Glu Ile 125 130 135 aaa aat tgc tct ttc tat atc acc aca agc ata aga aat aag gta aag 531 Lys Asn Cys Ser Phe Tyr Ile Thr Thr Ser Ile Arg Asn Lys Val Lys 140 145 150 aaa gaa tat gca ctt ttt aat aga ctt gat gta gta cca ata gaa aat 579 Lys Glu Tyr Ala Leu Phe Asn Arg Leu Asp Val Val Pro Ile Glu Asn 155 160 165 act aat aat act aag tat agg tta ata agt tgt aac acc tca gtc att 627 Thr Asn Asn Thr Lys Tyr Arg Leu Ile Ser Cys Asn Thr Ser Val Ile 170 175 180 185 aca cag gcc tgt cca aag gta tcc ttt cag cca att ccc ata cat tat 675 Thr Gln Ala Cys Pro Lys Val Ser Phe Gln Pro Ile Pro Ile His Tyr 190 195 200 tgt gtc ccg gct ggg ttt gcg atg cta aag tgt aac aat aag aca ttc 723 Cys Val Pro Ala Gly Phe Ala Met Leu Lys Cys Asn Asn Lys Thr Phe 205 210 215 aat gga tca gga cca tgc aca aat gtc agc aca gta caa tgt aca cat 771 Asn Gly Ser Gly Pro Cys Thr Asn Val Ser Thr Val Gln Cys Thr His 220 225 230 gga att agg cca gtg gtg tca act caa ctg ctg tta aat ggc agt cta 819 Gly Ile Arg Pro Val Val Ser Thr Gln Leu Leu Leu Asn Gly Ser Leu 235 240 245 gca gaa gaa gac ata gta att aga tct gaa aat ttc aca gac aat gct 867 Ala Glu Glu Asp Ile Val Ile Arg Ser Glu Asn Phe Thr Asp Asn Ala 250 255 260 265 aaa acc ata ata gta cag cta aat gaa tct gta gta att aat tgt aca 915 Lys Thr Ile Ile Val Gln Leu Asn Glu Ser Val Val Ile Asn Cys Thr 270 275 280 aga ccc aac aac aat aca aga aga agg tta tct ata gga cca ggg aga 963 Arg Pro Asn Asn Asn Thr Arg Arg Arg Leu Ser Ile Gly Pro Gly Arg 285 290 295 gca ttt tat gca aga aga aac ata ata gga gat ata aga caa gca cat 1011 Ala Phe Tyr Ala Arg Arg Asn Ile Ile Gly Asp Ile Arg Gln Ala His 300 305 310 tgt aac att agt aga gca aaa tgg aat aac act tta caa cag ata gtt 1059 Cys Asn Ile Ser Arg Ala Lys Trp Asn Asn Thr Leu Gln Gln Ile Val 315 320 325 ata aaa tta aga gaa aaa ttt agg aat aaa aca ata gcc ttt aat caa 1107 Ile Lys Leu Arg Glu Lys Phe Arg Asn Lys Thr Ile Ala Phe Asn Gln 330 335 340 345 tcc tca gga ggg gac cca gaa att gta atg cac agt ttt aat tgt gga 1155 Ser Ser Gly Gly Asp Pro Glu Ile Val Met His Ser Phe Asn Cys Gly 350 355 360 ggg gaa ttc ttc tac tgt aat aca gca caa ctg ttt aat agt act tgg 1203 Gly Glu Phe Phe Tyr Cys Asn Thr Ala Gln Leu Phe Asn Ser Thr Trp 365 370 375 aat gtt act gga ggg aca aat ggc act gaa gga aat gac ata atc aca 1251 Asn Val Thr Gly Gly Thr Asn Gly Thr Glu Gly Asn Asp Ile Ile Thr 380 385 390 ctc caa tgc aga ata aaa caa att ata aat atg tgg cag aaa gta gga 1299 Leu Gln Cys Arg Ile Lys Gln Ile Ile Asn Met Trp Gln Lys Val Gly 395 400 405 aaa gca atg tat gcc cct ccc atc aca gga caa att aga tgt tca tca 1347 Lys Ala Met Tyr Ala Pro Pro Ile Thr Gly Gln Ile Arg Cys Ser Ser 410 415 420 425 aat att aca ggg ctg cta cta aca aga gat gga ggt aat agt act gag 1395 Asn Ile Thr Gly Leu Leu Leu Thr Arg Asp Gly Gly Asn Ser Thr Glu 430 435 440 act gag act gag atc ttc aga cct gga gga gga gat atg agg gac aat 1443 Thr Glu Thr Glu Ile Phe Arg Pro Gly Gly Gly Asp Met Arg Asp Asn 445 450 455 tgg aga agt gaa tta tat aaa tat aaa gta gta aga att gaa cca ata 1491 Trp Arg Ser Glu Leu Tyr Lys Tyr Lys Val Val Arg Ile Glu Pro Ile 460 465 470 gga gta gca ccc acc agg gca aag aga aga aca gtg caa aga gaa aaa 1539 Gly Val Ala Pro Thr Arg Ala Lys Arg Arg Thr Val Gln Arg Glu Lys 475 480 485 aga ggg gga ggc ggt tca gga ggt gga ggt tct gga ggt ggc gga tcg 1587 Arg Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser 490 495 500 505 gat cca aga agg ttg gac aag ata gaa gat gaa agg aat ctt cat gaa 1635 Asp Pro Arg Arg Leu Asp Lys Ile Glu Asp Glu Arg Asn Leu His Glu 510 515 520 gat ttt gta ttc atg aaa acg ata cag aga tgc aac aca gga gaa aga 1683 Asp Phe Val Phe Met Lys Thr Ile Gln Arg Cys Asn Thr Gly Glu Arg 525 530 535 tcc tta tcc tta ctg aac tgt gag gag att aaa agc cag ttt gaa ggc 1731 Ser Leu Ser Leu Leu Asn Cys Glu Glu Ile Lys Ser Gln Phe Glu Gly 540 545 550 ttt gtg aag gat ata atg tta aac aaa gag gag acg aag aaa gaa aac 1779 Phe Val Lys Asp Ile Met Leu Asn Lys Glu Glu Thr Lys Lys Glu Asn 555 560 565 agc ttt gaa atg caa aaa ggt gat cag aat cct caa att gcg gca cat 1827 Ser Phe Glu Met Gln Lys Gly Asp Gln Asn Pro Gln Ile Ala Ala His 570 575 580 585 gtc ata agt gag gcc agc agt aaa aca aca tct gtg tta cag tgg gct 1875 Val Ile Ser Glu Ala Ser Ser Lys Thr Thr Ser Val Leu Gln Trp Ala 590 595 600 gaa aaa gga tac tac acc atg agc aac aac ttg gta acc ctg gaa aat 1923 Glu Lys Gly Tyr Tyr Thr Met Ser Asn Asn Leu Val Thr Leu Glu Asn 605 610 615 ggg aaa cag ctg acc gtt aaa aga caa gga ctc tat tat atc tat gcc 1971 Gly Lys Gln Leu Thr Val Lys Arg Gln Gly Leu Tyr Tyr Ile Tyr Ala 620 625 630 caa gtc acc ttc tgt tcc aat cgg gaa gct tcg agt caa gct cca ttt 2019 Gln Val Thr Phe Cys Ser Asn Arg Glu Ala Ser Ser Gln Ala Pro Phe 635 640 645 ata gcc agc ctc tgc cta aag tcc ccc ggt aga ttc gag aga atc tta 2067 Ile Ala Ser Leu Cys Leu Lys Ser Pro Gly Arg Phe Glu Arg Ile Leu 650 655 660 665 ctc aga gct gca aat acc cac agt tcc gcc aaa cct tgc ggg caa caa 2115 Leu Arg Ala Ala Asn Thr His Ser Ser Ala Lys Pro Cys Gly Gln Gln 670 675 680 tcc att cac ttg gga gga gta ttt gaa ttg caa cca ggt gct tcg gtg 2163 Ser Ile His Leu Gly Gly Val Phe Glu Leu Gln Pro Gly Ala Ser Val 685 690 695 ttt gtc aat gtg act gat cca agc caa gtg agc cat ggc act ggc ttc 2211 Phe Val Asn Val Thr Asp Pro Ser Gln Val Ser His Gly Thr Gly Phe 700 705 710 acg tcc ttt ggc tta ctc aaa ctc gag tgataatcta gata 2252 Thr Ser Phe Gly Leu Leu Lys Leu Glu 715 720 13 2208 DNA Artificial Sequence Description of Artificial Sequence Synthetic HIV-human fusion construct CDS (13)..(2196) sig_peptide (13)..(72) mat_peptide (73)..(2196) misc_feature (73)..(1545) HIV gp120 allele + ProAspPro linker misc_feature (1552)..(2196) CD154 extracellular domain long form (amino acids 48-261)+Glu binds to CD40 13 aagcttgccg cc atg ctg tat acc tct cag ctg tta gga cta ctt ctg ttt 51 Met Leu Tyr Thr Ser Gln Leu Leu Gly Leu Leu Leu Phe -20 -15 -10 tgg atc tcg gct tcg aga tcc atg ctc ctt ggg ata ttg atg atc tgt 99 Trp Ile Ser Ala Ser Arg Ser Met Leu Leu Gly Ile Leu Met Ile Cys -5 -1 1 5 agt gct aca gaa aaa ttg tgg gtc aca gtc tat tat ggg gta cct gtg 147 Ser Ala Thr Glu Lys Leu Trp Val Thr Val Tyr Tyr Gly Val Pro Val 10 15 20 25 tgg aga gaa gca acc acc act cta ttt tgt gca tca gat gct aaa gcc 195 Trp Arg Glu Ala Thr Thr Thr Leu Phe Cys Ala Ser Asp Ala Lys Ala 30 35 40 tat gat aca gag gta cat aat gtt tgg gcc aca cat gcc tgt gta ccc 243 Tyr Asp Thr Glu Val His Asn Val Trp Ala Thr His Ala Cys Val Pro 45 50 55 aca gac ccc aac cca caa gaa gta gta ttg gga aat gtg aca gaa aat 291 Thr Asp Pro Asn Pro Gln Glu Val Val Leu Gly Asn Val Thr Glu Asn 60 65 70 ttt aac atg tgg aaa aat aac atg gta gat cag atg cat gag gat ata 339 Phe Asn Met Trp Lys Asn Asn Met Val Asp Gln Met His Glu Asp Ile 75 80 85 atc agt tta tgg gat gaa agc cta aag cca tgt gta aaa tta acc cca 387 Ile Ser Leu Trp Asp Glu Ser Leu Lys Pro Cys Val Lys Leu Thr Pro 90 95 100 105 ctc tgt gtt act tta aat tgc act aat ttg aat atc act aag aat act 435 Leu Cys Val Thr Leu Asn Cys Thr Asn Leu Asn Ile Thr Lys Asn Thr 110 115 120 act aat ccc act agt agc agc tgg gga atg atg gag aaa gga gaa ata 483 Thr Asn Pro Thr Ser Ser Ser Trp Gly Met Met Glu Lys Gly Glu Ile 125 130 135 aaa aat tgc tct ttc tat atc acc aca agc ata aga aat aag gta aag 531 Lys Asn Cys Ser Phe Tyr Ile Thr Thr Ser Ile Arg Asn Lys Val Lys 140 145 150 aaa gaa tat gca ctt ttt aat aga ctt gat gta gta cca ata gaa aat 579 Lys Glu Tyr Ala Leu Phe Asn Arg Leu Asp Val Val Pro Ile Glu Asn 155 160 165 act aat aat act aag tat agg tta ata agt tgt aac acc tca gtc att 627 Thr Asn Asn Thr Lys Tyr Arg Leu Ile Ser Cys Asn Thr Ser Val Ile 170 175 180 185 aca cag gcc tgt cca aag gta tcc ttt cag cca att ccc ata cat tat 675 Thr Gln Ala Cys Pro Lys Val Ser Phe Gln Pro Ile Pro Ile His Tyr 190 195 200 tgt gtc ccg gct ggg ttt gcg atg cta aag tgt aac aat aag aca ttc 723 Cys Val Pro Ala Gly Phe Ala Met Leu Lys Cys Asn Asn Lys Thr Phe 205 210 215 aat gga tca gga cca tgc aca aat gtc agc aca gta caa tgt aca cat 771 Asn Gly Ser Gly Pro Cys Thr Asn Val Ser Thr Val Gln Cys Thr His 220 225 230 gga att agg cca gtg gtg tca act caa ctg ctg tta aat ggc agt cta 819 Gly Ile Arg Pro Val Val Ser Thr Gln Leu Leu Leu Asn Gly Ser Leu 235 240 245 gca gaa gaa gac ata gta att aga tct gaa aat ttc aca gac aat gct 867 Ala Glu Glu Asp Ile Val Ile Arg Ser Glu Asn Phe Thr Asp Asn Ala 250 255 260 265 aaa acc ata ata gta cag cta aat gaa tct gta gta att aat tgt aca 915 Lys Thr Ile Ile Val Gln Leu Asn Glu Ser Val Val Ile Asn Cys Thr 270 275 280 aga ccc aac aac aat aca aga aga agg tta tct ata gga cca ggg aga 963 Arg Pro Asn Asn Asn Thr Arg Arg Arg Leu Ser Ile Gly Pro Gly Arg 285 290 295 gca ttt tat gca aga aga aac ata ata gga gat ata aga caa gca cat 1011 Ala Phe Tyr Ala Arg Arg Asn Ile Ile Gly Asp Ile Arg Gln Ala His 300 305 310 tgt aac att agt aga gca aaa tgg aat aac act tta caa cag ata gtt 1059 Cys Asn Ile Ser Arg Ala Lys Trp Asn Asn Thr Leu Gln Gln Ile Val 315 320 325 ata aaa tta aga gaa aaa ttt agg aat aaa aca ata gcc ttt aat caa 1107 Ile Lys Leu Arg Glu Lys Phe Arg Asn Lys Thr Ile Ala Phe Asn Gln 330 335 340 345 tcc tca gga ggg gac cca gaa att gta atg cac agt ttt aat tgt gga 1155 Ser Ser Gly Gly Asp Pro Glu Ile Val Met His Ser Phe Asn Cys Gly 350 355 360 ggg gaa ttc ttc tac tgt aat aca gca caa ctg ttt aat agt act tgg 1203 Gly Glu Phe Phe Tyr Cys Asn Thr Ala Gln Leu Phe Asn Ser Thr Trp 365 370 375 aat gtt act gga ggg aca aat ggc act gaa gga aat gac ata atc aca 1251 Asn Val Thr Gly Gly Thr Asn Gly Thr Glu Gly Asn Asp Ile Ile Thr 380 385 390 ctc caa tgc aga ata aaa caa att ata aat atg tgg cag aaa gta gga 1299 Leu Gln Cys Arg Ile Lys Gln Ile Ile Asn Met Trp Gln Lys Val Gly 395 400 405 aaa gca atg tat gcc cct ccc atc aca gga caa att aga tgt tca tca 1347 Lys Ala Met Tyr Ala Pro Pro Ile Thr Gly Gln Ile Arg Cys Ser Ser 410 415 420 425 aat att aca ggg ctg cta cta aca aga gat gga ggt aat agt act gag 1395 Asn Ile Thr Gly Leu Leu Leu Thr Arg Asp Gly Gly Asn Ser Thr Glu 430 435 440 act gag act gag atc ttc aga cct gga gga gga gat atg agg gac aat 1443 Thr Glu Thr Glu Ile Phe Arg Pro Gly Gly Gly Asp Met Arg Asp Asn 445 450 455 tgg aga agt gaa tta tat aaa tat aaa gta gta aga att gaa cca ata 1491 Trp Arg Ser Glu Leu Tyr Lys Tyr Lys Val Val Arg Ile Glu Pro Ile 460 465 470 gga gta gca ccc acc agg gca aag aga aga aca gtg caa aga gaa aaa 1539 Gly Val Ala Pro Thr Arg Ala Lys Arg Arg Thr Val Gln Arg Glu Lys 475 480 485 aga ccg gat cca aga agg ttg gac aag ata gaa gat gaa agg aat ctt 1587 Arg Pro Asp Pro Arg Arg Leu Asp Lys Ile Glu Asp Glu Arg Asn Leu 490 495 500 505 cat gaa gat ttt gta ttc atg aaa acg ata cag aga tgc aac aca gga 1635 His Glu Asp Phe Val Phe Met Lys Thr Ile Gln Arg Cys Asn Thr Gly 510 515 520 gaa aga tcc tta tcc tta ctg

aac tgt gag gag att aaa agc cag ttt 1683 Glu Arg Ser Leu Ser Leu Leu Asn Cys Glu Glu Ile Lys Ser Gln Phe 525 530 535 gaa ggc ttt gtg aag gat ata atg tta aac aaa gag gag acg aag aaa 1731 Glu Gly Phe Val Lys Asp Ile Met Leu Asn Lys Glu Glu Thr Lys Lys 540 545 550 gaa aac agc ttt gaa atg caa aaa ggt gat cag aat cct caa att gcg 1779 Glu Asn Ser Phe Glu Met Gln Lys Gly Asp Gln Asn Pro Gln Ile Ala 555 560 565 gca cat gtc ata agt gag gcc agc agt aaa aca aca tct gtg tta cag 1827 Ala His Val Ile Ser Glu Ala Ser Ser Lys Thr Thr Ser Val Leu Gln 570 575 580 585 tgg gct gaa aaa gga tac tac acc atg agc aac aac ttg gta acc ctg 1875 Trp Ala Glu Lys Gly Tyr Tyr Thr Met Ser Asn Asn Leu Val Thr Leu 590 595 600 gaa aat ggg aaa cag ctg acc gtt aaa aga caa gga ctc tat tat atc 1923 Glu Asn Gly Lys Gln Leu Thr Val Lys Arg Gln Gly Leu Tyr Tyr Ile 605 610 615 tat gcc caa gtc acc ttc tgt tcc aat cgg gaa gct tcg agt caa gct 1971 Tyr Ala Gln Val Thr Phe Cys Ser Asn Arg Glu Ala Ser Ser Gln Ala 620 625 630 cca ttt ata gcc agc ctc tgc cta aag tcc ccc ggt aga ttc gag aga 2019 Pro Phe Ile Ala Ser Leu Cys Leu Lys Ser Pro Gly Arg Phe Glu Arg 635 640 645 atc tta ctc aga gct gca aat acc cac agt tcc gcc aaa cct tgc ggg 2067 Ile Leu Leu Arg Ala Ala Asn Thr His Ser Ser Ala Lys Pro Cys Gly 650 655 660 665 caa caa tcc att cac ttg gga gga gta ttt gaa ttg caa cca ggt gct 2115 Gln Gln Ser Ile His Leu Gly Gly Val Phe Glu Leu Gln Pro Gly Ala 670 675 680 tcg gtg ttt gtc aat gtg act gat cca agc caa gtg agc cat ggc act 2163 Ser Val Phe Val Asn Val Thr Asp Pro Ser Gln Val Ser His Gly Thr 685 690 695 ggc ttc acg tcc ttt ggc tta ctc aaa ctc gag tgataatcta ga 2208 Gly Phe Thr Ser Phe Gly Leu Leu Lys Leu Glu 700 705 14 2070 DNA Artificial Sequence Description of Artificial Sequence Synthetic HIV-human fusion construct CDS (13)..(2058) sig_peptide (13)..(72) mat_peptide (73)..(2058) misc_feature (73)..(1587) HIV gp120 allele + (Gly4Ser)3 linker misc_feature (1594)..(2058) CD154 extracellular domain from amino acids 108-261+Glu binds to CD40 14 aagcttgccg cc atg ctg tat acc tct cag ctg tta gga cta ctt ctg ttt 51 Met Leu Tyr Thr Ser Gln Leu Leu Gly Leu Leu Leu Phe -20 -15 -10 tgg atc tcg gct tcg aga tct atg ctc ctt ggg ata ttg atg atc tgt 99 Trp Ile Ser Ala Ser Arg Ser Met Leu Leu Gly Ile Leu Met Ile Cys -5 -1 1 5 agt gct aca gaa aaa ttg tgg gtc aca gtc tat tat ggg gta cct gtg 147 Ser Ala Thr Glu Lys Leu Trp Val Thr Val Tyr Tyr Gly Val Pro Val 10 15 20 25 tgg aga gaa gca acc acc act cta ttt tgt gca tca gat gct aaa gcc 195 Trp Arg Glu Ala Thr Thr Thr Leu Phe Cys Ala Ser Asp Ala Lys Ala 30 35 40 tat gat aca gag gta cat aat gtt tgg gcc aca cat gcc tgt gta ccc 243 Tyr Asp Thr Glu Val His Asn Val Trp Ala Thr His Ala Cys Val Pro 45 50 55 aca gac ccc aac cca caa gaa gta gta ttg gga aat gtg aca gaa aat 291 Thr Asp Pro Asn Pro Gln Glu Val Val Leu Gly Asn Val Thr Glu Asn 60 65 70 ttt aac atg tgg aaa aat aac atg gta gat cag atg cat gag gat ata 339 Phe Asn Met Trp Lys Asn Asn Met Val Asp Gln Met His Glu Asp Ile 75 80 85 atc agt tta tgg gat gaa agc cta aag cca tgt gta aaa tta acc cca 387 Ile Ser Leu Trp Asp Glu Ser Leu Lys Pro Cys Val Lys Leu Thr Pro 90 95 100 105 ctc tgt gtt act tta aat tgc act aat ttg aat atc act aag aat act 435 Leu Cys Val Thr Leu Asn Cys Thr Asn Leu Asn Ile Thr Lys Asn Thr 110 115 120 act aat ccc act agt agc agc tgg gga atg atg gag aaa gga gaa ata 483 Thr Asn Pro Thr Ser Ser Ser Trp Gly Met Met Glu Lys Gly Glu Ile 125 130 135 aaa aat tgc tct ttc tat atc acc aca agc ata aga aat aag gta aag 531 Lys Asn Cys Ser Phe Tyr Ile Thr Thr Ser Ile Arg Asn Lys Val Lys 140 145 150 aaa gaa tat gca ctt ttt aat aga ctt gat gta gta cca ata gaa aat 579 Lys Glu Tyr Ala Leu Phe Asn Arg Leu Asp Val Val Pro Ile Glu Asn 155 160 165 act aat aat act aag tat agg tta ata agt tgt aac acc tca gtc att 627 Thr Asn Asn Thr Lys Tyr Arg Leu Ile Ser Cys Asn Thr Ser Val Ile 170 175 180 185 aca cag gcc tgt cca aag gta tcc ttt cag cca att ccc ata cat tat 675 Thr Gln Ala Cys Pro Lys Val Ser Phe Gln Pro Ile Pro Ile His Tyr 190 195 200 tgt gtc ccg gct ggg ttt gcg atg cta aag tgt aac aat aag aca ttc 723 Cys Val Pro Ala Gly Phe Ala Met Leu Lys Cys Asn Asn Lys Thr Phe 205 210 215 aat gga tca gga cca tgc aca aat gtc agc aca gta caa tgt aca cat 771 Asn Gly Ser Gly Pro Cys Thr Asn Val Ser Thr Val Gln Cys Thr His 220 225 230 gga att agg cca gtg gtg tca act caa ctg ctg tta aat ggc agt cta 819 Gly Ile Arg Pro Val Val Ser Thr Gln Leu Leu Leu Asn Gly Ser Leu 235 240 245 gca gaa gaa gac ata gta att aga tct gaa aat ttc aca gac aat gct 867 Ala Glu Glu Asp Ile Val Ile Arg Ser Glu Asn Phe Thr Asp Asn Ala 250 255 260 265 aaa acc ata ata gta cag cta aat gaa tct gta gta att aat tgt aca 915 Lys Thr Ile Ile Val Gln Leu Asn Glu Ser Val Val Ile Asn Cys Thr 270 275 280 aga ccc aac aac aat aca aga aga agg tta tct ata gga cca ggg aga 963 Arg Pro Asn Asn Asn Thr Arg Arg Arg Leu Ser Ile Gly Pro Gly Arg 285 290 295 gca ttt tat gca aga aga aac ata ata gga gat ata aga caa gca cat 1011 Ala Phe Tyr Ala Arg Arg Asn Ile Ile Gly Asp Ile Arg Gln Ala His 300 305 310 tgt aac att agt aga gca aaa tgg aat aac act tta caa cag ata gtt 1059 Cys Asn Ile Ser Arg Ala Lys Trp Asn Asn Thr Leu Gln Gln Ile Val 315 320 325 ata aaa tta aga gaa aaa ttt agg aat aaa aca ata gcc ttt aat caa 1107 Ile Lys Leu Arg Glu Lys Phe Arg Asn Lys Thr Ile Ala Phe Asn Gln 330 335 340 345 tcc tca gga ggg gac cca gaa att gta atg cac agt ttt aat tgt gga 1155 Ser Ser Gly Gly Asp Pro Glu Ile Val Met His Ser Phe Asn Cys Gly 350 355 360 ggg gaa ttc ttc tac tgt aat aca gca caa ctg ttt aat agt act tgg 1203 Gly Glu Phe Phe Tyr Cys Asn Thr Ala Gln Leu Phe Asn Ser Thr Trp 365 370 375 aat gtt act gga ggg aca aat ggc act gaa gga aat gac ata atc aca 1251 Asn Val Thr Gly Gly Thr Asn Gly Thr Glu Gly Asn Asp Ile Ile Thr 380 385 390 ctc caa tgc aga ata aaa caa att ata aat atg tgg cag aaa gta gga 1299 Leu Gln Cys Arg Ile Lys Gln Ile Ile Asn Met Trp Gln Lys Val Gly 395 400 405 aaa gca atg tat gcc cct ccc atc aca gga caa att aga tgt tca tca 1347 Lys Ala Met Tyr Ala Pro Pro Ile Thr Gly Gln Ile Arg Cys Ser Ser 410 415 420 425 aat att aca ggg ctg cta cta aca aga gat gga ggt aat agt act gag 1395 Asn Ile Thr Gly Leu Leu Leu Thr Arg Asp Gly Gly Asn Ser Thr Glu 430 435 440 act gag act gag atc ttc aga cct gga gga gga gat atg agg gac aat 1443 Thr Glu Thr Glu Ile Phe Arg Pro Gly Gly Gly Asp Met Arg Asp Asn 445 450 455 tgg aga agt gaa tta tat aaa tat aaa gta gta aga att gaa cca ata 1491 Trp Arg Ser Glu Leu Tyr Lys Tyr Lys Val Val Arg Ile Glu Pro Ile 460 465 470 gga gta gca ccc acc agg gca aag aga aga aca gtg caa aga gaa aaa 1539 Gly Val Ala Pro Thr Arg Ala Lys Arg Arg Thr Val Gln Arg Glu Lys 475 480 485 aga ggg gga ggc ggt tca gga ggt gga ggt tct gga ggt ggc gga tcg 1587 Arg Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser 490 495 500 505 gat cca gaa aac agc ttt gaa atg caa aaa ggt gat cag aat cct caa 1635 Asp Pro Glu Asn Ser Phe Glu Met Gln Lys Gly Asp Gln Asn Pro Gln 510 515 520 att gcg gca cat gtc ata agt gag gcc agc agt aaa aca aca tct gtg 1683 Ile Ala Ala His Val Ile Ser Glu Ala Ser Ser Lys Thr Thr Ser Val 525 530 535 tta cag tgg gct gaa aaa gga tac tac acc atg agc aac aac ttg gta 1731 Leu Gln Trp Ala Glu Lys Gly Tyr Tyr Thr Met Ser Asn Asn Leu Val 540 545 550 acc ctg gaa aat ggg aaa cag ctg acc gtt aaa aga caa gga ctc tat 1779 Thr Leu Glu Asn Gly Lys Gln Leu Thr Val Lys Arg Gln Gly Leu Tyr 555 560 565 tat atc tat gcc caa gtc acc ttc tgt tcc aat cgg gaa gct tcg agt 1827 Tyr Ile Tyr Ala Gln Val Thr Phe Cys Ser Asn Arg Glu Ala Ser Ser 570 575 580 585 caa gct cca ttt ata gcc agc ctc tgc cta aag tcc ccc ggt aga ttc 1875 Gln Ala Pro Phe Ile Ala Ser Leu Cys Leu Lys Ser Pro Gly Arg Phe 590 595 600 gag aga atc tta ctc aga gct gca aat acc cac agt tcc gcc aaa cct 1923 Glu Arg Ile Leu Leu Arg Ala Ala Asn Thr His Ser Ser Ala Lys Pro 605 610 615 tgc ggg caa caa tcc att cac ttg gga gga gta ttt gaa ttg caa cca 1971 Cys Gly Gln Gln Ser Ile His Leu Gly Gly Val Phe Glu Leu Gln Pro 620 625 630 ggt gct tcg gtg ttt gtc aat gtg act gat cca agc caa gtg agc cat 2019 Gly Ala Ser Val Phe Val Asn Val Thr Asp Pro Ser Gln Val Ser His 635 640 645 ggc act ggc ttc acg tcc ttt ggc tta ctc aaa ctc gag tgataatcta ga 2070 Gly Thr Gly Phe Thr Ser Phe Gly Leu Leu Lys Leu Glu 650 655 660 15 2028 DNA Artificial Sequence Description of Artificial Sequence Synthetic HIV-human fusion construct CDS (13)..(2016) sig_peptide (13)..(72) mat_peptide (73)..(2016) misc_feature (73)..(1551) HIV gp120 allele + ProAspPro linker misc_feature (1552)..(2016) CD154 extracellular domain from amino acids 108-261+Glu binds to CD40 15 aagcttgccg cc atg ctg tat acc tct cag ctg tta gga cta ctt ctg ttt 51 Met Leu Tyr Thr Ser Gln Leu Leu Gly Leu Leu Leu Phe -20 -15 -10 tgg atc tcg gct tcg aga tcc atg ctc ctt ggg ata ttg atg atc tgt 99 Trp Ile Ser Ala Ser Arg Ser Met Leu Leu Gly Ile Leu Met Ile Cys -5 -1 1 5 agt gct aca gaa aaa ttg tgg gtc aca gtc tat tat ggg gta cct gtg 147 Ser Ala Thr Glu Lys Leu Trp Val Thr Val Tyr Tyr Gly Val Pro Val 10 15 20 25 tgg aga gaa gca acc acc act cta ttt tgt gca tca gat gct aaa gcc 195 Trp Arg Glu Ala Thr Thr Thr Leu Phe Cys Ala Ser Asp Ala Lys Ala 30 35 40 tat gat aca gag gta cat aat gtt tgg gcc aca cat gcc tgt gta ccc 243 Tyr Asp Thr Glu Val His Asn Val Trp Ala Thr His Ala Cys Val Pro 45 50 55 aca gac ccc aac cca caa gaa gta gta ttg gga aat gtg aca gaa aat 291 Thr Asp Pro Asn Pro Gln Glu Val Val Leu Gly Asn Val Thr Glu Asn 60 65 70 ttt aac atg tgg aaa aat aac atg gta gat cag atg cat gag gat ata 339 Phe Asn Met Trp Lys Asn Asn Met Val Asp Gln Met His Glu Asp Ile 75 80 85 atc agt tta tgg gat gaa agc cta aag cca tgt gta aaa tta acc cca 387 Ile Ser Leu Trp Asp Glu Ser Leu Lys Pro Cys Val Lys Leu Thr Pro 90 95 100 105 ctc tgt gtt act tta aat tgc act aat ttg aat atc act aag aat act 435 Leu Cys Val Thr Leu Asn Cys Thr Asn Leu Asn Ile Thr Lys Asn Thr 110 115 120 act aat ccc act agt agc agc tgg gga atg atg gag aaa gga gaa ata 483 Thr Asn Pro Thr Ser Ser Ser Trp Gly Met Met Glu Lys Gly Glu Ile 125 130 135 aaa aat tgc tct ttc tat atc acc aca agc ata aga aat aag gta aag 531 Lys Asn Cys Ser Phe Tyr Ile Thr Thr Ser Ile Arg Asn Lys Val Lys 140 145 150 aaa gaa tat gca ctt ttt aat aga ctt gat gta gta cca ata gaa aat 579 Lys Glu Tyr Ala Leu Phe Asn Arg Leu Asp Val Val Pro Ile Glu Asn 155 160 165 act aat aat act aag tat agg tta ata agt tgt aac acc tca gtc att 627 Thr Asn Asn Thr Lys Tyr Arg Leu Ile Ser Cys Asn Thr Ser Val Ile 170 175 180 185 aca cag gcc tgt cca aag gta tcc ttt cag cca att ccc ata cat tat 675 Thr Gln Ala Cys Pro Lys Val Ser Phe Gln Pro Ile Pro Ile His Tyr 190 195 200 tgt gtc ccg gct ggg ttt gcg atg cta aag tgt aac aat aag aca ttc 723 Cys Val Pro Ala Gly Phe Ala Met Leu Lys Cys Asn Asn Lys Thr Phe 205 210 215 aat gga tca gga cca tgc aca aat gtc agc aca gta caa tgt aca cat 771 Asn Gly Ser Gly Pro Cys Thr Asn Val Ser Thr Val Gln Cys Thr His 220 225 230 gga att agg cca gtg gtg tca act caa ctg ctg tta aat ggc agt cta 819 Gly Ile Arg Pro Val Val Ser Thr Gln Leu Leu Leu Asn Gly Ser Leu 235 240 245 gca gaa gaa gac ata gta att aga tct gaa aat ttc aca gac aat gct 867 Ala Glu Glu Asp Ile Val Ile Arg Ser Glu Asn Phe Thr Asp Asn Ala 250 255 260 265 aaa acc ata ata gta cag cta aat gaa tct gta gta att aat tgt aca 915 Lys Thr Ile Ile Val Gln Leu Asn Glu Ser Val Val Ile Asn Cys Thr 270 275 280 aga ccc aac aac aat aca aga aga agg tta tct ata gga cca ggg aga 963 Arg Pro Asn Asn Asn Thr Arg Arg Arg Leu Ser Ile Gly Pro Gly Arg 285 290 295 gca ttt tat gca aga aga aac ata ata gga gat ata aga caa gca cat 1011 Ala Phe Tyr Ala Arg Arg Asn Ile Ile Gly Asp Ile Arg Gln Ala His 300 305 310 tgt aac att agt aga gca aaa tgg aat aac act tta caa cag ata gtt 1059 Cys Asn Ile Ser Arg Ala Lys Trp Asn Asn Thr Leu Gln Gln Ile Val 315 320 325 ata aaa tta aga gaa aaa ttt agg aat aaa aca ata gcc ttt aat caa 1107 Ile Lys Leu Arg Glu Lys Phe Arg Asn Lys Thr Ile Ala Phe Asn Gln 330 335 340 345 tcc tca gga ggg gac cca gaa att gta atg cac agt ttt aat tgt gga 1155 Ser Ser Gly Gly Asp Pro Glu Ile Val Met His Ser Phe Asn Cys Gly 350 355 360 ggg gaa ttc ttc tac tgt aat aca gca caa ctg ttt aat agt act tgg 1203 Gly Glu Phe Phe Tyr Cys Asn Thr Ala Gln Leu Phe Asn Ser Thr Trp 365 370 375 aat gtt act gga ggg aca aat ggc act gaa gga aat gac ata atc aca 1251 Asn Val Thr Gly Gly Thr Asn Gly Thr Glu Gly Asn Asp Ile Ile Thr 380 385 390 ctc caa tgc aga ata aaa caa att ata aat atg tgg cag aaa gta gga 1299 Leu Gln Cys Arg Ile Lys Gln Ile Ile Asn Met Trp Gln Lys Val Gly 395 400 405 aaa gca atg tat gcc cct ccc atc aca gga caa att aga tgt tca tca 1347 Lys Ala Met Tyr Ala Pro Pro Ile Thr Gly Gln Ile Arg Cys Ser Ser 410 415 420 425 aat att aca ggg ctg cta cta aca aga gat gga ggt aat agt act gag 1395 Asn Ile Thr Gly Leu Leu Leu Thr Arg Asp Gly Gly Asn Ser Thr Glu 430 435 440 act gag act gag atc ttc aga cct gga gga gga gat atg agg gac aat 1443 Thr Glu Thr Glu Ile Phe Arg Pro Gly Gly Gly Asp Met Arg Asp Asn 445 450 455 tgg aga agt gaa tta tat aaa tat aaa gta gta aga att gaa cca ata 1491 Trp Arg Ser Glu Leu Tyr Lys Tyr Lys Val Val Arg Ile Glu Pro Ile 460 465 470 gga gta gca ccc acc agg gca aag aga aga aca gtg caa aga gaa aaa 1539 Gly Val Ala Pro Thr Arg Ala Lys Arg Arg Thr Val Gln Arg Glu Lys 475 480 485 aga ccg gat cca gaa aac agc ttt gaa atg caa aaa ggt gat cag aat 1587 Arg Pro Asp Pro Glu Asn Ser Phe Glu Met Gln Lys Gly Asp Gln Asn 490 495 500 505 cct caa att gcg gca cat gtc ata agt gag gcc agc agt aaa aca aca 1635 Pro Gln Ile Ala Ala His Val Ile Ser Glu Ala Ser Ser Lys Thr Thr 510 515 520 tct gtg tta cag tgg gct gaa aaa gga tac tac acc atg agc aac aac 1683 Ser Val Leu Gln Trp Ala Glu Lys Gly Tyr Tyr Thr Met Ser Asn Asn 525 530 535 ttg gta acc ctg gaa aat ggg aaa cag ctg acc gtt aaa aga caa gga 1731 Leu Val Thr Leu Glu Asn Gly Lys Gln Leu Thr Val Lys Arg Gln Gly 540 545 550 ctc tat tat atc tat gcc caa gtc acc ttc tgt tcc aat cgg gaa gct 1779 Leu Tyr Tyr Ile Tyr Ala Gln Val Thr Phe Cys Ser Asn Arg Glu Ala 555

560 565 tcg agt caa gct cca ttt ata gcc agc ctc tgc cta aag tcc ccc ggt 1827 Ser Ser Gln Ala Pro Phe Ile Ala Ser Leu Cys Leu Lys Ser Pro Gly 570 575 580 585 aga ttc gag aga atc tta ctc aga gct gca aat acc cac agt tcc gcc 1875 Arg Phe Glu Arg Ile Leu Leu Arg Ala Ala Asn Thr His Ser Ser Ala 590 595 600 aaa cct tgc ggg caa caa tcc att cac ttg gga gga gta ttt gaa ttg 1923 Lys Pro Cys Gly Gln Gln Ser Ile His Leu Gly Gly Val Phe Glu Leu 605 610 615 caa cca ggt gct tcg gtg ttt gtc aat gtg act gat cca agc caa gtg 1971 Gln Pro Gly Ala Ser Val Phe Val Asn Val Thr Asp Pro Ser Gln Val 620 625 630 agc cat ggc act ggc ttc acg tcc ttt ggc tta ctc aaa ctc gag 2016 Ser His Gly Thr Gly Phe Thr Ser Phe Gly Leu Leu Lys Leu Glu 635 640 645 tgataatcta ga 2028 16 906 DNA Artificial Sequence Description of Artificial Sequence Synthetic HIV-human fusion construct CDS (13)..(894) sig_peptide (13)..(72) mat_peptide (73)..(894) misc_feature (73)..(243) HIV gp120 V3 loop + (Gly4Ser)3 linker misc_feature (250)..(894) CD154 extracellular domain from amino acids 48-261+Glu binds to CD40 16 aagcttgccg cc atg ctg tat acc tct cag ctg tta gga cta ctt ctg ttt 51 Met Leu Tyr Thr Ser Gln Leu Leu Gly Leu Leu Leu Phe -20 -15 -10 tgg atc tcg gct tcg aga tct gta gta att aat tgt aca aga ccc aac 99 Trp Ile Ser Ala Ser Arg Ser Val Val Ile Asn Cys Thr Arg Pro Asn -5 -1 1 5 aac aat aca aga aga agg tta tct ata gga cca ggg aga gca ttt tat 147 Asn Asn Thr Arg Arg Arg Leu Ser Ile Gly Pro Gly Arg Ala Phe Tyr 10 15 20 25 gca aga aga aac ata ata gga gat ata aga caa gca cat tgt aac att 195 Ala Arg Arg Asn Ile Ile Gly Asp Ile Arg Gln Ala His Cys Asn Ile 30 35 40 agt ggt ggc ggt ggc tca gga ggc ggt gga tct ggc ggt gga ggt tcg 243 Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser 45 50 55 gat cca aga agg ttg gac aag ata gaa gat gaa agg aat ctt cat gaa 291 Asp Pro Arg Arg Leu Asp Lys Ile Glu Asp Glu Arg Asn Leu His Glu 60 65 70 gat ttt gta ttc atg aaa acg ata cag aga tgc aac aca gga gaa aga 339 Asp Phe Val Phe Met Lys Thr Ile Gln Arg Cys Asn Thr Gly Glu Arg 75 80 85 tcc tta tcc tta ctg aac tgt gag gag att aaa agc cag ttt gaa ggc 387 Ser Leu Ser Leu Leu Asn Cys Glu Glu Ile Lys Ser Gln Phe Glu Gly 90 95 100 105 ttt gtg aag gat ata atg tta aac aaa gag gag acg aag aaa gaa aac 435 Phe Val Lys Asp Ile Met Leu Asn Lys Glu Glu Thr Lys Lys Glu Asn 110 115 120 agc ttt gaa atg caa aaa ggt gat cag aat cct caa att gcg gca cat 483 Ser Phe Glu Met Gln Lys Gly Asp Gln Asn Pro Gln Ile Ala Ala His 125 130 135 gtc ata agt gag gcc agc agt aaa aca aca tct gtg tta cag tgg gct 531 Val Ile Ser Glu Ala Ser Ser Lys Thr Thr Ser Val Leu Gln Trp Ala 140 145 150 gaa aaa gga tac tac acc atg agc aac aac ttg gta acc ctg gaa aat 579 Glu Lys Gly Tyr Tyr Thr Met Ser Asn Asn Leu Val Thr Leu Glu Asn 155 160 165 ggg aaa cag ctg acc gtt aaa aga caa gga ctc tat tat atc tat gcc 627 Gly Lys Gln Leu Thr Val Lys Arg Gln Gly Leu Tyr Tyr Ile Tyr Ala 170 175 180 185 caa gtc acc ttc tgt tcc aat cgg gaa gct tcg agt caa gct cca ttt 675 Gln Val Thr Phe Cys Ser Asn Arg Glu Ala Ser Ser Gln Ala Pro Phe 190 195 200 ata gcc agc ctc tgc cta aag tcc ccc ggt aga ttc gag aga atc tta 723 Ile Ala Ser Leu Cys Leu Lys Ser Pro Gly Arg Phe Glu Arg Ile Leu 205 210 215 ctc aga gct gca aat acc cac agt tcc gcc aaa cct tgc ggg caa caa 771 Leu Arg Ala Ala Asn Thr His Ser Ser Ala Lys Pro Cys Gly Gln Gln 220 225 230 tcc att cac ttg gga gga gta ttt gaa ttg caa cca ggt gct tcg gtg 819 Ser Ile His Leu Gly Gly Val Phe Glu Leu Gln Pro Gly Ala Ser Val 235 240 245 ttt gtc aat gtg act gat cca agc caa gtg agc cat ggc act ggc ttc 867 Phe Val Asn Val Thr Asp Pro Ser Gln Val Ser His Gly Thr Gly Phe 250 255 260 265 acg tcc ttt ggc tta ctc aaa ctc gag tgataatcta ga 906 Thr Ser Phe Gly Leu Leu Lys Leu Glu 270 17 864 DNA Artificial Sequence Description of Artificial Sequence Synthetic HIV-human fusion construct CDS (13)..(852) sig_peptide (13)..(72) mat_peptide (73)..(852) misc_feature (73)..(207) HIV gp120 allele + (Gly4Ser)3 linker misc_feature (208)..(852) CD154 extracellular domain from amino acids 48-261+Glu binds to CD40 17 aagcttgccg cc atg ctg tat acc tct cag ctg tta gga cta ctt ctg ttt 51 Met Leu Tyr Thr Ser Gln Leu Leu Gly Leu Leu Leu Phe -20 -15 -10 tgg atc tcg gct tcg aga tct gta gta att aat tgt aca aga ccc aac 99 Trp Ile Ser Ala Ser Arg Ser Val Val Ile Asn Cys Thr Arg Pro Asn -5 -1 1 5 aac aat aca aga aga agg tta tct ata gga cca ggg aga gca ttt tat 147 Asn Asn Thr Arg Arg Arg Leu Ser Ile Gly Pro Gly Arg Ala Phe Tyr 10 15 20 25 gca aga aga aac ata ata gga gat ata aga caa gca cat tgt aac att 195 Ala Arg Arg Asn Ile Ile Gly Asp Ile Arg Gln Ala His Cys Asn Ile 30 35 40 agt ccg gat cca aga agg ttg gac aag ata gaa gat gaa agg aat ctt 243 Ser Pro Asp Pro Arg Arg Leu Asp Lys Ile Glu Asp Glu Arg Asn Leu 45 50 55 cat gaa gat ttt gta ttc atg aaa acg ata cag aga tgc aac aca gga 291 His Glu Asp Phe Val Phe Met Lys Thr Ile Gln Arg Cys Asn Thr Gly 60 65 70 gaa aga tcc tta tcc tta ctg aac tgt gag gag att aaa agc cag ttt 339 Glu Arg Ser Leu Ser Leu Leu Asn Cys Glu Glu Ile Lys Ser Gln Phe 75 80 85 gaa ggc ttt gtg aag gat ata atg tta aac aaa gag gag acg aag aaa 387 Glu Gly Phe Val Lys Asp Ile Met Leu Asn Lys Glu Glu Thr Lys Lys 90 95 100 105 gaa aac agc ttt gaa atg caa aaa ggt gat cag aat cct caa att gcg 435 Glu Asn Ser Phe Glu Met Gln Lys Gly Asp Gln Asn Pro Gln Ile Ala 110 115 120 gca cat gtc ata agt gag gcc agc agt aaa aca aca tct gtg tta cag 483 Ala His Val Ile Ser Glu Ala Ser Ser Lys Thr Thr Ser Val Leu Gln 125 130 135 tgg gct gaa aaa gga tac tac acc atg agc aac aac ttg gta acc ctg 531 Trp Ala Glu Lys Gly Tyr Tyr Thr Met Ser Asn Asn Leu Val Thr Leu 140 145 150 gaa aat ggg aaa cag ctg acc gtt aaa aga caa gga ctc tat tat atc 579 Glu Asn Gly Lys Gln Leu Thr Val Lys Arg Gln Gly Leu Tyr Tyr Ile 155 160 165 tat gcc caa gtc acc ttc tgt tcc aat cgg gaa gct tcg agt caa gct 627 Tyr Ala Gln Val Thr Phe Cys Ser Asn Arg Glu Ala Ser Ser Gln Ala 170 175 180 185 cca ttt ata gcc agc ctc tgc cta aag tcc ccc ggt aga ttc gag aga 675 Pro Phe Ile Ala Ser Leu Cys Leu Lys Ser Pro Gly Arg Phe Glu Arg 190 195 200 atc tta ctc aga gct gca aat acc cac agt tcc gcc aaa cct tgc ggg 723 Ile Leu Leu Arg Ala Ala Asn Thr His Ser Ser Ala Lys Pro Cys Gly 205 210 215 caa caa tcc att cac ttg gga gga gta ttt gaa ttg caa cca ggt gct 771 Gln Gln Ser Ile His Leu Gly Gly Val Phe Glu Leu Gln Pro Gly Ala 220 225 230 tcg gtg ttt gtc aat gtg act gat cca agc caa gtg agc cat ggc act 819 Ser Val Phe Val Asn Val Thr Asp Pro Ser Gln Val Ser His Gly Thr 235 240 245 ggc ttc acg tcc ttt ggc tta ctc aaa ctc gag tgataatcta ga 864 Gly Phe Thr Ser Phe Gly Leu Leu Lys Leu Glu 250 255 260 18 726 DNA Artificial Sequence Description of Artificial Sequence Synthetic HIV-human fusion construct CDS (13)..(714) sig_peptide (13)..(72) mat_peptide (73)..(714) misc_feature (73)..(207) HIV gp120 V3 loop + ProAspPro linker misc_feature (208)..(714) CD154 extracellular domain from amino acids 108-261+Glu binds to CD40 18 aagcttgccg cc atg ctg tat acc tct cag ctg tta gga cta ctt ctg ttt 51 Met Leu Tyr Thr Ser Gln Leu Leu Gly Leu Leu Leu Phe -20 -15 -10 tgg atc tcg gct tcg aga tct gta gta att aat tgt aca aga ccc aac 99 Trp Ile Ser Ala Ser Arg Ser Val Val Ile Asn Cys Thr Arg Pro Asn -5 -1 1 5 aac aat aca aga aga agg tta tct ata gga cca ggg aga gca ttt tat 147 Asn Asn Thr Arg Arg Arg Leu Ser Ile Gly Pro Gly Arg Ala Phe Tyr 10 15 20 25 gca aga aga aac ata ata gga gat ata aga caa gca cat tgt aac att 195 Ala Arg Arg Asn Ile Ile Gly Asp Ile Arg Gln Ala His Cys Asn Ile 30 35 40 agt ggt ggc ggt ggc tca gga ggc ggt gga tct ggc ggt gga ggt tcg 243 Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser 45 50 55 gat cca gaa aac agc ttt gaa atg caa aaa ggt gat cag aat cct caa 291 Asp Pro Glu Asn Ser Phe Glu Met Gln Lys Gly Asp Gln Asn Pro Gln 60 65 70 att gcg gca cat gtc ata agt gag gcc agc agt aaa aca aca tct gtg 339 Ile Ala Ala His Val Ile Ser Glu Ala Ser Ser Lys Thr Thr Ser Val 75 80 85 tta cag tgg gct gaa aaa gga tac tac acc atg agc aac aac ttg gta 387 Leu Gln Trp Ala Glu Lys Gly Tyr Tyr Thr Met Ser Asn Asn Leu Val 90 95 100 105 acc ctg gaa aat ggg aaa cag ctg acc gtt aaa aga caa gga ctc tat 435 Thr Leu Glu Asn Gly Lys Gln Leu Thr Val Lys Arg Gln Gly Leu Tyr 110 115 120 tat atc tat gcc caa gtc acc ttc tgt tcc aat cgg gaa gct tcg agt 483 Tyr Ile Tyr Ala Gln Val Thr Phe Cys Ser Asn Arg Glu Ala Ser Ser 125 130 135 caa gct cca ttt ata gcc agc ctc tgc cta aag tcc ccc ggt aga ttc 531 Gln Ala Pro Phe Ile Ala Ser Leu Cys Leu Lys Ser Pro Gly Arg Phe 140 145 150 gag aga atc tta ctc aga gct gca aat acc cac agt tcc gcc aaa cct 579 Glu Arg Ile Leu Leu Arg Ala Ala Asn Thr His Ser Ser Ala Lys Pro 155 160 165 tgc ggg caa caa tcc att cac ttg gga gga gta ttt gaa ttg caa cca 627 Cys Gly Gln Gln Ser Ile His Leu Gly Gly Val Phe Glu Leu Gln Pro 170 175 180 185 ggt gct tcg gtg ttt gtc aat gtg act gat cca agc caa gtg agc cat 675 Gly Ala Ser Val Phe Val Asn Val Thr Asp Pro Ser Gln Val Ser His 190 195 200 ggc act ggc ttc acg tcc ttt ggc tta ctc aaa ctc gag tgataatcta ga 726 Gly Thr Gly Phe Thr Ser Phe Gly Leu Leu Lys Leu Glu 205 210 19 684 DNA Artificial Sequence Description of Artificial Sequence Synthetic HIV-human fusion construct CDS (13)..(672) sig_peptide (13)..(72) mat_peptide (73)..(672) misc_feature (73)..(207) HIV gp120 V3 loop + ProAspPro linker misc_feature (208)..(672) CD154 extracellular domain from amino acids 108-261+Glu binds to CD40 19 aagcttgccg cc atg ctg tat acc tct cag ctg tta gga cta ctt ctg ttt 51 Met Leu Tyr Thr Ser Gln Leu Leu Gly Leu Leu Leu Phe -20 -15 -10 tgg atc tcg gct tcg aga tct gta gta att aat tgt aca aga ccc aac 99 Trp Ile Ser Ala Ser Arg Ser Val Val Ile Asn Cys Thr Arg Pro Asn -5 -1 1 5 aac aat aca aga aga agg tta tct ata gga cca ggg aga gca ttt tat 147 Asn Asn Thr Arg Arg Arg Leu Ser Ile Gly Pro Gly Arg Ala Phe Tyr 10 15 20 25 gca aga aga aac ata ata gga gat ata aga caa gca cat tgt aac att 195 Ala Arg Arg Asn Ile Ile Gly Asp Ile Arg Gln Ala His Cys Asn Ile 30 35 40 agt ccg gat cca gaa aac agc ttt gaa atg caa aaa ggt gat cag aat 243 Ser Pro Asp Pro Glu Asn Ser Phe Glu Met Gln Lys Gly Asp Gln Asn 45 50 55 cct caa att gcg gca cat gtc ata agt gag gcc agc agt aaa aca aca 291 Pro Gln Ile Ala Ala His Val Ile Ser Glu Ala Ser Ser Lys Thr Thr 60 65 70 tct gtg tta cag tgg gct gaa aaa gga tac tac acc atg agc aac aac 339 Ser Val Leu Gln Trp Ala Glu Lys Gly Tyr Tyr Thr Met Ser Asn Asn 75 80 85 ttg gta acc ctg gaa aat ggg aaa cag ctg acc gtt aaa aga caa gga 387 Leu Val Thr Leu Glu Asn Gly Lys Gln Leu Thr Val Lys Arg Gln Gly 90 95 100 105 ctc tat tat atc tat gcc caa gtc acc ttc tgt tcc aat cgg gaa gct 435 Leu Tyr Tyr Ile Tyr Ala Gln Val Thr Phe Cys Ser Asn Arg Glu Ala 110 115 120 tcg agt caa gct cca ttt ata gcc agc ctc tgc cta aag tcc ccc ggt 483 Ser Ser Gln Ala Pro Phe Ile Ala Ser Leu Cys Leu Lys Ser Pro Gly 125 130 135 aga ttc gag aga atc tta ctc aga gct gca aat acc cac agt tcc gcc 531 Arg Phe Glu Arg Ile Leu Leu Arg Ala Ala Asn Thr His Ser Ser Ala 140 145 150 aaa cct tgc ggg caa caa tcc att cac ttg gga gga gta ttt gaa ttg 579 Lys Pro Cys Gly Gln Gln Ser Ile His Leu Gly Gly Val Phe Glu Leu 155 160 165 caa cca ggt gct tcg gtg ttt gtc aat gtg act gat cca agc caa gtg 627 Gln Pro Gly Ala Ser Val Phe Val Asn Val Thr Asp Pro Ser Gln Val 170 175 180 185 agc cat ggc act ggc ttc acg tcc ttt ggc tta ctc aaa ctc gag 672 Ser His Gly Thr Gly Phe Thr Ser Phe Gly Leu Leu Lys Leu Glu 190 195 200 tgataatcta ga 684 20 742 PRT Artificial Sequence Description of Artificial Sequence Synthetic HIV-human fusion construct SIGNAL (1)..(20) Synthetic secretory signal peptide DOMAIN (21)..(526) HIV gp120 domain with (Gly4Ser)3 linker BINDING (529)..(742) CD154 extracellular domain long form amino acids 48(Arg) to 261(Leu) + Glu binds CD40 20 Met Leu Tyr Thr Ser Gln Leu Leu Gly Leu Leu Leu Phe Trp Ile Ser -20 -15 -10 -5 Ala Ser Arg Ser Met Leu Leu Gly Ile Leu Met Ile Cys Ser Ala Thr -1 1 5 10 Glu Lys Leu Trp Val Thr Val Tyr Tyr Gly Val Pro Val Trp Arg Glu 15 20 25 Ala Thr Thr Thr Leu Phe Cys Ala Ser Asp Ala Lys Ala Tyr Asp Thr 30 35 40 Glu Val His Asn Val Trp Ala Thr His Ala Cys Val Pro Thr Asp Pro 45 50 55 60 Asn Pro Gln Glu Val Val Leu Gly Asn Val Thr Glu Asn Phe Asn Met 65 70 75 Trp Lys Asn Asn Met Val Asp Gln Met His Glu Asp Ile Ile Ser Leu 80 85 90 Trp Asp Glu Ser Leu Lys Pro Cys Val Lys Leu Thr Pro Leu Cys Val 95 100 105 Thr Leu Asn Cys Thr Asn Leu Asn Ile Thr Lys Asn Thr Thr Asn Pro 110 115 120 Thr Ser Ser Ser Trp Gly Met Met Glu Lys Gly Glu Ile Lys Asn Cys 125 130 135 140 Ser Phe Tyr Ile Thr Thr Ser Ile Arg Asn Lys Val Lys Lys Glu Tyr 145 150 155 Ala Leu Phe Asn Arg Leu Asp Val Val Pro Ile Glu Asn Thr Asn Asn 160 165 170 Thr Lys Tyr Arg Leu Ile Ser Cys Asn Thr Ser Val Ile Thr Gln Ala 175 180 185 Cys Pro Lys Val Ser Phe Gln Pro Ile Pro Ile His Tyr Cys Val Pro 190 195 200 Ala Gly Phe Ala Met Leu Lys Cys Asn Asn Lys Thr Phe Asn Gly Ser 205 210 215 220 Gly Pro Cys Thr Asn Val Ser Thr Val Gln Cys Thr His Gly Ile Arg 225 230 235 Pro Val Val Ser Thr Gln Leu Leu Leu Asn Gly Ser Leu Ala Glu Glu 240 245 250 Asp Ile Val Ile Arg Ser Glu Asn Phe Thr Asp Asn Ala Lys Thr Ile 255 260 265 Ile Val Gln Leu Asn Glu Ser Val Val Ile Asn Cys Thr Arg Pro Asn 270 275 280 Asn Asn Thr Arg Arg Arg Leu Ser Ile Gly Pro Gly Arg Ala Phe Tyr 285 290 295 300 Ala Arg Arg Asn Ile Ile Gly Asp Ile Arg Gln Ala His Cys Asn Ile 305 310 315 Ser Arg Ala Lys Trp Asn Asn Thr Leu Gln Gln Ile Val Ile Lys Leu 320 325 330 Arg Glu Lys Phe Arg Asn Lys Thr Ile Ala Phe Asn Gln Ser Ser Gly 335 340 345 Gly Asp Pro Glu Ile Val Met His Ser Phe Asn Cys Gly Gly Glu Phe 350

355 360 Phe Tyr Cys Asn Thr Ala Gln Leu Phe Asn Ser Thr Trp Asn Val Thr 365 370 375 380 Gly Gly Thr Asn Gly Thr Glu Gly Asn Asp Ile Ile Thr Leu Gln Cys 385 390 395 Arg Ile Lys Gln Ile Ile Asn Met Trp Gln Lys Val Gly Lys Ala Met 400 405 410 Tyr Ala Pro Pro Ile Thr Gly Gln Ile Arg Cys Ser Ser Asn Ile Thr 415 420 425 Gly Leu Leu Leu Thr Arg Asp Gly Gly Asn Ser Thr Glu Thr Glu Thr 430 435 440 Glu Ile Phe Arg Pro Gly Gly Gly Asp Met Arg Asp Asn Trp Arg Ser 445 450 455 460 Glu Leu Tyr Lys Tyr Lys Val Val Arg Ile Glu Pro Ile Gly Val Ala 465 470 475 Pro Thr Arg Ala Lys Arg Arg Thr Val Gln Arg Glu Lys Arg Gly Gly 480 485 490 Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Asp Pro Arg 495 500 505 Arg Leu Asp Lys Ile Glu Asp Glu Arg Asn Leu His Glu Asp Phe Val 510 515 520 Phe Met Lys Thr Ile Gln Arg Cys Asn Thr Gly Glu Arg Ser Leu Ser 525 530 535 540 Leu Leu Asn Cys Glu Glu Ile Lys Ser Gln Phe Glu Gly Phe Val Lys 545 550 555 Asp Ile Met Leu Asn Lys Glu Glu Thr Lys Lys Glu Asn Ser Phe Glu 560 565 570 Met Gln Lys Gly Asp Gln Asn Pro Gln Ile Ala Ala His Val Ile Ser 575 580 585 Glu Ala Ser Ser Lys Thr Thr Ser Val Leu Gln Trp Ala Glu Lys Gly 590 595 600 Tyr Tyr Thr Met Ser Asn Asn Leu Val Thr Leu Glu Asn Gly Lys Gln 605 610 615 620 Leu Thr Val Lys Arg Gln Gly Leu Tyr Tyr Ile Tyr Ala Gln Val Thr 625 630 635 Phe Cys Ser Asn Arg Glu Ala Ser Ser Gln Ala Pro Phe Ile Ala Ser 640 645 650 Leu Cys Leu Lys Ser Pro Gly Arg Phe Glu Arg Ile Leu Leu Arg Ala 655 660 665 Ala Asn Thr His Ser Ser Ala Lys Pro Cys Gly Gln Gln Ser Ile His 670 675 680 Leu Gly Gly Val Phe Glu Leu Gln Pro Gly Ala Ser Val Phe Val Asn 685 690 695 700 Val Thr Asp Pro Ser Gln Val Ser His Gly Thr Gly Phe Thr Ser Phe 705 710 715 Gly Leu Leu Lys Leu Glu 720 21 728 PRT Artificial Sequence Description of Artificial Sequence Synthetic HIV-human fusion construct SIGNAL (1)..(20) Synthetic secretory signal peptide DOMAIN (21)..(513) HIV gp120 domain with ProAspPro linker BINDING (514)..(728) CD154 extracellular domain long form amino acids 48(Arg) to 261(Leu) + Glu binds CD40 21 Met Leu Tyr Thr Ser Gln Leu Leu Gly Leu Leu Leu Phe Trp Ile Ser -20 -15 -10 -5 Ala Ser Arg Ser Met Leu Leu Gly Ile Leu Met Ile Cys Ser Ala Thr -1 1 5 10 Glu Lys Leu Trp Val Thr Val Tyr Tyr Gly Val Pro Val Trp Arg Glu 15 20 25 Ala Thr Thr Thr Leu Phe Cys Ala Ser Asp Ala Lys Ala Tyr Asp Thr 30 35 40 Glu Val His Asn Val Trp Ala Thr His Ala Cys Val Pro Thr Asp Pro 45 50 55 60 Asn Pro Gln Glu Val Val Leu Gly Asn Val Thr Glu Asn Phe Asn Met 65 70 75 Trp Lys Asn Asn Met Val Asp Gln Met His Glu Asp Ile Ile Ser Leu 80 85 90 Trp Asp Glu Ser Leu Lys Pro Cys Val Lys Leu Thr Pro Leu Cys Val 95 100 105 Thr Leu Asn Cys Thr Asn Leu Asn Ile Thr Lys Asn Thr Thr Asn Pro 110 115 120 Thr Ser Ser Ser Trp Gly Met Met Glu Lys Gly Glu Ile Lys Asn Cys 125 130 135 140 Ser Phe Tyr Ile Thr Thr Ser Ile Arg Asn Lys Val Lys Lys Glu Tyr 145 150 155 Ala Leu Phe Asn Arg Leu Asp Val Val Pro Ile Glu Asn Thr Asn Asn 160 165 170 Thr Lys Tyr Arg Leu Ile Ser Cys Asn Thr Ser Val Ile Thr Gln Ala 175 180 185 Cys Pro Lys Val Ser Phe Gln Pro Ile Pro Ile His Tyr Cys Val Pro 190 195 200 Ala Gly Phe Ala Met Leu Lys Cys Asn Asn Lys Thr Phe Asn Gly Ser 205 210 215 220 Gly Pro Cys Thr Asn Val Ser Thr Val Gln Cys Thr His Gly Ile Arg 225 230 235 Pro Val Val Ser Thr Gln Leu Leu Leu Asn Gly Ser Leu Ala Glu Glu 240 245 250 Asp Ile Val Ile Arg Ser Glu Asn Phe Thr Asp Asn Ala Lys Thr Ile 255 260 265 Ile Val Gln Leu Asn Glu Ser Val Val Ile Asn Cys Thr Arg Pro Asn 270 275 280 Asn Asn Thr Arg Arg Arg Leu Ser Ile Gly Pro Gly Arg Ala Phe Tyr 285 290 295 300 Ala Arg Arg Asn Ile Ile Gly Asp Ile Arg Gln Ala His Cys Asn Ile 305 310 315 Ser Arg Ala Lys Trp Asn Asn Thr Leu Gln Gln Ile Val Ile Lys Leu 320 325 330 Arg Glu Lys Phe Arg Asn Lys Thr Ile Ala Phe Asn Gln Ser Ser Gly 335 340 345 Gly Asp Pro Glu Ile Val Met His Ser Phe Asn Cys Gly Gly Glu Phe 350 355 360 Phe Tyr Cys Asn Thr Ala Gln Leu Phe Asn Ser Thr Trp Asn Val Thr 365 370 375 380 Gly Gly Thr Asn Gly Thr Glu Gly Asn Asp Ile Ile Thr Leu Gln Cys 385 390 395 Arg Ile Lys Gln Ile Ile Asn Met Trp Gln Lys Val Gly Lys Ala Met 400 405 410 Tyr Ala Pro Pro Ile Thr Gly Gln Ile Arg Cys Ser Ser Asn Ile Thr 415 420 425 Gly Leu Leu Leu Thr Arg Asp Gly Gly Asn Ser Thr Glu Thr Glu Thr 430 435 440 Glu Ile Phe Arg Pro Gly Gly Gly Asp Met Arg Asp Asn Trp Arg Ser 445 450 455 460 Glu Leu Tyr Lys Tyr Lys Val Val Arg Ile Glu Pro Ile Gly Val Ala 465 470 475 Pro Thr Arg Ala Lys Arg Arg Thr Val Gln Arg Glu Lys Arg Pro Asp 480 485 490 Pro Arg Arg Leu Asp Lys Ile Glu Asp Glu Arg Asn Leu His Glu Asp 495 500 505 Phe Val Phe Met Lys Thr Ile Gln Arg Cys Asn Thr Gly Glu Arg Ser 510 515 520 Leu Ser Leu Leu Asn Cys Glu Glu Ile Lys Ser Gln Phe Glu Gly Phe 525 530 535 540 Val Lys Asp Ile Met Leu Asn Lys Glu Glu Thr Lys Lys Glu Asn Ser 545 550 555 Phe Glu Met Gln Lys Gly Asp Gln Asn Pro Gln Ile Ala Ala His Val 560 565 570 Ile Ser Glu Ala Ser Ser Lys Thr Thr Ser Val Leu Gln Trp Ala Glu 575 580 585 Lys Gly Tyr Tyr Thr Met Ser Asn Asn Leu Val Thr Leu Glu Asn Gly 590 595 600 Lys Gln Leu Thr Val Lys Arg Gln Gly Leu Tyr Tyr Ile Tyr Ala Gln 605 610 615 620 Val Thr Phe Cys Ser Asn Arg Glu Ala Ser Ser Gln Ala Pro Phe Ile 625 630 635 Ala Ser Leu Cys Leu Lys Ser Pro Gly Arg Phe Glu Arg Ile Leu Leu 640 645 650 Arg Ala Ala Asn Thr His Ser Ser Ala Lys Pro Cys Gly Gln Gln Ser 655 660 665 Ile His Leu Gly Gly Val Phe Glu Leu Gln Pro Gly Ala Ser Val Phe 670 675 680 Val Asn Val Thr Asp Pro Ser Gln Val Ser His Gly Thr Gly Phe Thr 685 690 695 700 Ser Phe Gly Leu Leu Lys Leu Glu 705 22 682 PRT Artificial Sequence Description of Artificial Sequence Synthetic HIV-human fusion construct SIGNAL (1)..(20) Synthetic secretory signal peptide DOMAIN (21)..(525) HIV gp120 domain with (Gly4Ser)3 linker BINDING (528)..(682) CD154 extracellular domain long form amino acids 108(Glu) to 261(Leu) + Glu binds CD40 22 Met Leu Tyr Thr Ser Gln Leu Leu Gly Leu Leu Leu Phe Trp Ile Ser -20 -15 -10 -5 Ala Ser Arg Ser Met Leu Leu Gly Ile Leu Met Ile Cys Ser Ala Thr -1 1 5 10 Glu Lys Leu Trp Val Thr Val Tyr Tyr Gly Val Pro Val Trp Arg Glu 15 20 25 Ala Thr Thr Thr Leu Phe Cys Ala Ser Asp Ala Lys Ala Tyr Asp Thr 30 35 40 Glu Val His Asn Val Trp Ala Thr His Ala Cys Val Pro Thr Asp Pro 45 50 55 60 Asn Pro Gln Glu Val Val Leu Gly Asn Val Thr Glu Asn Phe Asn Met 65 70 75 Trp Lys Asn Asn Met Val Asp Gln Met His Glu Asp Ile Ile Ser Leu 80 85 90 Trp Asp Glu Ser Leu Lys Pro Cys Val Lys Leu Thr Pro Leu Cys Val 95 100 105 Thr Leu Asn Cys Thr Asn Leu Asn Ile Thr Lys Asn Thr Thr Asn Pro 110 115 120 Thr Ser Ser Ser Trp Gly Met Met Glu Lys Gly Glu Ile Lys Asn Cys 125 130 135 140 Ser Phe Tyr Ile Thr Thr Ser Ile Arg Asn Lys Val Lys Lys Glu Tyr 145 150 155 Ala Leu Phe Asn Arg Leu Asp Val Val Pro Ile Glu Asn Thr Asn Asn 160 165 170 Thr Lys Tyr Arg Leu Ile Ser Cys Asn Thr Ser Val Ile Thr Gln Ala 175 180 185 Cys Pro Lys Val Ser Phe Gln Pro Ile Pro Ile His Tyr Cys Val Pro 190 195 200 Ala Gly Phe Ala Met Leu Lys Cys Asn Asn Lys Thr Phe Asn Gly Ser 205 210 215 220 Gly Pro Cys Thr Asn Val Ser Thr Val Gln Cys Thr His Gly Ile Arg 225 230 235 Pro Val Val Ser Thr Gln Leu Leu Leu Asn Gly Ser Leu Ala Glu Glu 240 245 250 Asp Ile Val Ile Arg Ser Glu Asn Phe Thr Asp Asn Ala Lys Thr Ile 255 260 265 Ile Val Gln Leu Asn Glu Ser Val Val Ile Asn Cys Thr Arg Pro Asn 270 275 280 Asn Asn Thr Arg Arg Arg Leu Ser Ile Gly Pro Gly Arg Ala Phe Tyr 285 290 295 300 Ala Arg Arg Asn Ile Ile Gly Asp Ile Arg Gln Ala His Cys Asn Ile 305 310 315 Ser Arg Ala Lys Trp Asn Asn Thr Leu Gln Gln Ile Val Ile Lys Leu 320 325 330 Arg Glu Lys Phe Arg Asn Lys Thr Ile Ala Phe Asn Gln Ser Ser Gly 335 340 345 Gly Asp Pro Glu Ile Val Met His Ser Phe Asn Cys Gly Gly Glu Phe 350 355 360 Phe Tyr Cys Asn Thr Ala Gln Leu Phe Asn Ser Thr Trp Asn Val Thr 365 370 375 380 Gly Gly Thr Asn Gly Thr Glu Gly Asn Asp Ile Ile Thr Leu Gln Cys 385 390 395 Arg Ile Lys Gln Ile Ile Asn Met Trp Gln Lys Val Gly Lys Ala Met 400 405 410 Tyr Ala Pro Pro Ile Thr Gly Gln Ile Arg Cys Ser Ser Asn Ile Thr 415 420 425 Gly Leu Leu Leu Thr Arg Asp Gly Gly Asn Ser Thr Glu Thr Glu Thr 430 435 440 Glu Ile Phe Arg Pro Gly Gly Gly Asp Met Arg Asp Asn Trp Arg Ser 445 450 455 460 Glu Leu Tyr Lys Tyr Lys Val Val Arg Ile Glu Pro Ile Gly Val Ala 465 470 475 Pro Thr Arg Ala Lys Arg Arg Thr Val Gln Arg Glu Lys Arg Gly Gly 480 485 490 Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Asp Pro Glu 495 500 505 Asn Ser Phe Glu Met Gln Lys Gly Asp Gln Asn Pro Gln Ile Ala Ala 510 515 520 His Val Ile Ser Glu Ala Ser Ser Lys Thr Thr Ser Val Leu Gln Trp 525 530 535 540 Ala Glu Lys Gly Tyr Tyr Thr Met Ser Asn Asn Leu Val Thr Leu Glu 545 550 555 Asn Gly Lys Gln Leu Thr Val Lys Arg Gln Gly Leu Tyr Tyr Ile Tyr 560 565 570 Ala Gln Val Thr Phe Cys Ser Asn Arg Glu Ala Ser Ser Gln Ala Pro 575 580 585 Phe Ile Ala Ser Leu Cys Leu Lys Ser Pro Gly Arg Phe Glu Arg Ile 590 595 600 Leu Leu Arg Ala Ala Asn Thr His Ser Ser Ala Lys Pro Cys Gly Gln 605 610 615 620 Gln Ser Ile His Leu Gly Gly Val Phe Glu Leu Gln Pro Gly Ala Ser 625 630 635 Val Phe Val Asn Val Thr Asp Pro Ser Gln Val Ser His Gly Thr Gly 640 645 650 Phe Thr Ser Phe Gly Leu Leu Lys Leu Glu 655 660 23 668 PRT Artificial Sequence Description of Artificial Sequence Synthetic HIV-human fusion construct SIGNAL (1)..(20) Synthetic secretory signal peptide DOMAIN (21)..(513) HIV gp120 domain with ProAspPro linker BINDING (514)..(668) CD154 extracellular domain long form amino acids 108(Glu) to 261(Leu) + Glu binds CD40 23 Met Leu Tyr Thr Ser Gln Leu Leu Gly Leu Leu Leu Phe Trp Ile Ser -20 -15 -10 -5 Ala Ser Arg Ser Met Leu Leu Gly Ile Leu Met Ile Cys Ser Ala Thr -1 1 5 10 Glu Lys Leu Trp Val Thr Val Tyr Tyr Gly Val Pro Val Trp Arg Glu 15 20 25 Ala Thr Thr Thr Leu Phe Cys Ala Ser Asp Ala Lys Ala Tyr Asp Thr 30 35 40 Glu Val His Asn Val Trp Ala Thr His Ala Cys Val Pro Thr Asp Pro 45 50 55 60 Asn Pro Gln Glu Val Val Leu Gly Asn Val Thr Glu Asn Phe Asn Met 65 70 75 Trp Lys Asn Asn Met Val Asp Gln Met His Glu Asp Ile Ile Ser Leu 80 85 90 Trp Asp Glu Ser Leu Lys Pro Cys Val Lys Leu Thr Pro Leu Cys Val 95 100 105 Thr Leu Asn Cys Thr Asn Leu Asn Ile Thr Lys Asn Thr Thr Asn Pro 110 115 120 Thr Ser Ser Ser Trp Gly Met Met Glu Lys Gly Glu Ile Lys Asn Cys 125 130 135 140 Ser Phe Tyr Ile Thr Thr Ser Ile Arg Asn Lys Val Lys Lys Glu Tyr 145 150 155 Ala Leu Phe Asn Arg Leu Asp Val Val Pro Ile Glu Asn Thr Asn Asn 160 165 170 Thr Lys Tyr Arg Leu Ile Ser Cys Asn Thr Ser Val Ile Thr Gln Ala 175 180 185 Cys Pro Lys Val Ser Phe Gln Pro Ile Pro Ile His Tyr Cys Val Pro 190 195 200 Ala Gly Phe Ala Met Leu Lys Cys Asn Asn Lys Thr Phe Asn Gly Ser 205 210 215 220 Gly Pro Cys Thr Asn Val Ser Thr Val Gln Cys Thr His Gly Ile Arg 225 230 235 Pro Val Val Ser Thr Gln Leu Leu Leu Asn Gly Ser Leu Ala Glu Glu 240 245 250 Asp Ile Val Ile Arg Ser Glu Asn Phe Thr Asp Asn Ala Lys Thr Ile 255 260 265 Ile Val Gln Leu Asn Glu Ser Val Val Ile Asn Cys Thr Arg Pro Asn 270 275 280 Asn Asn Thr Arg Arg Arg Leu Ser Ile Gly Pro Gly Arg Ala Phe Tyr 285 290 295 300 Ala Arg Arg Asn Ile Ile Gly Asp Ile Arg Gln Ala His Cys Asn Ile 305 310 315 Ser Arg Ala Lys Trp Asn Asn Thr Leu Gln Gln Ile Val Ile Lys Leu 320 325 330 Arg Glu Lys Phe Arg Asn Lys Thr Ile Ala Phe Asn Gln Ser Ser Gly 335 340 345 Gly Asp Pro Glu Ile Val Met His Ser Phe Asn Cys Gly Gly Glu Phe 350 355 360 Phe Tyr Cys Asn Thr Ala Gln Leu Phe Asn Ser Thr Trp Asn Val Thr 365 370 375 380 Gly Gly Thr Asn Gly Thr Glu Gly Asn Asp Ile Ile Thr Leu Gln Cys 385 390 395 Arg Ile Lys Gln Ile Ile Asn Met Trp Gln Lys Val Gly Lys Ala Met 400 405 410 Tyr Ala Pro Pro Ile Thr Gly Gln Ile Arg Cys Ser Ser Asn Ile Thr 415 420 425 Gly Leu Leu Leu Thr Arg Asp Gly Gly Asn Ser Thr Glu Thr Glu Thr 430 435 440 Glu Ile Phe Arg Pro Gly Gly Gly Asp Met Arg Asp Asn Trp Arg Ser 445 450 455 460 Glu Leu Tyr Lys Tyr Lys Val Val Arg Ile Glu Pro Ile Gly Val Ala 465 470 475 Pro Thr Arg Ala Lys Arg Arg Thr Val Gln Arg Glu Lys Arg Pro Asp 480 485 490 Pro Glu Asn Ser Phe Glu Met Gln Lys Gly Asp Gln Asn Pro Gln Ile 495 500 505 Ala Ala His Val Ile Ser Glu Ala Ser Ser Lys Thr Thr Ser Val Leu 510

515 520 Gln Trp Ala Glu Lys Gly Tyr Tyr Thr Met Ser Asn Asn Leu Val Thr 525 530 535 540 Leu Glu Asn Gly Lys Gln Leu Thr Val Lys Arg Gln Gly Leu Tyr Tyr 545 550 555 Ile Tyr Ala Gln Val Thr Phe Cys Ser Asn Arg Glu Ala Ser Ser Gln 560 565 570 Ala Pro Phe Ile Ala Ser Leu Cys Leu Lys Ser Pro Gly Arg Phe Glu 575 580 585 Arg Ile Leu Leu Arg Ala Ala Asn Thr His Ser Ser Ala Lys Pro Cys 590 595 600 Gly Gln Gln Ser Ile His Leu Gly Gly Val Phe Glu Leu Gln Pro Gly 605 610 615 620 Ala Ser Val Phe Val Asn Val Thr Asp Pro Ser Gln Val Ser His Gly 625 630 635 Thr Gly Phe Thr Ser Phe Gly Leu Leu Lys Leu Glu 640 645 24 294 PRT Artificial Sequence Description of Artificial Sequence Synthetic HIV-human fusion construct SIGNAL (1)..(20) Synthetic secretory signal peptide DOMAIN (21)..(77) HIV gp120 V3 loop with (Gly4Ser)3 linker BINDING (80)..(294) CD154 extracellular domain long form amino acids 48(Arg) to 261(Leu) + Glu binds CD40 24 Met Leu Tyr Thr Ser Gln Leu Leu Gly Leu Leu Leu Phe Trp Ile Ser -20 -15 -10 -5 Ala Ser Arg Ser Val Val Ile Asn Cys Thr Arg Pro Asn Asn Asn Thr -1 1 5 10 Arg Arg Arg Leu Ser Ile Gly Pro Gly Arg Ala Phe Tyr Ala Arg Arg 15 20 25 Asn Ile Ile Gly Asp Ile Arg Gln Ala His Cys Asn Ile Ser Gly Gly 30 35 40 Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Asp Pro Arg 45 50 55 60 Arg Leu Asp Lys Ile Glu Asp Glu Arg Asn Leu His Glu Asp Phe Val 65 70 75 Phe Met Lys Thr Ile Gln Arg Cys Asn Thr Gly Glu Arg Ser Leu Ser 80 85 90 Leu Leu Asn Cys Glu Glu Ile Lys Ser Gln Phe Glu Gly Phe Val Lys 95 100 105 Asp Ile Met Leu Asn Lys Glu Glu Thr Lys Lys Glu Asn Ser Phe Glu 110 115 120 Met Gln Lys Gly Asp Gln Asn Pro Gln Ile Ala Ala His Val Ile Ser 125 130 135 140 Glu Ala Ser Ser Lys Thr Thr Ser Val Leu Gln Trp Ala Glu Lys Gly 145 150 155 Tyr Tyr Thr Met Ser Asn Asn Leu Val Thr Leu Glu Asn Gly Lys Gln 160 165 170 Leu Thr Val Lys Arg Gln Gly Leu Tyr Tyr Ile Tyr Ala Gln Val Thr 175 180 185 Phe Cys Ser Asn Arg Glu Ala Ser Ser Gln Ala Pro Phe Ile Ala Ser 190 195 200 Leu Cys Leu Lys Ser Pro Gly Arg Phe Glu Arg Ile Leu Leu Arg Ala 205 210 215 220 Ala Asn Thr His Ser Ser Ala Lys Pro Cys Gly Gln Gln Ser Ile His 225 230 235 Leu Gly Gly Val Phe Glu Leu Gln Pro Gly Ala Ser Val Phe Val Asn 240 245 250 Val Thr Asp Pro Ser Gln Val Ser His Gly Thr Gly Phe Thr Ser Phe 255 260 265 Gly Leu Leu Lys Leu Glu 270 25 280 PRT Artificial Sequence Description of Artificial Sequence Synthetic HIV-human fusion construct SIGNAL (1)..(20) Synthetic secretory signal peptide DOMAIN (21)..(65) HIV gp120 V3 loop with ProAspPro linker BINDING (66)..(280) CD154 extracellular domain long form amino acids 48(Arg) to 261(Leu) + Glu binds CD40 25 Met Leu Tyr Thr Ser Gln Leu Leu Gly Leu Leu Leu Phe Trp Ile Ser -20 -15 -10 -5 Ala Ser Arg Ser Val Val Ile Asn Cys Thr Arg Pro Asn Asn Asn Thr -1 1 5 10 Arg Arg Arg Leu Ser Ile Gly Pro Gly Arg Ala Phe Tyr Ala Arg Arg 15 20 25 Asn Ile Ile Gly Asp Ile Arg Gln Ala His Cys Asn Ile Ser Pro Asp 30 35 40 Pro Arg Arg Leu Asp Lys Ile Glu Asp Glu Arg Asn Leu His Glu Asp 45 50 55 60 Phe Val Phe Met Lys Thr Ile Gln Arg Cys Asn Thr Gly Glu Arg Ser 65 70 75 Leu Ser Leu Leu Asn Cys Glu Glu Ile Lys Ser Gln Phe Glu Gly Phe 80 85 90 Val Lys Asp Ile Met Leu Asn Lys Glu Glu Thr Lys Lys Glu Asn Ser 95 100 105 Phe Glu Met Gln Lys Gly Asp Gln Asn Pro Gln Ile Ala Ala His Val 110 115 120 Ile Ser Glu Ala Ser Ser Lys Thr Thr Ser Val Leu Gln Trp Ala Glu 125 130 135 140 Lys Gly Tyr Tyr Thr Met Ser Asn Asn Leu Val Thr Leu Glu Asn Gly 145 150 155 Lys Gln Leu Thr Val Lys Arg Gln Gly Leu Tyr Tyr Ile Tyr Ala Gln 160 165 170 Val Thr Phe Cys Ser Asn Arg Glu Ala Ser Ser Gln Ala Pro Phe Ile 175 180 185 Ala Ser Leu Cys Leu Lys Ser Pro Gly Arg Phe Glu Arg Ile Leu Leu 190 195 200 Arg Ala Ala Asn Thr His Ser Ser Ala Lys Pro Cys Gly Gln Gln Ser 205 210 215 220 Ile His Leu Gly Gly Val Phe Glu Leu Gln Pro Gly Ala Ser Val Phe 225 230 235 Val Asn Val Thr Asp Pro Ser Gln Val Ser His Gly Thr Gly Phe Thr 240 245 250 Ser Phe Gly Leu Leu Lys Leu Glu 255 260 26 234 PRT Artificial Sequence Description of Artificial Sequence Synthetic HIV-human fusion construct SIGNAL (1)..(20) Synthetic secretory signal peptide DOMAIN (21)..(77) HIV gp120 V3 loop with (Gly4Ser)3 linker BINDING (80)..(234) CD154 extracellular domain long form amino acids 108(Glu) to 261(Leu) + Glu binds CD40 26 Met Leu Tyr Thr Ser Gln Leu Leu Gly Leu Leu Leu Phe Trp Ile Ser -20 -15 -10 -5 Ala Ser Arg Ser Val Val Ile Asn Cys Thr Arg Pro Asn Asn Asn Thr -1 1 5 10 Arg Arg Arg Leu Ser Ile Gly Pro Gly Arg Ala Phe Tyr Ala Arg Arg 15 20 25 Asn Ile Ile Gly Asp Ile Arg Gln Ala His Cys Asn Ile Ser Gly Gly 30 35 40 Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Asp Pro Glu 45 50 55 60 Asn Ser Phe Glu Met Gln Lys Gly Asp Gln Asn Pro Gln Ile Ala Ala 65 70 75 His Val Ile Ser Glu Ala Ser Ser Lys Thr Thr Ser Val Leu Gln Trp 80 85 90 Ala Glu Lys Gly Tyr Tyr Thr Met Ser Asn Asn Leu Val Thr Leu Glu 95 100 105 Asn Gly Lys Gln Leu Thr Val Lys Arg Gln Gly Leu Tyr Tyr Ile Tyr 110 115 120 Ala Gln Val Thr Phe Cys Ser Asn Arg Glu Ala Ser Ser Gln Ala Pro 125 130 135 140 Phe Ile Ala Ser Leu Cys Leu Lys Ser Pro Gly Arg Phe Glu Arg Ile 145 150 155 Leu Leu Arg Ala Ala Asn Thr His Ser Ser Ala Lys Pro Cys Gly Gln 160 165 170 Gln Ser Ile His Leu Gly Gly Val Phe Glu Leu Gln Pro Gly Ala Ser 175 180 185 Val Phe Val Asn Val Thr Asp Pro Ser Gln Val Ser His Gly Thr Gly 190 195 200 Phe Thr Ser Phe Gly Leu Leu Lys Leu Glu 205 210 27 220 PRT Artificial Sequence Description of Artificial Sequence Synthetic HIV-human fusion construct SIGNAL (1)..(20) Synthetic secretory signal peptide DOMAIN (21)..(65) HIV gp120 V3 loop with ProAspPro linker BINDING (66)..(220) CD154 extracellular domain long form amino acids 108(Glu) to 261(Leu) + Glu binds CD40 27 Met Leu Tyr Thr Ser Gln Leu Leu Gly Leu Leu Leu Phe Trp Ile Ser -20 -15 -10 -5 Ala Ser Arg Ser Val Val Ile Asn Cys Thr Arg Pro Asn Asn Asn Thr -1 1 5 10 Arg Arg Arg Leu Ser Ile Gly Pro Gly Arg Ala Phe Tyr Ala Arg Arg 15 20 25 Asn Ile Ile Gly Asp Ile Arg Gln Ala His Cys Asn Ile Ser Pro Asp 30 35 40 Pro Glu Asn Ser Phe Glu Met Gln Lys Gly Asp Gln Asn Pro Gln Ile 45 50 55 60 Ala Ala His Val Ile Ser Glu Ala Ser Ser Lys Thr Thr Ser Val Leu 65 70 75 Gln Trp Ala Glu Lys Gly Tyr Tyr Thr Met Ser Asn Asn Leu Val Thr 80 85 90 Leu Glu Asn Gly Lys Gln Leu Thr Val Lys Arg Gln Gly Leu Tyr Tyr 95 100 105 Ile Tyr Ala Gln Val Thr Phe Cys Ser Asn Arg Glu Ala Ser Ser Gln 110 115 120 Ala Pro Phe Ile Ala Ser Leu Cys Leu Lys Ser Pro Gly Arg Phe Glu 125 130 135 140 Arg Ile Leu Leu Arg Ala Ala Asn Thr His Ser Ser Ala Lys Pro Cys 145 150 155 Gly Gln Gln Ser Ile His Leu Gly Gly Val Phe Glu Leu Gln Pro Gly 160 165 170 Ala Ser Val Phe Val Asn Val Thr Asp Pro Ser Gln Val Ser His Gly 175 180 185 Thr Gly Phe Thr Ser Phe Gly Leu Leu Lys Leu Glu 190 195 200 28 6 PRT Human immunodeficiency virus type 1 28 Gly Pro Gly Arg Ala Phe 1 5 29 15 PRT Artificial Sequence Description of Artificial Sequence Linker peptide 29 Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser 1 5 10 15

Claims

1. A vaccine comprising one or more antigens linked to a domain that binds at least one receptor.

2. A vaccine of claim 1 where said receptor is CD40.

3. A vaccine of claim 1 where said domain is CD154 or a portion of CD154.

4. A vaccine of claim 1 where said domain is a single chain Fv that binds CD40.

5. A vaccine of claim 1 where said domain binds to one or more receptors selected from the group consisting of CD80, CD86, CD32, CD64, CD83, ICOS ligand, Flt3, CD10, CD11, CD14, CD15, CD16, CD18, CD19, CD20, CD21, CD22, CD23, CD37, CD38, CD39, CD43, CD56, CD58, CD72, CD75, CD76, CD77, CD78, and cytokine/growth factor receptors.

6. A vaccine of claim 1 where said antigen is HIV-1 gp160 or a portion of HIV-1 gp160.

7. A vaccine of claim 1 where said antigen is a tumor antigen or a microbial antigen.

8. A DNA expression plasmid encoding a vaccine comprising one or more antigens linked to a domain that binds at least one receptor.

9. A DNA expression plasmid of claim 8 encoding a vaccine where said receptor is CD40.

10. A DNA expression plasmid of claim 8 encoding a vaccine where said domain is CD154 or a portion of CD154.

11. A DNA expression plasmid of claim 8 encoding a vaccine where said domain is a single chain Fv that binds CD40.

12. A DNA expression plasmid of claim 8 encoding a vaccine where said domain binds to one or more antigens selected from the group consisting of CD80, CD86, CD32, CD64, CD83, ICOS ligand, Flt3, CD10, CD11, CD14, CD15, CD16, CD18, CD19, CD20, CD21, CD22, CD23, CD37, CD38, CD39, CD43, CD56, CD58, CD72, CD75, CD76, CD77, CD78, and cytokine/growth factor receptors.

13. A DNA expression plasmid of claim 8 encoding a vaccine where said antigen is HIV-1 gp160 or a portion of HIV-1 gp160.

14. A DNA expression plasmid of claim 8 encoding a vaccine where said antigen is a tumor antigen or a microbial antigen.