U.S. patent application number 11/477988 was filed with the patent office on 2006-11-02 for polynucleotide detection method employing self-reporting dual inversion probes.
This patent application is currently assigned to Gen-Probe Incorporated. Invention is credited to Kenneth A. Browne.
Application Number | 20060246500 11/477988 |
Document ID | / |
Family ID | 30002762 |
Filed Date | 2006-11-02 |
United States Patent
Application |
20060246500 |
Kind Code |
A1 |
Browne; Kenneth A. |
November 2, 2006 |
Polynucleotide detection method employing self-reporting dual
inversion probes
Abstract
Method of detecting a target polynucleotide based on the use of
dual inversion hybridization probes having stem-and-loop
structures, wherein the stem portion of the structure comprises a
pair of interactive arms that are substantially prevented from
interacting with target polynucleotides. The arms of the dual
inversion hybridization probes interact in a conventional
antiparallel fashion, but have backbone polarities opposite that of
the target-complementary loop portion of the probe. Arm portions of
the dual inversion probes do not substantially contribute to
sequence-dependent stabilization of probe:target hybrids.
Incorporating inversion linkages into the structures of these
probes dramatically simplifies the process of designing
stem-and-loop hybridization probes.
Inventors: |
Browne; Kenneth A.; (Poway,
CA) |
Correspondence
Address: |
GEN PROBE INCORPORATED
10210 GENETIC CENTER DRIVE
SAN DIEGO
CA
92121
US
|
Assignee: |
Gen-Probe Incorporated
|
Family ID: |
30002762 |
Appl. No.: |
11/477988 |
Filed: |
June 29, 2006 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10388918 |
Mar 14, 2003 |
7070933 |
|
|
11477988 |
Jun 29, 2006 |
|
|
|
10259272 |
Sep 27, 2002 |
|
|
|
10388918 |
Mar 14, 2003 |
|
|
|
60325600 |
Sep 28, 2001 |
|
|
|
Current U.S.
Class: |
435/6.11 |
Current CPC
Class: |
C12Q 1/6837 20130101;
C12Q 1/6837 20130101; C12Q 1/6816 20130101; C12Q 1/6876 20130101;
C07H 21/04 20130101; C12Q 2565/518 20130101; C12Q 1/6816 20130101;
C12Q 2525/301 20130101 |
Class at
Publication: |
435/006 |
International
Class: |
C12Q 1/68 20060101
C12Q001/68 |
Claims
1. A method of detecting a target polynucleotide in a test sample,
comprising the steps of: providing a dual inversion hybridization
probe; contacting said dual inversion hybridization probe with any
of said target polynucleotide that may be present in the test
sample under hybridization-promoting conditions; and detecting the
formation of hybrid duplexes comprising said dual inversion
hybridization probe and said target polynucleotide as an indication
of the presence of said target polynucleotide sequence in said test
sample, wherein said dual inversion hybridization probe comprises
(a) a loop comprising a target-complementary sequence of bases
joined to a loop backbone, said target-complementary sequence of
bases extending from a first boundary thereof to a second boundary
thereof, (b) a first arm joined to said target-complementary
sequence of bases at said first boundary thereof through a first
arm linkage, said first arm comprising a first arm sequence of
bases joined to a first arm backbone, (c) a second arm joined to
said target-complementary sequence of bases at said second boundary
thereof through a second arm linkage, said second arm comprising a
second arm sequence of bases joined to a second arm backbone,
wherein both said first arm linkage and said second arm linkage are
inversion linkages different from each other, said inversion
linkages optionally including a non-nucleotide linker, and (d) at
least one detectable label joined to any of said loop, said first
arm, said second arm or, if present, said non-nucleotide linker,
wherein said first arm and said second arm interact with each other
in the absence of said target polynucleotide to form a stem
duplex.
2. The method of claim 1, wherein said at least one detectable
label of said dual inversion hybridization probe comprises a pair
of interactive labels comprising a first label and a second label,
said first label being joined to said first arm and said second
label being joined to said second arm.
3. The method of claim 1, wherein said first arm linkage of said
dual inversion hybridization probe is a 3'-3' inversion linkage,
and wherein said second arm linkage of said dual inversion
hybridization probe is a 5'-5' inversion linkage.
4. The method of claim 1, wherein said first arm linkage of said
dual inversion hybridization probe is a 5'-5' inversion linkage,
and wherein said second arm linkage of said dual inversion
hybridization probe is a 3'-3' inversion linkage.
5. The method of claim 2, wherein at least one of said loop, said
first arm or said second arm of said dual inversion hybridization
probe comprises at least one nucleotide analog.
6. The method of claim 5, wherein said loop of said dual inversion
hybridization probe comprises 2'-methoxy nucleotide analogs.
7. The method of claim 2, wherein the target-complementary sequence
of bases of said loop of said dual inversion hybridization probe
has a length in the range of from 10-25 bases.
8. The method of claim 7, wherein the target-complementary sequence
of bases of said loop of said dual inversion hybridization probe
has a length in the range of from 16-22 bases.
9. The method of claim 7, wherein the first arm of said dual
inversion hybridization probe has a length of from 5-12 bases.
10. The method of claim 9, wherein the second arm of said dual
inversion hybridization probe has a length of from 5-12 bases.
11. The method of claim 7, wherein both the first arm and the
second arm of said dual inversion hybridization probe have lengths
in the range of from 6-8 bases.
12. The method of claim 2, wherein said pair of interactive labels
of said dual inversion hybridization probe is a pair of FRET
interactive labels.
13. The method of claim 2, wherein said pair of interactive labels
of said dual inversion hybridization probe is a pair of non-FRET
interactive labels.
14. The method of claim 13, wherein one member of said pair of
non-FRET interactive labels of said dual inversion hybridization
probe comprises fluorescein.
15. The method of claim 10, wherein said pair of interactive labels
of said dual inversion hybridization probe is a pair of FRET
interactive labels.
16. The method of claim 10, wherein said pair of interactive labels
of said dual inversion hybridization probe is a pair of non-FRET
interactive labels.
17. The method of claim 1, wherein the detecting step comprises
detecting by fluorometry.
Description
RELATED APPLICATIONS
[0001] This is a continuation of allowed U.S. patent application
Ser. No. 10/388,918, filed Mar. 14, 2003, issued as U.S. Pat. No.
7,070,933, which is a continuation-in-part of U.S. patent
application Ser. No. 10/259,272, filed Sep. 27, 2002, which claims
the benefit of U.S. Provisional Application No. 60/325,600, filed
Sep. 28, 2001. The entire disclosures of these related applications
are hereby incorporated by reference.
FIELD OF THE INVENTION
[0002] The present invention relates to the field of nucleic acid
detection. More specifically, the invention relates to labeled,
unitary hybridization probes having stem-and-loop structures,
wherein the stem comprises arm structures that cannot substantially
interact with target sequences.
BACKGROUND OF THE INVENTION
[0003] Hybridization probes used for nucleic acid detection
generally are single-stranded molecules complementary to a nucleic
acid sequence sought to be detected ("target sequence"). Background
descriptions of the use of nucleic acid hybridization as a
procedure for the detection of particular nucleic acid sequences
are given by Kohne in U.S. Pat. No. 4,851,330, and by Hogan et al.,
in U.S. Pat. No. 5,840,488. Hybridization probes may be labeled
with detectable moieties such as radioisotopes, antigens or
chemiluminescent moieties. When a first single strand of nucleic
acid contains sufficient contiguous complementary bases to a
second, and the two strands are brought together under conditions
which promote hybridization, double stranded nucleic acid will
result. Under appropriate conditions, DNA/DNA, RNA/DNA, or RNA/RNA
hybrids may be formed.
[0004] Molecular beacons are examples of hybridization probes that
have limited regions of self-complementarity. These probes, which
are particularly useful for conducting homogeneous detection
assays, comprise a target-complementary "loop" portion, a "stem"
portion formed by the annealing of two complementary "arms" that
extend from the loop, a fluorophore group and a quencher group. The
fluorophore is typically linked to the end of one arm while the
quencher is typically linked to the end of the other arm. The stem
portion maintains the probe in a closed conformation in the absence
of a target nucleic acid sequence, so that energy received by the
fluorophore is transferred to the quencher, rather than being
emitted. Upon hybridizing a target polynucleotide, the
complementary arm sequences of the molecular beacon become
separated, thereby shifting the probe to an open conformation. This
shift is detectable as a flourescent signal resulting from the
reduced energy transfer between the fluorophore and the quencher
(see Tyagi et al., Nature Biotechnology 14:303 (1996); Fang et al.,
Analytical Chemistry, Dec. 1, 2000 issue:747A). Molecular beacons
are fully described in U.S. Pat. Nos. 5,925,517 and 6,150,097, the
disclosures of which are hereby incorporated by reference.
[0005] Molecular beacons are not limited to having conventional
nucleic acid constituents. In addition to standard nucleotides,
peptide nucleic acids (PNAs) have also been used for preparing
molecular beacons (see published International Patent Application
No. PCT/US98/22785). Regardless of whether conventional nucleotides
or PNA analogs were used to prepare these probes, stem regions
uniformly were complementary as the result of antiparallel pairing
of nucleobases disposed on sugar-phosphate or glycyl peptide
backbones.
[0006] Molecular beacon probe design is naturally rendered somewhat
more complicated than the process of designing linear probes due to
the added presence of the stem structure. Since the stem portions
of previously described molecular beacons comprised base moieties
that conceivably could interact through complementary pairing with
bases present in the target polynucleotide that is to be detected,
those interactions must be considered during the design of every
molecular beacon. Thus, the process of designing a molecular beacon
requires selection of a target-complementary sequence for the loop
portion of the probe, as well as consideration of the effect that
the base sequence of the stem portion will have on interaction with
the target polynucleotide that is to be detected.
[0007] Previous attempts to simplify the process of designing
molecular beacons have focused on the use of a "universal stem"
structure. For example, in U.S. Pat. No. 6,103,476, Tyagi et al.,
described stems consisting of arm regions that comprised nucleobase
sequences orientated by standard antiparallel complementarity, with
one of the arms being linked to a fluorophore and the other arm
being linked to a quencher moiety. In these constructs it remained
possible for nucleobases of the universal stem to influence
hybridization between the target polynucleotide and the molecular
beacon probe, for example by influencing the Tm of the probe:target
complex. Notably, this same feature would also characterize
universal stems comprised of PNAs because the nucleobases of the
denatured stem could still interact with the target sequence.
[0008] The present invention provides a new class of hybridization
probes wherein opportunities for complementary interactions between
nucleobases of a target polynucleotide and nucleobases of the stem
region of a molecular beacon are substantially eliminated.
Additionally, these new probes have been shown to have unique
properties that distinguish them from previously known
hybridization probes.
SUMMARY OF THE INVENTION
[0009] A first aspect of the invention regards a hybridization
probe that can be used for detecting a target polynucleotide. The
invented probe includes a loop region, a first arm, a second arm,
and at least one detectable label. The loop region includes a
target-complementary sequence of bases joined to a loop backbone,
with the target-complementary sequence of bases extending from a
first boundary to a second boundary. The first arm, which includes
a first arm sequence of bases joined to a first arm backbone, is
joined to the target-complementary sequence of bases at its first
boundary through a first arm linkage. The second arm, which
includes a second arm sequence of bases joined to a second arm
backbone, is joined to the target-complementary sequence of bases
at its second boundary through a second arm linkage. Finally, there
is at least one detectable label joined to the hybridization probe
by any of the loop region, the first arm or the second arm.
Significantly, at least one of the first and second arm linkages is
an inversion linkage. Also significant, the first arm and the
second arm interact with each other in the absence of the target
polynucleotide to form a stem duplex.
[0010] If only one of the first and second arm linkages is an
inversion linkage, then the hybridization probe is a parallel-stem
hybridization probe. For example, if the first arm linkage of a
parallel-stem hybridization probe is an inversion linkage, then the
first arm is an "inversion arm" and the second arm is an "extension
arm." In accordance with certain embodiments of the invention, the
detectable label of the parallel-stem hybridization probe includes
a pair of interactive labels, with the first label being joined to
the first arm and the second label being joined to the second arm.
In accordance with one embodiment of the parallel-stem
hybridization probe, at least one of the loop, the inversion arm or
the extension arm includes at least one nucleotide analog. For
example, the nucleotide analog may particularly be any of a
2'-methoxy nucleotide analog, an isocytosine nucleotide analog and
an isoguanine nucleotide analog. In accordance with another
embodiment, the first arm of the parallel-stem hybridization probe
is an inversion arm, the second arm is an extension arm, and the
inversion arm and the extension arm both include
deoxyribonucleotides. In a highly preferred embodiment, the loop
includes 2'-methoxy nucleotide analogs. When the first arm linkage
of a parallel-stem hybridization probe is an inversion linkage, the
inversion linkage can be either a 5'-5' inversion linkage or a
3'-3' inversion linkage. If the inversion linkage of the
parallel-stem hybridization probe is a 5'-5' inversion linkage,
then the inversion arm and the extension arm both have 3' termini.
Alternatively, if the inversion linkage of the parallel-stem
hybridization probe is a 3'-3' inversion linkage, then the
inversion arm and the extension arm both have 5' termini. In a
preferred embodiment, when the hybridization probe is a
parallel-stem hybridization probe, the extension arm has a length
of from 5-12 bases. Still more preferably, when the hybridization
probe is a parallel-stem hybridization probe the extension arm has
a length of from 5-12 bases, the inversion arm also has a length of
from 5-12 bases. In another preferred embodiment, when the
hybridization probe is a parallel-stem hybridization probe, both
the extension arm and the inversion arm have lengths in the range
of from 6-8 bases. In other embodiments of the invented
hybridization probe, when the detectable label includes a pair of
interactive labels, with the first label being joined to the first
arm and the second label being joined to the second arm, the pair
of interactive labels is a pair of FRET interactive labels. In
still other embodiments of the invented hybridization probe, when
the detectable label includes a pair of interactive labels, with
the first label being joined to the first arm and the second label
being joined to the second arm, the pair of interactive labels is a
pair of non-FRET interactive labels. In a particular instance,
fluorescein is one member of the pair of non-FRET interactive
labels. In accordance with certain embodiments of the invented
parallel-stem hybridization probe, when at least one of the loop,
the inversion arm or the extension arm includes at least one
nucleotide analog, it is the extension arm that includes at least
one nucleotide analog. For example, this nucleotide analog can be
any of isocytosine and isoguanine. In accordance with certain other
embodiments of the invented parallel-stem hybridization probe, when
at least one of the loop, the inversion arm or the extension arm
includes at least one nucleotide analog, it is the inversion arm
that includes at least one nucleotide analog.
[0011] If both the first arm linkage and the second arm linkage of
the invented hybridization probe are inversion linkages which are
different from each other, then the hybridization probe is a dual
inversion probe. In separate versions of the invented dual
inversion probe, either the first arm linkage is a 3'-3' inversion
linkage and the second arm linkage is a 5'-5' inversion linkage, or
the first arm linkage is a 5'-5' inversion linkage and the second
arm linkage is a 3'-3' inversion linkage. In accordance with
certain embodiments of the invention, the detectable label of the
dual inversion probe includes a pair of interactive labels, with
the first label being joined to the first arm and the second label
being joined to the second arm of the probe. In certain preferred
embodiments of the invention, at least one of the loop, the first
arm or the second arm of the dual inversion probe include at least
one nucleotide analog. For example, the loop may include 2'-methoxy
nucleotide analogs. In accordance with other embodiments of the
invented dual inversion probe, the target-complementary sequence of
bases has a length in the range of from 10-25 bases, or more
preferably 16-22 bases. When the target-complementary sequence of
bases contained within a dual inversion probe has a length in the
range of from 16-22 bases, the first arm can have a length of from
5-12 bases. More preferably, when the target-complementary sequence
of bases contained within a dual inversion probe has a length in
the range of from 16-22 bases, and when the first arm has a length
of from 5-12 bases, the second arm has a length of from 5-12 bases.
In accordance with another preferred embodiment, when the
target-complementary sequence of bases contained within a dual
inversion probe has a length in the range of from 10-25 bases, both
the first arm and the second arm have lengths in the range of from
6-8 bases. In accordance with still another embodiment of the
invented dual inversion probe, there is included a pair of
interactive labels, more particularly a pair of FRET interactive
labels. Alternatively, the dual inversion probe can include a pair
of interactive labels, more particularly a pair of non-FRET
interactive labels. In a highly preferred embodiment, one member of
the pair of non-FRET interactive labels is fluorescein. In
accordance with yet another highly preferred embodiment of the
invented dual inversion probe, when the target-complementary
sequence of bases has a length in the range of from 16-22 bases,
when the first arm has a length of from 5-12 bases, and when the
second arm has a length of from 5-12 bases, the pair of interactive
labels is a pair of FRET interactive labels. In accordance with
still yet another highly preferred embodiment of the invented dual
inversion probe, when the target-complementary sequence of bases
has a length in the range of from 16-22 bases, when the first arm
has a length of from 5-12 bases, and when the second arm has a
length of from 5-12 bases, the pair of interactive labels is a pair
of non-FRET interactive labels.
[0012] In accordance with certain general embodiments of the
invented hybridization probe, including parallel-stem hybridization
probes and dual inversion probes, the target-complementary sequence
of bases has a length in the range of from 10-25 bases, or more
preferably a length in the range of from 16-22 bases.
[0013] A second aspect of the invention regards a method of
determining whether a test sample contains a target polynucleotide.
This method involves first providing a hybridization probe, as
described above. Next, there is a step for contacting the
hybridization probe with any of the target polynucleotide that may
be present in the test sample under hybridization-promoting
conditions. Finally, there is a step for detecting the formation of
hybrid duplexes which include the hybridization probe and the
target polynucleotide as an indication of the presence of the
target polynucleotide sequence in the test sample.
[0014] A third aspect of the invention regards a kit for detecting
a target polynucleotide sequence using a hybridization assay. The
kit typically includes a hybridization probe, as described above;
and a positive-control target polynucleotide having a sequence
complementary to the target-complementary sequence of bases of the
loop portion of the hybridization probe. In a preferred embodiment,
the kit further includes a hybridization solution.
[0015] As used herein, the following terms have the following
meanings unless expressly stated to the contrary.
[0016] As used herein, a "molecular beacon" or "molecular beacon
probe" is a nucleobase probe, having a stem-and-loop structure,
that hybridizes specifically to a target polynucleotide under
conditions that promote hybridization to form a detectable hybrid.
Molecular beacons have been described in U.S. Pat. Nos. 5,925,517
and 6,150,097, the disclosures of these references having been
incorporated by reference herein above.
[0017] As used herein, an "inversion linkage" refers to the
chemical linkage which joins the backbone of one portion of a
polynucleotide to the backbone of an adjacent position of the same
polynucleotide having an opposite orientation. The term
particularly embraces 5'-5' and 3'-3' linkages in conventional
nucleic acids. Also falling within the scope of the term are
linkages that may be found in nucleic acid analogs, such as
amino-amino and carboxy-carboxy linkages that may be found in
peptide nucleic acids or other peptide bond-linked nucleic acid
analogs. Notably, an inversion linkage may include a
"non-nucleotide linker" which may be detectably labeled, or joined
to a detectable label. Exemplary non-nucleotide linkers are
described in the working Examples, and in U.S. Pat. No. 6,031,091,
entitled "Non-Nucleotide Linking Reagents for Nucleotide Probes."
Inversion linkages are present in both parallel-stem hybridization
probes and dual inversion probes.
[0018] As used herein, an "inversion arm" of a parallel-stem
hybridization probe is a single strand of polynucleotide that
extends from one boundary of the target-complementary loop of the
probe, and that is able to form a stem duplex upon hybridization
with the extension arm of the parallel-stem hybridization probe.
The inversion arm corresponds to the segment of the probe that is
positioned between the inversion linkage and the nearest probe
terminus, and may include nucleobase analogs.
[0019] As used herein, an "extension arm" of a parallel-stem
hybridization probe is a single strand of polynucleotide that
extends from the boundary of the target-complementary loop of the
probe opposite the inversion arm, and that is able to form a stem
duplex upon hybridization with the inversion arm of the
parallel-stem hybridization probe. Preferably, the extension arm
contains nucleobases or nucleobase analogs that preferentially form
base pairs with a parallel orientation.
[0020] As used herein, a "detectable label" is a chemical species
that can be detected or can lead to a detectable response.
Detectable labels in accordance with the invention can be linked to
probes either directly or indirectly. With particular reference to
the use of detectable labels that are members of an interactive
label pair, it is highly preferred for one member of the label pair
to be a fluorophore, and for the other member of the label pair to
be a quencher. Examples of fluorophores and quenchers are given at
column 5 in U.S. Pat. No. 6,037,130.
[0021] As used herein, an "oligonucleotide" or "oligomer" is a
polymeric chain of at least two, generally between about five and
about 100, chemical subunits, each subunit comprising a nucleobase
moiety, and a linking moiety that joins the subunits in a linear
spacial configuration. In DNA and RNA the linking moiety will
include a sugar moiety. Common "base" or nucleobase moieties are
guanine (G), adenine (A), cytosine (C), thymine (T) and uracil (U),
although other rare or modified nucleotide bases able to base pair
are well known to those skilled in the art. Oligonucleotides may be
purified from naturally occurring sources, but preferably are
synthesized using any of a variety of well known enzymatic or
chemical methods.
[0022] As used herein, "polynucleotide" means either RNA or DNA,
along with any synthetic nucleotide analogs or other molecules that
may be present in the sequence and that do not prevent
hybridization of the polynucleotide with a second molecule having a
substantially complementary sequence. The term includes polymers
containing analogs of naturally occurring nucleotides and
particularly includes analogs having a methoxy group (OMe) at the
2' position of the ribose.
[0023] An "analyte polynucleotide" is a target polynucleotide that
is to be detected, quantified or replicated by a nucleic acid
amplification process.
[0024] By "target" or "target polynucleotide" is meant a specific
deoxyribonucleotide or ribonucleotide molecule containing a target
nucleobase sequence which may be hybridized by a probe or
amplification primer. Exemplary targets include viral
polynucleotides, bacterial polynucleotides (such as rRNA), and
eukaryotic mRNA. In the context of nucleic acid amplification
reactions, a target polynucleotide includes a target sequence to be
replicated, which may be either single-stranded or double-stranded,
and which may include sequences in addition to the target
sequence.
[0025] As used herein, "amplification" or "nucleic acid
amplification" or "polynucleotide amplification" refers to an in
vitro procedure for obtaining multiple copies of a target nucleic
acid sequence, its complement or fragments thereof.
[0026] An "amplicon" is a polynucleotide product generated in an
amplification reaction.
[0027] An "analyte amplicon" is a polynucleotide product of an
amplification reaction wherein an analyte polynucleotide served as
the template for synthesis of polynucleotide copies or
amplification products.
[0028] "Homogeneous" assay formats employing hybridization probes
do not require removal of unhybridized probe to determine
accurately the extent of specific probe binding.
[0029] By "consisting essentially of" is meant that additional
component(s), composition(s) or method step(s) that do not
materially change the basic and novel characteristics of the
present invention may be included in the compositions or kits or
methods of the present invention. Such characteristics include the
ability to selectively detect and quantify analyte polynucleotides
in biological samples such as whole blood, plasma or urine. Any
component(s), composition(s), or method step(s) that have a
material effect on the basic and novel characteristics of the
present invention would fall outside of this term.
BRIEF DESCRIPTION OF THE DRAWINGS
[0030] FIG. 1 is a schematic illustration showing the general
structure of a parallel-stem hybridization probe.
[0031] FIG. 2 is a schematic illustration showing two embodiments
of the parallel-stem hybridization probe. The structure shown on
the left is a parallel-stem hybridization probe that incorporates a
5'-5' inversion linkage. The structure shown on the right is a
parallel-stem hybridization probe that incorporates a 3'-3'
inversion linkage.
[0032] FIG. 3 is a schematic illustration showing the folded
structures of three probes in the absence of a complementary target
polynucleotide. Label moieties are omitted from the illustration.
The 1093 probe is a conventional molecular beacon. The 1034 probe
incorporates an inversion linkage but cannot form a stem duplex.
The 1094 probe is a parallel-stem hybridization probe.
[0033] FIGS. 4A-4C schematically illustrate the predicted
hybridization results for three probes with each of two different
target polynucleotides, and present corresponding sequence
alignments. The diagrams in FIG. 4A show predicted results for
hybridization of the 1093 molecular beacon with the 1059 and 1061
targets. The diagrams in FIG. 4B show predicted results for
hybridization of the 1034 probe with the 1059 and 1061 targets. The
diagrams in FIG. 4C show predicted results for hybridization of the
1094 parallel-stem hybridization probe with the 1059 and 1061
targets. Nucleotide sequences for the probes and target
polynucleotides are shown below each of the schematic diagrams.
Vertical lines in the alignments indicate complementary nucleobase
interactions. The schematic diagrams of the 1034 and 1094 probes
include the 5'-5' inversion linkage. Sequences of the 1059 and 1061
targets are presented in the 3' to 5' orientation to show
complementarity with the probe sequences. Label moieties are
omitted from the illustration.
[0034] FIGS. 5A-5C are line graphs showing signals generated by
self-reporting probes in the presence of increasing concentrations
of target polynucleotide. FIG. 5A shows results for the 1093
molecular beacon and the 1059 target (.circle-solid.) or the 1061
target (.box-solid.). FIG. 5B shows results for the 1094
parallel-stem hybridization probe and the 1059 target
(.largecircle.) or the 1061 target (.quadrature.). FIG. 5C shows
signal-to-noise ratios calculated for the 1059:1093
(.circle-solid.) and 1059:1094 (.largecircle.) data points in FIGS.
5A and 5B plotted against increasing amounts of target
polynucleotide.
[0035] FIGS. 6A-6F are line graphs showing either fluorescence
hybridization signal values or signal-to-noise ratios (S/N) plotted
against increasing concentrations of the 1059 target
polynucleotide. FIG. 6A represents fluorescence signal results
obtained using the 1093 probe at concentrations of 0.3 .mu.M
(.tangle-solidup.), 0.25 .mu.M (.diamond.), 0.2 .mu.M
(.box-solid.), 0.15 .mu.M (.gradient.), and 0.1 .mu.M
(.circle-solid.). FIG. 6B represents S/N results calculated from
the information presented in FIG. 6A. FIG. 6C represents the
fluorescence signal results obtained using the 1094 probe at
concentrations of 0.2 .mu.M (.box-solid.), 0.15 .mu.M (.gradient.),
0.1 .mu.M (.circle-solid.), and 0.05 .mu.M (.quadrature.). FIG. 6D
represents S/N results calculated from the information presented in
FIG. 6C. FIG. 6E represents the fluorescence signal results
obtained using combinations of the 1093 and 1094 probes at
different concentrations. These combinations included 1093/1094 at
0.3 .mu.M/0 .mu.M (.tangle-solidup.); 1093/1094 at 0.25 .mu.M/0.05
.mu.M (.diamond.); 1093/1094 at 0.2 .mu.M/0.1 .mu.M (.box-solid.);
1093/1094 at 0.15 .mu.M/0.15 .mu.M (.gradient.); and 1093/1094 at
0.1 .mu.M/0.2 .mu.M (.circle-solid.). FIG. 6F represents S/N
results calculated from the information presented in FIG. 6E. The
symbols shown in FIGS. 6B, 6D and 6F correspond to the symbols
shown in FIGS. 6A, 6C and 6E, respectively.
[0036] FIG. 7 is a nucleotide sequence alignment showing the 1261
molecular beacon and the 1262 parallel-stem hybridization probe
hybridized with a target polynucleotide. Vertical lines in the
alignments indicate complementary nucleobase interactions. The
sequence of the 1269 target is presented in the 3' to 5'
orientation to show complementarity with the probe sequences. Label
moieties are omitted from the illustration.
[0037] FIG. 8 is a line graph showing fluorescence signals
generated by the 1261 molecular beacon and the 1262 parallel-stem
hybridization probe in the presence of increasing amounts of target
polynucleotide. The curves represent results for the 1262
parallel-stem hybridization probe and the 1269 target
(.largecircle.), and for the 1261 molecular beacon and the 1269
target (.circle-solid.).
[0038] FIGS. 9A-9B schematically illustrate structural differences
between parallel-stem hybridization probes and dual inversion
probes. FIG. 9A shows a line diagram representing the structure of
an example parallel-stem hybridization probe. FIG. 9B shows a line
diagram representing the structure of an example dual inversion
probe. The locations of 3'-3' and 5'-5' inversion linkages are
indicated in the diagrams. Arrows indicate orientation of the
backbones in the 5' to 3' direction, and highlight the relationship
between the orientations of the arm structures and
target-complementary sequences in the different probe species.
Detectable labels are omitted from the diagrams.
[0039] FIG. 10 is a schematic illustration showing the general
structure of a dual inversion probe.
[0040] FIGS. 11A-11D are line graphs showing background-subtracted
S/N ratios as a function of target concentration for molecular
beacons (.circle-solid.) and corresponding dual inversion probes
(). FIGS. 11A-11D show results for pan-bacterial, pan-fungal,
Enterobacteriaceae and Gram positive probes, respectively.
[0041] FIG. 12 is a line graph showing the background-subtracted
fluorescent signal values as a function of target concentration for
pan-fungal molecular beacons and dual inversion probes interacting
with two different targets. The graph shows results for the 1531
molecular beacon interacting with the 1307 (.circle-solid.) and
1533 (.largecircle.) targets, and for the 1532 dual inversion probe
interacting with the 1307 (.box-solid.) and 1533 (.quadrature.)
targets.
[0042] FIG. 13 is a line graph showing corrected signal-to-noise
ratios (S/N) plotted against increasing concentrations of target
polynucleotide for various probes. The 1501 (.gradient.) probe was
a conventional molecular beacon. The 1502 (.circle-solid.) probe
was a dual inversion probe. The 1503 (.largecircle.), 1504
(.box-solid.), 1505 (.quadrature.), 1506 (.tangle-solidup.), 1507
(.DELTA.), and 1508 () probes were all dual inversion probes having
at least one inversion linkage that included a chemical linker.
DETAILED DESCRIPTION OF THE INVENTION
[0043] The present invention embraces hybridization probes having
stem-loop structures, wherein the loop portions of the probes can
interact with a complementary target, but wherein the individual
arm components of the stems are rendered unable to interact with
the target. This was accomplished by including in the structure of
the probe at least one inversion linkage. Reflecting this feature,
probes of the invention are referred to collectively as "inversion
probes." Probes that include one inversion linkage are particularly
referred to as "parallel-stem hybridization probes." Probes that
include two inversion linkages are particularly referred to as
"dual inversion probes."
[0044] The different types of inversion probe species, meaning
parallel-stem hybridization probes and dual inversion probes, share
structural and functional features in common with each other.
Structurally, both inversion probe species have stem-and-loop
configurations where the polarity of the backbone of at least one
arm that participates in stem formation is opposite the polarity of
the target-complementary sequence of bases which comprise the loop
portions of the probes. Parallel-stem hybridization probes have one
arm with a polarity opposite the polarity of the
target-complementary sequence of bases (illustrated in FIG. 9A).
Both of the arms of a dual inversion probe have the same polarity
in the primary structure of the molecule, and that polarity is
opposite the polarity of the target-complementary sequence of bases
(illustrated in FIG. 9B). Functionally, each of the two inversion
probe species possesses at least one arm that can participate in
stem formation but cannot interact with the target that hybridizes
to the target-complementary sequence of bases contained within the
probe. This is because at least one of the arms of the different
probe species has a polarity that is the same as the target that is
hybridized by the loop structure of the probe, and because
parallel-stranded structures do not substantially form between the
arm sequences and target polynucleotides in the absence of base
analogs, or tracts of poly-A and tracts of poly-T, that promote
parallel-stranded duplex formation.
[0045] As detailed herein, the inversion arm of a parallel-stem
hybridization probe is prevented from interacting with target
sequences because the polarities of the arms and the target are the
same when the probe and the target are hybridized to each other.
The extension arm of the parallel-stem hybridization probe can
similarly be prevented from interacting with the target by
including therein a sequence of base analogs that promote
parallel-strand duplex formation while inhibiting
antiparallel-strand duplex formation. Since both arms of the dual
inversion probe have polarities that are the same as the target
when the probe and target are hybridized to each other, neither arm
is able to hybridize target sequences.
[0046] Dual inversion probes contain inversion linkages at the
junction between the first arm and the first boundary of the
target-complementary loop, and at the junction between the second
arm and the second boundary of the target-complementary loop. This
arrangement means that the backbones of the two arms have the same
polarities along the length of the primary structure of the probe,
and that this polarity is opposite the polarity of the backbone of
the target-complementary loop. Thus, in the closed state the two
arms of the dual inversion probe are base-paired in an antiparallel
configuration. When a dual inversion probe hybridizes to its
complementary target, the arms are prevented from interacting with
the target because the backbones of the target and the two arms
have a parallel relationship to each other.
[0047] Inversion probes in accordance with the invention generally
include a loop region corresponding to a target-complementary
sequence of bases joined to a backbone. This loop is bounded on one
end by a first arm which includes a first arm sequence of bases
joined to a backbone, and which is joined to the
target-complementary sequence of bases through a first arm linkage.
The loop is bounded on its second end by a second arm which
includes a second arm sequence of bases joined to a backbone, and
which is joined to the target-complementary sequence of bases
through a second arm linkage. Optionally included is a pair of
interactive labels. In a preferred embodiment, a first label is
joined to the first arm and a second label is joined to the second
arm. In the absence of a target polynucleotide complementary to the
loop portion of the probe, the two arms of the probe interact with
each other to form a stem duplex. If only one of the two specified
linkages joining the arms to the loop region of the inversion probe
is an inversion linkage, then the probe is a "parallel-stem
hybridization probe." Alternatively, if both of the specified
linkages joining the arms to the loop region of the inversion probe
are inversion linkages, then the probe is a "dual inversion
probe."
[0048] Rather than interacting in an antiparallel fashion, arms of
the parallel-stem hybridization probe interact in a parallel
fashion. As a consequence of this structural arrangement,
interactions between at least one arm of the stem (referred to
herein as the "inversion arm") and the polynucleotide target that
is to be detected are substantially prevented. When nucleobase
analogs that preferentially form base pairs in a parallel
orientation are included in the other arm of the probe (referred to
herein as the "extension arm"), then neither of the arms of the
probe can substantially interact with target polynucleotide
sequences. In the absence of interactions between the
polynucleotide target and arms of the unitary probe, the arm
portions of the invented probes advantageously behave uniformly in
all probe:target interactions. More particularly, the arm portions
of a parallel-stem hybridization probe cannot interact with target
sequences, and so do not substantially contribute to
sequence-dependent stabilization of the probe:target hybrid.
[0049] Dual inversion probes necessarily will include two different
inversion linkage types, and will have stem structures formed as a
result of antiparallel base pairing. For example, a dual inversion
probe may include 5'-5' and 3'-3' inversion linkages, or
amino-amino ("N-N") and carboxy-carboxy ("C-C") inversion linkages.
The linear structure of a resulting probe molecule would have one
5' and one 3' terminus, or one amino and one carboxy terminus.
Thus, the backbones of the arm portions of the probe molecule would
share the same polarity, with respect to the primary structure of
the molecule, but would differ from the polarity of the backbone of
the loop portion of the probe.
General Features of Parallel-Stem Hybridization Probes
[0050] Parallel-stem probes of the present invention share certain
features in common with the unitary hybridization probes described
by Tyagi et al., in U.S. Pat. Nos. 5,925,517 and 6,150,097, the
disclosures of these U.S. patents having been incorporated by
reference herein above.
[0051] Like the unitary probes described by Tyagi et al. (now
commonly referred to as "molecular beacons"), the parallel-stem
probes disclosed herein include a loop region comprising a
target-complementary nucleobase sequence and a pair of "arms"
flanking the target-complementary sequence. In certain preferred
embodiments there is also included a paired set of interactive
labels. Under assay conditions in the absence of target, arms of
the parallel-stem probe interact to form a "parallel-stem duplex."
Hybridization of a parallel-stem probe to a target polynucleotide
effects a conformational change that results in loss of the stem
duplex structure. In certain preferred embodiments this
conformational change is detected as a change in the properties of
at least one member of a pair of interactive labels.
[0052] As stated above, the arms of a parallel-stem probe are
configured to have a parallel relationship. As a consequence,
interactions between at least one of the arms of the probe and the
nucleic acid target advantageously are substantially precluded when
the probe is hybridized to the target. In highly preferred
embodiments of the invention, interactions between both of the arms
of the parallel-stem probe and the nucleic acid target are
substantially precluded.
[0053] Target-complementary nucleobase sequences of parallel-stem
probes typically are disposed on a chemical "backbone" or scaffold,
and will be substantially single-stranded to facilitate efficient
interaction with the target. Regardless of whether the
target-complementary nucleobase sequence is disposed on a
phosphodiester backbone (as found in RNA and DNA), or a backbone
characteristic of peptide nucleic acids or "PNAs" (such as
described in U.S. Pat. No. 5,539,082, the disclosure of which is
hereby incorporated by reference), or other compatible backbones,
including 2'-OMe, phosphorothioate and phosphoramidate, the
target-complementary nucleobase sequence will have two ends or
"boundaries" located opposite each other along the length of the
primary sequence of bases which comprise the probe. These
boundaries may be designated as 5' and 3' for a conventional
phosphodiester backbone, or as amino ("N") and carboxy ("C") for
the PNA backbone.
[0054] Flanking the two ends of the target-complementary nucleobase
sequence is a pair of arms (one arm at either boundary of the
target-complementary nucleobase sequence) that reversibly interacts
by means of complementary base pairing. Each of the two arms
includes a sequence of nucleobases joined to a backbone, such as
one of those described in the preceding paragraph. Each of the arms
can hybridize to the other to form the stem duplex under detection
conditions when the target-complementary nucleobase sequence is not
bound to the target. Stem duplexes of the invented probes
characteristically have a substantially parallel-stranded
structure, so that the probe has two 5' termini or two 3' termini
(in the case of a phosphodiester backbone). Alternative probe
structures based on a PNA backbone will have two amino or two
carboxy termini.
[0055] Those having an ordinary level of skill in the art will
understand that backbone polarity is conventionally described in
terms such as 5' to 3', or 3' to 5', or N to C, or C to N. Those
familiar with the chemical synthesis of oligonucleotides and
oligonucleotide analogs such as PNAs understand that two backbones
of different polarity can be joined to each other through an
inversion linkage. For example, two oligonucleotides may be joined
in a tail-to-tail fashion by a 3'-3' inversion linkage to yield a
molecule having two 5' ends.
[0056] It is highly preferred for the signal-generating label
moieties of the invented parallel-stem probes to comprise
interactive "pairs." Preferably, these pairs are matched such that
at least one label moiety can alter at least one physically
measurable characteristic of the other label moiety when the two
are in close proximity, but not when they are sufficiently
separated. These label moieties typically are linked to the
parallel-stem probe such that the proximity of the label moieties
to each other is regulated by the status of the interaction of the
parallel-stem duplex. For example, one member of each label pair
may be linked to a different terminus of the probe structure. In
the absence of target, the label moieties are held in close
proximity to each other by the interaction of the parallel-stem
duplex. This conformation is referred to as the "closed" state.
Guidelines for Creating Stems Having Parallel-Stranded
Configuration
[0057] A common feature of the three major families of A-, B-, and
Z-DNA duplexes is the antiparallel disposition of the constituent
strands. However, it has also been shown that nucleic acids can
adopt alternative structures such as triple helices and
parallel-stranded duplexes. Those having an ordinary level of skill
in the art will appreciate that various models have been created to
study these unusual structures. A simplified set of guidelines was
followed to determine the nucleobase content of the stem portions
of the probes in order to illustrate the construction and use of
parallel-stem probes in accordance with the present invention.
[0058] The four conventional nucleobases found in DNA are
differentially able to participate in parallel-stranded duplex
formation. Adenine (A) and thymine (T) moieties in oligomers can
pair in either the antiparallel or parallel orientations (van de
Sande et al., Science 241:551 (1988)). Conversely, the presence of
guanine (G) and cytosine (C) can actually destabilize
parallel-stranded hybrids (Shchyolkina et al., Biochemistry
39:10034 (2000)). However, if G is paired with isocytosine (iC), or
if C is paired with isoguanine (iG), then oligomers containing G
and/or C moieties can form parallel-stranded hybrids (Sugiyama et
al., J. Am. Chem. Soc. 118:9994 (1996); Seela et al., Hel. Chim.
Acta. 80:73 (1997); Seela et al., Nucleic Acids Symp. Series No.
37:149 (1997)). A description of the synthesis of certain
nucleotides that are capable of forming parallel-stranded
structures is given in U.S. Pat. No. 6,147,199, the disclosure of
which is hereby incorporated by reference.
[0059] Novel chemical linkages have also been used in the backbone
structures of model polynucleotides to impose parallel-stranded
configurations. To study the details of parallel-stranded DNA,
hairpin structures incorporating either 3'-3' or 5'-5' linkages
that reverse strand polarity have been employed (van de Sande et
al., Science 241:551(1988); Germann et al., Biochemistry 37:12962
(1998)). Although these hairpin structures did not include label
moieties and were not used for promoting intermolecular base
pairing, the utility of the 5'-5' and 3'-3' linkages for supporting
parallel-stranded configurations in model polynucleotide structures
is accepted. In accordance with the present invention, reversed
sequence polarity consisting of amino-amino (N-N) and
carboxy-carboxy (C-C) linkages are particularly contemplated for
PNAs.
[0060] Studies of parallel-stranded DNA having mixed AT/GC
composition have emphasized the differences between
parallel-stranded and antiparallel-stranded double helical forms of
DNA. More specifically, parallel-stranded DNA exhibited more
pronounced sequence-dependent variations in local helical
stability. The overall stability of parallel-stranded DNA formed of
A:T and G:C base pairs may depend dramatically on the precise
nucleotide sequence, as opposed to antiparallel-stranded B-DNA for
which the sequence dependence is less pronounced. As indicated
above, the presence of G:C base pairs interspersed among A:T base
pairs has been shown to destabilize the parallel-stranded DNA
configuration.
[0061] Conversely, the presence of certain nucleotide analogs has
been shown to favor adoption of the parallel-stranded structure.
For example, Seela et al., (Nucleosides & Nucleotides 17:2045
(1998)) have disclosed that special sequence designs and a high
dA:dT content are required to form parallel-stranded DNA duplex
structures. However, the presence of iG:C and/or iC:G base pairs
can be sufficient to dictate parallel-stranded polarity.
Parallel-stranded duplexes can also be formed using other modified
bases, including 7-deazaisoguanine when paired with cytosine,
8-aza-7-deazaisoguanine when paired with cytosine, and
5-aza-7-deazaguanine when paired with guanine. It has been
particularly shown that the iGd:dC base pair in parallel-strand
hybrids is more stable than the dG:dC pair in antiparallel stranded
duplexes, and that this higher stability can dictate chain
orientation when additional dA:dT base pairs are present (Seela et
al., Nucleosides & Nucleotides 18:1543 (1999)).
[0062] To illustrate the invention, parallel-stem hybridization
probes incorporated 3'-3' or 5'-5' linkages to reverse polarity,
and further included the substitution of nucleobase analogs to
replace G:C and C:G base pairs which destabilize parallel-stranded
structures. Parallel-stranded DNA forms when the guanine-cytosine
Watson-Crick base pair of antiparallel-stranded DNA is replaced by
the isoguanine-cytosine pair and/or isocytosine- or
5-methylisocytosine-guanine pairs (Seela et al., Bioorg. &
Medicinal Chem. Letters 10:289 (2000)). Other nucleobase analogs
that can promote parallel-stranded helix formation are contemplated
for use in connection with the present invention. Thus,
parallel-stem probes are not limited by the particular nucleobases
that comprise the parallel-stem duplex. Indeed, any nucleobases
which participate in, or which favor, parallel-stranded duplex
formation may be used to create labeled parallel-stem hybridization
probes.
Functional Aspects of Inversion Probes
[0063] When the target-complementary nucleobase sequence of an
inversion probe, meaning a parallel-stem hybridization probe or a
dual inversion probe, hybridizes to its polynucleotide target, a
conformational change occurs whereby the two arms of the probe, and
any interactive labels attached thereto, become separated. This
conformation is referred to as the "open" state. Separation is
driven by the thermodynamics of the formation of a helical duplex
between the target-complementary nucleobase sequence of the probe
and the target. If the inversion probe includes a pair of
interactive labels, then open state formation will generate a
detectable signal because the separation of the arms alters the
interaction of the label moieties. As a consequence, a difference
in at least one characteristic of at least one label moiety linked
to the inversion probe can be measured. Like conventional molecular
beacons, the probes of this invention do not shift to the open
conformation when non-specifically bound.
[0064] As indicated above, parallel-stem hybridization probes and
dual inversion probes have a closed conformation and an open
conformation. Interactive label moieties linked to the arms of the
inversion probe are more separated in the open conformation than in
the closed conformation, and this difference is sufficient to
produce a detectable change in at least one measurable
characteristic. In the closed conformation the label moieties are
sufficiently close that they interact with each other. When this is
the case, the measurable characteristic differs in detectable
amount, quality, or level, from the open conformation when they do
not so interact.
[0065] Preferred interactive label moieties are a
fluorophore/quencher pair, preferably covalently linked to the
inversion probe, most preferably to arm portions of the probes.
Highly preferred parallel-stem probes generate a positive
fluorescent signal of a particular wavelength when bound to a
target polynucleotide in the open state and stimulated with an
appropriate light source.
[0066] The invention further includes assay methods which utilize
at least one interactively labeled inversion probe. These assays
may be used for detecting and/or quantifying targets that are
single-stranded or double-stranded. Homogeneous assays using
interactively labeled inversion probes are highly preferred.
Typical assays according to this invention include steps for adding
at least one inversion probe, which may be a parallel-stem
hybridization probe or a dual inversion probe, to a sample
suspected of containing polynucleotide strands that include a
target sequence, and determining whether there is a change in the
probe's measurable characteristic as compared to that
characteristic under the same conditions in the absence of target
sequence. The assays may be qualitative or quantitative.
Structural Features of Parallel-Stem Hybridization Probes
[0067] Parallel-stem probes can be made from DNA, RNA, PNA or other
nucleotide analog, or some combination of these. The probes may
particularly include modified nucleotides or nucleotide analogs in
the target-complementary nucleobase sequence or in the arm portions
of the probe. FIG. 1 schematically illustrates the structure of a
parallel-stem probe as it exists in the closed conformation.
Referring to the figure, parallel-stem hybridization probe 10
includes a target-complementary loop 3, an inversion arm 4 and an
extension arm 5 linked to and extending from target-complementary
loop 3 to end at the probe termini, identified as a first terminus
1 and a second terminus 2, respectively, in the figure.
Target-complementary loop 3 can be defined as extending from a
first boundary 6 to a second boundary 7. Although not shown in FIG.
1, it is contemplated that additional nucleobases having
antiparallel complementarity may be interposed between the first
and second boundaries 6 and 7 of target-complementary loop 3 and
the parallel-stranded duplex 8, and further, that those additional
nucleobases may participate in target binding. In the absence of a
target polynucleotide, the inversion arm 4 and extension arm 5 of
the parallel-stem probe are held together through complementary
nucleobase pairing (illustrated by dashed horizontal lines between
the two arms) to form parallel-stranded stem duplex 8. An inversion
linkage 9 in the backbone structure of the probe at a position
between inversion arm 4 of parallel-stranded stem duplex 8 and the
adjacent boundary 6 of target-complementary loop 3 ensures that
inversion arm 4 and extension arm 5 will have backbones disposed in
a parallel configuration. Thus, if inversion linkage 9 is a 5'-5'
linkage, then terminus 1 and terminus 2 will be 3' termini.
Alternatively, if inversion linkage 9 is a 3'-3' linkage, then
terminus 1 and terminus 2 will be 5' termini. Analogous linkages
for PNA backbones also can result in two carboxy or two amino
termini. In certain preferred embodiments of the invention,
parallel-stem probe 10 additionally includes a detectable label
(not shown in FIG. 1). In highly preferred embodiments one member
of an interactive label pair may be linked to the parallel stem
probe at or within several nucleobases of terminus 1, and the
second member of the interactive label pair may be linked to the
parallel stem probe at or within several nucleobases of terminus 2.
Preferably, each label is linked to the parallel-stem hybridization
probe at or within 8, more preferably at or within 5 nucleobases
distant from the probe termini.
[0068] Formation of a probe:target hybrid by interaction of
target-complementary loop 3 and its target (not shown in FIG. 1) is
thermodynamically favored under assay conditions at the detection
temperature, and this interaction drives the separation of
inversion arm 4 and extension arm 5, thereby resulting in
dissolution of parallel-stranded stem duplex 8 and the maintenance
of an open conformation. Indeed, inversion arm 4 and extension arm
5 reversibly interact through complementary nucleobase pairing
sufficiently strongly to maintain parallel-stranded stem duplex 8
in the closed state under detection conditions in the absence of
target sequence, but sufficiently weakly that the hybridization of
the target-complementary loop 3 and its target sequence is
thermodynamically favored over the intramolecular interaction of
arms 4 and 5. This balance allows the parallel-stem probe to
undergo a conformational change from the closed state to the open
state upon target binding. Non-specific binding of the
parallel-stem probe does not overcome the association of inversion
arm 4 and extension arm 5 in this manner, thereby facilitating low
background signals from interactions of non-complementary target
sequences with the target-complementary loop 3.
[0069] Referring now to FIG. 2, two related embodiments of the
invented parallel-stem probe are illustrated in the closed
conformation. Each of the probes shown in the figure has a
phosphodiester backbone and includes a target-complementary loop 3,
an inversion linkage, and a parallel-stranded stem duplex 8 formed
by the interaction (illustrated by dashed horizontal lines between
the two arms) of inversion arm 4 and extension arm 5. A first label
moiety 20 which is a member of an interactive label pair is shown
in this embodiment as being disposed at terminus 1 of inversion arm
4. A second label moiety 21 which is a member of the interactive
label pair is shown in this embodiment as being disposed at
terminus 2 of extension arm 5. The parallel-stem probe in the left
portion of the figure has a 5'-5' inversion linkage 9a, and so
termini 1 and 2 of this parallel-stem probe are 3' termini. The
parallel-stem probe in the right portion of the figure has a 3'-3'
inversion linkage 9b, and so termini 1 and 2 of this
parallel-stranded probe are 5' termini. Label moieties 20 and 21
are positioned in the structure of parallel-stranded stem duplex 8
such that their proximity is altered by the interaction of arms 4
and 5. Label moieties 20 and 21 could be linked elsewhere to arms 4
and 5 or to the sequence of target-complementary loop 3 near its
linkage with parallel-stem duplex 8, that is, close to arms 4 and
5. Some label moieties will interact to a detectably different
degree when linked internally along the arms. This is because they
will be differentially affected by unraveling of the termini or
"breathing" of the stem duplex, or by interactions with the
internal rather than the terminal bases.
[0070] There is no requirement for a one-to-one molecular
correspondence between members of a label pair, especially where
one member can affect, or be affected by, more than one molecule of
the other member. For example, there can be two quenchers and a
single fluorophore, or alternatively two fluorophores and a single
quencher. Certain preferred label moieties suitable for use in
parallel-stem probes of this invention interact so that at least
one moiety can alter at least one physically measurable
characteristic of another label moiety in a proximity-dependent
manner. The characteristic signal of the label pair is detectably
different depending on whether the probe is in the open
conformation or the closed conformation.
Structural Features of Dual Inversion Hybridization Probes
[0071] Dual inversion probes can be made from DNA, RNA, PNA or
other nucleotide analogs, or some combination of these. The probes
may particularly include modified nucleotides or nucleotide analogs
in the target-complementary nucleobase sequence or in the arm
portions of the probe. FIG. 10 schematically illustrates the
stricture of a dual inversion probe as it exists in the closed
conformation. Referring to the figure, dual inversion probe 100
includes a target-complementary loop 3, a first arm 4 and a second
arm 5, each being linked to and extending from target-complementary
loop 3 to end at the probe termini, identified as a first terminus
1 and a second terminus 2, respectively, in the figure.
Target-complementary loop 3 can be defined as extending from a
first boundary 6 to a second boundary 7. Although not shown in FIG.
10, it is contemplated that additional nucleobases having
antiparallel complementarity may be interposed between the first
and second boundaries 6 and 7 of target-complementary loop 3 and
the antiparallel stem duplex 8, and further, that those additional
nucleobases may participate in target binding. In the absence of a
target polynucleotide, the first arm 4 and second arm 5 of the dual
inversion probe are held together through complementary nucleobase
pairing (illustrated by dashed horizontal lines between the two
arms) to form an antiparallel stem duplex 8. A first inversion
linkage 9 in the backbone structure of the probe at a position
between first arm 4 and the first boundary 6 of
target-complementary loop 3, in combination with a second inversion
linkage 10 in the backbone structure of the probe at a position
between second arm 5 and the second boundary 7 of
target-complementary loop 3, ensures that first arm 4 and second
arm 5 will have backbones disposed in an antiparallel configuration
in antiparallel stem duplex 8. Thus, if inversion linkage 9 is a
5'-5' linkage, and if second linkage 10 is a 3'-3' inversion
linkage, then terminus 1 will be a 3' terminus and terminus 2 will
be a 5' terminus. Alternatively, if first linkage 9 is a 3'-3'
linkage, and if second linkage 10 is a 5'-5' inversion linkage,
then terminus 1 will be a 5' terminus and terminus 2 will be a 3'
terminus. Analogous linkages for PNA backbones also can result in
antiparallel stem duplex 8 having one amino terminus and one
carboxy terminus. In certain preferred embodiments of the
invention, dual inversion probe 100 additionally includes a
detectable label (not shown in FIG. 10). In highly preferred
embodiments one member of an interactive label pair may be linked
to the dual inversion probe at or within several nucleobases of
terminus 1, and the second member of the interactive label pair may
be linked to the dual inversion probe at or within several
nucleobases of terminus 2. Preferably, each label is linked to the
dual inversion probe at or within 8, more preferably at or within 5
nucleobases distant from the probe termini.
[0072] Again, there is no requirement for a one-to-one molecular
correspondence between members of a label pair, especially where
one member can affect, or be affected by, more than one molecule of
the other member. Certain preferred label moieties suitable for use
in dual inversion probes of this invention interact so that at
least one moiety can alter at least one physically measurable
characteristic of another label moiety in a proximity-dependent
manner. The characteristic signal of the label pair is detectably
different depending on whether the probe is in the open
conformation or the closed conformation.
[0073] Formation of a probe:target hybrid by interaction of
target-complementary loop 3 and its target (not shown in FIG. 10)
is thermodynamically favored under assay conditions at the
detection temperature, and this interaction drives the separation
of first arm 4 and second arm 5, thereby resulting in dissolution
of antiparallel stem duplex 8 and the maintenance of an open
conformation. Indeed, first arm 4 and second arm 5 reversibly
interact through complementary nucleobase pairing sufficiently
strongly to maintain antiparallel stem duplex 8 in the closed state
under detection conditions in the absence of target sequence, but
sufficiently weakly that the hybridization of the
target-complementary loop 3 and its target sequence is
thermodynamically favored over the intramolecular interaction of
arms 4 and 5. This balance allows the dual inversion probe to
undergo a conformational change from the closed state to the open
state upon target binding. Non-specific binding of the dual
inversion probe does not overcome the association of first arm 4
and second arm 5 in this manner, thereby facilitating low
background signals from interactions of non-complementary target
sequences with the target-complementary loop 3.
[0074] Importantly, the orientation of the target-complementary
loop sequence of a dual inversion probe will determine the identity
of the inversion linkages in the probe structure. If the
target-binding sequence of the probe has a 5'-end and a 3'-end,
then that 5'-end will always be adjacent to a 5'-5' inversion
linkage and the 3'-end will always be adjacent to a 3'-3' inversion
linkage. Thus, with reference to FIG. 10, if target-complementary
loop 3 is oriented so that first boundary 6 corresponds to the
5'-end and second boundary 7 corresponds to the 3'-end of the
target-binding portion of the probe, then first inversion linkage 9
must be a 5'-5' inversion linkage, and second inversion linkage 10
must be a 3'-3' inversion linkage.
Preferred Label Moieties for Inversion Probes
[0075] As indicated above, inversion probes preferably include at
least one detectable label. Preferred label moieties for inversion
probes are either singly detectable labels or individual members of
a pair of interactive labels.
[0076] Examples of singly detectable labels that are preferred for
use in connection with the invention include radioisotopes, enzymes
(i.e., alkaline phosphatase or horseradish peroxidase),
fluorophores, chromophores and label moieties for the generation of
light through radioluminescent, bioluminescent, chemiluminescent or
electrochemiluminescent reactions. These label moieties may be
positioned anywhere in the probe or may be linked to the probe at
any location, as long as probe function, particularly hybridization
to target, is not substantially compromised. Particular examples of
detectable labels that would be useful for labeling inversion
probes include a .sup.32P radioisotope, and a chemiluminescent
acridinium ester of the type disclosed by Arnold et al., in U.S.
Pat. No. 5,283,174 for use in conjunction with homogeneous
protection assays, and of the type disclosed by Woodhead et al., in
U.S. Pat. No. 5,656,207 for use in connection with assays that
quantify multiple targets in a single reaction. The disclosures
contained in these patent documents are hereby incorporated by
reference. Both radiolabels and acridinium ester labels can be
joined to an inversion probe in either the loop region or stem
region of the probe.
[0077] Examples of detectable labels that are preferred as members
of an interactive pair of labels interact with each other by FRET
or non-FRET energy transfer mechanisms. Fluorescence resonance
energy transfer (FRET) involves the radiationless transmission of
energy quanta from the site of absorption to the site of its
utilization in the molecule, or system of molecules, by resonance
interaction between chromophores, over distances considerably
greater than interatomic distances, without conversion to thermal
energy, and without the donor and acceptor coming into kinetic
collision. The "donor" is the moiety that initially absorbs the
energy, and the "acceptor" is the moiety to which the energy is
subsequently transferred. In addition to FRET, there are at least
three other "non-FRET" energy transfer processes by which
excitation energy can be transferred from a donor to an acceptor
molecule. First, "reabsorption" or "trivial reabsorption" is the
process in which a photon is emitted by the donor and is
subsequently absorbed by the acceptor. Second, "complex formation"
refers to the creation of an excited-state complex of a donor and
an acceptor that are in very close proximity, essentially in
molecular contact with each other. Third, "collisional quenching"
can occur when an excited molecule loses its excitation energy to
another molecule as a result of colliding with that other molecule.
Various aspects of these energy transfer processes have been
discussed in Resonance Energy Transfer: Theory and Data, B. W. van
der Meer, G. Coker III, S.-Y. S. Chen, VCH Publishers, NY
(1994).
[0078] As stated above, certain preferred labels are chosen such
that energy transfer is the mode of interaction between the labels.
In such cases, the measurable physical characteristics of the
labels could, among other modes, be a decrease in the lifetime of
the excited state of one label, a complete or partial quenching of
the fluorescence of one label, an enhancement of the fluorescence
of one label or a depolarization of the fluorescence of one label.
The labels may be excited with a narrow wavelength band of
radiation or a wide wavelength band of radiation. Similarly, the
emitted radiation may be monitored in a narrow or a wide range of
wavelengths, either with the aid of an instrument or by direct
visual observation.
[0079] When two labels are held sufficiently close that energy
emitted by one label can be received or absorbed by the second
label, whether by a FRET or non-FRET mechanism, the two labels are
said to be in "energy transfer relationship" with each other. This
is the case, for example, when an invented hybridization probe is
maintained in the closed state by formation of a stem duplex, and
fluorescent emission from a fluorophore attached to one arm of the
probe is quenched by a quencher moiety on the opposite arm.
[0080] Highly preferred label moieties for inversion probes include
a fluorophore and a second moiety having fluorescence quenching
properties (i.e., a "quencher"). In this embodiment, the
characteristic signal is likely fluorescence of a particular
wavelength, but alternatively could be a visible light signal. When
fluorescence is involved, changes in emission are preferably due to
FRET, or to radiative energy transfer or non-FRET modes. When an
inversion probe having a pair of interactive labels in the closed
state is stimulated by an appropriate frequency of light, a
fluorescent signal is generated at a first level, which may be very
low. When this same probe is in the open state and is stimulated by
an appropriate frequency of light, the fluorophore and the quencher
moieties are sufficiently separated from each other that energy
transfer between them is substantially precluded. Under that
condition, the quencher moiety is unable to quench the fluorescence
from the fluorophore moiety. If the fluorophore is stimulated by
light energy of an appropriate wavelength, a fluorescent signal of
a second level, higher than the first level, will be generated. The
difference between the two levels of fluorescence is detectable and
measurable. Using fluorophore and quencher moieties in this manner,
the inversion probe is only "on" in the "open" conformation and
indicates that the probe is bound to the target by emanating an
easily detectable signal. The conformational state of the probe
alters the signal generated from the probe by regulating the
interaction between the label moieties.
[0081] Examples of donor/acceptor label pairs that may be used in
connection with the invention, making no attempt to distinguish
FRET from non-FRET pairs, include fluorescein/tetramethylrhodamine,
IAEDANS/fluororescein, EDANS/DABCYL, coumarin/DABCYL,
fluorescein/fluorescein, BODIPY FL/BODIPY FL, fluorescein/DABCYL,
lucifer yellow/DABCYL, BODIPY/DABCYL, eosine/DABCYL,
erythrosine/DABCYL, tetramethylrhodamine/DABCYL, Texas Red/DABCYL,
Cy5/BHl and fluorescein/QSY7 dye. Those having an ordinary level of
skill in the art will understand that when donor and acceptor dyes
are different, energy transfer can be detected by the appearance of
sensitized fluorescence of the acceptor or by quenching of donor
fluorescence. When the donor and acceptor species are the same,
energy can be detected by the resulting fluorescence
depolarization. Non-fluorescent acceptors such as DABCYL and the
QSY 7 dyes advantageously eliminate the potential problem of
background fluorescence resulting from direct (i.e.,
non-sensitized) acceptor excitation. Preferred fluorophore moieties
that can be used as one member of a donor-acceptor pair include
fluorescein. Highly preferred quencher moieties that can be used as
another member of a donor-acceptor pair include
4-[4-(dimethylamino)phenylazo]benzoic acid (DABCYL).
Target-Complementary Loop Structures
[0082] Lengths of the target-complementary loops and arm sequences
of inversion probes are chosen to allow proper thermodynamic
functioning under the conditions of the projected hybridization
assay. The length of a target-complementary sequence of bases which
comprise the loop can range from 7 to about 140 nucleobases,
preferably from 10 nucleobases to about 140 nucleobases, still more
preferably from 10 nucleobases to 25 nucleobases, still more
preferably 16 nucleobases to 22 nucleobases, and yet still more
preferably from 8 nucleobases to 25 nucleobases.
Structure and Function of the Arm Portions of Inversion Probes
[0083] The sequences of the arm elements of the invented probes
should be of sufficient length that under conditions of the assay,
including the detection temperature, the arms are associated with
each other so that any interactive label moieties joined thereto
are kept in close proximity to each other when the probes are not
bound to a target. Depending upon the assay conditions, arm lengths
in the range of 3-25 nucleobases can perform this function. An
intermediate range of 4-15, more preferably 5-12, and still more
preferably 6-8 nucleobases also can be appropriate. The actual
length will be chosen with reference to the target-complementary
sequence such that the probe remains in the closed conformation in
the absence of target and assumes an open conformation when bound
to target.
[0084] The upper limit of the length of the arms is governed by two
criteria related to the thermodynamics of probes according to the
invention. First, it is preferred that the thermal denaturation, or
melting temperature (Tm), of the stem duplex, under assay
conditions, should be higher than the detection temperature of the
assay. "Tm" refers to the temperature at which 50% of the probe is
converted from the hybridized to the unhybridized form. Certain
preferred stem duplexes have melting temperatures 2-15.degree. C.
higher, or more preferably 5-10.degree. C. higher, than the assay
temperature. Second, the energy released by the formation of the
stem duplex should be less than the energy released by the
formation of the hybrid between the target-complementary loop of
the probe and the polynucleotide target at the detection
temperature of the assay. When this is the case, target-mediated
opening of the probe will be thermodynamically favored. Thus, the
Tm of the target-complementary loop:target hybrid should be higher
than the Tm of the stem duplex.
[0085] The Tm of the stem duplex must be above the assay
temperature, so that the probe does not open in the absence of the
target-complementary loop hybridizing to a target. At the same
time, the Tm of the stem duplex must be sufficiently below the Tm
of the hybrid of the target-complementary loop with the target
sequence to ensure proper probe functioning and appropriate
generation of a detectable signal. Certain preferred stem duplexes
have Tm 2-15.degree. C., more preferably 5-10.degree. C., above the
assay temperature, and at or below the Tm of the hybrid between the
target-complementary loop and the target polynucleotide sequence.
Inversion probes having target-complementary sequences from 8 to 25
nucleobases in length, combined with arm sequences from 6 to 12
nucleobases in length, may be designed within these parameters.
[0086] Those having an ordinary level of skill in the art will
realize that these parameters will vary with the conditions of the
hybridization assay, and that those conditions must be considered
when designing the inversion probes of this invention. The length
of the arms and their nucleobase content will affect the Tm of a
stem duplex. For a desired Tm, under particular assay conditions, a
length and a nucleobase content of the arms may easily be
calculated (see Chen et al., J. Am. Chem. Soc. 123:1267 (2001)).
The Tm of the stem duplex of a probe also can be empirically
determined for given assay conditions. Based on the foregoing
descriptions of probe function, it should be clear that the
thermodynamics of inversion probes having stem duplexes will vary
with length and nucleobase composition of the stem, and
target-complementary sequence, as well as assay conditions.
[0087] When interactive fluorescent donor-acceptor pairs are
employed as labels, the fluorophore and quencher moieties
preferably are linked anywhere along the arm portions of the probe,
subject to certain provisions. The fluorophore and quencher
moieties should be proximate to each other in the closed
conformation of the probe to give a relatively lower fluorescence
signal, yet should be sufficiently separated from each other in the
open conformation to give a relatively higher fluorescence
signal.
[0088] It is also contemplated that multiple labels (i.e., multiple
fluorophore and quencher moieties) can be used. Multiple labels, in
some cases, permit assays with higher sensitivity. In some
instances, when the affinity pair is made up of a pair of
oligonucleotide arms, a multiplicity of labels can be achieved by
distributing a number of fluorophore moieties on one arm and a
corresponding number of quencher moieties on the other arm, such
that each fluorophore moiety will be close to a quencher moiety
when the stem duplex forms. U.S. Pat. No. 6,037,130, the disclosure
of this patent being incorporated by reference herein, describes an
alternative mode of labeling that also is contemplated for labeling
the probes of the present invention.
[0089] The inversion probes described herein may comprise nucleic
acid molecules that can be assembled by commonly known methods of
solid-phase synthesis, by ligation of synthetic sequences or
restriction fragments or by a combination of these techniques. The
simplest inversion probes can be assembled by synthesis of a single
oligonucleotide comprising arm sequences flanking the target
complementary sequence. Labeled nucleotides can be used in
oligonucleotide synthesis, for example to introduce a fluorophore
moiety and a quencher moiety at oppositely disposed termini of the
probe. Alternatively, label moieties can be linked to the termini
of the probe after synthesis of the main structure of the
nucleobase-containing probe.
Assays Employing Inversion Probes
[0090] Preferably, assays for detecting target polynucleotides
using the invented probes are conducted in homogeneous formats.
These assays may involve direct detection of polynucleotides, or
alternatively may involve detection of amplicons produced in an
amplification reaction that uses a particular polynucleotide as a
template. When amplicons are detected by the parallel-stem probes
described herein, the detection may be an end-point detection
(i.e., detection of amplicons at the conclusion of the
amplification reaction), or alternatively may involve real-time
monitoring of amplicon synthesis during the amplification reaction.
Exemplary amplification reactions include transcription-based
amplification assays (such as TMA and NASBA), the polymerase chain
reaction (PCR), self-sustained sequence reaction (3SR),
strand-displacement amplification (SDA) reaction, and Q-beta
replicase-mediated amplification reactions. When amplicon synthesis
is monitored in real-time amplification protocols, the inversion
probe will be included in the reaction mixture, and fluorescence
will be measured continuously or intermittently during the
amplification reaction. Certain embodiments of assays according to
the present invention utilize multiple hybridization probes with
interactive labels immobilized to a solid surface. Exemplary
surfaces include beads or particles, membranes, dipsticks, planar
glass or plastic surfaces such as glass or plastic slides or
microtiter wells, and glass or plastic optical fibers.
Immobilization of Inversion Probes
[0091] Immobilized probes according to the invention advantageously
may be used in assays for the simultaneous determination of a
predetermined set of target sequences. For example, a series of
inversion probes can be prepared, each comprising a different
sequence in its target-complementary loop region. Each probe may
then be linked to the same support surface, such as those
elaborated above, at its own predetermined location through
covalent bonds or non-covalent interactions. After contacting the
support and the sample under hybridization conditions, the support
may be stimulated with light of an appropriate frequency.
Fluorescence will occur at those locations where immobilized probes
have formed hybrids with target molecules from the sample. Arrays
or microarrays of immobilized inversion probes are particularly
preferred embodiments of structures or devices incorporating
immobilized probes in accordance with the invention. Immobilization
of inversion probes by linkage through the target-complementary
loop is particularly preferred.
Illustration of the Preferred Embodiment
[0092] The utility of parallel-stem hybridization probes was first
demonstrated by creating three different probe species, and then
testing these probes for interaction with either of two synthetic
targets. Variables that were considered when designing these probes
included: (1) the desire to promote either parallel or antiparallel
orientations of the arm components of putative stem regions, and
(2) the presence or absence of modified nucleotides in the arm
components of putative stem regions that would facilitate formation
of parallel-stranded duplexes and prevent interaction between the
arm components and the target. RNA targets used in these procedures
had sequences that were contiguously complementary either to the
loop region of the probe, or to sequence of the probe over its
entire length. In all cases, the sequences of the probes were
identical over their lengths, except for the substitution of
5-methyl-iC for cyrosine in the stem portions, as indicated.
[0093] Oligonucleotides containing inversion linkages were
synthesized using standard laboratory procedures. More
particularly, to prepare oligonucleotides containing 3'-3'
internucleotide linkages, synthesis was first performed in the 5'
to 3' direction beginning with 5'-derivatized CPG columns and
5'-phosphoramidites. Subsequent coupling cycles were repeated in
the 5' to 3' direction (forming 3'-5' linkages) until the first of
the adjacent bidirectional segments was complete. The direction of
synthesis was reversed to 3' to 5' by replacing 5'-phosphoramidites
with standard 3'-phosphoramidites. The first linkage formed after
the reversal of synthesis direction was a 3'-3' internucleotide
linkage. Subsequent couplings were repeated in the 3' to 5'
direction (forming 5'-3' linkages) until the second of the
bidirectional segments was complete. A resulting oligonucleotide
containing a single 3'-3' inversion linkage had two 5' ends. An
analogous procedure was followed for preparation of 5'-5' linked
oligonucleotides, except that synthesis was begun in the 3' to 5'
direction from a 3'-derivatized CPG column, using standard
3'-phosphoramidites. After completion of the first segment, the
direction of synthesis was reversed to the 5' to 3' direction by
switching from 3'- to 5'-phosphoramidites, resulting in the
formation of a 5'-5' internucleotide linkage, followed by 3'-5'
internucleotide bond formation until the desired sequence was
achieved. A resulting oligonucleotide containing a single internal
5'-5' inversion linkage had two 3' ends.
[0094] The three probe species used to demonstrate the utility of
parallel-stem hybridization probes had the following structures.
The first probe, named 1093, had the structure: 5
'-DABCYL-GGTGTGGGGUACAGUGCAGGGGCACACC-Fluorescein-3' (SEQ ID NO:
1). This probe had the structure of a conventional molecular beacon
with an antiparallel stem duplex. The second probe, named 1034, had
the structure:
3'-DABCYL-GGTGTG-5'-5'-GGGUACAGUGCAGGGGCACACC-Fluorescein-3' (SEQ
ID NO:2). This probe was designed to have arms that were configured
in a parallel orientation, but that could not form a stem duplex
because O:C base pairs do not participate in parallel-stranded
structures. Thus, the 1034 probe served as a control that included
a 5'-5' linkage, but did not form a stem structure that maintained
a closed conformation in the absence of a complementary target
polynucleotide. The third probe was a parallel-stem hybridization
probe. The third probe, named 1094, had the structure:
3'-DABCYL-GGTGTG-5'-5'-GGGUACAGUGCAGGGGiCAiCAiCiC-Fluorescein-3'
(SEQ ID NO:3). This probe had arms capable of base pairing in a
parallel configuration, and forming duplex structures as the result
of the presence of 2'-deoxy-5-methylisocytidine
(2-amino-4-oxy-5-methyl-1-.beta.-D-2'-deoxyribofuranosyl-1H-pyrimidine)
(iC) residues in one arm of the stem. Thus, the 1094 probe included
a 5'-5' linkage and was capable of forming a parallel-stranded stem
duplex. The target-complementary sequence of bases in the loop
portions of the 1093 and 1094 probes is given by GGGUACAGUGCAGGGG
(SEQ ID NO:9). Underlined nucleotides in the probe sequences
indicate positions falling outside the target-complementary loop
region, but which may participate in stem formation. Underlined
positions were deoxyribonucleotides, while the remaining positions
of each probe were occupied by 2'-OMe nucleotide analogs. Each of
the three probes included a non-nucleotide linker, as described by
Arnold et al., in U.S. Pat. No. 5,696,251, located between
nucleotides 15 and 16 at a position within the target-complementary
sequence. Although initial procedures were carried out in solution,
this non-nucleotide linker provided a way to immobilize the probes
to a solid surface. Indeed, this approach is highly preferred for
immobilizing parallel-stem hybridization probes. FIG. 3
schematically illustrates how the structural differences between
the probes were reflected by the folded structures of the molecules
in the absence of complementary target polynucleotides.
[0095] Two different polynucleotides that were used as targets for
hybridizing the above-described probes had the following
structures. The first target, named 1059, had the sequence:
5'-UAUUCUUUCCCCUGCACUGUACCCCCCAAUC-3' (SEQ ID NO:4). The 1059
target was contiguously complementary only to the loop sequence of
each of the three probes. The second target, named 1061, had the
sequence: 5'-UAGGUGUGCCCCUGCACUGUACCCCACACCU-3' (SEQ ID NO:5), and
was complementary to the antiparallel probe 1093 over its entire
length.
[0096] Interactions between the different probes and targets were
conveniently assessed in the following Example using Tm
measurements. The Tm was measured as an indicator of hybrid
stability. When two nucleic acid hybrids have different Tm values,
the hybrid having the higher Tm is the more "stable" of the two. By
comparing the Tm values for the three probes described above, both
alone and hybridized with targets, it was possible to obtain
information about the extent to which the stem regions of the
self-reporting probes interacted with target sequences.
[0097] Example 1 describes the methods used to establish that the
arm segments of the model parallel-stem hybridization probe
advantageously did not interact with target sequences. Notably, the
model target sequence employed in the following procedure was an
HIV-1 polynucleotide sequence.
EXAMPLE 1
Quantifying Interactions Between Polynucleotide Targets and
Probes
[0098] The 1034, 1094 and 1093 probes were independently
synthesized by solid-phase phosphite triester chemistry using
DABCYL-linked controlled pore glass and 5' fluorescein-labeled
phosphoramidite on a Perkin-Elmer (Foster City, Calif.) EXPEDITE
model 8909 automated synthesizer. The inversion linkages in the
1034 and 1094 probes, like all of the inversion linkages described
herein, were created using a combination of 5'-.beta.-cyanoethyl
and 3'-.beta.-cyanoethyl phosphoramidites that were purchased from
Glen Research Corporation (Sterling, Va.), Proligo (Boulder, Colo.)
or Pierce Biotechnology (Rockford, Ill.). All of these probes were
constructed using 2'-OMe nucleotide analogs in their
target-complementary loop regions, and standard
deoxyribonucleotides in their stem regions. Following synthesis,
the probes were deprotected and cleaved from the solid support
matrix and then purified using polyacrylamide gel electrophoresis
followed by HPLC according to procedures that will be familiar to
those having an ordinary level of skill in the art. The 1059 and
1061 synthetic RNA targets also were prepared using procedures
familiar to those having an ordinary level of skill in the art.
[0099] Melting curves for samples containing the three probes
individually or in combination with one of the two RNA targets were
generated to assess probe:target interactions. Each trial was
conducted by combining the polynucleotides to be tested (1 .mu.M of
probe or 1 .mu.M of probe and 1 .mu.M of target) in TENT buffer (50
mM Tris-HCl (pH 8.0), 50 mM NaCl, 0.1 mM EDTA, 0.2% of the
non-ionic wetting agent TWEEN-20 (a registered trademark of ICI
Americas, Inc.)), incubating at 60.degree. C. for 30 minutes, and
then cooling to room temperature for 15 minutes. The hybridized
samples were then loaded into a Beckman DU-640
temperature-controlled UV/visible spectrophotometer. Temperatures
were increased from 30.degree. C. to 90.degree. C. in 0.5.degree.
C./minute increments, with absorbance measurements at 260 nm
(A.sub.260) and 494 nm (A.sub.494) being recorded every 0.5.degree.
C. The first derivative of the curve plotted on a graph of
absorbance against temperature was used to identify the inflection
point which represented the Tm value. Results of these procedures
appear in Table 1. TABLE-US-00001 TABLE 1 Quantifying Probe: Target
Interactions Tm at 260 nm Probe Features (in .degree. C.) Probe
1093 Molecular Beacon 61.8 1034 Linear Probe with Inversion not
detected Linkage 1094 Parallel-Stem Hybridization Probe 44.6
.dagger. Probe/Target 1093/1061 Molecular Beacon 72.8 .dagger.
1093/1059 Molecular Beacon 52.2 .dagger. 1034/1061 Linear Probe
with Inversion 79.1 .dagger. Linkage 1034/1059 Linear Probe with
Inversion 68.9 Linkage 1094/1061 Parallel-Stem Hybridization Probe
79.6 .dagger. 1094/1059 Parallel-Stem Hybridization Probe 77.8
.dagger. .dagger. Value represents the averaged measurements of two
trials
[0100] Where they could be determined, Tm values calculated from
A.sub.494 measurements generally confirmed trends observed in the
Tm values that were calculated from A.sub.260 measurements. Only
results obtained using A.sub.260 measurements are presented here
because these readings could be obtained for all but the 1034 probe
by itself. This probe was designed to have a structure that did not
include a stable stem region, and did not exhibit a discrete
melting transition measurable at the 494 nm absorbance wavelength
which monitors energy absorption by the fluorescein fluorophore or
at the 260 mn wavelength which monitors energy absorbance by the
nucleobases.
[0101] Table 1 summarizes the thermal stabilities for the three
probes that were used to demonstrate utility of a model
parallel-stem hybridization probe. As indicated by the Tm values
for the 1094, 1093 and 1034 self-reporting probes listed in the
table, there were significant differences between the stabilities
of the stem regions for these molecules. For example, the
antiparallel stem of the 1093 molecular beacon was more stable
(Tm=61.8.degree. C.) than the parallel stem of the 1094
parallel-stem hybridization probe (Tm=44.6.degree. C). As noted
above, it was not possible to determine a Tm value for the 1034
molecule that included a 5'-5' inversion linkage, but that lacked
the nucleobase analogs required to facilitate parallel-stem duplex
formation. These findings were consistent with the model structures
shown in FIG. 3 where the stem regions of only the 1093 and 1094
molecules formed duplex structures. Also, the parallel stem was
less stable when compared with a corresponding antiparallel stem
having an equivalent length and sequence, but lacking 5-methyl-iC
nucleobases. Of course, by extending the length of a parallel stem
the Tm would be increased.
[0102] The measured Tm values for hybrids that included the 1093
probe and either of the two model targets provided baseline
information about stem interactions with target sequences. The fact
that the Tm of the 1093/1059 hybrid (52.2.degree. C.) was lower
than the Tm of the 1093/1061 hybrid (72.8.degree. C.) indicated
that greater stability was provided by additional base pairing that
was possible with the 1061 target. This was because the sequence of
the 1093 probe was fully complementary to the sequence of the 1061
target, but had limited complementarity with the sequence of the
1059 target. Importantly, the difference between the referenced Tm
values indicated a difference in stabilities that was attributed to
differential interaction between the arms of the stem and the
targets. This result confirmed that the arm components could
positively interact with target polynucleotide sequences that were
complementary, as shown in FIG. 4A.
[0103] The measured Tm values for hybrids that included the 1034
probe provided reference examples for the behavior of a
polynucleotide that included a 5'-5' linkage and only conventional
nucleobases. The hybrid that included the 1034 probe and the 1059
target was characterized by a Tm of 68.9.degree. C. This
established a quantitative baseline value reflecting the stability
of a hybrid having a structure wherein neither of the two arms of
the probe substantially interacts with the target sequence, as
shown in FIG. 4B. The nucleic acid hybrid that included the 1034
probe and the 1061 target was characterized by a Tm of 79.1.degree.
C. This value, which was higher than the Tm measured using the 1059
target, reflected the increased stability of a hybrid having a
structure wherein only one of the two arms of the probe
substantially interacted with the target, also as shown in FIG.
4B.
[0104] The measured Tm values for hybrids that included the 1094
parallel-stem hybridization probe validated the model structures
shown in FIG. 3 and FIG. 4C by supporting a key prediction based on
the following reasoning. If the presence of 5-methyl-iC nucleobases
in the extension arm of the 1094 probe prevented interaction with
target polynucleotide sequences falling outside the region
hybridized by the target-complementary loop of the probe, then the
Tm of the 1094/1061 hybrid should be similar to the Tm of the
1094/1059 hybrid. As indicated by the entries in Table 1, the Tms
of both hybrids that included the 1094 probe were similar to each
other. These results established that the arms of the 1094 probe
did not interact with sequences present in the target. Thus, the
arm components of a parallel-stem hybridization probe having an
inversion arm, and an extension arm, where the extension arm
contains nucleobase analogs that participate only in parallel base
pairing, advantageously did not interact with target polynucleotide
sequences, as shown in FIG. 4C.
[0105] Functionality of the parallel-stem hybridization probe was
next investigated by comparing the fluorescence emission of the
1094 parallel-stem hybridization probe with the fluorescence
emission of the 1093 molecular beacon. More specifically, these
probes having stem-and-loop configurations were tested for their
abilities to quench fluorescence in the absence of target, and to
emit a fluorescent signal in the presence of a target.
[0106] Example 2 describes the methods used to demonstrate that
target polynucleotide hybridization caused the parallel-stem
hybridization probe to transition from a closed conformation to an
open conformation that was detectable by fluorescent signal
emission.
EXAMPLE 2
Target Polynucleotide Binding Triggers Signaling by Parallel-Stem
Hybridization Probes
[0107] Individual samples containing the 1093 molecular beacon or
the 1094 parallel-stem hybridization probe and either of the two
polynucleotide targets described in Example 1 were hybridized and
monitored for fluorescence emission. In these procedures the
concentrations of the probes were held constant at 0.3 .mu.M, while
the concentration of the target varied from 0-3 .mu.M. Parallel
procedures were carried out using the 1059 and 1061 targets. In all
instances the mixtures were heated to 60.degree. C. for 30 minutes,
cooled to 42.degree. C. for 30 minutes, and finally cooled to room
temperature (about 23.degree. C.) for 30 minutes before reading
fluorescence at room temperature. These thermal step procedures
promoted interaction between the probe and the target
polynucleotide in the samples that included a target
polynucleotide. Fluorescence measurements were carried out using a
FLUOROSKAN ASCENT fluorometer (Labsystems, Inc.; Franklin, Mass.)
at a 530 nm wavelength following excitation with light having a
wavelength of 485 nm. Results obtained using the 1093 molecular
beacon established the performance features of an authentic
molecular beacon in this experimental system, and provided a basis
for comparison with the parallel-stem hybridization probe.
[0108] The graphic results presented in FIG. 5A showed that the
1093 molecular beacon exhibited a low level of baseline
fluorescence in the absence of target, as expected. This indicated
that the stem of the molecular beacon was in a "closed"
configuration wherein the fluorophore and quencher moieties were
maintained in close proximity so that fluorescence emission
remained quenched. Increasing signal intensity in the presence of
increasing levels of target represented evidence for binding of the
molecular beacon to its target. Notably, fluorescence signals
across the range of target levels tested were uniformly higher for
trials that included the 1061 target rather than the 1059 target.
This enhanced signal reflected the ability of the 1061 target,
which is complementary to the 1093 molecular beacon over its entire
length, to more effectively separate the fluoropore and quencher
moieties when compared with the 1059 target.
[0109] The graphic results presented in FIG. 5B confirmed that the
1094 parallel-stem hybridization probe interacted with the target
polynucleotide in a manner substantially similar to the molecular
beacon. At low levels of target, the parallel-stem hybridization
probe gave a weak fluorescence signal. However, the fluorescence
signal emitted by the probe increased substantially with increasing
target levels. When compared with the behavior of the standard 1093
molecular beacon, the 1094 parallel-stem hybridization probe had a
slightly higher baseline fluorescence emission in the absence of
target. This may indicate that the parallel stem configuration was
slightly less stable than an antiparallel stem of the same length,
a possibility that would be consistent with observations that the
Tm of the 1094 parallel-stem hybridization probe was lower that the
Tm of the 1093 molecular beacon. Importantly, the difference
between the signal strengths for hybridization with the 1059 and
1061 target polynucleotides was much less pronounced for the
parallel-stem hybridization probe than for the molecular beacon.
This represented further confirmation that the parallel-stem
hybridization probe exhibited hybridization behavior that was
substantially independent of the target sequence outside the region
hybridized by the target-complementary loop region.
[0110] The information presented in FIG. 5C highlights one of the
functional differences between the parallel-stem hybridization
probe and the conventional molecular beacon. The signal-to-noise
ratios (S/N) for the two probes as a function of 1059 target
polynucleotide concentration were calculated by dividing the
background-subtracted fluorescence signals measured for samples
containing a probe and target by the background-subtracted
fluorescence measured for each sample in the absence of a target
polynucleotide. All of the data appearing in FIG. 5C was derived
from the information that appears in FIGS. 5A and 5B. Inspection of
the graph in FIG. 5C indicates that the S/N values for the
molecular beacon strongly depended on the concentration of target
polynucleotide over the range of concentrations tested in the
procedure. In contrast, the parallel-stem hybridization probe
exhibited S/N values that were substantially independent of target
polynucleotide concentration over a wide concentration range. Thus,
parallel-stem hybridization probes are well suited for use in
qualitative assays that deliver a positive signal of substantially
uniform strength over a wide range of analyte concentrations.
[0111] The unique properties of parallel-stem hybridization probes
were further investigated by analyzing both the raw fluorescence
signals and the calculated S/N ratios for parallel-stem
hybridization probes and molecular beacons when used alone or in
combination with each other, at different probe concentrations, and
across a range of target polynucleotide concentrations.
[0112] Example 3 describes the methods used to demonstrate that
parallel-stem hybridization probes and the molecular beacons
displayed quantitatively different properties in hybridization
assays. Notably, the parallel-stem hybridization probe yielded
substantially constant signal production and signal-to-noise ratios
when hybridized with target polynucleotides above a threshold level
that was exceedingly low. As indicated below, the parallel-stem
hybridization probe may be combined with a molecular beacon
directed to the same target and used for "tuning" the S/N value of
a hybridization signal without substantially compromising the
magnitude of the fluorescence hybridization signal.
EXAMPLE 3
Parallel-Stem Hybridization Probes and Molecular Beacons Exhibit
Different Functional Characteristics in Hybridization Assays
[0113] Samples containing the 1093 molecular beacon, the 1094
parallel-stem hybridization probe, or a combination of these two
probes were hybridized at one of several probe concentrations with
0-0.3 .mu.M of the 1059 target polynucleotide essentially as
described above. Samples containing the 1093 molecular beacon had
probe concentrations of either 0.1 .mu.M, 0.15 .mu.M, 0.2 .mu.M,
0.25 .mu.M or 0.3 .mu.M. Samples containing the 1094 parallel-stem
hybridization probe had probe concentrations of 0.05 .mu.M, 0.1
.mu.M, 0.15 .mu.M or 0.2 .mu.M. Samples containing both the
molecular beacon and the parallel-stem hybridization probe all had
total probe concentrations of 0.3 .mu.M, with different proportions
of this total being due to each of the two probes. In all cases
background fluorescence measurements from buffer controls were
subtracted from the fluorescence signals measured for each sample.
Corrected S/N values were calculated as described in the previous
Example.
[0114] The results presented in FIGS. 6A-F confirmed that the
parallel-stem hybridization probe and the molecular beacon
exhibited fundamentally different behaviors in hybridization
assays. FIG. 6A shows the corrected fluorescence signals for
different concentrations of the 1093 molecular beacon following
hybridization across a range of target polynucleotide
concentrations. The magnitudes of the fluorescence signals clearly
paralleled the amount of probe that was present in each sample.
Thus, samples containing higher amounts of the molecular beacon
yielded stronger signals than samples containing lower amounts of
the probe across the range of target concentrations. The same trend
was observed in samples containing the 1094 parallel-stem
hybridization probe, as indicated by the results appearing in FIG.
6C. However, in contrast with samples containing the molecular
beacon, samples containing the parallel-stem hybridization probe
yielded maximum fluorescent signals in a more abrupt fashion
wherein a constant signal strength (reflected by the substantially
horizontal portions of each curve) was achieved in a manner
dependent on both the probe and target polynucleotide
concentrations. This indicated that the ultimate S/N value for a
hybridization assay employing a parallel-stem hybridization probe
could be manipulated by adjusting the amount of probe used in the
procedure. FIG. 6E showed that the quantitative relationship
between the concentration of target polynucleotide and the
fluorescent signal produced in samples containing a combination of
the parallel-stem hybridization probe and the molecular beacon was
fully independent of the proportion of the each probe in the
composition. More specifically, virtually identical results were
achieved for samples containing 100%, 83%, 66%, 50% or 33% of total
probe as molecular beacon with the remaining proportion being
represented by the parallel-stem hybridization probe. This result
could not have been derived by the simple addition of data points
appearing in FIGS. 6A and 6C.
[0115] FIGS. 6B, 6D and 6F show the signal-to-noise ratios for the
data presented in FIGS. 6A, 6C and 6E, respectively. FIG. 6B shows
that the series of curves obtained in procedures using the 1093
molecular beacon had different initial slopes and different, but
closely related values at the maximum target concentration that was
tested in the procedure. In contrast, FIG. 6D shows that the curves
generated using the data obtained for the parallel-stem
hybridization probe had a different character. More particularly,
these curves differed from each other in their initial slopes, but
not in their maximum values at the highest target polynucleotide
concentration used in the procedure. Additionally, when compared
with results obtained using the molecular beacon, the maximum S/N
values obtained using the parallel-stem hybridization probe were
achieved at relatively low target polynucleotide concentrations.
Thus, the parallel-stem hybridization probe achieved a
substantially maximum S/N value at a low level of target
polynucleotide, and then maintained that S/N value over a broad
range of target concentrations. Finally, FIG. 6F shows how a family
of distinct S/N curves could be obtained when the molecular beacon
and parallel-stem hybridization probe were used in combination for
hybridizing a target polynucleotide. Significantly, the features of
the curves in FIG. 6F were clearly different from those shown for
either of the two probe types when used alone. These results
established that the parallel-stem hybridization probe differed
markedly in its properties from the molecular beacon.
[0116] The rapid increases followed by substantially flat portions
of the curves obtained using parallel-stem hybridization probes
suggested certain utilities for this species of probe. For example,
parallel-stem hybridization probes may be employed in qualitative
hybridization assays wherein positive signals of substantially
constant magnitude are desirable over a broad range of target
concentrations. The conventional molecular beacon would not be
suited for this application because the magnitudes of the
fluorescence signal and the S/N value strongly depended on the
amount of target polynucleotide that was present in the
hybridization mixture. In contrast, the parallel-stem hybridization
probe was capable of delivering substantially uniform signals for
both high and low levels of target polynucleotide that exceed a
particular minimum threshold.
[0117] Immobilized parallel-stem hybridization probes may also be
used in connection with nucleic acid amplification assays for
quantifying analyte polynucleotides in test samples. In some
applications, such as a microarray of immobilized self-reporting
parallel-stem hybridization probes and molecular beacons, the
hybridization signal detected from the immobilized parallel-stem
hybridization probe may provide a reference for comparison with the
signal from the molecular beacon. Quantitative information about
the amount of analyte polynucleotide in the sample may then be
derived from that comparison. When the two probes are both directed
against the same analyte polynucleotide target, and when the amount
of analyte polynucleotide in the test sample exceeds a certain
minimum threshold needed to produce a constant signal strength from
the parallel-stem hybridization probe, then the signal from the
parallel-stem hybridization probe will represent a substantially
constant baseline for comparison with the signal produced by the
molecular beacon.
[0118] To more fully illustrate the range of variables that may be
changed without compromising the basic nature of the parallel-stem
hybridization probe, another probe was prepared and tested. This
additional probe employed a different inversion linkage that gave
rise to a probe having two 5' ends instead of two 3' ends, and had
a different stem sequence and length. In addition, this new
parallel-stem hybridization probe did not contain nucleobase
analogs, and was directed to a different polynucleotide target
sequence. This additional probe, named 1262, had the structure: 5
'-DABCYL-AAAAAAAAAAAAGCAGGATGAAGAGGAA-3'-3'-TTTTTTTTTTTT-Fluorescein-5'
(SEQ ID NO:8). Notably, the 1262 probe included a 3'-3' inversion
linkage and had a parallel-stem duplex consisting of conventional
A:T base pairing. As indicated above, A:T base pairs may
participate in either parallel or antiparallel duplex formation.
The presence of the inversion linkage in this probe forced the
parallel stranded conformation. In contrast to the 1094
parallel-stem hybridization probe, the fluorophore label on the
1262 probe was linked to the terminus of the inversion arm instead
of the terminus of the extension arm. A related probe with a
conventional molecular beacon configuration was named 1261 and had
the structure:
5'-DABCYL-AAAAAAAAAAAAGCAGGATGAAGAGGAATTTTTTTTTTTT-Fluorescein-3'
(SEQ ID NO:6). The 1261 probe had a sequence identical to the
sequence of the 1262 probe, but did not include an inversion
linkage. Underlined nucleotides in the probe sequences indicate
residues that participated in the formation of stem duplexes. The
target-complementary sequence of bases in the loop portions of the
1261 and 1262 probes is given by GCAGGATGAAGAGGAA (SEQ ID NO:10).
Notably, the probes and target used in these procedures were
entirely made of DNA. Finally, the methyl group on the thymine base
located at position 19 in each of the two probes was carboxylated
to provide a means for surface-immobilizing the probes. As
indicated in the following Example, and despite changes in all of
these variables, the 1262 parallel-stem hybridization probe
functioned as a self-reporting hybridization probe having a
stem-and-loop structure.
[0119] Example 4 describes the methods used to explore the range of
structural variables that could be changed while still maintaining
the functional features of a parallel-stem hybridization probe.
Notably, the model target sequence employed in the following
procedure was a hepatitis B virus polynucleotide sequence.
EXAMPLE 4
Parallel-Stem Hybridization Probe Having a Parallel-Stranded Duplex
Composed of Conventional Nucleobases
[0120] The 1261 molecular beacon and the 1262 parallel-stem
hybridization probe were synthesized using the procedures described
above. Similarly, a synthetic DNA target polynucleotide named 1269,
and having the sequence
5'-GTCTGCGGCGTTTTATCATATTCCTCTTCATCCTGCTGCTATGCCTCATCTTCTTAT-3'
(SEQ ID NO:7), also was synthesized using conventional techniques
that will be familiar to those having an ordinary level of skill in
the art. The 1269 target was complementary to the 1261 and 1262
probes as indicated in FIG. 7.
[0121] Melting curves for the two probes individually or in
combination with the DNA target were produced to assess
probe:target interactions essentially as described under Example 1.
Again, the first derivative of the curve plotted on a graph of
absorbance against temperature was used to pinpoint the inflection
points which represented the Tm values. Results of these procedures
are presented in Table 2.
[0122] The ability of the 1262 parallel-stem hybridization probe to
function as a self-reporting probe was assessed by monitoring
fluorescence emission in the presence and absence of the
complementary 1269 target polynucleotide. As a control,
fluorescence emission by the 1261 molecular beacon also was
measured in the presence and absence of the target polynucleotide.
The 1262 and 1261 probes (0.3 .mu.M each) in TENT buffer were
either tested alone or combined with the 1269 target polynucleotide
over a range of 0-3 .mu.M and tested for fluorescence emission
essentially as described in Example 2. Results of these procedures
are presented graphically in FIG. 8.
[0123] The results presented in Table 2 and in FIG. 8 showed that
the 1262 parallel-stem hybridization probe hybridized to the 1269
target polynucleotide in a manner consistent with the functionality
of a self-reporting molecular beacon. The Tm value for the 1262
parallel-stem hybridization probe was somewhat lower than the Tm of
the 1261 molecular beacon, as expected. This trend was repeated in
the results obtained for each of the probes when hybridized with
the target polynucleotide. FIG. 8 shows that the 1261 molecular
beacon exhibited a low level of background fluorescence in the
absence of target polynucleotide, and that fluorescence emission
increased with increasing levels of target. As expected, the
molecular beacon was in a closed conformation in the absence of
target, but transitioned to the open conformation upon target
binding. Similarly, the 1262 parallel-stem hybridization probe
exhibited a low level of background fluorescence in the absence of
a complementary target polynucleotide. Like the 1261 molecular
beacon, the fluorescence from the 1262 parallel-stem hybridization
probe increased when contacted with increasing amounts of the
complementary polynucleotide target. These features of the 1262
probe confirmed the general utility of parallel-stem hybridization
probes as self-reporting probes having stem-and-loop structures.
TABLE-US-00002 TABLE 2 Quantifying Probe: Target Interactions Tm at
260 nm Probe Features (in .degree. C.) Probe Name 1261 Molecular
Beacon 47.9 1262 Parallel-Stem Hybridization Probe 36.9
Probe/Target 1261/1269 Molecular Beacon 48.4 1262/1269
Parallel-Stem Hybridization Probe 41.4
[0124] The foregoing results demonstrated that a stem-and-loop
hybridization probe can have an arm structure with a backbone
polarity opposite the polarity of a target-complementary loop
sequence, and that an inverted arm structure was substantially
precluded from interacting with the target, even when the
nucleobase sequences of the arm and the target had a complementary
order. Thus, a single inversion linkage positioned between one of
the probe termini and the target-complementary sequence of the
probe was sufficient to inhibit interactions between the target and
the inverted arm of the probe.
[0125] The following illustration demonstrated that a stem-and-loop
hybridization probe having two inversion linkages, one flanking
each end of the target-complementary sequence of the probe,
transitioned from a closed state to an open state following
interaction with an appropriate target. It necessarily follows from
this observation that the stem structure, which was composed of the
interactive arm pair of the dual inversion probe, must have formed
by conventional antiparallel base pairing. Importantly, the
nucleobase sequences located between each of the two probe termini
and the adjacent inversion linkage (i.e., the nucleobase sequence
of the two arms of the probe) have the same backbone polarity, but
a polarity opposite that of the target-complementary sequence that
is contained within the dual inversion probe. Taken together with
the fact that inversion arms are substantially incapable of
interacting with the target, each arm of the dual inversion probe
advantageously was substantially precluded from interacting with
the target.
[0126] Eight different self-reporting constructs were created to
illustrate the utility of dual inversion probes. Each of the probe
constructs included a DABCYL quencher moiety at one probe terminus
and a fluorescein fluorophore moiety at the opposite probe
terminus. The structures of oligonucleotides, including probes and
synthetic target molecules, that were used for demonstrating the
utility of dual inversion probes are presented in Tables 3-6.
TABLE-US-00003 TABLE 3 Oligonucleotides Used for Illustrating the
Utility of Dual Inversion Probes (Pan-Bacterial Probes and Targets)
SEQ Oligo ID Name Sequence NO: 1521
5'-[F]-CCGAGGACCGACAAGGAAUUUCGCGTCCTCGG- 11 [D]-3' 1522
5'-[D]-GGCTCCTG-3'-3'-CGCUUUAAGGAACAGC- 12 5'-5'-CAGGAGCC-[F]-3'
1254 5'-GGCCGUACCUAUAACGGUCCUAAGGUAGCGAAAUUC 13
CUUGUCGGGUAAGUUCCGACCUGCAC-3' 1523
5'-GGCCGUACCUAUAACGGUCCCGAGGACGCGAAAUUC 14
CUUGUCGGUCCUCGGCCGACCUGCAC-3' [F]represents fluorescein
[D]represents DABCYL
[0127] TABLE-US-00004 TABLE 4 Oligonucleotides Used for
Illustrating the Utility of Dual Inversion Probes (Pan-Fungal
Probes and Targets) SEQ Oligo ID Name Sequence NO: 1531
5'-[F]-CCGAGGACGUCUGGACCUGGUGAGUUUCCCGT 15 CCTCGG-[D]-3' 1532
5'-[D]-GGCTCCTG-3'-3'-CCCUUUGAGUGGUCCAG 16
GUCUG-5'-5'-CAGGAGCC-[F]-3' 1307
5'-CUGCGGCUUAAUUUGACUCAACACGGGGAAACUCAC 17
CAGGUCCAGACACAAUAAGGAUUGACAGAUUGAGAGC UC-3' 1533
5'-CUGCGGCUUAAUUUGACCCGAGGACGGGAAACUCAC 18
CAGGUCCAGACGUCCUCCGGAUUGACAGAUUGAGAGC UC-3' [F]represents
fluorescein [D]represents DABCYL
[0128] TABLE-US-00005 TABLE 5 Oligonucleotides Used for
Illustrating the Utility of Dual Inversion Probes
(Enterobacteriaceae Probes and Targets) SEQ Oligo ID Name Sequence
NO: 1541 5'-[F]-CCGAGGACCCGCUUGCUCUCGCGAGGTCCTCG 19 G-[D]-3' 1542
5'-[D]-GGCTCCTG-3'-3'-GAGCGCUCUCGUUCGC 20 C-5'-5'-CAGGAGCC-[F]-3'
1317 5'-GGGCUACACACGUGCUACAAUGGCGCAUACAAAGAG 21
AAGCGACCUCGCGAGAGCAAGCGGACCUCAUAAAGUGCG UCGUAGUCCGG-3' 1543
5'-GGGCUACACACGUGCUACAAUGGCGCAUACAAAGAC 22
CGAGGACCUCGCGAGAGCAAGCGGGUCCUCGGAAGUGCG UCGUAGUCCGG-3'
[F]represents fluorescein [D]represents DABCYL
[0129] TABLE-US-00006 TABLE 6 Oligonucleotides Used for
Illustrating the Utility of Dual Inversion Probes (Gram Positive
Bacterial Probes and Targets) SEQ Oligo ID Name Sequence NO: 1551
5'-[F]-CCGAGGACGAGGGAACCUUUGGGCGCGTCCTC 23 GG-[D]-3' 1552
5'-[D]-GGCTCCTG-3'-3'-CGCGGGUUUCCAAGGGA 24 G-5'-5'-CAGGAGCC-[F]-3'
1327 5'-UGGGGCGGUUGCCUCCUAAAGAGUAACGGAGGCGCC 25
CAAAGGUUCCCUCAGCCUGGUCGGCAAUCAGGUGUU-3' 1553
5'-UGGGGCGGUUGCCUCCUAAAGAGCCGAGGACGCGCC 26
CAAAGGUUCCCUCGUCCUCGGCGGCAAUCAGGUGUU-3' [F]represents fluorescein
[D]represents DABCYL
[0130] Each of the entries shown in Tables 3-6 served either as a
molecular beacon probe, a dual inversion probe, an RNA target
containing a natural sequence complementary to the loop portions of
the probes, or an RNA target made complementary to both the loop
portions and the arm sequences of the probes. The 1521
pan-bacterial rRNA specific molecular beacon had arms 8 base pairs
long with a deoxy backbone, and a target-complementary 2'-OMe loop
that was 16 bases long. The 1522 pan-bacterial rRNA specific dual
inversion probe had arms 8 base pairs long with a deoxy backbone,
and a target-complementary 2'-OMe loop that was 16 bases long. The
1254 62-mer synthetic RNA target was used for hybridizing the
pan-bacterial specific probes. The 1523 target oligonucleotide was
essentially the same as the 1254 oligonucleotide except that the
sequence flanking the probe-complementary sequence of 1254 was
exactly complementary to the arm sequences of the 1521
pan-bacterial molecular beacon. The 1531 pan-fungal rRNA specific
molecular beacon had arms 8 base pairs long with a deoxy backbone,
and a target-complementary 2'-OMe loop that was 22 bases long. The
1532 pan-fungal rRNA specific dual inversion probe had arms 8 base
pairs long with a deoxy backbone, and a target-complementary 2'-OMe
loop that was 22 bases long. The 1307 oligonucleotide was a 75-mer
synthetic RNA target that was used for hybridizing pan-fungal
probes. The 1533 oligonucleotide was essentially the same as the
1307 oligonucleotide except that the sequence flanking the
probe-complementary sequence of 1307 was exactly complementary to
the arm sequences of the 1531 pan-fungal molecular beacon. The 1541
oligonucleotide was an Enterobacteriaceae rRNA specific molecular
beacon that had arms 8 base pairs long with a deoxy backbone, and a
target-complementary 2'-OMe loop that was 17 bases long. The 1542
Enterobacteriaceae rRNA specific dual inversion probe had arms 8
base pairs long with a deoxy backbone, and a target-complementary
2'-OMe loop that was 17 bases long. The 1317 oligonucleotide was an
86-mer synthetic RNA target that was used for hybridizing
Enterobacteriaceae-specific probes. The 1543 oligonucleotide was
essentially the same as the 1317 oligonucleotide except that the
sequence flanking the probe-complementary sequence of 1317 was
exactly complementary to the arm sequences of the 1541
Enterobacteriaceae molecular beacon. The 1551 molecular beacon had
binding specificity for the rRNA of Gram positive bacteria, and a
structure having arms 8 base pairs long with a deoxy backbone, and
a target-complementary 2'-OMe loop that was 18 bases long. The 1552
dual inversion probe had binding specificity for the rRNA of Gram
positive bacteria, and a structure having arms 8 base pairs long
with a deoxy backbone, and a target-complementary 2'-OMe loop that
was 18 bases long. The 1327 oligonucleotide was a 72-mer synthetic
RNA target, having a sequence derived from Micrococcus luteus, that
was used for hybridizing probes specific for the rRNA of Gram
positive bacteria. The 1553 oligonucleotide was essentially the
same as the 1327 oligonucleotide except that the sequence flanking
the probe-complementary sequence of 1327 was exactly complementary
to the arm sequences of the 1551 Gram positive molecular beacon
probe.
[0131] The use of two different targets for hybridizing each of the
molecular beacons and corresponding dual inversion probes provided
a means for establishing functional differences between the two
types of hybridization probe. More particularly, each of the probes
listed in Tables 3-6 was hybridized with one of two different
synthetic target oligonucleotides, also listed in the tables. The
first target contained a sequence complementary to the
target-complementary loops of the corresponding probes, but not to
the flanking arm sequences. The second target further contained
sequences fully complementary to the arm sequences of the molecular
beacon. Although the bases in these flanking sequences were ordered
to be complementary to the arm sequences of the corresponding dual
inversion probes, those arm sequences were precluded from
interacting with the second target because the polarity of the
backbone was reversed. Thus, where the loops of both of the probes
were able to interact with the first oligonucleotide target, the
arms of only the molecular beacon, and not the arms of the dual
inversion probe, were additionally able to hybridize over their
lengths with the second target. Differential interactions of the
two probes with the second target reflected the differential
ability of the arm structures of the molecular beacon and the dual
inversion probe to interact with the target.
[0132] Example 5 describes the methods used to demonstrate that
target polynucleotide hybridization caused dual inversion probes to
transition from closed conformations to open conformations that
were detectable by fluorescent emissions.
Example 5
Binding to Target Polynucleotide Triggers Signaling by Dual
Inversion Probes
[0133] The molecular beacon and dual inversion probes listed in
Tables 3-6 were hybridized to corresponding synthetic RNA targets,
also presented in the tables. All probes were synthesized by solid
phase phosphite triester chemistry using either DABCYL-linked
controlled pore glass and 5' fluorescein-labeled phosphoramidite,
or fluorescein-linked controlled pore glass and 5' DABCYL-labeled
phosphoramidite on a Perkin-Elmer (Foster City, Calif.) EXPEDITE
model 8909 automated synthesizer and methods that will be familiar
to those having an ordinary level of skill in the art. The 5'-5'
and 3'-3' inversion linkages incorporated into the dual inversion
probes were created using reagents obtained from Glen Research
Corporation (Sterling, Va.), Proligo (Boulder, Colo.) or Pierce
Biotechnology (Rockford, Ill.). All probes were constructed using
2'-methoxy ribonucleotide analogs in their target-complementary
loop regions, and 2'-deoxyribonucleotides in their arm regions.
Notably, other dual inversion probes directed to different targets
were prepared using 2'-deoxoribonucleotides in their
target-complementary loop regions and then used with success.
Accordingly, the target-complementary loop region and arm portions
of dual inversion probes may contain standard nucleotides,
nucleotide analogs, or even mixtures of standard nucleotides and
nucleotide analogs. Following synthesis, the probes were
deprotected and cleaved from the solid support matrix and then
purified using polyacrylamide gel electrophoresis followed by HPLC
according to procedures that will be familiar to those having an
ordinary level of skill in the art.
[0134] Individual samples containing either one of the molecular
beacon probes or one of the dual inversion probes and one of the
two corresponding target molecules were hybridized and monitored
for fluorescence emission. For example, to monitor and compare the
activities of the 1521 pan-bacterial molecular beacon and 1522
pan-bacterial dual inversion probe, samples of each of these probes
were combined separately with the 1254 and 1523 targets (i.e., a
total of four hybridization reactions). Similar combinations were
used for measuring the activities of the probes specific for the
pan-fungal, Enterobacteriaceae, and Gram positive bacterial
targets. The concentrations of probes used in these procedures were
held constant at 0.3 .mu.M while the concentrations of the targets
varied from 0-3 .mu.M. Hybridization reactions were carried out in
a solution of TENL buffer (50 mM Tris-HCl (pH 8.0), 50 mM NaCl, 0.1
mM EDTA, 0.1% lithium lauryl sulfate). In all instances the
mixtures were heated to 60.degree. C. for 30 minutes, cooled to
42.degree. C. for 30 minutes, and finally cooled to room
temperature (about 23.degree. C.) for 30 minutes before reading
fluorescence at room temperature. Fluorescence measurements were
again carried out using the FLUOROSKAN ASCENT fluorometer
(Labsystems, Inc.; Franklin, Mass.) at a 530 nm wavelength
following excitation with light having a wavelength of 485 nm.
"Background" fluorescence was determined as the fluorescent signal
measured by the instrument in the absence of any probe or target.
"Signal" in this system is represented by the magnitude of the
fluorescent emission. "Background-subtracted fluorescent signals"
were calculated by subtracting background fluorescence from the
measured signals. "Noise" in the system represented the magnitude
of the fluorescent signal measured for labeled probe in the absence
of any target. "Background-subtracted signal-to-noise" (corrected
S/N) ratios were calculated by dividing background-subtracted
fluorescent signals by the value of background-subtracted noise
[(signal-background)/(noise-background)]. These procedures
established the performance characteristics of authentic molecular
beacons in this experimental system, and provided a basis of
comparison for each of the dual inversion probes.
[0135] The results presented in FIGS. 11A-D indicated that the dual
inversion probes and corresponding molecular beacons showed
qualitatively similar behaviors. The graphical presentation of
corrected S/N shown in the figures represents interactions between
the various probes and corresponding targets that were not fully
complementary to the arm sequences of the molecular beacons. The
graphs clearly show that each of the probes exhibited increased
fluorescence following hybridization to the target oligonucleotide.
This was consistent with an expected transition from a closed state
to an open state following interaction with a complementary target,
as would result from the physical separation of the fluorophore and
quencher moieties due to opening of a stem structure that was
closed in the absence of target. Interestingly, the corrected S/N
values for the dual inversion probes were uniformly somewhat lower
than the corrected S/N values for the corresponding molecular
beacons. The coefficients of variation (n=6) of the combined noise
levels for the molecular beacons and corresponding dual inversion
probes used in these procedures were 2.5%, 3.4%, 12.9% and 11.7%
for the pan-bacterial, pan-fungal, Enterobacteriaceae and Gram
positive probes, respectively. Notably, the levels for the
pan-bacterial probes and pan-fungal probes were virtually
identical. This showed that dual inversion probes did not exhibit
substantially different background fluorescence than corresponding
molecular beacons in the absence of target, and suggested that
relative differences in the corrected S/N values for molecular
beacons and dual inversion probes reflected differences in the
physical properties and hybridization characteristics of the two
probe species.
[0136] Results from these procedures also confirmed that dual
inversion probes did not preferentially interact with target
oligonucleotides having base sequences complementary to the arm
sequences, but with reversed polarity. For example, FIG. 12 shows
background-subtracted fluorescence measurements for each of the
1531 pan-fungal molecular beacon and 1532 dual inversion probe
interacting with either the 1307 conventional target or the 1533
target that included sequences fully complementary to the
target-complementary loop and arm sequences of the molecular
beacon. Notably, some of the same data used to produce the graph
shown in FIG. 12 were also used for producing the graph shown in
FIG. 11B. As will be clear from examining FIG. 12, the molecular
beacon yielded a greater fluorescent signal when hybridized with
the target that was complementary to both the loop and arm
sequences when compared with the conventional target at all target
concentrations that were tested. This presumably reflects either
enhanced probe binding or more effective separation of the
fluorophore and quencher moieties as the result of arm:target
interactions with the fully complementary 1533 target. In contrast,
the corresponding dual inversion probe interacted substantially
identically with both of the targets. Indeed, none of the four dual
inversion probes tested in this procedure interacted more strongly
with the targets that were fully complementary to the corresponding
molecular beacons. However, the pan-fungal and pan-bacterial
molecular beacons showed markedly enhanced fluorescence when
hybridized with the fully complementary targets. The Gram positive
molecular beacon showed substantially no preference for one target
over the other, while the Enterobacteriaceae-specific molecular
beacon showed a slight decrease in the fluorescent signal with the
fully complementary target, a result that may not be statistically
significant.
[0137] The data trend clearly established that dual inversion
probes did not interact more strongly with targets having a single
backbone polarity and base sequence complementary to the arm
sequences of corresponding molecular beacons. However, it was
common for molecular beacons to exhibit enhanced interactions with
targets that included sequences complementary to the sequences of
the arms. These conclusions were fully consistent with the results
and conclusions discussed above in connection with parallel-stem
hybridization probes.
[0138] Several different self-reporting constructs were created to
illustrate the utility of dual inversion probes that included a
chemical linker at the position of one or both of the inversion
linkages. Each of the constructs included a DABCYL quencher moiety
at the 5' terminus, a fluorescein fluorophore at the 3' terminus,
and included a target-complementary loop sequence specific for
HIV-1. The 1501 probe was substantially the same as the
above-described 1093 conventional molecular beacon, but omitted the
non-nucleotide linker contained within the target-complementary
sequence. The 1502 construct was a standard dual inversion probe.
The remaining constructs were dual inversion probes that included
one of two different chemical linker moieties interposed between
the target-complementary loop and the arm sequences of the probe.
In these constructs the inversion linkage is said to include the
chemical linker moiety because the linker is neither part of the
loop nor part of the arm, but is instead part of the linkage that
joins the loop and arm sequences of the probe. The 3'-3' inversion
linkage of the 1503 probe included an aliphatic 3 carbon ("propyl")
linker having the structure --(CH.sub.2).sub.3--. The carbon atoms
of the propyl linker essentially duplicate the spacing of the three
carbon atoms that are typically positioned between the 3' and 5'
oxygen atoms of a ribose or deoxyribose moiety that comprises a
polynucleotide backbone. The 5'-5' inversion linkage of the 1504
probe similarly included a propyl linker. The 3'-3' inversion
linkage of the 1505 probe included an 8 atom "triethylene glycol"
linker having the structure
--(CH.sub.2).sub.2O(CH.sub.2).sub.2O(CH.sub.2).sub.2--. The 5'-5'
inversion linkage of the 1506 probe included a triethylene glycol
linker. Both the 3'-3' and 5'-5' inversion linkages of the 1507
probe included propyl linkers. Both the 3'-3' and 5'-5' inversion
linkages of the 1508 probe included triethylene glycol linkers. The
structures of the various probes are presented in Table 7.
Nucleobase sequences corresponding to the arm portions of the
probes are underlined in the table. TABLE-US-00007 TABLE 7
Oligonucleotides Used for Illustrating the Utility of Inversion
Probes Having Inversion Linkages that Include Chemical Linkers SEQ
Oligo ID Name Sequence NO: 1501
5'-[D]-GGTGTGGGGUACAGUGCAGGGGCACACC- 27 [F]-3' 1502
5'-[D]-GGTGTG-3'-3'-GGGUACAGUGCAGGGG- 28 5'-5'-CACACC-[F]-3' 1503
5'-[D]-GGTGTG-3'-linker-3'-GGGUACAGUG 29 CAGGGG-5'-5'-CACACC-[F]-3'
1504 5'-[D]-GGTGTG-3'-3'-GGGUACAGUGCAGGGG- 30
5'-linker-5'-CACACC-[F]-3' 1505
5'-[D]-GGTGTG-3'-linker-3'-GGGUACAGUGCA 31 GGGG-5'-5'-CACACC-[F]-3'
1506 5'-[D]-GGTGTG-3'-3'-GGGUACAGUGCAGGGG- 32
5'-linker-5'-CACACC-[F]-3' 1507
5'-[D]-GGTGTG-3'-linker-3'-GGGUACAGUGCA 33
GGGG-5'-linker-5-CACACC-[F]-3' 1508
5'-[D]-GGTGTG-3'-linker-3'-GGGUACAGUGCA 34
GGGG-5'-linker-5'-CACACC-[F]-3' [F]represents fluorescein
[D]represents DABCYL
[0139] Example 6 describes the methods used to demonstrate that
dual inversion probes which included at least one chemical linker
at the position of the inversion linkage transitioned from a closed
conformation to an open conformation following hybridization with a
target polynucleotide.
Example 6
Signaling by Dual Inversion Probes Containing Inversion Linkages
that Include Chemical Linkers
[0140] The probes presented in Table 7 were hybridized to synthetic
targets that had been prepared using 2'-OMe nucleotide analogs
instead of ribonucleotides, a change that helped ensure chemical
stability of the targets while having substantially no effect on
the outcome of experimental results. Accordingly, the results
obtained in studies using dual inversion probes and parallel-stem
hybridization probes were expected to be directly comparable. As in
Example 1, all dual inversion probes were synthesized by solid
phase phosphite triester chemistry using DABCYL-linked controlled
pore glass and 5' fluorescein-labeled phosphoramidite on a
Perkin-Elmer (Foster City, Calif.) EXPEDITE model 8909 automated
synthesizer and methods that will be familiar to those having an
ordinary level of skill in the art. The 5'-5' and 3'-3' inversion
linkages incorporated into the dual inversion probes were created
using reagents obtained from Glen Research Corporation (Sterling,
Va.). "SPACER C3" phosphoramidite
(3-(4,4'-dimethoxytrityloxy)propyl-1-[(2-cyanoethyl)-(N,N-diisopropyl)]-p-
hosphoramidite) and "SPACER 9" phosphoramidite
(9-O-dimethoxytrityl-triethylene
glycol,1-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite), which
were used for introducing the propyl and triethylene glycol
chemical linkers, respectively, also were purchased from Glen
Research Corporation. All probes were constructed using 2'-methoxy
ribonucleotide analogs in their target-complementary loop regions,
and 2'-deoxyribonucleotides in their stem regions. Following
synthesis, the probes were deprotected and cleaved from the solid
support matrix and then purified using polyacrylamide gel
electrophoresis followed by HPLC, all according to procedures that
will be familiar to those having an ordinary level of skill in the
art.
[0141] The probes were hybridized to appropriate targets and
assayed for binding by monitoring fluorescent signal production.
More specifically, the 1501 molecular beacon was hybridized to a
1510 target polynucleotide synthesized using 2'-OMe RNA analogs and
having the sequence 5'-UAGGUGUGCCCCUGCACUGUACCCCACACCU-3' (SEQ ID
NO:35). All of the dual inversion probes were hybridized to a 1511
target polynucleotide synthesized using 2'-OMe RNA analogs and
having the sequence 5'-UCCACACCCCAUGUCACGUCCCCGUGUGGAU-3' (SEQ ID
NO:36). In these procedures the concentrations of the probes were
held constant at 0.3 .mu.M, while the concentrations of the target
varied from 0-3 .mu.M. In all instances the mixtures were heated in
TENT buffer to 60.degree. C. for 30 minutes, cooled to 42.degree.
C. for 30 minutes, and finally cooled to room temperature (about
23.degree. C.) for 30 minutes before reading fluorescence at room
temperature. Fluorescence measurements were again carried out using
the FLUOROSKAN ASCENT fluorometer (Labsystems, Inc.; Franklin,
Mass.) at a 530 nm wavelength following excitation with light
having a wavelength of 485 nm. The thermal step procedures promoted
interaction between the probe and the target polynucleotide in the
samples that included a target polynucleotide. Results obtained
using the 1501 molecular beacon established the performance
features of an authentic molecular beacon in this experimental
system, and provided a basis of comparison for each of the dual
inversion probes.
[0142] The graphic results presented in FIG. 13 demonstrated that
probes containing inversion linkages which included optional
chemical linkers transitioned from a closed state to an open state
following hybridization to a complementary target polynucleotide.
More specifically, each of the probes tested in this procedure gave
increasingly high corrected S/N levels that plateaued when
hybridized with increasing concentrations of a complementary
target. Notably, in this procedure the 1501 conventional molecular
beacon showed the least dramatic difference in signal strength
between the closed and opened configurations, the conventional dual
inversion probe gave the most dramatic differences, and the dual
inversion probes that included a chemical linker at the position of
at least one of the inversion linkages gave intermediate levels of
signaling. This proved that one or more non-nucleotide linkers
could be included in the backbone of an inversion probe while
allowing the probe to hybridize to a target polynucleotide and
transition from a closed state to an open state.
[0143] In addition to non-nucleotide linkers that are unlabeled,
such as the propyl and triethylene glycol linkers employed in the
foregoing Example, other non-nucleotide linkers, including
detectably labeled non-nucleotide linkers, can be included in the
structures of parallel-stem hybridization probes and dual inversion
probes. More particularly, labeled or unlabeled non-nucleotide
linkers can be joined to either or both of the arm structures, to
the target-complementary loop structures, or even at the positions
of one or both of the inversion linkages of the invented probes. In
certain preferred embodiments the inversion probe includes at least
one inversion linkage that includes a non-nucleotide linker. Even
more preferably, the non-nucleotide linker includes a detectable
label so that the probe, once hybridized to a complementary target
polynucleotide, can be detected. For example, the chemical linker
may include in its structure a radioactive atom, such as a
.sup.32P, .sup.14C or .sup.3H atom, which can be detected using
techniques that will be familiar to those having an ordinary level
of skill in the art. Alternatively, the chemical linker can be
joined to a chemiluminescent label, such as an acridinium ester
label of the type described herein above.
[0144] In a highly preferred embodiment the chemical linker is a
non-nucleotide linker of the type described by Arnold et al., in
U.S. Pat. No. 6,031,091, the disclosure of this patent document
being incorporated by reference herein. This patent document
particularly discloses how to make and use phosphoramidites for
incorporating non-nucleotide linkers into the structure of
synthetic polynucleotides, and further discloses how to attach
detectable labels, including chemiluminescent and fluorescent
moieties, to the non-nucleotide linker. The structure of highly
preferred non-nucleotide linker phosphoramidites that can be used
for preparing inversion probes containing non-nucleotide linkers
are described in Example 3(C) and in FIG. 5a of the Arnold patent.
Thus, inversion probes optionally may include non-nucleotide
linkers, and these non-nucleotide linkers may be detectably labeled
non-nucleotide linkers. Examples of preferred detectable labels
include chemiluminescent labels, such as acridinium ester labels of
the type disclosed in U.S. Pat. Nos. 5,283,174 and 5,656,207, the
disclosures of these patent documents having been incorporated by
reference herein above. Other examples of preferred detectable
labels include fluorescent labels, such as fluorescein.
Non-nucleotide linkers can be incorporated into any of the loop
region, the arm structures, or even the inversion linkages of the
inversion probes as long as the presence of the linker does not
prevent hybrid formation between the probe and its target
polynucleotide.
[0145] This invention has been described with reference to a number
of specific examples and embodiments thereof. Of course, a number
of different embodiments of the present invention will suggest
themselves to those having ordinary skill in the art upon review of
the foregoing detailed description. Thus, the true scope of the
present invention is to be determined upon reference to the
appended claims.
Sequence CWU 1
1
36 1 28 DNA HIV-1 misc_feature (7)...(22) HIV-1
target-complementary sequence of 2'-OMe analogs 1 ggngnggggu
acagugcagg ggcacacc 28 2 28 DNA HIV-1 misc_feature (7)...(22) HIV-1
target-complementary sequence of 2'-OMe analogs 2 ggngnggggu
acagugcagg ggcacacc 28 3 28 DNA HIV-1 misc_feature (7)...(22) HIV-1
target-complementary sequence of 2'-OMe analogs 3 ggngnggggu
acagugcagg ggnanann 28 4 31 RNA HIV-1 4 uauucuuucc ccugcacugu
accccccaau c 31 5 31 RNA HIV-1 5 uaggugugcc ccugcacugu accccacacc u
31 6 40 DNA Hepatitis B Virus misc_feature (13)...(28) HBV
target-complementary sequence 6 aaaaaaaaaa aagcaggatg aagaggaatt
tttttttttt 40 7 57 DNA Hepatitis B Virus 7 gtctgcggcg ttttatcata
ttcctcttca tcctgctgct atgcctcatc ttcttat 57 8 40 DNA Hepatitis B
Virus misc_feature (13)...(28) HBV target-complementary sequence 8
aaaaaaaaaa aagcaggatg aagaggaatt tttttttttt 40 9 16 RNA HIV-1 9
ggguacagug cagggg 16 10 16 DNA Hepatitis B Virus 10 gcaggatgaa
gaggaa 16 11 32 DNA Artificial Sequence misc_feature (1)...(8) DNA
backbone 11 ccgaggaccg acaaggaauu ucgcgnccnc gg 32 12 32 DNA
Artificial Sequence misc_feature (1)...(8) DNA backbone 12
ggcnccngcg cuuuaaggaa cagccaggag cc 32 13 62 RNA Artificial
Sequence Sequence hybridizes to ribosomal nucleic acids of
pan-bacterial organisms 13 ggccguaccu auaacggucc uaagguagcg
aaauuccuug ucggguaagu uccgaccugc 60 ac 62 14 62 RNA Artificial
Sequence Sequence hybridizes to ribosomal nucleic acids of
pan-bacterial organisms 14 ggccguaccu auaacggucc cgaggacgcg
aaauuccuug ucgguccucg gccgaccugc 60 ac 62 15 38 DNA Artificial
Sequence misc_feature (1)...(8) DNA backbone 15 ccgaggacgu
cuggaccugg ugaguuuccc gnccncgg 38 16 38 DNA Artificial Sequence
misc_feature (1)...(8) DNA backbone 16 ggcnccngcc cuuugagugg
uccaggucug caggagcc 38 17 75 RNA Artificial Sequence Sequence
hybridizes to ribosomal nucleic acids of pan-fungal organisms 17
cugcggcuua auuugacuca acacggggaa acucaccagg uccagacaca auaaggauug
60 acagauugag agcuc 75 18 75 RNA Artificial Sequence Sequence
hybridizes to ribosomal nucleic acids of pan-fungal organisms 18
cugcggcuua auuugacccg aggacgggaa acucaccagg uccagacguc cuccggauug
60 acagauugag agcuc 75 19 33 DNA Artificial Sequence misc_feature
(1)...(8) DNA backbone 19 ccgaggaccc gcuugcucuc gcgaggnccn cgg 33
20 33 DNA Artificial Sequence misc_feature (1)...(8) DNA backbone
20 ggcnccngga gcgcucucgu ucgcccagga gcc 33 21 86 RNA Artificial
Sequence Sequence hybridizes to ribosomal nucleic acids of
Enterobacteriaceae organisms 21 gggcuacaca cgugcuacaa uggcgcauac
aaagagaagc gaccucgcga gagcaagcgg 60 accucauaaa gugcgucgua guccgg 86
22 86 RNA Artificial Sequence Sequence hybridizes to ribosomal
nucleic acids of Enterobacteriaceae organisms 22 gggcuacaca
cgugcuacaa uggcgcauac aaagaccgag gaccucgcga gagcaagcgg 60
guccucggaa gugcgucgua guccgg 86 23 34 DNA Artificial Sequence
misc_feature (1)...(8) DNA backbone 23 ccgaggacga gggaaccuuu
gggcgcgncc ncgg 34 24 34 DNA Artificial Sequence misc_feature
(1)...(8) DNA backbone 24 ggcnccngcg cggguuucca agggagcagg agcc 34
25 72 RNA Artificial Sequence Sequence hybridizes to ribosomal
nucleic acids of Gram positive bacterial organisms 25 uggggcgguu
gccuccuaaa gaguaacgga ggcgcccaaa gguucccuca gccuggucgg 60
caaucaggug uu 72 26 72 RNA Artificial Sequence Sequence hybridizes
to ribosomal nucleic acids of Gram positive bacterial organisms 26
uggggcgguu gccuccuaaa gagccgagga cgcgcccaaa gguucccucg uccucggcgg
60 caaucaggug uu 72 27 28 DNA HIV-1 misc_feature (1)...(6) DNA
backbone 27 ggngnggggu acagugcagg ggcacacc 28 28 28 DNA HIV-1
misc_feature (1)...(6) DNA backbone 28 ggngnggggu acagugcagg
ggcacacc 28 29 28 DNA HIV-1 misc_feature (1)...(6) DNA backbone 29
ggngnggggu acagugcagg ggcacacc 28 30 28 DNA HIV-1 misc_feature
(1)...(6) DNA backbone 30 ggngnggggu acagugcagg ggcacacc 28 31 28
DNA HIV-1 misc_feature (1)...(6) DNA backbone 31 ggngnggggu
acagugcagg ggcacacc 28 32 28 DNA HIV-1 misc_feature (1)...(6) DNA
backbone 32 ggngnggggu acagugcagg ggcacacc 28 33 28 DNA HIV-1
misc_feature (1)...(6) DNA backbone 33 ggngnggggu acagugcagg
ggcacacc 28 34 28 DNA HIV-1 misc_feature (1)...(6) DNA backbone 34
ggngnggggu acagugcagg ggcacacc 28 35 31 RNA HIV-1 misc_feature
(1)...(31) Sequence of 2'-OMe analogs 35 uaggugugcc ccugcacugu
accccacacc u 31 36 31 RNA HIV-1 misc_feature (1)...(31) Sequence of
2'-OMe analogs 36 uccacacccc augucacguc cccgugugga u 31
* * * * *