U.S. patent application number 11/490945 was filed with the patent office on 2006-11-09 for method for diagnosing alopecia.
Invention is credited to Hyun-Jun Jang, Soogyun Kim.
Application Number | 20060251604 11/490945 |
Document ID | / |
Family ID | 19709884 |
Filed Date | 2006-11-09 |
United States Patent
Application |
20060251604 |
Kind Code |
A1 |
Kim; Soogyun ; et
al. |
November 9, 2006 |
Method for diagnosing alopecia
Abstract
The present invention relates to novel hair follicle growth
factor (HFGF) proteins, genes encoding HFGFs, methods for preparing
HFGF proteins and therapeutic uses of HFGF proteins. The HFGF
proteins of the present invention have a characteristic reduced
expression in hair follicles derived from alopecia patients and
have a stimulatory effect on hair follicle cell proliferation. HFGF
proteins may be used to prevent or treat alopecia and to promote or
accelerate hair growth and hair follicle repair.
Inventors: |
Kim; Soogyun; (Seoul,
KR) ; Jang; Hyun-Jun; (Seoul, KR) |
Correspondence
Address: |
FAEGRE & BENSON LLP;PATENT DOCKETING
2200 WELLS FARGO CENTER
90 SOUTH 7TH STREET
MINNEAPOLIS
MN
55402-3901
US
|
Family ID: |
19709884 |
Appl. No.: |
11/490945 |
Filed: |
July 20, 2006 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10155292 |
May 24, 2002 |
7094569 |
|
|
11490945 |
Jul 20, 2006 |
|
|
|
Current U.S.
Class: |
424/70.14 ;
435/320.1; 435/325; 435/69.1; 530/399; 536/23.5 |
Current CPC
Class: |
A61K 38/00 20130101;
A61Q 7/00 20130101; G01N 2800/20 20130101; C07K 14/50 20130101;
G01N 33/6893 20130101; A61K 8/64 20130101; A61P 17/14 20180101;
G01N 33/74 20130101 |
Class at
Publication: |
424/070.14 ;
435/069.1; 435/320.1; 435/325; 530/399; 536/023.5 |
International
Class: |
A61K 8/64 20060101
A61K008/64; C07H 21/04 20060101 C07H021/04; C12P 21/06 20060101
C12P021/06; C07K 14/475 20060101 C07K014/475 |
Foreign Application Data
Date |
Code |
Application Number |
May 24, 2001 |
KR |
10-2001-0028621 |
Claims
1-44. (canceled)
45. A method for diagnosing a condition which results from
under-expression or altered expression of hair follicle growth
factor (HFGF) in a subject, said method comprising: collecting an
analytical sample from the subject; and analyzing the analytical
sample for HFGF protein or DNA encoding HFGF to determine whether
the subject under-expresses or has altered expression of HFGF.
46. The method of claim 45, wherein the condition is alopecia.
47. The method of claim 45, wherein said method comprises detecting
HFGF proteins in the analytical sample.
48. The method of claim 45, wherein said method comprises detecting
DNA encoding HFGF proteins in the analytical sample.
49. The method of claim 45, wherein the analytical sample is
selected from the group consisting of a tissue sample, a fluid
sample, and a combination thereof.
50. The method of claim 49, wherein the fluid sample comprises
blood.
51. The method of claim 49, wherein the tissue sample comprises a
hair follicle cell.
52. A method for determining whether a subject is predisposed to
developing alopecia, said method comprising: collecting an
analytical sample from the subject; and analyzing the analytical
sample for HFGF protein or DNA encoding HFGF to determine whether
the subject is predisposed to developing alopecia.
53. The method of claim 52, wherein said method comprises detecting
HFGF proteins in the analytical sample.
54. The method of claim 52, wherein said method comprises detecting
DNA encoding HFGF proteins in the analytical sample.
55. The method of claim 54, wherein said method for detecting DNA
encoding HFGF proteins comprises: obtaining mRNA from the
analytical sample; obtaining cDNA from the mRNA; and determining
the presence of cDNA that encodes HFGF proteins.
56. The method of claim 55, wherein the analytical sample comprises
a hair follicle cell.
Description
RELATED APPLICATIONS
[0001] The present application claims priority to Korean
Application 10-2001-0028621, filed May 24, 2001, which is hereby
incorporated by reference in their entireties.
FIELD OF THE INVENTION
[0002] The present invention relates to newly isolated hair
follicle growth factor (HFGF) proteins, genes encoding HFGF
proteins, methods of preparing HFGF proteins and genes encoding the
same, and therapeutic or diagnostic uses thereof. More
specifically, the present invention relates to HFGF proteins which
are newly isolated from hair follicles of human scalp skin, genes
encoding said HFGF proteins, expression vectors containing said
gene, host cells transformed with said vector, and methods for
recombinantly producing HFGF proteins and genes encoding the same.
HFGF proteins of the present invention have reduced expression in
hair follicles derived from alopecia patients and exhibit a
stimulatory effect on hair follicle cell proliferation. HFGF
proteins and genes encoding the same are useful in prevention or
treatment of alopecia and in promotion, acceleration or induction
of hair growth and hair follicle repair. In addition, HFGF proteins
and genes encoding the same can be applied for hair transplantation
in alopecia patients. Moreover, HFGF proteins and genes encoding
the same can be used to diagnose alopecia symptoms.
BACKGROUND OF THE INVENTION
[0003] The hair follicle is an epidermal derivative that undergoes
cycles of growth (anagen), involution (catagen), and rest
(telogen). Although the mechanisms underlying hair cycling have not
been fully elucidated, the core of the process involves
interactions between the mesenchymal and epithelial cell
populations within the hair follicle unit (Jahoda, C. A. &
Reynolds, A. J. (1996) Dermatol. Clin. 14, 573-583). The most
obvious regulator of the cycle is the papillary mesenchyme, in
particular the dermal papilla.
[0004] Factors from the papillary mesenchyme act as inductive
signals for cycling of the follicular epithelium (Peus, D. &
Pittelkow, M. R. (1996) Dermatol. Clin. 14, 559-572). In
particular, it has been inferred that epithelial stem cells, which
reside in the bulge area of the hair follicles, can respond to the
inductive signals from the dermal papilla and become activated
(Cotsarelis, G., Sun, T. T. & Lavker, R. M. (1990) Cell 61,
1329-1337). This activation leads to proliferation of stem cells in
the bulge area, and then the stem cell progeny forms a downgrowth
into the deep dermis, followed by differentiative growth of matrix
cells and generation of the complex follicular product, the shaft,
and its housing sheath.
[0005] Analyses of the skin phenotypes of a considerable number of
transgenic or gene knockout mice have shed light on the mesenchymal
(dermal papilla) and epithelial (keratinocyte) interactions
involved in the morphogenesis of hair follicles in the fetus (Gat,
U. et al. (1998) Cell 95, 605-614; Chiang, C. et al. (1999) Dev.
Biol. 205, 1-9; Botchkarev, V. A. et al. (1999) Nat. Cell Biol. 1,
158-164). The mechanisms underlying the biological switching
process in postnatal follicles occurring between telogen and
anagen, however, have remained unclear. The most likely candidate
for factors inducing such switching is KGF-2, because KGF-2 is
found in dermal papilla fibroblasts and its receptor, FGFR2IIIb, is
found in neighboring keratinocytes (Katsuoka K., Schell H.,
Hornstein O. P., Wessel B. (1987) Br. J. Dermatol Mar 116(3),
464-5).
[0006] The kgf-2 (fgf-10) gene is a member of the fibroblast growth
factor (referred to hereinfter as "FGF") gene family comprising
more than 22 genes in mammals (Nishimura T., Nakatake Y., Konishi
M., Itoh N. (2000) Biochim. Biophys. Acta. 1492, 203-206). The FGF
proteins are thought to regulate cellular proliferation,
differentiation, migration, and survival by binding to and
activating members of a family of tyrosine kinase receptors, i.e.
FGF receptors (FGFRs). Among the 22 known FGF proteins, KGF-2 is
structurally most related to FGF-7 (Miki T. et al. (1991) Science
251, 72-75; Ornitz D. M. et al. (1996) J. Biol. Chem. 271,
15292-15297; Igarashi M. et al. (1998) J. Biol. Chem. 273,
13230-13235), and both FGFs specifically bind to one isoform out of
four FGFRs, i.e. FGFR2IIIb (Miki T. et al. (1991) Science 251,
72-75; Ornitz D. M. et al. (1996) J. Biol. Chem. 271, 15292-15297;
Igarashi M. et al. (1998) J. Biol. Chem. 273, 13230-13235).
[0007] Functionally, KGF-2 has been shown to be involved in
outgrowth of the limb bud and branching morphogenesis of the lung
(Martin G. R. (1998) Genes Dev. 12, 1571-15869). The limb and lung
buds are typical examples of organprimordia, which require intimate
epithelial-mesenchymal interactions during development.
[0008] In epithelial-mesenchymal interactions, signals from the
mesenchyme direct epithelial components to generate specific
structures through budding or branching morphogenesis, and
reciprocal interactions between the two tissues must be maintained
during further development.
[0009] U.S. Pat. Nos. 5,184,605, 5,824,643 and 5,965,530 discuss
the role of KGF-1 in the stimulation of proliferation, growth and
differentiation in various cells of epithelial tissue, besides
keratinocytes. It is thought that KGF-1 may be used as a
therapeutic agent for the specific treatment of disease states and
medical conditions afflicting tissues and organs such as the dermal
adnexae, the liver, the lung and the gastrointestinal tract. The
dermal adnexae include sebaceous glands, sweat glands and hair
follicles.
[0010] The re-epithelialization activity of KGF has only been
observed in dermis having an induced wound. The use of KGF for
treatment of inherited alopecia is not taught or suggested by any
of the above references.
[0011] Ruben et al., U.S. Pat. No. 6,077,692, disclose a newly
identified KGF-2 which exhibits biological activities such as wound
healing, anti-inflammatory effects, stimulation of differentiation
and proliferation of liver cells and protection against lung
damage. However, there is no experimental data regarding the effect
of KGF-2 on the proliferation of hair follicle cells.
SUMMARY OF THE INVENTION
[0012] The present inventors have undertaken studies in an attempt
to isolate a molecular factor for treating alopecia and have
developed hair follicle growth factor (HFGF) proteins from human
hair follicle, which have a reduced expression in hair follicles
derived from alopecia patients and show stimulatory effects on hair
follicle cell proliferation. The amino acid sequence of HFGF
protein (SEQ ID NO: 1) is provided in FIG. 8. HFGF is considered to
be an allelic form of keratinocyte growth factor-2 (KGF-2) wherein
HFGF has a glutamic acid residue (Glu) at position 87, whereas
KGF-2 has a lysine residue (Lys) at this position.
[0013] In one aspect, the present invention provides an isolated
polypeptide having the amino acid sequence of Ser 69 to Ser 208 of
SEQ ID NO:1 or an isolated polypeptide comprising the amino acid
sequence of Ser 69 to Ser 208 of SEQ ID NO:1, wherein Glu 87 is
replaced by Asp 87.
[0014] In another aspect, the present invention provides an
isolated nucleic acid molecule comprising a nucleotide sequence
encoding the amino acid sequence of Ser 69 to Ser 208 of SEQ ID NO:
1 or an isolated nucleic acid molecule comprising a nucleotide
sequence encoding the amino acid sequence of Ser 69 to Ser 208 of
SEQ ID NO: 1, wherein Glu 87 is replaced by Asp 87.
[0015] In other aspect, the present invention provides a vector
comprising the nucleic acid encoding the amino acid sequence of Ser
69 to Ser 208 of SEQ ID NO: 1 or the amino acid sequence of Ser 69
to Ser 208 of SEQ ID NO: 1, wherein Glu 87 is replaced by Asp
87.
[0016] In still other aspect, the present invention provides a host
cell transfected with the vector comprising a transcription
promoter, a DNA encoding the amino acid sequence of Ser 69 to Ser
208 of SEQ ID NO: 1 or the amino acid sequence of Ser 69 to Ser 208
of SEQ ID NO: 1, wherein Glu 87 is replaced by Asp 87, and a
transcription terminator, wherein said promoter is operably linked
to the DNA segment, and the DNA segment is operably linked to the
transcription terminator.
[0017] In a further aspect, the present invention provides a method
of producing a polypeptide comprising an amino acid sequence of Ser
69 to Ser 208 of SEQ ID NO: 1 which comprises culturing a host cell
under conditions such that said polypeptide is expressed, and
isolating said polypeptide from the cultures, wherein said host
cell is transfected with the vector comprising a transcription
promoter, a DNA encoding the amino acid sequence of Ser 69 to Ser
208 of SEQ ID NO: 1, and a transcription terminator, said promoter
being operably linked to the DNA, and the DNA being operably linked
to the transcription terminator. Also, the present invention
provides a method of producing an isolated polypeptide comprising
an amino acid sequence of Ser 69 to Ser 208 of SEQ ID NO: 1,
wherein Glu 87 is replaced by Asp 87, which comprises culturing a
host cell under conditions such that said polypeptide is expressed
and isolating said polypeptide from the cultures, wherein said host
cell is transfected with the vector comprising a transcription
promoter, a nucleic acid encoding the amino acid sequence of Ser 69
to Ser 208 of SEQ ID NO: 1, wherein Glu 87 is replaced by Asp 87,
and a transcription terminator, said promoter being operably linked
to the DNA, and the DNA being operably linked to the transcription
terminator.
[0018] In an additional aspect, the present invention provides a
pharmaceutical composition comprising the polypeptide which
comprises an amino acid sequence of Ser 69 to Ser 208 of SEQ ID NO:
1 or an amino acid sequence of Ser 69 to Ser 208 of SEQ ID NO: 1
wherein Glu 87 is replaced by Asp 87, and a pharmaceutically
acceptable carrier.
[0019] In still another aspect, the present invention provides a
pharmaceutical composition comprising the nucleic acid molecule
which comprises the nucleotide sequence encoding the amino acid
sequence of Ser 69 to Ser 208 of SEQ ID NO: 1 or the nucleotide
sequence encoding an amino acid sequence of Ser 69 to Ser 208 of
SEQ ID NO: 1, wherein Glu 87 is replaced by Asp 87, and a
pharmaceutically acceptable carrier.
[0020] In still another aspect, the present invention provides a
method for treating, preventing or ameliorating alopecia in a
subject, which comprises administering the composition containing
the polypeptide comprising an amino acid sequence of Ser 69 to Ser
208 of SEQ ID NO: 1 or the polypeptide comprising an amino acid
sequence of Ser 69 to Ser 208 of SEQ ID NO: 1, wherein Glu 87 is
replaced by Asp 87, and a pharmaceutically acceptable carrier, to
said subject.
[0021] In still another aspect, the present invention provides a
method for treating, preventing or ameliorating alopecia in a
subject, which comprises administering the composition containing
the nucleic acid molecule encoding an amino acid sequence of Ser 69
to Ser 208 of SEQ ID NO: 1 or the nucleic acid molecule encoding an
amino acid sequence of Ser 69 to Ser 208 of SEQ ID NO: 1 wherein
Glu 87 is replaced by Asp 87, and a pharmaceutically acceptable
carrier, to said subject.
[0022] In another aspect, the present invention provides a method
for stimulating, accelerating or inducing hair growth or hair
follicle repair in a subject, which comprises administering the
composition containing the polypeptide comprising an amino acid
sequence of Ser 69 to Ser 208 of SEQ ID NO: 1 or the polypeptide
comprising an amino acid sequence of Ser 69 to Ser 208 of SEQ ID
NO: 1 wherein Glu 87 is replaced by Asp 87, and a pharmaceutically
acceptable carrier to said subject.
[0023] In another aspect, the present invention provides a method
for stimulating, accelerating or inducing hair growth or hair
follicle repair in a subject which comprises administering the
composition containing the nucleic acid molecule encoding an amino
acid sequence of Ser 69 to Ser 208 of SEQ ID NO: 1 or the nucleic
acid molecule encoding an amino acid sequence of Ser 69 to Ser 208
of SEQ ID NO: 1 wherein Glu 87 is replaced by Asp 87, and a
pharmaceutically acceptable carrier, to said subject.
[0024] In another aspect, the present invention provides a method
for transplanting hair in a subject which comprises supplementing
scalp hair follicles or grafts with the polypeptide comprising an
amino acid sequence of Ser 69 to Ser 208 of SEQ ID NO: 1 or the
polypeptide comprising an amino acid sequence of Ser 69 to Ser 208
of SEQ ID NO: 1, wherein Glu 87 is replaced by Asp 87 and
transplanting the supplemented hair grafts or follicles with the
polypeptide to the bald or thinning area of said subject. Also, the
present invention provides a method for transplanting hair in a
subject which comprises supplementing scalp hair follicles or
grafts with the nucleic acid molecule encoding an amino acid
sequence of Ser 69 to Ser 208 of SEQ ID NO: 1 or the nucleic acid
molecule encoding an amino acid sequence of Ser 69 to Ser 208 of
SEQ ID NO: 1, wherein Glu 87 is replaced by Asp 87.
[0025] In another aspect, the present invention provides a method
for diagnosing alopecia in a subject comprising collecting a blood
or tissue sample from said subject and detecting HFGF proteins in
said sample.
BRIEF DESCRIPTION OF THE DRAWINGS
[0026] The foregoing summary, as well as the following detailed
description of the invention, will be better understood when read
in conjunction with the appended drawings. For the purpose of
illustrating the invention, the drawings exhibit embodiment(s)
which are presently preferred. It should be understood, however,
that the invention is not limited to the precise arrangements and
instrumentalities shown.
[0027] FIG. 1 shows a nucleotide and amino acid sequence comparison
between human HFGF of the present invention and known human
KGF-2.
[0028] FIG. 2 is a photograph of an SDS-polyacrylamide
electrophoresis gel (SDS-PAGE) showing the molecular mass of
GST-HFGF and HFGF prepared by a method of the present
invention.
[0029] FIG. 3 shows the expression levels of HFGF and HFGF
receptor, respectively, in hair follicles which were derived from
human scalp skin of normal persons or alopecia patients.
[0030] FIG. 4 shows a restriction map of the pGEM-T-KGF-2A
constructed by inserting HFGF DNA having the nucleotide sequence of
SEQ ID NO:2 into the pGEM-T vector.
[0031] FIG. 5 is a graph showing the stimulatory activity of HFGF
protein on hair follicle cell proliferation identified by
colorimetric MTS assays.
[0032] FIG. 6A is a bar graph showing the stimulatory activity of
HFGF on proliferation of hair follicles which were derived from a
normal person and in which dermal papilla were removed
surgically.
[0033] FIG. 6B is a bar graph showing the stimulatory activity of
HFGF on proliferation of hair follicle cells with dermal
papilla.
[0034] FIG. 7A is a bar graph showing the stimulatory activity of
KGF-1, KGF-2 and HFGF, respectively, on proliferation of hair
follicles derived from alopecia patients.
[0035] FIG. 7B is a bar graph showing the stimulatory activity of
KGF-1, KGF-2 and HFGF, respectively, on the proliferation of hair
follicles which were derived from alopecia patients and in which
dermal papilla were removed surgically.
[0036] FIG. 8 shows the amino acid sequence of hair follicle growth
factor (HFGF) (SEQ ID NO:1).
[0037] FIG. 9 shows that nucleic acid sequence encoding hair
follicle growth factor (HFGF) (SEQ ID NO:2).
DETAILED DESCRIPTION OF THE INVENTION
[0038] The full amino acid sequence and nucleotide sequence of
Keratinocyte Growth Factor-2 (KGF-2) are known in the art. The
polypeptide of the present invention shown in SEQ ID NO: 1 has an
amino acid sequence containing a glutamic acid residue at position
87, instead of a lysine residue at position 87. This polypeptide
was designated Hair Follicle Growth Factor and is referred to
herein as HFGF or HFGF protein. HFGF has a characteristic reduced
expression in hair follicles derived from alopecia patients and
shows a stimulatory effect on hair follicle cell proliferation.
According to the present invention, an amino acid sequence of Ser
69 to Ser 208 having a glutamic acid residue at position 87 as
shown in SEQ ID NO: 1 is found to be important to effecting hair
follicle cell proliferation. The polypeptides comprising at least
an amino acid sequence of Ser 69 to Ser 208 of SEQ ID NO: 1 are
nearly equal to HFGF in their stimulatory activity on hair follicle
cell proliferation. In particular, the amino acid residue at
position 89, i.e., glutamic acid (Glu 89), is found to have a
strong influence on hair follicle cell proliferation. Accordingly,
the polypeptides of the present invention include the polypeptides
further comprising at least one contiguous sequence of amino acids
Met 1 to Ala 39 of SEQ ID NO: 1 at the N-terminus of said
polypeptide. In addition, the polypeptides of the present invention
include the polypeptides having substitutions, deletions and/or
insertions of one, two, three, four or more amino acid residues in
the region of Met 1 to Ala 39 of SEQ ID NO: 1.
[0039] The polypeptides according to the present invention include
another group of polypeptides comprising an amino acid sequence in
glutamic acid at position 37 is replaced by aspartic acid (Asp).
Likewise, this group of the polypeptides having an aspartic acid
residue at position 87 includes the polypeptides further comprising
at least one contiguous sequence of amino acids Met 1 to Ala 39 of
SEQ ID NO: 1 at the N-terminus of said polypeptide and the
polypeptides having substitutions, deletions and/or insertions of
one, two, three, four or more amino acid residues in the region of
Met 1 to Ala 39 of SEQ ID NO: 1. As with Glu 87, Asp 87 plays an
important role in proliferation of hair follicle cells.
[0040] The isolated polypeptides as defined above are sometimes
collectively referred to herein as "HFGF proteins". Therefore,
examples of HFGF proteins are the polypeptide having Met 1 to Ser
208 of the amino acid sequence shown in SEQ ID NO: 1, the
polypeptide having Leu 40 to Ser 208 of the amino acid sequence
shown in SEQ ID NO: 1, and the polypeptide having Ser 69 to Ser 208
of the amino acid sequence shown in SEQ ID NO: 1.
[0041] Additionally, the polypeptides of the present invention may
further comprise a Met residue at the N-terminus of any of said
amino acid sequences. Moreover, the polypeptides of the present
invention may be mature proteins. These polypeptides are also
included in HFGF proteins of the present invention.
[0042] In the broadest aspect, the present invention therefore
provides an isolated polypeptide comprising an amino acid sequence
of Ser 69 to Ser 208 of SEQ ID NO: 1 or an isolated polypeptide
comprising an amino acid sequence of Ser 69 to Ser 208 of SEQ ID
NO: 1 wherein Glu 87 is replaced by Asp 87.
[0043] In one embodiment, the present invention is directed to a
HFGF that is newly isolated from hair follicles of human scalp skin
and is a variant or allelic form of known KGF-2. To isolate HFGF of
the present invention from hair follicles of human scalp skin,
total mRNA was extracted from hair follicles and cDNA was obtained
from total RNA by performing RT-PCR (Reverse
Transcriptase-Polymerase Chain Reaction). After the nucleotide
sequences of cDNA produced by the above RT-PCR were identified, the
amino acid sequences corresponding to the nucleotide sequences of
said cDNA were deduced and determined. One of the deduced amino
acid sequences was identified as an amino acid sequence wherein
glutamic acid replaces lysine at position 87 of the KGF-2 protein.
The amino acid sequence of HFGF protein is shown in SEQ ID NO:
1.
[0044] In another embodiment, the present invention is directed to
a variant or allelic form of HFGF wherein Asp 87 replaces Glu 87.
It was found by the inventors that a negatively charged amino acid
at position 87 of KGF-2 increases the hair follicle cell
proliferation activity in comparison to wild type KGF-2.
[0045] The HFGF proteins of the present invention can be readily
made by a conventional recombinant DNA technique. The coding region
for HFGF proteins can be obtained by standard procedures known in
the art from cloned DNA (e.g., a DNA "library"), by chemical
synthesis, by cDNA cloning, or by the cloning of genomic DNA, or
fragments thereof, purified from the desired cell (see, for
example, Sambrook et al., 1989, Molecular Cloning, A Laboratory
Manual, 2nd Ed., Cold Spring Harbor Laboratory Press, Cold Spring
Harbor, N.Y.; Glover, D. M. (ed.), 1985, DNA Cloning: A Practical
Approach, MRL Press, Ltd., Oxford, U.K. Vol. I, II.). Polymerase
chain reaction (PCR) can be used to amplify DNA sequences encoding
HFGF proteins in a genomic or cDNA library. Synthetic
oligonucleotides may be utilized as primers to amplify by PCR
sequences from a source (RNA or DNA), preferably a cDNA library.
The DNA being amplified can include cDNA or genomic DNA from any
human. After successful isolation or amplification of a segment of
HFGF, that segment may be molecularly cloned and sequenced, and
utilized as a probe to isolate a complete cDNA or genomic
clone.
[0046] Alternatives to isolating the coding regions for HFGF
proteins include, but are not limited to, chemically synthesizing
the gene sequence itself from the proposed sequence. Other methods
are possible and within the scope of the invention. The above
methods are not meant to limit the following general description of
methods by which HFGF proteins can be obtained.
[0047] The identified and isolated gene can be inserted into an
appropriate cloning vector for amplification of the gene sequence.
A large number of vector-host systems known in the art may be used.
Possible vectors include, but are not limited to, plasmids or
modified viruses, but the vector system must be compatible with the
host cell used. Such vectors include, but are not limited to,
bacteriophages such as lambda derivatives, or plasmids such as pBR
322 or pUC plasmid derivatives or the BLUESCRIPT vector
(Stratagene). The insertion into a cloning vector can, for example,
be accomplished by ligating the DNA fragment into a cloning vector
which has complementary cohesive termini. However, if the
complementary restriction sites used to fragment the DNA are not
present in the cloning vector, the ends of the DNA molecules may be
enzymatically modified. Alternatively, any site desired may be
produced by ligating nucleotide sequences (linkers) onto the DNA
termini; these ligated linkers may comprise specific chemically
synthesized oligonucleotides encoding restriction endonuclease
recognition sequences. In an alternative method, the cleaved vector
and gene may be modified by homopolymeric tailing. Recombinant
molecules can be introduced into host cells via transformation,
transfection, infection, electroporation, etc., so that many copies
of the gene sequence are generated.
[0048] In an alternative method, the desired gene may be identified
and isolated after insertion into a suitable cloning vector in a
"shot gun" approach. Enrichment of the desired gene, for example,
by size fractionation, can be done before insertion into the
cloning vector.
[0049] In specific embodiments, transformation of host cells with
recombinant DNA molecules that comprise the gene encoding HFGF
protein, cDNA, or synthesized DNA sequence enables generation of
multiple copies of the gene. Thus, the gene may be obtained in
large quantities by growing transformants, isolating the
recombinant DNA molecules from the transformants and, when
necessary, retrieving the inserted gene from the isolated
recombinant DNA. Copies of the gene are used in mutagenesis
experiments to study the structure and function of HFGF
proteins.
[0050] The mutations present in HFGF proteins of the present
invention can be produced by various methods known in the art. The
manipulations which result in their production can be produced at
the gene or protein level. For example, the cloned coding region of
the KGF-2 protein can be modified by any of numerous strategies
known in the art (Sambrook et al., 1990, Molecular Cloning, A
Laboratory Manual, 2nd. Ed., Cold Spring Harbor Laboratory, Cold
Spring Harbor, N.Y.). The sequence can be cleaved at appropriate
sites with restriction endonuclease(s), followed by further
enzymatic modification if desired, isolated, and ligated in vitro.
Additionally, the nucleic acid sequences encoding the HFGF proteins
can be mutated in vitro or in vivo, to create variations in desired
coding regions (e.g., amino acid residue 87 substitution), and/or
to create and/or destroy translation, initiation, and/or
termination sequences, and/or form new restriction endonuclease
sites or destroy preexisting ones, to facilitate further in vitro
modification. Any technique for mutagenesis known in the art can be
used, including but not limited to, chemical mutagenesis, in vitro
site-directed mutagenesis (Hutchinson, C., et al., 1978, J. Biol.
Chem 253:6551), PCR-based overlap extension (Ho et al., 1989, Gene
77:51-59), PCR-based megaprimer mutagenesis (Sarkar et al., 1990,
Biotechniques, 8:404-407), etc. Mutations can be confirmed by
double stranded dideoxy DNA sequencing.
[0051] Manipulations of the mutant sequence may also be made at the
protein level. Included within the scope of the invention are HFGF
proteins which are differentially modified during or after
translation, e.g., by glycosylation, acetylation, phosphorylation,
amidation, derivatization by known protecting/blocking groups,
proteolytic cleavage, linkage to another cellular ligand, etc. Any
of numerous chemical modifications may be carried out by known
techniques, including but not limited to specific chemical cleavage
by cyanogen bromide, trypsin, chymotrypsin, papain, V8 protease or
NaBH.sub.4, acetylation, formylation, oxidation, reduction,
metabolic synthesis in the presence of tunicamycin, etc.
[0052] In a specific embodiment, HFGF of the present invention was
isolated from hair follicles of human scalp skin and showed a
different level of expression in hair follicles of alopecia
patients in comparison to hair follicles of persons that do not
have alopecia. To investigate the expression level of HFGF, hair
follicles with a morphological structure characteristic of anagen
were obtained from human scalp skin of alopecia patients and
persons that do not have alopecia. Total mRNA was then extracted
from said hair follicles and cDNA was obtained from the total RNA
by RT-PCR and analyzed on agarose gels.
[0053] The results of agarose gel analysis showed that cDNA
encoding HFGF was detected in persons that do not have alopecia
while cDNA corresponding to mRNA encoding HFGF in alopecia patients
was not detected. In contrast, cDNA of HFGF receptor was detected
in both (see FIG. 3), demonstrating that HFGF may be a molecular
factor that regulates hair loss.
[0054] In another specific embodiment, the present invention also
provides a gene or isolated nucleic acid molecule encoding HFGF
protein (herein referred to as "HFGF gene"). A HFGF gene encodes a
protein having the 2.sup.nd to the 208.sup.th amino acids of SEQ ID
NO:1, wherein lysine 87 is replaced by glutamic acid. The HFGF gene
may further comprise an initiation codon at the 5'-end of said
gene.
[0055] In additional specific embodiment, mutant HFGF genes of the
present invention may comprise the 4.sup.th to the 627.sup.th
nucleotides or the 118.sup.th to the 627.sup.th nucleotides of SEQ
ID NO: 2, wherein the codon corresponding to the amino acid at
position 87 of the amino acid sequence encodes negatively charged
amino acid, i.e., glutamic acid or aspartic acid. These mutants may
further comprise an initiation codon at the 5'-end of said
nucleotide sequences.
[0056] The present invention provides methods for producing HFGF
proteins. Methods of the present invention include subcloning, for
example, HFGF gene into a vector, transforming host cells with said
vector and culturing said transformants, wherein said HFGF gene
encodes the 2.sup.nd to the 208.sup.th amino acids of SEQ ID NO:1,
and may further comprise an initiation codon at the 5'-end of the
nucleic acid sequences. A HFGF gene of the present invention may be
a gene fusion in which additional nucleotide sequences are joined
to a HFGF gene.
[0057] The present invention also provides pharmaceutical
compositions containing HFGF proteins, or genes encoding said
proteins, as an active component. A specific embodiment uses HFGF
comprising the 2.sup.nd to the 208.sup.th amino acids of SEQ ID
NO:1. In another specific embodiment, the pharmaceutical
composition of the present invention contains HFGF protein
comprising the 40.sup.th to the 208.sup.th amino acids of SEQ ID
NO:1 or a gene encoding said analogue. In further specific
embodiment, the pharmaceutical composition contains another HFGF
protein having the 69.sup.th to the 208.sup.th amino acids of SEQ
ID NO:1. In additional embodiments, the pharmaceutical composition
of the present invention contains HFGF protein comprising the
2.sup.nd to the 208.sup.th amino acids of SEQ ID NO:1, wherein Asp
87 is replaced by Glu 87, the 40.sup.th to the 208.sup.th amino
acids of SEQ ID NO:1, wherein Asp 87 is replaced by Glu 87,
69.sup.th to the 208.sup.th amino acids of SEQ ID NO:1, wherein Asp
87 is replaced by Glu 87 or genes encoding said proteins.
[0058] The pharmaceutical compositions of the present invention are
useful for preventing or treating alopecia and for promoting or
accelerating hair growth and hair follicle repair. In a specific
embodiment, the present invention provides methods of using HFGF or
HFGF gene to prevent or treat or ameliorate alopecia, comprising
administering a pharmaceutical composition containing HFGF or HFGF
gene as an effective component to a patient in need thereof.
[0059] Another aspect of the present invention is a HFGF gene
encoding HFGF protein. A HFGF gene may be constituted of all
possible degenerate sequences encoding said amino acid sequence.
Furthermore, a HFGF gene may be in the form of cDNA or gDNA
(genomic DNA), and it may comprise non-coding regions such as
introns, promoters and/or enhancers. In one preferred embodiment of
the invention, mutant HFGF genes encode the 2.sup.nd to the
208.sup.th amino acids, the 40.sup.th to the 208.sup.th amino acids
or the 69.sup.th to the 208.sup.th of SEQ ID NO:1, wherein the
amino acid residue at position 87 is glutamic acid or aspartic
acid, and may further comprise an initiation codon at the 5'-end
the nucleotide sequences.
[0060] In another preferred embodiment, mutant HFGF genes of the
present invention comprise the 4.sup.th to the 627.sup.th or the
118.sup.th to the 627.sup.th nucleotides of SEQ ID NO: 2, wherein
the codon corresponding to the amino acid at position 87 of the
amino acid sequence encodes glutamic acid or aspartic acid, and may
further comprise an initiation codon at the 5'-end of the
nucleotide sequences. Of course, it would be routine for those
skilled in the art to generate variants of the above nucleotide
sequences by virtue of the degeneracy of the genetic code.
Degenerate variants of the disclosed nucleic acid sequences are an
aspect of the present invention.
[0061] In a specific embodiment to obtain a HFGF gene of the
present invention, total RNA was extracted from hair follicle
cells. As generally known to those of skill in the art, total RNA
derived from a cell can be converted to cDNA by PCR or RT-PCR using
oligonucleotide primers corresponding to specific nucleotide
sequences of the gene or nucleic acid sequence intended to be
amplified.
[0062] In this regard, oligonucleotide primers shown as SEQ ID NO:
3 and SEQ ID NO: 4 were utilized to amplify a HFGF gene comprising
the 1.sup.st to the 627.sup.th nucleotides of SEQ ID NO: 2, and
oligonucleotide primers shown as SEQ ID NO: 9 and SEQ ID NO: 10
were used to amplify a HFGF gene comprising the 118.sup.th to the
627.sup.th nucleotides of SEQ ID NO: 2.
[0063] In one embodiment, total RNA extracted from hair follicle
cells was used as template to perform PCR with oligonucleotide
primers shown as SEQ ID NO: 3 and SEQ ID NO: 4. The nucleotide
sequence of a PCR product was identified, which provides a new cDNA
sequence in which Glu is substituted for Lys at the 87.sup.th codon
of that of human kgf-2 gene (see FIG. 1 and SEQ ID NO:2).
[0064] The gene, newly isolated by the above process and referred
to as HFGF gene, was inserted into the pGEM-T vector to construct a
recombinant plasmid which can express HFGF of the present invention
in a host cell. The construct was designated pGEM-T-KFG-2A and
deposited in Korean Collection for Type Cultures which is an
international depository authority under the regulations of
Budapest Treaty on the International Recognition of the Deposit of
Microorganisms for the Purpose of Patent Procedures, on Mar. 19,
2001 as Accession No. KCTC-1012BP.
[0065] In a further aspect, the present invention provides a method
for producing HFGF. In one embodiment, HFGF may be produced by
direct synthetic processes to yield a protein corresponding to the
amino acid sequence of SEQ ID NO:1. In another embodiment, HFGF may
be isolated from hair follicles of human scalp skin. In still
another embodiment, HFGF may be prepared by recombinant expression
using a HFGF gene.
[0066] In a specific embodiment of the invention, HFGF is produced
by subcloning a HFGF gene into a vector, transforming a host cell
with said vector and culturing said transformant, wherein said HFGF
gene encodes the 2.sup.nd to the 208.sup.th amino acids or the
40.sup.th to the 208.sup.th amino acids of SEQ ID NO:1, and may
further comprise an initiation codon at the 5'-end of the nucleic
acid sequences. A HFGF gene of the present invention may be a gene
fusion in which additional nucleotide sequences are joined to a
HFGF gene.
[0067] Examples of additional nucleotide sequences that may be
fused to a HFGF gene sequence include sequences encoding signals
(such as secretion signal sequences) for protein transport
following protein expression, membrane anchor sequences,
immunogenic determinants, tags, such as Histidine tags for aiding
in the isolation or purification of protein;
glutathione-S-transferase, and enzyme-specific restriction
sequences etc. The additional sequences may be cut or removed after
expression or purification of protein.
[0068] In one embodiment, a recombinant plasmid may be constructed
by subcloning a HFGF gene into a commercial expression vector such
as pET9c or pGEX-2T. The pET9c vector contains a T7 promoter for
inducing high level expression of a target gene. The pGEX-2T vector
contains a GST (Glutathione S Transferase)-encoding sequence
upstream of the insertion site for a target gene, which results in
expression of GST-fusion protein.
[0069] In one embodiment, a pGEX-2T-HFGF recombinant plasmid was
constructed by subcloning a HFGF gene into the pGEX-2T vector,
wherein said HFGF gene comprised the 118.sup.th to the 627.sup.th
nucleotides of SEQ ID NO:2 wherein the sequence lacked the 1.sup.st
to the 117.sup.th nucleotides encoding a signal sequence.
[0070] A transformant of the present invention may be prepared by
transforming prokaryotic or eukaryotic host cells such as E. coli
or yeast with a recombinant plasmid containing HFGF gene using
well-known methodology, e.g. calcium chloride mediated
transformation, calcium-phosphate precipitation, liposome
mediation, microinjection, transfection by electroporation,
etc.
[0071] In a preferred embodiment of the invention, E. coli strain
BL21(DE3) is utilized as a host cell, that is, E. coli BL21(DE3) is
transformed with a pGEX-2T-HFGF vector.
[0072] Generally, to isolate and purify protein from a
transformant, the transformant is cultured for an appropriate time
and then lysed. Subsequently, selective precipitation,
chromatography, dialysis and/or filtration may be performed to
purify the desired protein.
[0073] In a preferred embodiment of the invention, the above E.
coli BL21(DE3) containing pGEX-2T-HFGF vector was cultured for 48
hours or more and lysed. Said cell lysate was then applied to a
heparin-Sepharose column, hHFGF was eluted with a
concentration-gradient using NaCl solutions and purified.
[0074] If a host cell transformed with pGEX-2T-HFGF vector is
cultured, a GST-HFGF fusion protein is expressed. In this case,
said fusion protein may be specifically purified using glutathione
column chromatography. The GST moiety may be removed from the
target protein by thrombin treatment. The selection and application
of a suitable column for isolation and purification of protein will
be appreciated by those skilled in the art.
[0075] In the case of subcloning a fused gene composed of a HFGF
gene fused with additional nucleotide sequences into an expression
vector, amino acids encoded by the additional nucleotides may be
cut or removed from HFGF by using enzymes such as trypsin, or any
other endopeptidase or endoprotease, after expression of the fusion
protein.
[0076] The apparent molecular mass of HFGF determined by
polyacrylaminde gel electrophoresis (PAGE) was approximately 20 kDa
and that of a GST-HFGF fusion protein was approximately 45 kDa,
consistent with the predicted molecular weights (see FIG. 2).
[0077] In another aspect, the present invention is also directed to
pharmaceutical compositions containing HFGF, or a gene encoding a
HFGF, as an effective component, wherein said HFGF comprises the
2.sup.nd to the 208.sup.th amino acids or the 40.sup.th to the
208.sup.th amino acids of SEQ ID NO:1, and may further comprise a
Met residue at the N-terminus of said amino acid sequences, wherein
said HFGF may be mature protein.
[0078] Furthermore, a HFGF gene of the present invention encodes
the 2.sup.nd to the 208.sup.th amino acids or the 40.sup.th to the
208.sup.th amino acids of SEQ ID NO:1, and may further comprise an
initiation codon at the 5'-end of the nucleic acid sequence, and
said HFGF gene may be a fused gene bound to additional nucleotide
sequences.
[0079] Mitogenic activity of HFGF on human hair follicles was
measured to investigate the biological activities of HFGF.
Particularly, HFGF was used to treat hair follicle cells from human
scalp skin, and after a period of about 48 hours, cell
proliferation was measured by colorimetric MTS assays.
[0080] Accordingly, as seen in FIG. 5, the addition of HFGF
resulted in a dose-dependent stimulation of proliferation of human
hair follicle cells with a maximum stimulatory effect observed at a
HFGF concentration of 30 ng/ml; with an increased effect of 140%
compared to negative control of 100%.
[0081] To exclude any effect caused by endogenous KGF-2, HFGF was
used to treat human hair follicles in which dermal papilla (DP)
were removed surgically. Cell proliferation was measured by
colorimetric MTS assay.
[0082] Interestingly, HFGF stimulated the proliferation of
DP-deleted hair follicle cells with a surprisingly increased level
compared to DP-containing hair follicle cells (see FIGS. 6A and
6B).
[0083] KGF-1 and KGF-2 are closely related proteins in the FGF
family. Thus, it is appropriate to compare the stimulatory effect
of HFGF to that of KGF-1 and KGF-2.
[0084] Accordingly, human hair follicle cells derived from scalp
skin were treated with KGF-1, KGF-2 and HFGF, respectively, and,
after a lapse of about 48 hours, proliferation rates were measured
by calorimetric MTS assay. Further, human hair follicles, in which
dermal papilla were removed surgically to exclude any effect by
endogenous KGF-2, were treated with KGF-1, KGF-2 and HFGF,
respectively.
[0085] The results showed that HFGF significantly stimulated the
proliferation of human hair follicle cells compared to KGF-2 and
KGF-1, this was independent of removal of dermal papilla (see FIGS.
7A and 7B).
[0086] The HFGF of the present invention exhibit a stimulatory
effect on the proliferation of hair follicle cells. HFGF of the
present invention may be used as an effective component of a
pharmaceutical composition to prevent or treat alopecia and to
promote or accelerate hair growth and hair follicle repair.
[0087] In this regard, a HFGF gene encoding HFGF may also be used
in a gene therapy regimen to prevent or treat alopecia and for
promotion or acceleration of hair growth and hair follicle
repair.
[0088] Pharmaceutical compositions of the present invention may be
prepared by mixing a HFGF protein or a HFGF gene with a
pharmaceutically acceptable excipient or adjuvant using traditional
formulating methods. Said formulating methods may comprise
inserting a HFGF gene into a vector for gene therapy.
[0089] In one embodiment, the present invention includes methods
for preventing or treating alopecia with a HFGF protein or a gene
encoding a HFGF protein. Said methods may comprise administering a
pharmaceutical composition containing a HFGF protein or a gene
encoding a HFGF protein as an effective component on a patient's
scalp skin in a formulation comprising a cream, lotion, gel,
ointment, salve, balm, or transdermal patch.
[0090] In a further embodiment, a pharmaceutical composition
containing a HFGF protein or a gene encoding a HFGF protein may be
administered parenterally, i.e. intravenously, subcutaneously,
intramuscularly, percutaneously or transdermally, for example, by
directly applying to scalp skin.
Definitions
[0091] As used herein, the term "allele" refers to any of several
alternative forms of a gene.
[0092] As used herein, the term "biological activity" particularly
refers to a function or set of activities performed by a molecule
in a biological context (i.e., in an organism or an in vitro
facsimile thereof). Biological activities may include but are not
limited to the functions of a HFGF protein or gene encoding a HFGF
protein such as a stimulatory effect on hair follicle cell
proliferation as well as the promotion or acceleration of hair
growth and hair follicle repair. A fusion protein or peptide of the
invention is considered to be biologically active if it exhibits
one or more biological activities of its native counterpart.
[0093] As used herein, the term "gene" refers to any segment of DNA
associated with a biological function. Thus, genes include, but are
not limited to, coding sequences and/or the regulatory sequences
required for their expression. Genes can include nonexpressed DNA
segments, such as promoters, enhancers, and/or introns. Genes can
also include nonexpressed DNA segments that, for example, form
recognition sequences for other proteins. Genes can be obtained
from a variety of sources, including cloning from a source of
interest or synthesizing from known or predicted sequence
information, and may include sequences designed to have desired
parameters.
[0094] As used herein, the term "genotype" refers to the genetic
makeup of an individual cell, cell culture, tissue, bacterium,
fungus, animal or plant;
[0095] As used herein, a "heterologous polynucleotide" or a
"heterologous nucleic acid" or a "heterologous gene" or an
"exogenous DNA segment" refers to a polynucleotide, nucleic acid or
DNA segment that originates from a source foreign to the particular
host cell, or, if from the same source, is modified from its
original form. Thus, a heterologous gene in a host cell includes a
gene that is endogenous to the particular host cell, but has been
modified. Thus, the terms refer to a DNA segment which is foreign
or heterologous to the cell, or homologous to the cell but in a
position within the host cell nucleic acid in which the element is
not ordinarily found. Exogenous DNA segments are expressed to yield
exogenous polypeptides.
[0096] As used herein, "heterologous trait" refers to a phenotype
imparted to a transformed host cell or transgenic organism by an
exogenous DNA segment, heterologous polynucleotide or heterologous
nucleic acid.
[0097] As used herein, an "isolated" nucleic acid sequence refers
to a nucleic acid sequence which is essentially free of other
nucleic acid sequences, e.g. at least about 20% pure, preferably at
least about 40% pure, more preferably about 60% pure, even more
preferably about 80% pure, most preferably about 90% pure, and even
most preferably about 95% pure, as determined by agarose gel
electrophoresis. For example, an isolated nucleic acid sequence can
be obtained by standard cloning procedures used in genetic
engineering to relocate the nucleic acid sequence from its natural
location to a different site where it will be reproduced. The
cloning procedures may involve excision and isolation of a desired
nucleic acid fragment comprising the nucleic acid sequence encoding
the polypeptide, insertion of the fragment into a vector molecule,
and incorporation of the recombinant vector into a host cell where
multiple copies or clones of the nucleic acid sequence will be
replicated. The nucleic acid sequence may be of genomic, cDNA, RNA,
semisynthetic, synthetic origin, or any combinations thereof.
[0098] As used herein, two or more DNA coding sequences are said to
be "joined" or "fused" when, as a result of in-frame fusions
between the DNA coding sequences or as a result of the removal of
intervening sequences by normal cellular processing, the DNA coding
sequences are translated into a polypeptide fusion.
[0099] As used herein, the terms "nucleic acid" or "polynucleotide"
refer to deoxyribonucleotides or ribonucleotides and polymers
thereof in either single- or double-stranded form. Unless
specifically limited, the terms encompass nucleic acids containing
analogues of natural nucleotides that have similar binding
properties as the reference nucleic acid and are metabolized in a
manner similar to naturally occurring nucleotides. Unless otherwise
indicated, a particular nucleic acid sequence also implicitly
encompasses conservatively modified variants thereof (e.g.
degenerate codon substitutions in which a codon is altered but
still encodes the same amino acid) and complementary sequences as
well as the sequence explicitly indicated. Specifically, degenerate
codon substitutions may be achieved by generating sequences in
which the third position of one or more selected (or all) codons is
substituted with mixed-base and/or deoxyinosine residues (Batzer et
al. (1991) Nucleic Acid Res. 19:5081; Ohtsuka et al. (1985) J.
Biol. Chem. 260:2605-2608; Cassol et al. (1992); Rossolini et al.
(1994) Mol. Cell. Probes 8:91-98). The term nucleic acid is used
interchangeably with gene, cDNA, and mRNA encoded by a gene.
[0100] As used herein, codons are said to be degenerate if they
encode the same amino acid.
[0101] As used herein, a "mature protein" is a protein that has
been post-translationally processed to remove a secretory signal
sequence or signal sequence or secretion leader sequence. A mature
HFGF protein of the present invention is a protein that is lacking
about the first 1, 5, 10, 20, 30, 35, 36, 37, 38, 39, 40, 41, 42,
43, 44 or 45 amino acids of SEQ ID NO:1. Post-translational
processing may occur within a host cell or extracellularly, such
as, for example, in an in vitro milieu.
[0102] As used herein, a DNA segment is referred to as "operably
linked" when it is placed into a functional relationship with
another DNA segment. For example, DNA for a signal sequence is
operably linked to DNA encoding a polypeptide if it is expressed as
a preprotein that participates in the secretion of the polypeptide;
a promoter or enhancer is operably linked to a coding sequence if
it stimulates the transcription of the sequence. Generally, DNA
sequences that are operably linked are contiguous, and in the case
of a signal sequence both contiguous and in reading phase. However,
enhancers need not be contiguous with the coding sequences whose
transcription they control. Linking, in this context, is
accomplished by ligation at convenient restriction sites or at
adapters or linkers inserted in lieu thereof.
[0103] As used herein, the term "phenotype" refers to the
observable characteristics of an individual cell, cell culture,
bacterium, fungus, animal or plant which results from the
interaction between that individual's genetic makeup (i.e.,
genotype) and the environment.
[0104] As used herein, the term "promoter" refers to a region of
DNA involved in binding RNA polymerase to initiate
transcription.
[0105] As used herein, the term "recombinant" refers to a cell,
tissue or organism that has undergone transformation with
recombinant DNA.
[0106] As used herein, the term "transformation" refers to the
transfer of nucleic acid (i.e., a nucleotide polymer) into a cell.
As used herein, the term "genetic transformation" refers to the
transfer and incorporation of DNA, especially recombinant DNA, into
a cell.
[0107] As used herein, the term "transformant" refers to a cell,
tissue or organism that has undergone transformation.
[0108] As used herein, the term "transgene" refers to a nucleic
acid that is inserted into an organism, host cell or vector in a
manner that ensures its function.
[0109] As used herein, the term "transgenic" refers to cells, cell
cultures, organisms, bacteria, fungi, animals, plants, and progeny
of any of the preceding, which have received a foreign or modified
gene by one of the various methods of transformation, wherein the
foreign or modified gene is from the same or different species than
the species of the organism receiving the foreign or modified
gene.
[0110] As used herein, the term "vector" refers broadly to any
plasmid, phagemid or virus encoding an exogenous nucleic acid. The
term should also be construed to include non-plasmid, non-phagemid
and non-viral compounds which facilitate the transfer of nucleic
acid into virions or cells, such as, for example, polylysine
compounds and the like. The vector may be a viral vector that is
suitable as a delivery vehicle for delivery of the nucleic acid, or
mutant thereof, to a cell, or the vector may be a non-viral vector
which is suitable for the same purpose. Examples of viral and
non-viral vectors for delivery of DNA to cells and tissues are well
known in the art and are described, for example, in Ma et al.
(1997, Proc. Natl. Acad. Sci. U.S.A. 94:12744-12746). Examples of
viral vectors include, but are not limited to, a recombinant
vaccinia virus, a recombinant adenovirus, a recombinant retrovirus,
a recombinant adeno-associated virus, a recombinant avian pox
virus, and the like (Cranage et al., 1986, EMBO J. 5:3057-3063;
International Patent Application No. WO94/17810, published Aug. 18,
1994; International Patent Application No. WO94/23744, published
Oct. 27, 1994). Examples of non-viral vectors include, but are not
limited to, liposomes, polyamine derivatives of DNA, and the
like.
[0111] As used herein, the term "wild type" refers to a nucleic
acid molecule or polynucleotide or polypeptide sequence that is
naturally occurring.
Nucleic Acids
[0112] Nucleic acid molecules are provided by the present
invention. These encode HFGF proteins or fusion proteins comprising
HFGF proteins covalently linked or joined to another proteins. Any
protein or peptide may be joined to HFGF proteins. The fusion
protein may further comprise a linker region, for instance a linker
less than about 50, 40, 30, 20, or 10 amino acid residues. The
linker can be covalently linked to and between the HFGF protein and
the other protein. Host cells and vectors for replicating the
nucleic acid molecules and for expressing the encoded proteins are
also provided. Any vectors or host cells may be used, whether
prokaryotic or eukaryotic. Many vectors and host cells are known in
the art for such purposes. It is well within the skill of the art
to select an appropriate set for the desired application.
[0113] As known in the art "similarity" between two polynucleotides
or polypeptides is determined by comparing the nucleotide or amino
acid sequence and its conserved nucleotide or amino acid
substitutes of one polynucleotide or polypeptide to the sequence of
a second polynucleotide or polypeptide. Also known in the art is
"identity" which means the degree of sequence relatedness between
two polypeptide or two polynucleotide sequences as determined by
the identity of the match between two strings of such sequences.
Both identity and similarity can be readily calculated
(Computational Molecular Biology, Lesk, A. M., ed., Oxford
University Press, New York, 1988; Biocomputing: Informatics and
Genome Projects, Smith, D. W., ed., Academic Press, New York, 1993;
Computer Analysis of Sequence Data, Part I, Griffin, A. M., and
Griffin, H. G., eds., Humana Press, New Jersey, 1994; Sequence
Analysis in Molecular Biology, von Heinje, G., Academic Press,
1987; and Sequence Analysis Primer, Gribskov, M. and Devereux, J.,
eds., M Stockton Press, New York, 1991).
[0114] While there exist a number of methods to measure identity
and similarity between two polynucleotide or polypeptide sequences,
the terms "identity" and "similarity" are well known to skilled
artisans (Sequence Analysis in Molecular Biology, von Heinje, G.,
Academic Press, 1987; Sequence Analysis Primer, Gribskov, M. and
Devereux, J., eds., M Stockton Press, New York, 1991; and Carillo,
H., and Lipman, D., SIAM J. Applied Math., 48: 1073 (1988)).
Methods commonly employed to determine identity or similarity
between two sequences include, but are not limited to those
disclosed in Guide to Huge Computers, Martin J. Bishop, ed.,
Academic Press, San Diego, 1994, and Carillo, H., and Lipman, D.,
SIAM J. Applied Math. 48:1073 (1988).
[0115] Preferred methods to determine identity are designed to give
the largest match between the two sequences tested. Methods to
determine identity and similarity are codified in computer
programs. Preferred computer program methods to determine identity
and similarity between two sequences include, but are not limited
to, GCG program package (Devereux, et al., Nucleic Acids Research
12(1):387 (1984)), BLASTP, BLASTN, FASTA (Atschul, et al., J.
Molec. Biol. 215:403 (1990)). The degree of similarity or identity
referred to above is determined as the degree of identity between
the two sequences indicating a derivation of the first sequence
from the second. The degree of identity between two nucleic acid
sequences may be determined by means of computer programs known in
the art such as GAP provided in the GCG program package (Needleman
and Wunsch (1970), Journal of Molecular Biology, 48:443-453). For
purposes of determining the degree of identity between two nucleic
acid sequences for the present invention, GAP is used with the
following settings: GAP creation penalty of 5.0 and GAP extension
penalty of 0.3.
Vectors
[0116] The present invention further provides and utilizes
recombinant DNA molecules that contain a coding sequence. As used
herein, a recombinant DNA molecule is a DNA molecule that has been
subjected to molecular manipulation in situ. Methods for generating
recombinant DNA molecules are well known in the art, for example,
see Sambrook et al. Molecular Cloning: A Laboratory Manual. Cold
Spring Harbor, N.Y. Cold Spring Harbor Laboratory Press, 1985. In
the preferred recombinant DNA molecules, a coding DNA sequence is
operably linked to expression control sequences and/or vector
sequences.
[0117] The choice of vector and/or expression control sequences to
which one of the protein family encoding sequences of the present
invention is operably linked depends directly, as well known in the
art, on the functional properties desired, e.g., protein
expression, and the host cell to be transformed. A vector
contemplated by the present invention is at least capable of
directing the replication or insertion into the host chromosome,
and preferably also expression, of the structural gene included in
the recombinant DNA molecule.
[0118] Expression control elements that are used for regulating the
expression of an operably linked protein encoding sequence are
known in the art and include, but are not limited to, inducible
promoters, constitutive promoters, secretion signals, and other
regulatory elements. Preferably, the inducible promoter is readily
controlled, such as being responsive to a nutrient in the host
cell's medium.
[0119] In one embodiment, the vector containing a coding nucleic
acid molecule will include a prokaryotic replicon, i.e., a DNA
sequence having the ability to direct autonomous replication and
maintenance of the recombinant DNA molecule extra-chromosomally in
a prokaryotic host cell, such as a bacterial host cell, transformed
therewith. Such replicons are well known in the art. In addition,
vectors that include a prokaryotic replicon may also include a gene
whose expression confers a detectable marker such as drug
resistance. Typical bacterial drug resistance genes are those that
confer resistance to ampicillin, kanamycin or tetracycline,
etc.
[0120] Vectors that include a prokaryotic replicon can further
include a prokaryotic or bacteriophage promoter capable of
directing the expression (transcription and translation) of the
coding gene sequences in a bacterial host cell, such as E. coli. A
promoter is an expression control element formed by a DNA sequence
that permits binding of RNA polymerase and transcription to occur.
Promoter sequences compatible with bacterial hosts are typically
provided in plasmid vectors containing convenient restriction sites
for insertion of a DNA segment of the present invention. Typical
vector plasmids are pUC8, pUC9, pBR322 and pBR329 available from
BioRad Laboratories, (Richmond, Calif.), pPL and pKK223 available
from Pharmacia (Piscataway, N.J.).
[0121] Expression vectors compatible with eukaryotic cells,
preferably those compatible with vertebrate cells such as kidney
cells, can also be used to form recombinant DNA molecules that
contain a coding sequence. Eukaryotic cell expression vectors are
well known in the art and are available from several commercial
sources. Typically, such vectors are provided containing convenient
restriction sites for insertion of the desired DNA segment. Typical
vectors are pSVL and pKSV-10 (Pharmacia), pBPV-1/pML2d
(International Biotechnologies, Inc.), pTDT1 (ATCC, #31255), the
vector pCDM8 described herein, and other similar eukaryotic
expression vectors.
[0122] Eukaryotic cell expression vectors used to construct the
recombinant DNA molecules of the present invention may further
include a selectable marker that is effective in a eukaryotic cell,
preferably a drug resistance selection marker. A preferred drug
resistance marker is the gene whose expression results in neomycin
resistance, i.e., the neomycin phosphotransferase (neo) gene.
(Southern et al. Journal of Molecular and Applied Genetics, Vol. 1,
no. 4 (1982) pp. 327-341) Alternatively, the selectable marker can
be present on a separate plasmid, and the two vectors are
introduced by co-transfection of the host cell, and selected by
culturing in the appropriate drug for the selectable marker.
[0123] Expression units for use in the present invention will
generally, though not necessarily, comprise any or all of the
following elements, operably linked in a 5' to 3' orientation: a
transcriptional promoter, a secretory signal sequence, a DNA
sequence encoding a HFGF protein or a HFGF protein joined to a DNA
sequence encoding another protein or peptide of interest and a
transcriptional terminator. The selection of suitable promoters,
signal sequences and terminators will be determined by the selected
host cell and will be evident to one skilled in the art and are
discussed more specifically below.
[0124] Suitable yeast vectors for use in the present invention are
described in U.S. Pat. No. 6,291,212, (issued Sep. 18, 2001) and
include YRp7 (Struhl et al., Proc. Natl. Acad. Sci. USA 76:
1035-1039, 1978), YEp13 (Broach et al., Gene 8: 121-133, 1979),
pJDB249 and pJDB219 (Beggs, Nature 275:104-108, 1978) and
derivatives thereof. Such vectors will generally include a
selectable marker, which may be one of any number of genes that
exhibit a dominant phenotype for which a phenotypic assay exists to
enable transformants to be selected. Preferred selectable markers
are those that complement host cell auxotrophy, provide antibiotic
resistance or enable a cell to utilize specific carbon sources, and
include LEU2 (Broach et al. ibid.), URA3 (Botstein et al., Gene 8:
17, 1979), HIS3 (Struhl et al., ibid.) or POT1 (Kawasaki and Bell,
EP 171,142). Other suitable selectable markers include the CAT
gene, which confers chloramphenicol resistance on yeast cells.
Preferred promoters for use in yeast include promoters from yeast
glycolytic genes (Hitzeman et al., J Biol. Chem. 225: 12073-12080,
1980; Alber and Kawasaki, J. Mol. Appl. Genet. 1: 419-434, 1982;
Kawasaki, U.S. Pat. No. 4,599,311) or alcohol dehydrogenase genes
(Young et al., in Genetic Engineering of Microorganisms for
Chemicals, Hollaender et al., (eds.), p. 355, Plenum, N.Y., 1982;
Ammerer, Meth. Enzymol. 101: 192-201, 1983). In this regard,
particularly preferred promoters are the TPI1 promoter (Kawasaki,
U.S. Pat. No. 4,599,311, 1986) and the ADH2-4.sup.C [see U.S. Pat.
No. 6,291,212] promoter (Russell et al., Nature 304: 652-654,
1983). The expression units may also include a transcriptional
terminator. A preferred transcriptional terminator is the TPI1
terminator (Alber and Kawasaki, ibid.).
[0125] In addition to yeast, proteins of the present invention can
be expressed in filamentous fungi, for example, strains of the
fungi Aspergillus. Examples of useful promoters include those
derived from Aspergillus nidulans glycolytic genes, such as the
ADH3 promoter (McKnight et al., EMBO J. 4: 2093-2099, 1985) and the
tpiA promoter. An example of a suitable terminator is the ADH3
terminator (McKnight et al., ibid.). The expression units utilizing
such components may be cloned into vectors that are capable of
insertion into the chromosomal DNA of Aspergillus, for example.
[0126] Mammalian expression vectors for use in carrying out the
present invention will include a promoter capable of directing the
transcription of a cloned gene or cDNA. Preferred promoters include
viral promoters and cellular promoters. Preferred viral promoters
include the major late promoter from adenovirus 2 (Kaufman and
Sharp, Mol. Cell. Biol. 2: 1304-13199, 1982) and the SV40 promoter
(Subramani et al., Mol. Cell. Biol. 1: 854-864, 1981). Preferred
cellular promoters include the mouse metallothionein 1 promoter
(Palmiter et al., Science 222: 809-814, 1983) and a mouse V.sub.K
[see U.S. Pat. No. 6,291,212] promoter (Grant et al., Nuc. Acids
Res. 15: 5496, 1987). A particularly preferred promoter is a mouse
V.sub.H [see U.S. Pat. No. 6,291,212] promoter (Loh et al., ibid.).
Such expression vectors may also contain a set of RNA splice sites
located downstream from the promoter and upstream from the DNA
sequence encoding the HFGF protein. Preferred RNA splice sites may
be obtained from adenovirus and/or immunoglobulin genes. Also
contained in the expression vectors is a polyadenylation signal
located downstream of the coding sequence of interest.
Polyadenylation signals include the early or late polyadenylation
signals from SV40 (Kaufman and Sharp, ibid.), the polyadenylation
signal from the adenovirus 5 E1B region and the human growth
hormone gene terminator (DeNoto et al., Nuc. Acids Res. 9:
3719-3730, 1981). A particularly preferred polyadenylation signal
is the V.sub.H [see U.S. Pat. No. 6,291,212] gene terminator (Loh
et al., ibid.). The expression vectors may include a noncoding
viral leader sequence, such as the adenovirus 2 tripartite leader,
located between the promoter and the RNA splice sites. Preferred
vectors may also include enhancer sequences, such as the SV40
enhancer and the mouse mu. [see U.S. Pat. No. 6,291,212] enhancer
(Gillies, Cell 33: 717-728, 1983). Expression vectors may also
include sequences encoding the adenovirus VA RNAs.
Transformation
[0127] The present invention further provides or utilizes host
cells transformed with a nucleic acid molecule that encodes a
protein of the present invention. The host cell can be either
prokaryotic or eukaryotic. Eukaryotic cells useful for expression
of a protein of the invention are not limited, so long as the cell
line is compatible with cell culture methods and compatible with
the propagation of the expression vector and expression of the gene
product. Preferred eukaryotic host cells include, but are not
limited to, yeast, insect and mammalian cells, preferably
vertebrate cells such as those from a mouse, rat, monkey or human
cell line. Preferred eukaryotic host cells include Chinese hamster
ovary (CHO) cells available from the ATCC as CCL61, NIH Swiss mouse
embryo cells (NIH3T3) available from the ATCC as CRL 1658, baby
hamster kidney cells (BHK), COS and COS7 cells and like eukaryotic
tissue culture cell lines.
[0128] Any prokaryotic host can be used to express a recombinant
DNA molecule encoding a protein of the invention, particularly
peptides and fragments of the full-length receptor protein. The
preferred prokaryotic host is E. coli.
[0129] Transformation of appropriate cell hosts with a recombinant
DNA molecule of the present invention is accomplished by well known
methods that typically depend on the type of vector used and host
system employed. With regard to transformation of prokaryotic host
cells, electroporation and salt treatment methods are typically
employed, see, for example, Cohen et al., Proceedings of the
National Academy of Science USA, Vol. 69, no. 8 (1972) pp.
2110-2114; and Maniatis et al., Molecular Cloning: A Laboratory
Mammal. Cold Spring Harbor, N.Y. Cold Spring Harbor Laboratory
Press, 1982). With regard to transformation of vertebrate cells
with vectors containing recombinant DNAs, electroporation, cationic
lipid or salt treatment methods are typically employed, see, for
example, Graham et al., Virology, Vol. 52, no. 2 (1973) pp.
456-467; and Wigler et al., Proceedings of the National Academy of
Science USA, Vol. 76 (1979) pp. 1373-1376.
[0130] Successfully transformed cells, i.e., cells that contain a
recombinant DNA molecule of the present invention, can be
identified by well known techniques including the selection for a
selectable marker. For example, cells resulting from the
introduction of an recombinant DNA of the present invention can be
cloned to produce single colonies. Cells from those colonies can be
harvested, lysed and their DNA content examined for the presence of
the recombinant DNA using a method such as that described by
Southern, Journal of Molecular Biology, Vol. 98, no. 3 (1975) pp.
503-517; or Berent et al., Biotechnic and Histochemistry, Vol. 3
(1985) pp. 208; or the proteins produced from the cell assayed via
an immunological method.
[0131] Techniques for transforming fungi are well known in the
literature, and have been described, for instance, by Beggs
(ibid.), Hinnen et al. (Proc. Natl. Acad. Sci. USA 75: 1929-1933,
1978), Yelton et al., (Proc. Natl. Acad. Sci. USA 81: 1740-1747,
1984), and Russell (Nature 301: 167-169, 1983). The genotype of the
host cell will generally contain a genetic defect that is
complemented by the selectable marker present on the expression
vector. Choice of a particular host and selectable marker is well
within the level of ordinary skill in the art.
[0132] Cloned DNA sequences may be introduced into cultured
mammalian cells by, for example, calcium phosphate-mediated
transfection (Wigler et al., Cell 14: 725, 1978; Corsaro and
Pearson, Somatic Cell Genetics 7: 603, 1981; Graham and Van der Eb,
Virology 52: 456, 1973.) Other techniques for introducing cloned
DNA sequences into mammalian cells, such as electroporation
(Neumann et al., EMBO J. 1: 841-845, 1982), or lipofection may also
be used. In order to identify cells that have integrated the cloned
DNA, a selectable marker is generally introduced into the cells
along with the gene or cDNA of interest. Preferred selectable
markers for use in cultured mammalian cells include genes that
confer resistance to drugs, such as neomycin, hygromycin, and
methotrexate. The selectable marker may be an amplifiable
selectable marker. A preferred amplifiable selectable marker is the
DHFR gene. A particularly preferred amplifiable marker is the
DHFR.sup.r [see U.S. Pat. No. 6,291,212] cDNA (Simonsen and
Levinson, Proc. Natl. Adac. Sci. USA 80: 2495-2499, 1983).
Selectable markers are reviewed by Thilly (Mammalian Cell
Technology, Butterworth Publishers, Stoneham, Mass.) and the choice
of selectable markers is well within the level of ordinary skill in
the art.
Host Cells
[0133] Host cells for use in practicing the present invention
include prokaryotic and eukaryotic cells capable of being
transformed or transfected with exogenous DNA and grown in culture,
such as cultured mammalian, insect, fungal, plant, bacterial, viral
and baculoviral cells. Fungal cells, including species of yeast
(e.g., Saccharomyces spp., Schizosaccharomyces spp.) may be used as
host cells within the present invention. Examples of other fungal
cells are cells of filamentous fungi, e.g. Aspergillus spp.,
Neurospora spp., Fusarium spp. or Trichodermaspp., in particular
strains of A. oryzae, A. nidulans or A. niger. The use of
Aspergillus spp. for the expression of proteins have been described
in e.g., EP 272,277 and EP 230,023. The transformation of F.
oxysporum may, for instance, be carried out as described by
Malardier et al. (1989) Gene 78:147-156.
[0134] Strains of the yeast Saccharomyces cerevisiae are
particularly preferred. In a preferred embodiment, a yeast cell, or
more specifically, a Saccharomyces cerevisiae host cell that
contains a genetic deficiency in a gene required for
asparagine-linked glycosylation of glycoproteins is used. S.
cerevisiae host cells having such defects may be prepared using
standard techniques of mutation and selection. Ballou et al. (J.
Biol. Chem. 255: 5986-5991, 1980) have described the isolation of
mannoprotein biosynthesis mutants that are defective in genes which
affect asparagine-linked glycosylation. Briefly, mutagenized S.
cerevisiae cells were screened using fluoresceinated antibodies
directed against the outer mannose chains present on wild-type
yeast. Mutant cells that did not bind antibody were further
characterized and were found to be defective in the addition of
asparagine-linked oligosaccharide moieties. To optimize production
of the heterologous proteins, it is preferred that the host strain
carries a mutation, such as the S. cerevisiae pep4 mutation (Jones,
Genetics 85: 23-33, 1977), which results in reduced proteolytic
activity. Host strains containing mutations in other protease
encoding regions are also contemplated.
[0135] Host cells containing DNA constructs of the present
invention are grown in an appropriate growth medium. As used
herein, the term "appropriate growth medium" means a medium
containing nutrients required for the growth of cells. Nutrients
required for cell growth may include a carbon source, a nitrogen
source, essential amino acids, vitamins, minerals and growth
factors. The growth medium will be generally selected for cells
containing the DNA construct by, for example, drug selection or
deficiency in an essential nutrient which are complemented by the
selectable marker on the DNA construct or co-transfected with the
DNA construct. Yeast cells, for example, are preferably grown in a
chemically defined medium, comprising a non-amino acid nitrogen
source, inorganic salts, vitamins and essential amino acid
supplements. The pH of the medium is preferably maintained at a pH
greater than 2 and less than 8, preferably at pH 6.5. Methods for
maintaining a stable pH include buffering and constant pH control,
preferably through the addition of sodium hydroxide. Preferred
buffering agents include succinic acid and Bis-Tris (Sigma Chemical
Co., St. Louis, Mo.). Yeast cells having a defect in a gene
required for asparagine-linked glycosylation are preferably grown
in a medium containing an osmotic stabilizer. A preferred osmotic
stabilizer is sorbitol supplemented into the medium at a
concentration between 0.1 M and 1.5 M., preferably at 0.5 M or 1.0
M.
[0136] Cultured mammalian cells are generally grown in commercially
available serum-containing or serum-free media. Selection of a
medium appropriate for the particular cell line used is within the
level of ordinary skill in the art. Transfected mammalian cells are
allowed to grow for a period of time, typically 1-2 days, to begin
expressing the DNA sequence(s) of interest. Drug selection is then
applied to select for growth of cells that are expressing the
selectable marker in a stable fashion. For cells that have been
transfected with an amplifiable selectable marker the drug
concentration may be increased in a stepwise manner to select for
increased copy number of the cloned sequences, thereby increasing
expression levels.
Secretory Signal Sequences
[0137] The terms secretory signal sequences or signal sequences or
secretion leader sequences are used interchangeably and are
described, for example in U.S. Pat. No. 6,291,212 and U.S. Pat. No.
5,547,871, both of which are herein incorporated by reference in
their entirety. Secretory signal sequences or signal sequences or
secretion leader sequences encode secretory peptides. A secretory
peptide is an amino acid sequence that acts to direct the secretion
of a mature polypeptide or protein from a cell. Secretory peptides
are generally characterized by a core of hydrophobic amino acids
and are typically (but not exclusively) found at the amino termini
of newly synthesized proteins. Very often the secretory peptide is
cleaved from the mature protein during secretion. Secretory
peptides may contain processing sites that allow cleavage of the
signal peptide from the mature protein as it passes through the
secretory pathway. Processing sites may be encoded within the
signal peptide or may be added to the signal peptide by, for
example, in vitro mutagenesis. A mature HFGF protein of the present
invention is a protein that is lacking about the first 1, 5, 10,
20, 30, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44 or 45 amino acids of
SEQ ID NO:1. Certain secretory peptides may be used in concert to
direct the secretion of polypeptides and proteins. One such
secretary peptide that may be used in combination with other
secretory peptides is the third domain of the yeast Barrier
protein. Secretory signal sequences or signal sequences or
secretion leader sequences are required for a complex series of
post-translational processing steps which result in secretion of a
protein. If an intact signal sequence is present, the protein being
expressed enters the lumen of the rough endoplasmic reticulum and
is then transported through the Golgi apparatus to secretory
vesicles and is finally transported out of the cell. Generally, the
signal sequence immediately follows the initiation codon and
encodes a signal peptide at the amino-terminal end of the protein
to be secreted. In most cases, the signal sequence is cleaved off
by a specific protease, called a signal peptidase. Preferred signal
sequences improve the processing and export efficiency of
recombinant protein expression using viral, mammalian or yeast
expression vectors.
Detection of Secreted Proteins
[0138] Assays for detection of secreted, biologically active HFGF
protein or HFGF fusion proteins may include Western transfer,
protein blot or colony filter. A Western transfer filter may be
prepared using the method described by Towbin et al. (Proc. Natl.
Acad. Sci. USA 76: 4350-4354, 1979). Briefly, samples are
electrophoresed in a sodium dodecylsulfate polyacrylamide gel. The
proteins in the gel are electrophoretically transferred to
nitrocellulose paper. Protein blot filters may be prepared by
filtering supernatant samples or concentrates through
nitrocellulose filters using, for example, a Minifold (Schleicher
& Schuell, Keene, N. H.). Colony filters may be prepared by
growing colonies on a nitrocellulose filter that has been laid
across an appropriate growth medium. In this method, a solid medium
is preferred. The cells are allowed to grow on the filters for at
least 12 hours. The cells are removed from the filters by washing
with an appropriate buffer that does not remove the proteins bound
to the filters. A preferred buffer comprises 25 mM Tris-base, 19 mM
glycine, pH 8.3, 20% methanol.
Isolation of HFGF Proteins and Fusion Proteins
[0139] Biologically active HFGF proteins or fusion proteins may be
isolated from the medium of host cells grown under conditions that
allow the secretion of the biologically active proteins or they may
be isolated by cell lysis followed by purification of the resultant
cell lysate. Where HFGF protein of the invention is secreted, the
cell material is removed from the culture medium, and the
biologically active HFGF protein or HFGF fusion protein is isolated
using isolation techniques known in the art. Suitable isolation
techniques include precipitation and fractionation by a variety of
chromatographic methods, including gel filtration, ion exchange
chromatography and affinity chromatography. A particularly
preferred purification method is affinity chromatography on an iron
binding or metal chelating column or an immunoaffinity
chromatography using an antibody directed against the HFGF protein
or HFGF fusion protein. The antibody is preferably immobilized or
attached to a solid support or substrate. A particularly preferred
substrate is CNBr-activated Sepharose (Pharmacia LKB Technologies,
Inc., Piscataway, N.J.). By this method, the medium is combined
with the antibody/substrate under conditions that will allow
binding to occur. The complex may be washed to remove unbound
material, and the HFGF protein or HFGF fusion protein is released
or eluted through the use of conditions unfavorable to complex
formation. Particularly useful methods of elution include changes
in pH, wherein the immobilized antibody has a high affinity for the
ligand at a first pH and a reduced affinity at a second (higher or
lower) pH; changes in concentration of certain chaotropic agents or
salts, such as NaCl, for example; or through the use of
detergents.
HFGF Mutants
[0140] Within the scope of the present invention are HFGF proteins
or HFGF fusion proteins wherein one or more amino acid
substitutions, insertions or deletions occur in coding region of
Met 1 to Arg 68 of HFGF or N- or C-termini of HFGF. When carrying
out nucleotide substitutions using techniques for accomplishing
site-specific mutagenesis that are well known in the art, the
encoded amino acid changes are preferably of a minor nature, that
is, conservative amino acid substitutions, although other,
non-conservative, substitutions are contemplated as well.
Specifically contemplated are small deletions or insertions,
typically of one to about 30 amino acids; small amino- or
carboxyl-terminal extensions, such as an amino-terminal methionine
residue, or small linker peptides of less than 50, 40, 30, 20 or 10
residues linking a HFGF protein and another protein or peptide; or
a small extension that facilitates purification, such as a
poly-histidine tract, an antigenic epitope or a binding domain,
such as a GST fusion.
[0141] Examples of conservative amino acid substitutions are
substitutions made within the same group such as within the group
of basic amino acids (such as arginine, lysine, histidine), acidic
amino acids (such as glutamic acid and aspartic acid), polar amino
acids (such as glutamine and asparagine), hydrophobic amino acids
(such as leucine, isoleucine, valine), aromatic amino acids (such
as phenylalanine, tryptophan, tyrosine) and small amino acids (such
as glycine, alanine, serine, threonine, methionine).
[0142] Non-conservative substitutions encompass substitutions of
amino acids belonging to one group by amino acids belonging to
another group. For example, a non-conservative substitution would
include the substitution of a polar amino acid by a hydrophobic
amino acid. For a general description of nucleotide substitution,
see e.g. Ford et al. (1991) Protein Expression and Purification
2:95-107. Non-conservative substitutions, deletions and insertions
are particularly useful to produce mutant HFGF proteins with
altered biological properties.
[0143] For the polypeptides and proteins of the invention, the
following system is followed for designating amino acids in
accordance with the following conventional list: TABLE-US-00001
TABLE 1 AMINO ACIDS AND SYMBOLS ONE- THREE- LETTER LETTER AMINO
ACID SYMBOL SYMBOL Alanine A Ala Arginine R Arg Asparagine N Asn
Aspartic Acid D Asp Cysteine C Cys Glutamine Q Gln Glutamic Acid E
Glu Glycine G Gly Histidine H His Isoleucine I Ile Leucine L Leu
Lysine K Lys Methionine M Met Phenylalanine F Phe Proline P Pro
Serine S Ser Threonine T Thr Tryptophan W Trp Tyrosine Y Tyr Valine
V Val
Production of Fusion Proteins
[0144] The present invention further provides methods for producing
a fusion protein of the invention using nucleic acid molecules
described herein. In general terms, the production of a recombinant
form of a protein typically involves the following steps.
[0145] A nucleic acid molecule is first obtained that encodes HFGF
protein fusion protein of the invention. The nucleic acid molecule
is then preferably placed in operable linkage with suitable control
sequences, as described above, to form an expression unit
containing the protein open reading frame. The expression unit is
used to transform a suitable host and the transformed host is
cultured under conditions that allow the production of the
recombinant protein. Optionally, the recombinant protein is
isolated from the medium or from the cells; recovery and
purification of the protein may not be necessary in some instances
where some impurities may be tolerated.
[0146] Each of the foregoing steps can be accomplished in a variety
of ways. For example, the construction of expression vectors that
are operable in a variety of hosts is accomplished using
appropriate replicons and control sequences, as set forth above.
The control sequences, expression vectors, and transformation
methods depend on the type of host cell used to express the gene as
discussed in detail earlier, and are otherwise known to persons
skilled in the art. Suitable restriction sites can, if not normally
available, be added to the ends of the coding sequence so as to
provide an excisable gene to insert into these vectors. A skilled
artisan can readily adapt any host/expression system known in the
art for use with the nucleic acid molecules of the invention to
produce a desired recombinant protein.
[0147] Any expression system may be used, including yeast,
bacterial, animal, plant, eukaryotic and prokaryotic systems. In
some embodiments, yeast, mammalian cell culture and transgenic
animal or plant production systems are preferred. In other
embodiments, yeast systems that have been modified to reduce native
yeast glycosylation, hyper-glycosylation or proteolytic activity
may be used. In still further embodiments, bacterial expression
systems may be used.
Pharmaceutical Formulations
[0148] The HFGF proteins and HFGF fusion proteins of the invention
may be administered to a patient in need thereof using standard
administration protocols. For instance, the agents of the present
invention can be provided alone, or in combination, or in
sequential combination with other agents that modulate a particular
pathological process. As used herein, two agents are said to be
administered in combination when the two agents are administered
simultaneously or are administered independently in a way such that
the agents will act at the same or almost the same time.
[0149] The agents of the present invention can be administered via,
topical, parenteral, subcutaneous, intravenous, intramuscular,
intraperitoneal, transdermal, or buccal routes. For example, an
agent may be administered locally to a site via microinfusion or by
topical application in a cream, gel, lotion, ointment, salve, balm,
aqueous solution or patch. Alternatively, or concurrently,
administration may be by the oral route. The dosage administered
will be dependent upon the age, health, and weight of the
recipient, kind of concurrent treatment, if any, frequency of
treatment, and the nature of the desired effect.
[0150] The present invention further provides compositions
containing one or more proteins of the invention. While individual
needs vary, determination of optimal ranges of effective amounts of
each protein is within the skill of the art. Typical dosages of
protein for topical formulations comprise from about 0.1 ng to
about 100 ng per ml of the formulation, preferably from about 10 ng
to about 50 ng, most preferably about 30 ng.
[0151] In addition to the pharmacologically active protein, the
compositions of the present invention may contain suitable
pharmaceutically acceptable carriers comprising excipients and
auxiliaries that facilitate processing of the active compounds into
preparations which can be used pharmaceutically for delivery to the
site of action. Suitable formulations for parenteral administration
include aqueous solutions of the active compounds in water-soluble
form, for example, water-soluble salts. In addition, suspensions of
the active compounds as appropriate oily injection suspensions may
be administered. Suitable lipophilic solvents or vehicles include
fatty oils, for example, sesame oil, or synthetic fatty acid
esters, for example, ethyl oleate or triglycerides. Aqueous
injection suspensions may contain substances which increase the
viscosity of the suspension include, for example, sodium
carboxymethyl cellulose, sorbitol and dextran. Optionally, the
suspension may also contain stabilizers. Liposomes can also be used
to encapsulate the agent for delivery into the cell.
[0152] The pharmaceutical formulation for systematic administration
according to the invention may be formulated for enteral,
parenteral or topical administration. Indeed, all three types of
formulations may be used simultaneously to achieve systematic
administration of the active ingredient. Suitable formulations for
oral administration include hard or soft gelatin capsules, pills,
tablets, including coated tablets, elixirs, suspensions, syrups or
inhalations and controlled release forms thereof.
[0153] In practicing the methods of this invention, the agents of
this invention may be used alone or in combination, or in
combination with other therapeutic or diagnostic agents. In certain
preferred embodiments, the proteins of this invention may be
co-administered along with other compounds typically prescribed for
these conditions according to generally accepted medical practice.
The proteins of this invention can be utilized in vivo for mammals,
such as humans, sheep, horses, cattle, pigs, dogs, cats, rats and
mice, or in vitro.
Transgenic Animals
[0154] The production of transgenic non-human animals that contain
HFGF protein encoding construct of the instant invention is
contemplated in one embodiment of the present invention.
[0155] The successful production of transgenic, non-human animals
has been described in a number of patents and publications, such
as, for example U.S. Pat. No. 6,291,740 (issued Sep. 18, 2001);
U.S. Pat. No. 6,281,408 (issued Aug. 28, 2001); and U.S. Pat. No.
6,271,436 (issued Aug. 7, 2001) the contents of which are hereby
incorporated by reference in their entireties.
[0156] The ability to alter the genetic make-up of animals, such as
domesticated mammals including cows, pigs, goats, horses, cattle,
and sheep, allows a number of commercial applications. These
applications include the production of animals which express large
quantities of exogenous proteins in an easily harvested form (e.g.
expression into the milk or blood), the production of animals with
increased weight gain, feed efficiency, carcass composition, milk
production or content, disease resistance and resistance to
infection by specific microorganisms and the production of animals
having enhanced growth rates or reproductive performance. Animals
which contain exogenous DNA sequences in their genome are referred
to as transgenic animals.
[0157] The most widely used method for the production of transgenic
animals is the microinjection of DNA into the pronuclei of
fertilized embryos (Wall et al., J. Cell. Biochem. 49:113 [1992]).
Other methods for the production of transgenic animals include the
infection of embryos with retroviruses or with retroviral vectors.
Infection of both pre- and post-implantation mouse embryos with
either wild-type or recombinant retroviruses has been reported
(Janenich, Proc. Natl. Acad. Sci. USA 73:1260 [1976]; Janenich et
al., Cell 24:519 [1981]; Stuhlmann et al., Proc. Natl. Acad. Sci.
USA 81:7151 [1984]; Jahner et al., Proc. Natl. Acad. Sci. USA
82:6927 [1985]; Van der Putten et al., Proc. Natl. Acad. Sci. USA
82:6148-6152 [1985]; Stewart et al., EMBO J. 6:383-388 [1987]).
[0158] An alternative means for infecting embryos with retroviruses
is the injection of virus or virus-producing cells into the
blastocoele of mouse embryos (Jahner, D. et al., Nature 298:623
[1982]). The introduction of transgenes into the germline of mice
has been reported using intrauterine retroviral infection of the
midgestation mouse embryo (Jahner et al., supra [1982]). Infection
of bovine and ovine embryos with retroviruses or retroviral vectors
to create transgenic animals has been reported. These protocols
involve the micro-injection of retroviral particles or growth
arrested (i.e., mitomycin C-treated) cells which shed retroviral
particles into the perivitelline space of fertilized eggs or early
embryos (PCT International Application WO 90/08832 [1990]; and
Haskell and Bowen, Mol. Reprod. Dev., 40:386 [1995]. PCT
International Application WO 90/08832 describes the injection of
wild-type feline leukemia virus B into the perivitelline space of
sheep embryos at the 2 to 8 cell stage. Fetuses derived from
injected embryos were shown to contain multiple sites of
integration.
[0159] U.S. Pat. No. 6,291,740 (issued Sep. 18, 2001) describes the
production of transgenic animals by the introduction of exogenous
DNA into pre-maturation oocytes and mature, unfertilized oocytes
(i.e., pre-fertilization oocytes) using retroviral vectors which
transduce dividing cells (e.g., vectors derived from murine
leukemia virus [MLV]). This patent also describes methods and
compositions for cytomegalovirus promoter-driven, as well as mouse
mammary tumor LTR expression of various recombinant proteins.
[0160] U.S. Pat. No. 6,281,408 (issued Aug. 28, 2001) describes
methods for producing transgenic animals using embryonic stem
cells. Briefly, the embryonic stem cells are used in a mixed cell
co-culture with a morula to generate transgenic animals. Foreign
genetic material is introduced into the embryonic stem cells prior
to co-culturing by, for example, electroporation, microinjection or
retroviral delivery. ES cells transfected in this manner are
selected for integration of the gene via a selection marker such as
neomycin.
[0161] U.S. Pat. No. 6,271,436 (issued Aug. 7, 2001) describes the
production of transgenic animals using methods including isolation
of primordial germ cells, culturing these cells to produce
primordial germ cell-derived cell lines, transforming both the
primordial germ cells and the cultured cell lines, and using these
transformed cells and cell lines to generate transgenic animals.
The efficiency at which transgenic animals are generated is greatly
increased, thereby allowing the use of homologous recombination in
producing transgenic non-rodent animal species.
Gene Therapy
[0162] The use of HFGF protein constructs for gene therapy is
contemplated in one embodiment of this invention. The HFGF protein
constructs of the present invention are ideally suited to gene
therapy treatments.
[0163] The polynucleotide of the invention can be applied to the
scalp through delivery of nucleic acid molecules. The delivery of
nucleic acid molecules can be accomplished by many means known in
the art. Gene delivery vehicles (GDVs) are available for delivery
of polynucleotides to cells or tissue for expression. For example,
a nucleic acid sequence of the invention can be administered either
locally or systematically in a GDV. These constructs can utilize
viral or non-viral vector approaches in in vivo or ex vivo
modality. Expression of such coding sequence can be induced using
endogenous mammalian or heterologous promoters. Expression of the
coding sequence in vivo can be either constitutive or regulated.
The invention includes gene delivery vehicles capable of expressing
the contemplated polynucleotides. The gene delivery vehicle is
preferably a viral vector and, more preferably, a retroviral,
adenoviral, adeno-associated viral (AAV), herpes viral, or
alphavirus vectors. The viral vector can also be an astrovirus,
coronavirus, orthomyxovirus, papovavirus, paramyxovirus,
parvovirus, picornavirus, poxvirus, togavirus viral vector. See
generally, Jolly, Cancer Gene Therapy 1:51-64 (1994); Kimura, Human
Gene Therapy 5:845-852 (1994), Connelly, Human Gene Therapy
6:185-193 (1995), and Kaplitt, Nature Genetics 6:148-153
(1994).
[0164] Delivery of the gene therapy constructs of this invention
into cells is not limited to the above-mentioned viral vectors.
Other delivery methods and media may be employed such as nucleic
acid expression vectors, polycationic condensed DNA linked or
unlinked to killed adenovirus alone (Curiel, Hum Gene Ther
3:147-154 (1992), ligand linked DNA (Wu, J. Biol. Chem.
264:16985-16987 (1989), eucaryotic cell delivery vehicles cells
(U.S. Pat. No. 6,015,686), deposition of photopolymerized hydrogel
materials, hand-held gene transfer particle gun (U.S. Pat. No.
5,149,655), ionizing radiation (U.S. Pat. No. 5,206,152 and PCT
Patent Publication No. WO 92/11033), nucleic charge neutralization
or fusion with cell membranes. Additional approaches are described
in Philip, Mol. Cell. Biol. 14:2411-2418 (1994) and in Woffendin,
Proc. Natl. Acad. Sci. 91:1581-585 (1994). Particle mediated gene
transfer may be employed, for example see U.S. provisional
application No. 60/023,867. Briefly, the nucleotide sequence can be
inserted into conventional vectors that contain conventional
control sequences for high level expression, and then be incubated
with synthetic gene transfer molecules such as polymeric
DNA-binding cations like polylysine, protamine, and albumin, linked
to cell targeting ligands. Naked DNA may also be employed.
Exemplary naked DNA introduction methods are described in PCT
Patent Publication No. WO 90/11092 and U.S. Pat. No. 5,580,859.
Uptake efficiency may be improved using biodegradable latex beads.
DNA coated latex beads are efficiently transported into cells after
endocytosis initiation by the beads. The method may be improved
further by treatment of the beads to increase hydrophobicity and
thereby facilitate disruption of the endosome and release of the
DNA into the cytoplasm. Liposomes, that can act as gene delivery
vehicles are described in U.S. Pat. No. 5,422,120, PCT Patent
Publication Nos. WO 95/13796, WO 94/23697, and WO 91/144445, and EP
No. 524,968.
[0165] The nucleic acid molecule may be introduced into the scalp
using the injectable carrier alone; liposomal preparations are
preferred for methods in which in vitro transfections of cells
obtained from the scalp are carried out. The carrier preferably is
isotonic, hypotonic, or weakly hypertonic, and has a relatively low
ionic strength, such as provided by a sucrose solution. The
preparation may further advantageously comprise a source of a
cytokine which is incorporated into liposomes in the form of a
polypeptide or as a polynucleotide. Alternatively, an even more
prolonged effect can be achieved by introducing the DNA sequence
into the cell by means of a vector plasmid having the DNA sequence
inserted therein. Preferably, the plasmid further comprises a
replicator. Such plasmids are well known to those skilled in the
art, for example, plasmid pBR322, with replicator pMB1, or plasmid
pMK16, with replicator ColE1 (Ausubel, Current Protocols in
Molecular Biology, John Wiley and Sons, New York (1988)
.sctn.II:1.5.2.
[0166] It is possible to obtain long term administration of a
polypeptide to the scalp by introducing a naked DNA sequence
operatively coding for the polypeptide interstitially into the
scalp, whereby cells of the tissue produce the polypeptide for at
least one month or at least 3 months, more preferably at least 6
months. In addition, a method for obtaining transitory expression
of a polypeptide in the scalp can be achieved by introducing a
naked mRNA sequence operatively coding for the polypeptide
interstitially into the scalp, whereby cells of the tissue produce
the polypeptide for less than about 20 days, usually less than
about 10 days, and often less than 3 or 5 days.
[0167] One important aspect of the invention is a method for
treatment of alopecia, comprising the steps of introducing a
therapeutic amount of a composition comprising a nucleic acid
molecule operatively coding for the polypeptide of the invention in
a pharmaceutically acceptable injectable carrier in vivo into the
scalp of patients suffering from alopecia, whereby the nucleic acid
molecule is taken up into the cells and the polypeptide is produced
in vivo. Preferably, the nucleic acid molecule is a naked nucleic
acid molecule and the composition is introduced interstitially into
the scalp.
[0168] The nucleic acid may be either a DNA or RNA sequence. When
the nucleic acid is DNA, it can also be a DNA sequence which is
itself non-replicating, but is inserted into a plasmid, and the
plasmid further comprises a replicator. The DNA may be a sequence
engineered so as not to integrate into the host cell genome. The
nucleic acid sequences may code for a polypeptide which is either
contained within the cells or secreted therefrom, or may comprise a
sequence which directs the secretion of the peptide. The DNA
sequence may also include a promoter sequence. In one preferred
embodiment, the DNA sequence includes a cell-specific promoter that
permits substantial transcription of the DNA only in predetermined
scalp. The DNA may also code for a polymerase for transcribing the
DNA, and may comprise recognition sites for the polymerase and the
injectable preparation may include an initial quantity of the
polymerase. In one preferred embodiment, the nucleic acid is DNA
coding for both a polypeptide and a polymerase for transcribing the
DNA, and the DNA includes recognition sites for the polymerase and
the injectable preparation further includes a means for providing
an initial quantity of the polymerase in the cell. The initial
quantity of polymerase may be physically present together with the
DNA. Alternatively, it may be provided by including mRNA coding
therefor, which mRNA is translated by the cell. In this embodiment
of the invention, the DNA is preferably a plasmid. Preferably, the
polymerase is phage T7 polymerase and the recognition site is a T7
origin of replication sequence.
[0169] The pharmaceutical compositions containing the nucleic acid
molecule according to the invention can be formulated for the
purposes of topical, cutaneous, parenteral, subcutaneous, and
transdermal administrations and the like. The pharmaceutical
compositions of the invention preferably contain a pharmaceutical
vehicle which is acceptable for an injectable formulation,
especially for direct injection on the scalp. They can in
particular be isotonic, sterile solutions or dry compositions,
especially lyophilized, which, by addition, depending on the
situation, of sterilized water or of physiological serum, make it
possible to prepare injectable solutions. The doses of nucleic acid
used for injection, as well as the number of administrations, can
be varied according to various parameters, and especially as a
function of the method of administration used, severity of the
alopecia, age of patients, or alternatively of the desired duration
of treatment. Containers used in the present invention will usually
have at least 1, preferably at least 5 or 10, and more preferably
at least 50 or 100 micrograms of polynucleotide, to provide one or
more unit dosages. For many applications, the container will have
at least 500 micrograms or 1 milligram, and often will contain at
least 50 or 100 milligrams of polynucleotide.
[0170] In addition, gene therapy is described in a number of U.S.
patents including U.S. Pat. No. 6,225,290 (issued May 1, 2001);
U.S. Pat. No. 6,187,305 (issued Feb. 13, 2001); and U.S. Pat. No.
6,140,111 (issued Oct. 31, 2000). U.S. Pat. No. 6,225,290 provides
methods and constructs whereby intestinal epithelial cells of a
mammalian subject are genetically altered to operatively
incorporate a gene which expresses a protein which has a desired
therapeutic effect. Intestinal cell transformation is accomplished
by administration of a formulation composed primarily of naked DNA,
and the DNA may be administered orally. Oral or other
intragastrointestinal routes of administration provide a simple
method of administration, while the use of naked nucleic acid
avoids the complications associated with use of viral vectors to
accomplish gene therapy. The expressed protein is secreted directly
into the gastrointestinal tract and/or blood stream to obtain
therapeutic blood levels of the protein thereby treating the
patient in need of the protein. The transformed intestinal
epithelial cells provide short or long term therapeutic cures for
diseases associated with a deficiency in a particular protein or
which are amenable to treatment by overexpression of a protein.
U.S. Pat. No. 6,187,305 provides methods of gene or DNA targeting
in cells of vertebrate, particularly mammalian, origin. Briefly,
DNA is introduced into primary or secondary cells of vertebrate
origin through homologous recombination or targeting of the DNA,
which is introduced into genomic DNA of the primary or secondary
cells at a preselected site.
[0171] U.S. Pat. No. 6,140,111 (issued Oct. 31, 2000) describes
retroviral gene therapy vectors. The disclosed retroviral vectors
include an insertion site for genes of interest and are capable of
expressing high levels of the protein derived from the genes of
interest in a wide variety of transfected cell types. Also
disclosed are retroviral vectors lacking a selectable marker, thus
rendering them suitable for human gene therapy in the treatment of
a variety of disease states without the co-expression of a marker
product, such as an antibiotic. These retroviral vectors are
especially suited for use in certain packaging cell lines. The
ability of retroviral vectors to insert into the genome of
mammalian cells have made them particularly promising candidates
for use in the genetic therapy of genetic diseases in humans and
animals. Genetic therapy typically involves (1) adding new genetic
material to patient cells in vivo, or (2) removing patient cells
from the body, adding new genetic material to the cells and
reintroducing them into the body, i.e., in vitro gene therapy.
Discussions of how to perform gene therapy in a variety of cells
using retroviral vectors can be found, for example, in U.S. Pat.
No. 4,868,116, issued Sep. 19, 1989, and U.S. Pat. No. 4,980,286,
issued Dec. 25, 1990 (epithelial cells), WO89/07136 published Aug.
10, 1989 (hepatocyte cells), EP 378,576 published Jul. 25, 1990
(fibroblast cells), and WO89/05345 published Jun. 15, 1989 and
WO/90/06997, published Jun. 28, 1990 (endothelial cells), the
disclosures of which are incorporated herein by reference in their
entireties.
[0172] The successful use of gene therapy to express protein has
also been described in non-patent literature. In one case, gene
therapy via injection of an adenovirus vector containing a gene
encoding a soluble fusion protein consisting of cytotoxic
lymphocyte antigen 4 (CTLA4) and the Fc portion of human
immunoglubulin G1 was recently shown in Ijima et al. (Jun. 10,
2001) Human Gene Therapy (United States) 12/9:1063-77. In this
application of gene therapy, a murine model of type II
collagen-induced arthritis was successfully treated via
intraarticular injection of the vector.
Hair Transplantation
[0173] In a typical hair transplantation procedure, grafts of skin
containing hair are removed from the back or sides of the scalp
(donor area) of the individual and are transplanted to other areas,
that is, the bald or thinning area (recipient area). To place the
grafts onto these areas, a number of incisions are made in the
scalp. The incisions are then cleaned and a graft is inserted into
each incision. Hair transplantation includes a minigraft for
placing only a small number of hairs into the incisions, a
micrograft for placing a single hair in the incisions (also,
referred to as one-haired minigraft), and a follicular unit hair
transplantation.
[0174] The minigraft utilizes 2 to 6 hairs per graft. It provides
good hair density to the transplanted area. It is ideally suited
for the top portion of the head where the appearance of hair
density is desirable. A variety of techniques have been employed to
transplant minigrafts. In one attempt, the use of a dilator has
been proposed. According to this method, an 18 or 20 gauge
hypodermic needle is employed to form an incision. A dilator is
then placed in the incision to dilate the incision. After removal
of the dilator, the minigraft is inserted. Over time, the incision
shrinks so that the skin will support the graft. Alternatively,
with the quick "Slit Technique", the surgeon makes multiple slits
on the bald scalp with a knife blade. This can be accomplished in a
very short period of time. Following making of the quick skin
slits, the hair grafts are planted into these bald skin slits,
without removing (decreasing) the amount of balded scalp. The
original bald scalp remains discernible as bald gaps between the
slits of hair grafts. The transplanted hair grafts may also be
compressed by the tight bald scalp tissue on both sides of the skin
slits when the hair grafts and hair follicles are inserted. In
other proposed methods, punches have been employed to punch a small
diameter hole in the scalp. The graft is then placed in the
cylindrical opening left by the punch. In yet another proposed
method, a #11 blade (a Lancet blade) has been employed to form an
incision for receiving a minigraft. Since the Lancet blade is
angled, this method includes the additional step of translating the
blade downward at an angle of 45 degree after the initial insertion
so that the bottom of the incision has a constant depth. Having a
constant depth is desirable so that the hair follicles in the graft
will all be transplanted at the same depth. In a similar procedure,
the use of a No-Kor vented needle (Becton Dickinson and Co,
Rutherford, N.J.) has been proposed for creating incisions for
receiving 1 to 3 haired minigrafts. Such a method is described in,
Dominic A. Brandy and Michael Meshkin, Utilization of No-Kor
Needles For Slit-micrografting, J Dermatol Surg Oncol, 20:336-339
(1994).
[0175] The micrograft was developed in the 1990s to transplant 1 to
2 hairs per graft. It is ideally used for the front area of the
scalp, at the upper part of the forehead, so as to create a soft,
natural frontal hairline. The use of the micrografts is a major
improvement over the old hair plugs used in the 1980s, which
resulted in the "corn-row" hairline with the "Barbie doll"
appearance.
[0176] Follicular unit hair transplantation is a completely
different process. Scalp hair follicles actually grow in small
groupings or units of 1, 2, 3 or occasionally 4 hair follicles per
unit. This naturally occurring grouping of follicles is called a
"follicular unit". A thin linear segment of hair-bearing skin is
first harvested from areas where there is a surplus of follicles
that are genetically superior. The thin linear opening in the skin
is then carefully and meticulously closed with sutures. The
remaining pencil line incision is typically easily hidden by the
hair. Using magnification, "follicular unit" grafts are then
fashioned from the tiny naturally occurring groupings of hair
follicles. These grass seed size "follicle grafts" (not "hairy skin
grafts"), each containing a single "follicular unit", can then be
transplanted into closely spaced needle size openings within the
areas of hair loss.
[0177] HFGF proteins of the present invention have a
pharmacological effect on hair follicle cell proliferation. It is
therefore understood that the pretreatment of scalp hair follicles
or grafts with the HFGF proteins of the present invention will
promote or accelerate hair implantation. Accordingly, the present
invention provides a method for transplanting hair in a subject
which comprises supplementing scalp hair follicles or grafts with
the polypeptide comprising an amino acid sequence of Ser 69 to Ser
208 of SEQ ID NO: 1 and transplanting the supplemented hair grafts
or follicles with the polypeptide to the bald or thinning area of
said subject.
Diagnosis of Alopecia
[0178] The present invention also relates to the use of HFGF
proteins or nucleic acid molecule encoding said proteins in
diagnosis of alopecia. Detection of HFGF proteins or nucleic acid
molecules encoding said proteins of the present invention will
provide a diagnostic tool that can add or define a diagnosis of
alopecia or susceptibility to a disease which results from
under-expression or altered expression of HFGF. Individuals
carrying point mutation in the human KGF-2 gene in which a codon
for Lys 87 is replaced with either codon for Glu or codon for Asp
may be detected at the DNA level by a variety of techniques.
Proteins or nucleic acids for diagnosis may be obtained from a
patient's cells, such as from blood, urine, saliva, scalp tissue
biopsy and autopsy material. The genomic DNA may be used directly
for detection or may be amplified enzymatically by using PCR prior
to analysis (Saiki et al., Nature 324:163-166 (1986)). RNA or cDNA
may also be used in the same ways. As an example, PCR primers
complementary to the nucleic acid encoding HFGF can be used to
identify and analyze HFGF proteins expression and/or point mutation
in KGF-2. For example, deletions and insertions can be detected by
a change in size of the amplified product in comparison to the
normal genotype. Point mutations can be identified by hybridizing
amplified DNA to radiolabeled HFGF RNA or alternatively,
radiolabeled HFGF antisense DNA sequences. Perfectly matched
sequences can be distinguished from mismatched duplexes by RNase A
digestion or by differences in melting temperatures.
[0179] Sequence differences between a reference gene and genes
having mutations also may be revealed by direct DNA sequencing. In
addition, cloned DNA segments may be employed as probes to detect
specific DNA segments. The sensitivity of such methods can be
greatly enhanced by appropriate use of PCR or another amplification
method. For example, a sequencing primer is used with
double-stranded PCR product or a single-stranded template molecule
generated by a modified PCR. The sequence determination is
performed by conventional procedures with radiolabeled nucleotide
or by automatic sequencing procedures with fluorescent-tags.
[0180] Genetic testing based on DNA sequence differences may be
achieved by detection of alteration in electrophoretic mobility of
DNA fragments in gels, with or without denaturing agents. Small
sequence deletions and insertions can be visualized by high
resolution gel electrophoresis. DNA fragments of different
sequences may be distinguished on denaturing fortnamide gradient
gels in which the mobilities of different DNA fragments are
retarded in the gel at different positions according to their
specific melting or partial melting temperatures (see, e.g., Myers
et al., Science 230:1242 (1985)).
[0181] Sequence changes at specific locations also may be revealed
by nuclease protection assays, such as RNase and S1 protection or
the chemical cleavage method (e.g., Cotton et al., Proc. Natl.
Acad. Sci. (USA) 85:4397-4401 (1985)).
[0182] Thus, the detection of a specific DNA sequence may be
achieved by methods such as hybridization, RNase protection,
chemical cleavage, direct DNA sequencing or the use of restriction
enzymes, (e.g., restriction fragment length polymorphisms ("RFLP"))
and Southern blotting of genomic DNA. In addition to more
conventional gel-electrophoresis and DNA sequencing, mutations also
can be detected by in situ analysis.
[0183] The sequences of the present invention are also valuable for
chromosome identification. The sequence is specifically targeted to
and can hybridize with a particular location on an individual human
chromosome. Moreover, there is a current need for identifying
particular sites on the chromosome. Few chromosome marking reagents
based on actual sequence data (repeat polymorphisms) are presently
available for marking chromosomal location. The mapping of DNAs to
chromosomes according to the present invention is an important
first step in correlating those sequences with genes associated
with disease.
[0184] In certain preferred embodiments in this regard, the cDNA
herein disclosed is used to clone genomic DNA of a HFGF gene. This
can be accomplished using a variety of well known techniques and
libraries, which generally are available commercially. The genomic
DNA is used for in situ chromosome mapping using well known
techniques for this purpose. Typically, in accordance with routine
procedures for chromosome mapping, some trial and error may be
necessary to identify a genomic probe that gives a good in situ
hybridization signal.
[0185] The present invention also relates to diagnostic assays such
as quantitative and diagnostic assays for detecting levels of HFGF
protein in cells and tissues, including determination of normal and
abnormal levels. Thus, for instance, a diagnostic assay in
accordance with the invention for detecting under-expression of
HFGF proteins compared to normal control tissue samples may be used
to detect the prognosis of alopecia. Assay techniques that can be
used to determine levels of HFGF proteins of the present invention,
in a sample derived from a host, for example blood or scalp tissue
are well-known to those of skill in the art. Such assay methods
include radioimmunoassays, competitive-binding assays, Western Blot
analysis and ELISA assays. Among these, ELISAs are frequently
preferred. An ELISA assay initially comprises preparing an antibody
specific to HFGF, preferably a monoclonal antibody. In addition, a
reporter antibody generally is prepared which binds to the
monoclonal antibody. The reporter antibody is attached a detectable
reagent such as radioactive, fluorescent or enzymatic reagent, in
this example horseradish peroxidase enzyme.
[0186] To carry out an ELISA a sample is removed from a host and
incubated on a solid support, e.g. a polystyrene dish, that binds
the proteins in the sample. Any free protein binding sites on the
dish are then covered by incubating with a non-specific protein
such as bovine serum albumin. Next, the monoclonal antibody is
incubated in the dish during which time the monoclonal antibodies
attach to any HFGF proteins attached to the polystyrene dish.
Unbound monoclonal antibodies are washed out with buffer. The
reporter antibody linked to horseradish peroxidase is placed in the
dish resulting in binding of the reporter antibody to any
monoclonal antibody bound to HFGF protein. Unattached reporter
antibodies are then washed out. Reagents for peroxidase activity,
including a colorimetric substrate are then added to the dish.
Immobilized peroxidase, linked to HFGF protein through the primary
and secondary antibodies, produces a colored reaction product. The
amount of color developed in a given time period indicates the
amount of HFGF protein present in the sample. Quantitative results
typically are obtained by reference to a standard curve.
[0187] A competition assay may be employed wherein antibodies
specific to HFGF protein attached to a solid support and labeled
HFGF protein and a sample derived from the host are passed over the
solid support and the amount of label detected attached to the
solid support can be correlated to a quantity of HFGF protein in
the sample.
[0188] Accordingly, the present invention provides a method for
diagnosing alopecia in a subject comprising collecting a blood or
tissue sample from said subject and detecting HFGF proteins in said
sample.
[0189] Unless otherwise defined, all technical and scientific terms
herein have the same meaning as commonly understood by one of
ordinary skill in the art to which this invention belongs. Although
any methods and materials, similar or equivalent to those described
herein, can be used in the practice or testing of the present
invention, the preferred methods and materials are described
herein.
[0190] Without further description, it is believed that a person of
ordinary skill in the art can, using the preceding description and
the following illustrative examples, make and utilize the present
invention and practice the disclosed methods. The following working
examples therefore, specifically point out the preferred
embodiments of the present invention, and are not to be construed
as limiting in any way the remainder of the disclosure.
EXAMPLES
Example 1
Isolation of Hair Follicles
[0191] Hair follicles with a morphological structure characteristic
of anagen were obtained from human scalp skin both of normal
persons (persons without alopecia) and alopecia patients.
Example 2
Isolation of the Human HFGF cDNA
[0192] Reverse transcription was performed using total RNA
extracted by Trizol (Gibco BRL) from hair follicles obtained in
Example 1. More specifically, total RNA (50-1000 nanograms)
isolated from human hair follicles was incubated for 60 min at
37.degree. C. in a reaction mixture of about 200 microliters
containing 300 units of Moloney murine leukemia virus reverse
transcriptase, 15 units of human placenta RNase inhibitor and 0.5
micrograms of a random hexadeoxynucleotide primer, which resulted
in the production of a cDNA solution. To specifically amplify human
HFGF cDNA from said cDNA solution, PCR was performed using a
GeneAmp PCR System 9600 (Perkin-Elmer) for 30 cycles in a reaction
mixture containing an aliquot of the above cDNA solution, 0.05
units/microliter Taq DNA polymerase, and 4 pmol/microliter of each
of the sense primer, atgtggaaatggatactgac, (SEQ ID NO:3) and the
antisense primer, ctatgagtgtaccaccattgg, (SEQ ID NO:4) to amplify a
sequence corresponding to the sequence of the 1.sup.st to
208.sup.th amino acids of human KGF-2.
[0193] Five clones were randomly selected, and their nucleotide
sequences were determined. Specifically, the amplified cDNA of 627
base-pairs as shown in FIG. 9 (SEQ ID NO:2) was cloned into the
vector pGEM-T (Promega Biotech) and the nucleotide sequence of the
cloned cDNA was determined with an Applied Biosystems model 377 DNA
sequencer (Perkin-Elmer) using dideoxy terminator cycle sequencing
(Applied Biosystems).
[0194] As a result, one of the five clones was identified with a
sequence that encodes for a polypeptide having an amino acid
sequence wherein the lysine residue at position 87 of the human
KGF-2 protein is replaced by glutamic acid. The isolated cDNA was
analogous to that of human KGF-2 cDNA, suggesting that it was a
human HFGF protein (HFGF) cDNA clone. The nucleotide sequence of
the coding region of the human HFGF cDNA (627 nucleotides) (SEQ ID
NO:2) is shown in FIG. 9, which is highly homologous (99.5%) to
that of human KGF-2.
[0195] The above human HFGF cDNA was inserted into the pGEM-T
vector to construct pGEM-T-KGF-2A which express HFGF protein of the
present invention. The pGEM-T vector contains a T7 Sp6 RNA
polymerase dual promotor (-17 to +3) and lac operator (200 to
216).
[0196] The nucleotide sequence of SEQ ID NO:2 allowed the
elucidation of the complete amino acid sequence (208 amino acids)
of human HFGF, wherein the 4.sup.th to the 117.sup.th nucleotides
encode a putative signal sequence of HFGF. The amino acid sequence
of HFGF (SEQ ID NO:1) is shown in FIG. 8.
Example 3
Analysis of Expression of HFGF and its Receptor FGFR2IIIb mRNA by
RT-PCR
[0197] The mRNA level of HFGF from human hair follicles was
analyzed to investigate the expression level of HFGF. The mRNA of
HFGF was specifically converted to cDNA by RT-PCR using
oligonucleotide primers, ttggtcaggacatggtg (SEQ ID NO:5) and
ctatgagtgtaccaccattgg (SEQ ID NO:6) which flank a 427-base pair
coding sequence (nucleotides 119 to 627) of human HFGF.
[0198] Specifically, total RNA (100 micrograms) extracted from hair
follicles was converted to cDNA by PCR performed for 40 cycles at
94.degree. C. for 1 min, 55.degree. C. for 1 min, and 72.degree. C.
for 2 min in a reaction mixture containing 15 units of Moloney
murine leukemia virus reverse transcriptase and the oligonucleotide
primers shown as SEQ ID NO:5 and SEQ ID NO:6.
[0199] To investigate the expression level of HFGF receptor, i.e.
FGFR2 IIIb, RT-PCR was performed using the oligonucleotide primers,
ggagaatgaatacgggtcc (SEQ ID NO:7) and ggttggcctgccctatatata (SEQ ID
NO:8) which flank a 350-base pair coding sequence (nucleotides 699
to 1049) of human FGFR2IIIb.
[0200] The mRNA of FGFR2IIIb was specifically converted to cDNA by
RT-PCR having a reaction profile consisting of one cycle at
94.degree. C. for 1 min, followed by 35 cycles at 94.degree. C. for
1 min, 58.degree. C. for 30 sec, and 72.degree. C. for 1 min with a
final extension of 5 min at 72.degree. C.
[0201] The RT-PCR products were analyzed in a 1.5% agarose gel and
the mRNA level of .beta.-actin was also analyzed as an internal
control.
[0202] As shown in FIG. 3, the results of agarose gel analysis
demonstrate that cDNA encoding HFGF from normal persons (persons
without alopecia) was detected while no cDNA encoding HFGF from
alopecia patients was detected. This is in contrast to studies
involving the detection of HFGF receptor cDNA in which HFGF
receptor cDNA was detected in persons with and without
alopecia.
[0203] Additionally, as shown in Table 2, HFGF cDNA is absent in
seven of seven human hair follicles from alopecia patients while
that of normal hair follicles shows HFGF expression in four of
seven with a statistically significant difference (P<0.05).
TABLE-US-00002 TABLE 2 HFGF expression in human hair follicles Hair
follicles Expressed Absent Normal 4/7 (57%) 3/7 (43%) Alopecia 0/7
(0%) 7/7 (100%)
[0204] The foregoing results suggest that silent carriers who are
normal in appearance have a reduced expression level of HFGF in
their hair follicles, probably due to an inherited trait. These
persons are very likely to develop alopecia.
Example 4
Preparation of Recombinant HFGF
[0205] The cDNA encoding the 40.sup.th to the 208.sup.th amino
acids of human HFGF (hHFGF) of SEQ ID NO:1 was amplified using
human HFGF cDNA (described in Example 2) as a template by PCR for
25 cycles using Taq DNA polymerase and the following primers,
ggatccttggtcaggacatggtg (SEQ ID NO:9) and
gaattcctatgagtgtaccaccattgg (SEQ ID NO:10). The amplified region
corresponded to that encoding the putative mature growth factor
following secretion and cleavage of the signal sequence.
[0206] The PCR product was subcloned into the pET9c plasmid
(Novagen) and E. coli BL21(DE3) was transformed with the
pET9c-HFGF.
[0207] The transformant produced by the above process was cultured
for 48 hours and lysed. The cell lysate was then applied to a
heparin-Sepharose column.
[0208] Analysis of successive fractions of increasing NaCl
concentration eluted from the heparin-Sepharose column determined
that the majority of hHFGF eluted with the 1.0 M NaCl fraction, as
determined by silver staining of proteins separated by SDS-PAGE,
although some protein also eluted in the 0.8 and 1.2 M NaCl
fractions.
[0209] The apparent molecular mass of the polypeptide was
approximately 20 kDa, consistent with the predicted molecular
weight. Amino acid analysis of a sample of protein eluted at 1.0 M
NaCl confirmed that the preparation consisted of substantially pure
HFGF, whose amino terminus was in agreement with that predicted
from the sequence.
Example 5
Preparation of Recombinant HFGF using GST-Fusion System
[0210] The cDNA of hHFGF amplified according to Example 4 was
digested with restriction enzymes EcoRI and BamHI and ligated in
the EcoRI/BamHI site of the pGEX-2T expression vector. The
resultant construct, pGEX-2T-KGF2A recombinant vector was
transfected into E. coli BL21 (DE3) by heat shock for 30 min at
42.degree. C. The transformant produced by the above process was
cultured for 48 hours and lysed.
[0211] The cell lysate was applied directly to a glutathione column
(Pharmacia Biotech) pre-equilibrated with 50 mM Tris-HCl (pH 8.0).
The thrombin-treated column was left over-night (14-16 hours) for
cleavage at room temperature before elution (Sigma). Proteins bound
to glutathione beads were eluted with glutathione in 50 mM Tris-HCl
(pH 8.0).
[0212] The fraction containing recombinant HFGF was subsequently
applied to a Heparin column (Pharmacia Biotech). Recombinant HFGF
was eluted with a linear gradient of 0-2.0 M NaCl in 50 mM Tris-HCl
(pH 8.0). The recombinant HFGF fraction was dialyzed overnight
against phosphate-buffered saline and subsequently applied to
PyroSep-C (Tanabe Pharmaceuticals, Japan) for removal of
endotoxin.
[0213] The apparent molecular mass of HFGF identified by running it
on agarose gel was approximately 20 kDa and that of GST-HFGF was 45
kDa, consistent with the predicted molecular weight (see FIG.
2).
Example 6
Determination of Mitogenic Activity of Recombinant HFGF
[0214] Isolated human hair follicles are maintained in individual
wells of 24-well multiwell plates containing 1 ml of KBM media
(Clonetics) supplemented with 100 U/ml penicillin, 10 ng/ml
hydrocortisone, 75 .mu.g/ml bovine pituitary extract in an
atmosphere of 5% CO.sub.2/95% air.
[0215] The cell growth of hair follicles was measured by
colorimetric MTS assays. Specifically, isolated human hair
follicles were treated with HFGF at different concentrations from
10, 30 and 100 ng/ml for forty-eight hours before measuring by MTS
assay. In these studies, HFGF produced as in Example 4 was
utilized.
[0216] Single hair follicle was then plated in a 96-well microtiter
per well, and proliferation was measured 4 h later using a
calorimetric MTS assay according to the manufacturer's suggestions
(Promega). In each experiment, observations (n=8 hair follicles per
group) were performed and the values are reported as
mean.+-.standard error (S.E.). In the proliferation assay, the
negative control was evaluated using untreated hair follicle
cells.
[0217] As seen in FIG. 5, the addition of HFGF resulted in
dose-dependent of stimulation of human hair follicle cells with a
maximum stimulatory effect observed at a concentration of 30 ng/ml
HFGF.
Example 7
Determination of Molecular Mechanism of HFGF Activity
[0218] Like tooth or feather-bud development, hair follicle
morphogenesis is governed by epithelial-mesenchymal interactions,
between hair placode keratinocytes and fibroblasts of underlying
mesenchymal condensations.
[0219] Accordingly, the molecular mechanism of HFGF activity may be
suggested by assessing the effects of administration of HFGF on
hair follicle cell proliferation in organ culture.
[0220] Further, since KGF-2 exists in human hair follicles from
normal persons (persons without alopecia), it is intended to
exclude any effects caused by an endogenous KGF-2 from dermal
papilla. That is, HFGF was used to treat culture media containing
human hair follicles from a normal person in which dermal papilla
(DP) were removed surgically.
[0221] Interestingly, as shown in FIGS. 6A and 6B, HFGF stimulate
DP-deleted hair follicle cells with the increased percentage of
135%.+-.11.1 (P<0.05) cell proliferation compared to
DP-containing hair follicle cells (125%.+-.11.0).
Example 8
Comparison of Stimulatory Activities Between KGF-1, KGF-2 and
HFGF
[0222] Human hair follicle cells derived from scalp skin were
treated with KGF-1, KGF-2 and HFGF respectively and after a lapse
of about 48 hours their proliferation rates were measured by
colorimetric MTS assay. Further, human hair follicles, in which
dermal papilla were removed surgically to exclude any effect caused
by endogenous KGF-2, were treated with KGF-1, KGF-2 and HFGF,
respectively.
[0223] As a result, HFGF stimulated significantly human hair
follicle cells derived from alopecia patient's scalp by 135%.+-.7.8
compared to 126%.+-.8.6 for KGF-2 and 112%.+-.6.9 for KGF-1 as
shown in FIG. 7A. The significant stimulatory effect of HFGF was
also shown in human DP-deleted hair follicle cells from an alopecia
patient's scalp as 121%.+-.13.0 (FIG. 7B). As noted in the
foregoing summary, detailed description and examples, the HFGF of
the present invention is a new form of KGF-2, wherein HFGF
comprises an amino acid sequence with a glutamic acid residue at
position 87 and can be isolated from hair follicles of human scalp
skin. The HFGF of the present invention has a characteristic
reduced expression in hair follicles derived from alopecia patients
and has a stimulatory effect on hair follicle cell proliferation.
Therefore, HFGF can be used to prevent or treat alopecia and to
promote or accelerate hair growth and hair follicle repair.
Formulation Example 1
Ointment
[0224] An ointment base was prepared using the following
ingredients and composition (w/w): TABLE-US-00003 Ingredient
Composition White petrolatum 25% Stearyl alcohol 25% Propylene
glycol 12% Sodium lauryl sulfate 1% Methylparaben 0.025%
Propylparaben 0.015% Purified water, q.s. ad 100%
[0225] The stearyl alcohol and white petrolatum were melted in a
steam bath and warmed to about 75.degree. C. The water was heated
to 75.degree. C. and the sodium sulfate, propylene glycol,
methylparaben, and propylparaben were added to the water. The
aqueous phase was added and stirred until congealed to form an
ointment base.
[0226] 100. ml of an ointment base obtained above was mixed with
0.003 g of isolated HFGF polypeptide to afford an ointment, which
is to be applied topically to males with alopecia.
Formulation Example 2
Cream
[0227] A cream base was prepared using the following ingredients
and composition (w/w): TABLE-US-00004 Phase Ingredient Oleagenous
Stearyl alcohol 15% Beeswax 8% Sorbitan monooleate 1.25% Aqueous
Sorbitol solution (70% USP) 7.5% Polysorbate 80 3.75% Methylparaben
0.025% Propylparaben 0.015% Purified water, q.s. ad 100%
[0228] The oil phase and water phase were heated to 70.degree. C.
The oil phase was added slowly to the aqueous phase with stirring
to form a crude emulsion. The resulting emulsion was cooled to
about 55.degree. C. and homogenized. The cooling was continued with
agitation until it congealed.
[0229] 100 ml of a cream base obtained above was mixed with 0.003
ng of isolated HFGF polypeptide to afford an ointment, which is to
be applied topically to males with alopecia.
Formulation Example 3
Gel
[0230] A gel base was prepared using the following ingredients and
composition (w/w): TABLE-US-00005 Ingredient Composition Methocel
90 H.C. 4000 0.8% Carbopol 934 0.24% Propylene glycol 16.7%
Methylparaben 0.015% Sodium hydroxide, q.s. ad pH 7 Purified water,
q.s. ad 100%
[0231] The Methocel was dispersed in 40 ml of hot (85.degree. C.)
water. The resulting dispersion was chilled overnight in a
refrigerator to effect solution. The Carbopol 934 was dispersed in
20 ml of water. The pH of the dispersion was adjusted to 7.0 by
adding sufficient 1% sodium hydroxide solution (about 12 ml was
required per 100 ml) and the volume was brought to 40 ml with
purified water. The methylparaben was dissolved in the propylene
glycol. The Methodcel, Carbopol 934 and propylene glycol fractions
obtained above were mixed carefully to avoid the incorporation of
air.
[0232] 100 ml of a cream base obtained above was mixed with 0.003
ng of isolated HFGF polypeptide to afford an ointment, which is to
be applied topically to males with alopecia.
Formulation Example 4
Paste
[0233] A paste base was prepared using the following ingredients
and composition (w/w): TABLE-US-00006 Ingredient Composition Zinc
oxide 25% Starch 25% Calamine 5% White petrolatum, q.s. ad 100%
[0234] The calamine was titrated with the zinc oxide and starch.
The resulting mixture was incorporated uniformly in the petrolatum
by levigation in a glass slab with a spatula to afford a paste
base.
[0235] 100 ml of a paste base obtained above was mixed with 0.003
ng of isolated HFGF polypeptide to afford an ointment, which is to
be applied topically to males with alopecia.
[0236] All references, patents and patent applications cited herein
are hereby incorporated by reference in their entireties. It must
be noted that as used in this specification and the appended
claims, the singular forms "a", "an" and "the" include plural
referents unless the context clearly dictates otherwise. Thus, for
example, reference to "a method of producing a HFGF protein
recombinantly" includes one or more methods or steps of the type
described herein.
[0237] The present invention is not to be limited in scope by the
specific embodiments described herein. Indeed, various
modifications of the invention in addition to those described will
become apparent to those skilled in the art from the foregoing
description and accompanying figures. Such modifications are
intended to fall within the scope of the appended claims.
Sequence CWU 1
1
10 1 208 PRT Homo sapiens 1 Met Trp Lys Trp Ile Leu Thr His Cys Ala
Ser Ala Phe Pro His Leu 1 5 10 15 Pro Gly Cys Cys Cys Cys Cys Phe
Leu Leu Leu Phe Leu Val Ser Ser 20 25 30 Val Pro Val Thr Cys Gln
Ala Leu Gly Gln Asp Met Val Ser Pro Glu 35 40 45 Ala Thr Asn Ser
Ser Ser Ser Ser Phe Ser Ser Pro Ser Ser Ala Gly 50 55 60 Arg His
Val Arg Ser Tyr Asn His Leu Gln Gly Asp Val Arg Trp Arg 65 70 75 80
Lys Leu Phe Ser Phe Thr Glu Tyr Phe Leu Lys Ile Glu Lys Asn Gly 85
90 95 Lys Val Ser Gly Thr Lys Lys Glu Asn Cys Pro Tyr Ser Ile Leu
Glu 100 105 110 Ile Thr Ser Val Glu Ile Gly Val Val Ala Val Lys Ala
Ile Asn Ser 115 120 125 Asn Tyr Tyr Leu Ala Met Asn Lys Lys Gly Lys
Leu Tyr Gly Ser Lys 130 135 140 Glu Phe Asn Asn Asp Cys Lys Leu Lys
Glu Arg Ile Glu Glu Asn Gly 145 150 155 160 Tyr Asn Thr Tyr Ala Ser
Phe Asn Trp Gln His Asn Gly Arg Gln Met 165 170 175 Tyr Val Ala Leu
Asn Gly Lys Gly Ala Pro Arg Arg Gly Gln Lys Thr 180 185 190 Arg Arg
Lys Asn Thr Ser Ala His Phe Leu Pro Met Val Val His Ser 195 200 205
2 627 DNA Homo sapiens 2 atgtggaaat ggatactgac acattgtgcc
tcagcctttc cccacctgcc cggctgctgc 60 tgctgctgct ttttgttgct
gttcttggtg tcttccgtcc ctgtcacctg ccaagccctt 120 ggtcaggaca
tggtgtcacc agaggccacc aactcttctt cctcctcctt ctcctctcct 180
tccagcgcgg gaaggcatgt gcggagctac aatcaccttc aaggagatgt ccgctggaga
240 aagctattct ctttcaccga gtactttctc aagattgaga agaacgggaa
ggtcagcggg 300 accaagaagg agaactgccc gtacagcatc ctggagataa
catcagtaga aatcggagtt 360 gttgccgtca aagccattaa cagcaactat
tacttagcca tgaacaagaa ggggaaactc 420 tatggctcaa aagaatttaa
caatgactgt aagctgaagg agaggataga ggaaaatgga 480 tacaatacct
atgcatcatt taactggcag cataatggga ggcaaatgta tgtggcattg 540
aatggaaaag gagctccaag gagaggacag aaaacacgaa ggaaaaacac ctctgctcac
600 tttcttccaa tggtggtaca ctcatag 627 3 21 DNA Artificial Sequence
Primer 3 atgtggaaat ggatactgac a 21 4 21 DNA Artificial Sequence
Primer 4 ctatgagtgt accaccattg g 21 5 17 DNA Artificial Sequence
Primer 5 ttggtcagga catggtg 17 6 21 DNA Artificial Sequence Primer
6 ctatgagtgt accaccattg g 21 7 19 DNA Artificial Sequence Primer 7
ggagaatgaa tacgggtcc 19 8 21 DNA Artificial Sequence Primer 8
ggttggcctg ccctatatat a 21 9 23 DNA Artificial Sequence Primer 9
ggatccttgg tcaggacatg gtg 23 10 27 DNA Artificial Sequence Primer
10 gaattcctat gagtgtacca ccattgg 27
* * * * *