U.S. patent application number 10/579543 was filed with the patent office on 2006-11-30 for novel adenoviruses, nucleic acids that code for the same and the use of said viruses.
Invention is credited to Per Sonne Holm.
Application Number | 20060270016 10/579543 |
Document ID | / |
Family ID | 34635104 |
Filed Date | 2006-11-30 |
United States Patent
Application |
20060270016 |
Kind Code |
A1 |
Holm; Per Sonne |
November 30, 2006 |
Novel adenoviruses, nucleic acids that code for the same and the
use of said viruses
Abstract
The present invention is related to an adenovirus expressing a
first protein which is selected from the group comprising an E1B
protein and an E4 protein, priorto a second protein which is
selected from the group comprising an E1A protein.
Inventors: |
Holm; Per Sonne;
(Furstenfeldbruck, DE) |
Correspondence
Address: |
WOOD, PHILLIPS, KATZ, CLARK & MORTIMER
500 W. MADISON STREET
SUITE 3800
CHICAGO
IL
60661
US
|
Family ID: |
34635104 |
Appl. No.: |
10/579543 |
Filed: |
November 15, 2004 |
PCT Filed: |
November 15, 2004 |
PCT NO: |
PCT/EP04/12931 |
371 Date: |
May 15, 2006 |
Current U.S.
Class: |
435/235.1 |
Current CPC
Class: |
A61P 35/00 20180101;
C12N 2840/203 20130101; C12N 2840/206 20130101; C12N 15/86
20130101; C12N 2710/10332 20130101; C12N 2710/10343 20130101; A61K
48/00 20130101 |
Class at
Publication: |
435/235.1 |
International
Class: |
C12N 7/00 20060101
C12N007/00 |
Foreign Application Data
Date |
Code |
Application Number |
Nov 14, 2003 |
DE |
10353152.1 |
Apr 14, 2004 |
DE |
10 2004 018 117.9 |
Claims
1. Adenovirus expressing a first protein which is selected from the
group comprising an E1B protein and an E4 protein, prior to a
second protein which is selected from the group comprising an
E1A-protein.
2. Adenovirus according to claim 1 characterised in that the first
protein is an E1B protein, preferably an E1B55 kd protein.
3. Adenovirus according to claim 1, characterised in that the first
protein is an E4 protein, preferably an E4orf6 protein.
4. Adenovirus according to any of claims 1 to 3, characterised in
that the first protein is a combination of E1B protein and E4
protein, preferably a combination of E1B55 kD protein and E4orf6
protein.
5. Adenovirus according to any of claims 1 to 4, characterised in
that the E1A protein is an E1A12S protein.
6. Adenovirus, preferably an adenovirus according to any of claims
1 to 5, characterised in that the adenovirus comprises at least one
nucleic acid coding for a protein which is selected from the group
comprising E1B proteins, E4 proteins and E1A proteins, whereby the
at least one protein is under the control of a promoter which is
different from the promoter controlling the expression of the
protein in a wildtype adenovirus.
7. Adenovirus according to claim 6, characterised in that the at
least one protein is an E1B protein, preferably an E1B55 kD
protein.
8. Adenovirus according to claim 6 or 7, characterised in that the
at least one protein is an E4 protein, preferably an E4orf6
protein.
9. Adenovirus according to any of claims 6 to 8, characterised in
that the at least one protein is an E1A protein, preferably an
E1A12S protein.
10. Adenovirus according to any of claims 6 to 9, characterised in
that the at least one protein is a combination of E1B protein and
E4 protein, preferably a combination of E1B55kD protein and E4orf6
protein.
11. Adenovirus according to any of claims 6 to 9, characterised in
that the at least one protein is a combination of E1B protein and
E1A protein, preferably a combination of E1B55 kD protein and
E1A12S protein.
12. Adenovirus according to any of claims 6 to 9, characterised in
that the at least one protein is a combination of E4 protein and
E1A protein, preferably a combination of E4orf6 protein and E1A12S
protein.
13. Adenovirus according to any of claims 6 to 9, characterised in
that the at least one protein is a combination of E1B protein, E4
protein and E1A protein, preferably a combination of E1B55 kD
protein, E4orf6 protein and E1A12S protein.
14. Adenovirus according to any of claims 6 to 13, characterised in
that the expression of the E1B protein is controlled by a promoter,
whereby the promoter is selected from the group comprising
tumor-specific promoters, organ-specific promoters, tissue-specific
promoters, heterologous promoters and adenoviral promoters, whereby
the adenoviral promoter is different from the E1B promoter.
15. Adenovirus according to any of claims 6 to 14, characterised in
that the expression of the E4 protein is controlled by a promoter,
whereby the promoter is selected from the group comprising
tumor-specific promoters, organ-specific promoters, tissue-specific
promoters, heterologous promoters and adenoviral promoters, whereby
the adenoviral promoter is different from the E4 promoter.
16. Adenovirus according to claims 14 or 15, whereby the adenoviral
promoter is the E1A promoter.
17. Adenovirus according to any of claims 6 to 16, characterised in
that the expression of the E1A protein is controlled by a promoter,
whereby the promoter is selected from the group comprising
tumor-specific promoters, organ-specific promoters, tissue-specific
promoters, heterologous promoters and adenoviral promoters, whereby
the adenoviral promoter is different from the E1A promoter.
18. Adenovirus according to any of claims 14 to 17, characterised
in that the promoter controlling the expression of the E1A protein
is YB-1 controlled or can be regulated by YB-1.
19. Adenovirus according to any of claims 14 to 18, characterised
in that the promoter controlling the expression of the E1A protein
is the adenoviral E2 late promoter.
20. Adenovirus according to any of claims 1 to 19, characterised in
that the E4 protein, preferably the E4orf6 protein, and the E1B
protein, preferably the E1B55 kd protein, are under the control of
the same or a common promoter.
21. Adenovirus, preferably an adenovirus according to any of claims
1 to 20, characterised in that the adenovirus provides YB-1 in the
nucleus through at least one adenoviral protein or that the
provision of YB-1 in the nucleus is mediated through at least one
adenoviral protein, whereby preferably the adenoviral protein is
different from E1A.
22. Adenovirus, preferably according to any of claims 1 to 21,
characterised in that the adenovirus provides YB-1 for adenoviral
replication through at least one adenoviral protein or mediates the
provision of YB-1 for adenoviral replication through at least one
adenoviral protein, whereby preferably the adenoviral protein is
different from E1A.
23. Adenovirus according to claim 21 or 22, characterised in that
the adenoviral protein is a complex of E4orf6 and E1B55 kd.
24. Adenovirus, preferably according to any of claims 1 to 23,
characterised in that the nucleic acid of the adenovirus comprises
at least one functionally inactive adenoviral region, whereby the
region is selected from the group comprising the E1 region, the E3
region, the E4 region and combinations thereof.
25. Adenovirus according to claim 24, characterised in that the
region is the E1 region.
26. Adenovirus according to claim 24 or 25, characterised in that
the region is the E3 region.
27. Adenovirus according to any of claims 24 to 26, characterised
in that the region is the E4 region.
28. Adenovirus according to any of claims 24 to 27, characterised
in that the region comprises the E1 region, the E3 region and the
E4 region.
29. Adenovirus, preferably an adenovirus according to any of claims
1 to 28, characterised in that the adenovirus comprises at least
one expression cassette, whereby the expression cassette comprises
at least one promoter and a nucleic acid coding for an adenoviral
protein, whereby the adenoviral protein is an E1B protein,
preferably an E1B55 kD protein.
30. Adenovirus according to claim 29, characterised in that the
promoter is different from the E1B promoter.
31. Adenovirus according to claim 30, characterised in that the
promoter is selected from the group comprising tumor-specific
promoters, organ-specific promoters, tissue-specific promoters,
heterologous promoters and adenoviral promoters, whereby the
promoter is different from the E1B promoter.
32. Adenovirus, preferably according to any of claims 1 to 31,
characterised in that the adenovirus comprises at least one
expression cassette, whereby the expression cassette comprises at
least one promoter and a nucleic acid coding for an adenoviral
protein, whereby the adenoviral protein is an E4 protein,
preferably an E4orf6 protein.
33. Adenovirus according to claim 32, characterised in that the
promoter is different from the E4 promoter.
34. Adenovirus according to claim 33, characterised in that the
promoter is selected from the group comprising tumor-specific
promoters, organ-specific promoters, tissue-specific promoters,
heterologous promoters and adenoviral promoters, whereby the
adenoviral promoters are different from the E4 promoter.
35. Adenovirus according to any of claims 29 to 34, characterised
in that the promoter is the E1A promoter.
36. Adenovirus, preferably according to any of claims 1 to 35,
characterised in that the adenovirus comprises at least one
expression cassette, whereby the expression cassette comprises at
least one promoter and a nucleic acid coding for an adenoviral
protein, whereby the adenoviral protein is an E1A protein,
preferably an E1A12S protein.
37. Adenovirus according to claim 36, characterised in that the
promoter is different from the E1A promoter.
38. Adenovirus according to claim 37, characterised in that the
promoter is selected from the group comprising tumor-specific
promoters, organ-specific promoters, tissue-specific promoters,
heterologous promoters and adenoviral promoters.
39. Adenovirus according to any of claims 1 to 38, characterised in
that the adenovirus comprises a nucleic acid, whereby the nucleic
acid codes for YB-1.
40. Adenovirus according to claim 39, characterised in that the
nucleic acid coding for YB-1 is under the control of a promoter,
whereby the promoter is preferably the E2 late promoter.
41. Adenovirus according to claim 39 or 40, characterised in that
the nucleic acid coding for YB-1 is under the control of a
promoter, whereby the promoter is YB-1 dependent and YB-1
controlled, respectively.
42. Adenovirus according to any of claims 35 to 41, characterised
in that the nucleic acid coding for YB-1 is part of the expression
cassette comprising a nucleic acid coding for an E1A protein,
preferably a nucleic acid coding for an E1A12S protein.
43. Adenovirus according to claim 42, characterised in that the
nucleic acid coding for the E1A protein is separated from the
nucleic acid coding for YB-1 through an IRES sequence.
44. Adenovirus according to any of claims 29 to 43, characterised
in that the nucleic acid coding for the E4 protein, preferably the
E4orf6 protein, and the nucleic acid coding for the E1B protein,
preferably the E1B55 kD protein, are contained in an expression
cassette, whereby preferably the two coding sequences are separated
through an IRES sequence.
45. Adenovirus according to claim 44, characterised in that the
promoter of the expression cassette is selected from the group
comprising tumor-specific promoters, organ-specific promoters,
tissue-specific promoters, heterologous promoters and adenoviral
promoters, whereby the adenoviral promoters are different from the
E4 promoter and different from the E1B promoter, preferably
different from the wildtype E4 promoter and different from the
wildtype E1B promoter.
46. Adenovirus according to any of claims 1 to 45, characterised in
that the adenovirus comprises an expression cassette comprising a
promoter and a nucleic acid sequence, whereby the nucleic acid
sequence is selected from the group comprising aptamers, ribozymes,
aptazymes, antisense molecules and siRNA.
47. Adenovirus according to any of claims 1 to 45, characterised in
that the adenovirus comprises an expression cassette comprising a
promoter and a nucleic acid sequence, whereby the nucleic acid
sequence is a coding nucleic acid, whereby the nucleic acid codes
for a molecule which is selected from the group comprising
peptides, polypeptides, proteins, anticalines, antibodies and
antibody fragments.
48. Adenovirus according to any of claims 1 to 45, characterised in
that the adenovirus comprises an expression cassette, whereby the
expression cassette comprises a promoter and a nucleic acid
sequence, whereby the nucleic acid sequence is selected from the
group comprising apoptosis inducing genes, prodrug genes, protease
inhibitors, tumor suppressor genes, cytokines and angiogenesis
inhibitors.
49. Adenovirus according to any of claims 1 to 48, characterised in
that the adenovirus is a recombinant adenovirus.
50. Adenovirus according to any of claims 1 to 49, characterised in
that the adenovirus is an adenovirus mutant.
51. Adenovirus according to any of claims 1 to 50, characterised in
that the adenovirus is replication deficient.
52. Adenovirus according to claim 51, characterised in that the
adenovirus is capable of replicating in cells comprising
deregulated YB-1 or having YB-1 in the nucleus.
53. Adenovirus according to claim 52, characterised in that the
cells contain YB-1 in the nucleus independent of the cell
cycle.
54. Nucleic acid coding for an adenovirus according to any of
claims 1 to 53.
55. Replication system comprising a nucleic acid according to claim
54 and a nucleic acid of a helper virus, whereby the nucleic acid
of the helper virus comprises one or more of the expression
cassettes of the adenovirus according to any of claims 1 to 53.
56. Replication system according to claim 55, characterised in that
the adenovirus or the nucleic acid coding therefor is lacking the
expression cassette comprised by the helper virus.
57. Vector comprising a nucleic acid according to claim 54 and/or a
replication system according to any of claims 55 to 56.
58. Vector according to claim 57, characterised in that the vector
is an expression vector.
59. Cell comprising an adenovirus according to any of claims 1 to
53 and/or a nucleic acid according to claim 54 and/or a replication
system according to claim 55 or 56 and/or a vector according to
claim 57 or 58.
60. Cell according to claim 59, characterised in that the cell is a
eucaryotic cell, preferably an animal cell, more preferably a
mammalian cell.
61. Cell according to claim 60, characterised in that the mammalian
cell is a cell selected from the group comprising cells of mice,
rats, guinea pigs, pigs, sheep, goats, cattle, horses, dogs, cats
and human beings.
62. Organism, preferably a mammal organism, comprising an
adenovirus according to any of claims 1 to 53, a nucleic acid
according to claim 54, a replication system according to claim 55
or 56, a vector according to any of claims 57 or 58 or a cell
according to any of claims 59 to 61, whereby the organism is
preferably selected from the group comprising mice, rats, guinea
pigs, pigs, sheep, goats, cattle, horses, dogs and cats.
63. Use of an adenovirus according to any of claims 1 to 53, a
nucleic acid according to claim 54, a replication system according
to claim 55 or 56, a vector according to any of claims 57 or 58, or
a cell according to any of claims 59 to 61, for replication of an
adenovirus, preferably for in vitro replication of an
adenovirus.
64. Use of an adenovirus according to any of claims 1 to 53, a
nucleic acid according to claim 54, a replication system according
to claim 55 or 56, a vector according to any of claims 57 or 58, or
a cell according to any of claims 59 to 61 for the manufacture of
an adenovirus, preferably for in vitro manufacture of an
adenovirus.
65. Use of an adenovirus according to any of claims 1 to 53, a
nucleic acid according to claim 54, a replication system according
to claim 55 or 56, a vector according to any of claims 57 or 58, or
a cell according to any of claims 59 to 61 for the expression of
genes, preferably of genes which promote cell lysis, preferably
cell lysis during adenoviral replication, and/or are promoting
adenoviral mediated cell lysis.
66. Use of an adenovirus according to any of claims 1 to 53, a
nucleic acid according to claim 54, a replication system according
to claim 55 or 56, a vector according to any of claims 57 or 58, or
a cell according to any of claims 59 to 61 for the manufacture of a
medicament.
67. Use according to any of claims 63 to 66, characterised in that
the cell in which the adenovirus replicates, has YB-1 in its
nucleus, preferably has YB-1 in its nucleus independent of the cell
cycle.
68. Use according to any of claims 63 to 66, characterised in that
the cell in which the adenovirus replicates, comprises deregulated
YB-1.
69. Use according to claim 66, characterised in that the medicament
is for the treatment of tumor diseases.
70. Use according to claim 69, characterised in that the tumor
disease is selected from the group comprising malignant diseases,
cancer, cancer diseases and tumors.
71. Use according to claim 70, characterised in that the tumors are
selected from the group comprising solid, non-solid, malignant and
benign tumors.
72. Use according to any of claims 69 to 71, characterised in that
at least one part of the tumor forming cells have YB-1 in the
nucleus, preferably have YB-1 in the nucleus independent of the
cell cycle.
73. Use according to any of claims 69 to 72, characterised in that
at least a part of the cells forming the tumor comprises
deregulated YB-1.
74. Use according to any of claims 69 to 73, characterised in that
at least a part of the cells forming the tumor are Rb positive or
Rb negative.
75. Use according to any of claims 69 to 73, characterised in that
at least a part of the cells forming the tumor have a resistance,
preferably a multiple resistance against pharmaceutically active
agents.
76. Use according to claim 75, characterised in that the resistance
is a multiple resistance.
77. Use according to any of claims 75 or 76, characterised in that
the resistance is against anti-tumor agents, preferably
cytostatics, and/or that the resistance is caused by
irradiation.
77. Use according to any of claims 69 to 76, characterised in that
the patient for which the medicament is intended, comprises a
plurality of cells, whereby the cells are cells as described in any
of claims 72 to 76.
78. Use according to any of claims 69 to 77, characterised in that
the medicament comprises at least one further pharmaceutically
active agent.
79. Use according to any of claims 68 to 77, characterised in that
the medicament is administered together with a further
pharmaceutically active agent or is intended therefor.
80. Use according to claim 78 or 79, characterised in that the
further pharmaceutically active agent is selected from the group
comprising cytokines, metalloproteinase inhibitors, angiogenesis
inhibitors, cytostatics, tyrosine kinase inhibitors, cell cycle
inhibitors, proteosome inhibitors, inhibitors of the signal
transduction cascade, protein kinases and recombinant
antibodies.
81. Use according to any of claims 69 to 77, characterised in that
the medicament is administered prior, during or after
irradiation.
82. Use according to claim 81, characterised in that the radiation
is administered for the purpose of treating a tumor.
83. Use according to any of claims 69 to 82, characterised in that
the cell or the organism to be treated is subject to a measure,
whereby the measure is selected from the group comprising
irradiation, administration of cytostatics and hyperthermia.
84. Use according to any of claims 69 to 83, characterised in that
the measure is applied locally or systemically.
85. Use according to any of the preceding claims, characterised in
that the irradiation uses high-energy radiation, preferably uses
any irradiation as used in the treatment of tumor diseases.
86. Use of an adenovirus according to any of claims 1 to 53, a
nucleic acid according to claim 54, a replication system according
to claim 55 or 56, a vector according to any of claims 57 or 58, or
a cell according to any of claims 59 to 61 for the manufacture of a
medicament for the treatment of tumor diseases, characterised in
that the tumor disease is selected from the group comprising breast
tumors, bone tumors, gastric tumors, intestinal tumors,
gall-bladder tumors, pancreas tumors, liver tumors, kidney tumors,
brain tumors, ovarian tumors, skin tumors, tumors of cutaneous
appendages, head and neck cancer, uterine tumors, synovial tumors,
laryngeal tumors, oesophageal tumors, lingual tumors, prostate
tumors, preferably one of the preceding tumor diseases having the
characteristics as described in any of the preceding claims.
87. Use of an adenovirus according to any of claims 1 to 53, a
nucleic acid according to claim 54, a replication system according
to claim 55 or 56, a vector according to any of claims 57 or 58, or
a cell according to any of claims 59 to 61 for the manufacture of
medicament for the treatment of tumor diseases, whereby the
tumor-specific promoter is a promoter which is specific for the
tumor for which the medicament is used.
88. Pharmaceutical composition comprising an adenovirus according
to any of claims 1 to 53, a nucleic acid according to claim 54, a
replication system according to claim 55 or 56, a vector according
to any of claims 57 or 58, or a cell according to any of claims 59
to 61 and optionally a pharmaceutically acceptable carrier.
89. Use according to any of the preceding claims, characterised in
that the medicament comprises a combination of at least two agents,
whereby each agent is individually and independently selected from
the group comprising cytostatics.
90. Use according to claim 89, characterized in that at least two
of the agetns address different target molecules.
91. Use according to claim 90, characterized in that at least two
of the agents are active by a different mode of action.
92. Use according to any of claims 89 to 91, characterized in that
at least one agent increases the abilitiy of a cell to be infected,
whereby the virus replicates in such cell.
93. Use according to any of claims 89 to 92, characterized in that
at least one agent influences the availability of a component of
the cell, preferably increases the availability of the component,
whereby the component mediates the uptake of the virus.
94. Use according to any of claims 89 to 93, characterized in that
at least one agent mediates the transport of YB-1 into the nucleus,
preferably increases said transport.
95. Use according to any of claims 89 to 94, characterized in that
at least one agent is a histone deacylase inhibitor.
96. Use according to claim 95, characterized in that the histone
deacylase inhibitor is selected from the group comprising
Trichostatin A, FR 901228, MS-27-275, NVP-LAQ824, PXD101 Apicidin
and Scriptaid.
97. Use according to any of claims 89 to 95, characterized in that
at least one agent is selected from the group comprising
Trichostatin A, FR 901228, MS-27-275, NVP-LAQ824, PXD101, Apicidin
and Scriptaid.
98. Use according to any of claims 89 to 97, characterized in that
at least one agent is a topoisomerase inhibitor.
99. Use according to claims 98, characterized in that the
topoisomerase inhibitor is selected from the group comprising
Camptothecin, Irinotecan, Topotecan, DX-8951f, SN-38,
9-aminocamptothecin, 9-nitrocamptothecin, Daunorubicn and
Etoposid.
100. Use according to any of the proceeding claims, characterized
in that the agent comprises Trichostatin A and Irinotecan.
101. Use according to any of the proceeding claims, characterized
in that the virus, in particular the virus according to any of the
proceeding claims, is separated from the at least two agents.
102. Use according to claim 68, characterized in that at least one
unit dosis of the virus is separated from at least one unit dosis
of one or the at least two agents.
103. Kit comprising a virus, preferably a virus according to any of
the proceeding claims, and at least two agents, whereby any agent
is individually and independently selected from the group
comprising cytostatics.
Description
[0001] The invention is related to adenoviruses, nucleic acids
coding therefor and use thereof, in particular for the manufacture
of a medicament for the treatment of tumors.
[0002] A number of therapeutic concepts are currently used in the
treatment of tumors. Apart from using surgery, chemotherapy and
radiotherapy are predominant. All these techniques are, however,
associated with considerable side effects. The use of replication
selective oncolytic viruses provides for a new platform for the
treatment of tumors. In connection therewith a selective intratumor
replication of a viral agent is initiated which results in virus
replication, lysis of the infected tumor cell and spreading of the
virus to adjacent tumor cells. As the replication capabilities of
the virus is limited to tumor cells, normal tissue is spared from
replication and thus from lysis by the virus.
[0003] For the time being, several viral systems are subject to
clinic trials aiming at tumor lysis. One example for such an
adenovirus is dl1520 (Onyx-015) which has been successfully used in
clinical phases I and II (Khuri, F. et al. Nature Medicine 6,
879-885, 2000). Onyx-015 is an adenovirus having a completely
deleted E1B-55 kDa gene. The complete deletion of the E1B55 kDa
protein of the adenovirus is based on the discovery that
replication and thus lysis of cells is possible with an adenoviral
vector which have a p53 deficiency (Kirn, D. et al., Proc. Am. Soc.
Clin. Oncol. 17, 391a, 1998), whereby normal cells are not harmed.
More particularly, the E1B-55 kDa gene product is involved in the
inhibition of p53, the transport of viral mRNA and the switching
off of the protein synthesis of the host cell. The inhibition of
p53 occurs via formation of a complex consisting of p53 and the
adenoviral encoded E1B-55 kDa protein and/or a complex consisting
of E1B-55 kDa and E4orf6. p53, coded by TP53, is the starting point
for a complex regulatory mechanism (Zambetti, G. P. et al., FASEB
J. 7, 855-865, 1993), which results, among others, in an efficient
inhibition of the cellular replication of viruses like adenovirus.
The gene TP 53 is deleted or mutated in about 50% of all human
tumors which results in the absence of--desired--apoptosis due to
chemotherapy or radiation therapy resulting in an usually
unsuccessful tumor treatment.
[0004] A further concept of tumorlytic adenoviruses is based on the
discovery that if the E1A protein is present in a specific deleted
form or comprises one or several mutations, which do not affect the
binding of Rb/E2F and/or p107/E2F and/or p130/E2F, such adenovirus
will not induce the entry of the infected cells into the S phase
and will be capable of replicating in tumor cells which do not have
a functional Rb protein. Additionally, the E1A protein can be
deleted at the N-terminus and comprise one or several mutations in
the region of amino acid positions 1 to 76 of the E1A proteins,
respectively, in order to inhibit the binding of E1A to p300 and
thus to provide for a more selective replication in tumor cells.
These approaches are described in an exemplary manner in European
patent EP 0 931 830. Examples for such viruses are Ad.DELTA.24,
dl922-947, E1Ad/01/07 and CB016 (Howe, J. A. et al., Molecular
Therapy 2, 485-495, 2000; Fueyo, J. et al., Oncogene 19, 2-12,
2000; Heise, C. et al., Nature Medicine 6, 11341139, 2001; Balague,
C. et al., J. Virol. 75, 7602-7611, 2001). These adenoviral systems
for oncolysis known in the prior art thus comprise distinct
deletions in the E1A protein, whereby such deletions had been made
under the assumption that a functional Rb protein and complexes
consisting of inactive Rb protein and E2F, respectively, would
block an efficient in vivo replication and in order to provide an
adenoviral replication in vivo in Rb-negative/mutated cells only.
These adenoviral systems according to the prior art are based on
E1A in order to control in vivo replication by means of the early
E2 promoter (engl. E2 early promoter) and free E2F (Dyson, N. Genes
& Development, 12, 2245-2262, 1998).
[0005] A further form of tumorlytic adenoviral systems is based on
the use of selective promoters for specifically expressing the
viral oncogene E1A which provides for a selective replication in
tumor cells (Rodriguez, R. et al., Cancer Res. 57, 2559-2563,
1997).
[0006] As described above, the selection of a cellular background
which is appropriate for the respective concept underlying the mode
of action is important for the various concepts of adenoviral
tumorlytic viruses. In other words, the various adenoviral systems
currently known may only be used if distinct molecular biological
prerequisites are realized. This limits the use of such systems to
distinct patient groups.
[0007] A particular problem in the treatment of tumor diseases
arises once the patients develop a so-called multidrug resistance
(engl. multidrug resistance (MDR)) which represents a particularly
well studied form of resistance of tumors against cytostatics
(Gottesman and Pastan, Annu. Rev. Biochem. 62, 385-427, 1993). It
is based on the overexpression of the membrane-bound transport
protein P-glycoprotein which belongs to the so-called ABC
transporters (Stein, U. et al., JBC 276, 28562-69, 2001, J.
Wijnholds, Novartis Found Symp., 243, 69-79, 2002). Bargou, R. C.
et al. and Oda, Y. et al (Bargou, R. C. et al., Nature Medicine 3,
447-450, 1997; Clin. Cancer Res. 4, 2273-2277, 1998) were able to
show that nuclear localisation of the human transcription factor
YB-1 is directly involved in the activation of the expression of
the P-glycoprotein. Further studies confirmed that YB-1 is
transported into the nucleus by various stress conditions such as
UV irradiation, administration of cytostatics (Koike, K. et al.,
FEBS Lett 17, 390-394, 1997) and hyperthermia (Stein, U. et al.,
JBC 276, 28562-69, 2001). Further studies confirmed that the
nuclear localisation of YB-1 has an impact on one further ABC
transporter. This ABC transporter is referred to as MRP (engl.
multidrug resistance-related protein) and is involved in the
formation of the so-called atypical non-P-glycoprotein dependent
multidrug resistance (Stein, U. et al., JBC 276, 28562-69,
2001).
[0008] The problem underlying the present invention is to provide a
technical teaching and in particular a means which allows to treat
an organism, more particularly a human organism and a group of
patients, respectively, specifically with tumorlytically active
agents. It is a further problem underlying the present invention to
provide a means which is suitable to cause tumorlysis in patients
having tumor diseases which are resistant to cytostatics,
particularly those which have a multidrug resistance. Finally, a
problem underlying the present invention is to provide for an
adenovirus which is suitable for cell lysis.
[0009] In a first aspect the problem underlying the invention is
solved by an adenovirus expressing a first protein which is
selected from the group comprising an E1B protein and an E4
protein, prior to a second protein which is selected from the group
comprising an E1A-protein.
[0010] In an embodiment the first protein is an E1B protein,
preferably an E1B55 kd protein.
[0011] In a further embodiment the first protein is an E4 protein,
preferably an E4orf6 protein.
[0012] In a preferred embodiment the first protein is a combination
of E1B protein and E4 protein, preferably a combination of E1B55 kD
protein and E4orf6 protein.
[0013] In a preferred embodiment the E1A protein is an E1A12S
protein. In an alternative embodiment the E1A protein is the E1A
protein of the wildtype adenovirus, preferably of Ad 5, or the E1A
of adenovirus delta 24.
[0014] In a second aspect the problem underlying the invention is
solved by an adenovirus, whereby the adenovirus comprises at least
one nucleic acid coding for a protein which is selected from the
group comprising E1B proteins, E4 proteins and E1A proteins,
whereby the at least one protein is under the control of a promoter
which is different from the promoter controlling the expression of
the protein in a wildtype adenovirus.
[0015] In an embodiment of the second aspect the adenovirus is an
adenovirus according to the first aspect of the present
invention.
[0016] In an embodiment of the second aspect the at least one
protein is an E1B protein, preferably an E1B55 kD protein.
[0017] In an embodiment of the second aspect the at least one
protein is an E4 protein, preferably an E4orf6 protein.
[0018] In an embodiment of the second aspect the at least one
protein is an E1A protein, preferably an E1A12S protein. In a
particularly preferred embodiment the E1A12S protein is a E1A12S
protein of Ad5, preferably of wildtype Ad5, or a E1A12S protein of
adenovirus delta 24.
[0019] In an embodiment of the second aspect the at least one
protein is a combination of E1B protein and E4 protein, preferably
a combination of E1B55 kD protein and E4orf6 protein.
[0020] In an embodiment of the second aspect the at least one
protein is a combination of E1B protein and E1A protein, preferably
a combination of E1B55 kD protein and E1A12S protein.
[0021] In a preferred embodiment of the second aspect the at least
one protein is a combination of E4 protein and E1A protein,
preferably a combination of E4orf6 protein and E1A12S protein.
[0022] In an embodiment of the second aspect the at least one
protein is a combination of E1B protein, E4 protein and E1A
protein, preferably a combination of E1B55 kD protein, E4orf6
protein and E1A12S protein.
[0023] In an embodiment of the second aspect the expression of the
E1B protein is controlled by a promoter, whereby the promoter is
selected from the group comprising tumor-specific promoters,
organ-specific promoters, tissue-specific promoters, heterologous
promoters and adenoviral promoters, whereby the adenoviral promoter
is different from the E1B promoter.
[0024] In an embodiment of the second aspect the expression of the
E4 protein is controlled by a promoter, whereby the promoter is
selected from the group comprising tumor-specific promoters,
organ-specific promoters, tissue-specific promoters, heterologous
promoters and adenoviral promoters, whereby the adenoviral promoter
is different from the E4 promoter.
[0025] In a preferred embodiment of the second aspect the
adenoviral promoter is the E1A promoter.
[0026] In an embodiment of the second aspect the expression of the
E1A protein is controlled by a promoter, whereby the promoter is
selected from the group comprising tumor-specific promoters,
organ-specific promoters, tissue-specific promoters, heterologous
promoters and adenoviral promoters, whereby the adenoviral promoter
is different from the E1A promoter.
[0027] In a preferred embodiment of the second aspect the promoter
controlling the expression of the E1A protein is YB-1 controlled or
can be regulated by YB-1.
[0028] In a preferred embodiment of the second aspect the promoter
controlling the expression of the E1A protein is the adenoviral E2
late promoter.
[0029] In an embodiment of the first and second aspect the E4
protein, preferably the E4orf6 protein, and the E1B protein,
preferably the E1B55 kd protein, are under the control of the same
or a mutual promoter.
[0030] In a third aspect the problem underlying the invention is
solved by an adenovirus, whereby the adenovirus provides YB-1 in
the nucleus through at least one adenoviral protein or that the
provision of YB-1 in the nucleus is mediated through at least one
adenoviral protein, whereby preferably the adenoviral protein is
different from E1A.
[0031] In an embodiment of the third aspect, the adenovirus is an
adenovirus according to the first and/or second aspect of the
present invention.
[0032] In a fourth aspect the problem underlying the invention is
solved by an adenovirus, whereby the adenovirus provides YB-1 for
adenoviral replication through at least one adenoviral protein or
mediates the provision of YB-1 for adenoviral replication through
at least one adenoviral protein, whereby preferably the adenoviral
protein is different from E1A.
[0033] In an embodiment of the fourth aspect, the adenovirus us an
adenovirus according to the first and/or second and/or third aspect
of the present invention.
[0034] In an embodiment of the third and the fourth aspect, the
adenoviral protein is a complex of E4orf6 and E1B55 kd.
[0035] In a fifth aspect the problem underlying the invention is
solved by an adenovirus, whereby the nucleic acid of the adenovirus
comprises at least one functionally inactive adenoviral region,
whereby the region is selected from the group comprising the E1
region, the E3 region, the E4 region and combinations thereof.
[0036] In an embodiment of the fifth aspect the adenovirus is an
adenovirus in accordance with the first and/or second and/or third
and/or fourth aspect of the present invention.
[0037] In an embodiment of the fifith aspect the region is the E1
region.
[0038] In an embodiment of the fifth aspect the region is the E3
region.
[0039] In an embodiment of the fifth aspect the region is the E4
region.
[0040] In an embodiment of the fifth aspect the region comprises
the E1 region, the E3 region and the E4 region.
[0041] In a sixth aspect the problem underlying the invention is
solved by an adenovirus, whereby the adenovirus comprises at least
one expression cassette, whereby the expression cassette comprises
at least one promoter and a nucleic acid coding for an adenoviral
protein, whereby the adenoviral protein is an E1B protein,
preferably an E1B55 kD protein.
[0042] In an embodiment of the sixth aspect the adenovirus is an
adenovirus according to the first and/or second and/or third and/or
fourth and/or fifth aspect of the present invention.
[0043] In an embodiment of the sixth aspect the promoter is
different from the E1B promoter.
[0044] In an embodiment of the sixth aspect the promoter is
selected from the group comprising tumor-specific promoters,
organ-specific promoters, tissue-specific promoters, heterologous
promoters and adenoviral promoters, whereby the promoter is
different from the E1B promoter.
[0045] In a seventh aspect the problem underlying the invention is
solved by an adenovirus, whereby the adenovirus comprises at least
one expression cassette, whereby the expression cassette comprises
at least one promoter and a nucleic acid coding for an adenoviral
protein, whereby the adenoviral protein is an E4 protein,
preferably an E4orf6 protein.
[0046] In an embodiment of the seventh aspect the adenovirus is an
adenovirus according to the first and/or second and/or third and/or
fourth and/or fifth and/or sixth aspect of the present
invention.
[0047] In an embodiment of the seventh aspect the promoter is
selected from the group comprising tumor-specific promoters,
organ-specific promoters, tissue-specific promoters, heterologous
promoters and adenoviral promoters, whereby the adenoviral
promoters are different from the E4 promoter.
[0048] In an embodiment of the seventh aspect the promoter is the
E1A promoter.
[0049] In an eighth aspect the problem underlying the invention is
solved by an adenovirus, whereby the adenovirus comprises at least
one expression cassette, whereby the expression cassette comprises
at least one promoter and a nucleic acid coding for an adenoviral
protein, whereby the adenoviral protein is an E1A protein,
preferably an E1A12S protein.
[0050] In an embodiment of the eighth aspect, the adenovirus is an
adenovirus according to the first and/or second and/or third and/or
fourth and/or fifth and/or sixth and/or seventh aspect of the
present invention.
[0051] In an embodiment of the eighth aspect the promoter is
different from the E1A promoter.
[0052] In an embodiment of the eighth aspect the promoter is
selected from the group comprising tumor-specific promoters,
organ-specific promoters, tissue-specific promoters, heterologous
promoters and adenoviral promoters.
[0053] In an embodiment of the first and/or second and/or third
and/or fourth and/or fifth and/or sixth and/or seventh and/or
eighth aspect the adenovirus comprises a nucleic acid, whereby the
nucleic acid codes for YB-1.
[0054] In a preferred embodiment of the eighth aspect the nucleic
acid coding for YB-1 is under the control of a promoter, whereby
the promoter is preferably the E2 late promoter.
[0055] In an embodiment of the eighth aspect the nucleic acid
coding for YB-1 is under the control of a promoter, whereby the
promoter is YB-1 dependent and YB-1 controlled, respectively.
[0056] In an embodiment of the eighth aspect the nucleic acid
coding for YB-1 is part of the expression cassette comprising a
nucleic acid coding for an E1A protein, preferably a nucleic acid
coding for an E1A12S protein.
[0057] In an embodiment of the eighth aspect the nucleic acid
coding for the E1A protein is separated from the nucleic acid
coding for YB-1 through an IRES sequence.
[0058] In an embodiment of the sixth and/or seventh and/or eighth
aspect the nucleic acid coding for the E4 protein, preferably the
E4orf6 protein, and the nucleic acid coding for the E1B protein,
preferably the E1B55 kD protein, are contained in an expression
cassette, whereby preferably the two coding sequences are separated
through an IRES sequence.
[0059] In a preferred embodiment of the eighth aspect the promoter
of the expression cassette is selected from the group comprising
tumor-specific promoters, organ-specific promoters, tissue-specific
promoters, heterologous promoters and adenoviral promoters, whereby
the adenoviral promoters are different from the E4 promoter and
different from the E1B promoter, preferably different from the
wildtype E4 promoter and different from the wildtype E1B
promoter.
[0060] In an embodiment of the first and/or second and/or third
and/or fourth and/or fifth and/or sixth and/or seventh and/or
eighth aspect the adenovirus comprises an expression cassette
comprising a promoter and a nucleic acid sequence, whereby the
nucleic acid sequence is selected from the group comprising
aptamers, ribozymes, aptazymes, antisense molecules and siRNA.
[0061] In an embodiment of the first and/or second and/or third
and/or fourth and/or fifth and/or sixth and/or seventh and/or
eighth aspect the adenovirus comprises an expression cassette
comprising a promoter and a nucleic acid sequence, whereby the
nucleic acid sequence is a coding nucleic acid, whereby the nucleic
acid codes for a molecule which is selected from the group
comprising peptides, polypeptides, proteins, anticalines,
antibodies and antibody fragments.
[0062] In an embodiment of the first and/or second and/or third
and/or fourth and/or fifth and/or sixth and/or seventh and/or
eighth aspect the adenovirus comprises an expression cassette,
whereby the expression cassette comprises a promoter and a nucleic
acid sequence, whereby the nucleic acid sequence is selected from
the group comprising apoptosis inducing genes, prodrug genes,
protease inhibitors, tumor suppressor genes, cytokines and
angiogenesis inhibitors.
[0063] In an embodiment of the first and/or second and/or third
and/or fourth and/or fifth and/or sixth and/or seventh and/or
eighth aspect the adenovirus is a recombinant adenovirus.
[0064] In an embodiment of the first and/or second and/or third
and/or fourth and/or fifth and/or sixth and/or seventh and/or
eighth aspect the adenovirus is an adenovirus mutant.
[0065] In an embodiment of the first and/or second and/or third
and/or fourth and/or fifth and/or sixth and/or seventh and/or
eighth aspect the adenovirus is replication deficient.
[0066] In an embodiment of the first and/or second and/or third
and/or fourth and/or fifth and/or sixth and/or seventh and/or
eighth aspect the adenovirus is capable of replicating in cells
comprising deregulated YB-1 or having YB-1 in the nucleus.
[0067] In an embodiment of the first and/or second and/or third
and/or fourth and/or fifth and/or sixth and/or seventh and/or
eighth aspect the cells contain YB-1 in the nucleus independent of
the cell cycle.
[0068] In an embodiment of the first and/or second and/or third
and/or fourth and/or fifth and/or sixth and/or seventh and/or
eighth aspect the adenovirus does not comprise any E1A13S protein
and/or the adenovirus does not comprise any nucleic acid coding for
a E1A13S protein.
[0069] In a ninth aspect the problem underlying the invention is
solved by a nucleic acid coding for an adenovirus according to any
of the aspects one to eight.
[0070] In a tenth aspect the problem underlying the invention is
solved by replication system comprising a nucleic acid according to
the ninth aspect and a nucleic acid of a helper virus, whereby the
nucleic acid of the helper virus comprises one or more of the
expression cassettes of the adenovirus according to any of the
aspects one to eight.
[0071] In an embodiment of the tenth aspect the adenovirus or the
nucleic acid coding therefor is lacking the expression cassette
comprised by the helper virus.
[0072] In an eleventh aspect the problem underlying the invention
is solved by a vector comprising a nucleic acid according to the
ninth aspect and/or a replication system according to the tenth
aspect.
[0073] In an embodiment of the eleventh aspect the vector is an
expression vector.
[0074] In a twelfth aspect the problem underlying the invention is
solved by an adenovirus ell comprising an adenovirus according to
any of aspects one to eight and/or a nucleic acid according to the
ninth aspect and/or a replication system according to the tenth
aspect and/or a vector according to the eleventh aspect.
[0075] In an embodiment of the twelfth aspect the cell is a
eucaryotic cell, preferably an animal cell, more preferably a
mammalian cell.
[0076] In a preferred embodiment of the twelfth aspect the
mammalian cell is a cell selected from the group comprising cells
of mice, rats, guinea pigs, pigs, sheep, goats, cattle, horses,
dogs, cats and human beings.
[0077] In a thirteenth aspect the problem underlying the invention
is solved by an organism, preferably a mammal organism, comprising
an adenovirus according to aspect one to eighth, a nucleic acid
according to the ninth aspect, a replication system according to
the tenth aspect, a vector according to the eighth aspect or a cell
according to the twelfth aspect, whereby the organism is preferably
selected from the group comprising mice, rats, guinea pigs, pigs,
sheep, goats, cattle, horses, dogs and cats.
[0078] In a fourteenth aspect the problem underlying the invention
is solved by the use of an adenovirus according to any of the
aspects one to eighth, a nucleic acid according to the ninth
aspect, a replication system according to the tenth aspect, a
vector according to the eighth aspect, or a cell according to the
twelfth aspect, for replication of an adenovirus, preferably for in
vitro replication of an adenovirus.
[0079] In a fifteenth aspect the problem underlying the invention
is solved by the use of an adenovirus according to any of aspects
one to eighth, a nucleic acid according to the ninth aspect, a
replication system according to the tenth aspect, a vector
according to the eight aspect, or a cell according to the twelfth
aspect for the manufacture of an adenovirus, preferably for in
vitro manufacture of an adenovirus.
[0080] In a sixteenth aspect the problem underlying the invention
is solved by the use of an adenovirus according to any of aspects
one to eight, a nucleic acid according to the ninth aspect, a
replication system according to the tenth aspect, a vector
according to the eighth aspect, or a cell according to any the
twelfth aspect for the expression of genes, preferably of genes
which promote cell lysis, preferably cell lysis during adenoviral
replication, and/or are promoting adenoviral mediated cell
lysis.
[0081] In an embodiment of the sixteenth aspect the expressed genes
are transgenes as disclosed herein.
[0082] In a seventeenth aspect the problem underlying the invention
is solved by the use of an adenovirus according to any of aspects
one to eight, a nucleic acid according to the ninth aspect, a
replication system according to the tenth aspect, a vector
according to the eighth aspect, or a cell according to the twelfth
aspect for the manufacture of a medicament.
[0083] In an embodiment of the fourteenth to the seventeenth aspect
the cell in which the adenovirus replicates, has YB-1 in its
nucleus, preferably has YB-1 in its nucleus independent of the cell
cycle.
[0084] In an embodiment of the fourteenth to the seventeenth aspect
the cell in which the adenovirus replicates, comprises deregulated
YB-1.
[0085] In an embodiment of the use of the seventeenth aspect the
medicament is for the treatment of tumor diseases.
[0086] In a preferred embodiment of the use of the seventeenth
aspect the tumor disease is selected from the group comprising
malignant diseases, cancer, cancer diseases and tumors.
[0087] In an embodiment of the use of the seventeenth aspect the
tumors are selected from the group comprising solids, non-solid,
malignant and benign tumors.
[0088] In an embodiment of the use of the seventeenth aspect at
least a part of the tumor forming cells have YB-1 in the nucleus,
preferably have YB-1 in the nucleus independent of the cell
cycle.
[0089] In an embodiment of the use of the seventeenth aspect at
least a part of the cells forming the tumor comprises deregulated
YB-1.
[0090] In an embodiment of the use of the seventeenth aspect at
least a part of the cells forming the tumor are Rb positive or Rb
negative.
[0091] In an embodiment of the use of the seventeenth aspect at
least a part of the cells forming the tumor have a resistance,
preferably a multiple resistance against pharmaceutically active
agents.
[0092] In a preferred embodiment of the use of the seventeenth
aspect the resistance is a multiple resistance.
[0093] In an embodiment of the use of the seventeenth aspect the
resistance is against anti-tumor agents, preferably cytostatics,
and/or that the resistance is caused by irradiation.
[0094] In an embodiment of the use of the seventeenth aspect the
patient for which the medicament is intended, comprises a plurality
of cells, whereby the cells are cells as described in the various
embodiments of the use according to the seventeenth aspect of the
present invention.
[0095] In an embodiment of the use of the seventeenth aspect the
medicament comprises at least one further pharmaceutically active
agent.
[0096] In an embodiment of the use of the seventeenth aspect the
medicament is administered together with a further pharmaceutically
active agent or is intended therefor.
[0097] In an embodiment of the use of the seventeenth aspect the
further pharmaceutically active agent is selected from the group
comprising cytokines, metalloproteinase inhibitors, angiogenesis
inhibitors, cytostatics such as Irinotecan and CPT-11 against
colorectal carcinoma and Daunorubicin against leukemia, cell cycle
inhibitors such as CYC202 which inhibits CDK2/CyclinE kinase
activity and can be used against colorectal tumors (McClue S J,
Int. J. Cancer 2002, 102, 463-468) and BAY 43-9006 which inhibits
Raf-1 and is, for example, effective against mamma carcinoma
(Wilhelm S M et al., Cancer Res. 2004, 64, 7099-7109), proteosome
inhibitors such as PS-341 which inhibits the 26S proteasome
activity and is used against squamous-cell carcinoma (Fribley A et
al., Mol Cell Biol 2004 November; 24(22): 9695-704), recombinant
antibodies such as against the EGF receptor (Herceptin for breast
carcinoma and prostate tumor; H. G. van der Poel, European Urology
2004, 1-17; Erbitux against head and neck tumors; Bauman M et al.,
Radiother. Oncol., 2004, 72, 257-266), and inhibitors of the signal
transduction cascade such as STI 571 which represses, among others,
c-kit and can be used against gastrointestinal tumors (H. G. van
der Poel, European Urology 2004, 45, 1-17), ABT-627, an endothelin
inhibitor, which may be used, among others, against prostate tumors
(H. G. van der Poel, European Urology 2004, 45, 1-17), SU5416 which
inhibits phosphorylation of the VEGF tyrosine kinase receptor and
which may be used, among others, against glioblastoma and prostate
cancer (Bischof M et al Int. J. Radiat. Oncol. Biol. Phys. 2004; 60
(4): 1220-32), ZD1839 which inhibits EGFR tyrosine activity and may
be used, among others, against prostate tumors (H. G. van der Poel,
European Urology 2004, 45, 1-17); rapamycin derivatives such as
CCI-779 and RAD001 which inhibit mTOR and can be used against
prostate tumors. It is within the present invention that the
various adenoviruses described herein and the adenoviruses to be
used in accordance with the present invention, respectively, can,
in principle, be used with each and any of the aforementioned
compounds for each and any of the indication described herein in
connection therewith. In a particularly preferred embodiment the
indication is the one which is described for any of the previously
mentioned pharmaceutically active compounds.
[0098] In an embodiment of the use of the seventeenth aspect the
medicament is administered prior, during or after irradiation.
[0099] In a preferred embodiment of the use of the seventeenth
aspect the radiation is administered for the purpose of treating a
tumor.
[0100] In an embodiment of the use of the seventeenth aspect the
cell or the organism to be treated is subject to a measure, whereby
the measure is selected from the group comprising irradiation,
administration of cytostatics and hyperthermia.
[0101] In an embodiment of the use of the seventeenth aspect the
measure is applied locally or systemically.
[0102] In an embodiment of the use of the seventeenth aspect the
irradiation uses high-energy radiation, preferably uses any
irradiation as used in the treatment of tumor diseases.
[0103] In an eighteenth aspect the problem underlying the invention
is solved by the use of an adenovirus according to any of the
aspects one to eight, a nucleic acid according to the ninth aspect,
a replication system according to the tenth aspect, a vector
according to the eleventh aspect, or a cell according to the
twelfth aspect for the manufacture of a medicament for the
treatment of tumor diseases, characterised in that the tumor
disease is selected from the group comprising breast tumors, bone
tumors, gastric tumors, intestinal tumors, gall-bladder tumors,
pancreas tumors, liver tumors, kidney tumors, brain tumors, ovarian
tumors, skin tumors, tumors of cutaneous appendages, head and neck
cancer, uterine tumors, synovial tumors, laryngeal tumors,
oesophageal tumors, lingual tumors, prostate tumors, preferably one
of the preceding tumor diseases having the characteristics as
described in any of the preceding claims.
[0104] In a nineteenth aspect the problem underlying the invention
is solved by the use of an adenovirus according to any of the
aspects one to eight, a nucleic acid according to the ninth aspect,
a replication system according to the tenth aspect, a vector
according to the eleventh aspect, or a cell according to the
twelfth aspect for the manufacture of medicament for the treatment
of tumor diseases, whereby the tumor-specific promoter is a
promoter which is specific for the tumor for which the medicament
is used.
[0105] In a twentieth aspect the problem underlying the invention
is solved by a pharmaceutical composition comprising an adenovirus
according to any of the aspects one to eight, a nucleic acid
according to the ninth aspect, a replication system according to
the tenth aspect, a vector according to the eleventh aspect, or a
cell according to the twelfth aspect and optionally a
pharmaceutically acceptable carrier.
[0106] In a twenty-first aspect the problem underlying the present
invention is solved by the use of a virus, preferably an
adenovirus, for the manufacture of a medicament, whereby the virus
is replication deficient in normal cells which do not contain YB-1
in the nucleus, in cells which do not contain YB-1 in the nucleus
independent of the cell cycle, and in cells which do not contain
deregulated YB-1, respectively, and the virus codes for an oncogene
or oncogene product, in particular an oncogene protein which at
least transactivates one viral gene in YB-1 nucleus positive cells,
preferably an adenoviral gene, whereby the gene is selected from
the group comprising E1B55 kDa, E4orf6, E4 orf3 and E3ADP.
Preferably, the virus expresses the viral proteins E1B55 kD, which
is also referred to herein as E1B55 kDa, and E4orf6.
[0107] In a twenty-second aspect the problem underlying the
invention is solved by the use of a virus, preferably an
adenovirus, for replication in cells, which contain YB-1 in the
nucleus, whereby the virus is replication deficient in cells which
do not contain YB-1 in the nucleus, or cells which do not contain
YB-1 in the nucleus independent of the cell cycle, or cells which
do not contain any deregulated YB-1, and whereby the virus codes
for an oncogene or an oncogene product, in particular an oncogene
protein, which transactivates at least one viral gene, preferably
an adenoviral gene, whereby the gene is selected from the group
comprising E1B55 kDa, E4orf6, E4orf3 and E3ADP.
[0108] In an embodiment of the uses in accordance with the
twenty-first and twenty-second aspect of the invention the virus,
in particular the adenovirus, replicates in cells which contain
YB-1 in the nucleus or which do not contain YB-1 in the nucleus
independent of the cell cycle, or which do not comprise any
deregulated YB-1.
[0109] In a further embodiment of the uses in accordance with the
twenty-first and twenty-second aspect of the invention the viral
oncogene protein is E1A and/or the oncogene is the gene coding for
E1A and/or the oncogene protein is E1A.
[0110] In a preferred embodiment the viral oncogene protein E1A is
capable of binding a functional Rb tumor suppressor gene
product.
[0111] In an alternative embodiment the viral oncogene protein E1A
is incapable of binding a functional Rb tumor suppressor gene
product.
[0112] In a further embodiment of the uses in accordance with the
twenty-first and twenty-second aspect of the invention the viral
oncogene protein E1A does not induce nuclear localisation of
YB-1.
[0113] In a further embodiment of the uses in accordance with the
twenty-first and twenty-second aspect of the invention the
medicament is for patients the cells of which are either Rb
positive or Rb negative.
[0114] In a preferred embodiment the cells are those cells involved
in the formation of the condition which is to be affected by the
medicament.
[0115] In a further embodiment of the uses in accordance with the
twenty-first and twenty-second aspect of the invention the cells
are Rb-negative and YB-1-positive in the nucleus, in particular are
YB-1 positive in the nucleus independent of the cell cycle.
[0116] In a still further embodiment of the uses in accordance with
the twenty-first and twenty-second aspect of the invention the
medicament is for the treatment of tumors.
[0117] In a still further embodiment of the uses in accordance with
the twenty-first and twenty-second aspect of the invention the
cells, in particular the cells forming the tumor or parts thereof,
are resistant, in particular multiple resistant against drugs,
preferably anti-tumor agents and more preferably cytostatics.
[0118] In a preferred embodiment of the uses in accordance with the
twenty-first and twenty-second aspect of the invention the cells
are expressing, preferably are over-expressing the membrane-bound
transport protein P-glycoprotein and/or MRP.
[0119] In a further embodiment of the uses in accordance with the
twenty-first and twenty-second aspect of the invention the cells
are either p53-positive or p53-negative.
[0120] In an embodiment of the uses in accordance with the
twenty-first and twenty-second aspect of the invention the oncogene
protein comprises, compared to the wildtype oncogene protein E1A,
one or several mutations or deletions, whereby the deletions are
preferably those selected from the group comprising deletions of
the CR3 region and deletions of the N-terminus and deletions of the
C-terminus. It is contemplated that the E1A oncogene protein is
capable of binding to Rb.
[0121] In a further embodiment of the uses in accordance with the
twenty-first and twenty-second aspect of the invention the oncogene
protein comprises, compared to the wildtype oncogene protein, one
or several mutations or deletions, whereby the deletion is
preferably one in the CR1 region and/or CR2 region. It is
contemplated that the oncogene protein E1A is incapable of binding
to Rb.
[0122] In an embodiment of the uses in accordance with the
twenty-first and twenty-second aspect of the invention the viral
oncogene protein, in particular E1A, is under the control of a
tissue-specific and/or tumor-specific promoter.
[0123] In a further embodiment of the uses in accordance with the
twenty-first and twenty-second aspect of the invention the virus,
in particular the adenovirus, is coding for YB-1.
[0124] In a still further embodiment of the uses in accordance with
the twenty-first and twenty-second aspect of the invention YB-1 is
under the control of a tissue-specific and/or tumor-specific
promoter.
[0125] In a preferred embodiment of the uses in accordance with the
twenty-first and twenty-second aspect of the invention the virus,
in particular the adenovirus, codes for at least one protein which
is selected from the group comprising E4orf6, E4 orf3, E1B55k and
adenoviral E3ADP protein.
[0126] In a alternative embodiment of the uses in accordance with
the twenty-first and twenty-second aspect of the invention the
cells contain YB-1 in the nucleus, in particular the cells forming
the tumor or part thereof comprise YB-1 in the nucleus.
[0127] In a further embodiment of the uses in accordance with the
twenty-first and twenty-second aspect of the invention the tumor
contains YB-1 in the nucleus after induction of the transport of
YB-1 into the nucleus.
[0128] In a preferred embodiment of the uses in accordance with the
twenty-first and twenty-second aspect of the invention the
transport of YB-1 into the nucleus is caused by at least one
measure, whereby the measure is selected from the group comprising
irradiation, administration of cytostatics and hyperthermia.
[0129] In a particularly preferred embodiment of the uses in
accordance with the twenty-first and twenty-second aspect of the
invention the measure is applied to a cell, an organ or an
organism.
[0130] In a preferred embodiment of the uses in accordance with the
twenty-first and twenty-second aspect of the invention the virus,
in particular the adenovirus, is selected from the group comprising
Ad.DELTA.24, dl922-947, E1Ad/01/07, dl1119/1131, CB 016, dl520 and
viruses which are lacking an expressed viral E1A oncogene which is
capable of binding a functional Rb tumor suppressor gene
product.
[0131] In a twenty-third aspect the problem is solved by the use of
a virus, preferably the adenovirus, for the manufacture of a
medicament, whereby the virus, in particular the adenovirus, is
adapted such that the replication is controlled through or by YB-1
mediated activation of the E2-late promoter, preferably
predominantly controlled by the activation of the E2-late promoter.
In an embodiment YB-1 is either a transgenic YB-1 or a cellular
YB-1, in particular a cellular deregulated YB-1 or deregulated
YB-1. A transgenic YB-1 is preferably a YB-1 which is expressed in
a cell by a vector, in particular by a or the adenovirus. The
E2-late promoter is preferably the adenoviral E2-late promoter as
contained in wildtype adenovirus, or an E2-late promoter as used in
connection with the expression of the transgens as described
herein.
[0132] In a twenty-fourth aspect the problem is solved by the use
of a virus, in particular the adenovirus, for replication in cells
which contain YB-1 in the nucleus, whereby the virus, in particular
the adenovirus, is adapted such that the replication is controlled
by YB-1 through the activation of the E2-late promoter, preferably
predominantly by the activation of the E2-late promoter. In an
embodiment the YB-1 is either a transgenic YB-1 or a cellular YB-1,
in particular a cellular deregulated or deregulated YB-1. A
transgenic YB-1 is preferably a YB-1 which is expressed in a cell
by a vector, in particular a or the adenovirus. The E2-late
promoter is preferably the adenoviral E2-late promoter as present
in wildtype adenovirus, or an E2-late promoter as used in
connection with the expression of transgenes as described
herein.
[0133] In a preferred embodiment of the twenty-third and/or
twenty-fourth aspect of the present invention the adenovirus is
adapted as disclosed herein, particularly adapted such that it may
be used in accordance with the present invention.
[0134] In a twenty-fifth aspect the problem is solved by a viral
oncogene protein, in particular an isolated viral oncogene protein,
whereby the viral oncogene protein has the following
characteristics: [0135] a) transactivation of at least one viral
gene in YB-1 nucleus positive cells which is selected from the
group comprising E1B55k, E3ADP and E4orf6 and E4orf4; and [0136] b)
no induction of YB-1 in a cell nucleus, in particular in the cell
nucleus of the cell in which the viral oncogene protein is
present.
[0137] In an embodiment the viral oncogene protein is E1A.
[0138] In a further embodiment the viral oncogene protein
comprises, compared to the wildtype oncogene protein, one or
several mutations or deletions, whereby the deletions are
preferably those selected from the group comprising deletion of the
CR3 region, deletion of the N-terminus and deletion of the
C-terminus.
[0139] In an embodiment the induction of YB-1 through the viral
oncogene protein does not occur under the proviso that E4orf6
and/or E1B55 kD is/are not present in the cell comprising said
nucleus.
[0140] It is contemplated that the viral oncogene protein is
capable of binding to Rb.
[0141] In an alternative embodiment the viral oncogene protein
comprises one or several mutations or deletions, whereby the
deletion is preferably one in the CR1 region and/or the CR2 region
of the E1A oncogene protein. It is contemplated that the viral
oncogene protein is incapable of binding to Rb.
[0142] In a twenty-sixth aspect the invention is related to the use
of a viral replication system, in particular an adenoviral
replication system comprising a nucleic acid coding for a virus, in
particular an adenovirus, as used in accordance with the present
invention, and comprising a nucleic acid of a helper virus, whereby
the nucleic acid of the helper virus comprises a nucleic acid
sequence coding for YB-1.
[0143] In an embodiment the viral nucleic acid, in particular the
adenoviral nucleic acid, and/or the nucleic acid of the helper
virus is present as replicable vector.
[0144] In a twenty-seventh aspect the invention is related to the
use of a nucleic acid coding for a virus, in particular an
adenovirus, as used in accordance with the present invention, for
the manufacture of a medicament, in particular for the manufacture
of a medicament for the treatment of tumors.
[0145] In a preferred embodiment the cells, in particular the cells
forming the tumor or parts thereof, show a resistance, in
particular a multiple resistance against drugs, in particular
anti-tumor agents and more particularly cytostatics.
[0146] In a twenty-eighth aspect the present invention is related
to the use of a nucleic acid coding for a virus, in particular an
adenovirus, as used in accordance with the present invention, for
the replication in cells which contain YB-1 in the nucleus, whereby
the virus is replication deficient in cells which do not contain
YB-1 in the nucleus or which do not comprise YB-1 in the nucleus
independent of the cell cycle or which do not comprise any
deregulated YB-1, and whereby the virus codes for an oncogene or an
oncogene protein which at least transactivates one viral gene,
preferably an adenoviral gene in YB-1 nucleus positive cells,
whereby the gene is selected from the group comprising E1B55 kDa,
E4orf6, E4orf3 and E3ADP.
[0147] In a twenty-ninth aspect the problem is solved by the use of
a nucleic acid coding for a virus, in particular an adenovirus, as
used in accordance with the invention, for the manufacture of a
medicament, whereby the virus is adapted such that the replication
is controlled by YB-1 through the activation of the E2-late
promoter, preferably predominantly through the activation of the
E2-late promoter. In an embodiment the YB-1 is either a transgenic
YB-1 or a cellular, in particular cellular deregulated, or
deregulated YB-1. A transgenic YB-1 is preferably a YB-1 which is
expressed in a cell by a vector, in particular by a or the
adenovirus. The E2-late promoter is preferably the adenoviral
E2-late promoter such as contained in wildtype adenovirus, or an
E2-late promoter as used in connection with the expression of
transgenes described herein.
[0148] In a thirtieth aspect the problem is solved by the use of a
nucleic acid coding for a virus, in particular an adenovirus, as
used in accordance with the present invention, for the replication
in cells, whereby the virus is adapted so that the replication is
controlled by YB-1 through the activation of E2-late promoter,
preferably predominantly through the activation of the E2-late
promoter. In an embodiment YB-1 is either a transgenic YB-1 or a
cellular, in particular cellular deregulated YB-1. A transgenic
YB-1 is preferably one which is expressed in a cell by a vector,
preferably by a or the adenovirus. The E2-late promoter is
preferably the adenoviral E2-late promoter as present in wildtype
adenovirus, or an E2-late promoter as used in connection with the
expression of transgenes as described herein.
[0149] In a thirty-first aspect the problem is solved by the use of
a vector comprising one of the previously described nucleic acids,
for the use in accordance with the twenty-first or twenty-second
aspect of the present invention.
[0150] In a thirty-second aspect the invention is related to the
use of an agent interacting with YB-1 for the characterisation of
cells, of cells of a tumor tissue or of patients in order to
determine whether they shall be contacted and/or treated with a
virus, in particular an adenovirus, as used in accordance with the
present invention.
[0151] In an embodiment the agent is selected from the group
comprising antibodies, anticalines, aptamers, aptazymes and
spiegelmers.
[0152] In a thirty-second aspect the problem is solved by the use
of the viral oncogene protein in accordance with the present
invention, or a nucleic acid coding therefor, for the manufacture
of a virus, in particular of an adenovirus, as used in connection
with the uses in accordance with the twenty-first and twenty-second
aspect of the present invention.
[0153] In an embodiment the virus comprises a nucleic acid coding
for a transgene.
[0154] In a further embodiment the virus comprises the translation
product and/or the transcription product of a transgene.
[0155] In a preferred embodiment the nucleic acid of the adenoviral
replication system and/or the nucleic acid of the helper virus
comprises a transgene or a nucleic acid coding for a transgene.
[0156] In a still further embodiment the nucleic acid comprises a
transgen or a nucleic acid coding for a transgene.
[0157] In an alternative embodiment the transgene is selected from
the group comprising prodrugs, cytokines, apoptosis-inducing genes,
tumor suppressor genes, genes for metalloproteinase inhibitors and
genes for angiogenesis inhibitors and for tyrosine kinase
inhibitors.
[0158] In an embodiment the transgene is selected from the group
comprising nucleic acids for siRNA, for aptamers, for antisense
molecules and for ribozymes, whereby the siRNA, the aptamers, the
antisense molecules and/or the ribozymes are directed against the
target molecule.
[0159] In a further embodiment the target molecule is selected from
the group comprising resistance relevant factors, anti-apoptosis
factors, oncogenes, angiogenesis factors, DNA synthesis enzymes,
DNA repair enzymes, growth factors and their receptors,
transcription factors, metalloproteinases, in particular matrix
metalloproteinases, and plasminogen activator of the urokinase
type. In an embodiment the resistance relevant factors are
preferably selected from the group comprising P-glycoprotein, MRP
and GST, and also comprise the nucleic acids coding therefor. In an
embodiment the anti-apoptosis factors are selected from the group
comprising BCL2, and also comprise the nucleic acids coding
therefor. In an embodiment the oncogenes are selected from the
group comprising Ras, in particular mutated Ras, Rb and MYC, and
also comprise the nucleic acids coding therefor. In an embodiment
the angiogenesis factors are selected from the group comprising
VEGF and HMG proteins, and also comprise the nucleic acids coding
therefor. In an embodiment the DNA synthesis enzymes are selected
from the group comprising telomerase, and also comprise the nucleic
acids coding therefor. In an embodiment the DNA repair enzymes are
selected from the group comprising Ku-80, and also comprise the
nucleic acids coding therefor. In an embodiment the growth factors
are selected from the group comprising PDGF, EGF and M-CSF, and
also comprise the nucleic acids coding therefor. In a further
embodiment the receptors are preferably those for growth factors,
whereby preferably the growth factors are selected from the group
comprising PDGF, EGF and M-CSF, and also comprise the nucleic acids
coding therefor. In an embodiment the transcription factors are
selected from the group comprising YB-1, and also comprise the
nucleic acids coding therefor. In an embodiment the
metalloproteinases are in particular matrix metalloproteinases. In
a preferred embodiment the matrix metalloproteinases are selected
from the group comprising MMP-1 and MMP-2, and also comprise the
nucleic acids coding therefor. In an embodiment the plasminogen
activators of the urokinase type are selected from the group
comprising uPa-R, and also comprise the nucleic acids coding
therefor.
[0160] In a still further embodiment the medicament further
comprises at least one pharmaceutically active compound.
[0161] In a preferred embodiment the pharmaceutically active
compound is selected from the group comprising cytokines,
metalloproteinase inhibitors, angiogenesis inhibitors, cytostatics
such as Irinotecan and CPT-11 against colorectal carcinoma and
Daunorubicin against leukemia, cell cycle inhibitors such as CYC202
which inhibits CDK2/CyclinE kinase activity and can be used against
colorectal tumors (McClue S J, Int. J. Cancer 2002, 102, 463-468)
and BAY 43-9006 which inhibits Raf-1 and is, for example, effective
against mamma carcinoma (Wilhelm S M et al., Cancer Res. 2004, 64,
7099-7109), proteosome inhibitors such as PS-341 which inhibits the
26S proteasome activity and is used against brain tumors,
recombinant antibodies such as against the EGF receptor (Herceptin
for breast carcinoma and prostate tumor; H. G. van der Poel,
European Urology 2004, 1-17; Erbitux against head and neck tumors;
Bauman M et al., Radiother. Oncol., 2004, 72, 257-266), and
inhibitors of the signal transduction cascade such as STI 571 which
represses, among others, c-kit and can be used against
gastrointestinal tumors (H. G. van der Poel, European Urology 2004,
45, 1-17), ABT-627, an endothelin inhibitor, which may be used,
among others, against prostate tumors (H. G. van der Poel, European
Urology 2004, 45, 1-17), SU5416 which inhibits phosphorylation of
the VEGF tyrosine kinase receptor and which may be used, among
others, against neck and head tumors (Yin D. et al., Oncogene
2004), ZD1839 which inhibits EGFR tyrosine activity and may be
used, among others, against prostate tumors (H. G. van der Poel,
European Urology 2004, 45, 1-17); rapamycin derivatives such as
CCI-779 and RAD001 which inhibit mTOR and can be used against
prostate tumors. It is within the present invention that the
various adenoviruses described herein and the adenoviruses to be
used in accordance with the present invention, respectively, can,
in principle, be used with each and any of the aforementioned
compounds for each and any of the indication described herein in
connection therewith. In a particularly preferred embodiment the
indication is the one which is described for any of the previously
mentioned pharmaceutically active compounds.
[0162] In an embodiment the medicament comprises a combination of
at least two agents, whereby any agent is individually and
independently selected from the group comprising cytostatics.
[0163] In a preferred embodiment at least two of the agent act upon
different target molecules.
[0164] In an alternative embodiment at least two of the agents are
active through a different mode of action.
[0165] In an embodiment at least one agents increases the capacity
of a cell to be infected in which the virus replicates.
[0166] In an embodiment at least one agent has an impact on the
availability of a component within the cell, which preferably
increases the availability of the component, whereby the component
mediates the uptake of the virus.
[0167] In an embodiment at least one agent mediates the transport
inof YB-1 to the nucleus, preferably increases said transport.
[0168] In an embodiment at least one agent is a histone deacylase
inhibitor.
[0169] In a preferred embodiment the histone deacylase inhibitor is
selected from the group comprising trichostatine A, FR 901228,
MS-27-275, NVP-LAQ824 and PXD101.
[0170] In an embodiment at least one agent is selected from the
group comprising trichostatin A, FR 901228 (against pancreas
tumors, Sato N et al., Int. J. Oncol. 2004, 24, 679-685; MS-27-275
(against prostate tumors; Camphausen K et al., Clinical Canver
Research 2004, 10, 6066-6071), NVP-LAQ824 (against leukemiae;
Nimmanapalli R et al., Cancer Res. 2003, 63, 5126-5135; PXD101
(against ovary tumors, Plumb J A et al, Mol. Cancer Ther. 2003, 2,
721-728), Scriptaid (against breast carcinoma, Keen J C et al.,
Breast Cancer Res. Treat. 2003, 81, 177-186), apicidin (against
melanoma, Kim S H et al., Biochem. Biophys. Res. Commun. 2004, 315,
964-970) and CI-994 (against various tumors, Nemunaitis J J et al.,
Cancer J. 2003, 9, 58-66). The mode of action of histone
deacetylase inhibitors is, among others, described in Lindemann R K
et al., Cell Cycle 2004, 3, 77-86. It is within the present
invention that the various adenoviruses described herein and the
adenoviruses to be used in accordance with the present invention,
respectively, may be used with the aforementioned compounds, in
principle, for each and any of the indications described herein in
connection therewith. In a particularly preferred embodiment the
indication is one as has been described for each and any of the
aforementioned pharmaceutically active compounds.
[0171] In an embodiment at least one agent is a topoisomerase
inhibitor.
[0172] In a preferred embodiment the topoisomerase inhibitor is
selected from the group comprising camptothecin, irinotecan,
topotecan, DX-895If, SN-38, 9-aminocamptothecin,
9-nitrocamptothecin, etoposid and daunorubicin. These may be used
against various tumors, for example, colorectal tumors, pancreas
tumors, ovary carcinomas and prostate carcinomas. The fields of use
are, among others, described by Recchia F et al., British J. Cancer
2004, 91, 1442-1446; Cantore M et al., Oncology 2004, 67, 93-97;
Maurel J. et al., Gynecol. Oncol 2004, 95, 114-119; Amin A. et al.,
Urol. Oncol. 2004, 22, 398-403; Kindler H L et al., Invest. New
Drugs 2004, 22, 323-327, Ahmad T. et al., Expert Opin.
Pharmacother. 2004, 5, 2333-2340; Azzariti A. et al., Biochem
Pharmacol. 2004, 68, 135-144; Le Q T et al., Clinical Cancer Res.
2004, 10, 5418-5424. It is within the present invention that the
various adenoviruses described herein and the adenoviruses to be
used in accordance with the present invention, respectively, may in
principle be used with the aforementioned compounds for each and
any of the indications described herein in connection therewith. In
a particularly preferred embodiment the indication is one as
described for each of the aforementioned pharmaceutically active
compounds.
[0173] In a preferred embodiment the agent comprises trichostatine
A and irinotecan.
[0174] In an embodiment the virus, in particular the virus in
accordance with one of the aspects of the present invention, is
separated from the at least two agents.
[0175] In a preferred embodiment at least one unit dosis of the
virus is separated from at least one unit dosis of one or the at
least two agents.
[0176] In a thirty-fourth aspect the invention is related to a kit
comprising a virus, in particular a virus according to any aspect
of the present invention, and at least two agents, whereby any
agent is individually and independently selected from the group
comprising cytostatics.
[0177] The above disclosed adenovirus according to the present
invention, particularly those as described in connection with
aspects one to eight of the present invention, are also referred to
herein as group I adenoviruses, and the adenoviruses having a
transactivating oncogene protein such as, for example, E1A, and/or
those referred to herein and particularly above, as to be used in
accordance with the present invention, are also referred to herein
as group II adenoviruses. Group I adenoviruses and group II
adenoviruses are also collectively referred to herein as
adenoviruses or adenoviruses according to the invention or viruses
according to the invention.
[0178] The present invention is based on the surprising finding
that the reversal of the expression sequence of adenoviral genes
results in an efficient replication and optionally in the lysis of
the cell infected by the adenovirus. With regard to the
chronologically changed expression of the adenoviral genes
particular emphasis is to be put on an E1B protein and an E4
protein which are also referred to herein, individually or
collectively, as the first protein, which are expressed prior to a
second protein. The second protein is selected from the group
comprising E1A proteins. This expression sequence which is reversed
compared to wildtype adenoviruses where first an E1A protein and
only subsequently the E1B protein and an E4 protein are expressed,
ensures that transcription factors are activated, for example
transported, into the nucleus of the infected cell and influence
the further replication activity or control the same there. The
kinetics of the adenoviral transcripts in wildtype adenoviruses
are, for example, described in Glenn G. M. and Ricciardi R. P.
Virus Research 1988, 9, 73-91, who report that in the wildtype the
E1A transcripts, i.e. the E1A12S transcript and the E1A13S
transcript, are usually detectable prior to the transcripts and
translation products, respectively, E4orf6 and E1B55k. In the
present case the E1B protein is, and also herein in general if not
indicated to the contrary, preferably the E1B-55 kD protein. In the
present case, the E4 protein is, and also herein in general if not
indicated to the contrary, preferably the E4orf6 protein. In the
present case, the E1A protein is, and also herein in general if not
indicated to the contrary, preferably an E1A12S protein or such an
E1A protein as described herein in connection with the E1A-modified
adenoviruses.
[0179] It is within the present invention that the E1A protein, in
particular also the E1A12S protein may be substituted in principle.
Such substituted E1A proteins and E1A12S proteins, respectively,
are also referred to herein as E1A protein and E1A12S protein,
respectively, or shall be deemed to be comprised by this term, if
not indicated to the contrary. Instead of the E1A12S protein also
an E1A protein may be used which has a tumor suppressor function,
such as, for example, described by Dickopp A, Esche H, Swart G,
Seeber S, Kirch H C, Opalka B. Cancer Gene Ther. 2000,
July;7(7):1043-50. Further derivatives of E1A proteins, in
particular of the E1A12S protein, as used and/or as referred to as
such herein, are generally also such proteins which are capable of
releasing the factor E2F from the Rb/E2F complex. These are, among
others, Simian virus 40 tumor antigen (SV40 large T antigen),
papillomavirus E7 protein (HPV E7) as described by Chellappan S. et
al., Proc. Natl. Acad. Sci. USA 1992, 89, 4549-4533.
[0180] It is also within the present invention that derivatives of
E4orf6 and E1B55k may be used, whereby the term E4orf6 and E1B55k,
as used herein, comprises such derivatives. The derivatives are,
for example, described in Shen Y et al., J. of Virology 2001, 75,
4297-4307; Querido E. et al., J. of Virology 2001, 75, 699-709.
[0181] It is within the present invention that an E1B protein is
expressed prior to the E1A protein, or that an E4 protein is
expressed prior to an E1A protein, or that both an E1B protein and
an E4 protein are expressed prior to the E1A protein, each as
described above.
[0182] An adenovirus designed in such a way is capable of
replicating at a particularly high level upon infection of a cell
which expresses YB-1 in the nucleus, preferably expresses YB-1 in
the nucleus independent from the cell cycle, or which comprises
deregulated YB-1, preferably in the cytoplasm. Without wishing to
be bound thereto in the following the present inventor assumes that
a complex consisting of E1B protein and/or E4 protein and
individual ones of these two proteins, respectively, is/are capable
of transporting deregulated YB-1 into the cellular nucleus or
is/are capable of initiating adenoviral replication there under the
influence of the E1B protein and/or E4 protein being expressed
prior to the E1A protein. Once in the cellular nucleus or being
present there in activated form, YB-1 may, as described herein, in
particular using the E2-late promoter, efficiently replicate. The
chronologically early expression of an E1B protein and/or an E4
protein thus avoids the cascade as observed in wildtype going along
with initial expression of E1A protein. In a preferred embodiment
the E1A protein is an E1A protein which is in particular no longer
transactivating or transactivating only to a very limited extent
the E1B protein and/or the E4 protein. Preferably, this
transactivation is neither sufficient to ensure an efficient
replication, nor sufficient to ensure replication in cells which do
not have YB-1 in the nucleus. It is preferred that the
transactivation does not occur in cells which do not have YB-1 in
the nucleus independent from the cell cycle or which do not have
deregulated YB-1.
[0183] Furthermore, the present invention is based on the
surprising finding that an adenovirus is capable of replicating in
a particularly efficient manner if it comprises at least a nucleic
acid which codes for a protein, whereby the protein is selected
from the group comprising E1B proteins, E4 proteins and E1A
proteins and that at least one protein thereof is under the control
of a promoter which is different from the promoter which controls
the expression of the respective protein in a wildtype adenovirus.
Such replication is particularly efficient and usually results in
tumor lysis in case the cells have YB-1 in the nucleus, in
particular have YB-1 in the nucleus independent of the cell cycle,
or in case the cells comprise deregulated YB-1, in particular
comprise deregulated YB-1 in the cytoplasm. What has been said
above about the E1B proteins, E4 proteins and E1A proteins applies
also here. In wildtype adenoviruses the E1B protein is controlled
by the E1B promoter, the E4 protein is controlled by the E4
promoter and the E1A protein is controlled by the E1A promoter. By
selecting promoters which are different from those which control
the expression of the aforementioned proteins in wildtype
adenoviruses, the expression of the previously mentioned proteins
and thus the regulatory interplay of the individual adenoviral
nucleic acids and proteins is changed. By selecting the promoters a
chronologically different expression pattern can be created which,
without wishing to be bound thereto in the following, results in
the observed replication in cells, whereby the mechanism may be the
one as already previously described with regard to the
chronologically different expression of the adenoviral proteins
E1B, E4 and E1A. An example of a specific design for the control of
said proteins through promoters different from those controlling
the expression of the respective proteins in wildtype adenovirus,
may be taken from the sub-claims and from the example part, whereby
in particular the viruses referred to therein as XVirPSJL1 and
XVirPSJL2 are representative thereof. Preferably, the E1B protein
is the E1B55 kD protein, the E4 protein is the E4orf6 protein and
the E1A protein is the E1A12S protein.
[0184] The promoters which preferably control the E1B protein as
well as the E4 protein, are selected from the group comprising
tumor-specific promoters, organ-specific promoters, tissue-specific
promoters, heterologous promoters and adenoviral promoters under
the proviso that when adenoviral promoters are used, they are
different from the E1B promoter in case of the expression control
of the E1B protein, and are different from the E4 promoter in case
of expression control of the E4 protein. The use of the E1A
promoter for the expression control of the E1B protein and/or the
E4 protein is particularly preferred. The E1A promoter is, for
example, described by Boulanger P. A. and Blair, G. E. Biochem. J.
1991, 275, 281-299. Additionally, also the use of each and any
other heterologous promoter is possible, i.e. a promoter which is
different from the one which controls the expression of the
respective protein in a wildtype adenovirus. A representative
example is the CMV promoter, whereby other promoters will be
obvious for the ones skilled in the art.
[0185] The promoter which is used for the control of the E1A
protein, may also be selected from the group comprising
tumor-specific promoters, organ-specific promoters, tissue-specific
promoters, heterologous promoters and adenoviral promoters under
the proviso that the adenoviral promoter is different from the E1A
promoter. It is within the present invention that one or several of
the aforementioned proteins, i.e. the E1B protein, the E4 protein
or the E1A protein are under the control of the same promoter,
whereby it is nevertheless preferred that particularly the E1B
protein and the E4 protein are under the control of the same
promoter. It is particularly preferred that the expression of the
E1A protein is controlled by a YB-1-controlled promoter or a
promoter which can be regulated by YB-1. Such promoters are
disclosed herein in connection with other aspects of the present
invention. The use of the adenoviral E2-late promoter is
particularly preferred for the control of the expression of the E1A
promoter as it can, first, be regulated by YB-1 and, second, shows
only little transcription in the absence of YB-1 which can
factually be neglected so that a very good expression control of
the nucleic acid which is under the control of the E2-late
promoter, is ensured. This considerably increases biological
safety, particularly when applied in the field of medicine.
[0186] Furthermore, the present inventor has found that
adenoviruses will replicate particularly well in cells which have
YB-1 in the nucleus, particularly have YB-1 in the nucleus
independent of the cell cycle, and/or which have deregulated YB-1,
preferably have deregulated YB-1 in the cytoplasm, if YB-1 is
provided for replication either directly or indirectly in
particular in the cellular nucleus or if the provision of YB-1 is
directly or indirectly mediated through an adenoviral protein,
whereby such adenoviral protein is different from E1A. This aspect
of the present invention is different from the aspect which is also
disclosed herein, namely that the use of transactivating
E1A-modified adenoviruses, preferably group II adenoviruses, allows
for replication of these viruses in YB-1 nucleus-positive tumor
cells, particularly YB-1 nucleus-positive cells which are YB-1
positive independent of the cell cycle, and those cells which have
deregulated YB-1, particularly comprise YB-1 in the cytoplasm,
insofar that the transactivating characteristics of the E1A
protein, particularly the E1A13S protein are not used here, i.e. in
connection with the group I adenoviruses, but rather in a preferred
embodiment the E1A13S protein is functionally inactive and is thus
no longer capable of transactivating also E4orf6 and E1B55k, which
are involved in the transport and provision of YB-1, respectively,
in the nucleus, either directly or indirectly. Consequently, an
effective replication of the adenovirus is not possible in
accordance with this aspect of the present invention. Insofar, the
provision of YB-1 in the nucleus and the provision of YB-1 for
adenoviral replication, respectively, is now no longer under the
control of the direct or indirect involvement of the E1A protein
but occurs through the expression of the E1B protein, particularly
E1B55 kD protein, and/or the E4 protein, particularly the E4orf6
protein, which is not controlled by E1A.
[0187] This embodiment of the adenovirus may also be provided by
one of the above-described measures, for example by bringing
forward the chronological expression of the E1B protein and/or the
E4 protein compared to the expression of the E1A protein, or by
putting one or several of the E1B proteins, E4 proteins and E1A
proteins under the control of a promoter which is different from
the promoter which controls the expression of the respective
protein in wildtype adenovirus.
[0188] Finally, the present inventor starts from the surprising
finding that an effective adenoviral replication may also occur,
particularly in cells which have YB-1 in the nucleus, more
particularly YB-1 in the nucleus independent of the cell cycle, or
in cells which have deregulated YB-1, preferably in the cytoplasm,
in case at least one of the E1B proteins, E4 proteins and E1A
proteins, particularly the preferred forms thereof, are expressed
in an expression cassette under the control of a promoter. In one
embodiment of the present invention basically three expression
cassettes each comprising a single one of said proteins are
provided. In an alternative embodiment an expression cassette may
also comprise two or more of the proteins E1B, E4 and E1A and their
derivatives and possible substituents, respectively, particularly
in case of E1A12S. What has previously been said in relation to the
aspect that the adenoviruses comprise nucleic acids related to
proteins E1B, E4 and E1A, is also applicable to the design of the
various proteins and the respectively used promoters. When using
such expression cassettes it is preferred that proteins and nucleic
acids coding therefor in the genome of the wildtype adenovirus
which correspond to the respective proteins of the expression
cassettes, are either completely or partially deleted to ensure
that the virus is stable and to avoid recombinations, at least to a
bigger extent.
[0189] In principle, the expression cassettes can be cloned into
each region and each site, respectively, of the adenovirus, whereby
preferably one or several of the cassettes are inserted either
individually or in combination with each other into the E1 region,
the E3 region and/or the E4 region of the virus. It is possible
that the nucleic acids of the E1, E3 and E4 region are completely
deleted, partially deleted or not deleted at all, whereby it is
preferred with regard to the adenoviruses according to the
invention that the nucleic acid coding for the E1A13S gene is
inactivated or deleted so as not to provide any transactivating E1A
protein by the virus. The extent of such deletion in one or several
of the regions E1, E3 and E4 is determined by the expression
cassette used and, optionally, further introduced foreign genes or
transgenes or the further expression cassettes comprising them,
i.e. genes which are different from the adenoviral genes, at least
different in the sense that they are not provided in the regulatory
context of the adenoviral nucleic acid as prevailing in wildtype
adenovirus or are not provided in the sequence of the adenoviral
nucleic acids of wildtype adenoviruses at such site. It is within
the present invention that the nucleic acids which are contained in
one or several of the expression cassettes which code for an E1B
protein, an E4 protein and/or an E1A protein, are partially or
completely deleted in the adenoviral genome. In an embodiment, such
as in the adenovirus according to the present invention XvirPSJL1
or 2, the adenoviral nucleic acid coding for E4orf6 is partially
deleted and/or compeltely deleted, however, the complete nucleic
acid coding therefor is contained in the expression cassette.
Preferably, this will also be realised for the E1B55k (also
referred to as E155 Kd) protein and/or the E1A12S protein. The
extent of the deletion is to be selected in preferred embodiments
such that a maximum package size of about 103% of the maximum
package size of the wildtype adenovirus is reached, although this
limit is only a preferred limit. The possible deletions to be made
in the adenoviral genome are only subject to limitations in
preferred embodiments such as to make sure that still infectious
and packed particles can be manufactured. The precise extent of the
deletions may be determined by the ones skilled in the art on the
basis of the disclosure provided herein together with standard
tests.
[0190] As a starting point for the construction of the adenoviruses
described herein, any wildtype adenovirus may be used, but also
other adenoviruses may be used provided that they are constructed
in accordance with the technical teaching of the present invention.
It is particularly preferred to have recourse to adenoviruses of
subgroup C and within this group in turn to adenovirus 2 and
adenovirus 5.
[0191] The terms E1B protein and E1B proteins, E4 protein and E4
proteins as well as E1A protein and E1 proteins are used herein in
a synonymous manner, if not indicated to the contrary.
[0192] As used herein, the term "deregulated" YB-1 refers to a YB-1
molecule or YB-1 protein as described herein which is present in a
form which is quantitatively and/or qualitatively different from
YB-1 as normally present in cells, preferably in non-tumor cells. A
deregulated YB-1 can be characterised and identified as such by
particular viruses being able to replicate in the presence of
deregulated YB-1 in a cellular background comprising such
deregulated YB-1. The particular viruses in connection therewith
are those the E1A protein of which is mutated and exhibits a
transactivating function. Examples for these particular viruses are
AD delta 24, dl 922-947, E1 Ad/01/07 and CB 016 and/or those
described by Howe, J. A et al., Molecular Therapy 2, 485-495, 2000;
Fueyo J. et al., Oncogene 19, 2-12, 2000; Heise C. et al., Nature
Medicine 6, 1134-1139, 2001; Balague, C et al., J. Virol. 75,
7602-7611, 2001; Bautista, D. S. et al., Virology 1991, 182,
578-596; Jelsma T. N. et al., Virology 1988, 163, 494-502; Wong, H.
K. and Ziff E. B., J. of Virology 1994, 68, 4910-4920]. Such a cell
and a cell, respectively, having such a background can be used for
the replication of group I adenoviruses and/or group II
adenoviruses. Additionally, tumors comprising such cells may be
lysed by the adenoviruses according to the invention.
[0193] Furthermore, the present invention is based on the
surprising finding that the DNA replication of E1A-modified
adenoviruses in YB-1 nucleus-positive tumor cells is based on the
activation of the E2-late promoter. E1A-modified adenoviruses are
to be understood as those which (a) have, in YB-1 nucleus-negative
cells, a reduced or no replication at all compared to wildtype, (b)
have a transactivation activity on at least one viral gene, whereby
the gene is particularly selected from the group comprising E1B-55
kDa, E4orf6, E4orf3 and E3ADP, and/or (c) do not translocate
cellular YB-1 into the nucleus by the adenovirus. Optionally, the
adenoviruses used in accordance with the present invention have the
further characteristic that the binding of the E1A protein encoded
by the adenovirus is interfering with the binding of E2F to RB and
is capable of dissolving the respective complex consisting of E2F
and Rb. Adenoviruses which have one or several of the
aforementioned features a) to c), preferably all of the features a)
to c), are replication deficient in cells which do not have YB-1 in
the nucleus.
[0194] In an embodiment a strongly reduced replication herein in
particular means a replication which is decreased compared to the
wildtype by a factor of 2, preferably a factor of 5, more
preferably a factor of 10 and most preferably a factor of 100. In a
preferred embodiment the comparison of the replication is made
using identical or similar cell lines, identical or similar virus
titres for the infection (multiplicity of infection, MOI or plaque
forming unit, pfu) and/or identical or similar general experimental
conditions. Replication particularly means the formation of
particles. In further embodiments the measure for replication may
be the extent of viral nucleic acid synthesis. Methods for
determining the extent of viral nucleic acid synthesis and methods
for the determining particle formation are both known to the ones
skilled in the art.
[0195] The findings, methods, uses or nucleic acids, proteins,
replication systems and the like, are not necessarily limited to
adenoviruses. Basically, such systems also exist in other viruses
which are also encompassed herewith.
[0196] Using the viruses according to the present invention or the
use of the viruses described herein in accordance with the present
invention, may result in a replication comparable to wildtype when
using an infection rate of 1 to 10 pfu/cell compared to 10 to 100
pfu/cell in accordance with the prior art.
[0197] Cellular YB-1 shall be any YB-1 which is encoded and is,
preferably, also expressed by the cell, whereby this YB-1 is
present in the cell particularly prior to the infection of the
respective cell by an adenovirus, preferably an adenovirus and/or a
helper virus as described herein. However, it is also within the
present invention that cellular YB-1 is also a YB-1 which is
introduced into the cell or produced by the cell only when
exogenous measures such as infection with a virus, preferably an
adenovirus, are applied.
[0198] Without wishing to be bound thereto, the present inventor
assumes that the E2-early promoter, i.e. the early E2 promoter, is
not switched on by means of the human cellular E2F transcription
factor in connection with the replication of the viruses used in
accordance with the present invention and in connection with the
use in accordance with the present invention of the adenoviruses of
the present invention. Under such circumstances the start of the
replication is independent of the Rb status of the cells, i.e. the
tumor cells which are infected by using the viruses disclosed
herein and which are preferably lysed subsequently, may contain
either functional as well as inactive Rb proteins. In addition,
adenoviral replication using the adenoviruses disclosed herein or
using the conditions disclosed herein, does not require any
functional p53 protein, however is neither negatively affected by
its presence. Insofar the technical teaching turns away from the
principle underlying the use of oncolytic or tumorlytic
adenoviruses of the type of Ad.DELTA.24, dl922-947, E1Ad/01/07,
CB016 or those adenoviruses described, for example, in European
patent EP 0 931 830, which had been made subject to one and/or
several deletion(s) in the E1A protein under the assumption that
intact functional Rb proteins would hinder an efficient in vivo
replication and thus provide for adenoviral replication in vivo
only in Rb-negative and Rb-mutated cells. These adenoviral systems
of the prior art are based on E1A in order to control in vivo
replication of adenoviruses by means of the early E2 promoter
(E2-early promoter) and "free E2F". Nevertheless, these known
viruses of the prior art may be used in accordance with the present
invention for the replication in cells which contain YB-1 in the
nucleus independent of the cell cycle, or in cells which comprise
deregulated YB-1.
[0199] The viruses in particular adenoviruses described in said
European patent EP 0 931 830 may be used in accordance with the
present invention. More specifically, the viruses described in said
patent are viruses which are replication deficient and which lack
an expressed viral oncoprotein which is capable of binding a
functional Rb tumor suppressor gene product. The adenovirus can
particularly be any adenovirus which lacks expressed viral E1A
oncoprotein which is capable of binding a functional tumor
suppressor gene product, more particularly Rb. The viral E1A
oncoprotein can exhibit an inactivating mutation, for example in
the CR1 domain at the amino acid positions 30 to 85 in adenovirus
Ad5, which is also referred to herein as Ad5, Ad 5, the nucleotide
positions 697-790 and/or the CR2 domain at amino acid positions 120
to 130 in Ad 5, the nucleotide position 920 to 967 which are
involved in the binding of p105 Rb protein, p130 and p107 protein.
However, it is within the present invention that the adenovirus is
of type 2 dl 312 or type 5 NT dl 1010.
[0200] In connection with the use of adenoviruses in accordance
with the present invention for the manufacture of a medicament, in
particular for the manufacture of a medicament for the treatment of
tumor diseases and of the other diseases disclosed herein, and in
connection with the use of adenoviruses in accordance with the
present invention as well as the use of the adenoviruses according
to the present invention for replication in cells which have YB-1
in the nucleus, preferably have YB-1 in the nucleus independent of
the cell cycle or which comprise deregulated YB-1, preferably in
the cytoplasm, replication finally occurs in those cells which have
YB-1 in the nucleus, preferably independent of the cell cycle,
which are, in other words, YB-1 nucleus-positive, or in cells which
comprise deregulated YB-1. It is particularly to be acknowledged
that the adenoviruses as such do not replicate or only replicate at
a significantly reduced level in cells which do not have YB-1 in
the nucleus but only contain YB-1 in the cytoplasm, or in cells
which do not contain any deregulated YB-1. Insofar it is necessary
for a successful replication of these viruses that YB-1 is present
in the nucleus, preferably independent of the cell cycle, or that
deregulated YB-1 is present. As will also be explained in the
following, this can be achieved, for example, by applying to the
cells conditions which result in the expression or presence of
YB-1, preferably independent of the cell cycle, or deregulated YB-1
in the nucleus or in the expression of deregulated YB-1. A
respective measure can, for example, be the coding and expression,
respectively, of YB-1 by the adenoviruses which are either used in
accordance with the present invention or which are subject to the
present invention, which in addition to the adenoviral genes also
carry genetic information which codes for YB-1 and which
particularly codes for its expression. Other measures which result
in the transport, induction or expression of YB-1 in the nucleus of
the cell, are application of stress such as the administration to
the cell and to an organism containing such a cell of cytostatics,
irradiation, hyperthermia and the like. In a preferred embodiment
irradiation is any radiation which is, for example, used in the
treatment of tumor diseases.
[0201] The adenoviruses used in accordance with the present
invention, particularly for tumor lysis, as well as the
adenoviruses according to the invention are characterised in
preferred embodiments by the fact that they do not replicate in
cells which do not have YB-1 in the nucleus independent of the cell
cycle and which are thus YB-1 nucleus-negative, or which do not
comprise any deregulated YB-1.
[0202] A further feature of a part of the adenoviruses to be used
in accordance with the present invention which are different from
the adenoviruses of the present invention, is that they code for a
viral oncogene which is also referred to herein as oncogene
protein, whereby the oncogene protein is preferably E1A and whereby
the oncogene protein is capable of activating at least one viral
gene which has an impact on the replication of the virus and/or
cell lysis of the cell infected by said virus. Preferably, the
impact on the replication is such that the virus replicates better
in the presence of the oncogene protein compared to the scenario
where the oncogene protein of the respective virus is absent. This
process is also referred to herein as transactivating and
particularly as E1A transactivating in case the transactivation is
mediated by E1A. The term "transactivate" or "transactivation"
preferably describes the process that the respective viral
oncoprotein has an impact on the expression and/or on the
transcription of one or several other genes which are different
from the gene coding for the viral oncogene protein itself, i.e.
controls its/their expression and/or translation and particularly
activates it/them. Such viral genes are preferably E1B55 kDa,
E4orf6, E4orf3 and E3ADP as well as any combination of the
aforementioned genes and gene products, respectively.
[0203] A further, although only optional feature of the
adenoviruses to be used in accordance with the present invention as
well as of the adenoviruses of the present invention is their
binding characteristics and the binding characteristics of
particular ones of the proteins coded by them, respectively, to
tumor suppressor Rb. Basically, it is within the present invention
that the adenoviruses used in accordance with the present invention
may or may not bind to Rb. The use of any of the two alternative
embodiments of the adenoviruses is independent of the Rb status of
the cells treated or the cells to be treated.
[0204] In order to confer to E1A the ability not to bind to Rb, the
following deletions can be made to the E1A oncoprotein: deletion in
the CR1 region (amino acid positions 30-85 in Ad5) and deletion of
the CR2 region (amino acid positions 120-139 in Ad5). In doing so,
the CR3 region is preserved and can exercise its transactivating
function on the other early viral genes.
[0205] In order to confer to E1A the ability to bind to Rb, the
following deletions to E1A oncoprotein, however, are basically
possible: deletion of the CR3 region (amino acid positions
140-185); deletion of the N-terminus (amino acid positions 1-29);
deletion of the amino acid positions 85-119; and deletion of the
C-terminus (amino acid positions 186-289). The regions listed above
do not interfere with the binding of E2F to Rb. The transactivating
function remains intact, however, is reduced compared to wildtype
Ad5.
[0206] It is also within the present invention, particularly with
regard to the adenoviruses of the present invention, that the E1A
protein, particularly the E1A12S protein is designed such that, in
an embodiment, it is capable of binding to Rb and, in a different
embodiment, is not capable of binding to Rb, whereby such E1A12S
protein is an E1A protein and particularly an E1A12S protein in the
meaning of the present invention which is nevertheless referred to
in the prior art sometimes as modified E1A12S. The respective
design of the E1A12S protein is within the skills of those of the
art, particularly with regard to the aforementioned deletions of
the E1A protein which is also referred to herein simply as E1A.
[0207] Such adenoviruses which are basically already known in the
prior art and which do not show any transactivation, are generally
regarded as replication deficient. However, it is the merit of the
present inventor that he has recognised that they are nevertheless
capable of replicating in a suitable background, in particular a
cellular background. Such suitable cellular background is caused or
provided by the presence of YB-1 in the nucleus, preferably a cell
cycle independent presence of YB-1 in the nucleus, or by
deregulated YB-1. The term cells or cellular systems as used herein
in connection with each and any other aspect of the present
invention, comprises fragments or fractions of cell extracts as
well as cells which are present in vitro, in vivo or in situ.
Insofar, the term cellular systems or cells also comprises cells
which are present in cell culture, tissue culture, organ culture or
in any tissue or organ in vivo and in situ, respectively, isolated,
in groups or as part of tissues, organs or organisms, but which may
also be present as such in a preferably living organism. The
organism is preferably any vertebrate organism and more preferably
a mammal. More preferably the organism is a human organism. Other
preferred organisms are those disclosed in connection with the
various aspects of the present invention.
[0208] Additionally, it is within the present invention that based
on the technical teaching provided herein, new viruses are
generated which show the replication behaviour of the adenoviruses
described herein and of those of the prior art in such cells which
are YB-1 nucleus-positive, preferably YB-1 nucleus-positive
independent of the cell cycle, or which comprise deregulated YB-1.
In other words, particularly starting preferably from the
adenoviruses already known, further viruses can be constructed
which exhibit the features defined herein which are relevant for
the use in accordance with the invention.
[0209] In connection with the present invention the modified E1A
oncoprotein of the various adenoviruses to be used in accordance
with the present invention is, in contrast to the viruses of the
present invention, capable of transactivating the early viral genes
such as E1B55K, E4 orf3, E4orf6, E3ADP in YB-1 nucleus-positive
cells or cells which comprise deregulated YB-1. There are
preferably no other changes made to the viral genome and the
respective adenovirus may insofar correspond otherwise to a
wildtype adenovirus or a derivative thereof.
[0210] The viruses disclosed herein which code or comprise a
transactivating oncogene protein in the meaning of the present
invention, comprise, for example, the adenoviruses Ad.DELTA.24,
dl922-947, E1Ad/01/07, CB106 and/or the adenoviruses described in
European patent EP 0 931 830 which are each capable of
transactivating the early genes such as E1B, E2, E3 and/or E4 and
which are comparable to the adenoviruses of wildtype, particularly
wildtype Ad5. In these cases, a distinct region of the E1A protein
is responsible for the transactivation. Within the various
adenoviral serotypes there are three highly conserved regions
within the E1A protein. The region CR1 from amino acid positions
41-80, CR2 from amino acid positions 120-139 and CR3 from amino
acid positions 140-188. The transactivating function is mainly
based on the presence of the CR3 region within the E1A protein. The
amino acid sequence of CR3 is present in an unchanged manner in the
above mentioned adenoviruses. This results in a transactivation of
the early genes E1B, E2, E3 and E4 independent of whether YB-1 is
present in the nucleus or in the cytoplasm.
[0211] In contrast thereto, the CR3 region has been deleted in the
recombinant adenovirus dl520. Thus, dl520 expresses a so-called
E1A12S protein which does not comprise the amino acid sequence of
the CR3 region. Consequently, dl520 may exercise only a very weak
transactivating function, particularly on the E2 region, and thus
does not replicate in YB-1 nucleus-negative cells. In YB-1
nucleus-positive cells YB-1 is responsible for the transactivation
of the E2 region and thus allows for an efficient replication of
dl520. The use of systems like dl520 or systems originating
therefrom for the purposes disclosed herein, is based thereon. A
further important difference between the two previously described
groups of adenoviruses such as, for example, delta 24 (also
referred to herein as Ad.DELTA.24) and, for example, dl520, resides
in the fact that the early genes E1B, E3 and E4 are more
comprehensively transactivated in cells being YB-1 nucleus-positive
cells independent of the cell cycle or in cells containing
deregulated YB-1, compared to YB-1 nucleus-negative cells or cells
which do not comprise deregulated YB-1. In contrast thereto, there
are no or only minor differences in delta 24. The transactivation
of dl520, more specifically of the E1A12S protein is, however,
significantly reduced compared to wildype adenovirus. This
transactivation, however, is sufficient so as to provide for an
efficient replication in YB-1 nucleus-positive cells as also shown
in example 10. The design of the E1A protein as described herein
and in particular as described in this connection, and of the
nucleic acid coding therefor, such that the E1A protein has,
compared to the wildtype oncogene protein E1A, one or several
deletions and/or mutations, including and particularly preferably
those designs of the E1A protein as described in connection with
dl520 or Ad.DELTA.24, dl922 to 947, E1Ad/01/07, CB106 and/or the
adenoviruses described in European patent EP 0 931 830, are
embodiments of viruses, in particular of adenoviruses, the
replication of which is controlled, preferably predominantly
controlled by the activation of the E2-late promoter. Preferably,
the deletion is such that it is selected from the group comprising
deletions of the CR3 region and deletions of the N-terminus and
deletions of the C-terminus. Further embodiments of the E1A protein
which allow this kind of replication of adenoviruses, can be
generated by the ones skilled in the art based on the disclosure
provided herein. The embodiment of the E1A protein as described
previously is an embodiment which may also be used in connection
with the adenoviruses of the present invention which are also
referred to herein as adenoviruses of the present invention or
group I adenoviruses.
[0212] The adenoviruses of the present invention, particularly the
group I adenoviruses, which are also referred to herein as
derivatives and which may be used in accordance with the present
invention, typically comprise an E1 deletion, an E1/E3 deletion
and/or an E4 deletion, i.e. the corresponding adenoviruses are not
capable of generating functionally active E1 and/or E3 and/or E4
expression products and corresponding products, respectively. Or in
other words these adenoviruses are only capable of generating
functionally inactive E1, E3 and/or E4 expression products, whereby
a functionally inactive E1, E3 and/or E4 expression product is an
expression product which is either not present as an expression
product at all, either at the transcription level and/or at the
translation level, or is present in a form which at least does not
have one of the functions attributed to it in a wildtype
adenovirus. This/these function(s) inherent to the expression
product in wildtype adenovirus is/are known to the ones skilled in
the art and, for example, described in Russell, W. C., Journal of
Virology, 81, 2573-2604, 2000. Russell (supra) also describes
design principles of adenoviruses and adenoviral vectors which are
incorporated herein by reference. It is also within the present
invention that the modified E1A oncoprotein, i.e. the no longer
transactivating E1A protein and other proteins such as E1A12S,
E1B-55K, E4orf6 and/or E3ADP (adenoviral death protein (ADP))
(Tollefson, A. et al., J. Virology, 70, 2296-2306, 1996) are
expressed in such vector either alone or in any combination. The
individual mentioned genes as well as the transgenes disclosed
herein, may be, independently from each other, cloned into the E1
and/or E3 and/or E4 region and expressed using a suitable promoter
or under the control of a suitable promoter. Basically, each of the
E1, E3 and E4 region is suitable as cloning site within the
adenoviral nucleic acid, whereby the regions not used for the
cloning can, either individually or as a whole, be present,
partially and/or completely deleted. In case that these regions are
present, in particular are present in their entirety, it is within
the present invention that they are either intact and preferably
provide for a translation product and/or a transcription product,
and/or are not intact and preferably do not provide for a
translation product and/transcription product. In some embodiments
suitable promoters are those as disclosed herein in connection with
the control and expression, respectively, of E1A, preferably of the
modified E1A.
[0213] Finally, in an embodiment, the group II adenoviruses used in
accordance with the present invention are E1B deficient,
particularly E1B 19 kDa deficient. The term deficient as generally
used herein refers to a condition, wherein the E1B does not exhibit
all of the characteristics of the wildtype E1B and lacks at least
one of these characteristics.
[0214] The adenoviral BCL2 homolog E1B 19k avoids the E1A induced
apoptosis by interaction with the pro-apoptotic proteins Bak and
Bax. Because of this a maximum replication and/or particle
formation is possible in infected cells (Ramya Sundararajan and
Eileen White, Journal of Virology 2001, 75, 7506-7516). The lack of
E1B19k results in a better release of the viruses as, if present,
it will minimize the function of the adenoviral death protein. By
such a deletion the virus induced cytopathic effect is increased
(Ta-Chiang Liu et al., Molecular Therapy, 2004) and thus results in
a more pronounced lysis of infected tumor cells. Additionally, the
lack of E1B19k causes that TNF-alpha does not exert an influence on
the replication of such recombinant adenoviruses in tumor cells,
whereas in normal cells the treatment results in a reduced
replication and release of infectious viruses. Insofar, selectivity
and specificity are increased (Ta-Chiang Liu et al., Molecular
Therapy 2004, 9, 786-803).
[0215] At least some embodiments of the group II adenoviruses as
used in accordance with the invention disclosed herein, are as such
known in the art. The adenoviruses used in accordance with the
invention are preferably recombinant adenoviruses, particularly
also if, compared to the wildtype, a change has been made in the
sense of the technical teaching provided herein. It is within the
skills of those of the art to delete and mutate, respectively, the
adenoviral nucleic acid sequences which are irrelevant for the
invention. Such deletions may be related to, e.g. a part of the E3
and E4 coding nucleic acids as also described herein. A deletion of
E4 is particularly preferred provided that such deletion does not
extend to the protein E4orf6, in other words the adenovirus to be
used in accordance with the invention codes for E4orf6. In
preferred embodiments, these adenoviral nucleic acids may still be
packed into viral capsids and thus form infectious particles. This
is also true for the use of the nucleic acids in accordance with
the invention. Generally it is also to be acknowledged that the
adenoviral systems may be deficient with regard to single or
several expression products. In connection therewith it is to be
taken into consideration that this, in connection with both the
group I adenoviruses and the group II adenoviruses, may be caused
by the mutation or deletion of the nucleic acid coding the
expression product, whereby such mutation and deletion,
respectively, is either a complete one or performed to the extent
that no expression product is formed anymore or by the regulatory
elements and elements controlling the expression such as promoters
and transcription factors being missing or being active in a way
different from wildtype, either at the level of the nucleic acid
(lack of a promoter; cis acting elements) or at the level of the
translation and transcription system (transacting elements),
respectively. Particularly the latter aspect may depend on the
respective cellular background.
[0216] Apart from using adenoviruses which are as such already
known, in accordance with the present invention also novel
adenoviruses such as group II adenoviruses may be used for the
purposes already disclosed for the other adenoviruses described
herein. The new adenoviruses of the invention result from the
technical teaching provided herein. Particularly preferred
representatives are, for example, the viruses Xvir03 and Xvir03/01
which are depicted in FIGS. 16 and 17, the design principle of
which is further illustrated in examples 11 and 12.
[0217] In case of vector Xvir03 a CMV promoter was cloned into the
E1 region which controls the nucleic acids for E1B 55k and E4orf6
which are separated by an IRES sequence. In connection therewith
the E3 and E4 region may be deleted and/or may be present in an
intact form Due to the cloning of these two genes into the virus
and due to the gene products generated therefrom, respectively, a
high replication efficiency results, whereby the selective
replication in cells, preferably tumor cells, is maintained insofar
as a replication occurs particularly in YB-1 nucleus-positive cells
and more particularly in those cells which comprise deregulated
YB-1 in the sense of the present disclosure. Cells in which
deregulated YB-1 is present are, in an embodiment, cells which show
an increased expression of YB-1, preferably compartment independent
expression of YB-1, compared to normal or non-tumor cells. E1B 55k
and E4orf6 can also be cloned into the E4 region, whereby the E3
region can be intact or/and partially or completely deleted.
[0218] A further development of virus Xvir03 is virus Xvir03/01
into which in a preferred embodiment therapeutic genes or
transgenes have been cloned under the control of a specific
promoter, in particular a tumor-specific or tissue-specific
promoter. In connecton therewith the E3 and the E4 region can be
deleted and/or be intact. Furthermore, in connection with such
virus also the E4 region is functionally inactive, is preferably
deleted. The transgenes described herein may also be cloned into
the E4 region, whereby this can be done either alternatively or in
addition to the cloning of the transgenes into the E3 region.
[0219] The transgenes described herein and particularly described
in the following, may also be expressed in connection with or by
the adenoviruses of the present invention, i.e. group I
adenoviruses and their nucleic acids, respectively, or the
replication systems of the invention and are thus comprised in
connection with an expression cassette comprising a promoter and a
nucleic acid sequence, whereby such nucleic acid sequence codes for
one or several of said transgenes. The E1, E3 and/or E4 regions are
particularly suitable cloning sites in the adenoviral genome,
however, the cloning sites are not limited thereto. Transgenes as
used herein, may be viral genes, preferably adenoviral genes, which
are preferably not present in the genome and, respectively, which
are not present at the site of the genome of the wildtype where
they are present in the particular virus now, or therapeutic
genes.
[0220] Therapeutic genes may be prodrug genes, genes for cytokines,
apoptosis inducing genes, tumor suppressor genes, genes for
metalloproteinase inhibitors and/or angiogenesis inhibitors, and
tyrosine kinase inhibitors. Additionally, siRNA, aptamers,
antisense molecules and ribozymes may be expressed which are
preferably directed against cancer-relevant target molecules.
Preferably the individual or the several target molecules are
selected from the group comprising the resistance-relevant factors,
anti-apoptosis factors, oncogenes, angiogenesis factors, DNA
synthesis enzymes, DNA repair enzymes, growth factors and their
receptors, transcription factors, metalloproteinases, particularly
matrix metalloproteinases, and plasminogen activator of the
urokinase type. Preferred embodiments thereof are those which have
been disclosed already herein in connection with other aspects of
the invention.
[0221] Possible prodrug genes as may be used in preferred
embodiments, are, for example, cytosine deaminase, thymidine
kinase, carboxypeptidase, uracil phosphoribosyl transferase; or
purine nucleoside phosphorylase (PNP); [Kim et al, Trends. in
Molecular Medicine, volume 8, no. 4 (suppl), 2002; Wybranietz W. A.
et al., Gene Therapy, 8, 1654-1664, 2001; Niculescu-Duvaz et al.,
Curr. Opin. Mol. Therapy, 1, 480.486, 1999; Koyama et al., Cancer
Gene Therapy, 7, 1015-1022, 2000; Rogers et al., Human Gene
Therapy, 7, 2235-2245, 1996; Lockett et al., Clinical Cancer Res.,
3, 2075-2080, 1997; Vijayakrishna et al., J. Pharmacol. And Exp.
Therapeutics, 304, 1280-1284, 2003].
[0222] Possible cytokines as may be used in preferred embodiments,
are, for example, GM-CSF, TNF-alpha, Il-12, Il-2, Il-6, CSF or
interferon-gamma; [Gene Therapy, Advances in Pharmacology, volume
40, editor: J. Thomas August, Academic Press; Zhang and Degroot,
Endocrinology, 144, 1393-1398, 2003; Descamps et al., J. Mol. Med.,
74, 183-189, 1996; Majumdar et al., Cancer Gene Therapy, 7,
1086-1099, 2000].
[0223] Possible apoptosis-inducing genes as may be used in
preferred embodiments, are, for example, Decorin [Tralhao et al.,
FASEB J, 17, 464-466, 2003]; retinoblastoma 94 [Zhang et al.,
Cancer Res., 63, 760-765, 2003]; Bax and Bad [Zhang et al., Hum.
Gene Ther., 20, 2051-2064, 2002]; apoptin [Noteborn and Pietersen,
Adv. Exp. Med. Biol., 465, 153-161, 2000]; ADP [Toth et al., Cancer
Gene Therapy, 10, 193-200, 2003]; bcl-xs [Sumantran et al., Cancer
Res, 55, 2507-2512, 1995]; E4orf4 [Braithwaite and Russell,
Apoptosis, 6, 359-370, 2001]; FasL, Apo-1 and Trail [Boehringer
Manheim, Guide to Apoptotic Pathways, Arai et al., PNAC, 94,
13862-13867, 1997]; Bims [Yamaguchi et al., Gene Therapy, 10,
375-385, 2003; GNR163: Oncology News, 17 Jun., 2000].
[0224] Possible tumor suppressor genes as may be used in preferred
embodiments, are, for example, E1A, p53, p16, p21, p27 or MDA-7
[Opalka et al., Cell Tissues Organs, 172, 126-132, 2002, Ji et al.,
Cancer Res., 59, 3333-3339, 1999, Su et al., Oncogene, 22,
1164-1180, 2003].
[0225] Possible angiogenesis inhibitors as may be used in preferred
embodiments, are, for example, endostatin or angiostatin [Hajitou
et al., FASEB J., 16, 1802-1804, 2002], and antibodies against VEGF
[Ferrara, N., Semin Oncol 2002 December; 29 (6 suppl 16):
10-4].
[0226] Possible metalloproteinase inhibitors as may be used in
preferred embodiments, are, for example, Timp-3 [Ahonen et al., Mol
Therapy, 5, 705-715, 2002]; PAI-1 [Soff et al., J. Clin. Invest.,
96, 2593-2600, 1995]; Timp-1 [Brandt K. Curr. Gene Therapy, 2,
255-271, 2002].
[0227] Further transgenes in the sense of the present invention
which may be expressed by both group I adenoviruses and group II
adenoviruses are also tyrosine kinase inhibitors. Exemplary
tyrosine kinases are EGFR (epidermal growth factor receptor)
[Onkologie, Entstehung und Progression maligner Tumoren; author:
Christoph Wagner, Georg Thieme Verlag, Stuttgart, 1999]. A
preferred tyrosine kinase inhibitor is herceptin [Zhang H et al.,
Cancer Biol Ther. 2003, July-August; 2 (4 suppl 1): S122-6].
[0228] SiRNA (short interfering RNA) which may be used in
connection with the present invention, consists of two, preferably
separate RNA strands which hybridise to each other due to base
complementarity which means that they are present essentially base
paired and preferably have a length of up to 50 nucleotides,
preferably between 18 and 30 nucleotides, more preferably less than
25 nucleotides and most preferably 21, 22 or 23 nucleotides,
whereby these figures refer to the single strand of the siRNA,
particularly to the length of the stretch of the single strand
which hybridises to or is base paired with a, more precisely the
second single strand. siRNA specifically induces or mediates the
degradation of mRNA. The specificity required theretofore is
mediated by the sequence of the siRNA and thus its binding site.
The target sequence to be degraded is essentially complementary to
the first or to the second of the siRNA forming strands. Although
the precise mode of action is not yet clear, it is assumed that
siRNA is a biological strategy for cells in order to inhibit
distinct alleles during development and to protect themselves
against viruses. siRNA mediated RNA interference is used as a
method for the specific suppression or complete elimination of the
expression of a protein by introducing a gene specific
double-stranded RNA. For higher organisms a siRNA comprising 19 to
23 nucleotides is insofar particularly suitable as it does not
result in the activation of a non-specific defense reaction such as
an interleukin response. The direct transfection of double-stranded
RNA of 21 nucleotides having symmetrical 2-nt 3' overhangs was
suitable to mediate RNA interference in mammalian cells and is
highly efficient compared to other technologies such as ribozymes
and antisense molecules (Elbashir, S. Harborth J. Lendeckel W.
Yalvcin, A. Weber K, Tuschl T: Duplexes of 21-nucleotide RNAs
mediate RNA interference in cultured mammalian cells. Nature 2001,
411: 494-498). As little as a few siRNA molecules are sufficient so
as to suppress expression of the target gene. In order to avoid the
limitations of exogenously added siRNA which particularly reside in
the transient nature of the interference phenomenon and specific
delivery (delivery) of the siRNA molecules, vectors are used in the
prior art which allow for an endogenous siRNA expression. For such
purpose, for example, oligonucleotides having a length of 64
nucleotides are introduced into the vector which comprise the 19
nucleotide long target sequence both in the sense and in the
antisense orientation, separated by, for example, a 9 nucleotide
spacer sequence. The resulting transcript folds into a hairpin
structure with a stem structure (stem) of, for example, 19 base
pairs. The loop is rapidly degraded in the cell so that a
functional siRNA molecule is generated (Brummelkamp et al.,
Science, 296, 550-553, 2002).
[0229] The nucleic acid coding for YB-1 which may be part of the
adenoviruses in an embodiment of the adenoviruses to be used in
accordance with the invention, particularly group II adenoviruses,
but also of the adenoviruses according to the invention, i.e. group
I adenoviruses, may comprise a nucleic acid sequence which mediates
the transport of YB-1 into the nucleus. The nucleic acids,
adenoviruses and adenoviral systems according to the invention as
well as the adenoviruses known in the prior art such as, for
example, Onyx-15, Ad.DELTA.24, dl922-947, E1Ad/01/07, CB016, dl 520
and the adenoviruses described in patent EP 0 931 830 may be used,
as adenoviruses and adenoviral systems, respectively, and the
corresponding nucleic acids, in combination with these nucleic
acids in accordance with the invention. Suitable nucleic acid
sequences mediating nuclear transport are known to the ones skilled
in the art and, for example, described in Whittaker, G. R. et al.,
Virology, 246, 1-23, 1998; Friedberg, E. C., TIBS 17, 347, 1992;
Jans, D. A. et al., Bioassays 2000 June; 22(6): 532-44; Yoneda, Y.,
J. Biochem. (Tokyo) 1997 May; 121(5): 811-7; Boulikas, T., Crit.
Rev. Eukaryot. Gene Expr. 1993; 3(3): 193-227; Lyons R H, Mol. Cell
Biol., 7 2451-2456, 1987). The nucleic acid sequences mediating
nuclear transport may realise different principles. One such
principle is that YB-1 forms a fusion protein with a signal peptide
or is provided with such signal peptide and is transferred into the
cellular nucleus because of the signal peptide, whereupon the
replication of the adenoviruses in accordance with the invention
occurs.
[0230] A further principle which may be used in the design of the
adenoviruses to be used in accordance with the invention,
particularly group II adenoviruses, but also with the adenoviruses
in accordance with the present invention, i.e. the group I
adenoviruses, is providing YB-1 with a transport sequence which
results in the transfer or translocation of YB-1 into the cellular
nucleus, preferably starting from a synthesis in the cytoplasm, and
prompts viral replication there. An example for a particularly
effective nucleic acid sequence mediating transport into the
nucleus, is the TAT sequence of HIV which is, for example,
described together with other suitable nucleic acid sequences of
that kind in Efthymiadis, A., Briggs, L J, Jans, D A., JBC 273,
1623-1628, 1998. It is within the present invention that the
adenoviruses to be used in accordance with the invention,
particularly group II adenoviruses, but also the adenoviruses
according to the present invention, i.e. group I adenoviruses,
comprise the nucleic acid sequences which code for the peptides
which mediate nuclear transport.
[0231] It is within the present invention that YB-1 is present in
its full length, particularly in a form which corresponds to
wildtype YB-1. Furthermore, it is within the invention that YB-1 is
used or present as a derivative, for example in a shortened or
truncated form. A YB-1 derivative as may be used or may be present
in connection with the present invention, is a YB-1 which is
preferably capable of binding to the E2 late promoter and thus
activates gene expression of the adenoviral E2 region. Such
derivatives particularly comprise the YB-1 derivatives disclosed
herein. Further derivatives can be generated by deletion of single
or several amino acids at the N-terminus, the C-terminus or within
the amino acid sequence. It is within the present invention that
also YB-1 fragments are used as YB-1 proteins in the sense of the
present invention. In the paper of Jurchott K et al. [JBC 2003,
278, 27988-27996] various YB-1 fragments are disclosed which are
characterised by deletions at the C- and the N-terminus. The
distribution of the various YB-1 fragments has shown that both the
cold shock domain (CSD) as well as the C-terminus is relevant for
the cell cycle regulated transport of YB-1 into the cellular
nucleus. It is thus within the present invention that a shortened
YB-1 (herein also referred to as YB-1 protein) in connection with
the inventive expression of E1B55k and E4orf6 migrates better into
the nucleus and thus induces a stronger CPE without necessarily
binding better to the E2-late promoter compared to native YB-1,
whereby it cannot be excluded that also a shortened YB-1 migrates
better into the nucleus and is causing both effects, i.e. induces
CPE and binds to the E2-late promoter. Finally, such shortened YB-1
fragments may also migrate better into the nucleus and bind more
efficiently to the E2-late promoter without inducing a better CPE.
It is also within the present invention that shortened YB-1
proteins and fragments, respectively, comprise further sequences as
disclosed herein in connection with the full length YB-1, in
particular cell localisation signal sequences (NLS) and the
like.
[0232] With regard to the aforementioned various further genes and
gene products encoded and expressed, respectively, by the
adenovirus, it is in principle possible that these are coded and
expressed, respectively, in any combination.
[0233] It is within the present invention that the terms adenovirus
and adenoviral systems are to be understood as having essentially
the same meaning. The term adenovirus shall particularly be
understood such as to be related to the complete virus particle
comprising the capsid and the nucleic acid. The term adenoviral
system particularly focuses on the fact that the nucleic acid is
changed compared to the wildtype. Preferably such changes comprise
changes in the set-up of the genome of the adenovirus as may result
from deleting and/or adding and/or mutating promoters, regulatory
sequences and/or coding sequences such as reading frames. The term
adenoviral system is additionally more preferably used such that it
is a vector which may, for example, be used in gene therapy.
[0234] The above comments, including any use and any design of the
adenoviruses and adenoviral systems, respectively, are also
applicable to the nucleic acids coding therefor and vice versa.
[0235] In connection with the present invention it is possible that
the adenoviruses used in accordance with the invention,
particularly group II adenoviruses, but also group I adenoviruses
and the nucleic acids coding therefor, is any respective adenoviral
nucleic acid which as such or in combination with further nucleic
acid sequences results in a replication event. It is possible, as
explained herein, that the sequences and/or gene products necessary
for replication are provided by helper viruses. To the extent it is
referred to coding nucleic acid sequences and said nucleic
sequences are nucleic sequences which are known, it is within the
present invention that not only the identical sequence is used but
also sequences derived therefrom. Herein, derived sequences shall
mean in particular any sequences which still result in a gene
product, either a nucleic acid or a polypeptide which has a
function which corresponds to a or the function of the non-derived
sequence. This can be tested by routine tests known to the one
skilled in the art. An example for such derived nucleic acid
sequences are those nucleic acid sequences which code for the same
gene product, in particular for the same amino acid sequence,
which, however, have a different base sequence due to the
degeneracy of the genetic code.
[0236] With regard to the adenoviruses according to the invention
of group II and/or the corresponding adenoviral replication system
according to the invention and their use in accordance with the
invention, respectively, in an embodiment the adenoviral nucleic
acid is deficient for the expression of the oncogene protein, in
particular is E1A protein deficient, i.e. does either not code for
the 12S E1A protein (herein also referred to as E1A12S protein) or
for the 13S E1A protein (herein also referred to as E1A13S protein)
or does not code for both the 12S E1A protein and the 13S E1A
protein, or is modified, as defined herein, if not indicated to the
contrary, and that the adenoviral replication system further
comprises a nucleic acid of a helper virus, whereby the nucleic
acid of the helper virus comprises a nucleic acid sequence which
codes for the oncogene protein, particularly the E1A protein, which
has the following characteristics and confers the following
characteristics to the adenovirus, respectively: It is preferably
non-replicating in YB-1 nucleus-negative cells but is replicating
in cells which are independent of the cell cycle in YB-1
nucleus-positive or in cells exhibiting deregulated YB-1, is
transactivating at least one viral gene, in particular E1B55 kDa,
E4orf6, E4orf3 and/or E3ADP, in YB-1 nucleus-positive cells, and/or
does not transfer cellular YB-1 into the nucleus. It is within the
present invention that the transgenes described herein are either
individually or collectively coded and/or expressed by the helper
virus. This applies to helper viruses for both group I adenoviruses
and group II adenoviruses.
[0237] Furthermore, in an embodiment of such an adenoviral
replication system in accordance with the invention the adenoviral
nucleic acid and/or the nucleic acid of the helper virus is/are
present as replicable vector.
[0238] It is further within the present invention that the nucleic
acid(s) coding for group I adenoviruses and/or group II
adenoviruses is/are preferably present in an expression vector and
that this expression vector is used in accordance with the
invention.
[0239] In a further aspect the present invention is also related to
a vector group comprising at least two vectors, whereby the vector
group comprises in total an adenoviral replication system for group
I adenoviruses and/or group II adenoviruses as described herein,
and the vector group is used in accordance with the invention. In
an embodiment each component of the adenoviral replication system
is arranged on an individual vector, preferably an expression
vector.
[0240] Finally, the present invention is related in a further
aspect to the use of a cell which contains one or several of the
nucleic acids which code for the group I adenoviruses and/or group
II adenoviruses which are preferably used in accordance with the
present invention, and which are to be used in accordance with the
invention of and/or a corresponding adenoviral replication system
and/or a corresponding vector and/or a vector group according to
the invention, for the very same purpose as described herein for
the various adenoviruses.
[0241] The above described constructs of adenoviruses and in
particular their nucleic acids and the nucleic acids coding
therefor, may also be introduced in a multipartite form into a
cell, preferably a tumor cell, whereby due to the presence of the
various individual components they act together as if the
individual components were derived from a single nucleic acid and a
single or several adenoviruses, respectively.
[0242] The nucleic acids which are used in accordance with the
invention and which code for group I adenoviruses and/or group II
adenoviruses, corresponding adenoviral systems or parts thereof,
may also be present as vectors. Preferably these vectors are viral
vectors. In case the nucleic acids comprise adenoviral nucleic
acids, preferably the virus particle is the vector. It is, however,
also within the present invention that said nucleic acids are
present in a plasmid vector. In each case the vector comprises
elements which allow for and control the propagation of inserted
nucleic acid, i.e. replication and the optional expression of the
inserted nucleic acid. Suitable vectors, preferably expression
vectors, and respective elements are known to the ones skilled in
the art and, for example, described in Grunhaus, A., Horwitz, M.
S., 1994, Adenoviruses as cloning vectors. In Rice, C., editor,
Seminars in Virology, London: Saunders Scientific Publications.
[0243] The aspect related to the vector groups takes into account
the afore-described embodiment that the various elements of said
nucleic acid are not necessarily contained in a single vector only.
Accordingly, a vector group consists of at least two vectors. Apart
from that, any statements made in relation to the vectors is also
applicable to the vectors and the vector group, respectively.
[0244] Group I adenoviruses and/or group II adenoviruses are
characterised by the various nucleic acids and gene products,
respectively, disclosed herein and may otherwise comprise all those
elements known to the ones skilled in the art and which are
inherent to the wildtype adenoviruses (Shenk, T.: Adenoviridae: The
virus and their replication. Fields Virology, vol. 3, editors
Fields, B. N., Knipe, D. M., Howley, P. M. et al., Lippincott-Raven
Publishers, Philadelphia, 1996, chapter 67).
[0245] For purpose of illustration but not for purpose of
limitation of the present invention the replication of adenoviruses
shall be briefly discussed in the following.
[0246] The replication of adenoviruses is a very complex process
and is usually based on the human transcription factor E2F. During
viral infection at first the "early genes" E1, E2, E3 and E4 are
expressed. The group of the "late genes" is responsible for the
synthesis of the structural proteins of the virus. The E1 region
consisting of two transcriptional units E1A and E1B which code for
different E1A and E1B proteins, play a critical role for the
activation of both the early and the late genes, as they induce the
transcription of the E2, E3 and E4 genes (Nevins, J. R., Cell 26,
213-220, 1981). Additionally, the E1A proteins may initiate DNA
synthesis in resting cells and thus trigger their entry into the S
phase (c. f. Boulanger and Blair, 1991). Additionally, they
interact with the tumor suppressors of the Rb class (Whyte, P. et
al., Nature 334, 124-127, 1988). In doing so, the cellular
transcription factor E2F is released. The E2F factors may
subsequently bind to corresponding promoter regions of both
cellular and viral genes (in particular to the adenoviral E2 early
promoter) and initiate transcription and thus replication (Nevins,
J. R., Science 258, 424-429, 1992). The activity of pRb and E2F is
regulated by phosphorylation. The hypophosphorylated form of pRb
particularly exists in the G1 and M phase. In contrast thereto, the
hyperphosphorylated form of pRb is present in the S and G2 phase.
By phosphorylation of pRb E2F is released from the complex
consisting of E2F and hypophosphorylated pRb. The release of E2F
from the complex of E2F and hypophosphorylated pRb results in
transcription of E2F dependent genes. The E1A protein binds only to
the hypophosphorylated form of pRb, whereby the binding of E1A to
pRb predominantly occurs through the CR2 region of the E1A protein.
Additionally, it also binds to the CR1 region, however, with a
lower affinity (Ben-Israel and Kleiberger, Frontiers in Bioscience,
7, 1369-1395, 2002; Helt and Galloway, Carcinogenesis, 24, 159-169,
2003).
[0247] The gene products of the E2 region are especially needed for
the initiation and completion of the replication as they code for
three essential proteins. The transcription of the E2 proteins is
controlled by two promoters, the "E2 early E2F dependent" promoter,
which is also referred to herein as E2-early promoter or early E2
promoter, and the "E2-late" promoter (Swaminathan and Thimmapaya,
The Molecular Repertoire of Adenoviruses III: Current Topics in
Microbiology and Immunology, vol 199, 177-194, Springer Verlag
1995). Additionally, the products of the E4 region together with
the E1A and E1B-55 kDa protein play a crucial role for the activity
of E2F and the stability of p53. For example, the E2 promoter is
even more transactivated by direct interaction of the E4orf6/7
protein encoded by the E4 region with the heterodimer consisting of
E2F and DP1 (Swaminathan and Thimmapaya, JBC 258, 736-746, 1996).
Furthermore, the complex consisting of E1B-55 kDa and E4orf6 is
inactivated by p53 (Steegenga, W. T. et al., Oncogene 16, 349-357,
1998) in order to complete a successful lytic infectious cycle.
Additionally, E1B-55 kDa has a further important function insofar
as it promotes, when interacting with E4orf6 protein, the export of
viral RNA from the nucleus, whereas cellular RNAs are retained in
the nucleus (Bridge and Ketner, Virology 174, 345-353, 1990). A
further important observation is that the protein complex
consisting of E1B-55 kDa/E4orf6 is localised in the so-called
"viral inclusion bodies". It is assumed that these structures are
the sites of replication and transcription (Ornelles and Shenk, J.
Virology 65, 424-429, 1991).
[0248] The E3 region is another important region for the
replication and in particular for the release of adenoviruses. The
E3 region more precisely contains the genetic information for a
variety of comparatively small proteins which are not essential for
the infectious cycle of adenovirus in vitro, i.e. in cell culture.
However, they play a crucial role in the survival of the virus
during an acute and/or latent infection in vivo as they have, among
others, immune regulatory and apoptotic function(s) (Marshall S.
Horwitz, Virologie, 279, 1-8, 2001; Russell, supra). It could be
shown that a protein having a size of about 11.6 kDa induces cell
death. This protein was, due to its function, named ADP--for the
english term adenovirus death protein--(Tollefson, J. Virology, 70,
2296-2306, 1996). The protein is predominantly formed in the late
phase of the infectious cycle. Furthermore, the overexpression of
the protein results in a better lysis of the infected cells
(Doronin et al., J. Virology, 74, 6147-6155, 2000).
[0249] Furthermore, it is known to the present inventor that
E1A-deleted viruses, i.e. particularly those viruses which neither
express any 12S E1A protein nor any 13S E1A protein, may replicate
very efficiently at higher MOIs (Nevins J. R., Cell 26, 213-220,
1981), which, however, cannot be realised in clinical applications.
This phenomenon is referred to as "E1A-like activity" in
literature. Furthermore it was known that of the 5 proteins encoded
by E1A, two proteins, namely the 12S and the 13S protein, control
and induce, respectively, the expression of the other adenoviral
genes (Nevins, J. R., Cell 26, 213-220, 1981; Boulanger, P. and
Blair, E.; Biochem. J. 275, 281-299, 1991). It became evident that
particularly the CR3 region of the 13S protein is exhibiting the
transactivating function (Wong H K and Ziff E B., J Virol., 68,
4910-20, 1994). Adenoviruses having distinct deletions in the CR1
and/or CR2 region and/or CR3 region of the 13 S protein are
essentially replication-defective, however are still
transactivating in other cell lines the viral genes and promoters,
and in particular the E2 region (Wong H K, Ziff E B., J Virol. 68,
4910-20, 1994; Mymryk, J. S. and Bayley, S. T., Virus Research 33,
89-97, 1994).
[0250] After infection of a cell, typically a tumor cell, with a
wildtype adenovirus, YB-1 is induced into the nucleus by means of
E1A, E1B-55K and E4orf6 and co-localised with E1B-55K in the viral
inclusion bodies within the nucleus which allows an effective
replication of the virus in the cellular nucleus both in vitro and
in vivo. It has been found already earlier that E4orf6 also binds
to E1B-55K (Weigel, s. and Dobbelstein, M. J. Virology, 74,
764-772, 2000; Keith N. Leppard, Seminars in Virology, 8, 301-307,
1998) and thus mediates the transport and distribution of E1B-55K
into the nucleus which ensures an optimum virus production and
adenoviral replication, respectively. By the co-operation of E1A,
E1B-55K and YB-1, and by the complex consisting of E1B-55K/E4orf6
and YB-1, respectively, and the co-localisation of YB-1 and E1B-55K
in the nucleus in the so-called viral inclusion bodies, an
efficient replication of the virus in accordance with the invention
is possible and thus the use of the viruses described herein for
replication in cells which are YB-1 nucleus-positive, preferably
cells which contain YB-1 in the nucleus independent of the cell
cycle, and/or cells which comprise or exhibit deregulated YB-1,
and/or for the manufacture of a medicament, respectively, for the
treatment of diseases, in which YB-1 nucleus-positive cells,
preferably cells which contain YB-1 in the nucleus independent of
the cell cycle, and/or cells which comprise or exhibit deregulated
YB-1, are involved. The replication which is therefore possible in
this cellular background, results in lysis of the cell, release of
the virus and infection and lysis of adjacent cells so that in case
of infection of a tumor cell and a tumor, respectively, finally
lysis of the tumor, i.e. oncolysis, occurs.
[0251] YB-1 belongs to a group of highly conserved factors which
bind to an inverted CAAT sequence which is referred to as Y-box.
They may act in a regulatory manner both at the level of
transcription and translation (Wolffe, A. P. Trends in Cell Biology
8, 318-323, 1998). There are more and more Y-box dependent
regulation pathways found in the activation but also in the
inhibition of growth and apoptosis associated genes (Swamynathan,
S. K. et al., FASEB J. 12, 515-522, 1998). For example, YB-1
interacts directly with p53 (Okamoto, T. et al., Oncogene 19,
6194-6202, 2000), plays an essential role in the expression of the
Fas gene (Lasham, A. et al., Gene 252, 1-13, 2000), in gene
expression of MDR and MRP (Stein, U. et al., JBC 276, 28562-69,
2001; Bargou, R. C. et al., Nature Medicine 3, 447-450, 1997) and
in the activation of topoisomerases and metalloproteinases
(Mertens, P. R. et al., JBC 272, 22905-22912, 1997; Shibao, K. et
al., Int. J. Cancer 83, 732-737, 1999). Also, YB-1 is involved in
the regulation of mRNA stability (Chen, C-Y. et al., Genes &
Development 14, 1236-1248, 2000) and in repair processes (Ohga, T.
et al., Cancer Res. 56, 4224-4228, 1996; Izumi H. et al., Nucleic
Acid Research 2001, 29, 1200-1207; Ise T. et al., Cancer Res.,
1999, 59, 342-346).
[0252] The nuclear localisation of YB-1 in tumor cells either by
YB-1 being present in the nucleus independent of the cell cycle, or
by deregulated YB-1 present in the cytoplasm having been
translocated into the nucleus by group I adenoviruses and/or group
II adenoviruses, results in E1A-independent viral replication
during which especially neither any 12S E1A protein nor any 13S E1A
protein is expressed and used, respectively (Holm, P. S. et al. JBC
277, 10427-10434, 2002), and results in a multidrug resistance in
case of overexpression of the protein YB-1. Additionally, it is
known that the adenoviral proteins such as, e.g., E4orf6 and
E1B-55K have a positive impact on viral replication (Goodrum, F. D.
and Ornelles, D. A., J. Virology 73, 7474-7488, 1999), whereby a
functional E1A protein is responsible for the activation of the
other viral gene products (such as E4orf6, E3ADP and E1B-55K)
(Nevins J. R., Cell 26, 213-220, 1981). This, however, does not
happen with the E1A-minus adenoviruses known in the art in which
the 13S E1A protein is not present. Nuclear localisation of YB-1 in
multidrug resistant cells which have YB-1 in the nucleus, allows
for the replication and particle formation, respectively, of such
E1A-minus viruses. In connection therewith, however, the efficiency
of viral replication and particle formation is reduced compared to
the wildtype Ad5 by a multiple. Compared to this, a combination of
YB-1 allows for a very efficient viral replication and particle
formation mediated by YB-1 and thus oncolysis, whereby the YB-1 is
either already contained in the nucleus of the tumor cell which may
result from YB-1 being located in the nucleus in a cell cycle
independent manner, or whereby the deregulated YB-1 present in the
cytoplasm is translocated into the nucleus by group I adenoviruses
and/or group II adenoviruses, or is induced into the cellular
nucleus by exogenous factors (e.g. application of cytostatics or
irradiation or hyperthermia), i.e. is induced to be present in the
nucleus, particularly independent of the cell cycle, or whereby
YB-1 is introduced as a transgene by a vector with a system,
preferably an adenoviral system, which switches on the adenoviral
genes but does not show viral replication. This applies also to the
adenoviruses in accordance with the invention, i.e. group I
adenoviruses, which are capable of efficiently replicating due to
their specific design and using the effect that an E1B protein,
preferably the E1B55K protein, and/or an E4 protein, preferably the
E4orf6 protein, provide(s) for an effective mobilisation of YB-1,
preferably in the nucleus. Suitable cytostatics which may be used
together with the adenoviruses disclosed herein in connection with
the various aspects of the present invention are, for example,
those belonging to the following groups: anthracyclines such as for
example daunomycin and adriamycin; alkylating agents such as for
example cyclophosphamide; alkaloides such as etoposide;
vin-alkaloides such as for example vincristine and vinblastine;
antimetabolites such as for example 5-fluorouracil and
methrothrexat; platin-derivatives such as for example cis-platin;
topoisomerase inhibitors such as for example camphothecine, CPT-11;
taxanes such as for example taxole, paclitaxel, histone-deacetylase
inhibitors such as for example FR901228, MS-27-275, trichostatine
A, MDR modulators such as for example MS-209, VX-710 and
geldanamycine derivatives such as for example 17-AAG. The
adenoviruses disclosed herein, in particular recombinant
adenoviruses, which are only capable of replicating in cells which
are YB-1 nucleus-positive, and cells which contain regulated YB-1,
preferably in the cytoplasm, are limited in their ability to
transactivate the viral genes E1B-55K, E4orf6, E4orf3 and E3ADP
compared to the respective transactivating abilities of wildtype
adenoviruses, in particular wildtype Ad5. The present inventor has
surprisingly found that this limited transactivating ability can be
overcome by expressing the corresponding genes, and in particular
E1B-55K and E4orf6, in combination with the nuclear localisation of
YB-1. As shown in the examples herein, viral replication and
particle formation is increased under such conditions to a level
comparable to the replication activity and particle formation
activity, respectively, of wildtype adenoviruses.
[0253] The medicament in connection with which or for the
manufacture of which the adenoviruses disclosed herein are used in
accordance with the present invention, is intended to be applied,
usually, in a systemic manner, although it is also within the
present invention to apply or deliver it locally. The application
is intended to infect particularly those cells with adenoviruses
and it is intended that adenoviral replication particularly occurs
therein, which are involved, preferably in a causal manner, in the
formation of a condition, typically a disease, for the diagnosis
and/or prevention and/or treatment of which the inventive
medicament is used.
[0254] Such a medicament is preferably for the treatment of
malignant diseases, tumor diseases, cancer diseases, cancer and
tumors, whereby these terms are used herein in an essentially
synonymous manner if not indicated to the contrary. The tumor
diseases are preferably those where YB-1 is, due to the mechanism
underlying the tumor disease, in particular due to the underlying
pathological mechanism, already located in the nucleus, preferably
independent of the cell cycle, or where the presence of YB-1 in the
cellular nucleus is caused by exogenous measures whereby such
exogenous measures are suitable to transfer YB-1 into the cellular
nucleus or to induce or to express it there. The term tumor or
tumor disease shall comprise herein both malignant as well as
benign tumors, each both solid and diffuse tumors, and respective
diseases. In an embodiment the medicament comprises at least one
further pharmaceutically active compound. The nature and the amount
of such further pharmaceutically active compound will depend on the
kind of indication for which the medicament is used. In case the
medicament is used for the treatment and/or prevention of tumor
diseases, typically cytostatics such as cis-platin and taxole,
daunoblastin, daunorubicin, adriamycin and/or mitoxantrone or
others of the cytostatics or groups of cytostatics described
herein, are used, preferably those as described in connection with
the cytostatic mediated nuclear localisation of YB-1.
[0255] The medicament in accordance with the invention can be
present in various formulations, preferably in a liquid form.
Furthermore, the medicament will contain adjuvants such as
stabilisers, buffers, preservatives and the like which are known to
the one skilled in the art of formulations.
[0256] The present inventor has furthermore surprisingly found that
the efficacy of the viruses described herein and in particular the
viruses used in accordance with the present invention can be
increased by using them in combination with at least two agents
whereby each of the at least two agents is individually and
independently selected from the group comprising cytostatics.
[0257] As used herein in a preferred embodiment, cytostatics are in
particular chemical or biological compounds which, during or after
the administration to a cell or an organism containing a or such
cell, result in the cell no longer growing and/or no longer
dividing or slowing down cell division and/or cell growth.
Cytostatics also comprise compounds which turn into a cytostatic in
the afore-described sense only in the cell or in an organism
containing such cell. Insofar, the term cytostatics also comprises
pre-cytostatics.
[0258] Cytostatics are grouped according to their mode of action.
The following groups are distinguished which, in principle, can all
be used within the present invention:
[0259] Alkylating agents, i.e. chemical compounds which cause their
cytotoxic effect by alkylating phosphate, amino, sulphydryl,
carboxy and hydroxy groups of the nucleic acid as well as proteins.
Such compounds are often cancerogenic themselves. Typical examples
of this group of cytostatics are cis-platin and platin derivatives,
cyclophosphamide, dacarbazine, mitomycin, procarbazine.
[0260] Antimetabolites, i.e. compounds which, due to their
structural similarity or ability for binding block a metabolic
process or affect the same. Within the group of antimetabolites it
is distinguished between structurally similar antimetabolites,
structure changing antimetabolites and the indirectly acting
antimetabolites. The structurally similar antimetabolites compete
due to chemical similarity with the metabolite without exerting the
function thereof. Structure changing antimetabolites bind to the
metabolites which impedes its function or resorption or chemically
modifies the metabolite. Indirectly acting antimetabolites
interfere with the function of the metabolite, for example by the
binding of ions. Typical examples of this group are folic acid
antagonists such as methotrexate, pyrimidine analogues such as
fluorouracil, purine analogues such as azathioprine and
mercaptopurine.
[0261] Mitosis inhibitors, i.e. compounds which inhibit cell
division. Within the group of mitosis inhibitors it is
distinguished between cell division toxins, spindle toxins and
chromosome toxins. Typical examples of this group are taxanes and
vinca alkaloids. The taxanes in turn can be divided into the two
major groups of taxoles and taxoters, whereby a particularly
preferred taxole is paclitaxel, and a particularly preferred
taxoter is docetaxel.
[0262] Antibiotics having an inhibitory effect on the DNA-dependent
RNA polymerase. Typical examples are the anthracyclines, such as,
e.g., bleomycin, daunorubicin, doxorubicin and mitomycin.
[0263] Topoisomerase inhibitors, in particular topoisomerase I
inhibitors. Topoisomerase inhibitors are chemical compounds which
determine the tertiary structure of the DNA by catalysing the
change of the DNA twist number in a three stage process.
Essentially, two forms of topoisomerases are distinguished.
Topoisomerases of type I cleave only a DNA strand and are
ATP-independent, whereas topoisomerase of type II cleave both
strands of a DNA, whereby they are ATP-dependent. Typical examples
for topoisomerase I inhibitors are irinotecan and topotecan, and
for topoisomersae II inhibitors etoposid and daunorubicin.
[0264] Within the present invention at least one and preferably two
agents are selected from the aforementioned group. It is, however,
also within the invention that in particular also three, four or
five different agents are selected. The following comments are made
for the embodiment of the present invention where only two agents
are used together with the virus. These considerations are
basically also applicable to embodiments where more than two agents
are used.
[0265] Preferably the agents differ from each other such that they
address or target different target molecules or are described in
the literature as targeting different molecules. It is within the
present invention that the agent also comprises two or more
different agents which bind to the same target molecule. It is also
within the present invention that one agent binds to a first site
of the target molecule, whereas the second agent binds to a second
site of the target molecule.
[0266] It is also within the present invention that at least two of
the agents are active using different modes of action. Active means
in a preferred embodiment that the cell growth and/or cell division
inhibiting or retarding effect of the chemical compound is mediated
through a different mode of action. In a particularly preferred
embodiment the term active means that the replication efficiency of
a virus, in particular the virus in accordance with the present
invention, of the viruses described herein and of the viruses to be
used in accordance with the present invention, is increased
compared to a scenario where one and/or both of the agents are not
used. As a measure for the efficiency of viral replication
preferably the number of viruses required for cell lysis is used,
preferably expressed as pfu/cell.
[0267] In a particularly preferred embodiment at least one of the
at least two agents is one which increases the infectability of the
cell in which the replication of the virus is to occur, preferably
is to occur in a selective manner, preferably with the virus
described herein and/or the virus to be used in accordance with the
present invention. This can, e.g., be performed by increasing the
uptake of the virus by the cell. The uptake of the virus, in
particular of adenovirus, is, for example, mediated by the
coxsackievirus-adenovirus receptor (CAR) (Mizuguchi und Hayakawa,
GENE 285, 69-77, 2002). An increased expression of CAR is, for
example, caused by trichostatin A (Vigushin et al., Clinical Cancer
Research, 7, 971-976, 2001).
[0268] In a further embodiment one of the at least two agents is
one which increases the availability of a component within the
cell, whereby the component is one which increases the replication
of the virus, preferably the virus described herein and/or the
virus to be used in accordance with the present invention.
[0269] In a further embodiment one of the at least two agents is
one which mediates the transport of YB-1 into the nucleus. Such an
agent can be selected from the group comprising topoisomerase
inhibitors, alkylating agents, antimetabolites and mitosis
inhibitors. Preferred topoisomerase inhibitors are camptothecin,
irinotecan, etoposide and their respective analogues. Preferred
mitosis inhibitors are daunorubicin, doxorubicin, paclitaxel and
docetaxel. Preferred alkylating agents are cis-platin and their
analogues. Preferred antimetabolites are fluorouracil and
methotrexat.
[0270] In a particularly preferred embodiment one of the at least
two agents is one which increases the infectability of the cell, in
particular the expression of CAR, and the second of the at least
two agents is one which increases the transport of YB-1 into the
nucleus, whereby preferably as chemical compound a compound is used
which exhibits the respective required characteristic as preferably
described above.
[0271] In a further embodiment the one of the at least two agents
is a histone deacylase inhibitor. A preferred histone deacylase
inhibitor is one which is selected from the group comprising
trichostatin A, FR901228, MS-27-275, NVP-LAQ824 and PXD101.
Trichostatin A is, for example, described in Vigushin et al.,
Clinical Cancer Research, 7, 971-976, 2001; FR901228 is, for
example, described in Kitazono et al., Cancer Res., 61, 6328-6330,
2001; MS-27-275 is described in Jaboin et al., Cancer Res., 62,
6108-6115, 2002; PXD11 is described in Plumb et al., Mol. Cancer
Ther., 8, 721-728, 2003; NVP-LAQ824 is described in Atadja et al.,
Cancer Res., 64, 689-695, 2004.
[0272] In a still further embodiment the one of the at least two
agents is a topoisomerase inhibitor, preferably a topoisomerase I
inhibitor. A preferred topoisomerse inhibitor is one which is
selected from the group comprising camptothecin, irinotecan,
topotecan, SN-38, 9-aminocamptothecin, 9-nitrocamptothecin,
DX-895If and daunorubicin. Irinotecan and SN-38 are, for example,
described in Gilbert et al., Clinical Cancer Res., 9, 2940-2949,
2003; DX-8951F is described in van Hattum et al., British Journal
of Cancer, 87, 665-672, 2002; camptothecin is described in Avemann
et al., Mol. Cell. Biol., 8, 3026-3034, 1988; 9-aminocamptothecin,
9-nitrocamptothecin are described in Rajendra et al., Cancer Res.,
63, 3228-3233, 2003; daunorubicin is described in M. Binaschi et
al., Mol. Pharmacol., 51, 1053-1059.
[0273] In a particularly preferred embodiment the one of the at
least two agents is a histone deacylase inhibitor and the other one
of the at least two agents is a topoisomerse inhibitor.
[0274] In an embodiment the means according to the present
invention and/or the means prepared in accordance with the present
invention contains the virus separate from one or several of the at
least two agents which are combined with the virus in accordance
with the present invention. It is preferred that the virus is
separate from any agent which is combined with the virus.
Preferably the separation is a spatial separation. The spatial
separation can be such that the virus is present in a different
package than the agent. Preferably the package is a single dose
unit, i.e. the virus and the agent are packed as single dosages or
doses. The single dose units may in turn be combined to form a
package. However, it is also within the present invention that the
single dosages of the virus are combined with one or several single
dosages of one or several of the agents or are packed
therewith.
[0275] The kind of package depends on the way of administration as
known to the one skilled in the art. Preferably the virus will be
present in a lyophilized form or in a suitable liquid phase.
Preferably, the agents will be present in solid form, e.g. as
tablets or capsules, however, are not limited thereto.
Alternatively, also the agents can be present in liquid form.
[0276] It is within the present invention that the virus is
systemically or locally administered. It is also within the present
invention that the agents combined with the virus are systemically
or locally administered individually and independently from each
other or together. Other modes of administration are known to the
ones skilled in the art.
[0277] It is also within the present invention that the virus and
the agents combined with it, are administered in a chronologically
separate manner or at the same time. In connection with a
chronologically separate manner it is preferred that the agents are
administered prior to the administration of the virus. How long the
agent is administered prior to the virus depends on the kind of the
agent used and is obvious for the one skilled in the art from the
mode of action of the agent used. Also the administration of the at
least two agents can occur at the same or at different points in
time. In connection with a chronologically different administration
the points of time again result from the modes of action underlying
the agents and can, based thereon, be determined by the ones
skilled in the art.
[0278] The above considerations, given in connection with the
medicaments according to the present invention which are also
disclosed and referred to herein as pharmaceutical compositions,
are roughly also applicable to any composition, including
compositions as used for the replication of viruses, preferably for
the in vitro replication of viruses in accordance with the present
invention. The above considerations are also applicable to the kit
in accordance with the present invention and the kit to be used in
accordance with the present invention, respectively, which may
apart from the viruses described herein and the viruses to be used
in accordance with the invention, also comprise one agent or a
combination of agents as described herein. Such kits comprise the
virus and/or one or several agents in a form ready for use, and
preferably instructions for use. Furthermore, the above embodiments
apply also to the nucleic acids as disclosed herein, and the
nucleic acids used in accordance with the present invention, and
the replication systems in accordance with the present invention
and the nucleic acids coding therefor, and, respectivel, the
replication systems used in accordance with the present invention
and the nucleic acids coding therefor used in accordance with the
present invention.
[0279] The present inventor has surprisingly found that the
inventive use of the viruses described herein, preferably the use
of group I adenoviruses and/or group II adenoviruses can be
practised with a very high rate of success in connection with such
tumors and that they can be used for the manufacture of medicaments
for the treatment of such tumors, which have YB-1 in the cellular
nucleus independent of the cell cycle. Normally, YB-1 is located in
the cytoplasm, in particular in the perinuclear plasm. In the G1/S
phase of the cell cycle YB-1 can be found in the nucleus of both
normal as well as tumor cells, whereby part of the YB-1 remains in
the cytoplasm [Jurchott K et al., JBC 2003, 278, 27988-27996].
This, however, is not sufficient in order to provide for viral
oncolysis using such modified adenoviruses. The comparatively low
efficacy of such attenuated adenoviruses as described in the prior
art, is ultimately based on their wrong application. In other
words, such adenoviral systems may be particularly used with a
higher efficiency in case where the molecular biological
prerequisites for viral oncolysis is given using these attenuated
or modified adenoviruses as described herein, preferably using the
group I adenoviruses and/or group II adenoviruses. In case of the
adenoviruses described herein to be used in accordance with the
present invention, such as Ad.DELTA.24, dl922-947, E1Ad/01/07,
CB016, dl520 and the recombinant adenoviruses described in European
patent EP 0 931 830, the prerequisites are given in such tumors the
cells of which show a cell cycle independent nuclear localisation
of YB-1. This kind of nuclear localisation may be caused by the
nature of the tumor itself or by the measures or inventive agents
according to the invention as described herein. The present
invention thus defines a new group of tumors and tumor diseases and
thus also of patients which may still be efficiently treated using
the viruses according to the invention as, preferably group I
adenoviruses and/or group II viruses, but also using attenuated or
modified adenoviruses already described in the prior art.
[0280] A further group of patients which may be treated in
accordance with the invention using group I adenoviruses and/or
group II adenoviruses or the adenoviruses to be used in accordance
with the present invention which are, as such, already known in the
prior art, or using the adenoviruses described herein for the very
first time, and preferably using such adenoviruses which have a
mutation and deletion, respectively, in the E1A protein which does
not interfere with the binding of Rb/E2f or which are not
replicating in YB-1 nucleus-negative cells or which show a strongly
reduced replication as defined herein, and/or which have and/or
show a deleted oncoprotein, in particular E1A, such as, for
example, in case of the viruses Ad.DELTA.24, dl922-947, E1Ad/01/07,
CB106 and the adenoviruses described in European patent EP 0 931
830, are those patients in which it is ensured that by applying or
realising specific conditions that YB-1 migrates into the nucleus
or is induced or transported there, or that deregulated YB-1 is
present. The use of group I adenoviruses and/or group II
adenoviruses in connection with this group of patients is based on
the finding that the induction of viral replication is based on
nuclear localisation of YB-1 with subsequent binding of YB-1 to the
E2-late promoter. Because of this finding disclosed herein,
adenoviruses such as Ad.DELTA.24, dl922-947, E1Ad/01/07, CB106
and/or the adenoviruses described in European patent EP 0 931 830
may also replicate in such cells which are YB-1 nucleus-positive
and/or in cells in which YB-1 is present in a deregulated manner in
the meaning of the present invention. Insofar these adenoviruses
can be used for the treatment of diseases and patient groups in
accordance with the present invention which/who comprise cells
having these characteristics, particularly if these cells are
involved in the generation of the respective disease to be treated.
This is the basis for the success of Ad.DELTA.24, dl922-947,
E1Ad/01/07, CB106, of the adenoviruses described in patent EP 0 931
830 and of the group I adenoviruses and/or group II adenoviruses in
the treatment according to the invention of such tumors which
contain YB-1 in the nucleus independent of the cell cycle or which
contain deregulated YB-1 in the meaning of the present disclosure.
A further group of patients which may be treated in accordance with
the present invention using the viruses described herein as to be
used in accordance with the present invention and using the viruses
described herein for the very first time, particularly adenoviruses
and group I and/or group II adenoviruses, respectively, are those
which are YB-1 nucleus-positive and/or YB-1 nucleus-positive as a
result of any of the treatments in the following, and/or such
patients which will undergo one of the following measures,
preferably in the sense of a treatment, prior to the administration
of the adenoviruses, concomitant with the application of the
respective viruses or after the administration of adenoviruses. It
is within the present invention that YB-1 nucleus-positive patients
are patients who in particular have YB-1 in the nucleus in a number
of the tumor forming cells independent of the cell cycle, and/or
have deregulated YB-1 in such cells. One of these measures is the
administration of cytostatics as described herein as a whole and/or
as used in connection with tumor therapy. Furthermore, irradiation
belongs to this group of measures, particularly irradiation as
applied in the tumor therapy. Irradiation particularly means the
irradiation with high energy radiation, preferably radioactive
radiation, preferably as used in tumor therapy. A further measure
is hyperthermia and the application of hyperthermia, respectively,
preferably hyperthermia as used in tumor therapy. In a particularly
preferred embodiment hyperthermia is applied locally. Finally, a
further measure is hormone treatment, particularly hormone
treatment as applied in tumor therapy. In the course of such
hormone therapy anti-estrogens and/or anti-androgens are used. In
connection therewith, anti-estrogens such as tamoxifen, are
particularly used in the treatment of breast cancer, and
anti-endrogens, such as for example flutamide or cyproteronacetate,
are particularly used in the therapy of prostate cancer.
[0281] The adenoviruses disclosed herein may also be used for the
treatment of tumors, whereby the tumor is selected from the group
comprising primary tumors, secondary tumors, tertiary tumors and
metastatic tumors. In connection therewith it is preferred that the
tumors exhibit at least one of the following features, namely that
they have YB-1 in the nucleus independent of the cell cycle,
irrespective of what the reason for this is, and/or that they
contain deregulated YB-1.
[0282] It is within the present invention that the cells and the
tumors, respectively, comprising such cells in which the
adenoviruses in accordance with the invention replicate or are
capable of replicating, are those which have one or several of the
features described herein, particularly the feature that they have
YB-1 in the nucleus independent of the cell cycle, regardless of
the reason therefor, and/or the feature that they have deregulated
YB-1, and that these cells and tumors, respectively, may be treated
using the group I adenoviruses and/or group II adenoviruses in
accordance with the present invention, and that the adenoviruses
may be used for the manufacture of a medicament for the treatment
of them, whereby the adenoviruses express a YB-1 coding nucleic
acid. Therefore, there are preferably three categories of cells and
thus of tumors in which the group I adenoviruses and group II
adenoviruses in accordance with the present invention may replicate
and which may be treated and preferably lysed using these
adenoviruses, respectively: [0283] Group A: Cells which have YB-1
in the nucleus independent of the cell cycle; [0284] Group B: Cells
which do not have YB-1 in the nucleus, particularly not independent
of the cell cycle, but comprise deregulated YB-1; and [0285] Group
C: Cells which do not have YB-1 in the nucleus, particularly not
independent of the cell cycle, and which do not comprise
deregulated YB-1.
[0286] For the cells of group A the adenoviruses in accordance with
the present invention, particularly group I adenoviruses, which do
not express additional YB-1, may be used for replication or lysis.
However, it is also possible that such adenoviruses in accordance
with the present invention, in particular group I adenoviruses
which express additional YB-1, are used for replication and lysis.
This applies also to group B. Without wishing to be bound thereto,
the reason seems to be that due to the effect of the E1B protein,
in particular the E1B55K protein, and/or the E4 protein,
particularly the E4orf6 protein, an efficient replication is
ensured by localisation of YB-1 in the nucleus and the transfer of
the same to the nucleus, respectively. YB-1 additionally expressed
by the adenoviruses, supports this process.
[0287] In case of group C, preferably those adenoviruses in
accordance with the invention, particularly group I adenoviruses
will be used for replication or lysis which additionally express
YB-1. The reason for this seems to be, again without wishing to be
bound thereto, that the above processes of viral replication are
not active in the particular cellular background such that an
efficient replication may occur. Only by providing YB-1 and
expressing YB-1, respectively, an efficient replication may occur,
whereby the underlying mechanism seems to be such that the
overexpression of YB-1 results in nuclear localisation of YB-1 as
also described by Bargou [Bargout R. C. et al., Nature Medicine
1997, 3, 447-450) and Jurchott [Jurchott K. et al., JBC 2003, 278,
27988-27966].
[0288] It is within the present invention that some of the tumor
forming cells which either inherently contain YB-1 in the nucleus
or do so or after induction and active introduction into the
nucleus or which comprise deregulated YB-1 in the meaning of the
present disclosure. Preferably about 5% or any percentage higher
than that, i.e. 6%, 7%, 8% etc., of the tumor forming cells are
such YB-1 nucleus-positive cells or cells in which deregulated YB-1
is present. For other tumors such as breast tumor, osteosarcoma,
ovarian carcinoma, synovial carcinoma or lung carcinoma the
percentage of tumor cells which comprise deregulated YB-1 or which
show nuclear localisation of YB-1 independent of the cell cycle,
may be about 30 to 50% [Kohno K. et al., BioEssays 2003, 25,
691-698]. Such tumors may preferably be treated using the
adenoviruses in accordance with the present invention. Nuclear
localisation of YB-1 may be induced by outside stress and locally
applied stress, respectively. This induction may occur through
irradiation, particularly UV-irradiation, application of
cytostatics as, among others, also disclosed herein, and
hyperthermia. In connection with hyperthermia it is important that
it may be realized in a very specific manner, particularly a local
manner, and that thus also a specific nuclear transport of YB-1
into the nucleus may be caused and, because of this, the
prerequisites for replication of the adenovirus and thus of cell
and tumor lysis are given, which preferably is locally limited
(Stein U, Jurchott K, Walther W, Bergmann, S, Schlag P M, Royer H
D. J Biol Chem. 2001, 276(30):28562-9; Hu Z, Jin S, Scotto K W. J
Biol Chem. 2000 Jan. 28; 275(4):2979-85; Ohga T, Uchiumi T, Makino
Y, Koike K, Wada M, Kuwano M, Kohno K. J Biol Chem. 1998,
273(11):5997-6000).
[0289] The medicament of the invention would thus also be
administered to patients and groups of patients or would be
designed for them, where by appropriate pre- or post-treatment or
concomitant treatment a transport of YB-1, particularly in the
respective tumor cells, is caused and deregulated YB-1 is generated
in the cell, respectively.
[0290] Based on the technical teaching provided herein, it is
within the skills of the one of the art to suitably modify
particularly E1A which may, for example, comprise the generation of
deletions or point mutations in order to thus generate different
embodiments of the adenoviruses which may be applied in the use in
accordance with the present invention.
[0291] As already mentioned, group I and/or group II adenoviruses
are capable of replicating in such cells and cellular systems,
which have YB-1 in the nucleus. For the question whether also these
adenoviruses used in accordance with the invention are capable of
replicating and are thus capable of tumor lysis, the status of the
cells with regard to the presence or absence of Rb, i.e. the
retinoblastome tumor suppressor product, is irrelevant.
Furthermore, for the use of said adenoviruses in accordance with
the present invention, it is not necessary to take into account the
p53 status of the infected cells, of the cells to be infected or of
the cells to be treated as, when using the adenoviral systems
disclosed herein in connection with YB-1 nucleus-positive cells,
i.e. cells having YB-1 in the nucleus independent of the cell
status, the p53 status as well as the Rb status does not have any
impact on the replication of the adenovirus for the practising the
technical teaching disclosed herein.
[0292] The transactivating oncogene and oncogene protein,
respectively, in particular E1A, preferably of the group II
adenoviruses, can be either under the control of the proprietary
natural adenoviral promoters and/or be controlled through a
tumor-specific or tissue-specific promoter. Suitable non-adenoviral
promoters can be selected from the group comprising cytomegalovirus
promoter, RSV (rous sarcoma virus) promoter, adenovirus-based
promoter Va I and the non-viral YB-1 promoter (Makino Y. et al.,
Nucleic Acids Res. 1996, 15, 1873-1878). Further promoters which
may be used in connection with any aspect of the invention
disclosed herein, are the telomerase promoter, the
alpha-fetoprotein (AFP) promoter, the caecinoembryonic antigen
promoter (CEA) (Cao, G., Kuriyama, S., Gao, J., Mitoro, A., Cui,
L., Nakatani, T., Zhang, X., Kikukawa, M., Pan, X., Fukui, H., Qi,
Z. Int. J. Cancer, 78, 242-247, 1998), the L-plastin promoter
(Chung, I., Schwartz, P E., Crystal, R C., Pizzomo, G, Leavitt, J.,
Deisseroth, A B. Cancer Gene Therapy, 6, 99-106, 1999), argenine
vasopressin promoter (Coulson, J M, Staley, J., Woll, P J. British
J. Cancer, 80, 1935-1944, 1999), E2f promoter (Tsukada et al.,
Cancer Res., 62, 3428-3477, 2002), uroplakin II promoter (Zhang et
al., Cancer Res., 62, 3743-3750, 2002) and the PSA promoter
(Hallenbeck P L, Chang, Y N, Hay, C, Golightly, D., Stewart, D.,
Lin, J., Phipps, S., Chiang, Y L. Human Gene Therapy, 10,
1721-1733, 1999), tyrosinase promoter (Nettelbeck, DM. Anti-Cancer
Drugs, 14, 577-584, 2003), cyclooxygenase 2 promoter (Nettelbeck, D
M., Rivera, A A, Davydova, J., Dieckmann, D., Yamamoto, M., Curiel,
D T. Melanoma Res., 13, 287-292, 2003) and inducing systems such as
tetracycline (Xu, X L., Mizuguchi, H., Mayumi, T., Hayakawa, T.
Gene, 309, 145-151, 2003). Furthermore, the YB-1 dependent E2 late
promoter of adenoviruses as described in German patent application
DE 101 50 984.7 is a promoter which may be used in connection with
the present invention.
[0293] About the telomerase promoter it is known that it is of
crucial importance in human cells.
[0294] Accordingly, telomerase activity is regulated through
transcriptional control of the telomerase reverse transcriptase
gene (hTERT) which is a catalytic subunit of the enzyme. Expression
of the telomerase is active in 85% of the human tumor cells. In
contrast thereto it is inactive in most normal cells. Except
therefrom are germ cells and embryonic tissue (Braunstein, I. et
al., Cancer Research, 61, 5529-5536, 2001; Majumdar, A. S. et al.,
Gene Therapy 8, 568-578, 2001). Detailed studies of the hTERT
promoter have shown that the fragments of the promoter separated
from the initiation codon 283 bp and 82 bp, respectively, are
sufficient for specific expression in tumor cells (Braunstein I. et
al.; Majumdar A S et al., supra). Therefore, this promoter and the
specific fragments, respectively, are suitable for specific
expression in tumor cells of a gene and in particular of a
transgene, preferably one of the transgenes disclosed herein. The
promoter is to allow for the expression of the modified oncogene,
preferably the E1A oncogene protein, in tumor cells only. Also, in
an embodiment the expression of a transgene in an adenoviral vector
under the control of these promoters is contemplated, preferably of
a transgene which is selected from the group comprising E4orf6,
E1B55 kD, ADP and YB-1. It is also within the present invention
that the reading frame of the transactivating oncogene protein, in
particular the E1A protein is in frame with one or several gene
products of the adenoviral system. The reading frame of the
transactivating E1A protein, however, may also be independent
therefrom.
[0295] The various transgenes, thus also E1B55 kD, E4orf6, ADP and
the like, in particular if they are viral genes, can, in principle,
be cloned from any respective virus, preferably adenovirus. In the
prior art furthermore a multitude of plasmids is described which
contain respective genes and from which these may subsequently be
taken and introduced into the adenoviruses of the present invention
as well as into the viruses used in accordance with the present
invention. An example for such a plasmid which expresses E1B55 kD,
is, for example, described by Dobbelstein, M. et al., EMBO Journal,
16, 4276-4284, 1997. The coding region of the E1B55K gene can be
excised together with the 3' non-translating region for example
from this gene by Bam HI from plasmid pDCRE1B. The corresponding
fragment comprising the E1B55 kD gene as well as the 3' non-coding
region corresponds to nucleotides 20194107 of adenovirus type 5. It
is, however, also within the present invention that the E1B55 kD
gene is excised by means of restriction enzyme Bam HI and BfrI from
said plasmid and is subsequently cloned into the adenovirus.
[0296] It is within the present invention that, if not indicated to
the contrary, in case it is referred to viruses of the present
invention it is referred to both the nucleic acid coding therefore
as well as the adenoviral particles, preferably including the
respective nucleic acid. The respective nucleic acid may also be
present as being integrated in a different vector.
[0297] It is within the present invention that the various
promoters described above are also used in connection with the
various embodiments of the adenoviruses in accordance with the
invention, preferably the group I adenoviruses, particularly in
case a promoter is to be used which is different from the one which
controls the expression of the respective protein or expression
product in wildtype adenoviruses. The aforementioned promoters are
thus suitable heterologous promoters in the meaning of the present
invention. In preferred embodiments of the adenoviruses in
accordance with the invention, particularly the group I
adenoviruses, it is contemplated that when applying the
adenoviruses for cells of group A and B as defined above, this
occurs such that the expression of the E1B protein and/or the E4
protein starts from such heterologous promoters, whereby
preferably, but not exclusively, the expression of the E1A protein
is controlled by YB-1. The expression of the E1A protein is in this
and other embodiments under the control of a YB-1 controllable
promoter such as for example the adenoviral E2-late promoter. This
is also true in that case where the E1B protein and/or the E4
protein is/are expressed in an expression cassette.
[0298] In preferred embodiments of the adenoviruses in accordance
with the invention, particularly the group I adenoviruses, it is
contemplated that when applying the adenoviruses in connection with
cells of group C the promoter is each and independently a
tumor-specific, organ-specific or tissue-specific promoter. In
connection therewith it is sufficient when at least one of the
promoters which control the expression of the E1B protein, the E4
protein and/or the E1A protein, is such a specific promoter. By
this tumor, organ and tissue specificity, it is ensured that
replication of the adenoviruses in accordance with the invention
happens only in cells of the respective tumor, organ or tissue and
that, apart from that, no further tissue is damaged by the
replication of the adenoviruses such as, for example, is lysed.
Preferably, still a second and more preferably all three proteins
are controlled by such tumor-specific, organ-specific or
tissue-specific promoters. Using such adenoviruses it is possible
to lyse also those cells which do not form a tumor or which cannot
develop into such tumor, but which are for other reasons such as
medicinal reasons to be destroyed or to be removed from the
organism, preferably a mammalian and more preferably a human
organism, for example because they produce an undesired factor or
produce such factor at a too high level.
[0299] It is contemplated that, in an embodiment, the cells for the
lysis of which the described adenoviruses in accordance with the
invention are used, are resistant, preferably show a multiple
resistance.
[0300] Resistances as referred to herein and which are
characteristic for the tumors and patients to be treated, are those
which are mediated by the following genes, however, are not limited
thereto: MDR, MRP, topoisomerase, BCL2, glutathione-2-transferase
(GST), protein kinase C (PKC). As the effect of cytostatics is
based, among others, on the induction of apoptosis, the expression
of apoptosis-relevant genes plays a crucial role in the generation
of any resistance so that the following factors are also relevant
with regard thereto, namely Fas, the BCL2 family, HSP 70 and EGFR
[Kim et al., Cancer Chemther. Pharmacol. 2002, 50, 343-352].
[0301] It has been described by Levenson et al. [Levenson, V. V. et
al., Cancer Res., 2000, 60, 5027-5030] that the expression of YB-1
is strongly increased in resistant tumor cells compared to
non-resistant tumor cells.
[0302] Resistance as used herein, preferably refers to a resistance
against the cytostatics described herein. This multiple resistance
preferably goes along with the expression, preferably an
overexpression, of the membrane bound transporter protein P
glycoprotein which may be used as a marker for determining
respective cells and thus also of tumors exhibiting such marker and
respective patient groups. The term resistance as used herein also
comprises both the resistance which is referred to as classical
resistance mediated through P glycoprotein, as well as the
resistance referred to as atypical resistance which is mediated by
MRP or other, non-P-glycoprotein mediated resistances. A further
marker which correlates with the expression of YB-1 is
topoisomerase II alpha. Insofar topoisomerase II alpha may be used
in a screening method instead of or in addition to determining YB-1
in the nucleus in order to decide whether a patient may be treated
in accordance with the invention using the adenoviruses with an
expectation of success. A marker which, in principle, may be
similarly used as the P glycoprotein, is MRP. A further marker, at
least to the extent that colorectal carcinoma cells or patients
having colorectal carcinoma are concerned, is PCNA (proliferating
cell nuclear antigen) (Hasan S. et al., Nature, 15, 387-391, 2001),
as, for example, described by Shibao K. et al. (Shibao K et al.,
Int. Cancer, 83, 732-737, 1999). Finally, at least in the field of
breast cancer and osteosarcoma cells, the expression of MDR
(multiple drug resistance) is a marker in the afore-described
meaning (Oda Y et al., Clin. Cancer Res., 4, 2273-2277, 1998). A
further potential marker which may be used in accordance with the
invention is p73 (Kamiya, M., Nakazatp, Y., J Neurooncology 59,
143-149 (2002); Stiewe et al., J. Biol. Chem., 278, 14230-14236,
2003).
[0303] Finally, it shall also be referred to YB-1 as a prognostic
marker in breast cancer which may be used in the present invention.
Only in patients having increased expression of YB-1 in the primary
tumor, a recurrence occurs after surgery and chemotherapy [Janz M.
et al. Int. J. Cancer 2002, 97, 278-282].
[0304] It is a particular advantage of the present invention that
also those patients may be subject to treatment using in accordance
with the invention the adenoviruses described herein, which
otherwise cannot be treated anymore in the medicinal-clinical sense
and where thus a further treatment of the tumor diseases using the
methods of the prior art is no longer possible with an expectation
of success, in particular where the use of cytostatics and
irradiation is no longer reasonably possible and cannot be
successfully carried out any longer in the sense of influencing or
reducing the tumor. Herein the term tumor refers in general also to
any tumor or cancer disease which either inherently contains YB-1
in the cellular nucleus, preferably independent of the cell cycle,
or does so by applying exogenous measures, as disclosed herein,
and/or which contains deregulated YB-1.
[0305] Additionally, the viruses described herein can, in
principle, be used for the treatment of tumors.
[0306] The tumours which can in particular be treated by the
viruses described herein are preferably those tumours which are
selected from the group comprising tumours of the nervous system,
ocular tumours, tumours of the skin, tumours of the soft tissue,
gastrointestinal tumours, tumours of the respiratory system, tumour
of the skeleton, tumours of the endocrine system, tumours of the
female genital system, tumours of a mammary gland, tumours of the
male genital system, tumours of the urinary outflow system, tumours
of the haematopoietic system including mixed and embryonic tumours.
It is within the present invention that these tumours are in
particular resistant tumours as in particular defined herein.
[0307] The group of tumors of the nervous system preferably
comprises: [0308] 1. Tumors of the skull as well as of the brain
(intracranial), preferably astrocytoma, oligodendroglioma,
meningioma, neuroblastoma, ganglioneuroma, ependymoma,
schwannoglioma, neurofibroma, haemangioblastoma, lipoma,
craniopharyngioma, teratoma and chordoma; [0309] 2. Tumors of the
spinal cord and of the vertebral canal, preferably glioblastoma,
meningioma, neuroblastoma, neurofibroma, osteosarcoma,
chondrosarcoma, haemangiosarcoma, fibrosarcoma and multiple
myeloma; and [0310] 3. Tumors of the peripheral nerves, preferably
schwannoglioma, neurofibroma, neurofibrosarcoma and perineural
fibroblastoma.
[0311] The group of the ocular tumors preferably comprises: [0312]
1. Tumors of the eyelids and of the lid glands, preferably adenoma,
adenocarcinoma, papilloma, histiocytoma, mast cell tumor,
basal-cell tumor, melanoma, squamous-cell carcinoma, fibroma and
fibrosarcoma; [0313] 2. Tumors of the conjunctiva and of the
nictitating membrane, preferably squamous-cell carcinoma,
haemangioma, haemangiosarcoma, adenoma, adenocarcinoma,
fibrosarcoma, melanoma and papilloma; and
[0314] 3. Tumors of the orbita, the optic nerve and of the eyeball,
preferably retinoblastoma, osteosarcoma, mast cell tumor,
meningioma, reticular cell tumor, glioma, schwannoglioma,
chondroma, adenocarcinoma, squamous-cell carcinoma, plasma cell
tumor, lymphoma, rhabdomyosarcoma and melanoma.
[0315] The group of skin tumors preferably comprises: [0316] Tumors
of the histiocytoma, lipoma, fibrosarcoma, fibroma, mast cell
tumor, malignant melanoma, papilloma, basal-cell tumor,
keratoacanthoma, haemangiopericytoma, tumors of the hair follicles,
tumors of the sweat glands, tumors of the sebaceous glands,
haemangioma, haemangiosarcoma, lipoma, liposarcoma, malignant
fibrous histiocytoma, plasmacytoma and lymphangioma.
[0317] The group of tumors of the soft-tissues preferably
comprises: [0318] Tumors of the alveolar soft-tissue sarcoma,
epithelioid cell sarcoma, chondrosarcoma of the soft-tissue,
osteosarcoma of the soft-tissues, Ewing's sarcoma of the
soft-tissues, primitive neuroectodermal tumors (PNET),
fibrosarcoma, fibroma, leiomyosarcoma, leiomyoma, liposarcoma,
malignant fibrous histiocytoma, malignant haemangiopericytoma,
haemangioma, haemangiosarcoma, malignant mesenchymoma, malignant
peripheral nerve sheath tumor (MPNST, malignant schwannoglioma,
malignant melanocytic schwannoglioma, rhabdomyosarcoma, synovial
sarcoma, lymphangioma and lymphangiosarcoma.
[0319] The group of gastrointestinal tumors preferably comprises:
[0320] 1. Tumors of the oral cavity and of the tongue, preferably
squamous-cell carcinoma, fibrosarcoma, Merkel cell tumor, inductive
fibroameloblastoma, fibroma, fibrosarcoma, viral papillomatosis,
idiopathic papillomatosis, nasopharyngeal polyps, leiomyosarcoma,
myoblastoma and mast cell tumor; [0321] 2. Tumors of the salivary
glands, preferably adenocarcinoma; [0322] 3. Tumors of the
oesophagus, preferably squamous-cell carcinoma, leiomyosarcoma,
fibrosarcoma, osteosarcoma, Barrett carcinoma and paraoesophageal
tumors; [0323] 4. Tumors of the exocrine pancreas, preferably
adenocarcinoma; and [0324] 5. Tumors of the stomach, preferably
adenocarcinoma, leiomyoma, leiomyosarcoma and fibrosarcoma.
[0325] The group of the tumors of the respiratory system preferably
comprises: [0326] 1. Tumors of the nose and nasal cavity, of the
larynx and of the trachea, preferably squamous-cell carcinoma,
fibrosarcoma, fibroma, lymphosarcoma, lymphoma, haemangioma,
haemangiosarcoma, melanoma, mast cell tumor, osteosarcoma,
chondrosarcoma, oncocytoma (rhabdomyoma), adenocarcinoma and
myoblastoma; and [0327] 2. Tumors of the lung, preferably
squamous-cell carcinoma, fibrosarcoma, fibroma, lymphosarcoma,
lymphoma, haemangioma, haemangiosarcoma, melanoma, mast cell tumor,
osteosarcoma, chondrosarcoma, oncocytoma (rhabdomyoma),
adenocarcinoma, myoblastoma, small-cell carcinoma, non-small cell
carcinoma, bronchial adenocarcinoma, bronchoalveolar adenocarcinoma
and alveolar adenocarcinoma.
[0328] The group of the skeleton tumors preferably comprises:
[0329] osteosarcoma, chondrosarcoma, parosteal osteosarcoma,
haemangiosarcoma, synovial cell sarcoma, haemangiosarcoma,
fibrosarcoma, malignant mesenchymoma, giant-cell tumor, osteoma and
multilobular osteoma.
[0330] The group of the tumors of the endocrine system preferably
comprises: [0331] 1. Tumors of the thyroid gland/parathyroid,
preferably adenoma and adenocarcinoma; [0332] 2. Tumors of the
suprarenal gland, preferably adenoma, adenocarcinoma and
pheochromocytoma (medullosuprarenoma); [0333] 3. Tumors of the
hypothalamus/hypophysis, preferably adenoma and adenocarcinoma;
[0334] 4. Tumors of the endocrine pancreas, preferably insulinoma
(beta cell tumor, APUDom) and Zollinger-Ellison syndrome (gastrin
secernent tumor of the delta cells of the pancreas); and [0335] 5.
as well as multiple endocrine neoplasias (MEN) and
chemodectoma.
[0336] The group of the tumors of the female sexual system tumors
preferably comprises: [0337] 1. Tumors of the ovaries, preferably
adenoma, adenocarcinoma, cystadenoma, and undifferentiated
carcinoma; [0338] 2. Tumors of the uterine, preferably leiomyoma,
leiomyosarcoma, adenoma, adenocarcinoma, fibroma, fibrosarcoma and
lipoma; [0339] 3. Tumors of the cervix, preferably adenocarcinoma,
adenoma, leiomyosarcoma and leiomyoma; [0340] 4. Tumors of the
vagina and vulva, preferably leiomyoma, leiomyosarcoma,
fibroleiomyoma, fibroma, fibrosarcoma, polyps and squamous-cell
carcinoma.
[0341] The group of tumors of the mammary glands preferably
comprises: [0342] fibroadenoma, adenoma, adenocarcinoma,
mesenchymal tumora, carcinoma, carcinosarcoma.
[0343] The group of the tumors of the male sexual system preferably
comprises: [0344] 1. Tumors of the testicles, preferably seminoma,
interstitial-cell tumor and Sertoli cell tumor; [0345] 2. Tumors of
the prostate, preferably adenocarcinoma, undifferentiated
carcinoma, squamous-cell carcinoma, leiomyosarcoma and transitional
cell carcinoma; and [0346] 3. Tumors of the penis and the external
gentials, preferably mast cell tumor and squamous-cell
carcinoma.
[0347] The group of tumors of the urinary outflow system preferably
comprises: [0348] 1. Tumors of the kidney, preferably
adenocarcinoma, transitional cell carcinoma (epithelial tumors),
fibrosarcoma, chondrosarcoma (mesenchymal tumors), Wilm's tumor,
nephroblastoma and embryonal nephroma (embryonal pluripotent
blastoma); [0349] 2. Tumors of the ureter, preferably leiomyoma,
leiomyosarcoma, fibropapilloma, transitional cell carcinoma; [0350]
3. Tumors of the urinary bladder, preferably transitional cell
carcinoma, squamous-cell carcinoma, adenocarcinoma, botryoid
(embryonal rhabdomyosarcoma), fibroma, fibrosarcoma, leiomyoma,
leiomyosarcoma, papilloma and haemangiosarcoma; and [0351] 4.
Tumors of the urethra, preferably transitional cell carcinoma,
squamous-cell carcinoma and leiomyosarcoma.
[0352] The group of tumors of the haematopoietic system preferably
comprises: [0353] 1. Lymphoma, lymphatic leukemia, non-lymphactic
leukemia, myeloproliferative leukemia, Hodgkin's lymphoma,
Non-Hodgkin's lymphoma.
[0354] The group of the mixed and embryonal tumors preferably
comprises: [0355] Haemangiosarcoma, thymoma and mesothelioma.
[0356] In a particularly preferred embodiment these tumors are
selected from the group comprising breast cancer, ovary carcinoma,
prostate carcinoma, osteosarcoma, glioblastoma, melanoma,
small-cell lung carcinoma and colorectal carcinoma. Further tumors
are those which are resistant as described herein, preferably those
which are multiple resistant, particularly also those tumors of the
group described above. Especially preferred tumors are also those
selected from the group comprising breast tumors, bone tumors,
stomach tumors, intestinal tumors, gallbladder tumors, pancreatic
tumors, liver tumors, kidney tumors, brain tumors, ovary tumors,
tumors of the skin and of cutaneous appendages, head/neck tumors,
uterus tumors, synovial tumors, larynx tumors, oesophageal tumors,
tongue tumors and prostate tumors. It is preferred that these
tumors are those which are, regarding their manifestations,
disclosed herein altogether.
[0357] The adenoviruses of the invention, preferably the group I
adenoviruses and the adenoviruses to be used in accordance with the
invention, preferably the group II adenoviruses.
[0358] The use of the adenoviruses disclosed herein, particularly
group I adenoviruses and/or group II adenoviruses as medicaments
and in particular in connection for systemic administration can be
improved by a suitable targeting of the adenoviruses. The infection
of tumor cells by adenoviruses depends, among others, to a certain
extent on the presence of the coxackievirus-adenovirus receptor CAR
and distinct integrins. As soon as they are strongly expressed in
cells, preferably tumor cells, an infection is possible already at
very low titers (pfu/cell). Various strategies have been tried to
date in order to reach a so-called re-targeting of recombinant
adenoviruses, for example by inserting heterologous sequences in
the fiber knob region, using bi-specific antibodies, coating of the
adenoviruses with polymers, introducing ligands in the Ad fiber,
substituting the serotype 5 knob and serotype 5 fiber shaft and
knop by the serotype 3 knob and Ad 35 fiber shaft and knob, and
modification of the penton base, respectively (Nicklin S. A. et
al., Molecular Therapy 2001, 4, 534-542; Magnusson, M. K. et al.,
J. of Virology 2001, 75, 7280-7289; Barnett B. G. et al.,
Biochimica et Biophysica Acta 2002, 1575, 1-14). The realisation in
connection with the various aspects of the present invention of
such further embodiments and features, respectively, in the
adenoviruses in accordance with the invention and the adenoviruses
used in accordance with the invention, particularly in group I
adenoviruses and group II adenoviruses, is within the present
invention.
[0359] The invention is related in a further aspect to a method for
the screening of patients which may be treated using a modified
adenovirus, i.e. an adenovirus as used in accordance with the
invention, such as, for example, Ad.DELTA.24, dl922-947,
E1Ad/01/07, CB016 or the viruses described in European patent EP 0
931 830, and/or a group I adenovirus and/or group II adenovirus,
whereby the method comprises the following steps: [0360] Analysing
a sample of the tumor tissue and [0361] Determining whether YB-1 is
localised in the nucleus independent of the cell cycle, or whether
the cells contain deregulated YB-1.
[0362] Instead of or in addition to YB-1 also the presence of the
afore-described markers can be assessed.
[0363] In case that the tumor tissue or a part thereof comprises
YB-1 in the nculeus, preferably independent of the cell cycle, or
comprises deregulated YB-1, the adenoviruses as disclosed herein,
particularly group I adenoviruses and/or group II adenoviruses may
be used in accordance with the present invention.
[0364] In an embodiment of the method according to the invention it
is contemplated that the analysis of the tumor tissue occurs by
means of an agent which is selected from the group comprising
antibodies against YB-1, aptamers against YB-1, spiegelmers against
YB-1 as well as anticalines against YB-1. In principle, the same
kind of agents can also be made and used, respectively, for the
respective markers. The manufacture of antibodies, in particular
monoclonal antibodies, is known to the ones skilled in the art. A
further agent for specific detection of YB-1 or the markers are
peptides which bind with a high affinity to their target
structures, in the present case YB-1 or said markers. In the prior
art methods are known such as, for example, phage-display, in order
to generate such peptides. For such purpose, it is started from a
peptide library whereby the individual peptides have a length of
about 8 to 20 amino acids and the size of the library is about
10.sup.2 to 10.sup.18, preferably 10.sup.8 to 10.sup.15 different
peptides. A particular form of target molecule binding polypeptides
are the so-called anticalines which are, for example, described in
German patent application DE 197 42 706.
[0365] A further agent for specifically binding to YB-1 or the
corresponding markers disclosed herein and thus for the detection
of a cell cycle independent localisation of YB-1 in the nucleus,
are the so-called aptamers, i.e. D-nucleic acids, which, based on
RNA or DNA, are present as either a single strand or a double
strand and specifically bind to a target molecule. The generation
of aptamers is, for example, described in European patent EP 0 533
838. A special embodiment of aptamers are the so-called aptazymes
which, for example, are described by Piganeau, N. et al. (2000),
Angew. Chem. Int. Ed., 39, no. 29, pages 4369-4373. They are a
particular embodiment of aptamers insofar as they comprise apart
from the aptamer moiety a ribozyme moiety and, upon binding or
release of the target molecule binding to the aptamer moiety, the
ribozyme moiety becomes catalyctically active and cleaves a nucleic
acid substrate which goes along with generation of a signal.
[0366] A further form of the aptamers are the so-called
spiegelmers, i.e. target molecule binding nucleic acids which
consist of L-nucleic acids. The method for the generation of such
spiegelmers is, for example, described in WO 98/08856.
[0367] The sample of the tumor tissue can be obtained by
punctuation or surgery. The assessment whether YB-1 is located in
the nucleus independent of the cell cycle is frequently done by the
use of microscopic techniques and/or immunohistoanalysis, typically
using the antibody or any of the further agents described above.
Further methods for the detection of YB-1 in the nucleus and that
its localisation there is independent of the cell cycle, are known
to the one skilled in the art. For example, localisation of YB-1
can easily be detected when scanning tissue slices stained against
YB-1. The frequency of YB-1 being in the nucleus is already an
indication that the localisation in the nucleus is independent of
the cell cycle. A further possibility for cell cycle independent
detection of YB-1 in the nucleus is the staining against YB-1 and
assessment whether YB-1 is localised in the nucleus and determining
the phase of the cells. This and the detection of YB-1,
respectively, however, can also be performed using the
afore-mentioned agents directed against YB-1. The detection of the
agents is done by procedures known to the one skilled in the art.
Because said agents are specifically directed against YB-1 and
insofar do not bind to other structures within the sample to be
analysed, particularly other structures of the cells, both the
localisation of said agents by means of a suitable labelling of the
agents and due to their specific binding to YB-1, also the
localisation of YB-1 can be detected and assessed accordingly.
Methods for the labelling of the agents are known to the ones
skilled in the art. The same techniques may also be used in order
to determine whether and if so how many of the cells of the sample
contain deregulated YB-1. As deregulated YB-1 also shows an
overexpression compared to non-deregulated YB-1, the relative
expression of YB-1 compared to a reference sample may be used in
order to determine whether YB-1 is deregulated in the analysed
cell.
[0368] It is within the present invention that the viruses
described herein, whether they are the viruses of the present
invention or whether they are the viruses to be used in accordance
with the present invention, are also used in connection with
diseases, preferably tumor diseases and more preferably tumor
diseases where at least a part of the tumor cells exhibits a
multiple resistance, in particular a multi-drug resistance, in
which YB1 is deregulated. This applies also to each and any other
aspect as described herein in connection with the cells and tumors
to the extent that it refers to cells and diseases where YB1 is
present in the nucleus, preferably independent of the cell
cycle.
[0369] The present invention shall now be further illustrated using
the figures and examples, whereby novel features, embodiments and
advantages of the invention may be taken therefrom. In connection
therewith
[0370] FIG. 1 shows the structural design of the adenoviral vectors
referred to therein as AdE1/E3-minus adenoviral vectors which are
E1/E3-deleted adenoviruses, of wildtype adenovirus and of
adenovirus dl520;
[0371] FIG. 2 shows the binding domains of the E1A proteins with
respect to the binding of p300, p107 and p105;
[0372] FIG. 3 shows U2OS cells which do not have YB-1 in the
nucleus, after infection with the E1/E3-deleted adenovirus Ad5
referred to therein as E1/E3-minus Ad5, and dl520;
[0373] FIG. 4 shows 257RDB cells which contain YB-1 in the nucleus,
after infection with the E1/E3-deleted adenovirus Ad5 referred to
therein as E1/E3-minus Ad5, and adenovirus dl520;
[0374] FIG. 5 shows 257RDB cells and U2OS cells after infection
with adenovirus dl 119/1131;
[0375] FIG. 6 shows the result of an EMSA analysis which confirms
that YB-1 is present in the cellular nucleus in multi-resistant
cells and in cell lines 257RDB, 181 RDB, MCF-7Ad, whereas YB-1 is
not present in the nucleus of US2OS and HeLa cells;
[0376] FIG. 7 shows the structural design of the E1A protein of
wildtype adenovirus, of adenovirus dl520 and of adenovirus
dl119/1131;
[0377] FIG. 8 shows a bar graph indicating replication efficiency
of adenovirus in the presence of additionally expressed viral
proteins in absolute figures;
[0378] FIG. 9 shows a bar graph indicating the increase in
replication efficiency of adenoviruses in the presence of
additionally expressed viral proteins;
[0379] FIG. 10 shows wells with U2OS cells grown therein after
crystal violet staining and infection with dl520 with 10 and 30
pfu/cell and control (K), respectively, without administration of
daunorubicin and with administration of 40 ng daunorubicin per
ml;
[0380] FIG. 11 shows wells having HeLa cells grown therein after
crystal violet staining and infection with dl520 with 10 and 30
pfu/cell and control (K), respectively, without administration of
daunorubicin and with administration of 40 ng daunorubicin per
ml;
[0381] FIG. 12 shows a diagram of the tumor volume as a function of
time of tumors of different origin (RDB257 and HeLa) after
treatment with PBS and dl520, respectively;
[0382] FIG. 13 shows pictures of sacrificed mice which developed a
tumor based on RDB257 cells, after treatment with PBS and
5.times.10.sup.8 pfu dl520, respectively;
[0383] FIG. 14 shows the result of a Southern blot analysis of a
cell extract (of subcutaneously grown tumors) of RDB257 cells and
HeLa cells after infection with dl520;
[0384] FIG. 15 shows a bar graph indicating replication efficiency
and particle formation of dl520 and wildtype adenovirus in YB-1
nucleus-positive tumor cells (257RDB and 181RDB) and YB-1
nucleus-negative tumor cells (HeLa, U2OS);
[0385] FIG. 16 shows the structural design of wildtype adenovirus
and the adenoviral vector AdXVir03;
[0386] FIG. 17 shows the structural design of the adenoviral vector
AdXVir03/01; and
[0387] FIG. 18A/B shows wells having grown 18RDB cells (FIG. 18A)
and 272RDB cells (FIG. 18B) after crystal violet staining and
infection with Ad312 (20 pfu/cell), Xvir03 (5 pfu/cell) and control
(non-infected), whereby crystal violet staining was performed five
days after infection;
[0388] FIG. 19 shows the result of a Northern blot analysis of the
expression of the E2 gene in A549 cells and U2OS cells after
infection with wildtype adenovirus Ad5 and adenovirus Ad312;
[0389] FIG. 20 shows the result of a Northern blot analysis of the
expression of the E2 gene in U2OS cells after infection with
wildtype adenovirus and adenovirus delta24 after 12 and 24
hours;
[0390] FIG. 21 shows the structural design of the adenoviral vector
XvirPSJL1;
[0391] FIG. 22 shows the structural design of the adenoviral vector
XvirPSJL2;
[0392] FIG. 23 shows wells with HeLa cells grown therein after
crystal violet staining and infection with adenovirus dl520 using
different pfu/cells;
[0393] FIG. 24 shows a bar graph indicating the activity of
luciferase in U2OS cells, HeLa cells and 257RDB cells upon usage of
different promoter fragments of the adenoviral E2-late
promoter;
[0394] FIG. 25 shows a bar graph indicating the number of viral
particles after infection of U2OS cells with a YB-1 expressing
adenovirus and virus Ad312 after two and five days, whereby a
distinction is made between intracellularly remaining viral
particles (represented in black) and released extracellular viral
particles (horizontally striped);
[0395] FIG. 26 shows the result of a Southern Blot analysis of the
replication behaviour of Adenovirus dl 520 in U373 cells with and
without treatment of the cells with irinotecan;
[0396] FIG. 27 shows the result of a Southern Blot analysis of the
replication behaviour of adenovirus dl 520 in U 373 cells with and
without treatment of the cells with trichostatin A;
[0397] FIG. 28 shows the result of a FACS analysis of U 373 cells
treateed with trichostatin for the expression of
Coxsackievirus-Adenovirus receptor (CAR), expressed as percentage
of CAR-psotive cells;
[0398] FIG. 29 shows four different panels of cell layer for the
illustration of the effecto of replicating adenovirus dl520 and
irinotecan and trichostatin in different combinations;
[0399] FIG. 30 shows a schematic representation of the ORF of
E1B55K with the 3'UTR fragment and the restriction site BfrI at
position 3532;
[0400] FIG. 31 shows the sequence of the E1B55k-3'UTR region
corresponding sequence position 3507 to 4107 of wildtype Ad5;
and
[0401] FIG. 32 shows a schematic representation of a universal
shuttle plasmid for the generation of E3/E4 modified recombinant
adenoviruses having the RGD motif.
EXAMPLE 1
Types of E1A Modifications as May be Comprised by the Adenoviruses
Which are Used in Accordance with the Invention
[0402] FIG. 1 shows the structural design of adenoviral vectors
AdE1/E3-minus, i.e. E1/E3-deleted adenoviruses, wildtype adenovirus
and adenovirus dl520.
[0403] Adenovirus AdE1/E3-minus does not have a region coding for a
functional E1A or a functional E1B or E3 and is used in the present
experiments as a control for toxicity.
[0404] Wildtype E1A gene codes for a total of 5 proteins which are
generated through alternative splicing of the E1A RNA. Among
others, two different proteins are generated, namely a 289 amino
acid protein and a 243 amino acid protein. dl520 does not code for
the 289 amino acid protein as it has a deletion in the CR3 stretch
of the E1A gene which results in the lack of the 13S gene product.
The adenovirus dl520 which may be used in accordance with the
invention is referred to as 12S-E1A virus by those skilled in the
art. Adenovirus dl347 (Wong und Ziff, J. Virol., 68, 4910-4920,
1994) known in the prior art is also a 12S-E1A virus which can be
used in accordance with the present invention.
[0405] Within the 289 amino acid protein which is encoded by the
13S-E1A mRNA, there are 3 regions which are conserved among various
adenoviral subtypes. These are referred to as CR1, CR2 and CR3.
While C R1 and CR2 are present in both E1A proteins (E1A 12S and
E1A 13S), i.e. in both the 289 amino acid and the 243 amino acid
protein, the CR3 region is only present in the bigger one of the
two aforementioned proteins.
[0406] The CR3 region is required for the activation of viral
genes, in particular of E1B, E2, E3 and E4. Viruses which only
comprise the smaller, i.e. 243 amino acid protein are only very
weakly transactivating the viral genes and do not promote
adenoviral replication in those cells which do not have YB-1 in the
nucleus. As YB-1 is present in the nucleus only in tumor cells and
can be detected only there, this vector is suitable to induce
tumor-specific replication.
[0407] Due to the deletion of CR3 in dl520 this adenovirus cannot
translocate cellular YB-1 into the cell's nucleus which is also
referred to herein as translocation, and is thus not in a position
to replicate in cells which are YB-1 nucleus-negative and is thus a
virus which can be used in accordance with the present invention,
whereby this virus comprises the transactivation required in
accordance with the present invention.
EXAMPLE 2
Mode of Action of Adenoviruses in Depending on the Rb Status of
Cells
[0408] FIG. 2 shows the binding domains of the E1A protein with
regard to the binding of p300, p107 and p105. P300, as well as
p107, is a cellular binding protein. The binding of the
retinoblastoma protein (pRb), a tumor suppressor protein, is
mediated through CR1 and CR2. Studies have shown that pRb and
p107/p300 are in combination with the cellular transcription factor
E2F effective in regulating transcription. The wildtype E1A protein
interferes with the binding of E2F to Rb. The thus released E2F
binds to the E2 early promoter and induces adenoviral replication
thereby.
[0409] It is known from the prior art that certain deletions in the
E1A oncoprotein may result in recombinant adenoviral vectors such
as those mentioned in the following, which are capable of
replicating predominantly in Rb-negative cells and can be used in
accordance with the present invention. For example, the adenoviral
vector dl922-947 comprises a deletion in the CR2 region (amino acid
positions 122-129) and the vector CB016 has deletions in the CR1
region (amino acid positions 27-80) and CR2 region (amino acid
positions 122-129). The vector E1Adl01/07 comprises a deletion in
the CR2 region (amino acid positions 111-123). Additionally,
because of an additional deletion at the N-terminus (amino acid
positions 4-25), additionally, there is no binding to protein p300.
The adenoviral vector Ad.DELTA.24 comprises a deletion in the CR2
region (amino acid positions 120-127). The adenoviral vector
described in patent EP 0 931 830 comprises deletions in the CR1
region and CR2 region.
[0410] The binding mechanism of E2F/RB and the release of E2F
mediated through E1A is fundamentally different from the mechanism
underlying the present invention. Unlike assumed in the prior art
it is not the release of E2F from the Rb protein which is
essential, not to say critical for viral replication, but it is the
nuclear localisation of the human transcription factor YB-1. This
transcription factor is, in normal cells, only present in the
cytoplasm over most of the cell cycle. After infection with an
adenovirus it is induced into the nucleus under certain
circumstances or is already present in the nucleus in distinct
cellular systems, such as distinct tumor diseases including, for
example, but not limited thereto, breast cancer, ovary carcinoma,
prostate carcinoma, osteosarcoma, glioblastoma, melanoma, small
cell lung carcinoma and colorectal carcinoma.
EXAMPLE 3
Infection of U2OS Cells
[0411] 100,000 U2OS cells were plated per well. On the next day the
cells were infected with the various adenoviruses as depicted in
FIG. 3. The infection was performed in 500 .mu.l serum free DMEM
medium at 37.degree. C. for 1 h. Subsequently, the infection medium
was removed and replaced by 2 ml complete medium (10% FCS/DMEM).
The analysis was performed after 3 days using crystal violet
staining.
[0412] As may be taken from FIG. 3, the U2OS cells which do not
have YB-1 in the nucleus, show no lysis as illustrated by crystal
violet staining after infection with two different adenoviruses,
namely the E1/E3-deleted adenovirus referred to as E1/E3-minus, and
adenovirus dl520, which can be used in accordance with the present
invention. In connection therewith, first, the medium is removed.
Subsequently, the cells are overlaid with crystal violet (50% ETOH,
3% formaldehyde, 5% acetic acid, 1% crystal violet) and incubated
at room temperature for 5-10 min. Subsequently, the plates having 6
wells are thoroughly rinsed with water and dried at room
temperature.
[0413] This confirms the finding underlying the present invention
that the presence of YB-1 is required in order to induce the
viruses used in accordance with the present invention, to lyse the
infected cells.
EXAMPLE 4
Infection of 257RDB Cells
[0414] 100,000 257RDB cells were plated per well. On the next day
the cells were infected with the various adenoviruses as depicted
in FIG. 4. The infection was performed in 500 .mu.l serum free DMEM
medium for 1 h at 37.degree. C. Subsequently, the infection medium
was removed and replaced by 2 ml complete medium (10% FCS/DMEM).
The analysis was performed after three days using crystal violet
staining.
[0415] The result of this experiment is depicted in FIG. 4. The
adenovirus referred to as E1/E3-minus Ad5 which is E1/E3-deleted,
did not show any lysis at low MOIs (pfu/cell) upon infection of
257RDB cells which have YB-1 in the nucleus. In contrast thereto,
dl520 which, as shown in example 3, does not replicate in YB-1
nucleus-negative cells and at the same time codes with E1A for a
transactivating oncogene protein in accordance with the present
invention, results in a factually complete lysis at an MOI
(multiplicity of infection) of 40 pfu per cell and a still
predominant lysis at an MOI of 10 pfu per cell. It can be concluded
therefrom that dl520 and similar viruses such as described herein
by dl1119/1131 or AdXvir 03, require an MOI which is reduced by
about 1 magnitude (factor of ten) compared to E1-deleted or an
E1/E3-deleted adenovirus which justifies their clinical use.
[0416] As depicted in FIG. 7, the protein E1A of dl520 is
characterised in that the CR3 region thereof is deleted which
results in the transactivation required for the use in accordance
with the present invention and replication in YB-1 nucleus-positive
cells.
EXAMPLE 5
Infection of 257RDB and U2OS Cells with dl1119/1131
[0417] As depicted in FIG. 5, there is no lysis at an MOI of 20 pfu
per cell upon infection of YB-1 nucleus-negative U2OS cells with
adenovirus dl1119/1131 which exhibits a deletion of amino acids
4-138 of the E1A protein and the nucleic acid coding therefor, and
further comprises a stop codon after amino acid 218, whereby the
expressed truncated E1A protein comprises the CR3 region of the
complete E1A protein. As a negative control a non-infected cell
layer was used.
[0418] In contrast thereto, there was factually a complete lysis of
the cell layer at an MOI of 20 pfu per cell under the influence of
adenovirus dl1119/1131 in a cellular system such as 257RDB which
contains YB-1 in the nucleus, i.e. is YB-1 nucleus-positive.
Insofar this example is another proof that a modified E1A oncogene
protein which, as depicted in FIG. 7, comprises, for example, only
the CR3 region and which is lacking the CR1 region and CR2 region,
provides for the required transactivation in YB-1 nucleus-positive
cells which is required for the replication of adenoviruses in
accordance with the present invention, which results in viral
replication. The adenovirus dl1119/1131 is thus a further
adenovirus which can be used in accordance with the present
invention. It is within the present invention that also viruses can
be used which are designed similar to dl1119/1131 with regard to
the CR3 region, but, in contrast thereto, have the CR1 region
and/or CR2 region.
EXAMPLE 6
Detection of Nuclear YB-1 in Multidrug Resistant Cells
[0419] The example is based on the consideration that nuclear YB-1
should bind as a transcription factor to the Y-box (CAAT sequence)
within the mdr1 promoter (engl. multiple drug resistance promoter).
In order to detect this, a so-called EMSA analysis (electrophoretic
mobility shift assay) was performed. In connection therewith,
nuclear protein is isolated and subsequently 1-10 .mu.g protein is
incubated together with a short DNA fragment (oligo) at 37.degree.
C. In order to determine nuclear YB-1, the following
oligonucleotide was used: mdr1 promoter in contrast to U203
(Position -86 to -67): TGAGGCTGATTGGCTGGGCA (the X-box is
underlined).
[0420] This DNA fragment is radioactively labelled at the 5' end
with .sup.32P prior to that. Subsequently, separation is performed
in a native polyacryl amide gel. In case the protein YB-1 is
binding to a sequence in the oligonucleotide, this can be detected
as any non-bound oligonucleotide is migrating faster in the gel
than bound oligonucleotide (Holm, P. S. et al., JBC 277,
10427-10434, 2002; Bargou, R. C. et al., Nature Medicine 3,
447-450, 1997).
[0421] As depicted in FIG. 6, it could be shown with the EMSA
analysis that YB-1 is present in the nucleus of multidrug resistant
cells 257RDB, 181RDB and MCF-7Ad cells in contrast to cell lines
U2OS and HeLa cells.
[0422] The results shown in example 4 and 5 confirm that the
adenoviruses dl520 and dl1119/1131 replicate in YB-1
nucleus-positive cells such as, e.g., 257RDB in contrast to U205,
and induce lysis thereof. This confirms the finding about the use
of the adenoviruses in accordance with the present invention.
Additionally, the results confirm that already a, compared to
wildtype adenovirus, weak transactivation of viral genes in YB-1
nucleus-positive cells through modified or deleted E1A gene
products results in successful replication and lysis of such cells
in the presence of YB-1 in the nucleus, including, for example,
multidrug resistant cells and that the adenoviruses as described
herein, can thus be used in the lysis of such tumors.
EXAMPLE 7
Increase of Replication Efficiency of E1-Minus Adenoviruses
[0423] This example shows that the early viral genes E1B-55K and
E4orf6 can be substituted through transfection with the plasmid
pE4orf6 and infection with the E1/E3-deleted adenovirus Ad-55K.
Ad-55K is an E1/E3 deleted virus, whereby E1B-55K is cloned into E1
and is under the control of CMV. This substitution is necessary
with regard to the fact that AdYB-1, i.e. an adenovirus which
expresses YB-1, does not express these early genes and that the
present inventor has recognised that a substitution of these early
genes in a replication system which contains YB-1 in the nucleus,
is capable of increasing replication efficiency and particle
formation efficiency, respectively, to an extent comparable to the
one of wildtype adenoviruses of type Ad5.
The following was done:
[0424] Transfection of each 10.sup.5 U2OS cells with the plasmid
pE4orf6 using lipofectamine. The plasmid pE4orf6 carries the DNA
sequence coding for the early viral gene E4orf6 under the control
of CMV.
[0425] 24 h after transfection with the plasmid pE4orf6 the cells
were infected with the YB-1 expressing E1/E3-deleted adenovirus
AdYB-1 (50 pfu/cell) and the E1/E3-deleted E1B-55K adenovirus
Ad-55K (50 pfu/cell). Ad-55K is an E1/E3-deleted virus which
carries as transgene the viral gene E1B-55K under CMV control.
[0426] Subsequently, the cells were removed from the medium (2 ml)
5 days after infection (=post infectionem). The release of the
viral particles from the isolated cells was done by alternating
freezing and thawing for three times (thaw/freeze). Subsequently, a
plaque assay was performed on 293 cells for determining the
generated infectious particles (plaque forming units per ml
(pfu/ml)). The result is depicted in FIGS. 8 and 9. FIG. 8 shows
the result of the plaque assay, represented in absolute figures.
The most significant difference compared to infection with AdYB-1
alone is shown by transfection with the plasmid pE4orf6 and
co-infection with the two viruses AdYB-1 and Ad-55K. FIG. 9 shows
the result of FIG. 8, whereby the increase of the replication
efficiency is represented as multifold of the replication
determined for AdYB-1. The cells infected with plasmid pE4orf6 and
subsequently with AdYB-1 and E1B-55K (Ad-55K) produced up to 25
times more pfu/ml.
[0427] Based on these results it can be concluded that the
substitution of E1B-55K and E4orf6 increases the number of viruses
formed (pfu/ml) after infection with the E1/E3-deleted adenovirus
AdYB-1 by a factor of up to 25. The additive effects of E1B-55K and
E4orf6 on the production of plaque forming units (pfu) is
significantly higher compared to the effects of each of the two
gene products.
[0428] Control experiments with one plasmid which expresses EGFP,
clearly showed that in the experimental approach chosen only 10% of
the cells were successfully transfected with plasmid pE4orf6. The
number of the particles formed in the cells which express both
E1B-55K and E4orf6 is comparable to the one of human adenovirus
type 5 (wildtype). This confirms the finding underlying the present
invention that the expression of E4orf6 and E1B-55K is, in
combination with the nuclear localisation of YB-1, able to provide
for adenoviral replication and particle formation, in particular of
E1A-deleted adenoviruses, which is comparable to the one of
wildtype Ad5.
EXAMPLE 8
Increased Replication of Adenoviruses which are not Replicating in
YB-1 Nucleus-Negative Cells, in YB-1 Nucleus-Positive Cells Upon
Administration of Cytostatics
[0429] It is known in the prior art that the addition of different
cytostatics induces nuclear localisation of the human transcription
factor YB-1. As has been found by the present inventor, YB-1
localised in the nucleus controls adenoviral replication by means
of activation of the adenoviral E2-late promoter. The combination
of both effects can be used in order to provide for specific tumor
lysis.
[0430] In the practising of the oncolytic assays the following
procedure was followed: 200,000 cells (HeLa and U2OS, respectively)
were plated into each well of a 6 well plate. On the next day 40
ng/ml (final concentration) of daunorubicine were added. After 3
hours of incubation the cells were infected with 10 and 30 pfu
dl520/cell, respectively. Subsequently, the cells were incubated in
cytostatic free medium. After 3-5 days the cells were stained using
crystal violet.
[0431] As may be taken from FIGS. 10 and 11, the addition of
daunorubicine induces the replication of dl520 through nuclear
localisation of YB-1. Thus, dl520 creates a bigger tumorlytic
effect in combination with the cytostatic daunorubicine compared to
daunorubicine alone.
EXAMPLE 9
In Vivo Tumor Lysis by dl520
[0432] The HeLa (YB-1 nucleus-negative) and 257RDB (YB-1
nucleus-positive) cells used in this in vivo study, were expanded
under sterile cell culture conditions. Prior to the injection of
the cells into mice (strain CD1NuNu) in order to generate a
subcutaneous tumor, the cells are harvested by trypsinisation,
taken up in DMEM medium (10% FCS), counted and washed with PBS one
time. Subsequently, the cells are centrifuged, the PBS aspired and
the cells are portioned in fresh PBS with the desired cell number.
The cell number which was subcutaneously injected in this study,
was each 5.times.10.sup.6 cells of both cell lines. The injection
was performed subcutaneously into one flank of the animals, whereby
HeLa cells were injected into the right side and 257RDB cells were
injected into the left side for better distinction. The growth of
the tumors was controlled twice a week and thereby the length and
the width of the tumors was measured using vernier calipers. Based
thereon, the tumor volume was calculated based on the following
mathematical formula: 3/4.pi.*a/2*(b/2).sup.2a=length, b=width
[0433] Once the tumor has reached a volume of 200 to 520 mm.sup.3,
the virus and PBS as negative control, respectively, were
intratumorally applied. The volumes to be injected were identical
and were 50 .mu.l each time. This was repeated on 3 consecutive
days. The overall dosage of applied viruses was 5.times.10.sup.8
pfu. Subsequently, the tumor growth was continued to be documented
twice a week and the volume was calculated. At the end of the study
the mice were sacrificed and the tumors removed for further
analysis.
[0434] The results are depicted in FIGS. 12 and 13.
[0435] FIG. 12 shows a diagram representing the tumor volume as a
function of time and the various treatment schemes. In case the
tumor was formed by RDB257, there was a significant growth of the
tumor to about 438 mm.sup.3 to 1466 mm.sup.3 upon injection of PBS.
Under the influence of the vector dl520 which was used in
accordance with the invention, tumor growth could be reduced
significantly. Starting from a mean tumor size of 344 mm.sup.3, the
tumor size increased only by 21% to a total of 543 mm.sup.3.
[0436] In the present example the tumor consisting of HeLa cells
was used as a control which upon administration of PBS behaved
similarly to the RDB257 based tumor upon administration of PBS.
Tumors based on HeLa cells and treated with dl520, however, still
showed a significant increase in tumor growth starting from 311
mm.sup.3 and increasing to 1954 mm.sup.3.
[0437] FIG. 13 shows a picture of the sacrificed nude mice which
had a tumor grown using RDB257.
[0438] It can be clearly seen that after the application of
adenovirus dl520 in accordance with the present invention a
significant reduction of the tumor occurred. In the present case
there was even a reduction in the tumor volume (day 1 after
administration of virus dl520: 515 mm.sup.3; day 30 after
administration of virus dl520: 350 mm.sup.3).
EXAMPLE 10
Southern Blot of Tumor DNA
[0439] DNA was extracted from a tumor sample which has been taken
from the middle of the tumor developed in example 9. For isolation
the Dneasy Tissue Kit of Qiagen is used. The DNA isolation is done
in accordance with manufacturer's instructions. In accordance
therewith, the DNA was released from the cells through alkaline
lysis. Subsequently, the isolated DNA is purified over a column.
Subsequently, the concentration of the isolated DNA is determined
by photometry at 260 nm. The analysis was performed using 2 .mu.g
of the DNA samples which were digested with 10 units of restriction
enzyme Kpn I. Subsequently, an electrophoretic separation of the
samples was performed in a 0.8% agarose gel. Subsequently, the DNA
was blotted onto a nylon membrane (performed according to the
system of Schleicher & Schuell). The DNA blotted onto the
membrane is hybridised against a specific 1501 bp DNA probe. The
1501 bp DNA probe specifically binds to the 3369 bp Kpn I fragment
within the E2A coding Ad5 sequence. The probe was prepared prior to
that by PCR (primer: 5'-GTC GGA GAT CAG ATC CGC GT (SEQ. ID. No.
2), 5'-GAT CCT CGT CGT CTT CGC TT (SEQ. ID. No.3)) and
radioactively labelled using .sup.32P. Subsequently, the membrane
is washed and exposed to a film.
[0440] The result of the Southern Blot of tumor DNA is depicted in
FIG. 14. The analysis confirms that only dl520 replicates in vitro
in resistant cells RDB257, as depicted in lanes 3, 4 and 5. Lane 1
shows as positive control Ad-5d, lane 6, 7 and 8 show DNA from HeLa
cells which were infected with dl520. As HeLa cells are not YB-1
nucleus positive the virus dl520 did not replicate so that, in
accordance therewith, the E2A sequence could not be detected.
[0441] A further result with dl520 is depicted in FIG. 15. Based on
a plaque assay the particle formation (pfu/ml) was investigated
after infection with dl520 and wildtype adenovirus. Various YB-1
nucleus-positive (257RDB and 181RDB) tumor cells and YB-1
nucleus-negative tumor cells were infected with dl520 and wildtype
adenovirus.
[0442] The following procedure was practiced:
[0443] 100,000-200,000 cells each were plated in so-called plates
having 6 wells (engl. 6 well plates) in L 15 medium (resistant
cells) and DMEM (non-resistant cells) having 10% FCS. After 24 h
infection with dl520 and wildtype adenoviruses (10 pfu/cell) was
performed. 3 days after infection (post infectionem) the viral
particles were released from the cell suspension (3 ml) by
alternating freezing and thawing for three times. Subsequently, a
plaque assay was performed on 293 cells for determining the formed
infectious particles (plaque forming units per ml (pfu/ml)). The
result is depicted in FIG. 15. The result of the plaque assay shows
that dl520 is replicating in YB-1 nucleus-positive cells (257RDB
and 181RDB) similar to wildtype adenovirus. Insofar a replication
efficiency can be observed similar to the one of wildtype
adenoviruses when using, in accordance with the present invention,
the adenoviruses described herein.
EXAMPLE 11
Structural Design of the Adenoviral Vector Xvir03
[0444] FIG. 16 shows the structural design of the adenoviral vector
Xvir03. The adenovirus Xvir03 is a so-called E1/E3-deleted
adenovirus. This means that no E1A, E1B (E1B55k and E1B19K
proteins) and E3 proteins are manufactured which are functional in
adenoviral replication. The deletion of the E1 region extends from
342-3528; the deletion of the E3 region of the base position
27865-30995. As used herein, the term "E1-deleted virus" means a
virus in which E1 is no longer functionally active. This can be
achieved by inactivation with an otherwise mostly intact nucleic
acid and amino acid sequence, respectively, however, can also mean
a deletion of the E1 region coding proteins having various sizes.
Because of the lack of the E1A and E1B protein and the nucleic
acids coding therefor, the E4 region, such as E4orf6, is only
weakly expressed (about 1-5% compared to wildtype adenoviruses) or
expressed not at all. The viral genes E1B55k and E4orf6 are
expressed in the E1 region by means of the heterologuous CMV
promoter (Clontech: Plasmid pShuttle) introduced into Xvir03.
Instead of the CMV promoter each and any of the promoters as
disclosed herein in connection with the expression of E1A can be
used. The open reading frames of both genes are linked with each
other by means of a so-called IRES sequence (engl. internal
ribosomal entry site) (Pelletier, J. and Sonenberg, N. Nature,
1988, 334, 320-325). This element (Novagen: pCITE) provides for the
expression of 2 proteins from one mRNA.
The Vector was Manufactured as Follows: System Adeno-X of the
Company Clontech
[0445] The plasmid E1B55k-pShuttle was created by cloning the open
reading frame of E1B55k from pCGNE1B from M. Dobelstein (University
of Marburg) with XbaI and BfrI into the pShuttle vector from
Clontech. Alternatively, the BamH1 fragment from the pCGNE1B vector
can, after having been made blunt ended, cloned into the
correspondingly prepared pShuttle vector of Clontech. Subsequently,
E1B55k in pShuttle was linearised with ApaI, the ends blunt ended
and cut with NheI.
[0446] In a second vector, pcDNA3.1 (+) (Invitrogen), subsequent to
each other, the IRES element as a PCR product was cloned with
pCITE-4a(+) of the company Novagen as template by means of TA
cloning into the EcoRV cleaving site, and the E4orf6 from the
plasmid pCMV-E4orf6 (M. Dobelstein, University of Marburg) was
cloned by means of BamHI=IRES-E4orf6-pcDNA3.1(+). IRES-E4orf6 in
pcDNA3.1(+) was linearised with NotI, the ends blunt ended and
subsequently the fragment IRES-E4orf6 was cut out with NheI. The
fragment IRES-E4orf6 was linked with the open vector
E1B55k-pShuttle (blunt, NheI). The cassette was subsequently cloned
from the E1B55k-IRES-E4orf6-pShuttle together with the CMV promoter
and the bovine growth hormone (BGH)-PolyA into the .DELTA.E1,
.DELTA.E3 Adeno-X-Plasmid (Clontech) with I-Ceu I and PI-SceI, and
referred to as AdcmvE1B/IRES/E4orf6. Subsequently, the adenovirus
was prepared in accordance with manufacturer's instructions
(Clontech). The adeno plasmid which was linearised with PacI having
the expression element CMV-E1B55k-IRES-E4orf6-BGH polyA was
transfected into HEK293 cells and 11 days post transfectionem the
ablating cells were removed together with the medium in order to
release the generated adenoviruses through repeated freeze-thaw
cycles.
[0447] It is within the present invention and feasible for the one
skilled in the art with regard to the technical teaching provided
herein, that other systems such as the system AdEasy of QBIOGENE
and Microbix may be used for the manufacture of the adenoviruses
according to the present invention, preferably the recombinant
adenovirus, in particular those which contain, individually and/or
together, the cassettes E4orf6-IRES-E1B55k and YB-1-IRES-E1A12S.
Additionally, individual transgenes may be exchanged between the
cassettes. It is within the present invention that also such
adenoviruses can be manufactured and used in accordance with the
present invention, where the cassette has the following design:
E1B55k-IRES-E4orf6 and E1A12S-IRES-YB1.
[0448] In connection with the present invention a so called E1/E3
deleted recombinant adenovirus was used which contains the cassette
E4orf6-IRES-E1B55k. It is, however, within an embodiment that the
virus comprises only an E1-deletion, which means that the E3-region
remains intact. Optionally, the E4-region may be partially and/or
completely deleted.
[0449] In the manufacture of the vector using different systems it
was proceeded as follows.
[0450] Manufacture of the adenovirus Ad-Xvir 3'UTR having an intact
E3-region with the vector system according to Graham (company
Microbix).
Cloning of the Vector CMV-E4ORF6-IRES-E1B55k 3'UTR-polyA in pDelta
E1sp1A
[0451] For the plasmid E1B55k 3'UTR-pShuttle (Clontech) the open
reading frame having the 3'-UTR was prepared by amplification from
the DNA of adenovirus type 5 (E1B55k forward
primer=5'-ATGGAGCGAAGAAACCC-3' and E1B55k 3'UTR backward
primer=5'-CACGTCCTGGAAAAAATACAC-3') and introduced in the blunt
ended NheI restriction site, which was provided with T-ends
(TA-cloning) and cloned into the pShuttle plasmid of the company
Clontech. Thus, the transgene was provided with a hCMV-promoter at
the 5'end and with the bovine growth hormone polyadenylation signal
at the 3'end.
Cloning of the Vector E4ORF6-IRES-pcDNA3.1(+)
[0452] The amplificates E4orf6 using the adenovirus type 5 DNA as
template (E4orf6 forward primer 5'-CTTCAGGATCCATGACTACGTCCGGCG-3'
and E4orf6 backward primer
5'-GAAGTGAATTCCTACATGGGGGTAGAGTCATAATCGT-3') and from the plasmid
pCMVE4-34 kD which has been cut with Bam HI (Dobbelstein et al.,
EMBO, 16, 4276-4284, 1997), and the IRES element having the
pCITE-4a(+) of the company Novagen as template (IRES forward
primer=5'-TCCGGTTATTTTCCACCATATTGC-3' and IRES backward
primer=5'-TTATCATCGTGTTTTTCAAAGG-3') were subsequently cloned into
the multiple cloning site of the pcDNA3.1(+)-vector. For such
purpose, primers were used for the E4orf6 transgene which create a
BamHI cleavage site at the 5'-end and a EcoRI cleavage site at the
3'-end of the open reading frame. The amplificate was digested with
the respective restriction enzymes and the ends thereof were made
compatible for the directed cloning into the vector which has been
opened using BamHI and EcoRI. Subsequently, plasmid E4orf6 in
pcDNA3.1(+) was linearized with EcoRV, the T-ends added and the
amplificate cloned into the IRES element. After checking the
correct orientation of the IRES element, the vector was used for
further cloning.
[0453] The linkage of both transgenes with the IRES element
resulted from a cloning of the E4orf6-IRES cassette into the
previously generated plasmid CMV-E1B55k 3'UTR-polyA-pShuttle
(Clontech) which was linearized with NotI, blunt ended and
subsequently cut with XbaI. E4orf6-IRES in pcDNA3.1 (+) was
linearized with NotI, the ends made blunt ended and further
digested with NheI. By ligating the E4orf6-IRES insert with the
CMV-E1B55k 3'UTR-polyA-pShuttle (Clontech) XVIR-3'UTR was generated
in pShuttle (Clontech).
Generation of the Used Adenoviral Shuttle Vector
[0454] As the shuttle vector p.DELTA.E1sp1A, now used for the
adenoviral generation system of the company Microbix, did neither
contain a CMV promoter nor a bovine growth hormone polyadenylation
signal, these elements were cloned into p.DELTA.E1sp1A. For such
purpose, p.DELTA.E1sp1A was linearized with ClaI, made blunt ended
and cut with EcoRI. The element CMV-MCS (multiple cloning
site)-poly-A was linearized from pShuttle (Clontech) with MfeI, the
ends made blunt ended and further cut with EcoRI. Subsequently, the
cassette (Xvir-3'UTR pShuttle from Clontech) was cloned with PmeI
into the CMV-MCS-poly-A p.DELTA.E1sp1A vector which had also been
cut with PmeI and subsequently dephosphorylated. The cloning
product Xvir-3'UTR-p.DELTA.E1sp1A was used for virus
generation.
Virus Generation
[0455] Xvir-3'UTR-p.DELTA.E1sp1A and pBHGE3 (from Microbix,
contains the E3-region which corresponds to wildtype adenovirus
type 5) was cotransfected into HEK 293 cells, whereupon virus
Ad-Xvir-3'UTR E3 was generated due to recombination of homologous
sequences of both vectors.
Generation of Adenovirus Ad-Xvir3'UTR-AdEASY E3 using the
AdEASY-System (Company Qbiogene)
Generation of the Used Adenoviral Shuttle Vector
[0456] As, for the present used system, the vector pShuttle-AdEASY
did neither contain a CMV-promotor nor the bovine growth hormone
polyadenylation signal, these elements were cloned into
pShuttle-AdEASY. For such purpose, the plasmid was digested with
EcoRI, the ends made blunt ended by fling them up with
T4-polymerase and dNTPs, the backbone was dephosphorylated and both
of the generated digestion products ligated again. By doing so the
restriction recognition site for EcoRI was eliminated. The thus
resulting plasmid was referred to as pShuttle(-EcoRI)-AdEASY.
[0457] Subsequently, the cassette CMV-MCS-polyA from the pShuttle
of Clontech was cut wich MfeI and EcoRI, the ends made blunt ended
and cloned into the vector pShuttle (-EcoRI)-AdEASY which was, for
such purpose, linearized with XbaI, made blunt ended and
dephosphorylated. Thus plasmid CMV-MCS-polyA-pShuttle-AdEASY was
generated. The cassette E4Orf6-IRES-E1B55k-3'UTR was cloned into
this plasmid using MluI and EcoRI. By doing so the plasmid
Xvir-3'UTR in pShuttle AdEASY was generated. This was linearized
with Bstl 1071 and MroI and introduced into BJ5183 (EC) bacteria
together with rescue-plasmid pAdEASY by means of electroporation.
By homologous recombination the adenoviral plasmid
Ad-Xvir-3'UTR-pAdEASY was generated which resulted in virus
production after transfection in HEK293 cells.
Introducing the wt E3 Region into pAdEASY
[0458] As the E3 region is substantially deleted in plasmid
pAdEASY, the E3 region was cloned from plasmid pAdEASY with SpeI
and PacI into plasmid CMV-MCS-polyA pShuttle (AdEASY) for
reconstruction and thus the plasmid E3E4-pShuttle-AdEASY
generated.
[0459] By restriction with NdeI and religation one out of two NdeI
restriction sites was deleted and so was the multiple cloning site
from the plasmid. By this procedure plasmid
E3E4-pShuttle(-NdeI)-AdEASY was generated.
[0460] Subsequently the 4007 bp wtE3-region fragment from wildtype
adenovirus type 5 was excised by SpeI and NdeI and cloned into the
E3E4-pShuttle (-NdeI)-AdEASY which was opened by SpeI and NdeI. The
thus generated vector was referred to as wtE3E4-pShuttle
(NdeI)-AdEASY.
[0461] Subsequently the wildtype E3E4-region from the E3E4-pShuttle
(-NdeI)-AdEASY was cut with SpeI and PacI and cloned into the
pAdEASY and cut with SpeI and PacI, whereby in plasmid pAdEASY the
E3-region was re-established (pAdEASY-E3). XVir-3'UTR-pAdEASY-E3
was generated by homologous recombination upon transforming BJ5183
(EC) bacteria with plasmids Xvir-3'UTR in pShuttle AdEASY and
pAdEASY-E3.
Manipulation of E4 for all of the Systems Mentioned
[0462] In order to provide space for therapeutic genes and
transgenes and in order to avoid undesired homologous recombination
the E4 region in plasmid E3E4-pShuttle (-NdeI)-AdEASY can be
deleted specifically. For such purpose, the E4orf6 region is
shortened by about 0.6 kB, preferably 634 bp, by excision with PstI
and religation. This can, as described in FIG. 17, be performed in
connection with Xvir03/01. Respective deletions are also feasible
by the one skilled in the art in different systems for the
generation of recombinant adenovirus.
Cloning of the RGD-motif in Ad-Xvir 3'UTR-AdEASY E3 in Particular
(Also Applicable to Other Systems)
[0463] For increasing the infectivity the HI Loop of the fibre knob
domain was modified following Dmitriev et al. 1998 (An Adenovirus
Vector with Genetically Modified Fibers Demonstrates Expanded
Tropism via Utilization of a Coxsackievirus and Adenovirus
Receptor-Independent Cell Entry Mechanism): The respective region
was amplified using the primers RGD-Hpa fw
(5'-GAGgttaacCTAAGCACTGCCAAG-3'), RGD-EcoRV rev
(5'-CATAGAGTATGCAGATATCGTTAGTGTTACAGGTTTAGTTTTG-3') and RGD-EcoRV
fw (5'-GTAACACTAACGATATCTGCATACTCTATGTCATTTTCATGG-3') and RGD-Bfr
rev (5'-CAGCGACATGAActtaagTGAGCTGC-3') and thus an EcoRV
restriction site generated. In this restriction site the paired
oligonucleotides were cloned which code for an Arg-Gly-Asp
(RGD)-peptide: RGD-oligo 1
(5'-CACACTAAACGGTACACAGGAAACAGGAGACACAACTTGTGACTGCCGCGGAGA
CTGTTTCTGCCC-3') and RGD-oligo 2 (5'-GGGCAGAAACAG TCTCCGCGGCAGTCA
CAAGTTGTGTCTCCTGTTTCCTGTGTACCGTTTAGTGTG-3'). Thus, the RGD motif is
present in the HI Loop of the fibre knob domain.
[0464] The vector described above is in principle suitable as are
the other viruses described herein for use in accordance with the
present invention. In particular the afore-described vector is
suitable to replicate and trigger lysis insofar, in cells which are
YB-1 nucleus-positive cells as well as in cells where YB-1 is
deregulated, i.e. is overexpressed compared to normal cells and
non-tumor cells, respectively. The use of this vector particularly
applies to those diseases and groups of patients or groups of
patients which are disclosed in connection with the other
adenoviruses which are described herein to be used in accordance
with the present invention and the other adenoviruses of the
present invention disclosed herein.
EXAMPLE 12
Structural Design of the Adenoviral Vector Xvir03/01
[0465] As may be taken from FIG. 17, Xvir03/01 is a further
development of Xvir03. Therapeutic genes such as, for example, the
genes described herein and the transgene can be cloned into the E3
region. Additionally, a deletion was introduced into the E4 region
so as to avoid homologous recombination with the E4orf6 from the
expression cassette of Xvir03. This allows that larger transgenes
can be cloned in this construct. The deleted E3 region contains
SacI, NdeI and NheI cleavage sites for introducing a cassette, into
which, for example, the therapeutic transgenes can be cloned.
However, the E3 region may also stay intact and the therapeutic
genes may be clines into the E4 region. Thus, among others, the
expression of the adenoviral death protein ADP is ensured.
Preparing a Plasmid for Cloning Therapeutic Genes into the E3
Region as Well as for Making Deletions in the E4 Region: System
Adeno-X of Clontech
[0466] The pAdenoX-Plasmid of Clontech has a restriction site for
SfuI behind the 3' ITR region which is absent in wildtype
adenovirus. The E3-E4 region was taken from pAdenoX (Clontech) with
the SpeI (position 23644) and SfuI and transferred into pcDNA3.1(+)
(Invitrogen)=pcDNA3.1-E3.DELTA.27865-30995-E4. The bigger part of
E4ORF6, namely 33241-33875 was removed by means of
PstI=pcDNA3.1-E3.DELTA.27865-30995, E4.DELTA.33241-33875. For the
further development of Xvir03 the deleted E3/E4 region from
pcDNA3.1-E3.DELTA.27865-30995, E4.DELTA.33241-33875 was cloned by
means of SfuI and SpeI into plasmid pAdenoX pAdenoX
E3.DELTA.27865-30995, E4.DELTA.33241-33875.
[0467] The expression cassette was subsequently, as described for
Xvir03, cloned with I-Ceu I and PI-SceI from the
E1B55k-IRES-E4orf6-pShuttle together with the CMV promoter and the
bovine growth hormone (BGH)-PolyA into pAdenoX
E3.DELTA.27865-30995, E4.DELTA.3241-33875 and referred to as
AdcmvE1B/IRES/E4orf6-.DELTA.E4. Subsequently, the adenovirus was
prepared in accordance with manufacturer's instructions
(Clontech).
[0468] It is within the present invention and feasible for he one
skilled in the art in the light of the present disclosure that
other systems nay be used for the manufacture of the adenoviruses
in accordance with the present invention and in particular the
recombinant adenoviruses, such as the systems of the companies
QBIOGENE and Nicrobix.
[0469] The afore-described vector is in principle useful as are the
other viruses described herein to be used in accordance with the
present invention. In particular the afore-described vector is
suitable to replicate in YB-1 nucleus-positive cells as well as
cells in which YB-1 is deregulated, i.e. is overexpressed compared
to normal cells and non-tumor cells, and to cause lysis insofar.
This vector can also be used for those diseases and groups of
patients and collectives of patients which are disclosed herein for
the other adenoviruses to be used in accordance with the present
invention and the adenoviruses in accordance with the present
invention.
EXAMPLE 13
Oncolytic Effect of Xvir 03 in 257 RDB and 181 RDB Cells
[0470] 100,000 cells (257RDB and 181RDB) were plated per well of a
plate having six wells (engl.: 6 well plate). AT the next day the
cells were, as depicted in FIG. 18, infected with Ad312 (20
pfu/cell) and Xvir03 (5 pfu/cell). The infection was performed in
500 .mu.l serum free DMEM medium at 37.degree. C. for 1 h.
Subsequently, the infection medium was removed and replaced by 2 ml
complete medium (10% FCS/DMEM). The analysis was done by means of
crystal violet staining after 5 days. The result is depicted in
FIGS. 18A and 18B.
[0471] As may be taken from FIGS. 18A and 18B, the multidrug
resistant cells which have YB-1 in the nucleus, show lysis after
infection with Ad312 and Xvir03 only in case of Xvir03 as
represented by the crystal violet staining of the cells. In
connection therewith, first the medium is removed. Subsequently the
cells are covered with crystal violet (50% ETOH, 3% formaldehyde,
5% acetic acid, 1% crystal violet) and incubated at room
temperature for 5-10 min. Subsequently, the six well plates are
thoroughly rinsed with water and dried at room temperature.
[0472] It is known to the present inventor that E1A-deleted viruses
(e.g. Ad312) which, however, are not transactivating adenoviruses
in the sense of the present invention, may replicate very
efficiently at higher MOIs (Nevins J. R., Cell 26, 213-220, 1981),
which, however, cannot be realised in clinical application. This
phenomenon is referred to in the literature as "E1A-like activity".
The adenovirus Ad312 as used herein, is an E1A-deleted virus. At
the titer used (20 pfu/cell), which is still above the clinically
desirable titer, the early adenoviral genes such as E1B55k and
E4orf6 are not expressed or expressed only to a very small extent
(Nevins J. R., Cell 26, 213-220, 1981). As already described
herein, these genes and proteins play an important role in viral
replication. In contrast thereto, these genes and proteins,
respectively, are expressed by adenovirus Xvir03 (FIG. 16). As may
be taken from FIGS. 18A and 18B, the expression of the genes E1B55k
and E4orf6 will result in an efficient viral replication and cell
lysis at a concomitantly lower infection titer required (expressed
as pfu/cell). This confirms the finding underlying the present
invention, namely that the expression of E4orf6 and E1B-55K (and
the absence of E1A) in combination with nuclear localisation of
YB-1 is capable of inducing a very efficient adenoviral
replication. The titer required therefor of only 1 to 5 pfu/cell
now allows for clinical application.
[0473] This confirms the finding underlying the present invention,
namely that the presence of YB-1 in the nucleus, particularly the
presence independent from the cell cycle, is required in order to
make the viruses which are to be used in accordance with the
present invention, lyse infected cells.
EXAMPLE 14
Northern Blot Analysis of the E2 Gene Expression of Adenovirus
Ad312
[0474] In each case 1 million A549 and U2OS cells were plated in 10
cm Petri dishes. At the next day the cells were infected with Ad312
(50 pfu/cell) and Adwt (which served as control, 5 pfu/cell). The
high virus titer of Ad312 which was used resulted in an
E1-independent replication in tumor cells. The infection was done
in 1-2 ml serum-free DMEM medium for 1 h at 37.degree. C.
Subsequently, the infection medium was removed and replaced by 10
ml complete medium (10% FCS/DMEM). After 3 days the RNA was
isolated. Subsequently, the concentration of the isolated RNA was
measured in a photometer at 260 nm. Then the RNA samples were
electrophoretically separated in a 0.8% formaldehyde agarose gel.
Subsequently, the RNA was blotted on a nylon membrane (conducted
according to the system of Schleicher & Schuell). The RNA
blotted on the membrane is blotted against an "early probe" E2 and
a "late probe" E2. The 1501 bp "late probe" specifically binds
behind the E2-late promoter. The probe was prepared prior to that
by PCR (primer: 5'-GTC GGA GAT CAG ATC CGC GT (SEQ. ID. NO. 4),
5'-GAT CCT CGT CGT CTT CGC TT (SEQ. ID. NO. 5)) and radioactively
labelled using .sup.32P. In contrast, the early probe binds between
the E2-early promoter and the E2-late promoter (position:
226791-227002) and was also generated by means of PCR (primer:
5'-AGCTGATCTTCGCTTTTG (SEQ. ID. NO. 6), 5'-GGATAGCAAGACTCTGAC AAAG
(SEQ. ID. NO. 7)). Subsequently, the membrane was washed and
exposed to a film.
[0475] The result is depicted in FIG. 19. Both the early as well as
the late probe provided specific signals in the control infection
with wildtype adenovirus, whereas tumor cells infected with Ad312
only provided a specific signal when the late probe was used. This
confirms the finding underlying the present invention that the
expression of E4orf6 and E1B55K and the absence of E1A transports
overexpressed and deregulated YB-1, respectively, into the nucleus
and thus induces E2 gene expression as a prerequisite for efficient
adenoviral replication.
EXAMPLE 15
Northern Blot Analysis of the E2 Gene Expression of Adenovirus
Addelta 24
[0476] In each 1 million U2OS cells were plated in 10 cm Petri
dishes. At the next day the cells were infected with adenovirus
delta 24 (Addelta24) (10 pfu/cell) and wildtype adenovirus (Adwt)
(served as a control, 10 pfu/cell). The used recombinant adenovirus
Addelta24 (Fueyo, J. et al., Oncogene 19, 2-12, 2000) has a
specific deletion in the CR2 region of the E1A protein and is thus
only capable of replicating in Rb-negative tumors. Additionally,
the virus expresses the genes E1B55k and E4orf6 comparable to the
wildtype adenovirus. The infection occurred in 1-2 ml serum-free
DMEM medium for 1 h at 37.degree. C. Subsequently, the infection
medium was removed and replaced by 10 ml complete medium (10%
FCS/DMEM). The RNA was isolated after 12 h and 24 h. Subsequently,
the concentration of the isolated RNA was determined in a
photometer at 260 nm. Then the RNA samples were electrophoretically
separated in a 0.8% formaldehyde agarose gel. Subsequently, the RNA
was blotted on a nylon membrane (conducted according to the system
of Schleicher & Schuell). The RNA blotted onto the membrane is
hybridised against the "early probe" and against the "late probe".
The "late probe" comprising 1501 bp, binds specifically behind the
E2-late promoter. The probe was prepared prior to that by PCR
(primer: 5'-GTC GGA GAT CAG ATC CGC GT (SEQ. ID. NO. 4), 5'-GAT CCT
CGT CGT CTT CGC TT (SEQ. ID. NO. 5)) and radioactively labelled
using .sup.32P. The early probe, however, binds between the
E2-early promoter and the E2-late promoter and was also prepared by
PCR (primer: 5'-AGCTGATCTTCGCTTTG (SEQ. ID. NO. 6),
5'-GGATAGCAAGACTCTGACAAAG (SEQ. ID. NO. 7)). Subsequently, the
membrane was washed and exposed to a film.
[0477] The result is shown in FIG. 20.
[0478] After 12 h only the late probe provided for a specific
signal. Only after 24 h also the early probe provided a signal in
cells infected with Addelta24. Compared to wildtype adenoviruses,
however, the signal is significantly weaker. Also this result
confirms the finding underlying the present invention that the
expression of E4orf6 and E1B-55K transports overexpressed and
deregulated YB-1, respectively, into the nucleus which subsequently
binds to the E2-late promoter and induces E2 gene expression.
EXAMPLE 16
Structural Design of the Adenoviral Vectors XvirPSJL1 and
XvirPSJL2
[0479] Description of the vectors: The vectors of the XvirPSJL
group which are embodiments of the viruses referred to herein as
group I adenoviruses and which are exemplified by the vectors and
adenoviruses, respectively, XvirPSJL1 and XvirPSJL2, are not only,
like adenovirus dl520, capable of replicating in YB-1
nucleus-positive cells, in particular tumor cells, but also in
tumor cells in which YB-1 is overexpressed and deregulated,
respectively. While the viral genes E1B55k and E4orf6 are expressed
only in dl520 infected YB-1 nucleus-positive cells under the
influence of the E1B promoter and the E4 promoter, respectively,
the expression of E1B55k and E4orf6 in XvirPSJL occurs by means of
the cytomegalovirus (cmw) promoter. Instead of the cmw promoter,
however, also other promoters, in particular tumor-specific,
tissue-specific and organ-specific promoters and the natural E1A
promoter, i.e. preferably the E1A promoter as present in wildtype
adenovirus, preferably Ad5, may be used. Because of the expression
of E1B55k and E4orf6 the overexpressed YB-1 and the deregulated
YB-1, respectively, is transported into the nucleus and adenoviral
replication is initiated. The adenoviral vectors of the XvirPSJL
group as disclosed herein, thus combine various elements and thus
functions of the adenoviral vectors dl520, Xvir03 and AdYB-1 in a
single vector. Similar to the vector dl520 the XvirPSJL viruses
contain the E1A12S gene. This gene and the corresponding gene
product, respectively, is responsible for the induction of the S
phase of the infected cell and promotes viral replication and the
effect of chemotherapeutics and irradiation. Like Xvir03 the
XvirPSJL viruses contain the expression cassette
CMV-E4orf6/IRES/E1B55k, which is required for an efficient
replication and indirectly or directly transports deregulated YB-1
into the nucleus which is preferably contained in tumor cells. Thus
replication is possible only in cells, particularly tumor cells,
where YB-1 is overexpressed or deregulated. Additionally, P53 is
made subject to degradation by the E1B55k/E4orf6 complex. The
sequence coding for human transcription factor YB-1 is taken from
the virus AdYB-1. The endogenous, i.e. the YB-1 already present in
the cell amplifies viral replication. The expression of both E1A12S
and YB-1 is controlled by the YB-1-dependent adenoviral E2-late
promoter. Also in connection therewith specific promoters may be
used, in particular tumor-specific, tissue-specific or
organ-specific promoters. A further feature of these viruses is
that the E4 region is deleted. The vector contains restriction
sites there by which, in case of the adenoviral vectors XvirPSJL1
and XvirPSJL2, various transgenes as disclosed in the specification
such as ribozymes, antisense molecules, siRNA, apoptosis-inducing
genes, cytokines and prodrug genes may be expressed. Their
expression may also be controlled by tumor-specific,
tissue-specific or organ-specific promoters as disclosed in the
specification. The localisation of the expression cassettes is not
fixed, particularly not with regard to or within the E1, E3 and E4
region, but can be arranged in any way. In connection therewith the
non-required can be either deleted or can be intact. The vectors
replicate independent of the p53 or Rb status of the tumor
cells.
[0480] The structural designs of the recombinant adenoviruses
XvirPSJL1 and XvirPSJL2 are presented in FIGS. 21 and 22:
[0481] Generation of the vector XvirPSJL according to the system of
Aden-X of Clontech.
Generation of the Cassette E2-late-YB11RES/12S:
[0482] The pAdenoX plasmid of Clontech/BD Biosciences which is used
as a starting material herein, comprises the genomic nucleic acid
of adenovirus Ad5 and has a SfuI restriction site behind the 3' ITR
region which is ABSENT in wildtype adenovirus. The E3-E4 region was
transferred by SpeI (position 23644) and SfuI from pAdenoX
(Clontech) into pcDNA3.1(+) (Invitrogen) and referred to as
pcDNA3.1-E3.DELTA.27865-30995-E4. The majority of the E4ORF6,
namely the bases 33241-33875 were removed by means of PstI. The
such obtained fragment was referred to as
pcDNA3.1-E3.DELTA.27865-30995, E4.DELTA.33241-33875.
[0483] The E2-late promoter was excised from pGL3-EGFP (Holm et
al., JBC 2002, 277, 10427-10434) with SacI and NheI and cloned into
pcDNA3.1-E3.DELTA.27865-30995, E4.DELTA.33241-33875. In doing so,
the E3 region was further deleted in the region of bases
A27593-31509. The thus obtained fragment was referred to as
E2-late-pcDNA3.1-E3.DELTA.27593-31509, E4.DELTA.33241-33875
[0484] The cDNA for the E1A-243AA product was generated by means of
RT-PCR, isolated and the sequence checked and cloned into the
pcDNA3.1(+) vector (Invitrogen) using BamHI and EcoRI.
E1A-12S-pcDNA3.1+was linearised with NheI and BamHI, made
blunt-ended by T4 polymerase and provided with T overhangs by Taq
polymerase and dTTPs. The IRES element was cloned as a PCR product
(template=pCITE, Novagen) into the E1A-12S-pcDNA 3.1(+) vector (TA
cloning strategy).
[0485] The YB-1-EcoRI fragment was isolated from the vector pHVad2c
(Holm et al., JBC 2002, 277, 10427-10434) and made blunt-ended. The
vector pShuttle (commercially available from BD Biosciences) was
linearised with XbaI, the ends made blunt-ended and
dephosphorylated and ligated with the previously produced YB-1
coding nucleic acid. The vector thus obtained was referred to as
YB-1-pShuttle. The cloning into the pShuttle vector provided the
YB-1 fragment coding nucleic acid with an in-frame STOP codon. The
YB-1 coding nucleic acid was cloned from the YB-1-pShuttle by means
of NheI and BfrI into the vector IRES-E1A-12S in pcDNA3.1 (+). The
thus obtained fragment was referred to as YB-1 (EcoRI-EcoRI with
STOP codon)-IRES-E1A-12S-pcDNA3.1 (+).
[0486] Subsequently, the cassette YB-1-IRES-E1A12S was excised with
PmeI and cloned into the NheI linearised, blunt-ended and
dephosphorylated vector E2late-pcDNA3.1 E3.DELTA.27593-31509,
E4.DELTA.33241-33875. Thus the second cassette is in the deleted
region of the E3 region.
[0487] The transgene cassette comprising the nucleic acid construct
E2late-YB-1-IRES-E1A12S was cloned together with the remaining
adenoviral sequences E3.DELTA.27593-31509, E4.DELTA.33241-33875 by
means of SfuI and SpeI into the vector pAdenoX of Clontech
(=AdenoX/E2late-YB-1-IRES-E1A12S/E3.DELTA.27593-31509,
E4.DELTA.33241-33875).
[0488] The cassette CMV-E1B55k/IRES/E4orf6 was excised by means of
1-CeuI and PI-SceI from the pShuttle described above in relation to
Xvir03 and inserted into the vector
AdenoX/E2late-YB-1-IRES-E1A12S/E3.DELTA.27593-31509,
E4.DELTA.33241-33875.
[0489] Subsequently, the vector was linearised with Pac I,
transfected into 293 cells and the recombinant adenovirus XvirPSJL
1 and XvirPSJL 2, respectively, isolated without the transgenes
indicated in the figure in accordance with manufacturer's
instructions.
[0490] It is within the present invention and feasible for the one
skilled in the art in the light of the present disclosure that
other systems may be used, such as the system of the companies
QBIOGENE and MICROBIX, for the generation of the adenoviruses in
accordance with the present invention, preferably recombinant
adenovirus and in particular those containing, separately and/or
together, the cassettes E4orf6-IRES-E1B55k and E1A12S-IRES-YB-1,
respectively. Additionally, the individual transgenes can be
exchanged within the individual cassettes and in particular among
the respective cassettes. Additionally, the cassette
E1A12S-IRES-YB-1 may consist only of EA12S and/or E1A12S can be
linked to other relevant genes through IRES.
Generation of the Adenovirus AdPSJL-E2-Late Promoter 12S-AdEASY
with E1A12S in the Deleted E3-Region with the AdEASY-System
(Company Microbix).
Cloning of PSJL 12S
[0491] First, the E2-late promoter was cloned into the HindIII and
BglII cleavage site of the pGL3-enhancer plasmid (pGL3-E2-late) as
paired oligonucleotides (upper primer
5'-TCGAGCTCCGCATTTGGCGGGCGGGATTGGTCTTCGTAGAACCTAATCTCGTGGG
CGTGGTAGTCCTCAGGTACAAAT-3' and lower primer
5'-AGCTTATTTGTACCTGAGGACTACCACGCCCACGAGATTAGGTTCTACGAAGACC
AATCCCGCCCGCCAAATGCGGAGC-3').
[0492] Subsequently, the luciferase gene was excised using NcoI and
XbaI, the ends made blunt ended and T-ends added. The transgene E1A
12S which was amplified by the primers E1A 12S forward primer
5'-ATGGCCGCCAGTCTTTTG-3' and E1A 12S backward primer
5'-TTATGGCCTGGGGCGTTTAC-3', was introduced by TA-cloning into the
thus opened site.
[0493] This cassette was excised using PvuI and ClaI, the ends made
blunt ended and cloned into the blunt ended and dephosphorylated
NheI-cleavage site in the E3-region of E3E4-pShuttle
(-NdeI)-AdEASY. The cassette thus contains the E2-late promoter,
the open reading frame E1a-12S and the SV-40 late polyadenylation
signal. The resulting construct is
E2-late-E1a-12S-E3E4-pShuttle(-NdeI)-AdEASY.
[0494] Subsequently the E2-late-E1a 12S-E3E4 was excised from the
E2-late-E1a 12S-E3E4-pShuttle (-NdeI)-AdEASY using SpeI and PacI
and cloned into the SpeI and PacI cut pAdEASY. The thus resulting
construct was referred to as E2-late-E1a 12S-E3E4-pAdEASY.
AdPSJL-12S-AdEASY was generated by homologous recombination upon
transforming BJ5183 (EC) bacteria with the plasmids Xvir-3'UTR in
pShuttle AdEASY and E2-late-E1a 12S-E3E4-pAdEASY.
Generation of the Adenovirus AdPSJL-E2-Late
Promoter-12S-YB-1-AdEASY with E1A12S and YB-1 in the Deleted
E3-Region Using the AdEASY System (Company Microbix)
Cloning of the vector E4ORF6-IRES-pcDNA3.1(+)
[0495] The amplificates E1a 12S (see above) and the IRES element
(see above) were subsequently cloned into the multiple cloning site
of the pcDNA3.1(+)-vector. For such purpose the E1a-12S amplificate
was introduced into the blunt ended BamHI-cleavage site by
TA-cloning. Subsequently, the plasmid E1a-12S in pcDNA3.1(+) was
linearized with EcoRV, T-ends added and the amplificate cloned into
the IRES element. The thus obtained plasmid was subsequently
linearized with XhoI, the ends made blunt ended and the
EcoRI-EcoRI-cleavage product of YB-1 which is devoid of a stop
codon.
[0496] The thus created construct E1A-12S-IRES-pcDNA3.1(+) was
linearized using NotI and the ends made blunt ended. Also, the
YB-1-EcoRI-cleavage product was made blunt ended and introduced
into the dephosphorylated vector E1A-12S-IRES-pcDNA3.1(+). The
cassette E1A-12S-IRES-YB-1 was removed using PmeI and cloned into
the above described plasmid pGL3-E2-late after removal of the
liciferase gene with NcoI and XbaI and blunt ending and
dephosphorylation.
[0497] The cassette E2-late-E1A-12S-IRES-YB-1 was excised using
PvuI and ClaI, the ends made blunt ended and cloned into the blunt
ended and dephosphorylated NheI-cleavage site in the E3-region of
E3E4-pShuttle (-NdeI)-AdEASY. The thus obtained construct is
E2-late promoter-E1A-12S-IRES-YB-1-E3E4-pShuttle
(-NdeI)-AdEASY.
[0498] Subsequently, the E2-late promoter-E1A-12S-IRES-YB-1-E3E4
cassette was excised from the E2-late
promoter-E1A-12S-IRES-YB-1-E3E4-pShuttle (-NdeI)-AdEASY with SpeI
and PacI and cloned into the SpeI and PacI cut pAdEASY. The
resulting construct was referred to as
E1a-12S-IRES-YB-1-E3E4-pAdEASY.
[0499] AdPSJL-12S-Yb-1-AdEASY was generated by homologous
recombination upon transformation of BJ5183 (EC) bacteria with the
plasmid Xvir-3'UTR in pShuttle AdEASY and
E1a-12S-IRES-YB-1-E3E4-pAdEASY.
Cloning of the Cassette E2-Late Promoter-E1A-12S and/or E2-Late
Promoter-E1A-12S-IRES-YB-1 in the E4-Region
[0500] After manipulation and deletion, respectively, of the E4
region using PstI 634 bp were removed. The cassettes E2-late
promoter-E1A-12S and/or E2-late promoter-E1A-12S-IRES-YB-1 can be
introduced into the E4-region. Alternatively, the E2-region may
remain intact under such conditions.
Cloning of the RGD-Motive
[0501] For an improved infectivity the HI loop of the fibre knob
domain was modified according to Dmitriev et al. 1998 (An
Adenovirus Vector with Genetically Modified Fibers Demonstrates
Expanded Tropism via Utilization of a Coxsackievirus and Adenovirus
Receptor-Independent Cell Entry Mechanism): The respective region
was amplified using the primes RGD-Hpa fw
(5'-GAGgttaacCTAAGCACTGCCAAG-3'), RGD-EcoRV rev
(5'-CATAGAGTATGCAGATATCGTTAGTGTTACAGGTTTAGTTTTG-3'), as well as
RGD-EcoRV fw (5'-GTAACACTAACGATATCTGCATACTCTATGTCATTTTCATGG-3') and
RGD-Bfr rev (5'-CAGCGACATGAActtaagTGAGCTGC-3') and an
EcoRV-cleavage site thus generated. Paired oligonucleotides were
cloned into this cleavage site which code for an Arg-Gly-Asp
(RGD)-peptide with RGD oligo 1
(5'-CACACTAAACGGTACACAGGAAACAGGAGACACAACTTGTGAC TGCCGCGGAG
ACTGTTTCTGCCC-3') and RGD oligo 2 (5'-GGGCAGAAACAG
TCTCCGCGGCAGTCACAAGTTGTGTCTCCTGTTTCCTGTGTACCGTTTAGTGTG-3'). Thus
the RGD motif is contained in the HI loop of the fibre knob
domain.
[0502] In FIGS. 30 and 31 the cloned E1B55k-3'UTR is described in
more detail and the pE3/E4 Shuttle plasmid in the Adeasy system is
depicted in FIG. 32. The plasmid is characterised in that
manipulations and deletions, respectively, have been made to
regions E3 and E4 which allow to clone different cassettes by means
of different restriction site such as NheI for the E3 region and
PstI for the E4 region without adversely affecting the opent
reading frames other than the one of E4orf6 and L5. Additinoally, a
sequence for the RGD motif is introdiced into the region of the HI
loop.
[0503] Positions of the deletions corresponding to the wildtype
adenovirus sequence.
[0504] E3 deletion: 28138-30818
[0505] E4 deletion: 33246-33875
[0506] RGD motif: 32678 (9 amino acids introduced, central 3 amino
acids RGD: CDCRGDCFC
EXAMPLE 17
Infection of HeLa Cells with Adenovirus dl520
[0507] 100.000 HeLa cells were plated per dish. At the next day the
cells were infected with various titers (pfu/ml) of adenovirus
dl520. The infection was done in 500 .mu.l serum-free DMEM medium
for 1 h at 37.degree. C. Subsequently, the infection medium was
removed and replaced by 2 ml complete medium (10% FCS/DMEM). After
3-5 days an analysis was performed using crystal violet
staining.
[0508] The result of this experiment is depicted in FIG. 23. The
adenovirus dl520 does not show any lysis at low MOIs (5-10
pfu/cell) upon infection of HeLa cells which do not have YB-1 in
the nucleus. In contrast thereto, dl520 showed a factually complete
lysis at an MOI (multiplicity of infection) of 100-200 pfu per cell
and a still predominant lysis at an MOI of 50 pfu per cell.
Therefrom it can be concluded that dl520 and similar viruses which
are capable of switching on the adenoviral genes E1B55k and E4orf6
at higher MOIs, are suitable to transport either directly or
indirectly overexpressed or deregulated YB-1 into the nucleus and
thus to induce cell lysis.
EXAMPLE 18
Luciferase Assay for Determining the E2-Late Promoter Activity
[0509] It is known that YB-1 binds to the adenoviral E2-late
promoter in the nucleus (Holm et al., JBC 2002, 277, 10427-20434)
and that this promoter is also well suited for the expression of
nucleic acids. The use of the adenoviral E2-late promoter is
particularly motivated by the fact that it can be regulated by
YB-1, whereby YB-1 acts as a positive effector, i.e. the promoter
is only active in the presence of YB-1 in the nucleus. Insofar said
adenoviral E2-late promoter can be regulated in a highly selective
manner and thus used in systems in which YB-1 is present in the
nucleus and factually avoids any expression of the nucleic acid
which is under the control of the adenoviral E2-late promoter in
case that YB-1 is not present in the nucleus as an effector and
regulator, respectively. The E2-late promoter comprises 3 Y-boxes
(CCAAT) which are relevant for the activation of the E2 gene.
Different E2-late promoter constructions have been prepared and
tested for their specificity and activity. The analysis was carried
out as follows.
[0510] The cell lines EPG-257 RDB (epithelial stomach carcinoma)
which has YB-1 in the nucleus, HeLa (epithelial uterine cervix
carcinoma) and U2OS (osteosarcoma) were seeded using three
different cell concentrations in 6 well plates. The wells which
showed confluence of 70% at the next day, were used for
transfection. For each well 500 ng SpinMiniprep (Qiagen) purified
plasmid DNA of the different E2-late promoter constructions in
luciferase vectors (commercially available from Promega, starting
plasmid: pGL3-enhancer) were added to 500 .mu.l OptiMEM in a 1.5 ml
locking cap reaction vessel and 5 .mu.l DOTAP to 500 .mu.l in a
further locking cap reaction vessel. Both solutions were combined
and mixed. The mixture was incubated for complex formation for 30
minutes at room temperature. The cells were rinsed three times with
PBS and covered with a layer of the transfection mixture. The
plates were incubated at 37.degree. C. for 5 hours, subsequently
rinsed again three times with PBS and provided with complete
medium.
[0511] The cells were processed with the Luciferase Assay System
Kit of Promega (Cat. No. E11500) 48 h after infection: Each well
was provided with a layer of 500 .mu.l lysis buffer, the cells
rinsed off from the well plate with a 1 ml pipette after 10 minutes
at room temperature and transferred into a 1,5 ml locking cap
reaction vessel. The cell lysate was subsequently centrifuged at
4.degree. C. for 15 minutes at 14.000 rpm. To each 50 .mu.l of the
supernatant 100 .mu.l luciferase substrate were added and measured
with TopCount (Canberra-Packard GmbH, 63303 Dreieich) Microplate
Scintillation & Luminescence counter in black plates with 96
wells at a wave length of 945 nm.
[0512] Protein was measured with the BCA Protein Assay Reagent Kit,
catalogue number 23227 (PIERCE, Rockford, Ill., USA) at 570 nm in a
bioluminometer (Biolumin.TM. 960) kinetic fluorescence/absorbance
plate reader of Molecular Dynamics. The relative light signals of
the samples were translated into the protein amount (RLU/.mu.g
protein).
[0513] The following plasmids were used: pGL3-enhancer (Promega)
from which the enhancer was removed by means of BamHI (2250 bp) and
BsaBI (2003 bp), served as a blank reading. The various E2 promoter
constructions were cloned into the MCS in the enhancer-lacking pGL3
vector by means of restriction sites Apa I and Sac I. The hCMV
promoter was cloned by means of Bgl II and Hind III into the pGL3
enhancer and served as a positive control. The positive control
allowed to estimate transfection efficiency and also served as a
reference value for luciferase activity. For each cell line the CMV
control was set 100% and the enzyme activity produced by the E2
promoter constructions put in relation thereto and depicted as a
bar graph in FIG. 24.
[0514] The various constructs were referred to as follows:
[0515] 1. comprising the Y-box I, II and III corresponding to bases
25932-26179 bp (referring to the wildtype adenovirus sequence, see
also the part of the subsequently provided adenoviral E2
region)
[0516] 2. comprising the Y-box II and III corresponding to bases
25932-26127 bp (referring to the wildtype adenovirus sequence, see
also the part of the subsequently provided adenoviral E2
region)
[0517] 3. comprising the Y-box III corresponding to bases
25932-26004 bp (referring to the wildtype adenovirus sequence, see
also the part of the subsequently provided adenoviral E2
region)
[0518] 4. comprising no Y-box as acting as the blank reading
Part of the Adenoviral E2 Region (Taken from Virology 1992, 186,
280-285)
[0519] (The YB-1 binding sites are printed in bold): TABLE-US-00001
25561 aggaactttatcctagagcgctcaggaatcttgcccgccacctgctgtgcacttcctagc
25621 gactttgtgcccattaagtaccgcgaatgccctccgccgctttggggccactgctacctt
25681 ctgcagctagccaactaccttgcctaccactctgacataatggaagacgtgagcggtgac
25741 ggtctactggagtgtcactgtcgctgcaacctatgcaccccgcaccgctccctggtttgc
25801 aattcgcagctgcttaacgaaagtcaaattatcggtacctttgagctgcagggtccctcg
25861 cctgacgaaaagtccgcggctccggggttgaaactcactccggggctgtggacgtcggct
25921 ##STR1## 25981 ##STR2## 26041 ##STR3## 26101 ##STR4## 26161
tatcagcagcagccgcgggcccttgcttcccaggatggcacccaaaaagaagctgcagct 26221
gccgccgccacccacggacgaggaggaatactgggacagtcaggcagaggaggttttgga 26281
cgaggaggaggaggacatgatggaagactgggagagcctagacgaggaagcttccgaggt 26341
cgaagaggtgtcagacgaaacaccgtcaccctcggtcgcattcccctcgccggcgcccca 26401
gaaatcggcaaccggttccagcatggctacaacctccgctcctcaggcgccgccggcact 26461
gcccgttcgccgacccaaccgtagatgggacaccactggaaccagggccggtaagtccaa 26521
gcagccgccgccgttagcccaagagcaacaacagcgccaaggctaccgctcatggcgcgg 26581
gcacaagaacgccatagttgcttgcttgcaagactgtgggggcaacatctccttcgcccg 26641
ccgctttcttctctaccatcacggcgtggccttcccccgtaacatcctgcattactaccg 26701
tcatctctacagcccatactgcaccggcggcagcggcagcggcagcaacagcagcggcca 26761
cacagaagcaaaggcgaccggatagcaagactctgacaaagcccaagaaatccacagcgg (SEQ.
ID. No. 8)
[0520] The results presented in FIG. 24 confirm in an impressive
manner that the individual promoter fragments which contain
different E2-late/Y-boxes, are suitable for the expression of
therapeutic transgenes in YB-1 nucleus-positive tumor cells and may
thus be used as promoters in the meaning of the present
invention.
EXAMPLE 19
Effect of Yb-1 Expressed by Adenovirus on Particle Release
[0521] Human osteosarcoma cells (U2OS) were infected with the
E1/E3-deleted adenoviral vector AdYB-1 and Ad312 only having
E1A-deleted, at an MOI of 50 pfu/cell. AdYB-1 contains in its
genome the sequence coding for the cellular transcription factor
YB-1 and thus expresses the Y-box binding protein 1 (YB-1). In
order to evaluate the release of viral particles as "plaque forming
units" (pfu) after infection, either the supernatant of the culture
medium or the remaining cell layer was isolated 2 and 5 days,
respectively, post infectionem. The intracellular particles were
released by 3 cycles of thawing/freezing. The particle number was
analysed using the plaque assay on 293 cells.
[0522] The result is in depicted in FIG. 25, whereby the solid bars
indicate the intracellular remaining viral particles, whereas the
cross-striped bars represent the released, extracellular viral
particles.
[0523] The result depicted in FIG. 25 confirms that AdYB-1, as a
whole, produces more pfu than Ad312 and releases more particles.
After 5 days the AdYB-1 infected cells clearly show a cytopathic
effect (CPE) in contrast to Ad312-infected cells.
EXAMPLE 14
Replication of Adenovirus in Cells after Addition of Irinotecan
[0524] In order to determine the effect of Irinotecan on adenoviral
replication 10.sup.6 U373 tumour cells were plated in 10 cm.sup.2
Petri dishes. In a first reaction 5 .mu.M Irinotecan was added
after 24 hours. After another 24 hours the cells were infected with
10 pfu/cell dl520. After incubation of 3 days without Irinotecan
DNA was isolated in accordance with the procedure described in
example 10.
[0525] In a parallel reaction the thus prepared U373-cells were not
pre-incubated with Irinotecan. After 48 hours of cultivating the
cells without Irinotecan, they were infected with 10 pfu/cell dl520
and subsequently incubated without Irinotecan for another 3 days.
DNA was isolated as described above.
[0526] Subsequently 2 .mu.g DNA were digested with restriction
enzyme Kpn I and a Southern Blot analysis performed. A part of the
adenoviral genome (position:22734-24235) generated by means of PCR
was used as a probe.
[0527] The result is depicted in FIG. 26. FIG. 26 shows that after
incubation with Irinotecan adenoviral replication is significantly
increased in U373 cells after treatment with Irinotecan (lane 2)
compared to untreated control where no incubation with Irinotecan
was performed (lane 1). This means that adenoviral replication is
increased under the influence of Irinotecan.
EXAMPLE 15
Replication of Adenovirus in Cells after Administration of
Trichostatin a
[0528] In order to test the effect of Trichostatin A on adenoviral
replication, 10.sup.6 U373 tumour cells were plated in 10 cm.sup.2
Petri dishes. After 24 hours 0.25, 0.5 and 0.75 .mu.M Trichostatin
A was added. After another 24 hours the cells were infected with 10
pfu/cell dl520.
[0529] After 3 days of incubation in medium without Trichostatin
DNA was isolated. Subsequently 2 .mu.g DNA were digested with
restriction enzyme Kpn I and a Southern Blot analysis performed. A
part of the adenoviral genome (position:22734-24235) generated by
means of PCR was used as a probe.
[0530] The result is depicted in FIG. 27. FIG. 27 shows that after
incubation with increasing concentrations of Trichostatin A
adenoviral replication in U373 cells (lanes 2, 3 and 4) is
significantly increased compared to untreated controls where no
incubation with Trichostatin A was performed (lane 1). This means
that viral replication is increased under the influence of
Trichostatin A.
EXAMPLE 16
Influencing the Expression of Coxsackievirus-Adenovirus-Receptor
(CAR) on U373 Cells in Response to Addition of Trichostatin A
[0531] 200,000 U373 cells were plated in 6 well plates. After 24
hours the cells were cultivated with 1 .mu.M Trichostatin for 24
hours. After another 24 hours the cells were isolated.
Subsequently, analysis of CAR expression was performed according to
a standard protocol using Facs-analysis and the primary antibody
anti-CAR clone RmcB from the company Upstate, and a
rabbit-anti-mouse FITC as secondary antibody (company DAKO).
[0532] The result is depicted in FIG. 28. Without Trichostatin
treatment 11.3% of the cells were CAR-positive, whereby after
incubation of the cells with 1 .mu.M Trichostatin 56.2% of the
cells were CAR-positive. The figures are percentages of the overall
cells used in the test.
[0533] From FIG. 28 it can be taken that under the influence of the
histone deacylase inhibitor Trichostatin A CAR, which is an
important factor for the binding of adenovirus, is expressed at a
higher level and more available, respectively, which increases the
efficacy of transfection of the thus treated cells.
EXAMPLE 23
Oncolysis of U373 Cells by Adenovirus after Combined Treatment of
the Cells with Irinotecan and Trichostatin A
[0534] 200,000 U373 cells were plated in a 6 well plate. After 24
hours either 2 .mu.M Irinotecan or only 1 .mu.M Trichostatin A or 1
.mu.M Irinotecan +0.5 .mu.M Trichostatin were added to the medium.
After 24 hours of incubation the cells were infected with 10, 20
and 30 pfu/cell dl520. After 3-5 days the analysis was performed
using crystal violet staining. The assays were performed in
duplicate.
[0535] The result is depicted in FIG. 29. The six plates
represented in panel 1 show a complete cell layer which was not
affected by incubation with a combination of Irinotecan and
Trichostatin A as shown by crystal violet staining. The next two
wells of panel 1 show the cell layer after infection with 10 and 20
pfu/cell dl520, respectively. Also under such conditions there is
no lysis of the cells which is due to the absence of replication of
dl520. Thus it is shown that neither dl520 at 10 or 20 pfu/cells
nor 1 .mu.M Irinotecan +0.5 .mu.M Trichostatin A alone are suitable
to induce cell lysis.
[0536] The further 6 well plates 2, 3 and 4 depicted in FIG. 29,
herein also referred to as panels 2, 3 and 4, were basically
treated in accordance with this scheme. The individual wells were
inoculated with U373 cells as previously described and the cells
cultivated therein. The wells were inoculated with 10, 20 or 30
pfu/cell dl520 in duplicate, whereby the difference between the
three 6 well plates resided in the kind of cytostatics used. In
panel 2 2 .mu.M Irinotecan, in panel 3 1 .mu.M Trichostatin A and
in panel 4 1 .mu.M Irinotecan and 0.5 .mu.M Trichostatin A was
added to the individual wells.
[0537] In the 6 well plate 2 (panel 2) with 2 .mu.M Irinotecan the
cells were lysed with 30 pfu/cell dl520. In the 6 well plate 3
(panel 3) with 1 .mu.M Trichostatin A the cells were lysed at 20
and 30 pfu/cell dl520. In the 6 well plate 4 (panel 4) with 1 .mu.M
Irenotecan +0.5 .mu.M Trichostatin A the cells, in contrast
thereto, were already lysed at 10 pfu/cell dl 520.
[0538] The test, the results of which are depicted in FIGS. 26 to
29, shows that the combination consisting of
Irinotecan+Trichostatin A+dl520 induces a more effective cell lyses
of tumour cells as any compound alone. This results, on the one
hand, from Trichostatin A increasing CAR-expression and thus
significantly improves infectability of the cells. On the other
hand, Irinotecan translates YB-1 into the cell nucleus and thus
induces an improved adenoviral replication. Additionally, the
cellular YB-1 is assisting adenoviral replication after infection
with dl520 and is no longer available for DNA-repair processes.
Depending on the point of view, this results in an improved
efficacy of dl520 on the one hand and an increased efficacy of the
cytostatics on the other hand.
[0539] The features of the invention disclosed in the preceding
specification, the claims as well as the figures can both
individually as well as in any combination be important to the
realisation of the invention in its various embodiments.
Sequence CWU 1
1
31 1 20 DNA Artificial misc_feature probe 1 tgaggctgat tggctgggca
20 2 20 DNA Artificial misc_feature probe 2 gtcggagatc agatccgcgt
20 3 20 DNA Artificial misc_feature probe 3 gatcctcgtc gtcttcgctt
20 4 20 DNA Artificial misc_feature probe 4 gtcggagatc agatccgcgt
20 5 20 DNA Artificial misc_feature probe 5 gatcctcgtc gtcttcgctt
20 6 18 DNA Artificial misc_feature probe 6 agctgatctt cgcttttg 18
7 22 DNA Artificial misc_feature probe 7 ggatagcaag actctgacaa ag
22 8 1260 DNA Artificial misc_feature fragement of adenoviral E2
region 8 aggaacttta tcctagagcg ctcaggaatc ttgcccgcca cctgctgtgc
acttcctagc 60 gactttgtgc ccattaagta ccgcgaatgc cctccgccgc
tttggggcca ctgctacctt 120 ctgcagctag ccaactacct tgcctaccac
tctgacataa tggaagacgt gagcggtgac 180 ggtctactgg agtgtcactg
tcgctgcaac ctatgcaccc cgcaccgctc cctggtttgc 240 aattcgcagc
tgcttaacga aagtcaaatt atcggtacct ttgagctgca gggtccctcg 300
cctgacgaaa agtccgcggc tccggggttg aaactcactc cggggctgtg gacgtcggct
360 taccttcgca aatttgtacc tgaggactac cacgcccacg agattaggtt
ctacgaagac 420 caatcccgcc cgccaaatgc ggagcttacc gcctgcgtca
ttacccaggg ccacattctt 480 ggccaattgc aagccatcaa caaagcccgc
caagagtttc tgctacgaaa gggacggggg 540 gtttacttgg acccccagtc
cggcgaggag ctcaacccaa tccccccgcc gccgcagccc 600 tatcagcagc
agccgcgggc ccttgcttcc caggatggca cccaaaaaga agctgcagct 660
gccgccgcca cccacggacg aggaggaata ctgggacagt caggcagagg aggttttgga
720 cgaggaggag gaggacatga tggaagactg ggagagccta gacgaggaag
cttccgaggt 780 cgaagaggtg tcagacgaaa caccgtcacc ctcggtcgca
ttcccctcgc cggcgcccca 840 gaaatcggca accggttcca gcatggctac
aacctccgct cctcaggcgc cgccggcact 900 gcccgttcgc cgacccaacc
gtagatggga caccactgga accagggccg gtaagtccaa 960 gcagccgccg
ccgttagccc aagagcaaca acagcgccaa ggctaccgct catggcgcgg 1020
gcacaagaac gccatagttg cttgcttgca agactgtggg ggcaacatct ccttcgcccg
1080 ccgctttctt ctctaccatc acggcgtggc cttcccccgt aacatcctgc
attactaccg 1140 tcatctctac agcccatact gcaccggcgg cagcggcagc
ggcagcaaca gcagcggcca 1200 cacagaagca aaggcgaccg gatagcaaga
ctctgacaaa gcccaagaaa tccacagcgg 1260 9 17 DNA Artificial
misc_feature probe 9 atggagcgaa gaaaccc 17 10 21 DNA Artificial
misc_feature primer 10 cacgtcctgg aaaaaataca c 21 11 27 DNA
Artificial misc_feature primer 11 cttcaggatc catgactacg tccggcg 27
12 37 DNA Artificial misc_feature primer 12 gaagtgaatt cctacatggg
ggtagagtca taatcgt 37 13 24 DNA Artificial misc_feature primer 13
tccggttatt ttccaccata ttgc 24 14 22 DNA Artificial misc_feature
primer 14 ttatcatcgt gtttttcaaa gg 22 15 24 DNA Artificial
misc_feature primer 15 gaggttaacc taagcactgc caag 24 16 43 DNA
Artificial misc_feature primer 16 catagagtat gcagatatcg ttagtgttac
aggtttagtt ttg 43 17 42 DNA Artificial misc_feature primer 17
gtaacactaa cgatatctgc atactctatg tcattttcat gg 42 18 26 DNA
Artificial misc_feature primer 18 cagcgacatg aacttaagtg agctgc 26
19 66 DNA Artificial misc_feature oligonucleotide introducing RGD
19 cacactaaac ggtacacagg aaacaggaga cacaacttgt gactgccgcg
gagactgttt 60 ctgccc 66 20 66 DNA Artificial misc_feature
oligonucleotide introducing RGD 20 gggcagaaac agtctccgcg gcagtcacaa
gttgtgtctc ctgtttcctg tgtaccgttt 60 agtgtg 66 21 78 DNA Artificial
misc_feature primer 21 tcgagctccg catttggcgg gcgggattgg tcttcgtaga
acctaatctc gtgggcgtgg 60 tagtcctcag gtacaaat 78 22 79 DNA
Artificial misc_feature primer 22 agcttatttg tacctgagga ctaccacgcc
cacgagatta ggttctacga agaccaatcc 60 cgcccgccaa atgcggagc 79 23 18
DNA Artificial misc_feature primer 23 atggccgcca gtcttttg 18 24 20
DNA Artificial misc_feature primer 24 ttatggcctg gggcgtttac 20 25
24 DNA Artificial misc_feature primer 25 gaggttaacc taagcactgc caag
24 26 43 DNA Artificial misc_feature primer 26 catagagtat
gcagatatcg ttagtgttac aggtttagtt ttg 43 27 42 DNA Artificial
misc_feature primer 27 gtaacactaa cgatatctgc atactctatg tcattttcat
gg 42 28 26 DNA Artificial misc_feature oligonucleotide introducing
RGD 28 cagcgacatg aacttaagtg agctgc 26 29 66 DNA Artificial
misc_feature oligonucleotide introducing RGD 29 cacactaaac
ggtacacagg aaacaggaga cacaacttgt gactgccgcg gagactgttt 60 ctgccc 66
30 66 DNA Artificial misc_feature oligonucleotide introducing RGD
30 gggcagaaac agtctccgcg gcagtcacaa gttgtgtctc ctgtttcctg
tgtaccgttt 60 agtgtg 66 31 9 PRT Artificial MISC_FEATURE peptide
introducing RGD 31 Cys Asp Cys Arg Gly Asp Cys Phe Cys 1 5
* * * * *