U.S. patent application number 11/442668 was filed with the patent office on 2006-12-07 for genes regulating circadian clock function and photoperiodism.
This patent application is currently assigned to State of Oregon, the State Board of Higher Education on behalf of the University of Oregon. Invention is credited to Michael F. Covington, Henriette Foss, Karen A. Hicks, Xiang Liang Liu, Michelle T.Z. Spence, Ry Wagner.
Application Number | 20060277633 11/442668 |
Document ID | / |
Family ID | 22259135 |
Filed Date | 2006-12-07 |
United States Patent
Application |
20060277633 |
Kind Code |
A1 |
Wagner; Ry ; et al. |
December 7, 2006 |
Genes regulating circadian clock function and photoperiodism
Abstract
Nucleic acid molecules that encode plant proteins involved in
photoperiodism and circadian rhythms are disclosed. These molecules
may be introduced into plants in order to alter the photoperiodic
and/or circadian clock-based gene expression of the plants.
Inventors: |
Wagner; Ry; (Eugene, OR)
; Hicks; Karen A.; (Mt. Vernon, OH) ; Spence;
Michelle T.Z.; (Capitola, WA) ; Foss; Henriette;
(Eugene, OR) ; Liu; Xiang Liang; (Eugene, OR)
; Covington; Michael F.; (San Diego, CA) |
Correspondence
Address: |
KLARQUIST SPARKMAN, LLP
121 SW SALMON STREET
SUITE 1600
PORTLAND
OR
97204
US
|
Assignee: |
State of Oregon, the State Board of
Higher Education on behalf of the University of Oregon
|
Family ID: |
22259135 |
Appl. No.: |
11/442668 |
Filed: |
May 26, 2006 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
11109077 |
Apr 18, 2005 |
7053182 |
|
|
11442668 |
May 26, 2006 |
|
|
|
10719885 |
Nov 21, 2003 |
6903192 |
|
|
11109077 |
Apr 18, 2005 |
|
|
|
09746801 |
Dec 20, 2000 |
6689940 |
|
|
10719885 |
Nov 21, 2003 |
|
|
|
09513057 |
Feb 24, 2000 |
6433251 |
|
|
09746801 |
Dec 20, 2000 |
|
|
|
PCT/US99/18747 |
Aug 17, 1999 |
|
|
|
09513057 |
Feb 24, 2000 |
|
|
|
60096802 |
Aug 17, 1998 |
|
|
|
Current U.S.
Class: |
800/287 ;
435/419; 435/468; 530/370; 536/23.6 |
Current CPC
Class: |
C12N 15/8237 20130101;
C07K 14/415 20130101; Y02A 40/146 20180101; C12N 15/827 20130101;
C12N 15/8261 20130101 |
Class at
Publication: |
800/287 ;
435/468; 435/419; 530/370; 536/023.6 |
International
Class: |
A01H 1/00 20060101
A01H001/00; C07H 21/04 20060101 C07H021/04; C12N 15/82 20060101
C12N015/82; C12N 5/04 20060101 C12N005/04 |
Claims
1. An isolated nucleic acid molecule, comprising: (i) the
nucleotide sequence set forth as SEQ ID NO: 12 (ii) at least 20
contiguous nucleotides of the sequence shown in SEQ ID NO: 12;
(iii) an isolated nucleic acid molecule that hybridizes with a
nucleic acid probe comprising the sequence shown in SEQ ID NO: 12
under wash conditions of 55.degree. C., 2.times.SSC and 0.1% SDS
for 15 to 30 minutes (iv) an isolated nucleic acid sequence that
hybridizes with a nucleic acid probe comprising the sequence shown
in SEQ ID NO: 12 under wash conditions of 55.degree. C.,
0.2.times.SSC and 0.1% SDS for 15 to 30 minutes; or (v) an isolated
nucleic acid molecule that hybridizes with a nucleic acid probe
comprising the sequence shown in SEQ ID NO: 12 under wash
conditions of 50.degree. C., 2.times.SSC, 0.1% SDS for 3 hours.
2. A recombinant nucleic acid molecule comprising a promoter
sequence operably linked to the nucleic acid sequence according to
claim 1.
3. A cell transformed with the recombinant nucleic acid molecule
according to claim 2.
4. A transgenic plant comprising the recombinant nucleic acid
molecule according to claim 2.
5. The transgenic plant according to claim 4, wherein the plant is
selected from the group consisting of: Arabidopsis, Cardamine,
Medicago, Mimulus, Xanthia, pepper, tomato, carrot, tobacco,
broccoli, cauliflower, cabbage, canola, bean, pea, soybean, rice,
corn, wheat, barley, flax, citrus, cotton, cassava, walnut,
conifers, and ornamental plants.
6-7. (canceled)
8. The recombinant nucleic acid molecule according to claim 2,
wherein the nucleic acid sequence is in antisense orientation
relative to the promoter sequence.
9-26. (canceled)
27. A method of modifying the level of expression of an ELF3
protein in a plant, the method comprising expressing in the plant a
recombinant genetic construct comprising a promoter operably linked
to the nucleic acid molecule of claim 1.
28. The method of claim 27, wherein the nucleic acid molecule is in
antisense orientation relative to the promoter.
29. A method of modifying at least one circadian response of a
plant, the method comprising expressing in the plant a recombinant
genetic construct comprising a promoter operably linked to a
nucleic acid molecule, wherein the nucleic acid molecule comprises
at least 20 consecutive nucleotides of the sequence shown in SEQ ID
NO: 4, SEQ ID NO: 12, SEQ ID NO: 15, SEQ ID NO: 18, SEQ ID NO: 20,
SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID
NO: 28, SEQ ID NO: 30, SEQ ID NO: 32, SEQ ID NO:34, SEQ ID NO: 36,
SEQ ID NO: 38, SEQ ID NO: 40, SEQ ID NO: 42, SEQ ID NO: 44, SEQ ID
NO: 46, SEQ ID NO: 48, SEQ ID NO: 50, SEQ ID NO: 52, SEQ ID NO: 54,
SEQ ID NO: 56, SEQ ID NO: 58, SEQ ID NO: 60, or SEQ ID NO: 62.
30. The method of claim 29, wherein the circadian response is
selected from the group consisting of gene transcription, leaf
movement, photosynthetic ability, stomatal opening, hypocotyl
elongation, and photoperiodic control of flowering.
31. The method of claim 29, wherein the plant is selected from the
group consisting of: Arabidopsis, Cardamine, Medicago, Mimulus,
Xanthia, pepper, tomato, carrot, tobacco, broccoli, cauliflower,
cabbage, canola, bean, pea, soybean, rice, corn, wheat, barley,
flax, citrus, cotton, cassava, walnut, conifers, and ornamental
plants.
32. A method of modifying at least one circadian response of a
plant, the method comprising expressing in the plant a recombinant
genetic construct encoding at least one polypeptide comprising an
Essence of ELF3 Consensus (EEC) region.
33. The method of claim 32, wherein the EEC region is depicted in
FIG. 2.
34. The method of claim 32, wherein the circadian response is
selected from the group consisting of gene transcription, leaf
movement, photosynthetic ability, stomatal opening, hypocotyl
elongation, and photoperiodic control of flowering.
35. The method of claim 32, wherein the plant is selected from the
group consisting of: Arabidopsis, Cardamine, Medicago, Mimulus,
Xanthia, pepper, tomato, carrot, tobacco, broccoli, cauliflower,
cabbage, canola, bean, pea, soybean, rice, corn, wheat, barley,
flax, citrus, cotton, cassava, walnut, conifers, and ornamental
plants.
36. A plant modified by the method of claim 32.
37. The isolated nucleic acid molecule of claim 1, wherein the
nucleic acid molecule encodes a protein having ELF3 protein
biological activity.
Description
CROSS REFERENCE TO RELATED CASES
[0001] This is a continuation of co-pending U.S. patent application
Ser. No. 11/109,077 filed Apr. 18, 2005, which is a division of
U.S. patent application Ser. No. 10/719,885 filed Nov. 21, 2003,
now U.S. Pat. No. 6,903,192, which is a division of U.S. patent
application Ser. No. 09/746,801, filed Dec. 20, 2000, now U.S. Pat.
No. 6,689,940, which is a continuation-in-part of application Ser.
No. 09/513,057, filed Feb. 24, 2000, now U.S. Pat. No. 6,433,251,
which is a continuation-in-part of International Application No.
PCT/US99/18747, filed Aug. 17, 1999, which claims the benefit of
Provisional Application No. 60/096,802, filed Aug. 17, 1998. All of
these applications are incorporated herein in their entirety.
FIELD OF THE INVENTION
[0002] This invention relates to genes that regulate circadian
clock functions and photoperiodism in plants, and relates in
particular to the ELF3 gene. Aspects of the invention include the
purified ELF3 gene product (ELF3 protein), as well as nucleic acid
molecules encoding this gene product. Nucleic acid vectors,
transgenic cells, and transgenic plants having modified ELF3
activity are also provided.
INCORPORATION-BY-REFERENCE OF MATERIAL SUBMITTED ON COMPACT
DISC
[0003] A Sequence Listing is provided in electronic format only on
compact discs, as permitted under 37 CFR 1.52(e) and 1.821(c). The
discs (copy 1 and copy 2) contain the file entitled "Sequence
Listing.txt" (218 KB). The material on these discs is hereby
incorporated by reference in its entirety.
BACKGROUND OF THE INVENTION
[0004] Shoot development in flowering plants is a continuous
process ultimately controlled by the activity of the shoot apical
meristem. Apical meristem activity during normal plant development
is sequential and progressive, and can be summarized as a series of
overlapping phases: vegetative.fwdarw.inflorescence.fwdarw.floral
(V.fwdarw.I.fwdarw.F). Over the past 50 years many models have been
proposed for the control of the vegetative-to-floral transition.
These models range from simple single pathway models to complex
multiple pathway models, and are largely based on physiological
studies (for review, see Bernier, 1988). Modern techniques provide
researchers with genetic and molecular methods that can be used to
further investigate the control of V.fwdarw.I.fwdarw.F
transitions.
[0005] One such modern technique now routinely practiced by plant
molecular biologists is the production of transgenic plants
carrying a heterologous gene sequence. Methods for incorporating an
isolated gene sequence into an expression cassette, producing plant
transformation vectors, and transforming many types of plants are
well known. Examples of the production of transgenic plants having
modified characteristics as a result of the introduction of a
heterologous transgene include: U.S. Pat. No. 5,268,526
(modification of phytochrome expression in transgenic plants); U.S.
Pat. No. 5,719,046 (production of herbicide resistant plants by
introduction of bacterial dihydropteroate synthase gene); U.S. Pat.
No. 5,231,020 (modification of flavenoids in plants); U.S. Pat. No.
5,583,021 (production of virus resistant plants); and U.S. Pat.
Nos. 5,767,372 and 5,500,365 (production of insect resistant plants
by introducing Bacillus thuringiensis genes).
[0006] Light quality, photoperiod, and temperature often act as
important, and for some species essential, environmental cues for
the initiation of flowering. However, there is very little
information on the molecular mechanisms that directly regulate the
developmental pathway from reception of the inductive light
signal(s) to the onset of flowering and the initiation of floral
meristems. The analysis of floral transition mutants in pea (Pisum
sativum) (see Murfet, 1985) and Arabidopsis (see Koornneef et al.,
1991) has demonstrated that at least part of the genetic hierarchy
controlling flowering onset is responsive to the number of hours of
light perceived by a plant within a 24 hour light/dark cycle. The
monitoring of the length of the light period is referred to as the
photoperiodic response. Photoperiodic responses have long been
thought to be tied to one or more biological clocks that regulate
many physiological and developmental processes on the basis of an
endogenous circadian rhythm.
[0007] Many important physiological and developmental plant
processes are influenced by circadian rhythms. These include the
induction of gene transcription, leaf movement, stomatal opening,
and the photoperiodic control of flowering. While the relationship
of these plant processes to the circadian rhythm has long been
recognized, the genetic analysis of circadian rhythms in plants has
only recently begun. Most of the genetic analysis of circadian
regulation has been performed with Drosophila and Neurospora
crassa, where mutational studies have led to the isolation of the
per and frq genes, respectively (Hall, 1990; Dunlap, 1993). These
genes are thought to encode components of the circadian oscillator,
in part because, while null alleles cause arrhythmic responses,
alleles of these genes exist that produce either long or short
period responses. Transcriptional production of per and frq mRNA
cycles on a twenty-four hour period, and both genes regulate their
own expression (Edery et al., 1994; Aronson et al., 1994).
[0008] Arabidopsis is a quantitative long-day (LD) plant--wild-type
plants will initiate flowering more quickly when grown under LD
light conditions than when grown under short-day (SD) light
conditions. In order to identify genes required for floral
initiation and development, populations of Arabidopsis thaliana
ecotype Columbia grown in SD conditions have been screened for
early-flowering mutants. Isolated mutants were then examined for
additional shoot development anomalies, and those with discreet
shoot phenotypes related to meristem function or light perception
were considered for further analysis. Such mutants may identify
genes that are part of functionally redundant pathways that
operate, to varying degrees, as "fail-safe" mechanisms for ensuring
shoot growth and reproductive development. Examples of such
functionally redundant pathways have been described in studies of
Drosophila (e.g., Hulskamp et al., 1990) and C. elegans (e.g.,
Lambie and Kimble, 1991). The key genes identified by these
Arabidopsis screens were the TERMINAL FLOWER 1 (TFL1) gene and the
EARLY-FLOWERING 3 (ELF3) gene (Shannon and Meeks-Wagner, 1991;
Zagotta et al., 1992).
[0009] The early-flowering (elf3) mutant of Arabidopsis is
insensitive to photoperiod with regard to floral initiation. Plants
homozygous for a mutation in the ELF3 locus flower at the same time
in LD and SD growth conditions, whereas floral initiation of
wild-type plants is promoted by LD growth conditions (Zagotta et
al., 1992; Zagotta et al., 1996). In LD conditions, the flowering
time of the elf3-1 heterozygote is intermediate between wild-type
and the homozygous mutant. In addition to being
photoperiod-insensitive, all elf3 mutants display the long
hypocotyl phenotype characteristic of plants defective in light
reception or the transduction of light signals (Zagotta et al.,
1992; Zagotta et al., 1996). The majority of long hypocotyl mutants
that have been identified are defective in red light-mediated
inhibition of hypocotyl elongation. In contrast, elf3 mutants are
primarily defective in blue light-dependent inhibition of hypocotyl
elongation, although they are also partially deficient in red
light-dependent inhibition of hypocotyl elongation (Zagotta et al.,
1996).
[0010] The availability of the ELF3 gene would facilitate the
production of transgenic plants having altered circadian clock
function and programmed photoperiodic responses. It is to such a
gene that the present invention is directed.
SUMMARY OF THE INVENTION
[0011] The invention provides an isolated ELF3 gene from
Arabidopsis that is shown to complement the elf3
photoperiod-insensitive flowering and elongated hypocotyl defects
when introduced into elf3 mutant plants.
[0012] One aspect of this invention is a purified protein having
ELF3 protein biological activity. The prototypical Arabidopsis ELF3
protein has the amino acid sequence shown in SEQ ID NO: 2. Variants
of this protein that differ from SEQ ID NO: 2 by one or more
conservative amino acid substitutions are also provided, as are
homologs of the ELF3 protein. Such homologs typically share at
least 60% sequence identity with the sequence shown in SEQ ID NO:
2. Nucleic acid molecules encoding these proteins are also part of
this invention. Such nucleic acid molecules include those having
the nucleotide sequences set forth in SEQ ID NO: 1, SEQ ID NO: 3,
and SEQ ID NO:4.
[0013] Recombinant nucleic acid molecules in which a promoter
sequence is operably linked to any of these ELF3 protein-encoding
nucleic acid sequences are further aspects of this invention. The
invention also provides cells transformed with such a recombinant
nucleic acid molecule and transgenic plants comprising the
recombinant nucleic acid molecule. Such transgenic plants may be,
for instance, Arabidopsis, pepper, tomato, tobacco, broccoli,
cauliflower, cabbage, canola, bean, soybean, rice, corn, wheat,
barley, citrus, cotton, cassava and walnut, trees such as poplar,
oak, maple, pine, spruce, and other conifers, and ornamental plants
(e.g., petunias, orchids, carnations, roses, impatiens, pansies,
lilies, snapdragons, geraniums, and so forth).
[0014] A further aspect of this invention is an isolated nucleic
acid molecule or oligonucleotide comprising 15, 20, 30, 50, or 100
contiguous nucleotides of the sequence shown in SEQ ID NOs: 1, 3,
or 4. Such nucleic acid molecules or oligonucleotides may be
operably linked to a promoter sequence, and may be in the sense or
antisense orientation in relation to such a promoter. The invention
also includes cells and plants transformed with such recombinant
nucleic acid molecules, with or without an attached promoter.
[0015] Further embodiments of this invention include isolated
nucleic acid molecules that hybridize under specified hybridization
conditions to the nucleic acid sequence set forth in SEQ ID NO: 1,
and that encode a protein having ELF3 protein biological activity.
Closely related ELF3 gene homologs may be detected by hybridization
under stringent conditions, whereas less closely related homologs
may be detected by hybridization at low stringency. Appropriate
wash conditions for stringent hybridization may be 55.degree. C.,
0.2.times.SSC and 0.1% SDS for 1 hour. Appropriate wash conditions
for low stringency hybridization may be 50.degree. C., 2.times.SSC,
0.1% for 3 hours. Such a hybridizing isolated nucleic acid molecule
may be operably linked to a promoter for expression in plants.
Cells transformed with such a recombinant nucleic acid molecule,
and transgenic plants that comprise such a molecule, are also
provided.
[0016] The invention also provides the 5' regulatory region of the
ELF3 gene. This regulatory region, or parts thereof, may be used to
obtain ELF3-like circadian-rhythm expression of particular genes.
For example, the ELF3 5' regulatory region may be operably linked
to an open reading frame of a gene of interest, and the resulting
recombinant construct may be introduced into a plant by
transformation. One embodiment of an ELF3 regulatory region is
about nucleotides 1 through about 1900 of the 5' upstream region
shown in SEQ ID NO: 5.
BRIEF DESCRIPTION OF THE DRAWINGS
[0017] FIG. 1. Sequence comparison of ELF3 homologs.
[0018] Multiple-sequence alignment of ELF3 (residues 1-695 of SEQ
ID NO: 2) and several putative ELF3 homologs from Arabidopsis
thaliana (Essence of ELF3 Consensus, EEC) (residues 1-540 of SEQ ID
NO: 33) and other plant species (Cardamine oligosperma (residues
1-577 of SEQ ID NO: 13), tomato (residues 1-179 of SEQ ID NO. 24
and residues 1-389 of SEQ ID NO: 23), rice (residues 1-760 of SEQ
ID NO: 27), and maize (residues 117-247 of SEQ ID NO: 29)). Protein
designations are given on the left in the same order. Amino acid
residues are numbered on the right. Residues shaded in black
indicate identity of at least three ELF3/ELF3-related sequences in
the alignment; light-shaded residues indicate similarity to
consensus. Nucleotide sequences from C. oligosperma (a member of
the family Brassicaceae) were obtained by sequencing polymerase
chain reaction products using degenerate oligos to the Arabidopsis
ELF3 gene and genomic DNA or cDNA prepared from C. oligosperma
seedlings. Sequences were aligned and analyzed using CLUSTAL W (J.
D. Thompson, D. G. Higgins, T. Gibson, Nucleic Acids Res. 22,
4673-80, 1994) and PrettyBox (Genetics Computer Group, Inc.,
Madison, Wis.).
[0019] FIG. 2. Sequence comparison of ELF3 homologs showing
consensus boxes.
[0020] Multiple-sequence alignment shows four highly conserved
regions within ELF3 and putative ELF3 homologs from Arabidopsis
thaliana (Essence of ELF3 Consensus, EEC) and other plant species
(Cardamine oligosperma, tomato, rice, and maize). Protein
designations are given on the left in the same order. Amino acid
residues are numbered on both the right and left. Residues shaded
in black indicate identity of at least three ELF3/ELF3-related
sequences in the alignment; light-shaded residues indicate
similarity to consensus. Sequences were aligned and analyzed using
CLUSTAL W (J. D. Thompson, D. G. Higgins, T. Gibson, Nucleic Acids
Res. 22, 4673-80, 1994) and PrettyBox (Genetics Computer Group,
Inc., Madison, Wis.).
[0021] GenBank accession numbers for ELF3 and putative ELF3
homologs are as follows: AtELF3 (A. thaliana genomic DNA: AC004747,
published Dec. 17, 1999), AtEEC (A. thaliana genomic DNA: AB023045,
published Nov. 20, 1999), cELF3 (yet to be submitted), tELF3
[Lycopersicon esculentum Expressed Sequence Tags (ESTs) from
Clemson University Genomics Institute: AW093790 (Oct. 18, 1999),
AI894513 (Jul. 27, 1999), AI488927 (Jun. 29, 1999), AI486934 (Jun.
29, 1999), AI894398 (Jul. 27, 1999)], rELF3 (Oryza sativa genomic
DNA: AP000399, published Dec. 3, 1999), mELF3 (Zea mays EST from
Stanford University Genome Center: AI637184, published Apr. 26,
1999).
[0022] In Block I, the "AtELF3" amino acid sequence corresponds to
residues 13-49 of SEQ ID NO: 2; the "AtEEC" amino acid sequence
corresponds to residues 15-51 of SEQ ID NO: 33; the "cardamineELF3"
amino acid sequence corresponds to residues 1349 of SEQ ID NO: 13;
the "tomatoELF3" amino acid sequence corresponds to residues 13-49
of SEQ ID NO: 24; and the "riceELF3" amino acid sequence
corresponds to residues 22-59 of SEQ ID NO: 27.
[0023] In Block II, the "AtELF3" amino acid sequence corresponds to
residues 317-365 of SEQ ID NO: 2; the "AtEEC" amino acid sequence
corresponds to residues 238-286 of SEQ ID NO: 33; the "cELF3" amino
acid sequence corresponds to residues 291-339 of SEQ ID NO: 13; the
"tELF3" amino acid sequence corresponds to residues 22-70 of SEQ ID
NO: 23; the "rELF3" amino acid sequence corresponds to residues
394-442 of SEQ ID NO: 27; and the "maizeELF3" amino acid sequence
corresponds to residues 22-70 of SEQ ID NO: 57.
[0024] In Block III, the "AtELF3" amino acid sequence corresponds
to residues 462486 of SEQ ID NO: 2; the "ATEEC" amino acid sequence
corresponds to residues 358-379 of SEQ ID NO: 33; the "cELF3" amino
acid sequence corresponds to residues 441-464 of SEQ ID NO: 13; the
"tELF3" amino acid sequence corresponds to residues 167-189 of SEQ
ID NO: 23; the "rELF3" amino acid sequence corresponds to residues
544-565 of SEQ ID NO: 27; and the "mELF3" amino acid sequence
corresponds to residues 162-178 of SEQ ID NO: 57.
[0025] In Block IV, the "AtELF3" amino acid sequence corresponds to
residues 660-687 of SEQ ID NO: 2; the "AtEEC" amino acid sequence
corresponds to residues 505-532 of SEQ ID NO: 33; the "cELF3" amino
acid sequence corresponds to residues 639-653 of SEQ ID NO: 14; the
"tELF3" amino acid sequence corresponds to residues 358-385 of SEQ
ID NO: 23; the "rELF3" amino acid sequence corresponds to residues
729-756 of SEQ ID NO: 27; and the "mELF3" amino acid sequence
corresponds to residues 285-312 of SEQ ID NO: 57.
[0026] FIG. 3 is a Table showing growth and flowering
characteristics of Arabidopsis seedlings over-expressing ELF3
(ELF3-OX), seedlings that are mutant in ELF3 (elf3-1).
[0027] FIG. 4 shows the features of the predicted 695 amino acid
ELF3 protein, and the molecular basis of the several elf3
mutations.
SEQUENCE LISTING
[0028] The nucleic and amino acid sequences listed in the
accompanying sequence listing are shown using standard letter
abbreviations for nucleotide bases, and three letter code for amino
acids. Only one strand of each nucleic acid sequence is shown, but
the complementary strand is understood as included by any reference
to the displayed strand.
[0029] SEQ ID NO: 1 shows the cDNA and amino acid sequence of
Arabidopsis ELF3.
[0030] SEQ ID NO: 2 shows the amino acid sequence of Arabidopsis
ELF3 protein.
[0031] SEQ ID NO: 3 shows the genomic sequence of Arabidopsis ELF3.
The sequence comprises the following regions: TABLE-US-00001
Nucleotides Feature 1-142 promoter region 143-424 exon 1 (5' UTR)
425-644 exon 1 continued (initiating ATG at 425) 645-1006 intron 1
1007-1803 exon 2 1804-2983 intron 2 2984-3037 exon 3 3038-3127
intron 3 3128-4142 exon 4 4143-4145 stop codon 4146-4221 3' UTR and
3' regulatory region.
[0032] SEQ ID NO: 4 shows the DNA and corresponding amino acid
sequence of the Arabidopsis ELF3 ORF.
[0033] SEQ ID NO: 5 shows the 4071 base pair Arabidopsis ELF3 5'
regulatory region.
[0034] SEQ ID NO: 6-11 show primers that can be used to amplify
certain portions of the Arabidopsis ELF3 sequence.
[0035] SEQ ID NO: 12 shows the cDNA and corresponding amino acid
sequence of the Cardamine oligosperma ELF3 ortholog, cELF3. This
sequence can also be determined by applying well known computer
analyses to the genomic sequence shown in SEQ ID NO: 14 (also
referred to as COELF3.about.1) to determine where the introns and
exons are.
[0036] SEQ ID NO: 13 (also referred to as COELF3.about.2) shows the
amino acid sequence of the Cardamine oligosperma ELF3 ortholog,
cELF3.
[0037] SEQ ID NO: 14 (also referred to as COELF3.about.1) shows the
genomic sequence of the Cardamine oligosperma ELF3 ortholog,
cELF3.
[0038] SEQ ID NO: 15 shows a partial DNA sequence (also referred to
as PEAELF.about.2) of the pea ELF 3 ortholog.
[0039] SEQ ID NO: 16 (also referred to as PEAELF.about.1) shows the
amino acid sequence of the partial pea ELF 3 ortholog.
[0040] SEQ ID NO: 17 (also referred to as BROCCA.about.2) shows the
amino acid sequence of the broccoli/cauliflower EEC protein.
[0041] SEQ ID NO: 18 shows a partial DNA (also referred to as
GMELF3.about.2) sequence of the Glycine max (soybean) ELF3 coding
region.
[0042] SEQ ID NO: 19 (also referred to as GMELF3.about.1) shows the
amino acid sequence of the partial Glycine max (soybean) ELF3
protein.
[0043] SEQ ID NO: 20 shows the DNA (also referred to as
BROCCA.about.1) a sequence of the Lycopersicon esculentum (tomato)
ELF3 (N-terminus #2) coding region.
[0044] SEQ ID NO: 21 shows the DNA (also referred to as
LEAFFO.about.1) sequence of the Lycopersicon esculentum (tomato)
ELF3 (N-terminus #1) coding region.
[0045] SEQ ID NO: 22 shows the DNA (also referred to as
LE5B39.about.1) sequence of the Lycopersicon esculentum (tomato)
coding region.
[0046] SEQ ID NO: 23 (also referred to as LEELF3.about.3) shows the
amino acid sequence of the Lycopersicon esculentum (tomato) ELF3
(C-terminus) coding region.
[0047] SEQ ID NO: 24 (also referred to as LEELF.about.2) shows a
partial amino acid sequence of the Lycopersicon esculentum (tomato)
protein.
[0048] SEQ ID NO: 25 (also referred to as LEELF3.about.1) shows the
amino acid sequence of the Lycopersicon esculentum (tomato) ELF3
(N-terminus #2) protein.
[0049] SEQ ID NO: 26 shows the DNA (also referred to as
OSELF3.about.2) sequence of the Oryza sativa (rice) ELF3 genomic
region.
[0050] SEQ ID NO: 27 (also referred to as OSELF3.about.1) shows the
amino acid sequence of the Oryza sativa (rice) ELF3 protein.
[0051] SEQ ID NO: 28 shows a partial DNA (also referred to as
ZM8CC4.about.1) sequence of the Zea mays (maize) ELF3 coding
region.
[0052] SEQ ID NO: 29 (also referred to as ZMELF3.about.2) shows the
amino acid sequence of the partial Zea mays (maize) ELF3
protein.
[0053] SEQ ID NO: 30 shows a partial DNA (also referred to as
ZMELF3.about.4) sequence of the Zea mays (maize) ELF3 #2 coding
region.
[0054] SEQ ID NO: 31 (also referred to as ZMELF3.about.3) shows the
amino acid sequence of the partial Zea mays (maize) ELF3 #2 coding
region.
[0055] SEQ ID NO: 32 shows the DNA (also known as ATEECG.about.1)
of the Arabidopsis thaliana EEC genomic region.
[0056] SEQ ID NO: 33 (also known as ATEECP.about.1) shows the amino
acid sequence of the Arabidopsis thaliana EEC protein.
[0057] SEQ ID NO: 34 shows the DNA (also known as ATELF3.about.1)
sequence of the Arabidopsis thaliana ELF3 genomic region.
[0058] SEQ ID NO: 35 (also known as ATELF3.about.2) shows the amino
acid sequence of the Arabidopsis thaliana ELF3 protein.
[0059] SEQ ID NO: 36 (also known as MTELF3N1) shows a portion of
exon 1, including 5'UTR and start codon, of the Medicago trunculata
ELF3 cDNA nucleotide sequence. This partial sequence was originally
reported in Genbank Accession No. AW690413.
[0060] SEQ ID NO: 37 (also known as MTELF3P1) shows the peptide
portion of the Medicago trunculata ELF3 protein encoded for by SEQ
ID NO: 36.
[0061] SEQ ID NO: 38 (also known as MTELF3N4) shows a portion of
exon 4, including stop codon and 3'UTR, of the Medicago trunculata
ELF3 nucleotide sequence. This partial sequence was originally
reported as Genbank Accession No. AW693560.
[0062] SEQ ID NO: 39 (also known as MTELF3P4) shows the peptide
portion of the Medicago trunculata ELF3 protein encoded for by SEQ
ID NO: 38.
[0063] SEQ ID NO: 40 (also known as PSELF3N3) shows a portion of
exon 3 to exon 4 of the Pisum sativa genomic DNA encoding ELF3.
[0064] SEQ ID NO: 41 (also known as PSELF3P3) shows the peptide
portion of the Pisum sativa ELF3 protein encoded for by SEQ ID
NO:40.
[0065] SEQ ID NO: 42 (also known as PSELF3N4) shows a portion of
exon 4 of the Pisum sativa genomic DNA encoding ELF3.
[0066] SEQ ID NO: 43 (also known as PSELF3P4) shows the peptide
portion of the Pisum sativa ELF3 protein encoded for by SEQ ID NO:
42.
[0067] SEQ ID NO: 44 (also known as GMELF3N) shows a portion of the
Glycine max cDNA encoding ELF3. This partial sequence was
originally reported in Genbank Accession No. AW757137.
[0068] SEQ ID NO: 45 (also known as GMELF3P) shows the peptide
portion of the Glycine max ELF3 protein encoded for by SEQ ID NO:
44.
[0069] SEQ ID NO: 46 (also known as XELF3N1) shows a portion of the
Xanthium genomic DNA (from exon 3 to exon 4) encoding ELF3.
[0070] SEQ ID NO: 47 (also known as XELF3P1) shows the peptide
portion of the Xanthium ELF3 protein encoded for by SEQ ID NO:
46.
[0071] SEQ ID NO: 48 (also known as XELF3N2) shows a portion of the
Xanthium genomic DNA (from exon 3 to exon 4) encoding ELF3.
[0072] SEQ ID NO: 49 (also known as XELF3P2) shows the peptide
portion of the Xanthium ELF3 protein encoded for by SEQ ID NO:
48.
[0073] SEQ ID NO: 50 (also known as XELF3N4) shows a portion of the
Xanthium genomic DNA (a portion of exon 4) encoding ELF3.
[0074] SEQ ID NO: 51 (also known as XELF3P4) shows the peptide
portion of the Xanthium ELF3 protein encoded for by SEQ ID NO:
50.
[0075] SEQ ID NO: 52 (also known as POPELF3N) shows a portion of
the Poplar genomic DNA (a portion of exon 4) encoding ELF3.
[0076] SEQ ID NO: 53 (also known as POPELF3P) shows the peptide
portion of the Poplar ELF3 protein encoded for by SEQ ID NO:
52.
[0077] SEQ ID NO: 54 (also known as MIMELF3N) shows a portion of
the Mimulus genomic DNA (a portion of exon 4) encoding ELF3.
[0078] SEQ ID NO: 55 (also known as MIMELF3P) shows the peptide
portion of the Mimulus ELF3 protein encoded for by SEQ ID NO:
54.
[0079] SEQ ID NO: 56 (also known as ZMELF3N) shows a portion of the
Zea mays contig of cDNA/genomic DNA (exon 2, exon 3, intronic
sequence, and exon 4, including stop codon and 3'UTR) encoding
ELF3. This partial sequence was originally reported in Genbank
Accession No. AI637184.
[0080] SEQ ID NO: 57 (also known as ZMELF3P) shows the peptide
portion of the Zea mays ELF3 protein encoded for by SEQ ID NO:
56.
[0081] SEQ ID NO: 58 (also known as LEELF3-AN) shows a portion of
the Lycopersicon esculentum cDNA (exon 1, exon 2, exon 3, and exon
4, including stop codon and 3'UTR) encoding ELF3.
[0082] SEQ ID NO: 59 (also known as LEELF3-AP) shows the peptide
portion of the Lycopersicon esculentum ELF3 protein encoded for by
SEQ ID NO: 58.
[0083] SEQ ID NO: 60 (also known as BRELF3AN) shows a portion of
the Broccoli genomic DNA (portion of exon 1, exon 2, exon 3, and
portion of exon 4) encoding ELF3.
[0084] SEQ ID NO: 61 (also known as BRELF3AP) shows the peptide
portion of the Broccoli ELF3 protein encoded for by SEQ ID NO:
60.
[0085] SEQ ID NO: 62 (also known as BRELF3BN) shows a portion of
the Broccoli genomic DNA (a portion of exon 4) encoding ELF3.
[0086] SEQ ID NO: 63 (also known as BRELF3BP) shows the peptide
portion of the Broccoli ELF3 protein encoded for by SEQ ID NO:
62.
[0087] SEQ ID NOs: 64-68 (also known as C-FWD, D-REV, B-FWD,
PeAIb-C-FWD, and C-REV, respectively) show primers used to amplify
ELF3 homologous sequences.
DETAILED DESCRIPTION OF THE INVENTION
I. Definitions
[0088] Unless otherwise noted, technical terms are used according
to conventional usage. Definitions of common terms in molecular
biology may be found in Benjamin Lewin, Genes V, published by
Oxford University Press, 1994 (ISBN 0-19-854287-9); Kendrew et al.
(eds.), The Encyclopedia of Molecular Biology, published by
Blackwell Science Ltd., 1994 (ISBN 0-632-02182-9); and Robert A.
Meyers (ed.), Molecular Biology and Biotechnology: a Comprehensive
Desk Reference, published by VCH Publishers, Inc., 1995 (ISBN
1-56081-569-8).
[0089] In order to facilitate review of the various embodiments of
the invention, the following definitions of terms are provided:
[0090] ELF3 gene/ELF3 cDNA: Nucleic acid molecules that encode an
ELF3 protein. Nucleic acid molecules that encode the Arabidopsis
ELF3 protein are provided in SEQ ID NO: 3 (Arabidopsis ELF3 gene),
SEQ ID NO: 1 (Arabidopsis ELF3 cDNA) and SEQ ID NO:4 (Arabidopsis
ELF3 open reading frame). The invention includes not only the
nucleic acid molecules provided in SEQ ID NOS: 1, 3 and 4, but also
homologs and orthologs of these sequences, other nucleic acid
molecules that encode ELF3 proteins, and probes and primers that
are derived from these sequences.
[0091] elf3 mutant: The early-flowering (elf3) mutant of
Arabidopsis is insensitive to photoperiod with regard to floral
initiation (Zagotta et al., 1992; Zagotta et al., 1996). In
addition to being photoperiod-insensitive, all Arabidopsis efl3
mutants display the long-hypocotyl phenotype characteristic of
plants defective in light reception or the transduction of light
signals (Zagotta et al., 1992; Zagotta et al., 1996). Elf3 mutants
are primarily defective in blue light-dependent inhibition of
hypocotyl elongation, although elf3 mutants are also partially
deficient in red light-dependent inhibition of hypocotyl elongation
(Zagotta et al., 1996).
[0092] ELF3 protein: A protein having ELF3 protein biological
activity and sharing amino acid sequence identity with the amino
acid sequence of the prototypical ELF3 protein shown in SEQ ID NO:
2 (the Arabidopsis ELF3 protein). ELF3 proteins that are more
distantly related to the prototypical ELF3 protein will share at
least 60% amino acid sequence identity with the sequence shown in
SEQ ID NO: 2, as determined by the methods described below. More
closely related ELF3 proteins may share at least 70%, 75% or 80%
sequence identity with the Arabidopsis ELF3 protein. ELF3 proteins
that are most closely related to the Arabidopsis protein will have
ELF3 protein biological activity and share at least 85%, 90% or 95%
sequence identity with the Arabidopsis protein.
[0093] ELF3 protein biological activity: The ability of a protein
to complement an elf3 mutant. The ability of a protein to
complement an elf3 mutant may be readily determined by introducing
the gene encoding the protein into an elf3 mutant plant using
standard methods. If the encoded protein has ELF3 protein
biological activity, this will be manifested as a proportion of the
transgenic progeny plants having a wild-type phenotype for those
characteristics linked to the elf3 mutant (e.g.,
photoperiod-insensitive flowering and elongated hypocotyl).
[0094] ELF3 promoter: The region of nucleic acid sequence upstream
(5') of the ELF3 coding sequence that is responsible for spatial
and temporal regulation of ELF3 transcription. ELF3 transcription
is circadian regulated, but with an RNA maximum that is "later" in
the 24-hour period than that of other known circadian genes, e.g.,
CAB, CCR2, CCAIand LHY (Wang and Tobin, 1998; Schaffer et al.,
1998). ELF3-like circadian rhythm or cyclic transcriptional
regulation refers to this type of a relatively delayed
transcription maximum. Because ELF3 transcription reaches a maximal
level relatively late in the 24-hour period, the ELF3 promoter will
allow for altering the setting of the circadian clock. For
instance, if another circadian-regulated gene (e.g., chlorophyll
a/b binding protein) is expressed from the ELF3 promoter, the
circadian set on this protein will be delayed to match that of
ELF3. In addition, the ELF3 promoter may be used to provide altered
expression of other genes that are under control of the circadian
clock, if clock components and/or regulators such as CCA 1 and LHY
are driven by the ELF3 promoter instead of their own promoters or a
constitutive promoter, for instance the 35S promoter.
[0095] The ELF3 promoter region is contained within the 4071 kb 5'
regulatory region sequence shown in SEQ ID NO: 5, but one of
ordinary skill in the art will appreciate that expression may be
controlled by using less than this entire 5' upstream region, e.g.,
nucleotides 500-4071, 1000-4071, 1500-4071, 20004071, 2500-4071,
3000-4071, 3500-4071 or 4000-4071. One embodiment of an ELF3
promoter is about nucleotides 1 through about 1900 of the 5'
upstream region shown in SEQ ID NO: 5.
[0096] Sequences as short as 50 or 100 nucleotides from within the
5' regulatory region may also be employed. The degree to which such
a sequence provides for ELF3-like circadian cyclic transcriptional
regulation, when included in an expression vector, can be
ascertained by the methods described herein. Thus, the term
"biologically active ELF3 promoter" refers to a 5' regulatory
region of an ELF3 gene, or a part or a variant of such a region,
that, when operably linked to the 5' end of an ORF and introduced
into a plant, results in ELF3-like (i.e., relatively late)
circadian cyclic transcript expression of the protein encoded by
the ORF.
[0097] Essence of ELF3 Consensus (EEC): One or more highly
conserved regions of amino acid sequence within an ELF3 protein or
ELF3 protein homolog. EECs are depicted in FIGS. 1 and 2.
[0098] Oligonucleotide: A linear polynucleotide sequence of up to
about 100 nucleotide bases in length.
[0099] Probes and primers: Nucleic acid probes and primers can be
readily prepared based on the nucleic acid molecules provided in
this invention. A probe comprises an isolated nucleic acid attached
to a detectable label or reporter molecule. Typical labels include
radioactive isotopes, ligands, chemiluminescent agents, and
enzymes. Methods for labeling and guidance in the choice of labels
appropriate for various purposes are discussed, e.g., in Sambrook
et al. (1989) and Ausubel et al. (1987).
[0100] Primers are short nucleic acid molecules, typically DNA
oligonucleotides 15 nucleotides or more in length. Primers can be
annealed to a complementary target DNA strand by nucleic acid
hybridization to form a hybrid between the primer and the target
DNA strand, and then extended along the target DNA strand by a DNA
polymerase enzyme. Primer pairs can be used for amplification of a
nucleic acid sequence, e.g., by the polymerase chain reaction (PCR)
or other nucleic-acid amplification methods known in the art.
[0101] Methods for preparing and using probes and primers are
described, for example, in Sambrook et al. (1989), Ausubel et al.
(1987), and Innis et al. (1990). PCR primer pairs can be derived
from a known sequence, for example, by using computer programs
intended for that purpose such as Primer (Version 0.5, .COPYRGT.
1991, Whitehead Institute for Biomedical Research, Cambridge,
Mass.). One of ordinary skill in the art will appreciate that the
specificity of a particular probe or primer increases with its
length. Thus, for example, a primer comprising 20 consecutive
nucleotides of the Arabidopsis ELF3 cDNA or gene will anneal to a
target sequence such as an ELF3 gene homolog from tomato contained
within a tomato genomic DNA library with a higher specificity than
a corresponding primer of only 15 nucleotides. Thus, in order to
obtain greater specificity, probes and primers can be selected that
comprise 20, 25, 30, 35, 40, 50 or more consecutive nucleotides of
the Arabidopsis ELF3 cDNA or gene sequences.
[0102] The invention thus includes isolated nucleic acid molecules
that comprise specified lengths of the disclosed ELF3 cDNA or gene
sequences. Such molecules may comprise at least 20, 25, 30, 35, 40,
50 or 100 consecutive nucleotides of these sequences and may be
obtained from any region of the disclosed sequences. By way of
example, the Arabidopsis ELF3 cDNA, ORF and gene sequences may be
apportioned into halves or quarters based on sequence length, and
the isolated nucleic acid molecules may be derived from the first
or second halves of the molecules, or any of the four quarters. The
Arabidopsis ELF3 cDNA, shown in SEQ ID NO: 1, can be used to
illustrate this. The Arabidopsis ELF3 cDNA is 2518 nucleotides in
length and so may be hypothetically divided into about halves
(nucleotides 1-1259 and 1260-2518) or about quarters (nucleotides
1-629, 630-1259, 1260-1889 and 1890-2518). Nucleic acid molecules
may be selected that comprise at least 20, 25, 30, 35, 40, 50 or
100 consecutive nucleotides of any of these or other portions of
the Arabidopsis ELF3 cDNA. Thus, representative nucleic acid
molecules might comprise at least 25 consecutive nucleotides of the
region comprising nucleotides 1-1259 of the disclosed Arabidopsis
cDNA, or of the regions comprising nucleotides 1-1135 or 2502-2518
of the cDNA.
[0103] Sequence identity: The similarity between two nucleic acid
sequences, or two amino acid sequences is expressed in terms of the
similarity between the sequences, otherwise referred to as sequence
identity. Sequence identity is frequently measured in terms of
percentage identity (or similarity or homology); the higher the
percentage, the more similar the two sequences are. Homologs of the
Arabidopsis ELF3 protein will possess a relatively high degree of
sequence identity when aligned using standard methods. Methods of
alignment of sequences for comparison are well known in the art.
Various programs and alignment algorithms are described in: Smith
& Waterman Adv. Appl. Math. 2: 482, 1981; Needleman &
Wunsch J. Mol. Biol. 48: 443, 1970; Pearson & Lipman Proc.
Natl. Acad. Sci. USA 85: 2444, 1988; Higgins & Sharp Gene, 73:
237-244, 1988; Higgins & Sharp CABIOS 5: 151-153, 1989; Corpet
et al. Nuc. Acids Res. 16, 10881-90, 1988; Huang et al. Computer
Appls. in the Biosciences 8, 155-65, 1992; and Pearson et al Meth.
Mol Bio. 24, 307-31, 1994. Altschul et at (J. Mol. Biol.
215:403-410, 1990), presents a detailed consideration of sequence
alignment methods and homology calculations.
[0104] The NCBI Basic Local Alignment Search Tool (BLAST) (Altschul
et al., 1990) is available from several sources, including the
National Center for Biotechnology Information (NCBI, Bethesda, Md.)
and on the Internet, for use in connection with the sequence
analysis programs blastp, blastn, blastx, tblastn and tblastx. It
can be accessed at the NCBI BLAST web-site. A description of how to
determine sequence identity using this program is available at the
help page of the NCBI web-site.
[0105] Homologs of the disclosed Arabidopsis ELF3 protein typically
possess at least 60% sequence identity counted over full length
alignment with the amino acid sequence of Arabidopsis ELF3 using
the NCBI Blast 2.0, gapped blastp set to default parameters. For
comparisons of amino acid sequences of greater than about 30 amino
acids, the Blast 2 sequences function is employed using the default
BLOSUM62 matrix set to default parameters, (gap existence cost of
11, and a per residue gap cost of 1). When aligning short peptides
(fewer than around 30 amino acids), the alignment should be
performed using the Blast 2 sequences function, employing the PAM30
matrix set to default parameters (open gap 9, extension gap 1
penalties). Proteins with even greater similarity to the reference
sequence will show increasing percentage identities when assessed
by this method, such as at least 70%, at least 75%, at least 80%,
at least 90%, at least 91%, at least 92%, at least 93%, at least
94% or at least 95% sequence identity. When less than the entire
sequence is being compared for sequence identity, homologs will
typically possess at least 75% sequence identity over short windows
of 10-20 amino acids, and may possess sequence identities of at
least 85% or at least 90% or 95% or more depending on their
similarity to the reference sequence. Methods for determining
sequence identity over such short windows are described at the NCBI
web-site, frequently asked questions page. One of ordinary skill in
the art will appreciate that these sequence identity ranges are
provided for guidance only; it is entirely possible that strongly
significant homologs could be obtained that fall outside of the
ranges provided. The present invention provides not only the
peptide homologs that are described above, but also nucleic acid
molecules that encode such homologs. ELF3 homologs will typically
also have ELF3 protein biological activity.
[0106] An alternative indication that two nucleic acid molecules
are closely related is that the two molecules hybridize to each
other under stringent conditions. Stringent conditions are
sequence-dependent and are different under different environmental
parameters. Generally, stringent conditions are selected to be
about 5.degree. C. to 20.degree. C. lower than the thermal melting
point (Tm) for the specific sequence at a defined ionic strength
and pH. The T.sub.m is the temperature (under defined ionic
strength and pH) at which 50% of the target sequence hybridizes to
a perfectly matched probe. Conditions for nucleic acid
hybridization and calculation of stringencies can be found in
Sambrook et al (1989) and Tijssen (1993). Nucleic acid molecules
that hybridize under stringent conditions to the Arabidopsis ELF3
sequences will typically hybridize to a probe based on either the
entire Arabidopsis ELF3 cDNA or selected portions of the cDNA under
wash conditions of 0.2.times.SSC, 0.1% SDS at 55.degree. C. for 1
hour. A more detailed discussion of hybridization conditions,
including low stringency conditions, is presented below.
[0107] Nucleic acid sequences that do not show a high degree of
identity may nevertheless encode similar amino acid sequences, due
to the degeneracy of the genetic code. It is understood that
changes in nucleic acid sequence can be made using this degeneracy
to produce multiple nucleic acid molecules that all encode
substantially the same protein.
[0108] Ortholog: Two nucleotide or amino acid sequences are
orthologs of each other if they share a common ancestral sequence
and diverged when a species carrying that ancestral sequence split
into two species. Orthologous sequences are also homologous
sequences.
[0109] Specific binding agent: An agent that binds substantially
only to a defined target. Thus an ELF3 protein specific binding
agent binds substantially only the ELF3 protein. As used herein,
the term "ELF3 protein specific binding agent" includes anti-ELF3
protein antibodies and other agents that bind substantially only to
the ELF3 protein.
[0110] Anti-ELF3 protein antibodies may be produced using standard
procedures described in a number of texts, including Harlow and
Lane (1988). The determination that a particular agent binds
substantially only to the ELF3 protein may readily be made by using
or adapting routine procedures. One suitable in vitro assay makes
use of the Western blotting procedure (described in many standard
texts, including Harlow and Lane (1988)). Western blotting may be
used to determine that a given ELF3 protein binding agent, such as
an anti-ELF3 protein monoclonal antibody, binds substantially only
to the ELF3 protein.
[0111] Vector: A nucleic acid molecule as introduced into a host
cell, thereby producing a transformed host cell. A vector may
include nucleic acid sequences that permit it to replicate in a
host cell, such as an origin of replication. A vector may also
include one or more selectable marker genes and other genetic
elements known in the art.
[0112] Transformed: A transformed cell is a cell into which has
been introduced a nucleic acid molecule by molecular biology
techniques. As used herein, the term transformation encompasses all
techniques by which a nucleic acid molecule might be introduced
into such a cell, including transfection with viral vectors,
transformation with plasmid vectors, and introduction of naked DNA
by electroporation, lipofection, and particle gun acceleration.
[0113] Isolated: An "isolated" biological component (such as a
nucleic acid molecule, protein or organelle) has been substantially
separated or purified away from other biological components in the
cell of the organism in which the component naturally occurs, i.e.,
other chromosomal and extra-chromosomal DNA and RNA, proteins and
organelles. Nucleic acid molecules and proteins that have been
"isolated" include nucleic acid molecules and proteins purified by
standard purification methods. The term also embraces nucleic acid
molecules and proteins prepared by recombinant expression in a host
cell as well as chemically synthesized nucleic acid molecules.
[0114] Purified: The term purified does not require absolute
purity; rather, it is intended as a relative term. Thus, for
example, a purified ELF3 protein preparation is one in which the
ELF3 protein is more enriched than the protein is in its natural
environment within a cell. Generally, a preparation of ELF3 protein
is purified such that ELF3 represents at least 5% of the total
protein content of the preparation. For particular applications,
higher purity may be desired, such that preparations in which ELF3
represents at least 25%, 50% or at least 90% of the total protein
content may be employed.
[0115] Operably linked: A first nucleic acid sequence is operably
linked with a second nucleic acid sequence when the first nucleic
acid sequence is placed in a functional relationship with the
second nucleic acid sequence. For instance, a promoter is operably
linked to a coding sequence if the promoter affects the
transcription or expression of the coding sequence. Generally,
operably linked DNA sequences are contiguous and, where necessary
to join two protein-coding regions, in the same reading frame.
[0116] Recombinant: A recombinant nucleic acid is one that has a
sequence that is not naturally occurring or has a sequence that is
made by an artificial combination of two otherwise separated
segments of sequence. This artificial combination can be
accomplished by chemical synthesis or, more commonly, by the
artificial manipulation of isolated segments of nucleic acids,
e.g., by genetic engineering techniques.
[0117] cDNA (complementary DNA): A piece of DNA lacking internal,
non-coding segments (introns) and regulatory sequences that
determine transcription. cDNA is synthesized in the laboratory by
reverse transcription from messenger RNA extracted from cells.
[0118] ORF (open reading frame): A series of nucleotide triplets
(codons) coding for amino acids without any internal termination
codons. These sequences are usually translatable into a
peptide.
[0119] Transgenic plant: As used herein, this term refers to a
plant that contains recombinant genetic material not normally found
in plants of this type and which has been introduced into the plant
in question (or into progenitors of the plant) by human
manipulation. Thus, a plant that is grown from a plant cell into
which recombinant DNA is introduced by transformation is a
transgenic plant, as are all offspring of that plant that contain
the introduced transgene (whether produced sexually or
asexually).
II. ELF3 Protein and Nucleic Acid Sequences
[0120] This invention provides ELF3 proteins and ELF3 nucleic acid
molecules, including cDNA and gene sequences. The prototypical ELF3
sequences are the Arabidopsis sequences, and the invention provides
for the use of these sequences to produce transgenic plants, such
as corn and rice plants, having increased or decreased levels of
ELF3 protein.
[0121] a. Arabidopsis ELF3
[0122] The Arabidopsis ELF3 genomic sequence is shown in SEQ ID NO:
3. The sequence comprises three introns and four exons, and encodes
a protein that is 696 amino acids in length (SEQ ID NO: 2 shows the
amino acid sequence of the ELF3 protein). The Arabidopsis ELF3
protein shares no significant homology to any known published
proteins with assigned function. However, one published Arabidopsis
EST (GenBank # N96569; Newman et al., 1994) overlaps nucleotides
853-2088 of the Arabidopsis ELF3 open reading frame (ORF) (SEQ ID
NO: 4) (nucleotides 1136-2501 of the Arabidopsis ELF3 cDNA, SEQ ID
NO: 1).
[0123] GenBank accession numbers for ELF3 and putative ELF3
homologs identified as such by this research group are as follows:
AtELF3 (A. thaliana genomic DNA: AC004747, published Dec. 17,
1999), AtEEC (A. thaliana genomic DNA: AB023045, published Nov. 20,
1999), cELF3 (yet to be submitted), tELF3 [Lycopersicon esculentum
Expressed Sequence Tags (ESTs) from Clemson University Genomics
Institute: AW093790 (Oct. 18, 1999), AI894513 (Jul. 27, 1999),
AI488927 (Jun. 29, 1999), AI486934 (Jun. 29, 1999), AI894398 (Jul.
27, 1999)], rELF3 (Oryza sativa genomic DNA: AP000399, published
Dec. 3, 1999), and mELF3 (Zea mays EST from Stanford University
Genome Center: AI637184, published Apr. 26, 1999).
[0124] The cDNA corresponding to the ELF3 gene is shown in SEQ ID
NO: 1, and the ELF3 ORF is shown in SEQ ID NO: 4. As described
below, the Arabidopsis ELF3 protein has ELF3 biological activity,
i.e., it complements the defective characteristics of
photoperiod-insensitive flowering and elongated hypocotyl in elf3
mutant plants when the ELF3 gene sequence is introduced into these
plants and the ELF3 protein is thereby expressed. In addition, ELF3
proteins contain one or more ESSENCE of ELF3 CONSENSUS (EEC)
regions (see FIG. 2).
[0125] With the provision herein of the Arabidopsis ELF3 cDNA and
gene sequences, the polymerase chain reaction (PCR) may now be
utilized as a preferred method for producing nucleic acid sequences
encoding the Arabidopsis ELF3 protein. For example, PCR
amplification of the Arabidopsis ELF3 cDNA sequence may be
accomplished either by direct PCR from a plant cDNA library or by
reverse-transcription PCR (RT-PCR) using RNA extracted from plant
cells as a template. Methods and conditions for both direct PCR and
RT-PCR are known in the art and are described in Innis et al.
(1990). Any plant cDNA library would be useful for direct PCR. The
ELF3 gene sequences can be isolated from other libraries, for
instance the IGF Arabidopsis BAC library (Mozo et al. 1998)
[0126] The selection of PCR primers will be made according to the
portions of the ELF3 cDNA (or gene) that are to be amplified.
Primers may be chosen to amplify small segments of the cDNA, the
open reading frame, the entire cDNA molecule or the entire gene
sequence. Variations in amplification conditions may be required to
accommodate primers of differing lengths; such considerations are
well known in the art and are discussed in Innis et al. (1990),
Sambrook et al. (1989), and Ausubel et al. (1992). By way of
example only, the Arabidopsis ELF3 cDNA molecule as shown in SEQ ID
NO: 1 (excluding the poly A tail) may be amplified using the
following combination of primers: TABLE-US-00002 primer 1: 5'
TGAAAACTCACTTTGGTTTTGTTTG 3' (SEQ ID NO: 6) primer 2: 5'
AAGACAAATTAAGACATATAAATGA 3' (SEQ ID NO: 7)
[0127] The open reading frame portion of the cDNA (SEQ ID NO: 4)
may be amplified using the following primer pair: TABLE-US-00003
primer 3: 5' ATGAATAGAGGGAAAGATGAGGAG 3' (SEQ ID NO: 8) primer 4:
5' TTAAGGCTTAGAGGAGTCATAGCGT 3' (SEQ ID NO: 9)
These primers are illustrative only; one of ordinary skill in the
art will appreciate that many different primers may be derived from
the provided cDNA and gene sequences in order to amplify particular
regions of these molecules. Resequencing of PCR products obtained
by these amplification procedures is recommended; this will
facilitate confirmation of the amplified sequence and will also
provide information on natural variation in this sequence in
different ecotypes and plant populations. Oligonucleotides derived
from the Arabidopsis ELF3 sequence may be used in such sequencing
methods.
[0128] Oligonucleotides that are derived from the Arabidopsis ELF3
cDNA or gene sequences are encompassed within the scope of the
present invention. Preferably, such oligonucleotide primers will
comprise a sequence of at least 15-20 consecutive nucleotides of
the Arabidopsis ELF3 cDNA or gene sequences. To enhance
amplification specificity, oligonucleotide primers comprising at
least 25, 30, 35, 40, 45 or 50 consecutive nucleotides of these
sequences may also be used.
[0129] b. ELF3 Genes in Other Plant Species
[0130] Orthologs of the ELF3 gene are present in a number of plant
species including Chlamydomonas, Douglas fir, corn, broccoli,
cauliflower, soybean, Medicago, rice, poplar, tobacco, Cardamine,
and tomato (see Examples 4, 5 and 6, below). With the provision
herein of the prototypical ELF3 protein from Arabidopsis and cDNA
and gene sequences that encode this protein, cloning of cDNAs and
genes that encode ELF3 protein orthologs in other plant species is
now enabled. Standard methods, including those described herein,
can be used. As described above, orthologs of the disclosed
Arabidopsis ELF3 protein have ELF3 protein biological activity and
typically possess at least 60% sequence identity counted over the
full length alignment with the amino acid sequence of Arabidopsis
ELF3 using the NCBI Blast 2.0, gapped blastp set to default
parameters. Proteins with even greater similarity to the
Arabidopsis sequence will show greater percentage identities when
assessed by this method, such as at least 70%, at least 75%, at
least 80%, at least 90%, at least 91%, at least 92%, at least 93%,
at least 94% or at least 95% or more sequence identity.
[0131] Both conventional hybridization and PCR amplification
procedures may be utilized to clone sequences encoding ELF3 protein
orthologs. Common to these techniques is the hybridization of
probes or primers derived from the Arabidopsis ELF3 cDNA or gene
sequence to a target nucleotide preparation. This target may be, in
the case of conventional hybridization approaches, a cDNA or
genomic library or, in the case of PCR amplification, a cDNA or
genomic library, or an mRNA preparation.
[0132] Direct PCR amplification may be performed on cDNA or genomic
libraries prepared from the plant species in question, or RT-PCR
may be performed using mRNA extracted from the plant cells using
standard methods. PCR primers will comprise at least 15 consecutive
nucleotides of the Arabidopsis ELF3 cDNA or gene. One of ordinary
skill in the art will appreciate that sequence differences between
the Arabidopsis ELF3 cDNA or gene and the target nucleic acid to be
amplified may result in lower amplification efficiencies. To
compensate for this difference, longer PCR primers or lower
annealing temperatures may be used during the amplification cycle.
Where lower annealing temperatures are used, sequential rounds of
amplification using nested primer pairs may be necessary to enhance
amplification specificity.
[0133] For conventional hybridization techniques, the hybridization
probe is preferably conjugated with a detectable label such as a
radioactive label, and the probe is preferably of at least 20
nucleotides in length. As is well known in the art, increasing the
length of hybridization probes tends to give enhanced specificity.
The labeled probe derived from the Arabidopsis cDNA or gene
sequence may be hybridized to a plant cDNA or genomic library and
the hybridization signal detected using means known in the art. The
hybridizing colony or plaque (depending on the type of library
used) is then purified and the cloned sequence contained in that
colony or plaque isolated and characterized.
[0134] Orthologs of the Arabidopsis ELF3 may alternatively be
obtained by immunoscreening an expression library. With the
provision herein of the disclosed Arabidopsis ELF3 nucleic acid
sequences, the protein may be expressed in and purified from a
heterologous expression system (e.g., E. coli) and used to raise
antibodies (monoclonal or polyclonal) specific for the Arabidopsis
ELF3 protein. Antibodies may also be raised against synthetic
peptides derived from the Arabidopsis ELF3 amino acid sequence
presented herein. Methods of raising antibodies are well known in
the art and are described in Harlow and Lane (1988). Such
antibodies can be used to screen an expression cDNA library
produced from the plant from which it is desired to clone the ELF3
ortholog, using routine methods. The selected cDNAs can be
confirmed by sequencing.
[0135] c. ELF3 Sequence Variants
[0136] With the provision of the Arabidopsis ELF3 protein and ELF3
cDNA and gene sequences herein, the creation of variants of these
sequences is now enabled.
[0137] Variant ELF3 proteins include proteins that differ in amino
acid sequence from the Arabidopsis ELF3 sequence disclosed but
which retain ELF3 protein biological activity. Such proteins may be
produced by manipulating the nucleotide sequence of the Arabidopsis
ELF3 cDNA or gene using standard procedures, including for instance
site-directed mutagenesis or PCR. The simplest modifications
involve the substitution of one or more amino acids for amino acids
having similar biochemical properties. These so-called conservative
substitutions are likely to have minimal impact on the activity of
the resultant protein. Table 1 shows amino acids that may be
substituted for an original amino acid in a protein, and which are
regarded as conservative substitutions. Table 1. TABLE-US-00004
TABLE 1 Original Residue Conservative Substitutions Ala ser Arg lys
Asn gln; his Asp glu Cys ser Gln asn Glu asp Gly pro His asn; gln
Ile leu; val Leu ile; val Lys arg; gln; glu Met leu; ile Phe met;
leu; tyr Ser thr Thr ser Trp tyr Tyr trp; phe Val ile; leu
[0138] More substantial changes in protein functions or other
features may be obtained by selecting amino acid substitutions that
are less conservative than those listed in Table 1. Such changes
include changing residues that differ more significantly in their
effect on maintaining polypeptide backbone structure (e.g., sheet
or helical conformation) near the substitution, charge or
hydrophobicity of the molecule at the target site, or bulk of a
specific side chain. The following substitutions are generally
expected to produce the greatest changes in protein properties: (a)
a hydrophilic residue (e.g., seryl or threonyl) is substituted for
(or by) a hydrophobic residue (e.g., leucyl, isoleucyl,
phenylalanyl, valyl or alanyl); (b) a cysteine or proline is
substituted for (or by) any other residue; (c) a residue having an
electropositive side chain (e.g., lysyl, arginyl, or histadyl) is
substituted for (or by) an electronegative residue (e.g., glutamyl
or aspartyl); or (d) a residue having a bulky side chain (e.g.,
phenylalanine) is substituted for (or by) one lacking a side chain
(e.g., glycine). The effects of these amino acid substitutions,
deletions, or additions may be assessed in ELF3 protein derivatives
by analyzing the ability of a gene encoding the derivative protein
to complement the photoperiod-insensitive flowering and elongated
hypocotyl defects in an elf3 mutant. Alternatively, the effect may
be examined by studying circadian influenced CAB-luc transcription
and/or leaf movement as discussed in Example 2, below.
[0139] Variant ELF3 cDNA or genes may be produced by standard DNA
mutagenesis techniques, for example, M13 primer mutagenesis.
Details of these techniques are provided in Sambrook et al. (1989),
Ch. 15. By the use of such techniques, variants may be created
which differ in minor ways from the Arabidopsis ELF3 cDNA or gene
sequences disclosed, yet which still encode a protein having ELF3
protein biological activity. DNA molecules and nucleotide sequences
that are derivatives of those specifically disclosed herein and
that differ from those disclosed by the deletion, addition, or
substitution of nucleotides while still encoding a protein that has
ELF3 protein biological activity are comprehended by this
invention. In their most simple form, such variants may differ from
the disclosed sequences by alteration of the coding region to fit
the codon usage bias of the particular organism into which the
molecule is to be introduced.
[0140] Alternatively, the coding region may be altered by taking
advantage of the degeneracy of the genetic code to alter the coding
sequence such that, while the nucleotide sequence is substantially
altered, it nevertheless encodes a protein having an amino acid
sequence substantially similar to the disclosed Arabidopsis ELF3
protein sequence. For example, the 23rd amino acid residue of the
Arabidopsis ELF3 protein is alanine. This alanine residue is
encoded for by the nucleotide codon triplet GCA. Because of the
degeneracy of the genetic code, three other nucleotide codon
triplets--GCT, GCC and GCG--also code for alanine. Thus, the
nucleotide sequence of the Arabidopsis ELF3 ORF could be changed at
this position to any of these three alternative codons without
affecting the amino acid composition or other characteristics of
the encoded protein. Based upon the degeneracy of the genetic code,
variant DNA molecules may be derived from the cDNA and gene
sequences disclosed herein using standard DNA mutagenesis
techniques as described above, or by synthesis of DNA sequences.
Thus, this invention also encompasses nucleic acid sequences that
encode an ELF3 protein, but which vary from the disclosed nucleic
acid sequences by virtue of the degeneracy of the genetic code.
[0141] Variants of the ELF3 protein may also be defined in terms of
their sequence identity with the prototype ELF3 protein shown in
SEQ ID NO: 2. As described above, ELF3 proteins have ELF3
biological activity and share at least 60% sequence identity with
the Arabidopsis ELF3 protein. Nucleic acid sequences that encode
such proteins may readily be determined simply by applying the
genetic code to the amino acid sequence of an ELF3 protein, and
such nucleic acid molecules may readily be produced by assembling
oligonucleotides corresponding to portions of the sequence.
[0142] Nucleic acid molecules that are derived from the Arabidopsis
ELF3 cDNA and gene sequences disclosed include molecules that
hybridize under stringent conditions to the disclosed prototypical
ELF3 nucleic acid molecules, or fragments thereof. Stringent
conditions are hybridization at 55.degree. C. in 6.times.SSC,
5.times. Denhardt's solution, 0.1% SDS and 100 .mu.g sheared salmon
testes DNA, followed by 15-30 minute sequential washes at
55.degree. C. in 2.times.SSC, 0.1% SDS, followed by 1.times.SSC,
0.1% SDS and finally 0.2.times.SSC, 0.1% SDS.
[0143] Low stringency hybridization conditions (to detect less
closely related homologs) are performed as described above but at
50.degree. C. (both hybridization and wash conditions); however,
depending on the strength of the detected signal, the wash steps
may be terminated after the first 2.times.SSC, 0.1% SDS wash.
[0144] The Arabidopsis ELF3 gene or cDNA, and orthologs of these
sequences from other plants, may be incorporated into
transformation vectors and introduced into plants to produce plants
with an altered photoperiodic or circadian rhythm phenotype, as
described below.
III. Introducing ELF3 into Plants
[0145] Once a nucleic acid molecule (e.g., cDNA or gene) encoding a
protein involved in the determination of a particular plant
characteristic has been isolated, standard techniques may be used
to express the cDNA in transgenic plants in order to modify that
particular plant characteristic. The basic approach is to clone,
for instance, the cDNA into a transformation vector, such that it
is operably linked to control sequences (e.g., a promoter) that
direct expression of the cDNA in plant cells. The transformation
vector is then introduced into plant cells by one of a number of
techniques (e.g., electroporation) and progeny plants containing
the introduced cDNA are selected. Preferably all or part of the
transformation vector will stably integrate into the genome of the
plant cell. That part of the transformation vector that integrates
into the plant cell and that contains the introduced cDNA and
associated sequences for controlling expression (the introduced
"transgene") may be referred to as the recombinant expression
cassette.
[0146] Selection of progeny plants containing the introduced
transgene may be based upon the detection of an altered phenotype.
Such a phenotype may result directly from the cDNA cloned into the
transformation vector or may be manifested as enhanced resistance
to a chemical agent (such as an antibiotic) as a result of the
inclusion of a dominant selectable marker gene incorporated into
the transformation vector.
[0147] Successful examples of the modification of plant
characteristics by transformation with cloned cDNA sequences are
replete in the technical and scientific literature. Selected
examples, which serve to illustrate the knowledge in this field of
technology, include:
[0148] U.S. Pat. No. 5,451,514 (modification of lignin synthesis
using antisense RNA and co-suppression);
[0149] U.S. Pat. No. 5,750,385 (modification of plant light-, seed-
and fruit-specific gene expression using sense and antisense
transformation constructs);
[0150] U.S. Pat. No. 5,583,021 (modification of virus resistance by
expression of plus-sense untranslatable RNA);
[0151] U.S. Pat. No. 5,589,615 (production of transgenic plants
with increased nutritional value via the expression of modified 2S
storage albumins);
[0152] U.S. Pat. No. 5,268,526 (modification of phytochrome
expression in transgenic plants);
[0153] U.S. Pat. No. 5,741,684 (production of plants resistant to
herbicides or antibiotics through the use of anti-sense
expression);
[0154] U.S. Pat. No. 5,773,692 (modification of the levels of
chlorophyll by transformation of plants with anti-sense messages
corresponding to chlorophyll a/b binding protein);
[0155] WO 96/13582 (modification of seed VLCFA composition using
over expression, co-suppression and antisense RNA in conjunction
with the Arabidopsis FAEI gene)
[0156] These examples include descriptions of transformation vector
selection, transformation techniques and the assembly of constructs
designed to over-express the introduced nucleic acid, as well as
techniques for sense suppression and antisense expression. In light
of the foregoing and the provision herein of the Arabidopsis ELF3
cDNA and gene sequences, one of ordinary skill in the art will be
able to introduce these nucleic acid molecules, or orthologous,
homologous or derivative forms of these molecules, into plants in
order to produce plants having altered ELF3 activity. Manipulating
the expression of ELF3 in plants will be useful to confer altered
circadian clock and/or photoperiodism function. Alteration of the
ELF3 protein levels in plants could be used to re-set or customize
the circadian clock, for instance in order to alter the plant
developmental patterns or photoperiodic responses (e.g., the timing
of floral development).
[0157] a. Plant Types
[0158] The presence of a circadian cycle appears to be universal,
occurring not only in all plants thus far examined, but also in
insects, including Drosophila (Hall, 1990) and microbes such as
Neurospora crassa (Dunlap, 1993). At the molecular level, ELF3
homologs have been found in a variety of plant species (see Example
4, below). Thus, expression of the ELF3 protein may be modified in
a wide range of higher plants to confer altered circadian clock
and/or photoperiodism function, including monocotyledonous and
dicotyledenous plants. These include, but are not limited to,
Arabidopsis, Cardamine, cotton, tobacco, maize, wheat, rice,
barley, soybean, beans in general, rape/canola, alfalfa, flax,
sunflower, safflower, brassica, cotton, flax, peanut, clover;
vegetables such as lettuce, tomato, cucurbits, cassava, potato,
carrot, radish, pea, lentils, cabbage, cauliflower, broccoli,
Brussels sprouts, peppers; tree fruits such as citrus, apples,
pears, peaches, apricots, walnuts; other trees including poplar,
oak, maple, pine, spruce and other conifers; and flowers or other
ornamental plants such as carnations, roses, petunias, orchids,
impatiens, pansies, lilies, snapdragons, geraniums, and so
forth.
[0159] b. Vector Construction, Choice of Promoters
[0160] A number of recombinant vectors suitable for stable
transformation of plant cells or for the establishment of
transgenic plants have been described including those described in
Pouwels et al., (1987), Weissbach and Weissbach, (1989), and Gelvin
et al., (1990). Typically, plant transformation vectors include one
or more cloned plant genes (or cDNAs) under the transcriptional
control of 5' and 3' regulatory sequences, and at least one
dominant selectable marker. Such plant transformation vectors
typically also contain a promoter regulatory region (e.g., a
regulatory region controlling inducible or constitutive,
environmentally- or developmentally-regulated, or cell- or
tissue-specific expression), a transcription initiation start site,
a ribosome binding site, an RNA processing signal, a transcription
termination site, and/or a polyadenylation signal.
[0161] Examples of constitutive plant promoters that may be useful
for expressing an ELF3 nucleic acid molecule include: the
cauliflower mosaic virus (CaMV) 35S promoter, which confers
constitutive, high-level expression in most plant tissues (see,
e.g., Odel et al., 1985, Dekeyser et al., 1990, Terada and
Shimamoto, 1990; Benfey and Chua. 1990); the nopaline synthase
promoter (An et al., 1988); and the octopine synthase promoter
(Fromm et al., 1989).
[0162] A variety of plant gene promoters are regulated in response
to environmental, hormonal, chemical, and/or developmental signals,
and can be used for expression of the cDNA in plant cells. Such
promoters include, for instance, those regulated by: (a) heat
(Callis et al., 1988; Ainley, et al. 1993; Gilmartin et al. 1992);
(b) light (e.g., the pea rbcS-3A promoter, Kuhlemeier et al., 1989,
and the maize rbcS promoter, Schaffner and Sheen, 1991); (c)
hormones, such as abscisic acid (Marcotte et al., 1989); (d)
wounding (e.g., wunI, Siebertz et al., 1989); and (e) chemicals
such as methyl jasminate or salicylic acid (see also Gatz et al.,
1997).
[0163] Alternatively, tissue specific (root, leaf, flower, or seed,
for example) promoters (Carpenter et al. 1992, Denis et al. 1993,
Opperman et al. 1993, Stockhause et al. 1997; Roshal et al., 1987;
Schernthaner et al., 1988; and Bustos et al., 1989) can be fused to
the coding sequence to obtained protein expression in specific
organs.
[0164] Promoters responsive to the circadian cycle can also be used
in plant gene expression vectors. Such promoters include the native
ELF3 promoter as described herein, and the promoter from the
chlorophyll a/b binding protein (Millar et al. 1992).
[0165] Plant transformation vectors may also include RNA processing
signals, for example, introns, which may be positioned upstream or
downstream of the ORF sequence in the transgene. In addition, the
expression vectors may include further regulatory sequences from
the 3'-untranslated region of plant genes, e.g., a 3' terminator
region to increase mRNA stability of the mRNA, such as the PI-II
terminator region of potato or the Agrobacterium octopine or
nopaline synthase 3' terminator regions. The 3' region of the ELF3
gene can also be used.
[0166] Finally, as noted above, plant transformation vectors may
include dominant selectable marker genes to allow for the ready
selection of transformants. Such genes include those encoding
antibiotic resistance genes (e.g., resistance to hygromycin,
kanamycin, bleomycin, G418, streptomycin or spectinomycin) and
herbicide resistance genes (e.g., phosphinothricin
acetyltransferase).
[0167] c. Arrangement of ELF3 Sequence in the Vector
[0168] The particular arrangement of the ELF3 sequence in the
transformation vector will be selected according to the type of
expression of the sequence that is desired.
[0169] Where enhanced ELF3 protein activity is desired in the
plant, an ELF3 ORF may be operably linked to a constitutive
high-level promoter such as the CaMV 35S promoter. As noted below,
modification of ELF3 synthesis may also be achieved by introducing
into a plant a transformation vector containing a variant form of
an ELF3 cDNA or gene.
[0170] In contrast, a reduction of ELF3 activity in the transgenic
plant may be obtained by introducing into plants an antisense
construct based on an ELF3 cDNA or gene sequence. For antisense
suppression, an ELF3 cDNA or gene is arranged in reverse
orientation relative to the promoter sequence in the transformation
vector. The introduced sequence need not be a full length ELF3 cDNA
or gene, and need not be exactly homologous to the native ELF3 cDNA
or gene found in the plant type to be transformed. Generally,
however, where the introduced sequence is of shorter length, a
higher degree of homology to the native ELF3 sequence will be
needed for effective antisense suppression. The introduced
antisense sequence in the vector generally will be at least 30
nucleotides in length, and improved antisense suppression will
typically be observed as the length of the antisense sequence
increases. Preferably, the length of the antisense sequence in the
vector will be greater than 100 nucleotides. Transcription of an
antisense construct as described results in the production of RNA
molecules that are the reverse complement of mRNA molecules
transcribed from the endogenous ELF3 gene in the plant cell.
Although the exact mechanism by which antisense RNA molecules
interfere with gene expression has not been elucidated, it is
believed that antisense RNA molecules bind to the endogenous mRNA
molecules and thereby inhibit translation of the endogenous mRNA.
The production and use of anti-sense constructs are disclosed, for
instance, in U.S. Pat. No. 5,773,692 (using constructs encoding
anti-sense RNA for chlorophyll a/b binding protein to reduce plant
chlorophyll content), and U.S. Pat. No. 5,741,684 (regulating the
fertility of pollen in various plants through the use of anti-sense
RNA to genes involved in pollen development or function).
[0171] Suppression of endogenous ELF3 gene expression can also be
achieved using ribozymes. Ribozymes are synthetic RNA molecules
that possess highly specific endoribonuclease activity. The
production and use of ribozymes are disclosed in U.S. Pat. No.
4,987,071 to Cech and U.S. Pat. No. 5,543,508 to Haselhoff.
Inclusion of ribozyme sequences within antisense RNAs may be used
to confer RNA cleaving activity on the antisense RNA, such that
endogenous mRNA molecules that bind to the antisense RNA are
cleaved, leading to an enhanced antisense inhibition of endogenous
gene expression.
[0172] Constructs in which an ELF3 cDNA or gene (or variants
thereof) are over-expressed may also be used to obtain
co-suppression of the endogenous ELF3 gene in the manner described
in U.S. Pat. No. 5,231,021 to Jorgensen. Such co-suppression (also
termed sense suppression) does not require that the entire ELF3
cDNA or gene be introduced into the plant cells, nor does it
require that the introduced sequence be exactly identical to the
endogenous ELF3 gene. However, as with antisense suppression, the
suppressive efficiency will be enhanced as (1) the introduced
sequence is lengthened and (2) the sequence similarity between the
introduced sequence and the endogenous ELF3 gene is increased.
[0173] Constructs expressing an untranslatable form of an ELF3 mRNA
may also be used to suppress the expression of endogenous ELF3
activity. Methods for producing such constructs are described in
U.S. Pat. No. 5,583,021 to Dougherty et al. Preferably, such
constructs are made by introducing a premature stop codon into an
ELF3 ORF.
[0174] Finally, dominant negative mutant forms of the disclosed
sequences may be used to block endogenous ELF3 activity. Such
mutants require the production of mutated forms of the ELF3 protein
that interact with the same molecules as ELF3 but do not have ELF3
activity.
[0175] d. Transformation and Regeneration Techniques
[0176] Transformation and regeneration of both monocotyledonous and
dicotyledonous plant cells is now routine, and the most appropriate
transformation technique will be determined by the practitioner.
The choice of method will vary with the type of plant to be
transformed; those skilled in the art will recognize the
suitability of particular methods for given plant types. Suitable
methods may include, but are not limited to: electroporation of
plant protoplasts; liposome-mediated transformation; polyethylene
glycol (PEG) mediated transformation; transformation using viruses;
micro-injection of plant cells; micro-projectile bombardment of
plant cells; vacuum infiltration; and Agrobacterium tumefaciens
(AT) mediated transformation. Typical procedures for transforming
and regenerating plants are described in the patent documents
listed at the beginning of this section.
[0177] e. Selection of Transformed Plants
[0178] Following transformation and regeneration of plants with the
transformation vector, transformed plants are usually selected
using a dominant selectable marker incorporated into the
transformation vector. Typically, such a marker will confer
antibiotic resistance on the seedlings of transformed plants, and
selection of transformants can be accomplished by exposing the
seedlings to appropriate concentrations of the antibiotic.
[0179] After transformed plants are selected and grown to maturity,
they can be assayed using the methods described herein to determine
whether the circadian cycle or photoperiodism of the transformed
plant has been altered as a result of the introduced transgene.
IV. Production of Recombinant ELF3 Protein in Heterologous
Expression Systems
[0180] Many different expression systems are available for
expressing cloned nucleic acid molecules. Examples of prokaryotic
and eukaryotic expression systems that are routinely used in
laboratories are described in Chapters 16-17 of Sambrook et al.
(1989). Such systems may be used to express ELF3 at high levels to
facilitate purification of the protein. The purified ELF3 protein
may be used for a variety of purposes. For example, the purified
recombinant enzyme may be used as an immunogen to raise anti-ELF3
antibodies. Such antibodies are useful as both research reagents
(such as in the study of circadian clock and photoperiodism
mechanisms in plants) as well as diagnostically to determine
expression levels of the protein in plants that are being developed
for agricultural or other use. Thus, the antibodies may be used to
quantify the level of ELF3 protein both in non-transgenic plant
varieties and in transgenic varieties that are designed to
over-express or under-express the ELF3 protein. Such quantification
may be performed using standard immunoassay techniques, such as
ELISA and in situ immunofluorescence and others described in Harlow
& Lane (1988).
[0181] By way of example only, high level expression of the ELF3
protein may be achieved by cloning and expressing the ELF3 cDNA in
yeast cells using the pYES2 yeast expression vector (INVITROGEN,
Carlsbad, Calif.). Alternatively, a genetic construct may be
produced to direct secretion of the recombinant ELF3 protein from
yeast cells into the growth medium. This approach will facilitate
the purification of the ELF3 protein, if this is necessary.
Secretion of the recombinant protein from the yeast cells may be
achieved by placing a yeast signal sequence adjacent to the ELF3
coding region. A number of yeast signal sequences have been
characterized, including the signal sequence for yeast invertase.
This sequence has been successfully used to direct the secretion of
heterologous proteins from yeast cells, including such proteins as
human interferon (Chang et al., 1986), human lactoferrin (Liang and
Richardson, 1993) and prochymosin (Smith et al., 1985).
[0182] Alternatively, the enzyme may be expressed at high level in
prokaryotic expression systems, such as E. coli, as described in
Sambrook et al. (1989). Commercially available prokaryotic
expression systems include the pBAD expression system and the
ThioFusion expression system (INVITROGEN, Carlsbad, Calif.).
V. ELF3 Promoter
[0183] The 5' regulatory region of the ELF3 gene is also provided
herein (SEQ ID NO: 5). This regulatory region confers ELF3-like
circadian rhythm-based expression on open reading frames to which
it is operably linked. Approximately 4 kb of the ELF3 5' regulatory
region is provided in SEQ ID NO: 5. While this entire ca. 4 kb
regulatory sequence may be employed, one of ordinary skill in the
art will appreciate that less than this entire sequence may be
sufficient to confer ELF3-like circadian rhythm expression. For
example, sequences comprising nucleotides 14071 of SEQ ID NO: 5 or
shorter sequences such as those spanning nucleotides 500-4071,
1000-4071, 1500-4071, 2000-4071, 2500-4071, 3000-4071, 3500-4071
and 4000-4071 may be employed. One embodiment of an ELF3 promoter
is about nucleotides 1 through about 1900 of the 5' upstream region
shown in SEQ ID NO: 5. Other particular embodiments include about
nucleotides 50-1900, 150-1900, 250-1900, 350-1900, 450-1900,
550-1900 and so forth.
[0184] Sequences as short as 50 or 100 nucleotides from within the
5' regulatory region of ELF3 may also be employed. The
determination of whether a particular sub-region of the disclosed
sequence operates to confer effective ELF3-like circadian rhythm
expression in a particular system (taking into account the plant
species into which the construct is being introduced, the level of
expression required, etc.) will be performed using known methods.
These include, for instance, operably linking the promoter
sub-region to a marker gene (e.g. GUS or luciferase), introducing
such constructs into plants, and determining the level of
expression of the marker gene.
[0185] The present invention therefore facilitates the production,
by standard molecular biology techniques, of nucleic acid molecules
comprising this promoter sequence operably linked to a nucleic acid
sequence, such as an open reading frame. Suitable open reading
frames include open reading frames encoding any protein for which
ELF3-like circadian rhythm expression is desired.
EXAMPLES
Example 1
Cloning Arabidopsis ELF3
[0186] The ELF3 gene was isolated by map-based positional cloning.
Molecular markers tightly linked to the ELF3 gene were identified
by random fragment length polymorphism (RFLP) analysis, and a high
resolution genetic map of the locus was constructed. The region
containing the ELF3 gene was narrowed down to 30 kb contained on a
single bacterial artificial chromosome (BAC). This BAC was
sequenced, and cDNAs with homology to sequences within the BAC were
isolated from a variety of cDNA libraries. The ELF3 sequence was
further localized by complementation experiments to a 10 kb
subcloned fragment contained within the BAC. Identification of the
appropriate gene within the subcloned fragment was confirmed
through isolation and sequencing of elf3 alleles from various
Arabidopsis elf3 mutants.
[0187] The isolated ELF3 gene (SEQ ID NO: 3) has no significant
sequence similarity to other DNA or protein sequences with assigned
function. However, a published EST (GenBank # N96569; Newman et
al., 1994) overlaps nucleotide 1235-2501 of the corresponding cDNA
(SEQ ID NO: 1). ELF3 has four exons, and is transcribed as an mRNA
of about 2.4 kb in Arabidopsis seedlings and in mature leaves. The
putative protein (SEQ ID NO: 2) encoded by the ELF3 ORF (SEQ ID NO:
4) is 695 amino acids in length and has a predicted molecular
weight of approximately 80 KDa.
[0188] Research by this group has recently identified several
putative ELF3 orthologs from other plant species, including
Cardamine oligosperma, tomato, rice, and maize (see Examples 4 and
5, below). GenBank accession numbers for ELF3 and putative ELF3
homologs identified as such by this research group are as follows:
AtELF3 (A. thaliana genomic DNA: AC004747, published Dec. 17,
1999), AtEEC (A. thaliana genomic DNA: AB023045, published Nov. 20,
1999), cELF3 (yet to be submitted), tELF3 [Lycopersicon esculentum
Expressed Sequence Tags (ESTs) from Clemson University Genomics
Institute: AW093790 (Oct. 18, 1999), AI894513 (Jul. 27, 1999),
AI488927 (Jun. 29, 1999), AI486934 (Jun. 29, 1999), AI894398 (Jul.
27, 1999)], rELF3 (Oryza sativa genomic DNA: AP000399, published
Dec. 3, 1999), and mELF3 (Zea mays EST from Stanford University
Genome Center: AI637184, published Apr. 26, 1999).
Example 2
Analysis of ELF3 Phenotype
[0189] Sensitive assays for monitoring circadian rhythm responses
in Arabidopsis have been developed (Millar and Kay, 1991; Millar et
al., 1992). One assay system is based on the observation that the
transcription of the chlorophyll a/b binding protein gene, CAB2,
cycles on a 24-hour period. Transcription from the CAB2 promoter
increases prior to subjective dawn, peaks in late morning, and
falls to a low level late in the day (Millar and Kay, 1991).
Cycling of CAB mRNA continues under constant light conditions. In
order to follow expression in vivo, the CAB2 promoter has been
fused to the gene encoding firefly luciferase (luc), and this
fusion has been transformed in wild-type Arabidopsis (Millar et
al., 1992). Transcriptional expression from the CAB2-luc fusion
construct is monitored by imaging single transgenic seedlings using
a low-light video camera and a photon-counting image processor; the
results from imaging the CAB2-luc fusion is comparable to the
transcriptional expression of the endogenous CAB2 gene. With this
system, over one hundred individual seedlings can be imaged every
30 minutes, thus allowing the collection of thousands of data
points in less than one week. This very powerful system has
recently been used to characterize several known photomorphogenic
Arabidopsis mutants (Millar et al., 1995a) and to isolate a
short-period mutant of Arabidopsis (Millar et al., 1995b). Elf3
mutants examined using this system are defective in circadian
regulated CAB2 transcription (Hicks et al., 1996).
[0190] An automatic video imaging system can also be used to
monitor a second circadian regulated process, leaf movement (Millar
and Kay, 1991). Plant leaves turn down (open) during the day and
turn up (closed) during the night in a circadian fashion.
Arabidopsis seedlings display this circadian leaf movement in
constant light, and this can be assayed and quantified using a
relatively inexpensive video and computer system (Millar and Kay,
1991). The analysis of leaf movements provides an independent
circadian regulated process with which to evaluate potential
circadian rhythm mutants (see, for instance, Schaffer et al. 1998,
using leaf movement to analyze circadian cycle disruption in late
elongated hypocotyl (lhy) mutants in Arabidopsis). Elf3 mutants are
also defective in circadian regulated leaf movements.
[0191] These assays may be used to assess the effect that modifying
ELF3 protein expression level (e.g., through introduction of ELF3
antisense or sense constructs into plants) has on plant
phenotype.
Example 3
Introducing ELF3 Sequences into Plants
[0192] Plasmid Construction
[0193] Arabidopsis ELF3 cDNA (SEQ ID NO: 1) and full-length genomic
(SEQ ID NO: 3) sequences were used in the construction of
over-expression and antisense vectors. These sequences were
operably linked to the CaMV 35S (constitutive) promoter, in both
the sense and antisense orientations, and cloned using standard
molecular biology techniques into pSJL4 (Jones et al. 1992).
[0194] The over-expression and antisense expression cassettes were
removed from the above vectors and inserted into pMON505 for
Agrobacterium-mediated plant transformation.
[0195] Plant Transformation
[0196] Wild-type and elf3 mutant Arabidopsis plants (ecotype
Columbia) were transformed using standard in planta
Agrobacterium-mediated techniques (Chang et al. 1994, Katavic et
al. 1994). Transformed seeds were selected on kanamycin, and
Kan.sup.R seedlings transferred to soil and grown for further
analysis.
[0197] Over-expression of ELF3 protein in elf3 mutant plants
comprising the ELF3 genomic gene sequence as the transgene resulted
in full complementation of the elf3 mutant phenotype in some
transformed plants. In some instances, over-expression of ELF3
protein from cDNA-based transgenes in wild-type plants produced
elf3 mutant-like plants or plants having intermediate phenotype;
this is probably the result of co-suppression. Antisense expression
of the full-length ELF3 cDNA in wild-type plants produced some
transformants with an elf3 mutant-like phenotype.
Example 4
ELF3 Orthologs
[0198] As noted above, orthologs of ELF3 exist in a number of plant
species including corn, tomato and tobacco. The existence of these
sequences may be demonstrated by hybridization techniques, such as
Southern blotting. Hybridization was performed using a probe based
on the entire ELF3 cDNA sequence (SEQ ID NO: 1). This probe was
hybridized to genomic DNA from Arabidopsis, Chlamydomonas, Douglas
fir, corn, rice, poplar, tobacco, and tomato. High stringency
hybridization was performed at 55.degree. C. in 6.times.SSC,
5.times. Denhardt's solution, 0.1% SDS and 100 .mu.g sheared salmon
testes DNA, followed by 15-30 minute sequential washes at
55.degree. C. in 2.times.SSC, 0.1% SDS, followed by 1.times.SSC,
0.1% SDS and finally 0.2.times.SSC, 0.1% SDS. A single, clean
hybridizing band was observed on the Southern blot in Arabidopsis,
rice, and tobacco genomic DNA preparations.
[0199] Lower stringency hybridization conditions were used to
detect less closely related ELF3 homologs. Such hybridization was
performed at 50.degree. C. for 24 hours in the hybridization
solution described above, followed by washing in 2.times.SSC, 0.1%
SDS at 50.degree. C. for 3 hours, with five sequential changes of
wash solution. Hybridization of full length cDNA probe under low
stringency hybridization conditions detected ELF3 homologs
(indicated by one or more bands on the Southern) in Arabidopsis,
Chlamydomonas, Douglas fir, corn, rice, poplar, tobacco, and tomato
and other plant species.
[0200] Once an ELF3-hybridizing band is detected in a plant
species, standard techniques such as screening cDNA or genomic
libraries from the plant with the ELF3 probe may be used.
Alternatively, ELF3 homologs may be isolated by screening an
expression library from the plant in question using a ELF3 protein
specific binding agent, such as an anti-ELF3 antibody produced as
described above. Such homologs may be introduced into plants using
the methods described above in order to produce altered circadian
rhythm and/or photoperiodic phenotypes.
[0201] It is also possible to use primers complementary to the
Arabidopsis ELF3 sequence to amplify orthologous nucleic acid
sequences. For example, an ELF3 ortholog has been isolated in this
manner from a Cardamine genomic DNA preparation, using the
following PCR amplification primers:
[0202] primer 5: 5' ATGAAGAGAGGGAAAGATGAGG 3' (SEQ ID NO:10)
[0203] primer 6: 5' GCCACCATCTCGGTATAACC 3' (SEQ ID NO:11).
Degenerate mixtures of oligonucleotides may also be used to amplify
orthologous nucleic acid sequences. The construction of degenerate
oligonucleotides is well known to one of ordinary skill in the
art.
[0204] Nucleotide sequences from C. oligospenna (a member of the
family Brassicaceae) were obtained by sequencing polymerase chain
reaction products using degenerate oligonucleotides to the
Arabidopsis ELF3 gene and genomic DNA or cDNA prepared from C.
oligosperma seedlings using standard techniques. The sequence of
the amplified Cardamine ELF3 ortholog (cELF3) is shown in SEQ ID
NO: 12.
Example 5
Consensus Sequences Within the ELF3 Protein and Homologs
Thereof
[0205] Computerized, searchable databases were searched for
sequences having significant homology the Arabidopsis ELF3 cDNA and
genomic nucleotide sequences depicted herein, and the Cardamine
ELF3 ortholog nucleotide sequence (SEQ ID NO: 12).
[0206] This search yielded several putative ELF3 homologs. GenBank
accession numbers for ELF3 and the putative ELF3 homologs
identified as such by this research group are as follows: AtELF3
(A. thaliana genomic DNA: AC004747), AtEEC (A. thaliana genomic
DNA: AB023045), cELF3 (yet to be submitted), tELF3 (Lycopersicon
esculentum Expressed Sequence Tags (ESTs) from Clemson University
Genomics Institute: AW093790, AI894513, AI488927, AI486934,
AI894398), rELF3 (Oryza sativa genomic DNA: AP000399), and mELF3
(Zea mays EST from Stanford University Genome Center:
AI637184).
[0207] Multiple sequence alignment of the ELF3 proteins (FIGS. 1
and 2) shows four highly conserved regions within ELF3 and putative
ELF3 homologs from Arabidopsis thaliana (Essence of ELF3 Consensus,
EEC) and other plant species (Cardamine oligosperma, tomato, rice,
and maize) (FIG. 2). Sequences were aligned and analyzed using
CLUSTAL W (Thompson et al., Nucleic Acids Res. 22, 4673-80, 1994)
and PrettyBox (Genetics Computer Group, Inc.). Protein designations
are given on the left. Amino acid residues are numbered on both the
left and right. Residues shaded in black indicate identity of at
least three ELF3/ELF3-related sequences in the alignment;
light-shaded residues indicate similarity to consensus.
Example 6
Additional ELF3 Orthologs
[0208] The ELF3 sequences and consensus sequences isolated as
described above were used additional similar sequences from other
plant species, using nucleic acid amplification and/or computer
database searches. Additional ELF3 orthologs have been identified
in Medicago trunculata (SEQ ID NOs: 36-39), Pisum sativa (SEQ ID
NOs: 4043), Glycine max (SEQ ID NOs: 44- and 45), Xanthium (SEQ ID
NOs: 46-51), Poplar (SEQ ID NOs: 52-53), Mimulus (SEQ ID NOs: 54
and 55), Zea mays (SEQ ID NOs: 56 and 57), Lycopersicon esculentum
(SEQ ID NOs: 58 and 59), and Broccoli (SEQ ID NOs: 60-63). Nucleic
acid amplification, particularly polymerase chain amplification
(PCR) also was used to confirm several of these sequences. For
isolation and/or confirmation, amplification reactions were
annealed at 55.degree. C. and extended for 35 seconds per round.
The primers used were as follows: TABLE-US-00005 Amplified ortholog
Forward primer Reverse primer Pisum sativa B-FWD, SEQ ID NO: 66
C-REV, SEQ ID NO: 68 (SEQ ID NO: 40) Pisum sativa Pea1b-C-FWD, SEQ
ID D-REV, SEQ ID NO: 65 (SEQ ID NO: 42) NO: 67 first round Pisum
sativa C-FWD, SEQ ID NO: 64 D-REV, SEQ ID NO: 65 (SEQ ID NO: 42)
second round Xanthium B-FWD, SEQ ID NO: 66 C-REV, SEQ ID NO: 68
(SEQ ID NO: 46) Xanthium B-FWD, SEQ ID NO: 66 C-REV, SEQ ID NO: 68
(SEQ ID NO: 48) Xanthium C-FWD, SEQ ID NO: 64 D-REV, SEQ ID NO: 65
(SEQ ID NO: 50) Poplar C-FWD, SEQ ID NO: 64 D-REV, SEQ ID NO: 65
(SEQ ID NO: 52) Mimulus C-FWD, SEQ ID NO: 64 D-REV, SEQ ID NO: 65
(SEQ ID NO: 54) Zea mays B-FWD, SEQ ID NO: 66 C-REV, SEQ ID NO: 68
(SEQ ID NO: 56) Zea mays C-FWD, SEQ ID NO: 64 D-REV, SEQ ID NO: 65
(SEQ ID NO: 56) Broccoli C-FWD, SEQ ID NO: 64 D-REV, SEQ ID NO: 65
(SEQ ID NO: 62) The amplified products were of the expected
sizes.
[0209] The foregoing examples are provided by way of illustration
only. One of skill in the art will appreciate that numerous
variations on the biological molecules and methods described above
may be employed to make and use the ELF3 gene, corresponding
protein, and promoter region. We claim all such subject matter that
falls within the scope and spirit of the following claims.
REFERENCES
[0210] Ainley et al. (1993) Plant Mol. Biol. 22:13-23. [0211]
Altschul et al. (1990). J. Mol. Biol., 215, 403-10 [0212] Altschul
et al. (1994). Nature Genet., 6, 119-29. [0213] An et al. (1988)
Plant Physiol. 88:547. [0214] Aronson et al. (1994) Science
263:1578-1584. [0215] Ausubel et al. (1987) In Current Protocols in
Molecular Biology, Greene Publishing Associates and
Wiley-Intersciences. [0216] Benfey and Chua (1990) Science
250:959-966. [0217] Bernier (1988) Ann. Rev. Plant Phys. and Plant
Mol. Bio. 39:175-219. [0218] Bustos et al. (1989) Plant Cell 1:839.
[0219] Callis et al. (1988) Plant Physiol. 88:965. [0220] Carpenter
et al. (1992) The Plant Cell 4:557-571. [0221] Chang et al. (1994)
Plant J. 5:551-558. [0222] Chang et al. (1986) Mol. And Cell. Biol.
6:1812-1819. [0223] Corpet et al. (1988). Nucleic Acids Research
16, 10881-90. [0224] Dekeyser et al. (1990) Plant Cell 2:591.
[0225] Denis et al. (1993) Plant Physiol. 101: 1295-1304. [0226]
Dunlap (1993) Annu. Rev. Physiol. 55:683. [0227] Edery et al.
(1994) Science 263:237-240. [0228] Fromm et al. (1989) Plant Cell
1:977. [0229] Gatz et al. (1997) Ann. Rev. Plant Physiol. Plant
Mol. Biol. 48:89-108. [0230] Gelvin et al. (1990) Plant Molecular
Biology Manual, Kluwer Academic Publishers. [0231] Gilmartin et al.
(1992) The Plant Cell 4:839-949. [0232] Hall (1990) Ann. Rev.
Genet. 24:659. [0233] Harlow & Lane (1988) Antibodies, A
Laboratory Manual, Cold Spring Harbor Laboratory, New York. [0234]
Hicks et al. (1996) Science 274(5288):790-792. [0235] Higgins and
Sharp (1988). Gene, 73: 237-244. [0236] Higgins and Sharp (1989).
CABIOS 5: 151-153. [0237] Huang et al. (1992). Computer
Applications in the Biosciences 8, 155-65. [0238] Hulskamp et al.
(1990) Nature 346:577-580. [0239] Innis et al. (eds.) (1990) PCR
Protocols, A Guide to Methods and Applications, Academic Press,
Inc., San Diego, Calif. [0240] Jones et al. (1992) Transgenic Res.
1:285-297. [0241] Katavic et al. (1994) Mol. Gen. Genet.
245:363-370. [0242] Koornneef et al. (1991) Mol. Gen. Genet.
229:57-66. [0243] Kuhlemeier et al. (1989) Plant Cell 1: 471.
[0244] Lambie and Kimble (1991) Development 112:231-240. [0245]
Liang & Richardson (1993) J. Agric. Food Chem. 41:1800-1807.
[0246] Marcotte et al. (1989) Plant Cell 1:969. [0247] Millar et
al. (1995a) Science 267(5201):1163-1166. [0248] Millar et al.
(1995b) Science 267(5201):1161-1163. [0249] Millar et al. (1992)
Plant Cell 4:1075-1087. [0250] Millar and Kay (1991) Plant Cell
3:541-550. [0251] Mozo et al. (1998) Mo. Gen. Genet.
258(5):562-570. [0252] Murfet (1985) Pisum sativum. In Handbook of
Flowering Plants Vol. IV, ed. A. H. Halevy. (CRC Press: Boca Raton,
Fla.), pp. 97-126. [0253] Needleman and Wunsch (1970). J. Mol.
Biol. 48: 443. [0254] Newman et al. (1994) Plant Physiol. 106(4):
1241-1255. [0255] Odel et al. (1985) Nature 313:810. [0256]
Opperman et al. (1993) Science 263:221-223. [0257] Pearson and
Lipman (1988). Proc. Natl. Acad. Sci. USA 85: 2444. [0258] Pearson
et al. (1994). Methods in Molecular Biology 24, 307-31. [0259]
Pouwels et al. (1987) Cloning Vectors: A Laboratory Manual, 1985,
supp. [0260] Roshal et al. (1987) EMBO J. 6:1155. [0261] Sambrook
et al. (1989) In Molecular Cloning: A Laboratory Manual, Cold
Spring Harbor, N.Y. [0262] Schaffer et al. (1998) Cell
93:1219-1229. [0263] Schaffner & Sheen (1991) Plant Cell 3:997.
[0264] Schernthaner et al. (1988) EMBO J. 7:1249. [0265] Shannon
and Meeks-Wagner (1991) Plant Cell 3:877-892. [0266] Siebertz et
al. (1989) Plant Cell 1:961. [0267] Smith et al. (1985) Science
229:1219-1224. [0268] Smith and Waterman (1981). Adv. Appl. Math.
2: 482. [0269] Stockhause et al. (1997) The Plant Cell 9:479-489.
[0270] Terada & Shimamoto (1990) Mol. Gen. Genet. 220:389.
[0271] Tijssen (1993). Laboratory Techniques in Biochemistry and
Molecular Biology--Hybridization with Nucleic Acid Probes Part I,
Chapter 2 "Overview of principles of hybridization and the strategy
of nucleic acid probe assays", Elsevier, New York. [0272] Wang
& Tobin (1998) Cell 93:1207-1217. [0273] Weissbach &
Weissbach (1989) Methods for Plant Molecular Biology, Academic
Press. [0274] Zagotta et al. (1992) Aust. J. Plant Physiol.
19:411-418. [0275] Zagotta et al. (1996) Plant J.
10(4):691-702.
* * * * *