U.S. patent application number 10/523117 was filed with the patent office on 2006-10-26 for neisserial vaccine compositions comprising a combination of antigens.
Invention is credited to Francois-Xavier Berthet, Ralph Biemans, Philippe Denoel, Christiane Feron, Carine Goraj, Jan Poolman, Vincent Weynants.
Application Number | 20060240045 10/523117 |
Document ID | / |
Family ID | 31722002 |
Filed Date | 2006-10-26 |
United States Patent
Application |
20060240045 |
Kind Code |
A1 |
Berthet; Francois-Xavier ;
et al. |
October 26, 2006 |
Neisserial vaccine compositions comprising a combination of
antigens
Abstract
The present invention relates to immunogenic compositions and
vaccines for the treatment and prevention of Neisserial disease.
Immunogenic compositions of the invention contain combinations of
antigens selected from at least two different classes of antigens
including adhesins, autotransporter proteins, toxins, iron
acquisitions proteins and membrane-associated protein (preferably
integral outer membrane protein)s. Such combinations of antigens
are able to target the immune response against different aspects of
the neisserial life cycle, resulting in a more effective immune
response.
Inventors: |
Berthet; Francois-Xavier;
(KING OF PRUSSIA, PA) ; Biemans; Ralph;
(Rixensart, BE) ; Denoel; Philippe; (Rixensart,
DE) ; Feron; Christiane; (Rixensart, BE) ;
Goraj; Carine; (Rixensart, BE) ; Poolman; Jan;
(Rixensart, BE) ; Weynants; Vincent; (Rixensart,
BE) |
Correspondence
Address: |
SMITHKLINE BEECHAM CORPORATION;CORPORATE INTELLECTUAL PROPERTY-US, UW2220
P. O. BOX 1539
KING OF PRUSSIA
PA
19406-0939
US
|
Family ID: |
31722002 |
Appl. No.: |
10/523117 |
Filed: |
July 31, 2003 |
PCT Filed: |
July 31, 2003 |
PCT NO: |
PCT/EP03/08571 |
371 Date: |
October 13, 2005 |
Current U.S.
Class: |
424/249.1 ;
424/250.1 |
Current CPC
Class: |
A61K 2039/70 20130101;
A61K 2039/55516 20130101; A61P 43/00 20180101; A61K 2039/55505
20130101; A61P 37/04 20180101; A61K 39/095 20130101; A61K 39/102
20130101; A61K 2039/521 20130101; A61K 2039/55572 20130101; A61P
37/00 20180101; Y02A 50/30 20180101; A61P 11/00 20180101; Y02A
50/396 20180101; A61P 31/04 20180101; A61K 2039/55577 20130101;
A61K 39/1045 20130101; A61P 31/00 20180101; A61P 37/02 20180101;
C07K 14/22 20130101 |
Class at
Publication: |
424/249.1 ;
424/250.1 |
International
Class: |
A61K 39/095 20060101
A61K039/095 |
Foreign Application Data
Date |
Code |
Application Number |
Aug 2, 2002 |
GB |
0218037.0 |
Aug 2, 2002 |
GB |
0218036.2 |
Aug 2, 2002 |
GB |
0218035.4 |
Aug 2, 2002 |
GB |
0218051.1 |
Aug 30, 2002 |
GB |
0220197.8 |
Aug 30, 2002 |
GB |
0220199.4 |
Nov 1, 2002 |
GB |
0225524.8 |
Nov 1, 2002 |
GB |
0225531.3 |
Dec 24, 2002 |
GB |
0230164.6 |
Dec 24, 2002 |
GB |
0230168.7 |
Dec 24, 2002 |
GB |
0230170.3 |
Mar 5, 2003 |
GB |
0305028.3 |
Claims
1. An immunogenic composition comprising two or more different
antigens, wherein the antigens are selected from at least two of
the following categories: a) at least one Neisserial adhesin; b) at
least one Neisserial autotransporter; at least one Neisserial
toxin; at least one Neisserial Fe acquisition protein; or at least
one Neisserial membrane associated protein, preferably integral
outer membrane protein.
2. The immunogenic composition of claim 1, wherein the antigens are
selected from at least two of the following categories: a) at least
one Neisserial adhesin selected from the group consisting of FhaB,
NspA, PilC, Hsf, Hap, MafA, MafB, Omp26, NMBO315, NMB0995, NMB 1119
and NadA; b) at least one Neisserial autotransporter selected from
the group consisting of Hsf, Hap, IgA protease, AspA and NadA; c)
at least one Neisserial toxin selected from the group consisting of
FrpA, FrpC, FrpA/C, VapD, NM-ADPRT, and either or both of LPS
immunotype L2 and LPS immunotype L3; d) at least one Neisserial Fe
acquisition protein selected from the group consisting of TbpA
high, TbpA low, TbpB high, TbpB low, LbpA, LbpB, P2086, HpuA, HpuB,
Lipo28, Sibp, FbpA, BfrA, BfrB, Bcp, NMB0964 and NMB0293; or e) at
least one Neisserial membrane associated protein, preferably
integral outer membrane protein selected from the group consisting
of PilQ, OMP85, FhaC, NspA, TbpA(high), TbpA(low), LbpA, HpuB,
TspA, TspB, TdfH, PorB, HimD, HisD, GNA1870, OstA, HIpA, MltA, NMB
1124, NMB 1162, NMB 1220, NMB 1313, NMB 1953, HtrA and PldA.
3. The immunogenic composition of claim 1 which is a subunit
composition.
4. The immunogenic composition of claim 3 comprising at least 2
antigens selected from the following list: FhaB, NspA, passenger
domain of Hsf, passenger domain of Hap, surface exposed domain of
OMP85, FrpA, FrpC, TbpB, LbpB, PldA, PiIC, Lipo28 and either or
both of LPS immunotype L2 and LPS immunotype L3.
5. The immunogenic composition of claim 1 comprising an outer
membrane vesicle preparation, wherein the antigens have been
upregulated in the outer membrane vesicle.
6. The immunogenic composition of claim 5 comprising at least two
antigens selected from the following list which have been
upregulated in the outer membrane vesicle: NspA, Hsf, Hap, OMP85,
AspA, HpuA, HpuB, TspA, TspB, FhaC, TbpA (high), TbpA (low), LbpA,
TbpB, LbpB, PiIQ, NM-ADPRT, P2086, TdfH, PorB, MafA, MafB, HiMD,
HisD, GNA1870, OstA, HlpA, MltA and PldA; and optionally comprising
either or both of LPS immunotype L2 and LPS immunotype L3.
7. The immunogenic composition of claim 1 comprising a subunit
composition having one or more of the antigens, and an outer
membrane vesicle preparation having at least one antigen which has
been upregulated in the outer membrane vesicle.
8. The immunogenic composition of claim 7 comprising a subunit
composition and an outer membrane vesicle preparation wherein the
subunit composition comprises at least one antigen selected from
the following list: FhaB, NspA, passenger domain of Hsf, passenger
domain of Hap, surface exposed domain of OMP85, FrpA, FrpC, TbpB,
LbpB, PilC, Lipo28 and the outer membrane vesicle preparation
having at least one different antigen selected from the following
list, which has been recombinantly upregulated in the outer
membrane vesicle: NspA, Hsf, Hap, OMP85, AspA, HpuA, HpuB, TspA,
TspB, FhaC, TbpA (high), TbpA (low), LbpA, TbpB, LbpB, PiIQ,
NM-ADPRT, P2086, TdfH, PorB, MafA, MafB, HimD, HisD, GNA1870, OstA,
HlpA, MltA and PldA; and optionally comprising either or both of
LPS immunotype L2 and LPS immunotype L3, preferably within the
outer membrane vesicle preparation.
9. The immunogenic composition of claim 5 comprising at least two
different outer membrane vesicle preparations.
10. The immunogenic composition of claim 9 wherein one outer
membrane vesicle preparation is immunotype L2 and one outer
membrane vesicle preparation is immunotype L3.
11. The immunogenic composition of claims claim 1 wherein Hsf and
TbpA (high) are selected.
12. The immunogenic composition of claim 1 wherein Hsf and TbpA
(low) are selected.
13. The immunogenic composition of claim 11 wherein one or more
additional antigens from a list consisting of Hap, LbpB, OMP 85 and
FrpA are further selected.
14. The immunogenic composition of claim 11 wherein LPS immunotype
L2 is further selected.
15. The immunogenic composition of claim 11 wherein LPS immunotype
L3 is further selected.
16. The immunogenic composition of claim 1 wherein FhaB is selected
together with at least one further antigen selected from the group
consisting of: PilC, MafA, MafB, Omp26, NMB0995, FhaC, FbpA, Bcp,
NMB 1124, NMB 1162, NMB 1220, NMB 1313, NMB 1953, HtrA, Hsf, LbpB,
FrpA, FrpC, FrpA/C, NadA, OMP85, PldA, LbpA, TbpA (low),
TbpA(high), TbpB(low), TbpB(high), HpuA, HpuB, Hap, IgA protease,
AspA, PilQ, MltA, HimD, HisD, GNA1870, OstA, HIpA, NspA, TspA,
TspB, P2086, Lipo28, Sibp, NMB0964, NMB0293, NMB0315, NMB1119,
TdfH, PorB, NM-ADPRT, VapD and either or both of LPS immunotype L2
and LPS immunotype L3.
17. The immunogenic composition of claim 1 wherein NspA is selected
together with at least one further antigen selected from the group
consisting of: PilC, MafA, MafB, Omp26, NMB0995, FhaC, FbpA, Bcp,
NMB 1124, NMB 1162, NMB 1220, NMB 1313, NMB 1953, HtrA, Hsf, LbpB,
FrpA, FrpC, FrpA/C, NadA, OMP85, PldA, LbpA, TbpA (low),
TbpA(high), TbpB(low), TbpB(high), HpuA, HpuB, Hap, IgA protease,
AspA, PilQ, MltA, HimD, HisD, GNA1870, OstA, HipA, TspA, TspB,
P2086, Lipo28, Sibp, NMB0964, NMB0293, NMB0315, NMB1119, TdfH,
PorB, NM-ADPRT, VapD and either or both of LPS immunotype L2 and
LPS immunotype L3.
18. The immunogenic composition of claim 1 wherein NadA is selected
together with at least one further antigen selected from the group
consisting of: PilC, MafA, MafB, Omp26, NMB0995, FhaC, FbpA, Bcp,
NMB 1124, NMB 1162, NMB 1220, NMB 1313, NMB 1953, HtrA, Hsf, LbpB,
FrpA, FrpC, FrpA/C, OMP85, PldA, LbpA, TbpA (low), TbpA(high),
TbpB(low), TbpB(high), HpuA, HpuB, Hap, IgA protease, AspA, PilQ,
MltA, HimD, HisD, GNA1870, OstA, HIpA, TspA, TspB, P2086, Lipo28,
Sibp, NMB0964, NMB0293, NMB0315, NMB 1119, TdfH, PorB, NM-ADPRT,
VapD and either or both of LPS immunotype L2 and LPS immunotype
L3.
19. The immunogenic composition of claim 1 wherein TbpA (low) is
selected together with at least one further antigen selected from
the group consisting of: PilC, MafA, MafB, Omp26, NMB0995, FhaC,
FbpA, Bcp, NMB 1124, NMB 1162, NMB 1220, NMB 1313, NMB 1953, HtrA,
Hsf, LbpB, FrpA, FrpC, FrpA/C, OMP85, PldA, LbpA, TbpA(high),
TbpB(low), TbpB(high), HpuA, HpuB, Hap, IgA protease, AspA, PilQ,
MltA, HimD, HisD, GNA1870, OstA, HlpA, TspA, TspB, P2086, Lipo28,
Sibp, NMB0964, NMB0293, NMB0315, NMB1119, TdfH, PorB, NM-ADPRT,
VapD and either or both of LPS immunotype L2 and LPS immunotype
L3.
20. The immunogenic composition of claim 1 wherein TbpA (high) is
selected together with at least one further antigen selected from
the group consisting of: PilC, MafA, MafB, Omp26, NMB0995, FhaC,
FbpA, Bcp, NMB 1124, NMB 1162, NMB 1220, NMB 1313, NMB 1953, HtrA,
Hsf, LbpB, FrpA, FrpC, FrpA/C, OMP85, PldA, LbpA, TbpB(low),
TbpB(high), HpuA, HpuB, Hap, IgA protease, AspA, PilQ, MltA, HimD,
HisD, GNA1870, OstA, HlpA, TspA, TspB, P2086, Lipo28, Sibp,
NMB0964, NMB0293, NMB0315, NMB1119, TdfH, PorB, NM-ADPRT, VapD and
either or both of LPS immunotype L2 and LPS immunotype L3.
21. The immunogenic composition of claim 1 wherein LbpB is selected
together with at least one further antigen selected from the group
consisting of: PilC, MafA, MafB, Omp26, NMB0995, FhaC, FbpA, Bcp,
NMB 1124, NMB 1162, NMB 1220, NMB 1313, NMB 1953, HtrA, Hsf, FrpA,
FrpC, FrpA/C, OMP85, PldA, LbpA, TbpB(low), TbpB(high), HpuA, HpuB,
Hap, IgA protease, AspA, PilQ, MltA, HimD, HisD, GNA1870, OstA,
HlpA, TspA, TspB, P2086, Lipo28, Sibp, NMB0964, NMB0293, NMB0315,
NMB1119, TdfH, PorB, NM-ADPRT, VapD and either or both of LPS
immunotype L2 and LPS immunotype L3.
22. The immunogenic composition of claim 1 wherein OMP85 is
selected together with at least one further antigen selected from
the group consisting of: PilC, MafA, MafB, Omp26, NMB0995, FhaC,
FbpA, Bcp, NMB 1124, NMB 1162, NMB 1220, NMB 1313, NMB 1953, HtrA,
Hsf, FrpA, FrpC, FrpA/C, PldA, LbpA, TbpB(low), TbpB(high), HpuA,
HpuB, Hap, IgA protease, AspA, PilQ, MltA, HimD, HisD, GNA1870,
OstA, HlpA, TspA, TspB, P2086, Lipo28, Sibp, NMB0964, NMB0293,
NMB0315, NMB1119, TdfH, PorB, NM-ADPRT, VapD and either or both of
LPS immunotype L2 and LPS immunotype L3.
23. The immunogenic composition of claim 1 wherein Hap is selected
together with at least one further antigen selected from the group
consisting of: PilC, MafA, MafB, Omp26, NMB0995, FhaC, FbpA, Bcp,
NMB 1124, NMB 1162, NMB 1220, NMB 1313, NMB 1953, HtrA, Hsf, FrpA,
FrpC, FrpA/C, PldA, LbpA, TbpB(low), TbpB(high), HpuA, HpuB, IgA
protease, AspA, PilQ, MltA, HimD, HisD, GNA1870, OstA, HlpA, TspA,
TspB, P2086, Lipo28, Sibp, NMB0964, NMB0293, NMB0315, NMB1119,
TdfH, PorB, NM-ADPRT, VapD and either or both of LPS immunotype L2
and LPS immunotype L3.
24. The immunogenic composition of claim 1 wherein Hsf is selected
together with at least one further antigen selected from the group
consisting of: PilC, MafA, MafB, Omp26, NMB0995, FhaC, FbpA, Bcp,
NMB 1124, NMB 1162, NMB 1220, NMB 1313, NMB 1953, HtrA, FrpA, FrpC,
FrpA/C, PldA, LbpA, TbpB(low), TbpB(high), HpuA, HpuB, IgA
protease, AspA, PilQ, MltA, HimD, HisD, GNA1870, OstA, HlpA, TspA,
TspB, P2086, Lipo28, Sibp, NMB0964, NMB0293, NMB0315, NMB 1119,
TdfH, PorB, NM-ADPRT, VapD and either or both of LPS immunotype L2
and LPS immunotype L3.
25. The immunogenic composition of claim 1 wherein Frp A is
selected together with at least one further antigen selected from
the group consisting of: PilC, MafA, MafB, Omp26, NMB0995, FhaC,
FbpA, Bcp, NMB 1124, NMB 1162, NMB 1220, NMB 1313, NMB 1953, HtrA,
FrpC, FrpA/C, PldA, LbpA, TbpB(low), TbpB(high), HpuA, HpuB, IgA
protease, AspA, PilQ, MltA, HimD, HisD, GNA1870, OstA, HlpA, TspA,
TspB, P2086, Lipo28, Sibp, NMB0964, NMB0293, NMB0315, NMB 1119,
TdfH, PorB, NM-ADPRT, VapD and either or both of LPS immunotype L2
and LPS immunotype L3.
26. The immunogenic composition of claim 1 wherein FrpC is selected
together with at least one further antigen selected from the group
consisting of: PilC, MafA, MafB, Omp26, NMB0995, FhaC, FbpA, Bcp,
NMB 1124, NMB 1162, NMB 1220, NMB 1313, NMB 1953, HtrA, PldA, LbpA,
TbpB(low), TbpB(high), HpuA, HpuB, IgA protease, AspA, PilQ, MltA,
HimD, HisD, GNA1870, OstA, HlpA, TspA, TspB, P2086, Lipo28, Sibp,
NMB0964, NMB0293, NMB0315, NMB 1119, TdfH, PorB, NM-ADPRT, VapD and
either or both of LPS immunotype L2 and LPS immunotype L3.
27. The immunogenic composition of claim 1 wherein LPS immunotype
L2 is selected together with at least one further antigen selected
from the group consisting of: PilC, MafA, MafB, Omp26, NMB0995,
FhaC, FbpA, Bcp, NMB 1124, NMB 1162, NMB 1220, NMB 1313, NMB 1953,
HtrA, PldA, LbpA, TbpB(low), TbpB(high), HpuA, HpuB, IgA protease,
AspA, PilQ, MltA, HimD, HisD, GNA1870, OstA, HlpA, TspA, TspB,
P2086, Lipo28, Sibp, NMB0964, NMB0293, NMB0315, NMB1119, TdfH,
PorB, NM-ADPRT, VapD and LPS immunotype L3.
28. The immunogenic composition of claim 1 wherein LPS immunotype
L3 is selected together with at least one further antigen selected
from the group consisting of: PilC, MafA, MafB, Omp26, NMB0995,
FhaC, FbpA, Bcp, NMB 1124, NMB 1162, NMB 1220, NMB 1313, NMB 1953,
HtrA, PldA, LbpA, TbpB(low), TbpB(high), HpuA, HpuB, IgA protease,
AspA, PilQ, MltA, HimD, HisD, GNA1870, OstA, HlpA, TspA, TspB,
P2086, Lipo28, Sibp, NMB0964, NMB0293, NMB0315, NMB1119, TdfH,
PorB, NM-ADPRT and VapD.
29. The immunogenic composition of claim 1 wherein PilQ is selected
together with at least one further antigen selected from the group
consisting of: PilC, MafA, MafB, Omp26, NMB0995, FhaC, FbpA, Bcp,
NMB 1124, NMB 1162, NMB 1220, NMB 1313, NMB 1953, HtrA, PldA, LbpA,
TbpB(low), TbpB(high), HpuA, HpuB, IgA protease, AspA, MltA, HimD,
HisD, GNA1870, OstA, HlpA, TspA, TspB, P2086, Lipo28, Sibp,
NMB0964, NMB0293, NMB0315, NMB1119, TdfH, PorB, NM-ADPRT and
VapD.
30. The immunogenic composition of claim 1 wherein HlpA is selected
together with at least one further antigen selected from the group
consisting of: PilC, MafA, MafB, Omp26, NMB0995, FhaC, FbpA, Bcp,
NMB 1124, NMB 1162, NMB 1220, NMB 1313, NMB 1953, HtrA, PldA, LbpA,
TbpB(low), TbpB(high), HpuA, HpuB, IgA protease, AspA, MltA, HimD,
HisD, GNA1870, OstA, TspA, TspB, P2086, Lipo28, Sibp, NMB0964,
NMB0293, NMB0315, NMB 1119, TdfH, PorB, NM-ADPRT and VapD.
31. The immunogenic composition of claim 1 wherein MltA is selected
together with at least one further antigen selected from the group
consisting of: PilC, MafA, MafB, Omp26, NMB0995, FhaC, FbpA, Bcp,
NMB 1124, NMB 1162, NMB 1220, NMB 1313, NMB 1953, HtrA, PldA, LbpA,
TbpB(low), TbpB(high), HpuA, HpuB, IgA protease, AspA, HimD, HisD,
GNA1870, OstA, TspA, TspB, P2086, Lipo28, Sibp, NMB0964, NMB0293,
NMB0315, NMB1119, TdfH, PorB, NM-ADPRT and VapD.
32. The immunogenic composition of claim 1 wherein GNA1870 is
selected together with at least one further antigen selected from
the group consisting of: PilC, MafA, MafB, Omp26, NMB0995, FhaC,
FbpA, Bcp, NMB 1124, NMB 1162, NMB 1220, NMB 1313, NMB 1953, HtrA,
PldA, LbpA, TbpB(low), TbpB(high), HpuA, HpuB, IgA protease, AspA,
HimD, HisD, OstA, TspA, TspB, P2086, Lipo28, Sibp, NMB0964,
NMB0293, NMB0315, NMB1119, TdfH, PorB, NM-ADPRT and VapD.
33. The immunogenic composition of claim 1 wherein NM-ADPRT is
selected together with at least one further antigen selected from
the group consisting of: PilC, MafA, MafB, Omp26, NMB0995, FhaC,
FbpA, Bcp, NMB 1124, NMB 1162, NMB 1220, NMB 1313, NMB 1953, HtrA,
PldA, LbpA, TbpB(low), TbpB(high), HpuA, HpuB, IgA protease, AspA,
HimD, HisD, OstA, TspA, TspB, P2086, Lipo28, Sibp, NMB0964,
NMB0293, NMB0315, NMB1119, TdfH, PorB, and VapD.
34. The immunogenic composition of claim 1 wherein MafA is selected
together with at least one further antigen selected from the group
consisting of: PilC, MafB, Omp26, NMB0995, FhaC, FbpA, Bcp, NMB
1124, NMB 1162, NMB 1220, NMB 1313, NMB 1953, HtrA, PldA, LbpA,
TbpB(low), TbpB(high), HpuA, HpuB, IgA protease, AspA, HimD, HisD,
OstA, TspA, TspB, P2086, Lipo28, Sibp, NMB0964, NMB0293, NMB0315,
NMB1119, TdfH, PorB, and VapD.
35. The immunogenic composition of claim 1 wherein MafB is selected
together with at least one further antigen selected from the group
consisting of: PilC, MafB, Omp26, NMB0995, FhaC, FbpA, Bcp, NMB
1124, NMB 1162, NMB 1220, NMB 1313, NMB 1953, HtrA, PldA, LbpA,
TbpB(low), TbpB(high), HpuA, HpuB, IgA protease, AspA, HimD, HisD,
OstA, TspA, TspB, P2086, Lipo28, Sibp, NMB0964, NMB0293, NMB0315,
NMB1119, TdfH, PorB, and VapD.
36. The immunogenic composition of claim 1 wherein NMB0315 is
selected together with at least one further antigen selected from
the group consisting of: PilC, MafB, Omp26, NMB0995, FhaC, FbpA,
Bcp, NMB 1124, NMB 1162, NMB 1220, NMB 1313, NMB 1953, HtrA, PldA,
LbpA, TbpB(low), TbpB(high), HpuA, HpuB, IgA protease, AspA, HimD,
HisD, OstA, TspA, TspB, P2086, Lipo28, Sibp, NMB0964, NMB0293,
NMB1119, TdfH, PorB, and VapD.
37. The immunogenic composition of claim 1 wherein NMB1119 is
selected together with at least one further antigen selected from
the group consisting of: PilC, MafB, Omp26, NMB0995, FhaC, FbpA,
Bcp, NMB 1124, NMB 1162, NMB 1220, NMB 1313, NMB 1953, HtrA, PldA,
LbpA, TbpB(low), TbpB(high), HpuA, HpuB, IgA protease, AspA, HimD,
HisD, OstA, TspA, TspB, P2086, Lipo28, Sibp, NMB0964, NMB0293,
NMB1119, TdfH, PorB, and VapD.
38. The immunogenic composition of claim 1 wherein HisD is selected
together with at least one further antigen selected from the group
consisting of: PilC, MafB, Omp26, NMB0995, FhaC, FbpA, Bcp, NMB
1124, NMB 1162, NMB 1220, NMB 1313, NMB 1953, HtrA, PldA, LbpA,
TbpB(low), TbpB(high), HpuA, HpuB, IgA protease, AspA, HimD, OstA,
TspA, TspB, P2086, Lipo28, Sibp, NMB0964, NMB0293, NMB1119, TdfH,
PorB, and VapD.
39. The immunogenic composition of claim 1 wherein LbpA is selected
together with at least one further antigen selected from the group
consisting of: PilC, MafB, Omp26, NMB0995, FhaC, FbpA, Bcp, NMB
1124, NMB 1162, NMB 1220, NMB 1313, NMB 1953, HtrA, PldA,
TbpB(low), TbpB(high), HpuA, HpuB, IgA protease, AspA, HimD, OstA,
TspA, TspB, P2086, Lipo28, Sibp, NMB0964, NMB0293, NMB1119, TdfH,
PorB, and VapD.
40. The immunogenic composition of claim 1 wherein NMB 0995 is
selected together with at least one further antigen selected from
the group consisting of: PilC, MafB, Omp26, FhaC, FbpA, Bcp, NMB
1124, NMB 1162, NMB 1220, NMB 1313, NMB 1953, HtrA, PldA,
TbpB(low), TbpB(high), HpuA, HpuB, IgA protease, AspA, HimD, OstA,
TspA, TspB, P2086, Lipo28, Sibp, NMB0964, NMB0293, NMB1119, TdfH,
PorB, and VapD.
41. The immunogenic composition of claim 1 wherein Lipo28 is
selected together with at least one further antigen selected from
the group consisting of: PilC, MafB, Omp26, FhaC, FbpA, Bcp, NMB
1124, NMB 1162, NMB 1220, NMB 1313, NMB 1953, HtrA, PldA,
TbpB(low), TbpB(high), HpuA, HpuB, IgA protease, AspA, HimD, OstA,
TspA, TspB, P2086, Sibp, NMB0964, NMB0293, NMB 1119, TdfH, PorB,
and VapD.
42. The immunogenic composition of claim 1 wherein HimD is selected
together with at least one further antigen selected from the group
consisting of: PilC, MafB, Omp26, FhaC, FbpA, Bcp, NMB 1124, NMB
1162, NMB 1220, NMB 1313, NMB 1953, HtrA, PldA, TbpB(low),
TbpB(high), HpuA, HpuB, IgA protease, AspA, OstA, TspA, TspB,
P2086, Sibp, NMB0964, NMB0293, NMB1119, TdfH, PorB, and VapD.
43. The immunogenic composition of claim 1 wherein NMB1313 is
selected together with at least one further antigen selected from
the group consisting of: PilC, MafB, Omp26, FhaC, FbpA, Bcp, NMB
1124, NMB 1162, NMB 1220, NMB 1953, HtrA, PldA, TbpB(low),
TbpB(high), HpuA, HpuB, IgA protease, AspA, OstA, TspA, TspB,
P2086, Sibp, NMB0964, NMB0293, NMB1119, TdfH, PorB, and VapD.
44. The immunogenic composition of claim 1 wherein NMB1953 is
selected together with at least one further antigen selected from
the group consisting of: PilC, MafB, Omp26, FhaC, FbpA, Bcp, NMB
1124, NMB 1162, NMB 1220, HtrA, PldA, TbpB(low), TbpB(high), HpuA,
HpuB, IgA protease, AspA, OstA, TspA, TspB, P2086, Sibp, NMB0964,
NMB0293, NMB1119, TdfH, PorB, and VapD.
45. The immunogenic composition of claim 5 wherein a host cell from
which the outer membrane vesicle preparation is derived has been
engineered so as to down-regulate the expression from one or more
of lgtB or lgtE.
46. The immunogenic composition of claim 5 wherein a host cell from
which the outer membrane vesicle preparation is derived is unable
to synthesize capsular polysaccharide and has preferably been
engineered so as to down-regulate the expression from one or more
of siaD, ctrA, ctrB, ctrc, ctrD, synA (equivalent to synx and siaA)
or synB (equivalent to siaB and synC (equivalent to siaC),
preferably siaD.
47. The immunogenic composition of claim 5 wherein a host cell from
which the outer membrane vesicle preparation is derived has been
engineered so as to down-regulate the expression of one or more of
OpC, OpA or PorA, preferably PorA.
48. The immunogenic composition of claim 5 wherein a host cell from
which the outer membrane vesicle preparation is derived has been
engineered so as to down-regulate the expression of FrpB.
49. The immunogenic composition of claim 5 wherein a host cell from
which the outer membrane vesicle preparation is derived has been
engineered so as to down-regulate the expression from msbB and/or
htrB, preferably msbB.
50. The immunogenic composition of claim 5 wherein the outer
membrane vesicle preparation contains LPS which is conjugated to an
outer membrane protein (OMP).
51. The immunogenic composition of claim 50 wherein LPS is
conjugated (preferably intra-bleb) to OMP in situ in the outer
membrane vesicle preparation.
52. The immunogenic composition of claim 1 comprising an antigen
derived from Neisseria meningitidis, preferably serogroup B.
53. The immunogenic compositions of claim 1 comprising an antigen
derived from Neisseria gonorrhoeae.
54. The immunogenic composition of claim 1 wherein all neisserial
antigens are derived from N. meningitidis.
55. The immunogenic composition of claim 1 further comprising one
or more bacterial capsular polysaccharides or oligosaccharides.
56. The immunogenic composition of claim 55 wherein the capsular
polysaccharides or oligosaccharides are derived from bacteria
selected from the group consisting of: Neisseria meningitidis
serogroup A, C, Y and W-135, Haemophilus influenzae b,
Streptococcus pneumoniae, Group A Streptococci, Group B
Streptococci, Staphylococcus aureus and Staphylococcus
epidermidis.
57. The immunogenic composition of claim 55 wherein the capsular
polysaccharide or oligosaccharide is conjugated to a protein.
58. The immunogenic composition of claim 1 comprising an
adjuvant.
59. The immunogenic composition of claim 58 comprising aluminium
salts.
60. The immunogenic composition of claim 58 or 59 comprising
3D-MPL.
61. A vaccine comprising the immunogenic composition of claims 160
claim 1 and a pharmaceutically acceptable carrier.
62. A vaccine comprising one or more polynucleotide(s) encoding two
or more different proteins whose expression is driven by a
eukaryotic promoter, wherein the proteins are selected from at
least two of the following categories: at least one Neisserial
adhesin selected from the group consisting of FhaB, NspA, PilC,
Hsf, Hap, MafA, MafB, Omp26, NMB0315, NMB0995, NMB1119 and NadA; at
least one Neisserial autotransporter selected from the group
consisting of Hsf, Hap, IgA protease, AspA and NadA; at least one
Neisserial toxin selected from the group consisting of FrpA, FrpC,
FrpA/C, VapD and NM-ADPRT; at least one Neisserial Fe acquisition
protein selected from the group consisting of TbpA high, TbpA low,
TbpB high, TbpB low, LbpA, LbpB, P2086, HpuA, HpuB, Lipo28, Sibp,
FbpA, BfrA, BfrB, Bcp, NMB0964 and NMB0293; or at least one
Neisserial membrane associated protein, preferably integral outer
membrane protein selected from the group consisting of PilQ, OMP85,
FhaC, NspA, TbpA(high), TbpA(low), LbpA, HpuB, TspA, TspB, TdfH,
PorB, HimD, HisD, GNA1870, OstA, HlpA, MltA, NMB 1124, NMB 1162,
NMB 1220, NMB 1313, NMB 1953, HtrA and PldA.
63. A method for treatment or prevention of Neisserial disease
comprising administering a protective dose of the vaccine of claim
61 to a host in need thereof.
64. The method of claim 63 in which Neisseria meningitidis
infection is prevented or treated.
65. The method of claim 63 in which Neisseria gonorrhoeae infection
is prevented or treated.
66. A use of the vaccine of claim 61 in the preparation of a
medicament for treatment or prevention of Neisserial infection.
67. The use of claim 66 in which Neisseria meningitidis infection
is prevented or treated.
68. The use of claim 66 in which Neisseria gonorrhoeae infection is
prevented or treated.
69. A genetically engineered Neisserial strain from which the outer
membrane vesicle preparation of claim 5 is derived.
70. A method of making the immunogenic composition of claim 1
comprising a step of mixing together at least two antigens from
Neisseria.
71. A method of making the immunogenic composition of claim 1
comprising a step of isolating outer membrane vesicles from a
Neisserial culture.
72. The method of claim 71 comprising a further step of combining
at least two outer membrane vesicle preparations.
73. The method of claim 72 wherein at least one outer membrane
vesicle preparation contains LPS of immunotype L2 and at least one
outer membrane vesicle preparation contains LPS of immunotype
L3.
74. The method of claim 71 wherein the outer membrane vesicles are
isolated by extracting with a concentration of DOC of 0-0.5%.
75. The method of claim 74 wherein the outer membrane vesicles are
isolated by extracting with a concentration of DOC of 0.02%-0.4%,
0.04%-0.3%, 0.06%-0.2%, 0.08%-0.15%.
76. A method of making the vaccine of claim 61 comprising a step of
combining the immunogenic composition with a pharmaceutically
acceptable carrier.
77. A method of preparing an immune globulin for use in prevention
or treatment of Neisserial infection comprising the steps of
immunising a recipient with the vaccine of claim 61 and isolating
immune globulin from the recipient.
78. An immune globulin prepared by the method of claim 77.
79. A pharmaceutical composition comprising the immune globulin of
claim 78 and a pharmaceutically acceptable carrier.
80. A method for treatment or prevention of Neisserial infection
comprising a step of administering to a patient an effective amount
of the pharmaceutical preparation of claim 79.
81. A use of the pharmaceutical preparation of claim 79 in the
manufacture of a medicament for the treatment or prevention of
Neisserial disease.
82. The immunogenic composition of claim 5, comprising a
meningococcal bleb of immunotype L2 and a meningococcal bleb of
immunotype L3.
83. The immunogenic composition of claim 82 wherein TbpA(high) is
upregulated in one of the blebs.
84. The immunogenic composition of wherein TbpA(low) is upregulated
in one of the blebs.
85. The immunogenic composition of claim 82 wherein Hsf is
upregulated in one of the blebs.
86. The immunogenic composition of claim 82 wherein OMP85 is
upregulated in one of the blebs.
87. The immunogenic composition of claim 82 wherein the blebs are
isolated from meningococcal strains incapable of making capsular
polysaccharide, preferably siaD.sup.-.
88. The immunogenic composition of claim 82 wherein the L2 and/or
L3 LPS oligosaccharide structures are truncated consistent with the
blebs having been isolated from meningococcal strains that are
lgtB.sup.-.
89. The immiunogenic composition of claim 82 wherein the blebs are
isolated from meningococcal strains that have down-regulated
expression of msbB.
90. The immunogenic composition of claim 82 wherein the L2 and/or
L3 LPS oligosaccharide moieties are intra-bleb conjugated to
outer-membrane proteins integral to the bleb.
91. The immunogenic composition of claim 82 wherein the blebs are
derived from meningococcal strains which have down-regulated
expression of one or more of: FrpB, PorA, Opa or Opc.
Description
TECHNICAL FIELD
[0001] The present invention relates to the field of Neisserial
immunogenic compositions and vaccines, their manufacture and the
use of such compositions in medicine. More particularly, it relates
to vaccine compositions comprising a combination of antigens which
have qualities allowing the vaccines of the invention to elicit a
surprising good immune response as measured in a protection assay
or a serum bactericidal assay.
BACKGROUND
[0002] Neisserial strains of bacteria are the causative agents for
a number of human pathologies, against which there is a need for
effective vaccines to be developed. In particular Neisseria
gonorrhoeae and Neisseria meningitidis cause pathologies which
could be treated by vaccination.
[0003] Neisseria gonorrhoeae is the etiologic agent of gonorrhea,
one of the most frequently reported sexually transmitted diseases
in the world with an estimated annual incidence of 62 million cases
(Gerbase et al 1998 Lancet 351; (Suppl 3) 2-4). The clinical
manifestations of gonorrhea include inflammation of the mucus
membranes of the urogenital tract, throat or rectum and neonatal
eye infections. Ascending gonococcal infections in women can lead
to infertility, ectopic pregnancy, chronic pelvic inflammatory
disease and tubo-ovarian abscess formation. Septicemia, arthritis,
endocarditis and menigitis are associated with complicated
gonorrhea.
[0004] The high number of gonococcal strains with resistance to
antibiotics contributes to increased morbidity and complications
associated with gonorrhea. An attractive alternative to treatment
of gonorrhea with antibiotics would be its prevention using
vaccination. No vaccine currently exists for N. gonorrhoeae
infections. Neisseria menigitidis is an important pathogen,
particularly in children and young adults. Septicemia and
meningitis are the most life-threatening forms of invasive
meningococcal disease (IMD). This disease has become a worldwide
health problem because of its high morbidity and mortality.
[0005] Thirteen N. meningitidis serogroups have been identified
based on antigenic differences in the capsular polysaccharides, the
most common being A, B and C which are responsible for 90% of
disease worldwide. Serogroup B is the most common cause of
meningococcal disease in Europe, USA and several countries in Latin
America.
[0006] Vaccines based on the capsular polysaccharide of serogroups
A, C, W and Y have been developed and have been shown to control
outbreaks of meningococcal disease (Peltola et al 1985 Pediatrics
76; 91-96). However serogroup B is poorly immunogenic and induces
only a transient antibody response of a predominantly IgM isotype
(Ala'Aldeen D and Cartwright K 1996, J. Infect. 33; 153-157). There
is therefore no broadly effective vaccine currently available
against the serogroup B meningococcus which is responsible for the
majority of disease in most temperate countries. This is
particularly problematic since the incidence of serotype B disease
is increasing in Europe, Australia and America, mostly in children
under 5. The development of a vaccine against serogroup B
meningococcus presents particular difficulties because the
polysaccharide capsule is poorly immunogenic owing to its
immunologic similarity to human neural cell adhesion molecule.
Strategies for vaccine production have therefore concentrated on
the surface exposed structures of the meningococcal outer membrane
but have been hampered by the marked variation in these antigens
among strains.
[0007] Further developments have led to the introduction of
vaccines made up of outer membrane vesicles which will contain a
number of proteins that make up the normal content of the bacterial
membrane. One of these is the VA-MENGOC-BC.RTM. Cuban vaccine
against N. meningitidis serogroups B and C (Rodriguez et al 1999
Mem Inst. Oswaldo Cruz, Rio de Janeiro 94; 433-440). This vaccine
was designed to combat an invasive meningococcal disease outbreak
in Cuba which had not been eliminated by a vaccination programme
using a capsular polysaccharide AC vaccine. The prevailing
serogroups were B and C and the VA-MENGOC-BC.RTM. vaccine was
successful at controlling the outbreak with an estimated vaccine
efficiency of 83% against serogroup B strains of N. meningitidis
(Sierra et al 1990 In Neisseria, Walter Gruyter, Berlin, m. Atchman
et al (eds) p 129-134, Sierra et al 1991, NIPH Ann 14; 195-210).
This vaccine was effective against a specific outbreak, however the
immune response elicited would not protect against other strains of
N. meningitidis.
[0008] Subsequent efficacy studies conducted in Latin America
during epidemics caused by homologous and heterologous serogroup B
meningococcal strains have shown some efficacy in older children
and adults but its effectiveness was significantly lower in younger
children who are at greatest risk of infection (Milagres et al
1994, Infect. Immun. 62; 4419-4424). It is questionable how
effective such a vaccine would be in countries with multistrain
endemic disease such as the UK. Studies of immunogenicity against
heterologous strains have demonstrated only limited cross-reactive
serum bactericidal activity, especially in infants (Tappero et al
1999, JAMA 281; 1520-1527).
[0009] A second outer membrane vesicle vaccine was developed in
Norway using a serotype B isolate typical of those prevalent in
Scandinavia (Fredriksen et al 1991, NIPH Ann, 14; 67-80). This
vaccine was tested in clinical trials and found to have a
protective efficacy after 29 months of 57% (Bjune et al 1991,
Lancet, 338; 1093-1096).
[0010] However, the use of outer membrane vesicles in vaccines is
associated with some problems. For instance, the OMV contain toxic
lipopolysaccharides and they may contain immunodominant antigens
which are either strain specific or are expressed variably. Several
processes have been described which could be used to overcome some
of the problems of outer membrane vesicle preparation vaccines.
WO01/09350 describes processes that address some of these problems
for instance by reducing toxicity and modifying the antigens
present on the outer membrane vesicles.
[0011] WO01/52885 describes the possibility of combining outer
membrane vesicles with other antigens and a list of over 2,000
potential Neisserial proteins is included from which it is
speculated that a vaccines with efficacy against a broader range of
serotypes could be developed.
[0012] There are diverse problems with the anti-meningococcal
vaccines currently available. The protein based outer membrane
vaccines tend to be specific and effective against only a few
strains. The polysaccharide vaccines are also suboptimal since they
tend to elicit poor and short immune responses, particularly
against serogroup B (Lepow et al 1986; Peltola 1998, Pediatrics 76;
91-96).
[0013] Neisseria infections represent a considerable health care
problem for which no vaccines are available in the case of N.
gonorrhoeae or vaccines with limitations on their efficacy and
ability to protect against heterologous strains are available in
the case of N. meningitidis. Clearly there is a need to develop
superior vaccines against Neisserial infections that will improve
on the efficacy of currently available vaccines and allow for
protection against a wider range of strains.
DESCRIPTION OF FIGURES
[0014] FIG. 1.--Detection of ThpA and Hsf in OMV's prepared from a
recombinant N. meningitidis strain up-regulated for the expression
of tbpA and hsf Separation of OMV preparations (long) by SDS-PAGE
analysis (4-20% gradient gels) stained with Coomassie brilliant
blue.
[0015] FIG. 2.--Detection of recombinant Hsf passenger domain
produced in E. coli, 10 ug of purified Hsf passenger protein (Lane
2 & 3) was separated by SDS-PAGE on a 12% gel in comparison to
a molecular weight marker (Lane 1).
[0016] FIG. 3.--Analysis of Hap passenger purity as detected by (A)
Coomassie staining, (B) silver staining, (C) anti-His5 western
blotting and (D) anti-E. coli. 10 .mu.g of purified antigens was
separated by SDS-PAGE on a 4-20% acrylamide gradient gel.
[0017] FIG. 4.--Regions of sequence similarity shared by FrpA and
FrpC proteins isolated from N. meningitidis strain FAM20. (A)
Domain organization of N. meningitidis strain FAM20 RTX proteins
FrpA and FrpC. (B) FrpA/C Amplification products obtained from N.
meningitidis strain H44/76.
[0018] FIG. 5.--Expression of recombinant Frp23 (FrpA/C conserved
region with 23 repeats) antigen in E. coli. SDS-PAGE analysis of
non-induced (NI) and induced (I) total cell extracts of E. coli
BL21DE3 tranformed with control vectors (pET24d) or recombinant
constructs (Frp3, Frpl3 and Frp 23 respectively). Gels were stained
with Coomassie blue (A) or transferred to nitrocellulose and
immuno-detected with anti-His6 mouse serum.
[0019] FIG. 6.--Preferred DNA sequence of the FHAB 2/3.sup.rd
fragment expressed in E. coli.
[0020] FIG. 7.--Purification of recombinant FHAB 2/3.sup.rd from
induced E. coli B121DE3 extracts. (A) Main steps in the
purification process. (13) SDS-PAGE analysis of protein fractions
sampled at different steps of the purification process.
[0021] FIG. 8.--Adhesion blocking activities of anti-sera directed
against the FHAB2/3.sup.rd, Hap, Hap passenger domain, Hsf and Hsf
passenger domain antigens of N. meningitidis.
[0022] FIG. 9.--A Coomassie stained gel showing expression levels
of Hsf, ThpA and NspA in outer membrane vesicle preparations
derived from different N. meningitidis stains. Lane 1--molecular
weight markers; lane 2--outer membrane vesicles prepared from
strain H44/76 in which capsular polysaccharides were downregulated;
lane 3--outer membrane vesicles prepared from strain H44/76 in
which capsular polysaccharides and PorA were downregulated; lane
4--outer membrane vesicles prepared from strain H44/76 in which
capsular polysaccharides and PorA were downregulated and NspA was
upregulated; lane 5--outer membrane vesicles prepared from strain
H44/76 in which capsular polysaccharides and PorA were
down-regulated and Hsf was upregulated; lane 6--outer membrane
vesicles prepared from strain H44/76 in which capsular
polysaccharides and PorA were downregulated and ThpA was
upregulated; lane 7--outer membrane vesicles prepared from strain
H44/76 in which capsular polysaccharides and PorA were
downregulated and ThpA and Hsf were upregulated; lane 8--outer
membrane vesicles prepared from strain H44/76 in which capsular
polysaccharides and PorA were downregulated and ThpA and NspA were
upregulated.
DETAILED DESCRIPTION
[0023] The present invention discloses particular combinations of
Neisserial antigens which when combined, lead to a surprising
enhancement of the efficacy of the vaccine against Neisserial
infection.
[0024] Neisserial infections progress through several different
stages. For example, the meningococcal life cycle involve
nasopharyngeal colonisation, mucosal attachment, crossing into the
bloodstream, multiplication in the blood, induction of toxic shock,
crossing the blood/brain barrier and multiplication in the
cerebrospinal fluid and/or the meninges. Different molecules on the
surface of the bacterium will be involved in different steps of the
infection cycle. By targeting the immune response against an
effective amount of a combination of particular antigens, involved
in different processes of Neisserial infection, a Neisserial
vaccine with surprisingly high efficacy can be achieved.
[0025] In particular, combinations of certain antigens from
different classes, some of which are involved in adhesion to host
cells, some of which are involved in iron acquisition, some of
which are autotransporters and some of which are toxins, can elicit
an immune response which protects against multiple stages of
infection. Such combinations of antigens can surprisingly lead to
improved (preferably synergistically improved) vaccine efficacy
against Neisserial infection where more that one function of the
bacterium is targeted by the immune response in an optimal
fashion.
[0026] The efficacy of vaccines can be assessed through a variety
of assays. Protection assays in animal models are well known in the
art. Furthermore, serum bactericidal assay (SBA) is the most
commonly agreed immunological marker to estimate the efficacy of a
meningococcal vaccine (Perkins et al. J Infect Dis. 1998,
177:683-691).
[0027] Some combinations of antigens (for example, combinations of
certain autotransporter proteins and certain iron acquisition
proteins) can lead to improved protection in animal model assays
and/or synergistically higher SBA titres. Without wishing to be
bound by theory, such synergistic combinations of antigens are
enabled by a number of characteristics of the immune response to
the antigen combination. The antigens themselves are usually
surface exposed on the Neisserial cells and tend to be conserved
but also tend not to be present in sufficient quantity on the
surface cell for an optimal bactericidal response to take place
using antibodies elicited against the antigen alone. Combining the
antigens of the invention can result in a formulation eliciting an
advantageous combination of bactericidal antibodies which interact
with the Neisserial cell beyond a critical threshold. At this
critical level, sufficient antibodies of sufficient quality bind to
the surface of the bacterium to allow efficient killing by
complement and much higher bactericidal effects are seen as a
consequence.
[0028] As serum bactericidal assays (SBA) closely reflect the
efficacy of vaccine candidates, the attainment of good SBA titres
by a combination of antigens is a good indication of the protective
efficacy of a vaccine containing that combination of antigens. The
invention relates to the use of a combination of two antigens
either isolated or enriched in a mixture with other antigens. When
combined, such antigen combinations interact advantageously, and
preferably synergistically to elicit an immune response that is
higher in terms of bactericidal activity (for example as measured
by serum bactericidal assay or SBA), and preferably higher than the
additive response elicited by the antigens individually, more
preferably by a factor of at least 1.2, 1.5, two, three, four,
five, six, seven, eight, nine, most preferably by a factor of at
least ten.
[0029] An additional advantage of the invention is that the
combination of the antigens of the invention from different
families of proteins in an immunogenic composition may enable
protection against a wider range of strains.
[0030] The invention relates to immunogenic compositions comprising
a plurality (two or more) of proteins selected from at least two
different categories of protein, having different functions within
Neisseria. Examples of such categories of proteins are adhesins,
autotransporter proteins, toxins, integral outer membrane proteins
and Fe acquisition proteins. The vaccine combinations of the
invention show surprising improvement in vaccine efficacy against
homologous Neisserial strains (strains from which the antigens are
derived) and preferably also against heterologous Neisserial
strains.
[0031] The invention provides immunogenic compositions comprising
at least or exactly two, three, four, five six, seven, eight, nine
or ten of different antigens selected from at least or exactly two,
three, four or all five categories of antigens selected from the
following: [0032] at least one Neisserial adhesin; [0033] at least
one Neisserial autotransporter; [0034] at least one Neisserial
toxin; [0035] at least one Neisserial Fe acquisition protein;
[0036] at least one Neisserial membrane-associated protein
(preferably outer membrane protein, particularly integral outer
membrane protein).
[0037] Preferably, the invention provides immunogenic compositions
that comprise at least or exactly two, three, four, five, six,
seven, eight, nine or ten different Neisseria antigens. Most
preferably these antigens are selected from at least or exactly
two, three, four or five groups of proteins selected from the
following: [0038] at least one Neisserial adhesin selected from the
group consisting of FhaB, NspA PilC, Hsf, Hap, MafA, MafB, Omp26,
NMB 0315, NMB 0995, NMB 1119 and NadA; [0039] at least one
Neisserial autotransporter selected from the group consisting of
Hsf, Hap, IgA protease, AspA, and NadA; [0040] at least one
Neisserial toxin selected from the group consisting of FrpA, FrpC,
FrpA/C, VapD, NM-ADPRT and either or both of LPS immunotype L2 and
LPS immunotype L3; [0041] at least one Neisserial Fe acquisition
protein selected from the group consisting of TbpA, TbpB, LbpA,
LbpB, HpuA, HpuB, Lipo28 (GNA2132), Sibp, NMB0964, NMB0293, FbpA,
Bcp, BfrA, BfrB and P2086 (XthA); and [0042] at least one
Neisserial membrane-associated protein, preferably outer membrane
protein, particularly integral outer membrane protein, selected
from the group consisting of PilQ, OMP85, FhaC, NspA, ThpA, LbpA,
TspA, TspB, TdfH, PorB, MltA, HpuB, HimD, HisD, GNA1870, OstA, HlpA
(GNA1946), NMB 1124, NMB 1162, NMB 1220, NMB 1313, NMB 1953, HtrA,
and PldA (Omp1A).
[0043] The antigens of the present invention are all isolated,
meaning that they are altered by the hand of man. Preferably they
are purified to some degree, most preferably more than 40, 50, 60,
70, 80, 90, 95 or 99% pure (before combination with the other
components of the immunogenic compositions of the invention).
[0044] Preferably the immunogenic composition of the invention
comprises at least one Neisserial adhesin and at least one
Neisserial autotranporter and optionally a Neisserial toxin, a
Neisserial Fe acquisition protein or a Neisserial
membrane-associated protein (preferably integral outer membrane
protein). Preferably the antigens are selected from the above named
antigens.
[0045] Preferably the immunogenic composition of the invention
comprises at least one Neisserial adhesin and at least one
Neisserial toxin and optionally a Neisserial autotranporter, a
Neisserial Fe acquisition protein or a Neisserial
membrane-associated protein (preferably integral outer membrane
protein). Preferably the antigens are selected from the above named
antigens.
[0046] Preferably the immunogenic composition of the invention
comprises at least one Neisserial adhesin and at least one
Neisserial Fe acquisition protein and optionally a Neisserial
toxin, a Neisserial autotransporter or a Neisserial
membrane-associated protein (preferably integral outer membrane
protein). Preferably the antigens are selected from the above named
antigens.
[0047] Preferably the immunogenic composition of the invention
comprises at least one Neisserial adhesin and at least one
Neisserial membrane-associated protein (preferably integral outer
membrane protein) and optionally a Neisserial toxin, a Neisserial
Fe acquisition protein or a Neisserial autotransporter. Preferably
the antigens are selected from the above named antigens.
[0048] Preferably the immunogenic composition of the invention
comprises at least one Neisserial autotranporter and at least one
Neisserial toxin and optionally a Neisserial adhesin, a Neisserial
Fe acquisition protein or a Neisserial membrane-associated protein
(preferably integral outer membrane protein). Preferably the
antigens are selected from the above named antigens.
[0049] Preferably the immunogenic composition of the invention
comprises at least one Neisserial autotranporter and at least one
Neisserial Fe acquisition protein and optionally a Neisserial
adhesin, a Neisserial toxin or a Neisserial membrane-associated
protein (preferably integral outer membrane protein). Preferably
the antigens are selected from the above named antigens.
[0050] Preferably the immunogenic composition of the invention
comprises at least one Neisserial autotranporter and at least one
Neisserial membrane-associated protein (preferably integral outer
membrane protein) and optionally a Neisserial adhesin, a Neisserial
Fe acquisition protein or a Neisserial toxin. Preferably the
antigens are selected from the above named antigens.
[0051] Preferably the immunogenic composition of the invention
comprises at least one Neisserial toxin and at least one Neisserial
Fe acquisition protein and optionally a Neisserial adhesin, a
Neisserial autotransporter or a Neisserial membrane-associated
protein (preferably integral outer membrane protein). Preferably
the antigens are selected from the above named antigens.
[0052] Preferably the immunogenic composition of the invention
comprises at least one Neisserial toxin and at least one Neisserial
membrane-associated protein (preferably integral outer membrane
protein) and optionally a Neisserial adhesin, a Neisserial
autotransporter or a Neisserial toxin. Preferably the antigens are
selected from the above named antigens.
[0053] Preferably the immunogenic composition of the invention
comprises at least one Neisserial Fe acquisition protein and at
least one Neisserial membrane-associated protein (preferably
integral outer membrane protein) and optionally a Neisserial
adhesin, a Neisserial autotransporter or a Neisserial toxin.
Preferably the antigens are selected from the above named
antigens.
[0054] Preferably all five groups of antigen are represented in the
immunogenic composition of the invention.
[0055] Where a protein is specifically mentioned herein, it is
preferably a reference to a native, full-length protein, and to its
natural variants (i.e. to a native protein obtainable from a
Neisserial, preferably meningococcal strain) but it may also
encompass antigenic fragments thereof (particularly in the context
of subunit vaccines). These are fragments (often specifically
described herein) containing or comprising at least 10 amino acids,
preferably 20 amino acids, more preferably 30 amino acids, more
preferably 40 amino acids or most preferably 50 amino acids, taken
contiguously from the amino acid sequence of the protein. In
addition, antigenic fragments denotes fragments that are
immunologically reactive with antibodies generated against the
Neisserial full-length proteins or with antibodies generated by
infection of a mammalian host with Neisseria. Antigenic fragments
also includes fragments that when administered at an effective
dose, elicit a protective immune response against Neisserial
infection, more preferably it is protective against N. meningitidis
and/or N. gonorrhoeae infection, most preferably it is protective
against N. meningitidis serogroup B infection.
[0056] Also included in the invention are recombinant fusion
proteins of Neisserial proteins of the invention, or fragments
thereof. These may combine different Neisserial proteins or
fragments thereof in the same polypeptide. Alternatively, the
invention also includes individual fusion proteins of Neisserial
proteins or fragments thereof, as a fusion protein with
heterologous sequences such as a provider of T-cell epitopes or
purification tags, for example: .beta.-galactosidase,
glutathione-S-transferase, green fluorescent proteins (GFP),
epitope tags such as FLAG, myc tag, poly histidine, or viral
surface proteins such as influenza virus haemagglutinin, tetanus
toxoid, diphtheria toxoid, CRM197.
Antigens of the Invention
[0057] NMB references refer to reference numbers to sequences which
can be accessed from www.neisseria.org.
1. Adhesins
[0058] Adhesins include FhaB (WO98/02547), NadA (J. Exp. Med (2002)
195:1445; NMB 1994), Hsf also known as NhhA (NMB 0992)
(WO99/31132), Hap (NMB 1985)(WO99/55873), NspA (WO96/29412), MafA
(NMB 0652) and MafB (NMB 0643) (Annu Rev Cell Dev Biol. 16; 423-457
(2000); Nature Biotech 20; 914-921 (2002)), Omp26 (NMB 0181), NMB
0315, NMB 0995, NMB 1119 and PilC (Mol. Microbiol. 1997, 23;
879-892). These are proteins that are involved in the binding of
Neisseria to the surface of host cells. Hsf is an example of an
adhesin, as well as being an autotranporter protein. Immunogenic
compositions of the invention may therefore include combinations of
Hsf and other autotransporter proteins where Hsf contributes in its
capacity as an adhesin. These adhesins may be derived from
Neisseria meningitidis or Neisseria gonorrhoeae or other Neisserial
strains. The invention also includes other adhesins from
Neisseria.
FbaB
[0059] This antigen has been described in WO98/02547 SEQ ID NO 38
(nucleotides 3083-9025)--see also NMB0497. The present inventors
have found FhaB to be particularly effectively at inducing
anti-adhesive antibodies alone and in particular with other
antigens of the invention. Although full length FhaB could be used,
the inventors have found that particular C-terminal truncates are
surprisingly at least as effective and preferably even more
effective in terms of cross-strain effect. Such truncates have also
been advantageously shown to be far easier to clone. FhaB truncates
of the invention typically correspond to the N-terminal two-thirds
of the FhaB molecule, preferably the new C-terminus being situated
at position 1200-1600, more preferably at position 1300-1500, and
most preferably at position 1430-1440. Specific embodiments have
the C-terminus at 1433 or 1436. Accordingly such FhaB truncates of
the invention and vaccines comprising such truncates are
independent aspects of the present invention as well as being
components of the combination immunogenic compositions of the
invention. The N-terminus may also be truncated by up to 10, 20,
30, 40 or 50 amino acids.
2. Autotransporter Proteins
[0060] Autotransporter proteins typically are made up of a signal
sequence, a passenger domain and an anchoring domain for attachment
to the outer membrane. Examples of autotransporter proteins include
Hsf (WO99/31132) (NMB 0992), HMW, Hia (van Ulsen et al Immunol.
Med. Microbiol. 2001 32; 53-64), Hap (NMB 1985) (WO99/55873; van
Ulsen et al Immunol. Med. Microbiol. 2001 32; 53-64), UspA, UspA2,
NadA (NMB 1994) (Comanducci et al J. Exp. Med. 2002 195;
1445-1454), AspA (Infection and Immunity 2002, 70(8); 4447-4461;
NMB 1029), Aida-1 like protein, SSh-2 and Tsh. NadA (J. Exp. Med
(2002) 195:1445) is another example of an autotransporter proteins,
as well as being an adhesin. Immunogenic compositions of the
invention may therefore include combinations of NadA and adhesins
where NadA contributes in its capacity as an autotransporter
protein. These proteins may be derived from Neisseria meningitidis
or Neisseria gonorrhoeae or other Neiserial strians. The invention
also includes other autotransporter proteins from Neisseria.
Hsf
[0061] Hsf has a structure that is common to autotransporter
proteins. For example, Hsf from N. meningitidis strain H44/76
consists of a signal sequence made up of amino acids 1-51, a head
region at the amino terminus of the mature protein (amino acids
52-479) that is surface exposed and contains variable regions
(amino acids 52-106, 121-124, 191-210 and 230-234), a neck region
(amino acids 480-509), a hydrophobic alpha-helix region (amino
acids 518-529) and an anchoring domain in which four transmembrane
strands span the outer membrane (amino acids 539-591).
[0062] Although full length Hsf may be used in immunogenic
compositions of the invention, various Hsf truncates and deletions
may also be advantageously used depending on the type of
vaccine.
[0063] Where Hsf is used in a subunit vaccine, it is preferred that
a portion of the soluble passenger domain is used; for instance the
complete domain of amino acids 52 to 479, most preferably a
conserved portion thereof, for instance the particularly
advantageous sequence of amino acids 134 to 479. Preferred forms of
Hsf may be truncated so as to delete variable regions of the
protein disclosed in WO01/55182. Preferred variants would include
the deletion of one, two, three, four, or five variable regions as
defined in WO01/55182. The above sequences and those described
below, can be extended or truncated by up to 1, 3, 5, 7, 10 or 15
amino acids at either or both N or C termini.
[0064] Preferred fragments of Hsf therefore include the entire head
region of Hsf, preferably containing amino acids 52-473. Additional
preferred fragments of Hsf include surface exposed regions of the
head including one or more of the following amino acid sequences;
52-62, 76-93, 116-134, 147-157, 157-175, 199-211, 230-252, 252-270,
284-306, 328-338, 362-391, 408-418, 430-440 and 469-479.
[0065] Where Hsf is present in an outer membrane vesicle
preparation, it may be expressed as the full-length protein or
preferably as an advantageous variant made up of a fusion of amino
acids 1-51 and 134-591 (yielding a mature outer membrane protein of
amino acid sequence 134 to the C-terminus). Preferred forms of Hsf
may be truncated so as to delete variable regions of the protein
disclosed in WO01/55182. Preferred variants would include the
deletion of one, two, three, four, or five variable regions as
defined in WO01/55182. Preferably the first and second variable
regions are deleted. Preferred variants would delete residues from
between amino acid sequence 52 through to 237 or 54 through to 237,
more preferably deleting residues between amino acid 52 through to
133 or 55 through to 133. The mature protein would lack the signal
peptide.
Hap
[0066] Computer analysis of the Hap-like protein from Neisseria
meningitidis reveals at least three structural domains. Considering
the Hap-like sequence from strain H44/76 as a reference, Domain 1,
comprising amino-acid 1 to 42, encodes a sec-dependant signal
peptide characteristic of the auto-transporter family, Domain 2,
comprising amino-acids 43 to 950, encode the passenger domain
likely to be surface exposed and accessible to the immune system,
Domain 3, comprising residues 951 to the C-terminus (1457), is
predicted to encode a beta-strands likely to assemble into a
barrel-like structure and to be anchored into the outer-membrane.
Since domains 2 is likely to be surface-exposed, well conserved
(more than 80% in all strain tested) and could be produced as
subunit antigens in E. coli, it represents an interesting vaccine
candidates. Since domains 2 and 3 are likely to be surface-exposed,
are well conserved (Pizza et al. (2000), Science 287: 1816-1820),
they represent interesting vaccine candidates. Domain 2 is known as
the passenger domain.
[0067] Immunogenic compositions of the invention may comprise the
full-length Hap protein, preferably incorporated into an OMV
preparation. Immunogenic compositions of the invention may also
comprise the passenger domain of Hap which in strain H44/76 is
composed of amino acid residues 43-950. This fragment of Hap would
be particularly advantageously used in a subunit composition of the
invention. The above sequence for the passenger domain of Hap can
be extended or truncated by up to 1, 3, 5, 7, 10, 15, 20, 25, or 30
amino acids at either or both N or C termini.
3. Iron Acquisition Proteins
[0068] Iron aquisition proteins include ThpA (NMB 0461)
(WO92/03467, US5912336, WO93/06861 and EP586266), TbpB (NMB 0460)
(WO93/06861 and EP586266), LbpA (NMB 1540) (Med Microbiol (1999)
32:1117), LbpB (NMB 1541)(WO/99/09176), HpuA (U73112.2) (Mol
Microbiol. 1997, 23; 737-749), HpuB (NC.sub.--003116.1) (Mol
Microbiol. 1997, 23; 737-749), P2086 also known as XthA (NMB 0399)
(13.sup.th International Pathogenic Neisseria Conference 2002),
FbpA (NMB 0634), FbpB, BfrA (NMB 1207), BfrB (NMB 1206), Lipo28
also known as GNA2132 (NMB 2132), Sibp (NMB 1882), HmbR, HemH, Bcp
(NMB 0750), Iron (III) ABC transporter-permease protein (Tettelin
et al Science 287; 1809-1815 2000), Iron (III) ABC
transporter--periplasmic (Tettelin et al Science 287; 1809-1815
2000), TonB-dependent receptor (NMB 0964 and NMB 0293)(Tettelin et
al Science 287; 1809-1815 2000) and transferrin binding protein
related protein (Tettelin et al Science 287; 1809-1815 2000). These
proteins may be derived from Neisseria meizingitidis, Neisseria
gonorrhoeae or other Neisserial strains. The invention also
includes other iron aquisition proteins from Neisseria.
TbpA
[0069] ThpA interacts with TbpB to form a protein complex on the
outer membrane of Neisseria, which binds transferrin. Structurally,
ThpA contains an intracellular N-terminal domain with a TonB box
and plug domain, multiple transmembrane beta strands linked by
short intracellular and longer extracellular loops.
[0070] Two families of TbpB have been distinguished, having a high
molecular weight and a low molecular weight respectively. High and
low molecular weight forms of TbpB associate with different
families of ThpA which are distinguishable on the basis of
homology. Despite being of similar molecular weight, they are known
as the high molecular weight and low molecular weight families
because of their association with the high or low molecular weight
form of TbpB (Rokbi et al FEMS Microbiol. Lett. 100; 51, 1993). The
terms ThpA(high) and ThpA(low) are used to refer to these two forms
of ThpA, and similarly for TbpB. Immunogenic compositions of the
invention may comprise ThpA and TbpB from serogroups A, B, C, Y and
W-135 of N. meningitidis as well as iron acquisition proteins from
other bacteria including N. gonorrhoeae. Transferrin binding
proteins TbpA and TbpB have also been referred to as Tbp1 and Thp2
respectively (Cornelissen et al Infection and Immunity 65; 822,
1997).
[0071] ThpA contains several distinct regions. For example, in the
case of ThpA from N. meningitidis strain H44/76, the amino terminal
186 amino acids form an internal globular domain, 22 beta strands
span the membrane, forming a beta barrel structure. These are
linked by short intracellular loops and larger extracellular loops.
Extracellular loops 2, 3 and 5 have the highest degree of sequence
variability and loop 5 is surface exposed. Loops 5 and 4 are
involved in ligand binding.
[0072] Preferred fragments of TbpA include the extracellular loops
of ThpA. Using the sequence of ThpA from N. meningitidis strain
H44/76, these loops correspond to amino acids 200-202 for loop1,
amino acids 226-303 for loop 2, amino acids 348-395 for loop 3,
amino acids 438-471 for loop 4, amino acids 512-576 for loop 5,
amino acids 609-625 for loop 6, amino acids 661-671 for loop 7,
amino acids 707-723 for loop 8, amino acids 769-790 for loop 9,
amino acids 814-844 for loop 10 and amino acids 872-903 for loop
11. The corresponding sequences, after sequence alignment, in other
Tbp proteins would also constitute preferred fragments. Most
preferred fragments would include amino acid sequences constituting
loop 2, loop 3, loop 4 or loop 5 of Tbp.
[0073] Where the immunogenic compositions of the invention comprise
ThpA, it is preferable to include both ThpA(high) and ThpA
(low).
[0074] Although ThpA is preferably presented in an OMV vaccine, it
may also be part of a subunit vaccine. For instance, isolated iron
acquisition proteins which could be introduced into an immunogenic
composition of the invention are well known in the art
(WO00/25811). They may be expressed in a bacterial host, extracted
using detergent (for instance 2% Elugent) and purified by affinity
chromatography or using standard column chromatography techniques
well known to the art (Oakhill et al Biochem J. 2002 364;
613-6).
[0075] Where ThpA is presented in an OMV vaccine, its expression
can be upregulated by genetic techiques discussed herein, or may
preferably be upregulated by growth of the parent strain under iron
limitation conditions as described below. This process will also
result in the upregulation of variable iron-regulated proteins,
particularly FrpB which may become immunodominant and it is
therefore advantageous to downregulate the expression of (and
preferably delete the genes encoding) such proteins (particularly
FrpB) as described below, to ensure that the immunogenic
composition of the invention elicits an immune response against
antigens present in a wide range of Neisserial strains. It is
preferred to have both ThpA(high) and ThpA(low) present in the
immunogenic composition and this is preferably achieved by
combining OMVs derived from two strains, expressing the alternative
forms of ThpA.
4. Toxins
[0076] Toxins include FrpA (NMB 0585; NMB 1405), FrpA/C (see below
for definition), FrpC (NMB 1415; NMB 1405) (WO92/01460), NM-ADPRT
(NMB 1343) (13.sup.th International Pathogenic Neisseria Conference
2002 Masignani et al p135), VapD (NMB 1753), lipopolysaccharide
(LPS; also called lipooligosaccharide or LOS) immunotype L2 and LPS
immunotype L3. FrpA and FrpC contain a region which is conserved
between these two proteins and a preferred fragment of the proteins
would be a polypeptide containing this conserved fragment,
preferably comprising amino acids 227-1004 of the sequence of
FrpA/C. These antigens may be derived from Neisseria meningitidis
or Neisseria gonorrhoeae or other Neisserial strains. The invention
also includes other toxins from Neisseria.
[0077] In an alternative embodiment, toxins may include antigens
involved in the regulation of toxicity, for example OstA which
functions in the synthesis of lipopolysaccharides.
FrpA and FrpC
[0078] Neisseria meningitidis encodes two RTX proteins, referred to
as FrpA & FrpC secreted upon iron limitation (Thompson et al.,
(1993) J. Bacteriol. 175:811-818; Thompson et al., (1993) Infect.
Immun. 61:2906-2911). The RTX (Repeat ToXin) protein family have in
common a series of 9 amino acid repeat near their C-termini with
the consensus: Leu Xaa Gly Gly Xaa Gly (Asn/Asp) Asp Xaa.
(LXGGXGN/DDX). The repeats in E. coli HlyA are thought to be the
site of Ca2+ binding. As represented in FIG. 4, meningococcal FrpA
and FrpC proteins, as characterized in strain FAM20, share
extensive amino-acid similarity in their central and C-terminal
regions but very limited similarity (if any) at the N-terminus.
Moreover, the region conserved between FrpA and FrpC exhibit some
polymorphism due to repetition (13 times in FrpA and 43 times in
FrpC) of a 9 amino acid motif.
[0079] Immunogenic compositions of the invention may comprise the
full length FrpA and/or FrpC or preferably, a fragment comprising
the sequence conserved between FrpA and FrpC. The conserved
sequence is made up of repeat units of 9 amino acids. Immunogenic
compositions of the invention would preferably comprise more that
three repeats, more than 10 repeats, more than 13 repeats, more
than 20 repeats or more than 23 repeats.
[0080] Such truncates have advantageous properties over the full
length molecules and vaccines comprising such antigens form an
independent aspect of invention as sell as being incorporated in
the immunogenic compositions of the invention.
[0081] Sequences conserved between FrpA and FrpC are designated
FrpA/C and whereever FrpA or FrpC forms a constituent of
immunogenic compositions of the invention, FrpA/C could be
advantageously used. Amino acids 277-1004 of the FrpA sequence is
the preferred conserved region. The above sequence can be extended
or truncated by up to 1, 3, 5, 7, 10, 15, 20, 25, or 30 amino acids
at either or both N or C termini.
LPS
[0082] LPS (lipopolysaccharide, also known as
LOS--lipooligosaccharide) is the endotoxin on the outer membrane of
Neisseria. The polysaccharide moiety of the LPS is known to induce
bactericidal antibodies.
[0083] Heterogeneity within the oligosaccharide moiety of the LPS
generates structural and antigenic diversity among different
neisserial strains (Griffiss et al. Inf. Immun. 1987; 55:
1792-1800). This has been used to subdivide meningococcal strains
into 12 immunotypes (Scholtan et al. J Med Microbiol 1994,
41:236-243). Immunotypes L3, L7, & L9 are immunologically
identical and are structurally similar (or even the same) and have
therefore been designated L3,7,9 (or, for the purposes of this
specification, generically as "L3"). Meningococcal LPS L3,7,9 (L3),
L2 and L5 can be modified by sialylation, or by the addition of
cytidine 5'-monophosphate-N-acetylneuraminic acid. Although L2, L4
and L6 LPS are distinguishable immunologically, they are
structurally similar and where L2 is mentioned herein, either L4 or
L6 may be optionally substituted within the scope of the invention.
See M. P. Jennings et al, Microbiology 1999, 145, 3013-3021 and Mol
Microbiol 2002, 43:931-43 for further illustration of LPS structure
and heterogeneity.
[0084] Where LPS, preferably meningococcal LPS, is included in a
vaccine of the invention, preferably and advantageously either or
both of immunotypes L2 and L3 are present. LPS is preferably
presented in an outer membrane vesicle (preferably where the
vesicle is extracted with a low percentage detergent, more
preferably 0-0.5%, 0.02-0.4%, 0.04-0.3%, 0.06-0.2%, 0.08-0.15% or
0.1%, most preferably deoxycholate [DOC]) but may also be part of a
subunit vaccine. LPS may be isolated using well known precedure
including the hot water-phenol procedure (Wesphal and Jann Meth.
Carbo. Chem. 5; 83-91 1965). See also Galanos et al. 1969, Eur J
Biochem 9:245-249, and Wu et al. 1987, Anal Bio Chem 160:281-289.
LPS may be used plain or conjugated to a source of T-cell epitopes
such as tetanus toxoid, Diphtheria toxoid, CRM-197 or OMV outer
membrane proteins. Techniques for conjugating isolated LOS are also
known (see for instance EP 941738 incorporated by reference
herein).
[0085] Where LOS (in particular the LOS of the invention) is
present in a bleb formulation the LOS is preferably conjugated in
situ by methods allowing the conjugation of LOS to one or more
outer membrane proteins also present on the bleb preparation (e.g.
PorA or PorB in meningococcus).
[0086] This process can advantageously enhance the stability and/or
immunogenicity (providing T-cell help) and/or antigenicity of the
LOS antigen within the bleb formulation--thus giving T-cell help
for the T-independent oligosaccharide immunogen in its most
protective conformation--as LOS in its natural environment on the
surface of meningococcal outer membrane. In addition, conjugation
of the LOS within the bleb can result in a detoxification of the
LOS (the Lipid A portion being stably buried in the outer membrane
thus being less available to cause toxcity). Thus the
detoxification methods mentioned herein of isolating blebs from
htrB.sup.- or msbB mutants, or by adding non toxic peptide
functional equivalent of polymyxin B [a molecule with high affinity
to Lipid A] to the composition (see WO 93/14115, WO 95/03327,
Velucchi et al (1997) J Endotoxin Res 4: 1-12, and EP 976402 for
further details of non-toxic peptide functional equivalents of
polymyxin B--particularly the use of the peptide SAEP 2 (of
sequence KTKCKFLKKC where the 2 cysteines form a disulphide
bridge)) may not be required (but which may be added in combination
for additional security). Thus the inventors have found that a
composition comprising blebs wherein LOS present in the blebs has
been conjugated in an intra-bleb fashion to outer membrane proteins
also present in the bleb can form the basis of a vaccine for the
treatment or prevention of diseases caused by the organism from
which the blebs have been derived, wherein such vaccine is
substantially non-toxic and is capable of inducing a T-dependent
bactericidal response against LOS in its native environment.
[0087] This invention therefore further provides such an intra-bleb
LOS conjugated meningococcal bleb preparation.
[0088] Such bleb preparations may be isolated from the bacterial in
question (see WO 01/09350), and then subjected to known conjugation
chemistries to link groups (e.g. NH.sub.2 or COOH) on the
oligosaccharide portion of LOS to groups (e.g. NH.sub.2 or COOH) on
bleb outer membrane proteins. Cross-linking techniques using
glutaraldehyde, formaldehyde, or glutaraldehyde/formaldehyde mixes
may be used, but it is preferred that more selective chemistries
are used such as EDAC or EDAC/NHS (J. V. Staros, R. W. Wright and
D. M. Swingle. Enhancement by N-hydroxysuccinimide of water-soluble
carbodiimide-mediated coupling reactions. Analytical chemistry 156:
220-222 (1986); and Bioconjugates Techniques. Greg T. Hermanson
(1996) ppl73-176). Other conjugation chemistries or treatments
capable of creating covalent links between LOS and protein
molecules that could be used are described in EP 941738.
[0089] Preferably the bleb preparations are conjugated in the
absence of capsular polysaccharide. The blebs may be isolated from
a strain which does not produce capsular polysaccharide (naturally
or via mutation as described below), or may be purified from most
and preferably all contaminating capsular polysaccharide. In this
way, the intra-bleb LOS conjugation reaction is much more
efficient.
[0090] Preferably more than 10, 20, 30, 40, 50, 60, 70, 80, 90, or
95% of the LOS present in the blebs is cross-linked/conjugated.
[0091] Intrableb conjugation should preferably incorporate 1, 2 or
all 3 of the following process steps: conjugation pH should be
greater than pH 7.0, preferably greater than or equal to pH 7.5
(most preferably under pH 9); conditions of 1-5% preferably 2-4%
most preferably around 3% sucrose should be maintained during the
reaction; NaCl should be minimised in the conjugation reaction,
preferably under 0.1M, 0.05M, 0.01M, 0.005M, 0.001M, and most
preferably not present at all. All these process features make sure
that the blebs remain stable and in solution throughout the
conjugation process.
[0092] The EDAC/NHS conjugation process is a preferred process for
intra-bleb conjugation. EDAC/NHS is preferred to formalydehyde
which can cross-link to too high an extent thus adversely affecting
filterability. EDAC reacts with carboxylic acids (such as KDO in
LOS) to create an active-ester intermediate. In the presence of an
amine nucleophile (such as lysines in outer membrane proteins such
as PorB), an amide bond is formed with release of an isourea
by-product. However, the efficiency of an EDAC-mediated reaction
may be increased through the formation of a Sulfo-NHS ester
intermediate. The Sulfo-NHS ester survives in aqueous solution
longer than the active ester formed from the reaction of EDAC alone
with a carboxylate. Thus, higher yields of amide bond formation may
be realized using this two-stage process. EDAC/NHS conjugation is
discussed in J. V. Staros, R. W. Wright and D. M. Swingle.
Enhancement by N-hydroxysuccinimide of water-soluble
carbodiimide-mediated coupling reactions. Analytical chemistry 156:
220-222 (1986); and Bioconjugates Techniques. Greg T. Hermanson
(1996) pp 173-176. Preferably 0.01-5 mg EDAC/mg bleb is used in the
reaction, more preferably 0.05-1 mg EDAC/mg bleb. The amount of
EDAC used depends on the amont of LOS present in the sample which
in turn depends on the deoxycholate (DOC) % used to extract the
blebs. At low % DOC (e.g. 0.1%), high amounts of EDAC are used (1
mg/mg and beyond), however at higher % DOC (e.g. 0.5%), lower
amounts of EDAC are used (0.025-0.1 mg/mg) to avoid too much
inter-bleb crosslinking.
[0093] A preferred process of the invention is therefore a process
for producing intra-bleb conjugated LOS (preferably meningococcal)
comprising the steps of conjugating blebs in the presence of
EDAC/NHS at a pH between pH 7.0 and pH 9.0 (preferably around pH
7.5), in 1-5% (preferably around 3%) sucrose, and optionally in
conditions substantially devoid of NaCl (as described above), and
isolating the conjugated blebs from the reaction mix.
[0094] The reaction may be followed on Western separation gels of
the reaction mixture using anti-LOS (e.g. anti-L2 or anti-L3) mAbs
to show the increase of LOS molecular weight for a greater
proportion of the LOS in the blebs as reaction time goes on.
[0095] Yields of 99% blebs can be recovered using such
techniques.
[0096] EDAC was found to be an excellent intra-bleb cross-linking
agent in that it cross-linked LOS to OMP sufficiently for improved
LOS T-dependent immunogenicity, but did not cross link it to such a
high degree that problems such as poor filterability, aggregation
and inter-bleb cross-linking occurred. The morphology of the blebs
generated is similar to that of unconjugated blebs (by electron
microscope). In addition, the above protocol avoided an overly high
cross-linking to take place (which can decrease the immunogenicity
of protective OMPs naturally present on the surface of the bleb
e.g. TbpA or Hsf).
[0097] It is preferred that the meningococcal strain from which the
blebs are derived is a mutant strain that cannot produce capsular
polysaccharide (e.g. one of the mutant strains described below, in
particular siad). It is also preferred that immunogenic
compositions effective against meningococcal disease comprise both
an L2 and and L3 bleb, wherein the L2 and L3 LOS are both
conjugated to bleb outer membrane proteins. Furthermore, it is
preferred that the LOS structure within the intra-bleb conjugated
bleb is consistent with it having been derived from an lgtB.sup.-
meningococcal strain (as described below). Most preferably
immunogenic compositions comprise intrableb-conjugated blebs:
derived from a mutant meningococcal strain that cannot produce
capsular polysaccharide and is lgtB.sup.-; comprising L2 and L3
blebs derived from mutant meningococcal strains that cannot produce
capsular polysaccharide; comprising L2 and L3 blebs derived from
mutant meningococcal strains that are lgtB.sup.-, or most
preferably comprising L2 and L3 blebs derived from mutant
meningococcal strains that cannot produce capsular polysaccharide
and are lgtB.sup.-.
[0098] Typical L3 meningococcal strain that can be used for the
present invention is H44/76 menB strain. A typical L2 strain is the
B16B6 menB strain or the 39E meningococcus type C strain.
[0099] As stated above, the blebs of the invention have been
detoxified to a degree by the act of conjugation, and need not be
detoxified any further, however further detoxification methods may
be used for additional security, for instance using blebs derived
from a meningococcal strain that is htrB.sup.- or msbB.sup.- or
adding a non-toxic peptide functional equivalent of polymyxin B [a
molecule with high affinity to Lipid A] (preferably SEAP 2) to the
bleb composition (as described above).
[0100] In the above way meningococcal blebs and immunogenic
compositions comprising blebs are provided which have as an
important antigen LOS which is substantially non-toxic, devoid of
autoimmunity problems, has a T-dependent character, is present in
its natural environment, and is capable of inducing a bactericidal
antibody response against more than 90% of meningococcal strains
(in the case of L2+L3 compositions).
[0101] Preferably intrableb LOS conjugation should incorporate 1, 2
or all 3 of the following process steps: conjugation pH should be
greater than pH 7.0, preferably greater than or equal to pH 7.5
(most preferably under pH 9); conditions of 1-5% preferably 2-4%
most preferably around 3% sucrose should be maintained during the
reaction; NaCl should be minimised in the conjugation reaction,
preferably under 0.1M, 0.05M, 0.001M, 0.005M, 0.001M, and most
preferably not present at all. All these process features make sure
that the blebs remain stable and in solution throughout the
conjugation process.
[0102] Although LOS can be conjugated within blebs to outer
membrane proteins by various techniques and chemistries, the
EDAC/NHS conjugation process is a preferred process for intra-bleb
conjugation. EDAC/NHS is preferred to formalydehyde which can
cross-link to too high an extent thus adversely affecting
filterability. EDAC reacts with carboxylic acids to create an
active-ester intermediate. In the presence of an amine nucleophile,
an amide bond is formed with release of an isourea by-product.
However, the efficiency of an EDAC-mediated reaction may be
increased through the formation of a Sulfo-NHS ester intermediate.
The Sulfo-NHS ester survives in aqueous solution longer than the
active ester formed from the reaction of EDAC alone with a
carboxylate. Thus, higher yields of amide bond formation may be
realized using this two-stage process. EDAC/NHS conjugation is
discussed in J. V. Staros, R. W. Wright and D. M. Swingle.
Enhancement by N-hydroxysuccinimide of water-soluble
carbodiimide-mediated coupling reactions. Analytical chemistry 156:
220-222 (1986); and Bioconjugates Techniques. Greg T. Hermanson
(1996) pp 173-176.
[0103] A preferred process of the invention is therefore a process
for producing intra-bleb conjugated LOS (preferably meningococcal)
comprising the steps of conjugating blebs in the presence of
EDAC/NHS at a pH between pH 7.0 and pH 9.0 (preferably around pH
7.5), in 1-5% (preferably around 3%) sucrose, and optionally in
conditions substantially devoid of NaCl (as described above), and
isolating the conjugated blebs from the reaction mix.
[0104] The reaction may be followed on separation gels of the
reaction mixture using anti-LOS (e.g. anti-L2 or anti-L3) mAbs to
show the increase of LOS molecular weight for a greater proportion
of the LOS in the blebs as reaction time goes on.
[0105] Yields of 99% blebs can be recovered using such techniques.
EDAC was found to be an excellent intra-bleb cross-linking agent in
that it cross-linked LOS to OMP sufficiently for improved LOS
T-dependent immunogenicity, but did not cross link it to such a
high degree that problems such as poor filterability and inter-bleb
cross-linking occurred. A too high cross-linking should also
avoided to avoid any decrease in immunogenicity of protective OMPs
naturally present on the surface of the bleb e.g. TbpA.
[0106] 5. Integral Outer Membrane Proteins
[0107] Other categories of Neisserial proteins may also be
candidates for inclusion in the Neisserial vaccines of the
invention and may be able to combine with other antigens in a
surprisingly effective manner. Membrane associated proteins,
particularly integral membrane proteins and most advantageously
outer membrane proteins, especially integral outer membrane
proteins may be used in the compositions of the present invention.
An example of such a protein is PldA also known as Omp1A (NMB 0464)
(WO00/15801) which is a Neisserial phospholipase outer membrane
protein. Further examples are TspA (NMB 0341) (Infect. Immun. 1999,
67; 3533-3541) and TspB (T-cell stimulating protein) (WO 00/03003;
NMB 1548, NMB 1628 or NMB 1747). Further examples include PilQ (NMB
1812) (WO99/61620), OMP85--also known as D15--(NMB 0182)
(WO00/23593), NspA (U52066) (WO96/29412), FhaC (NMB 0496 or NMB
1780), PorB (NMB 2039) (Mol. Biol. Evol. 12; 363-370, 1995), HpuB
(NC.sub.--003116.1), TdfH (NMB 1497) (Microbiology 2001, 147;
1277-1290), OstA (NMB 0280), MltA also known as GNA33 and Lipo30
(NMB0033), HtrA (NMB 0532; WO 99/55872), HimD (NMB 1302), HisD (NMB
1581), GNA 1870 (NMB 1870), HlpA(NMB 1946), NMB 1124, NMB 1162, NMB
1220, NMB 1313, NMB 1953, HtrA, TbpA (NMB 0461) (WO92/03467) (see
also above under iron acquisition proteins) and LbpA (NMB
1541).
OMP85
[0108] Immunogenic compositions of the invention may comprise the
full length OMP85, preferably as part of an OMV preparation.
Fragments of OMP85 may also be used in immunogenic compositions of
the invention, in particularly, the surface exposed domain of OMP85
made up of amino acid residues 1-475 or 50-475 is preferably
incorporated into a subunit component of the immunogenic
compositions of the invention. The above sequence for the surface
exposed domain of OMP85 can be extended or truncated by up to 1, 3,
5, 7, 10, 15, 20, 25, or 30 amino acids at either or both N or C
termini. It is preferred that the signal sequence is omitted from
the OMP85 fragment.
OstA
[0109] OstA functions in the synthesis of lipopolysaccharides and
may be considered to be a regulator of toxicity. OstA may
alternatively be included in the toxin category where the toxin
category is broadened to contain regulators of toxicity as well as
toxins.
Immunogenic Compositions
[0110] An immunogenic composition is a composition comprising at
least one antigen which is capable of generating an immune response
when administered to a host. Preferably, such immunogenic
preparations are capable of generating a protective immune response
against Neisserial, preferably Neisseria meningitidis or Neisseria
gonorrhoeae infection.
[0111] The invention relates to immunogenic compositions comprising
at least two antigens, which preferably elicit one or more of a
synergistic bactericidal, protective, or adhesion blocking
response.
[0112] SBA Bactericidal Assays of the Invention
[0113] Such a synergistic response may be characterised by the SBA
elicited by the combination of antigens being at least 50%, two
times, three times, preferably four times, five times, six times,
seven times, eight times, nine times and most preferably ten times
higher than the SBA elicited by each antigen separately. Preferably
SBA is measured against a homologous strain from which the antigens
are derived and preferably also against a panel of heterologous
strains. (See below for a representative panel for instance BZ10
(B:2b:P1.2) belonging to the A-4 cluster; B16B6 (B:2a:P1.2)
belonging to the ET-37 complex; and H44/76 (B:15:P1.7,16)). SBA is
the most commonly agreed immunological marker to estimate the
efficacy of a meningococcal vaccine (Perkins et al. J Infect Dis.
1998, 177:683-691). Satisfactory SBA can be acertained by any known
method. SBA can be carried out using sera obtained from animal
models (see examples 17-20), or from human subjects.
[0114] A preferred method of conducting SBA with human sera is the
following. A blood sample is taken prior to the first vaccination,
two months after the second vaccination and one month after the
third vaccination (three vaccinations in one year being a typical
human primary vaccination schedule administered at, for instance,
0, 2 and 4 months, or 0, 1 and 6 months). Such human primary
vaccination schedules can be carried out on infants under 1 year
old (for instance at the same time as Hib vaccinations are carried
out) or 24 year olds or adolescents may also be vaccinated to test
SBA with such a primary vaccination schedule. A further blood
sample may be taken 6 to 12 months after primary vaccination and
one month after a booster dose, if applicable.
[0115] SBA will be satisfactory for an antigen or bleb preparation
with homologous bactericidal activity if one month after the third
vaccine dose (of the primary vaccination schedule) (in 2-4 year
olds or adolescents, but preferably in infants in the first year of
life) the percentage of subjects with a four-fold increase in terms
of SBA (antibody dilution) titre (compared with pre-vaccination
titre) against the strain of meningococcus from which the antigens
of the invention were derived is greater than 30%, preferably
greater than 40%, more preferably greater than 50%, and most
preferably greater than 60% of the subjects.
[0116] Of course an antigen or bleb preparation with heterologous
bactericidal activity can also constitute bleb preparation with
homologous bactericidal activity if it can also elicit satisfactory
SBA against the meningococcal strain from which it is derived.
[0117] SBA will be satisfactory for an antigen or bleb preparation
with heterologous bactericidal activity if one month after the
third vaccine dose (of the primary vaccination schedule) (in 2-4
year olds or adolescents, but preferably in infants in the first
year of life) the percentage of subjects with a four-fold increase
in terms of SBA (antibody dilution) titre (compared with
pre-vaccination titre) against three heterologous strains of
meningococcus is greater than 20%, preferably greater than 30%,
more preferably greater than 35%, and most preferably greater than
40% of the subjects. Such a test is a good indication of whether
the antigen or bleb preparation with heterologous bactericidal
activity can induce cross-bactericidal antibodies against various
meningococcal strains. The three heterologous strains should
preferably have different electrophoretic type (ET)-complex or
multilocus sequence typing (MLST) pattern (see Maiden et al. PNAS
USA 1998, 95:3140-5) to each other and preferably to the strain
from which the antigen or bleb preparation with heterologous
bactericidal activity is made or derived. A skilled person will
readily be able to determine three strains with different
ET-complex which reflect the genetic diversity observed amongst
meningococci, particularly amongst meningococcus type B strains
that are recognised as being the cause of significant disease
burden and/or that represent recognised MenB hyper-virulent
lineages (see Maiden et al. supra). For instance three strains that
could be used are the following: BZ10 (B:2b:P1.2) belonging to the
A-4 cluster; B16B6 (B:2a:P1.2) belonging to the ET-37 complex; and
H44/76 (B:15:P1.7,16) belonging to the ET-5 complex, or any other
strains belonging to the same ET/Cluster. Such strains may be used
for testing an antigen or bleb preparation with heterologous
bactericidal activity made or derived from, for instance,
meningococcal strain CU385 (B:4:P1.15) which belongs to the ET-5
complex. Another sample strain that could be used is from the
Lineage 3 epidemic clone (e.g. NZ124 [B:4:P1.7,4]). Another ET-37
strain is NGP165 (B:2a:P1.2).
[0118] Processes for measuring SBA activity are known in the art.
For instance a method that might be used is described in WO
99/09176 in Example 10C. In general terms, a culture of the strain
to be tested is grown (preferably in conditions of iron
depletion--by addition of an iron chelator such as EDDA to the
growth medium) in the log phase of growth. This can be suspended in
a medium with BSA (such as Hanks medium with 0.3% BSA) in order to
obtain a working cell suspension adjusted to approximately 20000
CFU/ml. A series of reaction mixes can be made mixing a series of
two-fold dilutions of sera to be tested (preferably
heat-inactivated at 56.degree. C. for 30 min) [for example in a 50
.mu.l/well volume] and the 20000 CFU/ml meningococcal strain
suspension to be tested [for example in a 25 .mu.l/well volume].
The reaction vials should be incubated (e.g. 37.degree. C. for 15
minutes) and shaken (e.g. at 210 rpm). The final reaction mixture
[for example in a 100 .mu.l volume] additionally contains a
complement source [such as 25% final volume of pretested baby
rabbit serum], and is incubated as above [e.g. 37.degree. C. for 60
min]. A sterile polystyrene U-bottom 96-well microtiter plate can
be used for this assay. A aliquot [e.g. 10 .mu.l] can be taken from
each well using a multichannel pipette, and dropped onto
Mueller-Hinton agar plates (preferably containing 1% Isovitalex and
1% heat-inactivated Horse Serum) and incubated (for example for 18
hours at 37.degree. C. in 5% CO.sub.2). Preferably, individual
colonies can be counted up to 80 CFU per aliquot. The following
three test samples can be used as controls:
buffer+bacteria+complement; buffer+bacteria+inactivated complement;
serum+bacteria+inactivated complement. SBA titers can be
straightforwardly calculated using a program which processes the
data to give a measurement of the dilution which corresponds to 50%
of cell killing by a regression calculation.
Animal Protection Assays
[0119] Alternatively, the synergistic response may be characterised
by the efficacy of the combination of antigens in an animal
protection assay. For instance, the assays described in example 12
or 13 may be used. Preferably the number of animals protected by
the combination of antigens is significantly improved compared with
using the antigens by themselves, particularly at suboptimal doses
of antigen.
[0120] A successful vaccine for the prevention of infection by N.
gono may require more than one of the following elements:
generation of serum and/or mucosal antibodies to facilitate
complement mediated killing of the gonococcus, and/or to enhance
phagocytosis and microbial killing by leukocytes such as
polymorphonuclear leukocytes, and/or to prevent attachment of the
gonococci to the host tissues; induction of a cell mediated immune
response may also participate to protection.
[0121] The improvement of efficacy of a bleb gono vaccine
preparation of the invention can be evaluated by analyzing the
induced immune response for serum and/or mucosal antibodies that
have antiadherence, and/or opsonizing properties, and/or
bactericidal activity, as described by others (McChesney D et al,
Infect. Immun. 36: 1006, 1982; Boslego J et al: Efficacy trial of a
purified gonococcl pilus vaccine, in Program and Abstracts of the
24th Interscience Conference on Antimicrobial Agents and
Chemotherapy, Washington, American Society for Microbiology, 1984;
Siegel M et al, J. Infect. Dis 145: 300, 1982; de la Pas,
Microbiology, 141 (Pt4): 913-20, 1995).
[0122] A mouse model of genital infection by N. gono has recently
been described (Plante M, J. Infect. Dis., 182: 848-55, 2000). The
improvement of efficiency of a bleb gono vaccine of the invention
could also be evaluated by its ability to prevent or to reduce
colonization by N. gono in this mouse model of infection.
Adhesion Blocking Assay
[0123] Alternatively, the synergisic response may be characterised
by the efficacy of the combination of anigens in an adhesion
blocking assay. For instance, the assay described in example 11 may
be used. Preferably the extent of blocking induced by antisera
raised against the combination of antigens is significantly
improved compared with using antisera raised against the antigens
by themselves, particularly at suboptimal doses of antibody.
Subunit Compositions
[0124] The immunogenic composition of the invention may be a
subunit composition. Subunit compositions are compositions in which
the components have been isolated and purified to at least 50%,
preferably at least 60%, 70%, 80%, 90% pure before mixing the
components to form the antigenic composition.
[0125] The immunogenic subunit composition of the invention
preferably comprises at least 2 antigens selected from the
following list: FhaB, PilC, Hsf, Hap, NadA, OMP85, IgA protease,
AspA, passenger domain of AspA, passenger domain of Hsf, passenger
domain of Hap, FrpA, FrpC, ThpA, TbpB, LbpA, LbpB, HpuA, HpuB,
TspA, TspB, PldA, PilQ, FhaC, NspA, and either or both of LPS
immunotype L2 and LPS immunotype L3.
[0126] Subunit compositions may be aqueous solutions of water
soluble proteins. They may comprise detergent, preferably
non-ionic, zwitterionic or ionic detergent in order to solubilise
hydrophobic portions of the antigens. They may comprise lipids so
that liposome structures could be formed, allowing presentation of
antigens with a structure that spans a lipid membrane.
Outer Membrane Vesicle Preparations
[0127] N. meningitidis serogroup B (menB) excretes outer membrane
blebs in sufficient quantities to allow their manufacture on an
industrial scale. An outer membrane vesicles may also be prepared
via the process of detergent extraction of the bacterial cells (see
for example EP 11243).
[0128] The immunogenic composition of the invention may also
comprise an outer membrane vesicle preparation having at least two
antigens which have been upregulated, either recombinantly or by
other means including growth under iron-depleted conditions.
Examples of antigens which would be upregulated in such a outer
membrane vesicle preparation include; NspA, Hsf, Hap, OMP85, ThpA
(high), ThpA (low), LbpA, TbpB, LbpB, PilQ, AspA, TdfH, PorB, HpuB,
P2086, NM-ADPRT, MafA, MafB and PldA. Such preparations would
optionally also comprise either or both of LPS immunotype L2 and
LPS immunotype L3.
[0129] The manufacture of bleb preparations from Neisserial strains
may be achieved by any of the methods well known to a skilled
person. Preferably the methods disclosed in EP 301992, U.S. Pat.
No. 5,597,572, EP 11243 or U.S. Pat. No. 4,271,147, Frederikson et
al. (NIPH Annals [1991], 14:67-80), Zollinger et al. (J. Clin.
Invest. [1979], 63:836-848), Saunders et al. (Infect. Immun.
[1999], 67:113-119), Drabick et al. (Vaccine [2000], 18:160-172) or
WO 01/09350 (Example 8) are used. In general, OMVs are extracted
with a detergent, preferably deoxycholate, and nucleic acids are
optionally removed enzymatically. Purification is achieved by
ultracentrifugation optionally followed by size exclusion
chromatography. If 2 or more different blebs of the invention are
included, they may be combined in a single container to form a
multivalent preparation of the invention (although a preparation is
also considered multivalent if the different blebs of the invention
are separate compositions in separate containers which are
administered at the same time [the same visit to a practitioner] to
a host). OMV preparations are usually sterilised by filtration
through a 0.2 .mu.m filter, and are preferably stored in a sucrose
solution (e.g. 3%) which is known to stabilise the bleb
preparations.
[0130] Upregulation of proteins within outer membrane vesicle
preparations may be achieved by insertion of an extra copy of a
gene into the Neisserial strain from which the OMV preparation is
derived. Alternatively, the promoter of a gene can be exchanged for
a stronger promoter in the Neisserial strain from which the OMV
preparation is derived. Such techniques are described in
WO01/09350. Upregulation of a protein will lead to a higher level
of protein being present in OMV compared to the level of protein
present in OMV derived from unmodified N. meningitidis (for
instance strain H44/76). Preferably the level will be 1.5, 2, 3, 4,
5, 7, 10 or 20 times higher.
[0131] Where LPS is intended to be an additional antigen in the
OMV, a protocol using a low concentration of extracting detergent
(for example deoxycholate or DOC) may preferably be used in the OMV
preparation method so as to preserve high levels of bound LPS
whilst removing particularly toxic, poorly bound LPS. The
concentration of DOC used is preferably 0-0.5% DOC, 0.02-0.4% DOC,
0.04-0.3% DOC more preferably 0.06%-0.2% DOC or 0.08-0.15% DOC most
preferably around or exactly 0.1% DOC.
[0132] "Stronger promoter sequence" refers to a regulatory control
element that increases transcription for a gene encoding antigen of
interest.
[0133] "Upregulating expression" refers to any means to enhance the
expression of an antigen of interest, relative to that of the
non-modified (i.e., naturally occurring) bleb. It is understood
that the amount of `upregulation` will vary depending on the
particular antigen of interest but will not exceed an amount that
will disrupt the membrane integrity of the bleb. Upregulation of an
antigen refers to expression that is at least 10% higher than that
of the non-modified bleb. Preferably it is at least 50% higher.
More preferably it is at least 100% (2 fold) higher. Most
preferably it is 3, 4, 5, 7, 10, 20 fold higher. Alternatively or
additionally, upregulating expression may refer to rendering
expression non-conditional on metabolic or nutritional changes,
particularly in the case of ThpA, TbpB, LbpA and LbpB. Preferably
the level of expression is assessed when blebs have been derived
from bacteria grown in iron limited conditions (for instance in the
presence of an iron chelator).
[0134] Again for the purpose of clarity, the terms `engineering a
bacterial strain to produce less of said antigen` or down
regulation refers to any means to reduce the expression of an
antigen (or the expression of a functional gene product) of
interest, relative to that of the non-modified (i.e., naturally
occurring bleb), preferably by deletion, such that expression is at
least 10% lower than that of the non-modified bleb. Preferably it
is at least 50% lower and most preferably completely absent. If the
down regulated protein is an enzyme or a functional protein, the
downregulation may be achieved by introducing one or more mutations
resulting in a 10%, 20%, 50%, 80% or preferably a 100% reduction in
enzymatic or functional activity.
[0135] The engineering steps required to modulate the expression of
Neisserial proteins can be carried out in a variety of ways known
to the skilled person. For instance, sequences (e.g. promoters or
open reading frames) can be inserted, and promoters/genes can be
disrupted by the technique of transposon insertion. For instance,
for upregulating a gene's expression, a strong promoter could be
inserted via a transposon up to 2 kb upstream of the gene's
initiation codon (more preferably 200-600 bp upstream, most
preferably approximately 400 bp upstream). Point mutation or
deletion may also be used (particularly for down-regulating
expression of a gene).
[0136] Such methods, however, may be quite unstable or uncertain,
and therefore it is preferred that the engineering step is
performed via a homologous recombination event. Preferably, the
event takes place between a sequence (a recombinogenic region) of
at least 30 nucleotides on the bacterial chromosome, and a sequence
(a second recombinogenic region) of at least 30 nucleotides on a
vector transformed within the strain. Preferably the regions are
40-1000 nucleotides, more preferably 100-800 nucleotides, most
preferably 500 nucleotides). These recombinogenic regions should be
sufficiently similar that they are capable of hybridising to one
another under highly stringent conditions.
[0137] Methods used to carry out the genetic modification events
herein described (such as the upregulation or downregulation of
genes by recombination events and the introduction of further gene
sequences into a Neisserial genome) are described in WO01/09350.
Typical strong promoters that may be integrated in Neisseria are
porA, porB, lgtF, Opa, p110, lst, and hpuAB. PorA and PorB are
preferred as constitutive, strong promoters. It has been
established that the PorB promoter activity is contained in a
fragment corresponding to nucleotides -1 to -250 upstream of the
initation codon of porB.
Upregulation of Expression of Antigens by Growth in Iron Limitation
Media
[0138] The upregulation of some antigens in an outer membrane
vesicle preparation of the invention is preferably achieved by
isolating outer membrane vesicles from a parental strain of
Neisseria grown under iron limitation conditions. A low
concentration of iron in the medium will result in increased
expression of proteins involved in iron acquisition including ThpA,
TbpB, LbpA, LbpB, HpuA, HpuB and P2086. The expression of these
proteins is thereby upregulated without the need for recombinantly
modifying the gene involved, for instance by inserting a stronger
promoter or inserting an additional copy of the gene. The invention
would also encompass upregulation of iron acquisition proteins by
growth in iron limitation medium where the gene has also been
recombinantly modified.
[0139] Iron limitation is achieved by the addition of an iron
chelator to the culture medium. Suitable iron chelators include
2,2-Dipyridil, EDDHA (ethylenediamine-di(o-hydroxyphenylacetic
acid) and Desferal (deferoxamine mesylate, Sigma). Desferal is the
preferred iron chelator and is added to the culture medium at a
concentration of between 10 and 100 .mu.M, preferably 25-75 .mu.M,
more preferably 50-70 .mu.M, most preferably at 60 .mu.M. The iron
content of medium comes primarily from the yeast extract and soy
peptone constituents and the amount present may vary between
batches. Therefore different concentrations of Desferal may be
optimal to achieve upregulation of iron acquisition proteins in
different batches of medium. The skilled artisan should easily be
able to determine the optimal concentration. In basic terms, enough
iron chelator should be added to the medium to upregulate the
expression of the desired iron-regulated protein, but not so much
so as to adversely affect the growth of the bacteria.
[0140] Preferably, upregulation of iron acquisition proteins by
growth under iron limited conditions is combined with recombinant
upregulation of other antigens so that the outer membrane vesicle
of the invention is achieved.
Down Regulation/Removal of Variable and Non-Protective
Immunodominant Antigens
[0141] Many surface antigens are variable among bacterial strains
and as a consequence are protective only against a limited set of
closely related strains. An aspect of this invention covers outer
membrane vesicles of the invention in which the expression of other
proteins is reduced, or, preferably, gene(s) encoding variable
surface protein(s) are deleted. Such deletion results in a
bacterial strain producing blebs which, when administered in a
vaccine, have a stronger potential for cross-reactivity against
various strains due to a higher influence exerted by conserved
proteins (retained on the outer membranes) on the vaccinee's immune
system. Examples of such variable antigens in Neisseria that may be
downregulated in the bleb immunogenic compositions of the invention
include PorA, PorB, Opa.
[0142] Other types of gene that could be down-regulated or switched
off are genes which, in vivo, can easily be switched on (expressed)
or off by the bacterium. As outer membrane proteins encoded by such
genes are not always present on the bacteria, the presence of such
proteins in the bleb preparations can also be detrimental to the
effectiveness of the vaccine for the reasons stated above. A
preferred example to down-regulate or delete is Neisseria Opc
protein. Anti-Opc immunity induced by an Opc containing bleb
vaccine would only have limited protective capacity as the
infecting organism could easily become Opc.sup.-.
[0143] For example, these variable or non-protective genes may be
down-regulated in expression, or terminally switched off. This has
the advantage of concentrating the immune system on better antigens
that are present in low amounts on the outer surface of blebs. By
down-regulation it is also meant that surface exposed, variable
immunodominant loops of the above outer membrane proteins may be
altered or deleted in order to make the resulting outer membrane
protein less immunodominant.
[0144] Methods for downregulation of expression are disclosed in
WO01/09350. Preferred combinations of proteins to be downregulated
in the bleb immunogenic compositions of the invention include PorA
and OpA; PorA and OpC; OpA and OpC; PorA and OpA and OpC.
[0145] Four different Opa genes are known to exist in the
meningococcal genome (Aho et al. 1991 Mol. Microbiol. 5:1429-37),
therefore where Opa is said to be downregulated in expression it is
meant that preferably 1, 2, 3 or (preferably) all 4 genes present
in meningococcus are so downregulated. Such downregulation may be
performed genetically as described in WO 01/09350 or by seeking
readily-found, natural, stable meningococcal strains that have no
or low expression from the Opa loci. Such strains can be found
using the technique described in Poolman et al (1985 J. Med. Micro.
19:203-209) where cells that are Opa have a different phenotype to
cells expressing Opa which can be seen looking at the appearance of
the cells on plates or under a microscope. Once found, the strain
can be shown to be stably Opa by performing a Western blot on cell
contents after a fermentation run to establish the lack of Opa.
[0146] Where upregulation of some antigens in the outer membrane
vesicle is achieved by growth under iron limitation conditions, the
variable protein FrpB (Microbiology 142; 3269-3274, (1996); J.
Bacteriol. 181; 2895-2901 (1999)) will also be upregulated. The
inventors have found that it is advantageous to down-regulate
expression of FrpB under these circumstances by downregulating
expression of the entire protein as described in WO01/09350 or by
deleting variable region(s) of FrpB. This will ensure that the
immune response elicited by the immunogenic composition is directed
towards antigens that are present in a wide range of strains. Down
regulation of FrpB is preferably combined with down regulation of
PorA and OpA; PorA and OpC; OpA and OpC; PorA and OpA and OpC in
the bleb immunogenic compositions of the invention.
[0147] In an alternative embodiment of the invention, FrpB is
downregulated in outer membrane vesicles which have been prepared
from Neisseria strains not grown under iron limitation
conditions.
Detoxification of LPS
[0148] The blebs in the immunogenic compositions of the invention
may be detoxified via methods for detoxification of LPS which are
disclosed in WO01/09350. In particular methods for detoxification
of LPS of the invention involve the downregulation/deletion of htrB
and/or msbB enzymes which are disclosed in WO01/09350. The msbB and
htrB genes of Neisseria are also called lpxL1 and lpxL2,
respectively (WO 00/26384) and deletion mutations of these genes
are characterised pnenoltypically by the msbB-mutant LOS losing one
secondary acyl chain), and the htrB-mutatn LOS losing both
secondary acyl chains. WO93/14155 and WO 95/03327 describe nontoxix
peptide functional equivalents of polymycin B that may be used in
compositions of the invention.
[0149] Such methods are preferably combined with methods of bleb
extraction involving low levels of DOC, preferably 0-0.3% DOC, more
preferably 0.05%-0.2% DOC, most preferably around or exactly 0.1%
DOC.
[0150] Further methods of LPS detoxification include adding to the
bleb preparations a non-toxic peptide functional equivalent of
polymyxin B (preferably SAEP 2) as described above.
Cross-Reactive Polysaccharides
[0151] The isolation of bacterial outer-membrane blebs from
encapsulated Gram-negative bacteria often results in the
co-purification of capsular polysaccharide. In some cases, this
"contaminant" material may prove useful since polysaccharide may
enhance the immune response conferred by other bleb components. In
other cases however, the presence of contaminating polysaccharide
material in bacterial bleb preparations may prove detrimental to
the use of the blebs in a vaccine. For instance, it has been shown
at least in the case of N. meningitidis that the serogroup B
capsular polysaccharide does not confer protective immunity and is
susceptible to induce an adverse auto-immune response in humans.
Consequently, outer membrane vesicles of the invention may be
isolated from a bacterial strain for bleb production, which has
been engineered such that it is free of capsular polysaccharide.
The blebs will then be suitable for use in humans. A particularly
preferred example of such a bleb preparation is one from N.
meningitidis serogroup B devoid of capsular polysaccharide.
[0152] This may be achieved by using modified bleb production
strains in which the genes necessary for capsular biosynthesis
and/or export have been impaired. Inactivation of the gene coding
for capsular polysaccharide biosynthesis or export can be achieved
by mutating (point mutation, deletion or insertion) either the
control region, the coding region or both (preferably using the
homologous recombination techniques described above), or by any
other way of decreasing the enzymatic function of such genes.
Moreover, inactivation of capsular biosynthesis genes may also be
achieved by antisense over-expression or transposon mutagenesis. A
preferred method is the deletion of some or all of the Neisseria
meningitidis cps genes required for polysaccharide biosynthesis and
export. For this purpose, the replacement plasmid pMF121 (described
in Frosh et al. 1990, Mol. Microbiol. 4:1215-1218) can be used to
deliver a mutation deleting the cpsCAD (+galE) gene cluster.
[0153] The safety of antibodies raised to L3 or L2 LPS has been
questioned, due to the presence of a structure similar to the
lacto-N-neotetraose oligosaccharide group
(Gal.beta.1-4GlcNAc.beta.1-3Gal.beta.1-4Glc.beta.1-) present in
human glycosphingolipids. Even if a large number of people has been
safely vaccinated with deoxycholate extracted vesicle vaccines
containing residual amount of L3 LPS (G. Bjune et al, Lancet
(1991), 338, 1093-1096; GVG. Sierra et al, NIPH ann (1991), 14,
195-210), the deletion of the terminal part of the LOS saccharidic
is advantageous in preventing any cross-reaction with structures
present at the surface of human tissues. In a preferred embodiment,
inactivation of the lgtB gene results in an intermediate LPS
structure in which the terminal galactose residue and the sialic
acid are absent (the mutation leaves a
4GlcNAc.beta.1-3Gal.beta.1-4Glc.beta.1-structure in L2 and L3 LOS).
Such intermediates could be obtained in an L3 and an L2 LPS strain.
An alternative and less preferred (short) version of the LPS can be
obtained by turning off the lgtE gene. A further alternative and
less preferred version of the LPS can be obtained by turning off
the lgtA gene. If such an lgtA.sup.- mutation is selected it is
preferred to also turn off lgtC expression to prevent the
non-immunogenic L1 immunotype being formed.
[0154] LgtB.sup.- mutants are most preferred as the inventors have
found that this is the optimal truncation for resolving the safety
issue whilst still retaining an LPS protective oligosaccharide
epitope that can still induce a bactericidal antibody response.
[0155] Therefore, immunogenic compositions of the invention further
comprising L2 or L3 preparations (whether purified or in an
isolated bleb) or meningococcal bleb preparations in general are
advantageously derived from a Neisserial strain (preferably
meningococcal) that has been genetic engineered to permanently
downregulate the expression of functional gene product from the
lgtB, lgtA or lgtE gene, preferably by switching the gene off, most
preferably by deleting all or part of the promoter and/or
open-reading frame of the gene.
[0156] Where the above immunogenic compositions of the invention
are derived from a meningococcus B strain, it is further preferred
that the capsular polysaccharide (which also contains human-like
saccharide structures) is also removed. Although many genes could
be switched off to achieve this, the inventors have advantageously
shown that it is preferred that the bleb production strain has been
genetically engineered to permanently downregulate the expression
of functional gene product from the siaD gene (i.e. downregulating
.alpha.-2-8 polysialyltransferase activity), preferably by
switching the gene off, most preferably by deleting all or part of
the promoter and/or open-reading frame of the gene. Such an
inactivation is described in WO 01/09350. The siaD (also known as
synD) mutation is the most advantageous of many mutations that can
result in removing the human-similar epitope from the capsular
polysaccharide, because it one of the only mutations that has no
effect on the biosynthesis of the protective epitopes of LOS, thus
being advantageous in a process which aims at ultimately using LOS
as a protective antigen, and has a minimal effect on the growth of
the bacterium. A preferred aspect of the invention is therefore a
bleb immunogenic preparation as described above which is derived
from an lgtE.sup.- siaD.sup.-, an lgtA.sup.- siaD.sup.- or,
preferably, an lgtB.sup.- siaD.sup.- meningococcus B mutant strain.
The strain itself is a further aspect of the invention.
[0157] Although siaD.sup.- mutation is preferable for the above
reasons, other mutations which switch off meningococcus B capsular
polysaccharide synthesis may be used. Thus bleb production strain
can be genetically engineered to permanently downregulate the
expression of functional gene product from one or more of the
following genes: ctrA, ctrB, ctrC, ctrD, synA (equivalent to synX
and siaA), synB (equivalent to siaB) or synC (equivalent to siaC)
genes, preferably by switching the gene off, most preferably by
deleting all or part of the promoter and/or open-reading frame of
the gene. The lgtE.sup.- mutation may be combined with one or more
of these mutations. Preferably the lgtB.sup.- mutation is combined
with one or more of these mutations. A further aspect of the
invention is therefore a bleb immunogenic preparation as described
above which is derived from such a combined mutant strain of
meningococcus B. The strain itself is a further aspect of the
invention.
[0158] A Neisserial locus containing various lgt genes, including
lgtB and lgtE, and its sequence is known in the art (see M. P.
Jennings et al, Microbiology 1999, 145, 3013-3021 and references
cited therein, and J. Exp. Med. 180:2181-2190 [1994]).
[0159] Where full-length (non-truncated) LOS is to be used in the
final product, it is desirable for LOS not to be sialyated (as such
LOS generates an immune response against the most dangerous,
invasive meningococcal B strains which are also unsialylated). In
such case using a capsule negative strain which has a deleted synA
(equivalent to synX and siaA), synB (equivalent to siaB) or synC
(equivalent to siaC) gene is advantageous, as such a mutation also
renders menB LOS incapable of being sialylated.
[0160] In bleb preparations, particularly in preparations extracted
with low DOC concentrations LPS may be used as an antigen in the
immunogenic composition of the invention. It is however
advantageous to downregulate/delete/inactivate enzymatic function
of either the lgtE, lgtA particularly in combination with lgtC),
or, preferably, lgtB genes/gene products in order to remove human
like lacto-N-neotetraose structures. The Neisserial locus (and
sequence thereof) comprising the lgt genes for the biosynthesis of
LPS oligosaccharide structure is known in the art (Jennings et al
Microbiology 1999 145; 3013-3021 and references cited therein, and
J. Exp. Med. 180:2181-2190 [1994]). Downregulation/deletion of lgtB
(or functional gene product) is preferred since it leaves the LPS
protective epitope intact.
[0161] In N. meningitidis serogroup B bleb preparations of the
invention, the downregulation/deletion of both siaD and lgtB is
preferred, (although a combination of lgtB.sup.- with any of
ctrA.sup.-, ctrB.sup.-, ctrc; ctrD.sup.-, synA.sup.- (equivalent to
synX.sup.- and siaA.sup.-), synB.sup.- (equivalent to siaB.sup.-)
or synC.sup.- (equivalent to siaC.sup.-) in a meningococcus B bleb
production strain may also be used) leading to a bleb preparation
with optimal safety and LPS protective epitope retention.
[0162] A further aspect of the invention is therefore a bleb
immunogenic preparation as described above which is derived from
such a combined mutant strain of meningococcus B. The strain itself
is a further aspect of the invention.
[0163] Immunogenic composition of the invention may comprise at
least, one, two, three, four or five different outer membrane
vesicle preparations. Where two or more OMV preparations are
included, at least one antigen of the invention is upregulated in
each OMV. Such OMV preparations may be derived from Neisserial
strains of the same species and serogroup or preferably from
Neisserial strains of different class, serogroup, serotype,
subserotype or immunotype. For example, an immunogenic composition
may comprise-one or more outer membrane vesicle preparation(s)
which contains LPS of immunotype L2 and one or more outer membrane
vesicle preparation which contains LPS of immunotype L3. L2 or L3
OMV preparations are preferably derived from a stable strain which
has minimal phase variability in the LPS oligosaccharide synthesis
gene locus.
Outer Membrane Vesicles Combined with Subunit Compositions
[0164] The immunogenic compositions of the invention may also
comprise both a subunit composition and an outer membrane vesicle.
There are several antigens that are particularly suitable for
inclusion in a subunit composition due to their solubility.
Examples of such proteins include; FhaB, NspA, passenger domain of
Hsf, passenger domain of Hap, passenger domain of AspA, AspA,
OMP85, FrpA, FrpC, TbpB, LbpB, PilQ. The outer membrane vesicle
preparation would have at least one different antigen selected from
the following list which has been recombinantly upregulated in the
outer membrane vesicle: NspA, Hsf, Hap, OMP85, ThpA (high), ThpA
(low), LbpA, TbpB, LbpB, NadA, TspA, TspB, PilC, PilQ, TdfH, PorB,
HpuB, P2086, NM-ADPRT, MafA, MafB and PldA; and optionally comprise
either or both of LPS immunotype L2 and LPS immunotype L3.
Specific Immunogenic Compositions of the Invention
[0165] In the specific combinations listed below, where
combinations of antigens are present in a bleb, such combinations
of antigens should be upregulated as descibed above.
[0166] A particularly preferred embodiment of the invention
comprises an autotransporter protein and an iron acquisition
protein, more preferably Hsf and ThpA (high) and/or ThpA (low).
Such immunogenic compositions may more preferably further comprise
at least one of OMP 85, FrpA, FrpC, LbpA, LbpB, Lipo28, Sibp,
NMB0964, NMB0293, TspA, NadA, TspB, PilQ, FiaC, NspA, PldA, HimD,
HisD, GNA1870, OspA, HlpA, FhaB, PilC, Omp26, NMB0315, NMB0995,
NMB1119, TdfH, PorB, HpuB, P2086, NM-ADPRT, VapD and Hap. All the
above immunogenic compositions may further comprise either or both
of LPS immunotype L2 and LPS immunotype L3.
[0167] A further preferred embodiment of the invention comprises
Hsf and at least one further antigen selected form the group
consisting of FrpA, FrpC,NM-ADPRT, VapD, LbpB, LbpA, TbpB, ThpA,
P2086, HpuA, HpuB, Lipo28, Sibp, Hap, AspA, IgA protease, OMP85,
NspA, PilQ, HimD, HisD, GNA1870, OspA, HipA, FhaC, NadA, PldA,
TspA, TspB, TdfH, PorB and FhaB. All the above immunogenic
compositions may further comprise either or both of LPS immunotype
L2 and LPS immunotype L3. Preferred combinations comprise Hsf and
OMP85 (optionally with one or more of Hap, FrpA or LbpB); Hsf and
Hap (optionally with one or more of FrpA, LbpB or OMP85); Hsf and
FrpA (optionally with one or more of Hap, LbpB or OMP85); Hsf and
LbpB (optionally with one or more of Hap, OMP85 or FrpA). In as
much as Hsf is an adhesin and an autotransporter protein, a
particularly preferred combination comprises Hsf, OMP85, ThpA, LPS
immunotype L2 and/or L3, preferably in a multivalent bleb
preparation, which has members of all five groups of antigens
represented. Preferably both TbpA(low) and ThpA(high) are
present.
[0168] A further immunogenic composition of the invention comprises
FhaB and at least one further antigen selected from the group
consisting of FrpA, FrpC, NM-ADPRT, VapD, LbpB, LbpA, TbpB, HpuA,
HpuB, P2086, Lipo28, Sibp, NMB0964, NMB0293, TdfH, PorB, PldA, Hap,
IgA protease, AspA, PilQ, HimD, HisD, GNA1870, OspA, HlpA, OMP85,
NspA, PilC, Omp26, NMB0315, NMB0995, NMB1119, NadA, PldA, ThpA,
Hsf, TspA and TspB, and either or both of LPS immunotype L2 and LPS
immunotype L3. Preferred combinations comprise FhaB and Hsf
(optionally with one or more of OMP85, LbpB, Hap or FrpA); FhaB and
OMP85 (optionally with one or more of LbpB, Hap or FrpA); FhaB and
LbpB (optionally with one or more of Hap or FrpA); FhaB and Hap
(optionally with FrpA). A prefered combination comprises FhaB,
LbpB, Hsf (as an OMP) and FrpA which has members of all five groups
of antigen represented.
[0169] A further immunogenic composition of the invention comprises
NspA and at least one further antigen selected from the group
consisting of FrpA, FrpC, NM-ADPRT, VapD, LbpB, LbpA, TbpB, ThpA,
HpuA, HpuB, P2086, Lipo28, Sibp, NMB0964, NMB0293, Hap, OMP85,
PilQ, AspA, IgA protease, NadA, PldA, Hsf, Hap, TspA, TspB, TdfH,
PorB, and either or both of LPS immunotype L2 and LPS immunotype
L3. Preferred combinations comprise NspA and Hsf (optionally with
one or more of OMP85, Hap, LbpA or ThpA); NspA and OMP85
(optionally with one or more of Hap, LbpA or ThpA); NspA and Hap
(optionally with one or more of LbpA or TbpA); NspA and LbpA
(optionally with ThpA). A particularly preferred combination
comprises NspA, Hsf, TbpA, LPS immunotype L2 and/or L3, preferably
in a multivalent bleb preparation, which has members of all five
groups of antigens represented. Preferably both ThpA(low) and
TbpA(high) are present.
[0170] Immunogenic compositins with individualised combinatins of
antigens disclosed in WO 00/25811 are not claimed in this
invention. Preferably, immunogenic compositions or vaccines are not
covered by the present invention if they have an antigen content
consisting solely of transferrin binding protein and NspA (or in
the case of a bleb vaccine, have an upregulated or enriched antigen
content consisting solely of transferrin binding protein and NspA),
however specific combinations of antigens (or upregulated antigens)
consisting of or including NspA as well as both ThpA(high) and ThpA
(low) may be included. Optionally, compositions or vaccines
comprising a combination (subunit) or upregulation (bleb) of
transferrin binding protein and NspA are not claimed.
[0171] A further immunogenic composition of the invention comprises
NadA and at least one further antigen selected from the group
consisting of FrpA, FrpC, NM-ADPRT, VapD, LbpB, LbpA, TbpB, ThpA,
P2086, Lipo28, Sibp, NMB0964, NMB0293, Hap, OMP85, NspA, PilQ,
HimD, HisD, GNA1870, OspA, HlpA, HpuA, HpuB, AspA, IgA protease,
PldA, Hsf, TspA, TspB, TdfH, PorB, and either or both of LPS
immunotype L2 and LPS immunotype L3.
[0172] A further immunogenic composition of the invention comprises
ThpA (low) and at least one further antigen selected from the group
consisting of FrpA, FrpC, NM-ADPRT, VapD, LbpB, LbpA, TbpB, IgA
protease, NspA, HpuA, HpuB, Hap, OMP85, NspA (when further combined
with ThpA(high)), PilQ, HimD, HisD, GNA1870, OspA, HlpA, PilC,
Omp26, NMB0315, NMB0995, NMB119, MafA, MafB, AspA, NadA, PldA, Hsf,
TspA, TspB, TdfH, PorB and FhaB, and either or both of LPS
immunotype L2 and LPS immunotype L3. Preferred combinations
comprise TbpA(low) and Hsf and LbpA; TbpA(low) and OMP85
(optionally with either or both of LbpA and Hap); ThpA(low) and
LbpA and Hap.
[0173] A further immunogenic composition of the invention comprises
TbpA (high) and at least one further antigen selected from the
group consisting of FrpA, FrpC, NM-ADPRT, VapD, LbpB, LbpA, TbpB,
Hap, OMP85, NspA (when further combined with ThpA(low)), PilC,
Omp26, NMB0315, NMB0995, NMB1119, PilQ, HimD, HisD, GNA1870, OspA,
HlpA, MafA, MafB, AspA, IgA protease, PldA, FhaB, NadA, PldA, Hsf,
TspA, TspB, TdfH, PorB and FhaB, and either or both of LPS
immunotype L2 and LPS immunotype L3. Preferred combinations
comprise TbpA(high) and Hsf and LbpA; ThpA(high) and OMP85
(optionally with either or both of LbpA and Hap); ThpA(high) and
LbpA and Hap.
[0174] A further immunogenic composition of the invention comprises
LbpA and at least one further antigen selected from the group
consisting of FrpA, FrpC, NM-ADPRT, VapD, LbpB, TbpB, Hap, OMP85,
NspA, PilC, Omp26, NMB0315, NMB0995, NMB119, NadA, PldA, TbpA, Hsf,
TspA, TspB, MafA, MafB, IgA protease, AspA, FhaB, PilQ, HimD, HisD,
GNA1870, OspA, HlpA, TdfH, PorB and FhaB and either or both of LPS
immunotype L2 and LPS immunotype L3. Preferred combinations
comprise LbpA and Hsf (optionally with Hap).
[0175] A further immunogenic composition of the invention comprises
LbpB and at least one further antigen selected from the group
consisting of FrpA, FrpC, NM-ADPRT, VapD, LbpA, TbpB, Hap, OMP85,
NspA, PilC, Omp26, NMB0315, NMB30995, NMB1119, NadA, PldA, ThpA,
Hsf, TspA, TspB, MafA, MafB, IgA protease, AspA, FhaB, PilQ, HimD,
HisD, GNA1870, OspA, HlpA, TdfH, PorB and FhaB, and either or both
of LPS immunotype L2 and LPS immunotype L3. Preferred combinations
comprise LbpB and Hsf (optionally with one or more of OMP85, Hap or
FrpA); LbpB and OMP85 (optionally with one or more of Hap or FrpA);
LbpB and Hap (optionally with FrpA).
[0176] A further immunogenic composition of the invention comprises
OMP85 and at least one further antigen selected from the group
consisting of FrpA, FrpC, NM-ADPRT, VapD, LbpB, LbpA, TbpB, ThpA,
HpuA, HpuB, P2086, Lipo28, Sibp, NMB0964, NMB0293, Hap, IgA
protease, AspA, Hsf, NspA, PilC, Omp26, NMB0315, NMB0995, NMB1119,
MafA, MafB, NadA, PIdA, Hsf, TspA, TspB, PilQ, TdfH, PorB and FhaB,
and either or both of LPS immunotype L2 and LPS immunotype L3.
Preferred combinations comprise OMP85 and Hsf (optionally with
either or both of LbpA or NspA); OMP85 and LbpA (optionally with
either or both of Hap and NspA); OMP85 and Hap (optionally with
NspA).
[0177] A further immunogenic composition of the invention comprises
Hap and at least one further antigen selected from the group
consisting of FrpA, FrpC, NM-ADPRT, VapD, LbpB, LbpA, TbpB, ThpA,
HpuA, HpuB, P2086, Lipo28, Sibp, NMB0964, NMB0293, PilQ, HimD,
HisD, GNA1870, OspA, HlpA, NspA, IgA protease, AspA, OMP85, NspA,
PilC, Omp26, NMB0315, NMB0995, NMB1119, MafA, MafB, NadA, PldA,
Hsf, TspA, TspB, TdfH, PorB and FhaB, and either or both of LPS
immunotype L2 and LPS immunotype L3.
[0178] A further immunogenic composition of the invention comprises
FrpA and at least one further antigen selected from the group
consisting of LbpB, LbpA, ThpA, TbpB, HpuA, HpuB, P2086, Lipo28,
Sibp, NMB0964, NMB0293, PilQ, HimD, HisD, GNA1870, OspA, HlpA,
TspA, TspB, Hap, IgA protease, AspA, NadA, FhaB, PilQ, HimD, HisD,
GNA1870, OspA, mpA, OMP85, NspA, PilC, Omp26, NMB0315, NMB0995,
NMB1119, MafA, MafB, PldA, Hsf, TspA, TspB, TdfH, PorB and FhaB,
and either or both of LPS immunotype L2 and LPS immunotype L3.
[0179] A further immunogenic composition of the invention comprises
FrpC and at least one further antigen selected from the group
consisting of LbpB, LbpA, ThpA, TbpB, HpuA, HpuB, P2086, Lipo28,
Sibp, NMB0964, NMB0293, PilQ, HimD, HisD, GNA1870, OspA, HipA,
TspA, TspB, Hap, IgA protease, AspA, NadA, FhaB, OMP85, NspA, PilC,
Omp26, NMB0315, NMB0995, NMB 1119, MafA, MafB, PldA, Hsf, TspA,
TspB, TdfH, PorB and FhaB, and either or both of LPS immunotype L2
and LPS immunotype L3.
[0180] A further immunogenic composition of the invention comprises
either or both of LPS immunotype L2 and LPS immunotype L3 and at
least one further antigen selected from the group consisting of
LbpB, LbpA, ThpA, TbpB, HpuA, HpuB, P2086, Lipo28, Sibp, NMB0964,
NMB0293, PilQ, HimD, HisD, GNA1870, OspA, HlpA, TspA, TspB, Hap,
IgA protease, AspA, NadA, FhaB, OMP85, NspA, PilC, Omp26, NMB0315,
NMB0995, NMB1119, MafA, MafB, PldA, Hsf, TspA, TspB, TdfH, PorB and
FhaB.
[0181] Preferred combinations of antigens in an immunogenic
composition of the invention include combinations comprising an
iron acquisition protein, an autotransporter protein and FhaB; an
iron acquisition protein, an autotransporter protein and PilC; an
iron acquisition protein, an autotransporter protein and NadA; an
iron acquisition protein, an autotransporter protein and FrpA; an
iron acquisition protein, an autotransporter protein and PilQ; an
iron acquisition protein, an autotransporter protein and TspA; an
iron acquisition protein, an autotransporter protein and TspB; an
iron acquisition protein, an autotransporter protein and NspA; an
iron acquisition protein, an autotransporter protein and FrpC; more
preferably comprising an iron acquisition protein, an
autotransporter protein and Hap; an iron acquisition protein, an
autotransporter protein and FrpA/C; an iron acquisition protein, an
autotransporter protein and LbpB; an iron acquisition protein, an
autotransporter protein and OMP85 (D15). Most preferably, OMP85
(D15) would be incorporated as part of an outer membrane vesicle
preparation.
[0182] Immunogenic compositions of the invention which contain LPS
will preferably have the LPS conjugated to a source of T-helper
epitopes, preferably proteins, and in the case of LPS in OMVs,
preferably outer membrane proteins. A particularly preferred
embodiment contains LPS which have been (preferably intra-bleb)
conjugated to OMP in situ in the outer membrane vesicle preparation
(for instance as described above).
[0183] The immunogenic compositions of the invention may comprise
antigens (proteins, LPS and polysaccharides) derived from Neisseria
meningitidis serogroups A, B, C, Y, W-135 or Neisseria
gonorrhoeae.
[0184] Preferably the immunogenic compositions or vaccines of the
invention do not consist of and/or comprise the particular
combinations of SEQ IDs listed in the table spanning from page 3,
line 18 to page 52, line 2 of WO 00/71725 and/or any individual
combination described in the examples 1-11 of WO 00/71725.
[0185] Preferably, any individualised combinations disclosed in WO
01/52885 are not claimed in this invention.
Further Combinations
[0186] The immunogenic composition of the invention may further
comprise bacterial capsular polysaccharides or oligosaccharides.
The capsular polysaccharides or oligosaccharides may be derived
from one or more of: Neisseria meningitidis serogroup A, C, Y,
and/or W-135, Haemophilus influenzae b, Streptococcus pneumoniae,
Group A Streptococci, Group B Streptococci, Staphylococcus aureus
and Staphylococcus epidermidis.
[0187] A further aspect of the invention are vaccine combinations
comprising the antigenic composition of the invention with other
antigens which are advantageously used against certain disease
states including those associated with viral or Gram positive
bacteria.
[0188] In one preferred combination, the antigenic compositions of
the invention are formulated with 1, 2, 3 or preferably all 4 of
the following meningococcal capsular polysaccharides or
oligosaccharides which may be plain or conjugated to a protein
carrier: A, C, Y or W-135. Preferably the immunogenic compositions
of the invention are formulated with A and C; or C; or C and Y.
Such a vaccine containing proteins from N. meningitidis, preferably
serogroup B may be advantageously used as a global meningococcus
vaccine.
[0189] In a further preferred embodiment, the antigenic
compositions of the invention, preferably formulated with 1, 2, 3
or all 4 of the plain or conjugated meningococcal capsular
polysaccharides or oligosaccharides A, C, Y or W-135 (as described
above), are formulated with a conjugated H. influenzae b capsular
polysaccharide or oligosaccharides, and/or one or more plain or
conjugated pneumococcal capsular polysaccharides or
oligosaccharides. Optionally, the vaccine may also comprise one or
more protein antigens that can protect a host against Streptococcus
pneumoniae infection. Such a vaccine may be advantageously used as
a global meningitis vaccine.
[0190] In a still further preferred embodiment, the immunogenic
composition of the invention is formulated with capsular
polysaccharides or oligosaccharides derived from one or more of
Neisseria meningitidis, Haemophilus influenzae b, Streptococcus
pneumoniae, Group A Streptococci, Group B Streptococci,
Staphylococcus aureus or Staphylococcus epidermidis. The
pneumococcal capsular polysaccharide antigens are preferably
selected from serotypes 1, 2, 3, 4, 5, 6B, 7F, 8, 9N, 9V, 10A, 11A,
12F, 14, 15B, 17F, 18C, 19A, 19F, 20, 22F, 23F and 33F (most
preferably from serotypes 1, 3, 4, 5, 6B, 7F, 9V, 14, 18C, 19F and
23F). A further preferred embodiment would contain the PRP capsular
polysaccharides of Haemophilus influenzae. A further preferred
embodiment would contain the Type 5, Type 8 or 336 capsular
polysaccharides of Staphylococcus aureus. A further preferred
embodiment would contain the Type I, Type II or Type III capsular
polysaccharides of Staphylococcus epidennidis. A further preferred
embodiment would contain the Type Ia, Type Ic, Type II or Type III
capsular polysaccharides of Group B streptocoocus. A further
preferred embodiment would contain the capsular polysaccharides of
Group A streptococcus, preferably further comprising at least one M
protein and more preferably multiple types of M protein.
[0191] Such capsular polysaccharides of the invention may be
unconjugated or conjugated to a carrier protein such as tetatus
toxoid, tetanus toxoid fragment C, diphtheria toxoid, CRM197,
pneumolysin, Protein D (U.S. Pat. No. 6,342,224). The
polysaccharide conjugate may be prepared by any known coupling
technique. For example the polysaccharide can be coupled via a
thioether linkage. This conjugation method relies on activation of
the polysaccharide with 1-cyano-4-dimethylamino pyridinium
tetrafluoroborate (CDAP) to form a cyanate ester. The activated
polysaccharide may thus be coupled directly or via a spacer group
to an amino group on the carrier protein. Preferably, the cyanate
ester is coupled with hexane diamine and the amino-derivatised
polysaccharide is conjugated to the carrier protein using
heteroligation chemistry involving the formation of the thioether
linkage. Such conjugates are described in PCT published application
WO93/15760 Uniformed Services University.
[0192] The conjugates can also be prepared by direct reductive
amination methods as described in U.S. Pat. No. 4,365,170
(Jennings) and U.S. Pat. No. 4,673,574 (Anderson). Other methods
are described in EP-O-161-188, EP-208375 and EP-O-477508. A further
method involves the coupling of a cyanogen bromide activated
polysaccharide derivatised with adipic acid hydrazide (ADH) to the
protein carrier by Carbodiimide condensation (Chu C. et al Infect.
Immunity, 1983 245 256). Where oligosaccharides are included, it is
preferred that they be conjugated.
[0193] Preferred pneumococcal proteins antigens are those
pneumococcal proteins which are exposed on the outer surface of the
pneumococcus (capable of being recognised by a host's immune system
during at least part of the life cycle of the pneumococcus), or are
proteins which are secreted or released by the pneumococcus. Most
preferably, the protein is a toxin, adhesin, 2-component signal
tranducer, or lipoprotein of Streptococcus pneumoniae, or fragments
thereof. Particularly preferred proteins include, but are not
limited to: pneumolysin (preferably detoxified by chemical
treatment or mutation) [Mitchell et al. Nucleic Acids Res. 1990
Jul. 11; 18(13): 4010 "Comparison of pneumolysin genes and proteins
from Streptococcus pneumoniae types 1 and 2.", Mitchell et al.
Biochim Biophys Acta 1989 Jan. 23; 1007(1): 67-72 "Expression of
the pneumolysin gene in Escherichia coli: rapid purification and
biological properties.", WO 96/05859 (A. Cyanamid), WO 90/06951
(Paton et al), WO 99/03884 (NAVA)]; PspA and transmembrane deletion
variants thereof (U.S. Pat. No. 5,804,193--Briles et al.); PspC and
transmembrane deletion variants thereof (WO 97/09994--Briles et
al); PsaA and transmembrane deletion variants thereof (Berry &
Paton, Infect Immun 1996 December; 64(12):5255-62 "Sequence
heterogeneity of PsaA, a 37-kilodalton putative adhesin essential
for virulence of Streptococcus pneumoniae"); pneumococcal choline
binding proteins and transmembrane deletion variants thereof; CbpA
and transmembrane deletion variants thereof (WO 97/41151; WO
99/51266); Glyceraldehyde-3-phosphate--dehydrogenase (Infect.
Immun. 1996 64:3544); HSP70 (WO 96/40928); PcpA (Sanchez-Beato et
al. FEMS Microbiol Lett 1998, 164:207-14); M like protein, (EP
0837130) and adhesin 18627, (EP 0834568). Further preferred
pneumococcal protein antigens are those disclosed in WO 98/18931,
particularly those selected in WO 98/18930 and PCT/US99/30390.
[0194] The immunogenic composition/vaccine of the invention may
also optionally comprise outer membrane vesicle preparations made
from other Gram negative bacteria, for example Moraxella
catarrhalis or Haemophilus influenzae.
Moraxella catarrhalis Bleb Preparations
[0195] Immunogenic compositions of the invention may further
comprise OMV preparations derived from Moraxella catarrhalis.
Engineered OMV preparations can be derived from Moraxella
catarrhalis as described in WO01/09350. One or more of the
following genes (encoding protective antigens) are preferred for
upregulation: OMP106 (WO 97/41731 & WO 96/34960), HasR
(PCT/EP99/03824), PilQ (PCT/EP99/03823), OMP85 (PCT/EP00/01468),
lipo06 (GB 9917977.2), lipo10 (GB 9918208.1), lipo11 (GB
9918302.2), lipo18 (GB 9918038.2), P6 (PCT/EP99/03038), ompCD, CopB
(Helminen M E, et al (1993) Infect. Immun. 61:2003-2010), D15
(PCT/EP99/03822), OmplA1 (PCT/EP99/06781), Hly3 (PCT/EP99/03257),
LbpA and LbpB (WO 98/55606), ThpA and TbpB (WO 97/13785 & WO
97/32980), OmpE, UspA1 and UspA2 (WO 93/03761), and Omp21. They are
also preferred as genes which may be heterologously introduced into
other Gram-negative bacteria.
[0196] One or more of the following genes are preferred for
downregulation: CopB, OMP106, OmpB1, ThpA, TbpB, LbpA, and
LbpB.
[0197] One or more of the following genes are preferred for
downregulation: htrB, msbB and lpxK.
[0198] One or more of the following genes are preferred for
upregulation: pmrA, pmrB, pmrE, and pmrF.
Haemophilus influenzae Bleb Preparations
[0199] Immunogenic compositions of the invention may further
comprise OMV preparations derived from Haemophilus influenzae.
Engineered OMV preparations can be derived from Haemophilus
influenzae as described in WO01/09350. One or more of the following
genes (encoding protective antigens) are preferred for
upregulation: D15 (WO 94/12641), P6 (EP 281673), TbpA (WO96/40929;
WO95/13370), TbpB (WO96/40929; WO95/13370), P2, P5 (WO 94/26304),
OMP26 (WO 97/01638), HMW1, HMW2, HMW3, HMW4, Hia, Hsf, Hap, Hin47,
and Hif (all genes in this operon should be upregulated in order to
upregulate pilin). They are also preferred as genes which may be
heterologously introduced into other Gram-negative bacteria.
[0200] One or more of the following genes are preferred for
downregulation: P2, P5, Hif, IgA1-protease, HgpA, HgpB, HMW1, HMW2,
Hxu, htrB, msbB and lpxK.
[0201] One or more of the following genes are preferred for
upregulation: pmrA, pmrB, pmrE, and pmrF.
[0202] The immunogenic composition/vaccine of the invention may
also optionally comprise antigens providing protection against one
or more of Diphtheria, tetanus and Bordetella pertussis infections.
The pertussis component may be killed whole cell B. pertussis (Pw)
or acellular pertussis (Pa) which contains at least one antigen
(preferably 2 or all 3) from PT, FHA and 69 kDa pertactin.
Typically, the antigens providing protection against Diphtheria and
tetanus would be Diphtheria toxoid and tetanus toxoid. The toxoids
may chemically inactivated toxins or toxins inactivated by the
introduction of point mutations.
[0203] The immunogenic composition/vaccine may also optionally
comprise one or more antigens that can protect a host against
non-typeable Haemophillus influenzae, RSV and/or one or more
antigens that can protect a host against influenza virus. Such a
vaccine may be advantageously used as a global otitis media
vaccine.
[0204] Preferred non-typeable H. influenzae protein antigens
include Fimbrin protein (U.S. Pat. No. 5,766,608) and fusions
comprising peptides therefrom (eg LB1 Fusion) (U.S. Pat. No.
5,843,464--Ohio State Research Foundation), OMP26, P6, protein D,
ThpA, TbpB, Hia, Hmw1, Hmw2, Hap, and D15.
[0205] Preferred influenza virus antigens include whole, live or
inactivated virus, split influenza virus, grown in eggs or MDCK
cells, or Vero cells or whole flu virosomes (as described by R.
Gluck, Vaccine, 1992, 10, 915-920) or purified or recombinant
proteins thereof, such as HA, NP, NA, or M proteins, or
combinations thereof.
[0206] Preferred RSV (Respiratory Syncytial Virus) antigens include
the F glycoprotein, the G glycoprotein, the HN protein, the M
protein or derivatives thereof.
[0207] Immunogenic compositions of the invention may include
proteins of Moraxella catarrhalis include TbpA (WO97/13785;
WO99/52947), TbpB (WO97/13785; WO99/52947; Mathers et al FEMS
Immunol Med Microbiol 1997 19; 231-236; Myers et al Infect Immun
1998 66; 4183-4192), LbpA, LbpB (Du et al Infect Immun 1998 66;
3656-3665), UspA1, UspA2 (Aebi et al Infect Immun. 1997 65;
4367-4377), OMP106 (U.S. Pat. No. 6,214,981), Ton-B dependent
receptor (WO00/78968), CopB (Sethi et al Infect. Immun. 1997 65;
3666-3671), and HasR receptor (WO00/78968); proteins of Haemophilus
influenzae include HMW (St Geme et al Infect Immun 1998 66;
364-368), Hia (St Geme et al J. Bacteriol. 2000 182; 6005-6013),
Tbp1 (WO96/40929; WO95/13370), Tbp2 (WO96/40929; WO95/13370;
Gray-Owen et al Infect Immun 1995 63; 1201-1210), LbpA, LbpB
(Schryvers et al 1989, 29:121-130), HasR, TonB-dependent receptor
(Fleishmann et al Science 1995 269; 496-512), hemoglobin-binding
protein, HhuA (Cope et al Infect Immun 2000 68; 4092-4101), HgpA
(Maciver et al Infect Immun 1996 64; 3703-3712), HgbA, HgbB and
HgbC (Jin et al Infect Immun 1996 64; 3134-3141), HxuA (Cope et al
Mol Microbiol 1994 13; 863-873), HxuC (Cope et al Infect Immun 2001
69; 2353-2363); proteins from Neisseria meningitidis include Tbp1,
Tbp2, FbpA, FbpB, BfrA, BfrB (Tettelin et al Science 2000 287;
1809-1815), LbpA, LbpB and HmbR.
Vaccine Formulations
[0208] A preferred embodiment of the invention is the formulation
of the immunogenic composition of the invention in a vaccine which
may also comprise a pharmaceutically acceptable excipient or
carrier.
[0209] The manufacture of outer membrane vesicle preparations from
any of the aforementioned modified strains may be achieved by any
of the methods well known to a skilled person. Preferably the
methods disclosed in EP 301992, U.S. Pat. No. 5,597,572, EP 11243
or U.S. Pat. No. 4,271,147 are used. Most preferably, the method
described in WO 01/09350 is used.
[0210] Vaccine preparation is generally described in Vaccine Design
("The subunit and adjuvant approach" (eds Powell M. F. & Newman
M. J.) (1995) Plenum Press New York).
[0211] The antigenic compositions of the present invention may be
adjuvanted in the vaccine formulation of the invention. Suitable
adjuvants include an aluminium salt such as aluminum hydroxide gel
(alum) or aluminium phosphate, but may also be a salt of calcium
(particularly calcium carbonate), iron or zinc, or may be an
insoluble suspension of acylated tyrosine, or acylated sugars,
cationically or anionically derivatised polysaccharides, or
polyphosphazenes.
[0212] Suitable Th1 adjuvant systems that may be used include,
Monophosphoryl lipid A, particularly 3-de-O-acylated monophosphoryl
lipid A, and a combination of monophosphoryl lipid A, preferably
3-de-O-acylated monophosphoryl lipid A (3D-MPL) together with an
aluminium salt preferably aluminium phosphate). An enhanced system
involves the combination of a monophosphoryl lipid A and a saponin
derivative particularly the combination of QS21 and 3D-MPL as
disclosed in WO 94/00153, or a less reactogenic composition where
the QS21 is quenched with cholesterol as disclosed in WO96/33739. A
particularly potent adjuvant formulation involving QS21 3D-MPL and
tocopherol in an oil in water emulsion is described in WO95/17210
and is a preferred formulation.
[0213] The vaccine may comprise a saponin, more preferably QS21. It
may also comprise an oil in water emulsion and tocopherol.
Unmethylated CpG containing oligo nucleotides (WO 96/02555) are
also preferential inducers of a TH1 response and are suitable for
use in the present invention.
[0214] The vaccine preparation of the present invention may be used
to protect or treat a mammal susceptible to infection, by means of
administering said vaccine via systemic or mucosal route. These
administrations may include injection via the intramuscular,
intraperitoneal, intradermal or subcutaneous routes; or via mucosal
administration to the oral/alimentary, respiratory, genitourinary
tracts. Thus one aspect of the present invention is a method of
immunizing a human host against a disease caused by infection of a
gram-negative bacteria, which method comprises administering to the
host an immunoprotective dose of the OMV preparation of the present
invention.
[0215] The amount of antigen in each vaccine dose is selected as an
amount which induces an immunoprotective response without
significant, adverse side effects in typical vaccinees. Such amount
will vary depending upon which specific immunogen is employed and
how it is presented. Generally, it is expected that each dose will
comprise 1-100 .mu.g of protein antigen or OMV preparation,
preferably 5-50 .mu.g, and most typically in the range 5-25
.mu.g.
[0216] An optimal amount for a particular vaccine can be
ascertained by standard studies involving observation of
appropriate immune responses in subjects. Following an initial
vaccination, subjects may receive one or several booster
immunisations adequately spaced.
[0217] The vaccines of the invention are preferably
immunoprotective and non-toxic and suitable for paediatric or
adolescent use.
[0218] By paediatric use it is meant use in infants less than 4
years old.
[0219] By immunoprotective it is meant that the SBA and/or animal
protection model and/or adhesion blocking assay described above are
satisfactorily met.
[0220] By non-toxic it is meant that there is no more than a
satisfactory level of endotoxin activity in the vaccine as measured
by the well-known LAL and pyrogenicity assays.
Polynucleotides of the Invention
[0221] "Polynucleotide" generally refers to any polyribonucleotide
or polydeoxribonucleotide, which may be unmodified RNA or DNA or
modified RNA or DNA. "Polynucleotides" include, without limitation
single- and double-stranded DNA, DNA that is a mixture of single-
and double-stranded regions, single- and double-stranded RNA, and
RNA that is mixture of single- and double-stranded regions, hybrid
molecules comprising DNA and RNA that may be single-stranded or,
more typically, double-stranded or a mixture of single- and
double-stranded regions. In addition, "polynucleotide" refers to
triple-stranded regions comprising RNA or DNA or both RNA and DNA.
The term polynucleotide also includes DNAs or RNAs containing one
or more modified bases and DNAs or RNAs with backbones modified for
stability or for other reasons. "Modified" bases include, for
example, tritylated bases and unusual bases such as inosine. A
variety of modifications has been made to DNA and RNA; thus,
"polynucleotide" embraces chemically, enzymatically or
metabolically modified forms of polynucleotides as typically found
in nature, as well as the chemical forms of DNA and RNA
characteristic of viruses and cells. "Polynucleotide" also embraces
relatively short polynucleotides, often referred to as
oligonucleotides.
[0222] Another aspect of the invention relates to an
immunological/vaccine formulation which comprises one or more
polynucleotide(s). Such techniques are known in the art, see for
example Wolff et al., Science, (1990) 247: 1465-8.
[0223] Such vaccines comprise one or more polynucleotide(s)
encoding a plurality of proteins corresponding to protein
combinations of the invention described above.
[0224] The expression of proteins from such polynucleotides would
be under the control of a eukaryotic promoter capable of driving
expression within a mammalian cell. The polynucleotide may
additionally comprise sequence encoding other antigens. Examples of
eukaryotic promoters that could drive the expression include viral
promoters from viruses including adenoviral promoters, retroviral
promoters. Alternatively, mammalian promoters could be used to
drive expression.
Further Aspects of the Invention
[0225] Another aspect of the invention involves a method for
treatment or prevention of Neisserial disease comprising
administering a protective dose (or effective amount) of the
vaccine of the invention to a host in need thereof. Neisseria
meningitidis serogroups A, B, C, Y or W135 and/or Neisseria
gonorrhoeae infection could be advantageously prevented or
treated.
[0226] The invention also includes a use of the vaccine of the
invention in the preparation of a medicament for treatment of
prevention of Neisserial infection. Again Neisserial infection
encompasses infection by Neisseria meningitidis serogroups A, B, C,
Y, W-135 and/or Neisseria gonorrhoeae.
[0227] Another aspect of the invention is a genetically engineered
Neisserial strain from which an outer membrane vesicle of the
inventions (having at least two proteins of the invention
recombinantly upregulated, as described above) may be derived. Such
Neisserial strains may be Neisseria meningitidis or Neisseria
gonorrhoeae.
[0228] The strain may also have been engineered (as described
above) to downregulate the expression of other Neisserial proteins
including the expression of one, two, three, four, five, six, seven
or eight of LgtB, LgtE, SiaD, OpC, OpA, PorA, FrpB, msbB and HtrB.
Preferred combinations for downregulation include down regulation
(preferably deletion) of at least LgtB and SiaD, downregulation of
at least PorA and OpC, downregulation of at least PorA and OpA and
downregulation of at least PorA, OpA and OpC.
[0229] Further aspects of the invention are methods of making the
immunogenic composition or vaccine of the invention. These include
a method comprising a step of mixing together at least two isolated
antigens or proteins from Neisseria, which may be present in the
form of blebs derived from the Neisserial strains of the invention,
to make an immunogenic composition of the invention, and a method
of making the vaccine of the invention comprising a step of
combining the immunogenic composition of the invention with a
pharmaceutically acceptable carrier.
[0230] Also included in the invention are methods of making the
immunogenic composition of the invention comprising a step of
isolating outer membrane vesicles of the invention from a
Neisserial culture. Such a method may involve a further step of
combining at least two outer membrane vesicle preparations,
preferably wherein at least one outer membrane vesicle preparation
contains LPS of immunotype L2 and at least one outer membrane
vesicle preparation contains LPS of immunotype L3. The invention
also includes such methods wherein the outer membrane vesicles are
isolated by extracting with a concentration of DOC of 0-0.5%. DOC
concentrations of 0.3%-0.5% are used to minimise LPS content. In
OMV preparations where LPS is to be conserved as an antigen, DOC
concentrations of 0-0.3%, preferably 0.05%-0.2%, most preferably of
about 0.1% are used for extraction.
Ghost or Killed Whole Cell Vaccines
[0231] The inventors envisage that the above improvements to bleb
preparations and vaccines can be easily extended to ghost or killed
whole cell preparations and vaccines (with identical advantages).
The modified Gram-negative strains of the invention from which the
bleb preparations are made can also be used to made ghost and
killed whole cell preparations. Methods of making ghost
preparations (empty cells with intact envelopes) from Gram-negative
strains are well known in the art (see for example WO 92/01791).
Methods of killing whole cells to make inactivated cell
preparations for use in vaccines are also well known. The terms
`bleb [or OMV] preparations` and `bleb [or OMV] vaccines` as well
as the processes described throughout this document are therefore
applicable to the terms `ghost preparation` and `ghost vaccine`,
and `killed whole cell preparation` and `killed whole cell
vaccine`, respectively, for the purposes of this invention.
Antibodies and Passive Immunisation
[0232] Another aspect of the invention is a method of preparing an
immune globulin for use in prevention or treatment of Neisserial
infection comprising the steps of immunising a recipient with the
vaccine of the invention and isolating immune globulin from the
recipient. An immune globulin prepared by this method is a further
aspect of the invention. A pharmaceutical composition comprising
the immune globulin of the invention and a pharmaceutically
acceptable carrier is a further aspect of the invention which could
be used in the manufacture of a medicament for the treatment or
prevention of Neisserial disease. A method for treatment or
prevention of Neisserial infection comprising a step of
administering to a patient an effective amount of the
pharmaceutical preparation of the invention is a further aspect of
the invention.
[0233] Inocula for polyclonal antibody production are typically
prepared by dispersing the antigenic composition in a
physiologically tolerable diluent such as saline or other adjuvants
suitable for human use to form an aqueous composition. An
immunostimulatory amount of inoculum is administered to a mammal
and the inoculated mammal is then maintained for a time sufficient
for the antigenic composition to induce protective antibodies.
[0234] The antibodies can be isolated to the extent desired by well
known techniques such as affinity chromatography (Harlow and Lane
Antibodies; a laboratory manual 1988).
[0235] Antibodies can include antiserum preparations from a variety
of commonly used animals e.g. goats, primates, donkeys, swine,
horses, guinea pigs, rats or man. The animals are bled and serum
recovered.
[0236] An immune globulin produced in accordance with the present
invention can include whole antibodies, antibody fragments or
subfragments. Antibodies can be whole immunoglobulins of any class
e.g. IgG, IgM, IgA, IgD or IgE, chimeric antibodies or hybrid
antibodies with dual specificity to two or more antigens of the
invention. They may also be fragments e.g. F(ab')2, Fab', Fab, Fv
and the like including hybrid fragments. An immune globulin also
includes natural, synthetic or genetically engineered proteins that
act like an antibody by binding to specific antigens to form a
complex.
[0237] A vaccine of the present invention can be administered to a
recipient who then acts as a source of immune globulin, produced in
response to challenge from the specific vaccine. A subject thus
treated would donate plasma from which hyperimmune globulin would
be obtained via conventional plasma fractionation methodology. The
hyperimmune globulin would be administered to another subject in
order to impart resistance against or treat Neisserial infection.
Hyperimmune globulins of the invention are particularly useful for
treatment or prevention of Neisserial disease in infants, immune
compromised individuals or where treatment is required and there is
no time for the individual to produce antibodies in response to
vaccination. An additional aspect of the invention is a
pharmaceutical composition comprising two of more monoclonal
antibodies (or fragments thereof; preferably human or humanised)
reactive against at least two constituents of the immunogenic
composition of the invention, which could be used to treat or
prevent infection by Gram negative bacteria, preferably Neisseria,
more preferably Neisseria meningitidis or Neisseria gonorrhoeae and
most preferably Neisseria meningitidis serogroup B.
[0238] Such pharmaceutical compositions comprise monoclonal
antibodies that can be whole immunoglobulins of any class e.g. IgG,
IgM, IgA, IgD or IgE, chimeric antibodies or hybrid antibodies with
specificity to two or more antigens of the invention. They may also
be fragments e.g. F(ab')2, Fab', Fab, Fv and the like including
hybrid fragments.
[0239] Methods of making monoclonal antibodies are well known in
the art and can include the fusion of splenocytes with myeloma
cells (Kohler and Milstein 1975 Nature 256; 495; Antibodies--a
laboratory manual Harlow and Lane 1988). Alternatively, monoclonal
Fv fragments can be obtained by screening a suitable phage display
library (Vaughan T J et al 1998 Nature Biotechnology 16; 535).
Monoclonal antibodies may be humanised or part humanised by known
methods.
[0240] All references or patent applications cited within this
patent specification are incorporated by reference herein.
[0241] The terms "comprising", "comprise" and "comprises" herein is
intended by the inventors to be optionally substitutable with the
terms "consisting of", "consist of", and "consists of",
respectively, in every instance.
Method of Industrial Application of the Invention
[0242] The examples below are carried our using standard
techniques, which are well known and routine to those of skill in
the art, except where otherwise described in detail. The examples
are illustrative, but do not limit the invention.
EXAMPLE 1
Methods for Constructing Strains of Neisseria meningitidis
Serogroup B Used in Outer Membrane Vesicle Preparations
[0243] WO01/09350 provides detailed methods for preparing outer
membrane vesicles and manipulating the bacterial strains from which
the outer membrane vesicles are derived. Where the outer membrane
vesicles are to retain lipoproteins such as TbpB and or
lipopolysaccharides, methods of isolation with low levels or no
deoxycholate are preferred.
EXAMPLE 2
Up-Regulation of the Hsf Protein Antigen in a Recombinant
Neisseiria meninitidis Serogroup B Strain Lacking Functional cps
Genes but Expressing PorA
[0244] As described in WO01/09350 examples, in certain countries,
the presence of PorA in outer membrane vesicles may be
advantageous, and can strengthen the vaccine efficacy of
recombinant improved blebs. In the following example, we have used
a modified pCMK(+) vector to up-regulate the expression of the Hsf
protein antigen in a strain lacking functional cps genes but
expressing PorA The original pCMK(+) vector contains a chimeric
porA/lacO promoter repressed in E. coli host expressing lacl.sup.q
but transcriptionally active in Neisseria meningitidis. In the
modified pCMK(+), the native porA promoter was used to drive the
transcription of the hsf gene. The gene coding for Hsf was PCR
amplified using the HSF 01-NdeI and HSF 02-NheI oligonucleotide
primers, presented in the table below. Because of the sequence of
the HSF 01-NdeI primer the Hsf protein expressed will contain two
methionine residues at the 5' end. The conditions used for PCR
amplification were those described by the supplier (HiFi DNA
polymerase, Boehringer Mannheim, GmbH). Thermal cycling was the
following: 25 times (94.degree. C. 1 min., 48.degree. C. 1 min.,
72.degree. C. 3 min.) and 1 time (72.degree. C. 10 min., 4.degree.
C. up to recovery). The corresponding amplicon was subsequently
cloned in the corresponding restriction sites of pCMK(+) delivery
vector. In this recombinant plasmid, designed pCMK(+)-Hsf, we
deleted the lacO present in the chimeric porA/lacO promoter by a
recombinant PCR strategy. The pCMK(+)-Hsf plasmid was used as a
template to PCR amplify 2 separate DNA fragments:
[0245] fragment 1 contains the porA 5' recombinogenic region, the
Kanamycin resistance gene and the porA promoter. Oligonucleotide
primers used, RP1 (SacII) and RP2, are presented in the table
below. RP1 primer is homologous to the sequence just upstream of
the lac operator.
[0246] fragment 2 contains the Shine-Dalgarno sequence from the
porA gene, the hsf gene and the porA 3' recombinogenic region.
Oligonucleotide primers used, RP3 and RP4(ApaI), are presented in
the table below. RP3 primer is homologous to the sequence just
downstream of the lac operator. The 3' end of fragment 1 and the
5'end of fragment 2 have 48 bases overlapping. 500 ng of each PCR
(1 and 2) were used for a final PCR reaction using primers RP1 and
RP4. The final amplicon obtained was subcloned in pSL1180 vector
restricted with SacII and ApaI. The modified plasmid pCMK(+)-Hsf
was purified at a large scale using the QIAGEN maxiprep kit and 2
.mu.g of this material was used to transform a Neisseiria
meningitidis serogroup B strain lacking functional cps genes. In
order to preserve the expression of porA, integration resulting
from a single crossing-over was selected by a combination of PCR
and Western blot screening procedures. Kanamycin resistant clones
testing positive by porA-specific PCR and western blot were stored
at -70.degree. C. as glycerol stocks and used for further studies.
Bacteria (corresponding to about 5.108 bacteria) were re-suspended
in 50 .mu.l of PAGE-SDS buffer, frozen (-20.degree. C.)/boiled
(100.degree. C.) three times and then were separated by PAGE-SDS
electrophoresis on a 12.5% gel. The expression of Hsf was examined
in Whole-cell bacterial lysates (WCBL) derived from NmB [Cps-,
PorA+] or NmB [Cps-, PorA+, Hsf+]. Coomassie staining detected a
significant increase in the expression of Hsf (with respect to the
endogenous Hsf level). This result confirms that the modified
pCMK(+)-Hsf vector is functional and can be used successfully to
up-regulate the expression of outer membrane proteins, without
abolishing the production of the major PorA outer membrane protein
antigen.
[0247] Oligonucleotides Used in this Work TABLE-US-00001 Oligo-
nucleotides Sequence Remark(s) Hsf 01-Nde 5'- GGA ATT CCA TAT GAT
GAA CAA NdeI cloning site AAT ATA CCG C-3' Hsf 02-Nhe 5'-GTA GCT
AGC TAG CTT ACC ACT Nhe I cloning site GAT AAC CGA C-3' GFP-mut-Asn
5'-AAC TGC AGA ATT AAT ATG AAA AsnI cloning site GGA GAA GAA CTT
TTC-3' Compatible with NdeI GFP-Spe 5'-GAC ATA CTA GTT TAT TTG TAG
SpeI cloning site AGC TCA TCC ATG-3' Compatible with NheI RP1
(SacII) 5'-TCC CCG CGG GCC GTC TGA ATA SacII cloning site CAT CCC
GTC-3' RP2 5'-CAT ATG GGC TTC CTT TTG TAA ATT TGA GGG CAA ACA CCC
GAT ACG TCT TCA-3' RP3 5'-AGA CGT ATC GGG TGT TTG CCC TCA AAT TTA
CAA AAG GAA GCC CAT ATG-3' RP4(ApaI) 5'-GGG TAT TCC GGG CCC TTC AGA
ApaI cloning site CGG CGC AGC AGG-3'
EXAMPLE 3
Up-Regulation of the N. meningitidis Serogroup B tbpA Gene by
Promoter Replacement
[0248] The aim of the experiment was to replace the endogenous
promoter region of the tbpA gene by the strong porA promoter, in
order to up-regulate the production of the ThpA antigen. For that
purpose, a promoter replacement plasmid was constructed using E.
coli cloning methodologies. A DNA region (731 bp) located upstream
from the tbpA coding sequence was discovered in the private Incyte
PathoSeq data base of the Neisseria meningitidis strain ATCC 13090.
This DNA contains the sequence coding for TbpB antigen. The genes
are organized in an operon. The tbpB gene will be deleted and
replaced by the CmR/porA promoter cassette. For that purpose, a DNA
fragment of 3218 bp corresponding to the 509 bp 5' flanking region
of tbpB gene, the 2139 bp tbpB coding sequence, the 87 bp
intergenic sequence and the 483 first nucleotides of tbpA coding
sequence was PCR amplified from Neisseria meningitidis serogroup B
genomic DNA using oligonucleotides BAD16 (5'-GGC CTA GCT AGC CGT
CTG AAG CGA TTA GAG TIT CAA AAT TTA TTC-3') and BAD17 (5'-GGC CAA
GCT TCA GAC GGC GTT CGA CCG AGT TTG AGC CTT TGC-3') containing
uptake sequences and NheI and HindIII restriction sites
(underlined). This PCR fragment was cleaned with a High Pure Kit
(Boerhinger Mannheim, Germany) and directly cloned in a pGemT
vector (Promega, USA). This plasmid was submitted to circle PCR
mutagenesis (Jones & Winistofer (1992)) in order to (i) insert
suitable restriction sites allowing cloning of a CmR/PorA promoter
cassette and (ii) to delete 209 bp of the 5' flanking sequence of
tbpB and the tbpB coding sequence. The circle PCR was performed
using the BAD 18 (5'-TCC CCC GGG AAG ATC TGG ACG AAA AAT CTC AAG
AAA CCG-3') & the BAD 19 (5'-GGA AGA TCT CCG CTC GAG CAA ATT
TAC AAA AGG AAG CCG ATA TGC AAC AGC AAC ATT TGT TCC G-3')
oligonucleotides containing suitable restriction sites XmaI, BglII
and XhoI (underlined). The CmR/PorA promoter cassette was amplified
from the pUC D15/Omp85 plasmid previously described, using primers
BAD21 (5'-GGA AGA TCT CCG CTC GAG ACA TCG GGC AAA CAC CCG-3') &
BAD20 (5'-TCC CCC GGG AGA TCT CAC TAG TAT TAC CCT GTT ATC CC-3')
containing suitable restriction sites XmaI, SpeI, BglII and XhoI
(underlined). This PCR fragment was cloned in the circle PCR
plasmid. This plasmid will be used to transform Neisseria
meningitidis serogroup B (cps-) and (cps- porA-) strains.
Integration by double crossing-over in the upstream region of tbpA
will direct the insertion of the porA promoter directly upstream of
the tbpA ATG.
EXAMPLE 4
Construction of a N. meningitidis Serogroup B Strain Up-Regulated
for the Expression of Two Antigens: TbpA and Hsf.
[0249] The aim of the experiment was to up-regulate the expression
of ThpA and Hsf simultaneously in the same N. meningitidis
serogroup B strain. The production of TbpA was up-regulated by
replacing its endogenous promoter region by the strong porA
promoter (promoter replacement). In this context, the tbpB gene,
located upstream of tbpA is deleted, and the TbpB protein no longer
present in the outer-membrane. The expression of Hsf was
up-regulated by insertion (homologous recombination) of a second
copy of the corresponding gene at the porA locus (gene delivery).
Both strains have been described in a separate patent referred to
as WO01/09350. The selection markers used in both strategies (CmR
or KanR) allowed the combination of both integrations into the same
chromosome.
[0250] Total genomic DNA was extracted from the recombinant Nm.B
cps-/TbpA+/PorA+ strain by the Qiagen Genomic tip 500-G protocol.
Ten .mu.g of DNA was restricted o/n with DraIII restriction enzyme
and used to transform Neisseria meningitidis serogroup B by the
classical transformation protocol. Cells used for transformation
were either recombinant NmB cps-/Hsf+/PorA+ (homologous
recombination by 1 crossing over into the pora locus) or
recombinant NmB cps-/Hsf+/PorA- (Allelic exchange/homologous
recombination by 2 crossing over into the porA locus). They were
plated over-night on GC agar containing 200 .mu.g/ml kanamycine,
diluted to DO.sub.650=0.1 in GC liquid medium 10 mM MgCl.sub.2, and
incubated 6 hours at 37.degree. C. under vigorous agitation with 10
.mu.g of DraIII restricted genomic DNA. Recombinant Neisseria
meningitidis resulting from a double crossing over event (PCR
screening) were selected on GC medium containing 200 .mu.g/ml
kanamycin and 5 .mu.g/ml chloramphenicol and analyzed for ThpA and
Hsf expression in OMV preparations. As represented in FIG. 1, the
production of both ThpA and Hsf was significantly increased in the
OMV prepared from the ThpA/Hsf recombinant NmB strain when compared
to the OMV prepared from the control NmB cps- strains. The level of
over expression of each protein in the dual recombinant is
comparable with the level of expression obtained in the
corresponding single recombinants. The level of over expression of
TbpA and Hsf was comparable in PorA+ and PorA- strains (data not
shown). All together, these data demonstrate that: (i) expression
of ThpA and Hsf can be jointly and concomitantly up-regulated into
N. meningitidis and (ii) recombinant blebs enriched for TbpA and
Hsf can be obtained and used for immunization.
EXAMPLE 5
Construction of a N. meningitidis Serogroup B Strain Up-Regulated
for the Expression of Two Antigens: ThpA and NspA
[0251] The aim of the experiment was to up-regulate the expression
of ThpA and NspA simultaneously in the same N. meningitidis
serogroup B strain. The production of ThpA was up-regulated by
replacing its endogenous promoter region by the strong porA
promoter (promoter replacement). The expression of NspA was
up-regulated by insertion (homologous recombination) of a second
copy of the corresponding gene at the porA locus (gene delivery).
Both individual strains have been described in a separate patent
WO01/09350. The selection markers used in both strategies (Cm.sup.R
or Kan.sup.R) allowed the combination of both integrations into the
same chromosome. Total genomic DNA was extracted from the
recombinant NmB cps-/TbpA+/PorA+ strain by the Qiagen Genomic tip
500-G protocol. Ten .mu.g of DNA was restricted o/n with AatII
restriction enzyme and used to transform Neisseria meningitidis
seregroup B by the classical transformation protocol. Cells used
for transformation were recombinant NmB cps-/NspA+/PorA-. They were
plated over-night on GC agar containing 200 .mu.g/ml kanamycine,
diluted to DO.sub.650=0.1 in GC liquid medium 10 nM MgCl.sub.2, and
incubated 6 hours at 37.degree. C. under vigorous agitation with 10
.mu.g of AatII restricted genomic DNA. Recombinant Neisseria
meningitidis resulting from a double crossing over event (PCR
screening) were selected on GC medium containing 200 .mu.g/ml
kanamycine and 5 .mu.g/ml chloramphenicol and analyzed for TbpA and
NspA expression in OMV preparations. The production of both ThpA
and NspA was significantly increased in the OMV prepared from the
ThpA/NspA recombinant NinB strain when compared to the OMV prepared
from the control NinB cps- strains. The level of over-expression of
each protein in the dual recombinant is comparable with the level
of expression obtained in the corresponding single recombinants.
All together, these data demonstrate that: (i) expression of TbpA
and NspA can be jointly and concomitantly up-regulated into N.
meningitidis and (ii) recombinant blebs enriched for ThpA and NspA
can be obtained and used for immunization.
EXAMPLE 6
Construction of a N. meningitidis Serogroup B Strain Up-Regulated
for the Expression of Two Antigens: NspA and D15/Omp85
[0252] The aim of the experiment was to up-regulate the expression
of NspA and D15/Omp85 simultaneously in the same N. meningitidis
serogroup B strain. The production of D15/Omp85 was up-regulated by
replacing its endogenous promoter region by the strong porA
promoter (promoter replacement). The expression of NspA was
up-regulated by insertion (homologous recombination) of a second
copy of the corresponding gene at the porA locus (gene delivery).
Both strains have been described in a separate patent WO01/09350.
The selection markers used in both strategies (Cm.sup.R or
Kan.sup.R) allowed the combination of both integrations into the
same chromosome.
[0253] Total genomic DNA was extracted from the recombinant NmB
cps-/D15-Omp85/PorA+ strain by the Qiagen Genomic tip 500-G
protocol. Ten .mu.g of DNA was restricted o/n with AatII
restriction enzyme and used to transform Neisseria meningitidis
seregroup B by the classical transformation protocol. Cells used
for transformation were recombinant NmB cps-/NspA+/PorA-. They were
plated o/n on GC agar containing 200 .mu.g/ml kanamycine, diluted
to DO.sub.650=0.1 in GC liquid medium 10 mM MgCl.sub.2, and
incubated 6 hours at 37.degree. C. under vigorous agitation with 10
.mu.g of AatII restricted genomic DNA. Recombinant Neisseria
meningitidis resulting from a double crossing over event (PCR
screening) were selected on GC medium containing 200 .mu.g/ml
kanamycine and 5 .mu.g/ml chloramphenicol and analyzed for NspA and
D15/Omp85 expression in OMV preparations. The production of both
NspA and D15/Omp85 was significantly increased in the OMV prepared
from the NspA/D15-Omp85 recombinant NmB strain when compared to the
OMV prepared from the control NmB cps- strains. The level of over
expression of each proteins in the dual recombinant is comparable
with the level of expression obtained in the corresponding single
recombinants. All together, these data demonstrate that: (i)
expression of NspA and Omp85 can be jointly and concomitantly
up-regulated into N. meningitidis and (ii) recombinant blebs
enriched for NspA and Omp85 can be obtained and used for
immunization.
EXAMPLE 7
Production and Purification of Recombinant Hsf Forms in E. coli
[0254] Computer analysis of the Hsf-like protein from Neisseria
meningitidis reveals at least four structural domains. Considering
the Hsf sequence from strain H44/76 as a reference, Domain 1,
comprising amino-acid 1 to 51, encodes a sec-dependant signal
peptide characteristic of the auto-transporter family, Domain 2,
comprising amino-acids 52 to 473, encode the passenger domain
likely to be surface exposed and accessible to the immune system,
Domain 3, comprising amino-acids 474 to 534, encodes a putative
coiled-coil domain required for protein oligomerisation and a hinge
(neck), Domain 4, comprising residues 535 to the C-terminus, is
predicted to encode a beta-strands likely to assemble into a
barrel-like structure and to be anchored into the outer-membrane
(Henderson et al. (1998), Trends Microbiol. 6: 370-378; Hoiczyk et
al. (2000), EMBO 22: 5989-5999). Since domains 2 and 3 are likely
to be surface-exposed, are well conserved (more than 80% in all
strain tested; as described in Pizza et al. (2000), Science 287:
1816-1820), they represent interesting vaccine candidates. For that
purpose, domain 2 (referred to as Hsf passenger domain) and domain
2+3 (referred to as Hsf neck+coiled-coil domain) were expressed in
and purified from E. coli. DNA fragments encoding amino-acids
52-473 (Hsf passenger) and 52-534 (Hsf n+cc) were PCR amplified
using oligonucleotides adding terminal RcaI (forward primer) and
XhoI (reverse primer) restriction sites. Purified amplicons were
digested with RcaI/XhoI in the conditions recommended by the
supplier, and were subsequently cloned into the NcoI (compatible
with rcaI)/XhoI sites of the pET24d (Novagen Inc., Madison Wis.) E.
coli expression vector. Recombinant plasmids were selected and used
to prepare purified recombinant plasmids. For expression study,
these vectors (pET-Hsf pas & pET-Hsf ncc) were introduced into
the Escherichia coli strain B121DE3 (Novagen), in which, the gene
for the T7 polymerase is placed under the control of the
isopropyl-beta-D thiogalactoside (IPTG)-regulatable lac promoter.
Liquid cultures (700 ml) of the Novablue (DE3) [pET-24b/BASB029] E.
coli recombinant strain were grown at 37.degree. C. under agitation
until the optical density at 600 nm (OD600) reached 0.6. At that
time-point, IPTG was added at a final concentration of 1 mM and the
culture was grown for 4 additional hours. The culture was then
centrifuged at 10,000 rpm and the pellet was frozen at -20.degree.
C. for at least 10 hours. After thawing, the pellet (680 ml
culture) was resuspended during 30 minutes at 22.degree. C. in 20
mM phosphate buffer pH 7.0 prior cell lysis by two passes through a
Rannie disruptor. Lysed cells were pelleted 30 min at 15,000 rpm
(Beckman J2-HS centrifuge, JA-20 rotor) at 4.degree. C. The
supernatant was loaded on a Q-Sepharose fast flow column
(Pharmacia) equilibrated in 20 mM Tris-HCl buffer ph 8.0. After
passage of the flowthrough, the column was washed with 5 column
volumes of 20 mM Tris-HCl buffer pH 8.0. The recombinant protein
was eluted from the column by 250 mM NaCl in 20 mM Tris-HCl buffer
pH 8.0. Antigen positive fractions were pooled and dialyzed
overnight against 20 mM phosphate buffer pH 7.0. 0.5M NaCl and 20
mM Imidazole were added to the dialyzed sample. Sample was then
applied onto Ni-NTA Agarose column (Qiagen) equilibrated in 20 mM
phosphate buffer pH 7.0 containing 500 mM NaCl and 20 mM Imidazole.
After passage of the flowthrough, the column was washed with 5
column volumes of 20 mM phosphate buffer pH 7.0 containing 500 mM
NaCl and 20 mM Imidazole. Contaminants were eluted by 100 mM
Imidazole in 20 mM phosphate buffer pH 7.0. The recombinant protein
was eluted from the column by 250 mM Imidazole in 20 mM phosphate
buffer pH 7.0. Antigen positive fractions were pooled and dialyzed
versus 10 mM phosphate buffer pH 6.8 containing 150 mM NaCl. As
shown in FIG. 2, an enriched (purity estimated to more than 90%
pure in CBB stained SDS-PAGE) Hsf-like passenger protein, migrating
at around 47 kDa (estimated relative molecular mass), was eluted
from the column. This polypeptide was reactive against a mouse
monoclonal antibody raised against the 5-histidine motif. Taken
together, these data indicate that the both Hsf passenger and Hsf
ncc gene can be expressed and purified under a recombinant form in
E. coli.
EXAMPLE 8
Production and Purification of Recombinant Hap Passenger in E.
coli
[0255] Computer analysis of the Hap-like protein from Neisseria
meningitidis reveals at least three structural domains. Considering
the Hap-like sequence from strain H44/76 as a reference, Domain 1,
comprising amino-acid 1 to 42, encodes a sec-dependant signal
peptide characteristic of the auto-transporter family, Domain 2,
comprising amino-acids 43 to 950, encode the passenger domain
likely to be surface exposed and accessible to the immune system,
Domain 3 comprising residues 951 to the C-terminus (1457), is
predicted to encode a beta-strands likely to assemble into a
barrel-like structure and to be anchored into the outer-membrane.
Since domains 2 is likely to be surface-exposed, well conserved
(more than 80% in all strain tested) and could be produced as
subunit antigens in E. coli, it represents an interesting vaccine
candidates. Since domains 2 and 3 are likely to be surface-exposed,
are well conserved (more than 80% in all strain tested; as
described in Pizza et al. (2000), Science 287: 1816-1820), they
represent interesting vaccine candidates. For that purpose, domain
2 (referred to as Hap passenger domain was expressed in and
purified from E. coli. A DNA fragment encoding amino-acids 43-950
(Hap passenger) was PCR amplified using oligonucleotides adding
terminal NcoI (forward primer) and XhoI (reverse primer)
restriction sites. Purified amplicons were digested with NcoI/XhoI
in the conditions recommended by the supplier, and were
subsequently cloned into the NcoI/XhoI sites of the pET24d (Novagen
Inc., Madison Wis.) E. coli expression vector. Recombinant plasmids
were selected and purified to large scale. For expression study,
these vectors (pET-Hap pass) were introduced into the Escherichia
coli strain B121DE3 (Novagen), in which, the gene for the T7
polymerase is placed under the control of the isopropyl-beta-D
thiogalactoside (IPTG)-regulatable lac promoter.
[0256] Cultivation of E. coli BL21[pET-Hap pass] in fermentor: An
aliquote fraction (100 .mu.l) from the master seed was spread on
FEC013AA plates (Soja peptone A3 20 g/L, yeast extract 5 g/L, NaCl
5 g/L, Agar 18 g/L, distillated H2O up to 1 L) and grown 20 hours
at 37.degree. C. The bacterial lawn was harvested and resuspended
in sterile water containing NaCl 0.9%. This solution was used to
inoculate a 20 L fermentor used in the batch mode in FEC011AC
medium (Soja peptone 24 g/L, Yeast extract 48 g/L, MgSO4/7H2O 0.5
g/L, K2HPO4 2 g/L, NaH2PO4/2H2O 0.45 g/L, Glycerol (87%) 40 g and
distilated H.sub.2O up to 1 L). Temperature (30.degree. C.), pH
(6.8, NaOH 25%/H.sub.H.sub.3PO.sub.4 25%), pressure (500 mbar),
were maintained constant and aeration was set to 20 L/min. In these
conditions dissolved oxygen pressure was maitained to 20% by tuning
agitation (100 to 1000 rpm). Inducer (IPTG, 1 mM) was added after 8
hours of growth (OD=27.8). Samples (6L) were collected after 6
hours (OD=49.2) and 16H30 (OD=48.6), biomass was harvested by
centrifugation and corresponding pellets stored at -20.degree.
C.
Purification of Hap Passenger:
[0257] HAP passenger was purified from a fermentor in batch mode. A
purification scheme was developed (see below). ##STR1## The
majority of Hap passenger is recovered in the centrifugation pellet
after cell breakage. Solubilization was made possible by 8M urea.
Despite N-term His-tail, IMAC was not operative as 1 st step, but
well after a first step on SP-XL cation-exchanger. On this
SP-Sepharose-XL, the protein is eluted quantitatively in the middle
of a linear NaCl (0-250 mM) gradient. IMAC was done with
Cu.sup.++-loaded Chelating Sepharose FF, as for FiAb. This time,
contrary to FHAb, IMAC shows a significant purification factor. On
SDS-PAGE, HAP2/3 seems pure after IMAC. The HAP2/3 peak was however
very broad on 0-200 mM imidazole gradient, so we tried elution by
imidazole steps (10 mM-100 mM); gradient mode seems however more
efficient in terms of purity. As final step, we tried the
urea-to-arginine buffer exchange by gel permeation however in this
case the protein eluted on two peaks. These two peaks show a
comparable profile on SDS-PAGE; so it can be hypothetized that it
is due to a partial refolding of HAP passenger. We then went back
to the classical dialysis as final step for buffer exchange.
SDS-PAGE analysis shows good purity of the final material (see in
FIG. 3). HAP passneger purity is further confirmed by WB anti-his.
It is recognized by anti-E. coli. A Molecular weight of 96.1 KD is
found.
EXAMPLE 9
Production and Purification of Recombinant FrpA/C Forms in E.
coli
[0258] Neisseria meningitidis encodes two RTX proteins, referred to
as FrpA & FrpC secreted upon iron limitation (Thompson et al.,
(1993) J. Bacteriol. 175:811-818; Thompson et al., (1993) Infect.
Immun. 61:2906-2911). The RTX (Repeat ToXin) protein family have in
common a series of 9 amino acid repeat near their C-termini with
the consensus: Leu Xaa Gly Gly Xaa Gly (Asn/Asp) Asp Xaa.
(LXGGXGN.sub./DDX). The repeats in E. coli HlyA are thought to be
the site of Ca2+ binding. As represented in FIG. 4, meningococcal
FrpA and FrpC proteins, as characterized in strain FAM20, share
extensive amino-acid similarity in their central and C-terminal
regions but very limited similarity (if any) at the N-terminus.
Moreover, the region conserved between FrpA and FrpC exhibit some
polymorphism due to repetition (13 times in FrpA and 43 times in
FrpC) of a 9 amino acid motif. To evaluate the vaccine potential of
FrpA & FrpC, we produced recombinantly in E. coli protein
regions conserved between FrpA and FrpC. For that purpose, a DNA
segment covering aminoacids 277 to 1007 (with regard to the N.
meningitidis FAM20 peptide sequence) was PCR amplified from the N.
meningitidis serogroupB H44/76 genome using forward primers FrpA-19
(5'-CTCGAGACCATGGGCAAA TATCATGTCTACGACCCCCTCGC-3') and reverse
primer FrpA-18 (3'-GTG
CATAGTGTCAGAGTTTTTGTCGACGTCGTAATTATAGACC-3'). Three amplicons of
respectively .about.1530 bp (3 repeats), 2130 bp (13 repeats) and
2732 bp (23 repeats) were obtained and digested with NcoI and SalI
restriction endonucleases. These fragments were then inserted into
the NcoI/XhoI (compatible with SalI) sites of pET24d and
recombinant plasmids (pET-Frp3, pET-Frp13 and pET-Frp23
respectively) were selected and used to transform E. coli BL21DE3
cells. As represented in FIG. 5, all three constructs produced
recombinant FrpA/C conserved domains upon induction. Moreover,
increasing the number of repeats increased the solubility of the
recombinant protein, as determined by cell fractionation analysis
(data not shown).
[0259] Purification of FrpA/C conserved domain containing 23
repeats of the nonapeptide LXGGXGN/DDX (911 aa in total): 3.5
liters of E. coli B121DE3[pET-Frp23] were cultivated and induced
for 4 hours by addition of 2 mM IPTG when OD reached 0.6. Cell were
harvested by centrifugation and the correspondeing pellet was
pressure-disrupted, clarified by centrifugation and the
corresponding supernatent loaded on a Ni2+-ion metal affinity
column (Ni-NTA-agarose, Qiagen GmBh). Imidazole ( ) was used for
elution and was finally removed by the extensive dialysis against
10 mM Na phosphate pH6.8, 150 mM NaCl.
EXAMPLE 10
Production and Purification of Recombinant FHA Forms in E. coli
Cloning of a Truncated FhaB from N. meningitidis
[0260] Genomic DNA was extracted from from 10.sup.10 cells of N.
meningitidis serogroup B strain H44/76 using the QIAGEN genomic DNA
extraction kit (Qiagen Gmbh). This material (1 .mu.g) was then
submitted to Polymerase Chain Reaction DNA amplification using the
following primers specific of the FhaB gene: JKP: 5'AAT GGA ATA CAT
ATG AAT AAA GGT TTA CAT CGC ATT ATC3' and 57JKP 5'CCA ACT AGT GTT
TTT CGC TAC TTG GAG CTG T3'. A DNA fragment of about 4200 bp,
encoding the first 1433 N-terminal amino acids of the protein, was
obtained, digested by the NdeI/SpeI restriction endonucleases and
inserted into the corresponding sites of the pMG MCS (pMG
derivative, Proc Natl Acad Sci USA 1985 January; 82(1):88-92) using
standard molecular biology techniques (Molecular Cloning, a
Laboratory Manual, Second Edition, Eds: Sambrook, Fritsch &
Maniatis, Cold Spring Harbor press 1989).). The DNA sequence of the
cloned FhaB fragment was determined using the Big Dye Cycle
Sequencing kit (Perkin-Elmer) and an ABI 373A/PRISM DNA sequencer
(see FIG. 1). The recombinant pMG-FhaB plasmid (1 .mu.g) was then
submitted to Polymerase Chain Reaction DNA amplification using
primers specific FhaB (XJKP03
5'AATGGAATACATATGAATAAAGGTTTACATCGCATTATCTTTAG3' and XJKP5702
5'GGGGCCACTCGAGGTTTTTCGCTACTTGGAGCTGTTTCAG ATAGG3'). A 4214 bp DNA
fragment was obtained, digested by the NdeI/XhoI restriction
endonucleases and inserted into the corresponding sites of the
pET-24b cloning/expression vector (Novagen) using standard
molecular biology techniques (Molecular Cloning, a Laboratory
Manual, Second Edition, Eds: Sambrook, Fritsch & Maniatis, Cold
Spring Harbor press 1989). Confirmatory sequencing of the
recombinant pET-24b containing the truncated FhaB (pET24b/FhaB2/3 )
was performed using using the Big Dyes kit (Applied biosystems) and
analysis on a ABI 373/A DNA sequencer in the conditions described
by the supplier. The resulting nucleotide sequence is presentedin
FIG. 6.
Expression and Purification of Recombinant Truncated FhaB Protein
in Escherichia coli
[0261] The construction of the pET24b/FhaB2/3 cloning/expression
vector was described above. This vector harbours the truncated FhaB
gene isolated from the strain H44/76 in fusion with a stretch of 6
Histidine residues (at the C-terminus of the recombinant product),
placed under the control of the strong bacteriophage T7 gene 10
promoter. For expression study, this vector was introduced into the
Escherichia coli strain Novablue (DE3) (Novagen), in which, the
gene for the T7 polymerase is placed under the control of the
isopropyl-beta-D thiogalactoside (IPTG)-regulatable lac promoter.
Liquid cultures (100 ml) of the Novablue (DE3) [pET24b/FhaB2/3 ] E.
coli recombinant strain were grown at 37.degree. C. under agitation
until the optical density at 600 nm (OD600) reached 0.6. At that
time-point, IPTG was added at a final concentration of 1 mM and the
culture was grown for 4 additional hours. The culture was then
centrifuged at 10,000 rpm and the pellet was frozen at -20.degree.
C. for at least 10 hours. After thawing, the pellet was resuspended
during 30 min at 25.degree. C. in buffer A (6M guanidine
hydrochloride, 0.1M NaH2PO4, 0.01M Tris, pH 8.0), passed
three-times through a needle and clarified by centrifugation (20000
rpm, 15 min). The sample was then loaded at a flow-rate of 1 ml/min
on a Ni2+-loaded Hitrap column (Pharmacia Biotech). After passsage
of the flowthrough, the column was washed succesively with 40 ml of
buffer B (8M Urea, 0.1MNaH2PO4, 0.01M Tris, pH 8.0), 40 ml of
buffer C (8M Urea, 0.1MNaH2PO4, 0.01M Tris, pH 6.3). The
recombinant protein FhaB2/3 /His6 was then eluted from the column
with 30 ml of buffer D (8M Urea, 0.1MNaH2PO4, 0.01M Tris, pH 6.3)
containing 500 mM of imidazole and 3 ml-size fractions were
collected. As presented in FIG. 7, a highly enriched FhaB-2/3 /His6
protein, migrating at around 154 kDa (estimated relative molecular
mass), was eluted from the column. This polypeptide was reactive
against a mouse monoclonal antibody raised against the 5-histidine
motif Taken together, these data indicate that the FhaB2/3 can be
expressed and purified under a recombinant form in E. coli.
Immunization of Mice with Recombinant FhaB2/3 /His
[0262] Partially purified recombinant FhaB2/3 /His6 protein
expressed in E. coli was injected three times in Balb/C mice on
days 0, 14 and 29 (10 animals/group). Animals were injected by the
subcutaneous route with around 5 .mu.g of antigen in two different
formulations: either adsorbed on 100 .mu.g AlPO.sub.4 or formulated
in SBAS2 emulsion (SB62 emulsion containing 5 .mu.g MPL and 5 .mu.g
QS21 per dose). A negative control group consisting of mice
immunized with the SBAS2 emulsion only has also been added in the
experiment. Mice were bled on days 29 (15 days Post II) and 35 (6
days Post III) in order to detect specific anti-FhaB antibodies.
Specific anti-FhaB antibodies were measured on pooled sera (from 10
mice/group) by ELISA on purified recombinant FhaB2/3/His.
EXAMPLE 11
Adhesion Blocking Activities of Mouse and Rabbit Sera Raised
Against FHA Hap and Hsf Antigens
[0263] Proteins homologous to the meningococcal FHAB-like, Hsf-like
and Hap-like have been described previously to be important
virulence determinant and to mediate bacterial adhesion of
Bordetella pertussis (FHA) and Haemophilus influenzae (Hap and
Hsf). Adhesion to epithelial and endothelial cells is known to be
crucial for colonization of the nasopharynges and crossing of the
blood-brain barrier by the meningococcus. Thus interfering with the
adhesion of N. meningitidis represent a valuable approach to
controle meningococcal colonization and infection. Here we tested
if anti-sera directed against the meningococcal FHAB 2/3.sup.rd,
Hap-like and Hsf-like antigens were able to interfer the adhesion
of Neisseria meningitidis to endothelial cells. The following
experimental procedure was used:
[0264] Inhibition of adhesion to RUVEC's: the meningococcal test
strain used in this study was a non-capsulated, non-piliated, Opa-
and Opc- derivative of strain NmA8013. Meningococcal cells (2.10E5
colony forming units (CFU) of the NmA8013 derivative) were
incubated during 30 minutes at 37.degree. C. in a medium composed
of 400 .mu.l of RPMI, 50 .mu.l of fetale bovine serum and 50 .mu.l
of the serum to be tested for adhesion blocking properties. This
mixture was then placed in a well containing confluent monolayers
of human umbilical vein endothelial cells (HUVEC's) whose culture
medium has been previously removed. Bacteria and HUVEC's cells were
incubated during 4 hours at 37.degree. C., under 5% CO2. Cell
monolayers were then washed three times with fresh RPMI serum and
subsequently scrapped off the plate. CFU associated to HUVEC's
cells was then determined serial dilution and plating of the cell
lysate onto GC plates. Plates were incubated during 48 hours at
37.degree. C. to allow the recovery and growth of cell-associated
meningococci.
[0265] Adhesion-blocking activities of mouse and rabbit sera raised
against recombinant FHAB2/3.sup.rd, Hap & hsf antigens:
anti-FHA 2/3 , anti-Hsf full-length (described in WO99/58683) and
anti-Hap full-length (WO99/55873) antibodies, as well as anti-sera
directed against corresponding Hsf & Hap passenger domains,
interfere with meningococcal adhesion to endothelial HUVEC's cells.
FIG. 8 illustrates that specific antibodies induced by FHA 2/3
formulated in AlPO4 was able to inhibit Neisseria meninitidis B
adhesion to the HUVEC cells compared to the adjuvant only. When
compared to the SBAS2 adjuvant only (without antigen, group 4), the
anti-FHA 2/3 abs (SBAS2 formulation) is still effective, but less
potent than AlPO4. The SBAS2 adjuvant only (without antigen) does
not induce antibodies able to interfere with the adhesion. Compared
to group 4, anti-Hap antibodies (group 1) may have a slight
inhibition effect. In group 5, when a mixture of anti-FHA 2/3,
anti-Hsf and anti-Hap antibodies is tested, inhibition of the
adhesion is stronger than with anti-FHA 2/3 only, suggesting a
synergetic effect given by anti-Hap and anti-Hsf antibodies. In a
second inhibition experiment (FIG. 2), a specific rabbit antiserum
directed against anti OMVs over-expressing Hsf (as a candidate
protein) was able to inhibit partially the fixation of Neisseria
meningitidis B to the endothelial cells compared to the negative
control (group 3 vs 4). This rabbit antiserum has been demonstrated
to contain a very high specific anti-Hsf antibody titer. Antibodies
against rec Hsf (Hsf passenger and Hsf full length) are also able
to inhibit adhesion of bacteria on the HUVEC cells. This is true
both with mice sera (groups 5-6) as well as with rabbit sera (in a
laser extend) (groups 7-8). In this second experiment, specific
anti-rec FHA 2/3 antibodies (group 1) already tested in the first
experiment confirm their very high inhibitory effect. These results
indicate that these specific antigens (Hap, FHA2/3 and Hsf),
isolated or in combination, are interesting vaccine antigens.
EXAMPLE 12
Protective Effect of Recombinant OMV's in the Mouse Challenge
Model
[0266] Several recombinant OMVs have been evaluated in Balb/C mice
for their protective effect after lethal challenge. This active
immunisation model involved intraperitoneal injection of
meningococci from several strains (suspended in iron depleted TSB
medium) into adult Balb/C or OF1 mice (6-8 weeks old), after a
series of immunization by the subcutaneous route. The iron dextran,
used as an external iron source seems to be needed to maintain
bacteraemia and induce mortality in infected animal. Although this
IP model in mice has been shown to be effective for assessing
virulence, immune protection and the role of iron in infection,
they do not incorporate the pharyngeal carriage phase, which
precedes bacteraemia and meningitis in humans. This model has been
used to screen our several OMV candidates over-expressing NspA,
ThpA, or Hsf. In the following experiments, Balb/C (inbred) or OF 1
(outbred) mice were immunized three times on days 0, 14 and 28 by
the subcutaneous route with 3 (PV00N049) to 5 .mu.g (PV00N035 and
PV00N043 experiments) of rec. OMV over-expressing Hsf, NspA or ThpA
formulated on Al(OH).sub.3 (100 .mu.g Al(OH).sub.3/animal)
(PV00N035 and PV00N043) or on Al PO.sub.4 (100 .mu.g Al
PO.sub.4/animal). Then, animals are bled on days 28 (day 14 past
II) and 35 (day 7 past III) for specific Ab evaluation. On day 35,
10 mg of iron dextran are injected intraperitaneally one hour
before the challenge. The challenges were done with H44/76
(B:15:P1.7,16) or CU-385 (B:4:P1.19,15) strains, with around 1.10
e7 CFU/animal (see the table of results for the exact challenge
doses). The heterologous strain done with the CU-385 strain is more
stringent than when using the homologous strain. Mortalities were
recorded from days 1 to 5. The table 1 hereafter illustrates that
when compared to OMV porA (-) and with OMV porA (+) in a lesser
extend, there is already a better protection observed with OMV TbpA
(+) (1/10 and 3/5 for porA(-) and 9/10 and 3/5 for porA (+)), with
OMV NspA (+) (4/10 and 4/5) and with OMV Hsf (+) (3/10, 2/10 and
3/5). This is the global observation we can make in these three
experiments. These data support that ThpA, Hsf and NspA antigens,
expressed at the bleb surface, are of interest for a future menB
vaccine. TABLE-US-00002 TABLE 1 Protective activity in the mouse
model of recombinant outer-membrane vesicles. The table summarizes
the results obtained during three experiments (PV00N35, PV00N043
& PV00N049) OMVs (blebs) Survival rate (on day Active mouse
protection PV00N035 PV00N043 PV00N049 in OF1 mice in Balb/C mice in
OF1 mice Immuno Challenge strain (+ Specific Abs Rec OMVs H44/76
H44/76 CU-385 by Elisa (H44/76 background = porA (B:15:P1.7,
(B:15:P1.7, (B:4:P1.19, 1 Mean - PV00N049 P1.17, 16) 1.27 1.0 1.1
only OMV porA(-) 1/10 0/10 1/5 / OMV porA(+) 2/10 9/10 4/5 / OMV
TbpA porA(+) NT 9/10 3/5 < OMV TbpA porA (-) NT 1/10 3/5 <
OMV NspA porA (-) 1/10 4/10 4/5 155 - (< OMV Hsf PorA(-) 3/10
2/10 3/5 7802 - (5496) OMV Hsf PorA(+) NT 9/9 NT / No antigen 0/10
0/10 1/5 / NT: Not tested.
EXAMPLE 13
Protective Effect of Recombinant Subunit Antigens in the Mouse
Challenge Model
[0267] Several recombinant purified proteins have been evaluated in
Balb/C mice for their protective effect after lethal challenge.
This active immunization model involved introperitoneal injection
of meningococci from several strains (suspended in iron depleted
TSB medium) into adult Balb/C or OF 1 mice (6-8 weeks old) after a
series of immunization by the subcutaneous route.
[0268] The iron dextran, used as an external iron source seems to
be needed to maintain bacteraemia and induce mortality in infected
animal. Although this IP model in mice has been shown to be
effective for assessing virulence, immune protection and the role
of iron in infection, they do not incorporate the pharyngeal
carriage phase, which precedes bacteraemia and meningitis in
humans. This model has been used to screen several menB sub-unit
vaccine candidates like recombinant FrpC, ThpA, FHA2/3 and Hap
molecules.
[0269] In this experiment, OF 1 (outbred) mice were immunized three
times on days 0, 14 and 28 by the subcutaneous route with 5 .mu.g
(PV00N050) of these proteins formulated on Al PO.sub.4 (100 .mu.g)
in presence of 10 .mu.g MPL (per animal).
[0270] Then, animals are bled on days 28 (day 14 past II) and 35
(day 7 past III) for specific Ab evaluation, while they are
challenged on day 35. The day of challenge, 10 mg of iron dextran
are injected intraperitaneally one hour before the challenge. The
challenges were done with CU-385 strains (B:4:P1.19,15), which is
heterologous in this case, indeed, the antigens sequence coming
from the H44/76 (B:15:P1.7,16), except for the TbpA for which the
sequence comes from the B16B6 strain (B:2a:P1.2).
[0271] The results illustrated in table 2 indicate that FrpC, ThpA,
FHAB2/3.sup.rd, Hap induced significant protection in this model:
from 2 to 4 out of 5 mice survived after challenge, compared to
only 1/5 with the adjuvant only. In all groups but one, the
specific antibody titer were high (specific anti-ThpA titer was
moderate). All these data support that FrpC, FrpA, FrpA/C conserved
domain, ThpA, FHAB2/3.sup.rd, Hap presented as sub-unit antigens,
isolated or in combination, are of interest for the development of
a menB vaccine. TABLE-US-00003 TABLE 2 Protective activity in the
mouse model of recombinant outer-membrane vesicles. The table
summarizes the results obtained during one experiment (PV00N050).
Sub-unit antigens Survival rate (on day 5) Active mouse protection
model PV00N050 (in OF1 mice) Rec sub-unit Challenge strain (+ dose)
Immuno Antigens CU-385 Specific Abs (from H44/76 (B:4:P1.19, 15) by
Elisa Ag sequence) 1.4 10e7 Mean - (GMT) FrpC Ca2++ treated 3/5
31477 - (27068) FHAB 2/3 refolded 2/5 98200 - (73220) FHAB 2/3 non
refolded 3/5 55939 - (35347) Hap N-ter 4/5 9960 - (12811) recTbpA
on SBAS4 3/5 875 - (520) SBAS4 1/5 /
EXAMPLE 14
Method to Show Synergetic Effect of Vaccine Antigens
Combinations
[0272] Different recombinant OMVs available (OMVs porA (+)
rmp-LbpB, OMVs porA (-) ThpA (+) Hsf (+), OMVs porA (-) ThpA (+),
OMVs porA (-) NspA (+), OMVs porA (-) Hsf (+), OMVs porA (-) TbpA
(+) NspA (+)) can be tested alone or in combination to determine
statistically the best combinations, in terms of detecting a
synergetic effect of such combinations of vaccine candidates. This
work can also be performed with combinations of subunit antigens,
as well as combination of subunit antigens+recombinant OMV's. 32
groups of 50 .mu.l mice/group can be injected and tested for serum
bactericidal & opsonic activity, active and passive protection
in the mouse model (if need be using suboptimal amounts of
individual antigens). An indication of synergistic antigen
combinations is if the level of protective conferred after combined
immunization is higher that the sum of individual antigens.
EXAMPLE 15
Analysis of Hsf and ThpA Content of Outer Membrane Vesicles
Coommassie Blue Stained SDS-PAGE
[0273] 15 .mu.g of protein in outer membrane vesicle preparations
with up-regulation of Hsf or ThpA or both Hsf and ThpA, were
diluted in a sample buffer containing .beta.-mercaptoethanol and
heated at 95.degree. C. for 10 minutes. The samples were then run
on SDS-PAGE polyacrylamide gel (Novex 4-20% Tris-glycine 1.5 mm
2Dwell SDS Page), stained in Coomassie blue for one hour and
destained in several washes of destain. Results are shown in FIG.
9, which shows that the level of Hsf and ThpA are considerably
higher in outer membrane vesicle preparations, derived from N.
meningitidis where their level of expression had been enhanced.
EXAMPLE 16
Immunogenicity of OMVs with Upregulation of Hsf and/or ThpA
[0274] Groups of 20 mice were immunised three times with OMV by the
intramuscular route on days 0, 21 and 28. Each innoculation was
made up of 5 .mu.g (protein content) of OMVs formulated on AlPO4
with MPL. The OMVs were derived from N. meningitidis strain H44/76,
engineered so that capsular polysaccharides and PorA were down
regulated. A comparison was made of OMVs in which Hsf, TbpA, both
Hsf and ThpA or neither were upregulated. On day 41, blood samples
were taken for analysis by ELISA or by serum bactericidal
assay.
ELISA to Detect Antibodies Against Hsf
[0275] 96 well microplates (Nunc, Maxisorb) were coated overnight
at 4.degree. C. with 100 .mu.l of 1 .mu.g/ml of specific antigen in
PBS. After washing with NaCl 150 mM Tween 20 0.05%, plates were
saturated with 100 .mu.l of PBS-BSA 1% under shaking at room
temperature for 30 minutes. Between each step (performed under
shaking at room temperature during 30 min and with PBS-BSA 0.2% as
diluant buffer), reagents in excess were removed by washing with
NaCl-Tween 20. One hundred micro-liters of diluted serum samples
were added per micro-well. Bound antibodies were recognized by a
biotinylated anti-mouse Ig (Prosan) (1/2000). The antigen-antibody
complex was revealed by incubation with streptavidin-biotinylated
peroxidase conjugate (Amersham) (1/4000).
OrthoPhenileneDiamine/H.sub.2O.sub.2 (4 mg/10 ml citrate buffer
0.1M pH 4.5+51 .mu.l H.sub.2O.sub.2) is used to reveal the assay.
Plates were incubated for 15 min at room temperature in the dark
before stoping the reaction by addition of 50 .mu.l of 1N HCl. The
absorbance was read at 490 nm. TABLE-US-00004 Titre Mid-Point (on
pooled sera) g1, blebs TbpA-HSF, IM 15471 g2, blebs TbpA, IM 15.41
g3, blebs HSF, IM 14508 g4, blebs CPS(-)PorA(-), IM -- g5,
MPL/AIPO4, IM --
[0276] The results shown in the table above, show that high and
equivalent antibody titres against Hsf were raised by immunisation
with OMVs with upregulation of Hsf or both Hsf and ThpA. Virtually
no antibody against Hsf could be detected in sera raised after
inoculation with adjuvant alone or OMV in which neither Hsf nor
ThpA had been upregulated or OMV in which only ThpA had been
upregulated.
EXAMPLE 17
Serum Bactericidal Activity of Antisera Raised Against OMVs with
Up-Regulation of Hsf and/or ThpA
[0277] The serum bactericidal activity of antisera from the mice
inoculated with OMVs with upregulation of Hsf, ThpA, both Hsf and
TbpA or without upregulation were compared in assays using either
the homologous strain H44/76 or the heterologous strain Cu385. The
serum bactericidal assay has been shown to show good correlation
with the protection and is therefore a good indication of how
effective a candidate composition will be in eliciting a protective
immune response.
[0278] Neisseria meningitidis serogroup B wild type strains (H44/76
strain=B:15 P1.7,16 L3,7,9 and CU385 strain=B: 4 P1.19,15 L3,7,9)
were cultured overnight on MH+1% Polyvitex+1% horse serum Petri
dishes at 37.degree. C.+5% CO.sub.2. They were sub-cultured for 3
hours in a liquid TSB medium supplemented with 50 .mu.M of Desferal
(Iron chelator) at 37.degree. C. under shaking to reach an optical
density of approximately 0.5 at 470 nm.
[0279] Pooled or individual serum were inactivated for 40 min at
56.degree. C. Serum samples were diluted 1/100 in HBSS-BSA 0.3% and
then serially diluted two fold (8 dilutions) in a volume of 50
.mu.l in round bottom microplates.
[0280] Bacteria, at the appropriate OD, were diluted in HBSS-BSA
0.3% to yield 1.3 10e4 CFU per ml. 37.5 .mu.l of this dilution was
added to the serum dilutions and microplates were incubated for 15
minutes at 37.degree. C. under shaking. Then, 12.5 .mu.l of rabbit
complement were added to each well. After 1 hour of incubation at
37.degree. C. and under shaking, the microplates were placed on ice
to stop the killing.
[0281] Using the tilt method, 20 .mu.l of each well were platted on
MH+1% Polyvitex+1% horse serum Petri dishes and incubated overnight
at 37.degree. C+CO.sub.2. The CFU's were counted and the percent of
killing calculated. The serum bactericidal titer is the last
dilution yielding .gtoreq.50% killing. TABLE-US-00005 H44/76 CU385
OMV GMT % responders GMT % responders CPS(-) PorA (-) 93 30% 58 5%
CPS(-) PorA (-) 158 40% 108 20% Hsf CPS(-) PorA (-) 327 60% 147 30%
TbpA CPS(-) PorA (-) Hsf - 3355 100% 1174 80% TbpA
[0282] Similar results to those shown in the above table were
obtained in two other similar experiments.
[0283] A dramatic increase in the bactericidal titres (GMT) against
the homologous strain and a heterologous strain were seen after
vaccination with OMV in which both Hsf and ThpA were upregulated.
By comparison, bactericidal GMTs measured on mice vaccinated with
Hsf or TbpA upregulated OMVs were similar to those obtained with
mice vaccinated with control OMVs.
[0284] The benefit of double up-regulation was also clearly
observed in the percentage of mice producing a significant level of
bactericidal antibodies (titres greater than 1/100), particularly
in experiments using the heterologous strain.
EXAMPLE 18
Effect of Mixing Anti-Hsf and Anti-TpbA Sera on Bactericidal
Activity
[0285] Groups of 20 mice were immunised three times with OMV by the
intra-muscular route on days 0, 21 and 28. Each inoculation was
made up of 5 .mu.g (protein content) of OMVs formulated on AIP04
with MPL. The OMVs were derived from N. meningitidis strain H44/76,
engineered so that capsular polysaccharides and PorA were down
regulated. One group of mice was immunised with control OMVs in
which there was no up-regulation of proteins. In a second group,
Hsf expression was up-regulated, in a third group TbpA expression
was up-regulated and in a fourth group, the expression of both Hsf
and ThpA was up-regulated.
[0286] The sera were pooled, either using sera from mice in the
same group or by mixing sera isolated from the group in with Hsf
alone or ThpA alone had been up-regulated. Serum bactericidal
activity was measured for each of the pooled sera and the results
are shown in the table below. TABLE-US-00006 SBA done on pooled
sera SBA from mice immunized with titer TbpA-Hsf blebs 774 TbpA
blebs 200 Hsf blebs 50 CPS(-) PorA(-) blebs 50 Mix anti-TbpA +
anti-Hsf sera 1162
[0287] The results in the above table show that mixing of anti-Hsf
and anti-ThpA antisera resulted in a much higher serum bactericidal
activity than was achieved by either antisera individually. The
synergistic effect seems to be achieved by the presence of
antibodies against both Hsf and ThpA.
EXAMPLE 19
Truncated Hsf Proteins may Combine Synergistically with TbpA
[0288] A series of truncated Hsf constructs were made using
standard molecular biology procedures. These include a construct
that encodes amino acids 1 to 54 which contains the signal sequence
of Hsf and amino acids 134 to 592 of Hsf (Tr1Hsf). A second
truncated Hsf contained amino acids 1-53 of the signal sequence of
Hsf followed by amino acids 238-592 of Hsf (Tr2Hsf). These two
truncated Hsf constructs and full length Hsf were introduced into
N. Meningitidis B strain MC58 siad-, Opc-, PorA- so that their
expression would be up-regulated and outer membrane vesicles were
produced using the methods described above.
[0289] The outer membrane vesicle preparations were adsorbed onto
Al(OH).sub.3 and injected into mice on days 0, 21 and 28. On day
42, the mice were bled and sera prepared. The sera were mixed with
sera from mice vaccinated with up-regulated TbpA OMVs and serum
bactericidal assays were performed as described above.
[0290] Results TABLE-US-00007 Serum Bactericidal titres Group
H44/76 CU385 MC58 PorA+ siaD+ 25600 25600 MC58 PorA- siaD- Hsf 1530
800 MC58 PorA- siaD- Tr1Hsf 1015 1360 MC58 PorA- siaD- Tr2Hsf 50 50
Negative control 50 50 TbpA + MC58 PorA+ siaD+ 25600 24182 TbpA +
MC58 PorA- siaD- Hsf 2595 1438 TbpA + MC58 PorA- siaD- Tr1Hsf 4383
2891 TbpA + MC58 PorA- siaD- Tr2Hsf 1568 742 TbpA + Negative
control 778 532
[0291] The results shown in the above table reveal that the first
truncation (Tr1Hsf) elicits an immune response which is capable of
combining with antisera against ThpA to produce a larger serum
bactericidal activity than when full length Hsf is used. However,
the extent of the truncation is important and the truncation
produced in Tr2 has a deleterious effect compared to the full
length Hsf. The enhanced bactericidal activity of Tr1Hsf was seen
against both the strains used.
EXAMPLE 20
Serum Bactericidal Activity of Antibodies Against ThpA, Hsf and a
Third Meningococcal Protein
[0292] N. meningitidis strain H66/76 in which PorA and capsular
polysaccharides were down regulated as described above, was used as
the background strain for up-regulating TbpA and Hsf, LbpB, D15,
PilQ or NspA using the procedure described above. Outer membrane
vesicles were prepared from each strain as described above.
Recombinant FHAb, FrpC, FrpA/C and Hap were made using techniques
hereinbefore described and known in the art (as described in
PCT/EP99/02766, WO92/01460 and WO98/02547).
[0293] The outer membrane vesicle preparations and recombinant
proteins were adsorbed onto Al(OH).sub.3 and injected into mice on
days 0, 21 and 28. On day 42, the mice were bled and sera prepared.
The sera against ThpA and Hsf up-regulated OMVs were mixed with
sera from mice vaccinated with OMVs containing up-regulated LbpB,
D15, PiIQ or NspA OMVs or recombinant FHAb, FrpC, FrpA/C or Hap and
serum bactericidal assays were performed as described above.
Results
[0294] Results are shown in the table below. In assays using the
homologous H44/76 stain, the addition of antibodies against a third
meningococcal antigen, with the exception of FrpC, did not produce
a serum bactericidal titre higher than that produced using
antibodies against ThpA and Hsf alone.
[0295] However, the addition of antibodies against a third antigen
was advantageous in serum bactericidal assays using a heterologous
strain. Antibodies against D15 (OMP85), Hap, FrpA/C and LbpB were
particularly effective at increasing the serum bactericidal titre
against the CU385 strain. TABLE-US-00008 Serum Bactericidal Titre
Antisera Mix H44/76 CU385 anti-TbpA-Hsf and nonimmune sera 5378
2141 anti-TbpA-Hsf and anti-FHA 5260 2563 anti-TbpA-Hsf and
anti-Hap 4577 5150 anti-TbpA-Hsf and anti-FrpA/C 5034 4358
anti-TbpA-Hsf and anti-LbpB 5400 4834 anti-TbpA-Hsf and anti-D15
4823 4657 anti-TbpA-Hsf and anti-PilQ 4708 2242 anti-TbpA-Hsf and
anti-NspA 4738 2518 anti-TbpA-Hsf and anti-FrpC 6082 2300
EXAMPLE 21
Effect of FrpB KO in Outer Membrane Vesicles on Their Ability to
Elicit a Bactericidal Immune Response in Homologous and
Heterologous Strains
[0296] Two strains of H44/76 N. meningitidis were used to prepare
outer membrane vesicle preparations as described in WO01/09350,
using a 0.1% DOC extraction so that the LOS content was around 20%.
Strain B1733 is siaD(-), PorA(-), has upregulation of Tr1 Hsf
(example 19) and lgtB is knocked out. Strain B1820 B1733 is
siaD(-), PorA(-), has upregulation of Tr1 Hsf, lgtB is knocked out
and FrpB is also knocked out. Both strains were cultured in media
supplemented with 60 .mu.M Desferal so that iron regulated proteins
such as LbpA/B and ThpA/B are upregulated.
[0297] The bleb preparations were adsorbed onto Al(OH).sub.3 and 5
.mu.g were injected intramuscularly into groups of 30 mice on day 0
and day 21. Blood samples were taken on day 28.
[0298] Serum bactericidal assays were carried out on three L3
strains (the homologous wild type strain H44/76 and two
heterologous L3 strains; NZ124 and M97250687), as described in
example 17.
[0299] Results TABLE-US-00009 Blebs used for H44/76 M97250687 NZ124
inoculation GMT SC GMT SC GMT SC B1733 1518 30/30 151 11/30 70 4/29
B1820 781 19/30 1316 24/30 276 19/30
[0300] GMT indicates the geometric mean titre of the sera in the
SBA.
[0301] SC indicates the number of mice seroconverting (SBA titre
> 1/100).
[0302] The results clearly show that FrpB KO (B1820) blebs induce a
better heterologous cross-bactericidal response than FrpB(+) blebs
(B1733). The SBA titres were higher and a higher proportion of mice
seroconverted in strains M97250687 and NZ124. The results in the
homologous strain was not quite as good when FrpB was deleted.
These data suggest that FrpB drives the immune response, but since
this outer membrane protein is highly variable, antibodies against
this protein are only able to induce killing of the homologous
strain.
Sequence CWU 1
1
24 1 9 PRT Neisseria meningitidis VARIANT (1)...(9) Xaa = Any Amino
Acid 1 Leu Xaa Gly Gly Xaa Gly Asn Asp Xaa 1 5 2 9 PRT Neisseria
meningitidis VARIANT (1)...(9) Xaa = Any Amino Acid 2 Leu Xaa Gly
Gly Xaa Gly Asp Asp Xaa 1 5 3 10 PRT Neisseria meningitidis 3 Lys
Thr Lys Cys Lys Phe Leu Lys Lys Cys 1 5 10 4 31 DNA Artificial
Sequence primer 4 ggaattccat atgatgaaca aaatataccg c 31 5 31 DNA
Artificial Sequence primer 5 gtagctagct agcttaccac tgataaccga c 31
6 36 DNA Artificial Sequence primer 6 aactgcagaa ttaatatgaa
aggagaagaa cttttc 36 7 33 DNA Artificial Sequence primer 7
gacatactag tttatttgta gagctcatcc atg 33 8 30 DNA Artificial
Sequence primer 8 tccccgcggg ccgtctgaat acatcccgtc 30 9 51 DNA
Artificial Sequence primer 9 catatgggct tccttttgta aatttgaggg
caaacacccg atacgtcttc a 51 10 48 DNA Artificial Sequence primer 10
agacgtatcg ggtgtttgcc ctcaaattta caaaaggaag cccatatg 48 11 33 DNA
Artificial Sequence primer 11 gggtattccg ggcccttcag acggcgcagc agg
33 12 45 DNA Artificial Sequence primer 12 ggcctagcta gccgtctgaa
gcgattagag tttcaaaatt tattc 45 13 42 DNA Artificial Sequence primer
13 ggccaagctt cagacggcgt tcgaccgagt ttgagccttt gc 42 14 39 DNA
Artificial Sequence primer 14 tcccccggga agatctggac gaaaaatctc
aagaaaccg 39 15 64 DNA Artificial Sequence primer 15 ggaagatctc
cgctcgagca aatttacaaa aggaagccga tatgcaacag caacatttgt 60 tccg 64
16 36 DNA Artificial Sequence primer 16 ggaagatctc cgctcgagac
atcgggcaaa cacccg 36 17 38 DNA Artificial Sequence primer 17
tcccccggga gatctcacta gtattaccct gttatccc 38 18 41 DNA Artificial
Sequence primer 18 ctcgagacca tgggcaaata tcatgtctac gaccccctcg c 41
19 43 DNA Artificial Sequence primer 19 gtgcatagtg tcagagtttt
tgtcgacgtc gtaattatag acc 43 20 39 DNA Artificial Sequence primer
20 aatggaatac atatgaataa aggtttacat cgcattatc 39 21 31 DNA
Artificial Sequence primer 21 ccaactagtg tttttcgcta cttggagctg t 31
22 44 DNA Artificial Sequence primer 22 aatggaatac atatgaataa
aggtttacat cgcattatct ttag 44 23 45 DNA Artificial Sequence primer
23 ggggccactc gaggtttttc gctacttgga gctgtttcag atagg 45 24 4217 DNA
Neisseria meningitidis 24 atgaataaag gtttacatcg cattatcttt
agtaaaaagc acagcaccat ggttgcagta 60 gccgaaactg ccaacagcca
gggcaaaggt aaacaggcag gcagttcggt ttctgtttca 120 ctgaaaactt
caggcgacct ttgcggcaaa ctcaaaacca cccttaaaac tttggtctgc 180
tctttggttt ccctgagtat ggtattgcct gcccatgccc aaattaccac cgacaaatca
240 gcacctaaaa accagcaggt cgttatcctt aaaaccaaca ctggtgcccc
cttggtgaat 300 atccaaactc cgaatggacg cggattgagc cacaaccgct
atacgcagtt tgatgttgac 360 aacaaagggg cagtgttaaa caacgaccgt
aacaataatc cgtttgtggt caaaggcagt 420 gcgcaattga ttttgaacga
ggtacgcggt acggctagca aactcaacgg catcgttacc 480 gtaggcggtc
aaaaggccga cgtgattatt gccaacccca acggcattac cgttaatggc 540
ggcggcttta aaaatgtcgg tcggggcatc ttaactaccg gtgcgcccca aatcggcaaa
600 gacggtgcac tgacaggatt tgatgtgcgt caaggcacat tgaccgtagg
agcagcaggt 660 tggaatgata aaggcggagc cgactacacc ggggtacttg
ctcgtgcagt tgctttgcag 720 gggaaattac agggtaaaaa cctggcggtt
tctaccggtc ctcagaaagt agattacgcc 780 agcggcgaaa tcagtgcagg
tacggcagcg ggtacgaaac cgactattgc ccttgatact 840 gccgcactgg
gcggtatgta cgccgacagc atcacactga ttgccaatga aaaaggcgta 900
ggcgtcaaaa atgccggcac actcgaagcg gccaagcaat tgattgtgac ttcgtcaggc
960 cgcattgaaa acagcggccg catcgccacc actgccgacg gcaccgaagc
ttcaccgact 1020 tatctctcca tcgaaaccac cgaaaaagga gcggcaggca
catttatctc caatggtggt 1080 cggatcgaga gcaaaggctt attggttatt
gagacgggag aagatatcag cttgcgtaac 1140 ggagccgtgg tgcagaataa
cggcagtcgc ccagctacca cggtattaaa tgctggtcat 1200 aatttggtga
ttgagagcaa aactaatgtg aacaatgcca aaggcccggc tactctgtcg 1260
gccgacggcc gtaccgtcat caaggaggcc agtattcaga ctggcactac cgtatacagt
1320 tccagcaaag gcaacgccga attaggcaat aacacacgca ttaccggggc
agatgttacc 1380 gtattatcca acggcaccat cagcagttcc gccgtaatag
atgccaaaga caccgcacac 1440 atcgaagcag gcaaaccgct ttctttggaa
gcttcaacag ttacctccga tatccgctta 1500 aacggaggca gtatcaaggg
cggcaagcag cttgctttac tggcagacga taacattact 1560 gccaaaacta
ccaatctgaa tactcccggc aatctgtatg ttcatacagg taaagatctg 1620
aatttgaatg ttgataaaga tttgtctgcc gccagcatcc atttgaaatc ggataacgct
1680 gcccatatta ccggcaccag taaaaccctc actgcctcaa aagacatggg
tgtggaggca 1740 ggctcgctga atgttaccaa taccaatctg cgtaccaact
cgggtaatct gcacattcag 1800 gcagccaaag gcaatattca gcttcgcaat
accaagctga acgcagccaa ggctctcgaa 1860 accaccgcat tgcagggcaa
tatcgtttca gacggccttc atgctgtttc tgcagacggt 1920 catgtatcct
tattggccaa cggtaatgcc gactttaccg gtcacaatac cctgacagcc 1980
aaggccgatg tcaatgcagg atcggttggt aaaggccgtc tgaaagcaga caataccaat
2040 atcacttcat cttcaggaga tattacgttg gttgccggca acggtattca
gcttggtgac 2100 ggaaaacaac gcaattcaat caacggaaaa cacatcagca
tcaaaaacaa cggtggtaat 2160 gccgacttaa aaaaccttaa cgtccatgcc
aaaagcgggg cattgaacat tcattccgac 2220 cgggcattga gcatagaaaa
taccaagctg gagtctaccc ataatacgca tcttaatgca 2280 caacacgagc
gggtaacgct caaccaagta gatgcctacg cacaccgtca tctaagcatt 2340
accggcagcc agatttggca aaacgacaaa ctgccttctg ccaacaagct ggtggctaac
2400 ggtgtattgg cactcaatgc gcgctattcc caaattgccg acaacaccac
gctgagagcg 2460 ggtgcaatca accttactgc cggtaccgcc ctagtcaagc
gcggcaacat caattggagt 2520 accgtttcga ccaaaacttt ggaagataat
gccgaattaa aaccattggc cggacggctg 2580 aatattgaag caggtagcgg
cacattaacc atcgaacctg ccaaccgcat cagtgcgcat 2640 accgacctga
gcatcaaaac aggcggaaaa ttgctgttgt ctgcaaaagg aggaaatgca 2700
ggtgcgccta gtgctcaagt ttcctcattg gaagcaaaag gcaatatccg tctggttaca
2760 ggagaaacag atttaagagg ttctaaaatt acagccggta aaaacttggt
tgtcgccacc 2820 accaaaggca agttgaatat cgaagccgta aacaactcat
tcagcaatta ttttcctaca 2880 caaaaagcgg ctgaactcaa ccaaaaatcc
aaagaattgg aacagcagat tgcgcagttg 2940 aaaaaaagct cgcctaaaag
caagctgatt ccaaccctgc aagaagaacg cgaccgtctc 3000 gctttctata
ttcaagccat caacaaggaa gttaaaggta aaaaacccaa aggcaaagaa 3060
tacctgcaag ccaagctttc tgcacaaaat attgacttga tttccgcaca aggcatcgaa
3120 atcagcggtt ccgatattac cgcttccaaa aaactgaacc ttcacgccgc
aggcgtattg 3180 ccaaaggcag cagattcaga ggcggctgct attctgattg
acggcataac cgaccaatat 3240 gaaattggca agcccaccta caagagtcac
tacgacaaag ctgctctgaa caagccttca 3300 cgtttgaccg gacgtacagg
ggtaagtatt catgcagctg cggcactcga tgatgcacgt 3360 attattatcg
gtgcatccga aatcaaagct ccctcaggca gcatagacat caaagcccat 3420
agtgatattg tactggaggc tggacaaaac gatgcctata ccttcttaaa aaccaaaggt
3480 aaaagcggca aaatcatcag aaaaaccaag tttaccagca cccgcgacca
cctgattatg 3540 ccagcccccg tcgagctgac cgccaacggc ataacgcttc
aggcaggcgg caacatcgaa 3600 gctaatacca cccgcttcaa tgcccctgca
ggtaaagtta ccctggttgc gggtgaagag 3660 ctgcaactgc tggcagaaga
aggcatccac aagcacgagt tggatgtcca aaaaagccgc 3720 cgctttatcg
gcatcaaggt aggcaagagc aattacagta aaaacgaact gaacgaaacc 3780
aaattgcctg tccgcgtcgt cgcccaaact gcagccaccc gttcaggctg ggataccgtg
3840 ctcgaaggta ccgaattcaa aaccacgctg gccggtgcgg acattcaggc
aggtgtaggc 3900 gaaaaagccc gtgccgatgc gaaaattatc ctcaaaggca
ttgtgaaccg tatccagtcg 3960 gaagaaaaat tagaaaccaa ctcaaccgta
tggcagaaac aggccggacg cggcagcact 4020 atcgaaacgc tgaaactgcc
cagcttcgaa agccctactc cgcccaaact gaccgccccc 4080 ggtggctata
tcgtcgacat tccgaaaggc aatttgaaaa ccgaaatcga aaagctggcc 4140
aaacagcccg agtatgccta tctgaaacag ctccaagtag cgaaaaacac tagtggccac
4200 catcaccatc accatta 4217
* * * * *
References