U.S. patent application number 11/441293 was filed with the patent office on 2006-10-26 for cng2b: a novel human cyclic nucleotide-gated ion channel.
This patent application is currently assigned to ICAgen, Inc.. Invention is credited to Christopher D. Creech, Timothy J. Jegla.
Application Number | 20060240465 11/441293 |
Document ID | / |
Family ID | 26920345 |
Filed Date | 2006-10-26 |
United States Patent
Application |
20060240465 |
Kind Code |
A1 |
Creech; Christopher D. ; et
al. |
October 26, 2006 |
CNG2B: a novel human cyclic nucleotide-gated ion channel
Abstract
The invention provides isolated nucleic acid and amino acid
sequences of CNG2B, antibodies to CNG2B, methods of detecting
CNG2B, and methods of screening for modulators of cyclic
nucleotide-gated ion channels using biologically active CNG2B. The
invention further provides, in a computer system, a method of
screening for mutations of human CNG2B genes as well as a method
for identifying a three-dimensional structure of human CNG2B
polypeptides.
Inventors: |
Creech; Christopher D.;
(Garner, NC) ; Jegla; Timothy J.; (San Diego,
CA) |
Correspondence
Address: |
TOWNSEND AND TOWNSEND AND CREW, LLP
TWO EMBARCADERO CENTER
EIGHTH FLOOR
SAN FRANCISCO
CA
94111-3834
US
|
Assignee: |
ICAgen, Inc.
Durham
NC
|
Family ID: |
26920345 |
Appl. No.: |
11/441293 |
Filed: |
May 24, 2006 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
11147623 |
Jun 7, 2005 |
7053183 |
|
|
11441293 |
May 24, 2006 |
|
|
|
09927267 |
Aug 10, 2001 |
6933147 |
|
|
11147623 |
Jun 7, 2005 |
|
|
|
60226253 |
Aug 17, 2000 |
|
|
|
Current U.S.
Class: |
435/6.16 ;
435/320.1; 435/325; 435/69.1; 530/350; 530/388.22; 536/23.5 |
Current CPC
Class: |
A61P 25/00 20180101;
C07K 14/705 20130101; C07K 2299/00 20130101 |
Class at
Publication: |
435/006 ;
435/069.1; 435/320.1; 435/325; 530/350; 530/388.22; 536/023.5 |
International
Class: |
C12Q 1/68 20060101
C12Q001/68; C07H 21/04 20060101 C07H021/04; C12P 21/06 20060101
C12P021/06; C07K 14/705 20060101 C07K014/705; C07K 16/28 20060101
C07K016/28 |
Claims
1. An isolated nucleic acid encoding a polypeptide comprising a
subunit of a cation channel, the polypeptide: (i) forming, with at
least one CNG alpha subunit, a cation channel having the
characteristic of cyclic nucleotide-gating; and (ii) comprising an
amino acid sequence having at least 95% sequence identity to SEQ ID
NO:1.
2. The nucleic acid of claim 1, wherein the nucleic acid encodes a
polypeptide comprising an amino acid sequence of SEQ ID NO:1.
3. The nucleic acid of claim 1, wherein the nucleic acid comprises
a nucleotide sequence having at least 90% sequence identity to SEQ
ID NO:2 or SEQ ID NO:3.
4. The nucleic acid of claim 3, wherein the nucleic acid comprises
a nucleotide sequence of SEQ ID NO:2 or SEQ ID NO:3.
5. The nucleic acid of claim 1, wherein the nucleic acid is
amplified by primers that selectively hybridize under stringent
hybridization conditions to the same sequence as the primers
selected from the group consisting of: TABLE-US-00003 (SEQ ID NO:4)
GCAGATCTTTCAGAACTGTGAGGCCA (SEQ ID NO:5) CCTGCCCTCTTCATCTTTGGAAGTTC
(SEQ ID NO:6) GCCAACATCAAGAGCCTAGGTTATTC (SEQ ID NO:7)
GGATGATCTACAGACCAAGTTTGCTCG (SEQ ID NO:8)
ATGAGCCAGGACACCAAAGTGAAGAC (SEQ ID NO:9) GTTGATGATGCTGATCTCCCCAAAG
(SEQ ID NO:10) GGATGATGAGGTTATACATGACTGGG (SEQ ID NO:11)
AGGCTAGCAACTTCCTGGCCTTGGAT (SEQ ID NO:12)
GCGAAAGCTTCCACCATGAGCCAGGACACCAAAGTG and (SEQ ID NO:13)
CATGTCTAGAATGGGGATGGGGTCACTCTGGACCT.
6. The nucleic acid of claim 1, wherein the nucleic acid
selectively hybridizes under moderately stringent hybridization
conditions to a nucleic acid comprising a nucleotide sequence of
SEQ ID NO:2 or SEQ ID NO:3.
7. An isolated nucleic acid encoding a CNG2B polypeptide, the
nucleic acid specifically hybridizing under stringent conditions to
a nucleic acid comprising a nucleotide sequence of SEQ ID NO:2 or
SEQ ID NO:3.
8. An isolated nucleic acid encoding a CNG2B polypeptide, the
nucleic acid comprising a nucleotide sequence having at least 90%
sequence identity to SEQ ID NO:2 or SEQ ID NO:3.
9. An isolated nucleic acid that specifically hybridizes under
stringent conditions to a nucleic acid encoding an amino acid
sequence of SEQ ID NO:1.
10. A method of detecting a nucleic acid, the method comprising
contacting the nucleic acid with an isolated nucleic acid of claim
1.
11. An isolated polypeptide comprising a subunit of a cation
channel, the polypeptide: (i) forming, with at least one CNG alpha
subunit, a cation channel having the characteristic of cyclic
nucleotide-gating; and (ii) comprising an amino acid sequence
having at least 95% amino acid sequence identity to SEQ ID NO:
1.
12. The polypeptide of claim 11, wherein the polypeptide
specifically binds to antibodies generated against SEQ ID NO:
1.
13. The polypeptide of claim 11, wherein the polypeptide has a
molecular weight of between about 61 kD to about 71 kD.
14. The polypeptide of claim 11, wherein the polypeptide has an
amino acid sequence of human CNG2B.
15. The polypeptide of claim 11, wherein the polypeptide has an
amino acid sequence of SEQ ID NO:1.
16. The polypeptide of claim 11, wherein the polypeptide comprises
an alpha subunit of a heteromeric cyclic nucleotide-gated cation
channel.
17. An antibody that specifically binds to the CNG2B polypeptide of
claim 11.
18. The antibody of claim 17, wherein the polypeptide to which the
antibody binds has an amino acid sequence of SEQ ID NO:1.
19. An expression vector comprising the nucleic acid of claim
1.
20. A host cell transfected with the vector of claim 19.
21. A method for identifying a compound that increases or decreases
ion flux through a cation channel, the method comprising the steps
of: (i) contacting the compound with a CNG2B polypeptide, the
polypeptide (a) forming, with at least one CNG alpha subunit, a
cation channel having the characteristic of cyclic
nucleotide-gating; and (b) comprising an amino acid sequence having
at least 95% sequence identity to SEQ ID NO:1; and (ii) determining
the functional effect of the compound upon the cation channel.
22. The method of claim 21, wherein the functional effect is
measured in vitro.
23. The method of claim 22, wherein the functional effect is a
physical effect.
24. The method of claim 22, wherein the functional effect is
determined by measuring ligand binding to the channel.
25. The method of claim 22, wherein the functional effect is a
chemical effect.
26. The method of claim 21, wherein the polypeptide is expressed in
a eukaryotic host cell or cell membrane.
27. The method of claim 26, wherein the functional effect is a
physical effect.
28. The method of claim 27, wherein the functional effect is
determined by measuring ligand binding to the channel.
29. The method of claim 26, wherein the functional effect is a
chemical effect.
30. The method of claim 29, wherein the functional effect is
determined by measuring ion flux, changes in ion concentrations,
changes in current or changes in voltage.
31. The method of claim 21, wherein the polypeptide is
recombinant.
32. The method of claim 21, wherein the cation channel is
homomultimeric.
33. The method of claim 21, wherein the cation channel is
heteromultimeric.
34. The method of claim 21, wherein the polypeptide has an amino
acid sequence of SEQ ID NO:1.
35. A method for identifying a compound that increases or decreases
ion flux through a cyclic nucleotide-gated cation channel
comprising a CNG2B polypeptide, the method comprising the steps of:
(i) entering into a computer system an amino acid sequence of at
least 100 amino acids of a CNG2B polypeptide or at least 300
nucleotides of a nucleic acid encoding the CNG2B polypeptide, the
CNG2B polypeptide comprising an amino acid sequence at least 89%
identical to SEQ ID NO:1; (ii) generating a three-dimensional
structure of the polypeptide encoded by the amino acid sequence;
(iii) generating a three-dimensional structure of the compound; and
(iv) comparing the three-dimensional structures of the polypeptide
and the compound to determine whether or not the compound binds to
the polypeptide.
36. A method of modulating ion flux through a CNG cation channel
comprising a CNG2B subunit to treat a disease in a subject, the
method comprising the step of administering to the subject a
therapeutically effective amount of a compound identified using the
method of claim 21 or 35.
37. A method of detecting the presence of CNG2B in human tissue,
the method comprising the steps of: (i) isolating a biological
sample; (ii) contacting the biological sample with a CNG2B-specific
reagent that selectively associates with CNG2B; and, (iii)
detecting the level of CNG2B-specific reagent that selectively
associates with the sample.
38. The method of claim 37, wherein the CNG2B-specific reagent is
selected from the group consisting of: CNG2B-specific antibodies,
CNG2B-specific oligonucleotide primers, and CNG2B-nucleic acid
probes.
39. In a computer system, a method of screening for mutations of a
human CNG2B gene, the method comprising the steps of: (i) entering
into the computer a first nucleic acid sequence encoding a CNG2B
polypeptide having a nucleotide sequence of SEQ ID NO:2 or SEQ ID
NO:3, and conservatively modified versions thereof; (ii) comparing
the first nucleic acid sequence with a second nucleic acid sequence
having substantial identity to the first nucleic acid sequence; and
(iii) identifying nucleotide differences between the first and
second nucleic acid sequences.
40. The method of claim 39, wherein the second nucleic acid
sequence is associated with a disease state.
Description
CROSS-REFERENCES TO RELATED APPLICATIONS
[0001] The present application claims priority to U.S. Ser. No.
60/226,253, filed Aug. 17, 2000, herein incorporated by reference
in its entirety.
STATEMENT AS TO RIGHTS TO INVENTIONS MADE UNDER FEDERALLY SPONSORED
RESEARCH AND DEVELOPMENT
[0002] Not applicable.
FIELD OF THE INVENTION
[0003] The invention provides isolated nucleic acid and amino acid
sequences of CNG2B, antibodies to CNG2B, methods of detecting
CNG2B, and methods of screening for modulators of cyclic
nucleotide-gated cation channels using biologically active CNG2B.
The invention further provides, in a computer system, a method of
screening for mutations of human CNG2B genes as well as a method
for identifying a three-dimensional structure of human CNG2B
polypeptides.
BACKGROUND OF THE INVENTION
[0004] Cyclic nucleotide gated cation channels (CNG) are a class of
non-selective cation channels that are opened by direct binding of
cyclic nucleotides such as cGMP and cAMP. CNG channels are highly
permeable to Na.sup.+ and Ca.sup.2+ and their activation leads to
depolarization and increases in internal Ca.sup.2+ concentrations.
These channels can link changes in cytoplasmic cyclic nucleotide
levels to changes in cellular excitability, secretion of
neurotransmitters and the stimulation of calcium-dependent
pathways.
[0005] CNG family channel proteins are multimers and can be formed
by at least two functionally distinct classes of subunits. The two
classes of subunits, alpha and beta, share a common motif of 6
transmembrane domains, a pore motif and a cytoplasmic cyclic
nucleotide binding domain (Finn et al., Annu. Rev. Physiol.
58:395-426:1996). CNG alpha subunits can form functional channels
as homomultimers, i.e., all subunits contributing to the channel
pore are identical. Beta subunits, in contrast, can only form
functional channels when expressed with an alpha subunit. These
heteromultimeric channels show functional properties consistent
with native CNG channels (Gerstner, et al., J. Neurosci.
20(4):1324-1332, 2000; Finn, et al, Annu. Rev. Physiol. 58:395-426,
1996). For example, coexpression of alpha and beta subunits occurs
in retinal rod cells where the alpha subunit CNGA1 forms a
heteromultimer with the beta subunit CNGB1 (CNG4) (Gerstner, et
al., J. Neurosci. 20(4):1324-1332, Feb. 15, 2000).
[0006] CNG channels are important for sensory signal transduction
in retinal and olfactory and taste bud cells in response to primary
sensory stimuli such as light and aerosolized or dissolved
molecules (Ding, C, et al., Am. J. Physiol. 272 (Cell Physiol. 41):
C1335-C1344, 1997). In photoreceptor cells, CNG channels are open
in darkness due to a high basal concentration of cGMP. This causes
a tonic depolarization of the membrane and constitutive
neurotransmitter release. Upon stimulation by light, cGMP levels
drop, closing the CNG channels. This in turn causes a
hyperpolarization of the membrane, a drop in the internal Ca.sup.2+
concentration, and a decrease in the release of neurotransmitter
(Finn, et al., Annu. Rev. Physiol. 58:395-426, 1996).
[0007] CNG channels have been found in a number of tissues,
suggesting that these channels may link a variety of stimuli to
changes in membrane potential and cytoplasmic calcium levels (Ding,
et al., Am. J. Physiol. 272 (Cell Physiol. 41):C1335-C1344, 1997;
Kingston P, Synapse 32:1-12, 1999). For instance, retinal and
olfactory CNG channels are expressed in various parts of the brain
(Ding, et al., Am. J. Physiol. 272 (Cell Physiol. 41):C1335-C1344,
1997; Kingston P, Synapse 32:1-12, 1999). Because these channels
are highly permeable to Ca.sup.2+, they may stimulate
Ca.sup.2+-dependent pathways that have significant effects on
neuronal activity. More directly, they may contribute to neuronal
activity by providing excitatory depolarizations. CNG channels may
also interact with other second messenger systems such as the
Nitric Oxide-pathway to provide the longer lasting changes that are
important mechanisms in learning and memory (Kingston, Synapse
32:1-12, 1999). CNG channels have been found in the testis, and
through the regulation of the internal Ca.sup.2+ concentration, may
be involved in chemotaxis of sperm (Weyand, et al., Nature
368:859-863, 1994). Expression of CNG channels has also been noted
in heart, aorta and kidney, where they may play a role in the
regulation of heart rate, blood pressure and electrolyte transport,
respectively (Finn et al., Ann. Rev. Physiol. 1996, 58:395-426).
The fill scope of CNG channel function is not yet entirely
understood, but it is clear that they play a key role in many
physiological processes.
SUMMARY OF THE INVENTION
[0008] The current invention provides the first isolation and
characterization of human CNG2B, a novel subunit of a cyclic
nucleotide gated cation channel. The present invention provides
both the nucleotide and amino acid sequence of CNG2B, as well as
methods of assaying for modulators of CNG2B, antibodies to CNG2B,
and methods of detecting CNG2B nucleic acids and proteins.
[0009] In one aspect, the present invention provides an isolated
nucleic acid encoding a polypeptide comprising a subunit of a
cation channel, the polypeptide: (i) forming, with at least one CNG
alpha subunit, a cation channel having the characteristic of cyclic
nucleotide-gating or nitric oxide gating; and (ii) comprising an
amino acid sequence having at least 95% identity to SEQ ID
NO:1.
[0010] In another aspect, the present invention provides an
isolated nucleic acid encoding a CNG2B polypeptide, the nucleic
acid specifically hybridizing under stringent conditions to a
nucleic acid comprising a nucleotide sequence of SEQ ID NO:2 or SEQ
ID NO:3.
[0011] In another aspect, the present invention provides an
isolated nucleic acid encoding a CNG2B polypeptide, the nucleic
acid comprising a nucleotide sequence having at least 90% sequence
identity to SEQ ID NO:2 or SEQ ID NO:3.
[0012] In one embodiment, the nucleic acid encodes a polypeptide
comprising an amino acid sequence of SEQ ID NO:1. In another
embodiment, the nucleic acid comprises a nucleotide sequence of SEQ
ID NO:2 or SEQ ID NO:3.
[0013] In another embodiment, the nucleic acid is amplified by
primers that selectively hybridize under stringent hybridization
conditions to the same sequence as the primers selected from the
group consisting of: TABLE-US-00001 (SEQ ID NO:4)
GCAGATCTTTCAGAACTGTGAGGCCA (SEQ ID NO:5) CCTGCCCTCTTCATCTTTGGAAGTTC
(SEQ ID NO:6) GCCAACATCAAGAGCCTAGGTTATTC (SEQ ID NO:7)
GGATGATCTACAGACCAAGTTTGCTCG (SEQ ID NO:8)
ATGAGCCAGGACACCAAAGTGAAGAC (SEQ ID NO:9) GTTGATGATGCTGATCTCCCCAAAG
(SEQ ID NO:10) GGATGATGAGGTTATACATGACTGGG (SEQ ID NO:11)
AGGCTAGCAACTTCCTGGCCTTGGAT (SEQ ID NO:12)
GCGAAAGCTTCCACCATGAGCCAGGACACCAAAGTG and (SEQ ID NO:13)
CATGTCTAGAATGGGGATGGGGTCACTCTGGACCT.
[0014] In another embodiment, the nucleic acid selectively
hybridizes under moderately stringent hybridization conditions to a
nucleic acid comprising a nucleotide sequence of SEQ ID NO:2 or SEQ
ID NO:3. In another aspect, the present invention provides an
isolated nucleic acid that specifically hybridizes under stringent
conditions to a nucleic acid encoding an amino acid sequence of SEQ
ID NO:1.
[0015] In another aspect, the present invention provides a method
of detecting a nucleic acid, the method comprising contacting the
nucleic acid with an isolated nucleic acid, as described above.
[0016] In another aspect, the present invention provides expression
vectors comprising the nucleic acids of the invention, and host
cells comprising such expression vectors.
[0017] In another aspect, the present invention provides an
isolated polypeptide comprising a subunit of a cation channel, the
polypeptide: (i) forming, with at least one CNG alpha subunit, a
cation channel having the characteristic of cyclic
nucleotide-gating; and (ii) comprising an amino acid sequence
having at least 95% sequence identity to SEQ ID NO:1.
[0018] In one embodiment, the polypeptide specifically binds to
antibodies generated against a polypeptide comprising an amino acid
sequence of SEQ ID NO:1. In another embodiment, the polypeptide
comprises an alpha subunit of a homomeric cyclic nucleotide gated
cation channel. In another embodiment, the polypeptide comprises an
alpha subunit of a heteromeric cyclic nucleotide gated cation
channel. In another embodiment, the polypeptide has a molecular
weight of between about 61 kD to about 71 kD. In another
embodiment, the polypeptide has an amino acid sequence of human
CNG2B. In another embodiment, the polypeptide has an amino acid
sequence of SEQ ID NO:1.
[0019] In another aspect, the present invention provides an
antibody that specifically binds to any of the CNG2B polypeptides
described herein.
[0020] In another aspect, the present invention provides a method
for identifying a compound that increases or decreases ion flux
through a cation channel, the method comprising the steps of: (i)
contacting the compound with a CNG2B polypeptide, the polypeptide
(a) forming, with at least one CNG alpha subunit, a cation channel
having the characteristic of cyclic nucleotide-gating; and (b)
comprising an amino acid sequence having at least 95% sequence
identity to SEQ ID NO:1; and (ii) determining the functional effect
of the compound upon the cation channel.
[0021] In one embodiment, the functional effect is a physical
effect or a chemical effect. In one embodiment, the polypeptide is
recombinant. In another embodiment, the functional effect is
determined by measuring ligand binding to the channel. In another
embodiment, the cation channel is homomultimeric. In another
embodiment, the cation channel is heteromultimeric.
[0022] In one embodiment, the polypeptide is expressed in a
eukaryotic host cell or cell membrane. In another embodiment, the
functional effect is determined by measuring ion flux, changes in
ion concentrations, changes in current or changes in voltage.
[0023] In another aspect, the present invention provides a method
for identifying a compound that increases or decreases ion flux
through a cyclic nucleotide-gated cation channel comprising a CNG2B
polypeptide, the method comprising the steps of: (i) entering into
a computer system an amino acid sequence of at least 100 amino
acids of a CNG2B polypeptide or at least 300 nucleotides of a
nucleic acid encoding the CNG2B polypeptide, the CNG2B polypeptide
comprising an amino acid sequence having at least 95% sequence
identity to SEQ ID NO:1; (ii) generating a three-dimensional
structure of the polypeptide encoded by the amino acid sequence;
(iii) generating a three-dimensional structure of the cation
channel comprising the CNG2B polypeptide; (iv) generating a
three-dimensional structure of the compound; and (v) comparing the
three-dimensional structures of the polypeptide and the compound to
determine whether or not the compound binds to the polypeptide.
[0024] In one embodiment, the amino acid sequence is of a
full-length CNG2B polypeptide.
[0025] In another aspect, the present invention provides a method
of modulating ion flux through a CNG cation channel comprising a
CNG2B subunit to treat a disease in a subject, the method
comprising the step of administering to the subject a
therapeutically effective amount of a compound identified using any
of the methods described herein.
[0026] In another aspect, the present invention provides a method
of detecting the presence of CNG2B in human tissue, the method
comprising the steps of: (i) isolating a biological sample; (ii)
contacting the biological sample with an CNG2B-specific reagent
that selectively associates with CNG2B; and, (iii) detecting the
level of CNG2B-specific reagent that selectively associates with
the sample.
[0027] In one embodiment, the CNG2B-specific reagent is selected
from the group consisting of: CNG2B-specific antibodies,
CNG2B-specific oligonucleotide primers, and CNG2B-nucleic acid
probes.
[0028] In another aspect, the present invention provides, in a
computer system, a method of screening for mutations of a human
CNG2B gene, the method comprising the steps of: (i) entering into
the computer a first nucleic acid sequence encoding a CNG2B
polypeptide having a nucleotide sequence of, SEQ ID NO:2 or SEQ ID
NO:3, and conservatively modified versions thereof; (ii) comparing
the first nucleic acid sequence with a second nucleic acid sequence
having substantial identity to the first nucleic acid sequence; and
(iii) identifying nucleotide differences between the first and
second nucleic acid sequences.
[0029] In one embodiment, the second nucleic acid sequence is
associated with a disease state.
BRIEF DESCRIPTION OF THE DRAWINGS
[0030] FIG. 1. Amino acid alignment of CNG2B with rat OCNC2.
Identical residues are shaded and numbers at the left margin
indicate amino acid position.
[0031] FIG. 2. Complete CNG2B sequence derived from assembly of PCR
fragments. Coding sequence is in bold type, and untranslated
sequence is in normal type.
[0032] FIG. 3. Complete CNG2B coding nucleotide sequence.
[0033] FIG. 4. Complete CNG2B amino acid sequence.
DETAILED DESCRIPTION OF THE INVENTION
I. Introduction
[0034] The present invention provides for the first time nucleic
acids encoding CNG2B, a member of the CNG family of cyclic
nucleotide gated cation channels. Members of this family are
polypeptide subunits of cation channels having six transmembrane
regions, a pore motif, and a cytoplasmic cyclic nucleotide binding
domain. CNG2B is most similar to rat OCNC2 which, without being
bound to any particular theory, has characteristics of both alpha
and beta subunits. Because CNG2B is expressed in the central
nervous system, modulators of CNG2B function can be identified
which would be useful in the treatment of any of a large number of
neurological disorders.
[0035] The invention therefore provides methods of screening for
activators and inhibitors of cation channels that contain a CNG2B
subunit. Such modulators of cation channel activity are useful for
treating disorders, including neurological disorders.
[0036] Furthermore, the invention provides assays for CNG activity
where CNG2B acts as a direct or indirect reporter molecule. Such
uses of CNG2B as a reporter molecule in assay and detection systems
have broad applications, e.g., CNG2B can be used as a reporter
molecule to measure changes in cation concentration, membrane
potential, current flow, ion flux, transcription, signal
transduction, receptor-ligand interactions, second messenger
concentrations, in vitro, in vivo, and ex vivo. In one embodiment,
CNG2B can be used as an indicator of current flow in a particular
direction (e.g., outward or inward cation flow), and in another
embodiment, CNG2B can be used as an indirect reporter via
attachment to a second reporter molecule such as green fluorescent
protein.
[0037] The invention also provides for methods of detecting CNG2B
nucleic acid and protein expression, allowing investigation of the
channel diversity provided by CNG2B family members, as well as
diagnosis of disorders, including neurological disorders.
[0038] Finally, the invention provides for a method of screening
for mutations of CNG2B genes or proteins. The invention includes,
but is not limited to, methods of screening for mutations in CNG2B
with the use of a computer. Similarly, the invention provides for
methods of identifying the three-dimensional structure of CNG2B
polypeptides, as well as the resulting computer readable images or
data that comprise the three dimensional structure of CNG2B
polypeptides. Other methods for screening for mutations of CNG2B
genes or proteins include high density oligonucleotide arrays, PCR,
immunoassays and the like.
[0039] Functionally, CNG2B polypeptides are subunits, e.g., alpha
subunits, of cyclic nucleotide-gated cation channels.
CNG2B-containing channels are either homomultimeric or
heteromultimeric. Heteromultimeric CNG2B-containing channels can
contain, in addition to the CNG2B subunits, one or more CNG alpha
or beta subunits. The presence of CNG2B in a cation channel may
modulate the activity of the heteromeric channel and thus enhance
channel diversity. Channel diversity is also enhanced with
alternatively spliced forms of CNG2B genes. CNG2B nucleic acids
have been isolated from cDNAs from the human central nervous
system.
[0040] Structurally, the nucleotide sequence of human CNG2B (SEQ ID
NOS:2-3) encodes a polypeptide monomer with a predicted molecular
weight of approximately 66 kD and a predicted molecular weight
range of 61-71 kD. CNG2B polypeptides typically contain each of the
motifs common among alpha and beta CNG subunits, including six
transmembrane domains, a pore motif, and a cytoplasmic cyclic
nucleotide binding domain (Finn et al., Ann. Rev. Physiol.
58:395-426:1996). Related CNG2B genes from other species share at
least about 60%, 65%, 70%, 75%, 80%, 85%, 90% or, preferably, 95%
to 100% amino acid identity with the CNG2B shown as SEQ ID
NO:1.
[0041] The present invention also provides polymorphic variants of
the human CNG2B depicted in SEQ ID NO:1: variant #1, in which an
isoleucine residue is substituted for the valine residue at amino
acid position 110; variant #2, in which a glycine residue is
substituted for the serine residue at amino acid position 520;
variant #3, in which a lysine residue is substituted for the
arginine residue at amino acid position 537; and variant #4, in
which a glutamic acid residue is substituted for the aspartic acid
residue at amino acid position 550.
[0042] The CNG2B nucleotide and amino acid sequence may be used to
identify CNG2B polymorphic variants, interspecies homologs, and
alleles. This identification can be made in vitro, e.g., under
stringent hybridization conditions and sequencing, or by using the
sequence information in a computer system for comparison with other
nucleotide sequences, or using antibodies raised against CNG2B.
Typically, identification of CNG2B polymorphic variants, orthologs,
and alleles is made by comparing the amino acid sequence (or the
nucleic acid encoding the amino acid sequence) of SEQ ID NO:1.
Amino acid identity of approximately at least 60% or above, 70%,
65%, 75%, 80%, preferably 85%, most preferably 95%, 96%, 97%, 98%,
or 99% typically demonstrates that a protein is a CNG2B polymorphic
variant, interspecies homolog, or allele. Sequence comparison is
typically performed using the BLAST or BLAST 2.0 algorithm with
default parameters, discussed below.
[0043] CNG2B polymorphic variants, interspecies homologs, and
alleles can be confirmed by expressing or co-expressing the
putative CNG2B polypeptide monomer and examining whether it forms a
cation channel with CNG family functional and biochemical
characteristics. This assay is used to demonstrate that a protein
having about 60% or greater, 65%, 70%, 75%, 80%, preferably 85%,
90%, or 95% or greater amino acid identity to CNG2B shares the same
functional characteristics as CNG2B and is therefore a species of
CNG2B. Typically, human CNG2B having the amino acid sequence of SEQ
ID NO:1 is used as a positive control in comparison to the putative
CNG2B protein to demonstrate the identification of a CNG2B
polymorphic variant, ortholog, conservatively-modified variant,
mutant, or allele.
[0044] CNG2B nucleotide and amino acid sequence information may
also be used to construct models of cyclic nucleotide-gated cation
channels in a computer system. These models are subsequently used
to identify compounds that can activate or inhibit cyclic
nucleotide-gated cation channels comprising CNG2B polypeptides.
Such compounds that modulate the activity of channels comprising
CNG2B polypeptides can be used to investigate the role of CNG2B
polypeptides in the modulation of channel activity and in channel
diversity.
[0045] The isolation of biologically active CNG2B for the first
time provides a means for assaying for inhibitors and activators of
cyclic nucleotide-gated cation channels that comprise CNG2B
subunits. Biologically active CNG2B polypeptides are useful for
testing inhibitors and activators of cyclic nucleotide-gated cation
channels comprising subunits of CNG2B, using in vivo and in vitro
expression that measure, e.g., changes in voltage or current. Such
activators and inhibitors identified using a cation channel
comprising at least one CNG2B subunit, optionally up to four CNG2B
subunits, can be used to further study cyclic nucleotide-gating,
channel kinetics and conductance properties of cation channels.
Such activators and inhibitors are useful as pharmaceutical agents
for treating diseases involving abnormal ion flux, e.g., disorders,
including neurological disorders, as described above. Methods of
detecting CNG2B nucleic acids and polypeptides and expression of
channels comprising CNG2B polypeptides are also useful for
diagnostic applications for diseases involving abnormal ion flux,
e.g., as described above. For example, chromosome localization of
the gene encoding human CNG2B can be used to identify diseases
caused by and associated with CNG2B. Methods of detecting CNG2B are
also useful for examining the role of CNG2B in channel diversity
and modulation of channel activity.
II. Definitions
[0046] As used herein, the following terms have the meanings
ascribed to them unless specified otherwise.
[0047] "CNG2B" refers to a polypeptide that is a subunit or monomer
of a cyclic nucleotide gated cation channel, and a member of the
CNG family. When CNG2B is part of a cation channel, e.g., a
homomultimeric or heteromultimeric cation channel, the channel has
the characteristic of cyclic nucleotide gating or nitric oxide
gating. The term CNG2B therefore refers to CNG2B polymorphic
variants, alleles, mutants, and interspecies homologs that: (1)
have an amino acid subsequence that has greater than about 60%
amino acid sequence identity, 65%, 70%, 75%, 80%, 85%, 90%,
preferably 95%, 96%, 97%, 98% or 99% or greater amino acid sequence
identity, to a CNG2B sequence of SEQ ID NO:1; (2) bind to
antibodies, e.g., polyclonal antibodies, raised against an
immunogen comprising an amino acid sequence of SEQ ID NO:1 or a
fragment or conservatively modified variants thereof; (3)
specifically hybridize under stringent hybridization conditions to
a sequence of SEQ ID NOS:2-3 and fragments and conservatively
modified variants thereof; (4) have a nucleic acid subsequence that
has greater than about 90%, preferably greater than about 96%, 97%,
98%, 99%, or higher nucleotide sequence identity to SEQ ID NO:2 or
SEQ ID NO:3; or (5) are amplified by primers that specifically
hybridize under stringent hybridization conditions to the same
sequence as a primer set selected from the group consisting of SEQ
ID NOS:4-13.
[0048] The phrase "cyclic nucleotide-gated" activity or "cyclic
nucleotide-gating" refers to a characteristic of a cation channel
composed of individual polypeptide monomers or subunits. Generally,
cyclic-nucleotide-gated cation channels are a class of
non-selective cation channels that are opened by direct binding of
cyclic nucleotides such as cGMP and cAMP. CNG channels are highly
permeable to Na.sup.+ and Ca.sup.2+, and their activation leads to
depolarization and increases in internal Ca.sup.2+ concentrations.
CNG channels can thus link changes in cytoplasmic cyclic nucleotide
levels to changes in cellular excitability, secretion of
neurotransmitters, and/or stimulation of calcium-dependent
pathways. CNG channels play an important role in sensory signal
transduction in numerous cells, e.g., cells throughout the central
nervous system, in response to primary sensory stimuli such as
light and aerosolized or dissolved molecules. In photoreceptor
cells, CNG channels are open in darkness due to a high basal
concentration of cGMP, causing a tonic depolarization of the
membrane and constitutive neurotransmitter release. Upon
stimulation by light, cGMP levels drop, closing the CNG channels,
and in turn causing a hyperpolarization of the membrane, a drop in
the internal Ca.sup.2+ concentration, and a decrease in
neurotransmitter release. CNG channels may also interact with
second messenger systems such as the nitric oxide pathway. In some
cases, NO may substitute for cyclic nucleotides in gating these
channels (see, e.g., Broillet, et al., Neuron 18:951-958
(1997)).
[0049] "Homomeric channel" or "homomultimeric channel" refers to a
CNG channel composed of identical alpha subunits, whereas
"heteromeric channel" or "heteromultimeric channel" refers to a CNG
channel composed of at least one CNG alpha subunit, e.g., CNG2B,
plus at least one other type of alpha or beta subunit.
[0050] An "alpha subunit" is a polypeptide monomer that is an
essential subunit of a CNG cation channel, as at least one alpha
subunit is required to create a functional channel. Alpha subunits
can form a homomultimeric cationic channel, or can form a
heteromultimeric channel comprising other beta subunits or other
heterologous alpha subunits. Any particular alpha subunit may
participate in a variety of channel types in an organism or in a
cell, e.g., forming homomultimeric channels in one cell type,
forming a heteromultimeric channel with a beta subunit in a second
cell type, and forming a third heteromultimeric channel with a
heterologous alpha subunit in a third cell type.
[0051] A "beta subunit" is a polypeptide monomer that is an
auxiliary subunit of a CNG cation channel composed of alpha
subunits; however, beta subunits alone cannot form a channel (see,
e.g., U.S. Pat. No. 5,776,734). Beta subunits are known, for
example, to increase the number of channels by helping the alpha
subunits reach the cell surface, change activation kinetics, and
change the sensitivity of natural ligands binding to the channels.
Beta subunits can be outside of the pore region and associated with
alpha subunits comprising the pore region. They can also contribute
to the external mouth of the pore region.
[0052] The phrase "functional effects" in the context of assays for
testing compounds affecting a channel comprising a CNG2B
polypeptide includes the determination of any parameter that is
indirectly or directly under the influence of the channel. It
includes e.g., direct, physical effects, such as ligand binding,
and indirect, chemical or phenotypic effects, e.g., changes in ion
flux and membrane potential, and other physiologic effects such as
increases or decreases of transcription or hormone release.
"Functional effects" include in vitro (biochemical or ligand
binding assays using, e.g., isolated protein, cell lysates or cell
membranes), in vivo (cell- and animal-based assays), and ex vivo
activities.
[0053] "Determining the functional effect" refers to examining the
effect of a compound that has a direct physical effect on a CNG2B
subunit or channel comprising a CNG2B subunit, e.g., ligand
binding, or indirect chemical or phenotypic effects on channel
comprising a CNG2B subunit, e.g., increases or decreases ion flux
in a cell or cell membrane. The ion flux can be any ion that passes
through a channel and analogues thereof, e.g., potassium, rubidium.
Preferably, the term refers to the functional effect of the
compound on the channels comprising CNG2B, e.g., changes in ion
flux including radioisotopes, current amplitude, membrane
potential, current flow, conductance, transcription, protein
binding, phosphorylation, dephosphorylation, second messenger
concentrations (cAMP, cGMP, Ca.sup.2+, IP.sub.3), ligand binding,
changes in ion concentration, and other physiological effects such
as hormone and neurotransmitter release, as well as changes in
voltage and current. Such functional effects can be measured by any
means known to those skilled in the art, e.g., patch clamping,
voltage-sensitive dyes, ion sensitive dyes, whole cell currents,
radioisotope efflux, inducible markers, and the like.
[0054] "Inhibitors," "activators" or "modulators" of cyclic
nucleotide-gated cation channels comprising a CNG2B polypeptide
refer to inhibitory or activating molecules identified using in
vitro and in vivo assays for CNG2B channel function. Inhibitors are
compounds that decrease, block, prevent, delay activation,
inactivate, desensitize, or down regulate the channel. Activators
are compounds that increase, open, activate, facilitate, enhance
activation, sensitize or up regulate channel activity. Such assays
for inhibitors and activators include e.g., expressing a CNG2B
polypeptide in cells or cell membranes and then measuring flux of
ions through the channel and determining changes in polarization or
Ca.sup.2+ concentration (i.e., electrical potential).
Alternatively, cells expressing endogenous CNG2B channels can be
used in such assays. To examine the extent of inhibition, samples
or assays comprising a CNG2B channel are treated with a potential
activator or inhibitor and are compared to control samples without
the inhibitor. Control samples (untreated with inhibitors) are
assigned a relative CNG2B activity value of 100%. Inhibition of
channels comprising CNG2B is achieved when the CNG2B activity value
relative to the control is about 90%, preferably 50%, more
preferably 25-0%. Activation of channels comprising CNG2B is
achieved when the CNG2B activity value relative to the control is
110%, more preferably 150%, most preferably at least 200-500%
higher or 1000% or higher.
[0055] "Biologically active" CNG2B polypeptides refers to CNG2B
polypeptides that have the ability to form a cation channel having
the characteristic of cyclic nucleotide-gating tested as described
herein.
[0056] The terms "isolated," "purified," or "biologically pure"
refer to material that is substantially or essentially free from
components that normally accompany it as found in its native state.
Purity and homogeneity are typically determined using analytical
chemistry techniques such as polyacrylamide gel electrophoresis or
high performance liquid chromatography. A protein that is the
predominant species present in a preparation is substantially
purified. In particular, an isolated CNG2B nucleic acid is
separated from open reading frames that flank the CNG2B gene and
encode proteins other than CNG2B. The term "purified" denotes that
a nucleic acid or protein gives rise to essentially one band in an
electrophoretic gel. Particularly, it means that the nucleic acid
or protein is at least 85% pure, more preferably at least 95% pure,
and most preferably at least 99% pure.
[0057] The term "test compound" or "drug candidate" or "modulator"
or grammatical equivalents as used herein describes any molecule,
either naturally occurring or synthetic, e.g., protein,
oligopeptide (e.g., from about 5 to about 25 amino acids in length,
preferably from about 10 to 20 or 12 to 18 amino acids in length,
preferably 12, 15, or 18 amino acids in length), small organic
molecule, polysaccharide, lipid (e.g., a sphingolipid), fatty acid,
polynucleotide, oligonucleotide, etc., to be tested for the
capacity to directly or indirectly modulation lymphocyte
activation. The test compound can be in the form of a library of
test compounds, such as a combinatorial or randomized library that
provides a sufficient range of diversity. Test compounds are
optionally linked to a fusion partner, e.g., targeting compounds,
rescue compounds, dimerization compounds, stabilizing compounds,
addressable compounds, and other functional moieties.
Conventionally, new chemical entities with useful properties are
generated by identifying a test compound (called a "lead compound")
with some desirable property or activity, e.g., inhibiting
activity, creating variants of the lead compound, and evaluating
the property and activity of those variant compounds. Often, high
throughput screening (HTS) methods are employed for such an
analysis.
[0058] A "small organic molecule" refers to an organic molecule,
either naturally occurring or synthetic, that has a molecular
weight of more than about 50 daltons and less than about 5000
daltons, preferably less than about 2000 daltons, preferably
between about 100 to about 1000 daltons, more preferably between
about 200 to about 500 daltons.
[0059] "Nucleic acid" refers to deoxyribonucleotides or
ribonucleotides and polymers thereof in either single- or
double-stranded form. The term encompasses nucleic acids containing
known nucleotide analogs or modified backbone residues or linkages,
which are synthetic, naturally occurring, and non-naturally
occurring, which have similar binding properties as the reference
nucleic acid, and which are metabolized in a manner similar to the
reference nucleotides. Examples of such analogs include, without
limitation, phosphorothioates, phosphoramidates, methyl
phosphonates, chiral-methyl phosphonates, 2-O-methyl
ribonucleotides, peptide-nucleic acids (PNAs).
[0060] Unless otherwise indicated, a particular nucleic acid
sequence also implicitly encompasses conservatively modified
variants thereof (e.g., degenerate codon substitutions) and
complementary sequences, as well as the sequence explicitly
indicated. Specifically, degenerate codon substitutions may be
achieved by generating sequences in which the third position of one
or more selected (or all) codons is substituted with mixed-base
and/or deoxyinosine residues (Batzer et al., Nucleic Acid Res.
19:5081 (1991); Ohtsuka et al., J. Biol. Chem. 260:2605-2608
(1985); Rossolini et al., Mol. Cell. Probes 8:91-98 (1994)). The
term nucleic acid is used interchangeably with gene, cDNA, mRNA,
oligonucleotide, and polynucleotide.
[0061] A particular nucleic acid sequence also implicitly
encompasses "splice variants." Similarly, a particular protein
encoded by a nucleic acid implicitly encompasses any protein
encoded by a splice variarit of that nucleic acid. "Splice
variants," as the name suggests, are products of alternative
splicing of a gene. After transcription, an initial nucleic acid
transcript may be spliced such that different (alternate) nucleic
acid splice products encode different polypeptides. Mechanisms for
the production of splice variants vary, but include alternate
splicing of exons. Alternate polypeptides derived from the same
nucleic acid by read-through transcription are also encompassed by
this definition. Any products of a splicing reaction, including
recombinant forms of the splice products, are included in this
definition.
[0062] The terms "polypeptide," "peptide" and "protein" are used
interchangeably herein to refer to a polymer of amino acid
residues. The terms apply to amino acid polymers in which one or
more amino acid residue is an artificial chemical mimetic of a
corresponding naturally occurring amino acid, as well as to
naturally occurring amino acid polymers and non-naturally occurring
amino acid polymer.
[0063] The term "amino acid" refers to naturally occurring and
synthetic amino acids, as well as amino acid analogs and amino acid
mimetics that function in a manner similar to the naturally
occurring amino acids. Naturally occurring amino acids are those
encoded by the genetic code, as well as those amino acids that are
later modified, e.g., hydroxyproline, .gamma.-carboxyglutamate, and
O-phosphoserine. Amino acid analogs refers to compounds that have
the same basic chemical structure as a naturally occurring amino
acid, i.e., a carbon that is bound to a hydrogen, a carboxyl group,
an amino group, and an R group, e.g., homoserine, norleucine,
methionine sulfoxide, methionine methyl sulfonium. Such analogs
have modified R groups (e.g., norleucine) or modified peptide
backbones, but retain the same basic chemical structure as a
naturally occurring amino acid. Amino acid mimetics refers to
chemical compounds that have a structure that is different from the
general chemical structure of an amino acid, but that functions in
a manner similar to a naturally occurring amino acid.
[0064] Amino acids may be referred to herein by either their
commonly known three letter symbols or by the one-letter symbols
recommended by the IUPAC-IUB Biochemical Nomenclature Commission.
Nucleotides, likewise, may be referred to by their commonly
accepted single-letter codes.
[0065] "Conservatively modified variants" applies to both amino
acid and nucleic acid sequences. With respect to particular nucleic
acid sequences, conservatively modified variants refers to those
nucleic acids which encode identical or essentially identical amino
acid sequences, or where the nucleic acid does not encode an amino
acid sequence, to essentially identical sequences. Because of the
degeneracy of the genetic code, a large number of functionally
identical nucleic acids encode any given protein. For instance, the
codons GCA, GCC, GCG and GCU all encode the amino acid alanine.
Thus, at every position where an alanine is specified by a codon,
the codon can be altered to any of the corresponding codons
described without altering the encoded polypeptide. Such nucleic
acid variations are "silent variations," which are one species of
conservatively modified variations. Every nucleic acid sequence
herein which encodes a polypeptide also describes every possible
silent variation of the nucleic acid. One of skill will recognize
that each codon in a nucleic acid (except AUG, which is ordinarily
the only codon for methionine, and TGG, which is ordinarily the
only codon for tryptophan) can be modified to yield a functionally
identical molecule. Accordingly, each silent variation of a nucleic
acid which encodes a polypeptide is implicit in each described
sequence.
[0066] As to amino acid sequences, one of skill will recognize that
individual substitutions, deletions or additions to a nucleic acid,
peptide, polypeptide, or protein sequence which alters, adds or
deletes a single amino acid or a small percentage of amino acids in
the encoded sequence is a "conservatively modified variant" where
the alteration results in the substitution of an amino acid with a
chemically similar amino acid. Conservative substitution tables
providing functionally similar amino acids are well known in the
art. Such conservatively modified variants are in addition to and
do not exclude polymorphic variants, interspecies homologs, and
alleles of the invention.
[0067] The following eight groups each contain amino acids that are
conservative substitutions for one another: [0068] 1) Alanine (A),
Glycine (G); [0069] 2) Aspartic acid (D), Glutamic acid (E); [0070]
3) Asparagine (N), Glutamine (Q); [0071] 4) Arginine (R), Lysine
(K); [0072] 5) Isoleucine (I), Leucine (L), Methionine (M), Valine
(V); [0073] 6) Phenylalanine (F), Tyrosine (Y), Tryptophan (W);
[0074] 7) Serine (S), Threonine (T); and [0075] 8) Cysteine (C),
Methionine (M) [0076] (see, e.g., Creighton, Proteins (1984)).
[0077] Macromolecular structures such as polypeptide structures can
be described in terms of various levels of organization. For a
general discussion of this organization, see, e.g., Alberts et al.,
Molecular Biology of the Cell (3.sup.rd ed., 1994) and Cantor and
Schimmel, Biophysical Chemistry Part I: The Conformation of
Biological Macromolecules (1980). "Primary structure" refers to the
amino acid sequence of a particular peptide. "Secondary structure"
refers to locally ordered, three dimensional structures within a
polypeptide. These structures are commonly known as domains.
Domains are portions of a polypeptide that form a compact unit of
the polypeptide and are typically 15 to 350 amino acids long.
Typical domains are made up of sections of lesser organization such
as stretches of .beta.-sheet and .alpha.-helices. "Tertiary
structure" refers to the complete three dimensional structure of a
polypeptide monomer. "Quaternary structure" refers to the three
dimensional structure formed by the noncovalent association of
independent tertiary units. Anisotropic terms are also known as
energy terms.
[0078] A "label" is a composition detectable by spectroscopic,
photochemical, biochemical, immunochemical, or chemical means. For
example, useful labels include .sup.32P, fluorescent dyes,
electron-dense reagents, enzymes (e.g., as commonly used in an
ELISA), biotin, digoxigenin, or haptens and proteins for which
antisera or monoclonal antibodies are available (e.g., the
polypeptide of SEQ ID NO:1 can be made detectable, e.g., by
incorporating a radiolabel into the peptide, and used to detect
antibodies specifically reactive with the peptide).
[0079] As used herein a "nucleic acid probe or oligonucleotide" is
defined as a nucleic acid capable of binding to a target nucleic
acid of complementary sequence through one or more types of
chemical bonds, usually through complementary base pairing, usually
through hydrogen bond formation. As used herein, a probe may
include natural (i.e., A, G, C, or T) or modified bases
(7-deazaguanosine, inosine, etc.). In addition, the bases in a
probe may be joined by a linkage other than a phosphodiester bond,
so long as it does not interfere with hybridization. Thus, for
example, probes may be peptide nucleic acids in which the
constituent bases are joined by peptide bonds rather than
phosphodiester linkages. It will be understood by one of skill in
the art that probes may bind target sequences lacking complete
complementarity with the probe sequence depending upon the
stringency of the hybridization conditions. The probes are
preferably directly labeled as with isotopes, chromophores,
lumiphores, chromogens, or indirectly labeled such as with biotin
to which a streptavidin complex may later bind. By assaying for the
presence or absence of the probe, one can detect the presence or
absence of the select sequence or subsequence.
[0080] A "labeled nucleic acid probe or oligonucleotide" is one
that is bound, either covalently, through a linker or a chemical
bond, or noncovalently, through ionic, van der Waals,
electrostatic, or hydrogen bonds to a label such that the presence
of the probe may be detected by detecting the presence of the label
bound to the probe.
[0081] The term "recombinant" when used with reference, e.g., to a
cell, or nucleic acid, protein, or vector, indicates that the cell,
nucleic acid, protein or vector, has been modified by the
introduction of a heterologous nucleic acid or protein or the
alteration of a native nucleic acid or protein, or that the cell is
derived from a cell so modified. Thus, for example, recombinant
cells express genes that are not found within the native
(non-recombinant) form of the cell or express native genes that are
otherwise abnormally expressed, under expressed or not expressed at
all.
[0082] A "promoter" is defined as an array of nucleic acid control
sequences that direct transcription of a nucleic acid. As used
herein, a promoter includes necessary nucleic acid sequences near
the start site of transcription, such as, in the case of a
polymerase II type promoter, a TATA element. A promoter also
optionally includes distal enhancer or repressor elements, which
can be located as much as several thousand base pairs from the
start site of transcription. A "constitutive" promoter is a
promoter that is active under most environmental and developmental
conditions. An "inducible" promoter is a promoter that is active
under environmental or developmental regulation. The term "operably
linked" refers to a functional linkage between a nucleic acid
expression control sequence (such as a promoter, or array of
transcription factor binding sites) and a second nucleic acid
sequence, wherein the expression control sequence directs
transcription of the nucleic acid corresponding to the second
sequence.
[0083] The term "heterolbgous" when used with reference to portions
of a nucleic acid indicates that the nucleic acid comprises two or
more subsequences that are not found in the same relationship to
each other in nature. For instance, the nucleic acid is typically
recombinantly produced, having two or more sequences from unrelated
genes arranged to make a new functional nucleic acid, e.g., a
promoter from one source and a coding region from another source.
Similarly, a heterologous protein indicates that the protein
comprises two or more subsequences that are not found in the same
relationship to each other in nature (e.g., a fusion protein).
[0084] An "expression vector" is a nucleic acid construct,
generated recombinantly or synthetically, with a series of
specified nucleic acid elements that permit transcription of a
particular nucleic acid in a host cell. The expression vector can
be part of a plasmid, virus, or nucleic acid fragment. Typically,
the expression vector includes a nucleic acid to be transcribed
operably linked to a promoter.
[0085] The terms "identical" or percent "identity," in the context
of two or more nucleic acids or polypeptide sequences, refer to two
or more sequences or subsequences that are the same or have a
specified percentage of amino acid residues or nucleotides that are
the same (i.e., 60% identity, 65%, 70%, 75%, 80%, preferably 85%,
90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher identity
to an amino acid sequence such as SEQ ID NO:1 or a nucleotide
sequence such as SEQ ID NO:2 or SEQ ID NO:3), when compared and
aligned for maximum correspondence over a comparison window, or
designated region as measured using one of the following sequence
comparison algorithms or by manual alignment and visual inspection.
Such sequences are then said to be "substantially identical." This
definition also refers to the compliment of a test sequence.
Preferably, the identity exists over a region that is at least
about 25 amino acids or nucleotides in length, or more preferably
over a region that is 50-100 amino acids or nucleotides in
length.
[0086] For sequence comparison, typically one sequence acts as a
reference sequence, to which test sequences are compared. When
using a sequence comparison algorithm, test and reference sequences
are entered into a computer, subsequence coordinates are
designated, if necessary, and sequence algorithm program parameters
are designated. Default program parameters can be used, or
alternative parameters can be designated. The sequence comparison
algorithm then calculates the percent sequence identities for the
test sequences relative to the reference sequence, based on the
program parameters. For sequence comparison of nucleic acids and
proteins to CNG2B nucleic acids and proteins, the BLAST and BLAST
2.0 algorithms and the default parameters discussed below are
used.
[0087] A "comparison window", as used herein, includes reference to
a segment of any one of the number of contiguous positions selected
from the group consisting of from 20 to 600, usually about 50 to
about 200, more usually about 100 to about 150 in which a sequence
may be compared to a reference sequence of the same number of
contiguous positions after the two sequences are optimally aligned.
Methods of alignment of sequences for comparison are well-known in
the art. Optimal alignment of sequences for comparison can be
conducted, e.g., by the local homology algorithm of Smith &
Waterman, Adv. Appl. Math. 2:482 (1981), by the homology alignment
algorithm of Needleman & Wunsch, J. Mol. Biol. 48:443 (1970),
by the search for similarity method of Pearson & Lipman, Proc.
Nat'l. Acad. Sci. USA 85:2444 (1988), by computerized
implementations of these algorithms (GAP, BESTFIT, FASTA, and
TFASTA in the Wisconsin Genetics Software Package, Genetics
Computer Group, 575 Science Dr., Madison, Wis.), or by manual
alignment and visual inspection (see, e.g., Current Protocols in
Molecular Biology (Ausubel et al., eds. 1995 supplement)).
[0088] A preferred example of algorithm that is suitable for
determining percent sequence identity and sequence similarity are
the BLAST and BLAST 2.0 algorithms, which are described in Altschul
et al., Nuc. Acids Res. 25:3389-3402 (1977) and Altschul et al., J.
Mol. Biol. 215:403410 (1990), respectively. BLAST and BLAST 2.0 are
used, with the parameters described herein, to determine percent
sequence identity for the nucleic acids and proteins of the
invention. Software for performing BLAST analyses is publicly
available through the National Center for Biotechnology Information
(http://www.ncbi.nlm.nih.gov/). This algorithm involves first
identifying high scoring sequence pairs (HSPs) by identifying short
words of length W in the query sequence, which either match or
satisfy some positive-valued threshold score T when aligned with a
word of the same length in a database sequence. T is referred to as
the neighborhood word score threshold (Altschul et al., supra).
These initial neighborhood word hits act as seeds for initiating
searches to find longer HSPs containing them. The word hits are
extended in both directions along each sequence for as far as the
cumulative alignment score can be increased. Cumulative scores are
calculated using, for nucleotide sequences, the parameters M
(reward score for a pair of matching residues; always>0) and N
(penalty score for mismatching residues; always<0). For amino
acid sequences, a scoring matrix is used to calculate the
cumulative score. Extension of the word hits in each direction are
halted when: the cumulative alignment score falls off by the
quantity X from its maximum achieved value; the cumulative score
goes to zero or below, due to the accumulation of one or more
negative-scoring residue alignments; or the end of either sequence
is reached. The BLAST algorithm parameters W, T, and X determine
the sensitivity and speed of the alignment. The BLASTN program (for
nucleotide sequences) uses as defaults a wordlength (W) of 11, an
expectation (E) of 10, M=S, N=-4 and a comparison of both strands.
For amino acid sequences, the BLASTP program uses as defaults a
wordlength of 3, and expectation (E) of 10, and the BLOSUM62
scoring matrix (see Henikoff & Henikoff, Proc. Natl. Acad. Sci.
USA 89:10915 (1989)) alignments (B) of 50, expectation (E) of 10,
M=5, N=-4, and a comparison of both strands.
[0089] The BLAST algorithm also performs a statistical analysis of
the similarity between two sequences (see, e.g., Karlin &
Altschul, Proc. Nat'l. Acad. Sci. USA 90:5873-5787 (1993)). One
measure of similarity provided by the BLAST algorithm is the
smallest sum probability (P(N)), which provides an indication of
the probability by which a match between two nucleotide or amino
acid sequences would occur by chance. For example, a nucleic acid
is considered similar to a reference sequence if the smallest sum
probability in a comparison of the test nucleic acid to the
reference nucleic acid is less than about 0.2, more preferably less
than about 0.01, and most preferably less than about 0.001.
[0090] An indication that two nucleic acid sequences or
polypeptides are substantially identical is that the polypeptide
encoded by the first nucleic acid is immunologically cross reactive
with the antibodies raised against the polypeptide encoded by the
second nucleic acid, as described below. Thus, a polypeptide is
typically substantially identical to a second polypeptide, for
example, where the two peptides differ only by conservative
substitutions. Another indication that two nucleic acid sequences
are substantially identical is that the two molecules or their
complements hybridize to each other under stringent conditions, as
described below. Yet another indication that two nucleic acid
sequences are substantially identical is that the same primers can
be used to amplify the sequence.
[0091] The phrase "selectively (or specifically) hybridizes to"
refers to the binding, duplexing, or hybridizing of a molecule only
to a particular nucleotide sequence under stringent hybridization
conditions when that sequence is present in a complex mixture
(e.g., total cellular or library DNA or RNA).
[0092] The phrase "stringent hybridization conditions" refers to
conditions under which a probe will hybridize to its target
subsequence, typically in a complex mixture of nucleic acids, but
to no other sequences. Stringent conditions are sequence-dependent
and will be different in different circumstances. Longer sequences
hybridize specifically at higher temperatures. An extensive guide
to the hybridization of nucleic acids is found in Tijssen,
Techniques in Biochemistry and Molecular Biology--Hybridization
with Nucleic Probes, "Overview of principles of hybridization and
the strategy of nucleic acid assays" (1993). Generally, stringent
conditions are selected to be about 5-10.degree. C. lower than the
thermal melting point (T.sub.m) for the specific sequence at a
defined ionic strength pH. The T.sub.m is the temperature (under
defined ionic strength, pH, and nucleic concentration) at which 50%
of the probes complementary to the target hybridize to the target
sequence at equilibrium (as the target sequences are present in
excess, at T.sub.m, 50% of the probes are occupied at equilibrium).
Stringent conditions may also be achieved with the addition of
destabilizing agents such as formamide. For selective or specific
hybridization, a positive signal is at least two times background,
preferably 10 times background hybridization. Exemplary stringent
hybridization conditions can be as following: 50% formamide,
5.times.SSC, and 1% SDS, incubating at 42.degree. C., or,
5.times.SSC, 1% SDS, incubating at 65.degree. C., with wash in
0.2.times.SSC, and 0.1% SDS at 65.degree. C.
[0093] Nucleic acids that do not hybridize to each other under
stringent conditions are still substantially identical if the
polypeptides which they encode are substantially-identical. This
occurs, for example, when a copy of a nucleic acid is created using
the maximum codon degeneracy permitted by the genetic code. In such
cases, the nucleic acids typically hybridize under moderately
stringent hybridization conditions. Exemplary "moderately stringent
hybridization conditions" include a hybridization in a buffer of
40% formamide, 1 M NaCl, 1% SDS at 37.degree. C., and a wash in
1.times.SSC at 45.degree. C. A positive hybridization is at least
twice background. Those of ordinary skill will readily recognize
that alternative hybridization and wash conditions can be utilized
to provide conditions of similar stringency. Additional guidelines
for determining hybridization parameters are provided in numerous
reference, e.g., and Current Protocols in Molecular Biology, ed.
Ausubel, et al.
[0094] For PCR, a temperature of about 36.degree. C. is typical for
low stringency amplification, although annealing temperatures may
vary between about 32.degree. C. and 48.degree. C. depending on
primer length. For high stringency PCR amplification, a temperature
of about 62.degree. C. is typical, although high stringency
annealing temperatures can range from about 50.degree. C. to about
65.degree. C., depending on the primer length and specificity.
Typical cycle conditions for both high and low stringency
amplifications include a denaturation phase of 90.degree.
C.-95.degree. C. for 30 sec-2 min., an annealing phase lasting 30
sec.-2 min., and an extension phase of about 72.degree. C. for 1-2
min. Protocols and guidelines for low and high stringency
amplification reactions are provided, e.g., in Innis et al. (1990)
PCR Protocols, A Guide to Methods and Applications, Academic Press,
Inc. N.Y.).
[0095] "Antibody" refers to a polypeptide comprising a framework
region from an immunoglobulin gene or fragments thereof that
specifically binds and recognizes an antigen. The recognized
immunoglobulin genes include the kappa, lambda, alpha, gamma,
delta, epsilon, and mu constant region genes, as well as the myriad
immunoglobtilin variable region genes. Light chains are classified
as either kappa or lambda. Heavy chains are classified as gamma,
mu, alpha, delta, or epsilon, which in turn define the
immunoglobulin classes, IgG, IgM, IgA, IgD and IgE,
respectively.
[0096] An exemplary immunoglobulin (antibody) structural unit
comprises a tetramer. Each tetramer is composed of two identical
pairs of polypeptide chains, each pair having one "light" (about 25
kD) and one "heavy" chain (about 50-70 kD). The N-terminus of each
chain defines a variable region of about 100 to 110 or more amino
acids primarily responsible for antigen recognition. The terms
variable light chain (V.sub.L) and variable heavy chain (V.sub.H)
refer to these light and heavy chains respectively.
[0097] Antibodies exist, e.g., as intact immunoglobulins or as a
number of well-characterized fragments produced by digestion with
various peptidases. Thus, for example, pepsin digests an antibody
below the disulfide linkages in the hinge region to produce
F(ab)'.sub.2, a dimer of Fab which itself is a light chain joined
to V.sub.H-C.sub.H1 by a disulfide bond. The F(ab)'.sub.2 may be
reduced under mild conditions to break the disulfide linkage in the
hinge region, thereby converting the F(ab)'.sub.2 dimer into an
Fab' monomer. The Fab' monomer is essentially Fab with part of the
hinge region (see Fundamental Immunology (Paul ed., 3d ed. 1993)).
While various antibody fragments are defined in terms of the
digestion of an intact antibody, one of skill will appreciate that
such fragments may be synthesized de novo either chemically or by
using recombinant DNA methodology. Thus, the term antibody, as used
herein, also includes antibody fragments either produced by the
modification of whole antibodies, or those synthesized de novo
using recombinant DNA methodologies (e.g., single chain Fv) or
those identified using phage display libraries (see, e.g.,
McCafferty et al., Nature 348:552-554 (1990)).
[0098] For preparation of monoclonal or polyclonal antibodies, any
technique known in the art can be used (see, e.g., Kohler &
Milstein, Nature 256:495-497 (1975); Kozbor et al., Immunology
Today 4: 72 (1983); Cole et al., pp. 77-96 in Monoclonal Antibodies
and Cancer Therapy, Alan R. Liss, Inc. (1985)). Techniques for the
production of single chain antibodies (U.S. Pat. No. 4,946,778) can
be adapted to produce antibodies to polypeptides of this invention.
Also, transgenic mice, or other organisms such as other mammals,
may be used to express humanized antibodies. Alternatively, phage
display technology can be used to identify antibodies and
heteromeric Fab fragments that specifically bind to selected
antigens (see, e.g., McCafferty et al., Nature 348:552-554 (1990);
Marks et al., Biotechnology 10:779-783 (1992)).
[0099] An "anti-CNG2B" antibody is an antibody or antibody fragment
that specifically binds a polypeptide encoded by a CNG2B gene,
cDNA, or a subsequence thereof.
[0100] A "chimeric antibody" is an antibody molecule in which (a)
the constant region, or a portion thereof, is altered, replaced or
exchanged so that the antigen binding site (variable region) is
linked to a constant region of a different or altered class,
effector function and/or species, or an entirely different molecule
which confers new properties to the chimeric antibody, e.g., an
enzyme, toxin, hormone, growth factor, drug, etc.; or (b) the
variable region, or a portion thereof, is altered, replaced or
exchanged with a variable region having a different or altered
antigen specificity.
[0101] The term "immunoassay" is an assay that uses an antibody to
specifically bind an antigen. The immunoassay is characterized by
the use of specific binding properties of a particular antibody to
isolate, target, and/or quantify the antigen.
[0102] The phrase "specifically (or selectively) binds" to an
antibody or "specifically (or selectively) immunoreactive with,"
when referring to a protein or peptide, refers to a binding
reaction that is determinative of the presence of the protein in a
heterogeneous population of proteins and other biologics. Thus,
under designated immunoassay conditions, the specified antibodies
bind to a particular protein at least two times the background and
do not substantially bind in a significant amount to other proteins
present in the sample. Specific binding to an antibody under such
conditions may require an antibody that is selected for its
specificity for a particular protein. For example, polyclonal
antibodies raised to CNG2B, as shown in SEQ ID NO:1, or splice
variants, or portions thereof, can be selected to obtain only those
polyclonal antibodies that are specifically immunoreactive with
CNG2B and not with other proteins. This selection may be achieved
by subtracting out antibodies that cross-react with molecules such
as other CNG family members. In addition, polyclonal antibodies
raised to CNG2B polymorphic variants, alleles, orthologs, and
conservatively modified variants can be selected to obtain only
those antibodies that recognize CNG2B, but not other CNG family
members. In addition, antibodies to human CNG2B but not other CNG2B
orthologs can be selected in the same manner. A variety of
immunoassay formats may be used to select antibodies specifically
immunoreactive with a particular protein. For example, solid-phase
ELISA immunoassays are routinely used to select antibodies
specifically immunoreactive with a protein (see, e.g., Harlow &
Lane, Antibodies, A Laboratory Manual (1988) for a description of
immunoassay formats and conditions that can be used to determine
specific immunoreactivity). Typically a specific or selective
reaction will be at least twice background signal or noise and more
typically more than 10 to 100 times background.
[0103] The phrase "selectively associates with" refers to the
ability of a nucleic acid to "selectively hybridize" with another
as defined above, or the ability of an antibody to "selectively (or
specifically) bind to a protein, as defined above.
[0104] By "host cell" is meant a cell that contains an expression
vector and supports the replication or expression of the expression
vector. Host cells may be prokaryotic cells such as E. coli, or
eukaryotic cells such as yeast, insect, amphibian, or mammalian
cells such as CHO, HeLa and the like, e.g., cultured cells,
explants, and cells in vivo.
[0105] "Biological sample" as used herein is a sample of biological
tissue or fluid that contains CNG2B polypeptides or nucleic acid
encoding a CNG2B protein. Such samples include, but are not limited
to, tissue isolated from humans. Biological samples may also
include sections of tissues such as frozen sections taken for
histologic purposes. A biological sample is typically obtained from
a eukaryotic organism, preferably eukaryotes such as fungi, plants,
insects, protozoa, birds, fish, reptiles, and preferably a mammal
such as rat, mice, cow, dog, guinea pig, or rabbit, and most
preferably a primate such as chimpanzees or humans.
III. Isolating a Gene Encoding a CNG2B Polypeptide
[0106] A. General Recombinant DNA Methods
[0107] This invention relies on routine techniques in the field of
recombinant genetics. Basic texts disclosing the general methods of
use in this invention include Sambrook et al., Molecular Cloning, A
Laboratory Manual (2nd ed. 1989); Kriegler, Gene Transfer and
Expression: A Laboratory Manual (1990); and Current Protocols in
Molecular Biology (Ausubel et al., eds., 1994)).
[0108] For nucleic acids, sizes are given in either kilobases (Kb)
or base pairs (bp). These are estimates derived from agarose or
acrylamide gel electrophoresis, from sequenced nucleic acids, or
from published DNA sequences. For proteins, sizes are given in
kilodaltons (kD) or amino acid residue numbers. Proteins sizes are
estimated from gel electrophoresis, from sequenced proteins, from
derived amino acid sequences, or from published protein
sequences.
[0109] Oligonucleotides that are not commercially available can be
chemically synthesized according to the solid phase phosphoramidite
triester method first described by Beaucage & Caruthers,
Tetrahedron Letts. 22:1859-1862 (1981), using an automated
synthesizer, as described in Van Devanter el. al., Nucleic Acids
Res. 12:6159-6168 (1984). Purification of oligonucleotides is by
either native acrylamide gel electrophoresis or by anion-exchange
HPLC as described in Pearson & Reanier, J. Chrom. 255:137-149
(1983).
[0110] The sequence of the cloned genes and synthetic
oligonucleotides can be verified after cloning using, e.g., the
chain termination method for sequencing double-stranded templates
of Wallace et al., Gene 16:21-26 (1981).
[0111] B. Cloning Methods for the Isolation of Nucleotide Sequences
Encoding CNG2B Polypeptides
[0112] In general, the nucleic acid sequences encoding CNG2B and
related nucleic acid sequence homologs are cloned from cDNA and
genomic DNA libraries or isolated using amplification techniques
with oligonucleotide primers. For example, CNG2B sequences are
typically isolated from human nucleic acid (genomic or cDNA)
libraries by hybridizing with a nucleic acid probe or
polynucleotide, the sequence of which can be derived from SEQ ID
NOS:2-3. A suitable tissue from which CNG2B RNA and cDNA can be
isolated is the central nervous system (CNS). Preferably, the
template for the amplification is first strand cDNA made from some
part of the human CNS.
[0113] Amplification techniques using primers can also be used to
amplify and isolate CNG2B from DNA or RNA. The following primers
can also be used to amplify a sequence of human CNG2B:
TABLE-US-00002 (SEQ ID NO:4) GCAGATCTTTCAGAACTGTGAGGCCA (SEQ ID
NO:5) CCTGCCCTCTTCATCTTTGGAAGTTC (SEQ ID NO:6)
GCCAACATCAAGAGCCTAGGTTATTC (SEQ ID NO:7)
GGATGATCTACAGACCAAGTTTGCTCG (SEQ ID NO:8)
ATGAGCCAGGACACCAAAGTGAAGAC (SEQ ID NO:9) GTTGATGATGCTGATCTCCCCAAAG
(SEQ ID NO:10) GGATGATGAGGTTATACATGACTGGG (SEQ ID NO:11)
AGGCTAGCAACTTCCTGGCCTTGGAT (SEQ ID NO:12)
GCGAAAGCTTCCACCATGAGCCAGGACACCAAAGTG and (SEQ ID NO:13)
CATGTCTAGAATGGGGATGGGGTCACTCTGGACCT.
[0114] IV. Purification of CNG2B Polypeptides
[0115] Either naturally occurring or recombinant CNG2B can be
purified for use in functional assays. Naturally occurring CNG2B
monomers can be purified, e.g., from human tissue such as the
central nervous system or any other source of a CNG2B homolog.
Recombinant CNG2B monomers can be purified from any suitable
expression system.
[0116] The CNG2B monomers may be purified to substantial purity by
standard techniques, including selective precipitation with such
substances as ammonium sulfate; column chromatography,
immunopurification methods, and others (see, e.g., Scopes, Protein
Purification: Principles and Practice (1982); U.S. Pat. No.
4,673,641; Ausubel et al., supra; and Sambrook et al., supra).
[0117] A number of procedures can be employed when recombinant
CNG2B monomers are being purified. For example, proteins having
established molecular adhesion properties can be reversibly fused
to the CNG2B monomers. With the appropriate ligand, the CNG2B
monomers can be selectively adsorbed to a purification column and
then freed from the column in a relatively pure form. The fused
protein is then removed by enzymatic activity. Finally the CNG2B
monomers could be purified using immunoaffinity columns.
[0118] A. Purification of CNG2B Monomers from Recombinant
Bacteria
[0119] Recombinant proteins are expressed by transformed bacteria
in large amounts, typically after promoter induction; but
expression can be constitutive. Promoter induction with IPTG is one
example of an inducible promoter system. Bacteria are grown
according to standard procedures in the art. Fresh or frozen
bacteria cells are used for isolation of protein.
[0120] Proteins expressed in bacteria may form insoluble aggregates
("inclusion bodies"). Several protocols are suitable for
purification of the CNG2B monomers inclusion bodies. For example,
purification of inclusion bodies typically involves the extraction,
separation and/or purification of inclusion bodies by disruption of
bacterial cells, e.g., by incubation in a buffer of 50 mM TRIS/HCL
pH 7.5, 50 mM NaCl, 5 mM MgCl.sub.2, 1 mM DTT, 0.1 mM ATP, and 1 mM
PMSF. The cell suspension can be lysed using 2-3 passages through a
French Press, homogenized using a Polytron (Brinkman Instruments)
or sonicated on ice. Alternate methods of lysing bacteria are
apparent to hose of skill in the art (see, e.g., Sambrook et al.,
supra; Ausubel et al., supra).
[0121] If necessary, the inclusion bodies are solubilized, and the
lysed cell suspension is typically centrifuged to remove unwanted
insoluble matter. Proteins that formed the inclusion bodies may be
renatured by dilution or dialysis with a compatible buffer.
Suitable solvents include, but are not limited to urea (from about
4 M to about 8 M), formamide (at least about 80%, volume/volume
basis), and guanidine hydrochloride (from about 4 M to about 8 M).
Some solvents which are capable of solubilizing aggregate-forming
proteins, for example SDS (sodium dodecyl sulfate), 70% formic
acid, are inappropriate for use in this procedure due to the
possibility of irreversible denaturation of the proteins,
accompanied by a lack of immunogenicity and/or activity. Although
guanidine hydrochloride and similar agents are denaturants, this
denaturation is not irreversible and renaturation may occur upon
removal (by dialysis, for example) or dilution of the denaturant,
allowing re-formation of immunologically and/or biologically active
protein. Other suitable buffers are known to those skilled in the
art. Human CNG monomers are separated from other bacterial proteins
by standard separation techniques, e.g., with Ni-NTA agarose
resin.
[0122] Alternatively, it is possible to purify the CNG2B monomers
from bacteria periplasm. After lysis of the bacteria, when the
CNG2B monomers are exported into the periplasm of the bacteria, the
periplasmic fraction of the bacteria can be isolated by cold
osmotic shock in addition to other methods known to skill in the
art. To isolate recombinant proteins from the periplasm, the
bacterial cells are centrifuged to form a pellet. The pellet is
resuspended in a buffer containing 20% sucrose. To lyse the cells,
the bacteria are centrifuged and the pellet is resuspended in
ice-cold 5 mM MgSO.sub.4 and kept in an ice bath for approximately
10 minutes. The cell suspension is centrifuged and the supernatant
decanted and saved. The recombinant proteins present in the
supernatant can be separated from the host proteins by standard
separation techniques well known to those of skill in the art.
[0123] B. Standard Protein Separation Techniques for Purifying
CNG2B Monomers
[0124] Solubility Fractionation
[0125] Often as an initial step, particularly if the protein
mixture is complex, an initial salt fractionation can separate many
of the unwanted host cell proteins (or proteins derived from the
cell culture media) from the recombinant protein of interest. The
preferred salt is ammonium sulfate. Ammonium sulfate precipitates
proteins by effectively reducing the amount of water in the protein
mixture. Proteins then precipitate on the basis of their
solubility. The more hydrophobic a protein is, the more likely it
is to precipitate at lower ammonium sulfate concentrations. A
typical protocol includes adding saturated ammonium sulfate to a
protein solution so that the resultant ammonium sulfate
concentration is between 20-30%. This concentration will
precipitate the most hydrophobic of proteins. The precipitate is
then discarded (unless the protein of interest is hydrophobic) and
ammonium sulfate is added to the supernatant to a concentration
known to precipitate the protein of interest. The precipitate is
then solubilized in buffer and the excess salt removed if
necessary, either through dialysis or diafiltration. Other methods
that rely on solubility of proteins, such as cold ethanol
precipitation, are well known to those of skill in the art and can
be used to fractionate complex protein mixtures.
[0126] Size Differential Filtration
[0127] The molecular weight of the CNG2B monomers (e.g.,
approximately 92 kD) can be used to isolate it from proteins of
greater and lesser size using ultrafiltration through membranes of
different pore size (for example, Amicon or Millipore membranes).
As a first step, the protein mixture is ultrafiltered through a
membrane with a pore size that has a lower molecular weight cut-off
than the molecular weight of the protein of interest. The retentate
of the ultrafiltration is then ultrafiltered against a membrane
with a molecular cut off greater than the molecular weight of the
protein of interest. The recombinant protein will pass through the
membrane into the filtrate. The filtrate can then be
chromatographed as described below.
[0128] Column Chromatography
[0129] The CNG2B monomers can also be separated from other proteins
on the basis of size, net surface charge, hydrophobicity, and
affinity for ligands. In addition, antibodies raised against
proteins can be conjugated to column matrices and the proteins
immunopurified. All of these methods are well known in the art. It
will be apparent to one of skill that chromatographic techniques
can be performed at any scale and using equipment from many
different manufacturers (e.g., Pharmacia Biotech).
V. Immunological Detection of CNG2B Polypeptides
[0130] In addition to the detection of CNG2B genes and gene
expression using nucleic acid hybridization technology, one can
also use immunoassays to detect the CNG2B monomers of the
invention. Immunoassays can be used to qualitatively or
quantitatively analyze the CNG2B monomers. A general overview of
the applicable technology can be found in Harlow & Lane,
Antibodies: A Laboratory Manual (1988).
[0131] A. Antibodies to CNG2B Monomers
[0132] Methods of producing polyclonal and monoclonal antibodies
that react specifically with CNG2B monomers, or CNG2B monomers from
particular species such as human CNG2B, are known to those of skill
in the art (see, e.g., Coligan, Current Protocols in Immunology
(1991); Harlow & Lane, supra; Goding, Monoclonal Antibodies:
Principles and Practice (2d ed. 1986); and Kohler & Milstein,
Nature 256:495-497 (1975). Such techniques include antibody
preparation by selection of antibodies from libraries of
recombinant antibodies in phage or similar vectors, as well as
preparation of polyclonal and monoclonal antibodies by immunizing
rabbits or mice (see, e.g., Huse et al., Science 246:1275-1281
(1989); Ward et al., Nature 341:544-546 (1989)).
[0133] A number of immunogens comprising portions of CNG2B monomers
may be used to produce antibodies specifically reactive with CNG2B
monomers. For example, recombinant CNG2B monomers or an antigenic
fragment thereof can be isolated as described herein. Recombinant
protein can be expressed in eukaryotic or prokaryotic cells as
described above, and purified as generally described above.
Recombinant protein is the preferred immunogen for the production
of monoclonal or polyclonal antibodies. Alternatively, a synthetic
peptide derived from the sequences disclosed herein and conjugated
to a carrier protein can be used an immunogen. Naturally occurring
protein may also be used either in pure or impure form. The product
is then injected into an animal capable of producing antibodies.
Either monoclonal or polyclonal antibodies may be generated, for
subsequent use in immunoassays to measure the protein.
[0134] Methods of production of polyclonal antibodies are known to
those of skill in the art. An inbred strain of mice (e.g., BALB/C
mice) or rabbits is immunized with the protein using a standard
adjuvant, such as Freund's adjuvant, and a standard immunization
protocol. The animal's immune response to the immunogen preparation
is monitored by taking test bleeds and determining the titer of
reactivity to the beta subunits. When appropriately high titers of
antibody to the immunogen are obtained, blood is collected from the
animal and antisera are prepared. Further fractionation of the
antisera to enrich for antibodies reactive to the protein can be
done if desired (see, Harlow & Lane, supra).
[0135] Monoclonal antibodies may be obtained by various techniques
familiar to those skilled in the art. Briefly, spleen cells from an
animal immunized with a desired antigen are immortalized, commonly
by fusion with a myeloma cell (see, Kohler & Milstein, Eur. J.
Immunol. 6:511-519 (1976)). Alternative methods of immortalization
include transformation with Epstein Barr Virus, oncogenes, or
retroviruses, or other methods well known in the art. Colonies
arising from single immortalized cells are screened for production
of antibodies of the desired specificity and affinity for the
antigen, and yield of the monoclonal antibodies produced by such
cells may be enhanced by various techniques, including injection
into the peritoneal cavity of a vertebrate host. Alternatively, one
may isolate DNA sequences which encode a monoclonal antibody or a
binding fragment thereof by screening a DNA library from human B
cells according to the general protocol outlined by Huse, et al,
Science 246:1275-1281 (1989).
[0136] Monoclonal antibodies and polyclonal sera are collected and
titered against the immunogen protein in an immunoassay, for
example, a solid phase immunoassay with the immunogen immobilized
on a solid support. Typically, polyclonal antisera with a titer of
10.sup.4 or greater are selected and tested for their cross
reactivity against non-CNG family proteins and other CNG family
proteins, using a competitive binding immunoassay. Specific
polyclonal antisera and monoclonal antibodies will usually bind
with a K.sub.d of at least about 0.1 mM, more usually at least
about 1 M, preferably at least about 0.1 M or better, and most
preferably, 0.01 M or better. Antibodies specific only for a
particular CNG2B ortholog, such as human CNG2B, can also be made,
by subtracting out other cross-reacting orthologs from a species
such as a non-human mammal.
[0137] Once the specific antibodies against a CNG2B are available,
the CNG2B can be detected by a variety of immunoassay methods. For
a review of immunological and immunoassay procedures, see Basic and
Clinical Immunology (Stites & Terr eds., 7.sup.th ed. 1991).
Moreover, the immunoassays of the present invention can be
performed in any of several configurations, which are reviewed
extensively in Enzyme Immunoassay (Maggio, ed., 1980); and Harlow
& Lane, supra.
[0138] B. Immunological Binding Assays
[0139] The CNG2B polypeptides of the invention can be detected
and/or quantified using any of a number of well recognized
immunological binding assays (see, e.g., U.S. Pat. Nos. 4,366,241;
4,376,110; 4,517,288; and 4,837,168). For a review of the general
immunoassays, see also Methods in Cell Biology: Antibodies in Cell
Biology, volume 37 (Asai, ed. 1993); Basic and Clinical Immunology
(Stites & Terr, eds., 7.sup.th ed. 1991). Immunological binding
assays (or immunoassays) typically use an antibody that
specifically binds to a protein or antigen of choice (in this case
the CNG2B or an antigenic subsequence thereof). The antibody (e.g.,
anti-CNG2B) may be produced by any of a number of means well known
to those of skill in the art and as described above.
[0140] Immunoassays also often use a labeling agent to specifically
bind to and label the complex formed by the antibody and antigen.
The labeling agent may itself be one of the moieties comprising the
antibody/antigen complex. Thus, the labeling agent may be a labeled
CNG2B polypeptide or a labeled anti-CNG2B antibody. Alternatively,
the labeling agent may be a third moiety, such a secondary
antibody, which specifically binds to the antibody/CNG2B complex (a
secondary antibody is typically specific to antibodies of the
species from which the first antibody is derived). Other proteins
capable of specifically binding immunoglobulin constant regions,
such as protein A or protein G may also be used as the label agent.
These proteins exhibit a strong non-immunogenic reactivity with
immunoglobulin constant regions from a variety of species (see,
e.g., Kronval et al., J. Immunol. 111:1401-1406 (1973); Akerstrom
et al., J. Immunol. 135:2589-2542 (1985)). The labeling agent can
be modified with a detectable moiety, such as biotin, to which
another molecule can specifically bind, such as streptavidin. A
variety of detectable moieties are well known to those skilled in
the art.
[0141] Throughout the assays, incubation and/or washing steps may
be required after each combination of reagents. Incubation steps
can vary from about 5 seconds to several hours, preferably from
about 5 minutes to about 24 hours. However, the incubation time
will depend upon the assay format, antigen, volume of solution,
concentrations, and the like. Usually, the assays will be carried
out at ambient temperature, although they can be conducted over a
range of temperatures, such as 10.degree. C. to 40.degree. C.
[0142] Non-Competitive Assay Formats
[0143] Immunoassays for detecting the CNG2B in samples may be
either competitive or noncompetitive. Noncompetitive immunoassays
are assays in which the amount of antigen is directly measured. In
one preferred "sandwich" assay, for example, the anti-CNG2B subunit
antibodies can be bound directly to a solid substrate on which they
are immobilized. These immobilized antibodies then capture CNG2B
present in the test sample. The CNG2B monomers are thus immobilized
and then bound by a labeling agent, such as a second CNG2B antibody
bearing a label. Alternatively, the second antibody may lack a
label, but it may, in turn, be bound by a labeled third antibody
specific to antibodies of the species from which the second
antibody is derived. The second or third antibody is typically
modified with a detectable moiety, such as biotin, to which another
molecule specifically binds, e.g., streptavidin, to provide a
detectable moiety.
[0144] Competitive Assay Formats
[0145] In competitive assays, the amount of the CNG2B present in
the sample is measured indirectly by measuring the amount of known,
added (exogenous) CNG2B displaced (competed away) from an
anti-CNG2B antibody by the unknown CNG2B present in a sample. In
one competitive assay, a known amount of the CNG2B is added to a
sample and the sample is then contacted with an antibody that
specifically binds to the CNG2B. The amount of exogenous CNG2B
bound to the antibody is inversely proportional to the
concentration of the CNG2B present in the sample. In a particularly
preferred embodiment, the antibody is immobilized on a solid
substrate. The amount of CNG2B bound to the antibody may be
determined either by measuring the amount of CNG2B present in a
CNG2B/antibody complex, or alternatively by measuring the amount of
remaining uncomplexed protein. The amount of CNG2B may be detected
by providing a labeled CNG2B molecule.
[0146] A hapten inhibition assay is another preferred competitive
assay. In this assay the known CNG2B is immobilized on a solid
substrate. A known amount of anti-CNG2B antibody is added to the
sample, and the sample is then contacted with the immobilized
CNG2B. The amount of anti-CNG2B antibody bound to the known
immobilized CNG2B is inversely proportional to the amount of CNG2B
present in the sample. Again, the amount of immobilized antibody
may be detected by detecting either the immobilized fraction of
antibody or the fraction of the antibody that remains in solution.
Detection may be direct where the antibody is labeled or indirect
by the subsequent addition of a labeled moiety that specifically
binds to the antibody as described above.
[0147] Cross-Reactivity Determinations
[0148] Immunoassays in the competitive binding format can also be
used for crossreactivity determinations for CNG2B. For example, a
CNG2B protein at least partially corresponding to an amino acid
sequence of SEQ ID NO:1 or an immunogenic region thereof can be
immobilized to a solid support. Other proteins such as other CNG
family members are added to the assay so as to compete for binding
of the antisera to the immobilized antigen. The ability of the
added proteins to compete for binding of the antisera to the
immobilized protein is compared to the ability of the CNG2B or
immunogenic portion thereof to compete with itself. The percent
crossreactivity for the above proteins is calculated, using
standard calculations. Those antisera with less than 10%
crossreactivity with each of the added proteins listed above are
selected and pooled. The cross-reacting antibodies are optionally
removed from the pooled antisera by immunoabsorption with the added
considered proteins, e.g., distantly related homologs. Antibodies
that specifically bind only to particular orthologs of CNG2B, such
as human CNG2B, can also be made using this methodology.
[0149] The immunoabsorbed and pooled antisera are then used in a
competitive binding immunoassay as described above to compare a
second protein, thought to be perhaps an allele, ortholog, or
polymorphic variant of CNG2B, to the immunogen protein. In order to
make this comparison, the two proteins are each assayed at a wide
range of concentrations and the amount of each protein required to
inhibit 50% of the binding of the antisera to the immobilized
protein is determined. If the amount of the second protein required
to inhibit 50% of binding is less than 10 times the amount of the
protein encoded by CNG2B that is required to inhibit 50% of
binding, then the second protein is said to specifically bind to
the polyclonal antibodies generated to the respective CNG2B
immunogen.
[0150] Other Assay Formats
[0151] Western blot (immunoblot) analysis is used to detect and
quantify the presence of the CNG2B in the sample. The technique
generally comprises separating sample proteins by gel
electrophoresis on the basis of molecular weight, transferring the
separated proteins to a suitable solid support, (such as a
nitrocellulose filter, a nylon filter, or derivatized nylon
filter), and incubating the sample with the antibodies that
specifically bind CNG2B. The anti-CNG2B antibodies specifically
bind to CNG2B on the solid support. These antibodies may be
directly labeled or alternatively may be subsequently detected
using labeled antibodies (e.g., labeled sheep anti-mouse
antibodies) that specifically bind to the anti-CNG2B
antibodies.
[0152] Other assay formats include liposome immunoassays (LIA),
which use liposomes designed to bind specific molecules (e.g.,
antibodies) and release encapsulated reagents or markers. The
released chemicals are then detected according to standard
techniques (see, Monroe et al., Amer. Clin. Prod. Rev. 5:34-41
(1986)).
[0153] Reduction of Non-Specific Binding
[0154] One of skill in the art will appreciate that it is often
desirable to minimize non-specific binding in immunoassays.
Particularly, where the assay involves an antigen or antibody
immobilized on a solid substrate it is desirable to minimize the
amount of non-specific binding to the substrate. Means of reducing
such non-specific binding are well known to those of skill in the
art. Typically, this technique involves coating the substrate with
a proteinaceous composition. In particular, protein compositions
such as bovine serum albumin (BSA), nonfat powdered milk, and
gelatin are widely used with powdered milk being most
preferred.
[0155] Labels
[0156] The particular label or detectable group used in the assay
is not a critical aspect of the invention, as long as it does not
significantly interfere with the specific binding of the antibody
used in the assay. The detectable group can be any material having
a detectable physical or chemical property. Such detectable labels
have been well-developed in the field of immunoassays and, in
general, most any label useful in such methods can be applied to
the present invention. Thus, a label is any composition detectable
by spectroscopic, photochemical, biochemical, immunochemical,
electrical, optical or chemical means. Useful labels in the present
invention include magnetic beads (e.g., DYNABEADS.TM.), fluorescent
dyes (e.g., fluorescein isothiocyanate, Texas red, rhodamine, and
the like), radiolabels (e.g., .sup.3H, .sup.125I, .sup.35S,
.sup.14C, or .sup.32P), enzymes (e.g., horse radish peroxidase,
alkaline phosphatase and others commonly used in an ELISA), and
calorimetric labels such as colloidal gold or colored glass or
plastic beads (e.g., polystyrene, polypropylene, latex, etc.).
[0157] The label may be coupled directly or indirectly to the
desired component of the assay according to methods well known in
the art. As indicated above, a wide variety of labels may be used,
with the choice of label depending on sensitivity required, ease of
conjugation with the compound, stability requirements, available
instrumentation, and disposal provisions.
[0158] Non-radioactive labels are often attached by indirect means.
Generally, a ligand molecule (e.g., biotin) is covalently bound to
the molecule. The ligand then binds to another molecule (e.g.,
streptavidin), which is either inherently detectable or covalently
bound to a signal system, such as a detectable enzyme, a
fluorescent compound, or a chemiluminescent compound. The ligands
and their targets can be used in any suitable combination with
antibodies that recognize CNG2B, or secondary antibodies that
recognize anti-CNG2B antibodies.
[0159] The molecules can also be conjugated directly to signal
generating compounds, e.g., by conjugation with an enzyme or
fluorophore. Enzymes of interest as labels will primarily be
hydrolases, particularly phosphatases, esterases and glycosidases,
or oxidases, particularly peroxidases. Fluorescent compounds
include fluorescein and its derivatives, rhodamine and its
derivatives, dansyl, umbelliferone, etc. Chemiluminescent compounds
include luciferin, and 2,3-dihydrophthalazinediones, e.g., luminol.
For a review of various labeling or signal producing systems that
may be used, see, U.S. Pat. No. 4,391,904.
[0160] Means of detecting labels are well known to those of skill
in the art. Thus, for example, where the label is a radioactive
label, means for detection include a scintillation counter or
photographic film as in autoradiography. Where the label is a
fluorescent label, it may be detected by exciting the fluorochrome
with the appropriate wavelength of light and detecting the
resulting fluorescence. The fluorescence may be detected visually,
by means of photographic film, by the use of electronic detectors
such as charge coupled devices (CCDs) or photomultipliers and the
like. Similarly, enzymatic labels may be detected by providing the
appropriate substrates for the enzyme and detecting the resulting
reaction product. Finally, simple colorimetric labels may be
detected simply by observing the color associated with the label.
Thus, in various dipstick assays, conjugated gold often appears
pink, while various conjugated beads appear the color of the
bead.
[0161] Some assay formats do not require the use of labeled
components. For instance, agglutination assays can be used to
detect the presence of the target antibodies. In this case,
antigen-coated particles are agglutinated by samples comprising the
target antibodies. In this format, none of the components need be
labeled and the presence of the target antibody is detected by
simple visual inspection.
VI. Assays for Modulators of CNG2B
[0162] A. Assays
[0163] Introduction
[0164] Human CNG2B and CNG2B alleles, orthologs, and polymorphic
variants are subunits of cation channels. The activity of a cation
channel comprising CNG2B can be assessed using a variety of in
vitro and in vivo assays, e.g., measuring current, measuring
membrane potential, measuring ion flux, e.g., cations such as
sodium or calcium, measuring ion concentration, measuring second
messengers and transcription levels, measuring ligand binding, and
using, e.g., voltage-sensitive dyes, ion sensitive dyes such as
cation (e.g., sodium or calcium) sensitive dyes, radioactive
tracers, and patch-clamp electrophysiology.
[0165] In preferred embodiments, the activity of a CNG cation
channel will be detected by detecting cation, e.g., calcium or
sodium, concentration or flux using an ion (e.g., calcium or
sodium) specific dye, e.g., a fluorescent dye. Any such dye, a
large number of which are well known to those of skill in the art,
can be used. For example, any of a number of fluorescent probes
that show a spectral response upon binding Ca.sup.2+ allowing the
detection of changes in intracellular free Ca.sup.2+ concentrations
using fluorescence microscopy, flow cytometry or fluorescence
spectroscopy, can be used.
[0166] Furthermore, such assays can be used to test for inhibitors
and activators of channels comprising CNG2B. Such modulators of a
cation channel are useful for treating various disorders involving
cation channels, e.g., neurological disorders, e.g., of the central
nervous system. Such modulators are also useful for investigation
of the channel diversity provided by CNG family members and the
regulation/modulation of cation channel activity provided by CNG
family members such as CNG2B.
[0167] Modulators of the CNG cation channels are tested using
biologically active CNG2B, either recombinant or naturally
occurring, preferably human CNG2B. CNG2B can be isolated,
co-expressed or expressed in a cell, or expressed in a membrane
derived from a cell. In such assays, CNG2B can be expressed alone
to form a homomultimeric cation channel, or in combination with
other CNG proteins, including alpha and/or beta subunits, to form a
heteromultimeric cation channel. Preferably, the CNG2B polypeptide
that is a part of the cation channel used in the assay will have
the sequence displayed in SEQ ID NO:1 or a conservatively modified
variant thereof. Generally, the amino acid sequence identity of the
polypeptide to SEQ ID NO:1 will be at least 60%, 65%, 70%, 75%,
80%, preferably 85%, or 90%, most preferably at least 95% or
higher.
[0168] Modulation is tested using one of the in vitro or in vivo
assays described herein Samples or assays that are treated with a
potential cation channel inhibitor or activator are compared to
control samples without the test compound, to examine the extent of
modulation. Often, such assays are performed in the presence of a
cyclic nucleotide, e.g., cAMP or cGMP, and the ability of the test
agent to modulate the effect of the cyclic nucleotide on the
channel is detected.
[0169] Control samples (untreated with activators or inhibitors)
are assigned a relative cation channel activity value of 100.
Inhibition of channels comprising a CNG2B polypeptide is achieved
when the cation channel activity value relative to the control is
about 90%, preferably 50%, more preferably 25%. Activation of
channels comprising a CNG2B polypeptide is achieved when the cation
channel activity value relative to the control is 110%, more
preferably 150%, more preferable 200% higher. Compounds that
increase the flux of ions will cause a detectable increase in the
ion current density by increasing the probability of a channel
comprising a CNG2B polypeptide being open, by decreasing the
probability of it being closed, by increasing conductance through
the channel, and/or by allowing the passage of ions.
[0170] In Vitro Assays
[0171] Assays to identify compounds with cation channel modulating
activity can be performed in vitro, e.g., binding assays and
biochemical assays. Purified recombinant or naturally occurring
CNG2B protein, or a channel comprising CNG2B protein, can be used
in the in vitro methods of the invention. In addition to purified
CNG2B protein or channel comprising the same, the recombinant or
naturally occurring CNG2B protein can be part of a cellular lysate
or a cell membrane. As described below, the assay can be either
solid state or soluble. Preferably, the protein or membrane is
bound to a solid support, either covalently or non-covalently.
Often, the in vitro assays of the invention are ligand or toxin
binding or ligand affinity assays, either non-competitive or
competitive. Other in vitro assays include measuring changes in
spectroscopic (e.g., fluorescence, absorbance, refractive index),
hydrodynamic (e.g., shape), chromatographic, or solubility
properties for the protein or channel. Cell membranes or lysates
can also be used to measure changes in polarization (i.e.,
electrical potential) of the cell or membrane expressing the cation
channel comprising a CNG2B polypeptide, as described below.
[0172] In Vivo Cell- or Membrane Based Assays
[0173] Changes in ion flux may be assessed by determining changes
in polarization (i.e., electrical potential) of the cell or
membrane expressing the cation channel comprising a CNG2B
polypeptide. A preferred means to determine changes in cellular
polarization is by measuring changes in current (thereby measuring
changes in polarization) with voltage-clamp and patch-clamp
techniques, e.g., the "cell-attached" mode, the "inside-out" mode,
and the "whole cell" mode (see, e.g., Ackerman et al., New Engl. J.
Med. 336:1575-1595 (1997)). Whole cell currents are conveniently
determined using standard methodology (see, e.g., Hamil et al.,
PFlugers. Archiv. 391:85 (1981). Other known assays include
fluorescence assays using ion sensitive dyes (see, e.g.,
Vestergarrd-Bogind et al., J. Membrane Biol. 88:67-75 (1988);
Daniel et al., J. Pharmacol. Meth. 25:185-193 (1991); Holevinsky et
al., J. Membrane Biology 137:59-70 (1994)).
[0174] Examples of such dyes useful for the detection of calcium
include, but are not limited to, fura-2, bis-fura 2, indo-1,
Quin-2, Quin-2 AM, Benzothiaza-1, Benzothiaza-2, indo-5F, Fura-FF,
BTC, Mag-Fura-2, Mag-Fura-5, Mag-Indo-1, fluo-3, rhod-2, fura-4F,
fura-5F, fura-6F, fluo-4, fluo-5F, fluo-5N, Oregon Green 488 BAPTA,
Calcium Green, Calcein, Fura-C18, Calcium Green-C18, Calcium
Orange, Calcium Crimson, Calcium Green-5N, Magnesium Green, Oregon
Green 488 BAPTA-1, Oregon Green 488 BAPTA-2, X-rhod-1, Fura Red,
Rhod-5F, Rhod-5N, X-Rhod-5N, Mag-Rhod-2, Mag-X-Rhod-1, Fluo-5N,
Fluo-5F, Fluo4FF, Mag-Fluo-4, Aequorin, dextran conjugates or any
other derivatives of any of these dyes, and others (see, e.g., the
catalog or Internet site (www.probes.com) for Molecular Probes,
Eugene, Oreg.; see, also, Nuccitelli, ed., Methods in Cell Biology,
Volume 40: A Practical Guide to the Study of Calcium in Living
Cells, Academic Press (1994); Lambert, ed., Calcium Signaling
Protocols (Methods in Molecular Biology Volume 114), Humana Press
(1999); W. T. Mason, ed., Fluorescent and Luminescent Probes for
Biological Activity. A Practical Guide to Technology for
Quantitative Real-Time Analysis, Second Ed, Academic Press (1999)).
Examples of sodium indicators include, but are not limited to,
SBFI, and Sodium Green (see, e.g., Molecular probes catalog or
Internet site; Mason, supra).
[0175] Assays for compounds capable of inhibiting or increasing
cation flux through the channel proteins comprising a CNG2B
polypeptide can be performed by application of the compounds to a
bath solution in contact with and comprising cells having a channel
of the present invention (see, e.g., Blatz et al., Nature
323:718-720 (1986); Park, J. Physiol. 481:555-570 (1994)).
Generally, the compounds to be tested are present in the range from
1 pM to 100 mM.
[0176] The effects of the test compounds upon the function of the
channels can be measured by changes in the electrical currents or
ionic flux or by the consequences of changes in currents and flux.
Changes in electrical current or ionic flux are measured by either
increases or decreases in flux of ions such as sodium or calcium
ions. The ions can be measured in a variety of standard ways. They
can be measured directly by concentration changes of the ions,
e.g., changes in intracellular concentrations, e.g., using any of
the dyes listed supra, or radiolabeled ions, or indirectly by
membrane potential. Consequences of the test compound on ion flux
can be quite varied. Accordingly, any suitable physiological change
can be used to assess the influence of a test compound on the
channels of this invention. The effects of a test compound can be
measured by a toxin binding assay. One can also measure a variety
of effects such as transmitter release (e.g., dopamine),
intracellular calcium changes, hormone release (e.g., insulin),
transcriptional changes to both known and uncharacterized genetic
markers (e.g., northern blots), cell volume changes (e.g., in red
blood cells), immunoresponses (e.g., T cell activation), changes in
cell metabolism such as cell growth or pH changes, and changes in
intracellular second messengers such as cyclic nucleotides.
[0177] CNG2B orthologs, alleles, polymorphic variants, and
conservatively modified variants will generally confer
substantially similar properties on a channel comprising a CNG2B
polypeptide, as described above. In a preferred embodiment, the
cell placed in contact with a compound that is suspected to be a
CNG2B homolog is assayed for increasing or decreasing ion flux in a
eukaryotic cell, e.g., an oocyte of Xenopus (e.g., Xenopus laevis)
or a mammalian cell such as a CHO or HeLa cell. Channels that are
affected by compounds in ways similar to CNG2B are considered
homologs or orthologs of CNG2B.
[0178] Animal Models
[0179] Animal models also find use in screening for cation channel
modulators. Transgenic animal technology, including gene knockout
technology as a result of homologous recombination with an
appropriate gene targeting vector, or gene overexpression, will
result in the absence or increased expression of the CNG2B protein.
When desired, tissue-specific expression or knockout of the CNG2B
protein may be necessary. Transgenic animals generated by such
methods find use as animal models of abnormal ion flux and are
additionally useful in screening for modulators of cation
channels.
[0180] B. Modulators
[0181] The compounds tested as modulators of CNG channels
comprising a CNG2B subunit can be any small organic molecule, or a
biological entity, such as a protein, peptide, sugar, nucleic acid,
oligonucleotide, or lipid. Alternatively, modulators can be
genetically altered versions of a CNG2B subunit. Typically, test
compounds will be small chemical molecules and peptides.
Essentially any chemical compound can be used as a potential
modulator or ligand in the assays of the invention, although most
often compounds can be dissolved in aqueous or organic (especially
DMSO-based) solutions are used. The assays are designed to screen
large chemical libraries by automating the assay steps and
providing compounds from any convenient source to assays, which are
typically run in parallel (e.g., in microtiter formats on
microtiter plates in robotic assays). It will be appreciated that
there are many suppliers of chemical compounds, including Sigma
(St. Louis, Mo.), Aldrich (St. Louis, Mo.), Sigma-Aldrich (St.
Louis, Mo.), Fluka Chemika-Biochemica Analytika (Buchs Switzerland)
and the like.
[0182] In one preferred embodiment, high throughput screening
methods involve providing a combinatorial chemical or peptide
library containing a large number of potential therapeutic
compounds (potential modulator or ligand compounds). Such
"combinatorial chemical libraries" or "ligand libraries" are then
screened in one or more assays, as described herein, to identify
those library members (particular chemical species or subclasses)
that display a desired characteristic activity. The compounds thus
identified can serve as conventional "lead compounds" or can
themselves be used as potential or actual therapeutics.
[0183] A combinatorial chemical library is a collection of diverse
chemical compounds generated by either chemical synthesis or
biological synthesis, by combining a number of chemical "building
blocks" such as reagents. For example, a linear combinatorial
chemical library such as a polypeptide library is formed by
combining a set of chemical building blocks (amino acids) in every
possible way for a given compound length (i.e., the number of amino
acids in a polypeptide compound). Millions of chemical compounds
can be synthesized through such combinatorial mixing of chemical
building blocks.
[0184] Preparation and screening of combinatorial chemical
libraries is well known to those of skill in the art. Such
combinatorial chemical libraries include, but are not limited to,
peptide libraries (see, e.g., U.S. Pat. No. 5,010,175, Furka, Int.
J. Pept. Prot. Res. 37:487-493 (1991) and Houghton et al., Nature
354:84-88 (1991)). Other chemistries for generating chemical
diversity libraries can also be used. Such chemistries include, but
are not limited to: peptoids (e.g., PCT Publication No. WO
91/19735), encoded peptides (e.g., PCT Publication No. WO
93/20242), random bio-oligomers (e.g. PCT Publication No. WO
92/00091), benzodiazepines (e.g., U.S. Pat. No. 5,288,514),
diversomers such as hydantoins, benzodiazepines and dipeptides
(Hobbs et al., Proc. Nat. Acad. Sci. USA 90:6909-6913 (1993)),
vinylogous polypeptides (Hagihara et al., J. Amer. Chem. Soc.
114:6568 (1992)), nonpeptidal peptidomimetics with glucose
scaffolding (Hirschmann et al., J. Amer. Chem. Soc. 114:9217-9218
(1992)), analogous organic syntheses of small compound libraries
(Chen et al., J. Amer. Chem. Soc. 116:2661 (1994)), oligocarbamates
(Cho et al., Science 261:1303 (1993)), and/or peptidyl phosphonates
(Campbell et al., J. Org. Chem. 59:658 (1994)), nucleic acid
libraries (see Ausubel, Berger and Sambrook, all supra), peptide
nucleic acid libraries (see, e.g., U.S. Pat. No. 5,539,083),
antibody libraries (see, e.g., Vaughn et al., Nature Biotechnology,
14(3):309-314 (1996) and PCT/US96/10287), carbohydrate libraries
(see, e.g., Liang et al., Science, 274:1520-1522 (1996) and U.S.
Pat. No. 5,593,853), small organic molecule libraries (see, e.g.,
benzodiazepines, Baum C&EN, Jan 18, page 33 (1993);
isoprenoids, U.S. Pat. No. 5,569,588; thiazolidinones and
metathiazanones, U.S. Pat. No. 5,549,974; pyrrolidines, U.S. Pat.
Nos. 5,525,735 and 5,519,134; morpholino compounds, U.S. Pat. No.
5,506,337; benzodiazepines, 5,288,514, and the like).
[0185] Devices for the preparation of combinatorial libraries are
commercially available (see, e.g., 357 MPS, 390 MPS, Advanced Chem
Tech, Louisville Ky., Symphony, Rainin, Woburn, Mass., 433A Applied
Biosystems, Foster City, Calif., 9050 Plus, Millipore, Bedford,
Mass.). In addition, numerous combinatorial libraries are
themselves commercially available (see, e.g., ComGenex, Princeton,
N.J., Asinex, Moscow, Ru, Tripos, Inc., St. Louis, Mo., ChemStar,
Ltd, Moscow, RU, 3D Pharmaceuticals, Exton, Pa., Martek
Biosciences, Columbia, Md., etc.).
[0186] In one embodiment, the invention provides solid phase based
in vitro assays in a high throughput format, where the cell or
tissue expressing a CNG channel comprising a human CNG2B subunit is
attached to a solid phase substrate. In the high throughput assays
of the invention, it is possible to screen up to several thousand
different modulators or ligands in a single day. In particular,
each well of a microtiter plate can be used to run a separate assay
against a selected potential modulator, or, if concentration or
incubation time effects are to be observed, every 5-10 wells can
test a single modulator. Thus, a single standard microtiter plate
can assay about 96 modulators. If 1536 well plates are used, then a
single plate can easily assay from about 100-about 1500 different
compounds. It is possible to assay many plates per day; assay
screens for up to about 6,000, 20,000, 50,000, or 100,000 or more
different compounds are possible using the integrated systems of
the invention.
[0187] C. Solid State and Soluble High Throughput Assays
[0188] In one embodiment the invention provides soluble assays
using cation channels comprising a CNG2B polypeptide, a membrane
comprising a CNG2B cation channel, or a cell or tissue expressing
cation channels comprising a CNG2B polypeptide, either naturally
occurring or recombinant. In another embodiment, the invention
provides solid phase based in vitro assays in a high throughput
format, where a CNG2B cation channel is attached to a solid phase
substrate.
[0189] In the high throughput assays of the invention, it is
possible to screen up to several thousand different modulators or
ligands in a single day. In particular, each well of a microtiter
plate can be used to run a separate assay against a selected
potential modulator, or, if concentration or incubation time
effects are to be observed, every 5-10 wells can test a single
modulator. Thus, a single standard microtiter plate can assay about
100 (e.g., 96) modulators. If 1536 well plates are used, then a
single plate can easily assay from about 100-about 1500 different
compounds. It is possible to assay many plates per day; assay
screens for up to about 6,000, 20,000, 50,000, or more than 100,000
different compounds are possible using the integrated systems of
the invention.
[0190] The channel of interest, or a cell or membrane comprising
the channel of interest, can be bound to the solid state component,
directly or indirectly, via covalent or non covalent linkage e.g.,
via a tag. The tag can be any of a variety of components. In
general, a molecule which binds the tag (a tag binder) is fixed to
a solid support, and the tagged molecule of interest is attached to
the solid support by interaction of the tag and the tag binder.
[0191] A number of tags and tag binders can be used, based upon
known molecular interactions well described in the literature. For
example, where a tag has a natural binder, for example, biotin,
protein A, or protein G, it can be used in conjunction with
appropriate tag binders (avidin, streptavidin, neutravidin, the Fc
region of an immunoglobulin, etc.) Antibodies to molecules with
natural binders such as biotin are also widely available and
appropriate tag binders; see, SIGMA Immunochemicals 1998 catalogue
SIGMA, St. Louis Mo.).
[0192] Similarly, any haptenic or antigenic compound can be used in
combination with an appropriate antibody to form a tag/tag binder
pair. Thousands of specific antibodies are commercially available
and many additional antibodies are described in the literature. For
example, in one common configuration, the tag is a first antibody
and the tag binder is a second antibody which recognizes the first
antibody. In addition to antibody-antigen interactions,
receptor-ligand interactions are also appropriate as tag and
tag-binder pairs. For example, agonists and antagonists of cell
membrane receptors (e.g., cell receptor-ligand interactions such as
transferrin, c-kit, viral receptor ligands, cytokine receptors,
chemokine receptors, interleukin receptors, immunoglobulin
receptors and antibodies, the cadherin family, the integrin family,
the selectin family, and the like; see, e.g., Pigott & Power,
The Adhesion Molecule Facts Book I (1993)). Similarly, toxins and
venoms, viral epitopes, hormones (e.g., opiates, steroids, etc.),
intracellular receptors (e.g. which mediate the effects of various
small ligands, including steroids, thyroid hormone, retinoids and
vitamin D; peptides), drugs, lectins, sugars, nucleic acids (both
linear and cyclic polymer configurations), oligosaccharides,
proteins, phospholipids and antibodies can all interact with
various cell receptors.
[0193] Synthetic polymers, such as polyurethanes, polyesters,
polycarbonates, polyureas, polyamides, polyethyleneimines,
polyarylene sulfides, polysiloxanes, polyimides, and polyacetates
can also form an appropriate tag or tag binder. Many other tag/tag
binder pairs are also useful in assay systems described herein, as
would be apparent to one of skill upon review of this
disclosure.
[0194] Common linkers such as peptides, polyethers, and the like
can also serve as tags, and include polypeptide sequences, such as
poly-gly sequences of between about 5 and 200 amino acids. Such
flexible linkers are known to persons of skill in the art. For
example, poly(ethelyne glycol) linkers are available from
Shearwater Polymers, Inc. Huntsville, Ala. These linkers optionally
have amide linkages, sulfhydryl linkages, or heterofunctional
linkages.
[0195] Tag binders are fixed to solid substrates using any of a
variety of methods currently available. Solid substrates are
commonly derivatized or functionalized by exposing all or a portion
of the substrate to a chemical reagent which fixes a chemical group
to the surface which is reactive with a portion of the tag binder.
For example, groups which are suitable for attachment to a longer
chain portion would include amines, hydroxyl, thiol, and carboxyl
groups. Aminoalkylsilanes and hydroxyalkylsilanes can be used to
functionalize a variety of surfaces, such as glass surfaces. The
construction of such solid phase biopolymer arrays is well
described in the literature. See, e.g., Merrifield, J. Am. Chem.
Soc. 85:2149-2154 (1963) (describing solid phase synthesis of,
e.g., peptides); Geysen et al., J. Immun. Meth. 102:259-274 (1987)
(describing synthesis of solid phase components on pins); Frank
& Doring, Tetrahedron 44:60316040 (1988) (describing synthesis
of various peptide sequences on cellulose disks); Fodor et al.,
Science, 251:767-777 (1991); Sheldon et al., Clinical Chemistry
39(4):718-719 (1993); and Kozal et al., Nature Medicine 2(7):753759
(1996) (all describing arrays of biopolymers fixed to solid
substrates). Non-chemical approaches for fixing tag binders to
substrates include other common methods, such as heat,
cross-linking by UV radiation, and the like.
VII. Computer Assisted Drug Design Using CNG2B
[0196] Yet another assay for compounds that modulate the activities
of a CNG2B channel involves computer assisted drug design, in which
a computer system is used to generate a three-dimensional structure
of CNG2B based on the structural information encoded by the amino
acid sequence. The input amino acid sequence interacts directly and
actively with a pre-established algorithm in a computer program to
yield secondary, tertiary, and quaternary structural models of the
protein. The models of the protein structure are then examined to
identify regions of the structure that have the ability to bind,
e.g., ligands or other cation channel subunits. These regions are
then used to identify ligands that bind to the protein or region
where CNG2B interacts with other cation channel subunits.
[0197] The three-dimensional structural model of the protein is
generated by entering channel protein amino acid sequences of at
least 25, 50, 75, 100, 150, or 200 amino acid residues or
corresponding nucleic acid sequences encoding a CNG2B monomer into
the computer system. The amino acid sequence of each of the
monomers is selected from the group consisting of SEQ ID NO:1,
conservatively modified versions thereof, and immunogenic portions
thereof. The amino acid sequence represents the primary sequence or
subsequence of each of the proteins, which encodes the structural
information of the protein. At least 25, 50, 75, 100, 150, or 200
residues of the amino acid sequence (or a nucleotide sequence
encoding at least about 25, 50, 75, 100, 150, or 200 amino acids)
are entered into the computer system from computer keyboards,
computer readable substrates that include, but are not limited to,
electronic storage media (e.g., magnetic diskettes, tapes,
cartridges, and chips), optical media (e.g., CD ROM), information
distributed by internet sites, and by RAM. The three-dimensional
structural model of the channel protein is then generated by the
interaction of the amino acid sequence and the computer system,
using software known to those of skill in the art. The resulting
three-dimensional computer model can then be saved on a computer
readable substrate.
[0198] The amino acid sequence represents a primary structure that
encodes the information necessary to form the secondary, tertiary
and quaternary structure of the monomer and the heteromeric cation
channel protein comprising four monomers. The software looks at
certain parameters encoded by the primary sequence to generate the
structural model. These parameters are referred to as "energy
terms," or anisotropic terms and primarily include electrostatic
potentials, hydrophobic potentials, solvent accessible surfaces,
and hydrogen bonding. Secondary energy terms include van der Waals
potentials. Biological molecules form the structures that minimize
the energy terms in a cumulative fashion. The computer program is
therefore using these terms encoded by the primary structure or
amino acid sequence to create the secondary structural model.
[0199] The tertiary structure of the protein encoded by the
secondary structure is then formed on the basis of the energy terms
of the secondary structure. The user at this point can enter
additional variables such as whether the protein is membrane bound
or soluble, its location in the body, and its cellular location,
e.g., cytoplasmic, surface, or nuclear. These variables along with
the energy terms of the secondary structure are used to form the
model of the tertiary structure. In modeling the tertiary
structure, the computer program matches hydrophobic faces of
secondary structure with like, and hydrophilic faces of secondary
structure with like.
[0200] Once the structure has been generated, potential ligand
binding regions are identified by the computer system.
Three-dimensional structures for potential ligands are generated by
entering amino acid or nucleotide sequences or chemical formulas of
compounds, as described above. The three-dimensional structure of
the potential ligand is then compared to that of the CNG2B protein
to identify ligands that bind to CNG2B. Binding affinity between
the protein and ligands is determined using energy terms to
determine which ligands have an enhanced probability of binding to
the protein.
[0201] Computer systems are also used to screen for mutations,
polymorphic variants, alleles and interspecies homologs of CNG2B
genes. Such mutations can be associated with disease states. Once
the variants are identified, diagnostic assays can be used to
identify patients having such mutated genes associated with disease
states. Identification of the mutated CNG2B genes involves
receiving input of a first nucleic acid, e.g., SEQ ID NOS:2-3, or
an amino acid sequence encoding CNG2B, e.g., SEQ ID NO:1, and
conservatively modified versions thereof. The sequence is entered
into the computer system as described above. The first nucleic acid
or amino acid sequence is then compared to a second nucleic acid or
amino acid sequence that has substantial identity to the first
sequence. The second sequence is entered into the computer system
in the manner described above. Once the first and second sequences
are compared, nucleotide or amino acid differences between the
sequences are identified. Such sequences can represent allelic
differences in CNG2B genes, preferably human CNG2B genes, and
mutations associated with disease states. The first and second
sequences described above can be saved on a computer readable
substrate.
[0202] Nucleic acids encoding CNG2B monomers can be used with high
density oligonucleotide array technology (e.g., GeneChip.TM.) to
identify CNG2B homologs, orthologs, alleles, conservatively
modified variants, and polymorphic variants in this invention. In
the case where the homologs being identified are linked to a known
disease, they can be used with GeneChip.TM. as a diagnostic tool in
detecting the disease in a biological sample, see, e.g., Gunthand
et al., AIDS Res. Hum. Retroviruses 14: 869-876 (1998); Kozal et
al., Nat. Med. 2:753-759 (1996); Matson et al., Anal. Biochem.
224:110-106 (1995); Lockhart et al., Nat. Biotechnol. 14:1675-1680
(1996); Gingeras et al., Genome Res. 8:435-448 (1998); Hacia et
al., Nucleic Acids Res. 26:3865-3866 (1998).
VIII. Cellular Transfection and Gene Therapy
[0203] The present invention provides the nucleic acids of CNG2B
genes for the transfection of cells in vitro and in vivo. These
nucleic acids can be inserted into any of a number of well-known
vectors for the transfection of target cells and organisms as
described below. The nucleic acids are transfected into cells, ex
vivo or in vivo, through the interaction of the vector and the
target cell. The nucleic acid for CNG2B, under the control of a
promoter, then expresses a CNG2B monomer of the present invention,
thereby mitigating the effects of absent, partial inactivation, or
abnormal expression of the CNG2B gene. The compositions are
administered to a patient in an amount sufficient to elicit a
therapeutic response in the patient. An amount adequate to
accomplish this is defined as "therapeutically effective dose or
amount."
[0204] Such gene therapy procedures have been used to correct
acquired and inherited genetic defects, cancer, and viral infection
in a number of contexts. The ability to express artificial genes in
humans facilitates the prevention and/or cure of many important
human diseases, including many diseases which are not amenable to
treatment by other therapies (for a review of gene therapy
procedures, see Anderson, Science 256:808-813 (1992); Nabel &
Felgner, TIBTECH 11:211-217 (1993); Mitani & Caskey, TIBTECH
11:162-166 (1993); Mulligan, Science 926-932 (1993); Dillon,
TIBTECH 11:167-175 (1993); Miller, Nature 357:455-460 (1992); Van
Brunt, Biotechnology 6(10):1149-1154 (i998); Vigne, Restorative
Neurology and Neuroscience 8:35-36 (1995); Kremer &
Perricaudet, British Medical Bulletin 51(1):31-44 (1995); Haddada
et al., in Current Topics in Microbiology and Immunology (Doerfler
& Bohm eds., 1995); and Yu et al., Gene Therapy 1:13-26
(1994)).
[0205] Delivery of the gene or genetic material into the cell is
the first step in gene therapy treatment of disease. A large number
of delivery methods are well known to those of skill in the art.
Preferably, the nucleic acids are administered for in vivo or ex
vivo gene therapy uses. Non-viral vector delivery systems include
DNA plasmids, naked nucleic acid, and nucleic acid complexed with a
delivery vehicle such as a liposome. Viral vector delivery systems
include DNA and RNA viruses, which have either episomal or
integrated genomes after delivery to the cell.
[0206] Methods of non-viral delivery of nucleic acids include
lipofection, microinjection, biolistics, virosomes, liposomes,
immunoliposomes, polycation or lipid:nucleic acid conjugates, naked
DNA, artificial virions, and agent-enhanced uptake of DNA.
Lipofection is described in, e.g., U.S. Pat. No. 5,049,386, U.S.
Pat. No. 4,946,787; and U.S. Pat. No. 4,897,355 and lipofection
reagents are sold commercially (e.g., Transfectam.TM. and
Lipofectin.TM.). Cationic and neutral lipids that are suitable for
efficient receptor-recognition lipofection of polynucleotides
include those of Felgner, WO 91/17424, WO 91/16024. Delivery can be
to cells (ex vivo administration) or target tissues (in vivo
administration).
[0207] The preparation of lipid:nucleic acid complexes, including
targeted liposomes such as immunolipid complexes, is well known to
one of skill in the art (see, e.g., Crystal, Science 270:404-410
(1995); Blaese et al., Cancer Gene Ther. 2:291-297 (1995); Behr et
al., Bioconjugate Chem. 5:382-389 (1994); Remy et al., Bioconjugate
Chem. 5:647-654 (1994); Gao et al., Gene Therapy 2:710-722 (1995);
Ahmad et al., Cancer Res. 52:4817-4820 (1992); U.S. Pat. Nos.
4,186,183, 4,217,344, 4,235,871, 4,261,975, 4,485,054, 4,501,728,
4,774,085, 4,837,028, and 4,946,787).
[0208] The use of RNA or DNA viral based systems for the delivery
of nucleic acids take advantage of highly evolved processes for
targeting a virus to specific cells in the body and trafficking the
viral payload to the nucleus. Viral vectors can be administered
directly to patients (in vivo) or they can be used to treat cells
in vitro and the modified cells are administered to patients (ex
vivo). Conventional viral based systems for the delivery of nucleic
acids could include retroviral, lentivirus, adenoviral,
adeno-associated and herpes simplex virus vectors for gene
transfer. Viral vectors are currently the most efficient and
versatile method of gene transfer in target cells and tissues.
Integration in the host genome is possible with the retrovirus,
lentivirus, and adeno-associated virus gene transfer methods, often
resulting in long term expression of the inserted transgene.
Additionally, high transduction efficiencies have been observed in
many different cell types and target tissues.
[0209] The tropism of a retrovirus can be altered by incorporating
foreign envelope proteins, expanding the potential target
population of target cells. Lentiviral vectors are retroviral
vector that are able to transduce or infect non-dividing cells and
typically produce high viral titers. Selection of a retroviral gene
transfer system would therefore depend on the target tissue.
Retroviral vectors are comprised of cis-acting long terminal
repeats with packaging capacity for up to 6-10 kb of foreign
sequence. The minimum cis-acting LTRs are sufficient for
replication and packaging of the vectors, which are then used to
integrate the therapeutic gene into the target cell to provide
permanent transgene expression. Widely used retroviral vectors
include those based upon murine leukemia virus (MuLV), gibbon ape
leukemia virus (GaLV), simian immunodeficiency virus (SIV), human
immunodeficiency virus (HIV), and combinations thereof (see, e.g.,
Buchscher et al., J. Virol. 66:2731-2739 (1992); Johann et al., J.
Virol. 66:1635-1640 (1992); Sommerfelt et al., Virol. 176:58-59
(1990); Wilson et al., J. Virol. 63:2374-2378 (1989); Miller et
al., J. Virol. 65:2220-2224 (1991); PCT/US94/05700).
[0210] In applications where transient expression of the nucleic
acid is preferred, adenoviral based systems are typically used.
Adenoviral based vectors are capable of very high transduction
efficiency in many cell types and do not require cell division.
With such vectors, high titer and levels of expression have been
obtained. This vector can be produced in large quantities in a
relatively simple system. Adeno-associated virus ("AAV") vectors
are also used to transduce cells with target nucleic acids, e.g.,
in the in vitro production of nucleic acids and peptides, and for
in vivo and ex vivo gene therapy procedures (see, e.g., West et
al., Virology 160:38-47 (1987); U.S. Pat. No. 4,797,368; WO
93/24641; Kotin, Human Gene Therapy 5:793-801 (1994); Muzyczka, J.
Clin. Invest. 94:1351 (1994)). Construction of recombinant AAV
vectors are described in a number of publications, including U.S.
Pat. No. 5,173,414; Tratschin et al., Mol. Cell. Biol. 5:3251-3260
(1985); Tratschin et al., Mol. Cell. Biol. 4:2072-2081 (1984);
Hermonat & Muzyczka, Proc. Natl. Acad. Sci. U.S.A. 81:6466-6470
(1984); and Samulski et al., J. Virol. 63:03822-3828 (1989).
[0211] In many gene therapy applications, it is desirable that the
gene therapy vector be delivered with a high degree of specificity
to a particular tissue type. A viral vector is typically modified
to have specificity for a given cell type by expressing a ligand as
a fusion protein with a viral coat protein on the viruses outer
surface. The ligand is chosen to have affinity for a receptor known
to be present on the cell type of interest. For example, Han et
al., Proc. Natl. Acad. Sci. U.S.A. 92:9747-9751 (1995), reported
that Moloney murine leukemia virus can be modified to express human
heregulin fused to gp70, and the recombinant virus infects certain
human breast cancer cells expressing human epidermal growth factor
receptor. This principle can be extended to other pairs of virus
expressing a ligand fusion protein and target cell expressing a
receptor. For example, filamentous phage can be engineered to
display antibody fragments (e.g., FAB or Fv) having specific
binding affinity for virtually any chosen cellular receptor.
Although the above description applies primarily to viral vectors,
the same principles can be applied to nonviral vectors. Such
vectors can be engineered to contain specific uptake sequences
thought to favor uptake by specific target cells.
[0212] Gene therapy vectors can be delivered in vivo by
administration to an individual patient, typically by systemic
administration (e.g., intravenous, intraperitoneal, intramuscular,
subdermal, or intracranial infusion) or topical application, as
described below. Alternatively, vectors can be delivered to cells
ex vivo, such as cells explanted from an individual patient (e.g.,
lymphocytes, bone marrow aspirates, tissue biopsy) or universal
donor hematopoietic stem cells, followed by reimplantation of the
cells into a patient, usually after selection for cells which have
incorporated the vector.
[0213] Ex vivo cell transfection for diagnostics, research, or for
gene therapy (e.g. via re-infusion of the transfected cells into
the host organism) is well known to those of skill in the art. In a
preferred embodiment, cells are isolated from the subject organism,
transfected with a nucleic acid (gene or cDNA), and re-infused back
into the subject organism (e.g., patient). Various cell types
suitable for ex vivo transfection are well known to those of skill
in the art (see, e.g., Freshney et al., Culture of Animal Cells, A
Manual of Basic Technique (3rd ed. 1994)) and the references cited
therein for a discussion of how to isolate and culture cells from
patients).
[0214] Vectors (e.g., retroviruses, adenoviruses, liposomes, etc.)
containing therapeutic nucleic acids can be also administered
directly to the organism for transduction of cells in vivo.
Alternatively, naked DNA can be administered. Administration is by
any of the routes normally used for introducing a molecule into
ultimate contact with blood or tissue cells. Suitable methods of
administering such nucleic acids are available and well known to
those of skill in the art, and, although more than one route can be
used to administer a particular composition, a particular route can
often provide a more immediate and more effective reaction than
another route.
[0215] Administration is by any of the routes normally used for
introducing a molecule into ultimate contact with blood or tissue
cells. The nucleic acids are administered in any suitable manner,
preferably with pharmaceutically acceptable carriers. Suitable
methods of administering such nucleic acids are available and well
known to those of skill in the art, and, although more than one
route can be used to administer a particular composition, a
particular route can often provide a more immediate and more
effective reaction than another route.
IX. Pharmaceutical Compositions and Administration
[0216] Pharmaceutically acceptable carriers are determined in part
by the particular composition being administered (e.g., nucleic
acid, protein, modulatory compounds or transduced cell), as well as
by the particular method used to administer the composition.
Accordingly, there are a wide variety of suitable formulations of
pharmaceutical compositions of the present invention (see, e.g.,
Remington's Pharmaceutical Sciences, 17.sup.th ed., 1989).
Administration can be in any convenient manner, e.g., by injection,
oral administration, inhalation, or transdermal application.
[0217] Formulations suitable for oral administration can consist of
(a) liquid solutions, such as an effective amount of the packaged
nucleic acid suspended in diluents, such as water, saline or PEG
400; (b) capsules, sachets or tablets, each containing a
predetermined amount of the active ingredient, as liquids, solids,
granules or gelatin; (c) suspensions in an appropriate liquid; and
(d) suitable emulsions. Tablet forms can include one or more of
lactose, sucrose, mannitol, sorbitol, calcium phosphates, corn
starch, potato starch, microcrystalline cellulose, gelatin,
colloidal silicon dioxide, talc, magnesium stearate, stearic acid,
and other excipients, colorants, fillers, binders, diluents,
buffering agents, moistening agents, preservatives, flavoring
agents, dyes, disintegrating agents, and pharmaceutically
compatible carriers. Lozenge forms can comprise the active
ingredient in a flavor, e.g., sucrose, as well as pastilles
comprising the active ingredient in an inert base, such as gelatin
and glycerin or sucrose and acacia emulsions, gels, and the like
containing, in addition to the active ingredient, carriers known in
the art.
[0218] The compound of choice, alone or in combination with other
suitable components, can be made into aerosol formulations (i.e.,
they can be "nebulized") to be administered via inhalation. Aerosol
formulations can be placed into pressurized acceptable propellants,
such as dichlorodifluoromethane, propane, nitrogen, and the
like.
[0219] Formulations suitable for parenteral administration, such
as, for example, by intaarticular (in the joints), intravenous,
intramuscular, intradermal, intraperitoneal, and subcutaneous
routes, include aqueous and non-aqueous, isotonic sterile injection
solutions, which can contain antioxidants, buffers, bacteriostats,
and solutes that render the formulation isotonic with the blood of
the intended recipient, and aqueous and non-aqueous sterile
suspensions that can include suspending agents, solubilizers,
thickening agents, stabilizers, and preservatives. In the practice
of this invention, compositions can be administered, for example,
by intravenous infusion, orally, topically, intraperitoneally,
intravesically or intrathecally. Parenteral administration and
intravenous administration are the preferred methods of
administration. The formulations of commends can be presented in
unit-dose or multi-dose sealed containers, such as ampules and
vials.
[0220] Injection solutions and suspensions can be prepared from
sterile powders, granules, and tablets of the kind previously
described. Cells transduced by nucleic acids for ex vivo therapy
can also be administered intravenously or parenterally as described
above.
[0221] The dose administered to a patient, in the context of the
present invention should be sufficient to effect a beneficial
therapeutic response in the patient over time. The dose will be
determined by the efficacy of the particular vector employed and
the condition of the patient, as well as the body weight or surface
area of the patient to be treated. The size of the dose also will
be determined by the existence, nature, and extent of any adverse
side-effects that accompany the administration of a particular
vector, or transduced cell type in a particular patient.
[0222] In determining the effective amount of the vector to be
administered in the treatment or prophylaxis of conditions owing to
diminished or aberrant expression of the CNG channels comprising a
CNG2B subunit, the physician evaluates circulating plasma levels of
the vector, vector toxicities, progression of the disease, and the
production of anti-vector antibodies. In general, the dose
equivalent of a naked nucleic acid from a vector is from about 1
.mu.g to 100 .mu.g for a typical 70 kilogram patient, and doses of
vectors which include a retroviral particle are calculated to yield
an equivalent amount of therapeutic nucleic acid.
[0223] For administration, compounds and transduced cells of the
present invention can be administered at a rate determined by the
LD-50 of the inhibitor, vector, or transduced cell type, and the
side-effects of the inhibitor, vector or cell type at various
concentrations, as applied to the mass and overall health of the
patient. Administration can be accomplished via single or divided
doses.
X. Kits
[0224] Human CNG2B and its homologs are useful tools for examining
expression and regulation of cation channels. Human CNG2B-specific
reagents that specifically hybridize to CNG2B nucleic acid, such as
CNG2B probes and primers, and CNG2B-specific reagents that
specifically bind to the CNG2B protein, e.g., CNG2B antibodies, are
used to examine expression and regulation.
[0225] Nucleic acid assays for the presence of CNG2B DNA and RNA in
a sample include numerous techniques are known to those skilled in
the art, such as Southern analysis, northern analysis, dot blots,
RNase protection, S1 analysis, amplification techniques such as PCR
and LCR, and in situ hybridization. In in situ hybridization, for
example, the target nucleic acid is liberated from its cellular
surroundings in such as to be available for hybridization within
the cell while preserving the cellular morphology for subsequent
interpretation and analysis. The following articles provide an
overview of the art of in situ hybridization: Singer et al.,
Biotechniques 4:230-250 (1986); Haase et al., Methods in Virology,
vol. VII, pp. 189-226 (1984); and Nucleic Acid Hybridization: A
Practical Approach (Hames et al., eds. 1987). In addition, CNG2B
protein can be detected with the various immunoassay techniques
described above. The test sample is typically compared to both a
positive control (e.g., a sample expressing recombinant CNG2B
monomers) and a negative control.
[0226] The present invention also provides for kits for screening
modulators of the cation channels of the invention. Such kits can
be prepared from readily available materials and reagents. For
example, such kits can comprise any one or more of the following
materials: CNG2B monomers, reaction tubes, and instructions for
testing the activities of cation channels containing CNG2B. A wide
variety of kits and components can be prepared according to the
present invention, depending upon the intended user of the kit and
the particular needs of the user. For example, the kit can be
tailored for in vitro or in vivo assays for measuring the activity
of a cation channel comprising a CNG2B monomer.
[0227] All publications and patent applications cited in this
specification are herein incorporated by reference as if each
individual publication or patent application were specifically and
individually indicated to be incorporated by reference.
[0228] Although the foregoing invention has been described in some
detail by way of illustration and example for purposes of clarity
of understanding, it will be readily apparent to one of ordinary
skill in the art in light of the teachings of this invention that
certain changes and modifications may be made thereto without
departing from the spirit or scope of the appended claims.
EXAMPLES
[0229] The following examples are provided by way of illustration
only and not by way of limitation. Those of skill in the art will
readily recognize a variety of noncritical parameters that could be
changed or modified to yield essentially similar results.
[0230] A. Identification of Human CNG2B
[0231] Multiple exons of human CNG2B were identified from public
genomic data (accession numbers AC022762 and AC021935) using
TBLASTN searches with cyclic nucleotide-gated channel protein
sequences. The 5' and 3' exons of the CNG2B coding sequence could
not be identified in these searches. Oligonucleotides based on the
AC022762 and AC021935 sequences were designed to clone a
full-length CNG2B cDNA.
[0232] An approximately 657 bp band from the CNG2B gene was
amplified from first strand cDNA prepared from the human brain,
demonstrating expression in the central nervous system. The oligos
used to amplify this band were 5'-(1) GCAGATCTTCCAGAACTGTAAGGCCA
(SEQ ID NO:14) (sense) and 5'-(2) CCTGCCCTCTTCATCTTTGGAAGTTC (SEQ
ID NO:5) (antisense). The complete 3' end of CNG2B was amplified by
standard 3' RACE PCR techniques from human brain cDNA in two
successive rounds. In the first round the gene specific primer used
was 5'-(3) GCCAACATCAAGAGCCTAGGTTATTC (SEQ ID NO:6) (sense). This
reaction was then reamplified with a nested gene specific oligo
5'-(4) GGATGATCTACAGACCAAGTTTGCTCG (SEQ ID NO:7) (sense) to produce
a fragment of approximately 765 bp in length that, when sequenced,
was found to include the complete 3' end of the human CNG2B mRNA.
The sequence of this fragment overlapped with the original 657 bp
CNG2B fragment to provide contiguous sequence. Most of the 5' end
of the CNG2B coding sequence was amplified from human brain cDNA
using a degenerate sense strand oligo based on the N-terminal amino
acid sequence of rat OCNC2 protein (5'-(5)
ATGAGCCAGGACGGNAARGTNAARAC (SEQ ID NO:15)) and an antisense primer
specific to human CNG2B (5'-(6) GTTGATGATGCTGATCTCCCCAAAG (SEQ ID
NO:9)). This reaction produced a fragment of approximately 1.2 Kb
with a sequence highly homologous to rat OCNC2. Two rounds of
standard 5' RACE PCR were then used to complete the 5' coding
sequence of human CNG2B and to identify the initiator methionine
codon. The CNG2B-specific oligo 5'-(7) GGATGATGAGGTTATACATGACTGGG
(SEQ ID NO:10) (antisense) was used in the first round of RACE PCR.
This reaction was reamplified using the nested CNG2B specific oligo
5'-(8) AGGCTAGCAACTTCCTGGCCTTGGAT (SEQ ID NO:11) (antisense). An
approximately 410 bp fragment containing the complete 5' end of
CNG2B including the start codon was isolated. This fragment
overlapped the 1.2 Kb PCR fragment described above. The entire
contiguous coding region of the CNG2B mRNA was determined by
assembling these two fragments with the original 657 bp internal
fragment and the 765 bp 3' RACE product.
[0233] The entire coding region of human CNG2B was then isolated in
a single fragment using oligonucleotides overlapping the CNG2B
coding sequence ends. The oligonucleotides used were 5'-(9)
GCGAAAGCTTCCACCATGAGCCAGGACACCAAAGTG (SEQ ID NO:12) (sense) and
5'-(10)
[0234] CATGTCTAGAATGGGGATGGGGTCACTCTGGACCT (SEQ ID NO:13)
(antisense). The first oligonucleotide includes the initiator
methionine and the first 21 coding nucleotides of the CNG2B gene.
Upstream are a HindIII restriction enzyme site for subcloning into
plasmid vectors and a Kozak consensus sequence to boost
translation. All nucleotides corresponding to CNG2B are in bold
type. The second oligonucleotide is from the 3' sequence of CNG2B
and includes an XbaI restriction enzyme site for subcloning. All
nucleotides in bold correspond to the 3' end sequence of CNG2B. The
stop codon is underlined. It is important to note that only the
nucleotides that are in bold type from the two oligos above are
necessary for amplification of CNG2B. The preferred template for
the amplification is first strand cDNA from the human brain. The
amplification conditions used were as follows: 24 cycles of
95.degree. C. for 15 seconds, 72-60.degree. C. for 15 seconds
(temperature was dropped 0.5.degree. C. each successive cycle),
72.degree. C. for 3 minutes, followed by 20 cycles of 95.degree. C.
for 15 seconds, 60.degree. C. for 15 seconds, and 72.degree. C. for
3 minutes. An approximately 1.73 Kb band corresponding to the
entire coding region of CNG2B was obtained and confirmed by
sequencing.
[0235] The predicted molecular weight of the human CNG2B protein is
about 66 Kd, with a range of approximately 60 Kd-80 Kd, preferably
about 61-71 Kd.
[0236] B. Comparison of Human CNG2B with Other CNG Genes
[0237] An alignment of the deduced amino acid sequence of CNG2B to
rat OCNC2 (Bradley, et al., Proc. Natl. Acad. Sci. U.S.A. 91,
8890-8894, 1994) is shown in FIG. 1. The amino acid sequences of
human CNG2B and rat OCNC2 are 93% identical, indicating that they
are likely to be orthologous genes. Additional evidence supporting
this idea is that human CNG2B is much more homologous to rat OCNC2
than any of the other cloned CNG channels. Most of the differences
between the two amino acid sequences are clustered at the amino and
carboxy termini. Human CNG2B and rat OCNC2 are less than 90%
identical on the nucleic acid level.
[0238] The human CNG2B gene appears to be orthologous to the rat
OCNC2 gene, suggesting that it serves a similar functional role. In
support of this idea is our evidence for expression of human CNG2B
in the brain, where there is widespread expression of rat OCNC2
(Kingston, et al., Synapse 32:1-12 (1999). The rat OCNC2 gene was
originally classified as a CNG beta subunit because it is
functionally insensitive to cyclic nucleotides when expressed as a
homomultimer (Bradley, et al., Proc. Nat. Acad. Sci. 91:8890-8894
(1994). Instead, it was shown to form functional heteromultimeric
channels with the rat OCNC1 alpha subunit which participates in
olfactory transduction (Bradley, et al., Proc. Nat. Acad. Sci.
91:8890-8894 (1994). This alpha and beta heteromultimeric channel
showed increased sensitivity to cAMP closely resembling the native
CNG olfactory channel (Linman, et al., Neuron 13:611-621 (1994).
However, other studies have shown that functional homomeric rat
OCNC2 channels may exist in the brain, and that they are nitric
oxide-sensitive (Broillet, et al., Neuron 18:95.1-958 (1997)). This
finding, combined with the widespread distribution of rat OCNC2 in
the brain and its high permeability to Ca.sup.2+, suggest that
these channels may play a role in neuronal signaling and synaptic
plasticity (Bradley, et al., JNC 17:1993-2005 (1997). The ability
of rat OCNC2 to form functional homomultimeric channels is
consistent with the fact that it shares greater homology with CNG
alpha subunits than with CNG beta subunits. Rat OCNC2 and human
CNG2B are thus likely to be functionally significant both as
heteromultimers and as homomultimers.
Sequence CWU 1
1
16 1 575 PRT Homo sapiens cyclic nucleotide-gated cation channel 2B
(CNG2B) 1 Met Ser Gln Asp Thr Lys Val Lys Thr Thr Glu Ser Ser Pro
Pro Ala 1 5 10 15 Pro Ser Lys Ala Arg Lys Leu Leu Pro Val Leu Asp
Pro Ser Gly Asp 20 25 30 Tyr Tyr Tyr Trp Trp Leu Asn Thr Met Val
Phe Pro Val Met Tyr Asn 35 40 45 Leu Ile Ile Leu Val Cys Arg Ala
Cys Phe Pro Asp Leu Gln His Gly 50 55 60 Tyr Leu Val Ala Trp Leu
Val Leu Asp Tyr Thr Ser Asp Leu Leu Tyr 65 70 75 80 Leu Leu Asp Met
Val Val Arg Phe His Thr Gly Phe Leu Glu Gln Gly 85 90 95 Ile Leu
Val Val Asp Lys Gly Arg Ile Ser Ser Arg Tyr Val Arg Thr 100 105 110
Trp Ser Phe Phe Leu Asp Leu Ala Ser Leu Met Pro Thr Asp Val Val 115
120 125 Tyr Val Arg Leu Gly Pro His Thr Pro Thr Leu Arg Leu Asn Arg
Phe 130 135 140 Leu Arg Ala Pro Arg Leu Phe Glu Ala Phe Asp Arg Thr
Glu Thr Arg 145 150 155 160 Thr Ala Tyr Pro Asn Ala Phe Arg Ile Ala
Lys Leu Met Leu Tyr Ile 165 170 175 Phe Val Val Ile His Trp Asn Ser
Cys Leu Tyr Phe Ala Leu Ser Arg 180 185 190 Tyr Leu Gly Phe Gly Arg
Asp Ala Trp Val Tyr Pro Asp Pro Ala Gln 195 200 205 Pro Gly Phe Glu
Arg Leu Arg Arg Gln Tyr Leu Tyr Ser Phe Tyr Phe 210 215 220 Ser Thr
Leu Ile Leu Thr Thr Val Gly Asp Thr Pro Pro Pro Ala Arg 225 230 235
240 Glu Glu Glu Tyr Leu Phe Met Val Gly Asp Phe Leu Leu Ala Val Met
245 250 255 Gly Phe Ala Thr Ile Met Gly Ser Met Ser Ser Val Ile Tyr
Asn Met 260 265 270 Asn Thr Ala Asp Ala Ala Phe Tyr Pro Asp His Ala
Leu Val Lys Lys 275 280 285 Tyr Met Lys Leu Gln His Val Asn Arg Lys
Leu Glu Arg Arg Val Ile 290 295 300 Asp Trp Tyr Gln His Leu Gln Ile
Asn Lys Lys Met Thr Asn Glu Val 305 310 315 320 Ala Ile Leu Gln His
Leu Pro Glu Arg Leu Arg Ala Glu Val Ala Val 325 330 335 Ser Val His
Leu Ser Thr Leu Ser Arg Val Gln Ile Phe Gln Asn Cys 340 345 350 Glu
Ala Ser Leu Leu Glu Glu Leu Val Leu Lys Leu Gln Pro Gln Thr 355 360
365 Tyr Ser Pro Gly Glu Tyr Val Cys Arg Lys Gly Asp Ile Gly Gln Glu
370 375 380 Met Tyr Ile Ile Arg Glu Gly Gln Leu Ala Val Val Ala Asp
Asp Gly 385 390 395 400 Ile Thr Gln Tyr Ala Val Leu Gly Ala Gly Leu
Tyr Phe Gly Glu Ile 405 410 415 Ser Ile Ile Asn Ile Lys Gly Asn Met
Ser Gly Asn Arg Arg Thr Ala 420 425 430 Asn Ile Lys Ser Leu Gly Tyr
Ser Asp Leu Phe Cys Leu Ser Lys Glu 435 440 445 Asp Leu Arg Glu Val
Leu Ser Glu Tyr Pro Gln Ala Gln Thr Ile Met 450 455 460 Glu Glu Lys
Gly Arg Glu Ile Leu Leu Lys Met Asn Lys Leu Asp Val 465 470 475 480
Asn Ala Glu Ala Ala Glu Ile Ala Leu Gln Glu Ala Thr Glu Ser Arg 485
490 495 Leu Arg Gly Leu Asp Gln Gln Leu Asp Asp Leu Gln Thr Lys Phe
Ala 500 505 510 Arg Leu Leu Ala Glu Leu Glu Ser Ser Ala Leu Lys Ile
Ala Tyr Arg 515 520 525 Ile Glu Arg Leu Glu Trp Gln Thr Arg Glu Trp
Pro Met Pro Glu Asp 530 535 540 Leu Ala Glu Ala Asp Asp Glu Gly Glu
Pro Glu Glu Gly Thr Ser Lys 545 550 555 560 Asp Glu Glu Gly Arg Ala
Ser Gln Glu Gly Pro Pro Gly Pro Glu 565 570 575 2 2308 DNA Homo
sapiens CDS (333)..(2060) cyclic nucleotide-gated cation channel 2B
(CNG2B) complete nucleotide sequence derived from assembly of PCR
fragments 2 agaggggagg aggaaaacag agacaagact caggcttccc tctgaggcat
gcacccccac 60 cttctccagg gatctcatta gaggtgttta gctgggcagg
tgtaagccca ggccctggga 120 gacagggcag agtgctagag ctagactgtc
tccacccctt cagtagcgct agctctggtt 180 gtgttgctaa gagccccaaa
gacaaagaag tcacagcaga agcccaacag cagcctcctt 240 cagacagtca
ggcactagtg cccaactcca gaagtcccct acaggcagag agggtgtgga 300
catctcacac cccagcacca gaccacagaa ccatgagcca ggacaccaaa gtgaagacaa
360 cagagtccag tcccccagcc ccatccaagg ccaggaagtt gctgcctgtc
ctggacccat 420 ctggggatta ctactactgg tggctgaaca caatggtctt
cccagtcatg tataacctca 480 tcatcctcgt gtgcagagcc tgcttccccg
acttgcagca cggttatctg gtggcctggt 540 tggtgctgga ctacacgagt
gacctgctat acctactaga catggtggtg cgcttccaca 600 caggattctt
ggaacagggc atcctggtgg tggacaaggg taggatctcg agtcgctacg 660
ttcgcacctg gagtttcttc ttggacctgg cttccctgat gcccacagat gtggtctacg
720 tgcggctggg cccgcacaca cccaccctga ggctgaaccg ctttctccgc
gcgccccgcc 780 tcttcgaggc cttcgaccgc acagagaccc gcacagctta
cccaaatgcc tttcgcattg 840 ccaagctgat gctttacatt tttgtcgtca
tccattggaa cagctgccta tactttgccc 900 tatcccggta cctgggcttc
gggcgtgacg catgggtgta cccggacccc gcgcagcctg 960 gctttgagcg
cctgcggcgc cagtacctct atagctttta cttctccacg ctgatactga 1020
ctacagtggg cgatacaccg ccgccagcca gggaagaaga gtacctcttc atggtgggcg
1080 acttcctgct ggccgtcatg ggtttcgcca ccatcatggg tagcatgagc
tctgtcatct 1140 acaacatgaa cactgcagat gcggctttct acccagatca
tgcactggtg aagaagtaca 1200 tgaagctgca gcacgtcaac cgcaagctgg
agcggcgagt tattgactgg tatcagcacc 1260 tgcagatcaa caagaagatg
accaacgagg tagccatctt acagcacttg cctgagcggc 1320 tgcgggcaga
agtggctgtg tctgtgcacc tgtccactct gagccgggtg cagatctttc 1380
agaactgtga ggccagcctg ctggaggagc tggtgctgaa gctgcagccc cagacctact
1440 caccaggtga atatgtatgc cgcaaaggag acattggcca agagatgtac
atcatccgag 1500 agggtcaact ggccgtggtg gcagatgatg gtatcacaca
gtatgctgtg ctcggtgcag 1560 ggctctactt tggggagatc agcatcatca
acatcaaagg gaacatgtct gggaaccgcc 1620 gcacagccaa catcaagagc
ctaggttatt cagacctatt ctgcctgagc aaggaggacc 1680 tgcgggaggt
gctgagcgag tatccacaag cacagaccat catggaggag aaaggacgtg 1740
agatcctgct gaaaatgaac aagttggacg tgaatgctga ggcagctgag atcgccctgc
1800 aggaggccac agagtcccgg ctacgaggcc tagaccagca gctggatgat
ctacagacca 1860 agtttgctcg cctcctggct gagctggagt ccagcgcact
taagattgct taccgcattg 1920 aacggctgga gtggcagact cgagagtggc
caatgcccga ggacctggct gaggctgatg 1980 acgagggtga gcctgaggag
ggaacttcca aagatgaaga gggcagggcc agccaggagg 2040 gacccccagg
tccagagtga ccccatcccc atccccagga ttcccacctc ctagtgaatc 2100
cagagttgta gtaaagccta actgctgcaa ctctgtcatc ctgtctgcga gatcacagac
2160 acaggagcga attggtctgt agatgcccag ctagagatat aggagtttaa
cgcacattca 2220 gcccccactt accagtacac acacacacac acacacacac
acatttgctc atagacctgt 2280 tggccccaag actgtgcatt ccatctaa 2308 3
1728 DNA Homo sapiens CDS (1)..(1728) cyclic nucleotide-gated
cation channel 2B (CNG2B) coding sequence 3 atgagccagg acaccaaagt
gaagacaaca gagtccagtc ccccagcccc atccaaggcc 60 aggaagttgc
tgcctgtcct ggacccatct ggggattact actactggtg gctgaacaca 120
atggtcttcc cagtcatgta taacctcatc atcctcgtgt gcagagcctg cttccccgac
180 ttgcagcacg gttatctggt ggcctggttg gtgctggact acacgagtga
cctgctatac 240 ctactagaca tggtggtgcg cttccacaca ggattcttgg
aacagggcat cctggtggtg 300 gacaagggta ggatctcgag tcgctacgtt
cgcacctgga gtttcttctt ggacctggct 360 tccctgatgc ccacagatgt
ggtctacgtg cggctgggcc cgcacacacc caccctgagg 420 ctgaaccgct
ttctccgcgc gccccgcctc ttcgaggcct tcgaccgcac agagacccgc 480
acagcttacc caaatgcctt tcgcattgcc aagctgatgc tttacatttt tgtcgtcatc
540 cattggaaca gctgcctata ctttgcccta tcccggtacc tgggcttcgg
gcgtgacgca 600 tgggtgtacc cggaccccgc gcagcctggc tttgagcgcc
tgcggcgcca gtacctctat 660 agcttttact tctccacgct gatactgact
acagtgggcg atacaccgcc gccagccagg 720 gaagaagagt acctcttcat
ggtgggcgac ttcctgctgg ccgtcatggg tttcgccacc 780 atcatgggta
gcatgagctc tgtcatctac aacatgaaca ctgcagatgc ggctttctac 840
ccagatcatg cactggtgaa gaagtacatg aagctgcagc acgtcaaccg caagctggag
900 cggcgagtta ttgactggta tcagcacctg cagatcaaca agaagatgac
caacgaggta 960 gccatcttac agcacttgcc tgagcggctg cgggcagaag
tggctgtgtc tgtgcacctg 1020 tccactctga gccgggtgca gatctttcag
aactgtgagg ccagcctgct ggaggagctg 1080 gtgctgaagc tgcagcccca
gacctactca ccaggtgaat atgtatgccg caaaggagac 1140 attggccaag
agatgtacat catccgagag ggtcaactgg ccgtggtggc agatgatggt 1200
atcacacagt atgctgtgct cggtgcaggg ctctactttg gggagatcag catcatcaac
1260 atcaaaggga acatgtctgg gaaccgccgc acagccaaca tcaagagcct
aggttattca 1320 gacctattct gcctgagcaa ggaggacctg cgggaggtgc
tgagcgagta tccacaagca 1380 cagaccatca tggaggagaa aggacgtgag
atcctgctga aaatgaacaa gttggacgtg 1440 aatgctgagg cagctgagat
cgccctgcag gaggccacag agtcccggct acgaggccta 1500 gaccagcagc
tggatgatct acagaccaag tttgctcgcc tcctggctga gctggagtcc 1560
agcgcactta agattgctta ccgcattgaa cggctggagt ggcagactcg agagtggcca
1620 atgcccgagg acctggctga ggctgatgac gagggtgagc ctgaggaggg
aacttccaaa 1680 gatgaagagg gcagggccag ccaggaggga cccccaggtc
cagagtga 1728 4 26 DNA Artificial Sequence Description of
Artificial Sequencesense strand amplification primer Oligo 1 4
gcagatcttt cagaactgtg aggcca 26 5 26 DNA Artificial Sequence
Description of Artificial Sequenceantisense strand amplification
primer Oligo 2 5 cctgccctct tcatctttgg aagttc 26 6 26 DNA
Artificial Sequence Description of Artificial Sequencesense strand
first round 3' RACE gene-specific amplification primer Oligo 3 6
gccaacatca agagcctagg ttattc 26 7 27 DNA Artificial Sequence
Description of Artificial Sequencesense strand nested gene specific
amplification primer Oligo 4 7 ggatgatcta cagaccaagt ttgctcg 27 8
26 DNA Artificial Sequence Description of Artificial Sequencesense
strand primer 8 atgagccagg acaccaaagt gaagac 26 9 25 DNA Artificial
Sequence Description of Artificial Sequenceantisense strand primer
Oligo 6 specific to human CNG2B 9 gttgatgatg ctgatctccc caaag 25 10
26 DNA Artificial Sequence Description of Artificial SequenceCNG2B-
specific antisense strand first round 5' RACE PCR primer Oligo 7 10
ggatgatgag gttatacatg actggg 26 11 26 DNA Artificial Sequence
Description of Artificial Sequenceantisense strand nested CNG2B
specific amplification primer Oligo 8 11 aggctagcaa cttcctggcc
ttggat 26 12 36 DNA Artificial Sequence Description of Artificial
Sequencesense strand primer Oligo 9 12 gcgaaagctt ccaccatgag
ccaggacacc aaagtg 36 13 35 DNA Artificial Sequence Description of
Artificial Sequenceantisense strand primer Oligo 10 13 catgtctaga
atggggatgg ggtcactctg gacct 35 14 26 DNA Artificial Sequence
Description of Artificial Sequencesense strand amplification primer
Oligo 1 14 gcagatcttc cagaactgta aggcca 26 15 26 DNA Artificial
Sequence Description of Artificial Sequencedegenerate sense strand
primer Oligo 5 based on N-terminal amino acid sequence or rat OCNC2
15 atgagccagg acggnaargt naarac 26 16 575 PRT Rattus norvegicus rat
cyclic nucleotide gated cation channel OCNC2 16 Met Ser Gln Asp Gly
Lys Val Lys Thr Thr Glu Ser Thr Pro Pro Ala 1 5 10 15 Pro Thr Lys
Ala Arg Lys Trp Leu Pro Val Leu Asp Pro Ser Gly Asp 20 25 30 Tyr
Tyr Tyr Trp Trp Leu Asn Thr Met Val Phe Pro Ile Met Tyr Asn 35 40
45 Leu Ile Ile Val Val Cys Arg Ala Cys Phe Pro Asp Leu Gln His Ser
50 55 60 Tyr Leu Val Ala Trp Phe Val Leu Asp Tyr Thr Ser Asp Leu
Leu Tyr 65 70 75 80 Leu Leu Asp Ile Gly Val Arg Phe His Thr Gly Phe
Leu Glu Gln Gly 85 90 95 Ile Leu Val Val Asp Lys Gly Met Ile Ala
Ser Arg Tyr Val Arg Thr 100 105 110 Trp Ser Phe Leu Leu Asp Leu Ala
Ser Leu Val Pro Thr Asp Ala Ala 115 120 125 Tyr Val Gln Leu Gly Pro
His Ile Pro Thr Leu Arg Leu Asn Arg Phe 130 135 140 Leu Arg Val Pro
Arg Leu Phe Glu Ala Phe Asp Arg Thr Glu Thr Arg 145 150 155 160 Thr
Ala Tyr Pro Asn Ala Phe Arg Ile Ala Lys Leu Met Leu Tyr Ile 165 170
175 Phe Val Val Ile His Trp Asn Ser Cys Leu Tyr Phe Ala Leu Ser Arg
180 185 190 Tyr Leu Gly Phe Gly Arg Asp Ala Trp Val Tyr Pro Asp Pro
Ala Gln 195 200 205 Pro Gly Phe Glu Arg Leu Arg Arg Gln Tyr Leu Tyr
Ser Phe Tyr Phe 210 215 220 Ser Thr Leu Ile Leu Thr Thr Val Gly Asp
Thr Pro Leu Pro Asp Arg 225 230 235 240 Glu Glu Glu Tyr Leu Phe Met
Val Gly Asp Phe Leu Leu Ala Val Met 245 250 255 Gly Phe Ala Thr Ile
Met Gly Ser Met Ser Ser Val Ile Tyr Asn Met 260 265 270 Asn Thr Ala
Asp Ala Ala Phe Tyr Pro Asp His Ala Leu Val Lys Lys 275 280 285 Tyr
Met Lys Leu Gln His Val Asn Lys Arg Leu Glu Arg Arg Val Ile 290 295
300 Asp Trp Tyr Gln His Leu Gln Ile Asn Lys Lys Met Thr Asn Glu Val
305 310 315 320 Ala Ile Leu Gln His Leu Pro Glu Arg Leu Arg Ala Glu
Val Ala Val 325 330 335 Ser Val His Leu Ser Thr Leu Ser Arg Val Gln
Ile Phe Gln Asn Cys 340 345 350 Glu Ala Ser Leu Leu Glu Glu Leu Val
Leu Lys Leu Gln Pro Gln Thr 355 360 365 Tyr Ser Pro Gly Glu Tyr Val
Cys Arg Lys Gly Asp Ile Gly Arg Glu 370 375 380 Met Tyr Ile Ile Arg
Glu Gly Gln Leu Ala Val Val Ala Asp Asp Gly 385 390 395 400 Val Thr
Gln Tyr Ala Val Leu Gly Ala Gly Leu Tyr Phe Gly Glu Ile 405 410 415
Ser Ile Ile Asn Ile Lys Gly Asn Met Ser Gly Asn Arg Arg Thr Ala 420
425 430 Asn Ile Lys Ser Leu Gly Tyr Ser Asp Leu Phe Cys Leu Ser Lys
Glu 435 440 445 Asp Leu Arg Glu Val Leu Ser Glu Tyr Pro Gln Ala Gln
Ala Val Met 450 455 460 Glu Glu Lys Gly Arg Glu Ile Leu Leu Lys Met
Asn Lys Leu Asp Val 465 470 475 480 Asn Ala Glu Ala Ala Glu Ile Ala
Leu Gln Glu Ala Thr Glu Ser Arg 485 490 495 Leu Lys Gly Leu Asp Gln
Gln Leu Asp Asp Leu Gln Thr Lys Phe Ala 500 505 510 Arg Leu Leu Ala
Glu Leu Glu Ser Ser Ala Leu Lys Ile Ala Tyr Arg 515 520 525 Ile Glu
Arg Leu Glu Trp Gln Thr Arg Glu Trp Pro Met Pro Glu Asp 530 535 540
Met Gly Glu Ala Asp Asp Glu Ala Glu Pro Gly Glu Gly Thr Ser Lys 545
550 555 560 Asp Gly Glu Gly Lys Ala Gly Gln Ala Gly Pro Ser Gly Ile
Glu 565 570 575
* * * * *
References