U.S. patent application number 10/456423 was filed with the patent office on 2007-01-18 for production of pseudotyped recombinant aav virions.
Invention is credited to Corinna Burger, Barry J. Byrne, Vince A. Chiodo, Terence R. Flotte, William Hauswirth, Scott Loiler, Nicholas Muzyczka, Mark R. Potter, Edgardo Rodriguez, Yoshihisa Sakai, Richard O. Snyder, Irine Zolotukhin, Sergie Zolotukhin.
Application Number | 20070015238 10/456423 |
Document ID | / |
Family ID | 29736112 |
Filed Date | 2007-01-18 |
United States Patent
Application |
20070015238 |
Kind Code |
A1 |
Snyder; Richard O. ; et
al. |
January 18, 2007 |
Production of pseudotyped recombinant AAV virions
Abstract
Vectors that encode Adeno-Associated Virus (AAV) Rep and Cap
proteins of different serotypes and Adenovirus transcription
products that provide helper functions were used to produce
pseudotyped recombinant AAV (rAAV) virions. Purification methods
generated pseudotyped rAAV virion stocks that were 99% pure with
titers of 1.times.10.sup.12-1.times.10.sup.13 vector
genomes/ml.
Inventors: |
Snyder; Richard O.;
(Gainesville, FL) ; Zolotukhin; Sergie;
(Gainesville, FL) ; Sakai; Yoshihisa;
(Gainesville, FL) ; Byrne; Barry J.; (Gainesville,
FL) ; Potter; Mark R.; (Gainesville, FL) ;
Zolotukhin; Irine; (Gainesville, FL) ; Loiler;
Scott; (Gainesville, FL) ; Chiodo; Vince A.;
(Gainesville, FL) ; Muzyczka; Nicholas;
(Gainesville, FL) ; Hauswirth; William;
(Gainesville, FL) ; Flotte; Terence R.; (Alachua,
FL) ; Burger; Corinna; (Gainesville, FL) ;
Rodriguez; Edgardo; (Gainesville, FL) |
Correspondence
Address: |
Akerman Senterfitt
Suite 400
222 Lakeview Avenue
West Palm Beach
FL
33402-3188
US
|
Family ID: |
29736112 |
Appl. No.: |
10/456423 |
Filed: |
June 5, 2003 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
60385864 |
Jun 5, 2002 |
|
|
|
Current U.S.
Class: |
435/69.1 ;
435/235.1; 435/325; 435/456; 977/802 |
Current CPC
Class: |
C12N 15/86 20130101;
C12N 2710/10322 20130101; C12N 2750/14143 20130101; C12N 2840/20
20130101 |
Class at
Publication: |
435/069.1 ;
435/456; 435/235.1; 435/325; 977/802 |
International
Class: |
C12P 21/06 20060101
C12P021/06; C12N 7/00 20060101 C12N007/00; C12N 15/861 20070101
C12N015/861; C12N 5/06 20070101 C12N005/06 |
Goverment Interests
STATEMENT AS TO FEDERALLY SPONSORED RESEARCH
[0002] This invention was made with United States government
support under grant numbers NS36302, HL51811, DK58327, and HL59412
all awarded by the National Institutes of Health. The United States
government may have certain rights in the invention.
Claims
1. A nucleic acid molecule comprising: (A) a first nucleotide
sequence encoding an AAV Rep protein of a first serotype; (B) a
second nucleotide sequence encoding an AAV Cap protein of a second
serotype; the second serotype being different from the first
serotype; and (C) a third nucleotide sequence encoding a
transcription product having at least one Adenoviral helper
function.
2. The nucleic acid molecule of claim 1, wherein the nucleic acid
molecule is comprised within a vector.
3. The nucleic acid molecule of claim 1, wherein the AAV Rep
protein is an AAV serotype 2 protein.
4. The nucleic acid molecule of claim 1, wherein the AAV Rep
protein is Rep52.
5. The nucleic acid molecule of claim 1, wherein the AAV Rep
protein is Rep78.
6. The nucleic acid molecule of claim 4, wherein the first
nucleotide sequence additionally encodes a Rep78 protein.
7. The nucleic acid molecule of claim 1, wherein the AAV Cap
protein is an AAV serotype 1 Cap protein.
8. The nucleic acid molecule of claim 1, wherein the AAV Cap
protein is an AAV serotype 5 Cap protein.
9. The nucleic acid molecule of claim 1, wherein the second
nucleotide sequence encodes an AAV protein selected from the group
consisting of: VP1, VP2, and VP3.
10. The nucleic acid molecule of claim 9, wherein the second
nucleotide sequence encodes VP1, VP2, and VP3.
11. The nucleic acid molecule of claim 1, wherein the transcription
product having at least one Adenoviral helper function is selected
from the group consisting of: Adenovirus DNA binding protein,
Adenovirus E4 protein, and Adenovirus virus associated RNA
molecule.
12. The nucleic acid molecule of claim 2, wherein the nucleic acid
is operably linked to at least one expression control sequence.
13. The nucleic acid molecule of claim 12, wherein the first
nucleotide sequence encoding an AAV Rep protein of a first serotype
is operably linked to a promoter.
14. The nucleic acid molecule of claim 13, wherein the promoter is
selected from the group consisting of: AAV p5 and AAV p19
promoters.
15. The nucleic acid molecule of claim 12, wherein the second
nucleotide sequence encoding an AAV Cap protein of a second
serotype is operably linked to a promoter.
16. The nucleic acid molecule of claim 15, wherein the promoter is
an AAV p40 promoter.
17. The nucleic acid molecule of claim 12, wherein the third
nucleotide sequence encoding a transcription product having at
least one Adenoviral helper function is operably linked to a
promoter.
18. The nucleic acid molecule of claim 1, wherein the nucleic acid
molecule further comprises a selectable marker.
19. The nucleic acid molecule of claim 18, wherein the selectable
marker confers antibiotic resistance to a cell.
20. A cell comprising the nucleic acid molecule of claim 1.
21. The cell of claim 20, wherein the cell is a mammalian cell.
22. The cell of claim 20, further comprising a second nucleic acid
comprising a polynucleotide to be expressed interposed between a
first AAV inverted terminal repeat and a second AAV inverted
terminal repeat.
23. The cell of claim 22, wherein the second nucleic acid is
comprised within a vector.
24. The cell of claim 23, wherein the first AAV inverted terminal
repeat is an AAV serotype 2 inverted terminal repeat.
25. The cell of claim 24, wherein the second AAV inverted terminal
repeat is an AAV serotype 2 inverted terminal repeat.
26. The cell of claim 22, wherein the polynucleotide encodes a
protein.
27. The cell of claim 22, wherein the polynucleotide encodes a
selectable marker.
28. The cell of claim 27, wherein the selectable marker is green
fluorescent protein.
29. A method of producing rAAV virions, the method comprising the
steps of: (a) placing the cell of claim 22 under conditions in
which the nucleic acid of claim 1 is expressed, the second nucleic
acid is replicated, and rAAV virions are produced; and (b)
isolating the rAAV virions produced from the cell.
30. The method of claim 29, wherein the cell is a mammalian
cell.
31. The method of claim 29, wherein the step (a) comprises placing
the cell into a culture medium.
32. The method of claim 31, wherein the step (b) of isolating the
rAAV virions produced from the cell comprises separating the cell
from the medium, lysing the cell to yield a cell lysate, and then
isolating the rAAV virions from the cell lysate.
33. The method of claim 29, wherein the step (b) of isolating the
rAAV virions produced from the cell comprises subjecting the
produced rAAV virions to an iodixanol step gradient.
34. The method of claim 33, further comprising subjecting the
produced rAAV virions to ion exchange chromatography.
35. The method of claim 34, wherein the produced rAAV virions
contain at least one AAV serotype 1 capsid protein.
36. The method of claim 34, wherein the produced rAAV virions
contain at least one AAV serotype 5 capsid protein.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] The present application claims the priority of U.S.
provisional patent application No. 60/385,864 filed on Jun. 5,
2002.
FIELD OF THE INVENTION
[0003] The invention relates to the fields of molecular biology,
gene therapy, microbiology and virology. More particularly, the
invention relates to compositions and methods for producing and
purifying recombinant Adeno-Associated Virus (rAAV) virions.
BACKGROUND OF THE INVENTION
[0004] AAV, a non-pathogenic, helper-dependent virus, is an
attractive vector for gene therapy as it exhibits a wide host and
tissue range and is able to replicate in cells from any species as
long as there is a successful infection of such cells with a
suitable helper virus [e.g., Adenovirus (Ad) or Herpesvirus]. The
host and tissue tropism of AAV is determined by the ability of its
capsid to bind to specific cellular receptors and/or co-receptors.
Due to the broad host and tissue range, however, delivery of
conventional AAV preferentially to a particular tissue of interest
has been problematic.
[0005] AAV of several different serotypes are known. Of these,
serotype 2 AAV has been the most extensively studied and
characterized. Accordingly, serotype 2 rAAV vectors (i.e., nucleic
acid constructs) and virions (i.e., encapsidated vectors) have been
proposed as the vector of choice for gene transfer protocols.
Animal experiments, however, have shown that dramatic differences
exist in the transduction efficiency and cell specificity of rAAV
virions of different serotypes (Chao et al., Mol. Ther. 2:619-623,
2000; Davidson et al., PNAS 97:3428-3432, 2000; and Rabinowitz et
al., J. Virol. 76:791-801, 2002). For example, non-serotype 2 AAV
virions were able to transduce certain tissues more efficiently and
specifically than serotype 2 virions. Accordingly, an AAV virion
including a well-characterized serotype 2 genome and a non-serotype
2 capsid would be useful for certain tissue-specific gene transfer
applications. Methods that facilitate preparing such pseudotyped
AAV virions would also be useful. Current methods involve the use
of multiple vectors to provide the replication, packaging, and
helper functions that are required for the formation of recombinant
virions. These methods are inefficient and inadequate for
large-scale production of pseudotyped recombinant virions.
SUMMARY
[0006] The invention relates to the development of reagents and
methods for producing purified AAV2 vectors pseudotyped with a
non-serotype 2 AAV capsid. AAV helper vectors were constructed for
pseudotyping AAV serotype 2 DNA with capsids from AAV serotypes 1
and 5. These helper vectors encode AAV gene products necessary for
AAV virion production (i.e., Rep and Cap proteins), as well as
transcription products having Ad helper function. To pseudotype AAV
serotype 2 DNA with an AAV1 capsid, a helper vector encoding a
serotype 2 Rep protein and a serotype 1 Cap protein was used.
Similarly, a helper vector useful for pseudotyping AAV serotype 2
DNA with an AAV5 capsid encodes a serotype 2 Rep protein and a
serotype 5 Cap protein. To purify pseudotyped virions, methods were
developed that result in highly purified and concentrated virion
stocks. These methods involve applying a virus-containing sample to
an iodixanol gradient centrifugation step followed by a
chromatography step. The helper vectors and purification methods
described herein provide for efficient, large-scale production of
pseudotyped virions without the need for multiple helper vectors.
The resultant pseudotyped virions can be used in numerous gene
therapy applications.
[0007] Accordingly, the invention features a nucleic acid molecule
including a first nucleotide sequence encoding an AAV Rep protein
of a first serotype, a second nucleotide sequence encoding an AAV
Cap protein of a second serotype, the second serotype being
different from the first serotype, and a third nucleotide sequence
encoding a transcription product having at least one Adenoviral
helper function. The nucleic acid molecule can be within a
vector.
[0008] The AAV Rep protein can be an AAV serotype 2 protein. The
AAV serotype 2 Rep protein can be a Rep52 protein and/or a Rep78
protein. Both Rep52 and Rep78 proteins can be encoded by the first
nucleotide sequence.
[0009] The AAV Cap protein can be an AAV serotype 1 protein and/or
an AAV serotype 5 Cap protein. The second nucleotide sequence
encoding an AAV Cap protein can encode an AAV protein such as VP1,
VP2, or VP3. The second nucleotide sequence can encode all three
AAV Cap proteins VP1, VP2, and VP3. The transcription product
having at least one Adenoviral helper function can be Adenovirus
DNA binding protein, Adenovirus E4 protein, as well as Adenovirus
virus associated RNA molecule.
[0010] The nucleic acid can be operably linked to at least one
expression control sequence. The first nucleotide sequence encoding
an AAV Rep protein of a first serotype can be operably linked to a
promoter. Examples of promoters include AAV p5 and AAV p19
promoters. The second nucleotide sequence encoding an AAV Cap
protein of a second serotype can also be operably linked to a
promoter, such as an AAV p40 promoter. The third nucleotide
sequence encoding a transcription product having at least one
Adenoviral helper function can further be operably linked to a
promoter. The nucleic acid molecule can further include a
selectable marker such as a selectable marker that confers
antibiotic resistance to a cell.
[0011] In another aspect, the invention features a cell including a
nucleic acid molecule that includes a first nucleotide sequence
encoding an AAV Rep protein of a first serotype, a second
nucleotide sequence encoding an AAV Cap protein of a second
serotype, the second serotype being different from the first
serotype, and a third nucleotide sequence encoding a transcription
product having at least one Adenoviral helper function. The cell
can be a mammalian cell. The cell can further include a second
nucleic acid that includes a polynucleotide (to be expressed)
interposed between a first AAV inverted terminal repeat and a
second AAV inverted terminal repeat. The second nucleic acid can be
within a vector. The first and second AAV inverted terminal repeats
can be AAV serotype 2 inverted terminal repeats. The polynucleotide
can encode a protein or a selectable marker such as green
fluorescent protein.
[0012] In still another aspect, the invention features a method of
producing rAAV virions. The method includes the steps of placing a
cell having: 1) a nucleic acid molecule that includes a first
nucleotide sequence encoding an AAV Rep protein of a first
serotype, a second nucleotide sequence encoding an AAV Cap protein
of a second serotype, the second serotype being different from the
first serotype, and a third nucleotide sequence encoding a
transcription product having at least one Adenoviral helper
function and 2) a nucleic acid having a polynucleotide to be
expressed interposed between a first AAV inverted terminal repeat
and a second AAV inverted terminal repeat under conditions in which
the first nucleic acid molecule is expressed, the second nucleic
acid molecule is replicated, and rAAV virions are produced, and
isolating the rAAV virions produced from the cell. The cell can be
a mammalian cell. The step of placing the cell under conditions in
which the first nucleic acid molecule is expressed and the second
nucleic acid molecule is replicated includes placing the cell into
a culture medium. The step of isolating the rAAV virions produced
from the cell includes separating the cell from the medium, lysing
the cell to yield a cell lysate, and then isolating the rAAV
virions from the cell lysate. This step can also include subjecting
the produced rAAV virions to an iodixanol step gradient and can
further include subjecting the produced rAAV virions to ion
exchange chromatography. The produced rAAV virions can contain at
least one AAV serotype 1 capsid protein or at least one AAV
serotype 5 capsid protein.
[0013] Unless otherwise defined, all technical terms used herein
have the same meaning as commonly understood by one of ordinary
skill in the art to which this invention belongs. Commonly
understood definitions of molecular biology terms can be found in
Rieger et al., Glossary of Genetics: Classical and Molecular, 5th
edition, Springer-Verlag: New York, 1991; and Lewin, Genes V,
Oxford University Press: New York, 1994. Commonly understood
definitions of virology terms can be found in Granoff and Webster,
Encyclopedia of Virology, 2nd edition, Academic Press: San Diego,
Calif., 1999; and Tidona and Darai, The Springer Index of Viruses,
1 st edition, Springer-Verlag: New York, 2002. Commonly understood
definitions of microbiology can be found in Singleton and
Sainsbury, Dictionary of Microbiology and Molecular Biology, 3rd
edition, John Wiley & Sons: New York, 2002.
[0014] By the term "gene" is meant a nucleic acid molecule that
codes for a particular protein, or in certain cases a functional or
structural RNA molecule.
[0015] As used herein, a "nucleic acid," "nucleic acid molecule,"
or "polynucleotide" means a chain of two or more nucleotides such
as RNA (ribonucleic acid) and DNA (deoxyribonucleic acid).
[0016] As used herein, "protein" or "polypeptide" are used
synonymously to mean any peptide-linked chain of amino acids,
regardless of length or post-translational modification, e.g.,
glycosylation or phosphorylation.
[0017] When referring to a nucleic acid molecule or polypeptide,
the term "native" refers to a naturally-occurring (e.g., a
wild-type; "WT") nucleic acid or polypeptide.
[0018] By the term "Rep protein" is meant a polypeptide having at
least one functional activity of a native AAV Rep protein (e.g.,
Rep 40, 52, 68, 78). By the term "Cap protein" is meant a
polypeptide having at least one functional activity of a native AAV
Cap protein (e.g., VP1, VP2, VP3). A "functional activity" of a
protein is any activity associated with the physiological function
of the protein. For example, functional activities of Rep proteins
(e.g., Rep 40, 52, 68, 78) include facilitating replication of DNA
through recognition, binding and nicking of the AAV origin of DNA
replication as well as DNA helicase activity. Additional functions
include modulation of transcription from AAV (or other
heterologous) promoters and site-specific integration of AAV DNA
into a host chromosome. Examples of functional activities of Cap
proteins (e.g., VP1, VP2, VP3) include the ability to induce
formation of a capsid, facilitate accumulation of single-stranded
DNA, facilitate AAV DNA packaging into capsids (i.e.,
encapsidation), bind to cellular receptors, and facilitate entry of
the virion into host cells.
[0019] As used herein, the term "vector" refers to a nucleic acid
molecule capable of transporting another nucleic acid to which it
has been linked. Vectors capable of directing the expression of
genes to which they are operatively linked are referred to herein
as "expression vectors."
[0020] A first nucleic acid sequence is "operably" linked with a
second nucleic acid sequence when the first nucleic acid sequence
is placed in a functional relationship with the second nucleic acid
sequence. For instance, a promoter is operably linked to a coding
sequence if the promoter affects the transcription or expression of
the coding sequence. Generally, operably linked nucleic acid
sequences are contiguous and, where necessary to join two protein
coding regions, in reading frame.
[0021] As used herein, the phrase "expression control sequence"
refers to a nucleic acid that regulates the replication,
transcription and translation of a coding sequence in a recipient
cell. Examples of expression control sequences include promoter
sequences, polyadenylation (pA) signals, introns, transcription
termination sequences, enhancers, upstream regulatory domains,
origins of replication, and internal ribosome entry sites ("IRES").
The term "promoter" is used herein to refer to a DNA regulatory
sequence to which RNA polymerase binds, initiating transcription of
a downstream (3' direction) coding sequence.
[0022] By the term "pseudotyped" is meant a nucleic acid or genome
derived from a first AAV serotype that is encapsidated or packaged
by an AAV capsid containing at least one AAV Cap protein of a
second serotype (i.e., one different from the first AAV
serotype).
[0023] By "AAV inverted terminal repeats", "AAV terminal repeats",
"ITRs", and "TRs" are meant those sequences required in cis for
replication and packaging of the AAV virion including any fragments
or derivatives of an ITR which retain activity of a full-length or
WT ITR.
[0024] As used herein, the terms "rAAV vector" and "recombinant AAV
vector" refer to a recombinant nucleic acid derived from an AAV
serotype, including without limitation, AAV1, AAV2, AAV3, AAV4,
AAV5, AAV6, AAV7, etc. rAAV vectors can have one or more of the AAV
WT genes deleted in whole or in part, preferably the rep and/or cap
genes, but retain functional flanking ITR sequences. A "recombinant
AAV virion" or "rAAV virion" is defined herein as an infectious,
replication-defective virus composed of an AAV protein shell
encapsulating a heterologous nucleotide sequence that is flanked on
both sides by AAV ITRs.
[0025] By the term "rAAV1" is meant a rAAV virion having at least
one AAV serotype 1 capsid protein. Similarly, by the term "rAAV5"
is meant a rAAV virion having at least one AAV serotype 5 capsid
protein.
[0026] Although methods and materials similar or equivalent to
those described herein can be used in the practice or testing of
the present invention, suitable methods and materials are described
below. All publications, patent applications, patents and other
references mentioned herein are incorporated by reference in their
entirety. In the case of conflict, the present specification,
including definitions will control. The particular embodiments
discussed below are illustrative only and not intended to be
limiting.
BRIEF DESCRIPTION OF THE DRAWINGS
[0027] FIG. 1 is two plasmid maps (top:pXYZ1, bottom: pXYZ5).
[0028] FIG. 2 is a schematic illustration of purification schemes
for rAAV1, 2, and 5 virions.
[0029] FIGS. 3A and B are chromatograms of rAAV virions purified by
anion exchange and hydroxyapatite chromatography.
[0030] FIGS. 4A, B, and C are gels characterizing rAAV virion
stocks. A. Silver-stained sodium dodecyl sulfate polyacrylamide gel
electrophoresis (SDS-PAGE) gel of rAAV1, 2, and 5 virion stocks (10
ul per lane). The titers of rAAV stocks are shown below each lane.
B. Western blot analysis of rAAV1 and 2 virion stocks (10 ul per
lane). C. Profile of anion exchange chromatography of an AAV5 virus
(10 ul of each fraction per lane). Load is the iodixanol gradient
purified material that was applied to the column; FT is the flow
through, 1-5 are fractions eluted from the column. Monoclonal
antibody B1 was used to detect AAV capsid proteins in Panels B and
C.
[0031] FIGS. 5A and B are infectious center and dot blot assays. A.
The infectious center assay was performed on a rAAV2-GFP stock
using a green fluorescent protein (GFP) probe. The values of the
rAAV ten-fold dilution series is shown on the left side. The
calculated infectious titer is shown below the blot. B. The dot
blot assay was performed on the same rAAV2-GFP vector stock.
Amounts (ng) of the relevant rAAV plasmid used to construct a
two-fold standard curve are shown on the right side. The calculated
titer (vector genome (vg)/ml) is shown below the blot. The
particle:infectivity (P:I) ratio for this preparation is 20.5.
DETAILED DESCRIPTION
[0032] The invention provides methods and compositions for
producing pseudotyped AAV virions. In the examples described below,
purified pseudotyped rAAV virions were produced in large quantities
by introducing into host cells both (1) a first nucleic acid
construct that contains AAV ITRs of a first AAV serotype, and
encodes an exogenous nucleic acid (i.e., polynucleotide to be
expressed in a cell infected with the virions produced); and (2) a
second nucleic acid construct that encodes Ad transcription
products having Ad helper function, Rep proteins of the first
serotype, and Cap proteins of a second serotype.
[0033] In the first nucleic acid construct, the exogenous nucleic
acid is located between two AAV ITRs that are the minimal
cis-acting AAV sequences that direct replication and packaging of
an AAV genome as well as an rAAV vector. The second nucleic acid
construct has sequences that encode (1) at least one AAV Cap
protein of a first serotype, (2) at least one AAV Rep protein of a
second serotype (i.e., serotype of the rAAV vector to be
encapsidated), and (3) at least one transcription product having Ad
helper function.
[0034] The first and second nucleic acids are introduced into host
cells, which are then cultured under appropriate conditions to
allow the host cells to replicate. During this phase, the portion
of the first nucleic acid construct containing the two AAV ITRs and
exogenous nucleic acid (i.e., rAAV vector) is replicated, resulting
in the generation of many rAAV vectors; the second nucleic acid
construct is expressed, resulting in the production of
transcription products having Ad helper function as well as Rep and
Cap proteins. Ad proteins such as E2A and E4, as well as Ad VA RNA
provide helper functions that facilitate a productive AAV
infection. Rep proteins (e.g., Rep40, Rep52, Rep68, Rep78) are
essential for rAAV vector replication, while the Cap (e.g., VP1,
VP2, VP3) proteins are structural proteins that are required for
formation of the virion capsid. As a result of expressing capsid
proteins in the presence of the replicated vectors, the replicated
rAAV vectors of a first serotype (e.g., serotype 2) are packaged
into infectious rAAV virions (i.e., an infectious virus particle
containing an rAAV vector) containing cap proteins of a second
serotype (e.g., serotypes 1, 5).
[0035] The below described preferred embodiments illustrate
adaptations of these compositions and methods. Nonetheless, from
the description of these embodiments, other aspects of the
invention can be made and/or practiced based on the description
provided below.
Biological Methods
[0036] Methods involving conventional molecular biology techniques
are described herein. Such techniques are generally known in the
art and are described in detail in methodology treatises such as
Molecular Cloning, 3rd edition, Sambrook and Russell, Cold Spring
Harbor Press, 2001; and Current Protocols in Molecular Biology, ed.
Ausubel et al., Greene Publishing and Wiley-Interscience, New York,
1992 (with periodic updates). Methods for chemical synthesis of
nucleic acids are discussed, for example, in Beaucage and
Carruthers, Tetra. Letts. 22:1859-1862, 1981, and Matteucci et al.,
J. Am. Chem. Soc. 103:3185, 1981. Nucleic Acid Constructs That
Encode An Exogenous Nucleic Acid And Nucleic Acids That Encode Rep
Proteins, Cap Proteins, and Transcription Products Having Ad Helper
Function
[0037] The first nucleic acid construct described above includes an
exogenous nucleic acid and also contains other sequences that
facilitates expression of the exogenous nucleic acid in a host
cell. An exogenous nucleic acid is a nucleic acid that is not
native to AAV. The exogenous nucleic acid is inserted into the
construct in such a way that the nucleic acid is expressed. For
example, the nucleic acid is placed within a construct (e.g.,
vector) at a particular location such that: (1) it is between two
functional AAV ITRs of a particular serotype, (2) it is operatively
linked with a promoter and (3) it is placed 5' to a pA tail.
[0038] The exogenous nucleic acid can be any nucleic acid that is
desired to be included in the rAAV to be produced so long as it
does not exceed the number of nucleotides that can be encapsulated
within a rAAV virion (i.e., approximately 5 kilobases). Typical
examples of such nucleic acids include those that encode a protein
or an RNA. Proteins might, for example, be those that exert a
therapeutic effect on a diseased cell (e.g., a human or non-human
cell). Genes that can be delivered by rAAV to exert a therapeutic
effect include alpha-one antitrypsin, clotting factor IX, clotting
factor VIII, clotting factor VII, dystrophin, .alpha.-,.beta.-,
.delta.-, .epsilon.-sarcoglycans, tyrosine hydroxylase, aromatic
acid decarboxylase, GTP cyclohydrolasel, erythropoietin,
aspartoacylase (ASPA), Nerve growth factor (NGF), lysosomal
beta-glucuronidase (GUSB), insulin, alpha-synuclein, basic
fibroblast growth factor (FGF-2), IGF1, alpha-galactosidase A
(alpha-gal A), neurotrophin-3, Neuroglobin (Ngb), angoigenic
proteins (vascular endothelial growth factor (VEGF165)),
anti-angiogenic proteins, and any cytokines, including interferons
(IFN-.alpha., IFN-.beta., IFN-.gamma.), interleukins, GM-CSF
(granulocyte-macrophage colony-stimulating factor), M-CSF
(macrophage colony-stimulating factor), tumor necrosis factors,
growth factors (TGF-.beta. (transforming growth factor-.beta.),
IL-10, IL-13, IL-4, and PDGF (platelet-derived growth factor)) or
neurotrophic factors CNTF (ciliary Neurotrophic factor),
brain-derived neurotrophic factor (BDNF), and GDNF (glial cell line
derived neurotrophic factor). Alternatively, proteins might be
those that act as reporters or markers of gene expression (e.g.,
GFP, .beta.-galactosidase, luciferase). RNA may be anti-sense,
RNAi, and ribozymes.
[0039] The second nucleic acid construct encodes transcription
products having Ad helper function and AAV proteins that facilitate
pseudotyping of an rAAV vector. Such a nucleic acid construct
encodes: 1) at least one AAV Cap protein of a first serotype, 2) at
least one AAV Rep protein of a second serotype (i.e., serotype of
the rAAV vector to be encapsidated), and 3) at least one
transcription product having Ad helper function. A nucleic acid
encoding a Rep and/or Cap protein and transcription product having
Ad helper function is inserted into the second nucleic acid
construct in such a way that the nucleic acid is expressed. For
example, the nucleic acid is placed within a construct (e.g.,
vector) at a particular location such that: (1) it is operatively
linked with a promoter and (2) it is placed 5' to a pA tail.
[0040] A nucleic acid encoding a Cap protein is any nucleic acid
that encodes at least one functional Cap protein or functional
derivative thereof. The AAV cap gene encodes three capsid proteins:
VP1, VP2 and VP3, and any one or combination of these three
proteins may be expressed by a nucleic acid of the invention. A
nucleic acid encoding a Rep protein is any nucleic acid that
encodes at least one functional Rep protein or functional
derivative thereof. Any one or combination of the four AAV Rep
proteins Rep40, Rep52, Rep68, and Rep78, may be expressed by a
nucleic acid of the invention. The rep and cap genes used in
methods of the invention can be mutant or non-naturally occurring
versions of AAV rep and cap genes. For example, nucleic acids
encoding Rep and Cap proteins useful in the invention may be hybrid
sequences containing portions of rep and cap genes from different
serotypes. Furthermore, rep and cap genes used in compositions and
methods of the invention may include engineered as well as
naturally-occurring rep and cap mutants. A preferred rep gene
according to the invention is a serotype 2 rep gene, while a
preferred cap gene is a serotype 1 or 5 cap gene. A nucleic acid
encoding a transcription product having Ad helper function is any
nucleic acid that encodes at least one protein or RNA molecule
having Ad helper function. Ad gene products that are known to
provide Ad helper function include E1a, E1b, E2a, E4 (e.g., E4
orf6) and VA RNA. Such nucleic acids can be mutant or non-naturally
occurring versions of Ad nucleotide sequences. Mutants include
those that are engineered as well as those that are
naturally-occurring.
[0041] In the experiments described below, vectors for pseudotyping
rAAV virions (e.g., AAV helper plasmids) are constructed by
combining the ORF coding for AAV Rep proteins of a first serotype
and the ORF coding for capsid proteins of serotypes different from
the first (FIG. 1). To generate a rAAV2 vector pseudotyped with an
AAV1 capsid, for example, a helper plasmid such as pACG2R1C is
constructed by substituting the AAV1 cap ORF for AAV2 cap ORF in
pACG2 (Li et al., J. Virol. 71:5236-5243, 1997). Similarly, to
generate a rAAV2 vector pseudotyped with an AAV5 capsid, a helper
plasmid such as pACG2R5C can be constructed. Rep2cap 1 and rep2cap5
helper sequences resulting from these constucts can be subcloned
into an Ad helper plasmid, pXYZ, constructed from pAdEasy
(Stratagene). To construct pXYZ, several Ad genes (penton, core
protein, hexon, and Ad DNA polymerase) are disrupted and the left
hand end of the Ad genome is removed to eliminate the possibility
of generating infectious Ad and Ad structural proteins (some of
which are cytotoxic). The resultant plasmids pXYZ1 (26,256 bp) and
pXYZ5 (26,147 bp) (FIG. 1) encode the AAV proteins and Ad
transcription products required to pseudotype AAV2-ITR-containing
nucleic acids into AAV1 and AAV5 capsids. Both plasmids contain the
Ad VA, E2A and E4 genes under the transcriptional control of their
native promoters. Both plasmid backbones also encode for ampicillin
resistance. Additionally, rAAV vectors pseudotyped with AAV1 and
AAV5 capsids can be generated using plasmids pACG2R1C and pACG2R5C,
respectively, with plasmids pXX6 and pXYZ. See Xiao et al., J.
Virol. 72:2224-2232, 1998.
[0042] Alternatively, the AAV and Ad transcription products can be
expressed by more than one vector. For example, cells can be
cotransfected with a first vector expressing the AAV genes and a
second vector expressing transcription products. In another
example, the AAV proteins and Ad transcription products can be
expressed by three different vectors. In this method, cells are
transfected with the three vectors expressing the AAV proteins and
Ad transcription products. In some applications, cells can be
transfected with more than one vector expressing the AAV and Ad
genes and a rAAV vector.
[0043] In preferred applications, the exogenous nucleic acid and
the nucleic acids encoding Rep, Cap and transcription products
having Ad helper function are operably linked to one or more
expression control sequences that facilitate gene expression in
host cells. Generally, operably linked nucleic acid sequences are
contiguous and, where necessary to join two protein coding regions,
in reading frame. Examples of expression control sequences include
promoters, insulators, response elements, introns, IRESs,
silencers, enhancers, introns, initiation sites, termination
signals, and pA tails. Within the invention, any expression control
sequence that facilitates gene expression in the host cell may be
used. Such control elements can include control sequences normally
associated with the selected exogenous nucleic acid or nucleic
acids encoding Rep and Cap. Alternatively, heterologous control
sequences can be employed.
[0044] To achieve appropriate levels of AAV proteins and Ad
transcription products, any of a number of promoters suitable for
use in the selected host cell may be employed. For example,
constitutive promoters of different strengths can be used to
express the different AAV proteins. Inducible promoters may also be
used in compositions and methods of the invention. To achieve
regulated expression of AAV proteins, the AAV p5 and p19 promoters
are preferred. Other promoters for use in the invention include
both non-viral and viral promoters. Non-viral promoters that may be
used include .beta.-actin and Factor IX promoters. Examples of
viral promoters include cytomegalovirus immediate early promoter
(CMV), simian virus 40 (SV40) late promoter, Mouse Mammary Tumor
Virus (MMTV) promoter (Grimm et al., Hum. Gene Ther. 9:2745-2760,
1998) and Ad E1A promoter.
[0045] In some applications, vectors of the invention contain a
selectable marker gene used to identify cells that contain the
vector. Suitable selectable marker genes for use in the invention
include genes encoding enzymes that produce antibiotic resistance
(e.g., those conferring resistance to ampicillin, penicillin,
kanamycin, hygromycin, G418, or streptomycin), as well as those
that encode enzymes that result in a colorimetric or fluorescent
signal (e.g., green fluorescent protein, .beta.-galactosidase).
Cells Containing Nucleic Acid Molecules of the Invention
[0046] The invention provides a cell containing a nucleic acid
molecule having a nucleotide sequence encoding an AAV Rep protein
of a first serotype, a nucleotide sequence encoding an AAV Cap
protein of a second serotype, and a nucleotide sequence encoding a
transcription product having at least one Ad helper function. A
cell according to the invention is any cell in which the nucleotide
sequences can be expressed resulting in expression products (e.g.,
polypeptides, RNA molecules). Cells of the invention may be
non-mammalian cells (e.g., microorganisms, yeast cells, insect
cells) or mammalian cells (e.g., human cells). A cell according to
the invention can further contain a second nucleic acid molecule
containing a polynucleotide to be expressed interposed between two
AAV ITRs. Typically, both nucleic acid molecules are present within
a vector (e.g., plasmid). Preferred cells are those in which
pseudotyped virions are formed based on the presence of the two
nucleic acid molecules. Examples of useful cells for expressing
nucleotide sequences resulting in the formation of pseudotyped rAAV
virions include 293 (Graham et al., J. Gen. Virol. 36:59-72, 1977),
HeLa (Bantel-Schaal et al., J. Virol. 73:939-947, 1984), and KB
(Srivastava, A. Intervirology 27:138-147, 1987) cells.
Ad Helper Function
[0047] The invention encompasses nucleotide sequences encoding
transcription products (e.g., polypeptides, RNA) having at least
one Ad helper function. AAV is a helper-dependent virus, and as
such, it requires co-infection with a helper virus such as Ad or
cotransfection of helper virus DNA for a productive infection. See
Ward and Berns, J. Virol., 70:4495, 1996. Nucleotide sequences
encoding transcription products having Ad helper function utilized
in the present invention may be derived from any of a number of Ad
serotypes that facilitate AAV infection. For example, sequences
derived from Ad serotype 5 (Ad5) can be used. Preferably,
nucleotide sequences encoding transcription products having Ad
helper function reside in plasmids pXYZ1 and pXYZ5 for the
generation of pseudotyped rAAV virions.
AAV Serotypes
[0048] rAAV vectors and virions useful in the invention include
those derived from a number of AAV serotypes, including 1, 2, 3, 4,
5, 6, and 7. Because of wide construct availability and extensive
characterization, preferred rAAV vectors for use in the invention
are those derived from serotype 2 (or mutants thereof). In methods
of encapsidating rAAV2 vector contructs, use of serotype 2 Rep
proteins is preferred. Because of tissue tropisms and purification
methods described herein, preferred AAV Cap proteins are those
derived from serotypes 1 and 5. Construction and use of AAV vectors
and AAV proteins of different serotypes are discussed in Chao et
al., Mol. Ther. 2:619-623, 2000; Davidson et al., PNAS
97:3428-3432, 2000; Xiao et al., J. Virol. 72:2224-2232, 1998;
Halbert et al., J. Virol. 74:1524-1532, 2000; Halbert et al., J.
Virol. 75:6615-6624, 2001; and Auricchio et al., Hum. Molec. Genet.
10:3075-3081, 2001.
[0049] The invention also relates to the production of pseudotyped
rAAV virions that have mutations within the virion capsid. For
example, suitable AAV mutants may have ligand insertion mutations
for the facilitation of targeting AAV to specific cell types. The
construction and characterization of AAV capsid mutants including
insertion mutants, alanine screening mutants, and epitope tag
mutants is described in Wu et al., (J. Virol. 74:8635-45, 2000).
Other rAAV virions that can be generated in methods of the
invention include those capsid hybrids that are generated by
molecular breeding of viruses as well as by exon shuffling. See
Soong et al., Nat. Genet. 25:436-439, 2000; and Kolman and Stemmer
Nat. Biotechnol. 19:423-428, 2001.
Producing Pseudotyped rAAV Virions
[0050] The nucleic acid molecules of the invention are useful in
methods of producing pseudotyped rAAV virions. In a method of
producing rAAV virions, a cell containing two nucleic acid
molecules, the first nucleic acid molecule having a nucleotide
sequence encoding an AAV Rep protein of a first serotype, a
nucleotide sequence encoding an AAV Cap protein of a second
serotype, and a nucleotide sequence encoding a transcription
product having at least one Ad helper function, the second nucleic
acid molecule having an exogenous nucleic acid interposed between
two AAV ITRs, is placed in in vitro conditions. These in vitro
conditions are such that the first nucleic acid molecule is
expressed, the second nucleic acid molecule is replicated, and rAAV
virions are produced. Placing the cell in in vitro conditions
includes placing the cell into a culture medium (e.g., DMEM
supplemented with fetal bovine serum and antibiotics) in a
humidified incubator (e.g., 5% CO.sub.2) at a suitable temperature
(e.g., 37.degree.). In the second step of this method, the rAAV
virions produced in the cell are isolated. To isolate produced rAAV
virions, the cell is separated from the medium, the cell is then
lysed to yield a cell lysate, and the virions are isolated from the
cell lysate. To separate the rAAV virions from the cell lysate, the
rAAV virions are subjected to a density gradient separation step,
such as an iodixanol step gradient. The virions can be further
isolated (e.g., purified) by subjecting the virions to an
additional purification step such as an ion exchange (e.g., anion
exchange) chromatography step. Typically, a cell used in the method
is a mammalian cell (e.g., 293 cells). In some applications, the
rAAV virions produced contain at least one AAV serotype 1 capsid
protein. In other applications, the rAAV virions produced contain
at least one AAV serotype 5 capsid protein.
[0051] To generate cells containing the nucleic acids described
above, the nucleic acids are introduced into the cells. To
introduce nucleic acid molecules into a suitable host cell, a
number of known transfection techniques may be used. See, e.g.,
Graham et al., (Virology 52:456, 1973), Sambrook et al., supra, Chu
et al., (Gene 13:197, 1981). Particularly suitable transfection
methods include calcium phosphate co-precipitation (Graham et al.,
Virol. 52:456-467, 1973), direct micro-injection into cultured
cells (Capecchi, M. R. Cell 22:479-488, 1980), electroporation
(Shigekawa et al., BioTechniques 6:742-751, 1988), liposome
mediated gene transfer (Mannino et al., BioTechniques 6:682-690,
1988), lipid-mediated transduction (Felgner et al., PNAS
84:7413-7417, 1987), and nucleic acid delivery using high-velocity
microprojectiles (Klein et al., Nature 327:70-73, 1987).
Purification of rAAV Virions
[0052] The invention provides methods for purifying pseudotyped
rAAV virions. Methods of the invention involve applying a
virus-containing sample to one or more purification steps,
including density gradient separation and chromatography. An
example of a method for purifying rAAV virions includes several
steps. First, a plurality of cells infected with rAAV virions is
provided. From these infected cells, rAAV virions are collected.
These virions are then subjected to a density gradient separation
step such as one using an iodixanol gradient. A typical iodixanol
step gradient contains a 15% iodixanol step, a 25% iodixanol step,
a 40% iodixanol step, and a 60% iodixanol step. The iodixanol step
can further include 1M NaCl. The virion-containing iodixanol step
is centrifuged, and the resultant virion-containing sample is
collected from the iodixanol gradient step. This sample is then
subjected to a chromatography step, such as an ion exchange or
hydroxyapatite chromatography step. Purification methods of the
invention are particularly useful for purifying virions having
capsids containing proteins from AAV serotypes 1 and 5 because
these serotypes do not bind to heparin columns. To purify rAAV 1
and rAAV5 virions, purification protocols are employed that use
iodixanol density gradient centrifugation followed by anion
exchange or hydroxyapatite chromatography. Iodixanol is an
iodinated density gradient media originally produced as an X-ray
contrast compound for injection into humans. Unlike the
hyper-osmotic inorganic salt (CsCl) and sucrose gradients commonly
used for fractionating macromolecules, iodixanol solutions can be
made iso-osmotic at all densities. This property makes iodixanol an
ideal media for analysis and downstream purification steps. In
addition, iodixanol has the capacity to separate free capsid
proteins and empty capsids from vector genome-containing (full)
capsids. Although the use of iodixanol is preferred in the
invention, other suitable density gradient media might be
substituted.
[0053] Following density gradient centrifugation, rAAV vectors are
purified by column chromatography. Any chromatography method that
allows purification of rAAV virions may be used. For example, ion
exchange chromatography can be used. Ion exchange chromatography is
a method that relies on charge interactions between the protein of
interest and the ion exchange matrix, which is generally composed
of resins, such as agarose, dextran, and cross-linked cellulose and
agarose, that are covalently bound to a charged group. Charged
groups are classified according to type (cationic and anionic) and
strength (strong or weak). Ion exchange chromatographic techniques
generally take place in several steps: equilibration of the column
to pH and ionic conditions ideal for target protein binding,
reversible adsorption of the sample to the column through
counterion displacement, introduction of elution conditions that
change the buffer's pH or ionic strength in order to displace bound
proteins, and elution of substances from the column in order of
binding strength (weakly-bound proteins are eluted first). Ion
exchange chromatography is directly upgradable from a small-scale
to a bulk-scale level. Anionic exchange chromatography is a type of
ionic exchange chromatography in which a negatively charged resin
will bind proteins with a net positive charge. Examples of
commercially available anion-exchange resins include HiTrapQ by
Pharmacia; MonoQ, MonoS, MiniQ, Source 15Q, 30Q, Q Sepharose, DEAE,
and Q Sepharose High Performance by Amersham Biosciences
(Piscataway, N.J.); WP PEI, WP DEAM, and WP QUAT by J. T. Baker
(St. Louis, Mo.); Hydrocell DEAE, and Hydrocell QA by Biochrom Labs
(Terre Haute, Ind.); UNOsphere Q, Macro-Prep DEAE, and Macro-Prep
HighQ by Bio-Rad (Hercules, Calif.); Ceramic HyperD Q, Ceramic
HyperD S, Ceramic HyperD DEAE, Trisacryl M DEAE, Trisacryl LS DEAE,
Spherodex LS DEAE, QMA Spherosil, and QMA M Spherosil by Ciphergen
(Fremont, Calif.); DOWEX MONOSPHERE by Dow Liquid Separations
(Midland, Mich.); Matrex Q500, Matrex A500, Matrex Q800, Matrex
A800, and Matrex A200 by Millipore (Bedford, Mass.); Fractogel EMD
TMAE, Fractogel EMD DEAE, and Fractogel EMD DMAE by Novagen
(Madison, Wis.); Amberlite Strong Anion Exchangers Type I,
Amberlite Strong Anion Exchangers Type II, DOWEX Strong Anion
Exchangers, Type I, DOWES Strong Anion Exchangers Type II, Diaion
Strong Anion Exchangers Type I, Diaion Strong Anion Exchangers Type
I, Diaion Strong Anion Exchangers Type II, Amberlite Weak Anion
Exchangers, and DOWEX Weak Anion Exchangers by Sigma-Aldrich (St.
Louis, Mo.); TSK Gel DEAE-5PW--HR, TSK Gel DEAE-5PW, TSK Gel
Q-5PW-HR, and TSK Gel Q-5PW by Tosoh Biosep (Montgomeryville, Pa.);
and QA52, DE23, DE32, DE51, DE52, DE53, Express-Ion D and
Express-Ion Q by Whatman (Kent, UK). For the purification of rAAV1
and rAAV5 virions, anion-exchange chromatography is preferred.
[0054] Hydroxyapatite chromatography is another example of a
suitable chromatography technique. Hydroxyapatite is a crystalline
form of calcium phosphate. The mechanism of hydroxyapatite
chromatography involves nonspecific interactions between negatively
charged protein carboxyl groups and positively charged calcium ions
on the resin, and positively charged protein amino groups and
negatively charged phosphate ions on the resin. Examples of
commercially available hydroxyapatite resins include Bio-Gel HT and
CHT ceramic resins by Bio-Rad (Hercules, Calif.); hydroxylapatite
high resolution and hydroxylapatite fast flow by Calbiochem (San
Diego, Calif.); HA Ultrogel by Ciphergen (Fremont, Calif.); and
hydroxyapatite by Sigma-Aldrich (St. Louis, Mo.). In addition to
anion exchange chromatography, rAAV5 virions, were purified using
hydroxyapatite chromatography (FIG. 3B). An example of a preferred
hydroxyapatite resin is ceramic hydroxyapatite by Bio-Rad,
Hercules, Calif., as this is a stable, porous form of
hydroxyapatite with an improved calcium:phoshpate ration, which
overcomes low binding capacity due to excess phoshpate.
[0055] For the purification of rAAV2 virions, heparin-agarose
chromatography is preferred (FIG. 3A). See, e.g, U.S. Pat. No.
6,146,874.
[0056] A combination of iodixanol step gradient followed by either
affinity heparin (for purifying rAAV2), hydroxyapatite, or anion
exchange chromatography (for purifying AAV1, 2 and 5) is used to
facilitate the high-throughput of several viruses for direct
comparison of transduction efficiency and specificity in animal
models and cell culture. Scaled-up production of the viruses in
tissue culture is facilitated by the use of cell factories, e.g.,
plastic trays with large culture surface areas (Nunc, Rochester,
N.Y.). More importantly, purification of rAAV1, 2 and 5 virions on
Q-Sepharose allows the comparison of virions purified using the
same method. Furthermore, the cell-factory based protocol results
in virion stocks with titers of 1.times.10.sup.12-1.times.10.sup.13
vg/ml purified from 1.times.10.sup.9 cells. These chromatographic
methods have the added benefit that they can be readily scaled up
to purify virus from 1.times.10.sup.10 cells.
[0057] By optimizing the transfection protocol and the method of
purification, 100-200 infectious units (IU) per cell can routinely
be obtained. For a preparation from 1.times.10.sup.9 cells, for
example, the final yield of rAAV is approximately
1-5.times.10.sup.11 IU or approximately
1.times.10.sup.12-1.times.10.sup.13 vector genomes, with P:I ratios
that average 20 and rarely exceed 100.
[0058] Virions are also purified using chromatography in the
absence of density gradient centrifugation. As an example, lysates
from infected cells can be directly subjected to chromatography for
purification of rAAV virions. For large-scale production methods of
rAAV vectors involving chromatography, see Potter et al. (Methods
Enzymol. 346:413-430, 2002).
EXAMPLES
[0059] The present invention is further illustrated by the
following specific examples. The examples are provided for
illustration only and are not to be construed as limiting the scope
or content of the invention in any way.
Example 1
Materials and Methods
[0060] AAV helper plasmids were constructed by combining the ORF
coding for the AAV2 Rep proteins and the ORF coding for capsid
proteins of serotypes 1 and 5. The pACG2R1C helper plasmid was
constructed by substituting the AAV1 cap ORF for AAV2 cap ORF in
pACG2 (Li et al., J. Virol. 71:5236-5243, 1997) and a similar
approach was applied to the pACG2R5C plasmid. Rep2cap1 and rep2cap5
helper cassettes were then subcloned into an Ad helper plasmid,
pXYZ, constructed from pAdEasy. To construct pXYZ, several Ad genes
(penton, core protein, hexon, and Ad DNA polymerase) were disrupted
and the left hand end of the Ad genome was removed to eliminate the
possibility of generating infectious Ad and Ad structural proteins
(some of which are cytotoxic). The resultant plasmids pXYZ1 and
pXYZ5 (FIG. 1) were used to pseudotype AAV2-ITR-containing
expression cassettes into AAV1 and AAV5 capsids, respectively.
Construction of pXYZ1 and pXYZ5 Helper Plasmids
[0061] pXYZ Ad helper plasmid. Plasmid pAdEasy-1 (Stratagene, La
Jolla, Calif.) was digested with SgfI and PmeI, the SgfI
3'-overhang was removed by treatment with T4 DNA-polymerase, and
blunt ends were ligated to produce pAdEasyDel1. Upon digestion with
ClaI and SalI, the 18.9 Kbp fragment was subcloned into
pBlueScriptKS(-) to derive the pXYZ Ad helper plasmid.
[0062] pACG2R1C and pACG2R5C pseudotyping plasmids. wtAAV1 DNA
(Genbank Accession no. NC.sub.--002077) and pAAV5-2 (Chiorini et
al., J. Virol. 73:1309-1319, 1999) were used to amplify the ORFs
coding for the capsid proteins of AAV1 and AAV5, respectively. For
the AAV1 cap ORF primers, 5'GAGCAATAAATGATTTAAACCAGGTATG3' (SEQ ID
NO:1) and 5'GCTCTAGACCCGATGACGTAAGTCTTTTATCG3' (SEQ ID NO:2) were
used, and for the AAV5 cap ORF primers, 5'
GCCAATAAAGAACAGTAAATAATTTAAATAGTCATGTCTTTTGTTGATCACC3' (SEQ ID
NO:3) and 5' GGTGATCAACAAAAGACATGACTATTTAAATTATTTACTGTTCTTTATTGGC3'
(SEQ ID NO:4) were used. Upon digestion of the PCR fragments with
DraI and XbaI, the resulting products were subcloned into pACG2 (Li
et al., J. Virol. 71:5236-5243, 1997) and digested with SwaI and
XbaI. The hybrid plasmids pACG2R1C and pACG2R5C contain the ORF
coding for the AAV2 Rep proteins, and the ORF coding for either
AAV1 or AAV5 capsid proteins, respectively.
[0063] pXYZ1 and pXYZ5 helper plasmids. XbaI fragments containing
the rep-cap ORFs from pACG2R1C and pACG2R5C were subcloned into the
XbaI site of pXYZ to derive pXYZ1 and pXYZ5, respectively. These
helper plasmids encode the AAV and Ad genes required to pseudotype
AAV2 ITR-containing nucleic acids into AAV1 or AAV5 capsids.
Construction of rAAV Vector Plasmids
[0064] rAAV vector constructs were assembled using the pTR-UF
backbone (Klein et al., Exp. Neurol. 150:183-194, 1998; and
Zolotukhin et al., J. Virol. 70:4646-4654, 1996), thereby
containing ITRs from AAV2.
Cell Transfection
[0065] Cell and virus processing was performed exclusively in
biosafety cabinets during open steps. 293 cells (Graham et al., J.
Gen. Virol. 36:59-72, 1977) were cultured in DMEM supplemented with
5% Fetal Bovine Serum and antibiotics (i.e., DMEM-complete). PBS
and 0.05% trypsin were used during cell passage. Briefly, 293 cells
were split 1:3 the day prior to transfection, so at the time of
transfection the cell confluency was .about.75-80%. A production
run utilized about 1.times.10.sup.9 cells seeded in a Cell Factory
(Nunc, Rochester, N.Y.). The CaPO.sub.4-precipitate was formed by
mixing 1.8 mg of pDG (Grimm et al., Hum. Gene Ther. 9:2745-2760,
1998), pXYZ1, or pXYZ5, and 0.6 mg of the rAAV vector plasmid
(.about.1:1 molar ratio) in a total volume of 50 ml of 0.25 M
CaCl.sub.2 followed by the addition of 50 ml of 2.times.HBS pH 7.05
to the DNA/CaCl.sub.2 (Snyder et al., Production of Recombinant
Adeno-Associated Viral Vectors, In N. Dracopoli, J. Haines, B.
Krof, D. Moir, C. Morton, C. Seidman, J. Seidman, and D. Smith,
Current Protocols in Human Genetics, John Wiley and Sons: New York,
N.Y. 1996). The mixture was incubated for 1 min at room
temperature, at which time the formation of precipitate was stopped
by diluting the mixture into 1100 ml of pre-warmed DMEM-complete.
The conditioned culture media was removed from the cells and the
fresh precipitate-containing media was added immediately. Cells
were incubated at 37.degree. C., 5% CO.sub.2 for 60 hrs and the
CaPO.sub.4 precipitate was allowed to remain on the cells during
this incubation period. At the end of the incubation the culture
media was discarded, cells were washed with PBS, and harvested
using PBS containing 5 mM EDTA. The collected cells were
centrifuged at 1000.times.g for 10 minutes, resuspended in 60 ml
Lysis Solution (150 mM NaCl, 50 mM Tris pH 8.4), combined, and
stored at -20.degree. C. until purified.
Cell Lysate and Iodixanol Gradients
[0066] Cells were lysed by 3 freeze/thaw cycles between dry
ice-ethanol and 37.degree. C. water baths. Other methods for lysing
cells might also be used, e.g., microfluidization. Benzonase
(Sigma, St. Louis, Mo.) was then added to the cell lysate (50 U/ml
final concentration) and incubated for 30 min at 37.degree. C. The
crude lysate was clarified by centrifugation at 4000.times.g for 20
minutes and the virus-containing supernatant was divided between
four iodixanol gradients.
[0067] Discontinuous iodixanol step gradients were formed in quick
seal tubes (25.times.89 mm, Beckman, Fullerton, Calif.) by
underlaying and displacing the less dense cell lysate (15 ml) with
iodixanol prepared using a 60% (w/v) sterile solution of OptiPrep
(Nycomed, Roskilde, Denmark) and PBS-MK buffer (1.times. PBS
containing 1 nM MgCl.sub.2 and 2.5 mM KCl). Therefore, each
gradient consisted of (from the bottom): 5 ml 60%, 5 ml 40%, 6 ml
25%, and 9 ml of 15% iodixanol; the 15% density step also contained
1 M NaCl. Tubes were sealed and centrifuged in a Type 70 Ti rotor
at 69,000 rpm (350,000.times.g) for 1 hr at 18.degree. C.
Approximately 5 ml of the 60%-40% step interface was aspirated
after side-puncturing each tube with a syringe equipped with an
18-gauge needle. The iodixanol band from each of the four gradients
was combined; this could be frozen until column chromatography was
performed.
rAAV Column Chromatography
[0068] The iodixanol gradient fraction was further purified and
concentrated by column chromatography. For AAV2 virions, a 3 ml
heparin agarose Type I column (Sigma, St. Louis, Mo.) was
equilibrated with 10 ml of PBS-MK buffer, then 10 ml of PBS-MK/1M
NaCl, followed by 20 ml of PBS-MK buffer. The virus-containing
iodixanol fraction (20 ml) was loaded onto the column by gravity
flow. The column was washed with 20 ml of PBS-MK buffer and eluted
in 15 ml of PBS-MK/1M NaCl. Alternatively, the AAV2 virions were
purified using a 1 ml or 5 ml HiTrap Heparin column (Pharmacia) on
an ATKA FPLC system (Pharmacia) run at 1 column volume per minute.
The virus was then concentrated and desalted in a Biomax 100K
concentrator (Millipore, Bedford, Mass.) by three cycles of
centrifugation. In each cycle the virus was concentrated to 1 ml
following the addition of 10 ml of Lactated Ringer's or
1.times.PBS. The virus was stored at -80.degree. in Lactated
Ringer's or 1.times.PBS.
[0069] For rAAV1, 2, and 5 virions, a 5 ml HiTrap Q column
(Pharmacia) was equilibrated at 5 ml/min with 5 column volumes (25
ml) of Buffer A (20 mM Tris, 15 mM NaCl, pH 8.5), then by 25 ml
Buffer B (20 mM Tris, 500 mM NaCl, pH 8.5), followed by 25 ml of
Buffer A using a Pharmacia ATKA FPLC system. The 20 ml
virus-containing iodixanol fraction was diluted 1:1 with Buffer A
and applied to the column at a flow rate of 3-5 ml/min. After
loading the sample, the column was washed with 10 column volumes
(50 ml) of Buffer A. The virus was eluted with Buffer B and 2 ml
fractions were collected.
[0070] For rAAV5 virions, a buffer exchange and concentration of
the vector-containing iodixanol fraction was performed using a
Millipore (Bedford, Mass.) BioMax 50 filter device and 50 mM Tris
pH 7.5. A Bio-scale Q5 (5 ml bed volume) CHT type I hydroxyapatite
column (BioRad, Hercules, Calif.) was equilibrated with 5 ml Buffer
C (20 mM potassium phosphate pH 7.5), then 7 ml Buffer D (500 mM
Potassium phosphate pH 7.5), followed by 7 ml Buffer C at 1 ml/min
using a BioRad (Hercules, Calif.) Biologic Duoflow system. Virus
was loaded onto the column at 1 ml/min and the column was washed
with 7 ml Buffer C, and eluted with a 25 ml linear gradient of
0-100% Buffer D followed by 7 ml 100% Buffer D. The virus eluted
with 0.2M K-phosphate.
Quality Control Assays
[0071] Assay for protein purity of rAAV stocks. Virion stocks were
analyzed by silver staining following electrophoresis on 10% SDS
polyacrylamide gels. Western blotting was performed using the
anti-AAV2 capsid monoclonal antibody B1 (American Research
Products, Belmont, Mass.) at 1:2000. This antibody also recognizes
the AAV1 and AAV5 capsid proteins (Wobus et al., J. Virol.
74:9281-9293, 2000). Detection was carried out using horseradish
peroxidase (HRP)-conjugated sheep anti-mouse (Amersham, Piscataway,
N.J.) at 1:5000 and Super Signal (Pierce, Rockford, Ill.).
[0072] Assays for infectious rAAV. Stocks were assayed for
infectious rAAV by the infectious center assay (ICA). In this
assay, 96-well plates seeded with 2.times.10.sup.4 C12 cells were
infected 16 hours after seeding with 10-fold dilutions of rAAV and
superinfected with WT Ad5 at a multiplicity of infection (MOI) of
10. Cells that had been infected by rAAV were then complemented for
DNA replication and amplification of the rAAV genomes. Cells were
harvested and suspended in 5 ml of 1.times. PBS, vacuum filtered
onto nylon membranes (0.45 .mu.m), and lysed with 0.5N NaOH/1.5M
NaCl (this step also denatured and immobilized the DNA to the
membrane) followed by neutralization with 1M Tris-HCl pH
7.0/2.times. SSC (20.times. SSC is 3M NaCl and 0.3M NaCitrate pH
7.0). The immobilized DNA was probed for transgene DNA (i.e.,
exogenous DNA) and only those cells that had been productively
infected with rAAV produced a spot. The assay was accurate in the
range of 10-200 spots (or infectious centers) per filter (FIG.
5A).
[0073] Additionally, a single cell fluorescence assay (SCFA) was
used to determine the infectious titer of rAAV virus that expressed
GFP. In this assay, 2.times.10.sup.4 293 or C12 cells in 96-well
plates were infected with serial dilutions of a rAAV-GFP virus and
co-infected with Ad5 (MOI of 10) to increase the sensitivity
(Ferrari et al., J. Virol 70:3227-3234, 1997). Thirty hours later,
cells infected with rAAV-GFP were visually scored using a
fluorescence microscope and the titer was calculated according to
the dilution factor. The titers obtained by SCFA were consistent
(within a factor of 2) with those obtained by ICA.
[0074] Dot blot assay to determine the titer of rAAV physical
particles and the particle to infectivity ratio. The dot blot assay
was used to determine the titer of rAAV virions that contained
vector genomes (FIG. 5B). Plasmid and unpackaged vector DNA was
digested for 1 hour at 37.degree. C. in a final volume of 200 ul
containing SU of DNaseI (Roche, Basel, Switzerland), 10 mM
Tris-HCl, pH 7.5, and 1 mM MgCl.sub.2. Encapsidated rAAV vector
genomes were liberated by adding an equal volume of 2.times.
proteinase K buffer (20 m M Tris-Cl, pH 8.0, 20 mM EDTA, pH 8.0, 1%
SDS) followed by the addition of proteinase K (100 ug), and
incubated at 37.degree. C. for 1 hour. The liberated vector DNA was
phenol extracted and ethanol precipitated. Precipitated DNA was
dissolved in 40 ul of dH.sub.2O and diluted into 400 ul 0.4N
NaOH/10 mM EDTA immediately prior to immobilization. A two-fold
dilution series of the plasmid DNA that was packaged was prepared
in water and diluted into 400 ul 0.4N NaOH/10 mM EDTA immediately
prior to immobilization. Denatured vector DNA was immobilized onto
a nylon membrane along with the plasmid standard curve using a dot
blot apparatus (BioRad, Hercules, Calif.). The blots were probed
for the transgene and exposed to film or Phosphorimager screen
(Molecular Dynamics, Piscataway, N.J.). The vector DNA signal was
compared to the signal generated from the plasmid DNA standard
curve, and extrapolated to determine a vector genome titer. A
comparison of the vector genome titer to the ICA titer produced the
P:I ratio.
[0075] Performance of purified rAAV1, 2, and 5 virions. Purified
serotype virions were used to transduce cells in culture. Vector
performance evaluation results are described below in Example
6.
Example 2
Purification of rAAV1 and 5 Virions
[0076] Because AAV1 and AAV5 both lack significant binding to the
heparin affinity resin used to purify rAAV2 virions, purification
protocols were developed that use density gradient centrifugation
followed by anion exchange or hydroxyapatite chromatography.
[0077] Following density gradient centrifugation, rAAV virions were
purified by column chromatography. Three column resins were used:
heparin-agarose, Q-sepharose, and hydroxyapatite. AAV2 virions
bound heparin-agarose (FIGS. 6A and B), AAV5 virions bound
hydroxyapatite, and AAV1, 2, and 5 virions bound Q-Sepaharose
(FIGS. 3A and 4). rAAV2 virions eluted from heparin with 0.35M NaCl
and rAAV5 virions eluted from hydroxyapatite with 0.2 M phosphate.
AAV1, 2, and 5 eluted from Q-Sepharose in 0.5 M NaCl. As shown in
FIG. 6A, virions produced were 99% pure with the three capsid
proteins at the proper ratio of .about.1:1:20 for VP1:VP2:VP3. A
combination of iodixanol step gradient followed by either affinity
Heparin (for purifying rAAV2), hydroxyapatite (for purifying AAV5),
or anion exchange chromatography (for purifying AAV1, 2 and 5) was
used to facilitate the high throughput of several viruses for
direct comparison of transduction efficiency and specificity in
animal models and cell culture. Scaled-up production of the virus
in tissue culture was facilitated by the use of cell factories,
e.g., plastic trays with large culture surface areas (Nunc,
Rochester, N.Y.). Purification of rAAV1, 2 and 5 virions on
Q-Sepharose allowed the comparison of virions purified using the
same method. Furthermore, the cell-factory based protocol resulted
in virus stocks with titers of 1.times.10.sup.12 -1.times.10.sup.13
vg/ml purified from 1.times.10.sup.9 cells. These chromatographic
methods have the added benefit that they can be readily scaled up
to purify vector from 1.times.10.sup.10 cells.
[0078] By optimizing the transfection protocol and the method of
purification, 100-200 IU per cell can routinely be obtained. For a
preparation from 1.times.10.sup.9 cells, this means that the final
yield of rAAV is approximately 1-5.times.10.sup.11 IU or
approximately 1.times.10.sup.12-1.times.10.sup.13 vector genomes,
with P:I ratios that average 20 and rarely exceed 100. Previous
preparations that relied on CsCl centrifugation had average P:I
ratios that were often greater than 200 and sometimes as high as
10,000.
Example 3
ICA For rAAV and rcAAV
[0079] The infectious titer of rAAV was determined by measuring the
ability of the virus to infect C12 cells expressing AAV2 rep and
cap ORFs, unpackage, and replicate (FIG. 5A). In this assay,
rep-cap expressing C12 cells were infected with serial dilutions of
rAAV. To score the infecting viral particle it was amplified
through viral DNA replication, whereupon the number of viral
genomes reached several thousand per cell. This amplification was
achieved by co-infecting the cell with a saturating amount of Ad5
to initiate rep and cap gene expression required for AAV DNA
replication. The cells were then incubated for 40 hours, harvested,
and transferred onto a nylon membrane and lysed. The immobilized
viral DNA was hybridized with a transgene-specific probe and the
cells infected with rAAV particles were scored as black dots
following autoradiography (FIG. 5A).
[0080] WT AAV may contaminate vector preparations, and rcAAV may be
formed during the production of rAAV due to recombination between
the rAAV genome and the AAV helper plasmid. Since expression of the
AAV rep gene has been shown to affect transduction frequency
(McLaughlin et al., J. Virol. 62:1963-1973, 1988; and Samulski et
al., J. Virol. 63:3822-3828, 1989) and gene expression (Horer et
al., J. Virol. 69:5485-5496, 1995; and Labow et al., J. Virol.
60:251-258, 1986), and possibly change the integration specificity
of the provirus (Kearns et al., Gene Ther. 3:748-755, 1996; and
Ponnazhagan et al., Hum. Gene Ther. 8:275-284, 1997), it was
necessary to evaluate the extent of rcAAV or wtAAV contamination in
rAAV virion stocks. A variation of the ICA allowed for the
determination of wtAAV and rcAAV contamination. In this assay, 293
cells were infected with the rAAV and Ad, and the filters were
hybridized with a AAV rep-cap probe. Only rep-cap expressing wtAAV
or rcAAV was propagated in the presence of Ad and scored as black
dots following autoradiography. The ICA was performed on a
rAAV2-GFP vector using a GFP probe. The calculated infectious titer
was 4.0.times.10.sup.11 IU/ml.
Example 4
Dot Blot Assay To Determine Titer and Particle To Infectivity Ratio
of rAAV Virions
[0081] The dot blot assay was used to determine the titer of rAAV
virions harboring vector genomes (FIG. 5B). This assay allowed
direct comparisons of the potency of the different serotype virions
administered to the same cell type. The dot blot assay was
performed on the same rAAV2-GFP stock as that of Example 2. The
calculated vg titer was 8.2.times.10.sup.12 vg/ml.
Example 5
Performance of rAAV 1, 2, and 5 Virions
[0082] rAAV1-GFP and rAAV5-GFP virions purified by Q-sepharose
chromatography and rAAV2 virions purified by heparin chromatography
were used to transduce rat oval cells in culture (FIG. 6). The
rAAV5-GFP transduced rat oval cells more efficiently than either
rAAV2-GFP or rAAV1-GFP virions. Transduction of oval cells with
rAAV vectors provides a therapeutic approach for treating liver
disease or systemic protein deficiencies.
Example 6
In Situ Detection of GAA Activity in Tibialis Anterior (TA) Muscles
from GAA-/-Mice
[0083] Glycogen storage disease type II (Gaa-/-) mice (Raben et
al., J. Biol. Chem. 273:19086-19092, 1998), which lack the
lysosomal hyrolase acid .alpha.-glucosidase, were injected
intramuscularly under 2,2,2-tribromoethanol (Avertin) anesthesia.
Mice were administered 4.times.10.sup.10 vector genomes of
rAAV1-CMV-mGaa, expressing the murine Gaa cDNA. For histochemical
detection of GAA, muscle was snap-frozen in liquid nitrogen-cooled
isopentane, followed by serial transverse sectioning (10 um), and
processing was performed much as described by Sanes et al., (Embo
J. 5:3133-3142, 1986) with the substitution of the substrate
5-bromo-4-chloro-3-indolyl-.alpha.-D-glucopyranoside (Calbiochem,
San Diego, Calif.), which yielded an intense blue color upon
cleavage by GAA, and counterstained with nuclear fast red. Gaa-1-TA
muscle treated with AAV1-CMV-mGaa expressed detectable amounts of
GAA, while untreated TA muscle from the contralateral leg of the
same mouse did not.
[0084] Rat oval cells were isolated from male Fischer 344 rats
(Petersen et al., Science 284:1168-1170, 1999; and Petersen et al.,
Hepatology 27:1030-1038, 1998). Briefly, a 2-acetylaminofluorene
(2-AAF) tablet was inserted subcutaneously into the lower quadrant
to suppress the hepatocyte proliferation. After 5-7 days a partial
hepatectamy was performed to induce a severe hepatic injury. Seven
days later the liver was perfused with a collagenase H solution.
The oval cells were immediately sorted by fluorescence activated
cell sorting (FACS) using a FITC-conjugated anti-rat Thy 1.1
antibody. The purified oval cells were then plated onto sixteen
well chamber slides and infected with the rAAV1, 2, and 5 viruses
(10,000 vector genomes/cell) or mock infected. Nine days after
infection the cells were visualized by either bright-field or
fluorescent microscopy for the expression of GFP using a Zeiss
Axiovert microscope.
Other Embodiments
[0085] It is to be understood that while the invention has been
described in conjunction with the detailed description thereof, the
foregoing description is intended to illustrate and not limit the
scope of the invention, which is defined by the scope of the
appended claims. Other aspects, advantages, and modifications are
within the scope of the following claims.
Sequence CWU 1
1
4 1 28 DNA Artificial Synthetic Oligonucleotide 1 gagcaataaa
tgatttaaac caggtatg 28 2 32 DNA Artificial Synthetic
Oligonucleotide 2 gctctagacc cgatgacgta agtcttttat cg 32 3 52 DNA
Artificial Synthetic Oligonucleotide 3 cgcaataaag aacagtaaat
aatttaaata gtcatgtctt ttgttgatca cc 52 4 52 DNA Artificial
Synthetic Oligonucleotide 4 ggtgatcaac aaaagacatg actatttaaa
ttatttactg ttctttattg gc 52
* * * * *