U.S. patent application number 11/532050 was filed with the patent office on 2007-01-25 for human oncogene induced secreted protein i.
This patent application is currently assigned to Human Genome Sciences, Inc.. Invention is credited to Henrik S. Olsen, Steven M. Ruben.
Application Number | 20070020277 11/532050 |
Document ID | / |
Family ID | 26710243 |
Filed Date | 2007-01-25 |
United States Patent
Application |
20070020277 |
Kind Code |
A1 |
Olsen; Henrik S. ; et
al. |
January 25, 2007 |
Human Oncogene Induced Secreted Protein I
Abstract
The present invention relates to a novel protein, the Human
Oncogene Induced Secreted Protein I ("HOIPS I") protein. In
particular, isolated nucleic acid molecules are provided encoding
the human HOIPS I protein. HOIPS I polypeptides are also provided
as are vectors, host cells and recombinant methods for producing
the same. Antibodies to human HOIPS I are also provided, as are
diagnostic methods for detecting abnormal cell proliferation and
differentiation disorders and therapeutic methods for treating the
same.
Inventors: |
Olsen; Henrik S.;
(Gaithersburg, MD) ; Ruben; Steven M.;
(Brookeville, MD) |
Correspondence
Address: |
HUMAN GENOME SCIENCES INC.;INTELLECTUAL PROPERTY DEPT.
14200 SHADY GROVE ROAD
ROCKVILLE
MD
20850
US
|
Assignee: |
Human Genome Sciences, Inc.
Rockville
MD
|
Family ID: |
26710243 |
Appl. No.: |
11/532050 |
Filed: |
September 14, 2006 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10909386 |
Aug 3, 2004 |
7109306 |
|
|
11532050 |
Sep 14, 2006 |
|
|
|
09899917 |
Jul 9, 2001 |
6800731 |
|
|
10909386 |
Aug 3, 2004 |
|
|
|
08994962 |
Dec 19, 1997 |
6284486 |
|
|
09899917 |
Jul 9, 2001 |
|
|
|
60033869 |
Dec 20, 1996 |
|
|
|
60037388 |
Feb 7, 1997 |
|
|
|
Current U.S.
Class: |
424/155.1 ;
435/320.1; 435/325; 435/6.16; 435/69.1; 514/44R; 530/350;
530/388.8; 536/23.5 |
Current CPC
Class: |
A61K 48/00 20130101;
C07K 14/47 20130101; A61K 38/00 20130101; C12N 2799/026
20130101 |
Class at
Publication: |
424/155.1 ;
514/044; 435/006; 435/069.1; 435/320.1; 435/325; 530/350;
530/388.8; 536/023.5 |
International
Class: |
A61K 48/00 20070101
A61K048/00; C12Q 1/68 20060101 C12Q001/68; C07H 21/04 20060101
C07H021/04; C12P 21/06 20060101 C12P021/06; A61K 39/395 20060101
A61K039/395; C07K 14/82 20070101 C07K014/82 |
Claims
1. An isolated nucleic acid molecule comprising a polynucleotide
having a nucleotide sequence at least 95% identical to a sequence
selected from the group consisting of: (a) a nucleotide sequence
encoding a polypeptide comprising amino acids from about -20 to
about 142 in SEQ ID NO:2; (b) a nucleotide sequence encoding a
polypeptide comprising amino acids from about -19 to about 142 in
FIG. 1 SEQ ID NO:2; (c) a nucleotide sequence encoding a
polypeptide comprising amino acids from about 1 to about 142 in SEQ
ID NO:2; (d) a nucleotide sequence encoding a polypeptide having
the amino acid sequence encoded by the cDNA clone contained in ATCC
Deposit No. 97825; (e) a nucleotide sequence encoding the mature
HOIPS I polypeptide having the amino acid sequence encoded by the
cDNA clone contained in ATCC Deposit No. 97825; and (f) a
nucleotide sequence complementary to any of the nucleotide
sequences in (a), (b), (c), (d) or (e).
2. The nucleic acid molecule of claim 1, wherein said
polynucleotide has the nucleotide sequence in SEQ ID NO:1.
3. An isolated nucleic acid molecule comprising a polynucleotide
which hybridizes under stringent hybridization conditions to a
polynucleotide having a nucleotide sequence identical to a
nucleotide sequence in (a), (b), (c), (d), (e) or (f) of claim 1
wherein said polynucleotide which hybridizes does not hybridize
under stringent hybridization conditions to a polynucleotide having
a nucleotide sequence consisting of only A residues or of only T
residues.
4. An isolated nucleic acid molecule comprising a polynucleotide
which encodes the amino acid sequence of an epitope-bearing portion
of a HOIPS I polypeptide having an amino acid sequence in (a), (b),
(c), (d), or (e) of claim 1.
5. A method for making a recombinant vector comprising inserting an
isolated nucleic acid molecule of claim 1 into a vector.
6. A recombinant vector produced by the method of claim 5.
7. A method of making a recombinant host cell comprising
introducing the recombinant vector of claim 6 into a host cell.
8. A recombinant host cell produced by the method of claim 7.
9. A recombinant method for producing a HOIPS I polypeptide,
comprising culturing the recombinant host cell of claim 8 under
conditions such that said polypeptide is expressed and recovering
said polypeptide.
10. An isolated HOIPS I polypeptide having an amino acid sequence
at least 95% identical to a sequence selected from the group
consisting of: (a) amino acids from about -20 to about 142 in SEQ
ID NO:2; (b) amino acids from about -19 to about 142 in SEQ ID
NO:2; (c) amino acids from about 1 to about 142 in SEQ ID NO:2; (d)
the amino acid sequence of the HOIPS I polypeptide having the amino
acid sequence encoded by the cDNA clone contained in ATCC Deposit
No. 97825; (e) the amino acid sequence of the mature HOIPS I
polypeptide having the amino acid sequence encoded by the cDNA
clone contained in ATCC Deposit No. 97825; and (f) the amino acid
sequence of an epitope-bearing portion of any one of the
polypeptides of (a), (b), (c), (d), or (e).
11. The isolated polypeptide of claim 10, which is produced or
contained in a recombinant host cell.
12. The isolated polypeptide of claim 11, wherein said recombinant
host cell is mammalian.
13. An isolated antibody that binds specifically to the polypeptide
of claim 10.
14. A pharmaceutical composition comprising: (a) the antibody of
claim 13, and (b) a pharmaceutically acceptable carrier.
15. A method of diagnosing a cell proliferative or differentiation
disorder comprising using the polynucleotide of claim 3 to
determine the level of HOIPS I mRNA in a biological sample, wherein
an increase in the level of HOIPS I mRNA compared to the standard
is indicative of a cell proliferative or differentiation
disorder.
16. The method of claim 15 wherein the cell proliferative or
differentiation disorder is cancer.
17. A method of treating a subject having or developing a HOIPS I
related cell proliferative and/or differentiation disorder
comprising administering the antibody of claim 13.
18. A method of treating a subject having or developing a HOIPS I
related cell proliferative or differentiation disorder comprising
administering the recombinant vector of claim 6 to an abnormally
proliferating cell or cells.
Description
CROSS REFERENCE TO RELATED APPLICATIONS
[0001] This application is a divisional of U.S. application Ser.
No. 10/909,386, filed Aug. 3, 2004, which is a divisional of U.S.
application Ser. No. 09/899,917, filed Jul. 9, 2001 (now U.S. Pat.
No. 6,800,731, issued Oct. 5, 2004), which is a divisional of U.S.
application Ser. No. 08/994,962, filed Dec. 19, 1997 (now U.S. Pat.
No. 6,284,486, issued Sep. 4, 2001), which claims benefit under 35.
U.S.C. .sctn. 119(e) of Provisional U.S. App. Nos. 60/033,869,
filed Dec. 20, 1996, and 60/037,388, filed Feb. 7, 1997, all of
which are hereby incorporated herein by reference.
FIELD OF THE INVENTION
[0002] Isolated nucleic acid molecules are provided encoding a
human oncogene induced secreted protein I (HOIPS I). HOIPS I
polypeptides are also provided, as are vectors, host cells and
recombinant methods for producing the same. Also provided are
diagnostic methods for detecting myeloid cells expressing the HOIPS
I gene and therapeutic methods for treating cell-proliferative
diseases.
BACKGROUND OF THE INVENTION
[0003] Hematopoiesis is the development and formation of blood
cells in the bone marrow, and is critical to the proper functioning
of the immune response. Differentiation of the myeloid cell lineage
(granulocytes and monocytes/macrophages) termed myelopoiesis
commences in the human fetus at approximately six weeks of
gestation. In the early stages of myelopoiesis, colony-forming
units for granulocytes/monocytes (CFU-GMs) can be induced along
either the granulocyte or monocyte pathways. Induction of the
CFU-GM's along the granulocyte pathway results in distinct
morphological stages of development, ultimately terminating in the
characteristic trilobed structure of polymorphonuclear leukocytes,
also known as granulocytes.
[0004] Induction of CFU-GMs along the monocyte pathway gives rise
initially to proliferating monoblasts. Monoblasts differentiate
into promonocytes and, ultimately, into mature monocytes. Monocytes
are considered to be circulating immature macrophages, which are
highly differentiated cells found in various tissues.
[0005] Monocyte-macrophages are known to secrete a number of
biologically active polypeptides called cytokines that affect the
functions of other cells. Interleukin-1 (IL-1), interleukin-6
(IL-6), and tumor necrosis factor-alpha (TNF-.alpha.) are all
cytokines secreted by monocytes/macrophages that play an important
role in hematopoiesis.
[0006] A continued need exists for the further identification and
characterization of the other cytokines and growth factors involved
in hematopoiesis and immunoregulation.
[0007] Abnormal expression of the genes encoding the various
cytokines and growth factors involved in cell differentiation and
proliferation can result in neoplasias, including leukemias.
Leukemia is defined as a progressive malignant disease of the
blood-forming organs, characterized by distorted proliferation and
development of leukocytes and their precursors in the blood and
bone marrow. The leukemias account for approximately 3 percent of
all cancers in the United States. (Li, F. P., "The Chronic
Leukemias: Etiology and Epidemiology," in Neoplastic Diseases of
the Blood, vol. I, pp. 7-17, Wiernik et al. eds. (1985)).
[0008] Oncogenes have been implicated as a cause of human
leukemias. Gelmann, E. P. et al., "The Etiology of Acute Leukemia:
Molecular Genetics and Viral Oncology," in Neoplastic Diseases of
the Blood, vol. I, pp. 161-182, Wiernik et al. eds. (1985). An
oncogene is a gene that brings about or contributes to neoplastic
transformation of cells by encoding proteins which regulate cell
growth and differentiation. Retroviral and cellular oncogenes arise
from cellular genes called proto-oncogenes, which appear to play an
important role in normal hematopoietic cell growth and
differentiation.
[0009] The isolation and characterization of viral oncogenes
(v-one) have facilitated the cloning and identification of the
cellular oncogenes (c-one) which derive their names from the
respective viral genes. They are highly conserved among species,
and homologs are found in all vertebrates, in lower organisms, and
in humans. (Gelmann et al.) The role of c-one genes in neoplasia
has been investigated extensively.
[0010] The retroviral oncogene v-myb transforms myelomonocytic
hematopoietic cells in vivo and in vitro. (Moscovici, C. et al.,
Adv. Viral Oncol. 1:83-106 (1982)). The v-myb oncogene was
originally defined by two naturally occurring avian retroviruses,
AMV and E26, that induce myeloid leukemias in chickens. (Moscovici
et al.) The v-myb oncogenes are derived from a normal, cellular
proto-oncogene, c-myb, which is expressed in high levels in all
immature hematopoietic lineages. (Klempnauer, K. H. et al., Cell
31:537-547 (1984)). In contrast, v-myb oncogenes only transform a
few cell types, such as the immature myeloid precursors of
neutrophils and macrophages. Both c-myb and v-myb encode nuclear,
DNA binding proteins (i.e. transcription activators) that regulate
the phenotypes of normal and transformed hematopoietic cells
respectively. (Ness, S. A. et al., Cell 59: 1115-1125 (1989); Burk,
O. and Klempnauer, K. H., EMBO J. 10(12):3713-3719 (1991)). The
transforming activity of these proteins is regulated by cell
type-specific cofactors. The DNA-binding domain of the v-myb
proteins corresponds to the domain of several other myb-related
DNA-binding proteins isolated from such diverse species as mammals,
insects, and plants. (Queva et al. 1992)
[0011] An interesting feature of the v-myb oncogene is that it not
only blocks differentiation, but it also dictates the
differentiation phenotype of the myeloid cells that it transforms.
(Ness, S. A. et al., Cell 59:1115-1125 (1989)). Expression of v-myb
in myeloid cells results in them acquiring an immature phenotype.
(Burk and Klempnauer, 1991). In addition, it has been shown that
minor changes in the structure of the v-Myb protein determine
whether the transformed cells take on the phenotype of immature
macrophages or immature granulocytes, (Golay, J. et al, Cell
55:1147-1158 (1988)). Moreover, temperature-sensitive v-myb
transformed cells induced to differentiate can be induced to
retrodifferentiate. (Introna, M. et al., Cell 63:1287-1297 (1990)).
Different forms of v-myb impose alternate phenotypes of
differentiation on transformed myeloid cells by regulating unique
sets of differentiation specific genes. (Introna, M. et al., Cell
63:1287-1297 (1990)).
[0012] Two genes, identified as mim-1 and MD-1, are known to be
regulated by v-myb. (Ness et al, 1989; Burk and Klempnauer, 1991).
The mim-1 gene is specifically expressed in normal, immature,
granulocytes and encodes a 35 kD secretable protein that is stored
in the granules of those cells. (Ness et al, 1989; Queva, C. et
al., Development 114:125-133 (1992)). Indeed, mim-1 encodes one of
the most abundant proteins found in granulocytes, and the high
level of expression suggests that it may be a structural component
of the promyelocyte granule. (Ness et al. 1989). When promyelocytes
undergo terminal differentiation to neutrophil granulocytes, a
decrease in the level of mim-1 protein is observed. (Queva et al.)
Moreover, analysis of chick embryo development shows that mim-1
mRNA transcripts are found where granulopoiesis occurs. (Queva et
al.) Thus, mim-1 is the first described marker for cells that are
differentiating into the granulocytic lineage. (Queva et al.;
Introna et al.).
[0013] The mim-1 gene is one of a number v-myb-regulated genes that
contribute to the unique differentiation phenotype displayed by
both normal and transformed myeloid cells. Those genes, which
include MD-1, must by definition be regulated similarly to mim-1 by
the various forms of the v-myb protein. (Ness et al.) It is likely
that a number of different structural changes to the myb protein
will alter the phenotype of myeloid cells transformed by the v-myb
oncogene and affect its capacity to regulate its target genes,
including mim-1 and MD-1. (Introna et al.)
[0014] Thus, v-myb acts as a master gene in hematopoietic cell
differentiation by regulating the expression of a unique set of
genes within the myelomonocytic lineage. (Introna et al.) Because
these genes are expected to be important regulators of cell
differentiation and proliferation, their identification is critical
to understanding the molecular mechanisms of neoplasia,
transformation, and growth control. Thus, a need exists in the art
for the identification of other genes involved in hematopoietic
cell differentiation.
SUMMARY OF THE INVENTION
[0015] The present invention provides isolated nucleic acid
molecules comprising a polynucleotide encoding the HOIPS I
polypeptide having the amino acid sequence shown in FIGS. 1A-1B
(SEQ ID NO:2) or the amino acid sequence encoded by the cDNA clone
deposited in a bacterial host with the American Type Culture
Collection ("ATCC"), Patent Depository, 10801 University Boulevard,
Manassas, Va., 20110-2209 (present address), on Dec. 16, 1996.
(ATCC Deposit Number 97825).
[0016] The present invention also relates to recombinant vectors,
which include the isolated nucleic acid molecules of the present
invention, and to host cells containing the recombinant vectors, as
well as to methods of making such vectors and host cells and for
using them for production of HOIPS I polypeptides or peptides by
recombinant techniques.
[0017] The invention further provides an isolated HOIPS I
polypeptide having an amino acid sequence encoded by a
polynucleotide described herein.
[0018] In another embodiment, the present invention provides a
method for inhibiting abnormal cell proliferation or
differentiation by administering to the abnormally proliferating or
differentiating cell, a synthetic DNA or RNA construct of the
present invention, wherein said synthetic DNA or RNA construct
represses the functional expression of the HOIPS I gene. In an
especially preferred embodiment, said DNA construct is operably
linked to an inducible promoter.
[0019] In another embodiment, the present invention provides a
method for identifying individuals who are believed to be
predisposed to cell proliferative or differentiation disorders
comprising the step of identifying individuals who have only one
active allele of the HOIPS I gene.
[0020] The present invention provides a diagnostic method useful
during diagnosis of a cell proliferative or cell differentiation
disorder.
[0021] An additional aspect of the invention is related to a method
for treating an individual in need of an increased level of HOIPS I
activity in the body comprising administering to such an individual
a composition comprising a therapeutically effective amount of an
isolated HOIPS I polypeptide of the invention or an agonist
thereof.
[0022] A still further aspect of the invention is related to a
method for treating an individual in need of a decreased level of
HOIPS I activity in the body comprising, administering to such an
individual a composition comprising a therapeutically effective
amount of an HOIPS I antagonist.
BRIEF DESCRIPTION OF THE FIGURES
[0023] FIGS. 1A-1B show the nucleotide (SEQ ID NO:1) and deduced
amino acid (SEQ ID NO:2) sequences of HOIPS I. The protein has a
leader sequence of about 20 amino acid residues and a deduced
molecular weight of about 17.8 kDa. The predicted amino acid
sequence of the mature HOIPS I protein is also shown in FIGS. 1A-1B
(SEQ ID NO:2).
[0024] FIG. 2 shows the regions of similarity between the amino
acid sequences of the HOIPS I protein and chicken MD-1 (SEQ ID
NO:3). The consensus sequence is shown (SEQ ID NO:17).
[0025] FIG. 3 shows an analysis of the HOIPS I amino acid sequence.
Alpha, beta, turn and coil regions; hydrophilicity and
hydrophobicity; amphipathic regions; flexible regions; antigenic
index and surface probability are shown. In the "Antigenic
Index--Jameson-Wolf" graph, amino acid residues about 17 to about
29, about 33 to about 39, about 43 to about 52, about 56 to about
67, about 74 to about 83, about 90 to about 94, about 110 to about
120, about 125 to about 139, and about 145 to about 152 in FIGS.
1A-1B correspond to the shown highly antigenic regions of the HOIPS
I protein. These highly antigenic fragments in FIGS. 1A-1B
correspond to the following fragments, respectively in SEQ ID NO:2:
amino acid residues about -4 to about 9, about 13 to about 19,
about 23 to about 32, about 36 to about 47, about 54 to about 63,
about 70 to about 74, about 90 to about 100, about 105 to about
119, and about 125 to about 132.
DETAILED DESCRIPTION
[0026] The present invention provides isolated nucleic acid
molecules comprising a polynucleotide encoding a HOIPS I
polypeptide having the amino acid sequence shown in FIGS. 1A-1B
(SEQ ID NO:2), which was determined by sequencing a cloned cDNA.
The HOIPS I protein of the present invention shares sequence
homology with the chicken MD -1 protein. (FIG. 2) (SEQ ID NO:3).
The nucleotide sequence shown in FIGS. 1A-1B (SEQ ID NO:1) was
obtained by sequencing the HTOCD71X clone, which was deposited on
Dec. 16, 1996 at the American Type Culture Collection (ATCC),
Patent Depository, 10801 University Boulevard, Manassas, Va.,
20110-2209 (present address). (ATCC accession number 97825) The
deposited clone is contained in the pBluescript SK(-) plasmid
(Stratagene, LaJolla, Calif.).
[0027] Nucleic Acid Molecules
[0028] Unless otherwise indicated, all nucleotide sequences
determined by sequencing a DNA molecule herein were determined
using an automated DNA sequencer (such as the Model 373 from
Applied Biosystems, Inc.), and all amino acid sequences of
polypeptides encoded by DNA molecules determined herein were
predicted by translation of a DNA sequence determined as above.
Therefore, as is known in the art for any DNA sequence determined
by this automated approach, any nucleotide sequence determined
herein may contain some errors. Nucleotide sequences determined by
automation are typically at least about 90% identical, more
typically at least about 95% to at least about 99.9% identical to
the actual nucleotide sequence of the sequenced DNA molecule. The
actual sequence can be more precisely determined by other
approaches including manual DNA sequencing methods well known in
the art. As is also known in the art, a single insertion or
deletion in a determined nucleotide sequence compared to the actual
sequence will cause a frame shift in translation of the nucleotide
sequence such that the predicted amino acid sequence encoded by a
determined nucleotide sequence will be completely different from
the amino acid sequence actually encoded by the sequenced DNA
molecule, beginning at the point of such an insertion or
deletion.
[0029] Using the information provided herein, such as the
nucleotide sequence in FIGS. 1A-1B, a nucleic acid molecule of the
present invention encoding a HOIPS I polypeptide may be obtained
using standard cloning and screening procedures, such as those for
cloning cDNAs using mRNA as starting material. Illustrative of the
invention, the nucleic acid molecule described in FIGS. 1A-1B (SEQ
ID NO:1) was discovered in a cDNA library derived from human
tonsils tissue. The gene was also identified in cDNA libraries from
the following tissues: bone marrow, dendritic cells, fetal and
adult brain macrophages, B cells, and lymph nodes. The determined
nucleotide sequence of the HOIPS I cDNA of FIGS. 1A-1B (SEQ ID
NO:1) contains an open reading frame encoding a protein of 162
amino acid residues and a deduced molecular weight of about 17.8
kDa. The HOIPS I protein shown in FIGS. 1A-1B (SEQ ID NO:2) is
about 45% identical to, and about 64% similar to, the chicken MD-1
protein (FIG. 2) in a 132 amino acid residue overlap.
[0030] The present invention also provides the mature form(s) of
the HOIPS I protein of the present invention. According to the
signal hypothesis, proteins secreted by mammalian cells have a
signal or secretory leader sequence which is cleaved from the
mature protein once export of the growing protein chain across the
rough endoplasmic reticulum has been initiated. Most mammalian
cells and even insect cells cleave secreted proteins with the same
specificity. However, in some cases, cleavage of a secreted protein
is not entirely uniform, which results in two or more mature
species on the protein. Further, it has long been known that the
cleavage specificity of a secreted protein is ultimately determined
by the primary structure of the complete protein, that is, it is
inherent in the amino acid sequence of the polypeptide. Therefore,
the present invention provides a nucleotide sequence encoding the
mature HOIPS I polypeptides having the amino acid sequence encoded
by the cDNA clone contained in the host deposited with the ATCC on
Dec. 16, 1996, (ATCC Deposit No. 97825) and as shown in FIGS. 1A-1B
(SEQ ID NO:2). By the mature HOIPS I protein having the amino acid
sequence encoded by the cDNA clone contained in the host deposited
with the ATCC on Dec. 16, 1996, (ATCC Deposit No. 97825) is meant
the mature form(s) of the HOIPS I protein produced by expression in
a mammalian cell (e.g., COS cells, as described below) of the
complete open reading frame encoded by the human DNA sequence of
the clone contained in the vector in the deposited host. As
indicated below, the mature HOIPS I having the amino acid sequence
encoded by the cDNA clone contained in the host deposited with the
ATCC on Dec. 16, 1996, (ATCC Deposit No. 97825) may or may not
differ from the predicted "mature" HOIPS I protein shown in FIGS.
1A-1B (amino acids from about 1 to about 142 in SEQ ID NO:2)
depending on the accuracy of the predicted cleavage site based on
computer analysis.
[0031] Methods for predicting whether a protein has a secretory
leader as well as the cleavage point for that leader sequence are
available. For instance, the methods of McGeoch (Virus Res.
3:271-286 (1985)) and von Heinje (Nucleic Acids Res. 14:4683-4690
(1986)) can be used. The accuracy of predicting the cleavage points
of known mammalian secretory proteins for each of these methods is
in the range of 75-80%. von Heinje, supra. However, the two methods
do not always produce the same predicted cleavage point(s) for a
given protein.
[0032] In the present case, the predicted amino acid sequence of
the complete HOIPS I polypeptides of the present invention were
analyzed by a computer program ("PSORT") (K. Nakai and M. Kanehisa,
Genomics 14:897-911 (1992)), which is an expert system for
predicting the cellular location of a protein based on the amino
acid sequence. As part of this computational prediction of
localization, the methods of McGeoch and von Heinje are
incorporated. The analysis by the PSORT program predicted the
cleavage sites between amino acids 20 and 21 in FIGS. 1A-1B (SEQ ID
NO:2). Thereafter, the complete amino acid sequences were further
analyzed by visual inspection, applying a simple form of the
(-1,-3) rule of von Heinje. von Heinje, supra. Thus, the leader
sequence for the HOIPS I protein is predicted to consist of amino
acid residues -20 to -1 in SEQ ID NO:2. However, while the
predicted mature HOIPS I protein consists of residues 1-142, the
present inventors have identified other possible cleavage sites
resulting in mature proteins having the following amino acid
residues shown in SEQ ID NO:2: -7-142, -6-142, -5-142, -4-142,
-3-142, -2-142, -1-142, 2-142, 3-142, 4-142, 5-142, 6-142, 7-142,
8-142, 9-142, 10-142, 11-142, 12-142, 13-142, 14-142.
[0033] As one of ordinary skill would appreciate, due to the
possibilities of sequencing errors discussed above, as well as the
variability of cleavage sites for leaders in different known
proteins, the predicted HOIPS I polypeptide encoded by the
deposited cDNA comprises about 162 amino acids, but may be anywhere
in the range of 142-182 amino acids; and the predicted leader
sequence of this protein is about 20 amino acids, but may be
anywhere in the range of about 13 to about 33 amino acids.
[0034] As indicated, nucleic acid molecules of the present
invention may be in the form of RNA, such as mRNA, or in the form
of DNA, including, for instance, cDNA and genomic DNA obtained by
cloning or produced synthetically. The DNA may be double-stranded
or single-stranded. Single-stranded DNA or RNA may be the coding
strand, also known as the sense strand, or it may be the non-coding
strand, also referred to as the anti-sense strand.
[0035] By "isolated" nucleic acid molecule(s) is intended a nucleic
acid molecule, DNA or RNA, which has been removed from its native
environment. For example, recombinant DNA molecules contained in a
vector are considered isolated for the purposes of the present
invention. Further examples of isolated DNA molecules include
recombinant DNA molecules maintained in heterologous host cells or
purified (partially or substantially) DNA molecules in solution.
Isolated RNA molecules include in vivo or in vitro RNA transcripts
of the DNA molecules of the present invention. Isolated nucleic
acid molecules according to the present invention further include
such molecules produced synthetically.
[0036] Isolated nucleic acid molecules of the present invention
include DNA molecules comprising an open reading frame (ORF) shown
in FIGS. 1A-1B (SEQ ID NO:1); DNA molecules comprising the coding
sequence for the mature HOIPS I protein shown in FIGS. 1A-1B (last
142 amino acids) (SEQ ID NO:2); and DNA molecules which comprise a
sequence substantially different from those described above but
which, due to the degeneracy of the genetic code, still encode the
HOIPS I protein. Of course, the genetic code is well known in the
art. Thus, it would be routine for one skilled in the art to
generate such degenerate variants.
[0037] In another aspect, the invention provides isolated nucleic
acid molecules encoding the HOIPS I polypeptide having an amino
acid sequence as encoded by the cDNA clone contained in the plasmid
deposited with the ATCC on Dec. 16, 1996 (ATCC Deposit No. 97825).
In a further embodiment, nucleic acid molecules are provided
encoding the mature HOIPS I polypeptide or the full-length
polypeptide lacking the N-terminal methionine. The invention also
provides an isolated nucleic acid molecule having the nucleotide
sequence shown in FIGS. 1A-1B (SEQ ID NO:1) or the nucleotide
sequence of the HOIPS I cDNA contained in the above-described
deposited clone, or a nucleic acid molecule having a sequence
complementary to one of the above sequences. Such isolated
molecules, particularly DNA molecules, are useful as probes for
gene mapping, by in situ hybridization with chromosomes, and for
detecting expression of the HOIPS I gene in human tissue, for
instance, by Northern blot analysis.
[0038] The present invention is further directed to fragments of
the isolated nucleic acid molecules described herein. By a fragment
of an isolated nucleic acid molecule having the nucleotide sequence
of the deposited cDNA or the nucleotide sequence shown in FIGS.
1A-1B (SEQ ID NO:1) is intended fragments at least about 15 nt, and
more preferably at least about 20 nt, still more preferably at
least about 30 nt, and even more preferably, at least about 40 nt
in length which are useful as diagnostic probes and primers as
discussed herein. Of course, larger fragments 50, 100, 150, 200,
250, 300, 350, 400, 450, or 500 nt in length are also useful
according to the present invention as are fragments corresponding
to most, if not all, of the nucleotide sequence of the deposited
cDNA or as shown in FIGS. 1A-1B (SEQ ID NO:1). By a fragment at
least 20 nt in length, for example, is intended fragments which
include 20 or more contiguous bases from the nucleotide sequence of
the deposited cDNA or the nucleotide sequence as shown in FIGS.
1A-1B (SEQ ID NO:1).
[0039] Preferred nucleic acid fragments of the present invention
include nucleic acid molecules encoding epitope-bearing portions of
the HOIPS I protein. In particular, such nucleic acid fragments of
the present invention include nucleic acid molecules encoding: a
polypeptide comprising amino acid residues from about -4 to about 9
of SEQ ID NO:2, a polypeptide comprising amino acid residues from
about 13 to about 19 of SEQ ID NO:2, a polypeptide comprising amino
acid residues from about 23 to about 32 of SEQ ID NO:2, a
polypeptide comprising amino acid residues from about 36 to about
47 of SEQ ID NO:2, a polypeptide comprising amino acid residues
from about 54 to about 63 of SEQ ID NO:2, a polypeptide comprising
amino acid residues from about 70 to about 74 of SEQ ID NO:2, a
polypeptide comprising amino acid residues from about 90 to about
100 of SEQ ID NO:2, a polypeptide comprising amino acid residues
from about 105 to about 119 of SEQ ID NO:2, and a polypeptide
comprising amino acid residues from about 125 to about 132 of SEQ
ID NO:2. The inventors have determined that the above polypeptide
fragments are antigenic regions of the HOIPS I protein. Methods for
determining other such epitope-bearing portions of the HOIPS I
protein are described in detail below.
[0040] In addition, the present inventors have identified the
following cDNA clone related to extensive portions of SEQ ID NO: 1:
HCASG14R (SEQ ID NO: 11).
[0041] The following public ESTs, which relate to portions of SEQ
ID NO:1, have also been identified: GenBank Accession No. AA340310
(SEQ ID NO: 12); GenBank Accession No. T91708 (SEQ ID NO:13);
GenBank Accession No. T92475 (SEQ ID NO:14); GenBank Accession No.
T84854 (SEQ ID NO:15); and GenBank Accession No. C02431 (SEQ ID
NO:16).
[0042] In another aspect, the invention provides an isolated
nucleic acid molecule comprising a polynucleotide which hybridizes
under stringent hybridization conditions to a portion of the
polynucleotide in a nucleic acid molecule of the invention
described above, for instance, the cDNA clone deposited with the
ATCC on Dec. 16, 1996 (ATCC Deposit No. 97825). By "stringent
hybridization conditions" is intended overnight incubation at
42.degree. C. in a solution comprising: 50% formamide, 5.times.SSC
(750 mM NaCl, 75 mM trisodium citrate), 50 mM sodium phosphate (pH
7.6), 5.times. Denhardt's solution, 10% dextran sulfate, and 20
.mu.g/ml denatured, sheared salmon sperm DNA, followed by washing
the filters in 0.1.times.SSC at about 65.degree. C.
[0043] By a polynucleotide which hybridizes to a "portion" of a
polynucleotide is intended a polynucleotide (either DNA or RNA)
hybridizing to at least about 15 nucleotides (nt), and more
preferably at least about 20 nt, still more preferably at least
about 30 nt, and even more preferably about 30-70 nt of the
reference polynucleotide. These are useful as diagnostic probes and
primers as discussed above and in more detail below.
[0044] By a portion of a polynucleotide of "at least 20 nt in
length," for example, is intended 20 or more contiguous nucleotides
from the nucleotide sequence of the reference polynucleotide (e.g.,
the deposited cDNA or the nucleotide sequence as shown in FIGS.
1A-1B (SEQ ID NO:1)). Of course, a polynucleotide which hybridizes
only to a poly A sequence (such as the 3' terminal poly(A) tract of
the HOIPS I cDNA shown in FIGS. 1A-1B (SEQ ID NO:1)), or to a
complementary stretch of T (or U) residues, would not be included
in a polynucleotide of the invention used to hybridize to a portion
of a nucleic acid of the invention, since such a polynucleotide
would hybridize to any nucleic acid molecule containing a poly (A)
stretch or the complement thereof (e.g., practically any
double-stranded cDNA clone).
[0045] As indicated, nucleic acid molecules of the present
invention which encode a HOIPS I polypeptide may include, but are
not limited to those encoding the amino acid sequence of the mature
polypeptide, by itself; the coding sequence for the mature
polypeptide and additional sequences, such as those encoding the
about 20 amino acid leader or secretory sequence, such as a pre-,
or pro- or prepro-protein sequence; the coding sequence of the
mature polypeptide, with or without the aforementioned additional
coding sequences, together with additional, non-coding sequences,
including for example, but not limited to introns and non-coding 5'
and 3' sequences, such as the transcribed, non-translated sequences
that play a role in transcription, mRNA processing, including
splicing and polyadenylation signals, for example--ribosome binding
and stability of mRNA; an additional coding sequence which codes
for additional amino acids, such as those which provide additional
functionalities. Thus, the sequence encoding the polypeptide may be
fused to a marker sequence, such as a sequence encoding a peptide
which facilitates purification of the fused polypeptide. In certain
preferred embodiments of this aspect of the invention, the marker
amino acid sequence is a hexa-histidine peptide, such as the tag
provided in a pQE vector (Qiagen, Inc.), among others, many of
which are commercially available. As described in Gentz et al.,
Proc. Natl. Acad. Sci. USA 86:821-824 (1989), for instance,
hexa-histidine provides for convenient purification of the fusion
protein. The "HA" tag is another peptide useful for purification
which corresponds to an epitope derived from the influenza
hemagglutinin protein, which has been described by Wilson et al.,
Cell 37: 767 (1984). As discussed below, other such fusion proteins
include the HOIPS I fused to Fc at the N- or C-terminus.
[0046] The present invention further relates to variants of the
nucleic acid molecules of the present invention, which encode
portions, analogs or derivatives of the HOIPS I protein. Variants
may occur naturally, such as a natural allelic variant. By an
"allelic variant" is intended one of several alternate forms of a
gene occupying a given locus on a chromosome of an organism. Genes
II, Lewin, B., ed., John Wiley & Sons, New York (1985).
Non-naturally occurring variants may be produced using art-known
mutagenesis techniques.
[0047] Such variants include those produced by nucleotide
substitutions, deletions or additions, which may involve one or
more nucleotides. The variants may be altered in coding regions,
non-coding regions, or both. Alterations in the coding regions may
produce conservative or non-conservative amino acid substitutions,
deletions or additions. Especially preferred among these are silent
substitutions, additions and deletions, which do not alter the
properties and activities of the HOIPS I protein or portions
thereof. Also especially preferred in this regard are conservative
substitutions.
[0048] Further embodiments of the invention include isolated
nucleic acid molecules comprising a polynucleotide having a
nucleotide sequence at least 95% identical, and more preferably at
least 96%, 97%, 98% or 99% identical to (a) a nucleotide sequence
encoding the polypeptide having the amino acid sequence in SEQ ID
NO:2; (b) a nucleotide sequence encoding the polypeptide having the
amino acid sequence in SEQ ID NO: 2, but lacking the N-terminal
methionine; (c) a nucleotide sequence encoding the polypeptide
having the amino acid sequence at positions from about 1 to about
142 in FIGS. 1A-1B SEQ ID NO:2; (d) a nucleotide sequence encoding
the polypeptide having the amino acid sequence encoded by the cDNA
clone contained in ATCC Deposit No. 97825; (e) a nucleotide
sequence encoding the mature HOIPS I polypeptide having the amino
acid sequence encoded by the cDNA clone contained in ATCC Deposit
No. 97825; or (f) a nucleotide sequence complementary to any of the
nucleotide sequences in (a), (b), (c), (d), or (e).
[0049] By a polynucleotide having a nucleotide sequence at least,
for example, 95% "identical" to a reference nucleotide sequence
encoding a HOIPS I polypeptide is intended that the nucleotide
sequence of the polynucleotide is identical to the reference
sequence except that the polynucleotide sequence may include up to
five point mutations per each 100 nucleotides of the reference
nucleotide sequence encoding the HOIPS I polypeptide. In other
words, to obtain a polynucleotide having a nucleotide sequence at
least 95% identical to a reference nucleotide sequence, up to 5% of
the nucleotides in the reference sequence may be deleted or
substituted with another nucleotide, or a number of nucleotides up
to 5% of the total nucleotides in the reference sequence may be
inserted into the reference sequence. These mutations of the
reference sequence may occur at the 5' or 3' terminal positions of
the reference nucleotide sequence or anywhere between those
terminal positions, interspersed either individually among
nucleotides in the reference sequence or in one or more contiguous
groups within the reference sequence.
[0050] As a practical matter, whether any particular nucleic acid
molecule is at least 95%, 96%, 97%, 98% or 99% identical to, for
instance, the nucleotide sequence shown in SEQ ID NO:1 or to the
nucleotide sequence of the deposited cDNA clone can be determined
conventionally using known computer programs such as the Bestfit
program (Wisconsin Sequence Analysis Package, Version 8 for Unix,
Genetics Computer Group, University Research Park, 575 Science
Drive, Madison, Wis. 53711. Bestfit uses the local homology
algorithm of Smith and Waterman, Advances in Applied Mathematics 2:
482-489 (1981), to find the best segment of homology between two
sequences. When using Bestfit or any other sequence alignment
program to determine whether a particular sequence is, for
instance, 95% identical to a reference sequence according to the
present invention, the parameters are set, of course, such that the
percentage of identity is calculated over the full length of the
reference nucleotide sequence and that gaps in homology of up to 5%
of the total number of nucleotides in the reference sequence are
allowed.
[0051] The present application is directed to nucleic acid
molecules at least 95%, 96%, 97%, 98% or 99% identical to the
nucleic acid sequence shown in SEQ ID NO:1 or to the nucleic acid
sequence of the deposited cDNA, irrespective of whether they encode
a polypeptide having HOIPS I activity. This is because even where a
particular nucleic acid molecule does not encode a polypeptide
having HOIPS I activity, one of skill in the art would still know
how to use the nucleic acid molecule, for instance, as a
hybridization probe or as a polymerase chain reaction (PCR) primer.
Uses of the nucleic acid molecules of the present invention that do
not encode a polypeptide having HOIPS I activity include, inter
alia, (1) isolating the HOIPS I gene or allelic variants thereof in
a cDNA library; (2) in situ hybridization (e.g., "FISH") to
metaphase chromosomal spreads to provide precise chromosomal
location of the HOIPS I gene, as described in Verma et al., Human
Chromosomes: A Manual of Basic Techniques, Pergamon Press, New York
(1988); and Northern Blot analysis for detecting HOIPS I mRNA
expression in specific tissues.
[0052] Preferred, however, are nucleic acid molecules having
sequences at least 95%, 96%, 97%, 98% or 99% identical to the
nucleic acid sequence shown in SEQ ID NO: 1 or to the nucleic acid
sequence of the deposited cDNA which do, in fact, encode a
polypeptide having HOIPS I protein activity. By "a polypeptide
having HOIPS I activity" is intended polypeptides exhibiting
activity similar, but not necessarily identical, to an activity of
the HOIPS I protein of the invention (either the full-length
protein or, preferably, the mature protein).
[0053] Of course, due to the degeneracy of the genetic code, one of
ordinary skill in the art will immediately recognize that a large
number of the nucleic acid molecules having a sequence at least
95%, 96%, 97%, 98%, or 99% identical to the nucleic acid sequence
of the deposited cDNA or the nucleic acid sequence shown in SEQ ID
NO: 1 will encode a polypeptide "having HOIPS I protein activity."
In fact, since degenerate variants of these nucleotide sequences
all encode the same polypeptide, this will be clear to the skilled
artisan even without performing the above described comparison
assay. It will be further recognized in the art that, for such
nucleic acid molecules that are not degenerate variants, a
reasonable number will also encode a polypeptide having HOIPS I
protein activity. This is because the skilled artisan is fully
aware of amino acid substitutions that are either less likely or
not likely to significantly affect protein function (e.g.,
replacing one aliphatic amino acid with a second aliphatic amino
acid).
[0054] For example, guidance concerning how to make phenotypically
silent amino acid substitutions is provided in Bowie, J. U. et al.,
"Deciphering the Message in Protein Sequences: Tolerance to Amino
Acid Substitutions," Science 247:1306-1310 (1990), wherein the
authors indicate that proteins are surprisingly tolerant of amino
acid substitutions.
[0055] Vectors and Host Cells
[0056] The present invention also relates to vectors which include
the isolated DNA molecules of the present invention, host cells
which are genetically engineered with the recombinant vectors, and
the production of HOIPS I polypeptides or fragments thereof by
recombinant techniques.
[0057] The polynucleotides may be joined to a vector containing a
selectable marker for propagation in a host. Generally, a plasmid
vector is introduced in a precipitate, such as a calcium phosphate
precipitate, or in a complex with a charged lipid. If the vector is
a virus, it may be packaged in vitro using an appropriate packaging
cell line and then transduced into host cells.
[0058] The DNA insert should be operatively linked to an
appropriate promoter, such as the phage lambda PL promoter, the E.
coli lac, trp and tac promoters, the SV40 early and late promoters
and promoters of retroviral LTRs, to name a few. Other suitable
promoters will be known to the skilled artisan. The expression
constructs will further contain sites for transcription initiation,
termination and, in the transcribed region, a ribosome binding site
for translation. The coding portion of the mature transcripts
expressed by the constructs will preferably include a translation
initiating at the beginning and a termination codon (UAA, UGA or
UAG) appropriately positioned at the end of the polypeptide to be
translated.
[0059] As indicated, the expression vectors will preferably include
at least one selectable marker. Such markers include dihydrofolate
reductase or neomycin resistance for eukaryotic cell culture and
tetracycline or ampicillin resistance genes for culturing in E.
coli and other bacteria. Representative examples of appropriate
hosts include, but are not limited to, bacterial cells, such as E.
coli, Streptomyces and Salmonella typhimurium cells; fungal cells,
such as yeast cells; insect cells such as Drosophila S2 and
Spodoptera Sf9 cells; animal cells such as CHO, COS and Bowes
melanoma cells; and plant cells. Appropriate culture mediums and
conditions for the above-described host cells are known in the
art.
[0060] Among vectors preferred for use in bacteria include pQE70,
pQE60 and pQE-9, available from Qiagen; pBS vectors, Phagescript
vectors, Bluescript vectors, pNH8A, pNH16a, pNH18A, pNH46A,
available from Stratagene; and ptrc99a, pKK223-3, pKK233-3, pDR540,
pRIT5 available from Pharmacia. Among preferred eukaryotic vectors
are pWLNEO, pSV2CAT, pOG44, pXT1 and pSG available from Stratagene;
and pSVK3, pBPV, pMSG and pSVL available from Pharmacia. Other
suitable vectors will be readily apparent to the skilled
artisan.
[0061] Introduction of the construct into the host cell can be
effected by calcium phosphate transfection, DEAE-dextran mediated
transfection, cationic lipid-mediated transfection,
electroporation, transduction, infection or other methods. Such
methods are described in many standard laboratory manuals, such as
Davis et al., Basic Methods In Molecular Biology (1986).
[0062] The polypeptide may be expressed in a modified form, such as
a fusion protein, and may include not only secretion signals, but
also additional heterologous functional regions. For instance, a
region of additional amino acids, particularly charged amino acids,
may be added to the N-terminus of the polypeptide to improve
stability and persistence in the host cell, during purification, or
during subsequent handling and storage. Also, peptide moieties may
be added to the polypeptide to facilitate purification. Such
regions may be removed prior to final preparation of the
polypeptide. The addition of peptide moieties to polypeptides to
engender secretion or excretion, to improve stability and to
facilitate purification, among others, are familiar and routine
techniques in the art. A preferred fusion protein comprises a
heterologous region from immunoglobulin that is useful to
solubilize proteins. For example, EP-A-O 464 533 (Canadian
counterpart 2045869) discloses fusion proteins comprising various
portions of constant region of immunoglobin molecules together with
another human protein or part thereof. In many cases, the Fc part
in a fusion protein is thoroughly advantageous for use in therapy
and diagnosis and thus results, for example, in improved
pharmacokinetic properties (EP-A 0232 262). On the other hand, for
some uses it would be desirable to be able to delete the Fc part
after the fusion protein has been expressed, detected and purified
in the advantageous manner described. This is the case when the Fc
portion proves to be a hindrance to use in therapy and diagnosis,
for example when the fusion protein is to be used as antigen for
immunizations. In drug discovery, for example, human proteins, such
as hIL-5 have been fused with Fc portions for the purpose of
high-throughput screening assays to identify antagonists of hIL-5.
See, D. Bennett et al., Journal of Molecular Recognition, Vol. 8
52-58 (1995) and K. Johanson et al., The Journal of Biological
Chemistry, Vol. 270, No. 16, pp 9459-9471 (1995).
[0063] The HOIPS I protein can be recovered and purified from
recombinant cell cultures by well-known methods including ammonium
sulfate or ethanol precipitation, acid extraction, anion or cation
exchange chromatography, phosphocellulose chromatography,
hydrophobic interaction chromatography, affinity chromatography,
hydroxylapatite chromatography and lectin chromatography. Most
preferably, high performance liquid chromatography ("HPLC") is
employed for purification. Polypeptides of the present invention
include naturally purified products, products of chemical synthetic
procedures, and products produced by recombinant techniques from a
prokaryotic or eukaryotic host, including, for example, bacterial,
yeast, higher plant, insect and mammalian cells. Depending upon the
host employed in a recombinant production procedure, the
polypeptides of the present invention may be glycosylated or may be
non-glycosylated. In addition, polypeptides of the invention may
also include an initial modified methionine residue, in some cases
as a result of host-mediated processes.
[0064] HOIPS I Polypeptides and Fragments
[0065] The invention further provides an isolated HOIPS I
polypeptide having the amino acid sequence encoded by the deposited
cDNA, or the amino acid sequence in FIGS. 1A-1B (SEQ ID NO:2), or a
peptide or polypeptide comprising a portion of the above
polypeptides.
[0066] It will be recognized in the art that some amino acid
sequences of the HOIPS I polypeptide can be varied without
significant effect of the structure or function of the protein. If
such differences in sequence are contemplated, it should be
remembered that there will be critical areas on the protein which
determine activity.
[0067] Thus, the invention further includes variations of the HOIPS
I polypeptide which show substantial HOIPS I polypeptide activity
or which include regions of HOIPS1 protein such as the protein
portions discussed below. Such mutants include deletions,
insertions, inversions, repeats, and type substitutions. As
indicated above, guidance concerning which amino acid changes are
likely to be phenotypically silent can be found in Bowie, J. U., et
al., "Deciphering the Message in Protein Sequences: Tolerance to
Amino Acid Substitutions," Science 247:1306-1310 (1990).
[0068] Thus, the fragment, derivative or analog of the polypeptide
of SEQ ID NO:2, or that encoded by the deposited cDNA, may be (i)
one in which one or more of the amino acid residues are substituted
with a conserved or non-conserved amino acid residue (preferably a
conserved amino acid residue) and such substituted amino acid
residue may or may not be one encoded by the genetic code, or (ii)
one in which one or more of the amino acid residues includes a
substituent group, or (iii) one in which the mature polypeptide is
fused with another compound, such as a compound to increase the
half-life of the polypeptide (for example, polyethylene glycol), or
(iv) one in which the additional amino acids are fused to the
mature polypeptide, such as an IgG Fc fusion region peptide or
leader or secretory sequence or a sequence which is employed for
purification of the mature polypeptide or a proprotein sequence.
Such fragments, derivatives and analogs are deemed to be within the
scope of those skilled in the art from the teachings herein.
[0069] Of particular interest are substitutions of charged amino
acids with another charged amino acid and with neutral or
negatively charged amino acids. The latter results in proteins with
reduced positive charge to improve the characteristics of the HOIPS
I protein. The prevention of aggregation is highly desirable.
Aggregation of proteins not only results in a loss of activity but
can also be problematic when preparing pharmaceutical formulations,
because they can be immunogenic. (Pinckard et al., Clin Exp.
Immunol 2:331-340 (1967); Robbins et al., Diabetes 36:838-845
(1987); Cleland et al. Crit. Rev. Therapeutic Drug Carrier Systems
10:307-377 (1993)).
[0070] As indicated, changes are preferably of a minor nature, such
as conservative amino acid substitutions that do not significantly
affect the folding or activity of the protein (see Table 1).
TABLE-US-00001 TABLE 1 Conservative Amino Acid Substitutions.
Aromatic Phenylalanine Tryptophan Tyrosine Hydrophobic Leucine
Isoleucine Valine Polar Glutamine Asparagine Basic Arginine Lysine
Histidine Acidic Aspartic Acid Glutamic Acid Small Alanine Serine
Threonine Methionine Glycine
[0071] Of course, the number of amino acid substitutions a skilled
artisan would make depends on many factors, including those
described above. Generally speaking, the number of amino acid
substitutions for any given HOIPS I polypeptide will not be more
than 50, 40, 30, 20, 10, 5, or 3.
[0072] Amino acids in the HOIPS I protein of the present invention
that are essential for function can be identified by methods known
in the art, such as site-directed mutagenesis or alanine-scanning
mutagenesis (Cunningham and Wells, Science 244:1081-1085 (1989)).
The latter procedure introduces single alanine mutations at every
residue in the molecule. The resulting mutant molecules are then
tested for biological activity such as in vitro proliferative
activity.
[0073] The polypeptides of the present invention are preferably
provided in an isolated form. By "isolated polypeptide" is intended
a polypeptide removed from its native environment. Thus, a
polypeptide produced and/or contained within a recombinant host
cell is considered "isolated" for purposes of the present
invention. Also intended as an "isolated polypeptide" are
polypeptides that have been purified, partially or substantially,
from a recombinant host cell or from a native source. For example,
a recombinantly produced version of the HOIPS I polypeptide can be
substantially purified by the one-step method described in Smith
and Johnson, Gene 67:31-40 (1988).
[0074] The polypeptides of the present invention include the
polypeptide encoded by the deposited cDNA including the leader, the
mature polypeptide encoded by the deposited cDNA minus the leader
(i.e., the mature protein), a polypeptide comprising amino acids
about -20 to about 142 in SEQ ID NO:2; a polypeptide comprising the
amino acids about -19 to about 142 in SEQ ID NO:2; a polypeptide
comprising amino acids about 1 to about 142 in SEQ ID NO:2; as well
as polypeptides which are at least 95% identical, more preferably
at least 96%, 97%, 98% or 99% identical to those described above
and also include portions of such polypeptides with at least 30
amino acids and more preferably at least 50 amino acids.
[0075] By a polypeptide having an amino acid sequence at least, for
example, 95% "identical" to a reference amino acid sequence of a
HOIPS I polypeptide is intended that the amino acid sequence of the
polypeptide is identical to the reference sequence except that the
polypeptide sequence may include up to five amino acid alterations
per each 100 amino acids of the reference amino acid of the HOIPS I
polypeptide. In other words, to obtain a polypeptide having an
amino acid sequence at least 95% identical to a reference amino
acid sequence, up to 5% of the amino acid residues in the reference
sequence may be deleted or substituted with another amino acid, or
a number of amino acids up to 5% of the total amino acid residues
in the reference sequence may be inserted into the reference
sequence. These alterations of the reference sequence may occur at
the amino or carboxy terminal positions of the reference amino acid
sequence or anywhere between those terminal positions, interspersed
either individually among residues in the reference sequence or in
one or more contiguous groups within the reference sequence.
[0076] As a practical matter, whether any particular polypeptide is
at least 95%, 96%, 97%, 98% or 99% identical to, for instance, the
amino acid sequence shown in SEQ ID NO:2 or to the amino acid
sequence encoded by the deposited cDNA clone can be determined
conventionally using known computer programs such as the Bestfit
program (Wisconsin Sequence Analysis Package, Version 8 for Unix,
Genetics Computer Group, University Research Park, 575 Science
Drive, Madison, Wis. 53711. When using Bestfit or any other
sequence alignment program to determine whether a particular
sequence is, for instance, 95% identical to a reference sequence
according to the present invention, the parameters are set, of
course, such that the percentage of identity is calculated over the
full length of the reference amino acid sequence and that gaps in
homology of up to 5% of the total number of amino acid residues in
the reference sequence are allowed.
[0077] The polypeptides of the present invention are useful as a
molecular weight marker on SDS-PAGE gels or on molecular sieve gel
filtration columns using methods well known to those of skill in
the art.
[0078] In another aspect, the invention provides a peptide or
polypeptide comprising an epitope-bearing portion of a polypeptide
of the invention. The epitope of this polypeptide portion is an
immunogenic or antigenic epitope of a polypeptide described herein.
An "immunogenic epitope" is defined as a part of a protein that
elicits an antibody response when the whole protein is the
immunogen. On the other hand, a region of a protein molecule to
which an antibody can bind is defined as an "antigenic epitope."
The number of immunogenic epitopes of a protein generally is less
than the number of antigenic epitopes. See, for instance, Geysen et
al., Proc. Natl. Acad. Sci. USA 81:3998-4002 (1983).
[0079] As to the selection of peptides or polypeptides bearing an
antigenic epitope (i.e., that contain a region of a protein
molecule to which an antibody can bind), it is well known in that
art that relatively short synthetic peptides that mimic part of a
protein sequence are routinely capable of eliciting an antiserum
that reacts with the partially mimicked protein. See, for instance,
Sutcliffe, J. G., Shinnick, T. M., Green, N. and Learner, R. A.
(1983) Antibodies that react with predetermined sites on proteins.
Science 219:660-666. Peptides capable of eliciting protein-reactive
sera are frequently represented in the primary sequence of a
protein, can be characterized by a set of simple chemical rules,
and are confined neither to immunodominant regions of intact
proteins (i.e., immunogenic epitopes) nor to the amino or carboxyl
terminals.
[0080] Antigenic epitope-bearing peptides and polypeptides of the
invention are therefore useful to raise antibodies, including
monoclonal antibodies, that bind specifically to a polypeptide of
the invention. See, for instance, Wilson et al., Cell 37:767-778
(1984) at 777.
[0081] Antigenic epitope-bearing peptides and polypeptides of the
invention preferably contain a sequence of at least seven, more
preferably at least nine and most preferably between at least about
15 to about 30 amino acids contained within the amino acid sequence
of a polypeptide of the invention.
[0082] Non-limiting examples of antigenic polypeptides or peptides
that can be used to generate HOIPS I-specific antibodies include: a
polypeptide comprising amino acid residues from about -4 to about 9
of SEQ ID NO:2, a polypeptide comprising amino acid residues from
about 13 to about 19 of SEQ ID NO:2, a polypeptide comprising amino
acid residues from about 23 to about 32 of SEQ ID NO:2, a
polypeptide comprising amino acid residues from about 36 to about
47 of SEQ ID NO:2, a polypeptide comprising amino acid residues
from about 54 to about 63 of SEQ ID NO:2, a polypeptide comprising
amino acid residues from about 70 to about 74 of SEQ ID NO:2, a
polypeptide comprising amino acid residues from about 90 to about
100 of SEQ ID NO:2, a polypeptide comprising amino acid residues
from about 105 to about 119 of SEQ ID NO:2, and a polypeptide
comprising amino acid residues from about 125 to about 132 of SEQ
ID NO:2. As indicated above, the inventors have determined that the
above polypeptide fragments are antigenic regions of the HOIPS I
protein.
[0083] The epitope-bearing peptides and polypeptides of the
invention may be produced by any conventional means. (Houghten, R.
A., "General method for the rapid solid-phase synthesis of large
numbers of peptides: specificity of antigen-antibody interaction at
the level of individual amino acids," Proc. Natl. Acad. Sci. USA
82:5131-5135 (1985)). This "Simultaneous Multiple Peptide Synthesis
(SMPS)" process is further described in U.S. Pat. No. 4,631,211 to
Houghten et al. (1986).
[0084] As one of skill in the art will appreciate, HOIPS I
polypeptides of the present invention and the epitope-bearing
fragments thereof described above can be combined with parts of the
constant domain of immunoglobulins (IgG), resulting in chimeric
polypeptides. These fusion proteins facilitate purification and
show an increased half-life in vivo. This has been shown, e.g., for
chimeric proteins consisting of the first two domains of the human
CD4-polypeptide and various domains of the constant regions of the
heavy or light chains of mammalian immunoglobulins (EPA 394,827;
Traunecker et al., Nature 331:84-86 (1988)). Fusion proteins that
have a disulfide-linked dimeric structure due to the IgG part can
also be more efficient in binding and neutralizing other molecules
than the monomeric HOIPS I protein or protein fragment alone
(Fountoulakis et al., J Biochem 270:3958-3964 (1995)).
[0085] Cancer Diagnosis and Prognosis
[0086] It is believed that certain tissues in mammals with cancer,
in particular acute myelogenous leukemias, express significantly
altered levels of the HOIPS I protein and mRNA encoding the HOIPS I
protein when compared to a corresponding "standard" mammal, i.e., a
mammal of the same species not having the cancer. Further, it is
believed that enhanced levels of the HOIPS I protein can be
detected in certain body fluids (e.g., sera, plasma, urine and
spinal fluid) from mammals with certain leukemias, e.g. acute
myelogenous leukemia, when compared to sera from mammals of the
same species not having the leukemia. Thus, the invention provides
a diagnostic method useful during myeloma diagnosis, which involves
assaying the expression level of the gene encoding the HOIPS I
protein in mammalian cells or body fluid and comparing the gene
expression level with a standard HOIPS I gene expression level,
whereby an increase in the gene expression level over the standard
is indicative of certain tumors.
[0087] Where a tumor diagnosis has already been made according to
conventional methods, the present invention is useful as a
prognostic indicator, whereby patients exhibiting enhanced HOIPS I
gene expression will be predicted to experience a worse clinical
outcome relative to patients expressing the gene at a lower
level.
[0088] By "assaying the expression level of the gene encoding the
HOIPS I protein" is intended qualitatively or quantitatively
measuring or estimating the level of the HOIPS I protein or the
level of the mRNA encoding the HOIPS I protein in a first
biological sample either directly (e.g., by determining or
estimating absolute protein level or mRNA level) or relatively
(e.g., by comparing to the HOIPS I protein level or mRNA level in a
second biological sample).
[0089] Preferably, the HOIPS I protein level or mRNA level in the
first biological sample is measured or estimated and compared to a
standard HOIPS I protein level or mRNA level, the standard being
taken from a second biological sample obtained from an individual
not having the cancer. As will be appreciated in the art, once a
standard HOIPS I protein level or mRNA level is known, it can be
used repeatedly as a standard for comparison.
[0090] By "biological sample" is intended any biological sample
obtained from an individual, cell line, tissue culture, or other
source which contains HOIPS I protein or mRNA. Biological samples
include mammalian body fluids (such as sera, plasma, urine,
synovial fluid and spinal fluid) which contain secreted mature
HOIPS I protein, and hematopoietic tissues including the spleen,
tonsils, bone marrow, dendritic cells, fetal and adult brain
macrophages, B cells, lymph nodes etc.
[0091] The present invention is useful for detecting cancer in
mammals. In particular the invention is useful during diagnosis of
the following pathological cell proliferative neoplasias: acute
myelogenous leukemias including acute monocytic leukemia, acute
myeloblastic leukemia, acute promyelocytic leukemia, acute
myelomonocytic leukemia, acute erythroleukemia, acute
megakaryocytic leukemia, and acute undifferentiated leukemia, etc.;
and chronic myelogenous leukemias including chronic myelomonocytic
leukemia, chronic granulocytic leukemia, etc. Preferred mammals
include monkeys, apes, cats, dogs, cows, pigs, horses, rabbits and
humans. Particularly preferred are humans.
[0092] Total cellular RNA can be isolated from a biological sample
using the single-step guanidinium-thiocyanate-phenol-chloroform
method described in Chomczynski and Sacchi, Anal. Biochem.
162:156-159 (1987). Levels of mRNA encoding the HOIPS I protein are
then assayed using any appropriate method. These include Northern
blot analysis (Harada et al., Cell 63:303-312 (1990)), S1 nuclease
mapping (Fujita et al., Cell 49:357-367 (1987)), the polymerase
chain reaction (PCR), reverse transcription in combination with the
polymerase chain reaction (RT-PCR) (Makino et al., Technique
2:295-301 (1990)), and reverse transcription in combination with
the ligase chain reaction (RT-LCR).
[0093] Assaying HOIPS I protein levels in a biological sample can
occur using antibody-based techniques. For example, HOIPS I protein
expression in tissues can be studied with classical
immunohistological methods (Jalkanen, M., et al., J. Cell. Biol.
101:976-985 (1985); Jalkanen, M., et al., J. Cell. Biol.
105:3087-3096 (1987)).
[0094] Other antibody-based methods useful for detecting HOIPS I
protein gene expression include immunoassays, such as the enzyme
linked immunosorbent assay (ELISA) and the radioimmunoassay (RIA).
Suitable labels are known in the art and include enzyme labels,
such as, Glucose oxidase, and radioisotopes, such as iodine
(.sup.125I, .sup.121I), carbon (.sup.14C), sulphur (.sup.35S),
tritium (.sup.3H), indium (.sup.112In), and technetium
(.sup.99mTc), and fluorescent labels, such as fluorescein and
rhodamine, and biotin.
[0095] Therapeutics
[0096] Pathological cell proliferative disorders are often
associated with inappropriate activation of proto-oncogenes.
(Gelmann, E. P. et al., "The Etiology of Acute Leukemia: Molecular
Genetics and Viral Oncology," in Neoplastic Diseases of the Blood,
Vol 1., Wiernik, P. H. et al. eds., 161-182 (1985)). Neoplasias are
now believed to result from the qualitative alteration of a normal
cellular gene product, or from the quantitative modification of
gene expression by insertion into the chromosome of a viral
sequence, by chromosomal translocation of a gene to a more actively
transcribed region, or by some other mechanism. (Gelmann et al.) It
is likely that mutated or altered expression of specific genes is
involved in the pathogenesis of some leukemias. (Gelmann et al.)
Indeed, the human counterparts of the oncogenes involved in some
animal neoplasias have been amplified or translocated in some cases
of human leukemia and carcinoma. (Gelmann et al.)
[0097] For example, c-myc expression is highly amplified in the
non-lymphocytic leukemia cell line HL-60. When HL-60 cells are
chemically induced to stop proliferation, the level of c-myc is
found to be downregulated. (WO 91/15580) However, it has been shown
that exposure of HL-60 cells to a DNA construct that is
complementary to the 5' end of c-myc or c-myb blocks translation of
the corresponding mRNAs which downregulates expression of the c-myc
or c-myb proteins and causes arrest of cell proliferation and
differentiation of the treated cells. (WO 91/15580; Wickstrom et
al., Proc. Natl. Acad. Sci. 85:1028 (1988); Anfossi et al., Proc.
Natl. Acad. Sci. 86:3379 (1989)).
[0098] Accordingly, the present invention is directed to the
utilization of the HOIPS I gene and its product in gene therapy
techniques to treat cell proliferative diseases in individuals. The
term "gene therapy" is meant to include the insertion of part of
all of the HOIPS I gene, a HOIPS I DNA or RNA construct or HOIPS I
gene product into a cell, group of cells, tissue, pathological
lesion, organ or organism for the purpose of modulating gene
expression, and/or function of the gene product.
[0099] Thus, in one embodiment, the present invention provides a
method for treating cell proliferative diseases, and in particular
acute and chronic myelogenous leukemias, by inserting into an
abnormally proliferating cell which expresses the HOIPS I gene a
synthetic DNA or RNA construct of the present invention, wherein
said DNA or RNA construct represses said expression.
[0100] Another embodiment of the present invention provides a
method of treating cell-proliferative disorders in individuals
comprising administration of one or more active gene copies of the
HOIPS I gene to an abnormally proliferating cell or cells. In a
preferred embodiment, the HOIPS I gene is a DNA construct
comprising a recombinant expression vector effective in expressing
a DNA sequence encoding said HOIPS I gene. In another preferred
embodiment of the present invention, the DNA construct encoding the
HOIPS I gene is inserted into cells to be treated utilizing a
retrovirus vector. In a most preferred embodiment, the retroviral
vector is defective and will not transform non-proliferating
cells.
[0101] By "repressing expression of the HOIPS I gene" is intended
the suppression of the transcription of the gene, the degradation
of the gene transcript (pre-message RNA), the inhibition of
splicing, the destruction of the messenger RNA, the prevention of
the post-translational modifications of the protein, the
destruction of the protein, or the inhibition of the normal
function of the protein. In an especially preferred embodiment,
suppression of HOIPS I gene expression in a cell is achieved by
administering antisense RNA. Antisense RNAs are RNAs that are
complimentary to all or part of the mRNA of the HOIPS I gene. In
general, overproduction of antisense RNA has been shown to prevent
translation of a given target RNA, thereby blocking the expression
of the target gene product. (WO 91/15580). Accordingly, in order to
block HOIPS I induced proliferation or differentiation of a cell,
antisense RNAs can be introduced into the proliferating or
differentiating cells.
[0102] The use of c-myc and c-myb antisense RNA constructs to
inhibit the growth of the non-lymphocytic leukemia cell line HL-60
and other cell lines was previously described. (Wickstrom et al.
(1988); Anfossi et al. (1989)). These experiments were performed in
vitro by incubating cells with the oligoribonucleotide. A similar
procedure for in vivo use is described in WO 91/15580. Briefly, a
pair of oligonucleotides for a given antisense RNA is produced as
follows: A sequence complimentary to the first 15 bases of the open
reading frame is flanked by an EcoR1 site on the 5' end and a
HindIII site on the 3' end. Next, the pair of oligonucleotides is
heated at 90.degree. C. for one minute and then annealed in
2.times. ligation buffer (20 mM TRIS HCl pH 7.5, 10 mM MgCl.sub.2,
10 mM dithiothreitol (DTT) and 0.2 mM ATP) and then ligated to the
EcoR1/Hind III site of the retroviral vector PMV7. (WO
91/15580)
[0103] It will be appreciated that conditions caused by a decrease
in the standard or normal level of HOIPS I activity in an
individual, can be treated by administration of HOIPS I protein.
Thus, the invention further provides a method of treating an
individual in need of an increased level of HOIPS I activity
comprising administering to such an individual a pharmaceutical
composition comprising an effective amount of an isolated HOIPS I
polypeptide of the invention, particularly a mature form of the
HOIPS I, effective to increase the HOIPS I activity level in such
an individual.
[0104] As a general proposition, the total pharmaceutically
effective amount of HOIPS I polypeptide administered parenterally
per dose will be in the range of about 1 .mu.g/kg/day to 10
mg/kg/day of patient body weight, although, as noted above, this
will be subject to therapeutic discretion. More preferably, this
dose is at least 0.01 mg/kg/day, and most preferably for humans
between about 0.01 and 1 mg/kg/day for the hormone. If given
continuously, the HOIPS I polypeptide is typically administered at
a dose rate of about 1 .mu.g/kg/hour to about 50 .mu.g/kg/hour,
either by 1-4 injections per day or by continuous subcutaneous
infusions, for example, using a mini-pump. An intravenous bag
solution may also be employed.
[0105] Pharmaceutical compositions containing the HOIPS I of the
invention may be administered orally, rectally, parenterally,
intracistemally, intravaginally, intra peritoneally, topically (as
by powders, ointments, drops or transdermal patch), bucally, or as
an oral or nasal spray. By "pharmaceutically acceptable carrier" is
meant a non-toxic solid, semisolid or liquid filler, diluent,
encapsulating material or formulation auxiliary of any type. The
term "parenteral" as used herein refers to modes of administration
which include intravenous, intramuscular, intraperitoneal,
intrasternal, subcutaneous and intraarticular injection and
infusion.
[0106] For local administration to abnormally proliferating cells,
the HOIPS I DNA or RNA constructs or genes may be administered by
any method known to those of skill in the art including, but not
limited to transfection, electroporation, microinjection of cells,
or in vehicles such as liposomes, lipofectin, or as naked DNA or
RNA. The DNA of the present invention may be delivered by known
gene delivery systems such as, but not limited to, retroviral
vectors (Gilboa, J. Virology 44:845 (1982); Hocke, Nature 320:275
(1986); Wilson, et al., Proc. Natl. Acad. Sci. U.S.A. 85:3014),
vaccinia virus system (Chakrabarty et al., Mol. Cell Biol. 5:3403
(1985) or other efficient DNA delivery systems (Yates et al.,
Nature 313:812 (1985)) known to those skilled in the art. These
references are exemplary only and are hereby incorporated by
reference. In order to specifically deliver or transfect cells
which are abnormally proliferating and spare non-dividing cells, it
is preferable to utilize a retrovirus delivery system known to
those of skill in the art. Since host DNA replication is required
for retroviral DNA to integrate and the retrovirus will be unable
to self replicate due to the lack of the retrovirus genes needed
for its life cycle. Utilizing such a retroviral delivery system for
the HOIPS I gene and DNA constructs of the present invention will
target said gene and constructs to abnormally proliferating cells
and will spare the non-dividing normal cells.
[0107] Administration of the HOIPS I gene, DNA or RNA constructs,
or gene product useful in the methods of the present invention may
be by topical, parenteral, oral, intranasal, intravenous,
intramuscular, subcutaneous, or any other suitable means.
[0108] The DNA constructs of the present invention may be delivered
directly to cell proliferative disorder/disease sites in internal
organs, body cavities and the like by use of imaging devices used
to guide an injecting needle directly to the disease site. The DNA
constructs of the present invention may also be administered to
disease sites at the time of surgical intervention.
[0109] The DNA dosage administered is dependent upon the age,
clinical stage and extent of the disease or genetic predisposition
of the individual, location, weight, kind of concurrent treatment,
if any, and nature of the pathological or malignant cell
proliferative disorder. The effective delivery system useful in the
method of the present invention may be employed in such forms as
capsules, tablets, liquid solutions, suspensions, or elixirs, for
oral administration or sterile liquid forms such as solutions,
suspensions, or emulsions. Any inert carrier is preferably used,
such as saline, or phosphate-buffered saline, or any such carrier
in which the compounds used in the method of the present invention
have suitable solubility properties.
[0110] By "cell proliferative disease" is meant any human or animal
disease or disorder, affecting any one or any combination of
organs, cavities, or body parts, which is characterized by single
or multiple local abnormal proliferations of cells, groups of
cells, or tissues, whether benign or malignant.
[0111] Any amount of the DNA or RNA constructs of the present
invention may be administered as long as it has a biologically
inhibiting effect on the proliferation of the treated cells.
Moreover, it is possible to administer more than one of the DNA or
RNA constructs of the present invention simultaneously to the same
site. By "biologically inhibiting" is meant partial or total growth
inhibition as well as decreases in the rate of proliferation or
growth of the cells. The biologically inhibitory dose may be
determined by assessing the effects of the sample DNA or RNA
constructs of the present invention on target malignant or
abnormally proliferating cell growth in tissue culture, tumor
growth in animals and cell cultures, or any other method known to
one of ordinary skill in the art.
[0112] The present invention is further directed to antibody-based
therapies which involve administering an anti-HOIPS I antibody to a
mammalian, preferably human, patient for treating one or more of
the above-described disorders. Methods for producing anti-HOIPS I
polyclonal and monoclonal antibodies are described in detail supra.
Such antibodies may be provided in pharmaceutically acceptable
compositions as known in the art or as described herein.
[0113] A summary of the ways in which the antibodies of the present
invention may be used therapeutically includes binding HOIPS I
locally or systemically in the body or by direct cytotoxicity of
the antibody, e.g. as mediated by complement (CDC) or by effector
cells (ADCC). Some of these approaches are described in more detail
below. Armed with the teachings provided herein, one of ordinary
skill in the art will know how to use the antibodies of the present
invention for diagnostic, monitoring or therapeutic purposes
without undue experimentation.
[0114] The pharmaceutical compositions of the present invention may
be administered by any means that achieve their intended purpose.
Amounts and regimens for the administration of antibodies, their
fragments or derivatives can be determined readily by those with
ordinary skill in the clinical art of treating cell proliferative
diseases.
[0115] For example, administration may be by parenteral,
subcutaneous, intravenous, intramuscular, intraperitoneal,
transdermal, or buccal routes. Alternatively, or concurrently,
administration may be by the oral route. The dosage administered
will be dependent upon the age, health and weight of the recipient,
kind of concurrent treatment, if any, frequency of treatment, and
the nature of the desired effect.
[0116] Compositions within the scope of this invention include all
compositions wherein the antibody, fragment or derivative is
contained in an amount effective to achieve its intended purpose.
While individual needs vary, determination of optimal ranges of
effective amounts of each component is within the skill of the art.
The effective dose is a function of the individual chimeric or
monoclonal antibody, the presence and nature of a conjugated
therapeutic agent (see below), the patient and his clinical status,
and can vary from about 10 .mu.g/kg body weight to about 5000 mg/kg
body weight. The preferred dosages comprise 0.1-500 mg/kg body
wt.
[0117] In addition to the pharmacologically active compounds, the
new pharmaceutical compositions may contain suitable
pharmaceutically acceptable carriers comprising excipients and
auxiliaries which facilitate processing of the active compounds
into preparations which can be used pharmaceutically. Preferably,
the preparations contain from about 0.01 to 99 percent, preferably
from about 20-75 percent of active compound(s), together with the
excipient.
[0118] Similarly, preparations of an anti-HOIPS I antibody, or
antigen binding fragment thereof, of the present invention for
parenteral administration, such as in detectably labeled form for
imaging or in a free or conjugated form for therapy, include
sterile aqueous or non-aqueous solutions, suspensions, or
emulsions. Examples of non-aqueous solvents are propylene glycol,
polyethylene glycol, vegetable oil, such as olive oil, and
injectable organic esters such as ethyl oleate. Aqueous carriers
include water, alcoholic/aqueous solutions, emulsions or
suspensions, including saline and buffered media, parenteral
vehicles including sodium chloride solution, Ringer's dextrose,
dextrose and sodium chloride, lactated Ringer's, or fixed oils.
Intravenous vehicles include fluid and nutrient replenishers, such
as those based on Ringer's dextrose, and the like. Preservatives
and other additives may also be present, such as, for example,
antimicrobials, anti-oxidants, chelating agents, and inert gases
and the like. See, generally, Remington's Pharmaceutical Science,
16th ed., Mack Publishing Co., Easton, Pa., 1980.
[0119] In particular, the antibodies, fragments and derivatives of
the present invention are useful for treating a subject having or
developing HOIPS I related cell proliferative and/or
differentiation disorders as described herein. Such treatment
comprises administering a single or multiple doses of the antibody,
or a fragment, derivative, or a conjugate thereof.
[0120] The antibodies of this invention may be advantageously
utilized in combination with other monoclonal or chimeric
antibodies, or with lymphokines or hematopoietic growth factors,
etc., which serve to increase the number or activity of effector
cells which interact with the antibodies.
[0121] It is preferred to use high affinity and/or potent in vivo
HOIPS I inhibiting and/or neutralizing antibodies, fragments or
regions thereof, for both HOIPS I immunoassays and therapy of HOIPS
I related disorders. Such antibodies, fragments, or regions, will
preferably have an affinity for human HOIPS I, expressed as Ka, of
at least 10.sup.8 M.sup.-1, more preferably, at least 10.sup.9
M.sup.-1, such as 5.times.10.sup.8 M.sup.-1, 8.times.10.sup.8
M.sup.-1, 2.times.10.sup.9 M.sup.-1, 4.times.10.sup.9 M.sup.-1,
6.times.10.sup.9 M.sup.-1, 8.times.10.sup.9 M.sup.-1.
[0122] Preferred for human therapeutic use are high affinity murine
and murine/human or human/human chimeric antibodies, and fragments,
regions, and derivatives thereof having potent in vivo HOIPS I
inhibiting and/or neutralizing activity, according to the present
invention, e.g., that block HOIPS I activity.
[0123] Chromosome Assays
[0124] The nucleic acid molecules of the present invention are also
valuable for chromosome identification. The sequence is
specifically targeted to and can hybridize with a particular
location on an individual human chromosome. The mapping of DNAs to
chromosomes according to the present invention is an important
first step in correlating those sequences with genes associated
with disease.
[0125] In certain preferred embodiments in this regard, the cDNA
herein disclosed is used to clone genomic DNA of a HOIPS I protein
gene. This can be accomplished using a variety of well known
techniques and libraries, which generally are available
commercially. The genomic DNA then is used for in situ chromosome
mapping using well known techniques for this purpose.
[0126] In addition, in some cases, sequences can be mapped to
chromosomes by preparing PCR primers (preferably 15-25 bp) from the
cDNA. Computer analysis of the 3' untranslated region of the gene
is used to rapidly select primers that do not span more than one
exon in the genomic DNA, thus complicating the amplification
process. These primers are then used for PCR screening of somatic
cell hybrids containing individual human chromosomes.
[0127] Fluorescence in situ hybridization ("FISH") of a cDNA clone
to a metaphase chromosomal spread can be used to provide a precise
chromosomal location in one step. This technique can be used with
probes from cDNA as short as 50 or 60 bp. For a review of this
technique, see Verma et al., Human Chromosomes: A Manual Of Basic
Techniques, Pergamon Press, New York (1988).
[0128] Once a sequence has been mapped to a precise chromosomal
location, the physical position of the sequence on the chromosome
can be correlated with genetic map data. Such data are found, for
example, in V. McKusick, Mendelian Inheritance In Man, available
on-line through Johns Hopkins University, Welch Medical Library.
The relationship between genes and diseases that have been mapped
to the same chromosomal region are then identified through linkage
analysis (coinheritance of physically adjacent genes).
[0129] Next, it is necessary to determine the differences in the
cDNA or genomic sequence between affected and unaffected
individuals. If a mutation is observed in some or all of the
affected individuals but not in any normal individuals, then the
mutation is likely to be the causative agent of the disease.
[0130] Thus, in one embodiment of the present invention these
techniques can be used to identify individuals who are predisposed
to cell proliferative diseases. Specifically, the present
inventions can be used to screen chromosomal DNA of an individual
to determine the presence or absence of active alleles of the HOIPS
I gene. Those having only one active allele of the HOIPS I gene are
predicted to be predisposed to cell proliferative disorders.
[0131] Having generally described the invention, the same will be
more readily understood by reference to the following examples,
which are provided by way of illustration and are not intended as
limiting.
EXAMPLES
Example 1
Expression and Purification of HOIPS I in E. coli
[0132] The DNA sequence encoding the mature HOIPS I protein in the
deposited cDNA clone is amplified using PCR oligonucleotide primers
specific to the amino terminal sequences of the HOIPS I protein and
to vector sequences 3' to the gene. Additional nucleotides
containing restriction sites to facilitate cloning are added to the
5' and 3' sequences respectively.
[0133] The 5' oligonucleotide primer has the sequence: 5'
GACTCCATGGGCGGCGGTGGGAAAGCCTG 3' (SEQ ID NO:4) containing the
underlined NcoI restriction site, which encodes 20 nucleotides of
the HOIPS I protein coding sequence in FIGS. 1A-1B (SEQ ID NO:1)
beginning immediately after the signal peptide.
[0134] The 3' primer has the sequence: 5'
GACTAGATCTGGAGCACATGATAGTAGCAT 3' (SEQ ID NO:5) containing the
underlined BglII restriction site followed by 20 nucleotides
complementary to the last 20 nucleotides of the HOIPS I protein
coding sequence in FIGS. 1A-1B.
[0135] The restriction sites are convenient to restriction enzyme
sites in the bacterial expression vector nQE60, which are used for
bacterial expression in these examples. (Qiagen, Inc. 9259 Eton
Avenue, Chatsworth, Calif., 91311). nQE60 encodes ampicillin
antibiotic resistance ("Amp.sup.r") and contains a bacterial origin
of replication ("ori"), an IPTG inducible promoter, a ribosome
binding site ("RBS"), a 6-His tag and restriction enzyme sites.
[0136] The amplified HOIPS I DNA and the vector nQE60 both are
digested with NcoI and BglII and the digested DNAs are then ligated
together. Insertion of the HOIPS I protein DNA into the restricted
nQE60 vector places the HOIPS I protein coding region downstream of
and operably linked to the vector's IPTG-inducible promoter and
in-frame with an initiating AUG appropriately positioned for
translation of HOIPS I protein.
[0137] The ligation mixture is transformed into competent E. coli
cells using standard procedures. Such procedures are described in
Sambrook et al., MOLECULAR CLONING: A LABORATORY MANUAL, 2nd Ed.;
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
(1989). E. coli strain M15/rep4, containing multiple copies of the
plasmid pREP4, which expresses lac repressor and confers kanamycin
resistance ("Kan.sup.r"), is used in carrying out the illustrative
example described herein. This strain, which is only one of many
that are suitable for expressing HOIPS I protein, is available
commercially from Qiagen.
[0138] Transformants are identified by their ability to grow on LB
plates in the presence of ampicillin and kanamycin. Plasmid DNA is
isolated from resistant colonies and the identity of the cloned DNA
confirmed by restriction analysis.
[0139] Clones containing the desired constructs are grown overnight
("O/N") in liquid culture in LB media supplemented with both
ampicillin (100 .mu.g/ml) and kanamycin (25 .mu.g/ml).
[0140] The O/N culture is used to inoculate a large culture, at a
dilution of approximately 1:100 to 1:250. The cells are grown to an
optical density at 600 nm ("OD600") of between 0.4 and 0.6.
Isopropyl-B-D-thiogalactopyranoside ("IPTG") is then added to a
final concentration of 1 mM to induce transcription from lac
repressor sensitive promoters, by inactivating the lacI repressor.
Cells subsequently are incubated further for 3 to 4 hours. Cells
then are harvested by centrifugation and disrupted, by standard
methods. Inclusion bodies are purified from the disrupted cells
using routine collection techniques, and protein is solubilized
from the inclusion bodies into 8M urea. The 8M urea solution
containing the solubilized protein is passed over a PD-10 column in
2.times. phosphate-buffered saline ("PBS"), thereby removing the
urea, exchanging the buffer and refolding the protein. The protein
is purified by a further step of chromatography to remove
endotoxin. Then, it is sterile filtered. The sterile filtered
protein preparation is stored in 2.times.PBS at a concentration of
95 .mu.g/ml.
Example 2
Cloning and Expression of HOIPS I protein in a Baculovirus
Expression System
[0141] In this illustrative example, the plasmid shuttle vector pA2
is used to insert the cloned DNA encoding the complete protein,
including its naturally associated secretary signal (leader)
sequence, into a baculovirus to express the mature HOIPS I protein,
using standard methods as described in Summers et al., A Manual of
Methods for Baculovirus Vectors and Insect Cell Culture Procedures,
Texas Agricultural Experimental Station Bulletin No. 1555 (1987).
This expression vector contains the strong polyhedrin promoter of
the Autographa californica nuclear polyhedrosis virus (AcMNPV)
followed by convenient restriction sites such as BamHI and Asp718.
The polyadenylation site of the simian virus 40 ("SV40") is used
for efficient polyadenylation. For easy selection of recombinant
virus, the plasmid contains the beta-galactosidase gene from E.
coli under control of a weak Drosophila promoter in the same
orientation, followed by the polyadenylation signal of the
polyhedrin gene. The inserted genes are flanked on both sides by
viral sequences for cell-mediated homologous recombination with
wild-type viral DNA to generate viable virus that express the
cloned polynucleotide.
[0142] Many other baculovirus vectors could be used in place of the
vector above, such as pAc373, pVL941 and pAcIM1, as one skilled in
the art would readily appreciate, as long as the construct provides
appropriately located signals for transcription, translation,
secretion and the like, including a signal peptide and an in-frame
AUG as required. Such vectors are described, for instance, in
Luckow et al., Virology 170:31-39.
[0143] The cDNA sequence encoding the full length HOIPS I protein
in the deposited clone, including the AUG initiation codon and the
naturally associated leader sequence shown in FIGS. 1A-1B (SEQ ID
NO:2), is amplified using PCR oligonucleotide primers corresponding
to the 5' and 3' sequences of the gene. The 5' primer has the
sequence 5' GAC TGGATCCGCC ATC ATG AAG GGT TTC ACA GCC AC 3' (SEQ
ID NO:6) containing the underlined BamHI restriction enzyme site,
an efficient signal for initiation of translation in eukaryotic
cells, as described by Kozak, M., J. Mol. Biol. 196:947-950 (1987),
followed by 20 bases of the sequence of the complete HOIPS I
protein shown in FIG. 1, beginning with the AUG initiation codon.
The 3' primer has the sequence 5' GACTGGTACCAG-CAGCTGCACTCTTTGGG 3'
(SEQ ID NO:7) containing the underlined, Asp718 restriction site
followed by 19 nucleotides complementary to the 3' noncoding
sequence in FIGS. 1A-1B.
[0144] The amplified fragment is isolated from a 1% agarose gel
using a commercially available kit ("Geneclean," BIO 101 Inc., La
Jolla, Calif.). The fragment then is digested with BamHI and Asp718
and again is purified on a 1% agarose gel. This fragment is
designated herein "F1".
[0145] The plasmid is digested with the restriction enzymes BamHI
and Asp718 and optionally, can be dephosphorylated using calf
intestinal phosphatase, using routine procedures known in the art.
The DNA is then isolated from a 1% agarose gel using a commercially
available kit ("Geneclean" BIO 101 Inc., La Jolla, Calif.). This
vector DNA is designated herein "V1".
[0146] Fragment F1 and the dephosphorylated plasmid V1 are ligated
together with T4 DNA ligase. E. coli HB101 or other suitable E.
coli hosts such as XL-1 Blue (Stratagene Cloning Systems, La Jolla,
Calif.) cells are transformed with the ligation mixture and spread
on culture plates. Bacteria are identified that contain the plasmid
with the human HOIPS I gene using the PCR method, in which one of
the primers that is used to amplify the gene and the second primer
is from well within the vector so that only those bacterial
colonies containing the HOIPS I gene fragment will show
amplification of the DNA. The sequence of the cloned fragment is
confirmed by DNA sequencing. This plasmid is designated herein
pBacHOIPS I.
[0147] Five .mu.g of the plasmid pBacHOIPS I is co-transfected with
1.0 .mu.g of a commercially available linearized baculovirus DNA
("BaculoGold.TM. baculovirus DNA", Pharmingen, San Diego, Calif.),
using the lipofection method described by Felgner et al., Proc.
Natl. Acad. Sci. USA 84:7413-7417 (1987). 1 .mu.g of BaculoGold.TM.
virus DNA and 5 .mu.g of the plasmid pBacHOIPS I are mixed in a
sterile well of a microtiter plate containing 50 .mu.l of
serum-free Grace's medium (Life Technologies Inc., Gaithersburg,
Md.). Afterwards, 10 .mu.l Lipofectin plus 90 .mu.l Grace's medium
are added, mixed and incubated for 15 minutes at room temperature.
Then the transfection mixture is added drop-wise to Sf9 insect
cells (ATCC CRL 1711) seeded in a 35 mm tissue culture plate with 1
ml Grace's medium without serum. The plate is rocked back and forth
to mix the newly added solution. The plate is then incubated for 5
hours at 27.degree. C. After 5 hours the transfection solution is
removed from the plate and 1 ml of Grace's insect medium
supplemented with 10% fetal calf serum is added. The plate is put
back into an incubator and cultivation is continued at 27.degree.
C. for four days.
[0148] After four days the supernatant is collected and a plaque
assay is performed, as described by Summers and Smith, supra. An
agarose gel with "Blue Gal" (Life Technologies Inc., Gaithersburg)
is used to allow easy identification and isolation of
gal-expressing clones, which produce blue-stained plaques. (A
detailed description of a "plaque assay" of this type can also be
found in the user's guide for insect cell culture and
baculovirology distributed by Life Technologies Inc., Gaithersburg,
page 9-10). After appropriate incubation, blue stained plaques are
picked with the tip of a micropipettor (e.g., Eppendorf). The agar
containing the recombinant viruses is then resuspended in a
microcentrifuge tube containing 200 .mu.l of Grace's medium and the
suspension containing the recombinant baculovirus is used to infect
Sf9 cells seeded in 35 mm dishes. Four days later the supernatants
of these culture dishes are harvested and then they are stored at
4.degree. C. The recombinant virus is called V-HOIPS I.
[0149] To verify the expression of the gene, Sf9 cells are grown in
Grace's medium supplemented with 10% heat-inactivated FBS. The
cells are infected with the recombinant baculovirus V-HOIPS I at a
multiplicity of infection ("MOI") of about 2. Six hours later the
medium is removed and is replaced with SF900 II medium minus
methionine and cysteine (available from Life Technologies Inc.,
Rockville, Md.). If radiolabeled proteins are desired, 42 hours
later, 5 .mu.Ci of .sup.35S-methionine and 5 .mu.Ci
.sup.35S-cysteine (available from Amersham) are added. The cells
are further incubated for 16 hours and then they are harvested by
centrifugation. The proteins in the supernatant as well as the
intracellular proteins are analyzed by SDS-PAGE followed by
autoradiography (if radiolabeled). Microsequencing of the amino
acid sequence of the amino terminus of purified protein may be used
to determine the amino terminal sequence of the mature protein and
thus the cleavage point and length of the secretory signal
peptide.
Example 3
Cloning and Expression in Mammalian Cells
[0150] A typical mammalian expression vector contains the promoter
element, which mediates the initiation of transcription of mRNA,
the protein coding sequence, and signals required for the
termination of transcription and polyadenylation of the transcript.
Additional elements include enhancers, Kozak sequences and
intervening sequences flanked by donor and acceptor sites for RNA
splicing. Highly efficient transcription can be achieved with the
early and late promoters from SV40, the long terminal repeats
(LTRS) from Retroviruses, e.g., RSV, HTLVI, HIVI and the early
promoter of the cytomegalovirus (CMV). However, cellular elements
can also be used (e.g., the human actin promoter). Suitable
expression vectors for use in practicing the present invention
include, for example, vectors such as PSVL and PMSG (Pharmacia,
Uppsala, Sweden), pRSVcat (ATCC 37152), pSV2dhfr (ATCC 37146) and
pBC12MI (ATCC 67109). Mammalian host cells that could be used
include, human HeLa 293, H9 and Jurkat cells, mouse NIH3T3 and C127
cells, Cos 1, Cos 7 and CV 1, quail QC1-3 cells, mouse L cells and
Chinese hamster ovary (CHO) cells.
[0151] Alternatively, the gene can be expressed in stable cell
lines that contain the gene integrated into a chromosome. The
co-transfection with a selectable marker such as dhfr, gpt,
neomycin, or hygromycin allows the identification and isolation of
the transfected cells.
[0152] The transfected gene can also be amplified to express large
amounts of the encoded protein. The DHFR (dihydrofolate reductase)
marker is useful to develop cell lines that carry several hundred
or even several thousand copies of the gene of interest. Another
useful selection marker is the enzyme glutamine synthase (GS)
(Murphy et al., Biochem J. 227:277-279 (1991); Bebbington et al.,
Bio/Technology 10:169-175 (1992)). Using these markers, the
mammalian cells are grown in selective medium and the cells with
the highest resistance are selected. These cell lines contain the
amplified gene(s) integrated into a chromosome. Chinese hamster
ovary (CHO) and NSO cells are often used for the production of
proteins.
[0153] The expression vectors pC1 and pC4 contain the strong
promoter (LTR) of the Rous Sarcoma Virus (Cullen et al., Molecular
and Cellular Biology, 438447 (March, 1985)) plus a fragment of the
CMV-enhancer (Boshart et al., Cell 41:521-530 (1985)). Multiple
cloning sites, e.g., with the restriction enzyme cleavage sites
BamHI, XbaI and Asp718, facilitate the cloning of the gene of
interest. The vectors contain in addition the 3' intron, the
polyadenylation and termination signal of the rat preproinsulin
gene.
Example 3(a)
Cloning and Expression in COS Cells
[0154] The expression plasmid, pHOIPS I HA, is made by cloning a
cDNA encoding HOIPS I into the expression vector pcDNAI/Amp or
pcDNAIII (which can be obtained from Invitrogen, Inc.).
[0155] The expression vector pcDNAI/amp contains: (1) an E. coli
origin of replication effective for propagation in E. coli and
other prokaryotic cells; (2) an ampicillin resistance gene for
selection of plasmid-containing prokaryotic cells; (3) an SV40
origin of replication for propagation in eukaryotic cells; (4) a
CMV promoter, a polylinker, an SV40 intron; (5) several codons
encoding a hemagglutinin fragment (i.e., an "HA" tag to facilitate
purification) followed by a termination codon and polyadenylation
signal arranged so that a cDNA can be conveniently placed under
expression control of the CMV promoter and operably linked to the
SV40 intron and the polyadenylation signal by means of restriction
sites in the polylinker. The HA tag corresponds to an epitope
derived from the influenza hemagglutinin protein described by
Wilson et al., Cell 37:767 (1984). The fusion of the HA tag to the
target protein allows easy detection and recovery of the
recombinant protein with an antibody that recognizes the HA
epitope. pcDNAIII contains, in addition, the selectable neomycin
marker.
[0156] A DNA fragment encoding the HOIPS I is cloned into the
polylinker region of the vector so that recombinant protein
expression is directed by the CMV promoter. The plasmid
construction strategy is as follows. The HOIPS I cDNA of the
deposited clone is amplified using primers that contain convenient
restriction sites, much as described above for construction of
vectors for expression of HOIPS I in E. coli. Suitable primers
include the following, which are used in this example. The 5'
primer, containing the underlined HindIII site, an AUG start codon
and 6 codons of the 5' coding region of the complete HOIPS I
polypeptide has the following sequence:
[0157] 5' AGCTAAGCTTCCGCCACCATGAAGGGTTTCACAGCC 3' (SEQ ID NO:8).
The 3' primer, containing the underlined XhoI site, a stop codon,
and 22 bp of 3' coding sequence has the following sequence:
TABLE-US-00002 5' CAGTCTCGAGTTAAGCGTAGTCTGGGACGTCGTA (SEQ ID NO:9)
TGGGTAGGAGCACATGATAGTAGCATTG 3'.
[0158] The PCR amplified DNA fragment and the vector, pcDNAI/Amp,
are digested with HindIII and XhoI and then ligated. The ligation
mixture is transformed into E. coli strain SURE (available from
Stratagene Cloning Systems, 11099 North Torrey Pines Road, La
Jolla, Calif. 92037), and the transformed culture is plated on
ampicillin media plates which then are incubated to allow growth of
ampicillin resistant colonies. Plasmid DNA is isolated from
resistant colonies and examined by restriction analysis or other
means for the presence of the HOIPS I-encoding fragment.
[0159] For expression of recombinant HOIPS I, COS cells are
transfected with an expression vector, as described above, using
DEAE-DEXTRAN, as described, for instance, in Sambrook et al.,
Molecular Cloning: a Laboratory Manual, Cold Spring Laboratory
Press, Cold Spring Harbor, N.Y. (1989). Cells are incubated under
conditions for expression of HOIPS I by the vector.
[0160] Expression of the HOIPS I-HA fusion protein is detected by
radiolabeling and immunoprecipitation, using methods described in,
for example Harlow et al., Antibodies: A Laboratory Manual, 2nd
Ed.; Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
(1988). To this end, two days after transfection, the cells are
labeled by incubation in media containing .sup.35S-cysteine for 8
hours. The cells and the media are collected, and the cells are
washed and lysed with detergent-containing RIPA buffer: 150 mM
NaCl, 1% NP-40, 0.1% SDS, 0.5% DOC, 50 mM TRIS, pH 7.5, as
described by Wilson et al. cited above. Proteins are precipitated
from the cell lysate and from the culture media using an
HA-specific monoclonal antibody. The precipitated proteins then are
analyzed by SDS-PAGE and autoradiography. An expression product of
the expected size is seen in the cell lysate, which is not seen in
negative controls.
Example 3(b)
Cloning and Expression in CHO Cells
[0161] The vector pC4 is used for the expression of HOIPS I
protein. Plasmid pC4 is a derivative of the plasmid pSV2-dhfr (ATCC
Accession No. 37146). The plasmid contains the mouse DHFR gene
under control of the SV40 early promoter. Chinese hamster ovary- or
other cells lacking dihydrofolate activity that are transfected
with these plasmids can be selected by growing the cells in a
selective medium (alpha minus MEM, Life Technologies) supplemented
with the chemotherapeutic agent methotrexate. The amplification of
the DHFR genes in cells resistant to methotrexate (MTX) has been
well documented (see, e.g., Alt, F. W., Kellems, R. M., Bertino, J.
R., and Schimke, R. T., 1978, J. Biol. Chem. 253:1357-1370, Hamlin,
J. L. and Ma, C. 1990, Biochem. et Biophys. Acta, 1097:107-143,
Page, M. J. and Sydenham, M. A. 1991, Biotechnology 9:64-68). Cells
grown in increasing concentrations of MTX develop resistance to the
drug by overproducing the target enzyme, DHFR, as a result of
amplification of the DHFR gene. If a second gene is linked to the
DHFR gene, it is usually co-amplified and over-expressed. It is
known in the art that this approach may be used to develop cell
lines carrying more than 1,000 copies of the amplified gene(s).
Subsequently, when the methotrexate is withdrawn, cell lines are
obtained which contain the amplified gene integrated into one or
more chromosome(s) of the host cell.
[0162] Plasmid pC4 contains for expressing the gene of interest the
strong promoter of the long terminal repeat (LTR) of the Rous
Sarcoma Virus (Cullen, et al., Molecular and Cellular Biology,
March 1985:438-447) plus a fragment isolated from the enhancer of
the immediate early gene of human cytomegalovirus (CMV) (Boshart et
al., Cell 41:521-530 (1985)). Downstream of the promoter are BamHI,
XbaI, and Asp718 restriction enzyme cleavage sites that allow
integration of the gene. Behind these cloning sites the plasmid
contains the 3' intron and polyadenylation site of the rat
preproinsulin gene. Other high efficiency promoters can also be
used for the expression, e.g., the human .beta.-actin promoter, the
SV40 early or late promoters or the long terminal repeats from
other retroviruses, e.g., HIV and HTLVI. Clontech's Tet-Off and
Tet-On gene expression systems and similar systems can be used to
express the HOIPS I in a regulated way in mammalian cells (Gossen,
M., & Bujard, H. 1992, Proc. Natl. Acad. Sci. USA 89:
5547-5551). For the polyadenylation of the mRNA other signals,
e.g., from the human growth hormone or globin genes can be used as
well. Stable cell lines carrying a gene of interest integrated into
the chromosomes can also be selected upon co-transfection with a
selectable marker such as gpt, G418 or hygromycin. It is
advantageous to use more than one selectable marker in the
beginning, e.g., G418 plus methotrexate.
[0163] The plasmid pC4 is digested with the restriction enzyme
BamHI and then dephosphorylated using calf intestinal phosphatase
by procedures known in the art. The vector is then isolated from a
1% agarose gel.
[0164] The DNA sequence encoding the complete HOIPS I protein
including its leader sequence is amplified using PCR
oligonucleotide primers corresponding to the 5' and 3' sequences of
the gene. The 5' primer has the sequence 5'
GACTGGATCCGCCATCATGAAGGGTTTCACAGCCAC 3' (SEQ ID NO:6) containing
the underlined BamHI restriction enzyme site followed by an
efficient signal for initiation of translation in eukaryotes, as
described by Kozak, M., J. Mol. Biol. 196:947-950 (1987), and 20
bases of the coding sequence of HOIPS I shown in FIGS. 1A-1B (SEQ
ID NO:1). The 3' primer has the sequence 5'
GACTGGTACCAGCAGCTGCACTCTTTGGG 3' (SEQ ID NO:10) containing the
underlined Asp718 restriction site followed by 19 nucleotides
complementary to the non-translated region of the HOIPS I gene
shown in FIGS. 1A-1B (SEQ ID NO:1).
[0165] The amplified fragment is digested with the endonucleases
BamHI and Asp718 and then purified again on a 1% agarose gel. The
isolated fragment and the dephosphorylated vector are then ligated
with T4 DNA ligase. E. coli HB101 or XL-1 Blue cells are then
transformed and bacteria are identified that contain the fragment
inserted into plasmid pC4 using, for instance, restriction enzyme
analysis.
[0166] Chinese hamster ovary cells lacking an active DHFR gene are
used for transfection. 5 .mu.g of the expression plasmid pC4 is
cotransfected with 0.5 .mu.g of the plasmid pSV2-neo using
lipofectin (Felgner et al., supra). The plasmid pSV2neo contains a
dominant selectable marker, the neo gene from Tn5 encoding an
enzyme that confers resistance to a group of antibiotics including
G418. The cells are seeded in alpha minus MEM supplemented with 1
mg/ml G418. After 2 days, the cells are trypsinized and seeded in
hybridoma cloning plates (Greiner, Germany) in alpha minus MEM
supplemented with 10, 25, or 50 ng/ml of methotrexate plus 1 mg/ml
G418. After about 10-14 days single clones are trypsinized and then
seeded in 6-well petri dishes or 10 ml flasks using different
concentrations of methotrexate (50 nM, 100 nM, 200 nM, 400 nM, 800
nM). Clones growing at the highest concentrations of methotrexate
are then transferred to new 6-well plates containing even higher
concentrations of methotrexate (1 .mu.M, 2 .mu.M, 5 .mu.M, 10 mM,
20 mM). The same procedure is repeated until clones are obtained
which grow at a concentration of 100-200 .mu.M. Expression of the
desired gene product is analyzed, for instance, by SDS-PAGE and
Western blot or by reverse phase HPLC analysis.
Example 4
Tissue Distribution of HOIPS I mRNA Expression
[0167] Northern blot analysis is carried out to examine HOIPS I
gene expression in human tissues, using methods described by, among
others, Sambrook et al., cited above. A cDNA probe containing the
entire nucleotide sequence of the HOIPS I protein (SEQ ID NO: 1) is
labeled with .sup.32P using the rediprime.TM. DNA labeling system
(Amersham Life Science), according to manufacturer's instructions.
After labeling, the probe is purified using a CHROMA SPIN-100.TM.
column (Clontech Laboratories, Inc.), according to manufacturer's
protocol number PT1200-1. The purified labeled probe is then used
to examine various human tissues for HOIPS I mRNA.
[0168] Multiple Tissue Northern (MTN) blots containing various
human tissues (H) or human immune system tissues (IM) are obtained
from Clontech and are examined with the labeled probe using
ExpressHyb.TM. hybridization solution (Clontech) according to
manufacturer's protocol number PT1190-1. Following hybridization
and washing, the blots are mounted and exposed to film at
-70.degree. C. overnight, and films developed according to standard
procedures.
[0169] The HOIPS I gene has been found to be expressed in
hematopoietic tissues including: spleen, tonsils, bone marrow,
dendritic cells, fetal and adult brain macrophages, B cells, lymph
nodes etc.
[0170] It will be clear that the invention may be practiced
otherwise than as particularly described in the foregoing
description and examples.
[0171] Numerous modifications and variations of the present
invention are possible in light of the above teachings and,
therefore, are within the scope of the appended claims.
[0172] The entire disclosure of all publications (including
patents, patent applications, journal articles, laboratory manuals,
books, or other documents) cited herein are hereby incorporated by
reference.
Sequence CWU 1
1
17 1 860 DNA Homo sapiens CDS (20)..(505) sig_peptide (20)..(79)
CDS (80)..(502) 1 tcccatacag gcccccacc atg aag ggt ttc aca gcc act
ctc ttc ctc tgg 52 Met Lys Gly Phe Thr Ala Thr Leu Phe Leu Trp -20
-15 -10 act ctg att ttt ccc agc tgc agt gga ggc ggc ggt ggg aaa gcc
tgg 100 Thr Leu Ile Phe Pro Ser Cys Ser Gly Gly Gly Gly Gly Lys Ala
Trp -5 1 5 ccc aca cac gtg gtc tgt agc gac agc ggc ttg gaa gtg ctc
tac cag 148 Pro Thr His Val Val Cys Ser Asp Ser Gly Leu Glu Val Leu
Tyr Gln 10 15 20 agt tgc gat cca tta caa gat ttt ggc ttt tct gtt
gaa aag tgt tcc 196 Ser Cys Asp Pro Leu Gln Asp Phe Gly Phe Ser Val
Glu Lys Cys Ser 25 30 35 aag caa tta aaa tca aat atc aac att aga
ttt gga att att ctg aga 244 Lys Gln Leu Lys Ser Asn Ile Asn Ile Arg
Phe Gly Ile Ile Leu Arg 40 45 50 55 gag gac atc aaa gag ctt ttt ctt
gac cta gct ctc atg tct caa ggc 292 Glu Asp Ile Lys Glu Leu Phe Leu
Asp Leu Ala Leu Met Ser Gln Gly 60 65 70 tca tct gtt ttg aat ttc
tcc tat ccc atc tgt gag gcg gct ctg ccc 340 Ser Ser Val Leu Asn Phe
Ser Tyr Pro Ile Cys Glu Ala Ala Leu Pro 75 80 85 aag ttt tct ttc
tgt gga aga agg aaa gga gag cag att tac tat gct 388 Lys Phe Ser Phe
Cys Gly Arg Arg Lys Gly Glu Gln Ile Tyr Tyr Ala 90 95 100 ggg cct
gtc aat aat cct gaa ttt act att cct cag gga gaa tac cag 436 Gly Pro
Val Asn Asn Pro Glu Phe Thr Ile Pro Gln Gly Glu Tyr Gln 105 110 115
gtt ttg ctg gaa ctg tac act gaa aaa cgg tcc acc gtg gcc tgt gcc 484
Val Leu Leu Glu Leu Tyr Thr Glu Lys Arg Ser Thr Val Ala Cys Ala 120
125 130 135 aat gct act atc atg tgc tcc tgactgtggc ctgtagcaaa
aatcacagcc 535 Asn Ala Thr Ile Met Cys Ser 140 agctgcatct
cgtgggacct ccaagctcct ctgactgaac ctactgtggg aggagaagca 595
gctgatgaca gagagaggct ctacaaagaa gcgcccccaa agagtgcagc tgctaatttt
655 agtcccagga ccagacatcc ccagactcca cagatgtaat gaagtccccg
aatgtatctg 715 tttctaagga gcctcttggc agtccttaag cagtcttgag
ggtccatcct ttttctctaa 775 ttggtcgcct cccaccagac tcacctgctt
ttcaactttt taggagtgct tcctcacagt 835 taccaagaaa taaagaaagc tggcc
860 2 162 PRT Homo sapiens 2 Met Lys Gly Phe Thr Ala Thr Leu Phe
Leu Trp Thr Leu Ile Phe Pro -20 -15 -10 -5 Ser Cys Ser Gly Gly Gly
Gly Gly Lys Ala Trp Pro Thr His Val Val 1 5 10 Cys Ser Asp Ser Gly
Leu Glu Val Leu Tyr Gln Ser Cys Asp Pro Leu 15 20 25 Gln Asp Phe
Gly Phe Ser Val Glu Lys Cys Ser Lys Gln Leu Lys Ser 30 35 40 Asn
Ile Asn Ile Arg Phe Gly Ile Ile Leu Arg Glu Asp Ile Lys Glu 45 50
55 60 Leu Phe Leu Asp Leu Ala Leu Met Ser Gln Gly Ser Ser Val Leu
Asn 65 70 75 Phe Ser Tyr Pro Ile Cys Glu Ala Ala Leu Pro Lys Phe
Ser Phe Cys 80 85 90 Gly Arg Arg Lys Gly Glu Gln Ile Tyr Tyr Ala
Gly Pro Val Asn Asn 95 100 105 Pro Glu Phe Thr Ile Pro Gln Gly Glu
Tyr Gln Val Leu Leu Glu Leu 110 115 120 Tyr Thr Glu Lys Arg Ser Thr
Val Ala Cys Ala Asn Ala Thr Ile Met 125 130 135 140 Cys Ser 3 133
PRT Gallus gallus 3 Trp Pro Thr His Thr Val Cys Lys Glu Glu Asn Leu
Glu Ile Tyr Tyr 1 5 10 15 Lys Ser Cys Asp Pro Gln Gln Asp Phe Ala
Phe Ser Ile Asp Arg Cys 20 25 30 Ser Asp Val Thr Thr His Thr Phe
Asp Ile Arg Ala Ala Met Val Leu 35 40 45 Arg Gln Ser Ile Lys Glu
Leu Tyr Ala Lys Val Asp Leu Ile Ile Asn 50 55 60 Gly Lys Thr Val
Leu Ser Tyr Ser Glu Thr Leu Cys Gly Pro Gly Leu 65 70 75 80 Ser Lys
Leu Ile Phe Cys Gly Lys Lys Lys Gly Glu His Leu Tyr Tyr 85 90 95
Glu Gly Pro Ile Thr Leu Gly Ile Lys Glu Ile Pro Gln Gly Asp Tyr 100
105 110 Thr Ile Thr Ala Arg Leu Thr Asn Glu Asp Arg Ala Thr Val Ala
Cys 115 120 125 Ala Asp Phe Thr Val 130 4 29 DNA Artificial Primer
4 gactccatgg gcggcggtgg gaaagcctg 29 5 30 DNA Artificial Primer 5
gactagatct ggagcacatg atagtagcat 30 6 36 DNA Artificial Primer 6
gactggatcc gccatcatga agggtttcac agccac 36 7 29 DNA Artificial
Primer 7 gactggtacc agcagctgca ctctttggg 29 8 36 DNA Artificial
Primer 8 agctaagctt ccgccaccat gaagggtttc acagcc 36 9 62 DNA
Artificial Primer 9 cagtctcgag ttaagcgtag tctgggacgt cgtatgggta
ggagcacatg atagtagcat 60 tg 62 10 29 DNA Artificial Primer 10
gactggtacc agcagctgca ctctttggg 29 11 514 DNA Homo sapiens
misc_feature (1)..(1) n is a, c, g, or t misc_feature (234)..(234)
n is a, c, g, or t misc_feature (337)..(337) n is a, c, g, or t
misc_feature (352)..(352) n is a, c, g, or t misc_feature
(354)..(354) n is a, c, g, or t misc_feature (373)..(373) n is a,
c, g, or t misc_feature (424)..(424) n is a, c, g, or t
misc_feature (428)..(428) n is a, c, g, or t misc_feature
(446)..(446) n is a, c, g, or t misc_feature (464)..(464) n is a,
c, g, or t misc_feature (484)..(484) n is a, c, g, or t
misc_feature (493)..(493) n is a, c, g, or t misc_feature
(495)..(495) n is a, c, g, or t misc_feature (508)..(508) n is a,
c, g, or t misc_feature (512)..(512) n is a, c, g, or t
misc_feature (514)..(514) n is a, c, g, or t 11 naattcgcga
gatttttccc agctgcagtg gaggcggcgg tgggaaagcc tggcccacac 60
acgtggtctg tagcgacagg ctttggaagt gctctaccag agttgcgatc cattacaaga
120 ttttggcttt tctgttgaaa agtgttccaa gcaattaaaa tcaaatatca
acattagatt 180 tggaattatt ctgaaggaca tcaaagagct ttttcttgac
ctagctctca tgtntcaagg 240 ctcatctgtt ttgaatttct cctatcccat
ctgtgaggcg gctctgccaa gttttctttc 300 tgtggaagaa ggaaaggaga
gcagatttac tatgctnggg ctgtcaataa tncngaattt 360 actatttcct
cangggggat taccaggttt tgctgggact gtacaatgaa aaacggtcca 420
ccgnggcngt gccatggtac tatcgngtgg tccgactgtg gccntaggaa aatcacacca
480 ttgnattcgg ggncnccagt ccttgatnac cnan 514 12 457 DNA Homo
sapiens misc_feature (34)..(34) n is a, c, g, or t misc_feature
(96)..(96) n is a, c, g, or t misc_feature (273)..(273) n is a, c,
g, or t misc_feature (295)..(295) n is a, c, g, or t 12 cacagccact
ctcttcctct ggactctaat tttncccagc tgcagtggag gcggcggtgg 60
gaaagcctgg cccacacacg tggtctgtag cgacanggct tggaagtgct ctaccagagt
120 tgcgatccat tacaagattt tggcttttct gttgaaaagt gttccaagca
attaaaatca 180 aatatcaaca ttagatttgg aattattctg agagaggaca
tcaaagagct ttttcttgac 240 ctagctctca tgtctcaagg ctcatctgtt
ttnaatttct cctatcccat ctgtnaggcg 300 gctctgccca agttttcttt
ctgtggaaga aggaaaggag agcagattta ctatgctggg 360 cctgttcaat
aaatcctgaa tttaactatt cctcagggag aataccaggt tttgctggaa 420
ctgtacactg aaaaacggtc caccgtggcc tgtgcca 457 13 413 DNA Homo
sapiens misc_feature (9)..(9) n is a, c, g, or t 13 ttggtaacnt
gtgaggaagc actcctaaaa agttgaaaag caggtgagtc tggtgggagg 60
cgaccaatta gagaaaaagg atggaccctc aagactgctt aaggactgcc aagaggctcc
120 ttagaaacag atacattcgg ggacttcatt acatctgtgg agtctgggga
tgtctggtcc 180 tgggactaaa attagcagct gcactctttg ggggcgcttc
tttgtagagc ctctctctgt 240 catcagctgc ttctcctccc acagtaggtt
cagtcagagg agcttggagg tcccacgaga 300 tgcagctggc tgtgattttt
gctacaggcc acagtcagga gcacatgata gtagcattgg 360 cacaggccac
ggtggaccgt ttttcagtgt acagttccag caaaacctgg gta 413 14 320 DNA Homo
sapiens misc_feature (237)..(237) n is a, c, g, or t misc_feature
(286)..(286) n is a, c, g, or t misc_feature (293)..(293) n is a,
c, g, or t misc_feature (308)..(308) n is a, c, g, or t 14
ggacatcaaa gagctttttc ttgacctagc tctcatgtct caaggctcat ctgttttgaa
60 tttctcctat cccatctgtg aggcggctct gccaagtttt ctttctgtgg
aagaaggaaa 120 ggagagcaga tttactatgc tgggcctgtc aataatcctg
aatttactat tcctcaggga 180 gaataccagg ttttgctgga actgtacact
gaaaaacggt ccaccgtggg cctgtgncaa 240 tgcttactat tcatgtgctc
ctgactgtgg gcctgttagc aaaaantcac agncagctgc 300 atctcgtngg
gaaccttcca 320 15 264 DNA Homo sapiens misc_feature (123)..(123) n
is a, c, g, or t misc_feature (229)..(229) n is a, c, g, or t
misc_feature (252)..(252) n is a, c, g, or t 15 ggcacgagcc
caccatgaag ggtttcacag ccactctctt cctctggact ctcatttttc 60
ccagctgcag tggaggcggc ggtggggaaa gcctggccca cacacgtggt ctgtagcgac
120 agnctttggg aagtgctcta ccagagttgc gatccattac aagattttgg
cttttctgtt 180 gaaaagtgtt ccaagcaatt aaaatcaaat atcaacatta
gatttggant tattctgaga 240 gaggacatca angagctttt tttt 264 16 249 DNA
Homo sapiens misc_feature (16)..(16) n is a, c, g, or t
misc_feature (24)..(24) n is a, c, g, or t misc_feature
(152)..(152) n is a, c, g, or t misc_feature (186)..(186) n is a,
c, g, or t misc_feature (204)..(204) n is a, c, g, or t
misc_feature (214)..(214) n is a, c, g, or t misc_feature
(219)..(219) n is a, c, g, or t misc_feature (223)..(223) n is a,
c, g, or t misc_feature (231)..(231) n is a, c, g, or t
misc_feature (239)..(239) n is a, c, g, or t misc_feature
(241)..(241) n is a, c, g, or t misc_feature (246)..(246) n is a,
c, g, or t 16 gatcgattac aagatnttgg cttntctgtt gaaaagtgtt
ccaagcaatt aaaatcaaat 60 atcaacatta gatttggaat tattctgaga
gaggacatca aagagctttt tcttgaccta 120 gctctcatgt ctcaaggctc
atctgttttg antttctcct atcccatctg tgaggcggct 180 ctgccnaagt
tttctttctg tggnagaagg aaanggggnc agntttactt nttcttgtnc 240
ntttcnatt 249 17 60 PRT Artificial Consensus sequence from Fig. 2
17 Trp Pro Thr His Val Cys Leu Glu Tyr Ser Cys Asp Pro Gln Asp Phe
1 5 10 15 Phe Ser Cys Ser Ile Arg Leu Arg Ile Lys Glu Leu Leu Gly
Val Leu 20 25 30 Ser Cys Leu Lys Phe Cys Gly Lys Gly Glu Tyr Tyr
Gly Pro Ile Pro 35 40 45 Gln Gly Tyr Leu Glu Arg Thr Val Ala Cys
Ala Thr 50 55 60
* * * * *