U.S. patent application number 11/335175 was filed with the patent office on 2006-12-07 for direct multiplex characterization of genomic dna.
Invention is credited to Ronald W. Davis, Paul Hardenbol, Maneesh Jain, Mostafa Ronaghi, Viktor Stolc, Thomas D. Willis.
Application Number | 20060275789 11/335175 |
Document ID | / |
Family ID | 22916584 |
Filed Date | 2006-12-07 |
United States Patent
Application |
20060275789 |
Kind Code |
A1 |
Willis; Thomas D. ; et
al. |
December 7, 2006 |
Direct multiplex characterization of genomic DNA
Abstract
The invention is directed to novel methods of multiplexing
nucleic acid reactions, including amplification, detection and
genotyping. The invention relies on the use of precircle probes
that are circularized in the presence of the corresponding target
nucleic acids, cleaved, and then amplified.
Inventors: |
Willis; Thomas D.; (San
Francisco, CA) ; Hardenbol; Paul; (Los Altos, CA)
; Jain; Maneesh; (Menlo Park, CA) ; Stolc;
Viktor; (Cupertino, CA) ; Ronaghi; Mostafa;
(Palo Alto, CA) ; Davis; Ronald W.; (Palo Alto,
CA) |
Correspondence
Address: |
FISH & NEAVE IP GROUP;ROPES & GRAY
ONE INTERNATIONAL PLACE
BOSTON
MA
02110
US
|
Family ID: |
22916584 |
Appl. No.: |
11/335175 |
Filed: |
January 19, 2006 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10826633 |
Apr 15, 2004 |
|
|
|
11335175 |
Jan 19, 2006 |
|
|
|
09999362 |
Oct 24, 2001 |
6858412 |
|
|
10826633 |
Apr 15, 2004 |
|
|
|
60242901 |
Oct 24, 2000 |
|
|
|
Current U.S.
Class: |
435/6.12 |
Current CPC
Class: |
C12Q 1/686 20130101;
C12Q 1/6858 20130101; C12Q 2525/307 20130101; C12Q 2531/113
20130101; C12Q 2537/143 20130101; C12Q 1/686 20130101; C12Q 1/6827
20130101; C12Q 1/6827 20130101 |
Class at
Publication: |
435/006 |
International
Class: |
C12Q 1/68 20060101
C12Q001/68 |
Goverment Interests
GOVERNMENT INTERESTS
[0002] This invention was made with government support under
HG00205 awarded by the National Institutes of Health. The
government has certain rights in the invention.
Claims
1. A method for detecting a target sequence comprising a first and
second target domain in a sample, said method comprising: a)
hybridizing said target sequence to a precircle probe to form a
first hybridization complex, said precircle probe comprising: i) a
first targeting domain; ii) a second targeting domain; iii) at
least a first universal priming site; and iv) a cleavage site;
wherein said first and second targeting domains hybridize to said
first and second target domains; b) contacting said first
hybridization complex with a ligase to form a closed circular
probe; c) cleaving said closed circular probe at said cleavage site
to form a cleaved probe; d) amplifying said cleaved probe to form a
plurality of amplicons; and e) detecting said amplicons to detect
the presence of said target sequence in said sample.
2. A method according to claim 1 wherein said amplifying is done by
contacting said cleaved probe with: a) at least a first universal
primer; b) an extension enzyme; and c) NTPs.
3. A method according to claim 2 wherein said extension enzyme is a
polymerase.
4. A method according to claim 1, wherein said precircle probe
further comprises a second universal priming site, and said second
contacting step further comprises contacting said cleaved probe
with a second universal primer.
5. A method according to claim 4, wherein said cleavage site is
between said first and second universal priming site.
6. A method according to claim 1, wherein said target sequence
further comprises a gap domain between said first and second target
domains and said method further comprises the additional step of
contacting said first hybridization complex with an extension
enzyme and at least one interrogation NTP prior to forming said
closed circular probe.
7. A method according to claim 1, wherein said target sequence
further comprises a gap domain between said first and second target
domains and said method further comprises the additional step of
contacting said first hybridization complex with at least one gap
oligonucleotide prior to forming said closed circular probe, said
gap oligonucleotide having a nucleic acid sequence perfectly
complementary to said gap domain, wherein detecting said amplicons
identifies said gap domain.
8. A method according to claim 1, wherein said target sequence
further comprises a gap domain between said first and second target
domains and said precircle probe further comprises a 3' or 5' most
detection domain comprising one or more nucleic acids perfectly
complementary to said gap domain, wherein detecting said amplicons
identifies said gap domain.
9. A method according to claim 8, wherein said detection domain is
joined to said second targeting domain.
10. A method according to claim 8, wherein said gap domain is from
one to about 1000 nucleotides.
11. A method according to claim 8, wherein said gap domain
corresponds to a single nucleotide polymorphism in said target
sequence.
12. A method according to claim 1, comprising the additional step
of digesting any linear precircle probes prior to cleaving said
closed circular probe.
13. A method according to claim 1 further comprising degrading any
dNTPs prior to the addition of said interrogation dNTPs.
14. A method according to claim 13 wherein said degrading is done
with apyrase.
15. A method according to claim 1, wherein said cleavage site is a
uracil and said cleavage step comprises contacting said closed
circular probe with uracil-N-glycolylase.
16. A method according to claim 1, wherein said cleavage site is a
restriction site and said cleavage step comprises contacting said
closed circular probe with a restriction enzyme.
17. A method according to claim 1, wherein said at least one of
said universal primers is labeled.
18. A method according to claim 1, wherein at least one of said
NTPs is labeled.
19. A method according to claim 17 or 18, wherein said label
comprises biotin and said method further comprises the additional
step of separating biotinylated amplicons prior to said
amplification step.
20. A method for detecting a target sequence in a sample, said
target sequence comprising a first and second target domain and a
gap domain between said first and second target domains, said
method comprising: a) hybridizing at least one of a plurality of
precircle probes to said target sequence to form a plurality of
first hybridization complexes, said precircle probes each
comprising: i) a first targeting domain; ii) a second targeting
domain; iii) a detection domain; iv) at least a first universal
priming site; v) a cleavage site; and vi) a barcode sequence;
wherein said plurality of first and second targeting domains are
complementary to said plurality of first and second target domains
and said gap domain will hybridize to at least one of said
plurality of detection domains; b) contacting said plurality of
first hybridization complexes with a ligase to form a plurality of
closed circular probes; c) cleaving said plurality of closed
circular probes at said cleavage sites to form a plurality of
cleaved probes; d) amplifying said cleaved probes to form
amplicons; and e) detecting the presence of said amplicons to
detect the presence of said plurality of target sequences in said
sample.
21. A method according to claim 20 wherein said amplifying is done
by contacting said cleaved probe with: a) at least a first
universal primer; b) an extension enzyme; and c) NTPs.
22. A method according to claim 21 wherein said extension enzyme is
a polymerase.
23. A method according to claim 20, wherein said plurality of
precircle probes each further comprise a second universal priming
site, and said contacting step further comprises contacting said
plurality of cleaved probes with a second universal primer.
24. A method according to claim 22, wherein said cleavage site is
between said first and second universal priming site.
25. A method according to claim 20, wherein said target sequence
further comprises a gap domain between said first and second target
domains and said plurality of precircle probes each comprise a
unique barcode and further comprise a 3' or 5' most detection
domain comprising one or more nucleic acids complementary to said
gap domain, wherein detecting said barcode identifies said gap
domain.
26. A method for detecting in a sample a plurality of target
sequences, wherein each of said plurality of target sequences
comprises first and second target domains, said method comprising:
a) hybridizing said plurality of target sequences to a plurality of
precircle probes to form a plurality of first hybridization
complexes, each of said precircle probes comprising: i) a first
targeting domain; ii) a second targeting domain; iii) at least a
first universal priming site; iv) a cleavage site; and v) a
barcode; wherein said plurality of first and second targeting
domains hybridize to said plurality of first and second target
domains; b) contacting said plurality of first hybridization
complexes with a ligase to form a plurality of closed circular
probes; c) cleaving said plurality of closed circular probes at
said cleavage sites to form a plurality of cleaved probes; d)
amplifying said cleaved probes to form amplicons; and e) detecting
the presence of said amplicons to detect the presence of said
plurality of target sequences in said sample.
27. A method according to claim 26 wherein said amplifying is done
by contacting said cleaved probe with: a) at least a first
universal primer; b) an extension enzyme; and c) NTPs.
28. A method according to claim 27 wherein said extension enzyme is
a polymerase.
29. A method according to claim 26, wherein said plurality of
precircle probes each further comprise a second universal priming
site, and said contacting step further comprises contacting said
plurality of cleaved probes with a second universal primer.
30. A method according to claim 29, wherein said cleavage site is
between said first and second universal priming site.
31. A method according to claim 26, wherein said plurality of
target sequences each further comprise a gap domain between said
first and second target domains, and said method further comprises
the additional step of contacting said plurality of first
hybridization complexes with a polymerase and at least one dNTP
prior to contacting said complexes with said ligase to form a
plurality of said closed circular probes.
32. A method according to claim 26, wherein said plurality of
target sequences each further comprise a gap domain between said
first and second target domains, and said method further comprises
the additional step of contacting said plurality of first
hybridization complexes with at least one gap oligonucleotide prior
to forming said plurality of closed circular probes, said gap
oligonucleotide having a nucleic acid sequence complementary to at
least one of said plurality of gap domains, wherein detecting said
amplicons identifies said gap domains.
33. A method according to claim 26, wherein said plurality of
target sequences each further comprise a gap domain between said
first and second target domains, and wherein said plurality of
precircle probes each comprise a unique barcode and further
comprise a detection region comprising one or more nucleic acids
complementary to at least one of said gap domains.
34. A method for identifying the base at a detection position in a
target sequence comprising a first and second target domain
separated by a gap domain, said gap domain comprising said
detection position, said method comprising: a) hybridizing said
target sequence to a precircle probe to form a first hybridization
complex, said precircle probe comprising: i) a 5' first targeting
domain; ii) a 3' second targeting domain; iii) at least a first
universal priming site; and iv) a cleavage site; wherein said first
and second targeting domains hybridize to said first and second
target domains; b) contacting said first hybridization complex with
a polymerase and at least one interrogation dNTP to form an
extended precircle probe; c) contacting said first hybridization
complex comprising said extended precircle probe and said target
sequence with a ligase to form a closed circular probe; d) cleaving
said closed circular probe at said cleavage site to form a cleaved
probe; e) amplifying said cleaved probe to form a plurality of
amplicons; f) detecting the presence of said amplicons to detect
the presence of said target sequence in said sample.
35. A method according to claims 34, further comprising degrading
any dNTPs prior to the addition of said interrogation dNTPs.
36. A method according to claim 35 wherein said degrading is done
with apyrase.
37. A method for amplifying a target sequence comprising a first
and second target domain in a sample, said method comprising: a)
hybridizing said target sequence to a precircle probe to form a
first hybridization complex, said precircle probe comprising: i) a
first targeting domain; ii) a second targeting domain; iii) at
least a first universal priming site; and iv) a cleavage site;
wherein said first and second targeting domains hybridize to said
first and second target domains; b) contacting said first
hybridization complex with a ligase to form a closed circular
probe; c) cleaving said closed circular probe at said cleavage site
to form a cleaved probe; and d) amplifying said cleaved probe.
38. A method according to claim 37, wherein said target sequence
further comprises a gap domain between said first and second target
domains, and said method further comprises the additional step of
contacting said first hybridization complex with a polymerase and
at least one NTP prior to contacting said complex with said ligase
to form said closed circular probes.
39. A method according to any of claims 37, comprising the
additional step of digesting any linear precircle probes prior to
cleaving said closed circular probe.
40. A method for detecting a target sequence comprising a first and
second target domain in a sample, said method comprising: a)
hybridizing said target sequence to a precircle probe to form a
first hybridization complex, said precircle probe comprising: i) a
first targeting domain; ii) a second targeting domain; and iii) at
least a first universal priming site; wherein said first and second
targeting domains hybridize to said first and second target
domains; b) contacting said first hybridization complex with a
ligase to form a closed circular probe; c) contacting said closed
circular probe at least a first universal primer, an extension
enzyme and NTPs to form an extension product; d) amplifying said
extension product to form amplicons; and e) detecting said
amplicons to detect the presence of said target sequence in said
sample.
41. A method according to claim 40 wherein said amplifying is done
by contacting said extension product with: a) at least a first
universal primer; b) an extension enzyme; and c) NTPs.
42. A method according to claim 40, wherein said target sequence
further comprises a gap domain between said first and second target
domains and said method further comprises the additional step of
contacting said first hybridization complex with an extension
enzyme and at least one interrogation NTP prior to forming said
closed circular probe.
43. A method according to claim 40, wherein said target sequence
further comprises a gap domain between said first and second target
domains and said method further comprises the additional step of
contacting said first hybridization complex with at least one gap
oligonucleotide prior to forming said closed circular probe, said
gap oligonucleotide having a nucleic acid sequence perfectly
complementary to said gap domain, wherein detecting said amplicons
identifies said gap domain.
44. A method according to claim 40, wherein said target sequence
further comprises a gap domain between said first and second target
domains and said precircle probe further comprises a 3' or 5' most
detection domain comprising one or more nucleic acids perfectly
complementary to said gap domain, wherein detecting said amplicons
identifies said gap domain.
45. A method according to claim 40, wherein said precircle probe
further comprises at least one cleavage site and said closed
circular probe is cleaved prior to amplifying said extension
product.
46. A method according to claim 41, wherein said at least one
cleavage site comprises uracil and said cleavage step comprises
contacting said closed circular probe with
uracil-N-glycolylase.
47. A method according to claim 45, wherein said cleavage site is a
restriction site and said cleavage step comprises contacting said
closed circular probe with a restriction enzyme.
Description
[0001] This is a continuing application of U.S. Ser. No.
60/242,901, filed Oct. 24, 2000, which is expressly incorporated by
reference herein.
FIELD OF THE INVENTION
[0003] The invention is directed to novel methods of multiplexing
nucleic acid reactions, including amplification, detection and
genotyping. The invention relies on the use of precircle probes
that are circularized in the presence of the corresponding target
nucleic acids, cleaved, and then amplified.
BACKGROUND OF THE INVENTION
[0004] Human diseases arise from a complex interaction of DNA
polymorphisms or mutations and environmental factors. Single
nucleotide polymorphisms (SNPs) have recently been identified as
potentially powerful means for genetic typing, and are predicted to
supersede microsatellite repeat analysis as the standard for
genetic association, linkage, and mapping studies.
[0005] The major goal in human genetics is to ascertain the
relationship between DNA sequence variation and phenotypic
variation. For these studies, molecular polymorphisms are
indispensable for conventional meiotic mapping, fine-structure
mapping and haplotype analysis. However, with the contemplated
sequencing of a reference human genome and identification of all
human genes, studies of complex genetic disorders are expected to
be more efficient if one were to systematically search all human
genes for functional variants by association and linkage
disequilibrium studies. This requires the development of technology
and methods for the systematic discovery of genetic variation in
human DNA, primarily the single nucleotide polymorphisms (SNPs)
which are the most abundant.
[0006] Several different types of polymorphism have been reported.
A restriction fragment length polymorphism (RFLP) means a variation
in DNA sequence that alters the length of a restriction fragment as
described in Botstein et al., Am. J. Hum. Genet. 32, 314-331
(1980). The restriction fragment length polymorphism may create or
delete a restriction site, thus changing the length of the
restriction fragment. RFLPs have been widely used in human and
animal genetic analyses (see WO 90/13668; WO90/11369; Donis-Keller,
Cell 51, 319-337 (1987); Lander et al., Genetics 121, 85-99
(1989)). When a heritable trait can be linked to a particular RFLP,
the presence of the RFLP in an individual can be used to predict
the likelihood that the animal will also exhibit the trait.
[0007] Other polymorphisms take the form of short tandem repeats
(STRs) that include tandem di-, tri- and tetra-nucleotide repeated
motifs. These tandem repeats are also referred to as variable
number tandem repeat (VNTR) polymorphisms. VNTRs have been used in
identity and paternity analysis (U.S. Pat. No. 5,075,217; Armour et
al., FEBS Lett. 307, 113-115 (1992); Horn et al., WO 91/14003;
Jeffreys, EP 370,719), and in a large number of genetic mapping
studies.
[0008] Other polymorphisms take the form of single nucleotide
variations between individuals of the same species. Such
polymorphisms are far more frequent than RFLPs, STRs and VNTRs.
Some single nucleotide polymorphisms occur in protein-coding
sequences, in which case, one of the polymorphic forms may give
rise to the expression of a defective or other variant protein.
Other single nucleotide polymorphisms occur in noncoding regions.
Some of these polymorphisms may also result in defective or variant
protein expression (e.g., as a result of defective splicing). Other
single nucleotide polymorphisms have no phenotypic effects. Single
nucleotide polymorphisms occur with greater frequency and are
spaced more uniformly throughout the genome than other forms of
polymorphism. The greater frequency and uniformity of single
nucleotide polymorphisms means that there is a greater probability
that such a polymorphism will be found in close proximity to a
genetic locus of interest than would be the case for other
polymorphisms. The presence of SNPs may be linked to, for example,
a certain population, a disease state, or a propensity for a
disease state.
[0009] Generally, polymorphisms can be associated with the
susceptibility to develop a certain disease or condition. The
presence of polymorphisms that cause a change in protein structure
are more likely to correlate with the likelihood to develop a
certain type or "trait." Thus, it is highly desirable to dispose of
methods that allow quick and cheap genotyping of subjects. Early
identification of alleles that are linked to an increased
likelihood of developing a condition would allow early intervention
and prevention of the development of the disease.
[0010] Pharmacogenomics is the study of the relationship between an
individual's genotype and that individual's response to a foreign
compound or drug. Differences in metabolism of therapeutics can
lead to severe toxicity or therapeutic failure by altering the
relation between dose and blood concentration of the
pharmacologically active drug. Thus, a physician or clinician may
consider applying knowledge obtained in relevant pharmacogenomics
studies in determining the type of drug and dosage and/or
therapeutic regimen of treatment.
[0011] Pharmacogenomics deals with clinically significant
hereditary variations in the response to drugs due to altered drug
disposition and abnormal action in affected persons. See, for
example, Eichelbaum, M. et al. (1996) Clin. Exp. Pharmacol.
Physiol. 23(10-11):983-985 and Linder, M. W. et al. (1997) Clin.
Chem. 43(2):254-266. In general, two types of pharmacogenetic
conditions can be differentiated. Genetic conditions transmitted as
a single factor altering the way drugs act on the body (altered
drug action) or genetic conditions transmitted as single factors
altering the way the body acts on drugs (altered drug metabolism).
These pharmacogenetic conditions can occur either as rare genetic
defects or as naturally-occurring polymorphisms. For example,
glucose-6-phosphate dehydrogenase deficiency (G6PD) is a common
inherited enzymopathy in which the main clinical complication is
haemolysis after ingestion of oxidant drugs (anti-malarials,
sulfonamides, analgesics, nitrofarans) and consumption of fava
beans. Thus, it would be highly desirable to dispose of fast and
cheap methods for determining a subject's genotype so as to predict
the best treatment.
[0012] Thus, there is a considerable demand for high throughput,
very low cost nucleotide sequence (e.g., SNPs) identification in
regions of known sequence in order to identify alleles of
polymorphic genes, e.g., SNPs. There are currently many methods
available to screen polymorphisms, e.g., SNPs. A typical genotyping
strategy involves three basic steps. The first step consists of
amplifying the target DNA, which is necessary since a human genome
contains 3.times.10.sup.9 base pairs of DNA and most assays lack
both the sensitivity and the selectivity to accurately detect a
small number of bases, in particular a single base, from a mixture
this complex. As a result, most strategies currently used rely on
first amplifying a region of several hundred bases including the
polymorphic region to be screened using PCR. This reaction requires
2 unique primers for each amplified region ("amplicon"). Once the
complexity has been reduced, the second step in the currently used
methods consists of differentially labeling the alleles so as to be
able to identify the genotype. This step involves attaching some
identifiable marker (e.g. fluorescent label, mass tag, etc.) in a
manner which is specific to the base being assayed. The third step
in currently used methods consists of detecting the allele to
determine the individuals genotypes. Detection mechanisms include
fluorescent signals, the polarization of a fluorescent signal, mass
spectrometry to identify mass tags, etc.
[0013] Sensitivity, i.e. detection limits, remain a significant
obstacle in nucleic acid detection systems, and a variety of
techniques have been developed to address this issue. Briefly,
these techniques can be classified as either target amplification
or signal amplification. Target amplification involves the
amplification (i.e. replication) of the target sequence to be
detected, resulting in a significant increase in the number of
target molecules. Target amplification strategies include the
polymerase chain reaction (PCR), strand displacement amplification
(SDA), and nucleic acid sequence based amplification (NASBA).
[0014] Alternatively, rather than amplify the target, alternate
techniques use the target as a template to replicate a signaling
probe, allowing a small number of target molecules to result in a
large number of signaling probes, that then can be detected. Signal
amplification strategies include the ligase chain reaction (LCR),
cycling probe technology (CPT), invasive cleavage techniques such
as Invader.TM. technology, Q-Beta replicase (Q.beta.R) technology,
and the use of "amplification probes" such as "branched DNA" that
result in multiple label probes binding to a single target
sequence.
[0015] The polymerase chain reaction (PCR) is widely used and
described, and involves the use of primer extension combined with
thermal cycling to amplify a target sequence; see U.S. Pat. Nos.
4,683,195 and 4,683,202, and PCR Essential Data, J. W. Wiley &
sons, Ed. C. R. Newton, 1995, all of which are incorporated by
reference. In addition, there are a number of variations of PCR
which also find use in the invention, including "quantitative
competitive PCR" or "QC-PCR", "arbitrarily primed PCR" or "AP-PCR",
"immuno-PCR", "Alu-PCR", "PCR single strand conformational
polymorphism" or "PCR-SSCP", allelic PCR (see Newton et al. Nucl.
Acid Res. 17:2503 91989); "reverse transcriptase PCR" or "RT-PCR",
"biotin capture PCR", "vectorette PCR". "panhandle PCR", and "PCR
select cDNA subtraction", among others.
[0016] Strand displacement amplification (SDA) is generally
described in Walker et al., in Molecular Methods for Virus
Detection, Academic Press, Inc., 1995, and U.S. Pat. Nos. 5,455,166
and 5,130,238, all of which are hereby incorporated by
reference.
[0017] Nucleic acid sequence based amplification (NASBA) is
generally described in U.S. Pat. No. 5,409,818 and "Profiting from
Gene-based Diagnostics", CTB International Publishing Inc., N.J.,
1996, both of which are incorporated by reference.
[0018] Cycling probe technology (CPT) is a nucleic acid detection
system based on signal or probe amplification rather than target
amplification, such as is done in polymerase chain reactions (PCR).
Cycling probe technology relies on a molar excess of labeled probe
which contains a scissile linkage of RNA. Upon hybridization of the
probe to the target, the resulting hybrid contains a portion of
RNA:DNA. This area of RNA:DNA duplex is recognized by RNAseH and
the RNA is excised, resulting in cleavage of the probe. The probe
now consists of two smaller sequences which may be released, thus
leaving the target intact for repeated rounds of the reaction. The
unreacted probe is removed and the label is then detected. CPT is
generally described in U.S. Pat. Nos. 5,011,769, 5,403,711,
5,660,988, and 4,876,187, and PCT published applications WO
95/05480, WO 95/1416, and WO 95/00667, all of which are
specifically incorporated herein by reference.
[0019] The oligonucleotide ligation assay (OLA; sometimes referred
to as the ligation chain reaction (LCR)) involves the ligation of
at least two smaller probes into a single long probe, using the
target sequence as the template for the ligase. See generally U.S.
Pat. Nos. 5,185,243, 5,679,524 and 5,573,907; EP 0 320 308 B1; EP 0
336 731 B1; EP 0 439 182 B1; WO 90/01069; WO 89/12696; and WO
89/09835, all of which are incorporated by reference.
[0020] Invader.TM. technology is based on structure-specific
polymerases that cleave nucleic acids in a site-specific manner.
Two probes are used: an "invader" probe and a "signaling" probe,
that adjacently hybridize to a target sequence with a
non-complementary overlap. The enzyme cleaves at the overlap due to
its recognition of the "tail", and releases the "tail" with a
label. This can then be detected. The Invader.TM. technology is
described in U.S. Pat. Nos. 5,846,717; 5,614,402; 5,719,028;
5,541,311; and 5,843,669, all of which are hereby incorporated by
reference.
[0021] None of the methods currently used are particularly well
suited to very high throughput at low cost. One of the principal
shortcomings of the available methods are their reliance on the
Polymerase Chain Reaction (PCR) in order to generate relatively
simple DNA template for polymorphism analysis (i.e., genotyping).
This reaction is not easily multiplexed which implies that each
assay for identifying a particular polymorphism requires a separate
reaction. This makes any high throughput assay cumbersome and
expensive as millions of reactions will have to be performed in
order to screen the requisite number of polymorphism. Thus, there
is a need for a method that allows thousands of polymorphic
regions, e.g., SNPs to be analyzed and quantified in a single
reaction vessel, greatly increasing the throughput and decreasing
the cost of analysis.
SUMMARY OF THE INVENTION
[0022] In accordance with the objects outlined above, the present
invention provides methods for detecting a target sequence
comprising a first and second target domain in a sample. The method
comprises hybridizing the target sequence to a precircle probe to
form a first hybridization complex. The precircle probe comprises:
a first targeting domain, a second targeting domain, at least a
first universal priming site and a cleavage site. The first and
second targeting domains hybridize to the first and second target
domains. The first hybridization complex is contacted with a ligase
to form a closed circular probe, and cleaving the closed circular
probe at the cleavage site to form a cleaved probe. The cleaved
probed is amplified to form a plurality of amplicons and the
amplicons are detected to detect the presence of said target
sequence in said sample. The precircle probe can optionally
comprise a second universal priming site, and the second contacting
step further comprises contacting the cleaved probe with a second
universal primer. The cleavage site is optionally situated between
the first and second universal priming sites.
[0023] In addition the target sequence may further comprise a gap
domain between the first and second target domains. The method
further comprises the additional step of contacting the first
hybridization complex with an extension enzyme and at least one
interrogation NTP prior to forming the closed circular probe.
Alternatively, the method further comprises the additional step of
contacting said first hybridization complex with at least one gap
oligonucleotide prior to forming said closed circular probe, said
gap oligonucleotide having a nucleic acid sequence perfectly
complementary to said gap domain, wherein detecting said amplicons
identifies said gap domain.
[0024] In an additional aspect, the method further comprises the
additional step of digesting any linear precircle probes prior to
cleaving said closed circular probe.
[0025] In an additional aspect, the method further comprises the
additional step of degrading any dNTPs prior to the addition of
said interrogation dNTPs.
[0026] In a further aspect, the invention provides methods for
detecting a target sequence in a sample, said target sequence
comprising a first and second target domain and a gap domain
between said first and second target domains, said method
comprising: [0027] a) hybridizing at least one of a plurality of
precircle probes to said target sequence to form a plurality of
first hybridization complexes, said precircle probes each
comprising: [0028] i) a first targeting domain; [0029] ii) a second
targeting domain; [0030] iii) a detection domain; [0031] iv) at
least a first universal priming site; [0032] v) a cleavage site;
and [0033] vi) a barcode sequence; [0034] wherein said plurality of
first and second targeting domains are complementary to said
plurality of first and second target domains and said gap domain
will hybridize to at least one of said plurality of detection
domains; [0035] b) contacting said plurality of first hybridization
complexes with a ligase to form a plurality of closed circular
probes; [0036] c) cleaving said plurality of closed circular probes
at said cleavage sites to form a plurality of cleaved probes;
[0037] d) amplifying said cleaved probes to form amplicons; and
[0038] e) detecting the presence of said amplicons to detect the
presence of said plurality of target sequences in said sample.
[0039] In an additional aspect, the invention provides methods for
detecting in a sample a plurality of target sequences, wherein each
of said plurality of target sequences comprises first and second
target domains, said method comprising: [0040] a) hybridizing said
plurality of target sequences to a plurality of precircle probes to
form a plurality of first hybridization complexes, each of said
precircle probes comprising: [0041] i) a first targeting domain;
[0042] ii) a second targeting domain; [0043] iii) at least a first
universal priming site; [0044] iv) a cleavage site; and [0045] v) a
barcode; [0046] wherein said plurality of first and second
targeting domains hybridize to said plurality of first and second
target domains; [0047] b) contacting said plurality of first
hybridization complexes with a ligase to form a plurality of closed
circular probes; [0048] c) cleaving said plurality of closed
circular probes at said cleavage sites to form a plurality of
cleaved probes; [0049] d) amplifying said cleaved probes to form
amplicons; and [0050] e) detecting the presence of said amplicons
to detect the presence of said plurality of target sequences in
said sample.
[0051] In a further aspect, the invention provides methods for
identifying the base at a detection position in a target sequence
comprising a first and second target domain separated by a gap
domain, said gap domain comprising said detection position, said
method comprising: [0052] a) hybridizing said target sequence to a
precircle probe to form a first hybridization complex, said
precircle probe comprising: [0053] i) a 5' first targeting domain;
[0054] ii) a 3' second targeting domain; [0055] iii) at least a
first universal priming site; and [0056] iv) a cleavage site;
[0057] wherein said first and second targeting domains hybridize to
said first and second target domains; [0058] b) contacting said
first hybridization complex with a polymerase and at least one
interrogation dNTP to form an extended precircle probe; [0059] c)
contacting said first hybridization complex comprising said
extended precircle probe and said target sequence with a ligase to
form a closed circular probe; [0060] d) cleaving said closed
circular probe at said cleavage site to form a cleaved probe;
[0061] e) amplifying said cleaved probe to form a plurality of
amplicons; [0062] f) detecting the presence of said amplicons to
detect the presence of said target sequence in said sample.
[0063] In an additional aspect, the invention provides methods for
amplifying a target sequence comprising a first and second target
domain in a sample, said method comprising: [0064] a) hybridizing
said target sequence to a precircle probe to form a first
hybridization complex, said precircle probe comprising: [0065] i) a
first targeting domain; [0066] ii) a second targeting domain;
[0067] iii) at least a first universal priming site; and [0068] iv)
a cleavage site; [0069] wherein said first and second targeting
domains hybridize to said first and second target domains; [0070]
b) contacting said first hybridization complex with a ligase to
form a closed circular probe; [0071] c) cleaving said closed
circular probe at said cleavage site to form a cleaved probe; and
[0072] d) amplifying said cleaved probe.
[0073] In an additional aspect, the invention provides methods for
detecting a target sequence comprising a first and second target
domain in a sample, said method comprising: [0074] a) hybridizing
said target sequence to a precircle probe to form a first
hybridization complex, said precircle probe comprising: [0075] i) a
first targeting domain; [0076] ii) a second targeting domain; and
[0077] iii) at least a first universal priming site; [0078] wherein
said first and second targeting domains hybridize to said first and
second target domains; [0079] b) contacting said first
hybridization complex with a ligase to form a closed circular
probe; [0080] c) contacting said closed circular probe at least a
first universal primer, an extension enzyme and NTPs to form an
extension product; [0081] d) amplifying said extension product to
form amplicons; and [0082] e) detecting said amplicons to detect
the presence of said target sequence in said sample.
BRIEF DESCRIPTION OF THE DRAWINGS
[0083] FIG. 1 is a diagram of a preferred embodiment of a precircle
probe according to the present invention, comprising first and
second targeting domains, a first universal primer, a cleavage
site, a second optional primer, an optional barcode, and an
optional restriction site.
[0084] FIGS. 2A-2H depicts a preferred assay of the invention using
an abutting ("gap-less") precircle probe. FIG. 2A depicts the
formation of a hybridization complex, wherein the targeting domains
of the precircle probe hybridize to the target domains of the
target sequence, leaving the 5' and 3' termini of the bound probe
adjacent. In the case of genotyping reactions, either the 5' or 3'
end of the precircle probe can comprise an interrogation position,
and a plurality of precircle probes, each comprising a different
base at the interrogation position and a different barcode sequence
may be used. FIG. 2B depicts the use of a ligase to circularize the
precircle probe to form a closed circle. Optionally (not shown),
the remaining linear precircle probes, and/or the target sequence,
may be removed, degraded or otherwise rendered incapable of being
amplified. FIG. 2C depicts the cleavage at the cleavage site, with
the target sequence still present. FIGS. 2D-2G depict the preferred
PCR amplification reaction, comprising the annealing of the first
universal primer (2D), the extension of the first primer (2E), the
annealing of the second and first primers (2F) and the extension of
the primers (2G). Optionally, the use of a restriction enzyme can
release the barcode and second universal priming sequences, which
can be labeled as outlined herein.
[0085] FIGS. 3A-3D depict a various embodiments of the gap
precircle probes of the present invention. FIG. 3A depicts a single
nucleotide gap precircle probe, wherein the gap position
corresponds to the SNP detection position in the target sequence.
Upon addition of the correct NTP and an extension enzyme, followed
by ligation with a ligase, the method proceeds as in FIG. 2. FIG.
3B depicts a multi nucleotide gap precircle probe that can be
filled in with NTPs using an extension enzyme. FIG. 3C depicts the
use of a gap oligonucleotide to fill the gap of the precircle
probe, with ligation occurring at both ends of the gap oligo. FIG.
3D depicts a "flap-gap" precircle probe. All of these can be used
in the general method shown in FIG. 2.
[0086] FIG. 4 depicts a variation on the compositions and methods
of the invention. In this embodiment, which can be used with any of
the abutting or gap precircle probes, the universal primers flank
the barcode sequence. This embodiment can take on a variety of
forms; in one embodiment, the precircle probe is hybridized to the
target sequence, gaps are filled as required, and the precircle
probes are ligated to form closed circular probes. In this
embodiment, it is important that any non-circularized probes are
removed. The universal primers are added and the barcode sequence
is amplified. This can be done either with a closed circular probe,
or the probes may be optionally cleaved at one or more
positions.
[0087] FIGS. 5A-5K depict the "two step" embodiment of the
invention, starting with an abutting precircle probe, although as
will be appreciated by those in the art, any of the gap probes may
be used as well. FIG. 5A depicts the precircle probe. FIG. 5B
depicts the formation of a hybridization complex, wherein the
targeting domains of the precircle probe hybridize to the target
domains of the target sequence, leaving the 5' and 3' termini
adjacent. In the case of genotyping reactions, either the 5' or 3'
end of the precircle probe can comprise an interrogation position,
and a plurality of precircle probes, each comprising a different
base at the interrogation position and a different barcode sequence
may be used. FIG. 5C depicts the use of a ligase to circularize the
precircle probe to form a closed circle. Optionally (not shown),
the remaining linear precircle probes, and/or the target sequence,
may be removed, degraded or otherwise rendered incapable of being
amplified. FIG. 5D depicts the annealing of the first primer,
followed by extension using NTPs and an extension enzyme (FIG.
5E).
[0088] FIG. 5F depicts the cleavage at the cleavage sites which
renders all probes incapable of amplification. FIGS. 5G-5J depict
the preferred PCR amplification reaction of the extension product
generated in 5E, comprising the annealing of the second universal
primer (5G), the extension of the primer (5H), the annealing of the
second and first primers (5I) and the extension of the primers
(5J). Optionally, the use of a restriction enzyme can release the
barcode and second universal priming sequences, which can be
labeled as outlined herein (FIG. 5K).
[0089] FIGS. 6A-6D depict a diagram of a "ligase" type method of
the invention on two alleles of a gene, one allele having an A at
the SNP detection position, while the other allele has a T at that
position.
[0090] FIG. 7 is a diagram of a "ligase/polymerase" type method of
the invention on alleles of a gene, one allele having an A at the
SNP position, while the other allele has a T at that position.
[0091] FIG. 8 is a diagram representing a method for determining
whether a subject is homozygous or heterozygous in an insertion
mutation.
DETAILED DESCRIPTION OF THE INVENTION
[0092] The present invention is directed to novel methods of
multiplexing amplification, detection and genotyping reactions,
particularly polymerase chain reaction (PCR) reactions, although as
described herein a variety of amplification techniques can be used.
As will be appreciated by those in the art, there are a wide
variety of configurations and assays that can be used; in general,
the invention can be described as follows and is generally depicted
in the Figures. There are two general methodologies: a "one step"
and a "two step" process.
[0093] The "one step" process can generally be described as
follows. A precircle probe is added to a target sequence from a
sample that contains a first and a second target domain to form a
hybridization complex. As outlined more fully below, these target
domains in the target sequence can be directly adjacent, or can be
separated by a gap of one or more nucleotides. The precircle probe
comprises first and second targeting domains at its termini that
are substantially complementary to the target domains of the target
sequence. The precircle probe comprises one or optionally more
universal priming sites, separated by a cleavage site, and a
barcode sequence. If there is no gap between the target domains of
the target sequence, and the 5' and 3' nucleotides of the precircle
probe are perfectly complementary to the corresponding bases at the
junction of the target domains, then the 5' and 3' nucleotides of
the precircle probe are "abutting" each other and can be ligated
together, using a ligase, to form a closed circular probe. The 5'
and 3' end of a nucleic acid molecule are referred to as "abutting"
each other when they are in contact close enough to allow the
formation of a covalent bond, in the presence of ligase and
adequate conditions.
[0094] This method is based on the fact that the two targeting
domains of a precircle probe can be preferentially ligated
together, if they are hybridized to a target strand such that they
abut and if perfect complementarity exists at the two bases being
ligated together. Perfect complementarity at the termini allows the
formation of a ligation substrate such that the two termini can be
ligated together to form a closed circular probe. If this
complementarity does not exist, no ligation substrate is formed and
the probes are not ligated together to an appreciable degree.
[0095] Once the precircle probes have been ligated, the unligated
precircle probes and/or target sequences are optionally removed or
inactivated. The closed circular probe is then linearized by
cleavage at the cleavage site, resulting in a cleaved probe
comprising the universal priming sites at the new termini of the
cleaved probe. The addition of universal primers, an extension
enzyme such as a polymerase, and NTPs results in amplification of
the cleaved probe to form amplicons. These amplicons can be
detected in a variety of ways. For example, in the case where
barcode sequences are used, the amplicons containing the barcodes
can then be added to universal biochip arrays, as is well known in
the art, although as will be appreciated by those in the art, a
number of other detection methods, including solution phase assays,
can be run.
[0096] In a preferred embodiment, there is a gap between the target
domains of the target sequence. In the case of a genotyping
reaction, there is a single nucleotide gap, comprising the
detection position, e.g. the SNP position. The addition of a single
type of dNTP and a polymerase to the hybridization complex to
"fill" the gap, if the dNTP is perfectly complementary to the
detection position base. The dNTPs are optionally removed, and the
ligase is added to form a closed circle probe. The cleavage,
amplification and detection proceeds as above.
[0097] Alternatively, there may be a gap of more than one
nucleotide between the target domains. In this case, as is more
fully outlined below, either a plurality of dNTPs, a "gap
oligonucleotide" as generally depicted in FIG. 3C or a precircle
probe with a "flap" as is generally depicted in FIG. 3D can be used
to accomplish the reaction.
[0098] The "two step" process is similar to the process outlined
above. However, in this embodiment, after the precircle probe has
been circularized, a single universal primer is added, in the
presence of a polymerase and dNTPs, such that a new linear copy of
the closed probe is produced, with new termini. This linearized
closed probe is then amplified as more fully described below. The
"two-step" process is particularly advantageous for reducing
unwanted background signals arising from subsequent amplification
reactions. This can be achived by designing the cleavage sites into
the precircle probes that when cleaved will prevent any
amplification of any probe. Additional background reduction
processes may also be incorporated into the compositions and
methods of the present invention and are discussed in more detail
herein.
[0099] The methods of the invention are particularly advantageous
in reducing problems associated with cross-hybridizations and
interactions between multiple probes, which can lead to unwanted
background amplification. By circularlizing the precircle probes
and treating the reaction with exonuclease, linear nucleic acids
are degraded and thus cannot participate in amplification
reactions. This allows the methods of the invention to be more
robust and multiplexable than other amplification methods that rely
on linear probes.
[0100] Accordingly, the present invention provides compositions and
methods for detecting, quantifying and/or genotyping target nucleic
acid sequences in a sample. In general, the genotyping methods
described herein relate to the detection of nucleotide
substitutions, although as will be appreciated by those in the art,
deletions, insertions, inversions, etc. may also be detected.
[0101] As will be appreciated by those in the art, the sample
solution may comprise any number of things, including, but not
limited to, bodily fluids (including, but not limited to, blood,
urine, serum, lymph, saliva, anal and vaginal secretions,
perspiration and semen) or solid tissue samples, of virtually any
organism, with mammalian samples being preferred and human samples
being particularly preferred); environmental samples (including,
but not limited to, air, agricultural, water and soil samples);
biological warfare agent samples; research samples; purified
samples, such as purified or raw genomic DNA, RNA, proteins, etc.;
raw samples (bacteria, virus, genomic DNA, mRNA, etc.). As will be
appreciated by those in the art, virtually any experimental
manipulation may have been done on the sample.
[0102] There is no limitation as to the source of the template
nucleic acid: it can be from a eukaryote, e.g., from a mammal, such
as human, mouse, ovine, bovine, or from a plant; it can be from a
prokaryote, e.g., bacteria, protozoan; and it can also be from a
virus.
[0103] Nucleic acid specimens may be obtained from an individual of
the species that is to be analyzed using either "invasive" or
"non-invasive" sampling means. A sampling means is said to be
"invasive" if it involves the collection of nucleic acids from
within the skin or organs of an animal (including, especially, a
murine, a human, an ovine, an equine, a bovine, a porcine, a
canine, or a feline animal). Examples of invasive methods include
blood collection, semen collection, needle biopsy, pleural
aspiration, umbilical cord biopsy, etc. Examples of such methods
are discussed by Kim, C. H. et al. (J. Virol. 66:3879-3882 (1992));
Biswas, B. et al. (Annals NY Acad. Sci. 590:582-583 (1990));
Biswas, B. et al. (J. Clin. Microbiol. 29:2228-2233 (1991)).
[0104] In contrast, a "non-invasive" sampling means is one in which
the nucleic acid molecules are recovered from an internal or
external surface of the animal. Examples of such "non-invasive"
sampling means include "swabbing," collection of tears, saliva,
urine, fecal material, sweat or perspiration, hair etc. As used
herein, "swabbing" denotes contacting an applicator/collector
("swab") containing or comprising an adsorbent material to a
surface in a manner sufficient to collect live cells, surface
debris and/or dead or sloughed off cells or cellular debris. Such
collection may be accomplished by swabbing nasal, oral, rectal,
vaginal or aural orifices, by contacting the skin or tear ducts, by
collecting hair follicles, etc.
[0105] Methods for isolating nucleic acid specimens are known in
the art, and will depend on the type of nucleic acid isolated. When
the nucleic acid is RNA, care to avoid RNA degradation must be
taken, e.g., by inclusion of RNAsin. For example, genomic DNA can
be prepared from human cells as described, e.g., in U.S. Pat. No.
6,027,889.
[0106] The present invention provides compositions and methods for
genotyping and/or detecting the presence or absence of target
nucleic acid sequences in a sample. By "nucleic acid" or
"oligonucleotide" or grammatical equivalents herein means at least
two nucleotides covalently linked together. A nucleic acid of the
present invention will generally contain phosphodiester bonds,
although in some cases, as outlined below, such as in the design of
probes, nucleic acid analogs are included that may have alternate
backbones, comprising, for example, phosphoramide (Beaucage et al.,
Tetrahedron 49(10):1925 (1993) and references therein; Letsinger,
J. Org. Chem. 35:3800 (1970); Sprinzl et al., Eur. J. Biochem.
81:579 (1977); Letsinger et al., Nucl. Acids Res. 14:3487(1986);
Sawai et al, Chem. Lett. 805 (1984), Letsinger et al., J. Am. Chem.
Soc. 110:4470 (1988); and Pauwels et al., Chemica Scripta 26:141
91986)), phosphorothioate (Mag et al., Nucleic Acids Res. 19:1437
(1991); and U.S. Pat. No. 5,644,048), phosphorodithioate (Briu et
al., J. Am. Chem. Soc. 111:2321 (1989), O-methylphophoroamidite
linkages (see Eckstein, Oligonucleotides and Analogues: A Practical
Approach, Oxford University Press), and peptide nucleic acid
backbones and linkages (see Egholm, J. Am. Chem. Soc. 114:1895
(1992); Meier et al., Chem. Int. Ed. Engl. 31:1008 (1992); Nielsen,
Nature, 365:566 (1993); Carlsson et al., Nature 380:207 (1996), all
of which are incorporated by reference). Other analog nucleic acids
include those with positive backbones (Denpcy et al., Proc. Natl.
Acad. Sci. USA 92:6097 (1995); non-ionic backbones (U.S. Pat. Nos.
5,386,023, 5,637,684, 5,602,240, 5,216,141 and 4,469,863;
Kiedrowshi et al., Angew. Chem. Intl. Ed. English 30:423 (1991);
Letsinger et al., J. Am. Chem. Soc. 110:4470 (1988); Letsinger et
al., Nucleoside & Nucleotide 13:1597 (1994); Chapters 2 and 3,
ASC Symposium Series 580, "Carbohydrate Modifications in Antisense
Research", Ed. Y. S. Sanghui and P. Dan Cook; Mesmaeker et al.,
Bioorganic & Medicinal Chem. Lett. 4:395 (1994); Jeffs et al.,
J. Biomolecular NMR 34:17 (1994); Tetrahedron Lett. 37:743 (1996))
and non-ribose backbones, including those described in U.S. Pat.
Nos. 5,235,033 and 5,034,506, and Chapters 6 and 7, ASC Symposium
Series 580, "Carbohydrate Modifications in Antisense Research", Ed.
Y. S. Sanghui and P. Dan Cook. Nucleic acids containing one or more
carbocyclic sugars are also included within the definition of
nucleic acids (see Jenkins et al., Chem. Soc. Rev. (1995)
pp169-176). Several nucleic acid analogs are described in Rawls, C
& E News Jun. 2, 1997 page 35. All of these references are
hereby expressly incorporated by reference. These modifications of
the ribose-phosphate backbone may be done to facilitate the
addition of labels, or to increase the stability and half-life of
such molecules in physiological environments.
[0107] As will be appreciated by those in the art, all of these
nucleic acid analogs may find use in the present invention. In
addition, mixtures of naturally occurring nucleic acids and analogs
can be made. Alternatively, mixtures of different nucleic acid
analogs, and mixtures of naturally occurring nucleic acids and
analogs may be made.
[0108] The nucleic acids may be single stranded or double stranded,
as specified, or contain portions of both double stranded or single
stranded sequence. The nucleic acid may be DNA, both genomic and
cDNA, RNA or a hybrid, where the nucleic acid contains any
combination of deoxyribo- and ribo-nucleotides, and any combination
of bases, including uracil, adenine, thymine, cytosine, guanine,
inosine, xathanine, hypoxathanine, isocytosine, isoguanine, etc. A
preferred embodiment utilizes nucleic acid probes comprising some
proportion of uracil, as is more fully outlined below. One
embodiment utilizes isocytosine and isoguanine in nucleic acids
designed to be complementary to other probes, rather than target
sequences, as this reduces non-specific hybridization, as is
generally described in U.S. Pat. No. 5,681,702. As used herein, the
term "nucleoside" includes nucleotides as well as nucleoside and
nucleotide analogs, and modified nucleosides such as labeled
nucleosides. In addition, "nucleoside" includes non-naturally
occuring analog structures. Thus for example the individual units
of a peptide nucleic acid, each containing a base, are referred to
herein as a nucleoside. Similarly, the term "nucleotide" (sometimes
abbreviated herein as "NTP"), includes both ribonucleic acid and
deoxyribonucleic acid (sometimes abbreviated herein as "dNTP").
While many descriptions below utilize the term "dNTP", it should be
noted that in many instances NTPs may be substituted, depending on
the template and the enzyme.
[0109] The compositions and methods of the invention are directed
to the detection of target sequences. The term "target sequence" or
"target nucleic acid" or grammatical equivalents herein means a
nucleic acid sequence on a single strand of nucleic acid. The
target sequence may be a portion of a gene, a regulatory sequence,
genomic DNA, cDNA, RNA including mRNA and rRNA, or others. As is
outlined herein, the target sequence may be a target sequence from
a sample, or a secondary target such as a product of a genotyping
or amplification reaction such as a ligated circularized probe, an
amplicon from an amplification reaction such as PCR, etc. Thus, for
example, a target sequence from a sample is amplified to produce a
secondary target (amplicon) that is detected. Alternatively, as
outlined more fully below, what may be amplified is the probe
sequence, although this is not generally preferred. The target
sequence may be any length, with the understanding that longer
sequences are more specific. As will be appreciated by those in the
art, the complementary target sequence may take many forms. For
example, it may be contained within a larger nucleic acid sequence,
i.e. all or part of a gene or mRNA, a restriction fragment of a
plasmid or genomic DNA, among others. As is outlined more fully
below, probes are made to hybridize to target sequences to
determine the presence, sequence or quantity of a target sequence
in a sample. Generally speaking, this term will be understood by
those skilled in the art. Preferred target sequences range from
about 20 to about 1,000,000 in size, more preferably from about 50
to about 10,000, with from about 40 to about 50,000 being most
preferred.
[0110] If required, the target sequence is prepared using known
techniques. For example, the sample may be treated to lyse the
cells, using known lysis buffers, sonication, electroporation,
etc., with purification and amplification as outlined below
occurring as needed, as will be appreciated by those in the art. In
addition, the reactions outlined herein may be accomplished in a
variety of ways, as will be appreciated by those in the art.
Components of the reaction may be added simultaneously, or
sequentially, in any order, with preferred embodiments outlined
below. In addition, the reaction may include a variety of other
reagents which may be included in the assays. These include
reagents like salts, buffers, neutral proteins, e.g. albumin,
detergents, etc., which may be used to facilitate optimal
hybridization and detection, and/or reduce non-specific or
background interactions. Also reagents that otherwise improve the
efficiency of the assay, such as protease inhibitors, nuclease
inhibitors, anti-microbial agents, etc., may be used, depending on
the sample preparation methods and purity of the target.
[0111] In addition, in most embodiments, double stranded target
nucleic acids are denatured to render them single stranded so as to
permit hybridization of the primers and other probes of the
invention. A preferred embodiment utilizes a thermal step,
generally by raising the temperature of the reaction to about
95.degree. C., although pH changes and other techniques may also be
used.
[0112] In addition, in some cases, for example when genomic DNA is
to be used, it can be captured, such as through the use of
precipitation or size exclusion techniques. Alternatively, DNA can
be processed to yield uniform length fragments using techniques
well known in the art, such as, e.g., hydrodynamic shearing or
restriction endonucleases.
[0113] The target sequences of the present invention generally
comprise at least a first and a second target domain. Target
domains are portions of the target sequence. In general, each
target domain may be any length, with the understanding that longer
sequences are more specific. The proper length of the target
domains in a probe will depend on factors including the GC content
of the regions and their secondary structure. The considerations
are similar to those used to identify an appropriate sequence for
use as a primer, and are further described below. The length of the
probe and GC content will determine the Tm of the hybrid, and thus
the hybridization conditions necessary for obtaining specific
hybridization of the probe to the template nucleic acid. These
factors are well known to a person of skill in the art, and can
also be tested in assays. An extensive guide to the hybridization
of nucleic acids is found in Tijssen (1993), "Laboratory Techniques
in biochemistry and molecular biology-hybridization with nucleic
acid probes." Generally, stringent conditions are selected to be
about 5.degree. C. lower than the thermal melting point (Tm) for
the specific sequence at a defined ionic strength and pH.
[0114] The Tm is the temperature (under defined ionic strength and
pH) at which 50% of the target sequence hybridizes to a perfectly
matched probe. Highly stringent conditions are selected to be equal
to the Tm point for a particular probe. Sometimes the term "Td" is
used to define the temperature at which at least half of the probe
dissociates from a perfectly matched target nucleic acid. In any
case, a variety of estimation techniques for estimating the Tm or
Td are available, and generally described in Tijssen, supra.
Typically, G-C base pairs in a duplex are estimated to contribute
about 3.degree. C. to the Tm, while A-T base pairs are estimated to
contribute about 2.degree. C., up to a theoretical maximum of about
80-100.degree. C. However, more sophisticated models of Tm and Td
are available and appropriate in which G-C stacking interactions,
solvent effects, the desired assay temperature and the like are
taken into account. For example, probes can be designed to have a
dissociation temperature (Td) of approximately 60.degree. C., using
the formula:
Td=(((((3.times.#GC)+(2.times.#AT)).times.37)-562)/#bp)-5; where
#GC, #AT, and #bp are the number of guanine-cytosine base pairs,
the number of adenine-thymine base pairs, and the number of total
base pairs, respectively, involved in the annealing of the probe to
the template DNA.
[0115] The stability difference between a perfectly matched duplex
and a mismatched duplex, particularly if the mismatch is only a
single base, can be quite small, corresponding to a difference in
Tm between the two of as little as 0.5 degrees. See Tibanyenda, N.
et al., Eur. J. Biochem. 139:19 (1984) and Ebel, S. et al.,
Biochem. 31:12083 (1992). More importantly, it is understood that
as the length of the homology region increases, the effect of a
single base mismatch on overall duplex stability decreases.
[0116] Thus, where there is a likelihood that there will be
mismatches between the probe and the target domains, it may be
advisable to include a longer targeting domain in the probe. Thus,
the specificity and selectivity of the probe can be adjusted by
choosing proper lengths for the targeting domains and appropriate
hybridization conditions. When the template nucleic acid is genomic
DNA, e.g., mammalian genomic DNA, the selectivity of the targeting
domains must be high enough to identify the correct base in
3.times.10.sup.9 in order to allow processing directly from genomic
DNA. However, in situations in which a portion of the genomic DNA
is isolated first from the rest of the DNA, e.g., by separating one
or more chromosomes from the rest of the chromosomes, the
selectivity or specificity of the probe is less important.
[0117] The length of the probe, and therefore the hybridization
conditions will also depend on whether a single probe is hybridized
to the template nucleic acid, or several probes. If several probes
are used, and if all the probes are to be hybridized simultaneously
to the template nucleic acid, then it is desirable to design the
targeting domains of the different probes such that their Tm and/or
Td is similar, such that they all the probes will hybridize
specifically to the template nucleic acid. These conditions can be
determined by a person of skill in the art, by taking into
consideration the factors discussed above, as well those described
within the context of the primers.
[0118] However, due to the length of the precircle probes, it is
preferred that each target domain range in size from about 5 bases
to about 100 bases, with from about 5 to about 40 being especially
preferred. As will be appreciated by those in the art, the target
domains may be the same length or different lengths, and may have
greatly differing Tms. The terms "first" and "second" are not meant
to confer an orientation of the sequences with respect to the 5'-3'
orientation of the target sequence. For example, assuming a 5'-3'
orientation of the complementary target sequence, the first target
domain may be located either 5' to the second domain, or 3' to the
second domain.
[0119] As outlined herein, the target domains may be adjacent (i.e.
contiguous) or separated, i.e. by a "gap". If separated, the target
domains may be separated by a single nucleotide or a plurality of
nucleotides, with from 1 to about 2000 being preferred, and from 1
to about 500 being especially preferred, although as will be
appreciated by those in the art, longer gaps may find use in some
embodiments.
[0120] In a preferred embodiment, e.g. for genotyping reactions, as
is more fully outlined below, the target sequence comprises a
position for which sequence information is desired, generally
referred to herein as the "detection position". In a particularly
preferred embodiment, the detection position is a single
nucleotide, although in alternative embodiments, it may comprise a
plurality of nucleotides, either contiguous with each other or
separated by one or more nucleotides. By "plurality" as used herein
is meant at least two. As used herein, the base which base pairs
with the detection position base in a target is termed the
"interrogation position". In the case where a single nucleotide gap
is used, the NTP that has perfect complementarity to the detection
position is called an "interrogation NTP".
[0121] It should be noted in this context that "mismatch" is a
relative term and meant to indicate a difference in the identity of
a base at a particular position, termed the "detection position"
herein, between two sequences. In general, sequences that differ
from wild type sequences are referred to as mismatches. However,
and particularly in the case of SNPs, what constitutes "wild type"
may be difficult to determine as multiple alleles can be relatively
frequently observed in the population, and thus "mismatch" in this
context requires the artificial adoption of one sequence as a
standard. Thus, for the purposes of this invention, sequences are
referred to herein as "perfect match" and "mismatch". "Mismatches"
are also sometimes referred to as "allelic variants". The term
"allele", which is used interchangeably herein with "allelic
variant" refers to alternative forms of a gene or portions thereof.
Alleles occupy the same locus or position on homologous
chromosomes. When a subject has two identical alleles of a gene,
the subject is said to be homozygous for the gene or allele. When a
subject has two different alleles of a gene, the subject is said to
be heterozygous for the gene. Alleles of a specific gene can differ
from each other in a single nucleotide, or several nucleotides, and
can include substitutions, deletions, and insertions of
nucleotides. An allele of a gene can also be a form of a gene
containing a mutation. The term "allelic variant of a polymorphic
region of a gene" refers to a region of a gene having one of
several nucleotide sequences found in that region of the gene in
other individuals of the same species.
[0122] The present invention provides precircle probes that
hybridize to the target sequence as described herein. In general,
probes of the present invention are designed to be complementary to
a target sequence (either the target sequence of the sample or to
other probe sequences, for example for universal primers and
barcodes, as is described herein), such that hybridization of the
target and the probes of the present invention occurs. This
complementarity need not be perfect; there may be any number of
base pair mismatches that will interfere with hybridization between
the target sequence and the single stranded nucleic acids of the
present invention. However, if the number of mutations is so great
that no hybridization can occur under even the least stringent of
hybridization conditions, the sequence is not a complementary
target sequence. Thus, by "substantially complementary" herein is
meant that the probes are sufficiently complementary to the target
sequences to hybridize under the selected reaction conditions.
[0123] A variety of hybridization conditions may be used in the
present invention, including high, moderate and low stringency
conditions; see for example Maniatis et al., Molecular Cloning: A
Laboratory Manual, 2d Edition, 1989, and Short Protocols in
Molecular Biology, ed. Ausubel, et al, hereby incorporated by
reference. Stringent conditions are sequence-dependent and will be
different in different circumstances. Longer sequences hybridize
specifically at higher temperatures. An extensive guide to the
hybridization of nucleic acids is found in Tijssen, Techniques in
Biochemistry and Molecular Biology--Hybridization with Nucleic Acid
Probes, "Overview of principles of hybridization and the strategy
of nucleic acid assays" (1993). Generally, stringent conditions are
selected to be about 5-10.degree. C. lower than the thermal melting
point (Tm) for the specific sequence at a defined ionic strength
and pH. The Tm is the temperature (under defined ionic strength, pH
and nucleic acid concentration) at which 50% of the probes
complementary to the target hybridize to the target sequence at
equilibrium (as the target sequences are present in excess, at Tm,
50% of the probes are occupied at equilibrium). Stringent
conditions will be those in which the salt concentration is less
than about 1.0 M sodium ion, typically about 0.01 to 1.0 M sodium
ion concentration (or other salts) at pH 7.0 to 8.3 and the
temperature is at least about 30.degree. C. for short probes (e.g.
10 to 50 nucleotides) and at least about 60.degree. C. for long
probes (e.g. greater than 50 nucleotides). Stringent conditions may
also be achieved with the addition of helix destabilizing agents
such as formamide. The hybridization conditions may also vary when
a non-ionic backbone, i.e. PNA is used, as is known in the art. In
addition, cross-linking agents may be added after target binding to
cross-link, i.e. covalently attach, the two strands of the
hybridization complex.
[0124] Thus, the assays are generally run under stringency
conditions which allows formation of the hybridization complex only
in the presence of target. Stringency can be controlled by altering
a step parameter that is a thermodynamic variable, including, but
not limited to, temperature, formamide concentration, salt
concentration, chaotropic salt concentration, pH, organic solvent
concentration, etc. Alternatively, single strand binding protein
may also be used to increase specificity.
[0125] These parameters may also be used to control non-specific
binding, as is generally outlined in U.S. Pat. No. 5,681,697. Thus
it may be desirable to perform certain steps at higher stringency
conditions to reduce non-specific binding.
[0126] The design, preparation and use of the precircle probes
according to the present invention will now be described in detail.
As outlined above and explained more fully herein, the precircle
probes of the present invention comprise at least first and second
targeting domains and at least one universal priming site or
sequence. Optionally, the precircle probes may further comprise one
or more cleavage sites, barcode sequences, one or more restriction
sites and/or labeling sequences.
[0127] A "universal" priming site is a site to which a universal
primer will hybridize. In general, "universal" refers to the use of
a single primer or set of primers for a plurality of amplification
reactions. For example, in the detection or genotyping of a 100
different target sequences, all the precircle probes may share the
identical universal priming sequences, allowing for the multiplex
amplification of the 100 different probes using a single set of
primers. This allows for ease of synthesis (e.g. only one set of
primers is made), resulting in reduced costs, as well as advantages
in the kinetics of hybridization. Most importantly, the use of such
primers greatly simplifies multiplexing in that only two primers
are needed to amplify a plurality of probes.
[0128] It should also be noted that "sets" of universal priming
sequences/primers may be used. For example, in highly multiplexed
reactions, it may be useful to use several sets of universal
sequences, rather than a single set; for example, 100 different
precircle probes may have the same priming sequences, and the
second 100 a different set, etc.
[0129] As will be appreciated by those in the art, the precircle
probes of the invention can take on a variety of configurations. As
a preliminary matter, the precircle probes can be designed wherein
the 5' and 3' termini of the targeting domains hybridize to
adjacent nucleotides in the target sequence, or with gaps, as is
more fully outlined below.
[0130] In a preferred embodiment, the precircle probe comprises two
targeting domains that hybridize adjacently (i.e. without any gap
nucleotides) to the target domains of the target sequence; this is
sometimes referred to herein as an "abutting" precircle probe. This
embodiment finds use in applications directed to both detection
and/or genotyping.
[0131] In a preferred embodiment, the abutting precircle probe is
used for detection of target sequences rather than genotyping. In
this embodiment, the target sequence does not contain a particular
detection position. Thus, abutting precircle probes are designed
having 5' and 3' termini that hybridize, with perfect
complementarity, to the directly adjacent target domains of the
target sequence, such that the 5' and 3' termini will be abutting
when the probe is hybridized to the target. Only if perfect
complementarity exists at the 5' and 3' termini will the two ends
of the abutting precircle probe ligate in the presence of a ligase,
outlined below, to form a closed circular probe, which can then be
further treated as outlined below. Of course, one of skill in the
art will appreciate that the further any non-complementary sequence
is from the site of ligation, the more likely the probe will be
ligated.
[0132] In an alternative embodiment, an abutting precircle probe is
used for genotyping of a detection position in the target sequence.
In this embodiment, at least one of the abutting precircle probes
comprises an interrogation base at either the 3' or 5' terminus of
the precircle probe, e.g. a nucleotide that has perfect
complementarity to the detection position of the target sequence.
As will be appreciated by those in the art, either the 3' or 5'
position can be used, as ligases will not ligate unless perfect
basepairing between both termini exists. This embodiment is
generally depicted in FIG. 3A.
[0133] In a particularly preferred embodiment, a plurality of
abutting precircle probes are used. In one such embodiment, each
abutting precircle probe comprises a different barcode sequence, as
is more fully described below. For example, if the SNP position is
biallelic, e.g. contains two different bases, two abutting
precircle probes are used, each with a different interrogation base
and a different barcode. Only if perfect complementarity exists
between the interrogation base and the detection position will
ligation occur. In this embodiment, the barcode sequence serves as
a type of "label" or "tag", identifying which base was present in
the interrogation position. Alternatively, two abutting precircle
probes are used having a different interrogation base but the same
barcode. In this embodiment, the probes are employed in separate
reaction mixtures and are worked up individually and detected as
described herein, such that only the probe having perfect
complementarity between the interrogation base and the detection
position will ligate to form a circularized probe for detection.
The latter embodiment can be used for, e.g., distinguishing between
major and minor alleles of a gene of interest.
[0134] The precircle probes of the present invention may also
comprise non-abutting targeting domains that do not hybridize
adjacent to each other on the target sequence, i.e. the
corresponding target domains of the target sequence are separated
by a gap domain comprising one or more nucleotides. These probes
may also be used in applications directed to detection,
amplification and/or genotyping.
[0135] In one such embodiment, the precircle probe comprises two
targeting domains that hybridize to two target domains in a target
sequence separated by a single nucleotide gap domain (a single
nucleotide gap position). Again, this embodiment finds use in
applications directed to both detection and/or genotyping, with the
latter being preferred.
[0136] In a preferred embodiment, a single-gap precircle probe is
used for genotyping of target sequence. In this embodiment, the
target sequence includes a particular detection position in the gap
domain, and precircle probes are designed having targeting domains
that hybridize, with perfect complementarity, to the
single-nucleotide separated target domains of the target sequence.
In this embodiment, a polymerase and one species of dNTP is added.
If the dNTP is an interrogation dNTP, e.g. it has perfect
complementarity to the detection position nucleotide, the
polymerase will extend the precircle probe and form a ligation
structure. The addition of a ligase as outlined herein then results
in a circularized probe.
[0137] In this genotyping embodiment, there must be a plurality of
separate reactions; that is, if the allele is biallelic, at least
two reactions are done, each with a different dNTP. Similarly,
triallelic positions are run with at least three reactions, etc.
Each reaction mixture may be worked up separately and detected
(e.g. added to an array), or they may be pooled, after
circularization and removal of the extra dNTPs, and processed
together. In a particularly preferred embodiment, all four dNTP
reactions can be done simultaneously in separate reaction mixtures
each with a different dNTP in order to identify the complementarity
of an allele, and/or to provide a measure of the inherent
background.
[0138] Alternatively, one of skill in the art will recognize that
the single-gap precircle probe can also be used for detection
and/or amplification simply by adding all four dNTPS simultaneously
in the same reaction mixture along with a polymerase, which adds
the dNTP with perfect complementarity to the detection position for
subsequent ligation and amplification of the probe.
[0139] In another preferred embodiment, the precircle probe
comprises two targeting domains that hybridize to two target
domains separated by a gap domain comprising a plurality of
nucleotides (an "oligo-gap" probe). As above, this embodiment finds
use in either detection, amplification or genotyping reactions, and
can rely on either probes containing a "flap-gap", or on one or
more additional oligonucleotides, sometimes referred to herein as
"gap oligonucleotides" or "intervening oligonucleotides".
[0140] In a particularly preferred embodiment, the oligo-gap
precircle probe is used in amplification reactions. In this
embodiment, as is generally depicted in FIG. 3B, the reaction
proceeds using a polymerase and dNTPs, in the presence of a ligase,
to form a closed circle probe. The closed circle probe is then
cleaved and amplified as outlined herein. One of skill in the art
will appreciate that, by incorporating the same primer or primers
in each of a plurality of probes to a plurality of different target
sequences, one may simultaneously amplify multiple targets of
interest in a single reaction vessel.
[0141] In another preferred embodiment, the multi nucleotide gap
probe is used with one or more gap oligonucleotides. In this
embodiment, as is generally depicted in FIG. 3C, rather than fill
in the gap enzymatically, a substantially complementary gap
oligonucleotide is used, which is then ligated on each end as
outlined herein. As will be appreciated by those in the art, this
embodiment can also rely on the use of a plurality of gap
oligonucleotides.
[0142] In a preferred embodiment, the oligo-gap probe is used in
genotyping reactions. In this embodiment, the detection position is
in the "middle" (e.g. at any position internal to the gap) of the
gap, and a "flap-gap" precircle probe is used. This embodiment is
generally depicted in FIG. 3D. Unlike other reactions outlined
herein, this embodiment relies on traditional hybridization methods
that utilize the variation of stringency conditions (temperature,
buffer conditions, etc.) to distinguish nucleotides at the
detection position. Thus, the reaction is run under conditions that
allow ligation only when the interrogation base is perfectly
complementary to the detection base. That is, since all other
parameters being equal, a perfectly complementary probe will be
more stable and presumably have a slower off rate than a probe
comprising a mismatch at any particular temperature. Accordingly,
by using different probes, each with a different base at the
interrogation position, the identification of the base at the
detection position is elucidated. As outlined above, identical or
different barcodes may be incorporated into the probes for
subsequent detection in separate or the same reaction mixtures,
respectively. The differences can be amplified by using different
temperatures. It should also be noted that in this embodiment, the
length of the gap and the position of the interrogation base should
be taken into account, as long gaps with interrogation bases far
from the terminus may still hybridize and allow ligation to take
place.
[0143] Alternatively, the same type of reaction can occur using one
or more gap oligonucleotides, as depicted in FIG. 3C. In this
embodiment, if the interrogation position is internal to the gap
oligonucleotide, traditional stringency control is done.
Alternatively, the interrogation position can be at either the 5'
or 3' (or both, in the case of two SNP detection positions being
close together) terminus of the gap oligonucleotide. This
embodiment may find use in the case where due to specificity
concerns, the target domains need to be long; yet in general, the
longer the precircle probe, the more synthetic quality control
issues are present.
[0144] Similarly, there may be genotyping reactions done with a
plurality of gap oligonucleotides, again either with internal
interrogation positions or interrogation positions at one or more
termini of the gap oligonucleotides.
[0145] All of the foregoing embodiments of the claimed invention
will benefit from reduction of background signals during subsequent
amplification reactions. As described in more detail herein, one
may render any unreacted probes and/or target sequences unavailable
for amplification in a variety of ways. Preferred embodiments
include, e.g. addition of exonuclease after ligation to degrade
remaining linear nucleic acids, and/or the incorporation of
appropriate labels (e.g. biotin) to allow separation and removal of
either unreacted probe or the circularized probe:target complex,
particularly when the latter comprises genomic DNA. Additional
reduction steps are also contemplated and are discussed in further
detail below including, e.g. extension of the circularized probe
for further analysis of the extension product.
[0146] As is generally depicted in the figures and described
herein, there are a variety of different embodiments to the present
invention, including a "one step" and a "two step" process that may
be employed after ligation of the precircle probe.
[0147] In the "one step" process, the closed circular probe is
cleaved and amplified directly. In the "two step" process, the
closed circular probe is first copied using a single universal
priming site to produce an extension product of the closed circular
probe. The closed circle probe is then removed along with the
target sequence, and any uncircularized precircle probes. This
extension product or "second strand" is now amplified, using the
techniques outlined herein. This embodiment is generally pictured
in FIGS. 5A-5I.
[0148] As outlined below, there are a wide variety of amplification
methods which may be used, that may require either a single
universal priming site or two priming sites. In a preferred
embodiment, the amplification reaction is the PCR reaction and the
precircle probes comprise two universal primers, one in each
orientation, for use in PCR reactions. That is, as is known in the
art, the orientation of primers is such to allow exponential
amplification, such that the first universal priming sequence is in
the "sense" orientation and the second universal priming sequence
is in the "antisense" orientation.
[0149] In a preferred embodiment, the universal primers will be
oriented as generally depicted in FIGS. 1-3 so that upon ligation
and subsequent cleavage PCR amplification of the intervening
targeting domains and optional barcode may be obtained. This
embodiment is particularly preferred for, e.g., amplification of
the target sequence(s). Alternatively, the primers may be oriented
flanking a barcode as generally depicted in FIG. 4, such that only
the barcode and primers may be exponentially amplified in
subsequent PCR reactions. Additionally, the resulting amplicons may
also be shortened by incorporation of cleavage sites as described
in more detail below.
[0150] In general, the universal priming sequences/primers each
range from about 12 to about 40 in length, with from about 15 to
about 25 being preferred. Suitable universal priming sequences
include, but are not limited to, those specifically exemplified
herein.
[0151] Other amplification reactions, outlined below, may require
one or more universal priming sequences as well.
[0152] In addition to the targeting domains and universal priming
sites, the precircle probes preferably comprise at least a first
cleavage site. Preferred cleavage sites are those that allow
cleavage of nucleic acids in specific locations. Suitable cleavage
sites include, but are not limited to, the incorporation of uracil
or other ribose nucleotides, restriction endonuclease sites,
etc.
[0153] In a preferred embodiment, the cleavage site comprises a
uracil base. This allows the use of uracil-N-glycolylase, an enzyme
which removes the uracil base while leaving the ribose intact. This
treatment, combined with changing the pH (to alkaline) by heating,
or contacting the site with an apurinic endonuclease that cleaves
basic nucleosides, allows a highly specific cleavage of the closed
circle probe.
[0154] In a preferred embodiment, a restriction endonuclease site
is used, preferably a rare one. As will be appreciated by those in
the art, this may require the addition of a second strand of
nucleic acid to hybridize to the restriction site, as many
restriction endonucleases require double stranded nucleic acids
upon which to work. In one embodiment, the restriction site can be
part of the primer sequence such that annealing the primer will
make the restriction site double-stranded and allow cleavage.
[0155] When two priming sites are used, the cleavage site is
preferably located between the two priming sites, such that upon
cleavage, a linear probe is created with the priming sites at the
termini, allowing the amplification of everything in between.
[0156] In some embodiments, more than one cleavage site is
included. In this embodiment, as is generally depicted in FIG. 5F,
there are a plurality of cleavage sites in the precircle probe.
This may be done for a variety of reasons. In one embodiment,
multiple cleavage sites can be used to render any probe incapable
of amplification. Thi scan be used to suppress unwanted PCR
backgrounds as discussed herein in the two step method. In another
embodiment, by cleaving off parts of the precircle probe, the
required components for amplification are less. For example, by
cleaving at the junction of the target domains and the other
components of the probe, only the barcode and universal primers
need be amplified. A further advantage of locating the cleavage
site other than between the two primers is that it can be used to
prevent spurious amplification, particularly in the two-step
process described above.
[0157] In addition to the targeting domains, cleavage site(s) and
universal priming sites, the precircle probes of the invention may
further comprise a barcode sequence. The terms "barcodes",
"adapters", tags" and "zipcodes" have all been used to describe
artificial sequences that are added to amplicons to allow
separation of nucleic acid fragment pools. One preferred form of
barcodes are hybridization barcodes. In this embodiment barcodes
are chosen so as to allow hybridization to the complementary
capture probes on a surface of an array. Barcodes serve as unique
identifiers of the probe. In general, sets of barcodes and the
corresponding capture probes are developed to minimize
cross-hybridization with both each other and other components of
the reaction mixtures, including the target sequences and sequences
on the larger nucleic acid sequences outside of the target
sequences (e.g. to sequences within genomic DNA). Other forms of
barcods are mass tags that can be separated using mass
spectroscopy, electrophoretic tags that can be separated based on
electrophoretic mobility, etc.
[0158] In general, both barcodes and the universal priming
sequences/primers can be selected in a variety of ways, to avoid
cross-hybridization, thereby preventing competition between
individual primers and a target nucleic acid and preventing duplex
formation of the primers in solution, and possible concatenation of
the primers during PCR. If there is more than one constant region
in the primer, the constant regions of the primer are selected so
that they do not self-hybridize or form hairpin structures.
[0159] One of skill will recognize that there are a variety of
possible ways of performing the above selection steps, and that
variations on the steps are appropriate. Most typically, selection
steps are performed using simple computer programs to perform the
selection as outlined above; however, all of the steps are
optionally performed manually. One available computer program for
primer selection is the MacVector.TM. program from Kodak.
[0160] In addition, the primers designed may be compared to the
known sequences in the template nucleic acid, to avoid non specific
hybridization of the primers to the template nucleic acid. For
example, primers for use in detecting nucleotides in human genomic
DNA can be "blasted" against human GenBank sequences, e.g., at the
National Center for Biotechnology Information (NCBI) at
http://www.ncbi.nim.nih.gov/.
[0161] There are numerous algorithms that can be used for comparing
sequences, such as probe sequences to template DNA sequences and
probe and primer sequences. These algorithms include Sequencher,
GCG, and the HGS Iris software. Any software which can align
sequence and find regions of homology can be used, or the sequences
can be compared manually.
[0162] A barcode for detection in array hybridization, e.g., high
density arrays, are preferably around 20 nucleotides long and are
described, e.g, in Shoemaker et al. (1996) Nature Genetics 14: 450.
Barcode sequences should be maximally different yet still retain
similar hybridization properties to facilitate simultaneous
analysis on high-density oliognucleotide arrays. As described in
Shoemaker et al., supra, an alogrithm can be used to select sets of
thousands (over 9,000) maximally distinguished 20mer barcode
sequences that are predicted to have similar melting temperatures,
no secondary structures and no extensive similarity between any two
sequences (more than 5 mismatches). Moreover, hybridizations are
sensitive and capable of detecting small differences in
hybridization signal. For example, as further described in
Shoemaker et al., supra, a two fold change in concentration was
detected in the presence of a hybridization mixture with 120
oligonucleotides.
[0163] The use of barcodes allow the use of "universal arrays",
e.g. arrays can be made with one set of capture probes that can be
used in a wide variety of applications. The use of barcode
sequences that allow the use of universal arrays has been described
in limited contexts; see for example Chee et al., Nucl. Acid Res.
19:3301 (1991); Shoemaker et al., Nature Genetics 14:450 (1998);
Barany, F. (1991) Proc. Natl. Acad. Sci. USA 88:189-193; EP 0 799
897 A1; WO 97/31256, all of which are expressly incorporated by
reference.
[0164] As will be appreciated by those in the art, the length of
the barcode sequences will vary, depending on the desired
"strength" of binding and the number of different barcodes desired.
In a preferred embodiment, barcode sequences range from about 6 to
about 500 basepairs in length, with from about 8 to about 100 being
preferred, and from about 10 to about 25 being particularly
preferred.
[0165] In one embodiment, nucleic acid barcodes are used but not
their hybridization properties. Rather, different length barcodes
can be used, alternatively, the sequence the barcode is altered to
result in different molecular weights. What is important is this
embodiment is that each barcode have a different molecular weight.
The barcodes are cleaved from the rest of the amplicon as described
herein and subjected to mass spectroscopy analysis, or other
techniques that rely on differential molecular weights for
separation, such as gel electrophoresis.
[0166] Preferred barcode sequences (and thus their corresponding
complementary capture probe sequences) are depicted in the examples
and include those complementary to Affymetrix's GenFlex chip.
[0167] In a preferred embodiment, the precircle probes can also
comprise additional elements. As is outlined herein, a labeling
sequence may also be used. A labeling sequence has substantial
complementarity to a label probe comprising labels, that can be
added to the amplicons to label them, as is more fully outlined
below. Again, it is preferred to use "universal" labeling
sequences, or sets of sequences, to minimize the amount of sequence
synthesis required and simplify multiplexing using multiple probes
and/or multiple targets.
[0168] Accordingly, the invention provides precircle probes
comprising a number of components, including, but not limited to,
targeting domains, universal priming site(s), cleavage site(s),
barcode sequences and labeling sequences. As is known in the art,
these precircle probes (and the primers and capture probes outlined
herein) can be made in a variety of ways. They may be may be
synthesized chemically, e.g., according to the solid phase
phosphoramidite triester method described by Beaucage and Caruthers
(1981), Tetrahedron Letts., 22(20):1859-1862, e.g., using an
automated synthesizer, as described in Needham-VanDevanter et al.
(1984) Nucleic Acids Res., 12:6159-6168. Oligonucleotides can also
be custom made and ordered from a variety of commercial sources
known to persons of skill. Purification of oligonucleotides, where
necessary, is typically performed by either native acrylamide gel
electrophoresis or by anion-exchange HPLC as described in Pearson
and Regnier (1983) J. Chrom. 255:137-149. The sequence of the
synthetic oligonucleotides can be verified using the chemical
degradation method of Maxam and Gilbert (1980) in Grossman and
Moldave (eds.) Academic Press, NY, Methods in Enzymology
65:499-560. Custom oligos can also easily be ordered from a variety
of commercial sources known to persons of skill.
[0169] Where probes are prepared by synthetic methods, it may be
necessary to phosphorylate the 5' end of the probe, since
oligonucleotide synthesizers do not usually produce
oligonucleotides having a phosphate at their 5' end. The absence of
a phosphate at the 5' end of the probe would otherwise prevent
ligation of the 5' and 3' ends of the probe. Phosphorylation may be
carried out according to methods well known in the art, e.g., using
T4 polynucleotide kinase as described, e.g., in U.S. Pat. No.
5,593,840.
[0170] Probes and primers can also be prepared by recombinant
methods, such as by including the probe in a plasmid that can be
replicated in a host cell, e.g., bacteria, amplified and isolated
by methods known in the art. The probe can then be cut out of the
plasmid using a restriction enzyme that cuts around the probe.
Alternatively, large amounts of probe can be prepared by PCR
amplification using primers that are complementary to the 5' and 3'
ends of the probe. The probe can then be further purified according
to methods known in the art.
[0171] Probes can be prepared in one step, e.g., by synthetically
synthesizing the whole probe. Alternatively, probes can be
synthesized in at least two parts and linked together through
linking oligonucleotides. For example, two parts of a precircle
probe can be synthesized and can be linked together by using a
bridging oligonucleotide, which contains sequences that are
complementary to part A and part B of the probe. This is further
described in Example 7. The bridging oligonucleotide is preferably
at least from about 20 to about 50 nucleotides long, e.g., between
30 and 40 nucleotides. The bridging oligonucleotide preferably
comprises at least about 10, more preferably, at least about 15 or
20 nucleotides that are complementary to each of part A and part B
of the probe. The criteria to consider when designing bridging
oligonucleotides are the same as those involved in designing a
primer for hybridizing to a particular sequence, as described
above. The ligation in the presence of the bridging oligonucleotide
can be performed by regular ligation methods.
[0172] The methods of the invention proceed with the addition of
the precircle probes to the target sequence. The targeting domains
of the precircle probes hybridize to the target domains of the
target sequence. If gaps exist, the reaction proceeds with the
addition of one or more NTPs and an extension enzyme (or a gap
oligo, as described herein). By "extension enzyme" herein is meant
an enzyme that will extend a sequence by the addition of NTPs. As
is well known in the art, there are a wide variety of suitable
extension enzymes, of which polymerases (both RNA and DNA,
depending on the composition of the target sequence and precircle
probe) are preferred. Preferred polymerases are those that lack
strand displacement activity, such that they will be capable of
adding only the necessary bases at the end of the probe, without
further extending the probe to include nucleotides that are
complementary to a targeting domain and thus preventing
circularization. Suitable polymerases include, but are not limited
to, both DNA and RNA polymerases, including the Klenow fragment of
DNA polymerase 1, SEQUENASE 1.0 and SEQUENASE 2.0 (U.S.
Biochemical), T5 DNA polymerase, Phi29 DNA polymerase and various
RNA polymerases such as from Thermus sp., or Q beta replicase from
bacteriophage, also SP6, T3, T4 and T7 RNA polymerases can be used,
among others.
[0173] Even more preferred polymerases are those that are
essentially devoid of a 5' to 3' exonuclease activity, so as to
assure that the probe will not be extended past the 5' end of the
probe. Exemplary enzymes lacking 5' to 3' exonuclease activity
include the Klenow fragment of the DNA Polymerase and the Stoffel
fragment of DNAPTaq Polymerase. For example, the Stoffel fragment
of Taq DNA polymerase lacks 5' to 3' exonuclease activity due to
genetic manipulations, which result in the production of a
truncated protein lacking the N-terminal 289 amino acids. (See
e.g., Lawyer et al., J. Biol. Chem., 264:6427-6437 [1989]; and
Lawyer et al., PCR Meth. Appl., 2:275-287 [1993]). Analogous mutant
polymerases have been generated for polymerases derived from T.
maritima, Tspsl7, TZ05, Tth and Taf.
[0174] Even more preferred polymerases are those that lack a 3' to
5' exonuclease activity, which is commonly referred to as a
proof-reading activity, and which removes bases which are
mismatched at the 3' end of a primer-template duplex. Although the
presence of 3' to 5' exonuclease activity provides increased
fidelity in the starnd synthesized, the 3' to 5' exonuclease
activity found in thermostable DNA polymerases such as Tma
(including mutant forms of Tma that lack 5' to 3' exonuclease
activity) also degrades single-stranded DNA such as the primers
used in the PCR, single-stranded templates and single-stranded PCR
products. The integrity of the 3' end of an oligonucleotide primer
used in a primer extension process is critical as it is from this
terminus that extension of the nascent strand begins. Degradation
of the 3' end leads to a shortened oligonucleotide which in turn
results in a loss of specificity in the priming reaction (i.e., the
shorter the primer the more likely it becomes that spurious or
non-specific priming will occur).
[0175] Yet even more preferred polymerases are thermostable
polymerases. For the purposes of this invention, a heat resistant
enzyme is defined as any enzyme that retains most of its activity
after one hour at 40.degree. C. under optimal conditions. Examples
of thermostable polymerase which lack both 5' to 3'exonuclease and
3' to 5' exonuclease include Stoffel fragment of Taq DNA
polymerase. This polymerase lacks the 5' to 3' exonuclease activity
due to genetic manipulation and no 3' to 5' activity is present as
Taq polymerase is naturally lacking in 3' to 5' exonuclease
activity. Tth DNA polymerase is derived form Thermus thermophilus,
and is available form Epicentre Technologies, Molecular Biology
Resource Inc., or Perkin-Elmer Corp. Other useful DNA polymerases
which lack 3' exonuclease activity include a Vent[R](exo-),
available from New England Biolabs, Inc., (purified from strains of
E. coli that carry a DNA polymerase gene from the archaebacterium
Thermococcus litoralis), and Hot Tub DNA polymerase derived from
Thermus flavus and available from Amersham Corporation.
[0176] Other preferred enzymes which are thermostable and deprived
of 5' to 3' exonuclease activity and of 3' to 5' exonuclease
activity include AmpliTaq Gold. Other DNA polymerases, which are at
least substantially equivalent may be used like other N-terminally
truncated Thermus aquaticus (Taq) DNA polymerase I. the polymerase
named KlenTaq I and KlenTaq LA are quite suitable for that purpose.
Of course, any other polymerase having these characteristics can
also be used according to the invention.
[0177] The conditions for performing the addition of one or more
nucleotides at the 3' end of the probe will depend on the
particular enzyme used, and will generally follow the conditions
recommended by the manufacturer of the enzymes used.
[0178] The nucleotides are preferably added to a final
concentration from about 0.01 uM to about 100 uM, and preferably
about 0.1 UM to 10 UM in the reaction. The concentration of ligase
to add is described in the following section. Preferred amounts of
Taq DNA Polymerase Stoffel fragment include 0.05 u/ul. A typical
reaction volume is about 10 to 20 ul. Preferred amounts of template
and probe DNA are also described in the following section.
[0179] In a preferred embodiment, the template nucleic acids and
probe(s) are combined in a reaction mixture together with a ligase,
ligase buffer and polymerase. The template and probe(s) are then
denatured, e.g., by incubation at 95.degree. C. for about 5 to 10
minutes, and then annealed, e.g., by decreasing the temperature of
the reaction. As described above, the annealing conditions will
depend on the Tm of the homology regions. Polymerization and
ligation are then done by adding nucleotides followed by
incubation, e.g., for about 10 minutes at 65.degree. C.
Alternatively, the nucleic acids are first incubated together in
the absence of enzymes, denatured and annealed and then the enzymes
are added and the reactions are further incubated for, e.g., about
10 minutes at 65.degree. C.
[0180] In order to decrease background signals that result from the
attachment and ligation of a non complementary nucleotide, instead
of adding a single dNTP to the polymerization reaction, one dNTP
could be added along with the other three ddNTP's. These ddNTPs
would not allow ligation but would render the reaction insensitive
to small amounts of contaminating nucleotide.
[0181] Background signals may also result from the presence of the
"correct" nucleotide in the reaction due to the presence of
nucleotides in reagents, and its attachment to the probe.
Contamination of reagents with nucleotides can be reduced by
treatment of the reagents with an enzyme that degrades free
nucleotides. Preferred enzymes include Apyrase and phosphotases,
with the former being especially preferred. As described in the
Examples, Apyrase is usually added to the reaction prior to the
addition of the one or more dNTPs, at about a concentration of 0.5
mU/ul in a typical reaction of about 20 ul. Generally, the
reactions are then incubated at 20.degree. C. for a few minutes to
up to 30 minutes. The enzyme is then denatured by incubation of the
reaction for about 5 to 10 minutes at 95.degree. C. Alternatively
alkaline phosphatases may be used such as, e.g. shrimp alkaline
phosphatase.
[0182] Ligation of the 3' and 5' ends of the probe(s) can be
performed using an enzyme, or chemically. Preferably, ligation is
carried out enzymatically using a ligase in a standard protocol.
Many ligases are known and are suitable for use in the invention,
e.g. Lehman, Science, 186: 790-797 (1974); Engler et al, DNA
Ligases, pages 3-30 in Boyer, editor, The Enzymes, Vol. 15B
(Academic Press, New York, 1982); and the like. Preferred ligases
include T4 DNA ligase, T7 DNA ligase, E. coli DNA ligase, Taq
ligase, Pfu ligase, and Tth ligase. Protocols for their use are
well known, e.g. Sambrook et al (cited above); Barany, PCR Methods
an Applications, 1: 5-16 (1991); Marsh et al., Strategies, 5: 73-76
(1992); and the like. Generally, ligases require that a 5'
phosphate group be present for ligation to the 3' hydroxyl of an
abutting strand. Preferred ligases include thermostable or
(thermophilic) ligases, such as pfu ligase, Tth ligase, Taq ligase
and Ampligase.TM. DNA ligase (Epicentre Technologies, Madison,
Wis.). Ampligase has a low blunt end ligation activity.
[0183] The preferred ligase is one which has the least mismatch
ligation and ligation across the gap activity. The specificity of
ligase can be increased by substituting the more specific
NAD+-dependant ligases such as E. coli ligase and (thermostable)
Taq ligase for the less specific T4 DNA ligase. The use of NAD
analogues in the ligation reaction further increases specificity of
the ligation reaction. See, U.S. Pat. No. 5,508,179 to Wallace et
al.
[0184] The conditions for carrying out the ligation will depend on
the particular ligase used and will generally follow the
manufacturer's recommendations. For example, preferred Ampligase
concentrations are from about 0.0001 to about 0.001 u/ul, and
preferably about 0.0005 ulul. Preferred concentrations of probe
nucleic acids are from about 0.001 to about 0.01 picomoles/ul and
even more preferably, about 0.015 picomoles/ul. Preferred
concentrations of template nucleic acids include from about 1
zeptomole/ul to about 1 attomole/ul, most preferably about 5
zeptomoles/ul. A typical reaction is performed in a total of about
20 ul.
[0185] In a preferred embodiment, the template nucleic acids and
probe(s) are combined in a reaction mixture together with a ligase
and ligase buffer. The template and probe(s) are then denatured,
e.g., by incubation at 95.degree. C. for about 5 to 10 minutes, and
then annealed, e.g., by decreasing the temperature of the reaction.
The annealing conditions will depend on the Tm of the homology
regions, as described elsewhere herein. Annealing can be carried
out by slowing reducing the temperature from 95.degree. C. to about
the Tm or several degrees below the Tm. Alternatively, annealing
can be carried out by incubating the reaction at a temperature
several degrees below the Tm for, e.g., about 10 to about 60
minutes. For example, the annealing step can be carried out for
about 15 minutes. Ligation can be then carried out by incubation
the reactions for about 10 minutes at 65.degree. C.
[0186] Alternatively, the nucleic acids are denatured and annealed
in the absence of the ligase, and the ligase is added to the
annealed nucleic acids and then incubated, e.g., for about 10
minutes at 65.degree. C. This embodiment is preferably for non heat
stable ligases.
[0187] As mentioned previously, unreacted probes can contribute to
backgrounds from undesired non-specific amplification. In a
preferred embodiment, any unreacted precircle probes and/or target
sequences are rendered unavailable for amplification. This can be
done in a variety of ways, as will be appreciated by those in the
art. In one embodiment, exonucleases are added, that will degrade
any linear nucleic acids, leaving the closed circular probes.
Suitable 3'-exonucleases include, but are not limited to, exo I,
exo III, exo VII, exo V, and polymerases, as many polymerases have
excellent exonuclease activity, etc.
[0188] In another preferred embodiment, terminal transferase can be
used to add nucleotides comprising separation labels such as biotin
to any linear molecules, and then the mixture run through a
strepavidin system to remove any linear nucleic acids, leaving only
the closed circular probes. For example, when genomic DNA is used
as the target, this may be biotinylated using a variety of
techniques, and the precircle probes added and circularized. Since
the circularized probes are catenated on the genomic DNA, the
linear unreacted precircle probes can be washed away. The closed
circle probes can then be cleaved, such that they are removed from
the genomic DNA, collected and amplified. Similarly, terminal
transferase may be used to add chain terminating nucleotides, to
prevent extension and/or amplification. Suitable chain terminating
nucleotides include, but are not limited to, dideoxy-triphosphate
nucleotides (ddNTPs), halogenated dNTPs and acyclo nucleotides
(NEN). These latter chain terminating nucleotide analogs are
particularly good substrates for Deep vent (exo.sup.-) and
thermosequenase.
[0189] In addition, known separation techniques based on size can
be used to separate the genomic DNA with the associated closed
circle probe and the linear probes.
[0190] In addition, it is important to note that there may be PCR
background that results from polymerase extension of the 3' end of
the probe along the template. This background may be reduced in
order to obtain high levels of enrichment of the specifically
ligated probes. The following represent examples of PCR background
suppression techniques. These techniques may be based on the
elimination of the original probe and/or template nucleic
acids.
[0191] In one embodiment of the "two step" process, after ligating
the probes, a biotinylated primer is introduced which is
complementary to the first probe primer. An extension
polymerization reaction is then performed resulting in either a
full length probe complement (in the case of the ligated probes) or
a truncated probe missing the second primer site (in the case of
the unligated probes) (see, e.g., FIG. 1). This product can then be
captured on magnetic streptavidin beads and the template and
original probes washed away. The PCR can then performed using this
"clean" product. Because the unligated probe products will lack the
second primer site, they will not amplify. Numerous examples of
such a reaction are provided in the Examples. Biotinylated probes
can be synthesized on an oligonucleotide synthesizer.
[0192] In another embodiment, the probe is made to contain a uracil
base between the first primer sequence and the first homology
sequence. After a run-off reaction as described above (the two step
process), uracil-N-glycosylase can be used to induce strand
scission on all the original probes stopping any PCR. Only the full
length extension products will amplify.
[0193] In yet another embodiment, instead of the elongation
reaction as described above, a rolling circle polymerization
reaction can be performed. In this way many concatenated copies of
the ligated probes can be made, effectively increasing the
concentration of the ligated probes relative to the unligated
probes and leading to a lower level of amplified un-ligated probe.
This technique is described, e.g., in Example 2, and in U.S. Pat.
No. 5,854,033 by Lizardi et al.
[0194] Yet other methods to reduce background amplification, i.e.,
non specific amplification, include using an exonuclease to degrade
any unligated probe. Prior to amplification, any exonuclease must
be eliminated from the reaction mixture, e.g., by heat denaturation
of the nuclease.
[0195] Once a closed circular probe is formed, it can follow one of
two fates, as described herein. In a preferred embodiment, any
remaining linear probes, sequences and primers are removed, and the
closed circle probe is cleaved as outlined herein, and amplified as
outlined below, to form amplicons (the "one-step" process).
Alternatively, a linear copy of the closed probe is made, and it is
this linear copy (comprising new termini) that is used in the
amplification reactions.
[0196] Once cleaved, the linearized cleaved probes can then be
amplified. However, in the genotyping "gap" embodiments, it is
useful to first remove or degrade any dNTPs prior to the addition
of the interrogation dNTP. This can be done in a variety of ways,
as outlined herein, generally by the addition of nucleotide
degrading enzymes, including, but not limited to, apyrase, as
outlined herein. Once cleaved, the linearized cleaved probes can
then be amplified. As will be appreciated by those in the art,
there are a wide variety of suitable amplification techniques that
can be used to form the amplicons of the invention that are then
detected, generally via the use of arrays, as is more fully
outlined below. Suitable amplification methods include both target
amplification and signal amplification and include, but are not
limited to, polymerase chain reaction (PCR), ligation chain
reaction (sometimes referred to as oligonucleotide ligase
amplification OLA), cycling probe technology (CPT), strand
displacement assay (SDA), transcription mediated amplification
(TMA), nucleic acid sequence based amplification (NASBA), and
invasive cleavage technology. All of these methods require a primer
nucleic acid (including nucleic acid analogs) that is hybridized to
a target sequence to form a hybridization complex, and an enzyme is
added that in some way modifies the primer to form a modified
primer. For example, PCR generally requires two primers, dNTPs and
a DNA polymerase; LCR requires two primers that adjacently
hybridize to the target sequence and a ligase; CPT requires one
cleavable primer and a cleaving enzyme; invasive cleavage requires
two primers and a cleavage enzyme; etc. Thus, in general, a cleaved
probe is added to a reaction mixture that comprises the necessary
amplification components, and amplicons are formed.
[0197] In general, the amplicon comprises a detectable label, such
as a fluorescent label, which is either incorporated by the enzyme
or present on the original primer. As required, the unreacted
primers are removed, in a variety of ways, as will be appreciated
by those in the art. The hybridization complex is then
disassociated, and the amplicon is detected and optionally
quantitated by an array. In some cases, the first amplicon serves
as a target sequence for a secondary reaction, which then produces
a number of second amplicons, which can be detected as outlined
herein.
[0198] Accordingly, the reaction starts with the addition of a
primer nucleic acid to the target sequence which forms a
hybridization complex. Once the hybridization complex between the
primer and the target sequence has been formed, an enzyme,
sometimes termed an "amplification enzyme", is used to modify the
primer. As for all the methods outlined herein, the enzymes may be
added at any point during the assay, either prior to, during, or
after the addition of the primers. The identity of the enzyme will
depend on the amplification technique used, as is more fully
outlined below. Similarly, the modification will depend on the
amplification technique, as outlined below.
[0199] Once the enzyme has modified the primer to form an amplicon,
the hybridization complex is disassociated. In one aspect,
dissociation is by modification of the assay conditions. In another
aspect, the modified primer no longer hybridizes to the target
nucleic acid and dissociates. Either one or both of these aspects
can be employed in signal and target amplification reactions as
described below. Generally, the amplification steps are repeated
for a period of time to allow a number of cycles, depending on the
number of copies of the original target sequence and the
sensitivity of detection, with cycles ranging from 1 to thousands,
with from 10 to 100 cycles being preferred and from 15 to 50 cycles
being especially preferred. In certain embodiments, e.g., where one
desires quantifying a specific sequence, it may be desirable to
perform several parralel amplification reactions each using a
different number of cycles, such that at least in one set of
reactions, the amplification reaction will be in the exponential
phase, and will therefore provide a direct correlation between the
level of amplified product and the number of original
sequences.
[0200] After a suitable time of amplification, unreacted primers
are removed, if required, in a variety of ways, as will be
appreciated by those in the art, and the hybridization complex is
disassociated. In general, the amplicon comprises a detectable
label, such as a fluorescent label, which is either incorporated by
the enzyme or present on the original primer, and the amplicon is
added to an array as outlined below. Detection proceeds via
detection of the label as an indication of the presence, absence or
amount of the target sequence, as is more fully outlined below.
[0201] In a preferred embodiment, the amplification is target
amplification. Target amplification involves the amplification
(replication) of the target sequence to be detected, such that the
number of copies of the target sequence is increased. Suitable
target amplification techniques include, but are not limited to,
the polymerase chain reaction (PCR), strand displacement
amplification (SDA), transcription mediated amplification (TMA) and
nucleic acid sequence based amplification (NASBA).
[0202] In a preferred embodiment, the target amplification
technique is PCR. The polymerase chain reaction (PCR) is widely
used and described, and involves the use of primer extension
combined with thermal cycling to amplify a target sequence; see
U.S. Pat. Nos. 4,683,195 and 4,683,202, and PCR Essential Data, J.
W. Wiley & sons, Ed. C. R. Newton, 1995, all of which are
incorporated by reference. In addition, there are a number of
variations of PCR which also find use in the invention, including
"quantitative competitive PCR" or "QC-PCR", "arbitrarily primed
PCR" or "AP-PCR", "immuno-PCR", "Alu-PCR", "PCR single strand
conformational polymorphism" or "PCR-SSCP", "reverse transcriptase
PCR" or "RT-PCR", "biotin capture PCR", "vectorette PCR",
"panhandle PCR", and "PCR select cDNA subtraction",
"allele-specific PCR", among others.
[0203] In general, PCR may be briefly described as follows. A
double stranded target nucleic acid is denatured, generally by
raising the temperature, and then cooled in the presence of an
excess of a PCR primer, which then hybridizes to the first target
strand. A DNA polymerase then acts to extend the primer with dNTPs,
resulting in the synthesis of a new strand forming a hybridization
complex. The sample is then heated again, to disassociate the
hybridization complex, and the process is repeated. By using a
second PCR primer for the complementary target strand, rapid and
exponential amplification occurs. Thus PCR steps are denaturation,
annealing and extension. The particulars of PCR are well known, and
include the use of a thermostable polymerase such as Taq I
polymerase and thermal cycling.
[0204] Accordingly, the PCR reaction requires at least one PCR
primer, a polymerase, and a set of dNTPs. As outlined herein, the
primers may comprise the label, or one or more of the dNTPs may
comprise a label.
[0205] In a preferred embodiment, the target amplification
technique is SDA. Strand displacement amplification (SDA) is
generally described in Walker et al., in Molecular Methods for
Virus Detection, Academic Press, Inc., 1995, and U.S. Pat. Nos.
5,455,166 and 5,130,238, all of which are hereby expressly
incorporated by reference in their entirety.
[0206] In general, SDA may be described as follows. A single
stranded target nucleic acid, usually a DNA target sequence, is
contacted with an SDA primer. An "SDA primer" generally has a
length of 25-100 nucleotides, with SDA primers of approximately 35
nucleotides being preferred. An SDA primer is substantially
complementary to a region at the 3' end of the target sequence, and
the primer has a sequence at its 5' end (outside of the region that
is complementary to the target) that is a recognition sequence for
a restriction endonuclease, sometimes referred to herein as a
"nicking enzyme" or a "nicking endonuclease", as outlined below.
The SDA primer then hybridizes to the target sequence. The SDA
reaction mixture also contains a polymerase (an "SDA polymerase",
as outlined below) and a mixture of all four
deoxynucleoside-triphosphates (also called deoxynucleotides or
dNTPs, i.e. dATP, dTTP, dCTP and dGTP), at least one species of
which is a substituted or modified dNTP; thus, the SDA primer is
modified, i.e. extended, to form a modified primer, sometimes
referred to herein as a "newly synthesized strand". The substituted
dNTP is modified such that it will inhibit cleavage in the strand
containing the substituted dNTP but will not inhibit cleavage on
the other strand. Examples of suitable substituted dNTPs include,
but are not limited, 2'deoxyadenosine 5'-O-(1-thiotriphosphate),
5-methyldeoxycytidine 5'-triphosphate, 2'-deoxyuridine
5'-triphosphate, adn 7-deaza-2'-deoxyguanosine 5'-triphosphate. In
addition, the substitution of the dNTP may occur after
incorporation into a newly synthesized strand; for example, a
methylase may be used to add methyl groups to the synthesized
strand. In addition, if all the nucleotides are substituted, the
polymerase may have 5'-3' exonuclease activity. However, if less
than all the nucleotides are substituted, the polymerase preferably
lacks 5'-3' exonuclease activity.
[0207] As will be appreciated by those in the art, the recognition
site/endonuclease pair can be any of a wide variety of known
combinations. The endonuclease is chosen to cleave a strand either
at the recognition site, or either 3' or 5' to it, without cleaving
the complementary sequence, either because the enzyme only cleaves
one strand or because of the incorporation of the substituted
nucleotides. Suitable recognition site/endonuclease pairs are well
known in the art; suitable endonucleases include, but are not
limited to, HincII, HindIII, AvaI, Fnu4HI, TthIII, NclI, BstXI,
BamHI, etc. A chart depicting suitable enzymes, and their
corresponding recognition sites and the modified dNTP to use is
found in U.S. Pat. No. 5,455,166, hereby expressly incorporated by
reference.
[0208] Once nicked, a polymerase (an "SDA polymerase") is used to
extend the newly nicked strand, 5'-3', thereby creating another
newly synthesized strand. The polymerase chosen should be able to
intiate 5'-3' polymerization at a nick site, should also displace
the polymerized strand downstream from the nick, and should lack
5'-3' exonuclease activity (this may be additionally accomplished
by the addition of a blocking agent). Thus, suitable polymerases in
SDA include, but are not limited to, the Klenow fragment of DNA
polymerase 1, SEQUENASE 1.0 and SEQUENASE 2.0 (U.S. Biochemical),
T5 DNA polymerase and Phi29 DNA polymerase.
[0209] Accordingly, the SDA reaction requires, in no particular
order, an SDA primer, an SDA polymerase, a nicking endonuclease,
and dNTPs, at least one species of which is modified.
[0210] In general, SDA does not require thermocycling. The
temperature of the reaction is generally set to be high enough to
prevent non-specific hybridization but low enough to allow specific
hybridization; this is generally from about 37.degree. C. to about
42.degree. C., depending on the enzymes.
[0211] In a preferred embodiment, as for most of the amplification
techniques described herein, a second amplification reaction can be
done using the complementary target sequence, resulting in a
substantial increase in amplification during a set period of time.
That is, a second primer nucleic acid is hybridized to a second
target sequence, that is substantially complementary to the first
target sequence, to form a second hybridization complex. The
addition of the enzyme, followed by disassociation of the second
hybridization complex, results in the generation of a number of
newly synthesized second strands.
[0212] In a preferred embodiment, the target amplification
technique is nucleic acid sequence based amplification (NASBA).
NASBA is generally described in U.S. Pat. No. 5,409,818; Sooknanan
et al., Nucleic Acid Sequence-Based Amplification, Ch. 12 (pp.
261-285) of Molecular Methods for Virus Detection, Academic Press,
1995; and "Profiting from Gene-based Diagnostics", CTB
International Publishing Inc., N.J., 1996, all of which are
incorporated by reference. NASBA is very similar to both TMA and
QBR. Transcription mediated amplification (TMA) is generally
described in U.S. Pat. Nos. 5,399,491, 5,888,779, 5,705,365,
5,710,029, all of which are incorporated by reference. The main
difference between NASBA and TMA is that NASBA utilizes the
addition of RNAse H to effect RNA degradation, and TMA relies on
inherent RNAse H activity of the reverse transcriptase.
[0213] In general, these techniques may be described as follows. A
single stranded target nucleic acid, usually an RNA target sequence
(sometimes referred to herein as "the first target sequence" or
"the first template", which is the cleaved circular probe), is
contacted with a first primer, generally referred to herein as a
"NASBA primer" (although "TMA primer" is also suitable). Starting
with a DNA target sequence is described below. These primers
generally have a length of 25-100 nucleotides, with NASBA primers
of approximately 50-75 nucleotides being preferred. The first
primer is preferably a DNA primer that has at its 3' end a sequence
that is substantially complementary to the 3' end of the first
template. The first primer also has an RNA polymerase promoter at
its 5' end (or its complement (antisense), depending on the
configuration of the system). The first primer is then hybridized
to the first template to form a first hybridization complex. The
reaction mixture also includes a reverse transcriptase enzyme (an
"NASBA reverse transcriptase") and a mixture of the four dNTPs,
such that the first NASBA primer is modified, i.e. extended, to
form a modified first primer, comprising a hybridization complex of
RNA (the first template) and DNA (the newly synthesized
strand).
[0214] By "reverse transcriptase" or "RNA-directed DNA polymerase"
herein is meant an enzyme capable of synthesizing DNA from a DNA
primer and an RNA template. Suitable RNA-directed DNA polymerases
include, but are not limited to, avian myloblastosis virus reverse
transcriptase ("AMV RT) and the Moloney murine leukemia virus RT.
When the amplification reaction is TMA, the reverse transcriptase
enzyme further comprises a RNA degrading activity as outlined
below.
[0215] In addition to the components listed above, the NASBA
reaction also includes an RNA degrading enzyme, also sometimes
referred to herein as a ribonuclease, that will hydrolyze RNA of an
RNA:DNA hybrid without hydrolyzing single- or double-stranded RNA
or DNA. Suitable ribonucleases include, but are not limited to,
RNase H from E. coli and calf thymus.
[0216] The ribonuclease activity degrades the first RNA template in
the hybridization complex, resulting in a disassociation of the
hybridization complex leaving a first single stranded newly
synthesized DNA strand, sometimes referred to herein as "the second
template".
[0217] In addition, the NASBA reaction also includes a second NASBA
primer, generally comprising DNA (although as for all the probes
herein, including primers, nucleic acid analogs may also be used).
This second NASBA primer has a sequence at its 3' end that is
substantially complementary to the 3' end of the second template,
and also contains an antisense sequence for a functional promoter
and the antisense sequence of a transcription initiation site.
Thus, this primer sequence, when used as a template for synthesis
of the third DNA template, contains sufficient information to allow
specific and efficient binding of an RNA polymerase and initiation
of transcription at the desired site. Preferred embodiments
utilizes the antisense promoter and transcription initiation site
are that of the T7 RNA polymerase, although other RNA polymerase
promoters and initiation sites can be used as well, as outlined
below.
[0218] The second primer hybridizes to the second template, and a
DNA polymerase, also termed a "DNA-directed DNA polymerase", also
present in the reaction, synthesizes a third template (a second
newly synthesized DNA strand), resulting in second hybridization
complex comprising two newly synthesized DNA strands.
[0219] Finally, the inclusion of an RNA polymerase and the required
four ribonucleoside triphosphates (ribonucleotides or NTPs) results
in the synthesis of an RNA strand (a third newly synthesized strand
that is essentially the same as the first template). The RNA
polymerase, sometimes referred to herein as a "DNA-directed RNA
polymerase", recognizes the promoter and specifically initiates RNA
synthesis at the initiation site. In addition, the RNA polymerase
preferably synthesizes several copies of RNA per DNA duplex.
Preferred RNA polymerases include, but are not limited to, T7 RNA
polymerase, and other bacteriophage RNA polymerases including those
of phage T3, phage .phi.II, Salmonella phage sp6, or Pseudomonase
phage gh-1.
[0220] In some embodiments, TMA and NASBA are used with starting
DNA target sequences. In this embodiment, it is necessary to
utilize the first primer comprising the RNA polymerase promoter and
a DNA polymerase enzyme to generate a double stranded DNA hybrid
with the newly synthesized strand comprising the promoter sequence.
The hybrid is then denatured and the second primer added.
[0221] Accordingly, the NASBA reaction requires, in no particular
order, a first NASBA primer, a second NASBA primer comprising an
antisense sequence of an RNA polymerase promoter, an RNA polymerase
that recognizes the promoter, a reverse transcriptase, a DNA
polymerase, an RNA degrading enzyme, NTPs and dNTPs, in addition to
the detection components outlined below.
[0222] These components result in a single starting RNA template
generating a single DNA duplex; however, since this DNA duplex
results in the creation of multiple RNA strands, which can then be
used to initiate the reaction again, amplification proceeds
rapidly.
[0223] Accordingly, the TMA reaction requires, in no particular
order, a first TMA primer, a second TMA primer comprising an
antisense sequence of an RNA polymerase promoter, an RNA polymerase
that recognizes the promoter, a reverse transcriptase with RNA
degrading activity, a DNA polymerase, NTPs and dNTPs, in addition
to the detection components outlined below.
[0224] These components result in a single starting RNA template
generating a single DNA duplex; however, since this DNA duplex
results in the creation of multiple RNA strands, which can then be
used to initiate the reaction again, amplification proceeds
rapidly.
[0225] In this way, a number of secondary target molecules (e.g.
amplicons) are made. As is more fully outlined below, these
reactions (that is, the products of these reactions) can be
detected in a number of ways.
[0226] In embodiments in which the unreacted linear probes are
removed, an alternative to target amplification is signal
amplification based on interactions with a specific probe sequence
such as a barcode sequence. In a preferred embodiment, the
amplification technique is signal amplification. Signal
amplification involves the use of limited number of target
molecules as templates to either generate multiple signalling
probes or allow the use of multiple signalling probes. Signal
amplification strategies include OLA, CPT, Q.beta.R and invasive
cleavage technology.
[0227] In a preferred embodiment, single base extension (SBE;
sometimes referred to as "minisequencing") is used for
amplification. Briefly, SBE is a technique that utilizes an
extension primer that hybridizes to the target nucleic acid, in
this case to at least the barcode sequence. A polymerase (generally
a DNA polymerase) is used to extend the 3' end of the primer with a
nucleotide analog labeled a detection label as described herein.
Based on the fidelity of the enzyme, a nucleotide is only
incorporated into the extension primer if it is complementary to
the adjacent base in the target strand. Generally, the nucleotide
is derivatized such that no further extensions can occur, so only a
single nucleotide is added. However, for amplification reactions,
this may not be necessary. Once the labeled nucleotide is added,
detection of the label proceeds as outlined herein. See generally
Sylvanen et al., Genomics 8:684-692 (1990); U.S. Pat. Nos.
5,846,710 and 5,888,819; Pastinen et al., Genomics Res.
7(6):606-614 (1997); all of which are expressly incorporated herein
by reference.
[0228] The reaction is initiated by introducing the assay complex
comprising the cleaved circular probe to a solution comprising a
first nucleotide, frequently an nucleotide analog. By "nucleotide
analog" in this context herein is meant a
deoxynucleoside-triphosphate (also called deoxynucleotides or
dNTPs, i.e. dATP, dTTP, dCTP and dGTP), that is further derivatized
to be chain terminating. As will be appreciated by those in the
art, any number of nucleotide analogs may be used, as long as a
polymerase enzyme will still incorporate the nucleotide at the
interrogation position. Preferred embodiments utilize
dideoxy-triphosphate nucleotides (ddNTPs). Generally, a set of
nucleotides comprising ddATP, ddCTP, ddGTP and ddTTP is used, at
least one of which includes a label, and preferably all four.
[0229] In a preferred embodiment, the nucleotide analogs comprise a
detectable label, which can be either a primary or secondary
detectable label as outlined below. However, the enzymatic
incorporation of nucleotides comprising fluorophores is poor under
many conditions; accordingly, preferred embodiments utilize
secondary detectable labels.
[0230] In addition to a first nucleotide, the solution also
comprises an extension enzyme, generally a DNA polymerase. Suitable
DNA polymerases include, but are not limited to, the Klenow
fragment of DNA polymerase 1, SEQUENASE 1.0 and SEQUENASE 2.0 (U.S.
Biochemical), T5 DNA polymerase and Phi29 DNA polymerase. If the
NTP is complementary to the base of the detection position of the
target sequence, which is adjacent to the extension primer, the
extension enzyme will add it to the extension primer. Thus, the
extension primer is modified, i.e. extended, to form a modified
primer, sometimes referred to herein as a "newly synthesized
strand".
[0231] A limitation of this method is that unless the target
nucleic acid is in sufficient concentration, the amount of
unextended primer in the reaction greatly exceeds the resultant
extended-labeled primer. The excess of unextended primer competes
with the detection of the labeled primer in the assays described
herein. Accordingly, when SBE is used, preferred embodiments
utilize methods for the removal of unextended primers as outlined
herein.
[0232] One method to overcome this limitation is thermocycling
minisequencing in which repeated cycles of annealing, primer
extension, and heat denaturation using a thermocycler and
thermo-stable polymerase allows the amplification of the extension
probe which results in the accumulation of extended primers. For
example, if the original unextended primer to target nucleic acid
concentration is 100:1 and 100 thermocycles and extensions are
performed, a majority of the primer will be extended.
[0233] Thus, the SBE reaction requires, in no particular order, an
extension primer, a polymerase and dNTPs, at least one of which is
labeled.
[0234] In a preferred embodiment, the signal amplification
technique is OLA. OLA, which is referred to as the ligation chain
reaction (LCR) when two-stranded substrates are used, involves the
ligation of two smaller probes into a single long probe, using the
target sequence as the template. In LCR, the ligated probe product
becomes the predominant template as the reaction progresses. The
method can be run in two different ways; in a first embodiment,
only one strand of a target sequence is used as a template for
ligation; alternatively, both strands may be used. See generally
U.S. Pat. Nos. 5,185,243, 5,679,524 and 5,573,907; EP 0 320 308 B1;
EP 0 336 731 B1; EP 0 439 182 B1; WO 90/01069; WO 89/12696; WO
97/31256; and WO 89/09835, and U.S. Ser. Nos. 60/078,102 and
60/073,011, all of which are incorporated by reference.
[0235] In a preferred embodiment, the cleaved circular probe
comprises a first target domain and a second target domain, which
are adjacent and contiguous, and should span the barcode sequence.
A first OLA primer and a second OLA primer nucleic acids are added,
that are substantially complementary to their respective target
domain and thus will hybridize to the target domains. These target
domains may be directly adjacent, i.e. contiguous, or separated by
a number of nucleotides. If they are non-contiguous, nucleotides
are added along with means to join nucleotides, such as a
polymerase, that will add the nucleotides to one of the primers.
The two OLA primers are then covalently attached, for example using
a ligase enzyme such as is known in the art, to form a modified
primer. This forms a first hybridization complex comprising the
ligated probe and the target sequence. This hybridization complex
is then denatured (disassociated), and the process is repeated to
generate a pool of ligated probes.
[0236] In a preferred embodiment, OLA is done for two strands of a
double-stranded target sequence. The target sequence is denatured,
and two sets of probes are added: one set as outlined above for one
strand of the target, and a separate set (i.e. third and fourth
primer probe nucleic acids) for the other strand of the target. In
a preferred embodiment, the first and third probes will hybridize,
and the second and fourth probes will hybridize, such that
amplification can occur. That is, when the first and second probes
have been attached, the ligated probe can now be used as a
template, in addition to the second target sequence, for the
attachment of the third and fourth probes. Similarly, the ligated
third and fourth probes will serve as a template for the attachment
of the first and second probes, in addition to the first target
strand. In this way, an exponential, rather than just a linear,
amplification can occur.
[0237] Again, as outlined above, the detection of the LCR reaction
can also occur directly, in the case where one or both of the
primers comprises at least one detectable label, or indirectly,
using sandwich assays, through the use of additional probes; that
is, the ligated probes can serve as target sequences, and detection
may utilize amplification probes, capture probes, capture extender
probes, label probes, and label extender probes, etc.
[0238] In a preferred embodiment, the signal amplification
technique is invasive cleavage technology, which is described in a
number of patents and patent applications, including U.S. Pat. Nos.
5,846,717; 5,614,402; 5,719,028; 5,541,311; and 5,843,669, all of
which are hereby incorporated by reference in their entirety.
Invasive cleavage technology is based on structure-specific
nucleases that cleave nucleic acids in a site-specific manner. Two
probes are used: an "invader" probe and a "signalling" probe, that
adjacently hybridize to a target sequence with overlap. For
mismatch discrimination, the invader technology relies on
complementarity at the overlap position where cleavage occurs. The
enzyme cleaves at the overlap, and releases the "tail" which may or
may not be labeled. This can then be detected.
[0239] Generally, invasive cleavage technology may be described as
follows. A cleaved circular probe is recognized by two distinct
probes. A first probe, generally referred to herein as an "invader"
probe, is substantially complementary to a first portion of the
cleaved circular probe. In this embodiment, a barcode is not
necessary, as the first portion of the cleaved circular probe can
include a target specific domain. A second probe, generally
referred to herein as a "signal probe", is partially complementary
to a target domain of the cleaved circular probe; the 3' end of the
signal oligonucleotide is substantially complementary to the
cleaved circular probe while the 5' end is non-complementary and
preferably forms a single-stranded "tail" or "arm". The
non-complementary end of the second probe preferably comprises a
"generic" or "unique" sequence, e.g. a barcode sequence, that is
used to indicate the presence or absence of the target nucleic
acid, as described below. The barcode sequence of the second probe
preferably comprises at least one detectable label, although as
outlined herein, since this detection sequence can function as a
target sequence for a capture probe, sandwich configurations
utilizing label probes as described herein may also be done.
[0240] Hybridization of the first and second oligonucleotides near
or adjacent to one another on the target nucleic acid forms a
number of structures. In a preferred embodiment, a forked cleavage
structure forms and is a substrate of a nuclease which cleaves the
detection sequence from the signal oligonucleotide. The site of
cleavage is controlled by the distance or overlap between the 3'
end of the invader oligonucleotide and the downstream fork of the
signal oligonucleotide. Therefore, neither oligonucleotide is
subject to cleavage when misaligned or when unattached to target
nucleic acid.
[0241] In a preferred embodiment, the nuclease that recognizes the
forked cleavage structure and catalyzes release of the tail is
thermostable, thereby, allowing thermal cycling of the cleavage
reaction, if desired. Preferred nucleases derived from thermostable
DNA polymerases that have been modified to have reduced synthetic
activity which is an undesirable side-reaction during cleavage are
disclosed in U.S. Pat. Nos. 5,719,028 and 5,843,669, hereby
expressly by reference. The synthetic activity of the DNA
polymerase is reduced to a level where it does not interfere with
detection of the cleavage reaction and detection of the freed tail.
Preferably the DNA polymerase has no detectable polymerase
activity. Examples of nucleases are those derived from Thermus
aquaticus, Thermus flavus, or Thermus thermophilus.
[0242] In another embodiment, thermostable structure-specific
nucleases are Flap endonucleases (FENs) selected from FEN-1 or
FEN-2 like (e.g. XPG and RAD2 nucleases) from Archaebacterial
species, for example, FEN-1 from Methanococcus jannaschii,
Pyrococcus furiosis, Pyrococcus woesei, and Archaeoglobus fulgidus.
(U.S. Pat. No. 5,843,669 and Lyamichev et al. 1999. Nature
Biotechnology 17:292-297; both of which are hereby expressly by
reference).
[0243] In a preferred embodiment, the nuclease is AfuFENI or
PfuFENI nuclease. To cleave a forked structure, these nucleases
require at least one overlapping nucleotide between the signal and
invasive probes to recognize and cleave the 5' end of the signal
probe. To effect cleavage the 3'-terminal nucleotide of the invader
oligonucleotide is not required to be complementary to the target
nucleic acid. In contast, mismatch of the signal probe one base
upstream of the cleavage site prevents creation of the overlap and
cleavage.
[0244] In a preferred embodiment, the signal amplification
technique is CPT. CPT technology is described in a number of
patents and patent applications, including U.S. Pat. Nos.
5,011,769, 5,403,711, 5,660,988, and 4,876,187, and PCT published
applications WO 95/05480, WO 95/1416, and WO 95/00667, and U.S.
Ser. No. 09/014,304, all of which are expressly incorporated by
reference in their entirety.
[0245] Generally, CPT may be described as follows. A CPT primer
(also sometimes referred to herein as a "scissile primer"),
comprises two probe sequences separated by a scissile linkage. The
CPT primer is substantially complementary to the target sequence
and thus will hybridize to it to form a hybridization complex. The
scissile linkage is cleaved, without cleaving the target sequence,
resulting in the two probe sequences being separated. The two probe
sequences can thus be more easily disassociated from the target,
and the reaction can be repeated any number of times. In general, a
first probe sequence (e.g. one end of the primer) comprises a
capture tag, such as biotin, and the other (the second probe
sequence) at least one label. Upon completion of the reaction, the
binding partner of the capture tag (e.g. streptavidin) is used to
remove all unreacted probes and the cleaved first probe sequences,
leaving behind the second probe sequence, which can be detected,
for example by binding to an array. In the present invention, the
CPT primers and precircle probes are constructed such that it is
the barcode sequence that serves as the second probe sequence.
[0246] By "scissile linkage" herein is meant a linkage within the
scissile probe that can be cleaved when the probe is part of a
hybridization complex, that is, when a double-stranded complex is
formed. It is important that the scissile linkage cleave only the
scissile probe and not the sequence to which it is hybridized (i.e.
either the target sequence or a probe sequence), such that the
target sequence may be reused in the reaction for amplification of
the signal. As used herein, the scissile linkage, is any connecting
chemical structure which joins two probe sequences and which is
capable of being selectively cleaved without cleavage of either the
probe sequences or the sequence to which the scissile probe is
hybridized. The scissile linkage may be a single bond, or a
multiple unit sequence. As will be appreciated by those in the art,
a number of possible scissile linkages may be used.
[0247] In a preferred embodiment, the scissile linkage comprises
RNA. This system, previously described in as outlined above, is
based on the fact that certain double-stranded nucleases,
particularly ribonucleases, will nick or excise RNA nucleosides
from a RNA:DNA hybridization complex. Of particular use in this
embodiment is RNAseH, Exo III, and reverse transcriptase.
[0248] CPT may be done enzymatically or chemically. That is, in
addition to RNAseH, there are several other cleaving agents which
may be useful in cleaving RNA (or other nucleic acid) scissile
bonds. For example, several chemical nucleases have been reported;
see for example Sigman et al., Annu. Rev. Biochem. 1990, 59,
207-236; Sigman et al., Chem. Rev. 1993, 93, 2295-2316; Bashkin et
al., J. Org. Chem. 1990, 55, 5125-5132; and Sigman et al., Nucleic
Acids and Molecular Biology, vol. 3, F. Eckstein and D. M. J.
Lilley (Eds), Springer-Verlag, Heidelberg 1989, pp. 13-27; all of
which are hereby expressly incorporated by reference.
[0249] The first step of the CPT method requires hybridizing a
primary scissile primer (also called a primary scissile probe) to
the target. This is preferably done at a temperature that allows
both the binding of the longer primary probe and disassociation of
the shorter cleaved portions of the primary probe, as will be
appreciated by those in the art.
[0250] In general, the scissile probes are introduced in a molar
excess to their targets, with ratios of scissile probe:target of at
least about 100:1 being preferred, at least about 1000:1 being
particularly preferred, and at least about 10,000:1 being
especially preferred. In some embodiments the excess of
probe:target will be much greater. In addition, ratios such as
these may be used for all the amplification techniques outlined
herein.
[0251] Once the hybridization complex between the primary scissile
probe and the target has been formed, the complex is subjected to
cleavage conditions. As will be appreciated, this depends on the
composition of the scissile probe; if it is RNA, RNAseH is
introduced. It should be noted that under certain circumstances,
such as is generally outlined in WO 95/00666 and WO 95/00667,
hereby incorporated by reference, the use of a double-stranded
binding agent such as RNAseH may allow the reaction to proceed even
at temperatures above the Tm of the primary probe:target
hybridization complex. Accordingly, the addition of scissile probe
to the target can be done either first, and then the cleavage agent
or cleavage conditions introduced, or the probes may be added in
the presence of the cleavage agent or conditions.
[0252] The cleavage conditions result in the separation of the two
(or more) probe sequences of the primary scissile probe. As a
result, the shorter probe sequences will no longer remain
hybridized to the target sequence, and thus the hybridization
complex will disassociate, leaving the target sequence intact.
[0253] The optimal temperature for carrying out the CPT reactions
is generally from about 5C to about 25.degree. C. below the melting
temperatures of the probe:target hybridization complex. This
provides for a rapid rate of hybridization and high degree of
specificity for the target sequence. The Tm of any particular
hybridization complex depends on salt concentration, G-C content,
and length of the complex, as is known in the art and described
herein.
[0254] These steps are repeated by allowing the reaction to proceed
for a period of time. The reaction is usually carried out for about
15 minutes to about 1 hour. Generally, each molecule of the target
sequence will turnover between 100 and 1000 times in this period,
depending on the length and sequence of the probe, the specific
reaction conditions, and the cleavage method. For example, for each
copy of the target sequence present in the test sample 100 to 1000
molecules will be cleaved by RNAseH. Higher levels of amplification
can be obtained by allowing the reaction to proceed longer, or
using secondary, tertiary, or quaternary probes, as is outlined
herein.
[0255] Upon completion of the reaction, generally determined by
time or amount of cleavage, the uncleaved scissile probes must be
removed or neutralized prior to detection, such that the uncleaved
probe does not bind to a detection probe, causing false positive
signals. As will be appreciated by those in the art, this may be
done in a variety of ways.
[0256] In a preferred embodiment, the separation is facilitated by
the use of beads containing the primary probe. Thus, when the
scissile probes are attached to beads, removal of the beads by
filtration, centrifugation, the application of a magnetic field,
electrostatic interactions for charged beads, adhesion, etc.,
results in the removal of the uncleaved probes.
[0257] After removal of the uncleaved probe, as required, detection
proceeds via the addition of the cleaved probe sequences to the
array compositions, as outlined below. In general, the cleaved
probe is bound to a capture probe, either directly or indirectly,
and the label is detected. In a preferred embodiment, no higher
order probes are used, and detection is based on the probe
sequence(s) of the primary primer. In a preferred embodiment, at
least one, and preferably more, secondary probes (also referred to
herein as secondary primers) are used; the secondary probes
hybridize to the domains of the cleavage probes; etc.
[0258] Thus, CPT requires, again in no particular order, a first
CPT primer comprising a first probe sequence, a scissile linkage
and a second probe sequence; and a cleavage agent.
[0259] In this manner, CPT results in the generation of a large
amount of cleaved primers, which then can be detected as outlined
below.
[0260] In all of the amplification methods described herein, labels
are used. In general, either direct or indirect detection of the
target products (e.g. amplicons) can be done. "Direct" detection as
used in this context, as for the other reactions outlined herein,
requires the incorporation of a label, in this case a detectable
label, preferably an optical label such as a fluorophore, into the
amplicon, with detection proceeding as outlined below. In this
embodiment, the label(s) may be incorporated in a variety of ways:
(1) the primers comprise the label(s), for example attached to the
base, a ribose, a phosphate, or to analogous structures in a
nucleic acid analog; (2) modified nucleosides are used that are
modified at either the base or the ribose (or to analogous
structures in a nucleic acid analog) with the label(s); these
label-modified nucleosides are then converted to the triphosphate
form and are incorporated into a newly synthesized strand by an
extension enzyme such as a polymerase; (3) modified nucleotides are
used that comprise a functional group that can be used
(post-enzymatic reaction) to add a detectable label; (4) modified
primers are used that comprise a functional group that can be used
to add a detectable label in a similar manner; or (5) a label probe
that is directly labeled and hybridizes to a portion of the
amplicon can be used. Any of these methods result in a detectable
amplicon.
[0261] Thus, the modified strands comprise a detection label. By
"detection label" or "detectable label" herein is meant a moiety
that allows detection. This may be a primary label or a secondary
label. Accordingly, detection labels may be primary labels (i.e.
directly detectable) or secondary labels (indirectly
detectable).
[0262] In a preferred embodiment, the detection label is a primary
label. A primary label is one that can be directly detected, by
spectroscopic, photochemical, biochemical, immunochemical,
electrical, optical or chemical means. Useful labels in the present
invention include spectral labels such as fluorescent dyes (e.g.,
fluorescein isothiocyanate, Texas red, rhodamine, dixogenin,
biotin, and the like), radiolabels (e.g., 3H, 125I, 35S, 14C, 32P,
33P, etc.), enzymes (e.g., horse-radish peroxidase, alkaline
phosphatase etc.) spectral calorimetric labels such as colloidal
gold or colored glass or plastic (e.g. polystyrene, polypropylene,
latex, etc.) beads; magnetic, electrical, thermal labels; and mass
tags. Labels can also include enzymes (horseradish peroxidase,
etc.) and magnetic particles. Preferred labels include chromophores
or phosphors but are preferably fluorescent dyes. Suitable dyes for
use in the invention include, but are not limited to, Fluorescent
moieties, which are incorporated into the labels of the invention,
are generally are known, including Texas red, dixogenin, biotin, 1-
and 2-aminonaphthalene, p,p'-diaminostilbenes, pyrenes, quaternary
phenanthridine salts, 9-aminoacridines, p,p'-diaminobenzophenone
imines, anthracenes, oxacarbocyanine, merocyanine,
3-aminoequilenin, perylene, bis-benzoxazole, bis-p-oxazolyl
benzene, 1,2-benzophenazin, retinol, bis-3-aminopyridinium salts,
hellebrigenin, tetracycline, sterophenol,
benzimidazolylphenylamine, 2-oxo-3-chromen, indole, xanthen,
7-hydroxycoumarin, phenoxazine, calicylate, strophanthidin,
porphyrins, triarylmethanes and flavin. Individual fluorescent
compounds which have functionalities for linking to an element
desirably detected in an apparatus or assay of the invention, or
which can be modified to incorporate such functionalities include,
e.g., dansyl chloride; fluoresceins such as
3,6-dihydroxy-9-phenylxanthydrol; rhodamineisothiocyanate; N-phenyl
1-amino-8-sulfonatonaphthalene; N-phenyl
2-amino-6-sulfonatonaphthalene;
4-acetamido-4-isothiocyanato-stilbene-2,2'-disulfonic acid;
pyrene-3-sulfonic acid; 2-toluidinonaphthalene-6-sulfonate;
N-phenyl-N-methyl-2-aminoaphthalene-6-sulfonate; ethidium bromide;
stebrine; auromine-0,2-(9'-anthroyl)palmitate; dansyl
phosphatidylethanolamine; N,N'-dioctadecyl oxacarbocyanine:
N,N'-dihexyl oxacarbocyanine; merocyanine, 4-(3'-pyrenyl)stearate;
d-3-aminodesoxy-equilenin; 12-(9'-anthroyl)stearate;
2-methylanthracene; 9-vinylanthracene;
2,2'(vinylene-p-phenylene)bisbenzoxazole;
p-bis(2--methyl-5-phenyl-oxazolyl))benzene;
6-dimethylamino-1,2-benzophenazin; retinol; bis(3'-aminopyridinium)
1,10-decandiyl diiodide; sulfonaphthylhydrazone of hellibrienin;
chlorotetracycline;
N-(7-dimethylamino-4-methyl-2-oxo-3-chromenyl)maleimide;
N-(p-(2benzimidazolyl)-phenyl)maleimide;
N-(4-fluoranthyl)maleimide; bis(homovanillic acid); resazarin;
4-chloro-7-nitro-2,1,3-benzooxadiazole; merocyanine 540; resorufin;
rose bengal; 2,4-diphenyl-3(2H)-furanone, fluorescent lanthanide
complexes, including those of Europium and Terbium, fluorescein,
rhodamine, tetramethylrhodamine, eosin, erythrosin, coumarin,
methyl-coumarins, quantum dots (also referred to as "nanocrystals":
see U.S. Ser. No. 09/315,584, hereby incorporated by reference),
pyrene, Malacite green, stilbene, Lucifer Yellow, Cascade Blue.TM.,
Texas Red, Cy dyes (Cy3, Cy5, etc.), alexa dyes, phycoerythin,
bodipy, and others described in the 6th Edition of the Molecular
Probes Handbook by Richard P. Haugland, hereby expressly
incorporated by reference. Other labels are described in U.S. Ser.
No. 60/242,901, filed Oct. 24, 2000, hereby expressly incorporated
by reference.
[0263] In a preferred embodiment, a secondary detectable label is
used. A secondary label is one that is indirectly detected; for
example, a secondary label can bind or react with a primary label
for detection, can act on an additional product to generate a
primary label (e.g. enzymes), or may allow the separation of the
compound comprising the secondary label from unlabeled materials,
etc. Secondary labels include, but are not limited to, one of a
binding partner pair; chemically modifiable moieties; nuclease
inhibitors, enzymes such as horseradish peroxidase, alkaline
phosphatases, lucifierases, etc.
[0264] In a preferred embodiment, the secondary label is a binding
partner pair. For example, the label may be a hapten or antigen,
which will bind its binding partner. In a preferred embodiment, the
binding partner can be attached to a solid support to allow
separation of extended and non-extended primers. For example,
suitable binding partner pairs include, but are not limited to:
antigens (such as proteins (including peptides)) and antibodies
(including fragments thereof (FAbs, etc.)); proteins and small
molecules, including biotin/streptavidin; enzymes and substrates or
inhibitors; other protein-protein interacting pairs;
receptor-ligands; and carbohydrates and their binding partners.
Nucleic acid--nucleic acid binding proteins pairs are also useful.
In general, the smaller of the pair is attached to the NTP for
incorporation into the primer. Preferred binding partner pairs
include, but are not limited to, biotin (or iminobiotin) and
streptavidin, digeoxinin and Abs, and Prolinx.TM. reagents (see
www.prolinxinc.com/ie4/home.hmtl).
[0265] In a preferred embodiment, the binding partner pair
comprises a primary detection label (for example, attached to the
NTP and therefore to the amplicon) and an antibody that will
specifically bind to the primary detection label. By "specifically
bind" herein is meant that the partners bind with specificity
sufficient to differentiate between the pair and other components
or contaminants of the system. The binding should be sufficient to
remain bound under the conditions of the assay, including wash
steps to remove non-specific binding. In some embodiments, the
dissociation constants of the pair will be less than about
10.sup.-4-10.sup.-6 M.sup.-1, with less than about 10.sup.-5 to
10.sup.-9 M.sup.-1 being preferred and less than about
10.sup.-7-10.sup.-9 M.sup.-1 being particularly preferred.
[0266] In a preferred embodiment, the secondary label is a
chemically modifiable moiety. In this embodiment, labels comprising
reactive functional groups are incorporated into the nucleic acid.
The functional group can then be subsequently labeled with a
primary label. Suitable functional groups include, but are not
limited to, amino groups, carboxy groups, maleimide groups, oxo
groups and thiol groups, with amino groups and thiol groups being
particularly preferred. For example, primary labels containing
amino groups can be attached to secondary labels comprising amino
groups, for example using linkers as are known in the art; for
example, homo-or hetero-bifunctional linkers as are well known (see
1994 Pierce Chemical Company catalog, technical section on
cross-linkers, pages 155-200, incorporated herein by
reference).
[0267] In one embodiment, the label is a mass tag, as is more fully
outlined below.
[0268] Once labeled, if applicable, the amplicons comprising the
barcodes of the invention are detected. All of the methods and
compositions herein are drawn to methods of detecting, quantifying
and/or determining the base at the detection position of a target
nucleic acid, generally by having differential reactions occur
depending on the presence or absence of a mismatch. The reaction
products are generally detected on arrays as is outlined herein,
although a number of different detection methods may be used.
[0269] Accordingly, the present invention provides methods and
compositions useful in the detection of nucleic acids. As will be
appreciated by those in the art, the compositions of the invention
can take on a wide variety of configurations, as is generally
outlined in the Figures. As is more fully outlined below, preferred
systems of the invention work as follows. An amplicon is attached
(via hybridization) to an array site. This attachment is generally
a direct hybridization between a barcode on the amplicon and a
corresponding capture probe, although in some instances, the system
can rely on indirect sandwich" complexes using capture extender
probes as are known in the art. In a preferred embodiment, the
target sequence (e.g. the amplicon) itself comprises the labels.
Alternatively, a label probe is added, that will hybridize to a
label sequence on the amplicon, forming an assay complex. The
capture probes of the array are substantially (and preferably
perfectly) complementary to the barcode sequences.
[0270] The terms length determination, separation-by-length assay,
and separation-by-length assay medium are taken collectively to
mean a process and its related apparatus that achieves separation
of DNA fragments on the basis of length, size, mass, or any other
physical property. This includes generally, liquid chromatography,
electrophoresis and direct mass spectrometry; more particularly,
high performance liquid chromatography (HPLC) and capillary
electrophoresis or gel electrophoresis, and MALDI-TOF MS
respectively.
[0271] Where the tag is a hybridization tag, in order to keep high
specificity, hybridization is normally carried out under the most
stringent conditions, achieved through various combinations of
temperature, salts, detergents, solvents, chaotropic agents, and
denaturants. Such conditions are further described herein in
context of the homology regions and primers.
[0272] Multiple sample nucleic acid hybridization analysis has been
conducted on a variety of filter and solid support formats (see G.
A. Beltz et al., in Methods in Enzymology, Vol. 100, Part B, R. Wu,
L. Grossmam, K. Moldave, Eds., Academic Press, New York, Chapter
19, pp. 266-308, 1985). One format, the so-called "dot blot"
hybridization, involves the non-covalent attachment of target DNAs
to a filter, which are subsequently hybridized with a radioisotope
labeled probe(s). "Dot blot" hybridization gained wide-spread use,
and many versions were developed (see M. L. M. Anderson and B. D.
Young, in Nucleic Acid Hybridization-A Practical Approach, B. D.
Hames and S. J. Higgins, Eds., IRL Press, Washington D.C., Chapter
4, pp. 73-111, 1985). The "dot blot" hybridization has been further
developed for multiple analysis of genomic mutations (D.
Nanibhushan and D. Rabin, in EPA 0228075, Jul. 8, 1987) and for the
detection of overlapping clones and the construction of genomic
maps (G. A. Evans, in U.S. Pat. No. 5,219,726, Jun. 15, 1993).
[0273] Another format, the so-called "sandwich" hybridization,
involves attaching oligonucleotide probes covalently to a solid
support and using them to capture and detect multiple nucleic acid
targets. (M. Ranki et al., Gene, 21, pp. 77-85, 1983; A. M. Palva,
T. M. Ranki, and H. E. Soderlund, in UK Patent Application GB
2156074A, Oct. 2, 1985; T. M. Ranki and H. E. Soderlund in U.S.
Pat. No. 4,563,419, Jan. 7, 1986; A. D. B. Malcolm and J. A.
Langdale, in PCT WO 86/03782, Jul. 3, 1986; Y. Stabinsky, in U.S.
Pat. No. 4,751,177, Jan. 14, 1988; T. H. Adams et al., in PCT WO
90/01564, Feb. 22, 1990; R. B. Wallace et al. 6 Nucleic Acid Res.
11, p. 3543, 1979; and B. J. Connor et al., 80 Proc. Natl. Acad.
Sci. USA pp. 278-282, 1983). Multiplex versions of these formats
are called "reverse dot blots".
[0274] In another approach of matrix hybridization, Beattie et al.,
in The 1992 San Diego Conference: Genetic Recognition, November,
1992, used a microrobotic system to deposit micro-droplets
containing specific DNA sequences into individual microfabricated
sample wells on a glass substrate. The hybridization in each sample
well is detected by interrogating miniature electrode test
fixtures, which surround each individual microwell with an
alternating current (AC) electric field.
[0275] One preferred aspect of the present invention is that it
results in high-throughput screening capabilities. In the assays
described herein, from a few up to millions of different tags
identifying, e.g., SNPs, can be identified simultaneously. For
example, using simple dot-blot hybridization methods, membranes
with thousands of immobilized probes can be generated for screening
against tags. The solid-phase techniques described below can be
adapted to having literally millions of different immobilized
nucleic acids per square inch. Similarly, very large sets of
amplified DNAs, e.g, tags, can be immobilized on membranes for
simultaneous screening against one or more sequence.
[0276] In one embodiment, the identity of the amplification
products are determined by detecting the molecular weights of the
amplification product or a fragment thereof, such as by
chromatography or mass spectroscopy.
[0277] For instance, the gross molecular weight of an amplification
product or a discrete fragment thereof can be detected. As set
forth above, each member of a probe library (i.e., all of the
probes in the reaction) has a unique molecular weight label based
on the particular sequence of the tag. For instance, mass
spectrometry can provide high detection sensitivity and accuracy of
mass measurements that can discern between probes which, while
identical in length, differ in sequence by only base. Thus, complex
libraries can be constructed by calculating the overall molecular
weight of each amplification product to be detected by varying the
G/C/A/T content in the tag sequence. In certain preferred
embodiments, the nucleic acid sequence which is being detected
includes, as its only variable sequence, the tag sequence and not
the template homology regions. Such fragments can be generated, for
example, by including restriction sites that flank the tag
sequence, or choosing the PCR primers such that only the tag
sequence is the only variable region of the covalently closed
circular product which is included in the amplification products.
That being said, in those embodiments where the amplification
product which is being detected also includes the template homology
region(s), the calculation and design of the tag sequences will
need to include the variability in the THRs as well in order to
produce products having a unique molecular weight so as to be
discernable from one another by mass spectroscopy or other
detection means as may be chosen.
[0278] Those skilled in the art will recognize that very simple
algorithms can be used to calculate the molecular weights for each
member of a library by varying the sequence of the tag, taking into
account if necessary the sequences of the template homology
regions. The molecular weight complexity of the tag can be
increased by allowing the probes to vary in length as well
sequence.
[0279] In certain instances, the library can be deconvoluted by
chromatographic techniques prior to detection by mass spectroscopy.
For example, prior to introducing a sample into the spectrometer,
the mixture can first be at least semi-purified. Separation
procedures based on size (e.g. gel-filtration), solubility (e.g.
isoelectric precipitation) or electric charge (e.g.
electrophoresis, isoelectric focusing, ion exchange chromatography)
may be used to separate a mixture of amplimers. A preferred
separation procedure is high performance liquid chromatography
(HPLC).
[0280] In certain embodiments, the amplification product can
include an integrated mass label for multiplex sequencing.
Multiplexing by mass modification in this case is obtained by
mass-modifying the nucleic acid primer, e.g., at the level of the
sugar or base moiety. Such embodiments are most practical when
amplification products are to be mixed for detection after the
amplification step rather than before.
[0281] Suitable mass spectrometry techniques for use in the present
invention include DNA analyses of the present invention include
collision-induced dissociation (CID) fragmentation analysis (e.g.,
CID in conjunction with a MS/MS configuration, see Schram, K.
(1990) "Mass Spectrometry of Nucleic Acid Components," in
Biomedical Applications of Mass Spectrometry 34:203-287; and Crain
P. (1990) Mass Spectrometry Reviews 9:505-554); fast atomic
bombardment (FAB mass spectrometry) and plasma desorption (PD mass
spectrometry), see Koster et al. (1987) Biomedical Environmental
Mass Spectrometry 14:111-116; and electrospray/ionspray (ES) and
matrix-assisted laser desorption/ionization (MALDI) mass
spectrometry (see Fenn et al. (1984) J. Phys. Chem. 88:4451-4459,
Smith et al. (1990) Anal. Chem. 62:882-889, and Ardrey, B. (1992)
Spectroscopy Europe 4:10-18). MALDI mass spectrometry is
particularly well suited to such analyses when a time-of-flight
(TOF) configuration is used as a mass analyzer (MALDI-TOF). See
International Publication No. WO 97/33000, published Sep. 12, 1997,
see also Huth-Fehre et al. (1992) Rapid Communications in Mass
Spectrometry 6:209-213, and Williams et al. (1990) Rapid
Communications in Mass Spectrometry 4:348-351.
[0282] Suitable mass spectrometry techniques for use in the mass
tag analyses of the present invention include collision-induced
dissociation (CID) fragmentation analysis (e.g., CID in conjunction
with a MS/MS configuration, see Schram, K. (1990) "Mass
Spectrometry of Nucleic Acid Components," in Biomedical
Applications of Mass Spectrometry 34:203-287; and Crain P. (1990)
Mass Spectrometry Reviews 9:505-554); fast atomic bombardment (FAB
mass spectrometry) and plasma desorption (PD mass spectrometry),
see Koster et al. (1987 Biomedical Environmental Mass Spectrometry
14:111-116; and electrospray/ionspray (ES) and matrix-assisted
laser desorption/ionization (MALDI) mass spectrometry (see Fenn et
al. (1984) J. Phys. Chem. 88:4451-4459, Smith et al. (1990) Anal.
Chem. 62:882-889, and Ardrey, B. (1992) Spectroscopy Europe
4:10-18). MALDI mass spectrometry is particularly well suited to
such analyses when a time-of-flight (TOF) configuration is used as
a mass analyzer (MALDI-TOF). See International Publication No. WO
97/33000, published Sep. 12, 1997, see also Huth-Fehre et al.
(1992) Rapid Communications in Mass Spectrometry 6:209-213, and
Williams et al. (1990) Rapid Communications in Mass Spectrometry
4:348-351.
[0283] In this regard, a number of mass tags suitable for use with
nucleic acids are known (see U.S. Pat. No. 5,003,059 to Brennan and
U.S. Pat. No. 5,547,835 to Koster), including mass tags which are
cleavable from the nucleic acid (see International Publication No.
WO 97/27331).
[0284] In still another embodiment, the various tag sequences can
be concatenated and sequenced by traditional sequencing techniques,
e.g., Sanger or Maxim-Gilbert techniques. To further illustrate,
the amplification products can be generated to include restriction
sites that flank the tag sequence. Thus, the amplification product
can be represented by the formula linker-TAG-linker. After
treatment of the amplification products with the restriction
enzymes, linker-TAG-linker fragments are ligated to form
concatenated nucleic molecules. For example, 5' and 3' linkers can
carry a BamH1 and BglII site, respectively, so as to produce
compatible sticky ends. In the illustrated example, by carrying out
the ligation in the presence of BamH1 and BglII, the resulting
concatemer will result in the restriction fragments being linked in
a head-to-tail format by virtue of the redigestion of BamHI/BamHI
and BglII/BglII ligation products but not of the BamHI/BglII
ligation products (which do not produce a sequence recognized by
either restriction enzyme).
[0285] The concatamer arrays can be isolated, preferably as 2-3 kb
fragments, and ligated into an amplification vector. The amplified
arrays can then be readily sequenced, with the junction site of
restriction enzymes marking the boundaries of one tag sequence from
the next.
[0286] In another embodiment, the hybridization tags are detected
on a micro-formatted multiplex or matrix devices (e.g., DNA chips)
(see M. Barinaga, 253 Science, pp. 1489, 1991; W. Bains, 10
BiofTechnology, pp. 757-758, 1992). These methods usually attach
specific DNA sequences to very small specific areas of a solid
support, such as micro-wells of a DNA chip. In one variant, the
invention is adapted to solid phase arrays for the rapid and
specific detection of multiple polymorphic nucleotides, e.g., SNPs.
Typically, an olignoucletodie is linked to a solid support and a
tag nucleic acid is hybridized to the oligonucleotide. Either the
oligonucleotide, or the tag, or both, can be labeled, typically
with a fluorophore. Where the tag is labeled, hybridization is
detected by detecting bound fluorescence. Where the oligonucleotide
is labeled, hybridization is typically detected by quenching of the
label. Where both the oligonucleotide and the tag are labeled,
detection of hybridization is typically performed by monitoring a
color shift resulting from proximity of the two bound labels. A
variety of labeling strategies, labels, and the like, particularly
for fluorescent based applications are described, supra.
[0287] In one embodiment, an array of oligonucleotides are
synthesized on a solid support. Exemplar solid supports include
glass, plastics, polymers, metals, metalloids, ceramics, organics,
etc. Using chip masking technologies and photoprotective chemistry
it is possible to generate ordered arrays of nucleic acid probes.
These arrays, which are known, e.g., as "DNA chips," or as very
large scale immobilized polymer arrays ("VLSIPS.TM." arrays) can
include millions of defined probe regions on a substrate having an
area of about 1 cm2 to several cm2, thereby incorporating sets of
from a few to millions of probes.
[0288] The construction and use of solid phase nucleic acid arrays
to detect target nucleic acids is well described in the literature.
See, Fodor et al. (1991) Science, 251: 767-777; Sheldon et al.
(1993) Clinical Chemistry 39(4): 718-719; Kozal et al. (1996)
Nature Medicine 2(7): 753-759 and Hubbell U.S. Pat. No. 5,571,639.
See also, Pinkel et al. PCT/US95116155 (WO 96/17958). In brief, a
combinatorial strategy allows for the synthesis of arrays
containing a large number of probes using a minimal number of
synthetic steps. For instance, it is possible to synthesize and
attach all possible DNA 8 mer oligonucleotides (48, or 65,536
possible combinations) using only 32 chemical synthetic steps. In
general, VLSIPS.TM. procedures provide a method of producing 4n
different oligonucleotide probes on an array using only 4n
synthetic steps.
[0289] Light-directed combinatorial synthesis of oligonucleotide
arrays on a glass surface is performed with automated
phosphoramidite chemistry and chip masking techniques similar to
photoresist technologies in the computer chip industry. Typically,
a glass surface is derivatized with a silane reagent containing a
functional group, e.g., a hydroxyl or amine group blocked by a
photolabile protecting group. Photolysis through a photolithogaphic
mask is used selectively to expose functional groups which are then
ready to react with incoming 5'-photoprotected nucleoside
phosphoramidites. The phosphoramidites react only with those sites
which are illuminated (and thus exposed by removal of the
photolabile blocking group). Thus, the phosphoramidites only add to
those areas selectively exposed from the preceding step. These
steps are repeated until the desired array of sequences have been
synthesized on the solid surface.
[0290] A 96 well automated multiplex oligonucleotide synthesizer
(A.M.O.S.) has also been developed and is capable of making
thousands of oligonucleotides (Lashkari et al. (1995) PNAS 93:
7912). Existing light-directed synthesis technology can generate
high-density arrays containing over 65,000 oligonucleotides
(Lipshutz et al. (1995) BioTech. 19: 442.
[0291] Combinatorial synthesis of different oligonucleotide
analogues at different locations on the array is determined by the
pattern of illumination during synthesis and the order of addition
of coupling reagents. Monitoring of hybridization of target nucleic
acids to the array is typically performed with fluorescence
microscopes or laser scanning microscopes. In addition to being
able to design, build and use probe arrays using available
techniques, one of skill is also able to order custom-made arrays
and array-reading devices from manufacturers specializing in array
manufacture. For example, Affymetrix Corp., in Santa Clara, Calif.
manufactures DNA VLSIP.TM. arrays.
[0292] It will be appreciated that oligonucleotide design is
influenced by the intended application. For example, where several
oligonucleotide-tag interactions are to be detected in a single
assay, e.g., on a single DNA chip, it is desirable to have similar
melting temperatures for all of the probes. Accordingly, the length
of the probes are adjusted so that the melting temperatures for all
of the probes on the array are closely similar (it will be
appreciated that different lengths for different probes may be
needed to achieve a particular T[m]where different probes have
different GC contents). Although melting temperature is a primary
consideration in probe design, other factors are optionally used to
further adjust probe construction, such as selecting against primer
self-complementarity and the like. The "active" nature of the
devices provide independent electronic control over all aspects of
the hybridization reaction (or any other affinity reaction)
occurring at each specific microlocation. These devices provide a
new mechanism for affecting hybridization reactions which is called
electronic stringency control (ESC). For DNA hybridization
reactions which require different stringency conditions, ESC
overcomes the inherent limitation of conventional array
technologies. The active devices of this invention can
electronically produce "different stringency conditions" at each
microlocation. Thus, all hybridizations can be carried out
optimally in the same bulk solution. These arrays are described in
U.S. Pat. No. 6,051,380 by Sosnowski et al.
[0293] Accordingly, the present invention provides array
compositions comprising at least a first substrate with a surface
comprising individual sites. By "array" or "biochip" herein is
meant a plurality of nucleic acids in an array format; the size of
the array will depend on the composition and end use of the array.
Nucleic acids arrays are known in the art, and can be classified in
a number of ways; both ordered arrays (e.g. the ability to resolve
chemistries at discrete sites), and random arrays (e.g. bead
arrays) are included. Ordered arrays include, but are not limited
to, those made using photolithography techniques (Affymetrix
GeneChip.TM.), spotting techniques (Synteni and others), printing
techniques (Hewlett Packard and Rosetta), electrode arrays, three
dimensional "gel pad" arrays, etc. Liquid arrays may also be
used.
[0294] As those in the art will appreciate, the size of the array
will vary. Arrays containing from about 2 different capture probes
to many millions can be made, with very large arrays being
possible. Preferred arrays generally range from about 100 different
capture probes to about 100,000, with array densities varying
accordingly.
[0295] In general, the arrays comprise a substrate with associated
capture probes. By "substrate" or "solid support" or other
grammatical equivalents herein is meant any material that can be
modified to contain discrete individual sites appropriate for the
attachment or association of capture probes and is amenable to at
least one detection method. As will be appreciated by those in the
art, the number of possible substrates is very large. Possible
substrates include, but are not limited to, glass and modified or
functionalized glass, plastics (including acrylics, polystyrene and
copolymers of styrene and other materials, polypropylene,
polyethylene, polybutylene, polyurethanes, Teflon, etc.),
polysaccharides, nylon or nitrocellulose, resins, silica or
silica-based materials including silicon and modified silicon,
carbon, metals, inorganic glasses, plastics, optical fiber bundles,
and a variety of other polymers. In general, the substrates allow
optical detection and do not themselves appreciably fluoresce.
[0296] Methods of adding, washing and detecting the amplicons on
the array are well known.
[0297] Thus, the compositions of the present invention may be used
in a variety of research, clinical, quality control, or field
testing settings.
[0298] In a preferred embodiment, the present invention finds use
in the quantification of PCR reactions. Thus, the invention
provides a method for quantifying the number of one or more
specific sequences in a sample of nucleic acids. The method may be
similar to any of the methods described above, so long as the
product being detected is present in proportions that are directly
correlated with the the amount of original template sequence. This
is the case, e.g., where the method involves a hybridization step
to the template DNA, circularization of the probe, extension of the
primers and detection of the extension product. In a preferred
embodiment, the method further comprises an amplification step,
wherein the amplification reaction is a controlled amplification.
This is the case, e.g., when using PCR amplification and stopping
the PCR reaction during the exponential phase. The amount of
amplified product in this situation will be directly proportional
to the amount of original sequence in the nucleic acid sample.
Thus, in a preferred embodiment, several amplification reactions
are conducted in parallel, using a different number of
amplification cycles in each of them. This will assure that at
least one of the reactions will have been stopped in the
exponential phase.
[0299] In methods for quantifying the number of a specific sequence
in a sample, it may also be desirable in certain situations to
include a marker nucleic acid. The marker nucleic acid can be added
to the reaction during the hybridization stage or at any stage
thereafter and be subject or not to the same reactions.
Alternatively, the marker DNA is used merely to determine the
amount of amplied product at the end of the amplification step.
[0300] The methods for genotyping and those for quantifying can be
used simultaneously, so long as the processes are controlled, such
that the amount of amplified product is directly correlated to the
amount of the original sequence in the sample nucleic acid.
[0301] Nucleic acid variations (i.e., genetic variations) to be
detected according to the method of the invention include
variations in one or more consecutive or non-consecutive
nucleotides in a nucleic acid sample. These variations may be
present on a single nucleic acid molecule, e.g., a chromosome, or
on several nucleic acid molecules. The invention is particularly
applicable for determining the identity of alleles of variable
genomic regions (also referred to herein as "allelic variants of a
polymorphic region"), e.g., polymorphic regions, is situations in
which it has previously been established that different individuals
may have one of several possible alleles (as opposed to discovering
a new variable region). Generally, the methods of the invention can
detect nucleotide insertions, deletions, substitutions, chromosomal
translocations and other genetic lesions or variations.
[0302] Exemplary variable regions include SNPS. Certain SNPs have
two alleles, others have three alleles and yet others have four
alleles. The presence of SNPs may be indicative of, for example, a
certain population, a disease state, or a propensity for a disease
state.
[0303] Other variable regions include more than one nucleotides,
and may be polymorphic regions, simple sequence repeats (SSRs),
short tandem repeats (STRs), and microsatellite repeats (MRs).
[0304] In another embodiment, the methods of the invention permit
the detection and identification of microorganisms, e.g., pathogens
infecting mammals. Thus, the invention can be used, e.g., to
identify the particular strain of a virus that is infecting a human
subject, e.g., the particular strain of human immunodeficiency
virus, or papilloma virus (HPV), among others. Strains of
microorganisms often differ from each other in a few nucleotides,
whereas the remaining of their genomes is identical. Thus, probes
can be made to recognize the conserved regions and to identify the
particular variable nucleotide(s).
[0305] For example, a wide variety of infectious diseases can be
detected by the process of the present invention. Typically, these
are caused by bacterial, viral, parasite, and fungal infectious
agents. The resistance of various infectious agents to drugs can
also be determined using the present invention.
[0306] Bacterial infectious agents which can be detected by the
present invention include Escherichia coli, Salmonella, Shigella,
Klebsiella, Pseudomonas, Listeria monocytogenes, Mycobacterium
tuberculosis, Mycobacterium aviumintracellulare, Yersinia,
Francisella, Pasteurella, Brucella, Clostridia, Bordetella
pertussis, Bacteroides, Staphylococcus aureus, Streptococcus
pneumonia, B-Hemolytic strep., Corynebacteria, Legionella,
Mycoplasma, Ureaplasma, Chlamydia, Neisseria gonorrhea, Neisseria
meningitides, Hemophilus influenza, Enterococcus faecalis, Proteus
vulgaris, Proteus mirabilis, Helicobacter pylori, Treponema
palladium, Borrelia burgdorferi, Borrelia recurrentis, Rickettsial
pathogens, Nocardia, and Acitnomycetes.
[0307] Fungal infectious agents which can be detected by the
present invention include Cryptococcus neoformans, Blastomyces
dermatitidis, Histoplasma capsulatum, Coccidioides immitis,
Paracoccidioides brasiliensis, Candida albicans, Aspergillus
fumigautus, Phycomycetes (Rhizopus), Sporothrix schenckii,
Chromomycosis, and Maduromycosis.
[0308] Viral infectious agents which can be detected by the present
invention include human immunodeficiency virus, human T-cell
lymphocytotrophic virus, hepatitis viruses (e.g., Hepatitis B Virus
and Hepatitis C Virus), Epstein-Barr Virus, cytomegalovirus, human
papillomaviruses, orthomyxo viruses, paramyxo viruses,
adenoviruses, corona viruses, rhabdo viruses, polio viruses, toga
viruses, bunya viruses, arena viruses, rubella viruses, and reo
viruses.
[0309] Parasitic agents which can be detected by the present
invention include Plasmodium falciparum, Plasmodium malaria,
Plasmodium vivax, Plasmodium ovale, Onchoverva volvulus,
Leishmania, Trypanosoma spp., Schistosoma spp., Entamoeba
histolytica, Cryptosporidum, Giardia spp., Trichimonas spp.,
Balatidium coli, Wuchereria bancrofti, Toxoplasma spp., Enterobius
vermicularis, Ascaris lumbricoides, Trichuris trichiura,
Dracunculus medinesis, trematodes, Diphyllobothrium latum, Taenia
spp., Pneumocystis carinii, and Necator americanis.
[0310] The present invention is also useful for detection of drug
resistance by infectious agents. For example, vancomycin-resistant
Enterococcus faecium, methicillin-resistant Staphylococcus aureus,
penicillin-resistant Streptococcus pneumoniae, multi-drug resistant
Mycobacterium tuberculosis, and AZT-resistant human
immunodeficiency virus can all be identified with the present
invention.
[0311] Genetic diseases can also be detected by the process of the
present invention. This can be carried out by prenatal or
post-natal screening for chromosomal and genetic aberrations or for
genetic diseases. Examples of detectable genetic diseases include:
21 hydroxylase deficiency, cystic fibrosis, Fragile X Syndrome,
Turner Syndrome, Duchenne Muscular Dystrophy, Down Syndrome or
other trisomies, heart disease, single gene diseases, HLA typing,
phenylketonuria, sickle cell anemia, Tay-Sachs Disease,
thalassemia, Klinefelter Syndrome, Huntington Disease, autoimmune
diseases, lipidosis, obesity defects, hemophilia, inborn errors of
metabolism, and diabetes.
[0312] Cancers which can be detected by the process of the present
invention generally involve oncogenes, tumor suppressor genes, or
genes involved in DNA amplification, replication, recombination, or
repair. Examples of these include: BRCA1 gene, p53 gene, APC gene,
Her2/Neu amplification, Bcr/Ab1, K-ras gene, and human
papillomavirus Types 16 and 18. Various aspects of the present
invention can be used to identify amplifications, large deletions
as well as point mutations and small deletions/insertions of the
above genes in the following common human cancers: leukemia, colon
cancer, breast cancer, lung cancer, prostate cancer, brain tumors,
central nervous system tumors, bladder tumors, melanomas, liver
cancer, osteosarcoma and other bone cancers, testicular and ovarian
carcinomas, head and neck tumors, and cervical neoplasms.
[0313] In the area of environmental monitoring, the present
invention can be used for detection, identification, and monitoring
of pathogenic and indigenous microorganisms in natural and
engineered ecosystems and microcosms such as in municipal waste
water purification systems and water reservoirs or in polluted
areas undergoing bioremediation. It is also possible to detect
plasmids containing genes that can metabolize xenobiotics, to
monitor specific target microorganisms in population dynamic
studies, or either to detect, identify, or monitor genetically
modified microorganisms in the environment and in industrial
plants.
[0314] The present invention can also be used in a variety of
forensic areas, including for human identification for military
personnel and criminal investigation, paternity testing and family
relation analysis, HLA compatibility typing, and screening blood,
sperm, or transplantation organs for contamination.
[0315] In the food and feed industry, the present invention has a
wide variety of applications. For example, it can be used for
identification and characterization of production organisms such as
yeast for production of beer, wine, cheese, yogurt, bread, etc.
Another area of use is with regard to quality control and
certification of products and processes (e.g., livestock,
pasteurization, and meat processing) for contaminants. Other uses
include the characterization of plants, bulbs, and seeds for
breeding purposes, identification of the presence of plant-specific
pathogens, and detection and identification of veterinary
infections and in animal breeding programs.
[0316] The following examples serve to more fully describe the
manner of using the above-described invention, as well as to set
forth the best modes contemplated for carrying out various aspects
of the invention. It is understood that these examples in no way
serve to limit the true scope of this invention, but rather are
presented for illustrative purposes. All references cited herein
are incorporated by reference.
EXAMPLES
Example 1
Distinction of Two Templates Differing by a Single Nucleotide
[0317] This example demonstrates that it is possible to distinguish
two nucleic acids which differ by a single nucleotide by a method
in which an oligonucleotide probe is hybridized to the nucleic acid
prior to PCR amplification.
[0318] Eight reactions were conducted in parallel in which one of
two template DNAs, differing from each other by a single nucleotide
(referred to herein as "SNP"), were incubated with or without one
of two oligonucleotide probes. The different combinations are set
forth in Table 1. The template DNA S7 is 600 bp long double
stranded DNA amplified from S. cerevisiae strain S288C, which
includes the nucleotide sequence 5'
ATCTCGGGATATCAGACTTAGCGGCACCGTCCTCACCG 3'(SEQ ID NO: 10): 1 and
template DNA Y7 is 600 bp long double stranded DNA from S.
cerevisiae strain YJM789, which includes the nucleotide sequence 5'
ATCTCGGGATATCAGACTTAGCGGTACCGTCCTCACCG 3'(SEQ ID NO: 11). The two
template DNAs are identical except in the underlined nucleotide.
The oligonucleotide probe "S" (also referred to as Y2:L:S288C) has
the nucleotide sequence
5'CCGCTAAGTCTGATATCCCGAGAT/GTCCACGAGGTCTCTAGTC/GACCTGCAGCGTACG/CGG
ACCTCMGTGMGTACA/CGGTGAGGACGGT/G 3' (SEQ ID NO: 12); and the
oligonucleotide probe "Y" (also referred to as Y2:L:yjm789) has the
nucleotide sequence
5'CCGCTMGTCTGATATCCCGAGAT/GTCCACGAGGTCTCTAGTC/GACCTGCAGCGTACG/CGG
ACCTCMGTGAAGTACA/CGGTGAGGACGGT/A 3' (SEQ ID NO: 13). The "/" in the
probe sequences indicate the different parts of the probe: homology
1/primer 1/primer 2/barcode/homology 2/SNP. The oligonucleotide
probe Y is identical to probe S, except that the 3' most base is
complementary to the SNP nucleotide in template DNA Y7.
TABLE-US-00001 TABLE 1 Contents of the different reactions Reaction
1 2 3 4 5 6 7 8 Probe S Y none S Y none S Y Template S 7 S 7 S 7 Y
7 Y 7 Y 7 none none
[0319] A ligase mix was prepared by combining (per reaction): 8 ul
of 5.times.Tth ligase buffer (from Marsh Biomedical, Rochester,
N.Y.); 0.32 ul of Tth ligase (from Marsh Biomedical, Rochester,
N.Y.) and 29.7 ul of water. To the 38 ul of ligase mix, 1 ul of
template DNA at 10 pmol/ul was added. The reaction was incubated
for 60 minutes at 55.degree. C. to hybridize the template DNA and
the probe and to ligate the 3' and 5' ends of the oligonucleotide
probe. To 12.5 ul of this reaction was then added 37.5 ul of PCR
mix, prepared by mixing (per reaction) 5 ul of 10.times. Taq Gold
buffer (from PE Biosystems, Foster City, Calif.); 6 ul dNTPs at
1.25 mM; 0.2 ul of AmpliTaq Gold DNA Polymerase at 5 u/ul (from PE
Biosystems, Foster City, Calif.) 1 ul of primer p1BAR at 10
pmol/ul; 1 ul of primer P2 at 10 pmol/ul; and 24.3 ul of water. The
primer p1 Bar has the nucleotide sequence 5' GACTAGAGACCTCGTGGAC 3'
(SEQ ID NO: 1) and the primer P2 has the nucleotide sequence 5'
GACCTGCAGCGTACG 3' (SEQ ID NO: 2). The reactions were then
incubated for 10 minutes at 95.degree. C. to denature the template
DNA, followed by 14 cycles of 95.degree. C. for 20 seconds;
57.degree. C. (decreasing by 0.5 degrees each cycle) for 1 minute;
followed by 16 cycles of 95.degree. C. for 20 seconds; 50.degree.
C. for 45 seconds; followed by incubation at 4.degree. C.
[0320] 20 ul of each of the amplification products were then
subjected to electrophoresis on a 2% weight/volume agarose gel, and
the amplification products were visualized by ethidium bromide
staining and U.V. light. The results indicate the presence of a
band of about 100 nucleotides in the lanes containing the reaction
products in which the probe contains the complementary SNP
nucleotide to that present in the template DNA, but not in the
other lanes. Thus, probe S identifies the SNP on the template DNA
S7 and probe Y identifies the SNP on the template DNA Y7. No
product is amplified from a reaction mixture containing template
DNA S7 and probe Y or template DNA Y7 and probe S.
[0321] Thus, this example demonstrates the identification of a SNP
using a method involving hybridization, ligation and then PCR
amplification.
Example 2
Identification of a SNP by "Gap Filling"
[0322] This example describes a method for determining the identity
of a nucleotide, e.g., a SNP, comprising adding an oligonucleotide
probe in four reactions containing a polymerase, a ligase, and one
of the four nucleotides.
[0323] Four different SNPs were tested in singleplex reactions.
Sixteen reactions were conducted in parallel, in which each of four
DNA templates were incubated with one of four probes. In this
example, the template DNAs were from 36 to 42 base oligonuclotides
from S. cerevisiae. The different combinations are set forth in
Table 2. The nucleotide sequences of the templates and probes are
as follows (the structure of the probes is indicated as: homology
1/primer 1/primer 2/barcode/(+/-DraI)/homology 2): TABLE-US-00002
Template DNA Y1:TOS:T: (SEQ ID NO: 14) 5'
ACATTTAGATCTGCAGTTTCTAATATGAATTCAGTGGAAAAT 3'; Template DNA Y2:TO
S:C: (SEQ ID NO: 15) 5' TCGGGATATCAGACTTAGCGGCACCGTCCTCACCGT 3';
Template DNA Y3:TO S:A: (SEQ ID NO: 16) 5'
GATCAAATGCGACCATATTCATCAAACTTATAGGCG 3'; Template DNA Y5:TO S:G:
(SEQ ID NO: 17) 5' CCAGTCCCTTGAGTTCGCGAATAGTAATTTTGGTGATACCTG 3';
Probe Y1:PL:119:31 (also referred to as SNP1): (SEQ ID NO: 18)
5'GAAACTGCAGATCTAAATGTACC/UGTCCACGAGGTCTCTAGTC/
TGTAAAACGACGGCCAGTU/GCTGGAGTTCGCACGCTATA/ ATTTTCCACTGAATTCATATT 3';
Probe Y2:PL:C:119:55 (also referred to as SNP2): (SEQ ID NO: 19)
5'CCGCTAAGTCTGATATCCCGAGAT/UGTCCACGAGGTCTCTAGTC/
TGTAAAACGACGGCCAGTU/CAAAGGTGGAGCTGCACACT/TTTAAA/ ACGGTGAGGACGGT 3';
Probe Y3:PL:C:119:131 (also referred to as SNP3): (SEQ ID NO: 20)
5'ATGGTCGCATTTGATCGAG/UGTCCACGAGGTCTCTAGTC/
TGTAAAACGACGGCCAGTU/GCCTGGGTTACGTGTCTACT/
TTTAAA/CGCCTATAAGTTTGATGAA 3'; and Probe Y5:PL:119:167 (also
referred to as SNP5): (SEQ ID NO: 21)
5'GCGAACTCAAGGGACTGGTAC/UGTCCACGAGGTCTCTAGTC/
TGTAAAACGACGGCCAGTU/GCAATATGTAACTCTCTGGG/ CAGGTATCACCAAAATTACTATT
3'.
[0324] TABLE-US-00003 TABLE 2 Contents of the different reactions
Probe Y1:PL Y1:PL Y1:PL Y1:PL Y2:PL:C Y2:PL:C Y2:PL:C Y2:PL:C
119:31 119:31 119:31 119:31 119:55 119:55 119:55 119:55 Template
Y1:TO Y1:TO Y1:TO Y1:TO Y2:TO Y2:TO Y2:TO Y2:TO S:T S:T S:T S:T S:C
S:C S:C S:C dNTP dATP dCTP dGTP dTTP dATP dCTP dGTP dTTP Reaction 9
10 11 12 13 14 15 16 Probe Y3:PL Y3:PL Y3:PL Y3:PL Y5:PL: Y5:PL:
Y5:PL: Y5:PL: 119:131 119:131 119:131 119:131 119:167 119:167
119:167 119:167 Template Y3:TO Y3:TO Y3:TO Y3:TO Y5:TO Y5:TO Y5:TO
Y5:TO S:A S:A S:A S:A S:G S:G S:G S:G dNTP dATP dCTP dGTP dTTP dATP
dCTP dGTP dTTP
[0325] A DNA mix was prepared by mixing (per reaction) 2 ul of pfu
ligase buffer (from Stratagene, San Diego, Calif.); 0.1 mul of
template oliogonucleotide at 400 fmoles/ul; 0.4 ul of probe oligo
(also referred to as "barcode oligo") at 10 pmoles/ul; and 17.5 ul
of water. The DNA was denatured by incubating these reactions at
95.degree. C. for 5 minutes. The nucleic acids were then annealed
by incubating the reactions at 65.degree. C. for one hour. The
final template amount was 40 femtomoles/reaction, and that of the
probe oligonucleotide was 4 picomoles/reaction. To each reaction,
20 ul of prewarmed (1 minute at 65.degree. C.)
polymerase/ligase/dNTP mix was added. This mix was prepared by
combining (per reaction) 2 ul of 10.times.pfu ligase buffer (from
Stratagene, San Diego, Calif.); 2 ul of one dNTP at 1 mM; 0.05 ul.
of Taq DNA Polymerase Stoffel fragment (from PE Biosystems, Foster
City, Calif.) at 10 u/ul; 1 ul of pfu Ligase (from, Stratagene, San
Diego, Calif.) at 4 u/ul; and 14.95 ul of water. The 40 ul
reactions were incubated at 65.degree. C. for 10 minutes.
[0326] The template DNA was then subjected to rolling circle
amplification as follows. 4 ul of the above reactions was added to
32 ul of RCA mix prewarmed at 65.degree. C. for 10 minutes. RCA mix
was prepared by combining (per reaction) 4 ul of 10.times. Vent
buffer (from New England Biolabs, Beverly, Mass.); 2 ul of DMSO;
6.4 ul of Vent DNA pol. Exo- at 2 u/ul (NEB); 0.36 ul of RCA primer
at 100 pmole/ul; 0.93 ul of T4 gene 32 Protein at 1.7 mg/ml (USB);
0.4 ml of MgSO4 at 100 mM; and 17.91 ul of water. The nucleotide
sequence of the RCA primer contains at its 5' end the complement of
a portion of the sequence of primer 2, followed by the sequence of
primer 1 and has the nucleotide sequence 5'
GTCGTTTTACAGACTAGAGACCTCGTGGAC 3' (SEQ ID NO: 22). The reactions
were then incubated at 92.degree. C. for 3 minutes (heat
denaturation), following which, 4 ul of prewarmed dNTP mix
containing 4 mM of all four nucleotides was added, and the
reactions were further incubated at 65.5.degree. C. for 4.5 hours.
This amplification results in the synthesis of a long strand having
at its 5' end the RCA primer, followed by the rest of primer
2-primer 1-HR1-HR2-tag-primer 2-[primer 1-HR1-HR2-tag-primer
2-]n.
[0327] For the PCR amplification step, two reactions were done for
each of the template/probe combinations by combining 1 ul of each
of the above reactions with 19 ul of PCR mix containing (per
reaction) 2 ul of 10.times. Taq Gold buffer (from PE Biosystems,
Foster City, CA); 0.75 ul of dNTPs at 4.0 mM; 0.15 ul of AmpliTaq
gold DNA Polymerase at 5 u/ul (PE); 0.16 ul of P1 bar primer (SEQ
ID NO: 1) at 100 pmol/ul; 0.16 ul of M13 primer (i.e., primer 2) at
100 pmol/ul; 2 ul of MgCl2 at 25 mM; and 13.78 ul of water. The
nucleotide sequence of the Ml 3 primer is 5' TGTAAAACGACGGCCAGT
3'(SEQ ID NO: 3). The PCR reactions were denatured for 5 minutes at
95.degree. C. and then subjected to either 15 or 25 cycles of
[0328] 20 seconds at 95.degree. C. and 1 minute at 50.degree. C. 20
ul of each of the reactions were then subjected to gel
electrophoresis in 2% agarose, and the products visualized as
described in Example 1. The results indicate that in one of each of
the four reactions containing a different dNTP each, amplification
product is obtained with the dNTP that is complementary to the SNP
in the DNA. For example, more amplification product was detected in
the reaction in which dATP was added to the probe containing a
thymidine as SNP nucleotide, compared to the reactions in which
dCTP, dGTP or dTTP was added.
[0329] Thus, this example demonstrates a method for identifying a
nucleotide in a nucleic acid, comprising hybridization of a probe
to the nucleic acid, gap filling by the addition of a specific dNTP
through polymerization and ligation, extension of a primer,
ligation, PCR amplification; and detection of amplified
product(s).
Example 3
Background Suppression by Capture of the Run-Off Products Using
Biotin-Streptavidin
[0330] This experiment is a demonstration of a biotin capture
cleanup method used to suppress background that arises from
elongation events that are primed by unligated oligo probe during
PCR amplification. A biotinylated primer is used to make a first
copy of the ligated probe. This copy is captured with streptavidin
coated magnetic beads while all other molecules are washed away.
The captured copy is then amplified in a PCR reaction.
[0331] The template DNAs and probes were identical to those used in
Example 1: The two template DNAs used were the 600 bp amplicons
designated S7 and Y7, comprising SEQ ID NO: 10 and 11,
respectively, which differ from each other in a single nucleotide;
and the two probes S and Y, having SEQ ID NO: 12 and 13,
respectively.
[0332] The different combinations of template and probes are set
forth in Table 3. TABLE-US-00004 TABLE 3 Components of the reaction
mixtures Reaction 1 2 3 4 5 6 7 8 Probe S S S S Y Y Y allele Y
allele allele allele allele allele allele allele Template Y 7 S 7 S
7 none Y 7 Y 7 S 7 none other No No ligase ligase
[0333] Two barcode oligo mixes were prepared (one for each barcode
oligo) by mixing 20 ul of 5.times. Tth ligase buffer, 15 ul of
barcode oligonucleotide S or Y at 10 pmoles/ul; and 62.5 ul of
water, and 19.5 ul of this mix was added to 8 strip tubes. To each
strip tube, 0.5 ul of respective PCR template S7 or Y7 at 0.04
ug/ul was added. The final barcode and template amount was 30
picomoles and 40 femtomoles per reaction, respectively.
[0334] 21.5 ul of ligase mix that was prepared by mixing 36 ul of
5.times. Tth ligase buffer and 135 ul of water, was added to strip
tubes 3 and 6 (reactions without ligase). 3.5 ul of Tth ligase (50
u/ul Marsch Bio.) was added to the remaining ligase mix and 21 ul
of this mix were added to the remaining tubes. The tubes were
heated for 1 minute at 65.degree. C., and 20 ul of each tube was
added to each of the strip tubes containing the DNAs. The volume of
each reaction was 40 ul.
[0335] Biotinylated P1 Bar primer is identical to P1 bar primer
(SEQ ID NO:1) except that it was synthesized with a 5' biotin.
[0336] For rolling amplification, an extension mix (RCA mix) was
prepared by combining (for 20 reactions) 40 ul of 10.times. vent
buffer; 20 ul DMSO; 64 ul of Vent DNA Polymerase exo- at 2 u/ul
(NEB); 3.6 ul of P1 bar biotin primer (SEQ ID NO: 1) at 100
pmol/ul; 9.3 ul of T4 gene 32 protein 1.7 m/ml; 4 ul of MgSO4 at
100 mM; 40 ul of each of the four dNTPs at 4 mM; and 179.2 ul of
water to obtain a final volume of 360 ul. 18 ul of RCA mix that was
prewarmed for 1 minute at 65.degree. C., was added to 2 ul of the
above reactions, and incubated for 2.5 minutes at 65.degree. C.
This results in having 8 tubes each with Taq and Vent elongated
biotin P1 bar primer.
[0337] The biotinylated run-off product was isolated using stock
Dynabeads (10 ug/ul). These beads can capture up to 20 pmole of
biotinyalated oligo using 10 ul of stock. 20 ul out of the 40 ul
were taken from each reaction tube and captured with Dynal beads as
follows: the stock beads were first washed thrice with 2M NaCl
Buffer (use same volume of buffer as sample); equal volumes of
sample and washed beads were combined to obtain a final 1 M NaCl
mix; this mix was centrifuged at 43.degree. C. for 15 minutes at
1400 rpm; the beads were washed twice with 100 ul of 2M NaCl buffer
and then, once with 100 ul double distilled water (by gentle
tapping instead, not by pipetting); the beads were resuspended in
50 ul of 50 mM NaOH and incubated at room temperature for 5
minutes; the supernatant (which may be neutralized with 5 ul of
0.5M HCl) was removed; and the beads were resuspended in original
sample volume (eg. 20 ul) using 1.times.TE.
[0338] A PCR mix was prepared by mixing 48 ul of 10.times. Taq Gold
buffer; 18 ul of dNTPs at 4.0 mM; 3.84 ul of P1 Bar primer (SEQ ID
NO: 1) at 100 pmol/ul; 3.84 ul of M13 primer (SEQ ID NO: 3) at 100
pmol/ul; 48 ul of MgCl.sub.2 at 25 mM; and 330.7 ul of water to
obtain a total of 456 ul. 1.0 ul of bead slurry reaction was added
to 19 ul PCR mix; denatured for 5 minutes at 95.degree. C.; and
subjected to 30 or 40 cycles of PCR as follows: 20 seconds at
95.degree. C. and 1 minute at 60.degree. C.
[0339] 20 ul of each reaction was then subjected to electrophoresis
in 2% agarose, and the bands were visualized as described in the
previous examples. The results indicate that more amplification
product was obtained in reactions in which the probe perfectly
matches the template DNA and ligase is included, i.e., in reactions
2 and 5. In addition, isolation of the run-off product on beads
allows cleaner amplification.
Example 4
Background Suppression by Digestion of the Probe with
uracil-N-glycosylase Prior to Amplification
[0340] Another method to suppress background that arises as a
result of extension from unligated oligonucleotide probe during PCR
is to digest the unligated probe with uracil --N-glycosylase prior
to PCR amplification. Digestion of the unligated oligonucleotide
probe with uracil-N-glycosylase (also referred to as "UNG") breaks
the probe into three fragments that can no longer prime the
generation of PCR background amplicons.
[0341] This example describes a method using comparing
uracil-N-glycosylase as a and biotin isolation of run-off product
cleanup methods.
[0342] The template DNA and probes were the same as those used in
Example 3 (note that these oligonucleotides were synthesized with U
bases in the indicated locations), and the different combinations
were also the same (Table 3). In this example, pfu ligase was used
instead of Tth ligase.
[0343] Two barcode oligo mixes were prepared (one for each barcode
oligo) by mixing 10 ul of 5.times. Tth ligase buffer, 15 ul of
barcode oligonucleotide S (SEQ ID NO: 12) or Y (SEQ ID NO: 13) at
10 pmoles/ul; and 72.5 ul of water. 19.5 ul of this mix was added
to 8 strip tubes. To each strip tube, 0.5 ul of respective PCR
template S7 or Y7 at 0.40 ug/ul was added. The final barcode and
template amount was 30 picomoles and 40 femtomoles per reaction,
respectively.
[0344] The reaction mixtures (containing the DNAs) were denatured
for 5 minutes at 95.degree. C. and annealed for 15 minutes at
65.degree. C. 23.75 ul of ligase mix prepared by combining 24 ul of
10.times.pfu ligase buffer and 204 ul of water, were added into
strip tubes 3 and 6. 10 ul of pfu ligase at 4 u/ul (Stratagene) was
added to the remaining mix of 204.25 ul. To each tube (except tubes
3 and 6), 20 ul of ligase mix prewarmed for 1 minute at 65.degree.
C. was added, and the reactions were incubated for 10 minutes at
65.degree. C. (ligation reactions). The final reaction volume was
40 ul.
[0345] 2 ul of ligation reactions were added to 18 ul of extension
mix, which was prepared by combining 40 ul of 10.times. Taq Gold
buffer; 15 ul of dNTPs at 4 mM each; 3 ul of AmpliTaq Gold DNA
Polymerase at 5 u/ul (P.E.); 3.2 ul biotin RCAP1 Bar primer (5'
GTCGTTTTACAGACTAGAGACCTCGTGGAC 3' SEQ ID NO: 28) at 100 pmol/ul
(same as in example 3); 40 ul of MgCl.sub.2 at 25 mM; and 258.8 ul
of water to obtain a final volume of 360 ul of PCR reaction mix.
The reactions were then incubated for 10 minutes at 95.degree. C.
to denature the ligated product as well as to activate Taq Gold.
One set of reactions was then incubated for 2 minutes at 65.degree.
C., and another set of reactions was TheOne set of reactions was
then incubated for 15 minutes at 65.degree. C. to run-off and
another set of reactions was not incubated at 65.degree. C. (no
run-off control). This resulted in 2.times.8 tubes with Taq
elongated biotin RCA primer. The RCA biotin primer contains
sequence appended to the 5' end of the P1 primer and was used to
increase the distance between the priming sequences and the bead in
case the bead sterically hindered the PCR reaction.
[0346] Two PCR mixes were prepared as described in Example 3 with
and without the addition of 1 ul per reaction of
uracil-N-glycosylase (PE Biosystems, Foster City, Calif.). 1.0 ul
of extension reaction was added to 19 ul PCR mix; denatured for 5
minutes at 95.degree. C.; and subjected to 25 cycles of PCR as
follows: 20 seconds at 95.degree. C. and 1 minute at 64.degree. C.
Also, as a control, 1 ul of a 1:10 dilution of the ligation
reaction (no extension) was added to 19 ul PCR mix, denatured for 5
minutes at 95.degree. C.; and subjected to 25 cycles of PCR as
follows: 20 seconds at 95.degree. C. and 1 minute at 64.degree.
C.
[0347] 20 ul of each reaction was then subjected to electrophoresis
in 2% agarose, and the bands were visualized as described in the
previous examples. The results indicate that, in the no extension
controls, all background is eliminated by UNG digestion of the
probe (lanes 1,3,4,6,7,8). In addition, this control shows that the
specific signal (lanes 2 and 5) are also eliminated without the
extension step, thus confirming that the original probe is degraded
by UNG and that extension is required for signal. The extendedsion
experiments indicate that UNG eliminates the background (lanes
1,3,4,6,7,8) but not the specific signal (lanes 2 and 5).
Example 5
Background Suppression by use of Apyrase
[0348] Another source of background signal comes from contaminating
nucleotides in various reagents such as ligase and template
preparations. These contaminating nucleotides generate signal in
the polymerase--ligase step even if the added nucleotide is not
complementary to the SNP being tested. To eliminate this source of
background, apyrase, an enzyme that degrades nucleotides, was added
to all reagents at the assembly of the reaction. Contaminating
nucleotides were degraded in a 20.degree. C. incubation, prior to
the DNA denaturing step. Apyrase was heat inactivated during the
denaturing and annealing steps so that the later added specific
nucleotide is not degraded.
[0349] The different reactions performed are summarized in Table 4.
TABLE-US-00005 TABLE 4 components of the different reactions:
Reaction 1 2 3 4 5 6 7 8 probe SNP 2 SNP 2 SNP 2 SNP 2 SNP 2 SNP 2
SNP 2 SNP 2 Template Y 7 Y 7 Y 7 Y 7 S 7 S 7 S 7 S 7 dXTP dATP dCTP
dGTP dTTP dATP dCTP dGTP dTTP Other Apyrase+ Apyrase+ Apyrase+
Apyrase+ Apyrase+ Apyrase+ Apyrase+ Apyrase+ Reaction 9 10 11 12 13
14 15 16 probe SNP 2 SNP 2 SNP 2 SNP 2 SNP 2 SNP 2 SNP 2 SNP 2
Template S 7 S 7 S 7 S 7 S 7 S 7 S 7 dXTP dATP dCTP dGTP dTTP dGTP
dGTP dTTP Other Apyrase- Apyrase- Apyrase- Apyrase- Apyrase+
Apyrase+ Apyrase+ Apyrase+ Template- Pol/lig- Pol/lig- dXTP-
[0350] Three template/barcode mixes were prepared by mixing in each
6 ul of 10.times.pfu ampligase buffer; 1.8 ul of barcode oligo
(having the sequence set forth in SEQ ID NO: 19); 3 ul of PCR
template (either S7 SEQ ID NO 10, Y7 SEQ ID NO 11, or water; these
templates are the same as those used in Example 1); and 49.2 ul of
water to obtain a final volume of 60 ul. 12 ul of each were
distributed into tubes.
[0351] 12 ul of ligase mix was aliquoted into 16 strip tubes. The
mix was prepared for the various reactions as described in Table 5,
and the ligase dilution was prepared by mixing 5 ul of 10.times.
ampligase buffer with 44.33 ul of water and 0.67 ul of Ampligase at
5 u/ul, resulting in a solution containing 0.067 u/ul of Ampligase.
TABLE-US-00006 TABLE 5 Preparation of ligase mixes each (.times.16)
(.times.8) (.times.4) 10x ampligase buffer 1.0 ul 16.0 ul 8.0 ul
4.0 ul Ampligase dilution 0.125 2.0 ul 1.0 ul N/A Taq DNA Pol.
Stoffel frag 0.05 ul 0.8 ul 0.4 ul N/A 10 u/ul Apyrase 50 mU/ul 0.2
ul 3.2 ul N/A 0.8 ul H2O 106 ul 54.6 ul 27.2 ul Total 8.0 ul 128.0
ul 64.0 ul 32.0 ul
[0352] The barcode/tempate mixes were denatured for 5 minutes at
95.degree. C. and annealed for 15 minutes at 65.degree. C. 8 ul
ligase mixes were added to the annealed DNA mixes. These were then
incubated for 2 min at 20.degree. C. degrees. The barcode/tempate
mixes were then denatured for 5 minutes at 95.degree. C. and
annealed for 15 minutes at 65.degree. C. The temperature was raised
to 65.degree. C. and 2 ul dXTP (1 mM) were added to the appropriate
tubes, following which they were incubated for 10 min at 65.degree.
C. Final reaction volume was 20 ul. Final enzyme ligase
concentration was 0.00042 units/ul in the ligation reaction (0.0084
units total), the final barcode concentration was 0.015
picomoles/ul and the final template concentration was approximately
2 femtomoles/ul. [Please confirm or infirm this sequence of
steps]
[0353] 2 ul of each ligation reaction were added to 18 ul of PCR
extension mix, prepared by combining 85 ul of 4.times.E/U buffer
(4.times.Taq Gold buffer; 3.2 picomoles per microliter P1 bar
primer (SEQ ID NO: 1); 10 mM MgCl.sub.2; 0.6 mM dNTPs); 2.55 ul of
AmpliTaq Gold DNA Polymerase (P.E. Biosystems, Foster City, Calif.)
at 5 u/ul and 218.5 ul of water to obtain a final volume of 306 ul.
The reactions were incubated for 10 minutes at 95.degree. C. to
denature the ligated product as well as to activate Taq Gold. The
reactions were then incubated for 2 minutes at 65.degree. C. to
run-off.
[0354] UNG clean up and amplification were conducted as follows. To
each reaction (20 ul), 20 ul of UNG/PCR mix was added. This mix was
prepared by combining 85 ul of 4.times.E/U buffer; 2.55 ul of
AmpliTaq Gold DNA Polymerase (P.E.) at 5 ulul; 17 ul of UNG (1
unit/ul PE Biosystems, Foster City, Calif.); 5.44 .mu.l of M13
primer (SEQ ID NO: 3) at 100 pmol/ul and 230 ul of water to obtain
a final volume of 340 ul. The reactions were incubated for 20
minutes at 37.degree. C. and then heat denatured for 5 minutes at
95.degree. C. PCR was conducted for 33 cycles as follows: 20
seconds at 95.degree. C. and 1 minute at 60.degree. C.
[0355] The amplification products were analyzed in the same way as
in the previous examples. The results indicate that the presence of
apyrase in the reactions strongly reduce background amplification.
This can be seen, e.g., by comparing the first four lanes 3 and 4,
in which the absence of apyrase in a tube containing dCTP
(nucleotide that is not complementary to the SNP in the template
DNA) results in a band, whereas the presence of apyrase in the same
reaction does not produce a band. In comparison, in the first two
lanes, representing reactions done with dATP (the nucleotide that
is complementary to the SNP in the template DNA), the presence or
absence of apyrase does not affect the signal observed, thus
showing that the signal is specific, and not resulting from
background amplification. Thus, the use of apyrase can reduce
background amplification.
Example 6
Detection of Two SNPs in a Single Reaction
[0356] This example describes an example of a reaction in which two
SNPs were detected simultaneously. The background reduction methods
using apyrase; and uracil-N-glycosylase digestion; or and biotin
capture of extension products were included.
[0357] The combinations of template and probe are were as shown in
Table 6. The DNA templates were 600 bp DNA fragments amplified from
S. cerevisiae. The template S7 (SEQ ID NO: 10 is described in
Example 1. Template S37 is a 600 bp long double stranded DNA
amplified from S. cerevisiae strain S288C, which includes the
nucleotide sequence 5' CCAGTCCCTTGAGTTCGCGMTAGTAATTTTGGTGATACCTG
3'(SEQ ID NO: 179). The barcode oliogonucleotides are SNP2 (SEQ ID
NO: 19) and SNP5 (SEQ ID NO: 21). TABLE-US-00007 TABLE 6 Components
of the reactions Reaction 1 2 3 4 5 6 7 8 probe SNP 2 SNP 2 SNP 5
SNP 5 SNP 2 SNP 2 SNP 2 SNP 2 SNP 5 SNP 5 SNP 5 SNP 5 Template S-7
S-7 S-37 S-37 S-7 S-7 S-7 S-7 S-37 S-37 S-37 S-37 dXTP dCTP dGTP
dCTP dGTP dATP dCTP dGTP dTTP
[0358] DNA template/probe reaction mixtures were prepared as set
forth in Table 7. The enzyme mix listed in the table was prepared
by mixing 154.3 ul water; 22 ul of 10.times. ampligase buffer; 2.2
ul of Apyrase at 50 mU/ul; 1.38 ul of Ampligase dilution (5 ul of
10.times. ampligase buffer; 44.33 ul of water and 0.67 ul of
Ampligase at 5 u/ul); and 0.55 ul of Taq DNA Pol. Stoffel fragment
at 10 u/ul. TABLE-US-00008 TABLE 7 Components of DNA/enzyme mix
Enzyme mix 41.0 ul 41.0 ul 82.0 ul Template S-7 1.25 ul (S7) 2.5 ul
(S7) Template S-37 1.25 ul (S37) 2.5 ul (S37) SNP2 1 pmol/ 0.75 ul
(SNP2) 1.5 ul (SNP2) ul SNP5 1 pmol/ 0.75 ul (SNP5) 1.5 ul (SNP5)
ul Total 45.0 ul 45.0 ul 90.0 ul
[0359] 18 ul of the mix were distributed into strip tubes. The
potential contaminating nucleotides dXTPs were degraded by
incubation of the reactions for 4 minutes at 20.degree. C. The
reactions were then heated for 5 minutes at 95.degree. C. and
annealed by incubation for 15 minutes at 65.degree. C. 2 ul of the
respective dXTPs 0.1 mM set forth in Table 6 were added to the
reactions and the reactions were incubated for 10 minutes at
65.degree. C. (ligation reactions). In the ligation reaction (20
ul), the final barcode concentration was 0.015 picomoles/ul and
template was approximately 2 femtomoles/ul. Final ligase
concentration was 0.00042 units/ul in the ligation reaction (0.0084
units total).
[0360] 6 ul of ligation reactions were added to 54 ul of extension
mix prewarmed for 1 minute at 95.degree. C. The extension mix was
prepared by combining 54 ul of 10.times. Taq Gold buffer; 4.05 ul
AmpliTaq Gold DNA Polymerase at 5 u/ul; 64.8 ul of dNTPs at 1.25 mM
each; 54 ul of MgCl.sub.2 at 25 mM; 4.32 ul of P1 BAR (SEQ ID NO 1)
biotin primer at 100 pmol/ul; and 101.61 ul of water.
[0361] The reactions were incubated 10 minutes at 95.degree. C. to
denature the ligated products as well as to activate Taq Gold and
then incubated for 2 minutes at 55.degree. C. to 79.degree. C.
gradient to runoff. The reactions were then cooled to 4.degree.
C.
[0362] Three cleanups were performed: UNG cleanup, a low stringency
biotin cleanup (3 washes), and an increased stringency biotin
cleanup (6 washes). 20 ul of each reaction were subjected to
capture on Dynal beads. The stock beads were washed thrice with 2M
NaCl Buffer using the same volume of buffer as that of the sample.
To 25 ul of beads were added 75 ul 1 M NaCl. 20 ul of sample were
mixed with 80 ul of beads in NaCl to get final 1 M NaCl mix and
incubated at 43.degree. C. for 15 min, pipetting up and down every
5 minutes. The beads were then washed 3 or 6 times in 200 ul of 0.5
M NaCl/0.5 M NaOH buffer, followed by a wash with 200 ul of 0.5 M
NaCl in TE. The beads were resuspended in 200 ul of: 100 mM NaCl,
TE, 0.25% DMSO, 0.01% Triton, and heated for 15-20 min at
70.degree. C. This releases non-specifically bound product to
beads. The beads were then washed again with 200 ul TE. The beads
were resuspended in original sample volume (eg. 20 ul) using
1.times.TE.
[0363] Amplification of the cleaned up extension product was
carried out by mixing 20 ul of the extension product with 20 ul of
UNG/PCR mix prepared by combining 18 ul 10.times. TaqAQ Gold
buffer; 1.35 ul AmpliTaq gold DNA polymerase at 5 u/ul; 21.6 ul of
dNTPs at 1.25 mM each; 18 ul of MgCl.sub.2 at 25 mM; 1.44 ul P1 Bar
primer (SEQ ID NO: 1 !) at 100 pmol/ul; 1.44 ul M13 primer (SEQ ID
NO: 3) at 100 pmol/ul; 9 ul of UNG at 1 unit/ul; and 109.17 ul of
water. The reactions were incubated for 20 minutes at 37.degree.
C., heat denatured for 5 minutes at 95.degree. C. and subjected to
14 PCR cycles including 20 seconds denaturation at 95.degree. C.; 1
minute annealing at 63.degree. C.; and 10 seconds extension at
72.degree. C.; followed by 20 cycles of 20 seconds at 95.degree.
C.; 45 seconds at 56.degree. C. and 10 seconds at 72.degree. C. The
reactions were incubated for another 10 seconds at 72.degree. C.
and then at 4.degree. C.
[0364] The reaction products were analyzed in the same way as in
the previous example. The results show that, as expected, a
stronger amplification signal was obtained in lanes 2, 3, 6 and 7
(which correspond to reactions including dNTPs that are
complementary to the SNP in the template DNA) relative to the other
lanes. Since lanes 6 and 7 comprise the two template DNAs and the
same two probes and that the reactions were identical except for
addition of dCTP in one reaction and dGTP in the other reaction,
these results show that two different SNPs can be identified using
in the same reaction if the two dNTPs are included in the same
reactions.
[0365] The amplified products from reactions 6 and 7 were also
subjected to a Dral restriction digest, which cleaves between the
tag sequence and the homology region THR2s. Because the two
different probes have different length homology regions, it is
evident it possible to identify which the probe is which was
amplified in each reaction on a high resolution gel. Probe 5
consisted of 109 bases, whereas probe 2 consisted of 104 bases.
[0366] Accordingly, 1 ul of DraI enzyme was added to 20 ul of PCR
product of reactions 6 and 7 and incubated at 37.degree. C. for 1
hour. The results show that, as expected, the amplification product
observed in reaction 6 corresponds to probe SNP2, whereas that
observed in reaction 7 corresponds to probe SNP7. These results
provide further support for multiplexing.
Example 7
Use of a Two Part Probes Instead of a One Part Probe
[0367] All probe oligonucleotides described above were synthesized
as a single molecule. This example shows the functional use of a
two part ligated oligonucleotide probe. These probes awere made
constructed by ligating a 40 base oligonucleotide to a 60 base
oligonucleotide using a bridge oligonucleotide that is common to
all probes.
[0368] The template/probe combinations are set forth in Table 8.
The Ttemplate S37 and the probe SNP5 (SEQ ID NO: 21) were was
described in the previous Example. SNP5 was described in Example 2
(SEQ ID NO: 21). SNP5 2 part probe was constructed by ligating part
A, comprising the template homology region 1 and primer 1 homology
region with part Bcomprising primer 2 homology region, barcode
sequence, DraI and template homology region 2. The two parts were
enzymatically ligated with a bridging oligonucleotide having the
sequence 5' ACTGGCCGTCGTTTTACA/GACTAGAGACCTCGTGGAC 3' (SEQ ID NO:
226; the "/" indicates the portions that are complementary to part
A and part B, respectively. Ligation was carried out as follows: 10
picomoles each of SNP5 parta, SNP5 part B, and the bridging
oligonucleotide were incubated with 5 units of ampligase, in
1.times. ampligase buffer for one hour at 60 degrees C. The probes
contain an uracil base between the primer 2 homology region and the
barcode sequence. TABLE-US-00009 TABLE 8 Components of the
reactions Reaction 1 2 3 4 5 6 7 8 probe SNP 5 SNP 5 SNP 5 SNP 5
SNP 5 SNP 5 SNP 5 SNP 5 Syn 3 Syn 3 Syn 3 Syn 3 2 part 2 part 2
part 2 part Template S-37 S-37 S-37 S-37 S-37 S-37 S-37 S-37 dXTP
dATP dCTP dGTP dTTP dATP dCTP dGTP dTTP
[0369] An enzyme mix was prepared by combining 148.3 ul of water,
20 ul of pfu ampligase buffer; 5 ul of template S37 at 0.04 . . .
ug/ul; 2 ul of Apyrase at 50 mU/ul; 1.25 ul Ampligase dilution (5
ul 10.times. ampligase buffer; 44.33 ul water; and 0.67 ul
Ampligase at 5 u/ul); and 0.5 ul Taq DNA Polymerase Stoffel
fragment at 10 u/ul. DNA enzyme mixes were prepared by combining
79.7 ul of enzyme mix with 1.35 ul of either probe at 1 pmol/ul. In
the ligation reaction (20 ul), the final barcode concentration was
0.015 picomoles/ul, template is approximately 2 femtomoles/ul.
Final ligase concentration was 0.00042 units/ul in the ligation
reaction (0.0084 units total).
[0370] 18 ul were aliquoted into strip tubes. The dXTPs Potential
contaminating nucleotides were degraded by incubation for 4 minutes
at 20.degree. C. The DNA is then denatured by incubation for 5
minutes at 95.degree. C., and annealed by incubation for 15 minutes
at 65.degree. C. 2 ul of respective dXTPs at . . . 0.1 mM . . . .
was added to the appropriate reactions and incubated for 10 minutes
at 65.degree. C. (ligation reactions). 2 ul of ligation reactions
were added to 18 ul of extension mix prewarmed at 95.degree. C.
Extension mix was prepared by combining 45 ul 4.times. E/U buffer
(described in example 5); 1.35 ul of AmpliTaq gold DNA Polymerase
at 5 u/ul and 115, 65 ul of water. The reactions were incubated for
10 minutes at 95.degree. C. to denature the ligantded product as
well as to activate Taq Gold. The reactions were incubated for 2
minutes to runoff, and then brought to 4.degree. C. (extension
reaction).
[0371] UNG cleanup and amplification was performed by mixing 20 ul
of extension reaction with 20 ul of UNG/PCR mix, prepared by mixing
85 ul of 4.times.E/U buffer; 2.55 ul of AmpliTaq Ggold DNA
Polymerase at 5 u/ul; 17 ul UNG at 1 unit/ul; 5.44 ul of M13 primer
(SEQ ID NO 3) at 100 pmol/ul and 230 ul of water. The reactions
were incubated for 20 minutes at 37.degree. C.; denatured for 10
minutes at 95.degree. C.; subjected to 14 PCR cycles of 20 seconds
at 95.degree. C., 1 minute at 69.6.degree. C. (decreasing by 0.4
degrees every cycle) and 10 seconds at 72.degree. C.; followed by
20 PCR cycles of 20 seconds at 95.degree. C.; 45 seconds at
64.degree. C.; and 10 seconds at 72.degree. C. The reactions were
then incubated for 10 seconds at 72.degree. C. and then soaked at
4.degree. C.
[0372] The reaction products were analyzed in the same way as in
the previous examples. The results clearly show that amplification
was observed only in lanes 2 and 6, both of which contained the
dGTP, which is the nucleotide that is complementary to the SNP in
the template DNA. In addition, the bands in the two reactions were
similar, indicating that 2 part probes are as functional as a one
part probe.
Example 8
Detection of a SNP among in S. cerevisiae Genomic DNA
[0373] This example describes the detection of a SNP within in S.
cerevisiae genomic DNA template using the polymerase/ligase method
with a two part probe, and Apyrase and UNG for reducing background
amplification.
[0374] PCR Template DNA used in this example was either S.
cerevisiae genomic DNA (referred to as genomic template) alone or
containing varying concentrations of the template DNA S37 (SEQ ID
NO: 179 described in previous examples) was diluted in S.
cerevisiae genomic DNA (referred to as genomic template). To obtain
the different diultions of S37 genomic DNA, tThe yeast The probe
used in this example was SNP5 (SEQ ID NO 21). Probe DNA was first
diluted to 0.3 pmol/ul, from which 4 aliquots of 19 ul were
prepared. 1 ul of S37 DNA was added to the first tube, mixed, one
ul of this dilution was added into the next tube and so on so that
the PCR template S37 is serially diluted by the probegenomic DNA.
In reactions 7 and 8, no PCR template is added and only genomic DNA
template is present.
[0375] The different probe and template DNA combinations are set
forth in Table 9. TABLE-US-00010 TABLE 9 Components of the
reactions Reaction 1 2 3 4 5 6 7 8 Probe SNP5 SNP5 SNP5 SNP5 SNP5
SNP5 SNP5 SNP5 Template S37/10 S37/10 S37/200 S37/200 S37/4000
S37/4000 -- -- Genomic + + + + + + + + template dXTP C G C G C G C
G
[0376] The reactions were carried out as described in Example 7.
Briefly, the template and probe DNAs weare combined and incubated
with 100 ng of genomic yeast DNA, Apryase, Ampligase and Taq DNA
Polymerase Stoffel fragment for 4 minutes at 20.degree. C. to
degrade the dXTPpotential contaminating nucleotides. The reactions
were then denatured by incubation at 95.degree. C. and annealed by
ramping down to 65.degree. C. over about 30 minutes, and then
incubated for 10 minutes at 65.degree. C.
[0377] 2 ul of each reaction was added to 18 ul of runoff mix
prepared by combining (per reaction) 2 ul 10.times.Taq Gold buffer;
0.75 ul dNTPs at 4 mM each; 0.15 ul of AmpliTaq gold DNA Polymerase
at 5 u/ul; 0.16 ul P1 bar biotin primer (SEQ ID NO 1) at 100
pmol/ul; 2 ul MgCl.sub.2 at 25 mM; and 12.94 ul water. The
reactions were heat denatured for 10 minutes at 95.degree. C. and
runoff products obtained by incubation for 2 minutes at 60.degree.
C. While the reactions weare still at 60.degree. C., 20 ul of the
reactions weare transferred to a UNG/PCR mix prepared by combining
2 ul of 10.times. Taq Gold buffer; 0.75 ul dNTPs at 1.25 mM each;
0.3 ul AmplTaq Gold DNA Polymerase at 100 pmol.ul; 1 ul UNG; 0.32
ul M13 primer (SEQ ID NO 3) at 100 pmol/ul; 2 ul MgCl.sub.2 at 25
mM; and 13.31 ul water. The reactions were incubated for 20 minutes
at 37.degree. C., heat denatured for 5 minutes at 95.degree. C. and
subjected to 14 and 30 amplification cycles of 20 seconds at
95.degree. C. and 1 minute at 60.degree. C. each.
[0378] The amplification products were analyzed as described above.
The results show the presence of an amplified product in each lane
containing a reaction with a dCTP (the nucleotide complementary to
the SNP in the template DNA), but not in lanes containing a
reaction with a dGTP. Thus, identification of the SNP was clear
even in template DNA highly diluted with yeast DNA. In addition, a
strong band was also seen in lanes 7, which contained only genomic
template and no S37 template, but not in lane 8, which contained
dGTP. Thus, this example clearly shows that a SNP can be identified
in a unique sequence in genomic DNA.
[0379] In lanes 7 and 8, with no added PCR template, the only
template present is genomic template demonstrating that a SNP can
be detected from genomic DNA.
Example 9
Detection of Five SNPs in the Same Reaction
[0380] This example demonstrates the identification of five SNPs in
template DNA in a single reaction using the ligase/polymerase
method, two part probes, and the Apyrase, biotin isolation of
extension product, and UNG background reduction methods.
[0381] The template DNAs were a mix of 600 base pair PCR templates
amplified from S cerevisiae; S-7 (SEQ ID NO: 10), 26 containing the
sequence 5' ACATTTAGATCTGCAGTTTCTMTATGMTTCAGTGGAAAAT 3'(SEQ ID NO:
238), 30 containing the sequence 5'
GATCAAATGCGACCATATTCATCAAACTTATAGGCG 3' (SEQ ID NO: 167 and 37
containing both sequences 5' TACTGTACCCATTTTTTTGTCGCTTAAGGTTTCGCGT
3' (SEQ ID NO: 5) and SEQ ID NO: 17 (S37)9. The probes used were
SNPs 1, 2, 3, and 5 described previously, e.g., in Example 2. SNP4
(Y4:PL:C:119:159) has the nucleotide sequence
5'ACAAAAAAATGGGTACAGTATA/UGTCCACGAGGTCTCTAGTC//TGTAAAACGACGGCCAGT/UGGTAGT-
ACGGTGCTCTTACAT/TTTAAA/ACGCGAAACCTTAAG 3' (SEQ ID NO: 23;
representing homology 1/primer1/primer 2/barcode/DraI/homology2; U
is uracil). The different combinations of tempate DNA and probes is
set forth in Table 10. TABLE-US-00011 TABLE 10 Components of each
reaction Reaction 1 2 3 4 5 6 7 8 probe SNPs SNPs SNPs SNPs SNPs
SNPs SNPs SNPs 1, 2, 3, 4, 5 1, 2, 3, 4, 5 1, 2, 3, 4, 5 1, 2, 3,
4, 5 1, 2, 3, 4, 5 1, 2, 3, 4, 5 1, 2, 3, 4, 5 1, 2, 3, 4, 5
Template S- S-7, 26, S-7, 26, S-7, 26, S-7, 26, S-7, 26, S-7, 26,
S-7, 26, 7, 26, 30, 37 30, 37 30, 37 30, 37 30, 37 30, 37 30, 37
30, 37 dXTP dATP dCTP dGTP dTTP dATP dCTP dGTP dTTP
[0382] The reactions were carried out as described in Example 8.
Briefly, the template and probe DNAs are combined and incubated
with Apryase, Ampligase and Taq DNA Polymerase Stoffel fragment for
4 minutes at 20.degree. C. to degrade the dXTPs. The Eenzyme mix
was prepared by combining 109.1 ul of water, 18 ul 10.times. pfu
Ampligase buffer; 2.7 ul of each barcode olio; 4.5 ul of each
template DNA; 1.8 ul Apyrase at 50 mU/ul; 1.125 ul Ampligase
dilution (5 ul Ampligase buffer; 44.33 water and 0.67 ul Ampligase
5 u/ul); and 0.45 ul Taq DNA Polymerase Stoffel fragment at 10
u/ul. 18 ul of the mix were transferred to strip tubes, which were
incubated for 4 minutes at 20.degree. C. to degrade potential
contaminating nucleotides. The reactions were then denatured by
incubation at 95.degree. C. for 5 minutes and annealed at
65.degree. C. for 15 minutes. 2 ul of the respective dXTP was added
and the reactions incubated for 10 minutes at 65.degree. C. In the
ligation reaction (20 ul), the final barcode probe concentration
wais 0.015 picomoles/ul and, template concentration wais
approximately 2 femtomoles/ul. Final ligase concentration iwas
0.00042 units/ul in the ligation reaction (0.0084 units total).
[0383] 2 ul of each reaction was added to 18 ul of runoff mix
preheated to 95.degree. C. prepared by combining 34 ul 10.times.
Taq Gold buffer; 40.8 ul dNTPs at 1.25 mM each; 2.25 ul of AmpliTaq
gold DNA Polymerase at 5 u/ul; 2.72 ul P1 bar biotin primer (SEQ ID
NO: 1) at 100 pmol/ul; 34 ul MgCl.sub.2 at 25 mM; and 306 ul water.
The reactions were heat denatured for 10 minutes at 95.degree. C.
and runoff products obtained by incubation for 2 minutes at
60.degree. C. The reactions were then brought to 4.degree. C.
[0384] Biotin cleanup was performed as described in Example 6.
Briefly, the beads were washed as described and resuspended in 2
volumes 2M NaCl. 20 ul of each reaction were added to 20 ul of
beads to get a 1 M NaCl mix. The mix was incubated at 43.degree. C.
for 15 min, pipetting up and down every 5 minutes. The beads were
then washed 6 times in 200 ul of 0.5 M NaCl/0.5 M NaOH buffer,
followed by a wash with 200 ul of 0.5 M NaCl in TE. The beads were
resuspended in 200 ul of: 100 mM NaCl, TE, 0.25% DMSO, 0.01%
Triton, and heated for 15-20 min at 70.degree. C. This releases
non-specifically bound product to beads. The beads were then washed
again with 200 ul TE. The beads were resuspended in original sample
volume (eg. 20 ul) using 1.times.TE.
[0385] 20 ul of the reactions were transferred to a UNG/PCR mix
prepared by combining 18 ul of 10.times. Taq Gold buffer; 21.6 ul
dNTPs at 1.25 mM each; 1.35 ul AmplTaq Gold DNA Polymerase at 100
pmol.ul; 1.44 ul P1 Bar primer (SEQ ID NO 1) at 100 pmol/ul; 9 ul
UNG; 2.88 ul M13 biotin primer (SEQ ID NO: 3) at 100 pmol/ul; 18 ul
MgCl.sub.2 at 25 mM; and 107.9 ul water. The reactions were
incubated for 20 minutes at 37.degree. C., heat denatured for 5
minutes at 95.degree. C. and subjected to 14 amplification cycles
of 20 seconds at 95.degree. C.; 1 minute at 69.6.degree. C.
(decreasing by 0.4.degree. C. every cycle); and 10 seconds at
72.degree. C. and 20 amplification cycles of 45 seconds at
64.degree. C.; and 10 seconds at 72.degree. C. The reactions are
then incubated for 10 seconds at 72.degree. C. and further
incubated at 4.degree. C.
[0386] The amplified products were analyzed by gel electrophoresis
and the result indicate that an amplification product is seen for
each nucleotide as expected (A,C,G,T in lanes 1,2,3,4
respectively). The five SNPs tested had the following nucleotide
matches: SNP1, dATP; SNP2, dGTP; SNP3, dTTP: and both SNP4 and
SNP5, dCTP. Therefore different SNPs are amplified in each lane
although this cannot be distinguished by gel electrophoresis
[0387] The amplified products were further then analyzed by
hybridization of each multiplexed reaction to a DNA chip. Each dXTP
reaction (multiplexed to 5 probes) was hybridized to a separate
chip. In each case, the hybridization mixture consisted of the
following: 2.0 ul of the above PCR reaction, 0.5 ul of a control
(border) oligo at 0.7 fm/ul, 2.9 ul M13 complement oligo at 10
pm/ul (10 fold excess over the M13 primer of the PCR reaction),
brought up to 160 ul in 6.times.SSPE-T buffer (6.times.SSPE buffer
with 0.005% Triton). This mixture was denatured for 2 min at
95.degree. C. C and then put incubated on ice for 5 min. The
solution was loaded on a DNA chip and hybridized at 42.degree. C. C
for 4 hours. After this period, the chip was washed with
6.times.SSPE-T, 5 times and loaded with the following for
fluorescent labeling: 0.5 ul of Streptavidin R-Phycoerythrin
conjugate (1 mg/ml), 10 ul of BSA (20 mg/ml), brought up to 160 ul
in SSPE-T buffer. The chip was incubated for 10 minutes at 42 C.
After this, the chip was again washed with SSPE-T buffer 5 times
and loaded onto a laser fluorescence scanner for analysis of the
multiplexed reaction products. The signal at each of the five probe
features of interest were averaged over the 8.times.8 pixels per
feature, background subtracted and then normalized using the
average signal intensity of the control (border) features. This
effectively normalized the difference in hybridization efficiency
on the four different chips. Table 11 shows normalized signal
intensity from four hybridizations, one for each nucleotide. The
signal:noise ratio corresponds to the normalized signal at the
expected nucleotide to the highest normalized signal at the other
three nucleotides. TABLE-US-00012 TABLE 11 Normalized signal
intensity from DNA chip hybridization A C G T Signal Signal Signal
Signal Base call Signal:Noise Probe 1 1.5 0.01 0.02 0.03 Correct
50:1 Probe 2 0.2 0.04 1.3 0.16 Correct 6.5:1 Probe 3 0.06 0 0 0.56
Correct 9:1 Probe 4 0.03 0.14 0.02 0.01 Correct 5:1 Probe 5 0.24
0.48 0.18 0.27 Correct 2:1
[0388] The results of the DNA chips hybridization are not shown,
however, three separate hybridizations were done. The reaction to
which dATP was added was colored in green. The reaction to which
dCTP was added was in blue. The reaction to which dGTP was in red.
The allele calls are shown by the color of the spot at the given
SNP tag location: SNP1: A; SNP2: G and SNP5: C.
[0389] Thus, this example demonstrates that multiplexing is
possible with the method of the invention, and that the different
SNPs can easily be identified by hybridization to DNA chips.
Example 10
Multiplexing with S. cerevisiae Genomic DNA
[0390] This example demonstrates multiplexing on yeast genomic DNA
using gap modular synthesis and Apyrase and UNG to reduce
background.
[0391] The template DNA from S. cerevisiae (S96 genomic DNA at 197
ng/ul [what is S96 DNA?we tested two strain of yeast S96 and YJM,
in all examples, S96 was used]) was incubated with one or more SNP
probes, as set forth in Table 12. The sequences of the two part
probes are provided in the previous examples. TABLE-US-00013 TABLE
12 Components of the reactions Reaction 1 2 3 4 5 6 7 8 Probe SNP 1
SNP 1 SNP 1 SNP 1 SNP 2 SNP 2 SNP 2 SNP 2 dXTP dATP dCTP dGTP dTTP
dATP dCTP dGTP dTTP Reaction 9 10 11 12 13 14 15 16 Probe SNP 3 SNP
3 SNP 3 SNP 3 SNP 4 SNP 4 SNP 4 SNP 4 dXTP dATP dCTP dGTP dTTP dATP
dCTP dGTP dTTP Reaction 17 18 19 20 21 22 23 24 Probe SNP 5 SNP 5
SNP 5 SNP 5 AII 5 AII 5 AII 5 AII 5 probes probes probes probes
dXTP dATP dCTP dGTP dTTP dATP dCTP dGTP dTTP
[0392] The reactions were carried out as described in Example 9.
Briefly, the template and probe DNAs were combined and incubated
with Apryase, Ampligase and Taq DNA Polymerase Stoffel fragment for
4 minutes at 20.degree. C. to degrade the dXTPs. An enzyme mix was
prepared by combining 409.95 ul of water, 60 ul 10.times.pfu
Ampligase buffer; 15.3 ul of template DNA at 197 ng/ul; 6 ul
Apyrase at 50 mU/ul; 0.75 ul Ampligase; and 3 ul Taq DNA Polymerase
Stoffel fragment at 10 u/ul. 18 ul were transferred to strip tubes.
The final mix was prepared by combining (for 5 reactions) 74.25 ul
enzyme mix; 1.35 ul of each barcode oligoprobe and TE if necessary
to obtain a volume of 81 ul.
[0393] The reactions were then denatured by incubation at
95.degree. C. and annealed at 65.degree. C. for 15 minutes. 2 ul of
the respective dXTP at 0.1 mM was added and the reactions were
incubated for 10 minutes at 65.degree. C.
[0394] In the ligation reaction (20 ul), the final barcode probe
concentration wais 0.015 picomoles/ul.
[0395] 3 ul of each reaction was added to 27 ul of runoff mix
prepared by combining 78 ul Ox Taq Gold buffer; 93.6 ul dNTPs at
1.25 mM each; 5.85 ul of AmpliTaq gold DNA Polymerase at 5 u/ul;
6.24 ul Pibar biotin primer (SEQ ID NO 1) at 100 pmol/ul; 78 ul
MgCl.sub.2 at 25 mM; and 440.31 ul water. The reactions were heat
denatured (and Taq activated) for 10 minutes at 95.degree. C. and
runoff products obtained by incubation for 2 minutes at 60.degree.
C. The reactions were then, and chilled by incubation at 4.degree.
C.
[0396] 20 ul of the reactions were transferred to a UNG/PCR mix
prepared by combining 78 ul of 10.times. Taq Gold buffer; 93.6 ul
dNTPs at 1.25 mM each; 78 ul AmpiTaq Gold DNA Polymerase; 39 ul
UNG; 12.48 ul M13 primer (SEQ ID NO: 3) at 100 pmol/ul; 6.24 ul P1
Bar primer (SEQ ID NO: 1) at 100 pmol/ul; 78 ul MgCl.sub.2 at 25
mM; and 466.83 ul water. The reactions were incubated for 20
minutes at 37.degree. C., heat denatured for 10 minutes at
95.degree. C. and subjected to 14 amplification cycles of 20
seconds at 95.degree. C.; 1 minute at 69.6.degree. C. (decreasing
by 0.4.degree. C. every cycle), followed by 30 amplification cycles
of 20 seconds at 95.degree. C.; 45 seconds at 64.degree. C.; and 10
seconds at 72.degree. C. The reactions weare then incubated for 10
seconds at 72.degree. C. and then soaked at 4.degree. C.
[0397] The amplification products were analyzed as described in
Example 8. The results clearly show the presence of amplification
products in reactions in which the dNTP that was added is
complementary to the SNP in the template DNA. For example, lane 7
shows a reaction with a SNP2 probe and dGTP, which is the
nucleotide that is complementary to the SNP in the template DNA at
that location. Similary, lane 18 shows an amplification product
resulting from the addition of dCTP which is the complementary
nucleotide to SNP5 in template DNA. In reactions 22, 23 and 24,
bands are also clearly visible indicating that amplification does
occur in multiplexed reactions.
[0398] The dCTP and the dGTP nucleotide reactions were also
analyzed by hybridization to DNA chips. The hybridization
conditions were similar to those in the example 9, except that 20
ul of the PCR reaction was used in the hybridization mix and the
chip was hybrizided for 12 hours. Table 13 shows normalized signal
intensity from the two hybridizations. The Signal:Noise ratio
corresponds to the normalized signal at the expected nucleotide to
the normalized signal at the other nucleotide. TABLE-US-00014 TABLE
13 Normalized signal intensity from DNA chip hybridization C Signal
G Signal Base call Signal:Noise Probe 2 0.13 0.39 Correct 3:1 Probe
4 0.16 0.08 Correct 2:1 Probe 5 0.13 0.05 Correct 2.5:1
Example 11
Detection of SNPs in Very High Complexity DNA
[0399] To mimic the complexity and quantity of DNA needed to
genotype human DNA, yet still use the current yeast specific
probes, S. cerevisiae DNA was mixed with calf thymus DNA in an
equimolar ratio or further diluted and then performed the SNP
genotyping reaction. Calf thymus DNA is mammalian DNA and contains
roughly the same complexity in base pairs as does human DNA.
[0400] The reactions are set forth in Table 143. Yeast genomic DNA
(200 ng/ul) was serially diluted into calf thymus (100 ng 1 ul) as
follows. 1 ul of yeast S96 was mixed with 19 ul of calf thymus
(Dilution 1). 2 ul of Dilution 1 were mixed into 18 ul of calf
thymus (Dilution 2). 2 ul of Dilution 2 were mixed into 18 ul of
calf thymus (Dilution 3). TABLE-US-00015 TABLE 143 Components of
the reactions Reaction 1 2 3 4 5 6 7 8 probe SNP5 SNP5 SNP5 SNP5
SNP5 SNP5 SNP5 SNP5 Yeast S96 100 ng 100 ng 10 ng 10 ng 1 ng 1 ng
0.1 ng 0.1 ng Genomic uncut Calf 100 ng 100 ng 100 ng 100 ng 100 ng
100 ng 100 ng 100 ng Thymus dXTP C G C G C G C G
[0401] An enzyme mix containing the template and probe DNAs was
prepared by combining (per reaction) 4.875; 11.875; 13.875; or
14.575 ul of water; 2 ul 10.times.pfu Ampligase buffer; 0.3 ul of
barcode olio; 10, 3, 1, or 0.3 ul of yeast genomic dilution; 0.2 ul
Apyrase at 50 mU/ul; 0.125 ul Ampligase; and 0.5 ul Taq DNA
Polymerase Stoffel fragment at 10 u/ul. 18 ul were transferred to
strip tubes. dXTPs Potential contaminating nucleotides were
degraded by incubation for 20 minutes at 4.degree. C. The reactions
were then denatured by incubation at 95.degree. C. for 5 minutes
and ramped down to 65.degree. C. 2 ul dXTP at 100 uM dilution was
added and the reactions were incubated at 65.degree. C. for 10
minutes.
[0402] For Taq run-off, 2 ul of ligation mix was added to 18 ul of
run-off mix and heat denatured for 10 minutes at 95.degree. C.
Runoff mix was prepared by combining (per reaction) 2 ul 10.times.
Taq Gold buffer; 0.75 ul dNTPs at 4 mM each; 0.15 ul of AmpliTaq
gold DNA Polymerase at 5 u/ul; 0.16 ul Pibar biotin primer (SEQ ID
NO 1) at 10 pmol/ul; 2 ul MgCl.sub.2 at 25 mM; 1 ul UNG; and 13.78
ul water. The reactions were heat denatured (and Taq activated) for
10 minutes at 95.degree. C. and runoff products obtained by
incubation for 2 minutes at 60.degree. C.
[0403] After runoff, while the mixture is still at 60.degree. C.,
20 ul of the extension reaction were transferred into a UNG/PCR
mix, prepared by combining (per reaction) 2 ul of 10.times. Taq
Gold buffer; 0.75 ul dNTPs at 1.25 mM each; 0.15 ul AmpiTaq Gold
DNA Polymerase at 5 units/ul; 1 ul UNG; 0.16 ul M13 primer (SEQ ID
NO 3) at 100 pmol/ul; 0.16 ul P1 Bar primer (SEQ ID NO 1) at 100
pmol/ul; 2 ul MgCl.sub.2 at 25 mM; and 13.78 ul water. The
reactions were incubated for 20 minutes at 37.degree. C., heat
denatured for 5 minutes at 95.degree. C. and subjected to 35
amplification cycles of 20 seconds at 95.degree. C.; 45 seconds at
64.degree. C.; and 10 seconds at 72.degree. C. The reactions are
then incubated for 10 seconds at 72.degree. C. and then soaked at
4.degree. C.
[0404] The amplification products were analyzed by gel
electrophoresis as described in the previous examples. The results
indicate the presence of an amplification product in all lanes
having reactions done in the presence of dCTP, the nucleotide that
is complementary to the SNP in the template nucleic acid. This
demonstrates that, even in the presence of several billion base
pairs of DNA, a SNP can be detected by this method.
Example 12
Amplification of SNPs in Human DNA
[0405] This example demonstrates the use of the system to identify
SNPs in human genomic DNA. This example used the polymerase/ligase
method with two part synthesized probes and the Apyrase and UNG
background reduction methods.
[0406] Two DNA samples were obtained from a Northern European donor
and an Indian donor. The samples were screened for two markers in
the human ATM gene, GenBank accession number HSU82828. This gene
contains many polymorphisms including two SNPs: one at base 46611
(intron 17; G to A: 34,107) and the second one at 60136 (Intron 22;
T to C: 35107). The probe designed to detect the SNP at base 46611
was prepared by ligating two oligonucleotides using a bridging
oligonucleotide as described above, to produce a probe having the
nucleotide sequence 5'
AGMTMTTGTTTTTATTTCTTTGAAC/UGTCCACGAGGTCTCTAGTC/TGTAAAACGACGGCCAGT/UATGCGT-
ACCCTCGACTGAG/TTTAAA/TAGAGAAAACACTGTCTGC C.sub.3' (SEQ ID NO: 264),
represented as homology1/primer1/primer2/barcode/DraI/homology2
("U" indicates uracil bases). The probe to detect the second SNP
was also constructed by ligating two oligonucleotides using a
bridging oligonucleotides, to produce a probe having the nucleotide
sequence 5'
AATAACCTTTCAGTGAGTTTTGAC/UGTCCACGAGGTCTCTAGTC/TGTAAAACGACGGCCAGT/UACTGTCA-
CCGGAGTCTGAG/TTTAAA/GACATATTGGMGTAACTTA 3' (SEQ ID NO: 275).
[0407] The compositions of the reactions are set forth in Table
145. TABLE-US-00016 TABLE 154 Components of the reactions Reactions
1 2 3 4 5 6 7 8 probe ATM466 ATM466 ATM466 ATM466 ATM601 ATM601
ATM601 ATM60 oligo 11 11 11 11 36 36 36 136 Genomic NE NE NE NE NE
NE NE NE templatee dXTP dATP dCTP dGTP dTTP dATP dCTP dGTP dTTP
Reactions 9 10 11 12 13 14 15 16 probe ATM466 ATM466 ATM466 ATM466
ATM601 ATM601 ATM601 ATM60 oligo 11 11 11 11 36 36 36 136 Genomic
EI EI EI EI EI EI EI EI templatee dXTP dATP dCTP dGTP dTTP dATP
dCTP dGTP dTTP NE stands for North European and EI stands for
Indian.
[0408] An enzyme mix containing the template and probe DNAs was
prepared by combining 232.7 ul of water; 40 ul 10.times.pfu
Ampligase buffer; 4 ul Apyrase at 50 mU/ul; 2.5 ul Ampligase; and
0.5 ul Taq DNA Polymerase Stoffel fragment at 10 u/ul. Four
enzyme/DNA mixes were prepared by combining 65.07 ul enzyme mix;
13.5 ul of template DNA; and 0.54 ul probe DNA. 18 ul were
transferred to strip tubes. dXTPs Potential contaminating
nucleotides were degraded by incubation for 20 minutes at 4.degree.
C. The reactions were then denatured by incubation at 95.degree. C.
for 5 minutes and ramped down to 65.degree. C. for about 15
minutes. 2 ul dXTP at 100 uM dilution was added and the reactions
were incubated at 58 for 10 minutes.
[0409] For Taq run-off, 2 ul of ligation mix was added to 18 ul of
run-off mix warmed to 95.degree. C., prepared by combining 34 ul
10.times. Taq Gold buffer; 12.75 ul dNTPs at 1.25 mM each; 2.55 ul
of AmpliTaq gold DNA Polymerase at 5 u/ul; 2.72 ul P1 bar biotin
primer (SEQ ID NO: 1) at 10 pmol/ul; 34 ul MgCl.sub.2 at 25 mM; and
220 ul water. The reactions were heat denatured (and Taq activated)
for 10 minutes at 95.degree. C. and runoff products obtained by
incubation for 2 minutes at 60.degree. C., and then chilled at
4.degree. C.
[0410] 20 ul of the extension reaction were transferred into a
UNG/PCR mix, prepared by combining 34 ul of 10.times. Taq Gold
buffer; 12.75 ul dNTPs at 1.25 mM each; 2.55 ul AmpiTaq Gold DNA
Polymerase at 5 units/ul; 17 ul UNG 1 unit/ul; 2.72 ul M13 primer
(SEQ ID NO 3) at 100 pmol/ul; 2.72 ul P1 Bar primer (SEQ ID NO 1)
at 100 pmol/ul; 34 ul MgCl.sub.2 at 25 mM; and 234.26 ul water. The
reactions were incubated for 20 minutes at 37.degree. C., heat
denatured for 10 minutes at 95.degree. C. and subjected to 35
amplification cycles of 20 seconds at 95.degree. C.; 45 seconds at
64.degree. C.; and 10 seconds at 72.degree. C. The reactions are
then incubated for 10 seconds at 72.degree. C. and then soaked at
4.degree. C.
[0411] The amplification products were analyzed by gel
electrophoresis as described in previous examples. The results
indicate the presence of an amplification product in lanes 3 and 11
for the ATM46611 SNP indicating that both genomic DNAs are
homozygous G for this SNP. Amplification products in lane 6 but not
8 for the nNorthern eEuropean donor indicates that this genomic DNA
is homozygous for C for the ATM60136 SNP while the eEast indian
Indian genomic DNA is heterozygous for C and T due to the presence
of products in the lanes 14 and 16 lanes, respectively.
[0412] Increase in signal due to the release of ligated circular
probe from genomic DNA using uracil Example 13:
[0413] N-glycosylase digestion.
[0414] Because it is difficult for polymerases to copy a primed
circular probe while it is circularized around long DNA templates,
signal is improved if the ligated probe is released from the
genomic DNA template allowing free access to the ligated probe by
primers and polymerase. In this example, this is achieved by
depyrimidization of the ligated circularized probe by
uracil--N--glycosylase also referred to as UNG) followed by heat
scission of the abasic site by heat linearizes the ligated probe
which can then be heat denatured from the genomic DNA template.
[0415] This example describes a method comparing probes containing
(probes A9U and AIOU) and not containing (A9 and A10) the UNG
target base, uracil (dUTP or simply U) in a reaction containing or
not containing the digesting enzyme uracil--N--glycosylase.
[0416] The template DNA used was purified human genomic DNA and the
probes used have the nucleotide sequence 5' A9 TABLE-US-00017 A9
(SEQ ID NO: X) TATGACCAGAGGTTTCTGACTGTCCACGAGGTCTCTAGTCTGTAAAACGA
CGGCCAGTGGGTACATCCAAGCAACCGAGTTTCCTGGCATTATATCATCT A10 (SEQ ID NO:
X) ACCTGGAAGCCAACTTCGTCCACGAGGTCTCTAGTCTGTAAAACGACGG
CCAGTAGCGTACTCTGAATGCCGTCGCCAGAAATTAGTCAAGGAAA A9 (SEQ ID NO: X)
UTATGACCAGAGGTTTCTGACTGTCCACGAGGTCTCTAGTCUTGTAAAA
CGACGGCCAGTGGGTACATCCAAGCAACCGAGTTTCCTGGCATTATATC ATCT A10 (SEQ ID
NO: X) UCACCTGGAAGCCAACTTCGTCCACGAGGTCTCTAGTCUTGTAAAACGA
CGGCCAGTAGCGTACTCTGAATGCCGTCGCCAGAAATTAGTCAAGGAAA
[0417] A single nucleotide gap fill reaction mix was prepared by
mixing 48 ul of 10.times. ampligase reaction buffer (Epicentre),
0.6 ul apyrase 500 milliunits/ul (Sigma), 2.4 ul Taq polymerase
Stoffel fragment 10 units/ul (ABI), 0.6 ul Ampligase enzyme 5
units/ul (Epicentre), 24 ul human genomic DNA 100 ng/ul, and 345 ul
water. 44.75 ul of this reaction mix was added to 0.25 ul of each
probe (1.25 femptomoles/ul) 9 ul of which was pippetted into each
of four positions in a reaction plate, one for each nucleotide.
[0418] The reaction mixtures (containing the DNAs) were incubate
for 4 minutes at 20.degree. C., denatured for 5 minutes at
95.degree. C. and annealed for 15 minutes at 55.degree. C. To each
tube 1 ul of 1.25 micromolar deoxynucleotide (Pharmacia) was added
(as indicated in table XX) and the reaction was incubated 10
minutes at 55.degree. C. At this point, probes have been
circularized around the genomic DNA if the correct nucleotide was
added. The reaction mixture was then incubated at 95.degree. C. for
2 minutes and then brought to 37.degree. C. To each well, 25 ul of
uracil--N--glycosylase mix was added consisting of 2.5 ul 10.times.
Taq gold buffer (ABI), 1.6 ul 25 mM MgCl2, water, and 10 ul of UNG
(if indicated in table XX). The reactions were incubated 20 minutes
at 37.degree. C. for depyrimidization, then for 10 minutes at
95.degree. C. to break the abasic site. TABLE-US-00018 TABLE XX
components of the different reactions: Reaction 1 2 3 4 5 6 7 8 9
10 11 12 13 14 15 16 Probe A10 A9 A10 A9 A10 A9 A10 A9 A10U A9U
A10U A9U A10U A9U A10U A9U dXTP dATP dATP dCTP dCTP dGTP dGTP dTTP
dTTP dATP dATP dCTP dCTP dGTP dGTP dTTP dTTP UNG - - - - - - - - -
- - - - - - - Reaction 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 Probe
A10 A9 A10 A9 A10 A9 A10 A9 A10U A9U A10U A9U A10U A9U A10U A9U
dXTP dATP dATP dCTP dCTP dGTP dGTP dTTP dTTP dATP dATP dCTP dCTP
dGTP dGTP dTTP dTTP UNG + + + + + + + + + + + + + + + 25
[0419] Ligated probe products were amplified by adding 25 ul of an
amplification mix consisting of 2.5 ul 10.times. Taq gold buffer
(ABI), 1.6 ul 25 mM MgCl2, 2.24 ul dNTPs at 1.25 mM each, 0.08 ul
of M13 primer (SEQ ID NO: XX) at 197 pmol/ul, 0.09 ul of P1Bar
primer (SEQ ID NO: XX) at 186 pmol/ul, 0.4 ul Amplitaq Gold DNA
polymerase 5 units/ul (ABI), and water, and thermocycling the
mixture 20 seconds at 95.degree. C., 45 seconds at 64.degree. C.,
and 10 seconds at 72.degree. C. for 31 cycles
[0420] 20 ul of each reaction was then subjected to electrophoresis
in 4% agarose, and the bands were visualized as described in the
previous examples. The results indicate the signal, which is a band
seen migrating at 100 base pairs as compared to the DNA ladder run
to the left, is greatly increased in reactions with probes that
contain a uracil and were incubated with uracil--N--glycosylase
indicating that both the enzyme and its target uracil on the probe
are necessary to release the circularized probe from the genomic
DNA template and allow efficient amplification.
Sequence CWU 1
1
29 1 38 DNA Saccharomyces cerevisiae 1 atctcgggat atcagactta
gcggcaccgt cctcaccg 38 2 38 DNA Saccharomyces cerevisiae 2
atctcgggat atcagactta gcggtaccgt cctcaccg 38 3 92 DNA Artificial
Sequence synthetic. 3 ccgctaagtc tgatatcccg agatgtccac gaggtctcta
gtcgacctgc agcgtacgcg 60 gacctcaagt gaagtacacg gtgaggacgg tg 92 4
92 DNA Artificial Sequence synthetic. 4 ccgctaagtc tgatatcccg
agatgtccac gaggtctcta gtcgacctgc agcgtacgcg 60 gacctcaagt
gaagtacacg gtgaggacgg ta 92 5 19 DNA Artificial Sequence synthetic.
5 gactagagac ctcgtggac 19 6 15 DNA Artificial Sequence synthetic. 6
gacctgcagc gtacg 15 7 42 DNA Saccharomyces cerevisiae 7 acatttagat
ctgcagtttc taatatgaat tcagtggaaa at 42 8 36 DNA Saccharomyces
cerevisiae 8 tcgggatatc agacttagcg gcaccgtcct caccgt 36 9 36 DNA
Saccharomyces cerevisiae 9 gatcaaatgc gaccatattc atcaaactta taggcg
36 10 42 DNA Saccharomyces cerevisiae 10 ccagtccctt gagttcgcga
atagtaattt tggtgatacc tg 42 11 103 DNA Artificial Sequence
synthetic. 11 gaaactgcag atctaaatgt accugtccac gaggtctcta
gtctgtaaaa cgacggccag 60 tugctggagt tcgcacgcta taattttcca
ctgaattcat att 103 12 103 DNA Artificial Sequence synthetic. 12
ccgctaagtc tgatatcccg agatugtcca cgaggtctct agtctgtaaa acgacggcca
60 gtucaaaggt ggagctgcac acttttaaaa cggtgaggac ggt 103 13 103 DNA
Artificial Sequence synthetic. 13 atggtcgcat ttgatcgagu gtccacgagg
tctctagtct gtaaaacgac ggccagtugc 60 ctgggttacg tgtctacttt
taaacgccta taagtttgat gaa 103 14 103 DNA Artificial Sequence
synthetic. 14 gcgaactcaa gggactggta cugtccacga ggtctctagt
ctgtaaaacg acggccagtu 60 gcaatatgta actctctggg caggtatcac
caaaattact att 103 15 30 DNA Artificial Sequence synthetic. 15
gtcgttttac agactagaga cctcgtggac 30 16 18 DNA Artificial Sequence
synthetic. 16 tgtaaaacga cggccagt 18 17 30 DNA Artificial Sequence
synthetic. 17 gtcgttttac agactagaga cctcgtggac 30 18 42 DNA
Artificial Sequence synthetic. 18 ccagtccctt gagttcgcga atagtaattt
tggtgatacc tg 42 19 37 DNA Artificial Sequence synthetic. 19
actggccgtc gttttacaga ctagagacct cgtggac 37 20 42 DNA Saccharomyces
cerevisiae 20 acatttagat ctgcagtttc taatatgaat tcagtggaaa at 42 21
36 DNA Saccharomyces cerevisiae 21 gatcaaatgc gaccatattc atcaaactta
taggcg 36 22 37 DNA Saccharomyces cerevisiae 22 tactgtaccc
atttttttgt cgcttaaggt ttcgcgt 37 23 103 DNA Artificial Sequence
synthetic. 23 acaaaaaaat gggtacagta taaugtccac gaggtctcta
gtctgtaaaa cgacggccag 60 tuggtagtac ggtgctctta catttaaaac
gcgaaacctt aag 103 24 111 DNA Artificial Sequence synthetic. 24
agaataattg tttttatttc tttgaacugt ccacgaggtc tctagtctgt aaaacgacgg
60 ccagtuatgc gtaccctcga ctgagtttaa atagagaaaa cactgtctgc c 111 25
108 DNA Artificial Sequence synthetic. 25 aataaccttt cagtgagttt
tgacugtcca cgaggtctct agtctgtaaa acgacggcca 60 gtuactgtca
ccggagtctg agtttaaaga catattggaa gtaactta 108 26 100 DNA Homo
sapiens 26 tatgaccaga ggtttctgac tgtccacgag gtctctagtc tgtaaaacga
cggccagtgg 60 gtacatccaa gcaaccgagt ttcctggcat tatatcatct 100 27 95
DNA Homo sapiens 27 acctggaagc caacttcgtc cacgaggtct ctagtctgta
aaacgacggc cagtagcgta 60 ctctgaatgc cgtcgccaga aattagtcaa ggaaa 95
28 102 DNA Homo sapiens 28 utatgaccag aggtttctga ctgtccacga
ggtctctagt cutgtaaaac gacggccagt 60 gggtacatcc aagcaaccga
gtttcctggc attatatcat ct 102 29 98 DNA Homo sapiens 29 ucacctggaa
gccaacttcg tccacgaggt ctctagtcut gtaaaacgac ggccagtagc 60
gtactctgaa tgccgtcgcc agaaattagt caaggaaa 98
* * * * *
References