U.S. patent application number 11/269906 was filed with the patent office on 2006-12-28 for method of detecting antibodies to hcv.
This patent application is currently assigned to Chiron Corporation. Invention is credited to Qui-Lim Choo, Michael Houghton, George Kuo.
Application Number | 20060292556 11/269906 |
Document ID | / |
Family ID | 27537079 |
Filed Date | 2006-12-28 |
United States Patent
Application |
20060292556 |
Kind Code |
A1 |
Houghton; Michael ; et
al. |
December 28, 2006 |
Method of detecting antibodies to HCV
Abstract
A family of cDNA sequences derived from hepatitis C virus (HCV)
are provided. These sequences encode antigens which react
immunologically with antibodies present in individuals with non-A
non-B hepatitis (NANBV), but which are absent from individuals
infected with hepatitis A virus, or hepatitis B virus, and also are
absent in control individuals. The HCV cDNA sequences lack
substantial homology to the sequences of hepatitis delta virus
(HDV) and HBV. A comparison of the sequences of amino acids encoded
in the HCV cDNA with the sequences of Flaviviruses indicated that
HCV may be related to the Flaviviruses. The HCV cDNA sequences and
the polypeptides encoded therein are useful as reagents for the
detection and therapy of HCV. The reagents provided in the
invention are also useful for the isolation of NANBV agent(s), for
the propagation of these agents in tissue culture, and for the
screening of antiviral agents for HCV.
Inventors: |
Houghton; Michael;
(Danville, CA) ; Choo; Qui-Lim; (El Cerrito,
CA) ; Kuo; George; (San Francisco, CA) |
Correspondence
Address: |
NOVARTIS VACCINES AND DIAGNOSTICS INC.
CORPORATE INTELLECTUAL PROPERTY R338
P.O. BOX 8097
Emeryville
CA
94662-8097
US
|
Assignee: |
Chiron Corporation
Emeryville
CA
|
Family ID: |
27537079 |
Appl. No.: |
11/269906 |
Filed: |
November 9, 2005 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10387530 |
Mar 14, 2003 |
|
|
|
11269906 |
Nov 9, 2005 |
|
|
|
08686983 |
Jul 25, 1996 |
|
|
|
10387530 |
Mar 14, 2003 |
|
|
|
08307273 |
Sep 16, 1994 |
6074816 |
|
|
08686983 |
Jul 25, 1996 |
|
|
|
08103961 |
Aug 9, 1993 |
5350671 |
|
|
08307273 |
Sep 16, 1994 |
|
|
|
07456637 |
Dec 21, 1989 |
|
|
|
08103961 |
Aug 9, 1993 |
|
|
|
07355002 |
May 18, 1989 |
|
|
|
07456637 |
Dec 21, 1989 |
|
|
|
07341334 |
Apr 20, 1989 |
|
|
|
07355002 |
May 18, 1989 |
|
|
|
Current U.S.
Class: |
435/5 |
Current CPC
Class: |
Y02A 50/30 20180101;
G01N 33/5767 20130101; C07K 2317/21 20130101; C12Q 1/701 20130101;
Y02A 50/451 20180101; C07K 2319/00 20130101; C12Q 1/6853 20130101;
C07K 16/109 20130101; A61K 39/00 20130101; C07K 14/005 20130101;
C12Q 1/707 20130101; C12N 2770/24222 20130101; C12Q 1/6858
20130101 |
Class at
Publication: |
435/005 |
International
Class: |
C12Q 1/70 20060101
C12Q001/70 |
Claims
1. An immunoassay method for detecting antibodies directed against
a hepatitis C virus (HCV) antigen comprising: (a) incubating a
sample suspected of containing anti-HCV antibodies with a
polypeptide comprising an epitope of the HCV, under conditions
which allow the formation of an antibody-antigen complex; and (b)
detecting the antibody-antigen complex containing the polypeptide,
said polypeptide having the amino acid sequence:
Gln-Gly-Met-Met-Leu-Ala-Glu-Gln-Phe-Lys-Gln-Lys-Ala-Leu-Gly-Leu-Leu-Gln-T-
hr-Ala-Ser-Arg-Gln-Ala-Glu-Val-X wherein X is --OH or
--NH.sub.2.
2. A method of detecting antibodies to hepatitis C virus (HCV), or
diagnosis of HCV infection in a subject comprising: (a) providing a
peptide composition comprising a peptide selected from the group
consisting of: (i)
Gln-Gly-Met-Met-Leu-Ala-Glu-Gln-Phe-Lys-Gln-Lys-Ala-Leu-Gly-Leu-Leu-Gln-T-
hr-Ala-Ser-Arg-Gln-Ala-Glu-Val-X wherein X is --OH or --NH.sub.2
(ii) an analog peptide of peptide (i) having an amino acid sequence
from a strain/isolate of HCV in a region corresponding to peptide
(i) and having specific immunoreactivity to antibodies to HCV;
(iii) a segment or truncated sequence of peptide (i) or said analog
peptide which has specific immunoreactivity to antibodies to HCV;
and (iv) a conjugate or fusion protein of peptide (i), said analog
peptide, or said segment or truncated sequence, wherein the
conjugate or fusion protein has specific inimunoreactivity to
antibodies to HCV; (b) contacting an effective amount of the
peptide composition with a sera or body fluid sample from the
subject; and (c) detecting a complex of the peptide composition and
antibodies to HCV.
3. The method according to claim 2 wherein the peptide composition
is coated on a solid substrate.
4. The method according to claim 3 wherein the step of detecting
the complex of peptide with antibodies to HCV is determined by
means of an enzyme linked immunosorbent assay.
5. The method according to claim 3 wherein the method of detecting
the complex of peptide with antibodies to HCV is determined by
using an radioimmunoassay.
6. The method according to claim 2 wherein the method of detecting
the complex of peptide with antibodies to HCV is determined by a
hemagglutination assay.
7. A method of detecting antibodies to hepatitis C virus (HCV), or
diagnosis of HCV infection in a subject comprising: (a) providing a
peptide composition comprising a peptide having an amino acid
sequence as follows:
Gln-Gly-Met-Met-Leu-Ala-Glu-Gln-Phe-Lys-Gln-Lys-Ala-Leu-Gly-Leu-
-Leu-Gln-Thr-Ala-Ser-Arg-Gln-Ala-Glu-Val-X wherein X is --OH or
--NH.sub.2; or an analog of the above peptide having an amino acid
sequence from a strain/isolate of HCV in a region corresponding to
the peptide, and having specific imrnmunoreactivity to antibodies
to HCV; (b) contacting an effective amount of the peptide
composition with a sera or body fluid sample from the subject; and
(c) detecting the presence of a complex of the peptide and
antibodies to HCV.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application is a continuation of U.S. Ser. No.
10/387,530, filed Mar. 14, 2003, which is a continuation of U.S.
Ser. No. 08/686,983, filed Jul. 25, 1996, which is a continuation
of Ser. No. 08/307,273 filed Sep. 16, 1994, which is a division of
Ser. No. 08/103,961 filed Aug. 9, 1993, which is a continuation of
Ser. No. 07/457,637 filed Dec. 21, 1989, which is a
continuation-in-part of Ser. No. 07/355,002 filed May 18, 1989,
abandoned, which is a continuation-in-part of Ser. No. 07/341,334
filed Apr. 20,1989, abandoned, which is a continuation-in-part of
Ser. No. 353,896 filed Apr. 21, 1989, abandoned, which is a
continuation-in-part of Ser. No. 07/325,338 filed Mar. 17, 1989,
abandoned, which is a continuation-in-part of Ser. No. 271,450
filed Nov. 14, 1988, abandoned, which is a continuation-in-part of
Ser. No. 263,584 filed Oct. 26, 1988, abandoned, which is a
continuation-in-part of Ser. No. 191,263 filed May 6, 1988,
abandoned, which is a continuation-in-part of Ser. No. 161,072
filed Feb. 26,1988, abandoned, which is a continuation-in-part of
Ser. No. 139,886 filed Dec. 30, 1987, abandoned, which is a
continuation-in-part of Ser. No. 122,714 filed Nov. 18, 1987,
abandoned. These references are incorporated herein by reference in
their entireties.
TECHNICAL FIELD
[0002] The invention relates to materials and methodologies for
managing the spread of non-A, non-B hepatitis virus (NANBV)
infection. More specifically, it relates to diagnostic DNA
fragments, diagnostic proteins, diagnostic antibodies and
protective antigens and antibodies for an etiologic agent of NANB
hepatitis, i.e., hepatitis C virus.
REFERENCES CITED IN THE APPLICATION
[0003] Barr et al. (1986), Biotechniques 4:428. [0004] Bradley et
al. (1985), Gastroenterology 88:773. [0005] Botstein (1979), Gene
8:17. [0006] Brinton, M. A. (1986) in THE VIRUSES: THE TOGAVIRIDAE
AND FLAVIVIRIDAE (Series eds. Fraenkel-Conrat and Wagner, vol. Eds.
Schlesinger and Schlesinger, Plenum Press), P. 327-374. [0007]
Broach (1981) in: Molecdular Biology of the Yeast Saccharomyces,
Vol. 1, p. 445, Cold Spring Harbor Press. [0008] Broach et al.
(1983), Meth. Enz. 101:307. [0009] Catty (1988), ANTIBODIES, Volume
1: A Practical Approach (IRL Press). [0010] Chaney et al. (1986),
Cell and Molecular Genetics 12:237. [0011] Chakrabarti et al.
(1985), Mol. Cell Biol. 5:3403. [0012] Chang et al. (1977), Nature
198:1056. [0013] Chen and Seeeburg (1985), DNA 4:165. [0014]
Chirgwin et al. (1979), Biochemistry 18:5294. [0015] Chomczynski
and Sacchi (1987), Analytical Biochemistry 162:156. [0016] Choo et
al. (1989), Science 244359. [0017] Clewell et al. (1969), Proc.
Natl. Acad. Sci. USA 62:1159. Clewell (1972), J. Bacteriol.
110:667. [0018] Cohen (1972), Proc. Nat. Acad. Sci. USA 69:2110.
[0019] Cousens et al. (1987), gene 61:265. [0020] De Boer et al.
(1983), Proc. Natl. Acad. Sci. USA 292:128. [0021] Dreesman et al.
(1985), J. Infect. Disease 151:761. [0022] Feinstone, S. M. and
Hoofnagle, J. H. (1984), New Engl. J. Med. 311:185. [0023] Felgner
et al. (1987), Proc. Natl. Acad. Sci. USA 84:7413. [0024] Fields
& Knipe (1986), FUNDAMENTAL VIROLOGY (Raven Press, N.Y.).
[0025] Fiers et al. (1978), Nature 273:113. [0026] Gerety, R. J. et
al., in VIRAL HEPATITIS AND LIVER DISEASE (Vyas, B. N., Dienstag,
J. L., and Hoofnagle, J. H., eds, [0027] Glennie et al. (1982),
Nature 295:712. [0028] Grune and Stratton, Inc., 1984) pp 23-47.
[0029] Gluzman (1981), Cell 23:175. [0030] Goeddel et al. (1980),
Nucleic Acids Res. 8:4057. [0031] Graham and Van der Eb (1978),
Virology 52:546. [0032] Grunstein and Hogness (1975), Proc. Natl.
Acad. Sci. USA 73:3961. [0033] Grych et al. (1985), Nature 316:74.
[0034] Gubler and Hoffman (1983), Gene 25:263. [0035] Hahn (1988)
Virology 162:167. [0036] Hammerling et al. (1981), MONOCLONAL
ANTIBODIES AND T-CELL HYBRIDOMAS. [0037] Han (1987), Biochemistry
26:1617. [0038] Helfman (1983), Proc. Natl. Acad. Sci. USA 80:31.
[0039] Hess et al. (1968), J. Adv. Enzyme Reg 7:149. [0040] Hinnen
et al. (1978), Proc. Natl. Acad. Sci. 75:1929. [0041] Hitzeman et
al. (1980), J. Biol. Chem. 255:2073. [0042] Holland et al. (1978),
Biochemistry 17:4900. [0043] Holland (1981), J. Biol. Chem. 256:
1385. [0044] Holland and Holland (1980), J. Biol. Chem. 255:2596.
[0045] Hoopes et al. (1981), Nucleic Acid Res. 9:5493. [0046]
Houghton et al. (1981), Nucleic Acids Res. 9:247 [0047] Hunyh, T.
V. et al. (1985) in DNA CLONING TECHNIQUES; A PRACTICAL APPROACH
(D. Glover, Ed., IRL Press, Oxford, U.K.) pp. 49-78. [0048] Immun.
Rev. (1982) 62:185. [0049] Ito et al. (1984), Agric. Biol. Chem.
48:341. [0050] Iwarson (1987), British Medical J. 295:946. [0051]
Kennett et al. (1980) MONOCLONAL ANTIBODIES. [0052] Kniskern et al.
(1986), Gene 46:135. [0053] Kyte and Doolittle (1982), J. Mol.
Biol. 157:105-132. [0054] Laemmli (1970), Nature 227, 680. [0055]
Lee et al. (1988), Science 239:1288. [0056] Luckow and Summers
(1989), Virology 17:31. [0057] Mackett et al. (1984), J. Virol.
49:857. [0058] Maniatis, T., et al. (1982) MOLECULAR CLONING; A
LABORATORY MANUAL (Cold Spring Harbor Press, Cold Spring Harbor,
N.Y.). [0059] Maniatis et al. (1989), MOLECULAR CLONING; A
LABORATORY MANUAL, Second Edition (Cold Spring Harbor Press, Cold
Spring Harbor, N.Y.). [0060] Manning and Mocarski (1988), Virology
167:477. [0061] Mayer and Walker, eds. (1987), IMMUNOCHEMICAL
METHODS IN CELL AND MOLECULAR BIOLOGY (Academic Press, London).
[0062] Maxam et al. (1980), Methods in Enzymology 65:499. [0063]
MacNamara et al. (1984), Science 226:1325. [0064] Messing et al.
(1981), Nucleic Acids Res. 9:309. [0065] Messing (1983), Methods in
Enzymology 101:20-37. METHODS IN ENZYMOLOGY (Academic Press).
[0066] Michelle et al., Int. Symposium on Viral Hepatitis. [0067]
Monath (1986) in THE VIRUSES: THE TOGAVIRADAE AND FLAVIVIRIDAE
(Series eds. Fraenkel-Conrat and Wagner, vol. eds. Schlesinger and
Schlesinger, Plenum Press), p. 375-440. [0068] Moss (1987) in GENE
TRANSFER VECTORS FOR MAMMALIAN CELLS (Miller and Calos, eds., Cold
Spring Harbor Laboratory, Cold Spring Harbor, N.Y.), p. 10. [0069]
Nagahuma et al. (1984), Anal. Biochem. 141:74. [0070] Neurath et
al. (1984), Science 224:392. [0071] Nisonoff et al. (1981), Clin.
Immunol. Immunopathol. 21:397-406. [0072] Overby, L. R. (1985),
Curr. Hepatol. 5:49. [0073] Overby, L. R. (1986), Curr. Hepatol.
6:65. [0074] Overby, L. R. (1987), Curr. Hepatol. 7:35. [0075]
Pachl et al. (1987), J. Virol. 61:315. [0076] Peleg (1969), Nature
221:193. [0077] Pfefferkorn and Shapiro (1974), in COMPREHENSIVE
VIROLOGY, Vol. 2 (Fraenkel-Conrat & Wagner, eds., Plenum, N.Y.)
pp. 171-230. [0078] Prince, A. M. (1983), Annu. Rev. Microbiol.
37:217. [0079] Rice et al. (1985), Science 229:726. [0080] Rice et
al. (1986) in THE VIRUSES: THE TOGAVIRIDAE AND FLAVIVIRIDAE (Series
eds. Fraenkel-Conrat and Wagner, vol. eds. Schlesinger and
Schlesinger, Plenum Press), p. 279-328. [0081] Roehrig (1986) in
THE VIRUSES: THE TOGAVIRIDAE AND FLAVIVIRIDAE (Series eds.
Fraenkel-Conrat and Wagner, vol. eds. Schlesinger and Schlesinger,
Plenum Press) Sadler et al. (1980), Gene 8, 279. [0082] Saiki et
al. (1986), Nature 324: 163. [0083] Saiki et al. (1988), Science
239:487. [0084] Sanger et al. (1977), Proc. Natl. Acad. Sci. USA
74:5463. [0085] Setlow, ed. (1988), GENETIC ENGINEERING. Vol. 10,
p. 195-219 (Plenum Publishing Co., N.Y. [0086] Schlesinger et al.
(1986), J. Virol. 60:1153. [0087] Schreier, M., et al. (1980)
HYBRIDOMA TECHNIQUES Scopes (1984), PROTEIN PURIFICATION,
PRINCIPLES AND PRACTICE, SECOND EDITION (Springer-Verlag, N.Y.).
Shimatake et al. (1981), Nature 292:128. [0088] Singh et al.
(1983), Nucleic Acids. Res. 11:4049. [0089] Sippel (1973), Eur. J.
Biochem. 37:31. [0090] Smith et al. (1983), Mol. & Cell Biol.
3:2156-2165. [0091] Steimer et al. (1986), J. Virol. 58:9. [0092]
Stollar (1980), in THE TOGAVIRUSES (R. W. Schlesinger, ed.,
Academic Press, N.Y.), pp. 584-622. [0093] Stuve et al. (1987), J.
Virol. 61:326. [0094] Sumiyoshi et al. (1987), Virology 161:497.
[0095] Taylor et al. (1976), Biochem. Biophys. Acta 442:324. [0096]
Towbin et al. (1979), Proc. Natl. Acad. Sci. USA 76, 4350. [0097]
Tsu and Herzenberg (1980), in SELECTED METHODS IN CELLULAR
IMMUNOLOGY (W.H. Freeman and Co.) pp. 373-391. [0098] Vytdehaag et
al. (1985), J. Immunol. 134:1225. [0099] Valenzuela, P., et al.
(1982), Nature 298:344. [0100] Valenzuela, P., et al. (1984), in
HEPATITIS B (Millman, I., et al., ed, Plenum Press) pp. 225-236.
[0101] Warner (1984), DNA 3:401. [0102] Ward et al. (1989), Nature
341:544. [0103] Wu and Grossman (1987), Methods in.Enzymology Vol.
154, RECOMBINANT DNA, Part E. [0104] Wu (1987), Methods in
Enzymology vol 155, RECOMBINANT DNA, part F. [0105] Zoller (1982),
Nucleic Acids Res. 10:6487.
CITED PATENTS
[0105] [0106] U.S. Pat. No. 4,341,761 [0107] U.S. Pat. No.
4,399,121 [0108] U.S. Pat. No. 4,427,783 [0109] U.S. Pat. No.
4,444,887 [0110] U.S. Pat. No. 4,466,917 [0111] U.S. Pat. No.
4,472,500 [0112] U.S. Pat. No. 4,491,632 [0113] U.S. Pat. No.
4,493,890 [0114] U.S. Pat. No. 4,816,467
BACKGROUND ART
[0115] Non-A, Non-B hepatitis (NANBH) is a transmissible disease or
family of diseases that are believed to be viral-induced, and that
are distinguishable from other forms of viral-associated liver
diseases, including that caused by the known hepatitis viruses,
i.e., hepatitis A virus (HAV), hepatitis B virus (HBV), and delta
hepatitis virus (HDV), as well as the hepatitis induced by
cytomegalovirus (CMV) or Epstein-Barr virus (EBV). NANBH was first
identified in transfused individuals. Transmission from man to
chimpanzee and serial passage in chimpanzees provided evidence that
NANBH is due to a transmissible infectious agent or agents.
However, the transmissible agent responsible for NANBH is still
unidentified and the number of agents which are causative of the
disease are unknown.
[0116] Epidemiologic evidence is suggestive that there may be three
types of NANBH: the water-borne epidemic type; the blood or needle
associated type; and the sporadically occurring (community
acquired) type. However, the number of agents which may be the
causative of NANBH are unknown.
[0117] Clinical diagnosis and identification of NANBH has been
accomplished primarily by exclusion of other viral markers. Among
the methods used to detect putative NANBV antigens and antibodies
are agar-gel diffusion, counterimmunoelectrophoresis,
immunofluorescence microscopy, immune electron microscopy,
radioimmunoassay, and enzyme-linked immunosorbent assay. However,
none of these assays has proved to be sufficiently sensitive,
specific, and reproducible to be used as a diagnostic test for
NANBH.
[0118] Until now there has been neither clarity nor agreement as to
the identity or specificity of the antigen antibody systems
associated with agents of NANBH. This is due, at least in part, to
the prior or co-infection of HBV with NANBV in individuals, and to
the known complexity of the soluble and particulate antigens
associated with HBV, as well as to the integration of HBV DNA into
the genome of liver cells. In addition, there is the possibility
that NANBH is caused by more than one infectious agent, as well as
the possibility that NANBH has been misdiagnosed.
[0119] Moreover, it is unclear what the serological assays detect
in the serum of patients with NANBH. It has been postulated that
the agar-gel diffusion and counterimmuno-electrophoresis assays
detect autoimmune responses or non-specific protein interactions
that sometimes occur between serum specimens, and that they do not
represent specific NANBV antigen-antibody reactions. The
immunofluorescence, and enzyme-linked immunosorbent, and
radioimmunoassays appear to detect low levels of a
rheumatoid-factor-like material that is frequently present in the
serum of patients with NANBH as well as in patients with other
hepatic and nonhepatic diseases. Some of the reactivity detected
may represent antibody to host-determined cytoplasmic antigens.
[0120] There are a number of alleged candidate NANBV. See, for
example the reviews by Prince (1983), Feinstone and Hoofnagle
(1984), and Overby (1985, 1986, 1987) and the article by Iwarson
(1987). However, the field has not accepted that any of these
candidates represent the etiological agent of NANBH.
[0121] The demand for sensitive, specific methods for screening and
identifying carriers of NANBV and NANBV contaminated blood or blood
products is significant. Post-transfusion hepatitis (PTH) occurs in
approximately 10% of transfused patients, and NANBH accounts for up
to 90% of these cases. The major problem in this disease is the
frequent progression to chronic liver damage (25-55%).
[0122] Patient care as well as the prevention of transmission of
NANBH by blood and blood products or by close personal contact
require reliable diagnostic and prognostic tools to detect nucleic
acids, antigens and antibodies related to NANBV. In addition, there
is also a need for effective vaccines and immunotherapeutic
therapeutic agents for the prevention and/or treatment of the
disease.
DISCLOSURE OF THE INVENTION
[0123] The invention pertains to the isolation and characterization
of a newly discovered etiologic agent of NANBH, hepatitis C virus
(HCV), its nucleotide sequences, its protein sequences and
resulting polynucleotides, polypeptides and antibodies derived
therefrom. The inventions described herein were made possible by
the discovery of cDNA replicas isolated by a technique which
included a novel step of screening expression products from cDNA
libraries created from a particulate agent in infected tissue with
sera from patients with NANBH to detect newly synthesized antigens
derived from the genome of the heretofore unisolated and
uncharacterized viral agent, and of selecting clones which produced
products which reacted immunologically only with sera from infected
individuals as compared to non-infected individuals.
[0124] Studies of the nature of the genome of the HCV, utilizing
probes derived from the HCV cDNA, as well as sequence information
contained within the HCV cDNA, are suggestive that HCV is a
positive-stranded RNA virus which appears to be distantly related
to the flaviviridae family, and to the pestiviruses.
[0125] Portions of the cDNA sequences derived from HCV are useful
as probes to diagnose the presence of virus in samples, and to
isolate naturally occurring variants of the virus. These cDNAs also
make available polypeptide sequences of HCV antigens encoded within
the HCV genome(s) and permits the production of polypeptides which
are useful as standards or reagents in diagnostic tests and/or as
components of vaccines. Antibodies, including for example both
polyclonal and monoclonal, directed against HCV epitopes contained
within these polypeptide sequences are also useful for diagnostic
tests, as therapeutic agents, for screening of antiviral agents,
and for the isolation of the NANBV agent from which these cDNAs
derive. In addition, by utilizing probes derived from these cDNAs
it is possible to isolate and sequence other portions of the HCV
genome, thus giving rise to additional probes and polypeptides
which are useful in the diagnosis and/or treatment, both
prophylactic and therapeutic, of NANBH.
[0126] Accordingly with respect to polynucleotides, some aspects of
the invention are: a purified HCV polynucleotide; a recombinant HCV
polynucleotide; a recombinant polynucleotide comprising a sequence
derived from an HCV genome or from HCV cDNA; a recombinant
polynucleotide encoding an epitope of HCV; a recombinant vector
containing the any of the above recombinant polynucleotides, and a
host cell transformed with any of these vectors.
[0127] Other aspects of the invention are: a recombinant expression
system comprising an open reading frame (ORF) of DNA derived from
an HCV genome or from HCV cDNA, wherein the ORF is operably linked
to a control sequence compatible with a desired host, a cell
transformed with the recombinant expression system, and a
polypeptide produced by the transformed cell.
[0128] Still other aspects of the invention are: purified HCV, a
preparation of polypeptides from the purified HCV; a purified HCV
polypeptide; a purified polypeptide comprising an epitope which is
immunologically identifiable with an epitope contained in HCV.
[0129] Included aspects of the invention are a recombinant HCV
polypeptide; a recombinant polypeptide comprised of a sequence
derived from an HCV genome or from HCV cDNA; a recombinant
polypeptide comprised of an HCV epitope; and a fusion polypeptide
comprised of an HCV polypeptide.
[0130] Also included in the invention are a monoclonal antibody
directed against an HCV epitope; and a purified preparation of
polyclonal antibodies directed against an HCV epitope; and an
anti-idiotype antibody comprising a region which mimics an HCV
epitope.
[0131] Another aspect of the invention is a particle which is
immunogenic against HCV infection comprising a non-HCV polypeptide
having an amino acid sequence capable of forming a particle when
said sequence is produced in a eukaryotic host, and an HCV
epitope.
[0132] Still another aspect of the invention is a polynucleotide
probe for HCV.
[0133] Aspects of the invention which pertain to kits are those
for: analyzing samples for the presence of polynucleotides derived
from HCV comprising a polynucleotide probe containing a nucleotide
sequence from HCV of about 8 or more nucleotides, in a suitable
container; analyzing samples for the presence of an HCV antigen
comprising an antibody directed against the HCV antigen to be
detected, in a suitable container; analyzing samples for the
presence of an antibodies directed against an HCV antigen
comprising a polypeptide containing an HCV epitope present in the
HCV antigen, in a suitable container.
[0134] Other aspects of the invention are: a polypeptide comprised
of an HCV epitope, attached to a solid substrate; and an antibody
to an HCV epitope, attached to a solid substrate.
[0135] Still other aspects of the invention are: a method for
producing a polypeptide containing an HCV epitope comprising
incubating host cells transformed with an expression vector
containing a sequence encoding a polypeptide containing an HCV
epitope under conditions which allow expression of said
polypeptide; and a polypeptide containing an HCV epitope produced
by this method.
[0136] The invention also includes a method for detecting HCV
nucleic acids in a sample comprising reacting nucleic acids of the
sample with a probe for an HCV polynucleotide under conditions
which allow the formation of a polynucleotide duplex between the
probe and the HCV nucleic acid from the sample; and detecting a
polynucleotide duplex which contains the probe.
[0137] Immunoassays are also included in the invention. These
include an immunoassay for detecting an HCV antigen comprising
incubating a sample suspected of containing an HCV antigen with a
probe antibody directed against the HCV antigen to be detected
under conditions which allow the formation of an antigen-antibody
complex; and detecting an antigen-antibody complex containing the
probe antibody. An immunoassay for detecting antibodies directed
against an HCV antigen comprising incubating a sample suspected of
containing anti-HCV antibodies with a probe polypeptide which
contains an epitope of the HCV, under conditions which allow the
formation of an antibody-antigen complex; and detecting the
antibody-antigen complex containing the probe antigen.
[0138] Also included in the invention are vaccines for treatment of
HCV infection comprising an immunogenic peptide containing an HCV
epitope, or an inactivated preparation of HCV, or an attenuated
preparation of HCV.
[0139] Another aspect of the invention is a tissue culture grown
cell infected with HCV.
[0140] Yet another aspect of the invention is a method for
producing antibodies to HCV comprising administering to an
individual an isolated immunogenic polypeptide containing an HCV
epitope in an amount sufficient to produce an immune response.
BRIEF DESCRIPTION OF THE DRAWINGS
[0141] FIG. 1 shows the double-stranded nucleotide sequence of the
HCV cDNA insert in clone 5-1-1, and the putative amino acid
sequence of the polypeptide encoded therein.
[0142] FIG. 2 shows the homologies of the overlapping HCV cDNA
sequences in clones 5-1-1, 81, 1-2, and 91.
[0143] FIG. 3 shows a composite sequence of HCV cDNA derived from
overlapping clones 81, 1-2, and 91, and the amino acid sequence
encoded therein.
[0144] FIG. 4 shows the double-stranded nucleotide sequence of the
HCV cDNA insert in clone 81, and the putative amino acid sequence
of the polypeptide encoded therein.
[0145] FIG. 5 shows the HCV cDNA sequence in clone 36, the segment
which overlaps the NANBV cDNA of clone 81, and the polypeptide
sequence encoded within clone 36.
[0146] FIG. 6 shows the combined ORF of HCV cDNAs in clones 36 and
81, and the polypeptide encoded therein.
[0147] FIG. 7 shows the HCV cDNA sequence in clone 32, the segment
which overlaps clone 81, and the polypeptide encoded therein.
[0148] FIG. 8 shows the HCV cDNA sequence in clone 35, the segment
which overlaps clone 36, and the polypeptide encoded therein.
[0149] FIG. 9 shows the combined ORF of HCV cDNAs in clones 35, 36,
81, and 32, and the polypeptide encoded therein.
[0150] FIG. 10 shows the HCV cDNA sequence in clone 37b, the
segment which overlaps clone 35, and the polypeptide encoded
therein.
[0151] FIG. 11 shows the HCV cDNA sequence in clone 33b, the
segment which overlaps clone 32, and the polypeptide encoded
therein.
[0152] FIG. 12 shows the HCV cDNA sequence in clone 40b, the
segment which overlaps clone 37b, and the polypeptide encoded
therein.
[0153] FIG. 13 shows the HCV cDNA sequence in clone 25c, the
segment which overlaps clone 33b, and the polypeptide encoded
therein.
[0154] FIG. 14 shows the nucleotide sequence and polypeptide
encoded therein of the ORF which extends through the HCV cDNAs in
clones 40b, 37b, 35, 36, 81, 32, 33b, and 25c.
[0155] FIG. 15 shows the HCV cDNA sequence in clone 33c, the
segment which overlaps clones 40b and 33c, and the amino acids
encoded therein.
[0156] FIG. 16 shows the HCV cDNA sequence in clone 8h, the segment
which overlaps clone 33c, and the amino acids encoded therein.
[0157] FIG. 17 shows the HCV cDNA sequence in clone 7e, the segment
which overlaps clone 8h, and the amino acids encoded therein.
[0158] FIG. 18 shows the HCV cDNA sequence in clone 14c, the
segment which overlaps clone 25c, and the amino acids encoded
therein.
[0159] FIG. 19 shows the HCV cDNA sequence in clone 8f, the segment
which overlaps clone 14c, and the amino acids encoded therein.
[0160] FIG. 20 shows the HCV cDNA sequence in clone 33f, the
segment which overlaps clone 8f, and the amino acids encoded
therein.
[0161] FIG. 21 shows the HCV cDNA sequence in clone 33g, the
segment which overlaps clone 33f, and the amino acids encoded
therein.
[0162] FIG. 22 shows the HCV cDNA sequence in clone 7f, the segment
which overlaps the sequence in clone 7e, and the amino acids
encoded therein.
[0163] FIG. 23 shows the HCV cDNA sequence in clone 11b, the
segment which overlaps the sequence in clone 7f, and the amino
acids encoded therein.
[0164] FIG. 24 shows the HCV cDNA sequence in clone 14i, the
segment which overlaps the sequence in clone 11b, and the amino
acids encoded therein.
[0165] FIG. 25 shows the HCV cDNA sequence in clone 39c, the
segment which overlaps the sequence in clone 33g, and the amino
acids encoded therein.
[0166] FIG. 26 shows a composite HCV cDNA sequence derived from the
aligned cDNAs in clones 14i, 11b, 7f, 7e, 8h, 33c 40b 37b 35 36,
81, 32, 33b, 25c, 14c, 8f, 33f, and 33g; also shown is the amino
acid sequence of the polypeptide encoded in the extended ORF in the
derived sequence.
[0167] FIG. 27 shows the sequence of the HCV cDNA in clone 12f, the
segment which overlaps clone 14i, and the amino acids encoded
therein.
[0168] FIG. 28 shows the sequence of the HCV cDNA in clone 35f, the
segment which overlaps clone 39c, and the amino acids encoded
therein.
[0169] FIG. 29 shows the sequence of the HCV cDNA in clone 19g, the
segment which overlaps clone 35f, and the amino acids encoded
therein.
[0170] FIG. 30 shows the sequence of clone 26g, the segment which
overlaps clone 19g, and the amino acids encoded therein.
[0171] FIG. 31 shows the sequence of clone 15e, the segment which
overlaps clone 26g, and the amino acids encoded therein.
[0172] FIG. 32 shows the sequence in a composite cDNA, which was
derived by aligning clones 12f through 15e in the 5' to 3'
direction; it also shows the amino acids encoded in the continuous
ORF.
[0173] FIG. 33 shows a photograph of Western blots of a fusion
protein, SOD-NANB.sub.5-1-1'with chimpanzee serum from chimpanzees
infected with BB-NANB, HAV, and HBV.
[0174] FIG. 34 shows a photograph of Western blots of a fusion
protein, SOD-NANB.sub.5-1-1', with serum from humans infected with
NANBV, HAV, HBV, and from control humans.
[0175] FIG. 35 is a map showing the significant features of the
vector pAB24.
[0176] FIG. 36 shows the putative amino acid sequence of the
carboxy-terminus of the fusion polypeptide C100-3 and the
nucleotide sequence encoding it.
[0177] FIG. 37A is a photograph of a coomassie blue stained
polyacrylamide gel which identifies C10-3 expressed in yeast.
[0178] FIG. 37B shows a Western blot of C100-3 with serum from a
NANBV infected human.
[0179] FIG. 38 shows an autoradiograph of a Northern blot of RNA
isolated from the liver of a BB-NANBV infected chimpanzee, probed
with BB-NANBV cDNA of clone-81.
[0180] FIG. 39 shows an autoradiograph of NANBV nucleic acid
treated with RNase A or DNase I, and probed with BB-NANBV cDNA of
clone 81.
[0181] FIG. 40 shows an autoradiograph of nucleic acids extracted
from NANBV particles captured from infected plasma with
anti-NANB.sub.5-1-1'and probed with .sup.32P-labeled NANBV cDNA
from clone 81.
[0182] FIG. 41 shows autoradiographs of filters containing isolated
NANBV nucleic acids, probed with .sup.32P-labeled plus and minus
strand DNA probes derived from NANBV cDNA in clone 81.
[0183] FIG. 42 shows the homologies between a polypeptide encoded
in HCV cDNA and an NS protein from Dengue flavivirus.
[0184] FIG. 43 shows a histogram of the distribution of HCV
infection in random samples, as determined by an ELISA
screening.
[0185] FIG. 44 shows a histogram of the distribution of HCV
infection in random samples using two configurations of
immunoglobulin-enzyme conjugate in an ELISA assay.
[0186] FIG. 45 shows the sequences in a primer mix, derived from a
conserved sequence in NS1 of flaviviruses.
[0187] FIG. 46 shows the HCV cDNA sequence in clone k9-1, the
segment which overlaps the cDNA in FIG. 26, and the amino acids
encoded therein.
[0188] FIG. 47 shows the sequence in a composite cDNA which was
derived by aligning clones k9-1 through 15e in the 5' to 3'
direction; it also shows the amino acids encoded in the continuous
ORF.
[0189] FIG. 48 shows the nucleotide sequence of HCV cDNA in clone
13i, the amino acids encoded therein, and the sequences which
overlap with clone 12f.
[0190] FIG. 49 shows the nucleotide sequence of HCV cDNA in clone
26j, the amino acids encoded therein, and the sequences which
overlap clone 13i.
[0191] FIG. 50 shows the nucleotide sequence of HCV cDNA in clone
CA59a, the amino acids encoded therein, and the sequences which
overlap with clones 26j and K9-1.
[0192] FIG. 51 shows the nucleotide sequence of HCV cDNA in clone
CA84a, the amino acids encoded therein, and the sequences which
overlap with clone CA59a.
[0193] FIG. 52 shows the nucleotide sequence of HCV cDNA in clone
CA156e, the amino acids encoded therein, and the sequences which
overlap with CA84a.
[0194] FIG. 53 shows the nucleotide sequence of HCV cDNA in clone
CA167b, the amino acids encoded therein, and the sequences which
overlap CA156e.
[0195] FIG. 54 shows the ORF of HCV cDNA derived from clones pi14a,
CA167b, CA156e, CA84a, CA59a, K9-1, 12f, 14i, 11b, 7f, 7e, 8h, 33c,
40b, 37b, 35, 36, 81, 32, 33b, 25c, 14c, 8f, 33f, 33g, 39c, 35f,
19g, 26g, and 15e.
[0196] FIG. 55 shows the hydrophobicity profiles of polyproteins
encoded in HCV and in West Nile virus.
[0197] FIG. 56 shows the nucleotide sequence of HCV cDNA in clone
CA216a, the amino acids encoded therein, and the overlap with clone
CA167b.
[0198] FIG. 57 shows the nucleotide sequence of HCV cDNA in clone
CA290a, the amino acids encoded therein, and the overlap with clone
CA216a.
[0199] FIG. 58 shows the nucleotide sequence of HCV cDNA in clone
ag30a and the overlap with clone CA290a.
[0200] FIG. 59 shows the nucleotide sequence of HCV cDNA in clone
CA205a, and the overlap with the HCV cDNA sequence in clone
CA290a.
[0201] FIG. 60 shows the nucleotide sequence of HCV cDNA in clone
18g, and the overlap with the HCV cDNA sequence in clone ag30a.
[0202] FIG. 61 shows the nucleotide sequence of HCV cDNA in clone
16jh, the amino acids encoded therein, and the overlap of
nucleotides with the HCV cDNA sequence in clone 15e.
[0203] FIG. 62 shows the composite sequence of the HCV cDNA sense
strand deduced from overlapping clones b114a, 18g, ag30a, CA205a,
CA290a, CA216a, pi14a, CA167b, CA156e, CA84a, CA59a, K9-1 (also
called k9-1), 26j, 13i, 12f, 14i, 11b, 7f, 7e, 8h, 33c, 40b, 37b,
35, 36, 81, 32, 33b, 25c, 14c, 8f, 33f, 33g, 39c, 35f, 19g, 26g,
15e, b5a, and 16jh.
[0204] FIG. 62A shows the sequence of FIG. 62, but includes the
complementary cDNA strand.
[0205] FIG. 63 shows the relative positions of the clones from
which HCV cDNA was isolated for expression and antigenic mapping of
the putative HCV polyprotein.
[0206] FIG. 64 is a diagram of the immunological colony screening
method used in antigenic mapping studies.
[0207] FIG. 65 presents the antigenicity of polypeptides expressed
from HCV cDNA clones used in an antigenic mapping study of the
putative HCV polyprotein.
[0208] FIG. 66 presents the amino acid sequence of the putative
polyprotein encoded in a composite HCV cDNA sequence shown in FIG.
62.
[0209] FIG. 67 is a tracing of the hydrophilicity/hydrophobicity
profile and of the antigenic index of the putative HCV
polyprotein.
[0210] FIG. 68 shows the conserved co-linear peptides in HCV and
Flaviviruses.
[0211] FIG. 69 shows schematic alignment of a flaviviral
polyprotein and a putative HCV polyprotein encoded in the major ORF
of the HCV genome. Also indicated in the figure are the possible
functions of the flaviviral polypeptides cleaved from the flaviral
polyprotein. In addition, the relative placements of the HCV
polypeptides, NANB.sub.5-1-1 and C100, with respect to the putative
HCV polyprotein are indicated.
[0212] FIG. 70 shows relevant characteristics of AcNPV transfer
vectors used for high level expression of nonfused foreign
proteins. It also shows a restriction endonuclease map of the
transfer vector pAc373.
[0213] FIG. 71 shows the nucleotide sequence of clone 6k, the part
of the sequence which overlaps clone 16jh, and the amino acids
encoded therein.
[0214] FIG. 72 shows a composite cDNA sequence derived from
overlapping clones clones b114a, 18g, ag30a, CA205a, CA290a,
CA216a, pi14a, CA167b, CA156e, CA84a, CA59a, K9-1 (also called
k9-1), 26j, 13i, 12f, 14i, 11b, 7f, 7e, 8h, 33c, 40b, 37b, 35, 36,
81, 32, 33b, 25c, 14c, 8f, 33f, 33g, 39c, 35f, 19g, 26g, 15e, b5a,
16jh and 6k; also shown are the amino acids encoded in the positive
strand of the cDNA (which is the equivalent of the HCV RNA).
[0215] FIG. 73 shows the linkers used in the construction of
pS3-56.sub.C100m.
[0216] FIG. 74 shows the nucleotide sequence of the HCV cDNA in
clone 31, the amino acids encoded therein, and putative restriction
enzyme sites encoded therein.
[0217] FIG. 75 shows the nucleotide sequence of the HCV cDNA in
clone p131jh, and its overlap with the nucleotide sequence in clone
6k.
[0218] FIG. 76 shows a flow chart for construction of the
expression vector pC100.sup.-d#3.
[0219] FIG. 77 shows a flow chart for construction of the
expression vector pS2d#9.
[0220] FIG. 78 shows a flow chart for construction of the
expression vector pNS11d/13.
[0221] FIG. 79 shows the nucleotide sequence of HCV cDNA in the
C200-C100 construct, the amino acids encoded therein, and putative
restriction enzyme sites encoded therein.
[0222] FIG. 80 shows the nucleotide consensus sequence of human
isolate 23, variant sequences are shown below the sequence line.
The amino acids encoded in the consensus. sequence are also
shown.
[0223] FIG. 81 shows the nucleotide consensus sequence of human
isolate 27, variant sequences are shown below the sequence line.
The amino acids encoded in the consensus sequence are also
shown.
[0224] FIG. 82 shows the aligned nucleotide sequences of human
isolates 23 and 27 and of HCV1. Homologous sequences are indicated
by the symbol (*). Non homologous sequences are in small
letters.
[0225] FIG. 83 shows the aligned amino acid sequences of human
isolates 23 and 27 and of HCV1. Homologous sequences are indicated
by the symbol (*). Non homologous sequences are in small
letters.
[0226] FIG. 84 is a graph showing the relationship of the EnvL and
EnvR primers to the model flavivirus polyprotein and putative HCV
polyprotein.
[0227] FIG. 85 shows a comparison of the composite aligned
nucleotide sequences of isolates Thorn, EC1, HCT #18, and HCV1.
[0228] FIG. 86 shows a comparison of the nucleotide sequences of
EC10 and a composite of the HCV1 sequence; the EC10 sequence is on
the line above the dots, and the HCV1 sequence is on the line below
the dots.
[0229] FIG. 87 shows a comparison of the amino acid sequences
117-308 (relative to HCV1) encoded in the "EnvL" regions of the
consensus sequences of human isolates HCT #18, JH23, JH 27, Thorne,
EC1 , and of HCV1.
[0230] FIG. 88 shows a comparison of the amino acid sequences
330-360 (relative to HCV1) encoded in the "EnvR" regions of the
consensus sequences of human isolates HCT #18, JH23, JH 27, Thorne,
EC1, and of HCV1.
[0231] FIG. 89 shows a composite cDNA sequence for HCV1, deduced
from overlapping clones b114a, 18g, ag30a, CA205a, CA290a, CA216a,
pi14a, CA167b, CA156e, CA84a, CA59a, K9-1 (also called k9-1),26j,
13i, 12f, 14i, 11b, 7f, 7e, 8h, 33c, 40b, 37b, 35, 36, 81, 32, 33b,
25c, 14c, 8f, 33f, 33g, 39c, 35f, 19g, 26g, 15e, b5a, 16jh, 6k, and
131jh.
[0232] FIG. 90 shows a putative polyprotein encoded in the HCV cDNA
shown in FIG. 89.
[0233] FIG. 91 is a flow chart for the preparation of expression
vector pC22.
MODES FOR CARRYING OUT THE INVENTION
I. Definitions
[0234] The term "hepatitis C virus" has been reserved by workers in
the field for an heretofore unknown etiologic agent of NANBH.
Accordingly, as used herein, "hepatitis C virus" (HCV) refers to an
agent causitive of NANBH, which was formerly referred to as NANBV
and/or BB-NANBV. The terms HCV, NANBV, and BB-NANBV are used
inter-changeably herein. As an extension of this terminology, the
disease caused by HCV, formerly called NANB hepatitis (NANBH), is
called hepatitis C. The terms NANBH and hepatitis C may be used
interchangeably herein.
[0235] HCV is a viral species of which pathogenic strains cause
NANBH, and attenuated strains or defective interfering particles
derived therefrom. As shown infra, the HCV genome is comprised of
RNA. It is known that RNA containing viruses have relatively high
rates of spontaneous mutation, i.e., reportedly on the order of
10.sup.-3 to 10.sup.-4 per incorporated nucleotide (Fields &
Knipe (1986)). Therefore, since heterogeneity and fluidity of
genotype are inherent in RNA viruses, there are multiple
strains/isolates, which may be virulent or avirulent, within the
HCV species. The compositions and methods described herein, enable
the propagation, identification, detection, and isolation of the
various HCV strains or isolates. Moreover, the disclosure herein
allows the preparation of diagnostics and vaccines for the various
strains/isolates, as well as compositions and methods that have
utility in screening procedures for anti-viral agents for
pharmacologic use, such as agents that inhibit replication of
HCV.
[0236] Information on several different strains/isolates of HCV is
disclosed herein, particularly strain or isolate CDC/HCVI (also
called HCV1). Information from one strain or isolate, such as a
partial genomic sequence, is sufficient to allow those skilled in
the art using standard techniques to isolate new strains/isolates
and to identify whether such new strains/isolates are HCV. For
example, several different strains/isolates are described in
Section IV.H.7., infra. These strains, which were obtained from a
number of human sera (and from different geographical areas), were
isolated utilizing the information from the genomic sequence of
HCV1.
[0237] The information provided herein is indicative that HCV may
be distantly related to the flaviviridae. The Flavivirus family
contains a large number of viruses which are small, enveloped
pathogens of man. The morphology and composition of Flavivirus
particles are known, and are discussed in Brinton (1986).
Generally, with respect to morphology, Flaviviruses contain a
central nucleocapsid surrounded by a lipid bilayer. Virions are
spherical and have a diameter of about 40-50 nm. Their cores are
about 25-30 nm in diameter. Along the outer surface of the virion
envelope are projections that are about 5-10 nm long with terminal
knobs about 2 nm in diameter. Typical examples of the family
include Yellow Fever virus, West Nile virus, and Dengue Fever
virus. They possess positive-stranded RNA genomes (.about.11,000
nucleotides) that are slightly larger than that of HCV and encode a
polyprotein precursor of about 3500 amino acids. Individual viral
proteins are cleaved from this precursor polypeptide.
[0238] Using the techniques derived infra, the genomic structure
and the nucleotide sequence of HCV1 genomic RNA has been deduced.
The genome appears to be single-stranded RNA containing 10,000
nucleotides. The genome is positive-stranded, and possesses a
continuous, translational open reading frame (ORF) that encodes a
polyprotein of about 3,000 amino acids. In the ORF, the structural
protein(s) appear to be encoded in approximately the first quarter
of the N-terminus region, with the majority of the polyprotein
responsible for non-structural proteins. When compared with all
known viral sequences, small but significant co-linear homologies
are observed with the non-structural proteins of the flavivirus
family, and with the pestiviruses (which are now also considered to
be part of the Flavirus family).
[0239] A schematic alignment of possible regions of a flaviviral
polyprotein (using Yellow Fever Virus as an example), and of a
putative polyprotein encoded in the major ORF of the HCV genome, is
shown in FIG. FIG. 69. In the figure the possible domains of the
HCV polyprotein are indicated. The flavivirus polyprotein contains,
from the amino terminus to the carboxy terminus, the nucleocapsid
protein (C), the matrix protein (M), the envelope protein (E), and
the non-structural proteins 1, 2 (a+b), 3, 4 (a+b), and 5 (NS1,
NS2, NS3, NS4, and NS5). Based upon the putative amino acids
encoded in the nucleotide sequence of HCV1, a small domain at the
extreme N-terminus of the HCV polyprotein appears similar both in
size and high content of basic residues to the nucleocapsid protein
(C) found at the N-terminus of flaviviral polyproteins. The
non-structural proteins 2, 3, 4, and 5 (NS2-5) of HCV and of yellow
fever virus (YFV) appear to have counter parts of similar size and
hydropathicity, although there is divergence of the amino acid
sequences. However, the region of HCV which would correspond to the
regions of YFV polyprotein which contains the M, E, and NS1 protein
not only differs in sequence, but also appears to be quite
different both in size and hydropathicity. Thus, while certain
domains of the HCV genome may be referred to herein as, for
example, NS1, or NS2, it should be borne in mind that these
designations are speculative; there may be considerable differences
between the HCV family and flaviviruses that have yet to be
appreciated.
[0240] Based upon the nucleotide sequences encoding the
polypeptides NANB.sub.5-1-1 and HCV C100, and the sequence of the
ORF, the relative placements of the 5-1-1 polypeptide and the C100
polypeptide with respect to the putative HCV polyprotein have been
calculated. These are also shown in FIG. 69.
[0241] Different strains, isolates or subtypes of HCV are expected
to contain variations at the amino acid and nucleic acids compared
with HCV1. Many isolates are expected to show much (i.e., more than
about 40%) homology in the total amino acid sequence compared with
HCV1. However, it may also be found that there are other less
homologous HCV isolates. These would be defined as HCV according to
various criteria such as, for example, an ORF of approximately
9,000 nucleotides to approximately 12,000 nucleotides, encoding a
polyprotein similar in size to that of HCV1, an encoded polyprotein
of similar hydro-phobic and/or antigenic character to that of HCV1,
and the presence of co-linear peptide sequences that are conserved
with HCV1. In addition, the genome would be a positive-stranded
RNA.
[0242] HCV encodes at least one epitope which is immunologically
identifiable with an epitope in the HCV genome from which the cDNAs
described herein are derived; preferably the epitope is contained
in an amino acid sequence described herein. The epitope is unique
to HCV when compared to previously known Flaviviruses. The
uniqueness of the epitope may be determined by its immunological
reactivity with anti-HCV antibodies and lack of immunological
reactivity with antibodies to known Flavivirus species. Methods for
determining immunological reactivity are known in the art, for
example, by radioimmunoassay, by Elisa assay, by hemagglutination,
and several examples of suitable techniques for assays are provided
herein.
[0243] In addition to the above, the following parameters of
nucleic acid homology and amino acid homology are applicable,
either alone or in combination, in identifying a strain/isolate as
HCV. Since HCV strains and isolates are evolutionarily related, it
is expected that the overall homology of the genomes at the
nucleotide level may be about 10% or greater, probably will be
about 40% or greater, probably about 60% or greater, and even more
probably about 80% or greater; and in addition that there will be
corresponding contiguous sequences of at least about 13
nucleotides. It should be noted, as shown infra, that there are
variable and hypervariable regions within the HCV genome;
therefore, the homology in these regions is expected to be
significantly less than that in the overall genome. The
correspondence between the putative HCV strain genomic sequence
and, for example, the CDC/HCV1 cDNA sequence can be determined by
techniques known in the art. For example, they can be determined by
a direct comparison of the sequence information of the
polynucleotide from the putative HCV, and the HCV cDNA sequence(s)
described herein. For example, also, they can be determined by
hybridization of the polynucleotides under conditions which form
stable duplexes between homologous regions (for example, those
which would be used prior to S.sub.1 digestion), followed by
digestion with single stranded specific nuclease(s), followed by
size determination of the digested fragments.
[0244] Because of the evolutionary relationship of the strains or
isolates of HCV, putative HCV strains or isolates are identifiable
by their homology at the polypeptide level. Generally, HCV strains
or isolates are expected to be at least 10% homologous, more than
about 40% homologous, probably more than about 70% homologous, and
even more probably more than about 80% homologous, and some may
even be more than about 90% homologous at the polypeptide level.
The techniques for determining amino acid sequence homology are
known in the art. For example, the amino acid sequence may be
determined directly and compared to the sequences provided herein.
Alternatively the nucleotide sequence of the genomic material of
the putative HCV may be determined (usually via a cDNA
intermediate), the amino acid sequence encoded therein can be
determined, and the corresponding regions compared.
[0245] As used herein, a polynucleotide "derived from" a designated
sequence refers to a polynucleotide sequence which is comprised of
a sequence of approximately at least about 6 nucleotides,
preferably at least about 8 nucleotides, more preferably at least
about 10-12 nucleotides, and even more preferably at least about
15-20 nucleotides corresponding to a region of the designated
nucleotide sequence. "Corresponding" means homologous to or
complementary to the designated sequence. Preferably, the sequence
of the region from which the polynucleotide is derived is
homologous to or complementary to a sequence which is unique to an
HCV genome. Whether or not a sequence is unique to the HCV genome
can be determined by techniques known to those of skill in the art.
For example, the sequence can be compared to sequences in
databanks, e.g., Genebank, to determine whether it is present in
the uninfected host or other organisms. The sequence can also be
compared to the known sequences of other viral agents, including
those which are known to induce hepatitis, e.g., HAV, HBV, and HDV,
and to members of the Flaviviridae. The correspondence or
non-correspondence of the derived sequence to other sequences can
also be determined by hybridization under the appropriate
stringency conditions. Hybridization techniques for determining the
complementarity of nucleic acid sequences are known in the art, and
are discussed infra. See also, for example, Maniatis et al. (1982).
In addition, mismatches of duplex polynucleotides formed by
hybridization can be determined by known techniques, including for
example, digestion with a nuclease such as S1 that specifically
digests single-stranded areas in duplex polynucleotides. Regions
from which typical DNA sequences may be "derived" include but are
not limited to, for example, regions encoding specific epitopes, as
well as non-transcribed and/or non-translated regions.
[0246] The derived polynucleotide is not necessarily physically
derived from the nucleotide sequence shown, but may be generated in
any manner, including for example, chemical synthesis or DNA
replication or reverse transcription or transcription. In addition,
combinations of regions corresponding to that of the designated
sequence may be modified in ways known in the art to be consistent
with an intended use.
[0247] Similarly, a polypeptide or amino acid sequence "derived
from" a designated nucleic acid sequence refers to a polypeptide
having an amino acid sequence identical to that of a polypeptide
encoded in the sequence, or a portion thereof wherein the portion
consists of at least 3-5 amino acids, and more preferably at least
8-10 amino acids, and even more preferably at least 11-15 amino
acids, or which is immunologically identifiable with a polypeptide
encoded in the sequence. This terminology also includes a
polypeptide expressed from a designated nucleic acid sequence.
[0248] A recombinant or derived polypeptide is not necessarily
translated from a designated nucleic acid sequence, for example,
the sequences in Section IV.A, or from an HCV genome; it may be
generated in any manner, including for example, chemical synthesis,
or expression of a recombinant expression system, or isolation from
HCV, including mutated HCV. A recombinant or derived polypeptide
may include one or more analogs of amino acids or unnatural amino
acids in its sequence. Methods of inserting analogs of amino acids
into a sequence are known in the art. It also may include one or
more labels, which are known to those of skill in the art.
[0249] The term "recombinant polynucleotide" as used herein intends
a polynucleotide of genomic, cDNA, semisynthetic, or synthetic
origin which, by virtue of its origin or manipulation: (1) is not
associated with all or a portion of a polynucleotide with which it
is associated in nature, (2) is linked to a polynucleotide other
than that to which it is linked in nature, or (3) does not occur in
nature.
[0250] The term "polynucleotide" as used herein refers to a
polymeric form of nucleotides of any length, either ribonucleotides
or deoxyribonucleotides. This term refers only to the primary
structure of the molecule. Thus, this term includes double- and
single-stranded DNA and RNA. It also includes known types of
modifications, for example, labels which are known in the art,
methylation, "caps", substitution of one or more of the naturally
occurring nucleotides with an analog, internucleotide modifications
such as, for example, those with uncharged linkages (e.g., methyl
phosphonates, phosphotriesters, phosphoamidates, carbamates, etc.)
and with charged linkages (e.g., phosphorothioates,
phosphorodithioates, etc.), those containing pendant moieties, such
as, for example proteins (including for e.g., nucleases, toxins,
antibodies, signal peptides, poly-L-lysine, etc.), those with
intercalators (e.g., acridine, psoralen, etc.), those containing
chelators (e.g., metals, radioactive metals, boron, oxidative
metals, etc.), those containing alkylators, those with modified
linkages (e.g., alpha anomeric nucleic acids, etc.), as well as
unmodified forms of the polynucleotide.
[0251] The term "purified viral polynucleotide" refers to an HCV
genome or fragment thereof which is essentially free, i.e.,
contains less than about 50%, preferably less than about 70%, and
even more preferably less than about 90% of polypeptides with which
the viral polynucleotide is naturally associated. Techniques for
purifying viral polynucleotides from viral particles are known in
the art, and include for example, disruption of the particle with a
chaotropic agent, differential extraction and separation of the
polynucleotide(s) and polypeptides by ion-exchange chromatography,
affinity chromatography, and sedimentation according to
density.
[0252] The term "purified viral polypeptide" refers to an HCV
polypeptide or fragment thereof which is essentially free, i.e.,
contains less than about 50%, preferably less than about 70%, and
even more preferably less than about 90%, of cellular components
with which the viral polypeptide is naturally associated.
Techniques for purifying viral polypeptides are known in the art,
and examples of these techniques are discussed infra.
[0253] "Recombinant host cells", "host cells", "cells", "cell
lines", "cell cultures", and other such terms denoting
microorganisms or higher eukaryotic cell lines cultured as
unicellular entities refer to cells which can be, or have been,
used as recipients for recombinant vector or other transfer DNA,
and include the progeny of the original cell which has been
transfected. It is understood that the progeny of a single parental
cell may not necessarily be completely identical in morphology or
in genomic or total DNA complement as the original parent, due to
natural, accidental, or deliberate mutation.
[0254] A "replicon" is any genetic element, e.g., a plasmid, a
chromosome, a virus, a cosmid, etc. that behaves as an autonomous
unit of polynucleotide replication within a cell; i.e., capable of
replication under its own control.
[0255] A "vector" is a replicon in which another polynucleotide
segment is attached, so as to bring about the replication and/or
expression of the attached segment. "Control sequence" refers to
polynucleotide sequences which are necessary to effect the
expression of coding sequences to which they are ligated. The
nature of such control sequences differs depending upon the host
organism; in prokaryotes, such control sequences generally include
promoter, ribosomal binding site, and terminators; in eukaryotes,
generally, such control sequences include promoters, terminators
and, in some instances, enhancers. The term "control sequences" is
intended to include, at a minimum, all components whose presence is
necessary for expression, and may also include additional
components whose presence is advantageous, for example, leader
sequences.
[0256] "Operably linked" refers to a juxtaposition wherein the
components so described are in a relationship permitting them to
function in their intended manner. A control sequence "operably
linked" to a coding sequence is ligated in such a way that
expression of the coding sequence is achieved under conditions
compatible with the control sequences.
[0257] An "open reading frame" (ORF) is a region of a
polynucleotide sequence which encodes a polypeptide; this region
may represent a portion of a coding sequence or a total coding
sequence.
[0258] A "coding sequence" is a polynucleotide sequence which is
transcribed into mRNA and/or translated into a polypeptide when
placed under the control of appropriate regulatory sequences. The
boundaries of the coding sequence are determined by a translation
start codon at the 5'-terminus and a translation stop codon at the
3'-terminus. A coding sequence can include, but is not limited to
mRNA, cDNA, and recombinant polynucleotide sequences.
[0259] "Immunologically identifiable with/as" refers to the
presence of epitope(s) and polypeptides(s) which are also present
in the designated polypeptide(s), usually HCV proteins.
Immunological identity may be determined by antibody binding and/or
competition in binding; these techniques are known to those of
average skill in the art, and are also illustrated infra.
[0260] As used herein, "epitope" refers to an antigenic determinant
of a polypeptide. An epitope could comprise 3 amino acids in a
spatial conformation which is unique to the epitope. Generally an
epitope consists of at least 5 such amino acids, and more usually,
consists of at least 8-10 such amino acids. Methods of determining
the spatial conformation of amino acids are known in the art, and
include, for example, x-ray crystallography and 2-dimensional
nuclear magnetic resonance.
[0261] A polypeptide is "immunologically reactive" with an antibody
when it binds to an antibody due to antibody recognition of a
specific epitope contained within the polypeptide. Immunological
reactivity may be determined by antibody binding, more particularly
by the kinetics of antibody binding, and/or by competition in
binding using as competitor(s) a known polypeptide(s) containing an
epitope against which the antibody is directed. The techniques for
determining whether a polypeptide is immunologically reactive with
an antibody are known in the art.
[0262] As used herein, the term "antibody" refers to a polypeptide
or group of polypeptides which are comprised of at least one
antibody combining site. An "antibody combining site" or "binding
domain" is formed from the folding of variable domains of an
antibody molecule(s) to form three-dimensional binding spaces with
an internal surface shape and charge distribution complementary to
the features of an epitope of an antigen, which allows an
immunological reaction with the antigen. An antibody combining site
may be formed from a heavy and/or a light chain domain (VH and VL,
respectively), which form hypervariable loops which contribute to
antigen binding. The term "antibody" includes, for example,
vertebrate antibodies, hybrid antibodies, chimeric antibodies,
altered antibodies, univalent antibodies, the Fab proteins, and
single domain antibodies.
[0263] AS used herein, a "single domain antibody" (dAb) is an
antibody which is comprised of an VH domain, which reacts
immunologically with a designated antigen. A dAB does not contain a
VL domain, but may contain other antigen binding domains known to
exist in antibodies, for example, the kappa and lambda domains.
Methods for preparing dABs are known in the art. See, for example,
Ward et al. (1989).
[0264] Antibodies may also be comprised of VH and VL domains, as
well as other known antigen binding domains. Examples of these
types of antibodies and methods for their preparation are known in
the art (see, e.g., U.S. Pat. No. 4,816,467, which is incorporated
herein by reference), and include the following. For example,
"vertebrate antibodies" refers to antibodies which are tetramers or
aggregates thereof, comprising light and heavy chains which are
usually aggregated in a "Y" configuration and which may or may not
have covalent linkages between the chains. In vertebrate
antibodies, the amino acid sequences of all the chains of a
particular antibody are homologous with the chains found in one
anti-body produced by the lymphocyte which produces that anti-body
in situ, or in vitro (for example, in hybridomas). Vertebrate
antibodies typicallly include native antibodies, for example,
purified polyclonal antibodies and monoclonal antibodies. Examples
of the methods for the preparation of these antibodies are
described infra.
[0265] "Hybrid antibodies" are antibodies wherein one pair of heavy
and light chains is homologous to those in a first antibody, while
the other pair of heavy and light chains is homologous to those in
a different second anti-body. Typically, each of these two pairs
will bind different epitopes, particularly on different antigens.
This results in the property of "divalence", i.e., the ability to
bind two antigens simultaneously. Such hybrids may also be formed
using chimeric chains, as set forth below.
[0266] "Chimeric antibodies", are antibodies in which the heavy
and/or light chains are fusion proteins. Typically the constant
domain of the chains is from one particular species and/or class,
and the variable domains are from a different species and/or class.
Also included is any antibody in which either or both of the heavy
or light chains are composed of combinations of sequences mimicking
the sequences in antibodies of different sources, whether these
sources be differing classes, or different species of origin, and
whether or not the fusion point is at the variable/constant
boundary. Thus, it is possible to produce antibodies in which
neither the constant nor the variable region mimic known antibody
sequences. It then becomes possible, for example, to construct
antibodies whose variable region has a higher specific affinity for
a particular antigen, or whose constant region can elicit enhanced
complement fixation, or to make other improvements in properties
possessed by a particular constant region.
[0267] Another example is "altered antibodies", which refers to
antibodies in which the naturally occurring amino acid sequence in
a vertebrate antibody has been varied. Utilizing recombinant DNA
techniques, antibodies can be redesigned to obtain desired
characteristics. The possible variations are many, and range from
the changing of one or more amino acids to the complete redesign of
a region, for example, the constant region. Changes in the constant
region, in general, to attain desired cellular process
characteristics, e.g., changes in complement fixation, interaction
with membranes, and other effector functions. Changes in the
variable region may be made to alter antigen binding
characeristics. The antibody may also be engineered to aid the
specific delivery of a molecule or substance to a specific cell or
tissue site. The desired alterations may be made by known
techniques in molecular biology, e.g., recombinant techniques, site
directed mutagenesis, etc.
[0268] Yet another example are "univalent antibodies", which are
aggregates comprised of a heavy chain/light chain dimer bound to
the Fc (i.e., constant) region of a second heavy chain. This type
of antibody escapes antigenic modulation. See, e.g., Glennie et al.
(1982).
[0269] Included also within the definition of antibodies are "Fab"
fragments of antibodies. The "Fab'" region refers to those portions
of the heavy and light chains which are roughly equivalent, or
analogous, to the sequences which comprise the branch portion of
the heavy and light chains, and which have been shown'to exhibit
immunological binding to a specified antigen, but which lack the
effector Fc portion . "Fab" includes aggregates of one heavy and
one light chain (commonly known as Fab'), as well as tetramers
containing the 2H and 2L chains (referred to as F(ab).sub.2), which
are capable of selectively reacting with a designated antigen or
antigen family. "Fab" antibodies may be divided into subsets
analogous to those described above, i.e, "vertebrate Fab", "hybrid
Fab", "chimeric Fab", and "altered Fab". Methods of producing "Fab"
fragments of antibodies are known within the art and include, for
example, proteolysis, and synthesis by recombinant techniques.
[0270] As used herein, the term "immunogenic polypeptide" is a
polypeptide that elicits a cellular and/or humoral immune response,
whether alone or linked to a carrier in the presence or absence of
an adjuvant.
[0271] The term "polypeptide" refers to a polymer of amino acids
and does not refer to a specific length of the product; thus,
peptides, oligopeptides, and proteins are included within the
definition of polypeptide. This term also does not refer to or
exclude post-expression modifications of the polypeptide, for
example, glycosylations, acetylations, phosphorylations and the
like. Included within the definition are, for example, polypeptides
containing one or more analogs of an amino acid (including, for
example, unnatural amino acids, etc.), polypeptides with
substituted linkages, as well as other modifications known in the
art, both naturally occurring and non-naturally occurring.
[0272] "Transformation", as used herein, refers to the insertion of
an exogenous polynucleotide into a host cell, irrespective of the
method used for the insertion, for example, direct uptake,
transduction, f-mating or electroporation. The exogenous
polynucleotide may be maintained as a non-integrated vector, for
example, a plasmid, or alternatively, may be integrated into the
host genome.
[0273] "Treatment" as used herein refers to prophylaxis and/or
therapy.
[0274] An "individual", as used herein, refers to vertebrates,
particularly members of the mammalian species, and includes but is
not limited to domestic animals, sports animals, and primates,
including humans.
[0275] As used herein, the "sense strand" of a nucleic acid
contains the sequence that has sequence homology to that of mRNA.
The "anti-sense strand" contains a sequence which is complementary
to that of the "sense strand".
[0276] As used herein, a "positive stranded genome" of a virus is
one in which the genome, whether RNA or DNA, is single-stranded and
which encodes a viral polypeptide(s). Examples of positive stranded
RNA viruses include Togaviridae, Coronaviridae, Retroviridae,
Picornaviridae, and Caliciviridae. Included also, are the
Flaviviridae, which were formerly classified as Togaviradae. See
Fields & Knipe (1986).
[0277] As used herein, "antibody containing body component" refers
to a component of an individual's body which is a source of the
antibodies of interest. Anti-body containing body components are
known in the art, and include but are not limited to, for example,
plasma, serum, spinal fluid, lymph fluid, the external sections of
the respiratory, intestinal, and genitourinary tracts, tears,
saliva, milk, white blood cells, and myelomas.
[0278] As used herein, "purified HCV" refers to a preparation of
HCV which has been isolated from the cellular constituents with
which the virus is normally associated, and from other types of
viruses which may be present in the infected tissue. The techniques
for isolating viruses are known to those of skill in the art, and
include, for example, centrifugation and affinity chromatography; a
method of preparing purified HCV is discussed infra.
[0279] The term "HCV particles" as used herein include entire
virion as well as particles which are intermediates in virion
formation. HCV particles generally have one or more HCV proteins
associated with the HCV nucleic acid.
[0280] As used herein, the term "probe" refers to a polynucleotide
which forms a hybrid structure with a sequence in a target region,
due to complementarity of at least one sequence in the probe with a
sequence in the target region.
[0281] As used herein, the term "target region" refers to a region
of the nucleic acid which is to be amplified and/or detected.
[0282] As used herein, the term "viral RNA", which includes HCV
RNA, refers to RNA from the viral genome, fragments thereof,
transcripts thereof, and mutant sequences derived therefrom.
[0283] As used herein, a "biological sample" refers to a sample of
tissue or fluid isolated from an individual, including but not
limited to, for example, plasma, serum, spinal fluid, lymph fluid,
the external sections of the skin, respiratory, intestinal, and
genitourinary tracts, tears, saliva, milk, blood cells, tumors,
organs, and also samples of in vitro cell culture constituents
(including but not limited to conditioned medium resulting from the
growth of cells in cell culture medium, putatively virally infected
cells, recombinant cells, and cell components).
II. Description of the Invention
[0284] The practice of the present invention will employ, unless
otherwise indicated, conventional techniques of molecular biology,
microbiology, recombinant DNA, and immunology, which are within the
skill of the art. Such techniques are explained fully in the
literature. See e.g., Maniatis, Fitsch & Sambrook, MOLECULAR
CLONING; A LABORATORY MANUAL (1982); DNA CLONING, VOLUMES I AND II
(D. N Glover ed. 1985); OLIGONUCLEOTIDE SYNTHESIS (M. J. Gait ed,
1984); NUCLEIC ACID HYBRIDIZATION (B. D. Hames & S. J. Higgins
eds. 1984); TRANSCRIPTION AND TRANSLATION (B. D. Hames & S. J.
Higgins, eds. 1984); ANIMAL CELL CULTURE (R. I. Freshney ed. 1986);
IMMOBILIZED CELLS AND ENZYMES (IRL Press, 1986); B. Perbal, A
PRACTICAL GUIDE TO MOLECULAR CLONING, (1984); the series, METHODS
IN ENZYMOLOGY (Academic Press, Inc.); GENE TRANSFER VECTORS FOR
MAMMALIAN CELLS (J. H. Miller and M. P. Calos eds. 1987, Cold
Spring Harbor Laboratory), Methods in Enzymology Vol. 154 and Vol.
155 (Wu and Grossman, and Wu, eds., respectively), Mayer and
Walker, eds. (1987), IMMUNOCHEMICAL METHODS IN CELL AND MOLECULAR
BIOLOGY (Academic Press, London), Scopes, (1987), PROTEIN
PURIFICATION: PRINCIPLES AND PRACTICE, Second Edition
(Springer-Verlag, N.Y.), and HANDBOOK OF EXPERIMENTAL IMMUNOLOGY,
VOLUMES I-IV (D. M. Weir and C. C. Blackwell eds 1986). All
patents, patent applications, and publications mentioned herein,
both supra and infra, are hereby incorporated herein by
reference.
[0285] The useful materials and processes of the present invention
are made possible by the provision of a family of closely
homologous nucleotide sequences isolated from a cDNA library
derived from nucleic acid sequences present in the plasma of an HCV
infected chimpanzee. This family of nucleotide sequences is not of
human or chimpanzee origin, since it hybridizes to neither human.
nor chimpanzee genomic DNA from uninfected individuals, since
nucleotides of this family of sequences are present only in liver
and plasma of chimpanzees with HCV infection, and since the
sequence is not present in Genebank. In addition, the family of
sequences shows no significant homology to sequences contained
within the HBV genome.
[0286] The sequence of one member of the family, contained within
clone 5-1-1, has one continuous open reading frame (ORF) which
encodes a polypeptide of approximately 50 amino acids. Sera from
HCV infected humans contain antibodies which bind to this
polypeptide, whereas sera from non-infected humans do not contain
antibodies to this polypeptide. Moreover, whereas the sera from
uninfected chimpanzees do not contain antibodies to this
polypeptide, the antibodies are induced in chimpanzees following
acute NANBH infection. In addition, antibodies to this polypeptide
are not detected in chimps and. humans infected with HAV and HBV.
By these criteria the sequence is a cDNA to a viral sequence,
wherein the virus causes or is associated with NANBH; this cDNA
sequence is shown in FIG. 1. As discussed infra, the cDNA sequence
in clone 5-1-1 differs from that of the other isolated cDNAs in
that it contains 28 extra base pairs.
[0287] A composite of other identified members of the cDNA family,
which were isolated using as a probe a synthetic sequence
equivalent to a fragment of the cDNA in clone 5-1-1, is shown in
FIG. 3. A member of the cDNA. family which was isolated using a
synthetic sequence derived from the cDNA in clone 81 is shown in
FIG. 5, and the composite of this sequence with that of clone 81 is
shown in FIG. 6. Other members of the cDNA family are described in
Section IV.A. A composite of the cDNAs in these clones is shown in
FIG. 62. The composite cDNA shows that it contains one continuous
ORF, and thus encodes a polyprotein. This data is consistent with
the suggestion, discussed infra., that HCV is a flavi-like
virus.
[0288] The availability of the family of cDNAs shown herein in
Section IV.A permits the construction of DNA probes and
polypeptides useful in diagnosing NANBH due to HCV infection and in
screening blood donors as well as donated blood and blood products
for infection. For example, from the sequences it is possible to
synthesize DNA oligomers of about 8-10 nucleotides, or larger,
which are useful as hybridization probes to detect the presence of
HCV RNA in, for example, sera of subjects suspected of harboring
the virus, or for screening donated blood for the presence of the
virus. The family of cDNA sequences also allows the design and
production of HCV specific polypeptides which are useful as
diagnostic reagents for the presence of antibodies raised during
NANBH. Anti-bodies to purified polypeptides derived from the cDNAs
may also be used to detect viral antigens in infected individuals
and in blood.
[0289] Knowledge of these cDNA sequences also enables the design
and production of polypeptides which may be used as vaccines
against HCV and also for the production of antibodies, which in
turn may be used for protection against the disease, and/or for
therapy of HCV infected individuals.
[0290] Moreover, the family of cDNA sequences enables further
characterization of the HCV genome. Polynucleotide probes derived
from these sequences may be used to screen cDNA libraries for
additional overlapping cDNA sequences, which, in turn, may be used
to obtain more overlapping sequences. Unless the genome is
segmented and the segments lack common sequences, this technique
may be used to gain the sequence of the entire genome. However, if
the genome is segmented, other segments of the genome can be
obtained by repeating the lambda-gt11 serological screening
procedure used to isolate the cDNA clones described herein, or
alternatively by isolating the genome from purified HCV
particles.
[0291] The family of cDNA sequences and the polypeptides derived
from these sequences, as well as antibodies directed against these
polypeptides are also useful in the isolation and identification of
the BB-NANBV agent(s). For example, antibodies directed against HCV
epitopes contained in polypeptides derived from the cDNAs may be
used in processes based upon affinity chromatography to isolate the
virus. Alternatively, the antibodies may be used to identify viral
particles isolated by other techniques. The viral antigens and the
genomic material within the isolated viral particles may then be
further characterized.
[0292] The information obtained from further sequencing of the HCV
genome(s), as well as from further characterization of the HCV
antigens and characterization of the genome enables the design and
synthesis of additional probes and polypeptides and antibodies
which may be used for diagnosis, for prevention, and for therapy of
HCV induced NANBH, and for screening for infected blood and
blood-related products.
[0293] The availability of probes for HCV, including antigens and
antibodies, and polynucleotides derived from the genome from which
the family of cDNAs is derived also allows for the development of
tissue culture systems which will be of major use in elucidating
the biology of HCV. This in turn, may lead to the development of
new treatment regimens based upon antiviral compounds which
preferentially inhibit the replication of, or infection by HCV.
[0294] In addition to the above, the information provided infra
allows the identification of additional HCV strains or isolates.
The isolation and characterization of the additional HCV strains or
isolates may be accomplished by isolating the nucleic acids from
body components which contain viral particles and/or viral RNA,
creating cDNA libraries using polynucleotide probes based on the
HCV cDNA probes described infra., screening the libraries for
clones containing HCV cDNA sequences described infra., and
comparing the HCV cDNAs from the new isolates with the cDNAs
described infra. The polypeptides encoded therein, or in the viral
genome, may be monitored for immunological cross-reactivity
utilizing the polypeptides and antibodies described supra. Strains
or isolates which fit within the parameters of HCV, as described in
the Definitions section, supra., are readily identifiable. Other
methods for identifying HCV strains will be obvious to those of
skill in the art, based upon the information provided herein.
[0295] The method used to identify and isolate the etiologic agent
for NANBH may be applicable to the identification and/or isolation
of heretofore uncharacterized agents which contain a genome, and
which are associated with a variety of diseases, including those
induced by viruses, viroids, bacteria, fungi and parasites. In this
method, a cDNA library was created from the nucleic acids present
in infected tissue from an infected individual. The library was
created in a vector which allowed the expression of polypeptides
encoded in the cDNA. Clones of host cells containing the vector,
which expressed an immunologically reactive fragment of a
polypeptide of the etiologic agent, were selected by immunological
screening of the expression products of the library with an
antibody-containing body component from another individual
previously infected with the putative agent. The steps in the
immunological screening technique included interacting the
expression products of the cDNA containing vectors with the
antibody-containing body component of a second infected individual,
and detecting the formation of antibody-antigen complexes between
the expression product(s) and antibodies of the second infected
individual. The isolated clones are screened further
immunologically by interacting their expression products with the
antibody-containing body components of other individuals infected
with the putative agent and with control individuals uninfected
with the putative agent, and detecting the formation of
antigen-antibody complexes with antibodies from the infected
individuals; and the cDNA containing vectors which encode
polypeptides which react immunologically with antibodies from
infected individuals and individuals suspected of being infected
with the agent, but not with control individuals are isolated. The
infected individuals used for the construction of the cDNA library,
and for the immunological screening need not be of the same
species.
[0296] The cDNAs isolated as a result of this method, and their
expression products, and antibodies directed against the expression
products, are useful in characterizing and/or capturing the
etiologic agent. As described in more detail infra, this method has
been used successfully to isolate a family of cDNAs derived from
the HCV genome.
II.A. Preparation of the cDNA Sequences
[0297] Pooled serum from a chimpanzee with chronic HCV infection
and containing a high titer of the virus, i.e., at least 10.sup.6
chimp infectious doses/ml (CID/ml) was used to isolate viral
particles; nucleic acids isolated from these particles was used as
the template in the construction of a cDNA library to the viral
genome. The procedures for isolation of putative HCV particles and
for constructing the cDNA library in lambda-gt11 is discussed in
Section IV.A.1. Lambda-gt11 is a vector that has been developed
specifically to express inserted cDNAs as fusion polypeptides with
beta-galactosidase and to screen large numbers of recombinant phage
with specific antisera raised against a defined antigen. Huynh, T.
V. et al. (1985). The lambda-gt11 cDNA library generated from a
cDNA pool containing cDNA of approximate mean size of 200 base
pairs was screened for encoded epitopes that could bind
specifically with sera derived from patients who had previously
experienced NANB hepatitis. Approximately 10.sup.6 phages were
screened, and five positive phages were identified, purified, and
then further tested for specificity of binding to sera from
different humans and chimpanzees previously infected with the HCV
agent. One of the phages, 5-1-1, bound 5 of the 8 human sera
tested. This binding appeared selective for sera derived from
patients with prior NANB hepatitis infections since 7 normal blood
donor sera did not exhibit such binding.
[0298] The sequence of the cDNA in recombinant phage 5-1-1 was
determined, and is shown in FIG. 1. The polypeptide encoded by this
cloned cDNA, which is in the same translational frame as the
N-terminal beta-Galactosidase moiety of the fusion polypeptide is
shown above the nucleotide sequence. This translational ORF,
therefore, encodes an epitope(s) specifically recognized by sera
from patients with NANB hepatitis infections.
[0299] The availability of the cDNA in recombinant phage 5-1-1 has
allowed for the isolation of other clones containing additional
segments and/or alternative segments of cDNA to the viral genome.
The lambda-gt11 cDNA library described supra, was screened using a
synthetic polynucleotide derived from the sequence of the cloned
5-1-1 cDNA. This screening yielded three other clones, which were
identified as 81, 1-2 and 91; the cDNAs contained within these
clones were sequenced. See Sections IV.A.3. and IV.A.4. The
homologies between the four independent clones are shown in FIG. 2,
where the homologies are indicated by the vertical lines. Sequences
of nucleotides present uniquely in clones 5-1-1, 81, and 91 are
indicated by small letters.
[0300] The cloned cDNAs present in recombinant phages in clones
5-1-1, 81, 1-2, and 91 are highly homologous, and differ in only
two regions. First, nucleotide number 67 in clone 1-2 is a
thymidine, whereas the other three clones contain a cytidine
residue in this position. This substitution, however, does not
alter the nature of the encoded amino acid.
[0301] The second difference between the clones is that clone 5-1-1
contains 28 base pairs at its 5'-terminus which are not present in
the other clones. The extra sequence may be a 5'-terminal cloning
artifact; 5'-terminal cloning artifacts are commonly observed in
the products of cDNA methods.
[0302] Synthetic sequences derived from the 5'-region and the
3'-region of the HCV cDNA in clone 81 were used to screen and
isolate cDNAs from the lambda-gt11 NANBV cDNA library, which
overlapped clone 81 cDNA (Section IV.A.5.). The sequences of the
resulting cDNAs, which are in clone 36 and clone 32, respectively,
are shown in FIG. 5 and FIG. 7.
[0303] Similarly, a synthetic polynucleotide based on the 5'-region
of clone 36 was used to screen and isolate cDNAs from the lambda
gt-11 NANBV cDNA library which overlapped clone 36 cDNA (Section
IV.A.8.). A purified clone of recombinant phage-containing cDNA
which hybridized to the synthetic polynucleotide probe was named
clone 35 and the NANBV cDNA sequence contained within this clone is
shown in FIG. 8.
[0304] By utilizing the technique of isolating overlapping cDNA
sequences, clones containing additional upstream and downstream HCV
cDNA sequences have been obtained. The isolation of these clones,
is described infra in Section IV.A.
[0305] Analysis of the nucleotide sequences of the HCV cDNAs
encoded within the isolated clones show that the composite cDNA
contains one long continuous ORF. FIG. 62 shows the sequence of the
composite cDNA from these clones, along with the putative HCV
polypeptide encoded therein.
[0306] The description of the method to retrieve the cDNA sequences
is mostly of historical interest. The resultant sequences (and
their complements) are provided herein, and the sequences, or any
portion thereof, could be prepared using synthetic methods, or by a
combination of synthetic methods with retrieval of partial
sequences using methods similar to those described herein.
[0307] The description above, of "walking" the genome by isolating
overlapping cDNA sequences from the HCV lambda gt-11 library
provides one method by which cDNAs corresponding to the entire HCV
genome may be isolated. However, given the information provided
herein, other methods for isolating these cDNAs are obvious to one
of skill in the art. Some of these methods are described in Section
IV.A., infra.
II.B. Preparation of Viral Polypeptides and Fragments
[0308] The availability of cDNA sequences, either those isolated by
utilizing the cDNA sequences described in Section IV.A, as
discussed infra, or nucleotide sequences derived therefrom
(including segments and modifications of the sequence), permits the
construction of expression vectors encoding antigenically active
regions of the polypeptide encoded in either strand. These
antigenically active regions may be derived from coat or envelope
antigens or from core antigens, or from antigens which are
non-structural including, for example, polynucleotide binding
proteins, polynucleotide polymerase(s), and other viral proteins
required for the replication and/or assembly of the virus particle.
Fragments encoding the desired polypeptides are derived from the
cDNA clones using conventional restriction digestion or by
synthetic methods, and are ligated into vectors which may, for
example, contain portions of fusion sequences such as
beta-Galactosidase or superoxide dismutase (SOD), preferably SOD.
Methods and vectors which are useful for the production of
polypeptides which contain fusion sequences of SOD are described in
European Patent Office Publication number 0196056, published Oct.
1, 1986. Vectors encoding fusion polypeptides of SOD and HCV
polypeptides, i.e., NANB.sub.5-1-1'NANB.sub.81, and C100-3, which
is encoded in a composite of HCV cDNAs, are described in Sections
IV.B.1, IV.B.2, and IV.B.4, respectively. Any desired portion of
the HCV cDNA containing an open reading frame, in either sense
strand, can be obtained as a recombinant polypeptide, such as a
mature or fusion protein; alternatively, a polypeptide encoded in
the cDNA can be provided by chemical synthesis.
[0309] The DNA encoding the desired polypeptide, whether in fused
or mature form, and whether or not containing a signal sequence to
permit secretion, may be ligated into expression vectors suitable
for any convenient host. Both eukaryotic and prokaryotic host
systems are presently used in forming recombinant polypeptides, and
a summary of some of the more common control systems and host cell
lines is given in Section III.A., infra. The polypeptide is then
isolated from lysed cells or from the culture medium and purified
to the extent needed for its intended use. Purification may be by
techniques known in the art, for example, differential extraction,
salt fractionation, chromatography on ion exchange resins, affinity
chromatography, centrifugation, and the like. See, for example,
Methods in Enzymology for a variety of methods for purifying
proteins. Such polypeptides can be used as diagnostics, or those
which give rise to neutralizing antibodies may be formulated into
vaccines. Antibodies raised against these polypeptides can also be
used as diagnostics, or for passive immunotherapy. In addition, as
discussed in Section II.J. herein below, antibodies to these
polypeptides are useful for isolating and identifying HCV
particles.
[0310] The HCV antigens may also be isolated from HCV virions. The
virions may be grown in HCV infected cells in tissue culture, or in
an infected host.
II.C. Preparation of Antigenic Polypeptides and Conjugation with
Carrier
[0311] An antigenic region of a polypeptide is generally relatively
small--typically 8 to 10 amino acids or less in length. Fragments
of as few as 5 amino acids may characterize an antigenic region.
These segments may correspond to regions of HCV antigen.
Accordingly, using the cDNAs of HCV as a basis, DNAs encoding short
segments of HCV polypeptides can be expressed recombinantly either
as fusion proteins, or as isolated polypeptides. In addition, short
amino acid sequences can be conveniently obtained by chemical
synthesis. In instances wherein the synthesized polypeptide is
correctly configured so as to provide the correct epitope, but is
too small to be immunogenic, the polypeptide may be linked to a
suitable carrier.
[0312] A number of techniques for obtaining such linkage are known
in the art, including the formation of disulfide linkages using
N-succinimidyl-3-(2-pyridyl-thio)propionate (SPDP) and succinimidyl
4-(N-maleimido-methyl)cyclohexane-1-carboxylate (SMCC) obtained
from Pierce Company, Rockford, Ill., (if the peptide lacks a
sulfhydryl group, this can be provided by addition of a cysteine
residue.) These reagents create a disulfide linkage between
themselves and peptide cysteine residues on one protein and an
amide linkage through the epsilon-amino on a lysine, or other free
amino group in the other. A variety of such disulfide/amide-forming
agents are known. See, for example, Immun. Rev. (1982) 62:185.
Other bifunctional coupling agents form a thioether rather. than a
disulfide linkage. Many of these thio-ether-forming agents are
commercially available and include reactive esters of
6-maleimidocaproic acid, 2-bromoacetic acid, 2-iodoacetic acid,
4-(N-maleimido-methyl)cyclohexane-1-carboxylic acid, and the like.
The carboxyl groups can be activated by combining them with
succinimide or 1-hydroxyl-2-nitro-4-sulfonic acid, sodium salt.
Additional methods of coupling antigens employs the
rotavirus/"binding peptide" system described in EPO Pub. No.
259,149, the disclosure of which is incorporated herein by
reference. The foregoing list is not meant to be exhaustive, and
modifications of the named compounds can clearly be used.
[0313] Any carrier may be used which does not itself induce the
production of antibodies harmful to the host. Suitable carriers are
typically large, slowly metabolized macromolecules such as
proteins; polysaccharides, such as latex functionalized sepharose,
agarose, cellulose, cellulose beads and the like; polymeric amino
acids, such as polyglutamic acid, polylysine, and the like; amino
acid copolymers; and inactive virus particles, see, for example,
section II.D. Especially useful protein substrates are serum
albumins, keyhole limpet hemocyanin, immunoglobulin molecules,
thyroglobulin, ovalbumin, tetanus toxoid, and other proteins well
known to those skilled in the art.
[0314] In addition to full-length viral proteins, polypeptides
comprising truncated HCV amino acid sequences encoding at least one
viral epitope are useful immunological reagents. For example,
polypeptides comprising such truncated sequences can be used as
reagents in an immunoassay. These polypeptides also are candidate
subunit antigens in compositions for antiserum production or
vaccines. While these truncated sequences can be produced by
various known treatments of native viral protein, it is generally
preferred to make synthetic or recombinant polypeptides comprising
an HCV sequence. Polypeptides comprising these truncated HCV
sequences can be made up entirely of HCV sequences (one or more
epitopes, either contiguous or noncontiguous), or HCV sequences and
heterologous sequences in a fusion protein. Useful heterologous
sequences include sequences that provide for secretion from a
recombinant host, enhance the immunological reactivity of the HCV
epitope(s),.or facilitate the coupling of the polypeptide to an
immunoassay support or a vaccine carrier. See, e.g., EPO Pub. No.
116,201; U.S. Pat. No. 4,722,840; EPO Pub. No. 259,149; U.S. Pat.
No. 4,629,783, the disclosures of which are incorporated herein by
reference.
[0315] The size of polypeptides comprising the truncated HCV
sequences can vary widely, the minimum size being a sequence of
sufficient size to provide an HCV epitope, while the maximum size
is not critical. For convenience, the maximum size usually is not
substantially greater than that required to provide the desired HCV
epitopes and function(s) of the heterologous sequence, if any.
Typically, the truncated HCV amino acid sequence will range from
about 5 to about 100 amino acids in length. More typically,
however, the HCV sequence will be a maximum of about 50 amino acids
in length, preferably a maximum of about 30 amino acids. It is
usually desirable to select HCV sequences of at least about 10, 12
or 15 amino acids, up to a maximum of about 20 or 25 amino
acids.
[0316] Truncated HCV amino acid sequences comprising epitopes can
be identified in a number of ways. For example, the entire viral
protein sequence can be screened by preparing a series of short
peptides that together span the entire protein sequence. By
starting with, for example, 100 mer polypeptides, it would be
routine to test each polypeptide for the presence of epitope(s)
showing a desired reactivity, and then testing progressively
smaller and overlapping fragments from an identified 100 mer to map
the epitope of interest. Screening such peptides in an immunoassay
is within the skill of the art. It is also known to carry out a
computer analysis of a protein sequence to identify potential
epitopes, and then prepare oligopeptides comprising the identified
regions for screening. Such a computer analysis of the HCV amino
acid sequence is shown in FIG. 67, where the
hydrophilic/hydrophobic character is displayed above the antigen
index. The amino acids are numbered from the starting MET (position
1) as shown in FIG. 66. It is appreciated by those of skill in the
art that such computer analysis of antigenicity does not always
identify an epitope that actually exists, and can also incorrectly
identify a region of the protein as containing an epitope.
[0317] Examples of HCV amino acid sequences that may be useful as
described herein are set forth below. It is to be understood that
these peptides do not necessarily precisely map one epitope, but
may also contain HCV sequence that is not immunogenic. These
non-immunogenic portions of the sequence can be defined as
described above using conventional techniques and deleted from the
described sequences. Further, additional truncated HCV amino acid
sequences that comprise an epitope or are immunogenic can be
identified as described above. The following sequences are given by
amino acid number (i.e., "AAn") where n is the amino acid number as
shown in FIG. 66: TABLE-US-00001 AA1-AA25; AA1-AA50; AA1-AA84;
AA9-AA177; AA1-AA10; AA5-AA20; AA20-AA25; AA35-AA45; AA50-AA100;
AA40-AA90; AA45-AA65; AA65-AA75; AA80-90; AA99-AA120; AA95-AA110;
AA105-AA120; AA100-AA150; AA150-AA200; AA155-AA170; AA190-AA210;
AA200-AA250; AA220-AA240; AA245-AA265; AA250-AA300; AA290-AA330;
AA290-305; AA300-AA350; AA310-AA330; AA350-AA400; AA380-AA395;
AA405-AA495; AA400-AA450; AA405-AA415; AA415-AA425; AA425-AA435;
AA437-AA582; AA450-AA500; AA440-AA460; AA460-AA470; AA475-AA495;
AA500-AA550; AA511-AA690; AA515-AA550; AA550-AA600; AA550-AA625;
AA575-AA605; AA585-AA600; AA600-AA650; AA600-AA625; AA635-AA665;
AA650-AA700; AA645-AA680; AA700-AA750; AA700-AA725; AA700-AA750;
AA725-AA775; AA770-AA790; AA750-AA800; AA800-AA815; AA825-AA850;
AA850-AA875; AA800-AA850; AA920-AA990; AA850-AA900; AA920-AA945;
AA940-AA965; AA970-AA990; AA950-AA1000; AA1000-AA1060;
AA1000-AA1025; AA1000-AA1050; AA1025-AA1040; AA1040-AA1055;
AA1075-AA1175; AA1050-AA1200; AA1070-AA1100; AA1100-AA1130;
AA1140-AA1165; AA1192-AA1457; AA1195-AA1250; AA1200-AA1225;
AA1225-AA1250; AA1250-AA1300; AA1260-AA1310; AA1260-AA1280;
AA1266-AA1428; AA1300-AA1350; AA1290-AA1310; AA1310-AA1340;
AA1345-AA1405; AA1345-AA1365; AA1350-AA1400; AA1365-AA1380;
AA1380-AA1405; AA1400-AA1450; AA1450-AA1500; AA1460-AA1475;
AA1475-AA1515; AA1475-AA1500; AA1500-AA1550; AA1500-AA1515;
AA1515-AA1550; AA1550-AA1600; AA1545-AA1560; AA1569-AA1931;
AA1570-AA1590; AA1595-AA1610; AA1590-AA1650; AA1610-AA1645;
AA1650-AA1690; AA1685-AA1770; AA1689-AA1805; AA1690-AA1720;
AA1694-AA1735; AA1720-AA1745; AA1745-AA1770; AA1750-AA1800;
AA1775-AA1810; AA1795-AA1850; AA1850-AA1900; AA1900-AA1950;
AA1900-AA1920; AA1915-AA2021; AA1920-AA1940; AA1949-AA2124;
AA1950-AA2000; AA1950-AA1985; AA1980-AA2000; AA2000-AA2050;
AA2005-AA2025; AA2020-AA2045; AA2045-AA2100; AA2045-AA2070;
AA2054-AA2223; AA2070-AA2100; AA2100-AA2150; AA2150-AA2200;
AA2200-AA2250; AA2200-AA2325; AA2250-AA2330; AA2255-AA2270;
AA2265-AA2280; AA2280-AA2290; AA2287-AA2385; AA2300-AA2350;
AA2290-AA2310; AA2310-AA2330; AA2330-AA2350; AA2350-AA2400;
AA2348-AA2464; AA2345-AA2415; AA2345-AA2375; AA2370-AA2410;
AA2371-AA2502; AA2400-AA2450; AA2400-AA2425; AA2415-AA2450;
AA2445-AA2500; AA2445-AA2475; AA2470-AA2490; AA2500-AA2550;
AA2505-AA2540; AA2535-AA2560; AA2550-AA2600; AA2560-AA2580;
AA2600-AA2650; AA2605-AA2620; AA2620-AA2650; AA2640-AA2660;
AA2650-AA2700; AA2655-AA2670; AA2670-AA2700; AA2700-AA2750;
AA2740-AA2760; AA2750-AA2800; AA2755-AA2780; AA2780-AA2830;
AA2785-AA2810; AA2796-AA2886; AA2810-AA2825; AA2800-AA2850;
AA2850-AA2900; AA2850-AA2865; AA2885-AA2905; AA2900-AA2950;
AA2910-AA2930; AA2925-AA2950; AA2945-end(C' terminal).
The above HCV amino acid sequences can be prepared as discrete
peptides or incorporated into a larger polypeptide, and may find
use as described herein. Additional polypeptides comprising
truncated HCV sequences are described in the examples.
[0318] The observed relationship of the putative polyproteins of
HCV and the Flaviviruses allows a prediction of the putative
domains of the HCV "non-structural" (NS) proteins. The locations of
the individual NS proteins in the putative Flavirus precursor
polyprotein are fairly well-known. Moreover, these also coincide
with observed gross fluctuations in the hydrophobicity profile of
the polyprotein. It is established that NS5 of Flaviviruses encodes
the virion polymerase, and that NS1 corresponds with a complement
fixation antigen which has been shown to be an effective vaccine in
animals. Recently, it has been shown that a flaviviral protease
function resides in NS3. Due to the observed similarities betwen
HCV and the Flaviviruses, deductions concerning the approximate
locations of the corresponding protein domains and functions in the
HCV polyprotein are possible (see Section IV.H.6). The expression
of polypeptides containing these domains in a variety of
recombinant host cells, including, for example, bacteria, yeast,
insect, and vertebrate cells, should give rise to important
immunological reagents which can be used for diagnosis, detection,
and vaccines.
[0319] Although the non-structural protein region of the putative
polyproteins of the HCV isolate described herein and of
Flaviviruses appears to be generally similar, there is less
similarity between the putative structural regions which are
towards the N-terminus. In this region, there is a greater
divergence in sequence, and in addition, the hydrophobic profile of
the two regions show less similarity. This "divergence" begins in
the N-terminal region of the putative NS1 domain in HCV, and
extends to the presumed N-terminus. Nevertheless, it is still
possible to predict the approximate locations of the putative
nucleocapsid (N-terminal basic domain) and E (generally
hydrophobic) domains within the HCV polyprotein. In Section
IV.H.6., the predictions are based on the changes observed in the
hydrophobic profile of the HCV polyprotein, and on a knowledge of
the location and character of the flaviviral proteins. From these
predictions it may be possible to identify approximate regions of
the HCV polyprotein that could correspond with useful immunological
reagents. For example, the E and NS1 proteins of Flaviviruses are
known to have efficacy as protective vaccines. These regions, as
well as some which are shown to be antigenic in the HCV isolate
described herein, for example those within putative NS3, C, and
NS5, etc., should also provide diagnostic reagents. Moreover, the
location and expression of viral-encoded enzymes may also allow the
evaluation of anti-viral enzyme inhibitors, i.e., for example,
inhibitors which prevent enzyme activity by virtue of an
interaction with the enzyme itself, or substances which may prevent
expression of the enzyme, (for example, anti-sense RNA, or other
drugs which interfere with expression).
II.D. Preparation of Hybrid Particle Immunogens Containing HCV
Epitopes
[0320] The immunogenicity of the epitopes of HCV may also be
enhanced by preparing them in mammalian or yeast systems fused with
or assembled with particle-forming proteins such as, for example,
that associated with hepatitis B surface antigen. See, e.g., U.S.
Pat. No. 4,722,840. Constructs wherein the NANBV epitope is linked
directly to the particle-forming protein coding sequences produce
hybrids which are immunogenic with respect to the HCV epitope. In
addition, all of the vectors prepared include epitopes specific to
HBV, having various degrees of immunogenicity, such as, for
example, the pre-S peptide. Thus, particles constructed from
particle forming protein which include HCV sequences are
immunogenic with respect to HCV and HBV.
[0321] Hepatitis surface antigen (HBSAg) has been shown to be
formed and assembled into particles in S. cerevisiae (Valenzuela et
al. (1982)), as well as in, for example, mammalian cells
(Valenzuela, P., et al. (1984)). The formation of such particles
has been shown to enhance the immunogenicity of the monomer
subunit. The constructs may also include the immunodominant epitope
of HBSAg, comprising the 55 amino acids of the presurface (pre-S)
region. Neurath et al. (1984). Constructs of the pre-S-HBSAg
particle expressible in yeast are disclosed in EPO 174,444,
published Mar. 19, 1986; hybrids including heterologous viral
sequences for yeast expression are disclosed in EPO 175,261,
published Mar. 26, 1966. These constructs may also be expressed in
mammalian cells such as Chinese hamster ovary (CHO) cells using an
SV40-dihydrofolate reductase vector (Michelle et al. (1984)).
[0322] In addition, portions of the particle-forming protein coding
sequence may be replaced with codons encoding an HCV epitope. In
this replacement, regions which are not required to mediate the
aggregation of the units to form immunogenic particles in yeast or
mammals can be deleted, thus eliminating additional HBV antigenic
sites from competition with the HCV epitope.
II.E. Preparation of Vaccines
[0323] Vaccines may be prepared from one or more immunogenic
polypeptides derived from HCV. The observed homology between HCV
and Flaviviruses provides information concerning the polypeptides
which are likely to be most effective as vaccines, as well as the
regions of the genome in which they are encoded. The general
structure of the Flavivirus genome is discussed in Rice et al
(1986). The flavivirus genomic RNA is believed to be the only
virus-specific mRNA species, and it is translated into the three
viral structural proteins, i.e., C, M, and E, as well as two large
nonstructural proteins, NS4 and NS5, and a complex set of smaller
nonstructural proteins. It is known that major neutralizing
epitopes for Flaviviruses reside in the E (envelope) protein
(Roehrig (1986)). The corresponding HCV E gene and polypeptide
encoding region may be predicted, based upon the homology to
Flaviviruses. Thus, vaccines may be comprised of recombinant
polypeptides containing epitopes of HCV E. These polypeptides may
be expressed in various host cells (e.g., bacteria, yeast, insect,
or mammalian cells), or alternatively may be isolated from viral
preparations. It is also anticipated that the other structural
proteins may also contain epitopes which give rise to protective
anti-HCV antibodies. Thus, polypeptides containing the epitopes of
E, C, and M may also be used, whether singly or in combination, in
HCV vaccines.
[0324] In addition to the above, it has been shown that
immunization with NS1 (nonstructural protein 1), results in
protection against yellow fever (Schlesinger et al (1986)). This is
true even though the immunization does not give rise to
neutralizing antibodies. Thus, particularly since this protein
appears to be highly conserved among Flaviviruses, it is likely
that HCV NS1 will also be protective against HCV infection.
Moreover, it also shows that nonstructural proteins may provide
protection against viral pathogenicity, even if they do not cause
the production of neutralizing antibodies.
[0325] In view of the above, multivalent vaccines against HCV may
be comprised of one or more epitopes from one or more structural
proteins, and/or one or more epitopes from one or more
nonstructural proteins. These vaccines may be comprised of, for
example, recombinant HCV polypeptides and/or polypeptides isolated
from the virions. In particular, vaccines are contemplated
comprising one or more of the following HCV proteins, or subunit
antigens derived therefrom: E, NS1, C, NS2, NS3, NS4 and NS5.
Particularly preferred are vaccines comprisng E and/or NS1, or
subunits thereof. In addition, it may be possible to use
inactivated HCV in vaccines; inactivation may be by the preparation
of viral lysates, or by other means known in the art to cause
inactivation of Flaviviruses, for example, treatment with organic
solvents or detergents, or treatment with formalin. Moreover,
vaccines may also be prepared from attenuated HCV strains. The
preparation of attenuated HCV strains is described infra.
[0326] It is known that some of the proteins in Flaviviruses
contain highly conserved regions. Thus, some immunological
cross-reactivity is possible between HCV and other Flaviviruses. It
is possible that shared epitopes between the Flaviviruses and HCV
will give rise to protective antibodies against one or more of the
disorders caused by these pathogenic agents. Thus, it may be
possible to design multipurpose vaccines based upon this
knowledge.
[0327] In addition to the above, it is also possible to prepare
live vaccines of attenuated microorganisms which express one or
more recombinant HCV polypeptides. Suitable attenuated
microorganisms are known in the art and include, for example,
viruses (e.g., vaccinia virus (see Brown et al. (1986)), as well as
bacteria.
[0328] The preparation of vaccines which contain an immunogenic
polypeptide(s) as active ingredients, is known to one skilled in
the art. Typically, such vaccines are prepared as injectables,
either as liquid solutions or suspensions; solid forms suitable for
solution in, or suspension in, liquid prior to injection may also
be prepared. The preparation may also be emulsified, or the protein
encapsulated in liposomes. The active immunogenic ingredients are
often mixed with excipients which are pharmaceutically acceptable
and compatible with the active ingredient. Suitable excipients are,
for example, water, saline, dextrose, glycerol, ethanol, or the
like and combinations thereof. In addition, if desired, the vaccine
may contain minor amounts of auxiliary substances such as wetting
or emulsifying agents, pH buffering agents, and/or adjuvants which
enhance the effectiveness of the vaccine. Examples of adjuvants
which may be effective include but are not limited to: aluminum
hydroxide, N-acetyl-muramyl-L-threonyl-D-isoglutamine (thr-MDP),
N-acetyl-nor-muramyl-L-alanyl-D-isoglutamine (CGP 11637, referred
to as nor-MDP),
N-acetylmuramyl-L-alanyl-D-isoglutaminyl-L-alanine-2-(1'-2'-dip-
almitoyl-sn-glycero-3-hydroxyphosphoryloxy)-ethylamine (CGP 19835A,
referred to as MTP-PE), and RIBI, which contains three components
extracted from bacteria, monophosphoryl lipid A, trehalose
dimycolate and cell wall skeleton (MPL+TDM+CWS) in a 2%
squalene/Tween 80 emulsion. The effectiveness of an adjuvant may be
determined by measuring the amount of antibodies directed against
an immunogenic polypeptide containing an HCV antigenic sequence
resulting from administration of this polypeptide in vaccines which
are also comprised of the various adjuvants.
[0329] The vaccines are conventionally administered parenterally,
by injection, for example, either subcutaneously or
intramuscularly. Additional formulations which are suitable for
other modes of administration include suppositories and, in some
cases, oral formulations. For suppositories, traditional binders
and carriers may include, for example, polyalkylene glycols or
triglycerides; such suppositories may be formed from mixtures
containing the active ingredient in the range of 0.5% to 10%,
preferably 1%-2%. Oral formulations include such normally employed
excipients as, for example, pharmaceutical grades of mannitol,
lactose, starch, magnesium stearate, sodium saccharine, cellulose,
magnesium carbonate, and the like. These compositions take the form
of solutions, suspensions, tablets, pills, capsules, sustained
release formulations or powders and contain 10%-95% of active
ingredient, preferably 25%-70%.
[0330] The proteins may be formulated into the vaccine as neutral
or salt forms. Pharmaceutically acceptable salts include the acid
addition salts (formed with free amino groups of the peptide) and
which are formed with inorganic acids such as, for example,
hydrochloric or phosphoric acids, or such organic acids such as
acetic, oxalic, tartaric, maleic, and the like. Salts formed with
the free carboxyl groups may also be derived from inorganic bases
such as, for example, sodium, potassium, ammonium, calcium, or
ferric hydroxides, and such organic bases as isopropylamine,
trimethylamine, 2-ethylamino ethanol, histidine, procaine, and the
like.
II.F. Dosage and Administration of Vaccines
[0331] The vaccines are administered in a manner compatible with
the dosage formulation, and in such amount as will be
prophylactically and/or therapeutically effective. The quantity to
be administered, which is generally in the range of 5 micrograms to
250 micrograms of antigen per dose, depends on the subject to be
treated, capacity of the subject's immune system to synthesize
antibodies, and the degree of protection desired. Precise amounts
of active ingredient required to be administered may depend on the
judgment of the practitioner and may be peculiar to each
subject.
[0332] The vaccine may be given in a single dose schedule, or
preferably in a multiple dose schedule. A multiple dose schedule is
one in which a primary course of vaccination may be with 1-10
separate doses, followed by other doses given at subsequent time
intervals required to maintain and or reenforce the immune
response, for example, at 1-4 months for a second dose, and if
needed, a subsequent dose(s) after several months. The dosage
regimen will also, at least in part, be determined by the need of
the individual and be dependent upon the judgment of the
practitioner.
[0333] In addition, the vaccine containing the immunogenic HCV
antigen(s) may be administered in conjunction with other
immunoregulatory agents, for example, immune globulins.
II.G. Preparation of Antibodies Against HCV Epitopes
[0334] The immunogenic polypeptides prepared as described above are
used to produce antibodies, including polyclonal and monoclonal. If
polyclonal antibodies are desired, a selected mammal (e.g., mouse,
rabbit, goat, horse, etc.) is immunized with an immunogenic
polypeptide bearing an HCV epitope(s). Serum from the immunized
animal is collected and treated according to known procedures. If
serum containing polyclonal antibodies to an HCV epitope contains
antibodies to other antigens, the polyclonal antibodies can be
purified by immunoaffinity chromatography. Techniques for producing
and processing polyclonal antisera are known in the art, see for
example, Mayer and Walker (1987).
[0335] Alternatively, polyclonal antibodies may be isolated from a
mammal which has been previously infected with HCV. An example of a
method for purifying antibodies to HCV epitopes from serum from an
infected individual, based upon affinity chromatography and
utilizing a fusion polypeptide of SOD and a polypeptide encoded
within cDNA clone 5-1-1, is presented in Section V.E.
[0336] Monoclonal antibodies directed against HCV epitopes can also
be readily produced by one skilled in the art. The general
methodology for making monoclonal antibodies by hybridomas is well
known. Immortal antibody-producing cell lines can be created by
cell fusion, and also by other techniques such as direct
transformation of B lymphocytes with oncogenic DNA, or transfection
with Epstein-Barr virus. See, e.g., M. Schreier et al. (1980);
Hammerling et al. (1981); Kennett et al. (1980); see also, U.S.
Pat. Nos. 4,341,761; 4,399,121; 4,427,783; 4,444,887; 4,466,917;
4,472,500; 4,491,632; and 4,493,890. Panels of monoclonal
antibodies produced against HCV epitopes can be screened for
various properties; i.e., for isotype, epitope affinity, etc.
[0337] Antibodies, both monoclonal and polyclonal, which are
directed against HCV epitopes are particularly useful in diagnosis,
and those which are neutralizing are useful in passive
immunotherapy. Monoclonal antibodies, in particular, may be mused
to raise anti-idiotype antibodies.
[0338] Anti-idiotype antibodies are immunoglobulins which carry an
"internal image" of the antigen of the infectious agent against
which protection is desired. See, for example, Nisonoff, A., et al.
(1981) and Dreesman et al. (1985). Techniques for raising
anti-idiotype antibodies are known in the art. See, for example,
Grzych (1985), MacNamara et al. (1984), and Uytdehaag et al.
(1985). These anti-idiotype antibodies may also be useful for
treatment, vaccination and/or diagnosis of NANBH, as well as for an
elucidation of the immunogenic regions of HCV antigens.
II.H. Diagnostic Oligonucleotide Probes and Kits
[0339] Using the disclosed portions of the isolated HCV cDNAs as a
basis, including those described in Section IV.A, oligomers of
approximately 8 nucleotides or more can be prepared, either by
excision from recombinant polynucleotides or synthetically, which
hybridize with the HCV genome and are useful in identification of
the viral agent(s), further characterization of the viral
genome(s), as well as in detection of the virus(es) in diseased
individuals. The probes for HCV polynucleotides (natural or
derived) are a length which allows the detection of unique viral
sequences by hybridization. While 6-8 nucleotides may be a workable
length, sequences of 10-12 nucleotides are preferred, and about 20
nucleotides appears optimal. Preferably, these sequences will
derive from regions which lack heterogeneity. These probes can be
prepared using routine methods, including automated oligonucleotide
synthetic methods. Among useful probes, for example, are the clone
5-1-1 and the additional clones disclosed herein, as well as the
various oligomers useful in probing cDNA libraries, set forth
below. A complement to any unique portion of the HCV genome will be
satisfactory. For use as probes, complete complementarity is
desirable, though it may be unnecessary as the length of the
fragment is increased.
[0340] For use of such probes as diagnostics, the biological sample
to be analyzed, such as blood or serum, may be treated, if desired,
to extract the nucleic acids contained therein. The resulting
nucleic acid from the sample may be subjected to gel
electrophoresis or other size separation techniques; alternatively,
the nucleic acid sample may be dot blotted without size separation.
The probes are usually labeled. Suitable labels, and methods for
labeling probes are known in the art, and include, for example,
radioactive labels incorporated by nick translation or kinasing,
biotin, fluorescent probes, and chemiluminescent probes. The
nucleic acids extracted from the sample are then treated with the
labeled probe under hybridization conditions of suitable
stringencies.
[0341] The probes can be made completely complementary to the HCV
genome. Therefore, usually high stringency conditions are desirable
in order to prevent false positives. However, as shown infra,
portions of the HCV genome are variable. Therefore, conditions of
high stringency should only be used if the probes are complementary
to regions of the viral genome which lack heterogeneity. The
stringency of hybridization is determined by a number of factors
during hybridization and during the washing procedure, including
temperature, ionic strength, length of time, and concentration of
formamide. These factors are outlined in, for example, Maniatis, T.
(1982).
[0342] Generally, it is expected that the HCV genome sequences will
be present in serum of infected individuals at relatively low
levels, i.e., at approximately 10.sup.2-10.sup.3 chimp infectious
doses (CID) per ml. This level may require that amplification
techniques be used in hybridization assays. Such techniques are
known in the art. For example, the Enzo Biochemical Corporation
"Bio-Bridge" system uses terminal deoxynucleotide transferase to
add unmodified 31'-poly-dT-tails to a DNA probe. The poly dT-tailed
probe is hybridized to the target nucleotide sequence, and then to
a biotin-modified poly-A. PCT application 84/03520 and EPA124221
describe a DNA hybridization assay in which: (1) analyte is
annealed to a single-stranded DNA probe that is complementary to an
enzyme-labeled oligonucleotide; and (2) the resulting tailed duplex
is hybridized to an enzyme-labeled oligonucleotide. EPA 204510
describes a DNA hybridization assay in which analyte DNA is
contacted with a probe that has a tail, such as a poly-dT tail, an
amplifier strand that has a sequence that hybridizes to the tail of
the probe, such as a poly-A sequence, and which is capable of
binding a plurality of labeled strands. A particularly desirable
technique may first involve amplification of the target HCV
sequences in sera approximately 10,000 fold, i.e., to approximately
10 sequences/ml. This may be accomplished, for example, by the
polymerase chain reactions (PCR) technique described which is by
Saiki et al. (1986), by Mullis, U.S. Pat. No. 4,683,195, and by
Mullis et al. U.S. Pat. No. 4,683,202. The amplified sequence(s)
may then be detected using a hybridization assay which is described
in co-pending U.S. Ser. No. 109,282 (Attorney Docket No.
2300-0171), which was filed 15 Oct. 1987, U.S. Ser. No. 185,201
(filed 22 Apr. 1988), and U.S. Ser. No. 252,638 (filed 30 Sep.
1988), which are assigned to the herein assignee, and are hereby
incorporated herein by reference. These hybridization assays, which
should detect sequences at the level of 10.sup.6/ml, utilize
nucleic acid multimers which bind to single-stranded analyte
nucleic acid, and which also bind to a multiplicity of
single-stranded labeled oligonucleotides. A suitable solution phase
sandwich assay which may be used with labeled polynucleotide
probes, and the methods for the preparation of probes is described
in EPO 225,807, published Jun. 16, 1987, which is assigned to the
herein assignee, and which is hereby incorporated herein by
reference.
[0343] The probes can be packaged into diagnostic kits. Diagnostic
kits include the probe DNA, which may be labeled; alternatively,
the probe DNA may be unlabeled and the ingredients for labeling may
be included in the kit in separate containers. The kit may also
contain other suitably packaged reagents and materials needed for
the particular hybridization protocol, for example, standards, as
well as instructions for conducting the test.
II.I. Immunoassay and Diagnostic Kits
[0344] Both the polypeptides which react immunologically with serum
containing HCV antibodies, for example, those derived from,
expressed from, or encoded within the clones described in Section
IV.A., and composites thereof, (see section IV.A.) and the
antibodies raised against the HCV specific epitopes in these
polypeptides, see for example Section IV.E, are useful in
immunoassays to detect presence of HCV antibodies, or the presence
of the virus and/or viral antigens, in biological samples. Design
of the immunoassays is subject to a great deal of variation, and
many formats are known in the art. The immunoassay will utilize at
least one viral epitope derived from HCV. In one embodiment, the
immunoassay uses a combination of viral epitopes derived from HVC.
These epitopes may be derived from the same or from different viral
polypeptides, and may be in separate recombinant or natural
polypeptides, or together in the same recombinant polypeptides. An
immunoassay may use, for example, a monoclonal antibody directed
towards a viral epitope(s), a combination of monoclonal antibodies
directed towards epitopes of one viral antigen, monoclonal
antibodies directed towards epitopes of different viral antigens,
polyclonal antibodies directed towards the same viral antigen, or
polyclonal antibodies directed towards different viral antigens.
Protocols may be based, for example, upon competition, or direct
reaction, or sandwich type assays. Protocols may also, for example,
use solid supports, or may be by immunoprecipitation. Most assays
involve the use of labeled antibody or polypeptide; the labels may
be, for example, enzymatic, fluorescent, chemiluminescent,
radioactive, or dye molecules. Assays which amplify the signals
from the probe are also known; examples of which are assays which
utilize biotin and avidin, and enzyme-labeled and mediated
immunoassays, such as ELISA assays.
[0345] Typically, an immunoassay for an anti-HCV antibody(s) will
involve selecting and preparing the test sample suspected of
containing the antibodies, such as a biological sample, then
incubating it with an antigenic (i.e., epitope-containing) HCV
polypeptide(s) under conditions that allow antigen-antibody
complexes to form, and then detecting the formation of such
complexes. Suitable incubation conditions are well known in the
art. The immunoassay may be, without limitations, in a heterogenous
or in a homogeneous format, and of a standard or competitive
type.
[0346] In a heterogeneous format, the polypeptide is typically
bound to a solid support to facilitate separation of the sample
from the polypeptide after incubation. Examples of solid supports
that can be used are nitro-cellulose (e.g., in membrane or
microtiter well form), polyvinyl chloride (e.g., in sheets or
microtiter wells), polystyrene latex (e.g., in beads or microtiter
plates, polyvinylidine fluoride (known as Immulon), diazotized
paper, nylon membranes, activated beads, and Protein A beads. For
example, Dynatech Immulon.TM. or Immulon.TM. 2 microtiter plates or
0.25 inch polysterene beads (Precision Plastic Ball) can be used in
the heterogeneous format. The solid support containing the
antigenic polypeptide is typically washed after separating it from
the test sample, and prior to detection of bound antibodies. Both
standard and competitive formats are known in the art.
[0347] In a homogeneous format, the test sample is incubated with
antigen in solution. For example, it may be under conditions that
will precipitate any antigen-antibody complexes which are formed.
Both standard and competitive formats for these assays are known in
the art.
[0348] In a standard format, the amount of HCV antibodies forming
the antibody-antigen complex is directly monitored. This may be
accomplished by determining whether labeled anti-xenogenic (e.g.,
anti-human) antibodies which recognize an epitope on anti-HCV
antibodies. will bind due to complex formation. In a competitive
format, the amount of HCV antibodies in the sample is deduced by
monitoring the competitive effect on the binding of a known amount
of labeled antibody (or other competing ligand) in the complex.
[0349] Complexes formed comprising anti-HCV antibody (or, in the
case of competetive assays, the amount of competing antibody) are
detected by any of a number of known techniques, depending on the
format. For example, unlabeled HCV antibodies in the complex may be
detected using a conjugate of antixenogeneic Ig complexed with a
label, (e.g., an enzyme label).
[0350] In immunoassays where HCV polypeptides are the analyte, the
test sample, typically a biological sample, is incubated with
anti-HCV antibodies under conditions that allow the formation of
antigen-antibody complexes. Various formats can be employed. For
example, a "sandwich assay" may be employed, where antibody bound
to a solid support is incubated with the test sample; washed;
incubated with a second, labeled antibody to the analyte, and the
support is washed again. Analyte is detected by determining if the
second antibody is bound to the support. In a competitive format,
which can be either heterogeneous or homogeneous, a test sample is
usually incubated with antibody and a labeled, competing antigen is
also incubated, either sequentially or simultaneously. These and
other formats are well known in the art.
[0351] The Flavivirus model for HCV allows predictions regarding
the likely location of diagnostic epitopes for the virion
structural proteins. The C, pre-M, M, and E domains are all likely
to contain epitopes of significant potential for detecting viral
antigens, and particularly for diagnosis. Similarly, domains of the
nonstructural proteins are expected to contain important diagnostic
epitopes (e.g., NS5 encoding a putative polymerase; and NS1
encoding a putative cornplement-binding antigen). Recombinant
polypeptides, or viral polypeptides, which include epitopes from
these specific domains may be useful for the detection of viral
antibodies in infections blood donors and infected patients.
[0352] In addition, antibodies directed against the E and/or M
proteins can be used in immunoassays for the detection of viral
antigens in patients with HCV caused NANBH, and in infectious blood
donors. Moreover, these antibodies may be extremely useful in
detecting acute-phase donors and patients.
[0353] Some of the antigenic regions of the putative polyprotein
have been mapped and identified by screening the antigenicitiy of
bacterial expression products of HCV cDNAs which encode portions of
the polyprotein. See Section IV.B.8. Other antigenic regions of HCV
may be detected by expressing the portions of the HCV cDNAs in
other expression systems, including yeast systems and cellular
systems derived from insects and vertebrates. In addition, studies
giving rise to an antigenicity index and
hydrophobicity/hydrophilicity profile give rise to information
concerning the probability of a region's antigenicity.
[0354] The studies on antigenic mapping by expression of HCV cDNAs
showed that a number of clones containing these cDNAs expressed
polypeptides which were immunologically reactive with serum from
individuals with NANBH. No single polypeptide was immunologically
reactive with all sera. Five of these polypeptides were very
immunogenic in that antibodies to the HCV epitopes in these
polypeptides were detected in many different patient sera, although
the overlap in detection was not complete. Thus, the results on the
immunogenicity of the polypeptides encoded in the various clones
suggest that efficient detection systems for HCV infection may
include the use of panels of epitopes. The epitopes in the panel
may be constructed into one or multiple polypeptides. The assays
for the varying epitopes may be sequential or simultaneous.
[0355] Kits suitable for immunodiagnosis and containing the
appropriate labeled reagents are constructed by packaging the
appropriate materials, including the polypeptides of the invention
containing HCV epitopes or antibodies directed against HCV epitopes
in suitable containers, along with the remaining reagents and
materials required for the conduct of the assay, as well as a
suitable set of assay instructions.
II.J. Further Characterization of the HCV Genome, Virions, and
Viral Antigens Using Probes Derived From cDNA to the Viral
Genome
[0356] The HCV cDNA sequence information in the clones described in
Section IV.A may be used to gain further information on the
sequence of the HCV genome, and for identification and isolation of
the HCV agent, and thus will aid in its characterization including
the nature of the genome, the structure of the viral particle, and
the nature of the antigens of which it is composed. This
information, in turn, can lead to additional polynucleotide probes,
polypeptides derived from the HCV genome, and antibodies directed
against HCV epitopes which would be useful for the diagnosis and/or
treatment of HCV caused NANBH.
[0357] The cDNA sequence information in the above-mentioned clones
is useful for the design of probes for the isolation of additional
cDNA sequences which are derived from as yet undefined regions of
the HCV genome(s) from which the cDNAs in clones described in
Section IV.A. are derived. For example, labeled probes containing a
sequence of approximately 8 or more nucleotides, and preferably 20
or more nucleotides, which are derived from regions close to the
5'-termini or 3'-termini of the family of HCV cDNA sequences shown
in FIGS. 1, 3, 6, 9, 14 and 62 may be used to isolate overlapping
cDNA sequences from HCV cDNA libraries. These sequences which
overlap the cDNAs in the above-mentioned clones, but which also
contain sequences derived from regions of the genome from which the
cDNA in the above mentioned clones are not derived, may then be
used to synthesize probes for identification of other overlapping
fragments which do not necessarily overlap the cDNAs in the clones
described in Section IV.A. Unless the HCV genome is segmented and
the segments lack common sequences, it is possible to sequence the
entire viral genome(s) utilizing the technique of isolation of
overlapping cDNAs derived from the viral genome(s). Although it is
unlikely, if the genome is a segmented genome which lacks common
sequences, the sequence of the genome can be determined by
serologically screening lambda-gt11 HCV cDNA libraries, as used to
isolate clone 5-1-1, sequencing cDNA isolates, and using the
isolated cDNAs to isolate overlapping fragments, using the
technique described for the isolation and sequencing of the clones
described in Section IV.A. Alternatively, characterization of the
genomic segments could be from the viral genome(s) isolated from
purified HCV particles. Methods for purifying HCV particles and for
detecting them during the purification procedure are described
herein, infra. Procedures for isolating polynucleotide genqmes from
viral particles are known in the art, and one procedure which may
be used is shown in Example IV.A.1. The isolated genomic segments
could then be cloned and sequenced. Thus, with the information
provided herein, it is possible to clone and sequence the HCV
genome(s) irrespective of their nature.
[0358] Methods for constructing cDNA libraries are known in the
art, and are discussed supra and infra; a method for the
construction of HCV cDNA libraries in lambda-gt11 is discussed
infra in Section IV.A. However, cDNA libraries which are useful for
screening with nucleic acid probes may also be constructed in other
vectors known in the art, for example, lambda-gt10 (Huynh et al.
(1985)). The HCV derived cDNA detected by the probes derived from
the cDNAs described in Section IV.A, and from the probes
synthesized from polynucleotides derived from these cDNAs, may be
isolated from the clone by digestion of the isolated polynucleotide
with the appropriate restriction enzyme(s), and sequenced. See, for
example, Section IV.A.3. and IV.A.4. for the techniques used for
the isolation and sequencing of HCV cDNA which overlaps HCV cDNA in
clone 5-1-1, Sections IV.A.5-IV.A.7 for the isolation and
sequencing of HCV cDNA which overlaps that in clone 81, and Section
IV.A.8 and IV.A.9 for the isolation and sequencing of a clone which
overlaps another clone (clone 36), which overlaps clone 81.
[0359] The sequence information derived from these overlapping HCV
cDNAs is useful for determining areas of homology and heterogeneity
within the viral genome(s), which could indicate the presence of
different strains of the genome, and/or of populations of defective
particles. It is also useful for the design of hybridization probes
to detect HCV or HCV antigens or HCV nucleic acids in biological
samples, and during the isolation of HCV (discussed infra),
utilizing the techniques described in Section II.G. Moreover, the
overlapping cDNAs. may be used to create expression vectors for
polypeptides derived from the HCV genome(s) which also encode the
polypeptides encoded in clones 5-1-1, 36, 81, 91, and 1-2, and in
the other clones described in Section IV.A. The techniques for the
creation of these polypeptides containing HCV epitopes, and for
antibodies directed against HCV epitopes contained within them, as
well as their uses, are analogous to those described for
polypeptides derived from NANBV cDNA sequences contained within the
HCV cDNA clones described in Section IV.A, discussed supra and
infra.
[0360] Encoded within the family of cDNA sequences contained within
clones 5-1-1, 32, 35, 36, 81, 91, 1-2, and the other clones
described in Section IV.A. are antigen(s) containing epitopes which
appear to be unique to HCV; i.e., antibodies directed against these
antigens are absent from individuals infected with HAV or HBV, and
from individuals not infected with HCV (see the serological data
presented in Section IV.B.). Moreover, a comparison of the sequence
information of these cDNAs with the sequences of HAV, HBV, HDV, and
with the genomic sequences in Genebank indicates that minimal
homology exists between these cDNAs and the polynucleotide
sequences of those sources. Thus, antibodies directed against the
antigens encoded within the cDNAs of these clones may be used to
identify BB-NANBV particles isolated from infected individuals. In
addition, they are also useful for the isolation of NANBH
agent(s).
[0361] HCV particles may be isolated from the sera from individuals
with NANBH or from cell cultures by any of the methods known in the
art, including for example, techniques based on size discrimination
such as sedimentation or exclusion methods, or techniques based on
density such as ultracentrifugation in density gradients, or
precipitation with agents such as polyethylene glycol, or
chromatography on a variety of materials such as anionic or
cationic exchange materials, and materials which bind due to
hydrophobicity, as well as affinity columns. During the isolation
procedure the presence of HCV may be detected by hybridization
analysis of the extracted genome, using probes derived from the HCV
cDNAs described supra, or by immunoassay (see Section II.I.)
utilizing as probes antibodies directed against HCV antigens
encoded within the family of cDNA sequences described in Section
IV.A, and also directed against HCV antigens encoded within the
overlapping HCV cDNA sequences discussed supra. The antibodies may
be monoclonal, or polyclonal, and it may be desirable to purify the
antibodies before their use in the immunoassay. A purification
procedure for polyclonal antibodies directed against antigen(s)
encoded within clone 5-1-1 is described in Section IV.E; analogous
purification procedures may be utilized for antibodies directed
against other HCV antigens.
[0362] Antibodies directed against HCV antigens encoded within the
family of cDNAs described in Section IV.A, as well as those encoded
within overlapping HCV cDNAs, which are affixed to solid supports
are useful for the isolation of HCV by immunoaffinity
chromatography. Techniques for immunoaffinity chromatography are
known in the art, including techniques for affixing antibodies to
solid supports so that they retain their immunoselective activity;
the techniques may be those in which the antibodies are adsorbed to
the support (see, for example, Kurstak in ENZYME IMMUNODIAGNOSIS,
page 31-37), as well as those in which the antibodies are
covalently linked to the support. Generally, the techniques are
similar to those used for covalent linking of antigens to a solid
support, which are generally described in Section II.C.; however,
spacer groups may be included in the bifunctional coupling agents
so that the antigen binding site of the antibody remains
accessible.
[0363] During the purification procedure the presence of HCV may be
detected and/or verified by nucleic acid hybridization, utilizing
as probes polynucleotides derived from the family of HCV cDNA
sequences described in Section IV.A, as well as from overlapping
HCV cDNA sequences, described supra. In this case, the fractions
are treated under conditions which would cause the disruption of
viral particles, for example, with detergents in the presence of
chelating agents, and the presence of viral nucleic acid determined
by hybridization techniques described in Section II.H. Further
confirmation that the isolated particles are the agents which
induce HCV may be obtained by infecting chimpanzees with the
isolated virus particles, followed by a determination of whether
the symptoms of NANBH result from the infection.
[0364] Viral particles from the purified preparations may then be
further characterized. The genomic nucleic acid has been purified.
Based upon its sensitivity to RNase, and not DNase I, it appears
that the virus is composed of an RNA genome. See Example IV.C.2.,
infra. The strandedness and circularity or non-circularity can
determined by techniques known in the art, including, for example,
its visualization by electron microscopy, its migration in density
gradients, and its sedimentation characteristics. Based upon the
hybridization of the captured HCV genome to the negative strands of
HCV cDNAs, it appears that HCV may be comprised of a positive
stranded RNA genome (see Section IV.H.1). Techniques such as these
are described in, for example, METHODS IN ENZYMOLOGY. In addition,
the purified nucleic acid can be cloned and sequenced by known
techniques, including reverse transcription since the genomic
material is RNA. See, for example, Maniatis (1982), and Glover
(1985). Utilizing the nucleic acid derived from the viral
particles, it is possible to sequence the entire genome, whether or
not it is segmented.
[0365] Examination of the homology of the polypeptide encoded
within the continuous ORF of combined clones 14i through 39c (the
ORF is shown in FIG. 26), suggests that a portion of the HCV
polypeptide contains regions of homology with the corresponding
proteins in conserved regions of flaviviruses. An example of this
is described in Section IV.H.3. This evidence, in conjunction with
the results which show that HCV contains a positive-stranded
genome, the size of which is approximately 10,000 nucleotides, is
consistent with the suggestion that HCV is is distantly related to
the flaviviridae. Generally, flavivirus virions and their genomes
have a relatively consistent structure and organization, which are
known. See Rice et al. (1986), and Brinton, M.A. (1988). Using the
comparison with flaviviruses, predictions as to the location of the
sequences encoding some of the HCV proteins may be made.
[0366] The structure of the HCV may also be determined and its
components isolated. The morphology and size may be determined by,
for example, electron microscopy. The identification and
localization of specific viral polypeptide antigens such as coat or
envelope antigens, or internal antigens, such as nucleic acid
binding proteins, core antigens, and polynucleotide polymerase(s)
may also be determined by, for example, determining whether the
antigens are present as major or minor viral components, as well as
by utilizing antibodies directed against the specific antigens
encoded within isolated cDNAs as probes. This information is useful
in the design of vaccines; for example, it may be preferable to
include an exterior antigen in a vaccine preparation. Multivalent
vaccines may be comprised of, for example, an epitope derived from
the genome encoding a structural protein, for example, E, as well
as an epitope from another portion of the genome, for example, a
nonstructural or structural polypeptide.
II.K. Cell Culture Systems and Animal Model Systems for HCV
Replication
[0367] The suggestion that HCV is a flavi-like virus also provides
information on methods for growing HCV. The virus is thought to be
"Flavi-like" for several reasons. Based upon the HCV cDNA sequence,
the genome appears to contain a large ORF which encodes a putative
polyprotein. The HCV genome is positive-stranded with respect to
translation of this polyprotein. The hydrophobicity profile of the
HCV polyprotein resembles in particular that of putative
polyproteins from known Flaviviruses. The apparent size of the
genome, approximately 10,000 nucleotides in size, may be smaller
than, but is close to that of known Flaviviruses. Although there is
only a slight amount of amino acid homology between the HCV
putative polyprotein and that of Flaviviruses, the homology is
probably significant because there appear to be at three conserved
motifs that have similar spacing in HCV and the Flaviviruses. Two
of these conserved motifs, which are of larger size, are in the
putative NS3 region. A third conserved motif is in putative NS5;
the conserved sequence in this region, GDD, is usually associated
with a Flavivirus polymerase. Other regions which are conserved
between the Flaviviruses are also partially conserved in HCV.
Methods for culturing flaviviruses are known to those of skill in
the art (see, for example, the reviews by Brinton (1986) and
Stollar, V. (1980)). Generally, suitable cells or cell lines for
culturing HCV may include those known to support Flavivirus
replication, for example, the following: monkey kidney cell lines
(e.g. MK2, VERO); porcine kidney cell lines (e.g. PS); baby hamster
kidney cell lines (e.g. BHK); murine macrophage cell lines (e.g.,
P388D1, MK1, Mm1); human macrophage cell lines (e.g., U-937); human
peripheral blood leukocytes; human adherent monocytes; hepatocytes
or hepatocyte cell lines (e.g., HUH7 , HEPG2); embryos or embryonic
cells (e.g., chick embryo fibroblasts); or cell lines derived from
invertebrates, preferably from insects (e.g. drosophila cell
lines), or more preferably from arthropods, for example, mosquito
cell lines (e.g., A. Albopictus, Aedes aegypti, Cutex
tritaeniorhynchus) or tick cell lines (e.g. RML-14 Dermacentor
parumapertus).
[0368] It is possible that primary hepatocytes can be cultured, and
then infected with HCV; or alternatively, the hepatocyte cultures
could be derived from the livers of infected individuals (e.g.,
humans or chimpanzees). The latter case is an example of a cell
which is infected in vivo being passaged in vitro. In addition,
various immortalization methods can be used to obtain cell-lines
derived from hepatocyte cultures. For example, primary liver
cultures (before and after enrichment of the hepatocyte population)
may be fused to a variety of cells to maintain stability. For
example, also, cultures may be infected with transforming viruses,
or transfected with transforming genes in order to create permanent
or semi-permanent cell lines. In addition, for example, cells in
liver cultures may be fused to established cell lines (e.g., HepG2
). Methods for cell fusion are known in the art, and include, for
example, the use of fusion agents such as polyethylene glycol,
Sendai Virus, and Epstein-Barr virus.
[0369] As discussed above, HCV is a Flavi-like virus. Therefore, it
is probable that HCV infection of cell lines may be accomplished by
techniques known in the art for infecting cells with Flaviviruses.
These include, for example, incubating the cells with viral
preparations under conditions which allow viral entry into the
cell. In addition, it may be possible to obtain viral production by
transfecting the cells with isolated viral polynucleotides. It is
known that Togavirus and Flavivirus RNAs are infectious in a
variety of vertebrate cell lines (Pfefferkorn and Shapiro (1974)),
and in a mosquito cell line (Peleg (1969)). Methods for
transfecting tissue culture cells with RNA duplexes, positive
stranded RNAS, and DNAs (including cDNAs) are known in the art, and
include, for example, techniques which use electroporation, and
precipitation with DEAE-Dextran or calcium phosphate. An abundant
source of HCV RNA can be obtained by performing in vitro
transcription of an HCV cDNA corresponding to the complete gendme.
Transfection with this material, or with cloned HCV cDNA should
result in viral replication and the in vitro propagation of the
virus.
[0370] In addition to cultured cells, animal model systems may be
used for viral replication; animal systems in which flaviviruses
are known to those of skill in the art (see, for example, the
review by Monath (1986)). Thus, HCV replication may occur not only
in chimpanzees, but also in, for example, marmosets and suckling
mice.
II.L. Screening for Anti-Viral Agents for HCV
[0371] The availability of cell culture and animal model systems
for HCV also makes possible screening for anti-viral agents which
inhibit HCV replication, and particularly for those agents which
preferentially allow cell growth and multiplication while
inhibiting viral replication. These screening methods are known by
those of skill in the art. Generally, the anti-viral agents are
tested at a variety of concentrations, for their effect on
preventing viral replication in cell culture systems which support
viral replication, and then for an inhibition of infectivity or of
viral pathogenicity (and a low level of toxicity) in an animal
model system.
[0372] The methods and compositions provided herein for detecting
HCV antigens and HCV polynucleotides are useful for screening of
anti-viral agents in that they provide an alternative, and perhaps
more sensitive means, for detecting the agent's effect on viral
replication than the cell plaque assay or ID.sub.50 assay. For
example, the HCV-polynucleotide probes described herein may be used
to quantitate the amount of viral nucleic acid produced in a cell
culture. This could be accomplished, for example, by hybridization
or competition hybridization of the infected cell nucleic acids
with a labeled HCV-polynucleotide probe. For example, also,
anti-HCV antibodies may be used to identify and quantitate HCV
antigen(s) in the cell culture utilizing the immunoassays described
herein. In addition, since it may be desirable to quantitate HCV
antigens in the infected cell culture by a competition assay, the
polypeptides encoded within the HCV cDNAs described herein are
useful in these competition assays. Generally, a recombinant HCV
polypeptide derived from the HCV cDNA would be labeled, and the
inhibition of binding of this labeled polypeptide to an HCV
polypeptide due to the antigen produced in the cell culture system
would be monitored. Moreover, these techniques are particularly
useful in cases where the HCV may be able to replicate in a cell
line without causing cell death.
[0373] The anti-viral agents which may be tested for efficacy by
these methods are known in the art, and include, for example, those
which interact with virion components and/or cellular components
which are necessary for the binding and/or replication of the
virus. Typical anti-viral agents may include, for example,
inhibitors of virion polymerase and/or protease(s) necessary for
cleavage of the precursor polypeptides. Other anti-viral agents may
include those which act with nucleic acids to prevent viral
replication, for example, anti-sense polynucleotides, etc.
[0374] Antisense polynucleotides molecules are comprised of a
complementary nucleotide sequence which allows them to hybridize
specifically to designated regions of genomes or RNAs. Antisense
polynucleotides may include, for example, molecules that will block
protein translation by binding to mRNA, or may be molecules which
prevent replication of viral RNA by transcriptase. They may also
include molecules which carry agents (non-covalently attached or
covalently bound) which cause the viral RNA to be inactive by
causing, for example, scissions in the viral RNA. They may also
bind to cellular polynucleotides which enhance and/or are required
for viral infectivity, replicative ability, or chronicity.
Antisense molecules which are to hybridize to HCV derived RNAs may
be designed based upon the sequence information of the HCV cDNAs
provided herein. The antiviral agents based upon anti-sense
polynucleotides for HCV may be designed to bind with high
specificity, to be of increased solubility, to be stable, and to
have low toxicity. Hence, they may be delivered in specialized
systems, for example, liposomes, or by gene therapy. In addition,
they may include analogs, attached proteins, substituted or altered
bonding between bases, etc.
[0375] Other types of drugs may be based upon polynucleotides which
"mimic" important control regions of the HCV genome, and which may
be therapeutic due to their interactions with key components of the
system responsible for viral infectivity or replication.
II.M. Preparation of Attenuated Strains of HCV
[0376] In addition to the above, utilizing the tissue culture
systems and/or animal model systems, it may be possible to isolate
attenuated strains of HCV. These strains would be suitable for
vaccines, or for the isolation of viral antigens. Attenuated
strains are isolatable after multiple passages in cell culture
and/or an animal model. Detection of an attenuated strain in an
infected cell or individual is achievable by techniques known in
the art, and could include, for example, the use of anti-bodies to
one or more epitopes encoded in HCV as a probe or the use of a
polynucleotide containing an HCV sequence of at least about 8
nucleotides as a probe. Alternatively, or in addition, an
attenuated strain may be constructed utilizing the genomic
information of HCV provided herein, and utilizing recombinant
techniques. Generally, one would attempt to delete a region of the
genome encoding, for example, a polypeptide related to
pathogenicity, but which allows viral replication. In addition, the
genome construction would allow the expression of an epitope which
gives rise to neutralizing antibodies for HCV. The altered genome
could then be utilized to transform cells which allow HCV
replication, and the cells grown under conditions to allow viral
replication. Attenuated HCV strains are useful not only for vaccine
purposes, but also as sources for the commercial production of
viral antigens, since the processing of these viruses would require
less stringent protection measures for the employees involved in
viral production and/or the production of viral products.
III. General Methods
[0377] The general techniques used in extracting the genome from a
virus, preparing and probing a cDNA library, sequencing clones,
constructing expression vectors, transforming cells, performing
immunological assays such as radioimmunoassays and ELISA assays,
for growing cells in culture, and the like are known in the art and
laboratory manuals are available describing these techniques.
However, as a general guide, the following sets forth some sources
currently available for such procedures, and for materials useful
in carrying them out.
III.A. Hosts and Expression Control Sequences
[0378] Both prokaryotic and eukaryotic host cells may be used for
expression of desired coding sequences when appropriate control
sequences which are compatible with the designated host are used.
Among prokaryotic hosts, E. coli is most frequently used.
Expression control sequences for prokaryotes include promoters,
optionally containing operator portions, and ribosome binding
sites. Transfer vectors compatible with prokaryotic hosts are
commonly derived from, for example, pBR322, a plasmid containing
operons conferring ampicillin and tetracycline resistance, and the
various pUC vectors, which also contain sequences conferring
antibiotic resistance markers. These markers may be used to obtain
successful transformants by selection. Commonly used prokaryotic
control sequences include the Beta-lactamase (penicillinase) and
lactose promoter systems (Chang et al. (1977)), the tryptophan
(trp) promoter system (Goeddel et al. (1980)) and the
lambda-derived PL promoter and N gene ribosome binding site
(Shimatake et al. (1981)) and the hybrid tac promoter (De Boer et
al. (1983)) derived from sequences of the trp and lac UV5
promoters. The foregoing systems are particularly compatible with
E. coli; if desired, other prokaryotic hosts such as strains of
Bacillus or Pseudomonas may be used, with corresponding control
sequences.
[0379] Eukaryotic hosts include yeast and mammalian cells in
culture systems. Saccharomyces cerevisiae and Saccharomyces
carlsbergensis are the most commonly used. yeast hosts, and are
convenient fungal hosts. Yeast compatible vectors carry markers
which permit selection of successful transformants by conferring
prototrophy to auxotrophic mutants or resistance to heavy metals on
wild-type strains. Yeast compatible vectors may employ the 2 micron
origin of replication (Broach et al. (1983)), the combination of
CEN3 and ARS1 or other means for assuring replication, such as
sequences which will result in incorporation of an appropriate
fragment into the host cell genome. Control sequences for yeast
vectors are known in the art and include promoters for the
synthesis of glycolytic enzymes (Hess et al. (1968); Holland et al.
(1978)), including the promoter for 3 phosphoglycerate kinase
(Hitzeman (1980)). Terminators may also be included, such as those
derived from the enolase gene (Holland (1981)). Particularly useful
control systems are those which comprise the glyceraldehyde-3
phosphate dehydrogenase (GAPDH) promoter or alcohol dehydrogenase
(ADH) regulatable prom oter, terminators also derived from GAPDH,
and if secretion is desired, leader sequence from yeast alpha
factor. In addition, the transcriptional regulatory region and the
transcriptional initiation region which are operably linked may be
such that they are not naturally associated in the wild-type
organism. These systems are described in detail in EPO 120,551,
published Oct. 3, 1984; EPO 116,201, published Aug. 22, 1984; and
EPO 164,556, published Dec. 18, 1985, all of which are assigned to
the herein assignee, and are hereby incorporated herein by
reference.
[0380] Mammalian cell lines available as hosts for expression are
known in the art and include many immortalized cell lines available
from the American Type Culture Collection (ATCC), including HeLa
cells, Chinese hamster ovary (CHO) cells, baby hamster kidney (BHK)
cells, and a number of other cell lines. Suitable promoters for
mammalian cells are also known in the art and include viral
promoters such as that from Simian Virus 40 (SV40) (Fiers (1978)),
Rous sarcoma virus (RSV), adenovirus (ADV), and bovine papilloma
virus (BPV). Mammalian cells may also require terminator sequences
and poly A addition sequences; enhancer sequences which increase
expression may also be included, and sequences which cause
amplification of the gene may also be desirable. These sequences
are known in the art.
[0381] Vectors suitable for replication in mammalian cells are
known in the art, and may include viral replicons, or sequences
which insure integration of the appropriate sequences encoding
NANBV epitopes into the host genome.
[0382] A vector which is used to express foreign DNA, and which may
be used in vaccine preparation is Vaccinia virus. In this case the
heterologous DNA is inserted into the Vaccinia genome. Techniques
for the insertion of foreign DNA into the vaccinia virus genome are
known in the art, and utilize, for example, homologous
recombination. The insertion of the heterologous DNA is generally
into a gene which is non-essential in nature, for example, the
thymidine kinase gene (tk), which also provides a selectable
marker. Plasmid vectors that greatly facilitate the construction of
recombinant viruses have been described (see, for example, Mackett
et al. (1984), Chakrabarti et al. (1985); Moss (1987)). Expression
of the HCV polypeptide then occurs in cells or individuals which
are immunized with the live recombinant vaccinia virus.
[0383] The segment of HCV cDNA which is inserted into a Vaccinia
vector may be derived from the "x" region of the. HCV genome (see
FIG. 69); for example, it may encode a polypeptide comprised of
amino acid numbers 406-661. The polypeptide encoding sequence may
be attached to a leader sequence. The leader sequence may be that
for tissue plasminogen activator (tPA), or from another source,
e.g., that for beta-globin. The heterologous polynucleotide may be
inserted into a vaccinia vector which is a modified version of
pSC11, due to the addition of a polylinker sequence which contains
a cloning site.
[0384] The segment of HCV cDNA which is inserted into the Vaccinia
vector may also be derived from the "x" region of the HCV genome,
but it may encode a larger polypeptide, i.e., one comprised of
amino acid numbers 347-906. The polypeptide encoding sequence,
which may or may not be attached to an upstream heterologous leader
sequence, may be inserted into the modified pSC11 vaccinia vector
described above.
[0385] In order to detect whether or not the HCV polypeptide is
expressed from the vaccinia vector, BSC 1 cells may be infected
with the recombinant vector and grown on microscope slides under
conditions which allow expression. The cells may then be
acetone-fixed, and immunofluorescence assays performed using serum
which is known to contain anti-HCV antibodies to a polypeptide(s)
encoded in the region of the HCV genome from which the HCV segment
in the recombinant expression vector was derived.
[0386] Other systems for expression of eukaryotic or viral genomes
include insect cells and vectors suitable for use in these cells.
These systems are known in the art, and include, for example,
insect expression transfer vectors derived from the baculovirus
Autographa californica nuclear polyhedrosis virus (AcNPV), which is
a helper-independent, viral expression vector. Expression vectors
derived from this system usually use the strong viral polyhedrin
gene promoter to drive expression of heterologous genes. Currently
the most commonly used transfer vector for introducing foreign
genes into AcNPV is pAc373 (FIG. 70). Many other vectors, known to
those of skill in the art, have also been designed for improved
expression. These include, for example, pVL985 (which alters the
polyhedrin start codon from ATG to ATT, and which introduces a
BamHI cloning site 32 basepairs downstream from the ATT; See Luckow
and Summers (1989)). AcNPV transfer vectors for high level
expression of nonfused foreign proteins are shown in FIG. 70. In
the figure, the numbers shown refer to positions wihtin the native
gene, where the A of the ATG codon is +1. FIG. 70 also shows a
restriction endonuclease map of the transfer vector pAc373. The map
shows that a unique BamHI site is located following position -8
with respect to the translation initiation codon ATG of the
polyhedrin gene. There are no cleavage sites for SmaI, PstI, BglII,
XbaI or SstI. Good expression of nonfused foreign proteins usually
requires foreign genes that ideally have a short leader sequence
containing suitable translation initiation signals preceding an ATG
start signal. The plasmid also contains the polyhedrin
polyadenylation signal and the ampicillin-resistance (amp) gene and
origin of replication for selection and propagation in E. coli.
[0387] Methods for the introduction of heterologous DNA into the
desired site in the baculovirus virus are known in the art. (See
Summer and Smith, Texas Agricultural Experiment Station Bulletin
No. 1555; Ju et al. (1987); Smith et al. (1983); and Luckow and
Summers (1989)). For example, the insertion can be into a gene such
as the polyhedrin gene, by homologous recombination; insertion can
also be into a restriction enzyme site engineered into the desired
baculovirus gene. The inserted sequences may be those which encode
all or varying segments of the polyprotein, or other orfs which
encode viral polypeptides. For example, the insert could encode the
following numbers of amino acid segments from the polyprotein:
amino acids 1-1078; amino acids 332-662; amino acids 406-662; amino
acids 156-328, and amino acids 199-328.
[0388] The signals for posttranslational modifications, such as
signal peptide cleavage, proteolytic cleavage, and phosphorylation,
appear to be recognized by insect cells. The signals required for
secretion and nuclear accumulation also appear to be conserved
between the invertebrate cells and vertebrate cells. Examples of
the signal sequences from vertebrate cells which are effective in
invertebrate cells are known in the art, for example, the human
interleukin 2 signal (IL2.sub.s) which is a signal for transport
out of the cell, is recognized and properly removed in insect
cells.
III.B. Transformations
[0389] Transformation may be by any known method for introducing
polynucleotides into a host cell, including, for example packaging
the polynucleotide in a virus and transducing a host cell with the
virus, and by direct uptake of the polynucleotide. The
transformation procedure used depends upon the host to be
transformed. For example, transformation of the E. coli host cells
with lambda-gt11 containing BB-NANBV sequences is discussed in the
Example section, infra. Bacterial transformation by direct uptake
generally employs treatment with calcium or rubidium chloride
(Cohen (1972); Maniatis (1982)). Yeast transformation by direct
uptake may be carried out using the method of Hinnen et al. (1978).
Mammalian transformations by direct uptake may be conducted using
the calcium phosphate precipitation method of Graham and Van der Eb
(1978), or the various known modifications thereof. Other methods
for the introduction of recombinant polynucleotides into cells,
particularly into mammalian cells, which are known in the art
include dextran-mediated transfection, calcium phosphate mediated
transfection, polybrene mediated transfection, protoplast fusion,
electroporation, encapsulation of the polynucleotide(s) in
liposomes, and direct microinjection of the polynucleotides into
nuclei.
III.C. Vector Construction
[0390] Vector construction employs techniques which are known in
the art. Site-specific DNA cleavage is performed by treating with
suitable restriction enzymes under conditions which generally are
specified by the manufacturer of these commercially available
enzymes. In general, about 1 microgram of plasmid or DNA sequence
is cleaved by 1 unit of enzyme in about 20 microliters buffer
solution by incubation of 1-2 hr at 37.degree. C. After incubation
with the restriction enzyme, protein is removed by
phenol/chloroform extraction and the DNA recovered by precipitation
with ethanol. The cleaved fragments may be separated using
polyacrylamide or agarose gel electrophoresis techniques, according
to the general procedures found in Methods in Enzymology (1980)
65:499-560.
[0391] Sticky ended cleavage fragments may be blunt ended using E.
coli DNA polymerase I (Klenow) in the presence of the appropriate
deoxynucleotide triphosphates (dNTPs) present in the mixture.
Treatment with S1 nuclease may also be used, resulting in the
hydrolysis of any single stranded DNA portions.
[0392] Ligations are carried out using standard buffer and
temperature conditions using T4 DNA ligase and ATP; sticky end
ligations require less ATP and less ligase than blunt end
ligations. When vector fragments are used as part of a ligation
mixture, the vector fragment is often treated with bacterial
alkaline phosphatase (BAP) or calf intestinal alkaline phosphatase
to remove the 5'-phosphate and thus prevent religation of the
vector; alternatively, restriction enzyme digestion of unwanted
fragments can be used to prevent ligation.
[0393] Ligation mixtures are transformed into suitable cloning
hosts, such as E. coli, and successful transformants selected by,
for example, antibiotic resistance, and screened for the correct
construction.
III.D. Construction of Desired DNA Sequences
[0394] Synthetic oligonucleotides may be prepared using an
automated oligonucleotide synthesizer as described by Warner
(1984). If desired the synthetic strands may be labeled with
.sup.32P by treatment with polynucleotide kinase in the presence of
.sup.32P-ATP, using standard conditions for the reaction.
[0395] DNA sequences, including those isolated from cDNA libraries,
may be modified by known techniques, including, for example site
directed mutagenesis, as described by Zoller (1982). Briefly, the
DNA to be modified is packaged into phage as a single stranded
sequence, and converted to a double stranded DNA with DNA
polymerase using, as a primer, a synthetic oligonucleotide
complementary to the portion of the DNA to be modified, and having
the desired modification included in its own sequence. The
resulting double stranded DNA is transformed into a phage
supporting host bacterium. Cultures of the transformed bacteria,
which contain replications of each strand of the phage, are plated
in agar to obtain plaques. Theoretically, 50% of the new plaques
contain phage having the mutated sequence, and the remaining 50%
have the original sequence. Replicates of the plaques are
hybridized to labeled synthetic probe at temperatures and
conditions which permit hybridization with the correct strand, but
not with the unmodified sequence. The sequences which have been
identified by hybridization are recovered and cloned.
III.E. Hybridization with Probe
[0396] DNA libraries may be probed using the procedure of Grunstein
and Hogness (1975). Briefly, in this procedure, the DNA to be
probed is immobilized on nitro-cellulose filters, denatured, and
prehybridized with a buffer containing 0-50% formamide, 0.75 M
NaCl, 75 mM Na citrate, 0.02% (wt/v) each of bovine serum albumin,
poly-vinyl pyrollidone, and Ficoll, 50 mM Na Phosphate (pH 6.5),
0.1% SDS, and 100 micrograms/ml carrier denatured DNA. The
percentage of formamide in the buffer, as well as the time and
temperature conditions of the prehybridization and subsequent
hybridization steps depends on the stringency required. Oligomeric
probes which require lower stringency conditions are generally used
with low percentages of formamide, lower temperatures, and longer
hybridization times. Probes containing more than 30 or 40
nucleotides such as those derived from cDNA or genomic sequences
generally employ higher temperatures, e.g., about 40-42.degree. C.,
and a high percentage, e.g., 50% formamide. Following
prehybridization, 5'-.sup.32P-labeled oligonucleotide probe is
added to the buffer, and the filters are incubated in this mixture
under hybridization conditions. After washing, the treated filters
are subjected to autoradiography to show the location of the
hybridized probe; DNA in corresponding locations on the original
agar plates is used as the source of the desired DNA.
III.F. Verification of Construction and Sequencing
[0397] For routine vector constructions, ligation mixtures are
transformed into E. coli strain HB101 or other suitable host, and
successful transformants selected by antibiotic resistance or other
markers. Plasmids from the transformants are then prepared
according to the method of Clewell et al. (1969), usually following
chloramphenicol amplification (Clewell (1972)). The DNA is isolated
and analyzed, usually by restriction enzyme analysis and/or
sequencing. Sequencing may be by the dideoxy method of Sanger et
al. (1977) as further described by Messing et al. (1981), or by the
method of Maxam et al. (1980). Problems with band compression,
which are sometimes observed in GC rich regions, were overcome by
use of T-deazoguanosine according to Barr et al. (1986).
III.G. Enzyme Linked Immunosorbent Assay
[0398] The enzyme-linked immunosorbent assay (ELISA) can be used to
measure either antigen or antibody concentrations. This method
depends upon conjugation of an enzyme to either an antigen or an
antibody, and uses the bound enzyme activity as a quantitative
label. To measure antibody, the known antigen is fixed to a solid
phase (e.g., a microplate or plastic cup), incubated with test
serum dilutions, washed, incubated with anti-immunoglobulin labeled
with an enzyme, and washed again. Enzymes suitable for labeling are
known in the art, and include, for example, horseradish peroxidase.
Enzyme activity bound to the solid phase is measured by adding the
specific substrate, and determining product formation or substrate
utilization calorimetrically. The enzyme activity bound is a direct
function of the amount of anti-body bound.
[0399] To measure antigen, a known specific antibody is fixed to
the solid phase, the test material containing antigen is added,
after an incubation the solid phase is washed, and a second
enzyme-labeled antibody is added. After washing, substrate is
added, and enzyme activity is estimated calorimetrically, and
related to antigen concentration.
IV. EXAMPLES
[0400] Described below are examples of the present invention which
are provided only for illustrative purposes, and not to limit the
scope of the present invention. In light of the present disclosure,
numerous embodiments within the scope of the claims will be
apparent to those of ordinary skill in the art. The procedures set
forth, for example, in Sections IV.A. may, if desired, be repeated
but need not be, as techniques are available for construction of
the desired nucleotide sequences based on the information provided
by the invention. Expression is exemplified in E. coli; however,
other systems are available as set forth more fully in Section
III.A. Additional epitopes derived from the genomic structure may
also be produced, and used to generate antibodies as set forth
below.
IV.A. Preparation, Isolation and Sequencing of HCV cDNA
IV.A.1. Preparation of HCV cDNA
[0401] The source of NANB agent was a plasma pool derived from a
chimpanzee with chronic NANBH. The chimpanzee had been
experimentally infected with blood from another chimpanzee with
chronic NANBH resulting from infection with HCV in a contaminated
batch of factor 8 concentrate derived from pooled human sera. The
chimpanzee plasma pool was made by combining many individual plasma
samples containing high levels of alanine aminotransferase
activity; this activity results from hepatic injury due to the HCV
infection. Since 1 ml of a 10.sup.-6 dilution of this pooled serum
given i.v. caused NANBH in another chimpanzee, its CID was at least
10 /ml, i.e., it had a high infectious virus titer.
[0402] A cDNA library from the high titer plasma pool was generated
as follows. First, viral particles were isolated from the plasma; a
90 ml aliquot was diluted with 310 ml of a solution containing 50
mM Tris-HCl, pH 8.0, 1 mM EDTA, 100 mM NaCl. Debris was removed by
centrifugation for 20 min at 15,000.times.g at 20.degree. C. Viral
particles in the resulting supernatant were then pelleted by
centrifugation in a Beckman SW28 rotor at 28,000 rpm for 5 hours at
20.degree. C. To release the viral genome, the particles were
disrupted by suspending the pellets in 15 ml solution containing 1%
sodium dodecyl sulfate (SDS), 10 mM EDTA, 10 mM Tris-HCl, pH 7.5,
also containing 2 mg/ml proteinase k, followed by incubation at
45.degree. C. for 90 min. Nucleic acids were isolated by adding 0.8
micrograms MS2 bacteriophage RNA as carrier, and extracting the
mixture four times with a 1:1. mixture of phenol:chloroform (phenol
saturated with 0.05M Tris-HCl, pH 7.5, 0.1% (v/v)
beta-mercaptoethanol, 0.1% (w/v) hydroxyquinolone, followed by
extraction two times with chloroform. The aqueous phase was
concentrated with 1-butanol prior to precipitation with 2.5 volumes
absolute ethanol overnight at -20.degree. C. Nucleic acid was
recovered by centrifugation in a Beckman SW41 rotor at 40,000 rpm
for 90 min at 4.degree. C., and dissolved in water that had been
treated with 0.05% (v/v) diethylpyrocarbonate and autoclaved.
[0403] Nucleic acid obtained by the above procedure (<2
micrograms) was denatured with 17.5 mM CH.sub.3HgOH; cDNA was
synthesized using this denatured nucleic acid as template, and was
cloned into the EcoRI site of phage lambda-gt11 using methods
described by Huynh (1985), except that random primers replaced
oligo(dT) 12-18 during the synthesis of the first cDNA strand by
reverse transcriptase (Taylor et al. (1976)). The resulting double
stranded cDNAs were fractionated according to size on a Sepharose
CL-4B column; eluted material of approximate mean size 400, 300,
200, and 100 base-pairs were pooled into cDNA pools 1, 2, 3, and 4,
respectively. The lambda-gt11 cDNA library was generated from the
cDNA in pool 3.
[0404] The lambda-gt11 cDNA library generated from pool 3 was
screened for epitopes that could bind specifically with serum
derived from a patient who had previously experienced NANBH. About
10.sup.6 phage were screened with patient sera using the methods of
Huynh et al. (1985), except that bound human antibody was detected
with sheep anti-human Ig antisera that had been radio-labeled with
.sup.125I. Five positive phages were identified and purified. The
five positive phages were then tested for specificity of binding to
sera from 8 different humans previously infected with the NANBH
agent, using the same method. Four of the phage encoded a
polypeptide that reacted immunologically with only one human serum,
i.e., the one that was used for primary screening of the phage
library. The fifth phage (5-1-1) encoded a polypeptide that reacted
immunologically with 5 of 8 of the sera tested. Moreover, this
polypeptide did not react immunologically with sera from 7 normal
blood donors. Therefore, it appears that clone 5-1-1 encodes a
polypeptide which is specifically recognized immunologically by
sera from NANB patients.
IV.A.2. Sequences of the HCV cDNA in Recombinant Phage 5-1-1, and
of the Polypeptide Encoded Within the Sequence.
[0405] The cDNA in recombinant phage 5-1-1 was sequenced by the
method of Sanger et al. (1977). Essentially, the cDNA was excised
with EcoRI, isolated by size fractionation using gel
electrophoresis. The EcoRI restriction fragments were subcloned
into the ML3 vectors, mp18 and mp19 (Messing (1983)) and sequenced
using the dideoxychain termination method of Sanger et al. (1977).
The sequence obtained is shown in FIG. 1.
[0406] The polypeptide encoded in FIG. 1 that is encoded in the HCV
cDNA is in the same translational frame as the N-terminal
beta-galactosidase moiety to which it is fused. As shown in Section
IV.A., the translational open reading frame (ORF) of 5-1-1 encodes
epitope(s) specifically recognized by sera from patients and
chimpanzees with NANBH infections.
IV.A.3. Isolation of Overlapping HCV cDNA to cDNA in Clone
5-1-1.
[0407] Overlapping HCV cDNA to the cDNA in clone 5-1-1 was obtained
by screening the same lambda-gt11 library, created as described in
Section IV.A.1., with a synthetic polynucleotide derived from the
sequence of the HCV cDNA in clones 5-1-1, as shown in FIG. 1. The
sequence of the polynucleotide used for screening was:
TABLE-US-00002 5'-TCC CTT GCT CGA TGT ACG GTA AGT GCT GAG AGC ACT
CTT CCA TCT CAT CGA ACT CTC GGT AGA GGA CTT CCC TGT CAG GT-3'.
The lambda-gt11 library was screened with this probe, using the
method described in Huynh (1985). Approximately 1 in 50,000 clones
hybridized with the probe. Three clones which contained cDNAs which
hybridized with the synthetic probe have been numbered 81, 1-2, and
91. IV.A.4. Nucleotide Sequences of Overlapping HCV cDNAs to cDNA
in Clone 5-1-1.
[0408] The nucleotide sequences of the three cDNAs in clones 81,
1-2, and 91 were determined essentially as in Section IV.A.2. The
sequences of these clones relative to the HCV cDNA sequence in
phage 5-1-1 is shown in FIG. 2, which shows the strand encoding the
detected HCV epitope, and where the homologies in the nucleotide
sequences are indicated by vertical lines between the
sequences.
[0409] The sequences of the cloned HCV cDNAs are highly homologous
in the overlapping regions (see FIG. 2). However, there are
differences in two regions. Nucleotide 67 in clone 1-2 is a
thymidine, whereas the other three clones contain a cytidine
residue in this position. It should be noted, however, that the
same amino acid is encoded when either C or T occupies this
position.
[0410] The second difference is that clone 5-1-1 contains 28 base
pairs which are not present in the other three clones. These base
pairs occur at the start of the cDNA sequence in 5-1-1, and are
indicated by small letters. The 28 bp region is probably a terminal
artifact in clone 5-1-1 which enhances its antigenicity.
[0411] The sequences of small letters in the nucleotide sequence of
clones 81 and 91 simply indicate that these sequences have not been
found in other cDNAs because cDNAs overlapping these regions were
not yet isolated.
[0412] A composite HCV cDNA sequence derived from over-lapping
cDNAs in clones 5-1-1, 81, 1-2 and 91 is shown in FIG. 3. However,
in this figure the unique 28 base pairs of clone 5-1-1 are omitted.
The figure also shows the sequence of the polypeptide encoded
within the ORF of the composite HCV cDNA.
IV.A.5. Isolation of Overlapping HCV cDNAs to cDNA in Clone 81.
[0413] The isolation of HCV cDNA sequences upstream of, and which
overlap those in clone 81 cDNA was accomplished as follows. The
lambda-gt11 cDNA library prepared as described in Section IV.A.1.
was screened by hybridization with a synthetic. polynucleotide
probe which was homologous to a 5' terminal sequence of clone 81.
The sequence of clone 81 is presented in FIG. 4. The sequence of
the synthetic polynucleotide used for screening was: TABLE-US-00003
5' CTG TCA GGT ATG ATT GCC GGC TTC CCG GAC 3'.
The methods were essentially as described in Huynh. (1985), except
that the library filters were given two washes under stringent
conditions, i.e., the washes were in 5.times.SSC, 0.1% SDS at
55.degree. C. for 30 minutes each. Approximately 1 in 50,000 clones
hybridized with the probe. A positive recombinant phage which
contained cDNA which hybridized with the sequence was isolated and
purified. This phage has been numbered clone 36.
[0414] Downstream cDNA sequences, which overlaps the carboxyl-end
sequences in clone 81 cDNA were isolated using a procedure similar
to that for the isolation of upstream cDNA sequences, except that a
synthetic oligonucleotide probe was prepared which is homologous to
a 3' terminal sequence of clone 81. The sequence of the synthetic
polynucleotide used for screening was: TABLE-US-00004 5' TTT GGC
TAG TGG TTA GTG GGC TGG TGA CAG 3'
A positive recombinant phage, which contained cDNA which hybridized
with this latter sequence was isolated and purified, and has been
numbered clone 32. IV.A.6. Nucleotide Sequence of HCV cDNA in Clone
36.
[0415] The nucleotide sequence of the cDNA in clone 36 was
determined essentially as described in Section IV.A.2. The
double-stranded sequence of this cDNA, its region of overlap with
the HCV cDNA in clone 81, and the polypeptide encoded by the ORF
are shown in FIG. 5.
[0416] The ORF in clone 36 is in the same translational frame as
the HCV antigen encoded in clone 81. Thus, in combination, the ORFs
in clones 36 and 81 encode a polypeptide that represents part of a
large HCV antigen. The sequence of this putative HCV polypeptide
and the double stranded DNA sequence encoding it, which is derived
from the combined ORFs of the HCV cDNAs of clones 36 and 81, is
shown in FIG. 6.
IV.A.7 Nucleotide Sequences of HCV cDNA in Clone 32
[0417] The nucleotide sequence of the cDNA in clone 32 was
determined essentially as was that described in Section IV.A.2 for
the sequence of clone 5-1-1. The sequence data indicated that the
cDNA in clone 32 recombinant phage was derived from two different
sources. One fragment of the cDNA was comprised of 418 nucleotides
derived from the HCV genome; the other fragment was comprised of
172 nucleotides derived from the bacteriophage MS2 genome, which
had been used as a carrier during the preparation of the lambda
gt11 plasma cDNA library.
[0418] The sequence of the cDNA in clone 32 corresponding to that
of the HCV genome is shown in FIG. 7. The region of the sequences
that overlaps that of clone 81, and the polypeptide encoded by the
ORF are also indicated in the figure. This sequence contains one
continuous ORF that is in the same translational frame as the HCV
antigen encoded by clone 81.
IV.A.8 Isolation of Overlapping HCV cDNA to cDNA in Clone 36
[0419] The isolation of HCV cDNA sequences upstream of, and which
overlap those in clone 36 cDNA was accomplished as described in
Section IV.A.5, for those which overlap clone 81 cDNA, except that
the synthetic polynucleotide was based on the 5'-region of clone
36. The sequence of the synthetic polynucleotide used for screening
was: TABLE-US-00005 5' AAG CCA CCG TGT GCG CTA GGG CTC AAG CCC
3'
Approximately 1 in 50,000 clones hybridized with the probe. The
isolated, purified clone of recombinant phage which contained cDNA
which hybridized to this sequence was named clone 35. IV.A.9
Nucleotide Sequence of HCV cDNA in Clone 35
[0420] The nucleotide sequence of the cDNA in clone 35 was
determined essentially as described in Section IV.A.2. The
sequence, its region of overlap with that of the cDNA in clone 36,
and the putative polypeptide encoded therein, are shown in FIG.
8.
[0421] Clone 35 apparently contains a single, continuous ORF that
encodes a polypeptide in the same translational frame as that
encoded by clone 36, clone 81, and clone 32. FIG. 9 shows the
sequence of the long continuous ORF that extends through clones 35,
36, 81, and 32, along with the putative HCV polypeptide encoded
therein. This combined sequence has been confirmed using other
independent cDNA clones derived from the same lambda gt11 cDNA
library.
IV.A.10. Isolation of Overlapping HCV cDNA to cDNA in Clone 35
[0422] The isolation of HCV cDNA sequences upstream of, and which
overlap those in clone 35 cDNA was accomplished as described in
Section IV.A.8, for those which overlap clone 36 cDNA, except that
the synthetic polynucleotide was based on the 5'-region of clone
35. The sequence of the synthetic polynucleotide used for screening
was: TABLE-US-00006 5' CAG GAT GCT GTC TCC CGC ACT CAA CGT 3'
Approximately 1 in 50,000 clones hybridized with the probe. The
isolated, purified clone of recombinant phage which contained cDNA
which hybridized to this sequence was named clone 37b. IV.A.11.
Nucleotide Sequence of HCV in Clone 37b
[0423] The nucleotide sequence of the cDNA in clone 37b was
determined essentially as described in Section IV.A.2. The
sequence, its region of overlap with that of the cDNA in clone 35,
and the putative polypeptide encoded therein, are shown in FIG.
10.
[0424] The 5'-terminal nucleotide of clone 35 is a T, whereas the
corresponding nucleotide in clone 37b is an A. The cDNAs from three
other independent clones which were isolated during the procedure
in which clone 37b was isolated, described in Section IV.A.10, have
also been sequenced. The cDNAs from these clones also contain an A
in this position. Thus, the 5'-terminal T in clone 35 may be an
artefact of the cloning procedure. It is known that artefacts often
arise at the 5'-termini of cDNA molecules.
[0425] Clone 37b apparently contains one continuous ORF which
encodes a polypeptide which is a continuation of the polypeptide
encoded in the ORF which extends through the overlapping clones 35,
36, 81and 32.
IV.A.12 Isolation of Overlapping HCV cDNA to cDNA in Clone 32
[0426] The isolation of HCV cDNA sequences downstream of clone 32
was accomplished as follows. First, clone cla was isolated
utilizing a synthetic hybridization probe which was based on the
nucleotide sequence of the HCV cDNA sequence in clone 32. The
method was essentially that described in Section IV.A.5, except
that the sequence of the synthetic probe was: TABLE-US-00007 5' AGT
GCA GTG GAT GAA CCG GCT GAT AGC CTT 3'.
[0427] Utilizing the nucleotide sequence from clone cla, another
synthetic nucleotide was synthesized which had the sequence:
TABLE-US-00008 5' TCC TGA GGC GAC TGC ACC AGT GGA TAA GCT 3'.
Screening of the lambda gt11 library using the clone cla derived
sequence as probe yielded approximately 1 in 50,000 positive
colonies. An isolated, purified clone which hybridized with this
probe was named clone 33b. IV.A.13 Nucleotide Sequence of HCV cDNA
in Clone 33b
[0428] The nucleotide sequence of the cDNA in clone 33b was
determined essentially as described in Section IV.A.2. The
sequence, its region of overlap with that of the cDNA in clone 32,
and the putative polypeptide encoded therein, are shown in FIG.
11.
[0429] Clone 33b apparently contains one continuous ORF which is an
extension of the ORFs in overlapping clones 37b, 35, 36, 81 and 32.
The polypeptide encoded in clone 33b is in the same translational
frame as that encoded in the extended ORF of these overlapping
clones.
IV.A.14 Isolation of Overlapping HCV cDNAs to cDNA Clone 37b and to
cDNA in Clone 33b
[0430] In order to isolate HCV cDNAs which overlap the cDNAs in
clone 37b and in clone 33b, the following synthetic oligonucleotide
probes, which were derived from the cDNAs in those clones, were
used to screen the lambda gt11 library, using essentially the
method described in Section IV.A.3. The probes used were:
TABLE-US-00009 5' CAG GAT GCT GTC TCC CGC ACT CAA CGT C 3' and 5'
TCC TGA GGC GAC TGC ACC AGT GGA TAA GCT 3'
to detect colonies containing HCV cDNA sequences which overlap
those in clones 37b and 33b, respectively. Approximately 1 in
50,000 colonies were detected with each probe. A clone which
contained cDNA which was upstream of, and which overlapped the cDNA
in clone 37b, was named clone 40b. A clone which contained cDNA
which was downstream of, and which overlapped the cDNA in clone 33b
was named clone 25c. IV.A.15 Nucleotide Sequences of HCV cDNA in
clone 40b and in clone 25c
[0431] The nucleotide sequences of the cDNAs in clone 40b and in
clone 25c were determined essentially as described in Section
IV.A.2. The sequences of 40b and 25c, their regions of overlap with
the cDNAs in clones 37b and 33b, and the putative polypeptides
encoded therein, are shown in FIG. 12 (clone 40b) and FIG. 13
(clone 25c).
[0432] The 5'-terminal nucleotide of clone 40b is a G. However, the
cDNAs from five other independent clones which were isolated during
the procedure in which clone 40b was isolated, described in Section
IV.A.14, have also been sequenced. The cDNAs from these clones also
contain a T in this position. Thus, the G may represent a cloning
artifact (see the discussion in Section IV.A.11).
[0433] The 5'-terminus of clone 25c is ACT, but the sequence of
this region in clone cla (sequence not shown), and in clone 33b is
TCA. This difference may also represent a cloning artifact, as may
the 28 extra 5'-terminal nucleotides in clone 5-1-1.
[0434] Clones 40b and 25c each apparently contain an ORF which is
an extension of the continuous ORF in the previously sequenced
clones. The nucleotide sequence of the ORF extending through clones
40b, 37b, 35, 36, 81, 32, 33b, and 25c, and the amino acid sequence
of the putative polypeptide encoded therein, are shown in FIG. 14.
In the figure, the potential artifacts have been omitted from the
sequence, and instead, the corresponding sequences in
non-5'-terminal regions of multiple overlapping clones are
shown.
IV.A.16. Preparation of a Composite HCV cDNA from the cDNAs in
Clones 36, 81, and 32
[0435] The composite HCV cDNA, C100, was constructed as follows.
First the cDNAs from the clones 36, 81, and 32 were excised with
EcoRI. The EcoRI fragment of cDNA from each clone was cloned
individually into the EcoRI site of the vector pGEM3-blue (Promega
Biotec). The resulting recombinant vectors which contained the
cDNAs from clones 36, 81, and 32 were named pGEM3-blue/36,
pGEM3-blue/81, and pGEM3-blue/32, respectively. The appropriately
oriented recombinant of pGEM3-blue/81 was digested with NaeI and
NarI, and the large (.about.2850 bp) fragment was purified and
ligated with the small (.about.570bp) NaeI/NarI purified
restriction fragment from pGEM3-blue/36. This composite of the
cDNAs from clones 36 and 81 was used to generate another pGEM3-blue
vector containing the continuous HCV ORF contained within the
overlapping cDNA within these clones. This new plasmid was then
digested with PvuII and EcoRI to release a fragment of
approximately 680bp, which was then ligated with the small (580bp)
PvuII/EcoRI fragment isolated from the appropriately oriented
pGEM3-blue/32 plasmid, and the composite cDNA from clones 36, 81,
and 32 was ligated into the EcoRI linearized vector pSODcf1, which
is described in Section IV.B.1, and which was used to express clone
5-1-1 in bacteria. Recombinants containing the .about.1270bp EcoRI
fragment of composite HCV cDNA (C100) were selected, and the cDNA
from the plasmids was excised with EcoRI and purified.
IV.A.17. Isolation and Nucleotide Sequences of HCV cDNAs in Clones
14i, 11b, 7f, 7e, 8h, 33c, 14c, 8f, 33f, 33q, and 39c
[0436] The HCV cDNAs in clones 14i, 11b, 7f, 7e, 8h, 33c, 14c, 8f,
33f, 33g, and 39c were isolated by the technique of isolating
overlapping cDNA fragments from the lambda gt11 library of HCV
cDNAs described in Section IV.A.1.. The technique used was
essentially as described in Section IV.A.3., except that the probes
used were designed from the nucleotide sequence of the last
isolated clones from the 5' and the 3' end of the combined HCV
sequences. The frequency of clones which hybridized with the probes
described below was approximately 1 in 50,000 in each case.
[0437] The nucleotide sequences of the HCV cDNAs in clones 14i, 7f,
7e, 8h, 33c, 14c, 8f, 33f, 33g, and 39c were determined essentially
as described in Section IV.A.2., except that the cDNA excised from
these phages were substituted for the cDNA isolated from clone
5-1-1.
[0438] Clone 33c was isolated using a hybridization probe based on
the sequence of nucleotides in clone 40b. The nucleotide sequence
of clone 40b is presented in FIG. 12. The nucleotide sequence of
the probe used to isolate. 33c was: TABLE-US-00010 5' ATC AGG ACC
GGG GTG AGA ACA ATT ACC ACT 3'
The sequence of the HCV cDNA in clone 33c, and the overlap with
that in clone 40b, is shown in FIG. 15, which also shows the amino
acids encoded therein.
[0439] Clone 8h was isolated using a probe based on the sequence of
nucleotides in clone 33c. The nucleotide sequence of the probe was
TABLE-US-00011 5' AGA GAC AAC CAT GAG GTC CCC GGT GTT C 3'.
The sequence of the HCV cDNA in clone 8h, and the overlap with that
in clone 33c, and the amino acids encoded therein, are shown in
FIG. 16.
[0440] Clone 7e was isolated using a probe based on the sequence of
nucleotides in clone 8h. The nucleotide sequence of the probe was
TABLE-US-00012 5' TCG GAC CTT TAC CTG GTC ACG AGG CAC 3'.
The sequence of HCV cDNA in clone 7e, the overlap with clone 8h,
and the amino acids encoded therein, are shown in FIG. 17.
[0441] Clone 14c was isolated with a probe based on the sequence of
nucleotides in clone 25c. The sequence of clone 25c is shown in
FIG. 13. The probe in the isolation of clone 14c had the sequence
TABLE-US-00013 5' ACC TTC CCC ATT AAT GCC TAC ACC ACG GGC 3'.
The sequence of HCV cDNA in clone 14c, its overlap with that in
clone 25c, and the amino acids encoded therein are shown in FIG.
18.
[0442] Clone 8f was isolated using a probe based on the sequence of
nucleotides in clone 14c. The nucleotide sequence of the probe was
TABLE-US-00014 5' TCC ATC TCT CAA GGC AAC TTG CAC CGC TAA 3'.
The sequence of HCV cDNA in clone 8f, its overlap with that in
clone 14c, and the amino acids encoded therein are shown in FIG.
19.
[0443] Clone 33f was isolated using a probe based on the nucleotide
sequence present in clone 8f. The nucleotide sequence of the probe
was TABLE-US-00015 5' TCC ATG GCT GTC CGC TTC CAC CTC CAA AGT
3'.
The sequence of HCV cDNA in clone 33f, its overlap with that in
clone 8f, and the amino acids encoded therein are shown in FIG.
20.
[0444] Clone 33g was isolated using a probe based on the sequence
of nucleotides in clone 33f. The nucleotide sequence of the probe
was TABLE-US-00016 5' GCG ACA ATA CGA CAA CAT CCT CTG AGC CCG
3'.
The sequence of HCV cDNA in clone 33g, its overlap with that in
clone 33f, and the amino acids encoded therein are shown in FIG.
21.
[0445] Clone 7f was isolated using a probe based on the sequence of
nucleotides in clone 7e. The nucleotide sequence of the probe was
TABLE-US-00017 5' AGC AGA CAA GGG CCC TCC TAG GGT GCA TAA T 3'.
The sequence of HCV cDNA in clone 7f, its overlap with clone 7e,
and the amino acids encoded therein are shown in FIG. 22.
[0446] Clone 11b was isolated using a probe based on the sequence
of clone 7f. The nucleotide sequence of the probe was
TABLE-US-00018 5' CAC CTA TGT TTA TAA CCA TCT CAC TCC TCT 3'.
The sequence of HCV cDNA in clone 11b, its overlap with clone 7f,
and the amino acids encoded therein are shown in FIG. 23.
[0447] Clone 14i was isolated using a probe based on the sequence
of nucleotides in clone 11b. The nucleotide sequence of the probe
was TABLE-US-00019 5' CTC TGT CAC CAT ATT ACA AGC GCT ATA TCA
3'.
The sequence of HCV cDNA in clone 14i, its overlap with 11b, and
the amino acids encoded therein are shown in FIG. 24.
[0448] Clone 39c was isolated using a probe based on the sequence
of nucleotides in clone 33g. The nucleotide sequence of the probe
was TABLE-US-00020 5' CTC GTT GCT ACG TCA CCA CAA TTT GGT GTA
3'
The sequence of HCV cDNA in clone 39c, its overlap with clone 33g,
and the amino acids encoded therein are shown in FIG. 25. IV.A.18.
The Composite HCV cDNA Sequence Derived from Isolated Clones
Containing HCV cDNA
[0449] The HCV cDNA sequences in the isolated clones described
supra have been aligned to create a composite HCV cDNA sequence.
The isolated clones, aligned in the 5' to 3' direction are: 14i,
7f, 7e, 8h, 33c, 40b, 37b, 35, 36, 81, 32, 33b, 25c, 14c, 8f, 33f,
33g, and 39c.
[0450] A composite HCV cDNA sequence derived from the isolated
clones, and the amino acids encoded therein, is shown in FIG.
26.
[0451] In creating the composite sequence the following sequence
heterogeneities have been considered. Clone 33c contains an HCV
cDNA of 800 base pairs, which overlaps the cDNAs in clones 40b and
37c. In clone 33c, as well as in 5 other overlapping clones,
nucleotide #789 is a G. However, in clone 37b (see Section
IV.A.11), the corresponding nucleotide is an A. This sequence
difference creates an apparent heterogeneity in the amino acids
encoded therein, which would be either CYS or TYR, for G or A,
respectively. This heterogeneity may have important ramifications
in terms of protein folding.
[0452] Nucleotide residue #2 in clone 8h HCV cDNA is a T. However,
as shown infra, the corresponding residue in clone 7e is an A;
moreover, an A in this position is also found in 3 other isolated
overlapping clones. Thus, the T residue in clone 8h may represent a
cloning artifact. Therefore, in FIG. 26, the residue in this
position is designated as an A.
[0453] The 3'-terminal nucleotide in clone 8f HCV cDNA is a G.
However, the corresponding residue in clone 33f, and in 2 other
overlapping clones is a T. Therefore, in FIG. 26, the residue in
this position is designated as a T.
[0454] The 3'-terminal sequence in clone 33f HCV cDNA is TTGC.
However, the corresponding sequence in clone 33g and in 2 other
overlapping clones is ATTC. Therefore, in FIG. 26, the
corresponding region is represented as ATTC.
[0455] Nucleotide residue #4 in clone 33g HCV cDNA is a T. However,
in clone 33f and in 2 other overlapping clones the corresponding
residue is an A. Therefore, in FIG. 26, the corresponding residue
is designated as an A.
[0456] The 3'-terminus of clone 14i is an AA, whereas the
corresponding dinucleotide in clone 11b, and in three other clones,
is TA. Therefore, in FIG. 26, the TA residue is depicted.
[0457] The resolution of other sequence heterogeneities is
discussed supra.
[0458] An examination of the composite HCV cDNA indicates that it
contains one large ORF. This suggests that the viral genome is
translated into a large polypeptide which is processed concomitant
with, or subsequent to translation.
IV.A.19. Isolation and Nucleotide Sequences of HCV cDNAs in Clones
12f, 35f, 19g, 26q, and 15e
[0459] The HCV cDNAs in clones 12f, 35f, 19g, 26g, and 15e were
isolated essentially by the technique described in Section IV.A.17,
except that the probes were as indicated below. The frequency of
clones which hybridized with the probes was approximately 1 in
50,000 in each case. The nucleotide sequences of the HCV cDNAs in
these clones were determined essentially as described in Section
IV.A.2., except that the cDNA from the indicated clones were
substituted for the cDNA isolated from clone 5-1-1.
[0460] The isolation of clone 12f, which contains cDNA upstream of
the HCV cDNA in FIG. 26, was accomplished using a hybridization
probe based on the sequence of nucleotides in clone 14i. The
nucleotide sequence of the probe was TABLE-US-00021 5' TGC TTG TGG
ATG ATG CTA CTC ATA TCC CAA 3'.
The HCV cDNA sequence of clone 12f, its overlap with clone 14i, and
the amino acids encoded therein are shown in FIG. 27.
[0461] The isolation of clone 35f, which contains cDNA downstream
of the HCV cDNA in FIG. 26, was accomplished. using a hybridization
probe based on the sequence of nucleotides in clone 39c. The
nucleotide sequence of the probe was TABLE-US-00022 5' AGC AGC GGC
GTC AAA AGT GAA GGC TAA CTT 3'.
The sequence of clone 35f, its overlap with the sequence in clone
39c, and the amino acids encoded therein are shown in FIG. 28.
[0462] The isolation of clone 19g was accomplished using a
hybridization probe based on the 3' sequence of clone 35f. The
nucleotide sequence of the probe was TABLE-US-00023 5' TTC TCG TAT
GAT ACC CGC TGC TTT GAC TCC 3'.
The HCV cDNA sequence of clone 19g, its overlap with the sequence
in clone 35f, and the amino acids encoded therein are shown in FIG.
29.
[0463] The isolation of clone 26g was accomplished using a
hybridization probe based on the 3' sequence of clone 19g. The
nucleotide sequence of the probe was TABLE-US-00024 5' TGT GTG GCG
ACG ACT TAG TCG TTA TCT GTG 3'.
The HCV cDNA sequence of clone 26g, its overlap with the sequence
in clone 19g, and the amino acids encoded therein. are shown in
FIG. 30.
[0464] Clone 15e was isolated using a hybridization probe based on
the 3' sequence of clone 26 g. The nucleotide sequence of the probe
was TABLE-US-00025 5' CAC ACT CCA GTC AAT TCC TGG CTA GGC AAC
3'.
The HCV cDNA sequence of clone 15e, its overlap with the sequence
in clone 26g, and the amino acids encoded therein are shown in FIG.
31.
[0465] The HCV cDNA sequences in the isolated clones described
supra. have been aligned to create a composite HCV cDNA sequence.
The isolated clones, aligned in the 5' to 3' direction are: 12f,
14i, 7f, 7e, 8h, 33c, 40b, 37b, 35, 36, 81, 32, 33b, 25c, 14c, 8f
33f, 33g, 39c, 35f, 19g, 26g, and 15e.
[0466] A composite HCV cDNA sequence derived from the isolated
clones, and the amino acids encoded therein, is shown in FIG.
32.
IV.A.20. Alternative Method of Isolating cDNA Sequences Upstream of
the HCV cDNA Sequence in Clone 12f
[0467] Based on the most 5' HCV sequence in FIG. 32, which is
derived from the HCV cDNA in clone 12f, small synthetic
oligonucleotide primers of reverse transcriptase are synthesized
and used to bind to the corresponding sequence in HCV genomic RNA,
to prime reverse transcription of the upstream sequences. The
primer sequences are proximal to the known 5'-terminal sequence of
clone 12f, but sufficiently downstream to allow the design of probe
sequences upstream of the primer sequences. Known standard methods
of priming and cloning are used. The resulting cDNA libraries are
screened with sequences upstream of the priming sites (as deduced
from the elucidated sequence in clone 12f). The HCV genomic RNA is
obtained from either plasma or liver samples from chimpanzees with
NANBH, or from analogous samples from humans with NANBH.
IV.A.21. Alternative Method Utilizing Tailing to Isolate Sequences
from the 5'-Terminal Region of the HCV Genome
[0468] In order to isolate the extreme 5'-terminal sequences of the
HCV RNA genome, the cDNA product of the first round of reverse
transcription, which is duplexed with the template RNA, is tailed
with oligo C. This is accomplished by incubating the product with
terminal transferase in the presence of CTP. The second round of
cDNA synthesis, which yields the complement of the first strand of
cDNA, is accomplished utilizing oligo G as a primer for the reverse
transcriptase reaction. The sources of genomic HCV RNA are as
described in Section IV.A.20. The methods for tailing with terminal
transferase, and for the reverse transcriptase reactions are as in
Maniatis et al. (1982). The cDNA products are then cloned,
screened, and sequenced.
IV.A.22. Alternative Method Utilizing Tailing to Isolate Sequences
from the 3'-Terminal Region of the HCV Genome
[0469] This method is based on previously used methods for cloning
cDNAs of Flavivirus RNA. In this method, the RNA is subjected to
denaturing conditions to remove secondary structures at the
3'-terminus, and is then tailed with Poly A polymerase using rATP
as a substrate. Reverse transcription of the poly A tailed RNA is
catalyzed by reverse transcriptase, utilizing oligo dT as a primer.
The second strands of cDNA are synthesized, the cDNA products are
cloned, screened, and sequenced.
IV.A.23 Creation of Lambda-gt11 HCV cDNA Libraries Containing
Larger cDNA Inserts
[0470] The method used to create and screen the Lambda gt11
libraries are essentially as described in Section IV.A.1., except
that the library is generated from a pool of larger size cDNAs
eluted from the Sepharose CL-4B column.
IV.A.24. Creation of HCV cDNA Libraries Using Synthetic Oligomers
as Primers
[0471] New HCV cDNA libraries have been prepared from the RNA
derived from the infectious chimpanzee plasma pool described in
Section IV.A.1, and from the poly A RNA fraction derived from the
liver of this infected animal. The cDNA was constructed essentially
as described by Gubler and Hoffman (1983), except that the primers
for the first cDNA strand synthesis were two synthetic oligomers
based on the sequence of the HCV genome described supra. Primers
based on the sequence of clone 11 b and 7e were, respectively,
TABLE-US-00026 5' CTG GCT TGA AGA ATC 3' and 5' AGT TAG GCT GGT GAT
TAT GC 3'.
The resulting cDNAs were cloned into lambda bacteriophage vectors,
and screened with various other synthetic oligomers, whose
sequences were based on the HCV sequence in FIG. 32. IV.A.25.
Creation of HCV cDNA Library From Liver of a Chimpanzee with
Infectious NANBH
[0472] An HCV cDNA library was created from liver from the
chimpanzee from which the HCV cDNA library in Section IV.A.1. was
created. The technique for creating the library was similar to that
in Section IV.A.24, except for this different source of the RNA,
and that a primer based on the sequence of HCV cDNA in clone 11b
was used. The sequence of the primer was TABLE-US-00027 5' CTG GCT
TGA AGA ATC 3'.
IV.A.26. Isolation and Nucleotide Sequence of Overlapping HCV cDNA
in Clone k9-1 to cDNA in Clone 11b
[0473] Clone k9-1 was isolated from the HCV cDNA library created
from the liver of an NANBH infected chimpanzee, as described in
Section IV.A.25. The library was screened for clones which overlap
the sequence in clone 11b, by using a clone which overlaps clone
11b at the 5'-terminus, clone 11e. The sequence of clone 11b is
shown in FIG. 23. Positive clones were isolated with a frequency of
1 in 500,000. One isolated clone, k9-1, was subjected to further
study. The overlapping nature of the HCV cDNA in clone k9-1 to the
5'-end of the HCV-cDNA sequence in FIG. 26 was confirmed by probing
the clone with clone Alex46; this latter clone contains an HCV cDNA
sequence of 30 base pairs which corresponds to those base pairs at
the 5' terminus of the HCV cDNA in clone 14i, described supra.
[0474] The nucleotide sequence of the HCV cDNA isolated from clone
k9-1 was determined using the techniques described supra. The
sequence of the HCV cDNA in clone k9-1, the overlap with the HCV
cDNA in FIG. 26 (indicated by the dotted line), and the amino acids
encoded therein are shown in FIG. 46.
[0475] The HCV cDNA sequence in clone k9-1 has been aligned with
those of the clones described in Section IV.A.19. to create a
composite HCV cDNA sequence, with the k9-1 sequence being placed
upstream of the sequence shown in FIG. 32. The composite HCV cDNA
which includes the k9-1 sequence, and the amino acids encoded
therein, is shown in FIG. 47.
IV.A.27. Isolation and Sequence of Overlapping HCV cDNA Clones 13i,
26j, CA59a, CA84a, CA156e and CA167b
[0476] The clones 13i, 26j, CA59a, CA84a, CA156e and CA167b were
isolated from the lambda-gt11 library described in Section IV.A.1.
The frequencies with which positive clones appeared with the
respective probes was about 1 in 50,000.
[0477] The isolation of clone 13i was accomplished using a
synthetic probe derived from the sequence of clone 12f. The
sequence of the probe was: TABLE-US-00028 5' GAA CGT TGC GAT CTG
GAA GAC AGG GAC AGG 3'.
[0478] The isolation of clone 26j was accomplished using a probe
derived from the 5'-region of clone K9-1. The sequence of the probe
was: TABLE-US-00029 5' TAT CAG TTA TGC CAA CGG AAG CGG CCC CGA
3'.
[0479] The HCV cDNA sequences of clones 13i and 26j, are shown in
FIGS. 48 and 49, respectively. Also shown are the amino acids
encoded therein, as well as the overlap of clone 13i with clone
12f, and the overlap of clone 26J with clone 13i. The sequences for
these clones confirmed the sequence of clone K9-1, which had been
isolated from a different HCV cDNA library (see, Section
IV.A.26).
[0480] Clone CA59a was isolated utilizing a probe based upon the
sequence of the 5'-region of clone 26j. The sequence of this probe
was: TABLE-US-00030 5' CTG GTT AGC AGG GCT TTT CTA TCA CCA CAA
3'.
[0481] A probe derived from the sequence of clone CA59a was used to
isolate clone CA84a. The sequence of the probe used for this
isolation was: TABLE-US-00031 5' AAG GTC CTG GTA GTG CTG CTG CTA
TTT GCC 3'.
[0482] Clone CA156e was isolated using a probe derived from the
sequence of clone CA84a. The sequence of the probe was:
TABLE-US-00032 5' ACT GGA CGA CGC AAG GTT GCA ATT GCT CTA 3'.
[0483] Clone CA167b was isolated using a probe derived from the
sequence of clone CA 156e. The sequence of the probe was:
TABLE-US-00033 5' TTC GAC GTC ACA TCG ATC TGC TTG TCG GGA 3'.
[0484] The nucleotide sequences of the HCV cDNAs in clones CA59a,
CA84a, CA156e, and CA167b, are shown FIGS. 50, 51, 52, and 53,
respectively. The amino acids encoded therein, as well as the
overlap with the sequences of relevant clones, are also shown in
the FIGS.
IV.A.28. Creation of "pi" HCV cDNA Library
[0485] A library of HCV cDNA, the "pi" library, was constructed
from the same batch of infectious chimpanzee plasma used to
construct the lambda-gt11 described in Section IV.A.1, and
utilizing essentially the same techniques. However, construction of
the pi library utilized a primer-extension method, in which the
primer for reverse transcriptase was based on the sequence of clone
CA59A. The sequence of the primer was: TABLE-US-00034 5' GGT GAC
GTG GGT TTC 3'.
IV.A.29. Isolation and Sequence of Clone pi14a
[0486] Screening of the "pi" HCV cDNA library described in Section
IV.A.28 with the probe used to isolate clone CA167b (see Section
IV.A.27.) yielded clone pi14a. The clone contains about 800 base
pairs of cDNA which overlaps clones CA16i7b, CA156e, CA84a and
CA59a (which were isolated from the HCV cDNA library described in
Section IV.A.1.). In addition, pi14a also contains about 250 base
pairs of DNA which are upstream of the HCV cDNA in clone
CA167b.
[0487] The combined ORF derived from the HCV cDNA sequences in
clones pi14a, CA167b, CA156e, CA84a, CA59a, K9-1, 12f, 14i, 11b,
7f, 7e, 8h, 33c, 40b, 37b, 35, 36, 81, 32, 33b, 25c, 14c, 8f, 33f,
33g, 39c, 35f, 19g, 26g, and 15e is shown in FIG. 54; also shown
are the amino acids encoded therein.
IV.A.30. Isolation and Sequence of Clones CA216a, CA290a and
aq30a
[0488] Based on the sequence of clone CA167b (see Section IV.A.27
and FIG. 53), a synthetic probe was made having the following
sequence: TABLE-US-00035 5' GGC TTT ACC ACG TCA CCA ATG ATT GCC CTA
3'
The above probe was used to screen the lambda-gt11 library
described in Section IV.A.1, which yielded clone CA216a, whose HCV
sequences are shown in FIG. 56.
[0489] Another probe was made based on the sequence of clone CA216a
having the following sequence: TABLE-US-00036 5' TTT GGG TAA GGT
CAT CGA TAC CCT TAG GTG 3'
Screening the above library with this probe yielded clone CA290a,
the HCV sequences therein being shown in FIG. 57.
[0490] In a parallel approach, a primer-extension cDNA library was
made using nucleic acid extracted from the same infectious plasma
used in the original lambda-gt11 cDNA library described above. The
primer used was based on the sequence of clones CA216a and CA290a:
TABLE-US-00037 5' GAA GCC GCA CGT AAG 3'
[0491] The cDNA library was made using methods similar to those
described previously for libraries used in the isolation of clones
pi14a and k9-1 (see Sections IV.A.26 and IV.A.29). The probe used
to screen this library was based on the sequence of clone CA290a:
TABLE-US-00038 5' CCG GCG TAG GTC GCG CAA TTT GGG TAA 3'
Clone ag30a was isolated from the new library with the above probe,
and contained about 670 basepairs of HCV sequence. See FIG. 58.
Part of this sequence overlaps the HCV sequence of clones CA216a
and CA290a. About 300 base-pairs of the ag30a sequence, however, is
upstream of the sequence from clone CA290a. The non-overlapping
sequence shows a start codon (*) and stop codons that may indicate
the start of the HCV ORF. Also indicated in FIG. 58 are putative
small encoded peptides (#) which may play a role in regulating
translation, as well as the putative first amino acid of the
putative polypeptide (/), and downstream amino acids encoded
therein. IV.A.31. Isolation and Sequence of Clone CA205a
[0492] Clone CA205a was isolated from the original lambda gt-11
library, using a synthetic probe derived from the HCV sequence in
clone CA290a (FIG. 57). The sequence of the probe was:
TABLE-US-00039 5' TCA GAT CGT TGG TGG AGT TTA CTT GTT GCC 3'.
[0493] The sequence of the HCV cDNA in CA205a, shown in FIG. 59,
overlaps with the cDNA sequences in both clones ag30a and CA290a.
The overlap of the sequence with that of CA290a is shown by the
dotted line above the sequence (the figure also shows the putative
amino acids encoded in this fragment).
[0494] As observed from the HCV cDNA sequences in clones CA205a and
ag30a, the putative HCV polyprotein appears to begin at the ATG
start codon; the HCV sequences in both clones contain an in-frame,
contiguous double stop codon (TGATAG) forty two nucleotides
upstream from this ATG. The HCV ORF appears to begin after these
stop codons, and to extend for at least 8907 nucleotides (see the
composite HCV cDNA shown in FIG. 62).
IV.A.32. Isolation and Sequence of Clone 18q
[0495] Based on the sequence of clone ag30a (see IV.A.30 and FIG.
58) and of an overlapping clone from the original lambda gt-11
library, CA230a, a synthetic probe was made having the following
sequence: TABLE-US-00040 5' CCA TAG TGG TCT GCG GAA CCG GTG AGT ACA
3'.
Screening of the original lambda-gt11 HCV cDNA library (described
in Section IV.A.1.) with the probe yielded clone 18g, the HCV cDNA
sequence of which is shown in FIG. 60. Also shown in the figure are
the overlap with clone ag30a, and putative polypeptides encoded
within the HCV cDNA.
[0496] The cDNA in clone 18g (C18g or 18g) overlaps that in clones
ag30a and CA205a, described in Section IV.A.32. The sequence of
C18g also contains the double stop codon region observed in clone
ag30a. The polynucleotide region upstream of these stop codons
presumably represents part of the 5'-region of the HCV genome,
which may contain short ORFs, and which can be confirmed by direct
sequencing of the purified HCV genome. These putative small encoded
peptides may play a regulatory role in translation. The region of
the HCV genome upstream of that represented by C18g can be isolated
for sequence analysis using essentially the technique described in
Section IC.A.20., except that that the primers of reverse
transcriptase are based upon the sequence of C18g. Since HCV
appears to be a Flavi-like virus, it is probable that the
5'-terminus of the genome will be modified with a "cap" structure.
It is known that Flavivirus genomes contain 5'-terminal "cap"
structures. (Yellow Fever virus, Rice et al. (1988); Dengue virus,
Hahn et al (1988); Japanese Encephalitis Virus (1987)).
IV.A.33. Isolation and Sequence of Clones from the beta-HCV cDNA
library
[0497] Clones containing cDNA representative of the 3'-terminal
region of the HCV genome were isolated from a cDNA library
constructed from the original infectious chimpanzee plasma pool
which was used for the creation of the HCV cDNA lambda-gt11 library
described in Section IV.A.1. In order to create the DNA library,
RNA extracted from the plasma was "tailed" with poly rA using poly
(rA) polymerase, and cDNA was synthesized using oligo(dT).sub.12-18
as a primer for reverse transcriptase. The resulting RNA:cDNA
hybrid was digested with RNAase H, and converted to double stranded
HCV cDNA. The resulting HCV cDNA was cloned into lambda-gt10, using
essentially the technique described in Huynh (1985), yielding the
beta (or b) HCV cDNA library. The procedures used were as
follows.
[0498] An aliquot (12 ml) of the plasma was treated with proteinase
K, and extracted with an equal volume of phenol saturated with 0.05
M Tris-Cl, pH 7.5, 0.05% (v/v) beta-mercaptoethanol, 0.1% (w/v)
hydroxyquinolone, 1 mM EDTA. The resulting aqueous phase was
re-extracted with the phenol mixture, followed by 3 extractions
with a 1:1 mixture containing phenol and chloroform:isoamyl alcohol
(24:1), followed by 2 extractions with a mixture of chloroform and
isoamyl alcohol (1:1). Subsequent to adjustment of the aqueous
phase to 200 mM with respect to NaCl, nucleic acids in the aqueous
phase were precipitated overnight at -20.degree. C., with 2.5
volumes of cold absolute ethanol. The precipitates were collected
by centrifugation at 10,000 RPM for 40 min., washed with 70%
ethanol containing 20 mM NaCl, and with 100% cold ethanol, dried
for 5 min. in a dessicator, and dissolved in water.
[0499] The isolated nucleic acids from the infectious chimpanzee
plasma pool were tailed with poly rA utilizing poly-A polymerase in
the presence of human placenta ribonuclease inhibitor (HPRI)
(purchased from Amersham Corp.), utilizing MS2 RNA as carrier.
Isolated nucleic acids equivalent to that in 2 ml of plasma were
incubated in a solution containing TMN. (50 mM Tris HCl, pH 7.9, 10
mM MgCl.sub.2, 250 mM NaCl, 2.5 mM MnCl.sub.2, 2 mM dithiothreitol
(DTT)), 40 micromolar alpha-[.sup.32P] ATP, 20 units HPRI (Amersham
Corp.), and about 9 to 10 units of RNase free poly-A polymerase
(BRL). Incubation was for 10 min. at 37.degree. C., and the
reactions were stopped with EDTA (final concentration about 250
mM). The solution was extracted with an equal volume of
phenol-chloroform, and with an equal volume of chloroform, and
nucleic acids were precipitated overnight at -20.degree. C. with
2.5 volumes of ethanol in the presence of 200 mM NaCl.
IV.A.33.a. Isolation of Clone b5a
[0500] The beta HCV cDNA library was screened by hybridization
using a synthetic probe, which had a sequence based upon the HCV
cDNA sequence in clone 15e. The sequence of the probe was:
TABLE-US-00041 5' ATT GCG AGA TCT ACG GGG CCT GCT ACT CCA 3'.
Screening of the library yielded clone beta-5a (b5a), which
contains an HCV cDNA region of approximately 1000 base pairs. The
5'-region of this cDNA overlaps clones 35f, 19g, 26g, and 15e
(these clones are described supra). The region between the
3'-terminal poly-A sequence and the 3'-sequence which overlaps
clone 15e, contains approximately 200 base pairs. This clone allows
the identification of a region of the 3'-terminal sequence the HCV
genome.
[0501] The sequence of b5a is contained within the sequence of the
HCV cDNA in clone 16jh (described infra). Moreover, the sequence is
also present in CC34a, isolated from the original lambda-gt11
library. (The original lambda-gt11 library is referred to herein as
the "C" library).
IV.A.34. Isolation and Sequence of Clones Generated by PCR
Amplification of the 3'-Region of the HCV Genome
[0502] Multiple cDNA clones have been generated which contain
nucleotide sequences derived from the 3'-region of the HCV genome.
This was accomplished by amplifying a targeted region of the genome
by a polymerase chain reaction technique described in Saiki et al.
(1986), and in Saiki et al. (1988), which was modified as described
below. The HCV RNA which was amplified was obtained from the
original infectious chimpanzee plasma pool which was used for the
creation of the HCV cDNA lambda-gt11 library described in Section
IV.A.1. Isolation of the HCV RNA was as described in Section
IV.A.33. The isolated RNA was tailed at the 3'-end with ATP by E.
coli poly-A polymerase as described in Sippel (1973), except that
the nucleic acids isolated from chimp serum were substituted for
the nucleic acid substrate. The tailed RNA was then reverse
transcribed into cDNA by reverse transcriptase, using an oligo
dT-primer adapter, essentially as described by Han (1987), except
that the components and sequence of the primer-adapter were:
TABLE-US-00042 Stuffer NotI SP6 Promoter Primer AATTC GCGGCCGC
CATACGATTTAGGTGACACTATAGAA T.sub.15
[0503] The resultant cDNA was subjected to amplification by PCR
using two primers: TABLE-US-00043 Primer Sequence JH32 (30mer)
ATAGCGGCCGCCCTCGATTGCGAGATCTAC JH11 (20mer)
AATTCGGGCGGCCGCCATACGA
The JH32 primer contained 20 nucleotide sequences hybridizable to
the 5'-end of the target region in the CDNA, with an estimated
T.sub.m of 66.degree. C. The JH11 was derived from a portion of the
oligo dT-primer adapter; thus, it is specific to the 3'-end of the
cDNA with a T.sub.m of 64.degree. C. Both primers were designed to
have a recognition site for the restriction enzyme, NotI, at the
5'-end, for use in subsequent cloning of the amplified HCV
cDNA.
[0504] The PCR reaction was carried out by suspending the cDNA and
the primers in 100 microliters of reaction mixture containing the
four deoxynucleoside triphosphates, buffer salts and metal ions,
and a thermostable DNA polymerase isolated from Thermus aquaticus
(Taq polymerase), which are in a Perkin Elmer Cetus PCR kit
(N801-0043 or N801-0055). The PCR reaction was performed for 35
cycles in a Perkin Elmer Cetus DNA thermal cycler. Each cycle
consisted of a 1.5 min denaturation step at 94.degree. C., an
annealing step at 60.degree. C. for 2 min, and a primer extension.
step at 72.degree. C. for 3 min. The PCR products were subjected to
Southern blot analysis using a 30 nucleotide probe, JH34, the
sequence of which was based upon that of the 3'-terminal region of
clone 15e. The sequence of JH34 is: TABLE-US-00044 5' CTT GAT CTA
CCT CCA ATC ATT CAA AGA CTC 3'.
The PCR products detected by the HCV cDNA probe ranged in size from
about 50 to about 400 base pairs.
[0505] In order to clone the amplified HCV cDNA, the PCR products
were cleaved with NotI and size selected by polyacrylamide gel
electrophoresis. DNA larger than 300 base pairs was cloned into the
NotI site of pUC18S The vector pUC18S is constructed by including a
NotI polylinker cloned between the EcoRI and SailI sites of pUC18.
The clones were screened for HCV cDNA using the JH34 probe. A
number of positive clones were obtained and sequenced. The
nucleotide sequence of the HCV cDNA insert in one of these clones,
16jh, and the amino acids encoded therein, are shown in FIG. 61. A
nucleotide heterogeneity, detected in the sequence of the HCV cDNA
in clone 16jh as compared to another clone of this region, is
indicated in the figure.
IV.A.35 Compiled HCV cDNA Sequence
[0506] The HCV cDNA sequence compiled from a series of overlapping
clones derived from the various HCV cDNA libraries described supra.
and infra is shown in FIG. 62. The clones from which the sequence
was derived are b114a, 18g, ag30a, CA205a, CA290a, CA216a, pi14a,
CA167b, CA156e, CA84a, CA59a, K9-1 (also called k9-1),26j, 13i,
12f, 14i, 11b, 7f, 7e, 8h, 33c, 40b, 37b, 35, 36, 81, 32, 33b, 25c,
14c, 8f, 33f, 33g, 39c, 35f, 19g, 26g, 15e, b5a, and 16jh. In the
figure the three dashes above the sequence indicate the position of
the putative initiator methionine codon.
[0507] Clone b114a was obtained using the cloning procedure
described for clone b5a, supra., except that the probe was the
synthetic probe used to detect clone 18g, supra. Clone b114a
overlaps with clones 18g, ag30a, and CA205a, except that clone
b114a contains an extra two nucleotides upstream of the sequence in
clone 18g (i.e., 5'-CA). These extra two nucleotides have been
included in the HCV genomic sequence shown in FIG. 62.
[0508] It should be noted that although several of the clones
described supra. have been obtained from libraries other than the
original HCV cDNA lambda-gt11 library described in Section IV.A.1.,
these clones contain HCV cDNA sequences which overlap HCV cDNA
sequences in the original library. Thus, essentially all of the HCV
sequence is derivable from the original lambda-gt11 library which
was used to isolate the first clone (5-1-1).
IV.A.36 Isolation and Sequence of Clone 6k
[0509] Based on the sequence of clone 16jh and clone b5a (see
IV.A.34. and FIG. 61), a synthetic probe was made having the
following sequence: TABLE-US-00045 5' TCT TCA ACT GGG CAG TAA GAA
CAA AGC TCA 3'.
[0510] Screening of the original lambda-gt11 HCV cDNA library
(described in Section IV.A.1.) with the probe yielded clones with a
frequency of approximately 1 in 10.sup.6; one of these was called
clone 6k (also called C6k), the HCV cDNA sequence of which is shown
in FIG. 71. Also shown in the figure are the overlap with clone
16jh, and putative polypeptides encoded within the HCV cDNA.
Sequence information on the HCV cDNA in clone 6k was obtained from
only one strand. Information on the deposit of this clone is
provided infra, wherein the clone is listed as Lambda gt11 C6k.
Confirmation of the C6K sequence as part of an ORF encoding HCV1
polypeptide has been obtained by sequencing other overlapping
clones.
[0511] A composite of the HCV cDNA sequence derived from
overlapping clones b114a, 18g, ag30a, CA205a, CA290a, CA216a,
pi14a, CA167b, CA156e, CA84a, CA59a, K9-1 (also called k9-1), 26j,
13i, 12f, 14i, 11b, 7f, 7e, 8h, 33c, 40b, 37b, 35, 36, 81, 32, 33b,
25c, 14c, 8f, 33f, 33g, 39c, 35f, 19g, 26g, 15e, b5a, 16jh, and 16k
is shown in FIG. 72. The figure also shows the amino acids encoded
in the sense strand of the cDNA, which is the equivalent of the
genomic RNA.
IV.A.36 Construction of pS3-56.sub.C100m
[0512] The vector pS3-56 contains a construct which encodes the
fusion polypeptide SOD-C100 (see Section IV.B.4.). In addition,
this vector contains an ms2 phage sequence, which was removed from
the HCV C100 encoding sequence by digestion of pS3-56.sub.C100 with
XmaI and SalI, followed by isolation of the large fragment. The
aforementioned digestion, however, removes some of the HCV
sequence. The latter was recreated by ligation of the fragment with
the following linkers, which also introduced a SalI site and a stop
codon. The linker sequences, annealed to each other, are shown in
FIG. 73.
[0513] The resulting vector is called pS3-56.sub.C100m (also called
pS356.sub.C100m)
IV.A.37. Construction of Composite Sequence C200
[0514] An HCV-cDNA sequence, C200, which is a composite of HCV
sequences derived from clones 33c, 31, and 35, was constructed.
Clones 33c and 35 are described in Section IV.A.17. and IV.A.8.,
respectively. Clone 31 is from the C library, and has one
difference from the confirmed sequence of HCV-1 in FIG. 62. The
sequence of clone 31 is shown in FIG. 74, which also shows the
amino acids encoded therein, and the location of restriction enzyme
sites within the HCV cDNA. A C200 cassette was constructed by
ligating together a 718 bp fragment obtained by digestion of clone
33c DNA with EcoRI and HinfI, a 179 bp fragment obtained by
digestion of clone 31 DNA with HinfI and BglI, and a 377 bp
fragment obtained by digestion of clone 35 DNA with BglI and EcoRI.
The construct of ligated fragments were inserted into the EcoRI
site of pBR322, yielding the plasmid pBR322-C200.
IV.A.38. Isolation and Sequence of Clone p131h
[0515] A clone containing sequence from the 3'-region of the HCV
genome, and which contains an in-frame stop codon, was isolated
essentially as described in Section IV.A.34, except that HCV1 RNA
was converted to cDNA using the oligonucleotide TABLE-US-00046 5'
AAT TCG CGG CCG CCA TAC GAT TTA GGT GAC ACT ATA GAA T.sub.15
3'.
[0516] The cDNA was then amplified by the PCR reaction using the
primers: TABLE-US-00047 5' TTC GCG GCC GCT ACA GCG GGG GAG ACA T 3'
and 5' AAT TCG CGG CCG CCA TAC GA 3'.
[0517] After amplification, the PCR products were precipitated with
spermine, digested with NotI, and extracted with phenol. The
purified products were cloned into the NotI site of pUC18S, and HCV
positive clones were selected using the oligonucleotide:
TABLE-US-00048 5' CGA TGA AGG TTG GGG TAA ACA CTC CGG CCT 3'.
The HCV cDNA in one clone, designated p131jh, is shown in FIG. 75.
This clone contains an in-frame stop codon for the large ORF
contained in the HCV genome. IV.B. Expression and Purification of
Polypeptides Encoded Within HCV cDNAs and Identification of the
Expressed Products as HCV Induced Antigens. IV.B.1. Expression of
the Polypeptide Encoded in Clone 5-1-1.
[0518] The HCV polypeptide encoded within clone 5-1-1 (see Section
IV.A.2., supra) was expressed as a fusion polypeptide with
superoxide dismutase (SOD). This was accomplished by subcloning the
clone 5-1-1 cDNA insert into the expression vector pSODcf1 (Steimer
et al. (1986)) as follows.
[0519] First, DNA isolated from pSODcf1 was treated with BamHI and
EcoRI, and the following linker was ligated into the linear DNA
created by the restriction enzymes: TABLE-US-00049 5' GAT CCT GGA
ATT CTG ATA AGA CCT TAA GAC TAT TTT AA 3'
After cloning, the plasmid containing the insert was isolated.
[0520] Plasmid containing the insert was restricted. with EcoRI.
The HCV cDNA insert in clone 5-1-1 was excised with EcoRI, and
ligated into this EcoRI linearized plasmid DNA. The DNA mixture was
used to transform E. coli strain D1210 (Sadler et al. (1980)).
Recombinants with the 5-1-1 cDNA in the correct orientation for
expression of the ORF shown in FIG. 1 were identified by
restriction mapping and nucleotide sequencing.
[0521] Recombinant bacteria from one clone were induced to express
the SOD-NANB.sub.5-1-1 polypeptide by growing the bacteria in the
presence of IPTG.
IV.B.2. Expression of the Polypeptide Encoded in Clone 81.
[0522] The HCV cDNA contained within clone 81 was expressed as a
SOD-NANB.sub.81 fusion polypeptide. The method for preparing the
vector encoding this fusion polypeptide was analogous to that used
for the creation of the vector encoding SOD-NANB.sub.5-1-1 except
that the source of the HCV cDNA was clone 81, which was isolated as
described in Section IV.A.3, and for which the cDNA sequence was
determined as described in Section IV.A.4. The nucleotide sequence
of the HCV cDNA in clone 81, and the putative amino acid sequence
of the polypeptide encoded therein are shown in FIG. 4.
[0523] The HCV cDNA insert in clone 81 was excised with EcoRI, and
ligated into the pSODcf1 which contained the linker (see IV.B.1.)
and which was linearized by treatment with EcoRI. The DNA mixture
was used to transform E. coli strain D1210. Recombinants with the
clone 81 HCV cDNA in the correct orientation for expression of the
ORF shown in FIG. 4 were identified by restriction mapping and
nucleotide sequencing.
[0524] Recombinant bacteria from one clone were induced to express
the SOD-NANB.sub.81 polypeptide by growing the bacteria in the
presence of IPTG.
IV.B.3. Identification of the Polypeptide Encoded Within Clone
5-1-1 as an HCV and NANBH Associated Antigen.
[0525] The polypeptide encoded within the HCV cDNA of clone 5-1-1
was identified as a NANBH associated antigen by demonstrating that
sera of chimpanzees and humans infected with NANBH reacted
immunologically with the fusion polypeptide, SOD-NANB.sub.5-1-1,
which is comprised of superoxide dismutase at its N-terminus and
the in-frame 5-1-1 antigen at its C-terminus. This was accomplished
by "Western" blotting (Towbin et al. (1979)) as follows.
[0526] A recombinant strain of bacteria transformed with an
expression vector encoding the SOD-NANB.sub.5-1-1 polypeptide,
described in Section IV.B.I., was induced to express the fusion
polypeptide by growth in the presence of IPTG. Total bacterial
lysate was subjected to electrophoresis through polyacrylamide gels
in the presence of SDS according to Laemmli (1970). The separated
polypeptides were transferred onto nitrocellulose filters (Towbin
et al. (1979)). The filters were then cut into thin strips, and the
strips were incubated individually with the different chimpanzee
and human sera. Bound antibodies were detected by further
incubation with .sup.125I-labeled sheep anti-human Ig, as described
in Section IV.A.1.
[0527] The characterization of the chimpanzee sera used for the
Western blots and the results, shown in the photograph of the
autoradiographed strips, are presented in FIG. 33. Nitrocellulose
strips containing polypeptides were incubated with sera derived
from chimpanzees at different times during acute NANBH (Hutchinson
strain) infections (lanes 1-16), hepatitis A infections (lanes
17-24, and 26-33), and hepatitis B infections (lanes 34-44). Lanes
25 and 45 show positive controls in which the immunoblots were
incubated with serum from the patient used to identify the
recombinant clone 5-1-1 in the original screening of the
lambda-gt11 cDNA library (see Section IV.A.1.).
[0528] The band visible in the control lanes, 25 and 45, in FIG. 23
reflects the binding of antibodies to the NANB.sub.5-1-1 moiety of
the SOD fusion polypeptide. These antibodies do not exhibit binding
to SOD alone, since this has also been included as a negative
control in these samples, and would have appeared as a band
migrating significantly faster than the SOD-NANB.sub.5-1-1 fusion
polypeptide.
[0529] Lanes 1-16 of FIG. 33 show the binding of antibodies in sera
samples of 4 chimpanzees; the sera were obtained just prior to
infection with NANBH, and sequentially during acute infection. As
seen from the figure, whereas antibodies which reacted
immunologically with the SOD-NANB.sub.5-1-1 polypeptide were absent
in sera samples obtained before administration of infectious HCV
inoculum and during the early acute phase of infection, all 4
animals eventually induced circulating antibodies to this
polypeptide during the late part of, or following the acute phase.
Additional bands observed on the immunoblots in the cases of chimps
numbers 3 and 4 were due to background binding to host bacterial
proteins.
[0530] In contrast to the results obtained with sera from chimps
infected with NANBH, the development of antibodies to the
NANB.sub.5-1-1 moiety of the fusion polypeptide was not observed in
4 chimpanzees infected with HAV or 3 chimpanzees infected with HBV.
The only binding in these cases was background binding to the host
bacterial proteins, which also occurred in the HCV infected
samples.
[0531] The characterization of the human sera used for the Western
blots, and the results, which are shown in the photograph of the
autoradiographed strips, are presented in FIG. 34. Nitrocellulose
strips containing polypeptides were incubated with sera derived
from humans at different times during infections with NANBH (lanes
1-21), RAV (lanes 33-40), and HBV (lanes 41-49). Lanes 25 and 50
show positive controls in which the immunoblots were incubated with
serum from patient used in the original screening of the
lambda-gt11 library, described supra. Lanes 22-24 and 26-32 show
"non-infected" controls in which the sera was from "normal" blood
donors.
[0532] As seen in FIG. 34, sera from nine NANBH patients, including
the serum used for screening the lambda-gt11 library, contained
antibodies to the NANB.sub.5-1-1 moiety of the fusion polypeptide.
Sera from three patients with NANBH did not contain these
antibodies. It is possible that the anti-NANB.sub.5-1-1 antibodies
will develop at a future date in these patients. It is also
possible that this lack of reaction resulted from a different NANBV
agent being causative of the disease in the individuals from which
the non-responding serum was taken.
[0533] FIG. 34 also shows that sera from many patients infected
with HAV and HBV did not contain anti-NANB.sub.5-1-1 antibodies,
and that these antibodies were also not present in the sera from
"normal" controls. Although one HAV patient (lane 36) appears to
contain anti-NANB.sub.5-1-1 antibodies, it is possible that this
patient had been previously infected with HCV, since the incidence
of NANBH is very high and since it is often subclinical.
[0534] These serological studies indicate that the cDNA in clone
5-1-1 encodes epitopes which are recognized specifically by sera
from patients and animals infected with BB-NANBV. In addition, the
cDNA does not appear to be derived from the primate genome. A
hybridization probe made from clone 5-1-1 or from clone 81 did not
hybridize to "Southern" blots of control human and chimpanzee
genomic DNA from uninfected individuals under conditions where
unique, single-copy genes are detectable. These probes also did not
hybridize to Southern blots of control bovine genomic DNA.
IV.B.4. Expression of the Polypeptide Encoded in a Composite of the
HCV cDNAs in Clones 36, 81 and 32
[0535] The HCV polypeptide which is encoded in the ORF which
extends through clones 36, 81 and 32 was expressed as a fusion
polypeptide with SOD. This was accomplished by inserting the
composite cDNA, C100, into an expression cassette which contains
the human superoxide dismutase gene, inserting the expression
cassette into a yeast expression vector, and expressing the
polypeptide in yeast.
[0536] An expression cassette containing the composite C100 cDNA
derived from clones 36, 81, and 32, was constructed by inserting
the .about.1270 bp EcoRI fragment into the EcoRI site of the vector
pS3-56 (also called pS356), yielding the plasmid pS3-56.sub.C100.
The construction of C100 is described in Section IV.A.16,
supra.
[0537] The vector pS3-56, which is a pBR322 derivative, contains an
expression cassette which is comprised of the ADH2/GAPDH hybrid
yeast promoter upstream of the human superoxide dismutase gene, and
a downstream alpha factor transcription terminator. A similar
cassette, which contains these control elements and the superoxide
dismutase gene has been described in Cousens et al. (1987), and in
copending application EPO 196,056, published Oct. 1, 1986, which is
commonly owned by the herein assignee. The cassette in pS3-56,
however, differs from that in Cousens et al. (1987) in that the
heterologous proinsulin gene and the immunoglobulin hinge are
deleted, and in that the gln.sub.154 of the superoxide dismutase is
followed by an adaptor sequence which contains an EcoRI site. The
sequence of the adaptor is: TABLE-US-00050 5'-AAT TTG GGA ATT CCA
TAA TGA GAC CCT TAA GGT ATT ACT CAG CT 3'.
The EcoRI site allows the insertion of heterologous sequences
which, when expressed from a vector containing the cassette, yield
polypeptides which are fused to superoxide dismutase via an
oligopeptide linker containing the amino acid sequence:
-asn-leu-gly-ile-arg-.
[0538] After recombinants containing the C100 cDNA insert in the
correct orientation were isolated, the expression cassette
containing the C100 cDNA was excised from pS3-56.sub.C100 with
BamHI, and a fragment of 3400 bp which contains the cassette was
isolated and purified. This fragment was then inserted into the
BamHI site of the yeast vector pAB24.
[0539] Plasmid pAB24, the significant features of which are shown
in FIG. 35, is a yeast shuttle vector which contains the complete 2
micron sequence for replication (Broach (1981)) and pBR322
sequences. It also contains the yeast URA3 gene derived from
plasmid YEp24 [Botstein et al. (1979)], and the yeast LEU.sup.2d
gene derived from plasmid pC1/1. EPO Pub. No. 116,201. Plasmid
pAB24 was constructed by digesting YEp24 with EcoRI and religating
the vector to remove the partial 2 micron sequences. The resulting
plasmid, YEP24deltaRI, was linearized by digestion with ClaI and
ligated with the complete 2 micron plasmid which had been
linearized with ClaI. The resulting plasmid, pCBou, was then
digested with XbaI and the 8605 bp vector fragment was gel
isolated. This isolated XbaI fragment was ligated with a 4460 bp
XbaI fragment containing the LEU.sup.2d gene isolated from pC1/1;
the orientation of the LEU.sup.2d gene is in the same direction as
the URA3 gene. Insertion of the expression was in the unique BamHI
site of the pBR322 sequence, thus interrupting the gene for
bacterial resistance to tetracycline.
[0540] The recombinant plasmid which contained the SOD-C100
expression cassette, pAB24C100-3, was transformed into yeast strain
JSC 308, as well as into other yeast strains. The cells were
transformed as described by Hinnen et al. (1978), and plated onto
ura-selective plates. Single colonies were inoculated into
leu-selective media and grown to saturation. The culture was
induced to express the SOD-C100 polypeptide (called C100-3) by
growth in YEP containing 1% glucose.
[0541] Strain JSC 308 is of the genotype MAT @, leu2, ura3(del)
DM15 (GAP/ADR1) integrated at the ADR1 locus. In JSC 308,
over-expression of the positive activator gene product, ADR1,
results in hyperderepression (relative to an ADR1 wild type
control) and significantly higher yields of expressed heterologous
proteins when such proteins are synthesized via an ADH2 UAS
regulatory system. The construction of the yeast strain JSC 308 is
disclosed in copending application, U.S. Ser. No. 190,868, filed
concurrently herewith, and which is hereby incorporated herein by
reference.
[0542] The complete C100-3 fusion polypeptide encoded in
pAB24C100-3 should contain 154 amino acids of human SOD at the
amino-terminus, 5 amino acid residues derived from the synthetic
adaptor containing the EcoRI site, 363 amino acid residues derived
from C100 cDNA, and 5 carboxy-terminal amino acids derived from the
MS2 nucleotide sequence adjoining the HCV cDNA sequence in clone
32. (see Section IV.A.7.) The putative amino acid sequence of the
carboxy-terminus of this polypeptide, beginning at the penultimate
Ala residue of SOD, is shown in FIG. 36; also shown is the
nucleotide sequence encoding this portion of the polypeptide.
[0543] IV.B.4b. Contents of Selective Media For Yeast Auxotrophs
TABLE-US-00051 Leu- Medium Yeast Minimal Media 850 ml Leu-
Supplements (10x) 100 ml 50% Glucose (in MILLI Q) 40 ml (If the
Leu- medium is to be used for growth of yeast in flasks, Ura-
supplements are also included in the medium. Yeast Minimal Medium
Yeast Nitrogen Base w/o amino acids 6.7 g MILLI Q water q.s. to 850
ml Leu- Supplements Adenine 0.8 g Uridine 0.6 g L-Tryptophan 0.4 g
L-Histidine 0.4 g L-Arginine 0.4 g L-Methionine 0.4 g L-Tyrosine
0.6 g L-Lysine 0.6 g L-Phenylalanine 0.96 g Add all components to a
coffee grinder and grind until the powder is homogenous. The powder
may be added to a solution or the mix can be autoclaved as a 10x
concentrated solution by adding 2 L of MILLI Q water. Ura-/Sorbitol
Plates Ura-/Sorbitol Medium for Plates 500 ml 50% Glucose 20 ml 20%
Casamino acids 12.5 ml 1% Adenine 2.5 ml 1% Tryptophan 2.5 ml Stir
gently and pour into plates. Flame plates. Ura- Sorbitol Medium
D-Sorbitol 91 g Agar 10 g Yeast Nitrogen Base without amino acids
3.35 g Water q.s. to 450 ml Autoclave for 30 minutes YEP Peptone 20
g Yeast Extract 10 g MILLI Q Water q.s. to 1000 ml Autoclave at
121.degree. C. for 30 minutes. The solution is good for six months
when stored at 15 to 30.degree. C. Leu- Plates Leu- Plate Medium
950 ml 50% Glucose 40 ml 5% Threonine 4 ml 1% Adenine 1 ml Leu-
Medium for Plates Agar 20 g Leu- Supplements 0.25 g 10x Basal Salts
w/o amino acids 100 ml MILLI Q q.s. to 950 ml 10x Basal Salts Yeast
Nitrogen Base w/o Amino Acids 66.8 g Succinic Acid 100 g NaOH 60 g
MILLI Q Water q.s. to 1000 ml Filter Sterilize Leu-, Ura- plates
Leu-, Ura- Plate media 840 ml 50% Glucose 160 ml 5% Threonine 8 ml
Leu-, Ura- Plate Medium Yeast Nitrogen Base without amino acids 6.7
g Bacto Agar 20 g Leu-, Ura- supplements 0.5 g (Note: the Leu-,
Ura- supplement recipe is the same as the Leu- supplement recipe,
except that uridine is not added.)
IV.B.5. Identification of the Polypeptide Encoded within C100 as an
NANBH Associated Antigen The C100-3 fusion polypeptide expressed
from plasmid pAB24C100-3 in yeast strain JSC 308 was characterized
with respect to size, and the polypeptide encoded within C100 was
identified as an NANBH-associated antigen by its immunological
reactivity with serum from a human with chronic NANBH.
[0544] The C100-3 polypeptide, which was expressed as described in
Section IV.B.4., was analyzed as follows. Yeast JSC 308 cells were
transformed with pAB24, or with pAB24C100-3, and were induced to
express the heterologous plasmid encoded polypeptide. The induced
yeast cells in 1 ml of culture (OD.sub.650 nm.about.20) were
pelleted by centrifugation at 10,000 rpm for 1 minute, and were
lysed by vortexing them vigorously (10.times.1 min) with 2 volumes
of solution and 1 volume of glass beads (0.2 millimicron diameter).
The solution contained 50 mM Tris-HCl, pH 8.0, 1 mM EDTA, 1 mM
phenylmethylsulphonyl fluoride (PMSF), and 1 microgram/ml
pepstatin. Insoluble material in the lysate, which includes the
C100-3 polypeptide, was collected by centrifugation (10,000 rpm for
5 minutes), and was dissolved by boiling for 5 minutes in Laemmli
SDS sample buffer. (See Laemmli (1970)]. An amount of polypeptides
equivalent to that in 0.3 ml of the induced yeast culture was
subjected to electrophoresis through 10% polyacrylamide gels in the
presence of SDS according to Laemmli (1970). Protein standards were
co-electrophoresed on the gels. Gels containing the expressed
polypeptides were either stained with Coomassie brilliant blue, or
were subjected to "Western" blotting as described in Section
IV.B.2., using serum from a patient with chronic NANBH to determine
the immunological reactivity of the polypeptides expressed from
pAB24 and from pAB24C100-3.
[0545] The results are shown in FIG. 37. In FIG. 37A the
polypeptides were stained with Coomassie brilliant blue. The
insoluble polypeptide(s) from JSC 308 transformed with pAB24 and
from two different colonies of JSC transformed with pAB24C100-3 are
shown in lane 1 (pAB24), and lanes 2 and 3, respectively. A
comparison of lanes 2 and 3 with lane 1 shows the induced
expression of a polypeptide corresponding to a molecular weight of
.about.54,000 daltons from JSC 308 transformed with pAB24C100-3,
which is not induced in JSC 308 transformed with pAB24. This
polypeptide is indicated by the arrow.
[0546] FIG. 37B shows the results of the Western blots of the
insoluble polypeptides expressed in JSC 308 transformed with
pAB24(lane 1), or with pAB24C100-3 (lane 2). The polypeptides
expressed from pAB24 were not immunologically reactive with serum
from a human with NANBH. However, as indicated by the arrow, JSC
308 transformed with pAB24C100-3 expressed a polypeptide of
.about.54,000 dalton molecular weight which did react
immunologically with the human NANBH serum. The other
immunologically reactive polypeptides in lane 2 may be degradation
and/or aggregation products of this .about.54,000 dalton
polypeptide.
IV.B.6. Purification of Fusion Polypeptide C100-3
[0547] The fusion polypeptide, C100-3, comprised of SOD at the
N-terminus and in-frame C100 HCV-polypeptide at the C-terminus was
purified by differential extraction of the insoluble fraction of
the extracted host yeast cells in which the polypeptide was
expressed.
[0548] The fusion polypeptide, C100-3, was expressed in yeast
strain JSC 308 transformed with pAB24C100-3, as described in
Section IV.B.4. The yeast cells were then lysed by homogenization,
the insoluble material in the lysate was extracted at pH 12.0, and
C100-3 in the remaining insoluble fraction was solubilized in
buffer containing SDS.
[0549] The yeast lysate was prepared essentially according to
Nagahuma et al. (1984). A yeast cell suspension was prepared which
was 33% cells (v/v) suspended in a solution (Buffer A) containing
20 mM Tris HCl, pH 8.0, 1 mM dithiothreitol, and 1 mM
phenylmethylsulfonylfluoride (PMSF). An aliquot of the suspension
(15 ml) was mixed with an equal volume of glass beads (0.45-0.50 mm
diameter), and the mixture was vortexed at top speed on a Super
Mixer (Lab Line Instruments, Inc.) for 8 min. The homogenate and
glass beads were separated, and the glass beads were washed 3 times
with the same volume of Buffer A as the original packed cells.
After combining the washes and homogenate, the insoluble material
in the lysate was obtained by centrifuging the homogenate at
7,000.times.g for 15 minutes at 4.degree. C., resuspending the
pellets in Buffer A equal to twice the volume of original packed
cells, and re-pelleting the material by centrifugation at
7,000.times.g for 15 min. This washing procedure was repeated 3
times.
[0550] The insoluble material from the lysate was extracted at pH
12.0 as follows. The pellet was suspended in buffer containing 0.5
M NaCl, 1 mM EDTA, where the suspending volume was equal to 1.8
times the of the original packed cells. The pH of the suspension
was adjusted by adding 0.2 volumes of 0.4 M Na phosphate buffer, pH
12.0. After mixing, the suspension was centrifuged at 7,000.times.g
for 15 min at 4.degree. C., and the supernatant removed. The
extraction was repeated 2 times. The extracted pellets were washed
by suspending them in 0.5 M NaCl, 1 mM EDTA, using a suspension
volume equal to two volumes of the original packed cells, followed
by centrifugation at 7,000.times.g for 15 min at 4.degree. C.
[0551] The C100-3 polypeptide in the extracted pellet was
solubilized by treatment with SDS. The pellets were suspended in
Buffer A equal to 0.9 volumes of the original packed cell volume,
and 0.1 volumes of 2% SDS was added. After the suspension was
mixed, it was centrifuged at 7,000.times.g for 15 min at 4.degree.
C. The resulting pellet was extracted 3 more times with SDS. The
resulting supernatants, which contained C100-3 were pooled.
[0552] This procedure purifies C100-3 more than 10-fold from the
insoluble fraction of the yeast homogenate, and the recovery of the
polypeptide is greater than 50%.
[0553] The purified preparation of fusion polypeptide was analyzed
by polyacrylamide gel electrophoresis according to Laemmli (1970).
Based upon this analysis, the polypeptide was greater than 80%
pure, and had an apparent molecular weight of .about.54,000
daltons.
IV.B.7.a. Purification of Fusion Polypeptide C100-3
(Alternate Method 1)
[0554] The fusion polypeptide, C100-3 (HCV c100-3), expressed in
yeast strain JSC 308 transformed with pAB24C100-3, may be purified
by an alternative method. In this method the antigen is
precipitated from the crude cell lysate with acetone; the acetone
precipitated antigen is then subjected to ion-exchange
chromatography, and further purified by gel filtration.
[0555] The transformed yeast are grown under conditions which allow
expression (see Section IV.B.4). A cell lysate is prepared by
suspending the cells in Buffer A (20 mM Tris HCl, pH 8.0, 1 mM
EDTA, 1 mM PMSF. The cells are broken by grinding with glass beads
in a Dynomill type homogenizer or its equivalent. The extent of
cell breakage is monitored by counting cells under a microscope
with phase optics. Broken cells appear dark, while viable cells are
light-colored. The percentage of broken cells is determined.
[0556] When the percentage of broken cells is approximately 90% or
greater, the broken cell debris is separated from the glass beads
by centrifugation, and the glass beads are washed with Buffer A.
After combining the washes and homogenate, the insoluble material
in the lysate is obtained by centrifugation. The material in the
pellet is washed to remove soluble proteins by suspension in Buffer
B (50 mM glycine, pH 12.0, 1 mM DTT, 500 mM NaCl), followed by
Buffer C (50 mM glycine, pH 10.0, 1 mM DTT). The insoluble material
is recovered by centrifugation, and solubilized by suspension in
Buffer C containing SDS. The extract solution may be heated in the
presence of beta-mercaptoethanol and concentrated by
ultrafiltration. The HCV c100-3 in the extract is precipitated with
cold acetone. If desired, the precipitate may be stored at
temperatures at about or below -15.degree. C.
[0557] Prior to ion exchange chromatography, the acetone
precipitated material is recovered by centrifugation, and may be
dried under nitrogen. The precipitate is suspended in Buffer D (50
mM glycine, pH 10.0, 1 mM DTT, 7 M urea), and centrifuged to pellet
insoluble material. The supernatant material is applied to an anion
exchange column previously equilibrated with Buffer D. Fractions
are collected and analyzed by ultraviolet absorbance or gel
electrophoresis on SDS polyacrylamide gels. Those fractions
containing the HCV c100-3 polypeptide are pooled.
[0558] In order to purify the HCV c100-3 polypeptide by gel
filtration, the pooled fractions from the ion-exchange column are
heated in the presence of beta-mercaptoethanol and SDS, and the
eluate is concentrated by ultrafiltration. The concentrate is
applied to a gel filtration column previously equilibrated with
Buffer E (20 mM Tris HCl, pH 7.0, 1 mM DTT, 0.1% SDS). The presence
of HCV c100-3 in the eluted fractions, as well as the presence of
impurities, are determined by gel electrophoresis on polyacrylamide
gels in the presence of SDS and visualization of the polypeptides.
Those fractions containing purified HCV c100-3 are pooled.
Fractions high in HCV c100-3 may be further purified by repeating
the gel filtration process. If the removal of particulate material
is desired, the HCV c100-3 containing material may be filtered
through a 0.22 micron filter.
IV.B.7.b. Expression and Purification of Fusion Polypeptide C100-3
(Alternate Method 2)
[0559] The fusion polypeptide C100-3 (also called HCV c100-3), is
expressed in yeast strain JSC308 transformed with pAB24C100-3. The
expression of the C100-3 coding region is under control of the ADH2
upstream activator sequences (UAS) and GAP promoter sequences. This
system is repressed when glucose is present in the medium. In the
fermentation process, the inocula cultures (Inoculum 1 and 2) are
prepared in selective medium containing a high amount of glucose to
repress synthesis of the C100-3 polypeptide. Inoculum 2 is then
diluted into complete medium containing an initial concentration of
glucose sufficient to allow substantial mass increase before being
metabolically exhausted by fermentation growth of the culture.
After the glucose has been exhausted from this expression medium,
the cells derepress the ADH-2 regulated system as they begin to
grow by respiration. In this method, the majority of the mass
increase of the cell culture is functionally uncoupled from the
production of the HCV C100-3 polypeptide. The expressed C100-3
polypeptide thus expressed is purified by isolation of an insoluble
cell fraction, extraction of this fraction with SDS followed by
acetone precipitation, solubilization of the acetone precipitate,
followed by chromatography on Q-Sepharose and on gel filtration
columns.
[0560] Preparation and isolation of transformants is as follows.
Yeast strain JSC308 (MATa, ura3-delta 1, leu2-04-[cir.sup.O],
::DM15 (G418.sup.R) is transformed with plasmid pAB24-c100-3, using
the lithium transformation procedure described by Ito et al.
(1984). The transformation mix is plated onto selective ura agar
plates, and the plates are incubated at 30.degree. C. for 2 to 4
days. Next, transformants having high plasmid copy numbers are
selected by streaking ura colonies to leucine selective plates.
Transformants are selected on their ability to express the C100-3
polypeptide, as described below.
[0561] In order to test expression of C100-3, single transformant
colonies are transferred into leu.sup.-, 2% glucose medium and
grown at 30.degree. C. until saturation. Under these conditions,
expression of C100-3 is repressed due to the high glucose
concentration in the medium. Expression is induced by a 1/25
dilution of the saturated culture into YEP/1% glucose; the diluted
cells are grown to saturation. The cells are harvested, lysed by
grinding with glass beads in TE buffer containing NaCl. The
insoluble fractions are collected by centrifugation, and
solubilized by resuspension in SDS sample buffer and boiling. The
solubilized fraction is examined by fractionation on standard 10%
denaturing acrylamide gels (Laemmli (1970)). The polypeptides on
the gel are visualized by staining with Coomassie blue. Evidence of
expression is initially determined by appearance of a new
polypeptide in extracts of transformants harboring pAB24-c100-3 as
compared with control extracts (cells transformed with pAB24 vector
lacking the C100-3 coding region). A protein band of about 53 Kd
was clearly seen in extracts of cells harboring the C100-3
expression plasmid; this band was absent from the control
extract.
[0562] A stock is prepared from a single transformant colony by
streaking onto a leu.sup.- selective agar plate, and incubating at
30.degree. C. for 1-4 days. Single colonies are picked, and
individually inoculated into about 5 ml of leu.sup.-, 2% glucose
medium, and grown to saturation at 30.degree. C. One ml is
aseptically removed from each tube, and is transferred to a flask
containing 500 ml of leu.sup.- medium, 2% glucose. The flask is
incubated at 30.degree. C. with agitation, for approximately 29
hours, after which time the flask is removed from incubation, an
O.D. 650 value is determined, and the viability of the sample is
determined. If the sample is viable, glycerol is added to a final
concentration of 15%, and the sample is stored in 1 ml aliquots at
.ltoreq.60.degree. C.
[0563] A working seed stock is prepared. An aliquot of the frozen
stock is plated onto leu.sup.- selective plates. An isolated small
colony is picked, inoculated into 1-5 ml of selective culture
(described above), and incubated at 30.degree. C. for one day. One
ml from this culture is used to inoculate a larger leu.sup.-
selective media culture (500-1000 ml). After 30-60 hours of
incubation, the O.D..sub.650 value and viability is determined.
Glycerol is added to a final concentration of 15% to the viable
culture. The culture is stored at .ltoreq.60.degree. C. in 1 ml
aliquots
[0564] The stocks of transformed cells are analyzed. Viability of
the stocks is equal to or greater than 5.times.10.sup.5 viable
cells per ml of culture. Phenotypic analysis is for the chromosomal
markers MATa and ::DM15(G418.sup.R). MATa is tested by a plate
assay that detects secretion of mating factor when the test cells
are patched onto a lawn of cells carrying the opposite mating type.
Opposite mating types of the lawn and patched cells produce a clear
halo around the patch. DM15 (G418.sup.R) is tested by patching
cells onto YEPD plates with and without geneticin. The presence of
the latter marker allows for growth of the cells in geneticin
plates.
[0565] The plasmids from the cells are also analyzed by restriction
map and nucleotide sequence confirmation for the expression
cassette.
[0566] In order to prepare inoculum 1, the transformed yeast cells
from the working stock are incubated in sterile selective medium
(leu.sup.-, 2% glucose); incubation is at 30.+-.2.degree. C. at
250-350 rpm for 30 to 36 hours.
[0567] In order to prepare inoculum 2, sterile selective medium at
pH 5.9.+-.0.1 containing approximately 10 grams of yeast nitrogen
base without amino acids (DIFCO) per liter, 0.5 grams of Leu.sup.-
supplements per liter, antifoam (approximately 0.1 ml/L), and 200
grams of dextrose per liter, is prepared in a fermentor. Inoculum 1
is transferred aseptically to the fermentor, and is incubated at
30.+-.2.degree. C. at an agitation speed of 400.+-.50 rpm with an
air flow of 10.+-.2 liters per minute. Incubation is for 24.+-.6
hours.
[0568] Expression of C100-3 is accomplished by transferring
inoculum 2 to a fresh batch of sterile YEP medium with 2% dextrose,
and incubating the cells in a fermentor for 53.+-.7 hours at
30.+-.2.degree. C., with an agitation speed of 200.+-.20 rpm and an
air flow 200.+-.20 liters per minute. After the incubation, the
fermentor culture is cooled to <20.degree. C., and harvested by
continuous flow centrifugation. The supernatant is discarded, and
the yeast slurry is collected.
[0569] The C100-3 polypeptide is partially purified by removal of
the soluble yeast fraction. The yeast slurry is adjusted to 50 mM
Tris HCl (using 1.0 M Tris HCl, pH 8.0), 0.15 M NaCl, 2 mM EDTA,
and 1 mM PMSF. The yeast is mechanically disrupted using a
continuous flow Dynomill glass bead mill with 0.5 mm nominal
diameter glass beads. Breakage is continued until >90% of the
yeast cells are broken. The resulting lysate is then diluted to
achieve a 10% (v/v) solids concentration based on pre-lysis volume
and packed cell volume by adding the same lysis buffer containing
PMSF. Gross cellular debris is removed by continuous flow
centrifgation in a Westfalia Model SA-1 centrifuge, and is
discarded. The partially clarified, diluted lysate is further
centrifuged at a higher relative G-force to recover the C100-3
polypeptide. This step is accomplished by continuous centrifugation
of the lysate in a CEPA LE centrifuge at full speed (flow rate, 100
to 200.+-.20 ml/minute). The supernatant is discarded, and the CEPA
pellets are collected and stored at .ltoreq.60.degree. C.
[0570] Further purification of the C100-3 polypeptide from the CEPA
pelleted material is accomplished by acetone precipitation of an
SDS solubilized fraction, followed by ion-exchange chromatography
of the precipitated material, and then by gel filtration
chromatography of the eluate from the ion-exchange column.
[0571] The CEPA pelleted material is resuspended in a Tris/EDTA
buffer (20 mM Tris HCL, pH 8.0, 1.0 mM EDTA, 1.0 mM PMSF), and
insoluble material is collected by centrifugation at 17,000.times.G
for 60 minutes at approximately 4.degree. C. The pellet is washed
twice with a glycine/DTT/NaCl buffer (50 mM glycine, 1.0 mM DTT, 50
mM NaCl, pH 12) and once with glycine/DTT buffer (50 mM glycine,
1.0 mM DTT, pH 10.0) before it is extracted by suspension in the
same buffer containing 0.5% SDS (w/v). The pellet is recovered by
centrifugation (17,000.times.G, 30 min, about 4.degree. C.), and
the SDS extraction is repeated. The two extracts are combined, and
heated to 80-85.degree. C. to solubilize the C100-3 polypeptide.
After solubilization, the extract is cooled and BME is added to a
concentration of 1% (w/v), and the extract solution is precipitated
with cold acetone to remove excess SDS; this material may be stored
at <-15.degree. C. for up to five weeks. The acetone precipitate
is recovered by centrifugation (5,000.times.G).
[0572] In order to further purify the material in the acetone
precipitate by chromatography, the precipitate is suspended in
glycine/urea buffer (50 mM glycine, pH 10, 7 mM urea, 1o mM DTT),
is heated to 80-85.degree. C., then cooled. The extract is then
applied to a Q-Sepharose anion exchange column (2.5 L Q Sepharose,
25 cm diameter column) which was previously equilibrated against
the glycine/urea buffer; the flow rate is .about.50 ml per minute,
and the temperature is 2 to 8.degree. C. The fractions are
collected, and those containing C100-3 polypeptide, as determined
by absorbance at 280 nm, are pooled.
[0573] The material which passes through the ion exchange column is
further purified by gel filtration. The pool of fractions from the
ion-exchange column is adjusted to 0.5% (w/v) SDS, and is
concentrated two-fold with an ultrafiltation unit using a 30K
molecular weight cut-off membane. The concentrated fraction is then
adjusted to 2% (v/v) BME, heated, the protein concentration is
measured, and the fraction is cooled. The cooled eluate is then
applied to Sephacryl S-300 HR gel filtration columns which were
previously equilibrated with an SDS/Tris buffer (0.1% SDS (w/v), 20
mM Tris HCl, pH 7.0, 10 mM DTT). The gel filtration columns are 55
cm high by 25 cm diameter; the filtration is over two of these
units in series; the operating flow is 100 ml per minute. Fraction
collection is started immediately after loading. The eluted
fractions are analyzed by electrophoresis on polyacrylamide gels
containing SDS, in order to determine which of the fractions should
be pooled. Prior to electrophoresis, the test samples and a
reference sample are prepared by boiling in a buffer containing BME
and SDS. Following electrophoresis, the gels are stained with
Coomassie blue for visualization of the protein bands. The
determination of which fractions to pool is based on the following
analysis. The fraction containing the highest and purest amount of
polypeptide is called "peak fraction". This fraction together with
fractions which elute earlier are pooled up to, and including the
first fraction exhibiting a decrease of approximately 1/3 the
amount of C100-3 polypeptide band relative to the adjacent
fraction, and a decrease of approximately 2/3 relative to the peak
fraction. The decrease is observed in the relative thickness of the
C100-3 bands. Fractions which elute later than the C100-3 peak are
pooled up to, but not including the first fraction exhibiting a
visible band at the molecular weight of about 18,000 relative to a
molecular weight marker, and including the the last fraction
exhibiting a decrease of approximately 2/3 of the polypeptide band
relative to the peak fraction.
[0574] The pooled fractions are further purified by repeating the
gel filtration process. The fractions from the second gel
filtration column are analyzed as described above, and are further
analyzed by HPLC to determine pooling. Analysis by HPLC uses a
TSK-400 gel filtration HPLC column, equipped with a computerized
integrator. All samples are prepared in a buffer containing 20 mM
DTT to prevent oxidation of the C100-3 polypeptide. Pooling based
on HPLC analysis is as follows. Using the HPLC chromatograms, the
ratio of peak height to peak area for the C100-3 peak in each of
the fractions is calculated. The ratio values follow a trend,
increasing to a maximum value and then decreasing. Those fractions
with a ratio equal to or greater than 85% of the maximum value and
which meet the criteria in gel electrophoresis are pooled. The
total volume of the pool of fractions is measured, the protein
concentration is determined by the Lowry method, and the
concentration of the final pool is adjusted to 0.5 to 1.0 mg/ml
with the same buffer used for the gel filtration columns.
IV.B.8. Expression and Antigenicity of Polypeptides Encoded in HCV
cDNA
IV.B.8.a. Polypeptides Expressed in E. coli
[0575] The polypeptides encoded in a number of HCV cDNAs which span
the HCV genomic ORF were expressed in E. coli, and tested for their
antigenicity using serum obtained from a variety of individuals
with NANBH. The clones from which the HCV cDNAs were isolated, as
well as their relative relationships, and antigenicity, are shown
in FIG. 63. Also indicated in the figure are the putative
polypeptides encoded in the ORF of the HCV genome, based upon the
Flavivirus model and the hydropathic character of the putative
encoded polypeptides. However, the hydrophobicity profiles
(described infra), indicate that HCV diverges from the Flavivirus
model, particularly with respect to the region upstream of NS2.
Moreover, the boundaries indicated are not intended to show firm
demarcations between the putative polypeptides.
[0576] Possible protein domains of the encoded HCV polyprotein, as
well as the approximate boundaries, are the following:
TABLE-US-00052 Approximate Boundary Putative Domain (amino acid
nos.) C (nucleocapsid protein) 1-120 E (Virion envelope protein(s)
120-400 and possibly matrix (M) proteins NS1 (complement fixation
400-660 antigen?) NS2 (unknown function) 660-1050 NS3 (protease?)
1050-1640 NS4 (unknown function) 1640-2000 NS5 (polymerase) 2000-?
end
[0577] These domains are, however, extremely tentative, since they
are based upon the Flavivirus model, and recent evidence suggests
that the relationship between HCV and the flaviviridae may be
distant.
[0578] The expression vectors containing the cloned HCV cDNAs were
constructed from pSODcf1, which is described in Section IV.B.1. In
order to be certain that a correct reading frame would be achieved,
three separate expression vectors, pcf1AB, pcf1CD, and pcf1EF were
created by ligating three new linkers, AB, CD, and EF to a
BamHI-EcoRI fragment derived by digesting to completion the vector
pSODcf1 with EcoRI and BamHI, followed by treatment with alkaline
phosphatase. The linkers were created from six oligomers, A, B, C,
D, E, and F. Each oligomer was phosphorylated by treatment with
kinase in the presence of ATP prior to annealing to its
complementary oligomer. The sequences of the synthetic linkers were
the following. TABLE-US-00053 Name DNA Sequence (5' to 3') A GATC
CTG AAT TCC TGA TAA B GAC TTA AGG ACT ATT TTA A C GATC CGA ATT CTG
TGA TAA D GCT TAA GAC ACT ATT TTA A E GATC CTG GAA TTC TGA TAA . F
GAC CTT AAG ACT ATT TTA A
Each of the three linkers destroys the original EcoRI site, and
creates a new EcoRI site within the linker, but within a different
reading frame. Hence, the HCV cDNA EcoRI fragments isolated from
the clones when inserted into the expression vector, were in three
different reading frames.
[0579] The HCV cDNA fragments in the designated lambda-gt11 clones
(indicated in FIG. 63) were excised by digestion with EcoRI; each
fragment was inserted into pcf1AB, pcf1CD, and pcf1EF. These
expression constructs were then transformed into D1210 E. coli
cells, the transformants were cloned, and polypeptides were
expressed as described in Section IV.B.2.
[0580] Expression products of the indicated HCV cDNAs were tested
for antigenicity by direct immunological screening of the colonies,
using a modification of the method described in Helfman et al.
(1983). Briefly, as shown in FIG. 64, the bacteria were plated onto
nitrocellulose filters overlaid on ampicillin plates to give
approximately 1,000 colonies per filter. Colonies were replica
plated onto nitrocellulose filters, and the replicas were regrown
overnight in the presence of 2 mM IPTG and ampicillin. The
bacterial colonies were lysed by suspending the nitrocellulose
filters for about 15 to 20 min in an atmosphere saturated with
CHCl.sub.3 vapor. Each filter then was placed in an individual 100
mm Petri dish containing 10 ml of 50 mM Tris HCl, pH 7.5, 150 mM
NaCl, 5 mM MgCl.sub.2, 3% (w/v) BSA, 40 micrograms/ml lysozyme, and
0.1 microgram/ml DNase. The plates were agitated gently for at
least 8 hours at room temperature. The filters were rinsed in TBST
(50 mM Tris HCl, pH8.0, 150 mM NaCl, 0.005% Tween 20). After
incubation, the cell residues were rinsed and incubated in TBS
(TBST without Tween) containing 10% sheep serum; incubation was for
1 hour. The filters were then incubated with pretreated sera in TBS
from individuals with NANBH, which included: 3 chimpanzees; 8
patients with chronic NANBH whose sera were positive with respect
to antibodies to HCV C100-3 polypeptide (described in Sections
IV.B.6 and IV.B.7.) (also called C100); 8 patients with chronic
NANBH whose sera were negative for anti-C100 antibodies; a
convalescent patient whose serum was negative for anti-C100
antibodies; and 6 patients with community acquired NANBH, including
one whose sera was strongly positive with respect to anti-C100
antibodies, and one whose sera was marginally positive with respect
to anti-C100 antibodies. The sera, diluted in TBS, was pretreated
by preabsorption with hSOD. Incubation of the filters with the sera
was for at least two hours. After incubation, the filters were
washed two times for 30 min with TBST. Labeling of expressed
proteins to which antibodies in the sera bound was accomplished by
incubation for 2 hours with .sup.125I-labeled sheep anti-human
antibody. After washing, the filters were washed twice for 30 min
with TBST, dried, and autoradiographed.
[0581] As seen from the results shown in FIG. 65, a number of
clones expressed polypeptides containing HCV epitopes which were
immunologically reactive with serum from individuals with NANBH.
Five of these polypeptides were very immunogenic in that antibodies
to HCV epitopes in these polypeptides were detected in many
different patient sera. The clones encoding these polypeptides, and
the location of the polypeptide in the putative HCV polyprotein
(wherein the amino acid numbers begin with the putative initiator
codon) are the following: clone 5-1-1, amino acids 1694-1735; clone
C100, amino acids 1569-1931; clone 33c, amino acids 1192-1457;
clone CA279a, amino acids 1-84; and clone CA290a amino acids 9-177.
The location of the immunogenic-polypeptides within the putative
HCV polyprotein are shown immediately below. TABLE-US-00054 Clones
encoding polypeptides of proven reactivity with sera from NANBH
patients. Location within the HCV polyprotein (amino acid no.
beginning with putative Clone initiator methionine) CA279a 1-84
CA74a 437-582 13i 511-690 CA290a 9-177 33c 1192-1457 40b 1266-1428
5-1-1 1694-1735 81 1689-1805 33b 1916-2021 25c 1949-2124 14c
2054-2223 8f 2200-3325 33f 2287-2385 33g 2348-2464 39c 2371-2502
15e 2796-2886 C100 1569-1931
[0582] The results on the immunogenicity of the polypeptides
encoded in the various clones examined sugest efficient detection
and immunization systems may include panels of HCV
polypeptides/epitopes.
IV.B.8.b. Expression of HCV Epitopes in Yeast
[0583] Three different yeast expression vectors which allow the
insertion of HCV cDNA into three different reading frames are
constructed. The construction of one of the vectors is described in
Section IV.B.4., except that HCV cDNA from the clones listed in
Section IV.B.8.a. are substituted for the C100 HCV cDNA. The
construction of the other vectors replaces the adaptor described in
Section IV.B.4. with one of the following adaptors: TABLE-US-00055
Adaptor 1 ATT TTG AAT TCC TAA TGA G AC TTA AGG ATT ACT CAG CT
[0584] TABLE-US-00056 Adaptor 2 AAT TTG GAA TTC TAA TGA G AC CTT
AAG ATT ACT CAG CT.
[0585] The inserted HCV cDNA is expressed in yeast transformed with
the vectors, using the expression conditions described in Section
IV.B.4. The resulting polypeptides are screened using the sera from
individuals with NANBH, described in Section IV.B.8.a.
IV.B.9. Expression and Purification of Fusion Polypeptide
SOD-C33c
[0586] A fusion polypeptide comprised of SOD at the N-terminus and
in-frame C33c HCV-polypeptide at the C-terminus (SOD-C33c), is
encoded in clone pCF1EF/C33c (see
Section IV.B.8.). This polypeptide was expressed in E. coli, and
purified therefrom.
[0587] Expression was accomplished by inoculating 1500 ml of Luria
broth containing ampicillin (100 micrograms/ml) with 15 ml of an
overnight culture of E. coli D1210 transformed with clone
pCF1EF/C33c. The cells were grown to an O.D. of 0.3, IPTG was added
to yield a final concentration of 2 mM, and growth continued until
the cells attained a density of 1 O.D., at which time they were
harvested by centrifugation at 3,000.times.g at 4.degree. C. for 20
minutes. The packed cells can be stored at -80.degree. C. for
several months.
[0588] In order to purify the SOD-C33c polypeptide the bacterial
cells in which the polypeptide was expressed were subjected to
osmotic shock and mechanical disruption, the insoluble fraction
containing SOD-C33c was isolated and subjected to differential
extraction with an alkaline-NaCl solution, and the fusion
polypeptide in the extract purified by chromatography on columns of
S-Sepharose and Q-Sepharose.
[0589] The crude extract resulting from osmotic shock and
mechanical disruption was prepared by the following procedure. One
gram of the packed cells were suspended in 10 ml of a solution
containing 0.02 M Tris HCl, pH 7.5, 10 mM EDTA, 20% sucrose, and
incubated for 10 minutes on ice. The cells were then pelleted by
centrifugation at 4,000.times.g for 15 min at 4.degree. C. After
the supernatant was removed, the cell pellets were resuspended in
10 ml of Buffer A1 (0.01M Tris HCl, pH 7.5, 1 mM EDTA, 14 mM
beta-mercaptoethanol [BME]), and incubated on ice for 10 minutes.
The cells were again pelleted at 4,000.times.g for 15 minutes at
4.degree. C. After removal of the clear supernatant (periplasmic
fraction I), the cell pellets were resuspended in Buffer A1,
incubated on ice for 10 minutes, and again centrifuged at
4,000.times.g for 15 minutes at 4.degree. C. The clear supernatant
(periplasmic fraction II) was removed, and the cell pellet
resuspended in 5 ml of Buffer A2 (0.02 M Tris HCl, pH 7.5, 14 mM
BME, 1 mM EDTA, 1 mM PMSF). In order to disrupt the cells, the
suspension (5 ml) and 7.5 ml of Dyno-mill lead-free acid washed
glass beads (0.10-0.15 mm diameter)(obtained from Glen-Mills, Inc.)
were placed in a Falcon tube, and vortexed at top speed for two
minutes, followed by cooling for at least 2 min on ice; the
vortexing-cooling procedure was repeated another four times. After
vortexing, the slurry was filtered through a scintered glass funnel
using low suction; the glass beads were washed two times with
Buffer A2, and the filtrate and washes combined.
[0590] The insoluble fraction of the crude extract was collected by
centrifugation at 20,000.times.g for 15 min at 4.degree. C., washed
twice with 10 ml Buffer A2, and resuspended in 5 ml of MILLI-Q
water.
[0591] A fraction containing SOD-C33c was isolated from the
insoluble material by adding to the suspension NaOH (2 M) and NaCl
(2 M) to yield a final concentation of 20 mm each, vortexing the
mixture for 1 minute, centrifuging it 20,000.times.g for 20 min at
4.degree. C., and retaining the supernatant.
[0592] In order to purify SOD-C33c on S-Sepharose, the supernatant
fraction was adjusted to a final concentration of 6 M urea, 0.05 M
Tris HCl, pH 7.5, 14 mM BME, 1 mM EDTA. This fraction was then
applied to a column of S-Sepharose Fast Flow (1.5.times.10 cm)
which had been equilibrated with Buffer B (0.05M Tris HCl, pH 7.5,
14 mM BME, 1 mM EDTA). After application, the column was washed
with two column volumes of Buffer B. The flow through and wash
fractions were collected. The flow rate of application and wash,
was 1 ml/min; and collected fractions were 1 ml. In order to
identify fractions containing SOD-C33c, aliquots of the fractions
were analyzed by electrophoresis on 10% polyacrylamide gels
containing SDS followed by staining with Coomassie blue. The
fractions are also analyzable by Western blots using an antibody
directed against SOD. Fractions containing SOD-C33c were
pooled.
[0593] Further purification of SOD-C33c was on a Q-Sepharose column
(1.5.times.5 cm) which was equilibrated with Buffer B. The pooled
fractions containing SOD-C33c obtained from chromatography on
S-Sepharose was applied to the column. The column was then washed
with Buffer B, and eluted with 60 ml of a gradient of 0.0 to 0.4 M
NaCl in Buffer B. The flow rate for application, wash, and elution
was 1 ml/min; collected fractions were 1 ml. All fractions from the
Q-Sepharose column were analyzed as described for the S-Sepharose
column. The peak of SOD-C33c eluted from the column at about 0.2 M
NaCl.
[0594] The SOD-C33c obtained from the Q-Sepharose column was
greater than about 90% pure, as judged by analysis on the
polyacrylamide SDS gels and immunoblot using a monoclonal antibody
directed against human SOD.
IV.B.10. Expression in Yeast of Fusion Polypeptide
SOD-C200-C100
IV.B.10.a. Construction of an Expression Vector Comprised of
Expression Cassette C200-C100
[0595] An expression cassette containing the ADH2/GAP promoter, a
sequence encoding SOD, the composite HCV sequences C200 and C100,
and the alpha-factor terminator terminator was constructed. The
C200 sequence overlaps the C100 sequence. Thus, the C200-C100
construct was designed to express the segment of the continuous ORF
contained in clones 33c/31/35/36/81/32. FIG. 79 shows the sequence
of the HCV cDNA in the construct, the polypeptides encoded therein,
and the putative restriction enzyme sites encoded therein.
[0596] The C200-C100 construct was formed by ligating together a
.about.1.29 Kbp fragment obtained by digestion of plasmid
pBR322-C200 with EcoRI and NcoI, and a .about.950 bp fragment
obtained by digestion of plasmid pS3-56.sub.C100m with NcoI and
SalI. The construction of plasmids pBR322-C200 and of
pS3-56.sub.C100m are described in Sections IV.A.37 and IV.A.36.,
respectively.
[0597] In order to join the ADH2/GAP promoter, and the sequence
encoding SOD to the 5'-terminus of the construct, and the
alpha-factor terminator to the 3'-terminus of the construct, the
C200-C100 construct was inserted into the vector pS3-34, which had
been digested with EcoRI and SalI.
[0598] The vector pS3-34 was created from the vector pYSI3 by
deletion of the insulin sequences encoded therein, and by insertion
of two linkers, C and D. These linkers allow the SOD encoding
sequence and the HCV C200-C100 sequences to be in correct reading
frame. Deletion of the insulin sequences was accomplished by
digestion with EcoRI and SalI, followed by purification of the
large vector fragment. The sequences of the inserted linkers are:
TABLE-US-00057 Linker C: 5' AAT TTG GAA TTC TAA TTA ATT AAG 3'
Linker D: AC CTT AAG ATT AAT TAA TTCAGCT
The underlined sequences, CTTAAG and CAGCT, indicate an EcoRI site
and a SalI site, respectively.
[0599] The plasmid pYSI3, described briefly in Table 1 of the U.S.
Pat. No. 4,751,180, was used as a convenient way to attach the C100
and C200-C100m sequences to the ADH2/GAP hybrid promoter, the
alpha-factor terminator and the SOD sequences. Previously, pYSI3
was used to express insulin; therefore, the vector contains a BamHI
cassette (2.4 Kbp) which comprises the ADH2/GAP hybrid yeast
promoter upstream of the hSOD gene (see U.S. Pat. No. 4,751,180)
which in turn is fused to a hinge region and an insulin gene.
Downstream of the insulin sequence is the yeast alpha-factor
transcription terminator which is a 270 bp, SalI to EcoRI fragment,
from the Saccharomyces cerevisiae alpha-factor gene described in
Singh et al., Nucleic Acids Research (1983) 11(12):4049-4063. The
insulin and hinge sequences were removed from the vector by
digestion with EcoRI and SalI and the appropriate synthetic
adapters were inserted between these two restriction sites to yield
plasmid pS3-56 and pS3-34.
[0600] An expression vector containing the C200-C100 expression
cassette was constructed by insertion of the cassette into the
yeast expression vector pAB24; the vector pAB24 is described in
Section IV.B.4. The insertion was accomplished by excising a 4349
bp BamHI/BamHI cassette from the pS3-34/C200-C100 cloning vector
and inserting the fragment into the BamHI site of the expression
vector pAB24. The resulting vector, which is called
pAB24/C200-C100, was transformed into yeast strain JSC308. Yeast
strain JSC308 is described in commonly owned U.S. Ser. No. 190,868,
and is on deposit with the American Type Culture Collection under
Accession No. 20879.
IV.B.10.b. Expression of Fusion Polypeptide SOD/C200-C100
[0601] Expression of fusion polypeptide SOD/C200-C100 encoded in
pAB24/C200-C100 was in yeast strain JSC308, which had been
transformed with the isolated expression vector. The yeast
transformants were grown in an inoculum culture for 24 to 30 hours
in Leu.sup.- medium containing 2% glucose; growth was at 30.degree.
C. at an agitation rate of 300 rpm. Expression of the fusion
polypeptide was obtained by inoculating 500 ml of YEP containing 2%
glucose with 25 ml of the inoculum culture, followed by
incubationat 30.degree. C. for 48 hours at an agitation rate of
about 300 rpm. Growth was in a 2.8 L Fernbach flask.
[0602] Alternatively, 500 ml of inoculum was added to 10 L of YEP
containing 4% glucose, and growth was in a Braun Biotech Model
Biostat E fermentor at an agitation rate of about 400.+-.20 rpm at
a temperature of about 300.+-.2.degree. C. and an air flow rate of
10.+-.slpm; the cells were harvested 50 hours after
inoculation.
IV.B.11. Expression of HCV Polypeptide C100 in Yeast
[0603] The composite HCV cDNA C100 (see Section IV.A.16) was fused
directly to the ADH2/GAP promoter, and expressed in yeast.
IV.B.11.a. Construction of Yeast Expression Vector pC100.sup.-
d#3
[0604] The construction of a yeast expression vector in which the
HCV cDNA C100 sequence (described in Sections IV.A.16.) was fused
directly to the ADH2/GAP promoter was accomplished by a protocol
which included amplification of the C100 sequence using a PCR
method, followed by ligation of the amplified sequence into a
cloning vector. After cloning, the C100 sequence was excised, and
with a sequence which contained the ADH2/GAP promoter, was ligated
to a large fragment of a yeast vector to yield a yeast expression
vector. A flow chart of the construction of the yeast expression
vector is shown in FIG. 76.
[0605] The PCR amplification of C100 was performed using as
template the vector pS3-56.sub.C100m (see Section IV.A.36.), which
had been linearized by digestion with SalI.
[0606] The oligonucleotide primers used for the amplification were
designed to facilitate cloning into the expression vector, and to
introduce a translation termination codon. Specifically, novel
5'-HindIII and 3'-SalI sites were generated with the PCR
oligonucleotides. The oligonucleotide containing the SalI site also
encodes the double termination codons, TAA and TGA. The
oliogonucleotide containing the HindII site also contains an
untranslated leader sequence derived from the pgap63 gene, situated
immediately upstream of the AUG codon. The pEco63GAPDH gene is
described by Holland and Holland (1980) and by Kniskern et al.
(1986). The PCR primer sequences used for the direct expression of
C100m were: TABLE-US-00058 5' GAG TGC TCA AGC TTC AAA ACA AAA TGG
CTC ACT TTC TAT CCC AGA CAA AGC AGA GT 3' and 5' GAG TGC TCG TCG
ACT CAT TAG GGG GAA ACA TGG TTC CCC CGG GAG GCG AA 3'.
[0607] Amplification by PCR, utilizing the primers, and template,
was with a Cetus-Perkin-Elmer PCR kit, and was performed according
to the manufacturer's directions. The PCR conditions were 29 cycles
of 94.degree. C. for a minute, 37.degree. C. for 2 minutes,
72.degree. C. for 3 minutes; and the final incubation was at
72.degree. C. for 10 minutes. The DNA can be stored at 4.degree. C.
or -20.degree. C. overnight.
[0608] After amplification, the PCR products were digested with
HindIII and SalI. The major product of 1.1 kb was purified by
electrophoresis on a gel, and the eluted purified product was
ligated with a large SalI-HindIII fragment of pBR322. In order to
isolate correct recombinants, competent HB101 cells were
transformed with the recombinant vectors, and after cloning, the
desired recombinants were identified on the basis of the predicted
size of HindIII-SalI fragments excised from the clones. One of the
clones which contained the a HindIII-SalI fragment of the correct
size was named pBR322/C100.sup.-d. Confirmation that this clone
contained amplified C100 was by direct sequence analysis of the
HindIII-SalI fragment.
[0609] The expression vector containing C100 was constructed by
ligating the HindIII-SalI fragment from pBR322/C100.sup.-d to a
13.1 kb BamHI-SalI fragment of pBS24.1, and a 1369 bm BamHI-HindIII
fragment containing the ADH2/GAP promoter. (The latter fragment is
described in EPO 164,556). The pBS24.1 vector is described in
commonly owned U.S. Ser. No. 382,805 filed 19 Jul. 1989. The
ADH2/GAP promoter fragment was obtained by digestion of the vector
ppgAP/AG/HindIII with HindIII and BamHI, followed by purification
of the 1369 bp fragment on a gel.
[0610] Competent HB101 cells were transformed with the recombinant
vectors; and correct recombinants were identified by the generation
of a 2464 bp fragment and a 13.1 kb fragment generated by BamHI and
SalI digestion of the cloned vectors. One of the cloned correct
recombinant vectors was named pC100.sup.-d#3.
IV.B.11.b. Expression of C100 from pC100.sup.-d#3
[0611] In order to express C100, competent cells of Saccharomyces
cerevisiae strain AB122 (MATa leu2 ura3-53 prb 1-1122 pep4-3
prcl-407[cir-0]) were transformed with the expression vector
pC100.sup.-d#3. The transformed cells were plated on URA-sorbitol,
and individual transformants were then streaked on Leu.sup.-
plates.
[0612] Individual clones were cultured in Leu.sup.-, ura.sup.-
medium with 2% glucose at 30.degree. C. for 24-36 hours. One liter
of Yeast Extract Peptone Medium (YEP) containing 2% glucose was
inoculated with 10 ml of the overnight culture, and the resulting
culture was grown at 30.degree. C. at an agitation rate of 400 rpm
and an aeration rate of 1 L of air per 1 L of medium per minute
(i.e., 1 vvm) for 48 hours. The pH of the medium was not
controlled. The culture was grown in a BioFlo II fermentor
manufactured by New Brunswick Science Corp. Following fermentation,
the cells were isolated and analyzed for C100 expression.
[0613] Analysis for expressed C100 polypeptide by the transformed
cells was performed on total cell lysates and crude extracts
prepared from single yeast colonies obtained from the Leu.sup.-
plates. The cell lysates and crude extracts were analyzed by
electrophoresis on SDS polyacrylamide gels, and by Western blots.
The Western blots were probed with rabbit polyclonal antibodies
directed against the SOD-C100 polypeptide expressed in yeast. The
expected size of the C100 polypeptide is 364 amino acids. By gel
analysis the expressed polypeptide has a MW.sub.r of 39.9K.
[0614] Both analytical methods demonstrated that the expressed C100
polypeptide was present in total cell lysates, but was absent from
crude extracts. These results suggest that the expressed C100
polypeptide may be insoluble.
IV.B.12 Expression of HCV Polypeptide S2 in Yeast
[0615] An S2 polypeptide encoded in the HCV cDNA shown in FIG. 72
contains amino acids 199 to 328 encoded in the ORF. The clone,
pi14a, described supra., contains an HCV cDNA which encodes these
amino acids.
[0616] The protocol for the construction of the expression vector
encoding the S2 polypeptide and for its expression in yeast was
analagous to that used for the expression of the C100 polypeptide,
described in Sections IV.B.11, IV.B.11a and IV.B.11b, except for
the following. (A flow chart of the construction of the yeast
expression vector encoding S2 is shown in FIG. 77.) The template
for the PCR reaction was the vector pBR322/Pi14a, which had been
linearized by digestion with HindIII.
[0617] The oligonucleotides used as primers for the amplification
by PCR of the S2 encoding sequence were the following.
TABLE-US-00059 For the 5'-region of the S2 sequence: 5' GAG TGC TCA
AGC TTC AAA ACA AAA TGG GGC TCT ACC ACG TCA CCA ATG ATT GCC CTA AC
3'; for the 3'-region of the S2 sequence: 5' GAG TGC TCG TCG ACT
CAT TAA GGG GAC CAG TTC ATC ATC ATA TCC CAT GCC AT 3'.
The primer for the 5'-region introducies a HindIII site and an ATG
start codon into the amplified product. The primer for the 3'
region introduces translation stop codons and a SalI site into the
amplified product.
[0618] The PCR conditions were 29 cycles of 94.degree. C. for a
minute, 37.degree. C. for 2 minutes, 72.degree. C. for 3 minutes,
and the final incubation was at 72.degree. C. for 10 minutes.
[0619] The main product of the PCR reaction was a 413 bp fragment,
which was gel purified. The purified fragment was ligated to the
large fragment obtained from pBR322 digested with HindIII and SalI
fragment, yielding the plasmid pBR322/S2d.
[0620] Ligation of the 413 bp HindIII-SalI S2 fragment with the
1.36 kb BamHI-HindIII fragment containing the ADH2/GAP promoter,
and with the large BamHI-SalI fragment of the yeast vector pBS24.1
yielded recombinant vectors, which were cloned. Correct recombinant
vectors were identified by the presence of a 1.77 kb fragment after
digestion with BamHI and SalI. An expression vector constructed
from the amplified sequence, and containing the sequence encoding
S2 fused directly to the ADH2/GAP promoter is identified as
pS2d#9.
[0621] Analysis for expressed S2 polypeptide by the transformed
cells was performed on total cell lysates and crude extracts
prepared from single yeast colonies obtained from the Leu.sup.-
plates. The cell lysates and crude extracts were analyzed by
electrophoresis on SDS polyacrylamide gels. The expected size of
the S2 polypeptide is 130 amino acids. By gel analysis, the
expressed polypeptide has a MW.sub.r of 16 Kd. The expressed S2 was
detected in the total lysates, and not in the crude extracts,
suggesting that the expressed S2 may be insoluble.
IV.B.13. Expression of HCV C Polypeptide in Yeast
[0622] A polypeptide encoded in the HCV cDNA shown in FIG. 72, and
which contains amino acids numbers 1 to 122 encoded in the ORF, is
named herein the C polypeptide.
[0623] The protocol for the construction of the expression vector
encoding the C polypeptide and for its expression in yeast was
analogous to that used for the expression of the C100 polypeptide,
described in Sections IV.B.11, IV.B.11.a and IV.B.11.b, except for
the following. (A flow chart of the construction of the yeast
expression vector encoding the C polypeptide is shown in FIG.
92.)
[0624] The template for the PCR reaction was pBR322/Ag30a which had
been linearized with HindIII. The HCV cDNA in clone Ag30a is
described in Section IV.A.30. The oligonucleotides used as primers
for the amplification by PCR of the C encoding sequence were the
following. TABLE-US-00060 For the 5'-region of the C sequence: 5'
GAG TGC AGC TTC AAA ACA AAA TGA GCA CGA ATC CTA AAC CTC AAA AAA AAA
AC 3', and for the 3'-region of the C sequence: 5' GAG TGC TCG TCG
ACT CAT TAA CCC AAA TTG CGC GAC CTA CGC CGG GGG TCT GT 3'.
[0625] The primer for the 5'-region introduces a HindIII site into
the amplified product, and the primer for the 3'-region introduces
translation stop codons and a SalI site. The PCR was run for 29
cycles of 94.degree. C. for a minute, 37.degree. C. for 2 minutes,
72.degree. C. for 3 minutes, and the final incubation was at
72.degree. C. for 10 minutes.
[0626] The major product of PCR amplification is a 381 bp
polynucleotide. Ligation of this fragment with the SalI-HindIII
large SalI-HindIII fragment of pBR322 yielded the plasmid
pBR322/C2.
[0627] Ligation of the 381 bp HindIII-SalI C coding fragment
excised from pBR322/C2 with the 1.36 kb BamHI-HindIII fragment
containing the ADH2/GAP promoter, and with the large BamHI-SalI
fragment of the yeast vector pBS24.1 yielded recombinant vectors,
which were cloned. Correct recombinant vectors were identified by
the presence of a 1.74 kb fragment after digestion with BamHI and
SalI. An expression vector constructed from the amplified sequence,
and containing the sequence encoding C fused directly to the
ADH2/GAP promoter is identified as pC22.
[0628] Analysis for expressed C polypeptide by the transformed
cells was performed on total cell lysates and crude extracts
prepared from single yeast colonies obtained from the Leu.sup.-
plates. The cell lysates and crude extracts were analyzed by
electrophoresis on SDS polyacrylamide gels. The C polypeptide is
expected to have 122 amino acids and by gel analysis the expressed
polypeptide has a MW.sub.r of approximately 13.6 Kd.
IV.B.14. Expression of a Polypeptide Which Contains Amino Acid
Numbers 404-661 of the HCV Polyprotein
[0629] A polypeptide encoded in the HCV cDNA shown in FIG. 72, and
which contains amino acids numbers 404 to 661 encoded in a region
of the HCV ORF designated as "x" is named herein the NS1
polypeptide. It should be noted that this designation is not meant
to connote that the characteristics of this polypeptide are
equivalent to that of the NS1 polypeptide of the flaviviruses, for
the reasons discussed supra.
IV.B.14.a. Expression of NS1 in Yeast
[0630] The protocol for the construction of the expression vector
encoding the NS1 polypeptide and for its expression in yeast was
analogous to that used for the expression of the C100 polypeptide,
described in Sections IV.B.11, IV.B.11.a, and IV.B.11.b, except for
the following. (A flow chart of the construction of the yeast
expression vector encoding NS1 is shown in FIG. 78) The template
for the PCR amplification of the NS1 encoding sequence was pBR K-9-
1/59a (also called pBR K/9- 1/59a), which had been linearized by
digestion with HindIII. The clone CA59a, described in Example
IV.A.27, was inserted into the EcoRI site of pBR322 and the clone
K-9-1, described in Example IV.A.26, was inserted into the BglII
site of ppgAP. A PstI to NheI fragment from the pBR322/CA59a vector
was ligated to a PstI to NheI fragment from the ppgAP3/K-9-1 to
create the vector pBR K-9- 1/59a, from which the HCV cDNA can be
released by digestion with BglII and EcoRI. The vector ppgAP3 is a
PBR322 derivative with the GAP promoter and terminator, described
in U.S. patent application Ser. No. 468,589, filed on 22 Feb.
1983.
[0631] The oligonucleotides used as primers for PCR amplification
of the NS1 coding sequence were designed to not only to generate
novel 5' HindIII site, and a 3'-SalI site and double termination
codons; in addition, the 3'-oligonucleotide primer also included an
XhoI restriction site. The sequences of the oligonucleotide primers
is the following. TABLE-US-00061 For the 5'-region of the NS1
sequence: 5' GAG TGC TCA AGC TTA CAA AAC AAA ATG GCA CCA GGC GCC
AAG CAG AAC GTC CAG CTG ATC 3'; For the 3'-region of the NS1
sequence: 5' GAG TGC TCC TCG AGG TCG ACT CAT TAC TCG GAC CTG TCC
CTA TCT TCC AGA TCG CAA CG 3'.
[0632] For cloning NS1 into a yeast experssion vector, the PCR
conditions were 15 cycles of 94.degree. C. for 1.5 minutes,
60.degree. C. for 2 minutes, and 72.degree. C. for 3 minutes. After
15 cycles, the last incubation was at 72.degree. C. for 10
minutes.
[0633] After amplification by PCR, the products were digested with
HindIII and XhoI, and an 809 bp product isolated after gel
electrophoresis. This product was ligated with the large
HindIII-SalI fragment of pBR322. (This construction results in the
loss of 3'-XhoI site from the NS1 coding sequence, and the SalI
site of pBR322). After cloning in HB101, plasmids containing the
correct insert were identified by the presence of an 800 bp
HindIII-SalI fragment, after digestion of the DNA with HindIII and
partial digestion with SalI. A plasmid containing the correct
insert was named pBR322/NS11d/13.
[0634] An 800 bp fragment which encodes NS1 was excised from
pBR322/NS11d/13 by digestion with HindIII and partial digestion
with SalI, and was isolated by gel electrophoresis. Ligation of
this fragment with the 1.36 kb BamHI-HindIII fragment containing
the ADH2/GAP promoter, and with the large BamHI-SalI fragment of
the yeast vector pBS24.1 yielded recombinant vectors, which were
cloned. Correct recombinant vectors were identified by the
liberation of 2008 bp and 165 bp fragments in addition to a 13.1 kb
fragment after digestion with HindIII and SalI. A recombinant
vector containing the desired insert is named pNS11d/13 (also named
pNS 11/13-15).
[0635] Analysis for expressed NS1 polypeptide by the pNS11d/13
transformed cells was performed on total cell lysates and crude
extracts prepared from single yeast colonies obtained from the
Leu.sup.- plates. The cell lysates and crude extracts were analyzed
by electrophoresis on SDS polyacrylamide gels and by Western blots.
A human serum sample was identified by the experiment described in
Example IV.B.8.a to contain antibodies against the NS1 region. This
serum was used as a primary antibody in the Western blotting. The
NS1 polypeptide is expected to have 258 amino acids, and by gel
analysis the expressed polypeptide has a MW.sub.r of approximately
29 K. Both methods of analysis indicated the presence of expressed
NS1 polypeptide in the total cell lysates, but not in crude
extracts. These results suggest that the expressed NS1 polypeptide
is insoluble.
IV.B.14.b. Expression of NS1 in Mammalian Cells
[0636] A vector for expression of NS1 in mammalian cells was
constructed using a 795 bp fragment obtained by PCR amplification
of the NS1 ORF which is contained in plasmid ppgAT/K9- 1/59a,
described in Section IV.B.14.a. The PCR reaction was performed
using the following oligonucleotide sequences as primers.
[0637] The primer for the 5'-region of NS1 was: TABLE-US-00062 5'
GGA TCC GCT AGC GGC GCC AAG CAG AAC GTC CAG CTG ATC AAC ACC 3';
where the underlined sequence encodes an NheI site.
[0638] The primer for the 3'-region of NS1 was: TABLE-US-00063 5'
GGA TCC AAG CTT TTA CTC GGA CCT GTC CCT ATC TTC CAG ATC GCA ACG
3';
where the first and second underlined sequences encode a HindIII
site and a stop codon, respectively.
[0639] A polyacrylamide gel purified 795 bp fragment was digested
with NheI and HindIII. The resulting 777 bp NheI-HindIII fragment,
which encodes NS1, was ligated to the 3.98 Kbp fragment obtained by
digestion of pCMV6a120 with NheI, and partial digestion with
HindIII. A resulting plasmid containing the correct insert was
designated ptpa-NS1.
[0640] The vector pCMV6a120, which is described in U.S. Ser. No.
138,894 filed 24 Dec. 1987 (which is incorporated by reference,
along with any foreign filed counterparts), is a mammalian cell
expression vector which encodes gp 120 of human immunodeficiency
virus (HIV). The gp120 encoding sequence was excised by the
digestion with NheI and the partial digestion with HindIII.
[0641] Transient expression studies were performed in COS-7 cells
(Gluzman (1981)), which had been transfected with ptpa-NS1.
Transfection was accomplished by lipofection using techniques
described by Felgner et al. (1987). In order to perform
immunofluorescence studies, the transfected cells were subcultured
into 2-chamber plastic slide wells (Lab-Tek). The COS-7 cells were
fixed with acetone at 72 hours following transfection, and cells
producing NS1 were identified using indirect immunofluorescence
methods (Pachl et al. (1987)). In the inmunofluorescence studies,
the source of primary antibodies was an HCV positive human
antiserum which was immunoreactive with bacterially expressed NS1.
The secondary antibody was FITC-conjugated goat anti-human IgG
(Tago, Inc., Burlingame, Calif.), which had been diluted 1:200.
Immunofluorescence on the slides was observed using a Leitz Dialux
20 EB fluorescent microscope. The cells which were transfected with
ptpa-NS1 exhibited a diffuse cytoplasmic immunofluorescent staining
pattern. Mock controls were also run. Positive controls included
cells transfected with plasmids expresing CMV glycoprotein B,
including plasmids pXgB8, the pXgB23clv1-4 series, and the
pXgB24clv1-3 series.
IV.B.14.c. Expression of NS1 in Mammalian Cells Using a Vector with
a Selectable Marker
[0642] In order to physically link the NS4 encoding sequence to a
sequence encoding a selectable marker, i.e., the DHFR gene, the NS1
ORF DNA sequence was subcloned into two mammalian cell expression
vectors, pCMVAdhfr and pMCMVAdhfr. The vector pCMVAdhfr contains
the human CMV major immediate early (MIE) promoter, and also
contains the mouse dhfr gene linked to the adenovirus major late
promoter (Stuve et al. (1987)). The vector pMCMVAdhfr is colinear
to pCMVAdhfr, except that murine CMV (MCMV) MIE promoter is
substituted for the human CMV MIE promoter. The MCMV MIE promoter
is a HpaI-PstI fragment, which was cloned from pON402 (Manning and
Mocarski (1988)).
[0643] In order to subclone the NS1 ORF DNA, it was excised from
ptpa-NS1 by partial digestion with SalI. The 962 bp fragment was
then ligated to SalI digested pCMVAdhfr, or to SalI digested
pMCMVAdhfr. Each of these vectors contains a unique SalI site.
[0644] The recombinant dhfr vectors comprised of the NS1 sequence
were used to transfect dhfr.sup.- CHO cells in order to generate
stable cell lines expressing this ORF. Transfection was by the
polybrene transfection procedure of Chaney et al. (1986).
IV.C. Identification of RNA in Infected Individuals Which
Hybridizes to HCV cDNA.
IV.C.1. Identification of RNA in the Liver of a Chimpanzee With
NANBH Which Hybridizes to HCV cDNA.
[0645] RNA from the liver of a chimpanzee which had NANBH was shown
to contain a species of RNA which hybridized to the HCV cDNA
contained within clone 81 by Northern blotting, as follows.
[0646] RNA was isolated from a liver biopsy of the chimpanzee from
which the high titer plasma was derived (see Section IV.A.1.) using
techniques described in Maniatis et al. (1982) for the isolation of
total RNA from mammalian cells, and for its separation into poly
A.sup.+ and poly A.sup.- fractions. These RNA fractions were
subjected to electrophoresis on a formaldehyde/agarose gel (1%
w/v), and transferred to nitrocellulose. (Maniatis et al. (1982)).
The nitrocellulose filters were hybridized with radiolabeled HCV
cDNA from clone 81 (see FIG. 4 for the nucleotide sequence of the
insert.) To prepare the radiolabeled probe, the HCV cDNA insert
isolated from clone 81 was radiolabeled with .sup.32P by nick
translation using DNA Polymerase I (Maniatis et al. (1982)).
Hybridization was for 18 hours at 42.degree. C. in a solution
containing 10% (w/v) Dextran sulphate, 50% (w/v)
deionized-formamide, 750 mM NaCl, 75 mM Na citrate, 20 mM
Na.sub.2HPO.sub.4, pH 6.5, 0.1% SDS, 0.02% (w/v) bovine serum
albumin (BSA), 0.02% (w/v) Ficoll-400, 0.02% (w/v)
polyvinylpyrrolidone, 100 micrograms/ml salmon sperm DNA which had
been sheared by sonication and denatured, and 10.sup.6 CPM/ml of
the nick-translated cDNA probe.
[0647] An autoradiograph of the probed filter is shown in FIG. 38.
Lane 1 contains .sup.32P-labeled restriction fragment markers.
Lanes 2-4 contain chimpanzee liver RNA as follows: lane 2 contains
30 micrograms of total RNA; lane 3 contains 30 micrograms of poly
A- RNA; and lane 4 contains 20 micrograms of poly A+ RNA. As shown
in FIG. 38, the liver of the chimpanzee with NANBH contains a
heterogeneous population of related poly A+ RNA molecules which
hybridizes to the HCV cDNA probe, and which appears to be from
about 5000 nucleotides to about 11,000 nucleotides in size. This
RNA, which hybridizes to the HCV cDNA, could represent viral
genomes and/or specific transcripts of the viral genome.
[0648] The experiment described in Section IV.C.2. infra, is
consistent with the suggestion that HCV contains an RNA genome.
Iv.C.2. Identification of HCV Derived RNA in Serum from Infected
Individuals.
[0649] Nucleic acids were extracted from particles isolated from
high titer chimpanzee NANBH plasma as described in Section IV.A.1..
Aliquots (equivalent to 1 ml of original plasma) of the isolated
nucleic acids were resuspended in 20 microliters 50 mM Hepes, pH
7.5, 1 mm EDTA and 16 micrograms/ml yeast soluble RNA. The samples
were denatured by boiling for 5 minutes followed by immediate
freezing, and were treated with RNase A (5 micro-liters containing
0.1 mg/ml RNase A in 25 mM EDTA, 40 mM Hepes, pH 7.5) or with DNase
I (5 microliters containing 1 unit DNase I in 10 mM MgCl.sub.2, 25
mM Hepes, pH 7.5); control samples were incubated without enzyme.
Following incubation, 230 microliters of ice-cold 2.times.SSC
containing 2 micrograms/ml yeast soluble RNA was added, and the
samples were filtered on a nitrocellulose filter. The filters were
hybridized with a cDNA probe from clone 81, which had been
.sup.32P-labeled by nick-translation. FIG. 39 shows an
autoradiograph of the filter. Hybridization signals were detected
in the DNase treated and control samples (lanes 2 and 1,
respectively), but were not detected in the RNase treated sample
(lane 3). Thus, since RNase A treatment destroyed the nucleic acids
isolated from the particles, and DNase I treatment had no effect,
the evidence strongly suggests that the HCV genome is composed of
RNA.
IV.C.3. Detection of Amplified HCV Nucleic Acid Sequences derived
from HCV Nucleic Acid Sequences in Liver and Plasma Specimens from
Chimpanzees with NANBH
[0650] HCV nucleic acids present in liver and plasma of chimpanzees
with NANBH, and in control chimpanzees, were amplified using
essentially the polymerase chain reaction (PCR) technique described
by Saiki et al. (1986). The primer oligonucleotides were derived
from the HCV cDNA sequences in clone 81, or clones 36 and 37. The
amplified sequences were detected by gel electrophoresis and
Southern blotting, using as probes the appropriate cDNA oligomer
with a sequence from the region between, but not including, the two
primers.
[0651] Samples of RNA containing HCV sequences to be examined by
the amplification system were isolated from liver biopsies of three
chimpanzees with NANBH, and from two control chimpanzees. The
isolation of the RNA fraction was by the guanidinium thiocyanate
procedure described in Section IV.C.1.
[0652] Samples of RNA which were to be examined by the
amplification system were also isolated from the plasmas of two
chimpanzees with NANBH, and from one control chimpanzee, as well as
from a pool of plasmas from control chimpanzees. One infected
chimpanzee had a CID/ml equal to or greater than 10.sup.6, and the
other infected chimpanzee had a CID/ml equal to or greater than
10.sup.5.
[0653] The nucleic acids were extracted from the plasma as follows.
Either 0.1 ml or 0.01 ml of plasma was diluted to a final volume of
1.0 ml, with a TENB/proteinase K/SDS solution (0.05 M Tris-HCL, pH
8.0, 0.001 M EDTA, 0.1 M NaCl, 1 mg/ml Proteinase K, and 0.5% SDS)
containing 10 micrograms/ml polyadenylic acid, and incubated at
37.degree. C. for 60 minutes. After this proteinase K digestion,
the resultant plasma fractions were deproteinized by extraction
with TE (10.0 mM Tris-HCl, pH 8.0, 1 mM EDTA) saturated phenol. The
phenol phase was separated by centrifugation, and was reextracted
with TENB containing 0.1% SDS. The resulting aqueous phases from
each extraction were pooled, and extracted twice with an equal
volume of phenol/chloroform/isoamyl alcohol [1:1(99:2)], and then
twice with an equal volume of a 99:1 mixture of chloroform/isoamyl
alcohol. Following phase separation by centrifugation, the aqueous
phase was brought to a final concentration of 0.2 M Na Acetate, and
the nucleic acids were precipitated by the addition of two volumes
of ethanol. The precipitated nucleic acids were recovered by
ultracentrifugation in a SW 41 rotor at 38 K, for 60 minutes at
4.degree. C.
[0654] In addition to the above, the high titer chimpanzee plasma
and the pooled control plasma alternatively were extracted with 50
micrograms of poly A carrier by the procedure of Chomcyzski and
Sacchi (1987). This procedure uses an acid guanidinium thiocyanate
extraction. RNA was recovered by centrifugation at 10,000 RPM for
10 minutes at 4.degree. C. in an Eppendorf microfuge.
[0655] On two occasions, prior to the synthesis of cDNA in the PCR
reaction, the nucleic acids extracted from plasma by the proteinase
K/SDS/phenol method were further purified by binding to and elution
from S and S Elutip-R Columns. The procedure followed was according
to the manufacturer's directions.
[0656] The cDNA used as a template for the PCR reaction was derived
from the nucleic acids (either total nucleic acids or RNA) prepared
as described above. Following ethanol precipitation, the
precipitated nucleic acids were dried, and resuspended in DEPC
treated distilled water. Secondary structures in the nucleic acids
were disrupted by heating at 65.degree. C. for 10 minutes, and the
samples were immediately cooled on ice. cDNA was synthesized using
1 to 3 micrograms of total chimpanzee RNA from liver, or from
nucleic acids (or RNA) extracted from 10 to 100 microliters of
plasma. The synthesis utilized reverse transcriptase, and was in a
25 microliter reaction, using the protocol specified by the
manufacturer, BRL. The primers for cDNA synthesis were those also
utilized in the PCR reaction, described below. All reaction
mixtures for cDNA synthesis contained 23 units of the RNAase
inhibitor, RNASIN.TM. (Fisher/Promega). Following cDNA synthesis,
the reaction mixtures were diluted with water, boiled for 10
minutes, and quickly chilled on ice.
[0657] The PCR reactions were performed essentially according to
the manufacturer's directions (Cetus-Perkin-Elmer), except for the
addition of 1 microgram of RNase A. The reactions were carried out
in a final volume of 100 microliters. The PCR was performed for 35
cycles, utilizing a regimen of 37.degree. C., 72.degree. C., and
94.degree. C.
[0658] The primers for cDNA synthesis and for the PCR reactions
were derived from the HCV cDNA sequences in either clone 81, clone
36, or clone 37b. (The HCV cDNA sequences of clones 81, 36, and 37b
are shown in FIGS. 4, 5, and 10, respectively.) The sequences of
the two 16-mer primers derived from clone 81 were: TABLE-US-00064
5' CAA TCA TAC CTG ACA G 3' and 5' GAT AAC CTC TGC CTG A 3'.
[0659] The sequence of the primer from clone 36 was: TABLE-US-00065
5' GCA TGT CAT GAT GTA T 3'.
[0660] The sequence of the primer from clone 37b was:
TABLE-US-00066 5' ACA ATA CGT GTG TCA C 3'.
In the PCR reactions, the primer pairs consisted of either the two
16-mers derived from clone 81, or the 16-mer from clone 36 and the
16-mer from clone 37b.
[0661] The PCR reaction products were analyzed by separation of the
products by alkaline gel electrophoresis, followed by Southern
blotting, and detection of the amplified HCV-cDNA sequences with a
.sup.32P-labeled internal oligonucleotide probe derived from a
region of the HCV cDNA which does not overlap the primers. The PCR
reaction mixtures were extracted with phenol/chloroform, and the
nucleic acids precipitated from the aqueous phase with salt and
ethanol. The precipitated nucleic acids were collected by
centrifugation, and dissolved in distilled water. Aliquots of the
samples were subjected to electrophoresis on 1.8% alkaline agarose
gels. Single stranded DNA of 60, 108, and 161 nucleotide lengths
were co-electrophoresed on the gels as molecular weight markers.
After electrophoresis, the DNAs in the gel were transferred onto
Biorad Zeta Probe.TM. paper. Prehybridization and hybridization,
and wash conditions were those specified by the manufacturer
(Biorad).
[0662] The probes used for the hybridization-detection of amplified
HCV cDNA sequences were the following. When the pair of PCR primers
were derived from clone 81, the probe was an 108-mer with a
sequence corresponding to that which is located in the region
between the sequences of the two primers. When the pair of PCR
primers were derived from clones 36 and 37b, the probe was the
nick-translated HCV cDNA insert derived from clone 35. The primers
are derived from nucleotides 155-170 of the clone 37b insert, and
206-268 of the clone 36 insert. The 3'-end of the HCV cDNA insert
in clone 35 overlaps nucleotides 1-186 of the insert in clone 36;
and the 5'-end of clone 35 insert overlaps nucleotides 207-269 of
the insert in clone 37b. (Compare FIGS. 5, 8 and 10.) Thus, the
cDNA insert in clone 35 spans part of the region between the
sequences of the clone 36 and 37b derived primers, and is useful as
a probe for the amplified sequences which include these
primers.
[0663] Analysis of the RNA from the liver specimens was according
to the above procedure utilizing both sets of primers and probes.
The RNA from the liver of the three chimpanzees with NANBH yielded
positive hybridization results for amplification sequences of the
expected size (161 and 586 nucleotides for 81 and 36 and 37b,
respectively), while the control chimpanzees yielded negative
hybridization results. The same results were achieved when the
experiment was repeated three times.
[0664] Analysis of the nucleic acids and RNA from plasma was also
according to the above procedure utilizing the primers and probe
from clone 81. The plasmas were from two chimpanzees with NANBH,
from a control chimpanzee, and pooled plasmas from control
chimpanzees. Both of the NANBH plasmas contained nucleic acids/RNA
which yielded positive results in the PCR amplified assay, while
both of the control plasmas yielded negative results. These results
have been repeatably obtained several times.
[0665] Defective viruses have been known to occur in RNA viruses.
By using PCR technology it is possible to design primers to amplify
sequences of the HCV genome. By analysis of the amplified products,
it is expected to be able to identify both defective versions of
the viral genome as well as wild-type viral species. Accordingly,
using two primers based on known HCV sequence, one can predict
accurately the expected size of the PCR product. Any larger species
observed by gel electrophoresis and hybridization analysis could
represent potential wild-type genomes. Alternatively, any smaller
species observed in this fashion might represent defective agents.
Analyses of these types would be useful in confirming the exact
origin of the known HCV sequence, whether it is indeed a wild-type
viral sequence or a defective genome. Techniques and methods for
these analyses are well known in the art and have been previously
described. This methodology will enable one skilled in the art to
obtain related (wild-type or defective) forms of the viral
genome.
IV.D. Radioimmunoassay for Detecting HCV Antibodies in Serum from
Infected Individuals
[0666] Solid phase radioimmunoassays to detect antibodies to HCV
antigens were developed based upon Tsu and Herzenberg (1980).
Generally, microtiter plates (Immulon 2, Removawell strips) are
coated with purified polypeptides containing HCV epitopes. The
coated plates are incubated with either human serum samples
suspected of containing antibodies to the HCV epitopes, or to
appropriate controls. During incubation, antibody, if present, is
immunologically bound to the solid phase antigen. After removal of
the unbound material and washing of the microtiter plates,
complexes of human antibody-NANBV antigen are detected by
incubation with .sup.125I-labeled sheep anti-human immunoglobulin.
Unbound labeled antibody is removed by aspiration, and the plates
are washed. The radioactivity in individual wells is determined;
the amount of bound human anti-HCV antibody is proportional to the
radioactivity in the well.
[0667] The detection in serum of antibodies to HCV epitopes present
in fusion polypeptides of SOD with NANB.sub.5-1-1 with NANB.sub.81,
with NANB.sub.C100, and with NANB.sub.C33c (these polypeptides are
also called SOD-5-1-1, SOD-81, C100-3, and SOD-C33c, respectively),
was accomplished by solid phase radioimmunoassay.
[0668] Microtiter plates were coated with any of the aforementioned
antigens, which had been purified as described herein in Section
IV.D.1. (SOD-NANB.sub.5-1-1), Section IV.D.2. (SOD-NANB.sub.81),
Section IV.B.7. (C100-3), and Section IV.B.9. (SOD-33c). The assays
were conducted as follows.
[0669] One hundred microliter aliquots containing 0.1 to 0.5
micrograms of the designated SOD-NANB fusion polypeptide in 0.125 M
Na borate buffer, pH 8.3, 0.075 M NaCl (BBS) was added to each well
of a microtiter plate (Dynatech Inunulon 2 Removawell Strips). The
plate was incubated at 4.degree. C. overnight in a humid chamber,
after which, the protein solution was removed and the wells washed
3 times with BBS containing 0.02% Triton X-100 (BBST). To prevent
nonspecific binding, the wells were coated with bovine serum
albumin (BSA) by addition of 100 microliters of a 5 mg/ml solution
of BSA in BBS followed by incubation at room temperature for 1
hour; after this incubation the BSA solution was removed. The
polypeptides in the coated wells were reacted with serum by adding
100 microliters of serum samples diluted 1:100 in 0.01M Na
phosphate buffer, pH 7.2, 0.15 M NaCl (PBS) containing 10 mg/ml
BSA, and incubating the serum containing wells for 1 hr at
37.degree. C. After incubation, the serum samples were removed by
aspiration, and the wells were washed 5 times with BBST.
Anti-NANB.sub.5-1-1 and Anti-NANB.sub.81 bound to the fusion
polypeptides was determined by the binding of .sup.125I-labeled
F'(ab).sub.2 sheep anti-human IgG to the coated wells. Aliquots of
100 microliters of the labeled probe (specific activity 5-20
microcuries/microgram) were added to each well, and the plates were
incubated at 37.degree. C. for 1 hour, followed by removal of
excess probe by aspiration, and 5 washes with BBST. The amount of
radioactivity bound in each well was determined by counting in a
counter which detects gamma radiation.
IV.D.1. Purification of Fusion Polypeptide SOD-NANB.sub.5-1-1.
[0670] The fusion polypeptide SOD-NANB.sub.5-1-1, expressed in
recombinant bacteria as described in Section IV.B.1., was purified
from the recombinant E. coli by differential extraction of the cell
extracts with urea, followed by chromatography on anion and cation
exchange columns as follows.
[0671] Thawed cells from 1 liter of culture were resuspended in 10
ml of 20% (w/v) sucrose containing 0.01M Tris HCl, pH 8.0, and 0.4
ml of 0.5M EDTA, pH 8.0 was added. After 5 minutes at 0.degree. C.,
the mixture was centrifuged at 4,000.times.g for 10 minutes. The
resulting pellet was suspended in 10 ml of 25% (w/v) sucrose
containing 0.05 M Tris HCl, pH 8.0, 1 mM
phenylmethylsulfonylfluoride (PMSF) and 1 microgram/ml pepstatin A,
followed by addition of 0.5 ml lysozyme (10 mg/ml) and incubation
at 0.degree. C. for 10 minutes. After the addition of 10 ml 1%
(v/v) Triton X-100 in 0.05 M Tris HCl, pH 8.0, 1 mM EDTA, the
mixture was incubated an additional 10 min at 0.degree. C. with
occasional shaking. The resulting viscous solution was homogenized
by passage 6 times through a sterile 20-gauge hypodermic needle,
and centrifuged at 13,000.times.g for 25 minutes. The pelleted
material was suspended in 5 ml of 0.01 M Tris HCl pH 8.0, and the
suspension centrifuged at 4,000.times.g for 10 minutes. The pellet,
which contained SOD-NANB.sub.5-1-1 fusion protein, was dissolved in
5 ml of 6 M urea in 0.02 M Tris HCl, pH 8.0, 1 mM dithiothreitol
(Buffer A), and was applied to a column of Q-Sepharose Fast Flow
equilibrated with Buffer A. Polypeptides were eluted with a linear
gradient of 0.0 to 0.3 M NaCl in Buffer A. After elution, fractions
were analyzed by polyacrylamide gel electrophoresis in the presence
of SDS to determine their content of SOD-NANB.sub.5-1-1. Fractions
containing this polypeptide were pooled, and dialyzed against 6 M
urea in 0.02 M sodium phosphate buffer, pH 6.0, 1 mM dithiothreitol
(Buffer B). The dialyzed sample was applied on a column of
S-Sepharose Fast Flow equilibrated with Buffer B, and polypeptides
eluted with a linear gradient of 0.0 to 0.3 M NaCl in Buffer B. The
fractions were analyzed by polyacrylamide gel electrophoresis for
the presence of SOD-NANB.sub.5-1-1, and the appropriate fractions
were pooled.
[0672] The final preparation of SOD-NANB.sub.5-1-1 polypeptide was
examined by electrophoresis on polyacrylamide gels in the presence
of SDS. Based upon this analysis, the preparation was more than 80%
pure.
IV.D.2. Purification of Fusion Polypeptide SOD-NANB.sub.81.
[0673] The fusion polypeptide SOD-NANB.sub.81, expressed in
recombinant bacteria as described in Section IV.B.2,, was purified
from recombinant E. coli by differential extraction of the cell
extracts with urea, followed by chromatography on anion and cation
exchange columns utilizing the procedure described for the
isolation of fusion polypeptide SOD-NANB.sub.5-1-1 (see Section
IV.D.1.).
[0674] The final preparation of SOD-NANB.sub.81 polypeptide was
examined by electrophoresis on polyacrylamide gels in the presence
of SDS. Based upon this analysis, the preparation was more than 50%
pure.
IV.D.3. Detection of Antibodies to HCV Epitopes by Solid Phase
Radioimmunoassay.
[0675] Serum samples from 32 patients who were diagnosed as having
NANBH were analyzed by radioimmunoassay (RIA) to determine whether
antibodies to HCV epitopes present in fusion polypeptides
SOD-NANB.sub.5-1-1 and SOD-NANB.sub.81 were detected.
[0676] Microtiter plates were coated with SOD-NANB.sub.5-1-1 or
SOD-NANB.sub.81, which had been partially purified according to
Sections IV.D.1. and IV.D.2., respectively. The assays were
conducted as described supra.
[0677] The results of the detection of anti-NANB.sub.5-1-1 and
anti-NANB.sub.81 in individuals with NANBH is presented in Table 1.
TABLE-US-00067 TABLE 1 Detection of Anti-5-1-1 and Anti-81 in Sera
of NANB, HAV and HBV Hepatitis Patients Patient Reference S/N
Number Diagnosis Anti-5-1-1 Anti-81 1. 28.sup.1 Chronic NANB,
IVD.sup.2 0.77 4.20 Chronic NANB, IVD 1.14 5.14 Chronic NANB, IVD
2.11 4.05 2. 29.sup.1 AVH.sup.3, NANB, Sporadic 1.09 1.05 Chronic,
NANB 33.89 11.39 Chronic, NANB 36.22 13.67 3. 30.sup.1 AVH, NANB,
IVD 1.90 1.54 Chronic NANB, IVD 34.17 30.28 Chronic NANB, IVD 32.45
30.84 4. 31 Chronic NANB, PT.sup.4 16.09 8.05 5. 32.sup.1 Late AVH
NANB, IVD 0.69 0.94 Late AVH NANB, IVD 0.73 0.68 6. 33.sup.1 AVH,
NANB, IVD 1.66 1.96 AVH, NANB, IVD 1.53 0.56 7. 34.sup.1 Chronic
NANB, PT 34.40 7.55 Chronic NANB, PT 45.55 13.11 Chronic NANB, PT
41.58 13.45 Chronic NANB, PT 44.20 15.48 8. 35.sup.1 AVH NANB, IVD
31.92 31.95 "Healed" recent 6.87 4.45 NANB, AVH 9. 36 Late AVH NANB
PT 11.84 5.79 10. 37 AVH NANB, IVD 6.52 1.33 11. 38 Late AVH NANB,
PT 39.44 39.18 12. 39 Chronic NANB, PT 42.22 37.54 13. 40 AVH,
NANB, PT 1.35 1.17 14. 41 Chronic NANB? PT 0.35 0.28 15. 42 AVH,
NANB, IVD 6.25 2.34 16. 43 Chronic NANB, PT 0.74 0.61 17. 44 AVH,
NANB, PT 5.40 1.83 18. 45 Chronic, NANB, PT 0.52 0.32 19. 46 AVH,
NANB 23.25 4.45 20. 47 AVH, Type A 1.60 1.35 21. 48 AVH, Type A
1.30 0.66 22. 49 AVH, Type A 1.44 0.74 23. 50 Resolved Recent AVH,
0.48 0.56 Type A 24. 51 AVH, Type A 0.68 0.64 Resolved AVH, Type A
0.80 0.65 25. 52 Resolved Recent AVH, 1.38 1.04 Type A Resolved
Recent AVH, 0.80 0.65 Type A 26. 53 AVH, Type A 1.85 1.16 Resolved
Recent AVH 1.02 0.88 Type A 27. 54 AVH, Type A 1.35 0.74 28. 55
Late AVH, HBV 0.58 0.55 29. 56 Chronic HBV 0.84 1.06 30. 57 Late
AVH, HBV 3.20 1.60 31. 58 Chronic HBV 0.47 0.46 32. 59.sup.1 AVH,
HBV 0.73 0.60 Healed AVH, HBV 0.43 0.44 33. 60.sup.1 AVH, HBV 1.06
0.92 Healed AVH, HBV 0.75 0.68 34. 61.sup.1 AVH, HBV 1.66 0.61
Healed AVH, HBV 0.63 0.36 35. 62.sup.1 AVH, HBV 1.02 0.73 Healed
AVH, HBV 0.41 0.42 36. 63.sup.1 AVH, HBV 1.24 1.31 Healed AVH, HBV
1.55 0.45 37. 64.sup.1 AVH, HBV 0.82 0.79 Healed AVH, HBV 0.53 0.37
38. 65.sup.1 AVH, HBV 0.95 0.92 Healed AVH, HBV 0.70 0.50 39.
66.sup.1 AVH, HBV 1.03 0.68 Healed AVH, HBV 1.71 1.39
.sup.1Sequential serum samples availablve fromthese patients
.sup.2IVD = Intravenus Drug User .sup.3AVH = Acute viral hepatitis
.sup.4PT = Post transfusion
[0678] As seen in Table 1, 19 of 32 sera from patients diagnosed as
having NANBH were positive with respect to antibodies directed
against HCV epitopes present in SOD-NANB.sub.5-1-1 and
SOD-NANB.sub.81.
[0679] However, the serum samples which were positive were not
equally immunologically reactive with SOD-NANB .sub.5-1-1 and
SOD-NANB.sub.81. Serum samples from patient No. 1 were positive to
SOD-NANB.sub.81 but not to SOD-NANB.sub.5-1-1 Serum samples from
patients number 10, 15, and 17 were positive to SOD-NANB.sub.5-1-1
but not to SOD-NANB.sub.81. Serum samples from patients No. 3, 8,
11, and 12 reacted equally with both fusion polypeptides, whereas
serum samples from patients No. 2, 4, 7, and 9 were 2-3 fold higher
in the reaction to SOD-NANB.sub.5-1-1 than to SOD-NANB.sub.81.
These results suggest that NANB.sub.5-1-1 and NANB.sub.81 may
contain at least 3 different epitopes; i.e., it is possible that
each polypeptide contains at least 1 unique epitope, and that the
two polypeptides share at least 1 epitope.
IV.D.4. Specificity of the Solid Phase RIA for NANBH
[0680] The specificity of the solid phase RIAs for NANBH was tested
by using the assay on serum from patients infected with HAV or with
HBV and on sera from control individuals. The assays utilizing
partially purified SOD-NANB.sub.5-1-1 and SOD-NANB.sub.81 were
conducted essentially as described in Section IV.D.3, except that
the sera was from patients previously diagnosed as having HAV or
HBV, or from individuals who were blood bank donors. The results
for sera from HAV and HBV infected patients are presented in table
1. The RIA was tested using 11 serum specimens from HAV infected
patients, and 20 serum specimens from HBV infected patients. As
shown in table 1, none of these sera yielded a positive
immunological reaction with the fusion polypeptides containing
BB-NANBV epitopes.
[0681] The RIA using the NANB.sub.5-1-1 antigen was used to
determine immunological reactivity of serum from control
individuals. Out of 230 serum samples obtained from the normal
blood donor population, only 2 yielded positive reactions in the
RIA (data not shown). It is possible that the two blood donors from
whom these serum samples originated had previously been exposed. to
HCV.
IV.D.5. Reactivity of NANB.sub.5-1-1 During the Course of NANBH
Infection.
[0682] The presence of anti-NANB.sub.5-1-1 antibodies during the
course of NANBH infection of 2 patients and 4 chimpanzees was
followed using RIA as described in Section IV.D.3. In addition the
RIA was used to determine the presence or absence of
anti-NANB.sub.5-1-1 antibodies during the course of infection of
HAV and HBV in infected chimpanzees.
[0683] The results, which are presented in Table 2, show that with
chimpanzees and with humans, anti-NANB.sub.5-1-1 antibodies were
detected following the onset of the acute phase of NANBH infection.
Anti-NANB.sub.5-1-1 antibodies were not detected in serum samples
from chimpanzees infected with either HAV or HBV. Thus
anti-NANB.sub.5-1-1 antibodies serve as a marker for an
individual's exposure to HCV. TABLE-US-00068 TABLE 2 Seroconversion
in Sequential Serum Samples from Hepatitis patients and Chimpanzees
Using 5-5-5 Antigen Patient/ Sample Date (Days) Hepatitis
Anti-5-1-1 ALT Chimp (o = inoculation day) Viruses (S/N) (mu/ml)
Patient 29 T.sup.a NANB 1.09 1180 T + 180 33.89 425 T + 208 36.22
-- Patient 30 T NANB 1.90 1830 T + 307 34.17 290 T + 799 32.45 276
Chimp 1 0 NANB 0.87 9 76 0.93 71 118 23.67 19 154 32.41 -- Chimp 2
0 NANB 1.00 5 21 1.08 52 73 4.64 13 138 23.01 -- Chimp 3 0 NANB
1.08 8 43 1.44 205 53 1.82 14 159 11.87 6 Chimp 4 -3 NANB 1.12 11
55 1.25 132 83 6.60 -- 140 17.51 -- Chimp 5 0 HAV 1.50 4 25 2.39
147 40 1.92 18 268 1.53 5 Chimp 6 -8 HAV 0.85 -- 15 -- 106 41 0.81
10 129 1.33 -- Chimp 7 0 HAV 1.17 7 22 1.60 83 115 1.55 5 139 1.60
-- Chimp 8 0 HAV 0.77 15 26 1.98 130 74 1.77 8 205 1.27 5 Chimp 9
-290 HBV 1.74 -- 379 3.29 9 435 2.77 6 Chimp 10 0 HBV 2.35 8
111-118 2.74 96-155 (pool) (pool) 205 2.05 9 240 1.78 13 Chimp 11 0
HBV 1.82 11 28-56 1.26 8-100 (pool) (pool) 169 -- 9 223 0.52 10
.sup.aT = day of initial sampling
IV.E. Purification of Polyclonal Serum Antibodies to
NANB.sub.5-1-1
[0684] On the basis of the specific immunological reactivity of the
SOD-NANB.sub.5-1-1 polypeptide with the antibodies in serum samples
from patients with NANBH, a method was developed to purify serum
antibodies which react immunologically with the epitope(s) in
NANB.sub.5-1-1. This method utilizes affinity chromatography.
Purified SOD-NANB.sub.5-1-1 polypeptide (see Section IV.D.1) was
attached to an insoluble support; the attachment is such that the
immobilized polypeptide retains its affinity for antibody to
NANB.sub.5-1-1 Antibody in serum samples is absorbed to the
matrix-bound polypeptide. After washing to remove non-specifically
bound materials and unbound materials, the bound antibody is
released from the bound SOD-HCV polypeptide by change in pH, and/or
by chaotropic reagents, for example, urea.
[0685] Nitrocellulose membranes containing bound SOD-NANB.sub.5-1-1
were prepared as follows. A nitrocellulose membrane, 2.1 cm
Sartorius of 0.2 micron pore size, was washed for 3 minutes three
times with BBS. SOD-NANB.sub.5-1-1 was bound to the membrane by
incubation of the purified preparation in BBS at room temperature
for 2 hours; alternatively it was incubated at 4.degree. C.
overnight. The solution containing unbound antigen was removed, and
the filter was washed three times with BBS for three minutes per
wash. The remaining active sites on the membrane were blocked with
BSA by incubation with a 5 mg/ml BSA solution for 30 minutes.
Excess BSA was removed by washing the membrane with 5 times with
BBS and 3 times with distilled water. The membrane containing the
viral antigen and BSA was then treated with 0.05 M glycine
hydrochloride, pH 2.5, 0.10 M NaCl (GlyHCl) for 15 minutes,
followed by 3 three minute washes with PBS.
[0686] Polyclonal anti-NANB.sub.5-1-1 antibodies were isolated by
incubating the membranes containing the fusion polypeptide with
serum from an individual with NANBH for 2 hours. After the
incubation, the filters were washed 5 times with BBS, and twice
with distilled water. Bound antibodies were then eluted from each
filter with 5 elutions of GlyHCl, at 3 minutes per elution. The pH
of the eluates was adjusted to pH 8.0 by collecting each eluate in
a test tube containing 2.0 M Tris HCl, pH 8.0. Recovery of the
anti-NANB.sub.5-1-1 antibody after affinity chromatography is
approximately 50%.
[0687] The nitrocellulose membranes containing the bound viral
antigen can be used several times without appreciable decrease in
binding capacity. To reuse the membranes, after the antibodies have
been eluted the membranes are washed with BBS three times for 3
minutes. They are then stored in BBS at 4.degree. C.
IV.F. The Capture of HCV Particles from Infected Plasma Using
Purified Human Polyclonal Anti-HCV Antibodies; Hybridization of the
Nucleic Acid in the Captured Particles to HCV cDNA
IV.F.1. The Capture of HCV Particles from Infected Plasma Using
Human Polyclonal Anti-HCV Antibodies
[0688] Protein-nucleic acid complexes present in infectious plasma
of a chimpanzee with NANBH were isolated using purified human
polyclonal anti-HCV antibodies which were bound to polystyrene
beads.
[0689] Polyclonal anti-NANB.sub.5-1-1 antibodies were purified from
serum from a human with NANBH using the SOD-HCV polypeptide encoded
in clone 5-1-1. The method for purification was that described in
Section IV.E.
[0690] The purified anti-NANB.sub.5-1-1 antibodies were bound to
polystyrene beads (1/4'' diameter, specular finish, Precision
Plastic Ball Co., Chicago, Ill.) by incubating each at room
temperature overnight with 1 ml of antibodies (1 microgram/ml in
borate buffered saline, pH 8.5). Following the overnight
incubation, the beads were washed once with TBST [50 mM Tris HCl,
pH 8.0, 150 mM NaCl, 0.05% (v/v) Tween 20], and then with phosphate
buffered saline (PBS) containing 10 mg/ml BSA.
[0691] Control beads were prepared in an identical fashion, except
that the purified anti-NANB.sub.5-1-1 antibodies were replaced with
total human immunoglobulin.
[0692] Capture of HCV from NANBH infected chimpanzee plasma using
the anti-NANB.sub.5-1-1 antibodies bound to beads was accomplished
as follows. The plasma from a chimpanzee with NANBH used is
described in Section IV.A.1. An aliquot (1 ml) of the NANBV.
infected chimpanzee plasma was incubated for 3 hours at 37.degree.
C. with each of 5 beads coated with either anti-NANB.sub.5-1-1
antibodies, or with control immunoglobulins. The beads were washed
3 times with TBST.
IV.F.2. Hybridization of the Nucleic Acid in the Captured Particles
to NANBV-cDNA
[0693] The nucleic acid component released from the particles
captured with anti-NANB.sub.5-1-1 antibodies was analyzed for
hybridization to HCV cDNA derived from clone 81.
[0694] HCV particles were captured from NANBH infected chimpanzee
plasma, as described in IV.F.1. To release the nucleic acids from
the particles, the washed beads were incubated for 60 min. at
37.degree. C. with 0.2 ml per bead of a solution containing
proteinase k (1 mg/ml), 10 mM Tris HCl, pH 7.5, 10 mM EDTA, 0.25%
(w/v) SDS, 10 micrograms/ml soluble yeast RNA, and the supernatant
solution was removed. The supernatant was extracted with phenol and
chloroform, and the nucleic acids precipitated with ethanol
overnight at -20.degree. C. The nucleic acid precipitate was
collected by centrifugation, dried, and dissolved in 50 mM Hepes,
pH 7.5. Duplicate aliquots of the soluble nucleic acids from the
samples obtained from beads coated with anti-NANB.sub.5-1-1
antibodies and with control beads containing total human
immunoglobulin were filtered onto to nitrocellulose filters. The
filters were hybridized with a .sup.32P-labeled, nick-translated
probe made from the purified HCV cDNA fragment in clone 81. The
methods for preparing the probe and for the hybridization are
described in Section IV.C.1.
[0695] Autoradiographs of a probed filter containing the nucleic
acids from particles captured by beads containing
anti-NANB.sub.5-1-1 antibodies are shown in FIG. 40. The extract
obtained using the anti-NANB.sub.5-1-1 antibody (A.sub.1,A.sub.2)
gave clear hybridization signals relative to the control antibody
extract (A.sub.3,A.sub.4) and to control yeast RNA
(B.sub.1,B.sub.2) Standards consisting of 1 pg, 5 pg, and 10 pg of
the purified, clone 81 cDNA fragment are shown in C1-3,
respectively.
[0696] These results demonstrate that the particles captured from
NANBH plasma by anti-NANB.sub.5-1-1-antibodies contain nucleic
acids which hybridize with HCV cDNA in clone 81, and thus provide
further evidence that the cDNAs in these clones are derived from
the etiologic agent for NANBH.
IV.G. Immunological Reactivity of C100-3 with Purified
Anti-NANB.sub.5-1-1 Antibodies
[0697] The immunological reactivity of C100-3 fusion polypeptide
with anti-NANB.sub.5-1-1 antibodies was determined by a
radioimmunoassay, in which the antigens which were bound to a solid
phase were challenged with purified anti-NANB.sub.5-1-1 antibodies,
and the antigen-antibody complex detected with .sup.125 I-labeled
sheep anti-human antibodies. The immunological reactivity of C100-3
polypeptide was compared with that of SOD-NANB.sub.5-1-1
antigen.
[0698] The fusion polypeptide C100-3 was synthesized and purified
as described in Section IV.B.5. and in Section IV.B.6.,
respectively. The fusion polypeptide SOD-NANB.sub.5-1-1 was
synthesized and purified as described in Section IV.B.1. and in
Section IV.D.1., respectively. Purified anti-NANB.sub.5-1-1
antibodies were obtained as described in Section IV.E.
[0699] One hundred microliter aliquots containing varying amounts
of purified C100-3 antigen in 0.125M Na borate buffer, pH 8.3,
0.075M NaCl (BBS) was added to each well of a microtiter plate
(Dynatech Immulon 2 Removawell Strips). The plate was incubated at
4.degree. C. overnight in a humid chamber, after which, the protein
solution was removed and the wells washed 3 times with BBS
containing 0.02% Triton X-100 (BBST). To prevent non-specific
binding, the wells were coated with BSA by addition of 100
microliters of a 5 mg/ml solution of BSA in BBS followed by
incubation at room temperature for 1 hour, after which the excess
BSA solution was removed. The polypeptides in the coated wells were
reacted with purified anti-NANB.sub.5-1-1 antibodies by adding 1
microgram antibody/well, and incubating the samples for 1 hr at
37.degree. C. After incubation, the excess solution was removed by
aspiration, and the wells were washed 5 times with BBST.
Anti-NANB.sub.5-1-1 bound to the fusion polypeptides was determined
by the binding of .sup.125I-labeled F'(ab).sub.2 sheep anti-human
IgG to the coated wells. Aliquots of 100 microliters of the labeled
probe (specific activity 5-20 microcuries/microgram) were added to
each well, and the plates were incubated at 37.degree. C. for 1
hour, followed by removal of excess probe by aspiration, and 5
washes with BBST. The amount of radioactivity bound in each well
was determined by counting in a counter which detects gamma
radiation.
[0700] The results of the immunological reactivity of C100 with
purified anti-NANB.sub.5-1-1 as compared to that of NANB.sub.5-1-1
with the purified antibodies are shown in Table 3. TABLE-US-00069
TABLE 3 Immunological Reactivity of C100-3 compared to
NANB.sub.5-1-1 by Radioimmunoassay RIA (cpm/assay) AG(ng) 400 320
240 160 60 0 NANB.sub.5-1-1 7332 6732 4954 4050 3051 57 C100-3 7450
6985 5920 5593 4096 67
[0701] The results in Table 3 show that anti-NANB.sub.5-1-1
recognizes an epitope(s) in the C100 moiety of the
C100-3polypeptide. Thus NANB.sub.5-1-1 and C100 share a common
epitope(s). The results suggest that the cDNA sequence encoding
this NANBV epitope(s) is one which is present in both clone 5-1-1
and in clone 81.
IV.H. Characterization of HCV
IV.H.1. Characterization of the Strandedness of the HCV Genome.
[0702] The HCV genome was characterized with respect to its
strandedness by isolating the nucleic acid fraction from particles
captured on anti-NANB.sub.5-1-1 antibody coated polystyrene beads,
and determining whether the isolated nucleic acid hybridized with
plus and/or minus strands of HCV cDNA.
[0703] Particles were captured from HCV infected chimpanzee plasma
using polystyrene beads coated with immunopurified
anti-NANB.sub.5-1-1 antibody as described in Section IV.F.1. The
nucleic acid component of the particles was released using the
method described in Section IV.F.2. Aliquots of the isolated
genomic nucleic acid equivalent to 3 mls of high titer plasma were
blotted onto nitrocellulose filters. As controls, aliquots of
denatured HCV cDNA from clone 81 (2 picograms) was also blotted
onto the same filters. The filters were probed with
.sup.32P-labeled mixture of plus or mixture of minus strands of
single stranded DNA cloned from HCV cDNAs; the cDNAs were excised
from clones 40b, 81, and 25c.
[0704] The single stranded probes were obtained by excising the HCV
cDNAs from clones 81, 40b, and 25c with EcoRI, and cloning the cDNA
fragments in M13 vectors, mp18 and mp19 [Messing (1983)]. The M13
clones were sequenced to determine whether they contained the plus
or minus strands of DNA derived from the HCV cDNAs. Sequencing was
by the dideoxychain termination method of Sanger et al. (1977).
[0705] Each of a set of duplicate filters containing aliquots of
the HCV genome isolated from the captured particles was hybridized
with either plus or minus strand probes derived from the HCV cDNAS.
FIG. 41 shows the autoradiographs obtained from probing the NANBV
genome with the mixture of probes derived from clones 81, 40b, and
25c. This mixture was used to increase the sensitivity of the
hybridization assay. The samples in panel I were hybridized with
the plus strand probe mixture. The samples in panel II were probed
by hybridization with the minus strand probe mixture. The
composition of the samples in the panels of the immunoblot are
presented in Table 4. TABLE-US-00070 TABLE 4 lane A B 1 HCV genome
* 2 -- * 3 * cDNA 81 4 -- cDNA 81 * is an undescribed sample.
[0706] As seen from the results in FIG. 41, only the minus strand
DNA probe hybridizes with the isolated HCV genome. This result, in
combination with the result showing that the genome is sensitive to
RNase and not DNase (see Section IV.C.2.), suggests that the genome
of NANBV is positive stranded RNA.
[0707] These data, and data from other laboratories concerning the
physicochemical properties of a putative NANBV(s), are consistent
with the possibility that HCV is Flavi-like.
IV.H.2. Detection of Sequences in Captured Particles Which When
Amplified by PCR Hybridize to HCV cDNA Derived from Clone 81
[0708] The RNA in captured particles was obtained as described in
Section IV.H.1. The analysis for sequences which hybridize to the
HCV cDNA derived from clone 81 was carried out utilizing the PCR
amplification procedure, as described in Section IV.C.3, except
that the hybridization probe was a kinased oligonucleotide derived
from the clone 81 cDNA sequence. The results showed that the
amplified sequences hybridized with the clone 81 derived HCV cDNA
probe.
IV.H.3. Homology Between the Non-Structural Protein of Dengue
Flavivirus (MNWWVD1) and the HCV Polypeptides Encoded by the
Combined ORF of Clones 14i Through 39c
[0709] The combined HCV cDNAs of clones 14i through 39c contain one
continuous ORF, as shown in FIG. 26. The polypeptide encoded
therein was analyzed for sequence homology with the region of the
non-structural polypeptide(s) in Dengue flavivirus (MNWVD1). The
analysis used the Dayhoff protein data base, and was performed on a
computer. The results are shown in FIG. 42, where the symbol (:)
indicates an exact homology, and the symbol (.) indicates a
conservative replacement in the sequence; the dashes indicate
spaces inserted into the sequence to achieve the greatest
homologies. As seen from the figure, there is significant homology
between the sequence encoded in the HCV cDNA, and the
non-structural polypeptide(s) of Dengue virus. In addition to the
homology shown in FIG. 42, analysis of the polypeptide segment
encoded in a region towards the 3'-end of the cDNA also contained
sequences which are homologous to sequences in the Dengue
polymerase. Of consequence is the finding that the canonical
Gly-Asp-Asp (GDD) sequence thought to be essential for
RNA-dependent RNA polymerases is contained in the polypeptide
encoded in HCV cDNA, in a location which is consistent with that in
Dengue 2 virus. (Data not shown.)
IV.H.4. HCV-DNA is Not Detectable in NANBH Infected Tissue
[0710] Two types of studies provide results suggesting that HCV-DNA
is not detectable in tissue from an individual with NANBH. These
results, in conjunction with those described in IV.C. and IV.H.1.
and IV.H.2. provide evidence that HCV is not a DNA containing
virus, and that its replication does not involve cDNA.
IV.H.4.a. Southern Blotting Procedure
[0711] In order to determine whether NANBH infected chimpanzee
liver contains detectable HCV-DNA (or HCV-cDNA), restriction enzyme
fragments of DNA isolated from this source was Southern blotted,
and the blots probed with .sup.32P-labeled HCV cDNA. The results
showed that the labeled HCV cDNA did not hybridize to the blotted
DNA from the infected chimpanzee liver. It also did not hybridize
to control blotted DNA from normal chimpanzee liver. In contrast,
in a positive control, a labeled probe of the beta-interferon gene
hybridized strongly to Southern blots of restriction enzyme
digested human placental DNA. These systems were designed to detect
a single copy of the gene which was to be detected with the labeled
probe.
[0712] DNAs were isolated from the livers of two chimpanzees with
NANBH. Control DNAs were isolated from uninfected chimpanzee liver,
and from human placentas. The procedure for extracting DNA was
essentially according to Maniatis et al. (1982), and the DNA
samples were treated with RNAse during the isolation procedure.
[0713] Each DNA sample was treated with either EcoRI, MboI, or
HincII (12 micrograms), according to the manufacturer's directions.
The digested DNAs were electrophoresed on 1% neutral agarose gels,
Southern blotted onto nitrocellulose, and the blotted material
hybridized with the appropriate nick-translated probe cDNA
(3.times.10.sup.6 cpm/ml of hybridization mix). The DNA from
infected chimpanzee liver and normal liver were hybridized with
.sup.32P-labeled HCV cDNA from clones 36 plus 81; the DNA from
human placenta was hybridized with .sup.32P-labeled DNA from the
beta-interferon gene. After hybridization, the blots were washed
under stringent conditions, i.e., with a solution containing
0.1.times.SSC, 0.1% SDS, at 65.degree. C.
[0714] The beta-interferon gene DNA was prepared as described by
Houghton et al (1981).
IV.H.4.b. Amplification by the PCR Technique
[0715] In order to determine whether HCV-DNA could be detected in
liver from chimpanzees with NANBH, DNA was isolated from the
tissue, and subjected to the PCR amplification-detection technique
using primers and probe polynucleotides derived from HCV cDNA from
clone 81. Negative controls were DNA samples isolated from
uninfected HepG2 tissue culture cells, and from presumably
uninfected human placenta. Positive controls were samples of the
negative control DNAs to which a known relatively small amount (250
molecules) of the HCV cDNA insert from clone 81 was added.
[0716] In addition, to confirm that RNA fractions isolated from the
same livers of chimpanzees with NANBH contained sequences
complementary to the HCV-cDNA probe, the PCR
amplification-detection system was also used on the isolated RNA
samples.
[0717] In the studies, the DNAs were isolated by the procedure
described in Section IV.H.4.a, and RNAs were extracted essentially
as described by Chirgwin et al. (1981).
[0718] Samples of DNA were isolated from 2 infected chimpanzee
livers, from uninfected HepG2 cells, and from human placenta. One
microgram of each DNA was digested with HindIII according to the
manufacturer's directions. The digested samples were subjected to
PCR amplification and detection for amplified HCV cDNA essentially
as described in Section IV.C.3., except that the reverse
transcriptase step was omitted. The PCR primers and probe were from
HCV cDNA clone 81, and are described in Section IV.C.3.. Prior to
the amplification, for positive controls, a one microgram sample of
each DNA was "spiked" by the addition of 250 molecules of HCV cDNA
insert isolated from clone 81.
[0719] In order to determine whether HCV sequences were present in
RNA isolated from the livers of chimpanzees with NANBH, samples
containing 0.4 micrograms of total RNA were subjected to the
amplification procedure essentially as described in Section
IV.C.3., except that the reverse transcriptase was omitted from
some of the samples as a negative control. The PCR primers and
probe were from HCV cDNA clone 81, as described supra.
[0720] The results showed that amplified sequences complementary to
the HCV cDNA probe were not detectable in the DNAs from infected
chimpanzee liver, nor were they detectable in the negative
controls. In contrast, when the samples, including the DNA from
infected chimpanzee liver, was spiked with the HCV cDNA prior to
amplification, the clone 81 sequences were detected in all positive
control samples. In addition, in the. RNA studies, amplified HCV
cDNA clone 81 sequences were detected only when reverse
transcriptase was used, suggesting strongly that the results were
not due to a DNA contamination.
[0721] These results show that hepatocytes from chimpanzees with
NANBH contain no, or undetectable levels, of HCV DNA. Based upon
the spiking study, if HCV DNA is present, it is at a level far
below 0.06 copies per hepatocyte. In contrast, the HCV sequences in
total RNA from the same liver samples was readily detected with the
PCR technique.
IV.H.5 Comparison of the Hydrophobic Profiles of HCV Polyproteins
with West Nile Virus Polyprotein and with Dengue Virus NS1
[0722] The hydrophobicity profile of an HCV polyprotein segment was
compared with that of a typical flavivirus, West Nile virus. The
polypeptide sequence of the West Nile virus polyprotein was deduced
from the known polynucleotide sequences encoding the non-structural
proteins of that virus. The HCV polyprotein sequence was deduced
from the sequence of overlapping cDNA clones. The profiles were
determined using an antigen program which uses a window of 7 amino
acid width (the amino acid in question, and 3 residues on each
side) to report the average hydrophobicity about a given amino acid
residue. The parameters giving the reactive hydrophobicity for each
amino acid residue are from Kyte and Doolittle (1982). FIG. 55
shows the hydrophobic profiles of the two polyproteins; the areas
corresponding to the non-structural proteins of West Nile virus,
ns1 through ns5, are indicated in the figure. As seen in the
figure, there is a general similarity in the profiles of the HCV
polyprotein and the West Nile virus polyprotein.
[0723] The sequence of the amino acids encoded in the 5'-region of
HCV cDNA shown in FIG. 47 has been compared with the corresponding
region of one of the strains of Dengue virus, described supra.,
with respect to the profile of regions of hydrophobicity and
hydrophilicity (data not shown). This comparison indicated that the
polypeptides from HCV and Dengue encoded in this region, which
corresponds to the region encoding NS1 (or a portion thereof), have
a similar hydrophobic/hydrophilic profile.
[0724] The similarity in hydrophobicity profiles, in combination
with the previously identified homologies in the amino acid
sequences of HCV and Dengue Flavivirus in Section IV.H.3., suggests
that HCV is related to these members of the Flavivirus family.
IV.H.6. Characterization of the Putative Polypeptides Encoded
Within the HCV ORF
[0725] The sequence of the HCV cDNA sense strand, shown in FIG. 62,
was deduced from the overlapping HCV cDNAs in the various clones
described in Section IV.A. It may be deduced from the sequence that
the HCV genome contains primarily one long continuous ORF, which
encodes a polyprotein. The amino acid sequence of the putative HCV
polyprotein deduced from the HCV cDNA sense strand sequence is
shown in FIG. 66, where position 1 begins with the putative
initiator methionine, and the amino acids are indicated by the
one-letter code. In the figure, the numbers of the amino acids are
at the right of the sequence. The letters above the sequence
indicate heterogeneities which have been detected by sequencing a
number of clones which overlap the same region; the letters in
parentheses indicates that the heterogeneity is possibly due to 5'
or 3' terminal cloning artifacts.
IV.H.6.a. The Hydrophilic and Antigenic Profile of the
Polypeptide
[0726] Profiles of the hydrophilicity/hydrophobicity and the
antigenic index of the putative polyprotein encoded in the HCV cDNA
sequence shown in FIG. 89 were determined by computer analysis. The
program for hydrophilicity/hydrophobicity was as described in
Section IV.H.5. The antigenic index results from a computer program
which relies on the following criteria: 1)surface probability, 2)
prediction of alpha-helicity by two different methods; 3)
prediction of beta-sheet regions by two different methods; 4)
prediction of U-turns by two different methods; 5)
hydrophilicity/hydrophobicity; and flexibility. The traces of the
profiles generated by the computer analyses are shown in FIG. 67.
In the hydrophilicity profile, deflection above the abscissa
indicates hydrophilicity, and below the abscissa indicates
hydrophobicity. The probability that a polypeptide region is
antigenic is usually considered to increase when there is a
deflection upward from the abscissa in the hydrophilic and/or
antigenic profile. It should be noted, however, that these profiles
are not necessarily indicators of the strength of the
immunogenicity of a polypeptide.
IV.H.6.c. Identification of Co-linear Peptides in HCV and
Flaviviruses
[0727] The amino acid sequence of the putative polyprotein encoded
in the HCV cDNA sense strand was compared with the known amino acid
sequences of several members of Flaviviruses. The comparison shows
that homology is slight, but due to the regions in which it is
found, it is probably significant. The conserved colinear regions
are shown in FIG. 68. The amino acid numbers listed below the
sequences represent the number in the putative HCV polyprotein (see
FIG. 66.) The spacing of these conserved motifs is similar between
the Flaviviruses and HCV, and implies that there is some similarity
between HCV and these flaviviral agents.
IV.H.7. Sequence Variations in HCV Isolates from Different
Individuals
[0728] Isolates of HCV which contain sequences which deviate from
CDC/HCV1 were identified in human individuals, some of whom were
serologically positive for anti-C100-3 antibodies (EC10 was
antibody negative). Identification of these new isolates was
accomplished by cloning and sequencing segments of the HCV genome
which had been amplified by the PCR technique using CDC/HC1
sequences. Amplification was accomplished essentially based on an
HCV/cPCR method described in U.S. Ser. No. 398,667 filed 25 Aug.
1989, which is commonly owned by the herein assignee, and which is
hereby incorporated herein by reference. The method utilizes
primers and probes based upon the HCV cDNA sequences described
herein. The first step in the method is the synthesis of a cDNA to
either the HCV genome, or its replicative intermediate, using
reverse transcriptase. After synthesis of the HCV cDNA, and prior
to amplification, the RNA in the sample is degraded by techniques
known in the art. A designated segment of the HCV cDNA is then
amplified by the use of the appropriate primers. The amplified
sequences are cloned, and clones containing the amplified sequences
are detected by a probe which is complementary to a sequence lying
between the primers, but which does not overlap the primers.
IV.H.7.a. HCV Isolates Isolated from Humans in the U.S.
[0729] Blood samples which were used as a source of HCV virions
were obtained from the American Red Cross in Charlotte, North
Carolina, and from the Community Blood Center of Kansas, Kansas
City, Mo. The samples were screened for antibodies to the HCV
C100-3 antigen using an ELISA assay as described in Section IV.I.1,
and subjected to supplemental Western blot analysis using a
polyclonal goat anti-human HRP to measure anti-HCV antibodies. Two
samples, #23 and #27, from the American Red Cross and from the
Community Blood Center of Kansas, respectively, were determined to
be HCV positive by these assays.
[0730] Viral particles present in the serum of these samples were
isolated by ultracentrifugation under the conditions described by
Bradley et al. (1985). RNA was extracted from the particles by
digestion with proteinase K and SDS at final concentrations of 10
micrograms/ml proteinase K, and 0.1% SDS; digestion was for 1 hour
at 37.degree. C. Viral RNA was further purified by extraction with
chloroform-phenol, as described in Section IV.A-.1.
[0731] HCV RNA in the preparation of RNA was reverse transcribed
into cDNA essentially as described in Section IV.A.1., except that
the oligonucleotide JHC 7, which corresponds to the cDNA sequence
1958-1939, and which has the following sequence, was used as primer
for the reverse transcriptase reaction. TABLE-US-00071 JHC 7: CCA
GCG GTG GCC TGG TAT TG.
[0732] After both strands of the cDNA were synthesized, the
resulting cDNA was then amplified by the PCR method, essentially as
described in Section IV.A.34, except that the oligonucleotide
primers used, i.e., JHC 6 and ALX 80, were designed to amplify a
1080 nucleotide segment of the HCV genome from CDC/HCV1 nucleotides
673 to 1751. The primers, in addition, are designed to incorporate
a NOT I restriction site at the 3'-end of the PCR product, and a
blunt end at the 5'-terminus. The sequences of the primers is:
TABLE-US-00072 ALX 80: TTT GGG TAA GGT CAT CGA TAC CCT TAC GTG; and
JHC 6: ATA TGC GGC CGC CTT CCG TTG GCA TAA.
80 corresponds to nucleotides 673-702 of the CDC/HCV1 sequence; JHC
6 corresponds to nucleotides 1752-1738 of the HCV1 (in addition
there are 12 extra nucleotides which encode a NotI site). The
designation of nucleotides in JHC 6, i.e., a declining number,
indicates the placement in the anti-sense strand.
[0733] After PCR amplification with the above described primers,
the blunt end terminus was converted into a NOT I site as follows.
A homopolymer tail of 15 dGs was attached to the PCR product using
terminal deoxynucleotide transferase, and the products were again
subjected to amplification by PCR using as primers JHC 6 and JHC
13. The latter primer, JHC 13, the sequence of which follows, is
designed to contain a NOT I site in addition to an SP6 phage
promoter. (The SP6 promoter is described in GENETIC ENGINEERING, J.
Setlow Ed. (1988). TABLE-US-00073 JHC 13: AAT TCG CGG CCG CCA TAC
GAT TTA GGT GAC ACT ATA GAA CCC CCC CCC CCC CCC.
[0734] In order to clone the amplified HCV cDNA, the PCR products
were cleaved with NotI, precipitated with spermine to remove free
oligonucleotides (Hoopes et al. (1981)), and cloned into the NotI
site of pUC18S (see Section IV.A.34.). The HCV cDNAs in three
clones derived from each HCV isolate, were subjected to sequence
analysis. Analysis was essentially by the method described in Chen
and Seeburg (1985).
[0735] Consensus sequences of the clones derived from HCV in
samples 23 and 27 are shown in FIG. 80 and FIG. 81, respectively.
The variable sequences are also shown in these figures, as are the
amino acids encoded in the consensus sequences.
[0736] FIGS. 82 and 83 show comparisons of the aligned positive
strand nucleotide sequences (FIG. 82) and putative amino acid
sequences (FIG. 83) of samples 23, 27, and HCV1. The amino acid
sequence of HCV1 in FIG. 83 represents amino acid numbers 129-467
of the HCV polyprotein encoded by the large ORF in the HCV genomic
RNA. An examination of FIGS. 82 and 83 show that there are
variations in the sequences of the three isolated clones. The
sequence variations at the nucleotide level and the amino acid
level are summarized in the table immediately below. In the table,
the polypeptides designated S and NS1 represent amino acid numbers
130 to .about.380, and 380 to .about.470, respectively. The
numbering is from the putative initiator methionine. The
terminology S and NS1 is based upon the positioning of the
sequences encoding the polypeptides using the Flavivirus model. As
discussed above, however, recent evidence suggests that there is
not total correlation between HCV and the Flaviviruses with regard
to viral polypeptide domains, particularly in the putative E/NS1
domains. Indeed, HCV polypeptides and their coding domains may
exhibit substantial deviation from the Flavivirus model.
TABLE-US-00074 TABLE Sequence Homology Nucleotide Encoding Amino
Acid Encoded overall % S % NS1 % overall % S % NS1 % HCV1/HCV23 93
95 91 92 95 87 HCV1/HCV27 89 93 84 89 95 82 HCV23/ 89 93 85 90 93
84 HCV27
[0737] Although there are variations in the newly isolated HCV
sequences, the cloned sequences from samples 23 and 27 (called
HCV23 and HCV27) each contain 1019 nucleotides, indicating a lack
of deletion and addition mutants in this region in the selected
clones. The sequences in FIGS. 82 and 83 also show that the
isolated sequences are not rearranged in this region.
[0738] A comparison of the consensus sequences for HCV1 and for the
other isolates of HCV is summarized in the Table, supra. The
sequence variations between the chimpanzee isolate HCV1, and the
HCVs isolated from humans are about the same as that seen between
the HCVs of human origin.
[0739] It is of interest that the sequence variations in two of the
putative domains is not uniform. The sequence in a putative S
region appears to be relatively constant, and randomly scattered
throughout the region. In contast, a putative NS1 region has a
higher degree of variability than the overall sequence, and the
variation appears to be in a hypervariable pocket of about 28 amino
acids. which is located about 70 amino acids downstream from the
putative N-terminus of the putative polyprotein.
[0740] Although it may be argued that the detected variations were
introduced during the amplification process, it is unlikely that
all of the variations are from this result. It has been estimated
that Taq polymerase introduces errors into a sequence at
approximately one base per 10 kilobases of DNA template per cycle
(Saiki et al. (1988)). Based upon this estimate, up to 7 errors may
have been introduced during the PCR amplification of the 1019 bp
DNA fragment. However, the three subclones of HCV-23 and HCV-27
yielded 29 and 14 base variations, respectively. The following
suggest that these variations are naturally occurring. About 60% of
the base changes are silent mutations which do not change the amino
acid sequence. variations introduced by the Taq polymerase during
PCR amplification would be expected to occur randomly; however, the
results show that the variant sequences are clustered in at least
one specific region. Moreover, a consensus sequence was derived by
sequencing multiple different clones derived from the PCR amplified
products.
IV.H.7.b. HCV Isolates from Humans in Italy and in the U.S.
[0741] Segments of HCV RNA present in different isolates were
amplified by the HCV/cPCR method. These segments span a region of
.about.0.6Kb to .about.1.6Kb downstream from the methionine
encoding start codon of the putative HCV polyprotein. The isolates
are from biological specimens obtained from HCV infected
individuals. More specifically, isolate HCT #18 is from human
plasma from an individual in the U.S.A., EC1 and EC10 are from a
liver biopsy of an Italian patient, and Th is from a peripheral
blood mononucleocyte fraction of an American patient. Comparable
segments of HCV RNA have been isolated from a chimpanzee.
[0742] RNA was extracted from the human plasma specimens using
phenol:CHC13:isoamyl alcohol extraction. Either 0.1 ml or 0.01 ml
of plasma was diluted to a final volume of 1.0 ml, with a
TENB/proteinase K/SDS solution (0.05 M Tris-HCL, pH 8.0, 0.001 M
EDTA, 0.1 M NaCl, 1 mg/ml Proteinase K, and 0.5% SDS) containing 10
to 40 micrograms/ml polyadenylic acid, and incubated at 37.degree.
C. for 60 minutes. After this proteinase K digestion, the resultant
plasma fractions were deproteinized by extraction with TE (50 mM
Tris-HCl, pH 8.0, 1 mM EDTA) saturated phenol, pH 6.5. The phenol
phase was separated by centrifugation, and was reextracted with
TENB containing 0.1% SDS. The resulting aqueous phases from each
extraction were pooled, and extracted twice with an equal volume of
phenol/chloroform/isoamyl alcohol [1:1(99:1)], and then twice with
an equal volume of a 99:1 mixture of chloroform/isoamyl alcohol.
Following phase separation by centrifugation, the aqueous phase was
brought to a final concentration of 0.2 M Na Acetate, and the
nucleic acids were precipitated by the addition of two volumes of
ethanol. The precipitated nucleic acids were recovered by
ultracentrifugation in a SW 41 rotor at 38 K, for 60 minutes at
4.degree. C., or in a microfuge for 10 minutes at 10K, 4.degree.
C.
[0743] RNA extracted from the liver biopsy was provided by Dr. F.
Bonino, Ospedale Maggiore di S. Giovanni Battista, Torino,
Italy.
[0744] The mononucleocyte fraction was obtained by sedimentation of
the individual's aliquot of blood through Ficoll-Paque.RTM.
(Pharmacia Corp), using the manufacturer's directions. Total RNA
was extracted from the fraction using the guanidinium thiocyanate
procedure described in Section IV.C.1 (see also Section IV.C.1; See
also Choo et al (1989)).
[0745] Synthesis of HCV cDNA from the. samples was accomplished
using reverse transcriptase, and primers derived from clone 156e
and from clone K91. These primers, which are anti-sense relative to
the genomic RNA, have the following sequences. TABLE-US-00075
156e16B: 5' CGA CAA GAA AGA CAG A 3', and K91/16B 5' CGT TGG CAT
AAC TGA T 3'.
[0746] Following ethanol precipitation, the precipitated RNA or
nucleic acid fraction was dried,. and resuspended in DEPC treated
distilled water. Secondary structures in the nucleic acids were
disrupted by heating at 65.degree. C. for 10 minutes, and the
samples were immediately cooled on ice. cDNA was synthesized using
1 to 3 micrograms of total RNA from liver, or from nucleic acids
(or RNA) extracted from 10 to 100 microliters of plasma. The
synthesis utilized reverse transcriptase, and was in a 25
microliter reaction, using the protocol specified by the
manufacturer, BRL. All reaction mixtures for cDNA synthesis
contained 23 units of the RNAase inhibitor, RNASIN.TM.
(Fisher/Promega). Following cDNA synthesis, the reaction mixtures
were diluted with water., boiled for 10 minutes, and quickly
chilled on ice.
[0747] Each set of samples was subjected to two rounds of PCR
amplification. The primers for the reactions were selected to
amplify regions designated "EnvL" and EnvR". The "EnvL" region
encompasses nucleotides 669-1243, and putative amino acids 117 to
308; the "EnvR" region encompasses nucleotides 1215-1629, and
encodes putative amino acids 300-408 (the putative amino acids are
numbered starting from the putative methionine initiation codon).
The relationship of these regions relative to the putative
polyprotein encoded in the HCV cDNA, and to the polypeptides
encoded in the Flavirus model is shown in FIG. 84.
[0748] The primers for the first round of PCR reactions were
derived from the HCV cDNA sequences in either clone ag30a, clone
156e, or clone k9-1. The primers used for the amplification of the
EnvL region were 156el6B (shown supra), and ag30a16A for the sense
strand; the amplification of the EnvR region utilized the primer
K91/16B (shown supra), and 156e16a for the sense strand. The
sequences of the sense strand primers are the following.
TABLE-US-00076 For EnvL, ag30a16A: 5' CTC TAT GGC AAT GAG G 3', and
For EnvR, 156e16A: 5' AGC TTC GAC GTC ACA T 3'.
[0749] The PCR reactions were performed essentially according to
the manufacturer's directions (Cetus-Perkin-Elmer), except for the
addition of 1 microgram of RNase A. The reactions were carried out
in a final volume of 100 microliters. The PCR was performed for 30
cycles, utilizing a regimen of 94.degree. C. (1 min), 37.degree. C.
(2 min), and 72.degree. C. (3 min), with a 7 minute extension at
72.degree. C. for the last cycle. The samples were then extracted
with phenol:CHCl.sub.3, ethanol precipitated two times, resuspended
in 10 mM Tris HCl, pH 8.0, and concentrated using Centricon-30
(Amicon) filtration. This procedure efficiently removes
oligonucleotides less than 30 nucleotides in size; thus, the
primers from the first round of PCR amplification are removed.
[0750] The Centricon-30 concentrated samples were then subjected to
a second round of PCR amplification using probes designed from
clones 202a and 156e for the EnvL region, and from 156e and 59a for
the EnvR region. The primers for amplification of the EnvL region
have the following sequences. TABLE-US-00077 202aEnv41a: 5' CTT GAA
TTC GCA ATT TGG GTA AGG TCA TCG ATA CCC TTA CG 3' and 156e38B': 5'
CTT GAA TTC GAT AGA GCA ATT GCA ACC TTG CGT CGT CC 3'.
[0751] The primers for amplification of the EnvR region in RNAs
derived from humans have the following sequences. TABLE-US-00078
156e38A': 5' CTT GAA TTC GGA CGA CGC AAG GTT GCA ATT GCT CTA TC 3'
and 59aEnv39C: 5' CTT GAA TTC CAG CCG GTG TTG AGG CTA TCA TTG CAG
TTC 3'.
Amplification by PCR was for 35 cycles utilizing a regimen of
94.degree. C. (1 min), 60.degree. C. (1 min), and 72.degree. C. (2
min), with a 7 minute extension at 72.degree. C. for the last
cycle. The samples were then extracted with phenol:CHCl.sub.3,
precipitated two times, and digested with EcoRI. The PCR reaction
products were analyzed by separation of the products by
electrophoresis on 6% polyacrylamide gels. DNA of approximately the
estimated size of the expected PCR product was electroeluted from
the gels, and subcloned into either a pGEM-4 plasmid vector or into
lambda gt11. The expected product sizes for the EnvL and EnvR after
the first round of amplification are 615 bp and 683 bp,
respectively; after the second round of amplification the expected
product sizes for EnvL and EnvR are 414 bp and 575 bp,
respectively. The plasmids containing the amplified products were
used to transform host cells; the pGEM-4 plasmid was used to
transform DH5-alpha, and lambda gt11 was used to transform C600
delta-HFL. Clones of the transformed cells which either hybridized
to the appropriate HCV probes (described below), or those which had
inserts of the correct size were selected. The inserts were then
cloned in M13 and sequenced.
[0752] The probes for all of the HCV/cPCR products consisted of
.sup.32P labeled sections of HCV cDNA which had been prepared by
PCR amplification of a region of clone 216 (using CA216a16A and
216a16B as primers), and of clone 84 (using CA84a16A and CA84a16B
or CA84a16C as primers); .sup.32P was introduced into the PCR
products by nick translation. The probes for the first and second
round of EnvL amplification were from clone 216. Those for the
first round of EnvR amplification were from 84 (i.e., CA84a16A and
CA84a16B), for the second round of EnvL amplification were CA84a16A
and CA84a16C. These probes did not overlap the primers used in the
HCV/cPCR reactions. The sequence of the primers for the PCR
amplification of the probes is in the following table.
TABLE-US-00079 TABLE Primer Clone Sequence CA216a16A 216 5' TGA ACT
ATG CAA CAG G 3' CA216a16B 216 5' GGA GTG TGC AGG ATG G 3' CA84a16A
84 5' AAG GTT GCA ATT GCT C 3' CA84a16B 84 5' ACT AAC AGG ACC TTC G
3' CA84a16C 84 5' TAA CGG GTC ACC GCA T 3'
[0753] Sequence information on variants in the EnvL region was
obtained from 3 clones from HCT #18, 2 clones from TH, 3 clones
from EC1, and from the HCV1 clones described in Section IV.A. A
comparison of the composite nucleotide sequence of each isolate
derived from these clones is shown in FIG. 85. In the figure, each
sequence is shown 5' to 3' for the sense strand for the EnvL
region, and the sequences have been aligned. The vertical lines and
capital letters indicate sequence homology, the absence of a line
and an uncapitalized letter indicates a lack of homology. The
sequences shown in the lines are as follows: line 1, Thorn; line 2,
EC1; line 3, HCT #18; line 4, HCV1.
[0754] Sequence information on variants in the EnvR region was
obtained from two clones of EC10, and from the HCV1 clones
described in Section.IV.A. The two EC10 clones differed by only one
nucleotide. A comparison of the nucleotide sequences of EC10 (clone
2) and a composite of the HCV1 sequences is shown in FIG. 86; each
sequence is shown 5' to 3' for the sense strand of the EnvR region,
and the sequences have been aligned. The double dots between the
sequences indicate sequence homology.
[0755] A comparison of the amino acid sequences encoded in the EnvL
(amino acids #117-308) and EnvR region (amino acids #300-438) for
each of the isolates is shown in FIG. 87 and FIG. 88, respectively.
Included in the Figures are sequences for the isolates JH23 and
JH27, described in Section IV.H.7.a. Also indicated are sequences
from a Japanese isolate; these sequences were provided by Dr. T.
Miyamura, Japan. In the figures, the amino acid sequence for the
region is given in its entirety for HCV1, and the non-homologous
amino acids in the various isolates are indicated.
[0756] As seen in FIG. 87, In the EnvL region there is overall
about a 93% homology between HCV1 and the other isolates. HCT18,
Th, and EC1 have about a 97% homology with. HCV1; JH23 and JH27
have about 96% and about 95% homology, respectively, with HCV1.
FIG. 88 shows that the homologies in the EnvR region are
significantly less than in the EnvL region; moreover, one subregion
appears to be hypervariable (i.e., from amino acid 383-405). This
data is summarized in the Table immediately below. TABLE-US-00080
TABLE Homology of EnvR Region Percent Homology with HCV1 Isolate
AA330-AA438 AA383-AA405 JH23(U.S.) 83 57 JH27(U.S.) 80 39 Japanese
73 48 EC10 (Italy) 84 48
IV.H.8. Composite cDNA Sequence of HCV1
[0757] As described supra., in Section IV.A., overlapping clones of
HCV cDNA from a lambda gt11 library have been isolated and
sequenced. A composite cDNA sequence for HCV1, deduced from
overlapping clones b114a, 18g, ag30a, CA205a, CA290a, CA216a,
pi14a, CA167b, CA156e, CA84a, CA59a, K9-1 (also called k9-1),26j,
13i, 12f, 14i, 11b, 7f, 7e, 8h, 33c, 40b, 37b, 35, 36, 81, 32, 33b,
25c, 14c, 8f, 33f, 33g, 39c, 35f, 19g, 26g, 15e, b5a, 16jh, 6k, and
131jh is shown in FIG. 89. Shown above the sequence are the
position of the putative initiator methionine codon, and
nucleotides which vary from the sequence, which produce changes in
encoded amino acids. These variant nucleotides were detected by the
sequencing of overlapping clones, isolated from the same lambda
gt11 library, described in Section IV.A.1. Clonal heterogeneities
which cause many "silent" mutations were detected also, but are not
shown in the Figure.
[0758] The putative sequence of the major HCV polyprotein encoded
in the composite of HCV1 cDNA is shown in FIG. 90. The first amino
acid in the sequence is the putative initiator methionine. The
variant amino acids, due to the clonal heterogeneities, are
indicated above the sequence. Since the lambda gt11 library was
created from serum obtained from one individual (see Section
IV.A.1.), the results suggest that variant viral sequences (both
nucleotide and amino acid) are present in that individual.
[0759] An examination of the composite HCV cDNA sequence in FIG. 89
shows that besides the large ORF, there are a number or ORFs
upstream of that encoding the polyprotein, and within the sequence
encoding the polyprotein there are a large number of smaller ORFs
in the other two translational frames. The ORFs upstream of the HCV
polyprotein are shown in the Table immediately below.
TABLE-US-00081 TABLE ORFs Upstream of that Encoding the Large HCV
Polyprotein Nucl. # Translation Frame Amino Acid Sequence 10 1
MNHSPVRNYCLHAESV 63 3 MALV 74 2 MSVVQPPGPPLPGEP 193 1
MPGDLGVPPQDC
[0760] The reading frame, position, and size of the ORFs downstream
of the sequence encoding the putative initiator MET of the
polyprotein are shown in the Table below. The major polyprotein is
that translated from reading frame 2. TABLE-US-00082 TABLE ORFs
Downstream of the Putative Initiator MET Encoding Sequence Reading
Frame Size(aa) Position(bp) 1 168 1015 1 105 2662 1 119 5935 2 3025
278 3 160 324 3 111 1986 3 148 7212
[0761] In addition to the above, an examination of the sequence
which is complementary to the genomic strand of HCV RNA also
contains several small ORFs. One of these ORFs encodes a
polypeptide of 385 amino acids.
IV.I. ELISA Assays Using HCV Polypeptides
IV.I.1. ELISA Determinations for HCV Infection Using HCV c100-3 As
Test Antigen
[0762] All samples were assayed using the HCV c100-3 ELISA. This
assay utilizes the HCV c100-3 antigen (which was synthesized and
purified as described in Section IV.B.5), and a horseradish
peroxidase (HRP) conjugate of mouse monoclonal anti-human IgG.
[0763] Plates coated with the HCV c100-3 antigen were prepared as
follows. A solution containing Coating buffer (50 mM Na Borate, pH
9.0), 21 ml/plate, BSA (25 micrograms/ml), c100-3 (2.50
micrograms/ml) was prepared just prior to addition to the
Removeawell Immulon I plates (Dynatech Corp.). After mixing for 5
minutes, 0.2 ml/well of the solution was added to the plates, they
were covered and incubated for 2 hours at 37.degree. C., after
which the solution was removed by aspiration. The wells were washed
once with 400 microliters Wash Buffer (100 mM sodium phosphate, pH
7.4, 140 mM sodium chloride, 0.1% (W/V) casein, 1% (W/V) Triton
x-100, 0.01% (W/V) Thimerosal). After removal of the wash solution,
200 microliters/well of Postcoat solution (10 mM sodium phosphate,
pH 7.2, 150 mM sodium chloride, 0.1% (w/v) casein, 3% sucrose and 2
mM phenylmethylsulfonylfluoride (PMSF)) was added, the plates were
loosely covered to prevent evaporation, and were allowed to stand
at room temperature for 30 minutes. The wells were then aspirated
to remove the solution, and lyophilized dry overnight, without
shelf heating. The prepared plates may be stored at 2-8.degree. C.
in sealed aluminum pouches with dessicant (3 g Sorb-it.TM.
packs).
[0764] In order to perform the ELISA determination, 20 microliters
of serum sample or control sample was added to a well containing
200 microliters of sample diluent (100 mM sodium phosphate, pH 7.4,
500 mM sodium chloride, 1 mM EDTA, 0.1% (W/V) Casein, 0.01% (W/V)
Thimerosal, 1% (W/V) Triton X-100, 100 micrograms/ml yeast
extract). The plates were sealed, and incubated at 37.degree. C.
for two hours, after which the solution was removed by aspiration,
and the wells were washed three times with 400 microliters of wash
buffer (phosphate buffered saline (PBS) containing 0.05% Tween 20).
The washed wells were treated with 200 microliters of mouse
anti-human IgG-HRP conjugate contained in a solution of Ortho
conjugate diluent (10 mM sodium phosphate, pH 7.2, 150 mM sodium
chloride, 50% (V/V) fetal bovine serum, 1% (V/V) heat treated horse
serum, 1 mM K.sub.3Fe(CN ).sub.6, 0.05% (W/V) Tween 20, 0.02% (W/V)
Thimerosal). Treatment was for 1 hour at 37.degree. C., the
solution was removed by aspiration, and the wells were washed three
times with 400 ml wash buffer, which was also removed by
aspiration. To determine the amount of bound enzyme conjugate, 200
microliters of substrate solution (10 mg O-phenylenediamine
dihydrochloride per 5 ml of Developer solution) was added.
Developer solution contains 50 mM sodium citrate adjusted to pH 5.1
with phosphoric acid, and 0.6 microliters/ml of 30% H.sub.2O.sub.2.
The plates containing the substrate solution were incubated in the
dark for 30 minutes at room temperature, the reactions were stopped
by the addition of 50 microliters/ml 4N sulfuric acid, and the ODs
determined.
[0765] The examples provided below show that the microtiter plate
screening ELISA which utilizes HCV c100-3 antigen has a high degree
of specificity, as evidenced by an initial rate of reactivity of
about 1%, with a repeat reactive rate of about 0.5% on random
donors. The assay is capable of detecting an immunoresponse in both
the post acute phase of the infection, and during the chronic phase
of the disease. In addition, the assay is capable of detecting some
samples which score negative in the surrogate tests for NANBH;
these samples come from individuals with a history of NANBH, or
from donors implicated in NANBH transmission.
[0766] In the examples described below, the following abbreviations
are used: TABLE-US-00083 ALT Alanine amino transferase Anti-HBc
Antibody against HBc Anti-HBsAg Antibody against HBsAg HBc
Hepatitis B core antigen ABsAg Hepatitis B surface antigen IgG
Immunoglobulin G IgM Immunoglobulin M IU/L International
units/Liter NA Not available NT Not tested N Sample size Neg
Negative OD Optical density Pos Positive S/CO Signal/cutoff SD
Standard deviation x Average or mean WNL Within normal limits
IV.I.1.a. HCV Infection in a Population of Random Blood Donors
[0767] A group of 1,056 samples (fresh sera) from random blood
donors were obtained from Irwin Memorial Blood Bank, San Francisco,
Calif. The test results obtained with these samples are summarized
in a histogram showing the distribution of the OD values (FIG. 43).
As seen in FIG. 43, 4 samples read >3, 1 sample reads between 1
and 3, 5 samples read between 0.4 and 1, and the remaining 1,046
samples read <0.4, with over 90% of these samples reading
<0.1.
[0768] The results on the reactive random samples are presented in
Table 5. Using a cut-off value equal to the mean plus 5 standard
deviations, ten samples out of the 1,056 (0.95%) were initially
reactive. Of these, five samples (0.47%) repeated as reactive when
they were assayed a second time using the ELISA. Table 5 also shows
the ALT and Anti-HBd status for each of the repeatedly reactive
samples. Of particular interest is the fact that all five repeat
reactive samples were negative in both surrogate tests for NANBH,
while scoring positive in the HCV ELISA. TABLE-US-00084 TABLE 5
Results on Reactive Random Samples N = 1051 x = 0.049* SD =
.+-.0.074 Cut-off: x + 5SD = 0.419 (0.400 + Negative Control)
Initial Repeat Reactives Reactives Anti Samples OD OD ALT** HBc***
4227 0.462 0.084 NA (OD) 6292 0.569 0.294 NA NA 6188 0.699 0.326 NA
NA 6157 0.735 0.187 NA NA 6277 0.883 0.152 NA NA 6397 1.567 1.392
30.14 1.433 6019 >3.000 >3.000 46.48 1.057 6651 >3.000
>3.000 48.53 1.343 6669 >3.000 >3.000 60.53 1.165 4003
>3.000 >3.000 WNL**** Negative 10/1056 = 0.95% 5/1056 = 0.47%
*Samples reading >1.5 were not included in calculating the Mean
and SD **ALT .gtoreq.68 IU/L is above normal limits. ***Anti-HBc
.ltoreq.0.535 (competition assay) is considered positive. ****WNL:
Within normal limits
IV.I.1.b. Chimpanzee Serum Samples
[0769] Serum samples from eleven chimpanzees were tested with the
HCV c100-3 ELISA. Four of these chimpanzees were infected with
NANBH from a contaminated batch of Factor VIII (presumably
Hutchinson strain), following an established procedure in a
collaboration with Dr. Daniel Bradley at the Centers for Disease
Control. As controls, four other chimpanzees were infected with HAV
and three with HBV. Serum samples were obtained at different times
after infection.
[0770] The results, which are summarized in Table 6, show
documented antibody seroconversion in all chimpanzees infected with
the Hutchinson strain of NANBH. Following the acute phase of
infection (as evidenced by the significant rise and subsequent
return to normal of ALT levels), antibodies to HCV c100-3 became
detectable in the sera of the 4/4. NANBH infected chimpanzees.
These samples had previously been shown, as discussed in Section
IV.B.3., to be positive by a Western analysis, and an RIA. In
contrast, none of the control chimpanzees which had been infected
with HAV or HBV showed evidence of reactivity in the ELISA.
TABLE-US-00085 TABLE 6 Chimpanzee Serum Samples Inoculation Bleed
ALT OD S/CO Date Date (IU/L) Transfused Negative Control 0.001
Positive Control 1.504 Cutoff 0.401 Chimp 1 -0.007 0.00 May 24,
1984 May 24, 1984 9 NANB 0.003 0.01 Aug. 07, 1984 71 >3.000
>7.48 Sep. 18, 1984 19 >3.000 >7.48 Oct. 24, 1984 -- Chimp
2 -- -- Jun. 07, 1984 -- -- NANB -0.003 0.00 May 31, 1984 5 -0.005
0.00 Jun. 28, 1984 52 0.945 2.36 Aug. 20, 1984 13 >3.000
>7.48 Oct. 24, 1984 -- Chimp 3 0.005 0.01 Mar. 14, 1985 Mar. 14,
1985 8 NANB 0.017 0.04 Apr. 26, 1985 205 0.006 0.01 May 06, 1985 14
1.010 2.52 Aug. 20, 1985 6 Chimp 4 -0.006 0.00 Mar. 11, 1985 Mar.
11, 1985 11 NANB 0.003 0.01 May 09, 1985 132 0.523 1.31 Jun. 06,
1985 -- 1.574 3.93 Aug. 01, 1985 -- Chimp 5 -0.006 0.00 Nov. 21,
1980 Nov. 21, 1980 4 HAV 0.001 0.00 Dec. 16, 1980 147 0.003 0.01
Dec. 30, 1980 18 0.006 0.01 Jul. 29, 1981-Aug. 21, 1981 5 Chimp 6
-- -- May 25, 1982 -- -- HAV -0.005 0.00 May 17, 1982 -- 0.001 0.00
Jun. 10, 1982 106 -0.004 0.00 Jul. 06, 1982 10 0.290 0.72 Oct. 01,
1982 -- Chimp 7 -0.008 0.00 May 25, 1982 May 25, 1982 7 HAV -0.004
0.00 Jun. 17, 1982 83 -0.006 0.00 Sep. 16, 1982 5 0.005 0.01 Oct.
09, 1982 -- Chimp 8 -0.007 0.00 Nov. 21, 1980 Nov. 21, 1980 15 HAV
0.000 0.00 Dec. 16, 1980 130 0.004 0.01 Feb. 03, 1981 8 0.000 0.00
Jun. 03, 1981-Jun. 10, 1981 4.5 Chimp 9 -- -- Jul. 24, 1980 -- --
HBV 0.019 0.050 Aug. 22, 1979-Oct. 10, 1979 -- -- -- Mar. 11, 1981
57 0.015 0.04 Jul. 01, 1981-Aug. 05, 1981 9 0.008 0.02 Oct. 01,
1981 6 Chimp 10 -- -- May 12, 1982 -- -- HBV 0.011 0.03 Apr. 21,
1982-May 12, 1982 9 0.015 0.04 Sep. 01, 1982-Sep. 08, 1982 126
0.008 0.02 Dec. 02, 1982 9 0.010 0.02 Jan. 06, 1983 13 Chimp11 --
-- May 12, 1982 -- -- HBV 0.000 0.00 Jan. 06, 1982-May 12, 1982 11
-- -- Jun. 23, 1982 100 -0.003 0.00 Jun. 09, 1982-Jul. 07, 1982 --
-0.003 0.00 Oct. 28, 1982 9 -0.003 0.00 Dec. 20, 1982 10
IV.I.1.c. Panel 1: Proven Infectious Sera from Chronic Human NANBH
Carriers
[0771] A coded panel consisted of 22 unique samples, each one in
duplicate, for a total of 44 samples. The samples were from proven
infectious sera from chronic NANBH carriers, infectious sera from
implicated donors, and infectious sera from acute phase NANBH
patients. In addition, the samples were from highly pedigreed
negative controls, and other disease controls. This panel was
provided by Dr. H. Alter of the Department of Health and Human
Services, National Institutes of Health, Bethesda, Md. The panel
was constructed by Dr. Alter several years ago, and has been used
by Dr. Alter as a qualifying panel for putative NANBH assays.
[0772] The entire panel was assayed twice with the ELISA assay, and
the results were sent to Dr. Alter to be scored. The results of the
scoring are shown in Table 7. Although the Table reports the
results of only one set of duplicates, the same values were
obtained for each of the duplicate samples.
[0773] As shown in Table 7, 6 sera which were proven infectious in
a chimpanzee model were strongly positive. The seventh infectious
serum corresponded to a sample for an acute NANBH case, and was not
reactive in this ELISA. A sample from an implicated donor with both
normal ALT levels and equivocal results in the chimpanzee studies
was non-reactive in the assay. Three other serial samples from one
individual with acute NANBH were also non-reactive. All samples
coming from the highly pedigreed negative controls, obtained from
donors who had at least 10 blood donations without hepatitis
implication, were non-reactive in the ELISA. Finally, four of the
samples tested had previously scored as positive in putative NANBH
assays developed by others, but these assays were not confirmable.
These four samples scored negatively with the HCV ELISA.
TABLE-US-00086 TABLE 7 H. Alter's Panel 1: 1st 2nd Panel Result
Result 1) Proven Infectious by Chimpanzee Transmission A. Chronic
NANB; Post-Tx JF + + EB + + PG + + B. Implicated Donors with
Elevated ALT BC + + JJ + + BB + + C. Acute NANB; Post-Tx WH - - 2)
Equivocally Infectious by Chimpanzee Transmission A. Implicated
Donor with Normal ALT CC - - 3) Acute NANB; Post-Tx JL Week 1 - -
JL Week 2 - - JL Week 3 - - 4) Disease Controls A. Primary Biliary
Cirrhosis EK - - B. Alcoholic Hepatitis in Recovery HB - - 5)
Pedigreed Negative Controls DH - - DC - - LV - - ML - - AH - - 6)
Potential NANB "Antigens" JS-80-01T-0 (Ishida) - - Asterix (Trepo)
- - Zurtz (Arnold) - - Becassdine (Trepo) - -
IV.I.1.d. Panel 2: Donor/Recipient NANBH
[0774] The coded panel consisted of 10 unequivocal donor-recipient
cases of transfusion associated NANBH, with a total of 188 samples.
Each case consisted of samples of some or all the donors to the
recipient, and of serial samples (drawn 3, 6, and 12 months after
transfusion) from the recipient. Also included was a prebleed,
drawn from the recipient before transfusion. The coded panel was
provided by Dr. H. Alter, from the NIH, and the results were sent
to him for scoring.
[0775] The results, which are summarized in Table 8, show that the
ELISA detected antibody seroconversion in 9 of 10 cases of
transfusion associated NANBH. Samples from case 4 (where no
seroconversion was detected), consistently reacted poorly in the
ELISA. Two of the 10 recipient samples were reactive at 3 months
post transfusion. At six months, 8 recipient samples were reactive;
and at twelve months, with the exception of case 4, all samples
were reactive. In addition, at least one antibody positive donor
was found in 7 out of the 10 cases, with case 10 having two
positive donors. Also, in case 10, the recipient's pre-bleed was
positive for HCV antibodies. The one month bleed from this
recipient dropped to borderline reactive levels, while it was
elevated to positive at 4 and 10 month bleeds. Generally, a S/CO of
0.4 is considered positive. Thus, this case may represent a prior
infection of the individual with HCV.
[0776] The ALT and HBc status for all the reactive, i.e., positive,
samples are summarized in Table 9. As seen in the table, 1/8 donor
samples was negative for the surrogate markers and reactive in the
HCV antibody ELISA. On the other hand, the recipient samples
(followed up to 12 months after transfusion) had either elevated
ALT, positive Anti-HBc, or both. TABLE-US-00087 TABLE 8 H. Alter
Donor/Recipient NANB Panel Recipient Post-TX Donor Prebleed 3
Months 6 Months 12 Months Case OD S/CO OD S/CO OD S/CO OD S/CO OD
S/CO 1. -- -- .032 0.07 .112 0.26 >3.000 >6.96 >3.000
>6.96 2. -- -- .059 0.14 .050 0.12 1.681 3.90 >3.000 >6.96
3. .403 0.94 .049 0.11 .057 0.13 >3.000 >6.96 >3.000
>6.96 4. -- -- .065 0.15 .073 0.17 .067 0.16 .217 0.50 5.
>3.000 >6.96 .034 0.08 .096 0.22 >3.000 >6.96 >3.000
>6.96 6. >3.000 >6.96 .056 0.13 1.475 3.44 >3.000
>6.96 >3.000 >6.96 7. >3.000 >6.96 .034 0.08 .056
0.13 >3.000 >6.96 >3.000 >6.96 8. >3.000 >6.96
.061 0.14 .078 0.18 2.262 5.28 >3.000 >6.96 9. >3.000
>6.96 .080 0.19 .127 0.30 .055 0.13 >3.000 >6.96 10.
>3.000 >6.96 >3.000 >6.96 .317* 0.74 >3.000**
>6.96 >3.000*** >6.96 >3.000 >6.96 *1 Month, **4
Months, ***10 Months
[0777] TABLE-US-00088 TABLE 9 ALT AND HBc STATUS FOR REACTIVE
SAMPLES IN H. ALTER PANEL 1 Samples Anti-ALT* HBc** Donors Case 3
Normal Negative Case 5 Elevated Positive Case 6 Elevated Positive
Case 7 Not Available Negative Case 8 Normal Positive Case 9
Elevated Not Available Case 10 Normal Positive Case 10 Normal
Positive Recipients Case 1 6 mo Elevated Positive 12 mo Elevated
Not tested Case 2 6 mo Elevated Negative 12 mo Elevated Not tested
Case 3 6 mo Normal Not tested*** 12 mo Elevated Not tested*** Case
5 6 mo Elevated Not tested 12 mo Elevated Not tested Case 6 3 mo
Elevated Negative 6 mo Elevated Negative 12 mo Elevated Not tested
Case 7 6 mo Elevated Negative 12 mo Elevated Negative Case 8 6 mo
Normal Positive 12 mo Elevated Nat tested Case 9 12 mo Elevated Not
tested Case 10 4 mo Elevated Not tested 10 mo Elevated Not tested
*ALT .gtoreq.45 IU/L is above normal limits **Anti-HBc .ltoreq.50%
(competition assay) is considered positive. ***Prebleed and 3 mo
samples were negative for HBc.
IV.I.1.e. Determination of HCV Infection in High Risk Group
Samples
[0778] Samples from high risk groups were monitored using the ELISA
to determine reactivity to HCV c100-3 antigen. These samples were
obtained from Dr. Gary Tegtmeier, Community Blood Bank, Kansas
City. The results are summarized in Table 10.
[0779] As shown in the table, the samples with the highest
reactivity are obtained from hemophiliacs (76%). In addition,
samples from individuals with elevated ALT and positive for
Anti-HBc, scored 51% reactive, a value which is consistent with the
value expected from clinical data and NANBH prevalence in this
group. The incidence of antibody to HCV was also higher in blood
donors with elevated ALT alone, blood donors positive for
antibodies to Hepatitis B core alone, and in blood donors rejected
for reasons other than high ALT or anti-core antibody when compared
to random volunteer donors. TABLE-US-00089 TABLE 10 NANBH HIGH RISK
GROUP SAMPLES Distribution Group N N OD % Reactive Elevated ALT 35
3 >3.000 11.4% 1 0.728 Anti-HBc 24 5 >3.000 20.8% Elevated
ALT, Anti-HBc 33 12 >3.000 51.5% 1 2.768 1 2.324 1 0.939 1 0.951
1 0.906 Rejected Donors 25 5 >3.000 20.0% Donors with History of
150 19 >3.000 14.7% Hepatitis 1 0.837 1 0.714 1 0.469
Haemophiliacs 50 31 >3.000 76.0% 1 2.568 1 2.483 1 2.000 1 1.979
1 1.495 1 1.209 1 0.819
IV.I.1.f.(1) Comparative Studies Using Anti-IgG or Anti-IgM
Monoclonal Antibodies, or Polyclonal Antibodies as a Second
Antibody in the HCV c100-3 ELISA
[0780] The sensitivity of the ELISA determination which uses the
anti-IgG monoclonal conjugate was compared to that obtained by
using either an anti-IgM monoclonal conjugate, or by replacing both
with a polyclonal antiserum reported to be both heavy and light
chain specific. The following studies were performed.
IV.I.6.a. Serial Samples from Seroconverters
[0781] Serial samples from three cases of NANB seroconverters were
studied in the HCV c100-3 ELISA assay using in the enzyme conjugate
either the anti-IgG monoclonal alone, or in combination with an
anti-IgM monoclonal, or using a polyclonal antiserum. The samples
were provided by Dr. Cladd Stevens, N.Y. Blood Center, N.Y.C., N.Y.
The sample histories are shown in Table 11.
[0782] The results obtained using an anti-IgG monoclonal
antibody-enzyme conjugate are shown in Table 12. The data shows
that strong reactivity is initially detected in samples 1-4, 2-8,
and 3-5, of cases 1, 2, and 3, respectively.
[0783] The results obtained using a combination of an anti-IgG
monoclonal conjugate and an anti-IgM conjugate are shown in Table
13. Three different ratios of anti-IgG to anti-IgM were tested; the
1:10,000 dilution of anti-IgG was constant throughout. Dilutions
tested for the anti-IgM monoclonal conjugate were 1:30,000,
1:60,000, and 1:120,000. The data shows that, in agreement with the
studies with anti-IgG alone, initial strong reactivity is detected
in samples 1-4, 2-8, and 3-5.
[0784] The results obtained with the ELISA using anti-IgG
monoclonal conjugate (1:10,000 dilution), or Tago polyclonal
conjugate (1:80,000 dilution), or Jackson polyclonal conjugate
(1:80,000 dilution) are shown in Table 14. The data indicates that
initial strong reactivity is detected in samples 1-4, 2-8, and 3-5
using all three configurations; the Tago polyclonal antibodies
yielded the lowest signals.
[0785] The results presented above show that all three
configurations detect reactive samples at the same time after the
acute phase of the disease (as evidenced by the ALT elevation).
Moreover, the results indicate that the sensitivity of the HCV
c100-3 ELISA using anti-IgG monoclonal-enzyme conjugate is equal to
or better than that obtained using the other tested configurations
for the enzyme conjugate. TABLE-US-00090 TABLE 11 DESCRIPTION OF
SAMPLES FROM CLADD STEVENS PANEL Anti- Date HBsAg HBs Anti-HBc ALT
Bilirubin Case 1 1-1 Aug. 5, 1981 1.0 91.7 12.9 40.0 -1.0 1-2 Sep.
2, 1981 1.0 121.0 15.1 274.0 1.4 1-3 Oct. 7, 1981 1.0 64.0 23.8
261.0 0.9 1-4 Nov. 19, 1981 1.0 67.3 33.8 75.0 0.9 1-5 Dec. 15,
1981 1.0 50.5 27.6 71.0 1.0 Case 2 2-1 Oct. 19, 1981 1.0 1.0 116.2
17.0 -1.0 2-2 Nov. 17, 1981 1.0 0.8 89.5 46.0 1.1 2-3 Dec. 02, 1981
1.0 1.2 78.3 63.0 1.4 2-4 Dec. 14, 1981 1.0 0.9 90.6 152.0 1.4 2-5
Dec. 23, 1981 1.0 0.8 93.6 624.0 1.7 2-6 Jan. 20, 1982 1.0 0.8 92.9
66.0 1.5 2-7 Feb. 15, 1982 1.0 0.8 86.7 70.0 1.3 2-8 Mar. 17, 1982
1.0 0.9 69.8 24.0 -1.0 2-9 Apr. 21, 1982 1.0 0.9 67.1 53.0 1.5 2-10
May 19, 1982 1.0 0.5 74.8 95.0 1.6 2-11 Jun. 14, 1982 1.0 0.8 82.9
37.0 -1.0 Case 3 3-1 Apr. 7, 1981 1.0 1.2 88.4 13.0 -1.0 3-2 May
12, 1981 1.0 1.1 126.2 236.0 0.4 3-3 May 30, 1981 1.0 0.7 99.9
471.0 0.2 3-4 Jun. 9, 1981 1.0 1.2 110.8 315.0 0.4 3-5 Jul. 6, 1981
1.0 1.1 89.9 273.0 0.4 3-6 Aug. 10, 1981 1.0 1.0 118.2 158.0 0.4
3-7 Sep. 8, 1981 1.0 1.0 112.3 84.0 0.3 3-8 Oct. 14, 1981 1.0 0.9
102.5 180.0 0.5 3-9 Nov. 1, 1981 1.0 1.0 84.6 154.0 0.3
[0786] TABLE-US-00091 TABLE 12 ELISA RESULTS OBTAINED USING AN
ANTI-IgG MONOCLONAL CONJUGATE SAMPLE DATE ALT OD S/CO Neg Control
.076 Cutoff .476 PC (1:128) 1.390 Case #1 1-1 Aug. 05, 1981 40.0
.178 .37 1-2 Sep. 02, 1981 274.0 .154 .32 1-3 Oct. 07, 1981 261.0
.129 .27 1-4 Nov. 19, 1981 75.0 .937 1.97 1-5 Dec. 15, 1981 71.0
>3.000 >6.30 Case #2 2-1 Oct. 19, 1981 17.0 .058 0.12 2-2
Nov. 17, 1981 46.0 .050 0.11 2-3 Dec. 02, 1981 63.0 .047 0.10 2-4
Dec. 14, 1981 152.0 .059 0.12 2-5 Dec. 23, 1981 624.0 .070 0.15 2-6
Jan. 20, 1982 66.0 .051 0.11 2-7 Feb. 15, 1982 70.0 .139 0.29 2-8
Mar. 17, 1982 24.0 1.867 3.92 2-9 Apr. 21, 1982 53.0 >3.000
>6.30 2-10 May 19, 1982 95.0 >3.000 >6.30 2-11 Jun. 14,
1982 37.0 >3.000 >6.30 Case #3 3-1 Apr. 07, 1981 13.0 .090
.19 3-2 May 12, 1981 236.0 .064 .13 3-3 May 30, 1981 471.0 .079 .17
3-4 Jun. 09, 1981 315.0 .211 .44 3-5 Jul. 06, 1981 273.0 1.707 3.59
3-6 Aug. 10, 1981 158.0 >3.000 >6.30 3-7 Sep. 08, 1981 84.0
>3.000 >6.30 3-8 Oct. 14, 1981 180.0 >3.000 >6.30 3-9
Nov. 11, 1981 154.0 >3.000 >6.30
[0787] TABLE-US-00092 TABLE 13 ELISA RESULTS OBTAINED USING
ANTI-IgG and ANTI-IgM MONOCLONAL CONJUGATE NANB ELISAs Monoclonals
Monoclonals Monoclonals IgG 1:10K IgG 1:10K IgG 1:10K IgM 1:30K IgM
1:60K IgM 1:120K SAMPLE DATE ALT OD S/CO OD S/CO OD S/CO Neg
Control .100 .080 .079 Cutoff PC (1:128) 1.083 1.328 1.197 Case #1
1-1 Aug. 05, 1981 40 .173 .162 .070 1-2 Sep. 02, 1981 274 .194 .141
.079 1-3 Oct. 07, 1981 261 .162 .129 .063 1-4 Nov. 19, 1981 75 .812
.85 .709 1-5 Dec. 15, 1981 71 >3.00 >3.00 >3.00 Case #2
2-1 Oct. 19, 1981 17 .442 .045 .085 2-2 Nov. 17, 1981 46 .102 .029
.030 2-3 Dec. 02, 1981 63 .059 .036 .027 2-4 Dec. 14, 1981 152 .065
.041 .025 2-5 Dec. 23, 1981 624 .082 .033 .032 2-6 Jan. 20, 1982 66
.102 .042 .027 2-7 Feb. 15, 1982 70 .188 .068 .096 2-8 Mar. 17,
1982 24 1.728 1.668 1.541 2-9 Apr. 21, 1982 53 >3.00 2.443
>3.00 2-10 May 19, 1982 95 >3.00 >3.00 >3.00 2-11 Jun.
14, 1982 37 >3.00 >3.00 >3.00 Case #3 3-1 Apr. 07, 1981 13
.193 .076 .049 3-2 May 12, 1981 236 .201 .051 .038 3-3 May 30, 1981
471 .132 .067 .052 3-4 Jun. 09, 1981 315 .175 .155 .140 3-5 Jul.
06, 1981 273 1.335 1.238 1.260 3-6 Aug. 10, 1981 158 >3.00
>3.00 >3.00 3-7 Sep. 08, 1981 84 >3.00 >3.00 >3.00
3-8 Oct. 14, 1981 180 >3.00 >3.00 >3.00 3-9 Nov. 11, 1981
154 >3.00 >3.00 >3.00
[0788] TABLE-US-00093 TABLE 14 ELISA RESULTS OBTAINED USING
POLYCLONAL CONJUGATES NANB ELISAs Monoclonal Tago Jackson 1:10K
1:80K 1:80K SAMPLE DATE ALT OD S/CO OD S/CO OD S/CO Neg Control
.076 .045 .154 Cutoff .476 .545 .654 PC (1:128) 1.390 .727 2.154
Case #1 1-1 Aug. 05, 1981 40 .178 .37 .067 .12 .153 .23 1-2 Sep.
02, 1981 274 .154 .32 .097 .18 .225 .34 1-3 Oct. 07, 1981 261 .129
.27 .026 .05 .167 .26 1-4 Nov. 19, 1981 75 .937 1.97 .324 .60 .793
1.21 1-5 Dec. 15, 1981 71 >3.00 >6.30 1.778 3.27 >3.00
>4.29 Case #2 2-1 Oct. 19, 1981 17 .058 .12 .023 .04 .052 .08
2-2 Nov. 17, 1981 46 .050 .11 .018 .03 .058 .09 2-3 Dec. 02, 1981
63 .047 .10 .020 .04 .060 .09 2-4 Dec. 14, 1981 152 .059 .12 .025
.05 .054 .08 2-5 Dec. 23, 1981 624 .070 .15 .026 .05 .074 .11 2-6
Jan. 20, 1982 66 .051 .11 .018 .03 .058 .09 2-7 Feb. 15, 1982 70
.139 .29 .037 .07 .146 .22 2-8 Mar. 17, 1982 24 1.867 3.92 .355 .65
1.429 2.19 2-9 Apr. 21, 1982 53 >3.00 >6.30 .748 1.37
>3.00 >4.59 2-10 May 19, 1982 95 >3.00 >6.30 1.025 1.88
>3.00 >4.59 2-11 Jun. 14, 1982 37 >3.00 >6.30 .917 1.68
>3.00 >4.59 Case #3 3-1 Apr. 07, 1981 13 .090 .19 .049 .09
.138 .21 3-2 May 12, 1981 236 .064 .13 .040 .07 .094 .14 3-3 May
30, 1981 471 .079 .17 .045 .08 .144 .22 3-4 Jun. 09, 1981 315 .211
.44 .085 .16 .275 .42 3-5 Jul. 06, 1981 273 1.707 3.59 .272 .50
1.773 2.71 3-6 Aug. 10, 1981 158 >3.00 >6.30 1.347 2.47
>3.00 >4.59 3-7 Sep. 08, 1981 84 >3.00 >6.30 2.294 4.21
>3.00 >4.59 3-8 Oct. 14, 1981 180 >3.00 >6.30 >3.00
>5.50 >3.00 >4.59 3-9 Nov. 11, 1981 154 >3.00 >6.30
>3.00 >5.50 >3.00 >4.59
IV.I.l.f.(2). Samples from Random Blood Donors
[0789] Samples from random blood donors (see Section IV.I.1.) were
screened for HCV infection using the HCV c100-3 ELISA, in which the
antibody-enzyme conjugate was either an anti-IgG monoclonal
conjugate, or a polyclonal conjugate. The total number of samples
screened were 1077 and 1056, for the polyclonal conjugate and the
monoclonal conjugate, respectively. A summary of the results of the
screening is shown in Table 15, and the sample distributions are
shown in the histogram in FIG. 44.
[0790] The calculation of the average and standard deviation was
performed excluding samples that gave a signal over 1.5, i.e., 1073
OD values were used for the calculations utilizing the polyclonal
conjugate, and 1051 for the anti-IgG monoclonal conjugate. As seen
in Table 15, when the polyclonal conjugate was used, the average
was shifted from 0.0493 to 0.0931, and the standard deviation was
increased from 0.074 to 0.0933. Moreover, the results also show
that if the criteria of x +5SD is employed to define the assay
cutoff, the polyclonal-enzyme conjugate configuration in the ELISA
requires a higher cutoff value. This indicates a reduced assay
specificity as compared to the monoclonal system. In addition, as
depicted in the histogram in FIG. 44, a greater separation of
results between negative and positive distributions occurs when
random blood donors are screened in an ELISA using the anti-IgG
monoclonal conjugate as compared to the assay using a commercial
polyclonal label. TABLE-US-00094 TABLE 15 COMPARISON OF TWO ELISA
CONFIGURATIONS IN TESTING SAMPLES FROM RANDOM BLOOD DONORS
POLYCLONAL ANTI-IgG CONJUGATE (Jackson) MONOCLONAL Number of
samples 1073 1051 Average (x) 0.0931 0.04926 Standard deviation
(SD) 0.0933 0.07427 5 SD 0.4666 0.3714 CUT-OFF (5 SD + x) 0.5596
0.4206
IV.I.2. ELISA Assay Using Recombinant SOD-NANB.sub.5-1-1
[0791] This assay utilizes the SOD-NANB.sub.5-1-1 antigen, and is
similar to the assay utilizing the c100-3 antigen (see Section
IV.I.1.) except for the following.
[0792] The HCV polypeptide used in the assay is SOD-NANB.sub.5-1-1
which is purified as described in Section IV.N.1.b., infra.
[0793] In the preparation of the plates, Immulon 2 plates replace
Immulon 1 plates. In addition, BSA is omitted from the coating
solution, and the coating solution contains 3.75 micrograms/ml of
SOD-NANB.sub.5-1-1 instead of c100-3.
[0794] The assay is also changed in that the sample diluent
contains 1 mg/ml yeast extract, and also contains 500 micrograms/ml
of the second E. coli extract (which is comprised of proteins in
the soluble fraction of the lysozyme treated bacteria), and 100
micrograms/ml SOD. The extracts are prepared as described in
Section IV.N.1.a., infra.
IV.I.3. ELISA Assay Using Recombinant C33c
[0795] This assay utilizes the SOD-C33c antigen, and is similar to
the assay utilizing the SOD-NANB.sub.5-1-1 antigen (see Section
IV.I.2.) except for the following.
[0796] The HCV polypeptide used in the assay is SOD-C33c, which is
prepared as described in Section IV.B.9., supra. The plates coated
are Immulon 1 plates instead of Immulon 2 plates, and the coating
solution 1.25 micrograms/ml of SOD-C33c instead of c100-3. The
assay is also changed in that the sample diluent contains 1 mg/ml
yeast extract instead of 100 micrograms/ml of the second E. coli
extract and 100 micrograms/ml of SOD.
IV.I.4. ELISA Assay Using a Synthetic Polypeptide Containing
NANB.sub.5-1-1 Sequences
[0797] This assay utilizes a synthetic peptide containing 42 amino
acids encoded in HCV which are in the NANB 1-1 polypeptide, and
which are also in the c100-3 polypeptide. The polypeptide, which
was prepared by Peninsula Laboratory using chemical synthesis, has
the following sequence. TABLE-US-00095
NH.sub.2-Ile-Ile-Pro-Asp-Arg-Glu-Val-Leu-Tyr-Arg-Glu-
Phe-Asp-Glu-Met-Glu-Glu-Cys-Ser-Gln-His-Leu-
Pro_Tyr-Ile-Glu-Gln-Met-Met-Leu-Ala-Glu-Gln-Phe-
Lys-Gln-Lys-Ala-Leu-Gly-Leu-COOH.
[0798] The assay is essentially as described in Section IV.I.1.,
except that the synthetic 5-1-1 polypeptide replaces the c100-3
polypeptide in the coating solution at a concentration of 2.5 ug/mL
(micrograms). Also, Immulon 2 plates replace immulon 1 plates, and
the BSA is omitted from the coating solution.
IV.J. Detection of HCV Seroconversion in NANBH Patients from a
Variety of Geographical Locations
[0799] Sera from patients who were suspected to have NANBH based
upon elevated ALT levels, and who were negative in HAV and HBV
tests were screened using the RIA essentially as described in
Section IV.D., except that the HCV C100-3 antigen was used as the
screening antigen in the microtiter plates. As seen from the
results presented in Table 16, the RIA detected positive samples in
a high percentage of the cases. TABLE-US-00096 TABLE 16
Seroconversion Frequencies for Anti-c100-3 Among NANBH Patients in
Different Countries Country The Netherlands Italy Japan No. 5 36 26
Examined No. 3 29 19 Positive % 60 80 73 Positive
IV.K. Detection of HCV Seroconversion in Patients with "Community
Acquired" NANBH
[0800] Sera which was obtained from 100 patients with NANBH, for
whom there was no obvious transmission route (i.e., no
transfusions, i.v. drug use, promiscuity, etc. were identified as
risk factors), was provided by Dr. M. Alter of the Center for
Disease Control, and Dr. J. Dienstag of Harvard University. These
samples were screened using an RIA essentially as described in
Section IV.D., except that the HCV c100-3 antigen was used as the
screening antigen attached to the microtiter plates. The results
showed that of the 100 serum samples, 55 contained antibodies that
reacted immunologically with the HCV c100-3 antigen.
[0801] The results described above suggest that "Community
Acquired" NANBH is also caused by HCV. Moreover, since it has been
demonstrated herein that HCV is related to Flaviviruses, most of
which are transmitted by arthropods, it is suggestive that HCV
transmission in the "Community Acquired" cases also results from
arthropod transmission.
IV.L. Comparison of Incidence of HCV Antibodies and Surrogate
Markers in Donors Implicated in NANBH Transmission
[0802] A prospective study was carried out to determine whether
recipients of blood from suspected NANBH positive donors, who
developed NANBH, seroconverted to anti-HCV-antibody positive. The
blood donors were tested for the surrogate marker abnormalities
which are currently used as markers for NANBH infection, i.e.,
elevated ALT levels, and the presence of anti-core antibody. -In
addition, the donors were also tested for the presence of anti-HCV
antibodies. The determination of the presence of anti-HCV
antibodies was determined using a radioimmunoassay as described in
Section IV.K. The results of the study are presented in Table 17,
which shows: the patient number (column 1); the presence of
anti-HCV antibodies in patient serum (column 2); the number of
donations received by the patient, with each donation being from a
different donor (column 3); the presence of anti-HCV antibodies in
donor serum (column 4); and the surrogate abnormality of the donor
(column 5) (NT or--means not tested) (ALT is elevated transaminase,
and ANTI-HBC is anti-core antibody).
[0803] The results in Table 17 demonstrate that the HCV antibody
test is more accurate in detecting infected blood donors than are
the surrogate marker tests. Nine out of ten patients who developed
NANBH symptoms tested positive for anti-HCV antibody
seroconversion. Of the 11 suspected donors, (patient 6 received
donations from two different individuals suspected of being NANBH
carriers), 9 were positive for anti-HCV antibodies, and 1 was
borderline positive, and therefore equivocal (donor for patient 1).
In contrast, using the elevated ALT test 6 of the ten donors tested
negative, and using the anticore-antibody test 5 of the ten donors
tested negative. Of greater consequence, though, in three cases
(donors to patients 8, 9, and 10) the ALT test and the ANTI-HBc
test yielded inconsistent results. TABLE-US-00097 TABLE 17
DEVELOPMENT OF ANTI-HCV ANTIBODIES IN PATIENTS RECEIVING BLOOD FROM
DONORS SUSPECTED OF BEING NANBH CARRIERS Anti-HCV Anti-HCV
Surrogate Seroconversion No. of Positive Abnormality* Patient in
Patient Donations/Donors Donor Alt Anti-HBc 1 yes 18 equiv no no 2
yes 18 yes NT yes 3 yes 13 yes no no 4 no 18 no -- -- 5 yes 16 yes
yes yes 6 yes 11 yes(2) no no yes yes 7 yes 15 yes NT no 8 yes 20
yes no yes 9 yes 5 yes yes no 10 yes 15 yes no yes *Same donor as
anti-NANBV Positive
IV.M. Amplification for Cloning of HCV cDNA Sequences Utilizing the
PCR and Primers Derived from Conserved Regions of Flavivirus
Genomic Sequences
[0804] The results presented supra., which suggest that HCV is a
flavivirus or flavi-like virus, allows a strategy for cloning
uncharacterized HCV cDNA sequences utilizing the PCR technique, and
primers derived from the regions encoding conserved amino acid
sequences in flaviviruses. Generally, one of the primers is derived
from a defined HCV genomic sequence, and the other primer which
flanks a region of unsequenced HCV polynucleotide is derived from a
conserved region of the flavivirus genome. The flavivirus genomes
are known to contain conserved sequences within the NS1, and E
polypeptides, which are encoded in the 5'-region of the flavivirus
genome. Corresponding sequences encoding these regions lie upstream
of the HCV cDNA sequence shown in FIG. 26. Thus, to isolate cDNA
sequences derived from this region of the HCV genome, upstream
primers are designed which are derived from the conserved sequences
within these flavivirus polypeptides. The downstream primers are
derived from an upstream end of the known portion of the HCV
cDNA.
[0805] Because of the degeneracy of the code, it is probable that
there will be mismatches between the flavivirus probes and the
corresponding HCV genomic sequence. Therefore a strategy which is
similar to the one described by Lee (1988) is used. The Lee
procedure utilizes mixed oligonucleotide primers complementary to
the reverse translation products of an amino acid sequence; the
sequences in the mixed primers takes into account every codon
degeneracy for the conserved amino acid sequence.
[0806] Three sets of primer mixes are generated, based on the amino
acid homologies found in several flaviviruses, including Dengue-2,4
(D-2,4), Japanese Encephalitis Virus (JEV), Yellow Fever (YF), and
West Nile Virus (WN). The primer mixture derived from the most
upstream conserved sequence (5'-1), is based upon the amino acid
sequence gly-trp-gly, which is part of the conserved sequence
asp-arg-gly-trp-gly-aspN found in the E protein of D-2, JEV, YF,
and WN. The next primer mixture (5'-2) is based upon a downstream
conserved sequence in E protein,
phe-asp-gly-asp-ser-tyr-ileu-phe-gly-asp-ser-tyr-ileu, and is
derived from phe-gly-asp; the conserved sequence is present in D-2,
JEV, YF, and WN. The third primer mixture (5'-3), is based on the
amino acid sequence arg-ser-cys, which is part of the conserved
sequence cys-cys-arg-ser-cys in the NS1 protein of D-2, D-4, JEV,
YF, and WN. The individual primers which form the mixture in 5'-3
are shown in FIG. 45. In addition to the varied sequences derived
from conserved region, each primer in each mixture also contains a
constant region at the 5'-end which contains a sequence encoding
sites for restriction enzymes, HindIII, MboI, and EcoRI.
[0807] The downstream primer, ssc5h20A, is derived from a
nucleotide sequence in clone 5h, which contains HCV cDNA with
sequences with overlap those in clones 14i and 11b. The sequence of
ssc5h20A is TABLE-US-00098 5' GTA ATA TGG TGA CAG AGT CA 3'.
[0808] An alternative primer, ssc5h34A, may also be used. This
primer is derived from a sequence in clone 5h, and in addition
contains nucleotides at the 5'-end which create a restriction
enzyme site, thus facilitating cloning. The sequence of ssc5h34A is
TABLE-US-00099 5' GAT CTC TAG AGA AAT CAA TAT GGT GAC AGA GTC A
3'.
[0809] The PCR reaction, which was initially described by Saiki et
al. (1986), is carried out essentially as described in Lee et al.
(1988), except that the template for the cDNA is RNA isolated from
HCV infected chimpanzee liver, as described in Section IV.C.2., or
from viral particles isolated from HCV infected chimpanzee serum,
as described in Section IV.A.1. In addition, the annealing
conditions are less stringent in the first round of amplification
(0.6M NaCl, and 25.degree. C.), since the part of the primer which
will anneal to the HCV sequence is only 9 nucleotides, and there
could be mismatches. Moreover, if ssc5h34A is used, the additional
sequences not derived from the HCV genome tend to destabilize the
primer-template hybrid. After the first round of amplification, the
annealing conditions can be more stringent (0.066M NaCl, and
32.degree. C.-37.degree. C.), since the amplified sequences now
contain regions which are complementary to, or duplicates of the
primers. In addition, the first 10 cycles of amplification are run
with Klenow enzyme I, under appropriate PCR conditions for that
enzyme. After the completion of these cycles, the samples are
extracted, and run with Taq polymerase, according to kit
directions, as furnished by Cetus/Perkin-Elmer.
[0810] After the amplification, the amplified HCV cDNA sequences
are detected by hybridization using a probe derived from clone 5h.
This probe is derived from sequences upstream of those used to
derive the primer, and does not overlap the sequences of the clone
5h derived primers. The sequence of the probe is TABLE-US-00100 5'
CCC AGC GGC GTA CGC GCT GGA CAC GGA GGT GGC CGC GTC GTG TGG CGG TGT
TGT TCT CGT CGG GTT GAT GGC GC 3'.
IV.N.1. Immunoblot Assay for HCV Antibodies Using HCV Antigens
[0811] The immunoblot assay for HCV employs an immunoblot ELISA
technique for the qualitative detection of antibodies to HCV in
biological specimens. The assay uses three purified recombinant
antigens: the fusion polypeptide, SOD-NANB.sub.5-1-1 (also called
5-1-1); the fusion polypeptide SOD-C33c; the fusion polypeptide HCV
C100-3; and human superoxide dismutase (hSOD). The latter antigen
is included as a control to detect the presence of antibodies
against SOD. The purification procedure for SOD-NANB.sub.5-1-1 is
described below in Section IV.N.1.b.; that for the fusion C100-3
polypeptide is described in Section IV.B.7.b; and that for the C33c
polypeptide is described in Section IV.B.9.
IV.N.1.a. The Immunoblot Assay System for HCV
[0812] In the immunoblot assay system for HCV, the above described
individual recombinant derived HCV antigens are immobilized in
discreet bands on nitrocellulose strips (0.45 microns) by vacuum
blotting solutions of individual antigens. During the incubation of
the strips with the biological specimens, antibodies to HCV, if
present, react with the corresponding antigens coated in bands on
the nitrocellulose strips. After the removal of nonspecific
antibodies by aspiration and washing, the strip is then reacted
with goat anti-human IgG (heavy and light chain specific) labeled
with horseradish peroxidase (HRP). Following incubation,
decantation, and washing to remove excess conjugate,
4-chloro-1-naphthol solution containing hydrogen peroxide is added.
The corresponding intensities of the blue-black colored bands which
develop are proportional to the amount of specific antibody bound
to each of the recombinant proteins on the strips. After the
precipitation reaction is stopped by decantation and washing, the
reactivity of specimens towards each antigen is determined by
visually comparing the intensity of the individual antigen band
with that of the low and high IgG internal controls included on
each strip.
[0813] The reagents utilized in the test are the following. The
conjugate is goat anti-human IgG (heavy and light chain specific)
labeled with HRP in sodium phosphate buffer containing sodium
chloridae and protein stabilizers. The stock substrate is
4-chloro-1-naphthol (3 g/L) in methanol. The developer buffer is
sodium monobasic phosphate (1.3 g) containing sodium chloride (1.17
g/L) and hydrogen peroxide (1 ml/L). The developer buffer contains
sodium monobasic phosphate (13.8 g/L), NaCl (29.2 g/L), casein (1
g/L), EDTA disodium salt (0.34 g/L), Triton X-100 (10 g/L), 10%
thimerosal (1 ml/L), yeast extract (1 g/L), BSA (10 g/L), the first
E. coli extract (20 mg/L) and the second E. coli extract (0.5 g/L).
The HCV antibody positive control is inactivated human serum
containing antibodies to HCV; the serum is inactivated by heat and
psoralen treatment. The HCV antibody negative control is human
serum which does not demonstrate antibodies to HCV. A working
sample diluent for the assay is prepared by weighing out 0.5 gm
nonfat dry milk powder into each 10 ml sample diluent, and mixing
well before use. The working substrate for the assay is prepared by
combining 1 part of the stock substrate with 5 parts of developer
buffer.
[0814] The yeast extract used in the sample diluent is prepared as
follows. Red Star baker's yeast (Universal Foods) is slurried with
an approximately equal amount (weight to volume) of 64 mM Tris HCl,
and the pH is adjusted to 7.0. The yeast is mechanically disrupted
using a glass bead mill (Dynomill) using 0.5 mm nominal diameter
beads, until 95% of the cells are broken. Concentrated sodium
dodecylsulfate (SDS) is added to the lysate to yield a final
concentration of SDS of .about.2.14%. The lysate is then agitated
and heated to 70.degree. C..+-.5.degree. C. for 10 minutes. The
heated lysate is diluted with 3 volumes of buffer containing 67M
Tris HCl, pH 7.0, 2.25% SDS, and is cooled to 20-25.degree. C.
Gross debris is removed from the diluted lysate by centrifugation
using a Westphalia SA1 continuous flow desludging centrifuge at a
feed rate of about 1.5 liters per minute and back pressure of 20-23
psig. The desludge interval is about 3.5 minutes.
[0815] One of the E. coli extracts used in the diluent is comprised
of bacterial proteins which are solubilized during urea treatment
of an insoluble protein fraction. This extract is prepared from a
lysate of strain D1210 cells transformed with the expression vector
pSODcf1 (see Section IV.B.1.). The cells are cultured and pelleted
as described in Section IV.N.7.b., except that the pSODcf1
transformants replace the transformants which harbor pSODcf1
containing the HCV sequence from clone 5-1-1. In order to prepare
the extract, 40 g of pelleted cells are placed into a 500 ml
Beckman bottle, and resuspended in 14.4 ml of TE buffer (10 mM
Tris, pH8.0, 1 mM EDTA). Next, 18 ml of distilled water, 6.8 ml of
lysozyme solution, 0.8 ml of 0.1M PMSF (in ethanol) are added to
the suspension, and it is incubated on ice for 1 hour. After the
incubation, a solution containing 120 ml sterile water, 240
microliters 0.5 M MgCl.sub.2, 180 microliters DNAse I (20,000 u/ml
in distilled water) and 1.2 ml of 0.1M PMSF is added for each 40 g
of cells. The suspension is then sonicated in a Branson Sonifier
450 at setting 1 for 30 seconds and placed on ice for 1 minute;
this cycle is repeated five more times, after which the sonicate is
incubated at room temperature for 15 minutes. The solution is then
sonicated at setting 5 for 30 seconds and placed on ice for 1
minute; this cycle is repeated 3 more times, after which the
sonicate is incubated at room temperature for 15 minutes. This last
cycle of sonication is repeated. After sonication, the sonicate is
centrifuged at 10,000 rpm for 25 minutes. The supernatant is
decanted, and the remaining pellet is extracted with urea as
follows. Using an Omni mixer, the pellet is resuspended in 120 ml
of 6 M urea, 50 mM Tris HCl, pH 8.0, 0.1% beta-mercaptoethanol
(BME). The bottle is attached 0 to a tilt shaker and rocked at
4.degree. C. for four hours. The suspension is then centrifuged at
10,000 rpm for 25 minutes at 4.degree. C. The supernatant
containing urea is dialyzed against a 400-fold volume of buffer
containing 50 mM sodium borate, 0.5 M NaCl, pH 8.4. Dialysis is for
1.5 hours at room temperature, using Spectrapor.RTM. dialysis
tubing with a molecular weight cut-off of 12,000-14,000.
Precipitate in the dialysate is removed by centrifugation at 10,000
rpm for 15 minutes, and the supernatant. is subjected to a repeated
round of dialysis and centrifugation, yielding a supernatant which
is used as the bacterial extract.
[0816] The second E. coli extract used in the diluent is prepared
from non-transformed E. coli cells, and is comprised of proteins in
the soluble fraction of the lysozyme treated bacteria. The extract
is prepared by adding to 15 ml of packed cells the following: 3 ml
of lysozyme (5 mg/ml) in 0.25 M Tris HCl, pH 8.0, 150 microliters
0.1 M PMSF in ethanol, 3.3 ml 0.25 M EDTA, pH 8.0, and 12.5 ml of a
solution containing 1% triton and 0.4% deoxycholate. The cells are
suspended using an Omnimixer, and are broken by mixing for 15-25
minutes at 2-8.degree. C.; if breakage is incomplete (i.e., the
material is not viscous), an additional 150 microliters 0.1M PMSF
is added, and the mixing is continued for an additional 15 to 25
minutes. After cell breakage, 20,000 units of DNAse I in 1 ml water
and 15 ml 0.5 M MgCl.sub.2 are added, and the mixing is continued
for 15 to 25 minutes at room temperature, until the DNA is digested
(i.e., the mixture approaches the viscosity of water. The mixture
is then centrifuged at 17,000.times.G for 20 minutes at 20 to
8.degree. C., and the supernatant is decanted. The supernatant is
then dialyzed against 1 liter of phosphate buffered saline (PBS)
from 8 to 72 hours, using Spectropor tubing with a molecular weight
cutoff of 6,000 to 8,000. The protein concentration of the
dialysate is adjusted to 5 to 15 mg/ml.
[0817] The immunoblot assay is performed by setting up one tube per
sample, each containing a nitrocellulose assay strip. Each strip is
banded with the three aforementioned HCV antigens, with hSOD, and
with two levels of human IgG (internal controls), one of which
yields a weak positive reaction, and one of which yields a moderate
positive reaction. Sufficient working sample diluent is added to
each tube to cover the strip with liquid. An aliquot of the
appropriate specimen or control sample is added to each tube. The
tubes are covered, and inverted to mix, the tubes are placed in a
rocker, and agitated for 4 hours at room temperature. (The motion
of the sample solution over the strips, generated by the rocker, is
important in achieving even band staining and maximum sensitivity).
After the 4 hour incubation, the tubes are uncapped, the liquid
aspirated, and the strips are washed with distilled water, and
transferred to a wash vessel. Following another three washes with
excess distilled water, and removal of the wash by decantation, the
strips are reacted with conjugate (the aliquot added is in excess
of that which is sufficient to cover all of the strips). During the
reaction with conjugate, the vessel containing the strip and
conjugate is agitated on a rotary shaker at approximately 110 rpm
for 30 minutes at room temperature. Excess conjugate is removed by
washing the strips three times with an excess of distilled water,
and the final wash is decanted. An aliquot of working substrate is
added to the wash vessel, and the vessel is agitated on a rotary
shaker at approximately 110 rpm for 15 minutes at room temperature.
After the reaction, the working substrate is decanted off, and the
strips are washed twice with excess distilled water. The strips are
transferred to absorbent paper to blot off the excess water, air
dried for at least twenty minutes at room temperature (protected.
from the light), and read within three hours after completion of
the assay.
IV.N.1.b. Purification of SOD-NANB.sub.5-1-1
[0818] The HCV fusion polypeptide, SOD-NANB.sub.5-1-1 (also called
the 5-1-1 polypeptide), used in the immunoblot assay system for HCV
is purified according to the following procedure.
[0819] The 5-1-1 polypeptide is expressed in recombinant bacteria
D1210 transformed with the vector described in Section IV.B.1.. In
order to prepare an overnight culture of the transformed bacteria,
the cells (about 150 microliters of glycerol stock) were grown in
35 ml of L broth containing 160.+-.15 microliters of 2%
ampicillin); growth is overnight at 37.degree. C. with shaking at
300 rpm. For expression, each 1.5 liters of culture (L broth
containing 6.5.+-.0.25 ml 2% ampicillin) is inoculated with 15 ml
of the overnight culture, and grown at 37.degree. C. in a Fernbach
flask with shaking for 21/2 to 3 hours, until an O.D..sub.650 of
0.80 0.5 is attained; at this time expression is induced by the
addition of 15 ml 200 mM IPTG. After induction, the cells are grown
for 3 hours at 37.degree. C. with shaking. The cells are then
harvested by pelleting in a J6-B centrifuge in a JS5.2 rotor at
3.5K rpm for 15 minutes.
[0820] A 6 M urea extract of the cell pellet is prepared. Five
grams of cell pellet is resuspended in 1.8 ml of TE, and then 2.25
ml sterile water, 0.85 ml lysozyme solution (5 mg/ml in 0.25 M Tris
HCl, pH 8.0), and 100 microliters of 0.1M PMSF in ethanol are
added. The resuspended pellet is incubated on ice for one hour.
After the incubation, 15 ml of distilled water, 30 microliters of
0.5 M MgCl.sub.2, 22.5 microliters DNAse I (20,000 units/ml in
water), and 150 microliters of PMSF are added. The mixture is
sonicated and the insoluble material pelleted using the procedure
for the preparation of the E. coli extract described supra, except
that sonication at setting 1 is repeated for a total of four
times,. and sonication at setting 5 is repeated for a total of two
times. The pellet, which has a volume of .about.1.5 ml is suspended
in 15 ml of solution containing 6M urea, 50 mM Tris HCl, pH 8.0,
and 0.1% BME, using a pipetter and with vortexing. The suspension
is then rocked in a tilt shaker at 4.degree. C. for 4 hours, and
centrifuged at 12,000 rpm for 15 minutes at 4.degree. C.
[0821] The 5-1-1 polypeptide contained in the supernatant from the
above described centrifugation is purified from the urea extract by
passage through a Q Sepharose Fast Flow ion exchange column
(Pharmacia Corp.). A 30 ml column is equilibrated by pumping
through approximately 80 ml of running buffer (6 M urea in 20 mM
Tris HCl, pH 8.0, 1 mM Dithiothreitol (DTT)), or RB, at a speed of
about 2 ml per minute. After the column is equilibrated, the entire
6 M urea extract is loaded onto the column, and is washed in with
approximately 80 ml of running buffer; fractions of 2 ml are
collected during the loading and the washing steps. After the load
is washed into the column, the 5-1-1 polypeptide is eluted using a
0.0 to 0.5 M NaCl gradient in RB. The gradient solution is pumped
over the column at 2 ml per minute; 1 ml fractions are collected;
and the O.D .sub.280 is monitored throughout the load, wash, and
elution. The 5-1-1 polypeptide is expected to elute from the column
approximately two-thirds of the way through the gradient. The
column fractions are analyzed by electrophoresis on 12.5%
polyacrylamide gels containing SDS, and by Western blot using
positive polyclonal antibodies to SOD and/or the 5-1-1 polypeptide
and/or serum samples. The purity of the 5-1-1 polypeptide is
estimated based upon the O.D..sub.280, the Western blot, and the
polyacrylamide gel analysis. Based upon this, appropriate fractions
are pooled, yielding a total volume of .about.30 ml. Each 10 ml of
the pooled material is dialyzed at room temperature against 2
liters of buffer containing 50 mM sodium borate, pH 8.4, 0.5 M
NaCl, 10 mM BME, and 2 mM EDTA for 1.5 hours, with 1 change of
buffer after 1.5 hours; total dialysis time is approximately 3
hours. Protein concentration in the dialysate is determined by the
Lowry method. The purified, dialyzed material is stored at
-70.degree. C.
[0822] The following listed materials are on deposit under the
terms of the Budapest Treaty with the American Type Culture
Collection (ATCC), 12301 Parklawn Dr., Rockville, Md. 20852, and
have been assigned the following Accession Numbers. TABLE-US-00101
lambda-gt11 ATCC No. Deposit Date HCV cDNA library 40394 1 Dec.
1987 clone 81 40388 17 Nov. 1987 clone 91 40389 17 Nov. 1987 clone
1-2 40390 17 Nov. 1987 clone 5-1-1 40391 18 Nov. 1987 clone 12f
40514 10 Nov. 1988 clone 35f 40511 10 Nov. 1988 clone 15e 40513 10
Nov. 1988 clone K9-1 40512 10 Nov. 1988 JSC 308 20879 5 May 1988
pS356 67683 29 Apr. 1988
[0823] In addition, the following deposits were made on 11 May
1989. TABLE-US-00102 Strain Linkers ATCC No. D1210 (Cf1/5-1-1) EF
67967 D1210 (Cf1/81) EF 67968 D1210 (Cf1/CA74a) EF 67969 D1210
(Cf1/35f) AB 67970 D1210 (Cf1/279a) EF 67971 D1210 (Cf1/C36) CD
67972 D1210 (Cf1/13i) AB 67973 D1210 (Cf1/C33b) EF 67974 D1210
(Cf1/CA290a) AB 67975 HB101 (AB24/C100 #3R) 67976
[0824] The following derivatives of strain D1210 were deposited on
3May 1989. TABLE-US-00103 Strain Derivative ATCC No. pCF1CS/C8f
67956 pCF1AB/C12f 67952 pCF1EF/14c 67949 pCF1EF/15e 67954
pCF1AB/C25c 67958 pCF1EF/C33c 67953 pCF1EF/C33f 67050 pCF1CD/33g
67951 pCF1CD/C39c 67955 pCF1EF/C40b 67957 pCF1EF/CA167b 67959
[0825] The following biological materials were deposited on May 12,
1989. TABLE-US-00104 Material ATCC No. Lambda gt11(C35) 40603
Lambda gt10(beta-5a) 40602 D1210 (C40b) 67980 D1210 (M16) 67981
[0826] The following biological materials were deposited on Oct.
13, 1989. TABLE-US-00105 Material ATCC No. AB122 20961 Lambda gt11
40678 pAB24/C200-C100 40679 pNS11d-13-15 40680 pC100-d #3 68113
pC22 68114 pS2d #9 68115
[0827] The following biological materials were deposited on Oct.
17, 1989. TABLE-US-00106 Material ATCC No. pCMV-NS1 68125 pMCMV-NS1
68126
Upon allowance and issuance of this application as a United States
Patent, all restriction on availability of these deposits will be
irrevocably removed; and access to the designated deposits will be
available during pendency of the above-named application to one
determined by the Commissioner to be entitled thereto under 37 CFR
1.14 and 35 USC 1.22. Moreover, the designated deposits will be
maintained for a period of thirty (30) years from the date of
deposit, or for five (5) years after the last request for the
deposit; or for the enforceable life of the U.S. patent, whichever
is longer. The deposited materials mentioned herein are intended
for convenience only, and are not required to practice the present
invention in view of the descriptions herein, and in addition these
materials are incorporated herein by reference.
INDUSTRIAL APPLICABILITY
[0828] The invention, in the various manifestations disclosed
herein, has many industrial uses, some of which are the following.
The HCV cDNAs may be used for the design of probes for the
detection of HCV nucleic acids in samples. The probes derived from
the cDNAs may be used to detect HCV nucleic acids in, for example,
chemical synthetic reactions. They may also be used in screening
programs for anti-viral agents, to determine the effect of the
agents in inhibiting viral replication in cell culture systems, and
animal model systems. The HCV polynucleotide probes are also useful
in detecting viral nucleic acids in humans, and thus, may serve as
a basis for diagnosis of HCV infections in humans.
[0829] In addition to the above, the cDNAs provided herein provide
information and a means for synthesizing polypeptides containing
epitopes of HCV. These polypeptides are useful in detecting
antibodies to HCV antigens. A series of immunoassays for HCV
infection, based on recombinant polypeptides containing HCV
epitopes are described herein, and will find commercial use in
diagnosing HCV induced NANBH, in screening blood bank donors for
HCV-caused infectious hepatitis, and also for detecting
contaminated blood from infectious blood donors. The viral antigens
will also have utility in monitoring the efficacy of anti-viral
agents in animal model systems. In addition, the polypeptides
derived from the HCV cDNAs disclosed herein will have utility as
vaccines for treatment of HCV infections.
[0830] The polypeptides derived from the HCV cDNAs, besides the
above stated uses, are also useful for raising anti-HCV antibodies.
Thus, they may be used in anti-HCV vaccines. However, the
antibodies produced as a result of immunization with the HCV
polypeptides are also useful in detecting the presence of viral
antigens in samples. Thus, they may be used to assay the production
of HCV polypeptides in chemical systems. The anti-HCV antibodies
may also be used to monitor the efficacy of anti-viral agents in
screening programs where these agents are tested in tissue culture
systems. They may also be used for passive immunotherapy, and to
diagnose HCV caused NANBH by allowing the detection of viral
antigen(s) in both blood donors and recipients. Another important
use for anti-HCV antibodies is in affinity chromatography for the
purification of virus and viral polypeptides. The purified virus
and viral polypeptide preparations may be used in vaccines.
However, the purified virus may also be useful for the development
of cell culture systems in which HCV replicates.
[0831] Cell culture systems containing HCV infected cells will have
many uses. They can be used for the relatively large scale
production of HCV, which is normally a low titer virus. These
systems will also be useful for an elucidation of the molecular
biology of the virus, and lead to the development of anti-viral
agents. The cell culture systems will also be useful in screening
for the efficacy of antiviral agents. In addition, HCV permissive
cell culture systems are useful for the production of attenuated
strains of HCV.
[0832] For convenience, the anti-HCV antibodies and HCV
polypeptides, whether natural or recombinant, may be packaged into
kits.
[0833] The method used for isolating HCV cDNA, which is comprised
of preapring a cDNA library derived from infected tissue of an
individual, in an expression vector, and selecting clones which
produce the expression products which react immunologically with
antibodies in antibody-containing body components from other
infected individuals and not from non-infected individuals, may
also be applicable to the isolation of cDNAs derived from other
heretofore uncharacterized disease-associated agents which are
comprised of a genomic component. This, in turn, could lead to
isolation and characterization of these agents, and to diagnostic
reagents and vaccines for these other disease-associated
agents.
* * * * *