U.S. patent application number 10/546139 was filed with the patent office on 2006-11-30 for method for the production of evolved microorganisms which permit the generation or modification of metabolic pathways.
Invention is credited to Michel Chateau, Benjamin Gonzalez, Isabelle Meynial-Salles, Philippe Noel Paul Soucailles, Olivier Zink.
Application Number | 20060270013 10/546139 |
Document ID | / |
Family ID | 32931448 |
Filed Date | 2006-11-30 |
United States Patent
Application |
20060270013 |
Kind Code |
A1 |
Chateau; Michel ; et
al. |
November 30, 2006 |
Method for the production of evolved microorganisms which permit
the generation or modification of metabolic pathways
Abstract
The invention relates to a method for the preparation of evolved
microorganisms which permit a modification of metabolic pathways,
comprising the following steps: a) production of a modified
microorganism by genetic modification of initial microorganism
cells such as to inhibit the production of or the consumption of a
metabolite when the microorganism is cultivated in a defined medium
which also affects the capacity of the microorganism for growth, b)
culture of the modified microorganisms to induce evolution in said
cells, c) selection of the cells of modified microorganisms which
are capable of developing in the defined medium. The invention also
relates to the strains of evolved microorganisms, the genes evolved
which code for evolved proteins and the use of said evolved
microorganisms, genes or proteins in a biotransformation
method.
Inventors: |
Chateau; Michel; (Riom,
FR) ; Gonzalez; Benjamin; (Riom, FR) ;
Meynial-Salles; Isabelle; (Fourquevaux, FR) ;
Soucailles; Philippe Noel Paul; (Deyme, FR) ; Zink;
Olivier; (Mulhouse, FR) |
Correspondence
Address: |
DORSEY & WHITNEY LLP;INTELLECTUAL PROPERTY DEPARTMENT
250 PARK AVENUE
NEW YORK
NY
10177
US
|
Family ID: |
32931448 |
Appl. No.: |
10/546139 |
Filed: |
February 17, 2004 |
PCT Filed: |
February 17, 2004 |
PCT NO: |
PCT/FR04/00354 |
371 Date: |
July 19, 2006 |
Current U.S.
Class: |
435/193 ;
435/252.3; 435/471 |
Current CPC
Class: |
C12P 7/18 20130101; C12N
15/01 20130101; C12N 9/0036 20130101; C12P 7/52 20130101; C12P 7/20
20130101; C12P 13/12 20130101; C12N 15/1058 20130101; C12P 7/42
20130101; C12P 33/00 20130101 |
Class at
Publication: |
435/193 ;
435/471; 435/252.3 |
International
Class: |
C12N 15/74 20060101
C12N015/74; C12N 9/10 20060101 C12N009/10; C12N 1/21 20060101
C12N001/21 |
Foreign Application Data
Date |
Code |
Application Number |
Feb 18, 2003 |
FR |
03/01924 |
May 14, 2003 |
FR |
03/05768 |
May 14, 2003 |
FR |
03/05769 |
Nov 6, 2003 |
FR |
03/13054 |
Claims
1. A method for the preparation of evolved microorganisms
permitting a modification of metabolic pathways, characterized in
that it comprises the following steps: a) preparing a modified
microorganism by genetic modification of cells of an initial
microorganism so as to inhibit the production or consumption of a
metabolite when that microorganism is grown on a defined medium,
thereby impairing the ability of that microorganism to grow; b)
culturing the modified microorganism thereby obtained on said
defined medium to cause it to evolve, where the defined medium can
contain a co-substrate to allow such evolution; c) selecting a
modified microorganism able to grow on said defined medium, if
necessary with a co-substrate.
2. The method as claimed in claim 1, characterized in that the
metabolic pathway is chosen from among: biosynthesis pathways of
amino acids, synthesis pathways of nucleic acids, synthesis
pathways of lipids, and metabolism pathways of sugars.
3. The method as claimed in claim 2, characterized in that the
modified metabolic pathway is a biosynthesis pathway of amino
acids.
4. The method as claimed in claim 3, characterized in that the
modified metabolic pathway is a biosynthesis pathway of an amino
acid chosen from among: methionine, cysteine, threonine, lysine,
and isoleucine.
5. The method as claimed in claim 2, characterized in that the
modified metabolic pathway consumes NADPH.
6. The method as claimed in claim 1, characterized in that the
modification made in step a) favors the reduction of NADP to NADPH,
possibly by limiting the oxidation of NADPH to NADP.
7. The method as claimed in claim 1, characterized in that the
evolved microorganism possesses at least one evolved gene coding
for an evolved protein, the evolution of which replaces the
inhibited metabolic pathway by a new metabolic pathway.
8. The method as claimed in claim 1, characterized in that it
includes an additional step a1), of introducing at least one
heterologous gene coding for a heterologous protein, which
heterologous gene is to allow the evolution of a new metabolic
pathway, preparatory to step b) in which the modified
microorganisms are cultured.
9. The method as claimed in claim 7, characterized in that it
includes a step d) of isolating the evolved gene coding for the
evolved protein.
10. The method as claimed in claim 9, characterized in that the
evolved gene is introduced, in an appropriate form, into a
production microorganism intended for the production of the evolved
protein.
11. An evolved microorganism obtainable by a method according to
claim 1.
12. An evolved microorganism according to claim 11, characterized
in that the microorganism is the strain E. coli K 183 with a
modified "methionine synthase" activity, registered Apr. 2, 2003
under the number I-3005 at the CNCM.
13. A method for the preparation of an evolved protein, wherein the
evolved microorganism according to claim 11 is cultivated in a
culture medium appropriate for the production of the evolved
protein.
14. The method as claimed in claim 13, characterized in that the
produced evolved protein is purified.
15. An evolved gene coding for an evolved protein obtainable by a
method according to claim 9.
16. An evolved protein obtainable by a method according to claim
13.
17. An evolved protein according to claim 16, characterized in that
the enzyme has a modified "methionine synthase" activity and is
chosen from cystathionine-.gamma.-synthases and acylhomoserine
sulfhydrylases with modified "methionine synthase" activity.
18. An evolved protein according to claim 17, characterized in that
the cystathionine-.gamma.-synthase with non-modified "methionine
synthase" activity before the evolution is selected from
cystathionine-.gamma.-synthases corresponding to PFAM with the
reference PF01053 and COG with the reference CPG0626.
19. An evolved protein according to claim 18, where the
cystathionine-.gamma.-synthase with non-modified "methionine
synthase" activity before the evolution, comprises the following
amino acid sequence in its C-terminus (conserved region 1)
X1-X2-X3-L-G-X4-X5-X6-X7-X8-X9 in which: X1 represents A,G,S,
preferentially A; X2 represents E,V,P,T, preferentially E; X3
represents S,T,N, preferentially S; X4 represents G,D,A,H,T,
preferentially G; X5 represents V,A,T,H,N, preferentially V; X6
represents E,R,K,F, preferentially E; X7 represents S,T,
preferentially S; X8 represents L,I,V,A, preferentially L; and X9
represents I,V,A,T, preferentially I corresponding to residues 324
to 334 of the cystathionine-.gamma.-synthase sequence of E. coli
K12, represented by SEQ ID NO 6.
20. An evolved protein according to claim 18, characterized in that
the cystathionine-.gamma.-synthase with non-modified "methionine
synthase" activity before the evolution, comprises the following
amino acid sequence in its N-terminus (conserved region 2):
X10-X11-Y-X12-R-X13-X14-X15-X16-X17-X18 in which: X10 represents A,
H, Y, F, L, K, preferentially A; X11 represents Y, E, D, K, R, V,
I, preferentially Y; X12 represents S,A,T,P,G, preferentially S;
X13 represents I,S,T,R,E,F,W,D, preferentially S; X14 represents
S,G,A,I,E,N,K,P, preferentially G; X15 represents N,H,Q,S,
preferentially N; X16 represents P,D,L, preferentially P; X17
represents T,M,N,G,S, preferentially T; and X18 represents
R,L,V,S,W,E, preferentially R corresponding to residues 44 to 54 of
the cystathionine-.gamma.-synthase sequence of E. coli K12,
represented by SEQ ID NO 6.
21. An evolved protein according to claim 18, characterized in that
it comprises at least one mutation in its C-terminal part and/or at
least one mutation in its N-terminal part.
22. An evolved protein according to claim 21, characterized in that
the mutation consists in replacing an acidic amino acid, which
interacts with the co-substrate cysteine in the non-modified
enzyme, by a non-polar amino acid, selected from the residues
glycine, alanine, leucine, isoleucine, valine, phenylalanine and
methionine.
23. An evolved protein according to claim 22, characterized in that
the mutation in the C-terminal part of the
cystathionine-.gamma.-synthase is introduced among the acidic amino
acids of "conserved region 1", particularly into residue X2.
24. An evolved protein according to claim 23, characterized in that
it comprises the following amino acid sequence in its C-terminal
part: X1-X2-X3-L-G-X4-X5-X6-X7-X8-X9 in which: X1, X3, X4, X5, X6,
X7, X8 et X9 are defined above and X2 represents G,A,L,I,V,F,M,
preferentially A corresponding to residues 324 to 334 of the
cystathionine-.gamma.-synthase sequence of E. coli K12, represented
by SEQ ID NO 8.
25. An evolved protein according to claim 24 characterized in that
it comprises the following amino acid sequence in its C-terminal
part: A-A-S-L-G-G-V-E-S corresponding to residues 324 to 332 of the
cystathionine-.gamma.-synthase sequence of E. coli K12, represented
by SEQ ID NO 8.
26. An evolved protein according to claim 25 characterized in that
the cystathionine-.gamma.-synthase with modified <<methionine
synthase >> activity comprises the amino acid sequence
represented by SEQ ID NO 8.
27. An evolved protein according to claim 18, characterized in that
the mutation in the N-terminal part of the
cystathionine-.gamma.-synthase is introduced among the acidic amino
acids of the conserved region 2, as defined above, in particular
into residues X11 and/or R and/or X13.
28. An evolved protein according to claim 27 characterized in that
the cystathionine-.gamma.-synthase with modified <<methionine
synthase >> activity comprises the following amino acid
sequence in its N-terminal part:
X10-X11-Y-X12-X19-X13-X14-X15-X16-X17-X18 in which: X7, X9, X12,
X14, X15, X16, X17 et X18 are defined above, X11 is defined in
claim 15 or represents a non-polar amino acid, X13 is defined in
claim 15 or represents a non-polar amino acid, X19 is R or
represents a non-polar amino acid, and at least one of X11, X13 et
X19 represents a non-polar amino acid, where the non-polar amino
acids are chosen independently among the residues glycine, alanine,
leucine, isoleucine, valine, phenylalanine or methionine.
29. An evolved protein according to claim 16, characterized in that
the initial enzyme without mutations, before the evolution,
catalyzes a sulfhydrylation reaction in the presence of H2S.
30. An evolved protein according to claim 29, characterized in that
the initial enzyme without mutations, before the evolution has
O-acyl-L-homoserine sulfhydrylase activity.
31. An evolved protein according to claim 30, characterized in that
the initial enzyme with O-acyl-L-homoserine sulfhydrylase activity
is chosen among the O-acyl-L-homoserine sulfhydrylases
corresponding to PFAM reference PF01053 and COG reference
COG2873.
32. An evolved protein according to claim 31, characterized in that
the initial enzyme is chosen among the following acylhomoserine
sulfhydrylases: NP.sub.--785969 O-acetylhomoserine (thiol)-lyase,
Lactobacillus plantarum WCFS1; AAN68137 O-acetylhomoserine
sulfhydrylase, Pseudomonas putida KT2440; NP.sub.--599886
O-acetylhomoserine sulfhydrylase, Corynebacterium glutamicum
ATCC13032; NP.sub.--712243 acetylhomoserine sulfhydrylase,
Leptospira interrogans serovar lai str. 56601; BAC46370
O-succinylhomoserine sulfhydrylase, Bradyrhizobium japonicum
USDA110; AAO57279 O-succinylhomoserine sulfhydrylase, Pseudomonas
syringae pv. tomato str. DC3000; NP.sub.--284520
O-succinylhomoserine sulfhydrylase [Neisseria meningitidis Z2491,
and AAA83435 O-succinylhomoserine sulfhydrylase (P.
aeruginosa).
33. An evolved protein according to claim 31, characterized in that
the initial enzyme before the evolution, is O-acyl-L-homoserine
sulfhydrylase encoded by the metY gene of Corynebacterium.
34. An evolved protein according to claim 33, characterized in that
the O-acyl-L-homoserine sulfhydrylase is encoded by the metY gene
of Corynebacterium glutamicum (Genbank AF220150).
35. A method of biotransformation comprising culturing an evolved
microorganism according to claim 11 under conditions for
biotransformation by fermentation or bioconversion.
36. A biotransformation method according to claim 35 where the
biotransformation is depending on NADPH dependant enzymes.
37. A method according to claim 36 in which the NADPH-dependant
enzymes have evolved substrate specificity.
Description
[0001] This invention concerns a new method for the preparation of
evolved microorganisms permitting the creation or modification of
metabolic pathways, the strains of evolved microorganisms thereby
obtained, the evolved genes coding for the evolved proteins that
may be obtained by the method according to the invention, and the
use of said evolved microorganisms, genes or proteins in a
biotransformation process.
[0002] The preparation of microorganisms with modified properties
is a widely used process. The aim is either to cause the
microorganisms to evolve by letting them grow on a growth medium
with a factor that exerts a selection pressure, so as to select
those microorganisms able to resist that pressure, or to introduce
one or more heterologous genes by means of widely used genetic
engineering methods, in order to lend the microorganisms new
phenotypic features associated with the expression of said
heterologous gene or genes. This evolution can be favored by the
use of mutagenic agents well known to those skilled in the art.
[0003] Methods for evolution by growth under selection pressure by
removing a gene necessary for the transformation of a component of
the culture medium, and by means of a mutagenic agent, are
described in particular in FR 2 823 219 and WO 03/004656.
BRIEF DESCRIPTION OF THE INVENTION
[0004] This invention concerns a new method for the preparation of
evolved microorganisms permitting the creation or modification of
metabolic pathways, characterized in that it comprises the
following steps: [0005] a) Modification of the cells of an initial
microorganism so as to inhibit the production or consumption of a
metabolite when that microorganism is grown on a defined medium,
thereby adversely affecting the growth capacity of the
microorganism. If the cells are not modified, the microorganism is
able to produce or consume this metabolite, and displays a normal
growth when it is grown on that same defined medium. [0006] b)
Growth of the modified microorganism previously obtained on the
said defined medium that caused it to evolve, where that defined
medium can contain a co-substrate necessary for that evolution.
[0007] c) Selection of the modified microorganism able to grow on
the defined medium, with a co-substrate if appropriate.
[0008] The evolved microorganism preferentially contains at least
one evolved gene coding for an evolved protein, the evolution of
which makes it possible to replace the inhibited metabolic pathway
by a new metabolic pathway.
[0009] This invention also concerns a method comprising an
additional step a1) in which at least one heterologous gene coding
for a heterologous protein is introduced, which heterologous gene
is intended to cause the evolution of a new metabolic pathway,
prior to step b) in which a modified microorganism is grown.
[0010] This invention also concerns a method comprising a step d)
in which an evolved gene coding for said evolved protein is
isolated.
[0011] This invention also concerns a method according to the
invention whereby the evolved gene obtained previously is
introduced, in an appropriate form, into a production microorganism
intended for the production of the evolved protein.
[0012] This invention also concerns an evolved microorganism that
may be obtained by a method according to the invention as defined
above and below.
[0013] The invention also concerns a method for the preparation of
an evolved protein characterized in that an evolved microorganism
according to the invention is grown in an appropriate culture
medium for the production of the evolved protein, which protein is
purified when appropriate.
[0014] This invention also concerns an evolved gene coding for an
evolved protein that may be obtained by a method according to the
invention as defined above and below.
[0015] This invention also concerns an evolved protein that may be
obtained by a method according to the invention as defined above
and below.
[0016] This invention also concerns the use of an evolved
microorganism or an evolved protein as defined above and below in a
biotransformation process.
[0017] Definitions
[0018] According to the invention an `evolved microorganism` is
defined as a microorganism obtained by selection of a modified
microorganism. The evolved microorganism displays at least one
difference from the modified microorganism. This difference may,
for example, be the improvement of an enzymatic characteristic, or
the creation of a new metabolic pathway.
[0019] According to the invention a `metabolic pathway` is one or
more enzymatic reactions the succession of which forms a molecule
(product) that is different from the starting molecule
(substrate).
[0020] According to the invention a `modification` is a change, in
particular a deletion, of at least one gene and/or its promoter
sequence, which gene codes for an enzyme.
[0021] According to the invention a `metabolite` is a molecule
synthesized and/or transformed by the microorganism.
[0022] According to the invention a `defined medium` is a medium of
known molecular composition suitable for the growth of the
microorganism. The defined medium is substantially free of the
metabolite or metabolites, the production of which is inhibited by
performing the modification.
[0023] According to the invention a `co-substrate` is an organic or
inorganic molecule, different from the substrate, which is involved
in a reaction and gives one or more of its atoms to the substrate
to form a product. The co-substrate has no recognized mutagenic
properties.
[0024] According to the invention `selection` is a culture method
used to select microorganisms that have evolved in such a way that
a modification does not affect growth anymore. A preferred
application is a continuous culture method, carried out by applying
increasing rates of dilution so as to conserve in the culture
medium only those microorganisms with a growth rate equal to or
greater than the imposed rate of dilution.
[0025] According to the invention an `evolved gene` is a sequence
of nucleic acids (comprising A, T, G or C) bounded by a stop codon
(TAA, TAG, TGA) in phase and possessing, after selection, at least
one nucleic acid that is different from the initial sequence, so
that the protein coded by that evolved gene differs in at least one
amino acid from the protein coded by the initial gene.
[0026] According to the invention a `heterologous gene` is a
sequence of nucleic acids bounded by a start codon (ATG or GTG) and
a stop codon (TAA, TAG, TGA) in phase, called a coding sequence,
derived from an organism different from that used to carry out the
evolution and/or the production.
[0027] According to the invention an `evolved protein` is a
sequence of amino acids (protein sequence) that differs in at least
one amino acid from the initial protein sequence after
selection.
[0028] According to the invention a `heterologous protein` is a
protein resulting from the translation of a heterologous gene.
[0029] The genes and proteins can be identified by their primary
sequences, but also by sequence or alignment homology defining
groups of proteins.
[0030] PFAM (protein families database of alignments and hidden
Markov models; http://www.sanger.ac.uk/Software/Pfam/) represents a
large collection of protein sequence alignments. Each PFAM makes it
possible to visualize multiple alignments, see protein domains,
evaluate distribution among organisms, gain access to other
databases, and visualize known protein structures.
[0031] COGs (clusters of orthologous groups of proteins;
http://www.ncbi.nlm.nih.gov/COG/) are obtained by comparing protein
sequences from 43 fully sequenced genomes representing 30 major
phylogenic lines. Each COG is defined from at least three lines,
which permits the identification of former conserved domains.
[0032] The means of identifying homologous sequences and their
percentage homologies are well known to those skilled in the art,
and include in particular the BLAST programs, which can be used
from the website http://www.ncbi.nlm.nih.gov/BLAST/ with the
default parameters indicated on that website. The sequences
obtained can then be exploited (e.g., aligned) using, for example,
the programs CLUSTALW (http://www.ebi.ac.uk/clustalw/) or MULTALIN
(http://prodes.toulouse.inra.fr/multalin/cgi-bin/multalin.pl), with
the default parameters indicated on those websites.
[0033] Using the references given on GenBank for known genes, those
skilled in the art are able to determine the equivalent genes in
other organisms, bacterial strains, yeasts, fungi, mammals, plants,
etc. This routine work is advantageously done using consensus
sequences that can be determined by carrying out sequence
alignments with genes derived from other microorganisms, and
designing degenerate probes to clone the corresponding gene in
another organism. These routine methods of molecular biology are
well known to those skilled in the art, and are described, for
example, in Sambrook et al. (1989 Molecular Cloning: a Laboratory
Manual. 2.sup.nd ed. Cold Spring Harbor Lab., Cold Spring Harbor,
N.Y.).
[0034] The genes that may be deleted or overexpressed for the
evolved, strains according to the invention are principally defined
using the denomination of the gene of E. coli. However, this usage
has a more general meaning according to the invention and covers
the corresponding genes of other microorganisms. Using the GenBank
references for the genes of E. coli those skilled in the art can
determine the equivalent genes in bacterial strains other than E.
coli.
[0035] According to the invention a `new metabolic pathway` is a
set of one or more enzyme reactions, the succession of which
produces a chemical entity that, after the step to select the
evolved microorganism, differs in its enzymatic activities from the
corresponding pathway in the corresponding non-evolved
microorganism. This difference can reside in the type of reaction
catalyzed, or in kinetic characteristics (K.sub.m, V.sub.max,
K.sub.i, etc.). A new enzymatic pathway makes it possible to
produce a chemical entity different from or the same as the initial
product, from a substrate different from or the same as the initial
substrate.
[0036] According to the invention an `appropriate form` is a
sequence of nucleic acids, bounded by a start codon (ATG or GTG)
and a stop codon (TAA, TAG, TGA) in phase, called a coding
sequence, or a part of that coding sequence, under the control of
regulators necessary for its expression in the microorganism in
which the heterologous gene is to be expressed. These regulators
are well known to those skilled in the art, and include promoting
regulators, or promoters, in particular promoters called strong
constitutive promoters in microorganisms. The constitutive promoter
is preferably chosen from among pTAC-O, pLAC-O, pTRC-O, strong
promoters for which the lac operator has been deleted to make them
constitutive, pTHLA.
[0037] According to the invention an `initial microorganism` is a
microorganism that has not yet undergone any modification, mutation
or evolution.
[0038] According to the invention a `production microorganism` is
an evolved microorganism or optimized microorganism into which a
new metabolic pathway from an evolved microorganism has been
introduced.
[0039] According to the invention a `modified microorganism` is a
microorganism obtained by performing controlled modifications,
i.e., that are not the result of a process of evolution. Examples
of such a modification are the directed mutation or deletion of a
gene, or the directed modification of a promoter.
[0040] According to the invention a `culture medium suitable for
the production of the evolved protein` is a medium of defined
composition, or a complex medium, or a partially defined medium.
The complex medium is obtained from a plant, microorganism or
animal hydrolysate; its composition may be determined by analysis,
although an exhaustive analysis of this type of medium is seldom
possible. A partially defined medium is a defined medium to which a
complex medium has been added.
[0041] According to the invention a `biotransformation process` is
a process whereby a molecule A is transformed into a molecule B by
means of one or more enzymes, which may or may not be contained in
one or more microorganisms. There are three types of
biotransformation: bioconversion, fermentation and biocatalysis. In
bioconversion, the enzyme or enzymes are produced in one or more
microorganisms grown on a suitable medium, and substance A and if
necessary one or more co-substrates are supplied for conversion
into substance B. In fermentation, the enzyme or enzymes are
produced in one or more microorganisms grown on a suitable medium
to enable the microorganism or microorganisms to synthesize
substance A; the suitable medium can contain co-substrates. In
biocatalysis, the enzyme or enzymes are not in cells but in a
suitable medium supplying substance A and any co-substrates
necessary for the biotransformation.
[0042] The methods for the isolation of genes are well known to
those skilled in the art, and are described in particular in
Sambrook et al. (1989 Molecular Cloning: a Laboratory Manual.
2.sup.nd Ed. Cold Spring Harbor Lab., Cold Spring Harbor, N.Y.),
Ausubel et al., 1987 (Current Protocols in Molecular Biology, John
Wiley and Sons, New York); Maniatis et al., 1982, (Molecular
Cloning: a Laboratory Manual. Cold Spring Harbor Laboratory, Cold
Spring Harbor, N.Y.). These methods make it possible to locate,
copy or extract the gene in order to introduce it into a new
organism. This last step can be preceded by a step in which the
gene is incorporated into a polynucleotide before being introduced
into the microorganism.
[0043] Methods for purifying proteins are well known to those
skilled in the art, and are described in particular in Coligan et
al., 1997 (Current Protocols in Protein Science, John Wiley &
Sons, Inc). They make it possible to identify a protein of interest
in a fractionated or non-fractionated protein extract. This protein
can then be purified, resulting in an increase in its specific
activity if it is an enzyme. Lastly, these methods make it
possible, if necessary, to immobilize the protein on a support
(e.g., a resin).
[0044] According to the invention a `deletion` is the suppression
of the activity of the `deleted` gene. This suppression can result
from an inactivation, by suitable means, of the product of the
expression of the gene concerned, or the inhibition of the
expression of the gene concerned, or the deletion of at least part
of the gene concerned so that its expression is impaired (for
example deletion of part or all of promoter region necessary for
its expression), or the loss of function of the product of the
expression (for example deletion in the coding part of the gene
concerned).
[0045] The deletion of a gene preferably consists of the removal of
most of that gene, and if appropriate its replacement by a
selection marker gene to facilitate identification, isolation and
purification of the evolved strains according to the invention.
[0046] According to the invention a `substrate` is a metabolite
that can be transformed by the action of an enzyme, if necessary in
the presence of a co-substrate.
DETAILED DESCRIPTION OF THE INVENTION
A. MODIFIED MICROORGANISMS
[0047] The strains of modified microorganisms according to the
invention can be prokaryotic or eukaryotic.
[0048] According to the invention a strain of a microorganism is a
set of microorganisms belonging to the same species, that comprises
at least one microorganism of that species. Thus the
characteristics described for the strain apply to each of the
microorganisms of that strain. Likewise, the characteristics
described for one of the microorganisms of the strain apply to all
the microorganisms of which that strain is composed.
[0049] The optimized bacteria according to the invention are
selected from among bacteria, yeasts and fungi, in particular among
the following species: Aspergillus sp., Bacillus sp.,
Brevibacterium sp., Clostridium sp., Corynebacterium sp.,
Escherichia sp., Gluconobacter sp., Pseudomonas sp., Rhodococcus
sp., Saccharomyces sp., Streptomyces sp., Xanthomonas sp., Candida
sp.
[0050] In a preferred embodiment the bacterial strain is a strain
of Escherichia, in particular E. coli. In another embodiment the
bacterial strain is a strain of Corynebacterium, in particular C.
glutamicum.
[0051] In another embodiment the yeast strain is a strain of
Saccharomyces, in particular S. cerevisiae
[0052] To prepare such modified microorganisms it can be
advantageous to attenuate, and in particular to delete, other genes
associated with or independent of the metabolic pathway to be
modified, in order to favor the evolution of the microorganism.
[0053] To prepare such modified microorganisms it can also be
advantageous to favor, and in particular to overexpress, other
heterologous or non-heterologous genes, associated with or
independent of the metabolic pathway to be modified, in order to
favor the evolution of the microorganism.
[0054] The overexpression of a gene can be achieved by replacing
the promoter of that gene in situ by a strong or inducible
promoter. Alternatively, a single-copy or multicopy replicative
plasmid in which the gene that is to be overexpressed is controlled
by the appropriate promoter is introduced into the cell.
[0055] Such modifications will be decided on case by case according
to the choice of metabolic pathway to be modified. In particular
they will be described case by case for the particular metabolic
pathways outlined below.
[0056] Those skilled in the art know the protocols used to modify
the genetic characters of microorganisms.
[0057] The inactivation of a gene is carried out preferably by
homologous recombination. (Datsenko, K. A.; Wanner, B. L. (2000),
One-step inactivation of chromosomal genes in Escherichia coli K-12
using PCR products. Proc. Natl. Acad. Sci. USA 97: 6640-6645). The
principal of a protocol is briefly as follows: a linear fragment
obtained in vitro is introduced into the cell; this fragment
comprises the two regions flanking the gene and at least one gene
of selection between these two regions (generally a gene of
resistance to an antibiotic); the fragment therefore presents an
inactivated gene. The cells that have undergone a recombination
event and have integrated the fragment are then selected by
spreading them on a selective medium. The cells that have undergone
a double recombination event in which the native gene has been
replaced by the inactivated gene are then selected. This protocol
can be improved by using positive or negative selection systems to
increase the rate of detection of double recombination events.
[0058] The inactivation of a gene in S. cerevisiae is achieved
preferably by homologous recombination (Baudin et al., Nucl. Acids
Res. 21, 3329-3330, 1993; Wach et al., Yeast 10, 1793-1808, 1994;
Brachmann et al., Yeast. 14:115-32, 1998).
B. PRODUCTION MICROORGANISMS
[0059] The production microorganisms are also selected from among
the bacteria, yeasts and fungi listed above. They can be evolved
microorganisms obtained by the evolution procedure according to the
invention, or microorganisms optimized for the production of a
desired metabolite, in which at least one evolved gene according to
the invention has been introduced.
C. CULTURE OF MICROORGANISMS
[0060] According to the invention, the terms `culture` and
`fermentation` are used indifferently to denote the growth of a
microorganism on an appropriate culture medium containing a simple
carbon source.
[0061] According to the invention a simple carbon source is a
source of carbon that can be used by those skilled in the art to
obtain normal growth of a microorganism, in particular of a
bacterium. In particular it can be an assimilatable sugar such as
glucose, galactose, sucrose, lactose or molasses, or by-products of
these sugars. An especially preferred simple carbon source is
glucose. Another preferred simple carbon source is sucrose.
[0062] Those skilled in the art are able to define the culture
conditions for the microorganisms according to the invention. In
particular the bacteria are fermented at a temperature between
20.degree. C. and 55.degree. C., preferably between 25.degree. C.
and 40.degree. C., and more specifically about 30.degree. C. for C.
glutamicum and about 37.degree. C. for E. coli.
[0063] The fermentation is generally conducted in fermenters with
an inorganic culture medium of known defined composition adapted to
the bacteria used, containing at least one simple carbon source,
and if necessary a co-substrate necessary for the production of the
metabolite.
[0064] In particular, the inorganic culture medium for E. coli can
thus be of identical or similar composition to an M9 medium
(Anderson, 1946, Proc. Natl. Acad. Sci. USA 32:120-128), an M63
medium (Miller, 1992; A Short Course in Bacterial Genetics: A
Laboratory Manual and Handbook for Escherichia coli and Related
Bacteria, Cold Spring Harbor Laboratory Press, Cold Spring Harbor,
N.Y.) or a medium such as that defined by Schaefer et al. (1999,
Anal. Biochem. 270: 88-96).
[0065] Analogously, the inorganic culture medium for C. glutamicum
can thus be of identical or similar composition to BMCG medium
(Liebl et al., 1989, Appl. Microbiol. Biotechnol. 32: 205-210) or
to a medium such as that described by Riedel et al. (2001, J. Mol.
Microbiol. Biotechnol. 3: 573-583).
D. METABOLIC PATHWAYS
[0066] The metabolic pathways to be evolved are generally selected
from among the synthetic pathways of amino acids, the synthetic
pathways of nucleic acids, the synthetic pathways of lipids or the
metabolic pathways of sugars.
[0067] In a first preferred embodiment of the invention, the
evolved metabolic pathway is a biosynthesis pathway of amino acids,
in particular a biosynthesis pathway of an amino acid selected from
among methionine, cysteine, threonine, lysine, or isoleucine.
[0068] In a second preferred embodiment of the invention the
modified metabolic pathway is a pathway by which NADP is
regenerated from NADPH. In particular the biosynthesis pathway of
cysteine, of hydroxypropionate and of xylitol will be cited.
[0069] D.I. The Methionine Biosynthesis Pathway
[0070] The invention can be applied, for example, to the methionine
biosynthesis pathway (FIG. 1) and yields strains of microorganisms,
in particular bacteria, e.g., E. coli and corynebacteria, that
produce 2-amino-4-(alkylmercapto)butyrc acid, in particular
L-methionine 2-amino-4-(methylmercapto)butyrc acid) by metabolism
of a simple carbon source and a sulfur source, in particular
methylmercaptan (CH.sub.3SH), hydrogen sulfide (H.sub.2S) or
physiologically acceptable salts of these. The sulfur source
H.sub.2S can also be introduced into the culture medium as sulfate.
The invention also concerns the strain of a microorganism, the
improved enzymes and their coding sequences. The invention concerns
finally a process for the preparation of methionine by culturing
the said strain of a microorganism. DL-methionine is produced
industrially by chelical synthesis. Methylmercaptan reacts with
acroleine to produce .beta.-thiopropionaldehyde that reacts with
hydrogen cyanide producing
.alpha.-hydorxy-.gamma.-thiobutyronitrile. After treatment with
ammonia and hydrolysis methionine is obtained.
[0071] All the industrial producers of DL-methionine use the same
raw materials, namely acrolein, methane thiol (methyl mercaptan),
hydrogen cyanide and ammonia or ammonium carbonate. This synthesis
of racemic methionine can be carried out as a batch or a continuous
process.
[0072] One industrial process includes biocatalysis in the chemical
synthesis, using amino acylase, an enzyme produced by Aspergillus
oryzas, to obtain pure L-methionine from DL-methionine
[0073] Patents U.S. Pat. No. 6,379,934 and EP 1 055 730 describe
the production of amino acids using a strain of coryneform bacteria
in which the accBC gene is amplified. Methionine is mentioned, but
only the preparation of L-lysine is exemplified.
[0074] However, the synthesis of sulfur-containing amino acids by
culture of micro-organisms remains difficult to implement at a
scale suited to possible industrial production, in particular owing
to the complexity of their biosynthesis pathways and their many
mechanisms of regulation.
[0075] The metabolism of methionine is closely regulated at several
levels (Weissbach et al., 1991, Mol. Microbiol., 5, 1593-1597):
[0076] Carbon metabolism for the synthesis of L-serine from
3-Phosphoglycerate, and L-homoserine from aspartate and acetyl-CoA.
[0077] Sulfur metabolism for the synthesis of L-cysteine from
L-serine, acetyl-CoA and sulfate present in the culture medium.
[0078] Methionine synthesis (FIG. 1) from L-homoserine, cysteine
and acetyl-CoA or succinyl-CoA.
[0079] Patent application WO 93/17112 describes the different
enzymes involved in the biosynthesis of methionine from L-aspartic
acid in various organisms. This patent application also describes
the introduction into a micro-organism of several exogenous genes
acting in sequence for the synthesis of methionine, using methyl
mercaptan or hydrogen sulfide as a sulfur source.
[0080] This invention concerns strains of micro-organisms, in
particular of bacteria, in particular of E. coli and
corynebacteria, producing 2-amino-4-(alkylmercapto)butyric acids of
general formula (I) R--S--(CH.sub.2).sub.2--CHNH.sub.2--COOH
(I)
[0081] where R is a straight-chain or branched-chain alkyl group
containing 1 to 18 carbon atoms, which may bear one or more hydroxy
substituents, or an aryl group or a heteroaryl group containing one
or more atoms of nitrogen or sulfur in its heteroaromatic ring, and
which can be a phenyl, pyridyl, pyrolyl, pyrazolyl, triazolyl,
tetrazolyl, thiazolyl, or thienyl group,
[0082] by the metabolism of a simple carbon source and a sulfur
source consisting of a compound of general formula (II) R'--SH
(II)
[0083] where R' is a hydrogen atom or a group R as defined above,
and its physiologically acceptable salts,
[0084] which strains present at least one gene coding for an enzyme
with a modified `methionine synthase` activity.
[0085] An enzyme with a modified `methionine synthase` activity
according to the invention is any enzyme involved in the
biosynthesis of 2-amino-4-(alkylmercapto)butyric acids of general
formula (I) by bioconversion of a substrate of general formula
(III) R''--O--(CH.sub.2).sub.2--CHNH.sub.2--COOH (III)
[0086] where R'' is an acyl group, preferably either a succinyl
group or an acetyl group,
[0087] or by direct bioconversion of the substrate into an acid of
general formula (I),
[0088] or by bioconversion of the substrate into homocysteine, of
formula (IV) HS--(CH.sub.2).sub.2--CHNH.sub.2--COOH (IV) which is
then converted into the acid of general formula (I) by an
appropriate enzyme.
[0089] The enzymes with modified `methionine synthase` activity are
enzymes that are modified compared with the wild type enzymes, so
that they will preferentially perform the direct bioconversion of
the substrate of general formula (III) into the acid of general
formula (I) or homocysteine, of formula (IV), in place of the
reaction catalysed by the wild type enzyme. This modification, also
termed mutation, results essentially in a greater affinity of the
modified enzyme for the sulfur-containing compound of general
formula (II) than for its natural co-substrate.
[0090] A simple carbon source according to the present invention is
any carbon source that can be used by those skilled in the art to
obtain the normal growth of a micro-organism, in particular a
bacterium. This definition includes in particular any assimilable
sugar, such as glucose, galactose, sucrose, or molasses, or
by-products of these sugars. One especially preferred simple carbon
source is glucose. Another preferred simple carbon source is
sucrose.
[0091] A physiologically acceptable salt according to the invention
is any salt of the compound of general formula (I) that does not
affect the metabolism or the growth capacity of the micro-organism
according to the invention, being in particular an alkali metal
salt, such as a sodium salt.
[0092] In a preferred embodiment of the invention, R is a
straight-chain or branched-chain alkyl group containing 1 to 4
atoms of carbon, in particular a methyl, ethyl, n-propyl, i-propyl,
n-butyl, i-butyl or t-butyl group, and is preferably a methyl
group.
[0093] The 2-amino-4-(alkylmercapto)butyric acid of general formula
(I) obtained is preferably L-methionine. The use of a simple carbon
source and a sulfur compound of formula (II) to produce an acid of
formula (I) by bioconversion offers several advantages a priori, in
particular: [0094] The synthesis of the acid (1), and of
methionine, in one or two steps from O-acyl-L-homoserine, becomes
independent of the synthesis of cysteine, and also of the
tetrahydrofolate cycle. [0095] The sulfur-containing compounds of
formula (II), such as methyl mercaptan, which are generally toxic
petrochemicals, are used to good purpose as raw materials for the
biosynthesis of useful amino acids with added value.
[0096] The invention is based on the directed modification of the
`methionine-synthase` activity of cystationine-.gamma.-synthase (EC
4.2.99.9; GenBank AAN83320, or AAA24167) in the presence of
methyl-mercaptan. This enzyme of the methionine biosynthesis
pathway, coded for by the gene metB in E. coli (FIG. 2) and C.
glutamicum, presents an activity for a wide spectrum of substrates
(Flavin, M.; Slaughter, C. (1967) Enzymatic synthesis of homoserine
or methionine directly from O-succinyl-homoserine. Biochim.
Biophys. Acta 132: 400-405).
[0097] The invention is also based on the directed modification of
the `methionine-synthase` activity of O-acetyl-L-homoserine
sulfhydrylase (or O-acetyl-L-homoserine sulfhydrylase, C 4.2.99.10)
in the presence of methyl mercaptan. This enzyme of the methionine
biosynthesis pathway, coded for by the gene metY in C. glutamicum
(Genbank AF220150), presents an activity for a wide spectrum of
substrates (Smith I K, Thompson J F. (1969) Utilization of
S-methylcysteine and methyl mercaptan by methionineless mutants of
Neurospora and the pathway of their conversion to methionine. II.
Enzyme studies. Biochim Biophys Acta 184(1):130-8).
[0098] The invention therefore also concerns a method for the
preparation of the strains according to the invention and their use
in a method for the preparation of a
2-amino-4-(alkylmercapto)butyric acid of general formula (I),
preferably L-methionine.
[0099] The method for the preparation of strains according to the
invention consists of obtaining, from an initial bacterial strain,
a genetically modified bacterial strain that presents at least one
modification to a gene coding for an enzyme with `methionine
synthase` activity, by a process that comprises a step in which
that initial bacterial strain is subjected to a selection pressure
in the presence of a compound of formula (II) defined above, in
order to direct the evolution of the gene coding for the enzyme
with `methionine synthase` activity in that bacterial strain
towards a gene coding for an enzyme with a `methionine synthase`
activity that is modified relative to that of the initial bacterial
strain.
[0100] A `methionine synthase` activity is improved in strain (A)
of the micro-organism relative to the initial strain (I) when the
production of methionine in the same culture conditions (in a
medium containing an appropriate quantity of the sulfur-containing
compound of formula (II)) is greater in strain (A) than in strain
(I). This improvement is preferably observed by measuring the
quantity of methionine produced. In some cases this improvement can
be observed by the increase in the growth rate of bacteria (A)
relative to the growth rate of bacteria (I), in a minimum medium
containing no methionine.
[0101] This invention also concerns those strains with improved
`methionine synthase` activity that can be obtained by the
selection process according to the invention, and comprising at
least one gene coding for an enzyme with a modified `methionine
synthase` activity as defined above and below.
[0102] In a first embodiment of the invention the enzyme with
modified `methionine synthase` activity allows the direct
conversion of the substrate of general formula (III) into the acid
of general formula (I). In this case the sulfur source is a
compound of general formula (II) where R' is a group R as defined
above.
[0103] The enzyme with modified methionine synthase activity is
chosen from among the cystathionine-.gamma.-synthases and the
acylhomoserine sulfhydrylases.
[0104] In a second embodiment of the invention the enzyme with
modified `methionine synthase` activity allows the conversion of
the substrate of general formula (III) into homocysteine, of
general formula (IV) HS--(CH.sub.2).sub.2--CHNH.sub.2--COOH
(IV)
[0105] which is then converted into an acid of general formula (I)
by an appropriate enzyme. In this case, the sulfur-containing
source is a compound of general formula (II) in which R' is an atom
of hydrogen, preferably, hydrogen sulfide. The sulfur source
H.sub.2S can be introduced into the culture medium or be produced
by the bacteria from a simple sulfur source, for example a
sulfate.
[0106] The enzyme with modified methionine synthase activity is
advantageously chosen from among the
cystathionine-.gamma.-synthases and the acylhomoserine
sulfhydrylases.
[0107] Those skilled in the art will know how to select other
enzymes with modified `methionine synthase` activity according to
their ability to evolve, so as to carry out the modified enzymatic
`methionine synthase reaction` as defined above. Examples include
in particular the cysteine synthases A and B, coded for by the
genes cysK and cysM in bacteria.
[0108] For the modified cystathionine-.gamma.-synthases defined
above and below, the substrate is advantageously
O-acetyl-L-homoserine or O-succinyl-L-homoserine, preferably
O-succinyl-L-homoserine.
[0109] For the modified acylhomoserine sulfhydrylases defined above
and below, the substrate is advantageously O-succinyl-L-homoserine
or O-acetyl-L-homoserine, preferably O-acetyl-L-homoserine.
[0110] For these two enzymes, the modification consists essentially
of a mutation such that the conversion of the substrate of general
formula (III) takes place preferentially with the compound of
general formula (II) rather than with L-cysteine.
[0111] The mutation of the enzymes can be obtained by implementing
the method for the preparation of strains with improved `methionine
synthase` activity according to the invention by culture under
selection pressure in the presence of the compound of general
formula (II).
[0112] In this case, the gene with the sequence coding for
cystathionine-Y-synthase or acylhomoserine sulfhydrylase can be
[0113] a wild type gene present in the genome of the original
strain (I), where it is expressed to allow the translation of the
corresponding enzyme, or [0114] a heterologous gene that includes a
sequence coding for a cystathionine-.gamma.-synthase or an
acylhomoserine sulfhydrylase, under the control of regulatory
elements that permit its expression and translation in the original
strain (I) into which it was introduced, or [0115] obtained by
directed mutagenesis directly on the wild type gene present
naturally in the initial strain (I), in particular by homologous
recombination, or [0116] obtained by the usual techniques of
directed mutagenesis on sequences coding for a
cystathionine-.gamma.-synthase or an acylhomoserine sulfhydrylase,
subsequently introduced into the initial strain (I) under the
control of regulatory elements that allow its expression and
translation in the initial strain. (I) into which it was
introduced.
[0117] Such regulatory elements are well known to those skilled in
the art, and contain promoter regulation sequences, or promoters,
in particular strong constitutive promoters in micro-organisms. The
strong constitutive promoter is preferably pTAC-O (SEQ ID No. 1),
or pLAC-O (SEQ ID No. 2), or pTRC-O (SEQ ID No. 3), or pTHLA (SEQ
ID No. 4), all of which are strong promoters in which the lac
operator has been deleted to make them constitutive.
[0118] The `initial` or unmodified `methionine synthase` activity
cystathionine-.gamma.-synthases are advantageously selected among
the cystathionine-.gamma.-synthases corresponding to PFAM reference
PF01053 and to COG reference CPG0626.
[0119] The cystathionine-.gamma.-synthase is preferably the
cystathionine-.gamma.-synthase from E. coli K12, represented by SEQ
ID No. 6. Homologous sequences of this sequence have
cystathionine-.gamma.-synthase activity and at least 80% homology,
preferably 90% homology, and more preferably 95% homology with the
amino acid sequence of SEQ ID No. 6.
[0120] The means of identifying homologous sequences and their
percentage of homology are well-known to those skilled in the art,
and include in particular the BLAST program, and in particular the
BLASTP program, which can be used from the web site
http://www.ncbi.nlm.nih.gov/BLAST/ with the default parameters
indicated on that site.
[0121] In a preferred embodiment of the invention the initial
cystathionine-.gamma.-synthase, before modification, contains the
following sequence of amino acids in its C-terminal part.
(conserved zone 1) [0122] X1-X2-X3-L-G-X4-X5-X6-X7-X8-X9
[0123] in which
[0124] X1 represents A,G,S, preferably A
[0125] X2 represents E,V,P,T, preferably E
[0126] X3 represents S,T,N, preferably S
[0127] X4 represents G,D,A,H,T, preferably G
[0128] X5 represents V,A,T,H,N, preferably V
[0129] X6 represents E,R,K,F, preferably E
[0130] X7 represents S,T, preferably S
[0131] X8 represents L,I,V,A, preferably L and
[0132] X9 represents I,V,A,T, preferably I.
[0133] The cystathionine-.gamma.-synthase with modified `methionine
synthase` activity according to the invention preferably contains
the following amino acid sequence in its C-terminal part: [0134]
A-E-S-L-G-G-V-E-S
[0135] The initial cystathionine .gamma.-synthase, before
modification, also advantageously contains at least one of the
following amino acid sequences in its N-terminal part (conserved
zone 2): [0136] X10-X11-Y-X12-R-X13-X14-X15-X16-X17-X18
[0137] in which
[0138] X10 represents H,Y,F,L,K, preferably A
[0139] X11 represents E,D,K,R V,I, preferably Y
[0140] X12 represents S,A,T,P,G, preferably S
[0141] X13 represents I,S,T,R,E,F,W,D, preferably S
[0142] X14 represents S,G,A,I,E,N,K,P, preferably G
[0143] X15 represents N,H,Q,S, preferably N
[0144] X16 represents P,D,L, preferably P
[0145] X17 represents T,M,N,G,S, preferably T and
[0146] X18 represents R,L,V,S,W,E, preferably R.
[0147] Amino acids X1 to X9 correspond to residues 324 to 334 of
the cystathionine .gamma.-synthase sequence of E. coli K12,
represented on SEQ ID No. 6.
[0148] The amino acids X10 to X18 correspond to residues 44 to 54
of the sequence of cystathionine .gamma.-synthase of E. coli K12,
represented on SEQ ID No. 6.
[0149] The positions of the amino acids used above and below are
relative positions set with reference to the sequence of the
cystathionine-.gamma.-synthase of E. coli K12. Those skilled in the
art will of course know how to find the corresponding amino acids
on other sequences of cystathionine-.gamma.-synthases, using the
usual sequence alignment tools. These tools include in particular
the BLAST program, which can be used from the web site
http://www.ncbi.nlm.nih.gov/BLAST/ with the default parameters
indicated on that site. The sequence alignment can be carried out
at the level of both the protein (SEQ ID No. 6) and its coding
sequence, such as for example the coding sequence represented on
SEQ ID No. 5.
[0150] The advanced search function of BlastP can also be
advantageously used by refining the search with a (PHI-BLAST)
motif. In this case the motif
[AGS]-[EVPT]-[STN]-L-G-[GDAHT]-[VATHN]-[ERKF]-[ST]-[LIVA]-[IVAT]
can be taken for a first conserved zone, and the motif
x(2)-Y-[SATPG]-R-x(2)-[NHQS]-[PDL]-[TMNGS]-[RLVSWE] for a second
conserved zone, where the letters in bold type represent the amino
acids found most often at that position in the sequence, and where
x stands for any amino acid. The number 2 in brackets signifies
that there are two undetermined amino acids.
[0151] For the sequence alignment, the CLUSTALW program
(http://www.ebi.ac.uk/clustalw/) or the MULTALIN program
(http://prodes.toulouse.inra.fr/multalin/cgi-bin/multalin.pl) can
be used, with the default parameters indicated on those sites.
[0152] One such sequence alignment is represented in FIG. 7 for a
selection of different cystathionine-.gamma.-synthases.
[0153] These are preferably chosen from among the following
cystathionine-.gamma.-synthases (CGS): [0154] Q9ZMW7 O-succinyl
homoserine (thiol)-lyase, Helicobacter pylori [0155] P46807
O-succinyl homoserine (thiol)-lyase, Mycobacterium leprae [0156]
AAO29646 Xylella fastidiosa Temecula1 [0157] NP.sub.--638204
Xanthomonas campestris pv. campestris str. ATCC 33913 [0158]
NP.sub.--358970 Streptococcus pneumoniae R6 [0159] NP.sub.--126586
O-succinylhomoserine (thiol)-lyase, Pyrococcus abyssi [0160]
NP.sub.--373671 Staphylococcus aureus subsp. aureus N315 [0161]
NP.sub.--418374 [Escherichia coli K12 [0162] NP.sub.--601979
Corynebacterium glutamicum ATCC 13032 [0163] NP.sub.--343729
O-succinylhomoserine (thiol)-lyase, Sulfolobus solfataricus [0164]
NP.sub.--786043 O-succinylhomoserine (thiol)-lyase, Lactobacillus
plantarum WCFS1 [0165] NP.sub.--719586 Shewanella oneidensis MR-1
[0166] CAD30944 Streptomyces coelicolor A3(2) [0167]
NP.sub.--696324 Bifidobacterium longum NCC2705 [0168]
NP.sub.--457953 Salmonella enterica subsp. enterica serovar typhi
[0169] NP.sub.--539021 Brucella melitensis [0170] EAA30199
O-succinylhomoserine (thiol)-lyase, Neurospora crassa [0171]
BAC61028 Vibrio parahaemolyticus.
[0172] The modified cystathionine-.gamma.-synthase as defined above
preferably presents at least one mutation in its C-terminal part,
and (or) at least one mutation in its N-terminal part.
[0173] A mutation according to the invention is the substitution of
an amino acid in the wild type sequence by a different amino
acid.
[0174] The mutation preferably consists of the replacement of an
acidic amino acid, which interacts with the cysteine co-substrate
for the unmodified enzyme, by an apolar amino acid. This apolar
amino acid is a glycine, alanine, leucine, isoleucine, valine,
phenylalanine or methionine residue.
[0175] These amino acids can be identified by reference to the
crystal structure of the cystathionine-.gamma.-synthases of E.
coli, described by Clausen et al. (EMBOJ, Vol. 17, No. 23, pp
6827-6838, 1998).
[0176] The mutation in the C-terminal part is advantageously
introduced among the acidic amino acids of the `conserved zone 1`
as defined above, in particular at the level of residue X2.
[0177] The cystathionine-.gamma.-synthase with modified `methionine
synthase` according to the invention advantageously contains the
following amino acid sequence in its C-terminal part: [0178]
X1-X2-X3-L-G-X4-X5-X6-X7-X8-X9
[0179] in which
[0180] X1, X3, X4, X5, X6, X7, X8 and X9 are defined above, and
[0181] X2 stands for G,A,L,I,V,F, or M, and preferably A.
[0182] The mutation in the N-terminal part is advantageously
introduced among the amino acids of the `conserved zone 2` as
defined above, in particular at the level of residue X11 and (or) R
and (or) X13.
[0183] Preferentially the cystathionine-.gamma.-synthase with
modified `methionine synthase` activity according to the invention
contains the following amino acid sequence in its C-terminal part.
[0184] A-A-S-L-G-G-V-E-S
[0185] The cystathionine-.gamma.-synthase with modified `methionine
synthase` activity according to the invention can advantageously
contain the following amino acid sequence in its N-terminal
part:
[0186] X10-X11-Y-X12-X19-X13-X14-X15-X16-X17-X18
[0187] in which
[0188] X7; X9,X12, X14, X15, X16, X17 and X18 are defined
above,
[0189] X11 is defined above or is an apolar amino acid, [0190] X13
is defined above or is an apolar amino acid,
[0191] X19 is defined above or is an apolar amino acid, and
[0192] at least one of the amino acids X11, X13 and X19 is an
apolar amino acid as described above.
[0193] In a preferred embodiment of the invention the
cystathionine-.gamma.-synthase with modified `methionine synthase`
activity according to the invention is a
cystathionine-.gamma.-synthase as defined above, modified to allow
the direct conversion of O-succinyl-L-homoserine into L-methionine
with methyl mercaptan as a sulfur source (compound of general
formula (II) where R is a methyl group).
[0194] In a preferred embodiment of the invention the
cystathionine-.gamma.-synthase with modified `methionine synthase`
activity contains the sequence of amino acids represented on SEQ ID
No. 8. A DNA sequence coding for this modified enzyme is
represented on SEQ ID No. 7.
[0195] This invention also concerns the modified
cystathionine-.gamma.-synthases as defined above, and the nucleic
acid sequences coding for these modified
cystathionine-.gamma.-synthases, in particular the isolated
sequences, in particular the DNA sequences, and in particular the
sequence represented on SEQ ID No. 7, the cloning and (or)
expression vectors containing those nucleic acid sequences under
the control of the regulatory elements necessary for the expression
and transcription of the modified cystathionine-.gamma.-synthase in
a host organism, and the host organisms transformed with those
vectors.
[0196] The `initial` or unmodified `methionine synthase` activity
acylhomoserine sulihydrylases are advantageously chosen among the
acylhomoserine sulfhydrylases corresponding to the PFAM reference
PF01053 and the COG reference COG2873.
[0197] They are preferably chosen among the following
acylhomoserine sulhydrylases: [0198] NP.sub.--785969
O-acetylhomoserine (thiol)-lyase, Lactobacillus plantarum WCFS1
[0199] AAN68137 O-acetylhomoserine sulfhydrylase, Pseudomonas
putida KT2440 [0200] NP.sub.--599886 O-acetylhomoserine
sulfhydrylase, Corynebacterium glutamicum ATCC 13032 [0201] NP
712243 acetylhomoserine sulfhydrylase, Leptospira interrogans
serovar lai str. 56601 [0202] BAC46370 O-succinylhomoserine
sulfhydrylase, Bradyrhizobium japonicum USDA110 [0203] AA057279
O-succinylhomoserine sulfhydrylase, Pseudomonas syringae pv. tomato
str. DC3000 [0204] NP.sub.--284520 O-succinylhomoserine
sulfhydrylase [Neisseria meningitidis Z2491 [0205] AAA83435
O-succinylhomoserine sulfhydrylase (P. aeruginosa)
[0206] In a preferred embodiment of the invention, the modification
of the methionine biosynthetic pathway requires initially a
genetically modified bacterium. The modification involves
necessarily the attenuation of at least one gene and possibly the
cloning of at least one heterologous gene. The attenuation of the
gene makes the bacterium dependent on the restoration of an
equivalent metabolic pathway allowing its growth. The genetically
modified bacterium is cultivated and the strain or the bacterial
strains are selected whose growth rate improves in the presence or
absence of an exogenous co-substrate.
[0207] The process for the construction of strains according to the
invention consists of obtaining, starting with an initial strain, a
genetically modified bacterial strain that comprises at least one
modification in a gene coding for an enzyme with "methionine
synthase" activity (e.g. E. coli MetE) or "homocysteine synthase"
activity (e.g. E. coli MetC). This process comprises a step that
consists of subjecting the said initial bacterial strain to a
selection pressure in the presence of the sulfur source defined
above in order to direct the evolution of at least one gene (e.g.
metB in E. coli) in the said bacterial strain, in order to restore
a methionine synthase activity or homocysteine synthase activity in
the evolved strain; this restoration of activity is not linked to a
reversion of the effected modification.
[0208] The invention also concerns a strain with improved
"methionine synthase" activity that comprises an inactivation of at
least one endogenous gene involved in the conventional methionine
biosynthesis pathway.
[0209] In a preferred embodiment the bacterial strain comprises an
inactivation of at least one endogenous gene. This endogenous gene
is chosen among metB, metJ, metC, metE, or metH.
[0210] In a preferred embodiment of the invention, the said
modification of the initial strain that is found in the strain with
improved "methionine synthase" activity, notably E. coli consists
of inactivating the wild-type methionine synthase activity (encoded
by the gene metE in E. coli) and then cultivating the said obtained
modified microorganism on a defined medium lacking methionine,
S-adenosylmethionine, homocysteine and cystathionine, but
containing methylmercaptan (exogenous co-substrate), or one of its
salts, and of selecting an evolved microorganism with strongly
improved methionine synthase activity of the
cystathionine-.gamma.-synthase, in the presence of methylmercaptan,
to the point that it replaces the activity that was initially
inactivated. In this embodiment of the invention it is important to
note that the medium used for the selection of the evolved
microorganism is identical to the medium on which the initial
microorganism (the one that is not modified) grows; only one
co-substrate (e.g. alkylmercaptan) is added. In a specific
embodiment of the invention, the bacterial strain selected
comprising the evolved microorganism according to the invention, is
an E. coli strain, more particularly the strain E. coli K183, that
has been registered under the number 1-3005, on Apr. 2.sup.nd 2003
at the Collection Nationale de Culture et Microorganismes (CNCM),
25 rue du Docteur Roux, 75724 Paris Cedex 15, France according to
the treaty of Budapest. This strain comprises a gene expressing
modified cystathionine-.gamma.-synthase, the enzyme harboring the
mutation E325A, and the inactivation of metE.
[0211] In a particular application of this invention, it is also
possible to use strains that have additional deletions in the metC
and/or metH and/or metJ to obtain the strains with the
corresponding improved "methionine synthase".
[0212] In a second equally preferred embodiment of the invention,
the said modification of the initial strain, notably E. coli,
consists of inactivating the cystathionine-.beta.-lyase activity
(encoded by the gene MetC in E. coli), then of cultivating the said
modified microorganism that is obtained on a defined medium lacking
methionine, S-adenosylmethionine, homocysteine and cystathionine,
then selecting an evolved microorganism in which the homocysteine
synthase activity of the cystathionine-.gamma.-synthase is strongly
improved in the presence of endogenous H2S, to the point of
replacing the initial inactivated activity. In this embodiment it
is important to note that the medium used for the selection of the
evolved microorganism is identical to the medium on which grows the
initial microorganism (the non-modified). In a specific embodiment
of this application, it is also possible to add NaSH to the medium.
In another specific application it is possible to use a strain that
in addition has at least a mutation in metH and/or metJ.
[0213] In a third equally preferred embodiment of the invention,
the said modification of the initial strain, notably E. coli,
consists of inactivating the wild type succinyl-homoserine
sulfhydrylase (encoded by the metB gene) and methionine synthase
(encoded by the metE gene in E. coli). Then the acetyl-homoserine
sulfhydrylase (encoded by the metY gene in C. glutamicum) is
introduced and the said modified obtained microorganism is cultured
on a defined medium lacking methionine, S-adenosylmethionine,
homocysteine and cystathionine, but supplemented with sodium
methylmercaptide with the goal to select an evolved microorganism
in which the methionine synthase activity carried by the
acetyl-homoserine sulfhydrylase (MetY) is strongly improved, in the
presence of sodium methylmercaptide, to the point of replacing the
methionine synthase activity that was initially inactivated. In
this embodiment of the invention it is important to note that the
medium used for the selection of the evolved microorganism is
identical to the medium on which the initial microorganism (the one
that is not modified) grows; only a co-substrate (e.g.
methylmercaptan) is added. In a particular application of this
invention, it is possible to use strains that have additional
deletions in at least the metH and/or metJ and/or metC gene.
[0214] A mutation of the gene metJ is proposed in JP
2000157267-A/3, to produce a greater quantity of methionine (see
also GenBank E35587). This gene codes for a protein that represses
the genes metB, E, L, J and R (in Salmonella typhimurium). Its
inactivation or its modification reduces the negative feedback
control exerted by methionine.
[0215] The gene metC (GenBank M12858), codes for the
cystathionine-.beta.-lyase (EC 4.4.1.8), and the genes metE
(GenBank AE000458) and metH (GenBank J04975) code for the
methionine synthase (EC 2.1.1.13). Methionine is an amino acid that
is essential for cell life. The inactivation of one or more of
these genes has the effect of suppressing the usual methionine
biosynthesis pathway.
[0216] Using the references given in GenBank for these genes, which
are well known, those skilled in the art are able to determine the
equivalent genes in bacterial strains other than E. coli. This
routine work is advantageously performed using consensus sequences
that can be determined from the synthesis of these genes for other
micro-organisms, and by designing degenerate probes to clone the
corresponding gene in another organism. These routine techniques in
molecular biology are well known to those skilled in the art, and
are described for example in Sambrook et al. (1989 Molecular
cloning: a laboratory manual. 2.sup.nd Ed. Cold Spring Harbor Lab.,
Cold Spring Harbor, N.Y.).
[0217] The strain with modified `methionine synthase` activity
according to the invention that possesses an enzyme with modified
`methionine synthase` activity defined above preferably presents at
least one inactivation of the gene metE and (or) metH, and (or) of
the gene metC, and (or) of the gene metB.
[0218] When the enzyme with modified `methionine synthase` activity
defined above allows the direct bioconversion of the substrate of
general formula (III) into an acid of general formula (I), the
strain according to the invention advantageously presents at least
one inactivation of the gene metE and (or) metH and (or) metB,
preferably at least one inactivation of the gene metE.
[0219] When the enzyme with modified `methionine synthase` activity
defined above allows the direct bioconversion of the substrate of
general formula (III) into homocysteine, of formula (IV)
HS--(CH.sub.2).sub.2--CHNH.sub.2--COOH (IV)
[0220] which is then converted into an acid of general formula (I)
by an appropriate enzyme, the strain according to the invention
presents at least one inactivation of the gene MetC and (or) metB.
It can also present an inactivation of the gene metE and (or)
endogenous metH. In this case, the methylase activity associated
with the genes metE and (or) metH is restored by the introduction
of a gene coding for an enzyme with the same activity. This enzyme
can be one that has been selected and (or) modified to improve the
yields of the synthesis of the amino acids of general formula
(I).
[0221] In one embodiment, the bacterial strain can also present a
modification of the homoserine O-acyltransferase activity
controlled by the gene metA such as to lend it either a homoserine
O-succinyltransferase activity (EC 2.3.1.46) or a homoserine
O-acetyltransferase activity (EC 2.3.1.11).
[0222] In a particular embodiment, it is possible to replace or
modify the gene metA of E. coli, coding for the enzyme possessing
the homoserine O-succinyltransferase activity (Genbank AAN83396),
so as to obtain a homoserine O-acetyltransferase activity. Those
skilled in the art know that this activity is coded for by the gene
metA of C. glutamicum (Genbank AF052652). The protocols used to
replace the gene metA of E. coli by the gene metA of C. glutamicum,
or modify the sequence of metA of E. coli to obtain a homoserine
O-acetyltransferase activity in place of a homoserine
O-succinyltransferase activity are known to those skilled in the
art.
[0223] Similarly, it is possible to replace or modify the gene metA
of C. glutamicum, coding for a homoserine O-acetyltransferase
activity, so as to obtain a homoserine O-succinyltransferase
activity.
[0224] All the modifications stated above can be carried out
directly on the strain subjected to selection pressure when the
method according to the invention is implemented. Alternatively, it
is preferable to implement the screening process according to the
invention on a strain that presents only a limited number of
modifications, obtain a strain presenting a `methionine synthase`
activity in the presence of the compound of formula (II), in
particular methyl mercaptan, and carry out other modifications as
described, so as to enhance the bypass of the normal methionine
synthesis pathway.
[0225] Those skilled in the art know the protocols used to modify
the genetic characters of micro-organisms. The over-expression of a
gene can be achieved by changing a promoter of this gene in situ
for a strong or inducible promoter. Alternatively, a replicative
plasmid (single-copy or multicopy) can be introduced into the cell,
in which the gene to be over-expressed is under the control of an
appropriate promoter.
[0226] The inactivation of a gene is preferably carried out by
homologous recombination. The protocol principle is briefly as
follows: a linear fragment is introduced into the cell. This
fragment is obtained in vitro, and it comprises the two regions
flanking the gene, and at least one selected gene between these two
regions (generally a gene for antibiotic resistance). This linear
fragment thus presents an inactivated gene. The cells that have
undergone a recombination event and have integrated the fragment
introduced are selected by plating on a selective medium. The cells
that have undergone a double recombination event are then selected,
in which the native gene has been replaced by the inactivated gene.
This protocol can be improved by using systems of positive and
negative selection to speed up the detection of double
recombination events.
[0227] In a preferred embodiment, the bacterial strain is a strain
of E. coli.
[0228] In another embodiment, the bacterial strain is a strain of
Corynebacterium, in particular C. glutamicum.
[0229] In a preferred embodiment of the invention the bacterial
strain is the strain E. coli K183 registered at the CNCM (French
IDA) on 2 Apr. 2003 under the number I-3005. This strain possesses
a gene expressing a modified cystathionine-.gamma.-synthase that
presents the mutation E325A described previously, and an
inactivation of the gene metE.
[0230] The strains of micro-organisms according to the invention
possess a cystathionine-.gamma.-synthase enzyme and (or) an
acylhomoserine sulfhydrylase enzyme. They are preferably selected
and improved by a method of screening and evolution, which is also
an object of the invention. The strains according to the invention
can also be genetically modified (that is, they can present an
inactivation, a mutation and (or) an over-activation of at least
one endogenous gene). This modification can be made before or after
the implementation of the screening process.
[0231] To accelerate the selection and directed evolution of the
strains for the production of methionine in the presence of the
compound of formula (II), in particular of methyl mercaptan, the
operations described below can be performed. The process is
described for methyl mercaptan, but those skilled in the art will
know how to adapt it to any other compound of formula (II), in
particular H.sub.2S.
[0232] a. Coupling of the Biosynthesis of the Substance of Interest
with the Growth of the Micro-Organism in Such a Way that the
Production of that Substance Becomes Necessary for the Growth of
the Micro-Organism.
[0233] One option is to disrupt the metE gene coding for
methionine-synthase, which produces methionine from homocysteine.
The strain then becomes auxotrophic for methionine.
[0234] To survive in a minimum medium containing a simple carbon
source and methyl mercaptan or sodium methyl mercaptide, the
micro-organism has therefore to optimise the synthesis pathway of
L-methionine from O-acyl-L-homoserine and methyl mercaptan or
sodium methyl mercaptide. Computer modelling shows that in these
conditions it is possible to double theoretical methionine yields
(Table 1). TABLE-US-00001 TABLE 1 Maximum theoretical yields for
the production of methionine (mass of methionine/mass of glucose)
by E. coli for fermentation on glucose (a) and for fermentation on
glucose and methyl mercaptan (b) with a constant biomass yield
(continuous cultures). Methionine Methionine Biomass yields
yields.sup.a yields.sup.b Y.sub.x/s (g/g) Y.sub.p/s (g/g) Y.sub.p/s
(g/g) 0 0.36 0.74 0.11 0.30 0.62 0.28 0.21 0.42 0.44 0.12 0.24 0.61
0 0
[0235] However, when a 2-amino-4-(alkylmercapto)butyric acid other
than L-methionine is sought, the medium has to be supplemented with
methionine to enable the micro-organism to grow.
[0236] b. Suppressing Regulation, in Particular Negative Feedback
at Either Enzyme or Gene Level so that the Main Biosynthesis
Pathway is Potentiated.
[0237] The gene metJ, which codes for a repressor gene, can thus be
suppressed. In addition, it has been shown that homoserine
transsuccinylase, coded for by the gene metA, is down-regulated by
methionine and S-adenosylmethionine (Taylor et al., 1966, J. Biol.
Chem., 241: 3641-3642). It is therefore desirable to replace this
enzyme by one that is insensitive to this negative feedback (Chater
et al, 1970, J. Gen. Microbiol. 63: 121-131).
[0238] A further object of the invention is a screening and
identification test by which it is possible to obtain a
micro-organism producing a 2-amino-4-(alkylmercapto)butyric acid,
in particular L-methionine, by metabolising an alkyl mercaptan or
H.sub.2S, in particular methyl mercaptan.
[0239] Thus the present invention makes it possible to identify the
strains that possess mutations in their genome such that the strain
is able to assimilate a compound of formula (II), and produce the
amino acid of formula (I). These modifications thus induce an
increase in the `methionine synthase` activity of that strain. It
is thus possible to accelerate the production of the strain
producing methionine autonomously from a simple carbon source and a
compound of formula (II).
[0240] A further object of the invention is thus a method of
screening of an initial bacterial strain, which can be a
genetically modified bacterial strain, that possesses a gene coding
for a cystathionine-.gamma.-synthase enzyme or acylhomoserine
sulfhydrylase enzyme, in order to obtain a genetically modified
bacterial strain producing an amino acid of formula (I), in
particular L-methionine, and presenting a modification to the gene
of that enzyme that induces a modification to the `methionine
synthase` activity in the presence of a sulfur-containing compound
of formula (II), whereby the bacterial strain is subjected to a
selection pressure in the presence of a compound of formula (II),
so as to direct an evolution of the gene coding for the
cystathionine-.gamma.-synthase enzyme or for the acylhomoserine
sulfhydrylase enzyme in that bacterial strain, which evolution
consists of a mutation that enables it to carry out a preferential
direct conversion of the substrate of general formula (III) into an
amino acid of general formula (I) or into homocysteine, of formula
(IV).
[0241] The initial bacterial strain can present an inactivation and
(or) an over-activation, in particular by the insertion of a strong
constitutive promoter, of at least one endogenous gene.
[0242] The invention also concerns a bacterial strain presenting a
modification to the gene of the cystathionine-.gamma.-synthase
enzyme and (or) to the gene of the acylhomoserine sulfhydrylase
enzyme, inducing an increased `methionine synthase` activity of
that enzyme in the presence of a compound of formula (II), in
particular methyl mercaptan. Such a strain can also present at
least one other genetic modification (inactivation, mutation or
over-expression of an endogenous gene), as described above.
[0243] The strain according to the invention can preferably be
obtained by a method according to the invention, and in particular
is obtained by the method according to the invention.
[0244] The invention also concerns a method for the preparation of
a 2-amino-4(alkylmercapto)butyric acid of formula (I) defined
above, whereby a micro-organism with a modified `methionine
synthase` activity as defined above is grown in the presence of a
sulfur-containing compound of general formula (II) in an
appropriate medium containing a simple carbon source as defined
above. The amino acid of formula (I) is preferably methionine, more
preferably L-methionine, and the sulfur-containing compound of
general formula (II) is methyl mercaptan or H.sub.2S.
[0245] According to the invention, the terms `culture` and
`fermentation` are used interchangeably to designate the growth of
bacteria in an appropriate culture medium containing a simple
carbon source.
[0246] The culture conditions for micro-organisms according to the
invention (fermentation) can be set by those skilled in the art. In
particular, bacteria are grown at a temperature between 20.degree.
C. and 55.degree. C., preferably between 25.degree. C. and
40.degree. C., and in particular at about 30.degree. C. for C.
glutamicum and about 37.degree. C. for E. coli.
[0247] The fermentation is carried out in fermenters with a mineral
culture medium of known set composition adapted to the bacteria
used, containing at least one simple carbon source together with
the sulfur-containing compound of formula (II).
[0248] In particular, the mineral medium for E. coli can be
identical or similar in composition to an M9 medium (Anderson,
1946, Proc. Natl. Acad. Sci. USA 32:120-128), or to an M63 medium
(Miller, 1992; A Short Course in Bacterial Genetics: A Laboratory
Manual and Handbook for Escherichia coli and Related Bacteria, Cold
Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.), or to a
medium such as defined by Schaefer et al. (1999, Anal. Biochem.
270: 88-96).
[0249] In the same way, the mineral culture medium for C.
glutamicum can be identical or similar in composition to BMCG
medium (Liebl et al., 1989, Appl. Microbiol Biotechnol. 32:
205-210), or to a medium such as defined Riedel et al. (2001, J.
Mol. Microbiol. Biotechnol. 3: 573-583).
[0250] The media can be supplemented to compensate for any
auxotrophy. They contain a concentration of simple carbon that is
adapted to the culture and production mode, and a sulfur-containing
compound of formula (II) at a concentration adapted to the
evolution of the strain and the mode of production selected.
[0251] After fermentation, the amino acid of formula (I) is
recovered by the usual methods and if necessary purified.
[0252] The methods for recovery and purification of amino acids of
formula (I) in culture media are well-known to those skilled in the
art.
[0253] The present invention also concerns a method for the
preparation of a 2-amino-4(alkylmercapto)butyric acid of formula
(I) defined above, whereby a substrate of general formula (III)
R''--O--(CH.sub.2).sub.2--CHNH.sub.2--COOH (III)
[0254] where R'' represents an acyl group, preferably either a
succinyl or an acetyl group,
[0255] reacts with an enzyme with modified `methionine synthase`
activity as described above in an appropriate reaction medium
containing a sulfur-containing compound of formula (II) defined
above.
[0256] The appropriate reaction medium is a usual enzyme reaction
medium well known to those skilled in the art, in particular an
aqueous medium in which the substrates and the enzyme are dissolved
or suspended. The conditions of implementation of the reaction are
well known to those skilled in the art, in particular those
required to prevent any substantial denaturing of the enzyme.
[0257] In a particular embodiment of the invention, the enzyme with
modified `methionine synthase` activity is present in an
inactivated bacterium or in a cell extract.
[0258] In another particular embodiment of the invention, the
enzyme with modified `methionine synthase` activity is a purified
enzyme.
[0259] D.II. The Cysteine Biosynthesis Pathway
[0260] The present invention also relates to the field of
bioconversion and the production of amino acids by fermentation of
microorganisms. It relates also to a screening and directed
evolution method allowing the identification of strain of
microorganisms, possibly genetically modified, possessing an enzyme
with "modified cysteine synthase" activity, in particular a
modified O-acyl-L-homoserine sulfhydrylase. The corresponding
strain produces L-cysteine or an amino acid derivative by
metabolism of a simple carbon source. The invention also concerns
the strain of a microorganism and the process for the preparation
of L-cysteine, or an amino acid derivative, by culturing the said
strain of a microorganism.
[0261] Cysteine can be produced using various means and different
sources. Sun-Orient Chemical Co., Ltd extracts L-cystine from
hydrolyzed hair in the presence of HCl. L-cystine is then converted
into cysteine monohydrochloride using an electrolytic process.
[0262] DL-cysteine monohydrochloride can be produced by the
Strecker process (synthesis of L-cystine in the presence of
ammonium, HCN and mercaptaldehyde).
[0263] The Bucherer-Berg reaction, in which chloracetaldehyde, HCN,
ammoniumbicarbonate and sodiumsulfide are mixed, allows also the
production of L-cysteine. La L-cysteine is crystallized as
monohydrochloride in a solution of hydrochloric acid.
[0264] The enzymatic production of cysteine or the bioconversion
using tryptophane synthase to catalyze the reaction between an
alanine substituted in the .alpha.-position and a sulfide was
described in the patent applications GB2 174 390 and EP0 272 365.
Similarly the production of cysteine by fermentation of
microorganisms has been described in the patent applications EP 0
885 962 and WO01/27 307 and WO97/15 673 that describe,
respectively, the optimization of the excretion of the synthesized
cysteine by the microorganisms, the overexpression of the gene cysB
in order to optimize the production of H2S and a serine
acetyltransferase insensitive to the feed-back inhibition by
cysteine.
[0265] The invention can also be applied, for example, to the
cysteine biosynthesis pathway (FIG. 4) providing strains of evolved
microorganisms, in particular bacteria, e.g., E. Coli and
Corynebacteria, that produce 2-amino-4-(alkylmercapto) propionic
acids with the general formula (V) R--S--CH.sub.2--CHNH.sub.2--COOH
(V)
[0266] where R is defined above as the moiety of the general
formula (I)
[0267] by the metabolism of a simple carbon source and a source of
sulfur consisting of a compound of general formula (II): R'--SH
(II)
[0268] defined above
[0269] which strains present at least one gene coding for a mutated
enzyme with an `evolved cysteine synthase` activity.
[0270] According to the invention a `physiologically acceptable
salt` of the compound of general formula (I) is one that does not
effect the metabolism or ability to grow of the microorganism
strain according to the invention, in particular the salts of
alkali metals such as sodium.
[0271] In a preferred embodiment of the invention, R is a
straight-chain or branched-chain alkyl radical containing 1 to 4
atoms of carbon, selected in particular from among the methyl,
ethyl, n-propyl, i-propyl, n-butyl, i-butyl and t-butyl groups. R
is preferentially a methyl radical.
[0272] The 2-amino-4-(alkylmercapto)propionic acid of general
formula (V) obtained is preferably L-cysteine.
[0273] According to the invention an enzyme with evolved `cysteine
synthase` activity is any mutated enzyme involved in the
biosynthesis of the amino acid of general formula (V), in
particular L-cysteine, the essential activity of which is to carry
out the direct conversion of an acetylserine, preferably
O-acetyl-L-serine, into an amino acid of general formula (V) in the
presence of a sulfur compound of general formula (II), whereas the
essential activity of the initial non-mutated enzyme was not a
`cysteine synthase` activity. The enzymes naturally involved in the
biosynthesis of cysteine by the direct conversion of
O-actetyl-L-serine (acetylserine) into L-cysteine in the presence
of hydrogen sulfide (H.sub.2S), such as cysteine synthases A and B,
coded for by genes cysK or cysM, respectively, are therefore
excluded from this definition.
[0274] The `initial` non-mutated enzyme is preferentially an enzyme
that catalyzes a sulfhydrylation reaction in the presence of
H.sub.2S, preferably an enzyme with O-acyl-L-homoserine
sulfhydrylase activity.
[0275] The `initial` enzymes with O-acyl-L-homoserine sulfhydrylase
activity are advantageously selected form among the
O-acyl-L-homoserine sulfhydrylases corresponding to PFAM reference
PF01053 and COG reference COG2873.
[0276] They are preferentially chosen among the following
acylhomoserine: TABLE-US-00002 NP_785969 O-acetylhomoserine
(thiol)-lyase, Lactobacillus plantarum WCFS1 AAN68137
O-acetylhomoserine sulfhydrylase, Pseudomonas putida KT2440
NP_599886 O-acetylhomoserine sulfhydrylase, Corynebacterium
glutamicum ATCC 13032 NP_712243 acetylhomoserine sulfhydrylase,
Leptospira interrogans serovar lai str. 56601 BAC46370
O-succinylhomoserine sulfhydrylase, Bradyrhizobium japonicum
USDA110 AAO57279 O-succinylhomoserine sulfhydrylase, Pseudomonas
syringae pv. tomato str. DC3000 NP_284520 O-succinylhomoserine
sulfhydrylase [Neisseria meningitidis Z2491 AAA83435
O-succinylhomoserine sulfhydrylase (P. aeruginosa)
[0277] With higher preference the O-acyl-L-homoserine sulfhydrylase
is selected from among the O-acyl-L-homoserine sulfhydrylases coded
for by the gene metY of Corynebacterium, in particular the gene
metY of C. glutamicum (Genbank AF220150), and the homologous
enzymes presenting the same O-acyl-L-homoserine sulfhydrylase
activity, and at least 80% sequence homology with
O-acyl-L-homoserine sulfhydrylase coded for by the gene metY of C.
glutamicum (Genbank AF220150), preferably at least 85% homology,
and more preferably at least 90% homology.
[0278] The invention is in particular based on the fact that it is
possible to obtain, in a controlled manner, a modification of the
substrate specificity of the enzyme acyl-homoserine sulfhydrylase
so that it uses acetylserine preferentially. Consequently the
invention is based on the fact that it is possible to modify, in a
controlled manner, the substrate specificity of the unmodified
enzyme in order to evolve from an acylhomoserine sulfhydrylase
activity to a cysteine synthase activity.
[0279] In a preferred embodiment of the invention, the strains of
unmodified microorganisms do not naturally possess
O-acyl-L-homoserine sulfhydrylase activity or do not possess a gene
homologous to the gene metY that codes for that enzyme.
[0280] The strains modified according to the invention are
genetically modified by the inactivation, mutation and/or
overactivation of at least one endogenous gene in order to permit
the evolution of a new metabolic pathway. In particular, the
strains of microorganisms according to the invention are
genetically modified to suppress the genes cysK and/or cysM coding
for the proteins respectively bearing the cysteine synthase A, and
cysteine synthase B enzyme activities. The genes cysK and cysM are
preferentially suppressed.
[0281] The gene cysK (FIG. 4) codes for cysteine synthase A
(GenBank NP.sub.--416909) and the gene cysM codes for cystene
synthase B (GenBank NP.sub.--416916). The effect of inactivating
these genes closes the cysteine biosynthesis pathways and so makes
the strain auxotrophic for cysteine.
[0282] A gene is then introduced into the modified bacteria that
codes for an enzyme catalyzing a sulfhydrylation reaction in the
presence of H.sub.2S, as defined previously, other than those
enzymes the main activity of which is a cysteine synthase activity
(also called O-acetylserine sulfhydrylase), in particular a gene
coding for an O-acyl-L-homoserine sulfhydrylase, such as the gene
metY of Corynebacterium, and in particular the gene metY of C.
glutamicum (Genbank AF220150).
[0283] The gene coding for an enzyme catalyzing a sulfhydrylation
reaction in the presence of H.sub.2S can be introduced into the
bacterium to be modified by the usual methods available to those
skilled in the art, either by direct integration or carried by a
replicative plasmid.
[0284] The strain modified in this way is preferably selected and
improved by a method of screening and evolution, which is also an
object of this invention, and which makes it possible to cause the
acyl-homoserine sulfhydrylase activity to evolve into a cysteine
synthase activity to restore the production of cysteine.
[0285] The transformation of the acyl-homoserine sulfhydrylase
activity into an `evolved cysteine synthase` activity is deemed to
be achieved when the genetically modified and evolved bacterial
strain (E) has a growth rate at least similar to that of the
initial modified strain (M) when grown in a minimal medium in the
presence of glucose as a single carbon source. In a particular,
embodiment the transformation of the acyl-homoserine sulfhydrylase
activity into the `evolved cysteine synthase` activity is deemed to
be achieved when the cysteine synthase activity carried by the
modified O-acyl-L-homoserine sulfhydrylase protein has been
improved by 10% relative to its initial activity. In some cases
this improvement can be observed by an increased growth rate of
bacterium E relative to that of bacterium M. Lastly, this
transformation of the acyl-homoserine sulfhydrylase activity into
an `evolved cysteine synthase` activity will be deemed achieved
when strain E produces at least as much cysteine as strain M in
equivalent culture conditions, in the absence of any initial
cysteine content.
[0286] The strains according to the invention can also be
genetically modified by inactivation, mutation and/or
overactivation of at least one endogenous gene, such modification
being made before or after the evolution step of the modified
strain. In particular according to the invention the strains of
microorganisms are genetically modified in order to suppress the
enzymatic activities cysteine synthase A, cysteine synthase B and
cystathionine-.gamma.-synthase. Preferentially the genes cysK and
cysM are suppressed. The gene cysK encodes the cysteine synthase A
(GenBank NP.sub.--416909) and the gene cysM encodes cysteine
synthase B (Genbank NP.sub.--416916). The inactivation of these
genes leads to a suppression of the cysteine biosynthetic pathways
and thus renders the strain auxotrophic for cysteine. This allows
to select the strains that have modified the acyl-homoserine
sulfhydrylase activity into a cysteine synthase activity to restore
the production of cysteine.
[0287] The gene coding for cystathionine gamma-lyase activity can
be deleted, if required.
[0288] In one embodiment the bacterial strain can also undergo
modification of the serine O-acyltransferase activity carried by
the gene cysE (FIG. 4) to make it insensitive to feedback
inhibition by cysteine.
[0289] In another embodiment the bacterial strain can also be made
to overexpress the gene cysB in order to deregulate the H.sub.2S
sulfur assimilation pathway.
[0290] It can also be advantageous for the production of amino
acids of formula (V), preferably L-cysteine, to overexpress the
gene coding for acetyl-CoA synthetase, such as the gene acs (EC
6.2.1.1), accession number AE000480, at the same time as the gene
coding for an enzyme with an `improved cysteine synthase activity`
defined previously (FIG. 4).
[0291] It can also be advantageous to attenuate or even delete
genes coding for an acetate kinase and/or for a
phosphotransacetylase, in particular the genes ack and pta
accession numbers AE000318 and AE000319 respectively, and coding
respectively for an acetate kinase (EC 2.7.2.1) and a
phosphotransacetylase (EC 2.3.1.8). This attenuation/deletion is
preferably combined with an overexprssion of the gene coding for
acetyl-CoA synthetase.
[0292] All the modifications stated above can be made on the
modified strain before the process of evolution of the gene metY or
on the evolved strain, that is after the evolution of the gene
metY, but not for deletions of cysK and/or cysM, which have to be
carried out before the process of growth and evolution of the
modified strain.
[0293] The invention thus further concerns a method for the
preparation of a bacterial strain with an `evolved cysteine
synthase activity` as defined previously, which method comprises a
step consisting in growing, in an appropriate culture medium
containing a simple carbon source, a bacterial strain possessing an
enzyme catalyzing a sulfhydrylation reaction in the presence of
H.sub.2S of which the essential activity is not a `cysteine
synthase` activity as defined previously, in order to cause an
evolution of the gene coding for that enzyme in that bacterial
strain into a gene coding for an `evolved cysteine synthase`
activity.
[0294] In order to accelerate the selection and directed evolution
of a gene coding for an enzyme catalyzing a sulfhydrylation
reaction in the presence of H2S, the following steps can be carried
out:
[0295] a. Coupling of Cysteine Biosynthesis with the Growth of the
Microorganism in a Way that the Production of Cysteine is Required
for Good Growth of the Microorganism.
[0296] For this reason the genes cysK, cysM and possibly metB and
possibly the gene coding for a cystathionine gamma lyase (e.g. the
gene yrhB in B. subtilis) may be deleted, in order to suppress all
natural cysteine synthesis pathways. In this way the strain becomes
auxotroph for cysteine.
[0297] In order to live in minimal medium containing a simple
carbon source, the microorganism has to optimize the cysteine
synthase activity of the O-acyl-homoserine sulfhydrylase, so that
it can reestablish the synthetic pathway of cysteine starting with
acetylserine and H2S. When metB is deleted, it can be necessary to
supplement the medium with methionine.
[0298] b. Suppressing the Regulations, Notably the Feed-Back
Inhibition on the Enzymatic Level or Genetic Level in Order to
Potentiate the Major Biosynthetic Pathway.
[0299] The cysB gene encoding the activator protein of the
assimilatory sulfur pathway can be overexpressed (WO01/27307)
allowing the optimization of H2S production. Furthermore it has
been shown that serine acetyltransferase encoded by the cysE gene,
is feed-back inhibited by cysteine. Therefore it is desirable to
replace this enzyme by an enzyme that is not sensitive to feed-back
inhibition (WO97/15673; WO 02/061106) or alternatively
overexpressing the enzyme (WO 02/29029).
[0300] The invention further concerns a method for the preparation
of cysteine, in which a microorganism with an `evolved cysteine
synthase` activity as defined previously is grown in an appropriate
culture medium containing a simple carbon source as defined
previously.
[0301] The definition of the fermentation conditions belongs to
those skilled in the art. The fermentation is conducted in
fermenters with an inorganic growth medium of known set composition
adapted according to the bacteria used, containing at least one
simple carbon source.
[0302] The media can be supplemented to compensate for the
auxotrophies other than that caused by the deletion of the genes
cysK and/or cysM; they contain a simple source of carbon at a
concentration adapted according to the mode of growth and
production, and a sulfur compound of formula (II) at a
concentration adapted according to the evolution of the strain and
to the desired mode of production.
[0303] After fermentation, the cysteine is recovered by the usual
methods and purified if necessary.
[0304] The methods of recovery and purification of cysteine in
culture media are well known to those skilled in the art.
[0305] This invention further concerns a method for the preparation
of an amino acid of general formula (V) as defined previously,
characterized in that acetylserine is made to react with an enzyme
with an `evolved cysteine synthase` activity as defined previously,
in an appropriate reaction medium containing a sulfur compound of
general formula (II) defined previously.
[0306] The appropriate reaction medium is a usual enzyme reaction
medium, well known to those skilled in the art, in particular an
aqueous medium in which the substrates and the enzyme are dissolved
or suspended. The operating conditions for the reaction are well
known to those skilled in the art, in particular those required to
prevent substantial denaturing of the enzyme.
[0307] In a particular embodiment of the invention, the enzyme with
an `evolved cysteine synthase` activity is present in an
inactivated bacterium or in a cell extract.
[0308] D.III. The Evolution of NADPH-Dependent Pathways.
[0309] In another preferred embodiment of the invention, a
NADPH-dependent pathway can be caused to evolve. To this end the
initial bacterial strain must be modified in such a way that the
rate of production of NADPH is greater than its rate of oxidation
to NADP+ (also designated NADP), which will prevent growth of the
bacteria on the defined medium selected to implement the
method.
[0310] This invention concerns strains of microorganisms modified
to permit the evolution of metabolic pathways that consume NADPH.
The strains according to the invention can be used in
biotransformation processes that consume NADPH.
[0311] This invention further concerns a method for the preparation
of chemical entities by biotransformation involving the growth in
an appropriate medium of a strain according to the invention, which
strain also possesses the genetic features necessary for the
preparation of such chemical entities.
[0312] Biotransformation processes have been developed to permit
the production of large quantities of chemical entities at low
cost, while at the same time putting to good use various industrial
or agricultural by-products.
[0313] There are two main approaches to producing chemical entities
of interest by in vivo biotransformation: [0314] first,
fermentation, which allows the production of chemical entities from
a simple carbon source (e.g., WO0102547, which describes the
production of lysine by fermentation of C. glutamicum in the
presence of glucose), [0315] second, bioconversion by a
microorganism of a given substrate different from the simple carbon
source, which is used solely to produce the necessary biomass, for
the production of a chemical entity of interest (e.g., WO0012745,
which describes the production of R-piperidine derivatives, and
WO0068397, which describes the production of Tagatose).
[0316] The improvement of a biotransformation process can involve
various factors such as temperature, oxygenation, the composition
of the medium, the recovery process, etc. It is also possible to
modify the microorganism in such a way that the production and/or
excretion of the chemical entity of interest is increased.
[0317] For fermentation, efforts may be directed, for example, to
optimizing the biosynthesis pathway by, for example, modifying the
regulation of genes or by modifying genes to modify enzyme
characteristics or by optimizing the regeneration of
co-substrates.
[0318] For bioconversion, efforts may be directed to improving the
kinetic characteristics of enzymes, to reducing the formation of
co-products and to optimizing the regeneration of co-substrates
involved in the bioconversion step or steps.
[0319] Among the co-substrates involved in biotransformations,
NADPH is important, in particular for the production of amino acids
(e.g., arginine, proline, isoleucine, methionine or lysine),
vitamins (e.g., pantothenate, phylloquinone or tocopherol),
aromatic compounds (e.g., WO9401564), or other chemicals with high
added value.
[0320] This invention concerns strains of microorganisms modified
to cause the evolution of enzymes or metabolic pathways that
consume NADPH.
[0321] For the creation of such microorganisms, the inventors chose
modifications that increase the rate of production of NADPH and
reduce its rate of oxidation to NADP+, which modified
microorganisms are then used to cause the evolution of enzymes or
metabolic pathways that consume NADPH. These bacteria can also be
used judiciously in biotransformation processes for the production
of chemical entities derived from NADPH-dependent synthesis
pathways.
[0322] The optimization of NADPH is described below for E. coli.
The same principle can be applied in a similar way to all
microorganisms grown in aerobic conditions.
[0323] The strains modified according to the invention have
undergone the deletion of the gene udhA and/or the gene qor. In a
preferred embodiment of the invention, the genes udhA and qor are
both deleted.
[0324] In a particular embodiment of the invention the strain
modified according to the invention has also undergone the deletion
of a gene selected from among pgi or pfkA and or pfkB.
[0325] The above genes are well known to those skilled in the art
and are described in the scientific literature, in particular for
E. coli:
[0326] Genes and References in E. coli:
udhA: X66026 soluble pyridine transhydrogenase;
qor: L02312 quinone oxidoreductase;
pgi: X15196 phosphoglucose isomerase (EC 5.3.1.9);
pfkA: X02519 phosphofructokinase-1;
pfkB: K02500 phosphofructokinase-2.
[0327] A further object of this invention is an evolved
microorganism modified for the production of NADPH as described
above and below, which also possesses one or more genes coding for
NADPH-dependent enzymes involved in the biotransformation of a
chemical entity of interest, which enzymes it is intended to cause
to evolve, together with one or more selection marker genes.
[0328] These genes can be native to the modified strain according
to the invention or be introduced into the optimized strain
according to the invention by transformation with an appropriate
vector, either by integration in the genome of the microorganism,
or by a replicative vector, which vector possesses one or more
genes coding for the enzymes involved in the bioconversion of the
said chemical entity of interest or the said selection markers.
[0329] These genes contain a nucleic acid sequence coding for an
enzyme involved in the biotransformation of the chemical entity of
interest and/or for a selection marker, the coding sequence being
attached to efficient promoter sequences in the prokaryotic and/or
eukaryotic cell selected for the biotransformation. The vector (or
plasmid) can be a shuttle vector between E. coli and another
microorganism.
[0330] This invention further concerns a method for the preparation
of modified strains according to the invention as defined above and
below, in which the genes udhA and/or qor, and if necessary the
genes pgi or pfkA and/or pfkB are deleted.
[0331] In a particular embodiment of the invention the method of
preparation of the strains also includes the transformation of the
modified strains with at least one appropriate vector with one or
more genes coding for one or more NADPH-consuming enzymes involved
in the biotransformation of a chemical entity of interest, and one
or more selection marker genes. The vector allows either the
replication of the genes or their integration in the chromosome of
the modified bacterium. The transformation of the strain by the
vector defined above can be carried out on the modified strain or
before the modification of the strain according to the
invention.
[0332] The strain modified for the production of NADPH is obtained
by molecular biology methods.
[0333] A further aspect of the invention concerns the use of these
modified strains according to the invention to cause the evolution
of NADPH-dependent enzymes to improve their kinetic
characteristics, to broaden or to narrow their substrate
specificity, and ultimately to create a new metabolic pathway
and/or to improve biotransformation yields. A further aspect of the
invention concerns the use of the modified strain or the evolved
strain to carry out biotransformation reactions that consume NADPH
with biotransformation yields greater than those obtained with an
unmodified and/or non-evolved strain.
[0334] The invention further concerns a method for the production
of a chemical entity of interest synthesized by a NADPH-consuming
process, characterized in that it comprises the following steps:
[0335] a) Culture of evolved microorganisms according to the
invention in an appropriate culture medium that favors their growth
and that contains the substances necessary to carry out the
biotransformation by fermentation or bioconversion, except for
NADPH. [0336] b) Extraction of the chemical entity of interest from
the medium and, if necessary, its purification.
[0337] The chemical entity of interest is preferably selected from
among cysteine, methionine, 3-hydroxypropionate, hydrocortisone,
xylitol and glycerol.
[0338] For a bioconversion reaction the method also includes the
addition to the appropriate culture medium of the substrate to be
converted.
[0339] The culture medium of step b) of the method according to the
invention defined above contains at least one assimilatable
carbohydrate chosen from among the different assimilatable sugars
such as glucose, galactose, sucrose, lactose, or molasses, or
by-products of these sugars. An especially preferred simple carbon
source is glucose. Another preferred simple carbon source is
sucrose. The culture medium can also contain one or more substances
(e.g., amino acids, vitamins, mineral salts, etc.) that favor the
production of the chemical entity of interest.
[0340] The examples given below illustrate the invention but do not
restrict its scope.
E. DESCRIPTION OF FIGURES
[0341] FIG. 1: Synthesis of methionine from homoserine in
bacteria.
[0342] FIG. 2: Scheme for the synthesis of methionine according to
the invention applied in E. coli; an equivalent strategy is
transposable to many microorganisms including C. glutamicum. The
metB* or metY** strategies require the use of a strain that is
initially at least .DELTA.(metE), while the metB** or metY*
strategies require the use of a strain that is initially at least
.DELTA.(metC).
[0343] Legend
[0344] MetA: homoserine succinyltransferase; can be replaced by an
isoform that is insensitive to feedback inhibition by methionine,
or possibly by a homoserine acetyltransferase isoform that is
insensitive to feedback inhibition by methionine.
[0345] MetB: cystathionine .gamma.-synthase
[0346] MetB*: cystathionine .gamma.-synthase evolved into
`methionine synthase`
[0347] MetB**: cystathionine .gamma.-synthase evolved into
homocysteine synthase
[0348] MetY*: O-acetyl-homoserine (de C. glutamicum) evolved into
homocysteine synthase
[0349] MetY**: O-acetyl-homoserine (de C. glutamicum) evolved into
`methionine synthase`
[0350] The central pathway represents the natural synthetic pathway
of methionine in E. coli. The other pathways indicated correspond
to the methods according to the invention.
[0351] FIG. 3 representation of a continuous fermentation mechanism
for the directed selection of strains according to the invention.
We use for example the technology "Fedbatch-Pro" by the company
DASGIP. A modular system is controlled by a computer allowing the
parallel fermentation of microorganisms with a control of feeding
of medium, pH and pO2.
[0352] FIG. 4: Synthesis of cysteine from serine in bacteria.
[0353] FIG. 5: Strategy to achieve the synthesis of cysteine from
O-acetyl-L-serine. The red arrow corresponds to the cysteine
synthase activity of the enzyme coded for by the evolved gene metY
according to the invention (metY*).
[0354] FIG. 6: Comparison of .sup.13C-NMR spectra, corresponding to
the 5-carbon of methionine, obtained by HSQC on a hydrolysate of
the wild strain (top) or the optimized K1 a-F strain (bottom). It
can be observed that the 5-carbon of the strain K1 a-F is not
labeled by carbon 13, confirming that it originates from sodium
methylmercaptide.
[0355] FIG. 7: Alignment of non-modified sequences of
cystathionine-.gamma.-synthases obtained with the algorithm
MULTIALIN
(http://prodes.toulouse.inra.fr/multalin/multalin.html).
[0356] FIG. 8: Alignment of non-modified sequences of
acylhomoserine sulfhydrylases obtained with the algorithm
MULTIALIN.
[0357] FIG. 9: Growth rate evolution of the initial E. coli strain
.DELTA.(metE) during the process of directed selection in batch
culture. Abscissa: number of subcultures; arrow: population K144;
deduced .mu.: values obtained starting at OD values of 2-3;
calculated .mu.: values obtained with more than 4 values of DO.
[0358] FIG. 10: Growth kinetics of the population of E. coli
.DELTA.(metC) after initial seeding (Culture 1) and after tenth
reseeding (Reseeding 10).
[0359] FIG. 11: Execution of PCR on the modified strain of E. Coli
.DELTA.metJ::Cm using starters DmetJBF and MetJR. The 5' end of the
starter DmetJBF is also able to hybridise a sequence located in the
3' part of the gene metL.
[0360] FIG. 12: Strains obtained after homologous recombination
with the PCR-amplified fragment (see FIG. 11); it is possible to
have two different homologous recombination events, each occurring
with the same probability. In the first case, a strain E. coli
.DELTA.metJ::Cm is recreated, while in the second case the strain
E. Coli [.DELTA.metJ, .DELTA.metJ::Cm] is created by replacement of
the promoter of the operon metBLF before metL.
[0361] FIG. 13: Time course of the growth rate evolution of the
strain E. coli [.DELTA.(metBJ, metC) pTrc-metY] on a defined medium
(MML8) containing glucose as sole carbon source.
F. EXAMPLES
[0362] F.I. The Methionine Biosynthesis Pathway
A first application (Example F.I.1.) of the invention to the
metabolic engineering of the biosynthesis pathway of methionine
comprises the following steps:
[0363] a) Deletion of the gene metE in the initial strain of E.
coli; the modified strain obtained is therefore auxotrophic for
methionine. The initial strain is able to grow on a minimal medium
(MM) containing no methionine, S-adenosylmethionine, homocysteine
or cystathionine, whereas the modified strain has lost that
ability. [0364] b) Culture of the above modified strain on the same
minimal medium (MM) to which sodium methylmercaptide (co-substrate)
has been added to cause the evolution of an endogenous enzyme
activity into a methionine-synthase activity to compensate for the
initially deleted enzyme activity (MetE). [0365] c) Selection of an
evolved strain with a new methionine-synthase activity in the
presence of sodium methylmercaptide, the strain being
characterized. [0366] d) Isolation of the evolved gene coding for
the protein possessing an evolved enzyme activity, in this case
cystathionine-.gamma.-synthase with an improved methionine-synthase
activity.
[0367] A second application (Example F.I.2.) of the invention to
the metabolic engineering of the biosynthesis pathway of methionine
comprises the following steps: [0368] a) Deletion of the gene metC
in the initial strain of E. coli; the modified strain obtained is
thus auxotrophic for methionine. The initial strain is able to grow
on a minimal medium (MM) containing no methionine,
S-adenosylmethionine, homocysteine or cystathionine, whereas the
modified strain has lost that ability. [0369] b) Culture of the
above modified strain on the same minimal medium (MM) in the
absence of any co-substrate in order to cause the evolution of an
endogenous enzyme activity into a homocysteine-synthase activity to
compensate for the initially deleted enzyme activity (MetC).
[0370] A third application (Example F.I.3.) of the invention to the
evolution of the biosynthesis pathway of methionine comprises the
following steps: [0371] a) Deletion of the genes metC, metB, and
metJ in the initial strain of E. coli; the modified strain obtained
is thus auxotrophic for methionine. The initial strain is able to
grow on a minimal medium (MM) containing no methionine,
S-adenosylmethionine, homocysteine or cystathionine, whereas the
modified strain has lost that ability. [0372] a1) Introduction of
the gene metY, a heterologous gene from C. glutamicum. This gene is
to evolve from an acetylhomoserine sulfhydrylase activity into a
methionine-synthase activity. [0373] b) Culture of the modified
strain E. coli [mety .DELTA.(metB, metC, metJ)] on the same minimal
medium (MM) to which is added sodium methylmercaptide
(co-substrate) to cause the evolution of an endogenous enzyme
activity into a methionine-synthase activity to compensate for the
initially deleted enzyme activities (MetB, MetC). [0374] c)
Selection of an evolved strain possessing a new methionine-synthase
activity in the presence of sodium methylmercaptide.
Example F.I.1
Preparation of an Evolved Strain Possessing a Methionine-Synthase
Activity in the Presence of Sodium Methylmercaptide
[0375] a) Construction of the Modified Strain E. coli
.DELTA.(metE)
[0376] The inactivation of the gene metE is achieved by inserting a
chloramphenicol resistance gene cassette and at the same time
deleting most of the gene concerned. The method used is described
by Datsenko, K. A., Wanner, B. L. (2000) One-step inactivation of
chromosomal genes in Escherichia coli K-12 using PCR products.
Proc. Natl. Acad. Sci. USA 97: 6640-6645.
[0377] Two oligonucleotides were used to implement this
strategy:
[0378] DmetER with 100 bases (SEQ ID NO 1): TABLE-US-00003
tacccccgacgcaagttctgcgccgcctgcaccatgttcgccagtgccgc
gcgggtttctggccagccgcgcgttttcagCATATGAATATCCTCCTTAG
[0379] with: [0380] a region (lower case) homologous to the
sequence (4012903 to 4012824) of the gene metE (sequence 4010643 to
4012904, the reference sequence on the website
http://genolist.pasteur.fr/Colibri/); [0381] a region (upper case)
for the amplification of the chloramphenicol resistance cassette of
the plasmid pKD3 (Datsenko, K. A., Wanner, B. L. (2000) One-step
inactivation of chromosomal genes in Escherichia coli K-12 using
PCR products. Proc. Natl. Acad. Sci. USA 97: 6640-6645).
[0382] DmetEF de 100 bases (SEQ ID NO 2): TABLE-US-00004
tgacaatattgaatcacaccctcggtttccctcgcgttggcctgcgtcgc
gagctgaaaaaagcgcaagaaagttattggTGTAGGCTGGAGCTGCTTCG
[0383] with: [0384] a region (lower case) homologous to the
sequence (4010644 to 4010723) of the gene metE; [0385] a region
(upper case) for the amplification of the chloramphenicol
resistance cassette carried by the plasmid pKD3.
[0386] The oligonucleotides DmetER and DmetEF are used to amplify
the chloramphenicol resistance cassette from the plasmid pKD3. The
PCR product obtained is then introduced by electroporation into the
strain MG1655 (pKD46) in which the enzyme Red recombinase expressed
permits the homologous recombination. The chloramphenicol-resistant
transformants are then selected and the insertion of the resistance
cassette is verified by PCR analysis with the oligonucleotides
metER and metEF.
[0387] MetER (SEQ ID NO 3): ggtttaagcagtatggtgggaagaagtcgc
(homologous to the sequence from 4012978 to 4012949).
[0388] MetEF (SEQ ID NO 4): cccggggatgaataaacttgccgccttccc
(homologous to the sequence from 4010567 to 4010596).
[0389] The chloramphenicol resistance cassette can then be
eliminated. The plasmid pCP20 carrying the FLP recombinase acting
at the FRT sites of the chloramphenicol resistance cassette, is
then introduced into the recombinant strains by electroporation.
After a series of cultures at 42.degree. C., the loss of the
chloramphenicol resistance cassette is verified by a PCR analysis
with the same oligonucleotides as used previously.
[0390] b) Culture and Evolution of the .DELTA.(metE) Modified
Strain in the Presence of Sodium Methylmercaptide as
Co-Substrate
[0391] To optimize E. coli for the production of methionine from
methylmercaptan, a controlled selection is carried out in
flasks.
[0392] The E. coli strain made auxotrophic for methionine by
inactivating the metE gene (see above) cannot grow unless it can
make its own methionine from methylmercaptan.
[0393] The implementation of this method permits the selection of a
strain of Escherichia coli of which the
cystathionine-.gamma.-synthase (EC 4.2.99.9) has acquired a
modified `methionine-synthase` activity in the presence of
methylmercaptan.
[0394] The controlled selection is conducted in a hermetically
sealed glass flask containing 50 ml of inorganic medium (Schaefer
et al., 1999, Anal. Biochem. 270: 88-96) in the presence of 33 mM
glucose and chloramphenicol at a final concentration of 25
mg/l.
[0395] The culture media are seeded with the strain E. coli K12
.DELTA.metE at a defined value of OD.sub.600nm. Seeding is carried
out with a sufficiently large population of bacteria so that some
bacteria potentially possess relevant spontaneous mutations in the
gene metB enabling assimilation of methylmercaptan. This population
is obtained by culture of the strain auxotrophic for methionine on
a minimal medium supplemented with methionine.
[0396] Three flasks then receive 100 .mu.l of a 400 mg/l solution
of sodium mercaptide, while a fourth flask has no added sodium
mercaptide. The cultures are grown with shaking at 37.degree. C.,
for 6 days, after which time the OD.sub.600nm is measured. The
results are summarized in Table 2 below. TABLE-US-00005 TABLE 2
Measurement of the optical density (OD) of culture media for E.
coli in the presence (flasks 1-3) or absence (control flask) of
sodium mercaptide. Flask 1 Flask 2 Flask 3 Control flask OD.sub.600
nm at T = 0 0.34 0.34 0.34 0.34 OD.sub.600 nm at T = 6 days 0.23
1.14 0.79 0.32
[0397] These results show that in flasks 2 and 3 a strain grows
that is able to use methylmercaptan to produce the methionine
necessary for its growth (increase in optical density).
[0398] The observed improved "methionine synthase" activity results
from a modification of the gene encoding
cystathionine-.gamma.-synthase of E. coli K12 .DELTA.metE,
contained in flask 2 and 3.
[0399] The bacterial population of flask 2 can then be used to
improve even more the "methionine synthase" activity in the
presence of methylmercaptan, using a screening process and
improvement by multi-stage fermentation or by starting over the
process in flasks as described above.
[0400] c) Screening and Improvement by Multi-Stage Fermentation
[0401] To optimize E. coli for the production of methionine based
on methylmercaptan, a selection is performed.
[0402] The implementation of this technique allows the selection of
an Escherichia coli strain in which the
cystathionine-.gamma.-synthase (EC 4.2.99.9) has developed an
improved "methionine-synthase" activity in the presence of
methyl-mercaptan. Alternatively a strain obtained in example 2 can
be used.
[0403] The directed selection is carried out in a continuous
multi-stage system (FIG. 3).
[0404] The first fermenter produces bacteria with a speed close to
maximal growth rate. The bacteria are transferred continually from
this fermenter to a second fermenter characterized by a lower
dilution rate with a selective screen (here methylmercaptan).
[0405] The selection pressure, imposed on the bacteria in the
second fermenter, depends on the methylmercaptan concentration.
Successive cycles of selection allow applying stronger and stronger
screening conditions to the bacteria by increasing methylmercaptan
concentrations.
[0406] For each concentration the selected strain in the second
fermenter has evolved so that it metabolizes the total amount of
methylmercaptan (no residual methylmercaptan in the fermenter).
[0407] In this case one starts the selection over using fermenter 2
as growth fermenter and fermenter 1 for selection, presenting
methylmercaptan in stronger concentration as in the previous
step.
[0408] Different cycles of selection are performed in order to
obtain a strain that rapidly ferments methylmercaptan. The analysis
of this strain allows to define the mutations in the gene
cystathionine-.gamma.-synthase.
[0409] d) Selection of the Evolved Strain in the Presence of Sodium
Methylmercaptide
[0410] The population of E. coli .DELTA.(metE) from flask 2, after
undergoing successive reseedings in flasks, yields the population
K1a-F.
[0411] The new population obtained K1 a-F is cultured in a minimal
medium (Schaefer et al., 1999, Anal. Biochem. 270: 88-96)
containing 2.5 g.sup.-1 of uniformly carbon 13-labeled glucose, and
sodium methylmercaptide (200 ppm) with no carbon 13 enrichment.
This population is auxotrophic for methionine in the absence of
sodium methylmercaptide.
[0412] After culture, the cells are recovered, washed and
hydrolysed with 6N HCl for 24 hours at 107.degree. C. An analysis
by 2D NMR is then carried out (HSQC). This analysis shows whether
the 5-carbon of methionine comes from L-cysteine produced from the
glucose present in the solution (classical pathway), or from the
sodium methylmercaptide when the new metabolic pathway according to
the invention is used.
[0413] The experiment is conducted in a similar manner with the
wild strain E. coli K12 (producing methionine from glucose), in the
absence of sodium methylmercaptide.
[0414] FIG. 6 shows two 1D spectra, derived from two separate
acquisitions, superimposed for greater clarity. These 1D spectra
were extracted from 2D NMR spectra of the HSQC type (correlation
between protons and carbon 13). The 2D NMR spectra are obtained on
an acid hydrolysate of the bacteria.
[0415] The sample analyzed is a total hydrolysate. However, given
the sensitivity of the NMR and the acquisition times used,
essentially amino acids, sugars, bases and glycerol are detected,
each carbon atom (coupled to a proton) of each acid giving an NMR
signal.
[0416] The 5-carbon of methionine (i.e., the terminal methyl group)
presents a chemical shift of about 14.7 ppm. FIG. 6 shows the area
of the chemical shift centered at 14.7 ppm for the two strains.
[0417] It can be seen that the signal of the 5-carbon is strong in
the upper spectrum, indicating that the 5-carbon is labeled with
carbon 13. Hence this 5-carbon comes from the labeled glucose
introduced as a substrate in the culture medium.
[0418] In contrast, the same signal is very weak in the lower
spectrum (strain K1a-F). This indicates that the 5-carbon is
practically unlabeled. Yet the other carbons in the molecule are
strongly labeled (results not presented). The unlabeled 5-carbon
therefore comes not from glucose, but from methylmercaptan.
[0419] In can therefore be concluded that the strain K1a-F produces
methionine from succinyl-L-homoserine and sodium
methylmercaptide.
[0420] The population K1a-F undergoes 14 further successive
reseeding cycles in flasks. In this way the population K144 is
obtained (FIG. 9), which is then spread on minimal medium plates
containing glucose as sole carbon source. The inoculated dishes are
placed in aerobic conditions in an aerobic jar into which is
inserted a tube containing sodium methylmercaptide dissolved in
water. The jar is then placed in an incubator at 37.degree. C. As
the boiling point of methylmercaptan is 5.degree. C., the
atmosphere in the jar becomes enriched in methylmercaptan. After 4
days, clones appear in the dishes; these are bacteria able to
produce methionine in the presence of methylmercaptan. Ten clones
are isolated, including the clone K176. The clone K176 is grown in
liquid culture and glycerol stocks are prepared, numbered K183.
[0421] For the clone K183 and the initial strain E. coli K12
.DELTA.(metE), the sequence of the genes metJ and metB (SEQ ID
No.5) is determined. The sequence obtained for evolved metB,
designated metB* (SEQ ID No.7) reveals the presence of an alanine
unit at position 325 (SEQ ID No.8) in place of a glutamate (SEQ ID
No.6). The gene metJ shows no mutation. This strain is registered
at the CNCM on Apr. 2, 2003, under the number I-3005.
[0422] Characterization of the Clone K183
[0423] The clone K183 is grown in flasks in a minimal medium with
glucose and sodium methylmercaptide as sole carbon source. In
parallel, a culture is carried out under identical conditions with
wild strain E. coli K12. The consumption of glucose per unit of
biomass is found to be twice that of a wild strain of E. coli
(MBM01). This over-consumption is probably partly due to acetate
production. TABLE-US-00006 TABLE 3 Comparison of biomass yield of
wild strain E. coli and evolved clone K183: Biomass yield expressed
as mass of biomass/mass of glucose Acetate yield expressed as mass
of acetate/mass of glucose Strain Biomass yield Acetate yield MBM01
0.45 <0.002 K183 0.24 0.36
[0424] The analysis of intracellular and extracellular metabolites
of these two cultures shows, in particular:
[0425] Intracellularly, an increase in alanine, pyruvate,
ketobutyrate and 2-ketoisocaproate, and a decrease in the
concentration of tryptophan, norvaline, norleucine, leucine and
methionine.
[0426] Extracellularly, an accumulation of glutamate, isoleucine,
threonine, valine and 2-ketoisocaproate, and a decrease in
pyruvate, norleucine, and tryptophan.
[0427] Characterization of the Specific `Methionine Synthase`
Activity of the strains MBM01 and K183 in the Presence of
Methylmercaptan.
[0428] To show the improvement of the methionine-synthase activity
in the strain K183 relative to the wild strain (MBM01), enzyme
reactions are carried out using cell-free extracts prepared from
cultures of the strains K183 and MBM01 carried out on rich medium
(BH1, marketed by DIFCO, with 2.5 g/L of glucose) in the absence of
methylmercaptan. The protein extracts are desalted on PD 10 and
stored on ice.
[0429] Reaction Conditions and Sample Treatment [0430] A solution
of sodium methanethiolate diluted 10-fold (100 .mu.of 3M solution
plus 900 .mu.l of MilliQ water) is prepared on ice. [0431] Reaction
mixtures of 20 .mu.L of 500 mM pH 6.5 phosphate buffer, 10 .mu.L of
2.5 mM pyridoxal phosphate, 16 .mu.L of 25 mM O-succinylhomoserine,
10 .mu.L of 0.3 M sodium methanethiolate, and 24 .mu.L of MilliQ
water are prepared on ice. [0432] The tubes are placed at
37.degree. C. (thermomixer under a hood) and the protein extract
(20 .mu.l) added to start the reaction. [0433] To quench the
reaction (0 to 30 minutes), the tubes are placed on ice and 400
.mu.l of acetone added at -20.degree. C. [0434] The tubes are left
at -20.degree. C. for 30 minutes. [0435] The tubes are opened under
the hood for 10 minutes to evaporate off methanethiol and acetone
(kept on ice). [0436] The mixture is centrifuged for 5 minutes at
10,000 g, the supernatant (.about.100 .mu.l) decanted off into
Eppendorf tubes and diluted to a final volume of 1 ml.
[0437] Measurement of the Methionine Synthase Activity by Detection
of the Quantity of Succinate Released from Succinylhomoserine
[0438] A 10 .mu.l aliquot of the above sample is analyzed by ion
chromatography using a Dionex DX-500 apparatus fitted with a 2 mm
AG-11 precolumn and a 2 mm AS-11 column, an ASRS Ultra suppressor,
and a 10 .mu.l injection loop. A gradient is then applied: 0-7 min
0.5 mM KOH; 7 min injection; 7-9.5 min 0.5 mM KOH; 9.5-13 min 0.5-5
mM KOH; 13-25 min 5-38.3 mM KOH.
[0439] Measurement of the Methionine Synthase Activity by Detection
of the Quantity of Methionine Synthesized in the Presence of
Methylmercaptan
[0440] The analysis is carried out by GC-MS, which requires the
silylation of samples before injection. For this purpose each
sample receives an internal standard (serine 13C) to allow the
quality of the silylation to be validated. The samples are then
lyophilized overnight.
[0441] The derivatization is carried out using the following
protocol:
[0442] Using a 1 ml automatic pipette 400 .mu.l of hydroxylamine
solution (0.250 g+/0.002 g dissolved in 10 ml of pyridine) is
added, making sure the tubes were tightly closed. The mixture is
vortexed twice for 10 seconds, centrifuged to concentrate it at the
bottom of the tube (max. 1 minute at 5000 g) and left to react for
11/2 hours at 30.degree. C. The tubes are opened and 1000 .mu.l of
BSTFA solution is added using a 1 ml automatic pipette, topping up
with 100 .mu.l of pyridine (200 .mu.l automatic pipette). The tubes
are closed, vortexed for 10 seconds and left to incubate
respectively for 60 minutes at 60.degree. C. for TBDMS derivatives
and 30 minutes at 70.degree. C. for BSTFA. If necessary the samples
are filtered on a disposable filter with a 0.22 .mu.m PTFE membrane
or centrifuged at 5000 g for 5 minutes. They are transferred to 1.5
ml flasks, sealed and injected into the GC.
[0443] The analyses are carried out with an Agilent Technologies
GC6890/MSD5973 apparatus fitted with a non-polar column (HP-5MS,
Bios Analytique). The carrier gas is helium with a constant flow
rate of 1 mlmin.sup.-1. The injection of 1 .mu.l of sample is in
splitless mode with a purge flow rate of 50 mlmin.sup.-1 for 0.85
min. The temperature profile is: initial temperature 90.degree. C.
maintained for 2 minutes and then increased to 320.degree. C. with
a gradient of 10.degree. C.min.sup.-1. This temperature is
maintained for 6 minutes. Detection is by mass spectrometry with
ionization by electron impact in scanning mode in the range m/z=40
to 550 amu. The solvent passage time is set at 3.10 minutes.
[0444] Under these conditions, a `methionine synthase` activity can
be assayed in the samples incubated with methanethiol, by the
quantification first of succinate by ion chromatography and second
of methionine by GC-MS.
[0445] The results are given in Table 4 below. TABLE-US-00007 TABLE
4 Methionine synthase activity in the presence of methylmercaptan
of extracts from strains MBM01 and K183 Specific activity (mUI/mg
protein) Protein Succinate Methionine Strain concentration assay
assay MBM01 3.43 0.30 0.23 K183 3.62 1.40 1.72
[0446] It is thus evident that the methionine synthase activity in
the presence of methylmercaptan is strengthened in the evolved
strain relative to the wild strain, confirming that the mutated
cystathionine .gamma.-synthase (E325A) has a modified methionine
synthase activity.
[0447] e) Isolation of the Evolved Gene and Kinetic
Characterization of the Enzyme METB* Possessing an Evolved
Methionine-Synthase Activity
[0448] To determine the kinetic parameters of the
methionine-synthase and cystathionine-.gamma.-synthase activities
exerted by METB and METB*, the genes metB and metB* are cloned in
an overexpression vector pTopo (Invitrogene) using the following
strategy: [0449] Amplification of the gene metB or metB* with the
oligonucleotides metJ/metLR and heat-resistant polymerase Pwo.
[0450] Ligation of the PCR product to the plasmid pTOPO 4-PCR
blunt, and introduction of the plasmid thus formed, pTopo.metB or
pTopo.metB* into DH5.alpha. and selection of Ap.sup.r clones.
[0451] Verification by enzymatic digestion of the configuration of
the plasmid pTopo.metB ou pTopo.metB* after extraction. [0452]
Introduction of the verified plasmid pTopo.metB into the strain
MG1655(.DELTA.metBJ, .DELTA.metE). Verification by enzymatic
digestion, as previously described, of the introduced plasmid.
Verification by PCR of the strain MG1655(.DELTA.metBJ, .DELTA.metE)
with the oligonucleotides metJR/metLR for the deletion metJ, and
metER/metEF for the deletion metE: strain MINS33. [0453] Cultures
are then carried out on rich medium and protein extracts are
prepared. The methionine-synthase and
cystathionine-.gamma.-synthase enzyme activities are then
determined using sodium methylmercaptide and cysteine as reaction
co-substrates, respectively.
[0454] The kinetic characteristics of the methionine synthase
activity are given in Table 5. The kinetic characteristics of the
cystathionine-.gamma.-synthase activity are given in Table 6.
TABLE-US-00008 TABLE 5 Apparent kinetic characteristics of the
methionine-synthase activity of enzymes METB and METB*. K.sub.m
V.sub.max pTOPOmetB 277 mM 13.9 mUI/mg protein PTOPOmetB* 6 mM 5.6
mUI/mg protein
[0455] The effect of the mutation A325E is to reduce the K.sub.m of
the enzyme 45-fold for methylmercaptan, whereas V.sub.max is only
halved. TABLE-US-00009 TABLE 6 Apparent kinetic characteristics of
the cystathionine-.gamma.-synthase activity of enzymes METB and
METB*. K.sub.m V.sub.max pTOPOmetB 7.5 mM 39840 mUI/mg protein
PTOPOmetB* 0.6 mM 2889 mUI/mg protein
[0456] The effect of the mutation A325E reduces the
cystathionine-.gamma.-synthase activity 13-fold and the K.sub.m of
the enzyme for cysteine.
Example F.I.2
Evolution of a Homocysteine Synthase Activity from a
Cystathionine-.gamma.-Synthase
[0457] Construction of Strains MG1655 (.DELTA.metC::Cm) and MG1655
(.DELTA.metC)
[0458] To inactivate the gene metC the homologous recombination
strategy described by Datsenko & Wanner (2000) is used. This
strategy permits the insertion of a chloramphenicol resistance
cassette, while deleting most of the gene concerned. For this
purpose 2 oligonucleotides were used:
[0459] For metC:
[0460] DmetCR with 100 bases (SEQ ID NO 13): TABLE-US-00010
ccggcgtccagatcggcaatcagatcgtcgacatcttccagaccaatatg
caggcgaatcaaggtcccgctaaaatcgatCATATGAATATCCTCCTTAG
[0461] with [0462] a region (lower case) homologous to the sequence
(3151419 to 3151359) of the gene metc (sequence 3150251 to 3151438,
reference sequence on the website
http://genolist.pasteur.fr/Colibri/), [0463] a region (upper case)
for the amplification of the chloramphenicol resistance cassette
(reference sequence in Datsenko, K. A. & Wanner, B. L., 2000,
PNAS, 97: 6640-6645),
[0464] DmetCF with 100 bases (SEQ ID NO 14): TABLE-US-00011
cggacaaaaagcttgatactcaactggtgaatgcaggacgcagcaaaaaa
tacactctcggcgcggtaaatagcgtgattTGTAGGCTGGAGCTGCTTCG
[0465] with [0466] a region (lower case) homologous to the sequence
(3150255 to 3150334) of the gene metc [0467] a region (upper case)
for the amplification of the chloramphenicol resistance
cassette.
[0468] The oligonucleotides DmetCR and DmetCF are used to amplify
the chloramphenicol resistance cassette from the plasmid pKD3. The
PCR product obtained is then introduced by electroporation into the
strain MG1655 (pKD46) in which the Red recombinase enzyme expressed
permits the homologous recombination. The chloramphenicol resistant
transformants are then selected and the insertion of the resistance
cassette is verified by a PCR analysis with the oligonucleotides
metCR and metCF defined previously. The strain retained is
designated MG1655 (.DELTA.metC::Cm).
[0469] MetCR (SEQ ID NO 11): cgtccgggacgccttgatcccggacgcaac
(homologous to the sequence from 3151522 to 3151493).
[0470] MetCF (SEQ ID NO 12): gcgtttacgcagtaaaaaagtcaccagcacgc
(homologous to the sequence from 3150118 to 3150149).
[0471] The chloramphenicol resistance cassette can then be
eliminated. The plasmid pCP20 carrying recombinase FLP acting at
the FRT sites of the chloramphenicol resistance cassette is then
introduced into the recombinant strains by electroporation. After a
series of cultures at 42.degree. C., the loss of the
chloramphenicol resistance cassette is verified by a PCR analysis
with the same oligonucleotides as those used previously. The strain
retained is designated MG1655 (.DELTA.metC).
[0472] The construction of the strain .DELTA.(metC) is described in
Example F.I.2. In a particular embodiment of the invention the
strain E. coli .DELTA.(metC) is cultured in flasks (see Example
F.I.1) containing a minimal medium with glucose as sole carbon
source. The medium contained neither methylmercaptan nor H.sub.2S.
Reseeding is carried out and growth rates are determined for each
reseeding. A very marked improvement in the growth rate of the
strain .DELTA.(metC) is observed on the minimal medium, suggesting
that the homocysteine synthase activity of the cystathionine
.gamma.-synthase is strongly improved in the presence of endogenous
H.sub.2S (see FIG. 10). TABLE-US-00012 Reseeding cycle number
measured .mu. (h.sup.-1) 1 0.05 3 0.37 5 0.39 10 0.44 12 0.44
Example F.I.3
Evolution of a Methionine Synthase Activity from an
Acetylhomoserine Sulfhydrylase Activity
[0473] Construction of the strain MG1655
(.DELTA.metB-.DELTA.metJ)
[0474] To delete the genes metB and metJ, and conserve the promoter
of the operon metBL, a chloramphenicol resistance cassette is
inserted, while at the same time deleting most of the genes
concerned and maintaining the promoter of metBL. For this purpose
we use 2 oligonucleotides.
[0475] For metBJ:
[0476] MetJR with 30 bases (SEQ ID NO 9):
[0477] ggtacagaaaccagcaggctgaggatcagc
[0478] homologous to the sequence (4125431 to 4125460) downstream
of the gene metJ (sequence 4125975 to 4125581, reference sequence
on the website http://genolist.pasteur.fr/Colibri/).
[0479] DmetJBF with 100 bases (SEQ ID NO 10): TABLE-US-00013
tatgcagctgacgacctttcgcccctgcctgcgcaatcacactcattttt
accccttgtttgcagcccggaagccattttcaggcaccagagtaaacatt
[0480] with [0481] a part (upper case) homologous to the sequence
(4126217 to 4126197) between the genes metJ and metB (sequence
4126252 to 4127412) containing the promoter region of the operon
metBLF, [0482] a part (lower case) homologous to the sequence
(4127460 to 4127380) corresponding to the beginning of the gene
metL (sequence 4127415 to 4129847) and the end of the gene
metB.
[0483] These two oligonucleotides were used to amplify the region
concerned on the chromosomal DNA of MG1655 .DELTA.(metJ::Cm); see
FIG. 11.
[0484] The PCR product obtained is then introduced by
electroporation into the strain MG1655 (pKD46) in which the Red
recombinase enzyme expressed permits the homologous recombination.
The chloramphenicol resistant transformants are then selected and
the deletion of the gene metB by homologous recombination is
verified by PCR analysis with the oligonucleotides MetJR and MetLR,
defined previously.
[0485] The desired strain is strain MG1655
(.DELTA.metB-.DELTA.metJ::Cm) in which the genes metJ and metB are
eliminated and the promoter of the operon metBLF repositioned
before metL (see FIG. 12).
[0486] The chloramphenicol resistance cassette can then be
eliminated. The plasmid pCP20 carrying FLP recombinase acting at
the FRT sites of the chloramphenicol resistance cassette is then
introduced into the recombinant strains by electroporation. After a
series of cultures at 42.degree. C., the loss of the
chloramphenicol resistance cassette is verified by PCR analysis
with the same oligonucleotides as used previously (MetLR and
MetJR).
[0487] Construction of the Strains MG1655 .DELTA.(metC::Cm, metJB)
and MG1655 .DELTA.(metC, metJB)
[0488] To delete the gene metC (sequence 3150251 to 3151438, the
reference sequence on the website
http://genolist.pasteur.fr/Colibri/) of the strain MG1655
(.DELTA.metB-.DELTA.metJ), the method of phage P1 transduction is
used. The protocol followed is implemented in 2 steps with the
preparation of the phage lysate on the strain MG1655
.DELTA.(metC::Cm) and then transduction into strain MG1655
.DELTA.(metB-.DELTA.metJ).
[0489] The construction of the strain .DELTA.(metC::Cm) is
described in Example F.I.2.
[0490] Preparation of Phage Lysate P1: [0491] Seeding with 100
.mu.l of an overnight culture of the strain MG1655
(.DELTA.metC::Cm) of 10 ml of LB+Cm 30 .mu.g/ml+glucose
0.2%+CaCl.sub.2 5 mM. [0492] Incubation for 30 min at 37.degree. C.
with shaking. [0493] Addition of 100 .mu.l of phage lysate P1
prepared on the wild strain MG1655 (about 1.10.sup.9 phage/ml)
[0494] Shaking at 37.degree. C. for 3 hours until all the cells
were lysed. [0495] Addition of 200 .mu.l of chloroform and
vortexing. [0496] Centrifuging for 10 min at 4500 g to eliminate
cell debris. [0497] Transfer of supernatant to a sterile tube and
addition of 200 .mu.l of chloroform. [0498] Storage of lysate at
4.degree. C.
[0499] Transduction [0500] Centrifuging for 10 min at 1500 g of 5
ml of an overnight culture of the strain MG1655
(.DELTA.metB-.DELTA.metJ) in LB medium. [0501] Suspension of the
cell pellet in 2.5 ml of 10 mM MgSO.sub.4, 5 mM CaCl.sub.2 [0502]
Control tubes: 100 .mu.l cells [0503] 100 .mu.l phages P1 of strain
MG1655 (.DELTA.metC::Cm) [0504] Test tube: 100 .mu.l of cells+100
.mu.l of phages P1 of the strain MG1655 (.DELTA.metC::Cm) [0505]
Incubation for 30 min at 30.degree. C. without shaking. [0506]
Addition of 100 .mu.l of 1 M sodium citrate in each tube and
vortexing. [0507] Addition of 1 ml of LB [0508] Incubation for 1
hour at 37.degree. C. with shaking [0509] Spreading on dishes LB+Cm
30 .mu.g/ml after centrifuging of tubes for 3 min at 7000 rpm.
[0510] Incubation at 37.degree. C. overnight.
[0511] Verification of the Strain
[0512] The cloramphenicol transformants are then selected and the
insertion of the region containing (metC::Cm) is verified by a PCR
analysis with the oligonucleotides MetCR and MetCF, and MetJR and
MetLR to verify also the strain with genes metB and metJ. The
strain retained is designated MG1655 .DELTA.(metC::Cm, metJB).
[0513] MetCR (SEQ ID NO 11): cgtccgggacgccttgatcccggacgcaac
(homologous to sequence 3151522 a 3151493)
[0514] MetCF (SEQ ID NO 12): gcgtttacgcagtaaaaaagtcaccagcacgc
(homologous to the sequence from 3150118 to 3150149).
[0515] As previously, the chloramphenicol resistance cassette can
then be eliminated. The plasmid pCP20 carrying FLP recombinase
acting at the FRT sites of the chloramphenicol resistance cassette
is then introduced into the recombinant sites by electroporation.
After a series of cultures at 42.degree. C., the loss of the
chloramphenicol resistance cassette is verified by a PCR analysis
with the same oligonucleotides as used previously (MetCR and MetCF,
and MetJR and Met LR). The strain retained is designated MG1655
.DELTA.(metC, metJB).
[0516] Introduction of the Plasmid pTtrc99A-metY and Evolution of
the Strain
[0517] In a particular embodiment, a plasmid is constructed that
permits the expression of the gene metY of C. glutamicum. This gene
is amplified by PCR from chromosomal ADN of C. glutamicum and
introduced into a plasmid pTrc99A. It is possible to amplify by PCR
the gene metY and if necessary its natural promoter. In a preferred
embodiment, the gene metY is cloned under the control of a promoter
that permits an expression in E. coli. The vector used is a pTrC99A
(Pharmacia), but a vector selected from among pUC, pBluescript,
pCR-Script, pTopo, etc. could also be used.
[0518] The strain Escherichia coli .DELTA.(metC, metJB) obtained
previously is transformed with the plasmid pTrc-metY of C.
glutamicum. The transformation of the strain is carried out by
electroporation.
[0519] The strain obtained is then inoculated in a conical flask
(OD.sub.600nm.about.0.4-0.5) containing 10% of its volume in a
minimal medium with glucose for sole carbon source. The low
succinylhomoserine sulfhydrylase activity initially carried by the
enzyme MetY limits the growth (.mu..about.0.06 h.sup.-1) of the
bacterial population on the minimal medium (MML8) owing to
limitation of synthesized methionine. Reseeding is carried out when
the OD.sub.600nm in the flask reached about 2. The selection is
thus conducted for 22 culture cycles. A marked improvement in the
growth rate is observed during this phase of evolution-selection
(FIG. 13). In view of prior experience, it is likely that the
improvement in growth observed corresponds to an evolution of the
gene metY such that the O-acetyl-homoserine sulfhydrylase activity
is changed into an O-succinyl-homoserine sulfhydrylase activity
allowing the production of homocysteine from O-succinylhomoserine
and H.sub.2S; these two substrates being produced by the
bacterium.
[0520] To optimize the process of evolution of metY, a similar
approach is possible using other mutants of Escherichia coli, in
particular the mutant .DELTA.(metC, metB).
Example F.I.4
Fed-Batch Culture Process for the Production and Purification of
Methionine
[0521] Pre-Culture
[0522] The pre-culture is carried out overnight in a 500 ml flask
containing 50 ml of minimal medium, type M9 modified, supplemented
with 2.5 g/l of glucose. The cells are recovered by centrifuging
and taken up in 5 ml of minimal medium, type M9 modified.
[0523] Culture in a Fermenter
[0524] The culture is carried out in a fermenter with a useable
volume of 300 ml of the Fedbatch-pro DASGIP type.
[0525] The fermenter is filled with 145 ml of minimal medium, type
M9 modified, and inoculated with 5 ml of pre-culture, i.e., an
inoculation OD.sub.600nm between 0.5 and 1.2.
[0526] The temperature of the culture is maintained between 30 and
37.degree. C. and the pH is continuously adjusted to a value
between 6.5 and 8. It is partially regulated by adding a solution
of CH.sub.3SNa. A solution of 2N sodium hydroxide can if necessary
be used to complete the regulation. Shaking is maintained at
between 200 and 400 rpm during the batch phase and is increased to
1000 rpm at the end of the fed-batch process. The dissolved O.sub.2
content is maintained between 30% and 40% saturation using a gas
controller. As soon as the OD.sub.600nm attains a value between 2.5
and 3 the fed-batch process is started by adding the fed medium at
an initial flow rate of between 0.3 and 0.5 ml/h with a gradual
increase to flow rates between 2.5 and 3.5 ml/h. Thereafter the
flow rate is maintained constant for between 24 h and 32 h. The fed
medium is made up on the basis of a modified M9 medium complemented
by a glucose concentration between 300 and 500 g/l of glucose. At
the same time the medium is supplemented with a solution of
CH.sub.3SNa (solution between 1 and 5 M) to allow bacterial growth
while at the same time regulating the pH. As soon as the cell
concentration reaches a value between 20 and 50 g/l the fed medium
is replaced by a minimal medium of type M9 with limited phosphorus.
The solution of methylmercaptan is replaced by a direct injection
of CH.sub.3SH in gaseous form into the fermenter. The gas flow rate
is adapted to the flow rate of the fed solution in molar ratios to
the carbon substrate ranging from 1 to 3. As soon as the cell
concentration is between 50 and 80 g/l the fermentation is stopped.
The pH of the fermentation must liquor is adjusted to between 7.5
and 9 with a solution of NaOH, and it is heated to between 60 and
80.degree. C. The liquor is then filtered on UF modules. The
temperature of the liquor is maintained at between 60 and
80.degree. C., and the liquor is then concentrated before running
it through charcoal to de-color it (in a column or batchwise). The
de-colored liquor is filtered again to remove last particles before
acidification with concentrated HCl to a pH below 2.28 (pK.sub.1 of
methionine). The crystals of methionine hydrochloride thus formed
are recovered by filtration and the HCl eliminated by evaporation,
yielding purified L-methionine.
[0527] Registration of Biological Material
[0528] The strain K183 was registered on Apr. 2, 2003 at the
Collection Nationale de Cultures de Microorganismes (CNCM), 25 rue
du Docteur-Roux, 75724 Paris Cedex 15, France, in compliance with
the provisions of the Treaty of Budapest, under the serial number
I-3005.
[0529] F. II. Evolution of the Cysteine Biosynthesis Pathway
[0530] One application (Example F.II.1.) of the invention to
metabolic engineering of the biosynthesis pathway of cysteine
comprises the following steps: [0531] a) Deletion of the genes
cysK, cysM in the initial strain of E. coli; the modified strain
obtained is thus auxotrophic to cysteine. The initial strain is
able to grow on a minimal medium (MM) containing no methionine,
S-adenosylmethionine, homocysteine, cystathionine, or cysteine,
whereas the modified strain has lost that ability. [0532] a1)
Introduction of the gene metY, a heterologous gene from C.
glutamicum. This gene is to evolve from an acetylhomoserine
sulfhydrylase activity into a cysteine-synthase activity. [0533] b)
Culture of the modified strain E. coli [mety .DELTA.(cysK, cysM)]
on the same minimal medium (MM) with no co-substrate, to cause the
evolution of MetY into a cysteine-synthase activity to compensate
for the initially deleted enzyme activities (CysK, CysM). [0534] c)
Selection of an evolved strain with a new cysteine-synthase
activity in the presence of endogenous H.sub.2S; verification of
the new synthesis pathway.
Example F.II.1
Evolution of an Acetylhomoserine Sulfhydrylase Activity into a
Cysteine Synthase Activity
[0535] a) Construction of the Strain E. coli .DELTA.(cysK,
cysM)
[0536] The inactivation of the genes cysK and cysM is carried out
by inserting an antibiotic resistance cassette (chloramphenicol and
kanamycin respectively) while at the same time deleting most of the
genes concerned. The method used is described by Datsenko, K. A.;
Wanner, B. L. (2000), One-step inactivation of chromosomal genes in
Escherichia coli K-12 using PCR products. Proc. Natl. Acad. Sci.
USA 97: 6640-6645. For each construction a pair of oligonucleotides
is synthesized:
[0537] For cysK:
[0538] DcysKR with 100 bases (SEQ ID NO 15): TABLE-US-00014
Tgttgcaattctftctcagtgaagagatcggcaaacaatgcggtgcttaa
ataacgctcacccgatgatggtagaataacCATATGAATATCCTCCTTAG
[0539] with [0540] a region (lower case) homologous to the sequence
(2531396 to 2531317) of the gene cysK (reference sequence on the
website http://genolist.pasteur.fr/Colibri/), [0541] a region
(upper case) for the amplification of the chloramphenicol
resistance cassette (reference sequence in Datsenko, K. A. &
Wanner, B. L., 2000, PNAS, 97: 6640-6645).
[0542] DcysKF de 100 bases (SEQ ID NO 16): TABLE-US-00015
agtaagatttttgaagataactcgctgactatcggtcacacgccgctggt
tcgcctgaatcgcatcggtaacggacgcatTGTAGGCTGGAGCTGCTTCG
[0543] with: [0544] a region (lower case) homologous to the
sequence (2530432 a 2530511) of the gene cysK, [0545] a region
(upper case) for the amplificaion of the chloramphenicol resistance
cassette.
[0546] Pour cysM:
[0547] DcysMR with 100 bases (SEQ ID NO 17): TABLE-US-00016
cccgccccctggctaaaatgctcttccccaaacaccccggtagaaaggta
gcgatcgccacgatcgcagatgatcgccacCATATGAATATCCTCCTTAG
[0548] with: [0549] a region (lower case) homologous to the
sequence (2536699 to 2536778) of the gene cysM (reference sequence
on the website http:/genolist.pasteur.fr/Colibri/), [0550] a region
(upper case) for the amplification of the kanamycin resistance
cassette.
[0551] DcysMF with 100 bases (SEQ ID NO 18): TABLE-US-00017
Agtacattagaacaaacaataggcaatacgcctctggtgaagttgcagcg
aatggggccggataacggcagtgaagtgtgTGTAGGCTGGAGCTGCTTCG
[0552] with: [0553] a region (lower case) homologous to the
sequence (2537600 to 2537521) of the gene cysM, [0554] a region
(upper case) for the amplification of the kanamycin resistance
cassette.
[0555] The oligonucleotides DcysKR and DcysKF, and DcysMR and
DcysMF are used respectively to amplify the chloramphenicol and
kanamycin resistance cassettes from plasmids pKD3 and pKD4. The PCR
product obtained is then introduced by electroporation in the
strain MG1655 (pKD46) in which the enzyme Red recombinase expressed
permits the homologous recombination. The transformants resistant
to each of the antibiotics are then selected and the insertion of
the resistance cassette is verified by a PCR analysis with the
oligonucleotides cysKR and cysKF, and cysMR and cysMF.
cyKR (SEQ ID NO 19): tttttaacagacgcgacgcacgaagagcgc (homologous to
the sequence from 2531698 to 2531669)
cysKF (SEQ ID NO 20): ggcgcgacggcgatgtgggtcgattgctat (homologous to
the sequence from 2530188 to 2530217)
cysMR (SEQ ID NO 21): ggggtgacggtcaggactcaccaatacttc (homologous to
the sequence from 2536430 to 2536459)
cysMF (SEQ ID NO 22): gcgcgcatcgctggccgctgggctacacac (homologous to
the sequence from 2538071 to 2538042).
[0556] The chloramphenicol and kanamycin resistance cassettes can
then be eliminated. For this purpose the plasmid pCP20, carrying
FLP recombinase acting at the FRT sites of the chloramphenicol or
kanamycin resistance cassettes, is introduced into the recombinant
strains by electroporation. After a series of cultures at
42.degree. C., the loss of the antibiotic resistance cassette is
verified by a PCR analysis with the same oligonucleotides as used
previously.
[0557] a1) Introduction of the Gene metY in the Preceding
Strain
[0558] The plasmid pTopometY is constructed by insertion of the
gene metY in the vector Zero Blunt TOPO PCR cloning kit (PCR4 TOPO
vector, Invitrogen). For this purpose the gene metY is amplified by
PCR with the polymerase Pwo from the chromosomal DNA of the strain
Corynebacterium glutamicum ATCC13032 using the following
oligonucleotides:
[0559] MetYR (SEQ ID NO 23):
ttagagctgttgacaattaatcatccggctcgtataatgtgtggaataaaaactcttaaggacctccaaatgc-
c
[0560] Promoter of type TRC (pTRC-O) in bold roman, RBS of the gene
metY in bold roman underlined, initiation codon of the gene metY in
bold italics.
[0561] MetYF (SEQ ID NO 24):
[0562] gctctgtctagtctagtttgcattctcacg
[0563] Sequence chosen downstream of the transcription terminator
metY.
[0564] The PCR product obtained is then directly cloned in the
vector Topo to give the plasmid pTopometY. The vector Topo carries
a replication origin for E. coli, an ampicillin resistance gene and
a kanamycin resistance gene.
[0565] The plasmid pTopometY is then introduced into the strain E.
coli DH5.alpha. for verification of the construction. The
sequencing of the gene metY of the plasmid pTopometY with the
universal oligonucleotides M13 reverse and M13 forward is then
carried out to confirm the construction.
[0566] The plasmid is introduced into the strain E. coli
.DELTA.(cysK, cysM) by electroporation.
[0567] c) Culture of the Modified Strain to Cause the Gene MetY
Coding for Acetyl-Homoserine Sulfhydrylase Activity to Evolve
Toward a Cysteine Synthase Activity
[0568] The controlled selection of the preceding strain containing
the gene metY can be carried out in bottles or conical flasks. The
implementation of this method permits the selection of a strain of
Escherichia coli in which the enzyme acetyl-homoserine
sulfhydrylase has evolved into a `cysteine synthase` activity. The
controlled selection is performed in conical flasks containing 50
ml of inorganic medium (Schaefer et al., 1999, Anal. Biochem. 270:
88-96) in the presence of 33 mM glucose, chloramphenicol at a final
concentration of 25 mg/l and kanamycin at a concentration of 25
mg/l.
[0569] The culture media are seeded with the strain E. coli K12
[.DELTA.((cysK, cysM) pTopometY] at a defined OD.sub.600nm value.
Seeding is carried out with a population of bacteria sufficiently
large for some bacteria potentially to possess relevant mutations
in the gene metY enabling them to assimilate O-acetyl serine. This
population is obtained by growing the strain auxotrophic for
cysteine on a cysteine-supplemented minimal medium. A control
culture is seeded with the strain E. coli K12 (.DELTA. cysK,
cysM).
[0570] The cultures are carried out with shaking at 37.degree. C.,
for 6 days, after which time the OD.sub.600nm is measured. The
control culture displays practically no change in OD, while some
other cultures exhibit significant evolution of their OD. It is
therefore probable that the `evolved cysteine synthase activity`
has appeared in the populations contained in those conical flasks.
The mutation or mutations probably occurr in the gene metY because
this gene was the only difference between these strains and the
control strain.
[0571] The bacterial population of these positive cultures can then
be used to further improve the cysteine synthase activity by
repeating the flask culture procedure as described.
[0572] c) Selection of Clones
[0573] The evolved population is then spread on a gelosed minimal
medium containing glucose as sole carbon source. The inoculated
dishes are placed in aerobic conditions in an incubator at
37.degree. C. After 36 hours, the clones appear on the dishes; they
correspond to bacteria able to produce cysteine from glucose as
sole carbon source. Three clones are isolated
[0574] Control of the Synthesis Pathway
[0575] The population of evolved E. coli K12 [.DELTA.(cysK, cysM)
pTopometY] is cultured in a minimal medium (Schaefer et al., 1999,
Anal. Biochem. 270: 88-96) containing 2,5 gl.sup.-1 of glucose
uniformly labeled with carbon 13. After culture, the cells were
recovered, washed and hydrolysed with 6N HCl for 24 hours at
107.degree. C. A 2D NMR analysis was then performed (HSQC). This
analysis allows the fate of the glucose carbon 13 to be determined,
thereby confirming that the synthesis of cysteine takes place via
serine and acetyl-serine, indicating that the enzyme coded for by
the gene metY has evolved into a cysteine synthase.
[0576] F. III. Evolution of NADPH-Dependent Enzymes
[0577] One application (Example F.III.1.) of the invention to
metabolic engineering of NADPH-dependent bioconversion pathways
comprises, the following steps: [0578] a1) Inactivation of the
genes udhA and pgi in the initial strain E. coli; [0579] a2)
Inactivation of the genes pfkA, pfkB and udhA in the initial strain
E. coli; [0580] The resulting modified strains are thus optimized
for their ability to reduce NADP. The initial strain is able to
grow on a minimal medium (MM), while the ability of the modified
strains to grow on that medium is strongly impaired. [0581] b)
Introduction of a plasmid harboring the gene yueD coding for a
benzyl reductase of Bacillus cereus. [0582] c) Culture of the
preceding modified strain on the minimal medium (MM) to which is
added p-nitrobenzaldehyde (co-substrate) to cause the evolution of
the benzyl reductase activity for that poorly metabolized
substrate. [0583] d) Characterization of the evolved enzyme
YueD
Example F.III.1
Construction of the strains E.coli .DELTA.(udhA, pgi) and E. coli
.DELTA.(pfkA, pfkB, udhA) and Modification of the Kinetic
Characteristics of the Benzyl Reductase of Bacillus cereus
[0584] a1) Construction of the Modified Strain e. Coli
.DELTA.(udhA, pgi)
[0585] The inactivation of the gene udhA, is carried out by
inserting an antibiotic resistance cassette conferring resistance
to kanamycin while at the same time deleting most of the gene
concerned. The method used is described by Datsenko, K. A.; Wanner,
B. L. (2000), One-step inactivation of chromosomal genes in
Escherichia coli K-12 using PCR products. Proc. Natl. Acad. Sci.
USA 97: 6640-6645.
[0586] For this purpose two oligonucleotides are synthesized:
[0587] DudhAR with 100 bases (SEQ ID NO 25): TABLE-US-00018
cccagaatctcttttgtttcccgatggaacaaaattttcagcgtgcccac
gttcatgccgacgatttgtgcgcgtgccagTGTAGGCTGGAGCTGCTTCG
[0588] with [0589] a region (lower case) homologous to the sequence
(4157144 to 4157223) of the gene udhA (sequence 4158303 to 4156969,
reference sequence on the website
http://genolist.pasteur.fr/Colibri/), [0590] a region (upper case)
for the amplification of the kanamycin resistance cassette
(reference sequence in Datsenko, K. A. & Wanner, B. L., 2000,
PNAS, 97: 6640-6645).
[0591] DudhAF with 100 bases (SEQ ID NO 26): TABLE-US-00019
ggtgcgcgcgtcgcagttatcgagcgttatcaaaatgttggcggcggttg
cacccactggggcaccatcccgtcgaaagcCATATGAATATCCTCCTTAG
[0592] with: [0593] a region (lower case) homologous to the
sequence (4158285 to 4158206) of the gene udhA, [0594] a region
(upper case) for the amplification of the kanamycin resistance
cassette.
[0595] The oligonucleotides DudhAR and DudhAF are used to amplify
the kanamycin resistance cassette from the plasmid pKD4. The PCR
product obtained is then introduced by electroporation into the
strain MG1655 (pKD46) in which the Red recombinase enzyme expressed
permits the homologous recombination. The kanamycin resistant
transformants are then selected and the insertion of the resistance
cassette is verified by a PCR analysis with the oligonucleotides
UdhAR and UdhAF
[0596] UdhAR (SEQ ID NO 27): gcgggatcactttactgccagcgctggctg
(homologous to the sequence 4156772 to 4156801)
[0597] UdhAF (SEQ ID NO 28): ggccgctcaggatatagccagataaatgac
(homologous to the sequence 4158475 to 4158446)
[0598] The inactivation of the gene pgi, is carried out by
inserting an antibiotic resistance cassette conferring resistance
to chloramphenicol while at the same time deleting most of the gene
concerned. The method used is described by Datsenko, K. A.; Wanner,
B. L. (2000), One-step inactivation of chromosomal genes in
Escherichia coli K-12 using PCR products. Proc. Natl. Acad. Sci.
USA 97: 6640-6645.
[0599] For this purpose two oligonucleotides are synthesized:
[0600] DpgiR with 100 bases (SEQ ID NO 29): TABLE-US-00020
gcgccacgctttatagcggttaatcagaccattggtcgagctatcgtggc
tgctgatttctttatcatctttcagctctgCATATGAATATCCTCCTTAG
[0601] with [0602] a region (lower case) homologous to the sequence
(4232980 to 4232901) of the gene pgi (sequence 4231337 to 4232986,
reference sequence on the website
http://genolist.pasteur.fr/Colibri/), [0603] a region (upper case)
for the amplification of the chloramphenicol resistance cassette
(reference sequence in Datsenko, K. A. & Wanner, B. L., 2000,
PNAS, 97: 6640-6645).
[0604] DpgiF with 100 bases (SEQ ID NO 30): TABLE-US-00021
ccaacgcagaccgctgcctggcaggcactacagaaacacttcgatgaaat
gaaagacgttacgatcgccgatctttttgcTGTAGGCTGGAGCTGCTTCG
[0605] with: [0606] a region (lower case) homologous to the
sequence (4231352 to 4231432) of the gene pgi, [0607] a region
(upper case) for the amplification of the chloramphenicol
resistance cassette.
[0608] The oligonucleotides DpgiR and DpgiF are used to amplify the
chloramphenicol resistance cassette from the plasmid pKD3. The PCR
product obtained is then introduced by electroporation into the
strain MG1655 .DELTA.udhA (pKD46) in which the Red recombinase
enzyme expressed permits the homologous recombination. The
chloramphenicol resistant transformants are then selected and the
insertion of the resistance cassette is verified by a PCR analysis
with the oligonucleotides PgiR and PgiF
[0609] PgiR (SEQ ID NO 31): cggtatgatttccgttaaattacagacaag
(homologous to the sequence 4233220 to 4233191)
[0610] PgiF (SEQ ID NO 32): gcggggcggttgtcaacgatggggtcatgc
(homologous to the sequence 4231138 to 4231167)
[0611] The two antibiotic resistance cassettes can then be
eliminated. The plasmid pCP20 carrying recombinase FLP acting at
the FRT sites of both the kanamycin and chloramphenicol resistance
cassette is then introduced into the recombinant strains by
electroporation. After a series of cultures at 42.degree. C., the
loss of the two resistance cassettes is verified by a PCR analysis
with the same oligonucleotides as those used previously.
[0612] a2) Construction of the Modified Strain E. coli
.DELTA.(pfkA, pfkB, udhA)
[0613] The inactivation of the gene pfkA, is carried out by
inserting an antibiotic resistance cassette conferring resistance
to chloramphenicol while at the same time deleting most of the gene
concerned. The method used is described by Datsenko; K. A.; Wanner,
B. L. (2000), One-step inactivation of chromosomal genes in
Escherichia coli K-12 using PCR products. Proc. Natl. Acad. Sci.
USA 97: 6640-6645.
[0614] For this purpose two oligonucleotides are synthesized:
[0615] DpfkAR with 100 bases (SEQ ID NO 33): TABLE-US-00022
ttcgcgcagtccagccagtcacctttgaacggacgcttcatgttttcgat
agcgtcgatgatgtcgtggtgaaccagctgCATATGAATATCCTCCTTAG
[0616] with [0617] a region (lower case) homologous to the sequence
(4106081 to 4106002) of the gene pfkA (sequence 4105132 to 4106094,
reference sequence on the website
http://genolist.pasteur.fr/Colibri/), [0618] a region (upper case)
for the amplification of the chloramphenicol resistance cassette
(reference sequence in Datsenko, K. A. & Wanner, B. L., 2000,
PNAS, 97: 6640-6645).
[0619] DpfkAF de 100 bases (SEQ ID NO 34): TABLE-US-00023
ggtgtgttgacaagcggcggtgatgcgccaggcatgaacgccgcaattcg
cggggttgttcgttctgcgctgacagaaggTGTAGGCTGGAGCTGCTTCG
[0620] with: [0621] a region (lower case) homologous to the
sequence (4105147 to 4105227) of the gene pfkA, [0622] a region
(upper case) for the amplification of the chloramphenicol
resistance cassette.
[0623] The oligonucleotides DpfkAR and DpfkAF are used to amplify
the chloramphenicol resistance cassette from the plasmid pKD3. The
PCR product obtained is then introduced by electroporation into the
strain MG1655 (pKD46) in which the Red recombinase enzyme expressed
permits the homologous recombination. The chloramphenicol resistant
transformants are then selected and the insertion of the resistance
cassette is verified by a PCR analysis with the oligonucleotides
PfkAR and PfkAF PfkAR (SEQ ID NO 35): ccctacgccccacttgttcatcgcccg
(homologous to the
[0624] sequence 4106434 to 4106408) PfkAF (SEQ ID NO 36):
cgcacgcggcagtcagggccgacccgc (homologous to the sequence 4104751 to
4104777)
[0625] The inactivation of the udhA gene was described in example
F.III.1 a1) and can be carried out in the same way.
[0626] The two antibiotic resistance cassette can then be
eliminated. The plasmid pCP20 carrying recombinase FLP acting at
the FRT sites of both the kanamycin and chloramphenicol resistance
cassette is then introduced into the recombinant strains by
electroporation. After a series of cultures at 42.degree. C., the
loss of the two resistance cassettes is verified by a PCR analysis
with the same oligonucleotides as those used previously.
[0627] The inactivation of the gene pfkB, is carried out by
inserting an antibiotic resistance cassette conferring resistance
to chloramphenicol while at the same time deleting most of the gene
concerned. The method used is described by Datsenko, K. A.; Wanner,
B. L. (2000), One-step inactivation of chromosomal genes in
Escherichia coli K-12 using PCR products. Proc. Natl. Acad. Sci.
USA 97: 6640-6645.
[0628] For this purpose two oligonucleotides are synthesized:
[0629] DpfkBR with 100 bases (SEQ ID NO 37): TABLE-US-00024
gcgggaaaggtaagcgtaaattttttgcgtatcgtcatgggagcacagac
gtgttccctgattgagtgtggctgcactccCATATGAATATCCTCCTTAG
[0630] with [0631] a region (lower case) homologous to the sequence
(1805320 to 1805241) of the gene pfkB (sequence 1804394 to 1805323,
reference sequence on the website
http://genolist.pasteur.fr/Colibri/), [0632] a region (upper case)
for the amplification of the chloramphenicol resistance cassette
(reference sequence in Datsenko, K. A. & Wanner, B. L., 2000,
PNAS, 97: 6640-6645).
[0633] DpfkBF with 100 bases (SEQ ID NO 38): TABLE-US-00025
gcgccctctctcgatagcgcaacaattaccccgcaaatttatcccgaagg
aaaactgcgctgtaccgcaccggtgttcgTGTAGGCTGGAGCTGCTTCG
[0634] with: [0635] a region (lower case) homologous to the
sequence (1804421 to 1804499) of the gene pfkB, [0636] a region
(upper case) for the amplification of the chloramphenicol
resistance cassette.
[0637] The oligonucleotides DpfkBR and DpfkBF are used to amplify
the chloramphenicol resistance cassette from the plasmid pKD3. The
PCR product obtained is then introduced by electroporation into the
strain MG1655 .DELTA.(pfkA, udhA) (pKD46) in which the Red
recombinase enzyme expressed permits the homologous recombination.
The chloramphenicol resistant transformants are then selected and
the insertion of the resistance cassette is verified by a PCR
analysis with the oligonucleotides PfkBR and PfkBF
[0638] PfkBR (SEQ ID NO 39): gccggttgcactttgggtaagccccg (homologous
to the sequence 1805657 to 1805632)
[0639] PfkBF (SEQ ID NO 40): tggcaggatcatccatgacagtaaaaacgg
(homologous to the sequence 1803996 to 1804025)
[0640] The chloramphenicol resistance cassette can then be
eliminated. The plasmid pCP20 carrying recombinase FLP acting at
the FRT sites of the chloramphenicol resistance cassette is then
introduced into the recombinant strains by electroporation. After a
series of cultures at 42.degree. C., the loss of the
chloramphenicol resistance cassette is verified by a PCR analysis
with the same oligonucleotides as those used previously. The strain
retained is designated MG1655 .DELTA.(pfkA, pfkB, udhA).
[0641] a1) Introduction of the Gene yueD Coding for Benzil
Reductase of Bacillus cereus into the Strain .DELTA.(pgi, udhA) or
Similarly .DELTA.(pfkA, pfkB, udhA)
[0642] The gene yueD is cloned into the vector pTrc99A
(Amersham-Pharmacia). The oligos YueDR and YueDF are used for the
amplification of the gene from chromosomal DNA of Bacillus cereus.
TABLE-US-00026 YueDR (SEQ ID NO 41):
CGTGAATTCttattcatcaattctaataa
[0643] with: [0644] a region (lower case) homologous to the
sequence (731 to 750) of the gene yueD,
[0645] a region (upper case) allowing the cleavage by the enzyme
EcoRI. TABLE-US-00027 YueDF (SEQ ID NO 42):
ACGTTCatgAgAtacgttatcataacaggaac
[0646] with: [0647] a region (lower case) homologous to the
sequence (1 to 26) of the gene yueD, [0648] a region (changed and
added bases, upper case) allowing the cleavage by the enzyme
BspHI.
[0649] The PCR product obtained is digested with the restriction
enzymes BspHI and EcoRI and cloned into the vector pTrc99A that has
been digested with NcoI and EcoRI. The resulting plasmid pYU1 is
then introduced into the strain MG1655 .DELTA.(pgi, udhA). The gene
yueD codes for a NADPH-dependent benzil reductase that efficiently
reduces 1-phenyl-1,2-propanedione (k.sub.cat=165 min.sup.-1;
K.sub.m=42 .mu.M) but possesses a lower activity toward
p-nitrobenzaldehyde (k.sub.cat=1.2 min.sup.-1; K.sub.m=261 .mu.M)
(Maruyama, R. Nishizawa, M.; Itoi, Y.; Ito, S.; Inoue, M. (2002)
The enzyme with benzil reductase activity is conserved from
bacteria to mammals. J. Biotechnology 94: 157-169).
[0650] b) Culture and Evolution of the Modified Strain on a Minimal
Medium
[0651] The maximal growth rate of the strain of E. coli
[.DELTA.(udhA, pgi) yueD] obtained is evaluated on minimal medium
(.mu..sub.max=0.04). In these conditions it is much lower than that
of the unmodified strain (.mu..sub.max=0.61). It is then decided to
add 1-phenyl-1,2-propanedione (co-substrate) to the minimal medium,
and it is found that the modified strain is able to grow at a rate
slightly inferior to that of the initial (i.e., unmodified) strain
on the same medium. It is then decided to seed (OD 5) a chemostat
in a minimal medium containing p-nitrobenzaldehyde (co-substrate)
With the modified strain; in these conditions the strain exhibits a
growth rate similar to that of the modified strain grown on a
minimal medium with no co-substrate. The chemostat is maintained
for 1 to 5 weeks, while gradually increasing the dilution rate. The
increase in the dilution rate can be performed stepwise or
continuously. Glycerol stocks of the population contained in the
chemostat are made up regularly.
[0652] d) Characterization of the Evolved Enzyme YueD
[0653] When the population can no longer adapt to the dilution
rates imposed, it is considered that the selection is completed.
Single colonies are isolated from the final evolved population (if
necessary using one of the last glycerol stocks made up) and the
kinetic characteristics of the evolved benzil reductase are
evaluated, by comparison with the initial benzil reductase, using
substrates 1-phenyl-1,2-propanedione and p-nitrobenzaldehyde. The
k.sub.cat value for the evolved benzil reductase is markedly
improved for p-nitrobenzaldehyde, while its k.sub.cat for
1-phenyl-1,2-propanedione is strongly depressed. Sequencing of the
evolved clones demonstrates an accumulation of point mutations,
which explains the altered substrate specificity of these
enzymes.
REFERENCES
[0654] Anderson, E. H. (1946), Growth requirements of
virus-resistant mutants of Escherichia coli strain "B" Proc. Natl.
Acad. Sci. USA 32:120-12.8. [0655] A Baudin, O
Ozier-Kalogeropoulos, A Denouel, F Lacroute, and C Cullin (1993), A
simple and efficient method for direct gene deletion in
Saccharomyces cerevisiae, Nucl. Acids Res., 21: 3329-3330, 1993.
[0656] Brachmann C B, Davies A, Cost G J, Caputo E, Li J, Hieter P,
Boeke J D. (1998), Designer deletion strains derived from
Saccharomyces cerevisiae S288C: a useful set of strains and
plasmids for PCR-mediated gene disruption and other applications.
Yeast. 14:115-32. [0657] Datsenko, K. A.; Wanner, B. L. (2000),
One-step inactivation of chromosomal genes in Escherichia coli K-12
using PCR products. Proc. Natl. Acad. Sci. USA 97: 6640-6645.
[0658] Miller, 1992. A Short Course in Bacterial Genetics: A
Laboratory Manual and Handbook for Escherichia coli and Related
Bacteria, Cold Spring Harbor Laboratory Press, Cold Spring Harbor,
N.Y. [0659] Sambrook et al. (1989), Molecular cloning: a laboratory
manual. 2.sup.nd Ed. Cold Spring Harbor Lab., Cold Spring Harbor,
N.Y. [0660] Schaefer, U., Boos, W., Takors, R., Weuster-Botz, D.
(1999), Automated sampling device for monitoring intracellular
metabolite dynamics, Anal. Biochem. 270: 88-96. [0661] Wach, A.,
Brachat, A., Pohlmann, R., and Philippsen, P. (1994) New
heterologous modules for classical or PCR-based gene disruptions in
Saccharomyces cerevisiae. Yeast, 10, 1793-1808.
Sequence CWU 1
1
42 1 100 DNA Artificial Synthetic 1 tacccccgac gcaagttctg
cgccgcctgc accatgttcg ccagtgccgc gcgggtttct 60 ggccagccgc
gcgttttcag catatgaata tcctccttag 100 2 100 DNA Artificial Synthetic
2 tgacaatatt gaatcacacc ctcggtttcc ctcgcgttgg cctgcgtcgc gagctgaaaa
60 aagcgcaaga aagttattgg tgtaggctgg agctgcttcg 100 3 30 DNA
Artificial Synthetic 3 ggtttaagca gtatggtggg aagaagtcgc 30 4 30 DNA
Artificial Synthetic 4 cccggggatg aataaacttg ccgccttccc 30 5 1161
DNA Escherichia coli 5 atgacgcgta aacaggccac catcgcagtg cgtagcgggt
taaatgacga cgaacagtat 60 ggttgcgttg tcccaccgat ccatctttcc
agcacctata actttaccgg atttaatgaa 120 ccgcgcgcgc atgattactc
gcgtcgcggc aacccaacgc gcgatgtggt tcagcgtgcg 180 ctggcagaac
tggaaggtgg tgctggtgca gtacttacta ataccggcat gtccgcgatt 240
cacctggtaa cgaccgtctt tttgaaacct ggcgatctgc tggttgcgcc gcacgactgc
300 tacggcggta gctatcgcct gttcgacagt ctggcgaaac gcggttgcta
tcgcgtgttg 360 tttgttgatc aaggcgatga acaggcatta cgggcagcgc
tggcagaaaa acccaaactg 420 gtactggtag aaagcccaag taatccattg
ttacgcgtcg tggatattgc gaaaatctgc 480 catctggcaa gggaagtcgg
ggcggtgagc gtggtggata acaccttctt aagcccggca 540 ttacaaaatc
cgctggcatt aggtgccgat ctggtgttgc attcatgcac gaaatatctg 600
aacggtcact cagacgtagt ggccggcgtg gtgattgcta aagacccgga cgttgtcact
660 gaactggcct ggtgggcaaa caatattggc gtgacgggcg gcgcgtttga
cagctatctg 720 ctgctacgtg ggttgcgaac gctggtgccg cgtatggagc
tggcgcagcg caacgcgcag 780 gcgattgtga aatacctgca aacccagccg
ttggtgaaaa aactgtatca cccgtcgttg 840 ccggaaaatc aggggcatga
aattgccgcg cgccagcaaa aaggctttgg cgcaatgttg 900 agttttgaac
tggatggcga tgagcagacg ctgcgtcgtt tcctgggcgg gctgtcgttg 960
tttacgctgg cggaatcatt agggggagtg gaaagtttaa tctctcacgc cgcaaccatg
1020 acacatgcag gcatggcacc agaagcgcgt gctgccgccg ggatctccga
gacgctgctg 1080 cgtatctcca ccggtattga agatggcgaa gatttaattg
ccgacctgga aaatggcttc 1140 cgggctgcaa acaaggggta a 1161 6 10 PRT
Escherichia coli 6 Met Glu Thr Thr His Arg Ala Arg Gly Leu 1 5 10 7
1161 DNA Escherichia coli 7 atgacgcgta aacaggccac catcgcagtg
cgtagcgggt taaatgacga cgaacagtat 60 ggttgcgttg tcccaccgat
ccatctttcc agcacctata actttaccgg atttaatgaa 120 ccgcgcgcgc
atgattactc gcgtcgcggc aacccaacgc gcgatgtggt tcagcgtgcg 180
ctggcagaac tggaaggtgg tgctggtgca gtacttacta ataccggcat gtccgcgatt
240 cacctggtaa cgaccgtctt tttgaaacct ggcgatctgc tggttgcgcc
gcacgactgc 300 tacggcggta gctatcgcct gttcgacagt ctggcgaaac
gcggttgcta tcgcgtgttg 360 tttgttgatc aaggcgatga acaggcatta
cgggcagcgc tggcagaaaa acccaaactg 420 gtactggtag aaagcccaag
taatccattg ttacgcgtcg tggatattgc gaaaatctgc 480 catctggcaa
gggaagtcgg ggcggtgagc gtggtggata acaccttctt aagcccggca 540
ttacaaaatc cgctggcatt aggtgccgat ctggtgttgc attcatgcac gaaatatctg
600 aacggtcact cagacgtagt ggccggcgtg gtgattgcta aagacccgga
cgttgtcact 660 gaactggcct ggtgggcaaa caatattggc gtgacgggcg
gcgcgtttga cagctatctg 720 ctgctacgtg ggttgcgaac gctggtgccg
cgtatggagc tggcgcagcg caacgcgcag 780 gcgattgtga aatacctgca
aacccagccg ttggtgaaaa aactgtatca cccgtcgttg 840 ccggaaaatc
aggggcatga aattgccgcg cgccagcaaa aaggctttgg cgcaatgttg 900
agttttgaac tggatggcga tgagcagacg ctgcgtcgtt tcctgggcgg gctgtcgttg
960 tttacgctgg cggcatcatt agggggagtg gaaagtttaa tctctcacgc
cgcaaccatg 1020 acacatgcag gcatggcacc agaagcgcgt gctgccgccg
ggatctccga gacgctgctg 1080 cgtatctcca ccggtattga agatggcgaa
gatttaattg ccgacctgga aaatggcttc 1140 cgggctgcaa acaaggggta a 1161
8 5 PRT Escherichia coli 8 Met Glu Thr Thr His 1 5 9 30 DNA
Artificial Synthetic 9 ggtacagaaa ccagcaggct gaggatcagc 30 10 100
DNA Artificial Synthetic 10 tatgcagctg acgacctttc gcccctgcct
gcgcaatcac actcattttt accccttgtt 60 tgcagcccgg aagccatttt
caggcaccag agtaaacatt 100 11 30 DNA Artificial Synthetic 11
cgtccgggac gccttgatcc cggacgcaac 30 12 32 DNA Artificial Synthetic
12 gcgtttacgc agtaaaaaag tcaccagcac gc 32 13 72 DNA Artificial
Synthetic 13 gcgtttacgc agtaaaaaag tcaccagcac gcaaggtccc gctaaaatcg
atcatatgaa 60 tatcctcctt ag 72 14 100 DNA Artificial Synthetic 14
cggacaaaaa gcttgatact caactggtga atgcaggacg cagcaaaaaa tacactctcg
60 gcgcggtaaa tagcgtgatt tgtaggctgg agctgcttcg 100 15 100 DNA
Artificial Synthetic 15 tgttgcaatt ctttctcagt gaagagatcg gcaaacaatg
cggtgcttaa ataacgctca 60 cccgatgatg gtagaataac catatgaata
tcctccttag 100 16 100 DNA Artificial Synthetic 16 agtaagattt
ttgaagataa ctcgctgact atcggtcaca cgccgctggt tcgcctgaat 60
cgcatcggta acggacgcat tgtaggctgg agctgcttcg 100 17 100 DNA
Artificial Synthetic 17 cccgccccct ggctaaaatg ctcttcccca aacaccccgg
tagaaaggta gcgatcgcca 60 cgatcgcaga tgatcgccac catatgaata
tcctccttag 100 18 100 DNA Artificial Synthetic 18 agtacattag
aacaaacaat aggcaatacg cctctggtga agttgcagcg aatggggccg 60
gataacggca gtgaagtgtg tgtaggctgg agctgcttcg 100 19 30 DNA
Artificial Synthetic 19 tttttaacag acgcgacgca cgaagagcgc 30 20 30
DNA Artificial Synthetic 20 ggcgcgacgg cgatgtgggt cgattgctat 30 21
30 DNA Artificial Synthetic 21 ggggtgacgg tcaggactca ccaatacttc 30
22 30 DNA Artificial Synthetic 22 gcgcgcatcg ctggccgctg ggctacacac
30 23 74 DNA Artificial Synthetic 23 ttagagctgt tgacaattaa
tcatccggct cgtataatgt gtggaataaa aactcttaag 60 gacctccaaa tgcc 74
24 30 DNA Artificial Synthetic 24 gctctgtcta gtctagtttg cattctcacg
30 25 100 DNA Artificial Synthetic 25 cccagaatct cttttgtttc
ccgatggaac aaaattttca gcgtgcccac gttcatgccg 60 acgatttgtg
cgcgtgccag tgtaggctgg agctgcttcg 100 26 100 DNA Artificial
Synthetic 26 ggtgcgcgcg tcgcagttat cgagcgttat caaaatgttg gcggcggttg
cacccactgg 60 ggcaccatcc cgtcgaaagc catatgaata tcctccttag 100 27 30
DNA Artificial Synthetic 27 gcgggatcac tttactgcca gcgctggctg 30 28
30 DNA Artificial Synthetic 28 ggccgctcag gatatagcca gataaatgac 30
29 100 DNA Artificial Synthetic 29 gcgccacgct ttatagcggt taatcagacc
attggtcgag ctatcgtggc tgctgatttc 60 tttatcatct ttcagctctg
catatgaata tcctccttag 100 30 100 DNA Artificial Synthetic 30
ccaacgcaga ccgctgcctg gcaggcacta cagaaacact tcgatgaaat gaaagacgtt
60 acgatcgccg atctttttgc tgtaggctgg agctgcttcg 100 31 30 DNA
Artificial Synthetic 31 cggtatgatt tccgttaaat tacagacaag 30 32 30
DNA Artificial Synthetic 32 gcggggcggt tgtcaacgat ggggtcatgc 30 33
100 DNA Artificial Synthetic 33 ttcgcgcagt ccagccagtc acctttgaac
ggacgcttca tgttttcgat agcgtcgatg 60 atgtcgtggt gaaccagctg
catatgaata tcctccttag 100 34 100 DNA Artificial Synthetic 34
ggtgtgttga caagcggcgg tgatgcgcca ggcatgaacg ccgcaattcg cggggttgtt
60 cgttctgcgc tgacagaagg tgtaggctgg agctgcttcg 100 35 27 DNA
Artificial Synthetic 35 ccctacgccc cacttgttca tcgcccg 27 36 27 DNA
Artificial Synthetic 36 cgcacgcggc agtcagggcc gacccgc 27 37 100 DNA
Artificial Synthetic 37 gcgggaaagg taagcgtaaa ttttttgcgt atcgtcatgg
gagcacagac gtgttccctg 60 attgagtgtg gctgcactcc catatgaata
tcctccttag 100 38 99 DNA Artificial Synthetic 38 gcgccctctc
tcgatagcgc aacaattacc ccgcaaattt atcccgaagg aaaactgcgc 60
tgtaccgcac cggtgttcgt gtaggctgga gctgcttcg 99 39 26 DNA Artificial
Synthetic 39 gccggttgca ctttgggtaa gccccg 26 40 30 DNA Artificial
Synthetic 40 tggcaggatc atccatgaca gtaaaaacgg 30 41 29 DNA
Artificial Synthetic 41 cgtgaattct tattcatcaa ttctaataa 29 42 32
DNA Artificial Synthetic 42 acgttcatga gatacgttat cataacagga ac
32
* * * * *
References