U.S. patent application number 10/521206 was filed with the patent office on 2006-11-09 for multiplex genotyping using solid phase capturable dideoxynucleotides and mass spectrometry.
Invention is credited to Jingyue Ju.
Application Number | 20060252038 10/521206 |
Document ID | / |
Family ID | 30114858 |
Filed Date | 2006-11-09 |
United States Patent
Application |
20060252038 |
Kind Code |
A1 |
Ju; Jingyue |
November 9, 2006 |
Multiplex genotyping using solid phase capturable
dideoxynucleotides and mass spectrometry
Abstract
This invention provides methods for detecting single nucleotide
polymorphisms and multiplex genotyping using dideoxynucleotides and
mass spectrometry.
Inventors: |
Ju; Jingyue; (Englewood
Cliffs, NJ) |
Correspondence
Address: |
COOPER & DUNHAM, LLP
1185 AVENUE OF THE AMERICAS
NEW YORK
NY
10036
US
|
Family ID: |
30114858 |
Appl. No.: |
10/521206 |
Filed: |
July 11, 2003 |
PCT Filed: |
July 11, 2003 |
PCT NO: |
PCT/US03/21818 |
371 Date: |
September 29, 2005 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10194882 |
Jul 12, 2002 |
7074597 |
|
|
10521206 |
Sep 29, 2005 |
|
|
|
Current U.S.
Class: |
435/5 ; 435/6.17;
536/25.32 |
Current CPC
Class: |
C07H 21/04 20130101;
C07H 21/02 20130101; C12Q 2523/319 20130101; C12Q 1/6872 20130101;
C12Q 1/6872 20130101; C12Q 1/6872 20130101; C12Q 1/6827 20130101;
C07H 19/00 20130101; C12Q 1/6827 20130101; C12Q 1/6827 20130101;
C12Q 2563/167 20130101; C12Q 2563/167 20130101; C12Q 2563/131
20130101; C12Q 2523/319 20130101; C12Q 2535/125 20130101; C12Q
2563/131 20130101; C12Q 2523/319 20130101; C12Q 2563/131 20130101;
C12Q 2563/167 20130101; C12Q 2535/125 20130101; C12Q 2535/125
20130101; C12Q 2523/319 20130101; C12Q 2535/125 20130101 |
Class at
Publication: |
435/006 ;
536/025.32 |
International
Class: |
C12Q 1/68 20060101
C12Q001/68; C07H 21/04 20060101 C07H021/04 |
Claims
1. A method for determining the identity of a nucleotide present at
a predetermined site in a DNA whose sequence immediately 3' of such
predetermined site is known which comprises: (a) treating the DNA
with an oligonucleotide primer whose sequence is complementary to
such known sequence so that the oligonucleotide primer hybridizes
to the DNA and forms a complex in which the 3' end of the
oligonucleotide primer is located immediately adjacent to the
predetermined site in the DNA; (b) simultaneously contacting the
complex from step (a) with four different labeled
dideoxynucleotides, in the presence of a polymerase under
conditions permitting a labeled dideoxynucleotide to be added to
the 3' end of the primer so as to generate a labeled single base
extended primer, wherein each of the four different labeled
dideoxynucleotides (i) is complementary to one of the four
nucleotides present in the DNA and (ii) has a molecular weight
which can be distinguished from the molecular weight of the other
three labeled dideoxynucleotides using mass spectrometry; and (c)
determining the difference in molecular weight between the labeled
single base extended primer and the oligonucleotide primer so as to
identify the dideoxynucleotide incorporated into the single base
extended primer and thereby determine the identity of the
nucleotide present at the predetermined site in the DNA.
2. The method of claim 1, wherein each of the four labeled
dideoxynucleotides comprises a chemical moiety attached to the
dideoxynucleotide by a different linker which has a molecular
weight different from that of each other linker.
3. The method of claim 1 which further comprises after step (b) the
steps of: (i) contacting the labeled single base extended primer
with a surface coated with a compound that specifically interacts
with a chemical moiety attached to the dideoxynucleotide by a
linker so as to thereby capture the extended primer on the surface;
and (ii) treating the labeled single base extended primer so as to
release it from the surface.
4. The method of claim 3 which further comprises after step (i) the
step of treating the surface to remove primers that have not been
extended by a labeled dideoxynucleotide.
5. The method of claim 1, wherein step (c) comprises determining
the difference in mass between the labeled single base extended
primer and an internal mass calibration standard added to the
extended primer.
6. The method of claim 3, wherein the interaction between the
chemical moiety attached to the dideoxynucleotide by the linker and
the compound on the surface comprises a biotin-streptavidin
interaction, a phenylboronic acid-salicylhydroxamic acid
interaction, or an antigen-antibody interaction.
7. The method of claim 3, wherein the step of releasing the labeled
single base extended primer from the surface comprises disrupting
the interaction between the chemical moiety attached to the
dideoxynucleotide by the linker and the compound on the
surface.
8. The method of claim 7, wherein the interaction is disrupted by a
means selected from the group consisting of one or more of a
physical means, a chemical means, a physical chemical means, heat,
and light.
9. The method of claim 2, wherein the linker is attached to the
dideoxynucleotide at the 5-position of cytosine or thymine or at
the 7-position of adenine or guanine.
10. The method of claim 3, wherein the step of releasing the
labeled single base extended primer from the surface comprises
cleaving the linker between the chemical moiety and the
dideoxynucleotide.
11. The method of claim 10, where the linker is cleaved by a means
selected from the group consisting of one or more of a physical
means, a chemical means, a physical chemical means, heat, and
light.
12. The method of claim 11, wherein the linker is cleaved by
light.
13. The method of claim 2, wherein the linker comprises a
derivative of 4-aminomethyl benzoic acid, a 2-nitrobenzyl group, or
a derivative of a 2-nitrobenzyl group.
14. The method of claim 13, wherein the linker comprises one or
more fluorine atoms.
15. The method of claim 14, wherein the linker is selected from the
group consisting of: ##STR11##
16. The method of claim 3, wherein the chemical moiety comprises
biotin, the labeled dideoxynucleotide is a biotinylated
dideoxynucleotide, the labeled single base extended primer is a
biotinylated single base extended primer, and the surface is a
streptavidin-coated solid surface.
17. The method of claim 16, wherein the biotinylated
dideoxynucleotide is selected from the aroup consisting of
ddATP-11-biotin, ddCTP-11-biotin, ddGTP-11-biotin, and
ddTTP-16-biotin.
18. The method of claim 16, wherein the biotinylated
dideoxynucleotide is selected from the group consisting of:
##STR12## wherein ddNTP1, ddNTP2, ddNTP3, and ddNTP4 represent four
different dideoxynucleotides.
19. The method of claim 18, wherein the biotinylated
dideoxynucleotide is selected from the group consisting of:
##STR13##
20. The method of claim 16, wherein the biotinylated
dideoxynucleotide is selected from the group consisting of:
##STR14## wherein ddNTP1, ddNTP2, ddNTF3, and ddNTF4 represent four
different dideoxynucleotides.
21. The method of claim 20, wherein the biotinylated
dideoxynucleotide is selected from the group consisting of:
##STR15##
22. The method of claim 16, wherein the streptavidin-coated solid
surface is a streptavidin-coated magnetic bead or a
streptavidin-coated silica glass.
23. The method of claim 1, wherein steps (a) and (b) are performed
in a single container or in a plurality of connected
containers.
24. A method for determining the identity of nucleotides present at
a plurality of predetermined sites, which comprises carrying out
the method of claim 3 using a plurality of different primers each
having a molecular weight different from that of each other primer,
wherein a different primer hybridizes adjacent to a different
predetermined site.
25. The method of claim 24, wherein different linkers each having a
molecular weight different from that of each other linker are
attached to the different dideoxynucleotides to increase mass
separation between different labeled single base extended primers
and thereby increase mass spectrometry resolution.
Description
[0001] This application is a continuation-in-part and claims
priority of U.S. Ser. No. 10/194,882, filed Jul. 12, 2002, the
contents of which are hereby incorporated by reference into this
application.
BACKGROUND OF THE INVENTION
[0002] Throughout this application, various publications are
referenced in parentheses. Citations for these references may be
found at the end of the specification immediately preceding the
claims. The disclosures of these publications in their entireties
are hereby incorporated by reference into this application to more
fully describe the state of the art to which this invention
pertains.
[0003] Single nucleotide polymorphisms (SNPs), the most common
genetic variations in the human genome, are important markers for
identifying disease genes and for pharmacogenetic studies (1, 2).
SNPs appear in the human genome with an average density of once
every 1000-base pairs (3). To perform large-scale SNP genotyping, a
rapid, precise and cost-effective method is required.
Matrix-assisted laser desorption/ionization time-of-flight mass
spectrometry (MALDI-TOF MS) (4) allows rapid and accurate sample
measurements (5-7) and has been used in a variety of SNP detection
methods including hybridization (8-10), invasive cleavage (11, 12)
and single base extension (SBE) (5, 13-17). SBE is widely used for
multiplex SNP analysis. In this method, primers designed to anneal
immediately adjacent to a polymorphic site are extended by a single
dideoxynucleotide that is complementary to the nucleotide at the
variable site. By measuring the mass of the resulting extension
product, a particular SNP can be identified. Current SBE methods to
perform multiplex SNP analysis using MS require unambiguous
simultaneous detection of a library of primers and their extension
products. However, limitations in resolution and sensitivity of
MALDI-TOF MS for longer DNA molecules make it difficult to
simultaneously measure DNA fragments over a large mass range (6).
The requirement to measure both primers and their extension
products in this range limits the scope of multiplexing.
[0004] A high fidelity DNA sequencing method has been developed
which uses solid phase capturable biotinylated dideoxynucleotides
(biotin-ddNTPs) by detection with fluorescence (18) or mass
spectrometry (19), eliminating false terminations and excess
primers. Combinatorial fluorescence energy transfer tags and
biotin-ddNTPs have also been used to detect SNPs (20).
[0005] False stops or terminations occur when a deoxynucleotide
rather than a dideoxynucleotide terminates a se+quencing fragment.
It has been shown that false stops and primers which have dimerized
can produce peaks in the mass spectra that can mask the actual
results preventing accurate base identification (21).
[0006] The present application discloses an approach using solid
phase capturable biotin-ddNTPs in SBE for multiplex genotyping by
MALDI-TOF MS. In this method primers that have different molecular
weights and that are specific to the polymorphic sites in the DNA
template are extended with biotin-ddNTPs by DNA polymerase to
generate 3'-biotinylated DNA extension products. The
3'-biotinylated DNAs are then captured by streptavidin-coated
magnetic beads, while the unextended primers and other components
in the reaction are washed away. The pure DNA extension products
are subsequently released from the magnetic beads, for example by
denaturing the biotin-streptavidin interaction with formamide, and
analyzed with MALDI-TOF MS. The nucleotide at the polymorphic site
is identified by analyzing the mass difference between the primer
extension product and an internal mass standard added to the
purified DNA products. Since the primer extension products are
isolated prior to MS analysis, the resulting mass spectrum is free
of non-extended primer peaks and their associated dimers, which
increases the accuracy and scope of multiplexing in SNP analysis.
The solid phase purification system also facilitates desalting of
the captured oligonucleotides. Desalting is critical in sample
preparation for MALDI-TOF MS measurement since alkaline and
alkaline earth salts can form adducts with DNA fragments that
interfere with accurate peak detection (21).
SUMMARY OF THE INVENTION
[0007] This invention is directed to a method for determining the
identity of a nucleotide present at a predetermined site in a DNA
whose sequence immediately 3' of such predetermined site is known
which comprises: [0008] (a) treating the DNA with an
oligonucleotide primer whose sequence is complementary to such
known sequence so that the oligonucleotide primer hybridizes to the
DNA and forms a complex in which the 3' end of the oligonucleotide
primer is located immediately adjacent to the predetermined site in
the DNA; [0009] (b) simultaneously contacting the complex from step
(a) with four different labeled dideoxynucleotides, in the presence
of a polymerase under conditions permitting a labeled
dideoxynucleotide to be added to the 3' end of the primer so as to
generate a labeled single base extended primer, wherein each of the
four different labeled dideoxynucleotides (i) is complementary to
one of the four nucleotides present in the DNA and (ii) has a
molecular weight which can be distinguished from the molecular
weight of the other three labeled dideoxynucleotides using mass
spectrometry; and [0010] (c) determining the difference in
molecular weight between the labeled single base extended primer
and the oligonucleotide primer so as to identify the
dideoxynucleotide incorporated into the single base extended primer
and thereby determine the identity of the nucleotide present at the
predetermined site in the DNA.
[0011] In one embodiment, the method further comprises after step
(b) the steps of: [0012] (i) contacting the labeled single base
extended primer with a surface coated with a compound that
specifically interacts with a chemical moiety attached to the
dideoxynucleotide by a linker so as to thereby capture the extended
primer on the surface; and [0013] (ii) treating the labeled single
base extended primer so as to release it from the surface.
[0014] In one embodiment, the method further comprises after step
(i) the step of treating the surface to remove primers that have
not been extended by a labeled dideoxynucleotide.
BRIEF DESCRIPTION OF THE FIGURES
[0015] FIG. 1: Scheme of single base extension for multiplex SNP
analysis using biotin-ddNTPs and MALDI-TOF MS. Primers that anneal
immediately next to the polymorphic sites in the DNA template are
extended by DNA polymerase of a biotin-ddNTP in a sequence-specific
manner. After solid phase capture and isolation of the
3'-biotinylated DNA extension fragments, MALDI-TOF MS was used to
analyze these DNA products to yield a mass spectrum. From the
relative mass of each extended primer, compared to the mass of an
internal standard, the nucleotide at the polymorphic site is
identified.
[0016] FIG. 2. Multiplex SNP genotyping mass spectra generated
using biotin-ddNTPs. Inset is a magnified view of heterozygote
peaks. Masses of the extension product in reference to the internal
mass standard were listed on each single base extension peak. The
mass values in parenthesis indicate the mass difference between the
extension products and the corresponding primers. (A) Detection of
six nucleotide variations from synthetic DNA templates mimicking
mutations in the p53 gene. Four homozygous (T, G, C and C) and one
heterozygous (C/A) genotypes were detected. (B) Detection of two
heterozygotes (A/G and C/G) in the human HFE gene.
[0017] FIG. 3: Structure of four mass tagged biotinylated ddNTPs.
Any of the four ddNTPs (ddATP, ddCTP, ddGTP, ddTTP) can be used
with any of the illustrated linkers.
[0018] FIG. 4: Synthesis scheme for mass tag linkers. For
illustrative purposes, the linkers are labeled to correspond to the
specific ddNTP with which they are shown coupled in FIGS. 3, 5, 7,
8 and 9. However, any of the three linkers can be used with any
ddNTP. (i) (CF.sub.3CO).sub.2O; (ii)
Disuccinimidylcarbonate/diisopropylethylamine; (iii) Propargyl
amine.
[0019] FIG. 5: The synthesis of ddATP-Linker-II-11-Biotin. (i)
Linker II, tetrakis(triphenylphosphine) palladium(0); (ii)
POCl.sub.3, Bn.sub.4N.sup.+ pyrophosphate; (iii) NH.sub.4OH; (iv)
Sulfo-NHS-LC-Biotin.
[0020] FIG. 6: DNA products are purified by a streptavidin coated
porous silica surface. Only the biotinylated fragments are
captured. These fragments are then cleaved by light irradiation
(hv) to release the captured fragments, leaving the biotin moiety
still bound to the streptavidin.
[0021] FIG. 7: Mechanism for the cleavage of photocleavable
linkers.
[0022] FIG. 8: The structures of ddNTPs linked to photocleavable
(PC) biotin. Any of the four ddNTPs (ddATP, ddCTP, ddGTP, ddTTP)
can be used with any of the shown linkers.
[0023] FIG. 9: The synthesis of ddATP-Linker-II-PC-Biotin.
PC=photocleavable.
[0024] FIG. 10: Schematic for capturing a DNA fragment terminated
with a dideoxynucleoside monophosphate on a surface. The
dideoxynucleoside monophosphate (ddNMP) which is on the 3' end of
the DNA fragment is attached via a linker to a chemical moiety "X"
which interacts with a compound "Y" on the surface to capture the
DNA fragment terminated with the ddNMP. The DNA fragment can be
freed from the surface either by disrupting the interaction between
chemical moiety X and compound Y (lower scheme) or by cleaving the
linker (upper scheme).
[0025] FIGS. 11A-11C: Schematic of a high throughput channel based
purification system. Sample solutions can be pushed back and forth
between the two plates through glass capillaries and the
streptavidin coated channels in the chip. The whole chip can be
irradiated to cleave the samples after immobilization.
[0026] FIG. 12: The synthesis of streptavidin coated porous
surface.
[0027] FIGS. 13A-13C: Simultaneous detection of nucleotide
variations in 30 codons of the p53 tumor suppressor gene by
MALDI-TOF MS using solid phase capturable biotinylated
dideoxynucleotide. Each peak represents a different polymorphism
labeled with its nucleotide identity and absolute mass value. The
value in parentheses, denoting the mass difference between each DNA
extension product and its corresponding primer, is used to
determine the nucleotide identity. (A) A mass spectrum from a
Wilms' tumor sample showing 30 wild type p53 sequences. (B) A mass
spectrum from a head and neck tumor (primary tumor biopsy)
containing a heterozygous genotype G/T (4684/4734 Da) (boxed) in
codon 157, corresponding to the wild type and mutant alleles,
respectively. (C) A mass spectrum from a colorectal tumor cell line
(HT-29) containing a homozygous G to A mutation (boxed) in codon
273 of the p53 gene. The colorectal tumor cell line (SW-480)
contained the identical G to A mutation in codon 273.
[0028] FIGS. 14A-14B: (A) A mass spectrum from a head and neck
tumor sample showing 30 wild type sequences of the p53 gene. (B) A
mass spectrum from a head and neck tumor cell line (SCC-4)
containing a homozygous C (5881 Da) to T (5970 Da) mutation (boxed)
in codon 151 of the p53 gene. Both spectra were produced using the
primers shown in Table 3 with primer 16 replaced by primer
5'-TGTGGGTTGATTCCACA-3' for detecting the variation in codon 151
(C/TCC).
DETAILED DESCRIPTION OF THE INVENTION
[0029] The following definitions are presented as an aid in
understanding this invention.
[0030] The standard abbreviations for nucleotide bases are used as
follows: adenine (A), cytosine (C), guanine (G), thymine (T), and
uracil (U).
[0031] A nucleotide analogue refers to a chemical compound that is
structurally and functionally similar to the nucleotide, i.e. the
nucleotide analogue can be recognized by polymerase as a substrate.
That is, for example, a nucleotide analogue comprising adenine or
an analogue of adenine should form hydrogen bonds with thymine, a
nucleotide analogue comprising C or an analogue of C should form
hydrogen bonds with G, a nucleotide analogue comprising G or an
analogue of G should form hydrogen bonds with C, and a nucleotide
analogue comprising T or an analogue of T should form hydrogen
bonds with A, in a double helix format.
[0032] This invention is directed to a method for determining the
identity of a nucleotide present at a predetermined site in a DNA
whose sequence immediately 3' of such predetermined site is known
which comprises: [0033] (a) treating the DNA with an
oligonucleotide primer whose sequence is complementary to such
known sequence so that the oligonucleotide primer hybridizes to the
DNA and forms a complex in which the 3' end of the oligonucleotide
primer is located immediately adjacent to the predetermined site in
the DNA; [0034] (b) simultaneously contacting the complex from step
(a) with four different labeled dideoxynucleotides, in the presence
of a polymerase under conditions permitting a labeled
dideoxynucleotide to be added to the 3' end of the primer so as to
generate a labeled single base extended primer, wherein each of the
four different labeled dideoxynucleotides (i) is complementary to
one of the four nucleotides present in the DNA and (ii) has a
molecular weight which can be distinguished from the molecular
weight of the other three labeled dideoxynucleotides using mass
spectrometry; and [0035] (c) determining the difference in
molecular weight between the labeled single base extended primer
and the oligonucleotide primer so as to identify the
dideoxynucleotide incorporated into the single base extended primer
and thereby determine the identity of the nucleotide present at the
predetermined site in the DNA.
[0036] In one embodiment, each of the four labeled
dideoxynucleotides comprises a chemical moiety attached to the
dideoxynucleotide by a different linker which has a molecular
weight different from that of each other linker.
[0037] In one embodiment, the method further comprises after step
(b) the steps of: [0038] (i) contacting the labeled single base
extended primer with a surface coated with a compound that
specifically interacts with a chemical moiety attached to the
dideoxynucleotide by a linker so as to thereby capture the extended
primer on the surface; and [0039] (ii) treating the labeled single
base extended primer so as to release it from the surface.
[0040] In a further embodiment, the method comprises after step (i)
the step of treating the surface to remove primers that have not
been extended by a labeled dideoxynucleotide and any non-captured
component.
[0041] In one embodiment of the method step (c) comprises
determining the difference in mass between the labeled single base
extended primer and an internal mass calibration standard added to
the extended primer. In one embodiment, the internal mass standard
is 5'-TTTTTCTTTTTCT-3' (SEQ ID NO: 5) (MW=3855 Da).
[0042] In one embodiment, the chemical moiety is attached via a
different linker to different dideoxynucleotides. In one
embodiment, the different linkers increase mass separation between
different labeled single base extended primers and thereby increase
mass spectrometry resolution.
[0043] In one embodiment, the dideoxynucleotide is selected from
the group consisting of 2',3'-dideoxyadenosine 5'-triphosphate
(ddATP), 2',3'-dideoxyguanosine 5'-triphosphate (ddGTP),
2',3'-dideoxycytidine 5'-triphosphate (ddCTP), and
2',3'-dideoxythymidine 5'-triphosphate (ddTTP).
[0044] In different embodiments of the methods described herein,
the interaction between the chemical moiety attached to the
dideoxynucleotide by the linker and the compound on the surface
comprises a biotin-streptavidin interaction, a phenylboronic
acid-salicylhydroxamic acid interaction, or an antigen-antibody
interaction.
[0045] In one embodiment, the step of releasing the labeled single
base extended primer from the surface comprises disrupting the
interaction between the chemical moiety attached by the linker to
the dideoxynucleotide and the compound on the surface. In different
embodiments, the interaction is disrupted by a means selected from
the group consisting of one or more of a physical means, a is
chemical means, a physical chemical means, heat, and light. In one
embodiment, the interaction is disrupted by light. In one
embodiment, the interaction is disrupted by ultraviolet light. In
different embodiments, the interaction is disrupted by ammonium
hydroxide, formamide, or a change in pH (-log H.sup.+
concentration).
[0046] In different embodiments, the linker can comprise a chain
structure, or a structure comprising one or more rings, or a
structure comprising a chain and one or more rings. In different
embodiments, the dideoxynucleotide comprises a cytosine or a
thymine with a 5-position, or an adenine or a guanine with a
7-position, and the linker is attached to the dideoxynucleotide at
the 5-position of cytosine or thymine or at the 7-position of
adenine or guanine.
[0047] In different embodiments, the step of releasing the labeled
single base extended primer from the surface comprises cleaving the
linker between the chemical moiety and the dideoxynucleotide. In
different embodiments, the linker is cleaved by a means selected
from the group consisting of one or more of a physical means, a
chemical means, a physical chemical means, heat, and light. In one
embodiment, the linker is cleaved by light. In one embodiment, the
linker is cleaved by ultraviolet light. In different embodiments,
the linker is cleaved by ammonium hydroxide, formamide, or a change
in pH (-log H.sup.+ concentration);
[0048] In one embodiment, the linker comprises a derivative of
4-aminomethyl benzoic acid. In one embodiment, the linker comprises
a 2-nitrobenzyl group or a derivative of a 2-nitrobenzyl group. In
one embodiment, the linker comprises one or more fluorine
atoms.
[0049] In one embodiment, the linker is selected from the group
consisting of: ##STR1##
[0050] In one embodiment, a plurality of different linkers is used
to increase mass separation between different labeled single base
extended primers and thereby increase mass spectrometry
resolution.
[0051] In one embodiment, the chemical moiety comprises biotin, the
labeled dideoxynucleotide is a biotinylated dideoxynucleotide, the
labeled single base extended primer is a biotinylated single base
extended primer, and the surface is a streptavidin-coated solid
surface. In one embodiment, the biotinylated dideoxynucleotide is
selected from the group consisting of ddATP-11-biotin,
ddCTP-11-biotin, ddGTP-11-biotin, and ddTTP-16-biotin.
[0052] In one embodiment, the biotinylated dideoxynucleotide is
selected from the group consisting of: ##STR2##
[0053] wherein ddNTP1, ddNTP2, ddNTF3, and ddNTP4 represent four
different dideoxynucleotides, or their analogues.
[0054] In one embodiment, the biotinylated dideoxynucleotide is
selected from the group consisting of: ##STR3##
[0055] In one embodiment, the biotinylated dideoxynucleotide is
selected from the group consisting of: ##STR4##
[0056] wherein ddNTP1, ddNTP2, ddNTP3, and ddNTP4 represent four
different dideoxynucleotides or their analogues.
[0057] In one embodiment, the biotinylated dideoxynucleotide is
selected from the group consisting of: ##STR5##
[0058] In one embodiment, the streptavidin-coated solid surface is
a streptavidin-coated magnetic bead or a streptavidin-coated silica
glass.
[0059] In one embodiment of the method, steps (a) and (b) are
performed in a single container or in a plurality of connected
containers.
[0060] The invention provides methods for determining the identity
of nucleotides present at a plurality of predetermined sites, which
comprises carrying out any of the methods disclosed herein using a
plurality of different primers each having a molecular weight
different from that of each other primer, wherein a different
primer hybridizes adjacent to a different predetermined site. In
one embodiment, different linkers each having a molecular weight
different from that of each other linker are attached to the
different dideoxynucleotides to increase mass separation between
different labeled single base extended primers and thereby increase
mass spectrometry resolution.
[0061] In one embodiment, the mass spectrometry is matrix-assisted
laser desorption/ionization time-of-flight mass spectrometry.
[0062] Linkers are provided for attaching a chemical moiety to a
dideoxynucleotide, wherein the linker comprises a derivative of
4-aminomethyl benzoic acid.
[0063] In one embodiment, the dideoxynucleotide is selected from
the group consisting of 2',3'-dideoxyadenosine 5'-triphosphate
(ddATP), 2',3'-dideoxyguanosine 5'-triphosphate (ddGTP),
2',3'-dideoxycytidine 5'-triphosphate (ddCTP), and
2',3'-dideoxythymidine 5'-triphosphate (ddTTP).
[0064] In one embodiment, the linker comprises one or more fluorine
atoms.
[0065] In one embodiment, the linker is selected from the group
consisting of: ##STR6##
[0066] In different embodiments, the linker can comprise a chain
structure, or a structure comprising one or more rings, or a
structure comprising a chain and one or more rings.
[0067] In different embodiments, the linker is cleavable by a means
selected from the group consisting of one or more of a physical
means, a chemical means, a physical chemical means, heat, and
light. In one embodiment, the linker is cleavable by ultraviolet
light. In different embodiments, the linker is cleavable by
ammonium hydroxide, formamide, or a change in pH (-log H.sup.+
concentration).
[0068] In different embodiments of the linker, the chemical moiety
comprises biotin, streptavidin or related analogues that have
affinity with biotin, phenylboronic acid, salicylhydroxamic acid,
an antibody, or an antigen.
[0069] In different embodiments, the dideoxynucleotide comprises a
cytosine or a thymine with a 5-position, or an adenine or a guanine
with a 7-position, and the linker is attached to the 5-position of
cytosine or thymine or to the 7-position of adenine or guanine.
[0070] The invention provides for the use of any of the linkers
described herein in single nucleotide polymorphism detection using
mass spectrometry, wherein the linker increases mass separation
between different dideoxynucleotides and increases mass
spectrometry resolution.
[0071] Labeled dideoxynucleotides are provided which comprise a
chemical moiety attached via a linker to a 5-position of cytosine
or thymine or to a 7-position of adenine or guanine.
[0072] In one embodiment, the dideoxynucleotide is selected from
the group consisting of 2',3'-dideoxyadenosine 5'-triphosphate
(ddATP), 2',3'-dideoxyguanosine 5'-triphosphate (ddGTP),
2',3'-dideoxycytidine 5'-triphosphate (ddCTP), and
2',3'-dideoxythymidine 5'-triphosphate (ddTTP).
[0073] In different embodiments, the linker can comprise a chain
structure, or a structure comprising one or more rings, or a
structure comprising a chain and one or more rings. In different
embodiments, the linker is cleavable by a means selected from the
group consisting of one or more of a physical means, a chemical
means, a physical chemical means, heat, and light. In one
embodiment, the linker is cleavable by ultraviolet light. In
different embodiments, the linker is cleavable by ammonium
hydroxide, formamide, or a change in pH -log [H.sup.+
concentration].
[0074] In different embodiments of the labeled dideoxynucleotide,
the chemical moiety comprises biotin, streptavidin, phenylboronic
acid, salicylhydroxamic acid, an antibody, or an antigen.
[0075] In one embodiment, the labeled dideoxynucleotide is selected
from the group consisting of: ##STR7## [0076] wherein ddNTP1,
ddNTP2, ddNTP3, and ddNTP4 represent four different
dideoxynucleotides, or their analogues.
[0077] In one embodiment, the labeled dideoxynucleotide is selected
from the group consisting of: ##STR8##
[0078] In one embodiment, the labeled dideoxynucleotide is selected
from the group consisting of: ##STR9## wherein ddNTP1, ddNTP2T
ddNTP3, and ddNTP4 represent four different dideoxynucleotides, or
their analogues.
[0079] In one embodiment, the labeled dideoxynucleotide is selected
from the group consisting of: ##STR10##
[0080] In one embodiment, the labeled dideoxynucleotide has a
molecular weight of 844, 977, 1,017, or 1,051. In one embodiment,
the labeled dideoxynucleotide has a molecular weight of 1,049,
1,182, 1,222, or 1,257. Other molecular weights with sufficient
mass differences to allow resolution in mass spectrometry can also
be used.
[0081] In one embodiment the mass spectrometry is matrix-assisted
laser desorption/ionization time-of-flight mass spectrometry.
[0082] A system is provided for separating a chemical moiety from
other components in a sample in solution, which comprises: [0083]
(a) a channel coated with a compound that specifically interacts
with the chemical moiety at the 3' end of the DNA fragment, wherein
the channel comprises a plurality of ends; [0084] (b) a plurality
of wells each suitable for holding the sample; [0085] (c) a
connection between each end of the channel and a well; and [0086]
(d) a means for moving the sample through the channel between
wells.
[0087] In one embodiment of the system, the interaction between the
chemical moiety and the compound coating the surface is a
biotin-streptavidin interaction, a phenylboronic
acid-salicylhydroxamic acid interaction, or an antigen-antibody
interaction.
[0088] In one embodiment, the chemical moiety is a biotinylated
moiety and the channel is a streptavidin-coated silica glass
channel. In one embodiment, the biotinylated moiety is a
biotinylated DNA fragment.
[0089] In one embodiment, the chemical moiety can be freed from the
surface by disrupting the interaction between the chemical moiety
and the compound coating the surface. In different embodiments, the
interaction can be disrupted by a means selected from the group
consisting of one or more of a physical means, a chemical means, a
physical chemical means, heat, and light. In different embodiments,
the interaction can be disrupted by ammonium hydroxide, formamide,
or a change in pH -log [H.sup.+ concentration].
[0090] In one embodiment, the chemical moiety is attached via a
linker to another chemical compound. In one embodiment, the other
chemical compound is a DNA fragment. In one embodiment, the linker
is cleavable by a means selected from the group consisting of one
or more of a physical means, a chemical means, a physical chemical
means, heat, and light. In one embodiment, the channel is
transparent to ultraviolet light and the linker is cleavable by
ultraviolet light. Cleaving the linker frees the DNA fragment or
other chemical compound from the chemical moiety which remains
captured on the surface.
[0091] Multi-channel systems are provided which comprise a
plurality of any of the single channel systems disclosed herein. In
one embodiment, the channels are in a chip. In one embodiment, the
multi-channel system comprises 96 channels in a chip. Chips can
also be used with fewer or greater than 96 channels.
[0092] The invention provides for the use of any of the separation
systems described herein for single nucleotide polymorphism
detection.
[0093] This invention will be better understood from the
Experimental Details which follow. However, one skilled in the art
will readily appreciate that the specific methods and results
discussed are merely illustrative of the invention as described
more fully in the claims which follow thereafter.
[0094] Experimental Details
Experimental Set I
[0095] A. Materials and Methods
[0096] PCR amplification. DNA templates containing the polymorphic
sites for the human hereditary hemochromatosis gene HFE were
amplified from genomic DNA in a total volume of 10 .mu.l, that
contains 20 ng of genomic DNA, 500 pmol each of forward (C282Y;
5'-CTACCCCCAGAACATCACC-3' (SEQ ID NO: 1), H63D;
5'-GCACTACCTCTTCATGGGTGCC-3' (SEQ ID NO: 2)) and reverse (C282Y;
5'-CATCAGTCACATACCCCA-3' (SEQ ID NO: 3), H63D;
5'-CAGTGAACATGTGATCCCACCC-3' (SEQ ID NO: 4)) primers, 25 .mu.M
dNTPs (Amersham Biosciences, Piscataway, N.J.), 1 U Tag polymerase
(Life Technologies, Rockville, Md.), and 1.times. PCR buffer (50 mM
KCl, 1.5 mM MgCl.sub.2, 10 mM Tris-HCl). PCR amplification
reactions were started at 94.degree. C. for 4 min, followed by 45
cycles of 94.degree. C. for 30 s, 59.degree. C. for 30 s and
72.degree. C. for 10 s, and finished with an additional extension
step of 72.degree. C. for 6 min. Excess primers and dNTPs were
degraded by adding 2 U shrimp alkaline phosphatase (Roche
Diagnostics, Indianapolis, Ind.) and E. Coli exonuclease I
(Boehringer Mannheim, Indianapolis, Ind.) in 1.times. shrimp
alkaline phosphatase buffer. The reaction mixture was incubated at
37.degree. C. for 45 min followed by enzyme inactivation at
95.degree. C. for 15 min.
[0097] Single base extension using biotin-ddNTPs. The synthetic DNA
templates containing six nucleotide variations in p53 gene and the
five primers for detecting these variations are shown in Table 1.
These oligonucleotides and an internal mass standard
(5'-TTTTTCTTTTTCT-3' (SEQ ID NO: 5), MW=3855 Da) for MALDI-TOF MS
measurement were made using an Expedite nucleic acid synthesizer
(Applied Biosystems, Foster City, Calif.). SBE reactions contained
20 pmol of primer, 10 pmol of biotin-11-ddATP, 20 pmol of
biotin-11-ddGTP, 40 pmol of biotin-11-ddCTP (New England Nuclear
Life Science, Boston, Mass.), 80 pmol of biotin-16-ddUTP (Enzo
Diagnostics, Inc., Farmingdale, N.Y.), 2 .mu.l Thermo Sequenase
reaction buffer, 1 U Thermo Sequenase in its diluted buffer
(Amersham Biosciences) and 20 pmol of either synthetic template or
10 .mu.l PCR product in a total reaction volume of 20 .mu.l. For
SBE using synthetic template 1, 10 pmol of both wild type and
mutated templates were combined with 20 pmol of primers 1 and 3 or
20 pmol of primers 2 and 4. The SBE reaction of primer 5 was
performed with template 2 in a separate tube. PCR products from the
HFE gene were mixed with 20 pmol of the corresponding primers
5'-GGGGAAGAGCAGAGATATACGT-3' (SEQ ID NO: 6) (C282Y) and
5'-GGGGCTCCACACGGCGACTCTC-AT-3' (SEQ ID NO: 7) (H63D) in SBE to
detect the two heterozygous genotypes. All extension reactions were
thermalcycled for 35 cycles at 94.degree. C. for 10 s and
49.degree. C. for 30 s.
[0098] Solid phase purification. 20 .mu.l of the
streptavidin-coated magnetic beads (Seradyn, Ramsey, Minn.) were
washed with modified binding and washing (B/W) buffer (0.5 mM
Tris-HCl buffer, 2 M NH.sub.4Cl, 1 mM EDTA, pH 7.0) and resuspended
in 20 .mu.l modified B/W buffer. Extension reaction mixtures of
primers 1-4 with template 1 and primer 5 with template 2 were mixed
in a 2:1 ratio, while extension reaction mixtures from the PCR
products of HFE gene were mixed in equal amounts. 20 .mu.l of each
mixed extension product was added to the suspended beads and
incubated for 1 hour. After capture, the beads were washed twice
with modified B/W buffer, twice with 0.2 M triethyl ammonium
acetate (TEAA) buffer and twice with deionized water. The primer
extension products were released from the magnetic beads by
treatment with 8 .mu.l 98% formamide solution containing 2% 0.2 M
TEAA buffer at 94.degree. C. for 5 min. The released primer
extension products were precipitated with 100% ethanol at 4.degree.
C. for 30 min, and centrifuged at 4.degree. C. and 14000 RPM for 35
min.
[0099] MALDI-TOF MS analysis. The purified primer extension is
products were dried and re-suspended in 1 .mu.l deionized water and
2 .mu.l matrix solution. The matrix solution was made by dissolving
35 mg of 3-hydroxypicolinic acid (3-HPA; Aldrich, Milwaukee, Wis.)
and 6 mg of ammonium citrate (Aldrich) in 0.8 ml of 50%
acetonitrile. 10 pmol internal mass standard in 1 .mu.l of 50%
acetonitrile was then added to the sample. 0.5 .mu.l of this
mixture containing the primer extension products and internal
standard was spotted on a stainless steel sample plate, air-dried
and analyzed using an Applied Biosystems Voyager DE Pro MALDI-TOF
mass spectrometer. All measurements were taken in linear positive
ion mode with a 25 kV accelerating voltage, a 94% grid voltage and
a 350 ns delay time. The obtained spectra were processed using the
Voyager data analysis package.
[0100] B. Detection of Single Nucleotide Polymorphism Using
Biotinylated Dideoxynucleotides and Mass Spectrometry
[0101] Solid phase capturable biotinylated dideoxynucleotides
(biotin-ddNTPs) were used in single base extension for multiplex
genotyping by mass spectrometry (MS). In this method,
oligonucleotide primers that have different molecular weights and
that are specific to the polymorphic sites in the DNA template are
extended with biotin-ddNTPs by DNA polymerase to generate
3'-biotinylated DNA extension products (FIG. 1). These products are
then captured by streptavidin-coated solid phase magnetic beads,
while the unextended primers and other components in the reaction
are washed away. The pure extension DNA products are subsequently
released from the solid phase and analyzed with matrix-assisted
laser desorption/ionization time-of-flight MS. The mass of the
extension DNA products is determined using a stable oligonucleotide
as a common internal mass standard. Since only the pure extension
DNA products are introduced to MS for analysis, the resulting mass
spectrum is free of non-extended primer peaks and their associated
dimers, which increases the accuracy and scope of multiplexing in
single nucleotide polymorphism (SNP) analysis. The solid phase
purification approach also facilitates desalting of the captured
oligonucleotides, which is essential for accurate mass measurement
by MS.
[0102] Four biotin-ddNTPs with distinct molecular weights were
selected to generate extension products that have a two-fold
increase in mass difference compared to that with conventional
ddNTPs. This increase in mass difference provides improved
resolution and accuracy in detecting heterozygotes in the mass
spectrum.
[0103] The "lock and key" functionality of biotin and streptavidin
is often utilized in biological sample preparation as a way to
remove undesired impurities (23). In different embodiments of the
methods described herein, affinity systems other than
biotin-streptavidin can be used. Such affinity systems include but
are not limited to phenylboronic acid-salicylhydroxamic acid (31)
and antigen-antibody systems.
[0104] The multiplex genotyping approach was validated by detecting
six nucleotide variations from synthetic DNA templates that mimic
mutations in exons 7 and 8 of the p53 gene. Sequences of the
templates and the corresponding primers are shown in Table 1 along
with the masses of the primers and their extension products. The
mass increase of the resulting single base extension products in
comparison with the primers is 665 Da for addition of biotin-ddCTP,
688 Da for addition of biotin-ddATP, 704 Da for addition of
biotin-ddGTP and 754 Da for addition of biotin-ddUTP. The mass data
in Table 1 indicate that the smallest mass difference among any
possible extensions of a primer is 16 Da (between biotin-ddATP and
biotin-ddGTP). This is a substantial increase over the smallest
mass difference between extension products using standard ddNTPs (9
Da between ddATP and ddTTP). This mass increase yields improved
resolution of the peaks in the mass spectrum. Increased mass
difference in ddNTPs fosters accurate detection of heterozygous
genotypes (15), since an A/T heterozygote with a mass difference of
9 Da using conventional ddNTPs can not be well resolved in the
MALDI-TOF mass spectra. The five primers for each polymorphic site
were designed to produce extension products without overlapping
masses. Primers extended by biotin-ddNTPs were purified and
analyzed by MALDI-TOF MS according to the scheme in FIG. 1.
Extension products of all five primers were well-resolved in the
mass spectrum free from any unextended primers (FIG. 2A), allowing
each nucleotide variation to be unambiguously identified.
Unextended primers occupy the mass range in the mass spectrum
decreasing the scope of multiplexing, and excess primers can
dimerize to form false peaks in the mass spectrum (21). The excess
primers and their associated dimers also compete for the ion
current, reducing the detection sensitivity of MS for the desired
DNA fragments. These complications were completely removed by
carrying out SBE using biotin-ddNTPs and solid phase capture.
Extension products for all four biotin-ddNTPs were clearly detected
with well resolved mass values. The relative masses of the primer
extension products in comparison to the internal mass standard
revealed the identity of each nucleotide at the polymorphic site.
In the case of heterozygous genotypes, two peaks, one corresponding
to each allele (C/A), are clearly distinguishable in the mass
spectrum shown in FIG. 2A. TABLE-US-00001 TABLE 1 Oligonucleotide
primers and synthetic DNA templates for detecting mutations in the
p53 gene. Masses of single base extension products (Da) Biotin-
Biotin- Biotin- Biotin- Masses ddcTP ddATP ddGTP ddUTP Primers
Primer sequences (Da) .DELTA.665 .DELTA.688 .DELTA.704 .DELTA.754 1
5'-AGAGGATCCAACCGAGAC-3' 1656 2321 2344 2360 2410 2
5'-TGGTGGTAGGTGATGTTGATGTA-3' 3350 4015 4038 4054 4103 3
5'-CACATTGTCAAGGACGTACCCG-3' 2833 3498 3521 3538 3587 4
5'-TACCCGCCGTACTTGGCCTC-3' 2134 2799 2822 2838 2480 5
5'-TCCACGCACAAACACGGACAG-3' 2507 3172 3195 3211 3261 Templates
Template sequences 1
5'-TACCCG/TGAGGCCAAGTACGGCGGGTACGTCCTTGACAATGTGTACATCAACATCACCTACCA
CCATGTCAGTCTCGGTTGGATCCTCTATTGTGTCCGGG-3' (SEQ ID NO:13) 2
GAAGGAGACACGCGGCCAGAGAGGGTCCTGTCCGTGTTTGTGCGTGGAGTTTCGACAAGGCAGGGTC
ATCTAATGGTGATGAGTCCTATCCTTTTCTCTTCGTTCTCCGT-3' (SEQ ID NO:14) (Top)
The sequences and the calculated masses of primers and the four
possible single base extension products relative to the internal
mass standard are listed. The bold numbers refer to the nucleotide
variations detected in the p53 gene. (Bottom) The six nucleotide
variations in template 1 and 2 are shown in bold letters. Template
1 contains a heterozygous genotype (G/T). Primers 1-5 = SEQ ID NOs:
8-12, respectively.
[0105] One advantage of MALDI-TOF MS in comparison to other
detection techniques is its ability to simultaneously measure
masses of DNA fragments over a certain range.
[0106] In order to explore this feature to detect multiple SNPs in
a single spectrum, if unextended primers are not removed, masses of
all primers and their extension products must have sufficient
differences to yield adequately resolved peaks in the mass
spectrum. Ross et al. simultaneously detected multiple SNPs by
carefully tuning the masses of all primers and extension products
so that they would lie in the range of 4.5 kDa and 7.6 kDa without
overlapping (14). Since the unextended primers occupy the mass
range in the mass spectrum, by eliminating them, the approach
disclosed herein will significantly increase the scope of
multiplexing in SNP analysis.
[0107] To demonstrate the ability of this method to discriminate
SNPs in genomic DNA, two disease associated SNPs were genotyped in
the human hereditary hemochromatosis (HHC) gene HFE. HHC is a
common genetic condition in Caucasians with approximately 1/400
Caucasians homozygous for the C282Y mutation leading to iron
overload and potentially liver failure, diabetes and depression
(22). A subset of individuals who are compound heterozygotes for
the C282Y and H63D mutations also manifest iron overload. Because
of the high prevalence of these mutations and the ability to
prevent disease manifestations by phlebotomy, accurate methods for
genotyping these two SNPs will foster genetic screening for this
condition. Two PCR products were generated from human genomic DNA
for the C282Y and H63D polymorphic sites of the HFE gene and then
used these products for SBE with biotin-ddNTPs. After the extension
reaction, products were purified using solid phase capture
according to the scheme in FIG. 1 and analyzed by MALDI-TOF MS. The
mass spectrum obtained from this experiment is shown in FIG. 2B.
Extension products of each primer were readily identified by their
mass relative to the internal mass standard. Heterozygous genotypes
of A/G and C/G with a mass difference of 16 Da and 39 Da
respectively were accurately detected at the C282Y and H63D
polymorphic sites.
[0108] These results indicate that the use of solid phase
capturable biotin-ddNTPs in SBE, coupled with MALDI-TOF MS
detection, provides a rapid and accurate method for multiplex SNP
detection over broad mass ranges and should greatly increase the
number of SNPs that can be detected simultaneously. In multiplex
SBE reactions, the oligonucleotide primers and their
dideoxynucleotide extension products differ by only one base pair,
which requires analytical techniques with high resolution to
resolve. In addition, a primer designed to detect one polymorphism
and an extension product from another polymorphic site may have the
same size, which can not be separated by electrophoresis and other
conventional chromatographic or size exclusion methods. Methods for
purifying DNA samples using the strong interaction of biotin and
streptavidin are widely used (23-27). By introducing the biotin
moiety at the 3' end of DNA, the solid phase based affinity
purification approach described here is a unique and effective
method to remove the oligonucleotide primers from the
dideoxynucleotide extension products.
[0109] To increase the stability of DNA fragments for MALDI-TOF MS
measurement in multiplex SNP analysis, nucleotide analogues (28)
and peptide nucleic acid (9) can be used in the construction of the
oligonucleotide primers. It has been shown that MALDI-TOF MS could
detect DNA fragments up to 100 bp with sufficient resolution (29).
The mass difference between each adjacent DNA fragment is
approximately 300 Da. Thus, with a mass difference of 100 Da for
each primer in designing a multiplex SNP analysis project, at least
300 SNPs can be analyzed in a single spot of the sample plate by
MS. It is a routine method now to place 384 spots in each sample
plate in MS analysis. Thus, each plate can produce over 100,000
SNPs, which is roughly the entire SNPs in all the coding regions of
the human genome. This level of multiplexing should be achievable
by mass tagging the primers with stable chemical groups in SBE
using biotin-ddNTPs. For SNP sites of interest, a master database
of primers and the resulting masses of all four possible extension
products can be constructed. The experimental data from MALDI-TOF
MS can then be compared with this database to precisely identify
the library of SNPs automatically. This method coupled with future
improvements in mass spectrometer detector sensitivity (30) will
provide a platform for high-throughput SNP identification unrivaled
in speed and accuracy.
[0110] C. Design and Synthesis of Biotinylated Dideoxynucleotides
with Mass Tags
[0111] The ability to distinguish various bases in DNA using mass
spectrometry is dependent on the mass differences of the bases in
the spectra. For the above work, the smallest difference in mass
between any two nucleotides is 16 daltons (see Table 1). Fei et al.
(15) have shown that using dye-labeled ddNTP paired with a regular
dNTP to space out the mass difference, an increase in the detection
resolution in a single nucleotide extension assay can be achieved.
To enhance the ability to distinguish peaks in the spectra, the
current application discloses systematic modification of the
biotinylated dideoxynucleotides by incorporating mass linkers
assembled using 4-aminomethyl benzoic acid derivatives to increase
the mass separation of the individual bases. The mass linkers can
be modified by incorporating one or two fluorine atoms to further
space out the mass differences between the nucleotides. The
structures of four biotinylated ddNTPs are shown in FIG. 3.
ddCTP-11-biotin is commercially available (New England Nuclear,
Boston). ddTTP-Linker I-11-Biotin, ddATP-Linker II-11-Biotin and
ddGTP-Linker III-11-Biotin are synthesized as shown, for example,
for ddATP-Linker II-11-Biotin in FIG. 5. In designing these mass
tag linker modified biotinylated ddNTPs, the linkers are attached
to the 5-position on the pyrimidine bases (C and T), and to the
7-position on the purines (A and G) for subsequent conjugation with
biotin. It has been established that modification of these
positions on the bases in the nucleotides, even with bulky energy
transfer fluorescent dyes, still allows efficient incorporation of
the modified nucleotides into the DNA strand by DNA polymerase (32,
33). Thus, the ddNTPs-Linker-11-biotin can be incorporated into the
growing strand by the polymerase in DNA sequencing reactions.
Larger mass separations will greatly aid in longer read lengths
where signal intensity is smaller and resolution is lower. The
smallest mass difference between two individual bases is over three
times as great in the mass tagged biotinylated ddNTPs compared to
normal ddNTPs and more than double that achieved by the standard
biotinylated ddNTPs as shown in Table 2. TABLE-US-00002 TABLE 2
Relative mass differences (daltons) of dideoxynucleotides using
ddCTP as a reference. Commercial Biotinylated Standard Biotinylated
ddNTP with Base ddNTP ddNTP mass tag linker C relative to C 0 0 0
(no linker) T relative to C 15 89 (16 linker) 125 (Linker I) A
relative to C 24 24 165 (Linker II) G relative to C 40 40 200
(Linker III) Smallest relative 9 16 35 difference
[0112] Three 4-aminomethyl benzoic acid derivatives Linker I,
Linker II and Linker III are designed as mass tags as well as
linkers-for bridging biotin to the corresponding
dideoxynucleotides. The synthesis of Linker II (FIG. 4) is
described here to illustrate the synthetic procedure.
3-Fluoro-4-aminomethyl benzoic acid that can be easily prepared via
published procedures (41, 42) is first protected with
trifluoroacetic anhydride, then converted to N-hydroxysuccinimide
(NHS) ester with disuccinimidylcarbonate in the presence of
diisopropylethylamine. The resulting NHS ester is subsequently
coupled with commercially available propargylamine to form the
desired compound, Linker II. Using an analogous procedure, Linker I
and Linker III can be easily constructed.
[0113] FIG. 5 describes the scheme required to prepare biotinylated
ddATP-Linker II-11-Biotin using well-established procedures
(34-36). 7-I-ddA is coupled with linker II in the presence of
tetrakis(triphenylphosphine) palladium(0) to produce 7-Linker
II-ddA, which is phosphorylated with POCl.sub.3 in butylammonium
pyrophosphate (37). After removing the trifluoroacetyl group with
ammonium hydroxide, 7-Linker II-ddATP is produced, which then
couples with sulfo-NHS-LC-Biotin (Pierce, Rockford Ill.) to yield
the desired ddATP-Linker II-11-Biotin. Similarly, ddTTP-Linker
I-11-Biotin, and ddGTP-Linker III-11-Biotin can be synthesized.
[0114] D. Design and Synthesis of Mass Tagged ddNTPs Containing
Photocleavable Biotin
[0115] A schematic of capture and cleavage of the photocleavable
linker on the streptavidin coated porous surface is shown in FIG.
6. At the end of the reaction, the reaction mixture consists of
excess primers, enzymes, salts, false stops, and the desired DNA
fragment. This reaction mixture is passed over a
streptavidin-coated surface and allowed to incubate. The
biotinylated fragments are captured by the streptavidin surface,
while everything else in the mixture is washed away. Then the
fragments are released into solution by cleaving the photocleavable
linker with near ultraviolet (UV) light, while the biotin remains
attached to the streptavidin that is covalently bound to the
surface. The pure DNA fragments can then be crystallized in matrix
solution and analyzed by mass spectrometry. It is advantageous to
cleave the biotin moiety since it contains sulfur which has several
relatively abundant isotopes. The rest of the DNA fragments and
linkers contain only carbon, nitrogen, hydrogen, oxygen, fluorine
and phosphorous, whose dominant isotopes are found with a relative
abundance of 99% to 100%. This allows high resolution mass spectra
to be obtained. The photocleavage mechanism (38, 39) is shown in
FIG. 7. Upon irradiation with ultraviolet light at 300-350 nm, the
light sensitive o-nitroaromatic carbonamide functionality on DNA
fragment 1 is cleaved, producing DNA fragment 2, PC-biotin and
carbon dioxide. The partial chemical linker remaining on DNA
fragment 2 is stable for detection by mass spectrometry.
[0116] Four new biotinylated ddNTPs disclosed here,
ddCTP-PC-Biotin, ddTTP-Linker I-PC-Biotin, ddATP-Linker
II-PC-Biotin and ddGTP-Linker III-PC-Biotin are shown in FIG. 8.
These compounds are synthesized by a similar chemistry as shown for
the synthesis of ddATP-Linker II-11-Biotin in FIG. 6. The only
difference is that in the final coupling step NHS-PC-LC-Biotin
(Pierce, Rockford Ill.) is used, as shown in FIG. 9. The
photocleavable linkers disclosed here allow the use of solid phase
capturable terminators and mass spectrometry to be turned into a
high throughput technique for DNA analysis.
[0117] E. Overview of Capturing a DNA Fragment Terminated With a
ddNTP on a Surface and Freeing the ddNTP and DNA Fragment
[0118] The DNA fragment is terminated with a dideoxynucleoside
monophosphate (ddNMP). The ddNMP is attached via a linker to a
chemical moiety ("X" in FIG. 10). The DNA fragment terminated with
ddNMP is captured on the surface through interaction between
chemical moiety "X" and a compound on or attached to the surface
("Y" in FIG. 10). The present application discloses two methods for
freeing the captured DNA fragment terminated with ddNMP. In the
situation illustrated in the lower part of FIG. 10, the DNA
fragment terminated with ddNMP is freed from the surface by
disrupting or breaking the interaction between chemical moiety "X"
and compound "Y". In the upper part of FIG. 10, the DNA fragment
terminated with ddNMP is attached to chemical moiety "X" via a
cleavable linker which can be cleaved to free the DNA fragment
terminated with ddNMP.
[0119] Different moieties and compounds can be used for the "X"-"Y"
affinity system, which include but are not limited to,
biotin-streptavidin, phenylboronic acid-salicylhydroxamic acid
(31), and antigen-antibody systems.
[0120] In different embodiments, the cleavable linker can be
cleaved and the "X"-"Y" interaction can be disrupted by a means
selected from the group consisting of one or more of a physical
means, a chemical means, a physical chemical means, heat, and
light. In one embodiment, ultraviolet light can be used to cleave
the cleavable linker. Chemical means include, but are not limited
to, ammonium hydroxide (40), formamide, or a change in pH (-log
H.sup.+ concentration) of the solution.
[0121] F. High Density Streptavidin-Coated, Porous Silica Channel
System.
[0122] Streptavidin coated magnetic beads are not ideal for using
the photocleavable biotin capture and release process for DNA
fragments, since they are not transparent to UV light. Therefore,
the photocleavage reaction is not efficient. For efficient capture
of the biotinylated fragments, a high-density surface coated with
streptavidin is essential. It is known that the commercially
available 96-well streptavidin coated plates cannot provide a
sufficient surface area for efficient capture of the biotinylated
DNA fragments. Disclosed in this application is a porous silica
channel system designed to-overcome this limitation.
[0123] To increase the surface area available for solid phase
capture, porous channels are coated with a high density of
streptavidin. For example, ninety-six (96) porous silica glass
channels can be etched into a silica chip (FIG. 11). The surfaces
of the channels are modified to contain streptavidin as shown in
FIG. 12. The channel is first treated with 0.5 M NaOH, washed with
water, and then briefly pre-etched with dilute hydrogen fluoride.
Upon cleaning with water, the capillary channel is coated with high
density 3-aminopropyltrimethoxysilane in aqueous ethanol (43). An
excess of disuccinimidyl glutarate in N,N-dimethylformamide (DMF)
is then introduced into the capillary to ensure a highly efficient
conversion of the surface end group to a succinimidyl ester.
Streptavidin is then conjugated with the succinimidyl ester to form
a high-density surface using excess streptavidin solution. The
resulting 96-channel chip is used as a purification cassette.
[0124] A 96-well plate that can be used with biotinylated
terminators for DNA analysis is shown in FIG. 11. In the example
shown, each end of a channel is connected to a single well.
However, for other applications, the end of a channel could be
connected to a plurality of wells. Pressure is applied to drive the
samples through a glass capillary into the channels on the chip.
Inside the channels the biotin is captured by the covalently bound
streptavidin. After passing through the channel, the sample enters
into a clean plate in the other end of the chip. Pressure applied
in reverse drives the sample through the channel multiple times and
ensures a highly efficient solid phase capture. Water is similarly
added to drive out the reaction mixture and thoroughly wash the
captured fragments. After washing, the chip is irradiated with
ultraviolet light to cleave the photosensitive linker and release
the DNA fragments. The fragment solution is then driven out of the
channel and into a collection plate. After matrix solution is
added, the samples are spotted on a chip and allowed to crystallize
for detection by MALDI-TOF mass spectrometry. The purification
cassette is cleaned by chemically cleaving the biotin-streptavidin
linkage, and is then washed and reused.
Experimental Set II
[0125] A. Synopsis
[0126] The following experiments show the simultaneous genotyping
of 30 nucleotide variations in the p53 gene from human tumors in
one tube, by using solid phase capturable dideoxynucleotides to
generate single base extension products which are detected by mass
spectrometry. Both homozygous and heterozygous genotypes are
accurately determined with digital resolution. This is the highest
level of SNP multiplexing reported thus far using mass
spectrometry, indicating the approach will have wide applications
in screening a repertoire of genotypes in candidate genes as
potential markers for cancer and other diseases.
[0127] B. Introduction
[0128] With the completion of the Human Genome Project, a stage has
been set to screen genetic mutations for identifying disease genes
in a genomewide scale (44). Matrix-assisted laser
desorption/ionization time-of-flight mass spectrometry (MALDI-TOF
MS), which allows rapid DNA sample measurement yielding digital
data, has been explored to detect single nucleotide polymorphisms
(SNPs) using invasive cleavage (11) and primer-directed base
extension (14, 45). Conventional single base extension (SBE)
methods using MS to measure multiplex SNPs require unambiguous
simultaneous detection of a library of primers and their extension
products. However, limitations in resolution and sensitivity of
MALDI-TOF MS for longer DNA molecules make it difficult to
simultaneously measure DNA fragments over a large mass range. The
requirement to measure both primers and their extension products in
this range limits the scope of multiplexing. The use of MALDI-TOF
MS and molecular affinity for multiplex digital SNP detection using
solid phase capturable (SPC) dideoxynucleotides and SBE has
recently been explored, establishing the feasibility of
simultaneously measuring 20 SNPs in synthetic DNA templates (46).
This study shows the simultaneous genotyping of 30 nucleotide
variations, corresponding to known sites of cancer-associated
somatic mutations, in exons 5, 7 and 8 of the p53 gene from human
tumors in one tube using the SPC-SBE method. This is the highest
level of multiplexing reported thus far using mass spectrometry for
SNP analysis.
[0129] C. Materials and Methods
[0130] Multiplex PCR and single base extension reactions Multiplex
PCR was performed to amplify 3 regions in exons 5, 7 and 8 of the
p53 gene. The primers for each region were
5'-TATCTGTTCACTTGTGCCC-3' (exon 5, forward),
5'-CAGAGGCCTGGGGA-CCCTG-3'(exon 5, reverse),
5'-CTGCTTGCCACAGGTCTC-3'(exon 7, forward),
5'-CACAGCAG-GCCAGTGTGC-3' (exon 7, reverse),
5.sup.1-GGACCTGATTTCCTTAC-TG-3' (exon 8, forward), and
5'-TGAATCTGAGGCATAACTG-3' (exon 8, reverse). The 45 1 PCR reaction
consisted of 180 ng genomic DNA, 1.5 nmol dNTP, 4.5 1 10.times. PCR
buffer, 15 mM MgCl.sub.2, 4 pmol of forward and reverse primers for
exons 5 and 7, 6 pmol of forward and reverse primers for exon 8,
and 1.0 U of JumpStart RedAccuTaq DNA Polymerase. After a 5 min
96.degree. C. hot start, the touchdown PCR program was performed
with 10 cycles of 96.degree. C. (30 sec), 67.degree. C. to
57.degree. C. (-1.0.degree. C. per cycle, 30 sec) and 72.degree. C.
(30 sec), an additional 30 cycles of 96.degree. C. (30 sec),
57.degree. C. (30 sec) and 72.degree. C. (30 sec), and a final
extension at 72.degree. C. for 7 min. The 30 SBE primers (Table 3)
were designed to yield extension products with a sufficient mass
difference and to be extended simultaneously in a single tube.
Primer sequences were designed to avoid any overlap in mass, and
the formation of secondary structures. To evenly separate the
masses of such a large number of primers for SBE, some primers were
synthesized using methyl-dC and dU phosphoramidites (Glen Research)
to replace dC and dT respectively. Substitution of dC by methyl-dC
increased the primer mass by 14 Da whereas a change from dT to dU
decreased the mass by 14 Da. Primers were synthesized using an
Applied Biosystems DNA synthesizer. The procedures for the SBE,
solid phase purification and MALDI-TOF MS measurement were
performed as described (Kim et al., Analytical Biochemistry 2003,
316, 251). Direct DNA sequencing was conducted using energy
transfer terminator chemistry and a MegaBACE 1000 capillary DNA
sequencer (Amersham Bioscience).
[0131] D. Discussion
[0132] Thirty polymorphic sites, including the most frequently
mutated p53 codons, were chosen to explore the high multiplexing
scope of the SPC-SBE method (FIG. 1). Thirty primers specific to
each polymorphic site were designed to yield SBE products with
sufficient mass differences. This was achieved by tuning the mass
of some primers using methyl-dc and dU to replace dC and dT,
respectively. Human genomic DNA was amplified by multiplex PCR to
produce amplicons of three p53 exons. The 30 primers were mixed
with the PCR products and biotinylated dideoxynucleotides for SBE
to generate 3'-biotinylated extension DNA products. These products
were then captured by streptavidin-coated solid phase magnetic
beads, while the unextended primers and other components in the
reaction were washed away. The pure DNA products were subsequently
released from the solid phase and analyzed by MALDI-TOF MS. The
nucleotide at the polymorphic site is accurately identified by the
mass of the DNA extension product in a mass spectrum. Since only
the DNA extension products are isolated for MS analysis, the
resulting mass spectrum is free of non-extended primer peaks and
their associated dimers, increasing accuracy and scope of
multiplexing. The solid phase purification also facilitates
desalting of the captured DNA, a process that is critical for
accurate mass measurement by MALDI-TOF MS.
[0133] The SPC-SBE genotyping approach was used to analyze
nucleotide variations in 30 codons of 3 exons of the p53 gene from
30 Wilms' tumors, 19 head and neck squamous carcinomas and 3
colorectal carcinomas. Primer sequences are shown in Table 3 along
with the masses of the primers and their extension products.
Extension products of all 30 primers were resolved in the mass
spectrum, free from any unextended primers, yielding digital data
to unambiguously determine each nucleotide variation (FIGS.
13A-13C). Unextended primers occupy the mass range in the mass
spectrum decreasing the scope of multiplexing, and excess primers
can dimerize to form false peaks in the mass spectrum (21). The
excess primers and their associated dimers also compete for the ion
current, reducing the detection sensitivity of MS for the desired
DNA fragments. These complications were completely removed in the
SPC-SBE method. When using conventional ddNTPs, the mass difference
between ddATP and ddTTP is 9 Da, which is difficult to resolve by
MALDI-TOF MS (15). In the SPC-SBE method using biotinylated ddNTPs,
the difference between A and T is increased to 66 Da, which fosters
accurate detection of heterozygous genotypes.
[0134] None of the 30 Wilms' tumor samples showed somatic mutations
for the 30 polymorphic sites tested, yielding 30 distinct peaks
corresponding to the wild type p53 sequences in a mass spectrum
(FIG. 13A). In contrast, two of the 19 head and neck tumor samples
contained a genetic variation; one at codon 157 (G/T heterozygous
configuration; primary tumor biopsy; FIG. 13B) and the other at
codon 151 (C to T homozygous; squamous carcinoma cell line; FIG.
14). In the three colorectal tumor cell lines tested, one (HCT-116)
had 30 wild type p53 sequences for the 30 sites, yielding a mass
spectrum similar to the one shown in FIG. 13A, while the other two
(HT-29 and SW-480) had a G to A homozygous mutation in codon 273
(FIG. 13C). Both heterozygous and homozygous genotypes were clearly
detected in the 30 codons with great accuracy. The G/T heterozygote
(4684/4734 Da) was shown with two peaks corresponding to the wild
type and mutant alleles, respectively (FIG. 13B). These data,
confirmed by direct DNA sequencing, are consistent with the known
paucity of the p53 mutations in Wilms' tumor, and the known
occurrence of such mutations in squamous carcinomas and colorectal
carcinomas.
[0135] It has been reported that MALDI-TOF MS could detect DNA
sequencing fragments up to 100 bp with sufficient resolution using
cleavable primers (29). The mass difference between each adjacent
DNA sequencing fragment is approximately 300 Da. In principle, with
a mass difference of 100 Da for each primer in designing a
multiplex SNP analysis project using the SPC-SBE method, at least
300 SNPs can be analyzed in a single spot of an MS sample plate.
Thus, each MS sample plate with 384 spots can produce over 100,000
SNPs, which is roughly the number of tag SNPs required to identify
all the haplotypes in the human genome. This level of multiplexing
should be achievable by mass tuning the primers with nucleotide
analogues containing stable chemical groups (28). It is anticipated
that the SPC-SBE high-throughput digital SNP detection approach
will have wide applications in screening a repertoire of genotypes
in candidate genes as potential markers for cancer and other
diseases. TABLE-US-00003 TABLE 3 Thirty p53 codons and the
corresponding 30 SBE primers. Mass of Single Base Primer Primer
Extention Products (Da) Number Exon Codon Sequences (5'-3')
Modification Mass (Da) ddATP-B ddCTP-B ddGTP-B ddUTP-B 1 5 179
(CAT) GCGCTGCCCCCAC None 3857 4545 4522 4561 4611 2 5 157 (GTC)
GCCC GGCACCCGC methyl C 3980 4668 4645 4684 4734 3 5 179 (CAT)
GCGCTGCCCCCACC None 4146 4834 4811 4850 4900 4 5 163 (TAC)
CGCCATGGCCATCT methyl C 4270 4958 4935 4974 5024 5 5 158 (CGC)
CCGGCACCCGCGTCC None 4475 5163 5140 5179 5229 6 7 248 (CGG)
TGGGCGGCATGAACC None 4618 5306 5283 5322 5372 7 5 132 (AAG)
TCCCCTGCCCTCAACA methyl C 4736 5424 5401 5440 5490 8 8 298 (GAG)
AGGGGAGCCTCACCAC None 4876 5564 5541 5580 5630 9 8 285 (GAG)
GAGAGACCGGCGCACA methyl C 4995 5683 5660 5699 5749 10 5 161 (GCC)
CCCGCGTCCGCGCCATG None 5108 5796 5773 5812 5862 11 7 249 (AGG)
GGCGGCATGAACCGGAG methyl C 5341 6029 6006 6045 6095 12 8 266 (GGA)
GTAGTGGTAATCTACTGG dU 5486 6174 6151 6190 6240 13 8 286 (GAA)
AGAGACCGGCGCACAGAG methyl C 5638 6326 6303 6342 6392 14 7 258 (GAA)
CCTCACCATCATCACACTG methyl C 5765 6453 6430 6469 6519 15 5 176
(TGC) ACGGAGGTTGTGAGGCGCT dU 5897 6585 6562 6601 6651 16 5 152
(CCG) GTGGGTTGATTCCACACCCC dU 6041 6729 6706 6745 6795 17 8 273
(CGT) ACGGAACAGCTTTGAGGTGC None 6182 6870 6847 6886 6936 18 7 234
(TAC) CTGACTGTACCACCATCCACT None 6286 6974 6951 6990 7040 19 7 248
(CGG) TCCTGCATGGGCGGCATGAAC dU 6405 7093 7070 7109 7159 20 7 249
(AGG) GCATGGGCGGCATGAACCGGA None 6521 7209 7186 7225 7275 21 8 282
(CGG) TTGTGCCTGTCCTGGGAGAGAC dU 6698 7386 7363 7402 7452 22 8 278
(CCT) TGAGGTGCGTGTTTGTGCCTGT None 6819 7507 7484 7523 7573 23 5 135
(TGC) CCCTGCCCTCAACAAGATGTTTT None 6935 7623 7600 7639 7689 24 7
245 (GGC) TGTGTAACAGTTCCTGCATGGGC dU 7043 7731 7708 7747 7797 25 7
237 (ATG) TACCACCATCCACTACAACTACAT None 7170 7858 7835 7874 7924 26
7 242 (TGC) ACAAC TACATGTGTAACAGTTCCT dU 7282 7970 7947 7986 8036
27 7 241 (TCC) ACTACAACTACATGTGTAACAGTT methyl C 7390 8078 8055
8094 8144 28 8 275 (TGT) GGAACAGCTTTGAGGTGCGTGTTT methyl C 7497
8185 8162 8201 8251 29 5 141 (TGC) ATGTTTTGCCAACTGGCCAAGACCT None
7617 8305 8282 8321 8371 30 5 175 (CGC) CAGCACATGACGGAGGTTGTGAGGC
None 7772 8460 8437 8476 8526 The position of the nucleotide
variation tested in each codon is shown in bold. The primer
sequence and modification is specified and the modified nucleotides
are shown in bold. The mass of each primer is indicated along with
the mass of all four possible SBE products. The mass values in bold
specify the wild type nucleotide sequences (ddNTP-B = Biotinylated
dideoxynucleotides).
REFERENCES
[0136] 1) Kwok, P.-Y. (2000) Pharmacogenomics 1, 95-100. [0137] 2)
Roses A. (2000) Pharmacogenetics and the practice of medicine.
Nature. 405: 857-865. [0138] 3) The International SNP Map Working
Group (2001) Nature 409, 928-933. [0139] 4) Beavis, R. C. &
Chait, B. T. (1989) Rapid Commun. Mass Spectrom. 3, 436-439. [0140]
5) Li, J., Butler, J. M., Tan, Y., Lin, H., Royer, S., Ohler, L.,
Shaler, T. A., Hunter, J. A., Pollart, D. J., Monforte, J. A. &
Becker, C. H. (1999) Electrophoresis 20, 1258-1265. [0141] 6)
Griffin, T. J. & Smith, L. M. (2000) Trends. Biotechnol. 18,
77-84. [0142] 7) Graber, J. H., Smith, C. L. & Cantor, C. R.
(1999) Genetic Analysis: Biomol. Eng. 14, 215-219. [0143] 8)
Stoerker, J., Mayo, J. D., Tetzlaff, C. N., Sarracino, D. A.,
Schwope, I. & Richert, C. (2000) Nat. Biotechnol. 18,
1213-1216. [0144] 9) Ross, P. L., Lee, K. & Belgrader, P.
(1997) Anal. Chem. 69, 4197-4202. [0145] 10) Jiang-Baucom, P.,
Girard, J. E., Butler, J. & Belgrader, P. (1997) Anal. Chem.
69, 4894-4898. [0146] 11) Griffin, T. J., Hall, J. G., Prudent, J.
R. & Smith, L. M. (1999) Proc. Natl. Acad. Sci. USA. 96,
6301-6306. [0147] 12) Lyamichev, V., Mast, A. L., Hall, J. G.,
Prudent, J. R., Kaiser, M. W., Takova, T., Kwiatkowski, R. W.,
Sander, T. J., de Arruda, M., Arco, D. A., Neri, B. P. & Brow,
M. A. D. (1999) Nat. Biotechnol. 17, 292-296. [0148] 13) Haff, L.
A. & Smirnov, I. P. (1997) Nucleic Acids Res. 25, 3749-3750.
[0149] 14) Ross, P., Hall, L., Smirnov, I. P. & Haff, L. (1998)
Nat. Biotechncl. 16, 1347-1351. [0150] 15) Fei Z, Ono T, Smith L M.
(1998) MALDI-TOF mass spectrometric typing of single nucleotide
polymorphisms with mass-tagged ddNTPs. Nucleic Acids Res. 26:
2827-2828. [0151] 16) Tang K, Fu D J, Julien D, Braun A, Cantor C
R, Koster H. (1999) Chip-based genotyping by mass spectrometry.
Proc. Natl. Acad. Sci. USA. 96: 10016-10020. [0152] 17) Taranenko,
N. I., Allman, S. L., Golovlev, V. V., Taranenko, N. V., Isola, N.
R. & Chen, C. H. (1998) Nucleic Acids Res. 26, 2488-2490.
[0153] 18) Ju J. Nucleic Acid Sequencing with Solid Phase
Capturable Terminators. U.S. Pat. No. 5,876,936, issued Mar. 2,
1999. [0154] 19) Edwards, J. R., Itagaki, Y. & Ju, J. (2001)
Nucleic Acids Res. 29, e104 (p1-5). [0155] 20) Tong, A. K. &
Ju, J. (2002) Single nucleotide polymorphism detection by
combinatorial fluorescence energy transfer tags and biotinylated
dideoxynucleotides. Nucleic Acids Res. 30(5):e19. [0156] 21) Roskey
M T, Juhasz P, Smirnov I P, Takach E J, Martin S A, Haff L A.
(1996) DNA sequencing by delayed extraction-matrix-assisted laser
desorption/ionization time of flight mass spectrometry. Proc. Natl.
Acad. Sci. USA. 93: 4724-4729. [0157] 22) Hanson, E. H.,
Imperatore, G. & Burke, W. (2001) Am. J. Epidem. 154, 193-206.
[0158] 23) Langer P R, Waldrop A A, Ward D C. (1981) Enzymatic
synthesis of biotin-labeled polynucleotides: novel nucleic acid
affinity probes. Proc. Natl. Acad. Sci. USA. 78: 6633-6637. [0159]
24) Hawkins, T. L., O'Connor-Morin, T., Roy, A. & Santillan, C.
(1994) Nucleic Acids Res. 22, 4543-4544. [0160] 25) Uhlen, M.
(1989) Nature, 340, 733-734. [0161] 26) Wahlberg, J., Lunderberg,
J., Hultman, T. & Uhlen, M. (1990) Proc. Natl. Acad. Sci. USA.
87, 6569-6573. [0162] 27) Tong, X., Smith L M (1992) Solid-Phase
Method for the Purification of DNA Sequencing Reactions. Anal.
Chem. 64: 2672-2677. [0163] 28) Schneider K, Chait B T. (1995)
Increased stability of nucleic acids containing 7-deaza-guanosine
and 7-deaza-adenosine may enable rapid DNA sequencing by
matrix-assisted laser desorption mass spectrometry. Nucleic Acids
Res. 23: 1570-1575. [0164] 29) Monforte J A, Becker C H (1997)
High-throughput DNA analysis by time-of-flight mass spectrometry.
Nat Medicine. 3(3): 360-362. [0165] 30) Hilton, G. C., Martinis, J.
M., Wollman, D. A., Irwin, K. D., Dulcie, L. L., Gerber, D.,
Gillevet, P. M. & Twerenbold, D. (1998) Nature 391, 672-675.
[0166] 31) Bergseid M, Baytan A R, Wiley J P, Ankener W M,
Stolowitz, Hughs K A, Chestnut J D (November 2000) Small-molecule
base chemical affinity system for the purification of proteins.
BioTechniques 29: 1126-1133. [0167] 32) Rosenblum B B, Lee L G,
Spurgeon S L, Khan S H, Menchen S M, Heiner C R, Chen S M. (1997)
New dye-labeled terminators for improved DNA sequencing patterns.
Nucleic Acids Res. 25: 4500-4504. [0168] 33) Zhu Z, Chao J, Yu H,
Waggoner A S. (1994) Directly labeled DNA probes using fluorescent
nucleotides with different length linkers. Nucleic Acids Res. 22:
3418-3422. [0169] 34) Prober J M, Trainor G L, Dam R J, Hobbs F W,
Robertson C W, Zagursky R J, Cocuzza A J, Jensen M A, Baumeister K.
(1987) A system for rapid DNA sequencing with fluorescent
chain-terminating dideoxynucleotides. Science 238: 336-341. [0170]
35) Lee L G, Connell C R, Woo S L, Cheng R D, Mcardle B F, Fuller C
W, Halloran N D, Wilson R K. (1992) DNA sequencing with dye-labeled
terminators and T7 DNA-polymerase-effect of dyes and dNTPs on
incorporation of dye-terminators and probability analysis of
termination fragments. Nucleic Acids Res. 20: 2471-2483. [0171] 36)
Hobbs F W Jr, Cocuzza A J. Alkynylamino-Nucleotides. U.S. Pat. No.
5,047,519, issued Sep. 10, 1991. [0172] 37) Burgess K, Cook D.
(2000) Chemical Reviews. 100: 2047-2060. [0173] 38) Olejnik J,
Sonar S, Krzymanska-Olejnik E, Rothschild K J. (1995)
Photocleavable biotin derivatives: a versatile approach for the
isolation of biomolecules. Proc. Natl. Acad. Sci. USA. 92:
7590-7594. [0174] 39) Olejnik J, Ludemann H C, Krzymanska-Olejnik
E, Berkenkamp S, Hillenkamp F, Rothschild K J. (1999)
Photocleavable peptide-DNA conjugates: synthesis and applications
to DNA analysis using MALDI-MS. Nucleic Acids Res. 27: 4626-4631.
[0175] 40) Jurinke C, van de Boom D, Collazo V, Luchow A, Jacob A,
Koster H. (1997) Recovery of nucleic acids from immobilized
biotin-streptavidin complexes using ammonium hydroxide and
applications in MALDI-TOF mass spectrometry. Anal. Chem. 69:
904-910. [0176] 41) Maudling D R, Lotts K D, Robinson S A. (1983)
New procedure for making 2-(chloromethyl)-4-nitrotoluene. J. Org.
Chem. 48: 2938. [0177] 42) Rolla F. (1982) Sodium-borohydride
reactions under phase-transfer conditions--reduction of azides to
amines. J. Org. Chem. 47: 4327-4329. [0178] 43) Woolley A T,
Mathies R A. (1994) Ultra-high-speed DNA fragment separations using
microfabricated capillary array electrophoresis chips. Proc. Natl.
Acad. Sci. USA. 91: 11348-11352. [0179] 44) Collins F S, Green E D,
Guttmacher, A E and Guyer M S. (2003) Nature 422: 835-847. [0180]
45) Jurinke C, van den Boom D, Cantor C R and Koster H. (2002)
Methods Mol. Biol.187: 179-192 [0181] 46) Kim S et al. (2003)
Analytical Biochemistry 316: 251-258
Sequence CWU 1
1
14 1 19 DNA Artificial Sequence primer 1 ctacccccag aacatcacc 19 2
22 DNA Artificial Sequence primer 2 gcactacctc ttcatgggtg cc 22 3
18 DNA Artificial Sequence primer 3 catcagtcac atacccca 18 4 22 DNA
Artificial Sequence primer 4 cagtgaacat gtgatcccac cc 22 5 13 DNA
Artificial Sequence artificial internal mass standard, no natural
correlate 5 tttttctttt tct 13 6 22 DNA Artificial Sequence human
HFE gene primer 6 ggggaagagc agagatatac gt 22 7 24 DNA Artificial
Sequence human HFE gene primer 7 ggggctccac acggcgactc tcat 24 8 18
DNA Artificial Sequence human HFE gene primer 8 agaggatcca accgagac
18 9 23 DNA Artificial Sequence human p53 gene primer 9 tggtggtagg
tgatgttgat gta 23 10 22 DNA Artificial Sequence human p53 gene
primer 10 cacattgtca aggacgtacc cg 22 11 20 DNA Artificial Sequence
human p53 gene primer 11 tacccgccgt acttggcctc 20 12 21 DNA
Artificial Sequence human p53 gene primer 12 tccacgcaca aacacggaca
g 21 13 100 DNA Artificial Sequence template based on human p53 13
taccckgagg ccaagtacgg cgggtacgtc cttgacaatg tgtacatcaa catcacctac
60 caccatgtca gtctcggttg gatcctctat tgtgtccggg 100 14 110 DNA
Artificial Sequence template based on human p53 14 gaaggagaca
cgcggccaga gagggtcctg tccgtgtttg tgcgtggagt ttcgacaagg 60
cagggtcatc taatggtgat gagtcctatc cttttctctt cgttctccgt 110
* * * * *