U.S. patent application number 11/436901 was filed with the patent office on 2007-01-18 for antiviral oligonucleotides having a conserved g4 core sequence.
This patent application is currently assigned to ISIS Pharmaceuticals, Inc.. Invention is credited to Kevin P. Anderson, C. Frank Bennett, Vickie L. Brown-Driver, Ming-Yi Chiang, David J. Ecker, Ronnie C. Hanecak, Timothy Vickers, Jacqueline R. Wyatt.
Application Number | 20070015723 11/436901 |
Document ID | / |
Family ID | 25495059 |
Filed Date | 2007-01-18 |
United States Patent
Application |
20070015723 |
Kind Code |
A1 |
Hanecak; Ronnie C. ; et
al. |
January 18, 2007 |
Antiviral oligonucleotides having a conserved G4 core sequence
Abstract
Modified oligonucleotides having a conserved G.sub.4 sequence
and a sufficient number of flanking nucleotides to significantly
inhibit the activity of a virus or phospholipase A.sub.2 or to
modulate the telomere length of a chromosome are provided. G.sub.4
quartet oligonucleotide structures are also provided. Methods of
prophylaxis, diagnostics and therapeutics for viral-associated
diseases and diseases associated with elevated levels of
phospholipase A.sub.2 are also provided. Methods of modulating
telomere length of a chromosome are also provided; modulation of
telomere length is believed to play a role in the aging process of
a cell and in control of malignant cell growth.
Inventors: |
Hanecak; Ronnie C.; (San
Clemente, CA) ; Anderson; Kevin P.; (Carlsbad,
CA) ; Bennett; C. Frank; (Carlsbad, CA) ;
Chiang; Ming-Yi; (San Diego, CA) ; Brown-Driver;
Vickie L.; (Solana Beach, CA) ; Ecker; David J.;
(Encinitas, CA) ; Vickers; Timothy; (Oceanside,
CA) ; Wyatt; Jacqueline R.; (Sundance, WY) |
Correspondence
Address: |
KING & SPALDING LLP
1180 PEACHTREE STREET
ATLANTA
GA
30309
US
|
Assignee: |
ISIS Pharmaceuticals, Inc.
|
Family ID: |
25495059 |
Appl. No.: |
11/436901 |
Filed: |
May 17, 2006 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10038335 |
Jan 2, 2002 |
7067497 |
|
|
11436901 |
May 17, 2006 |
|
|
|
09299058 |
Apr 23, 1999 |
|
|
|
10038335 |
Jan 2, 2002 |
|
|
|
08403888 |
Jun 12, 1995 |
5952490 |
|
|
PCT/US93/09297 |
Sep 29, 1993 |
|
|
|
09299058 |
Apr 23, 1999 |
|
|
|
07954185 |
Sep 29, 1992 |
|
|
|
08403888 |
Jun 12, 1995 |
|
|
|
Current U.S.
Class: |
514/44A ;
514/81 |
Current CPC
Class: |
C12N 2310/346 20130101;
C12Y 301/01004 20130101; A61K 31/70 20130101; C12N 2310/315
20130101; A61P 31/12 20180101; C12N 2310/321 20130101; C12Y
207/07049 20130101; C12Q 1/701 20130101; A61K 38/00 20130101; C12N
2310/151 20130101; C12N 2310/18 20130101; A61P 35/00 20180101; A61P
31/22 20180101; C07H 21/00 20130101; C12N 15/115 20130101; C12N
15/117 20130101; A61P 31/18 20180101; C12N 2310/341 20130101; C12N
15/1133 20130101; C12N 15/1137 20130101; A61P 31/16 20180101; C12N
2310/321 20130101; C12N 2310/3521 20130101 |
Class at
Publication: |
514/044 ;
514/081 |
International
Class: |
A61K 48/00 20070101
A61K048/00 |
Claims
1. A chemically modified oligonucleotide having no more than about
27 nucleic acid base units, said oligonucleotide comprising at
least one GGGG sequence or at least two GGG sequences and a
sufficient number of flanking nucleotides to significantly inhibit
the activity of a virus or phospholipase A.sub.2 or to modulate the
telomere length of a chromosome.
2. An oligonucleotide of claim 1 wherein significant inhibition of
viral or enzyme activity is at least 50% inhibition.
3. An oligonucleotide of claim 1 wherein the virus is HIV, HSV,
HCMV or influenza virus.
4. An oligonucleotide of claim 3 wherein the virus is HSV.
5. An oligonucleotide of claim 4 wherein the oligonucleotide is
selected from the group consisting of: SEQ ID NO: 21, SEQ ID NO: 1,
SEQ ID NO: 8, SEQ ID NO: 12, SEQ ID NO: 16, SEQ ID NO: 22, SEQ ID
NO: 28, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35,
SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID
NO: 42, SEQ ID NO: 47, SEQ ID NO: 48 and SEQ ID NO: 50.
6. An oligonucleotide of claim 4 having a sequence shown in Table
8.
7. An oligonucleotide of claim 6 having a sequence selected from
the group consisting of SEQ ID NO: 124, SEQ ID NO:126, SEQ ID NO:
127, SEQ ID NO: 128, SEQ ID NO: 129, SEQ ID NO: 130 and SEQ ID NO:
133.
8. An oligonucleotide of claim 1 having the sequence
(N.sub.XG.sub.4N.sub.Y).sub.Q wherein X and Y are independently 1
to 8 and Q is 1 to 4.
9. An oligonucleotide of claim 8 having the sequence NNGGGGNN.
10. An oligonucleotide of claim 9 which has at least one
phosphorothioate intersugar linkage and which has the sequence
GNGGGGTN.
11. An oligonucleotide of claim 1 having the sequence
(G.sub.4N.sub.XG.sub.4).sub.Q wherein X is 1 to 8 and Q is 1 to
3.
12. An oligonucleotide of claim 1 having the sequence
(N.sub.XG.sub.3-4).sub.QN.sub.X wherein X is 1 to 8 and Q is 1 to
6.
13. An oligonucleotide of claim 1 which has at least one
phosphorothioate intersugar (backbone) linkage.
14. An oligonucleotide of claim 1 wherein each of the nucleosides
is in the alpha (.alpha.) anomeric configuration.
15. An oligonucleotide of claim 1 which is a chimeric
oligonucleotide.
16. A phosphorothioate oligonucleotide having SEQ ID NO: 21.
17. A phosphorothioate oligonucleotide having the sequence
TTGGGGTT.
18. The oligonucleotide of claim 17 wherein each of the nucleotides
of the oligonucleotide is in the alpha (.alpha.) anomeric
configuration.
19. A method for inhibiting the activity of a virus comprising
contacting the virus with a chemically modified oligonucleotide
having no more than 27 nucleic acid base units comprising at least
one GGGG sequence and at least two GGG sequences and a sufficient
number of flanking nucleotides to significantly inhibit the
activity of the virus.
20. The method of claim 19 wherein significant inhibition of viral
activity is at least 50% inhibition.
21. The method of claim 19 wherein the virus is HIV, HSV, HCMV or
influenza virus.
22. The method of claim 21 wherein the virus is HSV.
23. The method of claim 22 wherein the oligonucleotide is selected
from the group consisting of: SEQ ID NO: 21, SEQ ID NO: 1, SEQ ID
NO: 8, SEQ ID NO: 12, SEQ ID NO: 16, SEQ ID NO: 22, SEQ ID NO: 28,
SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID
NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 42,
SEQ ID NO: 47, SEQ ID NO: 48 and SEQ ID NO: 50.
24. The method of claim 22 wherein the oligonucleotide has a
sequence shown in Table 8.
25. The method of claim 24 wherein the oligonucleotide has a
sequence selected from the group consisting of SEQ ID NO: 124, SEQ
ID NO: 126, SEQ ID NO: 127, SEQ ID NO: 128, SEQ ID NO: 129, SEQ ID
NO: 130 and SEQ ID NO: 133.
26. The method of claim 19 wherein said oligonucleotide has the
sequence (N.sub.XG.sub.4N.sub.Y).sub.Q wherein X and Y are
independently 1 to 8 and Q is 1 to 4.
27. The method of claim 26 wherein said oligonucleotide has the
sequence NNGGGGNN.
28. The method of claim 27 wherein the oligonucleotide has at least
one phosphorothioate intersugar linkage and the sequence
GNGGGGTN.
29. The method of claim 19 wherein said oligonucleotide has the
sequence (G.sub.4N.sub.XG.sub.4).sub.Q wherein X is 1 to 8 and Q is
1 to 3.
30. The method of claim 19 wherein said oligonucleotide has the
sequence (N.sub.XG.sub.3-4).sub.QN.sub.X wherein X is 1 to 8 and Q
is 1 to 6.
31. The method of claim 19 wherein said oligonucleotide comprises a
sequence identified in Table 1, Table 2 or Table 3.
32. The method of claim 19 wherein said oligonucleotide has at
least one phosphorothioate intersugar (backbone) linkage.
33. The method of claim 19 wherein each of the nucleosides of the
oligonucleotide is in the alpha (.alpha.) anomeric
configuration.
34. The method of claim 19 wherein the oligonucleotide is a
chimeric oligonucleotide.
35. A method for inhibiting the activity of a virus comprising
contacting the virus with a phosphorothioate oligonucleotide having
SEQ ID NO: 21.
36. A method for inhibiting the activity of a virus comprising
contacting the virus with a phosphorothioate oligonucleotide having
the sequence TTGGGGTT.
37. The method of claim 36 wherein each of the nucleotides of the
oligonucleotide is in the alpha (.alpha.) anomeric
configuration.
38. The method of claim 36 wherein the virus is HIV.
39. A method for inhibiting phospholipase A.sub.2 enzyme activity
comprising contacting a cell with a chemically modified
oligonucleotide having no more than about 27 nucleic acid base
units comprising at least one GGGG sequence or at least two GGG
sequences and a sufficient number of flanking nucleotides to
significantly inhibit the activity of phospholipase A.sub.2.
40. The method of claim 39 wherein the phospholipase A.sub.2 enzyme
activity is inhibited by greater than 50%.
41. The method of claim 39 wherein said oligonucleotide comprises a
sequence selected from the group consisting of: SEQ ID NO:12, SEQ
ID NO:21, SEQ ID NO:22, SEQ ID NO:26, SEQ ID NO:42, SEQ ID NO:47,
SEQ ID NO:50, SEQ ID NO:65, SEQ ID NO:66, SEQ ID NO:68, SEQ ID
NO:71, SEQ ID NO:73, SEQ ID NO:83, SEQ ID NO:97, SEQ ID NO:98, SEQ
ID NO:99, SEQ ID NO:104, SEQ ID NO:105, SEQ ID NO:106, SEQ ID
NO:107 and TGGGG.
42. The method of claim 39 wherein said oligonucleotide has at
least one phosphorothioate intersugar (backbone) linkage.
43. A method of treating a viral-associated disease comprising
administering to an animal having a viral-associated disease a
therapeutically effective amount of a chemically modified
oligonucleotide having no more than about 27 nucleic acid base
units comprising at least one GGGG sequence and at least two GGG
sequences and a sufficient number of flanking nucleotides to
significantly inhibit the activity of the virus.
44. The method of claim 43 wherein significant inhibition of viral
activity is at least 50% inhibition.
45. The method of claim 43 wherein the virus is HIV, HSV, HCMV or
influenza virus.
46. The method of claim 45 wherein the virus is HSV.
47. The method of claim 46 wherein the oligonucleotide is selected
from the group consisting of: SEQ ID NO: 21, SEQ ID NO: 1, SEQ ID
NO: 8, SEQ ID NO: 12, SEQ ID NO: 16, SEQ ID NO: 22, SEQ ID NO: 28,
SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID
NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 42,
SEQ ID NO: 47, SEQ ID NO: 48 and SEQ ID NO: 50.
48. The method of claim 46 wherein the nucleotide has a sequence
shown in Table 8.
49. The method of claim 48 wherein the oligonucleotide has a
sequence selected from the group consisting of SEQ ID NO: 124, SEQ
ID NO: 126, SEQ ID NO: 127, SEQ ID NO: 128, SEQ ID NO: 129, SEQ ID
NO: 130 and SEQ ID NO: 133.
50. The method of claim 43 wherein said oligonucleotide has the
sequence (N.sub.XG.sub.4N.sub.Y).sub.Q wherein X and Y are
independently 1 to 8 and Q is 1 to 4.
51. The method of claim 50 wherein said oligonucleotide has the
sequence NNGGGGNN.
52. The method of claim 51 wherein said oligonucleotide has at
least one phosphorothioate intersugar linkage and the sequence
GNGGGGTN.
53. The method of claim 43 wherein said oligonucleotide has the
sequence (G.sub.4N.sub.XG.sub.4).sub.Q wherein X is 1 to 8 and Q is
1 to 3.
54. The method of claim 43 wherein said oligonucleotide has the
sequence (N.sub.XG.sub.3-4).sub.QN.sub.X wherein X is 1 to 8 and Q
is 1 to 6.
55. The method of claim 43 wherein said oligonucleotide comprises a
sequence identified in Table 1, Table 2 or Table 3.
56. The method of claim 43 wherein said oligonucleotide has at
least one phosphorothioate intersugar (backbone) linkage.
57. The method of claim 43 wherein each of the nucleotides of the
oligonucleotide is in the alpha (.alpha.) anomeric
configuration.
58. The method of claim 43 wherein the oligonucleotide is a
chimeric oligonucleotide.
59. A method of treating a viral-associated disease comprising
contacting the virus with a phosphorothioate oligonucleotide having
SEQ ID NO: 21.
60. A method of treating a viral-associated disease comprising
contacting the virus with a phosphorothioate oligonucleotide having
the sequence TTGGGGTT.
61. The method of claim 60 wherein each of the nucleotides of the
oligonucleotide is in the alpha (.alpha.) anomeric
configuration.
62. The method of claim 60 wherein the virus is HIV.
63. A method of treating an inflammatory disease or a neurological
disorder associated with phospholipase A.sub.2 enzyme activity
comprising administering to an animal having such an inflammatory
disease or neurological disease a therapeutically effective amount
of a chemically modified oligonucleotide having no more than about
27 nucleic acid base units comprising at least one GGGG sequence
and at least two GGG sequences and a sufficient number of flanking
nucleotides to significantly inhibit the activity of phospholipase
A.sub.2.
64. The method of claim 63 wherein significant inhibition of enzyme
activity is at least 50% inhibition.
65. The method of claim 63 wherein said oligonucleotide comprises a
sequence selected from the group consisting of: SEQ ID NO:12, SEQ
ID NO:21, SEQ ID NO:22, SEQ ID NO:26, SEQ ID NO:42, SEQ ID NO:47,
SEQ ID NO:50, SEQ ID NO:65, SEQ ID NO:66, SEQ ID NO:68, SEQ ID
NO:71, SEQ ID NO:73, SEQ ID NO:83, SEQ ID NO:97, SEQ ID NO:98, SEQ
ID NO:99, SEQ ID NO: 104, SEQ ID NO: 105, SEQ ID NO:106, SEQ ID
NO:107 and TGGGG.
66. A method of modulating telomere length of a chromosome
comprising contacting a chromosome with a chemically modified
oligonucleotide 6 to 27 nucleic acid base units in length having
the sequence (N.sub.XG.sub.3-4).sub.QN.sub.X wherein X is 1-8 and Q
is 1-5.
67. A method for inhibiting the division of a malignant cell
comprising contacting a malignant cell with a chemically modified
oligonucleotide having 6 to 27 nucleic acid base units and having
the sequence (N.sub.XG.sub.3-4).sub.QN.sub.X wherein X is 1-8 and Q
is 1-5.
68. A compound comprising a G-quartet structure of phosphorothioate
oligonucleotides each oligonucleotide having the sequence TxG4Ty
where x and y are independently 0 to 8.
69. The compound of claim 68 wherein the nucleotides of at least
one of the oligonucleotides of the G-quartet structure are in the
alpha (.alpha.) anomeric configuration.
70. The compound of claim 68 wherein x is 2 and y is 2.
71. The compound of claim 68 wherein x is 0 and y is 2.
72. The compound of claim 68 wherein x is 3 and y is 3.
73. The compound of claim 68 wherein each oligonucleotide has the
sequence (TxG4Ty)q where x and y are independently 0 to 8 and q is
from 1 to 10.
74. A method for inhibiting the activity of human immunodeficiency
virus comprising administering to a cell infected with said virus a
compound comprising a G-quartet structure of phosphorothioate
oligonucleotides each oligonucleotide having the sequence TxG4Ty
where x and y are independently 0 to 8 in an amount sufficient to
inhibit the activity of the virus.
75. The method of claim 74 wherein inhibition of viral activity is
at least 50% inhibition.
76. The method of claim 74 wherein a compound in which x is 2 and y
is 2 is administered to a cell infected with human immunodeficiency
virus.
77. The method of claim 75 wherein a compound in which x is 0 and y
is 2 is administered to a cell infected with human immunodeficiency
virus.
78. The method of claim 75 wherein a compound in which x is 3 and y
is 3 is administered to a cell infected with human immunodeficiency
virus.
79. A method for treating a patient infected with human
immunodeficiency virus comprising administering to said patient a
compound comprising a G-quartet structure of phosphorothioate
oligonucleotides having the sequence TxG4Ty where x and y are
independently 0 to 8 in an amount sufficient to inhibit the
activity of the virus.
80. The method of claim 79 wherein a compound in which x is 2 and y
is 2 is administered to said patient infected with human
immunodeficiency virus.
81. The method of claim 79 wherein a compound in which x is 0 and y
is 2 is administered to said patient infected with human
immunodeficiency virus.
82. The method of claim 79 wherein a compound in which x is 3 and y
is 3 is administered to said patient infected with human
immunodeficiency virus.
83. A pharmaceutical composition comprising a compound comprising a
G-quartet structure of phosphorothioate oligonucleotides having the
sequence TxG4Ty where x and y are independently 0 to 8 and a
pharmaceutically acceptable carrier.
84. A prophylactic device coated with a compound comprising a
G-quartet structure of phosphorothioate oligonucleotides having the
sequence TxG4Ty where x and y are independently 0 to 8.
Description
CROSS REFERENCE TO RELATED APPLICATIONS
[0001] The present application is a continuation of U.S.
application Ser. No. 08/403,888 filed Jun. 12, 1995, which is the
national phase of PCT Application Serial No. PCT/US93/09297 filed
Sep. 29, 1993, which is a continuation-in-part of U.S. application
Ser. No. 07/954,185 filed Sep. 29, 1992, now abandoned, each of
which is incorporated herein by reference in its entirety.
FIELD OF THE INVENTION
[0002] This invention relates to the design and synthesis of
oligonucleotides which can be used to inhibit the activity of
viruses in vivo or in vitro and to treat viral-associated disease.
These compounds can be used either prophylactically or
therapeutically for diseases associated with viruses such as HIV,
HSV, HCMV and influenza. Oligonucleotides capable of inhibiting
phospholipase A.sub.2 enzyme activity are also provided which may
be useful for the treatment of inflammatory disorders, as well as
neurological conditions. Oligonucleotides designed for the
treatment of cancer and to retard aging are also contemplated by
this invention.
BACKGROUND OF THE INVENTION
Antivirals
[0003] There have been many approaches for inhibiting the activity
of viruses such as the human immunodeficiency virus (HIV), herpes
simplex virus (HSV), human cytomegalovirus (HCMV) and influenza.
Such prior art methods include nucleoside analogs (e.g., HSV) and
antisense oligonucleotide therapies (e.g., HIV, influenza).
[0004] Prior attempts to inhibit HIV by various approaches have
been made by a number of researchers. For example, Zamecnik and
coworkers have used phosphodiester antisense oligonucleotides
targeted to the reverse transcriptase primer site and to splice
donor/acceptor sites, P. C. Zamecnik, J. Goodchild, Y. Taguchi, P.
S. Sarin, Proc. Natl. Acad. Sci. USA 1986, 83, 4143. Goodchild and
coworkers have made phosphodiester antisense compounds targeted to
the initiation sites for translation, the cap site, the
polyadenylation signal, the 5' repeat region, primer binding site,
splice sites and a site between the gag and pol genes. J.
Goodchild, S. Agrawal, M. P. Civeira, P. S. Sarin, D. Sun, P. C.
Zamecnik, Proc. Natl. Acad. Sci. U.S.A. 1988, 85, 5507; U.S. Pat.
No. 4,806,463. Agrawal and coworkers have used chemically modified
antisense oligonucleotide analogs targeted to the cap and splice
donor/acceptor sites. S. Agrawal, J. Goodchild, M. P. Civeira, A.
H. Thornton, P. S. Sarin, P. C. Zamecnik, Proc. Nat'l. Acad. Sci.
USA 1988, 85, 7079. Agrawal and coworkers have used antisense
oligonucleotide analogs targeted to the splice donor/acceptor site
inhibit HIV infection in early infected and chronically infected
cells. S. Agrawal, T. Ikeuchi, D. Sun, P. S. Sarin, A. Konopka, J.
Maizel, Proc. Natl. Acad. Sci. U.S.A. 1989, 86, 7790.
[0005] Sarin and coworkers have also used chemically modified
antisense oligonucleotide analogs targeted to the HIV cap and
splice donor/acceptor sites. P. S. Sarin, S. Agrawal, M. P.
Civeira, J. Goodchild, T. Ikeuchi, P. C. Zamecnik, Proc. Natl.
Acad. Sci. U.S.A. 1988, 85, 7448. Zaia and coworkers have also used
an antisense oligonucleotide analog targeted to a splice acceptor
site to inhibit HIV. J. A. Zaia, J. J. Rossi, G. J. Murakawa, P. A.
Spallone, D. A. Stephens, B. E. Kaplan, J. Virol. 1988, 62, 3914.
Matsukura and coworkers have synthesized antisense oligonucleotide
analogs targeted to the initiation of translation of the HIV rev
gene mRNA. M. Matsukura, K. Shinozuka, G. Zon, Proc. Natl. Acad.
Sci. USA 1987, 84, 7706; R. L. Letsinger, G. R. Zhang, D. K. Sun,
T. Ikeuchi, P. S. Sarin, Proc. Natl. Acad. Sci. U.S.A. 1989, 86,
6553. Mori and coworkers have used a different antisense
oligonucleotide analog targeted to the same region as Matsukura. K.
Mori, C. Boiziau, C. Cazenave, Nucleic Acids Res. 1989, 17, 8207.
Shibahara and coworkers have used antisense oligonucleotide analogs
targeted to a splice acceptor site as well as the reverse
transcriptase primer binding site. S. Shibahara, S. Mukai, H.
Morisawa, H. Nakashima, S. Kobayashi, N. Yamamoto, Nucl. Acids Res.
1989, 17, 239. Letsinger and coworkers have synthesized and tested
a oligonucleotide analogs with conjugated cholesterol targeted to a
splice site. K. Mori, C. Boiziau, C. Cazenave, Nucleic Acids Res.
1989, 17, 8207. Stevenson and Iversen have conjugated polylysine to
antisense oligonucleotide analogs targeted to the splice donor and
the 5'-end of the first exon of the HIV tat gene. M. Stevenson, P.
L. Iversen, J. Gen. Virol. 1989, 70, 2673. Buck and coworkers have
described the use of phosphate-methylated DNA oligonucleotides
targeted to HIV mRNA and DNA. H. M. Buck, L. H. Koole, M. H. P. van
Gendersen, L. Smith, J. L. M. C. Green, S. Jurriaans and J.
Goudsmit, Science 1990, 248, 208-212.
[0006] These prior attempts at inhibiting HIV activity have largely
focused on the nature of the chemical modification used in the
oligonucleotide analog. Although each of the above publications
have reported some degree of success in inhibiting some function of
the virus, a general therapeutic scheme to target HIV and other
viruses has not been found. Accordingly, there has been and
continues to be a long-felt need for the design of compositions
which are capable of effective, therapeutic use.
[0007] Currently, nucleoside analogs are the preferred therapeutic
agents for herpes (HSV) infections. A number of pyrimidine
deoxyribonucleoside compounds have a specific affinity for the
virus-encoded thymidine (dCyd) kinase enzyme. The specificity of
action of these compounds confines the phosphorylation and
antiviral activity of these compounds to virus-infected cells. A
number of drugs from this class, e.g., 5-iodo-dUrd (IDU),
5-trifluoro-methyl-dUrd (FMAU), 5-ethyl-dUrd (EDU),
(E)-5-(2-bromovinyl)-dUrd (BVDU), 5-iodo-dCyd (IDC), and
5-trifluoromethyl-dUrd (TFT), are either in clinical use or likely
to become available for clinical use in the near future. IDU is a
moderately effective topical antiviral agent when applied to HSV
gingivostomatitis and ocular stromal keratitis; however, its use in
controlled clinical studies of HSV encephalitis revealed a high
toxicity associated with IDU treatment. Although the antiviral
specificity of 5-arabinofuranosyl cytosine (Ara-C) was initially
promising, its clinical history has paralleled that of IDU. The
clinical appearance of HSV strains which are deficient in their
ability to synthesize the viral thymidine kinase has generated
further concern over the future efficacy of this class of
compounds.
[0008] The utility of a number of viral targets has been defined
for anti-HSV compound development. Studies with thiosemicarbazone
compounds have demonstrated that inhibition of the viral
ribonucleotide reductase enzyme is an effective means of inhibiting
replication of HSV in vitro. Further, a number of purine
nucleosides which interfere with viral DNA replication have been
approved for treatment of human HSV infections.
9-(.beta.-D-arabinofuranosyl)adenine (Ara-A) has been used for
treatment of HSV-1 keratitis, HSV-1 encephalitis and neonatal
herpes infections. Reports of clinical efficacy are contradictory
and a major disadvantage for practical use is the extremely poor
solubility of Ara-A in water. 9-(2-hydroxyethoxymethyl)guanine
(Acyclovir, ACV) is of major interest. In humans, ACV has been used
successfully in the therapy of localized and disseminated HSV
infections. However there appear to be both the existence of
drug-resistant viral mutants and negative results in double-blind
studies of HSV-1 treatment with ACV. ACV, like Ara-A, is poorly
soluble in water (0.2%) and this physical characteristic limits the
application forms for ACV. The practical application of purine
nucleoside analogs in an extended clinical situation suffers from
their inherently efficient catabolism, which not only lowers the
biological activity of the drug but also may result in the
formation of toxic catabolites.
[0009] The effective anti-HSV compounds currently in use or
clinical testing are nucleoside analogs. The efficacy of these
compounds is diminished by their inherently poor solubility in
aqueous solutions, rapid intracellular catabolism and high cellular
toxicities. An additional caveat to the long-term use of any given
nucleoside analogue is the recent detection of clinical isolates of
HSV which are resistant to inhibition by nucleoside compounds which
were being administered in clinical trials. Antiviral
oligonucleotides offer the potential of better compound
solubilities, lower cellular toxicities and less sensitivity to
nucleotide point mutations in the target gene than those typical of
the nucleoside analogs.
[0010] Effective therapy for cytomegalovirus (CMV) has not yet been
developed despite studies on a number of antivirals. Interferon,
transfer factor, adenine arabinoside (Ara-A), acycloguanosine
(Acyclovir, ACV) and certain combinations of these drugs have been
ineffective in controlling CMV infection. Based on preclinical and
clinical data, foscarnet (PFA) and ganciclovir (DHPG) show limited
potential as antiviral agents. PFA treatment has resulted in the
resolution of CMV retinitis in five AIDS patients. DHPG studies
have shown efficacy against CMV retinitis or colitis. DHPG seems to
be well tolerated by treated individuals, but the appearance of a
reversible neutropenia, the emergence of resistant strains of CMV
upon long-term administration, and the lack of efficacy against CMV
pneumonitis limit the long term applications of this compound. The
development of more effective and less-toxic therapeutic compounds
and methods is needed for both acute and chronic use.
[0011] Classical therapeutics has generally focused upon
interactions with proteins in efforts to moderate their
disease-causing or disease-potentiating functions. Such therapeutic
approaches have failed for cytomegalovirus infections. Therefore,
there is an unmet need for effective compositions capable of
inhibiting cytomegalovirus activity.
[0012] There are several drugs available which have some activity
against the influenza virus prophylactically. None, however, are
effective against influenza type B. Moreover, they are generally of
very limited use therapeutically and have not been widely used in
treating the disease after the onset of symptoms. Accordingly,
there is a world-wide need for improved therapeutic agents for the
treatment of influenza virus infections.
[0013] Prior attempts at the inhibition of influenza virus using
antisense oligonucleotides have been reported. Leiter and
co-workers have targeted phosphodiester and phosphorothioate
oligonucleotides to influenza A and influenza C viruses. Leiter,
J., Agrawal, S., Palese, P. & Zamecnik, P. C., Proc. Natl.
Acad. Sci. USA; 1990, 87, 3430-3434. These workers targeted the
polymerase PB1 gene and mRNA in the vRNA 3' region and mRNA 5'
region, respectively. Sequence-specific inhibition of influenza A
was not observed although some specific inhibition of influenza C
was noted.
[0014] Zerial and co-workers have reported inhibition of influenza
A virus by oligonucleotides coincidentally linked to an
intercalating agent. Zerial, A., Thuong, N. T. & Helene, C.,
Nucleic Acids Res. 1987, 57, 9909-9919. Zerial et al. targeted the
3' terminal sequence of 8 vRNA segments. Their oligonucleotide
analog was reported to inhibit the cytopathic effects of the virus
in cell culture.
[0015] Kabanov and co-workers have synthesized an oligonucleotide
complementary to the loop-forming site of RNA encoding RNA
polymerase 3. Kabanov, A. V., Vinogradov, S. V., Ovcharenko, A. V.,
Krivonos, A. V., Melik-Nubarov, N. S., Kiselev, V. I., Severin, E.
S., FEB; 1990, 259, 327-330. Their oligonucleotide was conjugated
to a undecyl residue at the 5' terminal phosphate group. They found
that their oligonucleotide inhibited influenza A virus infection in
MDCK cells.
[0016] Although each of the foregoing workers reported some degree
of success in inhibiting some function of an influenza virus, a
general therapeutic scheme to target influenza viruses has not been
found. Moreover, improved efficacy is required in influenza virus
therapeutics. Accordingly, there has been and continues to be a
long-felt need for the design of oligonucleotides which are capable
of effective therapeutic use.
Phospholipase A.sub.2 Enzyme Activity
[0017] Phospholipase A.sub.2 is a family of lipolytic enzymes which
hydrolyze membrane phospholipids. Phospholipase A.sub.2 catalyzes
the hydrolysis of the sn-2 bond of phospholipids resulting in the
production of free fatty acid and lysophospholipids. Several types
of phospholipase A.sub.2 enzymes have been cloned and sequenced
from human cells. However, there is biochemical evidence that
additional forms of phospholipase A.sub.2 exists. Mammalian
secreted phospholipase A.sub.2 shares strong sequence similarities
with phospholipase A.sub.2 isolated from the venom of poisonous
snakes. Secreted forms of phospholipase A.sub.2 have been grouped
into two categories based upon the position of cysteine residues in
the protein. Type I phospholipase A.sub.2 includes enzymes isolated
from the venoms of Elapidae (cobras), Hydrophidae (sea snakes) and
the mammalian pancreatic enzyme. Type II phospholipase A.sub.2
includes enzymes isolated from the venoms of Crotalidae
(rattlesnakes and pit vipers), Viperidae (old world vipers) and an
enzyme secreted from platelets and other mammalian cells.
[0018] Much interest has been generated in mammalian type II
phospholipase A.sub.2, in that elevated concentrations of the
enzyme have been detected in a variety of inflammatory disorders
including rheumatoid arthritis, inflammatory bowel disease, and
septic shock as well as neurological conditions such as
schizophrenia, Pruzanski, W., Keystone, E. C., Stemby, B.,
Bombardier, C., Snow, K. M., and Vadas, P. J. Rheumatol. 1988, 15,
1351; Pruzanski and Vadas J. Rheumatol. 1988, 15, 11; Oliason, G.,
Sjodahl, R., and Tagesson, C. Digestion 1988, 41, 136; Vadas et al.
Crit. Care Med. 1988, 16, 1; Gattaz, W. F., Hubner, C. v.K.,
Nevalainen, T. J., Thuren, T., and Kinnunen, P. K. J. Biol.
Psychiatry 1990, 28, 495. It has been recently demonstrated that
secretion of type II phospholipase A.sub.2 is induced by a variety
of proinflammatory cytokines such as interleukin-1, interleukin 6,
tumor necrosis factor, interferon-.gamma., and bacterial
lipopolysaccharide. Hulkower, K., Hope, W. C., Chen, T., Anderson,
C. M., Coffey, J. W., and Morgan, D. W., Biochem. Biophys. Res.
Comm. 1992, 184, 712; Crowl, R. M., Stoller, T. J., Conroy, R. R.
and Stoner, C. R., J. Biol. Chem. 1991, 266, 2647; Schalkwijk, C.,
Pfeilschafter, J., Marki, F., and van den Bosch, J., Biochem.
Biophys. Res. Comm. 1991, 174, 268; Gilman, S. C. and Chang, J., J.
Rheumatol. 1990, 17, 1392; Oka, S. and Arita, H., J. Biol. Chem.
1991, 266, 9956. Anti-inflammatory agents such as transforming
growth factor-.beta. and glucocorticoids have been found to inhibit
secretion of type II phospholipase A.sub.2. Oka, S. and Arita, H.,
J. Biol. Chem. 1991, 266, 9956; Schalkwijk, C., Pfeilschifter, J.,
Marki, F. and van den Bosch, H., J. Biol. Chem. 1992, 267, 8846.
Type II phospholipase A.sub.2 has been demonstrated to be secreted
from a variety of cell types including platelets, chrondrocytes,
synoviocytes, vascular smooth muscle cells, renal mesangial cells,
and keratinocytes. Kramer, R. M., Hession, C., Johansen, B., Hayes,
G., McGray, P., Chow, E. P., Tizard, R. and Pepinsky, R. B., J.
Biol. Chem. 1989, 264, 5768; Gilman, S. C. and Chang, J., J.
Rheumatol. 1990, 17, 1392; Gilman, S. C., Chang, J., Zeigler, P.
R., Uhl, J. and Mochan, E., Arthritis and Rheumatol. 1988, 31, 126;
Nakano, T., Ohara, O., Teraoka, H. and Arita, H., FEBS Lett., 1990,
261, 171; Schalkwijk, C., Pfeilschifter, J., Marki, F. and van den
Bosch, H. Biochem. Biophys. Res. Comm. 1991, 174, 268.
[0019] A role of type II phospholipase A.sub.2 in promoting some of
the pathophysiology observed in chronic inflammatory disorders was
suggested because direct injection of type II phospholipase A.sub.2
produced profound inflammatory reactions when injected
intradermally or in the articular space in rabbits, Pruzanski, W.,
Vadas, P., Fomasier, V., J. Invest. Dermatol. 1986, 86, 380-383;
Bomalaski, J. S., Lawton, P., and Browning, J. L., J. Immunol.
1991, 146, 3904; Vadas, P., Pruanski, W., Kim, J. and Formasier,
V., Am. J. Pathol. 1989, 134, 807. Denaturation of the protein
prior to injection was found to block the proinflammatory
activity.
[0020] Because of these findings, there is interest in identifying
potent and selective inhibitors of type II phospholipase A.sub.2.
To date, efforts at identifying non toxic and selective inhibitors
of type II phospholipase A.sub.2 have met with little success.
Therefore, there is an unmet need to identify effective inhibitors
of phospholipase A.sub.2 activity.
Modulation of Telomere Length
[0021] It has been recognized that telomeres, long chains of
repeated nucleotides located at the tip of each chromosome, play a
role in the protection and organization of the chromosome. In human
cells, the sequence TTAGGG is repeated hundreds to thousands of
times at both ends of every chromosome, depending on cell type and
age. Harley, C. B. et al., Nature, 1990, 345, 458-460; Hastie, N.
D. et al., Nature, 1990, 346, 866-868. Telomeres also appear to
have a role in cell aging which has broad implications for the
study of aging and cell immortality that is manifested by cancerous
cells.
[0022] Researchers have determined that telomere length is reduced
whenever a cell divides and it has been suggested that telomere
length controls the number of divisions before a cell's innate
lifespan is spent. Harley, C. B. et al., Nature, 1990, 345,
458-460; Hastie, N. D. et al., Nature, 1990, 346, 866-868. For
example, normal human cells divide between 70-100 times and appear
to lose about 50 nucleotides of their telomeres with each division.
Some researchers have suggested that there is a strong correlation
between telomere length and the aging of the entire human being.
Greider, C. W., Curr. Opinion Cell Biol., 1991, 3, 444-451. Other
studies have shown that telomeres undergo a dramatic transformation
during the genesis and progression of cancer. Hastie, N. D. et al.,
Nature 1990, 346, 866-868. For example, it has been reported that
when a cell becomes malignant, the telomeres become shortened with
each cell division. Hastie, N. D. et al., Nature 1990, 346,
866-868. Experiments by Greider and Bacchetti and their colleagues
have shown that at a very advanced and aggressive stage of tumor
development, telomere shrinking may cease or even reverse. Counter,
C. M. et al., EMBO J. 1992, 11, 1921-1929. It has been suggested,
therefore, that telomere blockers may be useful for cancer therapy.
In vitro studies have also shown that telomere length can be
altered by electroporation of linearized vector containing human
chromosome fragments into hybrid human-hamster cell lines.
Chromosome fragments consisted of approximately 500 base pairs of
the human telomeric repeat sequence TTAGGG and related variants
such as TTGGGG, along with adjacent GC-rich repetitive sequences.
Farr, C. et al., Proc. Natl. Acad. Sci. USA 1992, 88, 7006-7010.
While this research suggests that telomere length affects cell
division, no effective method for control of the aging process or
cancer has been discovered. Therefore, there is an unmet need to
identify effective modulators of telomere length.
[0023] Guanosine nucleotides, both as mononucleotides and in
oligonucleotides or polynucleotides, are able to form arrays known
as guanine quartets or G-quartets. For review, see Williamson, J.
R., (1993) Curr. Opin. Struct. Biol. 3:357-362. G-quartets have
been known for years, although interest has increased in the past
several years because of their possible role in telomere structure
and function. One analytical approach to this area is the study of
structures formed by short oligonucleotides containing clusters of
guanosines, such as GGGGTTTTGGGG (SEQ ID NO:143), GGGTTTTGGG (SEQ
ID NO:144), UGGGGU, GGGGGTTTTT (SEQ ID NO:145), TTAGGG, TTGGGG and
others reviewed by Williamson; TTGGGGTT described by Shida et al.
(Shida, T., Yokoyama, K., Tamai, S., and J. Sekiguchi (1991) Chem.
Pharm. Bull. 39:2207-2211), and others.
[0024] It has now been discovered that in addition to their natural
role (in telomeres, for example, though there may be others),
oligonucleotides which form G-quartets and oligonucleotides
containing clusters of G's are useful for inhibiting viral gene
expression and viral growth and for inhibiting PLA.sub.2 enzyme
activity, and may also be useful as modulators of telomere length.
Chemical modification of the oligonucleotides for such use is
desirable and, in some cases, necessary for maximum activity.
[0025] Oligonucleotides containing only G and T have been designed
to form triple strands with purine-rich promotor elements to
inhibit transcription. These triplex-forming oligonucleotides
(TFOs), 28 to 54 nucleotides in length, have been used to inhibit
expression of the oncogene c-erb B2/neu (WO 93/09788, Hogan).
Amine-modified TFOs 31-38 nucleotides long have also been used to
inhibit transcription of HIV. McShan, W. M. et al. (1992) J. Biol.
Chem. 267:5712-5721.
OBJECTS OF THE INVENTION
[0026] It is an object of the invention to provide oligonucleotides
capable of inhibiting the activity of a virus.
[0027] It is another object of the invention to provide methods of
prophylaxis, diagnostics and therapeutics for viral-associated
diseases such as HIV, HSV, HCMV and influenza.
[0028] It is a further object of the invention to provide
oligonucleotides capable of inhibiting phospholipase A.sub.2.
[0029] Yet another object of the invention is to provide methods of
prophylaxis, diagnostics and therapeutics for the treatment of
inflammatory disorders, as well as neurological conditions
associated with elevated levels of phospholipase A.sub.2.
[0030] It is another object of the invention to provide
oligonucleotides for modulating telomere length on chromosomes.
[0031] It is another object of the invention to provide
oligonucleotide complexes capable of inhibiting HIV.
[0032] These and other objects will become apparent to persons of
ordinary skill in the art from a review of the instant
specification and appended claims.
SUMMARY OF THE INVENTION
[0033] It has been discovered that oligonucleotides containing the
sequence GGGG (G.sub.4), denominated herein as a conserved G.sub.4
core sequence, have antiviral activity against a number of viruses
including but not limited to HIV, HSV, HCMV, and influenza virus. A
sequence containing 4 guanines (G's) or 2 stretches of 3 G's has
been found to be effective for significant antiviral activity. It
has also been discovered that oligonucleotides containing a
conserved G.sub.4 core sequence or two stretches of 3 G's are
effective inhibitors of phospholipase A.sub.2 activity. It is also
believed that such oligonucleotides could be useful for modulation
of telomere length on chromosomes.
[0034] The formula for an active sequence is generally
(N.sub.XG.sub.4N.sub.Y).sub.Q or (G.sub.3-4N.sub.XG.sub.3-4).sub.Q
wherein X and Y are 1-8, and Q is 1-4. The sequence
(N.sub.XG.sub.3-4).sub.QN.sub.X wherein X is 1-8 and Q is 1-6 has
also been found to be useful in some embodiments of the
invention.
BRIEF DESCRIPTION OF THE DRAWINGS
[0035] FIG. 1 is a graph showing anti-HSV activity of G.sub.4
oligonucleotides as measured by virus yield assay. Cells were
treated with oligonucleotide at dose of 3 .mu.M or 10 .mu.M. Viral
titers are shown as a percentage of virus titer from untreated,
infected cells. All oligonucleotides tested contain a
phosphorothioate backbone except for those noted with a
P.dbd.O.
[0036] FIG. 2 is a graph showing dose-dependent anti-HSV activity
of G.sub.4 oligonucleotides 5651 (SEQ ID NO: 35), 5652 (SEQ ID NO:
37), 5653 (SEQ ID NO: 38), 5676 (SEQ ID NO: 39), and 4015 (SEQ ID
NO: 21). 3383 (SEQ ID NO: 122) is a negative control
oligonucleotide. ACV is Acyclovir (positive control).
[0037] FIG. 3 is a graph showing anti-influenza activity of G.sub.4
oligonucleotides as measured by virus yield assay. Oligonucleotides
were tested at a single dose of 10 mM. Virus titer is expressed as
a percentage of the titer obtained from untreated, infected
cells.
[0038] FIG. 4 is a graph showing the inhibition of phospholipase
A.sub.2 by various 2'-substituted oligonucleotides.
[0039] FIG. 5 is a graph showing the effect of ISIS 3196 (SEQ ID
NO: 47) on enzyme activity of phospholipase A.sub.2 isolated from
different sources.
[0040] FIG. 6 is a graph showing the results of an experiment
wherein human phospholipase A.sub.2 was incubated with increasing
amounts of E. coli substrate in the presence of oligonucleotides
ISIS 3196 (SEQ ID NO: 47) and ISIS 3481 (SEQ ID NO: 77).
[0041] FIG. 7 is a line graph showing the effect of time of
oligonucleotide addition on HSV-1 inhibition.
[0042] FIG. 8 is a line graph showing activity of ISIS 4015 and
2'-O-propyl gapped phosphorothioate oligonucleotides against
HSV-1.
[0043] FIG. 9 is a line graph showing activity of ISIS 3657 and
2'-O-propyl phosphorothioate oligonucleotides against HSV-1.
[0044] FIG. 10 is a three-dimensional bar graph showing effects on
HSV-1 of ISIS 4015 and TFT separately and in combination.
[0045] FIG. 11 is a three-dimensional bar graph showing effects on
HSV-1 of ISIS 4015 and ACV separately and in combination.
[0046] FIG. 12 is a line graph showing antiviral activity of
G-string oligonucleotides 5684, 5058, 5060, 6170 and 4015.
[0047] FIG. 13 is a line plot showing dissociation of ISIS 5320
tetramer monitored by size exclusion chromatography over a period
of 1 to 131 days.
[0048] FIG. 14 is an autoradiogram of a gel electrophoresis
experiment showing a pattern characteristic of a parallel-stranded
tetramer. Lane 1: ISIS 5320 (T.sub.2G.sub.4T.sub.2) alone. Lane 2:
ISIS 5320 incubated with T.sub.13G.sub.4G.sub.4 (SEQ ID NO:146).
Lane 3. T.sub.13G.sub.4T.sub.4 (SEQ ID NO:142) alone.
[0049] FIG. 15 is a line graph showing dissociation of tetramers
formed by phosphorothioate ISIS 5320 in Na+ (squares), ISIS 5320 in
K+ (diamonds) and the phosphodiester version (circles) over a
period of days.
[0050] FIG. 16 is a line graph showing binding of ISIS 5320 to
gp120, measured by absorbance at 405 nm.
[0051] FIG. 17 is a line graph showing that dextran sulfate is a
competitive inhibitor of binding of biotinylated ISIS 5320 to
gp120.
[0052] FIG. 18 is a line graph showing that ISIS 5320 blocks
binding of an antibody specific for the V3 loop of gp120 (solid
line) but not antibodies specific for CD44 (even dashes) or CD4
(uneven dashes), as determined by immunofluorescent flow
cytometry.
DETAILED DESCRIPTION OF PREFERRED EMBODIMENTS
[0053] It has been discovered that oligonucleotides containing the
sequence GGGG (G.sub.4,) where G is a guanine-containing nucleotide
or analog, and denominated herein as a conserved G.sub.4 sequence,
have potent antiviral activity and can be effective inhibitors of
phospholipase A.sub.2 activity and modulators of telomere length on
chromosomes. In the context of this invention, the term
"oligonucleotide" refers to an oligomer or polymer of ribonucleic
acid or deoxyribonucleic acid. This term includes oligomers
consisting of naturally occurring bases, sugars and intersugar
(backbone) linkages as well as oligomers having non-naturally
occurring portions which function similarly. Such chemically
modified or substituted oligonucleotides are often preferred over
native forms because of properties such as, for example, enhanced
cellular uptake and increased stability in the presence of
nucleases.
[0054] Specific examples of some preferred oligonucleotides
envisioned for this invention may contain modified intersugar
linkages (backbones) such as phosphorothioates, phosphotriesters,
methyl phosphonates, chain alkyl or cycloalkyl intersugar linkages
or short chain heteroatomic or heterocyclic intersugar linkages.
Most preferred are those with CH.sub.2--NH--O--CH.sub.2,
CH.sub.2--N(CH.sub.3)--O--CH.sub.2,
CH.sub.2--O--N(CH.sub.3)--CH.sub.2,
CH.sub.2--N(CH.sub.3)--N(CH.sub.3)--CH.sub.2 and
O--N(CH.sub.3)--CH.sub.2--CH.sub.2 backbones (where phosphodiester
is O--P--O--CH.sub.2). Also preferred are oligonucleotides having
morpholino backbone structures. Summerton, J. E. and Weller, D. D.,
U.S. Pat. No. 5,034,506. In other preferred embodiments, such as
the protein-nucleic acid (PNA) backbone, the phosphodiester
backbone of the oligonucleotide may be replaced with a polyamide
backbone, the bases being bound directly or indirectly to the aza
nitrogen atoms of the polyamide backbone. P. E. Nielsen, M. Egholm,
R. H. Berg, O. Buchardt, Science 1991, 254, 1497. Other preferred
oligonucleotides may contain modified sugar moieties comprising one
of the following at the 2' position: OH, SH, SCH.sub.3, F, OCN,
O(CH.sub.2).sub.nNH.sub.2 or O(CH.sub.2).sub.nCH.sub.3 where n is
from 1 to about 10; C.sub.1 to C.sub.10 lower alkyl, substituted
lower alkyl, alkaryl or aralkyl; Cl; Br; CN; CF.sub.3; OCF.sub.3;
O-, S-, or N-alkyl; O-, S-, or N-alkenyl; SOCH.sub.3;
SO.sub.2CH.sub.3; ONO.sub.2; NO.sub.2; N.sub.3; NH.sub.2;
heterocycloalkyl; heterocycloalkaryl; aminoalkylamino;
polyalkylamino; substituted silyl; an RNA cleaving group;
fluorescein; a reporter group; an intercalator; a group for
improving the pharmacokinetic properties of an oligonucleotide; or
a group for improving the pharmacodynamic properties of an
oligonucleotide and other substituents having similar properties. A
fluorescein moiety may be added to the 5' end of the
oligonucleotide. Oligonucleotides may also have sugar mimetics such
as cyclobutyls in place of the pentofuranosyl group. Alpha
(.alpha.) anomers instead of the standard beta (.beta.) nucleotides
may also be used. Modified bases such as 7-deaza-7-methyl guanosine
may be used. A "universal" base such as inosine may also be
substituted for A, C, G, T or U.
[0055] Chimeric oligonucleotides can also be employed; these
molecules contain two or more chemically distinct regions, each
comprising at least one nucleotide. These oligonucleotides
typically contain a region of modified nucleotides that confer one
or more beneficial properties (such as, for example, increased
nuclease resistance, increased uptake into cells, increased binding
affinity for the target molecule) and an unmodified region that
retains the ability to direct RNase H cleavage.
[0056] The oligonucleotides in accordance with this invention
preferably comprise from about 6 to about 27 nucleic acid base
units. It is preferred that such oligonucleotides have from about 6
to 24 nucleic acid base units. As will be appreciated, a nucleic
acid base unit is a base-sugar combination suitably bound to
adjacent nucleic acid base unit through phosphodiester or other
bonds.
[0057] The oligonucleotides used in accordance with this invention
may be conveniently and routinely made through the well-known
technique of solid phase synthesis. Equipment for such synthesis is
sold by several vendors including Applied Biosystems. Any other
means for such synthesis may also be employed, however the actual
synthesis of the oligonucleotides are well within the talents of
the routineer. It is also well known to use similar techniques to
prepare other oligonucleotides such as the phosphorothioates and
alkylated derivatives.
[0058] Compounds with more than four G's in a row are active, but
four in a row or two or more runs of three G's in a row have been
found to be required for significant inhibitory activity. In the
context of this invention, a significant level of inhibitory
activity means at least 50% inhibition of activity as measured in
an appropriate, standard assay. Such assays are well known to those
skilled in the art. Although the conserved G.sub.4 core sequence or
G.sub.4 pharmacophore is necessary, sequences flanking the G.sub.4
core sequence have been found to play an important role in
inhibitory activity because it has been found that activity can be
modulated by substituting or deleting the surrounding sequences. In
the context of this invention, the term "modulate" means increased
or decreased.
[0059] The essential feature of the invention is a conserved
G.sub.4 core sequence and a sufficient number of additional
flanking bases to significantly inhibit activity. It has also been
discovered that analogs are tolerated in the backbone. For example,
deoxy, phosphorothioate and 2'-O-Methyl analogs have been
evaluated.
[0060] The formula for an active sequence is:
(N.sub.xG.sub.4N.sub.y).sub.Q or (G.sub.4N.sub.xG.sub.4).sub.Q
where G=a guanine-containing nucleotide or analog, N=any
nucleotide, X=1-8, Y=1-8, and Q=1-4. In some embodiments of the
present invention, the sequence (N.sub.XG.sub.3-4).sub.QN.sub.X
wherein X is 1-8 and Q is 1-6 has been found to be active.
Antivirals
[0061] A series of oligonucleotides containing G.sub.4 or 2
stretches of G.sub.3 were tested for inhibition of HSV replication.
Antiviral activity was determined by ELISA. The results are shown
in Table 1. Activity is shown as E.C..sub.50, which is the
concentration of oligonucleotide which provides 50% inhibition of
HSV replication relative to control infected cells.
Oligonucleotides were generally tested at doses of 3 .mu.M and
lower. TABLE-US-00001 TABLE 1 Oligonucleotide inhibition of HSV
replication SEQ ISIS EC50 ID NO SEQUENCE LENGTH COMPOSITION (.mu.m)
NO 1220 CAC GAA AGG CAT 21 MER P = S 0.24, 1 GAC CGG GGC 0.16 4881
GAA AGG CAT GAC 18 MER P = S 0.7, 2 CGG GGC 0.65 4874 AGG CAT GAC
CGG 15 MER P = S 1.1, 3 GGC 0.83 4873 CAT GAC CGG GGC 12 MER P = S
1.4, 4 1.0 5305 CAC GAA AGG CAT 19 MER P = S >3.0 5 GAC CGG G
5301 CAC GAA AGG CAT 18 MER P = S >3.0 6 GAC CGG 5302 CAC GAA
AGG CAT 15 MER P = S >3.0 7 GAC 4274 CAT GGC GGG ACT 21 MER P =
S 0.15, 8 ACG GGG GCC 0.15 4882 CAT GGC GGG ACT 15 MER P = S 1.7, 9
ACG 1.4 4851 T GGC GGG ACT ACG 18 MER P = S 0.55, 10 GGG GC 0.5
4872 GGC GGG ACT ACG 15 MER P = S 1.9, 11 GGG 1.7 4338 ACC GCC AGG
GGA 21 MER P = S 0.2, 12 ATC CGT CAT 0.2 4883 GCC AGG GGA ATC 18
MER P = S 1.8, 13 CGT CAT 1.8 4889 AGG GGA ATC CGT 15 MER P = S
2.0, 14 CAT 2.0 4890 GCC AGG GGA ATC 15 MER P = S 0.75, 15 CGT 0.7
3657 CAT CGC CGA TGC 21 MER P = S 0.2 16 GGG GCG ATC 4891 CAT CGC
CGA TGC 18 MER P = S 0.3 17 GGG GCG 4894 CAT CGC CGA TCG 15 MER P =
S >3.0 18 GGG 4895 CGC CGA TGC GGG 15 MER P = S 0.55 19 GCG 4896
GC CGA TGC GGG G 12 MER P = S 1.2 20 4015 GTT GGA GAC CGG 21 MER P
= S 0.22, 21 GGT TGG GG 0.22 4549 GGA GAC CGG GGT 17 MER P = S
0.22, 22 TGG GG 0.27 5365 GA GAC CGG GGT TGG 16 MER P = S 0.47 23
GG 4885 A GAC CGG GGT TGG 15 MER P = S 0.42, 24 GG 0.51 5356 CGG
GGT TGG GG 11 MER P = S 0.7 25 4717 GG GGT TGG GG 10 MER P = S 0.6
26 5544 TGG GG 5 MER P = S >3.0 4803 GG GG 4 MER P = S >3.0
4771 GTT GGA GAC CGG 17 MER P = S 0.7 27 GGT TG 4398 CAC GGG GTC
GCC 20 MER P = S 0.1 28 GAT GAA CC 4772 GGG GTC GCC GAT 17 MER P =
S 0.4 29 GAA CC 4773 CAC GGG GTC GCC 17 MER P = S 0.2 30 GAT GA
4897 CAC GGG GTC GCC 15 MER P = S 0.13 31 GAT 4721 CAC GGG GTC G 10
MER P = S 0.4 32 5366 TTG GGG TTG GGG 25 MER P = S 0.16 33 TTG GGG
TTG GGGG 5367 TTG GGG TTG GGG 25 MER P = O >4.0 34 TTG GGG TTG
GGGG 5651 TT GGGG TT GGGG TT 24 MER P = S 0.17 35 GGGG TT GGGG 5677
GGGG TT GGGG TT 22 MER P = S 0.2 36 GGGG TT GGGG 5652 TT GGGG TT
GGGG TT 20 MER P = S 0.16 37 GGGG TT 5653 TT GGGG TT GGGG TT 18 MER
P = S 0.2 38 GGGG 5676 GGGG TT GGGG TT 16 MER P = S 0.23 39 GGGG
5675 TT GGGG TT GGGG TT 14 MER P = S 0.42 40 5674 TT GGGG TT GGGG
12 MER P = S 1.5 41 5320 TT GGGG TT 8 MER P = S >3.0 5739 TT
GGGG 6 MER P = S >3.0 5544 T GGGG 5 MER P = S >3.0 4803 GGGG
4 MER P = S >3.0 4560 GGGG C GGGG C GGGG 21 MER P = S 0.18 42 C
GGGG C G 5649 TT GGGG TT GGGG TT 24 MER P = O >3.0 43 GGGG TT
GGGG 5670 GGGG TT GGGG TT 22 MER P = O >3.0 44 GGGG TT GGGG 5650
TT GGGG TT GGGG TT 20 MER P = O >3.0 45 GGGG TT 5590 GGGG TT
GGGG 10 MER P = O >3.0 46 3196 GGG T GGG T ATA G 21 MER P = S
0.2 47 AAG G GCT CC 4664 GGG T GGG T ATA G 18 MER P = S 0.2 48 AAG
G GC 4671 GGG T GGG T ATA 15 MER P = S 0.4 49 GAA G 4672 GGG T GGG
T ATA G 12 MER P = S 0.2 50 4692 T GGG T ATA G AAG 18 MER P = S 1.5
51 GGC TCC 4693 G T ATA G AAG GGC 15 MER P = S >3.0 52 TCC 4694
TA G AAG GGC TCC 12 MER P = S >3.0 53 5753 UUG GGG UU 8 MER O-Me
>3.0 5756 TTA GGG TT 8 MER P = S >3.0 5755 CCC CGG GG 8 MER P
= S >3.0
[0062] Oligonucleotides containing G.sub.4 sequences were also
tested for antiviral activity against human cytomegalovirus (HCMV,
Table 2) and influenza virus (FIG. 3). Again, antiviral activity
was determined by ELISA and I.C..sub.50's shown are expressed as a
percent of virus titer from untreated controls. TABLE-US-00002
TABLE 2 Antiviral Activity of Oligonucleotides Tested Against HCMV
SEQ ISIS I.C..sub.50 ID NO SEQUENCE COMP. (.mu.m) NO 4015 GTT GGA
GAC CGG GGT TGG GG P = S 0.17 21 4717 GGG GTT GGG G P = S 1.0 26
5366 TTG GGG TTG GGG TTG GGG TTG P = S 0.1 33 GGG G 4560 GGG GCG
GGG CGG GGC GGG GCG P = S 0.15 42 5367 TTG GGG TTG GGG TTG GGG TTG
P = O >2.0 34 GGG G
[0063] In the experiments it was found that the G.sub.4 core was
necessary for antiviral activity. Nucleotides surrounding G.sub.4
contributed to antiviral activity since deletion of nucleotides
flanking the G.sub.4 core decreased antiviral activity.
Oligonucleotides containing phosphorothioate backbones were most
active against HSV in these experiments. Compounds containing a
phosphodiester backbone were found to be generally inactive in
these studies. Compounds with various multiples of G.sub.4 and
T.sub.2 demonstrated comparable activity against HSV. However,
T.sub.2G.sub.4T.sub.2G.sub.4 was less active and
T.sub.2G.sub.4T.sub.2 was inactive. It is believed that it is not
necessary that G.sub.4 be flanked by T.sub.2 since a compound
containing multiples of G.sub.4C had antiviral activity similar to
that observed for G.sub.4T.sub.2. Oligonucleotides containing
G.sub.4 also showed antiviral activity in a HSV virus yield assay,
as shown in FIG. 1.
T.sub.2G.sub.4T.sub.2G.sub.4T.sub.2G.sub.4T.sub.2G.sub.4 (ISIS
#5651, SEQ ID NO: 35) showed greater antiviral activity than did
Acyclovir at a dose of 3 mM. Several G.sub.4 oligonucleotides were
subsequently shown to reduce virus yield in a dose-dependent manner
(FIG. 2). Oligonucleotides containing G.sub.4 also showed
significant antiviral activity against HCMV (Table 2) and influenza
virus (FIG. 3). Control compounds without G.sub.4 sequences did not
show antiviral activity.
[0064] A series of compounds comprising G.sub.4 were tested for HIV
activity. The results are shown in Table 3. TABLE-US-00003 TABLE 3
Oligonucleotide inhibition of HIV TI SEQ ISIS IC50 TC50 (TC50/ ID
NO SEQUENCE COMPOSITION (.mu.M) (.mu.M) IC50) NO 5274 GCC CCC TA P
= O INACTIVE 5273 GCT TTT TA P = O INACTIVE 5272 GCG GGG TA P = O
INACTIVE 5271 GCA AAA TA P = O INACTIVE 5312 GCG GGG TA P = S 1.3
5311 GCA AAA TA P = S INACTIVE >200 5307 GCT TTT TA P = S
INACTIVE 5306 GCC CCC TA P = S INACTIVE 5319 TCG GGG TT P = S 1
5059 GGG GGG TA P = S 0.53 5325 CGG GGG TA P = S 1.1 5321 CCG GGG
CC P = S 1.7 5753 UUG GGG UU O-ME, INACTIVE >>50 P = O 5058
GC GGGG TA P = S, 1.5 >25 5756 TTA GGG TT P = S 29 >50 5755
CCC CGG GG P = S 34 >>50 5543 TTT GGG TT P = S INACTIVE 5542
TTT GG TTT P = S INACTIVE 5544 TGGGG P = S 5 4560 GGG GCG GGG CGG
GGC P = S 0.14 42 GGG GCG 4721 CAC GGG GTC G P = S 0.21, 142 546 32
0.26 4338 ACC GCC AGG GGA ATC P = S 0.42 12 CGT CAT 4897 CAC GGG
GTC GCC GAT P = S 0.43 31 3657 CAT CGC CGA TGC GGG P = S 0.43 16
GCG ATC 4873 CAT GAC CGG GGC P = S 1 4 5366 TTG GGG TTG GGG TTG P =
S 0.08, 22 220 33 GGG TTG GGGG 0.1 5651 TT GGGG TT GGGG TT P = S
0.1, 19, 175 35 GGGG TT GGGG .18 19 5677 GGGG TT GGGG TT P = S 0.1,
15, 146 36 GGGG TT GGGG 0.19 14 5652 TT GGGG TT GGGG TT P = S 0.1,
22, 227 37 GGGG TT 0.18 19 5653 TT GGGG TT GGGG TT P = S 0.12, 27
38 GGGG 5676 GGGG TT GGGG TT P = S 0.18, 21, 114 39 GGGG 0.28 23
5675 TT GGGG TT GGGG TT P = S 0.38 14 36 40 5674 TT GGGG TT GGGG P
= S 0.43 >200 41 4717 GGGG TT GGGG P = S 0.41 >25, 26 39 5320
TT GGGG TT P = S 0.47 195, 415 52 5739 TT GGGG P = S 3.8 -200 4803
GGGG P = S 4 >25, 13 5367 TTG GGG TTG GGG TTG P = O 0.09, 52 400
34 GGG TTG GGGG 0.13 5649 TT GGGG TT GGGG TT P = O <0.08, 24,
300 43 GGGG TT GGGG 0.3 31 5670 GGGG TT GGGG TT P = O 0.17, 15 44
GGGG TT GGGG 5650 TT GGGG TT GGGG TT P = O 0.64 7.6 12 45 GGGG TT
5666 TT GGGG TT GGGG TT P = O 0.17, 16.7, 100 54 GGGG 0.6 5 5669
GGGG TT GGGG TT P = O 1.2 9.6 9 55 GGGG 5667 TT GGGG TT GGGG TT P =
O >22 5.6 56 5668 TT GGGG TT GGGG P = O >21 5.2 57 5590 GGGG
TT GGGG P = O >25 20 46 5671 TT GGGG TT P = O 16 18, 1 15 5672
TT GGGG P = O >16 18 5673 GGGG P = O >1 43
A number of compounds with significant HIV antiviral activity
(I.C..sub.50 2 .mu.M or less) were identified. Compound 5058 is a
prototypical phosphorothioate 8-mer oligonucleotide containing a
G.sub.4 core. When the G.sub.4 core was lengthened to G.sub.5 or
G.sub.6, activity was retained. When the G.sub.4 core was
substituted with A.sub.4, C.sub.4 or T.sub.4, activity was lost. A
change in the backbone from phosphorothioate to phosphodiester also
produced inactive compounds. The oligonucleotides containing a
single G.sub.4 run were also found to be inactive as
phosphodiesters. However, it was found that oligonucleotides with
multiple G.sub.4 repeats are active as phosphodiester analogs.
Substitution of the nucleotides flanking the G.sub.4 core resulted
in retention of HIV antiviral activity. The compound TTGGGGTT (ISIS
5320) was the most active of the series. Compounds with 3 G's in a
row or 2 G's in a row were found to be inactive. Compounds with
various multiples of G.sub.4 and T.sub.2 were generally more active
than the parent TTGGGGTT. However, T.sub.2G.sub.4 and G.sub.4 were
less active. It was found that it was not absolutely necessary that
G.sub.4 be flanked on both sides because G.sub.4T.sub.2G.sub.4 is
very active. Phospholipase A.sub.2 Enzyme Activity
[0065] Specific oligonucleotide compositions having a G.sub.4
conserved sequence have also been identified which selectively
inhibit human type II phospholipase A.sub.2 and type II
phospholipase A.sub.2 from selected snake venoms. These agents may
prove useful in the treatment of inflammatory diseases,
hyper-proliferative disorders, malignancies, central nervous system
disorders such as schizophrenia, cardiovascular diseases, as well
as the sequelae resulting from the bite of poisonous snakes, most
notably rattlesnakes.
[0066] Incubation of type II phospholipase A.sub.2 with increasing
amounts of phosphorothioate deoxyoligonucleotides resulted in a
sequence-specific inhibition of phospholipase A.sub.2 enzyme
activity. Of the oligonucleotides tested, ISIS 3196, SEQ ID NO: 47,
was found to exhibit the greatest activity, I.C..sub.50 value=0.4
.mu.M. ISIS 3631, SEQ ID NO: 81, and 3628, SEQ ID NO: 78, exhibited
I.C..sub.50 values approximately 10-fold higher and ISIS 1573, SEQ
ID NO: 120, did not significantly inhibit the phospholipase A.sub.2
at concentrations as high as 10 .mu.M.
[0067] To further define the sequence specificity of
oligonucleotides which directly inhibit human type II phospholipase
A.sub.2 activity, a series of phosphorothioate oligonucleotides
were tested for direct inhibition of enzyme activity. A compilation
of the results from 43 different sequences is shown in Table 4.
TABLE-US-00004 TABLE 4 Sequence Specific Inhibition of Human Type
II Phospholipase A.sub.2 With Phosphorothioate
Deoxyoligonucleotides SEQ ID ISIS # Sequence % Inhibition (1 .mu.M)
NO 3181 TCTGCCCCGGCCGTCGCTCCC 42.7 58 3182 CAGAGGACTCCAGAGTTGTAT
30.2 59 3184 TTCATGGTAAGAGTTCTTGGG 25.1 60 3185
CAAAGATCATGATCACTGCCA 22.7 61 3191 TCCCATGQCCCTGCAGTAGGC 41.5 62
3192 GGAAGGTTTCGAGQGAAGAGG 28.1 63 3193 CCTGCAGTAGGCCTGGAAGGA 22.6
64 3196 GGGTGGGTATAGAAGGGCTCC 98.5 47 3468 GGGACTCAGCAACGAGGGGTG
97.5 65 3470 GTAGGGAGGGAGGGTATGAGA 88.9 66 3471
AAGGAACTTGGTTAGGGTAGG 34.5 67 3472 TGGGTGAGGGATGCTTTCTGC 69.0 68
3473 CTGCCTGGCCTCTAGGATGGG 25.9 69 3474 ATAGAAGGGCTCCTGCCTGGC 13.3
70 3475 TCTCATTCTGGGTGGGTATAG 67.0 71 3476 GCTGGAAATCTGCTGGATGTC
43.4 72 3477 GTGGAGGAGAGCAGTAGAAGG 54.7 73 3478
TGGTTAAGCACGGAGTTGAGG 26.4 74 3479 CCGGAGTACAGGTTCTTTGGT 42.3 75
3480 TTGCTTTATTCAGAAGAGACC 24.5 76 3481 TTTTTGATTTGCTAATTGCTT 2.2
77 3628 GGAGCCCTfCTATACCCACCC 13.6 78 3629 CACCCCTCGTTGCTGAGTCCC
20.5 79 3630 TCTCATACCCTCCCTCCCTAC 17.6 80 3631
AGGTCGAGGAGTGGTCTGAGC 20.7 81 3632 CCAGGAGAGGTCGGTAAGGCG 29.2 82
3633 GTAGGGATGGGAGTGAAGGAG 58.5 83 3659 TGCTCCTCCTTGGTGGCTCTC 38.2
84 3663 GTCTGCTGGGTGGTCTGAACT 16.3 85 3665 GGACTGGCCTAGCTCCTCTGC
45.8 86 3669 GGTGACAAATGCAGATGGACT 34.7 87 3671
TAGGAGGGTCTTCATGGTAAG 49.3 88 3676 AGCTCTTACCAAAGATCATGA 24.5 89
3679 AGTAGGCCTGGAAGGAAATTT 30.3 90 3688 TGGCCTCACCGATCCGTTGCA 43.1
91 3694 ACAGCAGCTGTGAGGAGACAC 28.2 92 3697 ACTCTTACCACAGGTGATTCT 39
93 3712 AGGAGTCCTGTTTTGAAATCA 31.8 94 4015 GTTGGAGACCGGGGTTGGGG
79.4 21 4133 AGTGCACGTTGAGTATGTGAG 37.3 95 4149
CTACGGCAGAGACGAGATAGC 20.2 96 4338 ACCGCCAGGGGAATCCGTCAT 100 12
4560 GGGGCGGGGCGGGGCGGGG 100 42
[0068] Most of the oligonucleotides significantly inhibited
phospholipase A.sub.2 enzyme activity at a concentration of 1
.mu.M. Furthermore, a population of oligonucleotides were found to
completely inhibit phospholipase A.sub.2 activity at 1 .mu.M
concentration. A common feature of those oligonucleotides which
inhibit greater than 50% phospholipase A.sub.2 enzyme activity is
the occurrence of 2 or more runs of guanine residues, with each run
containing at least 3 bases. More guanine residues in the run, or
more runs, resulted in more potent oligonucleotides. As an example,
ISIS 3196, SEQ ID NO: 47, and ISIS 3470, SEQ ID NO: 66, both have
three sets of guanine runs, with each run three bases in length.
Both oligonucleotides completely inhibited human type II
phospholipase A.sub.2 enzyme activity at a concentration of 1
.mu.M. Two oligonucleotides were found to be an exception to this
finding. ISIS 3477, SEQ ID NO: 73, contained 3 sets of guanine
runs, but they were only 2 bases in length. This oligonucleotide
inhibited enzyme activity by 54.7% at 1 .mu.M. A second
oligonucleotide, ISIS 4338, SEQ ID NO: 12, contained only 1 run of
guanine residues, 4 bases in length. In this experiment, ISIS 4338,
SEQ ID NO: 12, completely inhibited human type II phospholipase
A.sub.2 at a concentration of 1 .mu.M.
[0069] To further define the minimum pharmacophore responsible for
inhibition of human type II phospholipase A.sub.2, truncated
versions of ISIS 3196, SEQ ID NO: 47 and 4015, SEQ ID NO: 21, were
tested for activity. In addition, the effects of base substitutions
on the activity of a truncated version of ISIS 3196, SEQ ID NO: 47,
were investigated. The results are shown in Table 5. As the effects
of base substitution and truncation were performed in two separate
experiments, the data from both experiments are shown.
TABLE-US-00005 TABLE 5 Identification of the Minimum Pharmacophore
for PLA.sub.2 Inhibition SEQ ISIS % Inhibition ID # Sequence (1
.mu.M) NO 3196 GGG TGG GTA TAG AAG GGC TCC 76.2 47 GGG TGG GTA TAG
AAG GGC 85.3 97 GGG TGG GTA TAG AAG 82.5 98 4672 GGG TGG GTA TAG
73.9 50 TGG GTA TAG AAG GGC TCC 84.6 99 GTA TAG AAG GGC TCC 9.2 100
TAG AAG GGC TCC 0 101 TGG GTA TAG AAG GGC 33.5 102 3196 GGG TGG GTA
TAG AAG GGC TCC 100 47 4672 GGG TGG GTA TAG 94.6 50 4947 AGG TGG
GTA TAG 22.7 103 4955 GGG AGG GTA TAG 97.5 104 4956 GGG CGG GTA TAG
92.0 105 4957 GGG TGG ATA TAG 81.9 106 4946 GGG TGG GAA TAG 73.2
107 4962 GGG TGG GTA T 36.3 108 4015 GTT GGA GAC CGG GGT TGG GG
98.5 21 4771 GTT GGA GAC CGG GGT TGG 17.1 27 4549 GGA GAC CGG GGT
TGG GG 96.2 22 4717 GG GGT TGG GG 83.1 26 5544 TGG GG 50 4803 GG
GG
[0070] These results demonstrate that the minimum pharmacophore is
4 G's or two runs of 3 guanines. For ISIS 4015, SEQ ID NO: 21, a
10-base phosphorothioate oligonucleotide containing the sequence
GGGGTTGGGG retains full inhibitory activity. A 5-base
phosphorothioate oligonucleotide with the sequence TGGGG (ISIS
5544) inhibited enzyme activity by 50% at 1 .mu.M; complete
inhibition of enzyme activity was observed at a concentration of 3
.mu.M by ISIS 5544.
[0071] A 12-base phosphorothioate oligonucleotide with the sequence
GGGTGGGTATAG (ISIS 4672, SEQ ID NO: 50) was shown in one experiment
to exhibit almost the same inhibition as the 21 base
oligonucleotide, ISIS 3196, SEQ ID NO: 47 (Table 5). Removal of the
last two 3'-bases from the 12-mer results in a loss of activity
(ISIS 4962, SEQ ID NO: 108). Base substitutions experiments
demonstrate that the base separating the two guanine runs does not
markedly affect the activity. Substitution of the 5'-guanine with
an adenine results in loss of activity. These data suggest that the
5'-guanine plays an important role in maintaining the activity of
the oligonucleotide. Further supporting an important role of the
5'-guanine in this sequence was the finding that addition of a
fluorescein phosphoramidite or a 5'-phosphate resulted in loss of
activity.
[0072] All of the oligonucleotides used in the assays described
above were deoxyoligonucleotides. To determine if the effects were
specific to DNA oligonucleotides, 2'-substituted analogs were
tested for activity. The results are shown in FIG. 4. In each case
the internucleosidic linkage was phosphorothioate. No difference in
potency was observed if the 2'-positions were substituted with
fluorine. Substitution of the 2'-position with methyl and propyl
enhanced the inhibitory activity towards human type II
phospholipase A.sub.2. Replacement of the phosphorothioate backbone
with phosphodiester backbone resulted in loss of inhibitory
activity. This loss of inhibitory activity by phosphodiester
oligonucleotides was not due to degradation of the
oligonucleotides, as the oligonucleotides were found to be stable
for at least 4 hours in the incubation buffer. The phospholipase
A.sub.2 enzyme assays were 15 minutes in duration.
[0073] In summary, these results demonstrate that phosphorothioate
oligonucleotides containing two or more runs of guanines, with each
run at least three bases in length are potent inhibitors of human
type II phospholipase A.sub.2 enzyme activity. Substitution of the
2'-position with either methyl or propyl groups enhanced inhibitory
activity. The phosphorothioate internucleosidic linkage was found
to be obligatory for biological activity.
Modulation of Telomere Length
[0074] Oligonucleotides capable of modulating telomere length are
also contemplated by this invention. In human cells, the sequence
TTAGGG is repeated from hundreds to thousands of times at both ends
of every chromosome, depending on cell type and age. It is believed
that oligonucleotides having a sequence
(N.sub.XG.sub.3-4).sub.QN.sub.X wherein X is 1-8 and Q is 1-6 would
be useful for modulating telomere length.
[0075] Since telomeres appear to have a role in cell aging, i.e.,
telomere length decreases with each cell division, it is believed
that such oligonucleotides would be useful for modulating the
cell's aging process. Altered telomeres are also found in cancerous
cells; it is therefore also believed that such oligonucleotides
would be useful for controlling malignant cell growth. Therefore,
modulation of telomere length using oligonucleotides of the present
invention could prove useful for the treatment of cancer or in
controlling the aging process.
[0076] The following examples are provided for illustrative
purposes only and are not intended to limit the invention.
EXAMPLES
Example 1
Oligonucleotide Synthesis
[0077] DNA synthesizer reagents, controlled-pore glass (CPG)-bound
and B-cyanoethyldiisopropylphosphoramidites were purchased from
Applied Biosystems (Foster City, Calif.). 2'-O-Methyl
B-cyanoethyldiisopropylphosphoramidites were purchased from
Chemgenes (Needham, Mass.). Phenoxyacetyl-protected
phosphoramadites for RNA synthesis were purchased from BioGenex
(Hayward, Calif.).
[0078] Oligonucleotides were synthesized on an automated DNA
synthesizer (Applied Biosystems model 380B). 2'-O-Methyl
oligonucleotides were synthesized using the standard cycle for
unmodified oligonucleotides, except the wait step after pulse
delivery of tetrazole and base was increased to 360 seconds. The 3'
base bound to the CPG used to start the synthesis was a
2'-deoxyribonucleotide. After cleavage from the CPG column and
deblocking in concentrated ammonium hydroxide at 55.degree. C. (18
hours), the oligonucleotides were purified by precipitation two
times out of 0.5 M NaCl solution with 2.5 volumes ethanol.
Analytical gel electrophoresis was accomplished in 20% acrylamide,
8 M urea, 45 mM Tris-borate buffer, pH=7.0. Oligonucleotides were
judged from polyacrylamide gel electrophoresis to be greater than
85% full length material.
Example 2
HIV Inhibition Acute HIV Infection Assay
[0079] The human T-lymphoblastoid CEM cell line was maintained in
exponential growth phase in RPMI 1640 with 10% fetal calf serum,
glutamine, and antibiotics. On the day of the assay, the cells were
washed and counted by trypan blue exclusion. These cells (CEM-IIIB)
were seeded in each well of a 96-well microtiter plate at
5.times.10.sup.3 cells per well. Following the addition of cells to
each well, the oligonucleotides were added at the indicated
concentrations and serial half log dilutions. Infectious
HIV-1.sub.IIIB was immediately added to each well at a multiplicity
of infection determined to give complete cell killing at 6 days
post-infection. Following 6 days of incubation at 37.degree. C., an
aliquot of supernatant was removed from each well prior to the
addition of the tetrazolium dye XTT to each well. The XTT was
metabolized to a formazan product by viable cells and the results
calculated spectrophotometrically with a Molecular Devices Vmax
Plate Reader. The XTT assay measures protection from the
HIV-induced cell killing as a result of the addition of test
compounds. The supernatant aliquot was utilized to confirm the
activities determined in the XTT assay. Reverse transcriptase
assays and p24 ELISA were performed to measure the amount of HIV
released from the infected cells. Protection from killing results
in an increased optical density in the XTT assay and reduced levels
of viral reverse transcriptase and p24 core protein.
Example 3
HSV-1 Inhibition HSV-1 Infection ELISA Assay
[0080] Confluent monolayers of human dermal fibroblasts were
infected with HSV-1 (KOS) at a multiplicity of 0.05 pfu/cell. After
a 90 minute adsorption at 37.degree. C., virus was removed and
culture medium containing oligonucleotide at the indicated
concentrations was added. Two days after infection medium was
removed and cells fixed by addition of 95% ethanol. HSV antigen
expression was quantitated using an enzyme linked immunoassay.
Primary reactive antibody in the assay was a monoclonal antibody
specific for HSV-1 glycoprotein B. Detection was achieved using
biotinylated goat anti-mouse IgG as secondary antibody followed by
reaction with streptavidin conjugated B-galactosidase. Color was
developed by addition of chlorophenol red B-D-galactopyranoside and
absorbance at 570 nanometers was measured. Results are expressed as
percent of untreated control.
Virus Yield Assay.
[0081] Confluent monolayers of human dermal fibroblasts were
infected with HSV-1 (KOS) at a multiplicity of 0.5 pfu/cell. After
a 90 minute adsorption at 37.degree. C., virus was removed and 1 ml
of culture medium containing oligonucleotide at the indicated
concentrations was added. Control wells received 1 ml of medium
which contained no oligonucleotide. 2 days after infection, culture
medium and cells were harvested and duplicate wells of each
experimental point were combined. The suspension was frozen and
thawed 3 times, then drawn through a 22 gauge needle five times.
Virus titer was determined by plaque assay on Vero cell monolayers.
Dilutions of each virus preparation were prepared and duplicates
were adsorbed onto confluent Vero monolayers for 90 minutes. After
adsorption, virus was removed, cells were rinsed once with
phosphate-buffered saline, and overlaid with 2 ml of medium
containing 5.0% FBS and methyl cellulose. Cells were incubated at
37.degree. C. for 72 hours before plaques were fixed with
formaldehyde and stained with crystal violet. The number of plaques
from treated wells was compared to the number of plaques from
control wells. Results are expressed as percent of virus titer from
untreated control cells and shown in FIG. 2.
Example 4
Cytomegalovirus Inhibition ELISA Assay
[0082] Confluent monolayer cultures of human dermal fibroblasts
were treated with oligonucleotides at the indicated concentrations
in serum-free fibroblast growth medium. After overnight incubation
at 37.degree. C., culture medium containing oligonucleotides was
removed, cells were rinsed and human cytomegalovirus was added at a
multiplicity of infection of 0.1 pfu/cell. After a 2 hour
adsorption at 37.degree. C., virus was removed and fresh fibroblast
growth medium containing oligonucleotide at the indicated
concentrations was added. Two days after infection, old culture
medium was removed and replaced with fresh fibroblast growth medium
containing oligonucleotides at the indicated concentrations. Six
days after infection media was removed, and cells fixed by addition
of 95% ethanol. HCMV antigen expression was quantitated using an
enzyme linked immunoassay. Primary reactive antibody in the assay
was a monoclonal antibody specific for a late HCMV viral protein.
Detection was achieved using biotinylated goat anti-mouse IgG as
secondary antibody followed by reaction with streptavidin
conjugated B-galactosidase. Color was developed by addition of
chlorophenol red B-D-galactopyranoside and absorbance at 575
nanometers measured using an ELISA plate reader. Results are
expressed as percent of untreated control.
Example 5
Influenza Virus Inhibition Virus Yield Assay
[0083] Confluent monolayer cultures of Madin-Darby canine kidney
(MDCK) cells were treated with oligonucleotide at a concentration
of 10 mM in serum-free Dulbecco's modified Eagle's medium (DMEM)
containing 0.2% BSA. After incubation at 37.degree. C. for 2 hours,
human influenza virus (A/PR strain) was added to the cells at a
multiplicity of infection of 0.00125 pfu/cell. Virus was adsorbed
for 30 minutes at 37.degree. C. Cells were washed and refed with
fresh medium containing oligonucleotide at a concentration of 10
.mu.M, plus 0.2% BSA, and 3 mg/ml trypsin. One day after infection,
medium was harvested. Viral supernatants were titered on MDCK
cells. MDCK cells grown in 6-well dishes were infected with
dilutions of each virus preparation. After adsorption for 30
minutes at 37.degree. C., virus was removed from the monolayers and
cells were overlaid with 2.5 ml of fresh medium containing 0.2%
BSA, 3 .mu.g/ml trypsin, and 0.44% agarose. Twenty-four hours after
infection, cells were fixed in 3.5% formaldehyde and plaques
visualized by staining monolayers with crystal violet. Results are
expressed as a percentage of the titer of virus stock from
untreated MDCK cells.
Example 6
Identification of Oligonucleotide Inhibition of Human Type II
Phospholipase A.sub.2
[0084] The human epidermal carcinoma cell line A431 was purchased
from American Type Culture Collection. Cells were grown in
Dulbecco's Modified Eagle's Medium containing 4.5 gm glucose per
liter and 10% fetal calf serum. Type II phospholipase A.sub.2 was
prepared from A431 cells by cultivating confluent monolayers with
Opti-MEM (Gibco). The medium was concentrated 5 to 10 fold on an
Amicon ultrafiltration device using YM-5 membranes. The
concentrated spent medium was used as a source of human type II
phospholipase A.sub.2. Previous studies have demonstrated that A431
cells only secrete type II phospholipase A.sub.2.
[0085] Phospholipase A.sub.2 assays were performed utilizing
.sup.3H-oleic acid labelled E. coli as the substrate. .sup.3H-Oleic
acid labelled E. coli were prepared as described by Davidson et al.
J. Biol. Chem. 1987, 262, 1698). The reactions contained 100,000
cpm of .sup.3H-oleic acid labelled E. coli, 50 mM Tris-HCl, pH=7.4,
50 mM NaCl, 1 mM CaCl.sub.2, and 50 .mu.g bovine serum albumin in a
final reaction volume of 200 .mu.L. Reactions were initiated by the
addition of the E. coli substrate. Reactions were terminated by the
addition of 100 .mu.L 2 N HCl and 100 .mu.L 100 mg/ml fatty acid
free bovine serum albumin. Samples were vortexed and centrifuged at
17,000.times.g for 5 minutes. The amount of .sup.3H-oleic acid in
the supernatant was determined by counting a 300 .mu.L aliquot in a
liquid scintillation counter. Oligonucleotides were added to the
incubation mixture prior to the addition of the substrate.
Example 7
Structural Requirement for Inhibition of Human Type II
Phospholipase A.sub.2 by Phosphorothioate Oligonucleotides
[0086] The oligonucleotides which inhibit human type II
phospholipase A.sub.2 share a common feature with telomeric DNA
sequences in that both are composed of guanine rich sequences.
Telomeric sequences such as that from Oxytricha
(XXXG.sub.4T.sub.4G.sub.4T.sub.4G.sub.4T.sub.4G.sub.4T.sub.4G.sub.4,
SEQ ID NO: 121) form an unusual structure termed a G quartet. The
formation of this structure is monovalent cation dependent and is
disrupted by high temperature. To determine if oligonucleotide
structure was part of the active pharmacophore, ISIS 3196, SEQ ID
NO: 47, was placed in boiling water for 15 minutes prior to
addition to the assay. Boiling reduced the inhibitory activity of
ISIS 3196, SEQ ID NO: 47, from 94% inhibition to 21% inhibition.
Examination of the oligonucleotide by denaturing gel
electrophoresis demonstrated that boiling did not cause the
oligonucleotide to fragment. Separation of native and denatured
ISIS 3196, SEQ ID NO: 47, by gel filtration chromatography on a
Superdex G-75 column demonstrated that in its native conformation,
this oligonucleotide exists as several molecular species. Boiling
ISIS 3196, SEQ ID NO: 47, prior to chromatography resulted in loss
of high molecular weight species and appearance of the
oligonucleotide in the lower molecular weight species. From these
studies we can conclude that structure appears to be part of the
pharmacophore for ISIS 3196, SEQ ID NO: 47.
Example 8
Specificity of Phosphorothioate Oligonucleotide for Select Type II
Phospholipase A.sub.2
[0087] Bovine pancreatic phospholipase A.sub.2, Apis mellifera
phospholipase A.sub.2, Naja naja naja phospholipase A.sub.2, and
Crotalus durissus terrificus phospholipase A.sub.2 were obtained
from Sigma Chemical Co. (St. Louis, Mo.). Phospholipase A.sub.2
isolated from the venom of Trimeresurus flavoridis was obtained
from Calbiochem (La Jolla, Calif.), and phospholipase A.sub.2 from
Agkistrodon piscivorus piscivorus was partially purified from whole
venom (Sigma Chemical Co.) by chromatography on a Mono S column
(Pharmacia, Upsalla, Sweden).
[0088] To determine the specificity of ISIS 3196, SEQ ID NO: 47,
towards human type II phospholipase A.sub.2, phospholipase A.sub.2
from different sources were tested for inhibitory activity (FIG.
5). Human type II phospholipase A.sub.2 was the most sensitive of
all the enzymes tested to the inhibitory effects of ISIS 3196, SEQ
ID NO: 47, I.C..sub.50.apprxeq.0.15 .mu.M (FIG. 5). Phospholipase
A.sub.2 isolated from Crotalus durissus venom (rattlesnake), also a
type II enzyme, was the next most sensitive to the effects of ISIS
3196, SEQ ID NO: 47, I.C..sub.50.apprxeq.0.3 .mu.M, followed by
phospholipase A.sub.2 isolated from the venom of Agkistrodon
piscivorus piscivorus (cottonmouth), also a type II enzyme,
I.C..sub.50.apprxeq.3 .mu.M. Bovine pancreatic phospholipase
A.sub.2, a type I enzyme, was the most resistant of all the enzymes
tested to the effects of ISIS 3196, SEQ ID NO: 47,
I.C..sub.50.apprxeq.100 .mu.M (FIG. 5). Phospholipase A.sub.2
isolated from Naja naja naja venom (cobra venom), a type 1 enzyme
and from Trimeresurus flavoridis (Asian pit viper, habu) were both
relatively resistant to the inhibitory effect of ISIS 3196, SEQ ID
No; 47, with I.C..sub.50 values greater than 10 .mu.M.
Phospholipase A.sub.2 isolated from Apis mellifera (honeybee),
neither a type I or type II enzyme, was also quite resistant to the
inhibitory activity of ISIS 3196, SEQ ID NO: 47, with an
I.C..sub.50 value greater than 100 .mu.M.
[0089] These results demonstrate that ISIS 3196, SEQ ID NO: 47,
selectively inhibits human type II phospholipase A.sub.2. Other
type II phospholipase A.sub.2, such as those isolated from Crotalus
and Agkistrodon venoms, were also sensitive to the effects of ISIS
3196, SEQ ID NO: 47. While, in general, type I enzymes were more
resistant to the effects of ISIS 3196, SEQ ID NO: 47. Although bee
venom (Apis mellifera) phospholipase A.sub.2 does not bear a strong
sequence homology to either type I or type II enzymes, it is more
closely related to type I enzymes. Like other type I enzymes, it is
relatively resistant to the inhibitor effects of ISIS 3196, SEQ ID
NO: 47.
Example 9
Mechanism of Inhibition of Human Type II Phospholipase A.sub.2 by
Phosphorothioate Oligonucleotides
[0090] As a first step in elucidation of the mechanism by which
phosphorothioate oligonucleotides inhibit phospholipase A.sub.2,
the effects of the oligonucleotides on the substrate kinetics of
the enzymes were determined. Human type II phospholipase A.sub.2
was incubated with increasing amounts of E. coli substrate in the
presence of oligonucleotides ISIS 3196, SEQ ID NO: 47, and ISIS
3481, SEQ ID NO: 77 (FIG. 6). The concentration of E. coli
phospholipid was determined by lipid phosphorus analysis as
described by Bartlett, J. Biol. Chem. 1959, 234:466. The results
demonstrate that ISIS 3481, SEQ ID NO: 77, at 0.2 .mu.M and 2 .mu.M
did not modify the substrate kinetics of human type II
phospholipase A.sub.2. In contrast, ISIS 3196, SEQ ID NO: 47,
behaved as an apparent noncompetitive inhibitor in that the
apparent Km and Vmax were both changed in the presence of the
oligonucleotide. It is unlikely that ISIS 3196, SEQ ID NO: 47,
inhibits human type H phospholipase A.sub.2 by chelating calcium
which is required for activity, in that the free calcium in the
assay was in 500 to 5000-fold excess to the oligonucleotide.
Example 10
Modulation of Telomere Length by G.sub.4 Phosphorothioate
Oligonucleotides
[0091] The amount and length of telomeric DNA in human fibroblasts
has been shown to decrease during aging as a function of serial
passage in vitro. To examine the effect of G.sub.4 phosphorothioate
oligonucleotides on this process, human skin biopsy fibroblasts are
grown as described in Harley, C. B., Meth. Molec. Biol. 1990, 5,
25-32. Cells are treated with the oligonucleotides shown in Table
6, by adding the oligonucleotide to the medium to give a final
concentration of 1 .mu.M, 3 .mu.M or 10 .mu.M; control cells
receive no oligonucleotide. Population doublings are counted and
DNA is isolated at regular intervals. Telomere length is determined
by Southern blot analysis and plotted against number of population
doublings as described in Harley, C. B. et al., Nature 1990, 345,
458-460. The slope of the resulting linear regression lines
indicates a loss of approximately 50 bp of telomere DNA per mean
population doubling in untreated fibroblasts. Harley, C. B. et al.,
Nature 1990, 345, 458-460. Treatment with oligonucleotides of Table
6 is expected to result in modulation of telomere length.
TABLE-US-00006 TABLE 6 Effect of G.sub.4 Phosphorothioate
Oligonucleotides on Telomere Length in Aging Fibroblasts ISIS NO.
SEQUENCE SEQ ID NO: TT AGGG 5739 TT GGGG 5756 TT AGGG TT 5320 TT
GGGG TT 5675 TT GGGG TT GGGG TT 40 5651 TT GGGG TT GGGG TT GGGG TT
GGGG 35 TTTT GGGG TTTA GGGG 5673 GGGG
Example 11
Activity of G.sub.4 Phosphorothioate Oligonucleotides Against
Several Viruses
[0092] Antiviral activity of oligonucleotides was determined by CPE
inhibition assay for influenza virus, adenovirus, respiratory
syncytial virus, human rhinovirus, vaccinia virus, HSV-2 and
varicella zoster virus. The MTT cell viability assay was used to
assay effects on HIV. HSV-2, adenovirus, vaccinia virus and
rhinovirus were assayed in MA104 cells. Respiratory syncytial virus
was assayed in HEp-2 cells and influenza virus was assayed in MDCK
cells. CEM cells were used in MTT assays of HIV inhibition.
Oligonucleotide was added at time of virus infection.
[0093] MDCK (normal canine kidney) cells and HEp-2, a continuous
human epidermoid carcinoma cell line, were obtained from the
American Type Culture Collection, Rockville, Md. MA-104, a
continuous line of African green monkey kidney cells, was obtained
from Whittaker M. A. Bioproducts, Walkersville, Md.
[0094] HSV-2 strain E194 and influenza strain A/NWS/33 (H1N1) were
used. Adenovirus, Type 5 (A-5), strain Adenoid 75; respiratory
syncytial virus (RSV) strain Long; rhinovirus 2 (R-2), strain HGP;
and vaccinia virus, stain Lederle-chorioallantoic were obtained
from the American Type Culture Collection, Rockville Md.
[0095] Cells were grown in Eagle's minimum essential medium with
non-essential amino acids (MEM, GIBCO-BRL, Grand Island N.Y.) with
9% fetal bovine serum (FBS, Hyclone Laboratories, Logan Utah), 0.1%
NaHCO.sub.3 for MA104 cells; MEM 5% FBS, 0.1% NaHCO.sub.3 for MDCK
cells, and MEM, 10% FBS, 0.2% NaHCO.sub.3 for HEp-2 cells. Test
medium for HSV-2, A-5, R-2 and vaccinia virus dilution was MEM, 2%
FBS, 0.18% NaHCO.sub.3, 50 .mu.g gentamicin/ml. RSV was diluted in
MEM, 5% FBS, 0.18% NaHCO.sub.3, 50 .mu.g gentamicin/ml. Test medium
for dilution of influenza virus was MEM without serum, with 0.18%
NaHCO.sub.3, 20 .mu.g trypsin/ml, 2.0 .mu.g EDTA/ml, 50 .mu.g
gentamicin/ml.
[0096] Ribavirin was obtained from ICN Pharmaceuticals, Costa Mesa,
Calif. Acyclovir and 9.beta.-D-arabinofuranosyladenine (ara-A) were
purchased from Sigma Chemical Co., St. Louis, Mo. Ribavirin,
acyclovir and ara-A were prepared and diluted in MEM without serum,
plus 0.18% NaHCO.sub.3, 50 .mu.g gentamicin/ml. Oligonucleotides
were diluted in the same solution.
[0097] Cells were seeded in 96-well flat bottom tissue culture
plates, 0.2 ml/well, and incubated overnight in order to establish
monolayers of cells. Growth medium was decanted from the plates.
Compound dilutions were added to wells of the plate (4
wells/dilution, 0.1 ml/well for each compound) as stocks having
twice the desired final concentration. Compound diluent medium was
added to cell and virus control wells (0.1 ml/well). Virus, diluted
in the specified test medium, was added to all compound test wells
3 wells/dilution) and to virus control wells at 0.1 ml/well. Test
medium without virus was added to all toxicity control wells (1
well/dilution for each comopund test) and to cell control wells at
0.1 ml/well. The plates were incubated at 37.degree. C. in a
humidified incubator with 5% CO.sub.2, 95% air atmosphere until
virus control wells had adequate CPE readings. Cells in test and
virus control wells were then examined microscopically and graded
for morphological changes due to cytotoxicity. Effective dose, 50%
endpoint (ED50) and cytotoxic dose, 50% endpoint (CD50) were
calculated by regression analysis of the viral CPE data and the
toxicity control data, respectively. The ED50 is that concentration
of compound which is calculated to produce a CPE grade halfway
between that of the cell controls (0) and that of the virus
controls. CD50 is that concentration of compound calculated to be
halfway between the concentration which produces no visible effect
on the cells and the concentration which produces complete
cytotoxicity. The therapeutic index (TI) for each substance was
calculated by the formula: TI=CD50/ED50.
[0098] Oligonucleotide sequences are shown in Table 1 except for
ISIS 3383 (SEQ ID NO: 122) and ISIS 6071. ISIS 3383 is a scrambled
version of ISIS 1082 (SEQ ID NO: 134). ISIS 6071 (TGTGTGTG) is a
scrambled version of ISIS 5320. The results are shown in Table 7.
Oligonucleotides with ED50 values of less than 50 .mu.M were judged
to be active in this assay and are preferred. TABLE-US-00007 TABLE
7 Oligonucleotide activity against RNA and DNA viruses Virus: DNA
Viruses RNA Viruses Compound: HSV-2 VZV A-5 Vacc RSV Rhino HIV
Influenza 3383 ED50 2.8 .mu.M -- >100 >100 0.7 >100 -- 19
TI >36 -- -- -- 60 -- -- >5 4015 ED50 0.8 29 >100 15 0.6
>100 0.16 0.6 TI >125 1.0 <1.0 >6.7 93 -- 100 93 3657
ED50 0.6 >100 >100 18 0.8 >100 -- 1.0 TI >167 1.0
<1.0 >5.6 >125 -- -- 56 4338 ED50 0.6 -- 68 19 1.0 >100
-- 0.5 TI >53 -- >1.5 >5.3 13 -- -- >200 1220 ED50 0.7
-- >50 46 -- >50 -- -- TI >71 -- -- >1.1 -- -- -- --
5652 ED50 0.3 18 >100 -- 1.9 >100 0.18 0.6 TI >333 --
<1.0 -- >53 -- 227 93 ACV ED50 97.7 -- -- -- -- -- -- -- TI
>45 -- -- -- -- -- -- -- Ribavirin ED50 -- -- 82 -- 49 229 --
7.78 TI -- -- 28 -- 20 10 -- 202 Ara-A ED50 -- -- -- 15.8 -- -- --
-- TI -- -- -- 125 -- -- -- -- 5320 ED50 4 >100 >100 >100
-- -- 0.4 40 TI -- -- -- -- -- -- 390 -- 6071 ED50 >100 >100
>100 >100 -- -- 50 >100 TI -- -- -- -- -- -- -- --
Example 12
Testing of Oligonucleotides for Activity Against HSV-1
[0099] Phosphorothioate oligonucleotides were synthesized which are
complementary to regions of the HSV-1 RNA containing clusters of
cytosines. These oligonucleotides are shown in Table 8:
TABLE-US-00008 TABLE 8 Phosphorothioate oligonucleotides targeted
to HSV-1 (sequences written 5' TO 3') SEQ Oligo Target ID #
Sequence Target Function NO: 1220 CAC GAA AGG CAT UL9, Ori binding
1 GAC CGG GGC AUG protein 4274 CAT GGC GGG ACT UL27, virion gB 8
ACG GGG GCC AUG 4338 ACC GCC AGG GGA UL42, DNA binding 12 ATC CGT
CAT AUG protein 4346 GAG GTG GGC TTC UL42, '' 123 GGT GGT GA 5'UTR
3657 CAT CGC CGA TGC IE175, Transc. 16 GGG GCG ATC AUG
transactivator 4015 GTT GGA GAC CGG UL29, ssDNA 21 GGT TGG GG 5'UTR
binding protein 4398 CAC GGG GTC GCC '' '' 28 GAT GAA CC 4393 GGG
GTT GGG GAA '' '' 124 TGA ATC CC 4348 GGG TTG GAG ACC '' '' 125 GGG
GTT GG 4349 GGT TGG AGA CCG '' '' 126 GGG TTG GG 4341 TGG AGA CCG
GGG '' '' 127 TTG GGG AA 4342 TTG GAG ACC GGG '' '' 128 GTT GGG GA
4350 GAC GGT CAA GGG '' '' 129 GAG GGT TGG 4435 GGG GAG ACC GAA
UL20, Viral egress 130 ACC GCA AA 5'UTR 4111 CCT GGA TGA TGC UL30,
DNA polymerase 131 TGG GGT AC coding 4112 GAC TGG GGC GAG '' '' 132
GTA GGG GT 4399 GTC CCG ACT GGG '' '' 133 GCG AGG AT
[0100] The oligonucleotides shown in Table 8 were tested for
activity against HSV-1 (KOS strain) using an ELISA assay as
described in Example 3. Results are expressed as percent of
untreated control. From these results, an EC50 (effective
oligonucleotide concentration giving 50% inhibition) is calculated
for each oligonucleotide. These values, expressed in .mu.M, are
given in Table 9. Oligonucleotides having EC50s of 1 .mu.M or less
in this ELISA assay were judged to have particularly good activity
and are preferred. The negative control oligonucleotide, ISIS 1082
(complementary to HSV UL13 translation initiation codon; has no
runs of G) had EC50 of 2.5 and 1.8 .mu.M in duplicate experiments.
TABLE-US-00009 TABLE 9 Oligonucleotide inhibition of HSV-1 All
oligonucleotides are phosphorothioates Oligo # EC50 (.mu.M)* 1220
0.24, 0.16 4274 0.15, 0.15 4338 0.20, 0.20 4346 0.50 3657 0.20 4015
0.22, 0.22 4398 0.10 4393 0.20 4348 0.40 4349 0.25 4341 0.20 4342
0.20 4350 0.25 4435 0.22 4111 0.60 4112 0.30 4399 0.25 *Some
experiments were done in duplicate
Example 13
Activity of G.sub.4 Phosphorothioate Oligonucleotides Against
Various Strains of HSV
[0101] Oligonucleotides were tested against HSV-1 and five strains
of HSV-1, of which two (HSV1-DM2.1 and HSV1-PAAr) are resistant to
acyclovir (ACV). Oligonucleotides were assayed by ELISA as
described in Example 3 and results are shown in Table 10. In this
assay, oligonucleotides with EC50s of 1 .mu.M or less were judged
to be particularly active and are preferred. TABLE-US-00010 TABLE
10 Oligonucleotide activity against various HSV strains Results are
given as EC50, expressed in .mu.M Compound: 4015 1220 3657 4338
4274 1082 ACV SEQ ID NO: HSV strain 21 1 16 12 8 134 HSV-1 (KOS)
0.25 0.34 0.38 0.24 0.21 2.1 2.5 HSV-2 0.2 0.1 0.2 0.2 0.2 2.0 2.0
HSV1-F 0.22 0.22 0.22 0.25 0.25 >3.0 0.7 HSV1-McKrae 0.45 0.30
0.40 0.60 >3.0 1.8 HSV1-DM2.1 0.10 0.10 0.10 0.70 0.40 >3.0
>3.0 HSV1-PAAr 0.35 0.12 0.10 0.30 0.25 >3.0 >3.0
Example 14
Effect of Time of Oligonucleotide Addition on HSV-1 Inhibition by
G.sub.4 Phosphorothioate Oligonucleotides
[0102] NHDF cells were infected with HSV-1 (KOS) at a MOI of 3.0
pfu/cell. Oligonucleotides or ACV were added at a concentration of
12 mM at different times after infection. HSV was detected by ELISA
48 hours after infection. It was found that all oligonucleotides,
including scrambled control oligonucleotide 3383, inhibited HSV
replication when added to cells at the time of virus infection
(t=0), but only oligonucleotides complementary to HSV genes (ISIS
4274, 1220, 4015 and 3657) inhibited HSV replication when added
after virus infection. Oligonucleotides showed good antiviral
activity when added 8 to 11 hours after infection. This pattern is
similar to that observed with ACV, as shown in FIG. 7.
Example 15
Chimeric 2'-O-methyl G.sub.4 Oligonucleotides with Deoxy Gaps
[0103] A series of phosphorothioate oligonucleotides were
synthesized having a 2'-O-methyl substitution on the sugar of each
nucleotide in the flanking regions, and 2'-deoxynucleotides in the
center portion of the oligonucleotide (referred to as the "deoxy
gap"). Deoxy gaps varied from zero to seven nucleotides in length.
These chimeric oligonucleotides were assayed by ELISA as described
in Example 3 and results are shown in Table 11. In this assay,
oligonucleotides with EC50s of 1 .mu.M or less were judged to be
particularly active and are preferred. TABLE-US-00011 TABLE 11
Activity of 2'-O-me C.sub.4 oligonucleotides against HSV (2'-O-me
nucleotides shown in bold) SEQ Oligo EC50 ID # Sequence Target Type
(.mu.M) NO: 1220 CAC GAA AGG CAT GAC UL9, Parent 0.24, 1 CGG GGC
AUG (deoxy) 0.16 4240 CAC GAA AGG CAT GAC '' Deoxy 1 CGG GGC gap
3657 CAT CGC CGA TGC GGG IE175, Parent 0.20 16 GCG ATC AUG (deoxy)
5377 CAT CGC CGA TGC GGG '' 2'-O-me 1.20 16 GCG ATC 4237 CAT CGC
CGA TGC GGG '' Deoxy gap 16 GCG ATC 4015 GTT GGA GAC CGG GGT UL29,
Parent 0.22, 21 TGG GG 5'UTR (deoxy) 0.22 4538 GTT GGA GAC CGG GGT
'' Deoxy gap 0.16 21 TGG GG 5378 GTT GGA GAC CGG GGT '' 2'-O-me
0.40 21 TGG GG 4398 CAC GGG GTC GCC GAT UL29, Parent 0.10 28 GAA CC
5'UTR (deoxy) 5039 CAC GGG GTC GCC GAT '' 2'-O-me 2.70 28 GAA CC
5189 CAC GGG GTC GCC GAT '' Deoxy gap 0.16 28 GAA CC
[0104] Additional chimeric oligonucleotides were synthesized having
the sequences of ISIS 4015 and ISIS 4398. These oligonucleotides
were 2'-O-methyl oligonucleotides with deoxy gaps as described
above, but instead of a uniform phosphorothioate backbone, these
compounds had phosphorothioate internucleotide linkages in the
deoxy gap region and phosphodiester linkages in the flanking
region. These oligonucleotides were not active against HSV in this
ELISA assay.
[0105] Additional oligonucleotides were synthesized with
2'-O-propyl modifications. 2'-O-propyl oligonucleotides were
prepared from 2'-deoxy-2'-O-propyl ribosides of nucleic acid bases
A, G, U(T), and C which were prepared by modifications of
literature procedures described by B. S. Sproat, et al., Nucleic
Acids Research 18:41-49 (1990) and H. Inoue, et al., Nucleic Acids
Research 15:6131-6148 (1987). ISIS 7114 is a phosphorothioate which
has the same sequence (SEQ ID NO: 21) as ISIS 4015, and has a
2'-O-propyl modification on each sugar. ISIS 7171 is a
phosphorothioate gapped 2'-O-propyl oligonucleotide with the same
sequence as ISIS 4015 and 2'-O-propyl modifications at positions
1-7 and 14-20 (6-deoxy gap). As shown in FIG. 8, all three
oligonucleotides are active against HSV. A uniform 2'-O-propyl
phosphorothioate version of ISIS 3657 (SEQ ID NO: 16) was also
synthesized and tested for activity against HSV-1. As shown in FIG.
9, this oligonucleotide (ISIS 7115) was even more active than ISIS
3657. 2'-O-propyl modifications are therefore a preferred
embodiment of this invention. FIG. 9 also shows that both ISIS 3657
and ISIS 7115 are several-fold more active than Acyclovir, which in
turn is more active than a control oligonucleotide, ISIS 3383.
Example 16
Effect of Chemical Modification on Inhibition of HSV-1 by G.sub.4
Oligonucleotides
Inosine Substitutions:
[0106] A series of oligonucleotides were prepared in which one or
more guanosines were replaced with an inosine residue.
Oligonucleotides containing inosine residues were synthesized as
for unmodified DNA oligonucleotides, using inosine phosphoramidites
purchased from Glen Research. These sequences were assayed for
activity in ELISA assays as described in Example 3. These
oligonucleotides, their parent sequences and EC50 values are shown
in Table 12. TABLE-US-00012 TABLE 12 Activity of
inosine-substituted oligonucleotides against HSV SEQ Oligo EC50 ID
# Sequence Target Type (.mu.M) NO: 1220 CAC GAA AGG CAT GAC UL9,
Parent 0.24, 1 CGG GGC AUG 0.16 5297 CAC GAA AGG CAT GAC '' Inosine
>3.0 135 CGI GGC #18 5308 CAC GAA AGG CAT GAC '' Inosine >3.0
136 CGG GIC #20 4015 GTT GGA GAC CGG GGT UL29, Parent 0.22, 21 TGG
GG 5'UTR 0.22 4925 GTT GGA GAC CGG IGT '' Inosine 1.60 137 TGG IG
#13, 19 5295 GTT GGA GAC CGG GIT '' Inosine >3.0 138 TGG GG #14
5296 GTT GGA GAC CGG GGT '' Inosine 0.80 139 TGG IG #19 5309 GTT
GGA GAC CGI GGT '' Inosine >3.0 140 TGG GG #12 5310 GTT GGA GAC
CGG GGT '' Inosine 0.40 141 TGG GI #20
[0107] In this assay, oligonucleotides with EC50s of 1 .mu.M or
less were judged to be particularly active and are preferred.
Fluorescein-Conjugated Oligonucleotides:
[0108] Several oligonucleotides were synthesized with a fluorescein
moiety conjugated to the 5' end of the oligonucleotide.
Fluorescein-conjugated oligonucleotides were synthesized using
fluorescein-labeled amidites purchased from Glen Research.
[0109] These sequences were assayed for activity in ELISA assays as
described in Example 3. These oligonucleotides, their parent
sequences and EC50 values are shown in Table 13. In this assay,
oligonucleotides with EC50s of 1 .mu.M or less were judged to be
particularly active and are preferred. TABLE-US-00013 TABLE 13
Activity of fluorescein-conjugated oligonucleotides against HSV SEQ
Oligo EC50 ID # Sequence Target Type (.mu.M) NO: 1220 CAC GAA AGG
CAT UL9, Parent 0.24, 1 GAC CGG GGC AUG 0.16 5338 CAC GAA AGG CAT
'' Fluorescein 0.16 1 GAC CGG GGC 3657 CAT CGC CGA TGC IE175,
Parent 0.20 16 GGG GCG ATC AUG 5340 CAT CGC CGA TGC '' Fluorescein
0.18 16 GGG GCG ATC 4398 CAC GGG GTC GCC UL29, Parent 0.10 28 GAT
GAA CC 5'UTR 5324 CAC GGG GTC GCC '' Fluorescein 0.16 28 GAT GAA CC
1082 GCC GAG GTC CAT UL13, Parent 2.50, 134 GTC GTA CGC AUG 1.80
5339 GCC GAG GTC CAT '' Fluorescein 0.65 134 GTC GTA CGC
7-Methyl-7-deaza Guanosine Substitutions:
[0110] Monomer Preparation:
[0111] A stirred suspension of 0.8 g (20 mmole) of a 60% sodium
hydride in hexane dispersion was decanted and taken to dryness,
resuspended in 100 ml of dry acetonitrile and the suspension
treated with 3.21 g (15 mmole) of
4-chloro-5-methyl-2-methylthiopyrrolo[2,3-d]pyrimidine [Kondo et
al. (1977) Agric. Biol. Chem. 4:1501-1507. The mixture was stirred
under nitrogen at room temperature for one hour and then treated
with 5.9 g (15 mmole) of
1-chloro-2-deoxy-3,5-di-O-(p-toluoyl)-.alpha.-D-erythropentofuranose
added in portions. An additional 40 ml of acetonitrile was added,
the mixture stirred at 50.degree. C. for about three and one half
hours and then filtered and the solid washed with acetonitrile and
dried to give 6.1 g (72%) of
4-chloro-5-methyl-2-methylthio-7-[.alpha.-D-erythro-pentofuranosyl]pyrrol-
o[2,3-d]pyrimidine, m.p. 163-163.5.degree. C.
[0112] Reaction of this product with sodium 2-propenyloxide in DMF
afforded
5-methyl-2-methylthio-4-(2-propenyloxy)-7-(.alpha.-D-erythro-pen-
tofuranosyl)pyrrolo[2,3-d]pyrimidine, which on oxidation with two
molar equivalents of 3-chloroperbenzoic acid in methylene
chloroide, afforded
5-methyl-2-methylsulfonyl-4-(2-propenyloxy-7-(.alpha.-D-erythro-pentofura-
nosyl)pyrrolo[2,3-d]-pyrimidine. Reaction of the product with
hydrazine afforded
5-methyl-2-hydrazino-4-(2-propenyloxy)-7-(.alpha.-D-erythro-pent-
ofuranosyl)pyrrolo[2,3-d]pyrimidine. Reduction of the product with,
for example, Raney nickel affords
7-deaza-2'-deoxy-7-methylguanosine.
[0113] Protection of Monomer:
[0114] The latter is treated sequentially first with
trimethylchlorosilane in the presence of pyridine, then with
isobutyric hydroxide to give
2-isobutyryl-7-deaza-2'-deoxy-7-methylguanosie, which, on reaction
with one molar equivalent of trityl chloride in the presence of dry
pyridine, affords
2-isobutyryl-7-deaza-2'-deoxy-7-methyl-5'tritylguanosine. Reaction
of the latter with one molar equivalent of
chloro-.beta.-cyanoethoxy-N,N-diisopropylaminophosphine affords
2-isobutyryl-7-deaza-2'-deoxy-7-methyl-3'-O-[N,N-diisopropylamino)-.beta.-
-cyanoethoxyphosphanyl]-5'-tritylguanosine. This protected monomer
is then incorporated into oligonucleotides during automated
synthesis.
[0115] An oligonucleotide having the same sequence as ISIS 3657 was
synthesized in which the guanosines at positions 14 and 15 were
replaced with 7-methyl-7-deaza guanosines. This oligonucleotide
(ISIS 6303) was found to have an IC50 of approximately 10
.mu.M.
Example 17
Activity of ISIS 4015 in Combination with Other Antiviral Drugs
[0116] ISIS 4015 was tested in combination with the nucleoside
analog 5-trifluoromethyl-dUrd (TFT) in the ELISA assay described in
Example 3. Oligonucleotide and TFT concentrations from 0 to 2 .mu.M
were tested. As shown in FIG. 10, ISIS 4015 appears to enhance the
activity of TFT against HSV-1.
[0117] ISIS 4015 was tested in the same way against
9-(2-hydroxyethoxymethyl)guanine (Acyclovir, ACV), at
oligonucleotide concentrations of 0 to 2 .mu.M and ACV
concentrations from 0 to 16 .mu.M. As shown in FIG. 11, the effect
of the two drugs in combination appeared to be additive.
Example 18
Activity of G.sub.4-Containing 8-mer Oligonucleotides Against
HSV-1
[0118] A progressive unrandomization strategy [Ecker, D. J. et al.,
(1993) Nucl. Acids. Res. 21:1853-1956] was used to identify an
8-mer phosphorothioate oligonucleotide which was active against
HSV-1 in the ELISA assay described in Example 3. The "winning"
oligonucleotide, ISIS 5684, had the sequence GGGGGGTG. The ED50 of
this oligonucleotide was found to be approximately 0.6 .mu.M.
[0119] A series of 8-mer phosphorothioate oligonucleotides
containing a G.sub.4 sequence were synthesized and tested in the
HSV-1 ELISA assay described in Example 3. These oligonucleotides
are shown in Table 14. TABLE-US-00014 TABLE 14 Anti-HSV Activity of
short G.sub.4-containing Oligonucleotides ISIS NO. SEQUENCE 5060
GTGGGGTA 6170 GTGGGGTG 5684 GGGGGGTG 5058 GCGGGGTA
As shown in FIG. 12, all of these oligonucleotides have IC50's
below 1 .mu.M and are therefore preferred. Several of these 8-mers
have anti-HSV activity greater than that of ISIS 4015, a 20-mer.
G.sub.4 Oligonucleotides Active Against HIV:
Example 19
Oligonucleotide Library Synthesis
[0120] Phosphorothioate oligonucleotides were synthesized using
standard protocols. Sulfurization was achieved using
3H-1,2-benzodithiole-3-one-1,1 dioxide ("Beaucage reagent") as
oxidizing agent. Iyer, R. P., Phillips, L. R., Egan, W., Regan, J.
B. & Beaucage, S. L. (1990) J. Org. Chem. 55, 4693-4699. For
oligonucleotides with randomized positions, amidites were mixed in
a single vial on the fifth port of the ABI 394 synthesizer. The
mixture was tested by coupling to dT-CPG, cleaving and deprotecting
the product, and analyzing the crude material on reversed-phase
HPLC. Proportions of the individual amidites were adjusted until
equal amounts of the four dimers were obtained. DMT-off
oligonucleotides were purified by reversed-phase HPLC with a
gradient of methanol in water to desalt and remove the protecting
groups. Several purified oligonucleotides were analyzed for base
composition by total digestion with nuclease followed by
reversed-phase HPLC analysis and yielded expected ratios of each
base.
[0121] Oligonucleotides with the .alpha.-configuration of the
glycosidic bond were synthesized as previously described. Morvan,
F., Rayner, B., Imbach, J-L., Thenet, S., Bertrand, J-R., Paoletti,
J., Malvy, C. & Paoletti, C. (1993) Nucleic Acids Res. 15,
3421-3437. Biotin was incorporated during chemical synthesis using
biotin-linked CPG from Glen Research. Oligonucleotide
T.sub.2G.sub.4T.sub.2 (ISIS 5320) was purified by reverse phase
chromatography to remove salts and protecting groups and then by
size exclusion chromatography to purify the tetramer as described
in Example 21.
[0122] Prior to antiviral screening, oligonucleotides were diluted
to 1 mM strand concentration in 40 mM sodium phosphate (pH 7.2),
100 mM KCl and incubated at room temperature overnight. Extinction
coefficients were determined as described by Puglisi & Tinoco,
(1989) In Methods in Enzymology, RNA Processing, eds. Dahlberg, J.
E. & Abelson, J. N. (Academic Press, Inc., New York), Vol. 180,
pp. 304-324. Samples were filtered through 0.2 .mu.m cellulose
acetate filters to sterilize.
Example 20
Acute HIV-1 Assay
[0123] Oligonucleotides were screened in an acute HIV-1 infection
assay which measures protection from HIV-induced cytopathic
effects. The CEM-SS cell line; Nara, P. L. & Fischinger, P. J.
(1988) Nature 332, 469-470; was maintained in RPMI 1640 medium
supplemented with 10% fetal bovine serum, 2 mM glutamine,
penicillin (100 units mL.sup.-1), and streptomycin (100 .mu.g
mL.sup.-1). The antiviral assay, using XTT-tetrazolium to
quantitate drug-induced protection from HIV-induced cell killing
has been described. White, E. L., Buckheit, Jr., R. W., Ross, L.
J., Germany, J. M., Andries, K., Pauwels, R., Janssen, P. A. J.,
Shannon, W. M. & Chirigos, M. A. (1991) Antiviral Res. 16,
257-266.
Example 21
Characterization of Tetramer
[0124] Monomeric and tetrameric forms of oligonucleotides were
separated on a Pharmacia Superdex HR 10/30 size exclusion column
(Pharmacia, Upsalla, Sweden). Running buffer was 25 mM sodium
phosphate (pH 7.2), 0.2 mM EDTA. Flow rate was 0.5 mL min.sup.-1
and detection was at 260 nm. Monomer and tetramer peaks were
integrated and fraction tetramer determined. For purification, a
Pharmacia Superdex 75 HiLoad 26/60 column was used with a buffer of
10 mM sodium phosphate (pH 7.2) at a flow rate of 2 mL
min.sup.-1.
[0125] Dissociation of the tetramer was followed after dilution. A
1 mM solution of oligonucleotide was diluted to 10 .mu.M into PBS
(137 mM NaCl; 2.7 mM KCl; 1.5 mM potassium phosphate, monobasic; 8
mM sodium phosphate, dibasic) and incubated at 37.degree. C.
Phosphorothioate oligonucleotides having the sequence
T.sub.2G.sub.4T.sub.2 in K.sup.+ and the phosphodiester
T.sub.2G.sub.4T.sub.2 were diluted from solutions in 40 mM sodium
phosphate (pH 7.2), 100 mM KCl. Oligonucleotide having the sequence
T.sub.2G.sub.4T.sub.2 in Na.sup.+ was diluted from a solution in 40
mM sodium phosphate (pH 7.2), 100 mM NaCl. Dissociation as a
function of time was followed by size exclusion chromatography.
[0126] The tetramer formed was parallel-stranded as determined by
analysis of the complexes formed by the phosphorothioate
oligonucleotides having T.sub.2G.sub.4T.sub.2 and
.sup.5'T.sub.13G.sub.4T.sub.4.sup.3' (SEQ ID NO: 142). Each
oligonucleotide was labeled at the 5' end with .sup.32P. Each
sample contained 125 .mu.M unlabeled and 15 pM radioactively
labeled amounts of one or both of the oligonucleotides. The samples
were heated in 50 mM sodium phosphate (pH 7.2), 200 mM KCl in a
boiling water bath for 15 min then incubated for 48 h at 4.degree.
C. Samples were analyzed by autoradiography of a 20% non-denaturing
polyacrylamide (19:1, acrylamide: bis) gel run at 4.degree. C. in
1.times.TBE running buffer.
Example 22
Assay of HIV-Induced Cell Fusion
[0127] Stochiometric amounts of chronically HIV-1-infected Hut 78
cells (Hut/4-3) and CD4+ HeLa cells harboring an LTR-driven lac z
gene were co-cultured for 20 h in the presence or absence of
oligonucleotide. Cells were fixed (1% formaldehyde, 0.2%
glutaraldehyde in PBS) and incubated with X-gal until
cell-associated color developed. After buffer removal, a standard
o-nitrophenyl-.beta.-D-galactopyranoside was used to quantitate
.beta.-galactosidase expression. As a control, HeLa CD4+ cells
containing the LTR-driven lac Z gene were transfected using the
calcium phosphate method with 30 .mu.g of proviral DNA (pNL 4-3).
Oligonucleotide was added immediately after the glycerol shock.
Cells were fixed 48 h after transfection and assayed as described
above.
Example 23
Binding of ISIS 5320 to gp120
[0128] Direct binding to gp120 was assayed using immobilized gp120
from a CD4 capture ELISA kit (American Bio-technologies).
Biotinylated oligonucleotides (biotinylated during synthesis using
biotin-linked CPG from Glen Research) were incubated in a volume of
100 .mu.L with immobilized gp120. Following a 1 hour incubation
wells were washed and 200 .mu.L of streptavidin-alkaline
phosphatase (Gibco BRL) diluted 1:1000 in PBS added to each well.
After a 1 hour incubation at room temperature wells were washed and
PNPP substrate (Pierce) added. Plates were incubated at 37.degree.
C. and absorbance at 405 nm was measured using a Titertek Multiscan
MCC/340 ELISA plate reader.
[0129] Ability of ISIS 5320 to compete with dextran sulfate for
binding to gp120 was determined. Biotinylated ISIS 5320 at a
concentration of 0.5 .mu.M was added to plates containing
immobilized gp120 along with dextran sulfate at the indicated
concentrations (Sigma, M.W. 5000). Following a 1 h incubation, the
amount of oligonucleotide associated with gp120 was determined as
described above.
[0130] The site of ISIS 5320 binding to gp120 was determined by
competition for binding of antisera specific for various regions of
the protein. Rusche, J. R., et al., (1987) Proc. Natl. Acad. Sci.
USA 84, 6924-6928; Matsushita, S., et al., (1988) J. Virol. 62,
2107-2114; Meuller, W. T., et al., (1986) Science 234, 1392-1395.
gp120-coated microtiter plates were incubated with oligonucleotide
at a concentration of 25 .mu.M for 1 h at room temperature.
Antisera was added at a dilution of 1:250 and the plates incubated
40 min. The plates were washed four times with PBS and amount of
antibody bound quantitated by incubating with protein A/G-alkaline
phosphatase (1:5000, Pierce) in PBS for 1 h at room temperature.
After one wash with PBS, substrate was added and absorbance at 405
nm was measured.
[0131] Binding of ISIS 5320 to gp120, CD44 and CD4 expressed on
cells was quantitated. HeLa cells harboring an HIV-1 env c gene;
Gama Sosa, M. A., et al., (1989) Biochem. Biophys. Res. Comm. 161,
305-311 and Ruprecht, R. M., et al., (1991) J. Acquir. Immune
Defic. Syndr. 4, 48-55; were cultured in DMEM supplemented with 10%
FCS and 100 .mu.g .mu.L.sup.-1 G-418. Extent of binding to gp120
was detected using 1 .mu.g of FITC-conjugated murine anti-gp120
HIV-1 IIIB mAb IgG (Agmed). CD44 binding was detected using 1 .mu.g
of FITC-conjugated murine anti-CD44 mAb IgG (Becton-Dickinson).
Each experiment consisted of 200,000 cells. Cells were washed once
in culture media with 0.05% NaN.sub.3 then resuspended in 100 .mu.L
of media containing oligonucleotide and incubated 15 min at room
temperature. Antibody was added and the incubation continued for 1
h at 4.degree. C. The cells were washed twice with PBS and
immunofluorescence was measured on a Becton-Dickinson FACScan. Mean
fluorescence intensity was determined using Lysis software.
[0132] CEM-T4 cells; Foley, G. E., et al., (1965) Cancer 18,
522-529; were maintained in MEM supplemented with 10% FCS. Extent
of binding to CD4 was determined using 1 .mu.g of Q425, a murine
anti-CD4 mAb IgG. Healey, D., et al., (1990) J. Exp. Med. 172,
1233-1242. Cells were harvested and washed and incubated with
oligonucleotide as above. After a 30 min incubation at room
temperature with antibody, the cells were washed and incubated with
100 .mu.L of media containing 5 .mu.g of goat F (ab').sub.2
anti-mouse IgG (Pierce). The cells were incubated 30 min, washed
and associated fluorescence determined as above.
Example 24
Selection and Characterization of T.sub.2G.sub.4T.sub.2
[0133] A phosphorothioate oligonucleotide library containing all
possible sequences of eight nucleotides divided into 16 sets, each
consisting of 4,096 sequences, was prepared as described in Example
19 and screened for inhibition of HIV infection as described in
Example 21. Results are summarized in Table 15. TABLE-US-00015
TABLE 15 Combinatorial Pools X = A X = G X = C X = T Round 1 NNA
NXN NN inactive inactive inactive inactive NNG NXN NN inactive 19.5
(5%) inactive inactive NNC NXN NN inactive inactive inactive
inactive (0%) NNT NXN NN inactive inactive inactive inactive (0%)
Round 2 NNG XGN NN 60.7 1.8 (36%) 55.6 56.2 (3%*) Round 3 NNG GGX
NN 8.0 0.5 (94%) 3.1 (19%*) 8.6 Round 4 NAG GGG XN 0.5 0.5 0.5 0.5
(87%) NGG GGG XN 0.5 0.6 (99%*) 0.4 0.5 NCG GGG XN 0.7 0.6 0.5
(91%) 0.4 NTG GGG XN 0.4 (82%) 0.5 0.4 0.5 Round 5 XTG GGG TN 0.2
(94%) 0.6 (89%*) 0.3 (94%) 0.3 (94%) Round 6 TTGGGGTX 0.6 (90%) 0.6
0.5 0.3 (93%)
[0134] Random positions, N, are an equimolar mixture of each base.
Antiviral data are reported as the quantity of drug (in .mu.M of
oligonucleotide strand) required to inhibit 50% of virus-induced
cell killing (IC.sub.50). Error in the IC.sub.50 is .+-.0.1 .mu.M.
"Inactive" pools showed no antiviral activity at 100 .mu.M strand
concentration. The % tetramer, determined as described in Example
21, is given in parentheses for selected pools. An asterisk
indicates multiple aggregate species.
[0135] The in vitro assay measured protection of cells from
HIV-induced cytopathic effects. White, E. L., et al., (1991)
Antiviral Res. 16, 257-266. In the initial rounds of selection,
antiviral activity was observed only in the set containing
guanosine in two fixed positions. Subsequent rounds of selection
showed that four consecutive Gs provided maximum antiviral
activity. No strong selection preference was observed for
nucleotides flanking the guanosine core. The sequence
T.sub.2G.sub.4T.sub.2 (oligonucleotide ISIS 5320) was chosen for
further study. The concentration of ISIS 5320 required for 50%
inhibition of virus-induced cell killing (IC.sub.50) was 0.3 .mu.M.
The antiviral activity of this oligonucleotide was not a result of
inhibition of cell metabolism; cytotoxic effects were not observed
until cells were incubated with approximately 100 .mu.M ISIS
5320.
[0136] Although the oligonucleotide ISIS 5320 has a
phosphorothioate backbone, evidence suggests that it adopts a
four-stranded, parallel helix as do phosphodiester oligonucleotides
of similar sequence. Cheong, C. & Moore, P. B. (1992)
Biochemistry 31, 8406-8414; Aboul-ela, F., et al., (1992) Nature
360, 280-282; Sarma, M. H., et al., (1992) J. Biomol. Str. Dyn. 9,
1131-1153; and Wang, Y. & Patel, D. J. (1992) Biochemistry 31,
8112-8119. The oligonucleotides in the combinatorial library pools
that show antiviral activity (Table 15) and oligonucleotide ISIS
5320 form multimeric complexes as shown by size exclusion
chromatography (FIG. 13). The retention time of the complex was
that expected for a tetrameric species based on plots of retention
time vs. log molecular weight of phosphorothioate oligonucleotide
standards (data not shown). The circular dichroism (CD) spectrum of
the multimeric form of oligonucleotide ISIS 5320 is characterized
by a peak at 265 nm and a trough at 242 nm (data not shown),
similar to the spectra reported by others for deoxyoligonucleotide
tetramers. Sarma, M. H., et al., (1992) J. Biomol. Str. Dyn. 9,
1131-1153; Lu, M., Guo, Q. & Kallenbach, N. R. (1992)
Biochemistry 31, 2455-2459; Jin, R., et al., (1992) Proc. Natl.
Acad. Sci. USA 89, 8832-8836 and Hardin, C. C., et al., (1992)
Biochemistry 31, 833-841. It has been reported that when two
phosphodiester oligonucleotides of dissimilar size, but each
containing four or five guanosines in a row, are incubated
together, five distinct aggregate species are formed on a
non-denaturing gel. Sen, D. & Gilbert, W. (1990) Nature 344,
410-414 and Kim, J., Cheong, C. & Moore, P. B. (1991) Nature
351, 331-332. In principle, only a tetramer of parallel strands can
explain this pattern. When this experiment was performed with two
phosphorothioate oligonucleotides, the antiviral oligonucleotide
SIS 5320 and a 21-residue oligonucleotide containing 4 guanosines
near the 3' end (.sup.5'T.sub.13G.sub.4T.sub.4.sup.3'), the five
aggregate species expected for a parallel-stranded tetramer were
observed on a non-denaturing gel (FIG. 14).
Example 25
The Tetramer is Active Against HIV
[0137] Oligonucleotides were screened for antiviral activity as
described in Example 22. Samples of ISIS 5320 were diluted from a 1
mM stock solution that was at least 98% tetramer. Results showed
that the tetramer is stable indefinitely at 1 mM strand
concentration; no decrease in tetramer was observed over 5 months
in a 1 mM sample in buffer containing 100 mM KCl at room
temperature. Upon dilution to concentrations used in antiviral
assays (less than 25 .mu.M) dissociation of the tetramer begins;
however, kinetics of the dissociation are very slow (FIG. 15). Slow
kinetics for association and dissociation of intermolecular
G-quartet complexes have been reported. Jin, R., et al., (1992)
Proc. Natl. Acad. Sci USA 89, 8832-8836 and Sen, D. & Gilbert,
W. (1990) Nature 344, 410-414. The half life for the dissociation
of the potassium form of ISIS 5320 is about 45 days. During the
six-day period of the acute antiviral assay, at least 70% of the
sample remained in the tetramer form whether the sample was
prepared in sodium or potassium. Both sodium and potassium forms
have the same IC.sub.50 values in the acute antiviral assay, even
though potassium preferentially stabilized the tetramer.
[0138] Heat denaturation of the tetrameric complex formed by ISIS
5320 before addition to the antiviral assay resulted in loss of
activity; antiviral activity was recovered upon renaturation (data
not shown). The striking difference in antiviral activity among the
initial 16 sets of oligonucleotides used for combinatorial
screening can be explained by the presence or absence of the G-core
and therefore the tetramer structure (Table 15). In the intial
round of screening, approximately 12% of the molecules in the
active .sup.5'NNGNGNNN.sup.3' pool contained at least four
sequential Gs, and size exclusion chromatography showed that 5% of
the oligonucleotides formed tetramers (Table 15). In contrast, in
the other three round 1 pools where X=G only 0.4% of the molecules
contained at least four sequential Gs and no tetramer was observed.
In other pools, there were no molecules with four consecutive
Gs.
[0139] Deletion of nucleotides from either end of the ISIS 5320
sequence resulted in a loss of activity (Table 16). TABLE-US-00016
TABLE 16 Sequence IC.sub.50 (.mu.M) % tetramer
T.sub.ST.sub.SG.sub.SG.sub.SG.sub.SG.sub.ST.sub.ST 0.3 98
T.sub.ST.sub.SG.sub.SG.sub.SG.sub.SG.sub.ST.sub.ST inactive 0 heat
denatured G.sub.SG.sub.SG.sub.SG.sub.ST.sub.ST 0.5 94*
G.sub.SG.sub.SG.sub.SG.sub.ST 1.4 61* G.sub.SG.sub.SG.sub.SG 4 29*
T.sub.ST.sub.SG.sub.SG.sub.SG.sub.SG 13 40*
T.sub.SG.sub.SG.sub.SG.sub.SG inactive 57*
T.sub.SG.sub.ST.sub.SG.sub.ST.sub.SG.sub.ST.sub.SG inactive 0
.alpha.-T.sub.ST.sub.SG.sub.SG.sub.SG.sub.SG.sub.ST.sub.ST 0.5 98
.alpha.-T.sub.OT.sub.OG.sub.OG.sub.OG.sub.OG.sub.OT.sub.OT inactive
97 T.sub.OT.sub.OG.sub.OG.sub.OG.sub.OG.sub.OT.sub.OT inactive 93
T.sub.ST.sub.SG.sub.OG.sub.OG.sub.OG.sub.ST.sub.ST 5.0 80
T.sub.OT.sub.OG.sub.SG.sub.SG.sub.SG.sub.OT.sub.OT inactive 72
T.sub.OT.sub.SG.sub.OG.sub.SG.sub.OG.sub.ST.sub.OT inactive 9
T.sub.ST.sub.OG.sub.SG.sub.OG.sub.SG.sub.OT.sub.ST 5.3 83
T.sub.ST.sub.SG.sub.SG.sub.SG.sub.SG.sub.ST.sub.ST.sub.SB 0.4
85
[0140] Data from the acute HIV assay for sequence variants and
analogs of ISIS 5320. Chemical modifications of the oligonucleotide
are indicated: "s" phosphorothioate backbone, "o" phosphodiester
backbone, ".alpha.", .alpha.-configuration of the glycosidic bond;
"B" biotin (incorporated during chemical synthesis using biotin
linked CPG from Glen Research). "Inactive" indicates no activity at
25 .mu.M concentration. The % tetramer was determined as described
in Example 21. An asterisk indicates more than one aggregate
species. The phosphorothioate GGGG shows some activity; two
nucleotides on the 3' side of the four Gs were required for nearly
optimal activity. More than one multimeric species was observed by
size exclusion chromatography for oligonucleotides with the G-core
exposed.
[0141] The sequence T.sub.2G.sub.4T.sub.2 with a phosphodiester
backbone was inactive in the anti-HIV assay, even though the
phosphodiester tetramer appears to be kinetically more stable than
that formed by the phosphorothioate ISIS 5320 (FIG. 15). While not
wishing to be bound to a particular theory, two hypotheses are
proposed. The phosphorothioate backbone may be mechanistically
required or the modified backbone may prevent nuclease-mediated
degradation of the oligonucleotide.
[0142] Oligonucleotide analogs with the glycosidic bond oriented in
the .alpha.-position are resistant to nuclease degradation. Morvan,
F., et al., (1993) Nucleic Acids Res. 15, 3421-3437. Based on size
exclusion chromatography it has been shown that both the
phosphorothioate .alpha.-oligonucleotide and the phosphodiester
.alpha.-oligonucleotide formed tetramers however, only the
phosphorothioate analog was active against HIV (Table 16). Assay of
oligonucleotides with mixed phosphorothioate-phosphodiester
backbones showed that phosphorothioate linkages at the termini, but
not within the G-core, are necessary for activity. Results are
shown in Table 16.
Example 26
Tetramer Inhibits HIV-1 Binding or Fusion to CD4.sup.+ Cells
[0143] The oligonucleotide ISIS 5320 had no effect on chronically
infected (H9 IIIB) cell models (data not shown) that respond only
to inhibitors that work at post-integration steps. In a high
multiplicity of infection (MOI) experiment performed as described
in Srivastava, K. K., et al., (1991) J. Virol. 65, 3900-3902, ISIS
5320 inhibited production of intracellular PCR-amplifiable DNA
(data not shown), which indicated that the compound inhibited an
early step of HIV replication, such as binding, fusion,
internalization, or reverse transcription.
[0144] The tetramer form of ISIS 5320 also inhibited binding or
fusion of infectious virus to a CD4.sup.+ cell. The assay was
performed as described in Example 22. HeLa-CD4-LTR-B-gal cells;
Kimpton, J. & Emerman, M. (1992) J. Virol. 66, 2232-2239; were
incubated for 15 minutes with oligonucleotide at 37.degree. C.
prior to the addition of virus. After 1 hour, the cells were washed
to remove unbound virus and oligonucleotide. During the incubation
period, virus binding and membrane fusion events occur. Srivastava,
K. K., et al., (1991) J. Virol. 65, 3900-3902. Extent of infection
after 48 hours was determined by quantitation of syncytia and ELISA
as previously described in Kimpton, J. & Emerman, M. (1992) J.
Virol. 66, 2232-2239. At a ISIS 5320 concentration of approximately
0.4 .mu.M, virus production was reduced to 50% of control (data not
shown). Heat-denatured ISIS 5320 and .sup.5'TGTGTGTG.sup.3' showed
inhibition of binding at 5 .mu.M oligonucleotide concentration.
These fusion and binding inhibition experiments strongly suggest
that the tetramer form of ISIS 5320 inhibits viral infection at a
very early step, either during binding of the virion to the cell or
during the early events of fusion and internalization of the
virion.
Example 27
Tetramer Binds to the V3 Domain of gp120
[0145] Cellular experiments indicated that ISIS 5320 blocks viral
binding or fusion, therefore, the affinities of the ISIS 5320
tetramer for CD4 and gp120 were determined as described in Example
23. Biotinylated ISIS 5320 (Table 16) bound to immobilized gp120
with a dissociation constant (K.sub.d) of less than 1 .mu.M (FIG.
16). In contrast, a control phosphorothioate,
.sup.5T.sub.2A4T2-biotin.sup.3', bound weakly to gp120 with an
estimated K.sub.d of 260 .mu.M. Addition of CD4 at concentrations
of up to 50 .mu.g mL.sup.-1 had no effect on ISIS 5320 binding to
gp120 (data not shown). Similar experiments using CD4-coated
microtiter plates showed that biotinylated ISIS 5320 also
associates with CD4; however, the K.sub.d of approximately 25 .mu.M
was considerably weaker than to gp120. The control bound CD4 only
when it was added at very high concentrations (K.sub.d
approximately 240 .mu.M). In addition, qualitative gel shift assays
performed as described in Fried, M. & Crothers, D. M. (1981)
Nucleic Acids Res. 9, 6505-6525, were performed to determine the
affinity of ISIS 5320 for other HIV proteins (Tat, p24, reverse
transcriptase, vif, protease, gp41), soluble CD4 (sCD4) and
non-related proteins (BSA, transferrin and RNase V.sub.1). Both
monomeric and tetrameric forms of ISIS 5320 bound to BSA and
reverse transcriptase. Tetramer-specific binding was observed only
to gp120 and sCD4.
[0146] The V3 loop of gp120 (amino acids 303-338) is considered the
principal neutralizing domain of the protein; peptides derived from
this region elicit type-specific neutralizing antibodies that block
viral infection by blocking fusion. (1992) Human Retroviruses and
AIDS 1992, eds. Myers, G. et al. (Theoretical Biology and
Biophysics, Los Alamos National Laboratory, Los Alamos, N. Mex.).
The V3 loop of gp120 is also the site of action of anionic
polysaccharides, such as dextran sulfate, that inhibit viral
binding, replication and syncytium formation. Callahan, L., et al.,
(1991) J. Virol. 65, 1543-1550. Dextran sulfate is a competitive
inhibitor of binding of biotinylated ISIS 5320 to gp120 immobilized
on a microtiter plate. About 50% of the tetramer binding was
inhibited at a dextran sulfate concentration between 10 and 50
.mu.g mL.sup.-1 (FIG. 17). Dextran sulfate has been shown to
inhibit binding of gp120-specific antibodies to gp120 in this
concentration range. Callahan, L., et al., (1991) J. Virol. 65,
1543-1550.
[0147] The oligonucleotide ISIS 5320 also interferes with binding
of antisera directed against the V3 loop region of gp120, but not
to antisera specific for another region of the protein. Rusche, J.
R., et al., (1987) Proc. Natl. Acad. Sci. USA 84, 6924-6928;
Matsushita, S., et al., (1988) J. Virol. 62, 2107-2114 and Meuller,
W. T., et al., (1986) Science 234, 1392-1395. The control
oligonucleotide had no effect on antibody binding.
[0148] The tetramer also binds to the V3 loop of gp120 expressed on
cells. Binding of a monoclonal antibody specific for the V3 loop of
gp120 was inhibited by ISIS 5320 at a concentration of
approximately 0.5 .mu.M (K.sub.i) determined using
immunofluorescent flow cytometry (FIG. 18). The control
oligonucleotide had little effect on binding at concentrations up
to 50 .mu.M. Neither oligonucleotide significantly decreased
binding of antibodies directed to human CD44 on the same cells or
to CD4; Healey, D., et al., (1990) J. Exp. Med. 172, 1233-1242. on
CEM-T4 cells.
[0149] Phosphorothioate oligonucleotides of at least 15 nucleotides
are known to be non-sequence-specific inhibitors of HIV. Stein, C.
A., et al., (1991) J. Acquir. Immune Defic. Syndr. 4, 686-693. In
the acute assay system used here, previously tested
phosphorothioate oligonucleotides of 18 to 28 nucleotides in length
have IC.sub.50 values between 0.2 and 4 .mu.M. Vickers, T., et al.,
(1991) Nucleic Acids Res. 19, 3359-3368. Stein and co-workers have
shown that phosphorothioate oligonucleotides of at least 18
nucleotides in length, bind to the V3 loop of gp120 (40), and to
the CD4 receptor and other cell surface antigens. Stein, C. A., et
al., (1991) J. Acquir. Immune Defic. Syndr. 4, 686-693. Variation
in the binding and antiviral activities of long mixed seqence
oligonucleotides likely result from folding into unknown structures
with varying affinities for membrane surface proteins. In contrast,
ISIS 5320 adopts a defined tetrameric structure. The antiviral
activity is 2- to 25-fold better, on a weight basis, than that of
longer linear oligonucleotides.
[0150] ELISA assays were performed to determine whether ISIS 5320
was capable of blocking the interaction between CD4 and gp120 (data
not shown). Addition of increasing amounts of ISIS 5320 decreased
binding of CD4 to immobilized gp120; 50% of binding was inhibited
at a concentration of approximately 2.5 .mu.M. The control
oligonucleotide (.sup.5'TGTGTGTG.sup.3') had no effect on the
CD4/gp120 interaction. These results were confirmed in a
gp120-capture ELISA assay in which the microtiter plates were
coated with CD4 (IC.sub.50 approximately 20 .mu.M). Compounds that
bind to the V3 loop of gp120 can inhibit fusion without completely
blocking the interaction between CD4 and gp120. Callahan, L., et
al., (1991) J. Virol. 65, 1543-1550. Unlike ISIS 5320, dextran
sulfate does not prevent the gp120/CD4 interaction in an ELISA
assay even at concentrations 10,000-fold above its IC.sub.50
Callahan, L., et al., (1991) J. Virol. 65, 1543-1550.
[0151] The tetrameric form of phosphorothioate
T.sub.2G.sub.4T.sub.2 blocks cell-to-cell and virion-to-cell spread
of HIV infection by binding to the gp120 V3 loop. The tetramer
provides a rigid, compact structure with a high thio-anionic charge
density that may be the basis for its strong interaction with the
cationic V3 loop. Although the V3 loop is a hypervariable region,
the functional requirement for cationic residues in the V3 loop may
limit the virus's capability to become resistant to dense
poly-anionic inhibitors. Compounds derived from the G-quartet
structural motif are potential candidates for use in anti-HIV
chemotherapy.
Sequence CWU 0
0
SEQUENCE LISTING <160> NUMBER OF SEQ ID NOS: 146 <210>
SEQ ID NO 1 <211> LENGTH: 21 <212> TYPE: DNA
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Oligomeric Compound <400>
SEQUENCE: 1 cacgaaaggc atgaccgggg c 21 <210> SEQ ID NO 2
<211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Oligomeric Compound <400> SEQUENCE: 2 gaaaggcatg
accggggc 18 <210> SEQ ID NO 3 <211> LENGTH: 15
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Oligomeric
Compound <400> SEQUENCE: 3 aggcatgacc ggggc 15 <210>
SEQ ID NO 4 <211> LENGTH: 12 <212> TYPE: DNA
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Oligomeric Compound <400>
SEQUENCE: 4 catgaccggg gc 12 <210> SEQ ID NO 5 <211>
LENGTH: 19 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Oligomeric Compound <400> SEQUENCE: 5 cacgaaaggc atgaccggg 19
<210> SEQ ID NO 6 <211> LENGTH: 18 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Oligomeric Compound <400>
SEQUENCE: 6 cacgaaaggc atgaccgg 18 <210> SEQ ID NO 7
<211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Oligomeric Compound <400> SEQUENCE: 7 cacgaaaggc
atgac 15 <210> SEQ ID NO 8 <211> LENGTH: 21 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <223> OTHER INFORMATION: Oligomeric Compound
<400> SEQUENCE: 8 catggcggga ctacgggggc c 21 <210> SEQ
ID NO 9 <211> LENGTH: 15 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Oligomeric Compound <400> SEQUENCE: 9
catggcggga ctacg 15 <210> SEQ ID NO 10 <211> LENGTH: 18
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Oligomeric
Compound <400> SEQUENCE: 10 tggcgggact acgggggc 18
<210> SEQ ID NO 11 <211> LENGTH: 15 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Oligomeric Compound <400>
SEQUENCE: 11 ggcgggacta cgggg 15 <210> SEQ ID NO 12
<211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Oligomeric Compound <400> SEQUENCE: 12
accgccaggg gaatccgtca t 21 <210> SEQ ID NO 13 <211>
LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Oligomeric Compound <400> SEQUENCE: 13 gccaggggaa tccgtcat 18
<210> SEQ ID NO 14 <211> LENGTH: 15 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Oligomeric Compound <400>
SEQUENCE: 14 aggggaatcc gtcat 15 <210> SEQ ID NO 15
<211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Oligomeric Compound <400> SEQUENCE: 15
gccaggggaa tccgt 15 <210> SEQ ID NO 16 <211> LENGTH: 21
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Oligomeric
Compound <400> SEQUENCE: 16 catcgccgat gcggggcgat c 21
<210> SEQ ID NO 17 <211> LENGTH: 18 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Oligomeric Compound <400>
SEQUENCE: 17 catcgccgat gcggggcg 18 <210> SEQ ID NO 18
<211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Oligomeric Compound <400> SEQUENCE: 18
catcgccgat cgggg 15 <210> SEQ ID NO 19 <211> LENGTH: 15
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Oligomeric
Compound <400> SEQUENCE: 19 cgccgatgcg gggcg 15 <210>
SEQ ID NO 20 <211> LENGTH: 12 <212> TYPE: DNA
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Oligomeric Compound <400>
SEQUENCE: 20 gccgatgcgg gg 12 <210> SEQ ID NO 21 <211>
LENGTH: 20
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Oligomeric
Compound <400> SEQUENCE: 21 gttggagacc ggggttgggg 20
<210> SEQ ID NO 22 <211> LENGTH: 17 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Oligomeric Compound <400>
SEQUENCE: 22 ggagaccggg gttgggg 17 <210> SEQ ID NO 23
<211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Oligomeric Compound <400> SEQUENCE: 23
gagaccgggg ttgggg 16 <210> SEQ ID NO 24 <211> LENGTH:
15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Oligomeric
Compound <400> SEQUENCE: 24 agaccggggt tgggg 15 <210>
SEQ ID NO 25 <211> LENGTH: 11 <212> TYPE: DNA
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Oligomeric Compound <400>
SEQUENCE: 25 cggggttggg g 11 <210> SEQ ID NO 26 <211>
LENGTH: 10 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Oligomeric Compound <400> SEQUENCE: 26 ggggttgggg 10
<210> SEQ ID NO 27 <211> LENGTH: 17 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Oligomeric Compound <400>
SEQUENCE: 27 gttggagacc ggggttg 17 <210> SEQ ID NO 28
<211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Oligomeric Compound <400> SEQUENCE: 28
cacggggtcg ccgatgaacc 20 <210> SEQ ID NO 29 <211>
LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Oligomeric Compound <400> SEQUENCE: 29 ggggtcgccg atgaacc 17
<210> SEQ ID NO 30 <211> LENGTH: 17 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Oligomeric Compound <400>
SEQUENCE: 30 cacggggtcg ccgatga 17 <210> SEQ ID NO 31
<211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Oligomeric Compound <400> SEQUENCE: 31
cacggggtcg ccgat 15 <210> SEQ ID NO 32 <211> LENGTH: 10
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Oligomeric
Compound <400> SEQUENCE: 32 cacggggtcg 10 <210> SEQ ID
NO 33 <211> LENGTH: 25 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Oligomeric Compound <400> SEQUENCE: 33
ttggggttgg ggttggggtt ggggg 25 <210> SEQ ID NO 34 <400>
SEQUENCE: 34 000 <210> SEQ ID NO 35 <211> LENGTH: 24
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Oligomeric
Compound <400> SEQUENCE: 35 ttggggttgg ggttggggtt gggg 24
<210> SEQ ID NO 36 <211> LENGTH: 22 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Oligomeric Compound <400>
SEQUENCE: 36 ggggttgggg ttggggttgg gg 22 <210> SEQ ID NO 37
<211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Oligomeric Compound <400> SEQUENCE: 37
ttggggttgg ggttggggtt 20 <210> SEQ ID NO 38 <211>
LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Oligomeric Compound <400> SEQUENCE: 38 ttggggttgg ggttgggg 18
<210> SEQ ID NO 39 <211> LENGTH: 16 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Oligomeric Compound <400>
SEQUENCE: 39 ggggttgggg ttgggg 16 <210> SEQ ID NO 40
<211> LENGTH: 14 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Oligomeric Compound <400> SEQUENCE: 40
ttggggttgg ggtt 14 <210> SEQ ID NO 41 <211> LENGTH: 12
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Oligomeric
Compound <400> SEQUENCE: 41 ttggggttgg gg 12 <210> SEQ
ID NO 42 <211> LENGTH: 21 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Oligomeric Compound
<400> SEQUENCE: 42 ggggcggggc ggggcggggc g 21 <210> SEQ
ID NO 43 <400> SEQUENCE: 43 000 <210> SEQ ID NO 44
<400> SEQUENCE: 44 000 <210> SEQ ID NO 45 <400>
SEQUENCE: 45 000 <210> SEQ ID NO 46 <400> SEQUENCE: 46
000 <210> SEQ ID NO 47 <211> LENGTH: 21 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <223> OTHER INFORMATION: Oligomeric Compound
<400> SEQUENCE: 47 gggtgggtat agaagggctc c 21 <210> SEQ
ID NO 48 <211> LENGTH: 18 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Oligomeric Compound <400> SEQUENCE: 48
gggtgggtat agaagggc 18 <210> SEQ ID NO 49 <211> LENGTH:
15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Oligomeric
Compound <400> SEQUENCE: 49 gggtgggtat agaag 15 <210>
SEQ ID NO 50 <211> LENGTH: 12 <212> TYPE: DNA
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Oligomeric Compound <400>
SEQUENCE: 50 gggtgggtat ag 12 <210> SEQ ID NO 51 <211>
LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Oligomeric Compound <400> SEQUENCE: 51 tgggtataga agggctcc 18
<210> SEQ ID NO 52 <211> LENGTH: 15 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Oligomeric Compound <400>
SEQUENCE: 52 gtatagaagg gctcc 15 <210> SEQ ID NO 53
<211> LENGTH: 12 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Oligomeric Compound <400> SEQUENCE: 53
tagaagggct cc 12 <210> SEQ ID NO 54 <400> SEQUENCE: 54
000 <210> SEQ ID NO 55 <400> SEQUENCE: 55 000
<210> SEQ ID NO 56 <400> SEQUENCE: 56 000 <210>
SEQ ID NO 57 <400> SEQUENCE: 57 000 <210> SEQ ID NO 58
<211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Oligomeric Compound <400> SEQUENCE: 58
tctgccccgg ccgtcgctcc c 21 <210> SEQ ID NO 59 <211>
LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Oligomeric Compound <400> SEQUENCE: 59 cagaggactc cagagttgta
t 21 <210> SEQ ID NO 60 <211> LENGTH: 21 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <223> OTHER INFORMATION: Oligomeric Compound
<400> SEQUENCE: 60 ttcatggtaa gagttcttgg g 21 <210> SEQ
ID NO 61 <211> LENGTH: 21 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Oligomeric Compound <400> SEQUENCE: 61
caaagatcat gatcactgcc a 21 <210> SEQ ID NO 62 <211>
LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Oligomeric Compound <400> SEQUENCE: 62 tcccatgggc ctgcagtagg
c 21 <210> SEQ ID NO 63 <211> LENGTH: 21 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <223> OTHER INFORMATION: Oligomeric Compound
<400> SEQUENCE: 63 ggaaggtttc cagggaagag g 21 <210> SEQ
ID NO 64 <211> LENGTH: 21 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Oligomeric Compound <400> SEQUENCE: 64
cctgcagtag gcctggaagg a 21 <210> SEQ ID NO 65 <211>
LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Oligomeric Compound <400> SEQUENCE: 65 gggactcagc aacgaggggt
g 21 <210> SEQ ID NO 66 <211> LENGTH: 21 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <223> OTHER INFORMATION: Oligomeric Compound
<400> SEQUENCE: 66
gtagggaggg agggtatgag a 21 <210> SEQ ID NO 67 <211>
LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Oligomeric Compound <400> SEQUENCE: 67 aaggaacttg gttagggtag
g 21 <210> SEQ ID NO 68 <211> LENGTH: 21 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <223> OTHER INFORMATION: Oligomeric Compound
<400> SEQUENCE: 68 tgggtgaggg atgctttctg c 21 <210> SEQ
ID NO 69 <211> LENGTH: 21 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Oligomeric Compound <400> SEQUENCE: 69
ctgcctggcc tctaggatgg g 21 <210> SEQ ID NO 70 <211>
LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Oligomeric Compound <400> SEQUENCE: 70 atagaagggc tcctgcctgg
c 21 <210> SEQ ID NO 71 <211> LENGTH: 21 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <223> OTHER INFORMATION: Oligomeric Compound
<400> SEQUENCE: 71 tctcattctg ggtgggtata g 21 <210> SEQ
ID NO 72 <211> LENGTH: 21 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Oligomeric Compound <400> SEQUENCE: 72
gctggaaatc tgctggatgt c 21 <210> SEQ ID NO 73 <211>
LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Oligomeric Compound <400> SEQUENCE: 73 gtggaggaga gcagtagaag
g 21 <210> SEQ ID NO 74 <211> LENGTH: 21 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <223> OTHER INFORMATION: Oligomeric Compound
<400> SEQUENCE: 74 tggttaagca cggagttgag g 21 <210> SEQ
ID NO 75 <211> LENGTH: 21 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Oligomeric Compound <400> SEQUENCE: 75
ccggagtaca gcttctttgg t 21 <210> SEQ ID NO 76 <211>
LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Oligomeric Compound <400> SEQUENCE: 76 ttgctttatt cagaagagac
c 21 <210> SEQ ID NO 77 <211> LENGTH: 21 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <223> OTHER INFORMATION: Oligomeric Compound
<400> SEQUENCE: 77 tttttgattt gctaattgct t 21 <210> SEQ
ID NO 78 <211> LENGTH: 21 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Oligomeric Compound <400> SEQUENCE: 78
ggagcccttc tatacccacc c 21 <210> SEQ ID NO 79 <211>
LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Oligomeric Compound <400> SEQUENCE: 79 cacccctcgt tgctgagtcc
c 21 <210> SEQ ID NO 80 <211> LENGTH: 21 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <223> OTHER INFORMATION: Oligomeric Compound
<400> SEQUENCE: 80 tctcataccc tccctcccta c 21 <210> SEQ
ID NO 81 <211> LENGTH: 21 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Oligomeric Compound <400> SEQUENCE: 81
aggtcgagga gtggtctgag c 21 <210> SEQ ID NO 82 <211>
LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Oligomeric Compound <400> SEQUENCE: 82 ccaggagagg tcggtaaggc
g 21 <210> SEQ ID NO 83 <211> LENGTH: 21 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <223> OTHER INFORMATION: Oligomeric Compound
<400> SEQUENCE: 83 gtagggatgg gagtgaagga g 21 <210> SEQ
ID NO 84 <211> LENGTH: 21 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Oligomeric Compound <400> SEQUENCE: 84
tgctcctcct tggtggctct c 21 <210> SEQ ID NO 85 <211>
LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Oligomeric Compound <400> SEQUENCE: 85 ctctgctggg tggtctcaac
t 21 <210> SEQ ID NO 86 <211> LENGTH: 21 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <223> OTHER INFORMATION: Oligomeric Compound
<400> SEQUENCE: 86 ggactggcct agctcctctg c 21 <210> SEQ
ID NO 87 <211> LENGTH: 21 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Oligomeric Compound <400> SEQUENCE: 87
ggtgacaaat gcagatggac t 21 <210> SEQ ID NO 88 <211>
LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Oligomeric Compound <400> SEQUENCE: 88 taggagggtc ttcatggtaa
g 21 <210> SEQ ID NO 89 <211> LENGTH: 21 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <223> OTHER INFORMATION: Oligomeric Compound
<400> SEQUENCE: 89 agctcttacc aaagatcatg a 21 <210> SEQ
ID NO 90 <211> LENGTH: 21 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Oligomeric Compound <400> SEQUENCE: 90
agtaggcctg gaaggaaatt t 21 <210> SEQ ID NO 91 <211>
LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Oligomeric Compound <400> SEQUENCE: 91 tggcctcacc gatccgttgc
a 21 <210> SEQ ID NO 92 <211> LENGTH: 21 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <223> OTHER INFORMATION: Oligomeric Compound
<400> SEQUENCE: 92 acagcagctg tgaggagaca c 21 <210> SEQ
ID NO 93 <211> LENGTH: 21 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Oligomeric Compound <400> SEQUENCE: 93
actcttacca caggtgattc t 21 <210> SEQ ID NO 94 <211>
LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Oligomeric Compound <400> SEQUENCE: 94 aggagtcctg ttttgaaatc
a 21 <210> SEQ ID NO 95 <211> LENGTH: 21 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <223> OTHER INFORMATION: Oligomeric Compound
<400> SEQUENCE: 95 agtgcacgtt gagtatgtga g 21 <210> SEQ
ID NO 96 <211> LENGTH: 21 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Oligomeric Compound <400> SEQUENCE: 96
ctacggcaga gacgagatag c 21 <210> SEQ ID NO 97 <400>
SEQUENCE: 97 000 <210> SEQ ID NO 98 <400> SEQUENCE: 98
000 <210> SEQ ID NO 99 <400> SEQUENCE: 99 000
<210> SEQ ID NO 100 <400> SEQUENCE: 100 000 <210>
SEQ ID NO 101 <400> SEQUENCE: 101 000 <210> SEQ ID NO
102 <211> LENGTH: 15 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Oligomeric Compound <400> SEQUENCE: 102
tgggtataga agggc 15 <210> SEQ ID NO 103 <211> LENGTH:
12 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Oligomeric
Compound <400> SEQUENCE: 103 aggtgggtat ag 12 <210> SEQ
ID NO 104 <211> LENGTH: 12 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Oligomeric Compound <400> SEQUENCE: 104
gggagggtat ag 12 <210> SEQ ID NO 105 <211> LENGTH: 12
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Oligomeric
Compound <400> SEQUENCE: 105 gggcgggtat ag 12 <210> SEQ
ID NO 106 <211> LENGTH: 12 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Oligomeric Compound <400> SEQUENCE: 106
gggtggatat ag 12 <210> SEQ ID NO 107 <211> LENGTH: 12
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Oligomeric
Compound <400> SEQUENCE: 107 gggtgggaat ag 12 <210> SEQ
ID NO 108 <211> LENGTH: 10 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Oligomeric Compound <400> SEQUENCE: 108
gggtgggtat 10 <210> SEQ ID NO 109 <400> SEQUENCE: 109
000 <210> SEQ ID NO 110 <400> SEQUENCE: 110 000
<210> SEQ ID NO 111 <400> SEQUENCE: 111 000
<210> SEQ ID NO 112 <400> SEQUENCE: 112 000 <210>
SEQ ID NO 113 <400> SEQUENCE: 113 000 <210> SEQ ID NO
114 <400> SEQUENCE: 114 000 <210> SEQ ID NO 115
<400> SEQUENCE: 115 000 <210> SEQ ID NO 116 <400>
SEQUENCE: 116 000 <210> SEQ ID NO 117 <400> SEQUENCE:
117 000 <210> SEQ ID NO 118 <400> SEQUENCE: 118 000
<210> SEQ ID NO 119 <400> SEQUENCE: 119 000 <210>
SEQ ID NO 120 <211> LENGTH: 18 <212> TYPE: DNA
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Oligomeric Compound <400>
SEQUENCE: 120 gaggctgagg tgggagga 18 <210> SEQ ID NO 121
<211> LENGTH: 39 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Oligomeric Compound <220> FEATURE: <221>
NAME/KEY: misc_feature <222> LOCATION: 1, 2, 3 <223>
OTHER INFORMATION: n = A,T,C or G <400> SEQUENCE: 121
nnnggggttt tggggttttg gggttttggg gttttgggg 39 <210> SEQ ID NO
122 <211> LENGTH: 21 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Oligomeric Compound <400> SEQUENCE: 122
tgggcacgtg cctgacacgg c 21 <210> SEQ ID NO 123 <211>
LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Oligomeric Compound <400> SEQUENCE: 123 gaggtgggct tcggtggtga
20 <210> SEQ ID NO 124 <211> LENGTH: 20 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <223> OTHER INFORMATION: Oligomeric Compound
<400> SEQUENCE: 124 ggggttgggg aatgaatccc 20 <210> SEQ
ID NO 125 <211> LENGTH: 20 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Oligomeric Compound <400> SEQUENCE: 125
gggttggaga ccggggttgg 20 <210> SEQ ID NO 126 <211>
LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Oligomeric Compound <400> SEQUENCE: 126 ggttggagac cggggttggg
20 <210> SEQ ID NO 127 <211> LENGTH: 20 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <223> OTHER INFORMATION: Oligomeric Compound
<400> SEQUENCE: 127 tggagaccgg ggttggggaa 20 <210> SEQ
ID NO 128 <211> LENGTH: 20 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Oligomeric Compound <400> SEQUENCE: 128
ttggagaccg gggttgggga 20 <210> SEQ ID NO 129 <211>
LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Oligomeric Compound <400> SEQUENCE: 129 gacggtcaag gggagggttg
g 21 <210> SEQ ID NO 130 <211> LENGTH: 20 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <223> OTHER INFORMATION: Oligomeric Compound
<400> SEQUENCE: 130 ggggagaccg aaaccgcaaa 20 <210> SEQ
ID NO 131 <211> LENGTH: 20 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Oligomeric Compound <400> SEQUENCE: 131
cctggatgat gctggggtac 20 <210> SEQ ID NO 132 <211>
LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Oligomeric Compound <400> SEQUENCE: 132 gactggggcg aggtaggggt
20 <210> SEQ ID NO 133 <211> LENGTH: 20 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <223> OTHER INFORMATION: Oligomeric Compound
<400> SEQUENCE: 133 gtcccgactg gggcgaggat 20 <210> SEQ
ID NO 134 <211> LENGTH: 21 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Oligomeric Compound <400> SEQUENCE: 134
gccgaggtcc atgtcgtacg c 21 <210> SEQ ID NO 135 <211>
LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Oligomeric Compound <400> SEQUENCE: 135 cacgaaaggc atgaccgggc
20
<210> SEQ ID NO 136 <211> LENGTH: 20 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Oligomeric Compound <400>
SEQUENCE: 136 cacgaaaggc atgaccgggc 20 <210> SEQ ID NO 137
<211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Oligomeric Compound <400> SEQUENCE: 137
gttggagacc gggttggg 18 <210> SEQ ID NO 138 <211>
LENGTH: 19 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Oligomeric Compound <400> SEQUENCE: 138 gttggagacc gggttgggg
19 <210> SEQ ID NO 139 <211> LENGTH: 19 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <223> OTHER INFORMATION: Oligomeric Compound
<400> SEQUENCE: 139 gttggagacc ggggttggg 19 <210> SEQ
ID NO 140 <211> LENGTH: 19 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Oligomeric Compound <400> SEQUENCE: 140
gttggagacc gggttgggg 19 <210> SEQ ID NO 141 <211>
LENGTH: 19 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Oligomeric Compound <400> SEQUENCE: 141 gttggagacc ggggttggg
19 <210> SEQ ID NO 142 <211> LENGTH: 21 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <223> OTHER INFORMATION: Oligomeric Compound
<400> SEQUENCE: 142 tttttttttt tttggggttt t 21 <210>
SEQ ID NO 143 <211> LENGTH: 12 <212> TYPE: DNA
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Oligomeric Compound <400>
SEQUENCE: 143 ggggttttgg gg 12 <210> SEQ ID NO 144
<211> LENGTH: 10 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Oligomeric Compound <400> SEQUENCE: 144
gggttttggg 10 <210> SEQ ID NO 145 <211> LENGTH: 10
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Oligomeric
Compound <400> SEQUENCE: 145 gggggttttt 10 <210> SEQ ID
NO 146 <211> LENGTH: 21 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Oligomeric Compound <400> SEQUENCE: 146
tttttttttt tttggggggg g 21
* * * * *