U.S. patent application number 10/993160 was filed with the patent office on 2006-11-23 for recombinant carrier molecule for expression, delivery and purification of target polypeptides.
Invention is credited to Irina V. Goldenkova, Eleonora S. Piruzian.
Application Number | 20060265787 10/993160 |
Document ID | / |
Family ID | 34312145 |
Filed Date | 2006-11-23 |
United States Patent
Application |
20060265787 |
Kind Code |
A1 |
Piruzian; Eleonora S. ; et
al. |
November 23, 2006 |
Recombinant carrier molecule for expression, delivery and
purification of target polypeptides
Abstract
Recombinant carrier molecules having amino acid sequences from
thermostable enzymes and methods of use for expression, recovery
and delivery of foreign sequences (peptides and polypeptides)
produced in different systems (bacteria, yeast, DNA, cell cultures
such as mammalian, plant, insect cell cultures, protoplast and
whole plants in vitro or in vivo are provided. The recombinant
carrier molecule using sequences from lichenase B (Lic B) were also
made and used it as part of carrier protein to express, recover and
deliver a variety of target polypeptides of interest.
Inventors: |
Piruzian; Eleonora S.;
(Moscow, RU) ; Goldenkova; Irina V.; (Moscow,
RU) |
Correspondence
Address: |
HOUSTON ELISEEVA
4 MILITIA DRIVE, SUITE 4
LEXINGTON
MA
02421
US
|
Family ID: |
34312145 |
Appl. No.: |
10/993160 |
Filed: |
November 19, 2004 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
PCT/US04/16452 |
May 24, 2004 |
|
|
|
10993160 |
Nov 19, 2004 |
|
|
|
60472495 |
May 22, 2003 |
|
|
|
Current U.S.
Class: |
800/288 ;
435/200; 435/419; 435/468; 435/69.7; 536/23.2 |
Current CPC
Class: |
C07K 2319/35 20130101;
C12Y 302/01073 20130101; C12N 9/2448 20130101; C12N 15/62 20130101;
C07K 16/1027 20130101; A61P 31/04 20180101; C07K 16/1278 20130101;
A61K 2039/6031 20130101; A61P 31/00 20180101; A61P 37/04 20180101;
A61P 35/00 20180101 |
Class at
Publication: |
800/288 ;
435/069.7; 435/419; 435/200; 435/468; 536/023.2 |
International
Class: |
A01H 1/00 20060101
A01H001/00; C07H 21/04 20060101 C07H021/04; C12P 21/04 20060101
C12P021/04; C12N 9/24 20060101 C12N009/24; C12N 15/82 20060101
C12N015/82; C12N 5/04 20060101 C12N005/04 |
Claims
1. A recombinant carrier molecule, comprising: (a) a modified
mature polypeptide of a thermostable enzyme lacking one or more
amino acid segments, wherein the modified mature polypeptide
retains its thermostability; or (b) a substantially complete mature
polypeptide of the thermostable enzyme suitable for fusing to a
heterologous polypeptide at each of N-terminus and C-terminus of
the mature polypeptide, and optionally in the loop region.
2. The recombinant carrier molecule of claim 1, wherein the mature
polypeptide of (a) is modified in that it lacks a loop region or
has a disrupted loop region, or has at least one unique restriction
site in the loop region not naturally present therein.
3. The recombinant carrier molecule of claim 2, wherein the
thermostable enzyme is lichenase B.
4. The recombinant carrier molecule of claim 3, wherein the
modified mature polypeptide or the substantially complete mature
polypeptide has a disrupted loop region.
5. The recombinant carrier molecule of claim 4, wherein the mature
polypeptide has two identifiable regions delineated by the loop
region, wherein the orientation or location of the two identifiable
regions are different from that in the wild-type mature
polypeptide.
6. A carrier protein comprising a recombinant carrier molecule
fused to at least one heterologous polypeptide, wherein the
recombinant carrier molecule has (a) a modified mature polypeptide
of the thermostable enzyme lacking one or more amino acid segments,
wherein the modified mature polypeptide retains its enymatic
activity or thermostability or (b) a complete or substantially
complete mature polypeptide of the thermostable enzyme is suitable
for carrying a heterologous polypeptide fused at each of N-terminus
and C-terminus of the mature polypeptide, and optionally in the
loop region.
7. The carrier protein of claim 6, wherein the heterologous
polypeptide is fused to the recombinant carrier molecule at at
least one fusion site selected from the group consisting of the
N-terminus, the C-terminus and an internal fusion site.
8. The carrier protein of claim 6, wherein the heterologous
polypeptide is fused to the carrier molecule at an internal fusion
site which is located at a region that links the two domains of the
mature polypeptide.
9. A carrier protein comprises a recombinant carrier molecule
having sequences from lichenase B protein; and one or more
heterologous polypeptides linked to the carrier molecule as N
terminal, C-terminal or internal fusions, wherein the carrier
protein is thermostable.
10. The carrier protein of claim 9, wherein the carrier molecule is
encoded by a sequence set forth in SEQ ID NO: 1 or 2.
11. The carrier protein of claim 9, wherein the recombinant carrier
molecule is about 28 kD.
12. A method for the production of a carrier protein in a plant
comprising: (a) providing a plant containing an expression cassette
having a nucleotide sequence encoding a carrier protein comprising
a recombinant carrier molecule having amino acid sequences from a
mature thermostable polypeptide, wherein the nucleotide sequence is
operably linked such that expression of the cassette results in
translation of the carrier protein; (b) growing said plant under
conditions whereby a nucleotide sequence is expressed and the
carrier protein is produced; and (c) optionally recovering the
carrier protein.
13. The method of claim 12, wherein the promoter is selected form
the group consisting of plant constitutive and plant tissue
specific promoters.
14. The method of claim 12, wherein the carrier protein is
expressed in leaf root or seed of the plant.
15. The method of claim 12, wherein the plant is a dicot or a
monocot.
16. The method of claim 12, wherein the amino acid sequences from a
mature thermostable polypeptide are sufficient to confer
thermostability to the carrier protein.
17. A method for recovering a polypeptide from prokaryotic or
eukaryotic cells after expression inside said cells of a carrier
protein, wherein the carrier protein comprises a recombinant
carrier molecule derived from Lie B protein; and one or more
heterologous polypeptides linked to the carrier molecule as
N-terminal, C-terminal or internal fusions, the method comprising:
(a) lysing said cells; (b) heating said lysate sufficient to
denature non-thermostable proteins; (c) separating soluble material
from insoluble material after step (b) by a separation device, and
(d) recovering the carrier protein in the soluble material after
step (c).
18. The method of claim 17, wherein the separation device is a
centrifugation device.
19. The method of claim 17, wherein the recombinant carrier
molecule is fused to two or more contiguous or non-contiguous
epitope-containing segments.
20. The method of claim 19, wherein the epitope-containing segments
being fused to the recombinant carrier molecule at fusion sites
selected from the group consisting of the N-terminus, C-terminus
and an internal fusion site.
21. The method of claim 20, wherein the recombinant carrier
molecule is encoded by a nucleic acid sequence set forth in SEQ ID
NO: 1 or 2.
Description
[0001] This application is a continuation of PCT Application Serial
No. PCT/US04/16452 filed on May 24, 2004 which claims the benefit
of U.S. Provisional Application Ser. No. 60/472,495 filed May 22,
2003 both of which are incorporated by reference herein.
FIELD OF THE INVENTION
[0002] The present invention is directed to the field of protein
expression, purification and molecular biology. Specifically, the
present invention is directed to a carrier protein expression in
which a mature polypeptide of a thermostable enzyme is used as
carrier molecule for production, recovery and delivery of target
polypeptides. The carrier molecule is useful for the production of
foreign sequences in different expression systems and hosts
including plants and mammalian cell cultures.
BACKGROUND OF THE INVENTION
[0003] Vaccines are the most effective means for preventing and
even eliminating infectious diseases. Although, there are a number
of efficacious vaccines based on full pathogens, development of
safer more potent and cost effective vaccines based on portions of
pathogen (subunit vaccines) is important. During the last two
decades several approaches to the expression (bacterial, yeast,
mammalian cell culture and plant) and delivery (DNA, live virus
vectors, purified proteins, plant virus particles) of vaccine
antigens have been developed. All these approaches have significant
impact on the development and testing of newly developed candidate
vaccines. However, there is a need for improving expression and
delivery systems to create more efficacious but safer vaccines with
fewer side effects. Some of the desired features of future vaccines
are (a) to be highly efficacious (stimulates both arms of immune
system), (b) to have known and controlled genetic composition, (c)
to have time efficiency of the system, (d) to be suitable for
expression of both small size peptides and large size polypeptides,
(e) to be suitable for expression in different systems (bacteria,
yeast, mammalian cell cultures, live virus vectors, DNA vectors,
transgenic plants and transient expression vectors), and (f) to be
capable of forming structures such as aggregates or virus like
particles that are easy to recover and are immunogenic.
[0004] Thus, there is a need for novel carrier molecules for
engineering, development and delivery of efficacious subunit
vaccines. These carrier molecules should provide advantages and
flexibility for: expressing commercially sufficient quantities of
target polypeptide in different systems, economical recovery of
target polypeptides from source material, accommodating different
size (4 amino acids and higher) polypeptides, accommodating tandem
repeats of target polypeptides, providing enhanced immune function,
use as a high throughput screening tool, and use as a delivery tool
for vaccine antigens and disease markers.
SUMMARY OF THE INVENTION
[0005] In the present invention, a novel recombinant protein has
been discovered. It will serve as a carrier molecule for expression
and recovery of useful target polypeptides for use as therapeutic
or preventative agents against infectious diseases or even cancer.
The carrier molecule discovered herein can accommodate polypeptides
of varying sizes (4 amino acids to a 100 kD protein and higher)
(target polypeptides) and can be expressed in different systems.
The target polypeptides can be vaccine antigens
[0006] In a general aspect, the present invention provides a
recombinant carrier molecule having a modified mature polypeptide
of a thermostable enzyme lacking one or more segments of amino
acids or a substantially complete mature polypeptide of the
thermostable enzyme suitable for fusing to a heterologous
polypeptide at each of N-terminus and C-terminus of the mature
polypeptide, and optionally in the loop region. The modified mature
polypeptide and substantially complete mature polypeptide retain
their thermostability and/or enzyme activity. The mature
polypeptide of is modified in that it lacks a loop region or has a
disrupted loop region, or has at least one restriction site in the
loop region not naturally present in the wild type thermostable
enzyme.
[0007] In one preferred embodiment, the carrier molecule discovered
herein is based on lichinase B (licB) gene from Clostridium
thermocellum (accession: X63355, [gi:40697]). The inventors
discovered that this thermostable bacterial enzyme can be used as a
carrier molecule for producing target polypeptides. It has loop
structure exposed on the surface that is located far from the
active domain. It has been discovered by the present inventors that
this loop structure can be used for the insertion of target
polypeptides. The target polypeptides can be expressed as N or C
terminal fusions or internal fusions and/or as inserts into loop
structure. Modified protein is expressed and characterized for any
of the parameters such as thermostability, pH and temperature
conditions for optimal activity. Engineered protein retained its pH
and temperature conditions for optimal activity. It also did not
change its thermostability at 65.degree. C.
[0008] Accordingly, the present invention discloses a recombinant
molecule derived from a thermostable enzyme for use as a carrier
for various heterologous target polypeptides (e.g., vaccines,
hormones, anticoaulants, immunoglobulins, interferons,
interleukins, hematopoietic growth factors, etc). In specific
embodiments, it discloses Rec LicB and LicKM. The carrier protein
(i.e., modified or engineered rec LicB or LicKM linked to one or
more heterologous target polypeptides) is a fusion protein and it
may be expressed in either prokaryotic or eukaryotic systems.
Specifically it has been found that these carrier molecules can
accommodate from small to a large size polypeptides of up to 100 kD
and more, can accommodate tandem repeats of the same polypeptide,
can be expressed in different systems, including bacterial, yeast,
baculovirus, mammalian cell cultures, plants, DNA and virus
vectors, can provide economic advantages for recovery of target
product due to their thermostability or capacity to form
aggregates, can be used as high throughput system for screening
target polypeptides; antigens, disease markers or other therapeutic
polypeptides.
[0009] The present invention also discloses a method for expressing
peptides as fusion proteins, by using a recombinant mature
polypeptide of a thermostable enzyme as the carrier for
heterologous polypeptide(s) and using the peptide expression
methods described herein.
BRIEF DESCRIPTION OF THE DRAWINGS
[0010] FIG. 1. A: Schematic representation of engineering of
recombinant LicKM carrier molecule. l is the loop structure. A
indicates the region upstream of the loop structure. C indicates
the region downstream of the loop structure. To create LicKM, the
gene encoding Lic B was split at the loop region and assembled as
shown. Unique cloning sites were created during engineering. The
nucleic acid sequence for engineered molecule LicKM (SEQ ID NO:1)
is shown in part B of the figure. The split was done by PCR using
specific primers. PCR resulted in 2 subclones (FIG. 1A) designated
as A (159 nucleotides, 364 trough 522) and C (486 nucleotides, 523
trough 1009). In final clone fragment A was cloned downstream of
fragment C preserving the original amino acid composition.
[0011] FIG. 1C shows the construction of Rec LicB from the wildtype
LicB. The Rec LicB consists of mature protein without cellulosome
binding domain. Target sequences can be fused to N and C terminus
as well as into loop structure using BamHI and BglII restriction
sites.
[0012] FIG. 1D shows the nucleic acid sequence for engineered
molecule Rec LicB (SEQ ID NO:2).
[0013] FIG. 1E shows a sequence of amino acids (SEQ ID NO:3)
encoded by LicKM nucleic acid (SEQ ID NO:1).
[0014] FIG. 1F shows a sequence of amino acids (SEQ ID NO:4)
encoded by Rec LicB (SEQ ID NO:2).
[0015] FIG. 1G shows the nucleic acid sequence for a variant of
LicKM carrier molecule (SEQ ID NO:5). It also has a KpnI
restriction site created at the 5' end and XhoI restriction site
created at the 3' end and BamHI/Bgl site in the loop region.
[0016] FIG. 1H shows a sequence of amino acids (SEQ ID NO:6)
encoded by a variant of LicKM carrier molecule (SEQ ID NO:5).
[0017] FIG. 2. Schematic representation of cloning of GFP into the
loop structure of rec Lic B to obtain recombinant Lic B-GFP. The
coding region of GFP was PCR amplified and cloned into the open
reading frame of LicB.
[0018] The cloning was done in 2 steps by PCR. Using primers shown
in FIG. 1 legend, 2 subclones, A and C were created. Then the
sequences encoding GFP were PCR amplified (during PCR at the 5' and
3' ends, BamHI and BglII restriction sites were incorporated,
respectively). Later, using the introduced BamHI and BglII sites,
the 3 fragments were ligated as A-GFP-C to obtain LicB-GFP. Primers
for GFP were:
Plus: 5'gcag gga tcc atg gtg agc aag ggc gag3' (SEQ ID NO:7)
Minus: 5'gcag aga tct ctt gta cag ctc gtc cat3' (SEQ ID NO:8)
[0019] FIG. 3. Zymogram of lichenase activity in bacterial and
yeast extracts detected in the presence of 0.1% lichenan as
substrate. Proteins were separated in 12% PAGE. The gel was loaded
with proteins extracted from E. coli strain XL-1 blue [C control,
LicB (wild type), LicKM (engineered carrier molecule) and
recombinant LicB-GFP (E)] and Saccharromyces cerevisiae strain YPH
857 (LicB-GFP (Y).
[0020] FIG. 4. Schematic representation of cloning of target
polypeptides in engineered carrier molecule LicKM. DNA fragments
encoding target polypeptides from respiratory syncytial virus (RSV)
G protein, green fluorescent protein (GFP) from gely fish, and
human interferon .alpha. (IFN.alpha.) were PCR amplified and
inserted into open reading frame of LicKM.
[0021] FIG. 5. A is zymogram of lichenase activity in bacterial
extracts detected in the presence of 0.1% lichenan as substrate.
Proteins were separated in 12% PAGE. The gel was loaded with
proteins extracted from E. coli strain XL-1 blue. C is a negative
control. LicKM is engineered carrier molecule. LicKM-RSV,
LicKM-GFP, and LicKM-IFN.alpha. are engineered proteins containing
respective target polypeptide. B shows the results of Western blot
analysis. Proteins were separated in 12% PAGE, electroblotted onto
nylon membrane and reacted with monoclonal antibodies specific for
peptide from RSV G protein. Antibodies reacted with LicKM-RSV, RSV
positive control (RSV (C+)) and plant virus coat protein containing
identical peptide (RSV (plant)). Extracts from LicKM that did not
contain target peptide had no specificity to RSV antibodies.
[0022] FIG. 6. RSV G peptide-specific serum antibody (IgG) response
of mice immunized i.p. with LicKM-RSV. Serum antibody responses
were measured by ELISA on plates coated with recombinant AlMV
particles containing identical peptide (amino acids 171 to 191)
from RSV G protein. Data represent OD.sub.490 values obtained using
preimmune (LicKM-RSV Pre) and sera after third dose (LicKM-RSV
Final) of antigen. Numbers 1, 2, 3, and 4 indicates individual
animals.
[0023] FIG. 7. Detection of LicKM-F200 enzymatically (A) and
serologically (B) by Western analysis. Proteins were separated in
12% PAGE. A is zymogram of lichenase activity in plant extracts
detected in the presence of 0.1% lichenan as substrate. LicKM-F200
(F200) reacted with antibodies specific to LicKM. Both methods
detected protein of expected size (47 kD).
[0024] FIG. 8. RSV F protein-specific serum antibody (IgG) response
of mice immunized i.p. with LicKM-F200. Serum antibody response was
measured by ELISA using plates coated with inactivated RSV Long
strain. Data represent OD.sub.490 values obtained using preimmune
(LicKM-F200 Pre) and sera after third dose (LicKM-F200 Final) of
antigen. Numbers 1, 2, 3, and 4 indicates pre and post-immune serum
samples collected from individual animals.
[0025] FIG. 9. Western blot analysis of recombinant LicKM-PAD4.
Proteins were separated electrophoretically (12% SDS-polyacrylamide
gel), transferred to a membrane, and reacted with different
antibodies. All antibodies specific to PA, including monoclonal
antibody 14B7 recognized the LicKM-PAD4 or control PA. AlMV CP or
LicKM, used as negative controls, did not react with any of
antibodies.
DETAILED DESCRIPTION OF THE INVENTION
[0026] The present invention is based on the discovery that
recombinant forms of certain thermostable enzymes can be used as
carriers or carrier molecules for expression, stabilization,
display, purification and/or delivery of various genetically fused
polypeptides of interest (target polypeptides) such as vaccine
antigens, enzymes, antibodies (single chain) and therapeutic
polypeptides.
[0027] The present invention discloses, among other things, (i) a
variety of thermostable carrier molecules derived from thermostable
enzymes and heterologous polypeptide-containing carrier proteins,
(ii) nucleic acid constructs, which can encode recombinant carrier
molecules and carrier proteins of the invention, and cells and
organisms transformed with carrier protein expression constructs,
(iii) methods for producing vaccine antigens in cells and
organisms; (iv) methods for stimulating an immune response in
animals and humans, the immune response being directed toward a
carrier protein, specifically toward target antigen of the present
invention, (v) methods for inducing humoral and cellular responses
against infectious agents using a carrier fusion protein described
below, and (vi) methods for producing various industrial enzymes
(other than the thermostable enzymes) and therapeutic proteins.
[0028] Thermostable enzymes are polypeptides that function at or
greater than 60.degree. C. A number of thermostable enzymes that
are known in the art, can be obtained from thermophilic organisms
found in hot springs, volcanic regions etc. and used as carrier
molecule. Lichinase B (LicB) protein. from Clostridium thermocellum
is one such example of thermostable enzymes. The present invention
encompasses recombinant carrier molecules derived from thermostable
enzymes from natural sources, i.e., any microbial sources (bacteria
and fungi,) or synthetic sources. Examples of such enzymes are
lichenase B (Piruzian et al., 2002, Mol Genet Genoinics, 266:
778-786), xylanase and xylosidase from Bacillus thennactarantis
that are active at 80oC (Calandrelli et al., Res. Microbiol. 2004,
155(4):283-289), formiltransferase from Methanopyrus kandleri
(Shima et al., Biochem Soc. Trans., 2004, 32:269-272), Taq
polymerase, alpha-amylase from Aspergillus tamarii (Moreira et al.,
J. Basic Microbiology, 2004, 44:29-35) or beta-glucosidase from
Thermus nonproteolyticus (Wang et al., J. Bacteriology, 2003,
185:4248-55).]
[0029] The molecular structure of wild type lichenase B (LicB) gene
and protein are well known to one skilled in the art (See, GenBank
Accession Number X63355). The wild type LicB has 27 amino acids
long signal peptide and 235 amino acids long mature peptide. Mature
peptide has a catalytic domain and 12 amino acid (a.a. 82-94) loop
region. LicB is member of glycosyl hydrolases (hydrolases
.beta.glucan in position 1-4) and is a thermostable protein.
Optimum temperature for enzymatic activity is between 65-70.degree.
C. According to 3D structure of the wild type Lic B, the N and C
terminal regions of protein are co-localized in close proximity
from active domain. The external loop is positioned far from active
domain and exposed on the surface.
[0030] The terms "carrier" "carrier molecule" "recombinant carrier
molecule" used interchangeably herein refer to a recombinant
thermostable enzyme used for expression, stabilization, display,
purification and/or delivery of heterologous polypeptide(s)
translationally fused to the recombinant thermostable enzyme. The
thermostable enzyme is recombinant in the sense that it is a
modified mature polypeptide of a selected wild-type thermostable
enzyme. The modified mature polypeptide lacks one or more portions
(or strings or segments) of amino acids but the modified mature
polypeptide must retain its enzymatic activity or thermostability.
For example, the mature polypeptide may lack a loop region or a
sting of 5 or more amino acids. Further, for example, the loop
region of the mature polypeptide is disrupted (i) by introducing
few amino acids coded for by at least one unique restriction site,
and/or (ii) by splitting the gene at its loop region to generate
two portions (N and C-terminal portions) of the mature polypeptide,
which two portions are then reengineered (circularly permutated)
into a single reading frame from C-terminus to N-terminus. As a
result, the original C-terminal portion remain fused upstream of
the original N-terminal portion. During this reengineering, unique
restriction site(s) may be incorporated at 5' and 3' ends as well
as internally including at the site corresponding to the fusion
site. be recombined so that the recombined polypeptide is flanked
at N and C-termini by the disrupted loop portions of or a string of
5 or more amino acids.
[0031] In the context of the present invention, the unique
restriction site means the one introduced into the nucleic acid
during the engineering process and it is the only site present in
the engineered nucleic acid.
[0032] Alternatively, the thermostable enzyme is recombinant in the
sense that it is a complete or substantially complete mature
polypeptide of a selected wild-type thermostable enzyme and the
encoding recombinant nucleic acid sequence has unique restriction
sites at the 5' end and at the 3'end, and optionally in the loop
region for fusion of a heterologous polypeptide at each of
N-terminus and C-terminus, and in the loop region. Upstream of the
unique restriction site at the 5'end, an ATG codon is incorporated.
Downstream of the unique restriction site at the 3'end, a stop
codon is incorporated. One skilled in the art would know how to
create a carrier molecule of the invention by making manipulations
at the nucleic acid level.
[0033] In one embodiment, the wild type licB protein is modified
such that it lacks signal peptide and cellulosome binding domain to
create a recombinant licB carrier molecule with unique cloning
sites introduced into the loop region.
[0034] Referring to LicB shown in FIG. 1C, the wild type LicB
consists of a leader peptide (27 amino acids, indicated as Lp),
mature polypeptide (235 amino acids symbolically divided into 3
regions (A, l and C), Pro-thr-box and cellulosome binding domain
designated as C-BD. Whereas the Rec LicB contains only the open
reading frame for mature protein (235 a. a.) that lacks sequences
for Lp and C-BD. In some embodiments, however, the C-BD is
retained.
[0035] In another embodiment, the wild type licB protein is
modified so that certain regions of it are deleted together and
certain regions of it are shuffled or swapped to create a
recombinant carrier molecule. Specifically, the N and C terminal
regions (designated herein as A and C, respectively) are circularly
permutated. For example a recombinant carrier molecule referred to
herein as LicKM can be created as follows. As described in the
brief description of FIG. 1, sets of primers are used to obtain
fragments A and C which subsequently are ligated as C-A, fusing the
fragment A into the open reading frame of fragment C. LicKM
maintains both enzymatic activity and thermostability similar to
that of wild type.
[0036] The carrier molecules recLicB and LicKM are merely preferred
and exemplary molecules of the enzyme. It should be readily
apparent that a number of variant or equivalent recLicB or LicKM
carrier molecules (and nucleotide sequences coding for equivalent
molecules) having the same or similar or higher thermostability can
be prepared by mutating these preferred carrier molecules, for
example, by deletion, addition or substitution of amino acids or by
directed evolution or gene shuffling of these molecules. One
skilled in the art would know how to carry out such alterations to
arrive at equivalent or variant LicB-based carrier molecules. A
variant carrier molecule, as the term used herein, will have the
same ability, like that of recLicB or LicKM, to facilitate at least
one of expression, stabilization, display, purification or delivery
of a heterologous polypeptide fused to the molecule.
[0037] A variant or equivalent carrier molecule will have a degree
of amino acid similarity or identity with the exemplified preferred
molecule (e.g., LicKM or Rec LicB). This amino acid similarity or
identity will typically be greater than 60%, preferably be greater
than 75%, more preferably greater than 80%, yet more preferably
greater than 90%, and can be greater than 95%. The amino acid
similarity or identity will be highest in critical regions of the
carrier molecule that account for the molecule's thermostability or
are involved in the determination of three-dimensional
configuration which ultimately is responsible for its carrier
function. In this regard, certain amino acid substitutions are
acceptable and can be expected if these substitutions are in
regions that are not critical to activity or are conservative amino
acid substitutions which do not affect the three-dimensional
configuration of the molecule. Conservative substitutions whereby
an amino acid of one class (non-polar such as Ala, Val, Leu, Ile,
Pro, Met, Phe, Trp; uncharged polar such as Gly, Ser, Thr, Cys,
Tyr, Asn, Gln; basic such as Lys, Arg, His; or acidic class such as
Asp, Glu) is replaced with another amino acid of the same class so
long as the substitution does not materially alter the
thermostability or three-dimensional configuration. In some
instances, non-conservative substitutions can also be made. The
critical factor is that these substitutions must not significantly
detract from the ability of "variant carrier molecule" to
facilitate at least one of expression, stabilization, display,
purification or delivery of a heterologous polypeptide.
[0038] The term "carrier fusion protein or carrier protein" as used
herein generally refers to a chimeric fusion polypeptide or protein
wherein one more heterolgous polypeptides are fused to the carrier
molecule.
The general architecture of the carrier protein can be, for
example, any of the following:
NH.sub.2-carrier molecule-heterologous polypeptide-COOH
NH.sub.2-tag-cleavage site-carrier molecule-heterologous
polypeptide-COOH
NH.sub.2-carrier molecule-cleavage site-heterologous
polypeptide-COOH
NH.sub.2-tag-carrier molecule-cleavage site-heterologous
polypeptide-COOH
NH.sub.2-tag-cleavage site-carrier molecule-heterologous
polypeptide-COOH
[0039] The carrier molecule may also have an internal fusion, in
which case the heterlogous polypeptide is flanked on either side by
a segment of the recombinant carrier molecule. The carrier protein
exhibits a high degree of thermotolerance (at least at about
60.degree. C.) which facilitates separation of the fusion protein
from all other host cell proteins, nucleic acids, pyrogens, and the
like after subjecting the lysate to heat and/or centrifugation.
Fusion of heterologous polypeptide(s) either at N-terminus or
C-terminus or internally) of a carrier molecule may not result in
loss of enzymatic activity and thermostability.
[0040] A tag may also be linked to the carrier molecule or carrier
protein as a tool for purification. The tag will serve as an
additional tool for purification of the carrier molecule or carrier
protein. The tag may also serve as fall back tool for purification.
The tag refers to a peptide used for facilitating purification of a
fusion protein prepared through expression by gene recombination.
It is preferred that the bonding between a tag and a substance
capable of binding thereto is reversible. The tag can be, for
example, glutathione S-transferase with affinity for glutathione, a
peptidic sequence of histidine residues where histidine has an
affinity for a metal, and the like known in the art. In one
preferred embodiment of the invention, such a tag is His His His
His His His (SEQ ID NO:2) (i.e., (His.sub.6). In the present
invention, one more linker sequences may be positioned in the
carrier protein as needed.
[0041] As used herein, the term "heterologous polypeptide or
protein" refers to a polypeptide or protein of interest (for
therapeutc, diagnostic or preventative use) that is encoded by
nucleic acid introduced into a host cell. The term heterologous
polypeptide or protein does not include a thermostable enzyme or
domains of a thermostable enzyme or its signal peptide. The
heterologous polypeptide for purposes of this invention denotes a
polypeptide of up to 100 kDa and higher and it generally refers to
a polypeptide which is not endogenous to the host selected,
although this definition will also include endogenous peptides in
cases in which overexpression of such is desired. In addition,
heterologous polypeptide will also exhibit some form of useful
activity, typically either antigenic activity for use in
recombinant vaccines and/or immunological assays or other
biological activity (for example as a peptide hormone, biological
marker etc).
[0042] The heterologous polypeptides include growth factors,
cytokines, ligands, receptors and inhibitors, as well as antigenic
determinants and antibodies. Heterologous proteins may also include
enzymes such as hydrolases including carbohydrases, and lipases.
Representative polypeptides within the scope of the invention
include, without limitation, GFP, IFN.alpha., antigens (or
epitopes) such as from tetanus toxin, anthrax, measles virus,
Mycobacterium tuberculosis, plague, and monoclonal antibodies
specific for RSV, insulin, and the like.
[0043] In addition other peptides or proteins (or fragments
thereof) such as epitopes from cytokines, e.g., interleukin-2
(IL-2), or granulocyte-macrophage colony stimulating factor
(GM-CSF) or peptides containing both T cell and B cell epitopes may
also be used to recruit various effector systems of the immune
system, as required. For example, based upon the available
nucleotide sequences of the target pathogen, one can clone computer
generated open reading frames, express the target polypeptides in
an appropriate system and screen them using material from infected
individuals. Target polypeptides selected based on their
immunoreactogenicity can be used for developing vaccine candidates,
therapeutic or diagnostic reagents. The screening could provide
highly time efficient and potent method and would be particularly
important if one has to keep pace with emerging pathogens or
disease out brakes such as SARS. Further, the carrier molecule can
be used to determine appropriate vaccine antigens for developing
efficacious vaccine against pathogens such as SARS, tuberculosis as
well as subunit vaccines (e.g., against hepatitis B using surface
antigen).
[0044] One or more cleavage sites can be introduced between the
carrier molecule and the heterologous polypeptide depending on the
location of the heterologous polypeptide in the carrier protein.
Thus can facilitate further purification of the target
polypeptides. It may also provide advantages over current protein
synthesis methodologies, which result in much reactant and solvent
toxic waste which must be disposed of.
[0045] For example, any of a number of prior art known cleavage
sites specific to proteases or other such enzymes or chemicals
useful in the efficient hydrolysis of peptide bonds may be
introduced. Proteases that are active both as endo- and
exopeptidases are known in the art. For example, protease specific
cleavage site can be introduced into a recombinant LicKM carrier
protein such that the LicKM carrier molecule has at its N-terminus
a poly His tag and at its C-terminus the cleavage site followed by
a target polypeptide such as an antigenic determinant and/or a
therapeutic polypeptide of interest (e.g., interferon).
[0046] In some embodiments, for improving qualitative and
quantitative parameters of target polypeptides, secretory signal
sequences may be added. The use of leader sequences or secretory
signal sequences are only optional, not necessary, for practicing
the present invention. For example, one can construct recombinant
vectors containing carrier protein with a leader sequence such as
to direct the secretion of heterologous proteins into the medium
used to culture various host cells.
[0047] Such a system would enable homogenous synthesis of the
recombinant protein and the system would allow easy scaling-up and
subsequent downstream processing, for example, purification. Such
modifications have been made to a number of proteins known in the
art.
[0048] The heterologous polypeptides can be fused to the carrier
molecule framework as outlined above, whether at a single location
or non-contiguous locations. Generally speaking, in the context of
carrier proteins as vaccines, heterologous polypeptides or a
sequence of amino acids containing one or more epitopes (i.e.,
epitope-containing segments having two or more identical or
non-identical epitopes), which can stimulate an immune response
that protects or prevents against an infectious disease or allergic
reactions are candidate polypeptides. The use of an
epitope-containing segment in which two or more distinct epitopes
are displayed is preferred when attempting to create bifunctional
antibodies for experimental, diagnostic or therapeutic uses. The
heterologous polypeptides may contain epitopes that can be B cell
epitopes, T cell epitopes or a mixture of B and T cell epitopes. In
some contexts, preferred epitopes are B-cell epitopes which are
known to be a target for neutralizing antibodies.
[0049] A preferred embodiment of the present invention relates to a
carrier protein having the recombinant carrier molecule fused to
two or more non-contiguous epitope-containing heterologous
polypetide segments. The non-contiguous locations where fusion is
appropriate are internal locations within the carrier protein
moiety including the loop region, or at the N- or C-terminus of the
recombinant carrier molecule.
[0050] It has been found in the present invention that insertions
and substitutions can be made within these loop regions without
disrupting the integrity of the carrier molecule or abolishing the
features which make the recombinant thermostable enzymes a useful
carrier for the delivery expression various polypeptides or display
of epitope containing heterologous polypeptides. Insertions and
substitutions within these loop regions tend not to alter the
relationships between the prominent structural features of the
carrier molecule. One skilled in the art would know how to create a
carrier protein of the invention by making manipulations at the
nucleic acid level.
[0051] In some embodiments, the carrier protein will have cleavage
sites such that the heterologous polypeptides fused to the
C-terminus, N-terminus and/or internally of a recombinant carrier
molecule of the invention can be cleaved off by specific proteases
in vivo or in vitro. This allows the peptide to be administered to
a cell as part of a larger fusion protein which is both easier to
purify and handle as compared to free heterologous polypeptide.
Following cellular uptake, the heterologous polypeptide attached to
the carrier molecule can be cleaved from the molecule.
[0052] One skilled in the art would know how to create a carrier
protein of the invention by making manipulations at the nucleic
acid level. Construction of suitable vectors containing the desired
coding and control sequences employs standard ligation and
restriction techniques which are well understood in the art.
Isolated plasmids, DNA sequences, or synthesized oligonucleotides
are cleaved, tailored and religated in the form desired. Virus
vectors such as plant, insect and mammalian virus vectors or
bacterial plasmids can be used as vectors.
[0053] As representative examples of expression vectors can be
viral particles, plasmids, cosmids, bacterial artificial
chromosomes, viral DNA (e.g. vaccinia, adenovirus, foul pox virus,
pseudorabies and derivatives of SV40), yeast plasmids, yeast
artificial chromosomes, and any other vectors specific for specific
hosts of interest (such as bacteria, yeast and other fungi, plants,
etc.) Thus, for example, the DNA may be included in any one of a
variety of expression vectors for expressing the recombinant
carrier protein. Large numbers of suitable vectors are known to
those of skill in the art, and are commercially available. The
following vectors are provided by way of example; Bacterial: pQE70
(Qiagen), pBluescript SK, pBluescript KS (Stratagene); pTRC99a,
pRIT2T (Pharmacia); Eukaryotic: pWLNEO, pXT1, pSG (Stratagene)
pSVK3, pSVLSV40 (Pharmacia). Any other plasmid or vector may be
used as long as they are replicable and viable in the host.
[0054] The recombinant DNA capable of encoding carrier protein may
be inserted into the vector by a variety of procedures. In general,
the DNA sequence is inserted into an appropriate restriction
endonuclease site(s) by procedures known in the art.
[0055] The DNA sequence in the expression vector is operatively
linked to an appropriate expression control sequence(s) or a
promoter to direct mRNA synthesis. Promoters used in the present
invention can be ubiquitous or constitutive and/or tissue specific
promoters from prokaryotic and eukaryotic organisms. Examples of
constitutive promoters are CaMV 35S promoter, the nopaline synthase
promoter, the octopine synthase promoter, the
ribulose-1,5-bisphosphate carboxylase promoter, Act1, SAM synthase
promoter, and Ubi promoter and the promoter of the chlorophyll a/b
binding protein. Examples of tissue specific promoters are potato
protease inhibitor II (pin2) gene promoter, napin gene promoter,
cruciferin gene promoter, beta-conglycinin gene promoter, phaseolin
gene promoter, zein gene promoter, oleosin gene promoter, acyl
carrier protein stearoyl-ACP desaturase gene promoter, a fatty acid
desaturase gene promoter, glycinin, Bec4 and promoters from a
number of nodule genes. A number of such promoters are known in the
art. Inducible promoters that specifically respond to certain
chemicals (copper etc.,) or heat-shock (HSP) are also contemplated.
In addition, the promoters also include artificial sequences
designed to function as promoters. Selection of the appropriate
vector and promoter is well within the level of ordinary skill in
the art. The expression vector also contain other appropriate
control sequences or other regions for facilitating transcription
and translation and selection.
[0056] The expression vector may be introduced into a suitable host
The host cell can be a eukaryotic cell, such as a mammalian cell,
plant cell or a yeast cell or the host cell can be a prokaryotic
cell, such as a bacterial cell. Plant and animal cell cultures can
also be used to produce carrier proteins of the invention. The
selection of an appropriate host is deemed to be within the scope
of those skilled in the art from the teachings herein. Preferred
host cells are plant cells and organisms are plants. Introduction
of the construct into the host cell can be effected by
transformation, calcium phosphate transfection, DEAE-Dextran
mediated transfection, or electroporation or other methods known in
the art.
[0057] Depending on the host cell used, transformation is
accomplished using standard techniques appropriate to such cells.
The calcium treatment employing calcium chloride, which is known in
the art, can be used. for prokaryotes or other cells which contain
substantial cell wall barriers. Transformations into yeast are
carried out according to the methods known in the art. For
mammalian cells without cell walls electroporation or DNA uptake
methods can be used. Insect cells known and routinely used for
protein expression purposes are also used as host cell in the
present invention. Infection with Agrobacterium tumfaciens is used
for certain plant cells. Accordingly, in the methods of the
invention, plant of interest is transformed with a vector
containing the carrier protein of interest to produce a transgenic
plant. Agrobacterium-based transformation methods may be used to
produce transgenic plants. Several other methods for stable
transformation of plants are available in the art (see, Piruzian et
al., 2002, Mol Genet Genomics 266:778-786, which is incorporated
herein by reference). In the present invention, the RecLicB and
LicKM constructs containing several target antigens, including RSV
peptide and hepatitis B surface antigen can be expressed in
plants.
[0058] The carrier protein of the present invention may also be
expressed from a suitable viral vector after infecting a host plant
with the selected viral vector. Recombinant viral vectors can be
constructed by manipulating the genomic component of the wild-type
viruses. Preferred viruses are RNA containing plant viruses.
Although many plant viruses have RNA genomes, it is well known that
organization of genetic information differs among groups. Thus, a
virus can be a mono-, bi-, tri-partite virus. "Genome" refers to
the total genetic material of the virus. "RNA genome" states that
as present in virions (virus particles), the genome is in RNA
form.
[0059] Some of the viruses which meet this requirement, and are
therefore suitable, include Alfalfa Mosaic Virus (AlMV),
ilarviruses, cucumoviruses such as Cucumber Green Mottle Mosaic
virus (CGMMV), closteroviruses or tobamaviruses (tobacco mosaic
virus group) such as Tobacco Mosaic virus (TMV), Tobacco Etch Virus
(TEV), Cowpea Mosaic virus (CMV), and viruses from the brome mosaic
virus group such as Brome Mosaic virus (BMV), broad bean mottle
virus and cowpea chlorotic mottle virus. Additional suitable
viruses include Rice Necrosis virus (RNV), and geminiviruses such
as tomato golden mosaic virus (TGMV), Cassava latent virus (CLV)
and maize streak virus (MSV). Each of these groups of suitable
viruses are well characterized and are well known to the skilled
artisans in the field. A number of recobminant viral vectors have
been used by those skilled in the art to transiently express
various polypeptides in plants. See, for example, U.S. Pat. Nos.
5,316,931 and 6,042,832; and PCT International Publication, WO
00/46350, WO 96/12028 and WO 00/25574, the contents of which are
incorporated herein by reference. Thus, the methods already known
in the art can be used as a guidance to develop recombinant viral
vectors of the present invention to deliver transacting
factors.
[0060] The recombinant viral vector used in the present invention
can be heterologous virus vectors. The heterologous virus vectors
as referred to herein are those having a recombinant genomic
component of a given class of virus (for example TMV) with a
movement protein encoding nucleic acid sequence of the given class
of virus but coat protein (either a full-length or truncated but
functional) nucleic acid sequence of a different class of virus
(for example AlMV) in place of the native coat protein nucleic acid
sequence of the given class of virus. Likewise, native movement
protein nucleic acid sequence instead of the coat protein sequence
is replaced by heterologous (i.e. not native) movement protein from
another class of virus. For example, a TMV genomic component having
an AlMV coat protein is one such heterologous vector. Similarly, an
AlMV genomic component having a TMV coat protein is another such
heterologous vector. The vectors are designed such that these
vectors, upon infection, are capable of replicating in the host
cell and transiently expressing the carrier protein in the host
cell.
[0061] In an aspect of the invention, both viral vectors and
tansgenic plants are used to express the carrier proteins of the
present invention in cells of a host plant by taking advantage of a
transactivation system is provided. The transactivation system has
two components: (i) a transgenic plant and (ii) a recombinant viral
vector. The genetically transformed cells of the host plant having
integrated into their nuclear genome, an inactive or silenced
carrier protein encoding nucleic acid sequence, are capable of
encoding the carrier protein only upon activation of the silenced
sequence. To activate the silenced sequence, a recombinant RNA
viral vector is used that is capable of infecting the cells of the
host plant and encoding therein a factor for activating the
expression of inactive or silenced carrier protein nucleic acid
sequence.
[0062] The carrier protein encoding nucleic acid sequence may be
silenced by placing a blocking sequence between promoter sequence
and the carrier protein encoding nucleic acid sequence. The
blocking sequence (e.g., a selectable marker element or any other
nucleic acid sequence (stuffer) should be sufficient enough to
block the promoter's ability to drive expression of the gene. The
blocking sequence must be flanked on each side by a recombinase
target site (e.g., "FRT" site) with a defined 5' to 3' orientation.
The FRT refers to a nucleic acid sequence at which the product of
the FLP gene, i.e., FLP recombinase, can catalyze the site-specific
recombination. In addition to the genomic elements necessary for
infection, replication, movement and spread of the viral vectors,
the vectors contain sequences encoding a recombinase (e.g., FLP) or
other factor (e.g., GAL4-VP16) to activate the silenced carrier
protein encoding nucleic acid sequence.
[0063] In accordance with the present invention, the host plants
included within the scope of the present invention are all species
of higher and lower plants of the Plant Kingdom. Mature plants,
seedlings, and seeds are included in the scope of the invention. A
mature plant includes a plant at any stage in development beyond
the seedling. A seedling is a very young, immature plant in the
early stages of development. Specifically, plants that can be used
as hosts to produce foreign sequences and polypeptides include and
are not limited to Angiosperms, Bryophytes such as Hepaticae
(liverworts) and Musci (mosses); Pteridophytes such as ferns,
horsetails, and lycopods; Gymnosperms such as conifers, cycads,
Ginkgo, and Gnetales; and Algae including Chlorophyceae,
Phaeopbpyceae, Rhodophyceae, Myxophyceae, Xanthophyceae, and
Euglenophyceae.
[0064] Host plants used for the production of carrier proteins can
be grown either in vivo and/or in vitro depending on the type of
the selected plant and the geographic location. It is important
that the selected plant is amenable to cultivation under the
appropriate field conditions and/or in vitro conditions including
cell culture.
[0065] Among angiosperms, the use of crop and/or crop-related
members of the families are particularly contemplated. The plant
members used in the present methods also include interspecific
and/or intergeneric hybrids, mutagenized and/or genetically
engineered plants. These families include and not limited to
Leguminosae (Fabaceae) including pea, alfalfa, and soybean;
Gramineae (Poaceae) including rice, corn, wheat; Solanaceae
particularly of the genus Lycopersicon, particularly the species
esculentum (tomato), the genus Solanum, particularly the species
tuberosum (potato) and melongena (eggplant), the genus Capsicum,
particularly the species annum (pepper), tobacco, and the like;
Umbelliferae, particularly of the genera Daucus, particularly the
species carota (carrot) and Apium, particularly the species
graveolens dulce, (celery) and the like; Rutaceae, particularly of
the genera Citrus (oranges) and the like; Compositae, particularly
the genus Lactuca, and the species sativa (lettuce), and the like
and the Family Cruciferae, particularly of the genera Brassica and
Sinapis. Examples of "vegetative" crop members of the family
Brassicaceae include, but are not limited to, digenomic tetraploids
such as Brassica juncea (L.) Czern. (mustard), B. carinata Braun
(ethopian mustard), and monogenomic diploids such as B. oleracea
(L.) (cole crops), B. nigra (L.) Koch (black mustard), B.
campestris (L.) (turnip rape) and Raphanus sativus (L.) (radish).
Examples of "oil-seed" crop members of the family Brassicaceae
include, but are not limited to, B. napus (L.) (rapeseed), B.
campestris (L.), B. juncea (L.) Czern. and B. tournifortii and
Sinapis alba (L.) (white mustard). Flax plants are also
contemplated.
[0066] Particularly preferred host plants are those that can be
infected by AlMV. For example, it is known in the art that alfalfa
mosaic virus has full host range. Other species that are known to
be susceptible to the virus are: Abelmoschus esculentus, Ageratum
conyzoides, Amaranthus caudatus, Amaranthus retroflexus,
Antirrhinum majus, Apium graveolens, Apium graveolens var.
rapaceum, Arachis hypogaea, Astragalus glycyphyllos, Beta vulgaris,
Brassica campestris ssp. rapa, Calendula officinalis, Capsicum
annuum, Capsicum frutescens, Caryopteris incana, Catharanthus
roseus, Celosia argentea, Cheiranthus cheiri, Chenopodium album,
Chenopodium amaranticol, Chenopodium murals, Chenopodium quinoa,
Cicer arietinum, Cichium endiva, Ciandrum sativum, Crotalaria
spectabilis, Cucumis melo, Cucumis sativus, Cucurbita pepo,
Cyamopsis tetragonoloba, Daucus carota (var. sativa), Dianthus
barbatus, Dianthus caryophyllus, Emilia sagittata, Fagopyrum
esculentum, Glycine max, Gomphrena globosa, Helianthus annuus,
Lablab purpureus, Lactuca sativa, Lathyrus odatus, Lens culinaris,
Linum usitatissimum, Lupinus albus, Lycopersicon esculentum,
Macroptilium lathyroides, Malva parvifla, Matthiola incana,
Medicago hispida, Medicago sativa, Melilotus albus, Nicotiana
bigelovii, Nicotiana clevelandii, Nicotiana debneyi, Nicotiana
glutinosa, Nicotiana megalosiphon, Nicotiana rustica, Nicotiana
sylvestris, Nicotiana tabacum, Ocimum basilicum,
Petunia.times.hybrida, Phaseolus lunatus, Phaseolus vulgaris,
Philadelphus, Physalis flidana, Physalis peruviana, Phytolacca
americana, Pisum sativum, Solanum demissum, Solanum melongena,
Solanum nigrum, Solanum nodiflum, Solanum rostratum, Solanum
tuberosum, Sonchus oleraceus, Spinacia oleracea, Stellaria media,
Tetragonia tetragonioides, Trifolium dubium, Trifolium hybridum,
Trifolium incarnatum, Trifolium pratense, Trifolium repens,
Trifolium subterraneum, Tropaeolum majus, Viburnum opulus, Vicia
faba, Vigna radiata, Vigna unguiculata, Vigna unguiculata ssp.
sesquipedalis, and Zinnia elegans.
[0067] In an aspect, the present invention also includes methods
for stimulating an immune response in an animal. The use of carrier
protein of the invention to stimulate immune response is described
in more detail in the following Examples section. Specifically, the
experiments demonstrate, for example, that the immunogenic
heterologous polypeptides containing B-cell and T-cell epitopes in
the carrier fusion protein stimulated pathogen specific immune
responses. Surprisingly, the target specific immunogenicity of
antigenic determinants fused to carrier molecule of the present
invention is significantly superior to that of antigenic
determinants administered alone without the carrier molecule.
Further, the experiments demonstrate that it is possible to
generate a humoral immune response to an internally inserted
epitope-containing polypeptide segments Although the in vivo data
reported herein were generated in experiments employing murine
assays for the generation of antibodies against the carrier
proteins, the fundamental principles are applicable to humans as
well as other animals such as rabbits, pigs, goats, monkeys and
chimpanzees. Given the disclosure of the subject application and
the general knowledge of one skilled in the art, it is a matter of
routine experimentation to select heterologous polypeptides of
interest and incorporate such polypeptides of interest into a
carrier molecule for use as an immunogen. One of skill in the art
can identify heterologous polypeptides with B-cell epitopes which
have the ability to drive a strong humoral immune response
following administration to an animal. The B-cell epitope which is
selected will depend upon the intended use of the carrier protein.
For instance, if the carried protein is to be used as a vaccine,
the heterologous polypeptides can be derived from a protein which
is expressed by a virus, bacteria or other infectious organism
associated with causing a disease. The heterologous polypeptide,
which is selected, should be one which contains epitopes which
elicit strong immune responses. In general, this will include
proteins found on the surface of the infectious organism which are
involved in binding and to which antibodies have a high degree of
access.
[0068] The selection of immunogenic heterologous polypeptides is
not limited to proteins associated with infectious organisms. For
instance, the carrier protein containing an internally (or at the N
or C-terminus) inserted polypeptide from a prostate-specific
antigen may be used to induce a strong immune response. One of
skill in the art will recognize that any heterologous polypeptide
containing one or more B-cell or T-cell epitopes, which is capable
of driving a humoral immune response can be included as part of the
carrier protein of the present invention. Many such heterologous
polypeptides are known and others can be determined through routine
experimentation.
[0069] In some instances, it is desired to stimulate cytotoxic
T-cells as part of a cellular immune response. In such instances,
heterologous polypeptides with T-cell epitopes are fused to the
carrier molecule, preferably inserted internally within the
carrier. Cytotoxic T-cells play an important role in the
surveillance and control of viral infections, bacterial infections,
parasitic infections and cancer, for example. protocols of T-cell
activation allow the triggering of more selective cytotoxic T-cell
responses with greater therapeutic effectiveness.
[0070] Generally, the fusion of peptides to the C-terminus of
carrier molecule with a cleavage site in between, may generate a
desirable construct, which is cleavable, in vivo, by the
recombinant carrier protein-specific cleavage agent. The carrier
protein-specific cleavage agent (e.g., proteases) cleaves carrier
protein fusion after a C-terminal residue thereby releasing the
C-terminal peptide.
[0071] Thus, the carrier protein based vaccine can be used to drive
a cellular and/or humoral immune response depending on the type of
heterologous polypeptides fused to the carrier protein. The
therapeutic amount of the carrier protein given to an animal
species will be determined as that amount deemed effective in
eliciting the desired immune response. The carrier protein is
administered in a pharmaceutically acceptable or compatible carrier
or adjuvant. Accordingly, the present invention also encompasses
pharmaceutical compositions for the administration of carrier
proteins. Examples of specific diseases which can be treated in
this manner include, for example, infection with HIV, cancer,
gastrointestinal diseases, respiratory infections etc. The
pharmaceutical compositions are prepared by methods known to one of
skill in the art. In general, the carrier protein is admixed with a
carrier and other necessary diluents which are known in the art to
aid in producing a product which is stable and administrable.
Administration of the pharmaceutical composition can be
accomplished by several means known to those of skill in the art.
These include, i.p., oral, intradermal, subcutaneous, intranasal,
intravenous or intramuscular. Typically patients to be treated are
dosed subcutaneously with the carrier proteins once per week for
several weeks. However, dosing can also be done orally or
intranasally over a similar length of time. The result is a
reduction of the allergic and/or autoimmune responses.
[0072] In addition to the conventional vaccination methods, the
present invention can be used for DNA vaccination. In this method,
DNA encoding the appropriate carrier protein is introduced into the
cells of an organism. Within these cells, the epitope-containing
carrier protein is directly expressed. Direct expression of the
carrier proteins of the present invention by endogenous cells of a
vaccinated animal allows for the continual stimulation of humoral
and cellular immune responses over an extended period of time.
Direct expression can be accomplished by introducing DNA constructs
which encode the desired carrier protein into the cells of an
animal. The constructs typically contain promoter elements and
other transcriptional control elements which direct the expression
of the carrier protein. Introduction of the DNA construct can be by
any conventional means including direct injection. The preferred
administration site is muscle tissue. This direct expression is in
contrast to standard immunization protocols whereby the vaccine is
injected at a single site one or more times. Following injection,
the vaccine is disseminated to lymphoid organs where a single
immune response occurs.
EXAMPLES
[0073] The examples presented below are provided as a further guide
to one of ordinary skill in the art, and are not to be construed as
limiting the invention in any way.
Example 1
Construction of Carrier Molecules and Carrier Proteins
[0074] This example addresses construction of the carrier protein
expression vector for expression in prokaryotic and eukaryotic
cells.
[0075] Shown in FIG. 1 is a schematic representation of engineering
of recombinant carrier molecules LicKM and recLicB. Letter "l"
indicates the loop structure, A indicates the region (domain)
upstream of the loop structure and C indicates the region (domain)
downstream of the loop structure. To create LicKM the gene encoding
a mature Lic B was split at the loop region and assembled as shown.
Unique cloning sites were created during engineering. The sequence
for the engineered gene (LicKM) is shown in part B of FIG. 1.
[0076] The LicKM was created in 2 step PCR cloning. 5 and 3'
primers were used to amplify the lic B gene into 2 fragments
designated as A (159 nucleotides of the lic B gene, 364 trough
522); and C (486 nucleotides of the lic B gene, 523 trough 1009).
In the final clone, fragment A was cloned downstream of fragment C
preserving the original amino acid composition.
[0077] The following are the specific primers used TABLE-US-00001
Fragment C: 5' primer: (SEQ ID NO:10) 5'gga tcc ATG GGC GGT TCA TAT
CCG TAT-3' 3' primer: (SEQ ID NO:11) 5'g cag aga TCT ATA TTC CCT
GTC AAG GGT-3' Fragment A: 5' primer: (SEQ ID NO:12) 5'aga tcc ATG
GTG GTA AAT ACG CCT TTT-3' 3' primer: (SEQ ID NO:13) 5'g cac aga
TCT ACC GTT AGG ATA GTA TTT TAC-3'.
[0078] Shown in FIG. 1C is a schematic of construction of rec LicB
from the wildtype LicB.
Example 2
Cloning and Expression of GEP Using recLic B
[0079] The recLic B was symbolically divided into 3 regions as
shown in the FIG. 2; l is the loop structure. The region (domain)
upstream of the loop structure is indicated as A and downstream of
loop structure is indicated as C. To use the recLic B as a carrier
molecule unique cloning sites (BamHI and BglI) were introduced into
the loop region of the gene. The gene encoding GFP (green
fluorescent protein) was cloned into the loop region of recLic B to
obtain recLic B-GFP (FIG. 2). The recombinant protein was expressed
using both Esherichia coli and yeast expression system (FIG. 3).
Target polypeptides can be inserted not only into the loop
structure as it is shown in this example but can also be fused to
the N or C terminus of carrier protein.
Example 3
Fermentation and Carrier Protein Recovery
[0080] E. coli dH5 alpha cells transformed with recLic B-GFP
constructs were cultured or fermented by overnight culturing
process in LB media. The fermentation was continued for 12 h and
harvested at a cell density of 10.sup.4. Two liters of cell culture
or fermentation broth were divided into 1 liter containers/
/bottles and centrifuged at 10,000 rpm for 30 min in a centrifuge.
The supernatant was discarded and the pellet was used to recover
the carrier protein.
Example 4
Cloning and Expression of Various Target Polypeptides Using the
Engineered LicKM
[0081] This example addresses the cloning and expression of the
following three target polypeptides using the engineered LicKM:
[0082] a. Peptide from G protein of respiratory syncytial virus (24
a.a.)
[0083] b. GFP (27 kD)
[0084] c. IFN.alpha..(19 kD)
[0085] To demonstrate the capacity of engineered LicKM as a carrier
molecule, 3 constructs were created where the target sequences
polypeptides (a) fragment of DNA encoding 24 amino acid peptide
from respiratory syncytial virus G protein, (b) open reading frame
of GFP or (c) open reading frame of human interferon .alpha. were
PCR amplified and cloned into the open reading frame of engineered
LicKM as shown in FIG. 4. These three engineered target
polypeptides were expressed in E. coli as shown in FIG. 5 and yeast
(data not shown). Shown in FIG. 5A is a zymogram of lichenase
activity in bacterial extracts detected in the presence of 0.1%
lichenan as substrate. Proteins were separated in 12% PAGE. The gel
was loaded with proteins extracted from E. coli strain XL-1 blue. C
is a negative control. LicKM is engineered carrier molecule.
LicKM-RSV, LicKM-GFP, and LicKM-IFN.alpha. are engineered proteins
containing respective target polypeptide. FIG. 5B shows the results
of Western blot analysis. Proteins were separated in 12% PAGE,
electroblotted onto nylon membrane and reacted with monoclonal
antibodies specific for peptide from RSV G protein. Antibodies
reacted with LicKM-RSV, RSV positive control (RSV (C+)) and plant
virus coat protein containing identical peptide (RSV (plant)).
Extracts from LicKM that did not contain target peptide had no
specificity to RSV antibodies.
Example 5
Immunization of Mice with LicKM-RSV Containing 24 Amino Acid
Peptide from RSV G Protein
[0086] Eight-week-old female balB/c mice were immunized with 200
.mu.g per dose of recombinant LicKM-RSV engineered to express the
24 amino acid (171-191 of G protein) of RSV G protein (Johnson et
al., 2004, J Virol. 2004 June;78(11):6024-32). Three immunizations
of 0.1 ml were administered intra-peritoneally at intervals of 2
weeks (first dose with complete Freund's adjuvant (CFA) at a 1:1,
vol:vol ratio, second dose with incomplete Freund's adjuvant (CFA)
at a 1:1, vol:vol ratio and third dose without any adjuvant). An
equal quantity of LicKM was used as a control. Samples of
pre-immune sera were collected 1 day before first dose of antigen.
Twelve (12) days after each immunization serum samples were
obtained from individual mice and RSV-specific antibody titers
assessed. Antigen-specific antibody analysis of serum was performed
using a solid phase enzyme-linked immunoabsorbant assay (ELISA).
ELISA plates (Nunc Polysorp, Denmark) were coated with 100 .mu.l
per well (1.0 .mu.g per well) of Recombinant AlMV containing
identical peptide from RSV G protein (10 .mu.g/ml in
Phosphate-buffered saline) overnight at room temperature (RT; about
25 'C). Coated plates were washed 3.times. with PBS-Tween (0.05%)
and then blocked with 0.5% of I-block (Tropix) in PBS-Tween at RT
for at least 1 hour. A series of dilutions of sera were added to
the plates (30 .mu.l/well) for 2 to 4 hours at RT. The plates were
then washed 3.times. with PBS-Tween and peroxidase-conjugated
secondary antibodies (goat anti-mouse IgG, either whole molecule or
gamma chain specific), were added (100 .mu.l per well) at a final
dilution of 1:10,000 in PBS-Tween, for 1 hour at RT. Plates were
then washed 5.times. with PBS-Tween and OPD (Sigma Fast.TM.)
substrate added (100 .mu.l/well) in phosphate-citrate buffer
containing urea, for 30 min at RT in the dark. The reaction was
stopped with 2M H.sub.2SO.sub.4 (50 .mu.l per well) and the color
change resulting from bound specific antibody measured at 490 nM in
an ELISA plate-reader (Spectramax Plus.sup.384). The results,
expressed in O.D. units, are shown in FIG. 6.
Example 6
Engineering and Experimental Immunization of Mice with LicKM-F200
Containing 200 Amino Acid Portion of RSV F Protein
[0087] Engineering of LicKM-F200 was carried out as follows: As
template DNA, plasmid DNA containing cDNAs for F, G, and M genes of
RSV obtained from National Institute of Health, USA, was used
(Johnson et al., 2004, J Virol. 2004 June;78(11):6024-32).
[0088] For cloning a portion of F gene encoding amino acids 324 to
524 was amplified using 5'-GCAC AGATCT GGGTCCAACATCTGTTTAAC-3' (SEQ
ID NO:14). and 5'-GCAC AAGCTT ATTTGTGGTGGATTTACCA-3' (SEQ ID
NO:15). as 5' and 3' primers. PCR amplified fragment was digested
and cloned into final vector using unique restriction sites
introduced during PCR reaction (BglII site at 5'- and HindIII at
3'-end, respectively). Target DNA was cloned into E. coli,
agrobacterial and plant virus expression vectors. Results described
in this example obtained using LicKM-F200 where target gene is
cloned and expressed plant virus vector D4.
[0089] For expression, plants were inoculated with in vitro
synthesized transcripts of LicKM-F200. Plant inoculations were
carried out using the prior art known procedures. See, PCT
International Publication, WO 00/46350 for guidance on infectious
RNA transcripts and procedures for viral infection. Two weeks after
inoculation samples were collected for analysis of target protein
expression as well as recovery. Recombinant protein maintained
enzymatic activity (FIG. 7A) and was recognized by antibodies
specific to LicKM (FIG. 7B).
[0090] For stimulating immune response, eight-week-old female
balB/c mice were immunized with 200 .mu.g per dose of recombinant
LicKM-F200 engineered to express the 200 amino acids (amino acid
324 to 524 of F protein) of RSV F protein. Three doses of antigen
(0.1 ml/dose) were administered intra-peritoneally at intervals of
2 weeks (first dose with complete Freund's adjuvant (CFA) at a 1:1,
vol:vol ratio, second dose with incomplete Freund's adjuvant (CFA)
at a 1:1, vol:vol ratio and third dose without any adjuvant). An
equal quantity of LicKM was used as a control. Samples of preimmune
sera were collected 1 day before first dose of antigen. Twelve (12)
days after each immunization serum samples were obtained from
individual mice and RSV-specific antibody titers assessed.
Antigen-specific antibody analysis of serum was performed using a
solid phase enzyme-linked immunoabsorbant assay (ELISA). ELISA
plates (Nunc Polysorp, Denmark) were coated with 100 .mu.l per well
(1.0 .mu.g per well) of inactivated RSV Long strain (Hy Test, 10
.mu.g/ml in Phosphate-buffered saline) overnight at room
temperature (RT; about 25 'C). Coated plates were washed 3.times.
with PBS-Tween (0.05%) and then blocked with 0.5% of I-block
(Tropix) in PBS-Tween at RT for at least 1 hour. A series of
dilutions of sera were added to the plates (30 .mu.l/well) for 2 to
4 hours at RT. The plates were then washed 3.times. with PBS-Tween
and peroxidase-conjugated secondary antibodies (goat anti-mouse
IgG, either whole molecule or gamma chain specific), were added
(100 .mu.l per well) at a final dilution of 1:10,000 in PBS-Tween,
for 1 hour at RT. Plates were then washed 5.times. with PBS-Tween
and OPD (Sigma Fast.TM.) substrate added (100 .mu.l/well) in
phosphate-citrate buffer containing urea, for 30 min at RT in the
dark. The reaction was stopped with 2M H.sub.2SO.sub.4 (50 .mu.l
per well) and the color change resulting from bound specific
antibody measured at 490 nM in an ELISA plate-reader (Spectrumax
Plus.sup.384). The results, expressed in O.D. units, are shown in
FIG. 8.
Example 7
Engineering and Experimental Immunization of Mice with LicKM-PAD4
Containing 145 Amino Acid Domain Four of Anthrax PA Protein
[0091] Engineering of LicKM-PAD4 was carried out as follows:
[0092] As template DNA, E. Coli plasmid DNA containing whole Domain
four (amino acids 621 to 760) of anthrax protective antigen was
obtained from NMRC (Moayeri et al., 2004, Curr Opin Microbiol.,
7(1):19-24).
[0093] For cloning Domain four encoding ammo acids 621 to 760 was
amplified using 5' GCACAGATCTAATATTTTAATAAGAGATAAACG 3' (SEQ ID
NO:16).and 5'GCACAAGCTT TCCTATCTCATAGCCTTTTT 3' (SEQ ID NO:17).as
5' and 3' primers. PCR amplified fragment was digested and cloned
into final vector using unique restriction sites introduced during
PCR reaction (BglII site at 5'- and HindIII at 3'-end
respectively). Target DNA was cloned into E. coli, agrobacterial
and plant virus expression vectors. Results described in this
example obtained using LicKM-PAD4 where target gene is cloned and
expressed plant virus vector D4.
[0094] For expression, tobacco plants were inoculated with in vitro
synthesized transcripts of LicKM-PAD4. Plant inoculations
procedures remain the same as in the above example. Two weeks after
inoculation tissue samples were collected for analysis of target
protein expression as well as recovery. Recombinant protein was
recognized by antibodies specific to protective antigen of anthrax
(FIG. 9).
[0095] For inducing immune response, eight-week-old female balB/c
mice were immunized with 200 .mu.g per dose of recombinant
LicKM-PAD4 engineered to express the 145 amino acid (amino acids
621 to 760 of PA protein) of anthrax PA protein. Three
immunizations of 0.1 ml were administered intra-peritoneally at
intervals of 2 weeks (first dose with complete Freund's adjuvant
(CFA) at a 1:1, vol:vol ratio, second dose with incomplete Freund's
adjuvant (CFA) at a 1:1, vol:vol ratio and third dose without any
adjuvant). An equal quantity of LicKM was used as a control.
Samples of pre-immune sera were collected 1 day before first dose
of antigen. Twelve (12) days after each immunization serum samples
were obtained from individual mice and RSV-specific antibody titers
assessed. Antigen-specific antibody analysis of serum was performed
using a solid phase enzyme-linked immunoabsorbant assay (ELISA).
ELISA plates (Nunc Polysorp, Denmark) were coated with 100 .mu.l
per well (1.0 .mu.g per well) of recombinant PA (10 .mu.g/ml in
Phosphate-buffered saline) overnight at room temperature (RT; about
25 'C). Coated plates were washed 3.times. with PBS-Tween (0.05%)
and then blocked with 0.5% of I-block (Tropix) in PBS-Tween at RT
for at least 1 hour. A series of dilutions of sera were added to
the plates (30 .quadrature.l/well) for 2 to 4 hours at RT. The
plates were then washed 3.times. with PBS-Tween and
peroxidase-conjugated secondary antibodies (goat anti-mouse IgG,
either whole molecule or gamma chain specific), were added (100
.quadrature.l per well) at a final dilution of 1:10,000 in
PBS-Tween, for 1 hour at RT. Plates were then washed 5.times. with
PBS-Tween and OPD (Sigma Fast.TM.) substrate added (100
.quadrature.l/well) in phosphate-citrate buffer containing urea,
for 30 min at RT in the dark. The reaction was stopped with 2M
H.sub.2SO.sub.4 (50 .quadrature.l per well) and the color change
resulting from bound specific antibody measured at 490 nM in an
ELISA plate-reader (Spectramax Plus.sup.384). The results,
expressed in O.D. units, are shown in FIG. 10.
[0096] LicKM-HbsAg was also expressed in plants. Tobacco plants are
used to produce target antigens as fusions with carrier
protein.
[0097] All publications, patents and patent applications mentioned
in the specification are indicative of the level of those skilled
in the art to which this invention pertains. All publications,
patents and patent applications referred to herein are incorporated
herein by reference to the same extent as if each individual
publication or patent application was specifically and individually
indicated to be incorporated by reference. While this invention has
been described with a reference to specific embodiments, it will be
obvious to those of ordinary skill in the art that variations in
these methods and compositions may be used and that it is intended
that the invention may be practiced otherwise than as specifically
described herein. Accordingly, this invention includes all
modifications encompassed within the spirit and scope of the
invention as defined by the claims.
Sequence CWU 1
1
16 1 709 DNA Artificial Circularly permited version of LicB gene
from Clostridium Thermocellum 1 ggaattcagg aatgagagga tcgcatcacc
atcaccatca cggatccatg ggcggttcat 60 atccgtataa aagcggtgaa
tatcgtacaa aatcattttt cggatacggt tatatgaagt 120 aagaatgaaa
gctgccaaaa acgtaggaat tgtttcatct ttcttcactt atacaggacc 180
ttcggacaac aatccatggg acgaaatcga tatcgagttt ttaggaaagg acacaactaa
240 agttcagttc aactggtaca aaaatggagt cggtggaaac gagtatttgc
acaatcttgg 300 attcgatgct tcccaggatt ttcatacata tggatttgaa
tggaggccgg attatataga 360 cttctatgtt gacggcaaaa aagtttatcg
tggaaccagg aacatacctg ttactcccgg 420 caaaattatg atgaatttgt
ggccaggaat aggagtggat gaatggttgg gacgttacga 480 cggaagaact
cctttgcagg cggagtacga atatgtaaaa tactatccta acggtagatc 540
catggtggta aatacgcctt ttgttgcagt gttttcgaac tttgactcca gtcagtggga
600 aaaagcggat tgggcgaacg gttcggtgtt caactgtgtt tggaagcctt
cacaggtgac 660 attttcgaac ggtaaaatga ttttgaccct tgacagggaa
tatagatct 709 2 778 DNA Artificial Truncated version of LicB gene
from Clostridium thermocellum 2 atgagaggat cgcatcacca tcaccatcac
ggatccgcat gcgagctcgg taccccgggt 60 cgagggccca tggtaaatac
gccttttgtt gcagtgtttt cgaactttga ctccagtcag 120 tgggaaaaag
cggattgggc gaacggttcg gtgttcaact gtgtttggaa gccttcacag 180
gtgacatttt cgaacggtaa aatgattttg acccttgaca gggaatatgg cggttcatat
240 ccgtataaaa gcggtgaata tcgtacaaaa tcatttttcg gatacggtta
ttatgaagta 300 agaatgaaag ctgccaaaaa cgtaggaatt gtttcatctt
tcttcactta tacaggacct 360 tcggacaaca atccatggga cgaaatcgat
atcgagtttt taggaaagga cacaactaaa 420 gttcagttca actggtacaa
aaatggagtc ggtggaaacg agtatttgca caatcttgga 480 ttcgatgctt
cccaggattt tcatacatat ggatttgaat ggaggccgga ttatatagac 540
ttctatgttg acggcaaaaa agtttatcgt ggaaccagga acatacctgt tactcccggc
600 aaaattatga tgaatttgtg gccaggaata ggagtggatg aatggttggg
acgttacgac 660 ggaagaactc ctttgcaggc ggagtacgaa tatgtaaaat
actatcctaa cggtgttccg 720 caagataatc ctactcctac tcctacgatt
gctccttcta ctccgagatc tatctaga 778 3 233 PRT Artificial Truncated
version of LicB gene from Clostridium thermocellum 3 Met Arg Gly
Ser His His His His His His Gly Ser Met Gly Gly Ser 1 5 10 15 Tyr
Pro Tyr Lys Ser Gly Glu Tyr Arg Thr Lys Ser Phe Phe Gly Tyr 20 25
30 Gly Tyr Tyr Glu Val Arg Met Lys Ala Ala Lys Asn Val Gly Ile Val
35 40 45 Ser Ser Phe Phe Thr Tyr Thr Gly Pro Ser Asp Asn Asn Pro
Trp Asp 50 55 60 Glu Ile Asp Ile Glu Phe Leu Gly Lys Asp Thr Thr
Lys Val Gln Phe 65 70 75 80 Asn Trp Tyr Lys Asn Gly Val Gly Gly Asn
Glu Tyr Leu His Asn Leu 85 90 95 Gly Phe Asp Ala Ser Gln Asp Phe
His Thr Tyr Gly Phe Glu Trp Arg 100 105 110 Pro Asp Tyr Ile Asp Phe
Tyr Val Asp Gly Lys Lys Val Tyr Arg Gly 115 120 125 Thr Arg Asn Ile
Pro Val Thr Pro Gly Lys Ile Met Met Asn Leu Trp 130 135 140 Pro Gly
Ile Gly Val Asp Glu Trp Leu Gly Arg Tyr Asp Gly Arg Thr 145 150 155
160 Pro Leu Gln Ala Glu Tyr Glu Tyr Val Lys Tyr Tyr Pro Asn Gly Arg
165 170 175 Ser Met Val Val Asn Thr Pro Phe Val Ala Val Phe Ser Asn
Phe Asp 180 185 190 Ser Ser Gln Trp Glu Lys Ala Asp Trp Ala Asn Gly
Ser Val Phe Asn 195 200 205 Cys Val Trp Lys Pro Ser Gln Val Thr Phe
Ser Asn Gly Met Ile Leu 210 215 220 Thr Leu Asp Arg Glu Tyr Arg Ser
Ile 225 230 4 258 PRT Artificial Truncated version of LicB gene
from Clostridium thermocellum 4 Met Arg Gly Ser His His His His His
His Gly Ser Ala Cys Glu Leu 1 5 10 15 Gly Thr Pro Gly Arg Gly Pro
Met Val Asn Thr Pro Phe Val Ala Val 20 25 30 Phe Ser Asn Phe Asp
Ser Ser Gln Trp Glu Lys Ala Asp Trp Ala Asn 35 40 45 Gly Ser Val
Phe Asn Cys Val Trp Lys Pro Ser Gln Val Thr Phe Ser 50 55 60 Asn
Gly Lys Met Ile Leu Thr Leu Asp Arg Glu Tyr Gly Gly Ser Tyr 65 70
75 80 Pro Tyr Lys Ser Gly Glu Tyr Arg Thr Lys Ser Phe Phe Gly Tyr
Gly 85 90 95 Tyr Tyr Glu Val Arg Met Lys Ala Ala Lys Asn Val Gly
Ile Val Ser 100 105 110 Ser Phe Phe Thr Tyr Thr Gly Pro Ser Asp Asn
Asn Pro Trp Asp Glu 115 120 125 Ile Asp Ile Glu Phe Leu Gly Lys Asp
Thr Thr Lys Val Gln Phe Asn 130 135 140 Trp Tyr Lys Asn Gly Val Gly
Gly Asn Glu Tyr Leu His Asn Leu Gly 145 150 155 160 Phe Asp Ala Ser
Gln Asp Phe His Thr Tyr Gly Phe Glu Trp Arg Pro 165 170 175 Asp Tyr
Ile Asp Phe Tyr Val Asp Gly Lys Lys Val Tyr Arg Gly Thr 180 185 190
Arg Asn Ile Pro Val Thr Pro Gly Lys Ile Met Met Asn Leu Trp Pro 195
200 205 Gly Ile Gly Val Asp Glu Trp Leu Gly Arg Tyr Asp Gly Arg Thr
Pro 210 215 220 Leu Gln Ala Glu Tyr Glu Tyr Val Lys Tyr Tyr Pro Asn
Gly Val Pro 225 230 235 240 Gln Asp Asn Pro Thr Pro Thr Pro Thr Ile
Ala Pro Ser Thr Pro Arg 245 250 255 Ser Ile 5 711 DNA Artificial
Variant of circularly permited LicB from Clostridium thermocellum 5
ggatccttaa ttaaaatgca ccatcaccat caccatggcg gttcatatcc gtataaaagc
60 ggtgaatatc gtacaaaatc atttttcgga tacggttatt atgaagtaag
aatgaaagct 120 gccaaaaacg taggaattgt ttcatctttc ttcacttata
caggaccttc ggacaacaat 180 ccatgggacg aaatcgatat cgagttttta
ggaaaggaca caactaaagt tcagttcaac 240 tggtacaaaa atggagtcgg
tggaaacgag tatttgcaca atcttggatt cgatgcttcc 300 caggattttc
atacatatgg atttgaatgg aggccggatt atatagactt ctatgttgac 360
ggcaaaaaag tttatcgtgg aaccaggaac atacctgtta ctcccggcaa aattatgatg
420 aatttgtggc caggaatagg agtggatgaa tggttgggac gttacgacgg
aagaactcct 480 ttgcaggcgg agtacgaata tgtaaaatac tatcctaacg
gtagatctga attcaagctt 540 gtggtaaata cgccttttgt tgcagtgttt
tcgaactttg actccagtca gtgggaaaaa 600 gcggattggg cgaacggttc
ggtgttcaac tgtgtttgga agccttcaca ggtgacattt 660 tcgaacggta
aaatgatttt gacccttgac agggaatatt gactcgagct c 711 6 228 PRT
Artificial Variant of circularly permited LicB from Clostridium
thermocellum 6 Met His His His His His His Gly Gly Ser Tyr Pro Tyr
Lys Ser Gly 1 5 10 15 Glu Tyr Arg Thr Lys Ser Phe Phe Gly Tyr Gly
Tyr Tyr Glu Val Arg 20 25 30 Met Lys Ala Ala Lys Asn Val Gly Ile
Val Ser Ser Phe Phe Thr Tyr 35 40 45 Thr Gly Pro Ser Asp Asn Asn
Pro Trp Asp Glu Ile Asp Ile Glu Phe 50 55 60 Leu Gly Lys Asp Thr
Thr Lys Val Gln Phe Asn Trp Tyr Lys Asn Gly 65 70 75 80 Val Gly Gly
Asn Glu Tyr Leu His Asn Leu Gly Phe Asp Ala Ser Gln 85 90 95 Asp
Phe His Thr Tyr Gly Phe Glu Trp Arg Pro Asp Tyr Ile Asp Phe 100 105
110 Tyr Val Asp Gly Lys Lys Val Tyr Arg Gly Thr Arg Asn Ile Pro Val
115 120 125 Thr Pro Gly Lys Ile Met Met Asn Leu Trp Pro Gly Ile Gly
Val Asp 130 135 140 Glu Trp Leu Gly Arg Tyr Asp Gly Arg Thr Pro Leu
Gln Ala Glu Tyr 145 150 155 160 Glu Tyr Val Lys Tyr Tyr Pro Asn Gly
Arg Ser Glu Phe Lys Leu Val 165 170 175 Val Asn Thr Pro Phe Val Ala
Val Phe Ser Asn Phe Asp Ser Ser Gln 180 185 190 Trp Glu Lys Ala Asp
Trp Ala Asn Gly Ser Val Phe Asn Cys Val Trp 195 200 205 Lys Pro Ser
Gln Val Thr Phe Ser Asn Gly Lys Met Ile Leu Thr Leu 210 215 220 Asp
Arg Glu Tyr 225 7 28 DNA Artificial Primers for amplification of
green fluoresence protein 7 gcagggatcc atggtgagca agggcgag 28 8 28
DNA Artificial Primers for amplification of green fluoresence
protein 8 gcagagatct cttgtacagc tcgtccat 28 9 21 DNA Artificial
Primers used to amplify fragment C (nucleotides 523-1009) of the
LicB gene from Clostridium thermocellum 9 atgggcggtt catatccgta t
21 10 21 DNA Artificial Primers used to amplify fragment C
(nucleotides 523-1009) of the LicB gene from Clostridium
thermocellum 10 tctatattcc ctgtcaaggg t 21 11 21 DNA Artificial
Primers used to amplify fragment C (nucleotides 523-1009) of the
LicB gene from Clostridium thermocellum 11 atggtggtaa atacgccttt t
21 12 24 DNA Artificial Primers used to amplify fragment C
(nucleotides 523-1009) of the LicB gene from Clostridium
thermocellum 12 tctaccgtta ggatagtatt ttac 24 13 30 DNA Artificial
Primers for amplification of fragment F, encoding amino acids
324-524 of LicB from Clostridium thermocellum 13 gcacagatct
gggtccaaca tctgtttaac 30 14 29 DNA Artificial Primers for
amplification of fragment F, encoding amino acids 324-524 of LicB
from Clostridium thermocellum 14 gcacaagctt atttgtggtg gatttacca 29
15 33 DNA Artificial Primers for amplifying domain 4, encoding
amino acids 621-760 of anthrax protective antigen 15 gcacagatct
aatattttaa taagagataa acg 33 16 30 DNA Artificial Primers for
amplifying domain 4, encoding amino acids 621-760 of anthrax
protective antigen 16 gcacaagctt tcctatctca tagccttttt 30
* * * * *